U.S. patent application number 15/344815 was filed with the patent office on 2017-05-04 for targeted alteration of dna with oligonucleotides.
The applicant listed for this patent is Keygene N.V.. Invention is credited to Michiel Theodoor Jan DE BOTH, Tomoyuki FURUKAWA.
Application Number | 20170121706 15/344815 |
Document ID | / |
Family ID | 44189196 |
Filed Date | 2017-05-04 |
United States Patent
Application |
20170121706 |
Kind Code |
A1 |
DE BOTH; Michiel Theodoor Jan ;
et al. |
May 4, 2017 |
TARGETED ALTERATION OF DNA WITH OLIGONUCLEOTIDES
Abstract
The current invention relates to a method for targeted
alteration of acceptor DNA, for example duplex acceptor DNA. The
method comprises use of at least two oligonucleotides, each
oligonucleotide having at least one mismatch relative to the
targeted (duplex) acceptor DNA. The mismatch of the first
oligonucleotide is directed to a nucleotide at a position in the
first strand of the duplex and the mismatch of the second
oligonucleotide is directed to the nucleotide in the second strand
that occupies the complementary position in the duplex acceptor DNA
(e.g. forms a base-pair with the nucleotide in the first strand).
These mismatches are located at specific positions within said
oligonucleotides. Also provided is a kit that comprises
instructions for performing the method according to the inventions,
and in a preferred embodiment, comprises oligonucleotides suitable
for use in the method.
Inventors: |
DE BOTH; Michiel Theodoor Jan;
(AE Wageningen, NL) ; FURUKAWA; Tomoyuki; (AE
Wageningen, NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Keygene N.V. |
AE Wageningen |
|
NL |
|
|
Family ID: |
44189196 |
Appl. No.: |
15/344815 |
Filed: |
November 7, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13991065 |
Aug 16, 2013 |
9518258 |
|
|
PCT/NL11/50805 |
Nov 25, 2011 |
|
|
|
15344815 |
|
|
|
|
61419183 |
Dec 2, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/102 20130101;
C12N 15/1024 20130101; C12N 15/1082 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 3, 2010 |
NL |
2005809 |
Claims
1. A method for targeted alteration of a duplex acceptor DNA
sequence comprising a first DNA sequence and a second DNA sequence
which is the complement of the first DNA sequence, the method
comprising combining the duplex acceptor DNA sequence with at least
a first oligonucleotide and a second oligonucleotide, wherein the
first oligonucleotide comprises at least one domain that is capable
of hybridizing to the first DNA sequence and wherein the first
oligonucleotide further comprises at least one mismatch with
respect to the first DNA sequence and wherein the at least one
mismatch is positioned at most 2 nucleotides from the 3' end of
said first oligonucleotide; and wherein the second oligonucleotide
comprises at least one domain that is capable of hybridizing to the
second DNA sequence and wherein the second oligonucleotide further
comprises at least one mismatch with respect to the second DNA
sequence and wherein the at least one mismatch is positioned at
most 2 nucleotides from the 3' end of said second oligonucleotide;
and wherein the at least one mismatch in the first oligonucleotide
is relative to a nucleotide in the first DNA sequence of the duplex
acceptor DNA sequence and wherein the at least one mismatch in the
second oligonucleotide is relative to a nucleotide in the second
DNA sequence of the duplex acceptor DNA, and wherein said
nucleotides occupy complementary positions in the duplex acceptor
DNA.
2. The method according to claim 1 wherein the mismatch in the
first oligonucleotide or the mismatch in the second oligonucleotide
is, independently, positioned at most 1 nucleotide from the 3' end
of said oligonucleotide, more preferably said at least one mismatch
is at the 3' end of the oligonucleotide, preferably the mismatch in
both oligonucleotides is at the 3' end of the oligonucleotides.
3. The method according to claim 1 wherein the domain in the first
oligonucleotide and/or in the second oligonucleotide comprises or
is directly adjacent to the at least one mismatch.
4. The method according to claim 1 wherein the first
oligonucleotide is complementary to the first DNA sequence except
for the mismatch and/or wherein the second oligonucleotide is
complementary to the second DNA sequence except for the
mismatch.
5. The method according to claim 4 wherein the mismatch in the
first oligonucleotide is at the 3' end and wherein the mismatch in
the second oligonucleotide is at the 3' end.
6. The method according to claim 1 wherein the first
oligonucleotide and/or the second oligonucleotide comprises at
least one section that contains at least one modified nucleotide,
wherein the modification is selected from the group consisting of a
base modification, a 3' and/or 5' end base modification, a backbone
modification or a sugar modification.
7. The method according to claim 6 wherein the modified nucleotide
is selected from the group consisting of LNA or phosphorothioate
bonds.
8. The method according to claim 6 wherein the oligonucleotide
comprises at least two, three, four, or five modified nucleotides,
preferably the oligonucleotide comprises two, three, four or five
modified nucleotides.
9. The method according to claim 1 wherein the mismatch is not a
modified nucleotide.
10. The method according to claim 6 wherein the modified nucleotide
is at least one nucleotide from the at least one mismatch located
at most 2, preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said at least one mismatch is at
the 3' end of the oligonucleotide.
11. The method according to claim 1, wherein the alteration of the
duplex acceptor DNA is within a cell preferably selected from the
group consisting of prokaryotic cell, a bacterial cell, a
eukaryotic cell, a plant cell, an animal cell, a yeast cell, a
fungal cell, a rodent cell, a human cell, a non-human cell, and/or
an embryonic cell.
12. The method according to claim 1 wherein the duplex acceptor DNA
is obtained from a prokaryotic organism, a bacteria, an eukaryotic
organism, a plant, an animal, a yeast, a fungus, a rodent, or a
human.
13. The method according to claim 1, wherein the alteration is a
deletion, a substitution and/or an insertion of at least one
nucleotide.
14. The method according to claim 1, wherein the duplex acceptor
DNA is from genomic DNA, linear DNA, artificial chromosomes,
mammalian artificial chromosomes, bacterial artificial chromosomes,
yeast artificial chromosomes, plant artificial chromosomes, nuclear
chromosomal DNA, organellar DNA, and/or episomal DNA including
plasmids.
15. The method according to claim 1, for altering a cell,
correcting a mutation by restoration to wild type, inducing a
mutation, inactivating an enzyme by disruption of coding region,
modifying bioactivity of an enzyme by altering coding region,
modifying a protein by disrupting the coding region.
16. (canceled)
17. A kit comprising instructions for performing a method for
targeted alteration of a duplex acceptor DNA according to claim
1.
18. A kit according to claim 17 further comprising at least two
oligonucleotides for use in the method according to claim 1,
preferably comprising the at least two oligonucleotides as
described in claim 1.
19. A kit according to claim 17 wherein, when combined with a
duplex acceptor DNA sequence containing a first DNA sequence and a
second DNA sequence which is the complement of the first DNA
sequence, the first oligonucleotide comprises at least one domain
that is capable of hybridizing to the first DNA sequence and
wherein the first oligonucleotide further comprises at least one
mismatch with respect to the first DNA sequence and wherein the at
least one mismatch is positioned at most 2 nucleotides from the 3'
end of said first oligonucleotide; and wherein the second
oligonucleotide comprises at least one domain that is capable of
hybridizing to the second DNA sequence and wherein the second
oligonucleotide further comprises at least one mismatch with
respect to the second DNA sequence and wherein the at least one
mismatch is positioned at most 2 nucleotides from the 3' end of
said second oligonucleotide; and wherein the at least one mismatch
in the first oligonucleotide is relative to a nucleotide in the
first DNA sequence of the duplex acceptor DNA sequence and wherein
the at least one mismatch in the second oligonucleotide is relative
to a nucleotide in the second DNA sequence of the duplex acceptor
DNA, and wherein said nucleotides occupy complementary positions in
the duplex acceptor DNA.
Description
TECHNICAL FIELD
[0001] The current invention relates to a method for targeted
alteration of acceptor DNA, for example duplex acceptor DNA. The
method comprises use of at least two oligonucleotides, each
oligonucleotide having at least one mismatch relative to the
targeted (duplex) acceptor DNA. The mismatch of the first
oligonucleotide is directed to a nucleotide in the first strand of
the duplex and the mismatch of the second oligonucleotide is
directed to the nucleotide in the second strand that forms a
base-pair with the nucleotide in the first strand. These mismatches
are located at specific positions within said oligonucleotides.
Also provided is a kit that comprises instructions for performing
the method according to the inventions, and in a preferred
embodiment, comprises oligonucleotides suitable for use in the
method.
BACKGROUND OF THE INVENTION
[0002] Genetic modification is the process of deliberately creating
changes in the genetic material of living cells. Often the purpose
is to modify a genetically encoded biological property of that
cell, or of the organism of which the cell forms part or into which
it can regenerate. These changes can take the form of deletion of
parts of the genetic material, addition of exogenous genetic
material, or changes in the existing nucleotide sequence of the
genetic material, for example by substituting one nucleotide for
another.
[0003] Methods for the genetic modification of eukaryotic organisms
have been known for over 20 years, and have found widespread
application in plant, human and animal cells and microorganisms for
improvements in the fields of agriculture, human health, food
quality and environmental protection.
[0004] A common genetic modification methodology consists of adding
exogenous DNA fragments to the genome of a cell, which may then
confer a new property to that cell or organism over and above the
properties encoded by already existing genes (including
applications in which the expression of existing genes will thereby
be suppressed).
[0005] Although these methods may have some effectiveness in
providing the desired properties to a target, these methods are
nevertheless not very precise. There is, for example, no control
over the genomic positions in which the exogenous DNA fragments are
inserted (and hence over the ultimate levels of expression). In
addition, the desired effect will have to manifest itself over the
natural properties encoded by the original and well-balanced
genome. On the contrary, methods of genetic modification that will
result in the addition, deletion or conversion of nucleotides in
predefined genomic loci will allow the precise and controllable
modification of existing genes.//esp
[0006] Oligonucleotide-directed Targeted Nucleotide Exchange (TNE)
is a method that is based on the delivery into the eukaryotic cell
of (synthetic) oligonucleotides (molecules consisting of short
stretches of nucleotides and/or nucleotide-like moieties that
resemble DNA in their Watson-Crick base pairing properties, but may
be chemically different from DNA; (Alexeev and Yoon, 1998); (Rice
et al., 2001); (Kmiec, 2003)).
[0007] By deliberately designing a mismatch nucleotide in the
homology sequence of the oligonucleotide, the mismatch nucleotide
may induce changes in the genomic DNA sequence to which the
nucleotide may hybridize. This method allows the conversion of one
or more nucleotides in the target, and may, for example, be applied
to create stop codons in existing genes, resulting in a disruption
of their function, or to create codon changes, resulting in genes
encoding proteins with altered amino acid composition (protein
engineering).
[0008] Targeted nucleotide exchange (TNE) has been described in
many organisms including plant, animal and yeast cells and is also
referred to as Oligonucleotide-directed Mutagenesis (ODM).
[0009] The first examples of TNE using chimeric DNA: RNA
oligonucleotides came from animal cells (reviewed in (Igoucheva et
al., 2001)). TNE using chimeric DNA:RNA oligonucleotides has also
been demonstrated in plant cells (Beetham et al., 1999; Kochevenko
and Willmitzer, 2003; Okuzaki and Toriyama, 2004; Zhu et al., 2000;
Zhu et al., 1999). In general, the frequencies reported in both
plant and animal studies were too low for practical application of
TNE on non-selectable chromosomal loci. TNE using chimeric
oligonucleotides was also found to be difficult to reproduce
(Ruiter et al., 2003), resulting in a search for alternative
oligonucleotide designs giving more reliable results.
[0010] Several laboratories have focused on the use of single
stranded (ss) oligonucleotides for TNE. These have been found to
give more reproducible results in both plant and animal cells (Liu
et al., 2002) (Parekh-Olmedo et al., 2005) (Dong et al., 2006).
However, the greatest problem facing the application of TNE in
cells of, in particular, higher organisms such as plants remains
the relative low efficiency that has been reported so far. In maize
a conversion frequency of 1.times.10.sup.-4 has been reported (Zhu
et al., 2000). Subsequent studies in tobacco (Kochevenko and
Willmitzer, 2003) and rice (Okuzaki and Toriyama, 2004) have
reported frequencies of 1.times.10.sup.-6 and 1.times.10.sup.-4
respectively.
[0011] TNE using various types of oligonucleotides has been the
subject of various patent and patent applications including U.S.
Pat. No. 6,936,467, U.S. Pat. No. 7,226,785, US579597, U.S. Pat.
No. 6,136,601, US2003/0163849, US2003/0236208, WO03/013226, U.S.
Pat. No. 5,594,121 and WO01/92512.
[0012] In U.S. Pat. No. 6,936,467 it is contemplated that the low
efficiency of gene alteration obtained using unmodified DNA
oligonucleotides is the result of degradation of the donor
oligonucleotides by nucleases present in the reaction mixture or
the target cell. It is proposed to incorporate modified nucleotides
that render the resulting oligonucleotides (more) resistant against
nucleases. These modifications are disclosed to preferably be
located at the ends of the oligonucleotide whereas the mismatch is
present at least 8 nucleotides from each terminal end.
[0013] U.S. Pat. No. 7,226,785 also discloses methods for targeted
chromosomal genomic alterations using modified single-stranded
oligonucleotides with at least one modified nuclease-resistant
terminal region. TNE using modified single stranded
oligonucleotides is also the subject of WO02/26967.
[0014] Because of the low efficiency of the current methods of TNE
there remains a need for alternative and/or better TNE techniques.
These can be used alone or in combination with existing TNE
techniques, like those disclosed above and in the art, to improve
efficiency. Accordingly, the present inventors have set out to
improve on the existing TNE technology.
SUMMARY OF THE INVENTION
Technical Problem
[0015] The technical problem identified in the art is that the
current available methodology for introducing specific and desired
genetic changes in cells, for example for introducing specific
genetic changes in the genome present in a plant cell, are hindered
by low efficiency, making the techniques laborious and costly.
There is a need to come to alternative and better TNE
techniques.
[0016] One of the problems to be solved is therefore to provide for
an alternative and/or better and/or additional method for the
introduction of genetic change(s) in the genetic information, in
particular duplex DNA sequences, as is present in cells. Preferably
such method has improved efficiency in comparison to those
described in the art. Such method would allow for the provision of
cells with altered genetic information, more in particular for
cells wherein a functionality of the cell has been changed by the
introduction of the alteration in the target DNA. Such
functionality may for example relate to altered properties of the
protein encoded by a DNA sequence encompassing the DNA that has
been altered by the method according to the invention.
The Solution to the Problem
[0017] The solution to the problem is presented in the accompanying
claims.
[0018] Duplex or double-stranded DNA is a term very well known to
the skilled person and refers to the two strands of DNA held in a
double helix by complementary base pairing (Watson-Crick
base-pairing) between A's and T's and between G's and C's.
[0019] The inventors have now found a new method for targeted
alteration of a duplex DNA sequence comprising a first DNA sequence
(comprised in the first strand) and a second DNA sequence
(comprised in the second strand) which is the complement of the
first DNA sequence.
[0020] The method takes advantage of at least two different and
specifically designed donor oligonucleotides. Each of the two donor
oligonucleotides comprises a domain that is capable of hybridizing
to the target (under conditions that allow hybridization, as they
are known to the skilled person). Each of the two donor nucleotides
further comprises at least one mismatch in comparison to the
targeted duplex DNA sequence, which mismatch is to be introduced in
the targeted duplex DNA sequence.
[0021] The first oligonucleotide comprises a domain that is capable
of hybridizing to said first DNA sequence (in the first strand) and
the second oligonucleotide comprises a domain that is capable of
hybridizing to said second DNA sequence (in the second strand).
[0022] The at least one mismatch in the first oligonucleotide is
directed/relative to a nucleotide in the first DNA sequence and the
at least one mismatch in the second oligonucleotide is
directed/relative to the nucleotide in the second DNA sequence that
forms a base-pair with the nucleotide in the first DNA sequence in
the duplex DNA.
[0023] In the art it is advocated and common knowledge that a
mismatch in a oligonucleotide should be present within the
oligonucleotide, in other words "somewhere in the middle" of the
oligonucleotide (see for example the various patent application
discussed above, in particular U.S. Pat. No. 6,936,467 and U.S.
Pat. No. 7,226,785).
[0024] Such oligonucleotide-design from the art, with a mismatch
somewhere in the middle and flanked by various nucleotides at both
sides, would prevent any skilled person from utilizing a set of at
least two oligonucleotides as described above as these
oligonucleotides will at least partially share complementary
domains that may for example hybridize with each other therewith
preventing use in targeted nucleotide exchange.
[0025] However, it has, surprisingly and unexpectedly, been found
that the method according to the invention, using the at least two
oligonucleotides described in detail herein, can be performed with
good efficiency when the mismatch in each of the oligonucleotide is
not located somewhere in the middle of the oligonucleotide but at
specific locations. In particular it has been found that for
efficient TNE the mismatch in the at least two oligonucleotides
described herein should (for each oligonucleotide independently) be
located at most two, preferably at most one nucleotide from the 3'
end of an oligonucleotide. Most preferably the at least one
mismatch is at the 3' end of the (ss) oligonucleotide.
[0026] In contrast to the general belief that any mismatch should
be in a central part of a oligonucleotide, and that, for example,
modifications at the 5' end and the 3' end of the oligonucleotide
should be introduced to prevent premature degradation of the
oligonucleotide by nucleases (see e.g. U.S. Pat. No. 6,936,467), it
was now found that having a mismatch in the oligonucleotide zero,
one or at most two nucleotide(s) from the 3' end provides for
oligonucleotides that can advantageously be used in methods of
targeted nucleotide exchange, i.e. in methods for targeted
alteration of a duplex DNA sequence as described herein.
[0027] With the above it has now become possible to target at the
same time a nucleotide in the first DNA sequence and the nucleotide
in the second DNA sequence that forms a base-pair with the
nucleotide in the first DNA sequence in the duplex DNA by using the
at least two oligonucleotides as described herein, further
unexpectedly improving targeted nucleotide exchange.
[0028] Each of the oligonucleotides comprising the at least one
mismatch zero, one or at most two nucleotide(s) from the 3' end and
as described herein may be further modified by the inclusion of
modified nucleotides, i.e. nucleotides having a base modification,
a backbone modification, a sugar modification and/or a modification
at the 3' end and/or 5' end of said nucleotide. These modifications
include well-known modifications to either improve
binding/hybridization of the oligonucleotides to the target
sequence and/or to prevent or inhibit breakdown of the
oligonucleotides by so-called nucleases. Examples of such modified
nucleotides include locked nucleic acids, or nucleotides having
phosphorothioate linkages. However, as shown in example 2, it is
not required that the first or the second oligonucleotide according
to the invention incorporates nucleotides having phosphorothioate
linkages nor is it required that any other type of modified
nucleotide is incorporated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 Nucleotide sequence of the GFP ORF containing a stop
codon (SEQ ID NO:1).
[0030] FIG. 2 Amino acid sequence of the GFP-STOP protein. The
position of the stop codon is represented by the asterisk (SEQ ID
NO:2).
[0031] FIG. 3 The constructs used in this study.
[0032] FIG. 4 Data showing TNE efficiency with oligonucleotides
according to the invention.
[0033] FIG. 5 shows the nucleotide sequence of the YFP-STOP
construct (SEQ ID NO:12). The nucleotide at position 186 has been
altered (C to A), resulting in an in-frame stop codon.
[0034] FIG. 6 shows the protein sequence of the YFP-STOP (SEQ ID
NO:13). The position of the stop codon in the protein is indicated
by an asterisk.
DEFINITIONS
[0035] In the following description and examples, a number of terms
are used. In order to provide a clear and consistent understanding
of the specification and claims, including the scope to be given
such terms, the following definitions are provided. Unless
otherwise defined herein, all technical and scientific terms used
have the same meaning as commonly understood by one of ordinary
skill in the art to which this invention belongs. The disclosures
of all publications, patent applications, patents and other
references are incorporated herein in their entirety by
reference.
[0036] As used herein, the singular forms "a," "an" and "the"
include plural referents unless the context clearly dictates
otherwise. For example, a method for isolating "a" DNA molecule, as
used above, includes isolating a plurality of molecules (e.g. 10's,
100's, 1000's, 10's of thousands, 100's of thousands, millions, or
more molecules). In particular, the invention described herein
takes advantage of the use of at least two oligonucleotides. Where
in the description reference is made to "a" or "the"
oligonucleotide, this is not to be understood by the skilled person
to indicate the absence of one of the at least two
oligonucleotides, but is to be understood to indicate that
reference is made, independently, to one, two, or more or all of
the at least two oligonucleotides applied in the method according
to the invention, unless the context clearly dictates otherwise.
For example, if it is mentioned that the oligonucleotide may
comprise an LNA-nucleotide, this is to be understood by the skilled
person that one of the oligonucleotides may comprise such
LNA-residue, but also that both of the at least two
oligonucleotides may comprise such LNA-residue.
[0037] In this document and in its claims, the verb "to comprise"
and its conjugations is used in its non-limiting sense to mean that
items following the word are included, but items not specifically
mentioned are not excluded.
[0038] Methods of carrying out the conventional techniques used in
method of the invention will be evident to the skilled worker. The
practice of conventional techniques in molecular biology,
biochemistry, computational chemistry, cell culture, recombinant
DNA, bioinformatics, genomics, sequencing and related fields are
well-known to those of skill in the art and are discussed, for
example, in the following literature references: Sambrook et al.,
Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et
al., Current Protocols in Molecular Biology, John Wiley & Sons,
New York, 1987 and periodic updates; and the series Methods in
Enzymology, Academic Press, San Diego.
[0039] A nucleic acid according to the present invention may
include any polymer or oligomer of pyrimidine and purine bases,
preferably cytosine, thymine, and uracil, and adenine and guanine,
respectively (See Albert L. Lehninger, Principles of Biochemistry,
at 793-800 (Worth Pub. 1982) which is herein incorporated by
reference in its entirety for all purposes). The present invention
contemplates any deoxyribonucleotide, ribonucleotide or peptide
nucleic acid component, and any chemical variants thereof, such as
methylated, hydroxymethylated or glycosylated forms of these bases,
and the like. The polymers or oligomers may be heterogenous or
homogenous in composition, and may be isolated from naturally
occurring sources or may be artificially or synthetically produced.
In addition, the nucleic acids may be DNA or RNA, or a mixture
thereof, and may exist permanently or transitionally in
single-stranded or double-stranded form, including homoduplex,
heteroduplex, and hybrid states.
[0040] (Synthetic) oligonucleotide: single-stranded DNA molecules
having preferably from about 5 to about 150 bases, which can be
synthesized chemically are referred to as synthetic
oligonucleotides. In general, these synthetic DNA molecules are
designed to have a unique or desired nucleotide sequence, although
it is possible to synthesize families of molecules having related
sequences and which have different nucleotide compositions at
specific positions within the nucleotide sequence. The term
synthetic oligonucleotide will be used to refer to DNA molecules
having a designed or desired nucleotide sequence.
[0041] "Targeted Nucleotide Exchange" or "TNE". Targeted nucleotide
exchange (TNE) is a process by which at least one synthetic
oligonucleotide, at least partially complementary to a site in a
chromosomal or an episomal gene directs the reversal of a
nucleotide at a specific site. TNE has been described using a wide
variety of oligonucleotides and targets. Some of the reported
oligonucleotides are RNA/DNA chimeras, contain terminal
modifications to impart nuclease resistance.
DETAILED DESCRIPTION OF THE INVENTION
[0042] In one aspect, the invention pertains to a method for
targeted alteration of a duplex acceptor DNA sequence comprising a
first DNA sequence and a second DNA sequence which is the
complement of the first DNA sequence.
[0043] The method comprises combining a/the duplex acceptor DNA
sequence with at least two donor oligonucleotides, being a first
oligonucleotide and a second oligonucleotide. The first
oligonucleotide comprises at least one domain that is capable of
hybridizing to the first DNA sequence and further comprises at
least one mismatch with respect to the first DNA sequence. This at
least one mismatch is positioned at most 2 nucleotides from the 3'
end of said first oligonucleotide. Preferably the mismatch is
positioned at most 1 nucleotide from the 3' end of said
oligonucleotide, even more preferably the mismatch is 0 nucleotides
from the 3' end of said oligonucleotide, in other words, is at the
3' end of said oligonucleotide. The second oligonucleotide
comprises at least one domain that is capable of hybridizing to the
second DNA sequence and further comprises at least one mismatch
with respect to the second DNA sequence. This at least one mismatch
is positioned at most 2 nucleotides from the 3' end of said second
oligonucleotide. Preferably the mismatch is positioned at most 1
nucleotide from the 3' end of said oligonucleotide, even more
preferably the mismatch is 0 nucleotides from the 3' end of said
oligonucleotide, in other words, is at the 3' end of said
oligonucleotide. The at least one mismatch in the first
oligonucleotide is relative to a nucleotide in the first DNA
sequence of the duplex acceptor DNA sequence and the at least one
mismatch in the second oligonucleotide is relative to a nucleotide
in the second DNA sequence of the duplex acceptor DNA, wherein said
nucleotides occupy complementary positions in the duplex acceptor
DNA (i.e. can form a base pair in the duplex acceptor DNA). In
other words, the at least two oligonucleotides target the same base
pair in the duplex acceptor DNA, the mismatch of the first
oligonucleotide targets the nucleotide in the first DNA sequence
and the mismatch of the second oligonucleotide targets the
complementary nucleotide in the second DNA sequence in the duplex
DNA.
[0044] In other words, there is provided a method for targeted
alteration of a duplex acceptor DNA sequence comprising a first DNA
sequence and a second DNA sequence which is the complement of the
first DNA sequence, the method comprising combining the duplex
acceptor DNA with at least two oligonucleotides wherein the first
oligonucleotide comprises a domain that is capable of hybridizing
to the first DNA sequence and further comprises a mismatch relative
to a nucleotide in the first DNA sequence and the second
oligonucleotide comprises a domain that is capable of hybridizing
to the second DNA sequence and further comprises a mismatch
relative to a nucleotide in the second DNA sequence and wherein
said nucleotides in the first DNA sequence and the second DNA
sequence occupy complementary positions in the duplex acceptor DNA
(e.g. form a base pair in the duplex acceptor DNA), and wherein,
independently, the mismatch in the first oligonucleotide and the
mismatch in the second oligonucleotide is positioned at most 2
nucleotides from the 3' end of said oligonucleotide.
[0045] As mentioned above, each oligonucleotide of the at least two
oligonucleotides according to the invention comprises a domain that
is capable of hybridizing either to the first or the second DNA
sequence (under conditions that allow hybridization, as known to
the skilled person). Preferably, the domain that is capable of
hybridizing to the first DNA sequence comprises at least one
mismatch with respect to the first DNA sequence, or the mismatch is
positioned directly adjacent to said domain (as long as the
mismatch is at most 2 nucleotides from the 3' end of said
oligonucleotide). Preferably, the domain that is capable of
hybridizing to the second DNA sequence comprises at least one
mismatch with respect to the second DNA sequence, or the mismatch
is positioned directly adjacent to said domain (as long as the
mismatch is at most 2 nucleotides from the 3' end of said
oligonucleotide).
[0046] The method according to the invention allows for the
specific and selective alteration of one or more nucleotides at (a)
specific site(s) of an acceptor DNA sequence by means of
oligonucleotides directed to both strands of the duplex DNA and
each directed to a different nucleotide of the same base-pair as in
present in the duplex DNA.
[0047] In particular the targeted alteration can be performed
within a target cell containing the duplex acceptor DNA sequence by
the introduction into that cell of the at least two
oligonucleotides according to the invention, i.e. a first
oligonucleotide having, in comparison to the first DNA sequence to
which it may hybridize, at least one mismatch and wherein said at
least one mismatch is positioned at most 2, preferably at most 1
nucleotide from the 3' end of said oligonucleotide and a second
oligonucleotide having, in comparison to the second DNA sequence to
which it may hybridize, at least one mismatch and wherein said at
least one mismatch is positioned at most 2, preferably at most 1
nucleotide from the 3' end of said oligonucleotide, and wherein the
mismatch in the first oligonucleotide and the mismatch in the
second oligonucleotide are each directed to a different nucleotide
of the same base-pair in the duplex DNA.
[0048] Most preferably said at least one mismatch is at the 3' end
of the oligonucleotide, even more preferably said at least one
mismatch is at the 3' end in both oligonucleotides. The result of
the method is the targeted alteration in a strand of one or more
nucleotides so that the sequence of the target DNA sequence is
altered. The invention may preferably be performed in vivo but may
also be performed ex vivo or in vitro.
[0049] Within the context of the current invention, the duplex DNA
sequence comprises a first DNA sequence and a second DNA sequence.
The second DNA sequence is the complement of the first DNA sequence
and pairs to it to form the duplex. For example, a complement of a
first DNA sequence ATTT (in the 5' to 3' direction) is TAAA (in the
3' to 5' direction). This second DNA sequence pairs with the first
DNA sequence to form a duplex. In case the duplex DNA sequence is,
for example, part of a gene, the first DNA sequence may be either
on the sense strand or anti-sense strand.
[0050] The DNA of the duplex DNA sequence may be any type of DNA,
such as genomic DNA, DNA derived from genomic DNA, linear DNA,
artificial chromosomes, nuclear chromosomal DNA, organellar DNA,
BACs, YACs, plasmid DNA, or episomal DNA. The DNA sequence may be
part of an intron or an exon, coding or non-coding, regulating
expression or not.
[0051] The oligonucleotides used in the method disclosed herein are
preferably single stranded and comprise at least one domain that is
capable of hybridizing to either the first DNA sequence (the first
oligonucleotide) or the second DNA sequence (the second
oligonucleotide).
[0052] For each of the two oligonucleotide, and independently from
each other, the at least one mismatch with respect to the DNA
sequence to be altered and which mismatch is positioned 0, 1 or 2
nucleotides from the 3' end of the oligonucleotide, is either
comprised in the domain that is capable of hybridizing to the first
(for the first oligonucleotide) or second (for the second
oligonucleotide) DNA sequence or is directly adjacent to the
domain.
[0053] The at least one domain in the oligonucleotide may thus
comprise at least one mismatch with respect to the DNA sequence to
be altered or is directly next/adjacent to the mismatch. In other
words, the oligonucleotide comprises a domain consisting of
adjacent nucleotides than can hybridize, under the conditions of
the experiment, with the first or second DNA sequence of the duplex
acceptor DNA sequence, and either comprises a mismatch with respect
to said first or second DNA sequence or the mismatch is positioned
directly next to said domain (and wherein the mismatch is
positioned 0, 1 or 2 nucleotides from the 3' end of the
oligonucleotide).
[0054] For example, if the domain is (in the 5' to 3' direction)
positioned up to 3 nucleotides from the 3' end, the mismatch may be
directly next to the domain 2 nucleotides from the 3' end of the
oligonucleotide. For example if the domain is (in the 5' to 3'
direction) positioned up to 1 nucleotide from the 3' end, the
mismatch can be comprised in the domain, e.g. localized 2
nucleotides from the 3' end, of be directly adjacent to the domain,
i.e. localized 0 nucleotides from the 3' end, in other words at the
3' end of the oligonucleotide.
[0055] It is to be understood that choices with respect to the
position of the mismatch in each of the at least two
oligonucleotides can be made independently from the other
oligonucleotide. In other words, in case the mismatch in the first
oligonucleotide is, for example, at the 3' end of said
oligonucleotide, the mismatch in the second oligonucleotide not
necessarily has to be positioned at the 3' end of said
oligonucleotide, but may also be positioned, for example at most 2
nucleotides from the 3' end of said oligonucleotide.
[0056] It is to be understood by the skilled person that within the
context of the current invention, and where reference is made to
the mismatch or the mismatch comprised in the domain that is
capable of hybridizing with the first or second DNA sequence, these
include any mismatch comprised in the domain or positioned directly
adjacent to the domain, as long as the mismatch is positioned 2, 1
or 0 nucleotides from the 3' end of the oligonucleotide.
[0057] In preferred embodiments the first oligonucleotide comprises
preferably no more than one mismatch with respect to the first DNA
sequence, and/or the second oligonucleotide comprises preferably no
more than one mismatch with respect to the second DNA sequence
(both directed to a different nucleotide of a base-pair as present
in the duplex DNA).
[0058] In certain embodiments, more than one mutation can be
introduced into the target DNA, either simultaneously or
successively. The oligonucleotide can accommodate more than one
mismatch on either adjacent or on removed locations on the
oligonucleotide. In certain embodiments the oligonucleotide can
comprise two, three, four or more mismatch nucleotides which may be
remote (i.e. non-adjacent). The oligonucleotide can comprise
further domains to accommodate this. The mismatches may be in the
same or in different domains.
[0059] It will be understood by the skilled person that the
oligonucleotides according to the invention may further comprise
non-hybridizing parts, in other words adjacent nucleotides that do
not hybridize with the first or second DNA sequence, for example as
these parts are not complementary to any sequence in the first or
second DNA sequence.
[0060] In a preferred embodiment the first oligonucleotide
comprises one domain that is capable of hybridizing to the first
DNA sequence and comprises, or is directly adjacent to at least one
mismatch, preferable one mismatch, with respect to the DNA sequence
to be altered and the second oligonucleotide comprises one domain
that is capable of hybridizing to the second DNA sequence and
comprises, or is directly adjacent to at least one mismatch,
preferable one mismatch, with respect to the DNA sequence to be
altered, wherein the at least one mismatch in the first
oligonucleotide is relative to a nucleotide in the first DNA
sequence of the duplex acceptor DNA sequence and wherein the at
least one mismatch in the second oligonucleotide is relative to a
nucleotide in the second DNA sequence of the duplex acceptor DNA,
and wherein said nucleotides occupy complementary positions in the
duplex acceptor DNA (e.g. form a base pair in the duplex acceptor
DNA).
[0061] In such embodiment the oligonucleotide may, in principal,
comprise more than one domain that is capable of hybridizing to the
respective first or second DNA sequence, however only one of the
domains may comprise, or be directly adjacent to, the at least one
mismatch (or the one mismatch), as disclosed herein. In another
preferred embodiment the oligonucleotide, preferably both
oligonucleotides, comprise(s) only one domain that can hybridize to
the duplex DNA. Such domain is located near or at the 3' end of the
oligonucleotide and includes the mismatch, or is directly adjacent
to the mismatch.
[0062] The oligonucleotides that are used as donors in the method
disclosed herein can vary in length but generally vary in length
between 10 and 500 nucleotides, with a preference for 11 to 100
nucleotides, preferably from 15 to 90, more preferably from 20 to
70.
[0063] The domain may consist of at least 5 nucleotides, including
the mismatch, but may also consist of all nucleotides, including
the mismatch, of the oligonucleotide. In case the mismatch is
directly adjacent to the domain, the domain may consist of at least
5 nucleotides, but may also consist of all nucleotides of the
oligonucleotide, except for the mismatch. Domain(s) in the
oligonucleotide are typically in the order of at least 5, 10,
preferably 15, 20, 25 or 30 nucleotides.
[0064] The oligonucleotides according to the invention comprise at
least one mismatch that is positioned at most 2, preferably at most
1 nucleotide from the 3' end of said oligonucleotide. Preferably
said (at least one) mismatch is at the 3' end of the
oligonucleotide, most preferably said (at least one) mismatch is at
the 3' end of the oligonucleotide in both the first oligonucleotide
and the second oligonucleotide. A person skilled in the art
understands what the term 3' end encompasses. A single-stranded
non-circular DNA molecule has two ends, the 3' end and the 5' end
(also referred to as "three prime end" and "five prime end").
[0065] The 5' end of a single strand nucleic acid designates that
specific nucleotide of which the C-5 carbon atom forms the terminal
carbon atom of the sugar-phosphate backbone. The C-5 carbon atom
may or may not be linked to a phosphate group by a phosphodiester
bond, but this phosphate group in turn does not form any linkage
with another nucleotide. The 3' end of a single strand nucleic acid
designates that specific nucleotide of which the C-3 carbon atom,
is not linked to any other nucleotides, whether by means of a
phosphate diester bond or otherwise. The C-5 atom is the 5.sup.th
carbon atom of the ribose or deoxyribose molecule and does not form
part of the furanose ring, starting counting from the C atom
directly adjacent to both the oxygen of the furanose ring and the
nucleobase. The C-3 atom is the 3.sup.rd carbon atom of the ribose
or deoxyribose molecule and forms part of the furanose ring,
starting counting from 1 which is the C atom directly adjacent to
both the oxygen of the furanose ring and the nucleobase.
[0066] The term "mismatch positioned 2 nucleotides from the 3' end"
indicates that the mismatch is two nucleotides from the nucleotide
at the 3' terminus of the oligonucleotide. The term "mismatch
positioned 1 nucleotide from the 3' end" indicates that the
mismatch is one nucleotide from the nucleotide at the 3' terminus
of the oligonucleotide. The term "mismatch positioned 0 nucleotides
from the 3' end" indicates that the mismatch is the nucleotide at
the 3' terminus of the oligonucleotide.
[0067] In a preferred embodiment of the method described herein,
the mismatch in the first oligonucleotide or the mismatch in the
second oligonucleotide is, independently, positioned at most 1
nucleotide from the 3' end of said oligonucleotide, more preferably
said at least one mismatch is at the 3' end of the oligonucleotide,
preferably the mismatch in both oligonucleotides is at the 3' end
of the respective oligonucleotides.
[0068] Also preferred in the method described herein is that the
domain in the first oligonucleotide and/or in the second
oligonucleotide comprises or is directly adjacent to the at least
one mismatch.
[0069] In addition, preferably in the method described herein, the
first oligonucleotide is complementary to the first DNA sequence
except for the mismatch and/or the second oligonucleotide is
complementary to the second DNA sequence except for the mismatch.
In such embodiment the first oligonucleotide thus comprises one
mismatch with respect to the first DNA sequence and the second
oligonucleotide comprises one mismatch with respect to the second
DNA sequence (each direct to a different nucleotide of a base-pair
in the duplex DNA). Such oligonucleotide is complementary to the
first or second DNA sequence over the entire length of the
oligonucleotide except for the one mismatch positioned at most 2,
preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said mismatch is at the 3' end of
the oligonucleotide. In another embodiment, the oligonucleotide is
(in the 5' to 3' direction) complementary to the first or second
DNA sequence over the entire length of the oligonucleotide up to
the position of the mismatch (localized 2, 1 or 0 nucleotides from
the 3' end). Even more preferably, the mismatch in the first
oligonucleotide is at the 3' end and the mismatch in the second
oligonucleotide is at the 3' end, and the first oligonucleotide is
complementary to the first DNA sequence over the entire length of
the oligonucleotide, except for the mismatch, and the second
oligonucleotide is complementary to the second DNA sequence over
the entire length of the oligonucleotide, except for the
mismatch.
[0070] In another preferred embodiment of the method described
herein, the first oligonucleotide and/or the second oligonucleotide
comprises at least one section that contains at least one modified
nucleotide, wherein the modification is selected from the group
consisting of a base modification, a 3' and/or 5' end base
modification, a backbone modification or a sugar modification.
[0071] The base modification, 3' and/or 5' end base modifications,
backbone modification, and/or sugar modifications can be
incorporated into the oligonucleotides to increase the
(binding/hybridization) affinity of the oligonucleotides to the
target sequence and, either independently or additionally, to
increase the oligonucleotides resistance against cellular
nucleases. However, as shown in example 2, it is not required that
the first or the second oligonucleotide incorporates any modified
nucleotide.
[0072] Any modification of a nucleotide in an oligonucleotide that
provides an oligonucleotide suitable for use in the method
according to the invention (and comprising at least one mismatch
positioned at most 2, preferably at most 1 nucleotide from the 3'
end of said oligonucleotide, most preferably said mismatch is at
the 3' end of the oligonucleotide) can advantageously be used. It
will be understood by the skilled person that a modification is
relative to any one of a naturally occurring A, C, T, G
nucleotides.
[0073] Advantageously, although not essential to the invention, the
first and/or the second oligonucleotide for use in the method
according to the invention may comprise modified nucleotides. In
case both the first and the second oligonucleotide comprise
modification(s), the modifications of the first may be the same as
or different from the modifications of the second. In particular,
any of the modifications discussed below may be incorporated in the
first and/or the second oligonucleotide according to the
invention.
[0074] For example, the first and/or the second oligonucleotide may
comprise modification(s) that increase the resistance of the
oligonucleotide against cellular nucleases, if compared to
naturally occurring A, T, C, and G nucleotides. These modifications
may include base modifications, backbone modifications, and/or
sugar modifications. Typically, such modified nucleotides that
increase the resistance of the oligonucleotide against cellular
nucleases may result in an increased stability of the
oligonucleotide in a cellular environment, which may result in
improved targeted nucleotide exchange. Preferably, the first and/or
the second oligonucleotides for use according to the method of the
invention comprises at least 1, preferably at least 2, more
preferably at least 4, more preferably at least 6, most preferably
at least 8 modified nucleotides that increase the resistance of the
oligonucleotide against cellular nucleases if compared to naturally
occurring A, T, C, and G nucleotides. Alternatively, or at the same
time, the first and/or the second oligonucleotide for use according
to the method of the invention comprises at most 25, preferably at
most 20, more preferably at most 15, most preferably at most 10
modified nucleotides that increase the resistance of the
oligonucleotide against cellular nucleases if compared to naturally
occurring A, T, C, and G nucleotides. Such modified nucleotides may
be positioned at any position within the first and/or the second
oligonucleotide, preferably within 20 nucleotides, preferably
within 15, more preferably within 10, even more preferably within
8, even more preferably within 6 nucleotides from the 3' end and/or
5' end of the respective oligonucleotide, and most preferably at
the last nucleotides at the 3' end and/or at the last nucleotides
at the 5' end. As the mismatch which is to be incorporated in the
target DNA sequence is located zero, one, or at most two
nucleotide(s) from the 3' end of the oligonucleotides, it is
particularly preferred that such modified nucleotide(s) protect the
3' side against cellular nucleases and thus are positioned on the
3' end of the first and/or the second oligonucleotide, such as
within 20, 15, 10, 9, 8, 7, 6, or 4 nucleotides from the 3' end.
However, as described earlier, and as shown in example 2, it is not
essential to the invention that the oligonucleotide indeed includes
modified nucleotides that increase resistance of the
oligonucleotide against cellular nucleases.
[0075] Various of such modified nucleotides are mentioned herein,
which increase the resistance of the oligonucleotide against
cellular nucleases if compared to naturally occurring A, T, C, and
G nucleotides and which may be incorporated in the first and/or the
second oligonucleotide for use in the method according to the
invention. Such modified nucleotide may be a nucleotide having
phosphorothioate linkage(s), but may also be a phosphoramidite, a
methylphosphonate, or a nucleotide with nonphosphate
internucleotide bonds such as carbonates, carbamates, siloxane,
sulfonamides and polyamide nucleic acid. Also, the modified
nucleotides conferring cellular nuclease resistance as described in
WO0226967 may be used, such as LNA (Locked Nucleic Acid), or any
other modified nucleotide that improves cellular nuclease
resistance of the oligonucleotide as known by the skilled
person.
[0076] Alternatively or additionally to the above-described
nuclease resistance conferring modified nucleotides, the first
and/or the second oligonucleotide for use in the method according
to the invention may comprise modified nucleotides having a higher
binding affinity to the target DNA sequence if compared to
naturally occurring A, T, C, and G nucleotides. These modification
may include base modifications, backbone modifications, and/or
sugar modifications. Typically, such modified nucleotides having
increased binding affinity will affect stronger base-pairing with
the target sequence, which may result in an increased stability of
the hybrid between the oligonucleotide and the target sequence,
which is believed to result in improved targeted nucleotide
exchange. Preferably, the first and/or the second oligonucleotide
for use according to the method of the invention comprises at least
1-10, preferably 1-8, more preferably 1-6, even more preferably
1-4, such as 1, 2, 3, or 4, even more preferably 2 modified
nucleotides having a higher binding affinity to the target DNA
sequence if compared to naturally occurring A, T, C, and G
nucleotides. Such modified nucleotides as mentioned above may be
positioned at any position within the first and/or the second
oligonucleotide, preferably at a position one nucleotide away from
the mismatch, preferably at most 2, 3, 4, 5, 6, or 7 nucleotides
away from the mismatch. Preferably, such modified nucleotide is
located at the 5' side of the mismatch, but it may also be opted to
position such modified nucleotide at the 3' side of the mismatch if
the mismatch is not positioned at the last nucleotide at the 3' end
of the first and/or the second oligonucleotide.
[0077] Various examples of such modified nucleotides having a
higher binding affinity to the target DNA sequence if compared to
naturally occurring A, T, C, and G nucleotides are mentioned herein
which may be incorporated in the oligonucleotide for use in the
method according to the invention, including 2-OMe substitution,
LNA (Locked Nucleic Acid), ribonucleotide, superA, superT, or any
other type of modified nucleotide that improves binding affinity of
the oligonucleotide to the target DNA sequence if compared to
naturally occurring A, T, C, and G nucleotides, as known by the
skilled person.
[0078] Determining whether a modified nucleotide confers increased
resistance against cellular nucleases if compared to naturally
occurring A, T, G, C nucleotides may for example be done by
comparing half-life times of a oligonucleotide having said modified
nucleotide with a oligonucleotide not having said modified
nucleotide, in the presence of cellular nucleases as e.g. present
in tomato extract, tomato cells, or in E. coli. If the half-life
time of the first mentioned is higher, said modified nucleotide
confers increased resistance against cellular nucleases if compared
to naturally occurring A, T, G, C nucleotides. Determining whether
a modified nucleotide confers higher binding affinity to the target
DNA sequence if compared to naturally occurring A, T, C, or G
nucleotides may for example be done by comparing melting
temperature (Tm) of the duplex formed between the oligonucleotide
having said modified nucleotide and its target over that formed by
the oligonucleotide not having said modified nucleotide and its
target. If the melting temperature of the first mentioned is
higher, said modified nucleotide confers higher binding affinity to
the target DNA sequence if compared to naturally occurring A, T, G,
C nucleotides.
[0079] A section according to the present invention is to be
understood to be any part of the oligonucleotide with a length of
at least one nucleotide. For example, a section may comprise 1-10,
preferably 1-6, more preferably 1-4, more preferably 1-2
nucleotides, and may be positioned at the 3' side and/or the 5'
side of the mismatch. The at least one section can be part of a
domain according to the invention; in other words the section may
be in a domain that can hybridize with the first or second DNA
sequence. Alternatively, the section may overlap with a domain,
either completely or partially. In case of complete overlap the
section may have the same length of the domain, but may also have a
length with exceeds the length of the domain. In the case of
partial overlap, the domain and the section share at least one
nucleotide.
[0080] Depending on the type of modification used in the
oligonucleotide there may be a preference for the modified
nucleotide to be part of a domain that can hybridize with the first
or second DNA sequence, and which domain comprises or is directly
adjacent to the at least one mismatch positioned at most 2,
preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said mismatch is at the 3' end of
the oligonucleotide. This is in particular the case for modified
nucleotides with a higher binding affinity compared to naturally
occurring A, C, T or G nucleotides with its complementary
nucleotide.
[0081] Base modifications include, but are not limited to such
modifications as for example described in WO0226967, including
modifications at the C-5 position of pyrimidines such as
2'-deoxyuridine, 5-fluoro-2'-deoxyuridine, 5-bromo-2'-deoxyuridine
and 5-methyl-2'-deoxycytidine. Other base modifications include
synthetic and natural nucleobases like 5-methylcytosine,
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine
and thymine, 5-uracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0082] End (3' and/or 5') modifications may include 2'-O-methyl
bases, 3' amine groups, phosphorothioate linkages, or any other
modification that is nuclease resistant. The skilled person is well
aware of these kinds of modifications. Providing resistance to
nuclease is believed to further improve the targeted nucleotide
exchange.
[0083] Various backbone modifications, such as those mentioned in
WO0226967, including phosphorothioates, phosphoramidites and
methylphosphonates, and those with nonphosphate internucleotide
bonds, such as carbonates, carbamates, siloxane, sulfonamides and
polyamide nucleic acid will increase the resistance to cellular
nucleases. Such backbone modifications are therefore useful in the
oligonucleotide used in the method according to the invention.
[0084] In addition, sugar modifications, including but not limited
to 2'-O-methyl, 2'-fluoro or 2'-methoxyethoxy can increase the
thermodynamic stability of a formed duplex, and at the same time
provide improved nuclease resistance.
[0085] Other examples of suitable modifications are described in
WO2007073149. Modification of the donor oligonucleotides can for
example comprise phosphorothioate linkages, 2-OMe substitutions,
the use of LNAs (Locked nucleic acids), ribonucleotide and other
bases that modify and preferably enhance, the stability of the
hybrid between the oligonucleotide and the acceptor stand either by
improving affinity binding to the target DNA or by inhibition of
nuclease activity, or both.
[0086] All these types of modifications are well know to the
skilled person and are readily available from various commercial
sources. It will be understood by the skilled person that
modification can be introduced in the first oligonucleotide
independently of the second oligonucleotide used in the method
described herein. For example, the first oligonucleotide may
comprise such modifications as described above, whereas the second
oligonucleotide does not. Alternatively the first oligonucleotide
may comprise more, less or different modification at the same or at
different positions in the oligonucleotide in comparison to the
second oligonucleotide.
[0087] In an embodiment there is provided for a method according to
the invention wherein a modified nucleotide is incorporated in the
oligonucleotide, or in both, and wherein the modified nucleotide
has a higher binding affinity compared to naturally occurring A, C,
T, or G nucleotides with its complementary nucleotide, and wherein
the modified nucleotide binds stronger to a nucleotide in the
opposite position in the first or second DNA sequence as compared
to a naturally occurring nucleotide complementary to the nucleotide
in the opposite position in the first or second DNA sequence and/or
wherein the modified nucleotide is a nuclease resistant
nucleotide.
[0088] Preferably the modification is a base modification, a 3' end
and/or 5' end base modification, a backbone modification or a sugar
modification. As discussed above, the donor oligonucleotides
according to the invention may contain modifications to improve the
hybridization characteristics such that the donor exhibits
increased affinity for the target DNA strand, which may make
intercalation of the donor easier and/or increases the
thermodynamic stability of the formed duplex (in comparison to the
same oligonucleotide not comprising such modification, and under
the same experimental circumstances). The donor oligonucleotide can
independently or in addition be modified to become more resistant
against nucleases, which may stabilize the duplex structure.
[0089] In the prior art a wide variety of modified nucleotides
having a higher binding affinity compared to naturally occurring A,
C, T, or G nucleotides with its complementary nucleotide, and
wherein the modified nucleotide binds stronger to a nucleotide in
the opposite position in the first or second DNA sequence as
compared to a naturally occurring nucleotide complementary to the
nucleotide in the opposite position in the first or second DNA
sequence and/or wherein the modified nucleotide is a nuclease
resistant nucleotide have been described (see for Example WO
2007073154 and the various modifications discussed above).
[0090] In certain embodiments, a modification is at a position one
nucleotide away from to the mismatch, preferably 2, 3, 4, 5, 6 or 7
nucleotides away from the mismatch. In certain embodiments,
modification is located at a position downstream from the mismatch.
In certain embodiments, modification is located at a position
upstream from the mismatch.
[0091] The domain that contains or is directly adjacent to the
mismatch and the sections containing the modified nucleotide(s) may
be overlapping. Thus, in certain embodiments, the domain containing
the mismatch or directly adjacent to the mismatch is located at a
different position on the oligonucleotide than the section of which
the modification is considered. In certain embodiments, the domain
incorporates one or more sections. In certain embodiments, sections
can incorporate the domain. In certain embodiments, the domain and
the sections may be located at the same position on the
oligonucleotide and have the same length i.e. the sections coincide
in length and position. In certain embodiments, there can be more
than one section within a domain.
[0092] For the present invention, this means that the part of the
oligonucleotide that contains the mismatch which is to alter the
DNA duplex can be located at a different or shifted position from
the part of the oligonucleotide that is modified.
[0093] Again, it will be understood by the skilled person that
modifications can be introduced in the first oligonucleotide
independently of the second oligonucleotide used in the method
described herein. For example, the first oligonucleotide may
comprise such modifications as described above, whereas the second
oligonucleotide does not. Alternatively the first oligonucleotide
may comprise more, less or different modifications at the same or
at different positions in the oligonucleotide in comparison to the
second oligonucleotide.
[0094] In a preferred embodiment the modified nucleotide is
selected from the group consisting of LNAs and/or nucleotides
having phosphorothioate bonds/linkage.
[0095] In a preferred embodiment, the modified nucleotide is a
Locked Nucleic Acid. Locked Nucleic Acid (LNA) is a DNA analogue
with interesting properties for use in antisense gene therapy and
is known to the skilled person.
[0096] LNAs are bicyclic and tricyclic nucleoside and nucleotide
analogues and may be incorporated in oligonucleotides. The basic
structural and functional characteristics of LNAs and related
analogues are disclosed in various publications and patents,
including WO99/14226, WO00/56748, WO00/66604, WO98/39352, U.S. Pat.
No. 6,043,060, and U.S. Pat. No. 6,268,490, all of which are
incorporated herein by reference in their entireties.
[0097] LNA nucleosides are available for all the common nucleobases
(T, C, G, A, U; for example from Exiqon (www.exiqon.com)) and are
able to form base pairs according to standard Watson-Crick base
pairing rules. When incorporated into a DNA oligonucleotide, LNA
makes the pairing with a complementary nucleotide strand more rapid
and increases the stability of the resulting duplex. In other
words, LNA combines the ability to discriminate between correct and
incorrect targets (high specificity) with very high bio-stability
(low turnover) and unprecedented affinity (very high binding
strength to target). In fact, the affinity increase recorded with
LNA leaves the affinities of all previously reported analogues in
the low-to-modest range.
[0098] LNA is an RNA analogue, in which the ribose is structurally
constrained by a methylene bridge between the 2'-oxygen and the
4'-carbon atoms. This bridge restricts the flexibility of the
ribofuranose ring and locks the structure into a rigid bicyclic
formation. This so-called N-type (or 3'-endo) conformation results
in an increase in the Tm (melting temperature) of LNA containing
duplexes, and consequently higher binding affinities and higher
specificities. Importantly, the favorable characteristics of LNA do
not come at the expense of other important properties as is often
observed with nucleic acid analogues.
[0099] LNA can be mixed freely with all other chemistries that make
up the DNA analogue universe. LNA bases can be incorporated into
oligonucleotides as short all-LNA sequences or as longer LNA/DNA
chimeras. LNAs can be placed in internal, 3' or 5'-positions.
However, due to their rigid bicyclic conformations, LNA residues
sometimes disturb the helical twist of nucleic acid strands. It is
hence generally less preferred to design an oligonucleotide with
two or more adjacent LNA residues. Preferably, the LNA residues are
separated by at least one (modified) nucleotide that does not
disturb the helical twist, such as a conventional nucleotide (A, C,
T, or G).
[0100] The originally developed and preferred LNA monomer (the
[beta]-D-oxy-LNA monomer) has been modified into new LNA monomers.
The novel [alpha]-L-oxy-LNA has been suggested to show superior
stability against 3' exonuclease activity, and is also more
powerful and more versatile than [beta]-D-oxy-LNA in designing
potent antisense oligonucleotides. Also xylo-LNAs, L-ribo LNAs and
other LNA's can be used, as disclosed in WO9914226, WO00/56748,
WO00/66604 and J. Org. Chem., 2010, 75 (7), pp 2341-2349. In the
present invention, any LNA of the above types is effective in
achieving the goals of the invention, i.e. improved efficiency of
TNE, with a preference for [beta]-D-LNA analogues.
[0101] As mentioned above, preferably, an LNA is at least one
nucleotide away from a mismatch in a (or both of the at least two
oligonucleotides) oligonucleotide used in the method according to
the invention. Although in the art on TNE, LNA modification has
been listed amongst a list of possible oligonucleotide
modifications as alternatives for the chimeric molecules used in
TNE, it has been found that when single-stranded DNA
oligonucleotides, as used in the method according to the invention,
are modified to contain LNA, TNE efficiency increase significantly
to the extent that has presently been found when the LNA is
positioned at least one nucleotide away from the mismatch, even
more preferably one nucleotide from the mismatch. The
oligonucleotide preferably does not contain more than about 75%
(rounded to the nearest whole number of nucleotides) LNAs.
[0102] In another preferred embodiment, the modified nucleotide
comprises a nucleotide having a phosphorothioate linkage. Many of
the nucleotide modifications commercially available have been
developed for use in antisense applications for gene therapy. The
simplest and most widely used nuclease-resistant chemistry
available for antisense applications (the "first generation"
antisense-oligonucleotide) is the phosphorothioate (PS) linkage. In
these molecules, a sulfur atom replaces a non-bridging oxygen in
the oligonucleotide phosphate backbone (see, for example, FIG. 2 of
WO2007073154, resulting in resistance to endonuclease and
exonuclease activity.
[0103] For gene therapy, a phosphorothioate/phosphodiester chimera
generally has one to four PS-modified internucleoside linkages on
both the 5'- and 3'-ends with a central core of unmodified DNA. The
phosphorothioate bonds can be incorporated, however, at any desired
location in the oligonucleotide.
[0104] Preferably the modified nucleotide is an LNA or, even more
preferably a nucleotide having a phosphorothioate linkage, more
preferably the modified oligonucleotide having at least one, for
example, one, two, three or four, phosphorothioate(s). Preferably
the oligonucleotide contains at least one phosphorothioate at or
near (e.g. within 1,2,3,4,5,6,7 nucleotides from) the 5' end of the
oligonucleotide according to the invention.
[0105] In an embodiment there is provided that the oligonucleotide
used in the method according to the invention comprises at least
two, three, four, or five modified nucleotides. Preferably the
oligonucleotide comprises two, three four or five modified
nucleotides. Preferably the modifications are selected from the
group consisting of LNAs and/or phosphorothioate bonds.
[0106] In certain preferred embodiments of the invention, the
nucleotide in the oligonucleotide at the position of the mismatch
can be modified. Whether or not the mismatch can be modified will
depend to a large extent on the exact mechanism of the targeted
nucleotide exchange or of the cell's DNA repair mechanism using the
difference in affinity between the donor and acceptor strands. In a
preferred embodiment the nucleotide at the position of the mismatch
is not a modified nucleotide.
[0107] In an embodiment there is provided for a method according to
the invention wherein the modified nucleotide is at least one
nucleotide from the at least one mismatch located at most 2,
preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said at least one mismatch is at
the 3' end of the oligonucleotide.
[0108] As discussed previously, it has been found that when
single-stranded DNA oligonucleotides, as used in the method
according to the invention, are modified to contain modified
nucleotides, for example LNA, TNE efficiency increases
significantly to the extent that has presently been found when the
modified nucleotide, preferably LNA, is positioned at least one
nucleotide away from the mismatch, even more preferably one
mismatch from the mismatch. In other words, in a preferred
embodiment, a modified nucleotide, preferably a LNA, is separated
from the mismatch by at least one other nucleotide, which at least
one other nucleotide is not a LNA, preferably not a modified
nucleotide. However, in case of for example a phosphorothioate
linkage, such linkage by be directly adjacent to the mismatch
nucleotide.
[0109] In an embodiment there is provided for a method wherein the
alteration of the duplex acceptor DNA is within a cell preferably
selected from the group consisting of a prokaryotic cell, a
bacterial cell, a eukaryotic cell, a plant cell, an animal cell, a
yeast cell, a fungal cell, a rodent cell, a human cell, a non-human
cell, and/or a(n) (non-human) embryonic cell. The invention is, in
its broadest form, generically applicable to all sorts of organisms
such as humans, animals, plants, fish, reptiles, insects, fungi,
bacteria and so on. The invention can thus be performed within a
cell selected from the group consisting of a prokaryotic cell, a
bacterial cell, a eukaryotic cell, a plant cell, an animal cell, a
yeast cell, a fungal cell, a rodent cell, a human cell, a non-human
cell, and/or an embryonic cell. In a preferred embodiment, the cell
is a plant cell.
[0110] There is also provided for a method as described herein
wherein the duplex acceptor DNA is obtained from a prokaryotic
organism, bacteria, a eukaryotic organism, a plant, an animal, a
yeast, a fungus, a rodent, or a human. In a preferred embodiment
the duplex acceptor DNA is obtained from a plant (or is plant DNA
present in a plant cell).
[0111] In an embodiment of the invention, the alteration of the
duplex acceptor DNA sequence is a deletion, a substitution and/or
an insertion of at least one nucleotide. Preferably the alteration
of the duplex DNA sequence is a deletion, a substitution and/or an
insertion of no more than 5 nucleotides, preferably no more than 4,
3, 2, 1 nucleotide(s), most preferably one nucleotide (or in other
words, one base-pair is modified in the duplex DNA). More
preferably the alteration of the duplex acceptor DNA sequence is a
substitution of no more than 5 nucleotides, preferably no more than
4, 3, 2, 1 nucleotide(s), most preferably one nucleotide.
[0112] In another embodiment there is provided a method according
to the invention, wherein the duplex acceptor DNA is from genomic
DNA, linear DNA, artificial chromosomes, mammalian artificial
chromosomes, bacterial artificial chromosomes, yeast artificial
chromosomes, plant artificial chromosomes, nuclear chromosomal DNA,
organellar DNA, and/or episomal DNA including plasmids.
[0113] Indeed the invention is applicable for the modification of
any type of DNA, such as those disclosed above. The invention can
be performed in vivo as well as ex vivo or in vitro, for example by
subjecting the DNA to be modified with the donor oligonucleotide in
the presence of proteins that are capable of targeted nucleotide
exchange, for instance, and in particular, proteins that are
functional in the mismatch repair mechanism of the cell.
[0114] The delivery of the oligonucleotide to a cell can be
achieved via electroporation or other conventional techniques that
are capable of delivering either to the nucleus or the cytoplasm.
In vitro testing of the method of the present invention can be
achieved using the Cell Free system as is described i.a. in
WO01/87914, WO03/027265, WO99/58702, WO01/92512. The
oligonucleotide may comprise methylated nucleotides, non-methylated
nucleotides or both.
[0115] The invention is, in its broadest form, applicable for many
purposes for altering a cell, correcting a mutation by restoration
to wild type, inducing a mutation, inactivating an enzyme by
disruption of coding region, modifying bioactivity of an enzyme by
altering coding region, modifying a protein by disrupting the
coding region.
[0116] The invention also relates to the use of oligonucleotides
essentially as described hereinbefore, for altering a cell,
correcting a mutation by restoration to wild type, inducing a
mutation, inactivating an enzyme by disruption of coding region,
modifying bioactivity of an enzyme by altering coding region,
modifying a protein by disrupting the coding region, mismatch
repair, targeted alteration of (plant) genetic material, including
gene mutation, targeted gene repair and gene knockout. Preferably
the method according to the invention is for targeted alteration of
duplex acceptor DNA obtained from a plant, present in a plant, or
to be presented to a plant.
[0117] The invention further relates to kits, preferably comprising
at least one, preferably both of the oligonucleotides used in the
method according to the invention, and as defined herein,
optionally in combination with proteins that are capable of
TNE.
[0118] In particular, the kit comprises instructions for targeted
alteration of a duplex DNA in accordance with the method described
and claimed herein. The instructions comprise essentially a
description of the steps of the method according to the invention
described herein.
[0119] In particular there is provided a kit comprising
instructions for performing a method for targeted alteration of a
duplex acceptor DNA according to the invention and as disclosed
herein, wherein the kit further comprises at least two
oligonucleotides for use in the method as described herein,
preferably the at least two oligonucleotides as described
herein.
[0120] In this embodiment, the kit may thus comprise at least a
first and a second oligonucleotide that, independently, each
comprise at least one domain that is capable of hybridizing to,
respectively, the first or second DNA sequence and which domain
comprises, or is directly adjacent to at least one mismatch with
respect to, respectively, the first or second DNA sequence, and
wherein said at least one mismatch is positioned at most 2,
preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said at least one mismatch is at
the 3' end of the oligonucleotide, and wherein the mismatch in the
first oligonucleotide and the mismatch in the second
oligonucleotide each target a different nucleotide, wherein the
nucleotide targeted in the first strand occupies the complementary
position of the targeted nucleotide in the second strand, e.g. the
nucleotides form a base-pair in the duplex DNA, and in addition
comprises instructions to perform the method according to the
invention.
[0121] As will be understood by the skilled person, by providing
instructions at least informing that the above mismatch is
positioned at the 3' end of the oligonucleotide(s) or 1 nucleotide
from the 3' end or 2 nucleotides from the 3' end, and that the
oligonucleotide(s) can be used for alteration of a duplex DNA
sequence, such kit comprising these instructions and the
oligonucleotide(s) are a kit within the scope of the above
described and claimed kits.
[0122] The kit may, for example, also take the form of a website or
a document providing instructions or information to perform
targeted alteration of a duplex acceptor DNA according to the
method of the invention, as described and disclosed herein, and the
(separate) provision or offering of an oligonucleotide(s) suitable
for use in the method according to the invention, and as described
and disclosed herein.
[0123] In a preferred embodiment there is provided for a kit
according to the invention, as described above, wherein the
oligonucleotide is an oligonucleotide that, when combined with a
duplex acceptor DNA sequence containing a first DNA sequence and a
second DNA sequence which is the complement of the first DNA
sequence, comprises a domain that is capable of hybridizing to the
first DNA sequence, which domain comprises, or is directly adjacent
to, at least one mismatch with respect to the first DNA sequence,
and wherein said at least one mismatch is located at most 2,
preferably at most 1 nucleotide from the 3' end of said
oligonucleotide, most preferably said at least one mismatch is at
the 3' end of the oligonucleotide.
[0124] In a preferred embodiment there is provided a kit wherein,
when combined with a duplex acceptor DNA sequence containing a
first DNA sequence and a second DNA sequence which is the
complement of the first DNA sequence, the first oligonucleotide
comprises at least one domain that is capable of hybridizing to the
first DNA sequence and wherein the first oligonucleotide further
comprises at least one mismatch with respect to the first DNA
sequence and wherein the at least one mismatch is positioned at
most 2 nucleotides from the 3' end of said first oligonucleotide;
and wherein the second oligonucleotide comprises at least one
domain that is capable of hybridizing to the second DNA sequence
and wherein the second oligonucleotide further comprises at least
one mismatch with respect to the second DNA sequence and wherein
the at least one mismatch is positioned at most 2 nucleotides from
the 3' end of said second oligonucleotide; and wherein the at least
one mismatch in the first oligonucleotide is relative to a
nucleotide in the first DNA sequence of the duplex acceptor DNA
sequence and wherein the at least one mismatch in the second
oligonucleotide is relative to a nucleotide in the second DNA
sequence of the duplex acceptor DNA, and wherein said nucleotides
occupy complementary positions in the duplex acceptor DNA (for
example, form a base pair in the duplex acceptor DNA).
[0125] As will be understood by the skilled person, in a preferred
embodiment, the mismatch in the first oligonucleotide and the
mismatch in the second oligonucleotide, each directed to a
different nucleotide in a (the same) base-pair in the duplex DNA,
is preferably such that when both mismatches would be introduced in
the duplex DNA, these are complementary to each other and may form
a base-pair (A-T/C-G) in the duplex DNA in which they are
introduced.
Examples
Example 1: TNE on a GFP Episome in Tobacco Protoplasts Using 2
Oligonucleotides
[0126] TNE involves the introduction of oligonucleotides into cells
where they induce a mutation in the genomic target locus, driven by
a mismatch nucleotide in the oligonucleotide.
[0127] In the experiments below accuracy and efficiency of TNE was
determined by performing TNE on an episome (plasmid) which carries
a non-functional Green fluorescent protein (GFP) containing an in
frame stop codon. Two oligonucleotides were designed each carrying
at the 3' end a mismatch nucleotide which could repair the stop
codon in GFP. Co-transfection of the plasmid together with the two
oligonucleotides restored GFP expression and activity which was, in
the experiments below, scored at a single cell level 24 hours after
protoplast transfection. This first example describes experiments
performed in tobacco protoplasts.
Materials and Methods
Constructs
[0128] The functional GFP open reading frame was synthesized and
the codon usage was optimized for use in the Solanaceae. A variant
of GFP was produced with a nucleotide change at position 82 (G to
T) as shown in FIG. 1. This resulted in the production of an in
frame stop codon and the amino acid sequence of the resulting
protein is shown in FIG. 2. The GFP ORF (GFP WT) and GFP variant
with the stop codon (GFP-STOP) were cloned as XhoI-SacI fragments
in the multiple cloning site of a pUC based vector containing the
CaMV 35S promoter for gene expression in plant cells. This resulted
in the constructs pKG7381 (GFP-WT) and pKG7384 (GFP-STOP). In
addition, GFP is translationally fused to a 6.times.HIS tag and an
NLS (sequence nuclear localization signal) to facilitate
accumulation of GFP protein in the protoplast nucleus and thus
improve our ability to score GFP positive cells. These constructs
are shown in FIG. 3.
Oligonucleotides
[0129] The oligonucleotides to repair the stop codon in the GFP
gene are shown in Table 1.
TABLE-US-00001 TABLE 1 Oligonucleotides used in this study. Oligo
Sequence Orientation ODM1 G*T*T*C*TCGAGATGGTGAGCAAG*G*G*C*T Sense
(SEQ ID NO: 3) ODM2 G*C*A*C*CACCCCGGTGAACAGCT*C*C*T*A Antisense
(SEQ ID NO: 4) ODM3 G*T*T*C*TCGAGATGGTGAGCAAG*G*G*C*G Sense (SEQ ID
NO: 5) ODM4 G*C*A*C*CACCCCGGTGAACAGCT*C*C*T*C Antisense (SEQ ID NO:
6) The mismatch nucleotide in ODM3 and ODM4 is underlined. The
asterisks represent phosphorothioate (PS) linkages. The orientation
of the oligonucleotide is given as sense (identical to the GFP
coding sequence) or antisense (complementary to the GFP coding
sequence). All oligonucleotides are shown in the 5'-3'
orientation.
Isolation and Transfection of Tobacco Protoplasts
[0130] The source material for this example was tobacco in vitro
shoot cultures, grown aseptically in glass jars (750 ml) in MS20
medium at a temperature of 25/20.degree. C. (day/night) and a
photon flux density of 80 .mu.Em.sup.-2s.sup.-1 (photoperiod of
16/24 h). MS20 medium is basic Murashige and Skoog's medium
(Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497,
1962) containing 2% (w/v) sucrose, no added hormones and 0.8% Difco
agar. The shoots were subcultured every 3 weeks to fresh
medium.
[0131] For the isolation of mesophyll protoplasts, fully expanded
leaves of 3-6 week old shoot cultures were harvested. The leaves
are sliced into 1 mm thin strips, which were then transferred to
large (100 mm.times.100 mm) Petri dishes containing 45 ml MDE basal
medium for a preplasmolysis treatment of 30 min at room
temperature. MDE basal medium contained 0.25 g KCl, 1.0 g
MgSO.sub.4.7H.sub.2O, 0.136 g of KH.sub.2PO.sub.4, 2.5 g
polyvinylpyrrolidone (MW 10,000), 6 mg naphthalene acetic acid and
2 mg 6-benzylaminopurine in a total volume of 900 ml. The
osmolarity of the solution was adjusted to 600 mOsmkg.sup.-1 with
sorbitol, the pH to 5.7.
[0132] After preplasmolysis, 5 ml of enzyme stock was added to each
Petri dish. The enzyme stock consisted of 750 mg Cellulase Onozuka
R10, 500 mg driselase and 250 mg macerozyme R10 per 100 ml (Duchefa
B. V., Haarlem, The Netherlands, e.g. products C8001 & M8002),
filtered over Whatman paper and filter-sterilized. The Petri dishes
were sealed and incubated overnight in the dark at 25.degree. C.
without movement to digest the cell walls.
[0133] The protoplast suspension was then passed through 500 .mu.m
and 100 .mu.m sieves into 250 ml Erlenmeyer flasks, mixed with an
equal volume of KCl wash medium, and centrifuged in 50 ml tubes at
85.times.g for 10 min. KCl wash medium consisted of 2.0 g
CaCl.sub.2.2H.sub.2O per liter and a sufficient quantity of KCl to
bring the osmolarity to 540 mOsmkg.sup.-1.
[0134] The centrifugation step was repeated twice, first with the
protoplasts resuspended in MLm wash medium, which is the
macro-nutrients of MS medium (Murashige, T. and Skoog, F.,
Physiologia Plantarum, 15: 473-497, 1962) at half the normal
concentration, 2.2 g of CaCl.sub.2.2H.sub.2O per liter and a
quantity of mannitol to bring the osmolality to 540 mOsmkg.sup.-1,
and finally with the protoplasts resuspended in MLs medium, which
is MLm medium with mannitol replaced by sucrose.
[0135] The protoplasts were recovered from the floating band in
sucrose medium and resuspended in an equal volume of KCl wash
medium. Their densities were counted using a haemocytometer.
Subsequently, the protoplasts were centrifuged again in 10 ml glass
tubes at 85.times.g for 5 min and the pellets resuspended at a
density of 1.times.10.sup.5 protoplasts ml.sup.-1 in
electroporation medium.
Protoplast Electroporation
[0136] A BioRad Gene Pulser apparatus was used for electroporation.
Using PHBS as an electroporation medium (10 mM Hepes, pH 7.2; 0.2 M
mannitol, 150 mM NaCl; 5 mM CaCl2) and with a protoplast density in
the electroporation mixture of ca. 1.times.10.sup.6 per ml, the
electroporation settings were 250V (625 V cm.sup.-1) charge and 800
.mu.F capacitance with a recovery time between pulse and
cultivation of 10 minutes. For each electroporation ca. 2 .mu.g
total oligonucleotide and 20 .mu.g KG7381 or KG7384 were used per
800 microliter electroporation.
[0137] After the electroporation treatment, the protoplasts were
placed on ice for 30 min to recover, then resuspended in T.sub.0
culture medium at a density of 1.times.10.sup.5 protoplasts
ml.sup.-1 and incubated at 21.degree. C. overnight in the dark.
T.sub.0 culture medium contained (per liter, pH 5.7) 950 mg
KNO.sub.3, 825 mg NH.sub.4NO.sub.3, 220 mg CaCl.sub.2.2H.sub.2O,
185 mg MgSO.sub.4.7H.sub.2O, 85 mg KH.sub.2PO.sub.4, 27.85 mg
FeSO.sub.4.7H.sub.2O, 37.25 mg Na.sub.2EDTA.2H.sub.2O, the
micro-nutrients according to Heller's medium (Heller, R., Ann Sci
Nat Bot Biol Veg 14: 1-223, 1953), vitamins according to Morel and
Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot. 38:
138-40, 1951), 2% (w/v) sucrose, 3 mg naphthalene acetic acid, 1 mg
6-benzylaminopurine and a quantity of mannitol to bring the
osmolality to 540 mOsmkg.sup.-1 The protoplasts were examined under
the UV microscope 20 hours after electroporation to visualize the
GFP signal in the nucleus.
[0138] Alternatively, PEG treatment could be used to introduce the
plasmid and oligonucleotide DNA into tobacco protoplasts. Methods
to achieve this are well known in the literature.
Results
[0139] When the construct KG7381 (GFP-WT) was electroporated to
tobacco protoplasts a strong GFP signal located in the nucleus
after approximately 20 hours of incubation was observed. This
signal is due to the strong transient expression of the GFP ORF.
This signal disappeared within 48 hours, presumably due to
degradation/elimination of the plasmid DNA from the cell. In a
typical experiment, approximately 30% of the protoplasts showed a
GFP signal and this represents the maximal electroporation
efficiency. No GFP signal was observed when KG7384 (GFP-STOP) was
introduced into tobacco protoplasts.
[0140] Once the experimental setup had been validated, experiments
were performed whereby KG7384 was introduced into tobacco
protoplasts in combination with the oligonucleotides described
above. The GFP signal was scored after 24 hours and the results are
shown in table 2.
TABLE-US-00002 TABLE 2 Repair of episomal GFP Treatment
Oligonucleotide(s) Repair efficiency (%) 1 ODM1 0 2 ODM2 0 3 ODM3
20 4 ODM4 14 5 ODM1 + ODM2 0 6 ODM3 + ODM4 80 Repair efficiency was
calculated as the percentage of cells with restored GFP expression
scored via fluorescence.
[0141] When oligonucleotides lacking a mismatch at the 3' end (ODM1
and ODM2) were added separately (treatment 1 & 2) or together
(treatment 5) no restoration of GFP activity was observed. In
contrast, we did observe restoration of GFP expression when
oligonucleotides carrying a single mismatch at the 3' end (ODM3 and
ODM4) were used (treatment 3 & 4). Surprisingly, we were able
to demonstrate that the repair efficiency was higher than expected
when ODM3 and ODM4 were added simultaneously. Therefore, such an
approach appears to significantly improve the efficiency of TNE and
enables the development of a more efficient TNE methodology.
Example 2. Effects of PS Linkage on TNE Efficiency
[0142] This example shows that it is not required that the first or
the second oligonucleotide according to the invention incorporates
nucleotides having e.g. phosphorothioate linkages nor that is it
required that any other type of modification is incorporated.
Methods
[0143] Tomato mesophyll protoplasts were isolated from young leaves
of tomato in vitro plants. Reporter constructs harbouring an
eYFP(stop) gene (see FIGS. 5 and 6) whose expression was driven by
the CaMV 35S promoter and oligonucleotides were transfected into
tomato protoplasts by a PEG-mediated method. After overnight
incubation under dark at 30.degree. C. in a growth chamber,
infected protoplasts were observed using a fluorescent microscope
equipped with a YFP filter set. The number of protoplasts emitting
yellow fluorescence was scored and the TNE efficiency was
calculated by dividing the number of yellow protoplasts by the
number of transfected protoplasts.
Sequence of Oligonucleotides Tested:
TABLE-US-00003 [0144] (SEQ ID NO: 7) PB72
C*A*T*G*CATGCATGCATGCATGC*A*T*G*C 25 mer, PS, Nonsense (= negative
control) (SEQ ID NO: 8) PB242 T*G*A*G*GGTGAAGGTGATGCTAC*T*T*A*C 25
mer, PS, 3' MM (= mismatch) Sense (SEQ ID NO: 9) PB243
G*A*T*G*AACTTAAGTGTAAGTTT*A*C*C*G 25 mer, PS, 3' MM Antisense (SEQ
ID NO: 10) TF7 TGAGGGTGAAGGTGATGCTACTTAC 25 mer, 3' MM Sense (SEQ
ID NO: 11) TF8 GATGAACTTAAGTGTAAGTTTACCG 25 mer, 3' MM Antisense
*represents a phosphorothioate linkage
[0145] The TNE reaction caused by PB242, PB243, TF7, and TF8
converts the target sequence from TAA to TAC. Oligonucleotides
PB242, PB243, TF7 and TF8 were thus designed to repair the STOP
codon in YFP, wherein PB72, PB242, and PB243 comprise PS linkages,
and TF7 and TF8 do not comprise PS linkages. As shown in FIG. 4,
PB242+PB243 was able to restore YFP expression with more than 23%;
TF7+TF8 was able to restore YFP expression with more than 3%,
almost 10 times more in comparison to the signal obtained with the
nonsense oligonucleotide.
[0146] This example thus shows that using oligonucleotides, with or
without modification, like PS linkages, can be used in TNE.
LITERATURE
[0147] Alexeev, V. and Yoon, K. (1998). Stable and inheritable
changes in genotype and phenotype of albino melanocytes induced by
an RNA-DNA oligonucleotide. Nat Biotechnol 16, 1343-6. [0148]
Beetham, P. R., Kipp, P. B., Sawycky, X. L., Arntzen, C. J. and
May, G. D. (1999). A tool for functional plant genomics: chimeric
RNA/DNA oligonucleotides cause in vivo gene-specific mutations.
Proc Natl Acad Sci USA 96, 8774-8. [0149] Dong, C., Beetham, P.,
Vincent, K. and Sharp, P. (2006). Oligonucleotide-directed gene
repair in wheat using a transient plasmid gene repair assay system.
Plant Cell Rep 25, 457-65. [0150] Igoucheva, O., Alexeev, V. and
Yoon, K. (2001). Targeted gene correction by small single-stranded
oligonucleotides in mammalian cells. Gene Ther 8, 391-9. [0151]
Kmiec, E. B. (2003). Targeted gene repair--in the arena. J Clin
Invest 112, 632-6. [0152] Kochevenko, A. and Willmitzer, L. (2003).
Chimeric RNA/DNA oligonucleotide-based site-specific modification
of the tobacco acetolactate syntase gene. Plant Physiol 132,
174-84. [0153] Liu, L., Cheng, S., van Brabant, A. J. and Kmiec, E.
B. (2002). Rad51p and Rad54p, but not Rad52p, elevate gene repair
in Saccharomyces cerevisiae directed by modified single-stranded
oligonucleotide vectors. Nucleic Acids Res 30, 2742-50. [0154]
Okuzaki, A. and Toriyama, K. (2004). Chimeric RNA/DNA
oligonucleotide-directed gene targeting in rice. Plant Cell Rep 22,
509-12. [0155] Parekh-Olmedo, H., Ferrara, L., Brachman, E. and
Kmiec, E. B. (2005). Gene therapy progress and prospects: targeted
gene repair. Gene Ther 12, 639-46. [0156] Rice, M. C., Czymmek, K.
and Kmiec, E. B. (2001). The potential of nucleic acid repair in
functional genomics. Nat Biotechnol 19, 321-6. [0157] Ruiter, R.,
van den Brande, I., Stals, E., Delaure, S., Cornelissen, M. and
D'Halluin, K. (2003). Spontaneous mutation frequency in plants
obscures the effect of chimeraplasty. Plant Mol Biol 53, 675-89.
[0158] Zhu, T., Mettenburg, K., Peterson, D. J., Tagliani, L. and
Baszczynski, C. L. (2000). Engineering herbicide-resistant maize
using chimeric RNA/DNA oligonucleotides. Nat Biotechnol 18, 555-8.
[0159] Zhu, T., Peterson, D. J., Tagliani, L., St Clair, G.,
Baszczynski, C. L. and Bowen, B. (1999). Targeted manipulation of
maize genes in vivo using chimeric RNA/DNA oligonucleotides. Proc
Natl Acad Sci USA 96, 8768-73.
Sequence CWU 1
1
131786DNAArtificial SequenceGFP ORF containing a stop codon
1atgggaagag gatcgcatca ccaccatcat cataagcttc caaagaagaa gaggaaggtt
60ctcgagatgg tgagcaaggg ctaggagctg ttcaccgggg tggtgcccat cctggtcgag
120ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga
gggcgatgcc 180acctacggca agctgaccct gaagttcatc tgcaccaccg
gcaagctgcc cgtgccctgg 240cccaccctcg tgaccaccct gacctacggc
gtgcagtgct tcagccgcta ccccgaccac 300atgaagcagc acgacttctt
caagtccgcc atgcccgaag gctacgtcca ggagcgcacc 360atcttcttca
aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac
420accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg
caacatcctg 480gggcacaagc tggagtacaa ctacaacagc cacaacgtct
atatcatggc cgacaagcag 540aagaacggca tcaaggtgaa cttcaagatc
cgccacaaca tcgaggacgg cagcgtgcag 600ctcgccgacc actaccagca
gaacaccccc atcggcgacg gccccgtgct gctgcccgac 660aaccactacc
tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac
720atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga
cgagctgtac 780aagtaa 7862260PRTArtificial SequenceGFP-STOP protein
2Met Gly Arg Gly Ser His His His His His His Lys Leu Pro Lys Lys 1
5 10 15 Lys Arg Lys Val Leu Glu Met Val Ser Lys Gly Glu Leu Phe Thr
Gly 20 25 30 Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn
Gly His Lys 35 40 45 Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala
Thr Tyr Gly Lys Leu 50 55 60 Thr Leu Lys Phe Ile Cys Thr Thr Gly
Lys Leu Pro Val Pro Trp Pro 65 70 75 80 Thr Leu Val Thr Thr Leu Thr
Tyr Gly Val Gln Cys Phe Ser Arg Tyr 85 90 95 Pro Asp His Met Lys
Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu 100 105 110 Gly Tyr Val
Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr 115 120 125 Lys
Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg 130 135
140 Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly
145 150 155 160 His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr
Ile Met Ala 165 170 175 Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe
Lys Ile Arg His Asn 180 185 190 Ile Glu Asp Gly Ser Val Gln Leu Ala
Asp His Tyr Gln Gln Asn Thr 195 200 205 Pro Ile Gly Asp Gly Pro Val
Leu Leu Pro Asp Asn His Tyr Leu Ser 210 215 220 Thr Gln Ser Ala Leu
Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met 225 230 235 240 Val Leu
Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp 245 250 255
Glu Leu Tyr Lys 260 325DNAArtificial Sequenceoligonucleotide
3gttctcgaga tggtgagcaa gggct 25425DNAArtificial
Sequenceoligonucleotide 4gcaccacccc ggtgaacagc tccta
25525DNAArtificial Sequenceoligonucleotide 5gttctcgaga tggtgagcaa
gggcg 25625DNAArtificial Sequenceoligonucleotide 6gcaccacccc
ggtgaacagc tcctc 25725DNAArtificial Sequenceoligonucleotide
7catgcatgca tgcatgcatg catgc 25825DNAArtificial
Sequenceoligonucleotide 8tgagggtgaa ggtgatgcta cttac
25925DNAArtificial Sequenceoligonucleotide 9gatgaactta agtgtaagtt
taccg 251025DNAArtificial Sequenceoligonucleotide 10tgagggtgaa
ggtgatgcta cttac 251125DNAArtificial Sequenceoligonucleotide
11gatgaactta agtgtaagtt taccg 2512786DNAArtificial SequenceYFP-STOP
12atgggaagag gatcgcatca ccaccatcat cataagcttc caaagaagaa gaggaaggtt
60ctcgagatgg tttctaaggg tgaggaactt ttcactggtg tggttccaat tctcgttgag
120cttgatggtg atgttaacgg acacaagttc tctgtttctg gtgaaggtga
aggtgatgct 180acttaaggaa agcttactct caagttcatc tgcactactg
gaaagcttcc agttccatgg 240ccaactcttg ttactacttt cggatacggt
gttcaatgct tcgctaggta tccagatcat 300atgaggcagc acgatttctt
caagtctgct atgccagagg gatatgttca agagaggact 360atcttcttca
aggatgatgg caactacaag actagggctg aggttaagtt cgagggtgat
420actcttgtga acaggattga gcttaagggc atcgatttca aagaggatgg
aaacattctc 480ggccacaagc ttgagtacaa ctacaattct cacaacgtgt
acatcatggc tgataagcag 540aagaacggca tcaaggttaa cttcaagatc
aggcacaaca tcgaggatgg atctgttcaa 600cttgctgatc attaccagca
gaacactcca attggagatg gaccagttct tcttcctgat 660aaccactacc
tttcttacca gtctgctctt tccaaggatc caaatgagaa gagggatcac
720atggtgcttt tggagtttgt tactgctgct ggaatcactc ttggcatgga
tgaactctac 780aagtga 78613261PRTArtificial SequenceYFP-STOP 13Met
Gly Arg Gly Ser His His His His His His Lys Leu Pro Lys Lys 1 5 10
15 Lys Arg Lys Val Tyr Leu Glu Met Val Ser Lys Gly Glu Glu Leu Phe
20 25 30 Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val
Asn Gly 35 40 45 His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp
Ala Thr Gly Lys 50 55 60 Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly
Lys Leu Pro Val Pro Trp 65 70 75 80 Pro Thr Leu Val Thr Thr Phe Gly
Tyr Gly Val Gln Cys Phe Ala Arg 85 90 95 Tyr Pro Asp His Met Arg
Gln His Asp Phe Phe Lys Ser Ala Met Pro 100 105 110 Glu Gly Tyr Val
Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn 115 120 125 Tyr Lys
Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn 130 135 140
Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu 145
150 155 160 Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr
Ile Met 165 170 175 Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe
Lys Ile Arg His 180 185 190 Asn Ile Glu Asp Gly Ser Val Gln Leu Ala
Asp His Tyr Gln Gln Asn 195 200 205 Thr Pro Ile Gly Asp Gly Pro Val
Leu Leu Pro Asp Asn His Tyr Leu 210 215 220 Ser Tyr Gln Ser Ala Leu
Ser Lys Asp Pro Asn Glu Lys Arg Asp His 225 230 235 240 Met Val Leu
Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met 245 250 255 Asp
Glu Leu Tyr Lys 260
* * * * *