Chimeric Pestiviruses

Abstract

The present invention relates to chimeric pestiviruses having utility as immunogenic compositions and vaccines. Also described herein are methods and kits for treating or preventing the spread of bovine viral diarrhea virus infection, as well as methods and kits for differentiating between vaccinated and wild-type infected animals.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application is a continuation of U.S. application Ser. No. 12/624,473, filed Nov. 24, 2009, an allowed application, and claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application Nos. 61/119,594, filed Dec. 3, 2008, and 61/173,363, filed Apr. 28, 2009. The complete disclosure of each of the aforementioned applications is incorporated by reference herein, as if fully set forth.

FIELD OF THE INVENTION

[0002] The present invention relates to novel chimeric pestiviruses and their use in immunogenic compositions and vaccines. It also relates to methods and kits for treating or preventing the spread of bovine viral diarrhea virus infection. The present invention further relates to the use of the chimeric pestiviruses in methods and kits for differentiating between vaccinated animals and animals infected with a wild-type virus.

BACKGROUND

[0003] Pestiviruses, including bovine viral diarrhea virus (BVD virus, or BVDV), have been isolated from several species of animals, both domestic and wild. Identified hosts for BVDV include buffalo, antelope, reindeer and various deer species, while unique pestivirus species have been identified in giraffes and pronghorn antelope. BVDV is a small RNA virus of the family Flaviviridae. It is closely related to other pestiviruses which are the causative agents of border disease in sheep and classical swine fever in pigs. Recently a divergent pestivirus named Bungowannah pestivirus was identified as an etiologic agent of fetal infection of piglets in Australia.

[0004] Disease caused by BVDV particularly in cattle is widespread, and can be economically devastating. BVDV infection in cattle can result in breeding problems, and can cause abortions or premature births. BVDV is capable of crossing the placenta of pregnant cattle, and may result in the birth of persistently infected (PI) calves that are immunotolerant to the virus and persistently viremic for the rest of their lives. Infected cattle can also exhibit "mucosal disease", characterized by elevated temperature, diarrhea, coughing and ulcerations of the alimentary mucosa. These persistently infected animals provide a source for dissemination of virus within the herd for further outbreaks of mucosal disease and are highly predisposed to infection with microorganisms responsible for causing enteric diseases or pneumonia.

[0005] BVDV is classified into one of two biotypes. Those of the "cp" biotype induce a cytopathic effect on cultured cells, whereas viruses of non-cytopathic, or "ncp", biotype do not. In addition, two major genotypes (type 1 and 2) are recognized, both of which have been shown to cause a variety of clinical syndromes.

[0006] BVDV virions are 40 to 60 nm in diameter. The nucleocapsid of BVDV consists of a single molecule of RNA and the capsid protein C. The nucleocapsid is surrounded by a lipid membrane with two glycoproteins anchored in it, E1 and E2. A third glycoprotein, E.sup.rns, is loosely associated to the envelope. The genome of BVDV is approximately 12.5 kb in length, and contains a single open reading frame located between the 5' and 3' non-translated regions (NTRs). A polyprotein of approximately 438 kD is translated from this open reading frame, and is processed by cellular and viral proteases into at least eleven viral structural and nonstructural (NS) proteins (Tautz, et al., J. Virol. 71:5415-5422 (1997); Xu, et al., J. Virol. 71:5312-5322 (1997); Elbers, et al., J. Virol. 70:4131-4135 (1996); and Wiskerchen, et al., Virology 184:341-350 (1991)). The genomic order of BVDV is p20/N.sup.pro, p14/C, gp48/E.sup.rns, gp25/E1, gp53/E2, p54/NS2, p80/NS3, p10/NS4A, p32/NS4B, p58/NS5A and p75/NS5B. The three envelope proteins, gp48/E.sup.rns, gp25/E1 and gp53/E2, are heavily glycosylated. E.sup.rns (formerly referred to as E0 or gp48) forms homodimers, covalently linked by disulfides. The absence of a hydrophobic membrane anchor region suggests that E.sup.rns is loosely associated with the envelope. E.sup.rns induces high antibody titers in infected cattle, but the antisera has limited virus-neutralizing activity.

[0007] Among the BVDV vaccines currently available are those which contain chemically-inactivated wild-type virus. These vaccines typically require the administration of multiple doses, and result in a short-lived immune response; they also do not protect against fetal transmission of the virus. In sheep, a subunit vaccine based on a purified E2 protein has been reported. Although this vaccine appears to protect fetuses from becoming infected, protection is limited to only the homologous strain of virus, and there is no correlation between antibody titers and protection.

[0008] Modified live (ML) BVDV vaccines have been produced using virus that has been attenuated by repeated passaging in bovine or porcine cells, or by chemically-induced mutations that confer a temperature-sensitive phenotype on the virus. A single dose of a MLV BVDV vaccine has proven sufficient for providing protection from infection, and the duration of immunity can extend for years in vaccinated cattle. In addition, cross-protection has been reported using MLV vaccines (Martin, et al., In "Proceedings of the Conference of Research Workers in Animal Diseases", 75:183 (1994)). However, existing MLV vaccines do not allow for the differentiation between vaccinated and naturally-infected animals.

[0009] Thus, it is clear that a need exists for new vaccines for controlling the spread of BVDV. Such a vaccine(s) could be invaluable in future national or regional BVDV eradication programs, and could also be combined with other cattle vaccines, representing a substantial advance in the industry. A more effective vaccine for controlling and monitoring the spread of BVDV would be a "marked" vaccine. Such a vaccine could either contain an additional antigenic determinant which is not present in wild-type virus, or lack an antigenic determinant which is present in wild-type virus. With respect to the former, vaccinated animals mount an immune response to the "marker" immunogenic determinant, while non-vaccinated animals do not. Through the use of an immunological assay directed against the marker determinant, vaccinated animals could be differentiated from non-vaccinated, naturally-infected animals by the presence of antibodies to the marker determinant. In the case of the latter strategy, animals infected with the wild-type virus mount an immune response to the marker determinant, while non-infected, vaccinated animals do not, as a result of the determinant not being present in the marked vaccine. Through the use of an immunological assay directed against the marker determinant, infected animals could be differentiated from vaccinated, non-infected animals. In both scenarios, by culling out the infected animals, the herd could, over time, become BVDV-free. In addition to the benefit of removing the threat of BVDV disease, certification of a herd as BVDV-free has direct freedom of trade economic benefits.

SUMMARY

[0010] In one embodiment, the present invention provides a chimeric pestivirus, wherein said chimeric pestivirus comprises a bovine viral diarrhea virus which does not express its homologous E.sup.rns protein, further wherein said chimeric pestivirus expresses a heterologous E.sup.rns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous E.sup.rns protein.

[0011] In another embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous E.sup.rns protein of said chimeric pestivirus, or the natural, synthetic or genetic variant of said heterologous E.sup.rns protein, is derived from a pestivirus selected from the group consisting of a reindeer pestivirus, a giraffe pestivirus, and a pronghorn antelope pestivirus.

[0012] In a different embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous E.sup.rns protein of said chimeric pestivirus has at least one E.sup.rns epitope which is not present in wild-type bovine viral diarrhea virus.

[0013] In a separate embodiment, the present invention provides the chimeric pestivirus as described above, wherein the heterologous E.sup.rns protein of said chimeric pestivirus lacks at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus.

[0014] In one embodiment, the present invention provides a culture of the chimeric pestivirus as described above.

[0015] In another embodiment, the present invention provides a cell line or host cell comprising the chimeric pestivirus as described above.

[0016] In yet another embodiment, the present invention provides a polynucleotide molecule encoding for the chimeric pestivirus as described above.

[0017] In a different embodiment, the present invention provides an immunogenic composition comprising the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

[0018] In a separate embodiment, the present invention provides the immunogenic composition as described above, wherein the veterinarily-acceptable carrier is an adjuvant.

[0019] In yet another embodiment, the present invention provides the immunogenic composition as described above, wherein said chimeric pestivirus is live attenuated.

[0020] In still another embodiment, the present invention provides the immunogenic composition as described above, wherein said chimeric pestivirus is inactivated.

[0021] In a different embodiment, the present invention provides the immunogenic composition as described above, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in an animal.

[0022] In a separate embodiment, the present invention provides an immunogenic composition comprising the polynucleotide molecule encoding for the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

[0023] In one embodiment, the present invention provides a vaccine comprising the chimeric pestivirus as described above and a veterinarily-acceptable carrier.

[0024] In another embodiment, the present invention provides the vaccine as described above, wherein the veterinarily-acceptable carrier is an adjuvant.

[0025] In a different embodiment, the present invention provides the vaccine as described above, wherein said chimeric pestivirus is live attenuated.

[0026] In yet another embodiment, the present invention provides the vaccine as described above, wherein said chimeric pestivirus is inactivated.

[0027] In still another embodiment, the present invention provides the vaccine as described above, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in an animal.

[0028] In a separate embodiment, the present invention provides a vaccine comprising a polynucleotide molecule encoding for the chimeric pestivirus as described above and a veterinary acceptable carrier.

[0029] In one embodiment, the present invention provides a kit comprising, in at least one container, a vaccine comprising the chimeric pestivirus as described above.

[0030] In another embodiment, the present invention provides a method of treating or preventing the spread of bovine viral diarrhea virus infection, wherein a vaccine comprising the chimeric pestivirus as described above is administered to an animal.

[0031] In a different embodiment, the present invention provides method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA pestivirus vaccine comprises the chimeric pestivirus as described above, further wherein said chimeric pestivirus has at least one E.sup.rns epitope which is not present in wild-type bovine viral diarrhea virus.

[0032] In a separate embodiment, the present invention provides method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA vaccine comprises the chimeric pestivirus as described above, further wherein said chimeric pestivirus lacks at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus. In yet another embodiment, the present invention provides method of differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above and an animal infected with wild type bovine viral diarrhea virus, wherein the animal vaccinated with said vaccine generates antibodies to at least one E.sup.rns epitope which is present in the chimeric pestivirus of said vaccine, but which is not present in wild-type bovine viral diarrhea virus, said method comprising the steps of: [0033] a) obtaining a serum sample from the animals; [0034] b) assaying said samples for the presence or absence of the antibodies; [0035] c) identifying the animal having said antibodies as having been vaccinated with said vaccine; and [0036] d) identifying the animal lacking said antibodies as having been infected with the wild type BVDV.

[0037] In still another embodiment, the present invention provides method of differentiating between an animal infected with wild-type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above, wherein the animal infected with wild type bovine viral diarrhea virus generates antibodies to at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of said vaccine, said method comprising the steps of: [0038] a) obtaining a serum sample from the animals; [0039] b) assaying said samples for the presence or absence of the antibodies; [0040] c) identifying the animal having said antibodies as having been infected with the wild type BVDV; and [0041] d) identifying the animal lacking said antibodies as having been vaccinated with said vaccine.

[0042] In one embodiment, the present invention provides diagnostic kit for differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above and an animal infected with wild type bovine viral diarrhea virus, said kit comprising reagents capable of detecting antibodies to at least one E.sup.rns epitope which is present in the chimeric pestivirus of the vaccine, but which is not present in wild-type bovine viral diarrhea virus.

[0043] In another embodiment, the present invention provides diagnostic kit for differentiating between an animal infected with wild type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus as described above, said kit comprising reagents capable of detecting antibodies to at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of the vaccine.

[0044] In yet another embodiment, the present invention provides an antibody which recognizes an epitope of E.sup.rns which is present in the chimeric pestivirus as described above, but which epitope is not present in wild-type bovine viral diarrhea virus.

[0045] In a different embodiment, the present invention provides an antibody which recognizes an epitope present in wild-type bovine viral diarrhea virus, but which epitope is not present in the chimeric pestivirus as described above.

[0046] In another embodiment, a chimeric pestivirus as described herein is used in the preparation of a medicament for the prevention or treatment of infections caused by BVDV.

DETAILED DESCRIPTION

[0047] The following definitions may be applied to terms employed in the description of embodiments of the invention. The following definitions supercede any contradictory definitions contained in each individual reference incorporated herein by reference.

[0048] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0049] The term "amino acid," as used herein, refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, for example, hydroxyproline, carboxyglutamate, and O-phosphoserine. Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as .alpha. and .alpha.-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4-hydroxyproline, .gamma.-carboxyglutamate, .epsilon.-N,N,N-trimethyllysine, .epsilon.-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, .sigma.-N-methylarginine, and other similar amino acids and imino acids.

[0050] Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group. Exemplary amino acid analogs include, for example, homoserine, norleucine, methionine sulfoxide, and methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same essential chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid.

[0051] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0052] The term "animal" as used herein, is meant to include any animal that is susceptible to BVDV infections, including but not limited to bovine, ovine, caprine and porcine species, both domesticated and wild.

[0053] The term "antibody" or "antibodies", as used herein, refers to an immunoglobulin molecule able to bind to an antigen by means of recognition of an epitope. Antibodies can be a polyclonal mixture or monoclonal. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources, or can be immunoreactive portions of intact immunoglobulins. Antibodies can exist in a variety of forms including, for example, as, Fv, Fab', F(ab').sub.2, as well as in single chains.

[0054] The term "antigen" as used herein refers to a molecule that contains one or more epitopes (linear, conformational or both) that upon exposure to a subject will induce an immune response that is specific for that antigen. The term "antigen" can refer to attenuated, inactivated or modified live bacteria, viruses, fungi, parasites or other microbes. The term "antigen" as used herein can also refer to a subunit antigen, which is separate and discrete from a whole organism with which the antigen is associated in nature. The term "antigen" can also refer to antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope). The term "antigen" can also refer to an oligonucleotide or polynucleotide that expresses an antigen or antigenic determinant in vivo, such as in DNA immunization applications.

[0055] The terms "BVDV", "BVDV isolates" or "BVDV strains" as used herein refer to bovine viral diarrhea viruses, including but not limited to type I and type II, that consist of the viral genome, associated proteins, and other chemical constituents (such as lipids). A number of type I and type II bovine viral diarrhea viruses are known to those skilled in the art and are available through, e.g., the American Type Culture Collection (ATCC.RTM.). The bovine viral diarrhea virus has a genome in the form of RNA. RNA can be reverse transcribed into DNA for use in cloning. Thus, references made herein to nucleic acid and bovine viral diarrhea virus sequences encompass both viral RNA sequences and DNA sequences derived from the viral RNA sequences.

[0056] The term "cell line" or "host cell", as used herein means a prokaryotic or eukaryotic cell in which a virus can replicate and/or be maintained.

[0057] The term "chimeric" or "chimera" as used herein means a microorganism, for example a virus, containing genetic or physical components derived from more than one progenitor.

[0058] The term "culture" as used herein means a population of cells or microorganisms growing in the absence of other species or types.

[0059] The term "DIVA" as used herein means a vaccine which is able to differentiate infected from vaccinated animals.

[0060] An "epitope" is the specific site of the antigen which binds to a T-cell receptor or specific antibody, and typically comprises from about 3 amino acid residues to about 20 amino acid residues.

[0061] The term "heterologous", as used herein, means derived from a different species or strain.

[0062] The term "homologous", as used herein, means derived from the same species or strain.

[0063] The term "immunogenic composition", as used herein, means a composition that generates an immune response (i.e., has immunogenic activity) when administered alone or with a pharmaceutically acceptable carrier, to an animal. The immune response can be a cellular immune response mediated primarily by cytotoxic T-cells, or a humoral immune response mediated primarily by helper T-cells, which in turn activates B-cells leading to antibody production.

[0064] The term "pathogen" or "pathogenic microorganism" as used herein means a microorganism--for example a virus, bacterium, fungus, protozoan, or helminth--which is capable of inducing or causing a disease, illness, or abnormal state in its host animal.

[0065] The term "pestivirus" as used herein means a RNA virus from the genus Pestivirus, of the family Flaviviridae. Pestiviruses include, but are not limited to, BVDV (type 1 and type 2), Classical Swine Fever Virus (CSFV), and Border Disease Virus (BDV), as well as pestiviruses isolated from species such as wild boar, buffalo, eland, bison, alpaca, pudu, bongo, various deer species, giraffe, reindeer, chamois and pronghorn antelope (Vilcek and Nettleton; Vet Microbiol. 116:1-12 (2006))

[0066] The term "polynucleotide molecule" as used herein means an organic polymer molecule composed of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides with distinct biological function.

[0067] The terms "prevent", "preventing" or "prevention", and the like, as used herein, mean to inhibit the replication of a microorganism, to inhibit transmission of a microorganism, or to inhibit a microorganism from establishing itself in its host. These terms and the like as used herein can also mean to inhibit or block one or more signs or symptoms of infection.

[0068] The term "therapeutically effective amount" as used herein means an amount of a microorganism, or a subunit antigen, or polypeptides, or polynucleotide molecules, and combinations thereof, sufficient to elicit an immune response in the subject to which it is administered. The immune response can comprise, without limitation, induction of cellular and/or humoral immunity.

[0069] The terms "treat", "treating" or "treatment", and the like, as used herein mean to reduce or eliminate an infection by a microorganism. These terms and the like as used herein can also mean to reduce the replication of a microorganism, to reduce the transmission of a microorganism, or to reduce the ability of a microorganism to establish itself in its host. These terms and the like as used herein can also mean to reduce, ameliorate, or eliminate one or more signs or symptoms of infection by a microorganism, or accelerate the recovery from infection by a microorganism.

[0070] The terms "vaccine" and "vaccine composition," as used herein, mean a composition which prevents or reduces an infection, or which prevents or reduces one or more signs or symptoms of infection. The protective effects of a vaccine composition against a pathogen are normally achieved by inducing in the subject an immune response, either a cell-mediated or a humoral immune response or a combination of both. Generally speaking, abolished or reduced incidences of infection, amelioration of the signs or symptoms, or accelerated elimination of the microorganism from the infected subjects are indicative of the protective effects of a vaccine composition. The vaccine compositions of the present invention provide protective effects against infections caused by BVDV.

[0071] The term "variant," as used herein, refers to a derivation of a given protein and/or gene sequence, wherein the derived sequence is essentially the same as the given sequence, but for mutational differences. Said differences may be naturally-occurring, or synthetically- or genetically-generated.

[0072] The term "veterinarily-acceptable carrier" as used herein refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use.

[0073] The following description is provided to aid those skilled in the art in practicing the present invention. Even so, this description should not be construed to unduly limit the present invention as modifications and variations in the embodiments discussed herein can be made by those of ordinary skill in the art without departing from the spirit or scope of the present inventive discovery.

Viruses, Immunogenic Compositions, and Vaccines

[0074] The present invention provides immunogenic compositions and vaccines comprising one or more chimeric pestiviruses, wherein said chimeric pestiviruses comprise a bovine viral diarrhea virus which does not express its homologous E.sup.rns protein, but wherein said chimeric pestivirus expresses a heterologous E.sup.rns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous E.sup.rns protein. The chimeric pestivirus can be selected from, but is not limited to, the group consisting of BVDV/reindeer pestivirus, BVDV/giraffe pestivirus, and BVDV/pronghorn antelope pestivirus chimeras.

[0075] In one embodiment, the BVDV/giraffe chimeric pestivirus is the strain deposited as UC 25547 with American Type Culture Collection (ATCC.RTM.), 10801 University Boulevard, Manassas, Va. 20110-2209, USA, and given the ATCC.RTM. deposit designation of PTA-9938. In one embodiment, the BVDV/pronghorn antelope chimeric pestivirus is the strain deposited as UC 25548 with ATCC.RTM. and given the ATCC.RTM. deposit designation of PTA-9939. In one embodiment, the BVDV/reindeer chimeric pestivirus is the strain deposited as UC 25549 with ATCC.RTM. and given the ATCC.RTM. deposit designation of PTA-9940.

[0076] Chimeric pestiviruses of the present invention can be propagated in cells, cell lines and host cells. Said cells, cell lines or host cells may be for example, but not limited to, mammalian cells and non-mammalian cells, including insect and plant cells. Cells, cell lines and host cells in which chimeric pestiviruses of the present invention may be propagated are readily known and accessible to those of ordinary skill in the art.

[0077] The chimeric pestiviruses of the present invention can be attenuated or inactivated prior to use in an immunogenic composition or vaccine. Methods of attenuation and inactivation are well known to those skilled in the art. Methods for attenuation include, but are not limited to, serial passage in cell culture on a suitable cell line, ultraviolet irradiation, and chemical mutagenesis. Methods for inactivation include, but are not limited to, treatment with formalin, betapropriolactone (BPL) or binary ethyleneimine (BEI), or other methods known to those skilled in the art.

[0078] Inactivation by formalin can be performed by mixing the virus suspension with 37% formaldehyde to a final formaldehyde concentration of 0.05%. The virus-formaldehyde mixture is mixed by constant stirring for approximately 24 hours at room temperature. The inactivated virus mixture is then tested for residual live virus by assaying for growth on a suitable cell line.

[0079] Inactivation by BEI can be performed by mixing the virus suspension of the present invention with 0.1 M BEI (2-bromo-ethylamine in 0.175 N NaOH) to a final BEI concentration of 1 mM. The virus-BEI mixture is mixed by constant stirring for approximately 48 hours at room temperature, followed by the addition of 1.0 M sodium thiosulfate to a final concentration of 0.1 mM. Mixing is continued for an additional two hours. The inactivated virus mixture is tested for residual live virus by assaying for growth on a suitable cell line.

[0080] Immunogenic compositions and vaccines of the present invention can include one or more veterinarily-acceptable carriers. As used herein, a "veterinarily-acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Diluents can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others known to those skilled in the art. Stabilizers include albumin, among others known to the skilled artisan. Preservatives include merthiolate, among others known to the skilled artisan.

[0081] Adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), alum, aluminum hydroxide gel, oil-in water emulsions, water-in-oil emulsions such as, e.g., Freund's complete and incomplete adjuvants, Block co polymer (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), AMPHIGEN.RTM. adjuvant, saponin, Quil A, QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, Ala.) or other saponin fractions, monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, or muramyl dipeptide, among many others known to those skilled in the art. The amounts and concentrations of adjuvants and additives useful in the context of the present invention can readily be determined by the skilled artisan. In one embodiment, the present invention contemplates immunogenic compositions and vaccines comprising from about 50 .mu.g to about 2000 .mu.g of adjuvant. In another embodiment adjuvant is included in an amount from about 100 .mu.g to about 1500 .mu.g, or from about 250 .mu.g to about 1000 .mu.g, or from about 350 .mu.g to about 750 .mu.g. In another embodiment, adjuvant is included in an amount of about 500 .mu.g/2 ml dose of the immunogenic composition or vaccine.

[0082] The immunogenic compositions and vaccines can also include antibiotics. Such antibiotics include, but are not limited to, those from the classes of aminoglycosides, carbapenems, cephalosporins, glycopeptides, macrolides, penicillins, polypeptides, quinolones, sulfonamides, and tetracyclines. In one embodiment, the present invention contemplates immunogenic compositions and vaccines comprising from about 1 .mu.g/ml to about 60 .mu.g/ml of antibiotic. In another embodiment, the immunogenic compositions and vaccines comprise from about 5 .mu.g/ml to about 55 .mu.g/ml of antibiotic, or from about 10 .mu.g/ml to about 50 .mu.g/ml of antibiotic, or from about 15 .mu.g/ml to about 45 .mu.g/ml of antibiotic, or from about 20 .mu.g/ml to about 40 .mu.g/ml of antibiotic, or from about 25 .mu.g/ml to about 35 .mu.g/ml of antibiotic. In yet another embodiment, the immunogenic compositions and vaccines comprise less than about 30 .mu.g/ml of antibiotic.

[0083] Immunogenic compositions and vaccines of the invention can further include one or more other immunomodulatory agents such as, e.g., interleukins, interferons, or other cytokines, suitable amounts of which can be determined by the skilled artisan.

[0084] Immunogenic compositions and vaccines of the present invention can include one or more polynucleotide molecules encoding for a chimeric pestivirus. Either DNA or RNA molecules encoding all of the chimeric pestivirus genome, or one or more open reading frames, can be used in immunogenic compositions or vaccines. The DNA or RNA molecule can be administered absent other agents, or it can be administered together with an agent facilitating cellular uptake (e.g., liposomes or cationic lipids). Total polynucleotide in the immunogenic composition or vaccine will generally be between about 0.1 .mu.g/ml and about 5.0 mg/ml. In another embodiment, the total polynucleotide in the immunogenic composition or vaccine will be from about 1 .mu.g/ml and about 4.0 mg/ml, or from about 10 .mu.g/ml and about 3.0 mg/ml, or from about 100 .mu.g/ml and about 2.0 mg/ml. Vaccines and vaccination procedures that utilize nucleic acids (DNA or mRNA) have been well described in the art, for example, U.S. Pat. No. 5,703,055, U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,589,466, all of which are incorporated herein by reference.

[0085] Immunogenic compositions and vaccines of the present invention can also include additional BVDV antigens, for example, those described in U.S. Pat. No. 6,060,457, U.S. Pat. No. 6,015,795, U.S. Pat. No. 6,001,613, and U.S. Pat. No. 5,593,873, all of which are herein incorporated by reference.

[0086] In addition to one or more chimeric pestiviruses, immunogenic compositions and vaccines can include other antigens. Antigens can be in the form of an inactivated whole or partial preparation of the microorganism, or in the form of antigenic molecules obtained by genetic engineering techniques or chemical synthesis. Other antigens appropriate for use in accordance with the present invention include, but are not limited to, those derived from pathogenic bacteria such as Haemophilus somnus, Haemophilus parasuis, Bordetella bronchiseptica, Bacillus anthracis, Actinobacillus pleuropneumonie, Pasteurella multocida, Mannhemia haemolytica, Mycoplasma bovis, Mycobacterium bovis, Mycobacterium paratuberculosis, Clostridial spp., Streptococcus uberis, Staphylococcus aureus, Erysipelothrix rhusopathiae, Chlamydia spp., Brucella spp., Vibrio spp., Salmonella enterica serovars and Leptospira spp. Antigens can also be derived from pathogenic fungi such as Candida, protozoa such as Cryptosporidium parvum, Neospora canium, Toxoplasma gondii, Eimeria spp., Babesia spp., Giardia spp., or helminths such as Ostertagia, Cooperia, Haemonchus, and Fasciola. Additional antigens include pathogenic viruses such as bovine coronavirus, bovine herpesviruses-1,3,6, bovine parainfluenza virus, bovine respiratory syncytial virus, bovine leukosis virus, rinderpest virus, foot and mouth disease virus, rabies virus, and influenza virus.

Forms, Dosages, Routes of Administration

[0087] Immunogenic compositions and vaccines of the present invention can be administered to animals to induce an effective immune response against BVDV. Accordingly, the present invention provides methods of stimulating an effective immune response against BVDV, by administering to an animal a therapeutically effective amount of an immunogenic composition or vaccine of the present invention described herein.

[0088] Immunogenic compositions and vaccines of the present invention can be made in various forms depending upon the route of administration. For example, the immunogenic compositions and vaccines can be made in the form of sterile aqueous solutions or dispersions suitable for injectable use, or made in lyophilized forms using freeze-drying techniques. Lyophilized immunogenic compositions and vaccines are typically maintained at about 4.degree. C., and can be reconstituted in a stabilizing solution, e.g., saline or and HEPES, with or without adjuvant. Immunogenic compositions and vaccines can also be made in the form of suspensions or emulsions.

[0089] Immunogenic compositions and vaccines of the present invention include a therapeutically effective amount of one or more of the above-described chimeric pestiviruses. Purified viruses can be used directly in an immunogenic composition or vaccine, or can be further attenuated, or inactivated. Typically, an immunogenic composition or vaccine contains between about 1.times.10.sup.2 and about 1.times.10.sup.12 virus particles, or between about 1.times.10.sup.3 and about 1.times.10.sup.11 virus particles, or between about 1.times.10.sup.4 and about 1.times.10.sup.10 virus particles, or between about 1.times.10.sup.5 and about 1.times.10.sup.9 virus particles, or between about 1.times.10.sup.6 and about 1.times.10.sup.8 virus particles. The precise amount of a virus in an immunogenic composition or vaccine effective to provide a protective effect can be determined by a skilled artisan.

[0090] The immunogenic compositions and vaccines generally comprise a veterinarily-acceptable carrier in a volume of between about 0.5 ml and about 5 ml. In another embodiment the volume of the carrier is between about 1 ml and about 4 ml, or between about 2 ml and about 3 ml. In another embodiment, the volume of the carrier is about 1 ml, or is about 2 ml, or is about 5 ml. Veterinarily-acceptable carriers suitable for use in immunogenic compositions and vaccines can be any of those described hereinabove.

[0091] Those skilled in the art can readily determine whether a virus needs to be attenuated or inactivated before administration. In another embodiment of the present invention, a chimeric pestivirus can be administered directly to an animal without additional attenuation. The amount of a virus that is therapeutically effective can vary depending on the particular virus used, the condition of the animal and/or the degree of infection, and can be determined by a skilled artisan.

[0092] In accordance with the methods of the present invention, a single dose can be administered to animals, or, alternatively, two or more inoculations can take place with intervals of from about two to about ten weeks. Boosting regimens can be required and the dosage regimen can be adjusted to provide optimal immunization. Those skilled in the art can readily determine the optimal administration regimen.

[0093] Immunogenic compositions and vaccines can be administered directly into the bloodstream, into muscle, or into an internal organ. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular and subcutaneous. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.

[0094] Parenteral formulations are typically aqueous solutions which can contain excipients such as salts, carbohydrates and buffering agents (preferably to a pH of from about 3 to about 9, or from about 4 to about 8, or from about 5 to about 7.5, or from about 6 to about 7.5, or about 7 to about 7.5), but, for some applications, they can be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water.

[0095] The preparation of parenteral formulations under sterile conditions, for example, by lyophilisation, can readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art.

[0096] The solubility of compounds used in the preparation of parenteral solutions can be increased by the use of appropriate formulation techniques known to the skilled artisan, such as the incorporation of solubility-enhancing agents including buffers, salts, surfactants, liposomes, cyclodextrins, and the like.

[0097] Formulations for parenteral administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release. Thus compounds of the invention can be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active compound. Examples of such formulations include drug-coated stents and poly(dl-lactic-coglycolic)acid (PGLA) microspheres.

[0098] Immunogenic compositions and vaccines of the present invention can also be administered topically to the skin or mucosa, that is, dermally or transdermally. Typical formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foams, films, skin patches, wafers, implants, sponges, fibres, bandages and microemulsions. Liposomes can also be used. Typical carriers include alcohol, water, mineral oil, liquid petrolatum, white petrolatum, glycerin, polyethylene glycol and propylene glycol. Penetration enhancers can be incorporated. See, for example, Finnin and Morgan, J. Pharm Sci, 88 (10):955-958 (1999).

[0099] Other means of topical administration include delivery by electroporation, iontophoresis, phonophoresis, sonophoresis and microneedle or needle-free (e.g. Powderject.TM., Bioject.TM., etc.) injection.

[0100] Formulations for topical administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

[0101] Immunogenic compositions and vaccines can also be administered intranasally or by inhalation, typically in the form of a dry powder (either alone or as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler or as an aerosol spray from a pressurized container, pump, spray, atomizer (preferably an atomizer using electrohydrodynamics to produce a fine mist), or nebulizer, with or without the use of a suitable propellant, such as 1,1,1,2-tetrafluoroethane or 1,1,1,2,3,3,3-heptafluoropropane. For intranasal use, the powder can comprise a bioadhesive agent, for example, chitosan or cyclodextrin.

[0102] The pressurized container, pump, spray, atomizer, or nebulizer contains a solution or suspension of the compound(s) of the invention comprising, for example, ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilizing, or extending release of the active, a propellant(s) as solvent and an optional surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid.

[0103] Prior to use in a dry powder or suspension formulation, the drug product is generally micronized to a size suitable for delivery by inhalation (typically less than about 5 microns). This can be achieved by any appropriate comminuting method, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization, or spray drying.

[0104] Capsules (made, for example, from gelatin or hydroxypropylmethylcellulose), blisters and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mix of the compound of the invention, a suitable powder base such as lactose or starch and a performance modifier such as l-leucine, mannitol, or magnesium stearate. The lactose can be anhydrous or in the form of the monohydrate. Other suitable excipients include dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose and trehalose.

[0105] A suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist can contain from about 1 .mu.g to about 20 mg of the compound of the invention per actuation and the actuation volume can vary from about 1 .mu.l to about 100 .mu.l. In another embodiment, the amount of compound per actuation can range from about 100 .mu.g to about 15 mg, or from about 500 .mu.g to about 10 mg, or from about 1 mg to about 10 mg, or from about 2.5 .mu.g to about 5 mg. In another embodiment, the actuation volume can range from about 5 .mu.l to about 75 .mu.l, or from about 10 .mu.l to about 50 .mu.l, or from about 15 .mu.l to about 25 .mu.l. A typical formulation can comprise the compound of the invention, propylene glycol, sterile water, ethanol and sodium chloride. Alternative solvents which can be used instead of propylene glycol include glycerol and polyethylene glycol.

[0106] Formulations for inhaled/intranasal administration can be formulated to be immediate and/or modified release using, for example, PGLA. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

[0107] In the case of dry powder inhalers and aerosols, the dosage unit is generally determined by means of a valve which delivers a metered amount. Units in accordance with the invention are typically arranged to administer a metered dose or "puff" containing from about 10 ng to about 100 .mu.g of the compound of the invention. In another embodiment, the amount of compound administered in a metered dose is from about 50 ng to about 75 .mu.g, or from about 100 ng to about 50 .mu.g, or from about 500 ng to about 25 .mu.g, or from about 750 ng to about 10 .mu.g, or from about 1 .mu.g to about 5 .mu.g. The overall daily dose will typically be in the range from about 1 .mu.g to about 100 mg which can be administered in a single dose or, more usually, as divided doses throughout the day. In another embodiment, the overall daily dose can range from about 50 .mu.g to about 75 mg, or from about 100 .mu.g to about 50 mg, or from about 500 .mu.g to about 25 mg, or from about 750 .mu.g to about 10 mg, or from about 1 mg to about 5 mg.

[0108] Immunogenic compositions and vaccines of the present invention can also be administered orally or perorally, that is into a subject's body through or by way of the mouth and involves swallowing or transport through the oral mucosa (e.g., sublingual or buccal absorption) or both. Suitable flavors, such as menthol and levomenthol, or sweeteners, such as saccharin or saccharin sodium, can be added to those formulations of the invention intended for oral or peroral administration.

[0109] Immunogenic compositions and vaccines of the present invention can be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives can be used as appropriate. Formulations for rectal/vaginal administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

[0110] Immunogenic compositions and vaccines of the present invention can also be administered directly to the eye or ear, typically in the form of drops of a micronized suspension or solution in isotonic, pH-adjusted, sterile saline. Other formulations suitable for ocular and aural administration include ointments, biodegradable (e.g. absorbable gel sponges, collagen) and non-biodegradable (e.g. silicone) implants, wafers, lenses and particulate or vesicular systems, such as niosomes or liposomes. A polymer such as crossed-linked polyacrylic acid, polyvinylalcohol, hyaluronic acid, a cellulosic polymer, for example, hydroxypropylmethylcellulose, hydroxyethylcellulose, or methyl cellulose, or a heteropolysaccharide polymer, for example, gelan gum, can be incorporated together with a preservative, such as benzalkonium chloride. Such formulations can also be delivered by iontophoresis.

[0111] Formulations for ocular/aural administration can be formulated to be immediate and/or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release.

[0112] The immunogenic compositions and vaccines of the present invention can be used in the preparation of a medicament for treating or preventing the spread of bovine viral diarrhea virus infection in an animal.

[0113] The immunogenic compositions and vaccines of the present invention can be used in the preparation of a medicament for administering to an animal, wherein the medicament is a DIVA pestivirus vaccine comprising a chimeric pestivirus comprising a bovine viral diarrhea virus which does not express its homologous E.sup.rns protein, and wherein said chimeric pestivirus expresses a heterologous E.sup.rns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous E.sup.rns protein. In one embodiment, the chimeric pestivirus has at least one E.sup.rns epitope which is not present in wild-type bovine viral diarrhea virus. In another embodiment the chimeric pestivirus lacks at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus.

Detection, Diagnostic Methods

[0114] The present invention provides methods of determining the origin of a pestivirus present in an animal subject.

[0115] Vaccination which utilizes a DIVA vaccine--one which is able to differentiate infected from vaccinated animals--provides a means for determining the origin of a pestivirus present in an animal subject. This differentiation can be accomplished via any of various diagnostic methods, including but not limited to ELISA, Western blotting and PCR. These and other methods are readily recognized and known to one of ordinary skill in the art.

[0116] The chimeric pestiviruses of the present invention can be distinguished from wild-type BVDV strains in both their genomic composition and proteins expressed. Such distinction allows for discrimination between vaccinated and infected animals. For example, a determination can be made as to whether an animal testing positive for BVDV in certain laboratory tests carries a wild-type BVDV strain, or carries a chimeric pestivirus of the present invention previously obtained through vaccination.

[0117] A variety of assays can be employed for making the determination. For example, virus can be isolated from the animal testing positive for BVDV, and nucleic acid-based assays can be used to determine the presence of a chimeric pestivirus genome, indicative of prior vaccination. The nucleic acid-based assays include Southern or Northern blot analysis, PCR, and sequencing. Alternatively, protein-based assays can be employed. In protein-based assays, cells or tissues suspected of an infection can be isolated from the animal testing positive for BVDV. Cellular extracts can be made from such cells or tissues and can be subjected to, e.g., Western Blot, using appropriate antibodies against viral proteins that can distinctively identify the presence of either the chimeric pestivirus previously inoculated, or wild-type BVDV.

[0118] The extent and nature of the immune responses induced in the animal can be assessed by using a variety of techniques. For example, sera can be collected from the inoculated animals and tested for the presence or absence of antibodies specific for the chimeric virus, e.g., in a conventional virus neutralization assay. Detection of responding cytotoxic T-lymphocytes (CTLs) in lymphoid tissues can be achieved by assays such as T cell proliferation, as indicative of the induction of a cellular immune response. The relevant techniques are well described in the art, e.g., Coligan et al. Current Protocols in Immunology, John Wiley & Sons Inc. (1994).

KITS

[0119] Inasmuch as it may be desirable to administer an immunogenic composition or vaccine in combination with additional compounds, for example, for the purpose of treating a particular disease or condition, it is within the scope of the present invention that an immunogenic composition or vaccine can conveniently be included in, or combined in, the form of a kit suitable for administration or co-administration of the compositions.

[0120] Thus, kits of the present invention can comprise one or more separate pharmaceutical compositions, at least one of which is an immunogenic composition or vaccine in accordance with the present invention, and a means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet. An example of such a kit is a syringe and needle, and the like. A kit of the present invention is particularly suitable for administering different dosage forms, for example, oral or parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another. To assist one administering a composition of the present invention, the kit typically comprises directions for administration.

[0121] Another kit of the present invention can comprise one or more reagents useful for the detection of and differentiation between a BVDV-infected animal and a chimeric pestivirus-vaccinated animal. The kit can include reagents for analyzing a sample for the presence of whole BVDV, or BVDV polypeptides, epitopes or polynucleotide sequences which are not present in the chimeric pestivirus of the immunogenic composition or vaccine. Alternatively, kits of the present invention can include reagents for analyzing a sample for the presence of a chimeric pestivirus, or polypeptides, epitopes or polynucleotide sequences which are not present in wild-type BVDV. The presence of virus, polypeptides, or polynucleotide sequences can be determined using antibodies, PCR, hybridization, and other detection methods known to those of skill in the art.

[0122] Another kit of the present invention can provide reagents for the detection of antibodies against particular epitopes. The epitopes are either present in the chimeric pestivirus of the present invention and not present in wild type BVDV, or alternatively, are present in wild-type BVDV and not present in the chimeric pestivirus of the present invention. Such reagents are useful for analyzing a sample for the presence of antibodies, and are readily known and available to one of ordinary skill in the art. The presence of antibodies can be determined using standard detection methods known to those of skill in the art.

[0123] In certain embodiments, the kits can include a set of printed instructions or a label indicating that the kit is useful for the detection and differentiation of BVDV-infected animals from chimeric pestivirus-vaccinated animals.

Antibody, Antibodies

[0124] Antibodies can either be monoclonal, polyclonal, or recombinant. Conveniently, the antibodies can be prepared against the immunogen or a portion thereof. For example, a synthetic peptide based on the amino acid sequence of the immunogen, or prepared recombinantly by cloning techniques or the natural gene product and/or portions thereof can be isolated and used as the immunogen. Immunogens can be used to produce antibodies by standard antibody production technology well known to those skilled in the art, such as described generally in Harlow and Lane, "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1988) and Borrebaeck, "Antibody Engineering--A Practical Guide", W.H. Freeman and Co. (1992). Antibody fragments can also be prepared from the antibodies, and include Fab, F(ab').sub.2, and Fv, by methods known to those skilled in the art.

[0125] In the production of antibodies, screening for the desired antibody can be accomplished by standard methods in immunology known in the art. Techniques not specifically described are generally followed as in Stites, et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton and Lange, Norwalk, Conn. (1994) and Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W.H. Freeman and Co., New York (1980). In general, ELISAs and Western blotting are the preferred types of immunoassays. Both assays are well known to those skilled in the art. Both polyclonal and monoclonal antibodies can be used in the assays. The antibody can be bound to a solid support substrate or conjugated with a detectable moiety or be both bound and conjugated as is well known in the art. (For a general discussion of conjugation of fluorescent or enzymatic moieties, see Johnstone and Thorpe, "Immunochemistry in Practice", Blackwell Scientific Publications, Oxford (1982).) The binding of antibodies to a solid support substrate is also well known in the art. (For a general discussion, see Harlow and Lane (1988) and Borrebaeck (1992).) The detectable moieties contemplated for use in the present invention can include, but are not limited to, fluorescent, metallic, enzymatic and radioactive markers such as biotin, gold, ferritin, alkaline phosphatase, b-galactosidase, peroxidase, urease, fluorescein, rhodamine, tritium, .sup.14C and iodination.

[0126] The present invention is further illustrated by, but by no means limited to, the following examples.

Example 1. Construction and Serological Characterization of Chimeric Pestiviruses

[0127] E. coli K12 GM2163 [F-ara-14, leuB6, thi-1, fhuA31, lacY1, tsx-78, galK2, galT22, supE44, hisG4, rpsL136, (Str.sup.r), xyl-5, mtl-1, dam13::Tn9(Cam.sup.r), dcm-6, mcrB1, hsdR2(rk.sup.-mk.sup.-), mcrA] harbors a plasmid containing the full length genomic cDNA of bovine viral diarrhea virus strain NADL (BVDV-NADL), obtained from Dr. R. Donis, University of Nebraska.

[0128] RD cells (bovine testicular cells transformed with SV40; obtained from Dr. R. Donis) were maintained in OptiMEM supplemented with 3% horse serum, 1% non-essential amino acids (NEAA) in modified Eagle's medium (MEM), 2 mM GlutaMax and 10 ug/ml Gentamicin. BK-6 cells were obtained from Pfizer Global Manufacturing (PGM). Cells were grown in Dulbecco's modified Eagles' medium (DMEM) supplemented with 5% horse serum or donor calf serum (PGM), 2 mM Glutamax, and 1% Antibiotic and Antimycotic. All medium components except where indicated were purchased from Invitrogen (Carlsbad, Calif.). All cells were maintained at 37.degree. C. in a 5% CO.sub.2 environment.

[0129] Monoclonal antibody (MAb) 15C5 specific to BVDV E.sup.rns was purchased from IDEXX (Westbrook, Me.). MAb 20.10.6 against BVDV NS3 was provided by Dr. E. Dubovi (Cornell University). MAbs WS 363, WS 373 and WS 371, having specificity for the Border Disease virus (BDV) E.sup.rns protein, were obtained from Veterinary Laboratories Agency (Surrey, UK). Bovine serum samples #77, #816, #1281, and #1434 were obtained internally at Pfizer. Chimeric pestiviruses were generated by replacing the E.sup.rns gene of the BVDV-NADL strain with the E.sup.rns gene of giraffe (G-E.sup.rns), reindeer (R-E.sup.rns), or pronghorn antelope (P-E.sup.rns) pestivirus using an overlapping PCR method. Either PfuUltra.TM. II fusion HS DNA polymerase (Stratagene; La Jolla, Calif.) or Platinum.RTM. Taq DNA Polymerase High Fidelity (Invitrogen) was used. The oligonucleotide primers (with accompanying SEQ ID NOs) for overlapping PCRs and for generating a full length viral DNA are listed in Table 1.

TABLE-US-00001 TABLE 1 Oligonucleotide primers used for PCR amplification SEQ ID Primer Binding Site NO Name Origin Sequences (5'-3') (underlined sequence) 1 Oligo B-5 T7 + NADL GTGTTAATACGACTCACTATAG T7 promoter TATACGAGAATTAGAAAAGGC 2 Oligo 84 NADL GGGGGCTGTTAGAGGTCTTCC 3 Oligo 127 G-E.sup.rns + NADL AATTCCACTGGGTGATGTTCTCTC G-E.sup.rns N-terminus CCATTGTAACTTGAAACAAAACT 4 Oligo 128 G-E.sup.rns GAGAACATCACCCAGTGGAA 5 Oligo 129 G-E.sup.rns TGCGTGGGCTCCAAACCATGT 6 Oligo 130 G-E.sup.rns + NADL AACATGGTTTGGAGCCCACGCA G-E.sup.rns C-terminus GCTTCCCCTTACTGTGATGTCG 7 Oligo 131 R-E.sup.rns + NADL GGTTCCACTGTGTTATATTCTCTC R-E.sup.rns N-terminus CCATTGTAACTTGAAACAAAACT 8 Oligo 132 R-E.sup.rns GAGAATATAACACAGTGGAACC 9 Oligo 133 R-E.sup.rns TGCATTAGCTCCGAACCACGTT 10 Oligo 134 R-E.sup.rns + NADL AACGTGGTTCGGAGCTAATGCA R-E.sup.rns C-terminus GCTTCCCCTTACTGTGATGTCG 11 Oligo 135 P-E.sup.rns + NADL GGTTCCACTGAGTTATATTCAC P-E.sup.rns N-terminus TCCCATTGTAACTTGAAACA 12 Oligo 136 P-E.sup.rns GTGAATATAACTCAGTGGAACC 13 Oligo 137 P-E.sup.rns TGCCTGTGCCCCAAACCATGT 14 Oligo 138 P-E.sup.rns + NADL AACATGGTTTGGGGCACAGGCA P-E.sup.rns C-terminus GCTTCCCCTTACTGTGATGTCG 15 Oligo 175 NADL GTTATCAATAGTAGCCACAGAAT 16 Oligo 177 NADL TCCACCCTCAATCGACGCTAAA 17 Oligo 237 CM5960 CCCTGAGGCCTTCTGTTCTGAT 18 Oligo P7 CM5960 CACTTGTCGGAGGTACTACTACT 19 Oligo P8 CM5960 CTTGTCTATCTTATCTCTTATTGC 20 Oligo P3 CM5960 ACTATCTGAACAGTTGGACAGG 21 Oligo 296-1 T7 + GTGTTAATACGACTCACTATA T7 promoter CM53637 GTATACGAGATTAGCTAAAG 22 Oligo 297 P- CCAGGTTCCACTGAGTTATATTCAC P-E.sup.rns N-terminus E.sup.rns + CM53637 TCCTGTTACCAGCTGAAGCAGAA 23 Oligo 298 P- AACATGGTTTGGGGCACAGGCA P-E.sup.rns C-terminus E.sup.rns + CM53637 GCAAGTCCATACTGTAAAGTG 24 Oligo 299 CM53637 TTAATGCCCTCCCTGTCTCTACCACCT 25 Oligo 300 CM53637 AGGATGAGGATCTAGCAGTGGATCT 26 Oligo 303 CM53637 CCATAGCCATCTGCTCAGACAGTA 27 Oligo 92-1 CM53637 GGGGCTGTCAGAGGCATCCTCTAGTC 28 Oligo 321 CM53637 AGCCACTACACCTGTCACGAGAAG 29 Oligo 250 NADL CACCATGAAAATAGTGCCCAAAGAATC NADL-C C terminus 30 Oligo 252 NADL TTAAGCGTATGCTCCAAACCACGTC NADL-E.sup.rns C terminus

[0130] Plasmid containing the full length cDNA of BVDV-NADL was extracted from dam-E. coli K12 GM2163. The plasmid was methylated in vitro with dam methyltransferase and S-adenosylmethionine (New England Biolabs; Ipswich, Mass.). G-E.sup.rns, R-E.sup.rns, and P-E.sup.rns genes (GenBank accession numbers NC_003678, NC_003677, and AY781152, respectively) were synthesized and cloned into a cloning vector.

[0131] For construction of chimeric BVDV-NADL/G-E.sup.rns DNA, a fragment of BVDV-NADL encoding for the 5'UTR to the 3' end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 127. The G-E.sup.rns gene was amplified by PCR from the plasmid DNA containing the G-E.sup.rns gene with Oligo 128 and Oligo 129. A BVDV fragment encoding for E1 to the 3'UTR was amplified by PCR from methylated plasmid with Oligo 130 and Oligo 84. The PCR products were gel purified using QIAquick Gel Extraction Kit (Qiagen; Valencia, Calif.). The purified PCR products were treated with Dpn I and Exonuclease 1 (New England Biolabs). The treated PCR products were assembled to create a full length chimeric BVDV-NADL/G-E.sup.rns genome by PCR using Oligo B-5 and Oligo 84.

[0132] For construction of chimeric BVDV-NADL/R-E.sup.rns DNA, a fragment of BVDV-NADL encoding for the 5'UTR to the 3' end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 131. The R-E.sup.rns gene was amplified by PCR from the plasmid containing R-E.sup.rns gene with Oligo 132 and Oligo 133. A BVDV fragment encoding for E1 to the 3'UTR was amplified by PCR from methylated plasmid with Oligo 134 and Oligo 84. The PCR products were gel purified with QIAquick Gel Extraction Kit. The purified PCR products were treated with Dpn I and Exonuclease 1. The treated PCR products were assembled to create a full length chimeric BVDV-NADL/R-E.sup.rns genome by PCR with Oligo B-5 and Oligo 84.

[0133] For construction of chimeric BVDV-NADL/P-E.sup.rns DNA, a fragment of BVDV-NADL encoding for the 5'UTR to the 3' end of C gene was amplified by PCR from methylated plasmid with primers Oligo B-5 and Oligo 135. The P-E.sup.rns gene was amplified by PCR from the plasmid DNA containing P-E.sup.rns gene with Oligo 136 and Oligo 137. A BVDV fragment encoding for E1 to the 3'UTR was amplified by PCR from methylated plasmid with Oligo 138 and Oligo 84. The PCR products were gel purified with QIAquick Gel Extraction Kit. The purified PCR products were treated with Dpn I and Exonuclease 1. The treated PCR products were assembled to create a full length chimeric BVDV-NADL/P-E.sup.rns genome by PCR with Oligo B-5 and Oligo 84.

[0134] For sequence confirmation of the chimeric E.sup.rns regions, a fragment corresponding to the 5' UTR to the E1 region of each assembled full length chimeric genome was amplified by PCR using Oligo B-5 and Oligo 175, and the PCR products were sequenced and analyzed.

[0135] Full length viral genomic RNA transcripts were generated from plasmid containing the full-length cDNA of BVDV-NADL or chimeric BVDV-NADL/E.sup.rns DNAs using mMessage mMachine T7 Ultra kit (Ambion; Austin, Tex.). Quality and quantity of each RNA transcript was determined on an RNA gel and a Nanodrop spectrophotometer (Nanodrop; Wilmington, Del.). Overnight cultures of RD cells in wells of 6-well plates were transfected with viral RNA using Lipofectin reagent (Invitrogen) according to the manufacturer's instructions. Following transfection, the cells were incubated at 37.degree. C. for 3 days. The supernatants were harvested and stored at -80.degree. C.

[0136] Viral RNAs from harvested supernatants were extracted using MagMax.TM. AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed and the region of each chimera encoding N.sup.pro to E1 was amplified using primers Oligo 177 and Oligo 175 (Table 1), and the ThermoScript.TM. RT-PCR System (Invitrogen) according to the manufacturer's instructions. The RT-PCR products were then sequenced.

[0137] Cell monolayers from either a viral RNA transfection or virus infection were fixed in 80% acetone. BVDV- or BDV-specific monoclonal antibodies (Mabs) were used in conjunction with the anti-mouse IgG peroxidase ABC Elite kit (Vector Laboratories; Burlingame, Calif.). Color was developed using VIP peroxidase substrate (Vector Laboratories).

[0138] Chimeric virus titers were determined by a limiting dilution method. Viral samples were 10-fold serially diluted and transferred to 96-well plates (100 .mu.l per well), with 4-6 replicates per dilution. 100 .mu.l of a suspension of BK-6 cells were then added to each well, and the plates incubated at 37.degree. C. for 4-5 days. Virus infection was determined by both cytopathic effect (CPE) and MAb staining. Virus titers were calculated using the Spearman-Karber method.

[0139] To obtain the biological clones of each chimera, virus samples were first diluted 100-fold and followed by a 10-fold dilution series. 100 .mu.l of the diluted viruses were transferred to each well of a 96 well plate, 4 replicates per dilution. 100 .mu.l of BK-6 cells were then added to each well, and the plates incubated at 37.degree. C. for 4 days. The supernatants were harvested and transferred to new plates and stored at -80.degree. C. The cells were fixed and stained. The supernatants from wells containing single virus foci were harvested and expanded as virus stocks.

[0140] Growth kinetics studies were carried out in T-25 flasks containing BK-6 cells. When the cells reached approximately 90% confluency, they were infected with each chimera at MOI of 0.02. After adsorption for 1 hr, the inoculum was removed. Cells were washed 3.times. with PBS, and 3 ml of fresh growth medium was then added. Samples were then collected at various time points from 0 to 144 hrs for titer determinations.

[0141] For the virus neutralization test, frozen stocks of the three BVDV-NADL/E.sup.rns chimeras, parental BVDV-NADL, and BVDV-CM5960 (BVDV type I) were diluted in DMEM to about 4,000 TCID.sub.50/ml. Sera from cattle immunized with Bovi-Shield Gold (Pfizer; New York, N.Y.), with pre-determined titers against both BVDV type I and II, were 2-fold serially diluted with DMEM. 50 .mu.l of virus (200 TCID.sub.50) were mixed with an equal volume of diluted cattle serum in 96-well tissue culture plates (4 replicates/dilution), and incubated at 37.degree. C. for 60 min. 100 .mu.l of BK-6 cells were then added to each well, and the plates were incubated at 37.degree. C. for 3-6 days. Serum negative for BVDV antibodies was also included in each plate as a control. End point neutralization titers of the sera were determined by both CPE and by immunohistochemistry (IHC) at day 3 and day 6.

[0142] Results. Chimeric BVDV-NADL/E.sup.rns DNAs in which the NADL E.sup.rns gene/protein was replaced by E.sup.rns of giraffe (G-E.sup.rns), reindeer (R-E.sup.rns) or pronghorn antelope (P-E.sup.rns) pestivirus, were constructed. Plasmid DNA containing each of the chimeric E.sup.rns regions was sequenced to confirm sequence authenticity. The following chimeric pestiviruses were deposited with the American Type Culture Collection (ATCC.RTM.), 10801 University Blvd., Manassas, Va., 20110, USA on Apr. 2, 2009, and confirmed viable by the ATCC.RTM. on Apr. 23, 2009: BVDV-NADL/G-E.sup.rns (PTA-9938), BVDV-NADL/P-E.sup.rns (PTA-9939), and BVDV-NADL/R-E.sup.rns (PTA-9940).

[0143] BVDV-NADL/E.sup.rns chimeric viruses were rescued from RD cells after transfection with in vitro-transcribed viral RNA. Extensive cytopathic effect (CPE) in RD cells was observed 48-72 hours after transfection with BVDV-NADL/G-E.sup.rns or BVDV-NADL/R-E.sup.rns RNA transcripts. CPE was not obvious with the BVDV-NADL/P-E.sup.rns virus, however. Culture supernatants were harvested from each well, and the remaining cells were fixed and stained with BVDV NS3-specific MAb antibody 20.10.6. Cells infected with one of the three chimeric pestiviruses were incubated with the MAb. Viral RNAs were extracted from the harvested supernatants, and sequenced to confirm the E.sup.rns genes of all three chimeras.

[0144] The three BVDV-NADL/E.sup.rns chimeras were tested for their reactivity to each of several E.sup.rns MAbs specific for BVDV or BDV. The results are shown in Table 2. The BVDV-NADL/R-E.sup.rns chimera reacted to all three BDV E.sup.rns Mabs, while neither BVDV-NADL/G-E.sup.rns, BVDV-NADL/P-E.sup.rns nor BVDV-NADL parental virus were recognized by BDV E.sup.rns MAbs. BVDV-NADL/G-E.sup.rns BVDV-NADL/R-E.sup.rns, and NADL parental virus reacted to a pan-BVDV E.sup.rns MAb 15C5. MAbs specific to either E.sup.rns of BDV or BVDV did not react with the BVDV-NADL/P-E.sup.rns chimera.

TABLE-US-00002 TABLE 2 Reactivity of BVDV-NADL/E.sup.rns chimeras to MAbs Chimera reactivity BVDV- BVDV- BVDV- NADL/ NADL/ NADL/ BVDV- MAb Specificity G-E.sup.rns R-E.sup.rns P-E.sup.rns NADL WS 371 BDV E.sup.rns - +++ - - WS 373 BDV E.sup.rns - +++ - - WS 363 BDV E.sup.rns - +++ - - 15C5 BVDV E.sup.rns +++ +++ - +++ 20.10.6 Pestivirus +++ +++ ++ +++ NS3

[0145] In order to determine whether the chimeric E.sup.rns proteins in the viruses had any impact on the recognition of viral neutralizing epitopes by antibodies from BVDV-vaccinated cattle, a virus neutralization assay was performed with the three BVDV-NADL/E.sup.rns chimeras, BVDV-NADL, and BVDV-CM5960 (BVDV type I). Sera from 4 cows with neutralizing antibody titers ranging from 0 to greater than 40,000 (determined previously against BVDV-CM5960) were utilized. The results (Table 3) indicate that titers against all three chimeras were generally comparable to those for parental BVDV-NADL and BVDV-CM5960. The neutralization titers against BVDV-NADL/P-E.sup.rns were slightly lower than those against the other two chimeras, BVDV-NADL and BVDV-CM5960.

TABLE-US-00003 TABLE 3 Neutralization titers of bovine antisera against BVDV-NADL/E.sup.rns chimeras Neutralization titers BVDV- BVDV- BVDV- Cattle NADL/ NADL/ NADL/ BVDV- Sera # G-E.sup.rns R-E.sup.rns P-E.sup.rns NADL CM5960 816 <10 <10 <10 <10 <10 77 320 320 320 160 320 1281 6400 12800 3200 3200 25600 1434 51200 25600 6400 25600 51200

[0146] The three BVDV-NADL/E.sup.rns chimeras were biologically cloned two times by limiting dilution. Three clones of BVDV-NADL/G-E.sup.rns, four of BVDV-NADL/R-E.sup.rns, and three of BVDV-NADL/P-E.sup.rns were obtained. These clones were each expanded between 1-3 times. Titration results indicated that expanded BVDV-NADL/G-E.sup.rns clone 1, BVDV-NADL/R-E.sup.rns clones 3 and 5, and BVDV-NADL/P-E.sup.rns clone 2 yielded the highest titers.

[0147] Growth kinetics studies were performed with BVDV-NADL/G-E.sup.rns clone 1, BVDV-NADL/R-E.sup.rns clone 3, BVDV-NADL/P-E.sup.rns clone 2, and uncloned BVDV-NADL/P-E.sup.rns. Growth curves generated from these clones were compared to the parental BVDV-NADL. BVDV-NADL/G-E.sup.rns and BVDV-NADL/R-E.sup.rns chimeras had growth kinetics similar to the parental BVDV-NADL, while BVDV-NADL/P-E.sup.rns grew slower and had lower titers at each time point than the parental virus and other two chimeras.

[0148] Three BVDV-NADL/E.sup.rns chimeric viruses were created, in which the NADL E.sup.rns gene/protein was replaced by E.sup.rns of a giraffe, reindeer or pronghorn antelope pestivirus. All three chimeras were viable and infectious in both RD and BK-6 cells. In vitro data demonstrated that the chimeric E.sup.rns proteins did not affect neutralization of the chimeras by antisera from BVDV-vaccinated cattle. This suggests that neutralizing epitopes on the chimeric viruses, regardless of where they are located, were not affected by the E.sup.rns substitutions.

[0149] The chimeric viruses had different growth kinetics and reacted differently to BVDV or BDV E.sup.rns monoclonal antibodies. BVDV-NADL/G-E.sup.rns and BVDV-NADL/R-E.sup.rns had similar growth kinetics to the parental virus, while BVDV-NADL/P-E.sup.rns grew slower and to a lower titer than the parental virus. Both BVDV-NADL/G-E.sup.rns and BVDV-NADL/R-E.sup.rns reacted to BVDV E.sup.rns monoclonal antibody 15C5, while BVDV-NADL/P-E.sup.rns did not. Sequence comparison results showed that G-E.sup.rns and R-E.sup.rns had higher sequence similarities to BVDV NADL (75.8% and 76.2%, respectively) than P-E.sup.rns(59%). These data, taken together with the MAb reactivity results, suggest that G-E.sup.rns and R-E.sup.rns may be antigenically more similar to the parental E.sup.rns than P-E.sup.rns.

Example 2. Construction and Serological Characterization and Efficacy Testing of Chimeric Pestivirus Vaccine Candidates

[0150] Type 1 BVDV strain CM5960 and Type 2 BVDV strain CM53637 were obtained from Pfizer Global Manufacturing. The viral RNAs were extracted using MagMax.TM. AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed to generate cDNAs using ThermoScript.TM. RT-PCR System (Invitrogen) according to the manufacturer's instructions. Chimeric pestiviruses were generated by replacing the E.sup.rns gene of CM5960 and CM53637 with the E.sup.rns gene of pronghorn antelope pestivirus (P-E.sup.rns) using an overlapping PCR method. The oligonucleotide primers used for PCRs are listed in Table 1.

[0151] For construction of chimeric CM5960/P-E.sup.rns DNA, a fragment of CM5960 cDNA between the 5'UTR and the 3' end of C gene was amplified by PCR from CM5960 cDNA with primers Oligo B-5 and Oligo 135. The P-E.sup.rns gene was amplified by PCR from the plasmid DNA containing P-E.sup.rns gene with Oligo 136 and Oligo 137. A third fragment between the beginning of E1 and the 3' end of E2 was amplified by PCR from CM5960 cDNA with primers Oligo 138 and Oligo 237.

[0152] The above-described fragments were gel purified using a QIAquick Gel Extraction Kit (Qiagen), and assembled by PCR to create one fragment with Oligo B-5 and Oligo 237. A fragment between E1 region and NS5B region was amplified by PCR from CM5960 cDNAs with primers Oligo P7 and Oligo P8. Another fragment between NS5A region and the end of 3'UTR was amplified by PCR from CM5960 cDNAs with primers Oligo P3 and Oligo 84. These three fragments were then gel purified, and assembled by PCR with Oligo B-5 and Oligo 84 to create a full length chimeric CM5960L/P-E.sup.rns genome.

[0153] For construction of chimeric CM53637/P-E.sup.rns DNA, a fragment of CM53637 cDNA between the 5'UTR and the 3' end of C gene was amplified by PCR from CM53637 cDNA with primers Oligo 296-1 and Oligo 297. A second fragment between the beginning of E1 and the 3' end of E2 was amplified by PCR from CM53637 cDNA with primers Oligo 298 and Oligo 303. These two fragments were gel purified, and together with a fragment encoding for the P-E.sup.rns gene (see above), were assembled by PCR to create one fragment using Oligo 296-1 and Oligo 303.

[0154] A fragment between E1 region and NS3 region was then amplified by PCR from CM53637 cDNA with primers Oligo 298 and Oligo 299. Another fragment between NS3 region and the end of 3'UTR was also amplified by PCR from CM53637 cDNA with primers Oligo 300 and Oligo 92-1. These two fragments and the one above were gel purified, and assembled by PCR with Oligo 296-1 and Oligo 92-1 to create a full length chimeric CM53637/P-E.sup.rns genome.

[0155] Full length viral genomic RNA transcripts were generated from chimeric CM5960/P-E.sup.rns and chimeric CM53637/P-E.sup.rns DNAs using mMessage mMachine T7 Ultra kit (Ambion). Quality and quantity of each RNA transcript was determined on an RNA gel. Overnight cultures of RD cells in wells of 6-well plates were transfected with viral RNA using Lipofectin reagent (Invitrogen) according to the manufacturer's instructions. Following transfection, the cells were incubated at 37.degree. C. for 3 days. The cells plus the supernatants were passed one to several times in RD and/or BK-6 cells. The supernatants were then serially passed in BK-6 cells. The supernatants were harvested and stored at -80.degree. C.

[0156] To confirm the identity of rescued recombinant virus, viral RNAs from harvested supernatants were extracted using MagMax.TM. AI/ND Viral RNA Isolation Kit (Ambion) according to the manufacturer's instructions. The RNAs were reverse transcribed using ThermoScript.TM. RT-PCR System (Invitrogen) according to the manufacturer's instructions and the region of each chimera between 5' UTR and E2 or p7 was amplified by PCR using primers Oligo B-5 and Oligo 237 (for CM5960/P-E.sup.rns chimera) or Oligo 296-1 and Oligo 321 (for CM53637/P-E.sup.rns chimera) (Table 1), The RT-PCR products were then sequenced.

[0157] Cell monolayers from either a viral RNA transfection or virus infection were fixed in 80% acetone. BVDV specific MAbs were used in conjunction with the anti-mouse IgG peroxidase ABC Elite kit (Vector Laboratories) for immunohistochemistry. Color was developed using VIP peroxidase substrate (Vector Laboratories).

Results.

[0158] Chimeric CM5960/P-E.sup.rns and CM53637/P-E.sup.rns viruses were constructed and rescued. The 5'UTR to E2 regions, including the chimeric pronghorn-E.sup.rns regions, were confirmed by sequencing. Both chimeras were viable and infectious in both RD and BK-6 cells. Both chimeras were not reactive to BVDV E.sup.rns specific MAb 15C5, but reactive to BVDV NS3 specific MAb 20.10.6 in immunohistochemistry staining.

[0159] The sequence for the chimeric pestivirus (BVDV-CM5960 (BVDV type I)/P-E.sup.rns) is presented in the sequence listing as SEQ ID NO: 31. The sequence for the chimeric pestivirus (BVDV-CM53637 (BVDV type II)/P-E.sup.rns) is presented in the sequence listing as SEQ ID NO: 32.

[0160] The CM5960/P-E.sup.rns chimera was biologically cloned by limited dilution (see above Example 1 for methodology).

Example 3. Efficacy Testing of Chimeric Pestivirus Vaccine Candidates in a Calf Respiratory Disease Model

[0161] BVDV negative healthy calves are obtained, randomly assigned to study groups, and maintained under supervision of an attending veterinarian. The test vaccine is combined with a sterile adjuvant, and administered by either intramuscular (IM) or subcutaneous (SC) injection, or by intranasal (IN) inoculation. The vaccine is given either as one or two doses. Two doses of vaccine are administered, 21 to 28 days apart. The animals are subsequently challenged at 21 to 28 days following the final vaccination with a Type 1 or Type 2 strain of BVDV. Challenge inoculum is given intranasally in a 4 ml divided dose, 2 ml per nostril. Control groups consisting of unvaccinated, unchallenged animals and/or unvaccinated, challenged animals are also maintained throughout the study.

[0162] Clinical parameters are monitored daily, including rectal temperature, depression, anorexia, and diarrhea. Serum neutralization titers are determined by a constant-virus, decreasing-serum assay in bovine cell culture, using serial dilutions of serum combined with a BVDV Type 1 or 2 strain. Post-challenge isolation of BVDV in bovine cell culture is attempted from peripheral blood. A BVDV-positive cell culture is determined by indirect immunofluorescence. To demonstrate protection following challenge, a reduction in incidence of infection is demonstrated in vaccinated groups versus the control groups.

Example 4. Chimeric Pestivirus Vaccine Efficacy Testing in a Pregnant Cow-Calf Model

[0163] BVDV-negative cows and heifers of breeding age are obtained and randomly assigned to a vaccination test group or a placebo (control) group. Cows are inoculated twice by intramuscular (IM) or subcutaneous (SC) injection, with either vaccine or placebo, 21 to 28 days apart. Following the second vaccination, all cows receive an IM prostaglandin injection to synchronize estrus. Cows displaying estrus are bred by artificial insemination with certified BVDV-negative semen. At approximately 60 days of gestation, the pregnancy status of cows is determined by rectal palpation.

[0164] Approximately 6 weeks later, cows with confirmed pregnancies are randomly selected from each test group. Each of these cows is challenged by intranasal inoculation of BVDV Type 1 or 2. Blood samples are collected on the day of challenge and at multiple postchallenge intervals for purposes of BVDV isolation.

[0165] Twenty-eight days after challenge, left flank laparotomies are performed and amniotic fluid is extracted from each cow. Immediately prior to surgery, a blood sample is collected from each cow for serum neutralization assays. Following caesarian delivery, a blood sample is collected from each fetus. Fetuses are then euthanized, and tissues are aseptically collected for purposes of BVDV isolation. In cases where spontaneous abortions occur, blood samples are taken from the dam when abortion is detected and two weeks later. The paired blood samples and aborted fetuses are subjected to serologic testing and virus isolation. Vaccine efficacy is demonstrated by a lack or decrease of fetal infection and late-term abortion.

Example 5. Diagnostic Assays for Differentiation Between Vaccinated and Naturally Infected Cattle

[0166] Cattle vaccinated with a vaccine of the present invention can be compared with cattle naturally infected with a wild type BVDV. Cattle of various ages are vaccinated with either a live or inactivated chimeric pestivirus vaccine according to instructions provided. Serum samples are collected 2-3 weeks or later following vaccination. To differentiate between cattle which received the chimeric pestivirus vaccine versus those infected by a field (wild-type) strain of BVDV, serum samples are tested via a differential diagnostic assay. The chimeric pestivirus elicits the production of specific antibodies which bind to the E.sup.rns protein of the chimeric pestivirus, but not to the E.sup.rns protein present on wild-type BVDV. In the context of wild-type BVDV, the opposite is true. Specific antibodies are generated which recognize the E.sup.rns protein present on wild-type BVDV, but not the E.sup.rns protein present on the chimeric pestivirus. Methods of assaying for antibody binding specificity and affinity are well known in the art, and include but are not limited to immunoassay formats such as competitive ELISA, direct peptide ELISA, Western blots, indirect immunofluorescent assays, and the like.

[0167] For a competitive ELISA, whole or partial wild-type or chimeric pestivirus viral antigens, including the E.sup.rns protein (naturally, synthetically or recombinantly derived), are used as an antigen source. Following coating of the ELISA plate with antigen under alkaline conditions, cattle serum samples and dilutions are added together with an optimized dilution of a MAb specific for either E.sup.rns protein of the wild type BVDV or the E.sup.rns protein of the chimeric pestivirus, and incubated for 30-90 min. Either horseradish peroxidase or alkaline phosphatase is conjugated to the MAb to allow for colorimetric detection of binding. Following washing of the plates, an enzyme-specific chromogenic substrate is added, and after a final incubation step, the optical density of each well is measured at a wavelength appropriate for the substrate used. The degree of inhibition of binding of the labeled mAb is dependent on the level of antibodies in the cattle serum that specifically recognize the protein coating the plate.

[0168] In the case of chimeric E.sup.rns protein (e.g. pronghorn E.sup.rns) present on the chimeric pestivirus being the test antigen, a lack of binding by the chimeric pestivirus E.sup.rns-specific mAb indicates the presence of antibodies in the cattle serum that recognize the chimeric pestivirus-specific epitope, indicative of vaccination. In contrast, serum from cattle not immunized, but naturally infected, will not contain antibodies which will bind to the chimeric pestivirus E.sup.rns protein coating the plate. Therefore, the chimeric pestivirus E.sup.rns-specific mAb will bind to the bound protein, and result in subsequent color development.

[0169] In the case of E.sup.rns protein present on wild-type BVDV being the test antigen, a lack of binding by the wild type BVDV E.sup.rns-specific mAb indicates the presence of antibodies in the cattle serum that recognize the wild-type BVDV-specific epitope, indicative of a natural (wild-type) infection. In contrast, serum from cattle immunized with the chimeric pestivirus vaccine will not contain antibodies which will bind to the wild-type BVDV E.sup.rns protein coating the plate. Therefore, the wild type BVDV E.sup.rns-specific mAb will bind to the bound protein, and result in subsequent color development.

[0170] For development of such an assay, the following methods were carried out. First, a recombinant baculovirus expressing BVDV-NADL E.sup.rns was constructed. A portion of the C protein of BVDV, plus the full length E.sup.rns gene, were amplified by PCR from a plasmid containing full length of BVDV-NADL cDNA with primers Oligo 250 (SEQ ID NO: 29; 5'-CACCATGAAAATAGTGCCCAAAGAATC-3') and Oligo 252 (SEQ ID NO: 30; 5'-TTAAGCGTATGCTCCAAACCACGTC-3'). The PCR product was cloned into pENTR.TM./D-TOPO (Invitrogen) and transformed into One Shot.RTM. Competent E. coli (Invitrogen) according to the manufacturer's instructions. The recombinant plasmid was extracted and the insert was confirmed by sequencing. This plasmid was designated pENTR-E.sup.rns. pENTR-E.sup.rns and BaculoDirect.TM. Baculovirus Expression System (Invitrogen) were used to construct recombinant baculovirus expressing BVDV-NADL E.sup.rns according to the manufacturer's instructions. The recombinant baculovirus expressing BVDV-NADL E.sup.rns was generated, plaque purified, expanded, and stored at both 4.degree. C. and -80.degree. C. The expression of BVDV-NADL E.sup.rns in the recombinant baculovirus was confirmed by immunofluorescent staining and Western blotting against BVDV E.sup.rns specific MAb 15C5 following conventional Western Blot methods.

[0171] For production of the ELISA antigen, SF21 cells in 100 ml suspension culture were infected with 0.5 ml of the recombinant baculovirus stock. The cells were harvested after 4 days incubation at 27.degree. C. The cells were centrifuged at low speed (about 800 g) for 10 min to collect the cells and washed once with PBS. The cells were lysed with 150 mM NaCl, 50 mM Tris HCl pH 8.0, and 1% IGEPAL CA-630. The mixture was first incubated on ice for 10 minutes and then at -80.degree. C. for 1 hour. After thawing, the mixture was clarified by centrifugation at 1000 g for 15 minutes. The supernatant was further clarified by centrifuge at 8000 g for 20 minutes at 4.degree. C. The final supernatant, designated Baculo-E.sup.rns lysate, was aliquoted and stored at -80.degree. C.

[0172] In carrying out the assay, the ELISA plates were coated overnight at 4.degree. C. with 100 .mu.l/well of MAb WB210 (Veterinary Laboratory Agency; Type 1 BVDV E.sup.rns specific), diluted 1:1000 in carbonate/bicarbonate buffer (pH 9.0). The next day, the plates were washed three times and blocked with blocking buffer (PBS containing 1% casein sodium salt and 0.05% Tween 20) at 37.degree. C. for 1 hour. The plates were subsequently washed three times with blocking buffer, and 100 .mu.l of Baculo-E.sup.rns lysate (1:3200 diluted in PBS) was added to each well, and the plates were incubated at 37.degree. C. for 1 hour. Following three washes with blocking buffer, 100 .mu.l of undiluted cattle serum samples were added to the wells, except for one column of wells (to serve as non-competing 15C5-HRP controls), and incubated at 37.degree. C. for 1 hour. Following three more washes with blocking buffer, 100 .mu.l of MAb 15C5-HRP conjugate (BVDV E.sup.rns specific, 1:20,000 diluted in blocking buffer) was added to each well, and incubated at 37.degree. C. for 1 hour. Following three washes with blocking buffer, 100 .mu.ll of ABTS substrate (Peroxidase substrate solutions A+B; KPL, USA) was added to each well, and incubated at room temperature for 20-60 minutes for color development. The optical density (OD) was measured at the wavelength of 405 nm. The percentage of OD reduction for each serum sample is calculated by following formula:

[1-(OD of Sample/Mean OD of 15C5-HRP Controls)].times.100%.

Results:

[0173] All of the serum samples that tested positive by the virus neutralization (VN) test had over 82% O.D. reduction, except sample ID#13851 (Table 4). All of the serum samples that tested negative by the virus neutralization test had less than 17% O.D. reduction, except sample ID#5150 (Table 4). The discrepancy might be explained by the differences in how the assays are carried out, as they are measuring different antibodies, and the proportion of specific antibodies varies among animals.

TABLE-US-00004 TABLE 4 BVDV positive and negative serum samples in a MAb15C5 competition ELISA. O.D. of Average O.D. of Row # Sample ID Sample No Serum Column % Reduction 1 40021 0.0615 0.907013 93.21950182 2 40014 0.0965 0.907013 89.36068171 3 40422 0.0639 0.907013 92.95489701 4 40372 0.0754 0.907013 91.68699897 5 40222 0.0634 0.907013 93.01002301 6 40152 0.0894 0.907013 90.14347093 7 13461 0.0663 0.907013 92.6902922 8 13851 0.641 0.907013 29.32846607 9 13801 0.1599 0.907013 82.37070472 10 13904 0.073 0.907013 91.95160378 11 40504 0.0625 0.907013 93.10924981 12 40471 0.0914 0.907013 89.92296693 13 35037 0.0639 0.907013 92.95489701 14 13690 0.159 0.907013 82.46993152 15 13797 0.0859 0.907013 90.52935294 16 6127 0.0886 0.907013 90.23167253 17 5138 0.7434 0.907013 18.03866097 18 5139 0.8423 0.907013 7.13473787 19 5141 0.7732 0.907013 14.75315128 20 5142 0.7475 0.907013 17.58662776 21 5144 0.8293 0.907013 8.568013909 22 5145 0.9488 0.907013 -4.607100449 23 5146 0.9451 0.907013 -4.199168038 24 5147 1.0138 0.907013 -11.77348064 25 5148 0.9322 0.907013 -2.7769172 26 5149 0.9794 0.907013 -7.980811741 27 5150 0.1157 0.907013 87.24384325 Rows 1-16: Positive cattle serum samples Rows 17-27: Negative cattle serum samples All serum samples are used undiluted in the ELISA

[0174] Although the present invention has been described in considerable detail with reference to certain versions thereof, other versions are possible. Therefore, the scope of the appended claims should not be limited to the description of the versions contained herein.

Sequence CWU 1

1

32143DNAArtificial SequenceT7 + NADL 1gtgttaatac gactcactat agtatacgag aattagaaaa ggc 43221DNAPestivirusmisc_featureNADL 2gggggctgtt agaggtcttc c 21347DNAArtificial SequenceG-Erns+NADL 3aattccactg ggtgatgttc tctcccattg taacttgaaa caaaact 47420DNAPestivirusmisc_featureG-Erns 4gagaacatca cccagtggaa 20521DNAPestivirusmisc_featureG-Erns 5tgcgtgggct ccaaaccatg t 21644DNAArtificial SequenceG-Erns+NADL 6aacatggttt ggagcccacg cagcttcccc ttactgtgat gtcg 44747DNAArtificial SequenceR-Erns+NADL 7ggttccactg tgttatattc tctcccattg taacttgaaa caaaact 47822DNAPestivirusmisc_featureR-Erns 8gagaatataa cacagtggaa cc 22922DNAPestivirusmisc_featureR-Erns 9tgcattagct ccgaaccacg tt 221044DNAArtificial SequenceR-Erns+NADL 10aacgtggttc ggagctaatg cagcttcccc ttactgtgat gtcg 441142DNAArtificial SequenceP-Erns+NADL 11ggttccactg agttatattc actcccattg taacttgaaa ca 421222DNAPestivirusmisc_featureP-Erns 12gtgaatataa ctcagtggaa cc 221321DNAPestivirusmisc_featureP-Erns 13tgcctgtgcc ccaaaccatg t 211444DNAArtificial SequenceP-Erns+NADL 14aacatggttt ggggcacagg cagcttcccc ttactgtgat gtcg 441523DNAPestivirusmisc_featureNADL 15gttatcaata gtagccacag aat 231622DNAPestivirusmisc_featureNADL 16tccaccctca atcgacgcta aa 221722DNAPestivirusmisc_featureCM5960 17ccctgaggcc ttctgttctg at 221823DNAPestivirusmisc_featureCM5960 18cacttgtcgg aggtactact act 231924DNAPestivirusmisc_featureCM5960 19cttgtctatc ttatctctta ttgc 242022DNAPestivirusmisc_featureCM5960 20actatctgaa cagttggaca gg 222141DNAArtificial SequenceT7+CM53637 21gtgttaatac gactcactat agtatacgag attagctaaa g 412248DNAArtificial SequenceP-Erns+CM53637 22ccaggttcca ctgagttata ttcactcctg ttaccagctg aagcagaa 482343DNAArtificial SequenceP-Erns+CM53637 23aacatggttt ggggcacagg cagcaagtcc atactgtaaa gtg 432427DNAPestivirusmisc_featureCM53637 24ttaatgccct ccctgtctct accacct 272525DNAPestivirusmisc_featureCM53637 25aggatgagga tctagcagtg gatct 252624DNAPestivirusmisc_featureCM53637 26ccatagccat ctgctcagac agta 242726DNAPestivirusmisc_featureCM53637 27ggggctgtca gaggcatcct ctagtc 262824DNAPestivirusmisc_featureCM53637 28agccactaca cctgtcacga gaag 242927DNAArtificial SequenceNADL 29caccatgaaa atagtgccca aagaatc 273025DNAArtificial SequenceNADL 30ttaagcgtat gctccaaacc acgtc 253112307DNAArtificial SequenceErns chimeric virus 31gtatacgaga attagaaaag gctctcgtat acgtattggg caattaaaat aataattagg 60cctagggaac aaaagtcccc ctcagcgaag gccgaaaaga ggctagccat gcccttagta 120ggactagcat aaagaggggg gtagcagcag tggtgagttc gttggatggc ttaagccctg 180agtacagggt agtcgtcagt ggttcgacgc cttggaataa aggtctcgag atgccacgtg 240gacgagggca tgcccaaagc acatcttaac ctgagcgggg gtcgcccagg taaaagcagt 300tctaaccgac tgttacgaat acagcctgat agggtgctgc agaggccttc tgttctgcta 360ctaaaaatct ctgctgtaca tggcacatgg agttgatcac aaatgaactt ttatacaaaa 420cttacaaaca aaaacccgtc agggtggaag aacctgttta tgatcaggca ggtgatccct 480tatttggtga aaggggagca gtccaccctc aatcgacgtt aaagctccca cacaagagag 540gggaatgcga tgtacccatc aacttggcat ctttaccaaa aaggggtgac tgcaggtcgg 600gtaatagcag aggacctgtg agcgggatct acttgaagcc agggccacta ttttaccagg 660actataaggg tcccgtctat cacagggccc cgctggagct ctttgaagag ggaaccatgt 720gtgaaacgac taaacggata gggagagtaa ctggaagtga cggaaagttg taccacattt 780atgtgtgtat agatggatgt ataataataa aaagtgccac aagaagtcac caaagggtgc 840ttaggtgggt ccataatagg cttaactgcc ctctatgggt cacaagttgc tcagacacga 900aagaagaggg agcaacaaaa aagaaaacac agaaacccga cagactagag aaggggaaga 960tgaaaatagt gcccagagaa tccgaaaaag acagcaaaac taaacctccg gatgctacaa 1020tagtggtaga tggagttaaa taccaggtga agaagaaggg aaaaatcaag agtaagaaca 1080ctcaggacgg cttgtaccat aacaaaaaca aaccgccgga atcacgtaag aaactggaaa 1140aagcattgct ggcatgggca ataataacta tagttttgtt tcaagttaca atgggagtga 1200atataactca gtggaacctg gctgacgaag gcaccgaagg cgtacatagg gtcatgtttg 1260agagagggat aaatagaagt ttacatggca tatggcccca acagatatgc cacggaatcc 1320caagctacaa ccccaccaac agagagctct cgatgattgt cggaatggtt gatgcaagca 1380ttagaacaaa ttatacctgc tgtaatctac agagacacga atggaacaaa catggctggt 1440gcaattggta caacatcata ccatggatta aggtgatgaa ctacagccag aggaacctca 1500ctgaaggcac atatggcaaa gagtgtgccg taacgtgtag gcacgacagc atattagaca 1560tcaatatagt cactcaggcc cgcaatcaac ccacaatgtt aaccgggtgc aaaataggaa 1620agaacttttc gttctcaggt gaaattagag aaaaaccatg taattatgat atccaaccag 1680aggaaatact acatttgcca cacgaatgtg gggagtggta tagtgaaata agccaccagg 1740cggtcgacat gatcactaat gggttggagg cctctagaaa ttcagcagcc aaagtcttga 1800gttggatagg gcgcaaattg gaaaggatag gaaagagagc acaagcaaaa tcaaaaacat 1860ggtttggggc acaggcagct tccccctact gtgatgtcga tcgaaagatt ggctacatat 1920ggtatacaaa aaattgtacc cctgcctgct tgcccaagaa cacaaaaatt gtcggccctg 1980ggaagtttga caccaacgca gaggacggca agatactaca tgagatgggg ggccacttgt 2040cggaggtact actactttct ttagtggtgc tgtccgactt cgcaccggaa acagccagcg 2100caatgtacct aatcctacat ttttccatcc cacaaagtca cgttgacata atggaatgtg 2160ataagaccca gttgaacctc acagtggagc ttacaacagc tgatgtaata ccaggatcag 2220tctggaacct aggcaagtgg gtatgtataa gaccaaattg gtggccttat gagacaactg 2280tggtgttggc atttgaagag gtgagccagg tggtgaagtt agtgttgagg gcactcagag 2340atttgacacg catttggaac gctgcaacaa ctactgcttt cttaatatgc cttgttaaga 2400tagtcagggg ccagatggta cagggcattc tgtggctact actgataaca ggggtacaag 2460gggacttgca ttgcaaacct gaattctcat atgccatagc aagggatgaa agaattggtc 2520aactgggggc tgaaggcctt actaccactt ggaaggatta ctcgcctgaa atgaaactgg 2580aagacacaat ggtcatagct tggtgcaaag atggtaagtt tacgtacctc ccaaggtgca 2640cgagagaaac cagatatctc gcgatcttgc atacaagggc cttaccgacc agtgtggtat 2700tcaaaaaact ttttgatggg cgaaagcaag aggatgtagt cgaaatggac gacaactttg 2760aatttggact ctgcccatgt gatgccaaac ccatagtaag agggaaattc aatacaacgc 2820tgctgaacgg accggccttc cagatggtat gccccatagg atggacaggg actgtaagct 2880gtatgtcatt caatatggac accttagcca caaccgtgat acggacatat agaaggtcca 2940aaccatttcc tcataggcaa ggctgtatca cccaaaagac tctgggggag gatctccata 3000actgcatcct cggaggaaat tggacttgtg tgcctggaga cgtgctatta tacaaagggg 3060gctctattga atcctgcaag tggtgtggtt atcaatttaa agagagcgag ggactaccac 3120actaccccat tggcaagtgt agattagaga atgagactgg ttacagacta gtagacgata 3180cctcttgtaa tagagaaggt gtggccatag taccacaagg gacattacgg tgcaagatag 3240gaaaaactac tatacaggtc atagctatgg ataccaaact cgggcctatg ccttgcagac 3300catatgaaat aatatcaagt gaggggcctg tagaaaggac agcgtgtacc ttcaactaca 3360ctaaaacatt aaaaaataag tattttgagc ccagagacag ctacttccag caatacatgc 3420taaaaggaga gtatcaatac tggtttgacc tggaggtaac cgaccatcac cgggattact 3480ttgccgagtc catattagtg gtggtggtag ccctcctggg tggcagatat gtactttggt 3540tactagttac atacatggtc ttatcagaac agaaggcctc agggactcag tatggagcag 3600gggaagtagt gatgatgggc aacttgctaa cccataatga cattgaagtg gtgacatact 3660tcttgctgtt gtacctactg ctgagggaag agagcgtaaa gaagtgggtc ttacttttat 3720accacatctt agtgtcacac ccaatcaaat ctgtaactgt gatcctattg atgattgggg 3780atgtggtaaa ggcagactca gggggccaag ggtactttgg gcaaatagac ctctgtttta 3840caatagttgt actaatcatc ataggtttaa tcatagccag gcgtgaccca actatagtgc 3900cactagtaac aataatggca gcactgaggg tcactggatt gacctaccag cctggagttg 3960acgtcgctat ggcagtcatg accataaccc tactgatggt tagctatgtg acagattact 4020ttagatataa aagatggtta cagtgcgttc tcagcctggt gtcaggggtg ttcttgataa 4080gaagcctaat gcacctaggt agaatagagg tgccagaggt aaccatccca aactggagac 4140cactaacttt aatactgtta tatttgatct caacaacaat tgtaacaatg tggaaggttg 4200acatcgctgg cttgttgttg caatgcctgc ctatcttatt actggccaca accttgtggg 4260ccgacttctt aaccctcata ctgatcctgc ctacctatga attggttaaa ttatactacc 4320tgaaaactgt taggactgat atagaaagaa gttggccagg ggggatagac tgtacaagag 4380ttgactccat ctacgacatt gatgagagtg gagagggcgt atatctcttt ccatcaaggc 4440agaaaggaca gaggagcttt tccatactct tgccccttgt caaagcaaca ctgataagtt 4500gcgtcagcag taaatggcag ctaatataca tgagttacct aactttggac tttatgtact 4560acatgcacag gaaagttata gaagagatat caggaggcac caacatgata tccaggttag 4620tagcggcact catagagctg aactggtcca tggaagaaga ggagagcaaa ggcctaaaga 4680agttttatct attatctgga aggttgagaa acctaataat aaaacataaa gtaagaaatg 4740agaccgtggc ttcttggtac ggggaggagg aagtctacgg tatgccaaag atcatgacaa 4800taatcaaggc cagtacgctg agtaagagca agcactgcat gatatgcact gtatgtgaga 4860gccgagagtg gaaaggcggc acctgcccaa aatgtggacg ccatgggaag ccgataatgt 4920gtgggatgtc gctagcggat tttgaagaaa gacactataa aagaatcttt ataagggaag 4980gtaactttga gggtcctttc aggcaagaat acaatggctt tgtacaatat accgctaggg 5040ggcaattact tgtgagaaac ttgcccgtac tggcaactaa agtaaaaatg ctcatggtag 5100gcaaccttgg agaagaaatt ggtgatctgg aacatcttgg gtggatccta agggggcctg 5160ccgtgtgtaa gaagatcaca gagcacgaaa aatgccacat caatatactg gataaactaa 5220ctgcattttt cgggatcatg ccgaggggga ctacacccag agccccggtg aggttcccta 5280cgagcttact aaaagtgagg aggggcctgg agactggctg ggcttacaca caccaaggtg 5340ggataagttc agtcgaccat gtaaccgccg gaaaagacct attggtctgt gacagcatgg 5400gacggactag agtggtttgc caaagcaaca acaggttgac cgatgagaca gaatatggcg 5460tcaagactga ctcaggatgc ccagacggtg ccagatgtta tgtgttaaat ccagaggctg 5520tcaacatatc aggatccaag ggggcagtcg tccacctcca aaagacaggt ggagaattca 5580cgtgtgtcac cgcatcaggc acaccggcct ttttcgacct aaaaaacttg aaaggatggt 5640caggattgcc tatattcgaa gcctccagcg ggagggtggt tggcagagtc aaagtaggga 5700agaatgaaga gtctaaacct acaaaaataa tgagtggaat ccagaccgtc tcaaagaaca 5760cagcagatct aactgagatg gtcaagaaga taaccagcat gaacagggga gacttcaagc 5820agattacttt ggcaacaggg gcaggaaaaa ccacagaact cccaaaagca gttatagagg 5880aaataggaag acacaagaga gtattagttc ttataccatt aagggcagcg gcagagtcag 5940tttaccagta tatgagatta aaacacccaa gcatctcttt taacctaagg ataggggaca 6000tgaaagaggg ggacatggca acggggataa cctatgcatc atacgggtac ttctgccaaa 6060tgccccaacc aaagctcaga gctgctatgg tagaatactc atacatattc ttagatgaat 6120accattgtgc cactcctgaa caactggcaa ttatcggaaa gatccacaga ttttcagaga 6180gtataagagt cgtcgccatg actgccacgc cggcagggtc ggtgaccaca acaggtcaaa 6240agcacccaat agaggaattc atagcccccg aggtaatgaa aggggaggat cttggtagtc 6300agttccttga tatagcaggg ttaaaaatac cagtggatga gatgaaaggt aatatgttgg 6360tttttgtacc cacgagaaac atggcagtag aggtggcaaa gaagctaaaa gctaagggct 6420ataattctgg atactattac agtggagagg atccagccaa tctgagagtt gtaacatcgc 6480agtctcccta tgtaatcgtg gccacaaatg ctattgaatc aggagtgaca ctaccagatt 6540tggacacggt tgtagacacg gggctgaaat gtgaaaagag ggtgagggta tcatcaaaga 6600tacccttcat cgtaacaggt cttaagagga tggccgtgac tgtgggtgag caggctcagc 6660gtaggggcag agtaggtaga atgaaacccg ggagatatta tagaagccag gaaacagcaa 6720ccgggtcaaa ggactaccac tatgacctct tgcaggcaca aagatacggg attgaggatg 6780gaatcaacgt aacgaagtcc tttagggaga tgaattacga ttggagccta tacgaggagg 6840acagcctact aataacccag ttggaaatac taaataatct actcatctca gaagacttgc 6900cagccgctgt taagaatata atggccagga cagatcaccc agagccaatc caacttgcat 6960acaacagcta tgaagtccag gtcccggtcc tgttcccaaa aataaggaat ggagaagtca 7020cagacaccta cgaaaattac tcgtttctaa acgccagaaa gttaggggag gatgtacccg 7080tgtatatcta tgccactgaa gatgaggatc tggcagttga cctcttaggg ctagactggc 7140cagatcctgg gaaccagcag gtagtggaga ctggcaaagc actgaagcaa gtgaccgggt 7200tgtcctcggc tgaaaatgcc ctactagtgg ctttatttgg gtacgtaggt tatcaggctc 7260tctcaaagag gcatgtccca atgataacag acatatatac catcgaggac cagagactag 7320aagacaccac ccacctccag tatgcaccca acgccataaa aaccgaaggg acagagactg 7380aactgaaaga actggcgtcg ggtgacgtgg aaaaaatcat gggagtcatt tcagattatg 7440cagccggggg actggagttt gtgaaatccc aagcagaaaa gataaaaaca gcacctttgt 7500ttaaagaaaa cgtagaagct gcaaaagggt acgtccaaaa attcattgac tcattaattg 7560aaaataaaga tgcaataatc agatatggtt tgtggggaac acacactgca ctatacaaaa 7620gcatagctgc aagactggga cacgaaacag cgtttgccac actggtgtta aaatggctag 7680cttttggagg ggaatcagtg ccagaccaca tcaagcagac ggcagttgat ttagtggtct 7740attatgtgat gaataagcct tccttcccag gcgacaccga aacacagcaa gaagggaggc 7800gattcgtcgc tagcctgttc atctccgcac tggcaaccta cacatacaaa acttggaatt 7860accacaatct ctctaaagtg gtggaaccag ccttggctta cctcccctat gctaccagcg 7920cattaaaaat gttcacccca acgcggctag agagcgtggt gatactgagc accacgatat 7980acaaaacata cctctccata aggaagggga agagtgatgg attgctgggc acggggatca 8040gtgcagccat ggaaatcctg tcacaaaacc cagtgtcggt gggtatatct gtgatgttgg 8100gggtaggggc cattgctgcg cacaacgcta ttgagtccag tgaacagaaa aggaccctac 8160ttatgaaggt gttcgtaaag aacttcttgg atcaggctgc aacggatgag ctggtaaaag 8220aaaacccaga gaaaattata atggccttat ttgaagcagt ccagacaatt ggtaaccccc 8280tgagactaat ataccacctg tatggggttt actacaaagg ttgggaggcc aaggaactat 8340ctgagaggac agcaggcaga aacttattca cattgataat gtttgaagcc ttcgagttat 8400tagggatgga ctcagaagga aaaataagga acctgtccgg aaattacatc ttggatctga 8460tatacggcct acacaagcag atcaacagag ggctgaagaa aatagtactg gggtgggctc 8520ctgcaccctt tagttgtgac tggaccccta gcgacgagag gatcagattg ccaacagaca 8580actatttgag ggtagaaacc aggtgcccat gtggttatga gatgaaagcg ttcaaaaatg 8640taggtggcaa gcttaccaaa gtggaggaga gcgggccttt cctatgtaga aacagacctg 8700gtaggggacc agtcaactac agagtcacca agtattacga tgacaacctc agagagataa 8760aaccggtagc aaagttggaa ggacaggtgg agcactacta taaaggggtc acagcaaaaa 8820ttgactacag taaaggaaaa acgctcttgg ctactgacaa gtgggaggtg gaacatggtg 8880tcatgaccag gttagctaag agatatactg gggttgggtt caatggtgca tacttaggtg 8940atgagcccaa tcaccgtgat ctagtggaga ggaactgtgc gactataacc aaaaacacag 9000tacagtttct aaaaatgaag aaggggtgtg cattcaccta tgacctgacc atctccaatc 9060tgaccaggct tattgaacta gtacacagga acaatcttga agagaaggaa atacccaccg 9120ttacagtcac tacatggcta gcttacacct tcgtgaatga agacgtaggg actataaaac 9180cagtactagg agagagggta atccccgacc ctgtagttga tgtcaactta caaccagagg 9240tccaagtgga tacatcagag gtcgggatca caataattgg aagggaaacc ctgatgacaa 9300cgggggtgac acctgtattg gaaaaagtag agcctgacgc tagcaacaac caaagctcag 9360tgaagattgg gttggataag ggtaattacc cagggcctgg aatacagaca catacactaa 9420cagaagaaat acacgacagg gatgcaagac ccttcatcat gatcctgggc tcaaagaatt 9480ccatgtcaaa tagggcaaag actgctagaa acataaatct gtacacagga aatgacccca 9540gggaaataag agacttgatg gctgcagggc gcatgttagt agtagcactg agggatgtcg 9600accctgagct ttctgaaatg gtcgacttca aggggacctt cttagatagg gaggccctgg 9660aggctctaag tctcgggcaa cctaaaccta agcaggtcac caaggcagct attagggatt 9720tgattgaaca ggaaaaacag gtggagatcc ctaactggtt tacatcagat gacccagtat 9780ttttggaagt ggccataaga aatgataagt actacttagt aggagatgtt ggagaggtaa 9840aagatcaagc taaaacactt ggggccacgg atcagacaag aattgtaaag gaggtaggct 9900caaggacgta taccatgaag ctatctagtt ggttcctcca agcatcaaaa aaacagataa 9960gtttaactcc actgtttgag gaattgttgt tacggtgccc acctgcaact aagagcaata 10020aggggcacat ggcatcagct taccaattgg cacagggtaa ctgggagccc ctcggttgcg 10080gggtgcacct aggtaccata ccagctagaa gggtgaagat acacccatat gaagcttacc 10140tgaggttgaa agatttttta gaagaagaag agaagaaacc tagggttaag gatacagtaa 10200taagagagca caacaaatgg atacttaaaa aaataaggtt tcaaggaaac ctcaacacca 10260agaaaatgct caaccccggg aaactatctg aacagttgga cagggagggg cgcaaaagga 10320acatctacaa ccaccagatt ggtaccataa tgtcaagtgc aggcataagg ctggagaaat 10380tgccaatagt aagggcccaa accgacacta aaacctttca tgaggcaata agagataaga 10440tagacaagag tgagaaccgg caaaatccag aattgcacaa caaattgttg gagatttttc 10500acacaatagc ccaacccgcc ctgaaacaca cttacggtga ggtgacgtgg gagcaacttg 10560aggcagggat aaataaaaaa ggggcagcag gctttctgga gaagaagaac atcggggaag 10620tattggattc agaaaaacac ctggtggaac aattggtcag ggatctgaag gccgggagaa 10680agataaaata ttatgaaact gcaataccaa aaaatgagaa aagagatgtc agcgatgact 10740ggcaggcagg ggacctggtg gatgagaaga ggccaagagt tattcaatac cctgaagcca 10800agacaaggct agccatcact aaggtcatgt ataactgggt gaaacagcag cccgttgtga 10860ttccaggata tgaaggaaag acccctttgt tcaacatctt tgataaagtg agaaaggaat 10920gggacttgtt caatgagcca gtggccgtaa gttttgacac caaagcctgg gacacacaag 10980tgactagtag ggatctgcaa cttatcggag aaatccagaa atattactat aggaaggagt 11040ggcacaagtt cattgacacc atcaccgacc acatgacaga agtgccagtt ataacagcag 11100atggtgaagt atatataaga aatgggcaga gaggtagtgg ccaaccagac acaagtgcag 11160gcaacagcat gttaaatgtc ctaacaatga tgtacgcttt ctgcgaaagc acaggggtcc 11220cgtacaagag tttcaacagg gtggcaagga tccatgtctg tggggatgat ggcttcttaa 11280taactgaaaa agggttaggg ctgaaatttg ctaacaaagg gatgcagatt cttcacgaag 11340caggcaaacc tcagaagata acggaagggg aaaagatgaa agttgcctat agatttgagg 11400acatagagtt ctgttcccat accccagtcc ctgttaggtg gtccgacaat accagtagtc 11460acatggccgg gagagacacc gctgtgatac tatcaaagat ggctacaaga ttggattcaa 11520atggagagag gggtaccaca gcatatgaaa aagcggtagc cttcagtttc ttgctgatgt 11580attcctggaa cccgcttgtt aggaggattt gcctgttggt actttcgcaa cagccagaga 11640cagacccatc caaacaggcc acttattatt acaaaggtga tccaataggg gcctataaag 11700atgtgatagg tcggaatcta agtgaactaa agagaacagg cttcgagaaa ttggcaaatc 11760taaacctaag cctgtccaca ttagggatct ggactaagca cacaagcaaa agaataatta 11820atgactgtgt tgccattggg aaagaagaag gcaactggct agttaacgcc gacaggctga 11880tatccagcaa aactggccac ttatacatac ctgataaggg ctttacatta caaggaaagc 11940attatgagca actacagcta agaacagaga caaaaccggt catgggggtc gggactgaga 12000gatacaagtt gggtcccata gtcaatctgc tgctgagaag gttgaaagtt ctgctcatga 12060cggccgtcgg tgccagcagc tgagacaagt gtatatattg taaataaatt

aacccatgta 12120catattgtat ataaatatag ttgggatcgt ccacctcaag aagacgacac acccaacacg 12180cacagctaaa cagtagttaa gattatctac ctcaagataa cactacattt aatgcacaca 12240gcactttagc tgtatgagga tacgcccgac gtctacagtt ggactaggga agacctctaa 12300cagcccc 123073212663DNAArtificial SequenceErns chimeric virus 32gtatacgaga ttagctaaag tactcgtata cggattggac gtcaacaaat ttttttaatt 60ggcaacgtag ggaactttcc cctcagcgaa ggccgaaaag aggctagcca tgcccttagt 120aggactagca aaaatagggg actagcggta gcagtgagtt cattggatgg ccgaacccct 180gagtacaggg gagtcgtcaa tggttcgaca ctccattggt tgaggagtct cgagatgcca 240tgtggacgag ggcatgccca cggcacatct taacccatgc gggggttgca tgggtgaaag 300cgctattcat ggcgttatgg acacagcctg atagggtgta gcagagacct gctattccgc 360tagtaaaaac tctgctgtac atggcacatg gagttgtttt caaatgaact tttatacaaa 420acatataaac aaaaaccagc aggcgtcgtg gaacctgttt acgacgtcaa cgggcgtcca 480ctgtttggag agagcagtga cttgcacccg cagtccacgc taaaactacc acaccaacga 540ggtagtgcca acatcctgac caatgctagg tccctaccgc ggaaaggtga ctgccggaga 600ggtaatgtgt atggagcggt gagtggcatc tatatcaagc caggaccgat ctactaccag 660gattatgcgg agcctgtcta ccatagagcc ccattagaac tatgtaggga ggcaagtatg 720tgcgaaacaa ctaggagagt tggcagagtg accggtagtg atgggaaatt atatcatatc 780tacatctgca tagatgggtg tatcctcctg aagagggcga ctaggaatca accagaagtc 840ctaaaatggg tatacaacag attagattgt cctttatggg tcactagctg ctccgatgaa 900gggagtaaga gtgctacaag taagaagcag cctaagccag ataggataga aaaaggcaag 960atgaaaatag ccccaaaaga gacagaaaaa gattgcaaaa ccagaccccc cgacgcgact 1020atagtagtag aaggggttaa gtaccaggtg aagaaaaaag gaaaggtaag gggaaaaaat 1080actcaagatg ggttgtatca caacaagaat aagccccctg aatcaagaaa gaaattggaa 1140aaggcactac tagcttgggc catcttggca gcggttctgc ttcagctggt aacaggagtg 1200aatataactc agtggaacct ggctgacgaa ggcaccgaag gcgtacatag ggtcatgttt 1260gagagaggga taaatagaag tttacatggc atatggcccc aacagatatg ccacggaatc 1320ccaagctaca accccaccaa cagagagctc tcgatgattg tcggaatggt tgatgcaagc 1380attagaacaa attatacctg ctgtaatcta cagagacacg aatggaacaa acatggctgg 1440tgcaattggt acaacatcat accatggatt aaggtgatga actacagcca gaggaacctc 1500actgaaggca catatggcaa agagtgtgcc gtaacgtgta ggcacgacag catattagac 1560atcaatatag tcactcaggc ccgcaatcaa cccacaatgt taaccgggtg caaaatagga 1620aagaactttt cgttctcagg tgaaattaga gaaaaaccat gtaattatga tatccaacca 1680gaggaaatac tacatttgcc acacgaatgt ggggagtggt atagtgaaat aagccaccag 1740gcggtcgaca tgatcactaa tgggttggag gcctctagaa attcagcagc caaagtcttg 1800agttggatag ggcgcaaatt ggaaaggata ggaaagagag cacaagcaaa atcaaaaaca 1860tggtttgggg cacaggcagc aagtccatac tgtaaagtgg agaggaagat cggttacatc 1920tggtatacaa aaaactgcac tccagcttgc cttccaagaa acactaaaat aataggcccc 1980gggaagtttg ataccaacgc cgaagatgga aaaatactcc atgagatggg ggggcacctc 2040tcagaatttg tcctattgtc tttggtggtt ctgtctgact ttgccccaga aaccgcgagt 2100gccatctact tggttctaca ttttgcgatc ccgcaaaacc acgttgatgt agacacatgc 2160gacaagaacc agctgaattt aacggtcgca actacagtag cagaggtcat accagggaca 2220gtgtggaacc tagggaagta tgtctgcata agaccagact ggtggccata tgagacgacg 2280acagtcttcg tcttagagga agcagggcaa gtaatcaaat tggggctaag ggccatcaga 2340gacttaacta ggatatggaa tgctgccacc accacagctt tcctaatctt tttagtgaaa 2400gcactaaggg gacaactaat ccaagggcta ttgtggctga tgctaataac aggagcacag 2460ggtttccctg aatgcaaaga gggcttccaa tatgccatat ctaaagacag aaaaatgggg 2520ttactgggac cagagagctt aactacaaca tggcacctcc ccaccaaaaa aatagtggac 2580tccatggtaa gtgtatggtg tgaaggaaaa gacttaaaaa tattaaaaac gtgcacaaag 2640gaagagaggt acctagtggc tgtgcacgag agagccttat caaccagtgc cgagtttatg 2700cagatcagtg atgggacaat aggcccagac gtgatagata tgcctgatga ctttgagttt 2760ggactctgcc cttgtgactc aaaaccagtg ataaagggca aatttaatgc cagcttactg 2820aatggaccag ctttccagat ggtatgccca caggggtgga ctggtacagt agaatgcacc 2880ctagtgaacc aagacacctt ggacacaact gtcattagga catatagaag aactacccca 2940tttcagcgga gaaaatggtg tacctatgaa aaaataatag gggaagatat ccatgaatgc 3000attctaggtg gaaactggac atgcataacc ggtggccaca gcgggttgaa agacggacct 3060atcaagaagt gtaagtggtg tggctatgac ttcgtcaact cagagggact accacactac 3120ccaataggca agtgcatgct catcaatgag agtgggtaca ggtatgtaga tgacacctct 3180tgcgataggg gtggtgtagc catagttcca actggcaccg taaagtgtag aataggtaac 3240gtcacggtgc aagttatcgc tactaacaat gatctgggac ccatgccttg cagcccagct 3300gaagtgatag caagtgaagg accagtggaa aagactgcat gcacattcaa ctattcaagg 3360actctaccta ataagtatta tgagccaagg gaccggtact tccaacaata catgttaaaa 3420ggggggtggc aatattggtt cgacctggat tctgtagacc accacaaaga ctacttctca 3480gagttcataa tcatagcagt ggtcgccttg ttgggtggta agtacgtact atggctcttg 3540ataacataca caatactgtc tgagcagatg gctatgggcg ctggagtgag tactgaagag 3600atagtcatga taggcaactt gctgacacac agtgatattg aggttgtggt ctatttcctt 3660cttctgtact taatagttaa agaggaactg gtgaggaaat gggttatact ggtataccac 3720atccttgtag ctaaccctat gaaaacaact ggggtcatct tactaatgct agggggagtg 3780gtgaaggcca gcagaatcaa tgctgatgac caaagtgcta tggacccatg ctttcttctc 3840gtgacaggtg tagtggctgt tttgatgatc gctagaagag aacctgccac cttaccactg 3900attgtagcat tgctagcaat aagaacatca ggattcctac tgtccgctag cattgatgta 3960actgtagcag tagtattaat tgtacttttg ctggctagct acgtaacaga ctactttaga 4020tataaaaagt ggcttcaatt ctcatttagt ctgatagctg gtatctttat tataaggagc 4080ttgaaacata tcaaccagat ggaggtacca gaaatatcta tgccaagttg gagacctcta 4140gctcttgtct tcttctatat aacatctaca gcaataacca ctaattggga cattgactta 4200gcaggcttcc tgctgcaatg ggcgccagca gtgatcatga tggctaccat gtgggcagac 4260tttttgactc tgatcatagt cctgcccagt tacgagttat ctaagcttta cttcctaaag 4320aacgtcagga cagacgtgga aaagaactgg ctcggcaagg tgaaatacag acagatcagt 4380tcagtttatg acatctgtga cagtgaggaa gcagtgtacc tatttccatc aaggcataag 4440agtggaagca ggccagattt catattaccc tttttgaaag ccgtgttaat aagctgcatc 4500agcagccaat ggcaaatggt ttacatttct tacctaatac tggaaatcac atactatatg 4560cacaggaaaa tcatagatga ggtgtcagga ggagcaaatt ttctatcaag acttatagca 4620gccatcatag aattaaattg ggccatagat gatgaggaat gtaaagggct gaagaaactg 4680tatctcttgt cagggagagt gaagaattta atagttaaac ataaggtaag aaatgaagcc 4740gtccacagat ggtttggtga ggaggaaata tatggggcac ccaaggtgat caccatcata 4800aaagctagta ccctaagtaa aaacaggcac tgcataatct gcacgatctg tgaagggaaa 4860gaatggaacg gagccaactg cccaaagtgt ggaagacaag gaaagcccat aacatgtgga 4920atgacactcg cagactttga ggagaaacat tacaaaaaga tatttataag agaaggacgc 4980caagaagcaa tgaatacgat gatgtgcagc cgatgccagg gaaagcatag gaggtttgaa 5040acggaccggg aacctaagag tgccagatac tgtgctgagt gtaataggct gcatcctgct 5100gaggaaggtg acttttgggc agagtcaagc atgttgggcc tcaaaatcac ctactttgcg 5160ctgatggatg gaaaggtgta tgatatcaca gagtgggctg gatgccagcg tgtgggaatc 5220tccccagata cccacagagt cccttgtcac atctcatttg gttcacggat gccaggcacc 5280agtgggcggc agagagctac tccagatgcc cctcctgctg accttcagga tttcttgagc 5340cggatctttc aagtaccccc aggccagatg tccagggaag agtataaggg ttacgtccaa 5400tacacagcca gaggacaact ctttctgagg aacctgccaa ttctagcgac gaagatgaag 5460ctattaatgg tggggaacct cggcgcagaa gttggcgacc tggaacatct aggatgggta 5520ctgagagggc cagccgtgtg caaaaaaatt accaaccatg agaagtgcca cgtaaacatc 5580atggataagc taactgcatt ttttggaatc atgcctagag gcacaacccc tagggcacct 5640gtgaggttcc ccacagcact attgaaagtg agaagggggc tagagacggg atgggcttac 5700acacaccaag gagggatcag ctcggtagac catgtcacag ccggaaagga tttactggtg 5760tgtgacagta tgggcaggac cagggttgtc tgtcatagta acaataagat gactgacgag 5820actgagtatg gcatcaagac cgactcaggg tgccccgaag gcgcgaggtg ttacgtgcta 5880aacccagaag ctgttaacat ttctggcaca aaaggagcta tggtacacct ccagaaaact 5940gggggggagt tcacatgtgt cactgcctca gggaccccgg ctttcttcga tctaaaaaat 6000ctaaaaggct ggtccgggct gccaattttt gaagcatcca gtggcagggt ggttggtagg 6060gtgaaagtcg gcaagaatga ggattccaag cccaccaaac taatgagcgg aatccagaca 6120gtgtctaaga gccagacgga cctagcggac atcgtaaaga aattgactag tatgaacaga 6180ggagagttca aacagataac attagccact ggggcaggaa aaactacgga actgccaagg 6240tccgttatag aggagatagg gaggcacaaa agggtcttag tcctgatacc attgagagcg 6300gcagcagagt cagtgtatca gtatatgaga gtgaagtacc caagtatatc tttcaatttg 6360agaataggag atatgaagga aggtgatatg gccaccggta tcacttacgc ctcatatggg 6420tacttttgtc agcttcctca gcccaaactg agagctgcca tggtagagta ttcatatata 6480ttcttagatg agtaccactg tgctacaccc gagcaattag caataattgg aaagatacac 6540aggtttgctg aaaatcttag agtggtagca atgacagcaa ccccagctgg aacggtcaca 6600acgactggtc agaaacaccc tatagaggag ttcatagccc cagaggtgat gaagggtgaa 6660gatctaggta gtgaatactt ggatattgca gggttgaaga taccgactga agagatgaaa 6720ggcaacatgc tcgtgttcgt gccaactagg aacatggcag tagaaacagc taagaaattg 6780aaggcaaaag ggtacaactc cggatactat tacagtgggg agaacccaga aaacttgagg 6840gtggtgacct cacaatcccc gtatgtggta gtagccacca atgccataga gtcaggtgtg 6900acattaccag acttagacac agttgtagac actggactaa aatgtgagaa gagggtgagg 6960atatcttcaa aaatgccctt cattgtaaca ggacttaaga gaatggcagt cacaatagga 7020gagcaagccc agcgcagggg gagagtagga agagtcaagc caggtaggta ctataggagt 7080caagaaacag cttcagggtc aaaagattac cattacgacc tactacaagc ccagaggtac 7140ggaatagaag atggaattaa tgtaacaaag tcattcaggg agatgaacta tgattggagc 7200ctttatgaag aggacagctt gatgataact caactcgagg tccttaacaa cctccttata 7260tcagaagacc tgcctgccgc agtgaagaac atcatggccc ggaccgatca cccagaaccc 7320atacaactgg cctataacag ttatgaaaac caagttccag tgctgttccc aaagatcaaa 7380aatggtgagg tgacagacag ttatgagaat tacacatacc tcaatgcaag aaaactagga 7440gaggacgtgc cggcgtatgt gtacgccacg gaggatgagg atctagcagt ggatcttctg 7500ggtatggatt ggccggaccc aggcaaccaa caggtggtag agacagggag ggcattaaag 7560caagtaactg gcttatccac agcagaaaat gccctcttga tagccttatt cggttacgtc 7620gggtaccaga cgctttcaaa aaggcacata cccatgatta ctgacatcta tacacttgaa 7680gaccacagac ttgaggacac aacccacctc cagtttgccc caaacgctat aaggaccgac 7740ggcaaggact cagagttgaa agaattagct gtgggagacc ttgataaata tgtggacgca 7800ctggtagact actccaaaca agggatgaaa tttatcaaag tccaagctga aaaggtcaga 7860gactcccagt ctacaaagga aggcttgcaa aatattaagg agtatgtgga taagtttata 7920caatcactaa cagagaataa ggaggagatc atcaggtatg gactatgggg agttcacaca 7980gcactctaca aaagcttggc agcgagactg gggcatgaaa cagcttttgc aactttagtg 8040gtaaaatggc tggcttttgg gggcgaaacg gtatctgctc acatcaagca agtagcagtt 8100gatctagtag tatactatat catcaacaaa ccatcctttc ctggagatac agagacccaa 8160caagagggga ggaggtttgt ggctagtctt tttatatctg cactagcaac atacacatat 8220aaaacctgga attacaacaa tctgcaacgg gttgtcgaac ctgccttagc ttacctccca 8280tatgctacaa gtgccttgaa gttgttcgca cccacaagat tagagagtgt ggtcatactc 8340agttctacaa tttacaagac atacctctct ataaggaagg gtaagagcga cggcttgtta 8400ggtacaggca taagtgcagc catggagatc ctaaaccaaa acccaatctc agtaggtata 8460tctgtgatgc tgggggtagg tgccatcgcc gcccataatg caatagaatc tagtgaacag 8520aaaagaactt tgctgatgaa ggtctttgta aaaaattttt tggaccaagc agcgacagat 8580gagctagtca aagagaaccc tgaaaaaata atcatggctc tatttgaagc agtccagacc 8640ataggaaacc ccctaagact catctaccat ctgtacgggg tgtactataa ggggtgggaa 8700gcaaaagaac tcgcagagaa aactgctggc cgcaacttat tcacattgat tatgtttgaa 8760gcctttgagc ttttaggtat ggactcagaa ggaaagataa gaaacttgtc aggcaactac 8820atactggact taatcttcaa tttgcataat aaattaaaca agggtctcaa aaaactagtc 8880cttgggtggg ctccagcacc tttcagctgt gattggacac caagtgatga gaggataagc 8940ttaccccata acaactactt aagggtagaa accaggtgtc cttgtggcta tgagatgaag 9000gcaataaaaa atgttgctgg taaattgaca aaagttgaag aaaaggggcc cttcctatgc 9060aggaatagat tagggagagg acctccaaac ttcaaagtaa caaagttcta tgatgatgac 9120ttgaaagaag tcaagccagt agctaggcta gaaggccagg tggacctcta ttacaaggga 9180gtaacagcaa agttagacta caacaatggg aaagtactgt tagctaccaa caagtgggag 9240gtggaccacg ctttcctgac cagattagta aagaagcaca cagggatagg ttttaaaggt 9300gcatatttgg gtgacagacc agaccatcaa gatcttgtcg atagagattg tgcaactata 9360acgaagaact cagtacagtt cctaaaaatg aagaaaggtt gcgctttcac atatgaccta 9420acaatctcta accttgtcag gcttattgaa ctagtccata agaacaattt acaagaaaga 9480gagatcccca ccgtgacagt aactacttgg cttgcatatt cttttgtcaa tgaagacctg 9540gggactatca agcctgtatt gggggagaaa gtcatcccag aaccccccga ggagttgagt 9600ctccaaccca ctgtgggact agtcaccact gagacagcaa taaccataac aggggaggct 9660gaagtgatga cgacagggat cacaccagtg gtagagatga aagaagaacc tcagctggac 9720caccagtcaa ctaccctaaa ggtagggtta aaggaagggg aatatccagg gccaggagtt 9780aaccctaacc atttagtaga ggtgatagat gagaaagatg acaggccttt tgtcctaatt 9840atcggtaaca aaggttctac ctcgaacaga gcaagaacgg ccaagaatat acggctgtac 9900aaaggaaaca acccaagaga gatcagggat ctgatgagcc aaggaagaat attaacggtt 9960gctctaaaag agttggaccc ggaattaaaa gaattagtag attacaaggg gacctttctc 10020aatagggaag ctttagaagc cctaagctta ggtaagccaa ttaagaggaa aaccacagca 10080gcaatgatca ggaggttaat agagccagag gttgaggagg aactaccaga ttggttccaa 10140gcggaagaac ccctattttt ggaagcaaaa atacagaatg acttatacca cctaattggc 10200agtgttgata gtataaaaag caaagcaaag gaattagggg ccacagataa cacaaagata 10260gtgaaggaag tcggggctag gacctatacg atgaaattga gtagctggag cacacaagtt 10320actaaaaaac agatgagttt agcccctctc tttgaagagc tgttattaaa gtgccctcca 10380tgtagtaaaa tttcaaaggg acatatggtg tcagcatacc aactggctca aggaaactgg 10440gaacccctcg ggtgtggggt ctatatggga accataccag ctaggcgtct caagatccac 10500ccttatgagg cttaccttaa actcaaagag ctgctggaag ttgaatcttc gaggatcacc 10560gcaaaagaat ccatcataag agaacataac acctggattc tgcggaaagt gagacatgag 10620gggaacctaa gaactaaatc aatgattaac cctgggaaaa tatcagatca gctatgcaga 10680gacggacaca aaagaaacat atataataag atcataggct caacaatggc ctctgctggt 10740attaggctgg agaaactgcc agtagtccga gcccaaactg acacaaccag tttccaccaa 10800gccataagag aaaaaattga taaaccagaa aacaagcaga cccctgaatt gcatgaagaa 10860ctaatgaagg ttttcgactg cttaaagatc ccagagctga aggaatcgta tgatgaagtt 10920tcatgggaac aattagaagc aggaataaac cgtaagggtg cagcaggtta tctagagagt 10980aagaacatag gggaagtgct agacacagag aaacacatag tagagcagct gatcaaggat 11040ctgaggaagg ggaagaagat taagtactat gaaacagcca ttcccaagaa tgagaagaga 11100gacgtcagcg acgactggga agccggagac ttcgttgatg aaaagaaacc aagagtaatc 11160cagtacccgg acgccaaggt gagactggca attacaaaaa tgatgtacaa atgggtaaag 11220caaaaaccag tggtgatacc cggctatgaa ggaaaaacac cactatttga catattcaac 11280aaagtgaaga aggaatggga ttcattccag gaccccgtag cagtgagctt tgacaccaaa 11340gcgtgggata cacaagtcac cagtagagac ctaatgttga taagggatat ccagaaatat 11400tatttcaaga gaagtacaca caaattttta gatacaataa cagaacacat ggtagaagta 11460cctgtcatta cagcagacgg tgaagtttac ataaggaatg gtcagagggg tagtggccaa 11520cccgacacaa gtgctggtaa tagtatgttg aatgtcctaa ccatgatata tgctttctgt 11580aaaagtacag gcatacctta caggggattc agcagagtgg caagaatcca tgtgtgtggt 11640gatgatggct ttctgataac agaaagagga ctggggctga aattctctga gaagggtatg 11700cagatattac atgaggccgg gaagccccag aaaataactg aaggggacag aatgaaagtg 11760gcatacagat ttgaggacat cgagttttgt tcccatacac ccgtaccagt cagatgggca 11820gataacacca gtagttacat ggcagggagg agcacagcca ctatactagc taagatggca 11880accaggttgg attccagcgg agagaggggt agcacagctt atgagaaggc cgtagccttc 11940agcttccttt tgatgtactc atggaatccc gtagttagaa ggatctgctt actggtgttg 12000tcacagtttc cagaaatatc cccatccaaa aacacaatat actactacca aggggatccc 12060atagctgcgt acagagaagt gataggtaaa cagctgtgtg aactgaaaag aacaggattt 12120gagaagctgg ctggtctgaa tttgagtatg accactctag gcatctggac aaaacattct 12180agtaaaagac taatccaaga ctgtgtagag ataggtaaga gagaaggtaa ctggttagtt 12240aatgctgaca gactgattgc aggaaagact gggaagtttt acatcccaag cactggtgtc 12300actctgttgg gaaaacatta tgaggaaatt aacttaaagc aaaaggcggc acaaccgccg 12360atagaggggg ttgacagata taagttgggc cccatagtta atgtaatctt gagaaggctg 12420agggtgatgc tgatgacagt tgccagcgga agctggtaaa tccgtccgga gcatcgtgcc 12480ctcgctcaag gttttaattg taaatattgt aaatagacag ctaagatatt tattgtagtt 12540ggatagtaat gtagtgatag tagatacccc aatttaacac tacctccaat gcactaagca 12600ctttagctgt gtgaggttaa ctcgacgtcc acggttggac tagaggatgc ctctgacagc 12660ccc 12663

Claims

1. A chimeric pestivirus, wherein said chimeric pestivirus comprises a bovine viral diarrhea virus which does not express its homologous E.sup.rns protein, further wherein said chimeric pestivirus expresses a heterologous E.sup.rns protein derived from another pestivirus, or a natural, synthetic or genetic variant of said heterologous E.sup.rns protein.

2. The chimeric pestivirus of claim 1, wherein the heterologous E.sup.rns protein of said chimeric pestivirus, or the natural, synthetic or genetic variant of said heterologous E.sup.rns protein, is derived from a pestivirus selected from the group consisting of a reindeer pestivirus, a giraffe pestivirus, and a pronghorn antelope pestivirus.

3. The chimeric pestivirus of claim 1, wherein the heterologous E.sup.rns protein of said chimeric pestivirus has at least one E.sup.rns epitope which is not present in wild-type bovine viral diarrhea virus.

4. The chimeric pestivirus of claim 1, wherein the heterologous E.sup.rns protein of said chimeric pestivirus lacks at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus.

5. A culture of the chimeric pestivirus of claim 1.

6. A cell line or host cell comprising the chimeric pestivirus of claim 1.

7. A polynucleotide molecule encoding for the chimeric pestivirus of claim 1.

8. An immunogenic composition comprising the chimeric pestivirus of claim 1, and a veterinarily-acceptable carrier.

9. The immunogenic composition of claim 8, wherein the veterinarily-acceptable carrier is an adjuvant.

10. The immunogenic composition of claim 8, wherein said chimeric pestivirus is live attenuated.

11. The immunogenic composition of claim 8, wherein said chimeric pestivirus is inactivated.

12. The immunogenic composition of claim 8, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in a bovine.

13. An immunogenic composition comprising the polynucleotide molecule of claim 7 and a veterinarily-acceptable carrier.

14. A vaccine comprising the chimeric pestivirus of claim 1 and a veterinarily-acceptable carrier.

15. The vaccine of claim 14, wherein the veterinarily-acceptable carrier is an adjuvant.

16. The vaccine of claim 14, wherein said chimeric pestivirus is live attenuated.

17. The vaccine of claim 14, wherein said chimeric pestivirus is inactivated.

18. A vaccine comprising the polynucleotide molecule of claim 7 and a veterinary acceptable carrier.

19. The vaccine of claim 14, further comprising one or more additional antigens useful for treating or preventing the spread of one or more additional pathogenic microorganisms in a bovine.

20. A kit comprising, in at least one container, the vaccine of claim 14.

21. A method of treating or preventing the spread of bovine viral diarrhea virus infection, wherein the vaccine of claim 14 is administered to an animal.

22. A method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA pestivirus vaccine comprises the chimeric pestivirus of claim 1, further wherein said chimeric pestivirus has at least one E.sup.rns epitope which is not present in wild-type bovine viral diarrhea virus.

23. A method of vaccinating an animal, wherein a DIVA pestivirus vaccine is administered to said animal, and wherein said DIVA vaccine comprises the chimeric pestivirus of claim 1, further wherein said chimeric pestivirus lacks at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus.

24. A method of differentiating between an animal vaccinated with the vaccine of claim 14 and an animal infected with wild type bovine viral diarrhea virus, wherein the animal vaccinated with said vaccine generates antibodies to at least one E.sup.rns epitope which is present in the chimeric pestivirus of said vaccine, but which is not present in wild-type bovine viral diarrhea virus, said method comprising the steps of: a) obtaining a serum sample from the animals; b) assaying said samples for the presence or absence of the antibodies; c) identifying the animal having said antibodies as having been vaccinated with said vaccine; and d) identifying the animal lacking said antibodies as having been infected with the wild type BVDV.

25. A method of differentiating between an animal infected with wild-type bovine viral diarrhea virus and an animal vaccinated with the vaccine of claim 14, wherein the animal infected with wild type bovine viral diarrhea virus generates antibodies to at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of said vaccine, said method comprising the steps of: a) obtaining a serum sample from the animals; b) assaying said samples for the presence or absence of the antibodies; c) identifying the animal having said antibodies as having been infected with the wild type BVDV; and d) identifying the animal lacking said antibodies as having been vaccinated with said vaccine.

26. A diagnostic kit for differentiating between an animal vaccinated with a vaccine comprising the chimeric pestivirus of claim 1 and an animal infected with wild type bovine viral diarrhea virus, said kit comprising reagents capable of detecting antibodies to at least one E.sup.rns epitope which is present in the chimeric pestivirus of the vaccine, but which is not present in wild-type bovine viral diarrhea virus.

27. A diagnostic kit for differentiating between an animal infected with wild type bovine viral diarrhea virus and an animal vaccinated with a vaccine comprising the chimeric pestivirus of claim 1, said kit comprising reagents capable of detecting antibodies to at least one E.sup.rns epitope which is present in wild-type bovine viral diarrhea virus, but which is not present in the chimeric pestivirus of the vaccine.

28. An antibody which recognizes an epitope of E.sup.rns which is present in the chimeric pestivirus of claim 1, but which epitope is not present in wild-type bovine viral diarrhea virus.

29. An antibody which recognizes an epitope present in wild-type bovine viral diarrhea virus, but which epitope is not present in the chimeric pestivirus of claim 1.