U.S. patent application number 15/316029 was filed with the patent office on 2017-04-27 for 18-20 member bi-polycyclic compounds.
The applicant listed for this patent is HARO PHARMACEUTICAL INC., THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING/MCGILL UNIVERSITY, UNIVERSITE DE MONTREAL. Invention is credited to David Bettoun, James Gleason, Sylvie Mader, Eduardo Martinez, Shuo Xing.
Application Number | 20170114019 15/316029 |
Document ID | / |
Family ID | 54767408 |
Filed Date | 2017-04-27 |
United States Patent
Application |
20170114019 |
Kind Code |
A1 |
Bettoun; David ; et
al. |
April 27, 2017 |
18-20 MEMBER BI-POLYCYCLIC COMPOUNDS
Abstract
The invention relates to 18-20 member bi-polycyclic compounds,
methods of making these compounds, and methods of using them in
treating hyperproliferative disorders (e.g., cancer) and
non-malignant tumors; promoting muscle formation; inhibiting muscle
degeneration or the loss of muscle mass or muscle function; and
myofibers ex vivo.
Inventors: |
Bettoun; David; (Merion
Station, PA) ; Martinez; Eduardo; (Bryn Mawr, PA)
; Gleason; James; (Montreal, CA) ; Mader;
Sylvie; (Montreal, CA) ; Xing; Shuo; (Lachine,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
HARO PHARMACEUTICAL INC.
THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING/MCGILL
UNIVERSITY
UNIVERSITE DE MONTREAL |
Merion Station
Montreal, Quebec
Montreal, Quebec |
PA |
US
CA
CA |
|
|
Family ID: |
54767408 |
Appl. No.: |
15/316029 |
Filed: |
June 4, 2015 |
PCT Filed: |
June 4, 2015 |
PCT NO: |
PCT/US2015/034303 |
371 Date: |
December 2, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62007673 |
Jun 4, 2014 |
|
|
|
62007686 |
Jun 4, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07C 259/10 20130101;
C07D 215/54 20130101; C07D 409/04 20130101; A61P 35/00 20180101;
C07D 209/08 20130101; C07D 209/42 20130101; C07D 215/48 20130101;
C07C 2602/10 20170501 |
International
Class: |
C07D 215/54 20060101
C07D215/54; C07D 209/08 20060101 C07D209/08; C07C 259/10 20060101
C07C259/10; C07D 209/42 20060101 C07D209/42 |
Claims
1. A compound of Formula I: A-W--Z (I) or a pharmaceutically
acceptable salt thereof, wherein A is ##STR00030## W is a
heterocyclylene, arylene, heteroarylene, alkenylenearylene,
arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene; and Z is a hydrogen bond donor, with the
proviso that the compound is not ##STR00031## where R is --OH,
--OCH.sub.3 and --NHOH; and R' is --OH or --OCH.sub.3.
2. The compound of claim 1, wherein W is an indolinylene linked to
A at any one of positions 2, 3, 4, 5, 6 or 7 of the indolinylene; a
quinolinene linked to A at any one of positions 2, 3, 4, 5, 6, 7,
or 8; or an isoquinolinene linked to A at any one of positions 1,
3, 4, 5, 6, 7, or 8.
3. The compound of claim 1, wherein W is -propylene-phenylene-.
4. The compound of claim 1, wherein Z is --C(O)NR.sup.1R.sup.2 or
--C(O)OR.sup.3, wherein R.sup.1 and R.sup.2 are each independently
hydrogen (H), hydroxyl (OH), C.sub.1-6 alkyl, hydroxyC.sub.1-6
alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and R.sup.3 is H or
C.sub.1-6 alkyl.
5. The compound of claim 2, wherein Z is linked to the
indolinylene, quinolinene, or isoquinolinene at any one of the
positions that is not linked to A.
6. The compound of claim 4, wherein W is ##STR00032##
7. The compound of claim 1, wherein W is an indolinylene linked to
A at any one of positions 2, 3, 4, 5, 6 or 7 of the indolinylene; Z
is --C(O)NR.sup.1R.sup.2 or --C(O)OR.sup.3, wherein R.sup.1 and
R.sup.2 are each independently hydrogen, hydroxyl, C.sub.1-6 alkyl,
hydroxyC.sub.1-6 alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and
R.sup.3 is H or C.sub.1-6 alkyl, and wherein Z is linked to the
indolinylene at any one of positions 2, 3, 4, 5, 6 or 7 of the
indolinylene not linked to A.
8. The compound of claim 1, wherein W is a quinolinene linked to A
at any one of positions 2, 3, 4, 5, 6, 7 or 8 of the quinolinene; Z
is --C(O)NR.sup.1R.sup.2 or --C(O)OR.sup.3, wherein R.sup.1 and
R.sup.2 are each independently hydrogen, hydroxyl, C.sub.1-6 alkyl,
hydroxyC.sub.1-6 alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and
R.sup.3 is H or C.sub.1-6 alkyl, and wherein Z is linked to the
quinolinene at any one of positions 2, 3, 4, 5, 6, 7 or 8 of the
quinolinene.
9. The compound of claim 1, W is a isoquinolinene linked to A at
one of positions 1, 3, 4, 5, 6, 7 or 8 of the isoquinolinene
moiety; Z is --C(O)NR.sup.1R.sup.2 or --C(O)OR.sup.3, wherein
R.sup.1 and R.sup.2 are each independently hydrogen, hydroxyl,
C.sub.1-6 alkyl, hydroxyC.sub.1-6 alkyl, aminoC.sub.1-6 alkyl, or
aminoaryl; and R.sup.3 is H or C.sub.1-6 alkyl, and wherein Z is
linked to the quinoline ring at any one of positions 2, 3, 4, 5, 6,
7 or 8 of the isoquinolinene.
10. The compound of claim 7, wherein Z is --C(O)NR.sup.1R.sup.2;
R.sup.1 is H; and R.sup.2 is OH.
11. The compound of claim 7, wherein Z is --C(O)NR.sup.1R.sup.2;
R.sup.1 is H; and R.sup.2 is aminoaryl.
12. The compound of claim 7, wherein Z is --C(O)OR.sup.3; and
R.sup.3 is H.
13. The compound of claim 7, wherein Z is --C(O)OR.sup.3; and
R.sup.3 is C.sub.1-6 alkyl.
14. The compound of claim 1, wherein the compound is ##STR00033##
##STR00034## ##STR00035##
15. A pharmaceutical composition comprising a compound of claim 1,
and a pharmaceutically acceptable carrier.
16. A method of treating a subject who has cancer or a
non-malignant tumor, the method comprising administering to the
subject a therapeutically effective amount of a compound of claim
1.
17. The method of claim 16, wherein the cancer is non-small cell
lung cancer, colon cancer, melanoma, breast cancer, renal cancer,
ovarian cancer, prostate cancer, cancer of the central nervous
system, a blood cancer, or a neuroblastoma.
18. (canceled)
19. A method of inhibiting loss of muscle mass or muscle function
in a subject, the method comprising administering to a subject in
need thereof a therapeutically effective amount of a compound of
Formula I: A-W--Z (I) or a pharmaceutically acceptable salt
thereof, wherein A is ##STR00036## W is a heterocyclylene, arylene,
heteroarylene, alkenylenearylene, arylenealkenylene or
alkenyleneheteroarylene, heteroarylenealkenylene; and Z is a
hydrogen bond donor.
20.-21. (canceled)
22. The method of claim 19, wherein the loss of muscle mass is
associated with intensive care unit-acquired weakness (ICUAW),
chronic obstructive pulmonary disease (COPD), heart failure,
traumatic injury or malignancy.
23. A method for treating myofibers ex vivo, the method comprising:
providing an ex vivo preparation of myofibers, optionally
comprising a natural or synthetic biological matrix; and contacting
the preparation with an amount of a compound of Formula I: A-W--Z
(I) or a pharmaceutically acceptable salt thereof, wherein the
amount of the compound is sufficient to promote muscle mass or
muscle function and A is ##STR00037## W is a heterocyclylene,
arylene, heteroarylene, alkenylenearylene, arylenealkenylene
alkenyleneheteroarylene, or heteroarylenealkenylene; and Z is a
hydrogen bond donor.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of the filing date of
U.S. Provisional Application No. 62/007,673, filed Jun. 4, 2014,
and U.S. Provisional Application No. 62/007,686, filed Jun. 4,
2014, which applications are hereby incorporated by reference
herein in their entireties.
FIELD OF THE INVENTION
[0002] The invention relates to 18-20 member bi-polycyclic
compounds and methods of making and using these compounds to
promote muscle formation, inhibit muscle degeneration, and treat
hyperproliferative disorders (e.g., cancer).
BACKGROUND OF THE INVENTION
[0003] The disappearance of muscle mass associated with several
pathological conditions is not effectively addressed by palliative
or pharmacological therapies. Therefore there is a need to develop
therapeutics that delay or prevent the mechanisms of muscle atrophy
and can therefore inhibit or help to prevent muscle degeneration
and support muscle function in patients.
[0004] The following references may be of interest: Vannini et al.,
EMBO Rep. 9:879-84, 2007; Shibata et al., Recent Prog. Horm. Res.
52:141-64, 1997; Gronemeyer and Miturski, Cell Mol. Biol. Lett.
6:3-52, 2001; Oehme et al., Clin. Cancer Res. 15(1):91-9, 2009;
Pori, Eur. J. Med. Chem. 70:857-63, 2013; Evans et al., J. Clin.
Nutr. 91(suppl):1123S-7S, 2010; Abmayr and Pavlath, Development
139:641-656, 2012; Macpherson et al., J. Cell. Biochem.
112(8):2149-59, 2010; Moresi et al. Cell 143(1):35-45, 2010;
Nebbioso et al., EMBO Rep. 10(7):776-82, 2009; Glenisson et al.,
Biochim. Biophys. Acta. 1773(10):1572-82, 2007 and
WO/2011/097712.
SUMMARY OF THE INVENTION
[0005] In a first aspect, the invention relates to a compound of
Formula I: A-W--Z (I) or a pharmaceutically acceptable salt
thereof, wherein A is
##STR00001##
W is a heterocyclylene, arylene, heteroarylene, alkenylenearylene,
arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene; and
[0006] Z is a hydrogen bond donor, with the proviso that the
compound is not
##STR00002##
where R is --OH, --OCH.sub.3 and --NHOH; and R' is --OH or
--OCH.sub.3.
[0007] In another aspect, the invention features methods of
treating a subject who has cancer or a non-malignant tumor by
administering to the subject a therapeutically effective amount of
a compound described above or a pharmaceutically acceptable
composition containing such a compound or a mixture thereof.
[0008] The invention also relates, in part, to methods of
inhibiting loss of muscle mass or muscle function in a subject, the
method comprising administering to a subject in need thereof a
therapeutically effective amount of a compound of Formula I:
A-W--Z (I)
[0009] or a pharmaceutically acceptable salt thereof, wherein
[0010] A is
##STR00003##
[0011] W is a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene or alkenyleneheteroarylene,
heteroarylenealkenylene; and
[0012] Z is a hydrogen bond donor.
[0013] In another aspect, the invention features methods for
treating myofibers ex vivo. These methods can include the steps of
providing an ex vivo preparation of myofibers, optionally
comprising a natural or synthetic biological matrix; and contacting
the preparation with an amount of a compound of Formula I: A-W--Z
(I) or a pharmaceutically acceptable salt thereof, that is
sufficient to promote muscle mass or muscle function. Within
Formula I,
[0014] A is
##STR00004##
[0015] W is a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene; and Z is a hydrogen bond donor.
[0016] In another aspect, the invention features methods of making
a compound as described herein, for example, as illustrated in the
synthetic schemes shown below.
[0017] In other aspects, the invention features the use of one or
more of the compounds described herein in the preparation of a
medicament or in the preparation of a medicament for the treatment
of cancer to for inhibiting the loss of muscle mass or muscle
function.
[0018] Where elements are listed, it is to be understood that any
one or more of the listed elements can be excluded from the
compound, composition, or method. For example, the inventors have
specified that W can be a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene. Therefore, W can be any of these elements
except heterocyclylene, for example.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 exemplifies various compounds of the invention.
[0020] FIG. 2 shows a proton NMR spectra for compound 5.
[0021] FIG. 3 shows a proton NMR spectra for compound 8.
[0022] FIG. 4 shows a proton NMR spectra for compound 13.
[0023] FIGS. 5A-B are graphs demonstrating dose-dependent
inhibition of recombinant human HDAC-1 and HDAC-6 using compounds
disclosed herein.
[0024] FIGS. 6A-B are graphs showing the induction of RAR-dependent
transcriptional activity and lack of induction of RXR-dependent
transcriptional activity in MCF7 cells.
[0025] FIGS. 7A-C are graphs depicting the cytotoxic effect of
compounds disclosed herein in high risk neuroblastoma (IMR-32 and
BE-2C) and triple negative breast cancer (MDA-MB-231) cell
lines.
[0026] FIG. 8 is a series of gels showing the effect of compound 13
on intracellular acetylation of p53 protein in IMR-32 neuroblastoma
cells.
[0027] FIG. 9 shows a series of gels demonstrating the effect of
certain compound on intracellular acetylation of alpha-tubulin in
BE-2C neuroblastoma cells.
[0028] FIG. 10 is a series of photomicrographs showing
immunohistochemically stained C2C12 cells in culture and the effect
of certain compounds on fiber apparition and maintenance in long
term culture.
[0029] FIG. 11 shows how the certain compounds of the invention
affect fusion of differentiated mononuclear C2C12 myoblasts in long
term cultures.
[0030] FIGS. 12A-B are bar graphs showing the effect of compound 17
on the distribution of the length and diameter of myotubes in long
term C2C12 culture.
[0031] FIG. 13 shows the effect of certain compounds on myotube
degeneration in differentiated C2C12 cells.
[0032] FIGS. 14A-B are bar graphs showing the effect of compounds
13 and 17 on myofiber gene expression in C2C12 cells.
[0033] FIG. 15 is a graph comparing the pharmacokinetic profile for
compounds 13 and 17.
DETAILED DESCRIPTION
[0034] Compounds:
[0035] The invention relates to compounds of Formula I: A-W--Z (I)
or a pharmaceutically acceptable salt thereof, wherein A is
##STR00005##
[0036] W is a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene; and
[0037] Z is a hydrogen bond donor, with the proviso that the
compound is not a compound conforming to
##STR00006##
wherein Z is a hydrogen bond donor (e.g., wherein Z is --OH,
--O(C.sub.1-6 alkyl), --NH.sub.2, and --NHOH). For example, the
invention relates to compounds of Formula I with the proviso that
the compound is not:
##STR00007##
where R is --OH, --OCH.sub.3 and --NHOH; and R' is --OH or
--OCH.sub.3.
[0038] In some embodiments, W is an indolinylene linked to A at any
one of positions 2, 3, 4, 5, 6 or 7 of the indolinylene; a
quinolinene linked to A at any one of positions 2, 3, 4, 5, 6, 7,
or 8; or an isoquinolinene linked to A at any one of positions 1,
3, 4, 5, 6, 7, or 8. In other embodiments, W is
-propylene-phenylene-.
[0039] In regard to the indolinylene, quinolinene and
isoquinolinene moieties, the following numbering schemes apply:
##STR00008##
[0040] The compounds of the invention are not limited to the
indolinylene, quinolinene and isoquinolinene moieties for W. The
nitrogen atom in these ring systems may have an oxygen or sulfur
atom instead of nitrogen.
[0041] In some embodiments, W is
##STR00009##
[0042] In some embodiments, Z is --C(O)NR.sup.1R.sup.2 or
--C(O)OR.sup.3, where R.sup.1 and R.sup.2 are each independently
hydrogen (H), hydroxyl (OH), C.sub.1-6 alkyl, hydroxyC.sub.1-6
alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and R.sup.3 is H or
C.sub.1-6 alkyl.
[0043] In some embodiments, Z is linked to the indolinylene,
quinolinene, or isoquinolinene at any one of the positions of the
indolinylene, quinolinene, or isoquinolinene that is not linked to
A.
[0044] In some embodiments, W is an indolinylene linked to A at any
one of positions 2, 3, 4, 5, 6 or 7 of the indolinylene; Z is
--C(O)NR.sup.1R.sup.2 or --C(O)OR.sup.3, where R.sup.1 and R.sup.2
are each independently hydrogen, hydroxyl, C.sub.1-6 alkyl,
hydroxyC.sub.1-6 alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and
R.sup.3 is H or C.sub.1-6 alkyl, and where Z is linked to the
indolinylene at any one of positions 2, 3, 4, 5, 6 or 7 of the
indolinylene not linked to A.
[0045] In other embodiments, W is a quinolinene linked to A at any
one of positions 2, 3, 4, 5, 6, 7 or 8 of the quinolinene; Z is
--C(O)NR.sup.1R.sup.2 or --C(O)OR.sup.3, where R.sup.1 and R.sup.2
are each independently hydrogen, hydroxyl, C.sub.1-6 alkyl,
hydroxyC.sub.1-6 alkyl, aminoC.sub.1-6 alkyl, or aminoaryl; and
R.sup.3 is H or C.sub.1-6 alkyl, and where Z is linked to the
quinolinene at any one of positions 2, 3, 4, 5, 6, 7 or 8 of the
quinolinene.
[0046] In certain other embodiments, W is a isoquinolinene linked
to A at one of positions 1, 3, 4, 5, 6, 7 or 8 of the
isoquinolinene moiety; Z is --C(O)NR.sup.1R.sup.2 or
--C(O)OR.sup.3, where R.sup.1 and R.sup.2 are each independently
hydrogen, hydroxyl, C.sub.1-6 alkyl, hydroxyC.sub.1-6 alkyl,
aminoC.sub.1-6 alkyl, or aminoaryl; and R.sup.3 is H or C.sub.1-6
alkyl, and where Z is linked to the quinoline ring at any one of
positions 2, 3, 4, 5, 6, 7 or 8 of the isoquinolinene.
[0047] In one embodiment, Z is --C(O)NR.sup.1R.sup.2; R.sup.1 is H;
and R.sup.2 is OH.
[0048] In another embodiment, Z is --C(O)NR.sup.1R.sup.2; R.sup.1
is H; and R.sup.2 is aminoaryl.
[0049] In yet another embodiment, Z is --C(O)OR.sup.3; and R.sup.3
is H.
[0050] In another embodiment, Z is --C(O)OR.sup.3; and R.sup.3 is
C.sub.1-6 alkyl.
[0051] The compound can be:
##STR00010## ##STR00011## ##STR00012##
[0052] It is to be understood that certain features of the
invention, which are, for clarity, described in the context of
separate embodiments, can be combined in a single embodiment.
Conversely, various features of the invention which are, for
brevity, described in the context of a single embodiment, can also
be provided separately or in any suitable subcombination.
[0053] The compounds described herein can be asymmetric (e.g.,
having one or more stereocenters). All stereoisomers, such as
enantiomers and diastereomers, are intended unless otherwise
indicated. Accordingly, the compositions of the invention (e.g.,
pharmaceutical compositions) can include a compound or compounds in
the R-form, the S-form, or a racemic or non-racemic mixture
thereof. Compounds that contain asymmetrically substituted carbon
atoms can be isolated in optically active or racemic forms. Methods
for preparing optically active forms from optically inactive
starting materials are known in the art and include resolution of
racemic mixtures and stereoselective synthesis. Stable, geometric
isomers are also contemplated in the present invention. Cis and
trans geometric isomers of the compounds are described and may be
isolated as a mixture of isomers or as separate isomers.
[0054] Resolution of racemic mixtures can be carried out by any of
the numerous methods known in the art. For example, compounds can
be resolved by fractional recrystallization using a chiral
resolving acid which is an optically active, salt forming organic
acid. Suitable resolving agents for fractional recrystallization
methods are, for example, optically active acids, such as the D and
L forms of tartaric acid, diacetyltartaric acid, dibenzoyltartaric
acid, mandelic acid, malic acid, lactic acid or the various
optically active camphorsulfonic acids such as 3-camphorsulfonic
acid. Other resolving agents suitable for fractional
crystallization methods include stereoisomerically pure forms of
ct-methylbenzylamine (e.g., S and R forms, or diastereomerically
pure forms), 2-phenylglycinol, norephedrine, ephedrine,
N-methylephedrine, cyclohexylethylamine, 1,2-diaminocyclohexane,
and the like. Racemic mixtures can also be resolved by elution on a
column packed with an optically active resolving agent (e.g.,
dinitrobenzoylphenylglycine). Suitable elution solvent compositions
can be determined by one of ordinary skill in the art.
[0055] Compounds of the invention also include tautomeric forms,
which result from the swapping of a single bond with an adjacent
double bond together with the concomitant migration of a proton.
Tautomeric forms include prototropic tantomers which are isomeric
protonation states having the same empirical formula and total
charge. Examples of prototropic tautomers include ketone-enol
pairs, amide-imidic acid pairs, lactam-lactim pairs, amide-imidic
acid pairs, enamine-imine pairs, and annular forms where a proton
can occupy two or more positions of a heterocyclic system, for
example, 1H- and 3H-imidazole, 1H-, 2H- and 4H-1,2,4-triazole, 1H-
and 2H-isoindole, and 1H- and 2H-pyrazole. Tautomeric forms can be
in equilibrium or sterically locked into one form by an appropriate
substitution.
[0056] Compounds of the invention can also include all isotopes of
atoms occurring in the intermediates or final compounds. Isotopes
include those atoms having the same atomic number but different
mass numbers. For example, isotopes of hydrogen include tritium and
deuterium.
[0057] As used herein, the term "alkyl" refers to a saturated
hydrocarbon group which is straight-chained or branched. Examples
of alkyl groups include methyl (Me), ethyl (Et), propyl (e.g.,
n-propyl and isopropyl), butyl (e.g., n-butyl, isobutyl, sec-butyl,
t-butyl), pentyl (e.g., n-pentyl, isopentyl, sec-pentyl,
neopentyl), and the like. An alkyl group can contain from 1 to
about 20 (e.g., from 2 to about 20, from 1 to about 10, from 1 to
about 8, from 1 to about 6, from 1 to about 4, or from 1 to about
3) carbon atoms. By "about," we mean.+-.10% (e.g., about 20 grams
is 18-22 grams) or, where the referenced number of units is less
than 10 or not readily useful in divided tenths, we mean.+-.1
(e.g., about 6 carbon atoms is 5-7 carbon atoms; about 20 carbon
atoms is 19-21 carbon atoms).
[0058] The term "alkoxy," when used alone or in combination with
other groups, refers to a terminal oxy containing alkyl group, as
defined above such as methoxy, ethoxy, propoxy, isopropoxy and the
like.
[0059] The terms "alkenyl" and "alkynyl," when used alone or in
combination with other groups, refer to mono- or polyunsaturated
aliphatic hydrocarbon radicals containing from two to 15 carbon
atoms and at least one double or triple bond, respectively.
"Alkenyl" and "alkynyl" refer to both branched and unbranched
alkenyl and alkynyl groups, respectively. The alkenyl and alkynyl
groups include straight chained alkenyl or alkynyl groups
containing from two to eight carbon atoms and branched alkenyl or
alkynyl groups containing from five to ten carbon atoms. The
alkenyl and alkynyl groups also include alkenyl and alkynyl groups
containing from two to six carbon atoms and branched alkenyl and
alkynyl groups containing from 5 to eight carbon atoms. Examples of
alkenyl groups include ethenyl, 2-propenyl, 1-propenyl,
2-methyl-1-propenyl, 1-butenyl, 2-butenyl, 1-pentenyl, 2-pentenyl,
3-pentenyl, allyl, 1, 3-butadienyl, 1, 3-dipentenyl, 1,4
dipentenyl, 1-hexenyl, 1, 3-hexenyl, 1,4-hexenyl, 1, 3,
5-trihexenyl, 2, 4-dihexenyl, and the like.
[0060] Examples of alkynyl include ethynyl, 1-propynyl, 2-propynyl,
1 butynyl, 2-butynyl, 2-methyl-1-butynyl, 1-pentynyl, 2-pentynyl,
3-pentynyl, 3-methyl-1-pentynyl, 2-methyl-1-pentynyl, 1-hexynyl,
2-hexynyl, 3-hexynyl, and the like. The alkenyl and alkynyl groups
contain at least one double bond or one triple bond, respectively.
In another embodiment, they each may contain up to 4 carbon-carbon
multiple bonds, for example, 1, 2, 3, or 4, double bonds or triple
bonds, respectively. The double bonds in the alkenyl groups may be
conjugated, as in 1,3-butadienyl, or non-conjugated, as in 1,4-di
pentenyl.
[0061] As used herein, "aryl" refers to monocyclic or polycyclic
(e.g., having 2, 3 or 4 fused rings) aromatic hydrocarbons such as,
for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl,
indenyl, and the like. In some embodiments, aryl groups have from 6
to about 20 carbon atoms. The term "aryl" includes aromatic rings
fused to non-aromatic rings, as long as one of the fused rings is
an aromatic hydrocarbon.
[0062] The term "heteroaryl" refers to an aryl group in which at
least one of the ring atoms is a heteroatom (i.e., oxygen,
nitrogen, or sulfur). Heteroaryl groups include monocyclic and
polycyclic (e.g., having 2, 3 or 4 fused rings) systems. Examples
of heteroaryl groups include without limitation, pyridyl,
pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, furyl, quinolyl,
isoquinolyl, thienyl, imidazolyl, thiazolyl, indolyl, pyrryl,
oxazolyl, benzodiazine, benzofuryl, benzothienyl, benzthiazolyl,
isoxazolyl, pyrazolyl, triazolyl, tetrazolyl, indazolyl,
1,2,4-thiadiazolyl, isothiazolyl, benzothienyl, purinyl,
carbazolyl, benzimidazolyl, indolinyl, quinolinyl, isoquinolinyl
purinyl, indolyl, and the like.
[0063] The term "heterocyclic" when used alone or in combination
with other groups refers to a 5- to 8-membered (e.g., 5- or
6-membered) monocyclic or 8- to 11-membered bicyclic heterocyclic
radical that may be either saturated or unsaturated, aromatic or
non-aromatic, and which may be optionally benzo- or pyrido-fused if
monocyclic, containing at least one ring heteroatom. Each
heterocycle consists of carbon atoms and from 1 to 4 ring
heteroatoms selected from nitrogen, oxygen and sulfur.
[0064] As used herein, "nitrogen" and "sulfur" include any oxidized
form of nitrogen and sulfur and the quaternized form of any basic
nitrogen.
[0065] "Alkylene" refers to a linear or branched saturated divalent
hydrocarbon radical, which may optionally be substituted as
described herein. In certain embodiments, the alkylene is a linear
saturated divalent hydrocarbon radical that has 1 to 20
(C.sub.1-20), 1 to 15 (C.sub.1-15), 1 to 10 (C.sub.1-10), or 1 to 6
(C.sub.1-6) carbon atoms, or branched saturated divalent
hydrocarbon radical of 3 to 20 (C.sub.3-20), 3 to 15 (C.sub.3-15),
3 to 10 (C.sub.3-10), or 3 to 6 (C.sub.3-6) carbon atoms. Linear
C.sub.1-6 and branched C.sub.3-6 alkylene groups are also referred
as "lower alkylene." Examples of alkylene groups include, but are
not limited to, methylene, ethylene, propylene (including all
isomeric forms), n-propylene, isopropylene, butylene (including all
isomeric forms), n-butylene, isobutylene, t-butylene, pentylene
(including all isomeric forms), and hexylene (including all
isomeric forms). For example, C.sub.1-6 alkylene refers to a linear
saturated divalent hydrocarbon radical of 1 to 6 carbon atoms or a
branched saturated divalent hydrocarbon radical of 3 to 6 carbon
atoms.
[0066] The term "alkenylene" refers to a linear or branched
divalent hydrocarbon radical that contains one or more
carbon-carbon double bonds. The alkenylene may be optionally
substituted as described herein. The term "alkenylene" also
embraces radicals having "cis" and "trans" configurations, or
alternatively, "E" and "Z" configurations. As used herein, the term
"alkenylene" encompasses both linear and branched alkenylene,
unless otherwise specified. For example, C.sub.2-6 alkenylene
refers to a linear unsaturated divalent hydrocarbon radical of 2 to
6 carbon atoms or a branched unsaturated divalent hydrocarbon
radical of 3 to 6 carbon atoms. In certain embodiments, the
alkenylene is a linear divalent hydrocarbon radical of 2 to 20
(C.sub.2-20), 2 to 15 (C.sub.2-15), 2 to 10 (C.sub.2-10), or 2 to 6
(C.sub.2-6) carbon atoms, or a branched divalent hydrocarbon
radical of 3 to 20 (C.sub.3-20), 3 to 15 (C.sub.3-15), 3 to 10
(C.sub.3-10), or 3 to 6 (C.sub.3-6) carbon atoms. Examples of
alkenylene groups include, but are not limited to, ethenylene,
allylene, propenylene, butenylene, and 4-methylbutenylene.
[0067] The term "cycloalkylene" refers to a cyclic saturated
bridged and/or non-bridged divalent hydrocarbon radical, which may
be optionally substituted as described herein. In certain
embodiments, the cycloalkylene has from 3 to 20 (C.sub.3-20), from
3 to 15 (C.sub.3-15), from 3 to 10 (C.sub.3-10), or from 3 to 7
(C.sub.3-7) carbon atoms. Examples of cycloalkylene groups include,
but are not limited to, cyclopropylene (e.g., 1,1-cyclopropylene
and 1,2-cyclopropylene), cyclobutylene (e.g., 1,1-cyclobutylene,
1,2-cyclobutylene, or 1,3-cyclobutylene), cyclopentylene (e.g.,
1,1-cyclopentylene, 1,2-cyclopentylene, or 1,3-cyclopentylene),
cyclohexylene (e.g., 1,1-cyclohexylene, 1,2-cyclohexylene,
1,3-cyclohexylene, or 1,4-cyclohexylene), cycloheptylene (e.g.,
1,1-cycloheptylene, 1,2-cycloheptylene, 1,3-cycloheptylene, or
1,4-cycloheptylene), decalinylene, and adamantylene.
[0068] The term "heterocyclylene" refers to a divalent non-aromatic
ring system and/or a multicyclic ring system that contains at least
one non-aromatic ring, wherein one or more of the non-aromatic ring
atoms are heteroatoms independently selected from O, S, or N, and
the remaining ring atoms are carbon atoms. In certain embodiments,
the heterocyclylene group has from 3 to 20 (e.g., 3-15, 3-10, 3-8,
4-7, or 5-6) ring atoms. In certain embodiments, the
heterocyclylene is a monocyclic, bicyclic, tricyclic, or
tetracyclic ring system, which may include a fused or bridged ring
system, and in which the nitrogen or sulfur atoms may be optionally
oxidized, the nitrogen atoms may be optionally quaternized, and
some rings may be partially or fully saturated, or aromatic. The
heterocyclylene may be attached to the main structure at any
heteroatom or carbon atom which results in the creation of a stable
compound. Examples of such heterocyclene groups include, but are
not limited to, azepinylene, benzodioxanylene, benzodioxolylene,
benzofuranonylene, benzopyranonylene, benzopyranylene,
benzotetrahydrofuranylene, benzotetrahydrothienylene,
benzothiopyranylene, benzoxazinylene, .beta.-carbolinylene,
chromanylene, chromonylene, cinnolinylene, coumarinylene,
decahydroisoquinolinylene, dihydrobenzisothiazinylene,
dihydrobenzisoxazinylene, dihydrofurylene, dihydroisoindolylene,
dihydropyranylene, dihydropyrazolylene, dihydropyrazinylene,
dihydropyridinylene, dihydropyrimidinylene, dihydropyrrolylene,
dioxolanylene, 1,4-dithianylene, furanonylene, imidazolidinylene,
imidazolinylene, indolinylene, isobenzotetrahydrofuranylene,
isobenzotetrahydrothienylene, isochromanylene, isocoumarinylene,
isoindolinylene, isothiazolidinylene, isoxazolidinylene,
morpholinylene, octahydroindolylene, octahydroisoindolylene,
oxazolidinonylene, oxazolidinylene, oxiranylene, piperazinylene,
piperidinylene, 4-piperidonylene, pyrazolidinylene, pyrazolinylene,
pyrrolidinylene, pyrrolinylene, quinuclidinylene,
tetrahydrofurylene, tetrahydroisoquinolinylene,
tetrahydropyranylene, tetrahydrothienylene, thiamorpholinylene,
thiazolidinylene, tetrahydroquinolinylene, and
1,3,5-trithianylene.
[0069] The terms, arylene, heteroarylene, alkenylenearylene,
arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene all refer to divalent forms of aryl,
heteroaryl, alkenylaryl, arylalkenyl, alkenylheteroaryl and
heteroarylalkenyl radicals.
[0070] As used herein, a "hydrogen bond donor" comprises a hydrogen
atom attached to an electronegative atom (e.g., fluorine, oxygen,
sulfur or nitrogen). In some embodiments, the hydrogen bond donor
is --OH, --O(C.sub.1-6 alkyl), --NH.sub.2, or --NHOH.
[0071] The term "compound," as used herein is meant to include all
stereoisomers, geometric isomers, tantomers, and isotopes of the
structures depicted, including structures conforming to a generic
formula set out herein.
[0072] All compounds, and all pharmaceutically acceptable salts
thereof, can be either found together with other substances such as
water and solvents (e.g., hydrates and solvates) or can be
substantially isolated. A compound of the invention or a salt
thereof is "substantially isolated" when at least partially or
substantially separated from the environment in which it was formed
or detected. Partial separation can include, for example, a
composition enriched to any extent in a compound of the invention.
Substantial separation can include compositions containing at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90%, at least about 95%, at least about 97%, or
at least about 99% by weight of a compound or compounds of the
invention, or a salt or salts thereof. Methods for isolating
compounds and their salts are routine in the art.
[0073] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio.
[0074] The expressions "ambient temperature" and "room
temperature," as used herein, are understood in the art, and refer
generally to a temperature, e.g. a reaction temperature, that is
about the temperature of the room in which the reaction is carried
out, for example, a temperature from about 20.degree. C. to about
30.degree. C.
[0075] The present invention also includes pharmaceutically
acceptable salts of the compounds described herein. As used herein,
"pharmaceutically acceptable salts" are derivatives of the
disclosed compounds wherein the parent compound is modified by
converting an existing acid or base moiety to its salt form.
Examples of pharmaceutically acceptable salts include, but are not
limited to, mineral or organic acid salts of basic residues such as
amines; alkali or organic salts of acidic residues such as
carboxylic acids; and the like. The pharmaceutically acceptable
salts of the present invention include the conventional non-toxic
salts of the parent compound formed, for example, from non-toxic
inorganic or organic acids. The pharmaceutically acceptable salts
of the present invention can be synthesized from the parent
compound which contains a basic or acidic moiety by conventional
chemical methods. Generally, such salts can be prepared by reacting
the free acid or base forms of these compounds with a
stoichiometric amount of the appropriate base or acid in water or
in an organic solvent, or in a mixture of the two; generally,
non-aqueous media like ether, ethyl acetate, alcohols (e.g.,
methanol, ethanol, iso-propanol, or butanol) or acetonitrile (ACN)
are preferred. Lists of suitable salts are found in Remington's
Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton,
Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2
(1977), each of which is incorporated herein by reference in its
entirety.
[0076] Synthesis: The reactions for preparing compounds of the
invention can be carried out in suitable solvents which can be
readily selected by one of skill in the art of organic synthesis.
Suitable solvents can be substantially non-reactive with the
starting materials (reactants), the intermediates, or products at
the temperatures at which the reactions are carried out, e.g.,
temperatures which can range from the solvent's freezing
temperature to the solvent's boiling temperature. A given reaction
can be carried out in one solvent or a mixture of more than one
solvent. Depending on the particular reaction step, suitable
solvents for a particular reaction step can be selected by the
skilled artisan.
[0077] Preparation of compounds of the invention can involve the
protection and deprotection of various chemical groups. The need
for protection and deprotection, and the selection of appropriate
protecting groups, can be readily determined by one skilled in the
art. The chemistry of protecting groups can be found, for example,
in T. W. Greene and P. G. M. Wuts, Protective Groups in Organic
Synthesis, 3.sup.rd Ed., Wiley & Sons, Inc., New York (1999),
which is incorporated herein by reference in its entirety.
[0078] Reactions can be monitored according to any suitable method
known in the art. For example, product formation can be monitored
by spectroscopic means, such as nuclear magnetic resonance
spectroscopy (e.g., 1H or 13C), infrared spectroscopy,
spectrophotometry (e.g., UV-visible), mass spectrometry, or by
chromatographic methods such as high performance liquid
chromatography (HPLC) or thin layer chromatography (TLC).
[0079] An exemplary method for preparing certain compounds of the
invention is provided in Scheme 1.
[0080] Compound 3 was produced by bromination of methyl
indole-5-carboxylate, compound 2 (ACC Corporation). Compound 4 is
then produced by reacting compound 1 with compound 3. Compound 5
was prepared from the corresponding methyl carboxylic ester,
compound 4, by nucleophilic substitution with hydroxylamine in the
presence of NaOH and MeOH.
##STR00013##
[0081] Scheme 2 shows the synthetic scheme for producing compound
8, which was derived from compound 7 by replacement of methyl ester
by hydroxamate in the presence of NaOH and MeOH/CH.sub.2Cl.sub.2.
Compound 7 was the product of a Suzuki coupling between compound 1
and methyl 6-bromoquinoline-2-carboxylate, compound 6.
##STR00014##
[0082] Further, Scheme 3 shows the synthetic scheme for preparing
compound 13, which is derived from compound 12 by replacement of
the methyl ester by hydroxamate in the presence of NaOH and
MeOH/CH.sub.2Cl.sub.2. Compound 12 was prepared by performing
concomitant intramolecular Pd(OAc).sub.2-catalysed Buchwald-Hartwig
coupling of vinyl bromide and amine in compound 11 followed by
intermolecular Suzuki cross coupling of the resulting 2-bromoindole
with boronic acid,
(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl) (compound
1). Compound 11 was synthesized from compound 10 by
platinium/carbon catalytic hydrogenation of the nitro group.
1,1-Dibromoalkene compound 10 was synthesized by Corey-Fuchs
reaction with aldehyde 9.
##STR00015##
Scheme 4 shows a synthetic method for preparing compound 17.
##STR00016##
##STR00017##
##STR00018##
[0083] Methods and Use of the Present Compounds in the Preparation
of a Medicament:
[0084] In another aspect, the invention features methods of use or
methods of treatment for a patient who is suffering from a
hyperproliferative disorder (e.g., a cancer, including blood-borne
cancers and cancers that manifest as solid tumors). The "use" or
methods of use can include the preparation of a medicament or the
preparation of a medicament for treating a hyperproliferative
disorder, non-malignant tumor, or muscle-related condition as
described herein. The medicament(s) can include a compound or
compounds as described herein (e.g., for the treatment of a
hyperproliferative disorder), and the methods of treating a patient
can include a step of administering to the patient a
therapeutically effective amount of a compound or compounds as
described herein. For ease of reading, we do not repeat the phrase
"or a pharmaceutically acceptable salt thereof" at every
opportunity. It is to be understood that where a compound of the
invention can be used, a pharmaceutically acceptable salt thereof
can also be used. In any method of treatment, the method can
include a step of identifying a patient in need.
[0085] In one aspect, the invention relates to methods of treating
a subject who has cancer or a non-malignant tumor, the method
comprising administering to the subject a therapeutically effective
amount of a compound described herein.
[0086] In various embodiments, the use can be directed to, or the
methods of treating can be applied to, a subject who has been
diagnosed with lung cancer (e.g., a non-small cell lung cancer), a
colon cancer, a melanoma, a breast cancer, a renal cancer, an
ovarian cancer, a prostate cancer, a cancer of the nervous system
(affecting the brain or spinal cord, such as a glioma), a
neuroendocrine tumor (e.g., a neuroblastoma), or a blood cancer
(e.g., a leukemia or lymphoma).
[0087] In one embodiment, the present invention features methods of
treating pheochromocytoma in a subject comprising administering to
the subject a therapeutically effective amount of a compound of
Formula I or a pharmaceutically acceptable salt thereof.
[0088] In another embodiment, the invention features methods of
treating neuroblastoma in a subject comprising administering to the
subject a therapeutically effective amount of compound of Formula I
or a pharmaceutically acceptable salt thereof.
[0089] As noted, the present invention further provides a compound
of Formula I, or a pharmaceutically acceptable salt thereof for use
in the preparation of a medicament or for the production of a
medicament for use in therapy, including therapy for any condition
or type of condition described herein.
[0090] Although the invention is not limited to compounds that
exert a beneficial effect through any particular mechanism of
action, our studies indicate that the compounds of the invention
can inhibit tumor growth or survival. Compounds of the invention
can also be an effective treatment to reduce metastatic growth of
tumors (metastasis).
[0091] The present invention further provides methods for treating
a disease caused by or associated with the presence of a tumor in a
mammalian subject, including identifying a subject in which
reduction of tumor mass is desirable, and administering to the
subject in need of such treatment a therapeutically effective
amount or dose of a compound of the present invention or a
pharmaceutical composition thereof. The subject can be a mammal
(e.g., a human or veterinary subject). The compound(s) and
composition(s) described herein can be administered orally or
parenterally. The disease can be a solid extracranial tumor such
as, but not limited to, neuroblatoma. The tumor can also be
associated with a breast cancer or be an intracranial tumor such,
but not limited to, a glioma. As noted, the disease can also be a
blood borne cancer such as, but not limited to, leukemia. In some
embodiments, the disease is localized to a tissue or organ while in
other instances the disease has spread to multiple organs or
tissues (e.g., as in metastasis).
[0092] As used herein, the term "contacting" refers to the bringing
together of indicated moieties (e.g., a compound or composition of
the invention) in an in vitro system (e.g., a culture system
including muscle cells or precursors or progenitors thereof) or an
in vivo system (e.g., within the body, either in the vicinity of or
distant from a tumor) in a manner that produces a desired outcome
(e.g., a treatment as described herein).
[0093] As noted, the present invention also relates to methods
inhibiting the loss of muscle mass or muscle function in a subject,
and such methods can be carried out by administering to a subject
in need thereof a therapeutically effective amount of a compound of
Formula I: A-W--Z (I) or a pharmaceutically acceptable salt
thereof, where
[0094] A is
##STR00019##
[0095] W is a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene or alkenyleneheteroarylene,
heteroarylenealkenylene; and Z is a hydrogen bond donor.
[0096] In certain aspects, the loss of muscle mass is associated
with an inherited myopathy. in other aspects, the loss of muscle
mass is associated with muscular dystrophy, neuromyotonia, nemaline
myopathy, multi/minicore myopathy, centronuclear myopathy,
mitochondrial myopathy, inflammatory myopathy, metabolic myopathy.
In yet another aspect, the loss of muscle mass is associated with
intensive care unit-acquired weakness (ICUAW), chronic obstructive
pulmonary disease (COPD), heart failure, traumatic injury or
malignancy.
[0097] The invention also relates to methods for treating myofibers
ex vivo. These methods can include the steps of providing an ex
vivo preparation of myofibers, optionally comprising a natural or
synthetic biological matrix; and contacting the preparation with an
amount of a compound of Formula I: A-W--Z (I) or a pharmaceutically
acceptable salt thereof, where the amount of the compound is
sufficient to promote muscle mass or muscle function and
[0098] A is
##STR00020##
[0099] W is a heterocyclylene, arylene, heteroarylene,
alkenylenearylene, arylenealkenylene alkenyleneheteroarylene, or
heteroarylenealkenylene; and Z is a hydrogen bond donor.
[0100] As used herein, the terms "individual" or "patient," or
"subject" are used interchangeably (unless the context clearly
indicates otherwise) to refer to any animal, including mammals,
preferably mice, rats, other rodents, rabbits, dogs, cats, swine,
cattle, sheep, horses, or primates, and most preferably humans.
[0101] As used herein, the phrase "therapeutically effective
amount" refers to the amount of active compound or pharmaceutical
agent that elicits the biological or medicinal response that is
being sought in a tissue, system, animal, individual or human by a
researcher, veterinarian, medical doctor or other clinician.
[0102] As used herein, the term "treating" or "treatment" refers to
one or more of (1) preventing the disease; for example, preventing
a disease, condition or disorder in an individual who may be
predisposed to the disease, condition or disorder but does not yet
experience or display the pathology or symptomatology of the
disease; (2) inhibiting the disease; for example, inhibiting a
disease, condition or disorder in an individual who is experiencing
or displaying the pathology or symptomatology of the disease,
condition or disorder (e.g., inhibiting the progression of the
disease); and (3) ameliorating the disease; for example,
ameliorating a disease, condition or disorder in an individual who
is experiencing or displaying the pathology or symptomatology of
the disease, condition or disorder (i.e., reversing the pathology
and/or symptomatology) such as decreasing the severity of
disease.
[0103] Pharmaceutical Formulations and Dosage Forms:
[0104] The invention provides compositions (e.g., pharmaceutical
compositions) comprising a compound of Formula I or a
pharmaceutically acceptable salt thereof and at least one carrier
(e.g., a pharmaceutically acceptable carrier). Thus, the invention
relates to pharmaceutical compositions comprising a compound as
disclosed herein, and a pharmaceutically acceptable carrier. The
compound can be present in an amount that confers a clinically
beneficial result on a patient to whom the compound has been
administered (i.e., a therapeutically effective amount).
[0105] When employed as pharmaceuticals, the compounds of the
invention can be administered in the form of pharmaceutical
compositions. These compositions can be prepared in a manner well
known in the pharmaceutical art, and can be administered by a
variety of routes, depending upon whether local or systemic
treatment is desired and upon the area to be treated. For example,
the compositions may be administered orally or parenterally.
[0106] This invention also includes pharmaceutical compositions
which contain, as the active ingredient, the compound of the
invention or a pharmaceutically acceptable salt thereof, in
combination with one or more pharmaceutically acceptable carriers
(excipients). In some embodiments, the composition is suitable for
oral administration. In making the compositions of the invention,
the active ingredient is typically mixed with an excipient, diluted
by an excipient or enclosed within such a carrier in the form of,
for example, a capsule, sachet, paper, or other container. When the
excipient serves as a diluent, it can be a solid, semi-solid, or
liquid material, which acts as a vehicle, carrier or medium for the
active ingredient. Thus, the compositions can be in the form of
tablets, pills, powders, lozenges, sachets, cachets, elixirs,
suspensions, emulsions, solutions, syrups, soft and hard gelatin
capsules, and sterile packaged powders. In preparing a formulation,
the active compound can be milled to provide the appropriate
particle size prior to combining with the other ingredients. If the
active compound is substantially insoluble, it can be milled to a
particle size of less than 200 mesh. If the active compound is
substantially water soluble, the particle size can be adjusted by
milling to provide a substantially uniform distribution in the
formulation, e.g. about 40 mesh.
[0107] The compounds of the invention may be milled using known
milling procedures such as wet milling to obtain a particle size
appropriate for tablet formation and for other formulation types.
Finely divided (nanoparticulate) preparations of the compounds of
the invention can be prepared by processes known in the art, e.g.,
see International Application No. WO 2002/000196.
[0108] Some examples of suitable excipients include lactose,
dextrose, sucrose, sorbitol, mannitol, starches, gum acacia,
calcium phosphate, alginates, tragacanth, gelatin, calcium
silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, water, syrup, alimentary oils and methyl cellulose. The
formulations can additionally include: lubricating agents such as
talc, magnesium stearate, and mineral oil; wetting agents;
emulsifying and suspending agents; preserving agents such as
methyl- and propylhydroxy-benzoates; sweetening agents; and
flavoring agents. The compositions of the invention can be
formulated so as to provide quick, sustained or delayed release of
the active ingredient after administration to the patient by
employing procedures known in the art.
[0109] The compositions can be formulated in a unit dosage form,
each dosage containing from about 5 to about 1000 mg (1 g), more
usually about 100 to about 500 mg, of the active ingredient. The
term "unit dosage forms" refers to physically discrete units
suitable as unitary dosages for human subjects and other mammals,
each unit containing a predetermined quantity of active material
calculated to produce the desired therapeutic effect, in
association with a suitable pharmaceutical excipient.
[0110] In some embodiments, the compounds or compositions of the
invention contain from about 5 to about 50 mg of the active
ingredient. One having ordinary skill in the art will appreciate
that this embodies compounds or compositions containing about 5 to
about 10, about 10 to about 15, about 15 to about 20, about 20 to
about 25, about 25 to about 30, about 30 to about 35, about 35 to
about 40, about 40 to about 45, or about 45 to about 50 mg of the
active ingredient.
[0111] In some embodiments, the compounds or compositions of the
invention contain from about 50 to about 500 mg of the active
ingredient. One having ordinary skill in the art will appreciate
that this embodies compounds or compositions containing about 50 to
about 100, about 100 to about 150, about 150 to about 200, about
200 to about 250, about 250 to about 300, about 350 to about 400,
or about 450 to about 500 mg of the active ingredient.
In some embodiments, the compounds or compositions of the invention
contain from about 500 to about 1000 mg of the active ingredient.
One having ordinary skill in the art will appreciate that this
embodies compounds or compositions containing about 500 to about
550, about 550 to about 600, about 600 to about 650, about 650 to
about 700, about 700 to about 750, about 750 to about 800, about
800 to about 850, about 850 to about 900, about 900 to about 950,
or about 950 to about 1000 mg of the active ingredient.
[0112] The active compound can be effective over a wide dosage
range and is generally administered in a pharmaceutically effective
amount. It will be understood, however, that the amount of the
compound actually administered will usually be determined by a
physician, according to the relevant circumstances, including the
condition to be treated, the chosen route of administration, the
actual compound administered, the age, weight, and response of the
individual patient, the severity of the patient's symptoms, and the
like.
[0113] For preparing solid compositions such as tablets, the
principal active ingredient is mixed with a pharmaceutical
excipient to form a solid preformulation composition containing a
homogeneous mixture of a compound of the present invention. When
referring to these preformulation compositions as homogeneous, the
active ingredient is typically dispersed evenly throughout the
composition so that the composition can be readily subdivided into
equally effective unit dosage forms such as tablets, pills and
capsules. This solid preformulation is then subdivided into unit
dosage forms of the type described above containing from, for
example, about 0.1 to about 1000 mg of the active ingredient of the
present invention.
[0114] The tablets or pills of the present invention can be coated
or otherwise compounded to provide a dosage form affording the
advantage of prolonged action. For example, the tablet or pill can
comprise an inner dosage and an outer dosage component, the latter
being in the form of an envelope over the former. The two
components can be separated by an enteric layer which serves to
resist disintegration in the stomach and permit the inner component
to pass intact into the duodenum or to be delayed in release. A
variety of materials can be used for such enteric layers or
coatings, such materials including a number of polymeric acids and
mixtures of polymeric acids with such materials as shellac, cetyl
alcohol, and cellulose acetate.
[0115] The liquid forms in which the compounds and compositions of
the present invention can be incorporated for administration orally
or by injection include aqueous solutions, suitably flavored
syrups, aqueous or oil suspensions, and flavored emulsions with
edible oils such as cottonseed oil, sesame oil, coconut oil, or
peanut oil, as well as elixirs and similar pharmaceutical
vehicles.
[0116] In some embodiments, the compositions are administered by
the oral route for local effect. Solution, suspension, or powder
compositions can be administered orally from devices which deliver
the formulation in an appropriate manner.
[0117] The amount of compound or composition administered to a
patient will vary depending upon what is being administered, the
purpose of the administration, such as prophylaxis or therapy, the
state of the patient, the manner of administration, and the like.
In therapeutic applications, compositions can be administered to a
patient already suffering from a disease in an amount sufficient to
cure or at least partially arrest the symptoms of the disease and
its complications. Effective doses will depend on the disease
condition being treated as well as by the judgment of the attending
clinician depending upon factors such as the severity of the
disease, the age, weight and general condition of the patient, and
the like.
[0118] The compositions administered to a patient can be in the
form of a pharmaceutical composition as described herein. These
compositions can be sterilized by conventional sterilization
techniques, or may be sterile filtered. Aqueous solutions can be
packaged for use as is, or lyophilized, the lyophilized preparation
being combined with a sterile aqueous carrier prior to
administration. The pH of the compound preparations typically will
be between 3 and 11, more preferably from 5 to 9 and most
preferably from 7 to 8. It will be understood that use of certain
excipients, carriers, or stabilizers will result in the formation
of pharmaceutical salts.
[0119] The therapeutic dosage of a compound of the present
invention can vary according to, for example, the particular use
for which the treatment is made, the manner of administration of
the compound, the health and condition of the patient, and the
judgment of the prescribing physician.
[0120] The proportion or concentration of a compound of the
invention in a pharmaceutical composition can vary depending upon a
number of factors including dosage, chemical characteristics (e.g.,
hydrophobicity), and the route of administration. For example, the
compounds of the invention can be provided in an aqueous
physiological buffer solution containing about 0.1 to about 10% w/v
of the compound for parenteral administration. Some typical dose
ranges are from about 1 .mu.g/kg to about 1 g/kg of body weight per
day.
EXAMPLES
Example 1: Synthesis of Compound 21
##STR00021##
##STR00022##
[0122] Methyl
3-hydroxy-7-((trifluoromethylsulfonyl)oxy)-2-naphthoate (I1):
[0123] 3,7-dihydroxy-2-naphthoic acid (200 mg, 0.980 mmol, 1 eq)
was dissolved in methanol (5 mL) at room temperature. Concentrated
HCl (7 drops, catalytic) was added, and the resulting mixture was
stirred at reflux for 16 hours. The reaction mixture was
concentrated in vacuo and partitioned between EtOAc (10 mL) and
H.sub.2O (10 mL). The aqueous layer was further extracted with
EtOAc (2.times.5 mL). The combined organic layer was washed with
brine, dried with anhydrous Na.sub.2SO.sub.4, filtered, and
concentrated in vacuo to give the corresponding methyl ester as a
yellow solid. No further purification was performed (the crude
product was used in the next step).
[0124] Characterization data for .delta..sub.H (500 MHz,
CDCl.sub.3) 4.02 (s, 3H), 7.12-7.17 (m, 2H), 7.27 (s, 1H), 7.60 (d,
1H, J 9 Hz), 10.28 (s, 1H). .delta..sub.C (500 MHz, CDCl.sub.3)
52.6, 110.1, 111.8, 114.6, 121.6, 127.8, 128.2, 130.4, 133.4,
151.8, 154.7, 170.3. HRMS (ESI) calculated for
C.sub.12H.sub.9O.sub.4 (M-H.sup.+), 217.0501, found 217.0506.
[0125] I1 (214 mg, 0.975 mmol, 1 eq) was dissolved in dry DCM (5
ml). The solution was cooled to 0.degree. C. and pyridine (i58
.mu.L, 1.96 mmol, 5 eq) and triflic anhydride (165 .mu.L, 0.975
mmol, 1 eq) were added using syringes in a dropwise manner. The
reaction was allowed to warm up to room temperature and stirred for
2 hours. The reaction solution was diluted with Et.sub.2O (5 mL)
and quenched with excess HCl (aq., 3M). The aqueous layer was
further extracted with Et.sub.2O (5 mL). The combined organic layer
was washed with saturated NaHCO.sub.3 and brine, dried with
anhydrous Na.sub.2SO.sub.4, filtered, and concentrated in vacuo to
give a brown oil. The crude mixture was purified using flash
chromatography (20% EtOAc in hexanes) to give I2 as an off-white
solid (262 mg, 80% over 2 steps).
[0126] Characterization data for I2: .delta..sub.H (500 MHz,
CDCl.sub.3) 4.04 (s, 3H), 7.34 (s, 1H), 7.35 (dd, 1H, J 2.5 Hz and
9.5 Hz), 7.69 (d, 1H, J 2.5 Hz), 7.72 (dd, 1H, J 0.5 Hz and 9.5
Hz), 8.49 (d, 1H, J 0.5 Hz), 10.54 (s, 1H). .delta..sub.C (500 MHz,
CDCl.sub.3) 52.9, 112.1, 115.7, 120.3, 122.8, 126.3, 128.9, 132.4,
136.6, 145.5, 157.3, 169.7. HRMS (ESI) calculated for
C.sub.13H.sub.8F.sub.3O.sub.6S (M-H.sup.+), 358.9994, found
348.9999.
[0127] Methyl
6-hydroxy-5',5',8',8'-tetramethyl-5',6',7',8'-tetrahydro-[2,2'-binaphthal-
ene]-7-carboxylate (I4):
[0128] I2 (13.0 mg, 0.0387 mmol, 1 eq) and I3 (27.0 mg, 0.116 mmol,
3 eq) were dissolved in DME (3 mL) at room temperature. PPh.sub.3
(2.03 mg, 0.00773 mmol, 20 mol %), KF dihydrate (11.0 mg, 0.116
mmol, 3 eq), and Pd.sub.2bda.sub.3 (1.77 mg, 0.00193 mmol, 5 mol %)
were added to the solution. Distilled water (0.4 mL) was added to
the resulting mixture and the reaction was degassed and purged with
argon. The reaction mixture was stirred at reflux for 16 hours.
After cooling, the reaction mixture was filtered through a layer of
Celite and the filtrate partitioned between EtOAc (5 mL) and
H.sub.2O (5 mL). The aqueous layer was further extracted with EtOAc
(5 mL). The combined organic layer was washed with brine, dried
with anhydrous Na.sub.2SO.sub.4, filtered and concentrated in
vacuo. The crude mixture was purified using flash chromatography
(20% EtOAc in hexanes) to give I4 (14.4 mg, 96%).
[0129] Characterization data for I4: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.34 (s, 6H), 1.37 (s, 6H), 1.74 (s, 2H), 4.04 (s, 3H),
7.33 (s, 1H), 7.43 (m, 2H), 7.61 (s, 1H), 7.76 (m, 2H), 7.97 (s,
2H), 8.56 (s, 1H), 10.45 (s, 1H). .delta..sub.C (500 MHz,
CDCl.sub.3) 32.3, 32.5, 33.9, 34.1, 34.7, 34.9, 52.9, 125.2, 125.3,
125.6, 125.9, 126.8, 127.4, 128.5, 129.1, 131.2, 131.9, 136.4,
137.7, 141.7, 145.4, 145.7, 168.9.
[0130] Methyl
5',5',8',8',-tetramethyl-6-((trifluoromethylsulfonyl)oxy)-5',6',7',8',-te-
trahydo-[2,2'-binaphthalene]-7-carboxylate (I5):
[0131] The phenol I4 (20.0 mg, 0.0257 mmol, 1 eq) was dissolved in
dry DCM (2 ml). This solution was cooled to 0.degree. C. and
pyridine (20.8 .mu.L, 0.129 mmol, 5 eq) and triflic anhydride (13.0
.mu.L, 0.0386 mmol, 1.5 eq) were added using a syringe. The
reaction was allowed to warm up to room temperature and stirred for
2 hours. The reaction solution was diluted with Et.sub.2O (5 mL)
and quenched with excess HCl (aq., 3M). The aqueous layer was
further extracted with Et.sub.2O (5 mL). The combined organic layer
was washed with saturated NaHCO.sub.3 and brine, dried with
anhydrous Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The
crude mixture was purified using flash chromatography (20% EtOAc in
hexanes) to give I5 (13.0 mg, 97%).
[0132] Characterization data for I5: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.35 (s, 6H), 1.38 (s, 6H), 1.75 (s, 4H), 4.03 (s, 3H),
7.47 (s, 2H), 7.63 (s, 1H), 7.76 (s, 1H), 7.95 (s, 2H), 8.14 (s,
1H), 8.72 (s, 1H).
[0133] Methyl
5',5',8',8'-tetramethyl-5',6',7',8'-tetrahydro-[2,2'-binaphthalene]-7-car-
boxylate (I6): The triflate I5 (29.4 mg, 0.0565 mmol, 1 eq) was
dissolved in dry DMF (0.5 mL) at room temperature. DIPEA (29.5
.mu.L, 0.169 mmol, 3 eq), Pd(PPh.sub.3).sub.2Cl.sub.2 (2 mg,
0.00283 mmol, 5 mol %), and HCOOH (43.0 .mu.L, 0.113 mmol, 2 eq)
were added and the final solution was heated to 100.degree. C. for
6 hours. The cooled reaction mixture was filtered through a layer
of Celite and partitioned between EtOAc (5 mL) and H.sub.2O (5 mL).
The aqueous layer was further extracted with another portion of
EtOAc (5 mL). The combined organic layer was washed with brine,
dried with anhydrous Na.sub.2SO.sub.4, filtered, and concentrated
in vacuo. The crude mixture was purified using flash chromatography
(20% EtOAc in hexanes) to give I6 (14.1 mg, 68%).
[0134] Characterization data for I6: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.35 (s, 6H), 1.38 (s, 6H), 1.75 (s, 4H), 4.00 (s, 3H),
7.43 (dd, 2H, J.sub.1 8.1 Hz and 8.1 Hz), 7.65 (s, 1H), 7.84 (m,
3H), 8.04 (d, 1H, J 8.4 Hz), 8.12 (s, 1H), 8.67 (s, 1H).
[0135]
N-(benzyloxy)-5',5',8',8'-tetramethyl-5',6',7',8'-tetrahydro-[2,2'--
binaphthalene]-7-carboxamide (I7):
[0136] To a solution of I6 (14.1 mg, 0.0379 mmol, 1 eq) in dry THF
(795 .mu.L) was added methanol (264 .mu.L) and 1M KOH (aqueous, 264
.mu.l, 7 eq). The solution was stirred at room temperature for 15
hours. The reaction mixture was acidified to around pH 3 with 3 M
HCl, and extracted with EtOAc (3.times.5 mL). The combined organic
layer was washed with brine, dried with Na.sub.2SO.sub.4, filtered,
and concentrated to dryness to give the corresponding carboxylic
acid. The crude acid (18.4 mg, 0.0513 mmol, 1 eq) was then
dissolved in dry DMF (2 mL), and OBnNH.sub.2 hydrochloride salt
(9.01 mg, 0.0564 mmol, 1.1 eq) and DIPEA (26.8 .mu.L, 0.154 mmol, 3
eq) were added to the solution. HBTU (25.3 mg, 0.0667 mmol, 1.3 eq)
was added. The resulting mixture was stirred at room temperature
for 15 hours. The crude reaction mixture was partitioned between
EtOAc and water. The organic layer was washed with brine, dried
with Na.sub.2SO.sub.4, filtered, and concentrated in vacuo. The
crude was purified by flash chromatography (6% EtOAc in toluene) to
give I7 as a white solid (22.6 mg, 95% over 2 steps).
[0137] Characterization data for I7: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.33 (s, 6H), 1.36 (s, 6H), 1.73 (s, 4H), 5.09 (s, 2H),
7.28 (m, 1H), 7.32-7.38 (m, 5H), 7.61 (d, 1H, J 1.2 Hz), 7.74-7.90
(m, 4H), 8.01 (s, 1H), 8.02 (s, 1H), 8.29 (s, 1H).
[0138]
N-hydroxy-5',5',8',8',-tetramethyl-5',6',7',8'-tetrahydro-[2,2'-bin-
aphthalene]-7-carboxamide (A):
[0139] I7 (25.0 mg, 0.0539 mmol) was dissolved in minimal amounts
of EtOAc. A catalytic amount of Pd--C was added and the flask was
purged with H.sub.2 using a balloon. The reaction was further
stirred at room temperature in presence of 1 atm of H.sub.2 gas
with TLC monitoring until the starting material was completely
consumed (about 20-30 min). The reaction mixture was filtered
through a layer of Celite and the filtrate concentrated under
reduced pressure to give an orange solid (15 mg, 85% before HPLC
purification). The crude product was purified by reverse-phase HPLC
(Agilent 1260 Infinity HPLC system equipped with an autosampler, a
quaternary pump, a photodiode array detector, and an Agilent Zorbax
SB-C18 analytical column, methanol/H.sub.2O). The final product A
was obtained as a white crystalline solid.
[0140] Characterization data for A: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.35 (s, 6H), 1.38 (s, 6H), 1.75 (s, 4H), 7.43 (d, 1H,
J 8.1 Hz), 7.47 (dd, 1H, J 2.1 Hz and 8.7 Hz), 7.64 (d, 1H, J 2.1
Hz), 7.83 (d, 2H, J 8.7 Hz), 7.92 (dd, 2H, J 3.9 Hz and 8.1 Hz),
8.09 (m, 1H), 8.21 (s, 1H), 8.40 (s, 1H). .delta..sub.C (400 MHz,
CDCl.sub.3) 30.9, 31.2, 33.9, 34.3, 34.9, 35.2, 123.5, 124.4,
124.6, 124.7, 125.3, 126.1, 127.0, 128.5, 129.3, 129.7, 131.9,
135.2, 137.8, 140.7, 144.5, 145.1, 166.9. HRMS (ESI) calculated for
C.sub.25H.sub.26NO.sub.2 (M-H.sup.+), 372.1969, found 372.1941.
Example 2: Synthesis of Compound B
##STR00023##
##STR00024##
[0142] 1,1,4,4-tetramethyl-1,2,3,4-tetrahydronaphthalene (I8):
[0143] 2,5-dichloro-2,5-dimethylhexane (300 mg, 1.64 mmol, 1 eq)
was dissolved in dry benzene (25 mL). AlCl.sub.3 (22.0 mg, 0.164
mmol, 0.1 eq) was added to the solution, which was stirred at
reflux for 16 hours. The reaction was quenched with 3M HCl (5 mL)
and extracted with hexanes (10 mL.times.3). The combined organic
layer was washed with brine, dried with Na.sub.2SO.sub.4, filtered,
and concentrated in vacuo. The crude was purified by flash
chromatography (100% hexanes) to give I8 (309 mg, 91% yield) as a
colourless oil.
[0144] Characterization data for I8: .delta..sub.H (500 MHz,
CDCl.sub.3) 1.33 (s, 12H), 1.74 (s, 4H), 7.16-7.19 (m, 2H),
7.34-7.36 (m, 2H, J 2 Hz and 8.4 Hz). .delta..sub.C (500 MHz,
CDCl.sub.3) 31.9, 34.2, 35.1, 125.5, 126.5, 144.8.
[0145]
1-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)ethanone
(I9):
[0146] I8 (37.0 mg, 0.197 mmol, 1 eq) was dissolved in dry DCM (5
mL), to which acetyl chloride (15.5 .mu.L, 0.216 mmol, 1.1 eq) and
AlCl.sub.3 (26.2 mg, 0.216 mmol, 1.1 eq) were added sequentially.
The reaction mixture was refluxed for two hours then cooled to room
temperature and quenched with water. The crude mixture was
extracted with EtOAc (3 mL.times.3). The combined organic layer was
washed with NaHCO.sub.3 (saturated, aqueous) and brine, dried with
Na.sub.2SO.sub.4, filtered, and concentrated in vacuo. The crude
was purified by flash chromatography (10% EtOAc/hexanes) to give I9
(44.8 mg, 98% yield).
[0147] Characterization data for I9: .delta..sub.H (500 MHz,
CDCl.sub.3) 1.28 (s, 6H), 1.30 (s, 6H), 1.69 (s, 4H), 2.55 (s, 3H),
7.38 (d, 1H, J 8.0 Hz), 7.70 (dd, 1H, J 1.9 Hz and 8.0 Hz), 7.92
(d, 1H, J 1.9 Hz). HRMS (ESI) calculated for C.sub.16H.sub.23O
(M+H.sup.+), 231.1749, found 231.1767.
[0148] Ethyl 4-(2-(5,5,8,8-tetramethyl-5, 6,
7,8-tetrahydronaphthalen-2-yl)prop-1-en-1-yl)benzoate (I12):
[0149] The Homer Wardsworth Emmons reagent I10 (316 mg, 1.10 mmol,
2 eq) was dissolved in dry THF (5 mL) and cooled to 0.degree. C.
NaHMDS (1M solution in THF, 1.10 mL, 2 eq) was added dropwise to
the phosphonate reagent and the mixture stirred at low temperature
for 30 minutes. I9 (127 mg, 0.552 mmol, 1 eq) was dissolved in dry
THF (5 mL) in a separate flask and was slowly added to deprotonated
HWE reagent through cannula. The mixture was allowed to slowly warm
up to room temperature and stirred until disappearance of starting
material. The reaction was quenched with saturated NH.sub.4Cl
solution and extracted with EtOAc (5 mL.times.3). The combined
organic layer was washed with NaHCO.sub.3 (saturated, aqueous) and
brine, dried with Na.sub.2SO.sub.4, filtered, and concentrated in
vacuo. The crude product was purified by flash chromatography (20%
EtOAc/hexanes) to give I11 as a E:Z mixture (1:4, 166 mg, 83%
yield). I11 (166 mg, 0.458 mmol, 1 eq) was dissolved in dry EtOH,
to which an excess of freshly prepared NaOEt solution was added.
The mixture was stirred at room temperature for two hours.
Neutralizing workup and removal of organic solvent yielded I12 as
mostly E isomer.
[0150] Characterization data for I12 as an E isomer: .delta..sub.H
(300 MHz, CDCl.sub.3) 1.32 (s, 6H), 1.35 (s, 6H), 1.39 (t, 3H, J
7.1 Hz), 1.72 (s, 4H), 2.30 (d, 3H, J 1.2 Hz), 4.36 (q, 2H, J 7.1
Hz), 6.82 (s, 1H), 7.32 (m, 2H), 7.42 (d, 1H, J 8.1 Hz), 7.47 (d,
1H, J 1.2 Hz), 8.04 (d, 1H, J 8.1 Hz).
[0151]
(E)-N-hydroxy-4-(2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthale-
n-2-yl)prop-1-en-1-yl)benzamide (B):
[0152] I12 (49 mg, 0.135 mmol) was dissolved in THF (1 mL), and KOH
(1M, 0.5 mL) and MeOH (0.5 mL) were added. The reaction proceeded
at room temperature for 5 hours until the starting material was not
observable on TLC. The mixture was acidified with 3M HCl to pH 3
and extracted repeatedly with EtOAc. The combined organic layer was
washed with brine, dried with Na.sub.2SO.sub.4, filtered, and
concentrated in vacuo. The crude carboxylic acid was used without
purification. The acid was subsequently dissolved in dry DMF (2
mL). NH.sub.2OTBS (23.3 mg, 0.158 mmol, 1.1 eq), DIPEA (75.0 .mu.L,
0.430 mmol, 3 eq) were added with stirring at room temperature,
followed by HBTU (71 mg, 0.186 mmol, 1.3 eq). The reaction mixture
was stirred at room temperature for 16 hours. A quick extraction
with EtOAc was performed and the organic layer containing the O-TBS
protected hydroxamic acid was concentrated in vacuo and redissolved
in DCM (3 mL). An excess of concentrated HF (.about.20 eq) was
added to the DCM solution and the biphasic mixture was stirred
vigorously for two hours at room temperature. The reaction was
neutralized with saturated NaHCO.sub.3 and extracted with
additional DCM. The organic layer was washed with brine, dried with
Na.sub.2SO.sub.4, filtered, and concentrated in vacuo. The crude
product was purified by reverse-phase flash chromatography (20-95%
MeOH in H.sub.2O) to yield B as a slightly yellow oil (43 mg,
87%).
[0153] Characterization data for B: .delta..sub.H (500 MHz,
CD.sub.3OD) 1.31 (s, 6H), 1.34 (s, 6H), 1.74 (s, 4H), 2.28 (d, 1H,
J 1.5 Hz), 6.82 (s, 1H), 7.02 (dd, 1H, J 2 Hz and 8.5 Hz), 7.31 (m,
2H), 7.45 (d, 2H, J 8.5 Hz), 7.77 (d, 2H, J 8.5 Hz). .delta..sub.C
(500 MHz, CD.sub.3OD) 30.82, 30.84, 30.9, 33.7, 33.9, 34.8, 35.0,
64.0, 123.1, 123.6, 125.3, 126.2, 126.6128.7, 128.9, 129.7, 139.5,
140.7, 142.1, 144.0, 144.4, 166.6. HRMS (ESI) calculated for
C.sub.24H.sub.28NO.sub.2, [M-H.sup.+] 362.2123, found 362.2132.
Example 3: Synthesis of Compound 20
##STR00025##
##STR00026##
[0155] 7-(benzyloxy)quinoline-3-carbonitrile (I13):
[0156] I13 was prepared according to the procedure of Cai T. B., et
al, Journal of Medicinal Chemistry, 51:1849-1860, 2008.
[0157] Characterization data for I13: .delta..sub.H (500 MHz,
CDCl.sub.3) 5.28 (s, 2H), 7.39-7.51 (m, 5H), 7.65 (dd, 1H, J 2.5 Hz
and 9.0 Hz), 8.05 (d, 1H, J 9.0 Hz), 8.14 (d, 1H, J 2.5 Hz), 8.63
(d, 1H, J 2.0 Hz), 9.15 (d, 1H, J 2.0 Hz) .delta..sub.C (500 MHz,
CDCl.sub.3) 70.6, 116.3, 121.7, 122.3, 122.8, 123.1, 123.3125.4,
127.7, 128.5, 129.5, 130.8, 141.2, 149.1, 151.4.
[0158] 3-cyanoquinolin-7-yl trifluoromethanesulfonate (I14):
[0159] I13 (27.0 mg, 0.104 mmol, 1 eq) was dissolved in minimal
EtOAc. A catalytic amount of Pd--C was added and the flask was
purged with H.sub.2 using a balloon. The reaction was further
stirred at room temperature in presence of 1 atm of H.sub.2 gas
with TLC monitoring until the starting material was completely
consumed (about three hours). The reaction mixture was filtered
through a layer of Celite and the filtrate concentrated under
reduced pressure to give an orange oil. The crude product was used
in the next step without purification. The crude hydroxyquinoline
(17.7 mg, 0.104 mmol, 1 eq) was dissolved in dry DCM (1 mL),
pyridine (42.0 .mu.L, 0.519 mmol, 5 eq) and triflic anhydride (27.0
.mu.L, 0.156 mmol, 1.5 eq) were added at room temperature. The
mixture was stirred for 2.5 hours at which point the reaction was
quenched with water and partitioned between EtOAc and water. The
aqueous layer was extracted with additional EtOAc (5 mL.times.3)
and the organic layers combined. The latter was washed with sodium
bicarbonate (saturated, aqueous) and brine, dried over anhydrous
Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The
purification using flash chromatography (20% EtOAc in hexanes)
yielded I14 as a waxy solid (13 mg, 54% over two steps).
[0160] Characterization data for I14: .delta..sub.H (500 MHz,
CDCl.sub.3) 7.64 (dd, 1H, J 2.5 Hz and 9.0 Hz), 8.05 (d, 1H, J 9.0
Hz), 8.14 (d, 1H, J 2.5 Hz), 8.63 (d, 1H, J 2.0 Hz), 9.15 (d, 1H, J
2.0 Hz) .delta..sub.C (500 MHz, CDCl.sub.3) 116.3, 117.5, 120.0,
121.7, 122.8, 125.4, 130.8, 141.2, 149.1, 151.4, 151.6.
[0161]
7-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)quinoline--
3-carbonitrile (I15):
[0162] I14 (5.7 mg, 0.0189 mmol, 1.0 eq) and 13 (13 mg, 0.0567
mmol, 3.0 eq) were dissolved in DME (1 mL) at room temperature.
PPh.sub.3 (1.00 mg, 0.00377 mmol, 20 mol %), KF dihydrate (5.30 mg,
0.0567 mmol, 3.0 eq), and Pd.sub.2bda.sub.3 (1.00 mg, 0.000943
mmol, 5 mol %) were added to the solution. Distilled water (10
drops) was added to the resulting mixture and the reaction was
degassed and purged with argon. The reaction mixture was stirred at
reflux for 16 hours. After cooling, the reaction mixture was
filtered through a layer of Celite and the filtrate partitioned
between EtOAc (5 mL) and H.sub.2O (5 mL). The aqueous layer was
further extracted with EtOAc (5 mL). The combined organic layer was
washed with brine, dried with anhydrous Na.sub.2SO.sub.4, filtered
and concentrated in vacuo. The crude mixture was purified using
flash chromatography (20% EtOAc in hexanes) to give I15 (4.89 mg,
76%).
[0163] Characterization data for I15: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.34 (s, 6H), 1.37 (s, 6H), 1.74 (s, 4H), 7.43 (d, 1H,
J 8.1 Hz), 7.51 (dd, 1H, J 2.1 Hz and 8.1 Hz), 7.70 (d, 1H, J 2.1
Hz), 7.83 (bs, 2H), 8.02 (bs, 1H), 8.37 (s, 1H), 8.80 (d, 1H, J 1.5
Hz). .delta..sub.C (300 MHz, CDCl.sub.3) 31.9, 34.2, 35.1, 125.5,
126.5, 144.8, 116.3, 117.5, 120.0, 121.7, 122.8, 125.4, 130.8,
141.2, 149.1, 151.4, 151.6.
[0164] Methyl
7-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)quinoline-3-carb-
oxylate (I16):
[0165] I15 (10.0 mg, 0.0294 mmol) was dissolved in MeOH (2 mL) to
which concentrated HCl (2 mL) was added. The mixture was heated to
reflux with stirring for 16 hours then cooled in an ice bath. The
pH was adjusted to neutral with 1M KOH. The reaction mixture was
extracted with EtOAc (5 mL.times.3). The combined organic layer was
washed with brine, dried with anhydrous Na.sub.2SO.sub.4, filtered
and concentrated in vacuo. The crude mixture was purified using
preparative thin layer chromatography (30% EtOAc in hexanes) to
give I16 (9.50 mg, 87%).
[0166] Characterization data for I16: .delta..sub.H (300 MHz,
CDCl.sub.3) 1.34 (s, 6H), 1.37 (s, 6H), 1.74 (s, 4H), 4.03 (s, 3H),
7.46 (d, 1H, J 8.4 Hz), 7.53 (d, 1H, J 8.1 Hz), 7.73 (s, 1H), 7.89
(d, 1H, J 8.1 Hz), 7.98 (d, 1H, J 8.4 Hz), 8.39 (s, 1H), 8.87 (s,
1H), 9.46 (s, 1H).
[0167]
N-hydroxy-7-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)-
quinoline-3-carboxamide (C):
[0168] I16 (9.50 mg, 0.0254 mmol, 1.00 eq) was dissolved in dry THF
(2 mL) and cooled in an ice bath. To the solution were added MeOH
(0.5 mL) and 50% v/v NH.sub.2OH (in water, 0.5 mL, excess). The
mixture was allowed to warm up slowly to room temperature and
stirred for three days. The pH was adjusted to approximately pH 3
with 1M KOH. The resulting solution was partitioned between water
and EtOAc. The aqueous layer was further extracted with EtOAc (5
mL.times.3). The combined organic layer was washed with brine,
dried with anhydrous Na.sub.2SO.sub.4, filtered and concentrated in
vacuo. The crude product was purified by reverse-phase flash
chromatography (20-95% MeOH in H.sub.2O) to yield C as a clear film
(6.5 mg, 74%).
[0169] Characterization data for C: .delta..sub.H (300 MHz,
CD.sub.3OD) 1.32 (s, 6H), 1.37 (s, 6H), 1.77 (s, 4H), 7.48 (d, 1H,
J 8.4 Hz), 7.58 (d, 1H, J 8.1 Hz), 7.75 (s, 1H), 7.94 (d, 1H, J 8.1
Hz), 7.98 (d, 1H, J 8.4 Hz), 8.39 (s, 1H), 8.95 (s, 1H), 9.50 (s,
1H). .delta..sub.C (300 MHz, CD.sub.3OD) 31.3, 31.4, 34.1, 34.4,
35.2, 35.3, 123.5, 124.3, 124.5, 124.7, 125.20, 126.4, 127.8,
128.6, 128.9, 129.7, 131.6, 136.6, 137.5, 140.7, 148.3, 149.1,
167.9. HRMS (ESI) calcd for C.sub.24H.sub.26N.sub.2O.sub.2,
[M-H.sup.+] 373.1992, found 373.1978.
Example 4: Synthesis of Compounds 22, 23, and 24
##STR00027##
[0171] To 200 mg of 6-bromoindole 2-carboxylic acid methyl ester in
THF 6 ml was added
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (70
mg), dicyclohexylmethylamine (1.2 ml) and boronic acid (300 mg).
The mixture was stirred under reflux for 12 hours then cooled to
room temperature. The reaction mixture was poured into water and
extracted with ethyl acetate, and the resulting organic layer was
dried and evaporated. The crude mixture was purified by flash
chromatography (ISCO combiflash) using a 10-50% ethyl acetate
gradient to afford 200 mg of product, which was dissolved in 10 ml
methanol:THF (1:1) and 2 ml of 2N KOH was added to the resulting
solution. The solution was heated for 12 hours at 60.degree. C.
then cooled to room temperature. Water (50 ml) and 2N HCl (4 ml)
was added to the solution, which was then extracted with ethyl
acetate (100 ml). The organic layer was dried and evaporated. The
crude product was purified by combiflash using 10-100% ethyl
acetate gradient to afford the acid as a white solid (140 mg). The
acid was dissolved in DMF (5 ml) to which EDCI (140 mg), HOBT (120
mg) and 1,2-phenylenediamine (120 mg) was added and the reaction
mixture was stirred overnight at room temperature. The reaction
solution was extracted with water (100 ml) and ethyl acetate (100
ml), and the isolated organic layer was dried and evaporated. This
crude product was purified using combiflash with 0-100% ethyl
acetate to give 70 mg of final product (22).
[0172] Characterization data: (300 MHz, CD.sub.3COCD.sub.3) 10.8
(s, 1H), 9.2 (s, 1H), 7.8 (s, 1H), 7.75 (d, 1H), 7.65 (s, 1H).
7.45-7.5 (m, 5H), 7.1 (m, 1H), 6.9 (m, 1H), 4.7 (bs, 2H), 1.75 (s,
4H), 1.4 (d. 6H). MS: [M+1] 438.
Synthesis of Compound 23
##STR00028##
[0174] To 250 mg of indole-5-carboxylic acid was added 16 ml of
acetic acid, 300 mg of boronic acid and 70 mg palladium acetate.
The reaction was flushed with oxygen, and then stirred for 48 hrs.
The solvent was evaporated, and the resulting product purified by
flash chromatography (ISCO combiflash) using a 10-50% ethyl
acetate/hexane gradient. The purified acid product was dissolved in
5 ml of DMF, and HOBt (150 mg), EDCI (150 mg), and
1,2-phenylenediamine (150 mg) was added to the solution. The
reaction was stirred overnight at room temperature. This reaction
mixture was poured into water, extracted with ethyl acetate, dried
and evaporated. A 5:1 hexane/ethyl acetate solution was added to
the crude product, and the suspension was filtered to afford 100 mg
of product (23).
[0175] Characterization data: NMR (600 MHz, CD3COCD3): 11.7 (s,
1H), 9.5 (s, 1H), 8.35 (s, 1H), 7.8 (s, 1H), 7.74 (d, 1H), 7.66 (d,
1H), 7.47 (d, 1H), 7.2 (d, 1H), 7.01 (m, 2H), 6.8 (d, 1H), 6.63 (m,
1H), 4.9 (s, 2H), 1.66 (s, 4H) and 1.3 (d, 12H).
Synthesis of Compound 24
##STR00029##
[0177] To a solution of 5-bromoindole-2-carboxylic acid methyl
ester (250 mg) in THF (6 ml) was added
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (70 mg)
and boronic acid (300 mg). This reaction mixture was placed
degassed with argon and heated at 60.degree. C. for 48 hours. The
solvent was evaporated, and the resulting product purified by flash
chromatography (ISCO combiflash) using a 10-50% ethyl
acetate/hexane gradient. The resulting product (purified ester) was
hydrolyzed by heating at 60.degree. C. overnight in a solution of
methanol/THF/2N NaOH (1:1:1, 9 ml). This solution was poured into a
solution of 5 ml 2N HCl and 50 ml water, and the extracted with
ethyl acetate. The organic layer was dried and evaporated. The
crude acid (100 mg) was dissolved in DMF (10 ml) to which EDCI (150
mg), HOBt (150 mg) and 1,2-phenylenediamine (150 mg) was added, and
this solution was stirred overnight. The solvent was evaporated
off, and the resulting product purified by flash chromatography
(ISCO combiflash) using a 10-50% ethyl acetate/hexane gradient to
provide compound 24.
[0178] Characterization data: NMR (600 MHz, CD3SOCD3): 11.6 (s,
1H), 9.75 (s, 1H), 7.9 (s, 1H), 7.4-7.7 (m, 6H), 7.25 (9d, 1H), 7.0
(m, 1H), 6.8 (s, 1H), 6.6 (s, 1H), 4.95 (s, 2H), 1.75 (s, 4H) and
1.3 (d, 12H).
Example 5
[0179] The effect of compounds on the enzymatic activity of
purified recombinant human HDAC-1, -2, -3, -6, and -8 activity and
of purified rat liver HDAC was examined by measuring the
deacetylation of synthetic peptides in various preparations of
HDACs. HDAC assays were performed using a two-step enzymatic
reaction where enzyme activity is correlated to the release of
4-amino-7-methylcoumarin (AMC). AMC fluorescence is measured in a
fluorescent plate reading using .lamda..sub.ex 380 nm and
.lamda..sub.em 440 nm. The assay was run in a 96-well format using
an assay buffer (50 mM Tris-HCl, pH 8, 137 mM NaCl, 2.7 mM KCl, 1
mM MgCl.sub.2 and 50 ug/mL ultra-pure, non-acetylated BSA. Purified
human recombinant HDAC-1, HDAC-2, HDAC-3/NCOR and HDAC-6 were
assayed using Ac-Arg-Gly-Lys (Ac)-AMC (Bachem 4044046) as a
substrate. Purified human recombinant HDAC-8 was assayed using
Boc-Lys(Tfa)-AMC (Bachem 4060676) as a substrate. Both substrates
were used at a final concentration of 10 .mu.M. Final enzyme
concentrations in the assays were as follows: 0.38 .mu.g/mL HDAC-2
(Cayman Chem 10009377), 1.37 .mu.g/mL HDAC-6 (Cayman Chem
10009465), HDAC-8 (Cayman Chem 10009465, 150 .mu.l, diluted
100.times.), purified rat liver HDAC (Millipore 382165, 0.8 mg/mL
proteins diluted 50.times.).
[0180] HDAC-8, HDAC-9, HDAC-10 and HDAC-11 were assayed using
HDAC-Glo.TM. I/II Kit (Promega Corporation G6421) in a total volume
of 110 .mu.l following the manufacturer's instructions. Enzyme
concentrations were as follows: 230 ng/.mu.L HDAC-8 (Cayman Chem
19380), 100 ng/mL HDAC-9 (Sigma SRP5268), 460 ng/ml HDAC-10
(Axxora/Enzo BML-SE99), 600 ng/mL HDAC-11 (Axxora/Enzo
BML-SE560).
[0181] Benchmark compounds, including, entinostat, panabinostat,
ricolinostat, romidepsin, and suberoylanilide hydroxamic acid
(SAHA) were run alongside the test compounds. The compounds were
dissolved in DMSO and tested in duplicate using 1/3 dilution
concentration curve. Typically, HDAC preparations were
pre-incubated with compounds or DMSO in assay buffer on ice for 5
min prior to substrate addition. The reaction was allowed to
proceed for 40 min at 37.degree. C., after which developer solution
(0.5% trypsin, 10 .mu.M trichostatin A (TSA)) was added to obtain a
final concentration of 0.1% trypsin, 2 .mu.M TSA. After 30 minutes
at room temperature, the amount of free fluorogenic AMC was
measured as described above. Data showing the effect of various
compounds of the invention on HDAC-1 and HDAC-6 are presented in
FIGS. 5A and 5B, respectively, and data for all HDACs are
summarized in Table 1.
TABLE-US-00001 TABLE 1 1 2 3 6 8 9 10 11 Rat liver 5 +/- ++ ++ +++
+++++ +/- +/- +/- ++ - 8 - - +++ ++ - - - - ++ - 13 +/- ++ ++ ++++
+++ +/- +/- +/- +++ +++ - 17 - - - ++ ++ - - - - ++ - 18 +/- ++ -
+++ ++ NT NT NT NT + - 19 - ++ - +++ - NT NT NT NT - - 20 - - ++ ++
NT NT NT +/- +++ 21 - - - - - - NT NT - - - Entinostat +++ ++++ +++
- + +++ ++ +++ NT - NT Panobinostat +++++ +++++ +++++ +++++ +++++
+++++ +++++ +++++ NT - +++++ Ricolinostat ++++ ++++ +++++ +++++
++++ NT ++ +++ NT - +++ Romidepsin +/- +/- +++ - ++ +++++ +++ +++
NT - ++++ SAHA ++++ ++++ +++++ +++++ +++++ +++++ ++++ ++++ +++++ -
+++++ Because absolute IC.sub.50 values vary with different assay
systems or substrates, the relative activity of each compound is
represented using the symbols "+" or "-". A greater number of "+"
signs denotes a greater potency (IC.sub.50) the inhibition of the
respective HDACs. The symbol "+/-" denotes that 100% inhibition of
the enzyme could not be reached in the condition used. "NT" = not
tested.
[0182] Results:
[0183] Under the experimental conditions, the compounds were mostly
inactive active against HDAC-1. However, compounds 5, 13, and 18
inhibited up to .about.50% HDAC-1 activity. All of the compounds
tested demonstrated an apparent lack of inhibition of HDAC-1, -2,
-3, -9, -10 and -11 under the experimental conditions.
Surprisingly, compound 5 was shown to be over 200 times more potent
than compound 17 in the HDAC-8 inhibition assay. Likewise, compound
13 was shown to be at least 50-fold more potent than compound 17 in
the HDAC-6 inhibition assay (FIG. 5A and Table 1), and at least
13-fold more potent than compound 17 in HDAC-8 inhibition assay
(Table 1).
[0184] When measuring inhibition of purified rat hepatic HDAC,
compound 8 was at least three times more potent than compound 17,
and compounds 5 and 13 were six and seventy times more potent than
compound 17, respectively (Table 1).
Example 6
[0185] The effect of various compounds of the invention on
RAR-mediated transcription in MCF7 breast cancer cells was examined
by measuring their effect on the transcription of a luciferase
reporter gene under the control of a TK promoter placed downstream
of a RAR response element (RARE: PuGGTCAnnnnnPuGGTCA (SEQ ID
NO:1)). In addition, the effect of the compounds on the closely
related RXR-mediated transcription was examined by measuring their
effect on the transcription of a luciferase reporter gene under the
control of a TK promoter placed downstream of a RXR response
element (RXRE: PuGGTCAnPuGGTCA (SEQ ID NO:2))
[0186] Typically, 10,000 cells were plated in 96 wells plates in
phenol red-free RPMI medium supplemented with 10% charcoal-stripped
Fetal Bovine Serum. After 24 hours, cells were transfected with 0.1
.mu.g of luciferase reporter plasmid and 0.01 .mu.g of a reporter
plasmid expressing renilla luciferase (RLuc) gene under the control
of a SV40 promoter, using Fugene 6 transfection reagent (0.5
.mu.l/well Promega Corporation). Cells were treated in triplicate
with compounds or vehicle (DMSO) for 24 hours. Luciferase and
renilla luciferase activities were measured using Dual-Glo reagent
(Promega Corporation). Luciferase activity was normalized in each
well for renilla activity.
[0187] Results:
[0188] As shown in FIG. 6A and summarized in Table 2, compounds 8,
13, 18, 19 and 20 activated RARE-dependent luciferase expression in
MCF7 cells. Compound 13 was five to ten times more potent than
compound 17 in activating a RARE-tk_luc reporter plasmid
transfected in MCF7 cells. Surprisingly, while all benchmark HDAC
inhibitors activated transcription from an RXRE-promoter, none of
compounds 5, 8, 13, 17, 18, 19, 20 and 21 demonstrated
transcriptional activation of RXR (FIG. 6B; Table 2).
TABLE-US-00002 TABLE 2 Summary of compounds' ability to activate
RARE-dependent transcription in MCF7 cells Compound RAR RXR 5 - 8
++ - 13 +++ - 17 ++ - 18 + - 19 - - 20 +++ 21 - - Entinostat - NT
Panobinostat - +++++ Ricolinostat - +++ Romidepsin - ++++ SAHA -
+++++
Example 7
[0189] The cytotoxicity of compounds was examined and directly
compared to compound 17, by measuring cell survival of clonal tumor
cell lines IMR-32, BE2C (neuroblastoma), as well as MDA-MB-231,
BT20, HCC-38 (Basal) and MCF7 (luminal) breast cancer cells (ATCC).
Cells were cultured in phenol red-free RPMI medium supplemented
with 10% FBS and 1 mM Ala-Glu. Typically, 10,000-20,000 cells/well
were plated in a 96 well plate (Costar 3197). Cells were exposed to
compounds or vehicle (1% DMSO final). Cells were maintained in the
presence of compound for four or five days. Media and compounds
were renewed every 48 hours. Cell survival was measured using the
luminescence CellTiterGlo kit (Promega Corporation) and expressed
as relative light unit as fold over DMSO.
[0190] Results:
[0191] The data show that compounds were cytotoxic in a variety of
cancer cell lines (FIGS. 7A-C). In IMR-32 neuroblastoma cells, the
compounds tested were cytotoxic in the 30 nM to 300 nM range.
Strikingly, compounds 5 and 13 were ten-fold more potent than
compounds 17 and 8 in killing IMR-32 cells (FIG. 7A). Strikingly,
in both BE-2C and MDA-MB-231 cancer cell lines, compounds 13 and 18
were more potent than compound 17, SAHA or Ricolinistat (FIGS.
7B-C).
Example 8
[0192] The effect of certain compounds on intracellular acetylation
of target proteins was tested in high risk neuroblastoma cells,
BE-2C and IMR-32 cells.
[0193] BE-2C cells were grown to confluence in phenol-red-free RPMI
media supplemented with 10% FBS and 2.5 mM Ala-Glu. The cells were
treated with DMSO or 5 .mu.M compound 13, Ricolinostat (2 uM), SAHA
(2 uM), or TSA (1 uM), in DMSO for 16 hours. Total and Lys 40
acetylated alpha tubulin were detected using specific
antibodies.
[0194] IMR32 cells were grown to confluence in phenol-red-free RPMI
media supplemented with 10% es grade FBS and 2.5 mM Ala-Glu. Cells
were treated with DMSO or 1 .mu.M or 5 .mu.M compound 13 in DMSO
for 16 hours. Protein extracts were prepared in RIPA buffer in the
presence of protease and phosphatase inhibitors. Proteins were
separated on a 4-20% gel by PAGE and transferred to a
nitrocellulose membrane.
[0195] Beta actin, total and Lys382 acetylated p53, and Lys40
acetylated alpha, and total tubulin were detected using antibodies
(Cell Signaling #8557, #2524 #2525, #12152 and #2144 respectively)
using manufacturer recommended conditions.
[0196] Results:
[0197] The data show that, consistent with the HDAC inhibitory
activity observed in vitro (Table 1), under conditions where
neither the level of total p53 nor that of total beta actin were
affected, addition of 1 .mu.M or 5 .mu.M compound 13 resulted in a
pronounced accumulation of lysine acetylated p53 (FIG. 8).
Surprisingly, while treatment with ricolinostat, SAHA and TSA all
resulted in a pronounced Lysin (K) 40 alpha-Tubulin acetylation, no
significant acetylation was observed in compound 13-treated cells
at 5 .mu.M, a concentration greater than IC.sub.50 (FIG. 9). The
lack of increased alpha tubulin acetylation was confirmed using
LC-MS analysis. These findings confirm that compound 13 acts as a
bona fide inhibitor of HDAC activity, and suggests that the
cytotoxicity of this compound does not result from tubulin
acetylation.
Example 9
[0198] The effect of compounds on myoblast fusion was examined in
C2C12 cells maintained in RPMI media supplemented with 2% horse
serum. C2C12 myoblastic cells where purchased from the American
Type Culture Collection (ATCC) and maintained undifferentiated in
RPMI media (Corning) supplemented with 2 mM L-Alanine-L-Glutamine
(ATCC) and 1 mM pyruvate (Corning). Undifferentiated cells where
maintained below 70% confluence. For long term cultures and
compound treatment, cells where plated at high density CellBIND
Culture Dishes (corning 3294, 3296, 3337) and in RPMI supplemented
with 2% Horse Serum (Gibco) and 2 mM L-Alanine-L-Glutamine (ATCC)
and 1 mM pyruvate (Corning). Compounds were dissolved in DMSO at
1000 time the final concentration and diluted 1-in-1000 in the
media covering the cells. Media and compounds were changed daily.
For immunocytochemistry, cells were fixed in 2% PFA in HBSS for 10
minutes and left in HBSS at 4.degree. under humidified atmosphere
and processed for immunocytochemistry. For myosin heavy chain
detection (MHC), cells were first incubated in 100 ul -1 ml 0.15 M
Glycine in DPBS for 10 minutes, rinse with DPBS. 100 ul-1 ml 0.5%
Triton-X in DPBS was added for 10 minutes, rinsed with DPBS, and
followed by incubation with 100 ul blocking agent (10% goat serum
in DPBS) for 30 min at room temperature. MF20 primary antibody in
10% goat serum in DPBS was added at 1/60 dilution for 30 min at
room temperature and rinsed three times with 100 ul DPBS. IgG2b
goat anti mouse secondary antibody (Jackson Immuno-Research) was
added at 1:1000 in 10% goat serum in DPBS for exactly 30 min at
room temperature then rinsed 3 times with 100 ul DPBS. A final
rinse in H2O was performed and cells were covered with two drops of
Elvanol and cover gently with cover slip and allowed to dry in the
dark for 24-48 hours.
[0199] Results:
[0200] Surprisingly, our data suggest that under long-term cultures
in suboptimal RPMI-containing media, addition of compounds 13, 17
or B enhances the fusion of single cells into large multinucleated,
elongated C2C12 myotubes (FIG. 10) Immunohistochemistry staining
assays suggest that the compounds promote the fusion and/or
maintenance of myosin heavy chain (MHC)-expressing differentiated
myoblasts. In DMSO-treated C2C12 cells cultured for 10 days,
myotube formation does not occurs despite the presence of a large
number of almost exclusively mononucleated MHC-expressing
differentiated myoblasts with a single polynucleated-MHC-expressing
myotube. Under the same conditions, using 300 nM of compound 17
resulted in the majority of MHC-expressing cells being
polynucleated myotubes with an average of 5-10 nuclei per cell,
suggesting that fusion was promoted (FIG. 11).
[0201] The quantitation of the average distribution of myotubes'
length and diameter demonstrate that in the presence of 300 nM of
compound 17 are longer and larger than when treated with DMSO
(FIGS. 12A and B).
[0202] Taken together, our data suggest that the compounds tested
significantly improve myoblast fusion and/or myotube survival in
long-term cultures.
Example 10
[0203] C2C12 myoblasts were seeded at 100,000 in 30 mm plate in
growth medium (Phenol red--free RMPI containing 10% FBS, Sodium
pyruvate and Ala-Glu), and "pre-treated" with DMSO or 200 nM of
compounds 13 or 17. At confluence cells were shifted to
differentiation media (high glucose DMEM, +0.2% HS+1.times.
Insulin/Transferrin/Selenium (Life Tech 41400-045)+Glutamine,
without Pyruvate). Fully differentiated C2C12-derived myotubes were
left in culture without media renewal for 8 days followed by media
renewal and microscopic examination.
[0204] Results:
[0205] The data show that extensive cellular fusion was observed
after 72 hours differentiation in cells that were treated with
compounds 13 or 17 versus DMSO (FIG. 13 top).
[0206] In addition, when left in exhausted media for over 8 days,
DMSO-treated myotubes, but not myotubes treated with compounds 13
or 17, underwent severe structural atrophy and cell death. In
contrast, myotubes treated with compounds 13 or 17 withstood
culture stress conditions with very little structural alteration
(FIG. 13 bottom).
Example 11
[0207] Treatment with compounds 13 or 17 down regulates the
expression muscle-atrophy genes myogenin and Atrogin in long term
C2C12 cultures (FIGS. 14A and B).
[0208] Quantitative RT-PCR was performed on RNA prepared from cell
treated as in Example 9. At day 10 of the experiment, cells were
rinsed in HBSS (without calcium or magnesium) and RNA was prepared
using FastLane Cell cDNA Kit (Qiagen). Quantitative PCR was
performed using Eppendorf and SYBR amplification mix
(Sigma-Aldrich) using the gene specific primer combination given in
Table 3. Data were normalized for ribosomal housekeeping gene
RPLP0
[0209] Results:
[0210] Consistent with a role in preserving myotube integrity
during long term cultures, compounds 13 and 17 down-regulated the
expression of genes implicated in myofiber degradation.
TABLE-US-00003 TABLE 3 Sequence of gene-specific primers used in
Q-RT PCR quantitation of myofiber- degradation associated genes.
ATROGIN MYOGENIN RPLP0 Forward CTTCTCAGAGAGGCAGATTC
CCCAACCCAGGAGATCAT CGGAGGAATCAGATGAGGATA Primer (SEQ ID NO: 3) (SEQ
ID NO: 4) (SEQ ID NO: 5) Reverse TCTTCTTGGGTAACATCGTACA
CTGGGAAGGCAACAGACATA CAGACCGGAGTTTTAAGAGAAG Primer (SEQ ID NO: 6)
(SEQ ID NO: 7) (SEQ ID NO: 8)
Example 11
[0211] Mouse Pharmacokinetics studies were conducted in female
athymic nude or male C57/B6 mice (n=3). Due to its very poor
aqueous solubility, compound 17 was formulated in 66% PEG-400/33%
H2O-1% Tween-80. In contrast compound 13 was formulated in 66%
PEG-400/33% H2O. Compounds were administered PO (30 mg/kg) or IV (5
mg/kg), and plasma concentrations were measured by UV/HPLC. The
results are presented in FIG. 15 and pharmacokinetic parameters for
each compounds are summarized in Table 4.
TABLE-US-00004 TABLE 4 Compound 17 Compound 13 AUC.sub.0-.infin.
(.mu.M*h) 28.71 42.00 C.sub.max (.mu.M) 2.08 5.54 T.sub.max (h) 4.3
1.4 F (%) 19.7 ~40 CLp (mL/min/kg) 10.2 0.24 Vd, ss(L/kg) 4.6 8 MRT
(h) 7.1 6.9
[0212] Results:
[0213] Compound 13 displayed improved aqueous solubility and
pharmacokinetics properties compared with compound 17. Notably,
oral bioavailability, AUC, Cmax were markedly higher for compound
13, while T max was markedly reduced (FIG. 15 and Table 4).
* * * * *