U.S. patent application number 15/217885 was filed with the patent office on 2017-06-29 for methods and compositions for risk prediction, diagnosis, prognosis, and treatment of pulmonary disorders.
The applicant listed for this patent is National Jewish Health. Invention is credited to David A. Schwartz, Max Seibold.
Application Number | 20170183730 15/217885 |
Document ID | / |
Family ID | 44319751 |
Filed Date | 2017-06-29 |
United States Patent
Application |
20170183730 |
Kind Code |
A1 |
Schwartz; David A. ; et
al. |
June 29, 2017 |
METHODS AND COMPOSITIONS FOR RISK PREDICTION, DIAGNOSIS, PROGNOSIS,
AND TREATMENT OF PULMONARY DISORDERS
Abstract
The invention provides diagnostic and therapeutic targets for
pulmonary disease, in particular, fibrotic lung disease. The
inventors have found that a genetic variant MUC5B gene is
associated with increased expression of the gene, increased risk of
developing a pulmonary disease, and an improved prognosis and
survival among those developing the pulmonary disease.
Inventors: |
Schwartz; David A.; (Aurora,
CO) ; Seibold; Max; (Denver, CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
National Jewish Health |
Denver |
CO |
US |
|
|
Family ID: |
44319751 |
Appl. No.: |
15/217885 |
Filed: |
July 22, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14171536 |
Feb 3, 2014 |
|
|
|
15217885 |
|
|
|
|
13014589 |
Jan 26, 2011 |
8673565 |
|
|
14171536 |
|
|
|
|
61323760 |
Apr 13, 2010 |
|
|
|
61323238 |
Apr 12, 2010 |
|
|
|
61298814 |
Jan 27, 2010 |
|
|
|
61298473 |
Jan 26, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12Q 2600/136 20130101; C12Q 2600/156 20130101; A61P 11/00
20180101; C12Q 2600/118 20130101; G01N 2800/12 20130101; C12Q
2600/172 20130101; G01N 2333/4725 20130101; C12Q 2600/158
20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] The present invention was supported at least in part by
government funding from the NIH Intramural Research Program of the
National Inst. of Environmental Health Sciences (Grant No.
Z01-ES101947) and the National Heart, Lung, and Blood Inst. (Grant
Nos. U01-HL067467, R01-HL095393, R01-HL097163, P01-HL092870, and
RC2-HL101715). The government has certain rights in the invention.
Claims
1-86. (canceled)
87. A method of diagnosing a pulmonary disease in a human subject
in need thereof, said method comprising: obtaining a biological
sample from a human subject; (ii) detecting whether a genetic
variant MUC5B gene sequence is present in said biological sample by
contacting said sample with a labeled nucleic acid probe capable of
hybridizing to a T allele at the rs35705950 single nucleotide
polymorphism (SNP) of said genetic variant MUC5B gene sequence, or
its complement; (iii) diagnosing said human subject with a
pulmonary disease when a detectable complex is formed by
hybridization of said labeled nucleic acid probe to said T allele
at the rs35705950 single nucleotide polymorphism (SNP), or its
complement.
88. The method of claim 87, further comprising, after said
diagnosing of step (iii) administering to said human subject an
effective amount of a pulmonary disease treatment.
89. The method of claim 88, comprising administering to said human
subject an effective amount of an anti-inflammatory agent, a
mucolytic agent, a mucoregulatory agent, a mucokinetic agent or an
expectorant.
90. The method of claim 89, wherein said mucolytic agent is
N-acetylcysteine, N-acystelyn, erdoseine, dornase alfa, thymosin
beta4, dextran, pulmozyme, heparin, or bronchiotol.
91. The method of claim 89, wherein said mucoregulatory agent is
carbocysteine, an anticholoinergic agent, a glucocorticoid or a
macrolide antibiotic.
92. The method of claim 89, wherein said mucokinetic agent is a
bronchodilator, a surfactant or ambroxol.
93. The method of claim 89, wherein said expectorant is hypertonic
saline, guaifenesin, dornase/pulmozyme or bronchiotol.
94. The method of claim 88, wherein said pulmonary disease is an
interstitial lung disease.
95. The method of claim 94, wherein said interstitial lung disease
is a fibrotic interstitial lung disease.
96. The method of claim 95, wherein said fibrotic interstitial lung
disease is idiopathic pulmonary fibrosis or familial interstitial
pneumonia.
97. The method of claim 88, wherein said biological sample is a
pulmonary tissue or a bodily fluid.
98. The method of claim 87, wherein said labeled nucleic acid probe
is a fluorescently labeled nucleic acid probe.
99. The method of claim 98, wherein said fluorescently labeled
nucleic acid probe has at least 10 nucleotides.
100. The method of claim 98, wherein said fluorescently labeled
nucleic acid probe comprises at least 10 contiguous nucleotides of
the sequence of SEQ ID NO:24_spanning said SNP, or said complement
thereof.
101. The method of claim 88, wherein said human subject has a
family history of idiopathic pulmonary fibrosis (IPF) or familial
interstitial pneumonia (FIP).
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/171,536, filed Feb. 3, 2014, which is a continuation of U.S.
application Ser. No. 13/014,589, now U.S. Pat. No. 8,673,565, filed
Jan. 26, 2011, which claims priority to US Provisional Application
No. 61/298,473, filed Jan. 26, 2010, U.S. Provisional Application
No. 61/298,814, filed Jan. 27, 2010, U.S. Provisional Application
No. 61/323,238, filed Apr. 12, 2010, and U.S. Provisional
Application No. 61/323,760, filed Apr. 13, 2010, the disclosures of
which are incorporated herein in their entireties.
BACKGROUND OF THE INVENTION
[0003] Pulmonary fibrosis disorders are a growing concern in human
and non-human populations. Pulmonary fibrosis is associated with a
number of complex disorders (e.g., Herman-Pudlak Syndrome, tuberous
sclerosis, neurofibromatosis, and dyskeratosis congenital).
[0004] Idiopathic interstitial pneumonia (IIP) represents a class
of chronic pulmonary fibrotic disorder characterized by progressive
scarring of the alveolar interstitium leading to severe dyspnea,
hypoxemia, and death. Idiopathic pulmonary fibrosis (IPF) is the
most common type of IIP and currently has the highest mortality.
Despite being an area of intensive research, the etiology of IPF is
largely unknown. Familial clustering of IPF and differential
susceptibility of individuals to fibrogenic dusts has implicated
genetics in the development of this disorder. Genetic variants in
the telomerase reverse transcriptase (TERT), surfactant protein Al,
and surfactant protein C genes have been implicated in development
of familial interstitial pneumonia (FIP). However, these mutations
only account for a small percentage of FIP cases. Familial
association with IPF is 5-20%, and inheritance appears to be
autosomal. The efficacy of current treatments, such as fibrogenic
agents, is variable, indicating a need for more individualized
treatment.
[0005] Mucins represent a family of glycoproteins associated with
mucosal epithelia. Mucins can be associated with the cell membrane
or secreted, and typically form a component of mucus. Abnormal
expression or mutations in these proteins have been associated with
adenocarcinomas, as well as pulmonary disorders such as asthma and
bronchitis.
[0006] The present inventors have found that genetic variants of
the MUC5B gene are associated with pulmonary disease, and can
provide a useful tool for prognosing the course of disease and
determining a course of treatment. In addition, the increased level
of MUC5B expression that results from the disclosed genetic
variants provides a novel therapeutic target for pulmonary diseases
such as IIP, IPF, and FIP.
BRIEF SUMMARY OF THE INVENTION
[0007] Accordingly, in some embodiments, the invention provides
methods and compositions for diagnosis, risk prediction, and
determining the course of pulmonary disease. The invention further
provides personalized methods of treatment for pulmonary
diseases.
[0008] In some embodiments, the invention provides methods of
determining whether a subject has or is at risk of developing a
pulmonary disease, said method comprising determining (detecting)
whether a subject expresses an elevated MUC5B RNA level or an
elevated MUC5B protein level relative to a standard (e.g., normal)
control, wherein the presence of said elevated MUC5B RNA level or
said elevated MUC5B protein level indicates said subject has or is
at risk of developing a pulmonary disease. In some embodiments, the
pulmonary disease is an interstitial lung disease, e.g., a fibrotic
interstitial lung disease, such as idiopathic pulmonary fibrosis or
familial interstitial pneumonia.
[0009] The level of MUC5B RNA or protein can be determined using an
in vitro assay or in vivo imaging assay. In some embodiments, said
elevated MUC5B protein level or said elevated MUC5B RNA level is
determined from a biological sample from the subject, e.g., a
pulmonary tissue or bodily fluid of said subject. The bodily fluid
can be, e.g., whole blood, plasma, serum, urine, sputum, saliva, a
bronchoalveolar lavage sample, or exhaled breath condensate. In
some embodiments, the sample is further processed, e.g., to
separate cellular components or subcellular components. For
example, the determining can further comprises separating cells
from the remaining sample, or isolating exosomes or subcellular
vesicles.
[0010] In some embodiments, the method further comprises
administering a treatment to the subject, e.g., a pulmonary disease
treatment, or interstitial lung disease treatment. In some
embodiments, the treatment is a mucolytic agent. In some
embodiments, the treatment is a MUC5B antagonist. In some
embodiments, the method further comprises determining a second
MUC5B RNA level or MUC5B protein level after administering said
treatment and comparing said second level to the level observed
before administering said treatment.
[0011] In some embodiments, the expression level of at least one
additional pulmonary disease marker is determined and compared to a
standard control. For example, the at least one additional
pulmonary disease marker can be selected from the group consisting
of Surfactant Protein A, Surfactant Protein D, KL-6/MUC1, CC16,
CK-19, Ca 19-9, SLX, MCP-1, MIP-1a, ITAC, glutathione, type III
procollagen peptide, sIL-2R, ACE, neopterin, beta-glucuronidase,
LDH, CCL-18, CCL-2, CXCL12, MMP7, and osteopontin. An aberrant
expression level of the pulmonary disease marker indicates that the
subject has or is at risk of developing a pulmonary disease. In
some embodiments, the aberrant expression is elevated relative to a
normal control.
[0012] In some embodiments, the aberrant expression is reduced
relative to a normal control. In some embodiments, the method
comprises determining whether the genome of the subject comprises a
genetic variant of the at least one additional pulmonary disease
marker selected from the group consisting of Surfactant Protein A2,
Surfactant Protein B, Surfactant Protein C, TERC, TERT, IL-1RN,
IL-1.alpha., IL-1.beta., TNF, Lymphotoxin .alpha., TNF-RII, IL-10,
IL-6, IL-12, IFN.gamma., TGF.beta., CR1, ACE, IL-8, CXCR1, CXCR2,
MUC1 (KL6), and MUC5AC, wherein the presence of a genetic variant
of the at least one additional pulmonary disease marker is
indicative that the subject has or is at risk of developing a
pulmonary disease. In some embodiments, the method does not
comprise determining whether the genome of the subject comprises a
genetic variant of MUC5AC.
[0013] In some embodiments, the standard control is obtained from
normal, non-diseased sample. In some embodiments, the standard
control is from a different individual or pool of individuals. In
some embodiments, the standard control is a standard obtained from
a population of individuals that do not have a pulmonary disease.
In some embodiments, the standard control is obtained from the same
individual, e.g., obtained at a different time, e.g., prior to
exposure to an airway stressor. Typically, when detecting or
determining the expression level of a given RNA or protein (e.g.,
MUC5B), the same RNA or protein is detected in the standard
control. However, in some embodiments, a different RNA or protein
can be detected and the ratio used to determine whether the RNA or
protein level from the subject is elevated. Moreover, in some
embodiments, the method can comprise comparison to a positive
control, e.g., from a known pulmonary disease sample, or a sample
from a known individual or pool of individuals that carry a genetic
variant MUC5B gene or have elevated MUC5B expression.
[0014] In some embodiments, the invention provides methods of
determining whether a subject has or is at risk of developing a
pulmonary disease, said method comprising detecting (determining)
whether a genome of a subject comprises a genetic variant MUC5B
gene, wherein the presence of said genetic variant MUC5B gene
indicates said subject has or is at risk of developing a pulmonary
disease. In some embodiments, the pulmonary disease is an
interstitial lung disease, e.g., a fibrotic interstitial lung
disease, such as idiopathic pulmonary fibrosis or familial
interstitial pneumonia.
[0015] In some embodiments, the genetic variant MUC5B gene in said
subject results in elevated expression of MUC5B RNA or MUC5B
protein. In some embodiments, the subject is homozygous for said
genetic variant MUC5B gene. In some embodiments, the subject is
heterozygous for said genetic variant MUC5B gene. In some
embodiments, the subject lacks the genetic variant MUC5B gene. In
some embodiments, the genetic variant MUC5B gene is a genetic
variant regulatory region MUC5B gene, e.g., a genetic variant
promoter MUC5B gene. In some embodiments, the genetic variant MUC5B
gene has a single nucleotide polymorphism (SNP). In some
embodiments, the SNP is selected from the group consisting of
single nucleotide polymorphism is rs2672792, rs72636989,
MUC5B-Prm1, rs2672794, rs35705950, MUC5B-Prm2, rs11042491,
rs2735726, rs868902, MUC5B-Prm3, MUC5B-Prm4, MUC5B-Prm5,
rs868903,MUC5B-Prm6, rs885455, rs885454,MUC5B-Prm7, rs7115457,
rs7118568 rs56235854 and rs2735738. In some embodiments, the
presence of more than one SNP is determined. In some embodiments,
the SNP is rs35705950.
[0016] In some embodiments, the genetic variant MUC5B gene
comprises a first single nucleotide polymorphism (SNP) and a second
SNP. In some embodiments, the first SNP is present within a first
DNA strand and said second SNP is present within a second DNA
strand. In some embodiments, the first and second SNP are present
within the same DNA strand.
[0017] In some embodiments, the determining comprises use of at
least one sequence selected from the group consisting of SEQ ID
NOs:20-53 to determine whether the genome of the subject comprises
a genetic variant MUC5B gene, e.g., by using an appropriate nucleic
acid assay to detect the variant nucleotide in the selected
sequence. For example, the determining can comprise use of one or
more of the sequences of SEQ ID NOs:20-53 in an RT-PCR, array
hybridization, or other appropriate SNP detection method as
described herein. In some embodiments, the determining comprises
(i) contacting a sample from the subject with a nucleic acid probe
having at least 10 contiguous nucleotides of at least one of the
sequences selected from SEQ ID NOs:20-53, or its complement,
wherein said 10 contiguous nucleotides span the genetic variant
nucleotide (i.e., the position of the SNP shown for each sequence),
and (ii) determining whether the nucleic acid probe hybridizes to a
nucleic acid in the sample. In some embodiments, the at least one
sequence includes SEQ ID NO:24, wherein the presence of a T at
position 28 of SEQ ID NO:24 indicates a genetic variant MUC5B gene,
and that the subject has or will have an attenuated form of the
pulmonary disease. The presence of a G at position 28 of SEQ ID
NO:24 indicates that the subject has or will have a more severe
form of the pulmonary disease (e.g., where the subject is
homozygous for G at position 28, or lacking a genetic variant
promoter MUC5B gene).
[0018] In some embodiments, the method further comprises
determining whether said individual expresses an elevated MUC5B RNA
level or an elevated MUC5B protein level relative to a standard
control, wherein the presence of said elevated MUC5B RNA level or
said elevated MUC5B protein level further indicates said subject
has or is at risk of developing a pulmonary disease. Said step of
determining can be carried out as discussed above.
[0019] In some embodiments, the method does not comprise
determining whether the individual expresses an elevated level of
MUC5AC RNA or protein. In some embodiments, the method does not
comprise determining whether said individual expresses an elevated
level of a second RNA or protein other than a MUC5B RNA or protein.
In some embodiments, the method does not comprise determining
whether said individual expresses an elevated level of a second RNA
or protein other than a MUC5B RNA or protein, unless said second
RNA or protein is a MUC5AC RNA or protein.
[0020] In some embodiments, the method further comprises
administering a treatment to the subject, e.g., a pulmonary disease
treatment, or interstitial lung disease treatment. In some
embodiments, the treatment is a mucolytic agent. In some
embodiments, the treatment is a MUC5B antagonist, e.g., small
molecule that inhibits MUC5B production or activity. In some
embodiments, the method further comprises determining a second
MUC5B RNA level or MUC5B protein level after administering said
treatment and comparing said second level to the level observed
before administering said treatment.
[0021] In some embodiments, the method further comprises
determining whether the genome of the subject comprises at least
one additional genetic variant pulmonary disease marker gene. In
some embodiments, the at least one additional pulmonary disease
marker can be selected from the group consisting of Surfactant
Protein A2, Surfactant Protein B, Surfactant Protein C, TERC, TERT,
IL-1RN, IL-1.alpha., IL-1.beta., TNF, Lymphotoxin .alpha., TNF-RII,
IL-10, IL-6, IL-12, IFN.gamma., TGF.beta., CR1, ACE, IL-8, CXCR1,
CXCR2, MUC1 (KL6), or MUC5AC. The presence of an additional genetic
variant pulmonary disease marker gene can indicate that the subject
is at risk of or has a pulmonary disease.
[0022] In some embodiments, the presence of the genetic variant
MUC5B gene indicates that the subject has an attenuated form of the
pulmonary disease. That is, the subject will have a reduced
severity of symptoms, more gradual loss of lung function, or
increased survival compared to the normal, non-attenuated form of
the pulmonary disease, i.e., compared to the pulmonary disease as
it occurs in an individual that does not have a genetic variant
MUC5B gene.
[0023] Thus, in some embodiments, the invention provides methods of
prognosing a pulmonary disease in a patient, said method comprising
determining whether a genome of a subject comprises a genetic
variant MUC5B gene, wherein the presence of said genetic variant
MUC5B gene indicates an attenuated form of said pulmonary disease
in said patient relative to the absence of said genetic variant
MUC5B gene. The absence of a genetic variant MUC5B gene can
indicate that the patient has a more aggressive form of said
pulmonary disease. In some embodiments, the pulmonary disease is an
interstitial lung disease, e.g., a fibrotic interstitial lung
disease, such as idiopathic pulmonary fibrosis or familial
interstitial pneumonia. Said genetic variant MUC5B gene can be as
described above.
[0024] In some embodiments, the method further comprises setting a
course of treatment for the subject, e.g., based on the presence of
a genetic variant MUC5B gene in the subject. For example, the
presence of a genetic variant MUC5B gene, or the level of MUC5B
gene expression, can be determined in the subject, a treatment
administered to the subject, and the progress of the subject
monitored, e.g., by monitoring MUC5B expression over time or other
pulmonary diagnostic indicators, and determining whether further
treatment is necessary. Thus, in some embodiments, the method
further comprises administering pulmonary disease treatment or an
interstitial lung disease treatment to the subject. In some
embodiments, the method further comprises determining whether the
genome of the subject comprises a genetic variant MUC5B gene,
wherein the presence of a genetic variant MUC5B gene indicates an
attenuated form of said interstitial lung disease in said
subject.
[0025] In some embodiments, the invention provides methods of
determining whether a pulmonary disease is progressing in pulmonary
disease patient, said method comprising: (i) determining a first
level of MUC5B RNA or first level of MUC5B protein in said patient
at a first time point; (ii) determining a second level of MUC5B RNA
or second level of MUC5B protein in said patient at a second time
point; and (iii) comparing the second level of MUC5B RNA to the
first level of MUC5B RNA or comparing the second level of MUC5B
protein to the first level of MUC5B protein, wherein if the second
level of MUC5B RNA is greater than the first level of MUC5B RNA or
if the first level of MUC5B protein is greater than the first level
of MUC5B protein, the pulmonary disease is progressing in the
patient. In some embodiments, the pulmonary disease is an
interstitial lung disease, e.g., a fibrotic interstitial lung
disease, such as idiopathic pulmonary fibrosis or familial
interstitial pneumonia.
[0026] In some embodiments, the method further comprises
determining the rate of progression based on said comparing. That
is, an rapid increase in MUC5B expression in a short time is
correlated with more rapid progression of the pulmonary disease. In
some embodiments, said determining said first level of MUC5B RNA or
first level of MUC5B protein and said second level of MUC5B RNA or
second level of MUC5B protein comprises normalizing said first
level of MUC5B RNA or first level of MUC5B protein and said second
level of MUC5B RNA or second level of MUC5B protein to a level of
RNA or protein expressed from a standard gene in said interstitial
lung disease patient, e.g., GAPDH, beta-actin, HPRT1, beta-tubulin,
or beta-20 microglobulin.
[0027] In some embodiments, the invention provides methods of
treating, preventing, or ameliorating a pulmonary disease in a
subject in need thereof, the method comprising administering to
said patient an effective amount of a MUC5B antagonist, wherein
said antagonist reduces the expression of the MUC5B gene or reduces
the activity of the MUC5B protein as compared to the expression or
activity in the absence of said MUC5B antagonist, thereby treating,
preventing, or ameliorating the pulmonary disease in the subject.
In some embodiments, the MUC5B antagonist is a nucleic acid, e.g.,
a pRNA, siRNA, or antisense sequence, and reduces expression of the
MUC5B gene. In some embodiments, the MUC5B antagonist is a small
molecule, e.g., that reduces translation of MUC5B mRNA or packaging
or activity of the MUC5B protein. In some embodiments, the MUC5B
antagonist is selected from the group consisting of: a MUC5B
antibody or MUC5B-binding fragment thereof, a MUC5B-binding
aptamer, and a mucolytic agent. In some embodiments, the MUC5B
antagonist nucleic acid is capable of hybridizing to at least a
10-nucleotide contiguous sequence of a MUC5B encoding target
nucleic acid sequence. In some embodiments, the method further
comprises monitoring the subject, e.g., by determining the level of
MUC5B RNA or protein before and after said administering, or at one
or more time points after said administering. Thus, in some
embodiments, the method of treatment includes a step of determining
whether the genome of the subject comprises a genetic variant MUC5B
gene, and/or a step of determining whether the subject has an
elevated level of MUC5B RNA or protein, as described herein.
[0028] In some embodiments, the invention provides methods of
identifying a candidate pulmonary disease treatment compound, said
method comprising: (i) contacting a test compound with a MUC5B
protein; (ii) allowing said test compound to inhibit the activity
of said MUC5B protein; and (iii) selecting the test compound that
inhibits the activity of said MUC5B protein, thereby identifying a
candidate pulmonary disease treatment compound. In some
embodiments, the method is carried out in vivo, e.g., in an animal
model for pulmonary disease. In some embodiments, the method is
carried out in vitro.
[0029] In some embodiments, the invention provides methods of
identifying a candidate pulmonary disease treatment compound, said
method comprising: (i) contacting a test compound with a MUC5B
secreting cell; (ii) allowing said test compound to inhibit
secretion of MUC5B protein from said MUC5B secreting cell; and
(iii) selecting the test compound that inhibits secretion of MUC5B
protein from said MUC5B secreting cell, thereby identifying a
candidate pulmonary disease treatment compound. In some
embodiments, said MUC5B secreting cell is in vitro. In some
embodiments, said MUC5B secreting cell forms part of a pulmonary
tissue. In some embodiments, said pulmonary tissue forms part of an
organism, i.e., the method is carried out in vivo. In some
embodiments, the organism is a mammal, e.g., an animal model or a
human.
[0030] The invention further provides kits, e.g., for determining
whether a subject expresses an elevated level of MUC5B RNA or MUC5B
protein, or carries a genetic variant MUC5B gene. In some
embodiments, the kit comprises (a) a MUC5B binding agent capable of
binding to a substance selected from the group consisting of (i) a
genetic variant MUC5B gene sequence; (ii) a MUC5B RNA or fragment
thereof; and (iii) a MUC5B protein or fragment thereof, and (b) a
detecting reagent or a detecting apparatus capable of indicating
binding of said MUC5B binding agent to said substance. In some
embodiments, the MUC5B binding agent is labeled, e.g., with a
fluorescent label or radioisotope. In some embodiments, the kit
further comprises a sample collection device for collecting a
sample from the subject. In some embodiments, the MUC5B binding
agent binds a genetic variant MUC5B gene in the promoter region. In
some embodiments, the kit further comprises at least one control
sample, e.g., a non-variant MUC5B gene sequence or a sample from a
normal, non-disease control.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 represents a flow chart related to the genetic study
design described herein.
[0032] FIG. 2 represents a Multipoint LOD score graphs for whole
genome screen (884 markers with an average inter-marker distance of
4.2 centimorgans (CM)) in 82 families with two or more cases of
IIP.
[0033] FIG. 3 illustrates pair-wise linkage disequilibrium (LD)
plot for SNPs significantly associated with IPF or FIP by allelic
association test in genetic screen of lung-expressed gel-forming
mucins. LD values displayed are calculated by the r2 statistic for
the mucin genetic screen IPF subjects (n=492). Multi-colored
graphic about the plot indicates the approximate location of these
SNPs within the gel-forming mucin region. The highly significant
MUC5B promoter SNP (r535705950) and the corresponding pairwise LD
values are highlighted in red. Intergenic region is abbreviated as
Int, and the MUC5B Promoter is abbreviated as Pr. LD patterns were
qualitatively similar in the controls although in most instances
the LD was weaker among controls.
[0034] FIGS. 4A-4C represent illustrations of MUC5B gene expression
in IPF (N=33) and unaffected subjects (N=47) stratified by MUC5B
promoter SNP (r535705950) genotype and smoking status. A. MUC5B
gene expression among unaffected and IPF subjects colored coded
based on whether subjects are wildtype (dark grey) or heterozygous
for the MUC5B promoter SNP (light grey). B. Comparison of MUC5B
expression in unaffected subjects, among unaffected smokers only,
and among unaffected non-smokers only, by MUC5B promoter SNP
genotype. C. Comparison of MUC5B expression in all IPF subjects,
among IPF smokers only, and among IPF non-smokers only, by MUC5B
promoter SNP genotype. Lines represent group medians and the
expression of MUC5B is determined relative to GAPDH expression
[0035] FIGS. 5A-5C represent MUC5B immunohistochemistry of
unaffected and IPF tissue. Tissue sections stained for MUC5B
distribution in both the unaffected and IPF lung show strong
specific cytoplasmic staining within secretory columnar cells of
the bronchi and larger proximal bronchioles (FIG. 5A). In subjects
with IPF, regions of dense accumulation of MUC5B were observed in
areas of microscopic honeycombing and involved patchy staining of
the metaplastic epithelia lining the honeycomb cysts (FIG. 5B), as
well as the mucus plugs within the cysts (FIG. 5C).
DETAILED DESCRIPTION OF THE INVENTION
[0036] The invention provides novel methods and compositions for
diagnosing and predicting the severity of pulmonary disease, and a
novel therapeutic target for ameliorating pulmonary disease. The
inventors have found that individuals carrying genetic variants of
the MUC5B gene that have elevated expression of the gene have an
increased likelihood of developing a pulmonary disease, e.g., an
interstitial lung disease such as fibrotic interstitial lung
disease, idiopathic pulmonary fibrosis, familial interstitial
pneumonia, etc. The presence of some genetic variations in the
MUC5B gene, while increasing the likelihood of a pulmonary disease,
are indicative of an attenuated form of the disease, e.g., a more
gradual progression of symptoms and improved survival.
I. Definitions
[0037] The terms "pulmonary disease," "pulmonary disorder," "lung
disease," etc. are used interchangeably herein. The term is used to
broadly refer to lung disorders characterized by difficulty
breathing, coughing, airway discomfort and inflammation, increased
mucus, and/or pulmonary fibrosis.
[0038] Mucins are a family of high molecular weight, heavily
glycosylated proteins (glycoproteins) produced by mammalian
epithelia. Secreted, gel-forming mucins form a component of mucus.
Typically, the N- and C-terminal ends of mucin proteins are lightly
glycosylated, but rich in di-sulfide bond-forming cysteine
residues.
[0039] Mucin 5b (MUC5B) is a gel-forming mucin expressed in airway
epithelial tissue. Additional gel-forming mucins, MUC2, MUC5AC, and
MUC6, have been mapped to the same chromosomal region on human
chromosome 11. MUC5B is further characterized in Desseyn et al.
(1996) J. Biol. Chem. 273:30157-64.
[0040] The term "genetic variant," in the context of a particular
gene, refers a gene with a variant (e.g., non-standard or abnormal)
nucleic acid sequence. The gene includes coding and non-coding
sequences, such as regulatory regions. Genetic variants include
mutations and polymorphic sequences. Thus, the genetic variant may
affect the expression or activity of the gene or gene product. The
genetic variant may be an insertion of one or more nucleotides,
deletion of one or more nucleotides, or a substitution of one or
more nucleotides. A single nucleotide polymorphism (SNP) is an
example of a genetic variant.
[0041] The term "genetic variant MUC5B gene" refers to a MUC5B
genetic variant (a MUC5B gene with a genetic variation as described
above). The term "genetic variant promoter MUC5B gene" refers to a
variation that is specifically in the promoter region of the MUC5B
gene. Similarly, "genetic variant regulatory region MUC5B gene" and
"genetic variant intronic MUC5B gene" localize the variation within
the MUC5B gene. An example of a genetic variant MUC5B gene is
rs35705950, which includes a SNP in the promoter region.
[0042] An "airway mucosal sample" can be obtained using methods
known in the art, e.g., a bronchial epithelial brush as described
herein. Additional methods include endobronchial biopsy, bronchial
wash, bronchoalveolar lavage, whole lung lavage, transendoscopic
biopsy, and transtracheal wash.
[0043] The terms "subject," "patient," "individual," etc. are not
intended to be limiting and can be generally interchanged. That is,
an individual described as a "patient" does not necessarily have a
given disease, but may be merely seeking medical advice.
[0044] A "control" sample or value refers to a sample that serves
as a reference, usually a known reference, for comparison to a test
sample. For example, a test sample can be taken from a patient
suspected of having a given pulmonary disease and compared to
samples from a known pulmonary disease patient, known genetic
variant MUC5B carrier, or a known normal (non-disease) individual.
A control can also represent an average value gathered from a
population of similar individuals, e.g., pulmonary disease patients
or healthy individuals with a similar medical background, same age,
weight, etc. A control value can also be obtained from the same
individual, e.g., from an earlier-obtained sample, prior to
disease, or prior to treatment. One of skill will recognize that
controls can be designed for assessment of any number of
parameters.
[0045] One of skill in the art will understand which controls are
valuable in a given situation and be able to analyze data based on
comparisons to control values. Controls are also valuable for
determining the significance of data. For example, if values for a
given parameter are widely variant in controls, variation in test
samples will not be considered as significant.
[0046] As used herein, the terms "pharmaceutically" acceptable is
used synonymously with physiologically acceptable and
pharmacologically acceptable. A pharmaceutical composition will
generally comprise agents for buffering and preservation in
storage, and can include buffers and carriers for appropriate
delivery, depending on the route of administration.
[0047] The terms "dose" and "dosage" are used interchangeably
herein. A dose refers to the amount of active ingredient given to
an individual at each administration. For the present invention,
the dose will generally refer to the amount of pulmonary disease
treatment, anti-inflammatory agent, or MUC5B antagonist. The dose
will vary depending on a number of factors, including the range of
normal doses for a given therapy, frequency of administration; size
and tolerance of the individual; severity of the condition; risk of
side effects; and the route of administration. One of skill will
recognize that the dose can be modified depending on the above
factors or based on therapeutic progress. The term "dosage form"
refers to the particular format of the pharmaceutical, and depends
on the route of administration. For example, a dosage form can be
in a liquid form for nebulization, e.g., for inhalants, in a tablet
or liquid, e.g., for oral delivery, or a saline solution, e.g., for
injection.
[0048] As used herein, the terms "treat" and "prevent" are not
intended to be absolute terms. Treatment can refer to any delay in
onset, reduction in the frequency or severity of symptoms,
amelioration of symptoms, improvement in patient comfort and/or
respiratory function, etc. The effect of treatment can be compared
to an individual or pool of individuals not receiving a given
treatment, or to the same patient prior to, or after cessation of,
treatment.
[0049] The term "prevent" refers to a decrease in the occurrence of
pulmonary disease symptoms in a patient. As indicated above, the
prevention may be complete (no detectable symptoms) or partial,
such that fewer symptoms are observed than would likely occur
absent treatment.
[0050] The term "therapeutically effective amount," as used herein,
refers to that amount of the therapeutic agent sufficient to
ameliorate the disorder, as described above. For example, for the
given parameter, a therapeutically effective amount will show an
increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%,
60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also
be expressed as "-fold" increase or decrease. For example, a
therapeutically effective amount can have at least a 1.2-fold,
1.5-fold, 2-fold, 5-fold, or more effect over a control.
[0051] The term "diagnosis" refers to a relative probability that a
pulmonary disease is present in the subject. Similarly, the term
"prognosis" refers to a relative probability that a certain future
outcome may occur in the subject. For example, in the context of
the present invention, prognosis can refer to the likelihood that
an individual will develop a pulmonary disease, or the likely
severity of the disease (e.g., severity of symptoms, rate of
functional decline, survival, etc.). The terms are not intended to
be absolute, as will be appreciated by any one of skill in the
field of medical diagnostics.
[0052] The terms "correlating" and "associated," in reference to
determination of a pulmonary disease risk factor, refers to
comparing the presence or amount of the risk factor (e.g.,
dysregulation or genetic variation in a mucin gene) in an
individual to its presence or amount in persons known to suffer
from, or known to be at risk of, the pulmonary disease, or in
persons known to be free of pulmonary disease, and assigning an
increased or decreased probability of having/ developing the
pulmonary disease to an individual based on the assay
result(s).
[0053] "Nucleic acid" or "oligonucleotide" or "polynucleotide" or
grammatical equivalents used herein means at least two nucleotides
covalently linked together. Oligonucleotides are typically from
about 5, 6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50 or more nucleotides
in length, up to about 100 nucleotides in length. Nucleic acids and
polynucleotides are a polymers of any length, including longer
lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000,
etc. A nucleic acid of the present invention will generally contain
phosphodiester bonds, although in some cases, nucleic acid analogs
are included that may have alternate backbones, comprising, e.g.,
phosphoramidate, phosphorothioate, phosphorodithioate, or
O-methylphophoroamidite linkages (see Eckstein, Oligonucleotides
and Analogues: A Practical Approach, Oxford University Press); and
peptide nucleic acid backbones and linkages. Other analog nucleic
acids include those with positive backbones; non-ionic backbones,
and non-ribose backbones, including those described in U.S. Pat.
Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium
Series 580, Carbohydrate Modifications in Antisense Research,
Sanghui & Cook, eds. Nucleic acids containing one or more
carbocyclic sugars are also included within one definition of
nucleic acids. Modifications of the ribose-phosphate backbone may
be done for a variety of reasons, e.g., to increase the stability
and half-life of such molecules in physiological environments or as
probes on a biochip. Mixtures of naturally occurring nucleic acids
and analogs can be made; alternatively, mixtures of different
nucleic acid analogs, and mixtures of naturally occurring nucleic
acids and analogs may be made.
[0054] The terms "identical" or percent "identity," in the context
of two or more nucleic acids (e.g., genomic sequences or
subsequences, such as shown in SEQ ID NOs:20-53, or coding
sequences) or polypeptide sequences, refer to two or more sequences
or subsequences that are the same or have a specified percentage of
amino acid residues or nucleotides that are the same (i.e., 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, or more identity over a specified region), when
compared and aligned for maximum correspondence over a comparison
window, or designated region as measured using one of the following
sequence comparison algorithms or by manual alignment and visual
inspection. Such sequences are then said to be "substantially
identical." This definition also refers to the compliment of a test
sequence. Optionally, the identity exists over a region that is at
least about 10 to about 100, about 20 to about 75, about 30 to
about 50 amino acids or nucleotides in length.
[0055] An example of algorithms suitable for determining percent
sequence identity and sequence similarity are the BLAST and BLAST
2.0 algorithms, which are described in Altschul et al., Nuc. Acids
Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol.
215:403-410 (1990), respectively. As will be appreciated by one of
skill in the art, the software for performing BLAST analyses is
publicly available through the website of the National Center for
Biotechnology Information (ncbi.nlm.nih.gov).
[0056] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers, those containing modified
residues, and non-naturally occurring amino acid polymer.
[0057] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function similarly to the naturally occurring amino
acids. Naturally occurring amino acids are those encoded by the
genetic code, as well as those amino acids that are later modified,
e.g., hydroxyproline, y-carboxyglutamate, and O-phosphoserine.
Amino acid analogs refers to compounds that have the same basic
chemical structure as a naturally occurring amino acid, e.g., an a
carbon that is bound to a hydrogen, a carboxyl group, an amino
group, and an R group, e.g., homoserine, norleucine, methionine
sulfoxide, methionine methyl sulfonium. Such analogs may have
modified R groups (e.g., norleucine) or modified peptide backbones,
but retain the same basic chemical structure as a naturally
occurring amino acid. Amino acid mimetics refers to chemical
compounds that have a structure that is different from the general
chemical structure of an amino acid, but that functions similarly
to a naturally occurring amino acid.
[0058] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0059] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical or associated, e.g.,
naturally contiguous, sequences. Because of the degeneracy of the
genetic code, a large number of functionally identical nucleic
acids encode most proteins. For instance, the codons GCA, GCC, GCG
and GCU all encode the amino acid alanine. Thus, at every position
where an alanine is specified by a codon, the codon can be altered
to another of the corresponding codons described without altering
the encoded polypeptide. Such nucleic acid variations are "silent
variations," which are one species of conservatively modified
variations. Every nucleic acid sequence herein which encodes a
polypeptide also describes silent variations of the nucleic acid.
One of skill will recognize that in certain contexts each codon in
a nucleic acid (except AUG, which is ordinarily the only codon for
methionine, and TGG, which is ordinarily the only codon for
tryptophan) can be modified to yield a functionally identical
molecule. Accordingly, often silent variations of a nucleic acid
which encodes a polypeptide is implicit in a described sequence
with respect to the expression product, but not with respect to
actual probe sequences.
[0060] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles of the invention typically conservative substitutions for
one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D),
Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine
(R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M),
Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7)
Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M)
(see, e.g., Creighton, Proteins (1984)).
[0061] A "label" or a "detectable moiety" is a composition
detectable by spectroscopic, photochemical, biochemical,
immunochemical, chemical, or other physical means. For example,
useful labels include .sup.32P, fluorescent dyes, electron-dense
reagents, enzymes (e.g., as commonly used in an ELISA), biotin,
digoxigenin, or haptens and proteins or other entities which can be
made detectable, e.g., by incorporating a radiolabel into a peptide
or antibody specifically reactive with a target peptide. Any method
known in the art for conjugating an antibody to the label may be
employed, e.g., using methods described in Hermanson, Bioconjugate
Techniques 1996, Academic Press, Inc., San Diego.
[0062] A "labeled nucleic acid probe or oligonucleotide" is one
that is bound, either covalently, through a linker or a chemical
bond, or noncovalently, through ionic, van der Waals,
electrostatic, or hydrogen bonds to a label such that the presence
of the probe may be detected by detecting the presence of the label
bound to the probe. Alternatively, method using high affinity
interactions may achieve the same results where one of a pair of
binding partners binds to the other, e.g., biotin,
streptavidin.
[0063] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule only
to a particular nucleotide sequence with a higher affinity, e.g.,
under more stringent conditions, than to other nucleotide sequences
(e.g., total cellular or library DNA or RNA). One of skill in the
art will appreciate that specific hybridization between nucleotides
usually relies on Watson-Crick pair bonding between complementary
nucleotide sequences.
[0064] The term "probe" or "primer", as used herein, is defined to
be one or more nucleic acid fragments whose specific hybridization
to a sample can be detected. A probe or primer can be of any length
depending on the particular technique it will be used for. For
example, PCR primers are generally between 10 and 40 nucleotides in
length, while nucleic acid probes for, e.g., a Southern blot, can
be more than a hundred nucleotides in length. The probe may be
unlabeled or labeled as described below so that its binding to the
target or sample can be detected. The probe can be produced from a
source of nucleic acids from one or more particular (preselected)
portions of a chromosome, e.g., one or more clones, an isolated
whole chromosome or chromosome fragment, or a collection of
polymerase chain reaction (PCR) amplification products. The length
and complexity of the nucleic acid fixed onto the target element is
not critical to the invention. One of skill can adjust these
factors to provide optimum hybridization and signal production for
a given hybridization procedure, and to provide the required
resolution among different genes or genomic locations.
[0065] The probe may also be isolated nucleic acids immobilized on
a solid surface (e.g., nitrocellulose, glass, quartz, fused silica
slides), as in an array. In some embodiments, the probe may be a
member of an array of nucleic acids as described, for instance, in
WO 96/17958. Techniques capable of producing high density arrays
can also be used for this purpose (see, e.g., Fodor (1991) Science
767-773; Johnston (1998) Curr. Biol. 8: R171-R174; Schummer (1997)
Biotechniques 23: 1087-1092; Kern (1997) Biotechniques 23: 120-124;
U.S. Pat. No. 5,143,854). One of skill will recognize that the
precise sequence of the particular probes described herein can be
modified to a certain degree to produce probes that are
"substantially identical" to the disclosed probes, but retain the
ability to specifically bind to (i.e., hybridize specifically to)
the same targets or samples as the probe from which they were
derived. Such modifications are specifically covered by reference
to the individual probes described herein.
[0066] "Antibody" refers to a polypeptide comprising a framework
region from an immunoglobulin gene or fragments thereof that
specifically binds and recognizes an antigen, e.g., a specific
bacterial antigen. Typically, the "variable region" contains the
antigen-binding region of the antibody (or its functional
equivalent) and is most critical in specificity and affinity of
binding. See Paul, Fundamental Immunology (2003).
[0067] An exemplary immunoglobulin (antibody) structural unit
comprises a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each
chain defines a variable region of about 100 to 110 or more amino
acids primarily responsible for antigen recognition. The terms
variable light chain (V.sub.L) and variable heavy chain (V.sub.H)
refer to these light and heavy chains respectively.
[0068] Antibodies can exist as intact immunoglobulins or as any of
a number of well-characterized fragments that include specific
antigen-binding activity. Such fragments can be produced by
digestion with various peptidases. Pepsin digests an antibody below
the disulfide linkages in the hinge region to produce F(ab)'.sub.2,
a dimer of Fab which itself is a light chain joined to
V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be
reduced under mild conditions to break the disulfide linkage in the
hinge region, thereby converting the F(ab)'.sub.2 dimer into an
Fab' monomer. The Fab' monomer is essentially Fab with part of the
hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill will appreciate that
such fragments may be synthesized de novo either chemically or by
using recombinant DNA methodology. Thus, the term antibody, as used
herein, also includes antibody fragments either produced by the
modification of whole antibodies, or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv) or
those identified using phage display libraries (see, e.g.,
McCafferty et al., Nature 348:552-554 (1990)).
II. Mucins
[0069] There are several gel-forming mucins including, but not
limited to, MUC6, MUC2, MUC5AC, and MUC5B. These proteins are large
filamentous and highly O-glycosylated.
III. Pulmonary Diseases
[0070] The pulmonary diseases contemplated herein can include any
pulmonary disorders, lung fibrosis diseases, interstitial lung
diseases, idiopathic interstitial pneumonias (IIP), idiopathic
pulmonary fibrosis, familial interstitial pneumonia (FIP), acute
respiratory distress syndrome (ARDS), scleroderma lung disease ,
Sarcoidosis, Beryllium disease, rheumatoid arthritis associated
lung disorder, collagen vascular associated lung disorder,
cigarette smoke associated lung disorders, Sjogren's syndrome,
mixed connective tissue disease, nonspecific interstitial
pneumonitis (NSIP), etc.
[0071] Pulmonary fibrotic conditions, e.g., interstitial lung
diseases (ILD) are characterized by shortness of breath, chronic
coughing, fatigue and weakness, loss of appetite, and rapid weight
loss. Pulmonary fibrosis is commonly linked to interstitial lung
diseases (e.g., autoimmune disorders, viral infections or other
microscopic injuries), but can be idiopathic. Fibrosis involves
exchange of normal lung tissue with fibrotic tissue (scar tissue)
that leads to reduced oxygen capacity.
[0072] Idiopathic interstitial pneumonias (IIP) are a subset of
diffuse interstitial lung diseases of unknown etiology (the term
"idiopathic" indicates unknown origin). IIPs are characterized by
expansion of the interstitial compartment (i.e., that portion of
the lung parenchyma sandwiched between the epithelial and
endothelial basement membranes) with an infiltrate of inflammatory
cells. The inflammatory infiltrate is sometimes accompanied by
fibrosis, either in the form of abnormal collagen deposition or
proliferation of fibroblasts capable of collagen synthesis.
[0073] Idiopathic Pulmonary Fibrosis (IPF) occurs in thousands of
people worldwide with a doubling of prevalence over the past 10
years. Onset of IPF occurs around 50 to 70 years of age and starts
with progressive shortness of breath and hypoxemia. IPF median
survival is around 3-5 years and is to date untreatable. The
etiology and pathogenesis of the condition is not well understood.
About 5-20 percent of all cases of IPF have a family history and
inheritance appears to be autosomal dominant.
[0074] Additional fibrotic pulmonary diseases include Acute
Interstitial Pneumonia (AIP), Respiratory Bronchiolitis-associated
Interstitial Lung Disease (RBILD), Desquamative Interstitial
Pneumonia (DIP), Non-Specific Interstitial Pneumonia (NSIP),
Bronchiolitis obliterans, with Organizing Pneumonia (BOOP).
[0075] AIP is a rapidly progressive and histologically distinct
form of interstitial pneumonia. The pathological pattern is an
organizing form of diffuse alveolar damage (DAD) that is also found
in acute respiratory distress syndrome (ARDS) and other acute
interstitial pneumonias of known causes (see Clinical Atlas of
Interstitial Lung Disease (2006 ed.) pp61-63).
[0076] RBILD is characterized by inflammatory lesions of the
respiratory bronchioles in cigarette smokers. The histologic
appearance of RBILD is characterized by the accumulation of
pigmented macrophages within the respiratory bronchioles and the
surrounding airspaces, variably, peribronchial fibrotic alveolar
septal thickening, and minimal associated mural inflammation (see
Wells et al. (2003) Sem Respir. Crit. Care Med. vol. 24).
[0077] DIP is a rare interstitial lung disease characterized by the
accumulation of macrophages in large numbers in the alveolar spaces
associated with interstitial inflammation and/or fibrosis. The
macrophages frequently contain light brown pigment. Lymphoid
nodules are common, as is a sparse but distinct eosinophil
infiltrate. DIP is most common in smokers (see Tazelaar et al.
(Sep. 21, 2010) Histopathology).
[0078] NSIP is characterized pathologically by uniform interstitial
inflammation and fibrosis appearing over a short period of time.
NSIP differs from other interstitial lung diseases in that it has a
generally good prognosis. In addition, the temporal uniformity of
the parenchymal changes seen in NSIP contrasts greatly with the
temporal heterogeneity of usual interstitial pneumonia (see Coche
et al. (2001) Brit J Radiol 74:189).
[0079] BOOP, unlike NSIP, can be fatal within days of first acute
symptoms. It is characterized by rapid onset of acute respiratory
distress syndrome; therefore, clinically, rapidly progressive BOOP
can be indistinguishable from acute interstitial pneumonia.
Histological features include clusters of mononuclear inflammatory
cells that form granulation tissue and plug the distal airways and
alveolar spaces. These plugs of granulation tissue may form polyps
that migrate within the alveolar ducts or may be focally attached
to the wall. (see White & Ruth-Saad (2007) Crit. Care Nurse
27:53).
[0080] Further details about the characteristics and therapies
available for these diseases can be found, e.g., on the website of
the American Lung Association at
lungusa.org/lung-disease/pulmonary-fibrosis.
[0081] Diagnostic indicators of pulmonary disorders include biopsy
(e.g., VATS or surgical lung biopsy), high resolution computed
tomography (HRTC) or breathing metrics, such as forced expiratory
volume (FEV1), vital capacity (VC), forced vital capacity (FVC),
and FEV1/FVC.
[0082] Additional disorders associated with MUC5B expression and/or
SNPs associated with MUC5B (e.g. SNP r535705950) can include, but
are not limited to, mucous secretion disorders, cancers (e.g.
ovarian, breast lung, pancreatic etc.), eye disease, colitis, and
cirrhosis of the liver.
IV. Methods of Diagnosis and Prognosis
[0083] Methods for detecting and identifying nucleic acids and
proteins and interactions between such molecules involve
conventional molecular biology, microbiology, and recombinant DNA
techniques within the skill of the art. Such techniques are
explained fully in the literature (see, e.g., Sambrook, Fritsch
& Maniatis, Molecular Cloning: A Laboratory Manual, Second
Edition 1989, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.; Animal Cell Culture, R. I. Freshney, ed., 1986).
A. Biological Samples
[0084] For detection of a genetic variant using genomic DNA, a
biological sample can be obtained from nearly any tissue. One of
skill in the art will understand that a blood sample or a cheek
swab is expected to carry the same genetic sequence information as
a lung cell. For detection of a given expression level, pulmonary
tissue samples and other biological fluids are typically used.
[0085] Biological samples can include a pulmonary mucosal sample or
biological fluid such as blood or blood components (plasma, serum),
sputum, mucus, urine, saliva, etc.
[0086] A pulmonary mucosal sample can be obtained using methods
known in the art, e.g., a bronchial epithelial brush or exhaled
breath condensate. Additional methods include bronchial biopsy,
bronchial wash, bronchoalveolar lavage, whole lung lavage,
transendoscopic biopsy, translaryngoscopic catheter, and
transtracheal wash. A review of commonly used techniques, including
comparisons and safety issues, is provided in Busse et al. (2005)
Am J Respir Crit Care Med 172:807-816.
[0087] For lavage techniques, a bronchoscope can be inserted to the
desired level of the airway. A small volume of sterile,
physiologically acceptable fluid (e.g., buffered saline) is
released, and immediately aspirated. The wash material contains
cells from the mucosa and upper epithelia (Riise et al. (1996) Eur
Resp J 9:1665).
[0088] For use of a bronchial epithelial brush, a sterile,
non-irritating (e.g., nylon) cytology brush can be used. Multiple
brushings can be taken to ensure representative sampling. The brush
is then agitated in physiologically acceptable fluid, and the cells
and debris separated using routine methods (Riise et al. (1992) Eur
Resp J 5:382).
[0089] Cellular components can be isolated using methods known in
the art, e.g., centrifugation. Similarly, subcellular components
(e.g., exosomes or vesicles) can be isolated using known methods or
commercial separation products (available from BioCat, System Bio,
Bioscientific, etc.). An exemplary method is described e.g., by
Thery et al. (2006) Current Prot. Cell Biol.
B. Detection of Genetic Variants
[0090] The inventors have found that genetic variations in the
mucin genes are associated with pulmonary diseases. These genetic
variations can be found in any part of the gene, e.g., in the
regulatory regions, introns, or exons. Relevant genetic variations
may also be found the intergene regions, e.g., in sequences between
mucin genes. Insertions, substitutions, and deletions are included
in genetic variants. Single nucleotide polymorphisms (SNPs) are
exemplary genetic variants.
[0091] In particular, 14 independent SNPs are associated with
pulmonary disorders (e.g. FIP or IPF). The studies disclosed herein
demonstrate that presence of one or more of these SNPs associated
with MUC5B can lead to predisposition to a pulmonary disorder. In
addition, in some embodiments, if present, some of these SNPs are
related to a transcription factor binding site. The transcription
factor binding site can effect modulation of MUC5B expression, for
example E2F3 loss, and HOXA9 and PAX-2 generation.
[0092] The invention thus provides methods for assessing the
presence or absence of SNPs in a sample from a subject suspected of
having or developing a pulmonary disorder (e.g., because of family
history). In certain embodiments, one or more SNPs are screened in
one or more samples from a subject. The SNPs can be associated with
one or more genes, e.g., one or more MUC genes or other genes
associated with mucous secretion. In some embodiments, a MUC gene
associated SNP is associated with MUC5B and/or another MUC gene,
such as MUC5AC or MUC1. SNPs contemplated for diagnostic,
treatment, or prognosis can include SNPs found within a MUC gene
and/or within a regulatory or promoter region associated with a MUC
gene. For example, one or more SNPs can include, but are not
limited to, detection of the SNPs of MUC5B shown in Table 4 (SEQ ID
NOs:20-53), e.g., SNP rs35705950 (SEQ ID NO:24), alone or in
combination with other genetic variations or SNPs and/or other
diagnostic or prognostic methods.
[0093] Methods for detecting genetic variants such as a SNP are
known in the art, e.g., Southern or Northern blot, nucleotide
array, amplification methods, etc. Primers or probes are designed
to hybridize to a target sequence. For example, genomic DNA can be
screened for the presence of an identified genetic element of using
a probe based upon one or more sequences, e.g., using a probe with
substantial identity to a subsequence of the MUC5B gene, such as
one of the subsequences shown in Table 4 (SEQ ID NOs: 20-53).
Exemplary human MUC5B genomic sequences that can be used for
reference and probe and primer design are found at GenBank
Accession Nos. AF107890.1 and AJ004862.1. Expressed RNA can also be
screened, but may not include all relevant genetic variations.
Various degrees of stringency of hybridization may be employed in
the assay. As the conditions for hybridization become more
stringent, there must be a greater degree of complementarity
between the probe and the target for duplex formation to occur.
Thus, high stringency conditions are typically used for detecting a
SNP.
[0094] Thus, in some embodiments, a genetic variant MUC5B gene in a
subject is detected by contacting a nucleic acid in a sample from
the subject with a probe having substantial identity to a
subsequence of the MUC5B gene, and determining whether the nucleic
acid indicates that the subject has a genetic variant MUC5B gene.
In some cases, the sample can be processed prior to amplification,
e.g., to separate genomic DNA from other sample components. In some
cases, the probe has at least 90, 92, 94, 95, 96, 98, 99, or 100%
identity to the MUC5B gene subsequence. Typically, the probe is
between 10-500 nucleotides in length, e.g., 10-100, 10-40, 10-20,
20-100, 100-400, etc. In the case of detecting a SNP, the probe can
be even shorter, e.g., 8-20 nucleotides in length. In some cases,
the MUC5B gene sequence to be detected includes at least 8
contiguous nucleotides, e.g., at least 10, 15, 20, 25, 30, 35 or
more contiguous nucleotides of one of the sequences shown in SEQ ID
NOs:20-53. In some embodiments, the sequence to be detected
includes 8 contiguous nucleotides, e.g., at least 10, 15, 20, 25,
30, 35 or more contiguous nucleotides of SEQ ID NO:24. In some
aspects, the contiguous nucleotides include nucleotide 28 of SEQ ID
NO:24.
[0095] The degree of stringency can be controlled by temperature,
ionic strength, pH and/or the presence of a partially denaturing
solvent such as formamide. For example, the stringency of
hybridization is conveniently varied by changing the concentration
of formamide within the range up to and about 50%. The degree of
complementarity (sequence identity) required for detectable binding
will vary in accordance with the stringency of the hybridization
medium and/or wash medium. In certain embodiments, in particular
for detection of a particular SNP, the degree of complementarity is
about 100 percent. In other embodiments, sequence variations can
result in <100% complementarity, <90% complimentarity probes,
<80% complimentarity probes, etc., in particular, in a sequence
that does not involve a SNP. In some examples, e.g., detection of
species homologs, primers may be compensated for by reducing the
stringency of the hybridization and/or wash medium.
[0096] High stringency conditions for nucleic acid hybridization
are well known in the art. For example, conditions may comprise low
salt and/or high temperature conditions, such as provided by about
0.02 M to about 0.15 M NaCl at temperatures of about 50.degree. C.
to about 70.degree. C. Other exemplary conditions are disclosed in
the following Examples. It is understood that the temperature and
ionic strength of a desired stringency are determined in part by
the length of the particular nucleic acid(s), the length and
nucleotide content of the target sequence(s), the charge
composition of the nucleic acid(s), and by the presence or
concentration of formamide, tetramethylammonium chloride or other
solvent(s) in a hybridization mixture. Nucleic acids can be
completely complementary to a target sequence or exhibit one or
more mismatches.
[0097] Nucleic acids of interest (e.g., nucleic acids comprising,
or comprised within, SEQ ID NOs:20-53) can also be amplified using
a variety of known amplification techniques. For instance,
polymerase chain reaction (PCR) technology may be used to amplify
target sequences (e.g., genetic variants) directly from DNA, RNA,
or cDNA. In some embodiments, a stretch of nucleic acids is
amplified using primers on either side of a targeted genetic
variation, and the amplification product is then sequenced to
detect the targeted genetic variation (using, e.g., Sanger
sequencing, Pyrosequencing, Nextgen.RTM. sequencing technologies).
For example, the primers can be designed to hybridize to either
side of the upstream regulatory region of the MUC5B gene, and the
intervening sequence determined to detect a SNP in the promoter
region. In some embodiments, one of the primers can be designed to
hybridize to the targeted genetic variant. In some cases, a genetic
variant nucleotide can be identified using RT-PCR, e.g., using
labeled nucleotide monomers. In this way, the identity of the
nucleotide at a given position can be detected as it is added to
the polymerizing nucleic acid. The Scorpion.TM. system is a
commercially available example of this technology.
[0098] Thus, in some embodiments, a genetic variant MUC5B gene in a
subject is detected by amplifying a nucleic acid in a sample from
the subject to form an amplification product, and determining
whether the amplification product indicates a genetic variant MUC5B
gene. In some cases, the sample can be processed prior to
amplification, e.g., to separate genomic DNA from other sample
components. In some cases, amplifying comprises contacting the
sample with amplification primers having substantial identity to
MUC5B genomic subsequences, e.g., at least 90, 92, 94, 95, 96, 98,
99, or 100% identity. Typically, the sequence to be amplified is
between 30-1000 nucleotides in length, e.g., 50-500, 50-400,
100-400, 50-200, 100-300, etc. In some cases, the sequence to be
amplified or detected includes at least 8 contiguous nucleotides,
e.g., at least 10, 15, 20, 25, 30, 35 or more contiguous
nucleotides of one of the sequences shown in SEQ ID NOs:20-53. In
some embodiments, the sequence to be amplified or detected includes
8 contiguous nucleotides, e.g., at least 10, 15, 20, 25, 30, 35 or
more contiguous nucleotides of SEQ ID NO:24. In some aspects, the
contiguous nucleotides include nucleotide 28 of SEQ ID NO:24.
[0099] Amplification techniques can also be useful for cloning
nucleic acid sequences, to make nucleic acids to use as probes for
detecting the presence of a target nucleic acid in samples, for
nucleic acid sequencing, for control samples, or for other
purposes. Probes and primers are also readily available from
commercial sources, e.g., from Invitrogen, Clonetech, etc.
C. Detection of Expression Levels
[0100] Expression of a given gene, e.g., MUC5B or another mucin,
pulmonary disease marker, or standard (control), is typically
detected by detecting the amount of RNA (e.g., mRNA) or protein.
Sample levels can be compared to a control level.
[0101] Methods for detecting RNA are largely cumulative with the
nucleic acid detection assays described above. RNA to be detected
can include mRNA. In some embodiments, a reverse transcriptase
reaction is carried out and the targeted sequence is then amplified
using standard PCR. Quantitative PCR (qPCR) or real time PCR
(RT-PCR) is useful for determining relative expression levels, when
compared to a control. Quantitative PCR techniques and platforms
are known in the art, and commercially available (see, e.g., the
qPCR Symposium website, available at qpersymposium.com). Nucleic
acid arrays are also useful for detecting nucleic acid expression.
Customizable arrays are available from, e.g., Affimatrix. An
exemplary human MUC5B mRNA sequence, e.g., for probe and primer
design, can be found at GenBank Accession No. AF086604.1.
[0102] Protein levels can be detected using antibodies or antibody
fragments specific for that protein, natural ligands, small
molecules, aptamers, etc. An exemplary human MUC5B sequence, e.g.,
for screening a targeting agent, can be found at UniProt Accession
No. O00446.
[0103] Antibody based techniques are known in the art, and
described, e.g., in Harlow & Lane (1988) Antibodies: A
Laboratory Manual and Harlow (1998) Using Antibodies: A Laboratory
Manual; Wild, The Immunoassay Handbook, 3d edition (2005) and Law,
Immunoassay: A Practical Guide (1996). The assay can be directed to
detection of a molecular target (e.g., protein or antigen), or a
cell, tissue, biological sample, liquid sample or surface suspected
of carrying an antibody or antibody target.
[0104] A non-exhaustive list of immunoassays includes: competitive
and non-competitive formats, enzyme linked immunosorption assays
(ELISA), microspot assays, Western blots, gel filtration and
chromatography, immunochromatography, immunohistochemistry, flow
cytometry or fluorescence activated cell sorting (FACS),
microarrays, and more. Such techniques can also be used in situ, ex
vivo, or in vivo, e.g., for diagnostic imaging.
[0105] Aptamers are nucleic acids that are designed to bind to a
wide variety of targets in a non-Watson Crick manner. An aptamer
can thus be used to detect or otherwise target nearly any molecule
of interest, including a pulmonary disease associated protein.
Methods of constructing and determining the binding characteristics
of aptamers are well known in the art. For example, such techniques
are described in U.S. Pat. Nos. 5,582,981, 5,595,877 and 5,637,459.
Aptamers are typically at least 5 nucleotides, 10, 20, 30 or 40
nucleotides in length, and can be composed of modified nucleic
acids to improve stability. Flanking sequences can be added for
structural stability, e.g., to form 3-dimensional structures in the
aptamer.
[0106] Protein detection agents described herein can also be used
as a treatment and/or diagnosis of pulmonary disease or predictor
of disease progression, e.g., propensity for survival, in a subject
having or suspected of developing a pulmonary disorder. In certain
embodiments, MUC5B antibodies can be used to assess MUC5B protein
levels in a subject having or suspected of developing a pulmonary
disorder. It is contemplated herein that antibodies or antibody
fragments may be used to modulate MUC5B production in a subject
having or suspected of developing a pulmonary disease. In certain
embodiments, one or more agents capable of modulating MUC5B may be
used to treat a subject having or suspected of developing a
pulmonary disorder. One or more antibodies or antibody fragments
may be generated to detect one or more of the SNPs disclosed herein
by any method known in the art.
[0107] In certain embodiments, MUC5B diagnostic tests may include,
but are not limited to, alone or in combination, analysis of
rs35705950 SNP in MUC5B gene, MUC5B mRNA levels, and/or MUC5B
protein levels.
D. Additional Pulmonary Disease Markers
[0108] The above methods of detection can be applied to additional
pulmonary disease markers. That is, the expression level or
presence of genetic variants of at least one additional pulmonary
disease marker gene can be determined, or the activity of the
marker protein can be determined, and compared to a standard
control for the pulmonary disease marker. The examination of
additional pulmonary disease markers can be used to confirm a
diagnosis of pulmonary disease, monitor disease progression, or
determine the efficacy of a course of treatment in a subject.
[0109] In some cases, pulmonary disease is indicated by an
increased number of lymphocytes, e.g., CD4+CD28-cells (Moeller et
al. (2009) Am. J. Resp. Crit Care. Med. 179:588; Gilani (2010) PLoS
One 5:e8959).
[0110] Genetic variations in the following genes are associated
with pulmonary disease: Surfactant Protein A2, Surfactant Protein
B, Surfactant Protein C, TERC, TERT, IL-1RN, IL-1.alpha.,
IL-1.beta., TNF, Lymphotoxin .alpha., TNF-RII, IL-10, IL-6, IL-12,
IFN.gamma., TGF.beta., CR1, ACE, IL-8, CXCR1, CXCR2, MUC1 (KL6), or
MUC5AC. Thus, the invention further includes methods of determining
whether the genome of a subject comprises a genetic variant of at
least one gene selected from these genes. The presence of a genetic
variant indicates that the subject has or is at risk of developing
pulmonary disease. Said determining can optionally be combined with
determining whether the genome of the subject comprises a genetic
variant MUC5B gene, or determining whether the subject has an
elevated level of MUC5B RNA or protein to confirm or strengthen the
diagnosis or prognosis.
[0111] Abnormal expression in the following genes can also be
indicative of pulmonary disease: Surfactant Protein A, Surfactant
Protein D, KL-6/MUC1, CC16, CK-19, Ca 19-9, SLX, MCP-1, MIP-1a,
ITAC, glutathione, type III procollagen peptide, sIL-2R, ACE,
neopterin, beta-glucuronidase, LDH, CCL-18, CCL-2, CXCL12, MMP7,
and osteopontin. Thus, the expression of one of these genes can be
detected and compared to a control, wherein an abnormal expression
level indicates that the subject has or is at risk of developing
pulmonary disease. Said determining can optionally be combined with
determining whether the genome of the subject comprises a genetic
variant MUC5B gene, or determining whether the subject has an
elevated level of MUC5B RNA or protein to confirm or strengthen the
diagnosis or prognosis.
E. Indications
[0112] The detection methods described herein can be used for
diagnosis, prognosis, risk prediction, determining a course of
treatment, monitoring therapeutic efficacy, and monitoring disease
progression. One of skill will appreciate that each of the
detection methods can be used alone or in combination.
[0113] For example, the presence of a genetic variant MUC5B gene
can be determined in a subject suspected of having or at risk of
developing a pulmonary disorder. In the event that a genetic
variant MUC5B gene is observed, the subject can optionally undergo
further testing, e.g., to determine the level of MUC5B gene
expression, or detect a genetic variant form of at least one
additional pulmonary disease marker. The subject can be prescribed
a course of treatment based on the results of one or more tests.
Such treatment can include administration of a MUC5B antagonist, or
a standard pulmonary disease treatment such as a mucolytic drug.
The expression level of the MUC5B gene can be detected again after
treatment, or periodically during the course of treatment, to
determine the therapeutic efficacy of the treatment. For example,
if a pulmonary disease treatment is prescribed for periodic
administration (e.g., daily, twice-daily, weekly, etc.), the MUC5B
gene expression level can be monitored periodically thereafter
(e.g., monthly).
[0114] The detection methods of the invention can be used to
determine if the subject has an attenuated form of the pulmonary
disease. The inventors have shown that individuals carrying the
rs35705950 genetic variant MUC5B gene have a better pulmonary
disease prognosis than individuals that do not carry a genetic
variant MUC5B gene. Thus, determination of whether an individual
carries the genetic variant MUC5B gene can be used to design a
course of treatment for the individual.
V. Methods of Treatment
A. Pulmonary Disease Treatments
[0115] A number of pulmonary disease treatments are available for
addressing airway inflammation and/or excess mucus secretion. These
include agents that can be roughly categorized, e.g., as mucolytic
agents, mucoregulatory agents, mucokinetic agents, and expectorants
(see, e.g., Balsamo et al. (2010) Eur. Respir. Rev. 19:127-33),
though there is some overlap in the categories. Such agents are
useful for treating the pulmonary diseases described herein, e.g.,
as part of a course of treatment and monitoring, or after detection
of elevated MUC5B RNA or protein, or detection of a genetic variant
MUC5B gene.
[0116] Mucolytic drugs are those that decrease mucus viscosity,
either by depolymerizing mucin glycoproteins or depolymerizing DNA
and F-actin polymer networks. The first mode of action can be
particularly useful for addressing excess MUC5B. Exemplary
mucolytics include N-acetylcysteine, N-acystelyn, erdoseine,
dornase alfa, thymosin beta4, dextran, pulmozyme, heparin, and
bronchiotol (inhaled mannose).
[0117] Mucoregulators are those agents that regulate mucus
secretion, or interfere with the DNA/ F-actin network. Examples of
mucoregulators include, e.g., carbocysteine, anticholoinergic
agents, glucocorticoids, and macrolide antibiotics.
[0118] Mucokinetic agents increase mucus clearance by acting on the
cilia lining the airway. Examplary mucokinetic agents include,
e.g., bronchodilators, surfactants, and ambroxol.
[0119] Expectorants are agents that induce discharge of mucus from
the airway or respiratory tract. Some examples include hypertonic
saline, guaifenesin, dornase/ pulmozyme, and bronchiotol (inhaled
mannose).
[0120] The pulmonary disease treatment, such as the agents
described above, can be used alone, sequentially, or in combination
according to the methods described herein. In some embodiments, a
pulmonary disease treatment is used in combination with a more
targeted inhibitor of MUC5B expression.
B. MUC5B Antagonists
[0121] The results disclosed herein indicate that elevated
expression of the MUC5B gene is associated with pulmonary disease.
The invention thus includes methods and compositions for inhibiting
the expression, secretion, and/ or activity of MUC5B. Exemplary
inhibitors include siRNA and antisense, pRNA (promoter-associated
RNA, see, e.g., Schmitz et al. (2010) Genes Dev. 24:2264-69),
MUC5B-specific antibodies and fragments thereof, and MUC5B-specific
aptamers. In some embodiments, MUC5B activity can be inhibited or
MUC5B clearance can be increased, e.g., using mucolytic agents,
glycosylation inhibitors, or inhibitors of protein secretion. The
terms "inhibitor" and "antagonist" and like terms are used
synonymously herein.
[0122] Thus, a nucleotide sequence that specifically interferes
with expression of the MUC5B gene at the transcriptional or
translational level can be used to treat or prevent pulmonary
disease. This approach may utilize, for example, siRNA and/or
antisense oligonucleotides to block transcription or translation of
a specific mRNA (e.g., a genetic variant RNA), either by inducing
degradation of the mRNA with a siRNA or by masking the mRNA with an
antisense nucleic acid. In some embodiments, the siRNA or antisense
construct does not significantly block expression of other mucin
genes.
[0123] Double stranded siRNA that corresponds to the MUC5B gene can
be used to silence the transcription and/or translation by inducing
degradation of MUC5B mRNA transcripts, and thus treat or prevent
pulmonary disease (e.g., pulmonary disease associated with genetic
variant MUC5B). The siRNA is typically about 5 to about 100
nucleotides in length, more typically about 10 to about 50
nucleotides in length, most typically about 15 to about 30
nucleotides in length. siRNA molecules and methods of generating
them are described in, e.g., Bass, 2001, Nature, 411, 428-429;
Elbashir et al., 2001, Nature, 411, 494-498; WO 00/44895; WO
01/36646; WO 99/32619; WO 00/01846; WO 01/29058; WO 99/07409; and
WO 00/44914. A DNA molecule that transcribes dsRNA or siRNA (for
instance, as a hairpin duplex) also provides RNAi. DNA molecules
for transcribing dsRNA are disclosed in U.S. Pat. No. 6,573,099,
and in U.S. Patent Application Publication Nos. 2002/0160393 and
2003/0027783, and Tuschl and Borkhardt, Molecular Interventions,
2:158 (2002). For example, dsRNA oligonucleotides that specifically
hybridize to the MUC5B nucleic acid sequences described herein can
be used in the methods of the present invention. A decrease in the
severity of pulmonary disease symptoms in comparison to symptoms
detected in the absence of the interfering RNA can be used to
monitor the efficacy of the siRNA
[0124] Antisense oligonucleotides that specifically hybridize to
nucleic acid sequences encoding MUC5B polypeptides can also be used
to silence transcription and/or translation, and thus treat or
prevent pulmonary disease. For example, antisense oligonucleotides
that specifically hybridize to a MUC5B polynucleotide sequence can
be used. A decrease in the severity of pulmonary disease symptoms
in comparison to symptoms detected in the absence of the antisense
nucleic acids can be used to monitor the efficacy of the antisense
nucleic acids.
[0125] Antisense nucleic acids are DNA or RNA molecules that are
complementary to at least a portion of a specific mRNA molecule
(see, e.g., Weintraub, Scientific American, 262:40 (1990)).
Typically, synthetic antisense oligonucleotides are generally
between 15 and 25 bases in length. Antisense nucleic acids may
comprise naturally occurring nucleotides or modified nucleotides
such as, e.g., phosphorothioate, methylphosphonate, and -anomeric
sugar-phosphate, backbone-modified nucleotides.
[0126] In the cell, the antisense nucleic acids hybridize to the
corresponding mRNA, forming a double-stranded molecule. The
antisense nucleic acids, interfere with the translation of the
mRNA, since the cell will not translate a mRNA that is
double-stranded. Antisense oligomers of about 15 nucleotides are
preferred, since they are easily synthesized and are less likely to
cause problems than larger molecules when introduced into the
target nucleotide mutant producing cell. The use of antisense
methods to inhibit the in vitro translation of genes is well known
in the art (Marcus-Sakura, Anal. Biochem., 172:289, (1988)). Less
commonly, antisense molecules which bind directly to the DNA may be
used.
[0127] siRNA and antisense can be delivered to the subject using
any means known in the art, including by injection, inhalation, or
oral ingestion. Another suitable delivery system is a colloidal
dispersion system such as, for example, macromolecule complexes,
nanocapsules, microspheres, beads, and lipid-based systems
including oil-in-water emulsions, micelles, mixed micelles, and
liposomes. The preferred colloidal system of this invention is a
liposome. Liposomes are artificial membrane vesicles which are
useful as delivery vehicles in vitro and in vivo. Nucleic acids,
including RNA and DNA within liposomes and be delivered to cells in
a biologically active form (Fraley, et al., Trends Biochem. Sci.,
6:77, 1981). Liposomes can be targeted to specific cell types or
tissues using any means known in the art.
[0128] The invention also provides antibodies that specifically
bind to MUC5B protein. Such antibodies can be used to sequester
secreted MUC5B, e.g., to prevent gel-forming activity and formation
of excess mucus.
[0129] An antibody that specifically detects MUC5B, and not other
mucin proteins, can be isolated using standard techniques described
herein. The protein sequences for MUC5B in a number of species,
e.g., humans, non-human primates, rats, dogs, cats, horses,
bovines, etc., are publically available.
[0130] Monoclonal antibodies are obtained by various techniques
familiar to those skilled in the art. Briefly, spleen cells from an
animal immunized with a desired antigen are immortalized, commonly
by fusion with a myeloma cell (see, for example, Kohler &
Milstein, Eur. J. Immunol. 6: 511-519 (1976)). Alternative methods
of immortalization include transformation with Epstein Barr Virus,
oncogenes, or retroviruses, or other methods well known in the art.
Colonies arising from single immortalized cells are screened for
production of antibodies of the desired specificity and affinity
for the antigen, and yield of the monoclonal antibodies produced by
such cells may be enhanced by various techniques, including
injection into the peritoneal cavity of a vertebrate host.
Alternatively, one may isolate DNA sequences which encode a
monoclonal antibody or a binding fragment thereof by screening a
DNA library from human B cells according to the general protocol
outlined by Huse et al., Science 246: 1275-1281 (1989).
[0131] Monoclonal antibodies are collected and titered against the
MUC5B in an immunoassay, for example, a solid phase immunoassay
with the immunogen immobilized on a solid support. Monoclonal
antibodies will usually bind with a K.sub.d of at least about 0.1
mM, more usually at least about 1 .mu.M, and can often be designed
to bind with a K.sub.d of 1 nM or less.
[0132] The immunoglobulins, including MUC5B-binding fragments and
derivatives thereof, can be produced readily by a variety of
recombinant DNA techniques, including by expression in transfected
cells (e.g., immortalized eukaryotic cells, such as myeloma or
hybridoma cells) or in mice, rats, rabbits, or other vertebrate
capable of producing antibodies by well known methods. Suitable
source cells for the DNA sequences and host cells for
immunoglobulin expression and secretion can be obtained from a
number of sources, such as the American Type Culture Collection
(Catalogue of Cell Lines and Hybridomas, Fifth edition (1985)
Rockville, Md).
[0133] In some embodiments, the antibody is a humanized antibody,
i.e., an antibody that retains the reactivity of a non-human
antibody while being less immunogenic in humans. This can be
achieved, for instance, by retaining the non-human CDR regions that
are specific for MUC5B, and replacing the remaining parts of the
antibody with their human counterparts. See, e.g., Morrison et al.,
PNAS USA, 81:6851-6855 (1984); Morrison and Oi, Adv. Immunol.,
44:65-92 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988);
Padlan, Molec. Immun., 28:489-498 (1991); Padlan, Molec. Immun.,
31(3):169-217 (1994). Techniques for humanizing antibodies are well
known in the art and are described in e.g., U.S. Pat. Nos.
4,816,567; 5,530,101; 5,859,205; 5,585,089; 5,693,761; 5,693,762;
5,777,085; 6,180,370; 6,210,671; and 6,329,511; WO 87/02671; EP
Patent Application 0173494; Jones et al. (1986) Nature 321:522; and
Verhoyen et al. (1988) Science 239:1534. Humanized antibodies are
further described in, e.g., Winter and Milstein (1991) Nature
349:293. For example, polynucleotides comprising a first sequence
coding for humanized immunoglobulin framework regions and a second
sequence set coding for the desired immunoglobulin complementarity
determining regions can be produced synthetically or by combining
appropriate cDNA and genomic DNA segments. Human constant region
DNA sequences can be isolated in accordance with well known
procedures from a variety of human cells.
[0134] The activity of MUC5B protein can be inhibited, or the
clearance of MUC5B can be increased, using mucolytic agents that
break up mucus and proteolyze mucins. Mucolytic agents are
described herein. Additional inhibitors of MUC5B protein include
glycosylation inhibitors and inhibitors of protein secretion from
epithelial cells. An exemplary glycosylation inhibitor includes
benzyl-O-N-acetyl-D galactosamine (specific for O-glycans) and .
Additional inhibitors of protein glycosylation are disclosed, e.g.,
in Jacob (1995) Curr. Opin. Structural Biol. 5:605-11 and Patsos et
al. 2005 Biochem Soc. Trans. 33:721-23. Secretion inhibitors
include Brefeldin A, colchicine, and small molecules such as that
disclosed in Stockwell (2006) Nat. Chem. Biol. 2:7-8. MUC5B
activity can also be modulated by targeting the MARCKS protein
(Adler et al. (2000) Chest 117: Supp 1 266S-267S).
C. Methods of Identifying MUC5B Antagonists
[0135] The invention further provides methods for identifying
additional antagonists of MUC5B expression, secretion, and/or
activity. Methods for screening for antagonists can involve
measuring the ability of the potential antagonists to reduce an
identifiable MUC5B activity or compete for binding with a known
binding agent (e.g., MUC5B-specific antibody). For example,
candidate agents can be screened for their ability to reduce MUC5B
gel formation, reduce MUC5B secretion, reduce MUC5B glycosylation,
etc.
[0136] The screening methods of the invention can be performed as
in vitro or cell-based assays. Cell based assays can be performed
in any cells in which MUC5B is expressed, either endogenously or
through recombinant methods. Cell-based assays may involve whole
cells or cell fractions containing MUC5B to screen for agent
binding or modulation of MUC5B activity by the agent. Suitable
cell-based assays are described in, e.g., DePaola et al., Annals of
Biomedical Engineering 29: 1-9 (2001).
[0137] Agents that are initially identified as inhibiting MUC5B can
be further tested to validate the apparent activity. Preferably
such studies are conducted with suitable cell-based or animal
models of pulmonary disease. The basic format of such methods
involves administering a lead compound identified during an initial
screen to an animal that serves as a model and then determining if
in fact the pulmonary disease is ameliorated. The animal models
utilized in validation studies generally are mammals of any kind.
Specific examples of suitable animals include, but are not limited
to, primates (e.g., chimpanzees, monkeys, and the like) and rodents
(e.g., mice, rats, guinea pigs, rabbits, and the like).
[0138] The agents tested as potential antagonists of MUC5B can be
any small chemical compound, or a biological entity, such as a
polypeptide, sugar, nucleic acid or lipid. Alternatively,
modulators can be genetically altered versions of MUC5B, e.g.,
forms that are not glycosylated. Essentially any chemical compound
can be used as a potential modulator or ligand in the assays of the
invention, although most often compounds that can be dissolved in
aqueous or organic (especially DMSO-based) solutions are used. The
assays are designed to screen large chemical libraries by
automating the assay steps and providing compounds from any
convenient source to assays, which are typically run in parallel
(e.g., in microtiter formats on microtiter plates in robotic
assays).
[0139] In one embodiment, high throughput screening methods involve
providing a combinatorial chemical or peptide library containing a
large number of potential therapeutic compounds (potential
modulator or ligand compounds). Such "combinatorial chemical
libraries" or "ligand libraries" are then screened in one or more
assays, as described herein, to identify those library members
(particular chemical species or subclasses) that display a desired
characteristic activity. The compounds thus identified can serve as
conventional "lead compounds" or can themselves be used as
potential or actual therapeutics.
[0140] A combinatorial chemical library is a collection of diverse
chemical compounds generated by either chemical synthesis or
biological synthesis, by combining a number of chemical "building
blocks" such as reagents. For example, a linear combinatorial
chemical library such as a polypeptide library is formed by
combining a set of chemical building blocks (amino acids) in every
possible way for a given compound length (i.e., the number of amino
acids in a polypeptide compound). Millions of chemical compounds
can be synthesized through such combinatorial mixing of chemical
building blocks.
[0141] Preparation and screening of combinatorial chemical
libraries is well known to those of skill in the art. Such
combinatorial chemical libraries include, but are not limited to,
peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Int.
J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., Nature
354:84-88 (1991)). Other chemistries for generating chemical
diversity libraries can also be used. Such chemistries include, but
are not limited to: peptoids (e.g., PCT Publication No. WO
91/19735), encoded peptides (e.g., PCT Publication WO 93/20242),
random bio-oligomers (e.g., PCT Publication No. WO 92/00091),
benzodiazepines (e.g., U.S. Pat. No. 5,288,514), diversomers such
as hydantoins, benzodiazepines and dipeptides (Hobbs et al., Proc.
Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides
(Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)), nonpeptidal
peptidomimetics with glucose scaffolding (Hirschmann et al., J.
Amer. Chem. Soc. 114:9217-9218 (1992)), analogous organic syntheses
of small compound libraries (Chen et al., J. Amer. Chem. Soc.
116:2661 (1994)), oligocarbamates (Cho et al., Science 261:1303
(1993)), and/or peptidyl phosphonates (Campbell et al., J. Org.
[0142] Chem. 59:658 (1994)), nucleic acid libraries (see Ausubel,
Berger and Sambrook, all supra), peptide nucleic acid libraries
(see, e.g., U.S. Pat. No. 5,539,083), antibody libraries (see,
e.g., Vaughn et al., Nature Biotechnology, 14(3):309-314 (1996) and
PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al.,
Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853), small
organic molecule libraries (see, e.g., benzodiazepines, Baum
C&EN, January 18, page 33 (1993); isoprenoids, U.S. Pat. No.
5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No.
5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134;
morpholino compounds, U.S. Pat. No. 5,506,337; benzodiazepines, and
U.S. Pat. No. 5,288,514).
D. Pharmaceutical Compositions
[0143] The compositions disclosed herein can be administered by any
means known in the art. For example, compositions may include
administration to a subject intravenously, intradermally,
intraarterially, intraperitoneally, intralesionally,
intracranially, intraarticularly, intraprostaticaly,
intrapleurally, intratracheally, intranasally, intravitreally,
intravaginally, intrarectally, topically, intratumorally,
intramuscularly, intrathecally, subcutaneously, subconjunctival,
intravesicularlly, mucosally, intrapericardially, intraumbilically,
intraocularly, orally, locally, by inhalation, by injection, by
infusion, by continuous infusion, by localized perfusion, via a
catheter, via a lavage, in a creme, or in a lipid composition.
Administration can be local, e.g., to the pulmonary mucosa, or
systemic.
[0144] Solutions of the active compounds as free base or
pharmacologically acceptable salt can be prepared in water suitably
mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations can contain a
preservative to prevent the growth of microorganisms.
[0145] Pharmaceutical compositions can be delivered via intranasal
or inhalable solutions or sprays, aerosols or inhalants. Nasal
solutions can be aqueous solutions designed to be administered to
the nasal passages in drops or sprays. Nasal solutions can be
prepared so that they are similar in many respects to nasal
secretions. Thus, the aqueous nasal solutions usually are isotonic
and slightly buffered to maintain a pH of 5.5 to 6.5. In addition,
antimicrobial preservatives, similar to those used in ophthalmic
preparations, and appropriate drug stabilizers, if required, may be
included in the formulation. Various commercial nasal preparations
are known and can include, for example, antibiotics and
antihistamines.
[0146] Oral formulations can include excipients as, for example,
pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate, sodium saccharine, cellulose, magnesium carbonate and the
like. These compositions take the form of solutions, suspensions,
tablets, pills, capsules, sustained release formulations or
powders. In some embodiments, oral pharmaceutical compositions will
comprise an inert diluent or assimilable edible carrier, or they
may be enclosed in hard or soft shell gelatin capsule, or they may
be compressed into tablets, or they may be incorporated directly
with the food of the diet. For oral therapeutic administration, the
active compounds may be incorporated with excipients and used in
the form of ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like. Such
compositions and preparations should contain at least 0.1% of
active compound. The percentage of the compositions and
preparations may, of course, be varied and may conveniently be
between about 2 to about 75% of the weight of the unit, or
preferably between 25-60%. The amount of active compounds in such
compositions is such that a suitable dosage can be obtained
[0147] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered and the liquid
diluent first rendered isotonic with sufficient saline or glucose.
Aqueous solutions, in particular, sterile aqueous media, are
especially suitable for intravenous, intramuscular, subcutaneous
and intraperitoneal administration. For example, one dosage could
be dissolved in 1 ml of isotonic NaCl solution and either added to
1000 ml of hypodermoclysis fluid or injected at the proposed site
of infusion
[0148] Sterile injectable solutions can be prepared by
incorporating the active compounds or constructs in the required
amount in the appropriate solvent followed by filtered
sterilization. Generally, dispersions are prepared by incorporating
the various sterilized active ingredients into a sterile vehicle
which contains the basic dispersion medium. Vacuum-drying and
freeze-drying techniques, which yield a powder of the active
ingredient plus any additional desired ingredients, can be used to
prepare sterile powders for reconstitution of sterile injectable
solutions. The preparation of more, or highly, concentrated
solutions for direct injection is also contemplated. DMSO can be
used as solvent for extremely rapid penetration, delivering high
concentrations of the active agents to a small area.
E. Treatment Regimes
[0149] The invention provides methods of treating, preventing,
and/or ameliorating a pulmonary disorder in a subject in need
thereof, optionally based on the diagnostic and predictive methods
described herein. The course of treatment is best determined on an
individual basis depending on the particular characteristics of the
subject and the type of treatment selected. The treatment, such as
those disclosed herein, can be administered to the subject on a
daily, twice daily, bi-weekly, monthly or any applicable basis that
is therapeutically effective. The treatment can be administered
alone or in combination with any other treatment disclosed herein
or known in the art. The additional treatment can be administered
simultaneously with the first treatment, at a different time, or on
an entirely different therapeutic schedule (e.g., the first
treatment can be daily, while the additional treatment is
weekly).
[0150] Administration of a composition for ameliorating the
pulmonary disease, e.g., by treating elevated expression of the
MUC5B gene, can be a systemic or localized administration. For
example, treating a subject having a pulmonary disorder can include
administering an inhalable or intranasal form of anti-MUC5B agent
(MUC5B antagonist) on a daily basis or otherwise regular schedule.
In some embodiments, the treatment is only on an as-needed basis,
e.g., upon appearance of pulmonary disease symptoms.
VI. Kits
[0151] The invention provides kits for detection of pulmonary
disease markers in a subject. The kit can be for personal use or
provided to medical professionals. The kit can be a kit for
diagnosing or prognosing a pulmonary disorder, or for monitoring
the progression of disease or the efficacy of treatment.
[0152] In some embodiments, the kit includes components for
assessing MUC5B gene expression comprising, e.g., a nucleic acid
capable of detecting MUC5B RNA or a MUC5B protein binding agent,
optionally labeled. One of skill will appreciate that MUC5B gene
expression can be determined by measuring MUC5B RNA or protein. The
kit can further include assay containers (tubes), buffers, or
enzymes necessary for carrying out the detection assay.
[0153] In some embodiments, the kit includes components for
determining whether the genome of the subject carries a genetic
variant MUC5B gene, e.g., a nucleic acid that specifically
hybridizes to a genetic variant MUC5B gene sequence. Other
components in a kit can include, DNA sequencing assay components,
Taqman.RTM. genotyping assay components, Meta Analysis, one or more
detection system(s), one or more control samples or a combination
thereof. Kits can further include one or more agents where at least
one of the agents is capable of associating with SNP
rs35705950.
[0154] In some embodiments, the kit includes components to examine
more than one pulmonary disease marker. For example, the kit can
include marker detection agents, such as marker specific primers or
probes attached to an addressable array. Exemplary markers include
SNPs in the MUC5B genes, or genetic variants in other genes, e.g.,
Surfactant Protein A2, Surfactant Protein B, Surfactant Protein C,
TERC, TERT, IL-1RN, IL-1.alpha., IL-1.beta., TNF, Lymphotoxin
.alpha., TNF-RII, IL-10, IL-6, IL-12, IFN.gamma., TGF.beta., CR1,
ACE, IL-8, CXCR1 or CXCR2. In some embodiments, the expression
level of the markers is detected instead of or in addition to the
genetic sequence. In this case, useful pulmonary disease markers
with aberrant expression include: Surfactant Protein A, Surfactant
Protein D, KL-6/MUC1, CC16, CK-19, Ca 19-9, SLX, MCP-1, MIP-1a,
ITAC, glutathione, type III procollagen peptide, sIL-2R, ACE,
neopterin, beta-glucuronidase, LDH, CCL-18, CCL-2, CXCL12, MMP7,
and osteopontin. Additional pulmonary disease markers can include
the other MUC genes, e.g., MUC2, MUC5AC, and MUC6.
[0155] The kit will generally include at least one vial, test tube,
flask, bottle, syringe or other container means, into which the
testing agent, can be suitably reacted or aliquoted. Kits can also
include components for comparing results such as a suitable control
sample, for example a positive and/or negative control. The kit can
also include a collection device for collecting and/or holding the
sample from the subject. The collection device can include a
sterile swab or needle (for collecting blood), and/or a sterile
tube (e.g., for holding the swab or a bodily fluid sample).
[0156] The following discussion of the invention is for the
purposes of illustration and description, and is not intended to
limit the invention to the form or forms disclosed herein. Although
the description of the invention has included description of one or
more embodiments and certain variations and modifications, other
variations and modifications are within the scope of the invention,
e.g., as may be within the skill and knowledge of those in the art,
after understanding the present disclosure. All publications,
patents, patent applications, Genbank numbers, and websites cited
herein are hereby incorporated by reference in their entireties for
all purposes.
VII. Examples
Example 1: Sequencing of Pulmonary, Gel-Forming Mucins and Disease
Association
[0157] Study populations: Subjects with FIP or IPF were identified
and phenotyped. The diagnosis of IIP was established according to
conventional criteria. Eligible subjects were at least 38 years of
age and had IIP symptoms for at least 3 months. A high resolution
computerized tomography (HRCT) scan was required to show definite
or probable IIP according to predefined criteria, and a surgical
lung biopsy was obtained in 46% of affected subjects. FIP families
were defined by the presence of two or more cases of definite or
probable IIP within three degrees, with at least one case of IIP
established as definite/probable IPF. Exclusion criteria included
significant exposure to known fibrogenic agents or an alternative
etiology for ILD. Control subjects for genetic analysis were
acquired (FIG. 1).
[0158] Linkage analysis: A genome-wide linkage screen was completed
in 82 multiplex families using a DeCode linkage panel consisting of
a total of 884 markers with an average inter-marker distance of 4.2
CM. Multipoint non-parametric linkage analysis was performed using
Merlin, previously described. Kong and Cox LOD scores were
calculated using the S.sub.pairs statistic under an exponential
model; support intervals were determined using the
one-LOD-score-down method.
[0159] Fine-mapping of chromosome 11: To interrogate the linked
region on the p-terminus of chromosome 11 (8.4 Mb bounded by
rs702966 and rs1136966), fine mapping by genotyping 306 tagging
SNPs in 145 unrelated cases of FIP, 152 cases of IPF, and 233
Caucasian controls were performed. Tests of association comparing
FIP cases and IPF cases to controls were calculated under an
additive model for the minor allele.
[0160] Resequencing of MUC2 and MUC5AC: Primer pairs to generate
overlapping amplicons for resequencing the proximal promoter and
most exons of MUC2 and MUC5AC were designed on sequences masked for
repetitive elements, SNPs, and homology to other regions of the
genome.
[0161] Genetic screen of lung-expressed, gel-forming mucins: A
case-control association study was conducted in an independent
population of FIP (N=83), sporadic IPF (N=492), and control (N=322)
subjects (Table 2) using tagging and other SNPs localized across
the lung-expressed, gel-forming mucin genes on chromosome 11. 175
SNPs were successfully genotyped using the Sequenom iPlex assays,
and haploview was used to test SNPs for allelic association with
FIP and IPF. For those SNPs remaining significant after Bonferroni
correction, odds ratios were estimated under an additive model for
the rare allele after adjustment for age and gender via logistic
regression. Chi-squared goodness-of-fit tests were computed to
evaluate the evidence for disease-model explanations for genotypic
departures from Hardy Weinberg Equilibrium (HWE) among cases. For
the most highly-associated SNP, linkage and association modeling in
pedigrees were used to test whether, in the original linkage
families, the SNP was linked to the disease locus, was in linkage
disequilibrium with the disease locus, and could account for the
linkage signal.
[0162] Strong evidence for linkage based on the 82 FIP families
occurred on chromosome 11 where the maximum multipoint LOD score
was 3.3 (p=0.00004, D11S1318; FIG. 3). The 1-LOD support interval
for this linked region was bounded by markers D11S4046 and
D11S1760, spanning 3.4 Mb. Since D11S4046 was the most telomeric
marker typed, the region of interest was inclusive of the
p-terminus of chromosome 11. Within the 8.4 Mb larger region, 306
tagging SNPs were selected for fine-mapping in a case-control
association analysis (145 FIP cases, 152 IPF cases, and 233
controls. Allelic association testing revealed 7 SNPs within the
mucin 2 (MUC2) gene significantly associated with either FIP or
IPF. MUC2 is contained in a genomic region harboring 4 gel-forming
mucin genes (telomere to centromere: MUC6, MUC2, MUC5AC, and
MUC5B). While there are reported recombination hotspots located
between MUC6 and MUC2, and within the proximal portion of MUC5B,
markers within MUC2 and MUC5AC exhibit strong linkage
disequilibrium (LD) 17. Thus, MUC2 and MUC5AC were selected for
resequencing using the oligonucleotide primers. Resequencing
analysis identified 330 genetic variants in MUC2 and 195 genetic
variants in MUC5AC. Allelic association testing between these
genetic variants and disease status yielded 7 independent SNPs in
both MUC2 and MUC5AC significantly associated with either FIP or
IPF disease status.
[0163] We designed a genetic screen for common genetic variation
across the genomic region containing the 3 gel-forming mucin genes
expressed in the lung (MUC2, MUC5AC, and MUC5B) in an independent
population of subjects with TIP (FIP=83 and IPF=492) and controls
(n=322) (FIG. 1, Table 2). 19 independent SNPs were observed to be
significantly associated by allelic test with either or both FIP or
IPF after Bonferroni correction for multiple comparisons (Table 1).
Of these 19 SNPs, 6 occurred in MUC2, one in the MUC2-MUC5AC
intergenic region, 4 in MUC5AC, 3 in the MUC5AC-MUC5B intergenic
region, and 5 in the putative MUC5B promoter, within 4kb of the
MUC5B transcription start site 18, 19 (Table 1).
[0164] Of significance, a SNP in the putative promoter of MUC5B,
3kb upstream of the transcription start site (r535705950) was found
to have the most substantial effect on both FIP and IPF. The minor
allele of this SNP was present at a frequency of 33.8% in FIP
cases, 37.5% in IPF cases, and 9.1% among controls (allelic
association; FIP P=1.2.times.10-15, IPF P=2.5.times.10-37).
Notably, the genotype frequencies for rs35705950 were consistent
with HWE in controls, but not among IPF cases (P=6.0.times.10-11)
and nearly so among FIP cases (P=0.11). By comparing the genotype
frequencies observed in cases and controls to those expected if
rs35705950 is a true risk locus, the data demonstrates that these
genotype frequencies are consistent with an additive genotypic
effect on disease risk conferred by rs35705950 (P=0.88 and P=0.77,
respectively for FIP and IPF to reject additive effect). In
addition, the disease allele frequency and penetrance estimates
suggest a similar disease model for both FIP and IPF. The odds
ratio for disease for subjects heterozygous and homozygous for the
rarer allele of this SNP were 6.8 (95% CI 3.9-12.0) and 20.8 (95%
CI 3.8-113.7) for FIP, and 9.0 (95% CI 6.2-13.1) and 21.8 (95% CI
5.1-93.5) for IPF (Table 1). To ensure this SNP was not tagging
another SNP in the MUC5B promoter region, the 4 kb region was
resequenced upstream of the MUC5B transcription start site in 48
IPF cases and 48 controls (Table 3). It was observed that 34
genetic variants but none had a pairwise r2 LD value with
rs35705950 above 0.2 (Table 4). Finally, among the original linkage
families, rs35705950 was found to be both linked to (P=0.04) and in
linkage disequilibrium with (P=1.5.times.10-9) the disease locus.
While there is some evidence for other linked variants in the
region (P=0.054), these results verify the relevance of this SNP to
disease in these families.
TABLE-US-00001 TABLE 1 Genotypic association results assuming an
additive model from the genetic screen of lung-expressed,
gel-forming mucins in subjects with IIP (FIP = 83 and IPF = 492)
and controls (n = 322). Nucleo- tide Genotypic Association Test by
Disease Group Amino Minor Allele Frequency Odds Odds Acid Mucin
Hg19 FIP IFF Controls Ratio P Ratio P SNP Change Region Position (n
= 83 (n = 492) (n = 322) (95% CI) Value (95% CI) Value rs10902081
C/T MUC2 Int7 1079809 37.2 38.6 47.9 0.6(0.4-0.9) 0.011
0.7(0.5-0.8) 4.3 .times. 10.sup.-4 rs7127117* T/C MUC2 Int7 1079879
49.3 60 47.4 1.0(0.7-1.5) 0.826 1.6(1.3-2.0) 6.9 .times. 10.sup.-5
rs41453346 C/T MUC2 Ex10 1080894 5 6.5 2.2 1.9(0.8-4.3) 0.124
2.8(1.6-5.2) 0.001 Tyr426Tyr rs41480348 G/A MUC2 Ex15 1082605 8.4
6.5 12.1 0.7(0.4-1.2) 0.188 0.5(0.4-0.8) 0.001 Thr618Thr rs7934606*
C/T MUC2 Int31 1093945 49.4 54 40.5 1.4(1.0-2.0) 0.055 1.7(1.4-2.2)
3.8 .times. 10.sup.-6 rs10902089* A/G MUC2 Int31 1094357 57.9 58.8
48.5 1.5(1.0-2.1) 0.031 1.5(1.2-1.9) 2.9 .times. 10.sup.-4
rs9667239 C/T MUC2-5AC 1143101 22.5 21 12.5 2.2(1.4-3.6) 0.001
1.9(1.4-2.7) 5.6 .times. 10.sup.-5 Intergeric rs55846509 G/A MUC5AC
Ex2 1154294 3.1 5.5 1.6 1.7(0.6-5.1) 0.316 3.6(1.7-7.3) 0.001
Arg47Gln rs28403537 C/T MUC5AC Ex12 1161315 8.9 13 3.4 2.7(1.3-5.3)
0.006 4.6(2.8-7.6) 3.2 .times. 10.sup.-9 Ala497Val MUC5AC- C/T
MUC5ACInt26 826476** 20.1 21 13.8 1.6(1.0-2.5) 0.053 1.6(1.2-2.2)
0.003 025447* rs35288961 G/T MUC5AC Int46 1220462 28.8 26.6 15.9
2.2(1.4-3.5) 3.2 .times. 10.sup.-4 2.0(1.5-2.6) 3.7 .times.
10.sup.-6 rs35671223 C/T MUC5AC-5B 1227069 42.6 42.4 33.4
1.4(1.0-2.0) 0.05 1.5(1.2-1.9) 0.001 Intergeric rs28654232 C/T
MUC5AC-5B 1229227 21.6 22.8 32.9 0.6(0.4-0.9) 0.009 0.6(0.5-0.8)
1.1 .times. 10.sup.-4 Intergeric rs34595903* C/T MUC5AC-5B 1230393
21.5 23.3 34.8 0.5(3.3-0.7) 0.001 0.5(0.4-0.7) 2.4 .times.
10.sup.-6 Intergeric rs2672794 C/T MUC5B Prm 1241005 27.2 27.5 40.4
0.5(0.3-0.8) 0.001 0.5(0.4-0.7) 1.9 .times. 10.sup.-7 rs35705950
G/T MUC5B Prm 1241221 33.8 37.5 9.1 6.2(3.7-10.4) .sup. 3.7 .times.
10.sup.-12 8.3(5.8-11.9) 4.6 .times. 10.sup.-3 rs35619543* G/T
MUC5B Prm 1242250 40.3 39 23.8 2.4(1.6-3.6) 3.3 .times. 10.sup.-5
2.1(1.6-2.8) 1.5 .times. 10.sup.-8 rs12804004 G/T MUC5B Prm 1242299
39.2 39.4 48.9 0.6(0.4-0.9) 0.019 0.6(0.5-0.8) 1.2 .times.
10.sup.-4 rs868903* T/C MUC5B Prm 1242690 65.4 61 49.5 1.8(1.3-2.6)
0.001 1.6(1.3-2.1) 2.8 .times. 10.sup.-5 *For these SNPs, DNA was
available for 304 controls. **Nucleotide position based on
NW_001838016.1.
TABLE-US-00002 TABLE 2 Demographic characteristics of subjects in
the re- sequencing and mucin genetic screen analyses. Genetic
Screen of Lung-expressed Re-Sequencing Subjects Gel-forming Mucins
Subjects FIP IPF Control FIP IPF Control Number of subjects 69 96
54 83 492 322* Male gender 41 61 18 44 352 147 (60%) (64%) (34%)
(53.0%) (71.5%) (45.7%) Caucasian 68 89 53 83 492 322 (99%) (93%)
(98%) (100%) (100%) (100%) Age at diagnosis 66 .+-. 10 65 .+-. 8 68
.+-. 8 66.3 .+-. 11.2 67.2 .+-. 8.1 60.3 .+-. 12.6 Ever smoked 44
71 25 46 342 245 (64%) (74%) (47%) (56.8%) (69.9%) (76.6%) *325
control subjects were included in allelic association analyses but
only 322 in genotypic regression analyses as demographic variables
needed for regression were missing for 3 subjects. Additionally, in
some genotyping multiplexes for the lung-expressed gel forming
mucins, 18 of the 322 controls were not screened due to lack of DNA
availability
TABLE-US-00003 TABLE 3 Oligos used in resequencing of the MUC5B
promoter MUC5B Promoter Amplicon Amplicon Forward Primer 5' > 3'
Reverse Primer 5' > 3' Size (bp) Hg19 Coordinates MUC5B-
GGTTCTCCTTGTCTTGCAGCCCCT ATGGGCTCTTGGTCTGCTCAGAG 616 Chr11:1239997-
Prim-1 (SEQ ID NO: 1) (SEQ ID NO: 2) 1240612 MUC5B-
GGGCCTGGCTCTGAGTACACATCCT AAGGAAAGGGACACAGCCGGTTCC 644
Chr11:1240556- Prim-2 (SEQ ID NO: 3) (SEQ ID NO: 4) 1241199 MUC5B-
GGGTCCCCATTCATGGCAGGATT TTTCTCCATGGCAGAGCTGGGACC 601 Chr11:1240957-
Prim-3 (SEQ ID NO: 5) (SEQ ID NO: 6) 1241557 MUC5B-
CTAGTGGGAGGGACGAGGGCAAAGT CTCGTGGCTGTGACTGCACCCAG 610
Chr11:1241386- Prim-4 (SEQ ID NO: 7) (SEQ ID NO: 8) 1241995 MUC5B-
TTGGCTAAGGTGGGAGACCT AGCTTGGGAATGTGAGAACG 700 Chr11:1241791- Prim-5
(SEQ ID NO: 9) (SEQ ID NO: 10) 1242490 MUC5B-
CATGAGGGGTGACAGGTGGCAAA CCCGCGTTTGTCTTTCTGAAGTT 676 Chr11:1242392-
Prim-6 (SEQ ID NO: 11) (SEQ ID NO: 12) 1243067 MUC5B-
GGTCAGAAGCTTTGAAGATGGGC CTTGTCCAATGCCAGCCCTGATC 607 Chr11:1242985-
Prim-7 (SEQ ID NO: 13) (SEQ ID NO: 14) 1243591 MUC5B-
CTGCCAGGGTTAATGAGGAG GGATCAGGAAGGATTTGCAG 663 Chr11:1243491- Prim-8
(SEQ ID NO: 14) (SEQ ID NO: 16) 1244153 MUC5B-
AGGCAGGCTGGCTGACCACTGTTT CGTGAAGACAGCATCGAGAGGGG 501 Chr11:1243966-
Prim-9 (SEQ ID NO: 17) (SEQ ID NO: 18) 1244466 MUC5B-
TTGGCTAAGGTGGGAGACCT Chr11:1241791- Prim-5 (SEQ ID NO: 19) 1241810
Seq Pr.
TABLE-US-00004 TABLE 4 SNPs identified in resequencing of the MUC5B
promoter SEQ Hg19 Base ID Position SNP Name NO: Flanking Sequence
240338 rs2672792 T/C 20
GTCACCTGCCCAGGTCCCCGAGGCC[T/C]GGAACACCTTCCTGCTGGGCCCACC 240485
rs72636989 G/A 21
CCACCCCAGGAGTTGGGGGGCCCCCGT[G/A]CCAGGGAGCAGGAGGCTGCCGAGG 240925
Muc5B-Prm1 C/T 22
GTGGCCCTGATCACTGGTGCCTGGA[C/T]GGCCTCTGAAGGGGTCTGTGGGGTC 241005
rs2672794 C/T 23
AACCCCCCTCGGGTTCTGTGTGGTC[C/T]AGGCCGCCCCTTTGTCTCCACTGCC 241221
rs35705950 G/T 24
TTTCTTCCTTTATCTTCTGTTTTCAGC[G/T]CCTTCAACTGTGAAGAAGTGA 241361
MUC5B-Prm2 A/G 25
TGCCCCGGACCCAGCCCAGTTCCCA[A/G]TGGGCCCTCTGCCCGGGGAGGTGC 241762
MUC5B-Prm3 C/T 26
GGTGGGCATCGGCTTGTGAGCTGGAGCCG[C/T]GGGCAGGGAGGGGGGATGTCACGAG 241821
rs11042491 G/A 27
GGCTAAGGTGGGAGACCTGGGCGGGTGC[G/A]TCGGGGGGACGTCTGCAGCAGAGGC 241848
rs2735726 T/C 28
TGCGTCGGGGGGACGTCTGCAGCAGAGGCC[T/C]GGGCAGCAGGCACACCCCTCCTGCCAG
241993 MUC5B-Prm4 G/A 29
GGGGCCTGGGTGCAGTCACAGCCAC[G/A]AGCCCAGGGGTGGGGACTCTGGCC 242092
MUC5B-Prm5 C/T 30
CCCCTCCCACCGTGCCGTGCTGCAG[C/T]GGGTCTACCGGCCTGGATGTGAAA 242101
MUC5B-Prm6 C/T 31
CCGTGCCGTGCTGCAGCGGGTCTAC[C/T]GGCCTGGATGTGAAAGAGAGCTTG 242227
rs11042646 C/T 32
AGTCCCGGAAGTGAGCGGGGAGCTA[C/T]GCTGAGATCTGGGAGACCCCCTGC 242244
rs55974837 C/T 33
GGGAGCTACGCTGAGATCTGGGAGA[C/T]CCCCTGCCCCCACCCAGGTACAGG 242250
rs35619543 G/T 34
TACGCTGAGATCTGGGAGACCCCCT[G/T]CCCCCACCCAGGTACAGGGCCAGG 242299
rs12804004 T/G 35
GCAGAAGCCCGAGGTGTGCCCTGAG[T/G]TAAAGAAACCGTCACAAAGAACAA 242472
rs56031419 G/A 36
TGTCTCCGCCCTCCATCTCCAGAAC[G/A]TTCTCACATTCCCAAGCTGAAACC 242508
rs868902 C/A 37
CCCAAGCTGAAACCCTGTCCCCATG[C/A]AACACCAGCTCACCATCCCCTCTGCC 242567
MUC5B-Prm7 C/T 38
GGCGCCCACCGTCCACACTCCGTCT[C/T]TGCGGGTTTCATGACTCCAGGGGCAG 242599
MUC5B-Prm8 G/A 39
TTTCATGACTCCAGGGGCAGCACAC[G/A]AGTGGCCCCTCCTGCCTTTGTCCTC 242607
MUC5B-Prm9 C/T 40
CTCCAGGGGCAGCACACGAGTGGCC[C/T]CTCCTGCCTTTGTCCTCTGTGTCCA 242690
rs868903 C/T 41
CCCCCATGGAGCAGCCTGGGCCAGCC[C/T]CTCCTTTTCACGGCTGAACCGTAT 242910
MUC5B- G/A 42
ACCCCCACCAGCAGGGCACAGGGCTCC[G/A]GGTCCCCACGTCTCTGCCAACACTT Prm10
242977 MUC5B- G/A 43
CTTGATCCCCGCCATCCTATTGAGC[G/A]TGAGACAGGTCAGAAGCTTTGAAG Prm11 243218
MUC5B- G/A 44
GTCTGCGCCACGGAGCATTCAGGAC[G/A]CTGGTGACCAGGGAGCCAGGAGGT Prm12 243378
rs885455 A/G 45
CGTCAAGGAGGTTTACCACATAGCCCCC[A/G]GGAAGCCCACCCGACACCAGCCGGA 243391
rs885454 G/A 46
TTTACCACATAGCCCCCRGGAAGCCCACCC[G/A]ACACCAGCCGGAGGTGCTAGGCTTC 243409
MUC5B- T/C 47
CCCACCCGACACCAGCCGGAGGTGC[T/C]AGGCTTCTGCGGCTCCCACCTGGG Prm13 243911
MUC5B- G/A 48
GGACCCATGGTCAGTGGCTGGGGGT[G/A]CTGCCCAGAGGCTGGGATTCCCTTC Prm14
244060 rs7115457 G/A 49
GCCATCTAGGACGGGTGCCAGGTGG[G/A]GTAGGCCCTTCTCTCCCTTCCGATT 244080
rs7118568 C/G 50
GGTGGGGTAGGCCCTTCTCTCCCTT[C/G]CGATTCTCAGAAGCTGCTGGGGGTG 244197
rs56235854 G/A 51
AGCCCCTCCCCGAGAGCAAACACAC[G/A]TGGCTGGAGCGGGGAAGAGCATGGTGC 244219
rs2735738 T/C 52
CACGTGGCTGGAGCGGGGAAGAGCA[T/C]GGTGCCCTGCGTGGCCTGGCCTGGC 244438
MUC5B- C/T 53
GCCGCAGGCAGGTAAGAGCCCCCCA[C/T]TCCGCCCCCTCTCGATGCTGTCTT Prm15
indicates data missing or illegible when filed
[0165] Next, the relationship between the rs35705950 SNP and the 18
other SNPs significantly associated with IIP were analyzed. Testing
pairwise LD between these SNPs by the r2 statistic, 10 of the 18
SNPs were found to exhibit low level LD (r2=0.15-0.27) with
rs35705950 among IPF cases, suggesting the significance of these
SNPs is due to LD with rs35705950 (FIG. 3). Using genotypic
logistic regression models to adjust for rs35705950 effects, we
observed that the coefficients and corresponding P values were
substantially reduced for all 18 SNPs which were previously
associated with FIP and/or IPF (Table 5). After controlling for
rs35705950, only one SNP retained nominal significance for IPF
(r541480348, P=0.04). It was demonstrated that the significance of
the rs35705950 SNP was largely unaffected by adjustment for any of
the 18
[0166] SNPs tested (P value for all SNP models was less than
1.7.times.10-9 for FIP and 1.1.times.10-24 for IPF; Table 5). These
results demonstrate a strong independent effect of the rs3570590
SNP on both FIP and IPF.
TABLE-US-00005 TABLE 5 Genotypic logistic regression models for the
19 significant SNPs in the screen of lung-expressed gel-forming
mucins alone, and after adjusting for rs35705950, in patients with
IPF or FIP. IPF Single SNP Model IPF rs35705950 FIP Single SNP
Model FIP rs35705950 Odds Odds Odds Odds Model Ratio Ratio Ratio
Ratio # SNP (95% C.I) P Value (95% C.I) P Value (95% C.I) P Value
(95% C.I) P Value 1 rs10902081 0.7 (0.5-0.8) 4.3 .times. 10.sup.-4
0.9 (0.7-1.2) 0.429 0.6 (0.4-0.9) 0.011 0.8 (0.5-1.2) 0.25
rs35705950 x x 8.3 (5.7-11.9) 1.5 .times. 10.sup.-29 x x 5.9
(3.5-10.1) 6.6 .times. 10.sup.-11 2 rs7127117 1.6 (1.3-2.0) 6.9
.times. 10.sup.-5 1.1 (0.8-1.4) 0.509 1.0 (0.7-1.5) 0.826 0.7
(0.4-1.1) 0.094 rs35705950 x x 7.9 (5.4-11.6) 1.3 .times.
10.sup.-25 x x 6.3 (3.5-11.4) 7.3 .times. 10.sup.-10 3 rs41453346
2.8 (1.6-5.2) 0.001 1.1 (0.6-2.2) 0.72 1.9 (0.8-4.3) 0.124 1.2
(0.5-3.0) 0.653 rs35705950 x x 8.1 (5.6-11.8) 2.7 .times.
10.sup.-28 x x 6.1 (3.6-10.3) 1.2 .times. 10.sup.-11 4 rs41480348
0.5 (0.4-0.8) 0.001 0.6 (0.4-1.0) 0.04 0.7 (0.4-1.2) 0.188 0.9
(0.5-1.7) 0.75 rs35705950 x x 7.9 (5.5-11.3) 2.1 .times. 10.sup.-29
x x 6.1 (3.6-10.2) 1.0 .times. 10.sup.-11 5 rs7934605 1.7 (1.4-2.2)
3.8 .times. 10.sup.-6 1.0 (0.7-1.3) 0.876 1.4 (1.0-2.0) 0.055 0.9
(0.5-1.3) 0.473 rs35705950 x x 8.7 (5.8-12.9) 1.4 .times.
10.sup.-26 x x 6.7 (3.8-11.9) 7.5 .times. 10.sup.-11 6 rs10902089
1.5 (1.2-1.9) 2.9 .times. 10.sup.-4 0.9 (0.7-1.2) 0.69 1.5
(1.0-2.1) 0.031 1.0 (0.7-1.6) 0.813 rs35705950 x x 8.3 (5.6-12.2)
1.3 .times. 10.sup.-26 x x 6.1 (3.6-10.5) 6.2 .times. 10.sup.-11 7
rs9667239 1.9 (1.4-2.7) 5.6 .times. 10.sup.-5 0.8 (0.5-1.2) 0.3 2.2
(1.4-3.6) 0.001 1.1 (0.6-2.0) 0.668 rs35705950 x x 8.9 (6.0-13.3)
8.2 .times. 10.sup.-27 x x 5.8 (3.3-10.2) 6.0 .times. 10.sup.-10 8
rs55846509 3.6 (1.7-7.3) 0.001 1.0 (0.5-2.3) 0.96 1.7 (0.6-5.1)
0.32 0.8 (0.3-2.5) 0.706 rs35705950 x x 8.3 (5.7-12.1) 2.7 .times.
10.sup.-28 x x 6.4 (3.8-10.7) 4.8 .times. 10.sup.-12 9 rs28403537
4.6 (2.8-7.6) 3.2 .times. 10.sup.-9 1.5 (0.8-2.6) 0.2 2.7 (1.3-5.3)
0.00 0.8 (0.3-1.8) 0.53 rs35705950 x x 7.6 (5.2-11.2) 1.1 .times.
10.sup.-24 x x 6.7 (3.8-11.8) 4.7 .times. 10.sup.-11 10 MUC5AC- 1.6
(1.2-2.2) 0.003 1.1 (0.8-1.6) 0.49 1.6 (1.0-2.5) 0.053 1.4
(0.8-2.4) 0.19 025447 RS35705950 x x 7.7 (5.3-11.2) 3.1 .times.
10.sup.-27 x x 6.0 (3.5-10.3) 4.7 .times. 10.sup.-11 11 rs35288961
2.0 (1.5-2.6) 3.7 .times. 10.sup.-6 1.1 (0.8-1.5) 0.58 2.2
(1.4-3.5) 3.2 .times. 10.sup.-4 1.3 (0.7-2.1) 0.384 rs35705950 x x
7.9 (5.4-11.5) 6.6 .times. 10.sup.-27 x x 5.7 (3.3-10.0) 1.3
.times. 10.sup.-9 12 rs35671223 1.5 (1.2-1.9) 0.001 0.9 (0.7-1.2)
0.46 1.4 (1.0-2.0) 0.05 0.9 (0.6-1.4) 0.61 rs35705950 x x 8.5
(5.8-12.4) 1.1 .times. 10.sup.-28 x x 6.3 (3.6-10.9) 5.4 .times.
10.sup.-11 13 rs28654232 0.6 (0.5-0.8) 1.1 .times. 10.sup.-4 0.9
(0.7-1.1) 0.29 0.6 (0.4-0.9) 0.009 0.7 (0.5-1.1) 0.157 rs35705950 x
x 8.0 (5.5-11.5) 5.7 .times. 10.sup.-29 x x 5.7 (3.4-9.6) 5.8
.times. 10.sup.-11 14 rs34595903 0.5 (0.4-0.7) 2.4 .times.
10.sup.-6 0.8 (0.6-1.1) 0.116 0.5 (0.3-0.7) 0.001 0.6 (0.4-1.0)
0.041 rs35705950 x x 7.4 (5.1-10.8) 7.0 .times. 10.sup.-26 x x 5.1
(3.0-8.6) 1.7 .times. 10.sup.-9 15 rs2672794 0.5 (0.4-0.7) 1.9
.times. 10.sup.-7 0.9 (0.7-1.2) 0.442 0.5 (0.3-0.8) 0.001 0.7
(0.4-1.1) 0.152 rs35705950 x x 8.0 (5.5-11.6) 2.5 .times.
10.sup.-27 x x 5.5 (3.2-9.3) 3.2 .times. 10.sup.-10 16 rs35619543
2.1 (1.6-2.8) 1.5 .times. 10.sup.-8 1.3 (0.9-1.7) 0.145 2.4
(1.6-3.6) 3.3 .times. 10-5 1.3 (0.8-2.1) 0.296 rs35705950 x x 7.6
(5.2-11.2) 7.0 .times. 10.sup.-25 x x 6.1 (3.4-10.9) 6.8 .times.
10.sup.-10 17 rs12804004 0.6 (0.5-0.8) 1.2 .times. 10.sup.-4 0.8
(0.6-1.0) 0.07 0.5 (0.4-0.9) 0.019 0.7 (0.5-1.1) 0.159 rs35705950 x
x 7.9 (5.5-11.3) 6.4 .times. 10.sup.-29 x x 5.9 (3.5-10.0) 3.5
.times. 10.sup.-11 18 rs868903 1.6 (1.3-2.1) 2.8 .times. 10.sup.-5
1.0 (0.8-1.4) 0.753 1.8 (1.3-2.6) 0.001 1.4 (0.9-2.0) 0.145
rs35705950 x x 7.8 (5.3-11.5) 8.6 .times. 10.sup.-26 x x 5.6
(3.2-9.6) 4.4 .times. 10.sup.-10 indicates data missing or
illegible when filed
Example 2: Single Nucleotide Polymorphism rs35705950 Results in
Increased Expression of MUC5B Gene
[0167] The wildtype G allele of the rs35705950 SNP is conserved
across primate species. The SNP is directly 5' to a highly
conserved region across vertebrate species, and is in the middle of
sequence predicted to be involved in MUC5B gene regulation. A
bioinformatic analysis of the effect of the rs35705950 SNP predicts
a disruption of an E2F binding site and creation of at least two
new binding sites (e.g. HOX9 and PAX-2).
[0168] Based on these analyses, the effect of rs35705950 was
examined on MUC5B gene expression. In lung tissue from 33 subjects
with IPF and 47 unaffected subjects, quantitative RT-PCR revealed
that MUC5B gene expression was upregulated 14.1-fold among IPF
subjects compared to unaffected subjects (P=0.0001, FIG. 4A). A
37.4-fold increase in MUC5B expression was observed among
unaffected subjects carrying at least one copy of the variant
allele compared to homozygous wildtype subjects (P=0.0003, FIG.
4B). In contrast, no significant difference in MUC5B gene
expression was observed among the IPF subjects with at least one
variant allele of rs35705950 (FIG. 4C). Smoking, a potential
confounder of MUC5B expression, appeared to have little effect on
the association between the rs35705950 variant allele and MUC5B
expression among either unaffected or IPF affected subjects (FIGS.
4B and 4C).
[0169] MUC5B immunohistochemical staining in lung tissue showed
cytoplasmic staining in secretory columnar cells of the bronchi and
larger proximal bronchioles (>200 .mu.m) in IPF cases and
controls (FIG. 5A). In subjects with IPF, regions of dense
accumulation of MUC5B were observed in areas of microscopic
honeycombing and involved patchy staining of the metaplastic
epithelia lining the honeycomb cysts (FIG. 5B), as well as the
mucous plugs within the cysts (FIG. 5C). No obvious differences
were observed in MUC5B staining characteristics in IPF cases with
the MUC5B promoter polymorphism.
[0170] IPF subjects have significantly more MUC5B lung gene
expression than controls, and MUC5B protein is expressed in
pathologic lesions of IPF. The present results show that the risk
of developing FIP or IPF is substantially correlated with the
re35705950 promoter polymorphism, which causes increased MUC5B
expression. In aggregate, the data show that MUC5B expression in
the lung plays a role in the pathogenesis of pulmonary disease.
[0171] Based on the relationship between the SNP and excess
production of MUC5B, too much MUC5B can impair mucosal host defense
to excessive lung injury from inhaled substances, and, over time,
lead to the development of TIP. In addition to the MUC5B promoter
SNP, common exposures and basic biological processes can influence
either the expression or clearance of MUC5B. For instance, MUC5B
expression can be enhanced in the lung by cigarette smoke,
acrolein, oxidative stress, IL-6, IL-8, IL-13, IL-17,
17.beta.-estradiol, extracellular nucleotides, or epigenetic
changes that alter DNA methylation or chromatin structure.
Moreover, clearance of lung mucus is dependent on effective ciliary
motion, adequate hydration of the periciliary liquid layer, and an
intact cough. Regardless of the cause, the present results indicate
that excess MUC5B can compromise mucosal host defense, reducing
lung clearance of inhaled particles, dissolved chemicals, and
microorganisms. Given the importance of environmental exposures,
such as asbestos, silica, and other pollutants in the development
of other forms of interstitial lung disease, it is logical to
speculate that common inhaled particles, such as those associated
with cigarette smoke or air pollution, might lead to or contribute
to exaggerated interstitial injury in individuals who have defects
in mucosal host defense.
[0172] In addition, excess MUC5B in the respiratory bronchioles can
interfere with alveolar repair. Alveolar injury can lead to
collapse of bronchoalveolar units and this focal lung injury is
repaired through re-epithelialization of the alveolus by type II
alveolar epithelial cells. Thus, MUC5B can impede alveolar repair
by either interfering with the interaction between the type II
alveolar epithelial cells and the underlying matrix, or by
interfering with the surface tension properties of surfactant.
Either failure to re-epithelialize the basal lamina of the alveolus
or suboptimal surfactant biology could enhance ongoing collapse and
fibrosis of adjacent bronchoalveolar units, and eventually result
in TIP.
[0173] Lesions of IPF are spatially heterogeneous, suggesting that
IPF is multifocal, originating in individual bronchoalveolar units.
Since SNP rs35705950 occurs in the promoter region of MUC5B and is
predicted to disrupt transcription factor binding sites, ectopic
production of MUC5B in cells or locations that cause injury to the
bronchoalveolar unit can be a causative agent. Unscreened genetic
variants (especially in the inaccessible repetitive mucin regions)
may be in linkage disequilibrium with the MUC5B promoter SNP and
affect the function of other lung mucins.
[0174] The present observations provide a novel clinical approach
to pulmonary disorders such as IIP. Invoking secreted airway mucins
in the pathogenesis of pulmonary fibrosis suggests that the
airspace plays a role in the pathogenesis of IIP. While the SNP
(r535705950) in the MUC5B promoter can be used to identify
individuals at risk for developing IIP, the observation that mucin
biology is be important in the etiology of IIP reorients the focus
of pathogenic and therapeutic studies in interstitial lung disease
to lung mucins and the airspace. Moreover, the genetic causes of
IIP (e.g., MUC5B, surfactant protein C, surfactant protein A2, and
the two telomerase genes TERC and TERT) provide insight into the
unique clinical manifestations of this complex disease process, and
consequently, lead to earlier detection, more predictable
prognosis, and personalized therapeutic strategies.
Example 3: Genetic Variant MUC5B Associated with Attenuated Form of
Pulmonary Disease
[0175] The data described herein demonstrate that the genetic
variant MUC5B rs35705950 is associated with development of
pulmonary disease. We next examined whether rs35705950 genetic
variant is associated with disease severity and prognosis. We found
that homozygous wildtype subjects (GG), i.e., those having normal
MUC5B gene sequence, displayed a steeper decline in forced vital
capacity (FVC) over time as compared to subjects with at least one
T allele (P=0.0006). Essentially, while FVC declines for both
groups, the decline is more gradual in those carrying the
G.fwdarw.T polymorphism. For GG subjects, the FVC absolute value
fell from about 3.4 liters to about 3.1 liters over years 1-3 of
the study. For GT and TT subjects, the FVC absolute value still
fell, but started at over 3.5 liters and fell to about 3.4 liters
over years 1-3 of the study.
[0176] Additionally, we observed an association between death with
subjects having at least one T allele having a lower mortality
(OR(95%CI)=0.37(0.20-0.67); p=0.001) after adjusting for gender,
history of smoking and DLCO (diffusion lung capacity for CO2). We
also observed an association with time to death and the T allele;
Hazard ratio (95% CI)=0.50(0.30-0.83) p=0.0069 after adjustment for
gender, history of smoking and DLCO. These results suggest that in
addition to being a strong risk factor for pulmonary disease
development, the rs35705950 SNP can indicate a less severe
prognosis for the pulmonary disease.
Sequence CWU 1
1
53124DNAArtificial SequenceSynthetic polynucleotide DNA forward
primer 1ggttctcctt gtcttgcagc ccct 24223DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 2atgggctctt
ggtctgctca gag 23325DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 3gggcctggct ctgagtacac atcct 25424DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 4aaggaaaggg
acacagccgg ttcc 24523DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 5gggtccccat tcatggcagg att 23624DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 6tttctccatg
gcagagctgg gacc 24725DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 7ctagtgggag ggacgagggc aaagt 25823DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 8ctcgtggctg
tgactgcacc cag 23920DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 9ttggctaagg tgggagacct 201020DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 10agcttgggaa
tgtgagaacg 201123DNAArtificial SequenceSynthetic polynucleotide DNA
forward primer 11catgaggggt gacaggtggc aaa 231223DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 12cccgcgtttg
tctttctgaa gtt 231323DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 13ggtcagaagc tttgaagatg ggc 231423DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 14cttgtccaat
gccagccctg atc 231520DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 15ctgccagggt taatgaggag 201620DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 16ggatcaggaa
ggatttgcag 201724DNAArtificial SequenceSynthetic polynucleotide DNA
forward primer 17aggcaggctg gctgaccact gttt 241823DNAArtificial
SequenceSynthetic polynucleotide DNA reverse primer 18cgtgaagaca
gcatcgagag ggg 231920DNAArtificial SequenceSynthetic polynucleotide
DNA forward primer 19ttggctaagg tgggagacct 202051DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 20gtcacctgcc caggtccccg
aggccyggaa caccttcctg ctgggcccac c 512152DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 21ccaccccagg agttgggggg
cccccgtrcc agggagcagg aggctgccga gg 522251DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 22gtggccctga tcactggtgc
ctggayggcc tctgaagggg tctgtggggt c 512351DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 23aacccccctc gggttctgtg
tggtcyaggc cgcccctttg tctccactgc c 512449DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 24tttcttcctt tatcttctgt
tttcagckcc ttcaactgtg aagaagtga 492550DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 25tgccccggac ccagcccagt
tcccartggg ccctctgccc ggggaggtgc 502655DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 26ggtgggcatc ggcttgtgag
ctggagccgy gggcagggag gggggatgtc acgag 552754DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 27ggctaaggtg ggagacctgg
gcgggtgcrt cggggggacg tctgcagcag aggc 542858DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 28tgcgtcgggg ggacgtctgc
agcagaggcc ygggcagcag gcacacccct cctgccag 582950DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 29ggggcctggg tgcagtcaca
gccacragcc caggggtggg gactctggcc 503050DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 30cccctcccac cgtgccgtgc
tgcagygggt ctaccggcct ggatgtgaaa 503150DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 31ccgtgccgtg ctgcagcggg
tctacyggcc tggatgtgaa agagagcttg 503250DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 32agtcccggaa gtgagcgggg
agctaygctg agatctggga gaccccctgc 503350DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 33gggagctacg ctgagatctg
ggagaycccc tgcccccacc caggtacagg 503450DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 34tacgctgaga tctgggagac
cccctkcccc cacccaggta cagggccagg 503550DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 35gcagaagccc gaggtgtgcc
ctgagktaaa gaaaccgtca caaagaacaa 503650DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 36tgtctccgcc ctccatctcc
agaacrttct cacattccca agctgaaacc 503752DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 37cccaagctga aaccctgtcc
ccatgmaaca ccagctcacc atcccctctg cc 523852DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 38ggcgcccacc gtccacactc
cgtctytgcg ggtttcatga ctccaggggc ag 523951DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 39tttcatgact ccaggggcag
cacacragtg gcccctcctg cctttgtcct c 514051DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 40ctccaggggc agcacacgag
tggccyctcc tgcctttgtc ctctgtgtcc a 514151DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 41cccccatgga gcagcctggg
ccagccyctc cttttcacgg ctgaaccgta t 514253DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 42acccccacca gcagggcaca
gggctccrgg tccccacgtc tctgccaaca ctt 534350DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 43cttgatcccc gccatcctat
tgagcrtgag acaggtcaga agctttgaag 504450DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 44gtctgcgcca cggagcattc
aggacrctgg tgaccaggga gccaggaggt 504554DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 45cgtcaaggag gtttaccaca
tagcccccrg gaagcccacc cgacaccagc cgga 544656DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 46tttaccacat agcccccrgg
aagcccaccc racaccagcc ggaggtgcta ggcttc 564750DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 47cccacccgac accagccgga
ggtgcyaggc ttctgcggct cccacctggg 504851DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 48ggacccatgg tcagtggctg
ggggtrctgc ccagaggctg ggattccctt c 514951DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 49gccatctagg acgggtgcca
ggtggrgtag gcccttctct cccttccgat t 515051DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 50ggtggggtag gcccttctct
cccttscgat tctcagaagc tgctgggggt g 515153DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 51agcccctccc cgagagcaaa
cacacrtggc tggagcgggg aagagcatgg tgc 535251DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 52cacgtggctg gagcggggaa
gagcayggtg ccctgcgtgg cctggcctgg c 515350DNAArtificial
SequenceSynthetic polynucleotide DNA of SNP identified in
resequencing of the MUC5B promoter 53gccgcaggca ggtaagagcc
ccccaytccg ccccctctcg atgctgtctt 50
* * * * *