U.S. patent application number 14/746960 was filed with the patent office on 2017-07-20 for perivascular mesenchymal precursor cells.
This patent application is currently assigned to ANGIOBLAST SYSTEMS, INC.. The applicant listed for this patent is Stan Gronthos, Songtao Shi, Andrew Zannettino. Invention is credited to Stan Gronthos, Songtao Shi, Andrew Zannettino.
Application Number | 20170204373 14/746960 |
Document ID | / |
Family ID | 31500707 |
Filed Date | 2017-07-20 |
United States Patent
Application |
20170204373 |
Kind Code |
A9 |
Gronthos; Stan ; et
al. |
July 20, 2017 |
PERIVASCULAR MESENCHYMAL PRECURSOR CELLS
Abstract
Mesenchymal precursors cells have been isolated from
perivascular niches from a range of tissues utilizing a
perivascular marker. A new mesenchymal precursor cell phenotype is
described characterized by the presence of the perivascular marker
3G5, and preferably also alpha smooth muscle actin together with
early developmental markers such as MUC 18, VCAM-1 and
STRO-1.sup.bri. The perivascular mesenchymal precursor cell is
multipotential and is shown to form, vascular tissue, as well as
bone marrow dentin and pulp. A method of enriching using cell
sorting based on these markers is also described.
Inventors: |
Gronthos; Stan; (Adelaide,
AU) ; Zannettino; Andrew; (Highbury, AU) ;
Shi; Songtao; (North Potomac, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Gronthos; Stan
Zannettino; Andrew
Shi; Songtao |
Adelaide
Highbury
North Potomac |
MD |
AU
AU
US |
|
|
Assignee: |
ANGIOBLAST SYSTEMS, INC.
New York
NY
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20150368614 A1 |
December 24, 2015 |
|
|
Family ID: |
31500707 |
Appl. No.: |
14/746960 |
Filed: |
June 23, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13098892 |
May 2, 2011 |
|
|
|
14746960 |
|
|
|
|
10551162 |
Sep 28, 2005 |
7947266 |
|
|
PCT/AU04/00416 |
Mar 29, 2004 |
|
|
|
13098892 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2501/165 20130101;
A61K 38/00 20130101; C12N 2501/135 20130101; A61P 9/10 20180101;
A61P 9/04 20180101; A61K 9/0014 20130101; C12N 5/0663 20130101;
C12N 5/0667 20130101; C12N 2501/39 20130101; A61K 35/28 20130101;
C12N 5/0668 20130101; C12N 2500/42 20130101; A61P 9/00 20180101;
C12N 2506/1392 20130101; C12N 2501/235 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101; A61K 35/28 20130101; A61K 35/44
20130101; C12N 5/0691 20130101; C12N 2501/11 20130101; A61K 35/44
20130101 |
International
Class: |
C12N 5/0775 20060101
C12N005/0775 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 28, 2003 |
AU |
2003901668 |
Claims
1. An isolated mammalian cell that is multipotent and/or
multipotent and that is positive for the surface marker 3G5.
2. The isolated cell of claim 1 wherein the cell has the capacity
to differentiate to form at least three differentiated cell types
of mesodermal origin and at least one other differentiated cell
type from ectodermal, and endodermal origin.
3. The isolated cell of claim 1 wherein the cell is a mesenchymal
precursor cell (MPC).
4. The isolated MPC of claim 3 wherein the cell co-expresses the
marker MUC18/CD146.
5. The isolated MPC of claim 3 wherein the cell co-expresses the
marker alpha-smooth muscle actin.
6. The isolated MPC of claim 3 wherein the cell co-expresses the
marker STRO-1.sup.bri.
7. The isolated MPC of claim 3 wherein the cell co-expresses a
marker selected from, but not limited to, the group comprising
THY-1, VCAM-1, ICAM-1, PECAM-1, CD49a/CD49b/CD29, CD49c/CD29,
CD49d/CD29, CD29, CD61, integrin beta 5, 6-19, thrombomodulin,
CD10, CD13, SCF, STRO-1.sup.bri, PDGF-R, EGF-R, IGF1-R, NGF-R,
FGF-R, Leptin-R (STRO-2).
8. The isolated MPC of claim 3 wherein the cell co-expresses the
markers STRO-1.sup.bri, MUC18/CD146, and alpha-smooth muscle
actin.
9. The isolated MPC of claim 3 wherein the cell is negative for the
hematopietic markers CD45, CD34, and glycophorin A.
10. The isolated cell of claim 1 or 3 wherein the cell is isolated
from a tissue of the group comprising, but not limited to, adipose
tissue, teeth, dental pulp, skin, liver, kidney, heart, retina,
brain, hair follicles, intestine, lung, spleen, lymph node, thymus,
pancreas, bone, ligament, bone marrow, tendon, and skeletal
muscle.
11. A mesenchymal precursor cell (MPC), capable of forming a
clonogenic colony and differentiating to three or more mesenchymal
tissue types, isolated from a tissue of the group comprising, but
not limited to, adipose tissue, teeth, dental pulp, skin, liver,
kidney, heart, retina, brain, hair follicles, intestine, lung,
spleen, lymph node, thymus, pancreas, bone, ligament, bone marrow,
tendon, and skeletal muscle, and which is positive for the surface
marker STRO-1.sup.bri.
12. The isolated cell of claim 11 wherein the MPC co-expresses the
marker MUC-18/CD146 or alpha-smooth muscle actin.
13. The isolated cell of claim 11 wherein the MPC co-expresses a
marker selected from, but not limited to, the group comprising
THY-1, VCAM-1, ICAM-1, PECAM-1, CD49a/CD49b/CD29, CD49c/CD29,
CD49d/CD29, CD29, CD61, integrin beta 5, 6-19, thrombomodulin,
CD10, CD13, SCF, STRO-1.sup.bri, PDGF-R, EGF-R, IGF1-R, NGF-R,
FGF-R, Leptin-R (STRO-2).
14. The isolated MPC of claim 11 wherein the cell is negative for
the hematopoietic markers CD45, CD34, and glycophorin A.
15. The isolated cell of claim 1, 3 or 11 wherein the cell is
isolated from a mammal.
16. The isolated cell of claim 1, 3 or 11 wherein the mammal is a
human.
17. The isolated cell of claim 1, 3 or 11 wherein the cell has the
capacity to be induced to differentiate to form cells comprising
one or more of at least osteoblast, odontoblast, dentin-producing,
chondrocyte, tendon, ligament, cartilage, adipocyte, fibroblast,
marrow stroma, osteoclast- and hematopoietic-supportive stroma,
cardiac muscle, smooth muscle, skeletal muscle, pericyte, vascular,
epithelial, glial, neuronal, astrocyte or oligodendrocyte cell
type.
18. A differentiated progeny cell obtained from the isolated cell
of claim 1, 3 or 11 wherein the progeny cell is at least an
osteoblast, odontoblast, dentin-producing, chondrocyte, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma,
osteoclast- and hematopoietic-supportive stroma, cardiac muscle,
smooth muscle, skeletal muscle, pericyte, vascular, epithelial,
glial, neuronal, astrocyte or oligodendrocyte cell.
19. An unexpanded population of cells enriched for mesenchymal
precursor cells (MPCs) of claim 3 or 11.
20. An unexpanded population of cells enriched for mesenchymal
precursor cells (MPCs), capable of forming a clonogenic colony and
differentiating to three or more mesenchymal tissue types, said
MPCs co-expressing the surface markers MUC18/CD146 and alpha-smooth
muscle actin.
21. An enriched population as in claim 20 wherein the MPCs are
additionally positive for the marker STRO-1.sup.bri.
22. An enriched population as in claim 20 wherein the MPCs are
additionally positive for the marker 3G5.
23. An enriched population as in claim 20 wherein the MPCs
co-express MUC18/CD146, alpha-smooth muscle actin, STRO-1.sup.bri,
and 3G5.
24. An enriched population as in claim 19 or 20 wherein the MPCs
are negative for the hematopoietic markers CD34, CD45, and
glycophorin-A.
25. An enriched population as in claim 19 or 20 comprising at least
0.01% MPCs capable of forming a clonogenic colony and
differentiating to three or more mesenchymal tissue types.
26. An enriched population as in claim 19 or 20 comprising at least
0.1% MPCs capable of forming a clonogenic colony and
differentiating to three or more mesenchymal tissue types.
27. An enriched population as in claim 19 or 20 comprising at least
1% MPCs capable of forming a clonogenic colony and differentiating
to three or more mesenchymal tissue types.
28. An enriched population as in claim 19 or 20 comprising at least
0.01% STRO-1.sup.bri MPCs.
29. An enriched population as in claim 19 or 20 comprising at least
0.1% STRO-1.sup.bri MPCs.
30. An enriched population as in claim 19 or 20 comprising at least
1% STRO-1.sup.bri MPCs.
31. The enriched population of claim 19, 20, 21, 22 or 23 wherein
the population has the capacity to be induced to differentiate to
form cells comprising one or more of at least osteoblast,
odontoblast, dentin-producing, chondrocyte, tendon, ligament,
cartilage, adipocyte, fibroblast, marrow stroma, osteoclast- and
hematopoietic-supportive stroma, cardiac muscle, smooth muscle,
skeletal muscle, pericyte, vascular, epithelial, glial, neuronal,
astrocyte, or oligodendrocyte cell type.
32. The enriched population of claim 19, 20, 21, 22 or 23 wherein
the population is enriched from a tissue of the group comprising,
but not limited to, adipose tissue, teeth, dental pulp, skin,
liver, kidney, heart, retina, brain, hair follicles, intestine,
lung, spleen, lymph node, thymus, pancreas, bone, ligament, bone
marrow, tendon, and skeletal muscle.
33. A differentiated progeny cell obtained from the enriched
population of claim 19, 20, 21, 22 or 23 wherein the progeny cell
is at least an osteoblast, odontoblast, dentin-producing,
chondrocyte, tendon, ligament, cartilage, adipocyte, fibroblast,
marrow stroma, osteoclast- and hematopoietic-supportive stroma,
cardiac muscle, smooth muscle, skeletal muscle, pericyte, vascular,
epithelial, glial, neuronal, astrocyte, or oligodendrocyte
cell.
34. An enriched population as in claim 19, 20, 21, 22 or 23 wherein
the enriched population is expanded.
35. The expanded population of claim 34 wherein the expanded
population comprises at least 0.1% cells which express at high
levels one or more of the markers STRO-1, 3G5, or MUC18/CD146.
36. The expanded population of claim 34 wherein the expanded
population comprises at least 1% cells which express at high levels
one or more of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
37. The expanded population of claim 34 wherein the expanded
population comprises at least 2% MPCs which express at high levels
one or more of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
38. The expanded population of claim 34 wherein the expanded
population comprises at least 5% cells which express at high levels
one or more of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
39. The expanded population of claim 34 wherein the expanded
population comprises a least 10% cells which express at high levels
one or more of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
40. A method of enriching for mesenchymal precursor cells (MPCs),
the method including the step of preparing a single cell suspension
from a vascularised source tissue and the step of enriching based
on the presence of markers expressed in the vascularized tissue by
pen-vascular cells.
41. The method of claim 40, wherein the vascularised source tissue
is in the group comprising, but not limited to, adipose tissue,
teeth, dental pulp, skin, liver, kidney, heart, retina, brain, hair
follicles, intestine, lung, spleen, lymph node, thymus, pancreas,
bone, ligament, bone marrow, tendon, and skeletal muscle.
42. The method of claim 40, wherein the step of enriching is based
on the presence of the marker 3G5.
43. The method of claim 40, wherein the step of enriching is based
on the presence of the marker MUC18/CD146.
44. The method of claim 40, wherein the step of enriching is based
on the presence of the marker STRO-1.sup.bri.
45. The method of claims 42, 43 or 44 wherein the step of enriching
is based on the additional presence of one or more markers.
46. The method of claims 42, 43 or 44 wherein the step of enriching
is based on the additional presence of one or more markers selected
from the group comprising, but not limited to, THY-1, VCAM-1,
ICAM-1, PECAM-1, CD49a/CD49b/CD29, CD49c/CD29, CD49d/CD29, CD29,
CD61, integrin beta 5, 6-19, thrombomodulin, CD10, CD13, SCF,
STRO-1.sup.bri, PDGF-R, EGF-R, IGF1-R, NGF-R, FGF-R, Leptin-R
(STRO-2).
47. The method of enriching for MPCs of claim 40 wherein the MPCs
co-express the markers 3G5, STRO-1.sup.bri, MUC18/CD146, and
alpha-smooth muscle actin.
48. The method of claims 42, 43 or 44 wherein the step of enriching
is based on the additional absence of a surface marker indicative
of commitment or hematopoietic lineage differentiation.
49. The method of claim 48 wherein the cells do not express the
hematopoietic markers CD34, CD45 or glycophorin A.
50. The method of claim 40, wherein the enriched MPCs are capable
of differentiating into cells comprising one or more of at least
osteoblast, odontoblast, dentin-producing, chondrocyte, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma,
osteoclast- and hematopoietic-supportive stroma, cardiac muscle,
smooth muscle, skeletal muscle, pericyte, vascular, epithelial,
glial, neuronal, astrocyte, or oligodendrocyte cell type.
51. The method of claim 40 wherein the source tissue for the
enrichment of MPC is selected from the group comprising, but not
limited to, adipose tissue, teeth, dental pulp, skin, liver,
kidney, heart, retina, brain, hair follicles, intestine, lung,
spleen, lymph node, thymus, pancreas, bone, ligament, bone marrow,
tendon, and skeletal muscle.
52. The method of claim 40 wherein the source tissue for the
enrichment of MPC is mammalian.
53. The method of claim 40 wherein the source tissue for the
enrichment of MPC is human.
54. The method of claim 40 wherein the enriched population
comprises at least 0.01% MPCs capable of forming a clonogenic
colony and differentiating to three or more mesenchymal tissue
types.
55. The method of claim 40 wherein the enriched population
comprises at least 0.1% MPCs capable of forming a clonogenic colony
and differentiating to three or more mesenchymal tissue types.
56. The method of claim 40 wherein the enriched population
comprises at least 1% MPCs capable of forming a clonogenic colony
and differentiating to three or more mesenchymal tissue types.
57. The method of claim 40, wherein the step of enriching is based
on the presence of the marker 3G5, and the method includes the
further step of expanding the population after enrichment.
58. The method of claim 40, wherein the step of enriching is based
on the presence of the marker MUC18/CD146, and the method includes
the further step of expanding the population after enrichment.
59. The method of claim 40, wherein the step of enriching is based
on the presence of the marker STRO-1, and the method includes the
further step of expanding the population after enrichment.
60. The method of claim 57, 58 or 59 wherein the expanded
population comprises at least 0.1% cells which express one or more
of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
61. The method of claim 57, 58 or 59 wherein the expanded
population comprises at least 1% cells which express one or more of
the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
62. The method of claim 57, 58 or 59 wherein the expanded
population comprises at least 2% cells which express one or more of
the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
63. The method of claim 57, 58 or 59 wherein the expanded
population comprises at least 5% cells which express at high levels
one or more of the markers STRO-1.sup.bri, 3G5, or MUC18/CD146.
64. The method of claim 57, 58 or 59 wherein the expanded
population comprises at least 10% cells which express at high
levels one or more of the markers STRO-1.sup.bri, 3G5, or
MUC18/CD146.
65. The method of claim 57, 58 or 59 wherein the expanded
population comprises cells of one or more of at least osteoblast,
odontoblast, dentin-producing, chondrocyte, tendon, ligament,
cartilage, adipocyte, fibroblast, marrow stroma, osteoclast- and
hematopoietic-supportive stroma, cardiac muscle, smooth muscle,
skeletal muscle, pericyte, vascular, epithelial, glial, neuronal,
astrocyte, or oligodendrocyte cell type.
66. A method of expanding MPC of claim 34 by culturing the cells in
media supplemented with growth factors.
67. The method of claim 66 wherein the growth factors are chosen
from the group comprising, but not limited to, PDGF, EGF, FGF, IGF,
VEGF and LIF.
Description
FIELD OF THE INVENTION
[0001] This invention relates to mesenchymal precursor cells, and
the isolation of a subpopulation of such precursors carrying a
perivascular marker.
BACKGROUND OF THE INVENTION
[0002] Numerous attempts at isolating and enriching mesenchymal
precursor cells have been attempted because of the potential that
these cells have for medicinal use. Pittinger et al., (1999) show
the expansion of clonogenic cells from bone marrow and describes a
preparation of enlarged mesenchymal stem cells. A more recent
example of such a method providing for a relatively high yield from
bone marrow is disclosed in publication WO01/04268 to Simmons et
al.
[0003] To date however there have been no examples of methods that
permit the isolation of mesenchymal precursor cells from a wide
range of tissues.
SUMMARY OF THE INVENTION
[0004] The present invention arises from the finding that a
population of multipotential mesenchmal precursor cells (MPCs) is
present in a perivascular niche. This has led to the demonstration
that there is a much wider range of tissue type sources of MPCs
than the single tissue, bone marrow, referred to in WO01/04268. The
present invention arises from the additional finding that an
enriched population MPCs can be differentiated into two populations
discriminated by the marker 3G5. MPCs that are 3G5 positive are
considered of interest particularly for neovascularization
applications, although demonstrably they are also shown to
differentiate into other tissue types. It is an additional finding
of the present invention that levels of MPCs present in preferred
enriched populations of this invention are able to give rise to
sufficient numbers of committed cells to provide a number of
differentiated tissue types.
[0005] In a first form of a first aspect the invention might be
said to reside in a method of enriching for mesenchymal precursor
cells (MPCs), the method including the step of preparing a single
cell suspension from a vascularised source tissue and the step of
enriching based on the presence of an early perivascular cell
marker.
[0006] In a second form of the first aspect the invention might be
said to reside in a method of enriching for mesenchymal precursor
cells, the method including the step of preparing a single cell
suspension from a, non-bone marrow, vascularised source tissue and
separating the tissue into separate cells and the step of enriching
based one of the presence or level of one or more early
developmental markers and the absence of one or more surface
markers indicative of commitment.
[0007] In a third form of the first aspect the invention might be
said to reside in a method of enriching for mesenchymal precursor
cells (MPCs), the method including the step of preparing a single
cell suspension from a vascularised source tissue and the step of
enriching based on the presence of markers expressed in the
vascularized tissue by peri-vascular cells.
[0008] In a second aspect the invention might be said to reside in
an enriched population of cells enriched for mesenchymal precursor
cells (MPCs) said MPCs having a phenotype of 3G5, MUC18, VCAM-1,
STRO-1.sup.bri and .alpha. smooth muscle actin.
[0009] In a first form of a third aspect the invention might be
said to reside in an isolated mesenchymal precursor cells (MPCs)
said MPCs having a phenotype of 3G5, MUC18, VCAM-1, STRO-1.sup.bri
and .alpha. smooth muscle actin.
[0010] In a second form of the third aspect the invention might be
said to reside in an isolated mammalian cell that is multipotent
and that is positive for the surface marker 3G5.
[0011] In a third form of the third aspect the invention might be
said to reside in a mesenchymal precursor cell (MPC), capable of
forming a clonogenic colony and differentiating to three or more
mesenchymal tissue types, isolated from a tissue of the group
comprising, but not limited to, adipose tissue, teeth, dental pulp,
skin, liver, kidney, heart, retina, brain, hair follicles,
intestine, lung, spleen, lymph node, thymus, pancreas, bone,
ligament, bone marrow, tendon, and skeletal muscle, and which is
positive for the surface marker STRO-1.
[0012] In a fourth form of the third aspect the invention might be
said to reside in an unexpanded population of cells enriched for
mesenchymal precursor cells (MPCs), capable of forming a clonogenic
colony and differentiating to three or more mesenchymal tissue
types, said MPCs co-expressing the surface markers MUC18/CD146 and
alpha-smooth muscle actin.
[0013] In a fourth aspect the invention might be said to reside in
a differentated progeny cell arising from the third aspect of the
invention preferably wherein the progeny cell is at least an
osteoblast, odontoblast, dentin-producing, chondrocyte, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma,
osteoclast- and hematopoietic-supportive stroma, cardiac muscle,
smooth muscle, skeletal muscle, pericyte, vascular, epithelial,
glial, neuronal, astrocyte or oligodendrocyte cell.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1. Properties of STRO-1.sup.+ MACS-isolated cells
co-labeled with anti-CD146 (CC9). (A) Sort region, R1, represents
the double positive STRO-1.sup.BRT/CD146.sup.+ population. (B) The
incidence of clonogenic cell colonies (>50 cells) based on
STRO-1.sup.BRT/CD146.sup.+ expression was determined by limiting
dilution analysis of 24 replicates per cell concentration using
Poisson distribution analysis from 5 independent experiments.
Forward (size) and perpendicular (granularity) light scatter
characteristics of BMMNCs (C), STRO-1.sup.int/CD146.sup.- cells (D)
and STRO-1.sup.BRT/CD146.sup.+ cells (E). (F) RT-PCR analysis of
STRO-1.sup.BRT/CD146.sup.+ sorted marrow cells for CBFA1 (lane 2),
osteocalcin (lane 4) and GAPDH (lane 6) transcripts. Control cells
(BMSSC cultures grown in the presence of dexamethasone) expressing
CBFA1 (lane 1), osteocalcin (lane 3), and GAPDH (lane 5) is also
shown. Reaction mixes were subjected to electrophoresis on a 1.5%
agarose gel and visualised by ethidium bromide staining. (G) In
situ expression of CD 146 on blood vessel (bv) walls (arrow) in
human bone marrow (bm) sections near the bone (b) surface
20.times.. Sections were counter stained with Hematoxylin. (H) Dual
Immunofluorescence staining demonstrating reactivity of the STRO-1
antibody labeled with Texas red and the CC9 antibody labeled with
fluorescein isothiocyanate, reacting to blood vessel walls in
frozen sections of human bone marrow.
[0015] FIG. 2. Immunophenotypic analysis of DPSCs in vivo. The bar
graph depicts the number of clonogenic colonies retrieved from
single cell suspensions of dental pulp following immunomagnetic
bead selection based on reactivity to antibodies that recognize
STRO-1, CD146, and 305 and isotype-matched negative control
antibodies. The data are expressed as the number of colony-forming
units obtained in the bead positive cell fractions as a percentage
of the total number of colonies in unfractionated pulp cells
averaged from three separate experiments. Statistical significance
(*) was determined using the student t-test (p 0.01) comparing the
percent total number of colonies for each antibody with the
corresponding isotype-matched control.
[0016] FIG. 3. Reactivity of perivascular makers in dental pulp.
(A) Immunolocalization of the STRO-1 antigen on blood vessels
(small arrows) in human dental pulp (p) and around perineurium
(large arrow) surrounding a nerve bundle (nb) 20.times.. (B) Dual
Immunofluorescence staining demonstrating reactivity of the STRO-1
antibody labeled with Texas Red to dental pulp perineurium (arrow)
in combination with an anti-neurofilament antibody labeled with
fluorescein isothiosyanate staining the inner nerve bundle (nb),
40.times.. (C) Immunolocalization of the CD146 antigen to blood
vessel walls in human dental pulp tissue 20.times.. (D) Dual
Immunofluorescence staining demonstrating reactivity of the STRO-1
antibody labeled with Texas red to a blood vessel and the CC9
antibody labeled with fluorescein isothiosyanate. (E)
Immunohistochemical staining of pulp tissue with a rabbit
polyclonal anti-DSP antibody (arrow) to the odontoblast outer layer
(od). 20.times.. (F) 3G5 reactivity to a single pericyte (arrow) in
a blood vessel (bv) wall 40.times.. Tissue sections were counter
stained with Hematoxylin.
[0017] FIG. 4. 3G5 reactivity to BMSSCs. (A) The representative
histogram depicts a typical dual-color FACS analysis profile of
whole bone marrow mononuclear cells (BMMNCs) expressing CD146 (PE)
and 3G5 (FITC). (B) Colony efficiency assays were performed for all
the different expression patterns observed (regions "R" 1-6). The
data are expressed as the mean incidence of colony-forming units
for each cell fraction averaged from three separate
experiments.
[0018] FIG. 5. Developmental potential of purified BMSSCs and DPSCs
in vivo. Cytospin preparations of MACS/FACS isolated
STRO-1.sup.BRT/CD146.sup.+ marrow cells (arrow) stained with an
antibody specific to .alpha.-smooth muscle actin (A) and von
Willebrand Factor (B). CD146.sup.+ pulp cells (large arrow)
isolated by immunomagnetic bead selection (magnetic beads depicted
by small arrows), stained with an antibody specific to
.alpha.-smooth muscle actin (C) and von Willebrand Factor. (D). (E)
Ectopic bone formation (b) and haematopoietic/adipogenic marrow
(bm) by ex vivo expanded cells derived from
STRO-1.sup.BRT/CD146.sup.+ BMSSCs transplanted with HA/TCP into
immunocompromised mice for three months (E). (F) Ectopic formation
of dentin (d) and fibrous pulp tissue (p) by ex vivo expanded cells
derived from CD146.sup.+ DPSCs transplanted with HA/TCP into
immunocompromised mice for three months. Sections were stained with
Hematoxylin & Eosin.
[0019] FIG. 6 Expression of CD34, CD45 and Glycophorin-A on STRO-1
positive bone marrow mononuclear cells. Representative histograms
depicting typical dual-colour flow cytometric analysis profiles of
STRO-1 positive bone marrow mononuclear cells isolated initially by
magnetic activated sorting and co-stained with antibodies directed
against CD34 (A), CD45 (B) or Glycophorin-A (C). The STRO-1
antibody was identified using a goat anti-murine IgM-fluorescein
isothiocyanate while CD34, CD45 and Glycophorin-A were identified
using a goat anti-murine IgG-phycoerythrin. The high expressing
STRO-1 fraction which contained the clonogenic MPC population was
isolated by fluorescence activated cell sorting based on regions R1
and R2.
[0020] FIG. 7 Bone marrow MPC are STRO-1 bright, CD34 negative,
CD45 negative and Glycophorin-A negative. The graph depicts the
results of in vitro adherent colony formation assays performed for
each of the different sorted STRO-1 bright populations selected by
their co-expression or lack of either the CD34, CD45 or
Gycophorin-A antigens, based on regions R1 and R2 as indicated in
FIG. 6. These data are expressed as the mean incidence of
colony-forming units for each cell fraction averaged from two
separate experiments.
[0021] FIG. 8 Reactivity of perivascular makers in different human
tissues. Dual-colour immunofluorescence staining demonstrating
reactivity of (A) STRO-1 and CD146, (B) STRO-1 and alpha-smooth
muscle actin, and (C) 3G5 and CD146, on blood vessels and
connective tissue present on spleen, pancreas (Panel 1), brain,
kidney (Panel 2), liver, heart (Panel 3) and skin (Panel 4)
20.times.. The STRO-1 and 3G5 antibodies were identified using a
goat anti-murine IgM-Texas Red while CD 146 and alpha-smooth muscle
actin were identified using a goat anti-murine or IgG-fluorescein
isothiocyanate. Co-localization is indicated by overlaping areas of
yellow and orange fluorescence (white arrows).
[0022] FIG. 9 Isolation of adipose-derived MPC by FACS.
Representative flow cytometirc histograms depicting the expression
of STRO-1, CD146 and 3G5 in fresh preparations of peripheral
adipose-derived single-cell suspensions generated following
collagenase/dispase digestion as previously described (Shi and
Gronthos 2003). The antibodies were identified using either a goat
anti-murine IgM or IgG-phycoerythrin. Cell populations were then
selected by FACS, based on their positivity (region R3) or
negativity (region R2) to each marker and then plated into regular
growth medium to assess the incidence of adherent colony-forming
cells in each cell fraction.
[0023] FIG. 10 Clonogenic adipose-derived MPC are positive for
STRO-1/3G5/CD146. The bar graph depicts the number of clonogenic
colonies retrieved from single cell suspensions of enzymatically
digested human peripheral adipose tissue, following fluorescence
activated cell sorting, based on their reactivity to antibodies
that recognize STRO-1, CD146, and 3G5 (FIG. 9), then cultured in
standard growth medium as previously described for bone marrow and
dental pulp tissue (Shi and Gronthos 2003). The data are expressed
as the number of colony-forming units obtained per 10.sup.5 cells
plated in the positive and negative cell fractions averaged from
two separate experiments.
[0024] FIG. 11 Immunophenotypic analysis of adipose-derived MPC.
Representative flow cytometric histograms depicting the
co-expression of STRO-1 and CD 146 (A) and 3G5 and CD146 in fresh
preparations of peripheral adipose-derived single-cell suspensions
generated following collagenase/dispase digestion. The STRO-1 and
3G5 antibodies were identified using a goat anti-murine
IgM-phycoerythrin while CD146 was identified using a goat
anti-murine IgG-fluorescein isothiocyanate. Approximately 60% and
50% of the CD146 positive cells co-express STRO-1 and 305,
respectively. These data suggest that 10% or more of the CD164
positive cells co-express STRO-1 and 3G5.
[0025] FIG. 12 Developmental potential of purified
Adipocyte-derived MPC in vitro. Preparations of primary MPC
cultures derived from STRO-1.sup.+/CD146.sup.+ adipose cells were
re-cultured either in standard culture conditions (A), osteogenic
inductive medium (B), Adipogenic inductive medium (C) or
condrogenic conditions (D) as previously described Gronthos et al.
2003. Following two weeks of multi-differentiation induction, the
adipocyte-derived MPC demonstrated the capacity to form bone (B;
Alizarin positive mineral deposits), fat (C; Oil Red 0 positive
lipid) and cartilage (D: collagen type II matrix).
[0026] FIG. 13 Isolation of skin-derived MPC by FACS.
Representative flow cytometirc histograms depicting the expression
of STRO-1, CD146 and 3G5 in fresh preparations of full thickness
skin-derived single-cell suspensions generated following
collagenase/dispase digestion. The antibodies were identified using
either a goat anti-murine IgM or IgG-phycoerythrin. Cell
populations were then selected by FACS, based on their positivity
(region R3) or negativity (region R2) to each marker and then
plated into regular growth medium to assess the incidence of
adherent colony-forming cells in each cell fraction.
[0027] FIG. 14 Clonogenic skin-derived MPC are positive for
STRO-1/3G5/CD146. The bar graph depicts the number of adherent
colonies recovered from single cell suspensions of enzymatically
digested human skin, following fluorescence activated cell sorting,
based on their reactivity to antibodies that recognize STRO-1,
CD146, and 3G5 (FIG. 6), then cultured in standard growth medium as
previously described for bone marrow and dental pulp tissue (Shi
and Gronthos 2003). The data are expressed as the number of
colony-forming units obtained per 10.sup.5 cells plated in the
positive and negative cell fractions averaged from two separate
experiments.
[0028] FIG. 15 A. Immunophenotypic expression pattern of ex vivo
expanded bone marrow MPC. Single cell suspensions of ex vivo
expanded bone marrow MPC were prepared by trypsin/EDTA treatment
then incubated with antibodies identifying cell lineage-associated
markers. For those antibodies identifying intracellular antigens,
cell preparations were fixed with cold 70% ethanol to permeanbilize
the cellular membrane prior to staining for intracellular markers.
Isotype matched control antibodies were treated under identical
conditions. Row cytometric analysis was performed using a COULTER
EPICS instrument. The dot plots represent 5,000 listmode events
indicating the level of fluorescence intensity for each lineage
cell marker (bold line) with reference to the isotype matched
negative control antibodies (thin line). B. Gene expression profile
of cultured MPC. Single cell suspensions of ex vivo expanded bone
marrow MPC were prepared by trypsin/EDTA treatment and total
cellular RNA was prepared. Using RNAzolB extraction method total
RNA was isolated and used as a template for cDNA synthesis,
prepared using standard procedure. The expression of various
transcripts was assessed by PCR amplification, using a standard
protocol as described previously (Gronthos et at 2003). Primers
sets used in this study are shown in Table 2. Following
amplification, each reaction mixture was analysed by 1.5% agarose
gel electrophoresis, and visualised by ethidium bromide staining.
Relative gene expression for each cell marker was assessed with
reference to the expression of the house-keeping gene, GAPDH, using
ImageQuant software.
[0029] FIG. 16. Ex vivo expanded STRO-1.sup.bri MPC can develop
into arterioles in vitro. Single cell suspensions of ex vivo
expanded bone marrow STRO-1.sup.bri MPC were prepared by
trypsin/EDTA treatment then plated into 48-well plates containing
200 .mu.l of matrigel. The STRO-1.sup.bri MPC were plated at 20,000
cells per well in serum-free medium (Gronthos et al. 2003)
supplemented with the growth factors PDGF, EGF, VEGF at 10 ng/ml.
Following 24 hours of culture at 37.degree. C. in 5% CO.sub.2, the
wells were washed then fixed with 4% paraformaldehyde.
Immunohistochemical studies were subsequently performed
demonstrated that the cord-like structures expressed alpha-smooth
muscle actin identified with a goat-anti-murine IgG horse radish
peroxidase antibody.
DETAILED DESCRIPTION OF THE ILLUSTRATED AND EXEMPLIFIED EMBODIMENTS
OF THE INVENTION
[0030] The present invention relates to mesenchmal precursor cells,
in particular those that may be present in the perivascular
compartment of vascularised tissue. Such mesenchymal cells may be
identified by the presence of the 3G5 surface marker, and perhaps
additionally or separately by other early developmental markers
such as CD146 (MUC18), VCAM-1 and STRO-1.
[0031] Precursor cells are early cells that are substantially at a
pre-expansion stage of development. These are cells that have yet
to differentiate to fully committed cells, however they need not be
stem cells in a strict sense, in that they are necessarily able to
differentiate into all types of cells. Partially differentiated
precursor cells have a benefit in that they have a greater
proliferative potential than stem cells.
[0032] The present precursor cells are somewhat differentiated in
that they are committed to mesenchymal tissue, as opposed, for
example, to haemopoietic tissues. It is evident from the data
produced that the MPCs that have been isolated lack markers
associated with haemopoietic cells such as CD34, and additionally
their differentiation potential does not extend to haemopoietic
lines. Additionally they need not necessarily have the potential to
differentiate into all mesenchymal cell type, rather, they may be
able to differentiate into one, two three or more cell types.
[0033] It is anticipated that these precursor cell harvested from
the tissues concerned may be useful for regenerating tissue for
cells types from which they have been sourced. Thus precursor cells
isolated from heart may be reintroduced to regenerate heart tissue,
however their potential need not be so limited, precursor cells
isolated from one tissue type might be useful for regenerating
tissue in another tissue type. The microenvironment in which an
undifferentiated cell finds itself is known to exert an influence
on the route of differentiation and therefore the reintroduction
need not necessarily be tissue specific.
[0034] The data presented show that MPCs have been harvested and
then re-introduced to produce bone and bone marrow and dentin and
pulp respectively, in addition aterioles, cord like structures,
have been produced after ex vivo expansion of isolated MPCs.
[0035] It is anticipated that a wide range of cells might be
produced based on gene expression of markers characteristic for
certain cell types. It is thus anticipated that under appropriate
culture conditions the range of cell types that can be generated
from the perivascular MPCs of the present invention include but are
not limited to the following, osteoblast, odontoblast,
dentin-producing, chondrocyte, tendon, ligament, cartilage,
adipocyte, fibroblast, marrow stroma, osteoclast- and
hematopoietic-supportive stroma, cardiac muscle, smooth muscle,
skeletal muscle, pericyte, vascular, epithelial, glial, neuronal,
astrocyte or oligodendrocyte cell.
[0036] One of the benefits of the finding that MPCs can be isolated
from perivascular cells is that this greatly expands the range of
source tissues from which MPCs can be isolated or enriched and
there is no longer an effective restriction on the source of MPCs
to bone marrow. The tissues from which these MPCs have been
isolated in the exemplifications of this invention are human bone
marrow, dental pulp cells, adipose tissue and skin. In addition in
situ staining and histological studies have identified that MPC are
present in the perivascular compartment of spleen, pancreas, brain,
kidney, liver and heart. Given this wide and diverse range of
tissue types where perivascular MPCs are present, it is proposed
that MPC will also be present from an even wider range of tissue
which may include, adipose tissue, teeth, dental pulp, skin, liver,
kidney, heart, retina, brain, hair follicles, intestine, lung,
spleen, lymph node, thymus, pancreas, bone, ligament, bone marrow,
tendon, and skeletal muscle.
[0037] These precursor cells of the present invention are
distinguished from other known MPCs in that they are positive for
3G5 or perhaps that they carry another perivascular markers. They
can be isolated by enriching for an early developmental surface
marker present on perivascular cells, in particular the presence of
one or more of CD146(MUC18), VCAM-1 and alternatively or
additionally high level expression of the marker recognised by the
monoclonal antibody STRO-1. Alternatively or additionally
enrichment may be carried out using 3G5.
[0038] Markers associated with perivascular cells may also be
present on the MPCs, for example alpha smooth muscle actin
(.alpha.SMA).
[0039] Other early developmental markers associated with MPCs may
also be present. These may include but are not necessarily limited
to the group consisting of THY-1, VCAM-1, ICAM-1, PECAM-1,
CD49a/CD49b/CD29, CD49c/CD29, CD49d/CD29, CD29, CD61, integrin beta
5, 6-19, thrombomodulin, CD10, CD13, SCF, STRO-1bri, PDGF-R, EGF-R,
IGF1-R, NGF-R, FGF-R, Leptin-R (STRO-2). Positive expression of one
or more of these markers may be used in methods of enriching for
MPCs from source tissue.
[0040] The MPCs of the present invention may also be characterised
by the absence of markers present in differentiated tissue, and
enrichment may be based on the absence of such markers.
[0041] Similarly it is preferred that the enriched cell populations
are not of haemopoietic origin and thus it is preferred that these
cells are not present. Markers characteristically identified as not
present include but are not limited to CD34, CD45 and glycophorin
A. Additional other markers for this purpose might include CD20 and
CD19 (B lymphocyte markers), CD117 (c-kit oncoprotein) present on
hemopoietic stem cells and angioblasts, CD14 (macrophage), CD3 and
CD4 (T cells).
[0042] It may be desirable to use the relatively quiescent,
directly enriched or isolated perivascular MCPs. Alternatively it
has been discovered that expansion of the enriched population can
be carried out and have the beneficial effect of resulting in much
greater numbers of cells. The effect of expansion of the directly
enriched pool of cells is, however, that some differentiation of
the initial MCPs will occur. Expansion over a 5 week period might
result in an increase of 10.sup.3 fold. Other periods might be
chosen to expand the population to between 10.sup.2 to 10.sup.5
fold. This potential might be directed by culturing them is media
containing cytokines and other factors directing the
differentiation to a particular tissue type for example PDGF and
VEGF forming smooth muscle alpha cords. These could then be
introduce into a tissue with, for example, an insult to assist with
repair. Alternatively it may be desired after expansion to re
select cells on the basis of an early developmental marker, that
might be STRO-1.sup.bri to increase the proportion of MPCs in the
population.
[0043] It is found that an essentially pure population of MCPs is
not necessary to provide for formation of differentiated cells to
form desired tissue structures. The enriched population may have
levels of MCPs of greater than about 0.001, 0.01, 0.02, 0.05, 0.1,
0.2, 0.5 or 1% or higher as a proportion of total cell numbers in
the enriched population. This order of enrichment can be achieved
by the use of a single marker for selection of the enriched MCP
population. This is particularly so where the source tissue has an
inherently high level of perivascular MCPs. It is found that
considerably more 3G5 pos MCPs are present in certain tissue, for
example dental pulp, than in bone marrow. Thus in bone marrow 305
positive MPCs constitute about 15% of MPC based on STR1.sup.bri
colony forming cells, whereas in dental pulp that are found to
constitue 65% and greater than 90% in fat and akin tissues.
Expansion of the population and then re-enrichment using a single
marker coung result in higher leves of MPCs, perhaps levels greaer
than about 0.1, 0.5, 1, 2, 5 or 10%
[0044] Whilst it is considered desirable that a substantial
proportion and preferably a majority of precursor cells are
perivascular MPCs, it is not considered essential for certain forms
of the invention for perivascular MPCs to be the sole precursor
cell form. Other forms of precursors may also be present without
unduly interfering with the capacity of the perivascular MPCs to
undergo the desired differentiation. Such other forms may include
haemopoietic precursors or non-perivascular MPCs, perhaps being
negative for 3G5.
[0045] Certain forms of the present invention provide perivascular
MPCs substantially free of endothelial cells. In that context
substantially free might be considered to be less than about 5, 2,
1, or 0.1% endothelial cells. Alternatively the context might be an
assessment that the enriched population is von Willebrand Factor
negative.
[0046] It will be understood that recognition of cells carrying the
cell surface markers that form the basis of the separation can be
effected by a number of different methods, however, all of these
methods rely upon binding a binding agent to the marker concerned
followed by a separation of those that exhibit binding, being
either high level binding, or low level binding or no binding. The
most convenient binding agents are antibodies or antibody based
molecules, preferably being monoclonal antibodies or based on
monoclonal antibodies because of the specificity of these latter
agents. Antibodies can be used for both steps, however other agents
might also be used, thus ligands for these markers may also be
employed to enrich for cells carrying them, or lacking them.
[0047] The antibodies may be attached to a solid support to allow
for a crude separation. The separation techniques should maximise
the retention of viability of the fraction to be collected. Various
techniques of different efficacy may be employed to obtain
relatively crude separations. The particular technique employed
will depend upon efficiency of separation, associated cytotoxicity,
ease and speed of performance, and necessity for sophisticated
equipment and/or technical skill. Procedures for separation may
include, but are not limited to, magnetic separation, using
antibody-coated magnetic beads, affinity chromatography and
"panning" with antibody attached to a solid matrix. Techniques
providing accurate separation include but are not limited to
FACS.
[0048] It is in the context of these methods that a cell be either
negative or positive. The positive cells may either be low (lo) or
a hi (bright) expresser depending on the degree to which the marker
is present on the cell surface, the terms relate to intensity of
fluoresence or other color used in the color sorting process of the
cells. The distinction of to and bri will be understood in the
context of the marker used on a particular cell population being
sorted.
[0049] The method of enriching for perivascular MPCs might include
the step of making a first partially enriched pool of cells by
enriching for the expression of a first of the markers, and then
the step of enriching for expression of the second of the markers
from the partially enriched pool of cells.
[0050] It is preferred that the method comprises a first step being
a solid phase sorting step, based on recognition of one or more of
the markers. The solid phase sorting step of the illustrated
embodiment utilises MACS recognising high level expression of
STRO-1. This then gives an enriched pool with greater numbers of
cells than if a high accuracy sort was used as a first step. If for
example FACS is used first, many of the precursor cells are
rejected because of their association with other cells. A second
sorting step can then follow using an accurate separation method.
This second sorting step might involve the use of two or more
markers. Thus in the illustrated embodiment two colour FACS is used
to recognise high level expression of the antigen recognised by
STRO-1 as wells as the expression of CD146. The windows used for
sorting in the second step can be more advantageously adjusted
because the starting population is already partially enriched.
[0051] The method of enriching for perivascular MPCs might also
include the harvesting of a source of the stem cells before the
first enrichment step using known techniques. Thus the tissue will
be surgically removed. Cells comprising the source tissue will then
be seprated into a so called single cells suspension. This
separation may be achieved by physical and or enzymic means.
[0052] The preferred source of such perivascular MPCs is human,
however, it is expected that the invention is also applicable to
animals, and these might include agricultural animals such as cows,
sheep, pigs and the like, domestic animals such as dogs, laboratory
animals such as mice, rats, hamsters, and rabbits or animals that
might be used for sport such as horses.
[0053] In a further form the invention might be said to reside a
method of generation tissue in a mammal comprising the step of
enriching a population of precursor cells as in the first aspect of
the invention, and introducing the enriched population into the
mammal, and allowing the enriched population to generate the tissue
in the mammal.
[0054] Another potential use for enriched cells of the present
invention is as a means of gene therapy, by the introduction of
exogenous nucleic acids for expression of therapeutic substances in
the tissue types concerned.
[0055] In the context of the present invention the term isolated
cell may mean that perivascular MPCs comprise at least 30, 40, 50,
60, 70, 80, or 95% of total cells of the population in which they
are present.
Example 1
Isolation and Expansion of Precursor Cells
[0056] Stem cell niches identified in a number of different adult
tissues including skin, hair follicles, bone marrow, intestine,
brain, pancreas and more recently dental pulp, are often highly
vascularized sites..sup.(1) The maintenance and regulation of
normally quiescent stem cell populations is tightly controlled by
the local microenvironment according to the requirements of the
host tissue..sup.(2,3) Both the supportive connective tissues of
bone marrow and dental pulp contain stromal stem cell populations
with high proliferative potentials capable of regenerating their
respective microenvironments with remarkable fidelity, including
the surrounding mineralized structures of bone and
dentin..sup.(4,5) In the postnatal organism, bone marrow stroma
exists as a loosely woven, highly vascularized tissue that supports
and regulates hematopoiesis..sup.(6-8) At a time when many tissues
have lost or decreased their ability to regenerate, adult bone
marrow retains a capacity for continuous renewal of haematopoietic
parenchymal tissue and is responsible for remodeling the adjoining
bone surfaces..sup.(9,10) In contrast, the inner pulp chamber of
teeth is comprised of a non-hematopoietic, compact fibrous tissue,
infiltrated by a microvascular network, that is entombed by
mineralized dentin..sup.(11-13) Following tooth maturation, dental
pulp becomes relatively static, acting only in a reparative
capacity in response to a compromised dentin matrix caused by
insults such as caries or mechanical trauma.
[0057] Precursors of functional osteoblasts (BMSSCs: bone marrow
stromal stem cells) and odontoblasts (DPSCs: dental pulp stem
cells), both forms of MPCs identified by their source tissue, were
initially identified by their capacity to form clonogenic cell
clusters in vitro, a common feature amongst different stem cell
populations..sup.(4,14-18) The progeny of ex vivo expanded BMSSCs
and DPSCs share a similar gene expression profile for a variety of
transcriptional regulators, extracellular matrix proteins, growth
factors/receptors, cell adhesion molecules, and some, but not all
lineage markers characteristic of fibroblasts, endothelial cells,
smooth muscle cells and osteoblasts..sup.(4,19) However, previous
studies have documented that individual BMSSC colonies demonstrate
marked differences in their proliferation rates in vitro and
developmental potentials in vivo..sup.(5,14,20) Similar to these
findings, we have recently observed comparable levels of
heterogeneity in the growth and developmental capacity of different
DPSC colonies..sup.(21) Together, these studies infer a
hierarchical arrangement of stromal precursor cells residing in
bone marrow and dental pulp, headed by a minor population of highly
proliferative pluri-potential stem cells that give rise to
committed bi- and uni-potential progenitor cell
populations..sup.(22)
[0058] Despite our extensive knowledge about the properties of
cultured BMSSCs and DPSCs, we still do not know if their in vitro
characteristics are an accurate portrait of their true gene
expression patterns and developmental potentials in situ. In
addition, it is not formally known if all of the colony-forming
cells within each tissue are derived from one pluri-potent stem
cell pool or whether they arise from committed progenitors
belonging to distinct lineages. There is also a lack of information
regarding the precise anatomical location of BMSSCs and DPSCs in
their respective tissues. This is mainly attributed to the rarity
of stem cells and the absence of specific markers that identify
different developmental stages during osteogenesis and
odontogenesis, particularly for primitive subpopulations. It has
previously been hypothesized that one possible niche for precursors
of osteoblasts and odontoblasts may be the microvasculature
networks of bone marrow and dental pulp,
respectively..sup.(23,24)
Materials and Methods
Tissue Samples
[0059] Iliac crest-derived bone marrow mononuclear cells (BMMNCs),
from normal human adult volunteers were obtained under guidelines
set by the Royal Adealaide Hospital Human Ethics Committee. Normal
human impacted third molars were collected from young adults the
University of Adelaide Dental Clinic Research under approved
guidelines set by the University of Adelaide Human Ethics
Committee, respectively. Discarded full thickness skin and
peripheral adipose tissue were obtained from routine plastic
surgery procedures from the Skin Cell Engineering Laboratory, under
the guidelines set by the Royal Adelaide Hospital Human Ethics
Committee. The pulp tissue was separated from the crown and root as
previously described..sup.(4) Single cell suspensions of dental
pulp, skin and adipose tissue were prepared by enzymatic digestion
in a solution of 3 mg/ml collagenase type I (Worthington Biochem,
Freehold, N.J.) and 4 mg/ml dispase (Boehringer Mannheim, GMBH,
Germany) for one to three hours at 37.degree. C. Single cell
suspensions were obtained by passing the cells through a 70 .mu.m
strainer (Falcon, BD Labware, Franklin Lakes, N.J.). Cell (0.01 to
1.times.10.sup.5/well) preparations of bone marrow, dental pulp,
skin and adipose were then used for either, immunolselection, RNA
extraction, or direct culture in 6-well plates (Costar, Cambridge,
Mass.) as described below.
[0060] Other human tissue specimens (Brain, liver, heart, kidney,
lung, spleen, thymus, lymph node, pancreas, skin) were obtained
from autopsies carried out at the Royal Adelaide Hospital during
routine pathological examinations under approved guidelines set by
the Royal Adelaide Hospital Human Ethics Committee. Small specimens
approximately 0.5 cm.sup.2 of each tissue type were placed into
Tissue-Tek II cryomoulds 25 mm.times.20 mm.times.5 mm (Miles
Laboratories; Naperville, Ill.) and embedded with O.C.T. compound
medium (Miles Laboratories) by immersion into a 150 ml to 200 ml
pyrex glass beaker of iso-pentane (BDH Chemicals, Poole, England)
pre-cooled by suspending a glass beaker into a bath of liquid
nitrogen. The isopentane has cooled when the bottom of the glass is
white. The frozen sections were immediately stored at -30.degree.
C. Frozen sections of nerve and muscle tissue were obtained from
the Histopathology Department of the I.M.V.S., South Australia and
sections of foreskin were obtained from the Immunology Department
of the I.M.V.S., South Australia. Sections of formalin fixed,
paraffin embedded human foetal limb (52 days) were kindly provided
by Dr. T. J. Khong from the Department of Histopathology, Women's
and Children's Hospital, Adelaide, South Australia.
Colony Efficiency Assay and Culture
[0061] Single cell suspensions were plated at low plating densities
(between 1,000 and 10,000 cells per well, as triplicates in six
well plates) to assess colony-forming efficiency of different
immunoselected cell fractions. The cells were cultured in
alpha-Modification of Eagle's Medium supplemented with 20% foetal
calf serum, 2 mM L-Glutamine, 100 .mu.M L-ascorbate-2-phosphate,
100 U/ml penicillin and 100 .mu.g/ml streptomycin at 37.degree. C.
in 5% CO.sub.2. Day 14 cultures were fixed with 4% formalin, and
then stained with 0.1% toluidine blue. Aggregates of equal to or
greater than fifty cells were scored as clonogenic colonies
equivalent to colony forming units-fibroblastic (CFU-F).
Magnetic-Activated Cell Sorting (MACS)
[0062] This procedure is a modification of that described
elsewhere..sup.(25) Briefly, approximately 1.times.10.sup.8 BMMNCs
were incubated with STRO-1bri supernatant (murine anti-human
BMSSCs, IgM).sup.(29) (1/2) for 1 hour on ice. The cells were then
washed with PBS/5% FBS and resuspended in a 1/50 dilution of
biotinylated goat anti-mouse IgM (.mu.-chain specific; Caltag
Laboratories, Burlingame, Calif.) for 45 minutes on ice. After
washing, the cells were incubated with streptavidin microbeads
(Miltenyi Biotec, Bergisch Gladbach, F. R. G.) for 15 minutes on
ice, then separated on a Mini MACS magnetic column (Miltenyi
Biotec) according to the manufacturers recommendations.
Fluorescence Activated Cell Sorting (FACS)
[0063] STRO-1bri MACS isolated cells were incubated with a
streptavidin-FITC conjugate ( 1/50; CALTAG Laboratories) for 20
minutes on ice then washed with PBS/5% FBS. Single-color
fluorescence activated cell sorting (FACS) was performed using a
FACStar.sup.PLUS flow cytometer (Becton Dickinson, Sunnyvale,
Calif.). Dual color-FACS analysis was achieved by incubating
MACS-isolated STRO-1.sup.bri BMMNCs with saturating (1:1) levels of
CC9 antibody supernatant (mouse anti-human CD146/MUC-18/Mel-CAM,
IgG.sub.2as Dr. Stan Gronthos) for one hour on ice. After washing
with PBS/5% FBS, the cells were incubated with a second label goat
anti-mouse IgG.sub.2a (.gamma.-chain specific) phycoerythrin (PE)
conjugate antibody ( 1/50, CALTAG Laboratories) for 20 minutes on
ice. The cells were then sorted using the automated cell deposition
unit (ACDU) of a FACStar.sup.PLUS flow cytometer. Limiting dilution
assay: seeded 1, 2, 3 4, 5, & 10 cells per well, 24 replicates,
cultured in serum-deprived medium for 10 days as previously
described.sup.(26). Similarly, freshly prepared unfractionated
BMMNCs were incubated with CC9 (IgG.sub.2a) and 3G5 (IgM)
antibodies or isotype-matched negative control antibodies for one
hour on ice. After washing with PBS/5% FBS, the cells were
incubated with a second label goat anti-mouse IgG.sub.2a
(.gamma.-chain specific) phycoerythrin (PE) and IgM ( 1/50; CALTAG
Laboratories) conjugated antibodies for 30 minutes on ice. Cells
were washed in PBS/%5 FBS prior to being analysed using a
FACStar.sup.PLUS flow cytometer. Positive reactivity for each
antibody was defined as the level of fluorescence greater than 99%
of the isotype matched control antibodies.
Flow Cytometric Analysis
[0064] Single cell suspensions of ex vivo expanded bone marrow MPC
were prepared by trypsin/EDTA treatment then incubated with neat
STRO-1 supernatant or antibodies identifying different cell
lineage-associated markers (10 .mu.g/ml) for one hour on ice. The
cells were then washed in PBS/5% FBS then incubated either with a
goat anti-murine IgM-phycoerythrin (1/50, SouthernBiotechnologies),
goat anti-murine or anti-rabbit IgG-phycoerythrin (Caltag
Laboratories). For those antibodies identifying intracellular
antigens, cell preparations were permeanbilize the cellular
membrane prior to staining for intracellular markers. Isotype
matched control antibodies were treated under identical conditions.
Flow cytometric analysis was performed using a COULTER EPICS
instrument. The dot plots represent 5,000 listmode events
indicating the level of fluorescence intensity for each lineage
cell marker with reference to the isotype matched negative control
antibodies.
Immunhistochemistry
[0065] Human tissue sections (.mu.n) were de-waxed in xylene and
rehydrated through graded ethanol into PBS. Frozen tissue sections
(.mu.m) and cytospin preparations were fixed with cold acetone at
-20.degree. C. for 15 minutes then washed in PBS. The samples were
subsequently treated with PBS containing 1.5% of hydrogen peroxide
for 30 minutes, washed then blocked with 5% non-immune goat serum
for 1 hour at room temperature. Samples were incubated with primary
antibodies for 1 hour at room temperature. Antibodies used: Mouse
(IgG.sub.1 & IgC.sub.2a) controls (Caltag, Burlingame, Calif.);
Rabbit (Ig) control, 1A4 (anti-.alpha. smooth muscle actin,
IgG.sub.1), 2F11 (anti-neurofilament, IgG.sub.1), F8/86 (murine
anti-von Willebrand Factor, IgG.sub.1) (Dako, Carpinteria, Calif.);
STRO-1; CC9 (anti-CD146); LF-151 (rabbit anti-human
dentinsialoprotein; Dr. L. Fisher, NIDCR/NIH, MD). Working
dilutions: rabbit serum ( 1/500), monoclonal supernatants (1/2) and
purified antibodies (10 .mu.g/ml). Single staining was performed by
incubating the samples with the appropriate secondary antibody,
biotinylated goat anti-mouse IgM, IgG.sub.1, IgG.sub.2a or
biotinylated goat anti-rabbit for one hour at room temperature
(Caltag Laboratories). Avidin-Peroxidase-complex and substrate were
then added according to the manufacturer instructions (Vectastain
ABC Kit standard, Vector Laboratories). Samples were counterstained
with hematoxylin and mounted in aqueous media. Dual-fluorescence
labeling was achieved by adding the secondary antibodies, goat
anti-mouse IgM-Texas Red
and IgG-FITC (CALTAG Laboratories), for 45 minutes at room
temperature. After washing the samples were mounted in VECTASHIELD
fluorescence mountant.
Immunomagnetic Bead Selection
[0066] Single cell suspensions of dental pulp tissue were incubated
with antibodies reactive to STRO-1 (1/2), CD146 (1/2), or 3G5 (1/2)
for 1 hour on ice. The cells were washed twice with PBS/1% BSA then
incubated with either sheep anti-mouse IgG-conjugated or rat
anti-mouse IgM-conjugated magnetic Dynabeads (4 beads per cell:
Dynal, Oslo, Norway) for 40 minutes on a rotary mixer at 4.degree.
C. Cells binding to beads were removed using the MPC-1 magnetic
particle concentrator (Dynal) following the manufactures
recommended protocol.
Matrigel-Arteriole Assay
[0067] Single cell suspensions of ex vivo expanded bone marrow
STRO-1.sup.bright MPC were prepared by trypsin/EDTA treatment then
plated into 48-well plates containing 200 .mu.l of matrigel. The
STRO-1.sup.bright MPC were plated at 20,000 cells per well in
serum-free medium (Gronthos et al. 2003) supplemented with the
growth factors PDGF, EGF, VEGF at 10 ng/ml. Following 24 hours of
culture at 37.degree. C. in 5% CO.sub.2, the wells were washed then
fixed with 4% paraformaldehyde. Immunohistochemical studies were
subsequently performed for alpha-smooth muscle actin identified
with a goat-anti-murine IgG horse radish peroxidase
antibody/Vectastaining Kit as described above.
Osteogenic, Adipogenic and Chondrogenic Differentiation of MPC In
Vitro
[0068] Single cell suspensions of ex vivo expanded adipose-derived
MPC were cultured in .alpha.MEM supplemented with 10% FCS, 100
.mu.M L-ascorbate-2-phosphate, dexamethasone 10.sup.-7M and 3 mM
inorganic phosphate previously shown to induce bone marrow MPC to
form a mineralized bone matrix in vitro (Gronthos et al., 2003).
Mineral deposits were identified by positive von Kossa staining.
Adipogenesis was induced in the presence of 0.5 mM
methylisobutylmethylxanthine, 0.5 .mu.M hydrocortisone, and 60
.mu.M indomethacin as previously described (Gronthos et al. 2003).
Oil Red 0 staining was used to identify lipid-laden fat cells.
Chondrogenic differentiation was assessed in aggregate cultures
treated with 10 ng/ml TGF-.beta.3 as described (Pittenger et al.,
1999)
In Vivo Transplantation Studies
[0069] Approximately 5.0.times.10.sup.6 of ex vivo expanded cells
derived from either STRO-1.sup.bri/CD146.sup.+ BMSSCs or CD
146.sup.+ DPSCs were mixed with 40 mg of hydroxyapatite/tricalcium
phosphate (HA/TCP) ceramic powder (Zimmer Inc, Warsaw, Ind.) and
then transplanted subcutaneously into the dorsal surface of
10-week-old immunocompromised beige mice (NIH-bg-nu-xid, Harlan
Sprague Dawley, Indianapolis, Ind.) as previously
described..sup.(4) These procedures were performed in accordance to
specifications of an approved animal protocol (NIDCR #00-113).
Reverse Transcription Polymerase Chain Reaction.
[0070] Total RNA was prepared from STRO-1.sup.BRT/CD146.sup.+
sorted BMMNCs, and control cells (primary BMSSC cultures grown in
the presence of 10.sup.-7 M dexamethasone for three weeks) using
RNA STAT-60 (TEL-TEST Inc. Friendswood Tex.). First-strand cDNA
synthesis was performed with a first-strand cDNA synthesis kit
(GIBCO BRL, Life Technologies) using an oligo-dT primer. First
strand cDNA (2 .mu.l) was added to 46 .mu.l of a 1.times.PCR master
reaction mix (Roche Diagnostics, Gmbh Mannheim Germany) and 10 pMol
of each human specific primer sets: CBFA1 (632 bp, and three
smaller alternative splice variants).sup.(27) sense
5'-CTATGGAGAGGACGCCACGCCTGG-3' [SEQ ID NO. 1], antisense,
5'-CATAGCCATCGTAGCCTTGTCCT-3' [SEQ ID NO. 2]; osteocalcin (310
bp).sup.(4) sense, 5'-CATGAGAGCCCTCACA-3' [SEQ ID NO. 3],
antisence, 5'-AGAGCGACACCCTAGAC-3' [SEQ ID NO. 4]; GAPDH (800
bp).sup.(4) sense, 5'-AGCCGCATCTTCTTTTGCGTC-3' [SEQ ID NO. 5];
antisense 5'-TCATATTTGGCAGGTTTTTCT-3' [SEQ ID NO. 6]. The reactions
were incubated in a PCR Express Hybaid thermal cycler (Hybaid,
Franklin, Mass.) at 95.degree. C. for 2 minutes for 1 cycle then
94.degree. C./(30 sec), 60.degree. C./(30 sec), 72.degree. C./(45
sec) for 35 cycles, with a final 7 minute extension at 72.degree.
C. Following amplification, each reaction was analyzed by 1.5%
agarose gel electrophoresis, and visualized by ethidium bromide
staining.
RESULTS
[0071] BMSSCs and DPSCs express vascular associated antigens STRO-1
and CD146 in vivo. We have previously demonstrated the efficacy of
magnetic activated cell sorting (MACS), to isolate and enrich for
all detectable clonogenic colonies from aspirates of human marrow,
based on their high expression of STRO-1 antigen..sup.(25,26) To
further characterize BMSSCs we incubated the STRO-1.sup.bri MACS
isolated cells with another monoclonal antibody, CC9,.sup.(28) that
recognizes the cell surface antigen CD146, also known as MUC-18,
Mel-CAM and Sendo-1, that is present on endothelial and smooth
muscle cells. These studies determined that CC9, selectively bound
the STRO-1 bright expressing fraction (STRO-1.sup.BRT) from the
total STRO-1.sup.+ population by dual-color FACS analysis (FIG.
1A). Cloning efficiency assays using Poisson distribution
statistics, yielded a marked increase in the incidence of BMSSCs (1
colony per 5 STRO-1.sup.BRT/CD146.sup.+ cells plated), and achieved
a 2.times.10.sup.3 fold enrichment of the clonogenic colony
population when compared to unfractionated marrow (FIG. 1B). No
colony formation could be detected in STRO-1.sup.BRT/CD146.sup.-
cell fraction (data not shown).
[0072] The light scatter properties of STRO-1.sup.BRT/CD146.sup.+
marrow cells were typically larger and more granular than the
nucleated erythroid cells and B-lymphocytes comprising the bulk of
the STRO-1.sup.+ population.sup.(29) (FIG. 1C-E). Cytospin
preparations of STRO-1.sup.BRT/CD146.sup.+ sorted cells were found
to be negative for the erythroid (glycophorin-A) and leukocyte
(CD45) associated markers (data not shown). Confirmation that
BMSSCs represented an early osteogenic precursor population was
obtained by RT-PCR analysis of highly purified MACS/FACS-isolated
STRO-1.sup.BRT/CD146.sup.+ cells, which failed to detect the early
and late osteogenic, markers CBFA1 and osteocalcin, respectively
(FIG. 1F). However, the progeny of STRO-1.sup.BRT/CD146.sup.+
sorted BMSSCs were found to express both CBFA1 and osteocalcin,
following ex vivo expansion. Immunolocalization studies
demonstrated that the CD146 antigen was predominantly expressed on
blood vessel walls in sections of human bone marrow (FIG. 1G).
Localization of both STRO-1 and CD146 was confined to large blood
vessels in frozen sections of human bone marrow trephine (FIG.
1H).
[0073] Immunoselection protocols were subsequently used to
determine if human DPSCs also expressed STRO-1 and CD146 in situ.
The use of either MACS or FACS analysis to isolate DPSCs was
restrictive due to the rarity of these cells (1 colony-forming cell
per 2.times.10.sup.5 cells plated) compounded by the limited number
of pulp cells (approximately 10.sup.5 cells per pulp sample)
obtained following processing. To circumvent this, we pooled
several pulp tissues obtained from 3 to 4 different third molars
per experiment and employed immunomagnetic bead selection on single
cell suspensions of pulp tissue, based on their expression of
either the STRO-1 or CD146 antigens. The STRO-1.sup.+ fraction
represented approximately 6% of the total pulp cell population.
Comparative studies demonstrated that growth rates of individual
colonies were unperturbed in the presence of magnetic beads (data
not shown). Colony efficiency assays indicated that the majority of
dental pulp derived colony-forming cells (82%) were represented in
the minor, STRO-1.sup.+ cell fraction analogous to BMSSCs (FIG. 2).
The mean incidence of DPSCs in the STRO-1 positive fraction (329
colony-forming cells per 10.sup.5 cells plated.+-.56 SE, n=3) was
six-fold greater than unfractionated pulp cells (55 colony-forming
cells per 10.sup.5 cells plated.+-.14 SE, n=3). Using a similar
strategy, different fractions of human dental pulp cells were
selected based on their reactivity with the antibody, CC9. Colony
efficiency assays showed that a high proportion (96%) of dental
pulp-derived clonogenic colonies were also present in the
CD146.sup.+ population, using immunomagnetic Dynal bead selection
(FIG. 2). The mean incidence of clonogenic colonies in the
CD146.sup.+ fraction (296 colony-forming cells per 10.sup.5 cells
plated.+-.37 SE, n=3) was seven-fold greater than unfractionated
pulp cells (42 colony-forming cells per 10.sup.5 cells plated.+-.9
SE, n=3).
[0074] Immunolocalization studies showed that STRO-1 expression was
restricted to blood vessel walls and perineurium surrounding the
nerve bundles, but was not present in the mature odontoblast layer
or fibrous tissue, in frozen sections of human dental pulp tissue
(FIG. 3A-B). Furthermore, co-localization of CD146 with STRO-1 was
detected on the outer blood vessel cell walls, with no reactivity
to the surrounding fibrous tissue, odontoblast layer, and the
perineurium of the nerve (FIG. 3C-D). Importantly, expression of
human odontoblast-specific differentiation marker,
dentinsialoprotein (DSP), was restricted to the outer pulpal layer
containing mature odontoblasts (FIG. 3E) and was absent in fibrous
tissue, nerve bundles and blood vessels.
Differential Expression of the Perivascular Marker 3G5 by BMSSCs
and DPSCs.
[0075] In the present study, flow cytometric analysis revealed that
the cell surface antigen, 3G5, was highly expressed by a large
proportion (54%) of hematopoietic marrow cells (FIG. 4A). This
observation eliminated 3G5 as a candidate marker for isolating
purified populations of BMSSCs directly from aspirates of human
marrow. In addition, dual-FACS analysis based on 3G5 and STRO-1
expression was not possible since both antibodies shared the same
isotype. Nevertheless, in vitro colony efficiency assays for
different 3G5/CD146 FACS sorted subfractions demonstrated that only
a minor proportion (14%) of bone marrow clonogenic colonies
expressed the 3G5 antigen at low levels (FIG. 4B). Conversely, a
larger proportion (63%) of clonogenic DPSCs (192 colony-forming
cells per 10.sup.5 cells plated.+-.18.4 SE n=3) were present in the
3G5.sup.+ cell fraction following immunomagnetic bead selection
(FIG. 2). 3G5 demonstrated specific reactivity to pericytes in
frozen sections of human dental pulp tissue (FIG. 3F).
[0076] We next analyzed the expression of more specific markers of
endothelial cells (von Willebrand Factor) and smooth muscle
cells/pericytes (.alpha.-smooth muscle actin) on cytospin
preparations using freshly isolated STRO-1.sup.BRT/CD146.sup.+
BMSSCs and CD146.sup.+ expressing DPSCs. A large proportion of
purified BMSSCs (67%), were found to be positive for .alpha.-smooth
muscle actin (FIG. 5A), but lacked expression of von Willebrand
Factor (FIG. 5B). Similarly, the majority of isolated DPSCs (85%)
were also found to express .alpha.-smooth muscle actin, but not von
Willebrand Factor (FIG. 5C, 5D). Purified populations of
STRO-1.sup.BRT/CD146.sup.+ BMSSCs and CD146.sup.+ DPSCs were
subsequently expanded in vitro then transplanted into
immunocompromised mice to assess their developmental potentials in
vivo. The progeny of cultured BMSSCs and DPSCs displayed distinct
capacities, capable of regenerating the bone marrow and dental/pulp
microenvironments, respectively (FIG. 5E, F), and appeared
identical to the developmental potential of non-selected
multi-colony derived BMSSCs and DPSCs (4).
DISCUSSION
[0077] The present study provides direct evidence that two
mesenchymal stem cell populations, distinct in their ontogeny and
developmental potentials, are both associated with the
microvasculature of their respective tissues.
[0078] We employed different Immunoselection protocols to
demonstrate that BMSSCs and DPSCs could be efficiently retrieved
from bone marrow aspirates and enzyme digested pulp tissue
respectively, based primarily on their high expression of the
STRO-1 antigen. This cell surface antigen is present on precursors
of various stromal cell types including, marrow fibroblasts,
osteoblasts, chondrocytes, adipocytes, and smooth muscle cells
isolated from human adult and fetal bone marrow..sup.(29,32-34)
Previous studies have implicated STRO-1 as a marker of
pre-osteogenic populations, where its expression is progressively
lost following cell proliferation and differentiation into mature
osteoblasts in vitro..sup.(27,35,36) The STRO-1 antigen was also
found to be present on the outer cell walls of human bone marrow
and dental pulp blood vessels, in accord with previous studies that
localized STRO-1 on large blood vessels, but not capillaries, in
different adult tissues such as brain, gut, heart, kidney, liver,
lung, lymphnode, muscle, thymus..sup.(6) Therefore, STRO-1 appears
to be an early marker of different mesenchymal stem cell
populations and infers a possible perivascular niche for these stem
cell populations in situ.
[0079] To determine if BMSSCs and DPSCs were associated directly
with blood vessels we utilized another antibody (CC9),.sup.(28)
which recognizes the immunoglobulin super family member, CD146
(MUC-18/Mel-CAM), known to be present on smooth muscle,
endothelium, myofibroblasts and Schwann cells in situ, as well as
being a marker for some human neoplasms..sup.(37) Notably, CD146 is
not expressed by bone marrow hematopoietic stem cells, nor their
progenitors. While the precise function of CD146 is not known, it
has been linked to various cellular processes including cell
adhesion, cytoskeletal reorganization, cell shape, migration and
proliferation through transmembrane signaling.
[0080] In order to dissect the BMSSC population, STRO-1.sup.BRT
expressing marrow cells were further distinguished from
STRO-1.sup.+ hematopoietic cells (predominantly glycophorin-A.sup.+
nucleated erythrocytes) based on their expression of CD146, using
dual-FACS analysis. Purified STRO-1.sup.BRT/CD146.sup.+ human
BMSSCs displayed light scatter properties characteristic of large
granular cells. Our study supports the findings of Van Vlasselaer
and colleagues (1994).sup.(38) who isolated partially purified
BMSSCs from murine bone marrow following 5-fluoracil (5-FU)
treatment, and identified this population as having high
perpendicular and forward light scatter characteristics.
Interestingly, freshly isolated 5-FU resistant murine BMSSCs were
also found to be positive for two perivascular markers Sab-1 and
Sab-2..sup.(38) Conversely, more recent studies have shown that
when BMSSCs are cultivated in vitro, the most primitive populations
display low perpendicular and forward light scatter
properties.sup.(39) and therefore may not reflect the true
morphology of BMSSC in situ. In the present study,
STRO-1.sup.BRT/CD146.sup.+ sorted human BMSSCs lacked the
expression of CBFA1 and osteocalcin that identify committed early
and late osteogenic populations, respectively,.sup.(40,41)
indicating that BMSSCs exhibit a pre-osteogenic phenotype in human
bone marrow aspirates. We found that a high proportion of freshly
isolated STRO-1.sup.BRT/CD146.sup.+ BMSSCs expressed .alpha.-smooth
muscle actin, but not the endothelial specific marker von
Willebrand Factor, providing direct evidence that this primitive
precursor population displays a characteristic perivascular
phenotype.
[0081] The present study also demonstrated the efficacy of using
magnetic bead selection to isolate and enrich for DPSCs directly
from human dental pulp tissue based on their expression of either
STRO-1 or CD146. Immunolocalization of CD146 appeared to be
specific to the microvasculature within dental pup. Co-localization
of both STRO-1 and CD146 on the outer walls of large blood vessel
in dental pulp tissue, implied that the majority of DPSCs arise
from the microvasculature. However, since the STRO-1 antibody also
reacted with the perineurium in dental pulp and peripheral nerve
bundles (unpublished observations), further investigation is
required to determine the role of this antigen in neural cell
development.
[0082] Analogous to BMSSCs, freshly isolated CD146.sup.+ DPSCs were
found to express .alpha.-smooth muscle actin but not von Willebrand
Factor. DPSCs were also shown to be an immature pre-odontogenic
population both by their location distal from the dentin forming
surface and by their lack of expression of the human
odontoblast-specific dentin sialoprotein (DSP), which is restricted
to the outer pulpal layer containing differentiated odontoblasts.
We have previously described that ex vivo expanded human DPSCs do
not express the precursor molecule, dentinsialophosphoprotein
(DSPP), in vitro when cultured under non-inductive
conditions..sup.(4) Similar studies have shown that DSPP mRNA was
highly expressed in freshly isolated odontoblast/pulp tissue, but
was not detect in cultured dental papilla cells derived from rat
incisors..sup.(43,44) It is only when DPSCs are induced, either in
vitro,.sup.(45) or by in vivo transplantation to form an ordered
dentin matrix that DSPP is expressed..sup.(4)
[0083] In vitro studies of ex viva expanded BMSSCs and DPSCs
supported the notion that their progeny were morphologically
similar to cultured perivascular cells having a bi-polar
fibroblastic, stellar or flat morphology, rather than a polygonal
endothelial-like appearance. In addition, we have previously shown
that the progeny of BMSSC- and DPSC-derived colonies exhibit
heterogeneous staining for both CD146 and .alpha.-smooth muscle
actin, but lack expression of the endothelial markers, CD34 and von
Willebrand Factor, in vitro..sup.(4)
[0084] The observations that two different mesenchymal stem cell
populations such as BMSSCs and DPSCs harbour in perivascular niches
may have further implications for identifying stem cell populations
in other adult tissues. Recent findings have identified human
"reserve" multi-potent mesenchymal stem cells in connective tissues
of skeletal muscle, and dermis derived from human fetal and adult
samples..sup.(56) However the exact location, developmental
potential and ontogeny of these stem cells is still largely
unknown. In the present study, identification of mesenchymal stem
cell niches in bone marrow and dentin pulp may help elucidate the
fundamental conditions necessary to selectively maintain and expand
primitive multi-potential populations in vitro, in order to direct
their developmental potentials in vivo.
Example 2
Adult Human Bone Marrow MPC are Distinct from Stromal Precursor
Cells, Haematopoietic Stem Cells and Angioblasts by their High
Expression of the STRO-1 Antigen and Lack of CD34 Expression
[0085] Postnatal bone marrow appears to be a hub of residential
stem and precursor cell types responsible for blood cell formation
(haematopoietic stem cells), endothelial development (angioblast),
and connective tissue/stromal differentiation (stromal precursor
cells/bone marrow stromal stem cells/mesenchymal stem cells).
Recent work by our group (Gronthos et al. 2003; Shi and Gronthos
2003) has, for the first time, purified and characterised human
multipotential bone marrow mesenchymal precursor cells (MPC) based
on their high expression of the STRO-1 antigen and by their
co-expression of the immunoglobulin superfamily members, VCAM-1
(CD106) and MUC-18 (CD146). Early studies by Simmons and
Torok-Storb (1991a and b), have shown that bone marrow-derived
STRO-1.sup.+ stromal precursor cells, with the capacity to form
adherent colonies in vitro, also expressed the haematopoietic stem
cell marker, CD34, albeit at low levels. These studies used CD34
antibody-complement mediated cell lysis to eliminate a high
proportion of adherent colony-forming cells in marrow aspirates
(Simmons and Torok-Storb 1991b). It is important to note that while
the STRO-1 antibody was generated following immunisation of mice
with human CD34.sup.+ bone marrow cells, this may have arisen due
to the fact that the STRO-1 antigen is also expressed at moderate
to low levels on CD34.sup.+/Glycophorin-A.sup.+ nucleated red cells
and CD34.sup.+/CD20.sup.+ B-lymphocytes. We now offer direct
evidence, using sophisticated fluorescence activated cell sorting
technology that multipotential adult human bone marrow MPC express
high levels of STRO-1, but lack expression to the stromal precursor
cell, haematopoietic stem cell and angioblast maker (CD34), the
leukocyte antigen (CD45), and the nucleated red cell marker
(Glycophorin-A) (FIG. 6A-C). These data demonstrate that adult
human bone marrow-derived MPC are a novel stem cell population,
distinct from more mature stromal precursor cells, haematopoietic
stem cells and angioblast (FIG. 7).
[0086] Unless otherwise indicated the materials and methods of this
example are the same as those for Example 1.
[0087] FIG. 6. Expression of CD34, CD45 and Glycophorin-A on STRO-1
positive bone marrow mononuclear cells. Representative histograms
depicting typical dual-colour flow cytometric analysis profiles of
STRO-1 positive bone marrow mononuclear cells isolated initially by
magnetic activated sorting and co-stained with antibodies directed
against CD34 (A), CD45 (B) or Glycophorin-A (C). The STRO-1
antibody was identified using a goat anti-murine IgM-fluorescein
isothiocyanate while CD34, CD45 and Glycophorin-A were identified
using a goat anti-murine IgG-phycoerythrin. The high expressing
STRO-1 fraction which contained the clonogenic MPC population was
isolated by fluorescence activated cell sorting based on regions R1
and R2.
[0088] FIG. 7. Bone marrow MPC are STRO-1 bright, CD34 negative,
CD45 negative and Glycophorin-A negative. The graph depicts the
results of in vitro adherent colony formation assays performed for
each of the different sorted STRO-1 bright populations selected by
their co-expression or lack of either the CD34, CD45 or
Gycophorin-A antigens, based on regions R1 and R2 as indicated in
FIG. 6. These data are expressed as the mean incidence of
colony-forming units for each cell fraction averaged from two
separate experiments.
Example 3
Identification of Multipotential MPC in Different Human Tissues
[0089] While the existence and precise location of MPC in different
tissues is largely unknown, we have recently demonstrated that MPC
appear to reside in a perivascular niche in human bone marrow and
dental pulp tissues (Shi and Gronthos 2003). These observations
were based on a combination of immunohistochemical and
immunoselection methods to identify and isolate different MPC
populations based on their expression of the mesenchymal stem cell
marker, STRO-1, the smooth muscle and pericyte markers, CD146,
alpha-smooth muscle actin and the pericyte specific marker, 3G5. We
have now extended these studies demonstrating the co-localization
of STRO-1/CD146, STRO-1/alpha-smooth muscle actin, and 3G5/CD146
antigens in a wider variety of tissues including heart, liver,
kidney, skin, spleen, pancreas, lymph node (FIG. 8).
[0090] To confirm our earlier findings that MPC can be derived from
non-bone marrow tissue such as dental pulp, we used fluorescence
activated cell sorting to isolate different MPC populations from
adult human peripheral adipose. Single cell suspensions were
obtained following digestion of the adipose tissue with collagenase
and dispase as previously described (Shi and Gronthos 2003). The
adipose-derived cells were then incubated with antibodies reactive
against STRO-1, CD146 and 3G5. Cell populations were then selected
by FACS, based on their positivity (region R3) or negativity
(region R2) to each marker and then plated into regular growth
medium (Shi and Gronthos 2003) to assess the incidence of adherent
colony-forming cells in each cell fraction (FIG. 9). Following 12
days of culture, colonies (aggregates of 50 cells or more) were
scored and displayed as the number of colonies per 10.sup.5 cells
plated for each cell fraction. Our data demonstrated that MPC can
be derived from adipose tissues based on their expression of
STRO-1/3G5/CD146 antigens (FIG. 10). Dual colour flow cytometric
analysis confirmed that only a minor proportion of adipose-derived
cells co-expressed STRO-1/CD146 and 3G5/CD146 (FIG. 11). These
findings are consistent with our previous observations that MPC can
be isolated from both bone marrow and dental pulp tissue based on
the same set of perivascular markers (Shi and Gronthos 2003).
Furthermore, we provide evidence demonstrating that adipose derived
MPC isolated by CD146 selection have the capacity to differentiate
into different tissues such as bone, fat and cartilage (FIG. 12),
as previous described (Gronthos et al. 2003).
[0091] Recent findings examining the existence of MPC in unrelated
tissues such as skin has also been examined to further strengthen
our hypothesis. Single cell suspensions were obtained following
digestion of full thickness human skin with collagenase and dispase
as described above for human adipose tissue. The skin-derived cells
were then incubated with antibodies reactive against STRO-1, CD146
and 3G5 identified using either a goat anti-murine IgM or
IgG-phycoerythrin. Cell populations were then selected by FACS,
based on their positivity (region R3) or negativity (region R2) to
each marker and then plated into regular growth medium (Shi and
Gronthos 2003) to assess the incidence of adherent colony-forming
cells in each cell fraction (FIG. 13). Following 12 days of
culture, colonies (aggregates of 50 cells or more) were scored and
displayed as the number of colonies per 10.sup.5 cells plated for
each cell fraction. The data demonstrated that MPC can also be
derived from skin based on their expression of STRO-1/3G5/CD146
antigens (FIG. 10). Collectively these data suggest that
multipotential MPC can be identified and isolated in virtually all
vascularised tissues derived from postnatal human tissue based on a
common phenotype.
[0092] Unless otherwise indicated the materials and methods of this
example are the same as those for Example 1.
[0093] FIG. 8. Reactivity of perivascular makers in different human
tissues. Dual-colour immunofluorescence staining demonstrating
reactivity of (A) STRO-1 and CD146, (B) STRO-1 and alpha-smooth
muscle actin, and (C) 3G5 and CD146, on blood vessels and
connective tissue present on spleen, pancreas (Panel I), brain,
kidney (Panel II), liver, heart (Panel III) and skin (Panel IV)
20.times.. The STRO-1 and 3G5 antibodies were identified using a
goat anti-murine IgM-Texas Red while CD146 and alpha-smooth muscle
actin were identified using a goat anti-murine or IgG-fluorescein
isothiocyanate. Co-localization is indicated by overlaping areas of
yellow and orange fluorescence (white arrows).
[0094] FIG. 9. Isolation of adipose-derived MPC by FACS.
Representative flow cytometric histograms depicting the expression
of STRO-1, CD146 and 3G5 in fresh preparations of peripheral
adipose-derived single-cell suspensions generated following
collagenase/dispase digestion as previously described (Shi and
Gronthos 2003). The antibodies were identified using either a goat
anti-murine IgM or IgG-phycoerythrin. Cell populations were then
selected by FACS, based on their positivity (region R3) or
negativity (region R2) to each marker and then plated into regular
growth medium to assess the incidence of adherent colony-forming
cells in each cell fraction.
[0095] FIG. 10. Clonogenic adipose-derived MPC are positive for
STRO-1/3G5/CD146. The bar graph depicts the number of clonogenic
colonies retrieved from single cell suspensions of enzymatically
digested human peripheral adipose tissue, following fluorescence
activated cell sorting, based on their reactivity to antibodies
that recognize STRO-1, CD146, and 3G5 (FIG. 9), then cultured in
standard growth medium as previously described for bone marrow and
dental pulp tissue (Shi and Gronthos 2003). The data are expressed
as the number of colony-forming units obtained per 10.sup.5 cells
plated in the positive and negative cell fractions averaged from
two separate experiments.
[0096] FIG. 11. Immunophenotypic analysis of adipose-derived MPC.
Representative flow cytometric histograms depicting the
co-expression of STRO-1 and CD146 (A) and 3G5 and CD146 in fresh
preparations of peripheral adipose-derived single-cell suspensions
generated following collagenase/dispase digestion. The STRO-1 and
3G5 antibodies were identified using a goat anti-murine
IgM-phycoerythrin while CD146 was identified using a goat
anti-murine IgG-fluorescein isothiocyanate. Approximately 60% and
50% of the CD146 positive cells co-express STRO-1 and 3G5,
respectively. These data suggest that 10% or more of the CD164
positive cells co-express STRO-1 and 3G5.
[0097] FIG. 12. Developmental potential of purified
Adipocyte-derived MPC in vitro. Preparations of primary MPC
cultures derived from STRO-1.sup.+/CD146.sup.+ adipose cells were
re-cultured either in standard culture conditions (A), osteogenic
inductive medium (B), Adipogenic inductive medium (C) or
condrogenic conditions (D) as previously described Gronthos et al.
2003. Following two weeks of multi-differentiation induction, the
adipocyte-derived MPC demonstrated the capacity to form bone (B;
Alizarin positive mineral deposits), fat (C; Oil Red O positive
lipid) and cartilage (D: collagen type II matrix).
[0098] FIG. 13. Isolation of skin-derived MPC by FACS.
Representative flow cytometirc histograms depicting the expression
of STRO-1, CD146 and 3G5 in fresh preparations of full thickness
skin-derived single-cell suspensions generated following
collagenase/dispase digestion. The antibodies were identified using
either a goat anti-murine IgM or IgG-phycoerythrin-Cell populations
were then selected by FACS, based on their positivity (region R3)
or negativity (region R2) to each marker and then plated into
regular growth medium to assess the incidence of adherent
colony-forming cells in each cell fraction.
[0099] FIG. 14. Clonogenic skin-derived MPC are positive for
STRO-1bri/3G5/CD146. The bar graph depicts the number of adherent
colonies recovered from single cell suspensions of enzymatically
digested human skin, following fluorescence activated cell sorting,
based on their reactivity to antibodies that recognize STRO-1,
CD146, and 3G5, then cultured in standard growth medium as
previously described for bone marrow and dental pulp tissue (Shi
and Gronthos 2003). The data are expressed as the number of
colony-forming units obtained per 10.sup.5 cells plated in the
positive and negative cell fractions averaged from two separate
experiments.
Example 4
Immunophenotypic Analysis of Ex Vivo Expanded Human Bone Marrow
Mesenchymal Precursor Cells
[0100] We have previously reported that multipotential mesenchymal
precursor cells (MPC) can be purified from adult human bone marrow
mononuclear cells based on the phenotype STRO-1.sup.bright/VCAM-1
(CD106).sup.+ or STRO-1.sup.bright/MUC-18 (CD146).sup.+ (Gronthos
et al. 2003; Shi and Gronthos 2003). The MPC population can be
readily propagated in vitro under defined culture conditions
(Gronthos et al. 2003). We now present data characterising the ex
vivo expanded MPC progeny based on markers associated with
different cell lineages, at both the mRNA and protein level, using
reverse transcriptase-polymerase chain reaction (RT-PCR) and flow
cytometric analysis, respectively.
[0101] In the first series of experiments, semi-quantitative RT-PCR
analysis was employed to examine the gene expression profile of
various lineage-associated genes present in the cultured MPC
populations (FIG. 15). Relative gene expression for each cell
marker was assessed with reference to the expression of the
house-keeping gene, GAPDH, using ImageQuant software (FIG. 15 B).
In addition, single-colour flow cytometric analysis was used to
examine the protein expression profile of ex vivo expanded MPC
based on their expression of cell lineage-associated markers (FIG.
15 A). A summary of the general phenotype based on the gene and
protein expression of the cultured MPC is presented in Table 1.
Direct comparison of the gene expression profile of MPC described
in the present patent demonstrated clear differences between this
cell population and mesenchymal stem cells (MSC) previously
described by Pittenger et al. 1999, (Table 1).
[0102] Unless otherwise indicated the materials and methods of this
example are the same as those for Example 1.
[0103] FIG. 15 A. Immunophenotypic expression pattern of ex vivo
expanded bone marrow MPC. Single cell suspensions of ex vivo
expanded bone marrow MPC were prepared by trypsin/EDTA treatment
then incubated with antibodies identifying cell lineage-associated
markers. For those antibodies identifying intracellular antigens,
cell preparations were fixed with cold 70% ethanol to permeanbilize
the cellular membrane prior to staining for intracellular markers.
Isotype snatched control antibodies were treated under identical
conditions. Flow cytometric analysis was performed using a COULTER
EPICS instrument. The dot plots represent 5,000 listmode events
indicating the level of fluorescence intensity for each lineage
cell marker (bold line) with reference to the isotype matched
negative control antibodies (thin line).
[0104] FIG. 15 B. Gene expression profile of cultured MPC. Single
cell suspensions of ex vivo expanded bone marrow MPC were prepared
by trypsin/EDTA treatment and total cellular RNA was prepared.
Using RNAzolB extraction method total RNA was isolated and used as
a template for cDNA synthesis, prepared using standard procedure.
The expression of various transcripts was assessed by PCR
amplification, using a standard protocol as described previously
(Gronthos et al. 2003). Primers sets used in this study are shown
in Table 2. Following amplification, each reaction mixture was
analysed by 1.5% agarose gel electrophoresis, and visualised by
ethidium bromide staining. Relative gene expression for each cell
marker was assessed with reference to the expression of the
house-keeping gene, GAPDH, using ImageQuant software.
[0105] FIG. 16. Ex vivo expanded STRO-1.sup.bri MPC can develop
into arterioles in vitro. Single cell suspensions of ex viva
expanded bone marrow STRO-1.sup.bri and STRO-1.sup.dull MPC were
prepared by trypsin/EDTA treatment then plated into 48-well plates
containing 200 .mu.l of matrigel. The STRO-1.sup.dull (A) and
STRO-1.sup.bri (B) MPC were plated at 20,000 cells per well in
serum-free medium (Gronthos et al. 2003) supplemented with the
growth factors PDGF, EGF, VEGF at 10 ng/ml. Following 24 hours of
culture at 37.degree. C. in 5% CO.sub.2, the wells were washed then
fixed with 4% paraformaldehyde. Immunohistochemical studies were
subsequently performed demonstrated that the cord-like structures
expressed alpha-smooth muscle actin identified with a
goat-anti-murine IgG horse radish peroxidase antibody.
TABLE-US-00001 TABLE 1 Comparison between cultured human
Mesenchymal Precursor Cells (MCP's) and cultured human Mesenchymal
Stem Cells (MSC's) following ex vivo expansion. Antigens found to
be present on cell surface, intracellular or in the extra cellular
matrix. MPCs express markers of tissues with different
developmental origin, ie. ECT-ectoderm, MES-mesoderm and
END-endoderm. Differentiated Cell ANTIGEN MSC MPC Type. STRO-1 -ve
+ve Collagen II -ve +ve Chondrocyte (MES) Collagen IV -ve +ve
Fibroblast (MES) Laminin -ve +ve Fibroblast (MES) Bone Sialoprotein
(BSP) -ve +ve Osteoblast (MES) Osteocalcin (OCN) -ve +ve Osteoblast
(MES) Nestin ND +ve Neural (ECT) Glial Fibrillary Acidic ND +ve
Neural (ECT) Protein (GFAP) CBFA1 -ve +ve Osteoblast (MES) Osterix
(OSX) ND +ve Osteoblast (MES) Osteocalcin (OCN) -ve +ve Osteoblast
(MES) Sox9 ND +ve Chondrocyte (MES) Collagen X (COL X) +ve +ve
Chondrocyte (MES) Leptin ND +ve Adipose (MES) GATA-4 ND +ve
Cardiomyocyte (MES) Transferrin (TFN) ND +ve Hepatocyte (END)
Flavin Containing ND +ve Hepatocyte (END) Monooxygenase (FCM)
TABLE-US-00002 TABLE 2 RT-PCR primers and conditions for the
specific amplification of human mRNA Prod- Target Sense/Antisense
(5-3) uct Gene Primer Sequences Size GAPDH CACTGACACGTTGGCAGTGG/
417 [SEQ ID NO. 7] CATGGAGAAGGCTGGGGCTC [SEQ ID NO. 8] Leptin
ATGCATTGGGAACCCTGTGC/ 492 [SEQ ID NO. 9] GCACCCAGGGCTGAGGTCCA [SEQ
ID NO. 10] CBFA-1 GTGGACGAGGCAAGAGTTTCA/ 632 [SEQ ID NO. 11]
TGGCAGGTAGGTGTGGTAGTG [SEQ ID NO. 12] OCN ATGAGAGCCCTCACACTCCTC/
289 [SEQ ID NO. 13] CGTAGAAGCGCCGATAGGC [SEQ ID NO. 14] GFAP
CTGTTGCCAGAGATGGAGGTT/ 370 [SEQ ID NO. 15] TCATCGCTCAGGAGGTCCTT
[SEQ ID NO. 16] Nestin GGCAGCGTTGGAACAGAGGTTGGA/ 460 [SEQ ID NO.
17] CTCTAAACTGGAGTGGTCAGGGCT [SEQ ID NO. 18] GATA-4
GACTTCTCAGAAGGCAGAG/ 800 [SEQ ID NO. 19] CTATCCTCCAAGTCCCAGAG [SEQ
ID NO. 20] PDGF.beta.-R AATGTCTCCAGCACCTTCGTT 650 [SEQ ID NO. 21]
AGCGGATGTGGTAAGGCATA [SEQ ID NO. 22] Osterix GGCACAAAGAAGCCGTACTC/
247 [SEQ ID NO. 23] CACTGGGCAGACAGTCAGAA [SEQ ID NO. 24] COL X
AGCCAGGGTTGCCAGGACCA/ 387 [SEQ ID NO. 25] TTTTCCCACTCCAGGAGGGC [SEQ
ID NO. 26] SOX9 CTC TGC CTG TTT GGA CTT TGT/ 598 [SEQ ID NO. 27]
CCT TTG CTT GCC TTT TAC CTC [SEQ ID NO. 28] Ang-1
CCAGTCAGAGGCAGTACATGCTAAGAATTGAGTTA/ 300 [SEQ ID NO. 29]
GTTTTCCATGGTTTTGTCCCGCAGTA [SEQ ID NO. 30]
REFERENCES
[0106] 1. Spradling et al., (2001). Nature 414(6859):98-104. [0107]
2. Bianco and Robey (2001) Nature 414(6859):118-121. [0108] 3.
Fuchs and Segre (2000) Cell 100(1):143-55. [0109] 4. Gronthos et
al., (2000) Proc Natl Acad Sci USA 97(25):13625-30. [0110] 5.
Kuznetsov et al., (1997). J Bone Miner Res 12(9):1335-47. [0111] 6.
Bianco et al., (2001) Stem Cells 19(3):180-92. [0112] 7. Lichtman
(1981) Exp Hematol 9(4):391-410. [0113] 8. Weiss (1976) Anatomical
Record 186:161-84. [0114] 9. Weiss and Sakai H (1984) Am J Anat
170(3):447-63. [0115] 10. Dexter and Shadduck (1980) J Cell Physiol
102(3):279-86. [0116] 11. Orchardson amd Cadden (2001) Dent Update
28(4):200-6, 208-9. [0117] 12. Peters and Balling (1999) Trends
Genet 15(2):59-65. [0118] 13. Thesleff and Aberg (1999) Bone
25(1):123-5. [0119] 14. Friedenstein et al., (1974) Transplantation
17(4):331-40. [0120] 15. Castro-Malaspina et al., (1980) Blood
56(2):289-301. [0121] 16. Weissman (2000) Cell 100(1):157-68.
[0122] 17. Uchida et al., (2000) Proc Natl Acad Sci USA
97(26):14720-5. [0123] 18. Kuznetsov et al., (2001) J Cell Biol
153(5):1133-40. [0124] 19. Shi et al. (2001) Bone 29(6):532-39.
[0125] 20. Pittenger et al., (1999) Science 284(5411):143-7. [0126]
21. Gronthos et al., (2002) J Dent Res 81(8):531-5. [0127] 22. Owen
and Friedenstein (1988) Ciba Found Symp 136(29):42-60. [0128] 23.
Doherty et al., (1998) J Bone Miner Res 13(5):828-38. [0129] 24.
Bianco and Cossu (1999). Exp Cell Res 251(2):257-63. [0130] 25.
Gronthos et al., (1998) Isolation, purification and in vitro
manipulation of human bone marrow stromal precursor cells. In:
Beresford J N and Owen M E (ed) Marrow stromal cell culture.
Cambridge University Press, Cambridge, UK, pp 26-42. [0131] 26.
Gronthos and Simmons (1995) Blood 85(4):929-40. [0132] 27. Gronthos
et al., (1999) J Bone Miner Res 14(1):47-56. [0133] 28. Filshie et
al., (1998) Leukemia 12(3):414-21. [0134] 29. Simmons and
Torok-Storb (1991). Blood 78(1):55-62. [0135] 30. Canfield and
Schor (1998) Osteogenic potential of vascular pericytes. In:
Beresford J N and Owen M E (ed) Marrow stromal cell culture.
Cambridge University Press, Cambridge, UK, pp 128-148. [0136] 31.
Riminucci and Bianco (1998) The bone marrow stroma in vivo:
ontogeny, structure, cellular composition and changes in disease.
In: Beresford J N and Owen M E (ed) Marrow stromal cell culture.
Cambridge University Press, UK, Cambridge, UK, pp 10-25. [0137] 32.
Gronthos et al., (1994) Blood 84(12):4164-73. [0138] 33. Oyajobi et
al., (1999) J Bone Miner Res 14(3):351-61. [0139] 34. Dennis et
al., (2002). Cells Tissues Organs 170(2-3):73-82. [0140] 35.
Stewart et al., (1999) J Bone Miner Res 14(8):1345-56. [0141] 36.
Alidjoudj et al., (2001) J Cell Biochem 81(1):23-38. [0142] 37.
Shih (1999) J Pathol 189(1):4-11. [0143] 38, Van Vlasselaer et al.,
(1994) Blood 84(3):753-63. [0144] 39. Prockop et al., (2001).
Cytotherapy 3(5):393-6. [0145] 40. Ducy et al., (1997) Cell
89(5):747-54. [0146] 41. Komori et al., (1997) Cell 89(5):755-64.
[0147] 42. Woodbury et al., (2000) J Neurosci Res 61(4)364-70.
[0148] 43. Dey et al., (2001) Arch Oral Biol 46(3):249-60. [0149]
44. Ueno et al., (2001) Matrix Biol 20(5-6):347-55. [0150] 45.
Couble et al., (2000) Calcif Tissue Int 66(2):129-38. [0151] 46.
Nehls and Drenckhahn (1993) Histochemistry 99(1):1-12. [0152] 47.
Schor et al., (1995) Clin Orthop 313:81-91. [0153] 48. Pugach et
al., (1999) Arkh Patol 61(4):18-21. [0154] 49. Nehls et al., (1992)
Cell Tissue Res 270(3):469-74. [0155] 50. Brighton et al., (1992)
Clin Orthop 275:287-99. [0156] 51. Nayak et al., (1988) J Exp Med
167(3):1003-15. [0157] 52. Andreeva et al., (1998) Tissue Cell
30(1):127-35. [0158] 53. Cattoretti et al., (1993) Blood
81(7):1726-38. [0159] 54. Charbord et al., (2000) J Hematother Stem
Cell Res 9(6):935-43. [0160] 55. Dennis and Charbord (2002) Stem
Cells 20(3):205-14. [0161] 56. Young et al., (2001) Anat Rec
263(4):350-60. [0162] Gronthos et al., (2003). Journal of Cell
Science 116: 1827-1835. [0163] Pittenger et al., (1999). Science
284, 143-7. [0164] Simmons and Torok-Storb (1991a). Blood
78(1):55-62. [0165] Simmons and Torok-Storb (1991 b). Blood
78:2848. [0166] Shi and Gronthos. (2003). Journal of Bone and
Mineral Research, 18(4): 696-704.
Sequence CWU 1
1
30124DNAArtificial SequencePrimer 1ctatggagag gacgccacgc ctgg
24223DNAArtificial SequencePrimer 2catagccatc gtagccttgt cct
23316DNAArtificial SequencePrimer 3catgagagcc ctcaca
16417DNAArtificial SequencePrimer 4agagcgacac cctagac
17521DNAArtificial SequencePrimer 5agccgcatct tcttttgcgt c
21621DNAArtificial SequencePrimer 6tcatatttgg caggtttttc t
21720DNAArtificial SequencePrimer 7cactgacacg ttggcagtgg
20820DNAArtificial SequencePrimer 8catggagaag gctggggctc
20920DNAArtificial SequencePrimer 9atgcattggg aaccctgtgc
201020DNAArtificial SequencePrimer 10gcacccaggg ctgaggtcca
201121DNAArtificial SequencePrimer 11gtggacgagg caagagtttc a
211221DNAArtificial SequencePrimer 12tggcaggtag gtgtggtagt g
211321DNAArtificial SequencePrimer 13atgagagccc tcacactcct c
211419DNAArtificial SequencePrimer 14cgtagaagcg ccgataggc
191521DNAArtificial SequencePrimer 15ctgttgccag agatggaggt t
211620DNAArtificial SequencePrimer 16tcatcgctca ggaggtcctt
201724DNAArtificial SequencePrimer 17ggcagcgttg gaacagaggt tgga
241824DNAArtificial SequencePrimer 18ctctaaactg gagtggtcag ggct
241919DNAArtificial SequencePrimer 19gacttctcag aaggcagag
192020DNAArtificial SequencePrimer 20ctatcctcca agtcccagag
202120DNAArtificial SequencePrimer 21aatgtctcca gcaccttcgt
202220DNAArtificial SequencePrimer 22agcggatgtg gtaaggcata
202320DNAArtificial SequencePrimer 23ggcacaaaga agccgtactc
202420DNAArtificial SequencePrimer 24cactgggcag acagtcagaa
202520DNAArtificial SequencePrimer 25agccagggtt gccaggacca
202620DNAArtificial SequencePrimer 26ttttcccact ccaggagggc
202721DNAArtificial SequencePrimer 27ctctgcctgt ttggactttg t
212821DNAArtificial SequencePrimer 28cctttgcttg ccttttacct c
212935DNAArtificial SequencePrimer 29ccagtcagag gcagtacatg
ctaagaattg agtta 353026DNAArtificial SequencePrimer 30gttttccatg
gttttgtccc gcagta 26
* * * * *