U.S. patent application number 15/451492 was filed with the patent office on 2017-06-29 for simian adenoviruses sadv-36, -42.1, -42.2, and -44 and uses thereof.
The applicant listed for this patent is The Trustees of the University of Pennsylvania. Invention is credited to Soumitra Roy, Luk H. Vandenberghe, James M. Wilson.
Application Number | 20170183636 15/451492 |
Document ID | / |
Family ID | 41110734 |
Filed Date | 2017-06-29 |
United States Patent
Application |
20170183636 |
Kind Code |
A1 |
Roy; Soumitra ; et
al. |
June 29, 2017 |
Simian Adenoviruses SAdV-36, -42.1, -42.2, and -44 and Uses
Thereof
Abstract
A recombinant vector comprises simian adenovirus 36, simian
adenovirus 42.1, simian adenovirus 42.2 and/or simian adenovirus 44
sequences and a heterologous gene under the control of regulatory
sequences. A cell line which expresses one or more simian
adenovirus-36, -42.1, -42.2 or -44 gene(s) is also described.
Methods of using the vectors and cell lines are provided.
Inventors: |
Roy; Soumitra; (Noordwijk,
NL) ; Wilson; James M.; (Philadelphia, PA) ;
Vandenberghe; Luk H.; (Weston, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Trustees of the University of Pennsylvania |
Philadelphia |
PA |
US |
|
|
Family ID: |
41110734 |
Appl. No.: |
15/451492 |
Filed: |
March 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13899037 |
May 21, 2013 |
9597363 |
|
|
15451492 |
|
|
|
|
12920648 |
Sep 2, 2010 |
8470310 |
|
|
PCT/US09/01344 |
Mar 3, 2009 |
|
|
|
13899037 |
|
|
|
|
61067993 |
Mar 4, 2008 |
|
|
|
61068027 |
Mar 4, 2008 |
|
|
|
61068024 |
Mar 4, 2008 |
|
|
|
61068069 |
Mar 4, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2710/10321
20130101; A61P 37/00 20180101; C07K 14/005 20130101; C12N 15/86
20130101; C12N 2760/16122 20130101; A61P 31/00 20180101; A61K
35/761 20130101; C12N 7/00 20130101; C12N 2710/10322 20130101; C12N
2760/16171 20130101; A61P 35/00 20180101; C12N 2760/16134 20130101;
A61K 39/145 20130101; C12N 2710/10343 20130101; A61K 2039/57
20130101; C12N 2710/10371 20130101; A61K 2039/5256 20130101 |
International
Class: |
C12N 7/00 20060101
C12N007/00; C12N 15/86 20060101 C12N015/86; C07K 14/005 20060101
C07K014/005; A61K 39/145 20060101 A61K039/145 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0001] This invention was made with government support under Grant
No. P30-DK47757 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A recombinant adenovirus having a capsid comprising a hexon
protein, a penton protein, and a fiber protein, wherein said hexon
protein is the hexon protein of SAdV-44, amino acids 1 to 962 of
SEQ ID NO: 105; said capsid encapsidating a heterologous nucleic
acid molecule carrying a gene sequence operably linked to
expression control sequences which direct transcription,
translation, or expression in a host cell.
2. The adenovirus according to claim 1, further comprising 5' and
3' adenovirus cis-elements necessary for replication and
encapsidation.
3. The adenovirus according to claim 1, wherein said adenovirus
lacks all or a part of the E1 gene.
4. The adenovirus according to claim 3, wherein said adenovirus is
replication-defective.
5. The adenovirus according to claim 1, wherein said virus has a
hybrid capsid.
6. The adenovirus according to claim 5, wherein said capsid
comprises a SAdV-42.1, SAdV-42.2 or SAdV-44 fiber protein.
7. The adenovirus according to claim 5, wherein the capsid
comprises a SAdV-42.1, SAdV-42.2 or SAdV-44 penton protein.
8. A recombinant adenovirus having a capsid comprising a hexon
containing a fragment of the simian adenovirus (SAdV) hexon protein
and a nucleic acid sequence heterologous to the SAdV, wherein the
fragment of the SAdV hexon protein is the SAdV hexon protein of SEQ
ID NO:43, 74 or 105 with an N-terminal or C-terminal truncation of
about 50 amino acids in length or is selected from the group
consisting of: amino acid residues 125 to 443 of SEQ ID NO:43, 74
or 105; amino acid residues 138 to 441 of SEQ ID NO:43, 74 or 105;
amino acid residues 138 to 163 of SEQ ID NO:43, 74 or 105; amino
acid residues 170 to 176 of SEQ ID NO:43, 74 or 105; and amino acid
residues 404 to 430 of SEQ ID NO:43, 74 or 105.
9. The recombinant adenovirus according to claim 8, wherein the
capsid further comprises a SAdV-42.1, SAdV-42.2 or SAdV-44 fiber
protein.
10. The recombinant adenovirus according to claim 8, wherein the
capsid further comprises a SAdV-42.1, SAdV-42.2 or SAdV-44 penton
protein.
11. The recombinant adenovirus according to claim 8, wherein said
adenovirus is a pseudotyped adenovirus comprising 5' and 3'
adenovirus cis-elements necessary for replication and
encapsidation, said cis-elements comprising an adenovirus 5'
inverted terminal repeat and an adenovirus 3' inverted terminal
repeat.
12. The recombinant adenovirus according to claim 8, wherein the
adenovirus comprises a nucleic acid sequence encoding a product
operatively linked to sequences which direct expression of said
product in a host cell.
13. The recombinant adenovirus according to claim 8, wherein the
recombinant adenovirus comprises one or more adenovirus genes.
14. The recombinant adenovirus according to claim 8, wherein the
recombinant adenovirus is replication-defective.
15. The recombinant adenovirus according to claim 14, wherein the
recombinant adenovirus is deleted in adenovirus E1.
16. A composition comprising an adenovirus according to claim 1 in
a pharmaceutically acceptable carrier.
17. A method for targeting a cell having an adenoviral receptor
comprising delivering to a subject a virus according to claim
1.
18. A vector comprising a simian adenovirus (SAdV) nucleic acid
sequence selected from one or more of the group consisting of: (a)
5' inverted terminal repeat (ITR) sequences; (b) the adenovirus E1a
region; (c) the adenovirus E1b region, or a fragment thereof
selected from among the group consisting of the open reading frames
for the small T, large T, and IX regions; (d) the E2b region, or a
fragment thereof selected from the group consisting of the open
reading frames for pTP, polymerase, and IVa2; (e) the L1 region, or
a fragment thereof selected from among the group consisting of the
open reading frames for the 52/55 kD protein and IIIa protein; (f)
the L2 region, or a fragment thereof selected from the group
consisting of the open reading frames for the penton, VII, V, and
pX/Mu proteins; (g) the L3 region, or a fragment thereof selected
from the group consisting of the open reading frames for the VI,
hexon, or endoprotease; (h) the E2a region or the open reading
frame for the DNA binding protein (DBP); (i) the L4 region, or a
fragment thereof selected from the group consisting of the open
reading frames for the 100 kD protein, the 33 kD homolog, the 22 kD
protein, and VIII; (j) the E3 region, or a fragment thereof
selected from the group consisting of the open reading frames for
the 12.5K protein, CR1-alpha, gp19K, CR1-beta, CR1-gamma,
RID-alpha, RID-beta, and 14.7K protein; (k) the L5 region, or the
open reading frame for the fiber protein; (l) the E4 region, or a
fragment thereof selected from the group consisting of the open
reading frames for the E4 ORF6/7, E4 ORF6, E4 ORF4, E4 ORF3, E4
ORF2, and E4 ORF1; and (m) the 3' ITR; of SAdV-42.1, SEQ ID NO:33,
SAdV-42.2, SEQ ID NO:64, or SAdV-44, SEQ ID NO:95.
19. A simian adenovirus protein encoded by the vector according to
claim 18.
20. A composition comprising an adenovirus according to claim 1,
wherein said adenovirus comprises one or more simian adenovirus
proteins selected from the group consisting of: E1a, SEQ ID NO:61,
92 or 123; E1b, small T/19K, SEQ ID NO: 54, 65 or 96; E1b, large
T/55K, SEQ ID NO: 34, 85 or 116; IX, SEQ ID NO:3 5, 66 or 97;
52/55D, SEQ ID NO: 36, 67 or 98; IIIa, SEQ ID NO: 37, 68 or 99;
Penton, SEQ ID NO: 38, 69 or 100; VII, SEQ ID NO: 39, 70 or 101; V,
SEQ ID NO: 40, 71 or 102; pX, SEQ ID NO: 41, 72 or 103; VI, SEQ ID
NO: 42, 73 or 104; Hexon, SEQ ID NO: 43, 74 or 105; Endoprotease,
SEQ ID NO: 44, 75 or 106; 100 kD, SEQ ID NO: 45, 76 or 107; 33 kD,
SEQ ID NO: 63, 94 or 125; 22 kD, SEQ ID NO: 56, 87 or 118; VIII,
SEQ ID NO: 46, 77 or 108; 12.5 K, SEQ ID NO: 57, 78 or 109;
CR1-alpha, SEQ ID NO: 47, 88 or 110; gp19K, SEQ ID NO: 48, 79 or
111; CR1-beta, SEQ ID NO:49, 80 or 112; CR1-gamma, SEQ ID NO: 58,
89 or 119; RID-alpha, SEQ ID NO: 50, 81 or 113; RID-beta, SEQ ID
NO: 51, 82 or 114; E3/14.7K, SEQ ID NO: 59, 90 or 120; and Fiber,
SEQ ID NO: 52, 83 or 121.
Description
BACKGROUND OF THE INVENTION
[0002] Adenovirus is a double-stranded DNA virus with a genome size
of about 36 kilobases (kb), which has been widely used for gene
transfer applications due to its ability to achieve highly
efficient gene transfer in a variety of target tissues and large
transgene capacity. Conventionally, E1 genes of adenovirus are
deleted and replaced with a transgene cassette consisting of the
promoter of choice, cDNA sequence of the gene of interest and a
poly A signal, resulting in a replication defective recombinant
virus.
[0003] Adenoviruses have a characteristic morphology with an
icosahedral capsid consisting of three major proteins, hexon (II),
penton base (III) and a knobbed fibre (IV), along with a number of
other minor proteins, VI, VIII, IX, IIIa and IVa2 [W. C. Russell,
J. Gen Virol., 81:2573-2604 (November 2000)]. The virus genome is a
linear, double-stranded DNA with a terminal protein attached
covalently to the 5' terminus, which have inverted terminal repeats
(ITRs). The virus DNA is intimately associated with the highly
basic protein VII and a small peptide pX (formerly termed mu).
Another protein, V, is packaged with this DNA-protein complex and
provides a structural link to the capsid via protein VI. The virus
also contains a virus-encoded protease, which is necessary for
processing of some of the structural proteins to produce mature
infectious virus.
[0004] A classification scheme has been developed for the
Mastadenovirus family, which includes human, simian, bovine,
equine, porcine, ovine, canine and opossum adenoviruses. This
classification scheme was developed based on the differing
abilities of the adenovirus sequences in the family to agglutinate
red blood cells. The result was six subgroups, now referred to as
subgroups A, B, C, D, E and F. See, T. Shenk et al., Adenoviridae:
The Viruses and their Replication", Ch. 67, in FIELD'S VIROLOGY,
6.sup.th Ed., edited by B. N Fields et al, (Lippincott Raven
Publishers, Philadelphia, 1996), p. 111-2112.
[0005] Recombinant adenoviruses have been described for delivery of
heterologous molecules to host cells. See, U.S. Pat. No. 6,083,716,
which describes the genome of two chimpanzee adenoviruses Simian
adenoviruses, C5, C6 and C7, have been described in U.S. Pat. No.
7,247,472 as being useful as vaccine vectors. Other chimpanzee
adenoviruses are described in WO 2005/1071093 as being useful for
making adenovirus vaccine carriers.
[0006] What is needed in the art are effective vectors which avoid
the effect of pre-existing immunity to selected adenovirus
serotypes in the population.
SUMMARY OF THE INVENTION
[0007] Isolated nucleic acid sequences and amino acid sequences of
simian adenovirus 36 (SAdV-36), simian adenovirus 42.1 (SAdV-42.1),
simian adenovirus 42.2 (SAdV-42.2), simian adenovirus 44 (SAdV-44),
and vectors containing these sequences are provided herein. Also
provided are a number of methods for using the vectors and cells of
the invention.
[0008] The methods described herein involve delivering one or more
selected heterologous gene(s) to a mammalian patient by
administering a vector of the invention. Use of the compositions
described herein for vaccination permits presentation of a selected
antigen for the elicitation of protective immune responses. The
vectors based on SAdV-36, SAdV-42.1, SAdV-42.2 and SAdV-44 may also
be used for producing heterologous gene products in vitro. Such
gene products are themselves useful in a variety for a variety of
purposes such as are described herein.
[0009] These and other embodiments and advantages of the invention
are described in more detail below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1 illustrates the polyfunctionality of CD8+ T cells in
response to stimulation with a influenza nucleoprotein peptide
following vaccination with C36 CMV PI FluA NP (a recombinant
SAdV-36 virus harboring the NP expression cassette--see Example 4))
and AdH5-FluA NP (a recombinant HAdV-5 virus harboring the NP
expression cassette), as described in Example 5. For both SAdV-36
and HAdV-5, the percentage of cytokine+ CD8+ T cells is shown. In
each bar, the top segment reflects the subset of CD8+ T cells
secreting IFN-.gamma., but not IL2 or TNF.alpha.. The middle
segment reflects the subset of CD8+ T cells secreting IFN-.gamma.
and TNF.alpha., but not IL2. The bottom segment reflects the subset
of CD8+ T cells secreting IFN-.gamma., IL2, and TNF.alpha..
DETAILED DESCRIPTION OF THE INVENTION
[0011] Novel nucleic acid and amino acid sequences from simian
adenovirus 36 (SAdV-36), SAdV-42.1, SAdV-42.2 and SAdV-44, which
was isolated from simian feces, are provided. Also provided are
novel adenovirus vectors and packaging cell lines to produce those
vectors for use in the in vitro production of recombinant proteins
or fragments or other reagents. Further provided are compositions
for use in delivering a heterologous molecule for therapeutic or
vaccine purposes. Such therapeutic or vaccine compositions contain
the adenoviral vectors carrying an inserted heterologous molecule.
In addition, the novel SAdV-36, SAdV-42.1, SAdV-42.2 and SAdV-44
sequences are useful in providing the essential helper functions
required for production of recombinant adeno-associated viral (AAV)
vectors. Thus, helper constructs, methods and cell lines which use
these sequences in such production methods, are provided.
[0012] SAdV-36 has been determined by the inventors to be in the
same subgroup as human subgroup E adenoviruses. Since this virus is
from subgroup E, the capsid of this virus (optionally an intact or
recombinant viral particle or an empty capsid) is useful in method
of inducing an immunomodulatory effect or enhanced immune response
by delivering an adenovirus subgroup E capsid to subject. The
SAdV-36 capsid can be delivered alone or in a combination regimen
with an active agent to enhance the immune response thereto. In
another aspect, a method of inducing interferon alpha production in
a subject in need thereof comprising delivering the SAdV-36 capsid
to a subject is provided. In still another aspect, a method for
producing one or more cytokines in culture is provided. This method
involves incubating a culture containing dendritic cells and the
SAdV-36 capsid under conditions suitable to produce
cytokines/chemokines, including, among others, alpha
interferon.
[0013] SAdV-42.1, 42.2 and 44 have been determined by the inventors
to be within the same subgroup as human subgroup C adenoviruses.
SAdV-42.1 and SAdV-42.2 were previously identified to be within the
same phylogenic subgroup as human subgroup C adenoviruses.
SAdV-42.1 and SAdV-42.2 were previously identified as SAdV-42 and
SAdV-43 in US Provisional Patent Application Nos. 61/068,069 (filed
Mar. 4, 2008) and 61/067,993 (filed Mar. 4, 2008), respectively,
from which priority is claimed. While these adenoviruses may not be
serologically distinct, their revised nomenclature reflects that
they are closely structurally related, differing by approximately
six amino acids or fewer within their respective hexon regions.
[0014] The term "substantial homology" or "substantial similarity,"
when referring to a nucleic acid or fragment thereof, indicates
that, when optimally aligned with appropriate nucleotide insertions
or deletions with another nucleic acid (or its complementary
strand), there is nucleotide sequence identity in at least about 95
to 99% of the aligned sequences.
[0015] The term "substantial homology" or "substantial similarity,"
when referring to amino acids or fragments thereof, indicates that,
when optimally aligned with appropriate amino acid insertions or
deletions with another amino acid (or its complementary strand),
there is amino acid sequence identity in at least about 95 to 99%
of the aligned sequences. Preferably, the homology is over
full-length sequence, or a protein thereof, or a fragment thereof
which is at least 8 amino acids, or more desirably, at least 15
amino acids in length. Examples of suitable fragments are described
herein.
[0016] The term "percent sequence identity" or "identical" in the
context of nucleic acid sequences refers to the residues in the two
sequences that are the same when aligned for maximum
correspondence. The length of sequence identity comparison may be
over the full-length of the genome (e.g., about 36 kbp), the
full-length of an open reading frame of a gene, protein, subunit,
or enzyme [see, e.g., the tables providing the adenoviral coding
regions], or a fragment of at least about 500 to 5000 nucleotides,
is desired. However, identity among smaller fragments, e.g. of at
least about nine nucleotides, usually at least about 20 to 24
nucleotides, at least about 28 to 32 nucleotides, at least about 36
or more nucleotides, may also be desired. Similarly, "percent
sequence identity" may be readily determined for amino acid
sequences, over the full-length of a protein, or a fragment
thereof. Suitably, a fragment is at least about 8 amino acids in
length, and may be up to about 700 amino acids. Examples of
suitable fragments are described herein.
[0017] Identity is readily determined using such algorithms and
computer programs as are defined herein at default settings.
Preferably, such identity is over the full length of the protein,
enzyme, subunit, or over a fragment of at least about 8 amino acids
in length. However, identity may be based upon shorter regions,
where suited to the use to which the identical gene product is
being put.
[0018] As described herein, alignments are performed using any of a
variety of publicly or commercially available Multiple Sequence
Alignment Programs, such as "Clustal W", accessible through Web
Servers on the internet. Alternatively, Vector NTI.RTM. utilities
[InVitrogen] are also used. There are also a number of algorithms
known in the art that can be used to measure nucleotide sequence
identity, including those contained in the programs described
above. As another example, polynucleotide sequences can be compared
using Fasta, a program in GCG Version 6.1. Fasta provides
alignments and percent sequence identity of the regions of the best
overlap between the query and search sequences. For instance,
percent sequence identity between nucleic acid sequences can be
determined using Fasta with its default parameters (a word size of
6 and the NOPAM factor for the scoring matrix) as provided in GCG
Version 6.1, herein incorporated by reference. Similarly programs
are available for performing amino acid alignments. Generally,
these programs are used at default settings, although one of skill
in the art can alter these settings as needed. Alternatively, one
of skill in the art can utilize another algorithm or computer
program that provides at least the level of identity or alignment
as that provided by the referenced algorithms and programs.
[0019] "Recombinant", as applied to a polynucleotide, means that
the polynucleotide is the product of various combinations of
cloning, restriction or ligation steps, and other procedures that
result in a construct that is distinct from a polynucleotide found
in nature. A recombinant virus is a viral particle comprising a
recombinant polynucleotide. The terms respectively include
replicates of the original polynucleotide construct and progeny of
the original virus construct.
[0020] "Heterologous" means derived from a genotypically distinct
entity from that of the rest of the entity to which it is being
compared. For example, a polynucleotide introduced by genetic
engineering techniques into a plasmid or vector derived from a
different species is a heterologous polynucleotide. A promoter
removed from its native coding sequence and operatively linked to a
coding sequence with which it is not naturally found linked is a
heterologous promoter. A site-specific recombination site that has
been cloned into a genome of a virus or viral vector, wherein the
genome of the virus does not naturally contain it, is a
heterologous recombination site. When a polynucleotide with an
encoding sequence for a recombinase is used to genetically alter a
cell that does not normally express the recombinase, both the
polynucleotide and the recombinase are heterologous to the
cell.
[0021] As used throughout this specification and the claims, the
term "comprise" and its variants including, "comprises",
"comprising", among other variants, is inclusive of other
components, elements, integers, steps and the like. The term
"consists of" or "consisting of" are exclusive of other components,
elements, integers, steps and the like.
I. The Simian Adenovirus Sequences
[0022] The invention provides nucleic acid sequences and amino acid
sequences of simian adenovirus 36 (SAdV-36), SAdV-42.1, SAdV42.2,
and SAdV-44, each of which are isolated from the other material
with which they are associated in nature.
[0023] A. Nucleic Acid Sequences
[0024] The SAdV-36 nucleic acid sequences provided herein include
nucleotides 1 to 36556 of SEQ ID NO:1. The SAdV-42.1 nucleic acid
sequences provided herein include nucleotides 1 to 37786 of SEQ ID
NO:33. The SAdV-42.2 nucleic acid sequences provided herein include
nucleotides 1 to 37820 of SEQ ID NO:64. The SAdV-44 nucleic acid
sequences provided herein include nucleotides 1 to 37711 of SEQ ID
NO:95. See Sequence Listing, which is incorporated by reference
herein.
[0025] In one embodiment, the nucleic acid sequences of the
invention further encompass the strand which is complementary to
the sequences of SEQ ID NO: 1, 33, 64 and 95, as well as the RNA
and cDNA sequences corresponding to the sequences of the following
sequences and their complementary strands. In another embodiment,
the nucleic acid sequences further encompass sequences which are
greater than 98.5% identical, and preferably, greater than about
99% identical, to the Sequence Listing. Also included in one
embodiment, are natural variants and engineered modifications of
the sequences provided in SEQ ID NO: 1, 33, 64 and 95, and their
complementary strands. Such modifications include, for example,
labels that are known in the art, methylation, and substitution of
one or more of the naturally occurring nucleotides with a
degenerate nucleotide.
TABLE-US-00001 TABLE 1 NUCLEIC ACID REGIONS SAdV-36 SAdV-42.1
SAdV-42.2 SAdV-44 ORF ORF ORF ORF SEQ ID SEQ ID SEQ ID SEQ ID
Regions NO: 1 NO: 33 NO: 64 NO: 95 ITR 1 . . . 124 1 . . . 109 1 .
. . 119 1 . . . 106 E1a Join Join Join Join 576 . . . 1143, 566 . .
. 1106, 576 . . . 1116, 576 . . . 1116, 1228 . . . 1433 1217 . . .
1512 1229 . . . 1524 1226 . . . 1521 E1b Small 1598 . . . 2173 1597
. . . 2247 1609 . . . 2259 1606 . . . 2256 T/19K Large 1903 . . .
3414 1989 . . . 3512 2001 . . . 3524 1998 . . . 3521 T/55K IX 3502
. . . 3927 3612 . . . 4052 3624 . . . 4064 3621 . . . 4061 E2b pTP
Complement Complement Complement Complement (8458 . . . 10380,
(8627 . . . 10618, (8639 . . . 10642, (8636 . . . 10639, 13827 . .
. 13835) 14208 . . . 14216) 14235 . . . 14243) 14231 . . . 14239)
Polymerase Complement Complement Complement Complement (5096 . . .
8656, (5223 . . . 8825, (5235 . . . 8837, (5232 . . . 8834, 13827 .
. . 13835) 14208 . . . 14216) 14235 . . . 14243) 14231 . . . 14239)
IVa2 Complement Complement Complement Complement (3993 . . . 5323,
(4117 . . . 5450, (4129 . . . 5462, (4126 . . . 5459, 5602 . . .
5614) 5729 . . . 5741) 5741 . . . 5753) 5738 . . . 5750) L1 52/55D
10815 . . . 11996 11097 . . . 12356 11117 . . . 12376 11114 . . .
12370 IIIa 12023 . . . 13798 12383 . . . 14152 12403 . . . 14172
12397 . . . 14166 L2 Penton 13880 . . . 15502 14258 . . . 16000
14285 . . . 16042 14281 . . . 16023 VII 15509 . . . 16093 16006 . .
. 16602 16048 . . . 16644 16029 . . . 16625 V 16141 . . . 17175
16696 . . . 17817 16743 . . . 17843 16724 . . . 17815 pX 17201 . .
. 17431 17845 . . . 18084 17872 . . . 18111 17844 . . . 18083 L3 VI
17507 . . . 18229 18191 . . . 18967 18219 . . . 18995 18190 . . .
18966 Hexon 18324 . . . 21146 19098 . . . 21968 19126 . . . 21196
19097 . . . 21982 Endo- 21173 . . . 21793 22001 . . . 22633 22029 .
. . 22661 22015 . . . 22647 protease E2a DBP Complement Complement
Complement Complement (21881 . . . 23416) (22764 . . . 24404)
(22792 . . . 24423) (22773 . . . 24407) L4 100 kD 23439 . . . 25841
24442 . . . 26934 24461 . . . 26950 24445 . . . 26940 33 kD Join
Join Join Join homolog 25552 . . . 25888, 26633 . . . 26973, 26649
. . . 26989, 26639 . . . 26969, 26058 . . . 26392 27293 . . . 27569
27315 . . . 27591 27187 . . . 27575 22 kD 25552 . . . 26121 26633 .
. . 27253 26649 . . . 27275 26639 . . . 27259 VIII 26467 . . .
27147 27648 . . . 28328 27670 . . . 28350 27654 . . . 28334 E3
12.5K 27151 . . . 27468 28332 . . . 28646 28354 . . . 28668 28338 .
. . 28652 CR1- 27425 . . . 28048 28603 . . . 29157 28625 . . .
29179 28657 . . . 29163 alpha gp19K 28033 . . . 28566 29344 . . .
29820 29366 . . . 29842 29350 . . . 29826 CR1- 28600 . . . 29217
29852 . . . 30751 29874 . . . 30782 29858 . . . 30766 beta CR1-
29233 . . . 29844 30751 . . . 31560 30782 . . . 31588 30766 . . .
31581 gamma CR1- 29862 . . . 30743 -- -- -- delta RID- 30754 . . .
31026 31575 . . . 31844 31603 . . . 31872 31596 . . . 31865 alpha
RID-beta 31035 . . . 31466 31850 . . . 32248 31878 . . . 32276
31871 . . . 32269 14.7K 31462 . . . 31866 32244 . . . 32627 32272 .
. . 32655 32265 . . . 32648 L5 Fiber 32167 . . . 33441 32836 . . .
34566 32810 . . . 34594 32803 . . . 34482 E4 Orf 6/7 Complement
Complement Complement Complement (33557 . . . 33808, (34755 . . .
35027, (34782 . . . 35054, (34672 . . . 34944, 34540 . . . 34710)
35730 . . . 35912) 35757 . . . 35939) 35647 . . . 35829) Orf 6
Complement Complement Complement Complement (33808 . . . 34710)
(35031 . . . 35912) (35058 . . . 35939) (34948 . . . 35829) Orf 4
Complement Complement Complement Complement (34619 . . . 34981)
(35815 . . . 36180) (35842 . . . 36207) (35732 . . . 36097) Orf 3
Complement Complement Complement Complement (34994 . . . 35344)
(36190 . . . 36534) (36217 . . . 36561) (36107 . . . 36451) Orf 2
Complement Complement Complement Complement (35344 . . . 35730)
(36534 . . . 36923) (36561 . . . 36950) (36451 . . . 36840) Orf1
Complement Complement Complement Complement (35773 . . . 36144)
(36987 . . . 37370) (37011 . . . 37394) (36902 . . . 37285) ITR
Complement Complement Complement Complement (36433 . . . 36556)
(37678 . . . 37786) (37702 . . . 37820) (37606 . . . 37711)
[0026] In one embodiment, fragments of the sequences of SAdV-36,
SAdV-42.1, SAdV-42.2 and SAdV-44, and their complementary strand,
cDNA and RNA complementary thereto are provided. Suitable fragments
are at least 15 nucleotides in length, and encompass functional
fragments, i.e., fragments which are of biological interest. For
example, a functional fragment can express a desired adenoviral
product or may be useful in production of recombinant viral
vectors. Such fragments include the gene sequences and fragments
listed in the tables herein. The tables provide the transcript
regions and open reading frames in the SAdV-36, SAdV-42.1,
SAdV-42.2 and SAdV-44 sequences. For certain genes, the transcripts
and open reading frames (ORFs) are located on the strand
complementary to that presented in SEQ ID NO:1, 33, 64 and 95. See,
e.g., E2b, E4 and E2a. The calculated molecular weights of the
encoded proteins are also shown. Note that the E1a open reading
frame of SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 and the E2b
open reading frame contain internal splice sites. These splice
sites are noted in the table above.
[0027] The SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 adenoviral
nucleic acid sequences are useful as therapeutic agents and in
construction of a variety of vector systems and host cells. As used
herein, a vector includes any suitable nucleic acid molecule
including, naked DNA, a plasmid, a virus, a cosmid, or an episome.
These sequences and products may be used alone or in combination
with other adenoviral sequences or fragments, or in combination
with elements from other adenoviral or non-adenoviral sequences.
The SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 sequences are also
useful as antisense delivery vectors, gene therapy vectors, or
vaccine vectors. Thus, further provided are nucleic acid molecules,
gene delivery vectors, and host cells which contain the SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 sequences.
[0028] For example, the invention encompasses a nucleic acid
molecule containing simian Ad ITR sequences of the invention. In
another example, the invention provides a nucleic acid molecule
containing simian Ad sequences of the invention encoding a desired
Ad gene product. Still other nucleic acid molecule constructed
using the sequences of the invention will be readily apparent to
one of skill in the art, in view of the information provided
herein.
[0029] In one embodiment, the simian Ad gene regions identified
herein may be used in a variety of vectors for delivery of a
heterologous molecule to a cell. For example, vectors are generated
for expression of an adenoviral capsid protein (or fragment
thereof) for purposes of generating a viral vector in a packaging
host cell. Such vectors may be designed for expression in trans.
Alternatively, such vectors are designed to provide cells which
stably contain sequences which express desired adenoviral
functions, e.g., one or more of E1a, E1b, the terminal repeat
sequences, E2a, E2b, E4, E4ORF6 region.
[0030] In addition, the adenoviral gene sequences and fragments
thereof are useful for providing the helper functions necessary for
production of helper-dependent viruses (e.g., adenoviral vectors
deleted of essential functions, or adeno-associated viruses (AAV)).
For such production methods, the SAdV-36, SAdV-42.1, SAdV-42.2 and
SAdV-44 sequences can be utilized in such a method in a manner
similar to those described for the human Ad. However, due to the
differences in sequences between the SAdV-36, SAdV-42.1, SAdV-42.2
and SAdV-44 sequences and those of human Ad, the use of the
SAdV-36, SAdV-42.1, SAdV-42.2 and SAdV-44 sequences greatly
minimize or eliminate the possibility of homologous recombination
with helper functions in a host cell carrying human Ad E1
functions, e.g., 293 cells, which may produce infectious adenoviral
contaminants during rAAV production.
[0031] Methods of producing rAAV using adenoviral helper functions
have been described at length in the literature with human
adenoviral serotypes. See, e.g., U.S. Pat. No. 6,258,595 and the
references cited therein. See, also, U.S. Pat. No. 5,871,982; WO
99/14354; WO 99/15685; WO 99/47691. These methods may also be used
in production of non-human serotype AAV, including non-human
primate AAV serotypes. The SAdV-36, SAdV-42.1, SAdV-42.2 and
SAdV-44 sequences which provide the necessary helper functions
(e.g., E1a, E1b, E2a and/or E4 ORF6) can be particularly useful in
providing the necessary adenoviral function while minimizing or
eliminating the possibility of recombination with any other
adenoviruses present in the rAAV-packaging cell which are typically
of human origin. Thus, selected genes or open reading frames of the
SAdV-36, SAdV-42.1, SAdV-42.2 or SAdV-44 sequences may be utilized
in these rAAV production methods.
[0032] Alternatively, recombinant SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 vectors may be utilized in these methods. Such
recombinant adenoviral simian vectors may include, e.g., a hybrid
chimp Ad/AAV in which chimp Ad sequences flank a rAAV expression
cassette composed of, e.g., AAV 3' and/or 5' ITRs and a transgene
under the control of regulatory sequences which control its
expression. One of skill in the art will recognize that still other
simian adenoviral vectors and/or SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 gene sequences will be useful for production of rAAV
and other viruses dependent upon adenoviral helper.
[0033] In still another embodiment, nucleic acid molecules are
designed for delivery and expression of selected adenoviral gene
products in a host cell to achieve a desired physiologic effect.
For example, a nucleic acid molecule containing sequences encoding
an SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 E1a protein may be
delivered to a subject for use as a cancer therapeutic. Optionally,
such a molecule is formulated in a lipid-based carrier and
preferentially targets cancer cells. Such a formulation may be
combined with other cancer therapeutics (e.g., cisplatin, taxol, or
the like). Still other uses for the adenoviral sequences provided
herein will be readily apparent to one of skill in the art.
[0034] In addition, one of skill in the art will readily understand
that the SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 sequences can
be readily adapted for use for a variety of viral and non-viral
vector systems for in vitro, ex vivo or in vivo delivery of
therapeutic and immunogenic molecules. For example, the SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 simian Ad sequences can be
utilized in a variety of rAd and non-rAd vector systems. Such
vectors systems may include, e.g., plasmids, lentiviruses,
retroviruses, poxviruses, vaccinia viruses, and adeno-associated
viral systems, among others. Selection of these vector systems is
not a limitation of the present invention.
[0035] The invention further provides molecules useful for
production of the simian and simian-derived proteins of the
invention. Such molecules which carry polynucleotides including the
simian Ad DNA sequences of the invention can be in the form of
naked DNA, a plasmid, a virus or any other genetic element.
[0036] B. SAdV-36, SAdV-42.1, SAdV-42.2 and SAdV-44 Adenoviral
Proteins
[0037] Gene products of the SAdV-36, SAdV-42.1, SAdV-42.2 or
SAdV-44 adenovirus, such as proteins, enzymes, and fragments
thereof, which are encoded by the adenoviral nucleic acids
described herein are provided. Further encompassed are SAdV-36,
SAdV-42.1, SAdV-42.2 or SAdV-44 proteins, enzymes, and fragments
thereof, having the amino acid sequences encoded by these nucleic
acid sequences which are generated by other methods. Such proteins
include those encoded by the open reading frames identified in
Table 1, above, the proteins in Table 2, below, (also shown in the
Sequence Listing) and fragments thereof of the proteins and
polypeptides.
TABLE-US-00002 TABLE 2 PROTEIN SEQUENCES SAdV-44 SAdV-36 SAdV-42.1
SAdV-42.2 SEQ Regions SEQ ID NO: SEQ ID NO: SEQ ID NO: ID NO: E1a
32 61 92 123 E1b Small 24 54 65 96 T/19K Large 2 34 85 116 T/55K IX
3 35 66 97 L1 52/55D 4 36 67 98 IIIa 5 37 68 99 L2 Penton 6 38 69
100 VII 7 39 70 101 V 8 40 71 102 pX 9 41 72 103 L3 VI 10 42 73 104
Hexon 11 43 74 105 Endo 12 44 75 106 protease L4 100 kD 13 45 76
107 33 kD 30 63 94 125 homolog 22 kD 26 56 87 118 VIII 14 46 77 108
E3 12.5k 15 57 78 109 CR1- 27 47 88 110 alpha gp19K 16 48 79 111
CR1-beta 17 49 80 112 CR1- 18 58 89 119 gamma CR1- 19 -- -- --
delta RID- 20 50 81 113 alpha RID-beta 28 51 82 114 14.7 K 21 59 90
120 L5 Fiber 22 52 83 121
[0038] Thus, in one aspect, unique simian adenoviral 36 (SAdV-36),
SAdV-42.1, SAdV-42.2 or SAdV-44 proteins which are substantially
pure, i.e., are free of other viral and proteinaceous proteins are
provided. Preferably, these proteins are at least 10% homogeneous,
more preferably 60% homogeneous, and most preferably 95%
homogeneous.
[0039] In one embodiment, unique simian-derived capsid proteins are
provided. As used herein, a simian-derived capsid protein includes
any adenoviral capsid protein that contains a SAdV-36, SAdV-42.1,
SAdV-42.2 or SAdV-44 capsid protein or a fragment thereof, as
defined above, including, without limitation, chimeric capsid
proteins, fusion proteins, artificial capsid proteins, synthetic
capsid proteins, and recombinant capsid proteins, without
limitation to means of generating these proteins.
[0040] Suitably, these simian-derived capsid proteins contain one
or more SAdV-36, SAdV-42.1, SAdV-42.2 or SAdV-44 regions or
fragments thereof (e.g., a hexon, penton, fiber, or fragment
thereof) in combination with capsid regions or fragments thereof of
different adenoviral serotypes, or modified simian capsid proteins
or fragments, as described herein. A "modification of a capsid
protein associated with altered tropism" as used herein includes an
altered capsid protein, i.e, a penton, hexon or fiber protein
region, or fragment thereof, such as the knob domain of the fiber
region, or a polynucleotide encoding same, such that specificity is
altered. The simian-derived capsid may be constructed with one or
more of the simian Ad of the invention or another Ad serotype which
may be of human or non-human origin. Such Ad may be obtained from a
variety of sources including the ATCC, commercial and academic
sources, or the sequences of the Ad may be obtained from GenBank or
other suitable sources.
[0041] The amino acid sequences of the penton protein of SAdV-36
(SEQ ID NO:6), SAdV-42.1 (SEQ ID NO:38), SAdV-42.2 (SEQ ID NO:69)
and SAdV-44 (SEQ ID NO: 100) are provided. Suitably, this penton
protein, or unique fragments thereof, may be utilized for a variety
of purposes. Examples of suitable fragments include the penton
having N-terminal and/or C-terminal truncations of about 50, 100,
150, or 200 amino acids, based upon the amino acid numbering
provided above and in SEQ ID NO:6, 38, 69 and 100. Other suitable
fragments include shorter internal, C-terminal, or N-terminal
fragments. Further, the penton protein may be modified for a
variety of purposes known to those of skill in the art.
[0042] Also provided are the amino acid sequences of the hexon
protein of SAdV-36 (SEQ ID NO:11), SAdV-42.1 (SEQ ID NO:43),
SAdV-42.2 (SEQ ID NO:74) and SAdV-44 (SEQ ID NO: 105). Suitably,
this hexon protein, or unique fragments thereof, may be utilized
for a variety of purposes. Examples of suitable fragments include
the hexon having N-terminal and/or C-terminal truncations of about
50, 100, 150, 200, 300, 400, or 500 amino acids, based upon the
amino acid numbering provided above and in SEQ ID NO: 11, 43, 74 or
105. Other suitable fragments include shorter internal, C-terminal,
or N-terminal fragments. For example, one suitable fragment the
loop region (domain) of the hexon protein, designated DE1 and FG1,
or a hypervariable region thereof. Such fragments include the
regions spanning amino acid residues about 125 to 443; about 138 to
441, or smaller fragments, such as those spanning about residue 138
to residue 163; about 170 to about 176; about 195 to about 203;
about 233 to about 246; about 253 to about 264; about 287 to about
297; and about 404 to about 430 of the simian hexon proteins, with
reference to SEQ ID NO: 11, 43, 74 or 105. Other suitable fragments
may be readily identified by one of skill in the art. Further, the
hexon protein may be modified for a variety of purposes known to
those of skill in the art. Because the hexon protein is the
determinant for serotype of an adenovirus, such artificial hexon
proteins would result in adenoviruses having artificial serotypes.
Other artificial capsid proteins can also be constructed using the
chimp Ad penton sequences and/or fiber sequences of the invention
and/or fragments thereof.
[0043] In one embodiment, an adenovirus having an altered hexon
protein utilizing the sequences of a SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 hexon protein may be generated. One suitable method
for altering hexon proteins is described in U.S. Pat. No.
5,922,315, which is incorporated by reference. In this method, at
least one loop region of the adenovirus hexon is changed with at
least one loop region of another adenovirus serotype. Thus, at
least one loop region of such an altered adenovirus hexon protein
is a simian Ad hexon loop region of SAdV-36, SAdV-42.1, SAdV-42.2
or SAdV-44. In one embodiment, a loop region of the SAdV-36,
SAdV-42.1, SAdV-42.2 or SAdV-44 hexon protein is replaced by a loop
region from another adenovirus serotype. In another embodiment, the
loop region of the SAdV-36, SAdV-42.1, SAdV-42.2 or SAdV-44 hexon
is used to replace a loop region from another adenovirus serotype.
Suitable adenovirus serotypes may be readily selected from among
human and non-human serotypes, as described herein. The selection
of a suitable serotype is not a limitation of the present
invention. Still other uses for the SAdV-36, SAdV-42.1, SAdV-42.2
or SAdV-44 hexon protein sequences will be readily apparent to
those of skill in the art.
[0044] The amino acid sequences of the fiber proteins of SAdV-36
(SEQ ID NO:22), SAdV-42.1 (SEQ ID NO:52), SAdV-42.2 (SEQ ID NO:83)
and SAdV-44 (SEQ ID NO:121) are also provided. Suitably, these
fiber proteins, or unique fragments thereof, may be utilized for a
variety of purposes. One suitable fragment is the fiber knob,
located within SEQ ID NO: 22, 52, 83 or 121. Examples of other
suitable fragments include the fiber having N-terminal and/or
C-terminal truncations of about 50, 100, 150, or 200 amino acids,
based upon the amino acid numbering provided in SEQ ID NO: 22, 52,
83 or 121. Still other suitable fragments include internal
fragments. Further, the fiber protein may be modified using a
variety of techniques known to those of skill in the art.
[0045] Unique fragments of the proteins of the SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 are at least 8 amino acids in length.
However, fragments of other desired lengths can be readily
utilized. In addition, modifications as may be introduced to
enhance yield and/or expression of a SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 gene product, e.g., construction of a fusion
molecule in which all or a fragment of the SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 gene product is fused (either directly or
via a linker) with a fusion partner to enhance are provided herein.
Other suitable modifications include, without limitation,
truncation of a coding region (e.g., a protein or enzyme) to
eliminate a pre- or pro-protein ordinarily cleaved and to provide
the mature protein or enzyme and/or mutation of a coding region to
provide a secretable gene product. Still other modifications will
be readily apparent to one of skill in the art. Further encompassed
are proteins having at least about 99% identity to the SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 proteins provided herein.
[0046] As described herein, vectors of the invention containing the
adenoviral capsid proteins of SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 are particularly well suited for use in applications in
which the neutralizing antibodies diminish the effectiveness of
other Ad serotype based vectors, as well as other viral vectors.
The rAd vectors are particularly advantageous in readministration
for repeat gene therapy or for boosting immune response (vaccine
titers).
[0047] Under certain circumstances, it may be desirable to use one
or more of the SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 gene
products (e.g., a capsid protein or a fragment thereof) to generate
an antibody. The term "an antibody," as used herein, refers to an
immunoglobulin molecule which is able to specifically bind to an
epitope. The antibodies may exist in a variety of forms including,
for example, high affinity polyclonal antibodies, monoclonal
antibodies, synthetic antibodies, chimeric antibodies, recombinant
antibodies and humanized antibodies. Such antibodies originate from
immunoglobulin classes IgG, IgM, IgA, IgD and IgE.
[0048] Such antibodies may be generated using any of a number of
methods know in the art. Suitable antibodies may be generated by
well-known conventional techniques, e.g., Kohler and Milstein and
the many known modifications thereof. Similarly desirable high
titer antibodies are generated by applying known recombinant
techniques to the monoclonal or polyclonal antibodies developed to
these antigens [see, e.g., PCT Patent Application No.
PCT/GB85/00392; British Patent Application Publication No.
GB2188638A; Amit et al., 1986 Science, 233:747-753; Queen et al.,
1989 Proc. Nat'l. Acad. Sci. USA, 86:10029-10033; PCT Patent
Application No. PCT/WO9007861; and Riechmann et al., Nature,
332:323-327 (1988); Huse et al, 1988a Science, 246:1275-1281].
Alternatively, antibodies can be produced by manipulating the
complementarity determining regions of animal or human antibodies
to the antigen of this invention. See, e.g., E. Mark and Padlin,
"Humanization of Monoclonal Antibodies", Chapter 4, The Handbook of
Experimental Pharmacology, Vol. 113, The Pharmacology of Monoclonal
Antibodies, Springer-Verlag (June, 1994); Harlow et al., 1999,
Using Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory
Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl.
Acad. Sci. USA 85:5879-5883; and Bird et al., 1988, Science
242:423-426. Further provided by the present invention are
anti-idiotype antibodies (Ab2) and anti-anti-idiotype antibodies
(Ab3). See, e.g., M. Wettendorff et al., "Modulation of anti-tumor
immunity by anti-idiotypic antibodies." In Idiotypic Network and
Diseases, ed. by J. Cerny and J. Hiernaux, 1990 J. Am. Soc.
Microbiol., Washington D.C.: pp. 203-229]. These anti-idiotype and
anti-anti-idiotype antibodies are produced using techniques well
known to those of skill in the art. These antibodies may be used
for a variety of purposes, including diagnostic and clinical
methods and kits.
[0049] Under certain circumstances, it may be desirable to
introduce a detectable label or a tag onto a SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 gene product, antibody or other construct
of the invention. As used herein, a detectable label is a molecule
which is capable, alone or upon interaction with another molecule,
of providing a detectable signal. Most desirably, the label is
detectable visually, e.g. by fluorescence, for ready use in
immunohistochemical analyses or immunofluorescent microscopy. For
example, suitable labels include fluorescein isothiocyanate (FITC),
phycoerythrin (PE), allophycocyanin (APC), coriphosphine-O (CPO) or
tandem dyes, PE-cyanin-5 (PC5), and PE-Texas Red (ECD). All of
these fluorescent dyes are commercially available, and their uses
known to the art. Other useful labels include a colloidal gold
label. Still other useful labels include radioactive compounds or
elements. Additionally, labels include a variety of enzyme systems
that operate to reveal a colorimetric signal in an assay, e.g.,
glucose oxidase (which uses glucose as a substrate) releases
peroxide as a product which in the presence of peroxidase and a
hydrogen donor such as tetramethyl benzidine (TMB) produces an
oxidized TMB that is seen as a blue color. Other examples include
horseradish peroxidase (HRP), alkaline phosphatase (AP), and
hexokinase in conjunction with glucose-6-phosphate dehydrogenase
which reacts with ATP, glucose, and NAD+ to yield, among other
products, NADH that is detected as increased absorbance at 340 nm
wavelength.
[0050] Other label systems that are utilized in the methods
described herein are detectable by other means, e.g., colored latex
microparticles [Bangs Laboratories, Indiana] in which a dye is
embedded are used in place of enzymes to form conjugates with the
target sequences provide a visual signal indicative of the presence
of the resulting complex in applicable assays.
[0051] Methods for coupling or associating the label with a desired
molecule are similarly conventional and known to those of skill in
the art. Known methods of label attachment are described [see, for
example, Handbook of Fluorescent probes and Research Chemicals, 6th
Ed., R. P. M. Haugland, Molecular Probes, Inc., Eugene, Oreg.,
1996; Pierce Catalog and Handbook, Life Science and Analytical
Research Products, Pierce Chemical Company, Rockford, Ill.,
1994/1995]. Thus, selection of the label and coupling methods do
not limit this invention.
[0052] The sequences, proteins, and fragments of SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 may be produced by any suitable
means, including recombinant production, chemical synthesis, or
other synthetic means. Suitable production techniques are well
known to those of skill in the art. See, e.g., Sambrook et al,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press
(Cold Spring Harbor, N.Y.). Alternatively, peptides can also be
synthesized by the well known solid phase peptide synthesis methods
(Merrifield, J. Am. Chem. Soc., 85:2149 (1962); Stewart and Young,
Solid Phase Peptide Synthesis (Freeman, San Francisco, 1969) pp.
27-62). These and other suitable production methods are within the
knowledge of those of skill in the art and are not a limitation of
the present invention.
[0053] In addition, one of skill in the art will readily understand
that the SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 sequences can
be readily adapted for use for a variety of viral and non-viral
vector systems for in vitro, ex vivo or in vivo delivery of
therapeutic and immunogenic molecules. For example, in one
embodiment, the simian Ad capsid proteins and other simian
adenovirus proteins described herein are used for non-viral,
protein-based delivery of genes, proteins, and other desirable
diagnostic, therapeutic and immunogenic molecules. In one such
embodiment, a protein of the invention is linked, directly or
indirectly, to a molecule for targeting to cells with a receptor
for adenoviruses. Preferably, a capsid protein such as a hexon,
penton, fiber or a fragment thereof having a ligand for a cell
surface receptor is selected for such targeting. Suitable molecules
for delivery are selected from among the therapeutic molecules
described herein and their gene products. A variety of linkers
including, lipids, polyLys, and the like may be utilized as
linkers. For example, the simian penton protein may be readily
utilized for such a purpose by production of a fusion protein using
the simian penton sequences in a manner analogous to that described
in Medina-Kauwe L K, et al, Gene Ther. 2001 May; 8(10):795-803 and
Medina-Kauwe L K, et al, Gene Ther. 2001 December; 8(23):
1753-1761. Alternatively, the amino acid sequences of simian Ad
protein IX may be utilized for targeting vectors to a cell surface
receptor, as described in US Patent Appln 20010047081. Suitable
ligands include a CD40 antigen, an RGD-containing or
polylysine-containing sequence, and the like. Still other simian Ad
proteins, including, e.g., the hexon protein and/or the fiber
protein, may be used for used for these and similar purposes.
[0054] Still other SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
adenoviral proteins may be used as alone, or in combination with
other adenoviral protein, for a variety of purposes which will be
readily apparent to one of skill in the art. In addition, still
other uses for the SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
adenoviral proteins will be readily apparent to one of skill in the
art.
II. Recombinant Adenoviral Vectors
[0055] The compositions described herein include vectors that
deliver a heterologous molecule to cells, either for therapeutic or
vaccine purposes. As used herein, a vector may include any genetic
element including, without limitation, naked DNA, a phage,
transposon, cosmid, episome, plasmid, or a virus. Such vectors
contain simian adenovirus DNA of SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44, and a minigene. By "minigene" is meant the
combination of a selected heterologous gene and the other
regulatory elements necessary to drive translation, transcription
and/or expression of the gene product in a host cell.
[0056] Typically, a SAdV-derived adenoviral vector is designed such
that the minigene is located in a nucleic acid molecule which
contains other adenoviral sequences in the region native to a
selected adenoviral gene. The minigene may be inserted into an
existing gene region to disrupt the function of that region, if
desired. Alternatively, the minigene may be inserted into the site
of a partially or fully deleted adenoviral gene. For example, the
minigene may be located in the site of such as the site of a
functional E1 deletion or functional E3 deletion, among others that
may be selected. The term "functionally deleted" or "functional
deletion" means that a sufficient amount of the gene region is
removed or otherwise damaged, e.g., by mutation or modification, so
that the gene region is no longer capable of producing functional
products of gene expression. If desired, the entire gene region may
be removed. Other suitable sites for gene disruption or deletion
are discussed elsewhere in the application.
[0057] For example, for a production vector useful for generation
of a recombinant virus, the vector may contain the minigene and
either the 5' end of the adenoviral genome or the 3' end of the
adenoviral genome, or both the 5' and 3' ends of the adenoviral
genome. The 5' end of the adenoviral genome contains the 5'
cis-elements necessary for packaging and replication; i.e., the 5'
inverted terminal repeat (ITR) sequences (which function as origins
of replication) and the native 5' packaging enhancer domains (that
contain sequences necessary for packaging linear Ad genomes and
enhancer elements for the E1 promoter). The 3' end of the
adenoviral genome includes the 3' cis-elements (including the ITRs)
necessary for packaging and encapsidation. Suitably, a recombinant
adenovirus contains both 5' and 3' adenoviral cis-elements and the
minigene is located between the 5' and 3' adenoviral sequences. A
SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 based adenoviral
vector may also contain additional adenoviral sequences.
[0058] Suitably, these SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
based adenoviral vectors contain one or more adenoviral elements
derived from the adenoviral genome of the invention. In one
embodiment, the vectors contain adenoviral ITRs from SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 and additional adenoviral
sequences from the same adenoviral serotype. In another embodiment,
the vectors contain adenoviral sequences that are derived from a
different adenoviral serotype than that which provides the
ITRs.
[0059] As defined herein, a pseudotyped adenovirus refers to an
adenovirus in which the capsid protein of the adenovirus is from a
different adenovirus than the adenovirus which provides the
ITRs.
[0060] Further, chimeric or hybrid adenoviruses may be constructed
using the adenoviruses described herein using techniques known to
those of skill in the art. See, e.g., U.S. Pat. No. 7,291,498.
[0061] The selection of the adenoviral source of the ITRs and the
source of any other adenoviral sequences present in vector is not a
limitation of the present embodiment. A variety of adenovirus
strains are available from the American Type Culture Collection,
Manassas, Va., or available by request from a variety of commercial
and institutional sources. Further, the sequences of many such
strains are available from a variety of databases including, e.g.,
PubMed and GenBank. Homologous adenovirus vectors prepared from
other simian or from human adenoviruses are described in the
published literature [see, for example, U.S. Pat. No. 5,240,846].
The DNA sequences of a number of adenovirus types are available
from GenBank, including type Ad5 [GenBank Accession No. M73260].
The adenovirus sequences may be obtained from any known adenovirus
serotype, such as serotypes 2, 3, 4, 7, 12 and 40, and further
including any of the presently identified human types. Similarly
adenoviruses known to infect non-human animals (e.g., simians) may
also be employed in the vector constructs of this invention. See,
e.g., U.S. Pat. No. 6,083,716.
[0062] The viral sequences, helper viruses (if needed), and
recombinant viral particles, and other vector components and
sequences employed in the construction of the vectors described
herein are obtained as described above. The SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 DNA sequences of the invention are
employed to construct vectors and cell lines useful in the
preparation of such vectors.
[0063] Modifications of the nucleic acid sequences forming the
vectors of this invention, including sequence deletions,
insertions, and other mutations may be generated using standard
molecular biological techniques and are within the scope of this
embodiment.
[0064] A. The "Minigene"
[0065] The methods employed for the selection of the transgene, the
cloning and construction of the "minigene" and its insertion into
the viral vector are within the skill in the art given the
teachings provided herein.
[0066] 1. The Transgene
[0067] The transgene is a nucleic acid sequence, heterologous to
the vector sequences flanking the transgene, which encodes a
polypeptide, protein, or other product, of interest. The nucleic
acid coding sequence is operatively linked to regulatory components
in a manner which permits transgene transcription, translation,
and/or expression in a host cell.
[0068] The composition of the transgene sequence will depend upon
the use to which the resulting vector will be put. For example, one
type of transgene sequence includes a reporter sequence, which upon
expression produces a detectable signal. Such reporter sequences
include, without limitation, DNA sequences encoding
.beta.-lactamase, .beta.-galactosidase (LacZ), alkaline
phosphatase, thymidine kinase, green fluorescent protein (GFP),
chloramphenicol acetyltransferase (CAT), luciferase, membrane bound
proteins including, for example, CD2, CD4, CD8, the influenza
hemagglutinin protein, and others well known in the art, to which
high affinity antibodies directed thereto exist or can be produced
by conventional means, and fusion proteins comprising a membrane
bound protein appropriately fused to an antigen tag domain from,
among others, hemagglutinin or Myc. These coding sequences, when
associated with regulatory elements which drive their expression,
provide signals detectable by conventional means, including
enzymatic, radiographic, colorimetric, fluorescence or other
spectrographic assays, fluorescent activating cell sorting assays
and immunological assays, including enzyme linked immunosorbent
assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For
example, where the marker sequence is the LacZ gene, the presence
of the vector carrying the signal is detected by assays for
beta-galactosidase activity. Where the transgene is GFP or
luciferase, the vector carrying the signal may be measured visually
by color or light production in a luminometer.
[0069] In one embodiment, the transgene is a non-marker sequence
encoding a product which is useful in biology and medicine, such as
proteins, peptides, RNA, enzymes, or catalytic RNAs. Desirable RNA
molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and
antisense RNAs. One example of a useful RNA sequence is a sequence
which extinguishes expression of a targeted nucleic acid sequence
in the treated animal.
[0070] The transgene may be used for treatment, e.g., of genetic
deficiencies, as a cancer therapeutic or vaccine, for induction of
an immune response, and/or for prophylactic vaccine purposes. As
used herein, induction of an immune response refers to the ability
of a molecule (e.g., a gene product) to induce a T cell and/or a
humoral immune response to the molecule. The invention further
includes using multiple transgenes, e.g., to correct or ameliorate
a condition caused by a multi-subunit protein. In certain
situations, a different transgene may be used to encode each
subunit of a protein, or to encode different peptides or proteins.
This is desirable when the size of the DNA encoding the protein
subunit is large, e.g., for an immunoglobulin, the platelet-derived
growth factor, or a dystrophin protein. In order for the cell to
produce the multi-subunit protein, a cell is infected with the
recombinant virus containing each of the different subunits.
Alternatively, different subunits of a protein may be encoded by
the same transgene. In this case, a single transgene includes the
DNA encoding each of the subunits, with the DNA for each subunit
separated by an internal ribozyme entry site (IRES). This is
desirable when the size of the DNA encoding each of the subunits is
small, e.g., the total size of the DNA encoding the subunits and
the IRES is less than five kilobases. As an alternative to an IRES,
the DNA may be separated by sequences encoding a 2A peptide, which
self-cleaves in a post-translational event. See, e.g., M. L.
Donnelly, et al, J. Gen. Virol., 78(Pt 1):13-21 (January 1997);
Furler, S., et al, Gene Ther., 8(11):864-873 (June 2001); Klump H.,
et al., Gene Ther., 8(10):811-817 (May 2001). This 2A peptide is
significantly smaller than an IRES, making it well suited for use
when space is a limiting factor. However, the selected transgene
may encode any biologically active product or other product, e.g.,
a product desirable for study.
[0071] Suitable transgenes may be readily selected by one of skill
in the art. The selection of the transgene is not considered to be
a limitation of this embodiment.
[0072] 2. Regulatory Elements
[0073] In addition to the major elements identified above for the
minigene, the vector also includes conventional control elements
necessary which are operably linked to the transgene in a manner
that permits its transcription, translation and/or expression in a
cell transfected with the plasmid vector or infected with the virus
produced by the invention. As used herein, "operably linked"
sequences include both expression control sequences that are
contiguous with the gene of interest and expression control
sequences that act in trans or at a distance to control the gene of
interest.
[0074] Expression control sequences include appropriate
transcription initiation, termination, promoter and enhancer
sequences; efficient RNA processing signals such as splicing and
polyadenylation (polyA) signals; sequences that stabilize
cytoplasmic mRNA; sequences that enhance translation efficiency
(i.e., Kozak consensus sequence); sequences that enhance protein
stability; and when desired, sequences that enhance secretion of
the encoded product.
[0075] A great number of expression control sequences, including
promoters which are native, constitutive, inducible and/or
tissue-specific, are known in the art and may be utilized. Examples
of constitutive promoters include, without limitation, the
retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with
the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally
with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530
(1985)], the SV40 promoter, the dihydrofolate reductase promoter,
the .beta.-actin promoter, the phosphoglycerol kinase (PGK)
promoter, and the EF1.alpha. promoter [Invitrogen].
[0076] Inducible promoters allow regulation of gene expression and
can be regulated by exogenously supplied compounds, environmental
factors such as temperature, or the presence of a specific
physiological state, e.g., acute phase, a particular
differentiation state of the cell, or in replicating cells only.
Inducible promoters and inducible systems are available from a
variety of commercial sources, including, without limitation,
Invitrogen, Clontech and Ariad. Many other systems have been
described and can be readily selected by one of skill in the art.
For example, inducible promoters include the zinc-inducible sheep
metallothionine (MT) promoter and the dexamethasone (Dex)-inducible
mouse mammary tumor virus (MMTV) promoter. Other inducible systems
include the T7 polymerase promoter system [WO 98/10088]; the
ecdysone insect promoter [No et al, Proc. Natl. Acad. Sci. USA,
93:3346-3351 (1996)], the tetracycline-repressible system [Gossen
et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], the
tetracycline-inducible system [Gossen et al, Science, 268:1766-1769
(1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518
(1998)]. Other systems include the FK506 dimer, VP16 or p65 using
castradiol, diphenol murislerone, the RU486-inducible system [Wang
et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther.,
4:432-441 (1997)] and the rapamycin-inducible system [Magari et al,
J. Clin. Invest., 100:2865-2872 (1997)]. The effectiveness of some
inducible promoters increases over time. In such cases one can
enhance the effectiveness of such systems by inserting multiple
repressors in tandem, e.g., TetR linked to a TetR by an IRES.
Alternatively, one can wait at least 3 days before screening for
the desired function. One can enhance expression of desired
proteins by known means to enhance the effectiveness of this
system. For example, using the Woodchuck Hepatitis Virus
Posttranscriptional Regulatory Element (WPRE).
[0077] In another embodiment, the native promoter for the transgene
will be used. The native promoter may be preferred when it is
desired that expression of the transgene should mimic the native
expression. The native promoter may be used when expression of the
transgene must be regulated temporally or developmentally, or in a
tissue-specific manner, or in response to specific transcriptional
stimuli. In a further embodiment, other native expression control
elements, such as enhancer elements, polyadenylation sites or Kozak
consensus sequences may also be used to mimic the native
expression.
[0078] Another embodiment of the transgene includes a transgene
operably linked to a tissue-specific promoter. For instance, if
expression in skeletal muscle is desired, a promoter active in
muscle should be used. These include the promoters from genes
encoding skeletal .beta.-actin, myosin light chain 2A, dystrophin,
muscle creatine kinase, as well as synthetic muscle promoters with
activities higher than naturally occurring promoters (see Li et
al., Nat. Biotech., 17:241-245 (1999)). Examples of promoters that
are tissue-specific are known for liver (albumin, Miyatake et al.,
J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter,
Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein
(AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone
osteocalcin (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone
sialoprotein (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)),
lymphocytes (CD2, Hansal et al., J. Immunol., 161:1063-8 (1998);
immunoglobulin heavy chain; T cell receptor chain), neuronal such
as neuron-specific enolase (NSE) promoter (Andersen et al., Cell.
Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene
(Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)),
and the neuron-specific vgf gene (Piccioli et al., Neuron,
15:373-84 (1995)), among others.
[0079] Optionally, vectors carrying transgenes encoding
therapeutically useful or immunogenic products may also include
selectable markers or reporter genes may include sequences encoding
geneticin, hygromicin or purimycin resistance, among others. Such
selectable reporters or marker genes (preferably located outside
the viral genome to be packaged into a viral particle) can be used
to signal the presence of the plasmids in bacterial cells, such as
ampicillin resistance. Other components of the vector may include
an origin of replication. Selection of these and other promoters
and vector elements are conventional and many such sequences are
available [see, e.g., Sambrook et al, and references cited
therein].
[0080] These vectors are generated using the techniques and
sequences provided herein, in conjunction with techniques known to
those of skill in the art. Such techniques include conventional
cloning techniques of cDNA such as those described in texts
[Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Press, Cold Spring Harbor, N.Y.], use of overlapping
oligonucleotide sequences of the adenovirus genomes, polymerase
chain reaction, and any suitable method which provides the desired
nucleotide sequence.
III. Production of the Viral Vector
[0081] In one embodiment, the simian adenoviral plasmids (or other
vectors) are used to produce adenoviral vectors. In one embodiment,
the adenoviral vectors are adenoviral particles which are
replication-defective. In one embodiment, the adenoviral particles
are rendered replication-defective by deletions in the E1a and/or
E1b genes. Alternatively, the adenoviruses are rendered
replication-defective by another means, optionally while retaining
the E1a and/or E1b genes. The adenoviral vectors can also contain
other mutations to the adenoviral genome, e.g.,
temperature-sensitive mutations or deletions in other genes. In
other embodiments, it is desirable to retain an intact E1a and/or
E1b region in the adenoviral vectors. Such an intact E1 region may
be located in its native location in the adenoviral genome or
placed in the site of a deletion in the native adenoviral genome
(e.g., in the E3 region).
[0082] In the construction of useful simian adenovirus vectors for
delivery of a gene to the human (or other mammalian) cell, a range
of adenovirus nucleic acid sequences can be employed in the
vectors. For example, all or a portion of the adenovirus delayed
early gene E3 may be eliminated from the simian adenovirus sequence
which forms a part of the recombinant virus. The function of simian
E3 is believed to be irrelevant to the function and production of
the recombinant virus particle. Simian adenovirus vectors may also
be constructed having a deletion of at least the ORF6 region of the
E4 gene, and more desirably because of the redundancy in the
function of this region, the entire E4 region. Still another vector
of this invention contains a deletion in the delayed early gene
E2a. Deletions may also be made in any of the late genes L1 through
L5 of the simian adenovirus genome. Similarly, deletions in the
intermediate genes IX and IVa.sub.2 may be useful for some
purposes. Other deletions may be made in the other structural or
non-structural adenovirus genes. The above discussed deletions may
be used individually, i.e., an adenovirus sequence for use as
described herein may contain deletions in only a single region.
Alternatively, deletions of entire genes or portions thereof
effective to destroy their biological activity may be used in any
combination. For example, in one exemplary vector, the adenovirus
sequence may have deletions of the E1 genes and the E4 gene, or of
the E1, E2a and E3 genes, or of the E1 and E3 genes, or of E1, E2a
and E4 genes, with or without deletion of E3, and so on. As
discussed above, such deletions may be used in combination with
other mutations, such as temperature-sensitive mutations, to
achieve a desired result.
[0083] An adenoviral vector lacking any essential adenoviral
sequences (e.g., E1a, E1b, E2a, E2b, E4 ORF6, L1, L2, L3, L4 and
L5) may be cultured in the presence of the missing adenoviral gene
products which are required for viral infectivity and propagation
of an adenoviral particle. These helper functions may be provided
by culturing the adenoviral vector in the presence of one or more
helper constructs (e.g., a plasmid or virus) or a packaging host
cell. See, for example, the techniques described for preparation of
a "minimal" human Ad vector in International Patent Application
Publication No. WO 96/13597, published May 9, 1996, and
incorporated herein by reference.
[0084] 1. Helper Viruses
[0085] Thus, depending upon the simian adenovirus gene content of
the viral vectors employed to carry the minigene, a helper
adenovirus or non-replicating virus fragment may be necessary to
provide sufficient simian adenovirus gene sequences necessary to
produce an infective recombinant viral particle containing the
minigene. Useful helper viruses contain selected adenovirus gene
sequences not present in the adenovirus vector construct and/or not
expressed by the packaging cell line in which the vector is
transfected. In one embodiment, the helper virus is
replication-defective and contains a variety of adenovirus genes in
addition to the sequences described above. Such a helper virus is
desirably used in combination with an E1-expressing cell line.
[0086] Helper viruses may also be formed into poly-cation
conjugates as described in Wu et al, J. Biol. Chem.,
264:16985-16987 (1989); K. J. Fisher and J. M. Wilson, Biochem. J.,
299:49 (Apr. 1, 1994). Helper virus may optionally contain a second
reporter minigene. A number of such reporter genes are known to the
art. The presence of a reporter gene on the helper virus which is
different from the transgene on the adenovirus vector allows both
the Ad vector and the helper virus to be independently monitored.
This second reporter is used to enable separation between the
resulting recombinant virus and the helper virus upon
purification.
[0087] 2. Complementation Cell Lines
[0088] To generate recombinant simian adenoviruses (Ad) deleted in
any of the genes described above, the function of the deleted gene
region, if essential to the replication and infectivity of the
virus, must be supplied to the recombinant virus by a helper virus
or cell line, i.e., a complementation or packaging cell line. In
many circumstances, a cell line expressing the human E1 can be used
to transcomplement the chimp Ad vector. This is particularly
advantageous because, due to the diversity between the chimp Ad
sequences of the invention and the human AdE1 sequences found in
currently available packaging cells, the use of the current human
E1-containing cells prevents the generation of
replication-competent adenoviruses during the replication and
production process. However, in certain circumstances, it will be
desirable to utilize a cell line which expresses the E1 gene
products can be utilized for production of an E1-deleted simian
adenovirus. Such cell lines have been described. See, e.g., U.S.
Pat. No. 6,083,716.
[0089] If desired, one may utilize the sequences provided herein to
generate a packaging cell or cell line that expresses, at a
minimum, the adenovirus E1 gene from SAdV36 under the
transcriptional control of a promoter for expression in a selected
parent cell line. Inducible or constitutive promoters may be
employed for this purpose. Examples of such promoters are described
in detail elsewhere in this specification. A parent cell is
selected for the generation of a novel cell line expressing any
desired SAdV36 gene. Without limitation, such a parent cell line
may be HeLa [ATCC Accession No. CCL 2], A549 [ATCC Accession No.
CCL 185], HEK 293, KB [CCL 17], Detroit [e.g., Detroit 510, CCL 72]
and WI-38 [CCL 75] cells, among others. These cell lines are all
available from the American Type Culture Collection, 10801
University Boulevard, Manassas, Va. 20110-2209. Other suitable
parent cell lines may be obtained from other sources.
[0090] Such E1-expressing cell lines are useful in the generation
of recombinant simian adenovirus E1 deleted vectors. Additionally,
or alternatively, cell lines that express one or more simian
adenoviral gene products, e.g., E1a, E1b, E2a, and/or E4 ORF6, can
be constructed using essentially the same procedures are used in
the generation of recombinant simian viral vectors. Such cell lines
can be utilized to transcomplement adenovirus vectors deleted in
the essential genes that encode those products, or to provide
helper functions necessary for packaging of a helper-dependent
virus (e.g., adeno-associated virus). The preparation of a host
cell involves techniques such as assembly of selected DNA
sequences. This assembly may be accomplished utilizing conventional
techniques. Such techniques include cDNA and genomic cloning, which
are well known and are described in Sambrook et al., cited above,
use of overlapping oligonucleotide sequences of the adenovirus
genomes, combined with polymerase chain reaction, synthetic
methods, and any other suitable methods which provide the desired
nucleotide sequence.
[0091] In still another alternative, the essential adenoviral gene
products are provided in trans by the adenoviral vector and/or
helper virus. In such an instance, a suitable host cell can be
selected from any biological organism, including prokaryotic (e.g.,
bacterial) cells, and eukaryotic cells, including, insect cells,
yeast cells and mammalian cells. Particularly desirable host cells
are selected from among any mammalian species, including, without
limitation, cells such as A549, WEHI, 3T3, 10T1/2, HEK 293 cells or
PERC6 (both of which express functional adenoviral E1) [Fallaux, F
J et al, (1998), Hum Gene Ther, 9:1909-1917], Saos, C2C12, L cells,
HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells
derived from mammals including human, monkey, mouse, rat, rabbit,
and hamster. The selection of the mammalian species providing the
cells is not a limitation of this invention; nor is the type of
mammalian cell, i.e., fibroblast, hepatocyte, tumor cell, etc.
[0092] 3. Assembly of Viral Particle and Transfection of a Cell
Line
[0093] Generally, when delivering the vector comprising the
minigene by transfection, the vector is delivered in an amount from
about 5 .mu.g to about 100 .mu.g DNA, and preferably about 10 to
about 50 .mu.g DNA to about 1.times.10.sup.4 cells to about
1.times.10'.sup.3 cells, and preferably about 10.sup.5 cells.
However, the relative amounts of vector DNA to host cells may be
adjusted, taking into consideration such factors as the selected
vector, the delivery method and the host cells selected.
[0094] The vector may be any vector known in the art or disclosed
above, including naked DNA, a plasmid, phage, transposon, cosmids,
episomes, viruses, etc. Introduction into the host cell of the
vector may be achieved by any means known in the art or as
disclosed above, including transfection, and infection. One or more
of the adenoviral genes may be stably integrated into the genome of
the host cell, stably expressed as episomes, or expressed
transiently. The gene products may all be expressed transiently, on
an episome or stably integrated, or some of the gene products may
be expressed stably while others are expressed transiently.
Furthermore, the promoters for each of the adenoviral genes may be
selected independently from a constitutive promoter, an inducible
promoter or a native adenoviral promoter. The promoters may be
regulated by a specific physiological state of the organism or cell
(i.e., by the differentiation state or in replicating or quiescent
cells) or by exogenously-added factors, for example.
[0095] Introduction of the molecules (as plasmids or viruses) into
the host cell may also be accomplished using techniques known to
the skilled artisan and as discussed throughout the specification.
In preferred embodiment, standard transfection techniques are used,
e.g., CaPO.sub.4 transfection or electroporation.
[0096] Assembly of the selected DNA sequences of the adenovirus (as
well as the transgene and other vector elements into various
intermediate plasmids), and the use of the plasmids and vectors to
produce a recombinant viral particle are all achieved using
conventional techniques. Such techniques include conventional
cloning techniques of cDNA such as those described in texts
[Sambrook et al, cited above], use of overlapping oligonucleotide
sequences of the adenovirus genomes, polymerase chain reaction, and
any suitable method which provides the desired nucleotide sequence.
Standard transfection and co-transfection techniques are employed,
e.g., CaPO.sub.4 precipitation techniques. Other conventional
methods employed include homologous recombination of the viral
genomes, plaquing of viruses in agar overlay, methods of measuring
signal generation, and the like.
[0097] For example, following the construction and assembly of the
desired minigene-containing viral vector, the vector is transfected
in vitro in the presence of a helper virus into the packaging cell
line. Homologous recombination occurs between the helper and the
vector sequences, which permits the adenovirus-transgene sequences
in the vector to be replicated and packaged into virion capsids,
resulting in the recombinant viral vector particles. The current
method for producing such virus particles is transfection-based.
However, the invention is not limited to such methods.
[0098] The resulting recombinant simian adenoviruses are useful in
transferring a selected transgene to a selected cell. In in vivo
experiments with the recombinant virus grown in the packaging cell
lines, the E1-deleted recombinant simian adenoviral vectors of the
invention demonstrate utility in transferring a transgene to a
non-simian, preferably a human, cell.
IV. Use of the Recombinant Adenovirus Vectors
[0099] The recombinant simian SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 based vectors are useful for gene transfer to a human or
non-simian veterinary patient in vitro, ex vivo, and in vivo.
[0100] The recombinant adenovirus vectors described herein can be
used as expression vectors for the production of the products
encoded by the heterologous genes in vitro. For example, the
recombinant adenoviruses containing a gene inserted into the
location of an E1 deletion may be transfected into an E1-expressing
cell line as described above. Alternatively, replication-competent
adenoviruses may be used in another selected cell line. The
transfected cells are then cultured in the conventional manner,
allowing the recombinant adenovirus to express the gene product
from the promoter. The gene product may then be recovered from the
culture medium by known conventional methods of protein isolation
and recovery from culture.
[0101] A SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 derived
recombinant simian adenoviral vector provides an efficient gene
transfer vehicle that can deliver a selected transgene to a
selected host cell in vivo or ex vivo even where the organism has
neutralizing antibodies to one or more AAV serotypes. In one
embodiment, the rAAV and the cells are mixed ex vivo; the infected
cells are cultured using conventional methodologies; and the
transduced cells are re-infused into the patient. These
compositions are particularly well suited to gene delivery for
therapeutic purposes and for immunization, including inducing
protective immunity.
[0102] More commonly, the SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 recombinant adenoviral vectors will be utilized for
delivery of therapeutic or immunogenic molecules, as described
below. It will be readily understood for both applications, that
the recombinant adenoviral vectors of the invention are
particularly well suited for use in regimens involving repeat
delivery of recombinant adenoviral vectors. Such regimens typically
involve delivery of a series of viral vectors in which the viral
capsids are alternated. The viral capsids may be changed for each
subsequent administration, or after a pre-selected number of
administrations of a particular serotype capsid (e.g., one, two,
three, four or more). Thus, a regimen may involve delivery of a rAd
with a first simian capsid, delivery with a rAd with a second
simian capsid, and delivery with a third simian capsid. A variety
of other regimens which use the Ad capsids of the invention alone,
in combination with one another, or in combination with other
adenoviruses (which are preferably immunologically
non-crossreactive) will be apparent to those of skill in the art.
Optionally, such a regimen may involve administration of rAd with
capsids of other non-human primate adenoviruses, human
adenoviruses, or artificial sequences such as are described herein.
Each phase of the regimen may involve administration of a series of
injections (or other delivery routes) with a single Ad capsid
followed by a series with another capsid from a different Ad
source. Alternatively, the SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 vectors may be utilized in regimens involving other
non-adenoviral-mediated delivery systems, including other viral
systems, non-viral delivery systems, protein, peptides, and other
biologically active molecules.
[0103] The following sections will focus on exemplary molecules
which may be delivered via the adenoviral vectors of the
invention.
[0104] A. Ad-Mediated Delivery of Therapeutic Molecules
[0105] In one embodiment, the above-described recombinant vectors
are administered to humans according to published methods for gene
therapy. A simian viral vector bearing the selected transgene may
be administered to a patient, preferably suspended in a
biologically compatible solution or pharmaceutically acceptable
delivery vehicle. A suitable vehicle includes sterile saline. Other
aqueous and non-aqueous isotonic sterile injection solutions and
aqueous and non-aqueous sterile suspensions known to be
pharmaceutically acceptable carriers and well known to those of
skill in the art may be employed for this purpose.
[0106] The simian adenoviral vectors are administered in sufficient
amounts to transduce the target cells and to provide sufficient
levels of gene transfer and expression to provide a therapeutic
benefit without undue adverse or with medically acceptable
physiological effects, which can be determined by those skilled in
the medical arts. Conventional and pharmaceutically acceptable
routes of administration include, but are not limited to, direct
delivery to the retina and other intraocular delivery methods,
direct delivery to the liver, inhalation, intranasal, intravenous,
intramuscular, intratracheal, subcutaneous, intradermal, rectal,
oral and other parenteral routes of administration. Routes of
administration may be combined, if desired, or adjusted depending
upon the transgene or the condition. The route of administration
primarily will depend on the nature of the condition being
treated.
[0107] Dosages of the viral vector will depend primarily on factors
such as the condition being treated, the age, weight and health of
the patient, and may thus vary among patients. For example, a
therapeutically effective adult human or veterinary dosage of the
viral vector is generally in the range of from about 100 .mu.L to
about 100 mL of a carrier containing concentrations of from about
1.times.10.sup.6 to about 1.times.10.sup.15 particles, about
1.times.10.sup.11 to 1.times.10.sup.13 particles, or about
1.times.10.sup.9 to 1.times.10.sup.12 particles virus. Dosages will
range depending upon the size of the animal and the route of
administration. For example, a suitable human or veterinary dosage
(for about an 80 kg animal) for intramuscular injection is in the
range of about 1.times.10.sup.9 to about 5.times.10.sup.12
particles per mL, for a single site. Optionally, multiple sites of
administration may be delivered. In another example, a suitable
human or veterinary dosage may be in the range of about
1.times.10.sup.11 to about 1.times.10.sup.15 particles for an oral
formulation. One of skill in the art may adjust these doses,
depending the route of administration, and the therapeutic or
vaccinal application for which the recombinant vector is employed.
The levels of expression of the transgene, or for an immunogen, the
level of circulating antibody, can be monitored to determine the
frequency of dosage administration. Yet other methods for
determining the timing of frequency of administration will be
readily apparent to one of skill in the art.
[0108] An optional method step involves the co-administration to
the patient, either concurrently with, or before or after
administration of the viral vector, of a suitable amount of a short
acting immune modulator. The selected immune modulator is defined
herein as an agent capable of inhibiting the formation of
neutralizing antibodies directed against the recombinant vector of
this invention or capable of inhibiting cytolytic T lymphocyte
(CTL) elimination of the vector. The immune modulator may interfere
with the interactions between the T helper subsets (T.sub.H1 or
T.sub.H2) and B cells to inhibit neutralizing antibody formation.
Alternatively, the immune modulator may inhibit the interaction
between T.sub.H1 cells and CTLs to reduce the occurrence of CTL
elimination of the vector. A variety of useful immune modulators
and dosages for use of same are disclosed, for example, in Yang et
al., J. Virol., 70(9) (September, 1996); International Patent
Application Publication No. WO 96/12406, published May 2, 1996; and
International Patent Application No. PCT/US96/03035, all
incorporated herein by reference.
[0109] 1. Therapeutic Transgenes
[0110] Useful therapeutic products encoded by the transgene include
hormones and growth and differentiation factors including, without
limitation, insulin, glucagon, growth hormone (GH), parathyroid
hormone (PTH), growth hormone releasing factor (GRF), follicle
stimulating hormone (FSH), luteinizing hormone (LH), human
chorionic gonadotropin (hCG), vascular endothelial growth factor
(VEGF), angiopoietins, angiostatin, granulocyte colony stimulating
factor (GCSF), erythropoietin (EPO), connective tissue growth
factor (CTGF), basic fibroblast growth factor (bFGF), acidic
fibroblast growth factor (aFGF), epidermal growth factor (EGF),
transforming growth factor (TGF), platelet-derived growth factor
(PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one
of the transforming growth factor superfamily, including TGF,
activins, inhibins, or any of the bone morphogenic proteins (BMP)
BMPs 1-15, any one of the heregluin/neuregulin/ARIA/neu
differentiation factor (NDF) family of growth factors, nerve growth
factor (NGF), brain-derived neurotrophic factor (BDNF),
neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF),
glial cell line derived neurotrophic factor (GDNF), neurturin,
agrin, any one of the family of semaphorins/collapsins, netrin-1
and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin,
sonic hedgehog and tyrosine hydroxylase.
[0111] Other useful transgene products include proteins that
regulate the immune system including, without limitation, cytokines
and lymphokines such as thrombopoietin (TPO), interleukins (IL)
IL-1 through IL-25 (including, e.g., IL-2, IL-4, IL-12 and IL-18),
monocyte chemoattractant protein, leukemia inhibitory factor,
granulocyte-macrophage colony stimulating factor, Fas ligand, tumor
necrosis factors and, interferons, and, stem cell factor,
flk-2/flt3 ligand. Gene products produced by the immune system are
also useful in the invention. These include, without limitation,
immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric
immunoglobulins, humanized antibodies, single chain antibodies, T
cell receptors, chimeric T cell receptors, single chain T cell
receptors, class I and class II MHC molecules, as well as
engineered immunoglobulins and MHC molecules. Useful gene products
also include complement regulatory proteins such as complement
regulatory proteins, membrane cofactor protein (MCP), decay
accelerating factor (DAF), CR1, CF2 and CD59.
[0112] Still other useful gene products include any one of the
receptors for the hormones, growth factors, cytokines, lymphokines,
regulatory proteins and immune system proteins. The invention
encompasses receptors for cholesterol regulation, including the low
density lipoprotein (LDL) receptor, high density lipoprotein (HDL)
receptor, the very low density lipoprotein (VLDL) receptor, and the
scavenger receptor. The invention also encompasses gene products
such as members of the steroid hormone receptor superfamily
including glucocorticoid receptors and estrogen receptors, Vitamin
D receptors and other nuclear receptors. In addition, useful gene
products include transcription factors such as jun, fos, max, mad,
serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin,
ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4,
ZFS, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins,
interferon regulation factor (IRF-1), Wilms tumor protein,
ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3,
and the forkhead family of winged helix proteins.
[0113] Other useful gene products include, carbamoyl synthetase I,
ornithine transcarbamylase, arginosuccinate synthetase,
arginosuccinate lyase, arginase, fumarylacetacetate hydrolase,
phenylalanine hydroxylase, alpha-1 antitrypsin,
glucose-6-phosphatase, porphobilinogen deaminase, factor VIII,
factor IX, cystathione beta-synthase, branched chain ketoacid
decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA
carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase,
insulin, beta-glucosidase, pyruvate carboxylate, hepatic
phosphorylase, phosphorylase kinase, glycine decarboxylase,
H-protein, T-protein, a cystic fibrosis transmembrane regulator
(CFTR) sequence, and a dystrophin cDNA sequence.
[0114] Other useful gene products include non-naturally occurring
polypeptides, such as chimeric or hybrid polypeptides having a
non-naturally occurring amino acid sequence containing insertions,
deletions or amino acid substitutions. For example, single-chain
engineered immunoglobulins could be useful in certain
immunocompromised patients. Other types of non-naturally occurring
gene sequences include antisense molecules and catalytic nucleic
acids, such as ribozymes, which could be used to reduce
overexpression of a target.
[0115] Reduction and/or modulation of expression of a gene are
particularly desirable for treatment of hyperproliferative
conditions characterized by hyperproliferating cells, as are
cancers and psoriasis. Target polypeptides include those
polypeptides which are produced exclusively or at higher levels in
hyperproliferative cells as compared to normal cells. Target
antigens include polypeptides encoded by oncogenes such as myb,
myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu,
trk and EGRF. In addition to oncogene products as target antigens,
target polypeptides for anti-cancer treatments and protective
regimens include variable regions of antibodies made by B cell
lymphomas and variable regions of T cell receptors of T cell
lymphomas which, in some embodiments, are also used as target
antigens for autoimmune disease. Other tumor-associated
polypeptides can be used as target polypeptides such as
polypeptides which are found at higher levels in tumor cells
including the polypeptide recognized by monoclonal antibody 17-1A
and folate binding polypeptides.
[0116] Other suitable therapeutic polypeptides and proteins include
those which may be useful for treating individuals suffering from
autoimmune diseases and disorders by conferring a broad based
protective immune response against targets that are associated with
autoimmunity including cell receptors and cells which produce
self-directed antibodies. T cell mediated autoimmune diseases
include Rheumatoid arthritis (RA), multiple sclerosis (MS),
Sjogren's syndrome, sarcoidosis, insulin dependent diabetes
mellitus (IDDM), autoimmune thyroiditis, reactive arthritis,
ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis,
psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease
and ulcerative colitis. Each of these diseases is characterized by
T cell receptors (TCRs) that bind to endogenous antigens and
initiate the inflammatory cascade associated with autoimmune
diseases.
[0117] The simian adenoviral vectors of the invention are
particularly well suited for therapeutic regimens in which multiple
adenoviral-mediated deliveries of transgenes is desired, e.g., in
regimens involving redelivery of the same transgene or in
combination regimens involving delivery of other transgenes. Such
regimens may involve administration of a SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 simian adenoviral vector, followed by
readministration with a vector from the same serotype adenovirus.
Particularly desirable regimens involve administration of a
SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 simian adenoviral
vector, in which the source of the adenoviral capsid sequences of
the vector delivered in the first administration differs from the
source of adenoviral capsid sequences of the viral vector utilized
in one or more of the subsequent administrations. For example, a
therapeutic regimen involves administration of a SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 vector and repeat
administration with one or more adenoviral vectors of the same or
different serotypes. In another example, a therapeutic regimen
involves administration of an adenoviral vector followed by repeat
administration with a SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
vector which has a capsid which differs from the source of the
capsid in the first delivered adenoviral vector, and optionally
further administration with another vector which is the same or,
preferably, differs from the source of the adenoviral capsid of the
vector in the prior administration steps. These regimens are not
limited to delivery of adenoviral vectors constructed using the
SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 simian sequences.
Rather, these regimens can readily utilize vectors other adenoviral
sequences, including, without limitation, other simian adenoviral
sequences, (e.g., Pan9 or C68, C1, etc), other non-human primate
adenoviral sequences, or human adenoviral sequences, in combination
with one or more of the SAdV-36, SAdV-42.1, SAdV-42.2 or SAdV-44
vectors. Examples of such simian, other non-human primate and human
adenoviral serotypes are discussed elsewhere in this document.
Further, these therapeutic regimens may involve either simultaneous
or sequential delivery of SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 adenoviral vectors in combination with non-adenoviral
vectors, non-viral vectors, and/or a variety of other
therapeutically useful compounds or molecules. The invention is not
limited to these therapeutic regimens, a variety of which will be
readily apparent to one of skill in the art.
[0118] B. Ad-Mediated Delivery of Immunogenic Transgenes
[0119] The recombinant SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
vectors may also be employed as immunogenic compositions. As used
herein, an immunogenic composition is a composition to which a
humoral (e.g., antibody) or cellular (e.g., a cytotoxic T cell)
response is mounted to a transgene product delivered by the
immunogenic composition following delivery to a mammal, and
preferably a primate. A recombinant simian Ad can contain in any of
its adenovirus sequence deletions a gene encoding a desired
immunogen. The simian adenovirus is likely to be better suited for
use as a live recombinant virus vaccine in different animal species
compared to an adenovirus of human origin, but is not limited to
such a use. The recombinant adenoviruses can be used as
prophylactic or therapeutic vaccines against any pathogen for which
the antigen(s) crucial for induction of an immune response and able
to limit the spread of the pathogen has been identified and for
which the cDNA is available.
[0120] Such vaccinal (or other immunogenic) compositions are
formulated in a suitable delivery vehicle, as described above.
Generally, doses for the immunogenic compositions are in the range
defined above for therapeutic compositions. The levels of immunity
of the selected gene can be monitored to determine the need, if
any, for boosters. Following an assessment of antibody titers in
the serum, optional booster immunizations may be desired.
[0121] Optionally, a vaccinal composition of the invention may be
formulated to contain other components, including, e.g., adjuvants,
stabilizers, pH adjusters, preservatives and the like. Such
components are well known to those of skill in the vaccine art.
Examples of suitable adjuvants include, without limitation,
liposomes, alum, monophosphoryl lipid A, and any biologically
active factor, such as cytokine, an interleukin, a chemokine, a
ligands, and optimally combinations thereof. Certain of these
biologically active factors can be expressed in vivo, e.g., via a
plasmid or viral vector. For example, such an adjuvant can be
administered with a priming DNA vaccine encoding an antigen to
enhance the antigen-specific immune response compared with the
immune response generated upon priming with a DNA vaccine encoding
the antigen only.
[0122] The recombinant adenoviruses are administered in a "an
immunogenic amount", that is, an amount of recombinant adenovirus
that is effective in a route of administration to transfect the
desired cells and provide sufficient levels of expression of the
selected gene to induce an immune response. Where protective
immunity is provided, the recombinant adenoviruses are considered
to be vaccine compositions useful in preventing infection and/or
recurrent disease.
[0123] Alternatively, or in addition, the vectors of the invention
may contain a transgene encoding a peptide, polypeptide or protein
which induces an immune response to a selected immunogen. The
recombinant SAdV-36, SAdV-42.1, SAdV-42.2 and SAdV-44 vectors are
expected to be highly efficacious at inducing cytolytic T cells and
antibodies to the inserted heterologous antigenic protein expressed
by the vector.
[0124] For example, immunogens may be selected from a variety of
viral families. Example of viral families against which an immune
response would be desirable include, the picornavirus family, which
includes the genera rhinoviruses, which are responsible for about
50% of cases of the common cold; the genera enteroviruses, which
include polioviruses, coxsackieviruses, echoviruses, and human
enteroviruses such as hepatitis A virus; and the genera
apthoviruses, which are responsible for foot and mouth diseases,
primarily in non-human animals. Within the picornavirus family of
viruses, target antigens include the VP1, VP2, VP3, VP4, and VPG.
Another viral family includes the calcivirus family, which
encompasses the Norwalk group of viruses, which are an important
causative agent of epidemic gastroenteritis. Still another viral
family desirable for use in targeting antigens for inducing immune
responses in humans and non-human animals is the togavirus family,
which includes the genera alphavirus, which include Sindbis
viruses, RossRiver virus, and Venezuelan, Eastern & Western
Equine encephalitis, and rubivirus, including Rubella virus. The
flaviviridae family includes dengue, yellow fever, Japanese
encephalitis, St. Louis encephalitis and tick borne encephalitis
viruses. Other target antigens may be generated from the Hepatitis
C or the coronavirus family, which includes a number of non-human
viruses such as infectious bronchitis virus (poultry), porcine
transmissible gastroenteric virus (pig), porcine hemagglutinating
encephalomyelitis virus (pig), feline infectious peritonitis virus
(cats), feline enteric coronavirus (cat), canine coronavirus (dog),
and human respiratory coronaviruses, which may cause the common
cold and/or non-A, B or C hepatitis. Within the coronavirus family,
target antigens include the E1 (also called M or matrix protein),
E2 (also called S or Spike protein), E3 (also called HE or
hemagglutin-elterose) glycoprotein (not present in all
coronaviruses), or N (nucleocapsid). Still other antigens may be
targeted against the rhabdovirus family, which includes the genera
vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general
lyssavirus (e.g., rabies).
[0125] Within the rhabdovirus family, suitable antigens may be
derived from the G protein or the N protein. The family
filoviridae, which includes hemorrhagic fever viruses such as
Marburg and Ebola virus, may be a suitable source of antigens. The
paramyxovirus family includes parainfluenza Virus Type 1,
parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3,
rubulavirus (mumps virus), parainfluenza Virus Type 2,
parainfluenza virus Type 4, Newcastle disease virus (chickens),
rinderpest, morbillivirus, which includes measles and canine
distemper, and pneumovirus, which includes respiratory syncytial
virus. The influenza virus is classified within the family
orthomyxovirus and is a suitable source of antigen (e.g., the HA
protein, the N1 protein). The bunyavirus family includes the genera
bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift
Valley Fever), hantavirus (puremala is a hemahagin fever virus),
nairovirus (Nairobi sheep disease) and various unassigned
bungaviruses. The arenavirus family provides a source of antigens
against LCM and Lassa fever virus. The reovirus family includes the
genera reovirus, rotavirus (which causes acute gastroenteritis in
children), orbiviruses, and cultivirus (Colorado Tick fever,
Lebombo (humans), equine encephalosis, blue tongue).
[0126] The retrovirus family includes the sub-family oncorivirinal
which encompasses such human and veterinary diseases as feline
leukemia virus, HTLVI and HTLVII, lentivirinal (which includes
human immunodeficiency virus (HIV), simian immunodeficiency virus
(SIV), feline immunodeficiency virus (FIV), equine infectious
anemia virus, and spumavirinal). Among the lentiviruses, many
suitable antigens have been described and can readily be selected.
Examples of suitable HIV and SIV antigens include, without
limitation the gag, pol, Vif, Vpx, VPR, Env, Tat, Nef, and Rev
proteins, as well as various fragments thereof. For example,
suitable fragments of the Env protein may include any of its
subunits such as the gp120, gp160, gp41, or smaller fragments
thereof, e.g., of at least about 8 amino acids in length.
Similarly, fragments of the tat protein may be selected. [See, U.S.
Pat. No. 5,891,994 and U.S. Pat. No. 6,193,981.] See, also, the HIV
and SIV proteins described in D. H. Barouch et al, J. Virol.,
75(5):2462-2467 (March 2001), and R. R. Amara, et al, Science,
292:69-74 (6 Apr. 2001). In another example, the HIV and/or SIV
immunogenic proteins or peptides may be used to form fusion
proteins or other immunogenic molecules. See, e.g., the HIV-1 Tat
and/or Nef fusion proteins and immunization regimens described in
WO 01/54719, published Aug. 2, 2001, and WO 99/16884, published
Apr. 8, 1999. The invention is not limited to the HIV and/or SIV
immunogenic proteins or peptides described herein. In addition, a
variety of modifications to these proteins have been described or
could readily be made by one of skill in the art. See, e.g., the
modified gag protein that is described in U.S. Pat. No. 5,972,596.
Further, any desired HIV and/or SIV immunogens may be delivered
alone or in combination. Such combinations may include expression
from a single vector or from multiple vectors. Optionally, another
combination may involve delivery of one or more expressed
immunogens with delivery of one or more of the immunogens in
protein form. Such combinations are discussed in more detail
below.
[0127] The papovavirus family includes the sub-family
polyomaviruses (BKU and JCU viruses) and the sub-family
papillomavirus (associated with cancers or malignant progression of
papilloma). The adenovirus family includes viruses (EX, AD7, ARD,
O.B.) which cause respiratory disease and/or enteritis. The
parvovirus family feline parvovirus (feline enteritis), feline
panleucopeniavirus, canine parvovirus, and porcine parvovirus. The
herpesvirus family includes the sub-family alphaherpesvirinae,
which encompasses the genera simplexvirus (HSVI, HSVII),
varicellovirus (pseudorabies, varicella zoster) and the sub-family
betaherpesvirinae, which includes the genera cytomegalovirus (HCMV,
muromegalovirus) and the sub-family gammaherpesvirinae, which
includes the genera lymphocryptovirus, EBV (Burkitts lymphoma),
infectious rhinotracheitis, Marek's disease virus, and
rhadinovirus. The poxvirus family includes the sub-family
chordopoxvirinae, which encompasses the genera orthopoxvirus
(Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus,
avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the
sub-family entomopoxvirinae. The hepadnavirus family includes the
Hepatitis B virus. One unclassified virus which may be suitable
source of antigens is the Hepatitis delta virus. Still other viral
sources may include avian infectious bursal disease virus and
porcine respiratory and reproductive syndrome virus. The alphavirus
family includes equine arteritis virus and various Encephalitis
viruses.
[0128] Immunogens which are useful to immunize a human or non-human
animal against other pathogens include, e.g., bacteria, fungi,
parasitic microorganisms or multicellular parasites which infect
human and non-human vertebrates, or from a cancer cell or tumor
cell. Examples of bacterial pathogens include pathogenic
gram-positive cocci include pneumococci; staphylococci; and
streptococci. Pathogenic gram-negative cocci include meningococcus;
gonococcus. Pathogenic enteric gram-negative bacilli include
enterobacteriaceae; pseudomonas, acinetobacteria and eikenella;
melioidosis; salmonella; shigella; haemophilus; moraxella; H.
ducreyi (which causes chancroid); brucella; Franisella tularensis
(which causes tularemia); yersinia (pasteurella); streptobacillus
moniliformis and spirillum; Gram-positive bacilli include listeria
monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium
diphtheria (diphtheria); cholera; B. anthracis (anthrax);
donovanosis (granuloma inguinale); and bartonellosis. Diseases
caused by pathogenic anaerobic bacteria include tetanus; botulism;
other clostridia; tuberculosis; leprosy; and other mycobacteria.
Pathogenic spirochetal diseases include syphilis; treponematoses:
yaws, pinta and endemic syphilis; and leptospirosis. Other
infections caused by higher pathogen bacteria and pathogenic fungi
include actinomycosis; nocardiosis; cryptococcosis, blastomycosis,
histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis,
and mucormycosis; sporotrichosis; paracoccidiodomycosis,
petriellidiosis, torulopsosis, mycetoma and chromomycosis; and
dermatophytosis. Rickettsial infections include Typhus fever, Rocky
Mountain spotted fever, Q fever, and Rickettsialpox. Examples of
mycoplasma and chlamydial infections include: mycoplasma
pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal
chlamydial infections. Pathogenic eukaryotes encompass pathogenic
protozoans and helminths and infections produced thereby include:
amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis;
Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis;
giardiasis; trichinosis; filariasis; schistosomiasis; nematodes;
trematodes or flukes; and cestode (tapeworm) infections.
[0129] Many of these organisms and/or toxins produced thereby have
been identified by the Centers for Disease Control [(CDC),
Department of Heath and Human Services, USA], as agents which have
potential for use in biological attacks. For example, some of these
biological agents, include, Bacillus anthracis (anthrax),
Clostridium botulinum and its toxin (botulism), Yersinia pestis
(plague), variola major (smallpox), Francisella tularensis
(tularemia), and viral hemorrhagic fevers [filoviruses (e.g.,
Ebola, Marburg], and arenaviruses [e.g., Lassa, Machupo]), all of
which are currently classified as Category A agents; Coxiella
burnetti (Q fever); Brucella species (brucellosis), Burkholderia
mallei (glanders), Burkholderia pseudomallei (meloidosis), Ricinus
communis and its toxin (ricin toxin), Clostridium perfringens and
its toxin (epsilon toxin), Staphylococcus species and their toxins
(enterotoxin B), Chlamydia psittaci (psittacosis), water safety
threats (e.g., Vibrio cholerae, Crytosporidium parvum), Typhus
fever (Richettsia powazekii), and viral encephalitis (alphaviruses,
e.g., Venezuelan equine encephalitis; eastern equine encephalitis;
western equine encephalitis); all of which are currently classified
as Category B agents; and Nipan virus and hantaviruses, which are
currently classified as Category C agents. In addition, other
organisms, which are so classified or differently classified, may
be identified and/or used for such a purpose in the future. It will
be readily understood that the viral vectors and other constructs
described herein are useful to deliver antigens from these
organisms, viruses, their toxins or other by-products, which will
prevent and/or treat infection or other adverse reactions with
these biological agents.
[0130] Administration of the SAdV-36, SAdV-42.1, SAdV-42.2 and/or
SAdV-44 vectors to deliver immunogens against the variable region
of the T cells is anticipated to elicit an immune response
including CTLs to eliminate those T cells. In RA, several specific
variable regions of TCRs which are involved in the disease have
been characterized. These TCRs include V-3, V-14, V-17 and
V.alpha.-17. Thus, delivery of a nucleic acid sequence that encodes
at least one of these polypeptides will elicit an immune response
that will target T cells involved in RA. In MS, several specific
variable regions of TCRs which are involved in the disease have
been characterized. These TCRs include V-7 and V.alpha.-10. Thus,
delivery of a nucleic acid sequence that encodes at least one of
these polypeptides will elicit an immune response that will target
T cells involved in MS. In scleroderma, several specific variable
regions of TCRs which are involved in the disease have been
characterized. These TCRs include V-6, V-8, V-14 and V.alpha.-16,
V.alpha.-3C, V.alpha.-7, V.alpha.-14, V.alpha.-15, V.alpha.-16,
V.alpha.-28 and V.alpha.-12. Thus, delivery of a recombinant simian
adenovirus that encodes at least one of these polypeptides will
elicit an immune response that will target T cells involved in
scleroderma.
[0131] C. Ad-Mediated Delivery Methods
[0132] The therapeutic levels, or levels of immunity, of the
selected gene can be monitored to determine the need, if any, for
boosters. Following an assessment of CD8+ T cell response, or
optionally, antibody titers, in the serum, optional booster
immunizations may be desired. Optionally, the recombinant SAdV-36,
SAdV-42.1, SAdV-42.2 and/or SAdV-44 vectors may be delivered in a
single administration or in various combination regimens, e.g., in
combination with a regimen or course of treatment involving other
active ingredients or in a prime-boost regimen. A variety of such
regimens have been described in the art and may be readily
selected.
[0133] For example, prime-boost regimens may involve the
administration of a DNA (e.g., plasmid) based vector to prime the
immune system to second, booster, administration with a traditional
antigen, such as a protein or a recombinant virus carrying the
sequences encoding such an antigen. See, e.g., WO 00/11140,
published Mar. 2, 2000, incorporated by reference. Alternatively,
an immunization regimen may involve the administration of a
recombinant SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 vector to
boost the immune response to a vector (either viral or DNA-based)
carrying an antigen, or a protein. In still another alternative, an
immunization regimen involves administration of a protein followed
by booster with a vector encoding the antigen.
[0134] In one embodiment, a method of priming and boosting an
immune response to a selected antigen by delivering a plasmid DNA
vector carrying said antigen, followed by boosting with a
recombinant SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 vector is
described. In one embodiment, the prime-boost regimen involves the
expression of multiproteins from the prime and/or the boost
vehicle. See, e.g., R. R. Amara, Science, 292:69-74 (6 Apr. 2001)
which describes a multiprotein regimen for expression of protein
subunits useful for generating an immune response against HIV and
SIV. For example, a DNA prime may deliver the Gag, Pol, Vif, VPX
and Vpr and Env, Tat, and Rev from a single transcript.
Alternatively, the SIV Gag, Pol and HIV-1 Env is delivered in a
recombinant SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44 adenovirus
construct. Still other regimens are described in WO 99/16884 and WO
01/54719.
[0135] However, the prime-boost regimens are not limited to
immunization for HIV or to delivery of these antigens. For example,
priming may involve delivering with a first SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 vector followed by boosting with a second
Ad vector, or with a composition containing the antigen itself in
protein form. In one example, the prime-boost regimen can provide a
protective immune response to the virus, bacteria or other organism
from which the antigen is derived. In another embodiment, the
prime-boost regimen provides a therapeutic effect that can be
measured using convention assays for detection of the presence of
the condition for which therapy is being administered.
[0136] The priming composition may be administered at various sites
in the body in a dose dependent manner, which depends on the
antigen to which the desired immune response is being targeted. The
amount or situs of injection(s) or to pharmaceutical carrier is not
a limitation. Rather, the regimen may involve a priming and/or
boosting step, each of which may include a single dose or dosage
that is administered hourly, daily, weekly or monthly, or yearly.
As an example, the mammals may receive one or two doses containing
between about 10 .mu.g to about 50 .mu.g of plasmid in carrier. A
desirable amount of a DNA composition ranges between about 1 .mu.g
to about 10,000 .mu.g of the DNA vector. Dosages may vary from
about 1 .mu.g to 1000 .mu.g DNA per kg of subject body weight. The
amount or site of delivery is desirably selected based upon the
identity and condition of the mammal.
[0137] The dosage unit of the vector suitable for delivery of the
antigen to the mammal is described herein. The vector is prepared
for administration by being suspended or dissolved in a
pharmaceutically or physiologically acceptable carrier such as
isotonic saline; isotonic salts solution or other formulations that
will be apparent to those skilled in such administration. The
appropriate carrier will be evident to those skilled in the art and
will depend in large part upon the route of administration. The
compositions described herein may be administered to a mammal
according to the routes described above, in a sustained release
formulation using a biodegradable biocompatible polymer, or by
on-site delivery using micelles, gels and liposomes. Optionally,
the priming step also includes administering with the priming
composition, a suitable amount of an adjuvant, such as are defined
herein.
[0138] Preferably, a boosting composition is administered about 2
to about 27 weeks after administering the priming composition to
the mammalian subject. The administration of the boosting
composition is accomplished using an effective amount of a boosting
composition containing or capable of delivering the same antigen as
administered by the priming DNA vaccine. The boosting composition
may be composed of a recombinant viral vector derived from the same
viral source (e.g., adenoviral sequences of the invention) or from
another source. Alternatively, the "boosting composition" can be a
composition containing the same antigen as encoded in the priming
DNA vaccine, but in the form of a protein or peptide, which
composition induces an immune response in the host. In another
embodiment, the boosting composition contains a DNA sequence
encoding the antigen under the control of a regulatory sequence
directing its expression in a mammalian cell, e.g., vectors such as
well-known bacterial or viral vectors. The primary requirements of
the boosting composition are that the antigen of the composition is
the same antigen, or a cross-reactive antigen, as that encoded by
the priming composition.
[0139] In another embodiment, the SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 vectors are also well suited for use in a variety of
other immunization and therapeutic regimens. Such regimens may
involve delivery of SAdV-36, SAdV-42.1, SAdV-42.2 and/or SAdV-44
vectors simultaneously or sequentially with Ad vectors of different
serotype capsids, regimens in which SAdV-36, SAdV-42.1, SAdV-42.2
and/or SAdV-44 vectors are delivered simultaneously or sequentially
with non-Ad vectors, and regimens in which the SAdV-36, SAdV-42.1,
SAdV-42.2 and/or SAdV-44 vectors are delivered simultaneously or
sequentially with proteins, peptides, and/or other biologically
useful therapeutic or immunogenic compounds. Such uses will be
readily apparent to one of skill in the art.
[0140] The following examples illustrate the cloning of SAdV-36,
SAdV-42.1, SAdV-42.2 and SAdV-44 and the construction of exemplary
recombinant vectors. These examples are illustrative only, and do
not limit the scope of the present invention.
Example 1--Isolation of Simian Adenovirus and PCR Analysis
[0141] A. Simian Adenovirus 36
[0142] Stool samples were recovered from the floors of the Michael
E. Keeling Center for Comparative Medicine and Research, University
of Texas M. D. Anderson Cancer Center) facility that houses the
chimpanzees (Pan troglodytes) and were frozen and sent to
University of Pennsylvania. The samples were thawed and suspended
in Hanks' Balanced Salt solution, the particulates pelleted by
centrifugation, and sterile filtered through 0.2 micron syringe
filters. 100 id of each filtered sample was inoculated into A549
cells grown in Ham's F12 with 10% FBS, 1% Penn-Strep and 50
.mu.g/ml gentamicin. After about 1 to 2 weeks in culture, visual
cytopathic effect (CPE) was obvious in cell cultures with several
of the inocula. The presence of adenoviruses in the cultures was
confirmed by PCR amplification of an internal 1.9 kb of the
hexon--the region encompassing the hypervariable (HVR) regions and
that is predominantly responsible for conferring serotype
specificity. The primer pair that was utilized for PCR was
CAGGATGCTTCGGAGTACCTGAG (SEQ ID NO:126) and
TTGGCNGGDATDGGGTAVAGCATGTT (SEQ ID NO:127). The sequence obtained
from this region was used to make an initial determination of
adenoviral species and novelty of the serotype. The sequence was
determined to be in adenovirus subgroup E.
[0143] Adenoviral isolates that were determined to be novel were
plaque purified on A549 cells, propagated to high titer and
purified on cesium chloride gradients using standard procedures.
Viral DNAs obtained from purified virus preparations were
completely sequenced (Qiagen Genomics Services, Hilden,
Germany).
[0144] A total of 25% (36/142) of the M.D. Anderson samples
demonstrated cytopathology which in each case was confirmed by PCR
to be due to the outgrowth of at least one adenovirus; the assay is
based on amplification of a portion of the hexon gene that spans
hypervariable regions 1 to 6 [L. Crawford-Miksza, et al, J Virol
70, 1836 (March 1996)].
[0145] B. Simian Adenovirus 42.1 (Previously Named SAdV-42)
[0146] Stool samples were recovered from the floors of the San
Diego zoo that houses bonobo apes [Pan paniscus)], were frozen and
sent to University of Pennsylvania. The samples were thawed and
suspended in Hanks' Balanced Salt solution, the particulates
pelleted by centrifugation, and sterile filtered through 0.2 micron
syringe filters. 100 .mu.l of each filtered sample was inoculated
into A549 cells grown in Ham's F12 with 10% FBS, 1% Penn-Strep and
50 .mu.g/ml gentamicin. After about 1 to 2 weeks in culture, visual
cytopathic effect (CPE) was obvious in cell cultures with several
of the inocula. The presence of adenoviruses in the cultures was
confirmed by PCR amplification of an internal 1.9 kb of the
hexon--the region encompassing the hypervariable (HVR) regions and
that is predominantly responsible for conferring serotype
specificity. The primer pair that was utilized for PCR was
CAGGATGCTTCGGAGTACCTGAG (SEQ ID NO:126) and
TTGGCNGGDATDGGGTAVAGCATGTT (SEQ ID NO:127). The sequence obtained
from this region was used to make an initial determination of
adenoviral species and novelty of the serotype. This isolate was
determined to be in adenovirus subgroup C.
[0147] C. Simian Adenovirus 42.2 (Previously Named SAdV-43)
[0148] Stool samples were recovered from the floors of the
Jacksonville, Fla. zoo that houses bonobo apes [Pan paniscus)],
were frozen and sent to University of Pennsylvania. The samples
were thawed and suspended in Hanks' Balanced Salt solution, the
particulates pelleted by centrifugation, and sterile filtered
through 0.2 micron syringe filters. 100 .mu.l of each filtered
sample was inoculated into A549 cells grown in Ham's F12 with 10%
FBS, 1% Penn-Strep and 50 .mu.g/ml gentamicin. After about 1 to 2
weeks in culture, visual cytopathic effect (CPE) was obvious in
cell cultures with several of the inocula. The presence of
adenoviruses in the cultures was confirmed by PCR amplification of
an internal 1.9 kb of the hexon--the region encompassing the
hypervariable (HVR) regions and that is predominantly responsible
for conferring serotype specificity. The primer pair that was
utilized for PCR was CAGGATGCTTCGGAGTACCTGAG (SEQ ID NO:126) and
TTGGCNGGDATDGGGTAVAGCATGTT (SEQ ID NO:127), where "N" represents
any amino acid. The sequence obtained from this region was used to
make an initial determination of adenoviral species and novelty of
the serotype. This isolate was determined to be in adenovirus
subgroup C.
[0149] D. Simian Adenovirus 44
[0150] Stool samples were recovered from the floors of the
Jacksonville, Fla. zoo that houses bonobo apes [Pan paniscus)],
were frozen and sent to University of Pennsylvania. The samples
were thawed and suspended in Hanks' Balanced Salt solution, the
particulates pelleted by centrifugation, and sterile filtered
through 0.2 micron syringe filters. 100 .mu.l of each filtered
sample was inoculated into A549 cells grown in Ham's F12 with 10%
FBS, 1% Penn-Strep and 50 .mu.g/ml gentamicin. After about 1 to 2
weeks in culture, visual cytopathic effect (CPE) was obvious in
cell cultures with several of the inocula. The presence of
adenoviruses in the cultures was confirmed by PCR amplification of
an internal 1.9 kb of the hexon--the region encompassing the
hypervariable (HVR) regions and that is predominantly responsible
for conferring serotype specificity. The primer pair that was
utilized for PCR was CAGGATGCTTCGGAGTACCTGAG (SEQ ID NO:126) and
TTGGCNGGDATDGGGTAVAGCATGTT (SEQ ID NO:127), where "N" represents
any amino acid. The sequence obtained from this region was used to
make an initial determination of adenoviral species and novelty of
the serotype. This isolate was determined to be in adenovirus
subgroup C.
Example 2--Neutralizing Antibody (NAB) in Human Serum to Adenoviral
Isolates
[0151] Serum samples from 50 normal human subjects (obtained from a
blood bank) were tested for their ability to neutralize the ape
adenovirus isolates. The prevalence and magnitude of human serum
neutralizing antibody (NAB) responses to SAdV-36, SAdV-42.2 and
SAdV-44 was determined.
[0152] Serum from each of the human subjects was serially diluted
and the NAB titer for each of SAdV-36, SAdV-42.2 and SAdV-44 was
determined. The frequency of seropositivity in samples having an
NAB titer greater than or equal to 1/20 was determined for SAdV-36,
SAdV-42.2, SAdV-44, along with controls SAdV-24 and HAdV-5. 10% and
28% of samples (NAB greater than or equal to 1/20), were positive
for SAdV-24 and HAdV-5, respectively. 82%, 97% and 68% of samples
(NAB greater than or equal to 1/20) were positive for SAdV-36,
SAdV-42.2 and SAdV-44, respectively.
[0153] Neutralization titers for samples having a NAB titer greater
than or equal to 1/20 were plotted as the reciprocal of serum
dilution, reflecting the breadth of the response and its
distribution for that subset of samples. The median neutralizing
antibody titers for SAdV-36, 42.2, and 44 were found to be more
comparable to SAdV-24 than HAdV-5, i.e., they avoid pre-existing
immunity in human serum.
Example 3--Vector Construction
[0154] A. SAdV-36 (subgroup E)
[0155] An E1 deleted vector using the SAdV-36 (species E) DNA (SEQ
ID NO:1) was prepared as described.
[0156] (i) Construction of pSR6
[0157] A linker containing SmaI, AscI, AvrII, EcoRV sites flanked
by PacI sites is cloned into pBR322 cut with EcoRI and NdeI as
follows. The oligomers
TABLE-US-00003 pSR6 top (SEQ ID NO: 128)
AATTTTAATTAACCCGGGTATCGGCGCGCCTTAACCTAGGGATAGATAT CTTAATTAA and
pSR6 bot (SEQ ID NO: 129)
TATTAATTAAGATATCTATCCCTAGGTTAAGGCGCGCCGATACCCGGGT TAATTAA
were annealed together to create the linker.
[0158] (ii) Cloning of the Viral Left End to the AscI Site
(7959)
[0159] The viral DNA was digested with AscI and the 7958 bp left
end fragment was cloned into pSR6 (prepared as in step (i))
digested with SmaI and AscI to yield pSR6 C36 LE.
[0160] (iii) E1 Functional Deletion and Insertion of I-CeuI and
PI-SceI Sites
[0161] The plasmid pSR6 C36 LE (prepared as in step (ii)) was
digested with SnaBI and NdeI; the NdeI site was filled in with
Klenow. The EcoRV fragment from pBleuSK I-PI was ligated in to
create pSR5 C36 LE IP. This step causes a deletion of the SAdV-36
E1 genes. In place of the E1 deletion, the fragment that was
ligated in harbors recognition sites for the extremely rare cutter
restriction enzymes I-CeuI and PI-SceI respectively. This allows
the subsequent insertion of transgene cassettes in place of the E1
deletion.
[0162] (iv) Cloning of the Viral Right End from the XbaI Site
(30009)
[0163] The plasmid pSR6 C36 LE IP (prepared as in step (iii)) was
digested with XbaI and EcoRV. The 6548 bp right end (XbaI digest)
fragment from the SAdV-36 DNA was ligated in to create pC36 LE IP
RE.
[0164] (v) Cloning of the Viral Middle XbaI Fragment
(6040-30009)
[0165] The plasmid p36 LE IP RE (prepared as in step (iv)) was
digested with XbaI. The 23969 bp fragment from the SAdV-36 DNA was
ligated in to create pC36 IP.
[0166] B. SAdV-42.1 (Subgroup C)
[0167] An E1 deleted vector using the SAdV-42.1 DNA (SEQ ID NO:33)
may be prepared in the same manner as an SAdV-42.2 E1 deleted
vector as described in part "C", below, or by the following
method.
[0168] An E1 deleted vector using the SAdV-42.1 DNA (SEQ ID NO:33)
may be prepared using methods which have been previously described.
A linker containing SmaI, ClaI, XbaI, SpeI, EcoRV sites flanked by
SwaI is cloned into pBR322 cut with EcoRI and NdeI (pSR5). Viral
DNA is digested with XbaI and the 6 kb fragments (left and right
ends) are gel purified and ligated into pSR5 digested with SmaI and
XbaI. 12 minipreps are diagnosed with SmaI and assessed for
expected fragment sizes. Minipreps are sequenced to check the
integrity of the viral DNA end. The sequence obtained is used to
correct the left end Qiagen sequence and deduce the correct right
ITR sequence as well. The plasmid is digested with SnaBI and NdeI
and the NdeI site is filled in with Klenow. The EcoRV fragment from
pBleuSK I-PI is ligated in. Minipreps are diagnosed using PstI. The
resulting plasmid is digested with XbaI and EcoRV. The right end
(XbaI digest) fragment from the SAdV-42.1 DNA is ligated in.
Minipreps are diagnosed using ApaLI. The resulting plasmid is then
digested with XbaI and EcoRV. The left end (XbaI digest) fragment
from the SAdV-42.1 DNA is ligated in and minipreps are diagnosed
using MfeI. 293 cells are then transfected using manufacturer's
protocol.
[0169] C. SAdV-42.2 (Subgroup C)
[0170] An E1 deleted vector using the SAdV-42.2 (subgroup C) DNA
(SEQ ID NO:64) was prepared as described.
[0171] (i) Construction of pSR2
[0172] A linker containing SnaBI, FseI, MluI, PacI and, EcoRV sites
flanked by PmeI sites was cloned into pBR322 cut with EcoRI and
NdeI as follows. The oligomers
TABLE-US-00004 P6 Top (SEQ ID NO: 130)
AATTGTTTAAACTACGTAATTAGGCCGGCCGCGCACGCGTGTCATTAAT
TAAGCTAGATATCGTTTAAAC and P6 Bot (SEQ ID NO: 131)
GTTTAAACGATATCTAGCTTAATTAATGACACGCGTGCGCGGCCGGCCT
AATTACGTAGTTTAAACAT
were annealed together to create the linker.
[0173] (ii) Construction of pSR7
[0174] The plasmid pSR2 (prepared as in step (i)) was digested with
MluI and the annealed oligomers
TABLE-US-00005 (SEQ ID NO: 132)
951top-CGCGCATATGGATCGATCGCTAGCGATCGATCGAATTC and (SEQ ID NO: 133)
951bot-CGCGGAATTCGATCGATCGCTAGCGATCGATCCATATG
were ligated in. This creates a linker harboring SnaBI, FseI, NdeI,
NheI, EcoRI, PacI and EcoRV sites flanked by PmeI sites. In pSR7,
this linker replaces the pBR322 fragment from the EcoRI to the NdeI
sites.
[0175] (iii) Cloning of the Viral Right End
[0176] The 826 bp right end fragment extending from the PacI site
was cloned into pSR7 (prepared as in step (ii)) between the EcoRV
and PacI sites, to yield pSR7 42.2 RE.
[0177] (iv) Construction of E1 Deleted Left End by PCR
[0178] A New England Biolabs (NEB) Phusion.TM. kit was used with
each primer at 0.5 .mu.M, dNTP at 0.2 mM each, NEB Phusion.TM.
enzyme, and buffers (as supplied in kit). PCR conditions (for all
three reactions) were 98.degree. for 30 seconds, and 25 cycles of
[98.degree. for 10 s, anneal for 30 seconds, 72.degree. for 15
seconds].
[0179] PCR 1--the oligomers
TABLE-US-00006 (SEQ ID NO: 134) 42.1-CATCATCAATAATATACCTTATTTTGG
and (SEQ ID NO: 135) 42.2-CCCAGATTACGTATAAAACGGAGACTTTGACCC
were designed to amplify the first 451 bp of the SAdV-42.2 genomic
DNA+10 bp overhang (template--SAdV-42.2 DNA, annealing at
61.degree.):
TABLE-US-00007 (SEQ ID NO: 136)
CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGA
GGTGGGCGGAGCGGGGCGGAGTTGGGAGGCGCGGGGCGGGGCGGCGGCG
CGGGGCGGGCCGGGAGGTGTGGCGGAAGTTGAGTTTGTAAGTGTGGCGG
ATGAGACTTGCTAGCGCCGGATGTGGTAAAAGTGACGTTTTTGGAGTGC
GACAACGCCCACGGGAAGTGACATTTTTCCCGCGGTTTTTACCGGATGT
CGTAGTGAATTTGGGCGTTACCAAGTAAGATTTGGCCATTTTCGCGGGA
AAACTGAAATGGGGAAGTGAAATCTGATTAATTTCGCGTTAGTCATACC
GCGTAATATTTGCCGAGGGCCGAGGGACTTTGACCGATTACGTGGAGGA
ATCGCCCAGGTGTTTTTTGAGGTGAATTTCCGCGTTCCGGGTCAAAGTC
TCCGTTTTATACGTAATCTGGG
[0180] PCR 2--the oligomers
TABLE-US-00008 (SEQ ID NO: 137) 42.3
(CGTTTTATACGTAATCTGGGCAACAGGAGGGGT) and (SEQ ID NO: 138) 42.4
(TCGGTCACATCCAGCATCAC)
were designed to amplify a 242 bp fragment containing to the 229 bp
fragment of SAdV-42.2 (3223 to 3451 bp of the SAdV-42.2 genome) and
a 13 bp overhang harboring a SnaBI site.
TABLE-US-00009 (SEQ ID NO: 139)
CGTTTTATACGTAATCTGGGCAACAGGAGGGGTGTGTTCCTGCCCTATC
AATGCAACTTGAGCCACACCAAGGTCTTGCTAGAGCCCGAAAGCATGTC
CAAGGTGAACCTGAACGGGGTGTTTGACATGACCCTGAAGATATGGAAG
GTGCTGAGGTACGACGAGACCAGGTCTCGGTGCAGGCCCTGCGAGTGCG
GGGGCAAGCATATGAGGAACCAGCCTGTGATGCTGGATGTGACCGA
[0181] There is a 20 bp sequence overlap between PCR 1 and PCR 2
that allows for polymerase chain reaction splicing by overlap
extension (PCR SOEing). A SnaBI site is present at the junction of
the two PCR fragments for insertion of foreign DNA in place of the
functional E1 deletion.
[0182] PCR 3--To combine the products of PCR 1 and PCR 2, 20 .mu.l
of each PCR were run on a 1% SeaPlaque.RTM. gel. The bands were cut
out and the agarose melted at 68.degree.. 5 .mu.l of each melted
gel was combined with 190 .mu.l of water. 4 .mu.l of the diluted
mixture was used as template in a 200 .mu.l PCR reaction using the
primers 42.1 and 42.4, annealing at 61.degree.. The expected
product size was 685 bp.
[0183] (v) Cloning of SAdV-42.2 Left End DNA Fragment Harboring a
Functional E1 Deletion with Insertion of I-CeuI and PI-SceI Sites
to Yield pSR7 C42.2 LE delE1 IP
[0184] The final PCR product was digested with NdeI and ligated
into pSR7 42.2 RE (prepared as in step (iii)) cut with SnaBI and
NdeI to yield pSR7 C42.2 LERE. This plasmid was digested with SnaBI
and an EcoRV fragment from pBleuSK I-PI harboring I-CeuI and
PI-SceI sites was ligated in, to yield pC42.2 LE delE1 IP.
[0185] (vi) Cloning of the SAdV-42 Viral Right End from the EcoRI
Site (33952)
[0186] The SAdV-42.2 viral DNA was digested with EcoRI and the 3767
bp right end fragment was cloned into pSR7 C14 LE delE1 IP
(prepared as in step (v)) between EcoRI and EcoRV to yield pC42.2IP
LE RE.
[0187] (vii) Cloning of the SAdV-42.2 Viral Nde I (3416-19843)
Fragment
[0188] The plasmid pC42.2IP LE RE (prepared as in step (vi)) was
digested with NdeI and the 16427 bp viral NdeI fragment was ligated
in. The clone was called pC42.2 del Mlu Pac.
[0189] (viii) Cloning of the SAdV-42.2 Viral MluI (12534)-PacI
(37000) Fragment
[0190] The plasmid pC42.2 del Mlu Pac (prepared as in step (vii))
was digested with MluI and PacI and the 24466 bp viral MluI-PacI
fragment was ligated in. The clone was called pC42.2 IP and is a
molecular clone of SAdV-42.2 genomic DNA harboring an E1 deletion
and I-CeuI and PI-SceI recognition sites in place of the E1
deletion.
[0191] D. SAdV-44 (Subgroup C)
[0192] An E1 deleted vector using the SAdV-42.2 (subgroup C) DNA
(SEQ ID NO: 95) was prepared as described.
[0193] (i) Construction of pSR2
[0194] A linker containing SnaBI, FseI, MluI, PacI and, EcoRV sites
flanked by PmeI sites was cloned into pBR322 cut with EcoRI and
NdeI as follows. The oligomers
TABLE-US-00010 P6 Top (SEQ ID NO: 130)
AATTGTTTAAACTACGTAATTAGGCCGGCCGCGCACGCGTGTCATTAAT
TAAGCTAGATATCGTTTAAAC and P6 Bot (SEQ ID NO: 131)
GTTTAAACGATATCTAGCTTAATTAATGACACGCGTGCGCGGCCGGCCT
AATTACGTAGTTTAAACAT
were annealed together to create the linker.
[0195] (ii) Cloning of the Viral Left End by PCR
[0196] The left end (PCR, 480 bp+24 bp extension) was cloned into
pSR2 between SnaBI and MluI using the following primers.
TABLE-US-00011 (SEQ ID NO: 134) forward
primer-pCATCATCAATAATATACCTTATTTTGG (SEQ ID NO: 140) reverse
primer-GATCACGCGTCATGCATGCATATGAATACACTCC GCGTCAGCTG
[0197] The underlined bases in the reverse primer sequence
correspond to recognition sites for MluI and NdeI respectively.
This plasmid yielded was pSR2 C44 LE.
[0198] (iii) Cloning of the Viral Right End
[0199] The 821 bp right end fragment of SAdV-44 extending from the
PacI site was cloned into pSR2 C44 LE (prepared as in step (ii))
between the EcoRV and PacI sites, to yield pSR2 44 LERE.
[0200] (iv) Cloning of the SAdV-44 Viral NdeI (3413) to MluI
(12528) Fragment
[0201] The SAdV-44 viral DNA was digested with NdeI and MluI and
the 9115 bp fragment was cloned into pSR2 44 LERE (prepared as in
step (iii)) between NdeI and MluI to yield pSR2 C44 LERE-2.
[0202] (v) Cloning of the SAdV-44 Viral MluI (12528)-PacI (36891)
Fragment
[0203] The plasmid pSR2 C44 LERE-2 (prepared as in step (iv)) was
digested with MluI and PacI and the 24363 bp viral MluI-PacI
fragment was ligated in. The clone was called pC44 IP and is a
molecular clone of SAdV-44 genomic DNA harboring an E1 deletion and
I-CeuI and PI-SceI recognition sites in place of the E1
deletion.
Example 4--Insertion of Influenza A Nucleoprotein Expression
Cassette
[0204] The nucleotide sequence encoding the H1N1 influenza A virus
nucleoprotein (NP) (A/Puerto Rico/8/34/Mount Sinai, GenBank
accession number AF389119.1) was codon optimized and completely
synthesized (Celtek Genes, Nashville, Tenn.). An expression
cassette (approximately 2.5 kb) composed of the human
cytomegalovirus early promoter, an artificial intron derived from
the Promega (Madison, Wis.) plasmid pCI, the codon optimized
influenza A NP coding sequence and the bovine growth hormone
polyadenylation signal was constructed in a shuttle plasmid.
[0205] The expression cassette was cut out with the restriction
enzymes I-CeuI and PI-SceI and inserted into the plasmid SAdV-36,
SAdV-42.2 and SAdV-44 molecular clones obtained as described in
Example 3 (above). The resulting molecular clones (harboring the
expression cassette for influenza nucleoprotein (NP)) were
transfected into the E1 trans-complementing cell line HEK 293, and
recombinant SAdV-36, SAdV-42.2 and SAdV-44 harboring the NP
expression cassette were rescued. Adenovirus was purified by cesium
chloride density gradient centrifugation and the particle titer
determined by measuring absorbance at 260 and 280 nm.
Example 5--T Cell Induction by Recombinant SAdV-36 Expressing
Influenza A Nucleoprotein (NP)
[0206] The protocols contained in Roy, et al. ["Partial protection
against H5N1 influenza in mice with a single dose of a chimpanzee
adenovirus vector expressing nucleoprotein", Vaccine 25:6845-6851
(Aug. 6, 2007)], which is herein incorporated by reference, were
utilized in the following experiment.
[0207] A. Inoculation of Mice
[0208] BALB/c mice (6-8 weeks old) were purchased from Charles
River Laboratories (Wilmington, Mass.). The chimpanzee adenovirus
vectors C36 CMV PI FluA NP (prepared as described in Example 4) and
the human HAdV-5 vector AdH5-FluA NP (prepared consistent with
Example 4) were used to vaccinate BALB/c mice (5 mice per group).
Mice were sedated with intra-peritoneal ketamine/xylazine, and the
total adenovirus dose (1011 viral particles per mouse) divided into
two 25 .mu.l injections given intra-muscularly to the hind leg
tibialis anterior.
[0209] B. Analysis of CD8+ T Lymphocytes from Immunized BALB/c
Mice
[0210] Vaccinated mice were sacrificed 10 days following
immunization and their and their CD8+ T cells were analyzed by
stimulating with the immunodominant peptide TYQRTRALV (SEQ ID
NO:141) of influenza nucleoprotein and staining for the cytokines
interferon gamma (IFN-.gamma.), interleukin-2 (IL-2) and tumor
necrosis factor-.alpha. (TNF-.alpha.). It was of interest to
determine the subset of the CD8+ T cells that were polyfunctional,
i.e., capable of secreting multiple cytokines such as IL-2 and
TNF-.alpha., which may be an indication of the quality of the T
cell response especially with respect to the formation of a memory
population. Splenocytes from 5 mice per group were assayed. The
results are shown in FIG. 1.
[0211] The vector based on SAdV-36 is similar to that based on
HAdV-5 in its ability to elicit a T cell response against the
vaccine immunogen (influenza A nucleoprotein).
[0212] All documents recited above, the Sequence Listing, US Patent
Application Nos.: 61/067,993, 61/068,027, 61/068,024, and
61/068,069, all filed Mar. 4, 2008, International Patent
Application No. PCT/US2009/001344, filed Mar. 3, 2009, U.S. patent
application Ser. No. 12/920,648, filed Sep. 2, 2010, and U.S.
patent application Ser. No. 13/899,037, filed May 21, 2013, are
incorporated herein by reference. Numerous modifications and
variations are included in the scope of the above-identified
specification and are expected to be obvious to one of skill in the
art. Such modifications and alterations to the compositions and
processes, such as selections of different minigenes or selection
or dosage of the vectors or immune modulators are believed to be
within the scope of the claims appended hereto.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20170183636A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20170183636A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References