U.S. patent application number 15/351267 was filed with the patent office on 2017-07-13 for compounds for treating spinal muscular atrophy.
This patent application is currently assigned to Hoffmann-La Roche Inc.. The applicant listed for this patent is Hoffmann-La Roche Inc., PTC Therapeutics, Inc.. Invention is credited to Luke Green, Nikolai A. Naryshkin, Hasane Ratni, Marla L. Weetall.
Application Number | 20170197990 15/351267 |
Document ID | / |
Family ID | 53175048 |
Filed Date | 2017-07-13 |
United States Patent
Application |
20170197990 |
Kind Code |
A1 |
Ratni; Hasane ; et
al. |
July 13, 2017 |
COMPOUNDS FOR TREATING SPINAL MUSCULAR ATROPHY
Abstract
The present invention provides compounds of formula (I)
##STR00001## wherein A, R.sup.1, R.sup.2 and R.sup.3 are as
described herein, as well as pharmaceutically acceptable salts
thereof. Further the present invention is concerned with the
manufacture of the compounds of formula (I), pharmaceutical
compositions comprising them and their use as medicaments.
Inventors: |
Ratni; Hasane; (Basel,
CH) ; Green; Luke; (Basel, CH) ; Weetall;
Marla L.; (South Plainfield, NJ) ; Naryshkin; Nikolai
A.; (South Plainfield, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Hoffmann-La Roche Inc.
PTC Therapeutics, Inc. |
Little Falls
South Plainfield |
NJ
NJ |
US
US |
|
|
Assignee: |
Hoffmann-La Roche Inc.
Little Falls
NJ
PTC Therapeutics, Inc.
South Plainfield
NJ
|
Family ID: |
53175048 |
Appl. No.: |
15/351267 |
Filed: |
November 14, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/EP2015/060343 |
May 11, 2015 |
|
|
|
15351267 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 21/02 20180101;
A61P 21/00 20180101; C07D 519/00 20130101; A61P 25/28 20180101;
C07D 487/04 20130101 |
International
Class: |
C07D 519/00 20060101
C07D519/00 |
Claims
1. A compound of formula (I): ##STR00062## wherein R.sup.1 is
hydrogen or C.sub.1-7-alkyl; R.sup.2 is hydrogen, cyano,
C.sub.1-7-haloalkyl or C.sub.3-8-cycloalkyl; R.sup.3 is hydrogen,
C.sub.1-7-alkyl, or C.sub.3-8-cycloalkyl; A is N-heterocycloalkyl
or NR.sup.12R.sup.13, wherein N-heterocycloalkyl comprises 1 or 2
nitrogen ring atoms and is optionally substituted with 1, 2, 3 or 4
substituents selected from R.sup.14; R.sup.12 is heterocycloalkyl
comprising 1 nitrogen ring atom, wherein heterocycloalkyl is
optionally substituted with 1, 2, 3 or 4 substituents selected from
R.sup.14; R.sup.13 is hydrogen, C.sub.1-7-alkyl or
C.sub.3-8-cycloalkyl; R.sup.14 is independently selected from
hydrogen, C.sub.1-7-alkyl, amino, amino-C.sub.1-7-alkyl,
C.sub.3-8-cycloalkyl and heterocycloalkyl or two R.sup.14 together
form C.sub.1-7-alkylene; with the proviso that if A is
N-heterocycloalkyl comprising only 1 nitrogen ring atom, then at
least one R.sup.14 substituent is amino or amino-C.sub.1-7-alkyl;
or a pharmaceutically acceptable salt thereof.
2. A compound according to claim 1, wherein R.sup.1 is hydrogen or
C.sub.1-7-alkyl; R.sup.2 is hydrogen, cyano, C.sub.1-7-haloalkyl or
C.sub.3-8-cycloalkyl; R.sup.3 is hydrogen, C.sub.1-7-alkyl, or
C.sub.3-8-cycloalkyl; A is N-heterocycloalkyl comprising 1 or 2
nitrogen ring atoms, wherein N-heterocycloalkyl is optionally
substituted with 1, 2, 3 or 4 substituents selected from R.sup.14;
R.sup.14 is independently selected from hydrogen, C.sub.1-7-alkyl,
amino, amino-C.sub.1-7-alkyl, C.sub.3-8-cycloalkyl and
heterocycloalkyl or two R.sup.14 together form C.sub.1-7-alkylene;
with the proviso that if A is N-heterocycloalkyl comprising only 1
nitrogen ring atom, then at least one R.sup.14 substituent is amino
or amino-C.sub.1-7-alkyl; or a pharmaceutically acceptable salt
thereof.
3. A compound according to claim 1, wherein R.sup.1 is
C.sub.1-7-alkyl.
4. A compound according to claim 1, wherein R.sup.1 is methyl.
5. A compound according to claim 1, wherein R.sup.2 is hydrogen or
C.sub.1-7-alkyl.
6. A compound according to claim 1, wherein R.sup.2 is hydrogen or
methyl.
7. A compound according to claim 1, wherein R.sup.3 is hydrogen or
C.sub.1-7-alkyl.
8. A compound according to claim 1, wherein R.sup.3 is hydrogen or
methyl.
9. A compound according to claim 1, wherein R.sup.12 is piperidinyl
optionally substituted with 1, 2, 3 or 4 substituents selected from
R.sup.14.
10.-14. (canceled)
15. A compound according to claim 1, wherein A is ##STR00063##
wherein X is N or CH; R.sup.4 is hydrogen, C.sub.1-7-alkyl or
--(CH.sub.2).sub.m--NR.sup.9R.sup.10; R.sup.5 is hydrogen or
C.sub.1-7-alkyl; R.sup.6 is hydrogen or C.sub.1-7-alkyl; R.sup.7 is
hydrogen or C.sub.1-7-alkyl; R.sup.8 is hydrogen or
C.sub.1-7-alkyl; R.sup.9 and R.sup.10 are independently selected
from hydrogen, C.sub.1-7-alkyl and C.sub.3-8-cycloalkyl; R.sup.13
is hydrogen, C.sub.1-7-alkyl or C.sub.3-8-cycloalkyl; n is 0, 1 or
2; m is 0, 1, 2 or 3; or R.sup.4 and R.sup.5 together form
C.sub.1-7-alkylene; or R.sup.4 and R.sup.7 together form
C.sub.1-7-alkylene; or R.sup.5 and R.sup.6 together form
C.sub.2-7-alkylene; or R.sup.5 and R.sup.7 together form
C.sub.1-7-alkylene; or R.sup.5 and R.sup.9 together form
C.sub.1-7-alkylene; or R.sup.7 and R.sup.8 together form
C.sub.2-7-alkylene; or R.sup.7 and R.sup.9 together form
C.sub.1-7-alkylene; or R.sup.9 and R.sup.10 together form
C.sub.2-7-alkylene; with the proviso that if X is CH then R.sup.4
is --(CH.sub.2).sub.m--NR.sup.9R.sup.10; and with the proviso that
if X is N and R.sup.4 is --(CH.sub.2).sub.m--NR.sup.9R.sup.10 then
m is 2 or 3.
16. A compound according to claim 1, wherein A is ##STR00064##
wherein X is N or CH; R.sup.4 is hydrogen, C.sub.1-7-alkyl or
--(CH.sub.2).sub.m--NR.sup.9R.sup.10; R.sup.5 is hydrogen or
C.sub.1-7-alkyl; R.sup.6 is hydrogen or C.sub.1-7-alkyl; R.sup.7 is
hydrogen or C.sub.1-7-alkyl; R.sup.8 is hydrogen or
C.sub.1-7-alkyl; R.sup.9 and R.sup.10 are independently selected
from hydrogen, C.sub.1-7-alkyl and C.sub.3-8-cycloalkyl; n is 0, 1
or 2; m is 0, 1, 2 or 3; or R.sup.4 and R.sup.5 together form
C.sub.1-7-alkylene; or R.sup.4 and R.sup.7 together form
C.sub.1-7-alkylene; or R.sup.5 and R.sup.6 together form
C.sub.2-7-alkylene; or R.sup.5 and R.sup.7 together form
C.sub.1-7-alkylene; or R.sup.5 and R.sup.9 together form
C.sub.1-7-alkylene; or R.sup.7 and R.sup.8 together form
C.sub.2-7-alkylene; or R.sup.7 and R.sup.9 together form
C.sub.1-7-alkylene; or R.sup.9 and R.sup.10 together form
C.sub.2-7-alkylene; with the proviso that if X is CH then R.sup.4
is --(CH.sub.2).sub.m--NR.sup.9R.sup.10; and with the proviso that
if X is N and R.sup.4 is --(CH.sub.2).sub.m--NR.sup.9R.sup.10 then
m is 2 or 3.
17. A compound according to claim 1, wherein X is N.
18. A compound according to claim 1, wherein n is 1.
19. A compound according to claim 1, wherein R.sup.4 is hydrogen,
methyl or --(CH.sub.2).sub.m--NR.sup.9R.sup.10.
20.-22. (canceled)
23. A compound according to claim 1, wherein R.sup.6 is hydrogen or
methyl.
24. (canceled)
25. A compound according to claim 1, wherein R.sup.7 is hydrogen or
methyl.
26.
27. A compound according to claim 1, wherein m is 0.
28. A compound according to claim 1, wherein R.sup.4 and R.sup.5
together form propylene.
29. A compound according to claim 1, wherein R.sup.5 and R.sup.6
together form ethylene.
30. A compound according to claim 1, wherein R.sup.9 and R.sup.10
together form butylene.
31.-36. (canceled)
37. A compound according to claim 1, wherein A is selected from the
group of: ##STR00065##
38. A compound according to claim 1, wherein A is selected from the
group of: ##STR00066## ##STR00067##
39. A compound according to claim 1 selected from the group
consisting of:
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-(4-methylpiperazin-1-yl)py-
rido[1,2-a]pyrimidin-4-one;
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2,-
8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2,-
8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimethylpiper-
azin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1--
yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1--
yl]pyrido[1,2-a]pyrimidin-4-one;
7-(1,4-diazepan-1-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[-
1,2-a]pyrimidin-4-one;
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]p-
yrido[1,2-a]pyrimidin-4-one;
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]p-
yrido[1,2-a]pyrimidin-4-one;
7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2--
a]pyrimidin-4-one;
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2--
methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2--
methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyr-
rolidin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl-
)pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one;
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyrroli-
din-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-y-
l)pyrido[1,2-a]pyrimidin-4-one;
7-(3,3-dimethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)py-
rido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3R)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R,5S)-3,5-dimethylpiper-
azin-1-yl]-9-methyl-pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-y-
l)-9-methyl-pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)-9-methyl-pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5S)-3,5-dimethylpiper-
azin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyr-
rolidin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyrroli-
din-1-yl]pyrido[1,2-a]pyrimidin-4-one;
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one;
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperaz-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one;
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperaz-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one;
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-(3,3-dimethylpiperazin-1-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyridazi-
n-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyrid-
azin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; and
7-[(3R)-3-ethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)py-
rido[1,2-a]pyrimidin-4-one; or a pharmaceutically acceptable
salt[s] thereof.
40. A compound according to claim 1, selected from the group
consisting of:
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-m-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimethylpiper-
azin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl-
)pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one;
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)-9-methyl-pyrido[1,2-a]pyrimidin-4-one;
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; and
7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyrid-
azin-6-yl)pyrido[1,2-a]pyrimidin-4-one; or a pharmaceutically
acceptable salt thereof.
41. The compound of formula (VI): ##STR00068## wherein R.sup.1,
R.sup.2 and R.sup.3 are as described in claim 1; Y is halogen or
trifluoromethanesulfonate; and salts thereof.
42.-43. (canceled)
44. A compound of formula (VI) according to claim 41, selected from
the group consisting of:
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-
-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]p-
yrimidin-4-one;
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one;
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one; or a pharmaceutically acceptable salt
thereof.
45. A process for the preparation of a compound of formula (I)
according to claim 1, comprising an aromatic nucleophilic
substitution reaction between a compound of formula (VI):
##STR00069## wherein R.sup.1 is hydrogen or C.sub.1-7-alkyl;
R.sup.2 is hydrogen, cyano, C.sub.1-7-alkyl, C.sub.1-7-haloalkyl or
C.sub.3-8-cycloalkyl; R.sup.3 is hydrogen, C.sub.1-7-alkyl, or
C.sub.3-8-cycloalkyl; Y is halogen or trifluoromethanesulfonate; or
a salt thereof; with a compound of formula M-A by heating in a
solvent, wherein, A is N-heterocycloalkyl or NR.sup.12R.sup.13,
wherein N-heterocycloalkyl comprises 1 or 2 nitrogen ring atoms and
is optionally substituted with 1, 2, 3 or 4 substituents selected
from R.sup.14; R.sup.12 is heterocycloalkyl comprising 1 nitrogen
ring atom, wherein heterocycloalkyl is optionally substituted with
1, 2, 3 or 4 substituents selected from R.sup.14; R.sup.13 is
hydrogen, C.sub.1-7-alkyl or C.sub.3-8-cycloalkyl; R.sup.14 is
independently selected from hydrogen, C.sub.1-7-alkyl, amino,
amino-C.sub.1-7-alkyl, C.sub.3-8-cycloalkyl and heterocycloalkyl or
two R.sup.14 together form C.sub.1-7-alkylene; with the proviso
that if A is N-heterocycloalkyl comprising only 1 nitrogen ring
atom, then at least one R.sup.14 substituent is amino or
amino-C.sub.1-7-alkyl; M is hydrogen, sodium or potassium, and
wherein M is linked to A via a nitrogen atom of A.
46.-48. (canceled)
49. A compound obtained by a process according to claim 45.
50. A pharmaceutical composition comprising a compound of formula
(I) according to claim 1, or a pharmaceutically acceptable salt
thereof, and one or more pharmaceutically acceptable
excipients.
51. (canceled)
52. (canceled)
53. A method for the treatment or prevention of spinal muscular
atrophy in a human, which method comprises administering a
therapeutically effective amount of a compound of formula (I)
according to claim 1, or a pharmaceutically acceptable salt
thereof, to a human in need of such treatment or prevention.
54.-56. (canceled)
57. A method for the treatment of spinal muscular atrophy in a
human, which method comprises administering a therapeutically
effective amount of a compound of formula (I) according to claim 1,
or a pharmaceutically acceptable salt thereof, to a human in need
of such treatment.
Description
INTRODUCTION
[0001] The present invention provides compounds which are SMN2 gene
splicing modulators, their manufacture, pharmaceutical compositions
comprising them and their use as medicaments for the treatment of
spinal muscular atrophy (SMA).
[0002] In particular, the present invention relates to compounds of
formula (I)
##STR00002##
[0003] wherein A, R.sup.1, R.sup.2 and R.sup.3 are as described
herein, and pharmaceutically acceptable salts thereof.
BACKGROUND
[0004] Spinal muscular atrophy (SMA), in its broadest sense,
describes a collection of inherited and acquired central nervous
system (CNS) diseases characterized by progressive motor neuron
loss in the spinal cord and brainstem causing muscle weakness and
muscle atrophy. The most common form of SMA is caused by mutations
in the Survival Motor Neuron (SMN) gene and manifests over a wide
range of severity affecting infants through adults (Crawford and
Pardo, Neurobiol. Dis., 1996, 3:97).
[0005] Infantile SMA is the most severe form of this
neurodegenerative disorder. Symptoms include muscle weakness, poor
muscle tone, weak cry, limpness or a tendency to flop, difficulty
sucking or swallowing, accumulation of secretions in the lungs or
throat, feeding difficulties, and increased susceptibility to
respiratory tract infections. The legs tend to be weaker than the
arms and developmental milestones, such as lifting the head or
sitting up, cannot be reached. In general, the earlier the symptoms
appear, the shorter the lifespan. As the motor neuron cells
deteriorate, symptoms appear shortly afterward. The severe forms of
the disease are fatal and all forms have no known cure. The course
of SMA is directly related to the rate of motor neuron cell
deterioration and the resulting severity of weakness. Infants with
a severe form of SMA frequently succumb to respiratory disease due
to weakness in the muscles that support breathing.
[0006] Children with milder forms of SMA live much longer, although
they may need extensive medical support, especially those at the
more severe end of the spectrum. The clinical spectrum of SMA
disorders has been divided into the following five groups. [0007]
(a) Type 0 SMA (In Utero SMA) is the most severe form of the
disease and begins before birth. Usually, the first symptom of Type
0 SMA is reduced movement of the fetus that can first be observed
between 30 and 36 weeks of pregnancy. After birth, these newborns
have little movement and have difficulties with swallowing and
breathing. [0008] (b) Type 1 SMA (Infantile SMA or Werdnig-Hoffmann
disease) presents symptoms between 0 and 6 months. form of SMA is
also very severe. Patients never achieve the ability to sit, and
death usually occurs within the first 2 years without ventilatory
support. [0009] (c) Type 2 SMA (Intermediate SMA) has an age of
onset at 7-18 months. Patients achieve the ability to sit
unsupported, but never stand or walk unaided. Prognosis in this
group is largely dependent on the degree of respiratory
involvement. [0010] (d) Type 3 SMA (Juvenile SMA or
Kugelberg-Welander disease) is generally diagnosed after 18 months.
Type 3 SMA individuals are able to walk independently at some point
during their disease course but often become wheelchair-bound
during youth or adulthood. [0011] (e) Type 4 SMA (Adult onset SMA).
Weakness usually begins in late adolescence in the tongue, hands,
or feet, then progresses to other areas of the body. The course of
adult SMA is much slower and has little or no impact on life
expectancy.
[0012] The SMN gene has been mapped by linkage analysis to a
complex region in chromosome 5q. In humans, this region contains an
approximately 500 thousand base pairs (kb) inverted duplication
resulting in two nearly identical copies of the SMN gene. SMA is
caused by an inactivating mutation or deletion of the telomeric
copy of the gene (SMN1) in both chromosomes, resulting in the loss
of SMN1 gene function. However, all patients retain the centromeric
copy of the gene (SMN2), and the copy number of the SMN2 gene in
SMA patients generally correlates inversely with the disease
severity; i.e., patients with less severe SMA have more copies of
SMN2. Nevertheless, SMN2 is unable to compensate completely for the
loss of SMN1 function due to alternative splicing of exon 7 caused
by a translationally silent C to T mutation in exon 7. As a result,
the majority of transcripts produced from SMN2 lack exon 7 (47
SMN2), and encode a truncated SMN protein that has an impaired
function and is rapidly degraded.
[0013] The SMN protein is thought to play a role in RNA processing
and metabolism, having a well characterized function of mediating
the assembly of a specific class of RNA-protein complexes termed
snRNPs. SMN may have other functions in motor neurons, however its
role in preventing the selective degeneration of motor neurons is
not well established.
[0014] In most cases, SMA is diagnosed based on clinical symptoms
and by the presence of at least one copy of the SMN1 gene test.
However, in approximately 5% of cases SMA is caused by mutation in
genes other than the inactivation of SMN 1, some known and others
not yet defined. In some cases, when the SMN 1 gene test is not
feasible or does not show any abnormality, other tests such as an
electromyography (EMG) or muscle biopsy may be indicated.
[0015] Medical care for SMA patients at present is limited to
supportive therapy including respiratory, nutritional and
rehabilitation care; there is no drug known to address the
underlying cause of the disease. Current treatment for SMA consists
of prevention and management of the secondary effects of chronic
motor unit loss. The major management issue in Type 1 SMA is the
prevention and early treatment of pulmonary problems, which are the
cause of death in the majority of the cases. While some infants
afflicted with SMA grow to be adults, those with Type 1 SMA have a
life expectancy of less than two years.
[0016] Several mouse models of SMA have been developed. In
particular, the SMN delta exon 7 (.DELTA.7 SMN) model (Le et al.,
Hum. Mol. Genet., 2005, 14:845) carries both the SMN2 gene and
several copies of the .DELTA.7 SMN2 cDNA and recapitulates many of
the phenotypic features of Type 1 SMA. The .DELTA.7 SMN model can
be used for both SMN2 expression studies as well as the evaluation
of motor function and survival. The C/C-allele mouse model (Jackson
Laboratory strain #008714, The Jackson Laboratory, Bar Harbor, Me.)
provides a less severe SMA disease model, with mice having reduced
levels of both SMN2 full length (FL SMN2) mRNA and SMN protein. The
C/C-allele mouse phenotype has the SMN2 gene and a hybrid
mSMN1-SMN2 gene that undergoes alternative splicing, but does not
have overt muscle weakness. The C/C-allele mouse model is used for
SMN2 expression studies.
[0017] As a result of improved understanding of the genetic basis
and pathophysiology of SMA, several strategies for treatment have
been explored, but none have yet demonstrated success in the
clinic.
[0018] Gene replacement of SMN1, using viral delivery vectors, and
cell replacement, using differentiated SMN1.sup.+/+stem cells, have
demonstrated efficacy in animal models of SMA. More research is
needed to determine the safety and immune response and to address
the requirement for the initiation of treatment at the neonatal
stage before these approaches can be applied to humans.
[0019] Correction of alternative splicing of SMN2 in cultured cells
has also been achieved using synthetic nucleic acids as therapeutic
agents: (i) antisense oligonucleotides that target sequence
elements in SMN2 pre-mRNA and shift the outcome of the splicing
reaction toward the generation of full length SMN2 mRNA (Passini et
al., Sci. Transl. Med., 2011, 3: 72ra18; and, Hua et al., Nature,
2011, 478:123) and (ii) trans-splicing RNA molecules that provide a
fully functional RNA sequence that replace the mutant fragment
during splicing and generate a full length SMN1 mRNA (Coady and
Lorson, J Neurosci., 2010, 30:126).
[0020] Other approaches under exploration include searching for
drugs that increase SMN levels, enhance residual SMN function, or
compensate for its loss. Aminoglycosides have been shown to enhance
expression of a stabilized SMN protein produced from .DELTA.7 SMN2
mRNA by promoting the translational read-through of the aberrant
stop codon, but have poor central nervous system penetration and
are toxic after repeat dosing. Chemotherapeutic agents, such as
aclarubicin, have been shown to increase SMN protein in cell
culture; however, the toxicity profile of these drugs prohibits
long-term use in SMA patients. Some drugs under clinical
investigation for the treatment of SMA include transcription
activators such as histone deacetylase ("HDAC") inhibitors (e.g.,
butyrates, valproic acid, and hydroxyurea), and mRNA stabilizers
(mRNA decapping inhibitor RG3039 from Repligen), the goal being to
increase the amount of total RNA transcribed from the SMN2 gene.
However, the use of the HDAC inhibitors or mRNA stabilizers does
not address the underlying cause of SMA and may result in a global
increase in transcription and gene expression with potential safety
problems in humans.
[0021] In an alternative approach, neuroprotective agents such as
Olesoxime have been chosen for investigation. Such strategies are
not aimed at SMN for the treatment of SMA, but instead are being
explored to protect the SMN-deficient motor neurons from
neurodegeneration.
[0022] A system designed for identifying compounds that increase
the inclusion of exon 7 of SMN into RNA transcribed from the SMN2
gene and certain benzooxazole and benzoisoxazole compounds
identified thereby have been described in International Patent
Application WO2009/151546A1. A system designed for identifying
compounds that cause ribosomal frameshifting to produce a
stabilized SMN protein from .DELTA.7 SMN2 mRNA and certain
isoindolinone compounds identified thereby have been described in
International Patent Applications WO2010/019236A1 and
WO2013/119916A2.
[0023] Despite the progress made in understanding the genetic basis
and pathophysiology of SMA, there remains a need to identify
compounds that alter the course of spinal muscular atrophy, one of
the most devastating childhood neurological diseases.
DETAILED DESCRIPTION OF THE INVENTION
[0024] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the invention,
suitable methods and materials are described below.
[0025] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety.
[0026] The nomenclature used in this Application is based on IUPAC
systematic nomenclature, unless indicated otherwise.
[0027] Any open valency appearing on a carbon, oxygen, sulfur or
nitrogen atom in the structures herein indicates the presence of a
hydrogen, unless indicated otherwise.
[0028] The definitions described herein apply irrespective of
whether the terms in question appear alone or in combination. It is
contemplated that the definitions described herein can be appended
to form chemically-relevant combinations, such as e.g.
"heterocycloalkylaryl", "haloalkylheteroaryl",
"arylalkylheterocycloalkyl", or "alkoxyalkyl". The last member of
the combination is the radical which is binding to the rest of the
molecule. The other members of the combination are attached to the
binding radical in reversed order in respect of the literal
sequence, e.g. the combination amino-C.sub.1-7-alkyl refers to a
C.sub.1-7-alkyl which is substituted by amino, or e.g. the
combination arylalkylheterocycloalkyl refers to a
heterocycloalkyl-radical which is substituted by an alkyl which is
substituted by an aryl.
[0029] The term "moiety" refers to an atom or group of chemically
bonded atoms that is attached to another atom or molecule by one or
more chemical bonds thereby forming part of a molecule. For
example, the variables A, R.sup.1, R.sup.2 and R.sup.3 of formula
(I) refer to moieties that are attached to the core structure of
formula (I) by a covalent bond.
[0030] When indicating the number of substituents, the term "one or
more" refers to the range from one substituent to the highest
possible number of substitution, i.e. replacement of one hydrogen
up to replacement of all hydrogens by substituents.
[0031] The term "optional" or "optionally" denotes that a
subsequently described event or circumstance can but need not
occur, and that the description includes instances where the event
or circumstance occurs and instances in which it does not.
[0032] The term "substituent" denotes an atom or a group of atoms
replacing a hydrogen atom on the parent molecule.
[0033] The term "substituted" denotes that a specified group bears
one or more substituents. Where any group can carry multiple
substituents and a variety of possible substituents is provided,
the substituents are independently selected and need not to be the
same. The term "unsubstituted" means that the specified group bears
no substituents. The term "optionally substituted" means that the
specified group is unsubstituted or substituted by one or more
substituents, independently chosen from the group of possible
substituents. When indicating the number of substituents, the term
"one or more" means from one substituent to the highest possible
number of substitution, i.e. replacement of one hydrogen up to
replacement of all hydrogens by substituents.
[0034] The terms "compound(s) of this invention" and "compound(s)
of the present invention" refer to compounds as disclosed herein
and stereoisomers, tautomers, solvates, and salts (e.g.,
pharmaceutically acceptable salts) thereof.
[0035] When the compounds of the invention are solids, it is
understood by those skilled in the art that these compounds, and
their solvates and salts, may exist in different solid forms,
particularly different crystal forms, all of which are intended to
be within the scope of the present invention and specified
formulae.
The term "pharmaceutically acceptable salts" denotes salts which
are not biologically or otherwise undesirable. Pharmaceutically
acceptable salts include both acid and base addition salts. The
term "pharmaceutically acceptable acid addition salt" denotes those
pharmaceutically acceptable salts formed with inorganic acids such
as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid,
carbonic acid, phosphoric acid, and organic acids selected from
aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic,
carboxylic, and sulfonic classes of organic acids such as formic
acid, acetic acid, propionic acid, glycolic acid, gluconic acid,
lactic acid, pyruvic acid, oxalic acid, malic acid, maleic acid,
maloneic acid, succinic acid, fumaric acid, tartaric acid, citric
acid, aspartic acid, ascorbic acid, glutamic acid, anthranilic
acid, benzoic acid, cinnamic acid, mandelic acid, embonic acid,
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
p-toluenesulfonic acid, and salicyclic acid. The term
"pharmaceutically acceptable base addition salt" denotes those
pharmaceutically acceptable salts formed with an organic or
inorganic base. Examples of acceptable inorganic bases include
sodium, potassium, ammonium, calcium, magnesium, iron, zinc,
copper, manganese, and aluminum salts. Salts derived from
pharmaceutically acceptable organic nontoxic bases includes salts
of primary, secondary, and tertiary amines, substituted amines
including naturally occurring substituted amines, cyclic amines and
basic ion exchange resins, such as isopropylamine, trimethylamine,
diethylamine, triethylamine, tripropylamine, ethanolamine,
2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine,
arginine, histidine, caffeine, procaine, hydrabamine, choline,
betaine, ethylenediamine, glucosamine, methylglucamine,
theobromine, purines, piperizine, piperidine, N-ethylpiperidine,
and polyamine resins.
[0036] Stereochemical definitions and conventions used herein
generally follow S. P. Parker, Ed., McGraw-Hill Dictionary of
Chemical Terms (1984) McGraw-Hill Book Company, New York; and
Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds",
John Wiley & Sons, Inc., New York, 1994. In describing an
optically active compound, the prefixes D and L, or R and S, are
used to denote the absolute configuration of the molecule about its
chiral center(s). The substituents attached to the chiral center
under consideration are ranked in accordance with the Sequence Rule
of Cahn, Ingold and Prelog. (Cahn et al. Angew. Chem. Inter. Edit.
1966, 5, 385; errata 511). The prefixes D and L or (+) and (-) are
employed to designate the sign of rotation of plane-polarized light
by the compound, with (-) or L designating that the compound is
levorotatory. A compound prefixed with (+) or D is
dextrorotatory.
[0037] The term "chiral center" denotes a carbon atom bonded to
four nonidentical substituents. The term "chiral" denotes the
ability of non-superimposability with the mirror image, while the
term "achiral" refers to embodiments which are superimposable with
their mirror image. Chiral molecules are optically active, i.e.,
they have the ability to rotate the plane of plane-polarized
light.
Compounds of the present invention can have one or more chiral
centers and can exist in the form of optically pure enantiomers,
mixtures of enantiomers such as, for example, racemates, optically
pure diastereoisomers, mixtures of diastereoisomers,
diastereoisomeric racemates or mixtures of diastereoisomeric
racemates. Whenever a chiral center is present in a chemical
structure, it is intended that all stereoisomers associated with
that chiral center are encompassed by the present invention.
[0038] The terms "halo", "halogen", and "halide" are used
interchangeably herein and denote fluoro, chloro, bromo, or iodo.
One particular example of halogen is fluoro.
[0039] The term "alkyl" denotes a monovalent linear or branched
saturated hydrocarbon group of 1 to 12 carbon atoms. In particular
embodiments, alkyl has 1 to 7 carbon atoms, and in more particular
embodiments 1 to 4 carbon atoms. Examples of alkyl include methyl,
ethyl, propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, or
tert-butyl. Particular examples for alkyl are methyl and ethyl.
[0040] The term "haloalkyl" denotes an alkyl group wherein at least
one of the hydrogen atoms of the alkyl group has been replaced by
same or different halogen atoms, particularly fluoro atoms.
Examples of haloalkyl include monofluoro-, difluoro- or
trifluoro-methyl, -ethyl or -propyl, for example
3,3,3-trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl,
fluoromethyl, or trifluoromethyl and the like. The term
"perhaloalkyl" denotes an alkyl group where all hydrogen atoms of
the alkyl group have been replaced by the same or different halogen
atoms.
[0041] The term "bicyclic ring system" denotes two rings which are
fused to each other via a common single or double bond (annelated
bicyclic ring system), via a sequence of three or more common atoms
(bridged bicyclic ring system) or via a common single atom (spiro
bicyclic ring system). Bicyclic ring systems can be saturated,
partially unsaturated, unsaturated or aromatic. Bicyclic ring
systems can comprise heteroatoms selected from N, O and S.
[0042] The term "cycloalkyl" denotes a saturated monocyclic or
bicyclic hydrocarbon group of 3 to 10 ring carbon atoms. In
particular embodiments cycloalkyl denotes a monovalent saturated
monocyclic hydrocarbon group of 3 to 8 ring carbon atoms. Bicyclic
means consisting of two saturated carbocycles having one or more
carbon atoms in common. Particular cycloalkyl groups are
monocyclic. Examples for monocyclic cycloalkyl are cyclopropyl,
cyclobutanyl, cyclopentyl, cyclohexyl or cycloheptyl. Examples for
bicyclic cycloalkyl are bicyclo[2.2.1]heptanyl, or
bicyclo[2.2.2]octanyl. One particular example of cycloalkyl is
cyclopropyl.
[0043] The term "heterocycloalkyl" denotes a saturated or partly
unsaturated mono-, bi- or tricyclic ring system of 3 to 9 ring
atoms, comprising 1, 2, or 3 ring heteroatoms selected from N, O
and S, the remaining ring atoms being carbon. In particular
embodiments, heterocycloalkyl is a monovalent saturated monocyclic
ring system of 4 to 7 ring atoms, comprising 1, 2, or 3 ring
heteroatoms selected from N, O and S, the remaining ring atoms
being carbon. Examples for monocyclic saturated heterocycloalkyl
are aziridinyl, oxiranyl, azetidinyl, oxetanyl, pyrrolidinyl,
tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl,
imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl,
piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl,
morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl,
azepanyl, diazepanyl, homopiperazinyl, or oxazepanyl. Examples for
bicyclic saturated heterocycloalkyl are 8-aza-bicyclo[3.2.1]octyl,
quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl,
9-aza-bicyclo[3.3.1]nonyl, 3-oxa-9-aza-bicyclo[3.3.1]nonyl, or
3-thia-9-aza-bicyclo[3.3.1]nonyl. Examples of a partly unsaturated
heterocycloalkyl are dihydrofuryl, imidazolinyl, dihydro-oxazolyl,
tetrahydro-pyridinyl, or dihydropyranyl. Particular examples of
heterocycloalkyl are 1,4-diazepanyl,
hexahydropyrrolo[1,2-a]pyrazinyl, piperidinyl, piperazinyl and
pyrrolidinyl. More particular examples of heterocycloalkyl are
hexahydropyrrolo[1,2-a]pyrazinyl and piperazinyl.
[0044] The term "N-heterocycloalkyl" denotes a heterocycloalkyl
radical containing at least one nitrogen ring atom and where the
point of attachment of the heterocycloalkyl radical to the rest of
the molecule is through a nitrogen ring atom. Particular examples
of N-heterocycloalkyl are 1,4-diazepanyl,
hexahydropyrrolo[1,2-a]pyrazinyl, piperidinyl, piperazinyl and
pyrrolidinyl. More particular examples of N-heterocycloalkyl are
hexahydropyrrolo[1,2-a]pyrazinyl and piperazinyl.
[0045] The term "basicity" in reference to a compound is expressed
herein by the negative decadic logarithm of the acidity constant of
the conjugate acid (pKa=-log Ka). The larger the pKa of the
conjugate acid, the stronger the base (pKa+pKb=14). In this
application, an atom or functional group is denoted "basic" if it
is suitable to accept a proton and if the calculated pKa of its
conjugate acid is at least 7, more particularly if the calculated
pKa of its conjugate acid is at least 7.8, most particularly if the
calculated pKa of its conjugate acid is at least 8. pKa values were
calculated in-silico as described in F. Milletti et al., J. Chem.
Inf. Model (2007) 47:2172-2181.
[0046] The term "alkylene" denotes a linear saturated divalent
hydrocarbon group of 1 to 7 carbon atoms or a divalent branched
saturated hydrocarbon group of 3 to 7 carbon atoms. Examples of
alkylene groups include methylene, ethylene, propylene,
2-methylpropylene, butylene, 2-ethylbutylene, pentylene, hexylene.
Particular examples for alkylene are ethylene, propylene, and
butylene.
[0047] The term "amino" denotes a group of the formula --NR'R''
wherein R' and R'' are independently hydrogen, alkyl, alkoxy,
cycloalkyl, heterocycloalkyl, aryl, heteroaryl or as described
herein. Alternatively, R' and R'', together with the nitrogen to
which they are attached, can form a heterocycloalkyl. The term
"primary amino" denotes a group wherein both R' and R'' are
hydrogen. The term "secondary amino" denotes a group wherein R' is
hydrogen and R'' is a group other than hydrogen. The term "tertiary
amino" denotes a group wherein both R' and R'' are other than
hydrogen. Particular secondary and tertiary amines are methylamine,
ethylamine, propylamine, isopropylamine, phenylamine, benzylamine
dimethylamine, diethylamine, dipropylamine and
diisopropylamine.
[0048] The term "active pharmaceutical ingredient" (or "API")
denotes the compound or molecule in a pharmaceutical composition
that has a particular biological activity.
[0049] The terms "pharmaceutical composition" and "pharmaceutical
formulation" (or "formulation") are used interchangeably and denote
a mixture or solution comprising a therapeutically effective amount
of an active pharmaceutical ingredient together with
pharmaceutically acceptable excipients to be administered to a
mammal, e.g., a human in need thereof.
[0050] The term "pharmaceutically acceptable" denotes an attribute
of a material which is useful in preparing a pharmaceutical
composition that is generally safe, non-toxic, and neither
biologically nor otherwise undesirable and is acceptable for
veterinary as well as human pharmaceutical use.
[0051] The terms "pharmaceutically acceptable excipient",
"pharmaceutically acceptable carrier" and "therapeutically inert
excipient" can be used interchangeably and denote any
pharmaceutically acceptable ingredient in a pharmaceutical
composition having no therapeutic activity and being non-toxic to
the subject administered, such as disintegrators, binders, fillers,
solvents, buffers, tonicity agents, stabilizers, antioxidants,
surfactants, carriers, diluents or lubricants used in formulating
pharmaceutical products.
[0052] The terms "individual" or "subject" refer to a mammal.
Mammals include, but are not limited to, domesticated animals
(e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans
and non-human primates such as monkeys), rabbits, and rodents
(e.g., mice and rats). In certain embodiments, the individual or
subject is a human.
[0053] The term "therapeutically effective amount" denotes an
amount of a compound or molecule of the present invention that,
when administered to a subject, (i) treats or prevents the
particular disease, condition or disorder, (ii) attenuates,
ameliorates or eliminates one or more symptoms of the particular
disease, condition, or disorder, or (iii) prevents or delays the
onset of one or more symptoms of the particular disease, condition
or disorder described herein. The therapeutically effective amount
will vary depending on the compound, the disease state being
treated, the severity of the disease treated, the age and relative
health of the subject, the route and form of administration, the
judgement of the attending medical or veterinary practitioner, and
other factors.
[0054] The terms "treating" or "treatment" of a disease state
include inhibiting the disease state, i.e., arresting the
development of the disease state or its clinical symptoms, or
relieving the disease state, i.e., causing temporary or permanent
regression of the disease state or its clinical symptoms.
[0055] The term "spinal muscular atrophy" (or SMA) relates to a
disease caused by an inactivating mutation or deletion in the SMN1
gene on both chromosomes, resulting in a loss of SMN1 gene
function.
Symptoms of SMA include muscle weakness, poor muscle tone, weak
cry, weak cough, limpness or a tendency to flop, difficulty sucking
or swallowing, difficulty breathing, accumulation of secretions in
the lungs or throat, clenched fists with sweaty hand,
flickering/vibrating of the tongue, head often tilted to one side,
even when lying down, legs that tend to be weaker than the arms,
legs frequently assuming a "frog legs" position, feeding
difficulties, increased susceptibility to respiratory tract
infections, bowel/bladder weakness, lower-than-normal weight,
inability to sit without support, failure to walk, failure to
crawl, and hypotonia, areflexia, and multiple congenital
contractures (arthrogryposis) associated with loss of anterior hom
cells.
[0056] The term "treating spinal muscular atrophy (SMA)" or
"treatment of spinal muscular atrophy (SMA)" includes one or more
of the following effects: (i) reduction or amelioration of the
severity of SMA; (ii) delay of the onset of SMA; (iii) inhibition
of the progression of SMA; (iv) reduction of hospitalization of a
subject; (v) reduction of hospitalization length for a subject;
(vi) increase of the survival of a subject; (vii) improvement of
the quality of life of a subject; (viii) reduction of the number of
symptoms associated with SMA; (ix) reduction of or amelioration of
the severity of one or more symptoms associated with SMA; (x)
reduction of the duration of a symptom associated with SMA; (xi)
prevention of the recurrence of a symptom associated with SMA;
(xii) inhibition of the development or onset of a symptom of SMA;
and/or (xiii) inhibition of the progression of a symptom associated
with SMA.
More particular, the term "treating SMA" denotes one or more of the
following beneficial effects: (i) a reduction in the loss of muscle
strength; (ii) an increase in muscle strength; (iii) a reduction in
muscle atrophy; (iv) a reduction in the loss of motor function; (v)
an increase in motor neurons; (vii) a reduction in the loss of
motor neurons; (viii) protection of SMN deficient motor neurons
from degeneration; (ix) an increase in motor function; (x) an
increase in pulmonary function; and/or (xi) a reduction in the loss
of pulmonary function. In further detail, the term "treating SMA"
refers to the functional ability or retention of the functional
ability for a human infant or a human toddler to sit up unaided or
for a human infant, a human toddler, a human child or a human adult
to stand up unaided, to walk unaided, to run unaided, to breathe
unaided, to turn during sleep unaided, or to swallow unaided.
[0057] The term "EC.sub.1.5.times. concentration for production of
full length SMN2 minigene mRNA" (or "EC.sub.1.5.times. minigene")
is defined as that concentration of test compound that is effective
in increasing the amount of full length SMN2 minigene mRNA to a
level 1.5-fold greater relative to that in vehicle-treated
cells.
[0058] The term "EC.sub.1.5.times. concentration for SMN protein
expression" (or "EC.sub.1.5.times. SMN protein") is defined as that
concentration of test compound that is effective in producing 1.5
times the amount of SMN protein in an SMA patient fibroblast cell
compared to the amount produced from the vehicle control.
[0059] In detail, the present invention relates to compounds of
formula (I)
##STR00003##
[0060] wherein [0061] R.sup.1 is hydrogen or C.sub.1-7-alkyl;
[0062] R.sup.2 is hydrogen, cyano, C.sub.1-7-haloalkyl or
C.sub.3-8-cycloalkyl; [0063] R.sup.3 is hydrogen, C.sub.1-7-alkyl,
or C.sub.3-8-cycloalkyl; [0064] A is N-heterocycloalkyl or
NR.sup.12R.sup.13, wherein N-heterocycloalkyl comprises 1 or 2
nitrogen ring atoms and is optionally substituted with 1, 2, 3 or 4
substituents selected from R.sup.14; [0065] R.sup.12 is
heterocycloalkyl comprising 1 nitrogen ring atom, wherein
heterocycloalkyl is optionally substituted with 1, 2, 3 or 4
substituents selected from R.sup.14; [0066] R.sup.13 is hydrogen,
C.sub.1-7-alkyl or C.sub.3-8-cycloalkyl; [0067] R.sup.14 is
independently selected from hydrogen, C.sub.1-7-alkyl, amino,
amino-C.sub.1-7-alkyl, C.sub.3-8-cycloalkyl and heterocycloalkyl or
two R.sup.14 together form C.sub.1-7-alkylene; [0068] with the
proviso that if A is N-heterocycloalkyl comprising only 1 nitrogen
ring atom, then at least one R.sup.14 substituent is amino or
amino-C.sub.1-7-alkyl; [0069] and pharmaceutically acceptable salts
thereof.
[0070] Particular embodiments of the present invention are
compounds of formula (I) and pharmaceutically acceptable salts
thereof.
[0071] Further, it is to be understood that every embodiment
relating to a specific A, R.sup.1, R.sup.2 or R.sup.3 as disclosed
herein may be combined with any other embodiment relating to
another A, R.sup.1, R.sup.2 or R.sup.3 as disclosed herein.
[0072] A particular embodiment of the present invention relates to
compounds of formula (I) wherein [0073] R.sup.1 is hydrogen or
C.sub.1-7-alkyl; [0074] R.sup.2 is hydrogen, cyano,
C.sub.1-7-haloalkyl or C.sub.3-8-cycloalkyl; [0075] R.sup.3 is
hydrogen, C.sub.1-7-alkyl, or C.sub.3-8-cycloalkyl; [0076] A is
N-heterocycloalkyl comprising 1 or 2 nitrogen ring atoms, wherein
N-heterocycloalkyl is optionally substituted with 1, 2, 3 or 4
substituents selected from R.sup.14; [0077] R.sup.14 is
independently selected from hydrogen, C.sub.1-7-alkyl, amino,
amino-C.sub.1-7-alkyl, C.sub.3-8-cycloalkyl and heterocycloalkyl or
two R.sup.14 together form C.sub.1-7-alkylene; [0078] with the
proviso that if A is N-heterocycloalkyl comprising only 1 nitrogen
ring atom, then at least one R.sup.14 substituent is amino or
amino-C.sub.1-7-alkyl; [0079] and pharmaceutically acceptable salts
thereof.
[0080] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.1 is C.sub.1-7-alkyl,
particularly methyl.
[0081] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.2 is hydrogen or
C.sub.1-7-alkyl, particularly hydrogen or methyl.
[0082] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.3 is hydrogen or
C.sub.1-7-alkyl, particularly hydrogen or methyl.
[0083] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.12 is piperidinyl
optionally substituted with 1, 2, 3 or 4 substituents selected from
R.sup.14.
[0084] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.13 is hydrogen or
C.sub.1-7-alkyl, particularly hydrogen or methyl.
[0085] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.14 is independently
selected from C.sub.1-7-alkyl and heterocycloalkyl or two R.sup.14
together form C.sub.1-7-alkylene.
[0086] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.14 is independently
selected from methyl, ethyl and pyrrolidinyl or two R.sup.14
together form ethylene.
[0087] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is a saturated mono- or
bicyclic N-heterocycloalkyl comprising 1 or 2 nitrogen atoms and is
optionally substituted with 1, 2, 3 or 4 substituents selected from
R.sup.14.
[0088] A particular embodiment of the present invention relates to
compounds of formula (I), wherein the N-heterocycloalkyl in A or
the heterocycloalkyl in R.sup.12 as defined herein are substituted
with 1 or 2 substituents selected from R.sup.14.
[0089] A particular embodiment of the present invention relates to
compounds of formula (I), wherein the N-heterocycloalkyl in A as
defined herein is further characterized in that one ring nitrogen
atoms is basic.
[0090] A particular embodiment of the present invention relates to
compounds of formula (I),
##STR00004##
wherein A is wherein [0091] X is N or CH; [0092] R.sup.4 is
hydrogen, C.sub.1-7-alkyl or --(CH.sub.2).sub.m--NR.sup.9R.sup.10;
[0093] R.sup.5 is hydrogen or C.sub.1-7-alkyl; [0094] R.sup.6 is
hydrogen or C.sub.1-7-alkyl; [0095] R.sup.7 is hydrogen or
C.sub.1-7-alkyl; [0096] R.sup.8 is hydrogen or C.sub.1-7-alkyl;
[0097] R.sup.9 and R.sup.10 are independently selected from
hydrogen, C.sub.1-7-alkyl and C.sub.3-8-cycloalkyl; [0098] R.sup.13
is hydrogen, C.sub.1-7-alkyl or C.sub.3-8-cycloalkyl; [0099] n is
0, 1 or 2; [0100] m is 0, 1, 2 or 3; [0101] or R.sup.4 and R.sup.5
together form a C.sub.1-7-alkylene; [0102] or R.sup.4 and R.sup.7
together form a C.sub.1-7-alkylene; [0103] or R.sup.5 and R.sup.6
together form a C.sub.2-7-alkylene; [0104] or R.sup.5 and R.sup.7
together form a C.sub.1-7-alkylene; [0105] or R.sup.5 and R.sup.9
together form a C.sub.1-7-alkylene; [0106] or R.sup.7 and R.sup.8
together form a C.sub.2-7-alkylene; [0107] or R.sup.7 and R.sup.9
together form a C.sub.1-7-alkylene; [0108] or R.sup.9 and R.sup.10
together form a C.sub.2-7-alkylene; [0109] with the proviso that if
X is CH then R.sup.4 is --(CH.sub.2).sub.m--NR.sup.9R.sup.10; and
[0110] with the proviso that if X is N and R.sup.4 is
--(CH.sub.2).sub.m--NR.sup.9R.sup.10 then m is 2 or 3.
[0111] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is
##STR00005##
wherein [0112] X is N or CH; [0113] R.sup.4 is hydrogen,
C.sub.1-7-alkyl or --(CH.sub.2).sub.m--NR.sup.9R.sup.10; [0114]
R.sup.5 is hydrogen or C.sub.1-7-alkyl; [0115] R.sup.6 is hydrogen
or C.sub.1-7-alkyl; [0116] R.sup.7 is hydrogen or C.sub.1-7-alkyl;
[0117] R.sup.8 is hydrogen or C.sub.1-7-alkyl; [0118] R.sup.9 and
R.sup.10 are independently selected from hydrogen, C.sub.1-7-alkyl
and C.sub.3-8-cycloalkyl; [0119] n is 0, 1 or 2; [0120] m is 0, 1,
2 or 3; [0121] or R.sup.4 and R.sup.5 together form
C.sub.1-7-alkylene; [0122] or R.sup.4 and R.sup.7 together form
C.sub.1-7-alkylene; [0123] or R.sup.5 and R.sup.6 together form
C.sub.2-7-alkylene; [0124] or R.sup.5 and R.sup.7 together form
C.sub.1-7-alkylene; [0125] or R.sup.5 and R.sup.9 together form
C.sub.1-7-alkylene; [0126] or R.sup.7 and R.sup.8 together form
C.sub.2-7-alkylene; [0127] or R.sup.7 and R.sup.9 together form
C.sub.1-7-alkylene; [0128] or R.sup.9 and R.sup.10 together form
C.sub.2-7-alkylene; [0129] with the proviso that if X is CH then
R.sup.4 is --(CH.sub.2).sub.m--NR.sup.9R.sup.10; and [0130] with
the proviso that if X is N and R.sup.4 is
--(CH.sub.2).sub.m--NR.sup.9R.sup.10 then m is 2 or 3.
[0131] It has been found that brain penetration is improved when at
least one of R.sup.4, R.sup.5, R.sup.6, R.sup.7 and R.sup.8 is not
hydrogen.
[0132] In a particular embodiment of the invention at least one of
R.sup.4, R.sup.5, R.sup.6, R.sup.7 and R.sup.8 is other than
hydrogen.
[0133] A particular embodiment of the present invention relates to
compounds of formula (I), wherein X is N.
[0134] A particular embodiment of the present invention relates to
compounds of formula (I), wherein n is 1.
[0135] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.4 is hydrogen, methyl or
--(CH.sub.2).sub.m--NR.sup.9R.sup.10, more particularly
hydrogen.
[0136] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.5 is hydrogen, methyl or
ethyl, more particularly methyl.
[0137] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.6 is hydrogen or methyl,
more particularly hydrogen.
[0138] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.7 is hydrogen or
methyl.
[0139] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.8 is hydrogen.
[0140] A particular embodiment of the present invention relates to
compounds of formula (I), wherein m is 0.
[0141] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.4 and R.sup.5 together form
propylene.
[0142] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.5 and R.sup.6 together form
ethylene;
[0143] A particular embodiment of the present invention relates to
compounds of formula (I), wherein R.sup.9 and R.sup.10 together
form butylene.
[0144] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group
of:
##STR00006##
wherein R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8 and R.sup.13
are as defined herein and wherein R.sup.11 is hydrogen or
C.sub.1-7-alkyl.
[0145] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group
of:
##STR00007##
wherein R.sup.4, R.sup.5, R.sup.6, R.sup.7 and R.sup.8 are as
defined herein and wherein R.sup.11 is hydrogen or
C.sub.1-7-alkyl.
[0146] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group of
piperazinyl, diazepanyl, pyrrolidinyl and
hexahydropyrrolo[1,2-a]pyrazinyl, each optionally substituted with
1, 2, 3 or 4 substituents selected from R.sup.14 as defined
herein.
[0147] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group of
piperazin-1-yl, 1,4-diazepan-1-yl, pyrrolidin-1-yl and
hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, each optionally
substituted with 1 or 2 substituents selected from R.sup.14 as
defined herein.
[0148] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is NR.sup.12R.sup.13, wherein
R.sup.12 and R.sup.13 are as described herein.
[0149] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is
##STR00008##
wherein R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8 and R.sup.13
are as described herein.
[0150] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is
##STR00009##
wherein R.sup.13 is hydrogen or methyl.
[0151] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group
of:
##STR00010##
[0152] A particular embodiment of the present invention relates to
compounds of formula (I), wherein A is selected from the group
of:
##STR00011##
[0153] Particular compounds of formula (I) of the present invention
are those selected from the group consisting of: [0154]
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-(4-methylpiperazin-1-yl)pyrido-
[1,2-a]pyrimidin-4-one; [0155]
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0156]
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0157]
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0158]
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2,-
8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0159]
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl-
]-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one-
; [0160]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimet-
hylpiperazin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0161]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1--
yl]pyrido[1,2-a]pyrimidin-4-one; [0162]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1--
yl]pyrido[1,2-a]pyrimidin-4-one; [0163]
7-(1,4-diazepan-1-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[-
1,2-a]pyrimidin-4-one; [0164]
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]p-
yrido[1,2-a]pyrimidin-4-one; [0165]
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]p-
yrido[1,2-a]pyrimidin-4-one; [0166]
7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2--
a]pyrimidin-4-one; [0167]
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0168]
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0169]
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2--
methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0170]
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2--
methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0171]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyr-
rolidin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0172]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl-
)pyrido[1,2-a]pyrimidin-4-one; [0173]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one; [0174]
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyrroli-
din-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0175]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-y-
l)pyrido[1,2-a]pyrimidin-4-one; [0176]
7-(3,3-dimethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)py-
rido[1,2-a]pyrimidin-4-one; [0177]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0178]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3R)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0179]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R,5S)-3,5-dimethylpiper-
azin-1-yl]-9-methyl-pyrido[1,2-a]pyrimidin-4-one; [0180]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-y-
l)-9-methyl-pyrido[1,2-a]pyrimidin-4-one; [0181]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)-9-methyl-pyrido[1,2-a]pyrimidin-4-one; [0182]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5S)-3,5-dimethylpiper-
azin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0183]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyr-
rolidin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0184]
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyrroli-
din-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0185]
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0186]
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperaz-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0187]
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperaz-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0188]
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0189]
7-(3,3-dimethylpiperazin-1-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyridazi-
n-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0190]
7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyrid-
azin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0191]
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0192]
7-[(3R)-3-ethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)py-
rido[1,2-a]pyrimidin-4-one; and pharmaceutically acceptable salts
thereof.
[0193] Particular compounds of formula (I) of the present invention
are those selected from the group consisting of: [0194]
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0195]
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0196]
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dim-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one;
[0197]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimethylpiper-
azin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0198]
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0199]
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methy-
limidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0200]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl-
)pyrido[1,2-a]pyrimidin-4-one; [0201]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one; [0202]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpip-
erazin-1-yl]pyrido[1,2-a]pyrimidin-4-one; [0203]
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin--
6-yl)-9-methyl-pyrido[1,2-a]pyrimidin-4-one; [0204]
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]-
pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one; [0205]
7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyrid-
azin-6-yl)pyrido[1,2-a]pyrimidin-4-one; and pharmaceutically
acceptable salts thereof.
[0206] Compounds of formula (VI) are suitable as intermediates in
the manufacture of compounds of formula (I).
[0207] Another embodiment of the invention relates to compounds of
formula (VI)
##STR00012##
[0208] wherein R.sup.1, R.sup.2 and R.sup.3 are as described
herein;
[0209] Y is halogen or trifluoromethanesulfonate;
[0210] and salts thereof.
[0211] A particular embodiment of the present invention relates to
compounds of formula (VI), wherein Y is fluoro, chloro, bromo, iodo
or trifluoromethanesulfonate, particularly fluoro.
[0212] Particular compounds of formula (VI) of the present
invention are those selected from the group consisting of: [0213]
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-
-one; [0214]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one; [0215]
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one; [0216]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one; and salts thereof.
[0217] Manufacturing Processes
[0218] Compounds of formula (I) and pharmaceutically acceptable
salts thereof as defined above can be prepared following standard
methods known in the art.
[0219] As illustrated in Scheme 1, the commercially available
amino-pyridine of formula (II) can be reacted with a malonic ester
to afford the intermediate of formula (III), wherein Y and R.sup.3
are as described herein and R is C.sub.1-2-alkyl, particularly
methyl. The compound of formula (III) is then treated with a
chlorinating reagent (such as POCl.sub.3 and the like) to provide a
compound of formula (IV). The compound of formula (IV) is then
reacted in a Suzuki cross-coupling reaction with a compound of
formula (V), wherein R.sup.1 and R.sup.2 are as described herein
and Z is B(OH).sub.2 or an C.sub.1-7-alkyl boronic acid ester such
as 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl, in the presence of
a catalyst (such as
(1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride
(Pd(dppf)Cl.sub.2) and the like) and a base (such as
K.sub.2CO.sub.3 and the like) in a suitable solvent (such as DMF
and the like), to afford the compound of formula (VI). Finally, the
compound of formula (VI) is reacted with a compound M-A either in:
[0220] a) an aromatic nucleophilic substitution reaction
(particularly if Y is fluoro) by heating at a temperature from
80.degree. C. to 200.degree. C.; or [0221] b) a Buchwald-Hartwig
amination reaction in the presence of a palladium catalyst (e.g.
tetrakis(triphenylphosphine)palladium (Pd(PPh.sub.3).sub.4) or
bis(dibenzylideneacetone)palladium (Pd(dba).sub.2) by heating at a
temperature from 20.degree. C. to 100.degree. C.;
[0222] in a solvent (e.g. dimethyl sulfoxide (DMSO),
N-methylpyrrolidone (NMP), or dimethylformamide (DMF)) to give a
compound of formula (I), wherein A is as defined herein, M is
hydrogen, sodium or potassium, particularly hydrogen, and wherein M
is linked to A via a nitrogen atom of A.
##STR00013##
[0223] In one embodiment, the invention relates to a process for
the manufacture of compounds of formula (I) and pharmaceutically
acceptable salts thereof as defined above, comprising the reaction
of a compound of formula (VI) with a compound M-A either in: [0224]
a) an aromatic nucleophilic substitution reaction (particularly if
Y is fluoro) by heating at a temperature from 80.degree. C. to
200.degree. C.; or [0225] b) a Buchwald-Hartwig amination reaction
in the presence of a palladium catalyst (e.g.
tetrakis(triphenylphosphine)palladium (Pd(PPh.sub.3).sub.4) or
bis(dibenzylideneacetone)palladium Pd(dba).sub.2) by heating at a
temperature from 20.degree. C. to 100.degree. C.;
[0226] in a solvent (e.g. dimethyl sulfoxide (DMSO),
N-methylpyrrolidone (NMP), or dimethylformamide (DMF)), wherein A,
Y, R.sup.1, R.sup.2 and R.sup.3 are as defined herein, M is
hydrogen, sodium or potassium, particularly hydrogen, and wherein M
is linked to A via a nitrogen atom of A.
##STR00014##
A particular embodiment of the invention relates to a process for
the preparation of compounds of formula (I) and pharmaceutically
acceptable salts thereof as defined above, comprising an aromatic
nucleophilic substitution reaction between a compound of formula
(VI) as described above with a compound of formula M-A by heating
in a solvent, wherein A, R.sup.1, R.sup.2, R.sup.3 and Y are as
defined above, M is hydrogen, sodium or potassium, and wherein M is
linked to A via a nitrogen atom of A.
[0227] A particular embodiment of the invention relates to a
process for the preparation of compounds of formula (I) and
pharmaceutically acceptable salts thereof as defined above, wherein
the aromatic nucleophilic substitution reaction is performed at a
temperature from 80.degree. C. to 200.degree. C.
[0228] A particular embodiment of the invention relates to a
process for the preparation of compounds of formula (I) and
pharmaceutically acceptable salts thereof as defined above, wherein
the solvent of the aromatic nucleophilic substitution reaction is
selected from dimethyl sulfoxide (DMSO), N-methylpyrrolidone (NMP),
and dimethylformamide (DMF).
[0229] A particular embodiment of the invention relates to a
process for the preparation of compounds of formula (I) and
pharmaceutically acceptable salts thereof as defined above, wherein
M is hydrogen.
[0230] Particularly, compounds of formula (I) and pharmaceutically
acceptable salts thereof can be prepared in accordance to the
methods described in the examples herein.
[0231] Pharmaceutical Compositions
[0232] Another embodiment provides pharmaceutical compositions or
medicaments comprising the compounds of the invention and a
therapeutically inert carrier, diluent or pharmaceutically
acceptable excipient, as well as methods of using the compounds of
the invention to prepare such compositions and medicaments.
[0233] Compositions are formulated, dosed, and administered in a
fashion consistent with good medical practice. Factors for
consideration in this context include the particular disorder being
treated, the particular mammal being treated, the clinical
condition of the individual patient, the cause of the disorder, the
site of delivery of the agent, the method of administration, the
scheduling of administration, and other factors known to medical
practitioners.
[0234] The compounds of the invention may be administered by any
suitable means, including oral, topical (including buccal and
sublingual), rectal, vaginal, transdermal, parenteral,
subcutaneous, intraperitoneal, intrapulmonary, intradermal,
intrathecal and epidural and intranasal, and, if desired for local
treatment, intralesional administration. Parenteral infusions
include intramuscular, intravenous, intraarterial, intraperitoneal,
or subcutaneous administration.
[0235] The compounds of the present invention may be administered
in any convenient administrative form, e.g., tablets, powders,
capsules, solutions, dispersions, suspensions, syrups, sprays,
suppositories, gels, emulsions, patches, etc. Such compositions may
comprise components conventional in pharmaceutical preparations,
e.g., diluents, carriers, pH modifiers, preservatives,
solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners,
colorants, flavorants, salts for varying the osmotic pressure,
buffers, masking agents, antioxidants, and further active agents.
They can also comprise still other therapeutically valuable
substances.
[0236] A typical formulation is prepared by mixing a compound of
the present invention and a carrier or excipient. Suitable carriers
and excipients are well known to those skilled in the art and are
described in detail in, e.g., Ansel H. C. et al., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems (2004)
Lippincott, Williams & Wilkins, Philadelphia; Gennaro A. R. et
al., Remington: The Science and Practice of Pharmacy (2000)
Lippincott, Williams & Wilkins, Philadelphia; and Rowe R. C,
Handbook of Pharmaceutical Excipients (2005) Pharmaceutical Press,
Chicago. The formulations may also include one or more buffers,
stabilizing agents, surfactants, wetting agents, lubricating
agents, emulsifiers, suspending agents, preservatives,
antioxidants, opaquing agents, glidants, processing aids,
colorants, sweeteners, perfuming agents, flavoring agents, diluents
and other known additives to provide an elegant presentation of the
drug (i.e., a compound of the present invention or pharmaceutical
composition thereof) or aid in the manufacturing of the
pharmaceutical product (i.e., medicament).
[0237] The dosage at which compounds of the invention can be
administered can vary within wide limits and will, of course, be
fitted to the individual requirements in each particular case. In
general, in the case of oral administration a daily dosage of about
0.01 to 1000 mg per person of a compound of general formula (I)
should be appropriate, although the above upper limit can also be
exceeded when necessary.
[0238] An example of a suitable oral dosage form is a tablet
comprising about 100 mg to 500 mg of the compound of the invention
compounded with about 30 to 90 mg anhydrous lactose, about 5 to 40
mg sodium croscarmellose, about 5 to 30 mg polyvinylpyrrolidone
(PVP) K30, and about 1 to 10 mg magnesium stearate. The powdered
ingredients are first mixed together and then mixed with a solution
of the PVP. The resulting composition can be dried, granulated,
mixed with the magnesium stearate and compressed to tablet form
using conventional equipment.
[0239] An example of an aerosol formulation can be prepared by
dissolving the compound, for example 10 to 100 mg, of the invention
in a suitable buffer solution, e.g. a phosphate buffer, adding a
tonicifier, e.g. a salt such as sodium chloride, if desired. The
solution may be filtered, e.g., using a 0.2 .mu.m filter, to remove
impurities and contaminants.
Uses
[0240] As described above, the compounds of formula (I) and their
pharmaceutically acceptable salts possess valuable pharmacological
properties and have been found to enhance inclusion of exon 7 of
SMN1 and/or SMN2 into mRNA transcribed from the SMN1 and/or SMN2
gene, thereby increasing expression of SMN protein in a human
subject in need thereof.
[0241] The compounds of the present invention can be used, either
alone or in combination with other drugs, for the treatment or
prevention of diseases caused by an inactivating mutation or
deletion in the SMN1 gene and/or associated with loss or defect of
SMN1 gene function. These diseases include, but are not limited to
spinal muscular atrophy (SMA).
[0242] A particular embodiment of the present invention relates to
pharmaceutical compositions comprising compounds of formula (I) as
defined above or their pharmaceutically acceptable salts as defined
above and one or more pharmaceutically acceptable excipients.
[0243] A particular embodiment of the present invention relates to
pharmaceutical compositions comprising compounds of formula (I) or
their pharmaceutically acceptable salts as defined above and one or
more pharmaceutically acceptable excipients for the treatment or
prevention of diseases caused by an inactivating mutation or
deletion in the SMN1 gene and/or associated with loss or defect of
SMN1 gene function, particularly for the treatment or prevention of
SMA.
[0244] A particular embodiment of the present invention relates to
compounds of formula (I) or their pharmaceutically acceptable salts
as defined above for use as therapeutically active substances,
especially for use as therapeutically active substances for the
treatment or prevention of diseases caused by an inactivating
mutation or deletion in the SMN1 gene and/or associated with loss
or defect of SMN1 gene function, particularly for the treatment or
prevention of spinal muscular atrophy (SMA).
[0245] A particular embodiment of the present invention relates to
compounds of formula (I) or their pharmaceutically acceptable salts
as defined above for the use in the treatment or prevention of
diseases caused by an inactivating mutation or deletion in the SMN1
gene and/or associated with loss or defect of SMN1 gene function,
particularly for use in the treatment or prevention of spinal
muscular atrophy (SMA).
[0246] A particular embodiment of the present invention relates to
a method for the treatment or prevention of diseases caused by an
inactivating mutation or deletion in the SMN1 gene and/or
associated with loss or defect of SMN1 gene function, particularly
for the treatment or prevention of spinal muscular atrophy (SMA),
which method comprises administering compounds of formula (I) or
their pharmaceutically acceptable salts as defined above to a
subject.
[0247] A particular embodiment of the present invention relates to
the use of compounds of formula (I) or their pharmaceutically
acceptable salts as defined above for the treatment or prevention
of diseases caused by an inactivating mutation or deletion in the
SMN1 gene and/or associated with loss or defect of SMN1 gene
function, particularly for the treatment or prevention of spinal
muscular atrophy (SMA).
[0248] A particular embodiment of the present invention relates to
the use of compounds of formula (I) or their pharmaceutically
acceptable salts as defined above for the preparation of
medicaments for the treatment or prevention of diseases caused by
an inactivating mutation or deletion in the SMN1 gene and/or
associated with loss or defect of SMN1 gene function, particularly
for the treatment or prevention of spinal muscular atrophy (SMA).
Such medicaments comprise compounds of formula (I) or their
pharmaceutically acceptable salts as defined above.
EXAMPLES
[0249] The invention will be more fully understood by reference to
the following examples. They should however not be construed as
limiting the scope of the invention.
[0250] Abbreviations Used
[0251] ACN: Acetonitrile; CH.sub.2Cl.sub.2: dichloromethane; DIPEA:
diisopropyl ethylamine; DMA: dimethyl acetamide; TEA:
triethylamine; RT: room temperature; B.sub.2(pin).sub.2:
bis(pinacolato)diboron; Pd(dppf)Cl.sub.2:
(1,1'-Bis(diphenylphosphino)ferrocene)palladium(II) dichloride;
PPTS: Pyridinium p-toluenesulfonate.
Intermediate 1
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4--
one
a) 2-chloro-7-fluoro-pyrido[1,2-a]pyrimidin-4-one
##STR00015##
[0253] A mixture of 2-amino-5-fluoropyridine (11.20 g, 0.10 mol)
and dimethyl malonate (57.0 mL, 0.50 mol) was heated at 230.degree.
C. for 1.5 h. After cooling to room temperature, the precipitate
was filtered and washed with ACN (3.times.) to give
7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one as a dark solid
(14 g), which was used directly in the next step. MS m/z 181.3
[M+H].sup.+.
[0254] A dark mixture of crude
7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one (14 g, .about.77
mmol) in POCl.sub.3 (50 mL) and DIPEA (13.3 mL, 77 mmol) was heated
at 110.degree. C. for 15 hours. The solvent was removed and the
dark residue was treated with ice-water, washed with water
(3.times.) and dried to give a brown solid. The crude brown solid
was chromatographed (5% MeOH in CH.sub.2Cl.sub.2) to give
2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid
(9.84 g, 50%, 2 steps), MS m/z 199.2 [M+H].sup.+.
b)
2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]p-
yridazine
##STR00016##
[0256] A mixture of 6-chloro-2-methylimidazo[1,2-b]pyridazine (900
mg, 5.37 mmol),
4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (1.36
g, 5.37 mmol, 1.0 eq.), KOAc (1.05 g, 10.7 mmol) and
Pd(dppf)Cl.sub.2.CH.sub.2Cl.sub.2 (393 mg, 0.54 mmol) in dioxane
(50 mL) was degassed and heated under N.sub.2 at 95.degree. C.
After 15 hours, the mixture was diluted with EtOAc, filtered
through celite and concentrated under vacuum to give
2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyr-
idazine which was used directly in the next step.
c)
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-
-4-one
##STR00017##
[0258] To a solution of
2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (750 mg, 3.78
mmol) in ACN (36 mL) was added
2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyr-
idazine (1.17 g, 4.53 mmol, Eq: 1.2), Pd(Ph.sub.3P).sub.4 (218 mg,
0.189 mmol, 0.05 eq.) and an aqueous solution of K.sub.2CO.sub.3
(3.78 mL, 7.55 mmol, 2.0 eq.). The mixture was degassed and heated
under argon at 105.degree. C. overnight. The reaction was cooled to
RT, and filtered. The precipitate was washed with Et.sub.2O and
then water, dried in vacuo to give 250 mg (22%) of
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-
-one as a light brown solid. MS m/z 296.1 [M+H].sup.+.
Intermediate 2
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido
pyrimidin-4-one
a)
2,8-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-
-b]pyridazine
##STR00018##
[0260] In a sealed flask, 3,6-dichloro-4-methylpyridazine (27 g,
161 mmol) was suspended in aqueous ammonia (25%, 300 mL). The
reaction mixture was heated at 110.degree. C. for 48 hours (turned
into solution after 1 hour). After cooling to room temperature, the
reaction was poured into CH.sub.2Cl.sub.2, and the organic phase
was separated, dried over Na.sub.2SO.sub.4, and concentrated under
vacuum, to give 22.4 g of 6-chloro-4-methyl-pyridazin-3-amine and
6-chloro-5-methyl-pyridazin-3-amine as a mixture of regioisomers
which were used directly in the next step.
[0261] The mixture of regioisomers
6-chloro-4-methyl-pyridazin-3-amine and
6-chloro-5-methyl-pyridazin-3-amine (22.4 g) was suspended in
2-propanol (300 mL). 1-bromo-2,2-dimethoxypropane (36.0 g, 26.6 mL,
193 mmol, 1.2 eq.) and PPTS (2.96 g, 11.6 mmol, 0.0725 eq.) were
added, and the resulting solution was heated at 105.degree. C.
overnight. The solvent was removed in vacuo and the residue was
taken up in CH.sub.2Cl.sub.2 and washed with NaHCO.sub.3. The
organic phases were dried over Na.sub.2SO.sub.4, concentrated in
vacuo and the crude light brown solid was chromatographed
(EtOAc/Heptane 1/2-1/1) to give separately 6.1 g of
6-chloro-2,8-dimethyl-imidazo[1,2-b]pyridazine MS m/z 182.1
[M+H].sup.+ (21%) as a white solid and 5.9 g of
6-chloro-2,7-dimethyl-imidazo[1,2-b]pyridazine MS m/z 182.1
[M+H].sup.+ (20%) as a white solid.
[0262] A mixture of 6-chloro-2,8-dimethylimidazo[1,2-b]pyridazine
(0.9 g, 4.96 mmol),
4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (1.26
g, 4.96 mmol, 1.0 eq.), KOAc (0.97 g, 9.91 mmol) and
Pd(dppf)Cl.sub.2.CH.sub.2Cl.sub.2 (363 mg, 0.49 mmol) in dioxane
(50 mL) was degassed and heated under N.sub.2 at 110.degree. C.
After 15 hours, the mixture was diluted with EtOAc, filtered
through celite and concentrated under vacuum to give
2,8-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b-
]pyridazine which was used directly in the next step.
b)
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyri-
midin-4-one
##STR00019##
[0264] To a solution of
2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (750 mg, 3.78
mmol, described herein above) in ACN (36 mL) was added
2,8-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b-
]pyridazine (1.24 g, 4.53 mmol, 1.2 eq.), Pd(Ph.sub.3P).sub.4 (218
mg, 0.189 mmol, 0.05 eq.) and an aqueous solution of
K.sub.2CO.sub.3 (3.78 mL, 7.55 mmol, 2.0 eq.). The mixture was
degassed and heated under argon at 100.degree. C. for 6 hours. The
reaction was cooled to RT, and filtered. The precipitate was washed
with Et.sub.2O and then water, dried in vacuo to give 700 mg (60%)
of
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one as a light brown solid. MS m/z 310.1 [M+H].sup.+.
Intermediate 3
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyr-
imidin-4-one
a) 2-chloro-7-fluoro-9-methyl-pyrido[1,2-a]pyrimidin-4-one
##STR00020##
[0266] A mixture of 5-fluoro-3-methylpyridin-2-amine (3.3 g, 26.2
mmol) and dimethyl malonate (15.0 mL, 0.13 mol, 5.0 eq.) was heated
at 210.degree. C. for 1.5 hours. After cooling to room temperature,
the precipitate was filtered and washed with ACN (3.times.) to give
7-fluoro-2-hydroxy-9-methyl-pyrido[1,2-a]pyrimidin-4-one as a dark
solid (2.3 g), which was used directly in the next step. MS m/z
195.1 [M+H].sup.+.
[0267] A mixture of crude
7-fluoro-2-hydroxy-9-methyl-pyrido[1,2-a]pyrimidin-4-one (2.3 g,
11.8 mmol) in POCl.sub.3 (7.7 mL, 82.9 mmol) and DIEA (2.07 mL,
11.8 mmol) was heated at 110.degree. C. for 15 hours. The solvent
was removed and the residue was treated with ice-water, washed with
water (3.times.) and dried to give a brown solid. The crude brown
solid was chromatographed (5% MeOH in CH.sub.2Cl.sub.2) to give
2-chloro-7-fluoro-9-methyl-pyrido[1,2-a]pyrimidin-4-one as a yellow
solid (1.77 g, 70% over 2 steps), MS m/z 213.1 [M+H].sup.+.
b)
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]-
pyrimidin-4-one
##STR00021##
[0269] To a solution of
2-chloro-7-fluoro-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one (2.2 g,
10.3 mmol) in ACN (80 mL) was added
2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b]pyr-
idazine (3.22 g, 12.4 mmol, 1.2 eq., described herein above),
Pd(Ph.sub.3P).sub.4 (1.20 g, 1.03 mmol, 0.1 eq.) and an aqueous
solution of K.sub.2CO.sub.3 (10.3 mL, 20.7 mmol, 2.0 eq.). The
mixture was degassed and heated under argon at 100.degree. C. for 6
hours. The reaction was cooled to RT, and filtered. The precipitate
was washed with Et.sub.2O and then water, dried in vacuo to give
1.80 g (56%) of
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one as a light brown solid. MS m/z 310.1 [M+H].sup.+.
Intermediate 4
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2--
a]pyrimidin-4-one
##STR00022##
[0271] To a solution of
2-chloro-7-fluoro-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one (0.98 g,
4.61 mmol, described herein above) in ACN (50 mL) was added
2,8-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-b-
]pyridazine (1.51 g, 5.53 mmol, 1.2 eq., described herein above),
Pd(Ph.sub.3P).sub.4 (0.32 g, 0.277 mmol, 0.06 eq.) and an aqueous
solution of K.sub.2CO.sub.3 (4.61 mL, 9.22 mmol, 2.0 eq.). The
mixture was degassed and heated under argon at 100.degree. C. for 6
hours. The reaction was cooled to RT, and filtered. The precipitate
was washed with Et.sub.2O and water, then dried in vacuo to give
0.89 g (60%) of
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one as a light brown solid. MS m/z 324.4
[M+H].sup.+.
Example 1
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-(4-methylpiperazin-1-yl)pyrido[-
1,2-a]pyrimidin-4-one
##STR00023##
[0273] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 35 mg, 0.119 mmol) and 1-methylpiperazine
(47.5 mg, 0.474 mmol, 4 eq.) were stirred in DMSO (1 mL) at
120.degree. C. overnight. LC-MS showed total conversion. The
solvent was removed under high vacuum. The crude product was
purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 9/1) to afford the title product (25
mg, 56%) as a light yellow solid. MS m/z 376.3 [M+H.sup.+].
Example 2
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methyl-
imidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00024##
[0275] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 125 mg, 0.426 mmol) and
(R)-octahydropyrrolo-[1,2-a]pyrazine (160 mg, 1.27 mmol, 3 eq.)
were stirred in DMSO (5 mL) at 125.degree. C. overnight. The
solvent was removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=98/2 to
95/5) to afford the title product (65 mg, 38%) as a light yellow
solid. MS m/z 402.5 [M+H.sup.+].
Example 3
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dime-
thylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00025##
[0277] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 200 mg, 0.647 mmol) and
(S)-octahydropyrrolo-[1,2-a]pyrazine (286 mg, 2.26 mmol, 3.5 eq.)
were stirred in DMSO (5 mL) at 125.degree. C. overnight. The
solvent was removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=98/2 to
95/5) to afford the title product (115 mg, 43%) as a light yellow
solid. MS m/z 416.3 [M+H.sup.+].
Example 4
7-[(8aR)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2,8-dime-
thylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00026##
[0279] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 200 mg, 0.647 mmol), DIPEA (0.113 mL,
0.67 mmol, 1 eq.) and (R)-octahydropyrrolo-[1,2-a]pyrazine (245 mg,
1.95 mmol, 3.0 eq.) were stirred in DMSO (2.5 mL) at 125.degree. C.
overnight. The solvent was removed under high vacuum. The residue
was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=98/2 to 95/5) to afford the title product
(132 mg, 49%) as a light yellow solid. MS m/z 416.3
[M+H.sup.+].
Example 5
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo
pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one
##STR00027##
[0281] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 90 mg, 0.291 mmol), DIPEA (0.05 mL, 0.29
mmol, 1 eq.) and (S)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (81
mg, 0.58 mmol, 2.0 eq.) were stirred in DMSO (2.5 mL) at
125.degree. C. overnight. The solvent was removed under high
vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and washed
with an aqueous saturated solution of NaHCO.sub.3. The organic
layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (55 mg, 44%) as a light yellow solid. MS
m/z 430.3 [M+H.sup.+].
Example 6
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo
pyrazin-2-yl]-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido
pyrimidin-4-one
##STR00028##
[0283] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 90 mg, 0.291 mmol), DIPEA (0.05 mL, 0.29
mmol, 1 eq.) and (R)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (81
mg, 0.58 mmol, 2.0 eq.) were stirred in DMSO (2.5 mL) at
125.degree. C. overnight. The solvent was removed under high
vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and washed
with an aqueous saturated solution of NaHCO.sub.3. The organic
layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (50 mg, 40%) as a light yellow solid. MS
m/z 430.4 [M+H.sup.+].
Example 7
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5R)-3,5-dimethylpipera-
zin-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00029##
[0285] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 50 mg, 0.162 mmol), and
cis-2,6-dimethylpiperazine (74 mg, 0.647 mmol, 4.0 eq.) were
stirred in DMSO (1.5 mL) at 110.degree. C. overnight. The solvent
was removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (32 mg, 49%) as a light yellow
solid. MS m/z 404.4 [M+H.sup.+].
Example 8
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-y-
l]pyrido[1,2-a]pyrimidin-4-one
##STR00030##
[0287] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 33 mg, 0.107 mmol), and
(S)-2-methylpiperazine (43 mg, 0.427 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 120.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (18 mg, 43%) as a light yellow solid. MS
m/z 390.3 [M+H.sup.+].
Example 9
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-y-
l]pyrido[1,2-a]pyrimidin-4-one
##STR00031##
[0289] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 85 mg, 0.275 mmol), and
(R)-2-methylpiperazine (110 mg, 1.10 mmol, 4.0 eq.) were stirred in
DMSO (5 mL) at 120.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (35 mg, 33%) as a light yellow solid. MS
m/z 390.3 [M+H.sup.+].
Example 10
7-(1,4-diazepan-1-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1-
,2-a]pyrimidin-4-one
##STR00032##
[0291] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 33 mg, 0.107 mmol), and 1,4-diazepane
(32 mg, 0.320 mmol, 3.0 eq.) were stirred in DMSO (2 mL) at
120.degree. C. overnight. The solvent was removed under high
vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and washed
with an aqueous saturated solution of NaHCO.sub.3. The organic
layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (20 mg, 48%) as a light yellow solid. MS
m/z 390.3 [M+H.sup.+].
Example 11
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]py-
rido[1,2-a]pyrimidin-4-one
##STR00033##
[0293] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), and
(S)-2-methylpiperazine (68 mg, 0.677 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 110.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (40 mg, 63%) as a light yellow solid. MS
m/z 376.2 [M+H.sup.+].
Example 12
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]py-
rido[1,2-a]pyrimidin-4-one
##STR00034##
[0295] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), and
(R)-2-methylpiperazine (68 mg, 0.677 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 110.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (48 mg, 75%) as a light yellow solid. MS
m/z 376.3 [M+H.sup.+].
Example 13
7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a-
]pyrimidin-4-one
##STR00035##
[0297] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), and 1,4-diazepane (68
mg, 0.677 mmol, 4.0 eq.) were stirred in DMSO (2 mL) at 110.degree.
C. overnight. The solvent was removed under high vacuum. The
residue was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to afford the title product
(41 mg, 65%) as a light yellow solid. MS m/z 376.2 [M+H.sup.+].
Example 14
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00036##
[0299] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), and
cis-2,6-dimethylpiperazine (77 mg, 0.677 mmol, 4.0 eq.) were
stirred in DMSO (2 mL) at 110.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (41 mg, 62%) as a light yellow
solid. MS m/z 390.3 [M+H.sup.+].
Example 15
7-[(8aS)-3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazin-2-yl]-2-(2-methyl-
imidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00037##
[0301] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), and
(S)-octahydropyrrolo[1,2-a]pyrazine (85 mg, 0.677 mmol, 4.0 eq.)
were stirred in DMSO (2 mL) at 125.degree. C. overnight. The
solvent was removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (36 mg, 53%) as a light yellow
solid. MS m/z 402.3 [M+H.sup.+].
Example 16
7-[(8aS)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2-m-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00038##
[0303] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol) and
(S)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (95 mg, 0.677 mmol,
4.0 eq.) were stirred in DMSO (2 mL) at 125.degree. C. overnight.
The solvent was removed under high vacuum. The residue was taken up
in CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution
of NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (45 mg, 64%) as a light yellow
solid. MS m/z 416.3 [M+H.sup.+].
Example 17
7-[(8aR)-8a-methyl-1,3,4,6,7,8-hexahydropyrrolo[1,2-a]pyrazin-2-yl]-2-(2-m-
ethylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00039##
[0305] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 100 mg, 0.339 mmol) and
(R)-8a-methyloctahydropyrrolo[1,2-a]pyrazine (190 mg, 1.35 mmol,
4.0 eq.) were stirred in DMSO (4 mL) at 125.degree. C. overnight.
The solvent was removed under high vacuum. The residue was taken up
in CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution
of NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (45 mg, 64%) as a light yellow
solid. MS m/z 416.3 [M+H.sup.+].
Example 18
[0306]
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-
-ylpyrrolidin-1-yl]pyrido pyrimidin-4-one
##STR00040##
[0307] In a microwave reactor,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 45 mg, 0.145 mmol),
(R)-1,3'-bipyrrolidine dihydrochloride (62 mg, 0.291 mmol, 2.0 eq.)
and DIPEA (0.20 mL, 1.16 mmol, 8 eq.) were stirred in NMP (3 mL) at
220.degree. C. for 1 hour. The solvent was removed under high
vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and washed
with an aqueous saturated solution of NaHCO.sub.3. The organic
layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=98/2 to 90/10) to
afford the title product (25 mg, 40%) as a light yellow solid. MS
m/z 430.3 [M+H.sup.+].
Example 19
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-
pyrido[1,2-a]pyrimidin-4-one
##STR00041##
[0309] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 50 mg, 0.169 mmol), DIPEA (0.24 mL, 1.35
mmol, 8 eq.) and 4,7-diazaspiro[2.5]octane dihydrochloride (62.7
mg, 0.339 mmol, 2.0 eq.) were stirred in DMSO (2 mL) at 125.degree.
C. for 2 days. The solvent was removed under high vacuum. The
residue was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to afford the title product
(22 mg, 33%) as a light yellow solid. MS m/z 388.3 [M+H.sup.+].
Example 20
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-
-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00042##
[0311] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 50 mg, 0.162 mmol), DIPEA (0.22 mL, 1.29
mmol, 4 eq.) and 4,7-diazaspiro[2.5]octane dihydrochloride (32 mg,
0.320 mmol, 3.0 eq.) were stirred in DMSO (2 mL) at 130.degree. C.
for 48 hours. The solvent was removed under high vacuum. The
residue was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=98/2 to 95/5) to afford the title product (12
mg, 18%) as a light yellow solid. MS m/z 402.3 [M+H.sup.+].
Example 21
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-pyrrolidin-1-ylpyrrolid-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00043##
[0313] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 40 mg, 0.135 mmol), DIPEA (0.19 mL, 1.08
mmol, 8 eq.) and (R)-1,3'-bipyrrolidine dihydrochloride (58 mg,
0.271 mmol, 2.0 eq.) were stirred in DMSO (4 mL) and heated at
220.degree. C. for 40 minutes in a microwave. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=98/2 to
90/10) to afford the title product (30 mg, 53%) as a light yellow
solid. MS m/z 416.3 [M+H.sup.+].
Example 22
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-yl-
)pyrido[1,2-a]pyrimidin-4-one
##STR00044##
[0315] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 40 mg, 0.129 mmol) and
2,2-dimethylpiperazine (59 mg, 0.517 mmol, 4.0 eq.) were stirred in
DMSO (1.6 mL) at 130.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 9/1) to
afford the title product (29 mg, 55%) as a light yellow solid. MS
m/z 404.3 [M+H.sup.+].
Example 23
7-(3,3-dimethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyr-
ido[1,2-a]pyrimidin-4-one
##STR00045##
[0317] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 40 mg, 0.135 mmol) and
2,2-dimethylpiperazine (62 mg, 0.542 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 130.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (26 mg, 49%) as a light yellow solid. MS
m/z 390.3 [M+H.sup.+].
Example 24
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3S)-3-methylpipe-
razin-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00046##
[0319] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one (Intermediate 4; 50 mg, 0.155 mmol) and
(S)-2-methylpiperazine (62 mg, 0.619 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 125.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (45 mg, 72%) as a light yellow solid. MS
m/z 404.3 [M+H.sup.+].
Example 25
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-9-methyl-7-[(3R)-3-methylpipe-
razin-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00047##
[0321] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one (Intermediate 4; 50 mg, 0.155 mmol) and
(R)-2-methylpiperazine (62 mg, 0.619 mmol, 4.0 eq.) were stirred in
DMSO (2 mL) at 125.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (40 mg, 70%) as a light yellow solid. MS
m/z 404.3 [M+H.sup.+].
Example 26
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R,5S)-3,5-dimethylpipera-
zin-1-yl]-9-methyl-pyrido[1,2-a]pyrimidin-4-one
##STR00048##
[0323] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one (Intermediate 4; 50 mg, 0.155 mmol) and
cis-2,6-dimethylpiperazine (70 mg, 0.619 mmol, 4.0 eq.) were
stirred in DMSO (2 mL) at 125.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (26 mg, 40%) as a light yellow
solid. MS m/z 418.3 [M+H.sup.+].
Example 27
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-(3,3-dimethylpiperazin-1-yl-
)-9-methyl-pyrido[1,2-a]pyrimidin-4-one
##STR00049##
[0325] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one (Intermediate 4; 50 mg, 0.155 mmol) and
2,2-dimethylpiperazine (35 mg, 0.309 mmol, 2.0 eq.) were stirred in
DMSO (2 mL) at 125.degree. C. overnight. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (36 mg, 56%) as a light yellow solid. MS
m/z 418.3 [M+H.sup.+].
Example 28
7-(4,7-diazaspiro[2.5]octan-7-yl)-2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-
-yl)-9-methyl-pyrido[1,2-a]pyrimidin-4-one
##STR00050##
[0327] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-9-methyl-pyrido[1,2-
-a]pyrimidin-4-one (Intermediate 4; 50 mg, 0.155 mmol), DIPEA (0.21
mL, 1.24 mmol, 8 eq.) and 4,7-diazaspiro[2.5]octane dihydrochloride
(57 mg, 0.309 mmol, 2.0 eq.) were stirred in DMSO (2 mL) at
125.degree. C. for 2 days. The solvent was removed under high
vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and washed
with an aqueous saturated solution of NaHCO.sub.3. The organic
layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (17 mg, 26%) as a light yellow solid. MS
m/z 416.3 [M+H.sup.+].
Example 29
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S,5S)-3,5-dimethylpipera-
zin-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00051##
[0329] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 50 mg, 0.162 mmol), TEA (0.18 mL, 1.29
mmol, 8 eq.) and (2S,6S)-2,6-dimethylpiperazine dihydrochloride (90
mg, 0.485 mmol, 3.0 eq.) were stirred in DMSO (2 mL) at 140.degree.
C. overnight. The solvent was removed under high vacuum. The
residue was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 9/1) to afford the title product (20
mg, 30%) as a light yellow solid. MS m/z 404.3 [M+H.sup.+].
Example 30
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyrr-
olidin-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00052##
[0331] In a sealed tube,
2-(2,8-dimethylimidazo[1,2-b]pyridazin-6-yl)-7-fluoro-pyrido[1,2-a]pyrimi-
din-4-one (Intermediate 2; 50 mg, 0.162 mmol), DIPEA (0.22 mL, 1.29
mmol, 8 eq.) and (S)-1,3'-bipyrrolidine dihydrochloride (103 mg,
0.485 mmol, 3.0 eq.) were stirred in NMP (2 mL) at 140.degree. C.
overnight. The solvent was removed under high vacuum. The residue
was taken up in CH.sub.2Cl.sub.2 and washed with an aqueous
saturated solution of NaHCO.sub.3. The organic layer was separated
and dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 9/1) to afford the title product (22
mg, 32%) as a light yellow solid. MS m/z 430.3 [M+H.sup.+].
Example 31
2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-pyrrolidin-1-ylpyrrolid-
in-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00053##
[0333] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 75 mg, 0.254 mmol), TEA (0.28 mL, 2.03
mmol, 8 eq.) and (S)-1,3'-bipyrrolidine dihydrochloride (162 mg,
0.762 mmol, 3.0 eq.) were stirred in NMP (4 mL) and heated at
220.degree. C. for 1 hour in a microwave. The solvent was removed
under high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (12 mg, 11%) as a light yellow solid. MS
m/z 416.2 [M+H.sup.+].
Example 32
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin--
6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00054##
[0335] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 75 mg, 0.254 mmol), TEA (0.28 mL, 2.03
mmol, 8 eq.) and (2S,6S)-2,6-dimethylpiperazine dihydrochloride
(143 mg, 0.762 mmol, 3.0 eq.) were stirred in DMSO (3 mL) and
heated at 140.degree. C. overnight. The solvent was removed under
high vacuum. The residue was taken up in CH.sub.2Cl.sub.2 and
washed with an aqueous saturated solution of NaHCO.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. The crude was purified by column
chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to 90/10) to
afford the title product (10 mg, 10%) as a light yellow solid. MS
m/z 390.3 [M+H.sup.+].
Example 33
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3S)-3-methylpiperazi-
n-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00055##
[0337] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 250 mg, 0.808 mmol), and
(S)-2-methylpiperazine (405 mg, 4.04 mmol, 5.0 eq.) were stirred in
DMSO (6 mL) and heated at 130.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
85/15) to afford the title product (135 mg, 43%) as a light yellow
solid. MS m/z 390.3 [M+H.sup.+].
Example 34
9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-7-[(3R)-3-methylpiperazi-
n-1-yl]pyrido[1,2-a]pyrimidin-4-one
##STR00056##
[0339] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 250 mg, 0.808 mmol), and
(R)-2-methylpiperazine (405 mg, 4.04 mmol, 5.0 eq.) were stirred in
DMSO (6 mL) and heated at 130.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
85/15) to afford the title product (100 mg, 32%) as a light yellow
solid. MS m/z 390.3 [M+H.sup.+].
Example 35
7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]p-
yridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00057##
[0341] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 250 mg, 0.808 mmol), and
(2S,6R)-2,6-dimethylpiperazine (461 mg, 4.04 mmol, 5.0 eq.) were
stirred in DMSO (6 mL) and heated at 130.degree. C. overnight. The
solvent was removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
85/15) to afford the title product (101 mg, 31%) as a light yellow
solid. MS m/z 404.3 [M+H.sup.+].
Example 36
7-(3,3-dimethylpiperazin-1-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-
-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00058##
[0343] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 250 mg, 0.808 mmol), and
2,2-dimethylpiperazine (461 mg, 4.04 mmol, 5.0 eq.) were stirred in
DMSO (6 mL) and heated at 130.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
85/15) to afford the title product (120 mg, 36%) as a light yellow
solid. MS m/z 404.3 [M+H.sup.+].
Example 37
7-(4,7-diazaspiro[2.5]octan-7-yl)-9-methyl-2-(2-methylimidazo[1,2-b]pyrida-
zin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00059##
[0345] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 125 mg, 0.404 mmol), K.sub.2CO.sub.3
(223 mg, 1.62 mmol, 4 eq.) and 4,7-diazaspiro[2.5]octane
dihydrochloride (112 mg, 0.606 mmol, 1.5 eq.) were stirred in DMA
(2 mL) and heated at 130.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (75 mg, 46%) as a light yellow
solid. MS m/z 402.2 [M+H.sup.+].
Example 38
7-[(3S,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-2-(2-methylimidazo[1,2-b]p-
yridazin-6-yl)pyrido[1,2-a]pyrimidin-4-one
##STR00060##
[0347] In a sealed tube,
7-fluoro-9-methyl-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyrido[1,2-a]py-
rimidin-4-one (Intermediate 3; 125 mg, 0.404 mmol), K.sub.2CO.sub.3
(223 mg, 1.62 mmol, 4 eq.) and (2S,6S)-2,6-dimethylpiperazine
dihydrochloride (113 mg, 0.606 mmol, 1.5 eq.) were stirred in DMA
(2 mL) and heated at 130.degree. C. overnight. The solvent was
removed under high vacuum. The residue was taken up in
CH.sub.2Cl.sub.2 and washed with an aqueous saturated solution of
NaHCO.sub.3. The organic layer was separated and dried over
Na.sub.2SO.sub.4 and concentrated in vacuo. The crude was purified
by column chromatography (SiO.sub.2, CH.sub.2Cl.sub.2/MeOH=95/5 to
90/10) to afford the title product (50 mg, 31%) as a light yellow
solid. MS m/z 404.3 [M+H.sup.+].
Example 39
7-[(3R)-3-ethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)pyr-
ido[1,2-a]pyrimidin-4-one
##STR00061##
[0349] In a sealed tube,
7-fluoro-2-(2-methylimidazo[1,2-b]pyridazin-6-yl)-4H-pyrido[1,2-a]pyrimid-
in-4-one (Intermediate 1; 200 mg, 0.677 mmol), K.sub.2CO.sub.3 (374
mg, 2.71 mmol, 4 eq.) and (R)-2-ethylpiperazine dihydrochloride
(238 mg, 0.606 mmol, 1.5 eq.) were stirred in DMA (3 mL) at
100.degree. C. for 4 days. The solvent was removed under high
vacuum. The crude was purified by column chromatography (SiO.sub.2,
CH.sub.2Cl.sub.2/MeOH=95/5 to 8/2) to afford the title product (168
mg, 64%) as a light yellow solid. MS m/z 390.2 [M+H.sup.+].
[0350] Biological Assays
[0351] To describe in more detail and assist in understanding the
present description, the following non-limiting biological examples
are offered to more fully illustrate the scope of the description
and are not to be construed as specifically limiting the scope
thereof. Such variations of the present description that may be now
known or later developed, which would be within the purview of one
skilled in the art to ascertain, are considered to fall within the
scope of the present description and as hereinafter claimed. These
examples illustrate the testing of certain compounds described
herein in vitro and/or in vivo and demonstrate the usefulness of
the compounds for treating of SMA by enhancing the inclusion of
exon 7 of SMN2 into mRNA transcribed from the SMN2 gene. Compounds
of formula (I) enhance inclusion of exon 7 of SMN2 into mRNA
transcribed from the SMN2 gene and increase levels of SMN protein
produced from the SMN2 gene, and thus can be used to treat SMA in a
human subject in need thereof. These examples further illustrate
the testing of certain compounds described herein in vitro and/or
in vivo and demonstrate the usefulness of the compounds for
enhancing the inclusion of exon 7 of SMN1 into mRNA transcribed
from the SMN1 gene. Accordingly, compounds of formula (I) also
enhance the inclusion of exon 7 of SMN1 into mRNA transcribed from
the SMN1 gene and increase levels of SMN protein produced from the
SMN1 gene.
Assay 1
SMN2 minigene mRNA splicing RT-qPCR assay in cultured cells
[0352] The reverse transcription-quantitative PCR-based (RT-qPCR)
assay is used to quantify the level of the full length SMN2
minigene (referred to herein by the term "FL SMN2mini") mRNA
containing SMN2 exon 7 in a HEK293H cell line stably transfected
with said minigene and treated with a test compound. Materials used
and respective sources are listed below in Table 1.
TABLE-US-00001 TABLE 1 Materials and their respective sources used
in the SMN2 minigene mRNA splicing RT-qPCR assay in cultured cells.
Material Source HEK293H cells Life Technologies, Inc. (formerly
Invitrogen) Catalog No. 11631-017 Cells-To-Ct lysis Life
Technologies, Inc. (formerly Applied buffer Biosystems) part No.
4399002 DMEM Life Technologies, Inc. (formerly Invitrogen) Catalog
No. 11960-044 96-well flat-bottom Becton Dickinson Catalog No.
353072 plates RT-PCR Enzyme Life Technologies, Inc. (formerly
Applied Mix Biosystems) part No. 4388520 RT-PCR buffer Life
Technologies, Inc. (formerly Applied Biosystems) part No. 4388519
AgPath-ID One- Life Technologies, Inc. (formerly Applied Step
RT-PCR kit Biosystems) part No. 4387391 Thermocycler Life
Technologies, Inc. (formerly Applied Biosystems) 7900HT
[0353] The SMN2-A minigene construct was prepared as described in
International Patent Application WO2009/151546A1 page 145 paragraph
[00400] to page 147 paragraph [00412] (incl. FIG. 1 and FIG. 3
therein).
[0354] HEK293H cells stably transfected with the SMN2-A minigene
construct (10,000 cells/well) are seeded in 200 .mu.L of cell
culture medium (DMEM plus 10% FBS, with 200 .mu.g/mL hygromycin) in
96-well flat-bottom plates and the plate is immediately swirled to
ensure proper dispersal of cells and the formation of an even
monolayer of cells. Cells are allowed to attach for 6 hours. Test
compounds are serially diluted 3.16-fold in 100% DMSO to generate a
7-point concentration curve. A solution of test compound (1 .mu.L,
200.times. in DMSO) is added to each cell-containing well and the
plate is incubated for 24 hours in a cell culture incubator
(37.degree. C., 5% CO.sub.2, 100% relative humidity). 2 replicates
are prepared for each test compound concentration. The cells are
then lysed in the Cells-To-Ct lysis buffer and the lysate is stored
at -80.degree. C.
[0355] Full length SMN2-A minigene and GAPDH mRNA are quantified
using the primers and probes referenced in Table 2. Primer SMN
Forward A (SEQ ID NO.1) hybridizes to a nucleotide sequence in exon
7 (nucleotide 22 to nucleotide 40), primer SMN Reverse A (SEQ ID
NO.2) hybridizes to a nucleotide sequence in the coding sequence of
Firefly luciferase, SMN Probe A (SEQ ID NO.3) hybridizes to a
nucleotide sequence in exon 7 (nucleotide 50 to nucleotide 54) and
exon 8 (nucleotide 1 to nucleotide 21). The combination of these
three oligonucleotides detects only SMN1 or SMN2 minigenes
(RT-qPCR) and will not detect endogenous SMN1 or SMN2 genes.
TABLE-US-00002 TABLE 2 Primers/ Probes Sequences Source SMN Forward
SEQ ID NO. 1: PTC.sup.1 Primer A GAAGGAAGGTGCTCACATT SMN Reverse
SEQ ID NO. 2: PTC.sup.1 Primer A TCTTTATGTTTTTGGCGTCTTC SMN Forward
SEQ ID NO. 3: PTC.sup.1 Probe A 6FAM-AAGGAGAAATGCTGGCA
TAGAGCAGC-TAMRA hGAPDH Forward SEQ ID NO. 4: LTI.sup.2 Probe
VIC-CGCCTGGTCACCAGGGCT GCT-TAMRA hGAPDH Forward SEQ ID NO. 5:
LTI.sup.2 Primer CAACGGATTTGGTCGTATTGG hGAPDH Reverse SEQ ID NO. 6:
LTI.sup.2 Primer TGATGGCAACAATATCCACTTT ACC .sup.1Primers and
probes designed by PTC Therapeutics, Inc.; .sup.2Commercially
available from Life Technologies, Inc. (formerly Invitrogen).
[0356] The SMN forward and reverse primers are used at final
concentrations of 0.4 .mu.M. The SMN probe is used at a final
concentration of 0.15 .mu.M. The GAPDH primers are used at final
concentrations of 0.2 .mu.M and the probe at 0.15 .mu.M.
[0357] The SMN2-minigene GAPDH mix (15 .mu.L total volume) is
prepared by combining 7.5 of 2.times.RT-PCR buffer, 0.4 .mu.L of
25.times. RT-PCR enzyme mix, 0.75 .mu.L of 20.times. GAPDH
primer-probe mix, 4.0075 .mu.L of water, 2 .mu.L of 10-fold diluted
cell lysate, 0.06 .mu.L of 100 .mu.M SMN forward primer, 0.06 .mu.L
of 100 .mu.M SMN reverse primer, and 0.225 .mu.L of 100 .mu.M SMN
probe.
[0358] PCR is carried out at the following temperatures for the
indicated time: Step 1: 48.degree. C. (15 min); Step 2: 95.degree.
C. (10 min); Step 3: 95.degree. C. (15 sec); Step 4: 60.degree. C.
(1 min); then repeat Steps 3 and 4 for a total of 40 cycles.
[0359] Each reaction mixture contains both SMN2-A minigene and
GAPDH primers/probe sets (multiplex design), allowing simultaneous
measurement of the levels of two transcripts.
[0360] The increase in the abundance of the FL SMN2mini mRNA
relative to that in cells treated with vehicle control is
determined from real-time PCR data using a modified
.DELTA..DELTA.Ct method (as described in Livak and Schmittgen,
Methods, 2001, 25:402-8). The amplification efficiency E is
calculated from the slope of the amplification curve for FL
SMN2mini and GAPDH individually. The abundance of FL SMN2mini and
GAPDH mRNA are then calculated as (1+E).sup.-Ct, where Ct is the
threshold value for each amplicon. The abundance of FL SMN2mini
mRNA is normalized to GAPDH mRNA abundance. The normalized FL
SMN2mini mRNA abundance from test compound-treated samples is then
divided by normalized FL SMN2mini mRNA abundance from
vehicle-treated cells to determine the level of FL SMN2mini mRNA
relative to vehicle control.
[0361] Table 3 provides EC.sub.1.5.times. concentrations for
production of full length SMN2 minigene mRNA that was obtained from
the 7-point concentration data generated according to the above
procedure for particular compounds of the present invention.
[0362] Particular compounds of the present invention exhibit an
EC.sub.1.5.times. concentration for production of full length SMN2
minigene mRNA .ltoreq.1 .mu.M.
[0363] More particular compounds of the present invention exhibit
an EC.sub.1.5.times. concentration for production of full length
SMN2 minigene mRNA .ltoreq.0.1 .mu.M.
[0364] Most particular compounds of the present invention exhibit
an EC1.5.times. concentration for production of full length SMN2
minigene mRNA .ltoreq.0.02 .mu.M.
TABLE-US-00003 TABLE 3 EC.sub.1.5x concentrations for production of
full length SMN2 minigene mRNA. Example EC.sub.1.5x minigene (nM) 1
3.5 2 3.8 3 3.2 4 1.8 5 0.6 6 2.8 7 3.7 8 0.3 9 0.1 10 6.4 11 1.4
12 1.2 13 5 14 4.1 15 4 16 1.1 17 6.4 18 3.6 19 10.2 20 4.3 21 9.6
22 0.9 23 3.4 24 0.4 25 0.5 26 327 27 39.9 28 5 29 0.3 30 3 31 6.7
32 1.6 33 0.5 34 0.9 35 4.7 36 5 37 4.4 38 0.3 39 0.9
Assay 2
SMN Protein Assay in Cultured Cells
[0365] The SMN HTRF (homogeneous time resolved fluorescence) assay
is used to quantify the level of SMN protein in SMA patient
fibroblast cells treated with test compounds. Materials used and
respective sources are listed below in Table 4.
TABLE-US-00004 TABLE 4 Materials and their respective sources used
in the SMN protein assay in cultured cells. Material Source SMA
Type 1 human GM03813 (Coriell Institute) cells Protease inhibitor
Roche Applied Science Catalog No. cocktail 11836145001 Anti-SMN d2
Blue cap Cisbio Catalog No. 63IDC002-SMN Anti-SMN kryptate Red cap
Cisbio Catalog No. 63IDC002-SMN SMN reconstitution Cisbio Catalog
No. 63IDC002-SMN-Buffer buffer DMEM Life Technologies (formerly
Invitrogen) Catalog No. 11960-044 RIPA Lysis Buffer 20 mM Tris-HCl
pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Thermo Scientific NP-40 Surfact-
Amps Detergent Solution (Fisher Scientific, Pittsburgh/PA), 1%
Sodium deoxycholate Diluent Buffer 20 mM Tris-HCl pH 7.5, 150 mM
NaCl Envision Plate Perkin Elmer Model # 2103 Reader
[0366] Cells are thawed and cultured in DMEM-10% FBS for 72 hours.
Cells are trypsinized, counted and re-suspended to a concentration
of 25,000 cells/mL in DMEM-10% FBS. The cell suspensions are plated
at 5,000 cells per well in a 96 well microtiter plate and incubated
for 3 to 5 hours. Test compounds are serially diluted 3.16-fold in
100% DMSO to generate a 7-point concentration curve. 1 .mu.L of
test compound solution is transferred to cell-containing wells and
cells are incubated for 48 hours in a cell culture incubator
(37.degree. C., 5% CO.sub.2, 100% relative humidity). Triplicate
samples are set up for each test compound concentration. After 48
hours, the supernatant is removed from the wells and 25 .mu.L of
the RIPA lysis buffer, containing protease inhibitors, is added to
the wells and incubated with shaking at room temperature for 1
hour. 25 .mu.L of the diluent is added and then 35 .mu.L of the
resulting lysate is transferred to a 384-well plate, where each
well contains 5 .mu.L of the antibody solution (1:100 dilution of
anti-SMN d2 and anti-SMN kryptate in SMN reconstitution buffer).
The plate is centrifuged for 1 minute to bring the solution to the
bottom of the wells, then incubated overnight at room temperature.
Fluorescence for each well of the plate at 665 nm and 620 nm is
measured on an EnVision multilabel plate reader (Perkin-Elmer).
[0367] The normalized fluorescence signal is calculated for each
sample, Blank and vehicle control well by dividing the signal at
665 nm by the signal at 620 nm. Normalizing the signal accounts for
possible fluorescence quenching due to the matrix effect of the
lysate. The .DELTA.F value (a measurement of SMN protein abundance
as a percent value) for each sample well is calculated by
subtracting the normalized average fluorescence for the Blank
control wells from the normalized fluorescence for each sample
well, then dividing this difference by the normalized average
fluorescence for the Blank control wells and multiplying the
resulting value by 100. The .DELTA.F value for each sample well
represents the SMN protein abundance from test compound-treated
samples. The .DELTA.F value for each sample well is divided by the
.DELTA.F value for the vehicle control wells to calculate the fold
increase in SMN protein abundance relative to the vehicle control.
Table 5 provides EC.sub.1.5.times. concentrations for SMN protein
expression that was obtained from the 7-point concentration data
generated according to the above procedure for particular compounds
of the present invention.
[0368] Particular compounds of the present invention exhibit an
EC.sub.1.5.times. concentration for SMN protein expression
.ltoreq.1 .mu.M.
[0369] More particular compounds of the present invention exhibit
an EC.sub.1.5.times. concentration for SMN protein expression
.ltoreq.100 nM.
[0370] Most particular compounds of the present invention exhibit
an EC.sub.1.5.times. concentration for SMN protein expression
.ltoreq.30 nM.
[0371] Table 6 provides the maximum fold increase of SMN protein
that was obtained from the 7-point concentration data generated
according to the above procedure for particular compounds of the
present invention
[0372] Particular compounds of the present invention exhibit a
maximum fold increase >1.5.
[0373] More particular compounds of the present invention exhibit a
maximum fold increase >1.7.
[0374] Most particular compounds of the present invention exhibit a
maximum fold increase >1.8.
TABLE-US-00005 TABLE 5 EC.sub.1.5x concentrations for SMN protein
expression. Example EC1.5x SMN protein (nM) 1 10.8 2 19.8 3 25.6 4
15.7 5 4.1 6 11 7 15.5 8 5.9 9 2.5 10 22.8 11 7 12 7.5 13 3 14 17.6
15 21.2 16 3 17 20.2 18 25 19 29.8 20 37 21 68.7 22 13.8 23 23.9 24
4.7 25 11.9 26 1230 27 126.5 28 49.7 29 2.1 30 13.6 31 27.7 32 4 33
4 34 4.4 35 19.5 36 34.4 37 45 38 3.1 39 15.8
TABLE-US-00006 TABLE 6 Maximum fold increase of SMN protein.
Example max. fold increase 1 1.84 2 1.76 3 1.81 4 1.76 5 1.71 6
1.84 7 1.76 8 1.85 9 1.92 10 1.95 11 1.9 12 1.77 13 1.91 14 1.86 15
1.94 16 1.83 17 1.98 18 1.75 19 1.83 20 1.72 21 1.54 22 1.69 23
1.63 24 1.77 25 1.79 26 1.52 27 1.57 28 1.72 29 1.81 30 1.84 31
1.65 32 1.88 33 1.82 34 1.89 35 1.79 36 1.77 37 1.87 38 1.85 39
1.81
Sequence CWU 1
1
6119DNAArtificial SequenceSMN Forward Primer A 1gaaggaaggt
gctcacatt 19222DNAArtificial SequenceSMN Reverse Primer A
2tctttatgtt tttggcgtct tc 22326DNAArtificial SequenceSMN Forward
Probe A 3aaggagaaat gctggcatag agcagc 26421DNAArtificial
SequencehGAPDH Forward Probe 4cgcctggtca ccagggctgc t
21521DNAArtificial SequencehGAPDH Forward Primer 5caacggattt
ggtcgtattg g 21625DNAArtificial SequencehGAPDH Reverse Primer
6tgatggcaac aatatccact ttacc 25
* * * * *