U.S. patent application number 14/976689 was filed with the patent office on 2017-07-27 for chimeric immunoreceptor useful in treating human cancers.
The applicant listed for this patent is City of Hope. Invention is credited to Michael C. Jensen.
Application Number | 20170209543 14/976689 |
Document ID | / |
Family ID | 42233623 |
Filed Date | 2017-07-27 |
United States Patent
Application |
20170209543 |
Kind Code |
A9 |
Jensen; Michael C. |
July 27, 2017 |
Chimeric Immunoreceptor Useful in Treating Human Cancers
Abstract
The present invention relates to chimeric transmembrane
immunoreceptors, named "zetakines," comprised of an extracellular
domain comprising a soluble receptor ligand linked to a support
region capable of tethering the extracellular domain to a cell
surface, a transmembrane region and an intracellular signalling
domain. Zetakines, when expressed on the surface of T lymphocytes,
direct T cell activity to those specific cells expressing a
receptor for which the soluble receptor ligand is specific.
Zetakine chimeric immunoreceptors represent a novel extension of
antibody-based immunoreceptors for redirecting the antigen
specificity of T cells, with application to treatment of a variety
of cancers, particularly via the autocrin/paracrine cytokine
systems utilized by human maligancy. In a preferred embodiment is a
glioma-specific immunoreceptor comprising the extracellular
targetting domain of the IL-13R.alpha.2-specific IL-13 mutant
IL-13(E13Y) linked to the Fc region of IgG, the transmembrane
domain of human CD4, and the human CD3 zeta chain.
Inventors: |
Jensen; Michael C.; (Duarte,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
City of Hope |
Duarte |
CA |
US |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20160175398 A1 |
June 23, 2016 |
|
|
Family ID: |
42233623 |
Appl. No.: |
14/976689 |
Filed: |
December 21, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13953622 |
Jul 29, 2013 |
9217025 |
|
|
14976689 |
|
|
|
|
13570032 |
Aug 8, 2012 |
8497118 |
|
|
13953622 |
|
|
|
|
13046518 |
Mar 11, 2011 |
8324353 |
|
|
13570032 |
|
|
|
|
12314195 |
Dec 5, 2008 |
|
|
|
13046518 |
|
|
|
|
11274344 |
Nov 16, 2005 |
7514537 |
|
|
12314195 |
|
|
|
|
61091915 |
Aug 26, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/46 20130101;
A61K 38/1774 20130101; C07K 14/70514 20130101; A61K 38/2086
20130101; A61K 35/17 20130101; C07K 2319/00 20130101; C12N 5/0636
20130101; A61P 35/00 20180101; C07K 14/7155 20130101; C07K 2319/30
20130101; C07K 14/5437 20130101; C07K 14/7051 20130101; C07H 21/04
20130101; C12N 15/63 20130101; C07K 19/00 20130101 |
International
Class: |
A61K 38/20 20060101
A61K038/20; C07K 14/725 20060101 C07K014/725; A61K 38/17 20060101
A61K038/17; C07K 14/73 20060101 C07K014/73; C07K 14/54 20060101
C07K014/54; A61K 35/17 20060101 A61K035/17 |
Goverment Interests
[0002] This invention was made with government support in the form
of Cancer Center Support Grant no. P30-CA33572-21 from the United
States Department of Health and Human Services, National Institutes
of Health. The United States government has certain rights in the
invention.
Claims
1. A chimeric immunoreceptor comprising SEQ ID NO:22.
2. A chimeric immunoreceptor encoded by a nucleic acid sequence
comprising SEQ ID NO:19 or SEQ ID NO:23.
3. A method for treating human cancer, comprising administering to
a human suffering from a glioma that overexpresses IL13.alpha.2
receptor a plurality of T lymphocyte cells expressing an
immunoreceptor of claim 1 or claim 2.
4. A vector which comprises a nucleic acid comprising SEQ ID NO: 19
or SEQ ID NO:23.
5. The vector which consists essentially of SEQ ID NO:19.
6. The vector which consists essentially of SEQ ID NO:23.
Description
[0001] This application is a continuation of prior co-pending
application Ser. No. 13/570,032, filed Aug. 8, 2012 (U.S. Pat. No.
8,497,118), which is a continuation of application Ser. No.
13/046,518, filed Mar. 11, 2011 (now U.S. Pat. No. 8,324,353),
which is a continuation of prior co-pending application Ser. No.
12/314,195, filed Dec. 5, 2008 (now abandoned), which is a
continuation-in-part of application serial no. U.S. Ser. No.
11/274,344, filed Nov. 16, 2005 (now U.S. Pat. No. 7,514,537),
which is a continuation-in-part of application serial no. U.S. Ser.
No. 10/134,645, filed Apr. 30, 2002 (now abandoned), which claims
the benefit of provisional application serial no. U.S. 60/286,981,
filed Apr. 30, 2001. Application Ser. No. 12/314,195 also claims
the benefit of provisional application serial no. U.S. 61/091,915,
filed Aug. 26, 2008. The disclosures of all of the above
applications are hereby incorporated by reference in their
entirety.
TECHNICAL FIELD
[0003] The invention relates to the field of biomedicine and
specifically methods useful for cancer therapy. In particular,
embodiments of the invention relate to methods for specific CTL
immunotherapeutic strategies for cancer including the use of
genetically-modified T lymphocytes expressing chimeric
immunoreceptors in the treatment of human brain tumors and other
cancers.
BACKGROUND OF THE INVENTION
[0004] Primary brain tumors are the third leading contributor to
cancer-related mortality in young adults, are the second leading
contributor in children, and appear to be increasing in incidence
both in the pediatric and geriatric population.sup.1-4. Gliomas are
the most common type of primary brain tumors; 20,000 cases are
diagnosed and 14,000 glioma-related deaths occur annually in the
United States.sup.5-8. Gliomas are heterogeneous with respect to
their malignant behavior and, in their most common and aggressive
forms, anaplastic astrocytoma (AA-grade III) and glioblastoma
multiforme (GBM-grade IV), are rapidly progressive and nearly
uniformly lethal.sup.9; 10. Currently available therapeutic
modalities have minimal curative potential for these high-grade
tumors and often exacerbate the already severe morbidities imposed
by their location in the central nervous system. Thus patients with
malignant glioma are often struck in the most productive period of
their lives; frequent deterioration of mental faculties and a high
case:fatality ratio contribute to the unique personal and social
impact of these tumors.
[0005] The cornerstones of oncologic management of malignant glioma
are resection and radiation therapy.sup.11-16. With modern surgical
and radiotherapeutic techniques the mean duration of survival has
increased to 82 weeks for glioblastoma multiforme and 275 weeks for
anaplastic astrocytoma, although 5-year survival rates have only
increased from 3 to 6% for glioblastoma multiforme and 12.1% for
anaplastic astrocytoma.sup.6-8. The major prognostic indicators for
prolonged survival are younger age (<40 yrs) and performance
status (KPS score>70).sup.17. Resections of >90% of bulky
tumors are usually attempted provided that vital functional anatomy
is spared. When used in conjunction with post-operative radiation
therapy, the impact of extent of resection on duration of survival
is less clear.sup.18; 19. The addition of chemotherapy to resection
and radiation provides only marginal survival advantage to patients
with anaplastic astrocytoma or glioblastoma multiforme.sup.20-23.
Nitrosureas alone or in combination with procarbazine and
vincristine are the conventional drugs used in the community and
appear to improve the 1-year and 2-year survival rates by 15%
without impacting on the overall median survival.sup.24; 25. More
aggressive regimens incorporating platinum-based drugs and
topoisomerase inhibitors are under investigation.sup.26. The role
of high-dose chemotherapy with stem cell rescue has not been
substantiated to date.sup.27-29.
[0006] Approximately 80% of recurrent tumors arise from
radiographically enhancing remnants of the original incompletely
resected tumor.sup.30; 31. Provided recurrences are unifocal and
amenable in their location to aggressive re-resection, this
approach can extend survival duration, particularly for patients
with anaplastic astrocytoma and those glioblastoma multiforme
patients with a KPS>70..sup.10 The median survival of recurrent
glioblastoma multiforme patients treated with re-resection is 36
weeks.sup.10; 30; 31. Radiation therapy in the form of either
brachytherapy or stereotactic radiosurgery may extend the duration
of survival in re-resected recurrent glioblastoma multiforme
patients by only 10-12 weeks.sup.32. The use of chemotherapy in the
setting of recurrent disease should be in the context of available
clinical trials, as its efficacy in this patient population is
unsubstantiated.
[0007] The continued dismal prognosis of malignant glioma has
prompted the clinical investigation of novel therapeutic entities,
including, but not limited to: gene therapy (TK-suicide, antisense
inhibition of tumor growth factor receptors, conditionally lethal
viral vectors), immunotherapy (antibody, tumor cell vaccines,
immunotoxins, adoptive transfer of activated lymphocytes), and
anti-angiogenesis approaches.sup.33-40. The multiplicity of
challenges faced in the development of effective adjuvant therapies
for malignant glioma include the extensive infiltrative growth of
tumor cells into normal brain parenchyma, the capacity of soluble
factors elaborated from these tumors to attenuate the development
of immune responses, and the difficulty of establishing clinically
meaningful therapeutic ratios when administering therapeutics into
the central nervous system (CNS). Early clinical evaluation of
novel therapeutics is clearly indicated in this patient
population.
[0008] Recently, receptors for transferrin and growth factors have
been the subject of experimental glioma therapeutics utilizing
ligands for these receptors conjugated to toxins or
radionucleotides as a delivery system.sup.41. The specificity of
this approach relies on the unique expression or over-expression of
targeted receptors on glioma cells compared to normal brain.
Interestingly, some receptor complexes for interleukins utilized by
the immune system are expressed by gliomas, in particular
high-affinity IL-13 receptors.sup.42-48. Unlike the IL-13 receptor
trimolecular complex utilized by the immune system, which consists
of the IL-13R.alpha.1, the IL-4R.beta., and .gamma.c, glioma cells
overexpress a unique IL-13R.alpha.2 chain capable of binding IL-13
independently of the requirement for IL-4R.beta. or
.gamma.c.sup.44; 49; 50. Like its homologue IL-4, IL-13 has
pleotrophic immunoregulatory activity outside the CNS.sup.51-53.
Both cytokines stimulate IgE production by B lymphocytes and
suppress pro-inflammatory cytokine production by macrophages. The
immunobiology of IL-13 within the CNS is largely unknown.
[0009] Detailed studies by Debinski et al. using autoradiography
with radiolabeled IL-13 have demonstrated abundant IL-13 binding on
nearly all malignant glioma tissues studied.sup.42; 45; 46; 48.
Moreover, the binding is highly homogeneous within tumor sections
and from single cell analysis.sup.46; 48. Scatchard analyses of
IL-13 binding to human glioma cell lines reveals on average
17,000-28,000 binding sites/cell.sup.45. Molecular analysis using
probes specific for IL-13R.alpha.2 mRNA fail to demonstrate
expression of the glioma-specific receptor by normal brain elements
in all CNS anatomic locations.sup.42; 43. Furthermore,
autoradiography with radiolabeled IL-13 failed to demonstrate
detectable specific IL-13 binding in the CNS, suggesting that the
shared IL13R.alpha.1/IL-4.beta./.gamma.c receptor is also not
expressed at detectable levels in the CNS.sup.46. These findings
were independently verified using immunohistochemical techniques on
non-pathologic brain sections with antibodies specific for
IL-13R.alpha.1 and IL-4.beta..sup.54. Thus IL-13R.alpha.2 stands as
the most specific and ubiquitously expressed cell-surface target
for glioma described to date.
[0010] As a strategy to exploit the glioma-specific expression of
IL-13R.alpha.2 in the CNS, molecular constructs of the IL-13
cytokine have been described that fuse various cytotoxins
(Pseudomonas exotoxin and Diptheria toxin) to its carboxyl
terminal.sup.55-58. Internalization of these toxins upon binding to
IL-13 receptors is the basis of the selective toxicity of these
fusion proteins. These toxins display potent cytotoxicity towards
glioma cells in vitro at picomolar concentrations.sup.55. Human
intracranial glioma xenografts in immunodeficient mice can be
eliminated by intratumor injection of the IL-13-toxin fusion
protein without observed toxicities.sup.55. These studies support
the initiation of clinical investigation utilizing IL-13-directed
immunotoxins loco-regionally for malignant glioma.
[0011] However, the binding of IL-13-based cytotoxins to the
broadly expressed IL-13R.alpha.1/IL-4.beta./.gamma.c receptor
complex has the potential of mediating untoward toxicities to
normal tissues outside the CNS, and thus limits the systemic
administration of these agents. IL-13 has been extensively
dissected at the molecular level: structural domains of this
cytokine that are important for associating with individual
receptor subunits have been mapped.sup.55; 58. Consequently,
selected amino acid substitutions in IL-13 have predictable effects
on the association of this cytokine with its receptor subunits.
Amino acid substitutions in IL-13's alpha helix A, in particular at
amino acid 13, disrupt its ability to associate with IL-4.beta.,
thereby selectively reducing the affinity of IL-13 to the
IL-13R.alpha.1/IL-4.beta./.gamma.c receptor by a factor of
five.sup.55; 57; 58. Surprisingly, binding of mutant IL-13(E13Y) to
IL-13R.alpha.2 was not only preserved but increased relative to
wild-type IL-13 by 50-fold. Thus, minimally altered IL-13 analogs
can simultaneously increase IL-13's specificity and affinity for
glioma cells via selective binding to IL-13R.alpha.2 relative to
normal tissues bearing IL-13R.alpha.1/IL-4.beta./.gamma.c
receptors.
[0012] Malignant gliomas represent a clinical entity that is highly
attractive for immunotherapeutic intervention since 1) most
patients with resection and radiation therapy achieve a state of
minimal disease burden and 2) the anatomic location of these tumors
within the confines of the CNS make direct loco-regional
administration of effector cells possible. At least two pathologic
studies have demonstrated that the extent of perivascular
lymphocytic infiltration in malignant gliomas correlates with an
improved prognosis.sup.59-61. Animal model systems have established
that glioma-specific T cells, but not lymphokine-activated killer
(LAK) cells, can mediate the regression of intracerebrally
implanted gliomas.sup.62-71. T cells, unlike LAK cells, have the
capacity to infiltrate into brain parenchyma and thus can target
infiltrating tumor cells that may be distant from the primary
tumor. Despite these findings, there is a substantial body of
evidence that gliomas actively subvert immune destruction,
primarily by the elaboration of immunosuppressive cytokines
(TGF-.beta.2) and prostaglandins, which, inhibit the
induction/amplification of glioma-reactive T cell
responses.sup.72-74. These findings have prompted the evaluation of
ex vivo expanded anti-glioma effector cells for adoptive therapy as
a strategy to overcome tumor-mediated limitations of generating
responses in vivo.
[0013] At least ten pilot studies involving the administration of
ex vivo activated lymphocytes to malignant glioma resection
cavities have been reported to date.sup.75-85. Despite the variety
of effector cell types (LAK, TILs, alloreactive CTLs), their
heterogeneous composition/variability of composition from patient
to patient, and the often modest in vitro reactivity of these
effector cells towards glioma targets, these studies, in aggregate,
report an approximate 50% response rate in patients with
recurrent/refractory disease with anecdotal long-term survivors.
These studies support the premise that a superior clinical effect
of cellular immunotherapy for glioma might be expected with
homogenous highly potent effector cells.
[0014] These pilot studies also report on the safety and
tolerability of direct administration of ex vivo activated
lymphocytes and interleukin-2 (IL-2), a T cell growth factor, into
the resection cavity of patients with malignant glioma.sup.75; 76;
78; 82; 86-92. Even at large individual cell doses (>10.sup.9
cells/dose), as well as high cumulative cell doses
(>27.times.10.sup.9 cells), toxicities are modest, and typically
consist of grade II or less transient headache, nausea, vomiting
and fever. As noted above, these studies also employed the
co-administration of rhIL-2 to support the in vivo survival of
transferred lymphocytes. Multiple doses given either concurrently
with lymphocytes or sequentially after lymphocyte administration
were tolerated at doses as high as 1.2.times.10.sup.6 IU/dose for
12-dose courses of IL-2 delivered every 48-hours.
[0015] Based on the findings outlined above, strategies to improve
the anti-tumor potency of lymphocyte effector cells used in glioma
immunotherapy are under development. One approach utilizes
bi-specific antibodies capable of co-localizing and activating T
lymphocytes via an anti-CD3 domain with glioma targets utilizing an
epidermal growth factor receptor (EGFR) binding domain.sup.93-96.
Preliminary clinical experience with this bi-specific antibody in
combination with autologous lymphocytes suggests that T cells are
activated in situ in the resection cavity. Targeting infiltrating
tumor cells within the brain parenchyma, however, is a potentially
significant limitation of this approach. T cells might have
significantly increased anti-glioma activity if they are specific
for target antigens expressed by gliomas. A growing number of human
genes encoding tumor antigens to which T lymphocytes are reactive
have been cloned, including the SART-1 gene, which appears to be
expressed by nearly 75% of high-grade gliomas.sup.97. Both
dendritic cell-based in vitro cell culture techniques, as well as
tetramer-based T cell selection technologies are making feasible
the isolation of antigen-specific T cells for adoptive therapy.
Since antigens like SART-1 are recognized by T cells in the context
of restricting HLA alleles, antigen-specific approaches will
require substantial expansion in the number of antigens and
restricting HLA alleles capable of presenting these antigens to be
broadly applicable to the general population of glioma
patients.
[0016] Chimeric antigen receptors engineered to consist of an
extracellular single chain antibody (scFvFc) fused to the
intracellular signaling domain of the T cell antigen receptor
complex zeta chain (scFvFc:.zeta.) have the ability, when expressed
in T cells, to redirect antigen recognition based on the monoclonal
antibody's specificity.sup.98. The design of scFvFc:.zeta.
receptors with target specificities for tumor cell-surface epitopes
is a conceptually attractive strategy to generate antitumor immune
effector cells for adoptive therapy as it does not rely on
pre-existing anti-tumor immunity. These receptors are "universal"
in that they bind antigen in a MHC independent fashion, thus, one
receptor construct can be used to treat a population of patients
with antigen-positive tumors. Several constructs for targeting
human tumors have been described in the literature including
receptors with specificities for Her2/Neu, CEA, ERRB-2, CD44v6, and
epitopes selectively expressed on renal cell carcinoma.sup.98-164.
These epitopes all share the common characteristic of being
cell-surface moieties accessible to scFv binding by the chimeric T
cell receptor. In vitro studies have demonstrated that both CD4+
and CD8+ T cell effector functions can be triggered via these
receptors. Moreover, animal models have demonstrated the capacity
of adoptively transferred scFvFc:.zeta. expressing T cells to
eradicate established tumors.sup.105. The function of primary human
T cells expressing tumor-specific scFvFc:.zeta. receptors have been
evaluated in vitro; these cells specifically lyse tumor targets and
secrete an array of pro-inflammatory cytokines including IL-2, TNF,
IFN-.gamma., and GM-CSF.sup.104. Phase I pilot adoptive therapy
studies are underway utilizing autologous scFvFc:.zeta.-expressing
T cells specific for HIV gp120 in HIV infected individuals and
autologous scFvFa:.zeta.-expressing T cells with specificity for
TAG-72 expressed on a variety of adenocarcinomas, including breast
and colorectal adenocarcinoma.
[0017] Investigators at City of Hope have engineered a
CD20-specific scFvFc:.zeta. receptor construct for the purpose of
targeting CD20+ B-cell malignancy and an L1-CAM-specific chimeric
immunoreceptor for targeting neuroblastoma.sup.106. Preclinical
laboratory studies have demonstrated the feasibility of isolating
and expanding from healthy individuals and lymphoma patients CD8+
CTL clones that contain a single copy of unrearranged chromosomally
integrated vector DNA and express the CD20-specific scFvFc:.zeta.
receptor.sup.107. To accomplish this, purified linear plasmid DNA
containing the chimeric receptor sequence under the transcriptional
control of the CMV immediate/early promoter and the NeoR gene under
the transcriptional control of the SV40 early promoter was
introduced into activated human peripheral blood mononuclear cells
by exposure of cells and DNA to a brief electrical current, a
procedure called electroporation. Utilizing selection, cloning, and
expansion methods currently employed in FDA-approved clinical
trials at the Fred Hutchinson Cancer Research Center, Seattle,
Wash., gene modified CD8+ CTL clones with CD20-specific cytolytic
activity have been generated from each of six healthy volunteers in
15 separate electroporation procedures. These clones when
co-cultured with a panel of human CD20+ lymphoma cell lines
proliferate, specifically lyse target cells, and are stimulated to
produce cytokines.
SUMMARY OF THE INVENTION
[0018] The present invention relates to chimeric transmembrane
immunoreceptors, named "zetakines," comprised of an extracellular
domain comprising a soluble receptor ligand linked to a support
region capable of tethering the extracellular domain to a cell
surface, a transmembrane region and an intracellular signaling
domain. Zetakines, when expressed on the surface of T lymphocytes,
direct T cell activity to those cells expressing a receptor for
which the soluble receptor ligand is specific. Zetakine chimeric
immunoreceptors represent a novel extension of antibody-based
immunoreceptors for redirecting the antigen specificity of T cells,
with application to treatment of a variety of cancers, particularly
via the autocrine/paracrine cytokine systems utilized by human
malignancy.
[0019] In one preferred embodiment exploiting the tumor-restricted
expression of IL-13R.alpha.2 by malignant glioma and renal cell
carcinoma as a target for cellular immunotherapy, a mutant of the
IL-13 cytokine, IL-13(E13Y), having selective high-affinity binding
to IL-13R.alpha.2 has been converted into a type I transmembrane
chimeric immunoreceptor capable of redirecting T cell antigen
specificity to IL-13R.alpha.2-expressing tumor cells. This
embodiment of the zetakine consists of extracellular IL-13(E13Y)
fused to human IgG4 Fc, transmembrane CD4, and intracellular T cell
antigen receptor CD3 complex zeta chain. Analogous immunoreceptors
can be created that are specific to any of a variety of cancer cell
types that selectively express receptors on their cell surfaces,
for which selective ligands are known or can be engineered.
[0020] Bulk lines and clones of human T cells stably transformed to
express such an immunoreceptor display redirected cytolysis of the
cancer cell type to which they are specific, while showing
negligible toxicity towards non-target cells. Such engineered T
cells are a potent and selective therapy for malignancies,
including difficult to treat cancers such as glioma.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1: Results of a Western Blot showing that the
IL13zetakine Chimeric Immunoreceptor is expressed as an intact
glycosylated protein in Jurkat T cells.
[0022] FIGS. 2A through 2B: Results of flow cytometric analysis
showing that expressed IL13zetakine chimeric immunoreceptor
trafficks to the cell-surface as a type I transmembrane
protein.
[0023] FIGS. 3A through 3C: Results of flow cytometric analysis
showing the cell surface phenotype of a representative primary
human IL13zetakine.sup.+ CTL clone.
[0024] FIGS. 4A through 4F: Results of chromium release assays.
FIG. 4A shows that the IL13zetakine.sup.+ CTL clone acquired
glioma-specific re-directed cytolytic activity, and FIG. 4B shows
the profile of anti-glioma cytolytic activity by primary human
IL13zetakine.sup.+ CD8.sup.+ CTL clones was observed in glioma
cells generally.
[0025] FIGS. 5A through 5C: Results of in vitro stimulation of
cytokine production, showing that IL13zetakine.sup.+ CTL clones are
activated for cytokine production by glioma stimulator cells.
[0026] FIGS. 6A through 6C: Results of in vitro stimulation of
cytokine production (FIG. 6A, IFN.gamma.; FIG. 6B, TNF.alpha.; FIG.
6C, GM-CSF), showing the specific inhibition of IL13zetakine.sup.+
CTL activation for cytokine production by anti-IL13R Mab and
rhIL13.
[0027] FIGS. 7A through 7B: Results of growth studies. FIG. 7A
shows that IL13zetakine.sup.+ CD8.sup.+ CTL cells proliferate upon
co-culture with glioma stimulators, and FIG. 7B shows the
inhibition of glioma-stimulated proliferation of IL13zetakine.sup.+
CD8.sup.+ CTL cells by rhIL-13.
[0028] FIGS. 8A through 8C: Flow chart of the construction of
IL13zetakine/HyTK-pMG (FIG. 8A, constructoin fo hsp-IL13-IgG4
(SmP)-hinge-Fe-Zeta; FIG. 8B, construction of IL13-Fc; .zeta.3pMB
Pac; FIG. 8C, construction of Il13/HyTK-pMG).
[0029] FIG. 9: Plasmid map of IL13zetakine/HyTK-pMG.
[0030] FIG. 10: Plasmid map of alternative
IL13zetakine/HyTK-pMG.
[0031] FIG. 11: Schematic diagram showing structure of IL13
zetakine insert.
[0032] FIGS. 12A through 12I: Nucleic acid sequence of a plasmid
DNA vector (upper strand: SEQ ID NO:24; lower strand: SEQ ID NO:25)
and the corresponding amino acid sequence of IL13zetakine (SEQ ID
NO:17) and HyTK (SEQ ID NO:18).
[0033] FIGS. 13A through 13I: Nucleic acid sequence of an alternate
plasmid DNA vector (upper strand: SEQ ID NO:19; lower strand: SEQ
ID NO:20) and the corresponding amino acid sequence of IL13zetakine
(SEQ ID NO:22) and HyTK (SEQ ID NO:21).
[0034] FIGS. 14A through 14C: Nucleic acid sequence of an alternate
plasmid DNA vector (SEQ ID NO:23).
[0035] FIGS. 15A through 15H: Nucleic acid sequence of an alternate
plasma DNA vector (upper strand: SEQ ID NO:14; lower strand: SEQ ID
NO:16) and the corresponding amino and sequence of IL 13zetakine
(SEQ ID NO:17) and HyTK (SEQ ID NO:18).
DETAILED DESCRIPTION
[0036] An ideal cell-surface epitope for tumor targeting with
genetically-engineered re-directed T cells would be expressed
solely on tumor cells in a homogeneous fashion and on all tumors
within a population of patients with the same diagnosis. Modulation
and/or shedding of the target molecule from the tumor cell membrane
may also impact on the utility of a particular target epitope for
re-directed T cell recognition. To date few "ideal" tumor-specific
epitopes have been defined and secondary epitopes have been
targeted based on either lack of expression on critical normal
tissues or relative over-expression on tumors. In the case of
malignant glioma, the intracavitary administration of T cells for
the treatment of this cancer permits the expansion of target
epitopes to those expressed on tumor cells but not normal CNS with
less stringency on expression by other tissues outside the CNS. The
concern regarding toxicity from cross-reactivity of tissues outside
the CNS is mitigated by a) the sequestration of cells in the CNS
based on the intracavitary route of administration and b) the low
cell numbers administered in comparison to cell doses typically
administered systemically.
[0037] The IL-13R.alpha.2 receptor stands out as the most
ubiquitous and specific cell-surface target for malignant
glioma.sup.47. Sensitive autoradiographic and immunohistochemical
studies fail to detect IL-13 receptors in the CNS.sup.46; 48.
Moreover, mutation of the IL-13 cytokine to selectively bind the
glioma-restricted IL-13R.alpha.2 receptor is a further safeguard
against untoward reactivity of IL-13-directed therapeutics against
IL-13R.alpha.1/IL-4.beta.+ normal tissues outside the CNS.sup.55;
57. The potential utility of targeting glioma IL-13R.alpha.2 the
design and testing of a novel engineered chimeric immunoreceptor
for re-directing the specificity of T cells that consists of an
extracellular IL-13 mutant cytokine (E13Y) tethered to the plasma
membrane by human IgG4 Fc which, in turn, is fused to CD4TM and the
cytoplasmic tail of CD3 zeta. This chimeric immunoreceptor has been
given the designation of "IL-13 zetakine." The IL-13R.alpha.2
receptor/IL-13(E13Y) receptor-ligand pair is an excellent guide for
understanding and assessing the suitability of receptor-ligand
pairs generally for use in zetakines. An ideal zetakine comprises
an extracellular soluble receptor ligand having the properties of
IL-13(E13Y) (specificity for a unique cancer cell surface receptor,
in vivo stability due to it being derived from a
naturally-occurring soluble cell signal molecule, low
immunogenicity for the same reason). The use of soluble receptor
ligands as distinct advantages over the prior art use of antibody
fragments (such as the scFvFc immunoreceptors) or cell adhesion
molecules, in that soluble receptor ligands are more likely to be
stable in the extracellular environment, non-antigenic, and more
selective.
[0038] Chimeric immunoreceptors according to the present invention
comprise an extracellular domain comprised of a soluble receptor
ligand linked to an extracellular support region that tethers the
ligand to the cell surface via a transmembrane domain, in turn
linked to an intracellular receptor signaling domain. Examples of
suitable soluble receptor ligands include autocrine and paracrine
growth factors, chemokines, cytokines, hormones, and engineered
artificial small molecule ligands that exhibit the required
specificity. Natural ligand sequences can also be engineered to
increase their specificity for a particular target cell. Selection
of a soluble receptor ligand for use in a particular zetakine is
governed by the nature of the target cell, and the qualities
discussed above with regard to the IL-13(E13Y) molecule, a
preferred ligand for use against glioma. Examples of suitable
support regions include the constant (Fc) regions of immunoglobins,
human CD8.alpha., and artificial linkers that serve to move the
targeting moiety away from the cell surface for improved access to
receptor binding on target cells. A preferred support region is the
Fc region of an IgG (such as IgG4). Examples of suitable
transmembrane domains include the transmembrane domains of the
leukocyte CD markers, preferably that of CD8. Examples of
intracellular receptor signaling domains are those of the T cell
antigen receptor complex, preferably the zeta chain of CD3 also
Fc.gamma. Rill costimulatory signaling domains, CD28, DAP10, CD2,
alone or in a series with CD3zeta.
[0039] In the IL-13 zetakine embodiment, the human IL-13 cDNA
having the E13Y amino acid substitution was synthesized by PCR
splice overlap extension. A full length IL-13 zetakine construct
was assembled by PCR splice overlap extension and consists of the
human GM-CSF receptor alpha chain leader peptide,
IL-13(E13Y)-Gly-Gly-Gly, human IgG4 Fc, human CD4TM, and human
cytoplasmic zeta chain. This cDNA construct was ligated into the
multiple cloning site of a modified pMG plasmid under the
transcriptional control of the human Elongation Factor-1alpha
promoter (Invivogen, San Diego). This expression vector
co-expresses the HyTK cDNA encoding the fusion protein HyTK that
combines in a single molecule hygromycin phosphotransferase
activity for in vitro selection of transfectants and HSV thymidine
kinase activity for in vivo ablation of cells with ganciclovir from
the CMV immediate/early promoter. Western blot of whole cell Jurkat
lysates pre-incubated with tunicamycin, an inhibitor of
glycosylation, with an anti-zeta antibody probe demonstrated that
the expected intact 56-kDa chimeric receptor protein is expressed.
This receptor is heavily glycosylated consistent with
post-translational modification of the native IL-13
cytokine.sup.108. Flow cytometric analysis of IL-13 zetakine+
Jurkat cells with anti-human IL-13 and anti-human Fc specific
antibodies confirmed the cell-surface expression of the IL-13
zetakine as a type I transmembrane protein.
[0040] Using established human T cell genetic modification methods
developed at City of Hope.sup.107, primary human T cell clones
expressing the IL-13 zetakine chimeric immunoreceptor have been
generated for pre-clinical functional characterization. IL-13
zetakine+ CD8+ CTL clones display robust proliferative activity in
ex vivo expansion cultures. Expanded clones display re-directed
cytolytic activity in 4-hr chromium release assays against human
IL-13R.alpha.2+ glioblastoma cell lines. The level of cytolytic
activity correlates with levels of zetakine expression on T cells
and IL-13R.alpha.2 receptor density on glioma target cells. In
addition to killing, IL-13 zetakine+ clones are activated for
cytokine secretion (IFN-.gamma., TNF-.alpha., GM-CSF). Activation
was specifically mediated by the interaction of the IL-13 zetakine
with the IL-13R.alpha.2 receptor on glioma cells since CTL clones
expressing an irrelevant chimeric immunoreceptor do not respond to
glioma cells, and, since activation can be inhibited in a
dose-dependent manner by the addition to culture of soluble IL-13
or blocking antibodies against IL-13 on T cell transfectants and
IL-13R.alpha.2 on glioma target cells. Lastly, IL-13
zetakine-expressing CD8+ CTL clones proliferate when stimulated by
glioma cells in culture. IL-13 zetakine+ CTL clones having potent
anti-glioma effector activity will have significant clinical
activity against malignant gliomas with limited collateral damage
to normal CNS.
[0041] An immunoreceptor according to the present invention can be
produced by any means known in the art, though preferably it is
produced using recombinant DNA techniques. A nucleic acid sequence
encoding the several regions of the chimeric receptor can prepared
and assembled into a complete coding sequence by standard
techniques of molecular cloning (genomic library screening, PCR,
primer-assisted ligation, site-directed mutagenesis, etc.). The
resulting coding region is preferably inserted into an expression
vector and used to transform a suitable expression host cell line,
preferably a T lymphocyte cell line, and most preferably an
autologous T lymphocyte cell line. A third party derived T cell
line/clone, a transformed humor or xerogenic immunologic effector
cell line, for expression of the immunoreceptor. NK cells,
macrophages, neutrophils, LAK cells, LIK cells, and stem cells that
differentiate into these cells, can also be used. In a preferred
embodiment, lymphocytes are obtained from a patient by
leukopharesis, and the autologous T cells are transduced to express
the zetakine and administered back to the patient by any clinically
acceptable means, to achieve anti-cancer therapy.
[0042] Suitable doses for a therapeutic effect would be between
about 10.sup.6 and about 10.sup.9 cells per dose, preferably in a
series of dosing cycles. A preferred dosing regimen consists of
four one-week dosing cycles of escalating doses, starting at about
10.sup.7 cells on Day 0, increasing incrementally up to a target
dose of about 10.sup.8 cells by Day 5. Suitable modes of
administration include intravenous, subcutaneous, intracavitary
(for example by reservoir-access device), intraperitoneal, and
direct injection into a tumor mass.
[0043] The following examples are solely for the purpose of
illustrating one embodiment of the invention.
Example 1
Construction of an Immunoreceptor Coding Sequence
[0044] The coding sequence for an immunoreceptor according to the
present invention was constructed by de novo synthesis of the
IL13(E13Y) coding sequence using the following primers (see FIGS.
8A-8C for a flow chart showing the construction of the
immunoreceptor coding sequence and expression vector):
TABLE-US-00001 IL13P1: (SEQ ID NO. 1) EcoRI
TATGAATTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCT
TGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGT AC IL13P2: (SEQ
ID NO. 2) GTTGATGCTCCATACCATGCTGCCATTGCAGAGCGGAGCCTTCTGGTTCT
GGGTGATGTTGACCAGCTCCTCAATGAGGTACCTGAGGGCTGTAGAGGGA G IL13P3: (SEQ
ID NO. 3) CTCTGGGTCTTCTCGATGGCACTGCAGCCTGACACGTTGATCAGGGATTC
CAGGGCTGCACAGTACATGCCAGCTGTCAGGTTGATGCTCCATACCATGC IL13P4: (SEQ ID
NO. 4) CCTCGATTTTGGTGTCTCGGACATGCAAGCTGGAAAACTGCCCAGCTGAG
ACCTTGTGCGGGCAGAATCCGCTCAGCATCCTCTGGGTCTTCTCGATGGC IL13P5: (SEQ ID
NO. 5) BamHI TCGGATCCTCAGTTGAACCGTCCCTCGCGAAAAAGTTTCTTTAAATGTAA
GAGCAGGTCCTTTACAAACTGGGCCACCTCGATTTTGGTGTCTCGG
[0045] The final sequence (417 bp) was end-digested with
EcoRI-BamHI, and ligated into the plasmid pSK (stratagene, LaJolla,
Calif.) as ligation 312#3. Ligation 312#3 was mutagenized
(stratagene kit, per manufacturer's instructions) to fix a deleted
nucleotide using the primers 5': IL13 312#3 mut5-3
(CAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATC (SEQ ID NO. 6)) and
3':IL13 312#3 mut3-5 (GATTCCAGGGCTGCACAGTACATGCCAGCTGTCAGGTTG (SEQ
ID NO. 7)), and ligation 312#3 as a template, to form ligation
348#1 (IL13zetakine/pSK).
[0046] The coding Human GM-CSFR alpha chain Signal Peptide (hsp)
coding sequence was fused to the 5' end of IL13(E13Y) by standard
PCR splice overlap extension. The hsp sequence (101 bp) was
obtained from the template ligation 301#10 (hsp/pSK) (human GCSF
receptor .alpha.-chain leader sequence from human T cell cDNA),
using the primers 5':19hsp5'
(ATCTCTAGAGCCGCCACCATGCTTCTCCTGGTGACAAGCCTTC (SEQ ID NO. 8)) (XbaI
site highlighted in bold), and 3': hsp-IL13FR
(GAGGGAGGCACAGGGCCTGGGATCAGGAGGAATG (SEQ ID NO. 9)). The IL-13
sequence (371 bp) was obtained using the primers 5': hsp-IL13FF
(CATTCCTCCTGATCCCAGGCCCTGTGCCTCCCTC (SEQ ID NO. 10)) and 3':
IL13-IgG4FR (GGGACCATATTTGGACTCGTTGAACCGTCCCTCGC (SEQ ID NO. 11)),
and ligation 312#3 as template. Fusion was achieved using the 101
bp hsp sequence and 371 bp IL13 sequence thus obtained, and the
primers 5': 19hsp5' and 3': IL13-IgG4FR, to yeild a 438 bp fusion
hsp-IL13 sequence.
[0047] A sequence encoding the IgG4 Fc region IgG4m:zeta was fused
to the 3' end of the hsp-IL13 fusion sequence using the same
methods. The IgG4m:zeta sequence (1119 bp) was obtained using the
primers 5': IL13-IgG4FF (GCGAGGGACGGTTCAACGAGTCCAAATATGGTCCC (SEQ
ID NO. 12)) and 3': ZetaN3' (ATGCGGCCGCTCAGCGAGGGGGCAGG (SEQ ID NO.
13)) (NotI site highlighted in bold), using the sequence R9.10
(IgG4mZeta/pSK) as template. The 1119 bp IgG4m:zeta sequence was
fused to the hsp-IL13 fusion sequence using the respective
sequences as templates, and the primers 5': 19hsp5' and 3':
ZetaN3', to yeild a 1522 bp hsp-IL13-IgG4m:zeta fusion sequence.
The ends were digested with XbaI-NotI, and ligated into pSK as
ligation 351#7, to create the plasmid IL13zetakine/pSK (4464
bp).
Example 2
Construction of Expression Vector
[0048] An expression vector containing the IL13 zetakine coding
sequence was created by digesting the IL13zetakine/pSK of Example 1
with XbaI-NotI, and creating blunt ends with Klenow, and ligating
the resulting fragment into the plasmid pMG Pac (Invirogen) (first
prepared by opening with SgrAI, blunting with Klenow, and
dephosphorylation with SAP), to yield the plasmid IL13zetakine/pMG.
See FIGS. 8A-8C. The hygromycin resistance region of
IL13zetakine/pMG was removed by digestion with NotI-NheI, and
replaced by the selection/suicide fusion HyTK, obtained from
plasmid CE7R/HyTK-pMG (Jensen, City of Hope) by digestion with
NotI-NheI, to create the expression vector IL13zetakine/HyTK-pMG
(6785 bp). This plasmid comprises the Human Elongation
Factor-1.alpha. promoter (hEF1p) at bases 6-549, the IL13zetakine
coding sequence at bases 692-2185, the Simian Virus 40 Late
polyadenylation signal (Late SV40pAN) at bases 2232-2500, a minimal
E. coli origin of replication (Ori ColE1) at bases 2501-3247, a
synthetic poly A and Pause site (SpAN) at bases 3248-3434, the
Immeate-early CMV enhancer/promoter (h CMV-1Aprom) at bases
3455-4077, the Hygromycin resistance-Thymidine kinase coding region
fusion (HyTK) at bases 4259-6334, and the bovine growth hormone
polyadenylation signal and a transcription pause (BGh pAn) at bases
6335-6633. The plasmid has a PacI linearization site at bases
3235-3242. The hEF1p and IL13zetakine elements derived from
IL13zetakine/pMG, and the remaining elements derived from
CE7R/HyTk-pMG (and with the exception of the HyTK element,
ultimately from the parent plasmid pMG Pac). In sum,
IL13zetakine/HyTK-pMG is a modified pMG backbone, expressing the
IL13zetakine gene from the hEF1 promoter, and the HyTK fusion from
the h CMV-1A promoter. A map of the plasmid IL13zetakine/HyTK-pMG
appears in FIG. 9. The full nucleic acid sequence of the plasmid is
shown in FIGS. 12A-12I. The sequence of an IL13zetakine insert is
given as SEQ ID NO:15, below. See also FIG. 11.
TABLE-US-00002 (SEQ ID NO: 15)
atgcttctcctggtgacaagccttctgctctgtgagttaccacacccag
cattcctcctgatcccaggccctgtgcctccctctacagccctcaggta
cctcattgaggagctggtcaacatcacccagaaccagaaggctccgctc
tgcaatggcagcatggtatggagcatcaacctgacagctggcatgtact
gtgcagccctggaatccctgatcaacgtgtcaggctgcagtgccatcga
gaagacccagaggatgctgagcggattctgcccgcacaaggtctcagct
gggcagttttccagcttgcatgtccgagacaccaaaatcgaggtggccc
agtttgtaaaggacctgctcttacatttaaagaaactttttcgcgaggg
acggttcaacgagtccaaatatggtcccccatgcccaccatgcccagca
cctgagttcctggggggaccatcagtcttcctgttccccccaaaaccca
aggacactctcatgatctcccggacccctgaggtcacgtgcgtggtggt
ggacgtgagccaggaagaccccgaggtccagttcaactggtacgtggat
ggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagttca
acagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactg
gctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccg
tcctccatcgagaaaaccatctccaaagccaaagggcagccccgagagc
cacaggtgtacaccctgcccccatcccaggaggagatgaccaagaacca
ggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgcc
gtggagtgggagagcaatgggcagccggagaacaactacaagaccacgc
ctcccgtgctggactccgacggctccttcttcctctacagcaggctaac
cgtggacaagagcaggtggcaggaggggaatgtcttctcatgctccgtg
atgcatgaggctctgcacaaccactacacacagaagagcctctccctgt
ctctgggtaaaatggccctgattgtgctggggggcgtcgccggcctcct
gcttttcattgggctaggcatcttcttcagagtgaagttcagcaggagc
gcagacgcccccgcgtaccagcagggccagaaccagctctataacgagc
tcaatctaggacgaagagaggagtacgatgttttggacaagagacgtgg
ccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaa
ggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtg
agattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcct
ttaccagggtctcagtacagccaccaaggacacctacgacgcccttcac
atgcaggccctgccccctcgc.
Example 3
Expression of the Immunoreceptor
[0049] Assessment of the integrity of the expressed construct was
first delineated by Wester blot probed with an anti-zeta antibody
of whole cell lysates derived from Jurkat T cell stable
transfectants.sup.107 cocultured in the presence or absence of
tunicamycin, an inhibitor of glycosylation. FIG. 1. Jurkat T cell
stable transfectants (Jurkat-IL13-pMG bulk line) were obtained by
electroporating Jurkat T cells with the IL13zetakine/HyTK-pMG
expression vector, followed by selection and expansion of positive
transfectants. 2.times.10.sup.6 cells from the Jurkat-IL13-pMG bulk
line were plated per well in a 24-well plate with or without 5
.mu.g/ml, 10 .mu.g/ml, or 20 .mu.g/ml Tunicamycin. The plate was
incubated at 37.degree. C. for 22 hrs. Cells were harvested from
each well, and each sample was washed with PBS and resuspended in
50 .mu.l RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1%
SDS) containing 1 tablet/10 ml Complete Protease Inhibitor Cocktail
(Boehringer Mannheim, Indianapolis, Ind.). Samples were incubated
on ice for 30 minutes then disrupted by aspiration with syringe
with 21 gauge needle then incubated on ice for an additional 30
minutes before being centrifuged at 4.degree. C. for 20 minutes at
14,000 rpm. Samples of centrifuged lysate supernatant were
harvested and boiled in an equal volume of sample buffer under
reducing conditions, then subjected to SDS-PAGE electrophoresis on
a 12% acrylamide gel. Following transfer to nitrocellulose,
membrane was allowed to dry O/N at 4.degree. C. Next morning,
membrane was blocked in a Blotto solution containing 0.04 gm/ml
non-fat dried milk in T-TBS (0.02% Tween 20 in Tris buffered saline
pH 8.0) for 1 hour. Membrane was then incubated with primary mouse
anti-human CD3.zeta. monoclonal antibody (Pharmingen, San Diego,
Calif.) at a concentration of 1 .mu.g/ml for 2 hours, washed, and
then incubated with a 1:3000 dilution (in Blotto solution) of goat
anti-mouse IgG alkaline phosphatase conjugated secondary antibody
(Bio-R.alpha.d ImmunoStar Kit, Hercules, Calif.) for 1 hour. Prior
to developing, membrane was washed 4 additional times in T-TBS, and
then incubated with 3 ml of phosphatase substrate solution (Biorad
ImmunoStar Kit, Hercules, Calif.) for 5 minutes at room
temperature. Membrane was then covered with plastic, and exposed to
x-ray film. Consistant with the known glycosylation pattern of
wild-type human IL-13, the electrophoretic mobility of expressed
IL-13(E13Y) zetakine is demonstrative of a heavily glycosylated
protein which, when expressed in the presence of tunicamycin, is
reduced to an amino acid backbone of approximately 54 kDa.
[0050] The IL-13(E13Y) zetakine traffics to the cell surface as a
homodimeric type I transmembrane protein, as evidenced by flow
cytometric analysis of transfectants with a phycoerythrin
(PE)-conjugated anti human-IL13 monoclonal antibody and a
fluorescein isothiocyanate (FITC)-conjugated mouse anti-human Fc
(gamma) fragment-specific F(ab')2 antibody. FIGS. 2A-2B. Jurkat
IL13zetakine-pMG transfectants were stained with anti-human
Fc(FITC) antibody (Jackson ImmunoResearch, West Grove, Pa.),
recombinant human IL13R.alpha.2/human IgG1 chimera (R&D
Systems, Minneapolis, Minn.) followed by FITC-conjugated anti
human-IgG1 monoclonal antibody (Sigma, St. Louis, Mo.), and an
anti-IL13 (PE) antibody (Becton Dickinson, San Jose, Calif.) for
analysis of cell surface chimeric receptor expression. Healthy
donor primary cells were also stained with FITC-conjugated
anti-CD4, anti-CD8, anti-TCR, and isotype control monoclonal
antibodies (Becton Dickinson, San Jose, Calif.) to assess cell
surface phenotype. For each stain, 10.sup.6 cells were washed and
resuspended in 100 .mu.l of PBS containing 2% FCS, 0.2 mg/ml
NaN.sub.3, and 5 .mu.l of stock antibody. Following a 30 minute
incubation at 4.degree. C., cells were washed twice and either
stained with a secondary antibody, or resuspended in PBS containing
1% paraformaldehyde and analyzed on a FACSCaliber cytometer.
Example 4
Binding of IL13(E13Y) Zetakine to IL13R.alpha.2 Receptor
[0051] IL-13(E13Y), tethered to the cell membrane by human IgG4 Fc
(i.e., IL13(E13Y) zetakine), is capable of binding to its target
IL13R.alpha.2 receptor as assessed by flow cytometric analysis
using soluble IL13R.alpha.2-Fc fusion protein. FIGS. 3A-3C. Cloned
human PBMC IL13zetakine-pMG transfectants were obtained by
electroporating PBMC with the IL13zetakine/HyTK-pMG expression
vector, followed by selection and expansion of positive
transfectants.sup.107. IL13zetakine.sup.+ CTL clonal cells were
stained with a fluorescein isothiocyanate (FITC)-conjugated mouse
anti-human Fc (gamma) fragment-specific F(ab')2 (Jackson
ImmunoResearch, West Grove, Pa.), recombinant human
IL13R.alpha.2/human IgG1 chimera (R&D Systems, Minneapolis,
Minn.) followed by FITC-conjugated anti human-IgG1 monoclonal
antibody (Sigma, St. Louis, Mo.), and a phycoerythrin
(PE)-conjugated anti human-IL13 monoclonal antibody (Becton
Dickinson, San Jose, Calif.) for analysis of cell surface chimeric
receptor expression. Healthy donor primary cells were also stained
with FITC-conjugated anti-CD4, anti-CD8, anti-TCR, and isotype
control monoclonal antibodies (Becton Dickinson, San Jose, Calif.)
to assess cell surface phenotype. For each stain, 10.sup.6 cells
were washed and resuspended in 100 .mu.l of PBS containing 2% FCS,
0.2 mg/ml NaN.sub.3, and 5 .mu.l of antibody. Following a 30 minute
incubation at 4.degree. C., cells were washed twice and either
stained with a secondary antibody, or resuspended in PBS containing
1% paraformaldehyde and analyzed on a FACSCaliber cytometer.
[0052] Next, the immunobiology of the IL-13(E13Y) zetakine as a
surrogate antigen receptor for primary human T cells was evaluated.
Primary human T cells were electroporated with the plasmid
expression vector. Positive transformants were selected with
hygromycin, cloned in limiting dilution, then expanded by recursive
stimulation cyles with OKT3, IL-2 and irradiated feeder cells.
Clones demonstrating IL 13zetakine expression by Western blot and
FACS were then subjected to functional evaluation in 4-hr chromium
release assays against a variety of IL-13.alpha.2.sup.+/CD20.sup.-
glioma cell lines (U251, SN-B19, U138), and the
IL-13.alpha..sup.-/CD20.sup.+ B cell lymphocyte line Daudi). These
tests showed that IL13zetakine conferred cytolytic activity that
was specific for glioma cells (FIG. 4A), and that this specific
cytolytic activity is present for glioma cells as a class (FIG.
4B). The cytolytic activity of MJ-IL13-pMG clones was assayed by
employing .sup.51Cr-labeled SN-B19, U251, and U138 glioma cell
lines (IL13.alpha.2+/CD20-) and Daudi (CD20+/IL13.alpha.2-) as
targets. MJ-IL13 effectors were assayed 8-12 days following
stimulation. Effectors were harvested, washed, and resuspeded in
assay media: 2.5.times.10.sup.5, 1.25.times.10.sup.5,
2.5.times.10.sup.4, and 5.times.10.sup.3 effectors were cultured in
triplicate at 37.degree. C. for 4 hours with 5.times.10.sup.3
target cells in 96-well V-bottom microtiter plates. After
incubation, 100 .mu.l aliquots of cell-free supernatant were
harvested and .sup.51Cr in the supernatants was assayed with a
.gamma.-counter. Percent specific cytolysis was calculated as
follows:
( Experimental 51 Cr release ) - ( control 51 Cr release ) (
Maximum 51 Cr release ) - ( control 51 Cr release ) .times. 100
##EQU00001##
Control wells contained target cells incubated in the presence of
target cells alone. Maximum .sup.51Cr release was determined by
measuring the .sup.51Cr released by labeled target cells in the
presence of 2% SDS. Bulk lines of stabley transfected human T cells
consisting of approximately 40% IL-13(E13Y) zetakine.sup.+
TCR.alpha./.beta..sup.+ lymphocytes displayed re-directed cytolysis
specific for 13R.alpha.2.sup.+ glioma targets in 4-hr chromium
release assays (>50% specific lysis at E:T ratios of 25:1), with
negligable acitivity against IL-13R.alpha.2.sup.- targets (<8%
specific lysis at E:T ratios of 25:1). IL-13(E13Y)
zetakine+CD8+TCR.alpha./.beta..sup.+ CTL clones selected on the
basis of high-level binding to anti-IL-13 antibody also display
redirected IL13R.alpha.2-specific glioma cell killing. FIG. 4b.
[0053] IL-13 zetakine-expressing CD8.sup.+ CTL clones are activated
and proliferate when stimulated by glioma cells in culture. FIGS.
5A-5C, 6A-6C, 7A-7B. MJ-IL13-pMG Cl. F2 responder cells expressing
the IL13 zetakine were evaluated for receptor-mediated triggering
of IFN.gamma., GM-CSF, and TNF.alpha. production in vitro.
2.times.10.sup.6 responder cells were co-cultured in 24-well tissue
culture plates with 2.times.10.sup.5 irradiated stimulator cells
(Daudi, Fibroblasts, Neuroblastoma 10HTB, and glioblastoma U251) in
2 ml total. Blocking rat anti-human-IL13 monoclonal antibody
(Pharmingen, San Diego, Calif.), recombinant human IL13 (R&D
Systems, Minneapolis, Minn.), and IL13R.alpha.2-specific goat IgG
(R&D Systems, Minneapolis, Minn.) were added to aliquots of
U251 stimulator cells (2.times.10.sup.5/ml) at concentrations of 1
ng/ml, 10 ng/ml, 100 ng/ml, and 1 .mu.g/ml, 30 minutes prior to the
addition of responder cells. Plates were incubated for 72 hours at
37.degree. C., after which time culture supernatants were
harvested, aliquoted, and stored at -70.degree. C. ELISA assays for
IFN.gamma., GM-CSF, and TNF.alpha. were carried out using the
R&D Systems (Minneapolis, Minn.) kit per manufacturer's
instructions. Samples were tested in duplicate wells undiluted or
diluted at 1:5 or 1:10. The developed ELISA plate was evaluated on
a microplate reader and cytokine concentrations determined by
extrapolation from a standard curve. Results are reported as
picograms/ml, and show strong activation for cytokine production by
glioma stimulator cells. FIGS. 5A-5C, FIGS. 6A-6C.
[0054] Lastly, IL-2 independent proliferation of IL13zetakine.sup.+
CD8.sup.+ CTL was observed upon co-cultivation with glioma
stimulators (FIG. 7A), but not with IL13 R.alpha.2 stimulators.
Proliferation was inhibited by the addition of rhIL-13 antibody
(FIG. 7B), showing that the observed proliferation was dependant on
binding of zetakine to the IL-13R.alpha.2 glioma cell-specific
receptor.
Example 5
Preparation of IL-13 Zetakine.sup.+ T Cells Suitable for
Therapeutic Use
[0055] The mononuclear cells are separated from heparinized whole
blood by centrifugation over clinical grade Ficoll (Pharmacia,
Uppsula, Sweden). PBMC are washed twice in sterile phosphate
buffered saline (Irvine Scientific) and suspended in culture media
consisting of RPMI 1640 HEPES, 10% heat inactivated FCS, and 4 mM
L-glutamine. T cells present in patient PBMC are polyclonally
activated by addition to culture of Orthoclone OKT3 (30 ng/ml).
Cell cultures are then incubated in vented T75 tissue culture
flasks in the study subject's designated incubator. Twenty-four
hours after initiation of culture rhIL-2 is added at 25 U/ml.
[0056] Three days after the initiation of culture PBMC are
harvested, centrifuged, and resuspended in hypotonic
electroporation buffer (Eppendorf) at 20.times.10.sup.6 cells/ml.
25 .mu.g of the plasmid IL13zetakine/HyTK-pMG of Example 3,
together with 400 .mu.l of cell suspension, are added to a sterile
0.2 cm electroporation cuvette. Each cuvette is subjected to a
single electrical pulse of 250V/40 .mu.s and again incubated for
ten minutes at RT. Surviving cells are harvested from cuvettes,
pooled, and resuspended in culture media containing 25 U/ml rhIL-2.
Flasks are placed in the patient's designated tissue culture
incubator. Three days following electroporation hygromycin is added
to cells at a final concentration of 0.2 mg/ml. Electroporated PBMC
are cultured for a total of 14 days with media and IL-2
supplementation every 48-hours.
[0057] The cloning of hygromycin-resistant CD8+ CTL from
electroporated OKT3-activated patient PBMC is initiated on day 14
of culture. Briefly, viable patient PBMC are added to a mixture of
100.times.10.sup.6 cyropreserved irradiated feeder PBMC and
20.times.10.sup.6 irradiated TM-LCL in a volume of 200 ml of
culture media containing 30 ng/ml OKT3 and 50 U/ml rhIL-2. This
mastermix is plated into ten 96-well cloning plates with each well
receiving 0.2 ml. Plates are wrapped in aluminum foil to decrease
evaporative loss and placed in the patient's designated tissue
culture incubator. On day 19 of culture each well receives
hygromycin for a final concentration of 0.2 mg/ml. Wells are
inspected for cellular outgrowth by visualization on an inverted
microscope at Day 30 and positive wells are marked for
restimulation.
[0058] The contents of each cloning well with cell growth are
individually transferred to T25 flasks containing 50.times.10.sup.6
irradiated PBMC, 10.times.10.sup.6 irradiated LCL, and 30 ng/mlOKT3
in 25 mls of tissue culture media. On days 1, 3, 5, 7, 9, 11, and
13 after restimulation flasks receive 50 U/ml rhIL-2 and 15mls of
fresh media. On day 5 of the stimulation cycle flasks are also
supplemented with hygromycin 0.2 mg/ml. Fourteen days after seeding
cells are harvested, counted, and restimulated in T75 flasks
containing 150.times.10.sup.6 irradiated PBMC, 30.times.10.sup.6
irradiated TM-LCL and 30 ng/ml OKT3 in 50 mls of tissue culture
media. Flasks receive additions to culture of rhIL-2 and hygromycin
as outlined above.
[0059] CTL selected for expansion for possible use in therapy are
analyzed by immunofluorescence on a FACSCalibur housed in CRB-3006
using FITC-conjugated monoclonal antibodies WT/31 (a.beta.TCR), Leu
2a (CD8), and OKT4 (CD4) to confirm the requisite phenotype of
clones (.alpha..beta.TCR+, CD4-, CD8+, and IL13+). Criteria for
selection of clones for clinical use include uniform TCR
.alpha..beta.+, CD4-, CD8+ and IL13+ as compared to isotype control
FITC/PE-conjugated antibody. A single site of plasmid vector
chromosomal integration is confirmed by Southern blot analysis. DNA
from genetically modified T cell clones will be screened with a DNA
probe specific for the plasmid vector. Probe DNA specific for the
HyTK in the plasmid vector is synthesized by random priming with
florescein-conjugated dUTP per the manufacture's instructions
(Amersham, Arlington Hts, Ill.). T cell genomic DNA is isolated per
standard technique. Ten micrograms of genomic DNA from T cell
clones is digested overnight at 37.degree. C. then
electrophoretically separated on a 0.85% agarose gel. DNA is then
transferred to nylon filters (BioRad, Hercules, Calif.) using an
alkaline capillary transfer method. Filters are hybridized
overnight with probe in 0.5 M Na.sub.2PO.sub.4, pH 7.2, 7% SDS,
containing 10 .mu.g/ml salmon sperm DNA (Sigma) at 65.degree. C.
Filters are then washed four times in 40 mM Na.sub.2PO.sub.4, pH
7.2, 1% SDS at 65.degree. C. and then visualized using a
chemiluminescence AP-conjugated anti-florescein antibody (Amersham,
Arlington Hts, Ill.). Criteria for clone selection is a single band
unique vector band.
[0060] Expression of the IL-13 zetakine is determined by Western
blot procedure in which chimeric receptor protein is detected with
an anti-zeta antibody. Whole cell lysates of transfected T cell
clones are generated by lysis of 2.times.10.sup.7 washed cells in 1
ml of RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1%
SDS) containing 1 tablet/10 ml Complete Protease Inhibitor Cocktail
(Boehringer Mannheim). After an eighty minute incubation on ice,
aliquots of centrifuged whole cell lysate supernatant are harvested
and boiled in an equal volume of loading buffer under reducing
conditions then subjected to SDS-PAGE electrophoresis on a precast
12% acrylamide gel (BioRad). Following transfer to nitrocellulose,
membranes are blocked in blotto solution containing 0.07 gm/ml
non-fat dried milk for 2 hours. Membranes are washed in T-TBS
(0.05% Tween 20 in Tris buffered saline pH 8.0) then incubated with
primary mouse anti-human CD3.zeta. monoclonal antibody 8D3
(Pharmingen, San Diego, Calif.) at a concentration of 1 .mu.g/ml
for 2 hours. Following an additional four washes in T-TBS,
membranes are incubated with a 1:500 dilution of goat anti-mouse
IgG alkaline phosphatase-conjugated secondary antibody for 1 hour.
Prior to developing, membranes are rinsed in T-TBS then developed
with 30 ml of "AKP" solution (Promega, Madison, Wis.) per the
manufacturer's instructions. Criteria for clone selection is the
presence of a chimeric zeta band.
[0061] CD8+ cytotoxic T cell clones expressing the IL-13 zetakine
chimeric immunoreceptor recognize and lyse human glioblastoma
target cells following interaction of the chimeric receptor with
the cell surface target epitope in a HLA-unrestricted fashion. The
requirements for target IL-13R.alpha.2 epitope expression and class
I MHC independent recognition will be confirmed by assaying each
a.beta.TCR+, CD8+, CD4-, IL-13 zetakine+ CTL clones against
IL-13R.alpha.2+ Daudi cell transfectants and IL-13R.alpha.2- Daudi
cells. T cell effectors are assayed 12-14 days following
stimulation with OKT3. Effectors are harvested, washed, and
resuspended in assay media; and Daudi cell transfectants expressing
IL-13R.alpha.2. 2.5.times.10.sup.5, 1.25.times.10.sup.5,
0.25.times.10.sup.5, and 0.05.times.10.sup.5 effectors are plated
in triplicate at 37.degree. C. for 4 hours with 5.times.10.sup.3
target cells in V-bottom microtiter plates (Costar, Cambridge,
Mass.). After centrifugation and incubation, 100 .mu.L aliquots of
cell-free supernatant is harvested and counted. Percent specific
cytolysis is calculated as:
( Experimental 51 Cr release ) - ( control 51 Cr release ) (
Maximum 51 Cr release ) - ( control 51 Cr release ) .times. 100
##EQU00002##
Control wells contain target cells incubated in assay media.
Maximum .sup.51Cr release is determined by measuring the .sup.51Cr
content of target cells lysed with 2% SDS. Criteria for clone
selection is >25% specific lysis of IL-13R.alpha.2+ Daudi
transfectants at an E:T ratio of 5:1 and a <10% lysis of
parental Daudi at the same E:T ratio.
Example 6
Treatment of Human Glioma Using IL-13 Zetakine-Expressing T
Cells
[0062] T cell clones genetically modified according to Example 5 to
express the IL-13R zetakine chimeric immunoreceptor and HyTK are
selected for: [0063] a. TCR.alpha./.beta..sup.+, CD4.sup.-,
CD8.sup.+, IL-13.sup.+ cell surface phenotype as determined by flow
cytometry. [0064] b. Presence of a single copy of chromosomally
integrated plasmid vector DNA as evidenced by Southern blot. [0065]
c. Expression of the IL-13 zetakine protein as detected by Western
blot. [0066] d. Specific lysis of human IL-13R.alpha.2.sup.+
targets in 4-hr chromium release assays. [0067] e. Dependence on
exogenous IL-2 for in vitro growth. [0068] f. Mycoplasma, fungal,
bacterial sterility and endotoxin levels <5 EU/ml. [0069] g. In
vitro sensitivity of clones to ganciclovir.
[0070] Peripheral blood mononuclear cells are obtained from the
patient by leukapheresis, preferably following recovery from
initial resection surgery and at a time at least three weeks from
tapering off steroids and/or their most recent systemic
chemotherapy. The target leukapheresis mononuclear cell yield is
5.times.10.sup.9 and the target number of hygromycin-resistant
cytolytic T cell clones is 25 with the expectation that at least
five clones will be identified that meet all quality control
parameters for ex-vivo expansion. Clones are cryopreserved and
patients monitored by serial radiographic and clinical
examinations. When recurrence of progression of disease is
documented, patients undergo a re-resection and/or placement of a
reservoir-access device (Omaya reservoir) for delivering T cells to
the tumor resection cavity. Following recovery from surgery and
tapering of steroids, if applicable, the patient commences with T
cell therapy.
[0071] The patient receives a target of at least four one-week
cycles of therapy. During the first cycle, cell dose escalation
proceeds from an initial dose on Day 0 of 10.sup.7 cells, followed
by 5.times.10.sup.7 cells on Day 3 to the target dose of 10.sup.8
cells on Day 5. Cycle 2 commences as early as one week from
commencement of cycle 1. Those patients demonstrating tumor
regression with residual disease on MRI may have additional courses
of therapy beginning no earlier than Week 7 consisting of
repetition of Cycles 3 and 4 followed by one week of rest/restaging
provided these treatments are well tolerated (max. toxicities
<grade 3) until such time that disease progression or a CR is
achieved based on radiographic evaluation.
[0072] Cell doses are at least a log less than doses given in
studies employing intracavitary LAK cells (individual cell doses of
up to 10.sup.9 and cumulative cell numbers as high as
2.75.times.10.sup.10 have been safety administered), ex vivo
expanded TILs (up to 10.sup.9 cells/dose reported with minimal
toxicity) and allo-reactive lymphocyte (starting cell dose 10.sup.8
with cumulative cell doses up to 51.5.times.10.sup.8) delivered to
a similar patient population.sup.75-85. The rationale for the lower
cell doses as proposed in this protocol is based on the increased
in vitro reactivity/anti-tumor potency of IL-13 zetakine+ CTL
clones compared to the modest reactivity profile of previously
utilized effector cell populations. Low-dose repetitive dosing is
favored to avoid potentially dangerous inflammatory responses that
might occur with single large cell number instillations. Each
infusion will consist of a single T cell clone. The same clone will
be administered throughout a patient's treatment course. On the
days of T cell administration, expanded clones are aseptically
processed by washing twice in 50 cc of PBS then resuspended in
pharmaceutical preservative-free normal saline in a volume that
results in the cell dose for patient delivery in 2mls. T cells are
instilled over 5-10 minutes. A 2 ml PFNS flush will be administered
over 5 minutes following T cells. Response to therapy is assessed
by brain MRI+/-gandolinium, with spectroscopy.
[0073] Expected side-effects of administration of T cells into
glioma resection cavities typically consist of self-limited nausea
and vomiting, fever, and transient worsening of existing
neurological deficits. These toxicities can be attributed to both
the local inflammation/edema in the tumor bed mediated by T cells
in combination with the action of secreted cytokines. These
side-effects typically are transient and less than grade II in
severity. Should patients experience more severe toxicities it is
expected that decadron alone or in combination with ganciclovir
will attenuate the inflammatory process and ablate the infused
cells. The inadvertent infusion of a cell product that is
contaminated with bacteria or fungus has the potential of mediating
serious or life-threatening toxicities. Extensive pre-infusion
culturing of the cell product is conducted to identify contaminated
tissue culture flasks and minimize this possibility. On the day of
re-infusion, gram stains of culture fluids, as well as, endotoxin
levels are performed.
[0074] Extensive molecular analysis for expression of
IL-13R.alpha.2 has demonstrated that this molecule is
tumor-specific in the context of the CNS.sup.44; 46; 48; 54.
Furthermore, the only human tissue with demonstrable IL-13R.alpha.2
expression appears to be the testis.sup.42. This tumor-testis
restrictive pattern of expression is reminiscent of the growing
number of tumor antigens (i.e. MAGE, BAGE, GAGE) expressed by a
variety of human cancers, most notably melanoma and renal cell
carcinoma.sup.109-111. Clinical experience with vaccine and
adoptive T cell therapy has demonstrated that this class of
antigens can be exploited for systemic tumor immunotherapy without
concurrent autoimmune attack of the testis.sup.112-114. Presumably
this selectively reflects the effect of an intact blood-testis
barrier and an immunologically privileged environment within the
testis. Despite the exquisite specificity of the mutant IL-13
targeting moiety, toxicities are theoretically possible if cells
egress into the systemic circulation in sufficient numbers and
recognize tissues expressing the IL-13R.alpha.1/IL-4.beta.
receptor. In light of this remote risk, as well as the possibility
that instilled T cells in some patients may mediate an overly
exuberant inflammatory response in the tumor bed, clones are
equipped with the HyTK gene which renders T cells susceptible to in
vivo ablation with ganciclovir.sup.115-118. Ganciclovir-suicide, in
combination with an intra-patient T cell dose escalation strategy,
helps minimize the potential risk to research participants.
[0075] Side effects associated with therapy (headache, fever,
chills, nausea, etc.) are managed using established treatments
appropriate for the condition. The patient receives ganciclovir if
any new grade 3 or any grade 4 treatment-related toxicity is
observed that, in the opinion of the treating physician, puts that
patient at significant medical danger. Parentally administered
ganciclovir is dosed at 10 mg/kg/day divided every 12 hours. A
14-day course will be prescribed but may be extended should
symptomatic resolution not be achieved in that time interval.
Treatment with ganciclovir leads to the ablation of IL-13
zetakine.sup.+ HyTK.sup.+ CD8.sup.+ CTL clones. Patients should be
hospitalized for the first 72 hours of ganciclovir therapy for
monitoring purposes. If symptoms do not respond to ganciclovir
within 48 hours additional immunosuppressive agents including but
not limited to corticosteroids and cyclosporin may be added at the
discretion of the treating physician. If toxicities are severe,
decadron and/or other immunosuppressive drugs along with
ganciclovir are used earlier at the discretion of the treating
physician.
Example 7
Additional Preferred DNA Vectors
[0076] Additional DNA vectors are shown in FIGS. 13A-13I and
14A-14C. Table I, below contains further information concerning the
sequence of FIGS. 13A-13I. See FIG. 10 for a map of this
vector.
TABLE-US-00003 TABLE I Plasmid DNA Vector Sequence Contents for SEQ
ID NO: 19. Plasmid Location Element Description (bases) hEF1p Human
Elongation Factor-1.alpha. Promoter 6-549 IL13zetakine IL13
cytokine fused to Fc: .zeta. 690-2183 Late SV40pAn Simian Virus 40
Late polyadenylation 2230-2498 signal Ori ColE1 A minimal E. coli
origin of replication 2499-3245 SpAn A synthetic poly A and Pause
site 3246-3432 hCMV-1Aprom Immediate-early CMV enhancer/promoter
3433-4075 HyTK Genetic fusion of the Hygromycin 4244-6319
Resistance and Thymidine Kinase coding regions BGh pAn Bovine
growth hormone polyadenylation 6320-6618 signal and a
transcriptional pause
REFERENCES
[0077] 1. Davis F G, McCarthy B J. Epidemiology of brain tumors.
Curr Opin Neurol. 2000; 13:635-640. [0078] 2. Davis F G, Malinski
N, Haenszel W, et al. Primary brain tumor incidence rates in four
United States regions, 1985-1989: a pilot study. Neuroepidemiology.
1996; 15:103-112. [0079] 3. Smith M A, Freidlin B, Ries L A, Simon
R. Increased incidence rates but no space-time clustering of
childhood astrocytoma in Sweden, 1973-1992: a population-based
study of pediatric brain tumors. Cancer. 2000; 88:1492-1493. [0080]
4. Ahsan H, Neugut A I, Bruce J N. Trends in incidence of primary
malignant brain tumors in USA, 1981-1990. Int J Epidemiol. 1995;
24:1078-1085. [0081] 5. Ashby L S, Obbens E A, Shapiro W R. Brain
tumors. Cancer Chemother Biol Response Modif. 1999; 18:498-549.
[0082] 6. Davis F G, Freels S, Grutsch J, Barlas S, Brem S.
Survival rates in patients with primary malignant brain tumors
stratified by patient age and tumor histological type: an analysis
based on Surveillance, Epidemiology, and End Results (SEER) data,
1973-1991. J Neurosurg. 1998; 88:1-10. [0083] 7. Duffner P K, Cohen
M E, Myers M H, Heise H W. Survival of children with brain tumors:
SEER Program, 1973-1980. Neurology. 1986; 36:597-601. [0084] 8.
Davis F G, Freels S, Grutsch J, Barlas S, Brem S. Survival rates in
patients with primary malignant brain tumors stratified by patient
age and tumor histological type: an analysis based on Surveillance,
Epidemiology, and End Results (SEER) data, 1973-1991. J Neurosurg.
1998; 88:1-10. [0085] 9. Kolles H, Niedermayer I, Feiden W. Grading
of astrocytomas and oligodendrogliomas. Pathologe. 1998;
19:259-268. [0086] 10. Huncharek M, Muscat J. Treatment of
recurrent high grade astrocytoma; results of a systematic review of
1,415 patients. Anticancer Res. 1998; 18:1303-1311. [0087] 11.
Loiseau H, Kantor G. The role of surgery in the treatment of glial
tumors. Cancer Radiother. 2000; 4 Suppl 1:48s-52s. [0088] 12. Palma
L. Trends in surgical management of astrocytomas and other brain
gliomas. Forum (Genova). 1998; 8:272-281. [0089] 13. Azizi S A,
Miyamoto C. Principles of treatment of malignant gliomas in adults:
an overview. J Neurovirol. 1998; 4:204-216. [0090] 14. Shapiro W R,
Shapiro J R. Biology and treatment of malignant glioma. Oncology
(Huntingt). 1998; 12:233-240. [0091] 15. Chamberlain M C, Kormanik
P A. Practical guidelines for the treatment of malignant gliomas.
West J Med. 1998; 168:114-120. [0092] 16. Ushio Y. Treatment of
gliomas in adults. Curr Opin Oncol. 1991; 3:467-475. [0093] 17.
Scott J N, Rewcastle N B, Brasher P M, et al. Long-term
glioblastoma multiforme survivors: a population-based study. Can J
Neurol Sci. 1998; 25:197-201. [0094] 18. Finlay J L, Wisoff J H.
The impact of extent of resection in the management of malignant
gliomas of childhood. Childs Nery Syst. 1999; 15:786-788. [0095]
19. Hess K R. Extent of resection as a prognostic variable in the
treatment of gliomas. J Neurooncol. 1999; 42:227-231. [0096] 20.
van den Bent M J. Chemotherapy in adult malignant glioma. Front
Radiat Ther Oncol. 1999; 33:174-191. [0097] 21. DeAngelis L M,
Burger P C, Green S B, Cairncross J G. Malignant glioma: who
benefits from adjuvant chemotherapy? Ann Neurol. 1998; 44:691-695.
[0098] 22. Armstrong T S, Gilbert M R. Chemotherapy of
astrocytomas: an overview. Semin Oncol Nurs. 1998; 14:18-25. [0099]
23. Prados M D, Russo C. Chemotherapy of brain tumors. Semin Surg
Oncol. 1998; 14:88-95. [0100] 24. Prados M D, Scott C, Curran W J,
Nelson D F, Leibel S, Kramer S. Procarbazine, lomustine, and
vincristine (PCV) chemotherapy for anaplastic astrocytoma: A
retrospective review of radiation therapy oncology group protocols
comparing survival with carmustine or PCV adjuvant chemotherapy. J
Clin Oncol. 1999; 17:3389-3395. [0101] 25. Fine H A, Dear K B,
Loeffler J S, Black P M, Canellos G P. Meta-analysis of radiation
therapy with and without adjuvant chemotherapy for malignant
gliomas in adults. Cancer. 1993; 71:2585-2597. [0102] 26. Mahaley M
S, Gillespie G Y. New therapeutic approaches to treatment of
malignant gliomas: chemotherapy and immunotherapy. Clin Neurosurg.
1983; 31:456-469. [0103] 27. Millot F, Delval O, Giraud C, et al.
High-dose chemotherapy with hematopoietic stem cell transplantation
in adults with bone marrow relapse of medulloblastoma: report of
two cases. Bone Marrow Transplant. 1999; 24:1347-1349. [0104] 28.
Kalifa C, Valteau D, Pizer B, Vassal G, Grill J, Hartmann O.
High-dose chemotherapy in childhood brain tumours. Childs Nery
Syst. 1999; 15:498-505. [0105] 29. Finlay J L. The role of
high-dose chemotherapy and stem cell rescue in the treatment of
malignant brain tumors. Bone Marrow Transplant. 1996; 18 Suppl
3:S1-S5. [0106] 30. Brandes A A, Vastola F, Monfardini S.
Reoperation in recurrent high-grade gliomas: literature review of
prognostic factors and outcome. Am J Clin Oncol. 1999; 22:387-390.
[0107] 31. Miyagi K, Ingram M, Techy G B, Jacques D B, Freshwater D
B, Sheldon H. Immunohistochemical detection and correlation between
MHC antigen and cell-mediated immune system in recurrent glioma by
APAAP method. Neurol Med Chir (Tokyo). 1990; 30:649-655. [0108] 32.
Bauman G S, Sneed P K, Wara W M, et al. Reirradiation of primary
CNS tumors. Int J Radiat Oncol Biol Phys. 1996; 36:433-441. [0109]
33. Fine H A. Novel biologic therapies for malignant gliomas.
Antiangiogenesis, immunotherapy, and gene therapy. Neurol Clin.
1995; 13:827-846. [0110] 34. Brandes A A, Pasetto L M. New
therapeutic agents in the treatment of recurrent high-grade
gliomas. Forum (Genova). 2000; 10:121-131. [0111] 35. Pollack I F,
Okada H, Chambers W H. Exploitation of immune mechanisms in the
treatment of central nervous system cancer. Semin Pediatr Neurol.
2000; 7:131-143. [0112] 36. Black K L, Pikul B K. Gliomas--past,
present, and future. Clin Neurosurg. 1999; 45:160-163. [0113] 37.
Riva P, Franceschi G, Arista A, et al. Local application of
radiolabeled monoclonal antibodies in the treatment of high grade
malignant gliomas: a six-year clinical experience. Cancer. 1997;
80:2733-2742. [0114] 38. Liang B C, Weil M. Locoregional approaches
to therapy with gliomas as the paradigm. Curr Opin Oncol. 1998;
10:201-206. [0115] 39. Yu J S, Wei M X, Chiocca E A, Martuza R L,
Tepper R I. Treatment of glioma by engineered interleukin
4-secreting cells. Cancer Res. 1993; 53:3125-3128. [0116] 40. Alavi
J B, Eck S L. Gene therapy for malignant gliomas. Hematol Oncol
Clin North Am. 1998; 12:617-629. [0117] 41. Debinski W. Recombinant
cytotoxins specific for cancer cells. Ann N Y Acad Sci. 1999;
886:297-299. [0118] 42. Debinski W, Gibo D M. Molecular expression
analysis of restrictive receptor for interleukin 13, a brain
tumor-associated cancer/testis antigen. Mol Med. 2000; 6:440-449.
[0119] 43. Mintz A, Debinski W. Cancer genetics/epigenetics and the
X chromosome: possible new links for malignant glioma pathogenesis
and immune-based therapies. Crit Rev Oncog. 2000; 11:77-95. [0120]
44. Joshi B H, Plautz G E, Puri R K. Interleukin-13 receptor alpha
chain: a novel tumor-associated transmembrane protein in primary
explants of human malignant gliomas. Cancer Res. 2000;
60:1168-1172. [0121] 45. Debinski W, Obiri N I, Powers S K, Pastan
I, Puri R K. Human glioma cells overexpress receptors for
interleukin 13 and are extremely sensitive to a novel chimeric
protein composed of interleukin 13 and pseudomonas exotoxin. Clin
Cancer Res. 1995; 1:1253-1258. [0122] 46. Debinski W, Gibo D M,
Hulet S W, Connor J R, Gillespie G Y. Receptor for interleukin 13
is a marker and therapeutic target for human high-grade gliomas.
Clin Cancer Res. 1999; 5:985-990. [0123] 47. Debinski W. An immune
regulatory cytokine receptor and glioblastoma multiforme: an
unexpected link. Crit Rev Oncog. 1998; 9:255-268. [0124] 48.
Debinski W, Slagle B, Gibo D M, Powers S K, Gillespie G Y.
Expression of a restrictive receptor for interleukin 13 is
associated with glial transformation. J Neurooncol. 2000;
48:103-111. [0125] 49. Debinski W, Miner R, Leland P, Obiri N I,
Puri R K. Receptor for interleukin (IL) 13 does not interact with
IL4 but receptor for IL4 interacts with IL13 on human glioma cells.
J Biol Chem. 1996; 271:22428-22433. [0126] 50. Murata T, Obiri N I,
Debinski W, Puri R K. Structure of IL-13 receptor: analysis of
subunit composition in cancer and immune cells. Biochem Biophys Res
Commun. 1997; 238:90-94. [0127] 51. Opal S M, DePalo V A.
Anti-inflammatory cytokines. Chest. 2000; 117:1162-1172. [0128] 52.
Romagnani S. T-cell subsets (Th1 versus Th2). Ann Allergy Asthma
Immunol. 2000; 85:9-18. [0129] 53. Spellberg B, Edwards J E, Jr.
Type 1/Type 2 immunity in infectious diseases. Clin Infect Dis.
2001; 32:76-102. [0130] 54. Liu H, Jacobs B S, Liu J, et al.
Interleukin-13 sensitivity and receptor phenotypes of human glial
cell lines: non-neoplastic glia and low-grade astrocytoma differ
from malignant glioma. Cancer Immunol Immunother. 2000; 49:319-324.
[0131] 55. Debinski W, Gibo D M, Obiri N I, Kealiher A, Puri R K.
Novel anti-brain tumor cytotoxins specific for cancer cells. Nat
Biotechnol. 1998; 16:449-453. [0132] 56. Debinski W, Gibo D M, Puri
R K. Novel way to increase targeting specificity to a human
glioblastoma-associated receptor for interleukin 13. Int J Cancer.
1998; 76:547-551 [0133] 57. Debinski W, Thompson J P. Retargeting
interleukin 13 for radioimmunodetection and radioimmunotherapy of
human high-grade gliomas. Clin Cancer Res. 1999; 5:3143s-3147s.
[0134] 58. Thompson J P, Debinski W. Mutants of interleukin 13 with
altered reactivity toward interleukin 13 receptors. J Biol Chem.
1999; 274:29944-29950. [0135] 59. Brooks W H, Netsky M G, Levine J
E. Immunity and tumors of the nervous system. Surg Neurol. 1975;
3:184-186. [0136] 60. Bullard D E, Gillespie G Y, Mahaley M S,
Bigner D D. Immunobiology of human gliomas. Semin Oncol. 1986;
13:94-109. [0137] 61. Coakham H B. Immunology of human brain
tumors. Eur J Cancer Clin Oncol. 1984; 20:145-149. [0138] 62.
Holladay F P, Heitz T, Wood G W. Antitumor activity against
established intracerebral gliomas exhibited by cytotoxic T
lymphocytes, but not by lymphokine-activated killer cells. J
Neurosurg. 1992; 77:757-762. [0139] 63. Holladay F P, Heitz T, Chen
Y L, Chiga M, Wood G W. Successful treatment of a malignant rat
glioma with cytotoxic T lymphocytes. Neurosurgery. 1992;
31:528-533. [0140] 64. Kruse C A, Lillehei K O, Mitchell D H,
Kleinschmidt-DeMasters B, Bellgrau D. Analysis of interleukin 2 and
various effector cell populations in adoptive immunotherapy of 9 L
rat gliosarcoma: allogeneic cytotoxic T lymphocytes prevent tumor
take. Proc Natl Acad Sci USA. 1990; 87:9577-9581. [0141] 65.
Miyatake S, Nishihara K, Kikuchi H, et al. Efficient tumor
suppression by glioma-specific murine cytotoxic T lymphocytes
transfected with interferon-gamma gene. J Natl Cancer Inst. 1990;
82:217-220. [0142] 66. Plautz G E, Touhalisky J E, Shu S. Treatment
of murine gliomas by adoptive transfer of ex vivo activated
tumor-draining lymph node cells. Cell Immunol. 1997; 178:101-107.
[0143] 67. Saris S C, Spiess P, Lieberman D M, Lin S, Walbridge S,
Oldfield E H. Treatment of murine primary brain tumors with
systemic interleukin-2 and tumor-infiltrating lymphocytes. J
Neurosurg. 1992; 76:513-519. [0144] 68. Tzeng J J, Barth R F,
Clendenon N R, Gordon W A. Adoptive immunotherapy of a rat glioma
using lymphokine-activated killer cells and interleukin 2. Cancer
Res. 1990; 50:4338-4343. [0145] 69. Yamasaki T, Kikuchi H. An
experimental approach to specific adoptive immunotherapy for
malignant brain tumors. Nippon Geka Hokan. 1989; 58:485-492. [0146]
70. Yamasaki T, Handa H, Yamashita J, Watanabe Y, Namba Y, Hanaoka
M. Specific adoptive immunotherapy with tumor-specific cytotoxic
T-lymphocyte clone for murine malignant gliomas. Cancer Res. 1984;
44:1776-1783. [0147] 71. Yamasaki T, Handa H, Yamashita J, Watanabe
Y, Namba Y, Hanaoka M. Specific adoptive immunotherapy of malignant
glioma with long-term cytotoxic T lymphocyte line expanded in
T-cell growth factor. Experimental study and future prospects.
Neurosurg Rev. 1984; 7:37-54. [0148] 72. Kikuchi K, Neuwelt E A.
Presence of immunosuppressive factors in brain-tumor cyst fluid. J
Neurosurg. 1983; 59:790-799. [0149] 73. Yamanaka R, Tanaka R,
Yoshida S, Saitoh T, Fujita K, Naganuma H. Suppression of TGF-beta1
in human gliomas by retroviral gene transfection enhances
susceptibility to LAK cells. J Neurooncol. 1999; 43:27-34. [0150]
74. Kuppner M C, Hamou M F, Bodmer S, Fontana A, de Tribolet N. The
glioblastoma-derived T-cell suppressor factor/transforming growth
factor beta 2 inhibits the generation of lymphokine-activated
killer (LAK) cells. Int J Cancer. 1988; 42:562-567. [0151] 75.
Hayes R L. The cellular immunotherapy of primary brain tumors. Rev
Neurol (Paris). 1992; 148:454-466. [0152] 76. Ingram M, Buckwalter
J G, Jacques D B, et al. Immunotherapy for recurrent malignant
glioma: an interim report on survival. Neurol Res. 1990;
12:265-273. [0153] 77. Jaeckle K A. Immunotherapy of malignant
gliomas. Semin Oncol. 1994; 21:249-259. [0154] 78. Kruse C A,
Cepeda L, Owens B, Johnson S D, Stears J, Lillehei K O. Treatment
of recurrent glioma with intracavitary alloreactive cytotoxic T
lymphocytes and interleukin-2. Cancer Immunol Immunother. 1997;
45:77-87. [0155] 79. Merchant R E, Baldwin N G, Rice C D, Bear H D.
Adoptive immunotherapy of malignant glioma using tumor-sensitized T
lymphocytes. Neurol Res. 1997; 19:145-152. [0156] 80. Nakagawa K,
Kamezaki T, Shibata Y, Tsunoda T, Meguro K, Nose T. Effect of
lymphokine-activated killer cells with or without radiation therapy
against malignant brain tumors. Neurol Med Chir (Tokyo). 1995;
35:22-27. [0157] 81. Plautz G E, Barnett G H, Miller D W, et al.
Systemic T cell adoptive immunotherapy of malignant gliomas. J
Neurosurg. 1998; 89:42-51. [0158] 82. Sankhla S K, Nadkarni J S,
Bhagwati S N. Adoptive immunotherapy using lymphokine-activated
killer (LAK) cells and interleukin-2 for recurrent malignant
primary brain tumors. J Neurooncol. 1996; 27:133-140. [0159] 83.
Sawamura Y, de Tribolet N. Immunotherapy of brain tumors. J
Neurosurg Sci. 1990; 34:265-278. [0160] 84. Thomas C, Schober R,
Lenard H G, Lumenta C B, Jacques D B, Wechsler W. Immunotherapy
with stimulated autologous lymphocytes in a case of a juvenile
anaplastic glioma. Neuropediatrics. 1992; 23:123-125. [0161] 85.
Tsurushima H, Liu S Q, Tuboi K, et al. Reduction of end-stage
malignant glioma by injection with autologous cytotoxic T
lymphocytes. Jpn J Cancer Res. 1999; 90:536-545. [0162] 86. Barba
D, Saris S C, Holder C, Rosenberg S A, Oldfield E H. Intratumoral
LAK cell and interleukin-2 therapy of human gliomas. J Neurosurg.
1989; 70:175-182. [0163] 87. Hayes R L, Koslow M, Hiesiger E M, et
al. Improved long term survival after intracavitary interleukin-2
and lymphokine-activated killer cells for adults with recurrent
malignant glioma. Cancer. 1995; 76:840-852. [0164] 88. Ingram M,
Jacques S, Freshwater D B, Techy G B, Shelden C H, Helsper J T.
Salvage immunotherapy of malignant glioma. Arch Surg. 1987;
122:1483-1486.
[0165] 89. Jacobs S K, Wilson D J, Kornblith P L, Grimm E A.
Interleukin-2 or autologous lymphokine-activated killer cell
treatment of malignant glioma: phase I trial. Cancer Res. 1986;
46:2101-2104. [0166] 90. Jeffes E W, III, Beamer Y B, Jacques S, et
al. Therapy of recurrent high-grade gliomas with surgery,
autologous mitogen-activated IL-2-stimulated (MAK) killer
lymphocytes, and rIL-2: II. Correlation of survival with MAK cell
tumor necrosis factor production in vitro. Lymphokine Cytokine Res.
1991; 10:89-94. [0167] 91. Merchant R E, McVicar D W, Merchant L H,
Young H F. Treatment of recurrent malignant glioma by repeated
intracerebral injections of human recombinant interleukin-2 alone
or in combination with systemic interferon-alpha. Results of a
phase I clinical trial. J Neurooncol. 1992; 12:75-83. [0168] 92.
Yoshida S, Takai N, Saito T, Tanaka R. Adoptive immunotherapy in
patients with malignant glioma. Gan To Kagaku Ryoho. 1987;
14:1930-1932. [0169] 93. Davico B L, De Monte L B, Spagnoli G C, et
al. Bispecific monoclonal antibody anti-CD3.times. anti-tenascin:
an immunotherapeutic agent for human glioma. Int J Cancer. 1995;
61:509-515. [0170] 94. Jung G, BrandI M, Eisner W, et al. Local
immunotherapy of glioma patients with a combination of 2 bispecific
antibody fragments and resting autologous lymphocytes: evidence for
in situ t-cell activation and therapeutic efficacy. Int J Cancer.
2001; 91:225-230. [0171] 95. Pfosser A, Brandl M, Salih H,
Grosse-Hovest L, Jung G. Role of target antigen in
bispecific-antibody-mediated killing of human glioblastoma cells: a
pre-clinical study. Int J Cancer. 1999; 80:612-616. [0172] 96.
Yoshida J, Takaoka T, Mizuno M, Momota H, Okada H. Cytolysis of
malignant glioma cells by lymphokine-activated killer cells
combined with anti-CD3/antiglioma bifunctional antibody and tumor
necrosis factor-alpha. J Surg Oncol. 1996; 62:177-182. [0173] 97.
Imaizumi T, Kuramoto T, Matsunaga K, et al. Expression of the
tumor-rejection antigen SART1 in brain tumors. Int J Cancer. 1999;
83:760-764. [0174] 98. Eshhar Z, Waks T, Gross G, Schindler D G.
Specific activation and targeting of cytotoxic lymphocytes through
chimeric single chains consisting of antibody-binding domains and
the gamma or zeta subunits of the immunoglobulin and T-cell
receptors. Proc Natl Acad Sci USA. 1993; 90:720-724. [0175] 99.
Haynes N M, Snook M B, Trapani J A, et al. Redirecting mouse CTL
against colon carcinoma: superior signaling efficacy of
single-chain variable domain chimeras containing TCR-zeta vs Fc
epsilon RI-gamma. J Immunol. 2001; 166:182-187. [0176] 100. Hombach
A, Heuser C, Sircar R, et al. An anti-CD30 chimeric receptor that
mediates CD3-zeta-independent T-cell activation against Hodgkin's
lymphoma cells in the presence of soluble CD30. Cancer Res. 1998;
58:1116-1119. [0177] 101. Hombach A, Schneider C, Sent D, et al. An
entirely humanized CD3 zeta-chain signaling receptor that directs
peripheral blood t cells to specific lysis of carcinoembryonic
antigen-positive tumor cells. Int J Cancer. 2000; 88:115-120.
[0178] 102. Hombach A, Sircar R, Heuser C, et al. Chimeric
anti-TAG72 receptors with immunoglobulin constant Fc domains and
gamma or zeta signalling chains. Int J Mol Med. 1998; 2:99-103.
[0179] 103. Moritz D, Wels W, Mattern J, Groner B. Cytotoxic T
lymphocytes with a grafted recognition specificity for
ERBB2-expressing tumor cells. Proc Natl Acad Sci USA. 1994;
91:4318-4322. [0180] 104. Weijtens M E, Willemsen R A, Valerio D,
Stam K, Bolhuis R L. Single chain Ig/gamma gene-redirected human T
lymphocytes produce cytokines, specifically lyse tumor cells, and
recycle lytic capacity. J Immunol. 1996; 157:836-843. [0181] 105.
Altenschmidt U, Klundt E, Groner B. Adoptive transfer of in
vitro-targeted, activated T lymphocytes results in total tumor
regression. J Immunol. 1997; 159:5509-5515. [0182] 106. Jensen M,
Tan G, Forman S, Wu A M, Raubitschek A. CD20 is a molecular target
for scFvFc:zeta receptor redirected T cells: implications for
cellular immunotherapy of CD20+ malignancy. Biol Blood Marrow
Transplant. 1998; 4:75-83. [0183] 107. Jensen M C, Clarke P, Tan G,
et al. Human T lymphocyte genetic modification with naked DNA. Mol
Ther. 2000; 1:49-55. [0184] 108. Minty A, Chalon P, Derocq J M, et
al. Interleukin-13 is a new human lymphokine regulating
inflammatory and immune responses. Nature. 1993; 362:248-250.
[0185] 109. Boon T, Cerottini J C, Van den E B, van der B P, Van
Pel A. Tumor antigens recognized by T lymphocytes. Annu Rev
Immunol. 1994; 12:337-365. [0186] 110. Castelli C, Rivoltini L,
Andreola G, Carrabba M, Renkvist N, Parmiani G. T-cell recognition
of melanoma-associated antigens. J Cell Physiol. 2000; 182:323-331.
[0187] 111. Chi D D, Merchant R E, Rand R, et al. Molecular
detection of tumor-associated antigens shared by human cutaneous
melanomas and gliomas. Am J Pathol. 1997; 150:2143-2152. [0188]
112. Boon T, Coulie P, Marchand M, Weynants P, Wolfel T, Brichard
V. Genes coding for tumor rejection antigens: perspectives for
specific immunotherapy. Important Adv Oncol. 1994; 53-69. [0189]
113. Cebon J, MacGregor D, Scott A, DeBoer R. Immunotherapy of
melanoma: targeting defined antigens. Australas J Dermatol. 1997;
38 Suppl 1:S66-S72. [0190] 114. Greenberg P D, Riddell S R.
Tumor-specific T-cell immunity: ready for prime time? J Natl Cancer
Inst. 1992; 84:1059-1061. [0191] 115. Cohen J L, Saron M F, Boyer
O, et al. Preservation of graft-versus-infection effects after
suicide gene therapy for prevention of graft-versus-host disease.
Hum Gene Ther. 2000; 11:2473-2481. [0192] 116. Drobyski W R, Morse
H C, III, Burns W H, Casper J T, Sandford G. Protection from lethal
murine graft-versus-host disease without compromise of
alloengraftment using transgenic donor T cells expressing a
thymidine kinase suicide gene. Blood. 2001; 97:2506-2513. [0193]
117. Link C J, Jr., Traynor A, Seregina T, Burt R K. Adoptive
immunotherapy for leukemia: donor lymphocytes transduced with the
herpes simplex thymidine kinase gene. Cancer Treat Res. 1999;
101:369-375. [0194] 118. Spencer D M. Developments in suicide genes
for preclinical and clinical applications. Curr Opin Mol Ther.
2000; 2:433-440.
Sequence CWU 1
1
251102DNAHomo sapiensmisc_feature(4)..(9)EcoRI restriction site
1tatgaattca tggcgctttt gttgaccacg gtcattgctc tcacttgcct tggcggcttt
60gcctccccag gccctgtgcc tccctctaca gccctcaggt ac 1022101DNAHomo
sapiens 2gttgatgctc cataccatgc tgccattgca gagcggagcc ttctggttct
gggtgatgtt 60gaccagctcc tcaatgaggt acctgagggc tgtagaggga g
1013100DNAHomo sapiens 3ctctgggtct tctcgatggc actgcagcct gacacgttga
tcagggattc cagggctgca 60cagtacatgc cagctgtcag gttgatgctc cataccatgc
1004100DNAHomo sapiens 4cctcgatttt ggtgtctcgg acatgcaagc tggaaaactg
cccagctgag accttgtgcg 60ggcagaatcc gctcagcatc ctctgggtct tctcgatggc
100596DNAHomo sapiensmisc_feature(3)..(8)BamHI restriction site
5tcggatcctc agttgaaccg tccctcgcga aaaagtttct ttaaatgtaa gagcaggtcc
60tttacaaact gggccacctc gattttggtg tctcgg 96639DNAHomo sapiens
6caacctgaca gctggcatgt actgtgcagc cctggaatc 39739DNAHomo sapiens
7gattccaggg ctgcacagta catgccagct gtcaggttg 39843DNAHomo
sapiensmisc_feature(4)..(9)XbaI restriction site 8atctctagag
ccgccaccat gcttctcctg gtgacaagcc ttc 43934DNAHomo sapiens
9gagggaggca cagggcctgg gatcaggagg aatg 341034DNAHomo sapiens
10cattcctcct gatcccaggc cctgtgcctc cctc 341135DNAHomo sapiens
11gggaccatat ttggactcgt tgaaccgtcc ctcgc 351235DNAHomo sapiens
12gcgagggacg gttcaacgag tccaaatatg gtccc 351326DNAHomo
sapiensmisc_feature(3)..(10)NotI restriction site 13atgcggccgc
tcagcgaggg ggcagg 26146783DNAArtificial Sequenceplasmid DNA vector
incorporating human, simian virus 40, E. coli, cytomegalovirus and
bovine sequences 14tcgaaggatc tgcgatcgct ccggtgcccg tcagtgggca
gagcgcacat cgcccacagt 60ccccgagaag ttggggggag gggtcggcaa ttgaaccggt
gcctagagaa ggtggcgcgg 120ggtaaactgg gaaagtgatg tcgtgtactg
gctccgcctt tttcccgagg gtgggggaga 180accgtatata agtgcagtag
tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag 240aacacagctg
aagcttcgag gggctcgcat ctctccttca cgcgcccgcc gccctacctg
300aggccgccat ccacgccggt tgagtcgcgt tctgccgcct cccgcctgtg
gtgcctcctg 360aactgcgtcc gccgtctagg taagtttaaa gctcaggtcg
agaccgggcc tttgtccggc 420gctcccttgg agcctaccta gactcagccg
gctctccacg ctttgcctga ccctgcttgc 480tcaactctac gtctttgttt
cgttttctgt tctgcgccgt tacagatcca agctgtgacc 540ggcgcctacg
taagtgatat ctactagatt tatcaaaaag agtgttgact tgtgagcgct
600cacaattgat acggattcat cgagagggac acgtcgacta ctaaccttct
tctctttcct 660acagctgaga tcaccctaga gccgccacca tgcttctcct
ggtgacaagc cttctgctct 720gtgagttacc acacccagca ttcctcctga
tcccaggccc tgtgcctccc tctacagccc 780tcaggtacct cattgaggag
ctggtcaaca tcacccagaa ccagaaggct ccgctctgca 840atggcagcat
ggtatggagc atcaacctga cagctggcat gtactgtgca gccctggaat
900ccctgatcaa cgtgtcaggc tgcagtgcca tcgagaagac ccagaggatg
ctgagcggat 960tctgcccgca caaggtctca gctgggcagt tttccagctt
gcatgtccga gacaccaaaa 1020tcgaggtggc ccagtttgta aaggacctgc
tcttacattt aaagaaactt tttcgcgagg 1080gacggttcaa cgagtccaaa
tatggtcccc catgcccacc atgcccagca cctgagttcc 1140tggggggacc
atcagtcttc ctgttccccc caaaacccaa ggacactctc atgatctccc
1200ggacccctga ggtcacgtgc gtggtggtgg acgtgagcca ggaagacccc
gaggtccagt 1260tcaactggta cgtggatggc gtggaggtgc ataatgccaa
gacaaagccg cgggaggagc 1320agttcaacag cacgtaccgt gtggtcagcg
tcctcaccgt cctgcaccag gactggctga 1380acggcaagga gtacaagtgc
aaggtctcca acaaaggcct cccgtcctcc atcgagaaaa 1440ccatctccaa
agccaaaggg cagccccgag agccacaggt gtacaccctg cccccatccc
1500aggaggagat gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc
ttctacccca 1560gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga
gaacaactac aagaccacgc 1620ctcccgtgct ggactccgac ggctccttct
tcctctacag caggctaacc gtggacaaga 1680gcaggtggca ggaggggaat
gtcttctcat gctccgtgat gcatgaggct ctgcacaacc 1740actacacaca
gaagagcctc tccctgtccc taggtaaaat ggccctgatt gtgctggggg
1800gcgtcgccgg cctcctgctt ttcattgggc taggcatctt cttcagagtg
aagttcagca 1860ggagcgcaga cgcccccgcg taccagcagg gccagaacca
gctctataac gagctcaatc 1920taggacgaag agaggagtac gatgttttgg
acaagagacg tggccgggac cctgagatgg 1980ggggaaagcc gagaaggaag
aaccctcagg aaggcctgta caatgaactg cagaaagata 2040agatggcgga
ggcctacagt gagattggga tgaaaggcga gcgccggagg ggcaaggggc
2100acgatggcct ttaccagggt ctcagtacag ccaccaagga cacctacgac
gcccttcaca 2160tgcaggccct gccccctcgc tgagcggccg gcgaaggagg
cctagatcta tcgattgtac 2220agctagctcg acatgataag atacattgat
gagtttggac aaaccacaac tagaatgcag 2280tgaaaaaaat gctttatttg
tgaaatttgt gatgctattg ctttatttgt gaaatttgtg 2340atgctattgc
tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt
2400gcattcattt tatgtttcag gttcaggggg aggtgtggga ggttttttaa
agcaagtaaa 2460acctctacaa atgtggtaga tccatttaaa tgttagcgaa
gaacatgtga gcaaaaggcc 2520agcaaaaggc caggaaccgt aaaaaggccg
cgttgctggc gtttttccat aggctccgcc 2580cccctgacga gcatcacaaa
aatcgacgct caagtcagag gtggcgaaac ccgacaggac 2640tataaagata
ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc
2700tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg
ctttctcaat 2760gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg ggctgtgtgc 2820acgaaccccc cgttcagccc gaccgctgcg
ccttatccgg taactatcgt cttgagtcca 2880acccggtaag acacgactta
tcgccactgg cagcagccac tggtaacagg attagcagag 2940cgaggtatgt
aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta
3000gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga
aaaagagttg 3060gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tggttttttt gtttgcaagc 3120agcagattac gcgcagaaaa aaaggatctc
aagaagatcc tttgatcttt tctacggggt 3180ctgacgctca gtggaacgaa
aactcacgtt aagggatttt ggtcatggct agttaattaa 3240gctgcaataa
acaatcatta ttttcattgg atctgtgtgt tggttttttg tgtgggcttg
3300ggggaggggg aggccagaat gactccaaga gctacaggaa ggcaggtcag
agaccccact 3360ggacaaacag tggctggact ctgcaccata acacacaatc
aacaggggag tgagctggat 3420cgagctagag tccgttacat aacttacggt
aaatggcccg cctggctgac cgcccaacga 3480cccccgccca ttgacgtcaa
taatgacgta tgttcccata gtaacgccaa tagggacttt 3540ccattgacgt
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt
3600gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc
ccgcctggca 3660ttatgcccag tacatgacct tatgggactt tcctacttgg
cagtacatct acgtattagt 3720catcgctatt accatggtga tgcggttttg
gcagtacatc aatgggcgtg gatagcggtt 3780tgactcacgg ggatttccaa
gtctccaccc cattgacgtc aatgggagtt tgttttggca 3840ccaaaatcaa
cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg
3900cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga
accgtcagat 3960cgcctggaga cgccatccac gctgttttga cctccataga
agacaccggg accgatccag 4020cctccgcggc cgggaacggt gcattggaac
gcggattccc cgtgccaaga gtgacgtaag 4080taccgcctat agagtctata
ggcccaccta gttgtgaccg gcgcctagtg ttgacaatta 4140atcatcggca
tagtatatcg gcatagtata atacgactca ctataggagg gccaccatgt
4200cgactactaa ccttcttctc tttcctacag ctgagatcac cggtaggagg
gccatcatga 4260aaaagcctga actcaccgcg acgtctgtcg cgaagtttct
gatcgaaaag ttcgacagcg 4320tctccgacct gatgcagctc tcggagggcg
aagaatctcg tgctttcagc ttcgatgtag 4380gagggcgtgg atatgtcctg
cgggtaaata gctgcgccga tggtttctac aaagatcgtt 4440atgtttatcg
gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg
4500aattcagcga gagcctgacc tattgcatct cccgccgtgc acagggtgtc
acgttgcaag 4560acctgcctga aaccgaactg cccgctgttc tgcaacccgt
cgcggagctc atggatgcga 4620tcgctgcggc cgatcttagc cagacgagcg
ggttcggccc attcggaccg caaggaatcg 4680gtcaatacac tacatggcgt
gatttcatat gcgcgattgc tgatccccat gtgtatcact 4740ggcaaactgt
gatggacgac accgtcagtg cgtccgtcgc gcaggctctc gatgagctga
4800tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat
ttcggctcca 4860acaatgtcct gacggacaat ggccgcataa cagcggtcat
tgactggagc gaggcgatgt 4920tcggggattc ccaatacgag gtcgccaaca
tcttcttctg gaggccgtgg ttggcttgta 4980tggagcagca gacgcgctac
ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc 5040tccgggcgta
tatgctccgc attggtcttg accaactcta tcagagcttg gttgacggca
5100atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc aatcgtccga
tccggagccg 5160ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc
cgtctggacc gatggctgtg 5220tagaagtcgc gtctgcgttc gaccaggctg
cgcgttctcg cggccatagc aaccgacgta 5280cggcgttgcg ccctcgccgg
cagcaagaag ccacggaagt ccgcccggag cagaaaatgc 5340ccacgctact
gcgggtttat atagacggtc cccacgggat ggggaaaacc accaccacgc
5400aactgctggt ggccctgggt tcgcgcgacg atatcgtcta cgtacccgag
ccgatgactt 5460actggcgggt gctgggggct tccgagacaa tcgcgaacat
ctacaccaca caacaccgcc 5520tcgaccaggg tgagatatcg gccggggacg
cggcggtggt aatgacaagc gcccagataa 5580caatgggcat gccttatgcc
gtgaccgacg ccgttctggc tcctcatatc gggggggagg 5640ctgggagctc
acatgccccg cccccggccc tcaccctcat cttcgaccgc catcccatcg
5700ccgccctcct gtgctacccg gccgcgcggt accttatggg cagcatgacc
ccccaggccg 5760tgctggcgtt cgtggccctc atcccgccga ccttgcccgg
caccaacatc gtgcttgggg 5820cccttccgga ggacagacac atcgaccgcc
tggccaaacg ccagcgcccc ggcgagcggc 5880tggacctggc tatgctggct
gcgattcgcc gcgtttacgg gctacttgcc aatacggtgc 5940ggtatctgca
gtgcggcggg tcgtggcggg aggactgggg acagctttcg gggacggccg
6000tgccgcccca gggtgccgag ccccagagca acgcgggccc acgaccccat
atcggggaca 6060cgttatttac cctgtttcgg gcccccgagt tgctggcccc
caacggcgac ctgtataacg 6120tgtttgcctg ggccttggac gtcttggcca
aacgcctccg ttccatgcac gtctttatcc 6180tggattacga ccaatcgccc
gccggctgcc gggacgccct gctgcaactt acctccggga 6240tggtccagac
ccacgtcacc acccccggct ccataccgac gatatgcgac ctggcgcgca
6300cgtttgcccg ggagatgggg gaggctaact gagtcgagaa ttcgctagag
ggccctattc 6360tatagtgtca cctaaatgct agagctcgct gatcagcctc
gactgtgcct tctagttgcc 6420agccatctgt tgtttgcccc tcccccgtgc
cttccttgac cctggaaggt gccactccca 6480ctgtcctttc ctaataaaat
gaggaaattg catcgcattg tctgagtagg tgtcattcta 6540ttctgggggg
tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc
6600atgcgcaggg cccaattgct cgagcggccg caataaaata tctttatttt
cattacatct 6660gtgtgttggt tttttgtgtg aatcgtaact aacatacgct
ctccatcaaa acaaaacgaa 6720acaaaacaaa ctagcaaaat aggctgtccc
cagtgcaagt gcaggtgcca gaacatttct 6780cta 6783151491DNAHomo sapiens
15atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg
60atcccaggcc ctgtgcctcc ctctacagcc ctcaggtacc tcattgagga gctggtcaac
120atcacccaga accagaaggc tccgctctgc aatggcagca tggtatggag
catcaacctg 180acagctggca tgtactgtgc agccctggaa tccctgatca
acgtgtcagg ctgcagtgcc 240atcgagaaga cccagaggat gctgagcgga
ttctgcccgc acaaggtctc agctgggcag 300ttttccagct tgcatgtccg
agacaccaaa atcgaggtgg cccagtttgt aaaggacctg 360ctcttacatt
taaagaaact ttttcgcgag ggacggttca acgagtccaa atatggtccc
420ccatgcccac catgcccagc acctgagttc ctggggggac catcagtctt
cctgttcccc 480ccaaaaccca aggacactct catgatctcc cggacccctg
aggtcacgtg cgtggtggtg 540gacgtgagcc aggaagaccc cgaggtccag
ttcaactggt acgtggatgg cgtggaggtg 600cataatgcca agacaaagcc
gcgggaggag cagttcaaca gcacgtaccg tgtggtcagc 660gtcctcaccg
tcctgcacca ggactggctg aacggcaagg agtacaagtg caaggtctcc
720aacaaaggcc tcccgtcctc catcgagaaa accatctcca aagccaaagg
gcagccccga 780gagccacagg tgtacaccct gcccccatcc caggaggaga
tgaccaagaa ccaggtcagc 840ctgacctgcc tggtcaaagg cttctacccc
agcgacatcg ccgtggagtg ggagagcaat 900gggcagccgg agaacaacta
caagaccacg cctcccgtgc tggactccga cggctccttc 960ttcctctaca
gcaggctaac cgtggacaag agcaggtggc aggaggggaa tgtcttctca
1020tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct
ctccctgtcc 1080ctaggtaaaa tggccctgat tgtgctgggg ggcgtcgccg
gcctcctgct tttcattggg 1140ctaggcatct tcttcagagt gaagttcagc
aggagcgcag acgcccccgc gtaccagcag 1200ggccagaacc agctctataa
cgagctcaat ctaggacgaa gagaggagta cgatgttttg 1260gacaagagac
gtggccggga ccctgagatg gggggaaagc cgagaaggaa gaaccctcag
1320gaaggcctgt acaatgaact gcagaaagat aagatggcgg aggcctacag
tgagattggg 1380atgaaaggcg agcgccggag gggcaagggg cacgatggcc
tttaccaggg tctcagtaca 1440gccaccaagg acacctacga cgcccttcac
atgcaggccc tgccccctcg c 1491166783DNAArtificial Sequenceplasmid DNA
vector incorporating human, simian virus 40, E. coli,
cytomegalovirus and bovine sequences 16tagagaaatg ttctggcacc
tgcacttgca ctggggacag cctattttgc tagtttgttt 60tgtttcgttt tgttttgatg
gagagcgtat gttagttacg attcacacaa aaaaccaaca 120cacagatgta
atgaaaataa agatatttta ttgcggccgc tcgagcaatt gggccctgcg
180catgcctgct attgtcttcc caatcctccc ccttgctgtc ctgccccacc
ccacccccca 240gaatagaatg acacctactc agacaatgcg atgcaatttc
ctcattttat taggaaagga 300cagtgggagt ggcaccttcc agggtcaagg
aaggcacggg ggaggggcaa acaacagatg 360gctggcaact agaaggcaca
gtcgaggctg atcagcgagc tctagcattt aggtgacact 420atagaatagg
gccctctagc gaattctcga ctcagttagc ctcccccatc tcccgggcaa
480acgtgcgcgc caggtcgcat atcgtcggta tggagccggg ggtggtgacg
tgggtctgga 540ccatcccgga ggtaagttgc agcagggcgt cccggcagcc
ggcgggcgat tggtcgtaat 600ccaggataaa gacgtgcatg gaacggaggc
gtttggccaa gacgtccaag gcccaggcaa 660acacgttata caggtcgccg
ttgggggcca gcaactcggg ggcccgaaac agggtaaata 720acgtgtcccc
gatatggggt cgtgggcccg cgttgctctg gggctcggca ccctggggcg
780gcacggccgt ccccgaaagc tgtccccagt cctcccgcca cgacccgccg
cactgcagat 840accgcaccgt attggcaagt agcccgtaaa cgcggcgaat
cgcagccagc atagccaggt 900ccagccgctc gccggggcgc tggcgtttgg
ccaggcggtc gatgtgtctg tcctccggaa 960gggccccaag cacgatgttg
gtgccgggca aggtcggcgg gatgagggcc acgaacgcca 1020gcacggcctg
gggggtcatg ctgcccataa ggtaccgcgc ggccgggtag cacaggaggg
1080cggcgatggg atggcggtcg aagatgaggg tgagggccgg gggcggggca
tgtgagctcc 1140cagcctcccc cccgatatga ggagccagaa cggcgtcggt
cacggcataa ggcatgccca 1200ttgttatctg ggcgcttgtc attaccaccg
ccgcgtcccc ggccgatatc tcaccctggt 1260cgaggcggtg ttgtgtggtg
tagatgttcg cgattgtctc ggaagccccc agcacccgcc 1320agtaagtcat
cggctcgggt acgtagacga tatcgtcgcg cgaacccagg gccaccagca
1380gttgcgtggt ggtggttttc cccatcccgt ggggaccgtc tatataaacc
cgcagtagcg 1440tgggcatttt ctgctccggg cggacttccg tggcttcttg
ctgccggcga gggcgcaacg 1500ccgtacgtcg gttgctatgg ccgcgagaac
gcgcagcctg gtcgaacgca gacgcgactt 1560ctacacagcc atcggtccag
acggccgcgc ttctgcgggc gatttgtgta cgcccgacag 1620tcccggctcc
ggatcggacg attgcgtcgc atcgaccctg cgcccaagct gcatcatcga
1680aattgccgtc aaccaagctc tgatagagtt ggtcaagacc aatgcggagc
atatacgccc 1740ggagccgcgg cgatcctgca agctccggat gcctccgctc
gaagtagcgc gtctgctgct 1800ccatacaagc caaccacggc ctccagaaga
agatgttggc gacctcgtat tgggaatccc 1860cgaacatcgc ctcgctccag
tcaatgaccg ctgttatgcg gccattgtcc gtcaggacat 1920tgttggagcc
gaaatccgcg tgcacgaggt gccggacttc ggggcagtcc tcggcccaaa
1980gcatcagctc atcgagagcc tgcgcgacgg acgcactgac ggtgtcgtcc
atcacagttt 2040gccagtgata cacatgggga tcagcaatcg cgcatatgaa
atcacgccat gtagtgtatt 2100gaccgattcc ttgcggtccg aatgggccga
acccgctcgt ctggctaaga tcggccgcag 2160cgatcgcatc catgagctcc
gcgacgggtt gcagaacagc gggcagttcg gtttcaggca 2220ggtcttgcaa
cgtgacaccc tgtgcacggc gggagatgca ataggtcagg ctctcgctga
2280attccccaat gtcaagcact tccggaatcg ggagcgcggc cgatgcaaag
tgccgataaa 2340cataacgatc tttgtagaaa ccatcggcgc agctatttac
ccgcaggaca tatccacgcc 2400ctcctacatc gaagctgaaa gcacgagatt
cttcgccctc cgagagctgc atcaggtcgg 2460agacgctgtc gaacttttcg
atcagaaact tcgcgacaga cgtcgcggtg agttcaggct 2520ttttcatgat
ggccctccta ccggtgatct cagctgtagg aaagagaaga aggttagtag
2580tcgacatggt ggccctccta tagtgagtcg tattatacta tgccgatata
ctatgccgat 2640gattaattgt caacactagg cgccggtcac aactaggtgg
gcctatagac tctataggcg 2700gtacttacgt cactcttggc acggggaatc
cgcgttccaa tgcaccgttc ccggccgcgg 2760aggctggatc ggtcccggtg
tcttctatgg aggtcaaaac agcgtggatg gcgtctccag 2820gcgatctgac
ggttcactaa acgagctctg cttatataga cctcccaccg tacacgccta
2880ccgcccattt gcgtcaatgg ggcggagttg ttacgacatt ttggaaagtc
ccgttgattt 2940tggtgccaaa acaaactccc attgacgtca atggggtgga
gacttggaaa tccccgtgag 3000tcaaaccgct atccacgccc attgatgtac
tgccaaaacc gcatcaccat ggtaatagcg 3060atgactaata cgtagatgta
ctgccaagta ggaaagtccc ataaggtcat gtactgggca 3120taatgccagg
cgggccattt accgtcattg acgtcaatag ggggcgtact tggcatatga
3180tacacttgat gtactgccaa gtgggcagtt taccgtaaat actccaccca
ttgacgtcaa 3240tggaaagtcc ctattggcgt tactatggga acatacgtca
ttattgacgt caatgggcgg 3300gggtcgttgg gcggtcagcc aggcgggcca
tttaccgtaa gttatgtaac ggactctagc 3360tcgatccagc tcactcccct
gttgattgtg tgttatggtg cagagtccag ccactgtttg 3420tccagtgggg
tctctgacct gccttcctgt agctcttgga gtcattctgg cctccccctc
3480ccccaagccc acacaaaaaa ccaacacaca gatccaatga aaataatgat
tgtttattgc 3540agcttaatta actagccatg accaaaatcc cttaacgtga
gttttcgttc cactgagcgt 3600cagaccccgt agaaaagatc aaaggatctt
cttgagatcc tttttttctg cgcgtaatct 3660gctgcttgca aacaaaaaaa
ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 3720taccaactct
ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc
3780ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg
cctacatacc 3840tcgctctgct aatcctgtta ccagtggctg ctgccagtgg
cgataagtcg tgtcttaccg 3900ggttggactc aagacgatag ttaccggata
aggcgcagcg gtcgggctga acggggggtt 3960cgtgcacaca gcccagcttg
gagcgaacga cctacaccga actgagatac ctacagcgtg 4020agcattgaga
aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg
4080gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc
tggtatcttt 4140atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg
atttttgtga tgctcgtcag 4200gggggcggag cctatggaaa aacgccagca
acgcggcctt tttacggttc ctggcctttt 4260gctggccttt tgctcacatg
ttcttcgcta acatttaaat ggatctacca catttgtaga 4320ggttttactt
gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa
4380tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat
aaagcaatag 4440catcacaaat ttcacaaata aagcaatagc atcacaaatt
tcacaaataa agcatttttt 4500tcactgcatt ctagttgtgg tttgtccaaa
ctcatcaatg tatcttatca tgtcgagcta 4560gctgtacaat cgatagatct
aggcctcctt cgccggccgc tcagcgaggg ggcagggcct 4620gcatgtgaag
ggcgtcgtag gtgtccttgg tggctgtact gagaccctgg taaaggccat
4680cgtgcccctt gcccctccgg cgctcgcctt tcatcccaat ctcactgtag
gcctccgcca 4740tcttatcttt ctgcagttca ttgtacaggc cttcctgagg
gttcttcctt ctcggctttc 4800cccccatctc agggtcccgg ccacgtctct
tgtccaaaac atcgtactcc tctcttcgtc 4860ctagattgag ctcgttatag
agctggttct ggccctgctg gtacgcgggg gcgtctgcgc 4920tcctgctgaa
cttcactctg aagaagatgc
ctagcccaat gaaaagcagg aggccggcga 4980cgccccccag cacaatcagg
gccattttac ctagggacag ggagaggctc ttctgtgtgt 5040agtggttgtg
cagagcctca tgcatcacgg agcatgagaa gacattcccc tcctgccacc
5100tgctcttgtc cacggttagc ctgctgtaga ggaagaagga gccgtcggag
tccagcacgg 5160gaggcgtggt cttgtagttg ttctccggct gcccattgct
ctcccactcc acggcgatgt 5220cgctggggta gaagcctttg accaggcagg
tcaggctgac ctggttcttg gtcatctcct 5280cctgggatgg gggcagggtg
tacacctgtg gctctcgggg ctgccctttg gctttggaga 5340tggttttctc
gatggaggac gggaggcctt tgttggagac cttgcacttg tactccttgc
5400cgttcagcca gtcctggtgc aggacggtga ggacgctgac cacacggtac
gtgctgttga 5460actgctcctc ccgcggcttt gtcttggcat tatgcacctc
cacgccatcc acgtaccagt 5520tgaactggac ctcggggtct tcctggctca
cgtccaccac cacgcacgtg acctcagggg 5580tccgggagat catgagagtg
tccttgggtt ttggggggaa caggaagact gatggtcccc 5640ccaggaactc
aggtgctggg catggtgggc atgggggacc atatttggac tcgttgaacc
5700gtccctcgcg aaaaagtttc tttaaatgta agagcaggtc ctttacaaac
tgggccacct 5760cgattttggt gtctcggaca tgcaagctgg aaaactgccc
agctgagacc ttgtgcgggc 5820agaatccgct cagcatcctc tgggtcttct
cgatggcact gcagcctgac acgttgatca 5880gggattccag ggctgcacag
tacatgccag ctgtcaggtt gatgctccat accatgctgc 5940cattgcagag
cggagccttc tggttctggg tgatgttgac cagctcctca atgaggtacc
6000tgagggctgt agagggaggc acagggcctg ggatcaggag gaatgctggg
tgtggtaact 6060cacagagcag aaggcttgtc accaggagaa gcatggtggc
ggctctaggg tgatctcagc 6120tgtaggaaag agaagaaggt tagtagtcga
cgtgtccctc tcgatgaatc cgtatcaatt 6180gtgagcgctc acaagtcaac
actctttttg ataaatctag tagatatcac ttacgtaggc 6240gccggtcaca
gcttggatct gtaacggcgc agaacagaaa acgaaacaaa gacgtagagt
6300tgagcaagca gggtcaggca aagcgtggag agccggctga gtctaggtag
gctccaaggg 6360agcgccggac aaaggcccgg tctcgacctg agctttaaac
ttacctagac ggcggacgca 6420gttcaggagg caccacaggc gggaggcggc
agaacgcgac tcaaccggcg tggatggcgg 6480cctcaggtag ggcggcgggc
gcgtgaagga gagatgcgag cccctcgaag cttcagctgt 6540gttctggcgg
caaacccgtt gcgaaaaaga acgttcacgg cgactactgc acttatatac
6600ggttctcccc caccctcggg aaaaaggcgg agccagtaca cgacatcact
ttcccagttt 6660accccgcgcc accttctcta ggcaccggtt caattgccga
cccctccccc caacttctcg 6720gggactgtgg gcgatgtgcg ctctgcccac
tgacgggcac cggagcgatc gcagatcctt 6780cga 678317497PRTHomo sapiens
17Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1
5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu
Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln
Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn
Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile
Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gln Arg Met
Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gln Phe
Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gln
Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg
Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135
140 Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
145 150 155 160 Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
Glu Val Thr 165 170 175 Cys Val Val Val Asp Val Ser Gln Glu Asp Pro
Glu Val Gln Phe Asn 180 185 190 Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys Thr Lys Pro Arg 195 200 205 Glu Glu Gln Phe Asn Ser Thr
Tyr Arg Val Val Ser Val Leu Thr Val 210 215 220 Leu His Gln Asp Trp
Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser 225 230 235 240 Asn Lys
Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys 245 250 255
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu 260
265 270 Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly
Phe 275 280 285 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
Gln Pro Glu 290 295 300 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
Ser Asp Gly Ser Phe 305 310 315 320 Phe Leu Tyr Ser Arg Leu Thr Val
Asp Lys Ser Arg Trp Gln Glu Gly 325 330 335 Asn Val Phe Ser Cys Ser
Val Met His Glu Ala Leu His Asn His Tyr 340 345 350 Thr Gln Lys Ser
Leu Ser Leu Ser Leu Gly Lys Met Ala Leu Ile Val 355 360 365 Leu Gly
Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe 370 375 380
Phe Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 385
390 395 400 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg
Glu Glu 405 410 415 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro
Glu Met Gly Gly 420 425 430 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly
Leu Tyr Asn Glu Leu Gln 435 440 445 Lys Asp Lys Met Ala Glu Ala Tyr
Ser Glu Ile Gly Met Lys Gly Glu 450 455 460 Arg Arg Arg Gly Lys Gly
His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 465 470 475 480 Ala Thr Lys
Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 485 490 495 Arg
18691PRTArtificial Sequenceselection/ suicide fusion coding region
containing herpes simplex virus and E.coli sequences 18Met Lys Lys
Pro Glu Leu Thr Ala Thr Ser Val Ala Lys Phe Leu Ile 1 5 10 15 Glu
Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu Ser Glu Gly Glu 20 25
30 Glu Ser Arg Ala Phe Ser Phe Asp Val Gly Gly Arg Gly Tyr Val Leu
35 40 45 Arg Val Asn Ser Cys Ala Asp Gly Phe Tyr Lys Asp Arg Tyr
Val Tyr 50 55 60 Arg His Phe Ala Ser Ala Ala Leu Pro Ile Pro Glu
Val Leu Asp Ile 65 70 75 80 Gly Glu Phe Ser Glu Ser Leu Thr Tyr Cys
Ile Ser Arg Arg Ala Gln 85 90 95 Gly Val Thr Leu Gln Asp Leu Pro
Glu Thr Glu Leu Pro Ala Val Leu 100 105 110 Gln Pro Val Ala Glu Leu
Met Asp Ala Ile Ala Ala Ala Asp Leu Ser 115 120 125 Gln Thr Ser Gly
Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln Tyr 130 135 140 Thr Thr
Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro His Val Tyr 145 150 155
160 His Trp Gln Thr Val Met Asp Asp Thr Val Ser Ala Ser Val Ala Gln
165 170 175 Ala Leu Asp Glu Leu Met Leu Trp Ala Glu Asp Cys Pro Glu
Val Arg 180 185 190 His Leu Val His Ala Asp Phe Gly Ser Asn Asn Val
Leu Thr Asp Asn 195 200 205 Gly Arg Ile Thr Ala Val Ile Asp Trp Ser
Glu Ala Met Phe Gly Asp 210 215 220 Ser Gln Tyr Glu Val Ala Asn Ile
Phe Phe Trp Arg Pro Trp Leu Ala 225 230 235 240 Cys Met Glu Gln Gln
Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu 245 250 255 Ala Gly Ser
Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly Leu Asp 260 265 270 Gln
Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp Asp Ala Ala Trp 275 280
285 Ala Gln Gly Arg Cys Asp Ala Ile Val Arg Ser Gly Ala Gly Thr Val
290 295 300 Gly Arg Thr Gln Ile Ala Arg Arg Ser Ala Ala Val Trp Thr
Asp Gly 305 310 315 320 Cys Val Glu Val Ala Ser Ala Phe Asp Gln Ala
Ala Arg Ser Arg Gly 325 330 335 His Ser Asn Arg Arg Thr Ala Leu Arg
Pro Arg Arg Gln Gln Glu Ala 340 345 350 Thr Glu Val Arg Pro Glu Gln
Lys Met Pro Thr Leu Leu Arg Val Tyr 355 360 365 Ile Asp Gly Pro His
Gly Met Gly Lys Thr Thr Thr Thr Gln Leu Leu 370 375 380 Val Ala Leu
Gly Ser Arg Asp Asp Ile Val Tyr Val Pro Glu Pro Met 385 390 395 400
Thr Tyr Trp Arg Val Leu Gly Ala Ser Glu Thr Ile Ala Asn Ile Tyr 405
410 415 Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile Ser Ala Gly Asp
Ala 420 425 430 Ala Val Val Met Thr Ser Ala Gln Ile Thr Met Gly Met
Pro Tyr Ala 435 440 445 Val Thr Asp Ala Val Leu Ala Pro His Ile Gly
Gly Glu Ala Gly Ser 450 455 460 Ser His Ala Pro Pro Pro Ala Leu Thr
Leu Ile Phe Asp Arg His Pro 465 470 475 480 Ile Ala Ala Leu Leu Cys
Tyr Pro Ala Ala Arg Tyr Leu Met Gly Ser 485 490 495 Met Thr Pro Gln
Ala Val Leu Ala Phe Val Ala Leu Ile Pro Pro Thr 500 505 510 Leu Pro
Gly Thr Asn Ile Val Leu Gly Ala Leu Pro Glu Asp Arg His 515 520 525
Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly Glu Arg Leu Asp Leu 530
535 540 Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly Leu Leu Ala Asn
Thr 545 550 555 560 Val Arg Tyr Leu Gln Cys Gly Gly Ser Trp Arg Glu
Asp Trp Gly Gln 565 570 575 Leu Ser Gly Thr Ala Val Pro Pro Gln Gly
Ala Glu Pro Gln Ser Asn 580 585 590 Ala Gly Pro Arg Pro His Ile Gly
Asp Thr Leu Phe Thr Leu Phe Arg 595 600 605 Ala Pro Glu Leu Leu Ala
Pro Asn Gly Asp Leu Tyr Asn Val Phe Ala 610 615 620 Trp Ala Leu Asp
Val Leu Ala Lys Arg Leu Arg Ser Met His Val Phe 625 630 635 640 Ile
Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys Arg Asp Ala Leu Leu 645 650
655 Gln Leu Thr Ser Gly Met Val Gln Thr His Val Thr Thr Pro Gly Ser
660 665 670 Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe Ala Arg Glu
Met Gly 675 680 685 Glu Ala Asn 690 196770DNAArtificial
Sequencealternate plasmid DNA vector incorporating human, simian
virus 40, E. coli, cytomegalovirus and bovine sequences
19tcgaaggatc tgcgatcgct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt
60ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg
120ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg
gtgggggaga 180accgtatata agtgcagtag tcgccgtgaa cgttcttttt
cgcaacgggt ttgccgccag 240aacacagctg aagcttcgag gggctcgcat
ctctccttca cgcgcccgcc gccctacctg 300aggccgccat ccacgccggt
tgagtcgcgt tctgccgcct cccgcctgtg gtgcctcctg 360aactgcgtcc
gccgtctagg taagtttaaa gctcaggtcg agaccgggcc tttgtccggc
420gctcccttgg agcctaccta gactcagccg gctctccacg ctttgcctga
ccctgcttgc 480tcaactctac gtctttgttt cgttttctgt tctgcgccgt
tacagatcca agctgtgacc 540ggcgcctacg taagtgatat ctactagatt
tatcaaaaag agtgttgact tgtgagcgct 600cacaattgat acggattcat
cgagagggac acgtcgacta ctaaccttct tctctttcct 660acagctgaga
tcaccctaga gccgccacca tgcttctcct ggtgacaagc cttctgctct
720gtgagttacc acacccagca ttcctcctga tcccaggccc tgtgcctccc
tctacagccc 780tcaggtacct cattgaggag ctggtcaaca tcacccagaa
ccagaaggct ccgctctgca 840atggcagcat ggtatggagc atcaacctga
cagctggcat gtactgtgca gccctggaat 900ccctgatcaa cgtgtcaggc
tgcagtgcca tcgagaagac ccagaggatg ctgagcggat 960tctgcccgca
caaggtctca gctgggcagt tttccagctt gcatgtccga gacaccaaaa
1020tcgaggtggc ccagtttgta aaggacctgc tcttacattt aaagaaactt
tttcgcgagg 1080gacggttcaa cgagtccaaa tatggtcccc catgcccacc
atgcccagca cctgagttcc 1140tggggggacc atcagtcttc ctgttccccc
caaaacccaa ggacactctc atgatctccc 1200ggacccctga ggtcacgtgc
gtggtggtgg acgtgagcca ggaagacccc gaggtccagt 1260tcaactggta
cgtggatggc gtggaggtgc ataatgccaa gacaaagccg cgggaggagc
1320agttcaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag
gactggctga 1380acggcaagga gtacaagtgc aaggtctcca acaaaggcct
cccgtcctcc atcgagaaaa 1440ccatctccaa agccaaaggg cagccccgag
agccacaggt gtacaccctg cccccatccc 1500aggaggagat gaccaagaac
caggtcagcc tgacctgcct ggtcaaaggc ttctacccca 1560gcgacatcgc
cgtggagtgg gagagcaatg ggcagccgga gaacaactac aagaccacgc
1620ctcccgtgct ggactccgac ggctccttct tcctctacag caggctaacc
gtggacaaga 1680gcaggtggca ggaggggaat gtcttctcat gctccgtgat
gcatgaggct ctgcacaacc 1740actacacaca gaagagcctc tccctgtccc
taggtaaaat ggccctgatt gtgctggggg 1800gcgtcgccgg cctcctgctt
ttcattgggc taggcatctt cttcagagtg aagttcagca 1860ggagcgcaga
cgcccccgcg taccagcagg gccagaacca gctctataac gagctcaatc
1920taggacgaag agaggagtac gatgttttgg acaagagacg tggccgggac
cctgagatgg 1980ggggaaagcc gagaaggaag aaccctcagg aaggcctgta
caatgaactg cagaaagata 2040agatggcgga ggcctacagt gagattggga
tgaaaggcga gcgccggagg ggcaaggggc 2100acgatggcct ttaccagggt
ctcagtacag ccaccaagga cacctacgac gcccttcaca 2160tgcaggccct
gccccctcgc tgagcggccg gcgaaggagg cctagatcta tcgattgtac
2220agctagctcg acatgataag atacattgat gagtttggac aaaccacaac
tagaatgcag 2280tgaaaaaaat gctttatttg tgaaatttgt gatgctattg
ctttatttgt gaaatttgtg 2340atgctattgc tttatttgta accattataa
gctgcaataa acaagttaac aacaacaatt 2400gcattcattt tatgtttcag
gttcaggggg aggtgtggga ggttttttaa agcaagtaaa 2460acctctacaa
atgtggtaga tccatttaaa tgttagcgaa gaacatgtga gcaaaaggcc
2520agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat
aggctccgcc 2580cccctgacga gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac ccgacaggac 2640tataaagata ccaggcgttt ccccctggaa
gctccctcgt gcgctctcct gttccgaccc 2700tgccgcttac cggatacctg
tccgcctttc tcccttcggg aagcgtggcg ctttctcaat 2760gctcacgctg
taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc
2820acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt
cttgagtcca 2880acccggtaag acacgactta tcgccactgg cagcagccac
tggtaacagg attagcagag 2940cgaggtatgt aggcggtgct acagagttct
tgaagtggtg gcctaactac ggctacacta 3000gaagaacagt atttggtatc
tgcgctctgc tgaagccagt taccttcgga aaaagagttg 3060gtagctcttg
atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc
3120agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt
tctacggggt 3180ctgacgctca gtggaacgaa aactcacgtt aagggatttt
ggtcatggct agttaattaa 3240gctgcaataa acaatcatta ttttcattgg
atctgtgtgt tggttttttg tgtgggcttg 3300ggggaggggg aggccagaat
gactccaaga gctacaggaa ggcaggtcag agaccccact 3360ggacaaacag
tggctggact ctgcaccata acacacaatc aacaggggag tgagctggat
3420cgagctagag tccgttacat aacttacggt aaatggcccg cctggctgac
cgcccaacga 3480cccccgccca ttgacgtcaa taatgacgta tgttcccata
gtaacgccaa tagggacttt 3540ccattgacgt caatgggtgg agtatttacg
gtaaactgcc cacttggcag tacatcaagt 3600gtatcatatg ccaagtacgc
cccctattga cgtcaatgac ggtaaatggc ccgcctggca 3660ttatgcccag
tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt
3720catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg
gatagcggtt 3780tgactcacgg ggatttccaa gtctccaccc cattgacgtc
aatgggagtt tgttttggca 3840ccaaaatcaa cgggactttc caaaatgtcg
taacaactcc gccccattga cgcaaatggg 3900cggtaggcgt gtacggtggg
aggtctatat aagcagagct cgtttagtga accgtcagat 3960cgcctggaga
cgccatccac gctgttttga cctccataga agacaccggg accgatccag
4020cctccgcggc cgggaacggt gcattggaac gcggattccc cgtgccaaga
gtgacgtaag 4080taccgcctat agagtctata ggcccaccta gttgtgaccg
gcgcctagtg ttgacaatta 4140atcatcggca tagtataata cgactcacta
taggagggcc accatgtcga ctactaacct 4200tcttctcttt cctacagctg
agatcaccgg taggagggcc atcatgaaaa agcctgaact 4260caccgcgacg
tctgtcgcga agtttctgat cgaaaagttc gacagcgtct ccgacctgat
4320gcagctctcg gagggcgaag aatctcgtgc tttcagcttc gatgtaggag
ggcgtggata 4380tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa
gatcgttatg tttatcggca 4440ctttgcatcg gccgcgctcc cgattccgga
agtgcttgac attggggaat tcagcgagag 4500cctgacctat tgcatctccc
gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac 4560cgaactgccc
gctgttctgc aacccgtcgc ggagctcatg gatgcgatcg ctgcggccga
4620tcttagccag acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc
aatacactac 4680atggcgtgat ttcatatgcg cgattgctga tccccatgtg
tatcactggc aaactgtgat 4740ggacgacacc gtcagtgcgt ccgtcgcgca
ggctctcgat gagctgatgc tttgggccga 4800ggactgcccc gaagtccggc
acctcgtgca cgcggatttc ggctccaaca atgtcctgac 4860ggacaatggc
cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca
4920atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg
agcagcagac 4980gcgctacttc gagcggaggc atccggagct tgcaggatcg
ccgcggctcc gggcgtatat 5040gctccgcatt ggtcttgacc aactctatca
gagcttggtt gacggcaatt tcgatgatgc 5100agcttgggcg cagggtcgat
gcgacgcaat cgtccgatcc ggagccggga
ctgtcgggcg 5160tacacaaatc gcccgcagaa gcgcggccgt ctggaccgat
ggctgtgtag aagtcgcgtc 5220tgcgttcgac caggctgcgc gttctcgcgg
ccatagcaac cgacgtacgg cgttgcgccc 5280tcgccggcag caagaagcca
cggaagtccg cccggagcag aaaatgccca cgctactgcg 5340ggtttatata
gacggtcccc acgggatggg gaaaaccacc accacgcaac tgctggtggc
5400cctgggttcg cgcgacgata tcgtctacgt acccgagccg atgacttact
ggcgggtgct 5460gggggcttcc gagacaatcg cgaacatcta caccacacaa
caccgcctcg accagggtga 5520gatatcggcc ggggacgcgg cggtggtaat
gacaagcgcc cagataacaa tgggcatgcc 5580ttatgccgtg accgacgccg
ttctggctcc tcatatcggg ggggaggctg ggagctcaca 5640tgccccgccc
ccggccctca ccctcatctt cgaccgccat cccatcgccg ccctcctgtg
5700ctacccggcc gcgcggtacc ttatgggcag catgaccccc caggccgtgc
tggcgttcgt 5760ggccctcatc ccgccgacct tgcccggcac caacatcgtg
cttggggccc ttccggagga 5820cagacacatc gaccgcctgg ccaaacgcca
gcgccccggc gagcggctgg acctggctat 5880gctggctgcg attcgccgcg
tttacgggct acttgccaat acggtgcggt atctgcagtg 5940cggcgggtcg
tggcgggagg actggggaca gctttcgggg acggccgtgc cgccccaggg
6000tgccgagccc cagagcaacg cgggcccacg accccatatc ggggacacgt
tatttaccct 6060gtttcgggcc cccgagttgc tggcccccaa cggcgacctg
tataacgtgt ttgcctgggc 6120cttggacgtc ttggccaaac gcctccgttc
catgcacgtc tttatcctgg attacgacca 6180atcgcccgcc ggctgccggg
acgccctgct gcaacttacc tccgggatgg tccagaccca 6240cgtcaccacc
cccggctcca taccgacgat atgcgacctg gcgcgcacgt ttgcccggga
6300gatgggggag gctaactgag tcgagaattc gctagagggc cctattctat
agtgtcacct 6360aaatgctaga gctcgctgat cagcctcgac tgtgccttct
agttgccagc catctgttgt 6420ttgcccctcc cccgtgcctt ccttgaccct
ggaaggtgcc actcccactg tcctttccta 6480ataaaatgag gaaattgcat
cgcattgtct gagtaggtgt cattctattc tggggggtgg 6540ggtggggcag
gacagcaagg gggaggattg ggaagacaat agcaggcatg cgcagggccc
6600aattgctcga gcggccgcaa taaaatatct ttattttcat tacatctgtg
tgttggtttt 6660ttgtgtgaat cgtaactaac atacgctctc catcaaaaca
aaacgaaaca aaacaaacta 6720gcaaaatagg ctgtccccag tgcaagtgca
ggtgccagaa catttctcta 6770206770DNAArtificial Sequencealternate
plasmid DNA vector incorporating human, simian virus 40, E. coli,
cytomegalovirus and bovine sequences 20tagagaaatg ttctggcacc
tgcacttgca ctggggacag cctattttgc tagtttgttt 60tgtttcgttt tgttttgatg
gagagcgtat gttagttacg attcacacaa aaaaccaaca 120cacagatgta
atgaaaataa agatatttta ttgcggccgc tcgagcaatt gggccctgcg
180catgcctgct attgtcttcc caatcctccc ccttgctgtc ctgccccacc
ccacccccca 240gaatagaatg acacctactc agacaatgcg atgcaatttc
ctcattttat taggaaagga 300cagtgggagt ggcaccttcc agggtcaagg
aaggcacggg ggaggggcaa acaacagatg 360gctggcaact agaaggcaca
gtcgaggctg atcagcgagc tctagcattt aggtgacact 420atagaatagg
gccctctagc gaattctcga ctcagttagc ctcccccatc tcccgggcaa
480acgtgcgcgc caggtcgcat atcgtcggta tggagccggg ggtggtgacg
tgggtctgga 540ccatcccgga ggtaagttgc agcagggcgt cccggcagcc
ggcgggcgat tggtcgtaat 600ccaggataaa gacgtgcatg gaacggaggc
gtttggccaa gacgtccaag gcccaggcaa 660acacgttata caggtcgccg
ttgggggcca gcaactcggg ggcccgaaac agggtaaata 720acgtgtcccc
gatatggggt cgtgggcccg cgttgctctg gggctcggca ccctggggcg
780gcacggccgt ccccgaaagc tgtccccagt cctcccgcca cgacccgccg
cactgcagat 840accgcaccgt attggcaagt agcccgtaaa cgcggcgaat
cgcagccagc atagccaggt 900ccagccgctc gccggggcgc tggcgtttgg
ccaggcggtc gatgtgtctg tcctccggaa 960gggccccaag cacgatgttg
gtgccgggca aggtcggcgg gatgagggcc acgaacgcca 1020gcacggcctg
gggggtcatg ctgcccataa ggtaccgcgc ggccgggtag cacaggaggg
1080cggcgatggg atggcggtcg aagatgaggg tgagggccgg gggcggggca
tgtgagctcc 1140cagcctcccc cccgatatga ggagccagaa cggcgtcggt
cacggcataa ggcatgccca 1200ttgttatctg ggcgcttgtc attaccaccg
ccgcgtcccc ggccgatatc tcaccctggt 1260cgaggcggtg ttgtgtggtg
tagatgttcg cgattgtctc ggaagccccc agcacccgcc 1320agtaagtcat
cggctcgggt acgtagacga tatcgtcgcg cgaacccagg gccaccagca
1380gttgcgtggt ggtggttttc cccatcccgt ggggaccgtc tatataaacc
cgcagtagcg 1440tgggcatttt ctgctccggg cggacttccg tggcttcttg
ctgccggcga gggcgcaacg 1500ccgtacgtcg gttgctatgg ccgcgagaac
gcgcagcctg gtcgaacgca gacgcgactt 1560ctacacagcc atcggtccag
acggccgcgc ttctgcgggc gatttgtgta cgcccgacag 1620tcccggctcc
ggatcggacg attgcgtcgc atcgaccctg cgcccaagct gcatcatcga
1680aattgccgtc aaccaagctc tgatagagtt ggtcaagacc aatgcggagc
atatacgccc 1740ggagccgcgg cgatcctgca agctccggat gcctccgctc
gaagtagcgc gtctgctgct 1800ccatacaagc caaccacggc ctccagaaga
agatgttggc gacctcgtat tgggaatccc 1860cgaacatcgc ctcgctccag
tcaatgaccg ctgttatgcg gccattgtcc gtcaggacat 1920tgttggagcc
gaaatccgcg tgcacgaggt gccggacttc ggggcagtcc tcggcccaaa
1980gcatcagctc atcgagagcc tgcgcgacgg acgcactgac ggtgtcgtcc
atcacagttt 2040gccagtgata cacatgggga tcagcaatcg cgcatatgaa
atcacgccat gtagtgtatt 2100gaccgattcc ttgcggtccg aatgggccga
acccgctcgt ctggctaaga tcggccgcag 2160cgatcgcatc catgagctcc
gcgacgggtt gcagaacagc gggcagttcg gtttcaggca 2220ggtcttgcaa
cgtgacaccc tgtgcacggc gggagatgca ataggtcagg ctctcgctga
2280attccccaat gtcaagcact tccggaatcg ggagcgcggc cgatgcaaag
tgccgataaa 2340cataacgatc tttgtagaaa ccatcggcgc agctatttac
ccgcaggaca tatccacgcc 2400ctcctacatc gaagctgaaa gcacgagatt
cttcgccctc cgagagctgc atcaggtcgg 2460agacgctgtc gaacttttcg
atcagaaact tcgcgacaga cgtcgcggtg agttcaggct 2520ttttcatgat
ggccctccta ccggtgatct cagctgtagg aaagagaaga aggttagtag
2580tcgacatggt ggccctccta tagtgagtcg tattatacta tgccgatgat
taattgtcaa 2640cactaggcgc cggtcacaac taggtgggcc tatagactct
ataggcggta cttacgtcac 2700tcttggcacg gggaatccgc gttccaatgc
accgttcccg gccgcggagg ctggatcggt 2760cccggtgtct tctatggagg
tcaaaacagc gtggatggcg tctccaggcg atctgacggt 2820tcactaaacg
agctctgctt atatagacct cccaccgtac acgcctaccg cccatttgcg
2880tcaatggggc ggagttgtta cgacattttg gaaagtcccg ttgattttgg
tgccaaaaca 2940aactcccatt gacgtcaatg gggtggagac ttggaaatcc
ccgtgagtca aaccgctatc 3000cacgcccatt gatgtactgc caaaaccgca
tcaccatggt aatagcgatg actaatacgt 3060agatgtactg ccaagtagga
aagtcccata aggtcatgta ctgggcataa tgccaggcgg 3120gccatttacc
gtcattgacg tcaatagggg gcgtacttgg catatgatac acttgatgta
3180ctgccaagtg ggcagtttac cgtaaatact ccacccattg acgtcaatgg
aaagtcccta 3240ttggcgttac tatgggaaca tacgtcatta ttgacgtcaa
tgggcggggg tcgttgggcg 3300gtcagccagg cgggccattt accgtaagtt
atgtaacgga ctctagctcg atccagctca 3360ctcccctgtt gattgtgtgt
tatggtgcag agtccagcca ctgtttgtcc agtggggtct 3420ctgacctgcc
ttcctgtagc tcttggagtc attctggcct ccccctcccc caagcccaca
3480caaaaaacca acacacagat ccaatgaaaa taatgattgt ttattgcagc
ttaattaact 3540agccatgacc aaaatccctt aacgtgagtt ttcgttccac
tgagcgtcag accccgtaga 3600aaagatcaaa ggatcttctt gagatccttt
ttttctgcgc gtaatctgct gcttgcaaac 3660aaaaaaacca ccgctaccag
cggtggtttg tttgccggat caagagctac caactctttt 3720tccgaaggta
actggcttca gcagagcgca gataccaaat actgttcttc tagtgtagcc
3780gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg
ctctgctaat 3840cctgttacca gtggctgctg ccagtggcga taagtcgtgt
cttaccgggt tggactcaag 3900acgatagtta ccggataagg cgcagcggtc
gggctgaacg gggggttcgt gcacacagcc 3960cagcttggag cgaacgacct
acaccgaact gagataccta cagcgtgagc attgagaaag 4020cgccacgctt
cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac
4080aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata
gtcctgtcgg 4140gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc
tcgtcagggg ggcggagcct 4200atggaaaaac gccagcaacg cggccttttt
acggttcctg gccttttgct ggccttttgc 4260tcacatgttc ttcgctaaca
tttaaatgga tctaccacat ttgtagaggt tttacttgct 4320ttaaaaaacc
tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt
4380gttaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat
cacaaatttc 4440acaaataaag caatagcatc acaaatttca caaataaagc
atttttttca ctgcattcta 4500gttgtggttt gtccaaactc atcaatgtat
cttatcatgt cgagctagct gtacaatcga 4560tagatctagg cctccttcgc
cggccgctca gcgagggggc agggcctgca tgtgaagggc 4620gtcgtaggtg
tccttggtgg ctgtactgag accctggtaa aggccatcgt gccccttgcc
4680cctccggcgc tcgcctttca tcccaatctc actgtaggcc tccgccatct
tatctttctg 4740cagttcattg tacaggcctt cctgagggtt cttccttctc
ggctttcccc ccatctcagg 4800gtcccggcca cgtctcttgt ccaaaacatc
gtactcctct cttcgtccta gattgagctc 4860gttatagagc tggttctggc
cctgctggta cgcgggggcg tctgcgctcc tgctgaactt 4920cactctgaag
aagatgccta gcccaatgaa aagcaggagg ccggcgacgc cccccagcac
4980aatcagggcc attttaccta gggacaggga gaggctcttc tgtgtgtagt
ggttgtgcag 5040agcctcatgc atcacggagc atgagaagac attcccctcc
tgccacctgc tcttgtccac 5100ggttagcctg ctgtagagga agaaggagcc
gtcggagtcc agcacgggag gcgtggtctt 5160gtagttgttc tccggctgcc
cattgctctc ccactccacg gcgatgtcgc tggggtagaa 5220gcctttgacc
aggcaggtca ggctgacctg gttcttggtc atctcctcct gggatggggg
5280cagggtgtac acctgtggct ctcggggctg ccctttggct ttggagatgg
ttttctcgat 5340ggaggacggg aggcctttgt tggagacctt gcacttgtac
tccttgccgt tcagccagtc 5400ctggtgcagg acggtgagga cgctgaccac
acggtacgtg ctgttgaact gctcctcccg 5460cggctttgtc ttggcattat
gcacctccac gccatccacg taccagttga actggacctc 5520ggggtcttcc
tggctcacgt ccaccaccac gcacgtgacc tcaggggtcc gggagatcat
5580gagagtgtcc ttgggttttg gggggaacag gaagactgat ggtcccccca
ggaactcagg 5640tgctgggcat ggtgggcatg ggggaccata tttggactcg
ttgaaccgtc cctcgcgaaa 5700aagtttcttt aaatgtaaga gcaggtcctt
tacaaactgg gccacctcga ttttggtgtc 5760tcggacatgc aagctggaaa
actgcccagc tgagaccttg tgcgggcaga atccgctcag 5820catcctctgg
gtcttctcga tggcactgca gcctgacacg ttgatcaggg attccagggc
5880tgcacagtac atgccagctg tcaggttgat gctccatacc atgctgccat
tgcagagcgg 5940agccttctgg ttctgggtga tgttgaccag ctcctcaatg
aggtacctga gggctgtaga 6000gggaggcaca gggcctggga tcaggaggaa
tgctgggtgt ggtaactcac agagcagaag 6060gcttgtcacc aggagaagca
tggtggcggc tctagggtga tctcagctgt aggaaagaga 6120agaaggttag
tagtcgacgt gtccctctcg atgaatccgt atcaattgtg agcgctcaca
6180agtcaacact ctttttgata aatctagtag atatcactta cgtaggcgcc
ggtcacagct 6240tggatctgta acggcgcaga acagaaaacg aaacaaagac
gtagagttga gcaagcaggg 6300tcaggcaaag cgtggagagc cggctgagtc
taggtaggct ccaagggagc gccggacaaa 6360ggcccggtct cgacctgagc
tttaaactta cctagacggc ggacgcagtt caggaggcac 6420cacaggcggg
aggcggcaga acgcgactca accggcgtgg atggcggcct caggtagggc
6480ggcgggcgcg tgaaggagag atgcgagccc ctcgaagctt cagctgtgtt
ctggcggcaa 6540acccgttgcg aaaaagaacg ttcacggcga ctactgcact
tatatacggt tctcccccac 6600cctcgggaaa aaggcggagc cagtacacga
catcactttc ccagtttacc ccgcgccacc 6660ttctctaggc accggttcaa
ttgccgaccc ctccccccaa cttctcgggg actgtgggcg 6720atgtgcgctc
tgcccactga cgggcaccgg agcgatcgca gatccttcga 677021691PRTHomo
sapiens 21Met Lys Lys Pro Glu Leu Thr Ala Thr Ser Val Ala Lys Phe
Leu Ile 1 5 10 15 Glu Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu
Ser Glu Gly Glu 20 25 30 Glu Ser Arg Ala Phe Ser Phe Asp Val Gly
Gly Arg Gly Tyr Val Leu 35 40 45 Arg Val Asn Ser Cys Ala Asp Gly
Phe Tyr Lys Asp Arg Tyr Val Tyr 50 55 60 Arg His Phe Ala Ser Ala
Ala Leu Pro Ile Pro Glu Val Leu Asp Ile 65 70 75 80 Gly Glu Phe Ser
Glu Ser Leu Thr Tyr Cys Ile Ser Arg Arg Ala Gln 85 90 95 Gly Val
Thr Leu Gln Asp Leu Pro Glu Thr Glu Leu Pro Ala Val Leu 100 105 110
Gln Pro Val Ala Glu Leu Met Asp Ala Ile Ala Ala Ala Asp Leu Ser 115
120 125 Gln Thr Ser Gly Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln
Tyr 130 135 140 Thr Thr Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro
His Val Tyr 145 150 155 160 His Trp Gln Thr Val Met Asp Asp Thr Val
Ser Ala Ser Val Ala Gln 165 170 175 Ala Leu Asp Glu Leu Met Leu Trp
Ala Glu Asp Cys Pro Glu Val Arg 180 185 190 His Leu Val His Ala Asp
Phe Gly Ser Asn Asn Val Leu Thr Asp Asn 195 200 205 Gly Arg Ile Thr
Ala Val Ile Asp Trp Ser Glu Ala Met Phe Gly Asp 210 215 220 Ser Gln
Tyr Glu Val Ala Asn Ile Phe Phe Trp Arg Pro Trp Leu Ala 225 230 235
240 Cys Met Glu Gln Gln Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu
245 250 255 Ala Gly Ser Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly
Leu Asp 260 265 270 Gln Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp
Asp Ala Ala Trp 275 280 285 Ala Gln Gly Arg Cys Asp Ala Ile Val Arg
Ser Gly Ala Gly Thr Val 290 295 300 Gly Arg Thr Gln Ile Ala Arg Arg
Ser Ala Ala Val Trp Thr Asp Gly 305 310 315 320 Cys Val Glu Val Ala
Ser Ala Phe Asp Gln Ala Ala Arg Ser Arg Gly 325 330 335 His Ser Asn
Arg Arg Thr Ala Leu Arg Pro Arg Arg Gln Gln Glu Ala 340 345 350 Thr
Glu Val Arg Pro Glu Gln Lys Met Pro Thr Leu Leu Arg Val Tyr 355 360
365 Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr Thr Thr Gln Leu Leu
370 375 380 Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr Val Pro Glu
Pro Met 385 390 395 400 Thr Tyr Trp Arg Val Leu Gly Ala Ser Glu Thr
Ile Ala Asn Ile Tyr 405 410 415 Thr Thr Gln His Arg Leu Asp Gln Gly
Glu Ile Ser Ala Gly Asp Ala 420 425 430 Ala Val Val Met Thr Ser Ala
Gln Ile Thr Met Gly Met Pro Tyr Ala 435 440 445 Val Thr Asp Ala Val
Leu Ala Pro His Ile Gly Gly Glu Ala Gly Ser 450 455 460 Ser His Ala
Pro Pro Pro Ala Leu Thr Leu Ile Phe Asp Arg His Pro 465 470 475 480
Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg Tyr Leu Met Gly Ser 485
490 495 Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala Leu Ile Pro Pro
Thr 500 505 510 Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu Pro Glu
Asp Arg His 515 520 525 Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly
Glu Arg Leu Asp Leu 530 535 540 Ala Met Leu Ala Ala Ile Arg Arg Val
Tyr Gly Leu Leu Ala Asn Thr 545 550 555 560 Val Arg Tyr Leu Gln Cys
Gly Gly Ser Trp Arg Glu Asp Trp Gly Gln 565 570 575 Leu Ser Gly Thr
Ala Val Pro Pro Gln Gly Ala Glu Pro Gln Ser Asn 580 585 590 Ala Gly
Pro Arg Pro His Ile Gly Asp Thr Leu Phe Thr Leu Phe Arg 595 600 605
Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu Tyr Asn Val Phe Ala 610
615 620 Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg Ser Met His Val
Phe 625 630 635 640 Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys Arg
Asp Ala Leu Leu 645 650 655 Gln Leu Thr Ser Gly Met Val Gln Thr His
Val Thr Thr Pro Gly Ser 660 665 670 Ile Pro Thr Ile Cys Asp Leu Ala
Arg Thr Phe Ala Arg Glu Met Gly 675 680 685 Glu Ala Asn 690
22497PRTArtificial SequenceIL13 cytokine fused to Fczeta 22Met Leu
Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15
Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20
25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala
Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val
Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gln Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gln Phe Val
Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly
Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys
Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro 145 150
155 160 Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr 165 170 175 Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val
Gln Phe Asn 180 185 190 Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro Arg 195 200 205 Glu Glu Gln Phe Asn Ser Thr Tyr Arg
Val Val Ser Val Leu Thr Val 210 215 220 Leu His Gln Asp Trp Leu Asn
Gly Lys Glu Tyr Lys Cys Lys Val Ser 225 230 235 240 Asn Lys Gly Leu
Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys 245 250 255 Gly Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu 260 265 270
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 275
280 285 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro Glu 290 295 300 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser Phe 305 310 315 320 Phe Leu Tyr Ser Arg Leu Thr Val Asp
Lys Ser Arg Trp Gln Glu Gly 325 330 335 Asn Val Phe Ser Cys Ser Val
Met His Glu Ala Leu His Asn His Tyr 340 345 350 Thr Gln Lys Ser Leu
Ser Leu Ser Leu Gly Lys Met Ala Leu Ile Val 355 360 365 Leu Gly Gly
Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe 370 375 380 Phe
Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 385 390
395 400 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu
Glu 405 410 415 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu
Met Gly Gly 420 425 430 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu
Tyr Asn Glu Leu Gln 435 440 445 Lys Asp Lys Met Ala Glu Ala Tyr Ser
Glu Ile Gly Met Lys Gly Glu 450 455 460 Arg Arg Arg Gly Lys Gly His
Asp Gly Leu Tyr Gln Gly Leu Ser Thr 465 470 475 480 Ala Thr Lys Asp
Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 485 490 495 Arg
236770DNAArtificial SequenceIL13-Zeta_diihyTk-pMG 23caccctagag
ccgccaccat gcttctcctg gtgacaagcc ttctgctctg tgagttacca 60cacccagcat
tcctcctgat cccaggccct gtgcctccct ctacagccct caggtacctc
120attgaggagc tggtcaacat cacccagaac cagaaggctc cgctctgcaa
tggcagcatg 180gtatggagca tcaacctgac agctggcatg tactgtgcag
ccctggaatc cctgatcaac 240gtgtcaggct gcagtgccat cgagaagacc
cagaggatgc tgagcggatt ctgcccgcac 300aaggtctcag ctgggcagtt
ttccagcttg catgtccgag acaccaaaat cgaggtggcc 360cagtttgtaa
aggacctgct cttacattta aagaaacttt ttcgcgaggg acggttcaac
420gagtccaaat atggtccccc atgcccacca tgcccagcac ctgagttcct
ggggggacca 480tcagtcttcc tgttcccccc aaaacccaag gacactctca
tgatctcccg gacccctgag 540gtcacgtgcg tggtggtgga cgtgagccag
gaagaccccg aggtccagtt caactggtac 600gtggatggcg tggaggtgca
taatgccaag acaaagccgc gggaggagca gttcaacagc 660acgtaccgtg
tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa cggcaaggag
720tacaagtgca aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac
catctccaaa 780gccaaagggc agccccgaga gccacaggtg tacaccctgc
ccccatccca ggaggagatg 840accaagaacc aggtcagcct gacctgcctg
gtcaaaggct tctaccccag cgacatcgcc 900gtggagtggg agagcaatgg
gcagccggag aacaactaca agaccacgcc tcccgtgctg 960gactccgacg
gctccttctt cctctacagc aggctaaccg tggacaagag caggtggcag
1020gaggggaatg tcttctcatg ctccgtgatg catgaggctc tgcacaacca
ctacacacag 1080aagagcctct ccctgtccct aggtaaaatg gccctgattg
tgctgggggg cgtcgccggc 1140ctcctgcttt tcattgggct aggcatcttc
ttcagagtga agttcagcag gagcgcagac 1200gcccccgcgt accagcaggg
ccagaaccag ctctataacg agctcaatct aggacgaaga 1260gaggagtacg
atgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg
1320agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa
gatggcggag 1380gcctacagtg agattgggat gaaaggcgag cgccggaggg
gcaaggggca cgatggcctt 1440taccagggtc tcagtacagc caccaaggac
acctacgacg cccttcacat gcaggccctg 1500ccccctcgct gagcggccgg
cgaaggaggc ctagatctat cgattgtaca gctagctcga 1560catgataaga
tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg
1620ctttatttgt gaaatttgtg atgctattgc tttatttgtg aaatttgtga
tgctattgct 1680ttatttgtaa ccattataag ctgcaataaa caagttaaca
acaacaattg cattcatttt 1740atgtttcagg ttcaggggga ggtgtgggag
gttttttaaa gcaagtaaaa cctctacaaa 1800tgtggtagat ccatttaaat
gttagcgaag aacatgtgag caaaaggcca gcaaaaggcc 1860aggaaccgta
aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag
1920catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
ataaagatac 1980caggcgtttc cccctggaag ctccctcgtg cgctctcctg
ttccgaccct gccgcttacc 2040ggatacctgt ccgcctttct cccttcggga
agcgtggcgc tttctcaatg ctcacgctgt 2100aggtatctca gttcggtgta
ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 2160gttcagcccg
accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga
2220cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
gaggtatgta 2280ggcggtgcta cagagttctt gaagtggtgg cctaactacg
gctacactag aagaacagta 2340tttggtatct gcgctctgct gaagccagtt
accttcggaa aaagagttgg tagctcttga 2400tccggcaaac aaaccaccgc
tggtagcggt ggtttttttg tttgcaagca gcagattacg 2460cgcagaaaaa
aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag
2520tggaacgaaa actcacgtta agggattttg gtcatggcta gttaattaag
ctgcaataaa 2580caatcattat tttcattgga tctgtgtgtt ggttttttgt
gtgggcttgg gggaggggga 2640ggccagaatg actccaagag ctacaggaag
gcaggtcaga gaccccactg gacaaacagt 2700ggctggactc tgcaccataa
cacacaatca acaggggagt gagctggatc gagctagagt 2760ccgttacata
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat
2820tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc
cattgacgtc 2880aatgggtgga gtatttacgg taaactgccc acttggcagt
acatcaagtg tatcatatgc 2940caagtacgcc ccctattgac gtcaatgacg
gtaaatggcc cgcctggcat tatgcccagt 3000acatgacctt atgggacttt
cctacttggc agtacatcta cgtattagtc atcgctatta 3060ccatggtgat
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg
3120gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac
caaaatcaac 3180gggactttcc aaaatgtcgt aacaactccg ccccattgac
gcaaatgggc ggtaggcgtg 3240tacggtggga ggtctatata agcagagctc
gtttagtgaa ccgtcagatc gcctggagac 3300gccatccacg ctgttttgac
ctccatagaa gacaccggga ccgatccagc ctccgcggcc 3360gggaacggtg
cattggaacg cggattcccc gtgccaagag tgacgtaagt accgcctata
3420gagtctatag gcccacctag ttgtgaccgg cgcctagtgt tgacaattaa
tcatcggcat 3480agtataatac gactcactat aggagggcca ccatgtcgac
tactaacctt cttctctttc 3540ctacagctga gatcaccggt aggagggcca
tcatgaaaaa gcctgaactc accgcgacgt 3600ctgtcgcgaa gtttctgatc
gaaaagttcg acagcgtctc cgacctgatg cagctctcgg 3660agggcgaaga
atctcgtgct ttcagcttcg atgtaggagg gcgtggatat gtcctgcggg
3720taaatagctg cgccgatggt ttctacaaag atcgttatgt ttatcggcac
tttgcatcgg 3780ccgcgctccc gattccggaa gtgcttgaca ttggggaatt
cagcgagagc ctgacctatt 3840gcatctcccg ccgtgcacag ggtgtcacgt
tgcaagacct gcctgaaacc gaactgcccg 3900ctgttctgca acccgtcgcg
gagctcatgg atgcgatcgc tgcggccgat cttagccaga 3960cgagcgggtt
cggcccattc ggaccgcaag gaatcggtca atacactaca tggcgtgatt
4020tcatatgcgc gattgctgat ccccatgtgt atcactggca aactgtgatg
gacgacaccg 4080tcagtgcgtc cgtcgcgcag gctctcgatg agctgatgct
ttgggccgag gactgccccg 4140aagtccggca cctcgtgcac gcggatttcg
gctccaacaa tgtcctgacg gacaatggcc 4200gcataacagc ggtcattgac
tggagcgagg cgatgttcgg ggattcccaa tacgaggtcg 4260ccaacatctt
cttctggagg ccgtggttgg cttgtatgga gcagcagacg cgctacttcg
4320agcggaggca tccggagctt gcaggatcgc cgcggctccg ggcgtatatg
ctccgcattg 4380gtcttgacca actctatcag agcttggttg acggcaattt
cgatgatgca gcttgggcgc 4440agggtcgatg cgacgcaatc gtccgatccg
gagccgggac tgtcgggcgt acacaaatcg 4500cccgcagaag cgcggccgtc
tggaccgatg gctgtgtaga agtcgcgtct gcgttcgacc 4560aggctgcgcg
ttctcgcggc catagcaacc gacgtacggc gttgcgccct cgccggcagc
4620aagaagccac ggaagtccgc ccggagcaga aaatgcccac gctactgcgg
gtttatatag 4680acggtcccca cgggatgggg aaaaccacca ccacgcaact
gctggtggcc ctgggttcgc 4740gcgacgatat cgtctacgta cccgagccga
tgacttactg gcgggtgctg ggggcttccg 4800agacaatcgc gaacatctac
accacacaac accgcctcga ccagggtgag atatcggccg 4860gggacgcggc
ggtggtaatg acaagcgccc agataacaat gggcatgcct tatgccgtga
4920ccgacgccgt tctggctcct catatcgggg gggaggctgg gagctcacat
gccccgcccc 4980cggccctcac cctcatcttc gaccgccatc ccatcgccgc
cctcctgtgc tacccggccg 5040cgcggtacct tatgggcagc atgacccccc
aggccgtgct ggcgttcgtg gccctcatcc 5100cgccgacctt gcccggcacc
aacatcgtgc ttggggccct tccggaggac agacacatcg 5160accgcctggc
caaacgccag cgccccggcg agcggctgga cctggctatg ctggctgcga
5220ttcgccgcgt ttacgggcta cttgccaata cggtgcggta tctgcagtgc
ggcgggtcgt 5280ggcgggagga ctggggacag ctttcgggga cggccgtgcc
gccccagggt gccgagcccc 5340agagcaacgc gggcccacga ccccatatcg
gggacacgtt atttaccctg tttcgggccc 5400ccgagttgct ggcccccaac
ggcgacctgt ataacgtgtt tgcctgggcc ttggacgtct 5460tggccaaacg
cctccgttcc atgcacgtct ttatcctgga ttacgaccaa tcgcccgccg
5520gctgccggga cgccctgctg caacttacct ccgggatggt ccagacccac
gtcaccaccc 5580ccggctccat accgacgata tgcgacctgg cgcgcacgtt
tgcccgggag atgggggagg 5640ctaactgagt cgagaattcg ctagagggcc
ctattctata gtgtcaccta aatgctagag 5700ctcgctgatc agcctcgact
gtgccttcta gttgccagcc atctgttgtt tgcccctccc 5760ccgtgccttc
cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg
5820aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg
gtggggcagg 5880acagcaaggg ggaggattgg gaagacaata gcaggcatgc
gcagggccca attgctcgag 5940cggccgcaat aaaatatctt tattttcatt
acatctgtgt gttggttttt tgtgtgaatc 6000gtaactaaca tacgctctcc
atcaaaacaa aacgaaacaa aacaaactag caaaataggc 6060tgtccccagt
gcaagtgcag gtgccagaac atttctctat cgaaggatct gcgatcgctc
6120cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt
tggggggagg 6180ggtcggcaat tgaaccggtg cctagagaag gtggcgcggg
gtaaactggg aaagtgatgt 6240cgtgtactgg ctccgccttt ttcccgaggg
tgggggagaa ccgtatataa gtgcagtagt 6300cgccgtgaac gttctttttc
gcaacgggtt tgccgccaga acacagctga agcttcgagg 6360ggctcgcatc
tctccttcac gcgcccgccg ccctacctga ggccgccatc cacgccggtt
6420gagtcgcgtt ctgccgcctc ccgcctgtgg tgcctcctga actgcgtccg
ccgtctaggt 6480aagtttaaag ctcaggtcga gaccgggcct ttgtccggcg
ctcccttgga gcctacctag 6540actcagccgg ctctccacgc tttgcctgac
cctgcttgct caactctacg tctttgtttc 6600gttttctgtt ctgcgccgtt
acagatccaa gctgtgaccg gcgcctacgt aagtgatatc 6660tactagattt
atcaaaaaga gtgttgactt gtgagcgctc acaattgata cggattcatc
6720gagagggaca cgtcgactac taaccttctt ctctttccta cagctgagat
6770246785DNAArtificial Sequenceplasmid DNA vector incorporating
human, simian virus 40, E. coli, cytomegalovirus and bovine
sequences 24tcgaaggatc tgcgatcgct ccggtgcccg tcagtgggca gagcgcacat
cgcccacagt 60ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa
ggtggcgcgg 120ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt
tttcccgagg gtgggggaga 180accgtatata agtgcagtag tcgccgtgaa
cgttcttttt cgcaacgggt ttgccgccag 240aacacagctg aagcttcgag
gggctcgcat ctctccttca cgcgcccgcc gccctacctg 300aggccgccat
ccacgccggt tgagtcgcgt tctgccgcct cccgcctgtg gtgcctcctg
360aactgcgtcc gccgtctagg taagtttaaa gctcaggtcg agaccgggcc
tttgtccggc 420gctcccttgg agcctaccta gactcagccg gctctccacg
ctttgcctga ccctgcttgc 480tcaactctac gtctttgttt cgttttctgt
tctgcgccgt tacagatcca agctgtgacc 540ggcgcctacg taagtgatat
ctactagatt tatcaaaaag agtgttgact tgtgagcgct 600cacaattgat
acttagattc atcgagaggg acacgtcgac tactaacctt cttctctttc
660ctacagctga gatcacccta gagccgccac catgcttctc ctggtgacaa
gccttctgct 720ctgtgagtta ccacacccag cattcctcct gatcccaggc
cctgtgcctc cctctacagc 780cctcaggtac ctcattgagg agctggtcaa
catcacccag aaccagaagg ctccgctctg 840caatggcagc atggtatgga
gcatcaacct gacagctggc atgtactgtg cagccctgga 900atccctgatc
aacgtgtcag gctgcagtgc catcgagaag acccagagga tgctgagcgg
960attctgcccg cacaaggtct cagctgggca gttttccagc ttgcatgtcc
gagacaccaa 1020aatcgaggtg gcccagtttg taaaggacct gctcttacat
ttaaagaaac tttttcgcga 1080gggacggttc aacgagtcca aatatggtcc
cccatgccca ccatgcccag cacctgagtt 1140cctgggggga ccatcagtct
tcctgttccc cccaaaaccc aaggacactc tcatgatctc 1200ccggacccct
gaggtcacgt gcgtggtggt ggacgtgagc caggaagacc ccgaggtcca
1260gttcaactgg tacgtggatg gcgtggaggt gcataatgcc aagacaaagc
cgcgggagga 1320gcagttcaac agcacgtacc gtgtggtcag cgtcctcacc
gtcctgcacc aggactggct 1380gaacggcaag gagtacaagt gcaaggtctc
caacaaaggc ctcccgtcct ccatcgagaa 1440aaccatctcc aaagccaaag
ggcagccccg agagccacag gtgtacaccc tgcccccatc 1500ccaggaggag
atgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctaccc
1560cagcgacatc gccgtggagt gggagagcaa tgggcagccg gagaacaact
acaagaccac 1620gcctcccgtg ctggactccg acggctcctt cttcctctac
agcaggctaa ccgtggacaa 1680gagcaggtgg caggagggga atgtcttctc
atgctccgtg atgcatgagg ctctgcacaa 1740ccactacaca cagaagagcc
tctccctgtc cctaggtaaa atggccctga ttgtgctggg 1800gggcgtcgcc
ggcctcctgc ttttcattgg gctaggcatc ttcttcagag tgaagttcag
1860caggagcgca gacgcccccg cgtaccagca gggccagaac cagctctata
acgagctcaa 1920tctaggacga agagaggagt acgatgtttt ggacaagaga
cgtggccggg accctgagat 1980ggggggaaag ccgagaagga agaaccctca
ggaaggcctg tacaatgaac tgcagaaaga 2040taagatggcg gaggcctaca
gtgagattgg gatgaaaggc gagcgccgga ggggcaaggg 2100gcacgatggc
ctttaccagg gtctcagtac agccaccaag gacacctacg acgcccttca
2160catgcaggcc ctgccccctc gctgagcggc cggcgaagga ggcctagatc
tatcgattgt 2220acagctagct cgacatgata agatacattg atgagtttgg
acaaaccaca actagaatgc 2280agtgaaaaaa atgctttatt tgtgaaattt
gtgatgctat tgctttattt gtgaaatttg 2340tgatgctatt gctttatttg
taaccattat aagctgcaat aaacaagtta acaacaacaa 2400ttgcattcat
tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta
2460aaacctctac aaatgtggta gatccattta aatgttagcg aagaacatgt
gagcaaaagg 2520ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg
gcgtttttcc ataggctccg 2580cccccctgac gagcatcaca aaaatcgacg
ctcaagtcag aggtggcgaa acccgacagg 2640actataaaga taccaggcgt
ttccccctgg aagctccctc gtgcgctctc ctgttccgac 2700cctgccgctt
accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca
2760atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc
tgggctgtgt 2820gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc
ggtaactatc gtcttgagtc 2880caacccggta agacacgact tatcgccact
ggcagcagcc actggtaaca ggattagcag 2940agcgaggtat gtaggcggtg
ctacagagtt cttgaagtgg tggcctaact acggctacac 3000tagaagaaca
gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt
3060tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt
ttgtttgcaa 3120gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
cctttgatct tttctacggg 3180gtctgacgct cagtggaacg aaaactcacg
ttaagggatt ttggtcatgg ctagttaatt 3240aagctgcaat aaacaatcat
tattttcatt ggatctgtgt gttggttttt tgtgtgggct 3300tgggggaggg
ggaggccaga atgactccaa gagctacagg aaggcaggtc agagacccca
3360ctggacaaac agtggctgga ctctgcacca taacacacaa tcaacagggg
agtgagctgg 3420atcgagctag agtccgttac ataacttacg gtaaatggcc
cgcctggctg accgcccaac 3480gacccccgcc cattgacgtc aataatgacg
tatgttccca tagtaacgcc aatagggact 3540ttccattgac gtcaatgggt
ggagtattta cggtaaactg cccacttggc agtacatcaa 3600gtgtatcata
tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg
3660cattatgccc agtacatgac cttatgggac tttcctactt ggcagtacat
ctacgtatta 3720gtcatcgcta ttaccatggt gatgcggttt tggcagtaca
tcaatgggcg tggatagcgg 3780tttgactcac ggggatttcc aagtctccac
cccattgacg tcaatgggag tttgttttgg 3840caccaaaatc aacgggactt
tccaaaatgt cgtaacaact ccgccccatt gacgcaaatg 3900ggcggtaggc
gtgtacggtg ggaggtctat ataagcagag ctcgtttagt gaaccgtcag
3960atcgcctgga gacgccatcc acgctgtttt gacctccata gaagacaccg
ggaccgatcc 4020agcctccgcg gccgggaacg gtgcattgga acgcggattc
cccgtgccaa gagtgacgta 4080agtaccgcct atagagtcta taggcccacc
tagttgtgac cggcgcctag tgttgacaat 4140taatcatcgg catagtatat
cggcatagta taatacgact cactatagga gggccaccat 4200gtcgactact
aaccttcttc tctttcctac agctgagatc accggtagga gggccatcat
4260gaaaaagcct gaactcaccg cgacgtctgt cgcgaagttt ctgatcgaaa
agttcgacag 4320cgtctccgac ctgatgcagc tctcggaggg cgaagaatct
cgtgctttca gcttcgatgt 4380aggagggcgt ggatatgtcc tgcgggtaaa
tagctgcgcc gatggtttct acaaagatcg 4440ttatgtttat cggcactttg
catcggccgc gctcccgatt ccggaagtgc ttgacattgg 4500ggaattcagc
gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca
4560agacctgcct gaaaccgaac tgcccgctgt tctgcaaccc gtcgcggagc
tcatggatgc 4620gatcgctgcg gccgatctta gccagacgag cgggttcggc
ccattcggac cgcaaggaat 4680cggtcaatac actacatggc gtgatttcat
atgcgcgatt gctgatcccc atgtgtatca 4740ctggcaaact gtgatggacg
acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct 4800gatgctttgg
gccgaggact gccccgaagt ccggcacctc gtgcacgcgg atttcggctc
4860caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga
gcgaggcgat 4920gttcggggat tcccaatacg aggtcgccaa catcttcttc
tggaggccgt ggttggcttg 4980tatggagcag cagacgcgct acttcgagcg
gaggcatccg gagcttgcag gatcgccgcg 5040gctccgggcg tatatgctcc
gcattggtct tgaccaactc tatcagagct tggttgacgg 5100caatttcgat
gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc
5160cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga
ccgatggctg 5220tgtagaagtc gcgtctgcgt tcgaccaggc tgcgcgttct
cgcggccata gcaaccgacg 5280tacggcgttg cgccctcgcc ggcagcaaga
agccacggaa gtccgcccgg agcagaaaat 5340gcccacgcta ctgcgggttt
atatagacgg tccccacggg atggggaaaa ccaccaccac 5400gcaactgctg
gtggccctgg gttcgcgcga cgatatcgtc tacgtacccg agccgatgac
5460ttactggcgg gtgctggggg cttccgagac aatcgcgaac atctacacca
cacaacaccg 5520cctcgaccag ggtgagatat cggccgggga cgcggcggtg
gtaatgacaa gcgcccagat 5580aacaatgggc atgccttatg ccgtgaccga
cgccgttctg gctcctcata tcggggggga 5640ggctgggagc tcacatgccc
cgcccccggc cctcaccctc atcttcgacc gccatcccat 5700cgccgccctc
ctgtgctacc cggccgcgcg gtaccttatg ggcagcatga ccccccaggc
5760cgtgctggcg ttcgtggccc tcatcccgcc gaccttgccc ggcaccaaca
tcgtgcttgg 5820ggcccttccg gaggacagac acatcgaccg cctggccaaa
cgccagcgcc ccggcgagcg 5880gctggacctg gctatgctgg ctgcgattcg
ccgcgtttac gggctacttg ccaatacggt 5940gcggtatctg cagtgcggcg
ggtcgtggcg ggaggactgg ggacagcttt cggggacggc 6000cgtgccgccc
cagggtgccg agccccagag caacgcgggc ccacgacccc atatcgggga
6060cacgttattt accctgtttc gggcccccga gttgctggcc cccaacggcg
acctgtataa 6120cgtgtttgcc tgggccttgg acgtcttggc caaacgcctc
cgttccatgc acgtctttat 6180cctggattac gaccaatcgc ccgccggctg
ccgggacgcc ctgctgcaac ttacctccgg 6240gatggtccag acccacgtca
ccacccccgg ctccataccg acgatatgcg acctggcgcg 6300cacgtttgcc
cgggagatgg gggaggctaa ctgagtcgag aattcgctag agggccctat
6360tctatagtgt cacctaaatg ctagagctcg ctgatcagcc tcgactgtgc
cttctagttg 6420ccagccatct gttgtttgcc cctcccccgt gccttccttg
accctggaag gtgccactcc 6480cactgtcctt tcctaataaa atgaggaaat
tgcatcgcat tgtctgagta ggtgtcattc 6540tattctgggg ggtggggtgg
ggcaggacag caagggggag gattgggaag acaatagcag 6600gcatgcgcag
ggcccaattg ctcgagcggc cgcaataaaa tatctttatt ttcattacat
6660ctgtgtgttg gttttttgtg tgaatcgtaa ctaacatacg ctctccatca
aaacaaaacg 6720aaacaaaaca aactagcaaa ataggctgtc cccagtgcaa
gtgcaggtgc cagaacattt 6780ctcta
6785256785DNAArtificial Sequenceplasmid DNA vector incorporating
human, simian virus 40, E. coli, cytomegalovirus and bovine
sequences 25tagagaaatg ttctggcacc tgcacttgca ctggggacag cctattttgc
tagtttgttt 60tgtttcgttt tgttttgatg gagagcgtat gttagttacg attcacacaa
aaaaccaaca 120cacagatgta atgaaaataa agatatttta ttgcggccgc
tcgagcaatt gggccctgcg 180catgcctgct attgtcttcc caatcctccc
ccttgctgtc ctgccccacc ccacccccca 240gaatagaatg acacctactc
agacaatgcg atgcaatttc ctcattttat taggaaagga 300cagtgggagt
ggcaccttcc agggtcaagg aaggcacggg ggaggggcaa acaacagatg
360gctggcaact agaaggcaca gtcgaggctg atcagcgagc tctagcattt
aggtgacact 420atagaatagg gccctctagc gaattctcga ctcagttagc
ctcccccatc tcccgggcaa 480acgtgcgcgc caggtcgcat atcgtcggta
tggagccggg ggtggtgacg tgggtctgga 540ccatcccgga ggtaagttgc
agcagggcgt cccggcagcc ggcgggcgat tggtcgtaat 600ccaggataaa
gacgtgcatg gaacggaggc gtttggccaa gacgtccaag gcccaggcaa
660acacgttata caggtcgccg ttgggggcca gcaactcggg ggcccgaaac
agggtaaata 720acgtgtcccc gatatggggt cgtgggcccg cgttgctctg
gggctcggca ccctggggcg 780gcacggccgt ccccgaaagc tgtccccagt
cctcccgcca cgacccgccg cactgcagat 840accgcaccgt attggcaagt
agcccgtaaa cgcggcgaat cgcagccagc atagccaggt 900ccagccgctc
gccggggcgc tggcgtttgg ccaggcggtc gatgtgtctg tcctccggaa
960gggccccaag cacgatgttg gtgccgggca aggtcggcgg gatgagggcc
acgaacgcca 1020gcacggcctg gggggtcatg ctgcccataa ggtaccgcgc
ggccgggtag cacaggaggg 1080cggcgatggg atggcggtcg aagatgaggg
tgagggccgg gggcggggca tgtgagctcc 1140cagcctcccc cccgatatga
ggagccagaa cggcgtcggt cacggcataa ggcatgccca 1200ttgttatctg
ggcgcttgtc attaccaccg ccgcgtcccc ggccgatatc tcaccctggt
1260cgaggcggtg ttgtgtggtg tagatgttcg cgattgtctc ggaagccccc
agcacccgcc 1320agtaagtcat cggctcgggt acgtagacga tatcgtcgcg
cgaacccagg gccaccagca 1380gttgcgtggt ggtggttttc cccatcccgt
ggggaccgtc tatataaacc cgcagtagcg 1440tgggcatttt ctgctccggg
cggacttccg tggcttcttg ctgccggcga gggcgcaacg 1500ccgtacgtcg
gttgctatgg ccgcgagaac gcgcagcctg gtcgaacgca gacgcgactt
1560ctacacagcc atcggtccag acggccgcgc ttctgcgggc gatttgtgta
cgcccgacag 1620tcccggctcc ggatcggacg attgcgtcgc atcgaccctg
cgcccaagct gcatcatcga 1680aattgccgtc aaccaagctc tgatagagtt
ggtcaagacc aatgcggagc atatacgccc 1740ggagccgcgg cgatcctgca
agctccggat gcctccgctc gaagtagcgc gtctgctgct 1800ccatacaagc
caaccacggc ctccagaaga agatgttggc gacctcgtat tgggaatccc
1860cgaacatcgc ctcgctccag tcaatgaccg ctgttatgcg gccattgtcc
gtcaggacat 1920tgttggagcc gaaatccgcg tgcacgaggt gccggacttc
ggggcagtcc tcggcccaaa 1980gcatcagctc atcgagagcc tgcgcgacgg
acgcactgac ggtgtcgtcc atcacagttt 2040gccagtgata cacatgggga
tcagcaatcg cgcatatgaa atcacgccat gtagtgtatt 2100gaccgattcc
ttgcggtccg aatgggccga acccgctcgt ctggctaaga tcggccgcag
2160cgatcgcatc catgagctcc gcgacgggtt gcagaacagc gggcagttcg
gtttcaggca 2220ggtcttgcaa cgtgacaccc tgtgcacggc gggagatgca
ataggtcagg ctctcgctga 2280attccccaat gtcaagcact tccggaatcg
ggagcgcggc cgatgcaaag tgccgataaa 2340cataacgatc tttgtagaaa
ccatcggcgc agctatttac ccgcaggaca tatccacgcc 2400ctcctacatc
gaagctgaaa gcacgagatt cttcgccctc cgagagctgc atcaggtcgg
2460agacgctgtc gaacttttcg atcagaaact tcgcgacaga cgtcgcggtg
agttcaggct 2520ttttcatgat ggccctccta ccggtgatct cagctgtagg
aaagagaaga aggttagtag 2580tcgacatggt ggccctccta tagtgagtcg
tattatacta tgccgatata ctatgccgat 2640gattaattgt caacactagg
cgccggtcac aactaggtgg gcctatagac tctataggcg 2700gtacttacgt
cactcttggc acggggaatc cgcgttccaa tgcaccgttc ccggccgcgg
2760aggctggatc ggtcccggtg tcttctatgg aggtcaaaac agcgtggatg
gcgtctccag 2820gcgatctgac ggttcactaa acgagctctg cttatataga
cctcccaccg tacacgccta 2880ccgcccattt gcgtcaatgg ggcggagttg
ttacgacatt ttggaaagtc ccgttgattt 2940tggtgccaaa acaaactccc
attgacgtca atggggtgga gacttggaaa tccccgtgag 3000tcaaaccgct
atccacgccc attgatgtac tgccaaaacc gcatcaccat ggtaatagcg
3060atgactaata cgtagatgta ctgccaagta ggaaagtccc ataaggtcat
gtactgggca 3120taatgccagg cgggccattt accgtcattg acgtcaatag
ggggcgtact tggcatatga 3180tacacttgat gtactgccaa gtgggcagtt
taccgtaaat actccaccca ttgacgtcaa 3240tggaaagtcc ctattggcgt
tactatggga acatacgtca ttattgacgt caatgggcgg 3300gggtcgttgg
gcggtcagcc aggcgggcca tttaccgtaa gttatgtaac ggactctagc
3360tcgatccagc tcactcccct gttgattgtg tgttatggtg cagagtccag
ccactgtttg 3420tccagtgggg tctctgacct gccttcctgt agctcttgga
gtcattctgg cctccccctc 3480ccccaagccc acacaaaaaa ccaacacaca
gatccaatga aaataatgat tgtttattgc 3540agcttaatta actagccatg
accaaaatcc cttaacgtga gttttcgttc cactgagcgt 3600cagaccccgt
agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct
3660gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg
gatcaagagc 3720taccaactct ttttccgaag gtaactggct tcagcagagc
gcagatacca aatactgttc 3780ttctagtgta gccgtagtta ggccaccact
tcaagaactc tgtagcaccg cctacatacc 3840tcgctctgct aatcctgtta
ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 3900ggttggactc
aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt
3960cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac
ctacagcgtg 4020agcattgaga aagcgccacg cttcccgaag ggagaaaggc
ggacaggtat ccggtaagcg 4080gcagggtcgg aacaggagag cgcacgaggg
agcttccagg gggaaacgcc tggtatcttt 4140atagtcctgt cgggtttcgc
cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 4200gggggcggag
cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt
4260gctggccttt tgctcacatg ttcttcgcta acatttaaat ggatctacca
catttgtaga 4320ggttttactt gctttaaaaa acctcccaca cctccccctg
aacctgaaac ataaaatgaa 4380tgcaattgtt gttgttaact tgtttattgc
agcttataat ggttacaaat aaagcaatag 4440catcacaaat ttcacaaata
aagcaatagc atcacaaatt tcacaaataa agcatttttt 4500tcactgcatt
ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtcgagcta
4560gctgtacaat cgatagatct aggcctcctt cgccggccgc tcagcgaggg
ggcagggcct 4620gcatgtgaag ggcgtcgtag gtgtccttgg tggctgtact
gagaccctgg taaaggccat 4680cgtgcccctt gcccctccgg cgctcgcctt
tcatcccaat ctcactgtag gcctccgcca 4740tcttatcttt ctgcagttca
ttgtacaggc cttcctgagg gttcttcctt ctcggctttc 4800cccccatctc
agggtcccgg ccacgtctct tgtccaaaac atcgtactcc tctcttcgtc
4860ctagattgag ctcgttatag agctggttct ggccctgctg gtacgcgggg
gcgtctgcgc 4920tcctgctgaa cttcactctg aagaagatgc ctagcccaat
gaaaagcagg aggccggcga 4980cgccccccag cacaatcagg gccattttac
ctagggacag ggagaggctc ttctgtgtgt 5040agtggttgtg cagagcctca
tgcatcacgg agcatgagaa gacattcccc tcctgccacc 5100tgctcttgtc
cacggttagc ctgctgtaga ggaagaagga gccgtcggag tccagcacgg
5160gaggcgtggt cttgtagttg ttctccggct gcccattgct ctcccactcc
acggcgatgt 5220cgctggggta gaagcctttg accaggcagg tcaggctgac
ctggttcttg gtcatctcct 5280cctgggatgg gggcagggtg tacacctgtg
gctctcgggg ctgccctttg gctttggaga 5340tggttttctc gatggaggac
gggaggcctt tgttggagac cttgcacttg tactccttgc 5400cgttcagcca
gtcctggtgc aggacggtga ggacgctgac cacacggtac gtgctgttga
5460actgctcctc ccgcggcttt gtcttggcat tatgcacctc cacgccatcc
acgtaccagt 5520tgaactggac ctcggggtct tcctggctca cgtccaccac
cacgcacgtg acctcagggg 5580tccgggagat catgagagtg tccttgggtt
ttggggggaa caggaagact gatggtcccc 5640ccaggaactc aggtgctggg
catggtgggc atgggggacc atatttggac tcgttgaacc 5700gtccctcgcg
aaaaagtttc tttaaatgta agagcaggtc ctttacaaac tgggccacct
5760cgattttggt gtctcggaca tgcaagctgg aaaactgccc agctgagacc
ttgtgcgggc 5820agaatccgct cagcatcctc tgggtcttct cgatggcact
gcagcctgac acgttgatca 5880gggattccag ggctgcacag tacatgccag
ctgtcaggtt gatgctccat accatgctgc 5940cattgcagag cggagccttc
tggttctggg tgatgttgac cagctcctca atgaggtacc 6000tgagggctgt
agagggaggc acagggcctg ggatcaggag gaatgctggg tgtggtaact
6060cacagagcag aaggcttgtc accaggagaa gcatggtggc ggctctaggg
tgatctcagc 6120tgtaggaaag agaagaaggt tagtagtcga cgtgtccctc
tcgatgaatc taagtatcaa 6180ttgtgagcgc tcacaagtca acactctttt
tgataaatct agtagatatc acttacgtag 6240gcgccggtca cagcttggat
ctgtaacggc gcagaacaga aaacgaaaca aagacgtaga 6300gttgagcaag
cagggtcagg caaagcgtgg agagccggct gagtctaggt aggctccaag
6360ggagcgccgg acaaaggccc ggtctcgacc tgagctttaa acttacctag
acggcggacg 6420cagttcagga ggcaccacag gcgggaggcg gcagaacgcg
actcaaccgg cgtggatggc 6480ggcctcaggt agggcggcgg gcgcgtgaag
gagagatgcg agcccctcga agcttcagct 6540gtgttctggc ggcaaacccg
ttgcgaaaaa gaacgttcac ggcgactact gcacttatat 6600acggttctcc
cccaccctcg ggaaaaaggc ggagccagta cacgacatca ctttcccagt
6660ttaccccgcg ccaccttctc taggcaccgg ttcaattgcc gacccctccc
cccaacttct 6720cggggactgt gggcgatgtg cgctctgccc actgacgggc
accggagcga tcgcagatcc 6780ttcga 6785
* * * * *