U.S. patent application number 15/217838 was filed with the patent office on 2017-06-08 for immunoglobulin variants and uses thereof.
The applicant listed for this patent is Genentech, Inc.. Invention is credited to Camellia W. ADAMS, Andrew C. CHAN, Craig W. CROWLEY, Henry B. LOWMAN, Gerald R. NAKAMURA, Leonard G. PRESTA.
Application Number | 20170158773 15/217838 |
Document ID | / |
Family ID | 32685285 |
Filed Date | 2017-06-08 |
United States Patent
Application |
20170158773 |
Kind Code |
A1 |
ADAMS; Camellia W. ; et
al. |
June 8, 2017 |
IMMUNOGLOBULIN VARIANTS AND USES THEREOF
Abstract
The invention provides humanized and chimeric anti-CD20
antibodies for treatment of CD20 positive malignancies and
autoimmune diseases.
Inventors: |
ADAMS; Camellia W.;
(Mountain View, CA) ; CHAN; Andrew C.; (Menlo
Park, CA) ; CROWLEY; Craig W.; (Del Mar, CA) ;
LOWMAN; Henry B.; (El Granada, CA) ; NAKAMURA; Gerald
R.; (San Francisco, CA) ; PRESTA; Leonard G.;
(San Francisco, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genentech, Inc. |
South San Francisco |
CA |
US |
|
|
Family ID: |
32685285 |
Appl. No.: |
15/217838 |
Filed: |
July 22, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14029717 |
Sep 17, 2013 |
|
|
|
15217838 |
|
|
|
|
12256349 |
Oct 22, 2008 |
8562992 |
|
|
14029717 |
|
|
|
|
11147780 |
Jun 7, 2005 |
7799900 |
|
|
12256349 |
|
|
|
|
PCT/US03/40426 |
Dec 16, 2003 |
|
|
|
11147780 |
|
|
|
|
60526163 |
Dec 1, 2003 |
|
|
|
60434115 |
Dec 16, 2002 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 19/02 20180101;
A61P 29/00 20180101; C07K 2317/72 20130101; C07K 2317/92 20130101;
A61P 13/12 20180101; A61K 2039/505 20130101; A61P 15/08 20180101;
A61P 17/14 20180101; A61P 37/02 20180101; A61P 35/02 20180101; C07K
2317/567 20130101; A61P 31/06 20180101; C07K 2317/56 20130101; A61P
5/40 20180101; A61P 7/06 20180101; A61P 9/14 20180101; C07K 2317/73
20130101; A61P 1/04 20180101; A61P 7/04 20180101; A61P 25/00
20180101; A61P 37/06 20180101; A61P 1/00 20180101; A61P 5/14
20180101; A61P 27/16 20180101; A61P 31/18 20180101; A61P 21/04
20180101; C07K 2317/522 20130101; A61P 35/00 20180101; C07K 16/2887
20130101; C07K 2317/75 20130101; A61P 5/00 20180101; A61P 17/06
20180101; A61P 27/02 20180101; C07K 2317/24 20130101; C07K 2317/52
20130101; A61P 37/00 20180101; C07K 2317/41 20130101; C07K 2317/734
20130101; A61P 9/00 20180101; A61P 11/02 20180101; A61P 43/00
20180101; C07K 2317/732 20130101; A61P 9/10 20180101; A61P 11/08
20180101; A61P 17/02 20180101; A61P 37/08 20180101; C07K 2317/55
20130101; A61P 1/12 20180101; A61P 11/00 20180101; A61P 11/06
20180101; A61P 17/00 20180101; C07K 2317/565 20130101; A61P 1/16
20180101; A61P 3/10 20180101; A61P 9/08 20180101 |
International
Class: |
C07K 16/28 20060101
C07K016/28 |
Claims
1-81. (canceled)
82. An isolated nucleic acid encoding an antibody that binds to
human CD20 or an antigen-binding fragment thereof, wherein the
antibody heavy chain variable region comprises the amino acid
sequence of SEQ ID NO:8 with amino acid substitutions D56A and
N100A and the antibody light chain variable region comprises the
amino acid sequence of SEQ ID NO:2 with amino acid substitution
S92A.
83. A vector comprising the nucleic acid of claim 82.
84. An isolated host cell comprising the nucleic acid of claim
82.
85. An isolated host cell comprising the vector of claim 83.
86. An isolated host cell comprising a first vector comprising a
nucleic acid encoding the heavy chain variable region (VH) of an
antibody or antigen-binding fragment thereof, and a second vector
comprising a nucleic acid encoding the light chain variable region
(VL) of the antibody or antigen-binding fragment thereof, wherein
the antibody heavy chain variable region comprises the amino acid
sequence of SEQ ID NO:8 with amino acid substitutions D56A and
N100A and the antibody light chain variable region comprises the
amino acid sequence of SEQ ID NO:2 with amino acid substitution
S92A; and wherein the antibody binds to human CD20.
87. A method of producing an antibody that binds to human CD20 or
an antigen-binding fragment thereof, encoded by the nucleic acid
present in the host cell of claim 84, comprising culturing the host
cell under suitable conditions so that the antibody or
antigen-binding fragment thereof is produced.
88. A method of producing an antibody that binds to human CD20 or
an antigen-binding fragment thereof, encoded by the nucleic acid in
the vector present in the host cell of claim 85, comprising
culturing the host cell under suitable conditions so that the
antibody or antigen-binding fragment thereof is produced.
89. A method of producing an antibody that binds to human CD20 or
antigen-binding fragment thereof, comprising culturing a host cell
under conditions so that the antibody or antigen-binding fragment
is produced, wherein the host cell comprises a first vector and a
second vector encoding the antibody or antigen-binding fragment
thereof, wherein the first vector comprises a nucleic acid encoding
the heavy chain variable region (VH) of the antibody, and the
second vector comprises a nucleic acid encoding the light chain
variable region (VL) of the antibody, wherein the antibody heavy
chain variable region comprises the amino acid sequence of SEQ ID
NO:8 with amino acid substitutions D56A and N100A and the antibody
light chain variable region comprises the amino acid sequence of
SEQ ID NO:2 with amino acid substitution S92A.
Description
[0001] This is a continuation application of U.S. patent
application Ser. No. 12/256,349 filed Oct. 22, 2008, which is a
divisional of Ser. No. 11/147,780, filed Jun. 7, 2005, U.S. Pat.
No. 7,799,900 issued Sep. 21, 2010, which is a continuation
application of international patent application number
PCT/US03/40426, filed Dec. 16, 2003, which claims benefit of
provisional application Ser. No. 60/526,163, filed on Dec. 1, 2003
and provisional application Ser. No. 60/434,115, filed on Dec. 16,
2002, which applications are incorporated herein by reference in
their entirety.
SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE
[0002] The content of the following submission on ASCII text file
is incorporated herein by reference in its entirety: a computer
readable form (CRF) of the Sequence Listing (file name:
146392006003SeqListing.txt, date recorded: Dec. 9, 2013, size: 119
KB).
FIELD OF THE INVENTION
[0003] The invention relates to anti-CD20 antibodies and their use
in the treatment of B-cell related diseases.
BACKGROUND OF THE INVENTION
[0004] Lymphocytes are one of several populations of white blood
cells; they specifically recognize and respond to foreign antigen.
The three major classes of lymphocytes are B lymphocytes (B cells),
lymphocytes (T cells) and natural killer (NK) cells. B lymphocytes
are the cells responsible for antibody production and provide
humoral immunity. B cells mature within the bone marrow and leave
the marrow expressing an antigen-binding antibody on their cell
surface. When a naive B cell first encounters the antigen for which
its membrane-bound antibody is specific, the cell begins to divide
rapidly and its progeny differentiate into memory B cells and
effector cells called "plasma cells". Memory B cells have a longer
life span and continue: to express membrane-bound antibody with the
same specificity as the original parent cell. Plasma cells do not
produce membrane-bound antibody but instead produce secreted form
of the antibody. Secreted antibodies are the major effector
molecules of humoral immunity.
[0005] The CD20 antigen (also called human B-lymphocyte-restricted
differentiation antigen, Bp35) is a hydrophobic transmembrane
protein with a molecular weight of approximately 35 kD located on
pre-B and mature B lymphocytes (Valentine et al, J. Biol. Chem.
264(19):11282-11287 (1989); and Einfeld et al. EMBO J. 7(3):711-717
(1988)). The antigen is also expressed on greater than 90% of B
cell non-Hodgkin's lymphomas (NHL) (Anderson et al. Blood
63(6):1424-1433 (1984)), but is not found on hematopoietic stem
cells, pro-B cells, normal plasma cells or other normal tissues
(Tedder et al. J. Immunol. 135(2):973-979 (1985)). CD20 is thought
to regulate an early step(s) in the activation process for cell
cycle initiation and differentiation (Tedder et al., supra) and
possibly functions as a calcium ion channel (Tedder et al. J. Cell.
Biochem. 14D:195 (1990)).
[0006] Given the expression of CD20 in B cell lymphomas, this
antigen has been a useful therapeutic target to treat such
lymphomas, There are more than 300,000 people in the United States
with B-cell NHL and more than 56,000 new cases are diagnosed each
year. For example, the rituximab (RITUXAN.RTM.) antibody which is a
genetically engineered chimeric; murine human monoclonal antibody
directed against human CD20 antigen (commercially available from
Genentech, Inc., South San Francisco, Calif., U.S.) is used for the
treatment of patients with relapsed or refractory low-grade or
follicular, CD20 positive, B cell non-Hodgkin's lymphoma. Rituximab
is the antibody referred to as "C2B8" in U.S. Pat. No. 5,736,137
issued Apr. 7, 1998 (Anderson at al.) and in U.S. Pat. No.
5,776,456. In vitro mechanism of action studies have demonstrated
that RITUXAN.RTM. binds human complement and lyses lymphoid B cell
lines through complement-dependent cytotoxicity (CDC) (Reff et al.
Blood 83(2):435-445 (1994)). Additionally, it has significant
activity in assays for antibody-dependent cellular cytotoxicity
(ADCC). In vivo preclinical studies have shown that RITUXAN.RTM.
depletes B cells from the peripheral blood, lymph nodes, and bone
marrow of cynomolgus monkeys, presumably through complement and
cell-mediated processes (Reff et al. Blood 83(2):435-445 (1994)).
Other anti-CD20 antibodies indicated for the treatment of NHL
include the murine antibody Zevalin.TM. which is linked to the
radioisotope, Yttrium-90 (IDEC Pharmaceuticals. San Diego, Calif.),
Bexxar.TM. which is a another fully murine antibody conjugated to
1-131 (Corixa, Wash.).
[0007] A major limitation in the use of murine antibodies in human
therapy is the human anti-mouse antibody (HAMA) response (see,
e.g., Miller, R. A. et al. "Monoclonal antibody therapeutic trials
in seven patients with T-cell lymphoma" Blood, 62:988-995, 1983;
and Schroff, R. W., et al. "Human anti-murine immunoglobulin
response in patients receiving monoclonal antibody therapy" Cancer
Res., 45:879-885, 1985). Even chimeric molecules, where the
variable (V) domains of rodent antibodies are fused to human
constant (C) regions, are still capable of eliciting a significant
immune response (HACA, human anti-chimeric antibody) (Neuberger et
al. Nature (Lond.), 314:268-270, 1985). A powerful approach to
overcome these limitations in the clinical use of monoclonal
antibodies is "humanization" of the murine antibody or antibody
from a nonhuman species (Jones et al. Nature (Lond), 321:522-525,
1986; Riechman et al., Nature (Lond), 332:323-327, 1988).
[0008] Thus, it is beneficial to produce therapeutic antibodies to
the CD20 antigen that create minimal or no antigenicity when
administered to patients, especially for chronic treatment. The
present invention satisfies this and other needs. The present
invention provides anti-CD20 antibodies that overcome the
limitations of current therapeutic compositions as well as offer
additional advantages that will be apparent from the detailed
description below.
SUMMARY OF THE INVENTION
[0009] The present invention provides CD20 binding antibodies or
functional fragments thereof, and their use in the treatment of
B-cell associated diseases. These antibodies are monoclonal
antibodies. In specific embodiments, the antibodies that bind CD20
are humanized or chimeric. The humanized 2H7 variants include those
that have amino acid substitutions in the FR and affinity
maturation variants with changes in the grafted CDRs. The
substituted amino acids in the CDR or FR are not limited to those
present in the donor or recipient antibody. In other embodiments,
the anti-CD20 antibodies of the invention further comprise changes
in amino acid residues in the Fc region that lead to improved
effector function including enhanced CDC and/or ADCC function and
B-cell killing (also referred to herein as B-cell depletion). Other
anti-CD20 antibodies of the invention include those having specific
changes that improve stability. In a specific embodiment, the
humanized 2H7 variants with increased stability are as described in
example 6 below. Fucose deficient variants having improved ADCC
function in vivo are also provided. In one embodiment, the chimeric
anti-CD20 antibody has murine V regions and human C region. One
such specific chimeric anti-CD20 antibody is Rituxan.RTM.
(Rituximab.RTM.; Genentech, Inc.).
[0010] In a preferred embodiment of ail of the antibody
compositions and methods of use of this invention, the humanized
CD20 binding antibody is 2H7.v16 having the light and heavy chain
amino acid sequence of SEQ ID NO. 21 and 22, respectively, as shown
in FIG. 6 and FIG. 7. When referring to the polypeptide sequences
in FIGS. 6, 7 and 8, it should be understood that the first 19 or
so amino acids that form the secretory signal sequence are not
present in the mature polypeptide. The V region of all other
variants based on version 16 will have the amino acid sequences of
v16 except at the positions of amino acid substitutions which are
indicated in the disclosure. Unless otherwise indicated, the 2H7
variants will have the same L chain as that of v16.
[0011] The invention provides a humanized antibody that binds human
CD20, or an antigen-binding fragment thereof, wherein the antibody
is effective to deplete primate B cells in vivo, the antibody
comprising in the H chain Variable region (V.sub.H) at least a CDR3
sequence of SEQ ID NO. 12 from an anti-human CD20 antibody and
substantially the human consensus framework (FR) residues of human
heavy chain subgroup III (V.sub.HIII). In one embodiment, the
primate B cells are from human and Cynornolgus monkey. In one
embodiment, the antibody further comprises the H chain CDR1
sequence of SEQ ID NO. 10 and CDR2 sequence of SEQ ID NO. 11. In
another embodiment, the preceding antibody comprises the L chain
CDR1 sequence of SEQ ID NO. 4, CDR2 sequence of SEQ ID NO. 5, CDR3
sequence of SEQ ID NO. 6 with substantially the human consensus
framework (FR) residues of human light chain .kappa. subgroup I
(V.kappa.I). In a preferred embodiment, the FR region in V.sub.L
has a donor antibody residue at position 46; in a specific
embodiment, FR2 in V.sub.L has an amino acid substitution of
leuL46pro (Leu in the human 1.kappa.I consensus sequence changed to
pro which is present in the corresponding position in m2H7). The VH
region further comprises a donor antibody residue at at least amino
acid positions 49, 71 and 73 in the framework. In one embodiment,
in the V.sub.H, the following FR positions in the human heavy chain
subgroup III are substituted: AlaH49Gly in FR2; ArgH71Val and
AsnH73Lys in FR3. In other embodiments, the CDR regions in the
humanized antibody further comprise amino acid substitutions where
the residues are neither from donor nor recipient antibody.
[0012] The antibody of the preceding embodiments can comprise the
V.sub.H sequence of SEQ ID NO.8 of v16, as shown in FIG. 1B. In a
further embodiment of the preceding, the antibody further comprises
the V.sub.L L sequence of SEQ ID NO.2 of v16, as shown in FIG.
1A.
[0013] In other embodiments, the humanized antibody is 2H7.v31
having the tight and heavy chain amino acid sequence of SEQ ID NO.
21 and 23, respectively, as shown in FIG. 6 and FIG. 8; 2H7.v31
having the heavy chain amino acid sequence of SEQ ID NO. 23 as
shown in FIG. 8; 2H7.v96 with the amino acid substitutions of D56A
and N100A in the H chain and S92A in the L chain of v16.
[0014] In separate embodiments, the antibody of any of the
preceding embodiments further comprises at least one amino acid
substitution in the Fc region that improves ADCC and/or CDC
activity over the original or parent antibody from which it was
derived, v.16 being the parent antibody being compared to in most
cases, and Rituxan in other cases. One such antibody with improved
activity comprises the triple Alanine substitution of
S298.A/E333A/K334A in the Pc region. One antibody having
8298A/E333A/K334A substitution is 2H7.v31 having the heavy chain
amino acid sequence of SEQ ID NO. 23. Antibody 2H7.v114 and
2H7.v115 show at least 10-fold improved ADCC activity as compared
to Rituxan.
[0015] In another embodiment, the antibody further comprises at
least one amino acid substitution in the Fc region that decreases
CDC activity as compared to the parent antibody from which it was
derived which is v16 in most cases. One such antibody with
decreased CDC activity as compared to v16 comprises at least the
substitution K322A in the II chain. The comparison of ADCC and CDC
activity can be assayed as described in the examples.
[0016] In a preferred embodiment, the antibodies of the invention
are full length antibodies wherein the V.sub.H region is joined to
a human IgG heavy chain constant region. In preferred embodiments,
the IgG is human IgG1 or IgG3.
[0017] In one embodiment, the CD20 binding antibody is conjugated
to a cytotoxic agent. In preferred embodiments the cytotoxic agent
is a toxin or a radioactive isotope.
[0018] In one embodiment, the antibodies of the invention for use
in therapeutic or diagnostic purposes are produced in CHO
cells.
[0019] Also provided is a composition comprising an antibody of any
one of the preceding embodiments, and a carrier. In one embodiment,
the carrier is a pharmaceutically acceptable carrier. These
compositions can be provided in an article of manufacture or a
kit.
[0020] The invention also provided a liquid formulation comprising
a humanized 2H7 antibody at 20 mg/mL antibody, 10 mM histidine
sulfate pH5.8, 60 mg/ml sucrose (6%), 0.2 mg/ml polysorbate 20
(0.02%).
[0021] The invention also provides an isolated nucleic acid that
encodes any of the antibodies disclosed herein, including an
expression vector for expressing the antibody.
[0022] Another aspect of the invention are host cells comprising
the preceding nucleic acids,and host cells that produce the
antibody. In a preferred embodiment of the latter, the host cell is
a CHO cell. A method of producing these antibodies is provided, the
method comprising culturing the host cell that produces the
antibody and recovering the antibody from the cell culture.
[0023] Yet another aspect of the invention is an article of
manufacture comprising a container and a composition contained
therein, wherein the composition comprises an antibody of any of
the preceding embodiments. For use in treating NHL, the article of
manufacture further comprises a package insert indicating that the
composition is used to treat non-Hodgkin's lymphoma.
[0024] A further aspect of the invention is a method of inducing
apoptosis in B cells in vivo, comprising contacting B cells with
the antibody of any of the preceding, thereby killing the B
cells.
[0025] The invention also provides methods of treating the diseases
disclosed herein by administration of a CD20 binding antibody or
functional fragment thereof, to a mammal such as a human patient
suffering from the disease. In any of the methods for treating an
autoimmune disease or a CD20 positive cancer, in one embodiment,
the antibody is 2H7.v16 having the light and heavy chain amino acid
sequence of SEQ ID NO. 21 and 22, respectively, as shown in FIGS. 6
and FIG. 7. Thus, one embodiment is a method of treating a CD20
positive cancer, comprising administering to a patient suffering
from the cancer, a therapeutically effective amount of a humanized
CD20 binding antibody of the invention. In preferred embodiments,
the CD20 positive cancer is a B cell lymphoma or leukemia including
non-Hodgkin's lymphoma (NHL) or lymphocyte predominant Hodgkin's
disease (LPHD), chronic lymphocytic leukemia (CLL) or SLL. In one
embodiment of the method of treating a B cell lymphoma or leukemia,
the antibody is administered at a dosage range of about 275-375
mg/m.sup.2. In additional embodiments, the treatment method further
comprises administering to the patient at least one
chemotherapeutic agent, wherein for non-Hodgkin's lymphoma (NHL),
the chemotherapeutic agent is selected from the group consisting of
doxorubicin, cyclophosphamide, vincristine and prednisolone.
[0026] Also provided is a method of treating an autoimmune disease,
comprising administering to patient suffering from the autoimmune
disease, a therapeutically effective amount of the humanized CD20
binding antibody of any one of the preceding claims. The autoimmune
disease is selected from the group consisting of rheumatoid
arthritis, juvenile rheumatoid arthritis, systemic lupus
erythematosus (SLE), Wegener's disease, inflammatory bowel disease,
idiopathic thrombocytopenic purpura (ITP), thrombotic
thrombocytopenic purpura (TTP), autoimmune thrombocytopenia,
multiple sclerosis, psoriasis, IgA nephropathy, IgM
polyneuropathies, myasthenia gravis, vasculitis, diabetes mellitus,
Reynaud's syndrome, Sjorgen's syndrome and glomerulonephritis.
Where the autoimmune disease is rheumatoid arthritis, the antibody
can be administered in conjunction with a second therapeutic agent
which is preferably methotrexate.
[0027] In these treatment methods, the CD20 binding antibodies can
he administered alone or in conjunction with a second therapeutic
agent such as a second antibody, or a chemotherapeutic agent or an
immunosuppressive agent. The second antibody can he one that binds
CD20 or a different B cell antigen, or a NK or T cell antigen. In
one embodiment, the second antibody is a radiolabeled anti-CD20
antibody. In other embodiments, the CD20 binding antibody is
conjugated to a cytotoxic agent including a toxin or a radioactive
isotope.
[0028] In another aspect, the invention provides a method of
treating an autoimmune disease selected from the group consisting,
of Dermatomyositis, Wegner's granulomatosis, ANCA, Aplastic anemia,
Autoimmune hemolytic anemia (AIHA), factor VIII deficiency,
hemophilia A, Autoimmune neutropenia, Castleman's syndrome,
Goodpasture's syndrome, solid organ transplant rejection, graft
versus host disease (GVHD), IgM mediated, thrombotic
thrombocytopenic purpura (TTP), Hashimoto's Thyroiditis, autoimmune
hepatitis, lymphoid interstitial pneumonitis (HIV), bronchiolitis
obliterans (non-transplant) vs. NSIP, Guillain-Barre Syndrome,
large vessel vasculitis, giant cell (Takayasu's) arteritis, medium
vessel vasculitis, Kawasaki's Disease, polyarteritis nodosa,
comprising administering to a patient suffering from the disease, a
therapeutically effective amount of a CD20 binding antibody. In one
embodiment of this method, the CD20 binding antibody is
Rituxan.RTM..
[0029] The invention also provides an isolated nucleic acid
comprising the nucleotide sequence of SEQ ID NO.: 24 of the
Cynomolgus monkey CD20 (shown in FIG. 19), or a degenerate variant
of this sequence. One embodiment is an isolated nucleic acid
comprising a sequence that encodes a polypeptide with the amino
acid sequence of SEQ ID NO. 25 (shown FIG. 20), or SEQ ID NO. 25
(FIG. 20) with conservative amino acid substitutions. Another
embodiment is a vector comprising the preceding nucleic acid,
including an expression vector for expression in a host cell.
Included as well is a host cell comprising the vector. Also
provided is a isolated polypeptide comprising the amino acid
sequence [SEQ ID NO. 25; FIG. 20] of the Cynomolgus monkey
CD20.
BRIEF DESCRIPTION OF THE FIGURES
[0030] FIG. 1A is a sequence alignment comparing the amino acid
sequences of the light chain variable domain (V.sub.L) of each of
murine 2H7 (SEQ ID NO. 1), humanized 2H7. v16 variant (SEQ ID NO.
2), and human kappa light chain subgroup I (SEQ ID NO. 3). The CDRs
of V.sub.L of 2H7 and hu2H7.v16 are follows: CDR1 (SEQ ID NO.4),
CDR2 (SEQ ID NO.5), and CDR3 (SEQ ID NO.6).
[0031] FIG. 1B is a sequence alignment which compares the V.sub.H
sequences of murine 2H7 (SEQ ID NO. 7), humanized 2H7.v16 variant
(SEQ ID NO. 8), and the human consensus sequence of heavy chain
subgroup III (SEQ ID NO. 9). The CDRs of V.sub.H of 2H7 and
hu2H7.v16 are as follow: CDR1 (SEQ ID NO.10), CDR2 (SEQ ID NO.11),
and CDR3 (SEQ ID NO.12).
[0032] In FIG. 1A and FIG. 1B, the CDR1, CDR2 and CDR3 in each
chain are enclosed within brackets, flanked by the framework
regions, FR1-FR4, as indicated. 2H7 refers to the murine 2H7
antibody. The asterisks in between two rows of sequences indicate
the positions that are different between the two sequences. Residue
numbering is according to Kabat et al., Sequences of Immunological
Interest. 5th Ed. Public Health Service, National Institutes of
Health, Bethesda, Md. (1991), with insertions shown as a, b, c, d,
and e.
[0033] FIG. 2A-2E show the sequence of phagemid pVX4 (SEQ II)
NO.13) used for construction of 2H7 Fab plasmids (see Example 1) as
well as the amino acid sequences of the L chain (SEQ ID NO.14) and
H chain (SEQ ID NO.15) of the Fab for the CDR grafted
anti-IFN-.alpha. humanized antibody.
[0034] FIG. 3A-3E show the sequence of the expression plasmid which
encodes the chimeric 2H7.v6.8 Fab (SEQ ID NO.16). The amino acid
sequences of the L chain (SEQ ID NO.17) and H chain (SEQ ID NO.18)
are shown.
[0035] FIG. 4A and 4B show the sequence of the plasmid pDR1 (SEQ ID
NO.19; 5391 bp) for expression of immunoglobulin light chains as
described in Example 1. pDR1 contains sequences encoding an
irrelevant antibody, the light chain of a humanized anti-CD3
antibody (Shalaby et al., J. Exp. Med. 175: 217-225 (1992)), the
start and stop codons for which are indicated in bold and
underlined.
[0036] FIG. 5A and 5B show the sequence of plasmid pDR2 (SEQ ID
NO.20; 6135 bp) for expression of immunoglobulin heavy chains as
described in Example 1. pDR2 contains sequences encoding an
irrelevant antibody, the heavy chain of a humanized anti-CD3
antibody (Shalaby et al., supra), the start and stop codons for
which are indicated in bold and underlined.
[0037] FIG. 6 shows the amino acid sequence of the 2H7.v16 complete
L chain (SEQ ID NO.21). The first 19 amino acids before DIQ are the
secretory signal sequence not present in the mature polypeptide
chain.
[0038] FIG. 7 shows the amino acid sequence of the 2H7.v16 complete
H chain (SEQ ID NO.22). The first 19 amino acids before EVQ before
are the secretory signal sequence not present in the mature
polypeptide chain. Aligning, the V.sub.H sequence in FIG. 1B (SEQ
ID NO. 8) with the complete H chain sequence, the human .gamma.1
constant region is from amino acid position 114-471 in SEQ ID NO.
22.
[0039] FIG. 8 shows the amino acid sequence of the 2H7.v31 complete
H chain (SEQ ID NO.23). The first 19 amino acids before EVQ before
are the secretory signal sequence not present in the mature
polypeptide chain. The L chain is the same as for 2H7.v16 (see FIG.
6).
[0040] FIG. 9 shows the relative stability of 2H7.v.16 and 2H7.v73
IgG variants as described in Example 6. Assay results were
normalized to the values prior to incubation and reported as
percent remaining after incubation.
[0041] FIG. 10 is a flow chart summarizing the amino acid changes
from the murine 2H7 to a subset of humanized versions up to
v75.
[0042] FIG. 11 is a summary of mean absolute B-cell count
[CD3-/CD40+] in all groups (2H7 study and Rituxan study combined),
as described in Example 10.
[0043] FIG. 12 shows the results of a representative ADCC assay on
fucose deficient 2H7 variants as described in Example 11.
[0044] FIG. 13 shows the results of the Annexin V staining plotted
as a function of antibody concentration. Ramos cells were treated
with an irrelevant IgG1 control antibody (Herceptin.RTM.; circles),
Rituximab (squares), or rhuMAb 2H7.v16 (triangles) in the presence
of a crosslinking secondary antibody and were analyzed by FACS.
FIGS. 13-15 are described in Example 13.
[0045] FIG. 14 shows the results of the Annexin V and propidium
iodide double-staining are plotted as a function of antibody
concentration. Ramos cells were treated with an irrelevant IgG1
control antibody (Herceptin.RTM.; circles). Rituximab (squares), or
rhuMAb 2H7.v16 (triangles) in the presence of a crosslinking
secondary antibody and were analyzed by FACS.
[0046] FIG. 15 shows the counts (per 10 s) of live, unstained cells
are plotted as a function of antibody concentration. Ramos cells
were treated with an irrelevant IgG1 control antibody
(Herceptin.RTM.; circles), Rituximab (squares), or rhuMAb 2H7.v16
(triangles) in the presence of a crosslinking secondary antibody
and were analyzed by FACS.
[0047] FIGS. 16, 17, 18 show inhibition of Raji cell tumor growth
in rude mice, as described in Example 14. Animals were treated
weekly (as indicated by vertical arrows; n=8 mice per group) for 6
weeks with PBS (control) or with Rituxan.RTM. or rhuMAb 2H7.v16 at
5 mg/kg (FIG. 16), 0.5 mg/kg (FIG. 17), or 0.05 mg/kg (FIG.
18).
[0048] FIG. 19 shows the nucleotide (SEQ ID NO. 24) and amino acid
(SEQ ID NO. 25) sequences of Cynomolgus monkey CD20, as described
in Example 15.
[0049] FIG. 20 shows the amino acid sequence for cynomolgus monkey
CD20 (SEQ ID NO. 25). Residues that differ from human CD20 are
underlined and the human residues (SEQ ID NO. 26) are indicated
directly below the monkey residue. The putative extracellular
domain of the monkey CD20 is in bold type.
[0050] FIG. 21 shows the results of Cynomolgus monkey cells
expressing CD20 binding to hu2H7.v16,.v31, and Rituxan, as
described in Example 15. The antibodies were assayed for the
ability to bind and displace FITC-conjugated murine 2H7 binding to
cynomolgus CD20.
[0051] FIG. 22 shows dose escalation schema for rheumatoid
arthritis phase clinical trial.
[0052] FIG. 23 shows the vector for expression of 2H7.v16 in CHO
cells.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0053] The "CD20" antigen is a non-glycosylated, transmembrane
phosphoprotein with a molecular weight of approximately 35 kD that
is found on the surface of greater than 90% of B cells from
peripheral blood or lymphoid organs. CD20 is expressed during early
pre-B cell development and remains until plasma cell
differentiation; it is not found on human stem cells, lymphoid
progenitor cells or normal plasma cells. CD20 is present on both
normal B cells as well as malignant B cells. Other names for CD20
in the literature include "B-lymphocyte-restricted differentiation
antigen" and "Bp35". The CD20 antigen is described in, for example,
Clark and Ledbetter, Adv. Can. Res. 52:81-149 (1989) and Valentine
et al. J. Biol. Chem. 264(19):11282-11287(1989).
[0054] The term "antibody" is used in the broadest sense and
specifically covers monoclonal antibodies (including full length
monoclonal antibodies), multispecific antibodies (e.g.., bispecific
antibodies), and antibody fragments so long as they exhibit the
desired biological activity or function.
[0055] The biological activity of the CD20 binding and humanized
CD20 binding antibodies of the invention will include at least
binding of the antibody to human CD20, more preferably binding to
human and other primate CD20 (including cynomolgus monkey, rhesus
monkey, chimpanzees). The antibodies would bind CD20 with a K.sub.d
value of no higher than 1.times.10.sup.-8, preferably a K.sub.d
value no higher than about 1.times.10.sup.-, and be able to kill or
deplete B cells in vivo, preferably by at least 20% when compared
to the appropriate negative control which is not treated with such
an antibody. B cell depletion can be a result of one or more of
ADCC, CDC, apoptosis, or other mechanism. In some embodiments of
disease treatment herein, specific effector functions or mechanisms
may be desired over others and certain variants of the humanized
2H7 are preferred to achieve those biological functions, such as
ADCC.
[0056] "Antibody fragments" comprise a portion of a full length
antibody, generally the antigen binding or variable region thereof.
Examples of antibody fragments include Fab, Fab', F(ab').sub.2, and
Fv fragments; diabodies; linear antibodies; single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments.
[0057] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This fragment
consists of a dimer of one heavy- and one light-chain variable
region domain in tight, non-covalent association. From the folding
of these two domains emanate six hypervariable loops (3 loops each
from the H and L chain) that contribute the amino acid residues for
antigen binding and confer antigen binding specificity to the
antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific for an antigen) has the ability
to recognize and bind antigen, although at a lower affinity than
the entire binding site.
[0058] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. The modifier "monoclonal" indicates the
character of the antibody as being obtained from a substantially
homogeneous population of antibodies, and is not to be construed as
requiring production of the antibody by any particular method. For
example, the monoclonal antibodies to be used in accordance with
the present invention may be made by the hybridoma method first
described by Kohler et al., Nature 256:495 (1975), or may be made
by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567).
The "monoclonal antibodies" may also be isolated from phage
antibody libraries using the techniques described in Clackson et
al., Nature 352:624-628 (1991) and Marks et al., J. Mol. Biol.
222:581-597 (1991), for example.
[0059] "Functional fragments" of the CD20 binding antibodies of the
invention are those fragments that retain binding to CD20 with
substantially the same affinity as the intact fall length molecule
from which they are derived and show biological activity including
depleting B cells as measured by in vitro or in vivo assays such as
those described herein.
[0060] The term "variable" refers to the fact that certain segments
of the variable domains differ extensively in sequence among
antibodies. The V domain mediates antigen binding and defines
specificity of a particular antibody for its particular antigen.
However, the variability is not evenly distributed across the
110-amino acid span of the variable domains. Instead, the V regions
consist of relatively invariant stretches called framework regions
(FRs) of 15-30 amino acids separated by shorter regions of extreme
variability called "hypervariable regions" that are each 9-12 amino
acids long. The variable domains of native heavy and light chains
each comprise four FRs, largely adopting a .beta.-sheet
configuration, connected by three hypervariable regions, which form
loops connecting, and in some cases forming part of, the
.beta.-sheet structure. The hypervariable regions in each chain are
held together in close proximity by the FRs and, with the
hypervariable regions from the other chain, contribute to the
formation of the antigen-binding site of antibodies (see Kabat et
al., Sequences of Proteins of Immunological Interest, 5th Ed.
Public Health Service, National Institutes of Health, Bethesda, Md.
(1991)). The constant domains are not involved directly in binding
an antibody to an antigen, but exhibit various effector functions,
such as participation of the antibody in antibody dependent
cellular cytotoxicity (ADCC).
[0061] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region generally comprises amino
acid residues front a "complementarity determining region" or "CDR"
(e.g. around about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3)
in the V.sub.L, and around about 31-35B (H1), 50-65 (H2) and 95-102
(H3) in the V.sub.H (Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)) and/or those residues
from a "hypervariable loop" (e.g. residues 26-32 (L1), 50-52 (L2)
and 91-96 (L3) in the V.sub.L, and 26-32 (H1), 52A-55 (H2) and
96-101 (H3) in the V.sub.H (Chothia and Lesk J. Mol. Biol.
196:901-917 (1987)).
[0062] As referred to herein, the "consensus sequence" or consensus
V domain sequence is an artificial sequence derived from a
comparison of the amino acid sequences of known human
immunoglobulin variable region sequences. Based on these
comparisons, recombinant nucleic acid sequences encoding the V
domain amino acids that are a consensus of the sequences derived
from the human K and the human H chain subgroup III V domains were
prepared. The consensus V sequence does not have any known antibody
binding specificity or affinity.
[0063] "Chimeric" antibodies (immunoglobulins) have a portion of
the heavy and/or light chain identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No. 4,816,567; and Morrison
et al., Prot. Natl. Acad. Sci. USA 81:6851-6855 (1984)). Humanized
antibody as used herein is a subset of chimeric antibodies.
[0064] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric antibodies which contain minimal sequence derived from
non-human immunoglobulin. For the most part, humanized antibodies
are human immunoglobulins (recipient or acceptor antibody) in which
hypervariable region residues of the recipient are replaced by
hypervariable region residues from a non-human species (donor
antibody) such as mouse, rat, rabbit or nonhuman primate having the
desired specificity, affinity, and capacity, in some instances, Fv
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues which are not found in
the recipient antibody or in the donor antibody. These
modifications are made to further refine antibody performance such
as binding affinity. Generally, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the
hypervariable loops correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin sequence although the FR regions
may include one or more amino acid substitutions that improve
binding affinity. The number of these anti no acid substitutions in
the FR is typically no more than 6 in the H chain, and in the L
chain, no more than 3. The humanized antibody optionally also will
comprise at least a portion of an immunoglobulin constant region
(Fc), typically that of a human immunoglobulin. For further
details, see Jones et al., Nature 321:522-525 (1986); Reichmann et
al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol.
2:593-596 (1992).
[0065] Antibody "effector functions" refer to those biological
activities attributable to the Fc region (a native sequence Fc
region or amino acid sequence variant Fc region) of an antibody,
and vary with the antibody isotype. Examples of antibody effector
functions include: C1q binding and complement dependent
cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated
cytotoxicity (ADCC); phagocytosis; down regulation of cell surface
receptors (e.g. B cell receptor); and B cell activation.
[0066] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC"
refers to a form of cytotoxicity in which secreted Ig bound onto Fc
receptors (FcRs) present on certain cytotoxic cells (e.g. Natural
Killer (NK) cells, neutrophils, and macrophages) enable these
cytotoxic effector cells to bind specifically to an antigen-bearing
target cell and subsequently kill the target cell with cytotoxins.
The antibodies "arm" the cytotoxic cells and are absolutely
required for such killing. The primary cells for mediating ADCC, NK
cells, express Fcy.gamma.RIII only, whereas monocytes express
Fc.gamma.R1, Fc.gamma.RIII and Fc.gamma.RIII. FcR expression on
hematopoietic cells is summarized in Table 3 on page 464 of Ravetch
and Kinet, Annu. Rev. Immunol 9:457-92 (1991). To assess ADCC
activity of a molecule of interest, an in vitro ADCC assay, such as
that described in U.S. Pat. Nos. 5,500,362 or 5,821,337 may be
performed. Useful effector cells for such assays include peripheral
blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
Alternatively, or additionally, ADCC activity of the molecule of
interest may be assessed in vivo, e.g., in a animal model such as
that disclosed in Clynes et al. PNAS (USA) 95:652-656 (1998).
[0067] "Fc receptor" or "FcR" describes a receptor that binds to
the Fc region of an antibody. The preferred FcR is a native
sequence human FcR. Moreover, a preferred FcR is one which binds an
IgG antibody (a gamma receptor) and includes receptors of the
Fc.gamma.RI, Fc.gamma.RII, and Fc.gamma.RIII subclasses, including
allelic variants and alternatively spliced forms of these
receptors. Fc.gamma.RII receptors include Fc.gamma.RIIA (an
"activating receptor") and Fc.gamma.RIIB (an "inhibiting
receptor"), which have similar amino acid sequences that differ
primarily in the cytoplasmic domains thereof. Activating receptor
Fcy.gamma.IIA contains an immunoreceptor tyrosine-based activation
motif (ITAM) in its cytoplasmic domain. Inhibiting receptor
Fc.gamma.RIIB contains an immunoreceptor tyrosine-based inhibition
motif (ITIM) in its cytoplasmic domain. (see review M. in Dacron,
Annu. Rev. Immunol. 15:203-234 (1997)). FcRs are reviewed in
Ravetch and Kinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et
al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab.
Clin. Med. 126:330-41 (1995). Other FcRs, including those to be
identified in the future, are encompassed by the term "FcR" herein.
The term also includes the neonatal receptor, FcRn, which is
responsible for the transfer of maternal IgGs to the fetus (Guyer
et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol.
24:249 (1994)).
[0068] WO00/42072 (Presto) describes antibody variants with
improved or diminished binding to FcRs. The content of that patent
publication is specifically incorporated herein by reference. See,
also, Shieids et al. J. Riot. Chem. 9(2): 6591-6604 (2001).
[0069] "Human effector cells" are leukocytes which express one or
more FcRs and perform effector functions. Preferably, the cells
express at least Fc.gamma.RIII and perform ADCC effector function.
Examples of human leukocytes which mediate ADCC include peripheral
blood mononuclear cells (PBMC), natural killer (NK) cells,
monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK
cells being preferred. The effector cells may be isolated from a
native source, e.g. from blood.
[0070] "Complement dependent cytotoxicity" or "CDC" refers to the
lysis of a target cell in the presence of complement. Activation of
the classical complement pathway is initiated by the binding of the
first component of the complement system (C1q) to antibodies (of
the appropriate subclass) which are bound to their cognate antigen.
To assess complement activation, a CDC assay, e.g. as described in
Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996), may be
performed.
[0071] Polypeptide variants with altered Fc region amino acid
sequences and increased or decreased C1q binding capability are
described in U.S. Pat. No. 6,194,551B1 and WO99/51642. The contents
of those patent publications are specifically incorporated herein
by reference. See, also, Idusogie et al. J. Immunol. 164: 4178-4184
(2000).
[0072] The N-glycosylation site in IgG is at Asa297 in the CH2
domain. The present invention also provides compositions of a
CD20-binding, humanized antibody having a Fc region. wherein about
80-100% (and preferably about 90-99%) of the antibody in the
composition comprises a mature core carbohydrate structure which
lacks fucose, attached to the Fc region of the glycoprotein. Such
compositions were demonstrated herein to exhibit a surprising
improvement in binding to Fc(RIIIA(F158), which is not as effective
as Fc(RIIIA (V158) in interacting with human IgG. Thus, the
compositions herein are anticipated to be superior to previously
described anti-CD20 antibody compositions, especially for therapy
of human patients who express Fc(RIIIA (F158). Fc(RIIIA (F158) is
more common than Fc(RIIIA (V158) in normal, healthy African
Americans and Caucasians. See Lehrnbecher et al. Blood 94:4220
(1999). The present application further demonstrates the
synergistic increase in Fc(RIII binding and/or ADCC function that
results from combining the glycosylation variations herein with
amino acid sequence modification(s) in the Fc region of the
glycoprotein.
[0073] An "isolated" antibody is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nortreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells since at
least one component of the antibody's natural environment will not
be present. Ordinarily however, isolated antibody will be prepared
by at least one purification step.
[0074] An "isolated" nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the antibody nucleic acid. An
isolated nucleic acid molecule is other than in the form or setting
in which it is found in nature. Isolated nucleic acid molecules
therefore are distinguished from the nucleic acid molecule as it
exists in natural cells. However, an isolated nucleic acid molecule
includes a nucleic acid molecule contained in cells that ordinarily
express the antibody where, for example, the nucleic acid molecule
is in a chromosomal location different from that of natural
cells.
[0075] The expression "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0076] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0077] "Vector" includes shuttle and expression vectors. Typically,
the plasmid construct will also include an origin of replication
(e.g., the ColE1 origin of replication) and a selectable marker
(e.g. ampicillin or tetracycline resistance), for replication and
selection, respectively, of the plasmids in bacteria. An
"expression vector" refers to a vector that contains the necessary
control sequences or regulatory elements for expression of the
antibodies including antibody fragment of the invention, in
bacterial or eukaryotic cells. Suitable vectors are disclosed
below.
[0078] The cell that produces a humanized CD20 binding antibody of
the invention will include the bacterial and eukaryotic host cells
into which nucleic acid encoding the antibodies have been
introduced. Suitable host cells are disclosed below.
[0079] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to the antibody. The label may itself be detectable by itself
(e.g., radioisotope labels or fluorescent labels) or, in the case
of an enzymatic label, may catalyze chemical alteration of a
substrate compound or composition which is detectable.
[0080] An "autoimmune disease" herein is a non-malignant disease or
disorder arising from and directed against individual's own (self)
antigens and/or tissues.
[0081] As used herein, "B cell depletion" refers to a reduction in
B cell levels in an animal or human after drug or antibody
treatment, as compared to the B cell level before treatment. B cell
levels are measurable using well known assays such as those
described in the Experimental Examples. B cell depletion can be
complete or partial. In one embodiment, the depletion of CD20
expressing B cells is at least 25%. Not to be limited by any one
mechanism, possible mechanisms of B-cell depletion include ADCC,
CDC, apoptosis, modulation of calcium flux or a combination of two
or more of the preceding.
[0082] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., I.sup.131, I.sup.125, Y.sup.90 and
Re.sup.186), chemotherapeutic agents, and toxins such as
enzymatically active toxins of bacterial, fungal, plant or animal
origin, or fragments thereof.
[0083] A "chemotherapeutic agent" is a chemical compound useful in
the treatment of cancer. Examples of chemotherapeutic agents
include alkalyzing or alkylating agents such as thiotepa and
cyclosphospharnide (CYTOXAN.TM.); alkyl sulfonates such as
busulfan, improsulfan and piposulfan; aziridines such as benzodopa,
carboquone, meturedopa, and uredopa; ethylenimines and
methylamelamines including altretamine, triethylenemelamine,
trietylenephosphoramide, triethyienethiophosphaoramide and
trimethyloiornelamine; nitrogen mustards such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,
novembichin, phenesterine, prednimustine, trofosfamide, uracil
mustard; nitrosureas such as carmustine, chlorozotocin,
fotemustine, lomustine, nimustine, ranimustine; antibiotics such as
aclacinomysins, actinomycin, authramycin, azaserine, bleomycins,
cactinomycin, calicheamicin, carabicin, carminomycin,
carzinophilin, chromomycins, dactinomycin, daunorubicin,
detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (Adriamycin),
epirubicin, esorubicin, idambicin, marcellomycin, mitomycins,
mycophenolic acid, nogalarnycin, olivomycins, peplomycin,
potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin,
streptozocin, tubercidin, ubenimex, zinostatin, zorubicin;
anti-metabolites such as methotrexate and 5-fluorouracil (5-FU);
folic acid analogues such as denopterin, methotrexate, pteropterin,
trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine,
thianaprine, thioguanine; pyrimidine analogs such as ancitabine,
azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine,
doxifluridine, enocitabine, floxuridine. 5-FU; androgens such as
calusterone, dromostanolone propionate, epitiostanol, mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane,
trilostane; folic acid replenisher such as frolinic acid;
aceglatone; aldophosphamide glycoside; aminolevulinic acid;
amsacrine; bestrabucil; bisantrene; edatraxate; defofamine;
demecolcine; diaziquone; elfornithine; elliptinium acetate;
etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine;
mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin;
phenamet; pirarubicin; podophyliinic acid; 2-ethylhydrazide;
procarbazine: PSK.RTM.; razoxane; sizofiran; spirogermanium;
tenuazonic acid; triaziquone; 2, 2',2''-trichlorotriethylamine;
urethan; vindesine; dacarbazine; mannomustine; mitobronitol;
mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C");
thiotepa; taxoids, e.g. paclitaxel (TAXOL.RTM., Bristol-Myers
Squibb Oncology, Princeton, N.J.) and doxetaxel (TAXOTERE.RTM.,
Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine;
6-thioguanine; mercaptopurine; methotrexate; platinum analogs such
as cisplatin and carboplatin; platinum; etoposide (VP-16);
ifosfamide; mitomycin C; mitoxantrone; vincristine; vinblastine;
vinorelbine; navelbine; novantrone; teniposide; daunomycin;
aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor
RFS 2000; difluoromethylomithine (DMFO); retinoic acid;
esperamicins; capecitabine; and pharmaceutically acceptable salts,
acids or derivatives of any of the above. Also included in this
definition are anti-hormonal agents that act to regulate or inhibit
hormone action on tumors such as anti-estrogens including for
example tamoxifen, raloxifene, aromatase inhibiting
4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene,
LY117018, onapristone, and toremifene (Fareston); anti-androgens
such as flutamide, nilutamide, bicalutamide, leuprolide, and
goserelia; other chemotherapeutic agents such as prednisolone,
Pharmaceutically acceptable salts, acids or derivatives of any of
the above are included.
[0084] "Treating" or "treatment" or "alleviation" refers to both
therapeutic treatment and prophylactic: or preventative measures,
wherein the object is to prevent or slow down (lessen) the targeted
pathologic condition or disorder. A subject is successfully
"treated" for a CD20 positive cancer or an autoimmune disease if,
after receiving a therapeutic amount of a CD20 binding antibody of
the invention according to the methods of the present invention,
the subject shows observable and/or measurable reduction in or
absence of one or more signs and symptoms of the particular
disease. For example, for cancer, reduction in the number of cancer
cells or absence of the cancer cells; reduction in the tumor size;
inhibition (i.e., slow to some extent and preferably stop) of tumor
metastasis; inhibition, to some extent, of tumor growth; increase
in length of remission, and/or relief to some extent, one or more
of the symptoms associated with the specific cancer; reduced
morbidity and mortality, and improvement in quality of life issues.
Reduction of the signs or symptoms of a disease may also be felt by
the patient. Treatment can achieve a complete response, defined as
disappearance of all signs of cancer, or a partial response,
wherein the size of the tumor is decreased, preferably by more than
50 percent, more preferably by 75% . A patient is also considered
treated if the patient experiences stable disease. In a preferred
embodiment, the cancer patients are still progression-free in the
cancer after one year, preferably after 15 months. These parameters
for assessing successful treatment and improvement in the disease
are readily measurable by routine procedures familiar to a
physician of appropriate skill in the art.
[0085] A "therapeutically effective amount" refers to an amount of
an antibody or a drug effective to "treat" a disease or disorder in
a subject. In the case of cancer, the therapeutically effective
amount of the drug may reduce the number of cancer cells; reduce
the tumor size; inhibit (i.e., slow to some extent and preferably
stop) cancer cell infiltration into peripheral organs; inhibit
(i.e., slow to some extent and preferably stop) tumor metastasis;
inhibit, to some extent, tumor growth; and/or relieve to some
extent one or more of the symptoms associated with the cancer. See
preceding definition of "treating".
[0086] "Chronic" administration refers to administration of the
agent(s) in a continuous mode as opposed to an acute mode, so as to
maintain the initial therapeutic effect (activity) for an extended
period of time. "Intermittent" administration is treatment that is
not consecutively done without interruption, but rather is cyclic
in nature.
Compositions and Methods of the Invention
[0087] The invention provides humanized antibodies that bind human
CD20, and preferably other primate CD20 as well, comprising a H
chain having at least one, preferably two or all of the H chain
CDRs of a non-human species anti-human CD20 antibody (donor
antibody), and substantially all of the framework residues of a
human consensus antibody as the recipient antibody. The donor
antibody can be from various non-human species including mouse,
rat, guinea pig, goat, rabbit, horse, primate but most frequently
will be a murine antibody. "Substantially all" in this context is
meant that the recipient FR regions in the humanized antibody may
include one or more amino acid substitutions not originally present
in the human consensus FR sequence. These FR changes may comprise
residues not found in the recipient or the donor antibody.
[0088] In one embodiment, the donor antibody is the murine 2H7
antibody, the V region including the CDR and FR sequences of each
of the H and L chains of which are shown in FIGS. 1A and 1B. In a
specific embodiment, the residues for the human Fab framework
correspond to the consensus sequence of human V.kappa. subgroup I
and of V.sub.H subgroup III, these consensus sequences are shown in
FIG. 1A and FIG. 1B, respectively. The humanized 2H7 antibody of
the invention will have at least one of the CDRs in the H chain of
the murine donor antibody. In one embodiment, the humanized 2H7
antibody that binds human CD20 comprises the CDRs of both the H and
L chains of the donor antibody.
[0089] In a full length antibody, the humanized CD20 binding
antibody of the invention will comprise a humanized V domain joined
to a C domain of a human immunoglobulin. In a preferred embodiment,
the H chain C region is from human IgG, preferably IgG1 or IgG3.
The L chain C domain is preferably from human .kappa. chain.
[0090] Unless indicated otherwise, a humanized 2H7 antibody version
herein will have the V and C domain sequences of 2H7.v16 L chain
(FIG. 6, SEQ. ID NO. 21) and H chain (FIG. 7., SEQ ID NO. 22)
except at the positions of amino acid substitutions or changes
indicated in the experimental examples below.
[0091] The humanized CD20 binding antibodies will bind at least
human CD20 and preferably hind other primate CD20 such as that of
monkeys including cynomolgus and rhesus monkeys, and chimpanzees.
The sequence of the cynomolgus monkey CD20 is disclosed in Example
15 and FIG. 19
[0092] The biological activity of the CD20 binding antibodies and
humanized CD20 binding antibodies of the invention will include at
least binding of the antibody to human CD20, more preferably
binding to human and primate CD20 (including cynomolgus monkey,
rhesus monkey, chimpanzees), with a K.sub.4 value of no higher than
1.times.10.sup.-8, preferably a K.sub.d value no higher than about
1.times.10.sup.-9, even more preferably a K.sub.d value no higher
than about 1.times.10.sup.-10, and be able to kill or deplete B
cells in vitro or in vivo, preferably by at least 20% when compared
to the baseline level or appropriate negative control which is not
treated with such an antibody.
[0093] The desired level of B cell depletion will depend on the
disease. For the treatment of a CD20 positive cancer, it may be
desirable to maximize the depletion of the B cells which are the
target of the anti-CD20 antibodies of the invention. Thus, for the
treatment of a CD20 positive B cell neoplasm, it is desirable that
the B cell depletion be sufficient to at least prevent progression
of the disease which can be assessed by the physician of skill in
the art, e.g., by monitoring tumor growth (size), proliferation of
the cancerous cell type, metastasis, other signs and symptoms of
the particular cancer. Preferably, the B cell depletion is
sufficient to prevent progression of disease for at least 2 months,
more preferably 3 months, even more preferably 4 months, more
preferably 5 months, even more preferably 6 or more months. In even
more preferred embodiments, the B cell depletion is sufficient to
increase the time in remission by at least 6 months, more
preferably 9 months, more preferably one year, more preferably 2
years, more preferably 3 years, even more preferably 5 or more
years. In a most preferred embodiment, the B cell depletion is
sufficient to cure the disease. In preferred embodiments, the B
cell depletion in a cancer patient is at least about 75% and more
preferably, 80%, 85%, 90%, 95% , 99% and even 100% of the baseline
level before treatment.
[0094] For treatment of an autoimmune disease, it may be desirable
to modulate the extent of B cell depletion depending on the disease
and/or the severity of the condition in the individual patient, by
adjusting the dosage of CD20 binding antibody. Thus, B cell
depletion can but does not have to be complete. Or, total B cell
depletion iay be desired in initial treatment but in subsequent
treatments, the dosage may be adjusted to achieve only partial
depletion. In one embodiment, the B cell depletion is at least 20%,
i.e., 80% or less of CD20 positive B cells remain as compared to
the baseline level before treatment. In other embodiments, B cell
depletion is 25%, 30%, 40%, 50%, 60%, 70% or greater. Preferably,
the B cell depletion is sufficient to halt progression of the
disease, more preferably to alleviate the signs and symptoms of the
particular disease under treatment, even more preferably to cure
the disease.
[0095] The invention also provides bispecific CD20 binding
antibodies wherein one arm of the antibody has a humanized H and L
chain of the humanized CD20 binding antibody of the invention, and
the other arm has V region binding specificity for a second
antigen. In specific embodiments, the second antigen is selected
from the group consisting of CD3, CD64, CD32A, CD16, NKG2D or other
NK activating ligands.
[0096] In comparison with Rituxan (rituximab), v16 exhibits about 2
to 5 fold increased ADCC potency, .about.3-4 fold decreased CDC
than Rituxan.
Antibody Production
[0097] Monoclonal Antibodies
[0098] Monoclonal antibodies may be made using the hybridoma method
first described by Kohler et al., Nature, 256:495 (1975), or may be
made by recombinant DNA methods (U.S. Pat. No. 4,816,567).
[0099] In the hybridoma method, a mouse or other appropriate host
animal, such as a hamster, is immunized as described above to
elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the protein used for
immunization. Alternatively, lymphocytes may be immunized in vitro.
After immunization, lymphocytes are isolated and then fused with a
myeloma cell line using a suitable fusing agent, such as
polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal
Antibodies: Principles and Practice, pp.59-103 (Academic Press,
1986)).
[0100] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium which medium preferably contains one or
more substances that inhibit the growth or survival of the unfused,
parental myeloma cells (also referred to as fusion partner). For
example, if the parental myeloma cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the selective
culture medium for the hybridomas typically will include
hypoxanthine, aminopterin, and thymidine (HAT medium), which
substances prevent the growth of HGPRT-deficient cells.
[0101] Preferred fusion partner myeloma cells are those that fuse
efficiently, support stable high-level production of antibody by
the selected antibody-producing cells, and are sensitive to a
selective medium that selects against the unfused parental cells.
Preferred myeloma cell lines are murine myeloma lines, such as
those derived from MOPC-21 and MPC-11 mouse tumors available from
the Salk institute Cell Distribution Center, San Diego, Calif. USA,
and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the
American Type Culture Collection, Rockville, Md. USA. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies (Kozbor, J.
Immunol., 133:3001 (1984); and Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, pp. 51-63 (Marcel Dekker,
Inc., New York, 1987)),
[0102] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the antigen. Preferably, the binding specificity of monoclonal
antibodies produced by hybridoma cells is determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunosorbent assay
(ELISA).
[0103] The binding affinity of the monoclonal antibody can, for
example, be determined by the Scatchard analysis described in
Munson et al., Anal. Biochem., 107:220 (1980).
[0104] Once hybridoma cells that produce antibodies of the desired
specificity, affinity, and/or activity are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp.59-103 (Academic Press, 1986)). Suitable culture media
for this purpose include, for example, D-MEM or RPMI-1640 medium.
In addition, the hybridoma cells may be grown in vivo as ascites
tumors in an animal e.g, by i.p. injection of the cells into
mice.
[0105] The monoclonal antibodies secreted by the subclones are
suitably separated front the culture medium, ascites fluid, or
serum by conventional antibody purification procedures such as, for
example, affinity chromatography (e.g., using protein A or protein
G-Sepharose) or ion exchange chromatography, hydroxylapatite
chromatography, gel electrophoresis, dialysis, etc.
[0106] DNA encoding the monoclonal antibodies is readily isolated
and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies).
The hybridoma cells serve as a preferred source of such DNA. Once
isolated, the DNA may be placed into expression vectors, which are
then transfected into host cells such as E. coli cells, simian COS
cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do
not otherwise produce antibody protein, to obtain the synthesis of
monoclonal antibodies in the recombinant host cells. Review
articles on recombinant expression in bacteria of DNA encoding the
antibody include Skean et al., Curr. Opinion in Immunol., 5:256-262
(1993) and Pluckthun, Immunol. Revs., 130:151-188 (1992).
[0107] In a further embodiment, monoclonal antibodies or antibody
fragments can be isolated from antibody phage libraries generated
using the techniques described in McCafferty et al., Nature,
348:552-554 (1990). Clackson et al., Nature, 352;624-628 (1997; and
Marks et al., J. Mol. Biol., 222:581-597 (1991) describe the
isolation of murine and human antibodies, respectively, using phage
libraries. Subsequent publications describe the production of high
affinity (nM range) human antibodies by chain shuffling (Marks et
al., Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.,
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0108] The DNA that encodes the antibody may be modified to produce
chimeric or fusion antibody polypeptides, for example, by
substituting human heavy chain and light chain constant domain
(C.sub.H and C.sub.L) sequences for the homologous murine sequences
(U.S. Pat. No, 4,816,567; and Morrison, et al, Proc. Natl. Acad.
Sci. USA, 81:6851 (1984)), or by fusing the immunoglobulin coding
sequence with all or part of the coding sequence for a
non-immunoglobulin polypeptide (heterologous polypeptide). The
non-immunoglobulin polypeptide sequences can substitute for the
constant domains of an antibody, or they are substituted for the
variable domains of one antigen-combining site of an antibody to
create a chimeric bivalent antibody comprising one
antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0109] Humanized Antibodies
[0110] Methods for humanizing non-human antibodies have been
described in the art. Preferably, a humanized antibody has one or
more amino acid residues introduced into it from a source which is
non-human. These non-human amino acid residues are often referred
to as "import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al.,
Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by
substituting hypervariable region sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567)
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some hypervariable region residues and possibly
some FR residues are substituted by residues from analogous sites
in rodent antibodies.
[0111] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity and HAMA response (human anti-mouse antibody)
when the antibody is intended for human therapeutic use. According
to the so-called "best-fit" method, the sequence of the variable
domain of a rodent antibody is screened against the entire library
of known human variable domain sequences. The human V domain
sequence which is closest to that of the rodent is identified and
the human framework region (FR) within it accepted for the
humanized antibody (Sims et al., J. Immunol., 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987)). Another method uses
a particular framework region derived from the consensus sequence
of all human antibodies of a particular subgroup of light or heavy
chains. The same framework may be used for several different
humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA,
89:4285 (1992); Presta et al., Immunol., 151:2623 (1993)).
[0112] It is further important that antibodies be humanized with
retention of high binding affinity for the antigen and other
favorable biological properties. To achieve this goal, according to
a preferred method, humanized antibodies are prepared by a process
of analysis of the parental sequences and various conceptual
humanized products using, three-dimensional models of the parental
and humanized sequences. Three-dimensional immunoglobulin models
are commonly available and are familiar to those skilled in the
art. Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can he
selected and combined from the recipient and import sequences so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
hypervariable region residues are directly and most substantially
involved in influencing antigen binding.
[0113] The humanized antibody may be an antibody fragment, such as
a Fab, which is optionally conjugated with one or more cytotoxic
agent(s) in order to generate an immunoconjugate. Alternatively,
the humanized antibody may be an full length antibody, such as an
full length IgG1 antibody.
[0114] Human Antibodies and Phage Display Methodology
[0115] As an alternative to humanization, human antibodies can be
generated. For example, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene is chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array into such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et at.,
Nature, 362:255-258 (1993); Bruggemann et al., Year in Immuno.,
7:33 (1993); U.S. Pat. Nos. 5,545,806, 5,569,825, 5,591,669 (all of
GenPharm); U.S. Pat. No. 5,545,807; and WO 97/17852.
[0116] Alternatively, phage display technology (McCafferty et al.,
Nature 348:552-553 [1990]) can be used to produce human antibodies
and antibody fragments in vitro, from immunoglobulin variable (V)
domain gene repertoires from unimmunized donors. According to this
technique, antibody V domain genes are cloned in-frame into either
a major or minor coat protein gene of a filamentous bacteriophage,
such as M13 or fd, and displayed as functional antibody fragments
on the surface of the phage particle. Because the filamentous
particle contains a single-stranded DNA copy of the phage genome,
selections based on the functional properties of the antibody also
result in selection of the gene encoding the antibody exhibiting
those properties. Thus, the phage mimics some of the properties of
the B-cell. Phage display can be performed in a variety of formats,
reviewed in, e.g., Johnson, Kevin S. and Chiswell, David J.,
Current Opinion in Structural Biology 3:564-571 (1993). Several
sources of V-gene segments can be used for phage display. Clackson
et al., Nature, 352:624-628 (1991) isolated a diverse array of
anti-oxazolone antibodies from a small random combinatorial library
of V genes derived from the spleens of immunized mice. A repertoire
of V genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated essentially following the techniques described by
Marks et al., J. Mol. Biol. 222:581-597 (1991), or Griffith et al.,
EMBO J. 12:725-734 (1993). See, also, U.S. Pat. Nos. 5,565,332 and
5,573,905.
[0117] As discussed above, human antibodies may also be generated
by in vitro activated B cells (see U.S. Pat. Nos. 5,567,610 and
5,229,275).
[0118] Antibody Fragments
[0119] In certain circumstances there are advantages of using
antibody fragments, rather than whole antibodies. The smaller size
of the fragments allows for rapid clearance, and may lead to
improved access to solid tumors.
[0120] Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al. , Journal of Biochemical and Biophysical Methods 24:107-117
(1992); and Brennan et al., Science, 229:81 (1985)). However, these
fragments can now be produced directly by recombinant host cells.
Fab, Fv and ScFv antibody fragments can all be expressed in and
secreted from E. coli, thus allowing the facile production of large
amounts of these fragments. Antibody fragments can be isolated from
the antibody phage libraries discussed above. Alternatively,
Fab'-SH fragments can be directly recovered from E. coli and
chemically coupled to form F(ab').sub.2 fragments (Carter et al.,
Bio/Technology 10:163-167 (1992)). According to another approach,
F(ab').sub.2 fragments can be isolated directly from recombinant
host cell culture. Fab and F(ab').sub.2 fragment with increased in
vivo half-life comprising a salvage receptor binding epitope
residues are described in U.S. Pat. No. 5,869,046. Other techniques
for the production of antibody fragments will be apparent to the
skilled practitioner. In other embodiments, the antibody of choice
is a single chain Fv fragment (scFv). See WO 93/16185; U.S. Pat.
No. 5,571,894; and U.S. Pat. No. 5,587,458. FV and sFv are the only
species with intact combining sites that are devoid of constant
regions; thus, they are suitable for reduced nonspecific binding
during in vivo use. sFv fusion proteins may be constructed to yield
fusion of an effector protein at either the amino or the carboxy
terminus of an sFv. See Antibody Engineering, ed. Borrebaeck,
supra. The antibody fragment may also be a "linear antibody", e.g.,
as described in U.S. Pat. No. 5,641,870 for example. Such linear
antibody fragments may be monospecific or bispecific.
[0121] Bispecific Antibodies
[0122] Bispecific antibodies are antibodies that have binding
specificities for at least two different epitopes. Exemplary
bispecific antibodies may bind to two different epitopes of the
CD20 protein. Other such antibodies may combine a CD20 binding site
with a binding site for another protein. Alternatively, an
anti-CD20 arm may be combined with an arm which binds to a
triggering molecule on a leukocyte such as a T-cell receptor
molecule (e.g. CD3), or Fc receptors for IgG (Fc.gamma.R), such as
Fc.gamma.RI (CD64), Fc.gamma.RII (CD32) and Fc.gamma.RIII (CD16),
or NKG2D) or other NK cell activating ligand, so as to focus and
localize cellular defense mechanisms to the CD20-expressing cell.
Bispecific antibodies may Aso be used to localize cytotoxic agents
to cells which express CD20. These antibodies possess a
CD20-binding arm and an arm which hinds the cytotoxic agent (e.g.
saporin, anti-interferon-.alpha., vinca alkaloid, ricin A chain,
methotrexate or radioactive isotope hapten). Bispecific antibodies
can be prepared as full length antibodies or antibody fragments
(e.g. F(ab').sub.2bispecific antibodies).
[0123] WO 96/16673 describes a bispecific
anti-ErbB2/anti-Fc.gamma.RIII antibody and U.S. Pat. No. 5,837,234
discloses a bispecific anti-ErbB2/anti-Fc.gamma.RI antibody. A
bispecific anti-ErbB2/Fc.alpha. antibody is shown in WO98/02463.
U.S. Pat. No. 5,821,337 teaches a bispecific anti-ErbB2/anti-CD3
antibody.
[0124] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the co-expression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature, 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., EMBO J., 10:3655-3659
(1991).
[0125] According to a different approach, antibody variable domains
with the desired binding specificities (antibody-antigen combining
sites) are fused to immunoglobulin constant domain sequences.
Preferably, the fusion is with an Ig heavy chain constant domain,
comprising at least part of the hinge, C.sub.H2, and C.sub.H3
regions. It is preferred to have the first heavy-chain constant
region (C.sub.H1) containing the site necessary for light chain
bonding, present in at least one of the fusions. DNAs encoding the
immunoglobulin heavy chain fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host cell. This
provides for greater flexibility in adjusting the mutual
proportions of the three polypeptide fragments in embodiments when
unequal ratios of the three polypeptide chains used in the
construction provide the optimum yield of the desired bispecific
antibody. It is, however, possible to insert the coding sequences
for two or all three polypeptide chains into a single expression
vector when the expression of at least two polypeptide chains in
equal ratios results in high yields or when the ratios have no
significant affect on the yield of the desired chain
combination.
[0126] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94104690. For further details of
generating bispecific antibodies see, for example. Suresh et al.,
Methods in Enzymology, 121:210 (1986).
[0127] According to another approach described in U.S. Pat. No.
5,731,168, the interface between a pair of antibody molecules can
be engineered to maximize the percentage of heterodimers which are
recovered from recombinant cell culture. The preferred interface
comprises at least a part of the C.sub.H3 domain. In this method,
one or more small amino acid side chains from the interface of the
first antibody molecule are replaced with larger side chains (e.g.
tyrosine or tryptophan). Compensatory "cavities" of identical or
similar size to the large side chain(s) are created on the
interface of the second antibody molecule by replacing large amino
acid side chains with smaller ones (e.g. alanine or threonine).
This provides a mechanism for increasing the yield of the
heterodimer over other unwanted end-products such as
homodimers.
[0128] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for example, been proposed to target immune
system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a moaner of cross-linking techniques.
[0129] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et. al., Science, 229: 81 (1985) describe a
procedure wherein intact antibodies are proteolytically cleaved to
generate F(ab').sub.2 fragments. These fragments are reduced in the
presence of the dithiol complexing agent, sodium arsenite, to
stabilize vicinal dithiols and prevent intermolecular disulfide
formation. The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0130] Recent progress has facilitated the direct recovery of
Fab'-SH fragments from E. coil, which can be chemically coupled to
form bispecific antibodies. Shalaby et al., J. Exp. Med., 175:
217-225 (1992) describe the production of a fully humanized
bispecific antibody F(ab').sub.2 molecule. Each Fab' fragment was
separately secreted from E. coil and subjected to directed chemical
coupling in vitro to form the bispecific antibody. The bispecific
antibody thus formed was able to bind to cells overexpressing the
ErbB2 receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets.
[0131] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.,
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci, USA,
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
V.sub.H connected to a V.sub.L by a linker which is too short to
allow pairing between the two domains on the same chain.
Accordingly, the V.sub.H and V.sub.L domains of one fragment are
forced to pair with the complementary V.sub.L and V.sub.H domains
of another fragment, thereby forming two antigen-binding sites.
Another strategy for making bispecific antibody fragments by the
use of single-chain Fv (sFv) dimers has also been reported. See
Gruber et al. J. Immunol., 152:5368 (1994).
[0132] Antibodies with more than two valencies are contemplated.
For example, tispecific antibodies can be prepared, Tutt et al. J.
Immunol. 147: 60 (1991).
[0133] Multivalent Antibodies
[0134] A multivalent antibody may be internalized (and/or
catabolized) faster than a bivalent antibody by a cell expressing
an antigen to which the antibodies bind. The antibodies of the
present invention can be multivalent antibodies (which are other
than of the IgM class) with three or more antigen binding sites
(e.g. tetravalent antibodies), which can be readily produced by
recombinant expression of nucleic acid encoding the polypeptide
chains of the antibody. The multivalent antibody can comprise a
dimerization domain and three or more antigen binding sites. The
preferred dimerization domain comprises (or consists of) an Fc
region or a hinge region. In this scenario, the antibody will
comprise an Fc region and three or more antigen binding sites
amino-terminal to the Fc region. The preferred multivalent antibody
herein comprises (or consists of) three to about eight, but
preferably four, antigen binding sites. The multivalent antibody
comprises at least one polypeptide chain (and preferably two
polypeptide chains), wherein the polypeptide chain(s) comprise two
or more variable domains. For instance, the polypeptide chain(s)
may comprise VD1-(X1).sub.n-VD2-(X2).sub.u-Fc, wherein VD1 is a
first variable domain, VD2 is a second variable domain, Fc is one
polypeptide chain of an Fc region, X1 and X2 represent an amino
acid or polypeptide, and n is 0 or 1. For instance, the polypeptide
chain(s) may comprise: VH--CH1-flexible linker-VH--CH1-Fc region
chain; or VH--CH1-VH--CH1-Fc region chain. The multivalent antibody
herein preferably further comprises at least two (and preferably
four) light chain variable domain polypeptides. The multivalent
antibody herein may, for instance, comprise from about two to about
eight light chain variable domain polypeptides. The light chain
variable domain polypeptides contemplated here comprise a light
chain variable domain and, optionally, further comprise a CL,
domain.
[0135] Other Amino Acid Sequence Modifications
[0136] Amino acid sequence modification(s) of the CD20 binding
antibodies described herein are contemplated. For example, it may
be desirable to improve the binding affinity and/or other
biological properties of the antibody. Amino acid sequence variants
of the anti-CD20 antibody are prepared by introducing appropriate
nucleotide changes into the anti-CD20 antibody nucleic acid, or by
peptide synthesis. Such modifications include, for example,
deletions from, and/or insertions into and/or substitutions of,
residues within the amino acid sequences of the anti-CD20 antibody.
Any combination of deletion, insertion, and substitution is made to
arrive at the final construct, provided that the final construct
possesses the desired characteristics. The amino acid changes also
may alter post-translational processes of the anti-CD20 antibody,
such as changing the number or position of glycosylation sites.
[0137] A useful method for identification of certain residues or
regions of the anti-CD20 antibody that are preferred locations for
mutagenesis is called "alanine scanning mutagenesis" as described
by Cunningham and Wells in Science, 244:1081-1085 (1989). Here, a
residue or group of target residues are identified (e.g., charged
residues such as arg, asp, his, lys, and gin) and replaced by a
neutral or negatively charged amino acid (most preferably alanine
or polyalanine) to affect the interaction, of the amino acids with
CD20 antigen. Those amino acid locations demonstrating functional
sensitivity to the substitutions then are refined by introducing
further or other variants at, or for, the sites of substitution.
Thus, while the site for introducing an amino acid sequence
variation is predetermined, the nature of the mutation per se need
not be predetermined. For example, to analyze the performance of a
imitation at a given site, ala scanning or random mutagenesis is
conducted at the target codon or region and the expressed anti-CD20
antibody variants are screened for the desired activity.
[0138] Amino acid sequence insertions include amino- and/or
carboxyl-terminal fusions ranging in length from one residue to
polypeptides containing a hundred or more residues, as well as
intrasequence insertions of single or multiple amino acid residues.
Examples of terminal insertions include an anti-CD20 antibody with
an N-terminal methionyl residue or the antibody fused to a
cytotoxic polypeptide. Other insertional variants of the anti-CD20
antibody molecule include the fusion to the N- or C-terminus of the
anti-CD20 antibody to an enzyme (e.g. for ADEPT) or a polypeptide
which increases the serum half-life of the antibody.
[0139] Another type of variant is an amino acid substitution
variant. These variants have at least one amino acid residue in the
anti-CD20 antibody molecule replaced by a different residue. The
sites of greatest interest for substitutional mutagenesis include
the hypervariable regions, but FR alterations are also
contemplated. Conservative substitutions are shown in the Table
below under the heading of "preferred substitutions". If such
substitutions result in a change in biological activity, then more
substantial changes, denominated "exemplary substitutions" in the
Table, or as further described below in reference to amino acid
classes, may be introduced and the products screened.
TABLE-US-00001 TABLE of Amino Acid Substitutions Original Exemplary
Preferred Residue Substitutions Substitutions Ala (A) val; leu; ile
val Arg (R) lys; gln; asn lys Asn (N) gln; his; asp, lys; arg gln
Asp (D) glu; asn glu Cys (C) ser; ala ser Gln (Q) asn; glu asn Glu
(E) asp; gln asp Gly (G) Ala ala His (H) asn; gln; lys; arg arg Ile
(I) leu; val; met; ala; phe; norleucine leu Leu (L) norleucine;
ile; val; met; ala; phe ile Lys (K) arg; gln; asn arg Met (M) leu;
phe; ile leu Phe (F) leu; val; ile; ala; tyr tyr Pro (P) Ala ala
Ser (S) Thr thr Thr (T) Ser ser Trp (W) tyr; phe tyr Tyr (Y) trp;
phe; thr; ser phe Val (V) ile; leu; met; phe; ala; norleucine
leu
[0140] Substantial modifications in the biological properties of
the antibody are accomplished by selecting substitutions that
differ significantly in their effect on maintaining (a) the
structure of the polypeptide backbone in the area of the
substitution, for example, as a sheet or helical conformation, (b)
the charge or hydrophobicity of the molecule at the target site, or
(c) the bulk of the side chain. Naturally occurring residues are
divided into groups based on common side-chain properties:
[0141] (1) hydrophobic: norleucine, met, ala, vat, leu, ile;
[0142] (2) neutral hydrophilic: cys, ser, thr;
[0143] (3) acidic: asp, glu;
[0144] (4) basic: asn, gln, has, lys, arg;
[0145] (5) residues that influence chain orientation: gly, pro;
and
[0146] (6) aromatic: trp, tyr, phe.
[0147] Non-conservative substitutions will entail exchanging a
member of one of these classes for another class.
[0148] Any cysteine residue not involved in maintaining the proper
conformation of the anti-CD20 antibody also may be substituted,
generally with serine, to improve the oxidative stability of the
molecule and prevent aberrant crosslinking. Conversely, cysteine
bond(s) may be added to the antibody to improve its stability
(particularly where the antibody is an antibody fragment such as an
Fv fragment).
[0149] A particularly preferred type of substitutional variant
involves substituting one or more hypervariable region residues of
a parent antibody (e.g. a humanized or human antibody). Generally,
the resulting variant(s) selected for further development will have
improved biological properties relative to the parent antibody from
which they are generated. A convenient way for generating such
substitutional variants involves affinity maturation using phage
display. Briefly, several hypervariable region sites (e.g. 6-7
sites) are mutated to generate all possible amino substitutions at
each site. The antibody variants thus generated are displayed in a
monovalent fashion from filamentous phage particles as fusions to
the gene III product of M13 packaged within each particle. The
phage-displayed variants are then screened for their biological
activity (e.g. binding affinity) as herein disclosed. In order to
identify candidate hypervariable region sites for modification,
alanine scanning mutagenesis can be performed to identify
hypervariable region residues contributing significantly to antigen
binding. Alternatively, or additionally, it may be beneficial to
analyze a crystal structure of the antigen-antibody complex to
identify contact points between the antibody and human CD20. Such
contact residues and neighboring residues are candidates for
substitution according to the techniques elaborated herein. Once
such variants are generated, the panel of variants is subjected to
screening as described herein and antibodies with superior
properties in one or more relevant assays may be selected for
further development.
[0150] Another type of amino acid variant of the antibody alters
the original glycosylation pattern of the antibody. By altering is
meant deleting one or more carbohydrate moieties found in the
antibody, and/or adding one or more glycosylation sites that are
not present in the antibody.
[0151] Glycosylation of antibodies is typically either N-linked or
O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tripeptide
sequences asparagine-X-serine and asparagine-X-threonine, where X
is any amino acid except proline, are the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tripeptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-aceylalactosamine, galactose, or xylose to a hydroxyamino
acid, most commonly serine or threonine, although 5-hydroxyproline
or 5-hydroxylysine may also be used.
[0152] Addition of glycosylation antibody is conveniently
accomplished by altering the amino acid sequence such that it
contains one or more of the above-described tripeptide sequences
(for N-linked glycosylation sites). The alteration may also be made
by the addition of, or substitution by, one or more serine or
threonine residues to the sequence of the original antibody (for
O-linked glycosylation sites).
[0153] Nucleic acid molecules encoding amino acid sequence variants
of the anti-GD20 antibody are prepared by a variety of methods
known in the art. These methods include, but are not limited to,
isolation from a natural source (in the case of naturally occurring
amino acid sequence variants) or preparation by
oligonucleotide-mediated (or site-directed) mutagenesis, PCR
mutagenesis, and cassette mutagenesis of an earlier prepared
variant or a non-variant version of the anti-CD20 antibody.
[0154] It may be desirable to modify the antibody of the invention
with respect to effector function, e.g. so as to enhance
antigen-dependent cell-mediated cyotoxicity (ADCC) and/or
complement dependent cytotoxicity (CDC) of the antibody. This may
be achieved by introducing one or more amino acid substitutions in
an Fc region of the antibody. Alternatively or additionally,
cysteine residue(s) may be introduced in the Fc region, thereby
allowing interchain disulfide bond formation in this region. The
homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See Caron et al., J. Exp Med. 76:1191-1195 (1992) and Hopes, B. J.
Immunol, 148:2918-2922 (1992). Homodimeric antibodies with enhanced
anti-tumor activity may also he prepared using heterobifunctional
cross-linkers as described in Wolff et al. Cancer Research
53:2560-2565 (1993). Alternatively, an antibody can be engineered
which has dual Fc regions and may thereby have enhanced complement
mediated lysis and ADCC capabilities. See Stevenson et al.
Anti-Cancer Drug Design 3:219-230 (1989).
[0155] To increase the serum half life of the antibody, one may
incorporate a salvage receptor binding epitope into the antibody
(especially an antibody fragment) as described in U.S. Pat. No.
5,739,277, for example. As used herein, the term "salvage receptor
binding epitope" refers to an epitope of the Fc region of an IgG
molecule (e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, or IgG.sub.4) that
is responsible for increasing the in .sup.coo serum half-life of
the IgG molecule.
[0156] Other Antibody Modifications
[0157] Other modifications of the antibody are contemplated herein.
For example, the antibody may be linked to one of a variety of
nonpoteinaceous polymers, e.g., polyethylene glycol, polypropylene
glycol, polyoxyalkylenes, or copolymers of polyethylene glycol and
polypropylene glycol. The antibody also may be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization (for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively), in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nanocapsules), or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences,
16th edition, Oslo, A., Ed., (1980),
[0158] Screening for Antibodies with the Desired Properties
[0159] Antibodies with certain biological characteristics may be
selected as described in the Experimental Examples.
[0160] The growth inhibitory effects of an anti-CD20 antibody of
the invention may be assessed by methods known in the art, e.g.,
using cells which express CD20 either endogenously or following
transfection with the CD20 gene. For example, tumor cell lines and
CD20-transfected cells may treated with an anti-CD20 monoclonal
antibody of the invention at various concentrations for a few days
(e.g., 2-7) days and stained with crystal violet or MTT or analyzed
by some other colorimetric assay. Another method of measuring
proliferation would be by comparing .sup.3H-thymidine uptake by the
cells treated in the presence or absence an anti-CD20 antibody of
the invention. After antibody treatment, the cells are harvested
and the amount of radioactivity incorporated into the DNA
quantitated in a scintillation counter. Appropriate positive
controls include treatment of a selected cell line with a growth
inhibitory antibody known to inhibit growth of that cell line.
[0161] To select for antibodies which induce cell death, loss of
membrane integrity as indicated by, e.g., propidium iodide (PI),
trypan blue or 7AAD uptake may be assessed relative to control. A
PI uptake assay can be performed in the absence of complement and
immune effector cells. CD20-expressing tumor cells are incubated
with medium alone or medium containing of the appropriate
monoclonal antibody at e.g, about 10 .mu.g/ml. The cells are
incubated for a 3 day time period. Following each treatment, cells
are washed and aliquoted into 35 mm strainer-capped 12.times.75
tubes (1 ml per tube, 3 tubes per treatment group) for removal of
cell clumps. Tubes then receive PI (10 .mu.g/ml). Samples may be
analyzed using a FACSCAN.TM. flow cytometer and FACSCONVERT.TM.
CellQuest software (Becton Dickinson). Those antibodies which
induce statistically significant levels of cell death as determined
by PI uptake may be selected as cell death-inducing antibodies.
[0162] To screen for antibodies which bind to an epitope on CD20
bound by an antibody of interest, a routinecross-blocking assay
such as that described in Antibodies, A laboratory Manual, Cold
Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be
performed. This assay can be used to determine if a test antibody
hinds same site or epitope as an anti CD20 antibody of the
invention. Alternatively, or additionally, epitope mapping can be
performed by methods known in the art . For example, the antibody
sequence can be mutagenized such as by alanine scanning, to
identify contact residues. The mutant antibody is initially tested
for binding with polyclonal antibody to ensure proper folding. In a
different method, peptides corresponding to different regions of
CD20 can be used in competition assays with the test antibodies or
with a test antibody and an antibody with a characterized or known
epitope.
Vectors, Host Cells and Recombinant Methods
[0163] The invention also provides an isolated nucleic acid
encoding a humanized CD20 binding antibody, vectors and host cells
comprising the nucleic acid, and recombinant techniques for the
production of the antibody.
[0164] For recombinant production of the antibody, the nucleic acid
encoding it is isolated and inserted into a replicable vector for
further cloning (amplification of the DNA) or for expression. DNA
encoding the monoclonal antibody is readily isolated and sequenced
using conventional procedures (e.g., by using oligortucleotide
probes that are capable of binding specifically to genes encoding
the heavy and light chains of the antibody). Many vectors are
available. The vector components generally include, but are not
limited to, one or more of the following: a signal sequence, an
origin of replication, one or more marker genes, an enhancer
element, a promoter, and a transcription termination sequence.
[0165] (i) Signal Sequence Component
[0166] The CD20 binding antibody of this invention may be produced
recombinantly not only directly, but also as a fusion polypeptide
with a heterologous polypeptide, which is preferably a signal
sequence or other polypeptide having a specific cleavage site at
the N-terminus of the mature protein or polypeptide. The
heterologous signal sequence selected preferably is one that is
recognized and processed (i.e., cleaved by a signal peptidase) by
the host cell. For prokaryotic host cells that do not recognize and
process the native CD20 binding antibody signal sequence, the
signal sequence is substituted by a prokaryotic signal sequence
selected, for example, from the group of the alkaline phosphatase,
penicillinase, lpp, or heat-stable enterotoxin II leaders. For
yeast secretion the native signal sequence may be substituted by,
e.g., the yeast invertase leader, .alpha. factor leader (including,
Saccharomyces and Kluyveromyces .alpha.-factor leaders), or acid
phosphatase leader, the C. albicans glucoamylase leader, or the
signal described in WO 90/13646. In mammalian cell expression,
mammalian signal sequences as well as viral secretory leaders, for
example, the herpes simplex gD signal, are available.
[0167] The DNA for such precursor region is ligated in reading
frame to DNA encoding the CD20 binding antibody.
[0168] (ii) Origin of Replication
[0169] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Generally, in cloning vectors this sequence is
one that enables the vector to replicate independently of the host
chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known
for a variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most
Gram-negative bacteria, the 2.mu. plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
BPV) are useful for cloning vectors in mammalian cells. Generally,
the origin of replication component is not needed for mammalian
expression vectors (the SV40 origin may typically be used only
because it contains the early promoter).
[0170] (iii) Selection Gene Component
[0171] Expression and cloning vectors may contain a selection gene,
also termed a selectable marker. Typical selection genes encode
proteins that (a) confer resistance to antibiotics or other toxins,
e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b)
complement auxotrophic deficiencies, or (c) supply critical
nutrients not available from complex media, e.g. the gene encoding
D-alanine racemase for Bacilli.
[0172] One example of a selection scheme utilizes a drug to arrest
growth of a host cell. Those cells that are successfully
transformed with a heterologous gene produce a protein conferring,
drug resistance and thus survive the selection regimen. Examples of
such dominant selection use the drugs neomycin, mycophenolic acid
and hygromycin.
[0173] Another example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the CD20 binding antibody nucleic acid, such as DHFR,
thymidine kinase, metallothionein-I and -II, preferably primate
metallothionein genes, adenosine deaminase, ornithine
decarboxylase, etc.
[0174] For example, cells transformed with the DHFR selection gene
are first identified by culturing all of transformants in a culture
medium that contains methotrexate (Mtx), a competitive antagonist
of DHFR. An appropriate host cell when wild-type DHFR is employed
is the Chinese hamster ovary (CHO) cell line deficient in DHFR
activity (e.g., ATCC CRL-9096).
[0175] Alternatively, host cells (particularly wild-type hosts that
contain endogenous DHFR) transformed or co-transformed with DNA
sequences encoding CD20 binding antibody, wild-type DHFR protein,
and another selectable marker such as aminoglycoside
3'-phosphotransferase (APH) can be selected by cell growth in
medium containing a selection agent for the selectable marker such
as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or
G418. See U.S. Pat. No. 4,965,199.
[0176] A suitable selection gene for use in yeast is the trpl gene
present in the yeast plasmid YRp7 (Stinchcomb et al.. Nature,
282:39 (1979)). The trp1 gene provides a selection marker for a
mutant strain of yeast lacking the ability to grow in tryptophan,
for example, ATCC No. 44076 or PEP4-1. Jones, Genetics, 85:12
(1977). The presence of the tip1 lesion in the yeast host cell
genome then provides an effective environment for detecting
transformation by growth in the absence of tryptophan. Similarly,
Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are
complemented by known plasmids bearing the Leu2 gene. in addition,
vectors derived from the 1.6 .mu.m circular plasmid pKD1 can be
used for transformation of Kluyveromyces yeasts. Alternatively, an
expression system for large-scale production of recombinant calf
chymosin was reported for K. lactis. Van den Berg, Bio/Technology,
8:135 (1990). Stable multi-copy expression vectors for secretion of
mature recombinant human serum albumin by industrial strains of
Kluyveromyces have also been disclosed. Fleer et a;.,
Bio/Technology, 9:968-975 (1991).
[0177] (iv) Promoter Component
[0178] Expression and cloning vectors usually contain a promoter
that is recognized by the host organism and is operably linked to
the nucleic acid encoding the CD20 binding antibody. Promoters
suitable for use with prokaryotic hosts include the phoA promoter ,
.beta.-lactamase and lactose promoter systems, alkaline phosphatase
promoter, a tryptophan (trp) promoter system, and hybrid promoters
such as the tac promoter. However, other known bacterial promoters
are suitable, Promoters for use in bacterial systems also will
contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA
encoding the CD20 binding antibody.
[0179] Promoter sequences are known for eukaryotes. Virtually all
eukaryotic genes have an AT-rich region located approximately 25 to
30 bases upstream from the site where transcription is initiated.
Another sequence found 70 to 80 bases upstream from the start of
transcription of many genes is a CNCAAT region where N may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAA
sequence that may be the signal for addition of the poly A tail to
the 3' end of the coding sequence. All of these sequences are
suitably inserted into eukaryotic expression vectors.
[0180] Examples of suitable promoter sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase or other
glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0181] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657. Yeast enhancers also are advantageously used with yeast
promoters.
[0182] CD20 binding antibody transcription from vectors in
mammalian host cells is controlled, for example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox
virus, adenovirus (such as Adenovirus 2), bovine papilloma virus,
avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B
virus and most preferably Simian Virus 40 (SV40), from heterologous
mammalian promoters, e.g., the actin promoter or an immunoglobulin
promoter, from heat-shock promoters, provided such promoters are
compatible with the host cell systems.
[0183] The early and late promoters of the SV40 virus are
conveniently obtained as an SV40 restriction fragment that also
contains the SV40 viral origin of replication. The immediate early
promoter of the human cytomegalovirus is conveniently obtained as a
HindIII E restriction fragment. A system for expressing DNA in
mammalian hosts using the bovine papilloma virus as a vector is
disclosed in U.S. Pat. No. 4,419,446. A modification of this system
is described in U.S. Pat. No. 4,601,978, See also Reyes et al.,
Nature 297:598-601 (1982) on expression of human .beta.-interferon
cDNA in mouse cells under the control of a thymidine kinase
promoter from herpes simplex virus. Alternatively, the Rous Sarcoma
Virus long terminal repeat can be used as the promoter.
[0184] (v) Enhancer Element Component
[0185] Transcription of a DNA encoding the CD20 binding antibody of
this invention by higher eukaryotes is often increased by inserting
an enhancer sequence into the vector. Many enhancer sequences are
now known from, mammalian genes (globin, elastase, albumin,
.alpha.-fetoprotein, and insulin). Typically, however, one will use
an enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers. See also Yaniv, Nature 297:17-18 (1982) on enhancing
elements for activation of eukaryotic promoters. The enhancer may
he spliced into the vector at a position 5' or 3' to the CD20
binding antibody-encoding sequence, but is preferably located at a
site 5' from the promoter.
[0186] (vi) Transcription Termination Component
[0187] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding CD20
binding antibody. One useful transcription termination component is
the bovine growth hormone polyadenylation region. See WO94/11026
and the expression vector disclosed therein.
[0188] (vii) Selection and Transformation of Host Cells
[0189] Suitable host cells for cloning or expressing the DNA in the
vectors herein are the prokaryote, yeast, or higher eukaryote cells
described above. Suitable prokaryotes for this purpose include
eubacteria, such as Gram-negative or Gram-positive organisms, for
example. Enterobacteriaceae such as Escherichia, e.g., E. coli,
Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710
published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. One preferred E. coli cloning host is E. coli 294
(ATCC 31,446), although other strains such as E. coli B, E. coli
X1776 (ATCC 31,537), and E. coli. W3110 (ATCC 27,325) are suitable.
These examples are illustrative rather than limiting.
[0190] Full length antibody, antibody fragments, and antibody
fusion proteins can be produced in bacteria, in particular when
glycosylation and Fc effector function are not needed, such as when
the therapeutic antibody is corqugated to a cytotoxic agent (e.g.,
a toxin) and the immunoconjugate by itself shows effectiveness in
tumor cell destruction. Full length antibodies have greater half
life in circulation. Production in E. coli is faster and more cost
efficient. For expression of antibody fragments and polypeptides in
bacteria, see, e.g., U.S. Pat. No. 5,648,237 (Carter et. al.), U.S.
Pat. No. 5,789,199 (Jolt' et al.), and U.S. Pat. No. 5,840,523
(Simmons et al.) which describes translation initiation region
(TIR) and signal sequences for optimizing expression and secretion,
these patents incorporated herein by reference. After expression,
the antibody is isolated from the E. coli cell paste in a soluble
fraction and can be purified through, e.g., a protein A or G column
depending on the isotype. Final purification can be carried out
similar to the process for purifying antibody expressed e.g in CHO
cells.
[0191] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for CD20 binding antibody-encoding vectors. Saccharomyces
cerevisiae, or common baker's yeast, is the most commonly used
among lower eukaryotic host microorganisms. However, a number of
other genera, species, and strains are commonly available and
useful herein, such as Schizosaccharomyces pombe; Kluvveromyces
hosts such as, e.g., K. lactis, K. fragilis (ATCC 12,424), K.
bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii
(ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans,
and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP
183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora
crassa; Schwanniomyces such as Schwanniomyces occidentalis; and
filamentous fungi such as, e.g., Neurospora, Penicillium,
Tolypocladium, and Aspergillus hosts such as A. nidulans and A.
niger.
[0192] Suitable host cells for the expression of glycosylated CD20
binding antibody are derived from multicellular organisms. Examples
of invertebrate cells include plant and insect cells. Numerous
baculoviral strains and variants and corresponding permissive
insect host cells from hosts such as Spodoptera frugiperda
(caterpillar), Aedes aegypti (mosquito), Aedes albopictus
(mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori
have been identified. A variety of viral strains for transfection
are publicly available, e.g., the L-1 variant of Autographa
californica NPV and the Bm-5 strain of Bombyx mori NPV, and such
viruses may be used as the virus herein according to the present
invention, particularly for transfection of Spodoptera frugiperda
cells.
[0193] Plant cell cultures of cotton, corn, potato, soybean,
tomato, and tobacco can also be utilized as hosts.
[0194] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. Examples of useful mammalian host cell
lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned
for growth in suspension culture, Graham et al., J. Gen Virol.
36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10);
Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl,
Acad. Sci, USA 77:4216 (1980)) ; mouse sertoli cells (TM4, Mather,
Bial. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCE
70); African green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney
cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRE 3A, ATCC
CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells
(Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51);
TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982));
MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
[0195] Host cells are transformed with the above-described
expression or cloning vectors for CD20 binding antibody production
and cultured in conventional nutrient media modified as appropriate
for inducing promoters, selecting transformants, or amplifying the
genes encoding the desired sequences.
[0196] (viii) Culturing the Host Cells
[0197] The host cells used to produce the CD20 binding antibody of
this invention may be cultured in a variety of media. Commercially
available media such as Ham's F10 (Sigma), Minimal Essential Medium
((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's
Medium ((DMEM), Sigma) are suitable for culturing the host cells.
In addition, any of the media described in Ham et al., Meth. Enz,
58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S.
Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469;
WO 90/03430; WO 87/00195; or U.S. Patent Re. 30,985 may be used as
culture media for the host cells. Any of these media may be
supplemented as necessary with hormones and/or other growth factors
(such as insulin, transferrin, or epidermal growth factor), salts
(such as sodium chloride, calcium, magnesium, and phosphate),
buffers (such as HEPES), nucleotides (such as adenosine and
thymidine), antibiotics (such as GENTAMYCIN.TM. drug), trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH, and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0198] (ix) Purification of Antibody
[0199] When using recombinant techniques, the antibody can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, are removed, for example, by
centrifugation or ultrafiltration. Carter et of, Bio/Technology
10:163-167 (1992) describe a procedure for isolating antibodies
which are secreted to the periplasmic space of E. coli. Briefly,
cell paste is thawed in the presence of sodium acetate (pH 3.5),
EDTA, and phetlylmethylsuifonylfluoride (PMSE) over about 30 min.
Cell debris can be removed by centrifugation. Where the antibody is
secreted into the medium, supernatants from such expression systems
are generally first concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. A protease inhibitor such as PMSF
may be included in any of the foregoing steps to inhibit
proteolysis and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0200] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography, gel
electrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the preferred purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can he used to purify antibodies that
are based on human .gamma.1, .gamma.2, or .gamma.4 heavy chains
(Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is
recommended for all mouse isotypes and for human .gamma.3 (Guss et
al., EMBO J. 5:15671575 (1986)). The matrix to which the affinity
ligand is attached is most often agarose, but other matrices are
available. Mechanically stable matrices such as controlled pore
glass or poly(styrenedivinyl)benzene allow for faster flow rates
and shorter processing times than can be achieved with agarose.
Where the antibody comprises a C.sub.H3 domain, the Bakerbond
ABX.TM. resin (J. T. Baker, Phillipsburg, N.J.) is useful for
purification. Other techniques for protein purification such as
fractionation on an ion-exchange column, ethanol precipitation,
Reverse Phase HPLC, chromatography on silica, chromatography on
heparin SEPHAROSE.TM. chromatography on an anion or cation exchange
resin (such as a polyaspartic acid column), chromatofocusing,
SDS-PAGE, and ammonium sulfate precipitation are also available
depending on the antibody to be recovered.
[0201] Following any preliminary purification step(s), the mixture
comprising the antibody of interest and contaminants may be
subjected to low pH hydrophobic interaction chromatography using an
elution buffer at a pH between about 2.5-4.5, preferably performed
at low salt concentrations (e.g., from about 0-0.25M salt).
Antibody Conjugates
[0202] The antibody may be conjugated to a cytotoxic agent such as
a toxin or a radioactive isotope. In certain embodiments, the toxin
is calicheamicin, a maytansinoid, a dolastatin, auristatin F and
analogs or derivatives thereof, are preferable.
[0203] Preferred drugs/toxins include DNA damaging agents,
inhibitors of microtubule polymerization or depolymerization and
antimetabolites. Preferred classes of cytotoxic agents include, for
example, the enzyme inhibitors such as dihydrofolate reductase
inhibitors, and thymidylate synthase inhibitors, DNA intercalators,
DNA cleavers, topoisomerase inhibitors, the anthracycline family of
drugs, the vinca drugs, the mitornycins, the bleomycins, the
cytotoxic nucleosides, the pteridine family of drugs, diynenes, the
podophyllotoxins and differentiation inducers. Particularly useful
members of those classes include, for example, methotrexate,
methopterin, dichloromethotrexate, 5-fluorouracil,
6-mercaptopurine, cytosine arabinoside, melphalan, leurosine,
leurosideine, actinomycin, daunorubicin, doxoruhicin,
N-(5,5-diacetoxypentyl)doxorubicin, morpholino-doxorubicin,
1-(2-choroehthyl)-1,2-dimethanesulfonyl hydrazide, N.sup.8-acetyl
spermidine, aminopterin methopterin, esperamicin, mitomycin C,
mitomycin A, actinomycin, bleomycin, carminomycin, aminopterin,
tallysomycin, podophyllotoxin and podophyllotoxin derivatives such
as etoposide or etoposide phosphate, vinblastine, vincristine,
vindesine, taxol, taxotere, retinoic acid, butyric acid,
N.sup.8-acetyl spermidine, camptothecin, calicheamicin,
bryostatins, cephalostatins, ansamitocin, actosin, maytansinoids
such as DM-1, maytansine, maytansinol,
N-desmethyl-4,5-desepoxymaytansinol, C-19-dechloromaytansinol,
C-20-hydroxymaytansinol, C-20-demethoxymaytansinol, C-9-SH
maytansinol, C-14-alkoxymethylmaytansinol, C-14-hydroxy or
acetyloxymethlmaytansinol, C-15-hydroxy/acetyloxymaytansinol,
C-15-methoxymaytansinol, C-18-N-demethylmaytansinol and
4,5-deoxymaytansinol, auristaans such as auristatin E, M, PHE and
PE; dolostatins such as dolostatin A, dolostatin B, dolostatin. C,
dolostatia D, dolostatin E (20-epi and 11-epi), dolostatin U,
dolostatin H, dolostatin I, dolostatin 1, dolostati a 2, dolostatin
3, dolostatin 4, dolostatin 5, dolostatin 6, dolostatin 7,
dolostatin 8, dolostatin 9, dolostatin 10, deo-dolostatin 10,
dolostatin 11, dolostatin 12, dolostatin 13, dolostatin 14,
dolostatin 15, dolostatin 16, dolostatin 17, and dolostatin 18;
cephalostatins such as cephalostatin 1, cephalostatin 2,
cephalostatin 3, cephalostatin 4, cephalostatin 5, cephalostatin 6,
cephalostatin 7, 25'-epi-cephalostatin 7, 20-epi-cephalostatin 7,
cephalostatin 8, cephalostatin cephalostatin 10, cephalostatin
11,cephalostatin 12,cephalostatin 13,cephalostatin 14,
cephalostatin 15,cephalostatin 16,cephalostatin 17, cephalostatin
18, and cephalostatin 19.
[0204] Maytansinoids are mitototic inhibitors which act by
inhibiting tubulin polymerization. Maytansine was first isolated
from the east African shrub Maytenus serrata (U.S. Pat. No.
3,896,111). Subsequently, it was discovered that certain microbes
also produce maytansinoids, such as maytansinol and C-3 maytansinol
esters (U.S. Pat. No. 4,151,042). Synthetic maytansinol and
derivatives and analogues thereof are disclosed, for example, in
U.S. Pat. Nos. 4,137,230; 4,248,870; 4,256,746; 4,260,608;
4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428;
4.313,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650;
4,364,866; 4,424,219; 4,450,254; 4,362,663; and 4,371,533, the
disclosures of which are hereby expressly incorporated by
reference.
[0205] Maytansine and maytansinoids have been conjugated to
antibodies specifically binding to tumor cell antigens.
Immunoconjugates containing maytansinoids and their therapeutic use
are disclosed, for example, in U.S. Pat. Nos. 5,208,020, 5,416,064
and European Patent EP 0 425 235 B I, the disclosures of which are
hereby expressly incorporated by reference. Liu et al., Proc. Natl.
Acad. Sci. USA 93:8618-8623 (1996) described immunoconjugates
comprising a maytansinoid designated DM1 linked to the monoclonal
antibody C242 directed against human colorectal cancer. The
conjugate was found to he highly cytotoxic towards cultured colon
cancer cells, and showed antitumor activity in an ivivo tumor
growth assay. Chari et al. Cancer Research 52:127-131 (1992)
describe immunoconjugates in which a maytansinoid was conjugated
via a disulfide linker to the murine antibody A7 binding to an
antigen on human colon cancer cell lines, or to another murine
monoclonal antibody TA.1 that binds the HER-2/neu oncogene. There
are many linking groups known in the art for making
antibody-maytansinoid conjugates, including, for example, those
disclosed in U.S. Pat. No. 5,208,020 or EP Patent 0 425 235 B1, and
Chari et al. Cancer Research 52: 127-131 (1992). The linking groups
include disulfide groups, thioether groups, acid labile groups,
photolabile groups, peptidase labile groups, or esterase labile
groups, as disclosed in the above-identified patents, disulfide and
thioether groups being preferred.
[0206] Conjugates of the antibody and maytansinoid may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as toluene 2,6-diisocyanate), and his-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
Particularly preferred coupling agents include
N-succinimidyl-3-2-pyridyldithiol propionate (SPDP) (Carlsson et
al.. Biochem. J. 173:723-737 [1978]) and
N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP) to provide for a
disulfide linkage.
[0207] The linker may be attached to the maytansinoid molecule at
various positions, depending on the type of the link. For example,
an ester linkage may be formed by reaction with a hydroxyl group
using conventional coupling techniques. The reaction may occur at
the C-3 position having a hydroxyl group, the C-14 position
modified with hyrdoxymethyl, the C-15 position modified with a
hydroxyl group, and the C-20 position having a hydroxyl group. In a
preferred embodiment, the linkage is formed at the C-3 position of
maytansinol or a maytansinol analogue.
[0208] Calicheamicin
[0209] Another immunoconjugate of interest comprises an CD20
binding antibody conjugated to one or more calicheamicin molecules.
The calicheamicin family of antibiotics are capable of producing
double-stranded DNA breaks at sub-picomolar concentrations. For the
preparation of conjugates of the calicheamicin family, see U.S.
Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701,
5,770,710, 5,773,001, 5,877,296 (all to American Cyanamid Company).
Structural analogues of calicheamicin which may be used include,
but are not limited to, .gamma..sub.1.sup.I, .alpha..sub.2.sup.I,
.alpha..sub.3.sup.I, N-acetyl-.gamma..sub.1.sup.I (Hiaman et al.
Cancer Research 53: 3336-3342 (1993), Lode et al. Cancer Research
58: 2925-2928 (1998) and the aforementioned U.S. patents to
American Cyanamid). Another anti-tumor drug that the antibody can
be conjugated is QFA which is an antifolate. Both calicheamicin and
QFA have intracellular sites of action and do not readily cross the
plasma membrane. Therefore, cellular uptake of these agents through
antibody mediated internalization greatly enhances their cytotoxic
effects.
[0210] Radioactive Isotopes
[0211] For selective destruction of the tumor, the antibody may
comprise a highly radioactive atom. A variety of radioactive
isotopes are available for the production of radioconjugated anti
CD20 antibodies. Examples include At.sup.211, I.sup.131, I.sup.125,
Y.sup.90, Re.sup.188Sm.sup.153, Bi.sup.212, P.sup.32, Pb.sup.212
and radioactive isotopes of Lu. When the conjugate is used for
diagnosis, it may comprise a radioactive atom for scintigraphic
studies, for example tc.sup.99m or I.sup.123, or a spin label for
nuclear magnetic resonance (NMR) imaging (also known as magnetic
resonance imaging, mri), such as iodine-123 again, iodine-131,
indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17,
gadolinium, manganese or iron.
[0212] The radio- or other labels may be incorporated in the
conjugate in known ways. For example, the peptide may be
biosynthesized or may be synthesized by chemical amino acid
synthesis using suitable amino acid precursors involving, for
example, fluorine-19 in place of hydrogen. Labels such as
tc.sup.99m or I.sup.123, Re.sup.186, Re.sup.188 and In.sup.111 can
be attached via a cysteine residue in the peptide. Yttrium-90 can
be attached via a lysine residue. The IODOGEN method (Fraker et al
(1978) Biochem. Biophys. Res. Commun. 80: 49-57 can be used to
incorporate iodine-123. "Monoclonal Antibodies in
Immunoscintigraphy" (Chatal, CRC Press 1989) describes other
methods in detail.
[0213] Conjugates of the antibody and cytotoxic agent may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl) cycloltexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al. Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026. The linker may be
a "cleavable linker" facilitating release of the cytotoxic drug in
the cell. For example, an acid-labile linker, peptidase-sensitive
linker, photolabile linker, dimethyl linker or disulfide-containing
linker (Chari et al. Cancer Research 52: 127-131 (1992); U.S. Pat.
No. 5,208,020) may be used.
Therapeutic Uses of the CD20 Binding Antibodies
[0214] The CD20 binding antibodies of the invention are useful to
treat a number of malignant and non-malignant diseases including
autoimmune diseases and related conditions, and CD20 positive
cancers including B cell lymphomas and leukemias. Stern cells
progenitors) in bone marrow lack the CD20 antigen, allowing healthy
B-cells to regenerate after treatment and return to normal levels
within several months.
[0215] Autoimmune diseases or autoimmune related conditions include
arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis,
osteoarthritis, psoriatic arthritis), psoriasis, dermatitis
including atopic dermatitis; chronic autoimmune urticaria,
polymyositistdermatomyositis, toxic epidermal necrolysis, systemic
scleroderma and sclerosis, responses associated with inflammatory
bowel disease (IBD) (Crohn's disease, ulcerative colitis),
respiratory distress syndrome, adult respiratory distress syndrome
(ARDS), meningitis, allergic rhinitis, encephalitis, uveitis,
colitis, glomerulonephritis, allergic conditions, eczema, asthma,
conditions involving infiltration of T cells and chronic
inflammatory responses, atherosclerosis, autoimmune rnyocardias,
leukocyte adhesion deficiency, systemic lupus erythematosus (SLE),
lupus (including, nephritis, non-renal, discoid, alopecia),
juvenile onset diabetes, multiple sclerosis, allergic
encephalomyelitis, immune responses associated with acute and
delayed hypersensitivity mediated by cytokines and T-lymphocytes,
tuberculosis, sarcoidosis, granulomatosis including Wegener's
granulomatosis, agranulocytosis, vasculitis (including ANCA),
aplastic anemia, Coombs positive anemia, Diamond Blackfan anemia,
immune hemolytic anemia including autoimmune hemolytic anemia
(AIHA), pernicious anemia, pure red cell aplasia (PRCA), Factor
VIII deficiency, hemophilia A, autoimmune neutropenia,
pancytopenia, leukopenia, diseases involving leukocyte diapedesis,
CNS inflammatory disorders, multiple organ injury syndrome,
myasthenia gravis, antigen-antibody complex mediated diseases,
anti-glomerular basement membrane disease, anti-phospholipid
antibody syndrome, allergic neuritis, Bechet disease, Castleman's
syndrome, Goodpasture's Syndrome, Lambert-Eaton Myasthenic
Syndrome, Reynaud's syndrome, Sjorgen's syndrome, Stevens-Johnson
syndrome, solid organ transplant rejection (including pretreatinem
for high panel reactive antibody titers, IgA deposit in (issues,
etc), graft versus host disease (GVHD), pemphigoid bullous,
pemphigus (all including vulgaris, foliaceus), autoimmune
polyendocrinopathies, Reiter's disease, stiff-man syndrome, giant
cell arteritis, immune complex nephritis, IgA nephropathy, IgM
polyneuropathies or IgM mediated neuropathy, idiopathic
thrombocytopetlic purpura (ITP), thrombotic throbocytopertic
purpura (TTP), autoimmune thrombocytopenia, autoimmune disease of
the testis and ovary including autoimune orchitis and oophoritis,
primary hypothyroidism; autoimmune endocrine diseases including
autoimmune thyroiditis, chronic thyroiditis (Hashimoto's
Thyroiditis), subacute thyroiditis, idiopathic hypothyroidism,
Addison's disease, Grave's disease, autoimmune polyglandular
syndromes (or polyglandular endocrinopathy syndromes), Type I
diabetes also referred to as insulin-dependent diabetes mellitus
(IDDM) and Sheehan's syndrome; autoimmune hepatitis, Lymphoid
interstitial pneumonitis (HIV), bronchiolitis obliterans
(non-transplant) vs NSIP, Guillain-Barre' Syndrome, Large Vessel
Vasculitis (including Polymyalgia Rheumatica and Giant Cell
(Takayasu's) Arteritis), Medium Vessel Vasculitis (including
Kawasaki's Disease and Polyarteritis Nodosa), ankylosing
spondylitis, Berger's Disease (IgA nephropathy), Rapidly
Progressive Glomerulonephritis, Primary biliary cirrhosis, Celiac
sprue (gluten enteropathy), Cryoglobulinemia, ALS, coronary artery
disease.
[0216] CD20 positive cancers are those comprising abnormal
proliferation of cells that express CD20 on cell surface. The CD20
positive B cell neoplasms include CD20-positive Hodgkin's disease
including lymphocyte predominant Hodgkin's disease (LPHD);
non-Hodgkin's lymphoma (NHL); follicular center cell (FCC)
lymphomas; acute lymphocytic leukemia (ALL); chronic lymphocytic
leukemia (CLL); Hairy cell leukemia. The non-Hodgkins lymphoma
include low grade/follicular non-Hodgkin's lymphoma (NHL), small
lymphocytic lymphoma (SLL), intermediate grade/follicular NHL,
intermediate grade diffuse NHL, high grade immunoblastic NHL, high
made lymphoblastic NHL, high grade small non-cleaved cell NHL,
bulky disease NHL, plasmacytoid lymphocytic lymphoma, mantle cell
lymphom, AIDS-related lymphoma and Waldenstrom's macroglobulinemia.
Treatment of relapses of these cancers are also contemplated. LPHD
is a type of Hodgkin's disease that tends to relapse frequently
despite radiation or chemotherapy treatment and is characterized by
CD20-positive malignant cells. CLL is one of four major types of
leukemia. A cancer of mature B-cells called lymphocytes, CLL is
manifested by progressive accumulation of cells in blood, bone
marrow and lymphatic tissues.
[0217] In specific embodiments, the humanized CD20 binding
antibodies and functional fragments thereof are used to treat
non-Hodgkin's lymphoma (NHL), lymphocyte predominant Hodgkin's
disease (LPHD), small lymphocytic lymphoma (SLL), chronic
lymphocyte leukemia, rheumatoid arthritis and juvenile rheumatoid
arthritis, systemic lupus erythematosus (SLE) including lupus
nephritis, Wegener's disease, inflammatory bowel disease,
idiopathic thrombocytopenic purpura (ITP), thrombotic
throbocytopenic purpura (TTP), autoimmune thrombocytopenia,
multiple sclerosis, psoriasis, IgA nephropathy, IgM
polyneuropathies, myasthenia gravis, vasculitis, diabetes mellitus,
Reynaud's syndrome, Sjorgen's syndrome and glomerulonephritis.
[0218] The humanized CD20 binding antibodies or functional
fragments thereof are useful as a single-agent treatment in, e.g.,
for relapsed or refractory low-grade or follicular, CD20-positive,
B-cell NHL, or can be administered to patients in conjunction with
other drugs in a multi drug regimen.
[0219] Indolent lymphoma is a slow-growing, incurable disease in
which the average patient survives between six and 10 years
following numerous periods of remission and relapse. In one
embodiment, the humanized CD20 binding antibodies or functional
fragments thereof are used to treat indolent NHL.
[0220] The parameters for assessing efficacy or success of
treatment of the neoplasm will be known to the physician of skill
in the appropriate disease. Generally, the physician of skill will
look for reduction in the signs and symptoms of the specific
disease. Parameters can include median time to disease progression,
time in remission, stable disease.
[0221] The following references describe lymphomas and CLL, their
diagnoses, treatment and standard medical procedures for measuring
treatment efficacy, Canellos G P, Lister, T A, Sklar J L: The
Lymphomas. W.B.Saunders Company, Philadelphia, 1998; van Besien K
and. Cabanillas, F: Clinical Manifestations, Staging and Treatment
of Non-Hodgkin's Lymphoma, Chap. 70, pp 1293-1338, in: Hematology
Basic Principles and Practice, 3rd ed. Hoffman et al. (editors).
Churchill Livingstone, Philadelphia, 2000; and Rai, K and Patel,
D:Chronic Lymphocytic Leukemia, Chap. 72, pp 1350-1362, in:
Hematology, Basic Principles and Practice. 3rd ed, Hoffman et al
(editors). Churchill Livingstone, Philadelphia, 2000.
[0222] The parameters for assessing efficacy or success of
treatment of an autoimmune or autoimmune related disease will be
known to the physician of skill in the appropriate disease.
Generally, the physician of skill will look for reduction in the
signs and symptoms of the specific disease. The following are by
way of examples.
[0223] In one embodiment, the antibodies of the invention are
useful to treat rheumatoid arthritis. RA is characterized by
inflammation of multiple joints, cartilage loss and bone erosion
that leads to joint destruction and ultimately reduced joint
function. Additionally, since RA is a systemic disease, it can have
effects in other tissues such as the lungs, eyes and bone marrow.
Fewer than 50 percent of patients who have had RA for more than 10
years can continue to work or function normally on a day-to-day
basis.
[0224] The antibodies can be used as first-line therapy in patients
with early RA (i.e., methotrexate (MTX) naive) and as monotherapy,
or in combination with, e.g., MTX or cyclophosphamide. Or, the
antibodies can be used in treatment as second-line therapy for
patients who were DMARD and/or MTX refractory, and as monotherapy
or in combination with, e,g., MTX. The humanized CD20 binding
antibodies are useful to prevent and control joint damage, delay
structural damage, decrease pain associated with inflammation in
RA, and generally reduce the signs and symptoms in moderate to
severe RA. The RA patient can be treated with the humanized CD20
antibody prior to, after or together with treatment with other
drugs used in treating RA (see combination therapy below). In one
embodiment, patients who had previously failed disease-modifying
antirheumatic drugs and/or had an inadequate response to
methotrexate alone are treated with a humanized CD20 binding
antibody of the invention. In one embodiment of this treatment, the
patients are in a 17-day treatment regimen receiving humanized CD20
binding antibody alone (1 g iv infusions on days 1 and 15); CD20
binding antibody plus cyclophosphamide (750 mg iv infusion days 3
and 17); or CD20 binding antibody plus methotrexate.
[0225] One method of evaluating treatment efficacy in RA is based
on American College of Rheumatology (ACR) criteria, which measures
the percentage of improvement in tender and swollen joints, among
other things. The RA patient can be scored at for example, ACR 20
(20 percent improvement) compared with no antibody treatment (e.g
baseline before treatment) or treatment with placebo. Other ways of
evaluating the efficacy of antibody treatment include X-ray scoring
such as the Sharp X-ray score used to score structural damage such
as bone erosion and joint space narrowing. Patients can also he
evaluated for the prevention of or improvement in disability based
on Health Assessment Questionnaire [HAQ] score, AIMS score, SF-36
at time periods during or after treatment. The ACR 20 criteria may
include 20% improvement in both tender (painful) joint count and
swollen joint count plus a 20% improvement in at least 3 of 5
additional measures: [0226] 1. patient's pain assessment by visual
analog scale (VAS), [0227] 2. patient's global assessment of
disease activity (VAS), [0228] 3. physician's global assessment of
disease activity (VAS), [0229] 4. patient's self-assessed
disability measured by the Health Assessment Questionnaire, and
[0230] 5. acute phase reactants, CRP or ESR. The ACR 50 and 70 are
defined analogously. Preferably, the patient is administered an
amount of a CD20 binding antibody of the invention effective to
achieve at least a score of ACR 20, preferably at least ACR 30,
more preferably at least ACR50, even more preferably at least
ACR70, most preferably at least ACR 75 and higher.
[0231] Psoriatic arthritis hay unique and distinct radiographic
features. For psoriatic arthritis, joint erosion and joint space
narrowing can be evaluated by the Sharp score as well. The
humanized CD20 binding antibodies of the invention can be used to
prevent the joint damage as well as reduce disease signs and
symptoms of the disorder.
[0232] Yet another aspect of the invention is a method of treating
Lupus or SLE by administering to the patient suffering from SLE, a
therapeutically effective amount of a humanized CD20 binding
antibody of the invention. SLEDAI scores provide a numerical
quantitation of disease activity. The SLEDAI is a weighted index of
24 clinical and laboratory parameters known to correlate with
disease activity, with a numerical range of 0-103. see Bryan Gescuk
& John Davis, "Novel therapeutic agent for systemic lupus
erythematosus" in Current Opinion in Rheumatology 2002, 14:515-521.
Antibodies to double-stranded DNA are believed to cause renal
flares and other manifestations of lupus. Patients undergoing
antibody treatment can he monitored for time to renal flare, which
is defined as a significant, reproducible increase in serum
creatinine, urine protein or blood in the urine. Alternatively or
in addition, patients can be monitored for levels of antinuclear
antibodies and antibodies to double-stranded DNA. Treatments for
SLE include high-dose corticosteroids and/or cyclophosphamide
(HDCC).
[0233] Spondyloarthropathies are a group of disorders of the
joints, including ankylosing spondylitis, psoriatic arthritis and
Crohn's disease. Treatment success can be determined by validated
patient and physician global assessment measuring tools.
[0234] Various medications are used to treat psoriasis; treatment
differs directly in relation to disease severity. Patients with a
more mild form of psoriasis typically utilize topical treatments,
such as topical steroids, anthralin, calcipotriene, clobetasol, and
tazarotene, to manage the disease while patients with moderate and
severe psoriasis are more likely to employ systemic (methotrexate,
retinoids, cyclosporine, PUVA and ITVB) therapies. Tars are also
used. These therapies have a combination of safety concerns, time
consuming regimens, or inconvenient processes of treatment.
Furthermore, some require expensive equipment and dedicated space
in the office setting. Systemic medications can produce serious
side effects, including hypertension, hyperlipidemia, bone marrow
suppression, liver disease, kidney disease and gastrointestinal
upset. Also, the use of phototherapy can increase the incidence of
skin cancers. In addition to the inconvenience and discomfort
associated with the use of topical therapies, phototherapy and
systemic treatments require cycling patients on and off therapy and
monitoring lifetime exposure due to their side effects.
[0235] Treatment efficacy for psoriasis is assessed by monitoring
changes in clinical signs and symptoms of the disease including
Physician's Global Assessment (PGA) changes and Psoriasis Area and
Severity Index (PASI) scores, Psoriasis Symptom Assessment (PSA),
compared with the baseline condition. The patient can be measured
periodically throughout treatment on the Visual analog scale used
to indicate the degree of itching experienced at specific time
points.
[0236] Patients may experience an infusion reaction or
infusion-related symptoms with their first infusion of a
therapeutic antibody. These symptoms vary in severity and generally
are reversible with medical intervention. These symptoms include
but are not limited to, flu-like fever, chills/rigors, nausea,
urticaria, headache, bronchospasm, angioedema. It would be
desirable for the disease treatment methods of the present
invention to minimize infusion reactions. Thus, another aspect of
the invention is a method of treating the diseases disclosed by
administering a humanized CD20 binding antibody wherein the
antibody has reduced or no complement dependent cytotoxicity and
results in reduced infusion related symptoms as compared to
treatment with Rituxan.RTM.. In one embodiment, the humanized CD20
binding antibody is 2H7.v116.
[0237] Dosage
[0238] Depending on the indication to be treated and factors
relevant to the dosing that a physician of skill in the field would
be familiar with, the antibodies of the invention will be
administered at a dosage that is efficacious for the treatment of
that indication while minimizing toxicity and side effects. For the
treatment of a CD20 positive cancer or an autoimmune disease, the
therapeutically effective dosage will be in the range of about 250
m g/m.sup.2 to about 400 mg/m.sup.2 or 500 mg/m.sup.2, preferably
about 250-375mg/m.sup.2. In one embodiment, the dosage range is
275-375 mg/m.sup.2. In one embodiment of the treatment of a CD20
positive B cell neoplasm, the antibody is administered at a range
of 300-375 mg/m.sup.2. For the treatment of patients suffering from
B-cell lymphoma such as non-Hodgkins lymphoma, in a specific
embodiment, the anti-CD20 antibodies and humanized anti-CD20
antibodies of the invention will be administered to a human patient
at a dosage of 10 mg/kg or 375 mg/m.sup.2. For treating NHL, one
dosing regimen would be to administer one dose of the antibody
composition a dosage of 10 mg/kg in the first week of treatment,
followed by a 2 week interval, then a second dose of the same
amount of antibody is administered. Generally, NHL patients receive
such treatment once during a year but upon recurrence of the
lymphoma, such treatment can be repeated. In another dosing
regimen, patients treated with low-grade NHL receive four weeks of
a version of humanized 2H7, preferably v16 (375 mg/m2 weekly)
followed at week five by three additional courses of the antibody
plus standard CHOP (cyclophosphamide, doxorubicin, vincristine and
prednisone) or CVP (cyclophosphamide, vincristine, prednisone)
chemotherapy, which was given every three weeks for three
cycles.
[0239] For treating rheumatoid arthritis, in one embodiment, the
dosage range for the humanized antibody is 125 mg/m.sup.2
(equivalent to about 200 mg/dose) to 600mg/m.sup.2, given in two
doses, e.g., the first dose of 200 mg is administered on day one
followed by a second dose of 200 mg on day 15. In different
embodiments, the dosage is 250 mg/dose, 275 mg, 300 mg, 325 mg, 350
mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg,
575 mg, 600 mg.
[0240] In treating disease, the CD20 binding antibodies of the
invention can be administered to the patient chronically or
intermittently, as determined by the physician of skill in the
disease.
[0241] A patient administered a drug by intravenous infusion or
subcutaneously may experience adverse events such as fever, chills,
burning sensation, asthenia and headache. To alleviate or minimize
such adverse events, the patient may receive an initial
conditioning dose(s) of the antibody followed by a therapeutic
dose. The conditioning dose(s) will be lower than the therapeutic
dose to condition the patient to tolerate higher dosages.
[0242] Route of Administration
[0243] The CD20 binding antibodies are administered to a human
patient in accord with known methods, such as by intravenous
administration, e.g., as a bolus or by continuous infusion over a
period of time, by subcutaneous, intramuscular, intraperitoneal,
intracerobrospinal, intra-articular, intrasynovial, intrathecal, or
inhalation routes, generally by intravenous or subcutaneous
administration.
[0244] In on embodiment, the humanized 2H7 antibody is administered
by intravenous infusion with 0.9% sodium chloride solution as an
infusion vehicle.
[0245] Combination Therapy
[0246] In treating the B cell neoplasms described above, the
patient can be treated with the CD20 binding antibodies of the
present invention in conjunction with one or more therapeutic
agents such as a chemotherapeutic agent in a multidrug regimen. The
CD20 binding antibody can be administered concurrently,
sequentially, or alternating with the chemotherapeutic agent, or
after non-responsiveness with other therapy. Standard chemotherapy
for lymphoma treatment may include cyclophosphamide, cytarabine,
melphalan and mitoxantrone plus melphalan. CHOP is one of the most
common chemotherapy regimens for treating Non-Hodgkin's lymphoma.
The following are the drugs used in the CHOP regimen:
cyclophosphamide (brand names cytoxan, neosar); adriamycin
(doxorubicin/hydroxydoxoruhicin); vincristine (Oncovin); and
prednisolone (sometimes called Deltasone or Orasone). In particular
embodiments, the CD20 binding antibody is administered to a patient
in need thereof in combination with one or more of the following
chemotherapeutic agents of doxorubicin, cyclophosphamide,
vincristine and prednisolone. In a specific embodiment, a patient
suffering from a lymphoma (such as a non-Hodgkin's lymphoma) is
treated with an anti-CD20 antibody of the present invention in
conjunction with CHOP (cyclophosphamide, doxorubicin, vincristine
and prednisone) therapy. In another embodiment, the cancer patient
can be treated with a humanized CD20 binding antibody of the
invention in combination with CVP (cyclophosphamide, vincristine,
and prednisone) chemotherapy. In a specific embodiment, the patient
suffering from CD20-positive NHL is treated with humanized 2H7.v16
in conjunction with CVP. In a specific embodiment of the treatment
of CLL, the CD20 binding antibody is administered in conjunction
with chemotherapy with one or both of fludarabine and cytoxan.
[0247] In treating the autoimmune diseases or autoimmune related
conditions described above, the patient can be treated with the
CD20 binding antibodies of the present invention in conjunction
with a second therapeutic agent, such as an immunosuppressive
agent, such as in a multi drug regimen. The CD20 binding antibody
can be administered concurrently, sequentially or alternating with
the immunosuppressive agent or upon non-responsiveness with other
therapy. The immunosuppressive agent can be administered at the
same or lesser dosages than as set forth in the art. The preferred
adjunct immunosuppressive agent will depend on many factors,
including the type of disorder being treated as well as the
patient's history.
[0248] "Immunosuppressive agent" as used herein for adjunct therapy
refers to substances that act to suppress or mask the immune system
of a patient. Such agents would include substances that suppress
cytokine production, down regulate or suppress self-antigen
expression, or mask the MHC antigens. Examples of such agents
include steroids such as glucocorticosteroids, e.g., prednisone,
methylprednisolone, and dexamethasone; 2-amino-6-aryl-5 substituted
pyrimidines (see U.S. Pat. No, 4,665,077), azathioprine (or
cyclophosphamide, if there is an adverse reaction to azathioprine);
bromocryptine; glutaraldehyde (which masks the MHC antigens, as
described in U.S. Pat. No. 4,120,649); anti-idiotypic antibodies
for MHC antigens and MHC fragments; cyclosporin A; cytokine or
cytokine receptor antagonists including anti-interferon-.alpha.,
-.beta., or -.gamma.antibodies; anti-tumor necrosis factor-.alpha.
antibodies; anti-tumor necrosis factor-.beta. antibodies;
anti-interleukin-2 antibodies and anti-IL-2 receptor antibodies;
anti-L3T4 antibodies; heterologous anti-lymphocyte globulin; pan-T
antibodies, preferably anti-CD3 or anti-CD4/CD4a, antibodies;
soluble peptide containing a LFA-3 binding domain (WO 90/08187
published Jul. 26, 1990); streptokinase; TGF-.beta.;
streptodornase; RNA or DNA from the host; FK506; RS-61443;
deoxyspergualin; rapamycin; T-cell receptor (U.S. Pat. No.
5,114.721); T-cell receptor fragments (Offner et al., Science
251:430-432 (1991); WO 90/11294; and WO 91/01133); and T cell
receptor antibodies (EP 340, 109) such as T10B9.
[0249] For the treatment of rheumatoid arthritis, the patient can
be treated with a CD20 antibody of the invention in conjunction
with any one or more of the following drugs: DMARDS (disease
modifying anti-rheumatic drugs (e.g., methotrexate), NSAI or NSALD
(non-steroidal anti-inflammatory drugs), HUMIRA.TM. (adalimumab;
Abbott Laboratories), ARAVA.RTM. (leflunomide), REMICADE.RTM.
(infliximab; Centocor Inc., of Malvern, Pa.), ENBREL (etanercept;
Immunex, WA), COX-2 inhibitors. DMARDs commonly used in RA are
hydroxycloroquine, sulfasalazine, methotrexate, leflunomide,
etatiercept, azathioprine, D penicillamine, Gold (oral), Gold
(intramuscular), minocycline, cyclosporine,
[0250] Staphylococcal protein A immunoadsorption. Adahmnurnab is a
human monoclonal antibody that binds to TNF.alpha.. Infliximab is a
chimeric monoclonal antibody that binds to INF.alpha.. Etanercept
is an "immunoadhesin" fusion protein consisting of the
extracellular ligand binding portion of the human 75 kD (p75) tumor
necrosis factor receptor (TNFR) linked to the Fc portion of a human
IgG1. For conventional treatment of RA, see, e.g., "Guidelines for
the management of rheumatoid arthritis" Arthritis& Rheumatism
46(2): 328-346 (February, 2002). In a specific embodiment, the RA
patient is treated with a CD20 antibody of the invention in
conjunction with methotrexate (MTX). An exemplary dosage of MIX is
about 7.5-25 mg/kg/wk. MIX can be administered orally and
subcutaneously.
[0251] For the treatment of ankylosing spondylitis, psoriatic
arthritis and Crohn's disease, the patient can be treated with a
CD20 binding antibody of the invention in conjunction with, for
example, Remicadeg (infliximab; from Centocor Inc., of Malvern,
Pa.), ENBREL (eumercept; Immunex, WA).
[0252] Treatments for SLE include high-dose corticosteroids and/or
cyclophosphamide (HDCC). For the treatment of psoriasis, patients
can he administered a CD20 binding antibody in conjunction with
topical treatments, such as topical steroids, arithralin,
calcipotriene, clobetasol, and tazarotene, or with methotrexate,
retinoids, cyclosporine, PUVA and UVB therapies. In one embodiment,
the psoriasis patient is treated with the CD20 binding antibody
sequentially or concurrently with cyclosporine.
Pharmaceutical Formulations
[0253] Therapeutic formulations of the CD20-binding antibodies used
in accordance with the present invention are prepared for storage
by mixing an antibody having the desired degree of purity with
optional pharmaceutically acceptable carriers, excipients or
stabilizers (Remington's Pharmaceutical Sciences 16th edition,
Osol, A. Ed. (1980)), in the form of lyophilized formulations or
aqueous solutions. Acceptable carriers, excipients, or stabilizers
are nontoxic to recipients at the dosages and concentrations
employed, and include buffers such as phosphate, citrate, and other
organic acids; antioxidants including ascorbic acid and methionine;
preservatives (such as octadecyldimethylbenzyl ammonium chloride;
hexamethonium chloride; benzalkordum chloride, benzethonium
chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as
methyl or propyl paraben; catechol; resorcinol; cyclohexanol;
3-pentanol; and m-cresol); low molecular weight (less than about 10
residues) polypeptides; proteins, such as serum albumin, gelatin,
or immunoglobulins; hydrophilic polymers such as
olyvinylpyrroliaone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g. Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.TM., PLURONICS.TM. or
polyethylene glycol (PEG).
[0254] Exemplary anti-CD20 antibody formulations are described in
WO98/56418, expressly incorporated herein by reference. Another
formulation is a liquid multidose formulation comprising the
anti-CD20 antibody at 40 mg/mL, 25 mM acetate, 150 mM trehalose,
0.9% benzyl alcohol, 0.02% polysorbate 20 at PH 5.0 that has a
minimum shelf life of two years storage at 2-8.degree. C. Another
anti-CD20 formulation of interest comprises 10 mg/mL, antibody in
9.0 mg/mL sodium chloride, 7.35 mg/mL sodium citrate dihydrate, 0.7
mg/mL polysorbate 80, and Sterile Water for Injection, pH 6.5. Yet
another aqueous pharmaceutical formulation comprises 10-30 mM
sodium acetate from about pH 4.8 to about pH 5.5, preferably at
pH5.5, polysorbate as a surfactant in a an amount of about
0.01-0.1% v/v, trehalose at an amount of about 2-10% w/v, and
benzyl alcohol as a preservative (U.S. Pat. No. 6,171,586).
Lyophilized formulations adapted for subcutaneous administration
are described in WO97/04801. Such lyophilized formulations may be
reconstituted with a suitable diluent to a high protein
concentration and the reconstituted formulation may be administered
subcutaneously to the mammal to be treated herein.
[0255] One formulation for the humanized 2H7 variants is antibody
at 12-14 mg/mL in 10 mM histidine, 6% sucrose, 0.02% polysorbate
20, pH 5.8.
[0256] In a specific embodiment, 2H7 variants and in particular
2H7.v16 is formulated at 20 mg/mL antibody in 10 mM histidine
sulfate, 60 mg/ml sucrose., 0.2 mg/ml polysorbate 20, and Sterile
Water for Injection, at pH5.8.
[0257] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. For example, it may be desirable to
further provide a cytotoxic agent, chemotherapeutic agent, cytokine
or immunosuppressive agent (e.g. one which acts on T cells, such as
cyclosporin or an antibody that binds T cells, e.g. one which binds
LFA-1). The effective amount of such other agents depends on the
amount of antibody present in the formulation, the type of disease
or disorder or treatment, and other factors discussed above. These
are generally used in the same dosages and with administration
routes as described herein or about from 1 to 99% of the heretofore
employed dosages.
[0258] The active ingredients may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nattocapsules) or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences
16th edition, Osol, A. Ed. (1980).
[0259] Sustained-release preparations may he prepared. Suitable
examples of sustained-release preparations include semi-permeable
matrices of solid hydrophobic polymers containing the antagonist,
which matrices are in the form of shaped articles, e.g. films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and ethyl-L-glutamate, non: degradable ethylene-vinyl acetate,
degradable lactic acid-glycolic acid copolymers such as the LUPRON
DEPOT.TM. (injectable microspheres composed of lactic acid-glycolic
acid copolymer and leuprolide acetate), and
poly-D-{-}-3-hydroxybutyric acid.
[0260] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
Articles of Manufacture and Kits
[0261] Another embodiment of the invention is an article of
manufacture containing materials useful for the treatment of
autoimmune diseases and related conditions and CD20 positive
cancers such as non-Hodgkin's lymphoma. The article of manufacture
comprises a container and a label or package insert on or
associated with the container. Suitable containers include, for
example, bottles, vials, syringes, etc. The containers may be
formed from a variety of materials such as glass or plastic. The
container holds a composition which is effective for treating the
condition and may have a sterile access port (for example the
container may he an intravenous solution bag or a vial having a
stopper pierceable by a hypodermic injection needle). At least one
active agent in the composition is a CD20 binding antibody of the
invention. The label or package insert indicates that the
composition is used for treating the particular condition. The
label or package insert will further comprise instructions for
administering the antibody composition, to the patient. Package
insert refers to instructions customarily included in commercial
packages of therapeutic products, that contain information about
the indications, usage, dosage, administration, contraindications
and/or warnings concerning the use of such therapeutic products. In
one embodiment, the package insert indicates that the composition
is used for treating non-Hodgkins' lymphoma.
[0262] Additionally, the article of manufacture may further
comprise a second container comprising a
pharmaceutically-acceptable buffer, such as bacteriostatic water
for injection (BWFI), phosphate-buffered saline, Ringer's solution
and dextrose solution. It may further include other materials
desirable from a commercial and user standpoint, including other
buffers, diluents, filters, needles, and syringes.
[0263] Kits are also provided that are useful for various purposes
, e.g., for B-cell killing assays, as a positive control for
apoptosis assays, for purification or immunoprecipitation of CD20
from cells. For isolation and purification of CD20, the kit can
contain an anti-CD20 antibody coupled to beads (e.g., sepharose
beads). Kits can be provided which contain, the antibodies for
detection and quantitation of CD20 in vitro, e.g. in an ELISA or a
Western blot, As with the article of manufacture, the kit comprises
a container and a label or package insert on or associated with the
container. The container holds a composition comprising at least
one anti-CD20 antibody of the invention. Additional containers may
be included that contain, e.g., diluents and buffers, control
antibodies. The label or package insert may provide a description
of the composition as well as instructions for the intended in
vitro or diagnostic use.
Cynomolgus Monkey CD20
[0264] The invention also provides an isolated nucleicacid
comprising the nucleotide sequence of SEQ ID NO.: 24 of the
Cynomolgus monkey CD20 as shown in FIG. 19. In one embodiment, the
nucleic acid is a cDNA. In one embodiment, the nucleic acid
encoding the monkey CD20 is in an expression vector for expression
in a host cell. The nucleotide sequence of SEQ ID NO.: 24 in the
expression vector is operably linked to an expression control
sequence such as a promoter or promoter and enhancer. The
expression control sequence can be can be the native sequence
normally associated with the Cynomolgus CD20 gene, or heterologous
to the gene. Also provided is an isolated polypeptide comprising
the amino acid sequence [SEQ ID NO. 25; FIG. 19 & 20] of the
Cynomolgus monkey CD20, as well as host cells containing the
Cynomoigus CD20 nucleic acid. In one aspect the host cells are
eukaryotic cells, e.g., CHO cells. Fusion proteins comprising the
Cynomoigus CD20 amino acid sequence or fragments of the sequence
are also contemplated.
EXPERIMENTAL EXAMPLES
Example 1
Humanization of 2H7 and-CD20 Murine Monoclonal Antibody
[0265] Humanization of the murine anti-human CD20 antibody, 2H7
(also referred to herein as in2H7, m for murine), was carried out
in a series of site-directed mutagenesis steps. The murine 2H7
antibody variable region sequences and the chimeric 2H7 with the
mouse V and human C have been described, see, e.g., U.S. Pat. Nos.
5,846,818 and 6,204,023. The CDR residues of 2H7 were identified by
comparing the amino acid sequence of the murine 2H7 variable
domains (disclosed in U.S. Pat. No. 5,846,818) with the sequences
of known antibodies (Kabat et al., Sequences of proteins of
immunological interest, Ed. 5. Public Health Service, National
institutes of Health, Bethesda, Md. (1991)). The CDR regions for
the light and heavy chains were defined based on sequence
hypervariability (Kabat et al., supra) and are shown in FIG. 1A and
FIG. 1B, respectively. Using synthetic oligonucleotides (Table 1),
site-directed mutagenesis (Kunkel, Proc. Natl. Acad. Sci.
82:488-492 (1985)) was used to introduce ail six of the murine 2H7
CDR regions into a complete human Fab framework corresponding, to a
consensus sequence V.sub..kappa.I, V.sub.HIII (V.sub.L kappa
subgroup I, V.sub.H subgroup III) contained on plasmid pVX4 (FIG.
2).
[0266] The phagemid pVX4 (FIG. 2) was used for mutagenesis as well
as for expression of F(ab,s in E. coli. Based on the phage mid
pb0720, a derivative of pB0475 (Cunningham et al., Science 243:
1330-1336 (1989)), pVX4 contains a DNA fragment encoding a
humanized consensus .kappa.-subgroup I light chain
(V.sub.L.kappa.I-C.sub.L) and a humanized consensus subgroup III
heavy chain (V.sub.HIII-C.sub.H1) anti-IFN-.alpha. (interferon
.alpha.) antibody, pVX4 also has an alkaline phosphatase promotor
and Shine-Daigamo sequence both derived from another previously
described pUC119-based plasmid, pAK2 (Carter et al., Proc. Natl.
Acad. Sci. USA 89: 4285 (1992)). A unique Spel restriction site was
introduced between the DNA encoding for the F(ab) light and heavy
chains. The first 23 amino acids in both anti-IFN-.alpha. heavy and
light chains are the StII secretion signal sequence (Chang et at.
Gene 55: 189-196 (1987)).
[0267] To construct the CDR-swap version of 2H7 (2H7.v2),
site-directed mutagenesis was performed on a
deoxyuridine-containing template of pVX4; all six CDRs of
anti-IFN-.alpha. were changed to the murine 2H7 CDRs. The resulting
molecule is referred to as humanized 2H7 version 2 (2H7,v2), or the
"CDR-swap version" of 2H7; it has the m2H7 CDR residues with the
consensus human FR residues shown in FIGS. 1A and 1B. Humanized
2H7.v2 was used for further humanization.
[0268] Table 1 shows the oligonucleotide sequence used to create
each of the murine 2H7 (m2H7) CDRs in the H and L chain. For
example, the CDR-H1 oligonucleotide was used to recreate the m2H7 H
chain CDR1, CDR-H1, CDR-H2 and CDR-H3 refers to the H chain CDR1,
CDR2 and CDR3, respectively; similarly, CDR-L1, CDR-L2 and CDR-L3
refers to each of the L chain CDRs. The substitutions in CDR-H2
were done in two steps with two oligonucleotides, CDR-H2A and
CDR-H2B.
TABLE-US-00002 TABLE 1 Oligonucleotide sequences used for
construction of the CDR-swap of murine 2H7 CDRs into a human
framework in pVX4. Residues changed by each oligonucleotide are
underlined. Substi- tution Oligonucleotide sequence CDR-H1 C TAC
ACC TTC ACC AGC TAT AAC ATG CAC TGG GTC CG (SEQ ID NO. 27) CDR-H2A
G ATT AAT CCT GAC AAC GGC GAC ACG AGC TAT AAC CAG AAG TTC AAG GGC
CG (SEQ ID NO. 28) CDR-H2B GAA TGG GTT GCA GCG ATC TAT CCT GGC AAC
GGC GAC AC (SEQ ID NO. 29) CDR-H3 AT TAT TGT GCT CGA GTG GTC TAC
TAT AGC AAC AGC TAC TGG TAC TTC GAC GTC TGG GGT GAA GGA (SEQ ID NO.
30) CDR-L1 C TGC ACA GCC AGC TCT TCT GTC AGC TAT ATG CAT TG (SEQ ID
NO. 31) CDR-L2 AA CTA CTG ATT TAC GCT CCA TCG AAC CTC GCG TCT GGA
GTC C (SEQ ID NO. 32) CDR-L3 TAT TAC TGT CAA CAG TGG AGC TTC AAT
CCG CCC ACA TTT GGA CAC (SEQ ID NO. 33)
[0269] For comparison with humanized constructs, a plasmid
expressing a chimeric 2H7 Fab (containing murine V.sub.L and
V.sub.H domains, and human C.sub.L and CH.sub.1 domains) was
constructed by site-directed mutagenesis (Kunkel, supra) using
synthetic oligonucleotides to introduce the murine framework
residues into 2H7.v2. The sequence of the resulting plasmid
construct for expression of the chimeric Fah known as 2H7.v6.8, is
shown in FIG. 3, Each encoded chain of the Fab has a 23 amino acid
StII secretion signal sequence as described for pVX4 (FIG. 2)
above.
[0270] Based on a sequence comparison of the murine 2H7 framework
residues with the human V.sub..kappa.V.sub.HIII consensus framework
(FIGS. 1A and 1B) and previously humanized antibodies (Carter et
al, Proc. Natl. Acad. Sci. USA 89:4285-4289 (1992)), several
framework mutations were introduced into the 2H7.v2 Fab construct
by site-directed mutagenesis. These mutations result in a change of
certain human consensus framework residues to those found in the
murine 2H7 framework, at sites that might affect CDR conformations
or antigen contacts. Version 3 contained V.sub.H(R71V, N73K),
version 4 contained V.sub.H(R71V), version 5 contained
V.sub.H(R71V, N73K) and V.sub.L(LA6P), and version 6 contained
V.sub.H(R71V, N73K) and V.sub.L(L46P, L47W).
[0271] Humanized and chimeric Fab versions of m2H7 antibody were
expressed in E. coli and purified as follows. Plasmids were
transformed into E. coli strain XL-1 Blue (Stratagene, San Diego,
Calif.) for preparation of double-and single-stranded DNA. For each
variant, both light and heavy chains were completely sequenced
using the dideoxynucleotide method (Sequenase, U.S. Biochemical
Corp.). Plasmids were transformed into E. coli strain 16C9, a
derivative of MM294, plated onto 1_,I3 plates containing 5 .mu.g/ml
carbenicillin, and a single colony selected for protein expression.
The single colony was grown in 5 ml LB-100 .mu.g/ml carbenicillin
for 5-8 h at 37 C. The 5 ml culture was added to 500 ml AP5-100
.mu.g/ml carbenicillin and allowed to grow for 16 h in a 4 L
baffled shake flask at 37.degree. C. AP5 media consists of: 1.5 g,
glucose, 11.0 Hycase SF, 0.6 g yeast extract (certified), 0.19 g
anhydrous MgSO.sub.4, 1.07 g NH.sub.4CI, 3.73 g KCl, 1.2 g NaCl,
120 ml 1 M triethanolamine, pH 7.4, to 1 L water and then sterile
filtered through 0.1 .mu.m Sealkeen filter.
[0272] Cells were harvested by centrifugation in a 1 L centrifuge
bottle (Nalgene) at 3000.times.g and the supernatant removed. After
freezing for 1 h, the pellet was resuspended in 25 ml cold 10 mM
MES-10 mM EDTA, pH 5.0 (buffer A). 250 .mu.l of 0.1M PMSF (Sigma)
was added to inhibit proteolysis and 3.5 ml of stock 10 mg/ml hen
egg white lysozyme (Sigma) was added to aid lysis of the bacterial
cell wall. After gentle shaking on ice for 1 h, the sample was
centrifuged at 40,000.times.g for 15 min. The supernatant was
brought to 50 ml with buffer A and loaded onto a 2 ml DEAL column
equilibrated with buffer A. The flow-through was then applied to a
protein G-Sepharose CL 4B (Pharmacia) column (0.5 ml bed volume)
equilibrated with buffer A. The column was washed with 10 ml buffer
A and eluted with 3 ml 0.3 M glycine, pH 3,0, into 1.25 ml 1 M
Tris, pH 8.0. The F(ab) was then buffer exchanged into PBS using a
Centricon-30 (Amicon) and concentrated to a final volume of 0.5 ml.
SDS-PAGE gels of all F(ab)s were run to ascertain purity and the
molecular weight of each variant was verified by electrospray mass
spectrometry.
[0273] In cell-based ELISA binding assays (described below), the
binding of Fabs, including chimeric 2H7 Fab, to CD20 was difficult
to detect. Therefore, the 2H7 Fab versions were reformatted as
full-length IgG1 antibodies for assays and further mutagenesis.
[0274] Plasmids for expression of full-length IgG's were
constructed by subcloning the V.sub.L, and V.sub.H domains of
chimeric 2H7 (v6.8) Fab as well as humanized Fab versions 2 to 6
into previously described pRK vectors for mammalian cell expression
(Gorman et al., DNA Prot. Eng. Tech. 2:3-10 (19901). Briefly, each
Fab construct was digested with FcoRV and BlpI to excise a V.sub.L
fragment, which was cloned into the EcoRV/BlpI sites of plasmid
pDR1 (FIG. 4) for expression of the complete light chain
(V.sub.L-C.sub.L, domains). Additionally. each Fab construct was
digested with PvuII and ApaI to excise a V.sub.H fragment, which
was cloned into the PvuII/ApaI sites of plasmid pDR2 (FIG. 5) for
expression of the complete heavy chain
(VH--CH.sub.1-hinge-CH.sub.2--CH.sub.3 domains). For each IgG
variant, transient transfections were performed by cotransfecting a
light-chain expressing plasmic' and a heavy-chain expressing
plasmid into an adenovirus-transformed human embryonic kidney cell
line, 293 (Graham et al., J. Gen. Virol., 36:59-74, (1977)).
Briefly, 293 cells were split on the day prior to transfection, and
plated in serum-containing medium. On the following day,
double-stranded DNA prepared as a calcium phosphate precipitate was
added, followed by pAdVAntage.TM. DNA (Promega, Madison, Wis.), and
cells were incubated overnight at 37.degree. C. Cells were cultured
in serum-free medium and harvested after 4 days. Antibodies were
purified from culture supernatants using protein A-Sepharose CL-4B,
then buffer exchanged into 10 mM sodium succinate, 140 mM NaCl, pH
6.0, and concentrated using a Centricon-10 (Amicon). Protein
concentrations were determined by quantitative amino acid
analysis.
[0275] To measure relative binding affinities to the CD20 antigen,
a cell-bases ELISA assay was developed. Human B-lymphoblastoid
WIL2-S cells (ATCC CRL 8885, American Type Culture Collection,
Rockville, MD.) were grown in RPMI 1640 supplemented with 2 mM
L-glutamine, 20 mM HEPES, pH 7.2 and 10% heat inactivated fetal
bovine serum in a humidified 5% CO.sub.2 incubator. The cells were
washed with PBS containing 1% PBS (assay buffer) and seeded at
250-300,000 cell/well in 96-well round bottom plates (Nunc,
Roskilde, Denmark). Two-fold serially diluted standard (15.6-1000
ng/ml of 2H7 v6.8 chimeric IgG) and threefold serially diluted
samples (2.7-2000 ng/ml) in assay buffer were added to the plates.
The plates were buried in ice and incubated for 45 min. To remove
the unbound antibody, 0.1 mL assay buffer were added to the wells.
Plates were centrifuged and supernatants were removed. Cells were
washed two more times with 0.2 mL assay buffer. Antibody bound to
the plates was detected by adding peroxidase conjugated goat
anti-human Fc antibody (Jackson ImmunoResearch, West Grove, Pa.) to
the plates. After a 45 min incubation, cells were washed as
described before. TMB substrate (3,3',5,5'-tetramethyl benzidine;
Kirkegaard & Perry Laboratories, Gaithersburg, Md.) was added
to the plates. The reaction was stopped by adding 1 M phosphoric
acid. Titration curves were fit with a four-parameter nonlinear
regression curve-fitting program (KaleidaGraph, Synergy software,
Reading, PA). The absorbance at the midpoint of the titration curve
(mid-OD) and its corresponding concentration of the standard were
determined. Then the concentration of each variant at this mid-OD
was determined, and the concentration of the standard was divided
by that of each variant. Hence the values are a ratio of the
binding of each variant relative to the standard. Standard
deviations in relative affinity (equivalent concentration) were
generally .+-.10% between experiments.
[0276] As shown in Table 2, binding of the CDR-swap variant (v.2)
was extremely reduced compared to chimeric 2H7 (v.6.8). However,
versions 3 to 6 showed improved binding. To determine the minimum
number of mutations that might be required to restore binding
affinity to that of chimeric 2H7, additional mutations and
combinations of mutations were constructed by site-direct
mutagenesis to produce variants 7 to 17 as indicated in Table 3. in
particular, these included V.sub.H mutations A49G, F67A, I69L,
N73K, and L78A; and V.sub.L mutations M4L, M33I, and F71Y. Versions
16 and 17 showed the best relative binding affinities, within
2-fold of that of the Chimeric version, with no significant
difference (s.d, =+/-10%) between the two. To minimize the number
of mutations, version 16, having only 4 mutations of human
framework residues to murine framework residues (Table 3), was
therefore chosen as the humanized form for additional
characterization.
TABLE-US-00003 TABLE 2 Relative binding affinity of humanized 2H7
IgG variants to CD20 compared to chimeric 2H7 using cell-based
ELISA. The relative binding is expressed as the concentration of
the chimeric 2H7 over the concentration of the variant required for
equivalent binding; hence a ratio <1 indicates weaker affinity
for the variant. Standard deviation in relative affinity
determination averaged +/-10%. Framework substitutions in the
variable domains are relative to the CDR-swap version according to
the numbering system of Kabat (Kabat et al., supra). 2H7 Heavy
chain (V.sub.H) Light Chain (V.sub.L) Relative version
substitutions substitutions binding 6.8 (Chimera) (Chimera) -1- 2
(CDR swap) (CDR swap) 0.01 3 R71V, N73K (CDR swap) 0.21 4 R71V (CDR
swap) 0.21 5 R71V, N73K L46P 0.50 6 R71V, N73K L46P, L47W 0.58 7
R71V L46P 0.33 8 R71V, L78A L46P 0.19 9 R71V, F67A L46P 0.07 10
R71V, F67A, I69L L46P 0.12 11 R71V, F67A, L78A L46P 0.19 12 R71V
L46P, M4L 0.32 13 R71V L46P, M33I 0.31 14 R71V L46P, F71Y 0.25 15
R71V L46P, M4L, M33I 0.26 16 R71V, N73K, A49G L46P 0.65 17 R71V,
N73K, A49G L46P, L47W 0.67
TABLE-US-00004 TABLE 3 Oligonucleotide sequences used for
construction of mutations VH(A49G, R71V, N73K) and VL(L46P) in
humanized 2H7 version 16 (2H7.v16). Underlined codons encode the
indicated amino acid substitutions. For V.sub.H(R71V, N73K) and
V.sub.L(L46P), the oligos are shown as the sense strand since these
were used for mutagenesis on the Fab template, while for
V.sub.H(A49G), the oligo is shown as the anti-sense strand, since
this was used with the pRK (IgG heavy chain) template. The protein
sequence of version 16 is shown in FIF. 6 and FIG. 7, Substitution
Oligonucleotide sequence V.sub.H(R71V, N73K) GT TTC ACT ATA AGT GTC
GAC AAG TCC AAA AAC ACA TT (SEQ ID NO. 34) V.sub.H(A49G)
GCCAGGATAGATGGCGCCAACCCATTCCAGGCC (SEQ ID NO. 35) V.sub.L(L46P)
AAGCTCCGAAACCACTGATTTACGCT (SEQ ID NO. 36)
Example 2
Antigen-binding Determinants (Paratope) of 2H7
[0277] Alanine substitutions (Cunningham & Wells, Science 244:
1081-1085 (1989) were made in 2H7.v16 or 2H7.v17 in order to test
the contributions of individual side chains of the antibody in
binding to CD20. IgG variants were expressed in 293 cells from pDR1
and pDR2 vectors, purified, and assayed for relative binding
affinity as described above. Several aJanine substitutions resulted
in significant decreases in relative binding to CD20 on WIL-2S
cells (Table 4).
TABLE-US-00005 TABLE 4 Effects of alanine substitutions in the CDR
regions of humanized 2H7.v16 measured using cell-based ELISA
(WIL2-S cells). The relative binding is expressed as the
concentration of the 2H7.v16 parent over the concentration of the
variant required for equivalent binding; hence a ratio <1
indicates weaker affinity for the variant; a ratio >1 indicates
higher affinity for the variant. Standard deviation in relative
affinity determination averaged +/-10%. Framework substitutions in
the variable domains are relative to 2H7.v16 according to the
numbering system of Kabat (Kabat et al., supra). NBD means no
detectable binding. The two numbers for version 45 are from
separate experiments. 2H7 CDR Heavy chain Light chain version
location substitutions substitutions Relative binding 16 -- -- --
-1- 140 H1 G26A -- 0.63 141 H1 Y27A -- 0.47 34 H1 T28A -- 0.86 35
H1 F29A -- 0.07 36 H1 T30A -- 0.81 37 H1 S31A -- 0.97 142 H1 Y32A
-- 0.63 143 H1 N33A -- NDB 144 H1 M34A -- 1.2 145 H1 H35A --
<0.25 146 H2 A50G -- 0.31 147 H2 I51A -- 0.65 38 H2 Y52A -- 0.01
148 H2 P52aA -- 0.66 39 H2 G53A -- 0.89 67 H2 N54A -- 1.4 40 H2
G55A -- 0.79 41 H2 D56A -- 2.0 89 H2 T57A -- 0.61 90 H2 S58A --
0.92 91 H2 Y59A -- 0.74 92 H2 N60A -- 0.80 93 H2 Q61A -- 0.83 94 H2
K62A -- 0.44 95 H2 F63A -- 0.51 83 H2 V71A -- 0.96 149 H2 K64A --
0.82 150 H2 G65A -- 1.2 153 H3 V95A -- 0.89 42 H3 V96A -- 0.98 43
H3 Y97A -- 0.63 44 H3 Y98A -- 0.40 45 H3 S99A -- 0.84; 0.92 46 H3
N100A -- 0.81 47 H3 S100aA -- 0.85 48 H3 Y100bA -- 0.78 49 H3
W100cA -- 0.02 59 H3 Y100dA -- 0.98 60 H3 F100eA -- NDB 61 H3 D101A
-- 0.31 151 H3 V102A -- 1.1 117 L1 -- R24A 0.85 118 L1 -- A25G 0.86
119 L1 -- S26A 0.98 120 L1 -- S27A 0.98 121 L1 -- S28A 1.0 122 L1
-- V29A 0.41 50 L1 -- S30A 0.96 51 L1 -- Y32A 1.0 123 L1 -- M33A
1.0 124 L1 -- H34A 0.21 125 L2 -- A50G 0.92 126 L2 -- P51A 0.88 52
L2 -- S52A 0.80 53 L2 -- N53A 0.76 54 L2 -- L54A 0.60 127 L2 --
A55G 1.1 128 L2 -- S56A 1.1 129 L3 -- Q89A 0.46 130 L3 -- Q90A
<0.22 55 L2 -- W91A 0.88 56 L3 -- S92A 1.1 57 L3 -- F93A 0.36 58
L3 -- N94A 0.61 131 L3 -- P95A NDB 132 L3 -- P96A 0.18 133 L3 --
T97A <0.22
Example 3
Additional Mutations Within 2H7 CDR Regions
[0278] Substitutions of additional residues and combinations of
substitutions at CDR positions that were identified as important by
Ala-scanning were also tested. Several combination variants,
particularly v.96 appeared to bind inure tightly than v.16.
TABLE-US-00006 TABLE 5 Effects of combinations of mutations and
non-alanine substitutions in the CDR regions of humanized 2H7.v16
measured using cell-based ELISA (WIL2-S cells). The relative
binding to CD20 is expressed as the concentration of the 2H7.v16
parent over the concentration of the variant required for
equivalent binding; hence a ratio <1 indicates weaker affinity
for the variant; a ratio >1 indicates higher affinity for the
variant. Standard deviation in relative affinity determination
averaged +/-10%. Framework substitutions in the variable domains
are relative to 2H7.v16 according to the numbering system of Kabat
(Kabat et al., supra). 2H7 Heavy chain Light chain Relative version
substitutions Substitutions binding 16 -- -- -1- 96 D56A, N100A
S92A 3.5 97 S99T, N100G, Y100bI -- 0.99 98 S99G, N100S, Y100bI --
1.6 99 N100G, Y100bI -- 0.80 101 N54S, D56A -- 1.7 102 N54K, D56A
-- 0.48 103 D56A, N100A -- 2.1 104 S99T, N100G -- 0.81 105 S99G,
N100S -- 1.1 106 N100G -- ~1 167 S100aG, Y100bS -- 136 D56A, N100A
S56A, S92A 2.6 137 D56A, N100A A55G, S92A 2.1 156 D56A, N100A S26A,
S56A, S92A 2.1 107 D56A, N100A, Y100bI S92A not expressed 182 Y27W
-- 183 Y27F -- 184 F29Y -- 185 F29W -- 186 Y32F -- 187 Y32W -- 188
N33Q -- 189 N33D -- 190 N33Y -- 191 N33S -- 208 H35S -- 209 A50S --
210 A50R -- 211 A50V -- 212 A50L -- 168 Y52W -- 169 Y52F -- 0.75
170 N54D -- 0.25 171 N54S -- 1.2 172 D56K -- 1 173 D56R -- 174 D56H
-- 1.5 175 D56E -- 1.2 213 D56S -- 214 D56G -- 215 D56N -- 216 D56Y
-- 176 Y59W -- 177 Y59F -- 180 K62R -- 181 K62D -- 178 F63W -- 179
F63Y -- 157 Y97W -- 0.64 158 Y97F -- 1.2 159 Y98W -- 0.64 160 Y98F
-- 0.88 106 N100G -- 161 W100cY -- 0.05 162 W100cF -- 0.27 163
F100eY -- 0.59 164 F100eW -- 0.71 165 D101N -- 0.64 166 S99G,
N100G, S100aD, -- 0.99 Y100b deleted 217 V102Y -- 1.0 207 -- H34Y
192 -- Q89E 193 -- Q89N 194 -- Q90E 195 -- Q90N 196 -- W91Y 197 --
W91F 205 -- S92N 206 -- S92G 198 -- F93Y 199 -- F93W 204 -- F93S,
N94Y 200 -- P96L 201 -- P96Y 202 -- P96W 203 -- P96R
Example 4
Mutations at Sites of Framework Humanization Substitutions
[0279] Substitutions of additiomil residues at framework positions
that were changed during humanization were also tested in the
2H7.v16 background. In particular, alternative framework
substitutions that were neither found in the murine 2H7 parent nor
the human consensus framework were made at V.sub.L (P46) and
V.sub.H(G49, V71, and K73).
[0280] These substitutions generally led to little change in
elative binding (Table 6), indicating that there is some
flexibility in framework residues at these positions.
TABLE-US-00007 TABLE 6 Relative binding in a cell-based (WIL2-S)
assay of framework substitutions. IgG variants are shown with
mutations with respect to the 2H7.v16 background. The relative
binding is expressed as the concentration of the 2H7.v6.8 chimera
over the concentration of the variant required for equivalent
binding; hence a ratio <1 indicates weaker affinity for the
variant; a ratio >1 indicates higher affinity for the variant.
Standard deviation in relative affinity determination averaged
+/-10%. Framework substitutions in the variable domains are
relative to 2H7.v16 according to the numbering system of Kabat
(Kabat et al., supra). (*) Variants that were assayed with 2H7.v16
as the standard comparator; relative values are normalized to that
of the chimera. 2H7 Heavy chain Light chain version substitutions
Substitutions Relative binding 6.8 (chimera) (chimera) -1- 16 -- --
0.64 78 K73R -- 0.72 79 K73H -- 0.49 80 K73Q -- 0.58 81 V71I --
0.42 82 V71T -- 0.58 83 V71A -- 84 G49S -- 0.32 85 G49L -- 86 --
P46E 0.22 87 -- P46V 0.51 88 -- P46T 108 G49A, V71T, K73R S92A,
M32L, P46T 0.026* 109 G49A, A49G, V71T, S92A, M32L, P46T 0.026*
K73R 110 K73R, D56A, N100A S92A, M32L Not expressed 111 G49A, V71T,
K73R -- 0.46* 112 G49A, A50G, V71T, -- 0.12* K73R *Variants that
were assayed with 2H7.v16 as the standard comparator; relative
values are normalized to that of the chimera.
Example 5
Humanized 2H7 Variants with Enhanced Effector Functions
[0281] Because 2H7 can mediate lysis of B-cells through both
complement-dependent cytotoxicity (CDC) and antibody-dependent
cellular cytotoxicity (ADCC), we sought to produce variants of
humanized 2H7.v16 with improved CDC and ADCC activity. Mutations of
certain residues within the Fe regions of other antibodies have
been described (Idusogie et al., J. Immunol. 166:2571-2575 (2001))
for improving CDC through enhanced binding to the complement
component C1q. Mutations have also been described (Shields et al.,
J. Biol. Chem. 276:6591-6604 (2001), Presta et al., Biochem. Soc.
Trans. 30:487-490 (2002)) for improving ADCC through enhanced IgG
binding to activating Fc.gamma. receptors and reduced IgG binding
to inhibitory Fc.gamma. receptors. In particular, three mutations
have been identified for improving CDC and ADCC activity:
S298A/E333A/K334A (also referred to herein as a triple Ala mutant
or variant; numbering in the Fc region is according to the ECT
numbering system; Kabat et al., supra) as described (Idusogie et
al, supra (2001); Shields et al., supra).
[0282] In order to enhance CDC and ADCC activity of 2H7, a triple
Ala mutant of the 2H7 Fc was constructed. A humanized variant of
the anti-HER2 antibody 4d5 has been produced with mutations
S298A/E333A/K334A and is known as 4D5Fc110 (i.e, anti-p.sup.185HER2
IgG1 (S298A/E333A/K334A); Shields et al, supra). A plasmid,
p4D5Fc110 encoding antibody 4D5Fc110 (Shields et al., supra) was
digested with ApaI and HindIII, and the Fc fragment (containing
mutations S298A/E333A/K334A) was ligated into the ApaI/HindIII
sites of the 2H7 heavy-chain vector pDR2-v16, to produce pDR2-v31.
The amino acid sequence of the version 31 complete H chain is shown
in FIG. 8. The L chain is the same as that of v16.
[0283] Although the constant domains of the Fc region of IgG1
antibodies are relatively conserved within a given species, allelic
variations exist (reviewed by Lefranc and Lefranc, in The human IgG
subclasses: molecular analysis of structure, function, and
regulation, pp. 43-78, F. Shakib (ed.), Pergammon Press, Oxford
(1990)).
TABLE-US-00008 TABLE 7 Effects of substitutions in the Fc region on
CD20 binding. Relative binding to CD20 was measured in a cell-based
(WIL2-S) assay of framework substitutions. Fc mutations (*) are
indicated by EU numbering (Kabat, supra) and are relative to the
2H7.v16 parent. The combination of three Ala changes in the Fc
region of v.31 is described as "Fc110." IgG variants are shown with
mutations with respect to the 2H7.v16 background. The relative
binding is expressed as the concentration of the 2H7.v6.8 chimera
over the concentration of the variant required for equivalent
binding; hence a ratio <1 indicates weaker affinity for the
variant. Standard deviation in relative affinity determination
averaged +/-10%. 2H7 Fc Relative version Substitutions* binding 6.8
-- -1- 16 -- 0.65 31 S298A, E333A, K334A 0.62
Example 6
Humanized 2H7 Variants with Enhanced Stability
[0284] For development as therapeutic proteins, it is desirable to
choose variants that remain stable with respect to oxidation,
deamidation, or other processes that may affect product quality, in
a suitable formulation buffer. In 2H7.v16 several residues were
identified as possible sources of instability: VL (M32) and VH
(M34, N100). Therefore, mutations were introduced at these sites
for comparison with v16.
TABLE-US-00009 TABLE 8 Relative binding of 2H7 variants designed
for enhanced stability and/or effector function, to CD20 in a
cell-based (WIL2-S) assay. IgG variants are shown with mutations
with respect to the 2H7.v16 background. The relative binding is
expressed as the concentration of the 2H7.v6.8 chimera over the
concentration of the variant required for equivalent binding; hence
a ratio <1 indicates weaker affinity for the variant. Standard
deviation in relative affinity determination averaged +/- 10%.
Framework substitutions in the variable domains are relative to
2H7.v16 according to the numbering system of Kabat and Fc mutations
(*) are indicated by EU numbering (Kabat et al., supra). (**)
Variants that were measured with 2H7.v16 as the standard
comparator; relative values are normalized to that of the chimera.
Additional Fc mutations were combined with stability or
affinity-enhancing mutations to alter or enhance effector functions
based on previously reported mutations (Idusogie et al. (2000);
Idusogie et al. (2001); Shields et al. (2001)). These changes
include S298, E333A, K334A as described in Example 5; K322A to
reduced CDC activity; D265A to reduce ADCC activity; K326A or K326W
to enhance CDC activity; and E356D/M358L to test the effects of
allotypic changes in the Fc region. None of these mutations caused
significant differences in CD20 binding affinity. 2H7 Heavy chain
Light chain Relative version (V.sub.H) changes (V.sub.L) changes Fc
changes* binding 6.8 (chimera) (chimera) -- -1- 16 -- -- -- 0.65 62
-- M32I -- 0.46 63 M34I -- -- 0.49 64 N100A -- -- 65 N100A L47W --
0.74 66 S99A L47W -- 0.62 67 N54A -- -- 68 -- M32I -- 0.48 69 --
M32L -- 0.52 70 N100A -- S298A, E333A, K334A 0.80 71 N100D --
S298A, E333A, K334A 0.44 72 N100A M32I -- 0.58 73 N100A M32L --
0.53 74 N100A M32I S298A, E333A, K334A 0.61 75 N100A M32L S298A,
E333A, K334A 0.60 113 -- -- E356D, M358L 0.60** 114 D56A, N100A
M32L, S92A S298A, E333A, K334A 1.2** 115 D56A, N100A M32L, S92A
S298A, E333A, K334A, E356D, M358L 1.4** 116 D56A, N100A M32L, S92A
S298A, K334A, K322A 1.2** 134 D56A, N100A M32L, S92A E356D, M358L,
D265A 1.5** 135 D56A, N100A M32L, S92A E356D, M358L, D265A, K326W
0.95** 138 D56A, N100A M32L, S92A S298A, E333A, K334A, K326A 1.2**
139 D56A, N100A M32L, S92A S298A, E333A, K334A, K326A, E356N, M358L
1.1** 154 -- -- D265A 0.70** 155 -- -- S298A, K322A, K334A 0.70**
**Variants that were measured with 2H7.v16 as comparator; relative
binding values are normalized to that of the chimera.
[0285] To test the effects of stability mutations on the rate of
protein degradation, 2H7.v16 and 2H7.v73 were formulated at 12-14
mg/ML in 10 mM histidine, 6% sucrose, 0.02% polysorbate 20, pH 5.8
and incubated at 40.degree. C. for 16 days. The incubated samples
were then assayed for changes in charge variants by ion exchange
chromatography, aggregation and fragmentation by size exclusion
chromatography, and relative binding by testing in a cell-based
(WIL2-S) assay.
[0286] The results (FIG. 9) show that 2H7 v.73 has greater
stability compared to 2H7 v.16 with respect to losses in the
fraction of main peak by ion exchange chromatography under
accelerated stability conditions. No significant differences were
seen with respect to aggregation, fragmentation, or binding
affinity.
Example 7
Scatchard Analysis of Antibody Binding to CD20 on WIL2-S Cells
[0287] Equilibrium dissociation constants (K.sub.d) were determined
for 2H7 IgG variants binding to WIL2-S cells using radiolabeled 2H7
IgG. IgG variants were produced in CHO cells. Rituxan.RTM. (source
for all experiments is Genentech, S. San Francisco, Calif.) and
murine 2H7 (BD PharMingen, San Diego, Calif.) were used for
comparison with humanized variants. The murine 2H7 antibody is also
available from other sources, e.g., eBioscience, and Calbiochem
(both of San Diego, Calif.), Accurate Chemical & Scientific
Corp., (Westbury, N.Y.), Ancell (Bayport, Minn.), and Vinci-Biochem
(Vinci, Italy). All dilutions were performed in binding assay
buffer (DMEM media containing 1% bovine serum albumin, 25 mM HEPES
pH 7.2, and 0.01% sodium azide). Aliquots (0.025 mL) of
.sup.125I-2H7.v16 (iodinated with lactoperoxidase) at a
concentration of 0.8 nM were dispensed into wells of a V-bottom
96-well microassay plate, and serial dilutions (0.05 mL) of cold
antibody were added and mixed. WIL2-S cells (60,000 cells in 0.025
mL) were then added. The plate was sealed and incubated at room
temperature for 24 h, then centrifuged for 15 min at 3,500 RPM. The
supernatant was then aspirated and the cell pellet was washed and
centrifuged. The supernatant was again aspirated, and the pellets
were dissolved in 1N1 NaOH and transferred to tubes for gamma
counting. The data were used for Scatchard analysis (Munson and
Rodbard, Anal. Biochem. 107:220-239 (1980)) using the program
Ligand (McPherson, Comput. Programs Biamed. 17: 107-114 (1983)).
The results, shown in Table 9, indicate that humanized 2H7 variants
had similar CD20 binding affinity as compared to murine 2H7, and
similar binding affinity to Rituxan.RTM.. It is expected that
2H7.v31 will have very similar K.sub.d to v.16 on the basis of the
binding shown in Table 7 above.
TABLE-US-00010 TABLE 9 Equilibrium binding affinity of 2H7 variants
from Scatchard analysis Antibody variant K.sub.d (nM) N Rituxan
0.99 .+-. 0.49 3 2H7 (murine) 1.23 .+-. 0.29 3 2H7.v16 0.84 .+-.
0.37 4 2H7.v73 1.22 .+-. 0.39 4 2H7.v75 1.09 .+-. 0.17 4
Example 8
Complement Dependent Cytotoxicity (CDC) Assays
[0288] 2H7 IgG variants were assayed for their ability to mediate
complement-dependent lysis of WIL2-S cells, a CD20 expressing
lymphoblastoid B-cell line, essentially as described (Ichisogie et
al., J. Immunol. 164:4178-4184 (2000); Idusogie et al., J. Immunol.
166:2,571-2575 (2001)), Antibodies were serially diluted 1:3 from a
0.1 mg/mL stock solution. A 0.05 mL aliquot of each dilution was
added to a 96-well tissue culture plate that contained 0.05 mL of a
solution of normal human complement (Quidel, San Diego, Calif.) To
this mixture, 50,000 WIL2-S cells were added in a 0.05 mL volume.
After incubation for 2 h at 37.degree. C., 0.05 mL of a solution of
Alamar blue (Accumed International, Westlake, Ohio) was added, and
incubation was continued for an additional 18 h at 37.degree. C.
Covers were then removed from the plates, and they were shaken for
15 min at room temperature on an orbital shaker. Relative
fluorescent units (RFU) were read using a 530 nm excitation filter
and a 590 nm emission filter. An EC.sub.50 was calculated by
fitting RFU as a function of concentration for each antibody using
KaleidaGraph software.
[0289] The results (Table 10) show surprising improvement in CDC by
humanized 2H7 antibodies, with relative potency similar to
Rituxan.RTM. for v.73, 3-fold more potent than Rituxan.RTM. for
v.75, and 3-fold weaker than Rituxan.RTM. for v.16.
TABLE-US-00011 TABLE 10 CDC activity of 2H7 antibodies compared to
Rituxan. Numbers >1 indicate less potent CDC activity than
Rituxan .RTM. and numbers <1 indicate more potent activity than
Rituxan .RTM.. Antibodies were produced from stable CHO lines,
except that those indicated by (*) were produced transiently.
Antibody variant n EC.sub.50(variant)/EC.sub.50(Rituxan) Rituxan
.RTM. 4 -1- 2H7.v16 4 3.72; 4.08 2H7.v31* 4 .21 2H7.v73 4 1.05
2H7.v75 4 0.33 2H7.v96* 4 0.956 2H7.v114* 4 0.378 2H7.v115* 4 0.475
2H7.v116* 1 >100 2H7.v135* 2 0.42
Example 9
Antibody Dependent Cellular Cytotoxicity (ADCC) Assays
[0290] 2H7 IgG variants were assayed for their ability to mediate
Natural-Killer cell (NK cell) lysis of WIL2-S cells, a CD20
expressing lymphoblastoid B-cell line, essentially as described
(Shields et al., J. Biol. Chem. 276:6591-6604 (2001)) using a
lactate dehydrogenase (LDH) readout. NK cells were prepared from
100 mL of heparinized blood, diluted with 100 mL of PBS (phosphate
buffered saline), obtained from normal human donors who had been
isotyped for Fc.gamma.RIII, also known as CD16 (Koene et al., Blood
90:1109-1114 (1997)). In this experiment, the NK cells were from
human donors heterozygous for CD16 (F158/V158). The diluted blood
was layered over 15 mL of lymphocyte separation medium (ICN
Biochemical, Aurora, Ohio) and centrifuged for 20 min at 2000 RPM.
White cells at the interface between layers were dispensed to 4
clean 50-mL tubes, which were filled with RPMI medium containing
15% fetal calf serum. Tubes were centrifuged for 5 min at 1400 RPM
and the supernatant discarded. Pellets were resuspended in MACS
buffer (0.5% BSA, 2 mM EDTA), and NK cells were purified using
beads (NK Cell Isolation Kit, 130-046-502) according to the
manufacturer's protocol (Miltenyi Biotech,). NK cells were diluted
in MACS buffer to 2.times.10.sup.6 cells/mL.
[0291] Serial dilutions of antibody (0.05 mL) in assay medium
(F12/DMEM 50:50 without glycine, 1 mM HEPES buffer pH 7.2,
Penicillin/Streptomycin (100 units/mL; Gibco), glutamine, and 1%
heat-inactivated fetal bovine serum) were added to a 96-well
round-bottom tissue culture plate. WIL2-S cells were diluted in
assay buffer to a concentration of 4.times.10.sup.5/mL. WIL2-S
cells (0.05 mL per well) were mixed with diluted antibody in the
96-well plate and incubated for 30 min at room temperature to allow
binding of antibody to CD20 (opsonization).
[0292] The ADCC reaction was initiated by adding 0.1 mL of NK cells
to each well. In control wells, 2% Triton X-100 was added. The
plate was then incubated for 4 h at 37.degree. C. Levels of LDH
released were measured using a cytotoxicity (LDH) detection kit
(Kit#1644793, Roche Diagnostics, Indianapolis, Ind.) following the
manufacturers instructions. 0.1 mL of LDH developer was added to
each well, followed by mixing for 10 s. The plate was then covered
with aluminum foil and incubated in the dark at room temperature
for 15 min. Optical density at 490 nm was then read and use to
calculate % lysis by dividing by the total LDH measured in control
wells. Lysis was plotted as a function of antibody concentration,
and a 4-parameter curve fit (KaleidaGraph) was used to determine
EC.sub.50 concentrations.
[0293] The results showed that humanized 2H7 antibodies were active
in ADCC, with relative potency 20-fold higher than Rituxan.RTM. for
v.31 and v.75, 5-fold more potent than Rituxan.RTM. for v.16, and
almost 4-fold higher than Rituxan.RTM. for v.73.
TABLE-US-00012 TABLE 11 ADCC activity of 2H7 antibodies on WIL2-S
cells compared to 2H7.v16, based on n experiments. (Values >1
indicate lower potency than 2H7.v16, and values <1 indicate
greater potency.) Antibody variant n EC.sub.50
(variant)/EC.sub.50(2H7.v16) Rituxan .RTM. 4 5.3 2H7.v16 5 1
2H7.v31 1 0.24 2H7.v73 5 1.4 2H7.v75 4 0.25
[0294] Additional ADCC assays were carried out to compare
combination-variants of 2H7 with Rituxan.RTM., The results of these
assays indicated that 2H7.v114 and 2H7.v115 have >10-fold
improved ADCC potency as compared to Rituxan.RTM. (Table 12).
TABLE-US-00013 TABLE 12 ADCC activity of 2H7 antibodies on WIL2-S
cells compared to Rituxan .RTM., based on n experiments (Values
>1 indicate lower potency than Rituxan .RTM., and values <1
indicate greater potency). Antibody variant
EC50(variant)/EC50(Rituxan) Rituxan .RTM. 2 -1- 2H7 v.16 2 0.52 2H7
v.96 2 0.58 2H7.v114 2 0.093 2H7.v115 2 0.083 2H7.v116 2 0.30
Example 10
In vivo Effects or 2H7 Variants in a Pilot Study in Cynomolgus
Monkeys
[0295] 2H7 variants, produced by transient transfection of CHO
cells, were tested in normal male cynomolgus (Macaca fascicularis)
monkeys in order to evaluate their in vivo activities. Other
anti-CD20 antibodies, such as C2B8 (Rituxan.RTM.) have demonstrated
an ability to deplete B-cells in normal primates (Reff et al.,
Blood 83: 435-445 (1994)).
[0296] In one study, humanized 2H7 variants were compared. In a
parallel study, Rituxan.RTM. was also tested in cynomolgus monkeys.
Four monkeys were used in each of five dose groups: (1) vehicle,
(2) 0.05 mg/kg hu2H7.v16, (3) 10 mg/kg hu2H7.v16, (4) 0.05 mg/kg
hu2H7.v31, and (5) 10 mg/kg hu2H7.v31. Antibodies were administered
intravenously at a concentration of 0, 0.2, or 20 mg/mL, for a
total of two doses, one on day 1 of the study, and another on day
8. The first day of closing is designated day 1 and the previous
day is designated day -1; the first day of recovery (for 2 animals
in each group) is designated as day 11. Blood samples were
collected on days -19, -12, 1 (prior to dosing), and at 6 h, 24 h,
and 72 h following the first dose. Additional samples were taken on
day 8 (prior to dosing), day 10 (prior to sacrifice of 2
animals/group), and on days 36 and 67 (for recovery animals).
[0297] Peripheral B-cell concentrations were determined by a FACS
method that counted CD3-/CD40+ cells. The percent of CD3-CD40+ B
cells of total lymphocytes in monkey samples were obtained by the
following gating strategy. The lymphocyte population was marked on
the forward scatter/side scatter scattergram to define Region 1
(R1). Using events in R1, fluorescence intensity dot plots were
displayed for CD40 and CD3 markers. Fluorescently labeled isotype
controls were used to determine respective cutoff points for CD40
and CD3 positivity.
[0298] The results indicated that both 2H7.v16 and 2H7.v31 were
capable of producing full peripheral B-cell depletion at the 10
mg/kg dose and partial peripheral B-cell depletion at the 0.05
mg/kg dose (FIG. 11). The time course and extent of B-cell
depletion measured during the first 72 h of dosing were similar for
the two antibodies. Subsequent analysis of the recovery animals
indicated that animals treated with 2H7.v31 showed a prolonged
depletion of B-cells as compared to those dosed with 2H7.v16. In
particular, recovery animals treated with 10 mg/kg 2H7.v16, B-cells
showed substantial B-cell recovery at some time between sampling on
Day 10 and on Day 36. However, for recovery animals treated with 10
mg/kg 2H7.v31, B-cells did not show recovery until some time
between Day 36 and Day 67 (FIG. 11). This suggests a greater
duration of full depletion by about one month for 2H7.v31 compared
to 2H7.v16.
[0299] No toxicity was observed in the monkey study at low or high
dose and the gross pathology was normal. In other studies, v16 was
well tolerated up to the highest dose evaluated of (100
mg/kg.times.2=1200 mg/m.sup.2.times.2) following i.v.
administration of 2 doses given 2 weeks apart in these monkeys.
[0300] Data in Cynomolgus monkeys with 2H7.v16 versus Rituxan.RTM.
suggests that a 5-fold reduction in CDC activity does not adversely
affect potency. An antibody with potent ADCC activity but reduced
CDC activity may have more favorable safety profile with regard to
first infusion reactions than one with greater CDC activity.
Example 11
Fucose Deficient 2H7 Variant Antibodies with Enhanced Effector
Function
[0301] Normal CHO and HEK293 cells add fucose to IgG
oligosaccharide to a high degree (97-98%). IgG from sera are also
highly fucosylated.
[0302] DP12, a dihydrofolate reductase minus (DHFR.sup.-) CHO cell
line that is fucosylation competent, and. Lec13, a cell line that
is deficient in protein fucosylation were used to produce
antibodies for this study. The CHO cell nine Pro-Lec13.6a (Lec13),
was obtained front Professor Pamela Stanley of Albert Einstein
College of Medicine of Yeshiva University. Parental lines are Pro-
(proline auxotroplo and Gat- (glycine, adenosine, thymidine
auxotroph). The CHO-DP12 cell line is a derivative of the CHO-K1
cell line (ATCC #CCL-61), which is dihydrofolate reductase
deficient, and has a reduced requirement for insulin. Cell lines
were transfected with cDNA using the Superfect method (Qiagen,
Valencia, Calif.). Selection of the Lec13 cells expressing
transfected antibodies was performed using puromycin
dihydrochloride (Calbiochem, San Diego, Calif.) at 10 .mu.g/ml in
growth medium containing: MEM Alpha Medium with L-glutamine,
ribonucleosides and deoxyribonucleosides (GIBCO-BRL, Gaithersburg,
Md.), supplemented with 10% inactivated FBS (GIBCO), 10 mM HEPES,
and 1.times. penicillin/streptomycin (GIBCO). The CHO cells were
similarly selected in growth medium containing Ham's F12 without
GHT: Low Glucose DMEM without Glycine with NaHCO3 supplemented with
5% FBS (GIBCO), 10 HEPES, 2 nM L-glutamine, 1.times. GHT(glycine,
hypoxanthine, thymidine), and 1.times. penicillin/streptomycin.
[0303] Colonies formed within two to three weeks and were pooled
for expansion and protein expression. The cell pools were seeded
initially at 3.times.10.sup.6 cells/10 cm plate for small batch
protein expression. The cells were converted to serum-free media
once they grew to 90-95% confluency and after 3-5 days cell
supernatants were collected and tested in an Fc IgG- and intact
IgG-ELISA to estimate protein expression levels. Lec13 and CHO
cells were seeded at approximately 8.times.10.sup.6 cells/15 cm
plate one day prior to converting to PS24 production medium,
supplemented with 10 mg/L recombinant human insulin and 1 mg/L
trace elements.
[0304] Lec13 cells and DP12 cells remained in serum-free production
medium for 3-5 days. Supernatants were collected and clarified by
centrifugation in 150 ml conical tubes to remove cells and debris.
The protease inhibitors PMSF and aprotinin (Sigma, St. Louis, Mo.)
were added and the supernatants were concentrated 5-fold on stirred
cells using MWCO30 filters (Amicon, Beverly, Mass.) prior to
immediate purification using protein G chromatography (Amersham
Pharmacia Biotech, Piscataway, N.J.)). All proteins were buffer
exchanged into phosphate-buffered saline (PBS) using Centripriep-30
concentrators (Amicon) and analyzed SDS-polyacrylamide gel
electrophoresis. Protein concentrations were determined using A280
and verified using amino acid composition analysis.
[0305] The CHO cells were transfected with vectors expressing
humanized 2H7v16, 2H7v.31 and selected as described. The 2H7v.16
antibody retains the wild type Fc region While v.31 (see Example 5,
Table 7 above) has an Fc region wherein 3 amino acid changes were
made (S298A, E333A, K334A) which results in higher affinity for the
Fc.gamma.RIIIa receptor (Shields et al. J. Biol. Chem. 276
(9):6591-6604 (2001)). Following transfection and selection,
individual colonies of cells were isolated and evaluated for
protein expression level and the highest producers were subjected
to methotrexate selection to select for cells that had amplified
the plasmid copy number and which therefore produced higher levels
of antibody. Cells were grown, transferred to serum free medium for
a period of 7 days, then the medium was collected, loaded onto a
protein A column and the antibody was eluted using standard
techniques. The final concentration of the antibody was determined
using an Elisa that measures intact antibody. All proteins were
buffer exchanged into phosphate-buffered saline (PBS) using
Centripriep-30 concentrators. (A.micon) and analyzed by
SDS-polyacrylamide gel electrophoresis.
[0306] Matrix-Assisted Laser Desorption/Ionization Time-of-flight
(MALDI-TOF) Mass Spectral Analysis of Asparagine-Linked
Oligosaccharides: N-linked oligosaccharides were released from
recombinant glycoproteins using the procedure of Papac et al.,
Glycobiology 8, 445-454 (1998). Briefly, the wells of a 96 well
PVDF-lined microtitre plate (Millipore, Bedford, Mass.) were
conditioned with 100 .mu.l methanol that was drawn through the PDVF
membranes by applying vacuum to the Millipore Multiscreen vacuum
manifold. The conditioned PVDF membranes were washed with
3.times.250 .mu.l water. Between all wash steps the wells were
drained completely by applying gentle vacuum to the manifold. The
membranes were washed with reduction and carboxymethylation buffer
(RCM) consisting of 6 M guanidine hydrochloride, 360 mM Tris, 2 mM
EDTA, pH 8.6. Glycoprotein samples (50 .mu.g) were applied to
individual wells, again drawn through the PVDF membranes by gentle
vacuum and the wells were washed with 2.times.50 .mu.l of RCM
buffer. The immobilized samples were reduced by adding 50 .mu.l of
a 0.1 M dithiothreitol (DTT) solution to each well and incubating
the microtitre plate at 37.degree. C. for 1 hr. DTT was removed by
vacuum and the wells were washed 4.times.250 .mu.l water. Cysteine
residues were carboxyimethylated by the addition of 50 .mu.l of a
0.1 M iodoacetic acid (IAA) solution which was freshly prepared in
1 M NaOH and diluted to 0.1 M with RCM buffer. Carboxymethylation
was accomplished by incubation for 30 min in the dark at ambient
temperature. Vacuum was applied to the plate to remove the IAA
solution and the wells were washed with 4.times.250 .mu.l purified
water. The PVDF membranes were blocked by the addition of 100 .mu.l
of 1% PVP360 (polyvinylpyrrolidine 360,000 MW) (Sigma) solution and
incubation for 1 hr at ambient temperature. The PVP-360 solution
was removed by gentle vacuum and the wells were washed 4.times.250
.mu.l water. The PNGase F (New England Biolabs, Beverly, Mass.)
digest solution, 25 .mu.l of a 25 Unit/ml solution in 10 mM Tris
acetate, pH 8.4, was added to each well and the digest proceeded
for 3 hr at 37'C. After digestion, the samples were transferred to
500 .mu.l Eppendorf tubes and 2.5 .mu.lL of a 1.5 M acetic acid
solution was added to each sample. The acidified samples were
incubated for 3 hr at ambient temperature to convert the
oligosaccharides from glycosylamines to the hydroxyl form. Prior to
MALIN-TOF mass spectral analysis, the released oligosaccharides
were desalted using a 0.7-ml bed of cation exchange resin (AG50W-X8
resin in the hydrogen form) (Bio-Rad, :Hercules, Calif.) slurried
packed into compact reaction tubes (US Biochemical, Cleveland,
Ohio).
[0307] For MALIN-TOE mass spectral analysis of the samples in the
positive mode, the desalted oligosaccharides (0.5 .mu.l aliquots)
were applied to the stainless target with 0.5 .mu.l of the 2,5
dihydroxybenzoic acid matrix (sDHB) that was prepared by dissolving
2 mg 2,5 dihydroxybenzoic acid with 0.1 mg of 5-methoxyslicylic
acid in 1 ml of ethanol/10 mM sodium chloride 1:1 (v/v). The
sample/matrix mixture was dried by vacuum. For analysis in the
negative mode, the desalted N-linked oligosaccharides (0.5 .mu.l
aliquots) were applied to the stainless target along with 0.5 .mu.l
2',4',6'-trihydroxyacetophenone matrix (TRAP) prepared in 1:3 (v/v)
acetonitrile/13.3 mM ammonium citrate buffer. The sample/matrix
mixture was vacuum dried and then allowed to absorb atmospheric
moisture prior to analysis. Released oligosaccharides were analyzed
by MALDI-TOF on a PerSeptive BioSystems Voyager-DE mass
spectrometer. The mass spectrometer was operated at 20 kV either in
the positive or negative mode with the linear configuration and
utilizing delayed extraction. Data were acquired using a laser
power of 1300 and in the data summation mode (240 scans) to Improve
the Signal to noise. The instrument was calibrated with a mixture
of standard oligosaccharides and the data was smoothed using a 19
point Savitsky-Golay algorithm before the masses were assigned.
Integration of the mass spectral data was achieved using Caesar 7.0
data analysis software package (SciBridge Software).
Natural Killer (NK) Cell Antibody Dependent Cytoxicity Assays.
[0308] ADCC assays were performed as described in Example 9. NK to
target cell (WIL2-S) ratio was 4 to 1, assays were run for 4 hours,
and toxicity was measured as before using lactose dehydrogenase
assay. Target cells were opsonized with the concentrations of
antibody indicated for 30 min prior to addition of NK cells. The
Rituxan.RTM. antibody used was from Genentech (S. San Francisco,
Calif.). FIG. 12 shows the results of a representative ADCC
assay.
[0309] The results show that underfucosylated antbodies mediate NK
cell target cell killing more efficiently than do antibodies with a
full complement of fucose. The underfucosylated antibody, 2H7v.31,
is most efficient at mediating target cell killing. This antibody
is effective at lower concentrations and is capable of mediating
killing of a greater percentage of target cells at higher
concentrations than are the other antibodies. The activity of the
antibodies is as follows: Lec13-derived 2H7 v31>Lee 13 derived
2H7v16>Dp12 derived 2H7v31>DP12 derived 2H7v16> or =to
Rituxan. The protein and carbohydrate alterations are additive.
Comparison of the carbohydrate found on native IgG from the
Lec13-produced and CHO-produced IgG showed no appreciable
differences in the extent of galactosylation and hence the results
can be attributed solely to the presence/absence of fucose.
Example 12
Fucose-dericient 2H7 Variant Antibodies with Enhanced ADCC in
vivo
[0310] This example describes ADCC activity in vivo of the
fucose-deficient humanized 2H7 variants including v.16 and v.31
produced in Lec13 compared to normal fucosylated counterparts
produced in DP12, in mice expressing human CD16 [FcR.gamma.III] and
human CD20.
Generation of huCD20Tg.sup.+huCD16Tg.sup.+mCD16.sup.-/- Mice
[0311] Human CD20 transgenic mice were generated from human CD20
BAC DNA (Itivitrogen, Carlsbad, Calif.). Mice were screened based
on the FACS analysis of human CD20 expression. HuCD20 Tg.sup.+ mice
were then crossed with huCD16Tg.sup.+mCD16.sup.-/- mice to generate
huCD20Tg.sup.+huCD16Tg.sup.+mCD16.sup.-/- mice.
In vivo Treatment
[0312] Ten to 100 .mu.g of each of the 2H7 variants or Rituxan.RTM.
is administrated to huCD20Tg.sup.+huCD16Tg.sup.+mCD16.sup.-/- mice
via intraperitoneal injections. Equal amount of isotype-thatched
antibodies will be applied similarly to the negative control group
of animals.
Mouse Lymphocytes Preparation
[0313] Mouse lymphocytes from whole blood, spleen, lymph nodes and
bone marrow are prepared according to standard protocol described
in "Current Protocols in Immunology, edited by John Coligan, Ada
Kruisbeek, David Margulies, Ethan Shevach and Warren Strober,
1994".
FACS analysis
[0314] Half million cells are washed and resuspended in 100 .mu.l
of FACS buffer, which is phosphate buffered saline with 1% BSA,
containing 5 .mu.l of staining or control antibody. All the
staining antibodies, including isotype controls, are obtained from
PharMingen, San Diego, Calif. Human CD20 expression is assessed by
staining with Rituxan.RTM. along with FITC-conjugated anti-human
IgG1 secondary antibody. FACS analysis is conducted using FACScan
and Cell Quest (Becton Dickinson Immunocytometry Systems, San Jose,
Calif.): All the lymphocytes are defined in the forward and side
light scatterings, while all the B lymphocytes are defined with the
expression of B220 on the cell surface.
[0315] B cell depletion and recovery are assessed by analyzing
peripheral B cell counts and analysis of hCD20+ B cells by FACS in
the spleen, lymph node and bone marrow on a daily basis for the
first week after injection and thereafter on a weekly basis. Serum
levels of the injected 2H7 variant antibody are monitored.
[0316] The results of this in vivo assay confirms the in vitro
findings on the increased ADCC activity and greater B cell
depletion of fucose-deficient 2H7 variants over wild-type (with
respect to fucosylation) glycosylation counterparts.
Example 13
Apoptosis Activity
[0317] Anti CD20 antibodies including Rituxim.RTM. have been shown
to induce apopiosis in vitro when crosslinked by a secondary
antibody or by chemical means (Shan et al., Blood 9:1644-1652
(1998); Byrd et al., Blood 99:1038-43 (2002); Pederson et al:,
Blood 99:1314,-19 (2002)). When chemically crosslinked, murine 2H7
dimers induced apoptosis of Daudi cells ((Gietie et al:, Proc Natl
Acad Sci USA 94:7509-14 (1997)). Crosslinking with a secondary
antibody also induced apoptosis with the urine 2H7 antibody (Shan
et al, 1998). These activities are believed to he physiologically
relevant because a variety of mechanisms could lead to crosslinking
of anti-CD20 antibodies bound to cell-surface CD20 in vivo.
[0318] RhuMAb 2H7.v16 [humanized 2H7 v16; RhuMAb stands for
recombinant human monoclonal antibody] and Rituxan.RTM. were
compared in apoptosis assays in vitro using a secondary
crosslinking antibody. Ramos cells (CRL-1596ATCC, Manassas, Va.), a
CD20-expressing, human B lymphocyte cell line, were used to measure
the ability of the anti-CD20 monoclonal antibodies rhuMAb 2H7.v16
and Rituximab versus a negative-control antibody, Trastuzumab
(Herceptin.RTM., Genentech, South San Francisco, Calif.), to induce
apoptosis as measured through Annexin V staining and propidium
iodide dye exclusion (Vybrant.RTM. Apoptosis Assay Kit, Molecular
Probes, Seattle, Wash.). The Ramos cells were cultured in RPMI-1640
medium (Gibco, Rockville, Md.) containing 10% fetal bovine serum
(Biosource International, Camarillo, Calif.) and 2 mM L-glutamine
(Gibco). Prior to being assayed, the cells were washed twice in
fresh media and then adjusted to a cell concentration of
2.times.10.sup.6 per mL. Cells (150 .mu.L) were added to 96-well
assay plates (Becton Dickinson, Palo Alto, Calif.) which contained
150 .mu.L of a predetermined amount of control IgG1, rhuMAb
2H7.v16, or Rituximab, along with F(ab)'2 goat anti-human Fc
(Pierce Biotechnology, Rockford, Ill.). The final IgG
concentrations were 100, 10, 1.0, 0.1, 0.01 and 0.001 nM, and the
F(ab)'2 goat anti-human Fc antibody concentration was set at twice
the respective sample antibody concentration. Each dilution was set
up in triplicate. After a 24-hour incubation at 37.degree. C., the
cells were washed twice with PBS and then stained with Annexin V
and propidium iodide according to the manufacturer's
recommendations. The staining patterns of the Ramos cells were
analyzed by flow cytometry using a FACscan Flow Cytometer (Becton
Dickinson, San Jose, Calif.), and data were collected for 10
s-periods. The data were reduced using the Cellquest Pro software
(Becton Dickinson). Ramos cells that were positive for (1) Annexin
V staining, (2) Annexin V and propiduim iodide double staining, and
(3) the number of unstained live cells, were counted and plotted
using KaleidaGraph software (Synergy Software, Reading, Pa.).
[0319] Both rhuMAb 2H7.v16 and Rituximab induced apoptosis of Ramos
cells when crosslinked with anti-human Fc and as compared to an
irrelevant IgG1 control antibody (FIGS. 13-15). The apoptotic
activity of (rhuMAb 2H7) was slightly lower than that of Rituximab.
At 10 nM concentrations of crosslinked rhuMAb 2H7, Rituximab, and
control IgG1 antibody, fractions of Annexin V stained cells were
18.5, 16.5, 2.5%, respectively, fractions of doubly labeled cells
were 29, 38, and 16%, and numbers of live cells counted per 10 s
were 5200, 3100, and 8600.
[0320] These in vitro data demonstrate that apoptosis is one
potential mechanism for in vivo B cell depletion. In vivo
crosslinking of rhuMAb 2H7 or Rituximab bound to cell-surface CD20
may occur through Fc.gamma.R on the surfaces of immune effector
cells.
Example 14
In Vivo Suppression of Tumor Growth
[0321] The ability of rhuMAb 2H7.v16 to inhibit the growth of the
Raji human B-cells, a lymphoma cell line (ATCC CCL 86), was
evaluated in Balb/c nude (athymic) mice. The Raji cells express
CD20 and have been reported to grow in nude mice, producing
metastatic disease; tumor growth is inhibited by Rituxan.RTM.
(Clynes et al., Nature Medicine 6, 443-446 (2000)). Fifty-six 8-10
week old, Balb/c nude mice were divided into 7 groups (A-G) with
each group consisting of 8 mice. On day 0, each mouse received a
subcutaneous injection of 5.times.10.sup.6 Raji B-lymphoma cells in
the flank. Beginning at day 0, each mouse received either 100 uL of
the negative-control solution (PBS; phosphate-buffered saline),
Rituxan.RTM. or 2H7.v16. Dosage was dependent on weight and drug
delivery was intravenously via the tail vein, Group A mice received
PBS. Groups B-D received Rituxan.RTM. at 5.0, mg/kg, 0.5 mg/kg, and
0.05 mg/kg respectively. Groups E-G mice received 2H7 v.16 at 5.0
mg/kg, 0.5 mg/kg, and 0.05 mg/kg respectively. The injections were
repeated every week for 6 weeks. At weekly intervals during
treatment, each mouse was inspected for the presence of palpable
tumors at the site of injection, and the volume of the tumors if
present were measured and recorded. A final inspection was made at
week 8 (after a two-week interval of no treatments).
[0322] The results of this study showed that both rhuMAb 2H7v16 and
Rituxan.RTM. and were effective at inhibiting subcutaneous
Raji-cell tumor growth in nude mice (FIGS. 16-18). Tumor growth was
observed in the PBS control group beginning at 4 weeks. However, no
tumor growth was observed in groups treated with Rituxan.RTM. or
2H7.v16 at 5 mg/kg or 0.5 mg/kg for the 8-week duration of the
study. In the low-dose 0.05 mg/kg treatment groups, tumors were
observed in one animal in the 2H7 group and in one animal in the
Rituxan.RTM. group (FIG. 18).
Example 15
Cloning of Cynomolgus Monkey C1D20 and Antibody Binding
[0323] The CD20 DNA sequence for cynomolgus monkey (Macaca
fascicularis) was determined upon the isolation of cDNA encoding
CD20 from a cynomolgus spleen cDNA library. A SUPERSCRIPT.TM. Prim
Plasmid System for cDNA Synthesis and Plasmid Cloning
(Cat#18248-013, Invitrogen, Carlsbad, Calif.) was used with slight
modifications to construct the library. The cDNA library was
ligated into a pRK5E vector using restriction sites Xho I-and Not
I. mRNA was isolated from spleen tissue ((California Regional
Research Primate Center, Davis, Calif.). Primers to amplify cDNA
encoding CD20 were designed based on non-coding sequences of human
CD20. N-terminal region primer 5-AGTTTTGAGAGCAAAATG-3' (SEQ ID NO.
37) and C-terminal region primer 5'-AAGCTATGAACACTAATG-3' (SEQ ID
NO. 38) were used to clone by polymerase chain reaction (PCR) the
cDNA encoding cynomolgus monkey CD20. The PCR reaction was carried
out using Platinum Taq DNA Polymerase High Fidelity according to
the manufacturer's recommendation (Gibco, Rockville, Md.). The PC:R
product was subcloned into pCR.RTM. 2.1-TOPO.RTM. Vector
(Invitrogen) and transformed into XL-1 blue E. coli (Stratagene. La
Jolla, Calif.). Plasmid DNA containing ligated PGR products was
isolated from individual clones and sequenced.
[0324] The amino acid sequence for cynomolgus monkey CD20 is shown
in FIG. 19. FIG. 20 shows comparison of cynomolgus and human CD20.
The cynomolgus monkey CD20 is 97.3% similar to human CD20 with 8
differences. The extracellular domain contains one change at V157A,
while the remaining 7 residues can be found in the cytoplasmic or
transmembrane regions.
[0325] Antibodies directed against human CD20 were assayed for the
ability to bind and displace FITC-conjugated murine 2H7 binding to
cynomolgus monkey cells expressing CD20. Twenty milliliters of
blood were drawn from 2 cynomolgus monkeys (California Regional
Research Primate Center, Davis, Calif.) into sodium heparin and
shipped directly to Genentech Inc. On the same day, the blood
samples were pooled and diluted 1:1 by the addition of 40 ml of
phosphate buffered saline (PBS). 20 ml of diluted blood was layered
on 4.times.20 ml of Ficoll-Paque.TM. Plus (Amersham Biosciences,
Uppsala, Sweden) in 50 ml conical tubes (Cat#352098, Falcon,
Franklin Lakes, N.J.) and centrifuged at 1300 rpm for 30 minutes
R.T. in a Sorval 7 centrifuge. (Dupont, Newtown, Conn.). The PBMC
layer was isolated and washed in PBS. Red blood cells were lysed in
a 0.2% NaCl solution, restored to isotonicity with an equivalent
volume of a 1.6% NaCl solution, and centrifuged for 10 minutes at
1000 R.PM. The PBMC pellet was resuspended in RPMI 1640 (Gibco,
Rockville, Md.) containing 5% fetal bovine serum (PBS) and
dispensed into a 10 cm tissue culture dish for 1 hour at 37.degree.
C. The non-adherent h and cell populations were removed by
aspiration, centrifuged and counted. A total of 2.4.times.10.sup.7
cells were recovered. The resuspended PBMC were distributed into
twenty 12.times.75 mm culture tubes (Cat#352053, Falcon), with each
tube containing 1.times.10.sup.6 cells in a volume of 0.25 ml.
Tubes were divided into four sets of five tubes. To each set was
added either media (RPMH640, 5% FBS), titrated amounts of control
human IgG.sub.1 antibody, Rituxan.RTM., 2H7.v16, or 2H7.v31. The
final concentration of each antibody was 30, 10, 3.3 and 1.1 nM. In
addition, each tube also received 20 ul of Fluorescein
Isothiocyanate (FITC)-conjugated anti-human CD20 (Cat#555622, BD
Biosciences, San Diego, Calif.), The cells were gently mixed,
incubated for 1 hour on ice and then washed twice in cold PBS. The
cell surface staining was analyzed on a Epic XL-MCL (Coulter,
Miami, Fla.), the geometric means derived, plotted
(KaleidaGraph.TM., Synergy Software, Reading, Pa.) versus antibody
concentrations.
[0326] Data in FIG. 21 showed that 2H7 v.16 and 2H7 v.31
competitively displaced FITC-murine 2H7 binding to cynomolgus
monkey cells. Furthermore, Rituxan.RTM. also displaced FTC-murine
2H7 binding thus demonstrating that both 2H7 and Rituxan.RTM. bind
to an overlapping epitope on CD20. in addition, the data show that
the IC.sub.5 value for 2H7 v.16, 2H7 v.31 and Rituxan are similar
and fall in the 4-6 nM range.
Example 16
Phase I/II Study or rhMAb 2H7 (2H7.v16) Moderate to Severe
Rheumatoid Arthritis
Protocol Synopsis
[0327] A randomized, placebo-controlled, multicenter, blinded phase
I/II study of the safety of escalating doses of PRO70769 (rhuMAb
2H7) in subjects with moderate to severe rheumatoid arthritis
receiving stable doses of concomitant methotrexate.
Objectives
[0328] Hie primary objective of this study is to evaluate the
safety and tolerabiitty of escalating intravenous (1V) doses of
PRO70769 (rbuMAb 2H7) in subjeels with moderate to severe
rheumatoid arthritis (RA).
Study Design
[0329] This is a randomized, placebo-controlled, multicenter,
blinded Phase I/II, investigator- and subject-blinded study of the
safety of escalating doses of PRO70769 in combination with MTX in
subjects with moderate to severe RA. The study consists of a dose
escalation phase and a second phase with enrollment of a larger
number of subjects. The Sponsor will remain unblinded to treatment
assignment.
[0330] Subjects with moderate to severe RA who have failed one to
five disease-modifying antirheumatic drugs or biologics who
currently have unsatisfactory clinical responses to treatment with
MTX will be enrolled.
[0331] Subjects will he required to receive MTX in the range of
10-25 mg weekly for at least 12 weeks prior to study entry and to
be on a stable dose for at least 4 weeks before receiving their
initial dose of study drug (PRO70769 or placebo). Subjects may also
receive stable doses of oral corticosteroids (up to 10 mg daily or
prednisone equivalent) and stable doses of nonsteroidal
anti-inflammatory drugs (NSAIDs). Subjects will receive two IV
infusions of PRO70769 or placebo equivalent at the indicated dose
on Days 1 and 15 according to the following dose escalation plan
(see FIG. 22).
[0332] Dose escalation will occur according to specific criteria
and after review of safety data by an internal safety data review
committee and assessment of acute toxicity 72 hours following the
second infusion in the last subject treated in each cohort. After
the dose escalation phase, 40 additional subjects (32 active and 8
placebo) will be randomized to each of the following dose levels:
2.times.50 mg, 2.times.200 mg, 2.times.500 mg, and 2.times.1000 mg,
if the dose levels have been demonstrated to be tolerable during
the dose escalation phase. Approximately 205 subjects will be
enrolled in the study.
[0333] B-cell counts will be obtained and recorded. B-cell counts
will e evaluated using flow cytometry in a 48-week follow-up period
beyond the 6-month efficacy evaluation. B-cell depletion will not
be considered a dose-limiting toxicity (DI,C), but rather the
expected pharmacodynamic outcome of PRO70769 treatment.
[0334] In an optional substudy, blood for serum and RNA analyses,
as well as urine samples will be obtained from subjects at various
timepoints. These samples may be used to identify biomarkers that
may be predictive of response to PRO70769 treatment in subjects
with moderate to severe RA.
Outcome Measures
[0335] The primary outcome measure for this study is the safety and
tolerability of PRO70769 in subjects with moderate to severe
RA.
Study Treatment
[0336] Cohorts of subjects will receive two IV inffisions of
PRO70769 or placebo equivalent at the indicated (lose on Days 1 and
15 according to the following escalation plan:
[0337] 10 mg PRO70769 or placebo equivalent: 4 subjects active
drug, 1 control
[0338] 50 mg PRO70769 or placebo equivalent; 8 subjects active
drug, 2 control
[0339] 200 mg PRO70769 or placebo equivalent: 8 subjects active
drug, 2 control
[0340] 500 mg PRO70769 or placebo equivalent: 8 subjects active
drug, 2 control
[0341] 1000 mg PRO70769 or placebo equivalent: 8 subjects active
drag, 2 control
Efficacy
[0342] The efficacy of PRO70769 will be measured by ACR responses.
The percentage of subjects who achieve an ACR20, ACR50, and ACR70
response will be summarized by treatment group and 95% confidence
intervals will be generated for each group. The components of these
response and their change from baseline will be summarized by
treatment and visit.
Conclusion
[0343] The data above demonstrated the success in producing
humanized CD20 binding antibodies, in particular humanized 2H7
antibody variants, that maintained and even enhanced their
biological properties. The humanized 2H7 antibodies of the
invention bound to CD20 at affinities similar to the murine donor
and chimeric 2H7 antibodies and were effective at B cell killing in
a primate, leading to B cell depletion. Certain variants showed
enhanced ADCC over a chimeric ante CD20 antibody currently used to
treat NIII favoring the use of lower doses of the therapeutic
antibody in patients. Additional, whereas it may be necessary for a
chimeric antibody that has marine FR residues to be administered at
a dose effective to achieve complete B cell depletion to obviate an
antibody response against it, the present humanized antibodies can
be administered at dosages that achieve partial or complete B cell
depletion, and for different durations of time, as desired for the
particular disease and patient. In addition, these antibodies
demonstrated stability in solution. These properties of the
humanized 2H7 antibodies make them ideal for use as
immunotherapeutic agent in the treatment of CD20 positive cancers
and autoimmune diseases; these antibodies are not expected to be
immunogenic or will at least be less immunogenic than fully murine
or chimeric anti-CD20 antibodies in human patients.
REFERENCES
[0344] References cited within this application, including patents,
published applications and other publications, are hereby
incorporated by reference.
[0345] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
and the like, which are within the skill of the art. Such
techniques are explained fully in the literature. See e.g.,
Molecular Cloning: A Laboratory Manual, (J. Sambrook et al., Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989); Current
Protocols in Molecular Biology (F. Ausubel et al., eds., 1987
updated); Essential Molecular Biology (T. Brown ed., IRL Press
1991); Gene Expression Technology (Goeddel ed., Academic Press
1991); Methods for Cloning and Analysis of Eukaryotic Genes (A.
Bothwell et al. eds., Bartlett Publ. 1990); Gene Transfer and
Expression (M, Kriegler, Stockton Press 1990); Recombinant DNA
Methodology 11 (R. Wu et al. eds., Academic Press 1995); PCR: A
Practical Approach (M. McPherson et Press at Oxford University
Press 1991); Oligonucleotide Synthesis, (M. Gait ed., 1984); Cell
Culture for Biochemists (R. Adams ed., Elsevier Science Publishers
1990); Gene Transfer Vectors for Mammalian Cells (J. Miller &
M. Calos eds., 1987); Mammalian Cell Biotechnology (M. Butler ed.,
1991); Animal Cell Culture (J. Pollard et al. eds., Humana Press
1990); Culture of Animal Cells, 2.sup.nd Ed. (R. Freshney et al.
eds Alan R. Liss 1987); Flow Cytometry and Sorting (M, Melamed et
al. eds., Wiley-Liss 1990); the series Methods in Enzymology
(Academic Press, Inc.);Wirth M. and Hauser H. (1993);
Immunochemistry in Practice, 3rd edition, A. Johnstone & R.
Thorpe, Blackwell Science, Cambridge, Mass., 1996; Techniques in
Immunocytochemistry, (G. Bullock & P. Petrusz eds., Academic
Press 1982, 1983, 1985, 1989); Handbook of Experimental Immunology,
(D. Weir & C. Blackwell, eds.); Current Protocols in Immunology
(J. Coligan et al. eds. 1991); Immunoassay (E. P. Diamandis T. K.
Christopoulos, eds., Academic Press, Inc., 1996); Goding (1986)
Monoclonal Antibodies: Principles and Practice (2d ed) Academic
Press, New York; Ed Harlow and David Lane. Antibodies A laboratory
Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New
York, 1988: Antibody Engineering. 2.sup.nd edition (C. Borrebaeck,
ed., Oxford University Press, 1995); and the series Annual Review
of Immunology; the series Advances in Immunology.
Sequence CWU 1
1
551107PRTMus musculus 1Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu
Ser Ala Ser Pro1 5 10 15Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser
Ser Ser Val Ser 20 25 30Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Ser
Ser Pro Lys Pro 35 40 45Trp Ile Tyr Ala Pro Ser Asn Leu Ala Ser Gly
Val Pro Ala Arg 50 55 60Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser 65 70 75Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr
Cys Gln Gln Trp 80 85 90Ser Phe Asn Pro Pro Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu 95 100 105Lys Arg2107PRTArtificial sequenceSequence
is synthesized 2Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val1 5 10 15Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser
Val Ser 20 25 30Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
Lys Pro 35 40 45Leu Ile Tyr Ala Pro Ser Asn Leu Ala Ser Gly Val Pro
Ser Arg 50 55 60Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser 65 70 75Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln
Gln Trp 80 85 90Ser Phe Asn Pro Pro Thr Phe Gly Gln Gly Thr Lys Val
Glu Ile 95 100 105Lys Arg3108PRTArtificial SequenceSequence is
synthesized 3Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val1 5 10 15Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser
Ile Ser 20 25 30Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala
Pro Lys 35 40 45Leu Leu Ile Tyr Ala Ala Ser Ser Leu Glu Ser Gly Val
Pro Ser 50 55 60Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile 65 70 75Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln 80 85 90Tyr Asn Ser Leu Pro Trp Thr Phe Gly Gln Gly Thr Lys
Val Glu 95 100 105Ile Lys Arg410PRTMus musculus 4Arg Ala Ser Ser
Ser Val Ser Tyr Met His 5 1057PRTMus musculus 5Ala Pro Ser Asn Leu
Ala Ser 5 69PRTMus musculus 6Gln Gln Trp Ser Phe Asn Pro Pro Thr 5
7122PRTMus musculus 7Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu
Val Arg Pro Gly1 5 10 15Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly
Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro
Arg Gln Gly Leu 35 40 45Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly
Asp Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr
Val Asp Lys Ser 65 70 75Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu
Thr Ser Glu Asp 80 85 90Ser Ala Val Tyr Phe Cys Ala Arg Val Val Tyr
Tyr Ser Asn Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp Gly Thr Gly
Thr Thr Val Thr Val 110 115 120Ser Ser8122PRTArtificial
sequenceSequence is synthesized 8Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Asp Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Asn Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser9119PRTArtificial
SequenceSequence is synthesized 9Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Phe Ser 20 25 30Ser Tyr Ala Met Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Ser Gly
Asp Gly Gly Ser Thr Tyr Tyr 50 55 60Ala Asp Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Gly Arg Val Gly Tyr Ser Leu 95 100 105Tyr Asp Tyr Trp Gly Gln Gly
Thr Leu Val Thr Val Ser Ser 110 115 1010PRTMus musculus 10Gly Tyr
Thr Phe Thr Ser Tyr Asn Met His 5 101117PRTMus musculus 11Ala Ile
Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe1 5 10 15Lys
Gly1213PRTMus musculus 12Val Val Tyr Tyr Ser Asn Ser Tyr Trp Tyr
Phe Asp Val 5 10 135679DNAArtificial SequenceSequence is
synthesized 13gaattcaact tctccatact ttggataagg aaatacagac
atgaaaaatc 50tcattgctga gttgttattt aagcttgccc aaaaagaaga agagtcgaat
100gaactgtgtg cgcaggtaga agctttggag attatcgtca ctgcaatgct
150tcgcaatatg gcgcaaaatg accaacagcg gttgattgat caggtagagg
200gggcgctgta cgaggtaaag cccgatgcca gcattcctga cgacgatacg
250gagctgctgc gcgattacgt aaagaagtta ttgaagcatc ctcgtcagta
300aaaagttaat cttttcaaca gctgtcataa agttgtcacg gccgagactt
350atagtcgctt tgtttttatt ttttaatgta tttgtaacta gaattcgagc
400tcggtacccg gggatcctct agaggttgag gtgattttat gaaaaagaat
450atcgcatttc ttcttgcatc tatgttcgtt ttttctattg ctacaaacgc
500gtacgctgat atccagatga cccagtcccc gagctccctg tccgcctctg
550tgggcgatag ggtcaccatc acctgcagag ccagtcagag cgtgtcgact
600agctcttata gctatatgca ctggtatcaa cagaaaccag gaaaagctcc
650gaaactactg atttactatg ctagcaacct cgagtctgga gtcccttctc
700gcttctctgg atccggttct gggacggatt tcactctgac catcagcagt
750ctgcagccag aagacttcgc aacttattac tgtcaacact cttggggtat
800tccgcgcaca tttggacagg gtaccaaggt ggagatcaaa cgaactgtgg
850ctgcaccatc tgtcttcatc ttcccgccat ctgatgagca gttgaaatct
900ggaactgctt ctgttgtgtg cctgctgaat aacttctatc ccagagaggc
950caaagtacag tggaaggtgg ataacgccct ccaatcgggt aactcccagg
1000agagtgtcac agagcaggac agcaaggaca gcacctacag cctcagcagc
1050accctgacgc tgagcaaagc agactacgag aaacacaaag tctacgcctg
1100cgaagtcacc catcagggcc tgagctcgcc cgtcacaaag agcttcaaca
1150ggggagagtg ttaagctgat cctctacgcc ggacgcatcg tggccctagt
1200acgcaagttc acgtaaaaag ggtatctaga ggttgaggtg attttatgaa
1250aaagaatatc gcatttcttc ttgcatctat gttcgttttt tctattgcta
1300caaacgcgta cgctgaggtt cagctggtgg agtctggcgg tggcctggtg
1350cagccagggg gctcactccg tttgtcctgt gcagcttctg gctacacctt
1400caccgaatat atcatccact gggtccgtca ggccccgggt aagggcctgg
1450aatgggttgc atcgattaat cctgactacg acatcacgaa ctataaccag
1500cgcttcaagg gccgtttcac tataagtcgc gacgattcca aaaacacatt
1550atacctgcag atgaacagcc tgcgtgctga ggacactgcc gtctattatt
1600gtgctcgatg gatcagcgat ttcttcgact actggggtca aggaaccctg
1650gtcaccgtct cctcggcctc caccaagggc ccatcggtct tccccctggc
1700accctcctcc aagagcacct ctgggggcac agcggccctg ggctgcctgg
1750tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc
1800ctgaccagcg gcgtgcacac cttcccggct gtcctacagt cctcaggact
1850ctactccctc agcagcgtgg tgaccgtgcc ctccagcagc ttgggcaccc
1900agacctacat ctgcaacgtg aatcacaagc ccagcaacac caaggtggac
1950aagaaagttg agcccaaatc ttgtgacaaa actcacacat gaccaccgca
2000tgcaccagta tcgtccattc cgacagcatc gccagtcact atggcgtgct
2050gctagcgccg ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc
2100atggagccgg gccacctcga cctgaatgga agccggcggc acctcgctaa
2150cggattcacc actccaagaa ttggagccaa tcaattcttg cggagaactg
2200tgaatgcgca aaccaaccct tggcagaaca tatccatcgc gtccgccatc
2250tccagcagcc gcacgcggcg catctcgggc agcgttgggt cctggccacg
2300ggtgcgcatg atcgtgctcc tgtcgttgag gacccggcta ggctggcggg
2350gttgccttac tggttagcag aatgaatcac cgatacgcga gcgaacgtga
2400agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt
2450cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct
2500gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt
2550ggaacaccta catctgtatt aacgaagcgc tggcattgac cctgagtgat
2600ttttctctgg tcccgccgca tccataccgc cagttgttta ccctcacaac
2650gttccagtaa ccgggcatgt tcatcatcag taacccgtat cgtgagcatc
2700ctctctcgtt tcatcggtat cattaccccc atgaacagaa attccccctt
2750acacggaggc atcaagtgac caaacaggaa aaaaccgccc ttaacatggc
2800ccgctttatc agaagccaga cattaacgct tctggagaaa ctcaacgagc
2850tggacgcgga tgaacaggca gacatctgtg aatcgcttca cgaccacgct
2900gatgagcttt accgcagcat ccggaaattg taaacgttaa tattttgtta
2950aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc
3000cgaaatcggc aaaatccctt ataaatcaaa agaatagacc gagatagggt
3050tgagtgttgt tccagtttgg aacaagagtc cactattaaa gaacgtggac
3100tccaacgtca aagggcgaaa aaccgtctat cagggctatg gcccactacg
3150tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac
3200taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag
3250ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc
3300tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg
3350ccgcgcttaa tgcgccgcta cagggcgcgt ccgcatcctg cctcgcgcgt
3400ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt
3450cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg
3500cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt
3550agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt
3600gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag
3650gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc
3700tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg
3750gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
3800agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg
3850cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc
3900tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt
3950tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
4000ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat
4050agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
4100gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg
4150gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg
4200gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc
4250tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag
4300tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
4350ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
4400tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc
4450ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt
4500taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct
4550tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
4600cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg
4650atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
4700aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac
4750cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca
4800gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat
4850ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta
4900atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc
4950tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
5000agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc
5050ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt
5100atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt
5150ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
5200ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca
5250catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
5300aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca
5350ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct
5400gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc
5450gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa
5500gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt
5550tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
5600acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata
5650ggcgtatcac gaggcccttt cgtcttcaa 567914241PRTArtificial
SequenceSequence is synthesized 14Met Lys Lys Asn Ile Ala Phe Leu
Leu Ala Ser Met Phe Val Phe1 5 10 15Ser Ile Ala Thr Asn Ala Tyr Ala
Asp Ile Gln Met Thr Gln Ser 20 25 30Pro Ser Ser Leu Ser Ala Ser Val
Gly Asp Arg Val Thr Ile Thr 35 40 45Cys Arg Ala Ser Gln Ser Val Ser
Thr Ser Ser Tyr Ser Tyr Met 50 55 60His Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile 65 70 75Tyr Tyr Ala Ser Asn Leu Glu Ser
Gly Val Pro Ser Arg Phe Ser 80 85 90Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Thr Ile Ser Ser Leu 95 100 105Gln Pro Glu Asp Phe Ala Thr
Tyr Tyr Cys Gln His Ser Trp Gly 110 115 120Ile Pro Arg Thr Phe Gly
Gln Gly Thr Lys Val Glu Ile Lys Arg 125 130 135Thr Val Ala Ala Pro
Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 140 145 150Gln Leu Lys Ser
Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn 155 160 165Phe Tyr Pro
Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala 170 175 180Leu Gln
Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser 185 190 195Lys
Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys 200 205
210Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His 215
220 225Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu
230 235 240Cys15248PRTArtificial SequenceSequence is synthesized
15Met Lys Lys Asn Ile Ala Phe Leu Leu Ala Ser Met Phe Val Phe1 5 10
15Ser Ile Ala Thr Asn Ala Tyr Ala Glu Val Gln Leu Val Glu Ser 20 25
30Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys 35 40
45Ala Ala Ser Gly Tyr Thr Phe Thr Glu Tyr Ile Ile His Trp Val 50 55
60Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Ser Ile Asn 65 70
75Pro Asp Tyr Asp Ile Thr Asn Tyr Asn Gln Arg Phe Lys Gly Arg 80 85
90Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu Gln 95
100 105Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
110 115 120Arg Trp Ile Ser Asp Phe Phe Asp Tyr Trp Gly Gln Gly Thr
Leu 125 130 135Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
Phe Pro 140 145 150Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala Ala Leu 155 160 165Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro
Val Thr Val Ser 170 175 180Trp Asn Ser Gly Ala Leu Thr Ser Gly Val
His Thr Phe Pro Ala 185 190 195Val Leu Gln Ser Ser Gly Leu Tyr Ser
Leu Ser Ser Val Val Thr 200 205 210Val Pro Ser Ser Ser Leu Gly Thr
Gln Thr Tyr Ile Cys Asn Val 215 220
225Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro 230
235 240Lys Ser Cys Asp Lys Thr His Thr 245 165678DNAArtificial
SequenceSequence is chimeric 16gaattcaact tctccatact ttggataagg
aaatacagac atgaaaaatc 50tcattgctga gttgttattt aagcttgccc aaaaagaaga
agagtcgaat 100gaactgtgtg cgcaggtaga agctttggag attatcgtca
ctgcaatgct 150tcgcaatatg gcgcaaaatg accaacagcg gttgattgat
caggtagagg 200gggcgctgta cgaggtaaag cccgatgcca gcattcctga
cgacgatacg 250gagctgctgc gcgattacgt aaagaagtta ttgaagcatc
ctcgtcagta 300aaaagttaat cttttcaaca gctgtcataa agttgtcacg
gccgagactt 350atagtcgctt tgtttttatt ttttaatgta tttgtaacta
gaattcgagc 400tcggtacccg gggatcctct agaggttgag gtgatttatg
aaaaagaata 450tcgcatttct tcttgcatct atgttcgttt tttctattgc
tacaaacgcg 500tacgctcaga tagtactgtc ccagtccccg gctatcctgt
ccgcctctcc 550tggcgagaag gtcactatga cctgcagagc cagctcttct
gtgagctata 600tgcattggta tcaacagaaa ccaggaagct ctccgaaacc
atggatttac 650gctccatcga acctcgcgtc tggagtccct gcgcgcttct
ctggatccgg 700ttctgggact agttactctc tgaccatcag cagagtggag
gcagaagacg 750ccgcaactta ttactgtcaa cagtggagct tcaatccgcc
cacatttgga 800gccggcacca agctggagct caaacgaact gtggctgcac
catctgtctt 850catcttcccg ccatctgatg agcagttgaa atctggaact
gcttctgttg 900tgtgcctgct gaataacttc tatcccagag aggccaaagt
acagtggaag 950gtggataacg ccctccaatc gggtaactcc caggagagtg
tcacagagca 1000ggacagcaag gacagcacct acagcctcag cagcaccctg
acgctgagca 1050aagcagacta cgagaaacac aaagtctacg cctgcgaagt
cacccatcag 1100ggcctgagct cgcccgtcac aaagagcttc aacaggggag
agtgttaagc 1150tgatcctcta cgccggacgc atcgtggccc tagtacgcaa
gttcacgtaa 1200aaagggtatc tagaggttga ggtgatttta tgaaaaagaa
tatcgcattt 1250cttcttgcat ctatgttcgt tttttctatt gctacaaacg
cgtacgctca 1300ggcttatctg cagcagtctg gcgccgagct ggtgcggcca
ggagctagcg 1350tcaagatgtc ctgtaaagct tctggctaca ccttcaccag
ctataacatg 1400cattgggtca agcagacacc gaggcaaggc ctggaatgga
ttggagcgat 1450ctatcctggc aacggcgaca cgagctataa ccagaagttc
aagggcaagg 1500ccactctgac tgtggacaag tccagcagta ctgcctacat
gcaactgagc 1550agcctgactt ctgaggacag cgctgtctac ttttgtgctc
gcgtggtcta 1600ctatagcaac agctactggt acttcgacgt ctggggtacc
ggaaccacag 1650tcaccgtctc ctcggcctcc accaagggcc catcggtctt
ccccctggca 1700ccctcctcca agagcacctc tgggggcaca gcggccctgg
gctgcctggt 1750caaggactac ttccccgaac cggtgacggt gtcgtggaac
tcaggcgccc 1800tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc
ctcaggactc 1850tactccctca gcagcgtggt gaccgtgccc tccagcagct
tgggcaccca 1900gacctacatc tgcaacgtga atcacaagcc cagcaacacc
aaggtggaca 1950agaaagttga gcccaaatct tgtgacaaaa ctcacacatg
accaccgcat 2000gcaccagtat cgtccattcc gacagcatcg ccagtcacta
tggcgtgctg 2050ctagcgccgc cctatacctt gtctgcctcc ccgcgttgcg
tcgcggtgca 2100tggagccggg ccacctcgac ctgaatggaa gccggcggca
cctcgctaac 2150ggattcacca ctccaagaat tggagccaat caattcttgc
ggagaactgt 2200gaatgcgcaa accaaccctt ggcagaacat atccatcgcg
tccgccatct 2250ccagcagccg cacgcggcgc atctcgggca gcgttgggtc
ctggccacgg 2300gtgcgcatga tcgtgctcct gtcgttgagg acccggctag
gctggcgggg 2350ttgccttact ggttagcaga atgaatcacc gatacgcgag
cgaacgtgaa 2400gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac
atgaatggtc 2450ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt
cagcgccctg 2500caccattatg ttccggatct gcatcgcagg atgctgctgg
ctaccctgtg 2550gaacacctac atctgtatta acgaagcgct ggcattgacc
ctgagtgatt 2600tttctctggt cccgccgcat ccataccgcc agttgtttac
cctcacaacg 2650ttccagtaac cgggcatgtt catcatcagt aacccgtatc
gtgagcatcc 2700tctctcgttt catcggtatc attaccccca tgaacagaaa
ttccccctta 2750cacggaggca tcaagtgacc aaacaggaaa aaaccgccct
taacatggcc 2800cgctttatca gaagccagac attaacgctt ctggagaaac
tcaacgagct 2850ggacgcggat gaacaggcag acatctgtga atcgcttcac
gaccacgctg 2900atgagcttta ccgcagcatc cggaaattgt aaacgttaat
attttgttaa 2950aattcgcgtt aaatttttgt taaatcagct cattttttaa
ccaataggcc 3000gaaatcggca aaatccctta taaatcaaaa gaatagaccg
agatagggtt 3050gagtgttgtt ccagtttgga acaagagtcc actattaaag
aacgtggact 3100ccaacgtcaa agggcgaaaa accgtctatc agggctatgg
cccactacgt 3150gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc
gtaaagcact 3200aaatcggaac cctaaaggga gcccccgatt tagagcttga
cggggaaagc 3250cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg
agcgggcgct 3300agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca
ccacacccgc 3350cgcgcttaat gcgccgctac agggcgcgtc cgcatcctgc
ctcgcgcgtt 3400tcggtgatga cggtgaaaac ctctgacaca tgcagctccc
ggagacggtc 3450acagcttgtc tgtaagcgga tgccgggagc agacaagccc
gtcagggcgc 3500gtcagcgggt gttggcgggt gtcggggcgc agccatgacc
cagtcacgta 3550gcgatagcgg agtgtatact ggcttaacta tgcggcatca
gagcagattg 3600tactgagagt gcaccatatg cggtgtgaaa taccgcacag
atgcgtaagg 3650agaaaatacc gcatcaggcg ctcttccgct tcctcgctca
ctgactcgct 3700gcgctcggtc gttcggctgc ggcgagcggt atcagctcac
tcaaaggcgg 3750taatacggtt atccacagaa tcaggggata acgcaggaaa
gaacatgtga 3800gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
cgttgctggc 3850gtttttccat aggctccgcc cccctgacga gcatcacaaa
aatcgacgct 3900caagtcagag gtggcgaaac ccgacaggac tataaagata
ccaggcgttt 3950ccccctggaa gctccctcgt gcgctctcct gttccgaccc
tgccgcttac 4000cggatacctg tccgcctttc tcccttcggg aagcgtggcg
ctttctcata 4050gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg 4100ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
ccttatccgg 4150taactatcgt cttgagtcca acccggtaag acacgactta
tcgccactgg 4200cagcagccac tggtaacagg attagcagag cgaggtatgt
aggcggtgct 4250acagagttct tgaagtggtg gcctaactac ggctacacta
gaaggacagt 4300atttggtatc tgcgctctgc tgaagccagt taccttcgga
aaaagagttg 4350gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tggttttttt 4400gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
aagaagatcc 4450tttgatcttt tctacggggt ctgacgctca gtggaacgaa
aactcacgtt 4500aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac
ctagatcctt 4550ttaaattaaa aatgaagttt taaatcaatc taaagtatat
atgagtaaac 4600ttggtctgac agttaccaat gcttaatcag tgaggcacct
atctcagcga 4650tctgtctatt tcgttcatcc atagttgcct gactccccgt
cgtgtagata 4700actacgatac gggagggctt accatctggc cccagtgctg
caatgatacc 4750gcgagaccca cgctcaccgg ctccagattt atcagcaata
aaccagccag 4800ccggaagggc cgagcgcaga agtggtcctg caactttatc
cgcctccatc 4850cagtctatta attgttgccg ggaagctaga gtaagtagtt
cgccagttaa 4900tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg
gtgtcacgct 4950cgtcgtttgg tatggcttca ttcagctccg gttcccaacg
atcaaggcga 5000gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
ccttcggtcc 5050tccgatcgtt gtcagaagta agttggccgc agtgttatca
ctcatggtta 5100tggcagcact gcataattct cttactgtca tgccatccgt
aagatgcttt 5150tctgtgactg gtgagtactc aaccaagtca ttctgagaat
agtgtatgcg 5200gcgaccgagt tgctcttgcc cggcgtcaac acgggataat
accgcgccac 5250atagcagaac tttaaaagtg ctcatcattg gaaaacgttc
ttcggggcga 5300aaactctcaa ggatcttacc gctgttgaga tccagttcga
tgtaacccac 5350tcgtgcaccc aactgatctt cagcatcttt tactttcacc
agcgtttctg 5400ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg
aataagggcg 5450acacggaaat gttgaatact catactcttc ctttttcaat
attattgaag 5500catttatcag ggttattgtc tcatgagcgg atacatattt
gaatgtattt 5550agaaaaataa acaaataggg gttccgcgca catttccccg
aaaagtgcca 5600cctgacgtct aagaaaccat tattatcatg acattaacct
ataaaaatag 5650gcgtatcacg aggccctttc gtcttcaa
567817236PRTArtificial sequenceSequence is chimeric 17Met Lys Lys
Asn Ile Ala Phe Leu Leu Ala Ser Met Phe Val Phe1 5 10 15Ser Ile Ala
Thr Asn Ala Tyr Ala Gln Ile Val Leu Ser Gln Ser 20 25 30Pro Ala Ile
Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr 35 40 45Cys Arg Ala
Ser Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln 50 55 60Lys Pro Gly
Ser Ser Pro Lys Pro Trp Ile Tyr Ala Pro Ser Asn 65 70 75Leu Ala Ser
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly 80 85 90Thr Ser Tyr
Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala 95 100 105Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Phe Asn Pro Pro Thr Phe 110 115 120Gly
Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro 125 130
135Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 140
145 150Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu
155 160 165Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly
Asn 170 175 180Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser
Thr Tyr 185 190 195Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp
Tyr Glu Lys 200 205 210His Lys Val Tyr Ala Cys Glu Val Thr His Gln
Gly Leu Ser Ser 215 220 225Pro Val Thr Lys Ser Phe Asn Arg Gly Glu
Cys 230 235 18253PRTArtificial sequenceSequence is chimeric 18Met
Lys Lys Asn Ile Ala Phe Leu Leu Ala Ser Met Phe Val Phe1 5 10 15Ser
Ile Ala Thr Asn Ala Tyr Ala Gln Ala Tyr Leu Gln Gln Ser 20 25 30Gly
Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys Met Ser Cys 35 40 45Lys
Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Asn Met His Trp Val 50 55 60Lys
Gln Thr Pro Arg Gln Gly Leu Glu Trp Ile Gly Ala Ile Tyr 65 70 75Pro
Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe Lys Gly Lys 80 85 90Ala
Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln 95 100
105Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala 110
115 120Arg Val Val Tyr Tyr Ser Asn Ser Tyr Trp Tyr Phe Asp Val Trp
125 130 135Gly Thr Gly Thr Thr Val Thr Val Ser Ser Ala Ser Thr Lys
Gly 140 145 150Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr
Ser Gly 155 160 165Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr
Phe Pro Glu 170 175 180Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val 185 190 195His Thr Phe Pro Ala Val Leu Gln Ser Ser
Gly Leu Tyr Ser Leu 200 205 210Ser Ser Val Val Thr Val Pro Ser Ser
Ser Leu Gly Thr Gln Thr 215 220 225Tyr Ile Cys Asn Val Asn His Lys
Pro Ser Asn Thr Lys Val Asp 230 235 240Lys Lys Val Glu Pro Lys Ser
Cys Asp Lys Thr His Thr 245 250 195391DNAArtificial
sequenceSequence is synthesized 19ttcgagctcg cccgacattg attattgact
agttattaat agtaatcaat 50tacggggtca ttagttcata gcccatatat ggagttccgc
gttacataac 100ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc
ccgcccattg 150acgtcaataa tgacgtatgt tcccatagta acgccaatag
ggactttcca 200ttgacgtcaa tgggtggagt atttacggta aactgcccac
ttggcagtac 250atcaagtgta tcatatgcca agtacgcccc ctattgacgt
caatgacggt 300aaatggcccg cctggcatta tgcccagtac atgaccttat
gggactttcc 350tacttggcag tacatctacg tattagtcat cgctattacc
atggtgatgc 400ggttttggca gtacatcaat gggcgtggat agcggtttga
ctcacgggga 450tttccaagtc tccaccccat tgacgtcaat gggagtttgt
tttggcacca 500aaatcaacgg gactttccaa aatgtcgtaa caactccgcc
ccattgacgc 550aaatgggcgg taggcgtgta cggtgggagg tctatataag
cagagctcgt 600ttagtgaacc gtcagatcgc ctggagacgc catccacgct
gttttgacct 650ccatagaaga caccgggacc gatccagcct ccgcggccgg
gaacggtgca 700ttggaacgcg gattccccgt gccaagagtg acgtaagtac
cgcctataga 750gtctataggc ccaccccctt ggcttcgtta gaacgcggct
acaattaata 800cataacctta tgtatcatac acatacgatt taggtgacac
tatagaataa 850catccacttt gcctttctct ccacaggtgt ccactcccag
gtccaactgc 900acctcggttc tatcgattga attccaccat gggatggtca
tgtatcatcc 950tttttctagt agcaactgca actggagtac attcagatat
ccagatgacc 1000cagtccccga gctccctgtc cgcctctgtg ggcgataggg
tcaccatcac 1050ctgccgtgcc agtcaggaca tccgtaatta tttgaactgg
tatcaacaga 1100aaccaggaaa agctccgaaa ctactgattt actatacctc
ccgcctggag 1150tctggagtcc cttctcgctt ctctggttct ggttctggga
cggattacac 1200tctgaccatc agtagtctgc aaccggagga cttcgcaact
tattactgtc 1250agcaaggtaa tactctgccg tggacgttcg gacagggcac
caaggtggag 1300atcaaacgaa ctgtggctgc accatctgtc ttcatcttcc
cgccatctga 1350tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg
ctgaataact 1400tctatcccag agaggccaaa gtacagtgga aggtggataa
cgccctccaa 1450tcgggtaact cccaggagag tgtcacagag caggacagca
aggacagcac 1500ctacagcctc agcagcaccc tgacgctgag caaagcagac
tacgagaaac 1550acaaagtcta cgcctgcgaa gtcacccatc agggcctgag
ctcgcccgtc 1600acaaagagct tcaacagggg agagtgttaa gcttggccgc
catggcccaa 1650cttgtttatt gcagcttata atggttacaa ataaagcaat
agcatcacaa 1700atttcacaaa taaagcattt ttttcactgc attctagttg
tggtttgtcc 1750aaactcatca atgtatctta tcatgtctgg atcgatcggg
aattaattcg 1800gcgcagcacc atggcctgaa ataacctctg aaagaggaac
ttggttaggt 1850accttctgag gcggaaagaa ccagctgtgg aatgtgtgtc
agttagggtg 1900tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa
agcatgcatc 1950tcaattagtc agcaaccagg tgtggaaagt ccccaggctc
cccagcaggc 2000agaagtatgc aaagcatgca tctcaattag tcagcaacca
tagtcccgcc 2050cctaactccg cccatcccgc ccctaactcc gcccagttcc
gcccattctc 2100cgccccatgg ctgactaatt ttttttattt atgcagaggc
cgaggccgcc 2150tcggcctctg agctattcca gaagtagtga ggaggctttt
ttggaggcct 2200aggcttttgc aaaaagctgt taacagcttg gcactggccg
tcgttttaca 2250acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat
cgccttgcag 2300cacatccccc cttcgccagc tggcgtaata gcgaagaggc
ccgcaccgat 2350cgcccttccc aacagttgcg tagcctgaat ggcgaatggc
gcctgatgcg 2400gtattttctc cttacgcatc tgtgcggtat ttcacaccgc
atacgtcaaa 2450gcaaccatag tacgcgccct gtagcggcgc attaagcgcg
gcgggtgtgg 2500tggttacgcg cagcgtgacc gctacacttg ccagcgccct
agcgcccgct 2550cctttcgctt tcttcccttc ctttctcgcc acgttcgccg
gctttccccg 2600tcaagctcta aatcgggggc tccctttagg gttccgattt
agtgctttac 2650ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc
acgtagtggg 2700ccatcgccct gatagacggt ttttcgccct ttgacgttgg
agtccacgtt 2750ctttaatagt ggactcttgt tccaaactgg aacaacactc
aaccctatct 2800cgggctattc ttttgattta taagggattt tgccgatttc
ggcctattgg 2850ttaaaaaatg agctgattta acaaaaattt aacgcgaatt
ttaacaaaat 2900attaacgttt acaattttat ggtgcactct cagtacaatc
tgctctgatg 2950ccgcatagtt aagccaactc cgctatcgct acgtgactgg
gtcatggctg 3000cgccccgaca cccgccaaca cccgctgacg cgccctgacg
ggcttgtctg 3050ctcccggcat ccgcttacag acaagctgtg accgtctccg
ggagctgcat 3100gtgtcagagg ttttcaccgt catcaccgaa acgcgcgagg
cagtattctt 3150gaagacgaaa gggcctcgtg atacgcctat ttttataggt
taatgtcatg 3200ataataatgg tttcttagac gtcaggtggc acttttcggg
gaaatgtgcg 3250cggaacccct atttgtttat ttttctaaat acattcaaat
atgtatccgc 3300tcatgagaca ataaccctga taaatgcttc aataatattg
aaaaaggaag 3350agtatgagta ttcaacattt ccgtgtcgcc cttattccct
tttttgcggc 3400attttgcctt cctgtttttg ctcacccaga aacgctggtg
aaagtaaaag 3450atgctgaaga tcagttgggt gcacgagtgg gttacatcga
actggatctc 3500aacagcggta agatccttga gagttttcgc cccgaagaac
gttttccaat 3550gatgagcact tttaaagttc tgctatgtgg cgcggtatta
tcccgtgatg 3600acgccgggca agagcaactc ggtcgccgca tacactattc
tcagaatgac 3650ttggttgagt actcaccagt cacagaaaag catcttacgg
atggcatgac 3700agtaagagaa ttatgcagtg ctgccataac catgagtgat
aacactgcgg 3750ccaacttact tctgacaacg atcggaggac cgaaggagct
aaccgctttt 3800ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt
gggaaccgga 3850gctgaatgaa gccataccaa acgacgagcg tgacaccacg
atgccagcag 3900caatggcaac aacgttgcgc aaactattaa
ctggcgaact acttactcta 3950gcttcccggc aacaattaat agactggatg
gaggcggata aagttgcagg 4000accacttctg cgctcggccc ttccggctgg
ctggtttatt gctgataaat 4050ctggagccgg tgagcgtggg tctcgcggta
tcattgcagc actggggcca 4100gatggtaagc cctcccgtat cgtagttatc
tacacgacgg ggagtcaggc 4150aactatggat gaacgaaata gacagatcgc
tgagataggt gcctcactga 4200ttaagcattg gtaactgtca gaccaagttt
actcatatat actttagatt 4250gatttaaaac ttcattttta atttaaaagg
atctaggtga agatcctttt 4300tgataatctc atgaccaaaa tcccttaacg
tgagttttcg ttccactgag 4350cgtcagaccc cgtagaaaag atcaaaggat
cttcttgaga tccttttttt 4400ctgcgcgtaa tctgctgctt gcaaacaaaa
aaaccaccgc taccagcggt 4450ggtttgtttg ccggatcaag agctaccaac
tctttttccg aaggtaactg 4500gcttcagcag agcgcagata ccaaatactg
tccttctagt gtagccgtag 4550ttaggccacc acttcaagaa ctctgtagca
ccgcctacat acctcgctct 4600gctaatcctg ttaccagtgg ctgctgccag
tggcgataag tcgtgtctta 4650ccgggttgga ctcaagacga tagttaccgg
ataaggcgca gcggtcgggc 4700tgaacggggg gttcgtgcac acagcccagc
ttggagcgaa cgacctacac 4750cgaactgaga tacctacagc gtgagcattg
agaaagcgcc acgcttcccg 4800aagggagaaa ggcggacagg tatccggtaa
gcggcagggt cggaacagga 4850gagcgcacga gggagcttcc agggggaaac
gcctggtatc tttatagtcc 4900tgtcgggttt cgccacctct gacttgagcg
tcgatttttg tgatgctcgt 4950caggggggcg gagcctatgg aaaaacgcca
gcaacgcggc ctttttacgg 5000ttcctggcct tttgctggcc ttttgctcac
atgttctttc ctgcgttatc 5050ccctgattct gtggataacc gtattaccgc
ctttgagtga gctgataccg 5100ctcgccgcag ccgaacgacc gagcgcagcg
agtcagtgag cgaggaagcg 5150gaagagcgcc caatacgcaa accgcctctc
cccgcgcgtt ggccgattca 5200ttaatccagc tggcacgaca ggtttcccga
ctggaaagcg ggcagtgagc 5250gcaacgcaat taatgtgagt tacctcactc
attaggcacc ccaggcttta 5300cactttatgc ttccggctcg tatgttgtgt
ggaattgtga gcggataaca 5350atttcacaca ggaaacagct atgaccatga
ttacgaatta a 5391206135DNAArtificial sequenceSequence is
synthesized 20attcgagctc gcccgacatt gattattgac tagttattaa
tagtaatcaa 50ttacggggtc attagttcat agcccatata tggagttccg cgttacataa
100cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
150gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
200attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta
250catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg
300taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc
350ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg
400cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
450atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
500aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
550caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg
600tttagtgaac cgtcagatcg cctggagacg ccatccacgc tgttttgacc
650tccatagaag acaccgggac cgatccagcc tccgcggccg ggaacggtgc
700attggaacgc ggattccccg tgccaagagt gacgtaagta ccgcctatag
750agtctatagg cccaccccct tggcttcgtt agaacgcggc tacaattaat
800acataacctt atgtatcata cacatacgat ttaggtgaca ctatagaata
850acatccactt tgcctttctc tccacaggtg tccactccca ggtccaactg
900cacctcggtt ctatcgattg aattccacca tgggatggtc atgtatcatc
950ctttttctag tagcaactgc aactggagta cattcagaag ttcagctggt
1000ggagtctggc ggtggcctgg tgcagccagg gggctcactc cgtttgtcct
1050gtgcagcttc tggctactcc tttaccggct acactatgaa ctgggtgcgt
1100caggccccag gtaagggcct ggaatgggtt gcactgatta atccttataa
1150aggtgttact acctatgccg atagcgtcaa gggccgtttc actataagcg
1200tagataaatc caaaaacaca gcctacctgc aaatgaacag cctgcgtgct
1250gaggacactg ccgtctatta ttgtgctaga agcggatact acggcgatag
1300cgactggtat tttgacgtct ggggtcaagg aaccctggtc accgtctcct
1350cggcctccac caagggccca tcggtcttcc ccctggcacc ctcctccaag
1400agcacctctg ggggcacagc ggccctgggc tgcctggtca aggactactt
1450ccccgaaccg gtgacggtgt cgtggaactc aggcgccctg accagcggcg
1500tgcacacctt cccggctgtc ctacagtcct caggactcta ctccctcagc
1550agcgtggtga ctgtgccctc tagcagcttg ggcacccaga cctacatctg
1600caacgtgaat cacaagccca gcaacaccaa ggtggacaag aaagttgagc
1650ccaaatcttg tgacaaaact cacacatgcc caccgtgccc agcacctgaa
1700ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac
1750cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga
1800gccacgaaga ccctgaggtc aagttcaact ggtacgtgga cggcgtggag
1850gtgcataatg ccaagacaaa gccgcgggag gagcagtaca acagcacgta
1900ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg ctgaatggca
1950aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag
2000aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtacac
2050cctgccccca tcccgggaag agatgaccaa gaaccaggtc agcctgacct
2100gcctggtcaa aggcttctat cccagcgaca tcgccgtgga gtgggagagc
2150aatgggcagc cggagaacaa ctacaagacc acgcctcccg tgctggactc
2200cgacggctcc ttcttcctct acagcaagct caccgtggac aagagcaggt
2250ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac
2300aaccactaca cgcagaagag cctctccctg tctccgggta aatgagtgcg
2350acggccctag agtcgacctg cagaagcttg gccgccatgg cccaacttgt
2400ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc
2450acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact
2500catcaatgta tcttatcatg tctggatcga tcgggaatta attcggcgca
2550gcaccatggc ctgaaataac ctctgaaaga ggaacttggt taggtacctt
2600ctgaggcgga aagaaccatc tgtggaatgt gtgtcagtta gggtgtggaa
2650agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
2700tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag
2750tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa
2800ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc
2850catggctgac taattttttt tatttatgca gaggccgagg ccgcctcggc
2900ctctgagcta ttccagaagt agtgaggagg cttttttgga ggcctaggct
2950tttgcaaaaa gctgttaaca gcttggcact ggccgtcgtt ttacaacgtc
3000gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat
3050ccccccttcg ccagttggcg taatagcgaa gaggcccgca ccgatcgccc
3100ttcccaacag ttgcgtagcc tgaatggcga atggcgcctg atgcggtatt
3150ttctccttac gcatctgtgc ggtatttcac accgcatacg tcaaagcaac
3200catagtacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt
3250acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt
3300cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag
3350ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac
3400ctcgacccca aaaaacttga tttgggtgat ggttcacgta gtgggccatc
3450gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta
3500atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc
3550tattcttttg atttataagg gattttgccg atttcggcct attggttaaa
3600aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa
3650cgtttacaat tttatggtgc actctcagta caatctgctc tgatgccgca
3700tagttaagcc aactccgcta tcgctacgtg actgggtcat ggctgcgccc
3750cgacacccgc caacacccgc tgacgcgccc tgacgggctt gtctgctccc
3800ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc
3850agaggttttc accgtcatca ccgaaacgcg cgaggcagta ttcttgaaga
3900cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat
3950aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa
4000cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
4050agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat
4100gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt
4150gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct
4200gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
4250cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga
4300gcacttttaa agttctgcta tgtggcgcgg tattatcccg tgatgacgcc
4350gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt
4400tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa
4450gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac
4500ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca
4550caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga
4600atgaagccat accaaacgac gagcgtgaca ccacgatgcc agcagcaatg
4650gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc
4700ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac
4750ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga
4800gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
4850taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta
4900tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag
4950cattggtaac tgtcagacca agtttactca tatatacttt agattgattt
5000aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata
5050atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca
5100gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg
5150cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt
5200gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc
5250agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg
5300ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa
5350tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg
5400ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac
5450ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac
5500tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg
5550agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
5600cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg
5650ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg
5700gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct
5750ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg
5800attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc
5850cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
5900gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat
5950ccaactggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac
6000gcaattaatg tgagttacct cactcattag gcaccccagg ctttacactt
6050tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc
6100acacaggaaa cagctatgac catgattacg aatta 613521232PRTArtificial
sequenceSequence is synthesized 21Met Gly Trp Ser Cys Ile Ile Leu
Phe Leu Val Ala Thr Ala Thr1 5 10 15Gly Val His Ser Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu 20 25 30Ser Ala Ser Val Gly Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser 35 40 45Ser Ser Val Ser Tyr Met His Trp
Tyr Gln Gln Lys Pro Gly Lys 50 55 60Ala Pro Lys Pro Leu Ile Tyr Ala
Pro Ser Asn Leu Ala Ser Gly 65 70 75Val Pro Ser Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr 80 85 90Leu Thr Ile Ser Ser Leu Gln Pro
Glu Asp Phe Ala Thr Tyr Tyr 95 100 105Cys Gln Gln Trp Ser Phe Asn
Pro Pro Thr Phe Gly Gln Gly Thr 110 115 120Lys Val Glu Ile Lys Arg
Thr Val Ala Ala Pro Ser Val Phe Ile 125 130 135Phe Pro Pro Ser Asp
Glu Gln Leu Lys Ser Gly Thr Ala Ser Val 140 145 150Val Cys Leu Leu
Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln 155 160 165Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser 170 175 180Val Thr
Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser 185 190 195Thr
Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 200 205
210Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 215
220 225Ser Phe Asn Arg Gly Glu Cys 230 22471PRTArtificial
sequenceSequence is synthesized 22Met Gly Trp Ser Cys Ile Ile Leu
Phe Leu Val Ala Thr Ala Thr1 5 10 15Gly Val His Ser Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu 20 25 30Val Gln Pro Gly Gly Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly 35 40 45Tyr Thr Phe Thr Ser Tyr Asn Met
His Trp Val Arg Gln Ala Pro 50 55 60Gly Lys Gly Leu Glu Trp Val Gly
Ala Ile Tyr Pro Gly Asn Gly 65 70 75Asp Thr Ser Tyr Asn Gln Lys Phe
Lys Gly Arg Phe Thr Ile Ser 80 85 90Val Asp Lys Ser Lys Asn Thr Leu
Tyr Leu Gln Met Asn Ser Leu 95 100 105Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala Arg Val Val Tyr 110 115 120Tyr Ser Asn Ser Tyr Trp
Tyr Phe Asp Val Trp Gly Gln Gly Thr 125 130 135Leu Val Thr Val Ser
Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 140 145 150Pro Leu Ala Pro
Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 155 160 165Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 170 175 180Ser Trp
Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 185 190 195Ala
Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 200 205
210Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn 215
220 225Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu
230 235 240Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro
Ala 245 250 255Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro Lys 260 265 270Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
Val Thr Cys 275 280 285Val Val Val Asp Val Ser His Glu Asp Pro Glu
Val Lys Phe Asn 290 295 300Trp Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro 305 310 315Arg Glu Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu 320 325 330Thr Val Leu His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys 335 340 345Lys Val Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile 350 355 360Ser Lys Ala Lys Gly Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu 365 370 375Pro Pro Ser Arg Glu
Glu Met Thr Lys Asn Gln Val Ser Leu Thr 380 385 390Cys Leu Val Lys
Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 395 400 405Glu Ser Asn
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 410 415 420Val Leu
Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 425 430 435Val
Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 440 445
450Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 455
460 465Ser Leu Ser Pro Gly Lys 470 23471PRTArtificial
sequenceSequence is synthesized 23Met Gly Trp Ser Cys Ile Ile Leu
Phe Leu Val Ala Thr Ala Thr1 5 10 15Gly Val His Ser Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu 20 25 30Val Gln Pro Gly Gly Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly 35 40 45Tyr Thr Phe Thr Ser Tyr Asn Met
His Trp Val Arg Gln Ala Pro 50 55 60Gly Lys Gly Leu Glu Trp Val Gly
Ala Ile Tyr Pro Gly Asn Gly 65 70 75Asp Thr Ser Tyr Asn Gln Lys Phe
Lys Gly Arg Phe Thr Ile Ser 80 85 90Val Asp Lys Ser Lys Asn Thr Leu
Tyr Leu Gln Met Asn Ser Leu 95 100 105Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala Arg Val Val Tyr 110 115 120Tyr Ser Asn Ser Tyr Trp
Tyr Phe Asp Val Trp Gly Gln Gly Thr 125 130 135Leu Val Thr Val Ser
Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 140 145 150Pro Leu Ala Pro
Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 155 160 165Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 170 175 180Ser Trp
Asn
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 185 190 195Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 200 205 210Thr
Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn 215 220
225Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu 230
235 240Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
245 250 255Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys 260 265 270Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys 275 280 285Val Val Val Asp Val Ser His Glu Asp Pro Glu Val
Lys Phe Asn 290 295 300Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro 305 310 315Arg Glu Glu Gln Tyr Asn Ala Thr Tyr Arg
Val Val Ser Val Leu 320 325 330Thr Val Leu His Gln Asp Trp Leu Asn
Gly Lys Glu Tyr Lys Cys 335 340 345Lys Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile Ala Ala Thr Ile 350 355 360Ser Lys Ala Lys Gly Gln Pro
Arg Glu Pro Gln Val Tyr Thr Leu 365 370 375Pro Pro Ser Arg Glu Glu
Met Thr Lys Asn Gln Val Ser Leu Thr 380 385 390Cys Leu Val Lys Gly
Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 395 400 405Glu Ser Asn Gly
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 410 415 420Val Leu Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 425 430 435Val Asp
Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 440 445 450Val
Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 455 460
465Ser Leu Ser Pro Gly Lys 470 24891DNAMacaca fascicularis
24atgacaacac ccagaaattc agtaaatggg actttcccag cagagccaat
50gaaaggccct attgctatgc aacctggtcc aaaaccactc ctcaggagga
100tgtcttcact ggtgggtccc acgcaaagct tcttcatgag ggaatctaag
150gctttggggg ctgtccagat tatgaatggg ctcttccaca ttgccctggg
200gggtcttctg atgatcccag cagggatcta tgcacccatc tgtgtgactg
250tgtggtaccc tctgtgggga ggcattatgt atattatttc cggatcactc
300ctggcagcaa cggagaaaaa ctccaggaag tgtttggtca aaggaaaaat
350gataatgaat tcattgagcc tctttgctgc catttctgga atgattcttt
400caatcatgga catacttaat attaaaattt cccatttttt aaaaatggag
450agtctgaatt ttatcagagt tcacacacca tatattaaca tatacaactg
500tgaaccagct aatccctctg agaaaaactc tccatctact caatactgtt
550acagcataca atctctgttc ctgggcattt tgtcagtgat gctgatcttt
600gccttcttcc aggaacttgt aatagctggc atcgttgaga atgaatggag
650aagaacatgc tccagaccca aatctagcgt agttctcctg tcagctgaag
700aaaaaaaaga acaagtcatt gaaataaaag aagaagtggt tgggctaact
750gaaacatctt cccaaccaaa gaatgaagaa gccattgaaa ttattccaat
800ccaagaagag gaagaagaag aaacagagac aaactttcca gaacctcccc
850aagatcagga atcttcacca atagaaaatg acagctctcc t 89125297PRTMacaca
fascicularis 25Met Thr Thr Pro Arg Asn Ser Val Asn Gly Thr Phe Pro
Ala Glu1 5 10 15Pro Met Lys Gly Pro Ile Ala Met Gln Pro Gly Pro Lys
Pro Leu 20 25 30Leu Arg Arg Met Ser Ser Leu Val Gly Pro Thr Gln Ser
Phe Phe 35 40 45Met Arg Glu Ser Lys Ala Leu Gly Ala Val Gln Ile Met
Asn Gly 50 55 60Leu Phe His Ile Ala Leu Gly Gly Leu Leu Met Ile Pro
Ala Gly 65 70 75Ile Tyr Ala Pro Ile Cys Val Thr Val Trp Tyr Pro Leu
Trp Gly 80 85 90Gly Ile Met Tyr Ile Ile Ser Gly Ser Leu Leu Ala Ala
Thr Glu 95 100 105Lys Asn Ser Arg Lys Cys Leu Val Lys Gly Lys Met
Ile Met Asn 110 115 120Ser Leu Ser Leu Phe Ala Ala Ile Ser Gly Met
Ile Leu Ser Ile 125 130 135Met Asp Ile Leu Asn Ile Lys Ile Ser His
Phe Leu Lys Met Glu 140 145 150Ser Leu Asn Phe Ile Arg Val His Thr
Pro Tyr Ile Asn Ile Tyr 155 160 165Asn Cys Glu Pro Ala Asn Pro Ser
Glu Lys Asn Ser Pro Ser Thr 170 175 180Gln Tyr Cys Tyr Ser Ile Gln
Ser Leu Phe Leu Gly Ile Leu Ser 185 190 195Val Met Leu Ile Phe Ala
Phe Phe Gln Glu Leu Val Ile Ala Gly 200 205 210Ile Val Glu Asn Glu
Trp Arg Arg Thr Cys Ser Arg Pro Lys Ser 215 220 225Ser Val Val Leu
Leu Ser Ala Glu Glu Lys Lys Glu Gln Val Ile 230 235 240Glu Ile Lys
Glu Glu Val Val Gly Leu Thr Glu Thr Ser Ser Gln 245 250 255Pro Lys
Asn Glu Glu Ala Ile Glu Ile Ile Pro Ile Gln Glu Glu 260 265 270Glu
Glu Glu Glu Thr Glu Thr Asn Phe Pro Glu Pro Pro Gln Asp 275 280
285Gln Glu Ser Ser Pro Ile Glu Asn Asp Ser Ser Pro 290 295
26297PRTHomo sapiens 26Met Thr Thr Pro Arg Asn Ser Val Asn Gly Thr
Phe Pro Ala Glu1 5 10 15Pro Met Lys Gly Pro Ile Ala Met Gln Ser Gly
Pro Lys Pro Leu 20 25 30Phe Arg Arg Met Ser Ser Leu Val Gly Pro Thr
Gln Ser Phe Phe 35 40 45Met Arg Glu Ser Lys Ala Leu Gly Ala Val Gln
Ile Met Asn Gly 50 55 60Leu Phe His Ile Ala Leu Gly Gly Leu Leu Met
Ile Pro Ala Gly 65 70 75Ile Tyr Ala Pro Ile Cys Val Thr Val Trp Tyr
Pro Leu Trp Gly 80 85 90Gly Ile Met Tyr Ile Ile Ser Gly Ser Leu Leu
Ala Ala Thr Glu 95 100 105Lys Asn Ser Arg Lys Cys Leu Val Lys Gly
Lys Met Ile Met Asn 110 115 120Ser Leu Ser Leu Phe Ala Ala Ile Ser
Gly Met Ile Leu Ser Ile 125 130 135Met Asp Ile Leu Asn Ile Lys Ile
Ser His Phe Leu Lys Met Glu 140 145 150Ser Leu Asn Phe Ile Arg Ala
His Thr Pro Tyr Ile Asn Ile Tyr 155 160 165Asn Cys Glu Pro Ala Asn
Pro Ser Glu Lys Asn Ser Pro Ser Thr 170 175 180Gln Tyr Cys Tyr Ser
Ile Gln Ser Leu Phe Leu Gly Ile Leu Ser 185 190 195Val Met Leu Ile
Phe Ala Phe Phe Gln Glu Leu Val Ile Ala Gly 200 205 210Ile Val Glu
Asn Glu Trp Lys Arg Thr Cys Ser Arg Pro Lys Ser 215 220 225Asn Ile
Val Leu Leu Ser Ala Glu Glu Lys Lys Glu Gln Thr Ile 230 235 240Glu
Ile Lys Glu Glu Val Val Gly Leu Thr Glu Thr Ser Ser Gln 245 250
255Pro Lys Asn Glu Glu Asp Ile Glu Ile Ile Pro Ile Gln Glu Glu 260
265 270Glu Glu Glu Glu Thr Glu Thr Asn Phe Pro Glu Pro Pro Gln Asp
275 280 285Gln Glu Ser Ser Pro Ile Glu Asn Asp Ser Ser Pro 290 295
2736DNAArtificial sequenceSequence is synthesized 27ctacaccttc
acgagctata acatgcactg ggtccg 362851DNAArtificial sequenceSequence
is synthesized 28gattaatcct gacaacggcg acacgagcta taaccagaag
ttcaagggcc 50g 512938DNAArtificial sequenceSequence is synthesized
29gaatgggttg cagcgatcta tcctggcaac ggcgacac 383065DNAArtificial
sequenceSequence is synthesized 30attattgtgc tcgagtggtc tactatagca
acagctactg gtacttcgac 50gtctggggtc aagga 653136DNAArtificial
sequenceSequence is synthesized 31ctgcacagcc agctcttctg tcagctatat
gcattg 363242DNAArtificial sequenceSequence is synthesized
32aactactgat ttacgctcca tcgaacctcg cgtctggagt cc
423345DNAArtificial sequenceSequence is synthesized 33tattactgtc
aacagtggag cttcaatccg cccacatttg gacag 453437DNAArtificial
sequenceSequence is synthesized 34gtttcactat aagtgtcgac aagtccaaaa
acacatt 373533DNAArtificial sequenceSequence is synthesized
35gccaggatag atggcgccaa cccattccag gcc 333626DNAArtificial
sequenceSequence is synthesized 36aagctccgaa accactgatt tacgct
263718DNAArtificial SequenceSequence is synthesized 37agttttgaga
gcaaaatg 183818DNAArtificial SequenceSequence is synthesized
38aagctatgaa cactaatg 1839452PRTArtificial sequencesequence is
synthesized 39Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln
Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr
Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr
Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe Thr Ile Ser Val Asp
Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg Val Val Tyr Tyr Ser
Asn Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu
Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe
Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala
Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr Phe Pro Glu Pro Val
Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu Thr Ser Gly Val His
Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser Gly Leu Tyr Ser Leu
Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser Ser Leu Gly Thr Gln
Thr Tyr Ile Cys Asn Val Asn His Lys 200 205 210Pro Ser Asn Thr Lys
Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215 220 225Asp Lys Thr His
Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 230 235 240Gly Gly Pro
Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 245 250 255Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 260 265 270Val
Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 275 280
285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 290
295 300Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His
305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser
Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys
Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro
Pro Ser Arg 350 355 360Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr
Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser Phe Phe Leu Tyr Ser
Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp Gln Gln Gly Asn Val
Phe Ser Cys Ser Val Met His Glu 425 430 435Ala Leu His Asn His Tyr
Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445 450Gly
Lys40213PRTArtificial sequencesequence is synthesized 40Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr Met His
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu Ile Tyr
Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe Ser Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser Leu Gln
Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ser Phe Asn
Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100 105Lys Arg
Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser 110 115 120Asp
Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu 125 130
135Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp 140
145 150Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln
155 160 165Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr
Leu 170 175 180Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys
Glu Val 185 190 195Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
Phe Asn Arg 200 205 210Gly Glu Cys41452PRTArtificial
sequencesequence is synthesized 41Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Asp Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Asn Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205
210Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215
220 225Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr 245 250 255Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp 260 265 270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln 290 295 300Tyr Asn Ala Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Ala
Ala Thr Ile Ser Lys Ala Lys 335 340
345Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 350
355 360Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys
365 370 375Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn
Gly 380 385 390Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp Ser 395 400 405Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val
Asp Lys Ser 410 415 420Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser
Val Met His Glu 425 430 435Ala Leu His Asn His Tyr Thr Gln Lys Ser
Leu Ser Leu Ser Pro 440 445 450Gly Lys42452PRTArtificial
sequencesequence is synthesized 42Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Asp Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205
210Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215
220 225Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr 245 250 255Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp 260 265 270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln 290 295 300Tyr Asn Ala Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Ala
Ala Thr Ile Ser Lys Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg 350 355 360Glu Glu Met Thr Lys Asn
Gln Val Ser Leu Thr Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 425 430 435Ala
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445
450Gly Lys43213PRTArtificial sequencesequence is synthesized 43Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu
Ile Tyr Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser
Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ser
Phe Asn Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100
105Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser 110
115 120Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu
125 130 135Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val
Asp 140 145 150Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr
Glu Gln 155 160 165Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr
Leu Thr Leu 170 175 180Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr
Ala Cys Glu Val 185 190 195Thr His Gln Gly Leu Ser Ser Pro Val Thr
Lys Ser Phe Asn Arg 200 205 210Gly Glu Cys44452PRTArtificial
sequencesequence is synthesized 44Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Ala Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205
210Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215
220 225Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr 245 250 255Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp 260 265 270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln 290 295 300Tyr Asn Ser Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Glu
Lys Thr Ile Ser Lys Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg 350 355 360Glu Glu Met Thr Lys Asn
Gln Val Ser Leu Thr Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 425 430 435Ala
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445
450Gly Lys45213PRTArtificial sequencesequence is synthesized 45Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr
Met His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu
Ile Tyr Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser
Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ala
Phe Asn Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100
105Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser 110
115 120Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu
125 130 135Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val
Asp 140 145 150Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr
Glu Gln 155 160 165Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr
Leu Thr Leu 170 175 180Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr
Ala Cys Glu Val 185 190 195Thr His Gln Gly Leu Ser Ser Pro Val Thr
Lys Ser Phe Asn Arg 200 205 210Gly Glu Cys46452PRTArtificial
sequencesequence is synthesized 46Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Ala Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205
210Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215
220 225Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr 245 250 255Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp 260 265 270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln 290 295 300Tyr Asn Ala Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Ala
Ala Thr Ile Ser Lys Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg 350 355 360Glu Glu Met Thr Lys Asn
Gln Val Ser Leu Thr Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 425 430 435Ala
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445
450Gly Lys47213PRTArtificial sequencesequence is synthesized 47Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu
Ile Tyr Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser
Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ala
Phe Asn Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100
105Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser 110
115 120Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu
125 130 135Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val
Asp 140 145 150Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr
Glu Gln 155 160 165Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr
Leu Thr Leu 170 175 180Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr
Ala Cys Glu Val 185 190 195Thr His Gln Gly Leu Ser Ser Pro Val Thr
Lys Ser Phe Asn Arg 200 205 210Gly Glu Cys48452PRTArtificial
sequencesequence is synthesized 48Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro
Gly Asn Gly Ala Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe
Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg
Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp
Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser
Gly
Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser Ser
Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205 210Pro
Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215 220
225Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 230
235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
245 250 255Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
Asp 260 265 270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr
Val Asp 275 280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg
Glu Glu Gln 290 295 300Tyr Asn Ala Thr Tyr Arg Val Val Ser Val Leu
Thr Val Leu His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys
Cys Lys Val Ser Asn 320 325 330Lys Ala Leu Pro Ala Pro Ile Ala Ala
Thr Ile Ser Lys Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro Ser Arg 350 355 360Asp Glu Leu Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 425 430 435Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445 450Gly
Lys49452PRTArtificial sequencesequence is synthesized 49Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val
Gly Ala Ile Tyr Pro Gly Asn Gly Ala Thr Ser Tyr 50 55 60Asn Gln Lys
Phe Lys Gly Arg Phe Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val
Tyr Tyr Cys Ala Arg Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp
Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser
Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro 125 130
135Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu 140
145 150Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser
155 160 165Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu
Gln 170 175 180Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val
Pro Ser 185 190 195Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val
Asn His Lys 200 205 210Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu
Pro Lys Ser Cys 215 220 225Asp Lys Thr His Thr Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu 230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr 245 250 255Leu Met Ile Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val Asp 260 265 270Val Ser His Glu Asp Pro Glu
Val Lys Phe Asn Trp Tyr Val Asp 275 280 285Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln 290 295 300Tyr Asn Ala Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu His 305 310 315Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Ala Val Ser Asn 320 325 330Lys Ala Leu
Pro Ala Pro Ile Glu Ala Thr Ile Ser Lys Ala Lys 335 340 345Gly Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 350 355 360Glu
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 365 370
375Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 380
385 390Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
395 400 405Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser 410 415 420Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met
His Glu 425 430 435Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro 440 445 450Gly Lys50452PRTArtificial sequencesequence
is synthesized 50Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly1 5 10 15Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr
Thr Phe Thr 20 25 30Ser Tyr Asn Met His Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu 35 40 45Glu Trp Val Gly Ala Ile Tyr Pro Gly Asn Gly Ala
Thr Ser Tyr 50 55 60Asn Gln Lys Phe Lys Gly Arg Phe Thr Ile Ser Val
Asp Lys Ser 65 70 75Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg
Ala Glu Asp 80 85 90Thr Ala Val Tyr Tyr Cys Ala Arg Val Val Tyr Tyr
Ser Ala Ser 95 100 105Tyr Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr
Leu Val Thr Val 110 115 120Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
Phe Pro Leu Ala Pro 125 130 135Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala Ala Leu Gly Cys Leu 140 145 150Val Lys Asp Tyr Phe Pro Glu Pro
Val Thr Val Ser Trp Asn Ser 155 160 165Gly Ala Leu Thr Ser Gly Val
His Thr Phe Pro Ala Val Leu Gln 170 175 180Ser Ser Gly Leu Tyr Ser
Leu Ser Ser Val Val Thr Val Pro Ser 185 190 195Ser Ser Leu Gly Thr
Gln Thr Tyr Ile Cys Asn Val Asn His Lys 200 205 210Pro Ser Asn Thr
Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 215 220 225Asp Lys Thr
His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 230 235 240Gly Gly
Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 245 250 255Leu
Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 260 265
270Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 275
280 285Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln
290 295 300Tyr Asn Ala Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu
His 305 310 315Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
Ser Asn 320 325 330Ala Ala Leu Pro Ala Pro Ile Ala Ala Thr Ile Ser
Lys Ala Lys 335 340 345Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
Pro Pro Ser Arg 350 355 360Glu Glu Met Thr Lys Asn Gln Val Ser Leu
Thr Cys Leu Val Lys 365 370 375Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp Glu Ser Asn Gly 380 385 390Gln Pro Glu Asn Asn Tyr Lys Thr
Thr Pro Pro Val Leu Asp Ser 395 400 405Asp Gly Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser 410 415 420Arg Trp Gln Gln Gly Asn
Val Phe Ser Cys Ser Val Met His Glu 425 430 435Ala Leu His Asn His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 440 445 450Gly
Lys51122PRTArtificial sequencesequence is synthesized 51Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly1 5 10 15Gly Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr 20 25 30Ser Tyr Asn
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val
Gly Ala Ile Tyr Pro Gly Asn Gly Ala Thr Ser Tyr 50 55 60Asn Gln Lys
Phe Lys Gly Arg Phe Thr Ile Ser Val Asp Lys Ser 65 70 75Lys Asn Thr
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 80 85 90Thr Ala Val
Tyr Tyr Cys Ala Arg Val Val Tyr Tyr Ser Ala Ser 95 100 105Tyr Trp
Tyr Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val 110 115 120Ser
Ser52107PRTArtificial sequencesequence is synthesized 52Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr Met His
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu Ile Tyr
Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe Ser Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser Leu Gln
Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ala Phe Asn
Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100 105Lys
Arg53107PRTArtificial sequencesequence is synthesized 53Asp Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val1 5 10 15Gly Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Val Ser 20 25 30Tyr Leu His
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro 35 40 45Leu Ile Tyr
Ala Pro Ser Asn Leu Ala Ser Gly Val Pro Ser Arg 50 55 60Phe Ser Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75Ser Leu Gln
Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp 80 85 90Ala Phe Asn
Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 95 100 105Lys
Arg545679DNAArtificial sequenceSequence is synthesized 54cttaagttga
agaggtatga aacctattcc tttatgtctg tactttttag agtaacgact 60caacaataaa
ttcgaacggg tttttcttct tctcagctta cttgacacac gcgtccatct
120tcgaaacctc taatagcagt gacgttacga agcgttatac cgcgttttac
tggttgtcgc 180caactaacta gtccatctcc cccgcgacat gctccatttc
gggctacggt cgtaaggact 240gctgctatgc ctcgacgacg cgctaatgca
tttcttcaat aacttcgtag gagcagtcat 300ttttcaatta gaaaagttgt
cgacagtatt tcaacagtgc cggctctgaa tatcagcgaa 360acaaaaataa
aaaattacat aaacattgat cttaagctcg agccatgggc ccctaggaga
420tctccaactc cactaaaata ctttttctta tagcgtaaag aagaacgtag
atacaagcaa 480aaaagataac gatgtttgcg catgcgacta taggtctact
gggtcagggg ctcgagggac 540aggcggagac acccgctatc ccagtggtag
tggacgtctc ggtcagtctc gcacagctga 600tcgagaatat cgatatacgt
gaccatagtt gtctttggtc cttttcgagg ctttgatgac 660taaatgatac
gatcgttgga gctcagacct cagggaagag cgaagagacc taggccaaga
720ccctgcctaa agtgagactg gtagtcgtca gacgtcggtc ttctgaagcg
ttgaataatg 780acagttgtga gaaccccata aggcgcgtgt aaacctgtcc
catggttcca cctctagttt 840gcttgacacc gacgtggtag acagaagtag
aagggcggta gactactcgt caactttaga 900ccttgacgaa gacaacacac
ggacgactta ttgaagatag ggtctctccg gtttcatgtc 960accttccacc
tattgcggga ggttagccca ttgagggtcc tctcacagtg tctcgtcctg
1020tcgttcctgt cgtggatgtc ggagtcgtcg tgggactgcg actcgtttcg
tctgatgctc 1080tttgtgtttc agatgcggac gcttcagtgg gtagtcccgg
actcgagcgg gcagtgtttc 1140tcgaagttgt cccctctcac aattcgacta
ggagatgcgg cctgcgtagc accgggatca 1200tgcgttcaag tgcatttttc
ccatagatct ccaactccac taaaatactt tttcttatag 1260cgtaaagaag
aacgtagata caagcaaaaa agataacgat gtttgcgcat gcgactccaa
1320gtcgaccacc tcagaccgcc accggaccac gtcggtcccc cgagtgaggc
aaacaggaca 1380cgtcgaagac cgatgtggaa gtggcttata tagtaggtga
cccaggcagt ccggggccca 1440ttcccggacc ttacccaacg tagctaatta
ggactgatgc tgtagtgctt gatattggtc 1500gcgaagttcc cggcaaagtg
atattcagcg ctgctaaggt ttttgtgtaa tatggacgtc 1560tacttgtcgg
acgcacgact cctgtgacgg cagataataa cacgagctac ctagtcgcta
1620aagaagctga tgaccccagt tccttgggac cagtggcaga ggagccggag
gtggttcccg 1680ggtagccaga agggggaccg tgggaggagg ttctcgtgga
gacccccgtg tcgccgggac 1740ccgacggacc agttcctgat gaaggggctt
ggccactgcc acagcacctt gagtccgcgg 1800gactggtcgc cgcacgtgtg
gaagggccga caggatgtca ggagtcctga gatgagggag 1860tcgtcgcacc
actggcacgg gaggtcgtcg aacccgtggg tctggatgta gacgttgcac
1920ttagtgttcg ggtcgttgtg gttccacctg ttctttcaac tcgggtttag
aacactgttt 1980tgagtgtgta ctggtggcgt acgtggtcat agcaggtaag
gctgtcgtag cggtcagtga 2040taccgcacga cgatcgcggc gggatatgga
acagacggag gggcgcaacg cagcgccacg 2100tacctcggcc cggtggagct
ggacttacct tcggccgccg tggagcgatt gcctaagtgg 2160tgaggttctt
aacctcggtt agttaagaac gcctcttgac acttacgcgt ttggttggga
2220accgtcttgt ataggtagcg caggcggtag aggtcgtcgg cgtgcgccgc
gtagagcccg 2280tcgcaaccca ggaccggtgc ccacgcgtac tagcacgagg
acagcaactc ctgggccgat 2340ccgaccgccc caacggaatg accaatcgtc
ttacttagtg gctatgcgct cgcttgcact 2400tcgctgacga cgacgttttg
cagacgctgg actcgttgtt gtacttacca gaagccaaag 2460gcacaaagca
tttcagacct ttgcgccttc agtcgcggga cgtggtaata caaggcctag
2520acgtagcgtc ctacgacgac cgatgggaca ccttgtggat gtagacataa
ttgcttcgcg 2580accgtaactg ggactcacta aaaagagacc agggcggcgt
aggtatggcg gtcaacaaat 2640gggagtgttg caaggtcatt ggcccgtaca
agtagtagtc attgggcata gcactcgtag 2700gagagagcaa agtagccata
gtaatggggg tacttgtctt taagggggaa tgtgcctccg 2760tagttcactg
gtttgtcctt ttttggcggg aattgtaccg ggcgaaatag tcttcggtct
2820gtaattgcga agacctcttt gagttgctcg acctgcgcct acttgtccgt
ctgtagacac 2880ttagcgaagt gctggtgcga ctactcgaaa tggcgtcgta
ggcctttaac atttgcaatt 2940ataaaacaat tttaagcgca atttaaaaac
aatttagtcg agtaaaaaat tggttatccg 3000gctttagccg ttttagggaa
tatttagttt tcttatctgg ctctatccca actcacaaca 3060aggtcaaacc
ttgttctcag gtgataattt cttgcacctg aggttgcagt ttcccgcttt
3120ttggcagata gtcccgatac cgggtgatgc acttggtagt gggattagtt
caaaaaaccc 3180cagctccacg gcatttcgtg atttagcctt gggatttccc
tcgggggcta aatctcgaac 3240tgcccctttc ggccgcttgc accgctcttt
ccttcccttc tttcgctttc ctcgcccgcg 3300atcccgcgac cgttcacatc
gccagtgcga cgcgcattgg tggtgtgggc ggcgcgaatt 3360acgcggcgat
gtcccgcgca ggcgtaggac ggagcgcgca aagccactac tgccactttt
3420ggagactgtg tacgtcgagg gcctctgcca gtgtcgaaca gacattcgcc
tacggccctc 3480gtctgttcgg gcagtcccgc gcagtcgccc acaaccgccc
acagccccgc gtcggtactg 3540ggtcagtgca tcgctatcgc ctcacatatg
accgaattga tacgccgtag tctcgtctaa 3600catgactctc acgtggtata
cgccacactt tatggcgtgt ctacgcattc ctcttttatg 3660gcgtagtccg
cgagaaggcg aaggagcgag tgactgagcg acgcgagcca gcaagccgac
3720gccgctcgcc atagtcgagt gagtttccgc cattatgcca ataggtgtct
tagtccccta 3780ttgcgtcctt tcttgtacac tcgttttccg gtcgttttcc
ggtccttggc atttttccgg 3840cgcaacgacc gcaaaaaggt atccgaggcg
gggggactgc tcgtagtgtt tttagctgcg 3900agttcagtct ccaccgcttt
gggctgtcct gatatttcta tggtccgcaa agggggacct 3960tcgagggagc
acgcgagagg acaaggctgg gacggcgaat ggcctatgga caggcggaaa
4020gagggaagcc cttcgcaccg cgaaagagta tcgagtgcga catccataga
gtcaagccac 4080atccagcaag cgaggttcga cccgacacac gtgcttgggg
ggcaagtcgg gctggcgacg 4140cggaataggc cattgatagc agaactcagg
ttgggccatt ctgtgctgaa tagcggtgac 4200cgtcgtcggt gaccattgtc
ctaatcgtct cgctccatac atccgccacg atgtctcaag 4260aacttcacca
ccggattgat gccgatgtga tcttcctgtc ataaaccata gacgcgagac
4320gacttcggtc aatggaagcc tttttctcaa ccatcgagaa ctaggccgtt
tgtttggtgg 4380cgaccatcgc caccaaaaaa acaaacgttc gtcgtctaat
gcgcgtcttt ttttcctaga 4440gttcttctag gaaactagaa aagatgcccc
agactgcgag tcaccttgct tttgagtgca 4500attccctaaa accagtactc
taatagtttt tcctagaagt ggatctagga aaatttaatt 4560tttacttcaa
aatttagtta gatttcatat atactcattt gaaccagact gtcaatggtt
4620acgaattagt cactccgtgg atagagtcgc tagacagata aagcaagtag
gtatcaacgg 4680actgaggggc agcacatcta ttgatgctat gccctcccga
atggtagacc ggggtcacga 4740cgttactatg gcgctctggg tgcgagtggc
cgaggtctaa atagtcgtta tttggtcggt 4800cggccttccc ggctcgcgtc
ttcaccagga cgttgaaata ggcggaggta ggtcagataa 4860ttaacaacgg
cccttcgatc tcattcatca agcggtcaat tatcaaacgc gttgcaacaa
4920cggtaacgac gtccgtagca ccacagtgcg agcagcaaac cataccgaag
taagtcgagg 4980ccaagggttg ctagttccgc tcaatgtact agggggtaca
acacgttttt tcgccaatcg
5040aggaagccag gaggctagca acagtcttca ttcaaccggc gtcacaatag
tgagtaccaa 5100taccgtcgtg acgtattaag agaatgacag tacggtaggc
attctacgaa aagacactga 5160ccactcatga gttggttcag taagactctt
atcacatacg ccgctggctc aacgagaacg 5220ggccgcagtt gtgccctatt
atggcgcggt gtatcgtctt gaaattttca cgagtagtaa 5280ccttttgcaa
gaagccccgc ttttgagagt tcctagaatg gcgacaactc taggtcaagc
5340tacattgggt gagcacgtgg gttgactaga agtcgtagaa aatgaaagtg
gtcgcaaaga 5400cccactcgtt tttgtccttc cgttttacgg cgttttttcc
cttattcccg ctgtgccttt 5460acaacttatg agtatgagaa ggaaaaagtt
ataataactt cgtaaatagt cccaataaca 5520gagtactcgc ctatgtataa
acttacataa atctttttat ttgtttatcc ccaaggcgcg 5580tgtaaagggg
cttttcacgg tggactgcag attctttggt aataatagta ctgtaattgg
5640atatttttat ccgcatagtg ctccgggaaa gcagaagtt
5679555678DNAArtificial sequenceSequence is synthesized
55cttaagttga agaggtatga aacctattcc tttatgtctg tactttttag agtaacgact
60caacaataaa ttcgaacggg tttttcttct tctcagctta cttgacacac gcgtccatct
120tcgaaacctc taatagcagt gacgttacga agcgttatac cgcgttttac
tggttgtcgc 180caactaacta gtccatctcc cccgcgacat gctccatttc
gggctacggt cgtaaggact 240gctgctatgc ctcgacgacg cgctaatgca
tttcttcaat aacttcgtag gagcagtcat 300ttttcaatta gaaaagttgt
cgacagtatt tcaacagtgc cggctctgaa tatcagcgaa 360acaaaaataa
aaaattacat aaacattgat cttaagctcg agccatgggc ccctaggaga
420tctccaactc cactaaatac tttttcttat agcgtaaaga agaacgtaga
tacaagcaaa 480aaagataacg atgtttgcgc atgcgagtct atcatgacag
ggtcaggggc cgataggaca 540ggcggagagg accgctcttc cagtgatact
ggacgtctcg gtcgagaaga cactcgatat 600acgtaaccat agttgtcttt
ggtccttcga gaggctttgg tacctaaatg cgaggtagct 660tggagcgcag
acctcaggga cgcgcgaaga gacctaggcc aagaccctga tcaatgagag
720actggtagtc gtctcacctc cgtcttctgc ggcgttgaat aatgacagtt
gtcacctcga 780agttaggcgg gtgtaaacct cggccgtggt tcgacctcga
gtttgcttga caccgacgtg 840gtagacagaa gtagaagggc ggtagactac
tcgtcaactt tagaccttga cgaagacaac 900acacggacga cttattgaag
atagggtctc tccggtttca tgtcaccttc cacctattgc 960gggaggttag
cccattgagg gtcctctcac agtgtctcgt cctgtcgttc ctgtcgtgga
1020tgtcggagtc gtcgtgggac tgcgactcgt ttcgtctgat gctctttgtg
tttcagatgc 1080ggacgcttca gtgggtagtc ccggactcga gcgggcagtg
tttctcgaag ttgtcccctc 1140tcacaattcg actaggagat gcggcctgcg
tagcaccggg atcatgcgtt caagtgcatt 1200tttcccatag atctccaact
ccactaaaat actttttctt atagcgtaaa gaagaacgta 1260gatacaagca
aaaaagataa cgatgtttgc gcatgcgagt ccgaatagac gtcgtcagac
1320cgcggctcga ccacgccggt cctcgatcgc agttctacag gacatttcga
agaccgatgt 1380ggaagtggtc gatattgtac gtaacccagt tcgtctgtgg
ctccgttccg gaccttacct 1440aacctcgcta gataggaccg ttgccgctgt
gctcgatatt ggtcttcaag ttcccgttcc 1500ggtgagactg acacctgttc
aggtcgtcat gacggatgta cgttgactcg tcggactgaa 1560gactcctgtc
gcgacagatg aaaacacgag cgcaccagat gatatcgttg tcgatgacca
1620tgaagctgca gaccccatgg ccttggtgtc agtggcagag gagccggagg
tggttcccgg 1680gtagccagaa gggggaccgt gggaggaggt tctcgtggag
acccccgtgt cgccgggacc 1740cgacggacca gttcctgatg aaggggcttg
gccactgcca cagcaccttg agtccgcggg 1800actggtcgcc gcacgtgtgg
aagggccgac aggatgtcag gagtcctgag atgagggagt 1860cgtcgcacca
ctggcacggg aggtcgtcga acccgtgggt ctggatgtag acgttgcact
1920tagtgttcgg gtcgttgtgg ttccacctgt tctttcaact cgggtttaga
acactgtttt 1980gagtgtgtac tggtggcgta cgtggtcata gcaggtaagg
ctgtcgtagc ggtcagtgat 2040accgcacgac gatcgcggcg ggatatggaa
cagacggagg ggcgcaacgc agcgccacgt 2100acctcggccc ggtggagctg
gacttacctt cggccgccgt ggagcgattg cctaagtggt 2160gaggttctta
acctcggtta gttaagaacg cctcttgaca cttacgcgtt tggttgggaa
2220ccgtcttgta taggtagcgc aggcggtaga ggtcgtcggc gtgcgccgcg
tagagcccgt 2280cgcaacccag gaccggtgcc cacgcgtact agcacgagga
cagcaactcc tgggccgatc 2340cgaccgcccc aacggaatga ccaatcgtct
tacttagtgg ctatgcgctc gcttgcactt 2400cgctgacgac gacgttttgc
agacgctgga ctcgttgttg tacttaccag aagccaaagg 2460cacaaagcat
ttcagacctt tgcgccttca gtcgcgggac gtggtaatac aaggcctaga
2520cgtagcgtcc tacgacgacc gatgggacac cttgtggatg tagacataat
tgcttcgcga 2580ccgtaactgg gactcactaa aaagagacca gggcggcgta
ggtatggcgg tcaacaaatg 2640ggagtgttgc aaggtcattg gcccgtacaa
gtagtagtca ttgggcatag cactcgtagg 2700agagagcaaa gtagccatag
taatgggggt acttgtcttt aagggggaat gtgcctccgt 2760agttcactgg
tttgtccttt tttggcggga attgtaccgg gcgaaatagt cttcggtctg
2820taattgcgaa gacctctttg agttgctcga cctgcgccta cttgtccgtc
tgtagacact 2880tagcgaagtg ctggtgcgac tactcgaaat ggcgtcgtag
gcctttaaca tttgcaatta 2940taaaacaatt ttaagcgcaa tttaaaaaca
atttagtcga gtaaaaaatt ggttatccgg 3000ctttagccgt tttagggaat
atttagtttt cttatctggc tctatcccaa ctcacaacaa 3060ggtcaaacct
tgttctcagg tgataatttc ttgcacctga ggttgcagtt tcccgctttt
3120tggcagatag tcccgatacc gggtgatgca cttggtagtg ggattagttc
aaaaaacccc 3180agctccacgg catttcgtga tttagccttg ggatttccct
cgggggctaa atctcgaact 3240gcccctttcg gccgcttgca ccgctctttc
cttcccttct ttcgctttcc tcgcccgcga 3300tcccgcgacc gttcacatcg
ccagtgcgac gcgcattggt ggtgtgggcg gcgcgaatta 3360cgcggcgatg
tcccgcgcag gcgtaggacg gagcgcgcaa agccactact gccacttttg
3420gagactgtgt acgtcgaggg cctctgccag tgtcgaacag acattcgcct
acggccctcg 3480tctgttcggg cagtcccgcg cagtcgccca caaccgccca
cagccccgcg tcggtactgg 3540gtcagtgcat cgctatcgcc tcacatatga
ccgaattgat acgccgtagt ctcgtctaac 3600atgactctca cgtggtatac
gccacacttt atggcgtgtc tacgcattcc tcttttatgg 3660cgtagtccgc
gagaaggcga aggagcgagt gactgagcga cgcgagccag caagccgacg
3720ccgctcgcca tagtcgagtg agtttccgcc attatgccaa taggtgtctt
agtcccctat 3780tgcgtccttt cttgtacact cgttttccgg tcgttttccg
gtccttggca tttttccggc 3840gcaacgaccg caaaaaggta tccgaggcgg
ggggactgct cgtagtgttt ttagctgcga 3900gttcagtctc caccgctttg
ggctgtcctg atatttctat ggtccgcaaa gggggacctt 3960cgagggagca
cgcgagagga caaggctggg acggcgaatg gcctatggac aggcggaaag
4020agggaagccc ttcgcaccgc gaaagagtat cgagtgcgac atccatagag
tcaagccaca 4080tccagcaagc gaggttcgac ccgacacacg tgcttggggg
gcaagtcggg ctggcgacgc 4140ggaataggcc attgatagca gaactcaggt
tgggccattc tgtgctgaat agcggtgacc 4200gtcgtcggtg accattgtcc
taatcgtctc gctccataca tccgccacga tgtctcaaga 4260acttcaccac
cggattgatg ccgatgtgat cttcctgtca taaaccatag acgcgagacg
4320acttcggtca atggaagcct ttttctcaac catcgagaac taggccgttt
gtttggtggc 4380gaccatcgcc accaaaaaaa caaacgttcg tcgtctaatg
cgcgtctttt tttcctagag 4440ttcttctagg aaactagaaa agatgcccca
gactgcgagt caccttgctt ttgagtgcaa 4500ttccctaaaa ccagtactct
aatagttttt cctagaagtg gatctaggaa aatttaattt 4560ttacttcaaa
atttagttag atttcatata tactcatttg aaccagactg tcaatggtta
4620cgaattagtc actccgtgga tagagtcgct agacagataa agcaagtagg
tatcaacgga 4680ctgaggggca gcacatctat tgatgctatg ccctcccgaa
tggtagaccg gggtcacgac 4740gttactatgg cgctctgggt gcgagtggcc
gaggtctaaa tagtcgttat ttggtcggtc 4800ggccttcccg gctcgcgtct
tcaccaggac gttgaaatag gcggaggtag gtcagataat 4860taacaacggc
ccttcgatct cattcatcaa gcggtcaatt atcaaacgcg ttgcaacaac
4920ggtaacgacg tccgtagcac cacagtgcga gcagcaaacc ataccgaagt
aagtcgaggc 4980caagggttgc tagttccgct caatgtacta gggggtacaa
cacgtttttt cgccaatcga 5040ggaagccagg aggctagcaa cagtcttcat
tcaaccggcg tcacaatagt gagtaccaat 5100accgtcgtga cgtattaaga
gaatgacagt acggtaggca ttctacgaaa agacactgac 5160cactcatgag
ttggttcagt aagactctta tcacatacgc cgctggctca acgagaacgg
5220gccgcagttg tgccctatta tggcgcggtg tatcgtcttg aaattttcac
gagtagtaac 5280cttttgcaag aagccccgct tttgagagtt cctagaatgg
cgacaactct aggtcaagct 5340acattgggtg agcacgtggg ttgactagaa
gtcgtagaaa atgaaagtgg tcgcaaagac 5400ccactcgttt ttgtccttcc
gttttacggc gttttttccc ttattcccgc tgtgccttta 5460caacttatga
gtatgagaag gaaaaagtta taataacttc gtaaatagtc ccaataacag
5520agtactcgcc tatgtataaa cttacataaa tctttttatt tgtttatccc
caaggcgcgt 5580gtaaaggggc ttttcacggt ggactgcaga ttctttggta
ataatagtac tgtaattgga 5640tatttttatc cgcatagtgc tccgggaaag cagaagtt
5678
* * * * *