U.S. patent application number 15/465397 was filed with the patent office on 2017-07-27 for apparatus and methods for controlling cellular development.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Raag D. Airan, Karl Deisseroth, M. Bret Schneider, Albrecht Stroh.
Application Number | 20170211040 15/465397 |
Document ID | / |
Family ID | 41434430 |
Filed Date | 2017-07-27 |
United States Patent
Application |
20170211040 |
Kind Code |
A1 |
Deisseroth; Karl ; et
al. |
July 27, 2017 |
APPARATUS AND METHODS FOR CONTROLLING CELLULAR DEVELOPMENT
Abstract
According to one aspect and example, a method for facilitating
cellular interactions in biological tissue provides controllable
activation of a selected type of stem cell among a plurality of
cell types present in the tissue. The method includes various steps
including the introduction of a microbial opsin into a region of
the tissue that includes a selected type of stem cell, by
expressing the microbial opsin in the stem cell. A light source is
then introduced near the stem cell, and the light source is used to
controllably activate thejight source to direct pulses of
illumination from the light source to the selected type of stem
cell, for selectively controlling the growth and development of the
stem cell in a manner that is independent of the growth and
development of the other types of cells.
Inventors: |
Deisseroth; Karl; (Stanford,
CA) ; Stroh; Albrecht; (Mainz, DE) ;
Schneider; M. Bret; (Portola Valley, CA) ; Airan;
Raag D.; (Menlo Park, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
41434430 |
Appl. No.: |
15/465397 |
Filed: |
March 21, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13850709 |
Mar 26, 2013 |
|
|
|
15465397 |
|
|
|
|
12997140 |
Feb 7, 2011 |
|
|
|
PCT/US2009/047701 |
Jun 17, 2009 |
|
|
|
13850709 |
|
|
|
|
61093086 |
Aug 29, 2008 |
|
|
|
61132163 |
Jun 17, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2510/00 20130101;
C12N 2535/00 20130101; C12N 2501/385 20130101; C12M 21/02 20130101;
C12N 15/86 20130101; C12N 2501/119 20130101; A61N 5/0601 20130101;
C12N 2740/00043 20130101; C12N 2501/998 20130101; C12N 2529/10
20130101; C12N 2501/115 20130101; C12N 2500/38 20130101; C12N
2501/41 20130101; C12N 5/0619 20130101; C12N 5/0606 20130101; C12N
2506/02 20130101 |
International
Class: |
C12N 5/0735 20060101
C12N005/0735; C12N 15/86 20060101 C12N015/86 |
Claims
1. A method for facilitating cellular development in a biological
environment having a selected type of stem cell that can be
distinguished from other cell types, the method comprising the
steps of: introducing a microbial opsin into a region of the
biological environment that includes a selected type of stem cell,
by expressing the microbial opsin in the stem cell; introducing a
light source near the stem cell; and controllably activating the
light source to direct pulses of illumination from the light source
to the selected type of stem cell, for selectively controlling its
growth and development independent of the growth and development of
the other types of cells.
2. The method of claim 1, wherein the selected type of stem cell is
as an integral part of the biological environment which includes a
mixed set of cell types.
3. The method of claim 1, further including using intrinsic
properties of axons and dendrites to facilitate the controlled
development of young neurons.
4. The method of claim 3, wherein the intrinsic properties include
one or more of: different associated chemo-attractants, temporal
properties characterizing the speed at which axons and dendrites
grow, and physical dimensions of axons relative to dendrites.
5. The method of claim 1, wherein the selected type of stem cell is
as an integral part of tissue which includes a mixed set of cell
types including cells that are targeted for control and cells that
are not targeted for control.
6. The method of claim 5, further including facilitating discrete
communication within the mixed set of cell types, whereby cells of
individual types and individual roles in tissue development are
governed.
7. The method of claim 1, further including facilitating cellular
growth of the stem cell within a predetermined spatial
configuration.
8. The method of claim 1, further including facilitating growth of
the stem cell within a predetermined geometric configuration.
9. The method of claim 8, further including facilitating control
for internal pacing of a portion of a brain, whether hypoactive or
hyperactive portion of the brain being internally paced, while
using another portion of the brain to facilitate control.
10. The method of claim 1, wherein the stem cells are immature
cells.
11. The method of claim 1, wherein the biological environment is a
tissue.
12. The method of claim 1, wherein the biological environment is a
cell culture.
Description
[0001] RELATED PATENT DOCUMENTS
[0002] This patent document claims the benefit, under 35 U.S.C.
.sctn.119(e), of U.S. Provisional Patent Application Ser. No.
61/132,163 filed on Jun. 17, 2008 and entitled "Control of Cellular
Interactions In Engineered Tissue," and of U.S. Provisional Patent
Application Ser. No. 61/093,086 filed on Aug. 29, 2008, and
entitled "Arrangements, Methods and Compositions Involving
Modulation of Embryonic Stem Cell Differentiation with Automated
Temporally Precise Optogenetic Stimulation;" the underlying
provisional applications and respective Appendic(es) are fully
incorporated herein by reference. This patent document also relates
to, and fully incorporates by reference, the following underlying
patent documents: U.S. patent application Ser. No. 11/459,636 filed
on Jul. 24, 2006 (STFD.169PA), PCT Patent Application Ser. No.
PCT/US2008/050628 filed on Jan. 9, 2008 (STFD.150PCT), and U.S.
patent application Ser. No. 12/187,927 filed on Aug. 7, 2008
(STFD.167PA) (e.g., discussion in connection with FIGS. 1-5).
FIELD OF THE INVENTION
[0003] The present invention relates generally to methods, devices
and systems for the growth and development of cells and/or
tissue.
BACKGROUND
[0004] Naturally developing tissue is intrinsically of a
multi-cell-type nature. A substantial portion of cultured stem
cells that are implanted, die without reaching maturity or
integrating themselves into a functional tissue system. The odds of
survival and functional integration increase when cultured cells
are allowed to develop along side of their natural companion cells.
In many cases, the number of surviving cells may be improved by
growing glial cells and endothelial cells or fibroblasts along with
neurons. This generally holds true both in culture, and after
implantation.
[0005] Tissue culture, involving the growth of tissues and/or cells
separate from the organism, is typically facilitated by use of a
liquid, semi-solid, or solid growth media, such as broth or agar.
When intended for implantation as a solid organ, e.g., in the
context of regenerative medicine, a suitable matrix is usually
required. Even with the appropriate immature cells (e.g., stem
cells) in place, development into function, and/or implantable
tissue does not occur spontaneously. In the specific case of neural
tissue, for example, brain, axonal and dendritic sprouting is
shaped by activity of the various cells in the milieu. In this way,
local cellular environments are crucial in the regulation of
neurogenesis. Empirically, scientists have evidenced that
hippocampal cell co-culture promotes hippocampal neurogenesis, and
that adult NPCs grown in an environment non-permissive for
neurogenesis are unable to respond to excitation. These cells
communicate with one another, e.g., via chemical, molecular and
electrical signals. Frequently, chemical or molecular signaling is
triggered by electrical signaling; for example an endocrine cell
releasing a growth factor when electrically stimulated.
Activity-dependent competition frequently occurs in this context.
For example, more active neurons from one brain region may overgrow
regions occupied by less active neurons. Conversely, limiting
activity in a brain region during development results in functional
deficits. Electrical signaling and molecular signaling are the most
common approaches by which cells in culture control mutual behavior
within the milieu.
[0006] Electrical signaling is an important part of nerve cell
development and for many other types of cells including endocrine
cells and muscle cells. The application of electrical pulses to
neuronal progenitor cells (NPCs) causes them to evolve from generic
sphere-like structures into mature neurons, sprouting axons and
dendrites along the way, and establishing electrical connections
with other neurons. Chemical/molecular signaling is frequently
triggered by electrical signaling. For example, adult neurogenesis
and maturation of NPCs is greatly enhanced by excitatory stimuli
and involves Cav1.2/1.3 channels and NMDA receptors. These
Ca.sup.2+ influx pathways are located on the proliferating NPCs,
allowing them to directly sense and process excitatory stimuli. The
Ca.sup.2+ signal in NPCs leads to rapid induction of a gene
expression pattern that facilitated neural development. This leads
to synaptic incorporation of new neurons into active neural
circuits. Another example is endocrine cell releasing a growth
factor when electrically stimulated, but may also be triggered by
other molecular or chemical signals. Nerve growth factor (NGF) is
secreted by cells surrounding a developing neuron, such as glial
cells, and is critical to the development and long-term survival of
neurons. Nerve growth factor (NGF), is a small protein secreted by
glial cells as well as by some neurons, and induces the
differentiation and survival of target neurons. NGF binds to and
activates its high affinity receptor (TrkA), and a low-affinity
receptor (LNGFR), and promotes neuron survival and differentiation.
Conversely, molecular modifications of NGF such as proNGF can
elicit apoptosis. Brain-derived neurotrophic factor (BDNF) is
released from cells including fibroblasts and endothelial cells
(such as those within capillaries), and serves to promote growth
and development of neurons, including axonal and dentdritic
sprouting. Deficient expression of BDNF not only impairs the
development of neurons, but also impairs the development of
capillaries and the survival of endothelial cells themselves. NGF,
BDNF and neurotrophin-3 bind to the neurons bearing tyrosine kinase
(trk) receptors trk A, trk B and trk C. Vascular endothelial growth
factor (VEGF)-D is a member of the VEGF family of angiogenic growth
factors that recognizes and activates the vascular endothelial
growth factor receptor (VEGFR)-2 and VEGFR-3 on blood and/or
lymphatic vessels. Neuropilin-1 (NRP-1), for example, is one of the
vascular permeability factor/vascular endothelial growth factor
(VPF/VEGF) receptors that is involved in normal vascular
development.
[0007] Electrical and chemical/molecular signaling has limitations,
however. For example, electrical stimulation is rather agnostic to
the types of cells that it activates. In brief, an electric field
of a given distribution displays relatively low preference with
respect to the type of cells which they affect. Electrodes
indiscriminately influence the behavior of activate neurons, glia,
endocrine cells, muscle cells, and even the growth of bone within
the stimulated area. As a result, physical proximity of an
electrode pole to a given cell may be the single largest
determining factor as to whether or not it is affected. Because of
these limitations, it is generally not possible to exclusively
affect a specific class of cell in heterogeneously populated
tissue.
[0008] Intercellular molecular signaling, although frequently
cell-type specific, is often not readily modified artificially in a
physically tightly knit cell culture environment, which frequently
resists permeation of required growth factors, particularly in the
absence of efficient capillary development. Proper and/or ideal
distribution of chemical and molecular signaling agents including
K+, BDNF, NGF, and VEGF may be best achieved using the cells that
natively produce these agents, in their natural spatial
configurations with respect to the target cells. Because molecular
signaling is frequently triggered by electric signals to the source
cell, such signaling is subject to the non-specify of electrical
activity within the milieu.
[0009] There are a number of challenges to successful production of
a cultured neuronal tract using stem cells (either adult stem cells
or embryonic stem cells). These challenges have included issues
emanating from maturing stem cell arrays remaining in evolution
continuously, and connections being made between them early in
their life where the connections may or may not be maintained as
they develop further. Some method of ongoing functional
reinforcement, either natural or artificial, is likely necessary
for the long term viability of a cultured tract.
[0010] Efforts continue toward the goal of facilitating the
consistent sprouting and growth of dendrites and axons in a
predictable direction, as present studies show their natural
development tendency to be lateral and/or randomly-directed
growth.
SUMMARY
[0011] The present invention is exemplified in a number of
implementations and applications, some of which are summarized
below.
[0012] In certain regards, the present invention is directed to
providing mechanisms and methodology for individually and
separately controlling the activity of specific cell types within a
mixed tissue culture milieu, in order to direct optimal development
of that tissue.
[0013] Certain aspects of the present invention are directed to
using the intrinsic properties of axons and dendrites to facilitate
the controlled development of young neurons. As specific examples,
dendrites and axons have different associated chemo-attractants,
temporal properties (axons grow faster than dendrites), and
physical dimensions (axons are longer and thinner than dendrites).
These properties may provide means by which one shape the
development of young neurons.
[0014] According to one example embodiment, a method for
facilitating cellular interactions in biological tissue or cell
culture provides controllable activation of a selected type of stem
cell among a plurality of cell types. The method includes
introducing a microbial opsin into a region of the tissue or cell
culture that includes a selected type of stem cell, by expressing
the microbial opsin in the stem cell. A light source is then
introduced near the stem cell, and the light source is used to
controllably activate the light to direct pulses of illumination
from the light source to the selected type of stem cell, for
selectively controlling the growth and development of the stem cell
in a manner that is independent of the growth and development of
the other types of cells.
[0015] Also consistent with the present invention, one specific
embodiment is directed to providing for discrete communication with
specific cell types within a mixed-cell culture milieu, whereby
cells of individual types and individual roles in tissue
development can be governed. Each of these selected cell types can
thereby be induced to release their specific products on demand, as
determined manually, or by a computer system. This approach is
intended to enable maximal control of virtually all aspects of a
tissue being cultured or engineered.
[0016] Another specific embodiment provides for artificially growth
of a tissue within a predetermined spatial and geometric
configuration. For example, a longitudinally-extending system of
electrically interconnected neurons which propagates signals
detected at one end of the system, and outputs a corresponding
signal at the other end. An artificially-produced neuronal tract
could serve as a replacement for a damaged neuronal tract, for
example in an injured human brain or spinal cord.
[0017] Another specific embodiment is directed to a method for
internal pacing of portion of a brain, e.g., hypoactive or
hyperactive portion of a brain being internally paced, while using
another portion of the brain as the controller (e.g., as opposed to
an external source like a DBS pulse generator).
[0018] Yet another specific embodiment is directed to retaining
stem cell somas enclosed within a predetermined range of migration.
This aspect of the present invention recognizes that stem cells can
escape from their implanted location, particularly embryonic stem
cells, and therefore may seed themselves as cancerous tumors within
the body.
[0019] Applications include the culturing of tissue, and the
continued nurturing stimulation applied to an area of cells
implanted in vivo. The specification details the application of an
optogentic approach which endows specific targeted cell types with
a privileged channel of communication. Non-targeted cell types
remain unaffected by that particular wavelength of light, but may
be sensitized to a different wavelength or signal. Embodiments
consistent therewith specifically regard the regulation of neural
tissue development suited for spinal cord or brain injury repair.
However the same general principles of independent control of
different cell types within the developing tissue apply to heart,
liver, pancreas, kidney, bone and other tissues of the body, in
culture or implanted in vivo.
[0020] Another aspect of the patent invention is directed to use
and introduction of a microbial opsin into embryonic stem cells and
the development of optogenetic technology for stem cell engineering
applications, with a novel automated system for noninvasive
modulation of embryonic stem cell differentiation employing fast
optics and optogenetic control of ion flux.
[0021] According to yet another embodiment, the present invention
is directed to CNS (central nervous system) disease/behavior
treatment (applicable, e.g., to Parkinson's Disease, stroke, and
spinal cord injury) by functionalizing neurons to integrate into
the host after intracerebral transplantation. To this end, the
present invention is directed to stem cell therapy for CNS
disease/behavior treatment wherein differentiated cells are
generated, integrated into native neural circuitry and then
controlled selectively by light.
[0022] The above summary of the present invention is not intended
to describe each illustrated embodiment or every implementation of
the present invention. The figures and detailed description that
follow more particularly exemplify these embodiments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The invention may be more completely understood in
consideration of the detailed description of various embodiments of
the invention that follows in connection with the accompanying
drawings, in which:
[0024] FIG. 1 illustrates a system, according to an embodiment of
the present invention, involving classes of cell types that
function in a coordinated fashion during tissue growth,
development, activity and maintenance, for selective activation
(e.g., stimulation or suppression), and their detection of their
activity.
[0025] FIGS. 2a and 2b illustrate an assembly of biological and
synthetic components, and stimulation means for multichannel
stimulation tissue culture, according to an embodiment of the
present invention;
[0026] FIGS. 3a and 3b illustrate a system for culturing tissue
samples in accordance with the present invention;
[0027] FIG. 4 illustrates a system, also in accordance with the
present invention, that uses multiple transductions used upon a
cell, and shows activity feedback mediated by the activity of a
secondarily impacted second cell type;
[0028] FIG. 5 illustrates a multichannel stimulation and monitoring
system, also in accordance with the present invention, suitable for
governing tissue development either in culture or
post-implantation;
[0029] FIG. 6 is a schematic illustration of in vivo implantation
and integration of cultured tissue into a living organism whereby
development may be facilitated in accordance with the present
invention; and
[0030] FIGS. 7-11 depict images and charts showing results of
experimental implementations in accordance with the present
invention.
[0031] While the invention is amenable to various modifications and
alternative forms, specifics thereof have been shown by way of
example in the drawings and will be described in detail. It should
be understood, however, that the intention is not to limit the
invention to the particular embodiments described. On the contrary,
the intention is to cover all modifications, equivalents, and
alternatives falling within the spirit and scope of the
invention.
DETAILED DESCRIPTION
[0032] The present invention is directed to methods and apparatus
for culturing and promoting the growth of stem cells, such as
embryonic stem cells, in biological tissue. The present invention
has been found to be particularly suited for use in arrangements
and methods dealing with growth of stem cells in neural networks.
While the invention is not necessarily limited to such biological
environments, various aspects of the invention may be appreciated
through a discussion of various examples using this context.
[0033] Consistent with one example embodiment of the present
invention, a method for facilitating cellular interactions in
biological tissue or cell culture provides controllable activation
of a selected type of stem cell among a plurality of cell types
whether or not present in the tissue or cell culture. The method
includes introducing a microbial opsin into a region of the tissue
or cell culture that includes a selected type of stem cell, by
expressing the microbial opsin in the stem cell. A light source is
then introduced near the stem cell, and the light source is used to
controllably activate the light to direct pulses of illumination
from the light source to the selected type of stem cell, for
selectively controlling the growth and development of the stem cell
in a manner that is independent of the growth and development of
the other types of cells.
[0034] FIG. 1 illustrates several classes of cell types which
function in a coordinated fashion during tissue growth,
development, activity and maintenance. These cell types may be
selectively stimulated or suppressed, and their activity may be
detected, for example by the array of colored LEDs and
selective-color-filtered photodiodes. Each LED and photodiode are
controlled by separate channels coupled to a computer. Computer
controller 100 sends and receives inputs and outputs via
multichannel driver 101, which in turn, communicates with each cell
via transducers (LEDs 187, 177 and 156, and photodiodes 167 and
147), connected via multichannel cable 150. LED 187 emits light 186
which produces ion channel modulation in glial cell 185 via ChR2.
This produces a release of neurotrophic chemicals 184 (for example
BDNF), which are received by neuron 120, thereby inducing growth
and development in neuron 120. Neuron 120, as a product of its
growth, releases tropic chemicals such as vascular-endothelial
growth factor (VEGF), which is received by capillary 145, and
promotes growth of the network of which capillary 145 is a part.
LED 177 emits light 176 which produces ion channel modulation in
neuron 175. Band-filtered photodiode 167 receives light 166 of the
wavelength emitted by an indicator (such as voltage dye) released
from neuron 165 in response to action potential 164. LED 157 emits
light 156 of a wavelength which produces ion channel modulation in
fibroblast 155. Band-filtered photodiode 147 receives light 146 of
the wavelength emitted by an indicator for example those
characteristic wavelengths emitted, for example, by Fura-2 or
RH1691. Neuron 120 has axon 122, which communicates via synapse 129
with second neuron 165 with axon 175. Neurons 120 receive metabolic
support from glial cell 185. Glia cell 185 draws nutrition from
end-feet 186 on capillary 145, and delivers nutrition to neuron
cell 120 via end-feet 187. Microglia 140 (representative sample
shown) are dispersed throughout. Ca.sup.2+ influx pathways are
located on the proliferating NPCs, allowing them to directly sense
and process excitatory stimuli. The Ca2+ signal in NPCs leads to
rapid induction of a gene expression pattern that facilitated
neural development. This leads to synaptic incorporation of new
neurons into active neural circuits. Another example is endocrine
cell releasing a growth factor when electrically stimulated, but
may also be triggered by other molecular or chemical signals. Nerve
growth factor (NGF) is secreted by cells surrounding a developing
neuron, such as glial cells, and is critical to the development and
long-term survival of neurons. Nerve growth factor (NGF) is a small
protein secreted by glial cells as well as by some neurons, and
induces the differentiation and survival of target neurons. NGF
binds to and activates its high affinity receptor (TrkA), and a
low-affinity receptor (LNGFR), and promotes neuron survival and
differentiation. Conversely, molecular modifications of NGF such as
proNGF can elicit apoptosis. Brain-derived neurotrophic factor
(BDNF) is released from cells including fibroblasts and endothelial
cells (such as those within capillaries), and serves to promote
growth and development of neurons, including axonal and dentdritic
sprouting. Deficient expression of BDNF not only impairs the
development of neurons, but also impairs the development of
capillaries and the survival of endothelial cells themselves. NGF,
BDNF and neurotrophin-3 bind to the neurons bearing tyrosine kinase
(trk) receptors trk A, trk B and trk C. Vascular endothelial growth
factor (VEGF)-D is a member of the VEGF family of angiogenic growth
factors that recognizes and activates the vascular endothelial
growth factor receptor (VEGFR)-2 and VEGFR-3 on blood and/or
lymphatic vessels. Neuropilin-1 (NRP-1, for example, is one of the
vascular permeability factor/vascular endothelial growth factor
(VPF/VEGF) receptors that is involved in normal vascular
development. Optogentic methods may be used to trigger the release
of compounds such as BDNF, NGF, GDNF and VEGF.
[0035] One function of G-Proteins is to mediate the process by
which a stimulus upon a cell impacts the response of that cell; for
example, the timing of electrical spikes delivered upon a neuron
may or may not translate into the emergence of excitatory
post-synaptic potentials, depending upon G-protein activities.
G-proteins may carry out their roles by using various subordinate
mediators. G-proteins such as Gx and Gq may be induced (by optical
or pharmacological stimulation) so as to release factors such as
BDNF, NGF, GDNF and VEGF. Stimulation of the G-protein may be
accomplished in a cell-type-specific manner (for example using
cell-type-specific genetic targeting and optogenetic stimulation
methods as described in one or more of the underlying provisional
patent documents and as described in Airan R. D., Thompson K. R.,
Fenno L. E., Bernstein H., Deisseroth K., Temporally Precise in
vivo Control of Intracellular Signaling, Nature, 2009 Apr. 23,
458(7241):1025-9, Epub 2009 Mar. 18. When this is done, the
regulation and control of a cell's response level to such factors
applies only to the selected type of cell, and not to other
adjacent populations within a tissue culture, neural circuit,
animal, or patient. G-proteins may also be used to control the
release of dopamine, norepinephrine, serotonin, vasopressin,
oxytocin, and other neurotransmitters and hormones. Control of
G-protein activity, thereby permit control of cellular
differentiation, and which neural circuits are turned on or off at
a given time.
[0036] Methods for external readout of levels of cellular activity
within a network are known in the art. As described in Knopfel et
al., Optical probing of neuronal circuit dynamics: genetically
encoded versus classical fluorescent sensors, Trends Neurosci. 2006
Mar. 29, 3:160-6, such methods include use of non-protein calcium
sensors such as Fura-2, Oregon green 488 BAPTA-1, and X-Rhod-5F;
genetically-encoded calcium sensors, such as yellow cameleon 3.6,
G-CaMP2, Camgaroo-2 and TN-L15; non protein voltage sensors such as
di-4-ANEPPS and WW3028; and hybrid voltage sensors such as hVOS,
genetically-encoded sensors such as FlaSh, SPARC and VSFP1.
Additionally, absorbance-based measures of calcium flux such as
RH-155 may be used by means known in the art.
[0037] Methods of providing readout regarding expression of cell
products and the subpopulations of cells that produce them with an
antibody linked to a fluorescent dye. For example, for gauging
developmental stage of cellular development, one may use nestin
staining (see, e.g., underlying U.S. provisional application No.
61/093,086).
[0038] Additionally, both size and morphology degree of
differentiation in developing cells may be assessed and read out
using automated image analysis software and systems. One example is
a microscopy system built upon the PERL-based OME server project at
Open Microscopy Environment (www.openmicroscopy.org), which
implements image-based analysis of cellular dynamics and
image-based screening of cellular localization or phenotypes.
Another example of software readout may be based upon BD IPLab
Advanced Image Analysis Software (BD Biosciences, Rockville, Md.).
Other methods of providing readout regarding cellular activity are
known in the art, and include spectroscopy (absorbance and
transmittance), functional magnetic resonance imaging (such as use
of the BOLD effect), and positron emission tomography. Readout on
cellular metabolic activity may also be obtained via electronic
chemical "sniffers" which react to the presence of gasses such as
carbon dioxide.
[0039] FIG. 2a illustrates an assembly of biological and synthetic
components, and stimulation means for multichannel stimulation
tissue culture within an engineered tissue culture matrix. Pulse
generator 201 provides power to LED 225 and LED 226, each of which
emit a different spectrum and parameters, while power 224 and
ground 223 provide the current flow required. LED 225 may, for
example, emit blue light at 50 Hz, while LED 226 emits yellow light
at 100 Hz. The electronics described in FIG. 1 are simplified for
illustrative purposes. In practice, multiple pulse generators
operating separately are used for the implementation of separate
channels, and these channels may be activated independently
depending upon readout data entering the system, as will be
described in subsequent figures. Neuronal progenitor cells (NPCs,
neural stem cells) 205, glial progenitor cells (GPCs, glial stem
cells) 206 and vascular progenitor cells (VPCs, vascular stem
cells) 207 are added to cellular growth media 208. All are held
within encapsulating porous membrane 217, and against porous
membrane 210, enclosed by the addition of porous membrane 204.
Porous barrier membrane 209 containing membrane pores 210 serves to
prevent cell migration out of the engineered matrix, and prevents
clumping in other portions of the engineered matrix. Porous
membrane 209 may be composed of materials such as polyethylene
terephthalate porous membrane. Generally, pores 210 are of a
diameter between approximately 3 and 7 .mu.L. At these dimensions,
pores 10 are generally too small for stem cell bodies (soma) to
pass through, but large enough for dendrites and axons to pass
through. Porous membrane 209 serves as an anchoring layer (either
above, below, above and below or enclosing around) which restricts
cell migration before and during the growth of axons and dendrites,
and provides easy means for removal of the cells from the culturing
apparatus prior to implantation. In an adjacent but separated
compartment of the engineered matrix, NPCs 211 are added to
cellular growth media 212, and more glial precursor cells and
vascular precursor cells 207 may be added. Porous barrier membrane
213 serves to close off this compartment of the matrix to prevent
migration or clumping, as was previously done with porous membrane
210. In a subsequent compartment, NPCs 214 are again added to
cellular growth media 215, and the additional cell types previously
specified. Encapsulating porous membrane 216 containing membrane
pores 217 encloses the entire engineered matrix described.
Encapsulating porous membrane 216 may be composed of materials such
as polyethylene terephthalate porous membrane. Generally, pores 217
are of a diameter between approximately 3 and 7.mu.. At these
dimensions, pores 217 are generally too small for stem cell bodies
(soma) to pass through, but large enough for dendrites and axons to
pass through. These pores 217 also permit physiological gas
exchange, and the influx of nutrients from microvascular structures
and glial cells located outside of luminous membrane 216. Cell and
media compartment 218, 219, 220, 221 are analogous to the
compartmentalized cell groups described above, and likewise serve
to prevent migration or clumping.
[0040] Under specific conditions known in the art, a variety of
cells of various lineages may be induced to produce any of a
variety of products or growth factors. For example, neurons
themselves may secrete BDNF, as well as gastric hormones (such as
vaso-intestinal peptide (VIP) or somatastatin), much like
endodermally-derived cells normally do. In an alternative
embodiment, neural stem cells or pluripotent stem cells or induced
pluripotent stem cells (iPS) (Takahahi et al, Yu et al.) may be
used in place of more differentiated counterparts, with some
portions acquiring, for example, a neuronal path of development,
and others assuming, for example, a vascular path of
development.
[0041] FIG. 2B illustrates in a generic manner, how two portions of
the brain or body, region 260 and region 270, respectively, may be
functionally connected or re-connected using cells or tissues grown
in accordance with the present invention. In the case of the brain,
regions 260 and 270 may represent two brain nuclei, the natural
connection between which has been severed, for example by a
cerebrovascular accident. In the case of a spinal cord injury,
regions 260 and 270 may represent the brain and a formerly
paralyzed muscle, respectively. In the case of peripheral nerves,
260 and 270 may represent a spinal cord ganglion and a
deafferentated hand, respectively. In the case of a cardiomyopathy,
regions 260 and 270 may represent the vagus nerve and newly
regenerated heart tissue, respectively. Cells 265 may be neural,
glial, and vasculor cells or precursor (stem) cells, and are held
in place by artificial matrix material 266, such as a porous
polyethylene terephthalate film. Pulse generator 280 provides power
to LED 285 to produce light emissions which fall upon cells
265.
[0042] Also in accordance with the present invention, FIGS. 3a and
3b show a system for efficiently culturing numerous tissue samples.
In a more particular implementations thereof, the system of FIG. 3a
is a high-throughput multiwall system for efficiently culturing
numerous tissue samples in parallel. FIG. 3a shows a multichannel
emitter-detector unit as suited to the present invention.
Multichannel emitter-detector unit 300 includes LED 315,
phototransistor 325, phototransistor 335, LED 346 and LED 356, and
is placed over tissue culture well 305, containing cells 310, 320,
330, 340 and 350. LED 315 emits a specific wavelength band of light
316 which is received by type-X cells 310. LED 345 emits a specific
wavelength band of light 346 which is received by type-Y cells 350.
LED 355 emits a specific wavelength band of light 356 which is
received by type-Z cells 340. Phototransistor 325 receives a
specific wavelength band of light 326 which is emitted by type V
cells 320. Phototransistor 335 receives a specific wavelength band
of light 336 which is emitted by type-W cells 330. In one
embodiment, cell type V may be a neuron, cell type W may be an
astrocyte, cell type X may be an astrocyte, cell type Y may be a
fibroblast, and cell type Z may be a pancreatic beta cell. Cell
types are referenced with variables V, W, X, Y, Z, in order to
emphasize the diversity of cell types that are amenable to this
method of control. Furthermore, any of these variable may be of the
same type as that represented by another variable. For example, a
type V cell could be identical to a type X cell.
[0043] FIG. 3b show a high-throughput multiwall incubation control
system for efficiently culturing numerous tissue samples in
parallel in accordance with the present invention. In FIG. 3A,
environmental control chamber 390 contains culture plate actuators
380, and culture plates 365, each containing tissue culture wells
370 (representative example). Multichannel emitter/detector unit
360 (representative example) is analogous with multichannel
emitter/detector unit 300 of FIG. 3a, and is arranged into arrays
of emitter/detector units 360, each of which is controlled by
computer 375. Each multichannel emitter/detector units 360 sends
stimuli and receives readouts including feedback from the stimuli,
from the developing tissue in wells 370. Stimulation instructions
and readout values are sent and received, respectively, by computer
375. Appropriate environmental conditions are maintained by heater
391, humidifier/gas mixture control 392, and thermostat 393, as
coordinated by computer 375.
[0044] FIG. 4 illustrates the use of multiple transductions used
upon a cell, and shows activity feedback mediated by the activity
of a secondarily impacted second cell type. Gene 402 imparts
light-sensitivity upon a host cell, for example the manner in which
ChR2 creates light sensitivity in neurons. Gene 412 causes cells to
give off light when they undergo a given physiological process. For
example, the florescent agents described in Knopfel et al. 2006,
causes neurons to give off light when they depolarize. Other
examples might include a substance that effervesces light when it
receives a given hormone (e.g., BDNF) or neurotransmitter, or
alternatively, gives off light when it secretes a given substance,
such as VEGF. Gene promoter 401 acts to promote gene 402, and gene
promoter 411 acts to promote gene 412. As a result 405 of this
promotion, cell 420 physiologically responds to light of wavelength
band 421 which is emitted from LED 420 as determined by electronic
control signals detailed in FIG. 3. The response to this light may
include self-recognized responses 421 (for example enhanced axonal
and dendritic development), and externally recognizable responses
(425), for example the release of vascular-endothelial growth
factor (VEGF), or the promotion of axonal and dendritic development
in an adjacent developing nerve cell. Externally recognized
response 425 is shown received by cell 430, which, in turn,
produces self-recognizable responses 431 as well as light of
wavelength band 441. This light emission, of course, is another
form of externally recognizable response. Light of wavelength band
441 is received by photodiode 440, producing an electronic
detection signal, as detailed in the description of FIG. 3.
[0045] FIG. 5 illustrates a multichannel stimulation and monitoring
system, suitable for governing tissue development either in culture
or in-vivo/post-implantation. The principal subunits are
multichannel pulse output generator 504 and multichannel detection
signal receiver 550 as controlled by computer 502. Multichannel
pulse output generator 504 selectively sends signals to the output
portion of the apparatus. When signals are pulsed from Channel 1
Output 505, through Channel 1 switching transistor 510, power 501
is conferred to channel 1 LED 512. Likewise, when signals are
pulsed from Channel 2 Output 506 through channel 2 switching
transistor 522, channel 2 LED 522 is illuminated. Likewise, when
signals are pulsed from channel 3 Output 507 through channel 3
switching transistor 530, channel 3 LED 532 is illuminated.
Multichannel detection signal input 550 receives signals from
sensors which monitor area of tissue culture or implantation.
Channel 4 Input 551 receives signals from channel 4 photodiode 561
when the latter is activated. Similarly, channel 5 Input 552
receives signals from channel 5 photodiode 562 when the latter is
activated. Likewise, channel 6 Input 553 receives signals from
Channel 6 photodiode 563 when the latter is activated. The above
circuitry operates between power 501 and ground 508. Computer 502
contains a knowledge base, algorithms or protocols for sending
stimulation signals through pulse output generator 504 and for
modifying these signals in accordance with patterns of signals
received by multichannel signal detection receiver 550.
[0046] FIG. 6 schematically represents the in vivo implantation and
integration of cultured tissue into a living organism whereby
development may be facilitated in accordance with the present
invention. Two apparatuses are shown for this purpose within the
figure; 2-dimensional grid array 660 (an array of emitters and
detectors), and a 3-dimensional multi-surface depth emitter and
detector probe 650. Grid array 660 has leads 665 while probe array
650 has leads 655. Intervention zones 630 are the designated sites
requiring tissue repair or development. Intervention sites 630
sites may be damaged or otherwise insufficient areas of brain 600
at which immature cells are implanted. Alternatively cells native
to or which have migrated to these areas by natural means may be
responsive to stimuli from grid array 660 or probe array 650. Grid
array 660 is best suited for governing the behavior of developing
tissue on surfaces of brain 600, while probe array 650 is best for
reaching sub-surface areas of tissue development. In an alternative
embodiment, 600 may instead represent another organ of the body
other than the brain. Shown in both intervention zones 630 are Type
I cells 620 and 640 (implanted), and Type II cells 625 and 645
(implanted or native). In an alternative embodiment, the discrete
channels of communication may be a non-native chemical or molecular
substance. For example, neurons may be sensitized to an arbitrary
molecule which does not naturally function to affect a neuron. This
may be accomplished, for example, by gene insertion for a receptor
for this arbitrarily selected molecule, with the receptor
functionally tied to the desired output function of that cell type.
In this new configuration, whenever that arbitrary molecule is
introduced into the culture, that cell will react. In the example
of a neuron, it would fire an action potential, or alternatively,
become hyperpolarized. Because no other type of cell in the milieu
is sensitive to the selected molecule, astrocytes and endothelial
cells do not react.
[0047] Another aspect of the patent invention is directed to use
and introduction of a microbial opsin into embryonic stem cells to
develop optogenetic technology for stem cell engineering
applications, with a novel automated system for noninvasive
modulation of embryonic stem cell differentiation employing fast
optics and optogenetic control of ion flux.
[0048] In one experimental embodiment, mouse embryonic stem cells
(ESCs) were stably transduced with ChR2-YFP and purified by FACS.
Illumination of resulting ChR2-ESCs with pulses of blue light
triggered strong inward currents. These labeled ESCs retained the
capability to differentiate into functional mature neurons,
assessed by the presence of voltage-gated sodium currents, action
potentials, fast excitatory synaptic transmission, and expression
of mature neuronal proteins and morphology. Optically stimulating
ChR2-ESCs during the first 5 days of neuronal differentiation, with
high-speed optical switching on a custom robotic stage and
environmental chamber for integrated optical stimulation and
automated imaging, drove increased expression of neural markers.
These data point to potential uses of ChR2 technology for chronic
and temporally precise noninvasive optical control of embryonic
stem cells both in vitro and in vivo, ranging from noninvasive
control of stem cell differentiation to causal assessment of the
specific contribution of transplanted cells to tissue and network
function.
[0049] As another aspect of the present invention and useful alone
or in combination with other aspects disclosed herein, optogenetic
technology (e.g., as described herein) may be used to selectively
affect certain cell types, rendering target cell types sensitive to
light while other cell types remain insensitive to light. In this
manner, such a system effectively differentiates between various
cell types. In this regard, development of one cell type can be
distinguished from other cell types by creating a viral vector in
which a cell-type-specific promoter gene sequence sits immediately
adjacent to the portion which codes for an opsin such as ChR2 or
NpHR. As specific examples, glial cells may be targeted by use of a
GFAP promoter; neurons in general by a Synapsin-I promoter;
excitatory neurons by a CaMK2-alpha promoter; inhibitory neurons by
a VGAT promoter; endothelial cells by a TIE-1 promoter, and stem
cells including progenitor cells by a nestin promoter.
EXPERIMENTAL RESULTS
[0050] Transduction of Mouse ESCs with ChR2
[0051] To assess the potential of optogenetics in stem cells, mouse
ESCs were transduced with a lentiviral ChR2-YFP-construct under the
control of the EFla promoter; after sorting for the top 5% based on
YFP fluorescence intensity, we found that the population doubling
time and vitality of the resulting ChR2-YFP-ESCs did not differ
significantly compared to non-transduced ESCs (not shown), and
confocal microscopy demonstrated membrane localization of ChR2-YFP
with high, uniform expression levels in the ESC population.
ChR2-ESCs continued to express the embryonic stem cell marker SSEAl
and Oct4 (not shown), maintaining the undifferentiated state as did
non-transduced control cells. Electrophysiologically, the ChR2-ESCs
displayed typical outwardly rectifying and passive currents, while
illumination with blue light (470 nm, 500 ms pulse duration) evoked
inward photocurrents (FIGS. 7a, 7b); steady-state photocurrents
showed little inactivation while peak photocurrents showed
inactivation and recovery with kinetics similar to that previously
shown in neurons30 (FIG. 7c).
[0052] The microbial opsins, including ChR2, require a chromophore
(all-trans-retinal) to absorb incoming blue photons and gate the
conformational change of the protein. A surprising finding in the
development of microbial opsins for neurobiology was that mammalian
neurons (but not invertebrate neurons) appear to have sufficient
endogenous retinoids to allow ChR2 to function without addition of
any chemical cofactors. If optogenetics is to become a useful tool
in stem cell engineering, it will be important to determine in stem
cells the extent of dependence on exogenous chemicals like
retinoids both in vitro and in vivo. No retinoids were added for
the in vitro experiments described above; to further determine
dependence or independence from exogenous retinoids in vivo,
5.times.105 ChR2-YFP expressing ESCs were stereotaxically injected
into the cortex of healthy rats. One week after transplantation,
animals were sacrificed and in acute slices, transplanted cells
could be identified by YFP fluorescence. To test whether
transplanted ChR2-ESCS could still respond to optical Stimulation,
patch clamp recordings were conducted, revealing inward currents
upon illumination with blue light (FIG. 7d) that displayed typical
inactivation of the peak current and stability of the steady-state
current. Together these data demonstrate that optogenetic
interventions can be effective, well-tolerated, and independent of
exogenous chemical cofactors in mammalian ES cells.
Differentiation of ChR2-ESCs
[0053] Intracellular Ca.sup.2+ is a major mediator of
differentiation and survival in stem cells and their progeny,
especially in neural lineages. ChR2 itself is a nonselective cation
channel that directly allows Ca.sup.2+ entry into cells. Additional
routes of photo-evoked Ca.sup.2+ entry could include activation of
voltage-gated Ca.sup.2+ channels (VGCCs) by virtue of ChR2-induced
membrane voltage changes. Notably, we find that mouse ES cells
express four major VGCCs assessed by RTPCR and immunoreactivity
(FIGS. 8a, 8b), and this supplementary mechanism for photoactivated
Ca.sup.2+ entry could become increasingly potent as cells proceed
down the neuronal lineage and develop hyperpolarized membrane
potentials. Regardless, the known Ca.sup.2+ flux of ChR2 itself
suggested the potential for optical control of stem cell
processes.
[0054] We first verified that ChR2-ESCs were capable of neural
lineage differentiation, using a retinoic acid-based neural
differentiation protocol (FIG. 8c). At differentiation day 8,
40.+-.10% of the cells expressed the neural lineage marker nestin.
By day 14, a dense network of .beta.-3-tubulin-positive ESC-derived
immature neurons could be detected, followed by expression of the
mature neuronal cytoskeletal protein MAP2 and the vesicular
glutamate transporter II (vGlutll). By day 28 the resulting
ChR2-ESC-derived neurons displayed mature neuronal morphology,
sodium currents, action potentials, and excitatory postsynaptic
currents which could be blocked by excitatory synaptic transmission
glutamate receptor antagonists CNQX and D-AP5 (FIG. 9a-d).
Optical Modulation of Neural Differentiation
[0055] One challenge in deriving replacement tissues from ES cells
is that the cell-type specification and phenotype consolidation
processes, and therefore also the patterning and differentiation
stimuli, take place over many days; to be applicable, optogenetic
stimulation must therefore be deliverable in chronic fashion. In
designing the system to meet this challenge, it is also important
to consider that since knowledge of the precise combinations and
timing of signaling events required for stem cell differentiation
is limited, a multiwall configuration would in principle be
desirable, to allow for fast optical mapping of cell lines,
conditions, and "differentiation space" in the laboratory. We
therefore devised an automated multiwell optogenetic stimulation
approach designed to precisely revisit and optically stimulate
multiple regions of interest (ROIs) in defined patterns over
extended periods of time (FIG. 10a).
[0056] ROIs in multiwell plates were user-defined in a custom GUI
and their locations saved for rapid and reproducible access by a
robotic stage (FIG. 10a). Stimulation parameters (excitation filter
wavelength, optical switch pulse duration, and frequency/duty cycle
of excitation) were set per configured parameters via the
software-based equipment that controls the microscopic stage in the
three spatial dimensions, and controls operation of the DG-4
optical switch which employs spinning galvanometers to deliver
light with sub-millisecond precision (FIG. 10a). The microscope
itself is surrounded by a climate controlled Plexiglass chamber
wherein both temperature and CO.sub.2-level are tightly regulated
and temporally precise imaging can proceed in parallel with optical
stimulation (FIG. 10a). Embryonic stem cells can be cultured and
photo stimulated in this environment rather than in a standard
incubator for many weeks, allowing us to investigate the effect of
optogenetic stimulation on the differentiation of embryonic stem
cells in a controlled, reproducible manner.
[0057] In a typical experiment, ESCs were seeded in a 24 well
plate, at a density of 100,000 cells/ml and 1 ml/well. To directly
capitalize on the advantages of the multiwall plate format, certain
wells were seeded with native ESCs and others with ChR2-YFP ESCs;
moreover specific wells were programmed to receive optical
stimulation; finally, in combinatorial fashion, different wells
within groups received different concentrations of differentiation
factors (for example, the neural lineage factor retinoic acid at 0,
1, or 2.5 .mu.M). In this way differentiation space could be
efficiently mapped while controlling for nonspecific effects
related to the rig or to illumination. Cells were stimulated for 5
days with blue light (470 nm at 15 Hz for 10 s) delivered every 60
min using a 10.times. objective. The survival and morphology of the
cells was monitored using time-lapse imaging every 8 hours (FIG.
10b-g), also demonstrating the precision and accuracy of the
automated setup in its ability to precisely revisit the same
ROI.
[0058] To identify rapidly-acting effects of optical stimulation on
ESC differentiation, cells were simultaneously assayed following
the conclusion of stimulation (FIG. 8c). Immunostaining for the
neural marker nestin followed by confocal analysis of fluorescence
histograms was used to quantify neural lineage differentiation,
along with imaging of cellular nuclei using DAPI. FIGS. 11a and 11b
show a 3D projection of two typical confocal z-stacks of single
ROIs, displaying both DAPI (blue) and nestin (red) fluorescence.
Optically stimulated cells consistently showed higher nestin
immunoreactivity (FIG. 11b) compared to non-stimulated cells (FIG.
11a), while optical stimulation interestingly was ineffective in
the absence of retinoic acid (RA) (FIG. 11c). To quantify this
effect, we generated fluorescence intensity histograms of all ROIs
across all wells in each condition (resulting in more than 150
confocal images per condition). These intensity histograms revealed
considerable differences between stimulated and nonstimulated
ChR2-ESCs (FIG. 11d-h; p<0.01, Kolmogorov-Smirnov test). We next
conducted an experiment to test the possibility that the nestin
distributions of unmodified ("native") optically stimulated ESCs
(FIG. 5g) and ChR2-YFP optically stimulated ESCs (FIG. 11e) could
represent samples from the same distribution; after automated
optical stimulation, repeated as in the above experiment and
subsequent blinded analysis, we found that this hypothesis could be
rejected (p<0.001; two-tailed K-S Z=5.43; FIG. 11e,g shows the
observed increase in high levels of optically-induced nestin
expression in the ChR2-YFP cells). We calculated the mean nestin
fluorescence intensity in each condition, and comparing optically
stimulated with non-optically stimulated cells across all
conditions revealed that only ChR2-YFP ESCs incubated with 2.5 pM
RA showed a significant optogenetically-induced increase in mean
nestin expression (p<0.01, two-tailed t-test; FIGS. 11f, 11h).
In the presence of 1 .mu.M RA, a nonsignificant trend toward higher
nestin expression in the setting of optical stimulation was
observed, while in 0 .mu.M RA no effect of optical stimulation was
observed (e.g., FIG. 11c).
[0059] Accordingly, the present invention presents an application
of optical control technology to stem cell engineering, and
demonstrates the potential of the optogenetic approach by
successfully expressing and driving the light-gated cation channel
channelrhodopsin-2 in mouse embryonic stem cells. We found that
ChR2-YFP ESCs were viable and maintained the undifferentiated
state, and also retained the capability to generate
electrophysiologically mature neurons when differentiated.
Moreover, pulsed illumination with blue light evoked precise and
robust cation currents in ESCs, enabling reproducible and
predictable control of ion flux without requiring addition of
chemical cofactors either in vitro or within intact brain tissue.
By developing automated multiwell optogenetic stimulation tools, we
were able to deliver optical stimulation in combinatorial
experiments over extended periods of time with high spatiotemporal
precision, and found that optogenetic stimulation could modulate
neural lineage progression in the presence of 2.5 .mu.M RA.
[0060] As specifically discussed in connection with the underlying
provisional documents, depolarization has been reported in other
studies to modulate neural differentiation processes in dividing
cells, and indeed depolarization and calcium waves have both been
observed in proliferating GNS progenitors in situ; for example, in
early CNS development, Momose-Sato et al. demonstrated spontaneous
depolarization waves, and Kriegstein and colleagues observed
calcium waves in cortical progenitors. Likewise in postmitotic
neurons, depolarization plays additional important roles in CNS
development, affecting spine development and synaptic plasticity.
In connection with the present invention, it is now believed that
while the specific signal transduction cascades mediating the
influence of membrane depolarization events in early development
remains unclear, the Ca.sup.2+ and Ca.sup.2+ channels may play a
key role and ChR2 is well suited to recruit these mechanisms.
Emerging evidence points to the expression of VGCCs during early
stages of embryonic, and in accordance with aspects of the present
invention, this allows ChR2 to recruit Ca.sup.2+- dependent
cellular processes not only via its own light-activated Ca.sup.2+
flux but also by activating native VGCCs as differentiating cells
mature. According to other aspects, lineages arising from ESCs also
are to be modulated by Ca.sup.2+, including cardiac cells and
others reporting on enhancement of hematoendothelial
differentiation upon chronic depolarization of human ESCs). In all
of these cases, as we observed with the RA gating of optogenetic
modulation, depolarization or Ca.sup.2+ influx is a function of
other patterning and lineage-specific differentiation factors.
[0061] Recent studies have shown the induction of pluripotent stem
cells (iPS) from somatic cell, significantly expanding the possible
sources of stem cells in regenerative medicine but further
highlighting the ongoing need for selective and highly sensitive
stem cell differentiation and control tools. Globally applied
stimuli such as growth factors and organic compounds will affect
all cells present, including non-dividing constituents of the stem
cell niche as well as the stem cells and their progeny, but it is
unlikely that these growth factors will have the same desired
effect in all of the very different cells present in the typical
differentiation milieu. By targeting optical control to either the
proliferating cells or to niche constituents like astrocytes,
optogenetic control of intracellular signaling will allow selective
control of the desired cell type.
[0062] Indeed, this optical specificity principle extends to the
selective control of fully differentiated stem cell progeny in
situ. Minimally invasive fiberoptic strategies have brought
optogenetics to the fully intact, behaving mammal. Transplanted
cells may require electrical activity to drive the final stages of
phenotype consolidation and to fully integrate into host neural
circuitry, representing the central goal of stem cell based
regeneration medicine.
[0063] Compared to conventional electric stimulation or drugs, the
genetic targeting of ChR2 makes it possible to specifically and
reversibly drive precise amounts of activity in the transplanted
ESCs and their progeny, which moreover do not require addition of
chemical cofactors in vivo for ChR2 function. Finally, optically
driving only the transplanted cells, with behavioral readouts or
non-invasive imaging readout modalities like fMRI (and without the
serious problem of signal interference from metal electrodes),
opens the door to imaging and tuning the specific contribution of
transplanted cells in the restoration of network activity and
circuit dynamics, for example in Parkinson's disease. With these
approaches and others, optogenetic technologies are applicable as
valuable tools in stem cell biology and regenerative medicine.
EXPERIMENTAL METHODS
Mouse Embryonic Stem Cell Culturing
[0064] Mouse embryonic stem cells (CRL-1934, ATCC, Manassas, USA)
were grown in DMEM medium (ATCC) containing medium conditioned by
feeder cells (CRL-1503, ATCC), 15% fetal calf serum (Gibco), 15
ng/ml leukemia inhibitory factor (LIF; Sigma-Aldrich), 0.1 mM
2-mercaptoethanol (Sigma-Aldrich), and 1% penicillin-streptomycin
(Sigma-Aldrich). The cells were cultured in 75 cm.sup.2 cell
culture flasks (Falcon) with 20 ml medium at 37.degree. C. and 5%
CO.sub.2 and passaged every 3 days. Only undifferentiated cells in
suspension were used for the experiments. After washing in
phosphate-buffered saline (PBS) (Gibco, Invitrogen), cells were
counted in a Neubauer counting chamber. The viability was
determined by staining with trypan blue solution (0.4%;
Sigma-Aldrich).
Transduction of ESCs with ChR2
[0065] Lentiviruses carrying the ChR2-EYFP fusion gene under the
control of the EF-1-alpha promoter were generated as previously
described. Viruses were concentrated via ultracentrifugation and
redissolved in PBS at 1/1000 of the original volume. The
concentrated viruses were then incubated with ESCs for 24 hr and
transduction efficiency evaluated using fluorescent microscopy one
week after transduction. To obtain a highly and homogenously
expressing ChR2-ESC colony, cells were sorted using FACS; a
subpopulation consisting of the top 5% of YFP-expressing cells was
collected.
Neuronal Differentiation of Embryonic Stem Cells
[0066] Neuronal differentiation was performed as previously
described, with modifications. ESCs were plated on matrigel-coated
dishes in embryoid body stage in complete ESC medium (see above).
24 hours later, medium was changed to ESC medium lacking LIF and
including 5 .mu.M retinoic acid, and changed every second day for 5
days. As a second differentiation step, cells were incubated with
neural expansion medium for 7 days consisting of N2 supplement, SHH
(50 ng/ml), FGF-8b (100 ng/ml), bFGF (10 ng/ml) and ascorbic acid
(200 .mu.M, Sigma) in DMEM/F12 and changed every two days.
Thereafter cells were cultured in N2 and ascorbic acid in
DMEM/F12.
Immunohistochemical Staining of Cultured Cells
[0067] Cells were fixed with 4% paraformaldehyde in PBS for 30 min
at room temperature. Fixation was stopped by washing cells three
times with 0.1M glycine/PBS. Cells were permeabilized and blocked
(4% BSA/0.4% saponin/PBS) for 30 min and incubated in primary
antibody solution at 4.degree. C. overnight. Cells were washed 4
times and incubated with secondary antibody at room temperature for
2 hr. Cells were washed 3.times. with PBS, and at the final washing
step DAPl was added (1:50,000). Coverslips were mounted using
anti-quenching Fluoromount. Primary antibodies were mouse
anti-SSEA1 (Chemicon 1:300), mouse anti-nestin (Chemicon 1:200),
chicken anti-.beta.ill tubulin (Chemicon 1:200), mouse anti MAP2ab
(Sigma 1:500), rabbit anti vGlut 2 (Chemicon 1:200), and rabbit
anti-a1C, -a1D, -a1G, and -a1H (all Alomone labs; 1:200). Cy3 or
Cy5 conjugated donkey anti mouse, chicken and rabbit secondary
antibodies (Jackson) were all used at 1:200.
[0068] Cells were homogenized by Homogenizer (Invitrogen). RNA
isolation was performed using Micro-to-Midi Total RNA Purification
System (Invitrogen). Prior to RT-PCR, RNA samples were pretreated
with DNasel (Invitrogen) and reverse transcription conducted per
manufacturer's protocol. Negative controls without reverse
transcriptase did not result in amplified sequences. Mouse
hippocampal total RNA was purchased from Clontech and the resulting
cDNA served as a positive control. For PCR analysis, primers
targeted to coding regions of two subunits each from both the L-
and T-type VGCC families were used, as follows: L-type a1C Forward:
GTGGTTAGCGTGTCCCTCAT Reverse: GTGGAGACGGTGAAGAGAGC; L-type a1D F:
AATGGCACGGAATGTAGGAG R: GACGAAAAATGAGCCAAGGA; T-type a1G F:
CTGAGCGGATCTTCCTAACG R: TGAAAAAGGCACAGCAGATG; T-type a1H F:
TGGGAACGTGCTTCTTCTCT R: TGGGCATCCATGACGTAGTA; Housekeeping gene
(Actin) F: GGCATTGTGATGGACTCCGG R: TGCCACAGGATTCCATACCC. 293 FT
kidney cells did not express these channel subunits, as expected
(FIG. 8a), and PCR products of actin and L-type and T-type subunits
were cloned and sequenced to confirm identity.
Long-Term Optical Stimulation of ESCs
[0069] Key components of the hardware interface include (a) Oasis4i
Controller (Objective Imaging) (hardware for x-y-z 3-axis and focus
control)
(http://ww.objectiveimaging.com/Download/OI_Download.htm-softwar- e
development kit (SDK) for the Oasis4i Controller), (b) DG4 Ultra
High Speed wavelength switcher (Sutter), (c) Retiga SRV Camera
(Qimaging), and (d) Leica DM6000 Microscope controlled by AHM
(Abstract Hardware Model) controller. The parallel port is
controlled using DLPORTIO library file
(www.driverlinx.com/DownLoad/DIPortlO.htm-Dlls to for parallel port
control) and camera parameters (gain, exposure) set using QCam SDK
(Ver. 5.1.1.14) (http://ww.qimaging.com/support/downloads/-SDK to
control the Retiga SRV/Exi Cameras). The custom software user
interface to the optogenetic stimulation setup was developed using
the Microsoft Foundation Library (MFC; Ver. 8.0) and is available
on request. Briefly, regions of interest (for example, an embryoid
body or a small well in a multiwall plate) to be stimulated and/or
imaged are selected using the Oasis4i Controller, and their
locations saved using the MFC interface. Stimulation parameters
(excitation filter wavelength, the duration of the excitatory
pulse, and the frequency and duty cycle of excitation) are then set
in the custom GUI. To allow stimulation space to be mapped, each
region of interest can be readily programmed to receive a different
stimulus pattern to operate over the many days of stimulation and
imaging. Similarly, imaging parameters can also be varied for
selected regions, including number of images per region and
exposure, gain, excitation and emission filters.
[0070] Undifferentiated cells were seeded on matrigel (BD) coated
coverslips in 24-well plates in complete ESC medium at a density of
100,000 cells/well. Both native ESCs and ChR2-expressing ESCs were
used in different wells on the same plate. 24 hours after seeding,
medium was changed to the various experimental conditions including
complete ESC medium, ESC medium lacking both LIF and conditioned
media from feeder cells (differentiation medium), differentiation
medium with 1 .mu.M retinoic acid (RA) (Sigma), and differentiation
medium with 2.5 .mu.M RA. Optical stimulation was conducted using
the previously-described tools (FIG. 4). Up to 30 regions of
interest (ROIs) were defined per well, ensuring that all
cell-containing regions on the coverslip were stimulated. ROIs were
illuminated every hour around the clock over 5 days with blue light
(470 nm) pulsing at 15 Hz for 10 s, using a 10.times. objective (NA
0.3). Every 8 hours, a photomicrograph was programmed to be taken
of the selected ROIs. At the end of the experiment, coverslips were
removed from the plates and immediately fixed with paraformaldehyde
and stained as described above. Mounted slides were labeled with
coded numbers by a colleague so that the investigators conducting
confocal analysis were blind to treatment condition.
Confocal Microscopy and Image Analysis
[0071] Confocal imaging was conducted using the Leica SP2 confocal
microscope and a 40.times. oil objective (NA 0.75). For DAP1
excitation, a 402 nm diode laser was used; Cy5-nestin was excited
using a 633 nm HeNe laser. 6 ROIs were randomly and blindly
selected for analysis per coverslip, and 1024.times.1024 8-bit
confocal images were obtained. For each ROI, a z-stack with 8-12
x-y-sections and a z step size of 0.98 .mu.m were collected,
thereby including all cells present in the ROI. Data analysis was
conducted using ImageJ (NIH, USA) software, and after unblinding,
confocal images of all ROIs of all coverslips of each condition
(e.g., ChR2-ESCs, optically stimulated, 2.5 .mu.M RA) were
converted into a single z-stack. Fluorescence intensity histograms
were calculated for DAP1 and nestin channels. DAN histograms
reflecting the cell numbers allowed for a normalization of nestin
histograms. All nestin voxel numbers have been divided by this DAP1
factor. Statistical analysis was conducted using SPSS (Chicago,
USA) software. To statistically compare histograms, the
parameter-free Kolmogorov-Smirnov test was employed, and to compare
means, statistical significance was calculated using the
t-test.
Stereotactic Cell Transplantation
[0072] Rats (male Wistars, 250-350 g) were the subjects of these
experiments. Animal husbandry and all aspects of experimental
manipulation of our animals were in strict accord with guidelines
from the National Institute of Health and approved by members of
the Stanford Institutional Animal Care and Use Committee. Rats were
anaesthetized by i.p. injection (90 mg ketamine and 5 mg xylazine
per kg of rat body weight). For cell transplantation, a 1 mm
craniotomy was drilled over motor cortex. 1 .mu.L of ESCs
expressing ChR2-EYFP fusion protein at a density of 50k
cells/.mu.L, suspended in PBS were injected (26 g Hamilton Syringe)
into rat motor cortex (AP+1.5 mm, ML+1.5 mm, DV+1.5 mm) The
injection duration was 10 min; an additional 10 min delay followed
before syringe withdrawal, and electrophysiology was conducted
after 1 week.
Electrophysiology
[0073] For acute slice electrophysiological experiments, 1 week
post cell transplantation, 250 .mu.m cortical slices were prepared
in ice-cold cutting buffer (64 mM NaCl, 25 mM NaHCO.sub.3, 10 mM
glucose, 120 mM sucrose, 2.5 mM KCl, 1.25 mM NaH.sub.2PO.sub.4, 0.5
mM CaCl.sub.2 and 7 mM MgCl.sub.2, equilibrated with 95% O.sub.2/5%
CO.sub.2) using a vibratome (VT 1000 S; Leica). After a recovery
period of 30 min in cutting buffer at 32-35.degree. C., slices were
gently removed to a recording chamber mounted on an upright
microscope (DM LFSA, Leica) and continuously perfused at a rate of
3-5 ml/min with carbonated ACSF (124 mM NaCl, 3 mM KCI, 26 mM
NaHCO.sub.3, 1.25 mM NaH.sub.2PO.sub.4, 2.4 mM CaCl.sub.2, 1.3 mM
MgCl.sub.2, 10 mM Glucose), ventilated with 95% O.sub.2/5%
CO.sub.2.ChR2-YFP-ESCs were identified on an upright fluorescence
microscope (DM LFSA, Leica) with a 20.times., 0.5 NA water
immersion objective and a YFP filter set. Images were recorded with
a CCD camera (Retiga Exi, Qimaging) by Qimaging software.
Electrophysiological recordings in cultured ChR2-YFP ESCs were
performed as previously described, in Tyrode solution containing
(in mM) NaCl 125, KCI 2, CaCI.sub.23, MgCl.sub.2 1, glucose 30 and
HEPES 25 (pH 7.3 with NaOH). Membrane currents were measured with
the patch-clamp technique in whole-cell mode using Axon Multiclamp
700B (Axon Instruments) amplifiers. Pipette solution consisted of
(in mM): 97 potassium gluconate, 38 KCI, 6 NaCl, 0.35 sodium ATP, 4
magnesium ATP, 0.35 EGTA, 7 phosphocreatine and 20 HEPES (pH 7.25
with KOH). Pipette resistance was 4-8 M. Membrane potential was
noted at the time of establishing the whole cell configuration. We
employed pClamp 9 acquisition software (Axon Instruments), a DG-4
high-speed optical switch with 300 W xenon lamp (Sutter
Instruments) and a GFP filter set (excitation filter HQ470/40x,
dichroic Q495LP; Chroma) to deliver blue light for ChR2 activation.
Through a 20.times. objective lens, power density of the blue light
was 8-12 mW/mm.sup.2, measured by power meter (Newport). All
experiments were performed at room temperature (22-24.degree.
C.).
[0074] The various embodiments described above are provided by way
of illustration only and should not be construed to limit the
invention. Based on the above discussion and illustrations, those
skilled in the art will readily recognize that various
modifications and changes may be made to the present invention
without strictly following the exemplary embodiments and
applications illustrated and described herein. Such modifications
and changes do not depart from the true spirit and scope of the
present invention, which is set forth in the following claims.
Sequence CWU 1
1
10120DNAArtificial SequenceSythetic Primer 1gtggttagcg tgtccctcat
20220DNAArtificial SequenceSythetic Primer 2gtggagacgg tgaagagagc
20320DNAArtificial SequenceSythetic Primer 3aatggcacgg aatgtaggag
20420DNAArtificial SequenceSythetic Primer 4gacgaaaaat gagccaagga
20520DNAArtificial SequenceSythetic Primer 5ctgagcggat cttcctaacg
20620DNAArtificial SequenceSythetic Primer 6tgaaaaaggc acagcagatg
20720DNAArtificial SequenceSythetic Primer 7tgggaacgtg cttcttctct
20820DNAArtificial SequenceSythetic Primer 8tgggcatcca tgacgtagta
20920DNAArtificial SequenceSythetic Primer 9ggcattgtga tggactccgg
201020DNAArtificial SequenceSythetic Primer 10tgccacagga ttccataccc
20
* * * * *
References