U.S. patent application number 15/494515 was filed with the patent office on 2017-08-10 for small molecule trail gene induction by normal and tumor cells as an anticancer therapy and tumor cells as an anticancer therapy.
This patent application is currently assigned to The Penn State Research Foundation. The applicant listed for this patent is The Penn State Research Foundation. Invention is credited to Joshua E. ALLEN, Wafik S. EL-DEIRY, Gen Sheng WU.
Application Number | 20170224690 15/494515 |
Document ID | / |
Family ID | 47068061 |
Filed Date | 2017-08-10 |
United States Patent
Application |
20170224690 |
Kind Code |
A1 |
ALLEN; Joshua E. ; et
al. |
August 10, 2017 |
SMALL MOLECULE TRAIL GENE INDUCTION BY NORMAL AND TUMOR CELLS AS AN
ANTICANCER THERAPY AND TUMOR CELLS AS AN ANTICANCER THERAPY
Abstract
Methods and compositions relating to TIC10 are described
according to aspects of the present invention. The compositions and
methods have utility in treating disease, particularly cancer in a
subject in need thereof, including a human subject as well as
subjects of other species. The compositions have utility in
treating brain cancer in a subject in need thereof.
Inventors: |
ALLEN; Joshua E.;
(Cambridge, MA) ; WU; Gen Sheng; (Troy, MI)
; EL-DEIRY; Wafik S.; (Bryn Mawr, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Penn State Research Foundation |
University Park |
PA |
US |
|
|
Assignee: |
The Penn State Research
Foundation
University Park
PA
|
Family ID: |
47068061 |
Appl. No.: |
15/494515 |
Filed: |
April 23, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15269114 |
Sep 19, 2016 |
9629842 |
|
|
15494515 |
|
|
|
|
14733740 |
Jun 8, 2015 |
9452165 |
|
|
15269114 |
|
|
|
|
14192329 |
Feb 27, 2014 |
9061032 |
|
|
14733740 |
|
|
|
|
13459775 |
Apr 30, 2012 |
8673923 |
|
|
14192329 |
|
|
|
|
61480743 |
Apr 29, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/505 20130101;
G01N 33/6863 20130101; A61K 39/39558 20130101; A61K 31/513
20130101; A61K 45/06 20130101; A61P 43/00 20180101; C07K 2317/24
20130101; A61P 35/00 20180101; A61K 31/337 20130101; A61K 31/4545
20130101; A61K 31/4188 20130101; A61K 39/3955 20130101; A61K 31/519
20130101; G01N 2800/52 20130101; A61K 9/0019 20130101; A61K 9/0053
20130101; C07K 16/22 20130101; A61K 39/39558 20130101; A61K 2300/00
20130101; A61K 31/337 20130101; A61K 2300/00 20130101; A61K 31/519
20130101; A61K 2300/00 20130101 |
International
Class: |
A61K 31/519 20060101
A61K031/519; A61K 9/00 20060101 A61K009/00; A61K 45/06 20060101
A61K045/06; A61K 39/395 20060101 A61K039/395; C07K 16/22 20060101
C07K016/22 |
Goverment Interests
GRANT REFERENCE
[0002] This invention was made with government support under Grant
No. U54 CA105008, awarded by the National Institutes of Health. The
Government has certain rights in the invention.
Claims
1.-19. (canceled)
20. A method of treating a subject having cancer, comprising:
administering to the subject a pharmaceutical composition
comprising a pharmaceutically effective amount of: ##STR00011## or
a pharmaceutically acceptable salt, hydrate, and/or solvate
thereof.
21. The method of claim 20, wherein the subject has a
pre-neoplastic hyperproliferation, a cancer in-situ, a neoplasm or
a metastasis.
22. The method of claim 20, wherein the cancer is a metastatic
cancer.
23. The method of claim 20, wherein the cancer is a grade IV
cancer.
24. The method of claim 20, wherein the cancer is a late stage
cancer.
25. The method of claim 20, wherein the cancer harbors an oncogenic
alteration.
26. The method of claim 25, wherein the oncogenic alteration is
inactivation of a tumor suppressor.
27. The method of claim 26, wherein p53 is inactivated.
28. The method of claim 26, wherein PTEN is inactivated.
29. The method of claim 25, wherein the oncogenic alteration is
activation of an oncogene.
30. The method of claim 29, wherein EGFR, Her2, and/or KRAS is
mutated.
31. The method of claim 20, wherein the cancer is a nervous system
cancer.
32. The method of claim 31, wherein the cancer is a central nervous
system (CNS) cancer.
33. The method of claim 20, further comprising administering a
second therapeutic to the subject, wherein the second therapeutic
comprises an anti-cancer agent.
34. The method of claim 33, wherein the anti-cancer agent is a
mitotic inhibitor.
35. The method of claim 33, wherein the anti-cancer agent is
selected from the group consisting of paclitaxel, docetaxel, and a
combination thereof.
36. The method of claim 20, further comprising administering a
second therapeutic to the subject, wherein the second therapeutic
comprises an anti-angiogenic agent.
37. The method of claim 36, wherein the anti-angiogenic agent is
bevacizumab.
38. The method of claim 20, wherein the pharmaceutical composition
is administered orally.
39. The method of claim 20, wherein the pharmaceutical composition
is administered via a route of administration selected from the
group consisting of rectal, nasal, pulmonary, epidural, ocular,
otic, intraarterial, intracardiac, intracerebroventricular,
intradermal, intravenous, intramuscular, intraperitoneal,
intraosseous, intrathecal, intravesical, subcutaneous, topical,
transdermal, transmucosal, sublingual, buccal, vaginal, and
inhalational routes of administration.
40. The method of claim 20, wherein the pharmaceutical composition
further comprises a pharmaceutically acceptable carrier.
41. The method of claim 20, wherein the pharmaceutical composition
is a solid dosage form.
42. The method of claim 20, wherein the pharmaceutical composition
is a liquid dosage form.
43. The method of claim 42, wherein the liquid dosage form is an
injectable liquid.
Description
REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/269,114, filed Sep. 19 2016, now allowed,
which is a continuation of U.S. patent application Ser. No.
14/733,740, filed 8 Jun. 2015, now issued as U.S. Pat. No.
9,452,165, which is a continuation of U.S. patent application Ser.
No. 14/192,329, filed 27 Feb. 2014, now issued as U.S. Pat. No.
9,061,032, which is a divisional of U.S. patent application Ser.
No. 13/459,775, filed 30 Apr. 2012, now issued as U.S. Pat. No.
8,673,923, which in turn claims priority to, and the benefit of,
U.S. Provisional Patent Application No. 61/480,743, filed 29 Apr.
2011, the entire contents of which are incorporated herein by
reference.
FIELD OF THE INVENTION
[0003] The present invention relates generally to methods and
compositions for treating proliferative disease, such as cancer, in
a subject in need thereof.
BACKGROUND OF THE INVENTION
[0004] TNF-related apoptosis-inducing ligand (TRAIL; Apo2L) is an
endogenous protein that selectively induces apoptosis in cancer
cells.
[0005] TRAIL is a powerful inducer of apoptosis in a wide range of
human cancer cell lines via pro-apoptotic death receptor 4 (DR4;
TRAIL-R1) and death receptor 5 (DR5; TRAIL-R2) at the cell surface
through engagement of the extrinsic or intrinsic apoptotic
pathways. TRAIL plays a direct role in tumor suppression during
immune surveillance but this anti-tumor mechanism is lost during
the disease progression. The ability of TRAIL to initiate apoptosis
selectively in cancer cells has led to ongoing clinical trials with
administration of recombinant TRAIL and the longer-lived
TRAIL-agonist antibodies targeting either of its two pro-apoptotic
death receptors.
[0006] Despite its potency, recombinant TRAIL has efficacy-limiting
properties such as short serum half-life, stability, cost, and
delivery. Delivery of recombinant TRAIL or TRAIL-agonist antibodies
to the brain is limited by inability of recombinant TRAIL and
TRAIL-agonist antibodies to cross the blood-brain barrier.
[0007] There is a continuing need for anti-cancer compositions and
methods.
SUMMARY OF THE INVENTION
[0008] Pharmaceutical compositions including
##STR00001##
also called TIC10 herein, a pharmaceutically acceptable derivative,
salt, ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier, are provided according to
aspects of the present invention. The compositions have utility in
treating disease in a subject in need thereof, including a human
subject as well as subjects of other species. The compositions have
utility in treating cancer in a subject in need thereof, including
a human subject as well as subjects of other species.
[0009] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and a second therapeutic agent.
[0010] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and a second anti-cancer agent, wherein TIC10,
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof is the first anti-cancer
agent.
[0011] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and a mitotic inhibitor.
[0012] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and paclitaxel, docetaxel or a combination
thereof.
[0013] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and an anti-angiogenic agent.
[0014] According to aspects of the present invention,
pharmaceutical compositions are provided which include TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; a pharmaceutically
acceptable carrier; and bevacizumab.
[0015] According to aspects of the present invention,
pharmaceutical compositions formulated for oral administration are
provided which include TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof; and a pharmaceutically acceptable carrier.
[0016] Methods of treatment of a subject in need thereof are
provided according to aspects of the present invention which
include administering a pharmaceutically effective amount of TIC10,
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier.
[0017] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier.
[0018] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10; and a pharmaceutically acceptable carrier.
[0019] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of a pharmaceutically acceptable derivative of TIC10; and a
pharmaceutically acceptable carrier.
[0020] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable salt, ester, amide,
hydrate and/or solvate thereof; and a pharmaceutically acceptable
carrier.
[0021] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10 or a pharmaceutically acceptable salt, hydrate or
solvate thereof; and a pharmaceutically acceptable carrier.
[0022] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier; and further including assaying
TNF-related apoptosis-inducing ligand in a sample obtained from the
subject to assess the effect of the treatment.
[0023] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier; and further including assaying
TNF-related apoptosis-inducing ligand in a blood, serum, plasma or
cerebrospinal fluid sample obtained from the subject to assess the
effect of the treatment.
[0024] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier; and further including
administering a therapeutically effective amount of a second
anti-cancer agent, wherein TIC10, the pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof is the first anti-cancer agent.
[0025] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier; and further including
administering a therapeutically effective amount of an anti-mitotic
agent.
[0026] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier; and further including
administering a therapeutically effective amount of paclitaxel,
docetaxel, bevacizumab or any two or more thereof.
[0027] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include oral administration a pharmaceutically
effective amount of TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof; and a pharmaceutically acceptable carrier.
[0028] Methods of treatment of a subject having, or at risk of
having, cancer are provided according to aspects of the present
invention which include administering a pharmaceutically effective
amount of TIC10, a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof; and a
pharmaceutically acceptable carrier, wherein the administering is
by a route selected from the group consisting of: rectal, nasal,
pulmonary, epidural, ocular, otic, intraarterial, intracardiac,
intracerebroventricular, intradermal, intravenous, intramuscular,
intraperitoneal, intraosseous, intrathecal, intravesical,
subcutaneous, topical, transdermal, transmucosal, sublingual,
buccal, vaginal, and inhalational routes of administration.
[0029] Methods of treatment of a subject having, or at risk of
having, brain cancer are provided according to aspects of the
present invention which include administering a pharmaceutically
effective amount of TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof; and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 is a graph showing activity of luciferase reporter in
HCT116 Bax.sup.-/- cells under transcriptional control of the first
504 base pairs of the human TRAIL gene promoter upstream of the
start of transcription;
[0031] FIG. 2 is a graph showing RT-qPCR analysis of TRAIL mRNA
levels in HCT116 p53.sup.-/- cells;
[0032] FIG. 3 is a graph showing surface TRAIL levels induced by
TIC10 in a panel of cancer cells;
[0033] FIG. 4 is a graph showing surface TRAIL levels in HCT116
p53.sup.-/- cells following TIC10 treatment at indicated conditions
and time points;
[0034] FIG. 5 is a graph showing HCT116 p53.sup.-/- TRAIL surface
levels by flow cytometry at 72 hr following TIC10 treatment
initiation;
[0035] FIG. 6 shows cell cycle profiles of HCT116 p53.sup.-/- and
human foreskin fibroblast (HFF) cells treated with TIC10;
[0036] FIG. 7 is a graph showing quantification of colony formation
assays of cancer cells treated with TIC10;
[0037] FIG. 8 is a graph showing parallel experiments as in FIG. 7
but with HFF cells that were enumerated at endpoint;
[0038] FIG. 9 is a graph showing sub-G1 analysis of HCT116 WT,
p53.sup.-/-, and Bax.sup.-/- cells following treatment with DMSO,
TIC10 or rhTRAIL (25 ng/mL);
[0039] FIG. 10 is an image showing Western blot analysis
results;
[0040] FIG. 11 is a graph showing sub-G1 analysis of TIC10-treated
cancer cells pre-incubated with or without zVAD-fmk;
[0041] FIG. 12 is a graph showing sub-G1 analysis of MDA-MB-231
cells with stable knockdown of TRAIL by short hairpin RNA;
[0042] FIG. 13 is a graph showing verification of MDA-MB-231
shTRAIL knockdown by flow cytometry analysis of TIC10-treated
cells;
[0043] FIG. 14 is a graph showing sub-G1 analysis of TIC10-induced
cell death in H460 cells with endogenous DR5 or overexpression of a
DR5 construct with its death domain replaced by EGFP;
[0044] FIG. 15 is a graph showing sub-G1 analysis of HCT116 cells
treated with DMSO, TIC10, or rhTRAIL in the presence or absence of
a TRAIL-sequestering antibody, RIK-2;
[0045] FIG. 16 is a graph showing TIC10-induced surface TRAIL with
freshly resected human colon cancer cells;
[0046] FIG. 17 is a graph showing results of a cell viability assay
of primary colon cancer cells from FIG. 16 treated with DMSO, TIC10
or 5-FU;
[0047] FIG. 18 is a graph showing ability of TIC10 or rhTRAIL to
reduce cell viability in HCT116 cells following a 1 hr
pre-incubation at the indicated temperatures;
[0048] FIG. 19 is a graph showing HCT116 p53.sup.-/- xenograft
treated with TIC10, TRAIL, or vehicle;
[0049] FIG. 20 is a graph showing results of bioluminescent imaging
of luciferase-infected HCT116 p53.sup.-/- xenografts treated with
TIC10 or vehicle;
[0050] FIG. 21 is a graph showing RKO xenograft treated with TIC10,
TRAIL or vehicle;
[0051] FIG. 22 is a box and whisker plot of tumor volume on day 9
following treatment initiation in MDA-MB-231 vector or shTRAIL
xenografts with TIC10, TRAIL or vehicle;
[0052] FIG. 23 is a graph showing relative tumor volume of DLD-1
xenografts treated with TRAIL, TIC10 or DMSO;
[0053] FIG. 24 is a graph showing comparison of i.p. versus oral
administration of TIC10 in SW480 xenografts;
[0054] FIG. 25 is a graph showing TIC10 or vehicle administered as
a single oral dose in the HCT116 xenograft;
[0055] FIG. 26 is a graph showing body weight of athymic, female
nude mice treated with a single dose of TIC10;
[0056] FIG. 27 is a graph showing body weight of C57/B6 female mice
at the end of week 4 of treatment with oral TIC10;
[0057] FIG. 28 is a graph showing overall survival of E.mu.-myc
treated during weeks 9-12 with weekly oral TIC10;
[0058] FIG. 29 is a graph showing cell viability of DLD-1 cells
treated with TIC10 in combination with paclitaxel;
[0059] FIG. 30 is a graph showing cell viability of SW620 cells
treated with TIC10 in combination with paclitaxel;
[0060] FIG. 31 is a graph showing cell viability of DLD-1 cells
treated with
[0061] TIC10 in combination with taxotere;
[0062] FIG. 32 is a graph showing cell viability of SW620 cells
treated with TIC10 in combination with taxotere;
[0063] FIG. 33 is a graph showing percent of cohorts in H460
xenograft that retain tumor burden following treatment with TIC10
or taxotere alone, in combination, or with vehicle;
[0064] FIG. 34 is a graph showing a relative tumor volume plot for
FIG. 33;
[0065] FIG. 35 is a graph showing percent of cohorts in H460
xenograft that retain tumor burden following treatment with TIC10
or paclitaxel alone, in combination, or with vehicle;
[0066] FIG. 36 is a graph showing a relative tumor volume plot for
FIG. 35;
[0067] FIG. 37 is a graph showing percent of cohorts with implanted
with intracecal HCT116 p53.sup.-/- tumors with evident tumors at
the primary and distal sites at endpoint, treated with TIC10,
bevacizumab or a combination of TIC10 and bevacizumab;
[0068] FIG. 38 is a graph showing body weight of mice implanted
with intracecal HCT116 p53.sup.-/- tumors treated with vehicle,
TIC10, bevacizumab or a combination of TIC10 and bevacizumab;
[0069] FIG. 39 is a graph showing TRAIL serum levels in tumor-free
mice following TIC10 or doxorubicin;
[0070] FIG. 40 is a graph showing the absorbance profile of TIC10
with a peak absorbance at 239 nm;
[0071] FIG. 41 is a graph showing a calibration curve for TIC10
spiked into mouse plasma and quantitated by HPLC analysis using
area under curve (AUC);
[0072] FIG. 42 is a graph showing plasma concentrations of TIC10
following intravenous administration in C57/B6 female mice;
[0073] FIG. 43 is a graph showing surface TRAIL analysis of HFF
cells following TIC10 treatment, 0, 2.5, 5, or 10 .mu.M from left
to right;
[0074] FIG. 44 is a graph showing sub-G1 analysis of a co-culture
of HCT116 p53.sup.-/- cells and pretreated HFFs;
[0075] FIG. 45 is a graph showing surface TRAIL in GBM cell lines
following incubation with TIC10;
[0076] FIG. 46 is a graph showing GI50 values extrapolated from
cell viability assays of indicated GBM cell lines at 72 hr
post-treatment with TIC10 or DMSO;
[0077] FIG. 47 shows results of a cell viability assay of freshly
resected human glioblastoma tissue treated with DMSO, TIC10, or
temozolomide;
[0078] FIG. 48 is a graph showing subcutaneous xenograft of T98G
with mice receiving a single dose of vehicle, TIC10 or
bevacizumab;
[0079] FIG. 49 is a graph showing overall survival of mice
harboring SF767 intracranial tumors treated with a single oral dose
of vehicle, TIC10, bevacizumab, or TIC10 and bevacizumab;
[0080] FIG. 50 is a graph showing transcriptional changes
associated with FOXO signaling from gene expression profiling of
HCT116 p53.sup.-/- cells at 48 hr post-TIC10 treatment versus
DMSO;
[0081] FIG. 51 is an image of Western blot analysis of DR5 in
HCT116 cells treated with TIC10 or DMSO;
[0082] FIG. 52 is a graph showing flow cytometry analysis of
surface DR5 levels in cancer and normal cells treated with
TIC10;
[0083] FIG. 53 is an image of Western blot analysis of whole cell
lysates (W) and cytoplasmic (C) and nuclear (N) extracts from
HCT116 cells treated with DMSO or TIC10;
[0084] FIG. 54 is an image of results of a chromatin
immunoprecipitation assay for TIC10-induced translocation of Foxo3a
to the TRAIL promoter at 48 hr post-TIC10 treatment in HCT116
p53.sup.-/- cells, 0, 2.5, 5, or 10 .mu.M from left to right;
[0085] FIG. 55 is a graph showing results of flow cytometry
analysis of cell surface TRAIL levels induced by TIC10 with or
without transient knockdown of Foxo1 and/or Foxo3a in HCT116
p53.sup.-/- cells using siRNA;
[0086] FIG. 56 is a graph showing sub-G1 analysis of TIC10-induced
cell death with or without stable knockdown of Foxo3a in HCT116
cells;
[0087] FIG. 57 is a graph showing flow cytometry analysis of
TIC10-induced surface TRAIL with or without stable knockdown of
Foxo3a in HCT116 cells;
[0088] FIG. 58 is a graph showing tumor volume of HCT116 xenograft
with or without stable knockdown of Foxo3a following a single oral
dose of vehicle or TIC10;
[0089] FIG. 59 is an image of Western blot analysis of HCT116
p53.sup.-/- cells treated with TIC10, 2.5, 5, 10 .mu.M for 72
hr;
[0090] FIG. 60 is an image of Western blot analysis of HCT116
p53.sup.-/- cells treated with TIC10;
[0091] FIG. 61 is a graph showing time course of protein expression
levels of TIC10-induced effects determined by densitometry of
Western blots from replicate experiments as in FIG. 60;
[0092] FIG. 62 is an image of Western blot analysis of
TIC10-induced effects on Foxo3a in DLD1 human colon cancer cells,
MDA-MB-468 human breast cancer cells, and T98G human glioblastoma
multiforme cell lines;
[0093] FIG. 63 is an image of Western blot analysis showing
overexpression of myr-Akt;
[0094] FIG. 64 is a graph showing flow cytometry analysis of
surface TRAIL in HCT116 cells overexpressing an empty vector or
myristilated Akt (myr-Akt) with TIC10 treatment;
[0095] FIG. 65 is a graph showing sub-G1 content of HCT116 cells
overexpressing an empty vector or myr-Akt with TIC10 treatment;
[0096] FIG. 66 is a graph showing RT-qPCR analysis of TRAIL mRNA in
HCT116 p53.sup.-/- cells following incubation with A6730 (Akt inh),
U0126 monoethanolate (MEK inh), or both;
[0097] FIG. 67 is a graph showing surface TRAIL induction as in
FIG. 66 with or without stable knockdown of Foxo3a;
[0098] FIG. 68 is a graph showing sub-G1 analysis of MDA-MB-231
with or without TRAIL knockdown by shRNA following incubation with
Akt inh, MEK inh, or both;
[0099] FIG. 69 is a graph showing surface TRAIL analysis of HCT116
p53.sup.-/- cells following incubation with A6730 (Akt inh), U0126
monoethanolate (MEK inh), or both;
[0100] FIG. 70 is a graph showing RT-qPCR analysis of TRAIL mRNA
levels following transient knockdown of Akt and/or ERK in HCT116
p53.sup.-/- cells;
[0101] FIG. 71 is an image showing confirmation of Akt and ERK
knockdown by Western blot analysis; and
[0102] FIG. 72 is a graph showing surface TRAIL analysis following
transient knockdown of Akt and/or ERK in HCT116 cells.
DETAILED DESCRIPTION OF THE INVENTION
[0103] Scientific and technical terms used herein are intended to
have the meanings commonly understood by those of ordinary skill in
the art. Such terms are found defined and used in context in
various standard references illustratively including J. Sambrook
and D. W. Russell, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press; 3rd Ed., 2001; F. M. Ausubel, Ed.,
Short Protocols in Molecular Biology, Current Protocols; 5th Ed.,
2002; B. Alberts et al., Molecular Biology of the Cell, 4th Ed.,
Garland, 2002; D. L. Nelson and M. M. Cox, Lehninger Principles of
Biochemistry, 4th Ed., W.H. Freeman & Company, 2004; Engelke,
D. R., RNA Interference (RNAi): Nuts and Bolts of RNAi Technology,
DNA Press LLC, Eagleville, P A, 2003; Herdewijn, P. (Ed.),
Oligonucleotide Synthesis: Methods and Applications, Methods in
Molecular Biology, Humana Press, 2004; A. Nagy, M. Gertsenstein, K.
Vintersten, R. Behringer, Manipulating the Mouse Embryo: A
Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory
Press; Dec. 15, 2002, ISBN-10: 0879695919; Kursad Turksen (Ed.),
Embryonic stem cells: methods and protocols in Methods Mol Biol.
2002; 185, Humana Press; Current Protocols in Stem Cell Biology,
ISBN: 9780470151808.
[0104] The singular terms "a," "an," and "the" are not intended to
be limiting and include plural referents unless explicitly state or
the context clearly indicates otherwise.
[0105] Methods and compositions according to aspects of the present
invention relate to TRAIL-inducing compound 10 (TIC10), identified
by the present inventors as a small molecule transcriptional
inducer of the TRAIL gene by a screen for TRAIL-inducing compounds
that upregulate the TRAIL gene by a mechanism that does not rely on
p53 since p53 is frequently inactivated in late stage cancers,
which causes resistance to many standard-of-care therapies such as
5-FU and doxorubicin.
[0106] TIC10 induces TRAIL expression in both normal and cancer
cells. The terms "induces TRAIL expression," "TIC10-induced TRAIL"
and grammatical equivalents thereof, used herein to describe an
effect of TIC10 or a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof, refers to
production of a detectable increase of TRAIL by cells contacted
with TIC10 or a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof. A detectable
increase of TRAIL can be determined by assays for TRAIL protein or
TRAIL nucleic acids using well-known protein or nucleic acid assay
methodology.
[0107] TIC10-induced TRAIL is sustained in cancer cells as well as
normal cells and serum, allowing for a TRAIL-mediated bystander
effect on cancer cells and tumors. TIC10 inactivates Akt and ERK
leading to the nuclear translocation of Foxo3a and induction of
TRAIL transcription.
[0108] TIC10-induced TRAIL is dependent on Foxo3a, which also
upregulates TRAIL death receptor DR5 among other targets, allowing
for sensitization of some TRAIL-resistant tumor cells. The
induction of TRAIL caused by TIC10 is sustained in tumor, stromal,
and host cells.
[0109] Pharmaceutical compositions including TIC10 or a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof, and methods for their use
are provided according to aspects of the present invention.
[0110] Pharmaceutical compositions including the compound of
structure (I) are provided according to aspects of the present
invention.
##STR00002##
[0111] The compound of structure (I) is also referred to herein as
TRAIL-inducing compound 10 (TIC10) and NSC350625.
[0112] The compound of structure (I) (TIC10) can be obtained
commercially or synthesized using standard chemical synthetic
methodology.
[0113] A pharmaceutical composition according to aspects of the
present invention may also be a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug of
the compound of structure (I).
[0114] Pharmaceutically acceptable derivatives, salts, esters,
amides, hydrates, solvates and/or prodrugs of the compound of
structure (I) can be obtained commercially or synthesized using
standard chemical synthetic methodology.
[0115] The term "pharmaceutically acceptable derivative" as used in
relation to of the compound of structure (I) is the compound of
structure (I) further substituted at any substitutable position
which substantially retains the described activity of the compound
of structure (I) to induce expression of TRAIL in a cell. For
example, the compound of structure (I) is optionally further
substituted at any substitutable position by one or more of the
following: F, Cl, Br, a lower alkyl group, a lower alkoxy group or
fluorinated lower alkyl group, such as CF.sub.3.
[0116] A "pharmaceutically acceptable" salt, ester, amide hydrate,
prodrug, or solvate is suitable for use in a subject without undue
toxicity or irritation to the subject and is effective for the
intended use.
[0117] Pharmaceutically acceptable salts include pharmaceutically
acceptable acid addition salts and base addition salts.
Pharmaceutically acceptable salts are well-known in the art, such
as those detailed in S. M. Berge et al., J. Pharm. Sci., 66:1-19,
1977. Exemplary pharmaceutically acceptable salts are those
suitable for use in a subject without undue toxicity or irritation
to the subject and which are effective for their intended use which
are formed with inorganic acids such as hydrochloric acid,
hydrobromic acid, hydroiodic acid, nitric acid, phosphoric acid,
sulfuric acid and sulfamic acid; organic acids such as acetic acid,
adipic acid, alginic acid, ascorbic acid, aspartic acid,
benzenesulfonic acid, benzoic acid, 2-acetoxybenzoic acid, butyric
acid, camphoric acid, camphorsulfonic acid, cinnamic acid, citric
acid, digluconic acid, ethanesulfonic acid, formic acid, fumaric
acid, glutamic acid, glycolic acid, glycerophosphoric acid,
hemisulfic acid, heptanoic acid, hexanoic acid,
2-hydroxyethanesulfonic acid (isethionic acid), lactic acid, maleic
acid, hydroxymaleic acid, malic acid, malonic acid, mandelic acid,
mesitylenesulfonic acid, methanesulfonic acid, naphthalenesulfonic
acid, nicotinic acid, 2-naphthalenesulfonic acid, oxalic acid,
pamoic acid, pectinic acid, phenylacetic acid, 3-phenylpropionic
acid, picric acid, pivalic acid, propionic acid, pyruvic acid,
pyruvic acid, salicylic acid, stearic acid, succinic acid,
sulfanilic acid, tartaric acid, p-toluenesulfonic acid,
trichloroacetic acid, trifluoroacetic acid and undecanoic acid;
inorganic bases such as ammonia, hydroxide, carbonate, and
bicarbonate of ammonium; organic bases such as primary, secondary,
tertiary and quaternary amine compounds ammonium, arginine,
betaine, choline, caffeine, diolamine, diethylamine,
diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol,
dicyclohexylamine, dicyclohexylamine, dibenzylamine, N,
N-dibenzylphenethylamine, 1-ephenamine, N,
N'-dibenzylethylenediamine, ethanolamine, ethylamine,
ethylenediamine, glucosamine, histidine, hydrabamine,
isopropylamine, 1h-imidazole, lysine, methyl amine,
N-ethylpiperidine, N-methylpiperidine, N-methylmorpholine, N,
N-dimethylaniline, piperazine, trolamine, methylglucamine, purines,
piperidine, pyridine, theobromine, tetramethylammonium compounds,
tetraethylammonium compounds, trimethylamine, triethylamine,
tripropylamine and tributylamine and metal cations such as
aluminum, calcium, copper, iron, lithium, magnesium, manganese,
potassium, sodium, and zinc.
[0118] Pharmaceutically acceptable solvates illustratively include
hydrates, ethanolates, methanolates.
[0119] Exemplary pharmaceutically acceptable amides include amides
derived from ammonia, primary C1-C6 alkyl amines and secondary
C1-C6 dialkyl amines including those in the form of a 5- or
6-member nitrogen-containing heterocycle.
[0120] A TIC10 prodrug is a form of TIC10 covalently bound to a
moiety which is released from TIC10 yielding the intact active
TIC10. Prodrug forms are well known in the art as exemplified in
Sloan, K. B., Prodrugs, M. Dekker, New York, 1992; and Testa, B.
and Mayer, J. M., Hydrolysis in drug and prodrug metabolism:
chemistry, biochemistry, and enzymology, Wiley-VCH, Zurich,
2003.
[0121] Pharmaceutical compositions are provided which include:
##STR00003##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof as a first therapeutic
agent; a pharmaceutically acceptable carrier; and a second
therapeutic agent, such as an anti-cancer agent.
[0122] Methods of treatment of a subject in need thereof are
provided according to aspects of the present invention including
administration of a pharmaceutically effective amount of:
##STR00004##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier.
[0123] Methods of treatment of a subject in need thereof are
provided including administration of a pharmaceutically effective
amount of
##STR00005##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier; effective to induce expression of TRAIL in the
subject.
[0124] TRAIL protein can be assayed in a test sample obtained from
a subject to detect TIC10-induced TRAIL expression.
[0125] Immunoassay methods can be used to assay TRAIL in a sample,
including, but not limited to, enzyme-linked immunosorbent assay
(ELISA), enzyme-linked immunofiltration assay (ELIFA), flow
cytometry, immunoblot, immunoprecipitation, immunohistochemistry,
immunocytochemistry, luminescent immunoassay (LIA), fluorescent
immunoassay (FIA), and radioimmunoassay. Assay methods may be used
to obtain qualitative and/or quantitative results. Specific details
of suitable assay methods for both qualitative and quantitative
assay of a sample are described in standard references,
illustratively including E. Harlow and D. Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988; F.
Breitling and S. Dubel, Recombinant Antibodies, John Wiley &
Sons, New York, 1999; H. Zola, Monoclonal Antibodies: Preparation
and Use of Monoclonal Antibodies and Engineered Antibody
Derivatives, Basics: From Background to Bench, BIOS Scientific
Publishers, 2000; B. K. C. Lo, Antibody Engineering: Methods and
Protocols, Methods in Molecular Biology, Humana Press, 2003; F. M.
Ausubel et al., Eds., Short Protocols in Molecular Biology, Current
Protocols, Wiley, 2002; S. Klussman, Ed., The Aptamer Handbook:
Functional Oligonucleotides and Their Applications, Wiley, 2006;
Ormerod, M. G., Flow Cytometry: a practical approach, Oxford
University Press, 2000; Givan, A. L., Flow Cytometry: first
principles, Wiley, New York, 2001; Gorczyca, W., Flow Cytometry in
Neoplastic Hematology: morphologic-immunophenotypic correlation,
Taylor & Francis, 2006; Crowther, J. R., The ELISA Guidebook
(Methods in Molecular Biology), Humana Press, 2000; Wild, D., The
Immunoassay Handbook, 3rd Edition, Elsevier Science, 2005. and J.
Sambrook and D. W. Russell, Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, 3rd Ed., 2001.
[0126] Aptamers can be used to assay a sample for TRAIL. The term
"aptamer" refers to a peptide and/or nucleic acid that
substantially specifically binds to a specified substance. In the
case of a nucleic acid aptamer, the aptamer is characterized by
binding interaction with a target other than Watson/Crick base
pairing or triple helix binding with a second and/or third nucleic
acid. Such binding interaction may include Van der Waals
interaction, hydrophobic interaction, hydrogen bonding and/or
electrostatic interactions, for example. Similarly, peptide-based
aptamers are characterized by specific binding to a target wherein
the aptamer is not a naturally occurring ligand for the target.
Techniques for identification and generation of peptide and nucleic
acid aptamers and their use are known in the art as described, for
example, in F. M. Ausubel et al., Eds., Short Protocols in
Molecular Biology, Current Protocols, Wiley, 2002; S. Klussman,
Ed., The Aptamer Handbook: Functional Oligonucleotides and Their
Applications, Wiley, 2006; and J. Sambrook and D. W. Russell,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, 3rd Ed., 2001.
[0127] Spectrometric analysis is used to assay a sample for TRAIL.
For example mass analysis can be used in an assay according to
aspects of the present invention. Mass analysis is conducted using,
for example, time-of-flight (TOF) mass spectrometry or Fourier
transform ion cyclotron resonance mass spectrometry. Mass
spectrometry techniques are known in the art and exemplary detailed
descriptions of methods for protein and/or peptide assay are found
in Li J., et al., Clin Chem., 48(8):1296-304, 2002; Hortin, G. L.,
Clinical Chemistry 52: 1223-1237, 2006; Hortin, G. L., Clinical
Chemistry 52: 1223-1237, 2006; A. L. Burlingame, et al. (Eds.),
Mass Spectrometry in Biology and Medicine, Humana Press, 2000; and
D. M. Desiderio, Mass Spectrometry of Peptides, CRC Press,
1990.
[0128] Localization of TRAIL at the surface of cells can be assayed
to detect an effect of a pharmaceutical composition of the present
invention. Detection of TRAIL localization can be performed by
immunoassay, such as flow cytometry, as well as by
immunohistochemistry.
[0129] A test sample can be any biological fluid, cell or tissue of
a subject, illustratively including blood, plasma, serum, urine,
saliva, ascites, cerebrospinal fluid, cerebroventricular fluid,
pleural fluids, pulmonary and bronchial lavage samples, mucous,
sweat, tears, semen, bladder wash samples, amniotic fluid, lymph,
peritoneal fluid, synovial fluid, bone marrow aspirate, tumor cells
or tissue, organ cells or tissue, such as biopsy material. In
preferred aspects, a test sample is blood, plasma or serum.
[0130] A test sample from a subject is optionally purified for
TRAIL or other biomarker assay. The term "purified" in the context
of a test sample refers to separation of TRAIL or another biomarker
from at least one other component present in the test sample. Test
sample purification is achieved by techniques illustratively
including electrophoretic methods such as gel electrophoresis and
2-D gel electrophoresis; chromatography methods such as HPLC, ion
exchange chromatography, affinity chromatography, size exclusion
chromatography, thin layer and paper chromatography.
[0131] Assay of TRAIL can be performed on cells and tissues. For
example, immunohistochemical methods and in situ hybridization can
be used to assay TRAIL protein and/or nucleic acid in a cell or
tissue test sample.
[0132] One or more standards can be used to allow quantitative
determination of TRAIL in a sample.
[0133] Assay of TRAIL in a test sample may be compared to assay of
TRAIL in a control sample. Control samples may be obtained from one
or more normal subjects, for example.
[0134] According to aspects of the present invention, assays for
TRAIL are used to monitor a subject. Thus, for example, a test
sample is obtained from the subject before treatment with a
pharmaceutical composition of the present invention and at one or
more times during and/or following treatment in order to assess
effectiveness of the treatment. In a further example, a test sample
is obtained from the subject at various times in order to assess
the course or progress of disease or healing.
[0135] In particular aspects, one or more additional biomarkers are
assayed in a test sample obtained from a subject to aid in
monitoring treatment with a pharmaceutical composition of the
present invention. For example, one or more of phospho-ERK,
phospho-Akt, Foxo3a localization and/or phosphorylation is assayed
in a test sample obtained from a subject to aid in monitoring
treatment with a pharmaceutical composition of the present
invention. Such additional biomarkers are assayed by immunoassay
methods such those described herein.
[0136] TRAIL nucleic acid can be assayed in a test sample obtained
from a subject to detect TIC10-induced TRAIL expression. Assays for
detecting TRAIL nucleic acids, particularly mRNA or cDNA, include,
but are not limited to, polymerase chain reactions (PCR) such as
RT-PCR, dot blot, in situ hybridization, Northern blot and RNase
protection.
[0137] Methods and compositions are provided according to the
present invention for treating cancer.
[0138] Methods of treatment of a subject having, or at risk of
having, cancer, are provided according to aspects of the present
invention including administration of a pharmaceutically effective
amount of
##STR00006##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier.
[0139] Methods of treatment of a subject having, or at risk of
having, cancer, are provided including administration of a
pharmaceutically effective amount of
##STR00007##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier; effective to induce expression of TRAIL in the
subject.
[0140] Cancers treated using methods and compositions described
herein are characterized by abnormal cell proliferation including,
but not limited to, pre-neoplastic hyperproliferation, cancer
in-situ, neoplasms and metastasis. Methods and compositions of the
present invention can be used for prophylaxis as well as
amelioration of signs and/or symptoms of cancer. The terms
"treating" and "treatment" used to refer to treatment of a cancer
in a subject include: preventing, inhibiting or ameliorating the
cancer in the subject, such as slowing progression of the cancer
and/or reducing or ameliorating a sign or symptom of the
cancer.
[0141] A pharmaceutically effective amount of a composition of the
present invention is an amount which has a beneficial effect in a
subject being treated. In subjects having cancer or at risk for
having cancer, such as a condition characterized by abnormal cell
proliferation including, but not limited to, pre-neoplastic
hyperproliferation, cancer in-situ, neoplasms, metastasis, a tumor,
a benign growth or other condition responsive to a composition of
the present invention, a pharmaceutically effective amount of a
composition of the present invention is effective to ameliorate or
prevent one or more signs and/or symptoms of the condition. For
example, a pharmaceutically effective amount of a composition of
the present invention is effective to detectably increase apoptosis
and/or decrease proliferation of cells of a cancer condition
characterized by abnormal cell proliferation including, but not
limited to, pre-neoplastic hyperproliferation, cancer in-situ,
neoplasms, metastasis, a tumor, a benign growth or other condition
responsive to a composition of the present invention.
[0142] TIC10 possesses broad-spectrum activity described herein in
primary patient samples and cell lines that are resistant to
conventional therapies, indicative that the therapeutic action of
TIC10 does not rely exclusively on commonly altered molecules in
cancer such as EGFR, Her2, KRAS, or PTEN. The elucidation of the
therapeutic cellular mechanism of TIC10 allows for the
identification of resistance mechanisms such as over-activated Akt,
described herein, and provides phospho-ERK, phospho-Akt, Foxo3a
localization and phosphorylation, and surface and serum TRAIL as
correlative biomarkers of TIC10 therapeutic activity in cancer.
[0143] Thus, according to aspects of the present invention, one or
more correlative biomarkers of TIC10 therapeutic activity in cancer
are assayed to assess treatment with a pharmaceutical composition
of the present invention.
[0144] A subject treated according to methods and using
compositions of the present invention can be mammalian or
non-mammalian. A mammalian subject can be any mammal including, but
not limited to, a human; a non-human primate; a rodent such as a
mouse, rat, or guinea pig; a domesticated pet such as a cat or dog;
a horse, cow, pig, sheep, goat, or rabbit. A non-mammalian subject
can be any non-mammal including, but not limited to, a bird such as
a duck, goose, chicken, or turkey. Subjects can be either gender
and can be any age. In aspects of methods including administration
of an inventive pharmaceutical composition to a subject, the
subject is human. The terms "subject" and "patient" are used
interchangeably herein.
[0145] A pharmaceutical composition according to the invention
generally includes about 0.1-99% of TIC10, a pharmaceutically
acceptable derivative, salt, ester, amide, hydrate, solvate and/or
prodrug thereof; and a pharmaceutically acceptable carrier.
Combinations of TIC10 and at least one pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof in a pharmaceutical composition are also considered within
the scope of the present invention. Furthermore, combinations of at
least two of: a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and prodrug thereof in a
pharmaceutical composition, are also considered within the scope of
the present invention.
[0146] Combinations of therapeutic agents are administered
according to aspects of the present invention. According to
aspects, of the present invention methods of treatment of cancer in
a subject include administration of a pharmaceutical composition of
TIC10, a pharmaceutically acceptable derivative, salt, ester,
amide, hydrate, solvate and/or prodrug thereof; and at least one
additional therapeutic agent. According to aspects, of the present
invention methods of treatment of cancer in a subject include
administration of a pharmaceutical composition of TIC10, a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and at least two
additional therapeutic agents.
[0147] The term "additional therapeutic agent" is used herein to
refer to a chemical compound, a mixture of chemical compounds, a
biological macromolecule (such as a nucleic acid, an antibody, a
protein or portion thereof, e.g., a peptide), or an extract made
from biological materials such as bacteria, plants, fungi, or
animal (particularly mammalian) cells or tissues which is a
biologically, physiologically, or pharmacologically active
substance (or substances) that acts locally or systemically in a
subject.
[0148] Additional therapeutic agents included according to aspects
of methods and compositions of the present invention include, but
are not limited to, antibiotics, antivirals, antineoplastic agents,
analgesics, antipyretics, antidepressants, antipsychotics,
anti-cancer agents, antihistamines, anti-osteoporosis agents,
anti-osteonecrosis agents, antiinflammatory agents, anxiolytics,
chemotherapeutic agents, diuretics, growth factors, hormones,
non-steroidal anti-inflammatory agents, steroids and vasoactive
agents.
[0149] Combination therapies utilizing TIC10, a pharmaceutically
acceptable derivative, salt, ester, amide, hydrate, solvate and/or
prodrug thereof and one or more additional therapeutic agents may
show synergistic effects, e.g., a greater therapeutic effect than
would be observed using a pharmaceutical composition of the present
invention including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof, or one or more additional therapeutic agents alone as a
monotherapy.
[0150] According to aspects, combination therapies include: (1)
pharmaceutical compositions that include a pharmaceutical
composition including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof of the present invention formulated together in a single
composition with one or more additional therapeutic agents; and (2)
co-administration of a pharmaceutical composition including TIC10,
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof of the present invention
with one or more additional therapeutic agents wherein the
pharmaceutical composition including TIC10, a pharmaceutically
acceptable derivative, salt, ester, amide, hydrate, solvate and/or
prodrug thereof of the present invention and the one or more
additional therapeutic agents have not been formulated in the same
composition. When using separate formulations, the pharmaceutical
composition including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof of the present invention may be administered at the same
time, intermittent times, staggered times, prior to, subsequent to,
or combinations thereof, with reference to the administration of
the one or more additional therapeutic agents.
[0151] Combination treatments can allow for reduced effective
dosage and increased therapeutic index of the pharmaceutical
composition including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof of the present invention and the one or more additional
therapeutic agents used in methods of the present invention.
[0152] According to aspects, combination therapies include: (1)
pharmaceutical compositions that include a pharmaceutical
composition including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof of the present invention formulated together in a single
composition with one or more additional anti-cancer agents; and (2)
co-administration of a pharmaceutical composition including TIC10,
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof of the present invention
with one or more additional anti-cancer agents wherein the
pharmaceutical composition including TIC10, a pharmaceutically
acceptable derivative, salt, ester, amide, hydrate, solvate and/or
prodrug thereof of the present invention and the one or more
additional therapeutic agents have not been formulated in the same
composition. When using separate formulations, the pharmaceutical
composition including TIC10, a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof of the present invention may be administered at the same
time, intermittent times, staggered times, prior to, subsequent to,
or combinations thereof, with reference to the administration of
the one or more additional anti-cancer agents.
[0153] Anti-cancer agents are described, for example, in Goodman et
al., Goodman and Gilman's The Pharmacological Basis of
Therapeutics, 8th Ed., Macmillan Publishing Co., 1990.
[0154] Anti-cancer agents illustratively include acivicin,
aclarubicin, acodazole, acronine, adozelesin, aldesleukin,
alitretinoin, allopurinol, altretamine, ambomycin, ametantrone,
amifostine, aminoglutethimide, amsacrine, anastrozole, anthramycin,
arsenic trioxide, asparaginase, asperlin, azacitidine, azetepa,
azotomycin, batimastat, benzodepa, bevacizumab, bicalutamide,
bisantrene, bisnafide dimesylate, bizelesin, bleomycin, brequinar,
bropirimine, busulfan, cactinomycin, calusterone, capecitabine,
caracemide, carbetimer, carboplatin, carmustine, carubicin,
carzelesin, cedefingol, celecoxib, chlorambucil, cirolemycin,
cisplatin, cladribine, crisnatol mesylate, cyclophosphamide,
cytarabine, dacarbazine, dactinomycin, daunorubicin, decitabine,
dexormaplatin, dezaguanine, dezaguanine mesylate, diaziquone,
docetaxel, doxorubicin, droloxifene, dromostanolone, duazomycin,
edatrexate, eflomithine, elsamitrucin, enloplatin, enpromate,
epipropidine, epirubicin, erbulozole, esorubicin, estramustine,
etanidazole, etoposide, etoprine, fadrozole, fazarabine,
fenretinide, floxuridine, fludarabine, fluorouracil, flurocitabine,
fosquidone, fostriecin, fulvestrant, gemcitabine, hydroxyurea,
idarubicin, ifosfamide, ilmofosine, interleukin II (IL-2, including
recombinant interleukin II or rIL2), interferon alfa-2a, interferon
alfa-2b, interferon alfa-nl, interferon alfa-n3, interferon
beta-Ia, interferon gamma-Ib, iproplatin, irinotecan, lanreotide,
letrozole, leuprolide, liarozole, lometrexol, lomustine,
losoxantrone, masoprocol, maytansine, mechlorethamine hydrochlride,
megestrol, melengestrol acetate, melphalan, menogaril,
mercaptopurine, methotrexate, metoprine, meturedepa, mitindomide,
mitocarcin, mitocromin, mitogillin, mitomalcin, mitomycin,
mitosper, mitotane, mitoxantrone, mycophenolic acid, nelarabine,
nocodazole, nogalamycin, ormnaplatin, oxisuran, paclitaxel,
pegaspargase, peliomycin, pentamustine, peplomycin, perfosfamide,
pipobroman, piposulfan, piroxantrone hydrochloride, plicamycin,
plomestane, porfimer, porfiromycin, prednimustine, procarbazine,
puromycin, pyrazofurin, riboprine, rogletimide, safingol,
semustine, simtrazene, sparfosate, sparsomycin, spirogermanium,
spiromustine, spiroplatin, streptonigrin, streptozocin, sulofenur,
talisomycin, tamoxifen, tecogalan, tegafur, teloxantrone,
temoporfin, teniposide, teroxirone, testolactone, thiamiprine,
thioguanine, thiotepa, tiazofurin, tirapazamine, topotecan,
toremifene, trestolone, triciribine, trimetrexate, triptorelin,
tubulozole, uracil mustard, uredepa, vapreotide, verteporfin,
vinblastine, vincristine sulfate, vindesine, vinepidine,
vinglycinate, vinleurosine, vinorelbine, vinrosidine, vinzolidine,
vorozole, zeniplatin, zinostatin, zoledronate, and zorubicin.
[0155] Synergistic effects of combination treatment with a
pharmaceutical composition including TIC10 with one or more
additional anti-cancer agents such as one or more mitotic
inhibitors and/or one or more anti-angiogenic agents is
unexpectedly found as described herein.
[0156] According to aspects of the present invention, a method of
treating a subject having cancer or at risk of having cancer
includes administration of a therapeutically effective amount of
TIC10, a pharmaceutically acceptable derivative, salt, ester,
amide, hydrate, solvate and/or prodrug thereof; and a mitotic
inhibitor.
[0157] According to aspects of the present invention, a method of
treating a subject having cancer or at risk of having cancer
includes administration of a therapeutically effective amount of
TIC10, a pharmaceutically acceptable derivative, salt, ester,
amide, hydrate, solvate and/or prodrug thereof; and a taxane
mitotic inhibitor, such as, but not limited to, paclitaxel and
docetaxel.
[0158] According to aspects of the present invention, a method of
treating a subject having cancer or at risk of having cancer
includes administration of a therapeutically effective amount of
TIC10, a pharmaceutically acceptable derivative, salt, ester,
amide, hydrate, solvate and/or prodrug thereof; and an
anti-angiogenic agent.
[0159] According to aspects of the present invention, a method of
treating a subject having cancer or at risk of having cancer
includes administration of a therapeutically effective amount of
TIC10, a pharmaceutically acceptable derivative, salt, ester,
amide, hydrate, solvate and/or prodrug thereof; and an
anti-angiogenic agent, such as, but not limited to,
bevacizumab.
[0160] In particular aspects of inventive compositions, the amount
of the adjunct anti-cancer agent administered is less than an
amount of the adjunct anti-cancer agent necessary to achieve a
therapeutic effect if administered without administration of a
therapeutically effective amount of structure (I), a
pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof. Thus, in particular
aspects of compositions of the present invention, the amount of the
adjunct anti-cancer agent in a unit dose of the composition is at
least 5%, at least 10%, at least 15%, at least 20%, at least 25%,
at least 30%, at least 35%, at least 40%, at least 50%, at least
55%, at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, or at least 90%, less than an amount of
the adjunct anti-cancer agent necessary to achieve a therapeutic
effect if administered without the therapeutically effective amount
of structure (I), a pharmaceutically acceptable derivative, salt,
ester, amide, hydrate, solvate and/or prodrug thereof.
[0161] According to aspects of the present invention, TRAIL can be
induced or provided by methods or compositions in addition to
administration of TIC10, such as by administration of one or more
histone deacetylase (HDAC) inhibitors such as vorinostat, described
in Nebbioso, A. et al, 2005, Nat Med 11, 77-84; one or more
TRAIL-agonist antibodies such as lexatumumab and mapatumumab;
and/or recombinant TRAIL such as adenoviral TRAIL as described in
Abdulghani, J. et al., 2010, Exp. Opin. Ther. Targets
14:1091-1108.
[0162] Optionally, a method of treating a subject having cancer or
at risk of having cancer further includes an adjunct anti-cancer
treatment. An adjunct anti-cancer treatment can be a radiation
treatment of a subject or an affected area of a subject's body.
[0163] TRAIL expression induced in the subject by administration of
a pharmaceutical composition of the present invention is detectable
in a sample obtained from the subject, such as a blood sample
obtained from the subject.
[0164] Aspects of the present invention include upregulation of the
TRAIL gene by normal and tumor tissues with sustained serum levels
of secreted TRAIL, after a single dose of TIC10, for 3-4 days.
Normally the serum half-life of the TRAIL protein is 20-30
minutes.
[0165] TIC10 has a calculated mass of 387.21 and crosses the
blood-brain barrier. Administration of TIC10 allows for induction
of TRAIL in cells of the central nervous system, illustratively
including glial cells and neurons of the brain and spinal cord.
Further, administration of a pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate or prodrug of
TIC10 which crosses the blood-brain barrier allows for induction of
TRAIL in cells of the central nervous system.
[0166] Methods of treatment of a subject having, or at risk of
having, a central nervous system (CNS) cancer are provided
according to aspects of the present invention which include
administration of a pharmaceutically effective amount of:
##STR00008##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof; and a pharmaceutically
acceptable carrier by a route of administration other than by
direct administration to the CNS.
[0167] Primary CNS cancers and CNS metastases of non-CNS cancers,
also called brain cancer herein, are treated according to aspects
of the present invention. Primary CNS cancers treated according to
aspects of the present invention include but are not limited to
gliomas, meningiomas, pituitary adenomas and nerve sheath tumors.
Glioblastoma multiforme is a primary CNS cancer treated according
to aspects of the present invention. Oligodendrogliomas are primary
CNS cancers treated according to aspects of the present
invention.
[0168] Methods of the present invention include administration of a
pharmaceutical composition of the present invention by a route of
administration including, but not limited to, oral, rectal, nasal,
pulmonary, epidural, ocular, otic, intraarterial, intracardiac,
intracerebroventricular, intradermal, intravenous, intramuscular,
intraperitoneal, intraosseous, intrathecal, intravesical,
subcutaneous, topical, transdermal, and transmucosal, such as by
sublingual, buccal, vaginal, and inhalational, routes of
administration.
[0169] Methods of treatment of a subject in need thereof are
provided according to aspects of the present invention which
include oral administration of a pharmaceutically effective amount
of:
##STR00009##
a pharmaceutically acceptable derivative, salt, ester, amide,
hydrate, solvate and/or prodrug thereof, formulated for oral
administration.
[0170] A pharmaceutical composition of the present invention may be
in any dosage form suitable for administration to a subject,
illustratively including solid, semi-solid and liquid dosage forms
such as tablets, capsules, powders, granules, suppositories, pills,
solutions, suspensions, ointments, lotions, creams, gels, pastes,
sprays and aerosols. Liposomes and emulsions are well-known types
of pharmaceutical formulations that can be used to deliver a
pharmaceutical agent, particularly a hydrophobic pharmaceutical
agent. Pharmaceutical compositions of the present invention
generally include a pharmaceutically acceptable carrier such as an
excipient, diluent and/or vehicle. Delayed release formulations of
compositions and delayed release systems, such as semipermeable
matrices of solid hydrophobic polymers can be used.
[0171] A pharmaceutical formulation of a composition of the present
invention can include a pharmaceutically acceptable carrier. The
term "pharmaceutically acceptable carrier" refers to a carrier
which is suitable for use in a subject without undue toxicity or
irritation to the subject and which is compatible with other
ingredients included in a pharmaceutical composition.
[0172] Pharmaceutically acceptable carriers, methods for making
pharmaceutical compositions and various dosage forms, as well as
modes of administration are well-known in the art, for example as
detailed in Pharmaceutical Dosage Forms: Tablets, eds. H. A.
Lieberman et al., New York: Marcel Dekker, Inc., 1989; and in L. V.
Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms and Drug
Delivery Systems, 8th Ed., Philadelphia, Pa.: Lippincott, Williams
& Wilkins, 2004; A. R. Gennaro, Remington: The Science and
Practice of Pharmacy, Lippincott Williams & Wilkins, 21st ed.,
2005, particularly chapter 89; and J. G. Hardman et al., Goodman
& Gilman's The Pharmacological Basis of Therapeutics,
McGraw-Hill Professional, 10th ed., 2001.
[0173] Pharmaceutical compositions according to aspects of the
present invention are formulated for oral administration.
[0174] A solid dosage form for administration or for suspension in
a liquid prior to administration illustratively includes capsules,
tablets, powders, and granules. In such solid dosage forms, one or
more active agents, is admixed with at least one carrier
illustratively including a buffer such as, for example, sodium
citrate or an alkali metal phosphate illustratively including
sodium phosphates, potassium phosphates and calcium phosphates; a
filler such as, for example, starch, lactose, sucrose, glucose,
mannitol, and silicic acid; a binder such as, for example,
carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone,
sucrose, and acacia; a humectant such as, for example, glycerol; a
disintegrating agent such as, for example, agar-agar, calcium
carbonate, plant starches such as potato or tapioca starch, alginic
acid, certain complex silicates, and sodium carbonate; a solution
retarder such as, for example, paraffin; an absorption accelerator
such as, for example, a quaternary ammonium compound; a wetting
agent such as, for example, cetyl alcohol, glycerol monostearate,
and a glycol; an adsorbent such as, for example, kaolin and
bentonite; a lubricant such as, for example, talc, calcium
stearate, magnesium stearate, a solid polyethylene glycol or sodium
lauryl sulfate; a preservative such as an antibacterial agent and
an antifungal agent, including for example, sorbic acid, gentamycin
and phenol; and a stabilizer such as, for example, sucrose, EDTA,
EGTA, and an antioxidant.
[0175] Solid dosage forms optionally include a coating such as an
enteric coating. The enteric coating is typically a polymeric
material. Preferred enteric coating materials have the
characteristics of being bioerodible, gradually hydrolyzable and/or
gradually water-soluble polymers. The amount of coating material
applied to a solid dosage generally dictates the time interval
between ingestion and drug release. A coating is applied having a
thickness such that the entire coating does not dissolve in the
gastrointestinal fluids at pH below 3 associated with stomach
acids, yet dissolves above pH 3 in the small intestine environment.
It is expected that any anionic polymer exhibiting a pH-dependent
solubility profile is readily used as an enteric coating in the
practice of the present invention to achieve delivery of the active
agent to the lower gastrointestinal tract. The selection of the
specific enteric coating material depends on properties such as
resistance to disintegration in the stomach; impermeability to
gastric fluids and active agent diffusion while in the stomach;
ability to dissipate at the target intestine site; physical and
chemical stability during storage; non-toxicity; and ease of
application.
[0176] Suitable enteric coating materials illustratively include
cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl
cellulose, hydroxypropyl methyl cellulose, methyl cellulose, ethyl
cellulose, cellulose acetate, cellulose acetate phthalate,
cellulose acetate trimellitate, hydroxypropylmethyl cellulose
phthalate, hydroxypropylmethyl cellulose succinate and
carboxymethylcellulose sodium; acrylic acid polymers and
copolymers, preferably formed from acrylic acid, methacrylic acid,
methyl acrylate, ammonium methylacrylate, ethyl acrylate, methyl
methacrylate and/or ethyl; vinyl polymers and copolymers such as
polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate
phthalate, vinylacetate crotonic acid copolymer, and ethylene-vinyl
acetate copolymers; shellac; and combinations thereof. A particular
enteric coating material includes acrylic acid polymers and
copolymers described for example U.S. Pat. No. 6,136,345.
[0177] The enteric coating optionally contains a plasticizer to
prevent the formation of pores and cracks that allow the
penetration of the gastric fluids into the solid dosage form.
Suitable plasticizers illustratively include, triethyl citrate
(Citroflex 2), triacetin (glyceryl triacetate), acetyl triethyl
citrate (Citroflec A2), Carbowax 400 (polyethylene glycol 400),
diethyl phthalate, tributyl citrate, acetylated monoglycerides,
glycerol, fatty acid esters, propylene glycol, and dibutyl
phthalate. In particular, a coating composed of an anionic
carboxylic acrylic polymer typically contains approximately 10% to
25% by weight of a plasticizer, particularly dibutyl phthalate,
polyethylene glycol, triethyl citrate and triacetin. The coating
can also contain other coating excipients such as detackifiers,
antifoaming agents, lubricants (e.g., magnesium stearate), and
stabilizers (e.g. hydroxypropylcellulose, acids or bases) to
solubilize or disperse the coating material, and to improve coating
performance and the coated product.
[0178] Liquid dosage forms for oral administration include one or
more active agents and a pharmaceutically acceptable carrier
formulated as an emulsion, solution, suspension, syrup, or elixir.
A liquid dosage form of a composition of the present invention may
include a colorant, a stabilizer, a wetting agent, an emulsifying
agent, a suspending agent, a sweetener, a flavoring, or a perfuming
agent.
[0179] For example, a composition for parenteral administration may
be formulated as an injectable liquid. Examples of suitable aqueous
and nonaqueous carriers include water, ethanol, polyols such as
propylene glycol, polyethylene glycol, glycerol, and the like,
suitable mixtures thereof; vegetable oils such as olive oil; and
injectable organic esters such as ethyloleate. Proper fluidity can
be maintained, for example, by the use of a coating such as
lecithin, by the maintenance of a desirable particle size in the
case of dispersions, and/or by the use of a surfactant, such as
sodium lauryl sulfate. A stabilizer is optionally included such as,
for example, sucrose, EDTA, EGTA, and an antioxidant.
[0180] For topical administration, a composition can be formulated
for administration to the skin such as for local effect, and/or as
a "patch" formulation for transdermal delivery. Pharmaceutical
formulations suitable for topical administration include, for
example, ointments, lotions, creams, gels, pastes, sprays and
powders. Ointments, lotions, creams, gels and pastes can include,
in addition to one or more active agents, a base such as an
absorption base, water-removable base, water-soluble base or
oleaginous base and excipients such as a thickening agent, a
gelling agent, a colorant, a stabilizer, an emulsifying agent, a
suspending agent, a sweetener, a flavoring, or a perfuming
agent.
[0181] Transdermal formulations can include percutaneous absorption
enhancers such as acetone, azone, dimethyl acetamide, dimethyl
formamide, dimethyl sulfoxide, ethanol, oleic acid, polyethylene
glycol, propylene glycol and sodium lauryl sulfate. Iontophoresis
and/or sonophoresis can be used to enhance transdermal
delivery.
[0182] Powders and sprays for topical administration of one or more
active agents can include excipients such as talc, lactose and one
or more silicic acids.
[0183] Sprays can include a pharmaceutical propellant such as a
fluorinated hydrocarbon propellant, carbon dioxide, or a suitable
gas. Alternatively, a spray can be delivered from a pump-style
spray device which does not require a propellant. A spray device
delivers a metered dose of a composition contained therein, for
example, using a valve for regulation of a delivered amount.
[0184] Opthalmic formulations of one or more active agents can
include ingredients such as a preservative, a buffer and a
thickening agent.
[0185] Suitable surface-active agents useful as a pharmaceutically
acceptable carrier or excipient in the pharmaceutical compositions
of the present invention include non-ionic, cationic and/or anionic
surfactants having good emulsifying, dispersing and/or wetting
properties. Suitable anionic surfactants include both water-soluble
soaps and water-soluble synthetic surface-active agents. Suitable
soaps are alkaline or alkaline-earth metal salts, non-substituted
or substituted ammonium salts of higher fatty acids (C10-C22), e.g.
the sodium or potassium salts of oleic or stearic acid, or of
natural fatty acid mixtures obtainable form coconut oil or tallow
oil. Synthetic surfactants include sodium or calcium salts of
polyacrylic acids; fatty sulphonates and sulphates; sulphonated
benzimidazole derivatives and alkylarylsulphonates. Fatty
sulphonates or sulphates are usually in the form of alkaline or
alkaline-earth metal salts, non-substituted ammonium salts or
ammonium salts substituted with an alkyl or acyl radical having
from 8 to 22 carbon atoms, e.g. the sodium or calcium salt of
lignosulphonic acid or dodecylsulphonic acid or a mixture of fatty
alcohol sulphates obtained from natural fatty acids, alkaline or
alkaline-earth metal salts of sulphuric or sulphonic acid esters
(such as sodium lauryl sulphate) and sulphonic acids of fatty
alcohol/ethylene oxide adducts. Suitable sulphonated benzimidazole
derivatives preferably contain 8 to 22 carbon atoms. Examples of
alkylarylsulphonates are the sodium, calcium or alcanolamine salts
of dodecylbenzene sulphonic acid or dibutyl-naphtalenesulphonic
acid or a naphtalenesulphonic acid/formaldehyde condensation
product. Also suitable are the corresponding phosphates, e.g. salts
of phosphoric acid ester and an adduct of p-nonylphenol with
ethylene and/or propylene oxide, or phospholipids. Suitable
phospholipids for this purpose are the natural (originating from
animal or plant cells) or synthetic phospholipids of the cephalin
or lecithin type such as e.g. phosphatidylethanolamine,
phosphatidylserine, phosphatidylglycerine, lysolecithin,
cardiolipin, dioctanylphosphatidylcholine,
dipalmitoylphoshatidyl-choline and their mixtures.
[0186] Suitable non-ionic surfactants useful as pharmaceutically
acceptable carriers or excipients in the pharmaceutical
compositions of the present invention include polyethoxylated and
polypropoxylated derivatives of alkylphenols, fatty alcohols, fatty
acids, aliphatic amines or amides containing at least 12 carbon
atoms in the molecule, alkylarenesulphonates and
dialkylsulphosuccinates, such as polyglycol ether derivatives of
aliphatic and cycloaliphatic alcohols, saturated and unsaturated
fatty acids and alkylphenols, said derivatives preferably
containing 3 to 10 glycol ether groups and 8 to 20 carbon atoms in
the (aliphatic) hydrocarbon moiety and 6 to 18 carbon atoms in the
alkyl moiety of the alkylphenol. Further suitable non-ionic
surfactants are water-soluble adducts of polyethylene oxide with
poylypropylene glycol, ethylenediaminopolypropylene glycol
containing 1 to 10 carbon atoms in the alkyl chain, which adducts
contain 20 to 250 ethyleneglycol ether groups and/or 10 to 100
propyleneglycol ether groups. Such compounds usually contain from 1
to 5 ethyleneglycol units per propyleneglycol unit. Representative
examples of non-ionic surfactants are
nonylphenol-polyethoxyethanol, castor oil polyglycolic ethers,
polypropylene/polyethylene oxide adducts,
tributylphenoxypolyethoxyethanol, polyethyleneglycol and
octylphenoxypolyethoxyethanol. Fatty acid esters of polyethylene
sorbitan (such as polyoxyethylene sorbitan trioleate), glycerol,
sorbitan, sucrose and pentaerythritol are also suitable non-ionic
surfactants.
[0187] Suitable cationic surfactants useful as pharmaceutically
acceptable carriers or excipients in the pharmaceutical
compositions of the present invention include quaternary ammonium
salts, preferably halides, having 4 hydrocarbon radicals optionally
substituted with halo, phenyl, substituted phenyl or hydroxy; for
instance quaternary ammonium salts containing as N-substituent at
least one C8-C22 alkyl radical (e.g. cetyl, lauryl, palmityl,
myristyl, oleyl and the like) and, as further substituents,
unsubstituted or halogenated lower alkyl, benzyl and/or
hydroxy-lower alkyl radicals.
[0188] A more detailed description of surface-active agents
suitable for this purpose may be found for instance in
"McCutcheon's Detergents and Emulsifiers Annual" (MC Publishing
Crop., Ridgewood, N.J., 1981), "Tensid-Taschenbuch", 2nd ed.
(Hanser Verlag, Vienna, 1981) and "Encyclopaedia of Surfactants
(Chemical Publishing Co., New York, 1981).
[0189] Structure-forming, thickening or gel-forming agents may be
included into the pharmaceutical compositions and combined
preparations of the invention. Suitable such agents are in
particular highly dispersed silicic acid, such as the product
commercially available under the trade name Aerosil; bentonites;
tetraalkyl ammonium salts of montmorillonites (e.g., products
commercially available under the trade name Bentone), wherein each
of the alkyl groups may contain from 1 to 20 carbon atoms;
cetostearyl alcohol and modified castor oil products (e.g. the
product commercially available under the trade name
Antisettle).
[0190] In particular aspects, a pharmaceutically acceptable carrier
is a particulate carrier such as lipid particles including
liposomes, micelles, unilamellar or mulitlamellar vesicles; polymer
particles such as hydrogel particles, polyglycolic acid particles
or polylactic acid particles; inorganic particles such as calcium
phosphate particles such as described in for example U.S. Pat. No.
5,648,097; and inorganic/organic particulate carriers such as
described for example in U.S. Pat. No. 6,630,486.
[0191] A particulate pharmaceutically acceptable carrier can be
selected from among a lipid particle; a polymer particle; an
inorganic particle; and an inorganic/organic particle. A mixture of
particle types can also be included as a particulate
pharmaceutically acceptable carrier.
[0192] A particulate carrier is typically formulated such that
particles have an average particle size in the range of about 1
nm-10 microns. In particular aspects, a particulate carrier is
formulated such that particles have an average particle size in the
range of about 1 nm-100 nm.
[0193] The dosage of an inventive pharmaceutical composition will
vary based on factors such as, but not limited to, the route of
administration; the age, health, sex, and weight of the subject to
whom the composition is to be administered; the nature and extent
of the subject's symptoms, if any, and the effect desired. Dosage
may be adjusted depending on whether treatment is to be acute or
continuing. One of skill in the art can determine a
pharmaceutically effective amount in view of these and other
considerations typical in medical practice.
[0194] In general it is contemplated that a daily dosage of an
inventive pharmaceutical composition is in the range of about 0.001
to 100 milligrams per kilogram of a subject's body weight. A daily
dose may be administered as two or more divided doses to obtain the
desired effect. An inventive pharmaceutical composition may also be
formulated for sustained release to obtain desired results.
[0195] Detailed information concerning customary ingredients,
equipment and processes for preparing dosage forms is found in
Pharmaceutical Dosage Forms: Tablets, eds. H. A. Lieberman et al.,
New York: Marcel Dekker, Inc., 1989; and in L. V. Allen, Jr. et
al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems,
8th Ed., Philadelphia, Pa.: Lippincott, Williams & Wilkins,
2004; A. R. Gennaro, Remington: The Science and Practice of
Pharmacy, Lippincott Williams & Wilkins, 21st ed., 2005,
particularly chapter 89; and J. G. Hardman et al., Goodman &
Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill
Professional, 10th ed., 2001.
[0196] Commercial packages according to aspects of the present
invention include a pharmaceutical composition described herein.
Instructions for administering the pharmaceutical composition are
included according to aspects of the invention.
[0197] According to aspects of the present invention, a commercial
package includes
##STR00010##
a pharmaceutically acceptable pharmaceutically acceptable
derivative, salt, ester, amide, hydrate, solvate and/or prodrug
thereof; and a pharmaceutically acceptable carrier.
[0198] One or more ancillary components is optionally included in
commercial packages of the present invention, such as a buffer or
diluent.
[0199] Aspects of inventive compositions and methods are
illustrated in the following examples. These examples are provided
for illustrative purposes and are not considered limitations on the
scope of inventive compositions and methods.
Examples
[0200] Reagents and Cell-Based Assays
[0201] All cell lines were obtained from ATCC except HCT116
Bax.sup.-/- and HCT116 p53.sup.-/- cells obtained from Bert
Vogelstein (Johns Hopkins University, Baltimore, Mass.) and GBM
cell lines obtained from Akiva Mintz (Wake Forrest University,
Winston-Salem, N.C.). Lentiviral infection was carried out with
MDA-MB-231 cells using TRAIL shRNA or vector and HCT116 using
Foxo3a shRNA or vector purchased from Sigma-Aldrich (St. Louis,
Mo.). H460 DR5.DELTA.DD-EGFP cells were constructed using cDNA
coding for a DR5 fragment without death domain by inserting amino
acids 1 to 298 of the human DR5 gene into the pEGFP-N1 vector to
express a DR5(1-298)-fusion protein. The fusion construct was
transfected into H460 cells with Lipofectamine 2000 (Invitrogen)
and selected with G418. Positive clones were verified by
florescence microscopy and Western blot analysis. Bioluminescent
high-throughput screening using the NCI diversity set II was
carried out in HCT116 Bax.sup.-/- cells that were stably
cotransfected to express a firefly luciferase construct under
transcriptional control of the first 504 base pairs of the TRAIL
promoter upstream of the start of transcription of the human TRAIL
gene. Compounds were tested at a working concentration of 20 nM,
200 nM, 500 nM, and 1 .mu.M with bioluminescent assessment of
transcriptional activity at 12, 24, 36, and 48 hours
post-treatment. Details of the screening methodology are described
in Wang et al., 2006, PNAS 103:11003-11008). TIC10 (NSC350625) was
obtained from the NCI DTP, reconstituted in DMSO at 20 mM,
aliquoted and stored at -20.degree. C. A6730 and U0126
monoethanolate were obtained from Sigma. Purified, recombinant
TRAIL was produced as described in Kim et al., 2004, J. of Biol.
Chem. 279:40044-40052. The RIK-2 antibody (Santa-Cruz
Biotechnology) was used at 1 .mu.g/mL and zVAD-fmk (Promega) was
used at 20 .mu.M.
[0202] Primary Specimens from Human Patients
[0203] All primary specimens from human patients were received
immediately following resection, manually digested in complete
DMEM, filtered with a 100-.mu.m nylon mesh, and plated at
2.times.10.sup.5 cells/mL in complete DMEM for use in Examples
described herein.
[0204] Mice
[0205] For subcutaneous xenografts, 4-6 week old female, athymic
nu/nu mice (Charles River Laboratories) were inoculated with
1.times.10.sup.6 cells (2.5.times.10.sup.6 for T98G) of indicated
cell lines in each rear flank as a 200 .mu.L suspension of 1:1
Matrigel (BD):PBS. All intraperitoneal and intravenous injections
were given at a total volume of 200 .mu.L. Oral formulations of
TIC10 were administered using an oral gavage and given as a 200
.mu.L suspension containing 20% Cremophor EL.RTM. (Sigma), 10%
DMSO, and 70% PBS. Tumors were monitored using digital calipers at
indicated time points. All subcutaneous tumors were allowed to
establish for 1-4 weeks post-injection until reaching a volume of
-125 mm.sup.3 before treatment initiation. Relief of tumor burden
was monitored for 3 weeks following disappearance of the tumor and
confirmed by visual inspection after euthanasia.
[0206] Intracecal implantation was performed as described in
Cespedes, M. V., et al., Am J Pathol, 2007, 170(3): p.
1077-1085.
[0207] For intracranial xenografts, anesthetized athymic nude mice
were implanted with 2.times.10.sup.5 SF767 cells in a 25 .mu.L
suspension of serum- and antibiotic-free RPMI. The site of
injection was a burr hole created 1 mm lateral to the midline of
the skull and 1 mm anterior to the coronal suture. The injection
was gradually administered over 5 minutes with a Hamilton syringe
and the burr hole was sealed using bone wax. Tumor take was
assessed by bioluminescent imaging 2 weeks following implantation.
Bioluminescent imaging of tumors was carried out on an IVIS imaging
system as described in Wang et al., 2003, PNAS 100:15095-15100.
[0208] Near-infrared imaging of mice was carried out on a Pearl
Impulse imaging system (LI-COR) following tail-vein injection of
AngioSense.RTM. 680 (VisEn Medical, Woburn, Mass.) according to the
manufacturer's protocols. 6 week old E.mu.-myc mice were obtained
from The Jackson Laboratory (B6.Cg-Tg(IghMyc)22Bri/J).
[0209] For CBC/differential and serum chemistry assays, 1 mL of
blood was harvested from anesthetized mice by terminal cardiac
puncture of the left ventricle. For serum chemistry, 500 .mu.L was
placed into a microfuge tube and allowed to clot for 30 minutes at
room temperature followed by centrifugation. Serum was removed,
centrifuged again to remove any further clots, and serum was
submitted for analysis. For CBC/differentials, 500 .mu.L of blood
was collected into EDTA tubes and analyzed.
[0210] Statistical Analyses.
[0211] For pair-wise comparisons, data were analyzed by the
Student's two-tailed t test using Excel (Microsoft). Log-rank
statistical analysis was performed using a web-based script that
interfaces with the statistical package R.
[0212] RT-qPCR
[0213] Total RNA was extracted using RNeasy Minikit (Qiagen) by
following the manufacturer's instructions. cDNA was generated using
SuperScript II (Invitrogen) with 1 .mu.g of RNA and oligodT.
Primers were: TRAIL forward (CAGAGGAAGAAGCAACACATT, SEQ ID NO:1),
TRAIL reverse (GGTTGATGATTCCCAGGAGTTTATTTTG, SEQ ID NO:2), GAPDH
forward (CCACATCGCTCAGACACCAT, SEQ ID NO:3), GAPDH reverse
(GGCAACAATATCCACTTTACCAGAGT, SEQ ID NO:4). PCR amplification was
performed with the Applied Biosystems 7900HT Fast Real-time
Detection System. Samples were standardized to 10 ng/.mu.l and
twenty ng of cDNA per sample was then utilized as a template for
real-time PCR using a SYBR Green Master Mix (Qiagen Corp, USA).
Samples were normalized to GAPDH used under identical conditions.
Quantitation used the 2.DELTA..DELTA.Ct method of crossing
thresholds described in Livak et al., 2001, Methods. 2001 December;
25(4):402-8, with GAPDH as the endogenous control for
normalization. Reactions were performed in 384 well optical plates
in a 7900HT instrument (Applied Biosystems), with 10 ul reaction
volumes. Data analysis used the ABI PRISM 7900 Sequence Detection
System 2.2 software. To exclude the possibility of genomic DNA
contamination, control PCR reactions with no cDNA template and
No-RT control samples were also performed for each gene-specific
primer set. Quadruplicates of each PCR reaction were performed and
the resultant data was averaged.
[0214] Immunofluorescence
[0215] Indicated cell lines were propagated in log-phase growth in
six-well plates in the presence of absence of TIC10 at indicated
working concentrations for 72 hr. Cells were fixed and
permeabilized using Cytofix/Cytoperm solution (BD Biosciences, San
Jose, Calif.) solution. Cells were incubated with anti-TRAIL
(ab2435, Abcam, Cambridge, Mass.) at 1:100 or anti-active caspase-3
(559565, BD Pharmingen, San Diego, Calif.) at 1:250 in Perm/Wash
solution (BD Biosciences) for 1 hr in the absence of light.
Anti-rabbit Alexa Fluor 488 was incubated at 1:200 in Perm/Wash
solution for 20 min at room temperature and rinsed in PBS. Hoechst
33342 (Invitrogen) was used as a nuclear counterstain according to
the manufacturer's protocol. Fluorescence imaging was performed on
an Axiovert inverted microscope (Carl Zeiss MicroImaging) using an
iVision imaging system (Bio vision).
[0216] Flow Cytometry and Cell Death Assays
[0217] For all flow cytometry analyses, floating and adherent cells
were analyzed on a Coulter-Beckman Elite Epics cytometer. For
surface TRAIL experiments, adherent cells were harvested by brief
trypsinization, fixed in 4% paraformaldehyde in PBS for 20 min,
incubated with an anti-TRAIL antibody for 2 hr (Abcam), washed and
incubated with anti-rabbit Alexafluor 488 (Invitrogen) for 30 min,
and analyzed. Cells were gated on forward and side scatter to
eliminate debris and dead cells from the analysis. Surface TRAIL
data is expressed as median fluorescence intensity relative to that
of control samples unless indicated as otherwise. For Sub-G1 and
cell cycle profile experiments, all cells were pelleted and ethanol
fixed followed by staining with propidium iodide (Sigma) in the
presence of RNAse. Cell viability assays were carried out in
96-well black-walled clear-bottom plates using CellTiter-Glo.RTM.
(Promega) according to the manufacturer's protocols. Imaging and
quantification of these assays were performed on an IVIS imaging
system (Xenogen).
[0218] Colony Formation Assays
[0219] Indicated cell lines were plated at 500 cells per well and
treated the following day in fresh complete media after adherence.
At 3 days post-treatment, the media was replaced with drug-free
media and cells were propagated for 10 days with fresh media given
once every 3 days. At the end of the 10 day period, cells were
washed in PBS, fixed with methanol, and stained with Coomassie
blue, rinsed, and dried for quantification.
[0220] Tissue Analyses.
[0221] Mice were humanely sacrificed at indicated time points and
excised normal tissue or tumors were fixed in 4%
paraformaldehyde/PBS overnight at 4.degree. C. If plasma samples
were desired, 500 .mu.L of blood was collected by terminal cardiac
puncture under anesthesia in EDTA-Vacutainer tubes (BD). Serum
samples were collected in a similar fashion but in microcentrifuge
tubes followed by a 30 minute incubation at room temperature to
allow for clotting. Serum was then removed following centrifugation
for 5 minutes. Paraffin-embedded blocks, serial section slides, and
hematoxylin and eosin staining were prepared according to standard
procedures. TUNEL staining was performed using the ApopTag.RTM.
Peroxidase In Situ Apoptosis Detection Kit (Millipore). For IHC
analysis, slides were dewaxed in xylene and hydrated in a
decreasing gradient of ethanol. Antigen retrieval was carried out
by boiling in 10 mM citric acid (pH 6.0) for 6 min. Samples were
blocked with streptavidin and biotin blocking solutions and goat
serum (Vector Laboratories). Primary antibodies were incubated
overnight at 4.degree. C. in a humidity chamber. Incubation with
biotinylated secondary antibody and DAB deposition was carried out
according the manufacturer's protocol (Vector Laboratories DAB
Substrate Kit for Peroxidase). Samples were counterstained with
hematoxylin (DAKO) for 6 min, rinsed in dH.sub.2O for 5 min, rinsed
with PBS, and dehydrated and sealed under cover slips. Images were
recorded on an Axioskop microscope using QCapture software
(QImaging).
[0222] Co-Cultures
[0223] Co-cultures of HCT116 p53.sup.-/- and HFF cells were
performed in a 1:1 mixture of complete DMEM and McCoy's 5A medium.
For fluorescence images, the two cells were separately labeled
using the Fluorescent Cell Linkers Kits for gene cell membrane
labeling (Sigma) according to the manufacturer's protocols. Cells
were counterstained with Hoechst 33342 as described in the
immunofluorescence section. For flow cytometry analysis of cell
death, the two populations of cells were determined by differential
light scattering and analyzed as described for sub-G1 analysis in
the cell death assays section.
[0224] ELISA
[0225] ELISA for TRAIL was carried out using the Quantikine.RTM.
TRAIL/TNFSF10 kit according to the manufacturer's protocol (DTRL00,
R&D systems, Minneapolis, Minn.). Optical correction was
performed as suggested by the manufacturer with absorbance at 540
nm. Absorbances were measured with a DTX 880 plate reader (Beckman
Coulter).
[0226] Pharmacokinetic Analysis of TIC10
[0227] The absorbance profile of TIC10 was determined on a Gene
Spec III spectrometer (Hitachi Solutions American, South San
Francisco, Calif.). HPLC analysis was performed by absorbance
detection at 239 nm on an Agilent 1200 series system (Agilent,
Santa Clara, Calif.) using an Eclipse XDB-C18 column (Agilent) and
a 100 .mu.L injection loop. Isocratic elution at 1 mL/minute was
carried out in 0.1% trifluoroacetic acid in dH.sub.2O. An
acetonitrile (ACN) gradient was carried out for elution as 15-20%
ACN at 0-5 minutes, 20-23% for 5-12 minutes, 25% for 12-18 minutes.
The standard curve was generated by spiking concentrations of TIC10
into plasma harvested from athymic nude mice from unrelated
experiments. For all plasma samples, blood was obtained by terminal
cardiac puncture of the left ventricle and collected into EDTA
tubes (BD). Samples were centrifuged at 500 g for 10 minutes.
Plasma was deproteinated by the adding 30 .mu.L of perchloric acid
to 100 .mu.L of samples, vortexed for 15 seconds, centrifuged for 2
minutes, and the supernatant was immediately injected into the
HPLC. AUC was normalized to an internal serum peak with a retention
time of 8.1 minutes. AUC data versus time was fit with a
two-compartment open model with first order elimination from
central compartment using the equation
AUC=Ae.sup.-.alpha.t+Be.sup.-.beta.t where t=time and A and B are
the extrapolated concentrations at the initiation of the two phases
(distribution and elimination). Half-lives calculated as
t.sub.1/2.alpha.=0.693/.alpha. and t.sub.1/2.beta.=0.693/.beta..
Other equations used for calculation include
CL=dose/AUC.sub.0-.infin. and V.sub.d=dose/(AUC.sub.0-.infin.X
.beta.).
[0228] Gene Expression Analysis
[0229] HCT116 p53.sup.-/- cells were grown in log-phase and treated
with DMSO or TIC10 (10 .mu.M). At 48 hr, RNA was isolated using the
RNeasy Mini Kit (Qiagen). Microarray analysis was performed using
the Illumina HT-12 Beadchip (Illumina). RNA quality and
concentration was assessed using an Agilent 2100 Bioanalyzer with
RNA Nano LabChip.RTM. (Agilent). cRNA was synthesized by
TotalPrep.TM. Amplification (Ambion) from 500 ng of RNA according
to manufacturer's instructions. T7 oligo (dT) primed reverse
transcription was used to produce first strand cDNA. cDNA then
underwent second strand synthesis and RNA degradation by DNA
Polymerase and RNase H, followed by filtration clean up. In vitro
transcription (IVT) was employed to generate multiple copies of
biotinylated cRNA. The labeled cRNA was purified using filtration,
quantified by NanoDrop, and volume-adjusted for a total of 750
ng/sample. Samples were fragmented, and denatured before
hybridization for 18 hr at 58.degree. C. Following hybridization,
beadchips were washed and fluorescently labeled. Beadchips were
scanned with a BeadArray Reader (Illumina) A project was created
with the resultant scan data imported into GenomeStudio 1.0
(Illumina). Results were exported to GeneSpring Gx11 (Agilent
Technologies). Measurements less than 0.01 were then set to 0.01,
arrays normalized to the 50.sup.th percentile, and individual genes
normalized to the median of controls. For network analysis of
transcriptional changes induced by TIC10, the dataset was analyzed
using the Ingenuity Pathway Analysis software (Ingenuity
Systems).
[0230] Western Blot Analysis
[0231] Western blot analysis was conducted as described in Wang, W.
et al., PNAS 103, 11003-11008, 2006, using NuPAGE 4-12% Bis-Tris
and and visualized using Supersignal West Femto (Thermo Scientific)
and X-ray film. Nuclear and cytoplasmic extracts were prepared
using a cytoplasmic lysis buffer (10 mM HEPES, 10 mM KCl, and 2 mM
MgCl.sub.2, 1 mM DTT) followed by a nuclear lysis buffer (20 mM
HEPES, 420 mM NaCl, 1.5 mM MgCl.sub.2, 250 .mu.M EDTA, 25%
glycerol). For all lysis buffers, fresh protease inhibitor (Roche)
and 1 mM sodium orthovanadate was added immediately prior to
use.
[0232] Chromatin Immunoprecipitation Assays
[0233] Chromatin immunoprecipitation (ChiP) assays were carried out
as described for the TRAIL promoter in Nebbioso, A., et al., Nat
Med, 11(1), 77-84, 2005 using a ChIP grade antibody for Foxo3a
(Abcam) or an equivalent concentration of rabbit IgG
(SouthernBiotech) as a nonspecific control.
[0234] TIC10 Causes p53-Independent Transcriptional Induction of
the TRAIL Gene.
[0235] A cell-based bioluminescence reporter screen conducted in
TRAIL-resistant Bax-null HCT116 human colon cancer cells using the
TRAIL gene promoter yielded the small molecule TIC10 as a
TRAIL-inducing compound.
[0236] TIC10 induced TRAIL promoter-dependent transcriptional
activity of a luciferase reporter construct under regulatory
control of the first 504 base pairs of the TRAIL promoter which
excludes the p53 DNA-binding response element identified in
Takimoto et al., 2000, Oncogene 19, 1735-1743. FIG. 1 is a graph
showing activity of luciferase reporter in HCT116 Bax.sup.-/- cells
under transcriptional control of the first 504 base pairs of the
human TRAIL gene promoter upstream of the start of transcription
(n=3). Error bars indicate s.d. of replicates. *P<0.05 between
the indicated condition and controls.
[0237] TIC10 caused a dose-dependent increase in TRAIL
messenger-RNA.
[0238] FIG. 2 is a graph showing RT-qPCR analysis of TRAIL mRNA
levels in HCT116 p53.sup.-/- cells (48 hr, n=4). Error bars
indicate s.d. of replicates.) TIC10 caused a dose-dependent
increase in TRAIL protein localized to the cell surface of several
cancer cell lines in a p53-independent manner. FIG. 3 is a graph
showing surface TRAIL levels induced by TIC10 in a panel of cancer
cells (10 .mu.M, 72 hr, n=3). Error bars indicate s.d. of
replicates. *P<0.05 between the indicated condition and
controls.
[0239] TIC10 exposure leads to a significant and sustained presence
of TRAIL on the cell surface of cancer cells. A time course
analysis found that TRAIL was localized to the cell surface as a
late event but that this induction could be temporally sustained
even after removal of TIC10 from the media. FIG. 4 is a graph
showing surface TRAIL levels in HCT116 p53.sup.-/- cells following
TIC10 treatment at indicated conditions and time points (n=3).
Error bars indicate s.d. of replicates. *P<0.05 between the
indicated condition and controls. FIG. 5 is a graph showing HCT116
p53.sup.-/- TRAIL surface levels by flow cytometry at 72 hr
following TIC10 treatment initiation (5 .mu.M, n=3). Cells were
treated for the indicated time of pre-incubation and then drug-free
media was exchanged for the remaining time period until analysis at
72 hr. Error bars indicate s.d. of replicates. *P<0.05 between
the indicated condition and controls.
[0240] TIC10 Induces TRAIL-Mediated Apoptosis
[0241] TIC10 induced sub-G1 DNA content that was suggestive of cell
death in TRAIL-sensitive HCT116 p53.sup.-/- cells without altering
the cell cycle profiles of normal fibroblasts at equivalent doses.
FIG. 6 shows cell cycle profiles of HCT116 p53.sup.-/- and HFF
cells treated with TIC10 (5 .mu.M, 72 hr, n=3).
[0242] TIC10 decreased the clonogenic survival of cancer cell lines
while sparing normal fibroblasts. FIG. 7 is a graph showing
quantification of colony formation assays of cancer cells treated
with TIC10 (10 .mu.M, 72 hr, n=3). Error bars indicate standard
deviation (s.d.) of replicates. FIG. 8 is a graph showing parallel
experiments as in FIG. 7 but with HFF cells that were enumerated at
endpoint (n=3). Error bars indicate standard deviation (s.d.) of
replicates.
[0243] TIC10 induced sub-G1 content in a p53-independent and
Bax-dependent manner FIG. 9 is a graph showing sub-G1 analysis of
HCT116 WT, p53.sup.-/-, and Bax.sup.-/- cells following treatment
with DMSO, TIC10 (1, 5, or 10 .mu.M), or rhTRAIL (25 ng/mL) for 72
hr (n=3). Error bars indicate standard deviation (s.d.) of
replicates. *P<0.05 between the indicated condition and control
unless otherwise indicated.
[0244] In accordance with apoptotic cell death, TIC10 increased
active caspase-3 levels as indicated by immunofluorescence assay in
HCT116 p53 cells treated with 5 .mu.M TIC10 for 72 hr and by
Western blot analysis in HCT116 p53.sup.-/- cells treated with 1
.mu.M, 2.5 .mu.M, 5 .mu.M or 10 .mu.M TIC10 for 72 hr. FIG. 10 is
an image showing Western blot analysis results. TIC10 induced
sub-G1 content was significantly inhibited by co-incubation with
the pan-caspase apoptosis inhibitor zVAD-fmk. FIG. 11 is a graph
showing sub-G1 analysis of TIC10-treated cancer cells pre-incubated
with or without zVAD-fmk (10 .mu.M, 72 hr, n=3). Error bars
indicate standard deviation (s.d.) of replicates. *P<0.05
between the indicated condition and control unless otherwise
indicated.
[0245] TIC10-induced apoptosis appears to be specifically mediated
by TRAIL, as indicated by inhibition of TIC10-induced cytotoxicity
following stable knockdown of TRAIL by shRNA. FIG. 12 is a graph
showing sub-G1 analysis of MDA-MB-231 cells with stable knockdown
of TRAIL by short hairpin RNA (72 hr, n=3). Error bars indicate
standard deviation (s.d.) of replicates. *P<0.05 between the
indicated condition and control unless otherwise indicated. FIG. 13
is a graph showing verification of MDA-MB-231 shTRAIL knockdown by
flow cytometry analysis of TIC10-treated cells (5 .mu.M, 72 hr,
n=3). Error bars indicate s.d. of replicates. *P<0.05 between
the indicated condition and control unless otherwise indicated.
[0246] Additional evidence for the requirement of TRAIL in
TIC10-induced tumor cell death was observed following disruption of
the DR5 death-domain that modulates proapoptotic TRAIL signaling.
FIG. 14 is a graph showing sub-G1 analysis of TIC10-induced cell
death in H460 cells with endogenous DR5 or overexpression of a DR5
construct with its death domain replaced by EGFP (10 .mu.M, 72 hr,
n=3). Error bars indicate standard deviation (s.d.) of replicates.
*P<0.05 between the indicated condition and control unless
otherwise indicated.
[0247] Experimental sequestration of TRAIL by use of a blocking
antibody showed the requirement of TRAIL in TIC10-induced tumor
cell death. FIG. 15 is a graph showing sub-G1 analysis of HCT116
cells treated with DMSO, TIC10 (10 .mu.M), or rhTRAIL (25 ng/mL) in
the presence or absence of a TRAIL-sequestering antibody, RIK-2 (72
hr, n=3). Error bars indicate s.d. of replicates. *P<0.05
between the indicated condition and control unless otherwise
indicated.
[0248] The activity of TIC10 on freshly resected colon tumor cells
from a human patient was examined and it was found that TIC10
induced TRAIL and potent cytotoxic effects unlike 5-FU. FIG. 16 is
a graph showing TIC10-induced surface TRAIL with freshly resected
colon cancer cells (10 .mu.M, 72 hr). Tissue was a mucinous
adenocarcinoma resected from an 85 year-old female patient. Data is
expressed as median fluorescence intensity. FIG. 17 is a graph
showing results of a cell viability assay of primary colon cancer
cells from FIG. 16 treated with DMSO, TIC10 (0.6, 1.25, 2.5, 5, 10,
20 .mu.M), or 5-FU (5 .mu.M) (n=3). Error bars indicate s.d. of
replicates.
[0249] The cytotoxic activity of TIC10 is thermally stable unlike
TRAIL. FIG. 18 is a graph showing ability of TIC10 (5 .mu.M) or
rhTRAIL (25 ng/mL) to reduce cell viability in HCT116 cells
following a 1 hr pre-incubation at the indicated temperatures (72
hr, n=3). Error bars indicate standard deviation (s.d.) of
replicates.
[0250] TIC10 is a Potent TRAIL-Mediated Antitumor Agent In Vivo
[0251] TIC10 caused tumor regression in the HCT116 p53.sup.-/-
xenograft to a comparable extent to that observed with TRAIL when
both were administered as multiple doses. FIG. 19 is a graph
showing HCT116 p53.sup.-/- xenograft treated with 3 doses of TIC10
(i.p.), TRAIL (i.v.), or vehicle (i.p.) administered on day 0, 3,
and 6 as indicated by gray vertical bars (n=10). Error bars
indicate standard deviation (s.d.) of replicates. *P<0.05 and
**P<0.005 between the indicated condition and control unless
otherwise indicated.
[0252] Single dose experiments in HCT116 WT) and RKO human colon
cancer xenograft-bearing mice corroborated the potent anti-tumor
activity of TIC10, and clearly demonstrated superiority TRAIL in
the RKO xenograft under the given conditions. FIG. 20 is a graph
showing results of bioluminescent imaging of luciferase-infected
HCT116 p53.sup.-/- xenografts that received a single i.p. injection
of TIC10 or vehicle (n=6). Error bars indicate standard deviation
(s.d.) of replicates. *P<0.05 and **P<0.005 between the
indicated condition and control unless otherwise indicated.
[0253] FIG. 21 is a graph showing RKO xenograft with a single dose
of TIC10 (i.p.), TRAIL (i.v.), or vehicle (i.p., n=10). Error bars
indicate standard deviation (s.d.) of replicates. *P<0.05 and
**P<0.005 between the indicated condition and control unless
otherwise indicated.
[0254] TIC10 induced regression of MDA-MB-231 human breast cancer
xenografts, an effect that was significantly inhibited by stable
knockdown of TRAIL whereas TRAIL-treated tumors progressed. FIG. 22
is a box and whisker plot of tumor volume on day 9 following
treatment initiation in MDA-MB-231 vector or shTRAIL xenografts
with single doses of TIC10 (i.p.), TRAIL (i.v.), or vehicle (DMSO,
i.p.) (n=8). Error bars indicate standard deviation (s.d.) of
replicates. *P<0.05 and **P<0.005 between the indicated
condition and control unless otherwise indicated. TUNEL staining of
tumors from the MDA-MB-231 vector and shTRAIL xenografts 2 days
post-treatment with 50 mg/kg or 100 mg/kg TIC10 show increased
TUNEL staining in vector-treated no shTRAIL-treated cells.
[0255] This directly demonstrates that the anti-tumor activity of
TIC10 is superior to that of TRAIL when administered as single
doses under these conditions and is modulated at least in part by
TRAIL produced by tumor cells. In DLD-1 xenografts, TIC10 induced
tumor stasis at 1 week post-treatment while TRAIL-treated tumors
progressed after a single dose. FIG. 23 is a graph showing relative
tumor volume of DLD-1 xenografts treated with TRAIL (i.v.), TIC10
(i.p.), or DMSO (i.p.) as a single dose at day 0 at indicated
concentrations (n=8).
[0256] TIC10 also induced a sustained regression of the SW480
xenograft as a single dose by intraperitoneal or oral delivery,
suggesting favorable bioavailability. FIG. 24 is a graph showing
comparison of i.p. versus oral administration of a single dose of
TIC10 at 30 mg/kg in SW480 xenografts treated on day 0 (n=6).
[0257] Titration of a single dose of orally administered TIC10 in
the HCT116 xenograft model revealed sustained anti-tumor efficacy
at 25 mg/kg. FIG. 25 is a graph showing TIC10 or vehicle
administered as a single oral dose in the HCT116 xenograft (n=6).
Error bars indicate standard deviation (s.d.) of replicates.
*P<0.05 and **P<0.005 between the indicated condition and
control unless otherwise indicated.
[0258] The lack of apparent toxicity at multiple doses delivered at
4-fold above this therapeutic dose in a previous xenograft along
with no adverse effects on body weight or liver histology suggests
that TIC10 has a wide therapeutic window. FIG. 26 is a graph
showing body weight of athymic, female nude mice treated with a
single dose of TIC10 (100 mg/kg, i.p.). FIG. 27 is a graph showing
body weight of C57/B6 female mice at the end of week 4 of treatment
with a single weekly dose of oral TIC10 (25 mg/kg) for 4 weeks.
Histologic analysis by H&E staining of liver from athymic,
female nude mice harvested 3 days post-treatment with TIC10 (100
mg/kg, i.p.) showed no apparent toxicity of TIC10.
[0259] Chronic exposure to oral TIC10 at 25 mg/kg weekly for 4
weeks in immuno-competent mice did not cause any changes in a panel
of serum chemistry markers as shown in Tables IA and IB.
[0260] Tables IA and IB show serum chemistry of C57/B6 mice treated
with vehicle or TIC10 (25 mg/kg) weekly for 4 weeks.
TABLE-US-00001 TABLE IA Total Blood urea Sodium Potassium Chloride
bilirubin nitrogen Cohort (mM) (mM) (mM) (mg/dl) (mg/dl) Control
151.5 .+-. 4.2 9.025 .+-. 2.2 106.75 .+-. 1.7 3.075 .+-. 1.6 26
.+-. 1.6 TIC10 154.5 .+-. 5.2 7.325 .+-. 3.2 104 2.725 .+-. 2.4
33.75 .+-. 7.3
TABLE-US-00002 TABLE IB Total Alkaline Lactate Creatinine Protein
Albumin phosphate dehyrogenase Cohort (mg/dl) (g/dl) (g/dl) (U/L)
(U/L) Control 0.25 .+-. .06 4.9 .+-. .36 3 .+-. .08 104.5 265 TIC10
0.15 .+-. .06 4.97 .+-. .61 2.9 112 .+-. 12 287.5 .+-. 125
[0261] To test the efficacy of TIC10 in an immuno-competent
preclinical cancer model, E.mu.-Myc transgenic mice that
spontaneously develop lymphoma were used. The same oral dosing
schedule as above that was demonstrated to be safe from weeks 9-12
of age was used. TIC10 significantly prolonged the survival of
these mice by 4 weeks. FIG. 28 is a graph showing overall survival
of E.mu.-myc treated during weeks 9-12 with weekly oral TIC10 (25
mg/kg). P value determined by log-rank test. For relative tumor
volume plots, tumor size is expressed relative to the tumor size on
day 0, which is defined as the day of treatment initiation.
Histologic analysis by H&E staining of E.mu.-myc and WT C57/B6
axillary lymph nodes at 14 weeks of age showed no apparent toxicity
of TIC10.
[0262] Synergistic Combinations of TIC10 and Chemotherapeutic
Agents
[0263] Surprisingly, in vitro synergy between TIC10 and the taxanes
paclitaxel and docetaxel (trade name Taxotere) is observed. FIG. 29
is a graph showing cell viability of DLD-1 treated with TIC10 in
combination with paclitaxel in at indicated conditions (72 hr,
n=3). Error bars indicate s.d. of replicates. FIG. 30 is a graph
showing cell viability of SW620 cells treated with TIC10 in
combination with paclitaxel in at indicated conditions (72 hr,
n=3). Error bars indicate s.d. of replicates. FIG. 31 is a graph
showing cell viability of DLD-1 cells treated with TIC10 in
combination with taxotere in at indicated conditions (72 hr, n=3).
Error bars indicate s.d. of replicates. FIG. 32 is a graph showing
cell viability of SW620 cells treated with TIC10 in combination
with taxotere in at indicated conditions (72 hr, n=3). Error bars
indicate s.d. of replicates.
[0264] The combination of TIC10 and either taxane paclitaxel or
docetaxel cooperated to yield sustained cures in the H460 non-small
cell lung cancer xenograft. FIG. 33 is a graph showing percent of
cohorts in H460 xenograft that retain tumor burden following
treatment with TIC10 (30 mg/kg, i.p.) or taxotere (20 mg/kg, i.v.)
alone, in combination, or with vehicle (DMSO, i.p.) (n=8) as single
doses. FIG. 34 is a graph showing a relative tumor volume plot for
FIG. 33. Error bars indicate s.d. of replicates.
[0265] FIG. 35 is a graph showing percent of cohorts in H460
xenograft that retain tumor burden following treatment with TIC10
(30 mg/kg, i.p.) or paclitaxel (20 mg/kg, i.v.) alone, in
combination, or with vehicle (DMSO, i.p.) (n=8) as single doses.
FIG. 36 is a graph showing a relative tumor volume plot for FIG.
35. Error bars indicate s.d. of replicates.
[0266] TIC10 was found in this example to cooperate with
bevacizumab when both were given once a week in a metastatic
orthotopic mouse model of p53-deficient colorectal cancer to reduce
tumor incidence at the primary cecal tumor and distal metastatic
sites including the lung, liver, lymph nodes and peritoneum. FIG.
37 is a graph showing percent of cohorts with implanted with
intracecal HCT116 p53.sup.-/- tumors with evident tumors at the
primary and distal sites at endpoint (n=5). As indicated by time
line, treatment was administered once a week starting at 2 weeks
post-implantation with cohorts receiving vehicle, TIC10 (25 mg/kg,
oral), bevacizumab (bev, 10 mg/kg, i.v.), or the combination of
TIC10 and bevacizumab.
[0267] TIC10 alone and in combination with bevacizumab was well
tolerated and caused no significant changes in body weight at
endpoint with this multi-dose regimen. FIG. 38 is a graph showing
body weight of mice at endpoint. Error bars indicate s.d. of
replicates.
[0268] TIC10 Causes Tumor-Specific Cell Death by TRAIL-Mediated
Direct and Bystander Effects
[0269] Immunohistochemical (IHC) analysis of HCT116 p53.sup.-/-
xenograft tumors following a single dose of TIC10 on day 0 (100
mg/kg, i.p.). revealed increased protein levels of TRAIL and
cleaved caspase-8, the initiator caspase involved in TRAIL-mediated
apoptosis.
[0270] Fragmented nuclei observed by histology and increased TUNEL
(TdT-mediated dUTP Nick-End Labeling) staining further confirmed
that TIC10 induced apoptosis in the treated tumors. Furthermore,
TIC10 not only induced TRAIL in the tumor but also in stromal
fibroblasts bordering the tumor as shown by H&E and IHC
analysis for TRAIL at the border of tumor and stromal fibroblasts
from HCT116 p53.sup.-/- xenograft tumors following treatment with
TIC10 (100 mg/kg, i.p.) or vehicle on day 2 post-treatment.
[0271] Noting the TIC10-induced TRAIL expression in fibroblasts,
soluble TRAIL In TIC10-treated non-tumor-bearing mice was assayed
in to determine if normal cells secrete TRAIL in response to TIC10.
TIC10 rapidly elevates serum levels of TRAIL in a manner that last
for greater than 72 hours, longer than the serum half-life of
recombinant TRAIL (.about.30 minutes). FIG. 39 is a graph showing
TRAIL serum levels in tumor-free mice following TIC10 (100 mg/kg,
i.v.) or doxorubicin (30 mg/kg, i.p.) (n=2). Error bars indicate
s.d. of replicates.
[0272] Serum TRAIL induced by TIC10 was detected as soon as 2 hours
following administration, which is more rapid that the kinetics
observed in vitro in examples described herein. Pharmacokinetic
analysis revealed that TIC10 is quickly distributed and has a
plasma half-life of -6.5 hours. Table II shows results of
pharmacokinetic analysis of TIC10 in plasma of C57B6 mice. FIG. 40
is a graph showing the absorbance profile of TIC10 with a peak
absorbance at 239 nm. FIG. 41 is a graph showing a calibration
curve for TIC10 spiked into mouse plasma and quantitated by HPLC
analysis using area under curve (AUC). FIG. 42 is a graph showing
plasma concentrations of TIC10 following intravenous administration
at 25 mg/kg in C57/B6 female mice (n=3). Error bars represent
standard error mean of replicates.
TABLE-US-00003 TABLE II Dose t.sub.max C.sub.max A B .alpha. .beta.
t.sub.1/2.alpha. t.sub.1/2.beta. AUC.sub.0-.infin. CL Vd (mg/kg)
(h) (.mu.M) (h) (h) (1/h) (1/h) (h) (h) (.mu.M h) (L/h/kg) (L/kg)
25 0.02 44.2 44.6 7.67 14.9 0.108 0.047 6.42 63.9 1.01 9.39
[0273] TIC10 has a longer half-life than recombinant TRAIL and that
the effects of TIC10, i.e. TRAIL induction, are temporally
sustained for days in vivo as seen in vitro.
[0274] IHC analysis of normal tissues in athymic, nude non-tumor
bearing mice following TIC10 administration on day 0 (100 mg/kg,
i.v.) revealed that TRAIL is upregulated at the protein level in
the brain, kidney, and spleen of mice without apparent toxicity as
determined by histology and TUNEL staining. TRAIL upregulation in
response to TIC10 was not noted in other tissues including the
liver at any time point.
[0275] The effects of TIC10 on normal fibroblasts and its
selectivity for normal cells was tested in this example TIC10
selectively induced apoptosis in p53-deficient tumor cells but not
normal fibroblasts in co-culture experiments, using HCT116
p53.sup.-/- and HFF cells treated with TIC10 (10 .mu.M) or DMSO for
3 days.
[0276] TIC10 induces a significant though modest amount of TRAIL on
the surface of normal fibroblasts. FIG. 43 is a graph showing
surface TRAIL analysis of HFF cells following TIC10 treatment (0,
2.5, 5, or 10 .mu.M from left to right) (72 hr, n=3). Error bars
indicate s.d. of replicates. *P<0.05 between the indicated
condition and control unless otherwise indicated.
[0277] To test whether normal cells contribute to the anti-tumor
efficacy of TIC10 through a TRAIL-mediated bystander effect normal
fibroblasts preincubated with TIC10 were transplanted into
co-culture with p53-deficient colon cancer cells. This resulted in
a modest but significant increase in TRAIL-specific cell death of
the cancer cell sub-population. FIG. 44 is a graph showing sub-G1
analysis of a co-culture of HCT116 p53.sup.-/- cells and pretreated
HFFs (24 hr, n=3). HFF pretreatment consisted of 72 hr incubation
with TIC10 (10 .mu.M) or DMSO. These experiments were performed in
the presence or absence of a TRAIL sequestering antibody (RIK-2).
Scale bars are 100 .mu.m. Error bars indicate s.d. of replicates.
*P<0.05 between the indicated condition and control unless
otherwise indicated.
[0278] Thus as demonstrated herein, TIC10 has a favorable
therapeutic index and induces TRAIL in tumor, stromal, and normal
cells that may contribute to the anti-tumor efficacy of TIC10
through direct as well as bystander mechanisms.
[0279] TIC10 is an Effective Antitumor Agent in Glioblastoma
Multiforme (GBM)
[0280] TIC10 induces TRAIL in the brain and is useful as an
anti-tumor agent against brain tumors. The activity of TIC10 in GBM
cell lines was tested in this example and it was found that TIC10
induced TRAIL and had a p53-independent GI50 in the low micromolar
range that is comparable with other cancer cell lines. FIG. 45 is a
graph showing surface TRAIL in GBM cell lines following incubation
with TIC10 (5 .mu.M, 72 hr, n=3). *P<0.05 between the indicated
condition and control. FIG. 46 is a graph showing GI50 values
extrapolated from cell viability assays of indicated GBM cell lines
at 72 hr post-treatment with TIC10 or DMSO (n=3).
[0281] TIC10 has cytotoxic effects on freshly isolated GBM cells
that were temozolomide-resistant and previously irradiated in this
example. FIG. 47 shows results of a cell viability assay of freshly
resected glioblastoma tissue treated with DMSO, TIC10, or
temozolomide (TMZ, 10 .mu.M) (72 hr, n=3). Tissue was a grade IV
glioblastoma with oligodendroglial component taken from a 38
year-old female patient who had undergone prior cytoreductive
surgery and radiation.
[0282] TIC10 was tested in preclinical models of GBM as a monoagent
and in combination with bevacizumab. TIC10 exerted p53-independent
cytotoxicity against a panel of GBM cell lines, including
temozolomide-resistant GBM cell lines such as T98G, and induced a
sustained regression of subcutaneous T98G xenografts to an extent
similar to bevacizumab when given as a single oral dose. FIG. 48 is
a graph showing subcutaneous xenograft of T98G with mice receiving
a single dose of vehicle, TIC10 (30 mg/kg, PO), or bevacizumab (10
mg/kg, i.v.) on day 0 (n=8). *P<0.05 between the indicated
condition and control.
[0283] A single dose of TIC10 significantly doubled the overall
survival of mice as a monoagent in an aggressive intracranial
xenograft of human GBM using the SF767 cell line and cooperated
with bevacizumab to triple the duration of survival of such brain
tumor-bearing mice.
[0284] FIG. 49 is a graph showing overall survival of mice
harboring SF767 intracranial tumors treated with a single oral dose
of vehicle (n=8), TIC10 (25 mg/kg, n=7), bevacizumab (10 mg/kg,
i.v., n=6), or TIC10 and bevacizumab (n=7) at 2 weeks
post-implantation.
[0285] Table III shows the change in overall survival of mouse
cohorts with SF767 intracranial tumors.
TABLE-US-00004 TABLE III Median .DELTA.Median Cohort n Survival
(days) Survival (days) P Control 8 28 -- -- TIC10 7 74 46 0.038 bev
6 70 42 0.119 TIC10 + bev 7 96.5 68.5 0.0308
[0286] TIC10-Induced TRAIL Upregulation is Foxo3a-Dependent
[0287] To identify the molecular events underpinning TIC10-induced
upregulation of TRAIL, gene expression profiles in TIC10-treated
HCT116 p53.sup.-/- cells were determined. Transcriptional changes
in target genes of the FOXO family of transcription factors were
observed, which includes Foxo3a that has been previously shown to
regulate the TRAIL gene promoter at a binding site contained within
the region selected for as described in Modur, V. et al., 2002, J.
Biol. Chem. 277:47928-47937. FIG. 50 is a graph showing
transcriptional changes associated with FOXO signaling from gene
expression profiling of HCT116 p53.sup.-/- cells at 48 hr
post-TIC10 treatment (10 .mu.M) versus DMSO (n=3). All of these
changes were P<0.05 between DMSO and TIC10 treatment groups.
Error bars indicate s.d. of replicates. *P<0.05 between the
indicated condition and control unless otherwise indicated.
[0288] The FOXO-target gene DR5 was upregulated by TIC10 in several
cancer cell lines and to a much lesser extent in normal cells and
this was also observed in TIC10-treated tumors. FIG. 51 is an image
of Western blot analysis of DR5 in HCT116 cells treated with TIC10
or DMSO at indicated concentrations for 72 hr. Ran is shown as a
loading control. FIG. 52 is a graph showing flow cytometry analysis
of surface DR5 levels in cancer and normal cells treated with TIC10
(72 hr, n=3). Error bars indicate s.d. of replicates. *P<0.05
between the indicated condition and control unless otherwise
indicated.
[0289] IHC analysis of DR5 in HCT116 xenograft tumors treated with
vehicle (i.p.) or TIC10 (100 mg/kg, i.p.) shows, in agreement with
in vitro observations that elevated DR5 expression was evident in
TIC10-treated xenograft tumors.
[0290] FOXO family members, Foxo3a (but not Foxola) underwent a
nuclear translocation in response to TIC10 as determined by
immunofluorescence and Western blot analysis of Foxo3a in HCT116
cells and immunofluorescence analysis of Foxo3a in H460 and SW480
cells treated with DMSO or TIC10, 10 .mu.M, 48 hr.
[0291] FIG. 53 is an image of Western blot analysis of whole cell
lysates (W) and cytoplasmic (C) and nuclear (N) extracts from
HCT116 cells treated with DMSO or TIC10 (48 hr, 10 .mu.M).
.beta.-actin and lamin B1 are shown as cytoplasmic and nuclear
loading controls, respectively.
[0292] A TIC10 dose-dependent increase in the amount of Foxo3a
localized to the TRAIL promoter was found as shown by chromatin
immunoprecipitation assay. FIG. 54 is an image of results of a
chromatin immunoprecipitation assay for
[0293] TIC10-induced translocation of Foxo3a to the TRAIL promoter
at 48 hr post-TIC10 treatment in HCT116 p53.sup.-/- cells (0, 2.5,
5, or 10 .mu.M from left to right).
[0294] Transient knockdown of Foxo3a and Foxo1 revealed that Foxo3a
specifically mediated TIC10-induced TRAIL upregulation. FIG. 55 is
a graph showing results of flow cytometry analysis of cell surface
TRAIL levels induced by TIC10 (10 .mu.M) with or without transient
knockdown of Foxo1 and/or Foxo3a in HCT116 p53.sup.-/- cells using
siRNA (72 hr, n=3). Knockdown is confirmed by Western blot
analysis. Error bars indicate s.d. of replicates. *P<0.05
between the indicated condition and control unless otherwise
indicated.
[0295] Stable knockdown of Foxo3a significantly inhibited
TIC10-induced upregulation of TRAIL production and subsequent tumor
cell death. FIG. 56 is a graph showing sub-G1 analysis of
TIC10-induced cell death with or without stable knockdown of Foxo3a
in HCT116 cells (10 .mu.M, 72 hr, n=3). Error bars indicate s.d. of
replicates. *P<0.05 between the indicated condition and control
unless otherwise indicated. FIG. 57 is a graph showing flow
cytometry analysis of TIC10-induced surface TRAIL with or without
stable knockdown of Foxo3a in HCT116 cells (10 .mu.M, 72 hr, n=3).
Error bars indicate s.d. of replicates. *P<0.05 between the
indicated condition and control unless otherwise indicated. Results
of Foxo3a stable knockdown were confirmed by Western blot
analysis.
[0296] Stable knockdown of Foxo3a in tumor cells also significantly
inhibited the anti-tumor activity of TIC10 and TIC10-induced
hallmarks of TRAIL-mediated apoptosis in tumors in vivo. FIG. 58 is
a graph showing tumor volume of HCT116 xenograft with or without
stable knockdown of Foxo3a following a single oral dose of vehicle
or TIC10 (25 mg/kg) on day 0 (n=10). Error bars indicate s.d. of
replicates. *P<0.05 between the indicated condition and control
unless otherwise indicated.
[0297] IHC analysis and TUNEL staining of HCT116 tumors with or
without stable knockdown of Foxo3a 3 days after a single dose of
TIC10 (25 mg/kg, oral) was performed and showed that stable
knockdown of Foxo3a in tumor cells also significantly inhibited the
anti-tumor activity of TIC10 and TIC10-induced hallmarks of
TRAIL-mediated apoptosis in tumors in vivo.
[0298] Dual Inactivation of Akt and ERK by TIC10 Cooperatively
Induces TRAIL
[0299] TIC10-induced changes in regulators of Foxo3a such as IKK,
Akt, and ERK were determined. FIG. 59 is an image of Western blot
analysis of HCT116 p53.sup.-/- cells treated with TIC10 (2.5, 5, 10
.mu.M) for 72 hr.
[0300] Both pAkt and pERK levels were found to be abolished with
TIC10 treatment in a dose-dependent manner that was accompanied by
dephosphorylation of their respective phosphorylation sites on
Foxo3a. A time course analysis revealed that TIC10-induced
inactivation of Akt and ERK occurred after 48 hours, kinetics that
were concerted with the dephosphorylation of Foxo3a and TRAIL
upregulation. FIG. 60 is an image of Western blot analysis of
HCT116 p53.sup.-/- cells treated with TIC10 (10 .mu.M) for
indicated time periods. FIG. 61 is a graph showing time course of
protein expression levels of TIC10-induced effects determined by
densitometry of Western blots from replicate experiments as in FIG.
60 (n=3). Data is express relative to the control sample for each
time point and normalized to Ran. TRAIL was quantified by flow
cytometry as a parallel experiment (n=3).
[0301] These TIC10-induced effects on Foxo3a were evident in
several cancer cell lines of different tumor types, which include
human cancer cell lines with diverse genetic backgrounds that
harbor oncogenic alterations in p53, KRAS, PTEN and others. FIG. 62
is an image of Western blot analysis of TIC10-induced effects on
Foxo3a in DLD1 human colon cancer cells, MDA-MB-468 human breast
cancer cells, and T98G human glioblastoma multiforme cell lines (10
.mu.M, 72 hr).
[0302] Akt is found to be a determinant of cytotoxic sensitivity to
TIC10 and its TRAIL upregulation, and overactivating Akt can
suppress even basal levels of TRAIL as shown by immunofluorescence
analysis of Foxo3a in HCT116 cells overexpressing an empty vector
or myristilated Akt (myr-Akt) with TIC10 treatment (10 .mu.M, 48
hr). Confirmation of overexpression of myr-Akt by Western blot
analysis is shown in FIG. 63. FIG. 64 is a graph showing flow
cytometry analysis of surface TRAIL in HCT116 cells overexpressing
an empty vector or myristilated Akt (myr-Akt) with TIC10 treatment
(10 .mu.M, 48 hr). FIG. 65 is a graph showing sub-G1 content of
HCT116 cells overexpressing an empty vector or myr-Akt with TIC10
treatment (10 .mu.M, 72 hr, n=3).
[0303] Dual inhibition of the Akt and the MAPK pathways will
cooperatively lead to the nuclear translocation of Foxo3a and
ensuing TRAIL upregulation. A6730 and U0126 monoethanolate are
commercially available and previously described inhibitors of
Akt1/2, Desplat, V. et al., 2008, J. Enz. Inhib. Med. Chem., 23:
648-658, and MEK, Favata, M. F., et al., 1998, J. Biol. Chem.,
273:18623-18632, respectively used in this example to determine if
dual inhibition of the Akt and the MAPK pathways will cooperatively
lead to the nuclear translocation of Foxo3a and ensuing TRAIL
upregulation. The combination of MEK and Akt inhibitors was found
to cooperatively induce Foxo3a-dependent TRAIL upregulation and
synergistically TRAIL-mediated cell death. FIG. 66 is a graph
showing RT-qPCR analysis of TRAIL mRNA in HCT116 p53.sup.-/- cells
following incubation with 10 .mu.M A6730 (Akt inh), U0126
monoethanolate (MEK inh), or both (48 hr, n=3). For Akt+MEK inh,
P<0.05 compared to all other conditions. *P<0.05 between the
indicated condition and control unless otherwise indicated.
[0304] FIG. 67 is a graph showing surface TRAIL induction as in
FIG. 66 with or without stable knockdown of Foxo3a (n=3).
*P<0.05 between the indicated condition and control unless
otherwise indicated.
[0305] FIG. 68 is a graph showing sub-G1 analysis of MDA-MB-231
with or without TRAIL knockdown by shRNA following incubation with
10 .mu.M Akt inh, MEK inh, or both for 48 hr (n=3). *P<0.05
between the indicated condition and control unless otherwise
indicated. FIG. 69 is a graph showing surface TRAIL analysis of
HCT116 p53.sup.-/- cells following incubation with 10 .mu.M A6730
(Akt inh), U0126 monoethanolate (MEK inh), or both (48 hr,
n=3).
[0306] siRNA experiments in this example show that ERK and Akt can
be inhibited to cooperatively upregulate TRAIL. FIG. 70 is a graph
showing RT-qPCR analysis of TRAIL mRNA levels following transient
knockdown of Akt and/or ERK in HCT116 p53.sup.-/- cells at 48 hr
post-knockdown (n=3). For siERK and siAkt combination, P<0.05
compared to all other conditions.
[0307] FIG. 71 is an image showing confirmation of Akt and ERK
knockdown by Western blot analysis. Error bars indicate s.d. of
replicates. FIG. 72 is a graph showing surface TRAIL analysis
following transient knockdown of Akt and/or ERK in HCT116 cells at
48 hr post-knockdown (n=3).
[0308] TIC10 causes a dual inactivation of Akt and ERK, which
cooperatively leads to the nuclear translocation of their mutual
substrate Foxo3a that transcriptionally induces the TRAIL gene as a
unique target gene to potentiate cell death and potent anti-tumor
effects in vivo.
[0309] Any patents or publications mentioned in this specification
are incorporated herein by reference to the same extent as if each
individual publication is specifically and individually indicated
to be incorporated by reference.
[0310] The compositions and methods described herein are presently
representative of preferred aspects, exemplary, and not intended as
limitations on the scope of the invention. Changes therein and
other uses will occur to those skilled in the art. Such changes and
other uses can be made without departing from the scope of the
invention as set forth in the claims.
Sequence CWU 1
1
4121DNAArtificial Sequenceforward primer for TRAIL 1cagaggaaga
agcaacacat t 21228DNAArtificial Sequencereverse primer for TRAIL
2ggttgatgat tcccaggagt ttattttg 28320DNAArtificial Sequenceforward
primer for GAPDH 3ccacatcgct cagacaccat 20426DNAArtificial
Sequencereverse primer for GAPDH 4ggcaacaata tccactttac cagagt
26
* * * * *