U.S. patent application number 15/228852 was filed with the patent office on 2017-06-22 for skin permeating and cell entering (space) peptides and methods of use thereof.
The applicant listed for this patent is The Regents of the University of California. Invention is credited to Tracy Hsu, Samir M. Mitragotri.
Application Number | 20170173173 15/228852 |
Document ID | / |
Family ID | 46051476 |
Filed Date | 2017-06-22 |
United States Patent
Application |
20170173173 |
Kind Code |
A1 |
Hsu; Tracy ; et al. |
June 22, 2017 |
Skin Permeating and Cell Entering (SPACE) Peptides and Methods of
Use Thereof
Abstract
The present disclosure provides peptides and peptide
compositions, which facilitate the delivery of an active agent or
an active agent carrier wherein the compositions are capable of
penetrating the stratum corneum (SC) and/or the cellular membranes
of viable cells.
Inventors: |
Hsu; Tracy; (Carlsbad,
CA) ; Mitragotri; Samir M.; (Santa Barbara,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
Oakland |
CA |
US |
|
|
Family ID: |
46051476 |
Appl. No.: |
15/228852 |
Filed: |
August 4, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14262453 |
Apr 25, 2014 |
9441014 |
|
|
15228852 |
|
|
|
|
13952525 |
Jul 26, 2013 |
8791062 |
|
|
14262453 |
|
|
|
|
13253796 |
Oct 5, 2011 |
8518871 |
|
|
13952525 |
|
|
|
|
61528036 |
Aug 26, 2011 |
|
|
|
61527574 |
Aug 25, 2011 |
|
|
|
61411884 |
Nov 9, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/46 20130101;
C12N 2310/14 20130101; C07K 7/06 20130101; C07K 7/64 20130101; A61K
9/127 20130101; A61P 17/00 20180101; C12N 15/1136 20130101; C12N
15/1137 20130101; A61K 47/6929 20170801; C12N 2310/3513 20130101;
A61K 38/00 20130101; A61K 47/64 20170801; A61P 37/02 20180101; C07K
7/08 20130101; A61K 39/395 20130101; C12N 2320/32 20130101; A61K
49/0056 20130101; A61K 38/164 20130101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 49/00 20060101 A61K049/00; A61K 38/16 20060101
A61K038/16; A61K 39/395 20060101 A61K039/395; C07K 16/46 20060101
C07K016/46; A61K 9/127 20060101 A61K009/127; C12N 15/113 20060101
C12N015/113 |
Goverment Interests
GOVERNMENT RIGHTS
[0002] This invention was made with Government support under
Federal Grant No. 1UO1 HL080718 awarded by the National Institutes
of Health and Federal Grant No. 1S10RR017753-01 awarded by the
National Center for Research Resources. The Government has certain
rights in this invention.
Claims
1.-138. (canceled)
139. A composition comprising a peptide comprising the amino acid
sequence HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ
ID NO:4), TDPNQLQ (SEQ ID NO:5), STHFIDT (SEQ ID NO:6); the amino
acid sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID
NO:5, or SEQ ID NO:6, wherein one or more of the amino acids of SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6,
respectively, is replaced with a conservative amino acid
substitution; or the amino acid sequence of ACTGSTQHQCG (SEQ ID
NO:13), wherein one or more of the amino acids of SEQ ID NO:13 is
replaced with a conservative amino acid substitution, wherein the
peptide is associated with or conjugated to an active agent or an
active agent carrier comprising the active agent, and wherein the
composition is capable of penetrating a stratum corneum (SC) layer
when contacted therewith or penetrating a cell when contacted
therewith.
140. The composition of claim 139, wherein the peptide is
associated with an active agent or an active agent carrier
comprising the active agent, and wherein the association results
from hydrophobic, electrostatic or van der Walls interactions.
141. The composition of claim 139, wherein the peptide is a cyclic
peptide comprising a Cys-Cys disulfide bond.
142. The composition of claim 139, wherein the composition is
capable of penetrating the cellular membrane of viable non-human
animal cells or of penetrating the cellular membrane of viable
human cells.
143. The composition of claim 139, wherein the composition is
capable of penetrating the cellular membrane of viable epidermal or
dermal cells.
144. The composition of claim 139, wherein the active agent
comprises a macromolecule.
145. The composition of claim 144, wherein the macromolecule
comprises a protein.
146. The composition of claim 145, wherein the protein comprises an
antibody or a fragment thereof comprising at least one
paratope.
147. The composition of claim 144, wherein the macromolecule
comprises a nucleic acid.
148. The composition of claim 147, wherein the nucleic acid is RNA
and the RNA is interfering RNA.
149. The composition of claim 148, wherein the interfering RNA is
shRNA, miRNA or siRNA.
150. The composition of claim 149, wherein the interfering RNA is
siRNA, and the siRNA is a mutation-specific siRNA.
151. The composition of claim 139, wherein the active agent is a
pharmaceutical compound.
152. The composition of claim 139, wherein the active agent
comprises a detectable agent.
153. The composition of claim 139, wherein the active agent is a
nanoparticle.
154. The composition of claim 139, wherein the active agent is a
low molecular weight compound.
155. The composition of claim 139, wherein the peptide is
conjugated to an active agent carrier comprising the active
agent.
156. The composition of claim 155, wherein the active agent carrier
is a liposome, a nanoparticle, or a polymeric micelle.
157. The composition of claim 139, wherein the peptide is from 6 to
30 amino acids in length.
158. The composition of claim 157, wherein the peptide is from 6 to
20 amino acids in length.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application Nos. 61/411,884, filed Nov. 9, 2010, and entitled
"Peptides to Facilitate Drug Delivery"; 61/527,574, filed Aug. 25,
2011, and entitled "Skin Permeating and Cell Entering (SPACE)
Peptides and Methods of Use Thereof"; and 61/528,036, filed Aug.
26, 2011, and entitled "Skin Permeating and Cell Entering (SPACE)
Peptides and Methods of Use Thereof", which applications are
incorporated by reference herein in their entireties and for all
purposes.
BACKGROUND
[0003] Skin, the largest organ of the human body, is a host to
numerous dermatological diseases which collectively represent a
large category of human health conditions. Accordingly, successful
delivery of therapeutics, e.g., macromolecules such as siRNA, into
skin has become a topic of active research and development. The
goal of topical siRNA delivery, however, is extremely challenging
and with some exceptions, has been very difficult to accomplish.
The primary challenge is poor skin penetration of macromolecules.
Among various physico-chemical methods proposed to enhance
penetration of macromolecules, peptide carriers have emerged as
potential candidates owing to their simplicity of use, diversity
and potential ability to target cellular sub-types within the skin.
Several peptides including TAT, polyarginine, meganin, and
penetratin, which were initially identified for delivering drugs
into the cytoplasm of cells, have been tested for penetration
across the stratum corneum (SC) and a few have shown some efficacy
in delivering small molecules into the epidermis. In contrast, only
one peptide, TD-1, has been specifically shown to penetrate the SC
and possess the ability to enhance systemic uptake of topically
applied drugs. Although several peptides are known to penetrate
cellular membranes and a few to penetrate the SC, peptides that
simultaneously enhance the penetration of macromolecules and other
actives across the SC and/or across the cellular membranes of
viable epidermal and dermal cells are needed.
SUMMARY OF THE INVENTION
[0004] The present disclosure provides peptides and peptide
compositions which facilitate the delivery of an active agent or an
active agent carrier wherein the compositions are capable of
penetrating the SC and/or the cellular membranes of viable
cells.
[0005] In a first aspect, the present disclosure provides a
composition including a peptide including the amino acid sequence
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ
ID NO:6), wherein the peptide is conjugated to an active agent or
an active agent carrier including the active agent, and wherein the
composition is capable of penetrating a stratum corneum (SC) layer
when contacted therewith or penetrating a cell when contacted
therewith.
[0006] In one embodiment of the first aspect, the composition is
capable of penetrating the stratum corneum (SC) layer and
penetrating the cell.
[0007] In one embodiment of the first aspect, the amino acid
sequence includes CTGSTQHQC (SEQ ID NO:7), CHSALTKHC (SEQ ID NO:8),
CKTGSHNQC (SEQ ID NO:9), CMGPSSMLC (SEQ ID NO:10), CTDPNQLQC (SEQ
ID NO:11), or CSTHFIDTC (SEQ ID NO:12).
[0008] In one embodiment of the first aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0009] In one embodiment of the first aspect, the composition is
capable of penetrating the cellular membrane of viable non-human
animal cells.
[0010] In one embodiment of the first aspect, the composition is
capable of penetrating the cellular membrane of viable human
cells.
[0011] In one embodiment of the first aspect, the composition is
capable of penetrating the cellular membrane of viable epidermal or
dermal cells.
[0012] In one embodiment of the first aspect, the composition is
capable of penetrating the cellular membrane of viable
immunological cells.
[0013] In one embodiment of the first aspect, the active agent
includes a macromolecule. In one embodiment, the macromolecule
includes a protein. In one embodiment, the protein includes an
antibody or a fragment thereof including at least one paratope.
[0014] In one embodiment of the first aspect, where the active
agent includes a macromolecule, the macromolecule includes a
nucleic acid. In one embodiment, the nucleic acid is DNA. In one
embodiment, the nucleic acid is RNA. In one embodiment, where the
nucleic acid is RNA, the RNA is interfering RNA. In one embodiment,
where the RNA is interfering RNA, the interfering RNA is shRNA. In
one embodiment, where the RNA is interfering RNA, the interfering
RNA is miRNA. In one embodiment, where the RNA is interfering RNA,
the interfering RNA is siRNA. In one embodiment, where the
interfering RNA is siRNA, the siRNA is IL-10 siRNA. In one
embodiment, where the interfering RNA is siRNA, the siRNA is CD86
siRNA. In one embodiment, where the interfering RNA is siRNA, the
siRNA is KRT6a siRNA. In one embodiment, where the interfering RNA
is siRNA, the siRNA is TNFR1 siRNA. In one embodiment, where the
interfering RNA is siRNA, the siRNA is TACE siRNA. In one
embodiment, where the interfering RNA is siRNA, the siRNA is a
mutation-specific siRNA.
[0015] In one embodiment of the first aspect, the active agent is a
pharmaceutical compound.
[0016] In one embodiment of the first aspect, the active agent
includes a detectable agent. In one embodiment, where the active
agent includes a detectable agent, the detectable agent includes a
fluorescent label. In one embodiment, where the active agent
includes a detectable agent, the detectable agent includes a
radioactive label.
[0017] In one embodiment of the first aspect, the active agent is a
nanoparticle.
[0018] In one embodiment of the first aspect, the active agent is a
low molecular weight compound.
[0019] In one embodiment of the first aspect, the active agent is
an inhibitor of IL-10 biological activity. In one embodiment, where
the active agent is an inhibitor of IL-10 biological activity, the
active agent is selected from an IL-10 siRNA and antibodies or
fragments thereof that bind IL-10.
[0020] In one embodiment of the first aspect, the peptide is
conjugated to the active agent.
[0021] In one embodiment of the first aspect, the peptide is
conjugated to an active agent carrier including the active agent.
In one embodiment, where the peptide is conjugated to an active
agent carrier including the active agent, the active agent carrier
is a liposome. In one embodiment, where the peptide is conjugated
to an active agent carrier including the active agent, the active
agent carrier is a nanoparticle. In one embodiment, where the
peptide is conjugated to an active agent carrier including the
active agent, the active agent carrier is a polymeric micelle.
[0022] In a second aspect, the present disclosure provides a
composition including a peptide including the amino acid sequence
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ
ID NO:6), wherein the peptide is associated with an active agent or
an active agent carrier including the active agent, wherein the
association results from hydrophobic, electrostatic or van der
Walls interactions, and wherein the composition is capable of
penetrating a stratum corneum (SC) layer when contacted therewith
or penetrating a cell when contacted therewith.
[0023] In one embodiment of the second aspect, the composition is
capable of penetrating the stratum corneum (SC) layer and
penetrating the cell.
[0024] In one embodiment of the second aspect, the amino acid
sequence includes CTGSTQHQC (SEQ ID NO:7), CHSALTKHC (SEQ ID NO:8),
CKTGSHNQC (SEQ ID NO:9), CMGPSSMLC (SEQ ID NO:10), CTDPNQLQC (SEQ
ID NO:11), or CSTHFIDTC (SEQ ID NO:12).
[0025] In one embodiment of the second aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0026] In a third aspect, the present disclosure provides a
composition including a peptide including an amino acid sequence
including a stretch of three consecutive amino acids selected from
one of the following amino acid sequences TGSTQHQ (SEQ ID NO:1),
HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID
NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the
peptide is conjugated to an active agent or an active agent carrier
including the active agent, and wherein the composition is capable
of penetrating a stratum corneum (SC) layer when contacted
therewith or penetrating a cell when contacted therewith.
[0027] In one embodiment of the third aspect, the composition is
capable of penetrating the stratum corneum (SC) layer and
penetrating the cell.
[0028] In one embodiment of the third aspect, the amino acid
sequence includes a stretch of four consecutive amino acids
selected from one of the following amino acid sequences TGSTQHQ
(SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3),
MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID
NO:6).
[0029] In one embodiment of the third aspect, the amino acid
sequence includes a stretch of five consecutive amino acids
selected from one of the following amino acid sequences TGSTQHQ
(SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3),
MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID
NO:6).
[0030] In one embodiment of the third aspect, the amino acid
sequence includes a stretch of six consecutive amino acids selected
from one of the following amino acid sequences TGSTQHQ (SEQ ID
NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ
ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6).
[0031] In a fourth aspect, the present disclosure provides a
composition including a peptide including an amino acid sequence
including a stretch of three consecutive amino acids selected from
one of the following amino acid sequences TGSTQHQ (SEQ ID NO:1),
HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID
NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the
peptide is associated with an active agent or an active agent
carrier including the active agent, wherein the association results
from hydrophobic, electrostatic or van der Walls interactions, and
wherein the composition is capable of penetrating a stratum corneum
(SC) layer when contacted therewith or penetrating a cell when
contacted therewith.
[0032] In one embodiment of the fourth aspect, the composition is
capable of penetrating the stratum corneum (SC) layer and
penetrating the cell.
[0033] In one embodiment of the fourth aspect, the amino acid
sequence includes a stretch of four consecutive amino acids
selected from one of the following amino acid sequences TGSTQHQ
(SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3),
MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID
NO:6).
[0034] In one embodiment of the fourth aspect, the amino acid
sequence includes a stretch of five consecutive amino acids
selected from one of the following amino acid sequences TGSTQHQ
(SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3),
MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID
NO:6).
[0035] In one embodiment of the fourth aspect, the amino acid
sequence includes a stretch of six consecutive amino acids selected
from one of the following amino acid sequences TGSTQHQ (SEQ ID
NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ
ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6).
[0036] In a fifth aspect, the present disclosure provides an
isolated peptide including an amino acid sequence selected from one
of the following sequences: ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG
(SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID
NO:16), ACTDPNQLQCG (SEQ ID NO:17), and ACSTHFIDTCG (SEQ ID
NO:18).
[0037] In one embodiment of the fifth aspect, the peptide includes
repeat units of one or more of ACTGSTQHQCG (SEQ ID NO:13),
ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG
(SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), and ACSTHFIDTCG (SEQ ID
NO:18). In one embodiment, where the peptide includes repeat units
of one or more of ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), and ACSTHFIDTCG (SEQ ID NO:18), the
unit is repeated 2 to 50 times. In one embodiment, where the
peptide includes repeat units of one or more of ACTGSTQHQCG (SEQ ID
NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), and
ACSTHFIDTCG (SEQ ID NO:18), each unit is separated by an
intervening peptide sequence.
[0038] In one embodiment of the fifth aspect, the peptide is a
cyclic peptide including a Cys-Cys disulfide bond.
[0039] In a sixth aspect, the present disclosure provides an
isolated polypeptide including repeat units of one or more of
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and STHFIDT
(SEQ ID NO:6).
[0040] In one embodiment of the sixth aspect, the unit is repeated
2 to 50 times.
[0041] In one embodiment of the sixth aspect, each unit is
separated by an intervening peptide sequence.
[0042] In a seventh aspect, the present disclosure provides an
isolated polypeptide consisting essentially of repeat units of one
or more of TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ
(SEQ ID NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and
STHFIDT (SEQ ID NO:6). In one embodiment, where the isolated
polypeptide consists essentially of repeat units of one or more of
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and STHFIDT
(SEQ ID NO:6).
[0043] In an eighth aspect, the present disclosure provides a
method of delivering an active agent to a subject, including:
administering to the subject a composition including a peptide
including the amino acid sequence TGSTQHQ (SEQ ID NO:1), HSALTKH
(SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID NO:4),
TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the peptide
is conjugated to an active agent or an active agent carrier
including the active agent, and wherein the composition is capable
of penetrating the stratum corneum (SC) of the subject or
penetrating a cell of the subject.
[0044] In one embodiment of the eighth aspect, the composition is
capable of penetrating the stratum corneum (SC) of the subject and
penetrating the cell of the subject.
[0045] In one embodiment of the eighth aspect, the administration
is topical administration.
[0046] In one embodiment of the eighth aspect, the amino acid
sequence includes CTGSTQHQC (SEQ ID NO:7), CHSALTKHC (SEQ ID NO:8),
CKTGSHNQC (SEQ ID NO:9), CMGPSSMLC (SEQ ID NO:10), CTDPNQLQC (SEQ
ID NO:11), or CSTHFIDTC (SEQ ID NO:12).
[0047] In one embodiment of the eighth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0048] In one embodiment of the eighth aspect, the composition is
capable of penetrating the cellular membrane of viable non-human
animal cells.
[0049] In one embodiment of the eighth aspect, the composition is
capable of penetrating the cellular membrane of viable human
cells.
[0050] In one embodiment of the eighth aspect, the composition is
capable of penetrating the cellular membrane of viable epidermal or
dermal cells.
[0051] In one embodiment of the eighth aspect, the composition is
capable of penetrating the cellular membrane of viable
immunological cells.
[0052] In one embodiment of the eighth aspect, the active agent
includes a macromolecule. In one embodiment, the macromolecule
includes a protein. In one embodiment, the protein includes an
antibody or a fragment thereof including at least one paratope.
[0053] In one embodiment of the eighth aspect, where the active
agent includes a macromolecule, the macromolecule includes a
nucleic acid. In one embodiment, the nucleic acid is DNA. In one
embodiment, the nucleic acid is RNA. In one embodiment, where the
nucleic acid is RNA, the RNA is interfering RNA. In one embodiment,
where the RNA is interfering RNA, the interfering RNA is shRNA. In
one embodiment, where the RNA is interfering RNA, the interfering
RNA is miRNA. In one embodiment, where the RNA is interfering RNA,
the interfering RNA is siRNA. In one embodiment, where the
interfering RNA is siRNA, the siRNA is IL-10 siRNA. In one
embodiment, where the interfering RNA is siRNA, the siRNA is CD86
siRNA. In one embodiment, where the interfering RNA is siRNA, the
siRNA is KRT6a siRNA. In one embodiment, where the interfering RNA
is siRNA, the siRNA is TNFR1 siRNA. In one embodiment, where the
interfering RNA is siRNA, the siRNA is TACE siRNA. In one
embodiment, where the interfering RNA is siRNA, the siRNA is a
mutation-specific siRNA.
[0054] In one embodiment of the eighth aspect, the active agent is
a pharmaceutical compound.
[0055] In one embodiment of the eighth aspect, the active agent
includes a detectable agent. In one embodiment, where the active
agent includes a detectable agent, the detectable agent includes a
fluorescent label. In one embodiment, where the active agent
includes a detectable agent, the detectable agent includes a
radioactive label.
[0056] In one embodiment of the eighth aspect, the active agent is
a nanoparticle.
[0057] In one embodiment of the eighth aspect, the active agent is
a low molecular weight compound.
[0058] In one embodiment of the eighth aspect, the active agent is
an inhibitor of IL-10 biological activity. In one embodiment, where
the active agent is an inhibitor of IL-10 biological activity, the
active agent is selected from an IL-10 siRNA and antibodies or
fragments thereof that bind IL-10.
[0059] In one embodiment of the eighth aspect, the peptide is
conjugated to the active agent.
[0060] In one embodiment of the eighth aspect, the peptide is
conjugated to an active agent carrier including the active agent.
In one embodiment, where the peptide is conjugated to an active
agent carrier including the active agent, the active agent carrier
is a liposome. In one embodiment, where the peptide is conjugated
to an active agent carrier including the active agent, the active
agent carrier is a nanoparticle. In one embodiment, where the
peptide is conjugated to an active agent carrier including the
active agent, the active agent carrier is a polymeric micelle.
[0061] In a ninth aspect, the present disclosure provides a method
of delivering an active agent to a subject, including:
administering to the subject a composition including a peptide
including the amino acid sequence TGSTQHQ (SEQ ID NO:1), HSALTKH
(SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID NO:4),
TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the peptide
is associated with an active agent or an active agent carrier
including the active agent, wherein the association results from
hydrophobic, electrostatic or van der Walls interactions, and
wherein the composition is capable of penetrating the stratum
corneum (SC) of the subject or penetrating a cell of the
subject.
[0062] In one embodiment of the ninth aspect, the composition is
capable of penetrating the stratum corneum (SC) of the subject and
penetrating the cell of the subject.
[0063] In one embodiment of the ninth aspect, the administration is
topical administration.
[0064] In one embodiment of the ninth aspect, the amino acid
sequence includes CTGSTQHQC (SEQ ID NO:7), CHSALTKHC (SEQ ID NO:8),
CKTGSHNQC (SEQ ID NO:9), CMGPSSMLC (SEQ ID NO:10), CTDPNQLQC (SEQ
ID NO:11), or CSTHFIDTC (SEQ ID NO:12).
[0065] In one embodiment of the ninth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0066] In a tenth aspect, the present disclosure provides a method
of treating a subject having a dermatological disease, including:
administering to the subject a composition including a peptide
including the amino acid sequence TGSTQHQ (SEQ ID NO:1), HSALTKH
(SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID NO:4),
TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the peptide
is conjugated to a dermatological active agent or a dermatological
active agent carrier including the active agent, and wherein the
composition is capable of penetrating the stratum corneum (SC) of
the subject or penetrating a cell of the subject.
[0067] In one embodiment of the tenth aspect, the composition is
capable of penetrating the stratum corneum (SC) of the subject and
penetrating the cell of the subject.
[0068] In one embodiment of the tenth aspect, the administration is
topical administration.
[0069] In one embodiment of the tenth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0070] In an eleventh aspect, the present disclosure provides a
method of treating a subject having a dermatological disease,
including: administering to the subject a composition including a
peptide including the amino acid sequence TGSTQHQ (SEQ ID NO:1),
HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML (SEQ ID
NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6), wherein the
peptide is associated with a dermatological active agent or a
dermatological active agent carrier including the active agent,
wherein the association results from hydrophobic, electrostatic or
van der Walls interactions, and wherein the composition is capable
of penetrating the stratum corneum (SC) of the subject or
penetrating a cell of the subject.
[0071] In one embodiment of the eleventh aspect, the composition is
capable of penetrating the stratum corneum (SC) of the subject and
penetrating the cell of the subject.
[0072] In one embodiment of the eleventh aspect, the administration
is topical administration.
[0073] In one embodiment of the eleventh aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0074] In a twelfth aspect, the present disclosure provides a
method of treating a subject having, suspected of having or
susceptible to a disorder resulting at least in part from
expression of an mRNA, including administering to the subject a
composition including a peptide including the amino acid sequence
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ
ID NO:6), wherein the peptide is conjugated to an interfering RNA
which targets the mRNA or a carrier including the interfering RNA,
wherein the composition is capable of penetrating the stratum
corneum (SC) of the subject or a cell of the subject, and wherein
the expression of the mRNA is attenuated thereby.
[0075] In one embodiment of the twelfth aspect, the composition is
capable of penetrating the stratum corneum (SC) of the subject and
penetrating the cell of the subject.
[0076] In one embodiment of the twelfth aspect, the administration
is topical administration.
[0077] In one embodiment of the twelfth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0078] In a thirteenth aspect, the present disclosure provides a
method of treating a subject having, suspected of having or
susceptible to a disorder resulting at least in part from
expression of an mRNA, including administering to the subject a
composition including a peptide including the amino acid sequence
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ
ID NO:6), wherein the peptide is associated with an interfering RNA
which targets the mRNA or a carrier including the interfering RNA,
wherein the association results from hydrophobic, electrostatic or
van der Walls interactions, wherein the composition is capable of
penetrating the stratum corneum (SC) of the subject or a cell of
the subject, and wherein the expression of the mRNA is attenuated
thereby.
[0079] In one embodiment of the thirteenth aspect, the composition
is capable of penetrating the stratum corneum (SC) of the subject
and penetrating the cell of the subject.
[0080] In one embodiment of the thirteenth aspect, the
administration is topical administration.
[0081] In one embodiment of the thirteenth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0082] In a fourteenth aspect, the present disclosure provides a
method of attenuating expression of an mRNA of a subject in need
thereof, including administering to the subject a composition
including a peptide including the amino acid sequence TGSTQHQ (SEQ
ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML
(SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6),
wherein the peptide is conjugated to an siRNA targeted to the mRNA
or a carrier including the siRNA targeted to the mRNA, wherein the
composition is capable of penetrating the stratum corneum (SC) of
the subject or a cell of the subject, and wherein the expression of
the mRNA is attenuated thereby.
[0083] In one embodiment of the fourteenth aspect, the mRNA is an
IL-10 mRNA and the siRNA is an IL-10 siRNA.
[0084] In one embodiment of the fourteenth aspect, the mRNA is a
CD86 mRNA and the siRNA is a CD86 siRNA.
[0085] In one embodiment of the fourteenth aspect, the mRNA is a
KRT6a mRNA and the siRNA is KRT6a siRNA.
[0086] In one embodiment of the fourteenth aspect, the mRNA is a
TNFR1 mRNA and the siRNA is a TNFR1 siRNA.
[0087] In one embodiment of the fourteenth aspect, the mRNA is a
TACE mRNA and the siRNA is a TACE siRNA.
[0088] In one embodiment of the fourteenth aspect, the composition
is capable of penetrating the stratum corneum (SC) and penetrating
the cell of the subject.
[0089] In one embodiment of the fourteenth aspect, the
administration is topical administration.
[0090] In one embodiment of the fourteenth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0091] In a fifteenth aspect, the present disclosure provides a
method of attenuating expression of an mRNA of a subject in need
thereof, including administering to the subject a composition
including a peptide including the amino acid sequence TGSTQHQ (SEQ
ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3), MGPSSML
(SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or STHFIDT (SEQ ID NO:6),
wherein the peptide is associated with an siRNA targeted to the
mRNA or a carrier including the siRNA targeted to the mRNA, wherein
the association results from hydrophobic, electrostatic or van der
Walls interactions, wherein the composition is capable of
penetrating the stratum corneum (SC) of the subject or a cell of
the subject, and wherein the expression of the mRNA is attenuated
thereby.
[0092] In one embodiment of the fifteenth aspect, the mRNA is an
IL-10 mRNA and the siRNA is an IL-10 siRNA.
[0093] In one embodiment of the fifteenth aspect, the mRNA is a
CD86 mRNA and the siRNA is a CD86 siRNA.
[0094] In one embodiment of the fifteenth aspect, the mRNA is a
KRT6a mRNA and the siRNA is KRT6a siRNA.
[0095] In one embodiment of the fifteenth aspect, the mRNA is a
TNFR1 mRNA and the siRNA is a TNFR1 siRNA.
[0096] In one embodiment of the fifteenth aspect, the mRNA is a
TACE mRNA and the siRNA is a TACE siRNA.
[0097] In one embodiment of the fifteenth aspect, the composition
is capable of penetrating the stratum corneum (SC) of the subject
and penetrating the cell of the subject.
[0098] In one embodiment of the fifteenth aspect, the
administration is topical administration.
[0099] In one embodiment of the fifteenth aspect, the amino acid
sequence includes ACTGSTQHQCG (SEQ ID NO:13), ACHSALTKHCG (SEQ ID
NO:14), ACKTGSHNQCG (SEQ ID NO:15), ACMGPSSMLCG (SEQ ID NO:16),
ACTDPNQLQCG (SEQ ID NO:17), or ACSTHFIDTCG (SEQ ID NO:18). In one
embodiment, where the amino acid sequence includes ACTGSTQHQCG (SEQ
ID NO:13), ACHSALTKHCG (SEQ ID NO:14), ACKTGSHNQCG (SEQ ID NO:15),
ACMGPSSMLCG (SEQ ID NO:16), ACTDPNQLQCG (SEQ ID NO:17), or
ACSTHFIDTCG (SEQ ID NO:18), the peptide is a cyclic peptide
including a Cys-Cys disulfide bond.
[0100] In a sixteenth embodiment, the present disclosure provides a
composition including a peptide consisting essentially of the amino
acid sequence TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ
(SEQ ID NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) or
STHFIDT (SEQ ID NO:6), wherein the peptide is conjugated to an
active agent or an active agent carrier including the active agent,
and wherein the composition is capable of penetrating a stratum
corneum (SC) layer when contacted therewith or penetrating a cell
when contacted therewith.
[0101] Other aspects and embodiments will be readily apparent to
the ordinarily skilled artisan upon reading the present
specification.
BRIEF DESCRIPTION OF THE DRAWINGS
[0102] FIG. 1 shows the identification of skin penetrating peptides
through in vitro phage display in porcine skin. (a) Phage library
was applied in the donor compartment of a FDC. Phage found to
penetrate through skin into the receiver compartment were
collected, amplified, and used for the subsequent rounds of
screening. The skin penetrating ability of individual clones was
confirmed through diffusion experiments and confocal microscopy. To
confirm the peptide's ability to penetrate skin, the peptide was
isolated from the phage and its penetration into skin was confirmed
visually through confocal microscopy, (b) Percentage of occurrence
for each high frequency peptide sequence from Rounds 3 through 5 of
the phage display screen, (c,d) Confocal microscopy images of the
skin penetration profiles of SPACE and control peptide into porcine
skin respectively. (e,f) Skin penetration profiles of Alexa Fluor
488 labeled streptavidin conjugated to biotinylated SPACE peptide
and Alexa Fluor 488 streptavidin alone respectively. Insets show
zoomed in views of the sections highlighted in the main images.
Scale bar=200 .mu.m.
[0103] FIG. 2 shows confocal microcopy images depicting penetration
of fluorescently labeled molecules through skin. (a,b) Penetration
of fluorescently labeled phage displaying peptides into porcine
skin. (c,d) Penetration of biotinylated peptide-streptavidin coated
quantum dots into porcine skin. (e,f) Penetration of fluorescently
labeled peptide into human skin. (g,h) Top view (looking down on
SC) of fluorescently labeled peptide in human skin. (a,c,e,g)
represent images of SPACE peptide and (b,d,f,h) represent images of
control peptide. Scale bar=200 .mu.m.
[0104] FIG. 3 shows images of the penetration of fluorescently
labeled peptide into mouse skin in vivo after 30 minutes. Three
representative images are provided for each case. (a-c) Penetration
of fluorescently labeled control peptide and (d-f) fluorescently
SPACE peptide. Scale bar=50 .mu.m.
[0105] FIG. 4 shows images of the penetration of fluorescently
labeled peptide into mouse skin in vivo after 2 hours. Three
representative images are provided for each case. (a-c) Penetration
of fluorescently labeled control peptide and (d-f) fluorescently
labeled SPACE peptide. Scale bar=50 .mu.m.
[0106] FIG. 5 shows image results for the binding of fluorescently
labeled peptide to delipidized stratum corneum (a,b) and FTIR
spectra of stratum corneum before and after treatment with peptide
(c-f). Images of delipidized SC under UV (a) and visible light
(different samples) (b). (i, ii, iii) represent the SPACE peptide,
control peptide and no peptide respectively. Scale bar=1 cm. Note
that the stratum corneum samples shown above were delipidized to
ensure a comparison of binding ability and not transport ability of
the peptides. Hence, the difference between the control and SPACE
peptide as seen above may not directly translate to their effect on
skin penetration. (c,d) 1400-1700 cm.sup.-1 region of spectra for
the SPACE peptide and control peptide respectively. (e,f) 2800-3000
cm.sup.-1 region of the spectra for the SPACE peptide and control
peptide respectively. Initial and final spectra indicated by
arrows.
[0107] FIG. 6 provides FTIR spectra of amide I and amide II region
for stratum corneum before and after treatment with no peptide.
[0108] FIG. 7 shows graphical results for inulin permeability and
the electrical conductivity enhancement of porcine skin after
co-incubation with control (CP) and SPACE peptide.
[0109] FIG. 8 shows the cellular penetration of SPACE peptide into
various cell lines. (a,c,e) Confocal images of cells treated with
no peptide (b,d,f) and cells incubated with fluorescently labeled
SPACE peptide for 24 hours. (a,b) Human keratinocytes, (c,d) Human
fibroblasts, and (e,f) Human Umbilical Vein Endothelial Cells
(HUVEC). (g) Magnified image of SPACE peptide internalization in
human keratinocytes. (h) Average fluorescence intensity of control
peptide (open bars) and SPACE peptide (closed bars) internalization
after 24 hours in HUVEC, fibroblasts and keratinocytes. Error bars
indicate SD (N> or =30). Scale bar=100 .mu.m (a-f) and 20 .mu.m
(g).
[0110] FIG. 9 shows image results for the Penetration of
fluorescently labeled peptide into MDA-MBA-231 human breast cancer
cells after 6 hours (a-c). Images of cells with no peptide (a),
control peptide (b), and SPACE peptide (c). Scale bar=50 .mu.m,
FIG. 7 also shows confocal images of GFP-expressing endothelial
cells after treatment with GFP siRNA complexed with Lipofectamine
(d-f). (d) Treatment of cells with Lipofectamine only (no siRNA),
(e) with Lipofectamine complexed with GFP siRNA, and (f) with
Lipofectamine complexed with SPACE-GFP siRNA. Scale bar=200
.mu.m.
[0111] FIG. 10 shows the results for cellular mechanism and
toxicity studies. (a) Peptide internalization (percent of control)
for control peptide and SPACE peptide at 4.degree. C. and with the
endocytosis inhibitors deoxy-D-glucose, chlorpromazine, nystatin,
and EIPA in human keratinocytes. (b) Cell proliferation of human
keratinocytes in the presence of control peptide (open bars) or
SPACE peptide (closed bars) at 0.1 mg/mL and 1.0 mg/mL. Error cars
indicate SD (N=4).
[0112] FIG. 11 shows the results for delivery of siRNA using the
SPACE peptide. (a) Percentage knockdown of GPF in GFP-expres sing
endothelial cells. Error bars indicate SD (N> or =30), (b)
Percentage knockdown of IL-10 protein levels in mice 24 hours after
treatment. Error bars indicate SE (N> or =3), NS-not
significantly different (p>0.15), (c) Percentage knockdown of
GAPDH protein levels in mice 72 hours after treatment. Error bars
indicate SE (N> or =3), (d) Dose dependence of GAPDH knockdown
upon topical siRNA application. Error bars indicate SE (N> or
=3).
[0113] FIG. 12 shows the results for GAPDH knockdown at various
application times using peptide-conjugated GAPDH siRNA. The
reduction in GAPDH protein levels after SPACE-GAPDH siRNA
application times of 4, 24, and 72 hours.
DEFINITIONS
[0114] Before the present invention is further described, it is to
be understood that this invention is not limited to particular
embodiments described, as such may, of course, vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0115] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0116] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, exemplary methods and materials are now described. All
publications and applications mentioned herein are incorporated by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited. To the extent any
of the applications or publications incorporated by reference
herein conflict with the instant disclosure, the instant disclosure
controls.
[0117] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a peptide" includes a plurality of such
peptides and reference to the "agent" includes reference to one or
more agents and equivalents thereof known to those skilled in the
art, and so forth.
[0118] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
[0119] It will be appreciated that throughout this present
disclosure reference is made to amino acids according to the single
letter or three letter code. For the reader's convenience, the
single and three letter amino acid code is provided below:
TABLE-US-00001 G Glycine Gly P Proline Pro A Alanine Ala V Valine
Val L Leucine Leu I Isoleucine Ile M Methionine Met C Cysteine Cys
F Phenylalanine Phe Y Tyrosine Tyr W Tryptophan Trp H Histidine His
K Lysine Lys R Arginine Arg Q Glutamine Gln N Asparagine Asn E
Glutamic Acid Glu D Aspartic Acid Asp S Serine Ser T Threonine
Thr
[0120] As used herein, the term "active agent" means an agent,
e.g., a protein, peptide, nucleic acid (including, e.g.,
nucleotides, nucleosides and analogues thereof) or small molecule
drug, that provides a desired pharmacological effect upon
administration to a subject, e.g., a human or a non-human animal,
either alone or in combination with other active or inert
components. Included in the above definition are precursors,
derivatives, analogues and pro-drugs of active agents. The term
"active agent" may also be used herein to refer generally to any
agent, e.g., a protein, peptide, nucleic acid (including, e.g.,
nucleotides, nucleosides and analogues thereof) or small molecule
drug, conjugated or associated with a penetrating peptide as
described herein or attached to or encompassed by an active agent
carrier as described herein.
[0121] The term "conjugated" as used in the context of the
penetrating peptide compositions described herein refers to a
covalent or ionic interaction between two entities, e.g.,
molecules, compounds or combinations thereof.
[0122] The term "associated" as used in the context of the
penetrating peptide compositions described herein refers to a
non-covalent interaction between two entities, e.g., molecules,
compounds or combinations thereof mediated by one or more of
hydrophobic, electrostatic, and van der Walls interactions.
[0123] The terms "polypeptide" and "protein", used interchangeably
herein, refer to a polymeric form of amino acids of any length,
which can include coded and non-coded amino acids, chemically or
biochemically modified or derivatized amino acids, and polypeptides
having modified peptide backbones. The term includes fusion
proteins, including, but not limited to, fusion proteins with a
heterologous amino acid sequence, fusions with heterologous and
native leader sequences, with or without N-terminal methionine
residues; immunologically tagged proteins; fusion proteins with
detectable fusion partners, e.g., fusion proteins including as a
fusion partner a fluorescent protein, .beta.-galactosidase,
luciferase, etc.; and the like.
[0124] The terms "antibody" and "immunoglobulin" include antibodies
or immunoglobulins of any isotype, fragments of antibodies which
retain specific binding to antigen, including, but not limited to,
Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized
antibodies, single-chain antibodies, and fusion proteins including
an antigen-binding portion of an antibody and a non-antibody
protein. The antibodies may be detectably labeled, e.g., with a
radioisotope, an enzyme which generates a detectable product, a
fluorescent protein, and the like. The antibodies may be further
conjugated to other moieties, such as members of specific binding
pairs, e.g., biotin (member of biotin-avidin specific binding
pair), and the like. Also encompassed by the terms are Fab', Fv,
F(ab').sub.2, and other antibody fragments that retain specific
binding to antigen.
[0125] Antibodies may exist in a variety of other forms including,
for example, Fv, Fab, and (Fab').sub.2, as well as bi-functional
(i.e. bi-specific) hybrid antibodies (e.g., Lanzavecchia et al.,
Eur. J. Immunol. 17, 105 (1987)) and in single chains (e.g., Huston
et al., Proc. Natl. Acad. Sci. U.S.A., 85, 5879-5883 (1988) and
Bird et al., Science, 242, 423-426 (1988), which are incorporated
herein by reference). (See, generally, Hood et al., Immunology,
Benjamin, N.Y., 2nd ed. (1984), and Hunkapiller and Hood, Nature,
323, 15-16 (1986).
[0126] The terms "nucleic acid", "nucleic acid molecule" and
"polynucleotide" are used interchangeably and refer to a polymeric
form of nucleotides of any length, either deoxyribonucleotides or
ribonucleotides, or analogs thereof. The terms encompass, e.g.,
DNA, RNA and modified forms thereof. Polynucleotides may have any
three-dimensional structure, and may perform any function, known or
unknown. Non-limiting examples of polynucleotides include a gene, a
gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA,
ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides,
branched polynucleotides, plasmids, vectors, isolated DNA of any
sequence, control regions, isolated RNA of any sequence, nucleic
acid probes, and primers. The nucleic acid molecule may be linear
or circular.
[0127] "RNA interference" (RNAi) is a process by which
double-stranded RNA (dsRNA) is used to silence gene expression.
Without intending to be bound by any particular theory, RNAi begins
with the cleavage of longer dsRNAs into small interfering RNAs
(siRNAs) by dicer, an RNaseIII-like enzyme. siRNAs are dsRNAs that
are generally about 19 to 28 nucleotides, or 20 to 25 nucleotides,
or 21 to 23 nucleotides in length and often contain 2-3 nucleotide
3' overhangs, and 5' phosphate and 3' hydroxyl termini. One strand
of the siRNA is incorporated into a ribonucleoprotein complex known
as the RNA-induced silencing complex (RISC). RISC uses this siRNA
strand to identify mRNA molecules that are at least partially
complementary to the incorporated siRNA strand, and then cleaves
these target mRNAs or inhibits their translation. The siRNA strand
that is incorporated into RISC is known as the guide strand or the
antisense strand. The other siRNA strand, known as the passenger
strand or the sense strand, is eliminated from the siRNA and is at
least partially homologous to the target mRNA. Those of skill in
the art will recognize that, in principle, either strand of an
siRNA can be incorporated into RISC and function as a guide strand.
However, siRNA may be designed (e.g., via decreased siRNA duplex
stability at the 5' end of the antisense strand) to favor
incorporation of the antisense strand into RISC.
[0128] RISC-mediated cleavage of mRNAs having a sequence at least
partially complementary to the guide strand leads to a decrease in
the steady state level of that mRNA and of the corresponding
protein encoded by the mRNA. Alternatively, RISC can also decrease
expression of the corresponding protein via translational
repression without cleavage of the target mRNA. Other RNA molecules
can interact with RISC and silence gene expression. Examples of
other RNA molecules that can interact with RISC include short
hairpin RNAs (shRNAs), single-stranded siRNAs, microRNAs (miRNAs),
and dicer-substrate 27-mer duplexes, RNA molecules containing one
or more chemically modified nucleotides, one or more
deoxyribonucleotides, and/or one or more non-phosphodiester
linkages. The term "siRNA" as used herein refers to a
double-stranded interfering RNA unless otherwise noted. For
purposes of the present discussion, all RNA molecules that can
interact with RISC and participate in RISC-mediated changes in gene
expression will be referred to as "interfering RNAs." siRNAs,
shRNAs, miRNAs, and dicer-substrate 27-mer duplexes are, therefore,
subsets of "interfering RNAs.
[0129] A "substitution" results from the replacement of one or more
amino acids or nucleotides by different amino acids or nucleotides,
respectively as compared to an amino acid sequence or nucleotide
sequence of a polypeptide. If a substitution is conservative, the
amino acid that is substituted into a polypeptide has similar
structural or chemical properties (e.g., charge, polarity,
hydrophobicity, and the like) to the amino acid that it is
substituting. Conservative substitutions of naturally occurring
amino acids usually result in a substitution of a first amino acid
with second amino acid from the same group as the first amino acid,
where exemplary amino acid groups are as follows: (1) acidic
(negatively charged) amino acids such as aspartic acid and glutamic
acid; (2) basic (positively charged) amino acids such as arginine,
histidine, and lysine; (3) neutral polar amino acids such as
glycine, serine, threonine, cysteine, tyrosine, asparagine, and
glutamine; and (4) neutral non-polar amino acids such as alanine,
leucine, isoleucine, valine, proline, phenylalanine, tryptophan,
and methionine. In some embodiments, polypeptide variants may have
"non-conservative" changes, where the substituted amino acid
differs in structural and/or chemical properties.
[0130] A "deletion" is defined as a change in either amino acid or
nucleotide sequence in which one or more amino acid or nucleotide
residues, respectively, are absent as compared to an amino acid
sequence or nucleotide sequence of a naturally occurring
polypeptide. In the context of a polypeptide or polynucleotide
sequence, a deletion can involve deletion of 2, 5, 10, up to 20, up
to 30 or up to 50 or more amino acids, taking into account the
length of the polypeptide or polynucleotide sequence being
modified.
[0131] An "insertion" or "addition" is that change in an amino acid
or nucleotide sequence which has resulted in the addition of one or
more amino acid or nucleotide residues, respectively, as compared
to an amino acid sequence or nucleotide sequence of a naturally
occurring polypeptide. "Insertion" generally refers to addition to
one or more amino acid residues within an amino acid sequence of a
polypeptide, while "addition" can be an insertion or refer to amino
acid residues added at the N- or C-termini. In the context of a
polypeptide or polynucleotide sequence, an insertion or addition
may be of up to 10, up to 20, up to 30 or up to 50 or more amino
acids.
[0132] "Non-native", "non-endogenous", and "heterologous", in the
context of a polypeptide, are used interchangeably herein to refer
to a polypeptide having an amino acid sequence or, in the context
of an expression system or a viral particle, present in an
environment different to that found in nature.
[0133] "Exogenous" in the context of a nucleic acid or polypeptide
is used to refer to a nucleic acid or polypeptide that has been
introduced into a host cell. "Exogenous" nucleic acids and
polypeptides can be native or non-native to the host cell, where an
exogenous, native nucleic acid or polypeptide provides for elevated
levels of the encoded gene product or polypeptide in the
recombinant host cell relative to that found in the host cell prior
to introduction of the exogenous molecule.
[0134] As used herein, the terms "determining," "measuring,"
"assessing," and "assaying" are used interchangeably and include
both quantitative and qualitative determinations.
[0135] As used herein the term "isolated," when used in the context
of an isolated compound, refers to a compound of interest that is
in an environment different from that in which the compound
naturally occurs. "Isolated" is meant to include compounds that are
within samples that are substantially enriched for the compound of
interest and/or in which the compound of interest is partially or
substantially purified.
[0136] As used herein, the term "substantially pure" refers to a
compound that is removed from its natural environment and is at
least 60% free, 75% free, or 90% free from other components with
which it is naturally associated.
[0137] A "coding sequence" or a sequence that "encodes" a selected
polypeptide, is a nucleic acid molecule which is transcribed (in
the case of DNA) and translated (in the case of mRNA) into a
polypeptide, for example, in-vivo when placed under the control of
appropriate regulatory sequences (or "control elements"). The
boundaries of the coding sequence are typically determined by a
start codon at the 5' (amino) terminus and a translation stop codon
at the 3' (carboxy) terminus. A coding sequence can include, but is
not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA,
genomic DNA sequences from viral or prokaryotic DNA, and synthetic
DNA sequences. A transcription termination sequence may be located
3' to the coding sequence. Other "control elements" may also be
associated with a coding sequence. A DNA sequence encoding a
polypeptide can be optimized for expression in a selected cell by
using the codons preferred by the selected cell to represent the
DNA copy of the desired polypeptide coding sequence.
[0138] "Encoded by" refers to a nucleic acid sequence which codes
for a gene product, such as a polypeptide. Where the gene product
is a polypeptide, the polypeptide sequence or a portion thereof
contains an amino acid sequence of at least 3 to 5 amino acids, 8
to 10 amino acids, or at least 15 to 20 amino acids from a
polypeptide encoded by the nucleic acid sequence.
[0139] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. In the case of a promoter, a promoter that is
operably linked to a coding sequence will have an effect on the
expression of a coding sequence. The promoter or other control
elements need not be contiguous with the coding sequence, so long
as they function to direct the expression thereof. For example,
intervening untranslated yet transcribed sequences can be present
between the promoter sequence and the coding sequence and the
promoter sequence can still be considered "operably linked" to the
coding sequence.
[0140] By "nucleic acid construct" it is meant a nucleic acid
sequence that has been constructed to comprise one or more
functional units not found together in nature. Examples include
circular, linear, double-stranded, extrachromosomal DNA molecules
(plasmids), cosmids (plasmids containing COS sequences from lambda
phage), viral genomes including non-native nucleic acid sequences,
and the like.
[0141] A "vector" is capable of transferring gene sequences to
target cells. Typically, "vector construct," "expression vector,"
and "gene transfer vector," mean any nucleic acid construct capable
of directing the expression of a gene of interest and which can
transfer gene sequences to target cells, which can be accomplished
by genomic integration of all or a portion of the vector, or
transient or inheritable maintenance of the vector as an
extrachromosomal element. Thus, the term includes cloning, and
expression vehicles, as well as integrating vectors.
[0142] An "expression cassette" includes any nucleic acid construct
capable of directing the expression of a gene/coding sequence of
interest, which is operably linked to a promoter of the expression
cassette. Such cassettes can be constructed into a "vector,"
"vector construct," "expression vector," or "gene transfer vector,"
in order to transfer the expression cassette into target cells.
Thus, the term includes cloning and expression vehicles, as well as
viral vectors.
[0143] Techniques for determining nucleic acid and amino acid
"sequence identity" are known in the art. Typically, such
techniques include determining the nucleotide sequence of the mRNA
for a gene and/or determining the amino acid sequence encoded
thereby, and comparing these sequences to a second nucleotide or
amino acid sequence. In general, "identity" refers to an exact
nucleotide-to-nucleotide or amino acid-to-amino acid correspondence
of two polynucleotides or polypeptide sequences, respectively. Two
or more sequences (polynucleotide or amino acid) can be compared by
determining their "percent identity." The percent identity of two
sequences, whether nucleic acid or amino acid sequences, is the
number of exact matches between two aligned sequences divided by
the length of the shorter sequences and multiplied by 100. An
approximate alignment for nucleic acid sequences is provided by the
local homology algorithm of Smith and Waterman, Advances in Applied
Mathematics, 2:482-489 (1981). This algorithm can be applied to
amino acid sequences by using the scoring matrix developed by
Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff
ed., 5 suppl. 3:353-358, National Biomedical Research Foundation,
Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res.
14(6):6745-6763 (1986).
[0144] An exemplary implementation of this algorithm to determine
percent identity of a sequence is provided by the Genetics Computer
Group (Madison, Wis.) in the "BestFit" utility application. The
default parameters for this method are described in the Wisconsin
Sequence Analysis Package Program Manual, Version 8 (1995)
(available from Genetics Computer Group, Madison, Wis.). Another
method of establishing percent identity in the context of the
present invention is to use the MPSRCH package of programs
copyrighted by the University of Edinburgh, developed by John F.
Collins and Shane S. Sturrok, and distributed by IntelliGenetics,
Inc. (Mountain View, Calif.). From this suite of packages the
Smith-Waterman algorithm can be employed where default parameters
are used for the scoring table (for example, gap open penalty of
12, gap extension penalty of one, and a gap of six). From the data
generated the "Match" value reflects "sequence identity." Other
suitable programs for calculating the percent identity or
similarity between sequences are generally known in the art, for
example, another alignment program is BLAST, used with default
parameters. For example, BLASTN and BLASTP can be used using the
following default parameters: genetic code=standard; filter=none;
strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50
sequences; sort by=HIGH SCORE; Databases=non-redundant,
GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss
protein+Spupdate+PIR. Details of these programs can be found at the
internet address located by placing http:// in front of
blast.ncbi.nlm.nih.gov/Blast.cgi.
[0145] Alternatively, in the context of polynucleotides, homology
can be determined by hybridization of polynucleotides under
conditions that form stable duplexes between homologous regions,
followed by digestion with single-stranded-specific nuclease(s),
and size determination of the digested fragments.
[0146] Two DNA, or two polypeptide sequences are "substantially
homologous" to each other when the sequences exhibit at least about
80%-85%, at least about 85%-90%, at least about 90%-95%, or at
least about 95%-98% sequence identity over a defined length of the
molecules, as determined using the methods above. As used herein,
substantially homologous also refers to sequences showing complete
identity to the specified DNA or polypeptide sequence. DNA
sequences that are substantially homologous can be identified in a
Southern hybridization experiment under, for example, stringent
conditions, as defined for that particular system. Defining
appropriate hybridization conditions is within the skill of the
art. See, e.g., Sambrook and Russel, Molecular Cloning: A
Laboratory Manual Third Edition, (2001) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.
[0147] A first polynucleotide is "derived from" a second
polynucleotide if it has the same or substantially the same
nucleotide sequence as a region of the second polynucleotide, its
cDNA, complements thereof, or if it displays sequence identity as
described above. This term is not meant to require or imply the
polynucleotide must be obtained from the origin cited (although
such is encompassed), but rather can be made by any suitable
method.
[0148] A first polypeptide (or peptide) is "derived from" a second
polypeptide (or peptide) if it is (i) encoded by a first
polynucleotide derived from a second polynucleotide, or (ii)
displays sequence identity to the second polypeptides as described
above. This term is not meant to require or imply the polypeptide
must be obtained from the origin cited (although such is
encompassed), but rather can be made by any suitable method.
[0149] The term "in combination with" as used herein refers to uses
where, for example, a first therapy is administered during the
entire course of administration of a second therapy; where the
first therapy is administered for a period of time that is
overlapping with the administration of the second therapy, e.g.
where administration of the first therapy begins before the
administration of the second therapy and the administration of the
first therapy ends before the administration of the second therapy
ends; where the administration of the second therapy begins before
the administration of the first therapy and the administration of
the second therapy ends before the administration of the first
therapy ends; where the administration of the first therapy begins
before administration of the second therapy begins and the
administration of the second therapy ends before the administration
of the first therapy ends; where the administration of the second
therapy begins before administration of the first therapy begins
and the administration of the first therapy ends before the
administration of the second therapy ends. As such, "in
combination" can also refer to regimen involving administration of
two or more therapies. "In combination with" as used herein also
refers to administration of two or more therapies which may be
administered in the same or different formulations, by the same or
different routes, and in the same or different dosage form
type.
[0150] The terms "treatment", "treating", "treat", and the like,
refer to obtaining a desired pharmacologic and/or physiologic
effect. The effect may be prophylactic in terms of completely or
partially preventing a disease or symptom thereof and/or may be
therapeutic in terms of a partial or complete cure for a disease
and/or adverse effect attributable to the disease. "Treatment", as
used herein, covers any treatment of a disease in a mammal,
particularly in a human, and includes: (a) preventing the disease
from occurring in a subject which may be predisposed to the disease
but has not yet been diagnosed as having it; (b) inhibiting the
disease, i.e., arresting its development or progression; and (c)
relieving the disease, i.e., causing regression of the disease
and/or relieving one or more disease symptoms. "Treatment" is also
meant to encompass delivery of an agent in order to provide for a
pharmacologic effect, even in the absence of a disease or
condition. For example, "treatment" encompasses delivery of a
penetrating peptide composition that can elicit an immune response
or confer immunity in the absence of a disease condition, e.g., in
the case of a vaccine.
[0151] "Subject", "host" and "patient" are used interchangeably
herein, to refer to an animal, human or non-human, amenable to
therapy according to the methods of the disclosure or to which a
peptide composition according to the present disclosure may be
administered to achieve a desired effect. Generally, the subject is
a mammalian subject.
[0152] The term "dermatitis," as used herein, refers to
inflammation of the skin and includes, for example, allergic
contact dermatitis, urticaria, asteatotic dermatitis (dry skin on
the lower legs), atopic dermatitis, contact dermatitis including
irritant contact dermatitis and urushiol-induced contact
dermatitis, eczema, gravitational dermatitis, nummular dermatitis,
otitis externa, perioral dermatitis, and seborrhoeic
dermatitis.
[0153] The term "stratum corneum" refers to the horny outer layer
of the epidermis, consisting of several layers of flat,
keratinized, nonnucleated, dead or peeling cells.
[0154] As used in the claims, the term "comprising", which is
synonymous with "including", "containing", and "characterized by",
is inclusive or open-ended and does not exclude additional,
unrecited elements and/or method steps. "Comprising" is a term of
art that means that the named elements and/or steps are present,
but that other elements and/or steps can be added and still fall
within the scope of the relevant subject matter.
[0155] As used herein, the phrase "consisting of" excludes any
element, step, and/or ingredient not specifically recited. For
example, when the phrase "consists of" appears in a clause of the
body of a claim, rather than immediately following the preamble, it
limits only the element set forth in that clause; other elements
are not excluded from the claim as a whole.
[0156] As used herein, the phrase "consisting essentially of"
limits the scope of the related disclosure or claim to the
specified materials and/or steps, plus those that do not materially
affect the basic and novel characteristic(s) of the disclosed
and/or claimed subject matter. For example, the peptides of the
presently disclosed subject matter in some embodiments can "consist
essentially of" a core amino acid sequence, which means that the
peptide can include one or more (e.g., 1, 2, 3, 4, 5, 6, or more)
N-terminal and/or C-terminal amino acids the presence of which does
not materially affect the desired biological activity of the
peptide.
[0157] With respect to the terms "comprising", "consisting
essentially of", and "consisting of", where one of these three
terms is used herein, the presently disclosed subject matter can
include the use of either of the other two terms. For example, the
presently disclosed subject matter relates in some embodiments to
compositions comprising the amino acid sequence TGSTQHQ (SEQ ID
NO:1). It is understood that the presently disclosed subject matter
thus also encompasses peptides that in some embodiments consist
essentially of the amino acid sequence TGSTQHQ (SEQ ID NO:1); as
well as peptides that in some embodiments consist of the amino acid
sequence TGSTQHQ (SEQ ID NO. 1) Similarly, it is also understood
that the methods of the presently disclosed subject matter in some
embodiments comprise the steps that are disclosed herein and/or
that are recited in the claims, that they in some embodiments
consist essentially of the steps that are disclosed herein and/or
that are recited in the claims, and that they in some embodiments
consist of the steps that are disclosed herein and/or that are
recited in the claim.
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS OF THE INVENTION
[0158] The disclosure is directed to peptides which both alone and
when conjugated to or associated with an active agent or an active
agent carrier are capable of penetrating the SC and/or the cellular
membranes of viable cells such as epidermal and dermal cells.
Related compositions and methods are also described herein.
[0159] Penetrating Peptides
[0160] The present disclosure provides peptides that are capable of
penetrating the SC and/or penetrating viable cells following
administration. These peptides are referred to herein as
"penetrating peptides". In some embodiments, these penetrating
peptides are capable of penetrating the cellular membranes of
viable epidermal and dermal cells. Penetrating peptides according
to the present disclosure may include, for example, one or more of
the amino acid sequences provided in Table 1 below.
TABLE-US-00002 TABLE 1 TGSTQHQ CTGSTQHQC ACTGSTQHQCG (SEQ ID NO: 1)
(SEQ ID NO: 7) (SEQ ID NO: 13) HSALTKH CHSALTKHC ACHSALTKHCG (SEQ
ID NO: 2) (SEQ ID NO: 8) (SEQ ID NO: 14) KTGSHNQ CKTGSHNQC
ACKTGSHNQCG (SEQ ID NO: 3) (SEQ ID NO: 9) (SEQ ID NO: 15) MGPSSML
CMGPSSMLC ACMGPSSMLCG (SEQ ID NO: 4) (SEQ ID NO: 10) (SEQ ID NO:
16) TDPNQLQ CTDPNQLQC ACTDPNQLQCG (SEQ ID NO: 5) (SEQ ID NO: 11)
(SEQ ID NO: 17) STHFIDT CSTHFIDTC ACSTHFIDTCG (SEQ ID NO: 6) (SEQ
ID NO: 12) (SEQ ID NO: 18)
[0161] In some embodiments, penetrating peptides according to the
present disclosure include an amino acid sequence including a
stretch of three, four, five, six, or seven consecutive amino acids
selected from one of the following amino acid sequences TGSTQHQ
(SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID NO:3),
MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and STHFIDT (SEQ ID
NO:6).
[0162] In some embodiments, penetrating peptides according to the
present disclosure have an amino acid sequence from 8 to 11, 12 to
15, or 16 to 19 amino acids in length, including an amino acid
sequence selected from one of the following amino acid sequences
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and STHFIDT
(SEQ ID NO:6). In some embodiments, penetrating peptides according
to the present disclosure have an amino acid sequence of at least
10, at least 20, at least 30, at least 40, at least 50, at least
60, at least 70, at least 80, at least 90, or at least 100 amino
acids. Penetrating peptides according to the present disclosure may
be circularized by any of a variety of known cross-linking methods.
In some embodiments, a penetrating peptide according to the present
disclosure may be provided in a circularized conformation (i.e., as
a cyclic peptide) in which a Cys-Cys disulfide bond is present. In
some embodiments, penetrating peptides according to the present
disclosure have an amino acid sequence including an internal amino
acid sequence selected from one of the following amino acid
sequences TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ
(SEQ ID NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and
STHFIDT (SEQ ID NO:6), wherein the amino acid sequence of the
peptide includes at least a first Cys positioned external to the
internal sequence in the N-terminal direction and at least a second
Cys positioned external to the internal sequence in the C-terminal
direction.
[0163] In some embodiments, penetrating peptides according to the
present disclosure include an amino acid sequence including an
internal stretch of three, four, five, or six consecutive amino
acids selected from one of the following amino acid sequences
TGSTQHQ (SEQ ID NO:1), HSALTKH (SEQ ID NO:2), KTGSHNQ (SEQ ID
NO:3), MGPSSML (SEQ ID NO:4), TDPNQLQ (SEQ ID NO:5) and STHFIDT
(SEQ ID NO:6); and further including at least a first Cys
positioned external to the internal sequence in the N-terminal
direction and at least a second Cys positioned external to the
internal sequence in the C-terminal direction.
[0164] The penetrating peptides disclosed herein include those
having the amino acid sequences provided, as well as peptides
having one or more amino acid substitutions, e.g., one or more
conservative amino acid substitutions, relative to the sequences
provided, wherein the peptides retains the capability of
penetrating the SC or penetrating a cell.
[0165] Active Agents
[0166] The ability of the above peptides to penetrate the SC
following topical administration and/or to penetrate the cellular
membranes of viable cells, e.g., epidermal and dermal cells, while
conjugated to or associated with a molecular cargo, e.g., a low
molecular weight compound or macromolecule, makes them suitable for
facilitating the delivery of a wide variety of active agents known
in the art.
[0167] General classes of active agents which may be delivered
include, for example, proteins, peptides, nucleic acids,
nucleotides, nucleosides and analogues thereof; as well as
pharmaceutical compounds, e.g., low molecular weight compounds.
[0168] Active agents which may be delivered using the penetrating
peptides disclosed herein include agents which act on the
peripheral nerves, adrenergic receptors, cholinergic receptors, the
skeletal muscles, the cardiovascular system, smooth muscles, the
blood circulatory system, synaptic sites, neuroeffector junction
sites, endocrine and hormone systems, the immunological system, the
reproductive system, the skeletal system, autacoid systems, the
alimentary and excretory systems, the histamine system and the
central nervous system.
[0169] Suitable active agents may be selected, for example, from
dermatological agents, anti-neoplastic agents, cardiovascular
agents, renal agents, gastrointestinal agents, rheumatologic
agents, immunological agents, and neurological agents among
others.
[0170] Suitable dermatological agents may include, for example,
local anesthetics, anti-inflammatory agents, anti-infective agents,
agents to treat acne, anti-virals, anti-fungals, agents for
psoriasis such as topical corticosteroids among others.
[0171] In some embodiments, a suitable dermatological agent is
selected from the following list: 16-17A-Epoxyprogesterone (CAS
Registry Number:1097-51-4), P-methoxycinnamic
acid/4-Methoxycinnamic acid (CAS Registry Number:830-09-1), Octyl
Methoxycinnamate (CAS Registry Number:5466-77-3), Octyl
Methoxycinnamate (CAS Registry Number:5466-77-3), Methyl p-methoxy
cinnamate (CAS Registry Number:832-01-9),
4-ESTREN-17.beta.-OL-3-ONE (CAS Registry Number:62-90-8),
Ethyl-p-anisoyl acetate (CAS Registry Number:2881-83-6),
Dihydrouracil (CAS Registry Number:1904-98-9), Lopinavir (CAS
Registry Number:192725-17-0), RITANSERIN(CAS Registry
Number:87051-43-2), Nilotinib (CAS Registry Number:641571-10-0);
Rocuronium bromide (CAS Registry Number:119302-91-9),
p-Nitrobenzyl-6-(1-hydroxyethyl)-1-azabicyclo(3.2.0)heptane-3,7-dione-2-c-
arboxylate (CAS Registry Number:74288-40-7), Abamectin (CAS
Registry Number:71751-41-2), Paliperidone (CAS Registry
Number:144598-75-4), Gemifioxacin (CAS Registry
Number:175463-14-6), Valrubicin (CAS Registry Number:56124-62-0),
Mizoribine (CAS Registry Number:50924-49-7), Solifenacin succinate
(CAS Registry Number:242478-38-2), Lapatinib (CAS Registry
Number:231277-92-2), Dydrogesterone (CAS Registry Number:152-62-5),
2,2-Dichloro-N-[(1R,2S)-3-fluoro-1-hydroxy-1-(4-methylsulfonylphenyl)prop-
an-2-yl]acetamide (CAS Registry Number:73231-34-2), Tilmicosin (CAS
Registry Number:108050-54-0), Efavirenz (CAS Registry
Number:154598-52-4), Pirarubicin (CAS Registry Number:72496-41-4),
Nateglinide (CAS Registry Number:105816-04-4), Epirubicin (CAS
Registry Number:56420-45-2), Entecavir (CAS Registry
Number:142217-69-4), Etoricoxib (CAS Registry Number:202409-33-4),
Cilnidipine (CAS Registry Number:132203-70-4), Doxorubicin
hydrochloride (CAS Registry Number:25316-40-9), Escitalopram (CAS
Registry Number:128196-01-0), Sitagliptin phosphate monohydrate
(CAS Registry Number:654671-77-9), Acitretin (CAS Registry
Number:55079-83-9), Rizatriptan benzoate (CAS Registry
Number:145202-66-0), Doripenem (CAS Registry Number:148016-81-3),
Atracurium besylate (CAS Registry Number:64228-81-5), Nilutamide
(CAS Registry Number:63612-50-0), 3,4-Dihydroxyphenylethanol (CAS
Registry Number:10597-60-1), KETANSERIN TARTRATE (CAS Registry
Number:83846-83-7), Ozagrel (CAS Registry Number:82571-53-7),
Eprosartan mesylate (CAS Registry Number:144143-96-4), Ranitidine
hydrochloride (CAS Registry Number:66357-35-5),
6,7-Dihydro-6-mercapto-5H-pyrazolo[1,2-a][1,2,4]triazolium chloride
(CAS Registry Number:153851-71-9), Sulfapyridine (CAS Registry
Number:144-83-2), Teicoplanin (CAS Registry Number:61036-62-2),
Tacrolimus (CAS Registry Number:104987-11-3), LUMIRACOXIB (CAS
Registry Number:220991-20-8), Allyl alcohol (CAS Registry
Number:107-18-6), Protected meropenem (CAS Registry
Number:96036-02-1), Nelarabine (CAS Registry Number:121032-29-9),
Pimecrolimus (CAS Registry Number:137071-32-0),
4-[6-Methoxy-7-(3-piperidin-1-ylpropoxy)quinazolin-4-yl]-N-(4-propan-2-yl-
oxyphenyl)piperazine-1-carboxamide (CAS Registry
Number:387867-13-2), Ritonavir (CAS Registry Number:155213-67-5),
Adapalene (CAS Registry Number:106685-40-9), Aprepitant (CAS
Registry Number:170729-80-3), Eplerenone (CAS Registry
Number:107724-20-9), Rasagiline mesylate (CAS Registry
Number:161735-79-1), Miltefosine (CAS Registry Number:58066-85-6),
Raltegravir potassium (CAS Registry Number:871038-72-1), Dasatinib
monohydrate (CAS Registry Number:863127-77-9), OXOMEMAZINE (CAS
Registry Number:3689-50-7), Pramipexole (CAS Registry
Number:104632-26-0), PARECOXIB SODIUM (CAS Registry
Number:198470-85-8), Tigecycline (CAS Registry Number:220620-09-7),
Toltrazuril (CAS Registry Number:69004-03-1), Vinflunine (CAS
Registry Number:162652-95-1), Drospirenone (CAS Registry
Number:67392-87-4), Daptomycin (CAS Registry Number:103060-53-3),
Montelukast sodium (CAS Registry Number:151767-02-1), Brinzolamide
(CAS Registry Number:138890-62-7), Maraviroc (CAS Registry
Number:376348-65-1), Doxercalciferol (CAS Registry
Number:54573-75-0), Oxolinic acid (CAS Registry Number:14698-29-4),
Daunorubicin hydrochloride (CAS Registry Number:23541-50-6),
Nizatidine (CAS Registry Number:76963-41-2), Idarubicin (CAS
Registry Number:58957-92-9), FLUOXETINE HYDROCHLORIDE (CAS Registry
Number:59333-67-4), Ascomycin (CAS Registry Number:11011-38-4),
beta-Methyl vinyl phosphate (MAP) (CAS Registry Number:90776-59-3),
Amorolfine (CAS Registry Number:67467-83-8), Fexofenadine HCl (CAS
Registry Number:83799-24-0), Ketoconazole (CAS Registry
Number:65277-42-1),
9,10-difluoro-2,3-dihydro-3-me-7-oxo-7H-pyrido-1 (CAS Registry
Number:82419-35-0), Ketoconazole (CAS Registry Number:65277-42-1),
Terbinafine HCl (CAS Registry Number:78628-80-5), Amorolfine (CAS
Registry Number:78613-35-1), Methoxsalen (CAS Registry
Number:298-81-7), Olopatadine HCl (CAS Registry
Number:113806-05-6), Zinc Pyrithione (CAS Registry
Number:13463-41-7), Olopatadine HCl (CAS Registry
Number:140462-76-6), Cyclosporine (CAS Registry Number:
59865-13-3), and Botulinum toxin and its analogs and vaccine
components.
[0172] Protein, Polypeptides and Peptides as Active Agents
[0173] Proteins useful in the disclosed depot formulations may
include, for example, molecules such as cytokines and their
receptors, as well as chimeric proteins including cytokines or
their receptors, including, for example tumor necrosis factor alpha
and beta, their receptors and their derivatives; renin; growth
hormones, including human growth hormone, bovine growth hormone,
methione-human growth hormone, des-phenylalanine human growth
hormone, and porcine growth hormone; growth hormone releasing
factor (GRF); parathyroid and pituitary hormones; thyroid
stimulating hormone; human pancreas hormone releasing factor;
lipoproteins; colchicine; prolactin; corticotrophin; thyrotropic
hormone; oxytocin; vasopressin; somatostatin; lypressin;
pancreozymin; leuprolide; alpha-1-antitrypsin; insulin A-chain;
insulin B-chain; proinsulin; follicle stimulating hormone;
calcitonin; luteinizing hormone; luteinizing hormone releasing
hormone (LHRH); LHRH agonists and antagonists; glucagon; clotting
factors such as factor VIIIC, factor IX, tissue factor, and von
Willebrands factor; anti-clotting factors such as Protein C; atrial
natriuretic factor; lung surfactant; a plasminogen activator other
than a tissue-type plasminogen activator (t-PA), for example a
urokinase; bombesin; thrombin; hemopoietic growth factor;
enkephalinase; RANTES (regulated on activation normally T-cell
expressed and secreted); human macrophage inflammatory protein
(MIP-1-alpha); a serum albumin such as human serum albumin;
mullerian-inhibiting substance; relaxin A-chain; relaxin B-chain;
prorelaxin; mouse gonadotropin-associated peptide; chorionic
gonadotropin; gonadotropin releasing hormone; bovine somatotropin;
porcine somatotropin; a microbial protein, such as beta-lactamase;
DNase; inhibin; activin; vascular endothelial growth factor (VEGF);
receptors for hormones or growth factors; integrin; protein A or D;
rheumatoid factors; a neurotrophic factor such as bone-derived
neurotrophic factor (BDNF), neurotrophin-3, 4, -5, or -6 (NT-3,
NT-4, NT-5, or NT-6), or a nerve growth factor such as NGF-.beta.;
platelet-derived growth factor (PDGF); fibroblast growth factor
such as acidic FGF and basic FGF; epidermal growth factor (EGF);
transforming growth factor (TGF) such as TGF-alpha and TGF-beta,
including TGF-.beta.1, TGF-.beta.2, TGF-.beta.3, TGF-.beta.4, or
TGF-.beta.5; insulin-like growth factor-I and -II (IGF-I and
IGF-II); des(1-3)-IGF-I (brain IGF-I), insulin-like growth factor
binding proteins; CD proteins such as CD-3, CD-4, CD-8, and CD-19;
erythropoietin; osteoinductive factors; immunotoxins; a bone
morphogenetic protein (BMP); an interferon such as interferon-alpha
(e.g., interferon.alpha.2A), -beta, -gamma, -lambda and consensus
interferon; colony stimulating factors (CSFs), e.g., M-CSF, GM-CSF,
and G-CSF; interleukins (ILs), e.g., IL-1 to IL-10; superoxide
dismutase; T-cell receptors; surface membrane proteins; decay
accelerating factor; viral antigen such as, for example, a portion
of the HIV-1 envelope glycoprotein, gp120, gp160 or fragments
thereof; transport proteins; homing receptors; addressins;
fertility inhibitors such as the prostaglandins; fertility
promoters; regulatory proteins; antibodies (including fragments
thereof) and chimeric proteins, such as immunoadhesins; precursors,
derivatives, prodrugs and analogues of these compounds, and
pharmaceutically acceptable salts of these compounds, or their
precursors, derivatives, prodrugs and analogues.
[0174] Suitable proteins or peptides may be native or recombinant
and include, e.g., fusion proteins.
[0175] In some embodiments, the protein is a growth hormone, such
as human growth hormone (hGH), recombinant human growth hormone
(rhGH), bovine growth hormone, methione-human growth hormone,
des-phenylalanine human growth hormone, and porcine growth hormone;
insulin, insulin A-chain, insulin B-chain, and proinsulin; or a
growth factor, such as vascular endothelial growth factor (VEGF),
nerve growth factor (NGF), platelet-derived growth factor (PDGF),
fibroblast growth factor (FGF), epidermal growth factor (EGF),
transforming growth factor (TGF), and insulin-like growth factor-I
and -II (IGF-I and IGF-II).
[0176] Suitable peptides for use as the active agent in the
injectable, biodegradable delivery depots disclosed herein include,
but are not limited to, Glucagon-like peptide-1 (GLP-1) and
precursors, derivatives, prodrugs and analogues thereof.
[0177] Nucleic Acids as Active Agents
[0178] Nucleic acid active agents include nucleic acids as well as
precursors, derivatives, prodrugs and analogues thereof, e.g.,
therapeutic nucleotides, nucleosides and analogues thereof;
therapeutic oligonucleotides; and therapeutic polynucleotides.
Active agents selected from this group may find particular use as
anticancer agents and antivirals. Suitable nucleic acid active
agents may include for example ribozymes, antisense
oligodeoxynucleotides, aptamers and siRNA. Examples of suitable
nucleoside analogues include, but are not limited to, cytarabine
(araCTP), gemcitabine (dFdCTP), and floxuridine (FdUTP). In some
embodiments, a suitable nucleic acid active agent is an interfering
RNA, e.g., shRNA, miRNA or siRNA. Suitable siRNAs include, for
example, IL-7 (Interleukin-7) siRNA, IL-10 (Interleukin-10) siRNA,
IL-22 (Interleukin-22) siRNA, IL-23 (Interleukin 23) siRNA, CD86
siRNA, KRT6a (keratin 6A) siRNA, K6a N171K (keratin 6a N171K)
siRNA, TNF.alpha. (tumor necrosis factor .alpha.) siRNA,
TNFR1(tumor necrosis factor receptor-1) siRNA, TACE (tumor necrosis
factor (TNF)-.alpha. converting enzyme) siRNA, RRM2 (ribonucleotide
reductase subunit-2) siRNA, and VEGF (vascular endothelial growth
factor) siRNA. mRNA sequences of the human gene targets of these
siRNAs are known in the art. For IL-7, see, e.g., GenBank
Accession: NM_000880.3, GenBank Accession: NM_001199886.1, GenBank
Accession: NM_001199887.1, and GenBank Accession: NM_001199888.1;
for IL-10, see, e.g., GenBank Accession: NM_000572.2; for IL-22
see, e.g., GenBank Accession: NM_020525.4; for IL-23, see, e.g.,
GenBank Accession: NM_016584.2, and GenBank Accession: AF301620.1;
for CD86, see, e.g., GenBank Accession: NM_175862.4, GenBank
Accession: NM_006889.4, GenBank Accession: NM_176892.1, GenBank
Accession: NM_001206924.1, and GenBank Accession: NM_001206925.1;
for KRT6a, see, e.g., GenBank Accession: NM_005554.3; for
TNF.alpha., see, e.g., GenBank Accession: NM_000594.2; for TNFR1,
see, e.g., GenBank Accession: NM_001065.3; for TACE, see, e.g.,
GenBank Accession: NM_003183.4; for RRM2, see, e.g., GenBank
Accession: NM_001165931.1 and GenBank Accession: NM_001034.3; for
VEGF, see, e.g., GenBank Accession: NM_001025366.2, GenBank
Accession: NM_001025367.2, GenBank Accession: NM_001025368.2,
GenBank Accession: NM_001025369.2, GenBank Accession:
NM_001025370.2, NM_001033756.2, GenBank Accession: NM_001171622.1,
and GenBank Accession: NM_003376.5.
[0179] In addition a variety of methods and techniques are known in
the art for selecting a particular mRNA target sequence during
siRNA design. See, e.g., the publicly available siRNA design tool
provided by the Whitehead Institute of Biomedical Research at MIT.
This tool can be located on the internet on the website located by
placing http:// directly preceding
jura.wi.mit.edu/bioc/siRNAext/.
[0180] Additional Active Agent Compounds
[0181] A variety of additional active agent compounds may be used
in the injectable depot compositions disclosed herein. Suitable
compounds may include compounds directed to one or more of the
following drug targets: Kringle domain, Carboxypeptidase,
Carboxylic ester hydrolases, Glycosylases, Rhodopsin-like dopamine
receptors, Rhodopsin-like adrenoceptors, Rhodopsin-like histamine
receptors, Rhodopsin-like serotonin receptors, Rhodopsin-like short
peptide receptors, Rhodopsin-like acetylcholine receptors,
Rhodopsin-like nucleotide-like receptors, Rhodopsin-like lipid-like
ligand receptors, Rhodopsin-like melatonin receptors,
Metalloprotease, Transporter ATPase, Carboxylic ester hydrolases,
Peroxidase, Lipoxygenase, DOPA decarboxylase, A/G cyclase,
Methyltransferases, Sulphonylurea receptors, other transporters
(e.g., Dopamine transporter, GABA transporter 1, Norepinephrine
transporter, Potassium-transporting ATPase .alpha.-chain 1,
Sodium-(potassium)-chloride cotransporter 2, Serotonin transporter,
Synaptic vesicular amine transporter, and Thiazide-sensitive
sodium-chloride cotransporter), Electrochemical nucleoside
transporter, Voltage-gated ion channels, GABA receptors (Cys-Loop),
Acetylcholine receptors (Cys-Loop), NMDA receptors, 5-HT3 receptors
(Cys-Loop), Ligand-gated ion channels Glu: kainite, AMPA Glu
receptors, Acid-sensing ion channels aldosterone, Ryanodine
receptors, Vitamin K epoxide reductase, MetGluR-like GABA.sub.B
receptors, Inwardly rectifying K.sup.+ channel, NPC1L1,
MetGluR-like calcium-sensing receptors, Aldehyde dehydrogenases,
Tyrosine 3-hydroxylase, Aldose reductase, Xanthine dehydrogenase,
Ribonucleoside reductase, Dihydrofolate reductase, IMP
dehydrogenase, Thioredoxin reductase, Dioxygenase, Inositol
monophosphatase, Phosphodiesterases, Adenosine deaminase,
Peptidylprolyl isomerases, Thymidylate synthase, Aminotransferases,
Farnesyl diphosphate synthase, Protein kinases, Carbonic anhydrase,
Tubulins, Troponin, Inhibitor of I.kappa.B kinase-.beta., Amine
oxidases, Cyclooxygenases, Cytochrome P450s, Thyroxine
5-deiodinase, Steroid dehydrogenase, HMG-CoA reductase, Steroid
reductases, Dihydroorotate oxidase, Epoxide hydrolase, Transporter
ATPase, Translocator, Glycosyltransferases, Nuclear receptors NR3
receptors, Nuclear receptors: NR1 receptors, and Topoisomerase.
[0182] In some embodiments, the active agent is a compound
targeting one of rhodopsin-like GPCRs, nuclear receptors,
ligand-gated ion channels, voltage-gated ion channels,
penicillin-binding protein, myeloperoxidase-like, sodium:
neurotransmitter symporter family, type II DNA topoisomerase,
fibronectin type III, and cytochrome P450.
[0183] In some embodiments, the active agent is an anticancer
agent. Suitable anticancer agents include, but are not limited to,
Actinomycin D, Alemtuzumab, Allopurinol sodium, Amifostine,
Amsacrine, Anastrozole, Ara-CMP, Asparaginase, Azacytadine,
Bendamustine, Bevacizumab, Bicalutimide, Bleomycin (e.g., Bleomycin
A.sub.2 and B.sub.2), Bortezomib, Busulfan, Camptothecin sodium
salt, Capecitabine, Carboplatin, Carmustine, Cetuximab,
Chlorambucil, Cisplatin, Cladribine, Clofarabine, Cyclophosphamide,
Cytarabine, Dacarbazine, Dactinomycin, Daunorubicin, Daunorubicin
liposomal, Dacarbazine, Decitabine, Docetaxel, Doxorubicin,
Doxorubicin liposomal, Epirubicin, Estramustine, Etoposide,
Etoposide phosphate, Exemestane, Floxuridine, Fludarabine,
Fludarabine phosphate, 5-Fluorouracil, Fotemustine, Fulvestrant,
Gemcitabine, Goserelin, Hexamethylmelamine, Hydroxyurea,
Idarubicin, Ifosfamide, Imatinib, Irinotecan, Ixabepilone,
Lapatinib, Letrozole, Leuprolide acetate, Lomustine,
Mechlorethamine, Melphalan, 6-Mercaptopurine, Methotrexate,
Mithramycin, Mitomycin C, Mitotane, Mitoxantrone, Nimustine,
Ofatumumab, Oxaliplatin, Paclitaxel, Panitumumab, Pegaspargase,
Pemetrexed, Pentostatin, Pertuzumab, Picoplatin, Pipobroman,
Plerixafor, Procarbazine, Raltitrexed, Rituximab, Streptozocin,
Temozolomide, Teniposide, 6-Thioguanine, Thiotepa, Topotecan,
Trastuzumab, Treosulfan, Triethylenemelamine, Trimetrexate, Uracil
Nitrogen Mustard, Valrubicin, Vinblastine, Vincristine, Vindesine,
Vinorelbine, and analogues, precursors, derivatives and pro-drugs
thereof. It should be noted that two or more of the above compounds
may be used in combination in the penetrating peptide compositions
of the present disclosure.
[0184] Active agents of interest for use in the disclosed
penetrating peptide compositions may also include opioids and
derivatives thereof as well as opioid receptor agonists and
antagonists, e.g., naltrexone, naloxone, nalbuphine, fentanyl,
sufentanil, oxycodone, and pharmaceutically acceptable salts and
derivatives thereof.
[0185] In some embodiments the active agent is a small molecule or
low molecular weight compound, e.g., a molecule or compound having
a molecular weight of less than or equal to about 1000 Daltons,
e.g., less than or equal to about 800 Daltons.
[0186] In some embodiments, the active agent is a label. Suitable
labels include, e.g, radioactive isotopes, fluorescers,
chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme
cofactors, enzyme inhibitors, chromophores, dyes, metal ions,
magnetic particles, nanoparticles and quantum dots.
[0187] The active agent may be present in any suitable
concentration in the compositions disclosed herein. Suitable
concentrations may vary depending on the potency of the active
agent, active agent half-life, etc. In addition, penetrating
peptide compositions according to the present disclosure may
include one or more active agents, e.g., a combination of two or
more of the active agents described above.
[0188] Active Agent Carriers
[0189] As described previously herein one or more active agents may
be conjugated to or associated with a penetrating peptide to
provide a penetrating peptide composition according to the present
disclosure. Alternatively, a penetrating peptide composition
according to the present disclosure may include a penetrating
peptide as disclosed herein conjugated or associated with an active
agent carrier which in turn includes the active agent attached
thereto and/or disposed therein.
[0190] Suitable active agent carriers include, for example,
liposomes, nanoparticles, micelles, microbubbles, and the like.
Techniques for incorporating active agents into such carriers are
known in the art. For example, liposomes or lipidic particles can
be prepared in accordance with U.S. Pat. No. 5,077,057 (Szoka,
Jr.). Liposomes formed from nonphosphal lipid components which have
the potential to form lipid bilayers are disclosed in Biochim.
Biophys. Acta., 19:227-232 (1982). For the preparation,
purification, modification and loading of liposomes see generally,
New, R.C.C., Liposomes: A Practical Approach, (1990) Oxford
University Press Inc., N.Y.
[0191] A general discussion of techniques for preparation of
liposomes and of medication encapsulating liposomes can be found in
U.S. Pat. No. 4,224,179 (Schneider). See, also Mayer et al.,
Chemistry and Physics of Lipids, 40: 333-345 (1986). See also, U.S.
Pat. No. 6,083,539 for the encapsulation of an active agent dry
powder composition. For incorporation of active agents into
nanoparticles, see, e.g., M. M. de Villiers et al. (editors),
Nanotechnology in Drug Delivery, (2009) American Associate of
Pharmaceutical Scientists. For incorporation of active agents into
micelles, see, e.g., D. R. Lu and S. Oie, Cellular Drug Delivery:
Principles and Practice, (2004) Humana Press Inc. Totowa, N.J.
[0192] Attachment of Peptides to Active Agents and Active Agent
Carriers
[0193] Penetrating peptides as described herein may be conjugated
to or associated with an active agent. Alternatively, a penetrating
peptide as disclosed herein may conjugated or associated with an
active agent carrier, which in turn includes the active agent
attached thereto and/or disposed therein (examples of which are
discussed above). Conjugation techniques generally result in the
formation of one or more covalent bonds between the penetrating
peptide and either the active agent or an active agent carrier
while association techniques generally utilize one or more of
hydrophobic, electrostatic or van der Walls interactions.
[0194] A variety of techniques may be used for conjugating or
associating a peptide to an active agent. Similarly, a variety of
techniques may be used for conjugating or associating a peptide to
an active agent carrier, e.g., liposomes, nanoparticles, or micelle
as described herein.
[0195] For example, where the active agent is a peptide or
polypeptide, the entire composition, including the penetrating
peptide, may be synthesized using standard amino acid synthesis
techniques. Other methods including standard molecular biology
techniques may be used to express and purify the entire polypeptide
sequence including the penetrating peptide. Additional methods of
conjugating peptides to other peptides or polypeptides include
Cu-catalyzed azide/alkyne [3+2] cycloaddition "Click Chemistry" as
described by Rostovtsev et al. (2002) Angew. Chem. Int. Ed. 41:
2596-2599 and Tornoe et al. (2002) J. Org. Chem. 67: 3057-3064;
azide/DIFO (Difluorinated Cyclooctyne) Cu-free Click Chemistry as
described by Baskin et al. (2007) PNAS Vol. 104, No. 43:
167393-16797; azide/phosphine "Staudinger Reaction" as described by
Lin et al. (2005) J. Am. Chem. Soc. 127: 2686-2695;
azide/triarylphosphine "Modified Staudinger Reaction" as described
by Saxon and Bertozzi (2000) March 17 Science 287(5460):2007-10;
and catalyzed olefin cross metathesis reactions as described by
Casey (2006) J. of Chem. Edu. Vol. 83, No. 2: 192-195, Lynn et al.
(2000) J. Am. Chem. Soc. 122: 6601-6609, and Chen et al. (2003)
Progress in Chemistry 15: 401-408.
[0196] Where the active agent is a low molecular weight compound or
small molecule, a variety of techniques may be utilized to
conjugate the low molecular weight compound or small molecule to a
penetrating peptide as described herein, e.g., Click chemistry as
described in Loh et al., Chem Commun (Comb), 2010 Nov. 28;
46(44):8407-9. Epub 2010 Oct. 7. See also, Thomson S., Methods Mol
Med., (2004);94:255-65, describing conjugation of small molecule
carboxyl, hydroxyl, and amine residues to amine and sulfhydryl
residues on proteins.
[0197] Methods are also available in the art for conjugating
peptides to active agent carriers such as liposomes. See, for
example, G. Gregoriadis (editor), Liposome Technology Third
Edition, Volume II Entrapment of Drugs and Other materials into
Liposomes, (2007), Informa Healthcare, New York, N.Y., which
describes techniques for coupling peptides to the surface of
liposomes. For the covalent attachment of proteins, to liposomes
see, New, R.C.C., Liposomes: A Practical Approach, (1990) Oxford
University Press Inc., N.Y. at pages 163-182.
[0198] Administration of Penetrating Peptide Compositions as
Pharmaceutical Formulations
[0199] One skilled in the art will appreciate that a variety of
suitable methods of administering a penetrating peptide composition
to a subject or host, e.g., patient, in need thereof, are
available, and, although more than one route can be used to
administer a particular composition, a particular route can provide
a more immediate and more effective reaction than another route.
Pharmaceutically acceptable excipients are also well known to those
who are skilled in the art, and are readily available. The choice
of excipient will be determined in part by the particular compound,
as well as by the particular method used to administer the
composition. Accordingly, there are a wide variety of suitable
formulations of the penetrating peptide compositions. The following
methods and excipients are merely exemplary and are in no way
limiting.
[0200] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as an effective amount of the compound
dissolved in diluents, such as water, saline, or orange juice; (b)
capsules, sachets or tablets, each containing a predetermined
amount of the active ingredient, as solids or granules; (c)
suspensions in an appropriate liquid; (d) suitable emulsions and
(e) hydrogels. Tablet forms can include one or more of lactose,
mannitol, corn starch, potato starch, microcrystalline cellulose,
acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium,
talc, magnesium stearate, stearic acid, and other excipients,
colorants, diluents, buffering agents, moistening agents,
preservatives, flavoring agents, and pharmacologically compatible
excipients. Lozenge forms can comprise the active ingredient in a
flavor, usually sucrose and acacia or tragacanth, as well as
pastilles including the active ingredient in an inert base, such as
gelatin and glycerin, or sucrose and acacia, emulsions, gels, and
the like containing, in addition to the active ingredient, such
excipients as are known in the art.
[0201] Penetrating peptide formulations can be made into aerosol
formulations to be administered via inhalation. These aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the like.
They may also be formulated as pharmaceuticals for non-pressured
preparations such as for use in a nebulizer or an atomizer.
[0202] Formulations suitable for parenteral administration include
aqueous and non-aqueous, isotonic sterile injection solutions,
which can contain anti-oxidants, buffers, bacteriostats, and
solutes that render the formulation isotonic with the blood of the
intended recipient, and aqueous and non-aqueous sterile suspensions
that can include suspending agents, solubilizers, thickening
agents, stabilizers, and preservatives. The formulations can be
presented in unit-dose or multi-dose sealed containers, such as
ampules and vials, and can be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid excipient, for example, water, for injections, immediately
prior to use. Extemporaneous injection solutions and suspensions
can be prepared from sterile powders, granules, and tablets of the
kind previously described.
[0203] Formulations suitable for topical administration may be
presented as creams, gels, pastes, patches, sprays or foams.
[0204] Suppository formulations are also provided by mixing with a
variety of bases such as emulsifying bases or water-soluble bases.
Formulations suitable for vaginal administration may be presented
as pessaries, tampons, creams, gels, pastes, foams.
[0205] Unit dosage forms for oral or rectal administration such as
syrups, elixirs, and suspensions may be provided wherein each
dosage unit, for example, teaspoonful, tablespoonful, tablet or
suppository, contains a predetermined amount of the composition.
Similarly, unit dosage forms for injection or intravenous
administration may comprise the penetrating peptides in a
formulation as a solution in sterile water, normal saline or
another pharmaceutically acceptable carrier.
[0206] The term "unit dosage form," as used herein, refers to
physically discrete units suitable as unitary dosages for human and
animal subjects, each unit containing a predetermined quantity of
penetrating peptide composition calculated in an amount sufficient
to produce the desired effect in association with a
pharmaceutically acceptable diluent, carrier or vehicle. The
specifications for the novel unit dosage forms of the penetrating
peptide compositions depend on the particular active agent employed
and the effect to be achieved, and the pharmacodynamics associated
with each compound in the host.
[0207] Those of skill in the art will readily appreciate that dose
levels can vary as a function of the specific compound, the nature
of the delivery vehicle, and the like. Suitable dosages for a given
compound are readily determinable by those of skill in the art by a
variety of means.
[0208] Optionally, the pharmaceutical composition may contain other
pharmaceutically acceptable components, such a buffers,
surfactants, antioxidants, viscosity modifying agents,
preservatives and the like. Each of these components is well-known
in the art. See, e.g., U.S. Pat. No. 5,985,310, the disclosure of
which is herein incorporated by reference.
[0209] Other components suitable for use in penetrating peptide
formulations can be found in Remington's Pharmaceutical Sciences,
Mack Pub. Co., 18th edition (June 1995). In an embodiment, the
aqueous cyclodextrin solution further comprise dextrose, e.g.,
about 5% dextrose.
[0210] Administration of Penetrating Peptide Compositions as
Medical Device Components
[0211] In some embodiments, one or more of the penetrating peptide
compositions of the present disclosure may be incorporated into a
medical device known in the art, for example, drug eluting stents,
catheters, fabrics, cements, bandages (liquid or solid),
biodegradable polymer depots and the like. In some embodiments, the
medical device is an implantable or partially implantable medical
device.
[0212] Methods of Treatment
[0213] The terms "an effective amount" (or, in the context of a
therapy, a "pharmaceutically effective amount") of a penetrating
peptide composition generally refers to an amount of the
penetrating peptide composition, effective to accomplish the
desired therapeutic effect, e.g., in the case of a penetrating
peptide-siRNA composition, an amount effective to reduce expression
of the targeted mRNA by an amount effective to produce a desired
therapeutic effect.
[0214] Effective amounts of penetrating peptide compositions,
suitable delivery vehicles, and protocols can be determined by
conventional means. For example, in the context of therapy a
medical practitioner can commence treatment with a low dose of one
or more penetrating peptide compositions in a subject or patient in
need thereof, and then increase the dosage, or systematically vary
the dosage regimen, monitor the effects thereof on the patient or
subject, and adjust the dosage or treatment regimen to maximize the
desired therapeutic effect. Further discussion of optimization of
dosage and treatment regimens can be found in Benet et al., in
Goodman & Gilman's The Pharmacological Basis of Therapeutics,
Ninth Edition, Hardman et al., Eds., McGraw-Hill, New York, (1996),
Chapter 1, pp. 3-27, and L. A. Bauer, in Pharmacotherapy, A
Pathophysiologic Approach, Fourth Edition, DiPiro et al., Eds.,
Appleton & Lange, Stamford, Conn., (1999), Chapter 3, pp.
21-43, and the references cited therein, to which the reader is
referred.
[0215] The dosage levels and mode of administration will be
dependent on a variety of factors such as the penetrating peptides
used, the active agent, the context of use (e.g., the patient to be
treated), and the like. Optimization of modes of administration,
dosage levels, and adjustment of protocols, including monitoring
systems to assess effectiveness are routine matters well within
ordinary skill.
[0216] In one embodiment, the present disclosure provides a method
of treating a subject having a dermatological disease, including:
administering to the subject a pharmaceutically effective amount of
a composition including a penetrating peptide as disclosed herein,
wherein the peptide is conjugated to or associated with a
dermatological active agent, e.g., a dermatological active agent as
disclosed herein, or a dermatological active agent carrier
including the active agent.
[0217] In one embodiment, the present disclosure provides a method
of treating a subject having, suspected of having or susceptible to
a disorder resulting at least in part from expression of an mRNA,
including administering to the subject a pharmaceutically effective
amount of a composition including a penetrating peptide as
described herein, wherein the penetrating peptide is conjugated to
or associated with an interfering RNA or an active agent carrier
including an interfering RNA, e.g., an shRNA, miRNA or siRNA which
targets the mRNA or a carrier including the interfering RNA.
[0218] In one embodiment, the interfering RNA is an siRNA, e.g., an
siRNA selected from one of the following: I1-10 siRNA, IL-17 siRNA,
IL-22 siRNA, IL-23 siRNA, CD86 siRNA, KRT6a siRNA, TNFR1 siRNA,
TNF.alpha. siRNA, and TACE siRNA.
[0219] In-Vitro Use
[0220] In addition to treatment methods and other in-vivo uses, the
penetrating peptide compositions disclosed herein may also be used
in the context of in-vitro experimentation. For example, the
penetrating peptides disclosed herein may be used to deliver any of
a wide variety of active agents as discussed herein, as well as
potential active agents, into viable cells in-vitro to determine
the potential therapeutic effect, toxicity, etc. of the active
agent or potential active agent. For this reason, the penetrating
peptides and penetrating peptide compositions of the present
disclosure may be useful in the context of drug testing and/or
screening.
[0221] In some embodiments, penetrating peptide compositions as
described herein may be used in in-vitro gene silencing
experiments, e.g., by introducing a penetrating peptide-interfering
RNA conjugate directed to a gene target and monitoring the effect
on gene expression.
[0222] Additional in-vitro uses may include the use of penetrating
peptides as disclosed herein conjugated or associated with one or
more labeling agents (e.g., fluorescent agents or radioactive
labels) or one or more labeling agent carriers in order to label
viable cells in vitro.
EXAMPLES
[0223] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Celsius, and pressure
is at or near atmospheric.
Example 1
[0224] Peptides that penetrate the SC were identified using in
vitro phage display as follows and as depicted generally in FIG. 1,
panel A.
[0225] Phage Display
[0226] The Ph.D.-C7C Phage Display Peptide Library (New England
Biolabs) was utilized. Screening studies were performed on porcine
skin in Franz Diffusion cells (FDCs, Permegear). 2.times.10.sup.11
pfu (10 .mu.L) of phage library along with 1 mL of Phosphate
Buffered Saline (PBS, pH 7.4) were placed in the donor compartment
of the FDC. After 24 hours, the liquid in the receiver compartment
was removed and titered by adding an aliquot of the receiver
solution to 200 .mu.L of E. coli strain ER2738 (New England
Biolabs) and plating on IPTG/Xgal plates. The number of blue
plaques formed after incubation for 18 hours at 37.degree. C. was
counted and 20 plaques were randomly selected for sequencing. For
subsequent screening rounds, 1 mL of the receiver solution was
added to 20 mL of a 1:100 diluted overnight culture of ER2738 and
grown for 4.5 hours to amplify the phage. The phage were purified
by PEG/NaCl precipitation and resuspended in PBS. The amplified
phage were then used in the next round of screening. The number of
phage placed in the donor compartment, 2.times.10.sup.11 pfu, was
held constant for all 5 rounds of screening.
[0227] Five rounds of selection led to narrowing down of the
display library as depicted in FIG. 1, panel B. One sequence,
AC-TGSTQHQ-CG (SEQ ID NO:13), appeared in high frequency in higher
rounds and was designated as Skin Permeating And Cell Entering
(SPACE) peptide. A second sequence (AC-HSALTKH-CG) (SEQ ID NO:14)
also appeared in high frequency. A third sequence (AC-STHFIDT-CG)
(SEQ ID NO:18) appeared in relatively high frequency in rounds 4
and 5. Note that "AC-" and "--CG" as used herein in the context of
the peptide sequences indicates that the AC and CG portions of the
sequence originated with the phage display system.
[0228] Phage Penetration
[0229] Penetration of various phage samples including phage with no
peptide library, the entire phage library, SPACE-peptide displaying
phage and heptaglycine phage was determined following the same
procedure described above (without the amplification and follow-up
screening steps) using the number of phage colonies detected in the
receiver samples and standard equations for determining
penetration.
[0230] Phage Cloning
[0231] To verify the ability of the phage to penetrate the skin,
the Ph.D. Peptide Display Cloning System (M13KE vector, New England
Biolabs) was used to create phage, which displayed specific peptide
sequences of interest. Peptide sequences of interest were cloned
into the Ph.D. Peptide Display Cloning System (M13KE vector, New
England Biolabs). The peptide sequence was inserted in between the
KpnI and EagI restriction sites. To differentiate the original
M13KE vector from the modified M13KE vector containing the peptide
insert, the reverse primer was engineered to modify the EagI
restriction site (5'-CGGCCG-3') (SEQ ID NO:19) to the SacII
restriction site (5'-CCGCGG-3') (SEQ ID NO:20) through two site
mutations. Both the forward and reverse primers were used to
replicate the entire vector. The forward primer was
5'-GTTCCGCGGAAACTGTTGAAAGTTGTTTAGCAAAATCCC-3' (SEQ ID NO:21). The
reverse primer for TGSTQHQ (SEQ ID NO:1) and THGQTQS (SEQ ID NO:22)
were 5'-TTTCCGCGGAACCTCCACCGCACTGATGCTGCTCGAACCAGTACAAGCAGAGTGAG
AATAGAAAGGTACTACTAAAGGAATTGCGAATAATAATTTTTTCAC-3' (SEQ ID NO:23)
and 5'-TTTCCGCGGAACCTCCACCGCA(AGACTGAGTCTGCCCATGAGT)ACAAGCAGAGTG
AGAATAGAAAGGTACTACTAAAGGAATTGCGAATAATAATTTTTTCAC-3' (SEQ ID NO:24)
respectively.
[0232] The replication products were purified and then digested
with SacII to produce the blunt ends required for ligation of the
vector. The modified vector was electroporated into
electrocompetent ER2738 cells and then immediately placed in 1 mL
of SOC medium (New England Biolabs) and grown for 45 minutes at
37.degree. C. The resulting culture was then placed into 50 mL of a
1:100 diluted overnight culture and grown for 4.5 hours. The
amplified phage were purified using the protocol stated above and
titered. Plaques were picked after 18 hours and sequenced to verify
the peptide being displayed on the phage surface.
[0233] Peptide Synthesis
[0234] The peptide sequence for the SPACE peptide was ACTGSTQHQCG
(SEQ ID NO:13) and the peptide sequence for the control peptide
(CP) was ACTHGQTQSCG (SEQ ID NO:25) with the formation of the
disulfide bond between the cysteines to produce a cyclic peptide.
5-carboxyfluorescein (5-FAM) or fluorescein isothiocyanate (FITC)
conjugated peptides were synthesized by ChinaTech Peptide Co. and
RS Synthesis. The dye was placed on the N-terminus of the peptide.
Biotinylated versions of both peptides were synthesized by
ChinaTech Peptide Co. and the peptides with no modifications were
synthesized by RS Synthesis.
Example 2
[0235] Mathematical Model
[0236] Penetration of phage across the SC is unexpected given its
size (Potts R O & Guy RH (1992) Predicting skin permeability.
Pharm Res 9(5):663-669; Magnusson B, Pugh W, & Roberts M (2004)
Simple rules defining the potential of compounds for transdermal
delivery or toxicity. Pharm Res 21(6):1047-1054; Mitragotri S
(2003) Modeling skin permeability to hydrophilic and hydrophobic
solutes based on four permeation pathways. J Control Release
86(1):69-92.). Large solutes (typically MW>500 Da) exhibit poor
skin penetration and measurement of their transdermal permeation is
often limited by the sensitivity of their detection. The M13 phage
used in this study is a long filamentous particle, approximately 8
nm in width and 900 nm in length. High donor concentration
(.about.2.times.10.sup.11 pfu/ml), low detection limit (.about.1
pfu) and the potential for amplification facilitated assessment of
dermal penetration of phage. The measured permeability of phage
across porcine skin was very low; 10.sup.-9 cm/hr for control phage
(phage without the peptide library) and 10.sup.-7-10.sup.-6 cm/hr
for SPACE-phage. Permeation of phage, though much smaller than that
of low molecular weight solutes, was significant and unexpected.
Most importantly, penetration of phage was sequence-specific.
[0237] Diffusion through intercellular lipids represents the
classical mechanism for transdermal permeation of molecules. This
mechanism, however, is generally limited to small, lipophilic
molecules. Permeation of large, hydrophilic molecules is relatively
less studied. Transdermal transport of such solutes is attributed
to two pathways; (i) polar or porous pathways and (ii) appendages
(follicles). Mathematical models have been described in the
literature to describe contributions of both pathways to
transdermal permeation (Tang H, Mitragotri S, Blankschtein D, &
Langer R (2001) Theoretical description of transdermal transport of
hydrophilic permeants: application to low-frequency sonophoresis. J
Pharm Sci 90(5):545-568; Peck K D, Ghanem A H, & Higuchi W I
(1994) Hindered diffusion of polar molecules through and effective
pore radii estimates of intact and ethanol treated human epidermal
membrane. Pharm Res 11(9):1306-1314.). Applications of these models
to phage transport and their comparison with experimental
observations are presented below.
[0238] Basics of these models have been published ((Tang H,
Mitragotri S, Blankschtein D, & Langer R (2001) Theoretical
description of transdermal transport of hydrophilic permeants:
application to low-frequency sonophoresis. (Translated from eng) J
Pharm Sci 90(5):545-568 (in eng); Peck K D, Ghanem A H, &
Higuchi W I (1994) Hindered diffusion of polar molecules through
and effective pore radii estimates of intact and ethanol treated
human epidermal membrane. (Translated from eng) Pharm Res
11(9):1306-1314 (in eng)) and a summary of these models is provided
below. These models have been applied to describe transport of
large molecules such as dextran which has a hydrodynamic radius of
2.6 nm, which, though smaller than the radius of the phage
(.about.4 nm), is of the same order of magnitude. The following
analysis is based on extrapolation of these models and provides
informative context for interpreting phage permeation through
skin.
[0239] Polar Pathway:
[0240] Polar (or porous) pathways have been used to describe
transdermal diffusion of several hydrophilic solutes including
macromolecules (Tang H, Mitragotri S, Blankschtein D, & Langer
R (2001) Theoretical description of transdermal transport of
hydrophilic permeants: application to low-frequency sonophoresis.
(Translated from eng) J Pharm Sci 90(5):545-568 (in eng);
Mitragotri S, et al. (Mathematical models of skin permeability: An
overview. (Translated from Eng) Int J Pharm (in Eng); Tezel A, Sens
A, & Mitragotri S (2003) Description of transdermal transport
of hydrophilic solutes during low-frequency sonophoresis based on a
modified porous pathway model. (Translated from eng) J Pharm Sci
92(2):381-393 (in eng); Tezel A, Sens A, & Mitragotri S (2002)
A theoretical analysis of low-frequency sonophoresis: dependence of
transdermal transport pathways on frequency and energy density.
(Translated from eng) Pharm Res 19(12):1841-1846 (in eng); Tezel A
& Mitragotri S (2003) On the origin of size-dependent
tortuosity for permeation of hydrophilic solutes across the stratum
corneum. (Translated from eng) J Control Release 86(1):183-186 (in
eng); Polat B E, Seto J E, Blankschtein D, & Langer R
(Application of the aqueous porous pathway model to quantify the
effect of sodium lauryl sulfate on ultrasound-induced skin
structural perturbation. (Translated from Eng) J Pharm Sci (in
Eng); Seto J E, Polat B E, Lopez R F, Blankschtein D, & Langer
R (Effects of ultrasound and sodium lauryl sulfate on the
transdermal delivery of hydrophilic permeants: Comparative in vitro
studies with full-thickness and split-thickness pig and human skin.
(Translated from eng) J Control Release 145(1):26-32 (in eng); Tang
H, Blankschtein D, & Langer R (2002) Prediction of steady-state
skin permeabilities of polar and nonpolar permeants across excised
pig skin based on measurements of transient diffusion:
characterization of hydration effects on the skin porous pathway.
(Translated from eng) J Pharm Sci 91(8):1891-1907 (in eng); Tang H,
Blankschtein D, & Langer R (2002) Effects of low-frequency
ultrasound on the transdermal permeation of mannitol: comparative
studies with in vivo and in vitro skin. (Translated from eng) J
Pharm Sci 91(8):1776-1794 (in eng)).
[0241] In order to cross the stratum corneum (SC), hydrophilic
solutes need to penetrate multiple lipid bilayers. However, given
the low permeabilities of hydrophilic solutes across lipid
bilayers, it appears unlikely that hydrophilic molecules can
diffuse across the SC by the classical partition-diffusion process
that plays an important role for hydrophobic solutes. Transdermal
penetration of such solutes has been proposed to take place
primarily through defects in the stratum corneum that exist in
various physical form including grain boundaries,
fault-dislocations, nanoscale pinholes or other abnormalities in
skin structure. Hydration of the stratum corneum may further
increase the occurrence of such defects. The precise size of these
defects depends on the type of defect and may span a length scale
of 1-100 nm.
[0242] A general expression for the permeability coefficient,
K.sub.P.sup.pore, of a hydrophilic permeant diffusing through skin
is given by the porous pathway as follows:
K P pore = D .infin. .tau. L ( .intg. 0 .infin. .gamma. ( r ) H (
.lamda. ) dr ) [ 1 ] ##EQU00001##
[0243] where .epsilon., .tau., and L are the porosity, tortuosity
and thickness of the membrane, respectively and D.sup..infin. is
the solute diffusion coefficient in infinite dilution. H(.lamda.)
is the steric hindrance factor, where .lamda. is the ratio of the
hydrodynamic radius of the permeant, r.sub.h, and the effective
pore radius of the skin, r (that is, .lamda.=r.sub.h/r). The
relationship between H(.lamda.) and .lamda. is given by the
hindered transport theory and is described in the literature (11).
.gamma.(r) is the pore size distribution in skin and it has been
described for porcine skin by the following function (4).
.gamma.(r)=0.024 exp(-0.00045r.sup.2) [2]
[0244] To put Eq. [2] is perspective, consider the energetics of
pore (or void) formation in a medium, for example skin. The
probability of pore formation can be related to the free energy of
pore formation according to the following general equation.
probability .varies. exp ( - .pi. r 2 E k T ) [ 3 ]
##EQU00002##
[0245] where E is the free energy of pore formation per unit area
per unit pore. A comparison of Eqs. [2] and [3] indicates that the
value of E for a pore with a 4 nm radius in porcine skin is
<1kT, a value that is relatively small.
[0246] Values of .epsilon. for porcine skin have been determined to
be about 2.times.10.sup.-5 (4). Similarly, tortuosity, .tau., for
diffusion of large hydrophilic solutes in porcine SC has been shown
to be .about.1 (4). D.sub.P.sup..infin. is the solute diffusion
coefficient in water and has been calculated using correlations
such as the Wilke-Chang or Stoke-Einstein equation as follows.
D p .infin. = 2.6 .times. 10 - 5 r h [ 4 ] ##EQU00003##
[0247] where r.sub.h is in .ANG. and D.sub.P.sup..infin. is in
cm.sup.2/s. By combining Eqs. [1], [2] and [4], the contribution of
porous pathways for a solute of radius r.sub.h can be estimated as
follows.
K P pore ( r h ) = 1.3 .times. 10 - 3 r h .intg. r h .infin. H (
.lamda. ) .gamma. ( r ) dr [ 5 ] ##EQU00004##
[0248] where, K.sub.P.sup.pore is in cm/hour. By substituting
r.sub.h=40 .ANG. (corresponding to radius of phage), one gets
K.sub.P.sup.pore(r.sub.h).about.10.sup.-8 cm/hr.
[0249] Contribution of Appendages:
[0250] Large solutes may also be able to diffuse across the skin
through appendages. While the density of hair follicles varies
substantially with anatomical location, the average density of hair
follicles in porcine skin is estimated to be approximately 10 per
cm.sup.2. A large fraction of the follicle, however, is occupied by
the hair and is not available for transport. The contribution of
shunts to skin permeability is given by the following.
K P shunt = .phi. s D s L shunt [ 6 ] ##EQU00005##
[0251] where, .phi..sub.s is the fraction of skin area occupied by
follicles that is available for transport. D.sub.s is the solute
diffusion coefficient in the contents within the follicles and
L.sub.shunt is the diffusion path length through follicles. The
area fraction of skin in the follicle that is available for
transport is .about.10.sup.-4 cm.sup.2/cm.sup.2. D.sub.s can be
estimated using the Wilke-Change Equation or the Stoke-Einstein
relationship. Assuming the follicles are filled with a viscous
liquid and given the large size of the phage, D.sub.s can be
approximated to be .about.10.sup.-8 cm.sup.2/s. L.sub.shunt is
.about.500 .mu.m. By substituting the above values for .phi..sub.s
and L.sub.shunt one can obtain the following expression for
K.sub.P.sup.shunt.about.10.sup.-7 cm/hr.
[0252] The above equations therefore estimate that phage
permeability across porcine skin in the range of
10.sup.-7-10.sup.-8 cm/hr.
[0253] To compare these estimates with experimental data, phage
permeation across porcine skin was measured as described previously
herein. Control phage (phage without any peptide displayed)
exhibited a permeability.about.10.sup.-9 cm/hr. Phage that displays
heptaglycine also exhibited a low permeability of .about.10.sup.-10
cm/hr. The entire phage display library exhibited a permeability of
.about.10.sup.-8-10.sup.-7 cm/hr and the permeability of phage
displaying the SPACE sequence was 10.sup.-7-10.sup.-6 cm/hr. These
numbers are generally consistent with theoretical predictions. Note
that the measured permeabilities may not represent steady-state
values and may not fulfill the classical definition of
permeability; nonetheless, these numbers provide reasonable values
to allow comparisons with theoretical predictions.
[0254] Given that all phage particles used in this study were of
identical size, the likely explanation for higher permeability of
SPACE phage over control phage (no peptide displayed) is due to the
peptide displayed on the surface of the phage. The porous pathway
model assumes that partitioning of solutes in the skin is unity,
that is, the solute exhibits no affinity towards the skin. If SPACE
phage were to exhibit higher affinity towards the skin, it would
lead to higher portioning and penetration of phage across the skin.
Experimental observations indeed suggest that SPACE increases the
affinity of the cargo towards skin components, especially keratin.
Without intending to be bound by any particular theory, it is
hypothesized that this increased affinity is the primary reason
behind increased penetration of SPACE phage over control phage.
[0255] To further confirm this hypothesis, experiments were
conducted where the effect of excess SPACE peptide on permeation of
SPACE phage across porcine skin was assessed. Specifically, SPACE
sequence-displaying phage was placed on the skin in presence of
about a 100,000-fold excess SPACE peptide (.about.10.sup.5 free
SPACE peptides per SPACE peptide on phage). Excess SPACE peptide
significantly reduced permeation of SPACE phage and the
permeability of SPACE-phage phage in this case was close to
heptaglycine phage (.about.10.sup.-10 cm/hr).
Example 3
[0256] Dermis Screen
[0257] In a separate experiment, phage screening was performed to
isolate phage that localized in the dermis. For the dermis screen,
the phage display library was also placed in the donor compartment
of the FDC. After 24 hours, the liquid from the donor compartment
was removed and the skin was placed at 60.degree. C. for 90
seconds. The epidermis was then removed from the dermis. To extract
phage from the dermis, the dermis was cut up into small pieces and
then homogenized (IKA disperser). The homogenate was spun down at
5,000 rpm for 5 minutes and then re-suspended in PBS and incubated
at room temperature for 5 minutes. The samples were then
centrifuged again and washed two more times. After the final
centrifuge spin, the homogenates were re-suspended in 1% NP40
(Sigma) to elute the remaining phage from the dermis. The eluate
was then plated and amplified according to the methods listed
above. This was repeated for a total of 5 rounds. At the end of the
fifth round of screening, about 1.9.times.10.sup.5 phage were
recovered from the dermis. Phage were sequenced and the three
leading sequences in the fifth round were AC-KTGSHNQ-CG (SEQ ID
NO:15) (30%), AC-MGPSSML-CG (SEQ ID NO:16) (30%) and AC-TDPNQLQ-CG
(SEQ ID NO:17) (20%). In view of the similarity between the
AC-KTGSHNQ-CG (SEQ ID NO:15) peptide and the SPACE peptide
identified above, the SPACE peptide was selected for further
studies.
Example 4
[0258] Penetration of Fluorescently Labeled Phage
[0259] Phage clones displaying the SPACE peptide were fluorescently
labeled and tested for their ability to penetrate into skin. Phage
particles were labeled using the Alexa Fluor 488 protein labeling
kit (Invitrogen). The Alexa Fluor 488 contains a TFP ester which
reacts with the primary amine groups on the coat proteins of the
phage. 2.times.10.sup.12 pfu in DI water or PBS were added to DI
water to obtain a total volume of 500 .mu.L. The phage solution was
then added to 50 .mu.L of 1M sodium bicarbonate and the resulting
solution was placed into a vial containing the fluorescent dye and
was at room temperature for 1 hour. The phage were then purified
with PEG/NaCl to remove the excess unreacted dye and titered.
[0260] Full thickness porcine skin was obtained from the lateral
abdominal region of Yorkshire pigs. The skin was stored at
-80.degree. C. and defrosted immediately prior to use. The
conductivity of the skin was measured to ensure the integrity of
the skin barrier. Skin samples with a resistivity above 50 k.OMEGA.
were used for experiments. Fluorescently labeled phage clones
displaying the SPACE peptide or a scrambled peptide sequence
(AC-THGQTQS-CG) (SEQ ID NO:25) were placed in the donor compartment
of the FDC. To resemble the phage screening experiments,
2.times.10.sup.11 pfu was added to the donor compartment and the
skin samples were harvested after 24 hours. Skin samples were then
prepared for imaging with confocal microscopy.
[0261] Preparation of Skin Samples for Confocal Microscopy
Imaging
[0262] The skin samples were placed into 4% paraformaldehyde
(Electron Microscopy Sciences) overnight at 4.degree. C.
immediately after being harvested and rinsed with DI water. Skin
samples were then frozen in O.C.T. Compound and sectioned at a
thickness of 20 .mu.m on a cyrotome (Leica). The tissues were
mounted on slides which were positively charged to adhere the
tissue to the glass slide Fisher Scientific). The slides were
washed in DI water for 5 minutes prior to staining with 5 .mu.g/mL
Hoechest 33342 (Invitrogen) for 5 minutes. The slides were then
washed again in DI water for 5 minutes and then allowed to dry
completely at room temperature in the dark. 10 .mu.L of Permount
mounting medium (Fisher Scientific) was placed on top of the skin
section along with a glass cover slip and then the slides were
sealed. All samples were imaged on a confocal microscope (Leica and
Olympus Fluoview 500).
[0263] The imaging results for the above experiment are shown in
FIG. 2, panels (a) and (b). Fluorescently labeled phage clones
displaying SPACE peptide exhibited small but detectable penetration
into skin (a). In contrast the scrambled control peptide sequence
(AC-THGQTQS-CG) (SEQ ID NO:25) exhibited only superficial
penetration (b).
Example 5
Peptide Penetration into Porcine Skin
[0264] The ability of the SPACE peptide to penetrate porcine skin
when removed from phage was tested as follows. Full thickness
porcine skin was obtained and prepared as described above.
Fluorescently labeled peptides, 200 .mu.L of a 1 mg/mL solution,
were placed in the donor compartment of the FDC. After 24 hours,
the remaining solution in the donor compartment was removed and the
FDC was dismantled. The skin sample was retrieved and rinsed with
DI water to remove excess peptide or peptide complex on the surface
of the skin. Skin samples were then prepared for imaging with
confocal microscopy as described above.
[0265] The imaging results for the above experiment are shown in
FIG. 1, panels (c) and (d). The SPACE peptide, when removed from
the phage, penetrated into the skin (c). Consistent with the
observations made with the entire phage, SPACE peptide was found to
localize strongly in the dermis. No significant penetration of the
control peptide was observed (d).
Example 6
Peptide and Macromolecule Penetration in Porcine Skin
[0266] The ability of the SPACE peptide to carry macromolecular
cargos across the SC was tested as follows. Full thickness porcine
skin was obtained and prepared as described above. The peptide was
first conjugated to the macromolecule as described in greater
detail below and then the peptide-macromolecule complex was placed
into the donor compartment of the FDC. After 24 hours, the
remaining solution in the donor compartment was removed and the FDC
was dismantled. The skin sample was retrieved and rinsed with DI
water to remove excess peptide complex on the surface of the skin.
Skin samples were then prepared for imaging with confocal
microscopy as described above.
[0267] To conjugate the peptide to the macromolecule streptavidin,
80 .mu.L of a 1 mg/mL biotinylated peptide solution was incubated
with 20 .mu.L of a 2 mg/mL streptavidin-Alexa Fluor 488 conjugate
(Invitrogen) solution and incubated at room temperature for 30
minutes. The resulting solution was then placed into the donor
compartment of the FDC. Skin samples were harvested after 24 hours
and imaged as described above.
[0268] Streptavidin, when conjugated to biotinylated SPACE peptide,
permeated well beyond the SC and some localization of streptavidin
was found in the epidermis and dermis (FIG. 1, panel (e)).
Streptavidin not conjugated to SPACE peptide exhibited minimal
penetration into epidermis (FIG. 1, panel (f)).
[0269] The ability of the SPACE peptide to carry quantum dots
across the SC was also tested. For the delivery of quantum dots
into the skin, 198 .mu.L of a 100 ng/mL biotinylated peptide
solution was incubated with 2 .mu.L of QDot 525 streptavidin
conjugate (Invitrogen) for 1 hour at room temperature. The 200
.mu.L suspension was then placed into the donor compartment of the
FDC. Skin samples were harvested after 24 hours and confocal
microscopy imaging was as described above.
[0270] SPACE peptide, when conjugated to streptavidin-coated
quantum dots, led to a detectable but smaller amount of transport.
No significant penetration of quantum dots conjugated to control
peptide was observed. See, FIG. 2, panels (c) and (d) respectively.
Without intending to be bound by any particular theory, the reduced
amount of transport may be due to the relatively large size of the
quantum dots.
Example 7
[0271] Peptide Penetration in Human Skin
[0272] The ability of the SPACE peptide to penetrate human skin
when removed from phage and conjugated to an exemplary small
molecule in the form of a fluorescent tag was tested as follows.
Full thickness human skin was obtained from the National Disease
Research Interchange. The skin was stored at -80.degree. C. and
defrosted immediately prior to use. The conductivity of the skin
was measured to ensure the integrity of the skin barrier. Skin
samples with a resistivity above 50 k.OMEGA. were used for
experiments. Fluorescently labeled peptides, 200 .mu.L of a 1 mg/mL
solution, were placed in the donor compartment of the FDC. After 24
hours, the remaining solution in the donor compartment was removed
and the FDC was dismantled. The skin sample was retrieved and
rinsed with DI water to remove excess peptide or peptide complex on
the surface of the skin. Skin samples were then prepared for
imaging with confocal microscopy as discussed above.
[0273] SPACE peptide was shown to successfully cross human skin and
exhibited penetration similar to that found in porcine skin. See,
FIG. 2, panels (e) (SPACE) and (f) (control). When observed from
the top, high localization of the SPACE peptide within the
corneocytes was found whereas no significant penetration of the
control peptide was observed. See, FIG. 2, panels (g) and (h)
respectively.
Example 8
[0274] Peptide Penetration into Mouse Skin In-Vivo
[0275] The ability of the SPACE peptide to penetrate mouse skin
in-vivo was tested as follows. 200 .mu.l of fluorescently labeled
peptide (1 mg/ml) was applied on the skin of a mouse. Penetration
was assessed at various time points by harvesting the skin,
sectioning it and observing under a microscope.
[0276] SPACE peptide penetrated into mouse skin in vivo at levels
significantly higher than control peptide (FIG. 3, panels (a)-(f),
and FIG. 4, panels (a)-(f)). Application of the SPACE peptide on
mouse skin for 30 minutes (FIG. 3) resulted in penetration and
application for two hours (FIG. 4) resulted in significant
penetration into the skin and localization in the deep dermis,
consistent with that seen in porcine and human skin.
Example 9
[0277] Stratum Corneum Studies
[0278] In order to further characterize the ability of the SPACE
peptide to penetrate the SC. Experiments were conducted using
isolated SC as follows. To isolate the SC from full thickness skin,
the skin was placed in a 60.degree. C. water bath for 90 seconds.
After removal from the water bath, the epidermis was separated from
the dermis. The SC was then placed epidermis side down in a petri
dish containing 0.25% trpysin to remove the epidermis from the SC.
The SC was washed in DI water and then allowed to dry completely at
room temperature. To delipidize the SC, the SC was placed in the
following chloroform:methanol solvent mixtures: 2:1 (v/v), 1:1
(v/v), and 1:2 (v/v) for 15 minutes each. To confirm the removal of
lipids, FTIR was performed on the SC samples before and after
exposure to the solvent mixtures.
[0279] Fourier Transform Infrared (FTIR) Spectroscopy of SC
[0280] FTIR was performed on SC samples to see the effects
different peptide solutions had on the SC structure. SC was cut
into 1.5.times.1.5 cm pieces and a control spectrum was obtained
for each piece prior to exposure with peptide. 2 mL of a peptide
solution was then incubated with the SC for 24 hours. The SC
samples were then rinsed with DI water and allowed to completely
dry at room temperature. The spectra were read again for each SC
sample and the before and after spectra were compared to determine
the effect each peptide had on SC structure. Spectra were obtained
using a Nicolet Magna 850 spectrometer with a resolution of 2
cm.sup.-1 and averaged over 400 scans.
[0281] The experiments with isolated human SC revealed that the
SPACE peptide binds to corneocyte proteins, most likely to keratin
(FIG. 5, panels (a) and (b)). Fourier Transform Infrared
Spectroscopy (FTIR) studies also confirmed the effect of SPACE
peptide on keratin. Specifically, SC exposed to SPACE peptide
exhibited changes in the FTIR spectrum, indicative of structural
changes in keratin (FIG. 5, panel (c)). The control peptide had no
significant effect on protein structure in FTIR compared to that
seen in the absence of any peptide (FIG. 5 panel (d) and FIG. 6).
FTIR also showed that the SPACE peptide had no detectable effect on
SC lipids (FIG. 5, panels (e) and (f)). Neither a change in the
area of the symmetric CH.sub.2 stretching peak nor a shift in
center frequency was found indicating that the SPACE peptide did
not induce extraction or fluidization of SC lipid. Consistent with
the FTIR data, exposure to SPACE peptide did not induce a
significant change in skin's electrical conductivity (FIG. 7).
Specifically, the electrical conductivity of skin increased by
about 1.7 (+/-0.6)-fold after 24 hour incubation with the SPACE
peptide. This enhancement, though higher than that observed for the
control peptide, was relatively modest. Similarly, co-incubation of
SPACE peptide with inulin, a large hydrophilic molecule led to only
a modest increase in its permeability (FIG. 7), indicating that the
SPACE peptide is primarily effective in enhancing permeation of
conjugated but not co-administered cargos.
[0282] Without intending to be bound by any particular theory, the
primary effect of SPACE peptide may be to enhance partitioning into
the SC, primarily corneocytes, which subsequently enhances the
ability of SPACE peptides and conjugates to cross the skin barrier.
An additional effect of the peptide on penetration may also be
potentially expected due to its ability to impact keratin
structure.
Example 10
[0283] Penetration of SPACE Peptide into Viable Cells
[0284] Having confirmed the ability of the SPACE peptide to
penetrate the SC, its ability to penetrate into viable cells
including keratinocytes, fibroblasts, and endothelial cells
(HUVECs) in cell cultures was tested.
[0285] For cell penetration studies, 1.2.times.10.sup.4 cells were
seeded on poly-d-lysine-coated glass bottom culture dishes
(MatTek). For HUVEC cells, the culture dishes were coated with 1%
gelatin prior to seeding with cells. After incubation at 37.degree.
C. for 4 hours, the media was removed and 20 .mu.L of a 1 mg/mL
fluorescent peptide solution was added to 180 .mu.L of media and
subsequently added to the cell culture dish. For the control, an
equivalent amount of PBS was added in place of a peptide solution.
After addition of the peptide, cell cultures were incubated at the
appropriate condition for studying cellular penetration (4.degree.
C. or 37.degree. C.) and incubated for either 6 or 24 hours. Cells
were prepared for imaging with confocal microscopy.
[0286] Cell Culturing Conditions
[0287] Human adult epidermal keratinocytes (Invitrogen) were
cultured in EpiLife Medium (Invitrogen) supplemented with Human
Keratinocyte Growth Supplement (Invitrogen), human skin fibroblasts
(ATCC) were cultured in Dulbecco's Modified Eagle's Medium (ATCC)
supplemented with 10% fetal bovine serum, pooled human umbilical
vein endothelial cells (HUVEC, Lonza) were cultured in M199 medium
on 1% gelatin-coated flasks supplemented with 15% fetal bovine
serum, 15 .mu.g/mL endothelial cell growth supplement, 100 .mu.g/mL
heparin, and 2 mM L-glutamine, and MDA-MB-231 breast cancer cells
were cultured in Dulbecco's Modified Eagle's Medium (ATCC)
supplemented with 10% fetal bovine serum. All cell culture media
were supplemented with 100 U/mL pencillin and 100 .mu.g/mL
streptomycin and cultures were grown under standard cell culture
conditions (37.degree. C. with 5% CO.sub.2).
[0288] Preparation of Cell Culture Samples for Confocal Microscopy
Imaging
[0289] After incubation, cells were washed with Hank's Balanced
Salt Solution (HBSS, Lonza) and incubated with 1% trypan blue for 5
minutes to quench any fluorescence on the surface of the cell. The
cells were then fixed with 4% paraformaldehyde for 3 minutes and
again washed in HBSS. The cells were then incubated with Hoechest
33342 (5 .mu.g/mL) for 5 minutes and then washed in HBSS. The cell
culture dishes were then filled with HBSS and imaged using confocal
microscopy (Olympus Fluoview 500).
[0290] Significant penetration of SPACE peptide was demonstrated
for all cell lines (FIG. 8, panels (a)-(f)), FIG. 8, panel (g)
shows a magnified view of SPACE peptide internalization in
keratinocytes). In all cases, the extent of internalization of
SPACE peptide was higher than that of control peptide indicating
that cellular penetration occurred in a sequence-specific manner
(FIG. 8, panel (h)). SPACE peptide also exhibited internalization
in breast cancer cells (MD-MB-23, FIG. 9, panels (a)-(c)). The
ability to penetrate all tested types of cells suggest that the
mode of entry into cells for SPACE is through a pathway that is
common to all studied cell lines and not due to a particular
membrane protein unique to keratinocytes.
Example 11
[0291] Cell Penetration Mechanism Studies
[0292] To determine the potential mechanism of cellular penetration
for SPACE peptide, the effect of several endocytosis inhibitors
including incubation at 4.degree. C. on internalization was tested
in human keratinocytes (See, FIG. 10, panel (a)).
[0293] Endocytosis Inhibitors
[0294] For cell mechanism studies, cells were incubated with
various endocytosis inhibitors or at 4.degree. C. for 1 hour prior
to the addition of fluorescently labeled peptides. The endocytosis
inhibitors used were EIPA (Invitrogen) and chlorpromazine,
nystatin, and deoxy-D-glucose (Sigma). EIPA was dissolved in DMSO
and used at a concentration of 100 .mu.M. Chlorpromazine, nystatin,
and deoxy-D-glucose were dissolved in sterile water and used at the
concentrations of 10 .mu.g/mL, 25 .mu.g/mL, and 5 mM respectively.
Cells were incubated with fluorescently labeled peptide for 3 hours
and then harvested for analysis using flow cytometry.
[0295] Preparation of Samples for Flow Cytometry
[0296] After incubation with fluorescently labeled peptide, the
media was removed and cells were washed 3 times for 5 minutes each
in HBSS to remove residual fluorescence. 0.25% trypsin (HyClone)
was used to remove the cells from the cell culture plate. The cells
were then centrifuged at 5,000 rpm for 5 minutes to pellet the
cells. The cell pellet was resuspended in PBS, pH 7.4 on ice and
samples were analyzed using the FACS Aria flow cytometer.
[0297] Incubation at 4.degree. C. significantly reduced
internalization of SPACE peptide (about 5% uptake compared to that
at 37.degree. C.) as well as the control peptide indicating that
both enter cells through an active mechanism (FIG. 10, panel (a)).
This was further confirmed by the use of deoxy-D-glucose which also
resulted in the reduction of internalization of both peptides
(.about.52%) (FIG. 10, panel (a)). To further assess the nature of
the active uptake, cells were incubated with the clathrin-mediated
endocytosis inhibitor chlorpromazine and the caveolae-mediated
endocytosis inhibitor nystatin. Neither of them reduced the
cellular internalization of SPACE peptide or the control peptide
(FIG. 10, panel (a)). Finally, the effect of a macropinocytosis
inhibitor 5-(N-ethyl-N-isopropyl) amiloride, EIPA, was tested.
Exposure of cells to EIPA resulted in approximately 50% reduction
in SPACE internalization (FIG. 10, panel (a)). In contrast, EIPA
had no effect on control peptide internalization. Collectively,
these results suggest that macropinocytosis plays a major role in
the internalization of SPACE peptide, a conclusion that is shared
by other cell penetrating peptides in the literature (Nakase I, et
al. (2004) Cellular uptake of arginine-rich peptides: roles for
macropinocytosis and actin rearrangement. Mol Ther
10(6):1011-1022., Patel L N, Zaro J L, & Shen W C (2007) Cell
penetrating peptides: intracellular pathways and pharmaceutical
perspectives. Pharm Res 24(11):1977-1992.). Studies have reported
that cargoes that are internalized by macropinocytosis are often
not co-localized with endo/lysosomes implying that their entry into
degrading lysosomal compartment can be potentially avoided (Tamaru
M, Akita H, Fujiwara T, Kajimoto K, & Harashima H (2010)
Leptin-derived peptide, a targeting ligand for mouse brain-derived
endothelial cells via macropinocytosis. Biochem Biophys Res Commun
394(3):587-592., Walsh M, et al. (2006) Evaluation of cellular
uptake and gene transfer efficiency of pegylated poly-L-lysine
compacted DNA: implications for cancer gene therapy. Mol Pharm
3(6):644-653.). MTT assays on keratinocyte cultures revealed that
the SPACE peptide was not toxic to cells at the concentration range
studied here (0.1-1.0 mg/mL, FIG. 10, panel (b)).
Example 12
[0298] GFP Knockdown Using SPACE Peptide-Conjugated siRNA
[0299] The ability of SPACE peptide to penetrate into a variety of
cells makes it an excellent candidate for siRNA delivery. This
possibility was explored using green fluorescent protein
(GFP)-expressing endothelial cells as a model cell line in
vitro.
[0300] GFP-expressing endothelial cells (ATCC) were grown in
Dulbecco's Modified Eagle's Medium supplemented with 10% fetal
bovine serum. GFP siRNA, 5'-GAC GUA AAC GGC CAC AAG UUC N6-3' (SEQ
ID NO:26) (Dharmacon), was conjugated to fluorescently labeled
peptide (containing a free carboxyl group) through EDC
chemistry.
[0301] A 10 mM peptide solution was incubated with a 10 mM solution
of N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride
(EDAC, Sigma) and a 9.5 mM solution of N-Hydroxysulfosuccinimide
sodium salt (NHS, Sigma) in equal parts in MES buffer (pH 5.5) for
15 minutes. The amine modified siRNA was then added to the mixture
to conjugate the peptide to siRNA and allowed to mix overnight.
[0302] The peptide-siRNA complex was added to the appropriate cell
culture media to obtain a final concentration of 1 .mu.M siRNA. The
media along with peptide-siRNA was then added to the cells and
allowed to incubate for 48 hours. Cells were imaged using confocal
microscopy and image analysis was performed using ImageJ to
determine the overall fluorescence intensity for each cell.
Knockdown was determined as the percent of cells in the test case
that possess intensity at least 30% lower than the mean intensity
observed for the population in control case (no treatment).
[0303] SPACE peptide-conjugated siRNA induced significant knockdown
of GFP (FIG. 11, panel (a)). In contrast, no significant knockdown
was observed with siRNA alone, SPACE alone, SPACE conjugated to a
control siRNA, or control peptide conjugated to siRNA. To determine
whether siRNA conjugation to SPACE peptide had an adverse effect on
the potency of siRNA, both unconjugated siRNA and SPACE-siRNA were
complexed with Lipofectmine.TM. and knockdown was assessed. In both
cases, knockdown was significant compared to control, that is, no
siRNA treatment (FIG. 9, panels (d)-(f)).
Example 13
[0304] Dermal Penetration Using Peptide-Conjugated IL-10 siRNA
In-Vivo
[0305] The ability of SPACE peptide to enhance dermal penetration
of IL-10 siRNA was assessed as follows. This siRNA was selected due
to its potential for treating atopic dermatitis, a major
dermatological disease. Due to the insignificant knockdown seen
with control peptide and the lack of skin penetration in vivo when
compared to SPACE peptide, the control peptide was not assessed in
the in vivo siRNA studies.
[0306] The siRNA sequences used in the in vivo studies are the
following: IL-10: 5'-GAA UGA AUU UGA CAU CUU CUU N6-3' (SEQ ID
NO:27), and luciferase (control): 5'-UAA GGC UAU GAA GAG AUA CUU
N6-3' (SEQ ID N0:28). The 2-O-methyl modification was placed on all
bases for IL-10. All siRNAs were purchased from Dharmacon.
[0307] siRNA delivery was performed in female Balb/C mice (Charles
River Laboratories) between 6-8 weeks old according to protocols
approved by the Institutional Animal Care and Use Committee. Mice
were placed under anesthesia (1-2% isofluorane) and the hair on
their back was lightly shaved. 200 .mu.L of a 10 .mu.M of
peptide-siRNA solution or corresponding controls were topically
applied over a 3 cm.sup.2 area on the back of the animal. The
solution was then covered with sterile gauze and a breathable
bandage. After 24 hours, the mice were euthanized using CO.sub.2
and skin samples were immediately taken using a 4 mm biopsy punch.
Two 4 mm biopsies were randomly taken from the treatment area and
immediately frozen in liquid nitrogen. The skin was then placed in
a surfactant combination of 0.5% (w/v) 3-(Decyl dimethyl ammonio)
propane sulfonate (DPS) and Brij 30 and homogenized (IKA disperser)
on ice for 1 minute to extract the proteins from the skin samples.
The homogenate was then centrifuged at 10,000 rpm for 5 minutes and
the supernatant was collected. The total protein concentration was
determined using the Micro BCA Protein Assay Kit (Pierce), IL-10
levels were determined using a mouse IL-10 ELISA (Raybiotech).
[0308] Application of IL-10 siRNA alone without the peptide
produced no significant effect on IL-10 levels compared to mice
that received no treatment, SPACE peptide alone, or SPACE
conjugated to luciferase siRNA (control siRNA). In contrast,
animals treated with SPACE conjugated to IL-10 siRNA and SPACE
conjugated to 2-O-methyl modified IL-10 siRNA showed significant
reduction in IL-10 levels (FIG. 11, panel (b)).
Example 14
[0309] Dermal Penetration Using Peptide-Conjugated GAPDH siRNA
In-Vivo
[0310] As another example, SPACE peptide was conjugated to
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) siRNA and its
effect on skin GAPDH levels was assessed as follows. This target
was chosen since GAPDH is a common housekeeping protein and
provides an example of a common siRNA target.
[0311] The siRNA sequences used in the in vivo studies are the
following: GAPDH: 5'-GUG UGA ACC ACG AGA AAU AUU N6-3' (SEQ ID
NO:29), and luciferase (control): 5'-UAA GGC UAU GAA GAG AUA CUU
N6-3' (SEQ ID NO:28). All siRNAs were purchased from Dharmacon.
[0312] siRNA delivery was performed in female Balb/C mice (Charles
River Laboratories) between 6-8 weeks old according to protocols
approved by the Institutional Animal Care and Use Committee. Mice
were placed under anesthesia (1-2% isofluorane) and the hair on
their back was lightly shaved. 200 .mu.L of a 1004 of peptide-siRNA
solution or corresponding controls were topically applied over a 3
cm.sup.2 area on the back of the animal. The solution was then
covered with sterile gauze and a breathable bandage. After 72 hours
for, the mice were euthanized using CO.sub.2 and skin samples were
immediately taken using a 4 mm biopsy punch. Two 4 mm biopsies were
randomly taken from the treatment area and immediately frozen in
liquid nitrogen. The skin was then placed in a surfactant
combination of 0.5% (w/v) 3-(Decyl dimethyl ammonio) propane
sulfonate (DPS) and Brij 30 and homogenized (IKA disperser) on ice
for 1 minute to extract the proteins from the skin samples. The
homogenate was then centrifuged at 10,000 rpm for 5 minutes and the
supernatant was collected. The total protein concentration was
determined using the Micro BCA Protein Assay Kit (Pierce). GAPDH
levels were measured using the Kdalert.TM. GAPDH Assay kit
(Ambion).
[0313] Animals treated with SPACE-GAPDH siRNA conjugate induced
significant reduction in protein levels compared to controls (no
treatment, siRNA alone, SPACE peptide alone and SPACE-conjugated to
control siRNA, FIG. 11, panel (c)). Knockdown of GAPDH in skin was
dose dependent; 43% knockdown was observed at 1004, 21% knockdown
at 504, and 10% knockdown at 1 .mu.M (FIG. 11, panel (d)).
Knockdown was also dependent on application time with longer
application times resulting in higher knockdown (FIG. 12).
Sequence CWU 1
1
2917PRTArtificial Sequenceidentified using phage display 1Thr Gly
Ser Thr Gln His Gln 1 5 27PRTArtificial Sequenceidentified using
phage display 2His Ser Ala Leu Thr Lys His 1 5 37PRTArtificial
Sequenceidentified using phage display 3Lys Thr Gly Ser His Asn Gln
1 5 47PRTArtificial Sequenceidentified using phage display 4Met Gly
Pro Ser Ser Met Leu 1 5 57PRTArtificial Sequenceidentified using
phage display 5Thr Asp Pro Asn Gln Leu Gln 1 5 67PRTArtificial
Sequenceidentified using phage display 6Ser Thr His Phe Ile Asp Thr
1 5 79PRTArtificial Sequenceidentified using phage display 7Cys Thr
Gly Ser Thr Gln His Gln Cys 1 5 89PRTArtificial Sequenceidentified
using phage display 8Cys His Ser Ala Leu Thr Lys His Cys 1 5
99PRTArtificial Sequenceidentified using phage display 9Cys Lys Thr
Gly Ser His Asn Gln Cys 1 5 109PRTArtificial Sequenceidentified
using phage display 10Cys Met Gly Pro Ser Ser Met Leu Cys 1 5
119PRTArtificial Sequenceidentified using phage display 11Cys Thr
Asp Pro Asn Gln Leu Gln Cys 1 5 129PRTArtificial Sequenceidentified
using phage display 12Cys Ser Thr His Phe Ile Asp Thr Cys 1 5
1311PRTArtificial Sequenceidentified using phage display 13Ala Cys
Thr Gly Ser Thr Gln His Gln Cys Gly 1 5 10 1411PRTArtificial
Sequenceidentified using phage display 14Ala Cys His Ser Ala Leu
Thr Lys His Cys Gly 1 5 10 1511PRTArtificial Sequenceidentified
using phage display 15Ala Cys Lys Thr Gly Ser His Asn Gln Cys Gly 1
5 10 1611PRTArtificial Sequenceidentified using phage display a
16Ala Cys Met Gly Pro Ser Ser Met Leu Cys Gly 1 5 10
1711PRTArtificial Sequenceidentified using phage display 17Ala Cys
Thr Asp Pro Asn Gln Leu Gln Cys Gly 1 5 10 1811PRTArtificial
Sequenceidentified using phage display 18Ala Cys Ser Thr His Phe
Ile Asp Thr Cys Gly 1 5 10 196DNAArtificial Sequenceportion of
artificial DNA sequence, specifically a vector restriction site.
19cggccg 6 206DNAArtificial Sequenceportion of artificial DNA
sequence, specifically a vector restriction site. 20ccgcgg 6
2139DNAArtificial Sequenceforward primer 21gttccgcgga aactgttgaa
agttgtttag caaaatccc 39227PRTArtificial Sequenceportion of a
control peptide amino acid sequence 22Thr His Gly Gln Thr Gln Ser 1
5 23102DNAArtificial Sequencereverse primer 23tttccgcgga acctccaccg
cactgatgct gctcgaacca gtacaagcag agtgagaata 60gaaaggtact actaaaggaa
ttgcgaataa taattttttc ac 1022482DNAArtificial Sequencereverse
primer 24tttccgcgga acctccaccg caacaagcag agtgagaata gaaaggtact
actaaaggaa 60ttgcgaataa taattttttc ac 822511PRTArtificial
Sequencecontrol peptide amino acid sequence 25Ala Cys Thr His Gly
Gln Thr Gln Ser Cys Gly 1 5 10 2621RNAArtificial SequenceGreen
Fluorescent Protein (GFP) siRNA 26gacguaaacg gccacaaguu c
212721RNAArtificial SequenceInterleukin-10 (IL-10) siRNA sequence
27gaaugaauuu gacaucuucu u 212821RNAArtificial Sequenceluciferase
(control) siRNA sequence siRNA sequence 28uaaggcuaug aagagauacu u
212921RNAArtificial Sequenceglyceraldehyde 3-phosphate
dehydrogenase (GAPDH) siRNA sequence 29gugugaacca cgagaaauau u
21
* * * * *
References