U.S. patent application number 15/329228 was filed with the patent office on 2017-07-27 for methods of determining tissues and/or cell types giving rise to cell-free dna, and methods of identifying a disease or disorder using same.
The applicant listed for this patent is UNIVERSITY OF WASHINGTON. Invention is credited to Martin KIRCHER, Jay SHENDURE, Matthew SNYDER.
Application Number | 20170211143 15/329228 |
Document ID | / |
Family ID | 55163988 |
Filed Date | 2017-07-27 |
United States Patent
Application |
20170211143 |
Kind Code |
A1 |
SHENDURE; Jay ; et
al. |
July 27, 2017 |
METHODS OF DETERMINING TISSUES AND/OR CELL TYPES GIVING RISE TO
CELL-FREE DNA, AND METHODS OF IDENTIFYING A DISEASE OR DISORDER
USING SAME
Abstract
The present disclosure provides methods of determining one or
more tissues and/or cell-types contributing to cell-free DNA
("cfDNA") in a biological sample of a subject. In some embodiments,
the present disclosure provides a method of identifying a disease
or disorder in a subject as a function of one or more determined
more tissues and/or cell-types contributing to cfDNA in a
biological sample from the subject.
Inventors: |
SHENDURE; Jay; (Seattle,
WA) ; SNYDER; Matthew; (Seattle, WA) ;
KIRCHER; Martin; (Seattle, WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF WASHINGTON |
Seattle |
WA |
US |
|
|
Family ID: |
55163988 |
Appl. No.: |
15/329228 |
Filed: |
July 27, 2015 |
PCT Filed: |
July 27, 2015 |
PCT NO: |
PCT/US15/42310 |
371 Date: |
January 25, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62029178 |
Jul 25, 2014 |
|
|
|
62087619 |
Dec 4, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G16B 40/00 20190201;
G16B 45/00 20190201; C12Q 1/6881 20130101; C12Q 1/6883 20130101;
G16H 50/20 20180101; G16B 20/00 20190201 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G06F 19/00 20060101 G06F019/00; G06F 19/24 20060101
G06F019/24; G06F 19/26 20060101 G06F019/26; G06F 19/18 20060101
G06F019/18 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under Grant
Nos. 1DP1HG007811 awarded by the National Institutes of Health
(NIH). The government has certain rights in the invention.
Claims
1. A method of determining tissues and/or cell types giving rise to
cell free DNA (cfDNA) in a subject, the method comprising:
isolating cfDNA from a biological sample from the subject, the
isolated cfDNA comprising a plurality of cfDNA fragments;
determining a sequence associated with at least a portion of the
plurality of cfDNA fragments; determining a genomic location within
a reference genome for at least some cfDNA fragment endpoints of
the plurality of cfDNA fragments as a function of the cfDNA
fragment sequences; and determining at least some of the tissues
and/or cell types giving rise to the cfDNA fragments as a function
of the genomic locations of at least some of the cfDNA fragment
endpoints.
2. The method of claim 1 wherein the step of determining at least
some of the tissues and/or cell types giving rise to the cfDNA
fragments comprises comparing the genomic locations of at least
some of the cfDNA fragment endpoints to one or more reference
maps.
3. The method of claim 1 or claim 2 wherein the step of determining
at least some of the tissues and/or cell types giving rise to the
cfDNA fragments comprises performing a mathematical transformation
on a distribution of the genomic locations of at least some of the
cfDNA fragment endpoints.
4. The method of claim 3 wherein the mathematical transformation
includes a Fourier transformation.
5. The method of any one of claims 1 to 4 further comprising
determining a score for each of at least some coordinates of the
reference genome, wherein the score is determined as a function of
at least the plurality of cfDNA fragment endpoints and their
genomic locations, and wherein the step of determining at least
some of the tissues and/or cell types giving rise to the observed
cfDNA fragments comprises comparing the scores to one or more
reference map.
6. The method of claim 5, wherein the score for a coordinate
represents or is related to the probability that the coordinate is
a location of a cfDNA fragment endpoint.
7. The method of any one of claims 2 to 6 wherein the reference map
comprises a DNase I hypersensitive site dataset generated from at
least one cell-type or tissue; or wherein the reference map
comprises an RNA expression dataset generated from at least one
cell-type or tissue; or wherein the reference map comprises a
chromosome conformation map generated from at least one cell-type
or tissue; or wherein the reference map comprises a chromatin
accessibility map generated from at least one cell-type or
tissue.
8. (canceled)
9. The method of any one of claims 2 to 7 wherein the reference map
is generated from cfDNA from an animal to which human tissues or
cells that have been xenografted.
10-11. (canceled)
12. The method of any one of claims 2 to 7 and 9 wherein the
reference map comprises sequence data obtained from samples
obtained from at least one reference subject.
13. The method of any one of claims 2 to 7, 9 and 12 wherein the
reference map corresponds to at least one cell-type or tissue that
is associated with a disease or a disorder or condition.
14. The method of any one of claims 2 to 7, 9, and 12 to 13 wherein
the reference map comprises positions or spacing of nucleosomes
and/or chromatosomes in a tissue or cell type.
15. The method of any one of claims 2 to 7, 9, and 12 to 14 wherein
the reference map is generated by digesting chromatin obtained from
at least one cell-type or tissue with an exogenous nuclease (e.g.,
micrococcal nuclease).
16. The method of any one of claims 2 to 7, 9 and 12 to 15, wherein
the reference maps comprise chromatin accessibility data determined
by a transposition-based method (e.g., ATAC-seq).
17. The method of any one of claims 2 to 7, 9 and 12 to 16 wherein
the reference maps comprise data associated with positions of a DNA
binding and/or DNA occupying protein for a tissue or cell type.
18. The method of claim 17 wherein the DNA binding and/or DNA
occupying protein is a transcription factor.
19. The method of claim 17 or claim 18 wherein the positions are
determined by chromatin immunoprecipitation of a crosslinked
DNA-protein complex.
20. The method of claim 17 or claim 18 wherein the positions are
determined by treating DNA associated with the tissue or cell type
with a nuclease (e.g., DNase-I).
21. The method of any one of claims 2 to 7, 9 and 12 to 20 wherein
the reference map comprises a biological feature related to the
positions or spacing of nucleosomes, chromatosomes, or other DNA
binding or DNA occupying proteins within a tissue or cell type.
22. The method of claim 21 wherein the biological feature is
quantitative expression of one or more genes; or wherein the
biological feature is presence or absence of one or more histone
marks; or wherein the biological feature is hypersensitivity to
nuclease cleavage.
23-24. (canceled)
25. The method of any one of claims 2 to 7, 9, and 12 to 22 wherein
the tissue or cell type used to generate a reference map is a
primary tissue from a subject having a disease or disorder or
condition.
26. The method of claim 25 wherein the disease or disorder or
condition is selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, inflammatory bowel disease, systemic
autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
27. The method of any one of claims 2 to 7, 9 and 12 to 22 wherein
the tissue or cell type used to generate a reference map is a
primary tissue from a healthy subject; or wherein the tissue or
cell type used to generate a reference map is an immortalized cell
line; or wherein the tissue or cell type used to generate a
reference map is a biopsy from a tumor.
28-29. (canceled)
30. The method of claim 12 wherein the sequence data comprises
positions of cfDNA fragment endpoints.
31. The method of claim 30 wherein the reference subject is
healthy; or wherein the reference subject has a disease or disorder
or condition.
32. (canceled)
33. The method of claim 31 wherein the disease or disorder or
condition is selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, inflammatory bowel disease, systemic
autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
34. The method of any one of claims 13 to 22, 25 to 27, 30 to 31
and 33 wherein the reference map comprises reference scores for at
least a portion of coordinates of the reference genome associated
with the tissue or cell type.
35. The method of claim 34 wherein the reference map comprises a
mathematical transformation of the scores.
36. The method of claim 34 wherein the scores represent a subset of
all reference genomic coordinates associated with the tissue or
cell type.
37. The method of claim 36 wherein the subset is associated with
positions or spacing of nucleosomes and/or chromatosomes; or
wherein the subset is associated with transcription start sites
and/or transcription end sites; or wherein the subset is associated
with binding sites of at least one transcription factor; or wherein
the subset is associated with nuclease hypersensitive sites.
38-40. (canceled)
41. The method of any one of claims 36 to 37 wherein the subset is
additionally associated with at least one orthogonal biological
feature.
42. The method of claim 41 wherein the orthogonal biological
feature is associated with high expression genes; or wherein the
orthogonal biological feature is associated with low expression
genes.
43. (canceled)
44. The method of any one of claims 35 to 37 and 41 to 42 wherein
the mathematical transformation includes a Fourier
transformation.
45. The method of any one of claims 5 to 7, 9, 12 to 22, 25 to 27,
30 to 31, 33 to 37, 41 to 42, and 44 wherein at least a subset of
the plurality of the scores each has a score above a threshold
value.
46. The method of any one of claims 1 to 7, 9, 12 to 22, 25 to 27,
30 to 31, 33 to 37, 41 to 42, and 44 to 45 wherein the step of
determining the tissues and/or cell types giving rise to the cfDNA
as a function of a plurality of the genomic locations of at least
some of the cfDNA fragment endpoints comprises comparing a Fourier
transform of the plurality of the genomic locations of at least
some of the cfDNA fragment endpoints, or a mathematical
transformation thereof, with a reference map.
47. The method of any one of claims 1 to 7, 9, 12 to 22, 25 to 27,
30, 31, 33 to 37, 41, 42, and 44 to 46 further comprising
generating a report comprising a list of the determined tissues
and/or cell types giving rise to the isolated cfDNA.
48. A method of identifying or diagnosing a disease or disorder or
condition in a subject, the method comprising: isolating cell free
DNA (cfDNA) from a biological sample from the subject, the isolated
cfDNA comprising a plurality of cfDNA fragments; determining a
sequence associated with at least a portion of the plurality of
cfDNA fragments; determining a genomic location within a reference
genome for at least some cfDNA fragment endpoints of the plurality
of cfDNA fragments as a function of the cfDNA fragment sequences;
optionally determining at least some of the tissues and/or cell
types giving rise to the cfDNA as a function of the genomic
locations of at least some of the cfDNA fragment endpoints; and
identifying or diagnosing the disease or disorder or condition as a
function of the determined tissues and/or cell types giving rise to
the cfDNA.
49. The method of claim 48 wherein the optional step of determining
the tissues and/or cell types giving rise to the cfDNA comprises
comparing the genomic locations of at least some of the cfDNA
fragment endpoints to one or more reference maps.
50. The method of claim 48 or claim 49 wherein the step of
determining the tissues and/or cell types giving rise to the cfDNA
comprises performing a mathematical transformation on a
distribution of the genomic locations of at least some of the
plurality of the cfDNA fragment endpoints.
51. The method of claim 50 wherein the mathematical transformation
includes a Fourier transformation.
52. The method of any one of claims 48 to 51 further comprising
determining a score for each of at least some coordinates of the
reference genome, wherein the score is determined as a function of
at least the plurality of cfDNA fragment endpoints and their
genomic locations.
53. The method of any one of claims 52, 112 and 113, wherein the
score for a coordinate represents or is related to the probability
that the coordinate is a location of a cfDNA fragment endpoint.
54. The method of any one of claims 49 to 53 and 112 to 113 wherein
the reference map comprises a DNase I hypersensitive site dataset,
an RNA expression dataset, expression data, a chromosome
conformation map, a chromatin accessibility map, chromatin
fragmentation map, or sequence data obtained from samples obtained
from at least one reference subject, and corresponding to at least
one cell type or tissue that is associated with a disease or a
disorder or condition, and/or positions or spacing of nucleosomes
and/or chromatosomes in a tissue or cell type.
55. The method of any one of claims 49 to 54 and 112 to 114 wherein
the reference map is generated by digesting chromatin from at least
one cell-type or tissue with an exogenous nuclease (e.g.,
micrococcal nuclease); or wherein the reference map comprises
chromatin accessibility data determined by applying a
transposition-based method (e.g., ATAC-seq) to nuclei or chromatin
from at least one cell-type or tissue.
56. (canceled)
57. The method of any one of claims 49 to 55 and 112 to 114 wherein
the reference maps comprise data associated with positions of a DNA
binding and/or DNA occupying protein for a tissue or cell type.
58. The method of claim 57 wherein the DNA binding and/or DNA
occupying protein is a transcription factor.
59. The method of claim 57 or claim 58 wherein the positions are
determined by applying chromatin immunoprecipitation of a
crosslinked DNA-protein complex to at least one cell-type or
tissue.
60. The method of claim 57 or claim 58 wherein the positions are
determined by treating DNA associated with the tissue or cell type
with a nuclease (e.g., DNase-I).
61. The method of any one of claims 48 to 55, 57 to 60, and 112 to
114 wherein the reference map comprises a biological feature
related to the positions or spacing of nucleosomes, chromatosomes,
or other DNA binding or DNA occupying proteins within a tissue or
cell type.
62. The method of claim 61 wherein the biological feature is
quantitative expression of one or more genes; or wherein the
biological feature is presence or absence of one or more histone
marks; or wherein the biological feature is hypersensitivity to
nuclease cleavage.
63-64. (canceled)
65. The method of any one of claims 49 to 55, 57 to 62 and 112 to
114 wherein the tissue or cell type used to generate a reference
map is a primary tissue from a subject having a disease or disorder
or condition.
66. The method of claim 65 wherein the disease or disorder or
condition is selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, inflammatory bowel disease, systemic
autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
67. The method of any one of claims 49 to 55, 57 to 62, 65, and 112
to 114 wherein the tissue or cell type used to generate a reference
map is a primary tissue from a healthy subject; or wherein the
tissue or cell type used to generate a reference map is an
immortalized cell line; or wherein the tissue or cell type used to
generate a reference map is a biopsy from a tumor.
68-69. (canceled)
70. The method of claim 54 wherein the sequence data obtained from
samples obtained from at least one reference subject comprises
positions of cfDNA fragment endpoints.
71. The method of claim 70 or 114 wherein at least one of the
reference subjects is healthy.
72. The method of claim 70 or 114 wherein at least one of the
reference subjects has a disease or disorder or condition.
73. The method of claim 72 wherein the disease or disorder or
condition is selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, inflammatory bowel disease, systemic
autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
74. The method of any one of claims 54 to 55, 57 to 62, 65 to 67,
70 to 73, and 114 wherein the reference map comprises cfDNA
fragment endpoint probabilities for at least a portion of the
reference genome associated with the tissue or cell type.
75. The method of claim 74 wherein the reference map comprises a
mathematical transformation of the cfDNA fragment endpoint
probabilities.
76. The method of claim 74 wherein the cfDNA fragment endpoint
probabilities represent a subset of all reference genomic
coordinates for the tissue or cell type.
77. The method of claim 76 wherein the subset is associated with
positions or spacing of nucleosomes and/or chromatosomes; wherein
the subset is associated with transcription start sites and/or
transcription end sites; or wherein the subset is associated with
binding sites of at least one transcription factor; or wherein the
subset is associated with nuclease hypersensitive sites.
78-80. (canceled)
81. The method of claim 76 or claim 77 wherein the subset is
additionally associated with at least one orthogonal biological
feature.
82. The method of claim 81 wherein the orthogonal biological
feature is associated with high expression genes; or wherein the
orthogonal biological feature is associated with low expression
genes.
83. (canceled)
84. The method of any one of claims 75 to 77 and 81 to 82 wherein
the mathematical transformation includes a Fourier
transformation.
85. The method of any one of claims 52 to 55, 57 to 62, 65 to 67,
70 to 77, 81 to 82, 84, and 112 to 114 wherein at least a subset of
the plurality of the cfDNA fragment endpoint scores each has a
score above a threshold value.
86. The method of any one of claims 48 to 55, 57 to 62, 65 to 67,
70 to 77, 81 to 82, 84 to 85, and 112 to 114 wherein the step of
determining the tissue(s) and/or cell type(s) giving rise to the
cfDNA as a function of a plurality of the genomic locations of at
least some of the cfDNA fragment endpoints comprises comparing a
Fourier transform of the plurality of the genomic locations of at
least some of the cfDNA fragment endpoints, or a mathematical
transformation thereof, with a reference map.
87. The method of any one of claims 48 to 55, 57 to 62, 65 to 67,
70 to 77, 81 to 82, 84 to 86, and 112 to 114 wherein the reference
map comprises DNA or chromatin fragmentation data corresponding to
at least one tissue that is associated with the disease or disorder
or condition.
88. The method of any one of claims 48 to 55, 57 to 62, 65 to 67,
70 to 77, 81 to 82, 84 to 87, and 112 to 114 wherein the reference
genome is associated with a human.
89. The method of any one of claims 48 to 55, 57 to 62, 65 to 67,
70 to 77, 81 to 82, 84 to 88, and 112 to 114 further comprising
generating a report comprising a statement identifying or
diagnosing the disease or disorder or condition.
90. The method of claim 89 wherein the report further comprises a
list of the determined tissue(s) and/or cell type(s) giving rise to
the isolated cfDNA.
91. The method of any one of claims 1 to 7, 9, 12 to 22, 25 to 27,
30, 31, 33 to 37, 41, 42, 44 to 55, 57 to 62, 65 to 67, 70 to 82,
and 84 to 90 wherein the biological sample comprises, consists
essentially of, or consists of whole blood, peripheral blood
plasma, urine, or cerebral spinal fluid.
92. The method for determining tissues and/or cell types giving
rise to cell-free DNA (cfDNA) in a subject of claim 1, comprising:
(i) generating a fragment endpoint map by obtaining a biological
sample from the subject, isolating the cfDNA from the biological
sample, and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA; (ii)
generating a reference set of fragment endpoint maps by obtaining a
biological sample from control subjects or subjects with known
disease or disorder or condition, isolating the cfDNA from the
biological sample, measuring distributions (a), (b) and/or (c) by
library construction and massively parallel sequencing of cfDNA;
and (iii) determining the tissues and/or cell types giving rise to
the cfDNA by comparing the fragment endpoint map derived from the
cfDNA to the reference set of fragment endpoint maps; wherein (a),
(b) and (c) are: (a) the distribution of likelihoods any specific
base-pair in a human genome will appear at a terminus of a cfDNA
fragment; (b) the distribution of likelihoods that any pair of
base-pairs of a human genome will appear as a pair of termini of a
cfDNA fragment; and (c) the distribution of likelihoods that any
specific base-pair in a human genome will appear in a cfDNA
fragment as a consequence of differential nucleosome occupancy.
93. The method for determining tissues and/or cell types giving
rise to cell-free DNA in a subject of claim 1, comprising: (i)
generating a fragment endpoint map by obtaining a biological sample
from the subject, isolating the cfDNA from the biological sample,
and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA; (ii)
generating a reference set of fragment endpoint maps by obtaining a
biological sample from control subjects or subjects with known
disease or disorder or condition, isolating chromatin from the
biological sample, measuring distributions (a), (b) and/or (c) by
library construction and massively parallel sequencing of DNA
derived from digestion of chromatin; and (iii) determining the
tissues and/or cell types giving rise to the cfDNA by comparing the
nucicosomcfragment endpoint map derived from the cfDNA to the
reference set of nucleosome maps; wherein (a), (b) and (c) are: (a)
the distribution of likelihoods any specific base-pair in a human
genome will appear at a terminus of a sequenced fragment; (b) the
distribution of likelihoods that any pair of base-pairs of a human
genome will appear as a pair of termini of a sequenced fragment;
and (c) the distribution of likelihoods that any specific base-pair
in a human genome will appear in a sequenced fragment as a
consequence of differential nucleosome occupancy.
94. The method for identifying or diagnosing a disease or disorder
or condition in a subject of claim 48, comprising: (i) generating a
fragment endpoint map by obtaining a biological sample from the
subject, isolating cfDNA from the biological sample, and measuring
distributions (a), (b) and/or (c) by library construction and
massively parallel sequencing of cfDNA; (ii) generating a reference
set of fragment endpoint maps by obtaining a biological sample from
control subjects or subjects with known disease or disorder or
condition, isolating the cfDNA from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of cfDNA; and (iii) determining
the clinical condition by comparing the fragment endpoint map
derived from the cfDNA to the reference set of fragment endpoint
maps; wherein (a), (b) and (c) are: (a) the distribution of
likelihoods any specific base-pair in a human genome will appear at
a terminus of a cfDNA fragment; (b) the distribution of likelihoods
that any pair of base-pairs of a human genome will appear as a pair
of termini of a cfDNA fragment; and (c) the distribution of
likelihoods that any specific base-pair in a human genome will
appear in a cfDNA fragment as a consequence of differential
nucleosome occupancy.
95. The method for identifying or diagnosing a disease or disorder
or condition in a subject, comprising (i) generating a fragment
endpoint map by obtaining a biological sample from the subject,
isolating cfDNA from the biological sample, and measuring
distributions (a), (b) and/or (c) by library construction and
massively parallel sequencing of cfDNA; (ii) generating a reference
set of nucleosome maps by obtaining a biological sample from
control subjects or subjects with known disease or disorder or
condition, isolating chromatin from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of DNA derived from digestion of
chromatin; and (iii) determining the tissue-of-origin composition
of the cfDNA by comparing the fragment endpoint map derived from
the cfDNA to the reference set of nucleosome maps; wherein (a), (b)
and (c) are: (a) the distribution of likelihoods any specific
base-pair in a human genome will appear at a terminus of a
sequenced fragment; (b) the distribution of likelihoods that any
pair of base-pairs of a human genome will appear as a pair of
termini of a sequenced fragment; and (c) the distribution of
likelihoods that any specific base-pair in a human genome will
appear in a sequenced fragment as a consequence of differential
nucleosome occupancy.
96. The method of any one of claims 92-95, wherein the fragment
endpoint map of the subject is generated by: purifying the cfDNA
isolated from the biological sample; constructing a library by
adaptor ligation and optionally PCR amplification; and sequencing
at least a portion of the resulting library.
97. The method of claim 92 and 94, wherein at least one of the
reference set of fragment endpoint maps are generated by: purifying
cfDNA isolated from the biological sample from control subjects;
constructing a library by adaptor ligation and optionally PCR
amplification; and sequencing at least a portion of the resulting
library.
98. The method of any one of claims 92-95, wherein distribution
(a), (b) or (c), or a mathematical transformation of one of these
distributions, is subjected to Fourier transformation in contiguous
windows, followed by quantitation of intensities for frequency
ranges that are associated with nucleosome occupancy, in order to
summarize the extent to which nucleosomes exhibit structured
positioning within each contiguous window.
99. The method of any one of claims 92-95, where distribution (a),
(b) or (c), or a mathematical transformation of one of these
distributions, is calculated for a subset of the genome.
100. The method of claim, 99 wherein the subset comprises
coordinates, within the reference genome, that are associated with
the binding of at least one transcription factor in at least one
cell type or tissue, or are associated with DNasel hypersensitive,
or are associated with transcription start sites, or are associated
with topologically associated domains.
101. (canceled)
102. The method of claim 99, wherein the subset is defined by
tissue-specific data e.g. tissue-specific DNase I
hypersensitivity.
103. The method of any one of claims 92-95, further comprising step
of statistical signal processing for comparing additional
nucleosome map(s) to the reference set.
104. The method of any one of claims 92-95, in which the comparison
in (iii) comprises clustering by principal components analysis
(PCA) or by hierarchical clustering.
105. The method of claim 94 or claim 95 wherein the disease or
disorder or condition is selected from the group consisting of:
cancer, normal pregnancy, a complication of pregnancy (e.g.,
aneuploidy pregnancy), myocardial infarction, inflammatory bowel
disease, systemic autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
106. The method of claim 105, wherein the biological sample
comprises, consists essentially of, or consists of whole blood,
peripheral blood plasma, urine, or cerebral spinal fluid.
107. (canceled)
108. The method of any one of claims 1 to 7, 9, 12 to 22, 25 to 27,
30, 31, 33 to 37, 41, 42, 44 to 55, 57 to 62, 65 to 67, 70 to 82,
84 to 100, 102 to 106, and 112 to 114 further comprising assigning
a proportion to each of the one or more tissues or cell types
determined to be contributing to cfDNA.
109. The method of claim 108 wherein the proportion assigned to
each of the one or more determined tissues or cell types is based
at least in part on the absolute magnitude of correlation, or on
the change in correlation relative to cfDNA from a healthy subject
or subjects.
110. The method of claim 108 or claim 109, wherein the correlation
is based at least in part on a comparison of a mathematical
transformation of the distribution of cfDNA fragment endpoints from
the biological sample with the reference map associated with the
determined tissue or cell type.
111. The method of claims 108 to 110, wherein the proportion
assigned to each of the one or more determined tissues or cell
types is based on a mixture model.
112. The method of any one of claims 48 to 52 wherein the step of
identifying or diagnosing the disease or disorder or condition
comprises comparing the scores to one or more reference map.
113. The method of any one of claims 48 to 52 and 112 wherein the
step of determining at least some of the tissues and/or cell types
giving rise to the observed cfDNA fragments comprises comparing the
scores to one or more reference map.
114. The method of any one of claims 49 to 53 and 112 to 113
wherein the reference map comprises sequence data obtained from
samples obtained from at least one reference subject.
115. The method of any one of claims 92-95, where distribution (a),
(b), or (c), or a mathematical transformation of one of these
distributions, is calculated for a subset of the genome.
Description
PRIORITY CLAIM
[0001] This application claims priority to U.S. Provisional
Application No. 62/029,178, filed Jul. 25, 2014, and 62/087,619,
filed Dec. 4, 2014, the subject matter of each of which is hereby
incorporated by reference as if fully set forth herein.
TECHNICAL FIELD
[0003] The present disclosure relates to methods of determining one
or more tissues and/or cell-types giving rise to cell-free DNA. In
some embodiments, the present disclosure provides a method of
identifying a disease or disorder in a subject as a function of one
or more determined tissues and/or cell-types associated with
cell-free DNA in a biological sample from the subject.
BACKGROUND
[0004] Cell-free DNA ("cfDNA") is present in the circulating
plasma, urine, and other bodily fluids of humans. The cfDNA
comprises double-stranded DNA fragments that are relatively short
(overwhelmingly less than 200 base-pairs) and are normally at a low
concentration (e.g. 1-100 ng/mL in plasma). In the circulating
plasma of healthy individuals, cfDNA is believed to primarily
derive from apoptosis of blood cells (i.e., normal cells of the
hematopoietic lineage). However, in specific situations, other
tissues can contribute substantially to the composition of cfDNA in
bodily fluids such as circulating plasma.
[0005] While cfDNA has been used in certain specialties (e.g.,
reproductive medicine, cancer diagnostics, and transplant
medicine), existing tests based on cfDNA rely on differences in
genotypes (e.g., primary sequence or copy number representation of
a particular sequence) between two or more cell populations (e.g.,
maternal genome vs. fetal genome; normal genome vs. cancer genome;
transplant recipient genome vs. donor genome, etc.). Unfortunately,
because the overwhelming majority of cfDNA fragments found in any
given biological sample derive from regions of the genome that are
identical in sequence between the contributing cell populations,
existing cfDNA-based tests are extremely limited in their scope of
application. In addition, many diseases and disorders are
accompanied by changes in the tissues and/or cell-types giving rise
to cfDNA, for example from tissue damage or inflammatory processes
associated with the disease or disorder. Existing cfDNA-based
diagnostic tests relying on differences in primary sequence or copy
number representation of particular sequences between two genomes
cannot detect such changes. Thus, while the potential for cfDNA to
provide powerful biopsy-free diagnostic methods is enormous, there
still remains a need for cfDNA-based diagnostic methodologies that
can be applied to diagnose a wide variety of diseases and
disorders.
SUMMARY
[0006] The present disclosure provides methods of determining one
or more tissues and/or cell-types giving rise to cell-free DNA
("cfDNA") in a biological sample of a subject. In some embodiments,
the present disclosure provides a method of identifying a disease
or disorder in a subject as a function of one or more determined
tissues and/or cell-types associated with cfDNA in a biological
sample from the subject.
[0007] In some embodiments, the present disclosure provides a
method of determining tissues and/or cell types giving rise to
cell-free DNA (cfDNA) in a subject, the method comprising isolating
cfDNA from a biological sample from the subject, the isolated cfDNA
comprising a plurality of cfDNA fragments; determining a sequence
associated with at least a portion of the plurality of cfDNA
fragments; determining a genomic location within a reference genome
for at least some cfDNA fragment endpoints of the plurality of
cfDNA fragments as a function of the cfDNA fragment sequences; and
determining at least some of the tissues and/or cell types giving
rise to the cfDNA fragments as a function of the genomic locations
of at least some of the cfDNA fragment endpoints.
[0008] In other embodiments, the present disclosure provides a
method of identifying a disease or disorder in a subject, the
method comprising isolating cell-free DNA (cfDNA) from a biological
sample from the subject, the isolated cfDNA comprising a plurality
of cfDNA fragments; determining a sequence associated with at least
a portion of the plurality of cfDNA fragments; determining a
genomic location within a reference genome for at least some cfDNA
fragment endpoints of the plurality of cfDNA fragments as a
function of the cfDNA fragment sequences; determining at least some
of the tissues and/or cell types giving rise to the cfDNA as a
function of the genomic locations of at least some of the cfDNA
fragment endpoints; and identifying the disease or disorder as a
function of the determined tissues and/or cell types giving rise to
the cfDNA.
[0009] In other embodiments, the present disclosure provides a
method for determining tissues and/or cell types giving rise to
cell-free DNA (cfDNA) in a subject, the method comprising: (i)
generating a nucleosome map by obtaining a biological sample from
the subject, isolating the cfDNA from the biological sample, and
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of cfDNA; (ii) generating a
reference set of nucleosome maps by obtaining a biological sample
from control subjects or subjects with known disease, isolating the
cfDNA from the biological sample, measuring distributions (a), (b)
and/or (c) by library construction and massively parallel
sequencing of cfDNA; and (iii) determining tissues and/or cell
types giving rise to the cfDNA from the biological sample by
comparing the nucleosome map derived from the cfDNA from the
biological sample to the reference set of nucleosome maps; wherein
(a), (b) and (c) are: (a) the distribution of likelihoods any
specific base-pair in a human genome will appear at a terminus of a
cfDNA fragment; (b) the distribution of likelihoods that any pair
of base-pairs of a human genome will appear as a pair of termini of
a cfDNA fragment; and (c) the distribution of likelihoods that any
specific base-pair in a human genome will appear in a cfDNA
fragment as a consequence of differential nucleosome occupancy.
[0010] In yet other embodiments, the present disclosure provides a
method for determining tissues and/or cell types giving rise to
cfDNA in a subject, the method comprising: (i) generating a
nucleosome map by obtaining a biological sample from the subject,
isolating the cfDNA from the biological sample, and measuring
distributions (a), (b) and/or (c) by library construction and
massively parallel sequencing of cfDNA; (ii) generating a reference
set of nucleosome maps by obtaining a biological sample from
control subjects or subjects with known disease, isolating the
cfDNA from the biological sample, measuring distributions (a), (b)
and/or (c) by library construction and massively parallel
sequencing of DNA derived from fragmentation of chromatin with an
enzyme such as micrococcal nuclease, DNase, or transposase; and
(iii) determining tissues and/or cell types giving rise to the
cfDNA from the biological sample by comparing the nucleosome map
derived from the cfDNA from the biological sample to the reference
set of nucleosome maps; wherein (a), (b) and (c) are: (a) the
distribution of likelihoods any specific base-pair in a human
genome will appear at a terminus of a sequenced fragment; (b) the
distribution of likelihoods that any pair of base-pairs of a human
genome will appear as a pair of termini of a sequenced fragment;
and (c) the distribution of likelihoods that any specific base-pair
in a human genome will appear in a sequenced fragment as a
consequence of differential nucleosome occupancy.
[0011] In other embodiments, the present disclosure provides a
method for diagnosing a clinical condition in a subject, the method
comprising: (i) generating a nucleosome map by obtaining a
biological sample from the subject, isolating cfDNA from the
biological sample, and measuring distributions (a), (b) and/or (c)
by library construction and massively parallel sequencing of cfDNA;
(ii) generating a reference set of nucleosome maps by obtaining a
biological sample from control subjects or subjects with known
disease, isolating the cfDNA from the biological sample, measuring
distributions (a), (b) and/or (c) by library construction and
massively parallel sequencing of cfDNA; and (iii) determining the
clinical condition by comparing the nucleosome map derived from the
cfDNA from the biological sample to the reference set of nucleosome
maps; wherein (a), (b) and (c) are: (a) the distribution of
likelihoods any specific base-pair in a human genome will appear at
a terminus of a cfDNA fragment; (b) the distribution of likelihoods
that any pair of base-pairs of a human genome will appear as a pair
of termini of a cfDNA fragment; and (c) the distribution of
likelihoods that any specific base-pair in a human genome will
appear in a cfDNA fragment as a consequence of differential
nucleosome occupancy.
[0012] In other embodiments, the present disclosure provides a
method for diagnosing a clinical condition in a subject, the method
comprising (i) generating a nucleosome map by obtaining a
biological sample from the subject, isolating cfDNA from the
biological sample, and measuring distributions (a), (b) and/or (c)
by library construction and massively parallel sequencing of cfDNA;
(ii) generating a reference set of nucleosome maps by obtaining a
biological sample from control subjects or subjects with known
disease, isolating the cfDNA from the biological sample, measuring
distributions (a), (b) and/or (c) by library construction and
massively parallel sequencing of DNA derived from fragmentation of
chromatin with an enzyme such as micrococcal nuclease (MNase),
DNase, or transposase; and (iii) determining the tissue-of-origin
composition of the cfDNA from the biological sample by comparing
the nucleosome map derived from the cfDNA from the biological
sample to the reference set of nucleosome maps; wherein (a), (b)
and (c) are: (a) the distribution of likelihoods any specific
base-pair in a human genome will appear at a terminus of a
sequenced fragment; (b) the distribution of likelihoods that any
pair of base-pairs of a human genome will appear as a pair of
termini of a sequenced fragment; and (c) the distribution of
likelihoods that any specific base-pair in a human genome will
appear in a sequenced fragment as a consequence of differential
nucleosome occupancy.
[0013] These and other embodiments are described in greater detail
below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 shows three types of information that relate cfDNA
fragmentation patterns to nucleosome occupancy, exemplified for a
small genomic region. These same types of information might also
arise through fragmentation of chromatin with an enzyme such as
micrococcal nuclease (MNase), DNase, or transposase. FIG. 1A shows
the distribution of likelihoods any specific base-pair in a human
genome will appear at a terminus of a sequenced fragment (i.e.
points of fragmentation); FIG. 1B shows the distribution of
likelihoods that any pair of base-pairs of a human genome will
appear as a pair of termini of a sequenced fragment (i.e.
consecutive pairs of fragmentation points that give rise to an
individual molecule); and FIG. 1C shows the distribution of
likelihoods that any specific base-pair in a human genome will
appear within a sequenced fragment (i.e. relative coverage) as a
consequence of differential nucleosome occupancy.
[0015] FIG. 2 shows insert size distribution of a typical cfDNA
sequencing library; here shown for the pooled cfDNA sample derived
from human plasma containing contributions from an unknown number
of healthy individuals (bulk.cfDNA).
[0016] FIG. 3A shows average periodogram intensities from Fast
Fourier Transformation (FFT) of read start coordinates mapping to
the first (chr1) human autosome across all cfDNA samples (Plasma),
cfDNA from tumor patient samples (Tumor), cfDNA from pregnant
female individuals (Pregnancy), MNase of human different human cell
lines (Cell lines) and a human DNA shotgun sequencing library
(Shotgun).
[0017] FIG. 3B shows average periodogram intensities from Fast
Fourier Transformation (FFT) of read start coordinates mapping to
the last (chr22) human autosome across all cfDNA samples (Plasma),
cfDNA from tumor patient samples (Tumor), cfDNA from pregnant
female individuals (Pregnancy), MNase of human different human cell
lines (Cell lines) and a human DNA shotgun sequencing library
(Shotgun).
[0018] FIG. 4 shows first three principal components (PC) of
intensities at 196 base-pairs (bp) periodicity in 10 kilobase-pair
(kbp) blocks across all autosomes: FIG. 4A shows PC 2 vs. PC 1;
FIG. 4B shows PC 3 vs. PC 2.
[0019] FIG. 5 shows hierarchical clustering dendogram of Euclidean
distances of intensities measured at 196 bp periodicity in 10 kbp
blocks across all autosomes.
[0020] FIG. 6 shows first three principal components of intensities
at 181 bp to 202 bp periodicity in 10 kbp blocks across all
autosomes: FIG. 6A shows PC 2 vs. PC 1; FIG. 6B shows PC3 vs. PC
2.
[0021] FIG. 7 shows hierarchical clustering dendogram of Euclidean
distances of intensities measured at 181 bp to 202 bp periodicity
in 10 kbp blocks across all autosomes.
[0022] FIG. 8 shows principal component analysis (first 7 of 10
PCs) of intensities at 181 bp to 202 bp periodicity in 10 kbp
blocks across all autosomes for the cfDNA data sets: FIG. 8A shows
PC 2 vs. PC 1; FIG. 8B shows PC 3 vs. PC 2; FIG. 8C shows PC 4 vs.
PC 3; FIG. 8D shows PC 5 vs. PC 4; FIG. 8E shows PC 6 vs. PC 5;
FIG. 8F shows PC 7 vs. PC 6.
[0023] FIG. 9 shows principal component analysis of intensities at
181 bp to 202 bp periodicity in 10 kbp blocks across all autosomes
for the MNase data sets: FIG. 9A shows PC 2 vs. PC 1; FIG. 9B shows
PC 3 vs. PC 2; FIG. 9C shows PC 4 vs. PC 3; FIG. 9D shows PC 5 vs.
PC 4; FIG. 9E shows PC 6 vs. PC 5.
[0024] FIG. 10 shows average periodogram intensities for a
representative human autosome (chr11) across all synthetic cfDNA
and MNase data set mixtures:
[0025] FIG. 11 shows first two principal components of intensities
at 181 bp to 202 bp periodicity in 10 kbp blocks across all
autosomes for the synthetic MNase data set mixtures.
[0026] FIG. 12 shows first two principal components of intensities
at 181 bp to 202 bp periodicity in 10 kbp blocks across all
autosomes for the synthetic cfDNA data set mixtures.
[0027] FIG. 13 shows hierarchical clustering dendogram of Euclidean
distances of intensities at 181 bp to 202 bp periodicity in 10 kbp
blocks across all autosomes for the synthetic MNase and cfDNA
mixture data sets.
[0028] FIG. 14 shows read-start density in 1 kbp window around
23,666 CTCF binding sites for a set of samples with at least 100M
reads.
[0029] FIG. 15 shows read-start density in 1 kbp window around
5,644 c-Jun binding sites for a set of samples with at least 100M
reads.
[0030] FIG. 16 shows read-start density for 1 kbp window around
4,417 NF-YB binding sites for a set of samples with at least 100M
reads.
[0031] FIG. 17 shows a schematic overview of the processes giving
rise to cfDNA fragments. Apoptotic and/or necrotic cell death
results in near-complete digestion of native chromatin.
Protein-bound DNA fragments, typically associated with histones or
transcription factors, preferentially survive digestion and are
released into the circulation, while naked DNA is lost. Fragments
can be recovered from peripheral blood plasma following proteinase
treatment. In healthy individuals, cfDNA is primarily derived from
myeloid and lymphoid cell lineages, but contributions from one or
more additional tissues may be present in certain medical
conditions.
[0032] FIG. 18 shows fragment length of cfDNA observed with
conventional sequencing library preparation. Length is inferred
from alignment of paired-end sequencing reads. A reproducible peak
in fragment length at 167 base-pairs (bp) (green dashed line) is
consistent with association with chromatosomes. Additional peaks
evidence .about.10.4 bp periodicity, corresponding to the helical
pitch of DNA on the nucleosome core. Enzymatic end-repair during
library preparation removes 5' and 3' overhangs and may obscure
true cleavage sites.
[0033] FIG. 19 shows a dinucleotide composition of 167 bp fragments
and flanking genomic sequence in conventional libraries. Observed
dinucleotide frequencies in the BH01 library were compared to
expected frequencies from simulated fragments (matching for
endpoint biases resulting from both cleavage and adapter ligation
preferences).
[0034] FIG. 20 shows a schematic of a single-stranded library
preparation protocol for cfDNA fragments.
[0035] FIG. 21 shows fragment length of cfDNA observed with
single-stranded sequencing library preparation. No enzymatic
end-repair is performed to template molecules during library
preparation. Short fragments of 50-120 bp are highly enriched
compared to conventional libraries. While .about.10.4 bp
periodicity remains, its phase is shifted by .about.3 bp.
[0036] FIG. 22 shows a dinucleotide composition of 167 bp fragments
and flanking genomic sequence in single-stranded libraries.
Observed dinucleotide frequencies in the IH02 library were compared
to expected frequencies derived from simulated fragments, again
matching for endpoint biases. The apparent difference in the
background level of bias between BH01 and IH02 relate to
differences between the simulations, rather than the real libraries
(data not shown).
[0037] FIG. 23A shows a gel image of representative cfDNA
sequencing library prepared with the conventional protocol.
[0038] FIG. 23B shows a gel image of a representative cfDNA
sequencing library prepared with the single-stranded protocol.
[0039] FIG. 24A shows mononucleotide cleavage biases of cfDNA
fragments.
[0040] FIG. 24B shows dinucleotide cleavage biases of cfDNA
fragments.
[0041] FIG. 25 shows a schematic overview of inference of
nucleosome positioning. A per-base windowed protection score (WPS)
is calculated by subtracting the number of fragment endpoints
within a 120 bp window from the number of fragments completely
spanning the window. High WPS values indicate increased protection
of DNA from digestion; low values indicate that DNA is unprotected.
Peak calls identify contiguous regions of elevated WPS.
[0042] FIG. 26 shows strongly positioned nucleosomes at a
well-studied alpha-satellite array. Coverage, fragment endpoints,
and WPS values from sample CH01 are shown for long fragment (120 bp
window; 120-180 bp reads) or short fragment (16 bp window; 35-80 bp
reads) bins at a pericentromeric locus on chromosome 12. Nucleosome
calls from CH01 (middle, blue boxes) are regularly spaced across
the locus. Nucleosome calls based on MNase digestion from two
published studies (middle, purple and black boxes) are also
displayed. The locus overlaps with an annotated alpha-satellite
array.
[0043] FIG. 27 shows inferred nucleosome positioning around a DNase
I hypersensitive site (DHS) on chromosome 9. Coverage, fragment
endpoints, and WPS values from sample CH01 are shown for long and
short fragment bins. The hypersensitive region, highlighted in
gray, is marked by reduced coverage in the long fragment bin.
Nucleosome calls from CH01 (middle, blue boxes) adjacent to the DHS
are spaced more widely than typical adjacent pairs, consistent with
accessibility of the intervening sequence to regulatory proteins
including transcription factors. Coverage of shorter fragments,
which may be associated with such proteins, is increased at the
DHS, which overlaps with several annotated transcription factor
binding sites (not shown). Nucleosome calls based on MNase
digestion from two published studies are shown as in FIG. 26.
[0044] FIG. 28 shows a schematic of peak calling and scoring
according to one embodiment of the present disclosure.
[0045] FIG. 29 shows CH01 peak density by GC content.
[0046] FIG. 30 shows a histogram of distances between adjacent
peaks by sample. Distances are measured from peak call to adjacent
call.
[0047] FIG. 31 shows a comparison of peak calls between samples.
For each pair of samples, the distances between each peak call in
the sample with fewer peaks and the nearest peak call in the other
sample are calculated and visualized as a histogram with bin size
of 1. Negative numbers indicate the nearest peak is upstream;
positive numbers indicate the nearest peak is downstream.
[0048] FIG. 32 shows a comparison of peak calls between samples:
FIG. 32A shows IH01 vs. BH01; FIG. 32B shows IH02 vs. BH01; FIG.
32C shows IH02 vs. IH01.
[0049] FIG. 33A shows nucleosome scores for real vs. simulated
peaks.
[0050] FIG. 33B shows median peak offset within a score bin as a
function of the score bin (left y-axis), and the number of peaks in
each score bin (right y-axis).
[0051] FIG. 34 shows a comparison of peak calls between samples and
matched simulations: FIG. 34A shows BH01 simulation vs. BH01
actual; FIG. 34B shows IH01 simulation vs. IH01 actual; FIG. 34C
shows IH02 simulation vs. IH01 actual.
[0052] FIG. 35 shows distances between adjacent peaks, sample CH01.
The dotted black line indicates the mode of the distribution (185
bp).
[0053] FIG. 36 shows aggregate, adjusted windowed protection scores
(WPS; 120 bp window) around 22,626 transcription start sites (TSS).
TSS are aligned at the 0 position after adjusting for strand and
direction of transcription. Aggregate WPS is tabulated for both
real data and simulated data by summing per-TSS WPS at each
position relative to the centered TSS. The values plotted represent
the difference between the real and simulated aggregate WPS,
further adjusted to local background as described in greater detail
below. Higher WPS values indicate preferential protection from
cleavage.
[0054] FIG. 37 shows aggregate, adjusted WPS around 22,626 start
codons.
[0055] FIG. 38 shows aggregate, adjusted WPS around 224,910 splice
donor sites.
[0056] FIG. 39 shows aggregate, adjusted WPS around 224,910 splice
acceptor sites.
[0057] FIG. 40 shows aggregate, adjusted WPS around various genic
features with data from CH01, including for real data, matched
simulation, and their difference.
[0058] FIG. 41 shows nucleosome spacing in NB compartments. Median
nucleosome spacing in non-overlapping 100 kilobase (kb) bins, each
containing .about.500 nucleosome calls, is calculated genome-wide.
A/B compartment predictions for GM12878, also with 100 kb
resolution, are from published sources. Compartment A is associated
with open chromatin and compartment B with closed chromatin.
[0059] FIG. 42 shows nucleosome spacing and A/B compartments on
chromosomes 7 and 11. A/B segmentation (red and blue bars) largely
recapitulates chromosomal G-banding (ideograms, gray bars). Median
nucleosome spacing (black dots) is calculated in 100 kb bins and
plotted above the NB segmentation.
[0060] FIG. 43 shows aggregate, adjusted WPS for 93,550 CTCF sites
for the long (top) and short (bottom) fractions.
[0061] FIG. 44 shows a zoomed-in view of the aggregate, adjusted
WPS for short fraction cfDNA at CTCF sites. The light red bar (and
corresponding shading within the plot) indicate the position of the
known 52 bp CTCF binding motif. The dark red subsection of this bar
indicates the location of the 17 bp motif used for the FIMO motif
search.
[0062] FIG. 45 shows -1 to +1 nucleosome spacing calculated around
CTCF sites derived from clustered FIMO predicted CTCF sites (purely
motif-based: 518,632 sites), a subset of these predictions
overlapping with ENCODE ChIP-seq peaks (93,530 sites), and a
further subset that have been experimentally observed to be active
across 19 cell lines (23,723 sites). The least stringent set of
CTCF sites are predominantly separated by distances that are
approximately the same as the genome-wide average (.about.190 bp).
However, at the highest stringency, most CTCF sites are separated
by a much wider distance (.about.260 bp), consistent with active
CTCF binding and repositioning of adjacent nucleosomes.
[0063] FIGS. 46-48 show CTCF occupancy repositions flanking
nucleosomes: FIG. 46 shows inter-peak distances for the three
closest upstream and three closest downstream peak calls for
518,632 CTCF binding sites predicted by FIMO. FIG. 47 shows
inter-peak distances for the three closest upstream and three
closest downstream peak calls for 518,632 CTCF binding sites
predicted by FIMO as in FIG. 46, but where the same set of CTCF
sites has been filtered based on overlap with ENCODE ChIP-seq
peaks, leaving 93,530 sites. FIG. 48 shows inter-peak distances for
the three closest upstream and three closest downstream peak calls
for 93,530 CTCF binding sites predicted by FIMO as in FIG. 47, but
where the set of CTCF sites has been filtered based on overlap with
the set of active CTCF sites experimentally observed across 19 cell
lines, leaving 23,732 sites.
[0064] FIG. 49 shows, for the subset of putative CTCF sites with
flanking nucleosomes spaced widely (230-270 bp), that both the long
(top) and short (bottom) fractions exhibit a stronger signal of
positioning with increasingly stringent subsets of CTCF sites. See
FIG. 45 for key defining colored lines.
[0065] FIGS. 50-52 show CTCF occupancy repositions flanking
nucleosomes: FIG. 50 shows mean short fraction WPS (top panel) and
mean long fraction WPS (bottom panel) for the 518,632 sites,
partitioned into distance bins denoting the number of base-pairs
separating the flanking +1 and -1 nucleosome calls for each site.
FIG. 51 shows mean short fraction WPS (top panel) and mean long
fraction WPS (bottom panel) for the 518,632 sites of FIG. 50, but
where the same set of CTCF sites has been filtered based on overlap
with ENCODE ChIP-seq peaks. FIG. 52 shows mean short fraction WPS
(top panel) and mean long fraction WPS (bottom panel) for the sites
of FIG. 51, but where the same set of sites has been further
filtered based on overlap with the set of active CTCF sites
experimentally observed across 19 cell lines. Key defining colored
lines for FIG. 50 is the same as in FIG. 51 and FIG. 52.
[0066] FIGS. 53A-H show footprints of transcription factor binding
sites from short and long cfDNA fragments. Clustered FIMO binding
sites predictions were intersected with ENCODE ChIP-seq data to
obtain a confident set of transcription factor (TF) binding sites
for a set of additional factors. Aggregate, adjusted WPS for
regions flanking the resulting sets of TF binding sites is
displayed for both the long and short fractions of cfDNA fragments.
Higher WPS values indicate higher likelihood of nucleosome or TF
occupancy, respectively. FIG. 53A: AP-2; FIG. 53B: E2F-2; FIG. 53C:
EBOX-TF; FIG. 53D: IRF; FIG. 53E: MYC-MAX; FIG. 53F: PAX5-2; FIG.
53G: RUNX-AML; FIG. 53H: YY1.
[0067] FIG. 54 shows aggregate, adjusted WPS for transcription
factor ETS (210,798 sites). WPS calculated from both long (top) and
short (bottom) cfDNA fractions are shown. Signal consistent with TF
protection at the binding site itself (short fraction) with
organization of the surrounding nucleosomes (long fraction) is
observed. Similar analyses for additional TFs are shown in FIGS.
53A-H.
[0068] FIG. 55 shows aggregate, adjusted WPS for transcription
factor MAFK (32,159 sites). WPS calculated from both long (top) and
short (bottom) cfDNA fractions are shown. Signal consistent with TF
protection at the binding site itself (short fraction) with
organization of the surrounding nucleosomes (long fraction) is
observed. Similar analyses for additional TFs are shown in FIGS.
53A-H.
[0069] FIG. 56 shows the inference of mixtures of cell-types
contributing to cell-free DNA based on DNase hypersensitivity (DHS)
sites. The frequency distribution of peak-to-peak spacing of
nucleosome calls at DHS sites from 116 diverse biological samples
shows a bimodal distribution, with the second mode plausibly
corresponding to widened nucleosome spacing at active DHS sites due
to intervening transcription factor binding (.about.190
bp.fwdarw.260 bp). DHS sites identified in lymphoid or myeloid
samples have the largest proportions of DHS sites with widened
nucleosome spacing, consistent with hematopoietic cell death as the
dominant source of cfDNA in healthy individuals.
[0070] FIG. 57 shows how partitioning of adjusted WPS scores around
transcriptional start sites (TSS) into five gene expression bins
(quintiles) defined for NB-4 (an acute promyelocytic leukemia cell
line) reveals differences in the spacing and placement of
nucleosomes. Highly expressed genes show a strong phasing of
nucleosomes within the transcript body. Upstream of the TSS, -1
nucleosomes are well-positioned across expression bins, but -2 and
-3 nucleosomes are only well-positioned for medium to highly
expressed genes.
[0071] FIG. 58 shows that, for medium to highly expressed genes, a
short fragment peak is observed between the TSS and the -1
nucleosome, consistent with footprinting of the transcription
preinitiation complex, or some component thereof, at
transcriptionally active genes.
[0072] FIG. 59 shows that median nucleosome distance in the
transcript body is negatively correlated with gene expression as
measured for the NB-4 cell line (.rho.=-0.17, n=19,677 genes).
Genes with little-to-no expression show a median nucleosome
distance of 193 bp, while for expressed genes, this ranges between
186-193 bp. This negative correlation is stronger when more
nucleosome calls are used to determine a more precise median
distance (e.g. requiring at least 60 nucleosomes, .rho.=-0.50;
n=12,344 genes).
[0073] FIG. 60 shows how, to deconvolve multiple contributions,
fast Fourier transformation (FFT) was used to quantify the
abundance of specific frequency contributions (intensities) in the
long fragment WPS for the first 10 kb of gene bodies starting at
each TSS. Shown are trajectories of correlation between RNA
expression in 76 cell lines and primary tissues with these
intensities at different frequencies. Marked with a bold black line
is the NB-4 cell line. Correlations are strongest in magnitude for
intensities in the 193-199 bp frequency range.
[0074] FIG. 61 shows the inference of cell-types contributing to
cell-free DNA in healthy states and cancer. The top panel shows the
ranks of correlation for 76 RNA expression datasets with average
intensity in the 193-199 bp frequency range for various cfDNA
libraries, categorized by type and listed from highest rank (top
rows) to lowest rank (bottom rows). Correlation values and full
cell line or tissue names are provided in Table 3. All of the
strongest correlations for all three healthy samples (BH01, IH01
and IH02; first three columns) are with lymphoid and myeloid cell
lines as well as bone marrow. In contrast, cfDNA samples obtained
from stage IV cancer patients (IC15, IC17, IC20, IC35, IC37; last
five columns) show top correlations with various cancer cell lines,
e.g. IC17 (hepatocellular carcinoma, HCC) showing highest
correlations with HepG2 (hepatocellular carcinoma cell line), and
IC35 (breast ductal carcinoma, DC) with MCF7 (metastatic breast
adenocarcinoma cell line). When comparing cell line/tissue ranks
observed for the cancer samples to each of the three healthy
samples and averaging the rank changes (bottom panel), maximum rank
changes are more than 2.times. higher than those observed from
comparing the three healthy samples with each other and averaging
rank changes (`Control`). For example, for IC15 (small cell lung
carcinoma, SCLC) the rank of SCLC-21H (small cell lung carcinoma
cell line) increased by an average of 31 positions, for IC20
(squamous cell lung carcinoma, SCC) SK-BR-3 (metastatic breast
adenocarcinoma cell line) increased by an average rank of 21, and
for IC37 (colorectal adenocarcinoma, AC) HepG2 increased by 24
ranks.
[0075] FIG. 62 shows quantitation of aneuploidy to select samples
with high burden of circulating tumor DNA, based on coverage (FIG.
62A) or allele balance (FIG. 62B). FIG. 62A shows the sums of Z
scores for each chromosome calculated based on observed vs.
expected numbers of sequencing reads for each sample (black dots)
compared to simulated samples that assume no aneuploidy (red dots).
FIG. 62B shows the allele balance at each of 48,800 common SNPs,
evaluated per chromosome, for a subset of samples that were
selected for additional sequencing.
[0076] FIG. 63 shows a comparison of peak calls to published
nucleosome call sets: FIG. 63A shows the distance between
nucleosome peak calls across three published data sets (Gaffney et
al. 2012, J. S. Pedersen et al. 2014, and A Schep et al. 2015) as
well as the calls generated here, including the matched simulation
of CA01. Previously published data sets do not show one defined
mode at the canonical .about.185 bp nucleosome distance, probably
due to their sparse sampling or wide call ranges. In contrast, all
the nucleosome calls from cfDNA show one well-defined mode. The
matched simulated data set has shorter mode (166 bp) and a wider
distribution. Further, the higher the coverage of the cfDNA data
set used to generate calls, the higher the proportion of calls
represented by the mode of the distribution. FIG. 63B shows the
number of nucleosomes for each of the same list of sets as FIG.
63A. The cfDNA nucleosome calls present the most comprehensive call
set with nearly 13M nucleosome peak calls. FIG. 63C shows the
distances between each peak call in the IH01 cfDNA sample and the
nearest peak call from three previously published data sets. FIG.
63D shows the distances between each peak call in the IH02 cfDNA
sample and the nearest peak call from three previously published
data sets. FIG. 63E shows the distances between each peak call in
the BH01 cfDNA sample and the nearest peak call from three
previously published data sets. FIG. 63F shows the distances
between each peak call in the CH01 cfDNA sample and the nearest
peak call from three previously published data sets. FIG. 63G shows
the distances between each peak call in the CA01 cfDNA sample and
the nearest peak call from three previously published data sets.
Negative numbers indicate the nearest peak is upstream; positive
numbers indicate the nearest peak is downstream. With increased
cfDNA coverage, a higher proportion of previously published calls
are found in closer proximity to the determined nucleosome call.
Highest concordance was found with calls generated by Gaffney et
al., PLoS Genet., vol. 8, e1003036 (2012) and A Schep et al.
(2015). FIG. 63H shows the distances between each peak call and the
nearest peak call from three previously published data sets, but
this time for the matched simulation of CA01. The closest real
nucleosome positions tend to be away from the peaks called in the
simulation for the Gaffney et al., PLoS Genet., vol. 8, e1003036
(2012) and JS Pedersen et al., Genome Research, vol. 24, pp.
454-466 (2014) calls. Calls generated by A Schep et al. (2015) seem
to show some overlap with the simulated calls.
DETAILED DESCRIPTION
[0077] The present disclosure provides methods of determining one
or more tissues and/or cell-types giving rise to cell-free DNA in a
subject's biological sample. In some embodiments, the present
disclosure provides a method of identifying a disease or disorder
in a subject as a function of one or more determined tissues and/or
cell-types associated with cfDNA in a biological sample from the
subject.
[0078] The present disclosure is based on a prediction that cfDNA
molecules originating from different cell types or tissues differ
with respect to: (a) the distribution of likelihoods any specific
base-pair in a human genome will appear at a terminus of a cfDNA
fragment (i.e. points of fragmentation); (b) the distribution of
likelihoods that any pair of base-pairs of a human genome will
appear as a pair of termini of a cfDNA fragment (i.e. consecutive
pairs of fragmentation points that give rise to an individual cfDNA
molecule); and (c) the distribution of likelihoods that any
specific base-pair in a human genome will appear in a cfDNA
fragment (i.e. relative coverage) as a consequence of differential
nucleosome occupancy. These are referred to below as distributions
(a), (b) and (c), or collectively referred to as "nucleosome
dependent cleavage probability maps", "cleavage accessibility maps"
or "nucleosome maps" (FIG. 1). Of note, nucleosome maps might also
be measured through the sequencing of fragments derived from the
fragmentation of chromatin with an enzyme such as micrococcal
nuclease (MNase), DNase, or transposase, or equivalent procedures
that preferentially fragment genomic DNA between or at the
boundaries of nucleosomes or chromatosomes.
[0079] In healthy individuals, cfDNA overwhelmingly derives from
apoptosis of blood cells, i.e. cells of the hematopoietic lineage.
As these cells undergo programmed cell death, their genomic DNA is
cleaved and released into circulation, where it continues to be
degraded by nucleases. The length distribution of cfDNA oscillates
with a period of approximately 10.5 base-pairs (bp), corresponding
to the helical pitch of DNA coiled around the nucleosome, and has a
marked peak around 167 bp, corresponding to the length of DNA
associated with a linker-associated mononucleosome (FIG. 2). This
evidence has led to the hypothesis that cfDNA's association with
the nucleosome is what protects it from complete, rapid degradation
in the circulation. An alternative possibility is that the length
distribution arises simply from the pattern of DNA cleavage during
apoptosis itself, which is influenced directly by nucleosome
positioning. Regardless, the length distribution of cfDNA provides
clear evidence that the fragmentation processes that give rise to
cfDNA are influenced by nucleosome positioning.
[0080] In some embodiments, the present disclosure defines a
nucleosome map as the measurement of distributions (a), (b) and/or
(c) by library construction and massively parallel sequencing of
either cfDNA from a bodily fluid or DNA derived from the
fragmentation of chromatin with an enzyme such as micrococcal
nuclease (MNase), DNase, or transposase, or equivalent procedures
that preferentially fragment genomic DNA between or at the
boundaries of nucleosomes or chromatosomes. As described below,
these distributions may be `transformed` in order to aggregate or
summarize the periodic signal of nucleosome positioning within
various subsets of the genome, e.g. quantifying periodicity in
contiguous windows or, alternatively, in discontiguous subsets of
the genome defined by transcription factor binding sites, gene
model features (e.g. transcription start sites or gene bodies),
topologically associated domains, tissue expression data or other
correlates of nucleosome positioning. Furthermore, these might be
defined by tissue-specific data. For example, one could aggregate
or summarize signal in the vicinity of tissue-specific DNase I
hypersensitive sites.
[0081] The present disclosure provides a dense, genome-wide map of
in vivo nucleosome protection inferred from plasma-borne cfDNA
fragments. The CH01 map, derived from cfDNA of healthy individuals,
comprises nearly 13M uniformly spaced local maxima of nucleosome
protection that span the vast majority of the mappable human
reference genome. Although the number of peaks is essentially
saturated in CH01, other metrics of quality continued to be a
function of sequencing depth (FIGS. 33A-B). An additional
genome-wide nucleosome map was therefore constructed--by identical
methods--that is based on nearly all of the cfDNA sequencing that
the inventors have performed to date, for this study and other work
(`CA01`, 14.5 billion (G) fragments; 700-fold coverage; 13.0M
peaks). Although this map exhibits even more uniform spacing and
more highly supported peak calls (FIGS. 33A-B, 63A-H), we caution
that it is based on cfDNA from both healthy and non-healthy
individuals (Tables 1, 5).
[0082] The dense, genome-wide map of nucleosome protection
disclosed herein approaches saturation of the mappable portion of
the human reference genome, with peak-to-peak spacing that is
considerably more uniform and consistent with the expected
nucleosome repeat length than previous efforts to generate human
genome-wide maps of nucleosome positioning or protection (FIGS.
63A-H). In contrast with nearly all previous efforts, the fragments
that observed herein are generated by endogenous physiological
processes, and are therefore less likely to be subject to the
technical variation associated with in vitro micrococcal nuclease
digestion. The cell types that give rise to cfDNA considered in
this reference map are inevitably heterogeneous (e.g. a mixture of
lymphoid and myeloid cell types in healthy individuals).
Nonetheless, the map's relative completeness may facilitate a
deeper understanding of the processes that dictate nucleosome
positioning and spacing in human cells, as well as the interplay of
nucleosomes with epigenetic regulation, transcriptional output, and
nuclear architecture.
Methods of Determining the Source(s) of cfDNA in a Subject's
Biological Sample
[0083] As discussed generally above, and as demonstrated more
specifically in the Examples which follow, the present technology
may be used to determine (e.g., predict) the tissue(s) and/or cell
type(s) which contribute to the cfDNA in a subject's biological
sample.
[0084] Accordingly, in some embodiments, the present disclosure
provides a method of determining tissues and/or cell-types giving
rise to cell-free DNA (cfDNA) in a subject, the method comprising
isolating cfDNA from a biological sample from the subject, the
isolated cfDNA comprising a plurality of cfDNA fragments;
determining a sequence associated with at least a portion of the
plurality of cfDNA fragments; determining a genomic location within
a reference genome for at least some cfDNA fragment endpoints of
the plurality of cfDNA fragments as a function of the cfDNA
fragment sequences; and determining at least some of the tissues
and/or cell types giving rise to the cfDNA fragments as a function
of the genomic locations of at least some of the cfDNA fragment
endpoints.
[0085] In some embodiments, the biological sample comprises,
consists essentially of, or consists of whole blood, peripheral
blood plasma, urine, or cerebral spinal fluid.
[0086] In some embodiments, the step of determining at least some
of the tissues and/or cell-types giving rise to the cfDNA fragments
comprises comparing the genomic locations of at least some of the
cfDNA fragment endpoints, or mathematical transformations of their
distribution, to one or more reference maps. As used herein, the
term "reference map" refers to any type or form of data which can
be correlated or compared to an attribute of the cfDNA in the
subject's biological sample as a function of the coordinate within
the genome to which cfDNA sequences are aligned (e.g., the
reference genome). The reference map may be correlated or compared
to an attribute of the cfDNA in the subject's biological sample by
any suitable means. For example and without limitation, the
correlation or comparison may be accomplished by analyzing
frequencies of cfDNA endpoints, either directly or after performing
a mathematical transformation on their distribution across windows
within the reference genome, in the subject's biological sample in
view of numerical values or any other states defined for equivalent
coordinates of the reference genome by the reference map. In
another non-limiting example, the correlation or comparison may be
accomplished by analyzing the determined nucleosome spacing(s)
based on the cfDNA of the subject's biological sample in view of
the determined nucleosome spacing(s), or another property that
correlates with nucleosome spacing(s), in the reference map.
[0087] The reference map(s) may be sourced or derived from any
suitable data source including, for example, public databases of
genomic information, published data, or data generated for a
specific population of reference subjects which may each have a
common attribute (e.g., disease status). In some embodiments, the
reference map comprises a DNase I hypersensitivity dataset. In some
embodiments, the reference map comprises an RNA expression dataset.
In some embodiments, the reference map comprises a chromosome
conformation map. In some embodiments, the reference map comprises
a chromatin accessibility map. In some embodiments, the reference
map comprises data that is generated from at least one tissue or
cell-type that is associated with a disease or a disorder. In some
embodiments, the reference map comprises positions of nucleosomes
and/or chromatosomes in a tissue or cell type. In some embodiments,
the reference map is generated by a procedure that includes
digesting chromatin with an exogenous nuclease (e.g., micrococcal
nuclease). In some embodiments, the reference map comprises
chromatin accessibility data determined by a transposition-based
method (e.g., ATAC-seq). In some embodiments, the reference map
comprises data associated with positions of a DNA binding and/or
DNA occupying protein for a tissue or cell type. In some
embodiments, the DNA binding and/or DNA occupying protein is a
transcription factor. In some embodiments, the positions are
determined by a procedure that includes chromatin
immunoprecipitation of a crosslinked DNA-protein complex. In some
embodiments, the positions are determined by a procedure that
includes treating DNA associated with the tissue or cell type with
a nuclease (e.g., DNase-I). In some embodiments, the reference map
is generated by sequencing of cfDNA fragments from a biological
sample from one or more individuals with a known disease. In some
embodiments, this biological sample from which the reference map is
generated is collected from an animal to which human cells or
tissues have been xenografted.
[0088] In some embodiments, the reference map comprises a
biological feature corresponding to positions of a DNA binding or
DNA occupying protein for a tissue or cell type. In some
embodiments, the reference map comprises a biological feature
corresponding to quantitative RNA expression of one or more genes.
In some embodiments, the reference map comprises a biological
feature corresponding to the presence or absence of one or more
histone marks. In some embodiments, the reference map comprises a
biological feature corresponding to hypersensitivity to nuclease
cleavage.
[0089] The step of comparing the genomic locations of at least some
of the cfDNA fragment endpoints to one or more reference maps may
be accomplished in a variety of ways. In some embodiments, the
cfDNA data generated from the biological sample (e.g., the genomic
locations of the cfDNA fragments, their endpoints, the frequencies
of their endpoints, and/or nucleosome spacing(s) inferred from
their distribution) is compared to more than one reference map. In
such embodiments, the tissues or cell-types associated with the
reference maps which correlate most highly with the cfDNA data in
the biological sample are deemed to be contributing. For example
and without limitation, if the cfDNA data includes a list of likely
cfDNA endpoints and their locations within the reference genome,
the reference map(s) having the most similar list of cfDNA
endpoints and their locations within the reference genome may be
deemed to be contributing. As another non-limiting example, the
reference map(s) having the most correlation (or increased
correlation, relative to cfDNA from a healthy subject) with a
mathematical transformation of the distribution of cfDNA fragment
endpoints from the biological sample may be deemed to be
contributing. The tissue types and/or cell types which correspond
to those reference maps deemed to be contributing are then
considered as potential sources of the cfDNA isolated from the
biological sample.
[0090] In some embodiments, the step of determining at least some
of the tissues and/or cell types giving rise to the cfDNA fragments
comprises performing a mathematical transformation on a
distribution of the genomic locations of at least some of the cfDNA
fragment endpoints. One non-limiting example of a mathematical
transformation suitable for use in connection with the present
technology is a Fourier transformation, such as a fast Fourier
transformation ("FFT").
[0091] In some embodiments, the method further comprises
determining a score for each of at least some coordinates of the
reference genome, wherein the score is determined as a function of
at least the plurality of cfDNA fragment endpoints and their
genomic locations, and wherein the step of determining at least
some of the tissues and/or cell types giving rise to the observed
cfDNA fragments comprises comparing the scores to one or more
reference map. The score may be any metric (e.g., a numerical
ranking or probability) which may be used to assign relative or
absolute values to a coordinate of the reference genome. For
example, the score may consist of, or be related to a probability,
such as a probability that the coordinate represents a location of
a cfDNA fragment endpoint, or a probability that the coordinate
represents a location of the genome that is preferentially
protected from nuclease cleavage by nucleosome or protein binding.
As another example, the score may relate to nucleosome spacing in
particular regions of the genome, as determined by a mathematical
transformation of the distribution of cfDNA fragment endpoints
within that region. Such scores may be assigned to the coordinate
by any suitable means including, for example, by counting absolute
or relative events (e.g., the number of cfDNA fragment endpoints)
associated with that particular coordinate, or performing a
mathematical transformation on the values of such counts in the
region or a genomic coordinate. In some embodiments, the score for
a coordinate is related to the probability that the coordinate is a
location of a cfDNA fragment endpoint. In other embodiments, the
score for a coordinate is related to the probability that the
coordinate represents a location of the genome that is
preferentially protected from nuclease cleavage by nucleosome or
protein binding. In some embodiments, the score is related to
nucleosome spacing in the genomic region of the coordinate.
[0092] The tissue(s) and/or cell-type(s) referred to in the methods
described herein may be any tissue or cell-type which gives rise to
cfDNA. In some embodiments, the tissue or cell-type is a primary
tissue from a subject having a disease or disorder. In some
embodiments, the disease or disorder is selected from the group
consisting of: cancer, normal pregnancy, a complication of
pregnancy (e.g., aneuploid pregnancy), myocardial infarction,
inflammatory bowel disease, systemic autoimmune disease, localized
autoimmune disease, allotransplantation with rejection,
allotransplantation without rejection, stroke, and localized tissue
damage.
[0093] In some embodiments, the tissue or cell type is a primary
tissue from a healthy subject.
[0094] In some embodiments, the tissue or cell type is an
immortalized cell line.
[0095] In some embodiments, the tissue or cell type is a biopsy
from a tumor.
[0096] In some embodiments, the reference map is based on sequence
data obtained from samples obtained from at least one reference
subject. In some embodiments, this sequence data defines positions
of cfDNA fragment endpoints within a reference genome--for example,
if the reference map is generated by sequencing of cfDNA from
subject(s) with known disease. In other embodiments, this sequence
data on which the reference map is based may comprise any one or
more of: a DNase I hypersensitive site dataset, an RNA expression
dataset, a chromosome conformation map, or a chromatin
accessibility map, or nucleosome positioning map generated by
digestion of chromatin with micrococcal nuclease.
[0097] In some embodiments, the reference subject is healthy. In
some embodiments, the reference subject has a disease or disorder,
optionally selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, inflammatory bowel disease, systemic
autoimmune disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
[0098] In some embodiments, the reference map comprises scores for
at least a portion of coordinates of the reference genome
associated with the tissue or cell type. In some embodiments, the
reference map comprises a mathematical transformation of the
scores, such as a Fourier transformation of the scores. In some
embodiments, the scores are based on annotations of reference
genomic coordinates for the tissue or cell type. In some
embodiments, the scores are based on positions of nucleosomes
and/or chromatosomes. In some embodiments, the scores are based on
transcription start sites and/or transcription end sites. In some
embodiments, the scores are based on predicted binding sites of at
least one transcription factor. In some embodiments, the scores are
based on predicted nuclease hypersensitive sites. In some
embodiments, the scores are based on predicted nucleosome
spacing.
[0099] In some embodiments, the scores are associated with at least
one orthogonal biological feature. In some embodiments, the
orthogonal biological feature is associated with highly expressed
genes. In some embodiments, the orthogonal biological feature is
associated with lowly expression genes.
[0100] In some embodiments, at least some of the plurality of the
scores has a value above a threshold (minimum) value. In such
embodiments, scores falling below the threshold (minimum) value are
excluded from the step of comparing the scores to a reference map.
In some embodiments, the threshold value is determined before
determining the tissue(s) and/or the cell type(s) giving rise to
the cfDNA. In other embodiments, the threshold value is determined
after determining the tissue(s) and/or the cell type(s) giving rise
to the cfDNA.
[0101] In some embodiments, the step of determining the tissues
and/or cell types giving rise to the cfDNA as a function of a
plurality of the genomic locations of at least some of the cfDNA
fragment endpoints comprises comparing a mathematical
transformation of the distribution of the genomic locations of at
least some of the cfDNA fragment endpoints of the sample with one
or more features of one or more reference maps. One non-limiting
example of a mathematical transformation suitable for this purpose
is a Fourier transformation, such as a fast Fourier transformation
("FFT").
[0102] In any embodiment described herein, the method may further
comprise generating a report comprising a list of the determined
tissues and/or cell-types giving rise to the isolated cfDNA. The
report may optionally further include any other information about
the sample and/or the subject, the type of biological sample, the
date the biological sample was obtained from the subject, the date
the cfDNA isolation step was performed and/or tissue(s) and/or
cell-type(s) which likely did not give rise to any cfDNA isolated
from the biological sample.
[0103] In some embodiments, the report further includes a
recommended treatment protocol including, for example and without
limitation, a suggestion to obtain an additional diagnostic test
from the subject, a suggestion to begin a therapeutic regimen, a
suggestion to modify an existing therapeutic regimen with the
subject, and/or a suggestion to suspend or stop an existing
therapeutic regiment.
Methods of Identifying a Disease or Disorder in a Subject
[0104] As discussed generally above, and as demonstrated more
specifically in the Examples which follow, the present technology
may be used to determine (e.g., predict) a disease or disorder, or
the absence of a disease or a disorder, based at least in part on
the tissue(s) and/or cell type(s) which contribute to cfDNA in a
subject's biological sample.
[0105] Accordingly, in some embodiments, the present disclosure
provides a method of identifying a disease or disorder in a
subject, the method comprising isolating cell free DNA (cfDNA) from
a biological sample from the subject, the isolated cfDNA comprising
a plurality of cfDNA fragments; determining a sequence associated
with at least a portion of the plurality of cfDNA fragments;
determining a genomic location within a reference genome for at
least some cfDNA fragment endpoints of the plurality of cfDNA
fragments as a function of the cfDNA fragment sequences;
determining at least some of the tissues and/or cell types giving
rise to the cfDNA as a function of the genomic locations of at
least some of the cfDNA fragment endpoints; and identifying the
disease or disorder as a function of the determined tissues and/or
cell types giving rise to the cfDNA.
[0106] In some embodiments, the biological sample comprises,
consists essentially of, or consists of whole blood, peripheral
blood plasma, urine, or cerebral spinal fluid.
[0107] In some embodiments, the step of determining the tissues
and/or cell-types giving rise to the cfDNA comprises comparing the
genomic locations of at least some of the cfDNA fragment endpoints,
or mathematical transformations of their distribution, to one or
more reference maps. The term "reference map" as used in connection
with these embodiments may have the same meaning described above
with respect to methods of determining tissue(s) and/or cell
type(s) giving rise to cfDNA in a subject's biological sample. In
some embodiments, the reference map may comprise any one or more
of: a DNase I hypersensitive site dataset, an RNA expression
dataset, a chromosome conformation map, a chromatin accessibility
map, sequence data that is generated from samples obtained from at
least one reference subject, enzyme-mediated fragmentation data
corresponding to at least one tissue that is associated with a
disease or a disorder, and/or positions of nucleosomes and/or
chromatosomes in a tissue or cell type. In some embodiments, the
reference map is generated by sequencing of cfDNA fragments from a
biological sample from one or more individuals with a known
disease. In some embodiments, this biological sample from which the
reference map is generated is collected from an animal to which
human cells or tissues have been xenografted.
[0108] In some embodiments, the reference map is generated by
digesting chromatin with an exogenous nuclease (e.g., micrococcal
nuclease). In some embodiments, the reference maps comprise
chromatin accessibility data determined by a transposition-based
method (e.g., ATAC-seq). In some embodiments, the reference maps
comprise data associated with positions of a DNA binding and/or DNA
occupying protein for a tissue or cell type. In some embodiments,
the DNA binding and/or DNA occupying protein is a transcription
factor. In some embodiments, the positions are determined chromatin
immunoprecipitation of a crosslinked DNA-protein complex. In some
embodiments, the positions are determined by treating DNA
associated with the tissue or cell type with a nuclease (e.g.,
DNase-I).
[0109] In some embodiments, the reference map comprises a
biological feature corresponding to positions of a DNA binding or
DNA occupying protein for a tissue or cell type. In some
embodiments, the reference map comprises a biological feature
corresponding to quantitative expression of one or more genes. In
some embodiments, the reference map comprises a biological feature
corresponding to the presence or absence of one or more histone
marks. In some embodiments, the reference map comprises a
biological feature corresponding to hypersensitivity to nuclease
cleavage.
[0110] In some embodiments, the step of determining the tissues
and/or cell types giving rise to the cfDNA comprises performing a
mathematical transformation on a distribution of the genomic
locations of at least some of the plurality of the cfDNA fragment
endpoints. In some embodiments, the mathematical transformation
includes a Fourier transformation.
[0111] In some embodiments, the method further comprises
determining a score for each of at least some coordinates of the
reference genome, wherein the score is determined as a function of
at least the plurality of cfDNA fragment endpoints and their
genomic locations, and wherein the step of determining at least
some of the tissues and/or cell types giving rise to the observed
cfDNA fragments comprises comparing the scores to one or more
reference maps. The score may be any metric (e.g., a numerical
ranking or probability) which may be used to assign relative or
absolute values to a coordinate of the reference genome. For
example, the score may consist of, or be related to a probability,
such as a probability that the coordinate represents a location of
a cfDNA fragment endpoint, or a probability that the coordinate
represents a location of the genome that is preferentially
protected from nuclease cleavage by nucleosome or protein binding.
As another example, the score may relate to nucleosome spacing in
particular regions of the genome, as determined by a mathematical
transformation of the distribution of cfDNA fragment endpoints
within that region. Such scores may be assigned to the coordinate
by any suitable means including, for example, by counting absolute
or relative events (e.g., the number of cfDNA fragment endpoints)
associated with that particular coordinate, or performing a
mathematical transformation on the values of such counts in the
region or a genomic coordinate. In some embodiments, the score for
a coordinate is related to the probability that the coordinate is a
location of a cfDNA fragment endpoint. In other embodiments, the
score for a coordinate is related to the probability that the
coordinate represents a location of the genome that is
preferentially protected from nuclease cleavage by nucleosome or
protein binding. In some embodiments, the score is related to
nucleosome spacing in the genomic region of the coordinate.
[0112] The term "score" as used in connection with these
embodiments may have the same meaning described above with respect
to methods of determining tissue(s) and/or cell type(s) giving rise
to cfDNA in a subject's biological sample. In some embodiments, the
score for a coordinate is related to the probability that the
coordinate is a location of a cfDNA fragment endpoint. In other
embodiments, the score for a coordinate is related to the
probability that the coordinate represents a location of the genome
that is preferentially protected from nuclease cleavage by
nucleosome or protein binding. In some embodiments, the score is
related to nucleosome spacing in the genomic region of the
coordinate.
[0113] In some embodiments, the tissue or cell-type used for
generating a reference map is a primary tissue from a subject
having a disease or disorder. In some embodiments, the disease or
disorder is selected from the group consisting of: cancer, normal
pregnancy, a complication of pregnancy (e.g., aneuploid pregnancy),
myocardial infarction, systemic autoimmune disease, localized
autoimmune disease, inflammatory bowel disease, allotransplantation
with rejection, allotransplantation without rejection, stroke, and
localized tissue damage.
[0114] In some embodiments, the tissue or cell type is a primary
tissue from a healthy subject.
[0115] In some embodiments, the tissue or cell type is an
immortalized cell line.
[0116] In some embodiments, the tissue or cell type is a biopsy
from a tumor.
[0117] In some embodiments, the reference map is based on sequence
data obtained from samples obtained from at least one reference
subject. In some embodiments, this sequence data defines positions
of cfDNA fragment endpoints within a reference genome--for example,
if the reference map is generated by sequencing of cfDNA from
subject(s) with known disease. In other embodiments, this sequence
data on which the reference map is based may comprise any one or
more of: a DNase I hypersensitive site dataset, an RNA expression
dataset, a chromosome conformation map, or a chromatin
accessibility map, or nucleosome positioning map generated by
digestion with micrococcal nuclease. In some embodiments, the
reference subject is healthy. In some embodiments, the reference
subject has a disease or disorder. In some embodiments, the disease
or disorder is selected from the group consisting of: cancer,
normal pregnancy, a complication of pregnancy (e.g., aneuploid
pregnancy), myocardial infarction, systemic autoimmune disease,
inflammatory bowel disease, localized autoimmune disease,
allotransplantation with rejection, allotransplantation without
rejection, stroke, and localized tissue damage.
[0118] In some embodiments, the reference map comprises cfDNA
fragment endpoint probabilities, or a quantity that correlates with
such probabilities, for at least a portion of the reference genome
associated with the tissue or cell type. In some embodiments, the
reference map comprises a mathematical transformation of the cfDNA
fragment endpoint probabilities, or a quantity that correlates with
such probabilities.
[0119] In some embodiments, the reference map comprises scores for
at least a portion of coordinates of the reference genome
associated with the tissue or cell type. In some embodiments, the
reference map comprises a mathematical transformation of the
scores, such as a Fourier transformation of the scores. In some
embodiments, the scores are based on annotations of reference
genomic coordinates for the tissue or cell type. In some
embodiments, the scores are based on positions of nucleosomes
and/or chromatosomes. In some embodiments, the scores are based on
transcription start sites and/or transcription end sites. In some
embodiments, the scores are based on predicted binding sites of at
least one transcription factor. In some embodiments, the scores are
based on predicted nuclease hypersensitive sites.
[0120] In some embodiments, the scores are associated with at least
one orthogonal biological feature. In some embodiments, the
orthogonal biological feature is associated with highly expressed
genes. In some embodiments, the orthogonal biological feature is
associated with lowly expression genes.
[0121] In some embodiments, at least some of the plurality of the
scores each has a score above a threshold value. In such
embodiments, scores falling below the threshold (minimum) value are
excluded from the step of comparing the scores to a reference map.
In some embodiments, the threshold value is determined before
determining the tissue(s) and/or the cell type(s) giving rise to
the cfDNA. In other embodiments, the threshold value is determined
after determining the tissue(s) and/or the cell type(s) giving rise
to the cfDNA.
[0122] In some embodiments, the step of determining the tissues
and/or cell types giving rise to the cfDNA as a function of a
plurality of the genomic locations of at least some of the cfDNA
fragment endpoints comprises a mathematical transformation of the
distribution of the genomic locations of at least some of the cfDNA
fragment endpoints of the sample with one or more features of one
or more reference maps.
[0123] In some embodiments, this mathematical transformation
includes a Fourier transformation.
[0124] In some embodiments, the reference map comprises
enzyme-mediated fragmentation data corresponding to at least one
tissue that is associated with the disease or disorder.
[0125] In some embodiments, the reference genome is associated with
a human.
[0126] In one aspect of the invention, the methods described herein
are used for detection, monitoring and tissue(s) and/or
cell-type(s)-of-origin assessment of malignancies from analysis of
cfDNA in bodily fluids. It is now well documented that in patients
with malignancies, a portion of cfDNA in bodily fluids such as
circulating plasma can be derived from the tumor. The methods
described here can potentially be used to detect and quantify this
tumor derived portion. Furthermore, as nucleosome occupancy maps
are cell-type specific, the methods described here can potentially
be used to determine the tissue(s) and/or cell-type(s)-of-origin of
a malignancy. Also, as noted above, it has been observed that there
is a major increase in the concentration of circulating plasma
cfDNA in cancer, potentially disproportionate to the contribution
from the tumor itself. This suggests that other tissues (e.g.
stromal, immune system) may possibly be contributing to circulating
plasma cfDNA during cancer. To the extent that contributions from
such other tissues to cfDNA are consistent between patients for a
given type of cancer, the methods described above may enable cancer
detection, monitoring, and/or tissue(s) and/or
cell-type(s)-of-origin assignment based on signal from these other
tissues rather than the cancer cells per se.
[0127] In another aspect of the invention, the methods described
herein are used for detection, monitoring and tissue(s) and/or
cell-type(s)-of-origin assessment of tissue damage from analysis of
cfDNA in bodily fluids. It is to be expected that many pathological
processes will result in a portion of cfDNA in bodily fluids such
as circulating plasma deriving from damaged tissues. The methods
described here can potentially be used to detect and quantify cfDNA
derived from tissue damage, including identifying the relevant
tissues and/or cell-types of origin. This may enable diagnosis
and/or monitoring of pathological processes including myocardial
infarction (acute damage of heart tissue), autoimmune disease
(chronic damage of diverse tissues), and many others involving
either acute or chronic tissue damage.
[0128] In another aspect of the invention, the methods described
herein are used for estimating the fetal fraction of cfDNA in
pregnancy and/or enhancing detection of chromosomal or other
genetic abnormalities. Relatively shallow sequencing of the
maternal plasma-borne DNA fragments, coupled with nucleosome maps
described above, may allow a cost-effective and rapid estimation of
fetal fraction in both male and female fetus pregnancies.
Furthermore, by enabling non-uniform probabilities to be assigned
to individual sequencing reads with respect to their likelihood of
having originated from the maternal or fetal genome, these methods
may also enhance the performance of tests directed at detecting
chromosomal aberrations (e.g. trisomies) through analysis of cfDNA
in maternal bodily fluids.
[0129] In another aspect of the invention, the methods described
herein are used for quantifying the contribution of a transplant
(autologous or allograft) to cfDNA--Current methods for early and
noninvasive detection of acute allograft rejection involve
sequencing plasma-borne DNA and identifying increased
concentrations of fragments derived from the donor genome. This
approach relies on relatively deep sequencing of this pool of
fragments to detect, for example, 5-10% donor fractions. An
approach based instead on nucleosome maps of the donated organ may
enable similar estimates with shallower sequencing, or more
sensitive estimates with an equivalent amount of sequencing.
Analogous to cancer, it is also possible that cell types other than
the transplant itself contribute to cfDNA composition during
transplant rejection. To the extent that contributions from such
other tissues to cfDNA are consistent between patients during
transplant rejection, the methods described above may enable
monitoring of transplant rejection based on signal from these other
tissues rather than the transplant donor cells per se.
Additional Embodiments of the Present Disclosure.
[0130] The present disclosure also provides methods of diagnosing a
disease or disorder using nucleosome reference map(s) generated
from subjects having a known disease or disorder. In some such
embodiments, the method comprises: (1) generating a reference set
of nucleosome maps, wherein each nucleosome map is derived from
either cfDNA from bodily fluids of individual(s) with defined
clinical conditions (e.g. normal, pregnancy, cancer type A, cancer
type B, etc.) and/or DNA derived from digestion of chromatin of
specific tissues and/or cell types; (2) predicting the clinical
condition and/or tissue/cell-type-of-origin composition of cfDNA
from bodily fluids of individual(s) by comparing a nucleosome map
derived from their cfDNA to the reference set of nucleosome
maps.
[0131] STEP 1: Generating a reference set of nucleosome maps, and
aggregating or summarizing signal from nucleosome positioning.
[0132] A preferred method for generating a nucleosome map includes
DNA purification, library construction (by adaptor ligation and
possibly PCR amplification) and massively parallel sequencing of
cfDNA from a bodily fluid. An alternative source for nucleosome
maps, which are useful in the context of this invention as
reference points or for identifying principal components of
variation, is DNA derived from digestion of chromatin with
micrococcal nuclease (MNase), DNase treatment, ATAC-Seq or other
related methods wherein information about nucleosome positioning is
captured in distributions (a), (b) or (c). Descriptions of these
distributions (a), (b) and (c) are provided above in [0078] and are
shown graphically in FIG. 1.
[0133] In principle, very deep sequencing of such libraries can be
used to quantify nucleosome occupancy in the aggregate cell types
contributing to cfDNA at specific coordinates in the genome, but
this is very expensive today. However, the signal associated with
nucleosome occupancy patterns can be summarized or aggregated
across continuous or discontinuous regions of the genome. For
example, in Examples 1 and 2 provided herein, the distribution of
sites in the reference human genome to which sequencing read start
sites map, i.e. distribution (a), is subjected to Fourier
transformation in 10 kilobase-pair (kbp) contiguous windows,
followed by quantitation of intensities for frequency ranges that
are associated with nucleosome occupancy. This effectively
summarizes the extent to which nucleosomes exhibit structured
positioning within each 10 kbp window. In Example 3 provided
herein, we quantify the distribution of sites in the reference
human genome to which sequencing read start sites map, i.e.
distribution (a), in the immediate vicinity of transcription factor
binding sites (TFBS) of specific transcription factor (TF), which
are often immediately flanked by nucleosomes when the TFBS is bound
by the TF. This effectively summarizes nucleosome positioning as a
consequence of TF activity in the cell type(s) contributing to
cfDNA. Importantly, there are many related ways in which nucleosome
occupancy signals can be meaningfully summarized. These include
aggregating signal from distributions (a), (b), and/or (c) around
other genomic landmarks such as DNasel hypersensitive sites,
transcription start sites, topological domains, other epigenetic
marks or subsets of all such sites defined by correlated behavior
in other datasets (e.g. gene expression, etc.). As sequencing costs
continue to fall, it will also be possible to directly use maps of
nucleosome occupancy, including those generated from cfDNA samples
associated with a known disease, as reference maps, i.e. without
aggregating signal, for the purposes of comparison to an unknown
cfDNA sample. In some embodiments, this biological sample from
which the reference map of nucleosome occupancy is generated is
collected from an animal to which human cells or tissues have been
xenografted. The advantage of this is that sequenced cfDNA
fragments mapping to the human genome will exclusively derive from
the xenografted cells or tissues, as opposed to representing a
mixture of cfDNA derived from the cells/tissues of interest along
with hematopoietic lineages.
[0134] STEP 2: Predicting pathology(s), clinical condition(s)
and/or tissue/cell-types-of-origin composition on the basis of
comparing the cfDNA-derived nucleosome map of one or more new
individuals/samples to the reference set of nucleosome maps either
directly or after mathematical transformation of each map.
[0135] Once one has generated a reference set of nucleosome maps,
there are a variety of statistical signal processing methods for
comparing additional nucleosome map(s) to the reference set. In
Examples 1 & 2, we first summarize long-range nucleosome
ordering within 10 kbp windows along the genome in a diverse set of
samples, and then perform principal components analysis (PCA) to
cluster samples (Example 1) or to estimate mixture proportions
(Example 2). Although we know the clinical condition of all cfDNA
samples and the tissue/cell-type-of-origin of all cell line samples
used in these Examples, any one of the samples could in principle
have been the "unknown", and its behavior in the PCA analysis used
to predict the presence/absence of a clinical condition or its
tissue/cell-type-of-origin based on its behavior in the PCA
analysis relative to all other nucleosome maps.
[0136] The unknown sample does not necessarily need to be precisely
matched to 1+ members of the reference set in a 1:1 manner. Rather,
its similarities to each can be quantified (Example 1), or its
nucleosome map can be modeled as a non-uniform mixture of 2+
samples from the reference set (Example 2).
[0137] The tissue/cell-type-of-origin composition of cfDNA in each
sample need not be predicted or ultimately known for the method of
the present invention to be successful. Rather, the method
described herein relies on the consistency of
tissue/cell-type-of-origin composition of cfDNA in the context of a
particular pathology or clinical condition. However, by surveying
the nucleosome maps of a large number of tissues and/or cell types
directly by analysis of DNA derived from digestion of chromatin and
adding these to the nucleosome map, it would be possible to
estimate the tissue(s) and/or cell-type(s) contributing to an
unknown cfDNA-derived sample.
[0138] In any embodiment described herein, the method may further
comprise generating a report comprising a statement identifying the
disease or disorder. In some embodiments, the report may further
comprise a list of the determined tissues and/or cell types giving
rise to the isolated cfDNA. In some embodiments, the report further
comprises a list of diseases and/or disorders which are unlikely to
be associated with the subject. The report may optionally further
include any other information about the sample and/or the subject,
the type of biological sample, the date the biological sample was
obtained from the subject, the date the cfDNA isolation step was
performed and/or tissue(s) and/or cell type(s) which likely did not
give rise to any cfDNA isolated from the biological sample.
[0139] In some embodiments, the report further includes a
recommended treatment protocol including, for example and without
limitation, a suggestion to obtain an additional diagnostic test
from the subject, a suggestion to begin a therapeutic regimen, a
suggestion to modify an existing therapeutic regimen with the
subject, and/or a suggestion to suspend or stop an existing
therapeutic regiment.
EXAMPLES
Example 1
Principal Components Analysis of Cell Free DNA Nucleosome Maps
[0140] The distribution of read start positions in sequencing data
derived from cfDNA extractions and MNase digestion experiments were
examined to assess the presence of signals related to nucleosome
positioning. For this purpose, a pooled cfDNA sample (human plasma
containing contributions from an unknown number of healthy
individuals; bulk.cfDNA), a cfDNA sample from single healthy male
control individual (MC2.cfDNA), four cfDNA samples from patients
with intracranial tumors (tumor.2349, tumor.2350, tumor.2351,
tumor.2353), six MNase digestion experiments from five different
human cell lines (Hap1.MNase, HeLa.MNase, HEK.MNase, NA12878.MNase,
HeLaS3, MCF.7) and seven cfDNA samples from different pregnant
female individuals (gm1matplas, gm2matplas, im1matplas, fgs002,
fgs003, fgs004, fgs005) were analyzed and contrasted with regular
shotgun sequencing data set of DNA extracted from a female
lymphoblastoid cell line (NA12878). A subset of the pooled cfDNA
sample (26%, bulk.cfDNA_part) and of the single healthy male
control individual (18%, MC2.cfDNA_part) were also included, as
separate samples, to explore the effect of sequencing depth.
[0141] Read start coordinates were extracted and periodograms were
created using Fast Fourier Transformation (FFT) as described in the
Methods section. This analysis determines how much of the
non-uniformity in the distribution of read start sites can be
explained by signals of specific frequencies/periodicities. We
focused on a range of 120-250 bp, which comprises the length range
of DNA wrapped around a single nucleosome (147 bp) as well as
additional sequence of the nucleosome linker sequence (10-80 bp).
FIG. 3 shows the average intensities for each frequency across all
blocks of human chromosome 1 and human chromosome 22. It can be
seen that MNase digestion experiments as well cfDNA samples show
clear peaks below 200 bp periodicity. Such a peak is not observed
in the human shotgun data. These analyses are consistent with a
major effect of nucleosome positioning on the distribution of
fragment boundaries in cfDNA.
[0142] Variation in the exact peak frequency between samples was
also observed. This is possibly a consequence of different
distributions of linker sequence lengths in each cell type. That
the peak derives from patterns of nucleosome bound DNA plus linker
sequence is supported by the observations that the flanks around
the peaks are not symmetrical and that the intensities for
frequencies higher than the peak compared to frequencies lower than
the peak are lower. This suggests that plots similar to those
presented in FIG. 3 can be used to perform quality control of cfDNA
and MNase sequencing data. Random fragmentation or contamination of
cfDNA and MNase with regular (shotgun) DNA will cause dilution or,
in extreme cases, total absence of these characteristic intensity
patterns in periodograms.
[0143] In the following, data were analyzed based on measured
intensities at a periodicity of 196 bp as well as all intensities
determined for the frequency range of 181 bp to 202 bp. A wider
frequency range was chosen in order to provide higher resolution
because a wider range of linker lengths are being captured. These
intensities were chosen as the focus purely for computational
reasons here; different frequency ranges may be used in related
embodiments. FIGS. 4 and 5, explore visualizations of the
periodogram intensities at 196 bp across contiguous,
non-overlapping 10 kbp blocks tiling the full length of human
autosomes (see Methods for details). FIG. 4 presents a Principal
Component Analysis (PCA) of the data and the projections across the
first three components. Principal component 1 (PC1) (28.1% of
variance) captures the differences in intensity strength seen in
FIG. 3 and thereby separates MNase and cfDNA samples from genomic
shotgun data. In contrast, PC2 (9.7% of variance) captures the
differences between MNase and cfDNA samples. PC3 (6.4% variance)
captures differences between individual samples. FIG. 5 shows the
hierarchical clustering dendogram of this data based on Euclidean
distances of the intensity vectors. We note that the two HeLa S3
experiments tightly cluster in the PCA and dendogram, even though
data was generated in different labs and following different
experimental protocols. "Normal" cfDNA samples, tumor cfDNA samples
and groups of cell line MNase samples also clustered. Specifically,
the three tumor samples originating from the same tumor type
(glioblastoma multiforme) appear to cluster, separately from
tumor.2351 sample which originates from a different tumor type (see
Table 1). The GM1 and IM1 samples cluster separately from the other
cfDNA samples obtained from pregnant women. This coincides with
higher intensities observed for frequencies below the peak in these
samples (i.e., a more pronounced left shoulder in FIG. 3). This
might indicate subtle differences in the preparation of the cfDNA
between the two sets of samples, or biological differences which
were not controlled for (e.g., gestational age).
[0144] FIGS. 6 and 7 show the results of equivalent analyses but
based on the frequency range of 181 bp to 202 bp. Comparing these
plots, the results are largely stable to a wider frequency range;
however additional frequencies may improve sensitivity in more
fine-scaled analyses. To further explore cell-type origin specific
patterns, the cfDNA and MNase data sets were analyzed separately
using PCA of intensities for this frequency range. In the following
set of analyses, the five cfDNA samples from pregnant women, which
show the pronounced left shoulder in FIG. 3, were excluded. FIG. 8
shows the first 7 principal components of the cfDNA data and FIG. 9
all six principal components for the six MNase data sets. While
there is a clustering of related samples, there is also
considerable variation (biological and technical variation) to
separate each sample from the rest. For example, an effect of
sequencing depth was observable, as can be seen from the separation
of bulk.cfDNA and bulk.cfDNA_part as well as MC2.cfDNA and
MC2.cfDNA_part. Read sampling may be used to correct for this
technical confounder.
[0145] Some key observations of this example include:
[0146] 1) Read start coordinates in cfDNA sequencing data capture a
strong signal of nucleosome positioning.
[0147] 2) Differences in the signal of nucleosome positioning,
aggregated across subsets of the genome such as contiguous 10 kbp
windows, correlate with sample origin.
Example 2
Mixture Proportion Estimation of Nucleosome Maps
[0148] In Example 1, basic clustering of samples that were
generated or downloaded from public databases was studied. The
analyses showed that read start coordinates in these data sets
capture a strong signal of nucleosome positioning (across a range
of sequencing depths obtained from 20 million sequences to more
than a 1,000 million sequences) and that sample origin correlates
with this signal. For the goals of this method, it would also be
useful to be able to identify mixtures of known cell types and to
some extent quantify the contributions of each cell type from this
signal. For this purpose, this example explored synthetic mixtures
(i.e., based on sequence reads) of two samples. We mixed sequencing
reads in ratios of 5:95, 10:90, 15:85, 20:80, 30:70, 40:60, 50:50,
60:40, 30:70, 80:20, 90:10 and 95:5 for two MNase data sets (MCF.7
and NA12878.MNase) and two cfDNA data sets (tumor.2349 and
bulk.cfDNA). The synthetic MNase mixture datasets were drawn from
two sets of 196.9 million aligned reads (each from one of the
original samples) and the synthetic cfDNA mixture datasets were
drawn from two sets of 181.1 million aligned reads (each from one
of the original samples).
[0149] FIG. 10 shows the average intensities for chromosome 11,
equivalent to FIG. 3 but for these synthetic mixtures. It can be
seen from FIG. 10 how the different sample contributions cause
shifts in the global frequency intensity patterns. This signal can
be exploited to infer the synthetic mixture proportions. FIG. 11
shows the first two principal components for the MNase data set
mixtures and FIG. 12 shows the first two principal components for
the cfDNA data set mixtures. In both cases, the first PC directly
captures the composition of the mixed data set. It is therefore
directly conceivable how mixture proportions for two and possibly
more cell types could be estimated from transformation of the
frequency intensity data given the appropriate reference sets and
using for example regression models. FIG. 13 shows the dendogram of
both data sets, confirming the overall similarities of mixture
samples deriving from similar sample proportions as well as the
separation of the cfDNA and MNase samples.
[0150] One of the key observations of this example is that the
mixture proportions of various sample types (cfDNA or cell/tissue
types) to an unknown sample can be estimated by modeling of
nucleosome occupancy patterns.
Example 3
Measuring Nucleosome Occupancy Relative to Transcription Factor
Binding Sites with cfDNA Sequencing Data
[0151] While previous examples demonstrate that signals of
nucleosome positioning can be obtained by partitioning the genome
into contiguous, non-overlapping 10 kbp windows, orthogonal methods
can also be used to generate cleavage accessibility maps and may be
less prone to artifacts based on window size and boundaries. One
such method, explored in some detail in this Example, is the
inference of nucleosome positioning through observed periodicity of
read-starts around transcription factor (TF) binding sites.
[0152] It is well established that local nucleosome positioning is
influenced by nearby TF occupancy. The effect on local remodeling
of chromatin, and thus on the stable positioning of nearby
nucleosomes, is not uniform across the set of TFs; occupancy of a
given TF may have local effects on nucleosome positioning that are
preferentially 5' or 3' of the binding site and stretch for greater
or lesser genomic distance in specific cell types. Furthermore, and
importantly for the purposes of this disclosure, the set of TF
binding sites occupied in vivo in a particular cell varies between
tissues and cell types, such that if one were able to identify TF
binding site occupancy maps for tissues or cell types of interest,
and repeated this process for one or more TFs, one could identify
components of the mixture of cell types and tissues contributing to
a population of cfDNA by identifying enrichment or depletion of one
or more cell type- or tissue-specific TF binding site occupancy
profiles.
[0153] To demonstrate this idea, read-starts in the neighborhood of
TF binding sites were used to visually confirm cleavage biases
reflective of preferential local nucleosome positioning. ChIP-seq
transcription factor (TF) peaks were obtained from the Encyclopedia
of DNA Elements ("ENCODE") project (National Human Genome Research
Institute, National Institutes of Health, Bethesda, Md.). Because
the genomic intervals of these peaks are broad (200 to 400 bp on
average), the active binding sites within these intervals were
discerned by informatically scanning the genome for respective
binding motifs with a conservative p-value cutoff
(1.times.10.sup.-5, see Methods for details). The intersection of
these two independently derived sets of predicted TF binding sites
were then carried forward into downstream analysis.
[0154] The number of read-starts at each position within 500 bp of
each candidate TF binding site was calculated in samples with at
least 100 million sequences. Within each sample, all read-starts
were summed at each position, yielding a total of 1,014 to 1,019
positions per sample per TF, depending on the length of the TF
recognition sequence.
[0155] FIG. 14 shows the distribution of read-starts around 24,666
CTCF binding sites in the human genome in a variety of different
samples, centered around the binding site itself. CTCF is an
insulator binding protein and plays a major role in transcriptional
repression. Previous studies suggest that CTCF binding sites anchor
local nucleosome positioning such that at least 20 nucleosomes are
symmetrically and regularly spaced around a given binding site,
with an approximate period of 185 bp. One striking feature common
to nearly all of the samples in FIG. 14 is the clear periodicity of
nucleosome positioning both upstream and downstream of the binding
site, suggesting that the local and largely symmetrical effects of
CTCF binding in vivo are recapitulated in a variety of cfDNA and
MNase-digested samples. Intriguingly, the periodicity of the
upstream and downstream peaks is not uniform across the set of
samples; the MNase-digested samples display slightly wider spacing
of the peaks relative to the binding site, suggesting the utility
of not only the intensity of the peaks, but also their period.
[0156] FIG. 15 shows the distribution of read-starts around 5,644
c-Jun binding sites. While the familiar periodicity is again
visually identifiable for several samples in this figure, the
effect is not uniform. Of note, three of the MNase-digested samples
(Hap1.MNase, HEK.MNase, and NA12878.MNase) have much flatter
distributions, which may indicate that c-Jun binding sites are not
heavily occupied in these cells, or that the effect of c-Jun
binding on local chromatin remodeling is less pronounced in these
cell types. Regardless of the underlying mechanism, the observation
that bias in the local neighborhood of read-starts varies from TF
to TF and between sample types reinforces the potential role for
read start-based inference of nucleosome occupancy for correlating
or deconvoluting tissue-of-origin composition in cfDNA samples.
[0157] FIG. 16 shows the distribution of read-starts around 4,417
NF-YB binding sites. The start site distributions in the
neighborhood of these TF binding sites demonstrate a departure from
symmetry: here, the downstream effects (to the right within each
plot) appear to be stronger than the upstream effects, as evidenced
by the slight upward trajectory in the cfDNA samples. Also of note
is the difference between the MNase-digested samples and the cfDNA
samples: the former show, on average, a flatter profile in which
peaks are difficult to discern, whereas the latter have both more
clearly discernable periodicity and more identifiable peaks.
Methods for Examples 1-3
Clinical and Control Samples
[0158] Whole blood was drawn from pregnant women fgs002, fgs003,
fgs004, and fgs005 during routine third-trimester prenatal care and
stored briefly in Vacutainer tubes containing EDTA (BD). Whole
blood from pregnant women IM1, GM1, and GM2 was obtained at 18, 13,
and 10 weeks gestation, respectively, and stored briefly in
Vacutainer tubes containing EDTA (BD). Whole blood from glioma
patients 2349, 2350, 2351, and 2353 was collected as part of brain
surgical procedures and stored for less than three hours in
Vacutainer tubes containing EDTA (BD). Whole blood from Male
Control 2 (MC2), a healthy adult male, was collected in Vacutainer
tubes containing EDTA (BD). Four to ten ml of blood was available
for each individual. Plasma was separated from whole blood by
centrifugation at 1,000.times.g for 10 minutes at 4.degree. C.,
after which the supernatant was collected and centrifuged again at
2,000.times.g for 15 minutes at 4.degree. C. Purified plasma was
stored in 1 ml aliquots at -80.degree. C. until use.
[0159] Bulk human plasma, containing contributions from an unknown
number of healthy individuals, was obtained from STEMCELL
Technologies (Vancouver, British Columbia, Canada) and stored in 2
ml aliquots at -80.degree. C. until use.
Processing of Plasma Samples
[0160] Frozen plasma aliquots were thawed on the bench-top
immediately before use. Circulating cfDNA was purified from 2 ml of
each plasma sample with the QiaAMP Circulating Nucleic Acids kit
(Qiagen, Venlo, Netherlands) as per the manufacturer's protocol.
DNA was quantified with a Qubit fluorometer (Invitrogen, Carlsbad,
Calif.) and a custom qPCR assay targeting a human Alu sequence.
MNase Digestions
[0161] Approximately 50 million cells of each line (GM12878, HeLa
S3, HEK, Hap1) were grown using standard methods. Growth media was
aspirated and cells were washed with PBS. Cells were trypsinized
and neutralized with 2.times. volume of CSS media, then pelleted in
conical tubes by centrifugation for at 1,300 rpm for 5 minutes at
4.degree. C. Cell pellets were resuspended in 12 ml ice-cold PBS
with 1.times. protease inhibitor cocktail added, counted, and then
pelleted by centrifugation for at 1,300 rpm for 5 minutes at
4.degree. C. Cell pellets were resuspended in RSB buffer (10 mM
Tris-HCl, 10 mM NaCl, 3 mM MgCl.sub.2, 0.5mM spermidine, 0.02%
NP-40, 1.times. protease inhibitor cocktail) to a concentration of
3 million cells per ml and incubated on ice for 10 minutes with
gentle inversion. Nuclei were pelleted by centrifugation at 1,300
rpm for five minutes at 4.degree. C. Pelleted nuclei were
resuspended in NSB buffer (25% glycerol, 5 mM MgAc.sub.2, 5 mM
HEPES, 0.08 mM EDTA, 0.5 mM spermidine, 1 mM DTT, 1.times. protease
inhibitor cocktail) to a final concentration of 15M per ml. Nuclei
were again pelleted by centrifugation at 1,300 rpm for 5 minutes at
4.degree. C., and resuspended in MN buffer (500 mM Tris-HCl, 10 mM
NaCl, 3 mM MgCl.sub.2, 1 mM CaCl, 1.times. protease inhibitor
cocktail) to a final concentration of 30M per ml. Nuclei were split
into 200 .mu.l aliquots and digested with 4 U of micrococcal
nuclease (Worthington Biochemical Corp., Lakewood, N.J., USA) for
five minutes at 37.degree. C. The reaction was quenched on ice with
the addition of 85 82 l of MNSTOP buffer (500 mM NaCl, 50 mM EDTA,
0.07% NP-40, 1.times. protease inhibitor), followed by a 90 minute
incubation at 4.degree. C. with gentle inversion. DNA was purified
using phenol:chloroform:isoamyl alcohol extraction. Mononucleosomal
fragments were size selected with 2% agarose gel electrophoresis
using standard methods and quantified with a Nanodrop
spectrophotometer (Thermo Fisher Scientific Inc., Waltham, Mass.,
USA).
Preparation of Sequencing Libraries
[0162] Barcoded sequencing libraries for all samples were prepared
with the ThruPLEX-FD or ThruPLEX DNA-seq 48 D kits (Rubicon
Genomics, Ann Arbor, Mich.), comprising a proprietary series of
end-repair, ligation, and amplification reactions. Between 3.0 and
10.0 ng of DNA were used as input for all clinical sample
libraries. Two bulk plasma cfDNA libraries were constructed with 30
ng of input to each library; each library was separately barcoded.
Two libraries from MC2 were constructed with 2 ng of input to each
library; each library was separately barcoded. Libraries for each
of the MNase-digested cell lines were constructed with 20 ng of
size-selected input DNA. Library amplification for all samples was
monitored by real-time PCR to avoid over-amplification.
Sequencing
[0163] All libraries were sequenced on HiSeq 2000 instruments
(Illumina, Inc., San Diego, Calif., USA) using paired-end 101 bp
reads with an index read of 9 bp. One lane of sequencing was
performed for pooled samples fgs002, fgs003, fgs004, and fgs005,
yielding a total of approximately 4.5.times.10.sup.7 read-pairs per
sample. Samples IM1, GM1, and GM2 were sequenced across several
lanes to generate 1.2.times.10.sup.9, 8.4.times.10.sup.8, and
7.6.times.10.sup.7 read-pairs, respectively. One lane of sequencing
was performed for each of samples 2349, 2350, 2351, and 2353,
yielding approximately 2.0.times.10.sup.8 read-pairs per sample.
One lane of sequencing was performed for each of the four cell line
MNase-digested libraries, yielding approximately 2.0.times.10.sup.8
read-pairs per library. Four lanes of sequencing were performed for
one of the two replicate MC2 libraries and three lanes for one of
the two replicate bulk plasma libraries, yielding a total of
10.6.times.10.sup.9 and 7.8.times.10.sup.8 read-pairs per library,
respectively.
Processing of cfDNA Sequencing Data
[0164] DNA insert sizes for both cfDNA and MNase libraries tend be
short (majority of data between 80 bp and 240 bp); adapter sequence
at the read ends of some molecules were therefore expected. Adapter
sequences starting at read ends were trimmed, and forward and
reverse read of paired end ("PE") data for short original molecules
were collapsed into single reads ("SRs"); PE reads that overlap
with at least 11 bp reads were collapsed to SRs. The SRs shorter
than 30 bp or showing more than 5 bases with a quality score below
10 were discarded. The remaining PE and SR data were aligned to the
human reference genome (GRCh37, 1000 G release v2) using fast
alignment tools (BWA-ALN or BWA-MEM). The resulting SAM (Sequence
Alignment/Map) format was converted to sorted BAM (Binary Sequence
Alignment/Map format) using SAMtools.
Additional Publically Available Data
[0165] Publically available PE data of Hela-S3 MNase (accessions
SRR633612, SRR633613) and MCF-7 MNase experiments (accessions
SRR999659-SRR999662) were downloaded and processed as described
above.
[0166] Publicly available genomic shotgun sequencing data of the
CEPH pedigree 146 individual NA12878 generated by Illumina
Cambridge Ltd. (Essex, UK) was obtained from the European
Nucleotide Archive (ENA, accessions ERR174324-ERR174329). This data
was PE sequenced with 2x101bp reads on the Illumina HiSeq platform
and the libraries were selected for longer insert sizes prior to
sequencing. Thus, adapter sequence at the read ends were not
expected; this data was therefore directly aligned using
BWA-MEM.
Extracting Read End Information
[0167] PE data provides information about the two physical ends of
DNA molecules used in sequencing library preparation. This
information was extracted using the SAMtools application
programming interface (API) from BAM files. Both outer alignment
coordinates of PE data for which both reads aligned to the same
chromosome and where reads have opposite orientations were used.
For non-trimmed SR data, only one read end provides information
about the physical end of the original DNA molecule. If a read was
aligned to the plus strand of the reference genome, the left-most
coordinate was used. If a read was aligned to the reverse strand,
its right-most coordinate was used instead. In cases where PE data
was converted to single read data by adapter trimming, both end
coordinates were considered. Both end coordinates were also
considered if at least five adapter bases were trimmed from a SR
sequencing experiment.
[0168] For all autosomes in the human reference sequence
(chromosomes 1 to 22), the number of read ends and the coverage at
all positions were extracted in windows of 10,000 bases (blocks).
If there were no reads aligning in a block, the block was
considered empty for that specific sample.
Smooth Periodograms
[0169] The ratio of read-starts and coverage was calculated for
each non-empty block of each sample. If the coverage was 0, the
ratio was set to 0. These ratios were used to calculate a
periodogram of each block using Fast Fourier Transform (FFT,
spec.pgram in the R statistical programming environment) with
frequencies between 1/500 bases and 1/100 bases. Optionally,
parameters to smooth (3 bp Daniell smoother; moving average giving
half weight to the end values) and detrend the data (e.g., subtract
the mean of the series and remove a linear trend) were used.
Intensities for the frequency range 120-250 bp for each block were
saved.
Average Chromosome Intensities
[0170] For a set of samples, blocks that were non-empty across all
samples were identified. The intensities for a specific frequency
were averaged across all blocks of each sample for each
autosome.
Principal Component Analysis and Dendograms
[0171] Blocks that were non-empty across samples were collected.
Principal component analysis (PCA; prcomp in the R statistical
programming environment) was used to reduce the dimensionality of
the data and to plot it in two-dimensional space. PCA identifies
the dimension that captures most variation of the data and
constructs orthogonal dimensions, explaining decreasing amounts of
variation in the data.
[0172] Pair-wise Euclidean distances between sample intensities
were calculated and visualized as dendograms (stats library in the
R statistical programming environment).
Transcription Factor Binding Site Predictions
[0173] Putative transcription factor binding sites, obtained
through analysis of ChlP-seq data generated across a number of cell
types, was obtained from the ENCODE project.
[0174] An independent set of candidate transcription factor binding
sites was obtained by scanning the human reference genome (GRCh37,
1000 G release v2) with the program fimo from the MEME software
package (version 4.10.0_1). Scans were performed using positional
weight matrices obtained from the JASPAR_CORE_2014_vertebrates
database, using options "-verbosity 1-thresh 1e-5". Transcription
factor motif identifiers used were MA0139.1, MA0502.1, and
MA0489.1.
[0175] Chromosomal coordinates from both sets of predicted sites
were intersected with bedtools v2.17.0. To preserve any asymmetry
in the plots, only predicted binding sites on the "+" strand were
used. Read-starts were tallied for each sample if they fell within
500 bp of either end of the predicted binding site, and summed
within samples by position across all such sites. Only samples with
at least 100 million total reads were used for this analysis.
Example 4
Determining Normal/Healthy Tissue(s)-of-Origin from cfDNA
[0176] To evaluate whether fragmentation patterns observed in a
single individual's cfDNA might contain evidence of the genomic
organization of the cells giving rise to these fragments--and thus,
of the tissue(s)-of-origin of the population of cfDNA
molecules--even when there are no genotypic differences between
contributing cell types, cfDNA was deeply sequenced to better
understand the processes that give rise to it. The resulting data
was used to build a genome-wide map of nucleosome occupancy that
built on previous work by others, but is substantially more
comprehensive. By optimizing library preparation protocols to
recover short fragments, it was discovered that the in vivo
occupancies of transcription factors (TFs) such as CTCF are also
directly footprinted by cfDNA. Finally, it was discovered that
nucleosome spacing in regulatory elements and gene bodies, as
revealed by cfDNA sequencing in healthy individuals, correlates
most strongly with DNase hypersensitivity and gene expression in
lymphoid and myeloid cell lines.
cfDNA Fragments Correspond to Chromatosomes and Contain Substantial
DNA Damage
[0177] Conventional sequencing libraries were prepared by
end-repair and adaptor ligation to cfDNA fragments purified from
plasma pooled from an unknown number of healthy individuals
("BH01") or plasma from a single individual ("IH01") (FIG. 17;
Table 1):
TABLE-US-00001 TABLE 1 Sequencing Statistics for Plasma Samples.
Sample Library Fragments Aligned Est. % name type Reads sequenced
Aligned Q30 Coverage duplicates 35-80 bp 120-180 bp BH01 DSP 2x101
1489569204 97.20% 88.85% 96.32 6.00% 0.65% 57.64% IH01 DSP 2x101
1572050374 98.58% 90.60% 104.92 21.00% 0.77% 47.83% IH02 SSP 2x50,
779794090 93.19% 75.27% 30.08 20.05% 21.83% 44.00% 43/42 CH01 -- --
3841413668 96.95% 86.81% 231.32 14.99% 5.00% 50.85% SSP,
single-stranded library preparation protocol. DSP, double-stranded
library preparation protocol.
[0178] For each sample, sequencing-related statistics, including
the total number of fragments sequenced, read lengths, the
percentage of such fragments aligning to the reference with and
without a mapping quality threshold, mean coverage, duplication
rate, and the proportion of sequenced fragments in two length bins,
were tabulated. Fragment length was inferred from alignment of
paired-end reads. Due to the short read lengths, coverage was
calculated by assuming the entire fragment had been read. The
estimated number of duplicate fragments was based on fragment
endpoints, which may overestimate the true duplication rate in the
presence of highly stereotyped cleavage. SSP, single-stranded
library preparation protocol. DSP, double-stranded library
preparation protocol.
[0179] Libraries BH01 and IH01 were sequenced to 96- and 105-fold
coverage, respectively (1.5 G and 1.6 G fragments). The fragment
length distributions, inferred from alignment of paired-end reads,
have a dominant peak at .about.167 bp (coincident with the length
of DNA associated with a chromatosome), and .about.10.4 bp
periodicity in the 100-160 bp length range (FIG. 18). These
distributions are consistent with a model in which cfDNA fragments
are preferentially protected from nuclease cleavage both pre- and
post-cell death by association with proteins--in this case, by the
nucleosome core particle and linker histone--but where some degree
of additional nicking or cleavage occurs in relation to the helical
pitch of nucleosome-bound DNA. Further supporting this model is the
dinucleotide composition of these 167 bp fragments, which
recapitulate key features of earlier studies of MNase-derived,
nucleosome-associated fragments (e.g. bias against A/T
dinucleotides at the dyad) and support the notion that the
nucleosome core particle is symmetrically positioned with respect
to the chromatosome (FIG. 19).
[0180] A prediction of this model of cfDNA ontology is widespread
DNA damage, e.g. single-strand nicks as well as 5' and 3'
overhangs. During conventional library preparation, nicked strands
are not amplified, overhangs are blunted by end-repair, and short
double stranded DNA ("dsDNA") molecules, which may represent a
substantial proportion of total cfDNA, may simply be poorly
recovered. To address this, a single-stranded sequencing library
from plasma-borne cfDNA derived from an additional healthy
individual (`IH02`) was prepared using a protocol adapted from
studies of ancient DNA by Gansauge, et al., where widespread DNA
damage and nuclease cleavage around nucleosomes have been reported.
Briefly, cfDNA was denatured and a biotin-conjugated,
single-stranded adaptor was ligated to the resulting fragments. The
ligated fragments were then subjected to second-strand synthesis,
end-repair and ligation of a second adaptor while the fragments
were immobilized to streptavidin beads. Finally, minimal PCR
amplification was performed to enrich for adaptor-bearing molecules
while also appending a sample index (FIG. 20; Table 2).
TABLE-US-00002 TABLE 2 Synthetic oligos used in preparation of
single stranded sequencing libraries. Oligo Name Sequence (5'-3')
Notes CL9 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT HPLC purification
Adapter2.1 CGACGCTCTTCCGATC/ddT/ HPLC purification Adapter2.2
/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAG*T*G*T*A HPLC purification
CL78 /5Phos/AGATCGGAAG/ISpC3/ISpC3/ISpC3/ISpC3/ISpC3/ISpC3/ Dual
HPLC /ISpC3/ISpC3/ISpC3/ISpC3/3BioTEG/ purification
[0181] For IH02, the resulting library was sequenced to 30-fold
coverage (779M fragments). The fragment length distribution again
exhibited a dominant peak at .about.167 bp corresponding to the
chromatosome, but was considerably enriched for shorter fragments
relative to conventional library preparation (FIGS. 21, 22, 23A-B,
24A-B). Although all libraries exhibit .about.10.4 bp periodicity,
the fragment sizes are offset by 3 bp for the two methods,
consistent with damaged or non-flush input molecules whose true
endpoints are more faithfully represented in single-stranded
libraries.
A Genome-Wide Map of In Vivo Nucleosome Protection Based on Deep
cfDNA Sequencing
[0182] To assess whether the predominant local positions of
nucleosomes across the human genome in tissue(s) contributing to
cfDNA could be inferred by comparing the distribution of aligned
fragment endpoints, or a mathematical transformation thereof, to
one or more reference maps, a Windowed Protection Score ("WPS") was
developed. Specifically, it was expected that cfDNA fragment
endpoints should cluster adjacent to nucleosome boundaries, while
also being depleted on the nucleosome itself. To quantify this, the
WPS was developed, which represents the number of DNA fragments
completely spanning a 120 bp window centered at a given genomic
coordinate, minus the number of fragments with an endpoint within
that same window (FIG. 25). As intended, the value of the WPS
correlates with the locations of nucleosomes within strongly
positioned arrays, as mapped by other groups with in vitro methods
or ancient DNA (FIG. 26). At other sites, the WPS correlates with
genomic features such as DNase I hypersensitive (DHS) sites (e.g.,
consistent with the repositioning of nucleosomes flanking a distal
regulatory element) (FIG. 27).
[0183] A heuristic algorithm was applied to the genome-wide WPS of
the BH01, IH01 and IH02 datasets to identify 12.6M, 11.9M, and 9.7M
local maxima of nucleosome protection, respectively (FIGS. 25-31).
In each sample, the mode of the distribution of distances between
adjacent peaks was 185 bp with low variance (FIG. 30), generally
consistent with previous analyses of the nucleosome repeat length
in human or mouse cells.
[0184] To determine whether the positions of peak calls were
similar across samples, the genomic distance for each peak in a
sample to the nearest peak in each of the other samples was
calculated. High concordance was observed (FIG. 31; FIGS. 32A-C).
The median (absolute) distance from a BH01 peak call to a
nearest-neighbor IH01 peak call was 23 bp overall, but was less
than 10 bp for the most highly scored peaks (FIGS. 33A-B).
[0185] Because biases introduced either by nuclease specificity or
during library preparation might artifactually contribute to the
signal of nucleosome protection, fragment endpoints were also
simulated, matching for the depth, size distribution and terminal
dinucleotide frequencies of each sample. Genome-wide WPS were then
calculated, and 10.3M, 10.2M, and 8.0M were called local maxima by
the same heuristic, for simulated datasets matched to BH01, IH01
and IH02, respectively. Peaks from simulated datasets were
associated with lower scores than peaks from real datasets (FIGS.
33A-B). Furthermore, the relatively reproducible locations of peaks
called from real datasets (FIG. 31; FIGS. 32A-C) did not align well
with the locations of peaks called from simulated datasets (FIG.
31; FIGS. 34A-C).
[0186] To improve the precision and completeness of the genome-wide
nucleosome map, the cfDNA sequencing data from BH01, IH01, and IH02
were pooled and reanalyzed for a combined 231 fold-coverage
(`CH01`; 3.8 B fragments; Table 1). The WPS was calculated and
12.9M peaks were called for this combined sample. This set of peak
calls was associated with higher scores and approached saturation
in terms of the number of peaks (FIGS. 33A-B). Considering all
peak-to-peak distances that were less than 500 bp (FIG. 35), the
CH01 peak set spans 2.53 gigabases (Gb) of the human reference
genome.
[0187] Nucleosomes are known to be well-positioned in relation to
landmarks of gene regulation, for example transcriptional start
sites and exon-intron boundaries. Consistent with that
understanding, similar positioning was observed in this data as
well, in relation to landmarks of transcription, translation and
splicing (FIGS. 36-40). Building on past observations of
correlations between nucleosome spacing with transcriptional
activity and chromatin marks, the median peak-to-peak spacing
within 100 kilobase (kb) windows that had been assigned to
compartment A (enriched for open chromatin) or compartment B
(enriched for closed chromatin) on the basis of long-range
interactions (in situ Hi-C) in a lymphoblastoid cell line was
examined. Nucleosomes in compartment A exhibited tighter spacing
than nucleosomes in compartment B (median 187 bp (A) vs. 190 bp
(B)), with further differences between certain subcompartments
(FIG. 41). Along the length of chromosomes, no general pattern was
seen, except that median nucleosome spacing dropped sharply in
pericentromeric regions, driven by strong positioning across arrays
of alpha satellites (171 bp monomer length; FIG. 42; FIG. 26).
Short cfDNA Fragments Directly Footprint CTCF and Other
Transcription Factors
[0188] Previous studies of DNase I cleavage patterns identified two
dominant classes of fragments: longer fragments associated with
cleavage between nucleosomes, and shorter fragments associated with
cleavage adjacent to transcription factor binding sites (TFBS). To
assess whether in vivo-derived cfDNA fragments also resulted from
two classes of sensitivity to nuclease cleavage, sequence reads
(CH01) were partitioned on the basis of inferred fragment length,
and the WPS was recalculated using long fragments (120-180 bp; 120
bp window; effectively the same as the WPS described above for
nucleosome calling) or short fragments (35-80 bp; 16 bp window)
separately (FIGS. 26-27). To obtain a set of well-defined TFBSs
enriched for actively bound sites in our data, clustered FIMO
predictions were intersected with a unified set of ChIP-seq peaks
from ENCODE (TfbsClusteredV3) for each TF.
[0189] The long fraction WPS supports strong organization of
nucleosomes in the vicinity of CTCF binding sites (FIG. 43).
However, a strong signal in the short fraction WPS is also observed
that is coincident with the CTCF binding site itself (FIGS. 44-45).
CTCF binding sites were stratified based on a presumption that they
are bound in vivo (all FIMO predictions vs. the subset intersecting
with ENCODE ChIP-seq vs. the further subset intersecting with those
that appear to be utilized across 19 cell lines). Experimentally
well-supported CTCF sites exhibit a substantially broader spacing
between the flanking -1 and +1 nucleosomes based on the long
fraction WPS, consistent with their repositioning upon CTCF binding
(.about.190 bp.fwdarw..about.260 bp; FIGS. 45-48). Furthermore,
experimentally well-supported CTCF sites exhibit a much stronger
signal for the short fraction WPS over the CTCF binding site itself
(FIGS. 49-52).
[0190] Similar analyses were performed for additional TFs for which
both FIMO predictions and ENCODE CHiP-seq data were available
(FIGS. 53A-H). For many of these TFs, such as ETS and MAFK (FIGS.
54-55), a short fraction footprint was observed, accompanied by
periodic signal in the long fraction WPS. This is consistent with
strong positioning of nucleosomes surrounding bound TFBS. Overall,
these data support the view that short cfDNA fragments, which are
recovered markedly better by the single-stranded protocol (FIG. 18,
FIG. 21), directly footprint the in vivo occupancy of DNA-bound
transcription factors, including CTCF and others.
Nucleosome Spacing Patterns Inform cfDNA Tissues-of-Origin
[0191] To determine whether in vivo nucleosome protection, as
measured through cfDNA sequencing, could be used to infer the cell
types contributing to cfDNA in healthy individuals, the
peak-to-peak spacing of nucleosome calls within DHS sites defined
in 116 diverse biological samples was examined. Widened spacing was
previously observed between the -1 and +1 nucleosomes at regulatory
elements (e.g., anecdotally at DHS sites (FIG. 27) or globally at
bound CTCF sites (FIG. 45)). Similar to bound CTCF sites,
substantially broader spacing was observed for nucleosome pairs
within a subset of DHS sites, plausibly corresponding to sites at
which the nucleosomes are repositioned by intervening transcription
factor binding in the cell type(s) giving rise to cfDNA (.about.190
bp.fwdarw..about.260 bp; FIG. 56). Indeed, the proportion of
widened nucleosome spacing (.about.260 bp) varies considerably
depending on which cell type's DHS sites are used. However, all of
the cell types for which this proportion is highest are lymphoid or
myeloid in origin (e.g., CD3_CB-DS17706, etc. in FIG. 56). This is
consistent with hematopoietic cell death as the dominant source of
cfDNA in healthy individuals.
[0192] Next the signal of nucleosome protection in the vicinity of
transcriptional start sites was re-examined (FIG. 36). When the
signal was stratified based on gene expression in a lymphoid
lineage cell line, NB-4, strong differences in the locations or
intensity of nucleosome protection in relation to the TSS were
observed, in highly vs. lowly expressed genes (FIG. 57).
Furthermore, the short fraction WPS exhibits a clear footprint
immediately upstream of the TSS whose intensity also strongly
correlates with expression level (FIG. 58). This plausibly reflects
footprinting of the transcription preinitiation complex, or some
component thereof, at transcriptionally active genes.
[0193] These data demonstrate that cfDNA fragmentation patterns do
indeed contain signal that might be used to infer the tissue(s) or
cell-type(s) giving rise to cfDNA.
[0194] However, a challenge is that relatively few reads in a
genome-wide cfDNA library directly overlap DHS sites and
transcriptional start sites.
[0195] Nucleosome spacing varies between cell types, and as a
function of chromatin state and gene expression. In general, open
chromatin and transcription are associated with a shorter
nucleosome repeat length, consistent with this Example's analyses
of compartment A vs. B (FIG. 41). This Example's peak call data
also exhibits a correlation between nucleosome spacing across gene
bodies and their expression levels, with tighter spacing associated
with higher expression (FIG. 59; .rho.=-0.17; n=19,677 genes). The
correlation is highest for the gene body itself, relative to
adjacent regions (upstream 10 kb .rho.=-0.08; downstream 10 kb
.rho.=-0.01). If the analysis is limited to gene bodies that span
at least 60 nucleosome calls, tighter nucleosome spacing is even
more strongly correlated with gene expression (.rho.=-0.50;
n=12,344 genes).
[0196] One advantage of exploiting signals such as nucleosome
spacing across gene bodies or other domains is that a much larger
proportion of cfDNA fragments will be informative. Another
potential advantage is that mixtures of signals resulting from
multiple cell types contributing to cfDNA might be detectable. To
test this, a further mathematical transformation, fast Fourier
transformation (FFT), was performed on the long fragment WPS across
the first 10 kb of gene bodies and on a gene-by-gene basis. The
intensity of the FFT signal correlated with gene expression at
specific frequency ranges, with a maximum at 177-180 bp for
positive correlation and a minimum at .about.199 bp for negative
correlation (FIG. 60). In performing this analysis against a
dataset of 76 expression datasets for human cell lines and primary
tissues, the strongest correlations were with hematopoietic
lineages (FIG. 60). For example, the most highly ranked negative
correlations with average intensity in the 193-199 bp frequency
range for each of three healthy samples (BH01, IH01, IH02) were all
to lymphoid cell lines, myeloid cell lines, or bone marrow tissue
(FIG. 61; Table 3):
TABLE-US-00003 TABLE 3 Correlation of WPS FFT intensities with gene
expression datasets. Correlations Rank Differences RName Category
Type Description BH01 IH01 IH02 IC15 IC20 IC17 IC37 IC35 healthy
IC15 IC20 IC17 IC37 IC35 A.431 Skin Skin Epidermoid -0.298 -0.188
-0.149 -0.200 -0.140 -0.176 -0.195 -0.178 2 3 -9 -9 -12 -21 cancer
carcinoma (Squamous cell line cells) A549 Lung Lung Lung -0.269
-0.185 -0.144 -0.202 -0.139 -0.172 -0.188 -0.170 3 -14 -12 -9 -2
-13 carcinoma carcinoma cell line adipose.sub.-- Primary Adipose
Primary -0.270 -0.169 -0.137 -0.169 -0.121 -0.153 -0.166 -0.146 1
12 5 0 14 12 tissue Tissue tissue tissue adrenal.sub.-- Primary
Adrenal Primary -0.257 -0.158 -0.131 -0.173 -0.118 -0.145 -0.161
-0.138 -2 -11 -5 1 5 6 gland Tissue gland tissue AN3.CA
Breast/Female Uterine Metastatic -0.303 -0.194 -0.157 -0.213 -0.147
-0.183 -0.195 -0.171 -4 -16 -13 -15 -6 -2 Reproductive cancer
endometrial adenocarcinoma cell line appendix Primary Appendix
Primary -0.287 -0.185 -0.137 -0.168 -0.118 -0.148 -0.171 -0.152 6
24 20 23 6 9 Tissue tissue BEWO Other Uterine Metastatic -0.254
-0.184 -0.147 -0.193 -0.139 -0.173 -0.194 -0.173 -5 3 -12 -15 -19
-27 cancer choriocarcinoma cell line bone.sub.-- Primary Bone
Primary -0.343 -0.230 -0.165 -0.192 -0.142 -0.167 -0.193 -0.165 2
40 9 30 18 28 marrow Tissue marrow tissue CACO_2 Abdominal Colon
Colon -0.281 -0.177 -0.137 -0.192 -0.128 -0.169 -0.184 -0.164 5 -5
-5 -14 -10 -9 adenocarcinoma adenocarcinoma cell line CAPAH_2
Abdominal Pancreas Pancreas -0.291 -0.187 -0.145 -0.202 -0.136
-0.176 -0.195 -0.175 3 -12 -2 -10 -19 -25 adenocarcinoma
adenocarcinoma cell line cerebral.sub.-- Primary Cerebral Primary
-0.225 -0.136 -0.120 -0.168 -0.103 -0.134 -0.142 -0.125 -1 -9 -3 0
0 0 cortex Tissue cortex tissue colon Primary Colon Primary -0.261
-0.162 -0.124 -0.154 -0.111 -0.145 -0.168 -0.148 7 6 6 6 -7 1
Tissue tissue Daudi Lymphoid Human Human -0.321 -0.206 -0.153
-0.195 -0.133 -0.165 -0.169 -0.160 4 17 19 19 13 24 Burkitt Burkitt
lymphoma lymphoma cell line duodenum Primary Duodenum Primary
-0.281 -0.164 -0.122 -0.159 -0.109 -0.144 -0.166 -0.144 10 10 10 7
-4 7 Tissue tissue EFO.21 Breast/Female Ovarian Metastatic -0.287
-0.186 -0.149 -0.201 -0.140 -0.176 -0.168 -0.169 -7 -9 -14 -20 -1
-8 Reproductive cancer ovarian corpus cystadenocarcinoma cell line
endometrium Primary Endometrium Primary -0.257 -0.158 -0.132 -0.170
-0.119 -0.151 -0.156 -0.151 -3 -11 -4 -9 -3 -12 Tissue tissue
esophagus Primary Esophagus Primary -0.237 -0.147 -0.124 -0.156
-0.116 -0.141 -0.158 -0.145 -3 1 -7 0 0 -7 Tissue tissue
fallopian.sub.-- Primary Fallopian Primary -0.247 -0.157 -0.129
-0.171 -0.114 -0.145 -0.161 -0.145 -4 -13 -2 -3 3 -2 tube Tissue
tube tissue gallbladder Primary Gallbladder Primary -0.249 -0.156
-0.119 -0.153 -0.103 -0.138 -0.154 -0.141 4 4 4 3 4 1 Tissue tissue
HaCaT Skin Keratinocyte Keratinocyte -0.290 -0.186 -0.149 -0.194
-0.142 -0.173 -0.193 -0.173 -5 7 -18 -4 -6 -17 cell line cell line
HDLM.2 Lymphoid Hodgkin Hodgkin -0.316 -0.200 -0.154 -0.201 -0.138
-0.173 -0.195 -0.171 1 6 11 1 -5 -5 lymphoma lymphoma cell line
heart.sub.-- Primary Heart Primary -0.248 -0.149 -0.126 -0.168
-0.113 -0.141 -0.155 -0.140 -3 -3 -3 0 3 2 muscle Tissue muscle
tissue HEX_293 Other Kidney Embryonal -0.292 -0.187 -0.150 -0.209
-0.139 -0.172 -0.159 -0.168 -4 -17 -4 -2 3 0 adrenal kidney cell
precursor line, cell line transformed by adenovirus type 5 HEL
Myeloid Erythroleukemia Erythroleukemia -0.324 -0.205 -0.161 -0.210
-0.140 -0.172 -0.194 -0.168 -1 -5 4 12 5 14 cell line (AML M8 in
relapse after treatment for Hodgkin's disease) HeLa Breast/Female
Cervical Cervical -0.286 -0.186 -0.149 -0.203 -0.139 -0.172 -0.190
-0.171 1 -10 -5 -3 1 -6 Reproductive cancer epithelial
adenocarcinoma cell line Hep_G2 Abdominal Hepatocellular
Hepatocellular -0.294 -0.186 -0.152 -0.202 -0.145 -0.186 -0.196
-0.167 -4 -6 -18 -24 -17 2 carcinoma carcinoma cell line HL.60
Myeloid Promyelocytic Acute -0.332 -0.208 -0.161 -0.202 -0.137
-0.171 -0.197 -0.170 2 8 18 18 -1 11 leukemia promyelocytic
leukemia (APL) cell line HMC.1 Myeloid Mastcell Mastcell -0.337
-0.228 -0.165 -0.212 -0.149 -0.181 -0.199 -0.180 0 -1 -2 3 0 -2
leukemia leukemia cell line K.662 Lymphoid Leukemia Chronic -0.317
-0.202 -0.158 -0.211 -0.143 -0.176 -0.195 -0.166 -3 -9 -5 -5 -1 13
myeloid leukemia (CML) cell line Karpas.707 Lymphoid Multiple
Multiple -0.325 -0.210 -0.155 -0.195 -0.138 -0.167 -0.188 -0.154 4
20 18 22 21 22 myeloma myeloma cell line kidney Primary Kidney
Primary -0.245 -0.150 -0.130 -0.163 -0.119 -0.153 -0.171 -0.147 -7
-4 -12 -19 -21 -6 Tissue tissue liver Primary Liver Primary -0.248
-0.148 -0.122 -0.150 -0.110 -0.150 -0.184 -0.138 1 4 -1 -13 -4 3
Tissue tissue lung Primary Lung Primary -0.254 -0.170 -0.133 -0.170
-0.121 -0.148 -0.167 -0.149 3 4 0 7 3 6 Tissue tissue lymph_node
Primary Lymph Primary -0.308 -0.195 -0.148 -0.162 -0.128 -0.155
-0.161 -0.156 7 24 17 25 14 22 Tissue node tissue MCF7
Breast/Female Breast Metastatic -0.298 -0.195 -0.154 -0.207 -0.145
-0.183 -0.196 -0.181 -3 -9 -12 -18 -11 -19 Reproductive cancer
breast adenocarcinoma cell line MOLT.4 Lymphoid Leukemia Acute
-0.323 -0.204 -0.163 -0.212 -0.144 -0.177 -0.197 -0.173 -3 -7 -2 -1
-5 -1 (ALL) lymphoblastic leukemia (T-ALL) cell line NB.4 Myeloid
Promyelocytic Acute -0.348 -0.228 -0.172 -0.211 -0.148 -0.182
-0.202 -0.171 0 4 3 5 2 13 leukemia promyelocytic leukemia (APL)
cell line NTERA_2 Urinary/Male Urinary Metastatic -0.269 -0.170
-0.137 -0.193 -0.117 -0.157 -0.169 -0.153 -2 -8 18 -2 5 0
Reproductive cancer embryonal carcinoma cell line, cloned from
TERA-2 ovary Primary Ovary Primary -0.268 -0.162 -0.135 -0.181
-0.120 -0.152 -0.166 -0.151 1 -7 2 -2 6 -1 Tissue tissue pancreas
Primary Pancreas Primary -0.250 -0.159 -0.132 -0.170 -0.116 -0.150
-0.166 -0.150 -5 -5 1 -8 -5 -7 Tissue tissue PC.3 Urinary/Male
Prostate Metastatic -0.295 -0.190 -0.151 -0.204 -0.138 -0.174
-0.188 -0.173 -3 -10 2 -6 8 -12 Reproductive cancer poorly
differentiated prostate adenocarcinoma cell line placenta Primary
Placenta Primary -0.266 -0.168 -0.134 -0.168 -0.126 -0.151 -0.168
-0.150 3 10 -7 1 9 6 Tissue tissue prostate Primary Prostate
Primary -0.248 -0.161 -0.133 -0.175 -0.123 -0.150 -0.165 -0.151 -8
-10 -11 -8 1 -12 Tissue tissue rectum Primary Rectum Primary -0.255
-0.154 -0.117 -0.159 -0.102 -0.136 -0.161 -0.142 6 0 5 4 -2 0
Tissue tissue REH Lymphoid Leukemia Pre-B cell -0.330 -0.216 -0.165
-0.214 -0.150 -0.162 -0.204 -0.174 -2 -5 -5 -2 -4 1 (ALL) leukemia
cell line (ALL, first relapse) RH.30 Sarcoma Rhabdomyosarcoma
Metastatic -0.260 -0.165 -0.137 -0.194 -0.125 -0.158 -0.175 -0.158
2 -14 -3 -7 -7 -7 rhabdomyosarcoma cell line RPML3226 Lymphoid
Multiple Multiple -0.322 -0.207 -0.155 -0.198 -0.138 -0.169 -0.190
-0.164 1 18 11 19 14 22 Myeloma myeloma cell line RT4 Urinary/Male
Bladder Urinary -0.282 -0.168 -0.145 -0.192 -0.138 -0.170 -0.191
-0.171 -5 -1 -12 -18 -19 -25 Reproductive cancer bladder
transitional cell carcinoma cell line salivary.sub.-- Primary
Salivary Primary -0.262 -0.188 -0.138 -0.177 -0.126 -0.154 -0.172
-0.155 -7 2 -9 -2 -5 -5 gland Tissue gland tissue SCLC.21H Lung
Small cell Small cell -0.259 -0.160 -0.138 -0.201 -0.123 -0.157
-0.172 -0.148 -11 -31 -5 -12 -10 8 lung lung carcinoma carcinoma
cell line SH.SY5Y Brain Neuroblastoma Metastatic -0.271 -0.170
-0.137 -0.201 -0.124 -0.157 -0.170 -0.151 2 -25 2 -5 1 6
neuroblastoma, cloned subline of neuroepithelioma cell line SK-N-SM
SiHa Breast/Female Cervical Cervical -0.288 -0.180 -0.148 -0.201
-0.139 -0.176 -0.193 -0.175 -2 -7 -15 -19 -11 -27 Reproductive
cancer squamous cell carcinoma cell line, integrated 1- 2 copies of
HPV18 SK.BR_3 Breast/Female Breast Metastatic -0.288 -0.176 -0.148
-0.195 -0.140 -0.176 -0.191 -0.169 -3 -4 -21 -22 -12 -11
Reproductive cancer breast adenocarcinoma cell line SK.MEL_30
Primary Melanoma Metastatic -0.301 -0.187 -0.154 -0.208 -0.141
-0.174 -0.193 -0.171 -2 -12 -8 -3 -1 -6 Tissue malignant melanoma
cell line skeletal.sub.-- Primary Skeletal Primary -0.261 -0.166
-0.134 -0.179 -0.125 -0.150 -0.164 -0.145 -1 -7 -7 0 9 11 muscle
Tissue muscle tissue skin Skin Skin Primary -0.259 -0.166 -0.134
-0.168 -0.127 -0.148 -0.167 -0.151 -4 8 -14 5 -1 -4 tissue
small.sub.-- Primary Small Primary -0.260 -0.164 -0.121 -0.158
-0.107 -0.141 -0.166 -0.142 9 10 11 9 0 7 intestine Tissue intestin
tissue smooth.sub.-- Primary Smooth Primary -0.259 -0.158 -0.127
-0.169 -0.113 -0.144 -0.161 -0.149 2 -6 3 4 4 -5 muscle Tissue
muscle tissue spleen Primary Spleen Primary -0.308 -0.202 -0.148
-0.160 -0.130 -0.155 -0.177 -0.154 7 27 15 25 20 25 Tissue tissue
stomach Primary Stomach Primary -0.264 -0.170 -0.131 -0.170 -0.117
-0.149 -0.169 -0.151 6 3 9 6 0 2 Tissue tissue testis Primary
Testis Primary -0.215 -0.142 -0.109 -0.147 -0.093 -0.128 -0.133
-0.123 0 0 0 0 0 0 Tissue tissue TMP.1 Myeloid Monocytic Acute
-0.338 -0.218 -0.166 -0.206 -0.149 -0.162 -0.204 -0.176 -1 6 -1 1
-3 0 leukemia monocytic leukemia (AML) cell line thyroid.sub.--
Primary Thyroid Primary -0.261 -0.158 -0.138 -0.178 -0.121 -0.153
-0.170 -0.161 -2 -7 -2 -6 -6 -19 gland Tissue gland tissue TiME
Other Microvascular Telomerase -0.296 -0.180 -0.147 -0.198 -0.134
-0.170 -0.186 -0.170 5 -3 3 -1 3 -11 endothellial immortalized cell
line human microvascular endothelial cells (pooled) tonsil Primary
Tonsil Primary -0.282 -0.179 -0.141 -0.169 -0.125 -0.147 -0.173
-0.152 -1 20 8 23 4 9 Tissue tissue U.139_MG Brain Glioblastoma
Glioblastoma -0.288 -0.177 -0.144 -0.191 -0.126 -0.162 -0.177
-0.161 1 8 7 0 2 2 cell line U.2_O5 Sarcoma Osteosarcoma
Osteosarcoma -0.275 -0.175 -0.139 -0.192 -0.134 -0.159 -0.170
-0.160 -2 0 -11 -3 6 -3 cell line U.2197 Sarcoma Sarcoma Malignant
-0.290 -0.181 -0.146 -0.195 -0.129 -0.184 -0.180 -0.165 2 1 5 3 4 0
fibrous histiocytoma cell line U.251_MG Brain Glioblastoma
Glioblastoma -0.292 -0.178 -0.140 -0.197 -0.125 -0.180 -0.177
-0.165 9 -6 11 4 4 -4 cell line U.266.70 Lymphoid Multiple Multiple
-0.320 -0.207 -0.157 -0.202 -0.135 -0.170 -0.191 -0.165 -1 4 19 15
12 17 Myeloma myeloma cell line (1970, IL-6- dependent) U.266.64
Lymphoid Multiple Multiple -0.320 -0.212 -0.182 -0.207 -0.139
-0.175 -0.194 -0.169 -1 2 11 8 10 14 Myeloma myeloma cell line
(1984, in vitro differentiated) U.698 Lymphoid B-cell B-cell -0.328
-0.212 -0.159 -0.203 -0.137 -0.170 -0.194 -0.165 2 5 18 20 6 20
lymphoma lymphoma cell line (lymphoblastic lymphosarcoma) U.87_MG
Brain Glioblastoma, Glioblastoma, -0.285 -0.175 -0.143 -0.192
-0.127 -0.160 -0.174 -0.162 1 0 2 -2 2 -4 astrocytoma astrocytoma
cell line U.937 Myeloid Myelomonocytic Myelomonocytic -0.346 -0.224
-0.167 -0.201 -0.146 -0.150 -0.199 -0.173 1 18 3 5 2 6 histiocytic
histiocytic lymphoma lymphoma cell line urinary.sub.-- Primary
Urinary Primary -0.260 -0.158 -0.130 -0.165 -0.113 -0.148 -0.164
-0.150 3 5 -2 1 3 -6 bladder Tissue bladder tissue WM.116 Skin
Melanoma Malignant -0.284 -0.175 -0.144 -0.193 -0.130 -0.160 -0.178
-0.157 -1 -4 -4 -3 -3 2 melanoma cell line
[0197] Correlation values between average FFT (fast Fourier
Transformation) intensities for the 193-199 bp frequencies in the
first 10 kb downstream of the transcriptional start site with FPKM
expression values measured for 19,378 Ensembl gene identifiers in
44 human cell lines and 32 primary tissues by the Human Protein
Atlas. Table 3 also contains brief descriptions for each of the
expression samples as provided by the Protein Atlas as well as rank
transformations and rank differences to the IH01, IH02 and BH01
samples.
Example 5
Determining Non-Healthy Tissue(s)-of-Origin from cfDNA
[0198] To test whether additional contributing tissues in
non-healthy states might be inferred, cfDNA samples obtained from
five late-stage cancer patients were sequenced. The patterns of
nucleosome spacing in these samples revealed additional
contributions to cfDNA that correlated most strongly with
non-hematopoietic tissues or cell lines, often matching the
anatomical origin of the patient's cancer.
Nucleosome Spacing in Cancer Patients' cfDNA Identifies
Non-Hematopoietic Contributions
[0199] To determine whether signatures of non-hematopoietic
lineages contributing to circulating cfDNA in non-healthy states
could be detected, 44 plasma samples from individuals with clinical
diagnoses of a variety of Stage IV cancers were screened with light
sequencing of single-stranded libraries prepared from cfDNA (Table
4; median 2.2-fold coverage):
TABLE-US-00004 TABLE 4 Clinical diagnoses and cfDNA yield for
cancer panel. cfDNA Yield Patient Sample ID Clinical Dx Stage
(ng/ml) Sex IC01 .dagger. Kidney cancer (Transitional IV 242 F
cell) IC02 Ovarian cancer (undefined) IV 22.5 F IC03 Skin cancer
(Melanoma) IV 12.0 M IC04 Breast cancer IV 12.6 F
(Invasive/infiltrating ductal) IC05 Lung cancer IV 5.4 M
(Adenocarcinoma) IC06 Lung cancer (Mesothelioma) IV 11.4 M IC07
.dagger. Gastric cancer (undefined) IV 52.2 M IC08 Uterine cancer
(undefined) IV 15.0 F IC09 Ovarian cancer (serous IV 8.4 F tumors)
IC10 Lung cancer IV 11.4 F (adenocarcinoma) IC11 Colorectal cancer
(undefined) IV 11.4 M IC12 Breast cancer IV 12.0 F
(Invasive/infiltrating lobular) IC13 Prostate cancer (undefined) IV
12.3 M IC14 Head and neck cancer IV 27.0 M (undefined) IC15 .sctn.
Lung cancer (Small cell) IV 22.5 M IC16 Bladder cancer (undefined)
IV 14.1 M IC17 .sctn. Liver cancer (Hepatocellular IV 39.0 M
carcinoma) IC18 Kidney cancer (Clear cell) IV 10.5 F IC19
Testicular cancer IV 9.6 M (Seminomatous) IC20 .sctn. Lung cancer
(Squamous cell IV 21.9 M carcinoma) IC21 Pancreatic cancer (Ductal
IV 35.4 M adenocarcinoma) IC22 Lung cancer IV 11.4 F
(Adenocarcinoma) IC23 Liver cancer (Hepatocellular IV 17.1 M
carcinoma) IC24 Pancreatic cancer (Ductal IV 37.2 M adenocarcinoma)
IC25 Pancreatic cancer (Ductal IV 27.9 M adenocarcinoma) IC26
Prostate cancer IV 24.6 M (Adenocarcinoma) IC27 Uterine cancer
(undefined) IV 19.2 F IC28 Lung cancer (Squamous cell IV 33.3 M
carcinoma) IC29 Head and neck cancer IV 14.4 M (undefined) IC30
Esophageal cancer IV 10.5 M (undefined) IC31 .dagger. Ovarian
cancer (undefined) IV 334.8 F IC32 Lung cancer (Small cell) IV 9.6
F IC33 Colorectal cancer IV 13.8 M (Adenocarcinoma) IC34 Breast
cancer IV 33.6 F (Invasive/infiltrating lobular) IC35 .sctn. Breast
cancer (Ductal IV 16.2 F carcinoma in situ) IC36 Liver cancer
(undefined) IV 26.4 M IC37 .sctn. Colorectal cancer IV 15.9 F
(Adenocarcinoma) IC38 Bladder cancer (undefined) IV 6.6 M IC39
Kidney cancer (undefined) IV 39.0 M IC40 Prostate cancer IV 13.8 M
(Adenocarcinoma) IC41 Testicular cancer IV 16.5 M (Seminomatous)
IC42 Lung cancer IV 11.4 F (Adenocarcinoma) IC43 Skin cancer
(Melanoma) IV 21.9 F IC44 Esophageal cancer IV 25.8 F (undefined)
IC45 .dagger. Colorectal cancer IV 3.0 M (Adenocarcinoma) IC46 **
Breast cancer (Ductal IV 36.6 F carcinoma in situ) IC47 Pancreatic
cancer (Ductal IV 19.2 F adenocarcinoma) IC48 ** Breast cancer IV
13.8 F (Invasive/infiltrating lobular) .sctn.: sample was selected
for additional sequencing. ** only 0.5 ml of plasma was available
for this sample. .dagger.: sample failed QC and was not used for
further analysis.
[0200] Table 4 shows clinical and histological diagnoses for 48
patients from whom plasma-borne cfDNA was screened for evidence of
high tumor burden, along with total cfDNA yield from 1.0 ml of
plasma from each individual and relevant clinical covariates. Of
these 48, 44 passed QC and had sufficient material. Of these 44,
five were selected for deeper sequencing. cfDNA yield was
determined by Qubit Fluorometer 2.0 (Life Technologies).
[0201] These samples were prepared with the same protocol and many
in the same batch as IH02 of Example 4. Human peripheral blood
plasma for 52 individuals with clinical diagnosis of Stage IV
cancer (Table 4) was obtained from Conversant Bio or PlasmaLab
International (Everett, Wash., USA) and stored in 0.5 ml or 1 ml
aliquots at -80.degree. C. until use. Human peripheral blood plasma
for four individuals with clinical diagnosis of systemic lupus
erythematosus was obtained from Conversant Bio and stored in 0.5 ml
aliquots at -80.degree. C. until use. Frozen plasma aliquots were
thawed on the bench-top immediately before use. Circulating
cell-free DNA was purified from 2 ml of each plasma sample with the
QiaAMP Circulating Nucleic Acids kit (Qiagen) as per the
manufacturer's protocol. DNA was quantified with a Qubit
fluorometer (Invitrogen). To verify cfDNA yield in a subset of
samples, purified DNA was further quantified with a custom qPCR
assay targeting a multicopy human Alu sequence; the two estimates
were found to be concordant.
[0202] Because matched tumor genotypes were not available, each
sample was scored on two metrics of aneuploidy to identify a subset
likely to contain a high proportion of tumor-derived cfDNA: first,
the deviation from the expected proportion of reads derived from
each chromosome (FIG. 62A); and second, the per-chromosome allele
balance profile for a panel of common single nucleotide
polymorphisms (FIG. 62B). Based on these metrics, single-stranded
libraries derived from five individuals (with a small cell lung
cancer, a squamous cell lung cancer, a colorectal adenocarcinoma, a
hepatocellular carcinoma, and a ductal carcinoma in situ breast
cancer) were sequenced to a depth similar to that of IH02 in
Example 4 (Table 5; mean 30-fold coverage):
TABLE-US-00005 TABLE 5 Sequencing statistics for additional samples
included in CA01 set. Sample Library Fragments Aligned Est. % name
type Reads sequenced Aligned Q30 Coverage duplicates 35-80 bp
120-180 bp IH03 SSP 2x39 53292855 92.66% 72.37% 2.29 15.46% 11.05%
52.34% IP01 .dagger. DSP 2x101, 1214536629 97.22% 86.38% 76.11
0.55% 0.08% 62.77% 2x102 IP02 .dagger. DSP 2x101, 655040273 97.16%
87.72% 52.45 0.83% 0.07% 68.10% 2x102 IA01 SSP 2x39 53934607 87.42%
68.30% 2.02 22.70% 15.20% 49.77% IA02 SSP 2x39 42496222 95.42%
76.61% 1.95 4.74% 12.28% 59.00% IA03 SSP 2x39 51278489 93.12%
71.33% 2.05 25.68% 14.27% 52.57% IA04 SSP 2x39 50768476 90.30%
70.51% 2.14 7.83% 17.80% 36.76% IA05 DSP 2x101 194985271 98.80%
90.61% 11.09 12.05% 2.24% 71.67% IA06 DSP 2x101 171670054 98.90%
90.88% 9.90 5.41% 1.93% 71.26% IA07 DSP 2x101 208609489 98.67%
90.34% 11.69 11.45% 2.59% 74.84% IA08 DSP 2x101 193729556 98.61%
90.70% 10.84 11.96% 2.58% 76.24% IC02 SSP 2x39 57913605 95.07%
75.57% 2.59 5.40% 12.98% 60.00% IC03 SSP 2x39 53862631 96.78%
75.66% 2.79 8.32% 13.25% 62.20% IC04 SSP 2x39 55239248 95.47%
76.26% 2.57 8.28% 10.98% 58.48% IC05 SSP 2x39 39623850 89.80%
69.92% 1.60 9.24% 14.63% 50.33% IC06 SSP 2x39 59679981 95.57%
74.90% 2.11 3.93% 24.30% 41.46% IC08 SSP 2x39 46933688 94.38%
74.21% 1.92 5.92% 16.04% 45.25% IC09 SSP 2x42 59639583 91.22%
71.15% 2.13 6.69% 21.39% 43.50% IC10 SSP 2x42 53994406 93.73%
73.40% 1.83 2.00% 27.08% 37.62% IC11 SSP 2x42 59225460 93.26%
72.51% 2.15 5.26% 21.30% 43.33% IC12 SSP 2x42 57884742 93.52%
74.33% 2.34 2.66% 18.28% 46.58% IC13 SSP 2x42 71946779 92.94%
72.47% 2.52 2.18% 23.51% 43.97% IC14 SSP 2x42 61649203 94.54%
73.47% 2.20 3.23% 22.26% 43.37% IC15 SSP 2x50, 908512803 95.49%
76.83% 29.77 10.66% 25.42% 38.47% 43/42 IC16 SSP 2x42 62739733
92.81% 72.85% 2.47 2.77% 17.71% 48.04% IC17 SSP 2x50, 1072374044
96.02% 76.42% 42.08 12.16% 17.08% 50.02% 2x39 IC18 SSP 2x39
59976914 87.91% 68.67% 2.24 4.39% 18.85% 44.44% IC19 SSP 2x39
51447149 89.38% 69.39% 2.02 8.24% 17.30% 46.33% IC20 SSP 2x50,
640838540 96.30% 79.11% 23.36 12.43% 25.72% 33.87% 2x39 IC21 SSP
2x39 53000679 94.64% 74.57% 1.79 37.39% 29.89% 43.81% IC22 SSP 2x39
58102606 94.08% 74.08% 2.51 6.24% 13.65% 58.41% IC23 SSP 2x39
65859970 95.67% 75.67% 2.94 5.34% 11.09% 60.86% IC24 SSP 43/42
66344431 94.63% 74.46% 2.46 2.00% 22.46% 45.31% IC25 SSP 43/42
75066833 93.75% 73.66% 2.86 2.24% 21.30% 46.19% IC26 SSP 43/42
79180860 92.59% 72.32% 2.97 2.93% 22.34% 40.42% IC27 SSP 43/42
78037377 88.81% 67.04% 2.20 1.50% 31.31% 30.59% IC28 SSP 43/42
61402081 95.24% 75.74% 2.60 2.46% 15.71% 46.44% IC29 SSP 2x39
49989522 94.45% 73.36% 1.75 3.03% 25.82% 36.23% IC30 SSP 2x39
58439504 93.52% 71.19% 1.75 17.35% 29.58% 30.47% IC32 SSP 43/42
78233981 87.86% 66.80% 2.25 1.79% 30.12% 31.20% IC33 SSP 43/42
62196185 87.26% 66.71% 1.93 1.93% 27.44% 36.92% IC34 SSP 43/42
63572169 95.42% 76.74% 2.53 2.35% 19.64% 48.55% IC35 SSP 43/42
618664393 86.47% 65.90% 18.22 5.23% 28.18% 35.24% IC36 SSP 43/42
54402943 94.62% 74.73% 2.21 3.32% 17.02% 52.42% IC37 SSP 2x50,
1175553677 93.00% 74.46% 38.22 10.15% 28.47% 35.11% 43/42 IC38 SSP
43/42 47981963 89.35% 69.45% 1.78 6.47% 18.59% 43.03% IC39 SSP
43/42 61968854 95.29% 75.57% 2.62 2.54% 14.42% 57.28% IC40 SSP 2x39
53228209 93.54% 71.69% 1.81 8.65% 24.88% 34.95% IC41 SSP 43/42
78081655 87.11% 65.25% 2.26 1.61% 27.94% 35.21% IC42 SSP 2x39
53017317 93.59% 74.33% 2.02 10.74% 19.04% 44.12% IC43 SSP 43/42
76395478 88.41% 67.21% 2.40 1.56% 26.68% 37.76% IC44 SSP 43/42
61354307 95.15% 74.88% 2.45 4.34% 19.10% 46.39% IC46 SSP 2x39
60123123 94.51% 72.23% 2.13 10.37% 15.46% 50.93% IC47 SSP 2x39
59438172 95.58% 73.84% 2.07 9.33% 21.67% 43.34% IC48 SSP 43/42
55704417 91.35% 72.79% 2.01 13.87% 22.56% 38.68% IC49 DSP 2x101
170489015 99.02% 90.53% 11.19 5.93% 2.41% 59.93% IC50 DSP 2x101
203828224 98.72% 90.28% 10.82 2.83% 4.81% 66.23% IC51 DSP 2x101
200454421 98.63% 90.53% 11.77 9.50% 2.58% 67.04% IC52 DSP 2x101
186975845 98.97% 91.25% 11.37 2.57% 0.83% 68.96% SSP,
single-stranded library preparation protocol. DSP, double-stranded
library preparation protocol. .dagger. Sample has been previously
published (J. O. Kitzman et al., Science Translational Medicine
(2012)).
[0203] Table 5 tabulates sequencing-related statistics, including
the total number of fragments sequenced, read lengths, the
percentage of such fragments aligning to the reference with and
without a mapping quality threshold, mean coverage, duplication
rate, and the proportion of sequenced fragments in two length bins,
for each sample. Fragment length was inferred from alignment of
paired-end reads. Due to the short read lengths, coverage was
calculated by assuming the entire fragment had been read. The
estimated number of duplicate fragments is based on fragment
endpoints, which may overestimate the true duplication rate in the
presence of highly stereotyped cleavage.
[0204] As described above, FFT was performed on the long fragment
WPS values across gene bodies and correlated the average intensity
in the 193-199 bp frequency range against the same 76 expression
datasets for human cell lines and primary tissues. In contrast with
the three samples from healthy individuals from Example 4 (where
all of the top 10, and nearly all of the top 20, correlations were
to lymphoid or myeloid lineages), many of the most highly ranked
cell lines or tissues represent non-hematopoietic lineages, in some
cases aligning with the cancer type (FIG. 61; Table 3). For
example, for IC17, where the patient had a hepatocellular
carcinoma, the top-ranked correlation was with HepG2, a
hepatocellular carcinoma cell line. For IC35, where the patient had
a ductal carcinoma in situ breast cancer, the top-ranked
correlation was with MCF7, a metastatic breast adenocarcinoma cell
line. In other cases, the cell lines or primary tissues that
exhibit the greatest change in correlation rank aligned with the
cancer type. For example, for IC15, where the patient had small
cell lung cancer, the largest change in correlation rank (-31) was
for a small cell lung cancer cell line (SCLC-21H). For IC20 (a lung
squamous cell carcinoma) and IC35 (a colorectal adenocarcinoma),
there were many non-hematopoietic cancer cell lines displacing the
lymphoid/myeloid cell lines in terms of correlation rank, but the
alignment of these to the specific cancer type was less clear. It
is possible that the specific molecular profile of these cancers
was not well-represented amongst the 76 expression datasets (e.g.,
none of these are lung squamous cell carcinomas; CACO-2 is a cell
line derived from a colorectal adenocarcinoma, but is known to be
highly heterogeneous).
[0205] A greedy, iterative approach was used to estimate the
proportions of various cell-types and/or tissues contributing to
cfDNA derived from the biological sample. First, the cell-type or
tissue whose reference map (here, defined by the 76 RNA expression
datasets) had the highest correlation with the average FFT
intensity in the 193-199 bp frequency of the WPS long fragment
values across gene bodies for a given cfDNA sample was identified.
Next, a series of "two tissue" linear mixture models were fitted,
including the cell-type or tissue with the highest correlation as
well as each of the other remaining cell-types or tissues from the
full set of reference maps. Of the latter set, the cell-type or
tissue with the highest coefficient was retained as contributory,
unless the coefficient was below 1% in which case the procedure was
terminated and this last tissue or cell-type not included. This
procedure was repeated, i.e. "three-tissue", "four-tissue", and so
on, until termination based on the newly added tissue being
estimated by the mixture model to contribute less than 1%. The
mixture model takes the form:
argmax_{a,b,c, . . . } cor(Mean_FFTintensity_193-199, a*log
2ExpTissue1+b*log 2Tissue2+c*log 2Tissue3+ . . . +(1-a-b-c- . . .
)*log 2ExpTissueN).
For example, for IC17, a cfDNA sample derived from a patient with
advanced hepatocellular carcinoma, this procedure predicted 9
contributory cell types, including Hep_G2 (28.6%), HMC.1 (14.3%),
REH (14.0%), MCF7 (12.6%), AN3.CA (10.7%), THP.1 (7.4%), NB.4
(5.5%), U.266.84 (4.5%), and U.937 (2.4%). For BH01, a cfDNA sample
corresponding to a mixture of healthy individuals, this procedure
predicted 7 contributory cell types or tissues, including bone
marrow (30.0%), NB.4 (19.6%), HMC.1 (13.9%), U.937 (13.4%),
U.266.84 (12.5%), Karpas.707 (6.5%), and REH (4.2%). Of note, for
IC17, the sample derived from a cancer patient, the highest
proportion of predicted contribution corresponds to a cell line
that is closely associated with the cancer type that is present in
the patient from whom this cfDNA was derived (Hep_G2 and
hepatocellular carcinoma). In contrast, for BH01, this approach
predicts contributions corresponding only to tissues or cell types
that are primarily associated with hematopoiesis, the predominant
source of plasma cfDNA in healthy individuals.
Example 6
General Methods for Examples 4-5
Samples
[0206] Bulk human peripheral blood plasma, containing contributions
from an unknown number of healthy individuals, was obtained from
STEMCELL Technologies (Vancouver, British Columbia, Canada) and
stored in 2 ml aliquots at -80.degree. C. until use. Individual
human peripheral blood plasma from anonymous, healthy donors was
obtained from Conversant Bio (Huntsville, Ala., USA) and stored in
0.5 ml aliquots at -80.degree. C. until use.
[0207] Whole blood from pregnant women IP01 and IP02 was obtained
at 18 and 13 gestational weeks, respectively, and processed as
previously described 41.
[0208] Human peripheral blood plasma for 52 individuals with
clinical diagnosis of Stage IV cancer (Supplementary Table 4) was
obtained from Conversant Bio or PlasmaLab International (Everett,
Wash., USA) and stored in 0.5 ml or 1 ml aliquots at -80.degree. C.
until use. Human peripheral blood plasma for four individuals with
clinical diagnosis of systemic lupus erythematosus was obtained
from Conversant Bio and stored in 0.5 ml aliquots at -80.degree. C.
until use.
Processing of Plasma Samples
[0209] Frozen plasma aliquots were thawed on the bench-top
immediately before use. Circulating cell-free DNA was purified from
2 ml of each plasma sample with the QiaAMP Circulating Nucleic
Acids kit (Qiagen) as per the manufacturer's protocol. DNA was
quantified with a Qubit fluorometer (Invitrogen). To verify cfDNA
yield in a subset of samples, purified DNA was further quantified
with a custom qPCR assay targeting a multicopy human Alu sequence;
the two estimates were found to be concordant.
Preparation of Double-Stranded Sequencing Libraries
[0210] Barcoded sequencing libraries were prepared with the
ThruPLEX-FD or ThruPLEX DNA-seq 48 D kits (Rubicon Genomics),
comprising a proprietary series of end-repair, ligation, and
amplification reactions. Between 0.5 ng and 30.0 ng of cfDNA were
used as input for all clinical sample libraries. Library
amplification for all samples was monitored by real-time PCR to
avoid over-amplification, and was typically terminated after 4-6
cycles.
Preparation of Single-Stranded Sequencing Libraries
[0211] Adapter 2 was prepared by combining 4.5 .mu.l TE (pH 8), 0.5
.mu.l 1M NaCl, 10 .mu.l 500 uM oligo Adapter2.1, and 10 .mu.l 500
.mu.M oligo Adapter2.2, incubating at 95.degree. C. for 10 seconds,
and decreasing the temperature to 14.degree. C. at a rate of
0.1.degree. C/s. Purified cfDNA fragments were dephosphorylated by
combining 2.times. CircLigase II buffer (Epicentre), 5 mM
MnCl.sub.2, and 1 U FastAP alkaline phosphatase (Thermo Fisher)
with 0.5-10 ng fragments in a 20 .mu.l reaction volume and
incubating at 37.degree. C. for 30 minutes. Fragments were then
denatured by heating to 95.degree. C. for 3 minutes, and were
immediately transferred to an ice bath. The reaction was
supplemented with biotin-conjugated adapter oligo CL78 (5 pmol),
20% PEG-6000 (w/v), and 200 U CircLigase II (Epicentre) for a total
volume of 40 .mu.l, and was incubated overnight with rotation at
60.degree. C., heated to 95.degree. C. for 3 minutes, and placed in
an ice bath. For each sample, 20 pl MyOne C1 beads (Life
Technologies) were twice washed in bead binding buffer (BBB) (10 mM
Tris-HCl [pH 8], 1M NaCl, 1 mM EDTA [pH 8], 0.05% Tween-20, and
0.5% SDS), and resuspended in 250 .mu.l BBB. Adapter-ligated
fragments were bound to the beads by rotating for 60 minutes at
room temperature. Beads were collected on a magnetic rack and the
supernatant was discarded. Beads were washed once with 500 ul wash
buffer A (WBA) (10 mM Tris-HCl [pH 8], 1 mM EDTA [pH 8], 0.05%
Tween-20, 100 mM NaCl, 0.5% SDS) and once with 500 .mu.l wash
buffer B (WBB) (10 mM Tris-HCl [pH 8], 1 mM EDTA [pH 8], 0.05%
Tween-20, 100 mM NaCl). Beads were combined with 1.times.
Isothermal Amplification Buffer (NEB), 2.5 .mu.M oligo CL9, 250 82
M (each) dNTPs, and 24 U Bst 2.0 DNA Polymerase (NEB) in a reaction
volume of 50 .mu.l, incubated with gentle shaking by ramping
temperature from 15.degree. C. to 37.degree. C. at 1.degree.
C./minute, and held at 37.degree. C. for 10 minutes. After
collection on a magnetic rack, beads were washed once with 200
.mu.l WBA, resuspended in 200 .mu.l of stringency wash buffer (SWB)
(0.1.times.SSC, 0.1% SDS), and incubated at 45.degree. C. for 3
minutes. Beads were again collected and washed once with 200 .mu.l
WBB. Beads were then combined with 1.times. CutSmart Buffer (NEB),
0.025% Tween-20, 100 .mu.M (each) dNTPs, and 5 U T4 DNA Polymerase
(NEB) and incubated with gentle shaking for 30 minutes at room
temperature. Beads were washed once with each of WBA, SWB, and WBB
as described above. Beads were then mixed with 1.times. CutSmart
Buffer (NEB), 5% PEG-6000, 0.025% Tween-20, 2 .mu.M double-stranded
adapter 2, and 10 U T4 DNA Ligase (NEB), and incubated with gentle
shaking for 2 hours at room temperature. Beads were washed once
with each of WBA, SWB, and WBB as described above, and resuspended
in 25 .mu.l TET buffer (10 mM Tris-HCl [pH 8], 1 mM EDTA [pH 8],
0.05% Tween-20). Second strands were eluted from beads by heating
to 95.degree. C., collecting beads on a magnetic rack, and
transferring the supernatant to a new tube. Library amplification
for all samples was monitored by real-time PCR to avoid
over-amplification, and required an average of 4 to 6 cycles per
library.
Sequencing
[0212] All libraries were sequenced on HiSeq 2000 or NextSeq 500
instruments (Illumina).
Primary Sequencing Data Processing
[0213] Barcoded paired end (PE) Illumina sequencing data was split
allowing up to one substitution in the barcode sequence. Reads
shorter or equal to read length were consensus called and adapter
trimmed. Remaining consensus single end reads (SR) and the
individual PE reads were aligned to the human reference genome
sequence (GRCh37, 1000 Genomes phase 2 technical reference
downloaded from
ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/phase2_refer-
ence_assembly_sequence/) using the ALN algorithm implemented in BWA
v0.7.10. PE reads were further processed with BWA SAMPE to resolve
ambiguous placement of read pairs or to rescue missing alignments
by a more sensitive alignment step around the location of one
placed read end. Aligned SR and PE data was directly converted to
sorted BAM format using the SAMtools API. BAM files of the sample
were merged across lanes and sequencing runs.
[0214] Quality control was performed using FastQC (v0.11.2),
obtaining a library complexity estimate (Picard tools v1.113),
determining the proportion of adapter dimers, the analysis of the
inferred library insert size, the nucleotide and dinucleotide
frequencies at the outer reads ends as well as checking the mapping
quality distributions of each library.
Simulated Read Data Sets
[0215] Aligned sequencing data was simulated (SR if shorter than 45
bp, PE 45 bp otherwise) for all major chromosomes of the human
reference (GRC37h). For this purpose, dinucleotide frequencies were
determined from real data on both read ends and both strand
orientations. Dinucleotide frequencies were also recorded for the
reference genome on both strands. Further, the insert size
distribution of the real data was extracted for the 1-500 bp range.
Reads were simulated by iterating through the sequence of the major
reference chromosomes. At each step (i.e., one or more times at
each position depending on desired coverage), (1) the strand is
randomly chosen, (2) the ratio of the dinucleotide frequency in the
real data over the frequency in the reference sequence is used to
randomly decide whether the initiating dinucleotide is considered,
(3) an insert size is sampled from the provided insert-size
distribution and (4) the frequency ratio of the terminal
dinucleotide is used to randomly decide whether the generated
alignment is reported. The simulated coverage was matched to that
of the original data after PCR duplicate removal.
Coverage, Read Starts and Window Protection Scores
[0216] The data of the present disclosure provides information
about the two physical ends of DNA molecules used in sequencing
library preparation. We extract this information using the SAMtools
application programming interface (API) from BAM files. As read
starts, we use both outer alignment coordinates of PE data for
which both reads aligned to the same chromosome and where reads
have opposite orientations. In cases where PE data was converted to
single read data by adapter trimming, we consider both end
coordinates of the SR alignment as read starts. For coverage, we
consider all positions between the two (inferred) molecule ends,
including these end positions. We define windowed protection scores
(WPS) of a window size k as the number of molecules spanning a
window minus those starting at any bases encompassed by the window.
We assign the determined WPS to the center of the window. For
molecules in the 35-80 bp range (short fraction), we use a window
size of 16 and, for molecules in the 120-180 bp (long fraction), we
use a window size of 120.
Nucleosome Peak Calling
[0217] Local maxima of nucleosome protection are called from the
long fraction WPS, which we locally adjust to a running median of
zero (1 kb window) and smooth using a Savitzky-Golay filter (window
size 21, 2nd order polynomial). The WPS track is then segmented
into above zero regions (allowing up to 5 consecutive positions
below zero). If the resulting region is between 50-150 bp long, we
identify the median value of that region and search for the
maximum-sum contiguous window above the median. We report the
start, end and center coordinates of this window. Peak-to-peak
distances, etc., are calculated from the center coordinates. The
score of the call is determined as the distance between maximum
value in the window and the average of the two adjacent WPS minima
neighboring the region. If the identified region is 150-450 bp
long, we apply the same above median contiguous window approach,
but only report those windows that are between 50-150 bp in size.
For score calculation of multiple windows derived from the 150-450
bp regions, we assume the neighboring minima within the region to
be zero. We discard regions shorter than 50 bp and longer than 450
bp.
Dinucleotide Composition of 167 bp Fragments
[0218] Fragments with inferred lengths of exactly 167 bp,
corresponding to the dominant peak of the fragment size
distribution, were filtered within samples to remove duplicates.
Dinucleotide frequencies were calculated in a strand-aware manner,
using a sliding 2 bp window and reference alleles at each position,
beginning 50 bp upstream of one fragment endpoint and ending 50 bp
downstream of the other endpoint. Observed dinucleotide frequencies
at each position were compared to expected dinucleotide frequencies
determined from a set of simulated reads reflecting the same
cleavage biases calculated in a library-specific manner (see above
for details).
WPS Profiles Surrounding Transcription Factor Binding Sites and
Genomic Features
[0219] Analysis began with an initial set of clustered FIMO
(motif-based) intervals defining a set of computationally predicted
transcription factor binding sites. For a subset of clustered
transcription factors (AP-2-2, AP-2, CTCF_Core-2, E2F-2, EBF1,
Ebox-CACCTG, Ebox, ESR1, ETS, IRF-2, IRF-3, IRF, MAFK, MEF2A-2,
MEF2A, MYC-MAX, PAXS-2, RUNX2, RUNX-AML, STAF-2, TCF-LEF, YY1), the
set of sites was refined to a more confident set of actively bound
transcription factor binding sites based on experimental data. For
this purpose, only predicted binding sites that overlap with peaks
defined by ChlP-seq experiments from publically available ENCODE
data (TfbsClusteredV3 set downloaded from UCSC) were retained.
[0220] Windowed protection scores surrounding these sites were
extracted for both the CH01 sample and the corresponding
simulation. A protection score for each site/feature was calculated
at each position relative to the start coordinate of each binding
site and the aggregated. Plots of CTCF binding sites were shifted
such that the zero coordinate on the x-axis at the center of the
known 52 bp binding footprint of CTCF. The mean of the first and
last 500 bp (which is predominantly flat and represents a mean
offset) of the 5 kb extracted WPS signal was then subtracted from
the original signal. For long fragment signal only, a sliding
window mean was calculated using a 200 bp window and subtracted
from the original signal. Finally, the corrected WPS profile for
the simulation was subtracted from the corrected WPS profile for
CH01 to correct for signal that was a product of fragment length
and ligation bias. This final profile was plotted and termed the
"Adjusted WPS".
[0221] Genomic features, such as transcription start sites,
transcription end sites, start codons, splice donor, and splice
acceptor sites were obtained from Ensembl Build version 75.
Adjusted WPS surrounding these features was calculated and plotted
as described above for transcription factor binding sites.
Analysis of Nucleosome Spacing Around CTCF Binding Sites and
Corresponding WPS
[0222] CTCF sites used for this analysis first included clustered
FIMO predictions of CTCF binding sites (computationally predicted
via motifs). We then created two additional subsets of this set: 1)
intersection with the set of CTCF ChlP-seq peaks available through
the ENCODE TfbsClusteredV3 (see above), and 2) intersection with a
set of CTCF sites that are experimentally observed to be active
across 19 tissues.
[0223] The positions of 10 nucleosomes on either side of the
binding site were extracted for each site. We calculated distances
between all adjacent nucleosomes to obtain a distribution of
inter-nucleosome distances for each set of sites. The distribution
of -1 to +1 nucleosome spacing changed substantially, shifting to
larger spacing, particularly in the 230-270 bp range. This
suggested that truly active CTCF sites largely shift towards wider
spacing between the -1 and +1 nucleosomes, and that a difference in
WPS for both long and short read fractions might therefore be
apparent. Therefore, the mean short and long fragment WPS at each
position relative to the center of CTCF sites were additionally
calculated. To explore the effect of nucleosome spacing, this mean
was taken within bins of -1 to +1 nucleosome spacing of less than
160, 160-200, 200-230, 230-270, 270-420, 420-460, and greater than
420 bp. These intervals approximately captured spacings of
interest, such as the dominant peak and the emerging peak at
230-270 bp for more confidently active sites.
Analysis of DNase I Hypersensitive Sites (DHS)
[0224] DHS peaks for 349 primary tissue and cell line samples in
BED format by Maurano et al. (Science, vol. 337(6099), pp. 1190-95
(2012); "all_fdr0.05_hot" file, last modified Feb. 13, 2012) were
downloaded from the University of Washington Encode database.
Samples derived from fetal tissues, comprising 233 of these peak
sets, were removed from the analysis as they behaved inconsistently
within tissue type, possibly because of unequal representation of
multiple cell types within each tissue sample. 116 samples
representing a variety of cell lineages were retained for analysis.
For the midpoint of each DHS peak in a particular set, the nearest
upstream and downstream calls in the CH01 callset were identified,
and the genomic distance between the centers of those two calls was
calculated. The distribution of all such distances was visualized
for each DHS peak callset using a smoothed density estimate
calculated for distances between 0 and 500 bp.
Gene Expression Analysis
[0225] FPKM expression values, measured for 20,344 Ensembl gene
identifiers in 44 human cell lines and 32 primary tissues by the
Human Protein Atlas ("ma.csv" file) were used in this study. For
analyses across tissues, genes with less than 3 non-zero expression
values were excluded (19,378 genes passing this filter). The
expression data set was provided with one decimal precession for
the FPKM values. Thus, a zero expression value (0.0) indicates
expression between 0 and a value less than 0.05. Unless otherwise
noted, the minimum expression value was set to 0.04 FPKM before
log.sub.2-transformation of the expression values.
Smooth Periodograms and Smoothing of Trajectories
[0226] The long fragment WPS was used to calculate periodograms of
genomic regions using Fast Fourier Transform (FFT, spec.pgram in
the R statistical programming environment) with frequencies between
1/500 bases and 1/100 bases. Parameters to smooth (3 bp Daniell
smoother; moving average giving half weight to the end values) and
de-trend the data (i.e. subtract the mean of the series and remove
a linear trend) are optionally additionally used.
[0227] Where indicated, the recursive time series filter as
implemented in the R statistical programming environment was used
to remove high frequency variation from trajectories. 24 filter
frequencies (1/seq(5,100,4)) were used, and the first 24 values of
the trajectory as initial values were used. Adjustments for the
24-value shift in the resulting trajectories were made by repeating
the last 24 values of the trajectory.
Correlation of FFT Intensities and Expression Values
[0228] The intensity values as determined from smooth periodograms
(FFT) in the context of gene expression for the 120-280 bp range
were analyzed. An S-shaped Pearson correlation between gene
expression values and FFT intensities around the major
inter-nucleosome distance peak was observed. A pronounced negative
correlation was observed in the 193-199 bp range. As a result, the
intensities in this frequency range were averaged correlated with
log.sub.2-transformed expression values.
FURTHER EXAMPLES
Example 7
[0229] A method of determining tissues and/or cell types giving
rise to cell free DNA (cfDNA) in a subject, the method
comprising:
[0230] isolating cfDNA from a biological sample from the subject,
the isolated cfDNA comprising a plurality of cfDNA fragments;
[0231] determining a sequence associated with at least a portion of
the plurality of cfDNA fragments;
[0232] determining a genomic location within a reference genome for
at least some cfDNA fragment endpoints of the plurality of cfDNA
fragments as a function of the cfDNA fragment sequences; and
[0233] determining at least some of the tissues and/or cell types
giving rise to the cfDNA fragments as a function of the genomic
locations of at least some of the cfDNA fragment endpoints.
Example 8
[0234] The method of Example 7 wherein the step of determining at
least some of the tissues and/or cell types giving rise to the
cfDNA fragments comprises comparing the genomic locations of at
least some of the cfDNA fragment endpoints to one or more reference
maps.
Example 9
[0235] The method of Example 7 or Example 8 wherein the step of
determining at least some of the tissues and/or cell types giving
rise to the cfDNA fragments comprises performing a mathematical
transformation on a distribution of the genomic locations of at
least some of the cfDNA fragment endpoints.
Example 10
[0236] The method of Example 9 wherein the mathematical
transformation includes a Fourier transformation.
Example 11
[0237] The method of any preceding Example further comprising
determining a score for each of at least some coordinates of the
reference genome, wherein the score is determined as a function of
at least the plurality of cfDNA fragment endpoints and their
genomic locations, and wherein the step of determining at least
some of the tissues and/or cell types giving rise to the observed
cfDNA fragments comprises comparing the scores to one or more
reference map.
Example 12
[0238] The method of Example 11, wherein the score for a coordinate
represents or is related to the probability that the coordinate is
a location of a cfDNA fragment endpoint.
Example 13
[0239] The method of any one of Examples 8 to 12 wherein the
reference map comprises a DNase I hypersensitive site map generated
from at least one cell-type or tissue.
Example 14
[0240] The method of any one of Examples 8 to 13 wherein the
reference map comprises an RNA expression map generated from at
least one cell-type or tissue.
Example 15
[0241] The method of any one of Examples 8 to 14 wherein the
reference map is generated from cfDNA from an animal to which human
tissues or cells that have been xenografted.
Example 16
[0242] The method of any one of Examples 8 to 15 wherein the
reference map comprises a chromosome conformation map generated
from at least one cell-type or tissue.
Example 17
[0243] The method of any one of Examples 8 to 16 wherein the
reference map comprises a chromatin accessibility map generated
from at least one cell-type or tissue.
Example 18
[0244] The method of any one of Examples 8 to 17 wherein the
reference map comprises sequence data obtained from samples
obtained from at least one reference subject.
Example 19
[0245] The method of any one of Examples 8 to 18 wherein the
reference map corresponds to at least one cell-type or tissue that
is associated with a disease or a disorder.
Example 20
[0246] The method of any one of Examples 8 to 19 wherein the
reference map comprises positions or spacing of nucleosomes and/or
chromatosomes in a tissue or cell type.
Example 21
[0247] The method of any one of Examples 8 to 20 wherein the
reference map is generated by digesting chromatin obtained from at
least one cell-type or tissue with an exogenous nuclease (e.g.,
micrococcal nuclease).
Example 22
[0248] The method of any one of Examples 8 to 21, wherein the
reference maps comprise chromatin accessibility data determined by
a transposition-based method (e.g., ATAC-seq) from at least one
cell-type or tissue.
Example 23
[0249] The method of any one of Examples 8 to 22 wherein the
reference maps comprise data associated with positions of a DNA
binding and/or DNA occupying protein for a tissue or cell type.
Example 24
[0250] The method of Example 23 wherein the DNA binding and/or DNA
occupying protein is a transcription factor.
Example 25
[0251] The method of Example 23 or Example 24 wherein the positions
are determined by chromatin immunoprecipitation of a crosslinked
DNA-protein complex.
Example 26
[0252] The method of Example 23 or Example 24 wherein the positions
are determined by treating DNA associated with the tissue or cell
type with a nuclease (e.g., DNase-I).
Example 27
[0253] The method of any one of Examples 8 to 26 wherein the
reference map comprises a biological feature related to the
positions or spacing of nucleosomes, chromatosomes, or other DNA
binding or DNA occupying proteins within a tissue or cell type.
Example 28
[0254] The method of Example 27 wherein the biological feature is
quantitative expression of one or more genes.
Example 29
[0255] The method of Example 27 or Example 28 wherein the
biological feature is presence or absence of one or more histone
marks.
Example 30
[0256] The method of any one of Examples 27 to 29 wherein the
biological feature is hypersensitivity to nuclease cleavage.
Example 31
[0257] The method of any one of Examples 8 to 30 wherein the tissue
or cell type used to generate a reference map is a primary tissue
from a subject having a disease or disorder.
Example 32
[0258] The method of Example 31 wherein the disease or disorder is
selected from the group consisting of: cancer, normal pregnancy, a
complication of pregnancy (e.g., aneuploid pregnancy), myocardial
infarction, inflammatory bowel disease, systemic autoimmune
disease, localized autoimmune disease, allotransplantation with
rejection, allotransplantation without rejection, stroke, and
localized tissue damage.
Example 33
[0259] The method of any one of Examples 8 to 30 wherein the tissue
or cell type used to generate a reference map is a primary tissue
from a healthy subject.
Example 34
[0260] The method of any one of Examples 8 to 30 wherein the tissue
or cell type used to generate a reference map is an immortalized
cell line.
Example 35
[0261] The method of any one of Examples 8 to 30 wherein the tissue
or cell type used to generate a reference map is a biopsy from a
tumor.
Example 36
[0262] The method of Example 18 wherein the sequence data comprises
positions of cfDNA fragment endpoints.
Example 37
[0263] The method of Example 36 wherein the reference subject is
healthy.
Example 38
[0264] The method of Example 36 wherein the reference subject has a
disease or disorder.
Example 39
[0265] The method of Example 38 wherein the disease or disorder is
selected from the group consisting of: cancer, normal pregnancy, a
complication of pregnancy (e.g., aneuploid pregnancy), myocardial
infarction, inflammatory bowel disease, systemic autoimmune
disease, localized autoimmune disease, allotransplantation with
rejection, allotransplantation without rejection, stroke, and
localized tissue damage.
Example 40
[0266] The method of any one of Examples 19 to 39 wherein the
reference map comprises reference scores for at least a portion of
coordinates of the reference genome associated with the tissue or
cell type.
Example 41
[0267] The method of Example 40 wherein the reference map comprises
a mathematical transformation of the scores.
Example 42
[0268] The method of Example 40 wherein the scores represent a
subset of all reference genomic coordinates for the tissue or cell
type.
Example 43
[0269] The method of Example 42 wherein the subset is associated
with positions or spacing of nucleosomes and/or chromatosomes.
Example 44
[0270] The method of Example 42 or Example 43 wherein the subset is
associated with transcription start sites and/or transcription end
sites.
Example 45
[0271] The method of any one of Examples 42 to 44 wherein the
subset is associated with binding sites of at least one
transcription factor.
Example 46
[0272] The method of any one of Examples 42 to 45 wherein the
subset is associated with nuclease hypersensitive sites.
Example 47
[0273] The method of any one of Examples 40 to 46 wherein the
subset is additionally associated with at least one orthogonal
biological feature.
Example 48
[0274] The method of Example 47 wherein the orthogonal biological
feature is associated with high expression genes.
Example 49
[0275] The method of Example 47 wherein the orthogonal biological
feature is associated with low expression genes.
Example 50
[0276] The method of any one of Examples 41 to 49 wherein the
mathematical transformation includes a Fourier transformation.
Example 51
[0277] The method of any one of Examples 11 to 50 wherein at least
a subset of the plurality of the scores has a score above a
threshold value.
Example 52
[0278] The method of any one of Examples 7 to 51 wherein the step
of determining the tissues and/or cell types giving rise to the
cfDNA as a function of a plurality of the genomic locations of at
least some of the cfDNA fragment endpoints comprises comparing a
Fourier transform of the plurality of the genomic locations of at
least some of the cfDNA fragment endpoints, or a mathematical
transformation thereof, with a reference map.
Example 53.
[0279] The method of any preceding Example further comprising
generating a report comprising a list of the determined tissues
and/or cell types giving rise to the isolated cfDNA.
Example 54
[0280] A method of identifying a disease or disorder in a subject,
the method comprising:
[0281] isolating cell free DNA (cfDNA) from a biological sample
from the subject, the isolated cfDNA comprising a plurality of
cfDNA fragments;
[0282] determining a sequence associated with at least a portion of
the plurality of cfDNA fragments;
[0283] determining a genomic location within a reference genome for
at least some cfDNA fragment endpoints of the plurality of cfDNA
fragments as a function of the cfDNA fragment sequences;
[0284] determining at least some of the tissues and/or cell types
giving rise to the cfDNA as a function of the genomic locations of
at least some of the cfDNA fragment endpoints; and
[0285] identifying the disease or disorder as a function of the
determined tissues and/or cell types giving rise to the cfDNA.
Example 55
[0286] The method of Example 54 wherein the step of determining the
tissues and/or cell types giving rise to the cfDNA comprises
comparing the genomic locations of at least some of the cfDNA
fragment endpoints to one or more reference maps.
Example 56
[0287] The method of Example 54 or Example 55 wherein the step of
determining the tissues and/or cell types giving rise to the cfDNA
comprises performing a mathematical transformation on a
distribution of the genomic locations of at least some of the
plurality of the cfDNA fragment endpoints.
Example 57
[0288] The method of Example 56 wherein the mathematical
transformation includes a Fourier transformation.
Example 58
[0289] The method of any one of Examples 54 to 57 further
comprising determining a score for each of at least some
coordinates of the reference genome, wherein the score is
determined as a function of at least the plurality of cfDNA
fragment endpoints and their genomic locations, and wherein the
step of determining at least some of the tissues and/or cell types
giving rise to the observed cfDNA fragments comprises comparing the
scores to one or more reference map.
Example 59
[0290] The method of Example 58, wherein the score for a coordinate
represents or is related to the probability that the coordinate is
a location of a cfDNA fragment endpoint.
Example 60
[0291] The method of any one of Examples 55 to 59 wherein the
reference map comprises a DNase I hypersensitive site map, an RNA
expression map, expression data, a chromosome conformation map, a
chromatin accessibility map, chromatin fragmentation map, or
sequence data obtained from samples obtained from at least one
reference subject, and corresponding to at least one cell type or
tissue that is associated with a disease or a disorder, and/or
positions or spacing of nucleosomes and/or chromatosomes in a
tissue or cell type.
Example 61
[0292] The method of any one of Examples 55 to 60 wherein the
reference map is generated by digesting chromatin from at least one
cell-type or tissue with an exogenous nuclease (e.g., micrococcal
nuclease).
Example 62
[0293] The method of Example 60 or Example 61, wherein the
reference maps comprise chromatin accessibility data determined by
applying a transposition-based method (e.g., ATAC-seq) to nuclei or
chromatin from at least one cell-type or tissue.
Example 63
[0294] The method of any one of Examples 55 to 62 wherein the
reference maps comprise data associated with positions of a DNA
binding and/or DNA occupying protein for a tissue or cell type.
Example 64
[0295] The method of Example 63 wherein the DNA binding and/or DNA
occupying protein is a transcription factor.
Example 65
[0296] The method of Example 63 or Example 64 wherein the positions
are determined by applying chromatin immunoprecipitation of a
crosslinked DNA-protein complex to at least one cell-type or
tissue.
Example 66
[0297] The method of Example 63 or Example 64 wherein the positions
are determined by treating DNA associated with the tissue or cell
type with a nuclease (e.g., DNase-I).
Example 67
[0298] The method of any one of Examples 54 to 66 wherein the
reference map comprises a biological feature related to the
positions or spacing of nucleosomes, chromatosomes, or other DNA
binding or DNA occupying proteins within a tissue or cell type.
Example 68
[0299] The method of Example 67 wherein the biological feature is
quantitative expression of one or more genes.
Example 69
[0300] The method of Example 67 or Example 68 wherein the
biological feature is presence or absence of one or more histone
marks.
Example 70
[0301] The method of Example any one of Examples 67 to 69 wherein
the biological feature is hypersensitivity to nuclease
cleavage.
Example 71
[0302] The method of any one of Examples 55 to 70 wherein the
tissue or cell type used to generate a reference map is a primary
tissue from a subject having a disease or disorder.
Example 72
[0303] The method of Example 71 wherein the disease or disorder is
selected from the group consisting of: cancer, normal pregnancy, a
complication of pregnancy (e.g., aneuploid pregnancy), myocardial
infarction, inflammatory bowel disease, systemic autoimmune
disease, localized autoimmune disease, allotransplantation with
rejection, allotransplantation without rejection, stroke, and
localized tissue damage.
Example 73
[0304] The method of any one of Examples 55 to 70 wherein the
tissue or cell type used to generate a reference map is a primary
tissue from a healthy subject.
Example 74
[0305] The method of any one of Examples 55 to 70 wherein the
tissue or cell type used to generate a reference map is an
immortalized cell line.
Example 75
[0306] The method of any one of Examples 55 to 70 wherein the
tissue or cell type used to generate a reference map is a biopsy
from a tumor.
Example 76
[0307] The method of Example 60 wherein the sequence data obtained
from samples obtained from at least one reference subject comprises
positions of cfDNA fragment endpoint probabilities.
Example 77
[0308] The method of Example 76 wherein the reference subject is
healthy.
Example 78
[0309] The method of Example 76 wherein the reference subject has a
disease or disorder.
Example 79
[0310] The method of Example 78 wherein the disease or disorder is
selected from the group consisting of: cancer, normal pregnancy, a
complication of pregnancy (e.g., aneuploid pregnancy), myocardial
infarction, inflammatory bowel disease, systemic autoimmune
disease, localized autoimmune disease, allotransplantation with
rejection, allotransplantation without rejection, stroke, and
localized tissue damage.
Example 80
[0311] The method of any one of Examples 60 to 79 wherein the
reference map comprises cfDNA fragment endpoint probabilities for
at least a portion of the reference genome associated with the
tissue or cell type.
Example 81
[0312] The method of Example 80 wherein the reference map comprises
a mathematical transformation of the cfDNA fragment endpoint
probabilities.
Example 82
[0313] The method of Example 80 wherein the cfDNA fragment endpoint
probabilities represent a subset of all reference genomic
coordinates for the tissue or cell type.
Example 83
[0314] The method of Example 82 wherein the subset is associated
with positions or spacing of nucleosomes and/or chromatosomes.
Example 84
[0315] The method of Example 82 or Example 83 wherein the subset is
associated with transcription start sites and/or transcription end
sites.
Example 85
[0316] The method of any one of Examples 82 to 84 wherein the
subset is associated with binding sites of at least one
transcription factor.
Example 86
[0317] The method of any one of Examples 82 to 85 wherein the
subset is associated with nuclease hypersensitive sites.
Example 87
[0318] The method of any one of Examples 82 to 86 wherein the
subset is additionally associated with at least one orthogonal
biological feature.
Example 88
[0319] The method of Example 87 wherein the orthogonal biological
feature is associated with high expression genes.
Example 89
[0320] The method of Example 87 wherein the orthogonal biological
feature is associated with low expression genes.
Example 90
[0321] The method of any one of Examples 81 to 89 wherein the
mathematical transformation includes a Fourier transformation.
Example 91
[0322] The method of any one of Examples 58 to 90 wherein at least
a subset of the plurality of the cfDNA fragment endpoint scores
each has a score above a threshold value.
Example 92
[0323] The method of any one of Examples 54 to 91 wherein the step
of determining the tissue(s) and/or cell type(s) of the cfDNA as a
function of a plurality of the genomic locations of at least some
of the cfDNA fragment endpoints comprises comparing a Fourier
transform of the plurality of the genomic locations of at least
some of the cfDNA fragment endpoints, or a mathematical
transformation thereof, with a reference map.
Example 93
[0324] The method of any one of Examples 54 to 92 wherein the
reference map comprises DNA or chromatin fragmentation data
corresponding to at least one tissue that is associated with the
disease or disorder.
Example 94
[0325] The method of any one of Examples 54 to 93 wherein the
reference genome is associated with a human.
Example 95
[0326] The method of any one of Examples 54 to 94 further
comprising generating a report comprising a statement identifying
the disease or disorder.
Example 96
[0327] The method of Example 95 wherein the report further
comprises a list of the determined tissue(s) and/or cell type(s) of
the isolated cfDNA.
Example 97
[0328] The method of any preceding Example wherein the biological
sample comprises, consists essentially of, or consists of whole
blood, peripheral blood plasma, urine, or cerebral spinal
fluid.
Example 98
[0329] A method for determining tissues and/or cell types giving
rise to cell-free DNA (cfDNA) in a subject, comprising:
[0330] (i) generating a nucleosome map by obtaining a biological
sample from the subject, isolating cfDNA from the biological
sample, and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA;
[0331] (ii) generating a reference set of nucleosome maps by
obtaining a biological sample from control subjects or subjects
with known disease, isolating the cfDNA from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of cfDNA; and
[0332] (iii) determining the tissues and/or cell types giving rise
to the cfDNA by comparing the nucleosome map derived from the cfDNA
to the reference set of nucleosome maps;
wherein (a), (b) and (c) are:
[0333] (a) the distribution of likelihoods any specific base-pair
in a human genome will appear at a terminus of a cfDNA
fragment;
[0334] (b) the distribution of likelihoods that any pair of
base-pairs of a human genome will appear as a pair of termini of a
cfDNA fragment; and
[0335] (c) the distribution of likelihoods that any specific
base-pair in a human genome will appear in a cfDNA fragment as a
consequence of differential nucleosome occupancy.
Example 99
[0336] A method for determining tissues and/or cell types giving
rise to cell-free DNA in a subject, comprising:
[0337] (i) generating a nucleosome map by obtaining a biological
sample from the subject, isolating the cfDNA from the biological
sample, and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA;
[0338] (ii) generating a reference set of nucleosome maps by
obtaining a biological sample from control subjects or subjects
with known disease, isolating the cfDNA from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of DNA derived from digestion of
chromatin with micrococcal nuclease (MNase), DNase treatment, or
ATAC-Seq; and
[0339] (iii) determining the tissues and/or cell types giving rise
to the cfDNA by comparing the nucleosome map derived from the cfDNA
to the reference set of nucleosome maps;
wherein (a), (b) and (c) are:
[0340] (a) the distribution of likelihoods any specific base-pair
in a human genome will appear at a terminus of a sequenced
fragment;
[0341] (b) the distribution of likelihoods that any pair of
base-pairs of a human genome will appear as a pair of termini of a
sequenced fragment; and
[0342] (c) the distribution of likelihoods that any specific
base-pair in a human genome will appear in a sequenced fragment as
a consequence of differential nucleosome occupancy.
Example 100
[0343] A method for diagnosing a clinical condition in a subject,
comprising:
[0344] (i) generating a nucleosome map by obtaining a biological
sample from the subject, isolating cfDNA from the biological
sample, and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA;
[0345] (ii) generating a reference set of nucleosome maps by
obtaining a biological sample from control subjects or subjects
with known disease, isolating the cfDNA from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of cfDNA; and
[0346] (iii) determining the clinical condition by comparing the
nucleosome map derived from the cfDNA to the reference set of
nucleosome maps;
wherein (a), (b) and (c) are:
[0347] (a) the distribution of likelihoods any specific base-pair
in a human genome will appear at a terminus of a cfDNA
fragment;
[0348] (b) the distribution of likelihoods that any pair of
base-pairs of a human genome will appear as a pair of termini of a
cfDNA fragment; and
[0349] (c) the distribution of likelihoods that any specific
base-pair in a human genome will appear in a cfDNA fragment as a
consequence of differential nucleosome occupancy.
Example 101
[0350] A method for diagnosing a clinical condition in a subject,
comprising
[0351] (i) generating a nucleosome map by obtaining a biological
sample from the subject, isolating cfDNA from the biological
sample, and measuring distributions (a), (b) and/or (c) by library
construction and massively parallel sequencing of cfDNA;
[0352] (ii) generating a reference set of nucleosome maps by
obtaining a biological sample from control subjects or subjects
with known disease, isolating the cfDNA from the biological sample,
measuring distributions (a), (b) and/or (c) by library construction
and massively parallel sequencing of DNA derived from digestion of
chromatin with micrococcal nuclease (MNase), DNase treatment, or
ATAC-Seq; and
[0353] (iii) determining the tissue-of-origin composition of the
cfDNA by comparing the nucleosome map derived from the cfDNA to the
reference set of nucleosome maps;
wherein (a), (b) and (c) are:
[0354] (a) the distribution of likelihoods any specific base-pair
in a human genome will appear at a terminus of a sequenced
fragment;
[0355] (b) the distribution of likelihoods that any pair of
base-pairs of a human genome will appear as a pair of termini of a
sequenced fragment; and
[0356] (c) the distribution of likelihoods that any specific
base-pair in a human genome will appear in a sequenced fragment as
a consequence of differential nucleosome occupancy.
Example 102
[0357] The method of any one of Examples 98-101, wherein the
nucleosome map is generated by:
[0358] purifying the cfDNA isolated from the biological sample;
[0359] constructing a library by adaptor ligation and optionally
PCR amplification; and
[0360] sequencing the resulting library.
Example 103
[0361] The method of any one of Examples 98-101, wherein the
reference set of nucleosome maps are generated by:
[0362] purifying cfDNA isolated from the biological sample from
control subjects;
[0363] constructing a library by adaptor ligation and optionally
PCR amplification; and
[0364] sequencing the resulting library.
Example 104
[0365] The method of any one of Examples 98-101, wherein
distribution (a), (b) or (c), or a mathematical transformation of
one of these distributions, is subjected to Fourier transformation
in contiguous windows, followed by quantitation of intensities for
frequency ranges that are associated with nucleosome occupancy, in
order to summarize the extent to which nucleosomes exhibit
structured positioning within each contiguous window.
Example 105
[0366] The method of any one of Examples 98-101, wherein in
distribution (a), (b) or (c), or a mathematical transformation of
one of these distributions, we quantify the distribution of sites
in the reference human genome to which sequencing read start sites
map in the immediate vicinity of transcription factor binding sites
(TFBS) of specific transcription factor (TF), which are often
immediately flanked by nucleosomes when the TFBS is bound by the
TF, in order to summarize nucleosome positioning as a consequence
of TF activity in the cell type(s) contributing to cfDNA.
Example 106
[0367] The method of any one of Examples 98-101, wherein the
nucleosome occupancy signals are summarized in accordance with any
one of aggregating signal from distributions (a), (b), and/or (c),
or a mathematical transformation of one of these distributions,
around other genomic landmarks such as DNasel hypersensitive sites,
transcription start sites, topological domains, other epigenetic
marks or subsets of all such sites defined by correlated behavior
in other datasets (e.g. gene expression, etc.).
Example 107
[0368] The method of any one of Examples 98-101, wherein the
distributions are transformed in order to aggregate or summarize
the periodic signal of nucleosome positioning within various
subsets of the genome, e.g. quantifying periodicity in contiguous
windows or, alternatively, in discontiguous subsets of the genome
defined by transcription factor binding sites, gene model features
(e.g. transcription start sites), tissue expression data or other
correlates of nucleosome positioning.
Example 108
[0369] The method of any one of Examples 98-101, wherein the
distributions are defined by tissue-specific data, i.e. aggregate
signal in the vicinity of tissue-specific DNase I hypersensitive
sites.
Example 109
[0370] The method of any one of Examples 98-101, further comprising
step of statistical signal processing for comparing additional
nucleosome map(s) to the reference set.
Example 110
[0371] The method of Example 109, wherein we first summarize
long-range nucleosome ordering within contiguous windows along the
genome in a diverse set of samples, and then perform principal
components analysis (PCA) to cluster samples or to estimate mixture
proportions.
Example 111
[0372] The method of Example 100 or Example 101, wherein the
clinical condition is cancer, i.e. malignancies.
Example 112
[0373] The method of Example 111, wherein the biological sample is
circulating plasma containing cfDNA, some portion of which is
derived from a tumor.
Example 113
[0374] The method of Example 100 or Example 101, wherein the
clinical condition is selected from tissue damage, myocardial
infarction (acute damage of heart tissue), autoimmune disease
(chronic damage of diverse tissues), pregnancy, chromosomal
aberrations (e.g. trisomies), and transplant rejection.
Example 114
[0375] The method of any preceding Example further comprising
assigning a proportion to each of the one or more tissues or cell
types determined to be contributing to cfDNA.
Example 115
[0376] The method of Example 114 wherein the proportion assigned to
each of the one or more determined tissues or cell types is based
at least in part on a degree of correlation or of increased
correlation, relative to cfDNA from a healthy subject or
subjects.
Example 116
[0377] The method of Example 114 or Example 115, wherein the degree
of correlation is based at least in part on a comparison of a
mathematical transformation of the distribution of cfDNA fragment
endpoints from the biological sample with the reference map
associated with the determined tissue or cell type.
Example 117
[0378] The method of Example 114 to 116, wherein the proportion
assigned to each of the one or more determined tissues or cell
types is based on a mixture model.
[0379] From the foregoing, it will be appreciated that specific
embodiments of the invention have been described herein for
purposes of illustration, but that various modifications may be
made without deviating from the scope of the invention.
Accordingly, the invention is not limited except as by the appended
claims.
Sequence CWU 1
1
4134DNAArtificial SequenceSynthetic oligonucleotide CL9 1gtgactggag
ttcagacgtg tgctcttccg atct 34216DNAArtificial SequenceSynthetic
oligonucleotide Adapter 2.1 2cgacgctctt ccgatc 16334DNAArtificial
SequenceSynthetic oligonucleotide Adapter 2.2 3agatcggaag
agcgtcgtgt agggaaagag tgta 34410DNAArtificial SequenceSynthetic
oligonucleotide CL78 4agatcggaag 10
* * * * *