U.S. patent application number 15/317019 was filed with the patent office on 2017-04-20 for on-slide staining by primer extension.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Yury Goltsev, David Robert McIlwain, Garry P. Nolan, Nikolay Samusik.
Application Number | 20170107563 15/317019 |
Document ID | / |
Family ID | 54869107 |
Filed Date | 2017-04-20 |
United States Patent
Application |
20170107563 |
Kind Code |
A1 |
Samusik; Nikolay ; et
al. |
April 20, 2017 |
ON-SLIDE STAINING BY PRIMER EXTENSION
Abstract
A method for analyzing planar sample is provided. In some cases
the method comprises: (a) labelling the planar sample with a
capture agent that is linked to a nucleic acid, wherein the capture
agent specifically binds to complementary sites in the planar
sample; (b) reading a fluorescent signal caused by extension of a
primer that is hybridized to the nucleic acid, using fluorescence
microscopy. Several implementations of the method, and multiplexed
versions of the same, are also provided.
Inventors: |
Samusik; Nikolay; (Mountain
View, CA) ; Nolan; Garry P.; (Redwood City, CA)
; Goltsev; Yury; (Stanford, CA) ; McIlwain; David
Robert; (Palo Alto, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
54869107 |
Appl. No.: |
15/317019 |
Filed: |
June 19, 2015 |
PCT Filed: |
June 19, 2015 |
PCT NO: |
PCT/US2015/036763 |
371 Date: |
December 7, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14560921 |
Dec 4, 2014 |
|
|
|
15317019 |
|
|
|
|
62015799 |
Jun 23, 2014 |
|
|
|
62015799 |
Jun 23, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6804 20130101;
C12Q 1/6818 20130101; C12Q 1/6804 20130101; C12Q 2565/1015
20130101; C12Q 1/6804 20130101; C12Q 2565/101 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with Government support under
contract W81XWH-12-1-0591 awarded by the Department of Defense and
under contracts GM104148 and HHSN268201000034C awarded by the
National Institutes of Health. The Government has certain rights in
the invention.
Claims
1. A method for analyzing a planar sample, the method comprising:
(a) labeling the planar sample with a capture agent to produce a
labeled sample, wherein: (i) the capture agent is linked to a
double-stranded nucleic acid that comprises a first strand and a
second strand; and (ii) a 3' end or 5' end of either the first
strand or the second strand is extendible using the other strand as
a template; (b) contacting the labeled sample with i. a polymerase
and a plurality of nucleotides and/or ii. a labeled oligonucleotide
and a ligase, thereby adding one or more nucleotides of the
plurality of nucleotides and/or a labeled oligonucleotide to an end
of one of the strands of the double-stranded nucleic acid; and (c)
reading a signal generated by addition of the one or more
nucleotides and/or labeled oligonucleotide to one of the first
strand or the second strand of the double-stranded nucleic
acid.
2. The method of claim 1, wherein the signal is a fluorescent
signal.
3. The method of claim 2, wherein reading comprises flourescence
microscopy.
4. The method of any prior claim, further comprising producing an
image showing the pattern of binding of the capture agent to the
planar sample.
5. The method of any prior claim, wherein: step (b) comprises
contacting the labeled sample with a polymerase and a plurality of
nucleotides that comprises a fluorescent nucleotide, thereby adding
the fluorescent nucleotide to one of the first strand or the second
strand of the double-stranded nucleic acid; and step (c) comprises
reading a fluorescent signal generated by addition of the
fluorescent nucleotide to one of the first strand or the second
strand of the double-stranded nucleic acid.
6. The method of claim 5, wherein the fluorescent signal is: i.
emitted directly from the added nucleotide; ii. a FRET signal
generated by energy transfer between two fluorescent nucleotides of
the plurality of flourescent nucleotides that are added to one of
the first strand or second strand of the double-stranded nucleic
acid; or iii. a FRET signal generated by energy transfer between
the added fluorescent nucleotide and a second fluorescent
nucleotide that is present in one of the first strand or second
strand double-stranded nucleic acid.
7. The method of any of claims 1-4, wherein: step (b) comprises
contacting the labeled sample with a ligase and a labeled
oligonucleotide, thereby adding the labeled oligonucleotide to one
of the first strand or second strand of the double-stranded nucleic
acid; and step (c) comprises reading a fluorescent signal generated
by addition of the labeled oligonucleotide to one of the first
strand or second strand of the double-stranded nucleic acid.
8. The method of claim 7, wherein the fluorescent signal is: i.
emitted directly from the added labeled nucleotide; ii. a FRET
signal generated by energy transfer between two labeled nucleotides
that are added to one of the first strand or second strand of the
double-stranded nucleic acid; or iii. a FRET signal generated by
energy transfer between the labeled nucleotide added to one of the
first strand and second strand of the double-stranded nucleic acid
and a second labeled nucleotide that is present in the other
strand.
9. The method of claim 8, wherein the labeled nucleotide comprises
a fluorescent nucleotide.
10. The method of claim 1, wherein extension of one of the first
strand or second strand of the double-stranded nucleic acid removes
a quencher from a quenched fluorescently labeled oligonucleotide
that is hybridized to the other strand, downstream from the first
strand.
11. The method of any of claims 1-10, wherein the first strand of
the double-stranded nucleic acid is a rolling circle amplification
(RCA) product, and the second strand of the double-stranded nucleic
acid comprises oligonucleotides that are hybridized to multiple
sites in the RCA product.
12. The method of any of claims 1-10, wherein the first strand of
the double-stranded nucleic acid is a first oligonucleotide, and
the second strand of the double-stranded nucleic acid is a second
oligonucleotide that is hybridized to the first
oligonucleotide.
13. The method of any of claims 1-12, wherein the planar sample is
a formalin-fixed, paraffin-embedded (FFPE) section.
14. The method of claim 1, wherein the capture agent is an
antibody, an aptamer, or an oligonucleotide probe.
15. A capture agent that is linked to a double-stranded nucleic
acid, wherein: (i) the double-stranded nucleic acid comprises a
first strand and a second strand; (ii) the capture agent is linked
to the first strand; and (iii) the 5' end or the 3' end of either
the first strand or the second strand is extendible using the other
strand as a template.
16. A capture agent composition comprising a plurality of capture
agents that each recognize different complementary sites, wherein:
each of the plurality of capture agents is linked to a
double-stranded nucleic acid that comprises a first strand and a
second strand; the 5' end or 3' end of the first or second strand
is extendible using the other strand as a template; and the
templates immediately downstream of the extendible ends are
different for each of the plurality of capture agents.
17. The capture agent composition of claim 16, wherein: the
sequence of the first strand is the same for each of the plurality
of capture agents; and the sequence of the second strand is
different for each of the plurality of capture agents.
18. The composition of claim 16, wherein the templates immediately
adjacent to the extendible 3' ends are of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more.
19. The composition of claim 16, wherein the templates immediately
adjacent to the extendible 3' ends are of the formula
3'-YN.sub.1/N.sub.2-5', optionally followed by a short stretch of
random nucleotides on the 5' end to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2,
N.sub.3 and N4 are different nucleotides selected from G, A, T and
C.
20. A method for analyzing a planar sample comprising: (a) labeling
the planar sample with a capture agent composition of any of claims
16-19; (b) contacting the labeled sample with i. a polymerase and
either an incomplete nucleotide mix or a nucleotide mix that
comprises a reversible terminator nucleotide, thereby adding a
nucleotide to the plurality of capture agents; and/or ii. a labeled
oligonucleotide and a ligase, thereby adding a labeled
oligonucleotide to the plurality of capture agents; and (c) reading
a signal generated by addition of the nucleotide or the labeled
oligonucleotide to some but not all of the plurality of capture
agents.
21. The method of claim 20, wherein the signal comprises a
fluorescent signal.
22. The method of claim 21, wherein the reading comprises
fluorescent microscopy.
23. The method of claim 20, comprising: (b) contacting the planar
sample with a polymerase and: (i) a nucleotide mix that comprises a
plurality of fluorescent nucleotides that are complementary to
N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide
that is complementary to N.sub.4; or (ii) a nucleotide mix that
comprises a plurality of fluorescent nucleotides that are
complementary to N.sub.1, and N.sub.2, an unlabeled nucleotide that
is complementary to N.sub.3, and no nucleotide that is
complementary to N.sub.4, thereby adding fluorescent nucleotides
onto the double-stranded nucleic acids of some but not all of the
plurality of capture agents; and (c) reading, using fluorescence
microscopy, a fluorescent signal generated by addition of the
fluorescent nucleotides to the double-stranded nucleic acids of
some but not all of the plurality of capture agents.
24. The method of claim 23, wherein the templates immediately
adjacent to the extendible 3' end are of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more; and step (b) comprises contacting the
planar sample with a polymerase and a nucleotide mix that comprises
a plurality of fluorescent nucleotides that are complementary to
N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide
that is complementary to N.sub.4.
25. The method of claim 23, further comprising: (d) inactivating
the fluorescent signal, (e) optionally, deprotecting the reversible
terminator nucleotide; (f) blocking the sample; and (g) repeating
steps (b) and (c).
26. The method of claim 25, wherein step (g) comprises repeating
steps (b)-(f) multiple times.
27. The method of claim 23, wherein the templates immediately
adjacent to the extendible 3' end are of the formula
3'-YN.sub.1/N.sub.2-5', optionally followed by a short stretch of
random nucleotides on the 5' end to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C.
28. The method of claim 27, further comprising: (d) inactivating
the fluorescent signal; (e) contacting the planar sample with a
polymerase and an unlabeled nucleotide that is complementary to
N.sub.4; and (f) repeating steps (b) and (c).
29. The method of claim 28, wherein step (f) comprises repeating
steps (b)-(e) multiple times.
30. The method of claim 20, wherein the double-stranded nucleic
acids each comprise a fluorescently labeled oligonucleotide
hybridized to the second strand downstream from the first strand,
wherein the fluorescently labeled oligonucleotide comprises a
quencher and extension of the first strand removes the quencher
from some but not all of the quenched fluorescently labeled
oligonucleotides, thereby generating a fluorescent signal for some
but not all of the plurality of capture agents.
31. The method of claim 20, wherein extension of the
double-stranded nucleic acid comprises contacting the planar sample
with a mixture of labeled and unlabeled oligonucleotides and a
ligase.
32. The method of claim 20, wherein the plurality of capture agents
are selected from the group consisting of: antibodies, aptamers,
and oligonucleotide probes.
33. A kit comprising: (a) one or more capture agents, wherein the
one or more capture agents can specifically bind to complementary
sites in a planar sample. (b) one or more double-stranded nucleic
acids comprising a first strand a second strand, wherein each of
the one or more capture agents is linked to the double-stranded
nucleic acid, and wherein a 5' end or 3' end of either the first
strand or the second strand is extendible using the other strand as
a template.
34. The kit of claim 33, further comprising a polymerase.
35. The kit of claim 34, further comprising a nucleotide mix
comprising at least one of a fluorescent nucleotide, an unlabeled
nucleotide, and a reversible terminator nucleotide.
36. The kit of claim 33, wherein the one or more capture agents is
selected from the group consisting of: an antibody, an aptamer and
an oligonucleotide probe.
Description
CROSS-REFERENCING
[0001] This patent application claims the benefit of U.S.
provisional application Ser. No. 62/015,799, filed Jun. 23, 2014,
and U.S. non-provisional application Ser. No. 14/560,921, filed on
Dec. 4, 2014, which patent applications are incorporated by
reference herein in their entireties.
BACKGROUND
[0003] Several major approaches have been used so far for
single-cell antigen cytometry. Among the most popular are single
cell PCR, fluorescence activated flow cytometry, mass cytometry and
single cell sequencing. These (fluorescence and mass-based
cytometry) approaches are limited from either inability to breach
the multiplexing levels of more than 100 parameters per analyte
(cell in this case) or from inability to achieve high throughput
(single cell sequencing). Also these methods are not appropriate or
readily modified to enable cell multiplexed analysis of archived
tissues and slide based samples.
[0004] Disclosed herein are several related methods for capture
agent detection that are based on labeling the capture agent with
DNA and subsequent detection of this DNA by primer extension.
SUMMARY
[0005] A method for analyzing a planar sample is provided. In
certain embodiments, the method may comprise: (a) labeling the
planar sample (e.g., a tissue section) with a capture agent (e.g.,
an antibody or an oligonucleotide probe) in a way that produces a
labeled sample in which: (i) the capture agent is linked to a
double-stranded nucleic acid that comprises a first strand and a
second strand; and (ii) the 3' end or 5' end of either the first
strand or the second strand is extendible using the other strand as
a template; (b) contacting the labeled sample with i. a polymerase
and a nucleotide mix and/or ii. a labeled oligonucleotide and a
ligase, thereby adding one or more nucleotides and/or a labeled
oligonucleotide to an one of the strands of the double-stranded
nucleic acid; and (c) reading a fluorescent signal generated by
addition of the one or more nucleotides and/or oligonucleotide to
one of the strands of the double-stranded nucleic acid using
fluorescence microscopy, thereby producing an image showing the
pattern of binding of the capture agent to the planar sample.
[0006] The method may be implemented in a variety of different
ways. For example, in some embodiments, step (b) may contacting the
labeled sample with a polymerase and a nucleotide mix that
comprises a fluorescent nucleotide, thereby adding the fluorescent
nucleotide to one of the strands (i.e., the top strand or the
bottom strand, whichever strand has the extendible 3' end) of the
double-stranded nucleic acid; and step (c) may comprise reading a
fluorescent signal generated by addition of the fluorescent
nucleotide to one of the strands (i.e., the top strand or the
bottom strand, whichever strand has the extendible 3' end) of the
double-stranded nucleic acid. In this embodiment, the fluorescent
signal may: i. emitted directly from the added nucleotide; ii. a
FRET signal generated by energy transfer between two fluorescent
nucleotides that are added to a 3' end of one of the strands; or
iii. a FRET signal generated by energy transfer between a first
added fluorescent nucleotide (i.e., a fluorescent nucleotide that
has been added to one of the strands) and a second fluorescent
nucleotide that is already present in one of the strands.
[0007] In alternative embodiments, step (b) comprises contacting
the labeled sample with a ligase and a labeled oligonucleotide,
thereby adding the labeled oligonucleotide to the 3' or 5' end of
one of the strands of the double-stranded nucleic acid; and step
(c) comprises reading a fluorescent signal generated by ligation of
the labeled oligonucleotide to one of the strands of the
double-stranded nucleic acid. In some cases, an extendible 3' end
may be extended by a polymerase, and ligated to a labeled
oligonucleotide. In these embodiments, the fluorescent signal may
be: i. emitted directly from the added nucleotide; ii. a FRET
signal generated by energy transfer between two fluorescent
nucleotides that are added to one of the strands; or iii. a FRET
signal generated by energy transfer between a first fluorescent
nucleotide added one of the strands and a second fluorescent
nucleotide that is already present in the other strand.
[0008] In some embodiments, extension of one of the strands removes
a quencher from a quenched fluorescently labeled oligonucleotide
that is hybridized to the other strand, downstream from the first
strand.
[0009] In some embodiments, the first strand is a rolling circle
amplification (RCA) product, and the second strand comprises
oligonucleotides that are hybridized to multiple sites in the RCA
product.
[0010] In other embodiments, the first strand is an
oligonucleotide, and the second strand is a second oligonucleotide
that is hybridized to the first oligonucleotide. In these
embodiments, the oligonucleotides may be designed to produce a 5'
overhang such that the 3' end of the first strand oligonucleotide
is extendible using the other oligonucleotide as a template. In
other embodiments, the oligonucleotides may be designed to produce
a 3' overhang such that the 5' end of the first strand
oligonucleotide is extendible by ligation, using the other
oligonucleotide as a template
[0011] In any embodiment, the planar sample may be a tissue
section, e.g., a formalin-fixed, paraffin-embedded (FFPE) tissue
section.
[0012] Also provided herein is a capture agent that is linked to a
double-stranded nucleic acid, wherein: (i) the double-stranded
nucleic acid comprises a first strand and a second strand; (ii) the
capture agent is linked to the first strand; and (iii) the 3' end
or 5' end of either the first strand or the second strand is
extendible using the other strand as a template.
[0013] Also provided herein is a capture agent composition
comprising a plurality of capture agents that recognize different
complementary sites, wherein: each of the capture agents is linked
to a double-stranded nucleic acid that comprises a first strand and
a second strand; the capture agents are linked to a double-stranded
nucleic acid by the first strand; the 3' end or 5' end of the first
or second strand is extendible using the other strand as a
template; and the templates immediately downstream of the
extendible ends are different for each of the capture agents. In
these embodiments, the sequence of the first strand is the same for
each of the capture agents; and the sequence of the second strand
is different for each of the capture agents.
[0014] In embodiments that use a reversible terminator ("reversible
terminator" approach), the templates immediately adjacent to the
template at the extendible 3' end may be of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3-5' optionally followed by short
stretch (e.g., 1-5 residues) of random nucleotides on the 5' end to
increase the overall polymerase residence on the DNA duplex, where
N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides
selected from G, A, T and C and n is 0, 1 or more. In some cases,
the population contains single nucleotide overhangs of nucleotides
N.sub.1, N.sub.2 and N.sub.3 or the population of overhangs
comprises two nucleotide overhangs of sequence
3'-N.sub.1N.sub.1-5', 3'-N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.3-5'-5' and, optionally overhangs of sequence,
3'-N.sub.4N.sub.4N.sub.1-5', 3'-N.sub.4N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.4N.sub.3-5' and so on (e.g., four nucleotide
overhangs of sequence 3'-N.sub.4N.sub.4N.sub.4N.sub.1-5',
3'-N.sub.4N.sub.4N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.4N.sub.4N.sub.3-5'). A population of
oligonucleotides or RCA products having sequences that are defined
by any of these formulas is also provided. In RCA embodiments, the
sequence may be found in each repeat of an RCA product.
[0015] In these embodiments, the templates immediately adjacent to
the extendible 3' end may be of a more general formula
3'-XN.sub.1/N.sub.2/N.sub.3-5', where N.sub.1, N.sub.2, N.sub.3 are
different nucleotides selected from G, A, T and C and X is a
nucleotide stretch of bases Xi (such that Xi are different
nucleotides selected from G, A, T and C) of random composition and
length. In some cases, the population may comprise comprises two
nucleotide overhangs of sequence 3'-X.sub.1N.sub.1-5',
3'-X.sub.1N.sub.2-5' and 3'-X.sub.1N.sub.3-5' and, optionally
overhangs of sequence, 3'-N.sub.1X.sub.1X.sub.2-5',
3'-N.sub.2X.sub.1X.sub.2-5' and 3'-N.sub.3X.sub.1X.sub.2-5' and so
on (e.g., four nucleotide overhangs of sequence
3'-N.sub.1X.sub.1X.sub.2X.sub.3-5',
3'-N.sub.2X.sub.1X.sub.2X.sub.3-5' and
3'-N.sub.3X.sub.1X.sub.2X.sub.3-5'). In many embodiments, this
population additionally contains single nucleotide overhangs of
nucleotides N.sub.1, N.sub.2 and N.sub.3. A population of
oligonucleotides or RCA products having sequences that are defined
by any of these formulas is also provided. In RCA embodiments, the
sequence may be found in each repeat of an RCA product.
[0016] In embodiments that rely on a "missing base" approach, the
template immediately adjacent to the extendible 3' end may be of
the formula 3'-YN.sub.1/N.sub.2-5', optionally followed by short
stretch (e.g., 1-5 residues) of random nucleotides on the 5' end to
increase the overall polymerase residence on the DNA duplex,
wherein Y is a nucleotide sequence of length n (n is 0, 1 or more)
composed of bases N.sub.3 and N.sub.4, wherein nucleotide N.sub.3
is in odd positions and nucleotide N.sub.4 is in even positions,
counting from the start of the overhang and N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C. For example, in some cases, the population may comprise 5'
overhangs of sequence 3'-N.sub.1-5' and 3'-N.sub.2-5' or optionally
3'-N.sub.3N.sub.1-5' and 3'-N.sub.3N.sub.2-5' or
3'-N.sub.3N.sub.4N.sub.1-5' and 3'-N.sub.3N.sub.4N.sub.2-5' and,
optionally, overhangs of sequence
3'-N.sub.3N.sub.4N.sub.3N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.2-5' and so on (e.g., overhangs of
sequence 3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.2-5' and then
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.2-5'). A population of
oligonucleotides or RCA products having sequences that are defined
by any of these formulas is also provided. In RCA embodiments, the
sequence may be found in each repeat of an RCA product.
[0017] In these embodiments the template immediately adjacent to
the extendible 3' end may also be of a more general formula
3'-YN.sub.1/N.sub.2-5', wherein Y is a nucleotide sequence of
length n (n is 0, 1 or more) composed of alternating random length
stretches of bases N.sub.3 and N.sub.4 such that the order number
of N.sub.3-- stretches is odd and of N.sub.4 stretches is even and
wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different
nucleotides selected from G, A, T and C. For example, the
population may comprise overhangs of sequence 3'-N.sub.1-5' and
3'-N.sub.2-5' or optionally 3'-N.sub.3N.sub.3N.sub.1-5' and
3'-N.sub.3N.sub.3N.sub.2-5' or 3'-N.sub.3N.sub.3N.sub.4N.sub.1-5'
and 3'-N.sub.3N.sub.3N.sub.4N.sub.2-5' and, optionally, overhangs
of sequence
3'-N.sub.3N.sub.3N.sub.3N.sub.3N.sub.4N.sub.4N.sub.3N.sub.3N.sub.3N.sub.1-
-5' and
3'-N.sub.3N.sub.3N.sub.3N.sub.3N.sub.4N.sub.4N.sub.3N.sub.3N.sub.3-
N-5' and so on). A population of oligonucleotides or RCA products
having sequences that are defined by any of these formulas is also
provided. In RCA embodiments, the sequence may be found in each
repeat of an RCA product.
[0018] A method for analyzing a tissue sample is also provided. In
these embodiments, the method may comprise (a) labeling a planar
sample with the above-described capture agent composition; (b)
contacting the labeled sample with i. a polymerase and either an
incomplete nucleotide mix or a nucleotide mix that comprises a
reversible terminator nucleotide and/or ii. a labeled
oligonucleotide and a ligase; and (c) reading, using fluorescence
microscopy, a fluorescent signal generated by addition a nucleotide
or a labeled oligonucleotide to some but not all of the capture
agents.
[0019] In these embodiments, the method may comprises: (c)
contacting the planar sample with a polymerase and: (i) a
nucleotide mix that comprises fluorescent nucleotides that are
complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible
terminator nucleotide that is complementary to N.sub.4 or (ii) a
nucleotide mix that comprises fluorescent nucleotides that are
complementary to N.sub.1, and N.sub.2, an unlabeled nucleotide that
is complementary to N.sub.3, and no nucleotide that is
complementary to N.sub.4, thereby adding fluorescent nucleotides
onto the double-stranded nucleic acids of some but not all of the
capture agents; and (d) reading, using fluorescence microscopy, a
fluorescent signal generated by addition of a fluorescent
nucleotide to some but not all of the capture agents.
[0020] In some embodiments, the templates immediately adjacent to
the extendible 3' end are of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more; and step (c) comprises contacting the
planar sample with a polymerase and a nucleotide mix that comprises
fluorescent nucleotides that are complementary to N.sub.1, N.sub.2
and N.sub.3 and a reversible terminator nucleotide that is
complementary to N.sub.4.
[0021] In some embodiments, this method may further comprise: (e)
inactivating the fluorescent signal, deprotecting the reversible
terminator nucleotide and blocking the sample; and (f) repeating
steps (c) and (d). In some cases, step (f) may comprise repeating
steps (c), (d) and (e) multiple times.
[0022] In some embodiments, the templates immediately adjacent to
the extendible 3' end may be of the formula 3'-YN.sub.1/N.sub.2-5',
optionally followed by short stretch (e.g., 1-5 nucleotides) of
random nucleotides on the 5' end to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of bases N.sub.3 and N.sub.4, and wherein N.sub.1,
N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected
from G, A, T and C.
[0023] In these embodiments, the method may comprise (e)
inactivating the fluorescent signal and contacting the planar
sample with a polymerase and a an unlabeled nucleotide that is
complementary to N.sub.4; and (f) repeating steps (c) and (d). In
certain cases, step (f) may comprise repeating steps (c), (d) and
(e) multiple times.
[0024] In alternative embodiments, the double-stranded
oligonucleotides may each comprise a fluorescently labeled
oligonucleotide hybridized to the second strand downstream from
first strand, wherein the fluorescently labeled oligonucleotide
comprises a quencher and extension of the first strand removes the
quencher from some but not all of the quenched fluorescently
labeled oligonucleotides, thereby generating a fluorescent signal
for some but not all of the capture agents.
[0025] In other embodiments, the capture agent is linked to a
single stranded oligonucleotide, which can be either unlabeled or
labeled with FRET acceptor fluorophore. Such a single stranded
nucleotide incorporates a dedicated sequence that hybridizes to a
complementary oligonucleotide which is to be extended with
unlabeled base or with a base labeled with a FRET excitation
fluorophore, thereby generating a fluorescent signal for some but
not all of the capture agents.
[0026] In some embodiments, a method for analyzing a planar sample.
In some embodiments, the method comprises: (a) labeling the planar
sample with a capture agent to produce a labeled sample, wherein:
(i) the capture agent is linked to a double-stranded nucleic acid
that comprises a first strand and a second strand; and (ii) a 3'
end or 5' end of either the first strand or the second strand is
extendible using the other strand as a template; (b) contacting the
labeled sample with i. a polymerase and a plurality of nucleotides
and/or ii. a labeled oligonucleotide and a ligase, thereby adding
one or more nucleotides of the plurality of nucleotides and/or a
labeled oligonucleotide to an end of one of the strands of the
double-stranded nucleic acid; and (c) reading a signal generated by
addition of the one or more nucleotides and/or labeled
oligonucleotide to one of the first strand or the second strand of
the double-stranded nucleic acid. In some embodiments, the signal
may be a fluorescent signal. In some embodiments, the reading may
comprises flourescence microscopy. Any embodiment, the method may
further comprise producing an image showing the pattern of binding
of the capture agent to the planar sample.
[0027] In any embodiment, step (b) may comprise contacting the
labeled sample with a polymerase and a plurality of nucleotides
that comprises a fluorescent nucleotide, thereby adding the
fluorescent nucleotide to one of the first strand or the second
strand of the double-stranded nucleic acid; and step (c) comprises
reading a fluorescent signal generated by addition of the
fluorescent nucleotide to one of the first strand or the second
strand of the double-stranded nucleic acid. In these embodiment,
wherein the fluorescent signal may be: i. emitted directly from the
added nucleotide; ii. a FRET signal generated by energy transfer
between two fluorescent nucleotides of the plurality of flourescent
nucleotides that are added to one of the first strand or second
strand of the double-stranded nucleic acid; or iii. a FRET signal
generated by energy transfer between the added fluorescent
nucleotide and a second fluorescent nucleotide that is present in
one of the first strand or second strand double-stranded nucleic
acid.
[0028] In any embodiment, the method step (b) may comprise
contacting the labeled sample with a ligase and a labeled
oligonucleotide, thereby adding the labeled oligonucleotide to one
of the first strand or second strand of the double-stranded nucleic
acid; and step (c) comprises reading a fluorescent signal generated
by addition of the labeled oligonucleotide to one of the first
strand or second strand of the double-stranded nucleic acid. In
this embodiment, the fluorescent signal may be: i. emitted directly
from the added labeled nucleotide; ii. a FRET signal generated by
energy transfer between two labeled nucleotides that are added to
one of the first strand or second strand of the double-stranded
nucleic acid; or iii. a FRET signal generated by energy transfer
between the labeled nucleotide added to one of the first strand and
second strand of the double-stranded nucleic acid and a second
labeled nucleotide that is present in the other strand. In these
embodiments, the labeled nucleotide may comprise a fluorescent
nucleotide.
[0029] In any embodiment, extension of one of the first strand or
second strand of the double-stranded nucleic acid may remove a
quencher from a quenched fluorescently labeled oligonucleotide that
is hybridized to the other strand, downstream from the first
strand.
[0030] In any embodiment, the first strand of the double-stranded
nucleic acid may be a rolling circle amplification (RCA) product,
and the second strand of the double-stranded nucleic acid comprises
oligonucleotides that are hybridized to multiple sites in the RCA
product.
[0031] In any embodiment, the first strand of the double-stranded
nucleic acid may be a first oligonucleotide, and the second strand
of the double-stranded nucleic acid is a second oligonucleotide
that is hybridized to the first oligonucleotide.
[0032] In any embodiment, the planar sample may be a
formalin-fixed, paraffin-embedded (FFPE) section.
[0033] In any embodiment, the capture agent may be an antibody, an
aptamer, or an oligonucleotide probe.
[0034] A capture agent that is linked to a double-stranded nucleic
acid is also provided. In some embodiments, (i) the double-stranded
nucleic acid comprises a first strand and a second strand; (ii) the
capture agent is linked to the first strand; and (iii) the 5' end
or the 3' end of either the first strand or the second strand is
extendible using the other strand as a template.
[0035] Also provided is a capture agent composition comprising a
plurality of capture agents that each recognize different
complementary sites. In these embodiments, each of the plurality of
capture agents may be linked to a double-stranded nucleic acid that
comprises a first strand and a second strand; the 5' end or 3' end
of the first or second strand may be extendible using the other
strand as a template; and the templates immediately downstream of
the extendible ends may be different for each of the plurality of
capture agents. In these embodiments, the sequence of the first
strand may be the same for each of the plurality of capture agents;
and the sequence of the second strand may be different for each of
the plurality of capture agents.
[0036] In some embodiments, the templates immediately adjacent to
the extendible 3' ends may be of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more.
[0037] In some embodiments, the templates immediately adjacent to
the extendible 3' ends may be of the formula
3'-YN.sub.1/N.sub.2-5', optionally followed by a short stretch of
random nucleotides on the 5' end to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C.
[0038] A method for analyzing a planar sample is provided. This
method may comprise (a) labeling the planar sample with a capture
agent composition summarized above; (b) contacting the labeled
sample with i. a polymerase and either an incomplete nucleotide mix
or a nucleotide mix that comprises a reversible terminator
nucleotide, thereby adding a nucleotide to the plurality of capture
agents; and/or ii. a labeled oligonucleotide and a ligase, thereby
adding a labeled oligonucleotide to the plurality of capture
agents; and (c) reading a signal generated by addition of the
nucleotide or the labeled oligonucleotide to some but not all of
the plurality of capture agents. In these embodiments, the signal
may be a fluorescent signal. In some embodiments, the reading may
be done by fluorescent microscopy.
[0039] In some embodiments, the method may be done by (b)
contacting the planar sample with a polymerase and: (i) a
nucleotide mix that comprises a plurality of fluorescent
nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3
and a reversible terminator nucleotide that is complementary to
N.sub.4; or (ii) a nucleotide mix that comprises a plurality of
fluorescent nucleotides that are complementary to N.sub.1, and
N.sub.2, an unlabeled nucleotide that is complementary to N.sub.3,
and no nucleotide that is complementary to N.sub.4, thereby adding
fluorescent nucleotides onto the double-stranded nucleic acids of
some but not all of the plurality of capture agents; and (c)
reading, using fluorescence microscopy, a fluorescent signal
generated by addition of the fluorescent nucleotides to the
double-stranded nucleic acids of some but not all of the plurality
of capture agents. In these embodiments, the templates immediately
adjacent to the extendible 3' end may be of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more; and step (b) comprises contacting the
planar sample with a polymerase and a nucleotide mix that comprises
a plurality of fluorescent nucleotides that are complementary to
N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide
that is complementary to N.sub.4. In these embodiments, the method
may further comprise: (d) inactivating the fluorescent signal, (e)
optionally, deprotecting the reversible terminator nucleotide; (f)
blocking the sample; and (g) repeating steps (b) and (c). In some
embodiment, step (g) may comprise repeating steps (b)-(f) multiple
times.
[0040] In some embodiments, the templates immediately adjacent to
the extendible 3' end may be of the formula 3'-YN.sub.1/N.sub.2-5',
optionally followed by a short stretch of random nucleotides on the
5' end to increase the overall polymerase residence on the DNA
duplex, wherein Y is composed of alternating stretches of N.sub.3
and N.sub.4, and wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are
different nucleotides selected from G, A, T and C. In these
embodiments, the method may further comprise: (d) inactivating the
fluorescent signal; (e) contacting the planar sample with a
polymerase and an unlabeled nucleotide that is complementary to
N.sub.4; and (f) repeating steps (b) and (c). In some cases, step
(f) may comprise repeating steps (b)-(e) multiple times.
[0041] In some embodiments, the double-stranded nucleic acids each
comprise a fluorescently labeled oligonucleotide hybridized to the
second strand downstream from the first strand, wherein the
fluorescently labeled oligonucleotide comprises a quencher and
extension of the first strand removes the quencher from some but
not all of the quenched fluorescently labeled oligonucleotides,
thereby generating a fluorescent signal for some but not all of the
plurality of capture agents.
[0042] In some embodiments, extension of the double-stranded
nucleic acid comprises contacting the planar sample with a mixture
of labeled and unlabeled oligonucleotides and a ligase.
[0043] In any embodiment, the plurality of capture agents may be
selected from the group consisting of: antibodies, aptamers, and
oligonucleotide probes.
[0044] A kit is also provided. In these embodiments, the kit may
comprise: (a) one or more capture agents, wherein the one or more
capture agents can specifically bind to complementary sites in a
planar sample. (b) one or more double-stranded nucleic acids
comprising a first strand a second strand, wherein each of the one
or more capture agents is linked to the double-stranded nucleic
acid, and wherein a 5' end or 3' end of either the first strand or
the second strand is extendible using the other strand as a
template. In some embodiments, the kit may further comprise a
polymerase or ligase. In some embodiments, the kit may further
comprise a nucleotide mix comprising at least one of a fluorescent
nucleotide, an unlabeled nucleotide, and a reversible terminator
nucleotide. In some embodiments, the one or more capture agents may
be selected from the group consisting of: an antibody, an aptamer
and an oligonucleotide probe.
[0045] In some aspects, a method is provided for analyzing a planar
sample. In some cases, the method comprises incubating the planar
sample with a capture agent under conditions by which the capture
agent specifically binds to complementary sites in the planar
sample. In some cases, the capture agent is linked to a
double-stranded oligonucleotide that comprises a first strand and a
second strand. In some cases, a 3' end of the first strand is
recessed relative to a 5' end of the second strand, thereby
producing an overhang. In some cases, the method comprises
contacting the planar sample with a polymerase and a plurality of
nucleotides, thereby adding one or more nucleotides of the
plurality of nucleotides to the overhang. In some cases, the method
comprises reading a signal generated by addition of the one or more
nucleotides to the overhang. In some cases, the plurality of
nucleotides comprises a plurality of fluorescent nucleotides. In
some cases, a fluorescent nucleotide of the plurality of
nucleotides is added to the overhang. In some cases, the signal
comprises a fluorescent signal. In some cases, the fluorescent
signal is emitted directly from the fluorescent nucleotide added to
the overhang. In other cases, two of the plurality of fluorescent
nucleotides are added to the overhang. In this example, the
fluorescent signal is a FRET signal generated by energy transfer
between the two of the plurality of fluorescent nucleotides added
to the overhang. In an alternative example, the fluorescent signal
is a FRET signal generated by energy transfer between the
fluorescent nucleotide from the plurality of fluorescent
nucleotides added to the overhang and a fluorescent nucleotide that
is present in the second strand. In some cases, extension of the
first strand removes a quencher from a quenched fluorescently
labeled oligonucleotide that is hybridized to the second strand,
downstream from the first strand. In some cases, the planar sample
is a formalin-fixed, paraffin-embedded (FFPE) section. In some
cases, the capture agent is linked to the double-stranded
oligonucleotide by a 5' end of the first strand. In other cases,
the capture agent is linked to the double-stranded oligonucleotide
by a 3' end of the second strand. In some cases, the method further
comprises crosslinking the capture agent to the planar sample. In
some cases, the reading comprises fluorescence microscopy. In some
cases, the method further comprises producing an image showing a
pattern of binding of the capture agent to the planar sample. In
some cases, the one or more nucleotides of the plurality of
nucleotides is added to the overhang by primer extension. In some
cases, the capture agent is an antibody, an aptamer or an
oligonucleotide probe.
[0046] In some aspects, a composition is provided comprising a
plurality of capture agents that specifically bind to different
complementary sites in a planar sample. In some cases, each of the
plurality of capture agents is linked to a double-stranded
oligonucleotide that comprises a first strand and a second strand.
In some cases, a 3' end of the first strand in each of the
double-stranded oligonucleotides is recessed relative to a 5' end
of the second strand, thereby producing an overhang. In some cases,
the overhang is different for each of the plurality of capture
agents. In some cases, each of the plurality of capture agents is
linked to the double-stranded oligonucleotide by a 5' end of the
first strand. In other cases, each of the plurality of capture
agents is linked to the double-stranded oligonucleotide by a 3' end
of the second strand. In some cases, a sequence of the first strand
is the same for each of the plurality of capture agents and a
sequence of the second strand is different for each of the
plurality of capture agents. In some cases, the overhang is of the
formula 3'-N4nN1/N2/N3, wherein N1, N2, N3 and N4 are different
nucleotides selected from G, A, T and C and n is 1 or more. In
other cases, the overhang is of the formula 3'-YN1/N2-5',
optionally followed by a short stretch of random nucleotides on the
5' end of the first strand to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of N3 and N4, and wherein N1, N2, N3 and N4 are different
nucleotides selected from G, A, T and C. In some cases, Y is a
nucleotide sequence of length n and wherein n is 0, 1, or more. In
some cases, the order number of N3 stretches is odd and wherein the
order number of N4 stretches is even. In some cases, the planar
sample is a formalin-fixed, paraffin-embedded section (FFPE). In
some cases, the plurality of capture agents are antibodies,
aptamers, or oligonucleotide probes.
[0047] In some aspects, a method is provided for analyzing a planar
sample. In some cases, the method comprises incubating the planar
sample with the composition described above under conditions by
which each of the plurality of capture agents specifically bind to
different complementary sites in the planar sample. In some cases,
the method comprises contacting the planar sample with a polymerase
and a plurality of nucleotides, thereby adding one or more
nucleotides of the plurality of nucleotides to the overhang of
some, but not all, of the plurality of capture agents. In some
cases, the method comprises reading a signal generated by addition
of the one or more nucleotides from the plurality of nucleotides to
the overhang of some, but not all, of the plurality of capture
agents. In some cases, the method further comprises crosslinking
the plurality of capture agents to the planar sample. In some
cases, the plurality of nucleotides comprises an incomplete
nucleotide mix or a nucleotide mix comprising a reversible
terminator nucleotide. In some cases, the signal comprises a
fluorescent signal. In some cases, the reading comprises
fluorescence microscopy. In some cases, the method further
comprises producing an image showing a pattern of binding of the
plurality of capture agents to the planar sample. In some cases,
the plurality of nucleotides comprises: (i) a plurality of
fluorescent nucleotides that are complementary to N1, N2 and N3,
and a reversible terminator nucleotide that is complementary to N4;
or (ii) a plurality of fluorescent nucleotides that are
complementary to N1 and N2, an unlabeled nucleotide that is
complementary to N3, and no nucleotide that is complementary to N4.
In some cases, a fluorescent nucleotide of the plurality of
fluorescent nucleotides is added to the overhang of some, but not
all, of the plurality of capture agents. In some cases, the signal
comprises a fluorescent signal generated by addition of the
fluorescent nucleotide of the plurality of fluorescent nucleotides
to some, but not all, of the plurality of capture agents. In some
cases, the reading comprises fluorescence microscopy. In some
cases, the method further comprises producing an image showing the
pattern of binding of the plurality of capture agents to the planar
sample. In some cases, the overhangs are of the formula
3'-N4nN1/N2/N3, wherein N1, N2, N3 and N4 are different nucleotides
selected from G, A, T and C and n is 1 or more, and wherein the
plurality of nucleotides comprises a plurality of fluorescent
nucleotides that are complementary to N1, N2, N3 and a reversible
terminator nucleotide that is complementary to N4. In some cases,
the method further comprises inactivating the fluorescent signal,
optionally, deprotecting the reversible terminator nucleotide;
blocking the planar sample; and repeating the steps of contacting
and reading. In some cases, the repeating further comprises
repeating the steps of contacting, reading, inactivating,
optionally deprotecting, and blocking a plurality of times. In
other cases, the overhangs are of the formula 3'-YN1/N2-5',
optionally followed by a short stretch of random nucleotides on the
5' end of the first strand to increase the overall polymerase
residence on the DNA duplex, wherein Y is composed of alternating
stretches of N3 and N4, and wherein N1, N2, N3 and N4 are different
nucleotides selected from G, A, T and C. In some cases, Y is a
nucleotide sequence of length n and wherein n is 0, 1, or more. In
some cases, the order number of N3 stretches is odd and wherein the
order number of N4 stretches is even. In some cases, the method
further comprises inactivating the fluorescent signal, contacting
the planar sample with a polymerase and an unlabeled nucleotide
that is complementary to N4; and repeating the steps of contacting
and reading. In some cases, the repeating comprises repeating the
steps of contacting, reading, inactivating, and contacting a
plurality of times. In some cases, each of the double-stranded
oligonucleotides comprise a fluorescently labeled oligonucleotide
hybridized to the second strand downstream from the first strand,
wherein the fluorescently labeled oligonucleotide comprises a
quencher and extension of the first strand removes the quencher
from some, but not all, of the quenched fluorescently-labeled
oligonucleotides, thereby generating a fluorescent signal for some,
but not all, of the capture agents.
BRIEF DESCRIPTION OF THE FIGURES
[0048] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0049] FIG. 1A-1B (A) schematically illustrates a detection reagent
composed of a combination of a capture agent that is conjugated to
a double-stranded oligonucleotide. Upon detection and removal of
unbound detection reagent the binding pattern is rendered by
polymerase driven primer extension. Panel (B) schematically
illustrates three approaches for linking the capture agent (an
antibody in this case, but not excluding other possible capture
agents) to a double stranded oligonucleotide (i.e., by chemical
conjugation of the upper strand oligonucleotide to the capture
agent; using streptavidin as an intermediate to connect
biotinylated antibody and biotinylated oligonucleotide; and by
linking biotinylated oligonucleotide to antibody chemically
conjugated to streptavidin).
[0050] FIG. 2 schematically illustrates examples of capture agents
that are bound to double-stranded oligonucleotides that have
different overhangs. Such different overhangs represent a strategy
to increase signal harvested from a particular capture agent by
multiplication of positions in lower strand oligonucleotide
complementary to detector base (dU in this case). The lower panel
also shows how a different base labeled with a different
fluorophore can be used as a FRET excitation pair for the
"Detector" base. SEQ ID NOS: 1-4.
[0051] FIG. 3 schematically illustrates several cycles of a
multiplexed detection method that relies on reversible dye
terminators.
[0052] FIG. 4 schematically illustrates several cycles of a
multiplexed detection method that relies on leaving out one of the
four nucleotides per cycle.
[0053] FIG. 5A-5D schematically illustrates an exemplary design of
oligonucleotide duplexes for "reversible terminator" and "missing
base" multiplexing methods. SEQ ID NOS: 5-12.
[0054] FIG. 6 schematically illustrates an exemplary design of
oligonucleotide duplexes for a strategy that allows one to reduce
the length of the lower strand oligonucleotide, creating an
overhang in the case of highly multiplexed capture agent panels.
SEQ ID NOS: 13-30.
[0055] FIG. 7 schematically illustrates an example of a detection
method that relies on removing a quencher from a labeled
oligonucleotide by nick translation. SEQ ID NOS: 31-35.
[0056] FIG. 8 schematically illustrates a multiplexed detection
method that relies on removing quenchers from labeled
oligonucleotides. Step 1: SEQ ID NOS 36-44, Step 2: SEQ ID NOS:
45-52, Step 3: SEQ ID NOS: 53-60, Step 4: SEQ ID NOS: 61-67.
[0057] FIGS. 9A and 9B schematically illustrate an embodiment that
relies on cyclical re-annealing of polymerase priming nucleotides
and a variant of the same approach that utilizes FRET. SEQ ID NOS:
68-80.
[0058] FIG. 10 schematically illustrates an embodiment that relies
on cyclical re-annealing of polymerase priming nucleotides and a
variant of the same approach that utilizes FRET. SEQ ID NOS:
81-86.
[0059] FIGS. 11A-11C shows an anti-CD4 antibody linked to
oligonucleotide duplex designed for rendering staining by primer
extension (panel A) and data obtained from labeled population of
spleen cells in suspension in the absence of polymerase (panel B)
and in the presence of polymerase (panel C). SEQ ID NOS: 87 and
88.
[0060] FIGS. 12A-12D shows data obtained from labeling by primer
extension a population of spleen cells preattached on the slide.
Cells were co-stained with "regular" TCRb-FITC antibody and CD4
antibody linked to oligonucleotide duplex designed for rendering
staining by primer extension.
[0061] FIGS. 13A-13D show schematic illustration of two capture
agents CD4 and CD8 linked to oligonucleotide duplexes (panel A) and
data obtained from a multiplexed method whereby staining by this
capture agents was sequentially detected on spleen cells smeared on
a slide using a "reversible terminator" method (panels C-D). SEQ ID
NOS: 89-92.
[0062] FIG. 14 shows a schematic diagram of an experiment testing
multiplexed staining by "missing base" approach. Mouse spleen
samples were barcoded by pan-leukocytic CD45 antibody conjugated to
per sample specific oligonucleotide duplexes. Samples were mixed
after staining and mixture was resolved by sequential rendering of
CD45-oligonucleotide variants.
[0063] FIG. 15 is 12 panels of images showing the first 6 cycles of
rendering the 30 populations barcoded by CD45 (as per scheme on
FIG. 14). Two populations were co-detected per cycle of rendering.
In each cycle control image was acquired after fluorescence
inactivation.
[0064] FIG. 16 illustrates enhanced antibody signal with rolling
circle amplification. A. Antibody-DNA conjugate that consists of an
antibody, a covalently linked linear linker oligonucleotide and a
5'-phosphorylated padlock nucleotide is used to stain the cellular
antigens. Padlock probe contains the detection primer sequence
(orange) followed by the fluorescent nucleotide incorporation site
(T). B. Padlock oligonucleotide is treated with T4 DNA ligase,
inducing its circularization. C. Rolling circle amplification with
strand-displacing phi29 DNA polymerase created repeats of the
reverse-complement of the detection primer sites (green). F-G.
Staining of Mouse Spleen cells with antibody-DNA conjugate
visualized by primer extension with dUTP-Cy5 without the rolling
circle amplification (F) and after rolling circle amplification
(G).
[0065] FIG. 17 shows fluorescent images of cells, showing the
staining of 22 different antigens rendered by the iterative primer
extension protocol. At each cycle one antigen-antibody-DNA complex
incorporates dUTP-SS-Cy5 fluorophore (red) and one complex
incorporates dCTP-SS-Cy3 (green), all other complexes receive an
unlabelled `walking` base (dGTP on odd cycles, dATP on even
cycles).
[0066] FIG. 18 shows A: multipanel design whereby antibody-DNA
conjugates are incapable of polymerase extension because of
3'-dideoxy-terminator bases, but each panel can be activated for
extension independently of others by an addition of a
panel-specific primer. B: 18 aliquotes of mouse spleen cells were
independently stained with different CD45 antibody conjugates that
were designed such. Aliquots 1-3 (panel 1) can be detected by
regular ABseq primer extension (top row), aliquots 4-6 (panel 2)
were be extended after addition of Spacer1 oligonucleotide primer
and aliquotes 7-9 (panel 3) can be extended after addition of
Spacer2 oligonucleotide primer. C: Results of image quantification.
Intensities of individual cell intensities displayed as a barcodes,
one cell for each row, red color representing higher staining
intensity. Columns represent intensities of cells on each extension
cycle. The diagonal pattern shows the high specificity of
spacer-based extension and the absence of signal cross-talk between
panels and extension cycles.
[0067] FIG. 19 shows A: A pair of coincidence detection probes is
hybridized to the target RNA. Upstream oligonucleotide probe
(Splint-primer) serves as a splint for circularization and ligation
of the downstream oligonucleotide probe (padlock). Padlock probe
contains a detection primer sequence (lilac) followed by the
fluorescent nucleotide incorporation site (red) B. Rolling circle
amplification is initiated at the 3' end of the upstream probe and
creates multiple copies of the reverse-complement of detection
primer sequence (lilac). C. Detection primer is annealed to the
multiple sites of the amplification product. D. Polymerase reaction
with dUTP-Cy5 results incorporations. E-F: small and bright puncta
in NALM cells correspond to single HLADRA RNA molecules, which are
absent in the negative control Jurkat cells. Large red blobs
present in both panels correspond to apoptotic cells that
nonspecifically bind the fluorescent nucleotide.
[0068] FIG. 20 shows an alternative method that relies on primer
extension and the ligation of a short, labeled oligonucleotide.
Left side, from top to bottom: SEQ ID NOS: 93-108; right side, from
top to bottom: SEQ ID NOS: 109-124.
[0069] FIG. 21 depicts a system to enable a user to detect,
analyze, and process images of samples.
DEFINITIONS
[0070] Unless defined otherwise herein, all technical and
scientific terms used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs. Although any methods and materials similar or
equivalent to those described herein can be used in the practice or
testing of the present invention, the preferred methods and
materials are described.
[0071] All patents and publications, including all sequences
disclosed within such patents and publications, referred to herein
are expressly incorporated by reference.
[0072] Numeric ranges are inclusive of the numbers defining the
range. Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively.
[0073] The headings provided herein are not limitations of the
various aspects or embodiments of the invention. Accordingly, the
terms defined immediately below are more fully defined by reference
to the specification as a whole.
[0074] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR
BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale
& Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper
Perennial, N.Y. (1991) provide one of skill with the general
meaning of many of the terms used herein. Still, certain terms are
defined below for the sake of clarity and ease of reference.
[0075] As used herein, the term "biological feature of interest"
refers to any part of a cell that can be indicated by binding to a
capture agent. Exemplary biological features of interest include
cell walls, nuclei, cytoplasm, membrane, keratin, muscle fibers,
collagen, bone, proteins, nucleic acid (e.g., mRNA or genomic DNA,
etc). fat, etc. A biological feature of interest can also be
indicated by immunohistological methods, e.g., a capture agent that
is linked to an oligonucleotide. In these embodiments, the capture
agent binds to an site, e.g., a protein epitope, in the sample.
Exemplary epitopes include, but are not limited to carcinoembryonic
antigen (for identification of adenocarcinomas, cytokeratins (for
identification of carcinomas but may also be expressed in some
sarcomas) CD15 and CD30 (for Hodgkin's disease), alpha fetoprotein
(for yolk sac tumors and hepatocellular carcinoma), CD117 (for
gastrointestinal stromal tumors), CD10 (for renal cell carcinoma
and acute lymphoblastic leukemia), prostate specific antigen (for
prostate cancer), estrogens and progesterone (for tumour
identification), CD20 (for identification of B-cell lymphomas), CD3
(for identification of T-cell lymphomas). Complementary nucleic
acid molecules (e.g., DNA and/or RNA) in the sample provide binding
complementary sites for oligonucleotide probes.
[0076] As used herein, the term "multiplexing" refers to using more
than one label for the simultaneous or sequential detection and
measurement of biologically active material.
[0077] As used herein, the terms "antibody" and "immunoglobulin"
are used interchangeably herein and are well understood by those in
the field. Those terms refer to a protein consisting of one or more
polypeptides that specifically binds an antigen. One form of
antibody constitutes the basic structural unit of an antibody. This
form is a tetramer and consists of two identical pairs of antibody
chains, each pair having one light and one heavy chain. In each
pair, the light and heavy chain variable regions are together
responsible for binding to an antigen, and the constant regions are
responsible for the antibody effector functions.
[0078] The recognized immunoglobulin polypeptides include the kappa
and lambda light chains and the alpha, gamma (IgG.sub.1, IgG.sub.2,
IgG.sub.3, IgG.sub.4), delta, epsilon and mu heavy chains or
equivalents in other species. Full-length immunoglobulin "light
chains" (of about 25 kDa or about 214 amino acids) comprise a
variable region of about 110 amino acids at the NH.sub.2-terminus
and a kappa or lambda constant region at the COOH-terminus.
Full-length immunoglobulin "heavy chains" (of about 50 kDa or about
446 amino acids), similarly comprise a variable region (of about
116 amino acids) and one of the aforementioned heavy chain constant
regions, e.g., gamma (of about 330 amino acids).
[0079] The terms "antibodies" and "immunoglobulin" include
antibodies or immunoglobulins of any isotype, fragments of
antibodies which retain specific binding to antigen, including, but
not limited to, Fab, Fv, scFv, and Fd fragments, chimeric
antibodies, humanized antibodies, minibodies, single-chain
antibodies, and fusion proteins comprising an antigen-binding
portion of an antibody and a non-antibody protein. Also encompassed
by the term are Fab', Fv, F(ab').sub.2, and or other antibody
fragments that retain specific binding to antigen, and monoclonal
antibodies. Antibodies may exist in a variety of other forms
including, for example, Fv, Fab, and (Fab').sub.2, as well as
bi-functional (i.e. bi-specific) hybrid antibodies (e.g.,
Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)) and in single
chains (e.g., Huston et al., Proc. Natl. Acad. Sci. U.S.A., 85,
5879-5883 (1988) and Bird et al., Science, 242, 423-426 (1988),
which are incorporated herein by reference). (See, generally, Hood
et al., "Immunology", Benjamin, N.Y., 2nd ed. (1984), and
Hunkapiller and Hood, Nature, 323, 15-16 (1986),).
[0080] The term "specific binding" refers to the ability of a
binding reagent to preferentially bind to a particular analyte that
is present in a homogeneous mixture of different analytes. In
certain embodiments, a specific binding interaction will
discriminate between desirable and undesirable analytes in a
sample, in some embodiments more than about 10 to 100-fold or more
(e.g., more than about 1000- or 10,000-fold).
[0081] In certain embodiments, the affinity between a binding
reagent and analyte when they are specifically bound in a capture
agent/analyte complex is characterized by a K.sub.D (dissociation
constant) of less than 10.sup.-6M, less than 10.sup.-7 M, less than
10.sup.-8 M, less than 10.sup.-9 M, less than 10.sup.-9 M, less
than 10.sup.-11 M, or less than about 10.sup.-12 M or less.
[0082] A "plurality" contains at least 2 members. In certain cases,
a plurality may have at least 2, at least 5, at least 10, at least
100, at least 1000, at least 10,000, at least 100,000, at least
10.sup.6, at least 10.sup.7, at least 10.sup.8 or at least 10.sup.9
or more members.
[0083] As used herein, the term "labeling" refers to attaching a
detectable fluorophore to specific sites in a sample (e.g., sites
containing an epitope for the antibody being used, for example)
such that the presence and/or abundance of the sites can be
determined by evaluating the presence and/or abundance of the
label.
[0084] The term "labelling" refers to a method for producing a
labeled sample in which any necessary steps are performed in any
convenient order, as long as the required labeled sample is
produced. For example, in some embodiments and as will be
exemplified below, the capture agent may be already linked to a
double-stranded nucleic acid prior to binding of the antibody to
the sample, in which case a sample can be labeled using relatively
few steps. In other embodiments, the capture agent may be linked to
the first strand of the double stranded nucleic acid at the time at
which it is incubated with the sample. In these embodiments, the
second strand of the double stranded nucleic acid may be hybridized
to the first strand of the double stranded nucleic acid after the
antibody has bound to the sample. Along similar lines, the capture
agent may be linked to a rolling circle amplification (RCA) primer
at the time at which it is incubated with the sample. In these
embodiments, the double-stranded nucleic acid may be produced by:
a) hybridizing the sample with a padlock probe having ends that are
complementary to the RCA primer, ligating the ends of the padlock
probes together, and copying the padlock probe by rolling circle
amplification and b) hybridizing an oligonucleotide to the RCA
product, as illustrated in FIG. 16. In this example, the RCA
product is the first strand of the double-stranded nucleic acid,
and the oligonucleotides that are hybridized to the RCA product are
the second strand of the double-stranded nucleic acid. In many
embodiments, the labeling step may comprise crosslinking the
capture agent to the planar sample so that subsequence
manipulations can be done without the capture agent disassociating
from its complementary sites in the planar sample. In these
embodiments, if the capture agent is linked to the double-stranded
nucleic acid prior to binding of the antibody to the sample, then
the crosslinking step may be done immediately after binding of the
antibody to the sample. In embodiments in which the capture agent
is only linked to the first strand (or an RCA primer for making the
same) at the time at which it is incubated with the sample, the
sample may be cross-linked after binding of the antibody to is the
sample, and the double-stranded may be produced after
crosslinking.
[0085] As used herein, the term "planar sample" refers to a
substantially planar, i.e., two dimensional, material (e.g. glass,
metal, ceramics, organic polymer surface or gel) that contains
cells or any combinations of biomolecules derived from cells, such
as proteins, nucleic acids, lipids, oligo/polysachharides,
biomolecule complexes, cellular organels, cellular debris or
excretions (exosomes, microvesicles). A planar cellular sample can
be made by, e.g., growing cells on a planar surface, depositing
cells on a planar surface, e.g., by centrifugation, by cutting a
three dimensional object that contains cells into sections and
mounting the sections onto a planar surface, i.e., producing a
tissue section, absorbing the cellular components onto the surface
that is functionalized with affinity agents (e.g. antibodies,
haptens, nucleic acid probes), introducing the biomolecules into a
polymer gel or transferring them onto a polymer surface
electrophoretically or by other means. The cells or biomolecules
may be fixed using any number of reagents including formalin,
methanol, paraformaldehyde, methanol:acetic acid, glutaraldehyde,
bifunctional crosslinkers such as bis(succinimidyl)suberate,
bis(succinimidyl)polyethyleneglycole etc. This definition is
intended to cover cellular samples (e.g., tissue sections, etc),
electrophoresis gels and blots thereof, Western blots, dot-blots,
ELISAs, antibody microarrays, nucleic acid microarrays etc.
[0086] As used herein, the term "tissue section" refers to a piece
of tissue that has been obtained from a subject, fixed, sectioned,
and mounted on a planar surface, e.g., a microscope slide.
[0087] As used herein, the term "formalin-fixed paraffin embedded
(FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy
that has been obtained from a subject, fixed in formaldehyde (e.g.,
3%-5% formaldehyde in phosphate buffered saline) or Bouin solution,
embedded in wax, cut into thin sections, and then mounted on a
microscope slide.
[0088] As used herein, the term "spatially-addressable
measurements" refers to a set of values that are each associated
with a specific position on a surface. Spatially-addressable
measurements can be mapped to a position in a sample and can be
used to reconstruct an image of the sample.
[0089] A "diagnostic marker" is a specific biochemical in the body
which has a particular molecular feature that makes it useful for
detecting a disease, measuring the progress of disease or the
effects of treatment, or for measuring a process of interest.
[0090] A "pathoindicative" cell is a cell which, when present in a
tissue, indicates that the animal in which the tissue is located
(or from which the tissue was obtained) is afflicted with a disease
or disorder. By way of example, the presence of one or more breast
cells in a lung tissue of an animal is an indication that the
animal is afflicted with metastatic breast cancer.
[0091] The term "complementary site" is used to refer to an epitope
for an antibody or aptamer, or a nucleic acid molecule if the
capture agent is an oligonucleotide probe.
[0092] Specifically, if the capture agent is an antibody, then the
complementary site for the capture agent is the epitope in the
sample to which the antibody binds. If the capture agent is an
oligonucleotide probe, then the complementary site for the capture
agent is a complementary sequence in a DNA or RNA molecule in the
sample.
[0093] The term "epitope" as used herein is defined as small
chemical groups on the antigen molecule that is bound to by an
antibody. An antigen can have one or more epitopes. In many cases,
an epitope is roughly five amino acids or sugars in size. One
skilled in the art understands that generally the overall
three-dimensional structure or the specific linear sequence of the
molecule can be the main criterion of antigenic specificity.
[0094] A "subject" of diagnosis or treatment is a plant or animal,
including a human. Non-human animals subject to diagnosis or
treatment include, for example, livestock and pets.
[0095] As used herein, the term "incubating" refers to maintaining
a planar sample and capture agent under conditions (which
conditions include a period of time, a temperature, an appropriate
binding buffer and a wash) that are suitable for specific binding
of the capture agent to molecules (e.g., epitopes or complementary
nucleic acid) in the planar sample.
[0096] As used herein, the term "capture agent" refers to an agent
that can specifically bind to complementary sites in a planar
sample. Exemplary capture agents include, e.g., an antibody, an
aptamer, and a nucleic acid (e.g., oligonucleotide) probe (which
may be DNA or RNA) that hybridizes to a binding site. If antibodies
are used, in many cases the antibodies may bind to protein
epitopes. If nucleic acid probes are used, the nucleic acid probes
may bind to, for example, genomic DNA or RNA (such that the
location and abundance of intracellular RNAs can be detected).
[0097] As used herein, the term "extendible", in the context of,
for example, a 3' end that is "extendible using the other strand as
a template", means that a polymerase or ligase can add to the 3'
end of a nucleic acid molecule, where the template sequence that is
immediately downstream of the 3' end (i.e., on the other strand)
determines which nucleotides (if a polymerase is used) or
oligonucleotide (if a ligase is used) is added. A "5' end that is
extendible using the other strand as a template" means that a
ligase can add an oligonucleotide to the 5' end of a nucleic acid
molecule, where the template sequence that is immediately
downstream of the 5' end (i.e., on the other strand) determines
which oligonucleotide is added.
[0098] As used herein, the term "template sequence that is
immediately downstream to the 3' end" refers to the sequence on the
other strand that use used as a template for extending the 3' end,
starting with the first nucleotide. In embodiments in which the
first strand is an RCA product, the template sequence that is
immediately downstream of the 3' end may be a sequence in the RCA
product. In embodiments in which the first strand is an
oligonucleotide, the template sequence that is immediately
downstream of the 3' end may be a 5' overhang. As used herein, the
term "capture agent that is linked to a double stranded nucleic
acid" refers to a capture agent, e.g., an antibody or an
oligonucleotide probe, that is non-covalently (e.g., via a
streptavidin/biotin interaction) or covalently (e.g., via a click
reaction or the like) linked to an double-stranded nucleic acid
(which may be composed of two single-stranded oligonucleotide
strands that are hybridized together, or an RCA product that is
hybridized to a plurality of oligonucleotides) in a way that the
capture agent can still bind to its binding site and the 3' end of
one of the nucleic acids is accessible to a polymerase and/or
ligase. The nucleic acid and the capture agent may be linked via a
number of different methods, including those that use maleimide or
halogen-containing group, which are cysteine-reactive. The capture
agent and the nucleic acid may be linked at, proximal to or at the
5' end of one of the strands of the double stranded nucleic acid,
proximal to or at the 3' end of one of the strands of the double
stranded nucleic acid, or anywhere in-between.
[0099] The terms "nucleic acid" and "polynucleotide" are used
interchangeably herein to describe a polymer of any length, e.g.,
greater than about 2 bases, greater than about 10 bases, greater
than about 100 bases, greater than about 500 bases, greater than
1000 bases, up to about 10,000 or more bases composed of
nucleotides, e.g., deoxyribonucleotides, ribonucleotides or a
combination thereof, and may be produced enzymatically or
synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902
and the references cited therein) and which can hybridize with
naturally occurring nucleic acids in a sequence specific manner
analogous to that of two naturally occurring nucleic acids, e.g.,
can participate in Watson-Crick base pairing interactions.
Naturally-occurring nucleotides include guanine, cytosine, adenine,
thymine, uracil (G, C, A, T and U respectively). DNA and RNA have a
deoxyribose and ribose sugar backbone, respectively, whereas PNA's
backbone is composed of repeating N-(2-aminoethyl)-glycine units
linked by peptide bonds. In PNA various purine and pyrimidine bases
are linked to the backbone by methylene carbonyl bonds. A locked
nucleic acid (LNA), often referred to as an inaccessible RNA, is a
modified RNA nucleotide. The ribose moiety of an LNA nucleotide is
modified with an extra bridge connecting the 2' oxygen and 4'
carbon. The bridge "locks" the ribose in the 3'-endo (North)
conformation, which is often found in the A-form duplexes. LNA
nucleotides can be mixed with DNA or RNA residues in the
oligonucleotide whenever desired. The term "unstructured nucleic
acid", or "UNA", is a nucleic acid containing non-natural
nucleotides that bind to each other with reduced stability. For
example, an unstructured nucleic acid may contain a G' residue and
a C' residue, where these residues correspond to non-naturally
occurring forms, i.e., analogs, of G and C that base pair with each
other with reduced stability, but retain an ability to base pair
with naturally occurring C and G residues, respectively.
Unstructured nucleic acid is described in US20050233340, which is
incorporated by reference herein for disclosure of UNA.
[0100] As used herein, the term "oligonucleotide" refers to a
multimer of at least 10, e.g., at least 15 or at least 30
nucleotides. In some embodiments, an oligonucleotide may be in the
range of 15-200 nucleotides in length, or more.
[0101] As used herein, the term "reading" in the context of reading
a fluorescent signal, refers to obtaining an image by scanning or
by microscopy, where the image shows the pattern of fluorescence as
well as the intensity of fluorescence in a field of view.
[0102] As used herein, the term "primer" is an oligonucleotide,
either natural or synthetic, that is capable, upon forming a duplex
with a polynucleotide template, of acting as a point of initiation
of nucleic acid synthesis and being extended from its 3' end along
the template so that an extended duplex is formed. The sequence of
nucleotides added during the extension process is determined by the
sequence of the template polynucleotide. Usually primers are
extended by a DNA polymerase. A primer may be at least 10, e.g., at
least 15 or at least 30 nucleotides in length.
[0103] As used herein, the term "single nucleotide 5' overhang"
refers to a 5' overhang, where the overhang is a single nucleotide
in length. Likewise, a "two nucleotide 5' overhang" is a 5'
overhang, where the overhang is two nucleotides in length. The 3'
end is recessed in a 5' overhang.
[0104] In certain cases, the various nucleotides of an overhang may
be referred to by their position, e.g., "first position" and
"second position". In these cases, the "position" is relative to
the recessed 3' end. As such, in a multiple base 5' overhang, the
"first" position of the overhang is immediately adjacent to the
recessed 3' end and the "second" position of the overhang is
immediately adjacent to the first position.
[0105] In certain cases, the complementary strands of a double
stranded oligonucleotide or nucleic acid may be referred to herein
as being the "first" and "second" or the "top" and "bottom"
strands. The assignment of a strand as being a "top" or "bottom"
strand is arbitrary and does not imply any particular orientation,
function or structure.
[0106] As used herein, the term "signal generated by", in the
context of reading a fluorescent signal generated by addition of
the fluorescent nucleotide, refers to a signal that is emitted
directly from the fluorescent nucleotide, a signal that is emitted
indirectly via energy transfer to another fluorescent nucleotide
(i.e., by FRET).
[0107] As used herein, the term "fluorescently labeled
oligonucleotide comprising a quencher" refers to an oligonucleotide
that contains a fluorophore and a quencher, wherein the quencher
quenches the fluorophore in the same oligonucleotide.
[0108] As used herein, the term "different" in the context of
different 5' overhangs that are different, refers to overhangs that
have a different sequence. Overhangs of different lengths (e.g.,
GATC vs GAT) implicitly have a different sequence, even through one
sequence may be encompassed by the other.
[0109] As used herein, the term "overhang" refers to a structure in
which one strand of a double stranded nucleic acid ends such that
nucleic acid synthesis can be initiated from that strand by a
polymerase (or an oligonucleotide can be ligated to the end by a
ligase) using the other strand as a template.
[0110] As used herein, the term "adding to the extendible 3' end",
in the context of adding one or more nucleotides or an
oligonucleotide to an extendible 3' end, refers to adding
nucleotides (or an oligonucleotide) to an extendible 3' end using
the other strand as a template (e.g., adding to the recessed 3' end
of a 5' overhang using the overhang as a template).
[0111] As used herein, the term "template of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3-5' followed by an optional short
stretch (e.g., 1-5 residues) of random nucleotides on the 5' end to
increase the overall polymerase residence on the DNA duplex, where
N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides
selected from G, A, T and C and n is 0, 1 or more", refers to a
population of sequences that potentially contains single nucleotide
overhangs of nucleotides N.sub.1, N.sub.2 and N.sub.3 or the
population of overhangs comprises two nucleotide overhangs of
sequence 3'-N.sub.4N.sub.1-5', 3'-N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.3-5'-5' and, optionally overhangs of sequence,
3'-N4N4N.sub.1-5', 3'-N.sub.4N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.4N.sub.3-5' and so on (e.g., four nucleotide
overhangs of sequence 3'-N.sub.4N.sub.4N.sub.4N.sub.1-5',
3'-N.sub.4N.sub.4N.sub.4N.sub.2-5' and
3'-N.sub.4N.sub.4N.sub.4N.sub.3-5').
[0112] As used herein, the term "template of the formula
3'-YN.sub.1/N.sub.2-5', optionally followed by short stretch (e.g.,
1-5 residues) of random nucleotides on the 5' end to increase the
overall polymerase residence on the DNA duplex, wherein Y is a
nucleotide sequence of length n (n is 0, 1 or more) composed of
bases N.sub.3 and N.sub.4, wherein nucleotide N.sub.3 is in odd
positions and nucleotide N.sub.4 is in even positions, counting
from the start of the overhang and N.sub.1, N.sub.2, N.sub.3 and
N.sub.4 are different nucleotides selected from G, A, T and C"
refers to a population of sequences that potentially contain
sequences 3'-N.sub.1-5' and 3'-N.sub.2-5' or optionally
3'-N.sub.3N.sub.1-5' and 3'-N.sub.3N.sub.2-5' or
3'-N.sub.3N.sub.4N.sub.1-5' and 3'-N.sub.3N.sub.4N.sub.2-5' and,
optionally, overhangs of sequence
3'-N.sub.3N.sub.4N.sub.3N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.2-5' and so on (e.g., overhangs of
sequence 3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.2-5' and then
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.1-5' and
3'-N.sub.3N.sub.4N.sub.3N.sub.4N.sub.3N.sub.2-5').
[0113] As used herein, the term "alternating stretches" refers to
two nucleotides stretches, where one "stretch" is a contiguous
sequence of, e.g., up to 10, of the same nucleotide (e.g., a G, A,
T or C), and the second stretch is contiguous sequence of, e.g., up
to 10, of a different nucleotide, that alternate with one another,
i.e., one stretch (e.g., a string of T's) occupies the odd
positions and the other stretch (e.g., a string of A's) occupies
the even positions.
[0114] As used herein, the term "incomplete nucleotide mix"
comprises a nucleotide mix that contains one, two or three
nucleotides (but not all four nucleotides) selected from G, A, T
and C. The nucleotides may be labeled or unlabeled.
[0115] As used herein, the term "reversible terminator" refers to a
chemically modified nucleotide base that when incorporated into
growing DNA strand by DNA polymerase blocks further incorporation
of bases. Such "reversible terminator" base and DNA strand can be
deprotected by chemical treatment and following such deprotection
DNA strand can be further extended by DNA polymerase.
[0116] As used herein, the term "fluorescently labeled reversible
terminator" refers to a "reversible terminator" base which is
labeled by fluorophore through linker cleavable by same treatment
which is used to deprotect the DNA strand which ends with this
base. Deprotecting the "fluorescently labeled reversible
terminator" simultaneously activates the DNA strand for further
extension and removes the fluorescent label from it.
[0117] For ease of description, many of the sequences described
herein are written out in the 3' to 5' direction. While DNA
sequences are routinely set forth in 5' to 3' direction, for the
ease description, certain DNA sequences in the text below are
described in the 3' to 5' direction. In each such case the
directionality is specifically annotated.
[0118] Other definitions of terms may appear throughout the
specification.
DETAILED DESCRIPTION
[0119] In some embodiments the method comprises producing a labeled
a planar sample (e.g., an FFPE section mounted on a planar surface
such as a microscope slide) using a capture agent that specifically
binds to complementary sites in the planar sample. Methods for
binding antibodies and/or nucleic acids to sites in the planar
sample are well known. In these embodiments, the capture agent in
the labeled sample is linked to a double-stranded nucleic acid that
comprises a first strand and a second strand (e.g., two
oligonucleotide that are hybridized together or an RCA product that
is hybridized to oligonucleotides) and the capture agent is linked
(covalently or non-covalently via a biotin) to the double-stranded
nucleic acid by the first strand of the double-stranded nucleic
acid (e.g., by the 5' end, the 3' end, or anywhere in-between), and
the 3' end or 5' end of one of the strands (e.g., the 3' end of the
first strand, any 3' ends in the second strand, the 5' end of the
first strand or any 5' ends in the second strand) is extendible
using the other strand as a template. In some cases, the 3' end of
the first strand may be recessed relative to the 5' end of the
second strand, thereby defining an overhang. In other cases, the 5'
end of the first strand may be recessed relative to the 3' end of
the second strand, thereby defining an overhang. In many
embodiments, the capture agent is cross-linked the planar sample,
thereby preventing the capture agent from disassociating during
subsequent steps. This crosslinking step may be done using any
amine-to-amine crosslinker (e.g. formaldehyde,
disuccinimiyllutarate or another reagents of similar action)
although a variety of other chemistries can be used to cross-link
the capture agent to the planar sample if desired. The method
comprises reading a fluorescent signal generated by addition of a
nucleotide or short oligonucleotide (e.g., of 2-10 bases) to the
extendible end (e.g., the 3' end) of one of the strands. This step
may be done by contacting the planar sample with a polymerase and a
nucleotide mix, a ligase and a labeled oligonucleotide, or a
combination of the two, thereby adding one or more nucleotides
and/or a labeled oligonucleotide to the extendible end; and reading
a fluorescent signal generated by addition of the one or more
nucleotides or oligonucleotide to the extendible end.
[0120] As will be described in greater detail below, the
fluorescent signal may be generated by a variety of different
methods. For example, in some embodiments, the fluorescent signal
may be fluorescence from a fluorescent nucleotide added to the end
of the primer, or a FRET (fluorescence resonance energy transfer)
signal resulting from the same. In other embodiments, the signal
may generated by removing a quencher from a fluorescently labeled
oligonucleotide that is also hybridized to the oligonucleotide.
[0121] In any implementation of the method, the reading step may be
followed by inactivating the fluorescence after reading so that
other binding events can be detected and read. In these
embodiments, the fluorescence may be inactivated by peroxide-based
bleaching, cleavage of fluorophore linked to nucleotide through
cleavable linker (e.g. using TCEP as a cleaving reagent),
base-exchange by exo+ polymerase such as Vent, or subsequent
incorporation of quencher, for example.
[0122] Also, as will be described in greater detailed below, the
method may be multiplexed in a way that a single planar sample can
be interrogated by a plurality of different capture agents, where
each antibody is linked to a different oligonucleotide (i.e.,
oligonucleotides of different sequence). In multiplex embodiments,
the planar sample may be labeled using at least 5, at least 10, at
least 20, at least 30, at least 50, or at least 100, up to 150 or
more capture agents that are each linked to a different
oligonucleotide, and binding of the capture agents can be
separately read using a fluorescence microscope equipped with an
appropriate filter for each fluorophore, or by using dual or triple
band-pass filter sets to observe multiple fluorophores. See, e.g.,
U.S. Pat. No. 5,776,688. As noted below, the oligonucleotides
linked to the capture agent may act as a splint for a padlock
probe, and as a primer for initiating rolling circle
amplification.
[0123] The capture agent used in some embodiments of the method may
be linked to a double-stranded oligonucleotide that contains a 5'
overhang (i.e., a recessed 3' end that can be extended by a
polymerase or ligase) or a 3' overhang (i.e., a recessed 5' end
that can be extended by a ligase). An example of such a capture
agent is shown in FIGS. 1 and 2. In the example shown in FIG. 1B,
the overhang is a single nucleotide overhang (e.g., an A), although
a longer overhang (e.g., at least 2, at least 3, at least 4, at
least 5, at least 6, at least 8, at least 10, at least 20, or at
least at least 30, may be useful for other applications (e.g.,
multiplexed applications). As shown in FIG. 5 A-D, in certain
cases, the overhang may contain a repeated sequence, e.g., 2, 3, 4,
5, or 6 or more repeats of the same sequence of 2, 3, 4, 5 or 6
nucleotides, thereby allowing the capture agent to be used in
multiplexed applications as described below. In certain
embodiments, the double stranded oligonucleotide may have a
recessed 3' end at the other end of the oligonucleotide (i.e., at
the end closest to the capture agent). However, this end may be
designed to be not extendible. In certain circumstances, the
double-stranded oligonucleotide may contain one or more third
oligonucleotides that are hybridized to the overhang. In these
embodiments, there will be a gap of 1, 2, 3, 4 or 5 or more
nucleotides between the second strand of the double-stranded
oligonucleotide and the oligonucleotide that is hybridized to the
overhang (see, e.g., FIGS. 7 and 8). In multiplex embodiments, the
plurality of capture agents may be distinguished by the sequence of
the overhang and not by the sequence of the first strand of the
double stranded oligonucleotide. In these embodiments, the second
strand of the double stranded oligonucleotides is different for
each of the capture agents. As shown in other figures, the method
may also be implemented using capture agents that are linked to a
primer that acts a splint for circularlizing a padlock probe and
for priming amplification of circularlized padlock probe by rolling
circle amplification. In these embodiments, the capture agents in
the labeled sample may be linked to a rolling circle amplification
product.
[0124] In certain cases, the fluorophore used may be a coumarin, a
cyanine, a benzofuran, a quinoline, a quinazolinone, an indole, a
benzazole, a borapolyazaindacene and or a xanthene including
fluorescein, rhodamine and rhodol. In multiplexing embodiments,
fluorophores may be chosen so that they are distinguishable, i.e.,
independently detectable, from one another, meaning that the labels
can be independently detected and measured, even when the labels
are mixed. In other words, the amounts of label present (e.g., the
amount of fluorescence) for each of the labels are separately
determinable, even when the labels are co-located (e.g., in the
same tube or in the same area of the section).
[0125] Specific fluorescent dyes of interest include: xanthene
dyes, e.g., fluorescein and rhodamine dyes, such as fluorescein
isothiocyanate (FITC), 6-carboxyfluorescein (commonly known by the
abbreviations FAM and F),
6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), 6-carboxy-4',
5'-dichloro-2', 7'-dimethoxyfluorescein (JOE or J),
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA or T),
6-carboxy-X-rhodamine (ROX or R), 5-carboxyrhodamine-6G (R6G.sup.5
or G.sup.5), 6-carboxyrhodamine-6G (R6G.sup.6 or G.sup.6), and
rhodamine 110; cyanine dyes, e.g., Cy3, Cy5 and Cy7 dyes;
coumarins, e.g., umbelliferone; benzimide dyes, e.g. Hoechst 33258;
phenanthridine dyes, e.g., Texas Red; ethidium dyes; acridine dyes;
carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes,
e.g., BODIPY dyes and quinoline dyes. Specific fluorophores of
interest that are commonly used in subject applications include:
Pyrene, Coumarin, Diethylaminocoumarin, FAM, Fluorescein
Chlorotriazinyl, Fluorescein, R110, Eosin, JOE, R6G,
Tetramethylrhodamine, TAMRA, Lissamine, Napthofluorescein, Texas
Red, Cy3, and Cy5, etc.
[0126] Suitable distinguishable fluorescent label pairs useful in
the subject methods include Cy-3 and Cy-5 (Amersham Inc.,
Piscataway, N.J.), Quasar 570 and Quasar 670 (Biosearch Technology,
Novato Calif.), Alexafluor555 and Alexafluor647 (Molecular Probes,
Eugene, Oreg.), BODIPY V-1002 and BODIPY V1005 (Molecular Probes,
Eugene, Oreg.), POPO-3 and TOTO-3 (Molecular Probes, Eugene,
Oreg.), and POPRO3 and TOPRO3 (Molecular Probes, Eugene, Oreg.).
Further suitable distinguishable detectable labels may be found in
Kricka et al. (Ann Clin Biochem. 39:114-29, 2002), Ried et al.
(Proc. Natl. Acad. Sci. 1992: 89: 1388-1392) and Tanke et al. (Eur.
J. Hum. Genet. 1999 7:2-11) and others.
[0127] In addition to the labeling methods described above, the
sample may be stained using a cytological stain, either before or
after performing the method described above. In these embodiments,
the stain may be, for example, phalloidin, gadodiamide, acridine
orange, bismarck brown, barmine, Coomassie blue, bresyl violet,
brystal violet, DAPI, hematoxylin, eosin, ethidium bromide, acid
fuchsine, haematoxylin, hoechst stains, iodine, malachite green,
methyl green, methylene blue, neutral red, Nile blue, Nile red,
osmium tetroxide (formal name: osmium tetraoxide), rhodamine,
safranin, phosphotungstic acid, osmium tetroxide, ruthenium
tetroxide, ammonium molybdate, cadmium iodide, carbohydrazide,
ferric chloride, hexamine, indium trichloride, lanthanum nitrate,
lead acetate, lead citrate, lead(II) nitrate, periodic acid,
phosphomolybdic acid, potassium ferricyanide, potassium
ferrocyanide, ruthenium red, silver nitrate, silver proteinate,
sodium chloroaurate, thallium nitrate, thiosemicarbazide, uranyl
acetate, uranyl nitrate, vanadyl sulfate, or any derivative
thereof. The stain may be specific for any feature of interest,
such as a protein or class of proteins, phospholipids, DNA (e.g.,
dsDNA, ssDNA), RNA, an organelle (e.g., cell membrane,
mitochondria, endoplasmic recticulum, golgi body, nulear envelope,
and so forth), a compartment of the cell (e.g., cytosol, nuclear
fraction, and so forth). The stain may enhance contrast or imaging
of intracellular or extracellular structures. In some embodiments,
the sample may be stained with haematoxylin and eosin
(H&E).
[0128] The structures of exemplary sulfhydryl-cleavable
deoxynucleotide analogues that can be used in the present method
are shown below. As would be recognized, these nucleotides are only
exemplary and other nucleotides, including nucleotides that are
cleavable by other stimuli (e.g., photocleavable nucleotides) can
be used in the present method.
##STR00001##
[0129] In order to further illustrate the present invention, the
following specific examples are given with the understanding that
they are being offered to illustrate the present invention and
should not be construed in any way as limiting its scope.
Implementation I
[0130] In this example, the fluorescent signal may be produced by a
fluorescent nucleotide that is added to (i.e., added by a
polymerase or, if the fluorescent nucleotide is in an
oligonucleotide, ligated onto) the 3' end of the primer. This
method may comprise reading a signal from the added fluorescent
nucleotide, or reading a FRET signal generated by energy transfer
between two fluorescent nucleotides that are added to the
primer.
[0131] The example shown in FIGS. 1 and 2 shows how an antibody can
be linked to a oligonucleotide chemically, or via
biotin/streptavidin interactions (FIG. 1B) and how a fluorescent
signal can be generated by adding a fluorescent nucleotide to the
end of the primer (FIG. 2). In this example, the antigen is stained
by an antibody that is coupled to a DNA dimer with an overhanging
5' end (lower strand) and recessed 3' end (upper strand) either
chemically (FIG. 1 top panel) or through streptavidin (FIG. 1
bottom and middle panels).
[0132] After binding the capture agent to the tissue sample, the
pattern of binding of the capture agent may be determined using an
on-slide end fill-in reaction by using a suitable polymerase (e.g.,
by exo.sup.- Klenow, Bst, Taq, Klentaq, or an exo.sup.- Klenow-Vent
mixture) and fluorescently labeled nucleotide (FIG. 1 and FIG. 2
top panel).
[0133] If necessary, the signal-to-noise ratio can be increased by:
a) multimerization of position complementary to labeling nucleotide
(FIG. 2, middle panel); or b) by generating a FRET between two
nucleotides are incorporated, whereby the emission wavelength of
one of the nucleotides (FIG. 2, bottom panel C on the figure)
serves as an excitation wavelength for another (FIG. 2, bottom
panel U on the figure).
[0134] Fluorescence may be inactivated before addition of
subsequent staining reagents by any convenient method including,
but not limited to photobleaching, peroxide-based bleaching,
inactivation by ozone, cleavage of fluorophore linked to nucleotide
through cleavable linker (e.g. using TCEP as a cleaving reagent),
base-exchange by exo+ polymerase such as Vent, subsequent
incorporation of quencher.
[0135] In these embodiments, after fluorescence has been
inactivated, the method can be repeated, i.e., the planar sample
may be re-stained using a different antibody and fluorescence can
be read.
[0136] Multiplexing
[0137] Multiplexing can be implemented using specially designed
oligonucleotides using two different approaches, referred to as the
"reversible terminator" and "missing base" approaches, which are
described in greater detail below. Both of these methods rely on a
composition comprising a plurality of (e.g., at least 5, at least
10, at least 20, at least 30, at least 50, or at least 100, up to
150 or more) capture agents that recognize different complementary
sites, wherein: each of the capture agents is linked to a
double-stranded nucleic acid (e.g., oligonucleotide) that comprises
a first strand and a second strand; the capture agents are linked
to a double-stranded nucleic acid by the (e.g., the 5' end of) the
first strand; the 3' end of one of the strands in each of the
double-stranded nucleic acids extendible using the other strand as
a template, where the template is different for each of the capture
agents. Examples of such compositions are illustrated in FIGS. 3
and 4, where the template is an overhang. The general principle
shown in FIGS. 3 and 4 can be extended to double stranded nucleic
acids that comprise RCA products. FIG. 3 shows a population of
capture agents that have a template (e.g., overhang) defined by the
formula: 3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3-5' followed by short
stretch of random composition on the 5' end to increase the overall
polymerase residence on the DNA duplex, where N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 0, 1 or more. FIG. 4, on the other hand, shows a
population of capture agents that have an overhang defined by the
formula 3'-YN.sub.1/N.sub.2-5', optionally followed by short
stretch (e.g., 1-5 residues) of random nucleotides on the 5' end to
increase the overall polymerase residence on the DNA duplex,
wherein Y is a nucleotide sequence of length n (n is 0, 1 or more)
composed of bases N.sub.3 and N.sub.4, wherein nucleotide N.sub.3
is in odd positions and nucleotide N.sub.4 is in even positions,
counting from the start of the overhang and N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C. As illustrated in FIGS. 3, 4 and 5, the sequence of the
first strand is the same for each of the capture agents; and the
sequence of the second strand is different for each of the capture
agents. In these embodiments, the different second strands make the
overhangs different between the different capture agents.
[0138] In some embodiments, the multiplex methods may generally
comprise: (a) incubating a planar sample with an above-described
antibody composition under conditions by which the capture agents
bind to complementary sites in the planar sample; (b) cross-linking
the capture agents to the planar sample; (c) contacting the planar
sample with a polymerase and either an incomplete nucleotide mix of
labeled and unlabeled nucleotides or a nucleotide mix where some or
all nucleotides are fluorescent and some or all nucleotides are
reversible terminator nucleotides or fluorescent reversible
terminator nucleotides and optionally, contacting the planar sample
with a mixture of labelled and unlabeled oligonucleotides and a DNA
ligase enzyme that covalently attaches the short labelled
oligonucleotides to the 3' end of the oligonucleotide duplexes that
are attached to the specific capture agents. In these embodiments,
oligonucleotides are only added to duplexes that an overhang that
is complementary to the oligonucleotide. This method further
comprises (d) reading, using fluorescence microscopy, a fluorescent
signal generated by addition a nucleotide to some but not all of
the capture agents. Following signal registration, this method may
comprise (e) removing the fluorescent signals by chemical or
photocleavage of a labeled nucleotide if the reversible terminator
approach is used, followed by deprotecting the 3' ends of the
oligonucleotides, enabling the addition of further nucleotides
and/or oligonucleotides. Step (c) of this method may comprise (c)
contacting the planar sample with a polymerase and: (i) a
nucleotide mix that comprises fluorescent nucleotides that are
complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible
terminator nucleotide that is complementary to N.sub.4 or (ii) a
nucleotide mix that comprises fluorescent reversible terminator
nucleotides that are complementary to N.sub.1, N.sub.2 and N.sub.3
and a reversible terminator nucleotide that is complementary to
N.sub.4 or (iii) a nucleotide mix that comprises fluorescent
nucleotides that are complementary to N.sub.1, and N.sub.2, an
unlabeled nucleotide that is complementary to N.sub.3, and no
nucleotide that is complementary to N.sub.4, thereby adding
fluorescent nucleotides onto the double-stranded oligonucleotides
of some but not all of the capture agents thereby adding
fluorescent nucleotides onto the double-stranded oligonucleotides
of some but not all of the capture agents; and (d) reading, using
fluorescence microscopy, a fluorescent signal generated by addition
of a fluorescent nucleotide to some but not all of the capture
agents. Step (c) can also be implemented by adding a labeled
oligonucleotide to the duplex using a ligase. Examples of such
methods are described in greater detail below.
[0139] With reference to FIG. 6 it is expected that in the case
when larger panels of capture agents are to be employed (e.g. 100
and more) the length of the read over the oligonucleotide overhangs
may increase accordingly. This may or may not reduce the efficiency
of staining due to accumulation of primer extension errors along
the length of the oligonucleotide duplex. To circumvent such
potential source of signal loss a slight modification of design can
be implemented. The plurality of capture agents can be divided in
sets such that number of capture agents in the set does exceed the
capacity of the multiplexing protocol to render staining without
significant signal loss (e.g. 30). Each such set of capture agents
will be conjugated to "terminated" (the last 3' base is dideoxy- or
propyl-modified) upper strand oligonucleotide of the same sequence
as in the original version of the "missing base" approach. The
lower strand oligonucleotides will incorporate an additional
set-specific region which will serve as a landing spot for an
additional primer which is to be on-slide hybridized to the
particular subset of the total plurality of the antibodies at the
time when they are to be rendered. This approach allows not to
extend the reads beyond certain threshold and at the same time have
an unlimited potential number of capture agents in the sample.
[0140] Reversible Terminator Method
[0141] This implementation of the method relies on reversible
terminators, i.e., chain terminator nucleotides that can be
de-protected after incorporation, thereby allowing further
nucleotides to be added to that nucleotide.
[0142] This method can be implemented using a composition
comprising a plurality of capture agents that are linked to a
double stranded nucleic acid (e.g., oligonucleotides), as
illustrated in FIG. 3. In these embodiments, the top strand of the
double stranded nucleic acid is linked to the capture agent and may
be the same for each antibody, and the sequence of the bottom
strand varies between capture agents. As shown on FIG. 5A, the 5'
end of the lower strand of the double-stranded nucleic acid (which
may form an overhang) is of the general
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3-5' followed by short stretch of
random nucleotides on the 5' end to increase the overall polymerase
residence on the DNA duplex, where N.sub.1, N.sub.2, N.sub.3 and
N.sub.4 are different nucleotides selected from G, A, T and C and n
is 0, 1 or more. As shown on FIG. 5B a more general formula of
lower oligonucleotide overhang 3'-XN.sub.1/N.sub.2/N.sub.3-5',
where N.sub.1, N.sub.2, N.sub.3 are different nucleotides selected
from G, A, T and C and X is a nucleotide stretch of bases Xi (such
that Xi are different nucleotides selected from G, A, T and C) of
random composition and length is also applicable in this
method.
[0143] In certain embodiments, this method may comprise: (a)
incubating a planar sample with a multiplex antibody composition in
which the overhangs are of the formula
5'-N.sub.1/N.sub.2/N.sub.3N.sub.4n, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more; under conditions by which the capture
agents specifically bind to complementary sites in the planar
sample; (b) cross-linking the capture agent to the planar sample;
(c) contacting the planar sample with a polymerase and a nucleotide
mix that comprises fluorescent nucleotides that are complementary
to N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator
nucleotide that is complementary to N.sub.4 and/or ligating a
oligonucleotide that comprises a labeled nucleotide; and (d)
reading, using fluorescence microscopy, a fluorescent signal
generated by addition of a nucleotide to some but not all of the
capture agents. This cycle may be repeated by (e) inactivating the
fluorescent signal, deprotecting the reversible terminator
nucleotide and (f) blocking the planar sample; and repeating steps
(c) and (d). In certain embodiments, the method may comprise
repeating steps (c), (d) (e) and (f) multiple times. The reagent
used for blocking may vary depending on the chemistry used. In
certain embodiments, the sample may be blocked with a
thiol-reactive compounds such as cysteine, glutathione or
iodoacetamide.
[0144] For example, this method can be implemented using a
composition comprising: a first antibody linked to a first double
stranded oligonucleotide, wherein the first double stranded
oligonucleotide comprises a single nucleotide 5' overhang
comprising base N.sub.1; a second antibody linked to a second
double stranded oligonucleotide, wherein the second double stranded
oligonucleotide comprises a single nucleotide 5' overhang
comprising base N.sub.2; a third antibody linked to a third double
stranded oligonucleotide, wherein the third double stranded
oligonucleotide comprises a single nucleotide 5' overhang
comprising base N.sub.3; a fourth antibody linked to a fourth
double stranded oligonucleotide comprises a two nucleotide 5'
overhang, wherein the first position of the overhang comprises base
N.sub.4 and the second position of the overhang is base N.sub.1; a
fifth antibody linked to a fifth double stranded oligonucleotide,
wherein the fifth double stranded oligonucleotide comprises a two
nucleotide 5' overhang, wherein the first position of the overhang
comprises base N.sub.4 and the second position of the overhang is
base N.sub.2; and a sixth antibody linked to a sixth double
stranded oligonucleotide, wherein the sixth double stranded
oligonucleotide comprises a two nucleotide 5' overhang, wherein the
first position of the overhang comprises base N.sub.4 and the
second position of the overhang is base N.sub.3, wherein N.sub.1,
N.sub.2, N.sub.3 and N.sub.4 are different nucleotides selected
from G, A, T and C. An example of such a population of capture
agents is shown in FIG. 3.
[0145] In RCA embodiments, the strand linked to the antibodies may
be different for each of the antibodies, where the RCA product
contains a sequence conforming to the formula described above in
each repeat of the RCA product.
[0146] In certain implementations, the composition may also contain
a seventh antibody linked to a seventh double stranded
oligonucleotide, wherein the seventh double stranded
oligonucleotide comprises a multiple nucleotide 5' overhang,
wherein the first position of the overhang comprises base N.sub.4,
the second position of the overhang is base N.sub.4 and third is
selected from N.sub.1, N.sub.2, and N.sub.3. The same principle may
be applied to overhangs that have more than 7 positions (e.g., 9,
10, 11 up to 20, 30, or 40 ore more) positions.
[0147] In this implementation of the method, the planar sample can
be co-stained simultaneously using a panel of capture agents, each
labeled with one oligonucleotide duplex designed according to the
strategy outlined on FIG. 3. The duplexes are designed in such a
way that each antibody has the same upper strand sequence linked,
covalently or through streptavidin, to an antibody through the 5'
end. The lower strand changes from antibody to antibody. In this
implementation, the general formula for the lower strand is
3'-dideoxydC-sequence-complimentary-to-upper-strand
G.sub.nA/T/C-5'. One type of lower strand base (nucleotide G in
this example) is reserved for step-wise progression and its
complementary pair on the upper strand is never used in labeled
form. The other three bases are complementary to labeled
nucleotides and can be used to identify three capture agents per
cycle. In a more general case the general formula for the lower
strand is
3'-dideoxydC-sequence-complimentary-to-upper-strand-X-N.sub.1/N.sub.2/N.s-
ub.3-5' where X, of X is any nucleotide excluding one reserved for
"walking base" of this particular cycle and X is any base as shown
on FIG. 5B. This design ensures that: a) no two antibody species
contain the same duplex and b) only three different capture agents
are detected at a time. Each cycle includes: (a) a labeling step in
which the three capture agents are labeled and duplexes on the rest
are extended one base at a time, (b) an imaging step and (c) a
destaining/deprotection step. During cycle to cycle transition the
added fluorescent labels from the previous cycle are inactivated by
any of the suitable methods, including but not limited to: cleavage
of fluorophore off the nucleotide (if the labeled nucleotide is
linked to the fluorophore through a cleavable linker); peroxide
based bleaching; photobleaching; chemically-assisted
photobleaching; labeled base replacement by exo+ polymerase, etc.
After or simultaneously with inactivation of the fluorophores added
in the previous reaction, the unlabeled "extension" nucleotide that
has been added to the remainder of the capture agents is activated
by cleavage of the protective group off its 3' end. Cleavage of the
protective group, in turn, allows that nucleotide to be extended in
the next cycle. Since the A, T and C are reserved for incorporation
of a labelled nucleotide, those nucleotides only occur at the end
of each lower strand of the duplex. This approach is based on the
chemical nature of reversible terminators, which precludes upper
strand extension for more than one nucleotide at a time even on
polyG stretches of the lower strand. Optionally, a quencher labeled
nucleotide can be incorporated following the labeled nucleotide.
The performance of "reversible terminator method" as exemplified in
sequential detection of CD4 and CD8 positive T-cells in smears of
mouse splenocytes is illustrated in FIG. 13A-D.
[0148] Missing Base Method
[0149] This implementation of the method relies on a "missing" base
design in which, in each cycle, two labeled and one unlabeled
nucleotides are added to the reaction, and the "missing base"
prevents the primers from being extended by more than a single
nucleotide.
[0150] This method can be implemented using a composition
comprising a plurality of capture agents that are linked to double
stranded nucleic acids, as illustrated in FIG. 4. In these
embodiments, the top strand of the double stranded nucleic acids is
linked to the capture agent and may be the same for each antibody,
and the sequence of the bottom strand varies between capture
agents. As shown in FIG. 4, the 5' end of the lower strand of the
double-stranded oligonucleotide (which forms the overhang) is of
the general formula 3'-YN.sub.1/N.sub.2-5', optionally followed by
short stretch (e.g., 1-5 residues) of random nucleotides on the 5'
end to increase the overall polymerase residence on the DNA duplex,
wherein Y is a nucleotide sequence of length n (n is 0, 1 or more)
composed of bases N.sub.3 and N.sub.4, wherein nucleotide N.sub.3
is in odd positions and nucleotide N.sub.4 is in even positions,
counting from the start of the overhang and N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C.
[0151] Also a more general formula 3'-YN.sub.1/N.sub.2-5', wherein
N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides
selected from G, A, T and C and Y is a nucleotide sequence of
length n (n is 0, 1 or more) composed of alternating random length
stretches of bases N.sub.3 and N.sub.4 such that the order number
of N.sub.3-- stretches is odd and of N.sub.4 stretches is even, may
be applicable in this method
[0152] In certain embodiments, this method may comprise: (a)
incubating a planar sample with a multiplex antibody composition in
which the overhangs are of the formula (3'-YN.sub.1/N.sub.2-5')
described in the prior paragraph; under conditions by which the
capture agents specifically bind complementary sites in the planar
sample; (b) cross-linking the capture agent to the planar sample;
(c) contacting the planar sample with a polymerase and a nucleotide
mix that comprises fluorescent nucleotides that are complementary
to N.sub.1, and N.sub.2, an unlabeled nucleotide that is
complementary to N.sub.3 and no nucleotide that is complementary to
N.sub.4 and/or ligating an oligonucleotide that has a labeled
nucleotide; and (d) reading, using fluorescence microscopy, a
fluorescent signal generated by addition of a nucleotide to some
but not all of the capture agents. This cycle may be repeated by
(e) inactivating the fluorescent signal, (f) blocking the sample
and contacting the planar sample with a polymerase and an unlabeled
nucleotide that is complementary to N.sub.4 and/or contacting the
sample with a labeled oligonucleotide and a ligase; and repeating
steps (c) (d). In certain embodiments, the method may comprise
repeating steps (c), (d), (e) and (f) multiple times.
[0153] This method can be implemented using a capture agent
composition that comprises: a first antibody linked to a first
double stranded oligonucleotide, wherein the first double stranded
oligonucleotide comprises a single nucleotide 5' overhang
comprising base N.sub.1; a second antibody linked to a second
double stranded oligonucleotide, wherein the second double stranded
oligonucleotide comprises a single nucleotide 5' overhang
comprising base N.sub.2; a third antibody linked to a fourth double
stranded oligonucleotide, wherein the third double stranded
oligonucleotide comprises a two nucleotide 5' overhang, wherein the
first from the 3' position of the overhang comprises base N.sub.4
and the second position comprises N.sub.1; and a fourth antibody
linked to a fourth double stranded oligonucleotide, wherein the
fourth double stranded oligonucleotide comprises a two nucleotide
5' overhang, wherein the first position of the overhang comprises
base N.sub.4 and the second position comprises base N.sub.2,
wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different
nucleotides selected from G, A, T and C. An example of such a
population of capture agents is shown in FIG. 4.
[0154] In certain implementations, the composition may also contain
a fifth antibody linked to a fifth double stranded oligonucleotide,
wherein the fifth double stranded oligonucleotide comprises a
multiple nucleotide 5' overhang, wherein the first position of the
overhang comprises base N.sub.4, the second position comprises base
N.sub.3, and the third position comprises N.sub.1 or N.sub.2.
[0155] Overall there is no theoretical limits to the number of
co-detected complementary sites, e.g., antigens, both in the case
of "reversible terminator" and of "missing base" approach
[0156] The missing base approach does not use reversible
terminators. Instead, extension of a single nucleotide is ensured
by using two interchanging bases (e.g., T and C as shown in FIG. 4
instead of the corresponding G in the "reversible terminators"
approach) and adding only one of the two dNTPs at a time in the
primer extension reaction. After the incorporation of the first
nucleotide, the absence of the second dNTP causes strand elongation
to stall, thereby ensuring that the primers are extended by only a
single nucleotide. As in the previous strategy, all complementary
sites can be co-stained simultaneously using capture agents, each
labeled with a specific oligonucleotide duplex.
[0157] In this embodiment, the duplexes can be designed using the
strategy shown in FIG. 4, i.e., in such a way that each antibody
has the same upper stand oligonucleotide sequence linked to it via
covalent bond or through a streptavidin-biotin interaction. In this
implementation, the lower strand changes from antibody to antibody.
In this method, the general formula for the lower strand is 3'
ddC-sequence-complimentary-to-upper-strand -YA/N.sub.2-5' where Y
is composed of bases T and C such that T can be found only in even
and C only at odd positions. Or in the more general case
3'-YN.sub.1/N.sub.2-5', wherein N.sub.1, N.sub.2, N.sub.3 and
N.sub.4 are different nucleotides selected from G, A, T and C and Y
is a nucleotide sequence of length n (n is 0, 1 or more) composed
of alternating random length stretches of bases N.sub.3 and N.sub.4
such that the order number of N.sub.3-- stretches is odd and of
N.sub.4 stretches is even. In the first simple implementation two
base pairs of the lower strand (T and C as in exemplary design on
FIG. 4) are reserved for step-wise progression and their
complementary pair on the upper strand is never labeled. The other
two bases are complementary to labeled nucleotides and can render
the staining with two different capture agents per cycle. Such
design ensures that a) no two capture agents contain the same
duplex and b) only two different antibody are read per cycle. In
this implementation, each cycle can have three steps: a labeling
step in which the two capture agents are labeled by incorporation
of fluorescent dNTPs and all of the other duplexes are extended one
base at a time, an imaging step, and a de-staining/reactivation
step.
[0158] In RCA embodiments, the strand linked to the antibodies may
be different for each of the antibodies, where the RCA product
contains a sequence conforming to the formula described above in
each repeat of the RCA product.
[0159] During cycle-to-cycle transition the labeled capture agents
from the prior cycle can be bleached/destained in the same way as
described above. Optionally, instead of bleaching, a quencher
labeled nucleotide can be incorporated after the labeled base.
Because, in this embodiment, the position that is labeled is the
last position in the overhang, the labeled capture agents from
prior cycle cannot be re-labeled in later cycles because all
nucleotide positions in the overhang have been filled in. The
performance of "reversible terminator method" as exemplified in
sequential detection of CD4 and CD8 positive T-cells in smears of
mouse splenocytes is illustrated in FIG. 13, 15 and FIG. 16.
Implementation II
[0160] In this method, extension of a primer by nick translation
removes a quencher from a fluorescently labeled "detector"
oligonucleotide that is hybridized to the lower strand
oligonucleotide in such a way that is positioned downstream from
the upper strand primer. The principles of this method are
illustrated in FIG. 7. A multiplexed version of this method is
shown in FIG. 8.
[0161] In certain embodiments, the multiplexed implementations may
comprise: (a) incubating the planar sample with a plurality of
capture agents that are linked to a double-stranded
oligonucleotide; (b) crosslinking the capture agents to the planar
sample; (c) extending a primer that is hybridized to the
oligonucleotide of a first set of capture agents of the plurality,
thereby generating a first set of fluorescent signals (e.g., by
removing the quencher from a labeled oligonucleotide that is
hybridized to the oligonucleotide downstream from the primer),
e.g., by adding a nucleotide using a polymerase or by adding an
oligonucleotide using a ligase; (d) reading the first set of
fluorescent signals using fluorescence microscopy; (e) inactivating
the fluorescence; (f) extending a primer that is hybridized to the
oligonucleotide of a second set of capture agents of the plurality,
thereby generating a second set of fluorescent signals (e.g., by
removing the quencher from a labeled oligonucleotide that is
hybridized to the oligonucleotide downstream from the primer); (g)
reading the second set of fluorescent signals using fluorescence
microscopy; and (h) comparing the images produce in steps (d) and
(g).
[0162] In this method, the architecture of the double-stranded
oligonucleotides linked to the capture agent has a specific design
which is effectively enabling rendering of the capture agent
binding pattern by "nick translation". In particular the duplex of
the upper strand and the lower strand oligonucleotide with long 5'
overhang of the lower strand is further hybridized to a small
detector oligonucleotide labeled both by fluorescent and the
quencher. There is a predesigned gap between the initial upper
strand and the upper strand detector oligo. During cyclic staining
this gap is "walked" by either "reversible terminator" or "missing
base" (similar to described in previous sections) until the gap is
reduced to a single base nick. Extension and progression through
the nick on the upper strand by "nick translating" polymerase such
as DNA pol I removes the quencher from some but not all of the
quenched fluorescently labeled oligonucleotides, thereby generating
a fluorescent signal for some but not all of the capture
agents.
[0163] In some embodiments the method generally comprises: (i)
labeling a planar sample with: i. a first antibody, wherein the
first antibody is linked to a first oligonucleotide duplex
comprising, lower strand oligonucleotide with a unique sequence
hybridized thereto: (i) an oligonucleotide upper strand "primer"
and (ii) a labeled upper strand oligonucleotide comprising a 5'
quencher at a site that is downstream from the primer; and a
fluorophore downstream from the quencher and ii. a second antibody,
wherein the second antibody is linked to a second oligonucleotide
duplex comprising, lower strand oligonucleotide with unique
sequence hybridized thereto: (i) an oligonucleotide upper strand
"primer" and (ii) an upper strand oligonucleotide labeled both by
fluorophore and a quencher; wherein the gap between the 3' end of
the primer and the 5' end of the labeled oligonucleotide is
different for the first and second oligonucleotides; (ii)
incubating the tissue sample with a first nucleotide mix and a
polymerase, thereby removing the quencher from only the labeled
oligonucleotide that is hybridized to the first oligonucleotide and
producing a first fluorescent signal; (iii) reading the first
fluorescent signal using fluorescence microscopy; (iv) inactivating
the fluorescent signal by further progression of nick-translating
polymerase; (v) incubating the tissue sample with a second
nucleotide mix and a polymerase, thereby removing the quencher from
only the labeled oligonucleotide that is hybridized to the second
oligonucleotide and producing a first fluorescent signal; and (vi)
reading the second fluorescent signal from the planar sample using
fluorescence microscopy.
[0164] FIGS. 7 and 8 show an example of this method. The
multiplexing method shown in FIG. 8 has the following steps:
[0165] Step 1: The planar sample is stained by capture agents that
are coupled to a DNA double-stranded oligonucleotide chemically or
through streptavidin (as described in FIG. 1) such that the top
strand of the duplex contains a nick or a single base deletion
followed by a nucleotide stretch bordered by a fluorophore and its
quencher on two ends ("molecular beacon" or Taqman based
design).
[0166] Step 2: Staining pattern is rendered by a nick-translation
reaction carried out by any 5' exo+ polymerase such as DnaPolI
Klenow fragment in the presence of a single letter (A as in FIG. 5
for example). Nick translation removes the quencher but stops
before removing the part of the duplex with the fluorophore.
[0167] Step 3: For rendering of other staining reagents, the
fluorescence is removed by continuing nick translation in the
presence of the letters of the stretch bearing the fluorophore.
[0168] Step 4: When multiplexing is desired, multiplexing can be
achieved by special design of oligonucleotide duplexes attached to
detection reagents. In particular each antibody set (two or three
per cycle) has a gap of an increasing length between the top strand
priming and the detector oligonucleotide. This sequence gap on the
strand bearing the quencher/fluorophore pair is filled up to final
nick in such a way that single base is extended per cycle, similar
to how it is achieved in method 1 (see FIG. 8).
Implementation III
[0169] In this implementation, the method comprises rending
antibody staining by primer extension with a fluorophore labeled
base or otherwise reading a FRET signal generated by energy
transfer between a first fluorescent nucleotide added to the primer
by primer extension and a second nucleotide that is present in the
oligonucleotide FIG. 10. The principles of this method are
illustrated in FIG. 9A. The multiplexing is achieved by removing
the extension priming oligonucleotide by melting the duplex or by
exonuclease and reannealing another primer oligonucleotide which is
extendable on a different antibody. A multiplexed version of this
method is shown in FIG. 9B. In certain embodiments, the multiplexed
implementations may comprise: (a) incubating the planar sample with
a plurality of capture agents; (b) cross-linking the capture agents
to the planar sample; (c) extending a primer that is hybridized to
the oligonucleotide of a first set of capture agents of the
plurality (e.g., wherein the 3' end of the first primer anneals to
only the oligonucleotide of the first population), thereby
generating a first set of fluorescent signals (which step can be
done by adding a labeled nucleotide using polymerase and/or
contacting the sample with a labeled oligonucleotide and a ligase);
(d) reading the first set of fluorescent signals using fluorescence
microscopy; (e) inactivating the fluorescence; (f) extending a
primer that hybridized to the oligonucleotide of a second set of
capture agents of the plurality (e.g., wherein the 3' end of the
first primer anneals to only the oligonucleotide of the second
population), thereby generating a second set of fluorescent signals
(which step can also be done by adding a labeled nucleotide using
polymerase and/or contacting the sample with a labeled
oligonucleotide and a ligase); (g) reading the second set of
fluorescent signals using fluorescence microscopy; and (h)
comparing the images produce in steps (d) and (g).
[0170] In certain embodiments, this method comprises: (a)
incubating the planar sample with (i) a first antibody that is
linked to a first labeled oligonucleotide and (ii) a second
antibody that is linked to a second labeled oligonucleotide, (b)
cross-linking the capture agents to the planar sample; (c)
hybridizing the first and second labeled oligonucleotides with a
first primer, wherein the 3' end of the first primer anneals to
only the first labeled oligonucleotide; (d) extending the primer
with a fluorescent nucleotide (which step can be done by adding a
labeled nucleotide using polymerase and/or contacting the sample
with a labeled oligonucleotide and a ligase); (e) reading, by
fluorescence microscopy, a FRET signal generated by energy transfer
between the label of the first oligonucleotide and the fluorescent
nucleotide added to the first primer; (f) inactivating the
fluorescent nucleotide added to the first primer; (g) hybridizing
the first and second labeled oligonucleotides with a second primer,
wherein the 3' end of the second primer anneals to only the second
labeled oligonucleotide; (h) extending the second primer with a
fluorescent nucleotide; and (i) reading, by fluorescence
microscopy, a FRET signal generated by energy transfer between the
label of the second oligonucleotide and the fluorescent nucleotide
added to the second primer.
[0171] FIGS. 9-10 shows an example of this method. The method shown
in FIGS. 8-11 has the following steps:
[0172] Step 1: The planar sample is stained using a capture agent
that is coupled to a single stranded oligonucleotide. The
oligonucleotide could be either unlabeled or labeled by FRET
acceptor (e.g. Cy5) fluorophore on the 3' end.
[0173] Step 2: The binding pattern can be determined by an on-slide
hybridization of a complementary probe followed a primer extension
reaction in which a fluorescently labeled nucleotide fills in the
overhang in the extended strand. In this example (see FIG. 10) the
extended base is labeled by a FRET donor (e.g. Cy3), which can
increase the signal to noise ratio. If the oligonucleotide that is
linked to the capture agent is unlabeled, then the fluorescent
emission of the nucleotide that has been incorporated by DNA
synthesis can be detected directly, without FRET FIG. 9.
[0174] Step 3: The binding pattern of other capture agents can be
determined by removing the fluorescence by cleavage of lower strand
by exo+ DNA polymerase such as Vent (FIG. 9). Alternatively, the
fluorescence can be removed by raising the temperature beyond the
melting point of the DNA strands or by one of the de-staining
techniques described previously.
[0175] Step 4: Multiplexing can be achieved by staining of the
sample with a library of capture agents each labeled with specific
oligonucleotides and cycling through Steps 1-3, as described above,
each time using a different detection oligonucleotide that is
complementary to one of the capture agent-conjugated
oligonucleotides. Only duplexes where primers are annealed
specifically will be properly extended (FIG. 11). In these
embodiments, each primers is designed so that its 3' end hybridizes
to only one of the oligonucleotides that are linked to a capture
agent.
Further Implementations
[0176] As schematically illustrated in FIG. 16, the signal may be
amplified using rolling circle amplification. In these embodiments,
a capture agent that is linked to an oligonucleotide is hybridized
to a padlock probe that hybridizes to the oligonucleotide in such a
way that the ends of the padlock probe are ligatably adjacent. In
this embodiment, after ligation, the padlock probe (which is now
circularized) can be copied by a rolling circle amplification
reaction that is primed by the oligonucleotide. This reaction
results in a concatamer of the padlock probe that contains several
(in many cases hundreds or thousands) of copies of the same
sequence in tandem that is linked to the capture agent. The rolling
circle amplification product (which is linked to the antibody) can
be detected using methods described above and, as illustrated, the
signal is amplified because the sequence being detected is
repeated. In these embodiments, the (i) the capture agent is linked
to a double-stranded nucleic acid that comprises a first strand
(i.e., the RCA product) and a second strand (comprising the
detection oligonucleotides). Single molecules can be detected using
such methods.
[0177] FIG. 19 shows how RNA molecules can be detected using a
padlock probe/RCA amplification approach. In this method, the
padlock probe hybridizes to the same mRNA as the capture agent (the
"splint-primer"), thereby ensuring that the padlock probe
circularizes only in the presence of the target RNA. In this
embodiment, the splint-primer hybridizes to the target RNA, acts as
a splint for the padlock probe, and also acts as a primer for
rolling circle amplification, thereby allowing the signal to be
amplified in a similar to FIG. 16.
[0178] FIG. 20 shows an alternative method that relies on primer
extension and the ligation of a short, labeled oligonucleotide. In
this embodiment, ligation of short labeled oligonucleotide to the
top strand oligonucleotide only occurs after the overhang has been
filed in to a certain point. In embodiments that rely on ligation,
a labeled oligonucleotide can be added to either the 3' end or the
5' end of the extendible end.
Utility
[0179] The methods and compositions described herein find general
use in a wide variety of application for analysis of any planar
sample (e.g., in the analysis of tissue sections, sheets of cells,
spun-down cells, blots of electrophoresis gels, Western blots,
dot-blots, ELISAs, antibody microarrays, nucleic acid microarrays
etc).
[0180] In particular embodiments, the planar sample may be a
section of a tissue biopsy obtained from a patient. Biopsies of
interest include both tumor and non-neoplastic biopsies of skin
(melanomas, carcinomas, etc.), soft tissue, bone, breast, colon,
liver, kidney, adrenal, gastrointestinal, pancreatic, gall bladder,
salivary gland, cervical, ovary, uterus, testis, prostate, lung,
thymus, thyroid, parathyroid, pituitary (adenomas, etc.), brain,
spinal cord, ocular, nerve, and skeletal muscle, etc.
[0181] In certain embodiments, capture agents specifically bind to
biomarkers, including cancer biomarkers, that may be proteinaceous
or a nucleic acid. Exemplary cancer biomarkers, include, but are
not limited to carcinoembryonic antigen (for identification of
adenocarcinomas), cytokeratins (for identification of carcinomas
but may also be expressed in some sarcomas), CD15 and CD30 (for
Hodgkin's disease), alpha fetoprotein (for yolk sac tumors and
hepatocellular carcinoma), CD117 (for gastrointestinal stromal
tumors), CD10 (for renal cell carcinoma and acute lymphoblastic
leukemia), prostate specific antigen (for prostate cancer),
estrogens and progesterone (for tumour identification), CD20 (for
identification of B-cell lymphomas) and CD3 (for identification of
T-cell lymphomas). The above-described method can be used to
analyze cells from a subject to determine, for example, whether the
cell is normal or not or to determine whether the cells are
responding to a treatment. In one embodiment, the method may be
employed to determine the degree of dysplasia in cancer cells. In
these embodiments, the cells may be a sample from a multicellular
organism. A biological sample may be isolated from an individual,
e.g., from a soft tissue. In particular cases, the method may be
used to distinguish different types of cancer cells in FFPE
samples.
[0182] The method described above finds particular utility in
examining planar samples using a plurality of antibodies, each
antibodies recognizing a different marker. Examples of cancers, and
biomarkers that can be used to identify those cancers, are shown
below. In these embodiments, one does not need to examine all of
the markers listed below in order to make a diagnosis.
TABLE-US-00001 Acute Leukemia IHC Panel CD3, CD7, CD20, CD34, CD45,
CD56, CD117, MPO, PAX-5, and TdT. Adenocarcinoma vs. Mesothelioma
IHC Pan-CK, CEA, MOC-31, BerEP4, TTF1, calretinin, and WT-1. Panel
Bladder vs. Prostate Carcinoma IHC Panel CK7, CK20, PSA, CK 903,
and p63. Breast IHC Panel ER, PR, Ki-67, and HER2. Reflex to HER2
FISH after HER2 IHC is available. Burkitt vs. DLBC Lymphoma IHC
panel BCL-2, c-MYC, Ki-67. Carcinoma Unknown Primary Site, Female
CK7, CK20, mammaglobin ER, TTF1, CEA, CA19-9, S100, (CUPS IHC Panel
- Female) synaptophysin, and WT-1. Carcinoma Unknown Primary Site,
Male CK7, CK20, TTF1, PSA, CEA, CA19-9, S100, and (CUPS IHC Panel -
Male) synaptophysin. GIST IHC Panel CD117, DOG-1, CD34, and desmin.
Hepatoma/Cholangio vs. Metastatic HSA (HepPar 1), CDX2, CK7, CK20,
CAM 5.2, TF-1, and Carcinoma IHC Panel CEA (polyclonal). Hodgkin
vs. NHL IHC Panel BOB-1, BCL-6, CD3, CD10, CD15, CD20, CD30, CD45
LCA, CD79a, MUM1, OCT-2, PAX-5, and EBER ISH. Lung Cancer IHC Panel
chromogranin A, synaptophysin, CK7, p63, and TTF-1. Lung vs.
Metastatic Breast Carcinoma IHC TTF1, mammaglobin, GCDFP-15
(BRST-2), and ER. Panel Lymphoma Phenotype IHC Panel BCL-2, BCL-6,
CD3, CD4, CD5, CD7, CD8, CD10, CD15, CD20, CD30, CD79a, CD138,
cyclin D1, Ki67, MUM1, PAX- 5, TdT, and EBER ISH. Lymphoma vs.
Carcinoma IHC Panel CD30, CD45, CD68, CD117, pan-keratin, MPO,
S100, and synaptophysin. Lymphoma vs. Reactive Hyperplasia IHC
BCL-2, BCL-6, CD3, CD5, CD10, CD20, CD23, CD43, cyclin Panel D1,
and Ki-67. Melanoma vs. Squamous Cell Carcinoma CD68, Factor XIIIa,
CEA (polyclonal), S-100, melanoma IHC Panel cocktail (HMB-45,
MART-1/Melan-A, tyrosinase) and Pan- CK. Mismatch Repair Proteins
IHC Panel MLH1, MSH2, MSH6, and PMS2. (MMR/Colon Cancer)
Neuroendocrine Neoplasm IHC Panel CD56, synaptophysin, chromogranin
A, TTF-1, Pan-CK, and CEA (polyclonal). Plasma Cell Neoplasm IHC
Panel CD19, CD20, CD38, CD43, CD56, CD79a, CD138, cyclin D1, EMA,
kappa, lambda, and MUM1. Prostate vs. Colon Carcinoma IHC Panel
CDX2, CK 20, CEA (monoclonal), CA19-9, PLAP, CK 7, and PSA. Soft
Tissue Tumor IHC Panel Pan-CK, SMA, desmin, S100, CD34, vimentin,
and CD68. T-Cell Lymphoma IHC panel ALK1, CD2, CD3, CD4, CD5, CD7,
CD8, CD10, CD20, CD21, CD30, CD56, TdT, and EBER ISH. T-LGL
Leukemia IHC panel CD3, CD8, granzyme B, and TIA-1.
Undifferentiated Tumor IHC Panel Pan-CK, S100, CD45, and
vimentin.
[0183] In some embodiments, the method may be employed to detect
the location and, optionally, the abundance of DNA molecules and/or
RNA molecules in situ. In one exemplary embodiment, the method may
be used to detect intracellular RNAs. In these embodiments, the
capture agent may be a nucleic acid, and the intracellular location
and, optionally, the abundance of RNA molecules (e.g., mRNAs or
lncRNAs) may be detected in situ. Such hybridization methods may be
adapted from known RNA or DNA FISH methods (see, e.g., Mahadevaiah
et al (Methods Mol Biol. 2009 558:433-44), Shaffer et al (PLoS One.
2013 8:e75120) and Pollex et al (Methods Mol. Biol. 2013
1042:13-31), which are incorporated by reference herein.
[0184] In some embodiments, the method may involve obtaining an
image as described above (an electronic form of which may have been
forwarded from a remote location) and may be analyzed by a doctor
or other medical professional to determine whether a patient has
abnormal cells (e.g., cancerous cells) or which type of abnormal
cells are present. The image may be used as a diagnostic to
determine whether the subject has a disease or condition, e.g., a
cancer. In certain embodiments, the method may be used to determine
the stage of a cancer, to identify metastasized cells, or to
monitor a patient's response to a treatment, for example.
[0185] The compositions and methods described herein can be used to
diagnose a patient with a disease. In some cases, the presence or
absence of a biomarker in the patient's sample can indicate that
the patient has a particular disease (e.g., cancer). In some cases,
a patient can be diagnosed with a disease by comparing a sample
from the patient with a sample from a healthy control. In this
example, a level of a biomarker, relative to the control, can be
measured. A difference in the level of a biomarker in the patient's
sample relative to the control can be indicative of disease. In
some cases, one or more biomarkers are analyzed in order to
diagnose a patient with a disease. The compositions and methods of
the disclosure are particularly suited to identifying the presence
or absence of, or determining expression levels, of a plurality of
biomarkers in a sample.
[0186] In some cases, the compositions and methods herein can be
used to determine a treatment plan for a patient. The presence or
absence of a biomarker may indicate that a patient is responsive to
or refractory to a particular therapy. For example, a presence or
absence of one or more biomarkers may indicate that a disease is
refractory to a specific therapy and an alternative therapy can be
administered. In some cases, a patient is currently receiving the
therapy and the presence or absence of one or more biomarkers may
indicate that the therapy is no longer effective.
[0187] In any embodiment, data can be forwarded to a "remote
location", where "remote location," means a location other than the
location at which the image is examined. For example, a remote
location could be another location (e.g., office, lab, etc.) in the
same city, another location in a different city, another location
in a different state, another location in a different country, etc.
As such, when one item is indicated as being "remote" from another,
what is meant is that the two items can be in the same room but
separated, or at least in different rooms or different buildings,
and can be at least one mile, ten miles, or at least one hundred
miles apart. "Communicating" information references transmitting
the data representing that information as electrical signals over a
suitable communication channel (e.g., a private or public network).
"Forwarding" an item refers to any means of getting that item from
one location to the next, whether by physically transporting that
item or otherwise (where that is possible) and includes, at least
in the case of data, physically transporting a medium carrying the
data or communicating the data. Examples of communicating media
include radio or infra-red transmission channels as well as a
network connection to another computer or networked device, and the
internet or including email transmissions and information recorded
on websites and the like. In certain embodiments, the image may be
analyzed by an MD or other qualified medical professional, and a
report based on the results of the analysis of the image may be
forwarded to the patient from which the sample was obtained.
[0188] In some cases, the method may be employed in a variety of
diagnostic, drug discovery, and research applications that include,
but are not limited to, diagnosis or monitoring of a disease or
condition (where the image identifies a marker for the disease or
condition), discovery of drug targets (where the a marker in the
image may be targeted for drug therapy), drug screening (where the
effects of a drug are monitored by a marker shown in the image),
determining drug susceptibility (where drug susceptibility is
associated with a marker) and basic research (where is it desirable
to measure the differences between cells in a sample).
[0189] In certain embodiments, two different samples may be
compared using the above methods. The different samples may be
composed of an "experimental" sample, i.e., a sample of interest,
and a "control" sample to which the experimental sample may be
compared. In many embodiments, the different samples are pairs of
cell types or fractions thereof, one cell type being a cell type of
interest, e.g., an abnormal cell, and the other a control, e.g.,
normal, cell. If two fractions of cells are compared, the fractions
are usually the same fraction from each of the two cells. In
certain embodiments, however, two fractions of the same cell may be
compared. Exemplary cell type pairs include, for example, cells
isolated from a tissue biopsy (e.g., from a tissue having a disease
such as colon, breast, prostate, lung, skin cancer, or infected
with a pathogen etc.) and normal cells from the same tissue,
usually from the same patient; cells grown in tissue culture that
are immortal (e.g., cells with a proliferative mutation or an
immortalizing transgene), infected with a pathogen, or treated
(e.g., with environmental or chemical agents such as peptides,
hormones, altered temperature, growth condition, physical stress,
cellular transformation, etc.), and a normal cell (e.g., a cell
that is otherwise identical to the experimental cell except that it
is not immortal, infected, or treated, etc.); a cell isolated from
a mammal with a cancer, a disease, a geriatric mammal, or a mammal
exposed to a condition, and a cell from a mammal of the same
species, preferably from the same family, that is healthy or young;
and differentiated cells and non-differentiated cells from the same
mammal (e.g., one cell being the progenitor of the other in a
mammal, for example). In one embodiment, cells of different types,
e.g., neuronal and non-neuronal cells, or cells of different status
(e.g., before and after a stimulus on the cells) may be employed.
In another embodiment of the invention, the experimental material
is cells susceptible to infection by a pathogen such as a virus,
e.g., human immunodeficiency virus (HIV), etc., and the control
material is cells resistant to infection by the pathogen. In
another embodiment, the sample pair is represented by
undifferentiated cells, e.g., stem cells, and differentiated
cells.
[0190] The images produced by the method may be viewed side-by-side
or, in some embodiments, the images may be superimposed or
combined. In some cases, the images may be in color, where the
colors used in the images may correspond to the labels used.
[0191] Cells any organism, e.g., from bacteria, yeast, plants and
animals, such as fish, birds, reptiles, amphibians and mammals may
be used in the subject methods. In certain embodiments, mammalian
cells, i.e., cells from mice, rabbits, primates, or humans, or
cultured derivatives thereof, may be used.
Computer Systems
[0192] The invention also provides a computer system that is
configured to implement the methods of the disclosure. The system
can include a computer server ("server") that is programmed to
implement the methods described herein. FIG. 21 depicts a system
1600 adapted to enable a user to detect, analyze, and process
images of samples. The system 1600 includes a central computer
server 1601 that is programmed to implement exemplary methods
described herein. The server 1601 includes a central processing
unit (CPU, also "processor") 1605 which can be a single core
processor, a multi core processor, or plurality of processors for
parallel processing. The server 1601 also includes memory 1610
(e.g. random access memory, read-only memory, flash memory);
electronic storage unit 1615 (e.g. hard disk); communications
interface 1620 (e.g. network adaptor) for communicating with one or
more other systems; and peripheral devices 1625 which may include
cache, other memory, data storage, and/or electronic display
adaptors. The memory 1610, storage unit 1615, interface 1620, and
peripheral devices 1625 are in communication with the processor
1605 through a communications bus (solid lines), such as a
motherboard. The storage unit 1615 can be a data storage unit for
storing data. The server 1601 is operatively coupled to a computer
network ("network") 1630 with the aid of the communications
interface 1620. The network 1630 can be the Internet, an intranet
and/or an extranet, an intranet and/or extranet that is in
communication with the Internet, a telecommunication or data
network. The network 1630 in some cases, with the aid of the server
1601, can implement a peer-to-peer network, which may enable
devices coupled to the server 1601 to behave as a client or a
server. A microscope can be a peripheral device 1625 or a remote
computer system 1640.
[0193] The storage unit 1615 can store files, such as individual
images, time lapse images, data about individual cells, data about
individual biomarkers, images showing a pattern of binding of
capture agents to a sample, or any aspect of data associated with
the invention. The data storage unit 1615 may be coupled with data
relating to locations of cells in a virtual grid.
[0194] The server can communicate with one or more remote computer
systems through the network 1630. The one or more remote computer
systems may be, for example, personal computers, laptops, tablets,
telephones, Smart phones, or personal digital assistants.
[0195] In some situations the system 1600 includes a single server
1601. In other situations, the system includes multiple servers in
communication with one another through an intranet, extranet and/or
the Internet.
[0196] Methods as described herein can be implemented by way of
machine (e.g., computer processor) computer readable medium (or
software) stored on an electronic storage location of the server
1601, such as, for example, on the memory 1610, or electronic
storage unit 1615. During use, the code can be executed by the
processor 1605. In some cases, the code can be retrieved from the
storage unit 1615 and stored on the memory 1610 for ready access by
the processor 1605. In some situations, the electronic storage unit
1615 can be precluded, and machine-executable instructions are
stored on memory 1610. Alternatively, the code can be executed on a
second computer system 1640.
[0197] Aspects of the systems and methods provided herein, such as
the server 1601, can be embodied in programming. Various aspects of
the technology may be thought of as "products" or "articles of
manufacture" typically in the form of machine (or processor)
executable code and/or associated data that is carried on or
embodied in a type of machine readable medium (e.g., computer
readable medium). Machine-executable code can be stored on an
electronic storage unit, such memory (e.g., read-only memory,
random-access memory, flash memory) or a hard disk. "Storage" type
media can include any or all of the tangible memory of the
computers, processors or the like, or associated modules thereof,
such as various semiconductor memories, tape drives, disk drives
and the like, which may provide non-transitory storage at any time
for the software programming. All or portions of the software may
at times be communicated through the Internet or various other
telecommunication networks. Such communications, for example, may
enable loading of the software from one computer or processor into
another, for example, from a management server or host computer
into the computer platform of an application server. Thus, another
type of media that may bear the software elements includes optical,
electrical, and electromagnetic waves, such as used across physical
interfaces between local devices, through wired and optical
landline networks and over various air-links. The physical elements
that carry such waves, such as wired or wireless likes, optical
links, or the like, also may be considered as media bearing the
software. As used herein, unless restricted to non-transitory,
tangible "storage" media, terms such as computer or machine
"readable medium" refer to any medium that participates in
providing instructions to a processor for execution.
[0198] Hence, a machine readable medium, such as
computer-executable code, may take many forms, including but not
limited to, tangible storage medium, a carrier wave medium, or
physical transmission medium. Non-volatile storage media can
include, for example, optical or magnetic disks, such as any of the
storage devices in any computer(s) or the like, such may be used to
implement the system. Tangible transmission media can include:
coaxial cables, copper wires, and fiber optics (including the wires
that comprise a bus within a computer system). Carrier-wave
transmission media may take the form of electric or electromagnetic
signals, or acoustic or light waves such as those generated during
radio frequency (RF) and infrared (IR) data communications. Common
forms of computer-readable media therefore include, for example: a
floppy disk, a flexible disk, hard disk, magnetic tape, any other
magnetic medium, a CD-ROM, DVD, DVD-ROM, any other optical medium,
punch cards, paper tame, any other physical storage medium with
patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM,
any other memory chip or cartridge, a carrier wave transporting
data or instructions, cables, or links transporting such carrier
wave, or any other medium from which a computer may read
programming code and/or data. Many of these forms of computer
readable media may be involved in carrying one or more sequences of
one or more instructions to a processor for execution.
[0199] The results of the sample staining or labeling can be
presented to a user with the aid of a user interface, such as a
graphical user interface.
Kits
[0200] In some aspects, the disclosure herein provides for kits.
The kits can comprise any number of compositions to perform the
methods of the disclosure, each of which have been described
herein. For example, a kit may comprise at least one capture agent.
The capture agent can be an antibody, an aptamer, or an
oligonucleotide probe. The capture agent can be custom-made to
specifically bind to a desired target. For example, a user may
custom-order one or more capture agents to be included in the kit.
In some cases, the capture agents can be sold separately. The
capture agents can specifically bind to a target molecule of
interest. Additionally or alternatively, capture agents can be
ordered as a panel (i.e., a pre-determined selection of capture
agents). The panel can be specific for a particular type of disease
(e.g., cancer) or a particular sub-type of a disease (e.g., colon
cancer). A kit of the disclosure can also include one or more
oligonucleotides. The oligonucleotides can comprise a first strand
and a double strand, as described herein. The oligonucleotides can
be provided as single-stranded oligonucleotides or as
double-stranded oligonucleotides. In the latter case, the kit can
include reagents and/or instructions for annealing the first strand
and the second strand of oligonucleotides to produce
double-stranded oligonucleotides. The single- or double-stranded
oligonucleotides can be conjugated to the capture agents or can be
provided unconjugated. In the latter case, reagents can be included
in the kit for conjugating the double-stranded oligonucleotides to
the capture agents (e.g., reagents to perform Click chemistry). In
some cases, the kit may provide a plurality of oligonucleotides
wherein each of the first strands is the same and each of the
second strands is different. The kit can further comprise any
nucleotide mixture disclosed herein. Nucleotide mixtures can
comprise any combination of fluorescent nucleotides, unlabeled
nucleotides, reversible terminator nucleotides, and the like.
Generally, the nucleotide mixture provided in the kit will be
compatible with the provided oligonucleotides. The kit can further
comprise, without limitation, a polymerase for performing primer
extension, a reagent for inactivating a signal (e.g., TCEP), a
blocking solution (e.g., iodoacetamide solution), and any buffer or
solution suitable to perform the methods herein. The kit can
comprise any reagent for preparing a sample for labeling such as a
fixative (e.g., formaldehyde) or reagents for embedding a sample
(i.e., paraffin wax). The kit can further comprise a control sample
for comparison with a test sample. The control sample can be a
healthy sample or a diseased sample. The control sample may be
matched to the tissue or cell type under investigation or to the
disease being studied. In some cases, the control sample may be a
positive control or a negative control.
EMBODIMENTS
[0201] A method for analyzing a planar sample is provided. In
certain embodiments, the method comprises: (a) incubating the
planar sample with a capture agent under conditions by which the
capture agent specifically binds to complementary sites in the
planar sample, wherein: (i) the capture agent is linked to a
double-stranded oligonucleotide that comprises a first strand and a
second strand; (ii) the capture agent is linked to a
double-stranded oligonucleotide by the 5' end of the first strand;
and (iii) the 3' end of the first strand is recessed relative to
the 5' end of the second strand, thereby producing an overhang; (b)
crosslinking the capture agent to planar sample; (c) contacting the
planar sample with a polymerase and a nucleotide mix, thereby
adding one or more nucleotides to the overhang; and/or contacting
the planar sample with a mixture of short oligonucleotides, some of
which may be labelled or not, and a DNA ligase and (d) reading a
fluorescent signal generated by addition of the one or more
nucleotides to the overhang using fluorescence microscopy, thereby
producing an image showing the pattern of binding of the capture
agent to the planar sample. In some embodiments, after the sample
has been read, this method may involve removing the fluorescent
moiety and deprotecting an added fluorescent nucleotide, thereby
allowing the method to be repeated.
[0202] In any embodiment, step (c) may comprise contacting the
planar sample with a polymerase and a nucleotide mix that comprises
a fluorescent nucleotide, thereby adding the fluorescent nucleotide
to the overhang, or contacting to planar sample with one or more
fluorescently labeled oligonucleotides, thereby adding a
fluorescently labeled oligonucleotide to the overhang; and step (d)
comprises reading a fluorescent signal generated by addition of the
fluorescent nucleotide or oligonucleotide to the overhang. In this
embodiment, the fluorescent signal may be: emitted directly from
the added nucleotide or oligonucleotide, a FRET signal generated by
energy transfer between two fluorescent nucleotides that are added
to the overhang or a FRET signal generated by energy transfer
between a first fluorescent nucleotide added to overhang and a
second fluorescent nucleotide that is present in the second
strand.
[0203] In some embodiments, extension of the first strand removes a
quencher from a quenched fluorescently labeled oligonucleotide that
is hybridized to the second strand, downstream from the first
strand.
[0204] In any embodiment, the sample may be a formalin-fixed,
paraffin-embedded (FFPE) section.
[0205] Also provided herein is a capture agent that is linked to a
double-stranded oligonucleotide, wherein: (i) the double-stranded
oligonucleotide comprises a first strand and a second strand; (ii)
the capture agent is linked to the 5' end of the first strand; and
(iii) the 3' end of the first strand is recessed relative to the 5'
end of the second strand, thereby producing an overhang or (iiii)
the 5' end is recessed relative to the 3' end of the second strand,
there producing and overhang
[0206] Also provided herein is a capture agent composition
comprising a plurality of capture agents that recognize different
complementary sites, wherein: each of the capture agents is linked
to a double-stranded oligonucleotide that comprises a first strand
and a second strand; the capture agents are linked to a
double-stranded oligonucleotide by the 5' end of first strand; the
3' end of the first strand in each of the double-stranded
oligonucleotides is recessed relative to the 5' end of the second
strand, thereby producing an overhang; and the overhang is
different for each of the capture agents. Alternatively, the 5' end
is recessed relative to the 3' end of the second strand, there
producing and overhang that is specific to each capture agent. In
this embodiment, the sequence of the first strand may be the same
for each of the capture agents; and the sequence of the second
strand may be different for each of the capture agents.
[0207] In these embodiments, the overhangs may be of the formula
3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein N.sub.1, N.sub.2,
N.sub.3 and N.sub.4 are different nucleotides selected from G, A, T
and C and n is 1 or more, or the formula 3'-YN.sub.1/N.sub.2-5',
optionally followed by short stretch of random nucleotides on the
5' end to increase the overall polymerase residence on the DNA
duplex, wherein Y is composed of alternating stretches of bases
N.sub.3 and N.sub.4, and wherein N.sub.1, N.sub.2, N.sub.3 and
N.sub.4 are different nucleotides selected from G, A, T and C.
[0208] A method for analyzing a tissue sample is also provided. In
these embodiments, the method may comprise (a) incubating a planar
sample with a capture agent composition of a prior embodiment under
conditions by which the capture agents specifically bind to sites
in the planar sample; (b) crosslinking capture agents to planar
sample; (c) contacting the planar sample with a polymerase and
either an incomplete nucleotide mix or a nucleotide mix that
comprises a reversible terminator nucleotide and/or a ligase and a
labeled oligonucleotide; and (d) reading, using fluorescence
microscopy, a fluorescent signal generated by addition a nucleotide
to some but not all of the capture agents.
[0209] In this embodiment, the method may comprise: (c) contacting
the planar sample with a polymerase and: (i) a nucleotide mix that
comprises fluorescent nucleotides that are complementary to
N.sub.1, N.sub.2 and N.sub.3 and a reversible terminator nucleotide
that is complementary to N.sub.4 or (ii) a nucleotide mix that
comprises fluorescent nucleotides that are complementary to
N.sub.1, and N.sub.2, an unlabeled nucleotide that is complementary
to N.sub.3, and no nucleotide that is complementary to N.sub.4,
thereby adding fluorescent nucleotides onto the double-stranded
oligonucleotides of some but not all of the capture agents. This
step can also be done by ligation, i.e., by contacting the planar
sample with a labeled oligonucleotide (or a mixture of the same),
where addition of the labeled oligonucleotide depends on the
underlying sequence of the overhang. This method also comprises:
(d) reading, using fluorescence microscopy, a fluorescent signal
generated by addition of a fluorescent nucleotide to some but not
all of the capture agents. In these embodiments, the overhangs may
be of the formula 3'-N.sub.4nN.sub.1/N.sub.2/N.sub.3, wherein
N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different nucleotides
selected from G, A, T and C and n is 1 or more; and step (c)
comprises contacting the planar sample with a polymerase and a
nucleotide mix that comprises fluorescent nucleotides that are
complementary to N.sub.1, N.sub.2 and N.sub.3 and a reversible
terminator nucleotide that is complementary to N.sub.4. This step
can also be implemented by addition of a labeled oligonucleotide
using a ligase. In these embodiments, the method may comprise (e)
inactivating the fluorescent signal, deprotecting the reversible
terminator nucleotide and blocking the sample; and (f) repeating
steps (c) and (d). In some cases, step (f) may comprise repeating
steps (c), (d) and (e) multiple times. Alternatively, the overhangs
may be of the formula 3'-YN.sub.1/N.sub.2-5', optionally followed
by short stretch of random nucleotides on the 5' end to increase
the overall polymerase residence on the DNA duplex, wherein Y is
composed of alternating stretches of bases N.sub.3 and N.sub.4, and
wherein N.sub.1, N.sub.2, N.sub.3 and N.sub.4 are different
nucleotides selected from G, A, T and C. In these embodiments, the
method may further comprise (e) inactivating the fluorescent signal
and contacting the planar sample with a polymerase and an unlabeled
nucleotide that is complementary to N.sub.4; and (f) repeating
steps (c) and (d). In some cases, step (f) may comprise repeating
steps (c), (d) and (e) multiple times.
[0210] In some embodiments, the double-stranded oligonucleotides
each comprise a fluorescently labeled oligonucleotide hybridized to
the second strand downstream from first strand, wherein the
fluorescently labeled oligonucleotide comprises a quencher and
extension of the first strand removes the quencher from some but
not all of the quenched fluorescently labeled oligonucleotides,
thereby generating a fluorescent signal for some but not all of the
capture agents.
Example I
Materials and Methods
[0211] Spleen cells fixed in 2% formaldehyde, permeablized and
stored in methanol at -80 were spun from methanol, resuspended and
washed with buffer 4 (10 mM Tris &. 5, 10 mM MgCl2, 150 mM
NaCl, 0.1% Triton.times.100) for 5 min on a rotator. To block
against non-specific binding of ab-oligonucleotide complexes cells
were further spun, resuspended in lml PBS, 0.5% BSA (SM) and
supplemented up to additional 0.5M NaCl (0.9 ml SM+100 ul 5M NaCl).
20 ul of sheared ssDNA (10 mg/ml), 50 ul of mouse IgG (10 mg/ml)
and 20 ul of 0.5M EDTA were further added to lml of cells and the
mix was incubated for 30 min on a rotator. For staining cells were
redistributed into 30 250 ul tubes (PCR strip tubes is a convenient
choice for that matter) with premade antibody/oligonucleotide
complexes (0.2 ug of CD45-146 complex was annealed with 1 ul of
specific oligonucleotide (147 etc) per tube 30 min at 40 C) and
incubated for 1 h with rotation. Cells were washed in (PBS, 0.1%
Triton 0.5M salt 5 mM EDTA) twice, placed on poly-lysine treated
glass coverslips, allowed to stand/attach for 10 min and further
fixed with 5 mM BS3 (7.4 mg per 4 ml) in PBS, 0.1% Triton, 0.5M
NaCl, 5 mM EDTA for 1 hour.
[0212] Staining was rendered in cycles. For odd cycles (1, 3, 5, 7,
9, 11, 13, 15) coverslips were incubated for 2 min in dG/dU mix
(150 nM dG, 150 nM dUssCy5, 150 nM dCssCy3, 25 ul NEB exo-Klenow
per ml in buffer#4 (10 mM Tris 7.5, 0.5M NaCl, 0.1%
Triton.times.100, 10 mM MgCl2)), washed twice with 405 (buffet#4
supplemented up to 0.65M NaCl); and imaged by confocal microscopy.
Following imaging the fluorophores were cleaved off cells by
incubation in 50 mM TCEP for 2 min in buffer 405E (10 mM Tris 7.5,
0.5M NaCl, 0.1% Triton.times.100, 5 mM EDTA). After cleavage cells
were washed in 405E and blocked for for 1 min in iodoacetamide
solution (FRESHLY made 100 mM iodoacetamide in buffer 405E). The
blocking solution was removed by two washes with buffer#4. Before
proceeding to next cycle cells were again imaged by confocal
microscopy. Even cycles (2, 4, 6, 8, 10, 12, 14) were performed
same as odd cycles except for substitution of dG with dA in
labeling step and extension of cleavage to 4 min at room
temperature.
Preliminary Data.
[0213] To explore the possibility of in situ staining by primer
extension expression of CD4 was visualized in mouse spleen cells in
suspension (FIG. 11) or immobilized on a slide. (FIG. 12). To
visualize the T lymphocytes spleen cells were co-stained with
conventional TcrB-Ax488 antibody. Both samples were stained with
CD4 antibody conjugated to oligonucleotide duplex as in (FIG. 11
A). No Klenow polymerase was added in control samples which results
in no separation of TcrB positive T-cells into subsets (FIG. 11 B).
When Klenow polymerase was supplied. CD4 positive T-cells could be
observed as a Cy5 positive subset of TcrB positive T-cells (FIG. 11
C and FIG. 12). Clear membrane staining pattern was observed by
confocal imaging of cells stained on-slide (FIG. 12 A). Taken
together this data shows that on-slide primer extension reaction
can be used for rendering the capture agent binding pattern
[0214] FIG. 11. Flow cytometric analysis of mouse spleen cells
stained by primer extension. Mouse spleen cells were fixed and
permeabilized with methanol as done for intracellular protein
staining Cells were co-stained with conventional TcrB-Ax488
antibody and CD4 antibody conjugated to oligonucleotide duplex as
in (A). After staining cells were either incubated in extension
buffer with dUTP-Cy5 without (B) or with (C) Klenow
exo.sup.-polymerase. Note that TcrB positive T-cells in (B) are
indicated by Ax-488 staining Dependent upon the addition of Klenow,
TcrB positive CD4 positive T-cells are seen as a Cy5 positive
subset of TcrB positive T-cells in (C).
[0215] FIG. 12. On-slide analysis of mouse spleen cells stained by
primer extension. Mouse spleen cells were fixed and permeabilized
with methanol as done for intracellular protein staining Cells were
attached to poly-Lysine coated slide and co-stained with
conventional TcrB-Ax488 antibody and CD4 antibody conjugated to
oligonucleotide duplex as in FIG. 12 A. After staining, cells were
incubated in extension buffer with dUTP-Cy5 Klenow exo.sup.-
polymerase and visualized by confocal microscopy. Shown are DIC
image in C, Cy5 channel in A, Ax488 channel in B and merged Ax488
and Cy5 channels in D. Note that only a subset of TcrB-Ax488
positive T-cells in (B) are rendered Cy5 positive CD4 positive
T-cells by primer extension as seen in (A). The membrane pattern of
CD4 points to specificity of staining by primer extension as it
takes place at a particular expected subcellular localization.
[0216] To prove the possibility of multiplexed detection of several
antigens by primer extension, the expression of CD4 and CD8 was
co-analyzed in mouse spleen cells immobilized on a slide by Method
1 and, specifically, the multiplexing approach based on "reversible
terminators". The cells were simultaneously stained by CD4 and CD8
antibodies conjugated to oligonucleotide duplexes as in (FIG. 14,
A) simultaneously. Two cycles of rendering were performed such that
CD8 was visualized in the first cycle (FIG. 14, C) and CD4 in the
second (FIG. 14, D). Cells were counterstained with TcrB-Ax488 to
delineate T-lynphocytes in the spleen cells. As expected CD4
positive cells were rendered as a subset of TcrB positive T-cells
mutually exclusive with CD8-positive subset of T-lymphocytes (FIG.
14, A-D). The data suggests that rendering antibody staining by
polymer (DNA-duplex) extension is an approach enabling sensitive
antigen detection and multiplexing.
[0217] FIG. 13. Two cycle analysis of CD4 and CD8 staining in mouse
spleen using Method 1 with reversible terminators. Mouse spleen
cells were fixed and permeabilized with methanol as done for
intracellular protein staining Cells were attached to poly-Lysine
coated slide and co-stained with conventional TcrB-Ax488 antibody
and a mixture of CD4 and CD8 antibodies conjugated to oligos as
indicated on (A). For the first cycle of staining the cells were
incubated in extension buffer with Illumina reversible terminators
and Klenow exo.sup.- polymerase and visualized by confocal
microscopy (C). Following the imaging after the first cycle, cells
were destained by Illumina cleavage buffer containing TCEP.
Following destaining-terminator reactivation, cells were again
incubated in extension buffer with Illumina reversible terminators
and Klenow exo.sup.- polymerase and visualized by confocal
microscopy (D) Note that four T-cells identified by high levels of
TcrB and marked by four white arrows on (B). It becomes evident
after the first cycle of staining that two of these cells are CD8a
positive (marked by purple arrows on (C). Second cycle of staining
reveals that the other two cells are CD4 positive (marked by green
arrows on (D). The expected mutual exclusivity of CD4 and CD8a as
well as membrane pattern of incorporated labeled nucleotide further
supports the specificity of staining by cycles of primer
extension.
[0218] The "missing base" multiplexing approach was tested on a
model of heterogeneous tissue containing multiplicity of distinct
cellular subsets (FIG. 14). To this end leukocytes from homogenized
mouse spleen were divided into 30 samples. 30 different versions of
CD45 were made by conjugating purified CD45 to common upper strand
oligonucleotide and then separately annealing 30 different lower
strand oligonucleotides designed to create overhangs that can be
sequentially rendered (two per cycle) in the multiplexed version of
"missing base approach". The samples were individually stained
(barcoded) by 30 CD45 antibody conjugates, the unbound CD45 was
washed off the barcoded samples were mixed and attached to a slide.
The staining of this mixture of pseudotyped cells was rendered by
"missing base" approach. Six first cycles (12 populations, 2 red
and green per cycle) as well as inactivation of fluorescence by
cleaving the fluorophore off the modified base by TCEP between the
cycles is shown on FIG. 15. As can be seen no same two cells are
stained in each cycle and between the cycles proving that on-cell
primer extension reliably renders the specific antibody
staining.
[0219] In order to test the performance and multiplexing capacity
of "missing base" method the following model approach was employed,
as shown in FIGS. 14 and 15. Mouse CD45 antibody was chemically
conjugated to an "upper strand" oligonucleotide (oligonucleotide
id-146). The conjugated antibody was further divided and separately
annealed (by 30 min co-incubation at 40 C) to 30 different "lower
strand" oligonucleotides--thus effectively creating 30 different
species of CD45 antibody. The 30 "lower strand" oligonucleotides
were designed in accordance with "missing base" strategy and in
addition in such a way that 2 antibodies could be rendered per
cycle using two bases (dUTP and dCTP) reversibly (through s-s
linker) coupled with distinct fluorophores (Cy5 and Cy3). 30
samples of homogenized mouse spleen have been "barcoded" with these
CD45-oligonucleotide duplex complexes such way that majority of
cells in each sample became labeled with a particular
CD45-upper/lower oligonucleotide combination. Following staining
and washing the samples were combined to mimic a tissue with 30
different cellular subsets. The mixture was smeared on a slide and
rendered by cycling staining with a "missing base" approach such
that two subsets per staining cycle were co-visualized on different
imaging channels.
Example 2
Antibody Signal Amplification In Situ with Rolling Circle
Amplification
Materials and Methods
[0220] Rat anti-mouse B220 antibody conjugate to oligonucleotide
146v2 was prepared as described. The conjugate were hybridized to a
padlock oligonucleotide
(PatgctaccgttAATTATTACTGAAACATACACTAAAGATAACATTA ttctgcaag; SEQ ID
NO:125) that is designed to form a circular hybrid on 146v2. Mouse
spleen cells were stained with either of the conjugates and then
those cells that were stained with the padlock construct were
incubated with T4 RNA ligase (NEB) in manufacturer's ligation
buffer at 37 C for 1 hour and then with phi29 polymerase and dNTP
mix for 15 minutes. Cells were washed 3 times with PBS and then
incubated with 10 nM RCA product detection oligonucleotide
(TGAAACATACACTAAAGA; SEQ ID NO:126) for 10 minutes. After that,
cells were incubated with fluorescent dUTP-Cy5 (Jena Biosciences)
was incorporated into the cells b incubating with 200 nM dUTP-Cy5
in buffer#4 and 1 ul of exo- Klenow polymerase (Thermo Scientific).
An aliquot of cells was left out and not subject to the rolling
circle amplification (RCA) step and then used as a reference to
assess the effect of RCA on staining.
Results
[0221] The efficiency of rolling circle amplification of
multiplexing DNA barcode attached to the antibody for enhancing
antibody staining was tested. A special antibody-DNA conjugate
based on anti-B220 antibody that contained a circularized `padlock`
oligonucleotide annealed to the linker (146v2) oligonucleotide
hybrid was assembled and mouse cells were stained with it. After
staining, the padlock oligonucleotide was ligated with T4 ligase
and amplified using the rolling circle protocol with phi29
polymerase, resulting in a long repetitive DNA stretch attached to
each antibody that contained the repetitive sequence complementary
to the detection primer. After annealing of the primer, multiple
molecules of dUTP-Cy5 could be incorporated into the amplified DNA
molecule, due to its repetitive nature. FIG. 16 panels A-E
schematically illustrate this method. FIG. 16 panels F-G shows that
the cells staining with the rolling circle amplification is much
stronger than without it.
Example 3
Co-Detecting 22 Antigens on Dispersed Spleen Cells
Materials and Methods
[0222] Antibody conjugates were prepared using the following
protocol. Antibodies were subject to partial reduction of disulfide
by 30 min incubation at room temperature with TCEP (final
concentration 1 mM) in PBS pH 7.4. The antibodies were purified
from TCEP by buffer exchange on BioGel P-30 spin-columns saturated
with conjugation buffer (PBS pH 7.0). Oligonucleotide 146v2
(5'Maleimide-ATAGCAGTCCAGCCGAACGGTA GCATCTTGCAGAA; SEQ ID NO:127)
bearing a protected maleimide group were ordered from Trilink Inc.
To prepare for covalent crosslinking to antibodies per instruction
from manufacturer the maleimide group residing on an
oligonucleotide was de-protected/activated by Adler reaction (4 h
at 90 C in toluene). Toluene was removed from the oligonucleotide
by several washes in absolute ethanol. Activated oligonucleotides
were dissolved in conjugation buffer and mixed with reduced
antibodies at a molar ratio of 50:1. Sodium Chloride was added to
conjugation reaction to final concentration of 1M. Conjugation
reaction was allowed to proceed for 1 h. To remove the unbound
oligonucleotide the conjugated antibodies were filtered 4 times on
molecular weight cutoff filters (Amicon 50KDa). Final wash and
storage were performed in phosphate buffer with 0.5M sodium
chloride and 0.1% Tween-20.
[0223] To assemble DNA duplex tag 0.2 ug of conjugated antibodies
was mixed with 100 pmoles of bottom strand oligonucleotide in
phosphate buffer with 0.6M Sodium Chloride and incubated for 30 min
at 40.degree. C.
TABLE-US-00002 v2_C_cycle1 SEQ ID NO: 128:
TTTTGTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle2 SEQ ID NO: 129:
TTTTGtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle3 SEQ ID NO: 130:
TTTTGCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle4 SEQ ID NO: 131:
TTTTGTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle5 SEQ ID NO: 132:
TTTTGCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle6 SEQ ID NO: 133:
TTTTGtttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle7 SEQ ID NO: 134:
TTTTGcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle8 (SEQ ID NO:
135) TTTTGttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle9 (SEQ ID
NO: 136) TTTTGcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_C_cycle10
(SEQ ID NO: 137) TTTTGtcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz
v2_C_cycle11 (SEQ ID NO: 138)
TTTTGcctcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle1 SEQ ID
NO: 139: TTTTATTCTGCAAGATGCTACCGTTCGGz v2_U_cycle2 SEQ ID NO: 140:
TTTTAtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle3 SEQ ID NO: 141:
TTTTACtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle4 SEQ ID NO: 142:
TTTTATCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle5 SEQ ID NO: 143:
TTTTACcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle6 SEQ ID NO: 144:
TTTTAtttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle7 SEQ ID NO: 145:
TTTTAcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle8 (SEQ ID NO:
146) TTTTAttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle9 (SEQ ID
NO: 147) TTTTActtcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz v2_U_cycle10
(SEQ ID NO: 148) TTTTAtcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz
v2_U_cycle11 (SEQ ID NO: 149)
TTTTAcctcttcctttCcTCtTTCTGCAAGATGCTACCGTTCGGz
[0224] Mouse spleen and bone marrow cells were prepared according
to standard procedure and fixed in 2% formaldehyde for 10 min at
room temperature. Following fixation, cells were spun and either
stored frozen at -80 in PBS with 5% DMSO or permeabilized by
incubation in ice-cold methanol for 10 min. and further stored at
-80.degree. C. in methanol.
[0225] Before staining stored cells were washed with SM (0.5% BSA
in PBS, 5mMEDTA) once and blocked for 30 min at room temperature in
staining buffer (0.6M NaCl, 0.5% BSA, 50 ug/ml rat IgG, 200 ug/ml
ssDNA, 5mMEDTA, 3 nmoles per ml of blocking oligonucleotide
TTTTccctctcctcttcctttCcTCt-ddC in phosphate buffer pH 7.4). In case
frozen sections were used--tissue sections were picked by warm
coverslips and immediately placed into dry ice without allowing the
section to dry. Coverslips with sections were dipped for 30 sec
into ethanol pre-chilled to dry-ice temperature, and transferred to
SME with 4% formaldehyde for 20 min. After that the fixed sections
were washed twice in SM and further blocked in staining buffer for
30 min. Mouse spleen cells were stained in staining buffer for 2-3
h at room temperature with a mixture of conjugated antibodies taken
at 0.2 ug of each antibody per 100 ul of solution. After staining
cells were washed twice with SM05 (SM supplemented with NaCl up to
0.65M final concentration), then were allowed to adhere to
poly-L-lysin coated coverslips and further fixed to coverslip
surface by 20 min incubation with 5 mM BS3 crosslinker in PBS.
Following methanol fixation/permeabilization cells were washed once
with SM05, allowed to adhere to coverslip surface and further fixed
to coverslip surface by 20 min incubation with 5 mM BS3 crosslinker
in PBS. If frozen sections were used--following staining sections
were washed twice by SM05 and fixed by 20 min incubation with 5 mM
BS3 crosslinker in PBS. Following staining procedure and converting
into planar form (in case of suspension cells) all kinds of samples
were subjected to similar ABseq rendering protocol.
[0226] Coverslips with cells were washed twice with buffer 4 (10 mM
Tris pH 6.5, 10 mM MgCl2, 150 mM NaCl, 0.1% Triton.times.100).
[0227] Staining was rendered by iterative incubation with
polymerase reaction mixes. In odd cycles (1, 3, 5 . . . )--cells
were incubated for 2 min in G-mix (150 nM dG, 150 nM dUssCy5, 150
nM dCssCy3, 25 ul NEB exo- Klenow per ml in buffer 4); wash 3 times
with 405 (buffet 4 without MgCl and supplemented with NaCl up to
final 0.65M); photographed; incubated 2 min in 50 mM TCEP in buffer
405; washed twice with 405; photographed; incubated for 1 min in
freshly made 100 mM iodoacetamide in buffer 405; washed three times
with buffer 4. In even cycles (2, 4, 6 . . . )--cells were
incubated for 2 min in A--mix (150 nM dATP, 150 nM dUTPssCy5, 150
nM dCTPssCy3, 25 ul NEB exo- Klenow per ml in buffer 4); wash 3
times with 405 (buffet 4 without MgCl and supplemented with NaCl up
to final 0.65M); photographed; incubated 4 min in 50 mM TCEP in
buffer 405; washed twice with 405; photographed; incubated for 1
min in freshly made 100 mM iodoacetamide in buffer 405; washed
three times with buffer #4. Reversibly labelled fluorescent
nucleotide triphosphates were custom synthesized by Jena
Bioscience.
Results
[0228] ABseq was used to explore the variety of cellular subsets in
mouse spleen and bone marrow using 22-antibody panel. Isolated
spleen and bone marrow cells were barcoded by whole cell staining
with NHS-PacBlu and NHS-Ax-488 dyes, mixed, stained with a panel of
22 antibodies tagged with DNA duplexes, attached to slide and
rendered by ABseq in 11 primer extension and imaging iterations
(FIG. 17). Conspicuously 22-color marker expression data on
pseudocolored image bearing all marker expressing data proved to be
impossible to parse visually due to proximity of colors in
multi-color palette (FIG. 17, bottom right panel).
Example 4
Multipanel Design with Spacers
Materials and Methods
[0229] Antibody conjugation, cell staining and rendering was
performed following the same experimental procedures as in section
4 (Co-detecting 22 antigens on dispersed spleen cells). Nine
aliquots of spleen cells were stained separately with a different
CD45 antibody-DNA conjugate. Conjugates for each panel were formed
in the following way.
TABLE-US-00003 Panel1: CD45 conjugated to 146v2 (5'Maleimide-
ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA (SEQ ID NO: 174) and forming a
DNA duplex with: (SEQ ID NO: 150) 1.
TTTTATTCTGCAAGATGCTACCGTTCGG-dideoxyC (SEQ ID NO: 151) 2.
TTTTAtTTCTGCAAGATGCTACCGTTCGGz-dideoxyC (SEQ ID NO: 152) 3.
TTTTACtTTCTGCAAGATGCTACCGTTCGGz-dideoxyC Panel2 CD45 conjugated to
146v2-ddC(5'Maleimide-
ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA-dideoxyC) (SEQ ID NO: 153) and
forming a DNA duplex with: (SEQ ID NO: 154) 4.
TTTTAGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCGG- dideoxyC (SEQ ID NO:
155) 5. TTTTAtGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCGG z-dideoxyC
(SEQ ID NO: 156) 6. TTTTACtGCGATTAAGCGTGAACTTCTGCAAGATGCTACCGTTCG
Gz-dideoxyC Panel3 CD45 conjugated to 146v2-ddC(5'Maleimide-
ATAGCAGTCCAGCCGAACGGTAGCATCTTGCAGAA-dideoxyC) (SEQ ID NO: 157) and
forming a DNA duplex with: (SEQ ID NO: 158) 7.
TTTTACGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCGG- dideoxyC (SEQ ID NO:
159) 8. TTTTAtCGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCGG z-dideoxyC
(SEQ ID NO: 160) 9. TTTTACtCGCTAATTCGCACTTGTTCTGCAAGATGCTACCGTTCG
Gz-dideoxyC
[0230] After staining the cells were washed with washed twice with
buffer 4 (10 mM Tris pH 6.5, 10 mM MgCl2, 150 mM NaCl, 0.1%
Triton.times.100) to remove unbound antibody-DNA conjugates and
then the aliquots of cells were mixed together and attached to a
lysine-coated coverslip. Antigen staining was rendered in the
following sequence of incubations:
dGTP+dUTP-Cy5->dATP+dUTP-Cy5->dGTP+dUTP-Cy5->Incubation
with luM spacer1 (GTTCACGCTTAATCGC; SEQ ID NO:161) in buffer#4 for
20
minutes->dGTP+dUTP-Cy5->dATP+dUTP-Cy5->dGTP+dUTP-Cy5->Incubat-
ion with luM spacer2 (CGCTAATTCGCACTTG; SEQ ID NO:162) in buffer#4
for 20
minutes->dGTP+dUTP-Cy5->dATP+dUTP-Cy5->dGTP+dUTP-Cy5.
Imaging, fluorophore inactivation with 50 mM TCEP pH 7.0 and
background blocking with iodoacetamide were performed after each
step of rendering.
Results
[0231] Due to polymerase misincorporation errors the signal
intensity of rendering by ABseq is expected to fall with increasing
cycle numbers as observed in other studies on development of deep
sequencing protocols utilizing sequential addition of individual
nucleotides. To circumvent that and to avoid the use of extensively
long DNA fragments linked to antibody the following amendment to
the design was tested (FIG. 18, panel A). Large antibody panels can
be split into subpanels such that the extension reaction on these
subpanels is precluded by termination of the upper strand
oligonucleotide with ddC, propyl or any other 3' terminating group.
After finishing the extension of each subpanel, the next subpanel
is activated by in situ hybridization of a short "activation"
spacer, which does not bear any terminating moiety on its 3' end
and thus initiates the consecutive cycles of primer extensions.
This design was tested experimentally on 3 sequential 3-cycle
panels (9 extension cycles in total) (FIG. 18, panel B). Image
quantification showed no significant reduction of ABseq rendering
efficiency associated with on-slide hybridization of panel
activating spacer oligonucleotide was observed and no signal
carryover between the individual panels (FIG. 18, panel C).
Example 5
Multiplexed Single Molecule RNA Detection
Materials and Methods
[0232] NALM and Jurkat cell lines were grown to a density of 1
million/ml, fixed with 1.6% formaldehyde for 10 minutes and then
transferred to ice-cold methanol. An aliquot of 200K cells was
washed with PBSTR (PBS, 0.1% Tween-20 and 1:1000 Rnasin) and
transferred to a hybridization buffer (1.times.SSC, 10% formamide,
10% vanadyl-ribonucleotide complex, 10% polyvinylsulfonic acid).
DNA probe mixture was added to the final concentration of 100 nM
and incubated at 40 C for 1 hour. Cells were washed 2 times with
PBSTR at room temperature for 5 minutes and 2 times with a high
salt buffer (4.times.SSC in PBSTR) at 40 degrees for 20 minutes,
once again washed with PBSTR and transferred to a ligation solution
(0.1 ul T4 DNA ligase (New England Biosciences), 5 ul 10.times. T4
ligase buffer (New England Biosciences), 45 ul H2O). Ligation
proceeded for 1 h at 37 C. Then cells were transferred to
amplification solution (1 ul of phi29 polymerase (Thermo
Scientific), 5 ul of 10.times. polymerase buffer (Thermo
Scientific), 1 ul of 10 mM dNTP mix, 43 ul of H2O) and incubated at
30 C for 1 h. Cells were washed with PBSTR and incubated with 1 mM
"RCA detection" oligonucleotide for 10 minutes at 37 C and
transferred to Sequencing buffer (10 mM Tris pH 7.5, 10 mM MgCl2,
150 mM NaCl, 0.1% Triton.times.100, 1:50 Klenow polymerase (Thermo
Scientific), 200 mM dUTP-Cy5 (Jena Biosciences)). Cells were washed
twice with high salt wash buffer (10 mM Tris pH 7.5, 10 mM MgCl2,
650 mM NaCl, 0.1% Triton.times.100) and imaged using a florescent
microscope.
TABLE-US-00004 HLA-DR padlock1 (SEQ ID NO: 163)
PACATTAaaatcctagcacagggactcAATTATTACTGAAACATACACTA AAGATApa HLA-DR
splint-primer1 (SEQ ID NO: 164) ctcatcagcacagctatgatgaTAATGTTATCTT
HLA-DR padlock2 (SEQ ID NO: 165)
PACATTAtagaactcggcctggatgatAATTATTACTGAAACATACACTA AAGATA HLA-DR
splint-primer2 (SEQ ID NO: 166) ctgattggtcaggattcagaTAATGTTATCTT
HLA-DR padlock3 (SEQ ID NO: 167)
PACATTAtcaaagctggcaaatcgtccAATTATTACTGAAACATACACTA AAGATA HLA-DR
splint-primer2 (SEQ ID NO: 168) tggccaatgcaccttgagccTAATGTTATCTT
HLA-DR padlock4 (SEQ ID NO: 169)
PACATTAtgatttccaggttggctttgAATTATTACTGAAACATACACTA AAGATA HLA-DR
splint-primer2 (SEQ ID NO: 170) atagttggagcgctttgtcaTAATGTTATCTT
HLA-DR padlock5 (SEQ ID NO: 171)
PACATTAtttcgaagccacgtgacattAATTATTACTGAAACATACACTA AAGATA HLA-DR
splint-primer2 (SEQ ID NO: 172) ctgtggtgacaggttttccaTAATGTTATCTT
RCA detect (SEQ ID NO: 173) CATACACTAAAGATAACAT
Results
[0233] An on-slide primer extension protocol was applied to detect
single molecules of human HLADRA mRNA in NALM pro-B-cell line.
Jurkat T-cell lymphoma line was used as a negative control to
assess the background. In order to enable single molecule mRNA
detection, a signal amplification system was designed based on
proximity ligation and rolling circle amplification (RCA). Five
pairs of probes were designed in a way that the two oligos of each
pair were complementary to directly adjacent 20-nt stretches of
HLADRA mRNA and that the 3' region of the upstream oligonucleotide
served as a splint for circularization of the downstream padlock
oligonucleotide (FIG. 19, A) and also as a primer for the rolling
circle amplification. After the complex assembly the cells were
washed and treated with T4 DNA ligase to circularize the padlock
oligonucleotide and the incubated with phi29 polymerase and dNTP
mix to carry out the rolling circle amplification (FIG. 19, B).
Amplification products were incubated with "RCA detect"
oligonucleotide (FIG. 19, C) and then fluorescent dUTP-Cy5 was
incorporated by a single base extension with Klenow polymerase
(FIG. 19, D). Cells were washed and imaged with a fluorescent
microscope. Images of NALM cells that express HLADR show abundant
punctate staining in the cytoplasm that corresponds to the RCA
products (FIG. 19, E) and the Jurkat cells that are negative for
HLADR show very few puncta (FIG. 19, F), demonstrating the high
specificity of the proximity ligation-based detection of HLADRA
mRNA.
Sequence CWU 1
1
174113DNAArtificial SequenceSynthetic oligonucleotide 1naaanaaana
aan 13213DNAArtificial SequenceSynthetic oligonucleotide
2atttatttat tta 13311DNAArtificial SequenceSynthetic
oligonucleotide 3naacnaacaa n 11413DNAArtificial SequenceSynthetic
oligonucleotide 4attgttattg tta 13542DNAArtificial
SequenceSynthetic oligonucleotide 5ttctaggggg ggggggggtc gtcaagatgc
taccgttcag gc 42634DNAArtificial SequenceSynthetic oligonucleotide
6atagcgctac cctgaacggt agcatcttga cgac 34742DNAArtificial
SequenceSynthetic oligonucleotide 7ttctaacgat ctagtcggtc gtcaagatgc
taccgttcag gc 42835DNAArtificial SequenceSynthetic oligonucleotide
8atagcgctac gcctgaacgg tagcatcttg acgac 35941DNAArtificial
SequenceSynthetic oligonucleotide 9ttctactctc tctctctgtc gtcaagatgc
taccgttcag g 411035DNAArtificial SequenceSynthetic oligonucleotide
10atagcgctac gcctgaacgg tagcatcttg acgac 351141DNAArtificial
SequenceSynthetic oligonucleotide 11ttctactcct ttcctctgtc
gtcaagatgc taccgttcag g 411235DNAArtificial SequenceSynthetic
oligonucleotide 12atagcgctac gcctgaacgg tagcatcttg acgac
351335DNAArtificial SequenceSynthetic oligonucleotide 13atagcgctac
gcctgaacgg tagcatcttg acgac 351452DNAArtificial SequenceSynthetic
oligonucleotide 14tttttannnn nnnnnnnnnn nnnnnnngtc gtcaagatgc
taccgttcag gc 521535DNAArtificial SequenceSynthetic oligonucleotide
15atagcgctac gcctgaacgg tagcatcttg acgac 351653DNAArtificial
SequenceSynthetic oligonucleotide 16tttttacnnn nnnnnnnnnn
nnnnnnnngt cgtcaagatg ctaccgttca ggc 531735DNAArtificial
SequenceSynthetic oligonucleotide 17atagcgctac gcctgaacgg
tagcatcttg acgac 351854DNAArtificial SequenceSynthetic
oligonucleotide 18tttttactnn nnnnnnnnnn nnnnnnnnng tcgtcaagat
gctaccgttc aggc 541935DNAArtificial SequenceSynthetic
oligonucleotide 19atagcgctac gcctgaacgg tagcatcttg acgac
352052DNAArtificial SequenceSynthetic oligonucleotide 20tttttannnn
nnnnnnnnnn nnnnnnngtc gtcaagatgc taccgttcag gc 522135DNAArtificial
SequenceSynthetic oligonucleotide 21atagcgctac gcctgaacgg
tagcatcttg acgac 352253DNAArtificial SequenceSynthetic
oligonucleotide 22tttttacnnn nnnnnnnnnn nnnnnnnngt cgtcaagatg
ctaccgttca ggc 532335DNAArtificial SequenceSynthetic
oligonucleotide 23atagcgctac gcctgaacgg tagcatcttg acgac
352454DNAArtificial SequenceSynthetic oligonucleotide 24tttttactnn
nnnnnnnnnn nnnnnnnnng tcgtcaagat gctaccgttc aggc
542535DNAArtificial SequenceSynthetic oligonucleotide 25atagcgctac
gcctgaacgg tagcatcttg acgac 352652DNAArtificial SequenceSynthetic
oligonucleotide 26tttttannnn nnnnnnnnnn nnnnnnngtc gtcaagatgc
taccgttcag gc 522735DNAArtificial SequenceSynthetic oligonucleotide
27atagcgctac gcctgaacgg tagcatcttg acgac 352853DNAArtificial
SequenceSynthetic oligonucleotide 28tttttacnnn nnnnnnnnnn
nnnnnnnngt cgtcaagatg ctaccgttca ggc 532935DNAArtificial
SequenceSynthetic oligonucleotide 29atagcgctac gcctgaacgg
tagcatcttg acgac 353054DNAArtificial SequenceSynthetic
oligonucleotide 30tttttactnn nnnnnnnnnn nnnnnnnnng tcgtcaagat
gctaccgttc aggc 543124DNAArtificial SequenceSynthetic
oligonucleotide 31cctgaacggt agcatcttga cgac 243219DNAArtificial
SequenceSynthetic oligonucleotide 32aaaaaaaaac gcggcccgg
193344DNAArtificial SequenceSynthetic oligonucleotide 33ccgggccgcg
ttttttttta gtcgtcaaga tgctaccgtt cagg 443444DNAArtificial
SequenceSynthetic oligonucleotide 34cctgaacggt agcatcttga
cgactaaaaa aaaacgcggc ccgg 443544DNAArtificial SequenceSynthetic
oligonucleotide 35ccgggccgcg ttttttttta gtcgtcaaga tgctaccgtt cagg
443624DNAArtificial SequenceSynthetic oligonucleotide 36cctgaacggt
agcatcttga cgac 243719DNAArtificial SequenceSynthetic
oligonucleotide 37aaaaaaaaac gcggcccgg 193844DNAArtificial
SequenceSynthetic oligonucleotide 38ccgggccgcg ttttttttta
gtcgtcaaga tgctaccgtt cagg 443924DNAArtificial SequenceSynthetic
oligonucleotide 39cctgaacggt agcatcttga cgac 244019DNAArtificial
SequenceSynthetic oligonucleotide 40aaaaaaaaac gcggcccgg
194145DNAArtificial SequenceSynthetic oligonucleotide 41ccgggccgcg
ttttttttta cgtcgtcaag atgctaccgt tcagg 454224DNAArtificial
SequenceSynthetic oligonucleotide 42cctgaacggt agcatcttga cgac
244319DNAArtificial SequenceSynthetic oligonucleotide 43aaaaaaaaac
gcggcccgg 194446DNAArtificial SequenceSynthetic oligonucleotide
44ccgggccgcg tttttttttc aggtcgtcaa gatgctaccg ttcagg
464544DNAArtificial SequenceSynthetic oligonucleotide 45cctgaacggt
agcatcttga cgactaaaaa aaaacgcggc ccgg 444644DNAArtificial
SequenceSynthetic oligonucleotide 46ccgggccgcg ttttttttta
gtcgtcaaga tgctaccgtt cagg 444724DNAArtificial SequenceSynthetic
oligonucleotide 47cctgaacggt agcatcttga cgac 244819DNAArtificial
SequenceSynthetic oligonucleotide 48aaaaaaaaac gcggcccgg
194945DNAArtificial SequenceSynthetic oligonucleotide 49ccgggccgcg
ttttttttta cgtcgtcaag atgctaccgt tcagg 455024DNAArtificial
SequenceSynthetic oligonucleotide 50cctgaacggt agcatcttga cgac
245119DNAArtificial SequenceSynthetic oligonucleotide 51aaaaaaaaac
gcggcccgg 195246DNAArtificial SequenceSynthetic oligonucleotide
52ccgggccgcg tttttttttc aggtcgtcaa gatgctaccg ttcagg
465344DNAArtificial SequenceSynthetic oligonucleotide 53cctgaacggt
agcatcttga cgactaaaaa aaaacgcggc ccgg 445444DNAArtificial
SequenceSynthetic oligonucleotide 54ccgggccgcg ttttttttta
gtcgtcaaga tgctaccgtt cagg 445525DNAArtificial SequenceSynthetic
oligonucleotide 55cctgaacggt agcatcttga cgacg 255619DNAArtificial
SequenceSynthetic oligonucleotide 56aaaaaaaaac gcggcccgg
195745DNAArtificial SequenceSynthetic oligonucleotide 57ccgggccgcg
ttttttttta cgtcgtcaag atgctaccgt tcagg 455825DNAArtificial
SequenceSynthetic oligonucleotide 58cctgaacggt agcatcttga cgacc
255919DNAArtificial SequenceSynthetic oligonucleotide 59aaaaaaaaac
gcggcccgg 196046DNAArtificial SequenceSynthetic oligonucleotide
60ccgggccgcg tttttttttc aggtcgtcaa gatgctaccg ttcagg
466144DNAArtificial SequenceSynthetic oligonucleotide 61cctgaacggt
agcatcttga cgactaaaaa aaaacgcggc ccgg 446244DNAArtificial
SequenceSynthetic oligonucleotide 62ccgggccgcg ttttttttta
gtcgtcaaga tgctaccgtt cagg 446345DNAArtificial SequenceSynthetic
oligonucleotide 63cctgaacggt agcatcttga cgacgtaaaa aaaaacgcgg cccgg
456445DNAArtificial SequenceSynthetic oligonucleotide 64ccgggccgcg
ttttttttta cgtcgtcaag atgctaccgt tcagg 456526DNAArtificial
SequenceSynthetic oligonucleotide 65cctgaacggt agcatcttga cgacct
266619DNAArtificial SequenceSynthetic oligonucleotide 66aaaaaaaaac
gcggcccgg 196746DNAArtificial SequenceSynthetic oligonucleotide
67ccgggccgcg tttttttttc aggtcgtcaa gatgctaccg ttcagg
466834DNAArtificial SequenceSynthetic oligonucleotide 68atagagcgag
ccagtgctag ggtgagtggc caag 346934DNAArtificial SequenceSynthetic
oligonucleotide 69atagagcgag ccagtgctag ggtgagtggc caag
347016DNAArtificial SequenceSynthetic oligonucleotide 70gcactggctc
gctcta 167134DNAArtificial SequenceSynthetic oligonucleotide
71atagagcgag ccagtgctag ggtgagtggc caag 347217DNAArtificial
SequenceSynthetic oligonucleotide 72gcactggctc gctctan
177334DNAArtificial SequenceSynthetic oligonucleotide 73atagagcgag
ccagtgctag ggtgagtggc caag 34748DNAArtificial SequenceSynthetic
oligonucleotide 74gcactggc 8 7535DNAArtificial SequenceSynthetic
oligonucleotide 75catagagcga gccagtgcta gggtgagtgg ccaag
357617DNAArtificial SequenceSynthetic oligonucleotide 76gcactggctc
gctctan 177735DNAArtificial SequenceSynthetic oligonucleotide
77caatgtccag gccagtgcta gggtgagtgg ccaag 357816DNAArtificial
SequenceSynthetic oligonucleotide 78gcactggctc gctcta
167935DNAArtificial SequenceSynthetic oligonucleotide 79caagtcagtg
accagtgcta gggtgagtgg ccaag 358016DNAArtificial SequenceSynthetic
oligonucleotide 80gcactggctc gctcta 168135DNAArtificial
SequenceSynthetic oligonucleotide 81acgtacgctc gtgccgcnnn
nnnnnnnnnn nnnnn 358217DNAArtificial SequenceSynthetic
oligonucleotide 82gcggcacgag cgtacgn 178335DNAArtificial
SequenceSynthetic oligonucleotide 83acctgcgctc gtgccgcnnn
nnnnnnnnnn nnnnn 358416DNAArtificial SequenceSynthetic
oligonucleotide 84gcggcacgag cgtacg 168535DNAArtificial
SequenceSynthetic oligonucleotide 85agcatcgctc gtgccgcnnn
nnnnnnnnnn nnnnn 358616DNAArtificial SequenceSynthetic
oligonucleotide 86gcggcacgag cgtacg 168750DNAArtificial
SequenceSynthetic oligonucleotide 87gaaccggtga gtgggatagc
gctacgcctg aacggtagca tcttgacgac 508831DNAArtificial
SequenceSynthetic oligonucleotide 88tttttagtcg tcaagatgct
accgttcagg c 318924DNAArtificial SequenceSynthetic oligonucleotide
89cctgaacggt agcatcttga cgac 249031DNAArtificial SequenceSynthetic
oligonucleotide 90tttttagtcg tcaagatgct accgttcagg c
319124DNAArtificial SequenceSynthetic oligonucleotide 91cctgaacggt
agcatcttga cgac 249232DNAArtificial SequenceSynthetic
oligonucleotide 92tttttatgtc gtcaagatgc taccgttcag gc
329324DNAArtificial sequenceSynthetic oligonucleotide 93cctgaacggt
agcatcttga cgac 249426DNAArtificial sequenceSynthetic
oligonucleotide 94atgcacgtcg tcaagatgct accgtt 269524DNAArtificial
sequenceSynthetic oligonucleotide 95cctgaacggt agcatcttga cgac
249627DNAArtificial sequenceSynthetic oligonucleotide 96atgcatcgtc
gtcaagatgc taccgtt 279725DNAArtificial sequenceSynthetic
oligonucleotide 97cctgaacggt agcatcttga cgacg 259826DNAArtificial
sequenceSynthetic oligonucleotide 98atgcacgtcg tcaagatgct accgtt
269925DNAArtificial sequenceSynthetic oligonucleotide 99cctgaacggt
agcatcttga cgacg 2510027DNAArtificial sequenceSynthetic
oligonucleotide 100atgcatcgtc gtcaagatgc taccgtt
2710130DNAArtificial sequenceSynthetic oligonucleotide
101cctgaacggt agcatcttga cgacgtgcat 3010226DNAArtificial
sequenceSynthetic oligonucleotide 102atgcacgtcg tcaagatgct accgtt
2610330DNAArtificial sequenceSynthetic oligonucleotide
103cctgaacggt agcatcttga cgacgtgcat 3010427DNAArtificial
sequenceSynthetic oligonucleotide 104atgcatcgtc gtcaagatgc taccgtt
2710530DNAArtificial sequenceSynthetic oligonucleotide
105cctgaacggt agcatcttga cgacgtgcat 3010626DNAArtificial
sequenceSynthetic oligonucleotide 106atgcacgtcg tcaagatgct accgtt
2610725DNAArtificial sequenceSynthetic oligonucleotide
107cctgaacggt agcatcttga cgacg 2510827DNAArtificial
sequenceSynthetic oligonucleotide 108atgcatcgtc gtcaagatgc taccgtt
2710929DNAArtificial sequenceSynthetic oligonucleotide
109cctgaacggt agcatcttga cgactgcat 2911026DNAArtificial
sequenceSynthetic oligonucleotide 110atgcacgtcg tcaagatgct accgtt
2611125DNAArtificial sequenceSynthetic oligonucleotide
111cctgaacggt agcatcttga cgacg 2511227DNAArtificial
sequenceSynthetic oligonucleotide 112atgcatcgtc gtcaagatgc taccgtt
2711330DNAArtificial sequenceSynthetic oligonucleotide
113cctgaacggt agcatcttga cgacgtgcat 3011426DNAArtificial
sequenceSynthetic oligonucleotide 114atgcacgtcg tcaagatgct accgtt
2611526DNAArtificial sequenceSynthetic oligonucleotide
115cctgaacggt agcatcttga cgacga 2611627DNAArtificial
sequenceSynthetic oligonucleotide 116atgcatcgtc gtcaagatgc taccgtt
2711730DNAArtificial sequenceSynthetic oligonucleotide
117cctgaacggt agcatcttga cgacgtgcat 3011826DNAArtificial
sequenceSynthetic oligonucleotide 118atgcacgtcg tcaagatgct accgtt
2611931DNAArtificial sequenceSynthetic oligonucleotide
119cctgaacggt agcatcttga cgacgatgca t 3112027DNAArtificial
sequenceSynthetic oligonucleotide 120atgcatcgtc gtcaagatgc taccgtt
2712130DNAArtificial sequenceSynthetic oligonucleotide
121cctgaacggt agcatcttga cgacgtgcat 3012226DNAArtificial
sequenceSynthetic oligonucleotide 122atgcacgtcg tcaagatgct accgtt
2612331DNAArtificial sequenceSynthetic oligonucleotide
123cctgaacggt agcatcttga cgacgatgca t 3112427DNAArtificial
sequenceSynthetic oligonucleotide 124atgcatcgtc gtcaagatgc taccgtt
2712555DNAArtificial sequenceSynthetic oligonucleotide
125atgctaccgt taattattac tgaaacatac actaaagata acattattct gcaag
5512618DNAArtificial sequenceSynthetic oligonucleotide
126tgaaacatac actaaaga 1812713DNAArtificial sequenceSynthetic
oligonucleotide 127gcatcttgca gaa 1312828DNAArtificial
sequenceSynthetic oligonucleotide 128ttttgttctg caagatgcta
ccgttcgg
2812929DNAArtificial sequenceSynthetic oligonucleotide
129ttttgtttct gcaagatgct accgttcgg 2913030DNAArtificial
sequenceSynthetic oligonucleotide 130ttttgctttc tgcaagatgc
taccgttcgg 3013131DNAArtificial sequenceSynthetic oligonucleotide
131ttttgtcttt ctgcaagatg ctaccgttcg g 3113233DNAArtificial
sequenceSynthetic oligonucleotide 132ttttgcctct ttctgcaaga
tgctaccgtt cgg 3313336DNAArtificial sequenceSynthetic
oligonucleotide 133ttttgtttcc tctttctgca agatgctacc gttcgg
3613438DNAArtificial sequenceSynthetic oligonucleotide
134ttttgccttt cctctttctg caagatgcta ccgttcgg 3813540DNAArtificial
sequenceSynthetic oligonucleotide 135ttttgttcct ttcctctttc
tgcaagatgc taccgttcgg 4013641DNAArtificial sequenceSynthetic
oligonucleotide 136ttttgcttcc tttcctcttt ctgcaagatg ctaccgttcg g
4113742DNAArtificial sequenceSynthetic oligonucleotide
137ttttgtcttc ctttcctctt tctgcaagat gctaccgttc gg
4213844DNAArtificial sequenceSynthetic oligonucleotide
138ttttgcctct tcctttcctc tttctgcaag atgctaccgt tcgg
4413928DNAArtificial sequenceSynthetic oligonucleotide
139ttttattctg caagatgcta ccgttcgg 2814029DNAArtificial
sequenceSynthetic oligonucleotide 140ttttatttct gcaagatgct
accgttcgg 2914130DNAArtificial sequenceSynthetic oligonucleotide
141ttttactttc tgcaagatgc taccgttcgg 3014231DNAArtificial
sequenceSynthetic oligonucleotide 142ttttatcttt ctgcaagatg
ctaccgttcg g 3114333DNAArtificial sequenceSynthetic oligonucleotide
143ttttacctct ttctgcaaga tgctaccgtt cgg 3314436DNAArtificial
sequenceSynthetic oligonucleotide 144ttttatttcc tctttctgca
agatgctacc gttcgg 3614538DNAArtificial sequenceSynthetic
oligonucleotide 145ttttaccttt cctctttctg caagatgcta ccgttcgg
3814640DNAArtificial sequenceSynthetic oligonucleotide
146ttttattcct ttcctctttc tgcaagatgc taccgttcgg 4014741DNAArtificial
sequenceSynthetic oligonucleotide 147ttttacttcc tttcctcttt
ctgcaagatg ctaccgttcg g 4114842DNAArtificial sequenceSynthetic
oligonucleotide 148ttttatcttc ctttcctctt tctgcaagat gctaccgttc gg
4214944DNAArtificial sequenceSynthetic oligonucleotide
149ttttacctct tcctttcctc tttctgcaag atgctaccgt tcgg
4415029DNAArtificial sequenceSynthetic oligonucleotide
150ttttattctg caagatgcta ccgttcggn 2915130DNAArtificial
sequenceSynthetic oligonucleotide 151ttttatttct gcaagatgct
accgttcggn 3015231DNAArtificial sequenceSynthetic oligonucleotide
152ttttactttc tgcaagatgc taccgttcgg n 3115336DNAArtificial
sequenceSynthetic oligonucleotide 153atagcagtcc agccgaacgg
tagcatcttg cagaan 3615445DNAArtificial sequenceSynthetic
oligonucleotide 154ttttagcgat taagcgtgaa cttctgcaag atgctaccgt
tcggn 4515546DNAArtificial sequenceSynthetic oligonucleotide
155ttttatgcga ttaagcgtga acttctgcaa gatgctaccg ttcggn
4615647DNAArtificial sequenceSynthetic oligonucleotide
156ttttactgcg attaagcgtg aacttctgca agatgctacc gttcggn
4715736DNAArtificial sequenceSynthetic oligonucleotide
157atagcagtcc agccgaacgg tagcatcttg cagaan 3615845DNAArtificial
sequenceSynthetic oligonucleotide 158ttttacgcta attcgcactt
gttctgcaag atgctaccgt tcggn 4515946DNAArtificial sequenceSynthetic
oligonucleotide 159ttttatcgct aattcgcact tgttctgcaa gatgctaccg
ttcggn 4616047DNAArtificial sequenceSynthetic oligonucleotide
160ttttactcgc taattcgcac ttgttctgca agatgctacc gttcggn
4716116DNAArtificial sequenceSynthetic oligonucleotide
161gttcacgctt aatcgc 1616216DNAArtificial sequenceSynthetic
oligonucleotide 162cgctaattcg cacttg 1616355DNAArtificial
sequenceSynthetic oligonucleotide 163acattaaaat cctagcacag
ggactcaatt attactgaaa catacactaa agata 5516434DNAArtificial
sequenceSynthetic oligonucleotide 164ctcatcagca cagctatgat
gataatgtta tctt 3416555DNAArtificial sequenceSynthetic
oligonucleotide 165acattataga actcggcctg gatgataatt attactgaaa
catacactaa agata 5516632DNAArtificial sequenceSynthetic
oligonucleotide 166ctgattggtc aggattcaga taatgttatc tt
3216755DNAArtificial sequenceSynthetic oligonucleotide
167acattatcaa agctggcaaa tcgtccaatt attactgaaa catacactaa agata
5516832DNAArtificial sequenceSynthetic oligonucleotide
168tggccaatgc accttgagcc taatgttatc tt 3216955DNAArtificial
sequenceSynthetic oligonucleotide 169acattatgat ttccaggttg
gctttgaatt attactgaaa catacactaa agata 5517032DNAArtificial
sequenceSynthetic oligonucleotide 170atagttggag cgctttgtca
taatgttatc tt 3217155DNAArtificial sequenceSynthetic
oligonucleotide 171acattatttc gaagccacgt gacattaatt attactgaaa
catacactaa agata 5517232DNAArtificial sequenceSynthetic
oligonucleotide 172ctgtggtgac aggttttcca taatgttatc tt
3217319DNAArtificial sequenceSynthetic oligonucleotide
173catacactaa agataacat 1917435DNAArtificial sequenceSynthetic
oligonucleotide 174atagcagtcc agccgaacgg tagcatcttg cagaa 35
* * * * *