U.S. patent application number 15/397006 was filed with the patent office on 2017-04-20 for neutralizing antibodies and methods of use thereof.
The applicant listed for this patent is NovImmune SA. Invention is credited to Greg Elson, Olivier Leger.
Application Number | 20170107296 15/397006 |
Document ID | / |
Family ID | 46123904 |
Filed Date | 2017-04-20 |
United States Patent
Application |
20170107296 |
Kind Code |
A1 |
Elson; Greg ; et
al. |
April 20, 2017 |
Neutralizing Antibodies and Methods of Use Thereof
Abstract
This invention provides monoclonal antibodies that recognize the
Toll-like Receptor 4/MD-2 receptor complex, and monoclonal
antibodies that recognize the TLR4/MD2 complex as well as TLR4 when
not complexed with MD-2. The invention further provides methods of
using the humanized monoclonal antibodies as therapeutics. This
invention also provides soluble chimeric proteins, methods of
expressing and purifying soluble chimeric proteins, and methods of
using soluble chimeric proteins as therapeutics, in screening
assays and in the production of antibodies.
Inventors: |
Elson; Greg; (Collonges Sous
Saleve, FR) ; Leger; Olivier; (St. Sixt, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NovImmune SA |
Geneva |
|
CH |
|
|
Family ID: |
46123904 |
Appl. No.: |
15/397006 |
Filed: |
January 3, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14109082 |
Dec 17, 2013 |
9534049 |
|
|
15397006 |
|
|
|
|
13362974 |
Jan 31, 2012 |
8609822 |
|
|
14109082 |
|
|
|
|
12719561 |
Mar 8, 2010 |
8105595 |
|
|
13362974 |
|
|
|
|
11151916 |
Jun 14, 2005 |
7674884 |
|
|
12719561 |
|
|
|
|
11009939 |
Dec 10, 2004 |
7312320 |
|
|
11151916 |
|
|
|
|
60528812 |
Dec 10, 2003 |
|
|
|
60528811 |
Dec 10, 2003 |
|
|
|
60528962 |
Dec 10, 2003 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 37/08 20180101;
C07K 2317/56 20130101; A61P 1/00 20180101; A61P 11/00 20180101;
C07K 16/28 20130101; C07K 16/2896 20130101; C07K 2317/76 20130101;
C07K 2317/565 20130101; A61P 11/06 20180101; A61P 19/02 20180101;
A61P 37/06 20180101; A61K 2039/505 20130101; A61P 29/00 20180101;
C07K 2317/24 20130101; C07K 2317/34 20130101; C07K 2317/32
20130101; A61P 9/10 20180101; C07K 16/18 20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28 |
Claims
1. An antibody that immunospecifically binds a Toll-like receptor 4
(TLR4)/MD-2 complex, wherein the antibody binds to an epitope
comprising one or more amino acid residues on human TLR4 between
residues 289 and 375 of SEQ ID NO: 54.
2. The antibody of claim 1, wherein said antibody specifically
binds to an epitope selected from the group consisting of: (a) an
epitope that comprises at least residues 328 and 329 of SEQ ID NO:
54; (b) an epitope that comprises at least residues 349 through 351
of SEQ ID NO: 54; (c) an epitope that comprises at least residues
369 through 371 of SEQ ID NO: 54; (d) an epitope that comprises at
least residues 328, 329, 349 through 351 and 369 through 371 of SEQ
ID NO: 54; (e) an epitope that comprises at least residues 293
through 295 of SEQ ID NO: 54; (f) an epitope that comprises at
least residues 296 and 297 of SEQ ID NO: 54; (g) an epitope that
comprises at least residues 319 through 321 of SEQ ID NO: 54; and
(h) an epitope that comprises at least residues 293 through 295,
296, 297 and 319 through 321 of SEQ ID NO: 54.
3. An antibody that immunospecifically binds a Toll-like receptor 4
(TLR4)/MD-2 complex, wherein the antibody binds to an epitope on
human MD-2 between residues 19 and 57 of SEQ ID NO: 44.
4. The antibody of claim 3, wherein said antibody specifically
binds to an epitope that comprises at least residues 53 of SEQ ID
NO: 44.
5. A humanized antibody that immunospecifically binds to a
Toll-like receptor 4 (TLR4)/MD-2 complex, wherein the antibody
comprises a heavy chain with three complementarity determining
regions (CDRs) comprising an amino acid sequence selected from the
group consisting of GGYSWH (SEQ ID NO: 23); YIHYSGYTDFNPSLKT (SEQ
ID NO: 24); KDPSDGFPY (SEQ ID NO: 25); DSYIH (SEQ ID NO: 3);
WTDPENVNSIYDPRFQG (SEQ ID NO: 4), GYNGVYYAMDY (SEQ ID NO: 5);
TYNIGVG (SEQ ID NO: 33); HIWWNDNIYYNTVLKS (SEQ ID NO: 34); and
MAEGRYDAMDY (SEQ ID NO: 35), and a light chain with three CDRs
comprising an amino acid sequence selected from the group
consisting of the amino acid sequence of RASQSISDHLH (SEQ ID NO:
28); YASHAIS (SEQ ID NO: 29); QNGHSFPLT (SEQ ID NO: 30); SASSSVIYMH
(SEQ ID NO: 8); RTYNLAS (SEQ ID NO: 9); HQWSSFPYT (SEQ ID NO: 10);
RASQDITNYLN (SEQ ID NO: 38); YTSKLHS (SEQ ID NO: 39); and QQGNTFPWT
(SEQ ID NO: 40).
6. The humanized antibody of claim 5, wherein the antibody
comprises a heavy chain variable amino acid sequence selected from
the group consisting of SEQ ID NOs: 45, 46, 49, 51 and 52 and a
light chain variable amino acid sequence selected from the group
consisting of SEQ ID NOs: 47, 48, 50 and 53.
7. A method of alleviating a symptom of a pathology associated with
aberrant TLR4 signaling, the method comprising administering an
antibody of claim 1 to a subject in need thereof in an amount
sufficient to alleviate the symptom of the pathology in the
subject.
8. The method of claim 7, wherein the subject is a human.
9. The method of claim 7, wherein the amount of said antibody
sufficient to alleviate the symptom of the pathology associated
with aberrant TLR4 signaling is an amount sufficient to reduce
LPS-induced pro-inflammatory cytokine production.
10. The method of claim 7, wherein said pathology is selected from
the group consisting of sepsis, ventilator-induced lung injury,
acute inflammation, chronic inflammation, autoimmune diseases and
disorders induced by endogenous soluble stress factors.
11. The method of claim 10, wherein said chronic inflammation is
associated with an allergic condition, or asthma.
12. The method of claim 10, wherein said pathology is inflammatory
bowel disorder or atherosclerosis.
13. The method of claim 10, wherein said disorder induced by
endogenous soluble stress factors is osteoarthritis or rheumatoid
arthritis.
14. The method of claim 10, wherein said endogenous soluble stress
factor is Hsp60, fibronectin, heparan sulphate, hyaluronan, gp96,
.beta.-Defensin-2 or surfactant protein A.
15. A pharmaceutical composition comprising an antibody of claim 1
and a carrier.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/109,082, filed Dec. 17, 2013 and issued as
U.S. Pat. No. 9,534,049, which is a continuation U.S. patent
application Ser. No. 13/362,974, filed Jan. 31, 2012 and issued as
U.S. Pat. No. 8,609,822, which is a continuation of U.S. patent
application Ser. No. 12/719,561, filed Mar. 8, 2010 and issued as
U.S. Pat. No. 8,105,595, which is a continuation of U.S. patent
application Ser. No. 11/151,916, filed Jun. 14, 2005 and issued as
U.S. Pat. No. 7,674,884, which is a continuation-in-part of U.S.
patent application Ser. No. 11/009,939, filed Dec. 10, 2004 and
issued as U.S. Pat. No. 7,312,320, which claims the benefit of U.S.
Provisional Application No. 60/528,812, filed Dec. 10, 2003; of
U.S. Provisional Application No. 60/528,811, filed Dec. 10, 2003;
and of U.S. Provisional Application No. 60/528,962, filed Dec. 10,
2003; each of which is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0002] This invention relates generally to the generation of
neutralizing monoclonal antibodies, e.g., humanized monoclonal
antibodies, that recognize the Toll-like Receptor 4/MD-2 receptor
complex, to monoclonal antibodies, e.g., humanized monoclonal
antibodies, that recognize both the Toll-like Receptor 4/MD-2
receptor complex and Toll-like Receptor 4 when not complexed with
MD-2, and to methods of using the monoclonal antibodies as
therapeutics.
INCORPORATION-BY-REFERENCE OF SEQUENCE LISTING
[0003] The contents of the text file named
"NOVI002CO7USSeqList.txt," which was created on Dec. 28, 2016 and
is 49.5 KB in size, are hereby incorporated by reference in their
entirety.
BACKGROUND OF THE INVENTION
[0004] Toll receptors, first discovered in Drosophila, are type I
transmembrane protein having leucine-rich repeats (LRRs) in the
extracellular portion of the protein, and one or two cysteine-rich
domains. The mammalian homologs of the Drosophila Toll receptors
are known as "Toll-like receptors" (TLRs). TLRs play a role in
innate immunity by recognizing microbial particles and activating
immune cells against the source of these microbial particles.
[0005] Currently, ten types of Toll-like receptors have been
identified in humans, TLRs 1-10. These TLRs are characterized by
the homology of their intracellular domains to that of the IL-1
receptor, and by the presence of extracellular leucine-rich
repeats. The different types of TLRs are activated by different
types of microbial particles. For example, TLR4 is primarily
activated by lipopolysaccharide (LPS), while TLR2 is activated by
lipoteichoic (LTA), lipoarabinomannan (LAM); lipoprotein (BLP), and
peptideglycans (PGN). Toll receptor homologs, such as RP105, have
also been identified.
[0006] Myeloid differentiation protein-2 (MD-2), a TLR4 accessory
protein, has been identified and characterized. This protein has
been found to interact directly with TLR4, and MD-2 has the ability
to enable post-translational modifications of TLR4, as well as
facilitate its transport to the cell surface. TLR4 and MD-2 form a
complex on the cell surface.
[0007] Lipopolysaccharide (LPS), a component of gram-negative
bacteria, is a microbial particle capable of strongly activating
the innate immune system. LPS delivers signals to immune cells via
its multi-chain receptor, comprising the TLR4/MD-2 complex as the
principle signaling component.
[0008] Accordingly, there exists a need for methods and
compositions that modulate signaling that is mediated by the
TLR4/MD-2 complex.
SUMMARY OF THE INVENTION
[0009] The invention provides monoclonal antibodies recognizing the
TLR4/MD-2 receptor expressed on the cell surface. The antibodies
are capable of blocking, e.g., neutralizing, LPS-induced
pro-inflammatory cytokine production. The monoclonal antibody is,
e.g., a humanized antibody. Antibodies of the invention include
antibodies that bind the human TLR4/MD-2 receptor complex and also
bind TLR4 independently of the presence of MD-2. Antibodies of the
invention also include antibodies that bind the TLR4 portion of the
human TLR4/MD-2 receptor complex, but binding is entirely dependent
on the presence of MD-2. In addition, antibodies of the invention
include antibodies that bind the human TLR4/MD-2 receptor complex
and also bind MD-2 but only in the presence of TLR4.
[0010] Exemplary antibodies of the invention include, for example,
the 18H10 antibody, the 16G7 antibody, the 15C1 antibody and the
7E3 antibody. These antibodies show specificity for the human
TLR4/MD-2 receptor complex, and they have been shown to inhibit
receptor activation and subsequent intracellular signaling via LPS.
These antibodies have distinct specificities. For example, 15C1
binds TLR4 independently of the presence of MD-2, 7E3 binds to
TLR4, but binding is dependent on the presence of MD-2, and 18H10
binds to MD-2, but requires the presence of TLR4, as the MAb does
not bind soluble forms of MD-2.
[0011] As used herein, the terms "16G7", "mu16G7", "7E3", "mu7E3",
".sup.15C1", "mu15C1", "18H10" or "mu18H10" refer to the murine
monoclonal antibody, and the terms "hu7E3", "hu15C1", or "hu18H10"
refer to the humanized monoclonal antibody.
[0012] The murine monoclonal antibodies of the invention contain a
heavy chain variable region having the amino acid sequence of SEQ
ID NOS: 2, 12, 22 or 32 and a light chain variable region having
the amino acid sequence of SEQ ID NOS: 7, 17, 27 or 37. The three
heavy chain CDRs include an amino acid sequence at least 90%, 92%,
95%, 97% 98%, 99% or more identical a sequence selected from the
group consisting of DSYIH (SEQ ID NO: 3); WTDPENVNSIYDPRFQG (SEQ ID
NO: 4), GYNGVYYAMDY (SEQ ID NO: 5); DYWIE (SEQ ID NO: 13);
EILPGSGSTNYNEDFKD (SEQ ID NO: 14); EERAYYFGY (SEQ ID NO: 15);
GGYSWH (SEQ ID NO: 23); YIHYSGYTDFNPSLKT (SEQ ID NO: 24); KDPSDGFPY
(SEQ ID NO: 25); TYNIGVG (SEQ ID NO: 33); HIWWNDNIYYNTVLKS (SEQ ID
NO: 34); and MAEGRYDAMDY (SEQ ID NO: 35) and a light chain with
three CDR that include an amino acid sequence at least 90%, 92%,
95%, 97% 98%, 99% or more identical to a sequence selected from the
group consisting of the amino acid sequence of SASSSVIYMH (SEQ ID
NO: 8); RTYNLAS (SEQ ID NO: 9); HQWSSFPYT (SEQ ID NO: 10);
RSSQSLENSNGNTYLN (SEQ ID NO: 18); RVSNRFS (SEQ ID NO: 19);
LQVTHVPPT (SEQ ID NO: 20); RASQSISDHLH (SEQ ID NO: 28); YASHAIS
(SEQ ID NO: 29); QNGHSFPLT (SEQ ID NO: 30); RASQDITNYLN (SEQ ID NO:
38); YTSKLHS (SEQ ID NO: 39); and QQGNTFPWT (SEQ ID NO: 40). The
antibody binds to the TLR4/MD-2 complex, to TLR4 when not complexed
with MD-2, or to both.
[0013] The humanized antibodies of the invention contain a heavy
chain variable region having the amino acid sequence of SEQ ID NOS:
45, 46, 49, 51 and 52. The humanized antibodies of the invention
contain a light chain variable region having the amino acid
sequence of SEQ ID NOS: 47, 48 50, and 53. The three heavy chain
CDRs include an amino acid sequence at least 90%, 92%, 95%, 97%
98%, 99% or more identical a sequence selected from the group
consisting of GGYSWH (SEQ ID NO: 23); YIHYSGYTDFNPSLKT (SEQ ID NO:
24); KDPSDGFPY (SEQ ID NO: 25); DSYIH (SEQ ID NO: 3);
WTDPENVNSIYDPRFQG (SEQ ID NO: 4), GYNGVYYAMDY (SEQ ID NO: 5);
TYNIGVG (SEQ ID NO: 33); HIWWNDNIYYNTVLKS (SEQ ID NO: 34); and
MAEGRYDAMDY (SEQ ID NO: 35). The three light chain CDRs include an
amino acid sequence at least 90%, 92%, 95%, 97% 98%, 99% or more
identical to a sequence selected from the group consisting of the
amino acid sequence of RASQSISDHLH (SEQ ID NO: 28); YASHAIS (SEQ ID
NO: 29); QNGHSFPLT (SEQ ID NO: 30); SASSSVIYMH (SEQ ID NO: 8);
RTYNLAS (SEQ ID NO: 9); HQWSSFPYT (SEQ ID NO: 10); RASQDITNYLN (SEQ
ID NO: 38); YTSKLHS (SEQ ID NO: 39); and QQGNTFPWT (SEQ ID NO: 40).
The antibody binds to the TLR4/MD-2 complex, to TLR4 when not
complexed with MD-2, or to both.
[0014] Antibodies of the invention immunospecifically bind a
TLR4/MD-2 complex, wherein the antibody binds to an epitope that
includes one or more amino acid residues on human TLR4 between
residues 289 and 375 of SEQ ID NO: 54. For example, the antibody
specifically binds to an epitope that includes residues selected
from the group consisting of at least residues 293 through 295 of
SEQ ID NO: 54; at least residues 296 and 297 of SEQ ID NO: 54; at
least residues 319 through 321 of SEQ ID NO: 54; at least residues
328 and 329 of SEQ ID NO: 54; at least residues 349 through 351 of
SEQ ID NO: 54; and at least residues 369 through 371 of SEQ ID NO:
54. For example, the antibody specifically binds to an epitope that
contains at least residues 328, 329, 349 through 351 and 369
through 371 of SEQ ID NO: 54. In another example, the antibody
specifically binds to an epitope that includes at least residues
293 through 295, 296, 297 and 319 through 321 of SEQ ID NO: 54.
[0015] Antibodies of the invention bind the TLR4/MD2 complex,
wherein the antibody binds to an epitope on human MD-2 between
residues 19 and 57 of SEQ ID NO: 44. For example, the antibody
specifically binds to an epitope that contains at least residues 53
of SEQ ID NO: 44.
[0016] Antibodies of the invention also include humanized
antibodies that immunospecifically bind a TLR4/MD-2 complex,
wherein the antibody exhibits greater than 50% inhibition of
lipopolysaccharide (LPS)-induced pro-inflammatory cytokine
production in human TLR4/MD-2 transfected HEK293 cells at a
concentration of 1 .mu.g/ml. For example, antibodies of the
invention exhibit greater than 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 92%, 95%, 97%, 98%, or 99% inhibition of LPS-induced
pro-inflammatory cytokine production in human TLR4/MD-2 transfected
HEK293 cells at a concentration of 1 .mu.g/ml. As used herein, the
term "pro-inflammatory cytokine" refers to those immunoregulatory
cytokines that promote inflammation and/or are associated with
inflammation. Pro-inflammatory cytokines, include, for example,
IL-6, IL-8, TNF-alpha, IL1-alpha, IL1-beta, IFN-alpha, IFN-beta,
IFN-gamma, IL-10, IL12, IL-23, IL17, and IL18.
[0017] Antibodies of the invention, for example, inhibit
LPS-induced pro-inflammatory cytokine production at least two-fold,
five-fold, 10-fold, 20-fold, 50-fold, 75-fold, or 100-fold more
than the commercially available, anti-TLR4 non-blocking monoclonal
antibody HTA125.
[0018] The present invention also provides methods of treating or
preventing pathologies associated with aberrant TLR4/MD-2
activation and/or aberrant LPS activity (e.g., aberrant
pro-inflammatory cytokine production such as aberrant IL-8
production), or alleviating a symptom associated with such
pathologies, by administering a monoclonal antibody of the
invention (e.g., a murine monoclonal or humanized monoclonal
antibody) to a subject in which such treatment or prevention is
desired. The subject to be treated is, e.g., human. The monoclonal
antibody is administered in an amount sufficient to treat, prevent
or alleviate a symptom associated with the pathology. The amount of
monoclonal antibody sufficient to treat or prevent the pathology in
the subject is, for example, an amount that is sufficient to reduce
LPS-induced production of one or more pro-inflammatory cytokines
(e.g., IL-8). As used herein, the term "reduced" refers to a
decreased production of a pro-inflammatory cytokine in the presence
of a monoclonal antibody of the invention, wherein the production
is, for example, local pro-inflammatory cytokine production (e.g.,
at a site of inflamed tissue) or systemic pro-inflammatory cytokine
production. LPS-induced production of a pro-inflammatory cytokine
such as IL-8 is decreased when the level of pro-inflammatory
cytokine (e.g., IL-8) production in the presence of a monoclonal
antibody of the invention is greater than or equal to 5%, 10%, 20%,
25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, or 100%
lower than a control level of pro-inflammatory cytokine production
(i.e., the level of pro-inflammatory cytokine production in the
absence of the monoclonal antibody). Level of pro-inflammatory
cytokine production (e.g., IL-8 or IL-6) is measured, e.g., using
the human whole blood or huTLR4/MD2 transfected HEK293 cellular
assays described herein. Those skilled in the art will appreciate
that the level of pro-inflammatory cytokine production can be
measured using a variety of assays, including, for example,
commercially available ELISA kits.
[0019] Pathologies treated and/or prevented using the monoclonal
antibodies of the invention (e.g., a murine monoclonal or humanized
monoclonal antibody) include, for example, sepsis induced by
microbial products, acute inflammation, chronic inflammation (e.g.,
chronic inflammation associated with allergic conditions and
asthma), autoimmune diseases (e.g., IBD and atherosclerosis) and
diseases in which mechanical stress induces the expression of
endogenous soluble stress factors (e.g., Hsp60, fibronectin,
heparan sulphate, hyaluronan, gp96, .beta.-Defensin-2 and
surfactant protein A). Pathologies in which mechanical stress
induces the expression of endogenous soluble stress factors
include, for example, osteoarthritis and rheumatoid arthritis.
Pathologies associated with mechanical stress can also occur in
subjects and patients placed on respirators, ventilators and other
respiratory-assist devices. Such pathologies include, for example,
ventilator-induced lung injury ("VILI"), also referred to as
ventilation-associated lung injury ("VALI").
[0020] Pharmaceutical compositions according to the invention can
include an antibody of the invention and a carrier. These
pharmaceutical compositions can be included in kits, such as, for
example, diagnostic kits.
[0021] The present invention also provides soluble chimeric toll
receptor proteins (also referred to herein as toll-like receptor
proteins), methods for expressing toll receptor proteins, and
methods for purifying such proteins in a soluble form.
[0022] The present invention provides chimeric polypeptides in
which a toll-like receptor polypeptide, or a biologically active
derivative thereof, is operably linked to an MD accessory
polypeptide, or a biologically active derivative thereof. The
toll-like receptor polypeptide is a polypeptide selected from the
group consisting of TLRs 1-10 and RP105.
[0023] The MD accessory polypeptide is, for example, MD-1 or MD-2.
The toll-like receptor polypeptide is, in some instances, operably
linked to the MD accessory polypeptide using a flexible
glycine-serine linker, which renders the toll receptor both stable
during expression and soluble during purification. For example, a
chimeric polypeptide of the invention includes the extracellular
portion of a toll receptor fused at its C terminus to the N
terminus of a mature MD protein (i.e., MD-1 or MD-2) via a flexible
glycine/serine linker.
[0024] The present invention also provides methods for producing
soluble chimeric fusion proteins by coupling a toll-like receptor
polypeptide, or a biologically active derivative thereof, to an MD
accessory polypeptide, or a biologically active derivative thereof.
The present invention also provides methods for producing soluble
chimeric fusion proteins by constructing a vector that includes a
nucleic acid sequence encoding a toll-like receptor polypeptide (or
a biologically active derivative thereof) coupled to a nucleic acid
sequence encoding an MD accessory polypeptide (or a biologically
active derivative thereof); transfecting a cell with this vector;
culturing the cell under conditions that permit production of a
fusion protein having a toll-like receptor polypeptide coupled to
an MD accessory polypeptide; and isolating that fusion protein. The
MD accessory polypeptide is, for example, MD-1 or MD-2, and the
toll-like receptor polypeptide can be a polypeptide selected from
the group consisting of TLRs 1-10 and RP105. The toll-like receptor
polypeptide is operably linked to the MD accessory polypeptide by a
flexible glycine-serine linker, which renders the toll receptor
both stable during expression and soluble during purification.
[0025] The present invention also provides methods of treating or
preventing pathologies associated with aberrant toll-like receptor
function, or alleviating a symptom associated with these
pathologies, by administering a soluble chimeric polypeptide of the
invention to a subject in which such treatment or prevention or
alleviation is desired in an amount sufficient to treat or prevent
or alleviate the pathology, or a symptom thereof, in the subject.
The subject to be treated is, e.g., human. The amount of soluble
chimeric polypeptide sufficient to treat or prevent the pathology
in the subject is an amount that is sufficient to modulate (e.g.,
reduce or prevent) the activation of a toll-like receptor in the
subject to be treated. Activation of a toll-receptor is reduced or
decreased when the level of toll-receptor activation in the
presence of a chimeric protein of the invention is greater than or
equal to 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%,
95%, 99%, or 100% lower than a control level of toll-like receptor
activation (i.e., the level of activation the absence of the
chimeric protein). The level of toll-receptor activation is
measured using any of a variety of techniques known in the art. For
example, the level of TLR4 activation can be measured by detecting
the level of LPS-induced IL-8 production. Those skilled in the art
will appreciate that the level of toll-receptor activation can also
be measured, for example, by detecting activation, if any, of
NF-kappa B or JNK (c-jun terminal kinase), which initiate the
transcription of genes encoding pro-inflammatory cytokines (e.g.,
IL1-alpha, IL1-beta, IL6, and TNF-alpha). Activation of JNK and/or
NF-kappa B can be detected by measuring the levels of one or more
pro-inflammatory cytokines.
[0026] In some embodiments, the pathology to be treated is sepsis,
acute inflammation, chronic inflammation or an autoimmune disease.
For example, the pathology is any one of a variety of types of
arthritis.
[0027] The present invention also includes antibodies that
immunospecifically bind to the soluble chimeric polypeptides of the
invention, such as, for example, monoclonal antibodies or humanized
antibodies.
[0028] Pharmaceutical compositions according to the invention can
include a soluble chimeric polypeptide of the invention and a
carrier, and/or an antibody of the invention and a carrier. These
pharmaceutical compositions can be included in kits, such as, for
example, diagnostic kits.
[0029] The invention also provides methods of screening for a
ligand that binds a toll-like receptor and modulates toll-like
receptor activity. According to these methods of the invention,
these ligands are identified by providing a chimeric polypeptide of
the invention that has a property or function that is ascribable to
that polypeptide; contacting the chimeric polypeptide with a
candidate compound; and determining whether the candidate compound
alters the property or function ascribable to the polypeptide,
wherein an alteration in the property or function ascribable to the
polypeptide in the presence of the candidate compound indicates
that the candidate compound is a ligand that modulates toll-like
receptor activity.
[0030] One skilled in the art will appreciate that the chimeric
polypeptides and antibodies of the invention have a variety of
uses. For example, the chimeric proteins of the invention are used
as therapeutic agents to prevent the activation of TLRs in
disorders such as, for example, sepsis, acute inflammation, chronic
inflammation, autoimmune diseases and various forms of arthritis.
The chimeric proteins of the invention are also used as immunogens
in more efficient methods of generating binding and blocking
anti-TLR antibodies, and/or these chimeric polypeptides can be used
as reagents in assays that screen for small molecular weight
binders and blockers of TLRs activity. The chimeric proteins and/or
antibodies of the invention are also used as reagents in diagnostic
kits or as diagnostic tools, or these chimeric proteins and/or
antibodies can be used in competition assays to generate
therapeutic reagents.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 is a graph depicting the binding of a murine
monoclonal antibody, referred to herein as "18H10", to the
TLR4/MD-2 complex. Specificity of binding is shown by flow
cytometry using mock transfected or TLR4/MD-2 transfected cells.
The results using mock-transfected cells are shown in the filled
graph (left), while the results using TLR4/MD-2 transfected cells
are shown as in the outline graph (right).
[0032] FIG. 2 is a graph depicting inhibition of lipopolysaccharide
(LPS)-induced IL-8 production in TLR4/MD-2 transfected HEK 293
cells by the monoclonal antibody mu18H10. The cells were incubated
with either mu18H10, HTA 125 (a commercially available anti-human
TLR4 non-blocking MAb) or an antibody control at the indicated
concentrations and subsequently incubated with LPS (15 ng/ml). IL-8
levels were assessed 16 hours post LPS treatment.
[0033] FIG. 3 is a series of graphs depicting inhibition of
LPS-induced IL-8 production in human whole blood by the monoclonal
antibody mu18H10. Whole blood was drawn from 3 healthy volunteers,
treated with heparin and diluted 1:4 in RPMI medium. The following
antibodies were added at the concentrations indicated: control
monoclonal antibody; HTA125 and mu18H10. LPS was subsequently added
for a final concentration of 10 ng/ml, and IL-8 levels were
measured 6 hours post LPS treatment.
[0034] FIGS. 4A-4L are a series of graphs depicting the specificity
of the mu18H10 monoclonal antibody for MD-2. The specificity of the
mu18H10 antibody is shown by flow cytometry analysis of HEK 293
cells transiently transfected with either human TLR4 and human MD-2
(FIG. 4A, FIG. 4E and FIG. 4I); rabbit TLR4 and rabbit MD-2 (FIG.
4B, FIG. 4F and FIG. 4J); human TLR4 and rabbit MD-2 (FIG. 4C, FIG.
4G and FIG. 4K); or rabbit TLR4 and human MD-2 (FIG. 4D, FIG. 4H
and FIG. 4L). Cells were incubated with either .alpha.-FLAG.TM.
antibody (to detect TLR4 expression); .alpha.-C-myc antibody (to
detect MD-2 expression) or the mu18H10 monoclonal antibody,
followed by an APC-coupled .alpha.-mouse (H+L) antibody.
[0035] FIG. 5A is a graph demonstrating the lack of specificity of
mu18H10 for recombinant soluble MD-2 purified from
baculovirus-infected insect cell supernatants as determined by
ELISA. Protein was coated directly on 96-well plates (5 .mu.g/ml)
followed by purified MAb at the indicated concentration and
anti-mouse IgG (H+L) HRP.
[0036] FIG. 5B is a graph demonstrating that MD-2 must be
associated with TLR4 for the mu18H10 antibody to recognize it.
Lysates (Panel 1, i.e., upper panel) or supernatants (Panel 2,
i.e., lower panel) from HEK 293 cells, transiently transfected as
indicated, were incubated in wells coated with anti-FLAG M2.
Binding of a biotinylated form of mu18H10 was detected using
streptavidin-HRP. Biotinylated 12D4 (an anti-TLR4 MAb) with
streptavidin-HRP or a polyclonal rabbit Ab raised against soluble
MD-2 with an anti-rabbit IgG-HRP controlled the presence of TLR4
and MD-2 respectively. In this experiment, TLR4 had a FLAG tag at
the N-terminus and was expressed using the vector pCNDA3.1(-)hygro
(Invitrogen). MD-2 had FLAG and 6.times. Histidine tags at the C
terminus and was expressed using the vector pCDNA3 (Invitrogen).
Mock cells were transfected with empty plasmid.
[0037] FIGS. 6A-6F are a series of illustrations depicting the VH
nucleotide sequence (SEQ ID NO: 1) (FIG. 6A), the VH amino acid
sequence (SEQ ID NO: 2) (FIG. 6B), the VL nucleotide sequence (SEQ
ID NO: 6) (FIG. 6D), and the VL amino acid sequence (SEQ ID NO: 7)
for mu18H10 (FIG. 6E). The VH complementarity determining regions
(CDRs) (SEQ ID NOs:3, 4 and 5) (FIG. 6C) and the VL CDRs (SEQ ID
NOs: 8, 9 and 10) (FIG. 6F) are highlighted in the underlined,
italic text in FIGS. 6B and 6E.
[0038] FIG. 7 is a graph depicting that the VH and VL nucleotide
sequence of mu18H10 expressed as a chimeric MAb ("chimeric 18H10")
is capable of binding specifically to the human TLR4/MD-2 complex
on the surface of transfected CHO cells. MAb binding to the
TLR4/MD-2 transfected CHO cells is shown by flow cytometry using
chimeric 18H10 or an isotype matched control MAb at the
concentrations indicated.
[0039] FIG. 8 is a graph depicting inhibition of lipopolysaccharide
(LPS)-induced IL-8 production in TLR4/MD-2 transfected HEK 293
cells by the chimeric 18H10 MAb. Cells were incubated with mu18H10,
or chimeric 18H10 at the indicated concentrations and subsequently
incubated with LPS (15 ng/ml). IL-8 levels were assessed 16 hours
post LPS-treatment. Inhibition of LPS-induced IL-8 production by
the chimeric 18H10 was similar to the inhibition by the 18H10 mouse
MAb of the invention.
[0040] FIG. 9 is a graph depicting the binding of a murine
monoclonal antibody, referred to herein as "16G7", to the TLR4/MD-2
complex. Specificity of binding is shown by flow cytometry using
mock-transfected or TLR4/MD-2 transfected cells. The results using
mock transfected cells are shown in the filled graph (left), while
the results using TLR4/MD-2 transfected cells are shown as in the
outline graph (right).
[0041] FIG. 10 is a graph depicting inhibition of
lipopolysaccharide (LPS)-induced IL-8 production in TLR4/MD-2
transfected HEK 293 cells by the monoclonal antibody mu16G7. The
cells were incubated with the mu16G7 monoclonal antibody, the HTA
125 anti-TLR4 MAb or an antibody control at the indicated
concentrations and subsequently incubated with LPS (15 ng/ml). IL-8
levels were assessed 16 hours post LPS treatment.
[0042] FIG. 11 is a series of graphs depicting inhibition of
LPS-induced IL-8 production in human whole blood by the monoclonal
antibody mu16G7. Whole blood was drawn from 3 healthy volunteers,
treated with heparin and diluted 1:4 in RPMI medium. The following
antibodies were added at the concentrations indicated: Isotype
matched control; HTA125 (anti-human TLR4 non-blocking monoclonal
antibody); mu16G7 and 28C5 (anti-human CD14 blocking monoclonal
antibody). LPS was subsequently added for a final concentration of
10 ng/ml.
[0043] FIGS. 12A-12L are a series of graphs depicting the
specificity of the mu16G7 monoclonal antibody for TLR4. The
specificity of the mu16G7 antibody is shown by flow cytometry
analysis of HEK 293 cells transiently transfected with either
rabbit TLR4 and rabbit MD-2 (FIG. 12A, FIG. 12E and FIG. 12I);
human TLR4 and human MD-2 (FIG. 12B, FIG. 12F and FIG. 12J); rabbit
TLR4 and human MD-2 (FIG. 12C, FIG. 12G and FIG. 12K); or human
TLR4 and rabbit MD-2 (FIG. 12D, FIG. 12H and FIG. 12L). Cells were
incubated with either .alpha.-FLAG.TM. antibody (to detect TLR4
expression); .alpha.-C-myc antibody (to detect MD-2 expression) or
the mu16G7 monoclonal antibody, followed by an APC-coupled
.alpha.-mouse (H+L) antibody.
[0044] FIGS. 13A-13F are a series of illustrations depicting the VH
nucleotide sequence (SEQ ID NO: 11) (FIG. 13A), the VH amino acid
sequence (SEQ ID NO: 12) (FIG. 13B), the VL nucleotide sequence
(SEQ ID NO: 16) (FIG. 13D), and the VL amino acid sequence (SEQ ID
NO: 17) (FIG. 13E) for mu16G7. The VH complementarity determining
regions (CDRs) (SEQ ID NOs: 13, 14 and 15) (FIG. 13C) and the VL
CDRs (SEQ ID NOs: 18, 19 and 20) (FIG. 13F) are highlighted in the
underlined, italic text in FIGS. 13B and 13E.
[0045] FIG. 14 is a graph depicting the binding of a murine
monoclonal antibody, referred to herein as "15C1", to the TLR4/MD-2
complex. Specificity of binding is shown by flow cytometry using
mock transfected or TLR4/MD-2 transfected cells. The results using
mock-transfected cells are shown in the filled graph (left), while
the results using TLR4/MD-2 transfected cells are shown as in the
outline graph (right).
[0046] FIG. 15 is a graph depicting inhibition of
lipopolysaccharide (LPS)-induced IL-8 production in TLR4/MD-2
transfected HEK 293 cells by the monoclonal antibody mu15C1. The
cells were incubated with the mu15C1 monoclonal antibody, HTA 125
(anti-human TLR4 non-blocking monoclonal antibody) and an
isotype-matched control (IgG1) at the indicated concentrations and
subsequently incubated with LPS (15 ng/ml). IL-8 levels were
assessed 16 hours post LPS treatment.
[0047] FIG. 16 is a series of graphs depicting inhibition of
LPS-induced IL-6 production in human whole blood by the monoclonal
antibody mu15C1. Whole blood was drawn from 3 healthy volunteers,
treated with heparin and diluted 1:4 in RPMI medium. The following
antibodies were added at the concentrations indicated: Isotype
matched control (IgG1); HTA125 (anti-human TLR4 non-blocking
monoclonal antibody); mu15C1 and 28C5 (anti-human CD14 blocking
monoclonal antibody). LPS was subsequently added for a final
concentration of 10 ng/ml.
[0048] FIGS. 17A-17F is a series of graphs depicting the
specificity of the mu15C1 monoclonal antibody for TLR4. The
specificity of the mu15C1 antibody is shown by flow cytometry
analysis of HEK 293 cells transiently transfected with either mock
vector, i.e., empty vector (FIG. 17A), human TLR4 (FIG. 17B), human
TLR4 and human MD-2 (FIG. 17C), rabbit TLR4 and rabbit MD-2 (FIG.
17D), human TLR4 and rabbit MD-2 (FIG. 17E), or rabbit TLR4 and
human MD-2 (FIG. 17F). Cells were incubated with the mu15C1
monoclonal antibody (10 .mu.g/ml), followed by an APC-coupled
.alpha.-mouse (H+L) antibody.
[0049] FIGS. 18A-18F are a series of illustrations depicting the VH
nucleotide sequence (SEQ ID NO: 21) (FIG. 18A), the VH amino acid
sequence (SEQ ID NO: 22) (FIG. 18B), the VL nucleotide sequence
(SEQ ID NO: 26) (FIG. 18D), and the VL amino acid sequence (SEQ ID
NO: 27) (FIG. 18E) for mu15C1. The VH complementarity determining
regions (CDRs) (SEQ ID NOs: 23, 24 and 25) (FIG. 18C) and the VL
CDRs (SEQ ID NOs: 28, 29 and 30) (FIG. 18F) are highlighted in the
underlined, italic text in FIGS. 18B and 18E.
[0050] FIG. 19 is a graph depicting that the VH and VL nucleotide
sequence of mu15C1 expressed as a chimeric MAb ("chimeric 15C1") is
capable of binding specifically to the human TLR4/MD-2 complex on
the surface of transfected CHO cells. MAb binding to the TLR4/MD-2
complex is shown by flow cytometry using chimeric 15C1 or an
isotype matched control monoclonal antibody at the indicated
concentration.
[0051] FIG. 20 is a graph depicting inhibition of
lipopolysaccharide (LPS)-induced IL-8 production in TLR4/MD-2
transfected HEK 293 cells by the chimeric 15C1 MAb. Cells were
incubated with mu15C1 or chimerical 15C1 at the concentrations
indicated and subsequently incubated with LPS (15 ng/ml). IL-8
levels were assessed 16 hours post LPS treatment. Inhibition of
LPS-induced IL-8 production by the chimeric 15C1 was similar to the
inhibition by the mu15C1 mouse MAb of the invention.
[0052] FIG. 21 is a graph depicting the binding of a murine
monoclonal antibody, referred to herein as "7E3", to the TLR4/MD-2
complex. Specificity of binding is shown by flow cytometry using
mock transfected or TLR4/MD-2 transfected cells. The results using
mock-transfected cells are shown in the filled graph (left), while
the results using TLR4/MD-2 transfected cells are shown as in the
outline graph (right).
[0053] FIG. 22 is a graph depicting inhibition of
lipopolysaccharide (LPS)-induced IL-8 production in TLR4/MD-2
transfected HEK 293 cells by the monoclonal antibody mu7E3. The
cells were incubated with the mu7E3 monoclonal antibody, HTA 125
(anti-human TLR4 non-blocking monoclonal antibody) and an
isotype-matched control (IgG1) at the indicated concentrations and
subsequently incubated with LPS (15 ng/ml). IL-8 levels were
assessed 16 hours post LPS treatment.
[0054] FIG. 23 is a series of graphs depicting inhibition of
LPS-induced IL-6 production in human whole blood by the monoclonal
antibody mu7E3. Whole blood was drawn from 3 healthy volunteers,
treated with heparin and diluted 1:4 in RPMI medium. The following
antibodies were added at the concentrations indicated: Isotype
matched control (IgG1); HTA125 (anti-human TLR4 non-blocking
monoclonal antibody); mu7E3 and 28C5 (anti-human CD14 blocking
monoclonal antibody). LPS was subsequently added for a final
concentration of 10 ng/ml.
[0055] FIGS. 24A-24F is a series of graphs depicting the
specificity of the mu7E3 monoclonal antibody for the TLR4/MD-2
complex. The specificity of the mu7E3 antibody is shown by flow
cytometry analysis of HEK 293 cells transiently transfected with
either mock vector (FIG. 24A), human TLR4 (FIG. 24B), human TLR4
and human MD-2 (FIG. 24C), rabbit TLR4 and rabbit MD-2 (FIG. 24D),
human TLR4 and rabbit MD-2 (FIG. 24E), or rabbit TLR4 and human
MD-2 (FIG. 24F). Cells were incubated with the mu7E3 monoclonal
antibody (10 .mu.g/ml), followed by an APC-coupled .alpha.-mouse
(H+L) antibody.
[0056] FIGS. 25A-25F are a series of illustrations depicting the VH
nucleotide sequence (SEQ ID NO: 31) (FIG. 25A), the VH amino acid
sequence (SEQ ID NO: 32) (FIG. 25B), the VL nucleotide sequence
(SEQ ID NO: 36) (FIG. 25D), and the VL amino acid sequence (SEQ ID
NO: 37) (FIG. 25E) for mu7E3. The VH complementarity determining
regions (CDRs) (SEQ ID NOs: 33, 34 and 35) (FIG. 25C) and the VL
CDRs (SEQ ID NOs: 38, 39 and 40) (FIG. 25F) are highlighted in the
underlined italic text in FIGS. 25B and 25E.
[0057] FIG. 26 is a graph illustrating that the VH and VL
nucleotide sequence of mu7E3 expressed as a chimeric MAb ("chimeric
7E3") is capable of binding specifically to the human TLR4/MD-2
complex on the surface of transfected CHO cells. Monoclonal
antibody binding to TLR4/MD-2 transfected CHO cells is shown by
flow cytometry using chimeric 7E3 or an isotype matched control MAb
at the indicated concentrations.
[0058] FIG. 27 is a graph depicting inhibition of
lipopolysaccharide (LPS)-induced IL-8 production in TLR4/MD-2
transfected HEK 293 cells by the chimeric 7E3 MAb. Cells were
incubated with chimeric 7E3 or an isotype matched MAb control at
the indicated concentrations and subsequently incubated with LPS
(15 ng/ml). IL-8 levels were assessed 16 hours post
LPS-treatment.
[0059] FIGS. 28A-28C are a series of illustrations depicting the
construction of a TLR4/MD-2 fusion protein cDNA according to the
present invention.
[0060] FIG. 29 is an illustration depicting the expression of a
TLR4/MD-2 chimeric protein of the invention in Sf9 cell lysates and
supernatant.
[0061] FIG. 30 is an illustration depicting the purification of a
TLR4/MD-2 chimeric protein according to the invention from infected
Sf9 cell lysates.
[0062] FIG. 31 is a graph depicting the inhibition of
lipopolysaccharide-(LPS) induced IL-8 production using a soluble
chimeric TLR4/MD-2 protein according to the present invention.
[0063] FIG. 32A illustrates a nucleic acid sequence encoding the
accessory protein MD-1 (SEQ ID NO: 41).
[0064] FIG. 32B depicts an amino acid sequence of a mature MD-1
accessory protein in a preferred embodiment of the invention (SEQ
ID NO: 42).
[0065] FIG. 33A illustrates a nucleic acid sequence encoding the
accessory protein MD-2 (SEQ ID NO: 43).
[0066] FIG. 33B depicts an amino acid sequence of a mature MD-2
accessory protein (SEQ ID NO: 44).
[0067] FIGS. 34A, 34B and 34C are a schematic representation and a
series of graphs depicting the binding of hu15C1 and hu7E3 to
human-mouse hybrid versions of TLR4. FIG. 34A is a schematic
representation and summary table of the mouse-human TLR4 hybrid
mutants and antibody binding to these mutants. Red regions in the
schematic representation depict mouse-derived sequence and the blue
regions represent human-derived sequence. In the summary table of
antibody binding, (++) represents strong binding, (+) represents
intermediate binding and (-) indicates weak or no binding. FIG. 34B
is a series of flow cytometry histograms depicting monoclonal
antibody binding to transfected cells expressing the human-mouse
hybrids. The HEK 293 cells were transfected with wild-type TLR4
(row 1); mouse-human-human-human (MHHH) TLR4 (row 2);
mouse-mouse-human-human (row 3); mouse-human-mouse-human (MHMH)
TLR4 (row 4) or human-human-human-mouse (HHHM) TLR4 (row 5). Cells
were incubated with either .alpha.-FLAG.TM. antibody (to detect
TLR4 expression); .alpha.-C-myc antibody (to detect MD-2
expression) or the hu15C1 or hu7E3 monoclonal antibody, followed by
an APC-conjugated antibody. FIG. 34C is a series of flow cytometry
histograms depicting monoclonal antibody binding to transfected
cells expressing the human-mouse hybrids.
[0068] FIGS. 35A and 35B are a schematic representation and a
series of graphs depicting binding of hu15C1 and hu7E3 to
"fine-resolution" human-mouse hybrid versions of TLR4. FIG. 35A is
a schematic representation and summary table of the "fine
resolution" mouse-human TLR4 hybrid mutants and antibody binding to
these mutants. Red regions represent mouse-derived sequence and
blue regions represent human-derived sequence. In the summary table
of antibody binding, (++) represents strong binding, (+) represents
intermediate binding and (-) indicates weak or no binding. FIG. 35B
is a series of flow cytometry histograms depicting MAb binding to
transfected cells expressing the human-mouse hybrids.
[0069] FIGS. 36A and 36B are a schematic representation and a
series of graphs depicting binding of hu15C1 and hu7E3 to
alanine-scanning mutants of TLR4. FIG. 36A is a schematic
representation of the alanine scanning mutants (QC1-QC20; boxed
from 1 to 20 on the human sequence) selected after alignment of the
human and mouse TLR4 amino acid sequences from amino acids 289-375
and amino acids 288-373, respectively. Mutants were designed so
that any amino acid differences between human and mouse sequences
within the boxes were converted to an alanine in the human sequence
(e.g., QC2 is modified from YL to AA). FIG. 36B is a series of bar
graphs representing MAb binding to transfected cells expressing the
TLR4 alanine-scan mutants. For C-myc, the actual MFI obtained
following flow cytometric analysis is shown. For hu18H10, hu15C1
and hu7E3, values represent "normalized" antibody binding by
dividing the MFI obtained for the given MAb by that obtained for
the C-myc.
[0070] FIGS. 37A and 37B are a schematic representation and a
series of graphs depicting binding of hu18H10 to human-mouse hybrid
versions of MD-2. FIG. 37A is a schematic representation and
summary table of the mouse-human MD-2 hybrid mutants and antibody
binding to these mutants. Red regions represent mouse-derived
sequence and blue regions represent human-derived sequence. In the
summary table of antibody binding, (++) represents strong binding,
(+) represents intermediate binding and (-) indicates weak or no
binding. FIG. 37B is a series of flow cytometry histograms
depicting MAb binding to transfected cells expressing the
human-mouse hybrids.
[0071] FIGS. 38A and 38B are a schematic representation and a
series of graphs depicting binding of hu18H10 to alanine-scanning
mutants of MD-2. FIG. 38A is a schematic representation of the
alanine scanning mutants (QC1-QC14; boxed from 1 to 14 on the human
sequence) selected after alignment of the human and mouse MD-2
amino acid sequences from amino acids 19-57. Mutants were designed
so that any amino acid differences between human and mouse
sequences were converted to an alanine in the human sequence (e.g.,
QC1 is modified from Q to A). FIG. 38B is a series of bar graphs
representing MAb binding to transfected cells co-expressing wt TLR4
along with the MD-2 mutants. For the anti-6.times.HIS and hu15C1
MAbs, the actual MFI obtained following flow cytometric analysis is
shown. For hu18H10, both actual MFIs and values represent
"normalized" antibody binding (by dividing the MFI obtained for the
MAb by that obtained for anti-6.times.HIS) are shown.
[0072] FIG. 39 is a graph depicting that the hu18H10 humanized
monoclonal antibody ("18H10 hum") is capable of binding
specifically to the human TLR4/MD-2 complex on the surface of
transfected CHO cells. MAb binding to the TLR4/MD-2 transfected CHO
cells is shown by flow cytometry using the hu18H10 antibody or the
chimeric 18H10 ("18H10chim") (described above) at the
concentrations indicated. Binding is measured as a cellular Mean
Fluorescence Intensity (MFI) value.
[0073] FIG. 40 is a graph depicting that the hu7E3 humanized
monoclonal antibody that includes V.sub.H 2-70 shown in SEQ ID NO:
51 ("7E3 2-70/L-19") and the hu7E3 humanized monoclonal antibody
that includes V.sub.H 3-66 (SEQ ID NO: 52) ("7E3 3-66/L19") are
capable of binding specifically to the human TLR4/MD-2 complex on
the surface of transfected CHO cells. MAb binding to the TLR4/MD-2
transfected CHO cells is shown by flow cytometry using the hu7E3
antibodies or the chimeric 7E3 ("7E3 CHIM") (described above) at
the concentrations indicated. Binding is measured as a cellular
Mean Fluorescence Intensity (MFI) value.
[0074] FIG. 4I is a graph depicting that the hu15C1 humanized
antibody that includes V.sub.H 4-28 shown in SEQ ID NO: 45 ("15C1
4-28/A26") and variants thereof in which residues at chosen
positions have been replaced by the corresponding amino acid in the
given human germline ("15C1 4-28 QC 30/A26"; "15C1 4-28 QC 48/A26";
"15C1 4-28 QC 67/A26" and "15C1 4-28 QC 69/A26", see TABLE 1) are
capable of binding specifically to the human TLR4/MD-2 complex on
the surface of transfected CHO cells. MAb binding to the TLR4/MD-2
transfected CHO cells is shown by flow cytometry using the hu15C1
antibodies or the chimeric 15C1 ("15C1 CHIM") (described above) at
the concentrations indicated. Binding is measured as a cellular
Mean Fluorescence Intensity (MFI) value.
[0075] FIG. 42 is a graph depicting that the hu15C1 humanized
antibody that includes V.sub.H 3-66 shown in SEQ ID NO: 46 and
V.sub.L L6 shown in SEQ ID NO: 47 (15C1 3-66 L6) and the hu15C1
humanized antibody that includes V.sub.H 3-66 shown in SEQ ID NO:
46 and V.sub.L A26 shown in SEQ ID NO: 48 (15C1 3-66 A26) are
capable of binding specifically to the human TLR4/MD-2 complex on
the surface of transfected CHO cells. MAb binding to the TLR4/MD-2
transfected CHO cells is shown by flow cytometry using the hu15C1
3-66 L6 and hu15C1 3-66 A26 hu15C1 antibodies, the hu15C1 4-28 A26
antibody or the chimeric 15C1 ("15C1 CHIM") (described above) at
the concentrations indicated. Binding is measured as a cellular
Mean Fluorescence Intensity (MFI) value.
[0076] FIG. 43 depicts the amino acid sequence of human toll-like
receptor 4 (TLR4).
[0077] FIG. 44 is a series of graphs depicting inhibition of
LPS-induced IL-6 production in human whole blood by the monoclonal
antibody hu15C1 having the heavy chain variable region 4-28 and the
light chain variable region A26 ("4-28/A26"). The hu15C1 4-28/A26
was compared to an isotype matched control (IgG1) and the 15C1
chimeric antibody described herein.
DETAILED DESCRIPTION OF THE INVENTION
[0078] The present invention provides monoclonal antibodies (MAbs)
that specifically bind the human TLR4/MD-2 receptor complex. This
receptor complex is activated by lipopolysaccharide (LPS), the
major component of the outer membrane of gram-negative bacteria.
The monoclonal antibodies of the invention inhibit receptor
activation and subsequent intracellular signaling via LPS. Thus,
the monoclonal antibodies neutralize the activation of the
TLR4/MD-2 receptor complex. In particular, the invention provides
monoclonal antibodies that recognize the TLR4/MD-2 receptor complex
expressed on the cell surface. These monoclonal antibodies block
LPS-induced IL-8 production. In addition, some monoclonal
antibodies of the invention also recognize TLR4 when not complexed
with MD-2. The monoclonal antibody is, e.g., a humanized
antibody.
[0079] Antibodies of the invention include antibodies that bind the
human TLR4/MD-2 receptor complex and also bind TLR4 independently
of the presence of MD-2. Antibodies of the invention also include
antibodies that bind the TLR4 portion of the human TLR4/MD-2
receptor complex but binding is dependent on the presence of MD-2,
but binding is greatly enhanced by the presence of MD-2, which
suggests that the presence of the MD-2 causes a conformational
change in TLR4, thereby exposing an epitope bound by the antibody.
In addition, antibodies of the invention include antibodies that
bind the human TLR4/MD-2 receptor complex and also bind MD-2 in the
presence of TLR4.
[0080] Antibodies of the invention immunospecifically bind a
TLR4/MD-2 complex, wherein the antibody binds to an epitope that
includes one or more amino acid residues on human TLR4 between
residues 289 and 375 of SEQ ID NO: 54. Antibodies of the invention
immunospecifically bind the TLR4/MD2 complex, wherein the antibody
binds to an epitope on human MD-2 between residues 19 and 57 of SEQ
ID NO: 44.
[0081] Exemplary antibodies of the invention include, for example,
the 18H10 antibody, the 16G7 antibody, the 15C1 antibody and the
7E3 antibody. These antibodies show specificity for the human
TLR4/MD-2 receptor complex, and they have been shown to inhibit
receptor activation and subsequent intracellular signaling via LPS.
These antibodies have distinct specificities. For example, 16G7 and
15C1 bind TLR4 independently of the presence of MD-2, 7E3 binds to
TLR4, but binding is dependent on the presence of MD-2, and 18H10
binds to MD-2, but requires the presence of TLR4, as the MAb does
not bind soluble forms of MD-2.
[0082] As used herein, the terms "16G7", "mu16G7", "7E3", "mu7E3",
"15C1", "mu15C1", "18H10" or "mu18H10" refer to the murine
monoclonal antibody, and the terms "hu7E3", "hu15C1", or "hu18H10"
refer to the humanized monoclonal antibody.
[0083] The present invention also provides soluble chimeric toll
receptor proteins (also referred to herein as toll-like receptor
proteins), methods for expressing toll receptor proteins, and
methods for purifying such proteins in a soluble form. The chimeric
proteins are useful, e.g., in generating antibodies.
[0084] TLRs recognize microbial particles and activate immune cells
against the source of these microbial particles. (See Takeda et
al., Annu. Rev. Immunol., 21: 335-76 (2003), hereby incorporated by
reference in its entirety). TLR4 and MD-2 have been shown to form a
complex on the cell surface, and the presence of MD-2 appears
essential for the responsiveness of TLR4 to various ligands,
including LPS. LPS is a gram-negative bacterial outer membrane
glycolipid that is capable of strongly activating the innate immune
system. LPS has been implicated as one of the major factors
activating the immune system during the severe generalized
inflammation resulting from gram-negative infection. (Lakhani et
al., Curr. Opin. Pediatr. 15: 278-282 (2003), hereby incorporated
by reference in its entirety).
[0085] LPS delivers signals to immune cells via its multi-chain
receptor in which the TLR4/MD-2 complex is the principle signaling
component. LPS has been shown to exert its effects on the immune
system via signaling through TLR4. LPS rapidly binds to the
lipopolysaccharide-binding protein (LBP) in the bloodstream, and in
this form, LPS interacts with the GPI-anchored cell surface protein
CD14. LPS is then transferred to TLR4, which transduces an
intracellular activation signal. Another protein, MD-2, has been
found to be necessary for signal transduction via TLR4 to occur.
MD-2 interacts directly with TLR4 and plays an important role in
its post-translational modification and intracellular trafficking.
In addition, MD-2 has been shown to directly bind LPS, which
demonstrates the importance of this accessory protein in the LPS
receptor complex. (See Miyake K., Int. Immunopharmacol. 3:119-128
(2003), hereby incorporated by reference in its entirety).
[0086] Accordingly, neutralization of LPS signaling mediated by the
TLR4/MD-2 complex is a potential therapeutic strategy in the
treatment of disorders such as, for example, acute systemic
inflammation and sepsis induced by gram-negative bacterial
infection.
DEFINITIONS
[0087] Unless otherwise defined, scientific and technical terms
used in connection with the present invention shall have the
meanings that are commonly understood by those of ordinary skill in
the art. Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the
singular. Generally, nomenclatures utilized in connection with, and
techniques of, cell and tissue culture, molecular biology, and
protein and oligo- or polynucleotide chemistry and hybridization
described herein are those well-known and commonly used in the art.
Standard techniques are used for recombinant DNA, oligonucleotide
synthesis, and tissue culture and transformation (e.g.,
electroporation, lipofection). Enzymatic reactions and purification
techniques are performed according to manufacturer's specifications
or as commonly accomplished in the art or as described herein. The
foregoing techniques and procedures are generally performed
according to conventional methods well known in the art and as
described in various general and more specific references that are
cited and discussed throughout the present specification. See e.g.,
Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)). The nomenclatures utilized in connection with, and the
laboratory procedures and techniques of, analytical chemistry,
synthetic organic chemistry, and medicinal and pharmaceutical
chemistry described herein are those well-known and commonly used
in the art. Standard techniques are used for chemical syntheses,
chemical analyses, pharmaceutical preparation, formulation, and
delivery, and treatment of patients.
[0088] As utilized in accordance with the present disclosure, the
following terms, unless otherwise indicated, shall be understood to
have the following meanings:
[0089] As used herein, the term "antibody" refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
(Ig) molecules, i.e., molecules that contain an antigen binding
site that specifically binds (immunoreacts with) an antigen. By
"specifically bind" or "immunoreacts with" or "immunospecifically
bind" is meant that the antibody reacts with one or more antigenic
determinants of the desired antigen and does not react with other
polypeptides or binds at much lower affinity
(K.sub.d>10.sup.-6). Antibodies include, but are not limited to,
polyclonal, monoclonal, chimeric, dAb (domain antibody), single
chain, F.sub.ab, F.sub.ab' and F.sub.(ab')2 fragments, scFvs, and
an F.sub.ab expression library.
[0090] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 kDa). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function. In general, antibody
molecules obtained from humans relate to any of the classes IgG,
IgM, IgA, IgE and IgD, which differ from one another by the nature
of the heavy chain present in the molecule. Certain classes have
subclasses as well, such as IgG.sub.1, IgG.sub.2, and others.
Furthermore, in humans, the light chain may be a kappa chain or a
lambda chain.
[0091] The term "monoclonal antibody" (MAb) or "monoclonal antibody
composition", as used herein, refers to a population of antibody
molecules that contain only one molecular species of antibody
molecule consisting of a unique light chain gene product and a
unique heavy chain gene product. In particular, the complementarity
determining regions (CDRs) of the monoclonal antibody are identical
in all the molecules of the population. MAbs contain an antigen
binding site capable of immunoreacting with a particular epitope of
the antigen characterized by a unique binding affinity for it.
[0092] The term "antigen-binding site," or "binding portion" refers
to the part of the immunoglobulin molecule that participates in
antigen binding. The antigen binding site is formed by amino acid
residues of the N-terminal variable ("V") regions of the heavy
("H") and light ("L") chains. Three highly divergent stretches
within the V regions of the heavy and light chains, referred to as
"hypervariable regions," are interposed between more conserved
flanking stretches known as "framework regions," or "FRs". Thus,
the term "FR" refers to amino acid sequences which are naturally
found between, and adjacent to, hypervariable regions in
immunoglobulins. In an antibody molecule, the three hypervariable
regions of a light chain and the three hypervariable regions of a
heavy chain are disposed relative to each other in three
dimensional space to form an antigen-binding surface. The
antigen-binding surface is complementary to the three-dimensional
surface of a bound antigen, and the three hypervariable regions of
each of the heavy and light chains are referred to as
"complementarity-determining regions," or "CDRs." The assignment of
amino acids to each domain is in accordance with the definitions of
Kabat Sequences of Proteins of Immunological Interest (National
Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia
& Lesk J. Mol. Biol. 196:901-917 (1987), Chothia et al. Nature
342:878-883 (1989).
[0093] As used herein, the term "epitope" includes any protein
determinant capable of specific binding to an immunoglobulin, an
scFv, or a T-cell receptor. The term "epitope" includes any protein
determinant capable of specific binding to an immunoglobulin or
T-cell receptor. Epitopic determinants usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. For example, antibodies may be raised against
N-terminal or C-terminal peptides of a polypeptide. An antibody is
said to specifically bind an antigen when the dissociation constant
is .ltoreq.1 .mu.M; preferably .ltoreq.100 nM and most preferably
.ltoreq.10 nM.
[0094] As used herein, the terms "immunological binding," and
"immunological binding properties" refer to the non-covalent
interactions of the type which occur between an immunoglobulin
molecule and an antigen for which the immunoglobulin is specific.
The strength, or affinity of immunological binding interactions can
be expressed in terms of the dissociation constant (K.sub.d) of the
interaction, wherein a smaller K.sub.d represents a greater
affinity. Immunological binding properties of selected polypeptides
can be quantified using methods well known in the art. One such
method entails measuring the rates of antigen-binding site/antigen
complex formation and dissociation, wherein those rates depend on
the concentrations of the complex partners, the affinity of the
interaction, and geometric parameters that equally influence the
rate in both directions. Thus, both the "on rate constant"
(K.sub.on) and the "off rate constant" (K.sub.off) can be
determined by calculation of the concentrations and the actual
rates of association and dissociation. (See Nature 361:186-87
(1993)). The ratio of K.sub.off/K.sub.on enables the cancellation
of all parameters not related to affinity, and is equal to the
dissociation constant K.sub.d. (See, generally, Davies et al.
(1990) Annual Rev Biochem 59:439-473). An antibody of the present
invention is said to specifically bind to the Toll-like Receptor 4
(TLR4)/MD-2 complex or to TLR4 when not complexed to MD-2, when the
equilibrium binding constant (K.sub.d) is .ltoreq.1 .mu.M,
preferably .ltoreq.100 nM, more preferably .ltoreq.10 nM, and most
preferably .ltoreq.100 pM to about 1 pM, as measured by assays such
as radioligand binding assays or similar assays known to those
skilled in the art.
[0095] The term "isolated polynucleotide" as used herein shall mean
a polynucleotide of genomic, cDNA, or synthetic origin or some
combination thereof, which by virtue of its origin the "isolated
polynucleotide" (1) is not associated with all or a portion of a
polynucleotide in which the "isolated polynucleotide" is found in
nature, (2) is operably linked to a polynucleotide which it is not
linked to in nature, or (3) does not occur in nature as part of a
larger sequence. Polynucleotides in accordance with the invention
include the nucleic acid molecules encoding the heavy chain
immunoglobulin molecules presented in SEQ ID NOS: 2, 12, 22, 32,
45, 46, 49, 51 and 52, and nucleic acid molecules encoding the
light chain immunoglobulin molecules represented in SEQ ID NOS: 7,
17, 27, 37, 47, 48, 50 and 53.
[0096] The term "isolated protein" referred to herein means a
protein of cDNA, recombinant RNA, or synthetic origin or some
combination thereof, which by virtue of its origin, or source of
derivation, the "isolated protein" (1) is not associated with
proteins found in nature, (2) is free of other proteins from the
same source, e.g., free of marine proteins, (3) is expressed by a
cell from a different species, or (4) does not occur in nature.
[0097] The term "polypeptide" is used herein as a generic term to
refer to native protein, fragments, or analogs of a polypeptide
sequence. Hence, native protein fragments, and analogs are species
of the polypeptide genus. Polypeptides in accordance with the
invention comprise the heavy chain immunoglobulin molecules
represented in SEQ ID NOS: 2, 12, 22, 32, 45, 46, 49, 51 and 52,
and the light chain immunoglobulin molecules represented in SEQ ID
NOS: 7, 17, 27, 37, 47, 48, 50 and 53, as well as antibody
molecules formed by combinations comprising the heavy chain
immunoglobulin molecules with light chain immunoglobulin molecules,
such as kappa light chain immunoglobulin molecules, and vice versa,
as well as fragments and analogs thereof.
[0098] The term "naturally-occurring" as used herein as applied to
an object refers to the fact that an object can be found in nature.
For example, a polypeptide or polynucleotide sequence that is
present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory or otherwise is
naturally-occurring.
[0099] The term "operably linked" as used herein refers to
positions of components so described are in a relationship
permitting them to function in their intended manner. A control
sequence "operably linked" to a coding sequence is ligated in such
a way that expression of the coding sequence is achieved under
conditions compatible with the control sequences.
[0100] The term "control sequence" as used herein refers to
polynucleotide sequences which are necessary to effect the
expression and processing of coding sequences to which they are
ligated. The nature of such control sequences differs depending
upon the host organism in prokaryotes, such control sequences
generally include promoter, ribosomal binding site, and
transcription termination sequence in eukaryotes, generally, such
control sequences include promoters and transcription termination
sequence. The term "control sequences" is intended to include, at a
minimum, all components whose presence is essential for expression
and processing, and can also include additional components whose
presence is advantageous, for example, leader sequences and fusion
partner sequences. The term "polynucleotide" as referred to herein
means a polymeric boron of nucleotides of at least 10 bases in
length, either ribonucleotides or deoxynucleotides or a modified
form of either type of nucleotide. The term includes single and
double stranded forms of DNA.
[0101] The term oligonucleotide referred to herein includes
naturally occurring, and modified nucleotides linked together by
naturally occurring, and non-naturally occurring oligonucleotide
linkages. Oligonucleotides are a polynucleotide subset generally
comprising a length of 200 bases or fewer. Preferably
oligonucleotides are 10 to 60 bases in length and most preferably
12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 bases in length.
Oligonucleotides are usually single stranded, e.g., for probes,
although oligonucleotides may be double stranded, e.g., for use in
the construction of a gene mutant. Oligonucleotides of the
invention are either sense or antisense oligonucleotides.
[0102] The term "naturally occurring nucleotides" referred to
herein includes deoxyribonucleotides and ribonucleotides. The term
"modified nucleotides" referred to herein includes nucleotides with
modified or substituted sugar groups and the like. The term
"oligonucleotide linkages" referred to herein includes
Oligonucleotides linkages such as phosphorothioate,
phosphorodithioate, phosphoroselerloate, phosphorodiselenoate,
phosphoroanilothioate, phoshoraniladate, phosphoronmidate, and the
like. See e.g., LaPlanche et al. Nucl. Acids Res. 14:9081 (1986);
Stec et al. J. Am. Chem. Soc. 106:6077 (1984), Stein et al. Nucl.
Acids Res. 16:3209 (1988), Zon et al. Anti Cancer Drug Design 6:539
(1991); Zon et al. Oligonucleotides and Analogues: A Practical
Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press,
Oxford England (1991)); Stec et al. U.S. Pat. No. 5,151,510;
Uhlmann and Peyman Chemical Reviews 90:543 (1990). An
oligonucleotide can include a label for detection, if desired.
[0103] The term "selectively hybridize" referred to herein means to
detectably and specifically bind. Polynucleotides, oligonucleotides
and fragments thereof in accordance with the invention selectively
hybridize to nucleic acid strands under hybridization and wash
conditions that minimize appreciable amounts of detectable binding
to nonspecific nucleic acids. High stringency conditions can be
used to achieve selective hybridization conditions as known in the
art and discussed herein. Generally, the nucleic acid sequence
homology between the polynucleotides, oligonucleotides, and
fragments of the invention and a nucleic acid sequence of interest
will be at least 80%, and more typically with preferably increasing
homologies of at least 85%, 90%, 95%, 99%, and 100%. Two amino acid
sequences are homologous if there is a partial or complete identity
between their sequences. For example, 85% homology means that 85%
of the amino acids are identical when the two sequences are aligned
for maximum matching. Gaps (in either of the two sequences being
matched) are allowed in maximizing matching gap lengths of 5 or
less are preferred with 2 or less being more preferred.
Alternatively and preferably, two protein sequences (or polypeptide
sequences derived from them of at least 30 amino acids in length)
are homologous, as this term is used herein, if they have an
alignment score of at more than 5 (in standard deviation units)
using the program ALIGN with the mutation data matrix and a gap
penalty of 6 or greater. See Dayhoff, M. O., in Atlas of Protein
Sequence and Structure, pp. 101-110 (Volume 5, National Biomedical
Research Foundation (1972)) and Supplement 2 to this volume, pp.
1-10. The two sequences or parts thereof are more preferably
homologous if their amino acids are greater than or equal to 50%
identical when optimally aligned using the ALIGN program. The term
"corresponds to" is used herein to mean that a polynucleotide
sequence is homologous (i.e., is identical, not strictly
evolutionarily related) to all or a portion of a reference
polynucleotide sequence, or that a polypeptide sequence is
identical to a reference polypeptide sequence. In
contradistinction, the term "complementary to" is used herein to
mean that the complementary sequence is homologous to all or a
portion of a reference polynucleotide sequence. For illustration,
the nucleotide sequence "TATAC" corresponds to a reference sequence
"TATAC" and is complementary to a reference sequence "GTATA".
[0104] The following terms are used to describe the sequence
relationships between two or more polynucleotide or amino acid
sequences: "reference sequence", "comparison window", "sequence
identity", "percentage of sequence identity", and "substantial
identity". A "reference sequence" is a defined sequence used as a
basis for a sequence comparison a reference sequence may be a
subset of a larger sequence, for example, as a segment of a
full-length cDNA or gene sequence given in a sequence listing or
may comprise a complete cDNA or gene sequence. Generally, a
reference sequence is at least 18 nucleotides or 6 amino acids in
length, frequently at least 24 nucleotides or 8 amino acids in
length, and often at least 48 nucleotides or 16 amino acids in
length. Since two polynucleotides or amino acid sequences may each
(1) comprise a sequence (i.e., a portion of the complete
polynucleotide or amino acid sequence) that is similar between the
two molecules, and (2) may further comprise a sequence that is
divergent between the two polynucleotides or amino acid sequences,
sequence comparisons between two (or more) molecules are typically
performed by comparing sequences of the two molecules over a
"comparison window" to identify and compare local regions of
sequence similarity. A "comparison window", as used herein, refers
to a conceptual segment of at least 18 contiguous nucleotide
positions or 6 amino acids wherein a polynucleotide sequence or
amino acid sequence may be compared to a reference sequence of at
least 18 contiguous nucleotides or 6 amino acid sequences and
wherein the portion of the polynucleotide sequence in the
comparison window may comprise additions, deletions, substitutions,
and the like (i.e., gaps) of 20 percent or less as compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Optimal alignment of
sequences for aligning a comparison window may be conducted by the
local homology algorithm of Smith and Waterman Adv. Appl. Math.
2:482 (1981), by the homology alignment algorithm of Needleman and
Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity
method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.)
85:2444 (1988), by computerized implementations of these algorithms
(GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software
Package Release 7.0, (Genetics Computer Group, 575 Science Dr.,
Madison, Wis.), Geneworks, or MacVector software packages), or by
inspection, and the best alignment (i.e., resulting in the highest
percentage of homology over the comparison window) generated by the
various methods is selected.
[0105] The term "sequence identity" means that two polynucleotide
or amino acid sequences are identical (i.e., on a
nucleotide-by-nucleotide or residue-by-residue basis) over the
comparison window. The term "percentage of sequence identity" is
calculated by comparing two optimally aligned sequences over the
window of comparison, determining the number of positions at which
the identical nucleic acid base (e.g., A, T, C, G, U or I) or
residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the comparison window (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity. The terms "substantial identity" as used herein
denotes a characteristic of a polynucleotide or amino acid
sequence, wherein the polynucleotide or amino acid comprises a
sequence that has at least 85 percent sequence identity, preferably
at least 90 to 95 percent sequence identity, more usually at least
99 percent sequence identity as compared to a reference sequence
over a comparison window of at least 18 nucleotide (6 amino acid)
positions, frequently over a window of at least 24-48 nucleotide
(8-16 amino acid) positions, wherein the percentage of sequence
identity is calculated by comparing the reference sequence to the
sequence which may include deletions or additions which total 20
percent or less of the reference sequence over the comparison
window. The reference sequence may be a subset of a larger
sequence.
[0106] As used herein, the twenty conventional amino acids and
their abbreviations follow conventional usage. See Immunology--A
Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds., Sinauer
Associates, Sunderland 7 Mass. (1991)). Stereoisomers (e.g.,
D-amino acids) of the twenty conventional amino acids, unnatural
amino acids such as .alpha.-, .alpha.-disubstituted amino acids,
N-alkyl amino acids, lactic acid, and other unconventional amino
acids may also be suitable components for polypeptides of the
present invention. Examples of unconventional amino acids include:
4 hydroxyproline, .gamma.-carboxyglutamate,
.epsilon.-N,N,N-trimethyllysine, .epsilon.-N-acetyllysine,
O-phosphoserine, N-acetylserine, N-formylmethionine,
3-methylhistidine, 5-hydroxylysine, .sigma.-N-methylarginine, and
other similar amino acids and imino acids (e.g., 4-hydroxyproline).
In the polypeptide notation used herein, the left-hand direction is
the amino terminal direction and the right-hand direction is the
carboxy-terminal direction, in accordance with standard usage and
convention.
[0107] Similarly, unless specified otherwise, the left-hand end of
single-stranded polynucleotide sequences is the 5' end the
left-hand direction of double-stranded polynucleotide sequences is
referred to as the 5' direction. The direction of 5' to 3' addition
of nascent RNA transcripts is referred to as the transcription
direction sequence regions on the DNA strand having the same
sequence as the RNA and which are 5' to the 5' end of the RNA
transcript are referred to as "upstream sequences", sequence
regions on the DNA strand having the same sequence as the RNA and
which are 3' to the 3' end of the RNA transcript are referred to as
"downstream sequences".
[0108] As applied to polypeptides, the term "substantial identity"
means that two peptide sequences, when optimally aligned, such as
by the programs GAP or BESTFIT using default gap weights, share at
least 80 percent sequence identity, preferably at least 90 percent
sequence identity, more preferably at least 95 percent sequence
identity, and most preferably at least 99 percent sequence
identity.
[0109] Preferably, residue positions which are not identical differ
by conservative amino acid substitutions.
[0110] Conservative amino acid substitutions refer to the
interchangeability of residues having similar side chains. For
example, a group of amino acids having aliphatic side chains is
glycine, alanine, valine, leucine, and isoleucine; a group of amino
acids having aliphatic-hydroxyl side chains is serine and
threonine; a group of amino acids having amide-containing side
chains is asparagine and glutamine; a group of amino acids having
aromatic side chains is phenylalanine, tyrosine, and tryptophan; a
group of amino acids having basic side chains is lysine, arginine,
and histidine; and a group of amino acids having sulfur-containing
side chains is cysteine and methionine. Preferred conservative
amino acids substitution groups are: valine-leucine-isoleucine,
phenylalanine-tyrosine, lysine-arginine, alanine valine,
glutamic-aspartic, and asparagine-glutamine.
[0111] As discussed herein, minor variations in the amino acid
sequences of antibodies or immunoglobulin molecules are
contemplated as being encompassed by the present invention,
providing that the variations in the amino acid sequence maintain
at least 75%, more preferably at least 80%, 90%, 95%, and most
preferably 99%. In particular, conservative amino acid replacements
are contemplated. Conservative replacements are those that take
place within a family of amino acids that are related in their side
chains. Genetically encoded amino acids are generally divided into
families: (1) acidic amino acids are aspartate, glutamate; (2)
basic amino acids are lysine, arginine, histidine; (3) non-polar
amino acids are alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan, and (4) uncharged polar
amino acids are glycine, asparagine, glutamine, cysteine, serine,
threonine, tyrosine. The hydrophilic amino acids include arginine,
asparagine, aspartate, glutamine, glutamate, histidine, lysine,
serine, and threonine. The hydrophobic amino acids include alanine,
cysteine, isoleucine, leucine, methionine, phenylalanine, proline,
tryptophan, tyrosine and valine. Other families of amino acids
include (i) serine and threonine, which are the aliphatic-hydroxy
family; (ii) asparagine and glutamine, which are the amide
containing family; (iii) alanine, valine, leucine and isoleucine,
which are the aliphatic family; and (iv) phenylalanine, tryptophan,
and tyrosine, which are the aromatic family. For example, it is
reasonable to expect that an isolated replacement of a leucine with
an isoleucine or valine, an aspartate with a glutamate, a threonine
with a serine, or a similar replacement of an amino acid with a
structurally related amino acid will not have a major effect on the
binding or properties of the resulting molecule, especially if the
replacement does not involve an amino acid within a framework site.
Whether an amino acid change results in a functional peptide can
readily be determined by assaying the specific activity of the
polypeptide derivative. Assays are described in detail herein.
Fragments or analogs of antibodies or immunoglobulin molecules can
be readily prepared by those of ordinary skill in the art.
Preferred amino- and carboxy-termini of fragments or analogs occur
near boundaries of functional domains. Structural and functional
domains can be identified by comparison of the nucleotide and/or
amino acid sequence data to public or proprietary sequence
databases. Preferably, computerized comparison methods are used to
identify sequence motifs or predicted protein conformation domains
that occur in other proteins of known structure and/or function.
Methods to identify protein sequences that fold into a known
three-dimensional structure are known. Bowie et al. Science 253:164
(1991). Thus, the foregoing examples demonstrate that those of
skill in the art can recognize sequence motifs and structural
conformations that may be used to define structural and functional
domains in accordance with the invention.
[0112] Preferred amino acid substitutions are those which: (1)
reduce susceptibility to proteolysis, (2) reduce susceptibility to
oxidation, (3) alter binding affinity for forming protein
complexes, (4) alter binding affinities, and (4) confer or modify
other physicochemical or functional properties of such analogs.
Analogs can include various muteins of a sequence other than the
naturally-occurring peptide sequence. For example, single or
multiple amino acid substitutions (preferably conservative amino
acid substitutions) may be made in the naturally-occurring sequence
(preferably in the portion of the polypeptide outside the domain(s)
forming intermolecular contacts. A conservative amino acid
substitution should not substantially change the structural
characteristics of the parent sequence (e.g., a replacement amino
acid should not tend to break a helix that occurs in the parent
sequence, or disrupt other types of secondary structure that
characterizes the parent sequence). Examples of art-recognized
polypeptide secondary and tertiary structures are described in
Proteins, Structures and Molecular Principles (Creighton, Ed., W.
H. Freeman and Company, New York (1984)); Introduction to Protein
Structure (C. Branden and J. Tooze, eds., Garland Publishing, New
York, N.Y. (1991)); and Thornton et at. Nature 354:105 (1991).
[0113] The term "polypeptide fragment" as used herein refers to a
polypeptide that has an amino terminal and/or carboxy-terminal
deletion, but where the remaining amino acid sequence is identical
to the corresponding positions in the naturally-occurring sequence
deduced, for example, from a full length cDNA sequence. Fragments
typically are at least 5, 6, 8 or 10 amino acids long, preferably
at least 14 amino acids long' more preferably at least 20 amino
acids long, usually at least 50 amino acids long, and even more
preferably at least 70 amino acids long. The term "analog" as used
herein refers to polypeptides which are comprised of a segment of
at least 25 amino acids that has substantial identity to a portion
of a deduced amino acid sequence and which has specific binding to
TLR4/MD2 complex or TLR4 alone, under suitable binding conditions.
Typically, polypeptide analogs comprise a conservative amino acid
substitution (or addition or deletion) with respect to the
naturally-occurring sequence. Analogs typically are at least 20
amino acids long, preferably at least 50 amino acids long or
longer, and can often be as long as a full-length
naturally-occurring polypeptide.
[0114] Peptide analogs are commonly used in the pharmaceutical
industry as non-peptide drugs with properties analogous to those of
the template peptide. These types of non-peptide compound are
termed "peptide mimetics" or "peptidomimetics". Fauchere, J. Adv.
Drug Res. 15:29 (1986), Veber and Freidinger TINS p. 392 (1985);
and Evans et al. J. Med. Chem. 30:1229 (1987). Such compounds are
often developed with the aid of computerized molecular modeling.
Peptide mimetics that are structurally similar to therapeutically
useful peptides may be used to produce an equivalent therapeutic or
prophylactic effect. Generally, peptidomimetics are structurally
similar to a paradigm polypeptide (i.e., a polypeptide that has a
biochemical property or pharmacological activity), such as human
antibody, but have one or more peptide linkages optionally replaced
by a linkage selected from the group consisting of: --CH.sub.2NH--,
--CH.sub.2S--, --CH.sub.2--CH.sub.2--, --CH.dbd.CH-(cis and trans),
--COCH.sub.2--, CH(OH)CH.sub.2--, and --CH.sub.2SO--, by methods
well known in the art. Systematic substitution of one or more amino
acids of a consensus sequence with a D-amino acid of the same type
(e.g., D-lysine in place of L-lysine) may be used to generate more
stable peptides. In addition, constrained peptides comprising a
consensus sequence or a substantially identical consensus sequence
variation may be generated by methods known in the art (Rizo and
Gierasch Ann. Rev. Biochem. 61:387 (1992)); for example, by adding
internal cysteine residues capable of forming intramolecular
disulfide bridges which cyclize the peptide.
[0115] The term "agent" is used herein to denote a chemical
compound, a mixture of chemical compounds, a biological
macromolecule, or an extract made from biological materials.
[0116] As used herein, the terms "label" or "labeled" refers to
incorporation of a detectable marker, e.g., by incorporation of a
radiolabeled amino acid or attachment to a polypeptide of biotinyl
moieties that can be detected by marked avidin (e.g., streptavidin
containing a fluorescent marker or enzymatic activity that can be
detected by optical or calorimetric methods). In certain
situations, the label or marker can also be therapeutic. Various
methods of labeling polypeptides and glycoproteins are known in the
art and may be used. Examples of labels for polypeptides include,
but are not limited to, the following: radioisotopes or
radionuclides (e.g., .sup.3H, .sup.14C, .sup.15N, .sup.35S,
.sup.90Y, .sup.99Tc, .sup.111In, .sup.125I, .sup.131I), fluorescent
labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic
labels (e.g., horseradish peroxidase, p-galactosidase, luciferase,
alkaline phosphatase), chemiluminescent, biotinyl groups,
predetermined polypeptide epitopes recognized by a secondary
reporter (e.g., leucine zipper pair sequences, binding sites for
secondary antibodies, metal binding domains, epitope tags). In some
embodiments, labels are attached by spacer arms of various lengths
to reduce potential steric hindrance. The term "pharmaceutical
agent or drug" as used herein refers to a chemical compound or
composition capable of inducing a desired therapeutic effect when
properly administered to a patient.
[0117] Other chemistry terms herein are used according to
conventional usage in the art, as exemplified by The McGraw-Hill
Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San
Francisco (1985)).
[0118] The term "antineoplastic agent" is used herein to refer to
agents that have the functional property of inhibiting a
development or progression of a neoplasm in a human, particularly a
malignant (cancerous) lesion, such as a carcinoma, sarcoma,
lymphoma, or leukemia. Inhibition of metastasis is frequently a
property of antineoplastic agents.
[0119] As used herein, "substantially pure" means an object species
is the predominant species present (i.e., on a molar basis it is
more abundant than any other individual species in the
composition), and preferably a substantially purified fraction is a
composition wherein the object species comprises at least about 50
percent (on a molar basis) of all macromolecular species
present.
[0120] Generally, a substantially pure composition will comprise
more than about 80 percent of all macromolecular species present in
the composition, more preferably more than about 85%, 90%, 95%, and
99%. Most preferably, the object species is purified to essential
homogeneity (contaminant species cannot be detected in the
composition by conventional detection methods) wherein the
composition consists essentially of a single macromolecular
species.
[0121] The term patient includes human and veterinary subjects.
[0122] Antibodies
[0123] Monoclonal antibodies of the invention (e.g., murine
monoclonal or humanized antibodies) have the ability to inhibit
LPS-induced proinflammatory cytokine production. Inhibition is
determined, for example, in the human whole blood and huTLR4/MD2
transfected HEK 293 cellular assays described herein. Exemplary
monoclonal antibodies include, for example, the antibodies referred
to herein as "mu18H10", "hu18H10", "mu16G7", "mu15C1", "hu15C1",
"mu7E3" and "hu7E3". The mu18H10 and hu18H10 antibodies recognize
the TLR4/MD-2 complex, but do not recognize an MD-2 protein when
not complexed with TLR4. The mu16G7, mu15C1, hu15C1, mu7E3 and
hu7E3 monoclonal antibodies recognize the TLR4/MD-2 complex.
mu15C1, hu15C1 and 16G7 also recognize TLR4 when not complexed with
MD-2.
[0124] Also included in the invention are antibodies that bind to
the same epitope as the antibodies described herein. For example,
antibodies of the invention immunospecifically bind a TLR4/MD-2
complex, wherein the antibody binds to an epitope that includes one
or more amino acid residues on human TLR4 between residues 289 and
375 of SEQ ID NO: 54. Antibodies of the invention
immunospecifically bind the TLR4/MD2 complex, wherein the antibody
binds to an epitope on human MD-2 between residues 19 and 57 of SEQ
ID NO: 44. Those skilled in the art will recognize that it is
possible to determine, without undue experimentation, if a
monoclonal antibody (e.g., a murine monoclonal or humanized
antibody) has the same specificity as a monoclonal antibody of the
invention (e.g., mu18H10, hu18H10, mu16G7, mu15C1, hu15C1, mu7E3
and/or hu7E3) by ascertaining whether the former prevents the
latter from binding to the TLR4/MD-2 complex or to TLR4 when not
complexed to MD-2. If the monoclonal antibody being tested competes
with the monoclonal antibody of the invention, as shown by a
decrease in binding by the monoclonal antibody of the invention,
then the two monoclonal antibodies bind to the same, or a closely
related, epitope. An alternative method for determining whether a
monoclonal antibody has the specificity of monoclonal antibody of
the invention is to pre-incubate the monoclonal antibody of the
invention with the TLR4/MD-2 complex or a soluble TLR4 protein
(with which it is normally reactive), and then add the monoclonal
antibody being tested to determine if the monoclonal antibody being
tested is inhibited in its ability to bind the TLR4/MD-2 complex or
to bind TLR4 and TLR4 complexed with MD-2. If the monoclonal
antibody being tested is inhibited then, in all likelihood, it has
the same, or functionally equivalent, epitopic specificity as the
monoclonal antibody of the invention. Screening of monoclonal
antibodies of the invention, can be also carried out by measuring
LPS-induced IL-8 production and determining whether the test
monoclonal antibody is able to neutralize LPS-induced IL-8
production.
[0125] Various procedures known within the art may be used for the
production of polyclonal or monoclonal antibodies directed against
the TLR4/MD-2 complex, or to TLR4 when not complexed to MD-2, or
against derivatives, fragments, analogs homologs or orthologs
thereof. (See, for example, Antibodies: A Laboratory Manual, Harlow
E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., incorporated herein by reference).
[0126] Antibodies are purified by well-known techniques, such as
affinity chromatography using protein A or protein G, which provide
primarily the IgG fraction of immune serum. Subsequently, or
alternatively, the specific antigen which is the target of the
immunoglobulin sought, or an epitope thereof, may be immobilized on
a column to purify the immune specific antibody by immunoaffinity
chromatography. Purification of immunoglobulins is discussed, for
example, by D. Wilkinson (The Scientist, published by The
Scientist, Inc., Philadelphia Pa., Vol. 14, No. 8 (Apr. 17, 2000),
pp. 25-28).
[0127] The antibodies of the invention (e.g., hu18H10, 16G7, hu15C1
and hu7E3) are monoclonal antibodies. Monoclonal antibodies that
neutralize LPS-signaling that is mediated by the TLR4/MD-2 complex
are generated, e.g., by immunizing BALB/c mice with combinations of
cell transfectants expressing high levels of TLR4 and MD-2 on their
surface and a recombinant soluble chimeric protein comprising both
TLR4 and MD-2 tethered by a flexible linker sequence. Hybridomas
resulting from myeloma/B cell fusions are then screened for
reactivity to this TLR4/MD-2 complex.
[0128] Monoclonal antibodies are prepared, for example, using
hybridoma methods, such as those described by Kohler and Milstein,
Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or
other appropriate host animal, is typically immunized with an
immunizing agent to elicit lymphocytes that produce or are capable
of producing antibodies that will specifically bind to the
immunizing agent. Alternatively, the lymphocytes can be immunized
in vitro.
[0129] The immunizing agent will typically include the protein
antigen, a fragment thereof or a fusion protein thereof. Generally,
either peripheral blood lymphocytes are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell (Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986) pp. 59-103). Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine and
human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells can be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
[0130] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Manassas, Va. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of monoclonal antibodies. (See Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63)).
[0131] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the antigen. Preferably, the binding specificity
of monoclonal antibodies produced by the hybridoma cells is
determined by immunoprecipitation or by an in vitro binding assay,
such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent
assay (ELISA). Such techniques and assays are known in the art. The
binding affinity of the monoclonal antibody can, for example, be
determined by the Scatchard analysis of Munson and Pollard, Anal.
Biochem., 107:220 (1980). Moreover, in therapeutic applications of
monoclonal antibodies, it is important to identify antibodies
having a high degree of specificity and a high binding affinity for
the target antigen.
[0132] After the desired hybridoma cells are identified, the clones
can be subcloned by limiting dilution procedures and grown by
standard methods. (See Goding, Monoclonal Antibodies: Principles
and Practice, Academic Press, (1986) pp. 59-103). Suitable culture
media for this purpose include, for example, Dulbecco's Modified
Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma
cells can be grown in vivo as ascites in a mammal.
[0133] The monoclonal antibodies secreted by the subclones can be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0134] Monoclonal antibodies can also be made by recombinant DNA
methods, such as those described in U.S. Pat. No. 4,816,567. DNA
encoding the monoclonal antibodies of the invention can be readily
isolated and sequenced using conventional procedures (e.g., by
using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA can be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also can be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences (see
U.S. Pat. No. 4,816,567; Morrison, Nature 368, 812-13 (1994)) or by
covalently joining to the immunoglobulin coding sequence all or
part of the coding sequence for a non-immunoglobulin polypeptide.
Such a non-immunoglobulin polypeptide can be substituted for the
constant domains of an antibody of the invention, or can be
substituted for the variable domains of one antigen-combining site
of an antibody of the invention to create a chimeric bivalent
antibody.
[0135] Monoclonal antibodies of the invention include humanized
antibodies or human antibodies. These antibodies are suitable for
administration to humans without engendering an immune response by
the human against the administered immunoglobulin. Humanized forms
of antibodies are chimeric immunoglobulins, immunoglobulin chains
or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) that are principally
comprised of the sequence of a human immunoglobulin, and contain
minimal sequence derived from a non-human immunoglobulin.
Humanization is performed, e.g., by following the method of Winter
and co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann
et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody. (See also U.S.
Pat. No. 5,225,539.) In some instances, Fv framework residues of
the human immunoglobulin are replaced by corresponding non-human
residues. Humanized antibodies also comprise, e.g., residues which
are found neither in the recipient antibody nor in the imported CDR
or framework sequences. In general, the humanized antibody includes
substantially all of at least one, and typically two, variable
domains, in which all or substantially all of the CDR regions
correspond to those of a non-human immunoglobulin and all or
substantially all of the framework regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also includes at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin (Jones et
al., 1986; Riechmann et al., 1988; and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)).
[0136] Fully human antibodies are antibody molecules in which the
entire sequence of both the light chain and the heavy chain,
including the CDRs, arise from human genes. Such antibodies are
termed "human antibodies", or "fully human antibodies" herein.
Monoclonal antibodies can be prepared by using trioma technique;
the human B-cell hybridoma technique (see Kozbor, et al., 1983
Immunol Today 4: 72); and the EBV hybridoma technique to produce
monoclonal antibodies (see Cole, et al., 1985 In: MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).
Monoclonal antibodies may be utilized and may be produced by using
human hybridomas (see Cote, et al., 1983. Proc Natl Acad Sci USA
80: 2026-2030) or by transforming human B-cells with Epstein Barr
Virus in vitro (see Cole, et al., 1985 In: MONOCLONAL ANTIBODIES
AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).
[0137] In addition, human antibodies can also be produced using
additional techniques, including phage display libraries. (See
Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al.,
J. Mol. Biol., 222:581 (1991)). Similarly, human antibodies can be
made by introducing human immunoglobulin loci into transgenic
animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge,
human antibody production is observed, which closely resembles that
seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire. This approach is described, for
example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825;
5,625,126; 5,633,425; 5,661,016, and in Marks et al.,
Bio/Technology 10, 779-783 (1992); Lonberg et al., Nature 368
856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et
al, Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature
Biotechnology 14, 826 (1996); and Lonberg and Huszar, Intern. Rev.
Immunol. 13 65-93 (1995).
[0138] Human antibodies may additionally be produced using
transgenic nonhuman animals which are modified so as to produce
fully human antibodies rather than the animal's endogenous
antibodies in response to challenge by an antigen. (See PCT
publication WO94/02602). The endogenous genes encoding the heavy
and light immunoglobulin chains in the nonhuman host have been
incapacitated, and active loci encoding human heavy and light chain
immunoglobulins are inserted into the host's genome. The human
genes are incorporated, for example, using yeast artificial
chromosomes containing the requisite human DNA segments. An animal
which provides all the desired modifications is then obtained as
progeny by crossbreeding intermediate transgenic animals containing
fewer than the full complement of the modifications. An example of
such a nonhuman animal is a mouse termed the Xenomouse.TM. as
disclosed in PCT publications WO 96/33735 and WO 96/34096. This
animal produces B cells which secrete fully human immunoglobulins.
The antibodies can be obtained directly from the animal after
immunization with an immunogen of interest, as, for example, a
preparation of a polyclonal antibody, or alternatively from
immortalized B cells derived from the animal, such as hybridomas
producing monoclonal antibodies. Additionally, the genes encoding
the immunoglobulins with human variable regions can be recovered
and expressed to obtain the antibodies directly, or can be further
modified to obtain analogs of antibodies such as, for example,
single chain Fv (scFv) molecules.
[0139] An example of a method of producing a nonhuman host,
exemplified as a mouse, lacking expression of an endogenous
immunoglobulin heavy chain is disclosed in U.S. Pat. No. 5,939,598.
It can be obtained by a method, which includes deleting the J
segment genes from at least one endogenous heavy chain locus in an
embryonic stem cell to prevent rearrangement of the locus and to
prevent formation of a transcript of a rearranged immunoglobulin
heavy chain locus, the deletion being effected by a targeting
vector containing a gene encoding a selectable marker; and
producing from the embryonic stem cell a transgenic mouse whose
somatic and germ cells contain the gene encoding the selectable
marker.
[0140] One method for producing an antibody of interest, such as a
human antibody, is disclosed in U.S. Pat. No. 5,916,771. This
method includes introducing an expression vector that contains a
nucleotide sequence encoding a heavy chain into one mammalian host
cell in culture, introducing an expression vector containing a
nucleotide sequence encoding a light chain into another mammalian
host cell, and fusing the two cells to form a hybrid cell. The
hybrid cell expresses an antibody containing the heavy chain and
the light chain.
[0141] In a further improvement on this procedure, a method for
identifying a clinically relevant epitope on an immunogen, and a
correlative method for selecting an antibody that binds
immunospecifically to the relevant epitope with high affinity, are
disclosed in PCT publication WO 99/53049.
[0142] The antibody can be expressed by a vector containing a DNA
segment encoding the single chain antibody described above.
[0143] These can include vectors, liposomes, naked DNA,
adjuvant-assisted DNA. gene gun, catheters, etc. Vectors include
chemical conjugates such as described in WO 93/64701, which has
targeting moiety (e.g. a ligand to a cellular surface receptor),
and a nucleic acid binding moiety (e.g. polylysine), viral vector
(e.g. a DNA or RNA viral vector), fusion proteins such as described
in PCT/US 95/02140 (WO 95/22618) which is a fusion protein
containing a target moiety (e.g. an antibody specific for a target
cell) and a nucleic acid binding moiety (e.g. a protamine),
plasmids, phage, etc. The vectors can be chromosomal,
non-chromosomal or synthetic.
[0144] Preferred vectors include viral vectors, fusion proteins and
chemical conjugates. Retroviral vectors include moloney murine
leukemia viruses. DNA viral vectors are preferred. These vectors
include pox vectors such as orthopox or avipox vectors, herpesvirus
vectors such as a herpes simplex I virus (HSV) vector (see Geller,
A. I. et al., J. Neurochem, 64:487 (1995); Lim, F., et al., in DNA
Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press,
Oxford England) (1995); Geller, A. I. et al., Proc Natl. Acad.
Sci.: U.S.A. 90:7603 (1993); Geller, A. I., et al., Proc Natl.
Acad. Sci USA 87:1149 (1990), Adenovirus Vectors (see LeGal LaSalle
et al., Science, 259:988 (1993); Davidson, et al., Nat. Genet 3:219
(1993); Yang, et al., J. Virol. 69:2004 (1995) and Adeno-associated
Virus Vectors (see Kaplitt, M. G. et al., Nat. Genet. 8:148
(1994).
[0145] Pox viral vectors introduce the gene into the cells
cytoplasm. Avipox virus vectors result in only a short term
expression of the nucleic acid. Adenovirus vectors,
adeno-associated virus vectors and herpes simplex virus (HSV)
vectors are preferred for introducing the nucleic acid into neural
cells. The adenovirus vector results in a shorter term expression
(about 2 months) than adeno-associated virus (about 4 months),
which in turn is shorter than HSV vectors. The particular vector
chosen will depend upon the target cell and the condition being
treated. The introduction can be by standard techniques, e.g.
infection, transfection, transduction or transformation. Examples
of modes of gene transfer include e.g., naked DNA, CaPO.sub.4
precipitation, DEAE dextran, electroporation, protoplast fusion,
lipofection, cell microinjection, and viral vectors.
[0146] The vector can be employed to target essentially any desired
target cell. For example, stereotaxic injection can be used to
direct the vectors (e.g. adenovirus, HSV) to a desired location.
Additionally, the particles can be delivered by
intracerebroventricular (icv) infusion using a minipump infusion
system, such as a SynchroMed Infusion System. A method based on
bulk flow, termed convection, has also proven effective at
delivering large molecules to extended areas of the brain and may
be useful in delivering the vector to the target cell. (See Bobo et
al., Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994); Morrison et
al., Am. J. Physiol. 266:292-305 (1994)). Other methods that can be
used include catheters, intravenous, parenteral, intraperitoneal
and subcutaneous injection, and oral or other known routes of
administration.
[0147] These vectors can be used to express large quantities of
antibodies that can be used in a variety of ways. For example, to
detect the presence of the TLR4/MD-2 complex and/or TLR4 in a
sample. The antibody can also be used to try to bind to and disrupt
TLR4/MD-2 complex-related signaling.
[0148] Techniques can be adapted for the production of single-chain
antibodies specific to an antigenic protein of the invention (see
e.g., U.S. Pat. No. 4,946,778). In addition, methods can be adapted
for the construction of F.sub.ab expression libraries (see e.g.,
Huse, et al., 1989 Science 246: 1275-1281) to allow rapid and
effective identification of monoclonal F.sub.ab fragments with the
desired specificity for a protein or derivatives, fragments,
analogs or homologs thereof. Antibody fragments that contain the
idiotypes to a protein antigen may be produced by techniques known
in the art including, but not limited to: (i) an F.sub.(ab')2
fragment produced by pepsin digestion of an antibody molecule; (ii)
an F.sub.ab fragment generated by reducing the disulfide bridges of
an F.sub.(ab')2 fragment; (iii) an F.sub.ab fragment generated by
the treatment of the antibody molecule with papain and a reducing
agent and (iv) F.sub.v fragments.
[0149] The invention also includes F.sub.v, F.sub.ab, F.sub.ab' and
F.sub.(ab')2 anti-TLR4/MD2 complex fragments or anti-TLR4
fragments, single chain anti-TLR4/MD2 or anti-TLR4 antibodies,
bispecific anti-TLR4/MD2 or anti-TLR4 antibodies and
heteroconjugate anti-TLR4/MD2 or anti-TLR4 antibodies.
[0150] Bispecific antibodies are antibodies that have binding
specificities for at least two different antigens. In the present
case, one of the binding specificities is for the TLR4/MD2 complex
and/or TLR4 when not complexed with MD-2. The second binding target
is any other antigen, and advantageously is a cell-surface protein
or receptor or receptor subunit.
[0151] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
(1983)). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0152] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0153] According to another approach described in WO 96/27011, the
interface between a pair of antibody molecules can be engineered to
maximize the percentage of heterodimers which are recovered from
recombinant cell culture. The preferred interface comprises at
least a part of the CH3 region of an antibody constant domain. In
this method, one or more small amino acid side chains from the
interface of the first antibody molecule are replaced with larger
side chains (e.g. tyrosine or tryptophan). Compensatory "cavities"
of identical or similar size to the large side chain(s) are created
on the interface of the second antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or
threonine). This provides a mechanism for increasing the yield of
the heterodimer over other unwanted end-products such as
homodimers.
[0154] Bispecific antibodies can be prepared as full length
antibodies or antibody fragments (e.g. F(ab').sub.2 bispecific
antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science 229:81 (1985) describe a procedure
wherein intact antibodies are proteolytically cleaved to generate
F(ab').sub.2 fragments. These fragments are reduced in the presence
of the dithiol complexing agent sodium arsenite to stabilize
vicinal dithiols and prevent intermolecular disulfide formation.
The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0155] Additionally, Fab' fragments can be directly recovered from
E. coli and chemically coupled to form bispecific antibodies.
Shalaby et al., J. Exp. Med. 175:217-225 (1992) describe the
production of a fully humanized bispecific antibody F(ab').sub.2
molecule. Each Fab' fragment was separately secreted from E. coli
and subjected to directed chemical coupling in vitro to form the
bispecific antibody. The bispecific antibody thus formed was able
to bind to cells overexpressing the ErbB2 receptor and normal human
T cells, as well as trigger the lytic activity of human cytotoxic
lymphocytes against human breast tumor targets.
[0156] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain (V.sub.H) connected to a light-chain
variable domain (V.sub.L) by a linker which is too short to allow
pairing between the two domains on the same chain. Accordingly, the
V.sub.H and V.sub.L domains of one fragment are forced to pair with
the complementary V.sub.L and V.sub.H domains of another fragment,
thereby forming two antigen-binding sites. Another strategy for
making bispecific antibody fragments by the use of single-chain Fv
(sFv) dimers has also been reported. See, Gruber et al., J.
Immunol. 152:5368 (1994).
[0157] Antibodies with more than two valencies are contemplated.
For example, trispecific antibodies can be prepared. Tutt et al.,
J. Immunol. 147:60 (1991).
[0158] Exemplary bispecific antibodies can bind to two different
epitopes, at least one of which originates in the protein antigen
of the invention. Alternatively, an anti-antigenic arm of an
immunoglobulin molecule can be combined with an arm which binds to
a triggering molecule on a leukocyte such as a T-cell receptor
molecule (e.g. CD2, CD3, CD28, or B7), or Fc receptors for IgG
(Fc.gamma.R), such as Fc.gamma.RI (CD64), Fc.gamma.RII (CD32) and
Fc.gamma.RIII (CD16) so as to focus cellular defense mechanisms to
the cell expressing the particular antigen. Bispecific antibodies
can also be used to direct cytotoxic agents to cells which express
a particular antigen. These antibodies possess an antigen-binding
arm and an arm which binds a cytotoxic agent or a radionuclide
chelator, such as EOTUBE, DPTA, DOTA, or TETA. Another bispecific
antibody of interest binds the protein antigen described herein and
further binds tissue factor (TF).
[0159] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells (see
U.S. Pat. No. 4,676,980), and for treatment of HIV infection (see
WO 91/00360; WO 92/200373; EP 03089). It is contemplated that the
antibodies can be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins can be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0160] It can be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance, e.g., the
effectiveness of the antibody in treating diseases and disorders
associated with aberrant LPS signaling. For example, cysteine
residue(s) can be introduced into the Fc region, thereby allowing
interchain disulfide bond formation in this region. The homodimeric
antibody thus generated can have improved internalization
capability and/or increased complement-mediated cell killing and
antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al.,
J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148:
2918-2922 (1992)). Alternatively, an antibody can be engineered
that has dual Fc regions and can thereby have enhanced complement
lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer
Drug Design, 3: 219-230 (1989)).
[0161] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a toxin (e.g.,
an enzymatically active toxin of bacterial, fungal, plant, or
animal origin, or fragments thereof), or a radioactive isotope
(i.e., a radioconjugate).
[0162] Enzymatically active toxins and fragments thereof that can
be used include diphtheria A chain, nonbinding active fragments of
diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins, Phytolaca americana
proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor,
curcin, crotin, sapaonaria officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, enomycin, and the
tricothecenes. A variety of radionuclides are available for the
production of radioconjugated antibodies. Examples include
.sup.212Bi, .sup.131I, .sup.31In, .sup.90Y, and .sup.186Re.
[0163] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein-coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. (See WO94/11026).
[0164] Those of ordinary skill in the art will recognize that a
large variety of possible moieties can be coupled to the resultant
antibodies of the invention. (See, for example, "Conjugate
Vaccines", Contributions to Microbiology and Immunology, J. M.
Cruse and R. E. Lewis, Jr (eds), Carger Press, New York, (1989),
the entire contents of which are incorporated herein by
reference).
[0165] Coupling may be accomplished by any chemical reaction that
will bind the two molecules so long as the antibody and the other
moiety retain their respective activities. This linkage can include
many chemical mechanisms, for instance covalent binding, affinity
binding, intercalation, coordinate binding and complexation. The
preferred binding is, however, covalent binding. Covalent binding
can be achieved either by direct condensation of existing side
chains or by the incorporation of external bridging molecules. Many
bivalent or polyvalent linking agents are useful in coupling
protein molecules, such as the antibodies of the present invention,
to other molecules. For example, representative coupling agents can
include organic compounds such as thioesters, carbodiimides,
succinimide esters, diisocyanates, glutaraldehyde, diazobenzenes
and hexamethylene diamines. This listing is not intended to be
exhaustive of the various classes of coupling agents known in the
art but, rather, is exemplary of the more common coupling agents.
(See Killen and Lindstrom, Jour. Immun. 133:1335-2549 (1984);
Jansen et al., Immunological Reviews 62:185-216 (1982); and Vitetta
et al., Science 238:1098 (1987).
[0166] Preferred linkers are described in the literature. (See, for
example, Ramakrishnan, S. et al., Cancer Res. 44:201-208 (1984)
describing use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide
ester). See also, U.S. Pat. No. 5,030,719, describing use of
halogenated acetyl hydrazide derivative coupled to an antibody by
way of an oligopeptide linker. Particularly preferred linkers
include: (i) EDC (1-ethyl-3-(3-dimethylamino-propyl) carbodiimide
hydrochloride; (ii) SMPT
(4-succinimidyloxycarbonyl-alpha-methyl-alpha-(2-pridyl-dithio)-toluene
(Pierce Chem. Co., Cat. (21558G); (iii) SPDP (succinimidyl-6
[3-(2-pyridyldithio) propionamido]hexanoate (Pierce Chem. Co., Cat
#21651G); (iv) Sulfo-LC-SPDP (sulfosuccinimidyl 6
[3-(2-pyridyldithio)-propianamide]hexanoate (Pierce Chem. Co. Cat.
#2165-G); and (v) sulfo-NHS (N-hydroxysulfo-succinimide: Pierce
Chem. Co., Cat. #24510) conjugated to EDC.
[0167] The linkers described above contain components that have
different attributes, thus leading to conjugates with differing
physio-chemical properties. For example, sulfo-NHS esters of alkyl
carboxylates are more stable than sulfo-NHS esters of aromatic
carboxylates. NHS-ester containing linkers are less soluble than
sulfo-NHS esters. Further, the linker SMPT contains a sterically
hindered disulfide bond, and can form conjugates with increased
stability. Disulfide linkages, are in general, less stable than
other linkages because the disulfide linkage is cleaved in vitro,
resulting in less conjugate available. Sulfo-NHS, in particular,
can enhance the stability of carbodimide couplings. Carbodimide
couplings (such as EDC) when used in conjunction with sulfo-NHS,
forms esters that are more resistant to hydrolysis than the
carbodimide coupling reaction alone.
[0168] The antibodies disclosed herein can also be formulated as
immunoliposomes. Liposomes containing the antibody are prepared by
methods known in the art, such as described in Epstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc.
Natl Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045
and 4,544,545. Liposomes with enhanced circulation time are
disclosed in U.S. Pat. No. 5,013,556.
[0169] Particularly useful liposomes can be generated by the
reverse-phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange
reaction.
[0170] Use of Antibodies Against the TLR4/MD2 Complex and
Antibodies Against TLR4
[0171] It will be appreciated that administration of therapeutic
entities in accordance with the invention will be administered with
suitable carriers, excipients, and other agents that are
incorporated into formulations to provide improved transfer,
delivery, tolerance, and the like. A multitude of appropriate
formulations can be found in the formulary known to all
pharmaceutical chemists: Remington's Pharmaceutical Sciences (15th
ed, Mack Publishing Company, Easton, Pa. (1975)), particularly
Chapter 87 by Blaug, Seymour, therein. These formulations include,
for example, powders, pastes, ointments, jellies, waxes, oils,
lipids, lipid (cationic or anionic) containing vesicles (such as
Lipofectin.TM.), DNA conjugates, anhydrous absorption pastes,
oil-in-water and water-in-oil emulsions, emulsions carbowax
(polyethylene glycols of various molecular weights), semi-solid
gels, and semi-solid mixtures containing carbowax. Any of the
foregoing mixtures may be appropriate in treatments and therapies
in accordance with the present invention, provided that the active
ingredient in the formulation is not inactivated by the formulation
and the formulation is physiologically compatible and tolerable
with the route of administration. See also Baldrick P.
"Pharmaceutical excipient development: the need for preclinical
guidance." Regul. Toxicol Pharmacol. 32(2):210-8 (2000), Wang W.
"Lyophilization and development of solid protein pharmaceuticals."
Int. J. Pharm. 203(1-2):1-60 (2000), Charman W N "Lipids,
lipophilic drugs, and oral drug delivery-some emerging concepts." J
Pharm Sci. 89(8):967-78 (2000), Powell et al. "Compendium of
excipients for parenteral formulations" PDA J Pharm Sci Technol.
52:238-311 (1998) and the citations therein for additional
information related to formulations, excipients and carriers well
known to pharmaceutical chemists.
[0172] Therapeutic formulations of the invention, which include a
monoclonal antibody of the invention (e.g., a murine monoclonal or
humanized monoclonal antibody), are used to treat or alleviate a
symptom associated with an immune-related disorder. The present
invention also provides methods of treating or alleviating a
symptom associated with an immune-related disorder. A therapeutic
regimen is carried out by identifying a subject, e.g., a human
patient suffering from (or at risk of developing) an immune-related
disorder, using standard methods.
[0173] Antibodies of the invention, which are capable of inhibiting
LPS-induced proinflammatory cytokine production, are useful
therapeutic tools in the treatment of disorders, such as, for
example, acute inflammation and sepsis induced by microbial
products (e.g., LPS) and exacerbations arising from this acute
inflammation, such as, for example, chronic obstructive pulmonary
disease and asthma (see O'Neill, Curr. Opin. Pharmacol. 3: 396-403
(2003), hereby incorporated by reference in its entirety). Such
antibodies are also useful in treating neurodegenerative autoimmune
diseases. (Lehnardt et al., Proc. Natl. Acad. Sci. USA 100:
8514-8519(2003), hereby incorporated by reference in its
entirety).
[0174] In addition, the antibodies of the invention are also useful
as therapeutic reagents in the treatment of diseases, such as, for
example, osteoarthritis, which are caused by mechanical stress,
which, in turn, induces endogenous soluble "stress" factors that
trigger TLR4. Endogenous soluble stress factor include e.g., Hsp60
(see Ohashi et al., J. Immunol. 164: 558-561 (2000)) and
fibronectin (see Okamura et al., J. Biol. Chem. 276: 10229-10233
(2001) and heparan sulphate, hyaluronan, gp96, .beta.-Defensin-2 or
surfactant protein A (see e.g., Johnson et al., Crit. Rev.
Immunol., 23(1-2):15-44 (2003), each of which is hereby
incorporated by reference in its entirety). The antibodies of the
invention are also useful in the treatment of a variety of
disorders associated with mechanical stress, such as for example,
mechanical stress that is associated with subjects and patients
placed on respirators, ventilators and other respiratory-assist
devices. For example, the antibodies of the invention are useful in
the treatment of ventilator-induced lung injury ("VILI"), also
referred to as ventilation-associated lung injury ("VALI").
[0175] Other disease areas in which inhibiting TLR4 function could
be beneficial include, for example, chronic inflammation (e.g.,
chronic inflammation associated with allergic conditions and
asthma), autoimmune diseases (e.g., inflammatory bowel disorder)
and atherosclerosis (see O'Neill, Curr. Opin. Pharmacol. 3: 396-403
(2003), hereby incorporated by reference in its entirety).
[0176] Symptoms associated with these immune-related disorders
include, for example, inflammation, fever, general malaise, fever,
pain, often localized to the inflamed area, rapid pulse rate, joint
pain or aches (arthralgia), rapid breathing or other abnormal
breathing patterns, chills, confusion, disorientation, agitation,
dizziness, cough, dyspnea, pulmonary infections, cardiac failure,
respiratory failure, edema, weight gain, mucopurulent relapses,
cachexia, wheezing, headache, and abdominal symptoms such as, for
example, abdominal pain, diarrhea or constipation.
[0177] Efficaciousness of treatment is determined in association
with any known method for diagnosing or treating the particular
immune-related disorder. Alleviation of one or more symptoms of the
immune-related disorder indicates that the antibody confers a
clinical benefit.
[0178] Methods for the screening of antibodies that possess the
desired specificity include, but are not limited to, enzyme linked
immunosorbent assay (ELISA) and other immunologically mediated
techniques known within the art.
[0179] Antibodies directed against the TLR4/MD-2 complex or to TLR4
when not complexed to MD-2 (or a fragment thereof) may be used in
methods known within the art relating to the localization and/or
quantitation of the TLR4/MD-2 complex or TLR4 (e.g., for use in
measuring levels of the TLR4/MD-2 complex or TLR4 within
appropriate physiological samples, for use in diagnostic methods,
for use in imaging the protein, and the like). In a given
embodiment, antibodies specific to the TLR4/MD-2 complex, or TLR4,
or derivative, fragment, analog or homolog thereof, that contain
the antibody derived antigen binding domain, are utilized as
pharmacologically active compounds (referred to hereinafter as
"Therapeutics").
[0180] An antibody specific for the TLR4/MD-2 complex or TLR4 can
be used to isolate the TLR4/MD-2 complex or a TLR4 polypeptide by
standard techniques, such as immunoaffinity, chromatography or
immunoprecipitation. Antibodies directed against the TLR4/MD-2
complex or a TLR4 protein (or a fragment thereof) can be used
diagnostically to monitor protein levels in tissue as part of a
clinical testing procedure, e.g., to, for example, determine the
efficacy of a given treatment regimen. Detection can be facilitated
by coupling (i.e., physically linking) the antibody to a detectable
substance. Examples of detectable substances include various
enzymes, prosthetic groups, fluorescent materials, luminescent
materials, bioluminescent materials, and radioactive materials.
Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, .beta.-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0181] Antibodies of the invention, including polyclonal,
monoclonal, humanized and fully human antibodies, may be used as
therapeutic agents. Such agents will generally be employed to treat
or prevent a disease or pathology associated with aberrant TLR4
signaling in a subject. An antibody preparation, preferably one
having high specificity and high affinity for its target antigen,
is administered to the subject and will generally have an effect
due to its binding with the target. Administration of the antibody
may abrogate or inhibit or interfere with the signaling function of
the target (e.g., the TLR4/MD-2 complex). Administration of the
antibody may abrogate or inhibit or interfere with the binding of
the target (e.g., TLR4) with an endogenous ligand (e.g., TLR4 or
the MD-2 accessory protein) to which it naturally binds. For
example, the antibody binds to the target and neutralizes
LPS-induced proinflammatory cytokine production.
[0182] A therapeutically effective amount of an antibody of the
invention relates generally to the amount needed to achieve a
therapeutic objective. As noted above, this may be a binding
interaction between the antibody and its target antigen that, in
certain cases, interferes with the functioning of the target. The
amount required to be administered will furthermore depend on the
binding affinity of the antibody for its specific antigen, and will
also depend on the rate at which an administered antibody is
depleted from the free volume other subject to which it is
administered. Common ranges for therapeutically effective dosing of
an antibody or antibody fragment of the invention may be, by way of
nonlimiting example, from about 0.1 mg/kg body weight to about 50
mg/kg body weight. Common dosing frequencies may range, for
example, from twice daily to once a week.
[0183] Antibodies specifically binding the TLR4/MD-2 complex or a
TLR4 protein or a fragment thereof of the invention can be
administered for the treatment of disorders associated with
aberrant LPS signaling in the form of pharmaceutical compositions.
Principles and considerations involved in preparing such
compositions, as well as guidance in the choice of components are
provided, for example, in Remington: The Science And Practice Of
Pharmacy 19th ed. (Alfonso R. Gennaro, et al., editors) Mack Pub.
Co., Easton, Pa.: 1995; Drug Absorption Enhancement: Concepts,
Possibilities, Limitations, And Trends, Harwood Academic
Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug
Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M.
Dekker, New York.
[0184] Where antibody fragments are used, the smallest inhibitory
fragment that specifically binds to the binding domain of the
target protein is preferred. For example, based upon the
variable-region sequences of an antibody, peptide molecules can be
designed that retain the ability to bind the target protein
sequence. Such peptides can be synthesized chemically and/or
produced by recombinant DNA technology. (See, e.g., Marasco et al.,
Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993)). The formulation
can also contain more than one active compound as necessary for the
particular indication being treated, preferably those with
complementary activities that do not adversely affect each other.
Alternatively, or in addition, the composition can comprise an
agent that enhances its function, such as, for example, a cytotoxic
agent, cytokine, chemotherapeutic agent, or growth-inhibitory
agent. Such molecules are suitably present in combination in
amounts that are effective for the purpose intended.
[0185] The active ingredients can also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacrylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles, and nanocapsules) or in macroemulsions.
[0186] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0187] Sustained-release preparations can be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g., films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.RTM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods.
[0188] An antibody according to the invention can be used as an
agent for detecting the presence of the TLR4/MD-2 complex or a TLR4
protein (or a protein fragment thereof) in a sample. In some
embodiments, the antibody contains a detectable label. Antibodies
are polyclonal, or more preferably, monoclonal. An intact antibody,
or a fragment thereof (e.g., F.sub.ab, scFv, or F.sub.(ab)2) is
used. The term "labeled", with regard to the probe or antibody, is
intended to encompass direct labeling of the probe or antibody by
coupling (i.e., physically linking) a detectable substance to the
probe or antibody, as well as indirect labeling of the probe or
antibody by reactivity with another reagent that is directly
labeled. Examples of indirect labeling include detection of a
primary antibody using a fluorescently-labeled secondary antibody
and end-labeling of a DNA probe with biotin such that it can be
detected with fluorescently-labeled streptavidin. The term
"biological sample" is intended to include tissues, cells and
biological fluids isolated from a subject, as well as tissues,
cells and fluids present within a subject. Included within the
usage of the term "biological sample", therefore, is blood and a
fraction or component of blood including blood serum, blood plasma,
or lymph. That is, the detection method of the invention can be
used to detect an analyte mRNA, protein, or genomic DNA in a
biological sample in vitro as well as in vivo. For example, in
vitro techniques for detection of an analyte mRNA include Northern
hybridizations and in situ hybridizations. In vitro techniques for
detection of an analyte protein include enzyme linked immunosorbent
assays (ELISAs), Western blots, immunoprecipitations, and
immunofluorescence. In vitro techniques for detection of an analyte
genomic DNA include Southern hybridizations. Procedures for
conducting immunoassays are described, for example in "ELISA:
Theory and Practice: Methods in Molecular Biology", Vol. 42, J. R.
Crowther (Ed.) Human Press, Totowa, N.J., 1995; "Immunoassay", E.
Diamandis and T. Christopoulus, Academic Press, Inc., San Diego,
Calif., 1996; and "Practice and Theory of Enzyme Immunoassays", P.
Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Furthermore,
in vivo techniques for detection of an analyte protein include
introducing into a subject a labeled anti-analyte protein antibody.
For example, the antibody can be labeled with a radioactive marker
whose presence and location in a subject can be detected by
standard imaging techniques.
[0189] Chimeric Polypeptides
[0190] The chimeric peptides of the invention include a first and
second domain operably linked together. The first domain includes
at least a portion of a toll-like receptor polypeptide, while the
second domain includes at least a portion of an MD accessory
protein. The first and second domains can occur in any order in the
peptide, and the peptide can include one or more of each domain.
The chimeric protein comprises at least one biologically active
portion of a toll-like receptor polypeptide or MD accessory
protein. The chimeric peptide is soluble. By soluble is meant the
ability to dissolve in a fluid.
[0191] A "toll-like receptor polypeptide" refers to a polypeptide
having an amino acid sequence corresponding to at least a portion
of a toll-like receptor polypeptide. A toll-like receptor
polypeptide includes, for example, TLRs 1-10 and RP105. The
toll-like receptor polypeptide, and/or nucleic acids encoding the
toll-like receptor polypeptide, can be constructed using toll-like
receptor polypeptide encoding sequences that are known in the art
and are described in, e.g. GenBank Accession Nos. (CAH72620;
CAH72619; NP_003254; NP_003255; NP_003259; NP_006059; NP_057646;
NP_003256; AAH33651; CAD99157; AAM23001; BAB43955; AAF05316;
AAK26744; AAF78037; AAF78036; AAF78035; BAB19259; AAF64061;
AAF60188; AAF89753; AAF07823; BAA78631; AAC34135; AAC34134;
AAC34133; AAC34137) and are incorporated herein by reference in
their entirety. Within the chimeric protein the toll-like receptor
polypeptide can correspond to all or a portion of a toll-like
receptor polypeptide. Preferably the toll-like receptor polypeptide
includes the extracellular portion of the polypeptide.
[0192] An "MD accessory protein" refers to a polypeptide having an
amino acid sequence corresponding to at least a portion of a MD
accessory protein. The MD protein is, e.g., MD-1 or MD-2. The MD
accessory protein, and/or nucleic acids encoding the MD accessory
protein, can be constructed using MD accessory protein encoding
sequences that are known in the art and are described in, e.g.
GenBank Accession Nos. GenBank Accession Nos. 095711 (MD-1);
AAC98152 (MD-1); Q9Y6Y9 (MD-2); NP_056179 (MD-2); AAH20690 (MD-2);
and BAA78717 (MD-2). Exemplary MD accessory protein and nucleic
acid sequences are is shown in FIGS. 32A, 32B, 33A and 33B. Within
the chimeric protein the MD accessory protein can correspond to all
or a portion of a MD accessory protein.
[0193] The chimeric protein may be linked to one or more additional
moieties. For example, the chimeric protein may additionally be
linked to a GST fusion protein in which the glycoprotein Ib.alpha.
fusion protein sequences are fused to the C-terminus of the GST
(i.e., glutathione S-transferase) sequences. Such fusion proteins
can facilitate the purification of chimeric protein.
[0194] In another embodiment, the chimeric protein is includes a
heterologous signal sequence (i.e., a polypeptide sequence that is
not present in a polypeptide encoded by a toll-like receptor
polypeptide or MD accessory protein nucleic acid) at its
N-terminus. For example, the native toll-like receptor polypeptide
signal sequence can be removed and replaced with a signal sequence
from another protein. In certain host cells (e.g., mammalian host
cells), expression and/or secretion of chimeric protein can be
increased through use of a heterologous signal sequence.
[0195] An chimeric protein of the invention can be produced by
standard recombinant DNA techniques. For example, DNA fragments
coding for the different polypeptide sequences are ligated together
in-frame in accordance with conventional techniques, e.g., by
employing blunt-ended or stagger-ended termini for ligation,
restriction enzyme digestion to provide for appropriate termini,
filling-in of cohesive ends as appropriate, alkaline phosphatase
treatment to avoid undesirable joining, and enzymatic ligation. In
another embodiment, the fusion gene can be synthesized by
conventional techniques including automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be carried
out using anchor primers that give rise to complementary overhangs
between two consecutive gene fragments that can subsequently be
annealed and reamplified to generate a chimeric gene sequence (see,
for example, Ausubel et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, 1992). Moreover, many expression
vectors are commercially available that encode a fusion moiety
(e.g., an Fc region of an immunoglobulin heavy chain). A
glycoprotein Ib.alpha. encoding nucleic acid can be cloned into
such an expression vector such that the fusion moiety is linked
in-frame to the immunoglobulin protein.
[0196] Within the chimeric protein, the term "operatively linked"
is intended to indicate that the first and second polypeptides are
chemically linked (most typically via a covalent bond such as a
peptide bond) in a manner that allows for at least one function
associated with the toll-like receptor polypeptide and MD accessory
protein. When used to refer to nucleic acids encoding the chimeric
protein the term operatively linked means that a nucleic acid
encoding the toll-like receptor polypeptide or MD accessory protein
are fused in-frame to each other. The MD accessory protein can be
fused to the N-terminus or C-terminus of the toll-like receptor
polypeptide. Optionally, the toll-like receptor polypeptide and MD
accessory protein are linked via a spacer arm. Spacer arms provide
intramolecular flexibility or adjust intramolecular distances
between conjugated moieties and thereby may help preserve
biological activity. A spacer arm may be in the form of a
polypeptide moiety that includes spacer amino acids, e.g. proline,
serine or glycine. Preferably the toll-like receptor polypeptide
and MD accessory protein are linked via a flexible glycine/serine
linker. Alternatively, a spacer arm may be part of the
cross-linking reagent, such as in "long-chain SPDP" (Pierce Chem.
Co., Rockford, Ill., cat. No. 21651 H).
[0197] In other embodiments, the toll-like receptor polypeptide and
the MD accessory protein are linked by chemical coupling in any
suitable manner known in the art. Many known chemical cross-linking
methods are non-specific, i.e.; they do not direct the point of
coupling to any particular site on the toll-like polypeptide or MD
accessory protein. As a result, use of non-specific cross-linking
agents may attack functional sites or sterically block active
sites, rendering the conjugated proteins biologically inactive.
[0198] One way to increasing coupling specificity is to directly
chemical coupling to a functional group found only once or a few
times in one or both of the polypeptides to be cross-linked. For
example, in many proteins, cysteine, which is the only protein
amino acid containing a thiol group, occurs only a few times. Also,
for example, if a polypeptide contains no lysine residues, a
cross-linking reagent specific for primary amines will be selective
for the amino terminus of that polypeptide. Successful utilization
of this approach to increase coupling specificity requires that the
polypeptide have the suitably rare and reactive residues in areas
of the molecule that may be altered without loss of the molecule's
biological activity.
[0199] Cysteine residues may be replaced when they occur in parts
of a polypeptide sequence where their participation in a
cross-linking reaction would otherwise likely interfere with
biological activity. When a cysteine residue is replaced, it is
typically desirable to minimize resulting changes in polypeptide
folding. Changes in polypeptide folding are minimized when the
replacement is chemically and sterically similar to cysteine. For
these reasons, serine is preferred as a replacement for cysteine.
As demonstrated in the examples below, a cysteine residue may be
introduced into a polypeptide's amino acid sequence for
cross-linking purposes. When a cysteine residue is introduced,
introduction at or near the amino or carboxy terminus is preferred.
Conventional methods are available for such amino acid sequence
modifications, whether the polypeptide of interest is produced by
chemical synthesis or expression of recombinant DNA.
[0200] Coupling of the two constituents can be accomplished via a
coupling or conjugating agent. There are several intermolecular
cross-linking reagents which can be utilized, See for example,
Means and Feeney, CHEMICAL MODIFICATION OF PROTEINS, Holden-Day,
1974, pp. 39-43. Among these reagents are, for example,
J-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or N,
N'-(1,3-phenylene) bismaleimide (both of which are highly specific
for sulfhydryl groups and form irreversible linkages); N,
N'-ethylene-bis-(iodoacetamide) or other such reagent having 6 to
11 carbon methylene bridges (which relatively specific for
sulfhydryl groups); and 1,5-difluoro-2, 4-dinitrobenzene (which
forms irreversible linkages with amino and tyrosine groups). Other
cross-linking reagents useful for this purpose include:
p,p'-difluoro-m,m'-dinitrodiphenylsulfone (which forms irreversible
cross-linkages with amino and phenolic groups); dimethyl
adipimidate (which is specific for amino groups);
phenol-1,4-disulfonylchloride (which reacts principally with amino
groups); hexamethylenediisocyanate or diisothiocyanate, or
azophenyl-p-diisocyanate (which reacts principally with amino
groups); glutaraldehyde (which reacts with several different side
chains) and disdiazobenzidine (which reacts primarily with tyrosine
and histidine).
[0201] Cross-linking reagents may be homobifunctional, i.e., having
two functional groups that undergo the same reaction. A preferred
homobifunctional cross-linking reagent is bismaleimidohexane
("BMH"). BMH contains two maleimide functional groups, which react
specifically with sulfhydryl-containing compounds under mild
conditions (pH 6.5-7.7). The two maleimide groups are connected by
a hydrocarbon chain. Therefore, BMH is useful for irreversible
cross-linking of polypeptides that contain cysteine residues.
[0202] Cross-linking reagents may also be heterobifunctional.
Heterobifunctional cross-linking agents have two different
functional groups, for example an amine-reactive group and a
thiol-reactive group, that will cross-link two proteins having free
amines and thiols, respectively. Examples of heterobifunctional
cross-linking agents are succinimidyl 4-(N-maleimidomethyl)
cyclohexane-1-carboxylate ("SMCC"),
m-maleimidobenzoyl-N-hydroxysuccinimide ester ("MBS"), and
succinimide 4-(p-maleimidophenyl) butyrate ("SMPB"), an extended
chain analog of MBS. The succinimidyl group of these cross-linkers
reacts with a primary amine, and the thiol-reactive maleimide forms
a covalent bond with the thiol of a cysteine residue.
[0203] Cross-linking reagents often have low solubility in water. A
hydrophilic moiety, such as a sulfonate group, may be added to the
cross-linking reagent to improve its water solubility. Sulfo-MBS
and sulfo-SMCC are examples of cross-linking reagents modified for
water solubility.
[0204] Many cross-linking reagents yield a conjugate that is
essentially non-cleavable under cellular conditions. However, some
cross-linking reagents contain a covalent bond, such as a
disulfide, that is cleavable under cellular conditions. For
example, Traut's reagent, dithiobis (succinimidylpropionate)
("DSP"), and N-succinimidyl 3-(2-pyridyldithio) propionate ("SPDP")
are well-known cleavable cross-linkers. The use of a cleavable
cross-linking reagent permits the cargo moiety to separate from the
transport polypeptide after delivery into the target cell. Direct
disulfide linkage may also be useful.
[0205] Numerous cross-linking reagents, including the ones
discussed above, are commercially available. Detailed instructions
for their use are readily available from the commercial suppliers.
A general reference on protein cross-linking and conjugate
preparation is: Wong, CHEMISTRY OF PROTEIN CONJUGATION AND
CROSS-LINKING, CRC Press (1991).
[0206] Also included in the invention are derivatives, fragments,
homologs, analogs and variants of the chimeric peptides and nucleic
acids encoding these peptides. For nucleic acids, derivatives,
fragments, and analogs provided herein are defined as sequences of
at least 6 (contiguous) nucleic acids, and which have a length
sufficient to allow for specific hybridization. For amino acids,
derivatives, fragments, and analogs provided herein are defined as
sequences of at least 4 (contiguous) amino acids, a length
sufficient to allow for specific recognition of an epitope.
[0207] The length of the fragments are less than the length of the
corresponding full-length nucleic acid or polypeptide from which
the chimeric peptide, or nucleic acid encoding same, is derived.
Derivatives and analogs may be full length or other than full
length, if the derivative or analog contains a modified nucleic
acid or amino acid. Derivatives or analogs of the chimeric peptides
include, e.g., molecules including regions that are substantially
homologous to the peptides, in various embodiments, by at least
about 30%, 50%, 70%, 80%, or 95%, 98%, or even 99%, identity over
an amino acid sequence of identical size or when compared to an
aligned sequence in which the alignment is done by a computer
homology program known in the art. For example sequence identity
can be measured using sequence analysis software (Sequence Analysis
Software Package of the Genetics Computer Group, University of
Wisconsin Biotechnology Center, 1710 University Avenue, Madison,
Wis. 53705), with the default parameters therein.
[0208] Where a particular polypeptide is said to have a specific
percent identity to a reference polypeptide of a defined length,
the percent identity is relative to the reference peptide. Thus, a
peptide that is 50% identical to a reference polypeptide that is
100 amino acids long can be a 50 amino acid polypeptide that is
completely identical to a 50 amino acid long portion of the
reference polypeptide. It might also be a 100 amino acid long
polypeptide, which is 50% identical to the reference polypeptide
over its entire length. Of course, other polypeptides will meet the
same criteria.
[0209] Pharmaceutical Compositions
[0210] The antibodies or soluble chimeric polypeptides of the
invention (also referred to herein as "active compounds"), and
derivatives, fragments, analogs and homologs thereof, can be
incorporated into pharmaceutical compositions suitable for
administration. Such compositions typically comprise the antibody
or soluble chimeric polypeptide and a pharmaceutically acceptable
carrier. As used herein, the term "pharmaceutically acceptable
carrier" is intended to include any and all solvents, dispersion
media, coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, compatible with
pharmaceutical administration. Suitable carriers are described in
the most recent edition of Remington's Pharmaceutical Sciences, a
standard reference text in the field, which is incorporated herein
by reference. Preferred examples of such carriers or diluents
include, but are not limited to, water, saline, ringer's solutions,
dextrose solution, and 5% human serum albumin. Liposomes and
non-aqueous vehicles such as fixed oils may also be used. The use
of such media and agents for pharmaceutically active substances is
well known in the art. Except insofar as any conventional media or
agent is incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0211] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (i.e., topical), transmucosal, and rectal
administration. Solutions or suspensions used for parenteral,
intradermal, or subcutaneous application can include the following
components: a sterile diluent such as water for injection, saline
solution, fixed oils, polyethylene glycols, glycerine, propylene
glycol or other synthetic solvents; antibacterial agents such as
benzyl alcohol or methyl parabens; antioxidants such as ascorbic
acid or sodium bisulfite; chelating agents such as
ethylenediaminetetraacetic acid (EDTA); buffers such as acetates,
citrates or phosphates, and agents for the adjustment of tonicity
such as sodium chloride or dextrose. The pH can be adjusted with
acids or bases, such as hydrochloric acid or sodium hydroxide. The
parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0212] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringeability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof. The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0213] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, methods of preparation are vacuum
drying and freeze-drying that yields a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0214] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0215] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0216] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0217] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0218] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0219] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0220] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0221] Screening Methods
[0222] The invention provides methods (also referred to herein as
"screening assays") for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules or other drugs) that modulate or otherwise interfere with
the binding of TLR4 to the MD-2 accessory protein, or candidate or
test compounds or agents that modulate or otherwise interfere with
the signaling function of TLR4 and/or the TLR4/MD-2 complex. Also
provided are methods of identifying compounds useful to treat
disorders associated with aberrant LPS-signaling. The invention
also includes compounds identified in the screening assays
described herein.
[0223] In one embodiment, the invention provides assays for
screening candidate or test compounds which modulate the signaling
function of the TLR4/MD-2 complex and/or the interaction between
TLR4 and MD-2. The test compounds of the invention can be obtained
using any of the numerous approaches in combinatorial library
methods known in the art, including: biological libraries;
spatially addressable parallel solid phase or solution phase
libraries; synthetic library methods requiring deconvolution; the
"one-bead one-compound" library method; and synthetic library
methods using affinity chromatography selection. The biological
library approach is limited to peptide libraries, while the other
four approaches are applicable to peptide, non-peptide oligomer or
small molecule libraries of compounds. (See, e.g., Lam, 1997.
Anticancer Drug Design 12: 145).
[0224] A "small molecule" as used herein, is meant to refer to a
composition that has a molecular weight of less than about 5 kD and
most preferably less than about 4 kD. Small molecules can be, e.g.,
nucleic acids, peptides, polypeptides, peptidomimetics,
carbohydrates, lipids or other organic or inorganic molecules.
Libraries of chemical and/or biological mixtures, such as fungal,
bacterial, or algal extracts, are known in the art and can be
screened with any of the assays of the invention.
[0225] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt, et al., 1993.
Proc. Natl. Acad. Sci. U.S.A. 90: 6909; Erb, et al., 1994. Proc.
Natl. Acad. Sci. U.S.A. 91: 11422; Zuckermann, et al., 1994. J.
Med. Chem. 37: 2678; Cho, et al., 1993. Science 261: 1303; Carrell,
et al., 1994. Angew. Chem. Int. Ed. Engl. 33: 2059; Carell, et al.,
1994. Angew. Chem. Int. Ed. Engl. 33: 2061; and Gallop, et al.,
1994. J. Med. Chem. 37: 1233.
[0226] Libraries of compounds may be presented in solution (see
e.g., Houghten, 1992. Biotechniques 13: 412-421), or on beads (see
Lam, 1991. Nature 354: 82-84), on chips (see Fodor, 1993. Nature
364: 555-556), bacteria (see U.S. Pat. No. 5,223,409), spores (see
U.S. Pat. No. 5,233,409), plasmids (see Cull, et al., 1992. Proc.
Natl. Acad. Sci. USA 89: 1865-1869) or on phage (see Scott and
Smith, 1990. Science 249: 386-390; Devlin, 1990. Science 249:
404-406; Cwirla, et al., 1990. Proc. Natl. Acad. Sci. U.S.A. 87:
6378-6382; Felici, 1991. J. Mol. Biol. 222: 301-310; and U.S. Pat.
No. 5,233,409.).
[0227] In one embodiment, a candidate compound is introduced to an
antibody-antigen complex and determining whether the candidate
compound disrupts the antibody-antigen complex, wherein a
disruption of this complex indicates that the candidate compound
modulates the signaling function of the TLR4/MD-2 complex and/or
the interaction between TLR4 and MD-2. For example, the antibody is
monoclonal antibody mu18H10, hu18H10 and the antigen is the
TLR4/MD-2 complex. Alternatively, the monoclonal antibody is 16G7,
mu15C1, hu15C1, mu7E3 or hu7E3 and the antigen is the TLR4/MD-2
complex or TLR4.
[0228] In another embodiment, a TLR4/MD-2 complex is provided and
exposed to at least one neutralizing monoclonal antibody. Formation
of an antibody-antigen complex is detected, and one or more
candidate compounds are introduced to the complex. If the
antibody-antigen complex is disrupted following introduction of the
one or more candidate compounds, the candidate compounds is useful
to treat disorders associated with aberrant LPS-signaling.
[0229] In another embodiment, a soluble chimeric protein of the
invention is provided and exposed to at least one neutralizing
monoclonal antibody. Formation of an antibody-antigen complex is
detected, and one or more candidate compounds are introduced to the
complex. If the antibody-antigen complex is disrupted following
introduction of the one or more candidate compounds, the candidate
compounds is useful to treat disorders associated with aberrant
LPS-signaling.
[0230] Determining the ability of the test compound to interfere
with or disrupt the antibody-antigen complex can be accomplished,
for example, by coupling the test compound with a radioisotope or
enzymatic label such that binding of the test compound to the
antigen or biologically-active portion thereof can be determined by
detecting the labeled compound in a complex. For example, test
compounds can be labeled with .sup.125I, .sup.35S, .sup.14C, or
.sup.3H, either directly or indirectly, and the radioisotope
detected by direct counting of radioemission or by scintillation
counting. Alternatively, test compounds can be
enzymatically-labeled with, for example, horseradish peroxidase,
alkaline phosphatase, or luciferase, and the enzymatic label
detected by determination of conversion of an appropriate substrate
to product.
[0231] In one embodiment, the assay comprises contacting an
antibody-antigen complex with a test compound, and determining the
ability of the test compound to interact with the antigen or
otherwise disrupt the existing antibody-antigen complex. In this
embodiment, determining the ability of the test compound to
interact with the antigen and/or disrupt the antibody-antigen
complex comprises determining the ability of the test compound to
preferentially bind to the antigen or a biologically-active portion
thereof, as compared to the antibody.
[0232] In another embodiment, the assay comprises contacting an
antibody-antigen complex with a test compound and determining the
ability of the test compound to modulate the antibody-antigen
complex. Determining the ability of the test compound to modulate
the antibody-antigen complex can be accomplished, for example, by
determining the ability of the antigen to bind to or interact with
the antibody, in the presence of the test compound.
[0233] Those skilled in the art will recognize that, in any of the
screening methods disclosed herein, the antibody may be a
neutralizing antibody, such as monoclonal antibody hu18H10, hu15C1
and/or hu7E3, each of which modulates or otherwise interferes with
LPS-induced proinflammatory cytokine production.
[0234] The screening methods disclosed herein may be performed as a
cell-based assay or as a cell-free assay. The cell-free assays of
the invention are amenable to use of either the soluble form or the
membrane-bound form of the TLR4 and/or TLR4 when complexed with
MD-2, and fragments thereof. In the case of cell-free assays
comprising the membrane-bound forms of TLR4 and/or the TLR4/MD-2
complex, it may be desirable to utilize a solubilizing agent such
that the membrane-bound form of the proteins are maintained in
solution. Examples of such solubilizing agents include non-ionic
detergents such as n-octylglucoside, n-dodecylglucoside,
n-dodecylmaltoside, octanoyl-N-methylglucamide,
decanoyl-N-methylglucamide, Triton.RTM. X-100, Triton.RTM. X-114,
Thesit.RTM., Isotridecypoly(ethylene glycol ether).sub.n,
N-dodecyl-N,N-dimethyl-3-ammonio-1-propane sulfonate,
3-(3-cholamidopropyl) dimethylamminiol-1-propane sulfonate (CHAPS),
or 3-(3-cholamidopropyl)dimethylamminiol-2-hydroxy-1-propane
sulfonate (CHAPSO).
[0235] In more than one embodiment, it may be desirable to
immobilize either the antibody or the antigen to facilitate
separation of complexed from uncomplexed forms of one or both
following introduction of the candidate compound, as well as to
accommodate automation of the assay. Observation of the
antibody-antigen complex in the presence and absence of a candidate
compound, can be accomplished in any vessel suitable for containing
the reactants. Examples of such vessels include microtiter plates,
test tubes, and micro-centrifuge tubes. In one embodiment, a fusion
protein can be provided that adds a domain that allows one or both
of the proteins to be bound to a matrix. For example, GST-antibody
fusion proteins or GST-antigen fusion proteins can be adsorbed onto
glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or
glutathione derivatized microtiter plates, that are then combined
with the test compound, and the mixture is incubated under
conditions conducive to complex formation (e.g., at physiological
conditions for salt and pH). Following incubation, the beads or
microtiter plate wells are washed to remove any unbound components,
the matrix immobilized in the case of beads, complex determined
either directly or indirectly. Alternatively, the complexes can be
dissociated from the matrix, and the level of antibody-antigen
complex formation can be determined using standard techniques.
[0236] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either the antibody (e.g. hu18H10, hu15C1, and/or hu7E3) or the
antigen (e.g. the TLR4/MD-2 complex and/or a TLR4 protein) can be
immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated antibody or antigen molecules can be prepared from
biotin-NHS (N-hydroxy-succinimide) using techniques well-known
within the art (e.g., biotinylation kit, Pierce Chemicals,
Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96 well plates (Pierce Chemical).
Alternatively, other antibodies reactive with the antibody or
antigen of interest, but which do not interfere with the formation
of the antibody-antigen complex of interest, can be derivatized to
the wells of the plate, and unbound antibody or antigen trapped in
the wells by antibody conjugation. Methods for detecting such
complexes, in addition to those described above for the
GST-immobilized complexes, include immunodetection of complexes
using such other antibodies reactive with the antibody or
antigen.
[0237] The invention further pertains to novel agents identified by
any of the aforementioned screening assays and uses thereof for
treatments as described herein.
[0238] Diagnostic Assays
[0239] Antibodies of the present invention can be detected by
appropriate assays, e.g., conventional types of immunoassays. For
example, a sandwich assay can be performed in which the TLR4/MD-2
complex or a TLR4 protein or fragment thereof is affixed to a solid
phase. Incubation is maintained for a sufficient period of time to
allow the antibody in the sample to bind to the immobilized
polypeptide on the solid phase. After this first incubation, the
solid phase is separated from the sample. The solid phase is washed
to remove unbound materials and interfering substances such as
non-specific proteins which may also be present in the sample. The
solid phase containing the antibody of interest (e.g. monoclonal
antibody hu18H10, hu15C1 and/or hu7E3) bound to the immobilized
polypeptide is subsequently incubated with a second, labeled
antibody or antibody bound to a coupling agent such as biotin or
avidin. This second antibody may be another anti-TLR4/MD-2 complex
antibody, another anti-TLR4 antibody or another antibody. Labels
for antibodies are well-known in the art and include radionuclides,
enzymes (e.g. maleate dehydrogenase, horseradish peroxidase,
glucose oxidase, catalase), fluors (fluorescein isothiocyanate,
rhodamine, phycocyanin, fluorescarmine), biotin, and the like. The
labeled antibodies are incubated with the solid and the label bound
to the solid phase is measured. These and other immunoassays can be
easily performed by those of ordinary skill in the art.
[0240] An exemplary method for detecting the presence or absence of
the TLR4/MD-2 complex or a TLR4 protein in a biological sample
involves obtaining a biological sample from a test subject and
contacting the biological sample with a labeled monoclonal antibody
according to the invention such that the presence of TLR4/MD-2
complex or TLR4 is detected in the biological sample.
[0241] As used herein, the term "labeled", with regard to the probe
or antibody, is intended to encompass direct labeling of the probe
or antibody by coupling (i.e., physically linking) a detectable
substance to the probe or antibody, as well as indirect labeling of
the probe or antibody by reactivity with another reagent that is
directly labeled. Examples of indirect labeling include detection
of a primary antibody using a fluorescently-labeled secondary
antibody and end-labeling of a DNA probe with biotin such that it
can be detected with fluorescently-labeled streptavidin. The term
"biological sample" is intended to include tissues, cells and
biological fluids isolated from a subject, as well as tissues,
cells and fluids present within a subject. That is, the detection
method of the invention can be used to detect TLR4/MD-2 complex or
TLR4 in a biological sample in vitro as well as in vivo. For
example, in vitro techniques for detection of TLR4/MD-2 complex or
TLR4 include enzyme linked immunosorbent assays (ELISAs), Western
blots, immunoprecipitations, and immunofluorescence. Furthermore,
in vivo techniques for detection of TLR4/MD-2 complex or TLR4
include introducing into a subject a labeled anti-TLR4/MD-2 complex
or anti-TLR4 antibody. For example, the antibody can be labeled
with a radioactive marker whose presence and location in a subject
can be detected by standard imaging techniques.
[0242] In one embodiment, the biological sample contains protein
molecules from the test subject. One preferred biological sample is
a peripheral blood leukocyte sample isolated by conventional means
from a subject.
[0243] The invention also encompasses kits for detecting the
presence of TLR4/MD-2 complex or TLR4 in a biological sample. For
example, the kit can comprise: a labeled compound or agent capable
of detecting TLR4/MD-2 complex or TLR4, when not complexed with
MD-2, (e.g., an anti-TLR4/MD-2 complex monoclonal antibody or an
anti-TLR4 monoclonal antibody) in a biological sample; means for
determining the amount of TLR4/MD-2 complex or TLR4 in the sample;
and means for comparing the amount of TLR4/MD-2 complex or TLR4 in
the sample with a standard. The compound or agent can be packaged
in a suitable container. The kit can further comprise instructions
for using the kit to detect TLR4/MD-2 complex or TLR4 in a
sample.
[0244] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1: Materials and Methods for the Generation of Murine 18H10
Monoclonal Antibody
[0245] A. Generation of Stable TLR4/MD-2 Transfectants
[0246] Stable TLR4/MD-2 transfectants were generated in CHO-K1 and
HEK 293 cells. For CHO-K1 cells, human TLR4 cDNA encoding an
N-terminal c-myc epitope tag was cloned into pCDNA3.1(-)hygro
(Invitrogen), and human MD-2 cDNA encoding C-terminal c-Myc and
Protein C epitope tags was cloned into pCDNA3 (Invitrogen). Both
constructs were co-transfected into CHO cells using Fugene 6.TM.
reagent (Roche), according to the manufacturer's guidelines.
Antibiotic resistant cells were selected in culture medium
containing 500 .mu.g/ml G418 and 250 .mu.g/ml hygromycin B (both
from Invitrogen).
[0247] To select for cells expressing the TLR4/MD-2 complex,
1.times.10.sup.7 cells/ml were incubated in 1.times.PBS
supplemented with 1% BSA and 10 .mu.g/ml anti-protein C monoclonal
antibody (Roche). Cells were washed once and then incubated in the
same buffer with PE-conjugated goat anti-mouse IgG (H+L) antibody
(1:200 dilution; Anwara). Cells were subsequently incubated with
anti-PE microbeads (Miltenyi Biotec) and passed through a Midi MACS
LS column. Cells retained on the column were eluted and placed back
in culture with antibiotic selection. Rounds of sorting were
continued until a uniformly positive population of cells expressing
the TLR4/MD-2 complex was obtained.
[0248] B. Generation of Recombinant MD-2 and Chimeric TLR4/MD-2
Protein
[0249] To generate recombinant soluble MD-2, cDNA encoding the
protein with C terminal FLAG and 6.times.HIS tags for detection and
purification purposes was cloned into pFASTBAC1 and subsequently
inserted into bacmid DNA by homologous recombination. Following
generation of a viral stock, Sf9 cells were superinfected. 48 hours
later, the recombinant protein was purified from infected cell
supernatants using a NiNTA affinity matrix (Qiagen).
[0250] To generate the recombinant TLR4/MD-2 chimeric protein, cDNA
encoding the extracellular portion of human TLR4 linked to MD-2 via
a glycine serine (GGGGS.sub.3) linker was assembled using PCR. FLAG
and 6.times.HIS tags were included at the C-terminus of MD-2 for
detection and purification purposes. The cDNA cassette was cloned
into the baculovirus expression vector pFASTBAC1 (Invitrogen) and
subsequently inserted into bacmid DNA by homologous recombination.
Following generation of a viral stock, Sf9 cells were
superinfected. 48 hours later, the recombinant fusion protein was
purified from cell lysates using an anti-FLAG.TM. M2 MAb affinity
matrix (Sigma).
[0251] C. Immunization of Mice
[0252] 8 week old female BALB/c mice (IFFA CREDO) were immunized
with a subcutaneous injection (s.c.) of 10.sup.6 CHO cells/ml in
RIBI adjuvant (Sigma) at days 0, 7 and 28 as previously described
in Buell et al., Blood 92: 3521-3528 (1998), hereby incorporated by
reference in its entirety.
[0253] D. Specific Serum Titrations
[0254] The mice were bled at days 0 and 14. TLR4/MD-2 specific
antibody titers were assessed in the sera by FACS analysis on
TLR4/MD-2 transfected 293 cells. Cells were incubated with mice
sera at 1:250, 1:2500 and 1:25000 dilutions, washed, incubated with
APC-conjugated goat anti-mouse IgG (H+L) antibody (Molecular
Probes) and analyzed on a FACScalibur (Becton Dickenson) in the
FL-4 channel.
[0255] E. B Cell/Myeloma Fusions
[0256] Mice having specific TLR4/MD-2 serum antibodies were
"hyperboosted" subcutaneously (s.c.) with the chimeric TLR4/MD-2
fusion protein either 3 or 4 days prior to fusion. Draining lymph
nodes were obtained as a source of B cells for fusion with the
mouse myeloma cell line P3-X63-Ag8.653. B cell extraction and
cellular fusions were performed as previously described in Buell et
al., Blood 92: 3521-3528 (1998), hereby incorporated by reference
in its entirety. Cells were plated at an approximate concentration
of 10.sup.4 myeloma cells/well and grown for 10-14 days in culture
medium supplemented with HAT (Sigma).
[0257] F. Hybridoma Screening
[0258] Supernatants from wells containing viable hybridoma cells
were screened on mock transfected cells vs. TLR4/MD-2 transfected
myeloma cells for TLR4/MD-2 specificity by FACS analysis. Cells
were then incubated with supernatant and goat-anti mouse IgG (H+L)
antibody (Molecular Probes). Cells were analyzed on a FACScalibur
in the FL-4 channel.
[0259] G. Monoclonal Antibody Specificity by FACS
[0260] HEK 293 cells were plated in 6 well plates at a density of
2.5.times.10.sup.5 cells/well in 2 ml culture medium containing 10%
FBS. 16 hours post-plating, cells were transfected with 0.75 .mu.g
of the appropriate vector(s) using Fugene.TM. reagent (Roche)
according to the manufacturer's guidelines. 48 hours
post-transfection, cells were stained with the appropriate
monoclonal antibody (as indicated in FIGS. 4A-4L) and an
APC-coupled goat anti-mouse IgG (H+L) antibody (Molecular Probes)
and analyzed using the FACScalibur in the FL-4 channel.
[0261] H. Monoclonal Antibody Specificity by Direct ELISA
[0262] Recombinant soluble MD-2 with C terminal FLAG and histidine
epitope tags was coated at a concentration of 5 .mu.g/ml in 50
.mu.l PBS on ELISA plates (Nunc Maxisorp). Wells were blocked with
200 .mu.l PBS 2% BSA and subsequently incubated with the
appropriate MAb at the indicated concentration in PBS 1% BSA.
Following 3 wash steps with PBS 0.05% Tween 20, 50 .mu.l HRP
conjugated goat anti-mouse IgG (H+L) at a 1:5000 dilution was added
to the wells. Following a further wash step, binding was revealed
using TMB substrate. Plates were read at a wavelength of 650
nm.
[0263] I Monoclonal Antibody Specificity by Sandwich ELISA
[0264] For sample preparation, HEK 293 cells were transfected with
the appropriate plasmid constructs using the Fugene 6.TM.
transfection reagent as described in paragraph G above. 48 hours
post-transfection, cells were collected and cleared by
centrifugation. Cells were subsequently incubated with biotinylated
mu18H10 (10 .mu.g/ml) and lysed in 20 mM Tris pH 7.4, 150 mM NaCl,
1% NP40 containing COMPLETE.TM. protease inhibitors (Roche).
[0265] To perform the sandwich ELISA, Nunc maxisorp plate wells
were coated with 50 .mu.l of the anti-FLAG.TM. M2 MAb (Sigma) at a
concentration of 5 .mu.g/ml in PBS. Wells were blocked with 200
.mu.l PBS 2% BSA and subsequently incubated with 50 .mu.l of the
appropriate samples at the indicated dilution. Wells were washed
three times with 200 .mu.l PBS 0.05% Tween 20 and incubated with 50
.mu.l of the appropriate antibody (10 .mu.g/ml for biotinylated
mu18H10 and 12D4, 1 .mu.g/ml for the polyclonal anti-MD-2 MAb).
Following a wash step as above, wells were incubated with 50 .mu.l
of the appropriate detection antibody (HRP conjugated streptavidin
at a dilution of 1:1500 for the biotinylated MAbs and HRP
conjugated anti-rabbit IgG (H+L) at a dilution of 1:5000 for the
polyclonal rabbit Ab). Following a further wash step, binding was
revealed using TMB substrate. Plates were read at a wavelength of
650 nm.
[0266] J. Cellular Assay 1
[0267] Monoclonal antibody was first purified from hybridoma cell
supernatant using protein G affinity chromatography.
[0268] TLR4/MD-2 transfected HEK 293 cells were plated in culture
medium containing 10% FBS at 5.times.10.sup.5 cells/ml in 96 well
plates and left to adhere overnight. The culture medium was
subsequently removed and replaced with 100 .mu.l culture medium
containing 2% FBS and the appropriate monoclonal antibody at twice
the desired final concentration for 30 minutes at 37.degree. C. LPS
(K12LD25, Sigma) was then added to the cells at a concentration of
30 ng/ml in 100 .mu.l culture medium containing 2% FBS. Cells were
incubated at 37.degree. C. for 16 hours and supernatants harvested.
IL-8 content was measured by sandwich ELISA using the monoclonal
antibody pair 801E and M802B (Endogen).
[0269] K. Cellular Assay 2
[0270] Human whole blood was diluted 1:4 in RPMI (Sigma) and plated
at 100 .mu.l/well in 96 well plates with the appropriate monoclonal
antibody at twice the desired final concentration for 30 minutes at
37.degree. C. LPS (K12LD25, Sigma), dosed at twice the desired
final concentration, was subsequently added in 100 .mu.l RPMI
containing 5 mg/ml HSA and incubated for 6 hours at 37.degree. C.
Plates were then centrifuged at 2000 rpm for 5 minutes and the
supernatant from each well was retained. IL-8 concentrations were
determined by sandwich ELISA using the monoclonal antibody pair
801E and M802B (Endogen), as described above.
[0271] L. 18H10 VH and VL Sequences
[0272] 10.sup.7 hybridoma cells were harvested and washed once with
PBS before being resuspended in 1 ml Trizol.TM. reagent
(Invitrogen). Total RNA was subsequently extracted according to the
manufacturer's guidelines. cDNA encoding the VH and VL from three
independent subclones of the mu18H10 hybridoma was generated by
RT-PCR using oligonucleotide primers specific for mouse leader
sequences and constant domains (Jones and Bendig, Biotechnology, 9:
88-89 (1991)). Amplified products were cloned into the pGEM-T easy
vector (Promega Corp.) and sequenced using the T7 and SP6
primers.
[0273] The VH and VL cDNAs were subsequently cloned in mammalian
expression vectors containing the human IgG1 and human kappa
constant regions respectively in order to express 7E3 as a chimeric
MAb ("chimeric 7E3"). To produce recombinant chimeric MAb, HEK 293
cells were plated in 6 well plates at a density of
2.5.times.10.sup.5 cells/well in 2 ml culture medium containing 10%
FBS. 16 hours post-plating, cells were transfected with 0.75 g of
the appropriate vector(s) using Fugene.TM. reagent (Roche)
according to the manufacturer's guidelines. 48 hours
post-transfection, supernatant was harvested and antibody was
purified using protein G affinity chromatography.
Example 2: Generation of mu18H10 MAbs Directed Against the Human
TLR4/MD-2 Complex
[0274] Mice immunized with CHO cells expressing surface TLR4/MD-2
were monitored for specific serum titers. Those showing a response
to TLR4/MD-2 were "hyperboosted" with recombinant TLR4/MD-2
chimeric protein. This strategy was chosen in order to ensure that
the immune system was initially exposed to a conformational
TLR4/MD-2 complex and minimize the response to non-specific CHO
cellular antigens and simultaneously maximizing the
TLR4/MD-2-specific response upon hyperboosting. Screening by FACS
of supernatants from hybridomas resulting from B cell/myeloma
fusions was performed on mock transfected vs. TLR4/MD-2 transfected
CHO cells. Monoclonal antibody from one particular clone, referred
to herein as mu18H10, demonstrated specific binding to TLR4/MD-2
transfected CHO cells (FIG. 1). This antibody was found to have the
IgG2b .kappa. isotype, as determined by FACS using the mouse Ig
isotyping CBA kit (Beckton Dickenson).
Example 3: mu18H10 MAb Neutralization of LPS Activity on TLR4/MD-2
Transfected HEK 293 Cells
[0275] LPS is known to have the ability to induce IL-8 production
in HEK 293 cells transfected with the TLR4/MD-2 complex. The
ability of mu18H10 to inhibit this IL-8 induction was analyzed by
pre-incubating cells with the antibody for 30 minutes prior to LPS
administration. FIG. 2 shows that mu18H10 inhibited the effects of
LPS on HEK 293 cells, even at concentrations below 1 .mu.g/ml.
Example 4: mu18H10 MAb Neutralization of LPS Activity on Human
Whole Blood
[0276] The ability of mu18H10 to inhibit LPS-induced IL-8
production in human whole blood was tested. mu18H10 neutralizing
activity was tested in blood from 3 different donors using a range
of monoclonal antibody concentrations from 0.5 to 10 .mu.g/ml. FIG.
3 demonstrates that mu18H10 significantly reduced the level of IL-8
induced by LPS in all 3 donors, as compared to an isotype matched
control. mu18H10 was found to be more potent than a previously
described .alpha.-TLR4 blocking monoclonal antibody (purchased from
e-biosciences). These results indicate that the neutralizing
epitope recognized by mu18H10 on transfected HEK 293 cells is also
exposed on the surface on cells in whole blood, and that mu18H10 is
potent enough to inhibit the activity of LPS in whole blood, even
at concentrations below 1 .mu.g/ml.
Example 5: mu18H10 Specificity
[0277] In order to determine the specificity of the mu18H10
monoclonal antibody, the fact that mu18H10 does not recognize the
rabbit ortholog of the TLR4/MD-2 complex (previously cloned) was
exploited. cDNAs for either human or rabbit TLR4 with N-terminal
FLAG.RTM. epitope tag and either human or rabbit MD-2 with
C-terminal c-Myc and protein C epitope tags were transfected in HEK
293 cells in the following combinations: (1) human TLR4 and human
MD-2; (2) rabbit TLR4 and rabbit MD-2; (3) human TLR4 and rabbit
MD-2; (4) rabbit TLR4 and human MD-2. FIGS. 4A-4L show FACS
analysis of these cells following antibody staining, which revealed
that mu18H10 recognized cells expressing the human TLR4/MD-2
complex and a combination of human TLR4 and rabbit MD-2, but not
the rabbit TLR4/MD-2 complex nor a combination of rabbit TLR4 and
human MD-2. These results indicate that the epitope recognized by
mu18H10 is situated on human MD-2 (FIGS. 4A-4L).
[0278] Although mu18H10 shows specificity for MD-2, it was
determined that mu18H10 only recognizes MD-2 in the context of its
interaction with TLR4. Using direct ELISA, no binding of mu18H10 to
recombinant soluble MD-2 generated with the baculovirus expression
system was detected (FIG. 5a). In addition, FIG. 5b reveals that
mu18H10 only bound to a complex of TLR4 and MD-2 as shown from
co-transfected cell lysates, and did not recognize either MD-2
alone in transfected cell lysates/supernatants or TLR4 alone in
transfected cell lysates. These data indicate that mu18H10 is
specific for the TLR4/MD-2 complex and does not recognize either
component of the complex separately.
Example 6: mu18H10 VH and VL Sequences
[0279] VH and VL sequences from the mu18H10 hybridoma clone were
amplified from total RNA by RT-PCR. Sequence analysis is shown in
FIGS. 6A-6F.
[0280] The mu18H10 antibody includes a heavy chain variable region
(SEQ ID NO: 2, FIG. 6B) encoded by the nucleic acid sequence of SEQ
ID NO: 1 shown in FIG. 6A, and a light chain variable region (SEQ
ID NO: 7, FIG. 6E) encoded by the nucleic acid sequence of SEQ ID
NO: 6 shown in FIG. 6D. The amino acids encompassing the
complementarity determining regions (CDR) as defined by Chothia et
al. 1989, E. A. Kabat et al., 1991 are highlighted in underlined
and italicized text in FIGS. 6B and 6E and shown in FIGS. 6C and
6F. (See Chothia, C, et al., Nature 342:877-883 (1989); Kabat, E A,
et al., Sequences of Protein of immunological interest, Fifth
Edition, US Department of Health and Human Services, US Government
Printing Office (1991)). The heavy chain CDRs of the mu18H10
antibody have the following sequences: DSYIH (SEQ ID NO: 3);
WTDPENVNSIYDPRFQG (SEQ ID NO: 4), and GYNGVYYAMDY (SEQ ID NO: 5).
The light chain CDRs of the mu18H10 antibody have the following
sequences: SASSSVIYMH (SEQ ID NO: 8); RTYNLAS (SEQ ID NO: 9); and
HQWSSFPYT (SEQ ID NO: 10).
Example 7: Chimeric 18H10 Binds to hTLR4 hMD2 Transfected CHO
Cells
[0281] In order to demonstrate the specificity of the cloned 18H10
VH and VL for the hTLR4/MD-2 complex, FACS analysis was performed
on hTLR4/MD-2 transfected CHO cells using the chimeric 18H10 MAb
(FIGS. 6A-6F). Specific binding of MAb at the indicated
concentration was detected using an APC-labeled goat-anti-human IgG
(H+L) secondary antibody. An irrelevant isotype-matched human IgG1
MAb was used as a control.
Example 8: Chimeric 18H10 Inhibits LPS-Induced IL-8 Production in
hTLR4 hMD2 Transfected HEK 293 Cells
[0282] In order to demonstrate the neutralizing capacity of the
cloned 18H10 VH and VL for LPS, the ability of 18H10 to inhibit LPS
dependent IL-8 induction of hTLR4/MD-2 transfected HEK 293 cells
was tested (as described above). FIG. 7 shows that chimeric 18H10
inhibited the effects of LPS on HEK 293 cells in a manner very
similar to that of the original 18H10 mouse MAb.
Example 9: Materials and Methods for the Generation of mu16G7
Monoclonal Antibody
[0283] A. Generation of Stable TLR4/MD-2 Transfectants
[0284] Stable TLR4/MD-2 transfectants were generated in CHO-K1 and
HEK 293 cells. For CHO-K1 cells, human TLR4 cDNA encoding an
N-terminal c-myc epitope tag was cloned into pCDNA3.1(-)hygro
(Invitrogen), and human MD-2 cDNA encoding C-terminal c-Myc and
Protein C epitope tags was cloned into pCDNA3 (Invitrogen). Both
constructs were co-transfected into CHO cells using Fugene 6.TM.
reagent (Roche), according to the manufacturer's guidelines.
Antibiotic resistant cells were selected in culture medium
containing 500 .mu.g/ml G418 and 250 .mu.g/ml hygromycin B (both
from Invitrogen).
[0285] For HEK 293 cells, human TLR4 cDNA encoding an N-terminal
FLAG.TM. epitope tag was cloned into pCDNA3.1(-)hygro (Invitrogen),
and human MD-2 cDNA encoding C-terminal FLAG.TM. and 6.times.
Histidine epitope tags was cloned into pCDNA3 (Invitrogen). Both
constructs were transfected into HEK 293 cells, and antibiotic
resistant cells were selected in culture medium containing 500
.mu.g/ml G418 and 250 .mu.g/ml hygromycin B (both from Invitrogen),
as described above.
[0286] To select for cells expressing the TLR4/MD-2 complex,
1.times.10.sup.7 cells/ml were incubated in 1.times.PBS
supplemented with 1% BSA and either 10 .mu.g/ml anti-protein C
monoclonal antibody (for CHO cells; Roche) or anti-FLAG monoclonal
antibody (for 293 cells; Sigma). Cells were washed once and then
incubated in the same buffer with PE-conjugated goat anti-mouse IgG
(H+L) antibody (1:200 dilution; Anwara). Cells were subsequently
incubated with anti-PE microbeads (Miltenyi Biotec) and passed
through a Midi MACS LS column. Cells retained on the column were
eluted and placed back in culture with antibiotic selection. Rounds
of sorting were continued until a uniformly positive population of
cells expressing the TLR4/MD-2 complex was obtained.
[0287] B. Immunization of Mice
[0288] 8 week old female BALB/c mice (IFFA CREDO) were immunized as
described above in Example 1, subsection C.
[0289] C. Specific Serum Titrations
[0290] Mice sera titrations were performed as described above in
Example 1, subsection D.
[0291] D. B Cell/Myeloma Fusions
[0292] Mice having specific TLR4/MD-2 serum antibodies were
"hyperboosted" subcutaneously (s.c.) with TLR4/MD-2 transfected HEK
293 either 3 or 4 days prior to fusion. Draining lymph nodes were
obtained as a source of B cells for fusion with the mouse myeloma
cell line P3-X63-Ag8.653. B cell extraction and cellular fusions
were performed as previously described in Buell et al., Blood 92:
3521-3528 (1998), hereby incorporated by reference in its entirety.
Cells were plated at an approximate concentration of 10.sup.4
myeloma cells/well and grown for 10-14 days in culture medium
supplemented with HAT (Sigma).
[0293] E. Hybridoma Screening
[0294] Hybridomas were screened as described above in Example 1,
subsection F.
[0295] F. Monoclonal Antibody Specificity
[0296] The specificity of the mu16G7 monoclonal antibody was
determined as described above in Example 1, subsection G.
[0297] G. Cellular Assay 1
[0298] Cellular Assay I was performed as described above in Example
1, subsection J.
[0299] H. Cellular Assay 2
[0300] Cellular Assay II was performed as described above in
Example 1, subsection K.
[0301] I. 16G7 VH and VL Sequences
[0302] 10.sup.7 hybridoma cells were harvested and washed once with
PBS before being resuspended in 1 ml Trizol.TM. reagent
(Invitrogen). Total RNA was subsequently extracted according to the
manufacturer's guidelines. cDNA encoding the VH and VL from the
mu16G7 clone was generated by RT-PCR with the mouse ScFv module
(Amersham Biosciences) according to the manufacturer's guidelines.
Amplified products were cloned into the pGEM-T easy vector (Promega
Corp.) and sequenced using the T7 and SP6 primers.
Example 10: Generation of mu16G7 MAbs Directed Against the Human
TLR4/MD-2 Complex
[0303] Mice immunized with CHO cells expressing surface TLR4/MD-2
were monitored for specific serum titers. Those showing a response
to TLR4/MD-2 were "hyperboosted" with HEK 293 TLR4/MD-2
transfectants. This strategy was chosen in order to minimize the
response to non-specific CHO cellular antigens, while
simultaneously maximizing the TLR4/MD-2-specific response.
Screening by FACS of supernatants from hybridomas resulting from B
cell/myeloma fusions was performed on mock transfected vs.
TLR4/MD-2 transfected CHO cells. Monoclonal antibody from a
specific clone, referred to herein as mu16G7, demonstrated specific
binding to TLR4/MD-2 transfected CHO cells (FIG. 9). mu16G7 was
found to have the IgG1 .kappa. isotype, as determined by FACS using
the mouse Ig isotyping CBA kit (Beckton Dickenson).
Example 11: mu16G7 Neutralization of LPS Activity on TLR4/MD-2
Transfected HEK 293 Cells
[0304] LPS is known to have ability to induce IL-8 production in
HEK 293 cells transfected with the TLR4/MD-2 complex. The ability
of mu16G7 to inhibit this IL-8 induction was analyzed by
pre-incubating cells with each antibody for 30 minutes prior to LPS
administration. FIG. 10 shows that mu16G7 inhibited the effects of
LPS on HEK 293 cells, even at sub-microgram/ml concentrations.
Example 12: mu16G7 Neutralization of LPS Activity on Human Whole
Blood
[0305] The ability of mu16G7 to inhibit LPS-induced IL-8 production
in human whole blood was tested. mu16G7 neutralizing activity was
tested in blood from 3 different donors using a range of monoclonal
antibody concentrations from 0.5 to 5 .mu.g/ml. FIG. 11
demonstrates that mu16G7 significantly reduced the level of IL-8
induced by LPS in all 3 donors, as compared to an isotype matched
control. mu16G7 was found to be more potent than a previously
described .alpha.-TLR4 blocking monoclonal antibody (from
e-biosciences). (See Shimazu et al. J. Exp. Med. 189: 1777-1782
(1999)). In some cases, mu16G7 was found to be as potent as an
.alpha.-CD14 blocking monoclonal antibody that was also included in
the study. (See Kirkland et al. J. Biol. Chem. 268:
24818-24823(1993)). These results indicate that the neutralizing
epitope recognized by mu16G7 on transfected HEK 293 cells is also
exposed on the surface on cells in whole blood, and that mu16G7 is
potent enough to inhibit the activity of LPS in whole blood, even
at concentrations below 1 .mu.g/ml.
Example 13: mu16G7 Specificity
[0306] In order to determine the specificity of the mu16G7
monoclonal antibody, the fact that mu16G7 does not recognize the
rabbit ortholog of the TLR4/MD-2 complex (previously cloned) was
exploited. cDNAs for either rabbit or human TLR4 with N-terminal
FLAG.TM. epitope tag and MD-2 with C-terminal c-Myc and protein C
epitope tags were transfected in HEK 293 cells in the following
combinations: (1) rabbit TLR4 and rabbit MD-2; (2) human TLR4 and
human MD-2; (3) rabbit TLR4 and human MD-2; (4) human TLR4 and
rabbit MD-2. FIGS. 12A-12L show FACS analysis of these cells
following antibody staining, which revealed that mu16G7 recognized
cells expressing the human TLR4/MD-2 complex and a combination of
human TLR4 and rabbit MD-2, but not the rabbit TLR4/MD-2 complex
nor a combination of rabbit TLR4 and human MD-2. These results
indicate that the epitope recognized by mu16G7 is situated on human
TLR4 (FIGS. 12A-12L).
Example 14: mu16G7 VH and VL Sequences
[0307] VH and VL sequences from the mu16G7 hybridoma clone were
amplified from total RNA by RT-PCR. Sequence analysis is shown in
FIGS. 13A-13F. Alignment of the mu16G7 VH and VL nucleotide
sequences with known mouse VH and VL sequences (using the
International Immunogenetics Information System; which can be found
at http://imgt.cines.fr) reveals that the mu16G7 VH sequence most
closely resembles the IgHV1 subfamily, while the mu16G7 VL belongs
to the IgKV1 subfamily.
[0308] The mu16G7 antibody includes a heavy chain variable region
(SEQ ID NO: 12, FIG. 13B) encoded by the nucleic acid sequence of
SEQ ID NO: 11 shown in FIG. 13A, and a light chain variable region
(SEQ ID NO: 17, FIG. 13E) encoded by the nucleic acid sequence of
SEQ ID NO: 16 shown in FIG. 13D. The amino acids encompassing the
CDR as defined by Chothia et al. 1989, E. A. Kabat et al., 1991 are
highlighted in underlined and italicized text in FIGS. 13B and 13E
and shown in FIGS. 13C and 13F. The heavy chain CDRs of the mu16G7
antibody have the following sequences: DYWIE (SEQ ID NO: 13);
EILPGSGSTNYNEDFKD (SEQ ID NO: 14); and EERAYYFGY (SEQ ID NO: 15).
The light chain CDRs of the mu16G7 antibody have the following
sequences: RSSQSLENSNGNTYLN (SEQ ID NO: 18); RVSNRFS (SEQ ID NO:
19); and LQVTHVPPT (SEQ ID NO: 20).
Example 15: Materials and Methods for the Generation of mu15C1
Monoclonal Antibody
[0309] A. Generation of Stable TLR4/MD-2 Transfectants
[0310] Stable TLR4/MD-2 transfectants were generated in CHO-K1 and
HEK 293 cells as described above in Example 9, subsection A.
[0311] B. Generation of Recombinant MD-2 and Chimeric TLR4/MD-2
Protein
[0312] To generate recombinant soluble MD-2, cDNA encoding the
protein with C terminal FLAG and 6.times.HIS tags for detection and
purification purposes was cloned into pFASTBAC1 and subsequently
inserted into bacmid DNA by homologous recombination. Following
generation of a viral stock, Sf9 cells were superinfected. 48 hours
later, the recombinant protein was purified from infected cell
supernatants using a NiNTA affinity matrix (Qiagen).
[0313] To generate the recombinant TLR4/MD-2 chimeric protein, cDNA
encoding the extracellular portion of human TLR4 linked to MD-2 via
a glycine serine (GGGGS.sub.3) linker was assembled using PCR. FLAG
and 6.times.HIS tags were included at the C-terminus of MD-2 for
detection and purification purposes. The cDNA cassette was cloned
into the baculovirus expression vector pFASTBAC1 (Invitrogen) and
subsequently inserted into bacmid DNA by homologous recombination.
Following generation of a viral stock, Sf9 cells were
superinfected. 48 hours later, the recombinant fusion protein was
purified from cell lysates using an anti-FLAG.TM. M2 MAb affinity
matrix (Sigma).
[0314] C. Immunization of Mice
[0315] 8 week old female BALB/c mice (IFFA CREDO) were immunized as
described above in Example 1, subsection C.
[0316] D. Specific Serum Titrations
[0317] Mice serum titrations were performed as described above in
Example 1, subsection D.
[0318] E. B Cell/Myeloma Fusions
[0319] B cell extraction and cellular fusion were performed and
analyzed as described above in Example 9, subsection D.
[0320] F. Hybridoma Screening
[0321] Hybridoma screening was performed as described above in
Example 1, subsection F.
[0322] G. Monoclonal Antibody Specificity
[0323] The specificity of the mu15C1 monoclonal antibody was
determined as described above in Example 1, subsection G.
[0324] H. Cellular Assay 1
[0325] Cellular Assay I was performed as described above in Example
1, subsection J.
[0326] I. Cellular Assay 2
[0327] Cellular Assay II was performed as described above in
Example 1, subsection K.
[0328] J. 15C1 VH and VL Sequences
[0329] 10.sup.7 hybridoma cells were harvested and washed once with
PBS before being resuspended in 1 ml Trizol.TM. reagent
(Invitrogen). Total RNA was subsequently extracted according to the
manufacturer's guidelines. cDNA encoding the VH and VL from the
mu15C1 clone was generated by RT-PCR with the mouse ScFv module
(Amersham Biosciences) according to the manufacturer's guidelines.
Amplified products were cloned into the pGEM-T easy vector (Promega
Corp.) and sequenced using the T7 and SP6 primers.
[0330] The VH and VL cDNAs were subsequently cloned in mammalian
expression vectors containing the human IgG1 and human kappa
constant regions respectively in order to express mu15C1 as a
chimeric MAb ("chimeric 15C1"). To produce recombinant chimeric
MAb, HEK 293 cells were plated in 6 well plates at a density of
2.5.times.10.sup.5 cells/well in 2 ml culture medium containing 10%
FBS. 16 hours post-plating, cells were transfected with 0.75 .mu.g
of the appropriate vector(s) using Fugene.TM. reagent (Roche)
according to the manufacturer's guidelines. 48 hours
post-transfection, supernatant was harvested and antibody was
purified using protein G affinity chromatography.
Example 16: Generation of MAbs Directed Against the Human TLR4/MD-2
Complex
[0331] Mice immunized with CHO cells expressing surface TLR4/MD-2
were monitored for specific serum titers. Those showing a response
to TLR4/MD-2 were "hyperboosted" with HEK 293 TLR4/MD-2
transfectants. This strategy was chosen in order to minimize the
response to non-specific CHO cellular antigens, while
simultaneously maximizing the TLR4/MD-2-specific response.
Screening by FACS of supernatants from hybridomas resulting from B
cell/myeloma fusions was performed on mock-transfected vs.
TLR4/MD-2-transfected CHO cells. Monoclonal antibody from a
specific clone, referred to herein as mu15C1, demonstrated specific
binding to TLR4/MD-2 transfected CHO cells (FIG. 14). mu15C1 was
found to have the IgG1 .kappa. isotype, as determined by FACS using
the mouse Ig isotyping CBA kit (Beckton Dickenson).
Example 17: Neutralization of LPS Activity on TLR4/MD-2 Transfected
HEK 293 Cells
[0332] LPS is known to have ability to induce IL-8 production in
HEK 293 cells transfected with the TLR4/MD-2 complex. The ability
of mu15C1 to inhibit this IL-8 induction was analyzed by
pre-incubating cells with each antibody for 30 minutes prior to LPS
administration. FIG. 15 shows that mu15C1 inhibited the effects of
LPS on HEK 293 cells, even at sub-microgram/ml concentrations.
Example 18: Neutralization of LPS Activity on Human Whole Blood
[0333] The ability of mu15C1 to inhibit LPS-induced IL-8 production
in human whole blood was tested. mu15C1 neutralizing activity was
tested in blood from 3 different donors using a range of monoclonal
antibody concentrations from 0.5 to 5 .mu.g/ml. FIG. 16
demonstrates that mu15C1 significantly reduced the level of IL-8
induced by LPS in all 3 donors, as compared to an isotype matched
control. mu15C1 was found to be more potent than a previously
described .alpha.-TLR4 blocking monoclonal antibody (from
e-biosciences). (See Shimazu et al. J. Exp. Med. 189: 1777-1782
(1999)). In some cases, mu15C1 was found to be as potent as an
.alpha.-CD14 blocking monoclonal antibody that was also included in
the study. (See Kirkland et al. J. Biol. Chem. 268:
24818-24823(1993)). These results indicate that the neutralizing
epitope recognized by mu15C1 on transfected HEK 293 cells is also
exposed on the surface on cells in whole blood, and that mu15C1 is
potent enough to inhibit the activity of LPS in whole blood, even
at concentrations below 1 .mu.g/ml.
Example 19: mu15C1 Specificity
[0334] In order to determine the specificity of the mu15C1
monoclonal antibody, the fact that mu15C1 does not recognize the
rabbit ortholog of the TLR4/MD-2 complex (previously cloned) was
exploited. cDNAs for either rabbit or human TLR4 with N-terminal
FLAG.TM. epitope tag and MD-2 with C-terminal c-Myc and protein C
epitope tags were transfected in HEK 293 cells in the following
combinations: (1) mock vector (2) human TLR4 alone (3) human TLR4
and human MD-2 (4) rabbit TLR4 and rabbit MD-2; (5) human TLR4 and
rabbit MD-2; (6) rabbit TLR4 and human MD-2. FIGS. 17A-17F show
FACS analysis of these cells following antibody staining, which
revealed that mu15C1 recognized cells expressing human TLR4 alone,
the human TLR4/MD-2 complex and a combination of human TLR4 and
rabbit MD-2, but not the rabbit TLR4/MD-2 complex nor a combination
of rabbit TLR4 and human MD-2. These results indicate that the
epitope recognized by mu15C1 is situated on human TLR4 (FIGS.
17A-17F).
Example 20: mu15C1 VH and VL Sequences
[0335] VH and VL sequences from the mu15C1 hybridoma clone were
amplified from total RNA by RT-PCR using oligonucleotide primers
specific for mouse leader sequences and constant domains (Jones and
Bendig, Biotechnology, 9: 88-89 (1991)). Sequence analysis is shown
in FIGS. 18A-18F.
[0336] The mu15C1 antibody includes a heavy chain variable region
(SEQ ID NO: 22, FIG. 18B) encoded by the nucleic acid sequence of
SEQ ID NO: 21 shown in FIG. 18A, and a light chain variable region
(SEQ ID NO: 27, FIG. 18E) encoded by the nucleic acid sequence of
SEQ ID NO: 26 shown in FIG. 18D. The amino acids encompassing the
CDR as defined by Chothia et al. 1989, E. A. Kabat et al., 1991 are
highlighted in underlined and italicized text in FIGS. 18B and 18E
and shown in FIGS. 18C and 18F. The heavy chain CDRs of the mu15C1
antibody have the following sequences: GGYSWH (SEQ ID NO: 23);
YIHYSGYTDFNPSLKT (SEQ ID NO: 24); and KDPSDGFPY (SEQ ID NO: 25).
The light chain CDRs of the mu15C1 antibody have the following
sequences: RASQSISDHLH (SEQ ID NO: 28); YASHAIS (SEQ ID NO: 29);
and QNGHSFPLT (SEQ ID NO: 30).
Example 21: Chimeric 15C1 Binds to hTLR4 hMD2 Transfected CHO
Cells
[0337] In order to demonstrate the specificity of the cloned 15C1
VH and VL for the hTLR4/MD-2 complex, FACS analysis on hTLR4/MD-2
transfected CHO cells using the chimeric 15C1 MAb was performed
(FIG. 19). Specific binding of MAb at the indicated concentration
was detected using an APC-labeled goat-anti-human IgG (H+L)
secondary antibody. An irrelevant isotype-matched human IgG1 MAb
was used as a control.
Example 22: Chimeric 15C1 Inhibits LPS-Induced IL-8 Production in
hTLR4 hMD2 Transfected HEK 293 Cells
[0338] In order to demonstrate the neutralizing capacity of the
cloned 15C1 VH and VL for LPS, the ability of 15C1 to inhibit LPS
dependent IL-8 induction of hTLR4/MD-2 transfected HEK 293 cells
was tested (as described above). FIG. 20 shows that chimeric 15C1
inhibited the effects of LPS on HEK 293 cells in a manner very
similar to that of the 15C1 MAb.
Example 23: Materials and Methods for the Generation of mu7E3
Monoclonal Antibody
[0339] A. Generation of Stable TLR4/MD-2 Transfectants
[0340] Stable TLR4/MD-2 transfectants were generated in CHO-K1 and
HEK 293 cells as described above in Example 9, subsection A.
[0341] B. Generation of Recombinant MD-2 and Chimeric TLR4/MD-2
Protein
[0342] Recombinant soluble MD-2 was generated as described above in
Example 15, subsection B.
[0343] To generate the recombinant TLR4/MD-2 chimeric protein, cDNA
encoding the extracellular portion of human TLR4 linked to MD-2 via
a glycine serine (GGGGS.sub.3) linker was assembled using PCR. FLAG
and 6.times.HIS tags were included at the C-terminus of MD-2 for
detection and purification purposes. The cDNA cassette was cloned
into the baculovirus expression vector pFASTBAC1 (Invitrogen) and
subsequently inserted into bacmid DNA by homologous recombination.
Following generation of a viral stock, Sf9 cells were
superinfected. 48 hours later, the recombinant fusion protein was
purified from cell lysates using an anti-FLAG.TM. M2 MAb affinity
matrix (Sigma).
[0344] C. Immunization of Mice
[0345] 8 week old female BALB/c mice (IFFA CREDO) were immunized as
described above in Example 1, subsection C.
[0346] D. Specific Serum Titrations
[0347] Mice serum titrations were performed as described above in
Example 1, subsection D.
[0348] E. B Cell/Myeloma Fusions
[0349] B cell extraction and cellular fusion were performed and
analyzed as described above in Example 9, subsection D.
[0350] F. Hybridoma Screening
[0351] Hybridoma screening was performed as described above in
Example 1, subsection F.
[0352] G. Monoclonal Antibody Specificity
[0353] The specificity of the mu7E3 monoclonal antibody was
determined as described above in Example 1, subsection G.
[0354] H. Cellular Assay 1
[0355] Monoclonal antibody was first purified from hybridoma cell
supernatant using protein G affinity chromatography.
[0356] Cellular Assay I was performed as described above in Example
1, subsection J.
[0357] I. Cellular Assay 2
[0358] Cellular Assay II was performed as described above in
Example 1, subsection K.
[0359] J. 7E3 VH and VL Sequences
[0360] 10.sup.7 hybridoma cells were harvested and washed once with
PBS before being resuspended in 1 ml Trizol.TM. reagent
(Invitrogen). Total RNA was subsequently extracted according to the
manufacturer's guidelines. cDNA encoding the VH and VL from the
mu7E3 clone was generated by RT-PCR using oligonucleotide primers
specific for mouse leader sequences and constant domains (Jones and
Bendig, Biotechnology, 9: 88-89 (1991)). Amplified products were
cloned into the pGEM-T easy vector (Promega Corp.) and sequenced
using the T7 and SP6 primers.
[0361] The VH and VL cDNAs were subsequently cloned in mammalian
expression vectors containing the human IgG1 and human kappa
constant regions respectively in order to express mu7E3 as a
chimeric MAb ("chimeric 7E3"). To produce recombinant chimeric MAb,
HEK 293 cells were plated in 6 well plates at a density of
2.5.times.10.sup.5 cells/well in 2 ml culture medium containing 10%
FBS. 16 hours post-plating, cells were transfected with 0.75 .mu.g
of the appropriate vector(s) using Fugene.TM. reagent (Roche)
according to the manufacturer's guidelines. 48 hours
post-transfection, supernatant was harvested and antibody was
purified using protein G affinity chromatography.
Example 24: Generation of MAbs Directed Against the Human TLR4/MD-2
Complex
[0362] Mice immunized with CHO cells expressing surface TLR4/MD-2
were monitored for specific serum titers. Those showing a response
to TLR4/MD-2 were "hyperboosted" with HEK 293 TLR4/MD-2
transfectants. This strategy was chosen in order to minimize the
response to non-specific CHO cellular antigens, while
simultaneously maximizing the TLR4/MD-2-specific response.
Screening by FACS of supernatants from hybridomas resulting from B
cell/myeloma fusions was performed on mock transfected vs.
TLR4/MD-2 transfected CHO cells. Monoclonal antibody from a
specific clone, referred to herein as mu7E3, demonstrated specific
binding to TLR4/MD-2 transfected CHO cells (FIG. 21). mu7E3 was
found to have the IgG1 .kappa. isotype, as determined by FACS using
the mouse Ig isotyping CBA kit (Beckton Dickenson).
Example 25: Neutralization of LPS Activity on TLR4/MD-2 Transfected
HEK 293 Cells
[0363] LPS is known to have ability to induce IL-8 production in
HEK 293 cells transfected with the TLR4/MD-2 complex. The ability
of mu7E3 to inhibit this IL-8 induction was analyzed by
pre-incubating cells with each antibody for 30 minutes prior to LPS
administration. FIG. 22 shows that mu7E3 inhibited the effects of
LPS on HEK 293 cells, even at sub-microgram/ml concentrations.
Example 26: Neutralization of LPS Activity on Human Whole Blood
[0364] The ability of mu7E3 to inhibit LPS-induced IL-8 production
in human whole blood was tested. mu7E3 neutralizing activity was
tested in blood from 3 different donors using a range of monoclonal
antibody concentrations from 0.5 to 5 .mu.g/ml. FIG. 23
demonstrates that mu7E3 significantly reduced the level of IL-8
induced by LPS in all 3 donors, as compared to an isotype matched
control. mu7E3 was found to be more potent than a previously
described .alpha.-TLR4 blocking monoclonal antibody (purchased from
e-biosciences). (See Shimazu et al. J. Exp. Med. 189: 1777-1782
(1999)). In some cases, mu7E3 was found to be as potent as an
.alpha.-CD14 blocking monoclonal antibody that was also included in
the study. (See Kirkland et al. J. Biol. Chem. 268:
24818-24823(1993)). These results indicate that the neutralizing
epitope recognized by mu7E3 on transfected HEK 293 cells is also
exposed on the surface on cells in whole blood, and that mu7E3 is
potent enough to inhibit the activity of LPS in whole blood, even
at concentrations below 1 .mu.g/ml.
Example 27: mu7E3 Specificity
[0365] In order to determine the specificity of the mu7E3
monoclonal antibody, the fact that mu7E3 does not recognize the
rabbit ortholog of the TLR4/MD-2 complex (previously cloned) was
exploited. cDNAs for either rabbit or human TLR4 with N-terminal
FLAG.TM. epitope tag and MD-2 with C-terminal c-Myc and protein C
epitope tags were transfected in HEK 293 cells in the following
combinations: (1) mock vector (2) human TLR4 alone (3) human TLR4
and human MD-2 (4) rabbit TLR4 and rabbit MD-2; (5) human TLR4 and
rabbit MD-2; (6) rabbit TLR4 and human MD-2. FIGS. 24A-24F show
FACS analysis of these cells following antibody staining, which
revealed that mu7E3 recognized cells expressing the human TLR4/MD-2
complex and a combination of human TLR4 and rabbit MD-2, but not
the rabbit TLR4/MD-2 complex nor a combination of rabbit TLR4 and
human MD-2. These results indicate that the epitope recognized by
mu7E3 is situated human TLR4 but the presence of MD-2 is essential
for MAb binding (FIGS. 24A-24F).
Example 28: mu7E3 VH and VL Sequences
[0366] VH and VL sequences from the mu7E3 hybridoma clone were
amplified from total RNA by RT-PCR. Sequence analysis is shown in
FIGS. 25A-25F.
[0367] The mu7E3 antibody includes a heavy chain variable region
(SEQ ID NO: 32, FIG. 25B) encoded by the nucleic acid sequence of
SEQ ID NO: 31 shown in FIG. 25A, and a light chain variable region
(SEQ ID NO: 37, FIG. 25E) encoded by the nucleic acid sequence of
SEQ ID NO: 36 shown in FIG. 25D. The amino acids encompassing the
CDR as defined by Chothia et al. 1989, E. A. Kabat et al., 1991 are
highlighted in underlined and italicized text in FIGS. 25B and 25E
and shown in FIGS. 25C and 25F. The heavy chain CDRs of the mu7E3
antibody have the following sequences: TYNIGVG (SEQ ID NO: 33);
HIWWNDNIYYNTVLKS (SEQ ID NO: 34); and MAEGRYDAMDY (SEQ ID NO: 35).
The light chain CDRs of the mu7E3 antibody have the following
sequences: RASQDITNYLN (SEQ ID NO: 38); YTSKLHS (SEQ ID NO: 39);
and QQGNTFPWT (SEQ ID NO: 40).
Example 29: Chimeric 7E3 Binds to hTLR4 hMD2 Transfected CHO
Cells
[0368] In order to demonstrate the specificity of the cloned 7E3 VH
and VL for the hTLR4/MD-2 complex, FACS analysis on hTLR4/MD-2
transfected CHO cells using the chimeric 7E3 MAb was performed
(FIG. 26). Specific binding of MAb at the indicated concentration
was detected using an APC-labeled goat-anti-human IgG (H+L)
secondary antibody. An irrelevant isotype-matched human IgG1 MAb
was used as a control.
Example 30: Chimeric 7E3 Inhibits LPS-Induced IL-8 Production in
hTLR4 hMD2 Transfected HEK 293 Cells
[0369] In order to demonstrate the neutralizing capacity of the
cloned 7E3 VH and VL for LPS, the ability of 7E3 to inhibit LPS
dependent IL-8 induction of hTLR4/MD-2 transfected HEK 293 cells
was tested as described above. FIG. 27 shows that chimeric 7E3
inhibited the effects of LPS on HEK 293 cells.
Example 31: Construction of TLR4/MD-2 Fusion Protein cDNA and
Cloning into pFASTBAC1
[0370] The extracellular portion of TLR4 linked to MD-2 via a
glycine serine (GGGGS.sub.3) linker was assembled using PCR. FLAG
and 6.times.HIS tags were included at the C-terminus of MD-2 for
detection and purification purposes. (FIGS. 28A-28C).
[0371] FIGS. 28A-C illustrate the construction of this TLR4/MD-2
fusion protein cDNA according to the present invention. cDNA
encoding the extracellular portion of human TLR4 (sTLR4) was
amplified by PCR, and unique NheI/XhoI restriction sites were
introduced into 5' non-annealing primer extensions. The
(GGGGS).sub.3 coding sequence and unique XhoI site was introduced
into the 5' non-annealing extension of the sense primer, and a
unique HindIII site was introduced into the 5' non-annealing
extension of the antisense primer. (Panel A). Panel B depicts the
sequential cloning of the amplified sTLR4 and (GGGGS).sub.3/MD-2
cDNAs into pFASTBAC1 between the unique XbaI and HindIII
restriction site. Panel C depicts a proposed protein product
following expression of the sTLR4/MD-2 cDNA in Sf9 cells.
Example 32: Expression of the TLR4/MD-2 Chimeric Protein in SF9
Cell Lysates and Supernatants
[0372] The cDNA cassette of Example 1 was cloned into the
baculovirus expression vector pFASTBAC1 (Invitrogen) and
subsequently inserted into bacmid DNA by homologous recombination.
Following generation of a viral stock, Sf9 cells were superinfected
and expression of the TLR4/MD-2 fusion protein was analyzed in the
cell lysate at 48 and 72 hours post infection by Western blotting.
(FIG. 29).
[0373] FIG. 29 demonstrates the expression of a TLR4/MD-2 chimeric
protein of the invention in Sf9 cell lysates and supernatants.
Protein expression in the Sf9 cell lysates and supernatants was
detected by Western blotting using the anti-FLAG M2 antibody: Lane
1 depicts cleared lysate at 48 hours post infection; lane 2 depicts
cleared lysate at 72 hours post infection; lane 3 depicts cleared
supernatant at 48 hours post infection; lane 4 depicts cleared
supernatant at 72 hours post infection; and lane 5 contains a
reference protein (FLAG tagged). The molecular weight marker sizes
in FIG. 29 are shown in KDa. The predicted molecular weight of
TLR4/MD-2 chimeric protein is approximately 90 KDa, and the
appearance of probable degradation product occurs at approximately
28 KDa.
Example 33: Purification of the TLR4/MD-2 Chimeric Protein from
Infected SF9 Cell Lysates
[0374] To purify the fusion protein, Sf9 cells were harvested 48
hours post superinfection and lysed in 20 mM Tris pH 7.4, 150 mM
NaCl, 1% NP40 with COMPLETE.TM. protease inhibitors (Roche) at a
concentration of 5 volumes/gram cells. Following a fifteen hour
(15') incubation at 4.degree. C., lysates were cleared by
centrifugation (4000 rpm) and filtration (0.22 .mu.m) and passed
through an anti-FLAG M2 MAb affinity matrix (Sigma). Unbound
protein was removed from the matrix by successive washing with 20
mM Tris (pH 7.4), 150 mM NaCl, 1% NP40 and 20 mM Tris (pH 7.4), 150
mM NaCl. Bound protein was eluted from the column with 100 mM
glycine (pH 2.75) and collected in 0.5 ml fractions. Fractions were
rapidly brought to neutral pH through the addition of 50 .mu.l of
1M Tris (pH 9). Protein content was analyzed by western blotting
(with peroxidase conjugated anti-FLAG M2) and Coomassie brilliant
blue staining. (FIG. 30).
[0375] FIG. 30 demonstrates the presence of purified TLR4/MD-2
chimeric protein in infected Sf9 cell lysates. Protein in the cell
lysates was detected by Coomassie brilliant blue staining (FIG. 30,
left panel) or Western blotting (FIG. 30, right panel) using the
anti-FLAG M2 antibody. Lanes 1-5 depict 0.5 ml eluted fractions
from the anti-FLAG M2 affinity column.
Example 34: Inhibition of LPS Induced IL-8 Production Using
Chimeric Soluble TLR4/MD-2
[0376] Lipopolysaccharide (LPS) (15 ng/ml) was preincubated with a
purified chimeric TLR4/MD-2 according to the present invention at
varying concentrations and subsequently incubated with TLR4/MD-2
transfected HEK 293 cells. FIG. 31 is a graph depicting IL-8
production in the cell culture medium 24 hours post treatment.
[0377] As seen in FIG. 31, purified chimeric TLR4/MD-2 was shown to
have an inhibitory effect on the LPS-induced IL-8 production in
TLR4/MD-2 transfected HEK cells, thereby indicating that the
purified TLR4/MD-2 protein of the invention was at least partially
conformationally correct.
Example 35: Humanization of 18H10, 15C1, and 7E3 Antibodies
Design and Construction of the CDR-Grafted Variable Regions
[0378] Mu15C1, mu18H10 and mu7 E3 antibodies were humanized by
CDR-grafting (Jones et al, Nature 321: 522-525, 1986; Verhofyen et
al. Science, 239: 1634-1536, 1988). "CDR-grafting" involves
redesigning the variable region so that the amino acids comprising
the non-human (i.e., mouse) binding site are integrated into the
framework of a human antibody variable region. In order to
accomplish the humanization process, the choice of the human
framework and the extent of mouse variable region sequence to be
transferred are determined.
[0379] The human framework for the humanization process was
selected from all published sequences for human germline
immunoglobulin genes which are used to create the human antibody
repertoire (see The international ImMunoGeneTics database, IMGT,
available online). For mu15C1, two candidates for each V gene were
chosen, namely IGHV3-66 (also known as DP-86) and IGHV4-28 (also
known as DP-48) for the heavy chain and IGKV3-11 (also known as L6)
and IGKV6-21 (also known as A26) for the Kappa light chain. For
mu7E3, two candidates for the heavy chains were chosen, namely
IGHV3-66 (or DP-86) and IGHV2-70 (also known as DP-27) and one
candidate for the Kappa light chain IGKV1-12 (also known as L19).
For mu18H10 one candidate for each V gene was chosen: IGHV1-69
(also known as DP-10) for the heavy chain and IGKV3-11 (or L6) for
the light chain.
[0380] The extent of the mouse sequences that are to be transferred
is determined as follows. Firstly, the antigen binding surface is
predominantly located on a series of loops, known as CDRs, three
per V gene, which extend from the .beta.-barrel framework. In all
cases, the residues chosen for transfer corresponded to the broad
definition of CDRs as defined by Kabat (hypervariable regions;
Kabat et al, Sequences of Proteins of Immunological Interest, Fifth
edition, U.S. Department of Health and Human Services, U.S.
Government Printing Office)) and Chothia (structural loops; Chothia
et al, Nature, 342:877-883, 1989). In addition, residues not
identified in the structural loops or hypervariable regions may
contribute to antigen binding directly or indirectly by affecting
binding site topology, by inducing a stable packing of the
individual variable domains, or by stabilizing the inter-variable
domain interaction. Such residues were identified by sequence
alignment analysis and noting "idiosyncratic" residues, followed by
examination of their structural location and likely effects.
[0381] Once the relevant sequence choices have been made the
humanized variable region DNA were generated using any of the
following procedures: by gene synthesis using suitable overlapping
oligonucleotides (exemplified by Kolbinger et al., Protein Eng. 6,
971-980, 1993)), or by using simultaneous or sequential
site-directed PCR mutagenesis of existing DNA sequences (Kammann et
al., Nucleic Acids Res. 17, 5404). For example, PCR primers coding
for the new CDRs were hybridized to a DNA template that was a fully
human or humanized variable region that was designed based on the
same, or a very similar human variable region (exemplified by Sato
et al., Cancer Res. 53, 851-856 1993). Several minor variants in
the design of the humanized V genes were obtained using the
QuikChange site directed mutagenesis technique originally described
by Stratagene.
[0382] Following the construction and sequencing of the DNA
sequences coding for the light and heavy chain leader sequences
plus humanized variable regions, the leader-variable regions were
converted to humanized whole IgG genes for expression in mammalian
cells by sub-cloning into vectors that contain a human light or
heavy expression cassette.
Humanized Versions of the 15C1 Antibody
[0383] The hu15C1 antibodies of the invention include the variable
heavy chain (V.sub.H) 4-28 shown below in SEQ ID NO: 45 or the
V.sub.H 3-66 shown below in SEQ ID NO: 46. The hu15C1 antibodies of
the invention include the variable light chain (V.sub.L) L6 shown
below in SEQ ID NO: 47 or A26 shown below in SEQ ID NO: 48. The
amino acids encompassing the complementarity determining regions
(CDR) as defined by Chothia et al. 1989, E. A. Kabat et al., 1991
are boxed in the sequences provided below. (See Chothia, C, et al.,
Nature 342:877-883 (1989); Kabat, E A, et al., Sequences of Protein
of immunological interest, Fifth Edition, US Department of Health
and Human Services, US Government Printing Office (1991)).
TABLE-US-00001 15C1 Hu V.sub.H version 4-28 (SEQ ID NO: 45)
##STR00001## ##STR00002## ##STR00003## (SEQ ID NO: 85) CDR 1:
GGYSWH (SEQ ID NO: 86) CDR 2: YIHYSGYTDFNPSLKT (SEQ ID NO: 87) CDR
3: KDPSDGFPY Where X.sub.1 is Thr or Ser Where X.sub.2 is Ile or
Met Where X.sub.3 is Val or Ile Where X.sub.4 is Met or Ile 15C1 Hu
V.sub.H version 3-66 (SEQ ID NO: 46) ##STR00004## ##STR00005##
##STR00006## (SEQ ID NO: 85) CDR 1: GGYSWH (SEQ ID NO: 86) CDR 2:
YIHYSGYTDFNPSLKT (SEQ ID NO: 87) CDR 3: KDPSDGFPY Where X.sub.1 is
Ala or Val Where X.sub.2 is Val or Met Where X.sub.3 is Leu or Phe
15C1 Hu VL version L6 (SEQ ID NO: 47) ##STR00007## ##STR00008##
##STR00009## (SEQ ID NO: 88) CDR1: RASQSISDHLH (SEQ ID NO: 89)
CDR2: YASHAIS (SEQ ID NO: 90) CDR3: QNGHSFPLT Where X.sub.1 is Lys
or Tyr 15C1 Hu VL version A26 (SEQ ID NO: 48) ##STR00010##
##STR00011## ##STR00012## (SEQ ID NO: 88) CDR1: RASQSISDHLH (SEQ ID
NO: 89) CDR2: YASHAIS (SEQ ID NO: 90) CDR3: QNGHSFPLT
[0384] Tables 1 and 2 present alignments of the amino acid
sequences that were used to design the humanized 15C1 V.sub.H
regions:
[0385] As used in Tables 1, (*) indicates parts of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
The bolded entries with no underlining represent positions in FRs
and CDRs where the human and mouse amino acid residues are
identical. The italicized entries represent positions in FRs where
the human residue differs from the analogous mouse residue number.
The underlined entries (bolded or not bolded) represent positions
in FRs and CDRs where the human amino acid residue was replaced by
the corresponding mouse residue. The boxed entries represent human
residues conserved in the humanized version.
[0386] As used in Table 2, (*) indicates parts of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
The bolded entries, not underlined, represent positions in FRs and
CDRs where the human and mouse amino acid residues are identical.
The italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. The
underlined entries (bolded or not bolded) represent positions in
FRs and CDRs where the human amino acid residue was replaced by the
corresponding mouse residue. The boxed entries represent human
residues conserved in the humanized version.
[0387] Tables 3 and 4 present alignments of the amino acid
sequences that were used to design the humanized 15C1 V.sub.L
regions:
[0388] As used in Table 3, (*) represents part of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue.
[0389] As used in Table 4, (*) represents part of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue.
Humanized Versions of the 18H10 Antibody
[0390] The hu18H10 antibodies of the invention include the V.sub.H
1-69 shown below in SEQ ID NO: 49. The hu18H10 antibodies of the
invention include the V.sub.L L6 shown below in SEQ ID NO: 50. The
amino acids encompassing the complementarity determining regions
(CDR) as defined by Chothia et al. 1989, E. A. Kabat et al., 1991
are boxed in the sequences provided below. (See Chothia, C, et al.,
Nature 342:877-883 (1989); Kabat, E A, et al., Sequences of Protein
of immunological interest, Fifth Edition, US Department of Health
and Human Services, US Government Printing Office (1991)).
TABLE-US-00002 18H10 Hu VH version 1-69 (SEQ ID NO: 49)
##STR00013## ##STR00014## ##STR00015## (SEQ ID NO: 91) CDR1: DSYIH
(SEQ ID NO: 92) CDR2: WTDPENVNSIYDPRFQG (SEQ ID NO: 93) CDR3:
GYNGVYYAMDY Where X.sub.1 is Met or Ile Where X.sub.2 is Lys or Thr
Where X.sub.3 is Met or Leu 18H10 Hu VL version L6 (SEQ ID NO: 50)
##STR00016## ##STR00017## ##STR00018## (SEQ ID NO: 94) CDR1:
SASSSVIYMH (SEQ ID NO: 95) CDR2: RTYNLAS (SEQ ID NO: 96) CDR3:
HQWSSFPYT Where X.sub.1 is Phe or Tyr
[0391] Table 5 presents alignments of the amino acid sequences that
were used to design the humanized 15C1 V.sub.H region:
[0392] As used in Table 5, (*) indicates parts of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue. Boxed entries represent human residues
conserved in the humanized version.
[0393] Table 6 presents alignments of the amino acid sequences that
were used to design the humanized 15C1 V.sub.L region:
[0394] As used in Table 6, (*) represents part of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs and CDRs where human
residues differ from analogous mouse residues numbers. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue. Boxed entries represent human residues
conserved in the humanized version.
Humanized Versions of the 7E3 Antibody
[0395] The hu7E3 antibodies of the invention include the V.sub.H
2-70 shown below in SEQ ID NO: 51 or the V.sub.H 3-66 shown below
in SEQ ID NO: 52. The hu7E3 antibodies of the invention include the
V.sub.L L19 shown below in SEQ ID NO: 53. The amino acids
encompassing the complementarity determining regions (CDR) as
defined by Chothia et al. 1989, E. A. Kabat et al., 1991 are boxed
in the sequences provided below. (See Chothia, C, et al., Nature
342:877-883 (1989); Kabat, E A, et al., Sequences of Protein of
immunological interest, Fifth Edition, US Department of Health and
Human Services, US Government Printing Office (1991)).
TABLE-US-00003 7E3 Hu VH version 2-70 (SEQ ID NO: 51) ##STR00019##
##STR00020## ##STR00021## (SEQ ID NO: 97) CDR1: TYNIGVG (SEQ ID NO:
98) CDR2: HIWWNDNIYYNTVLKS (SEQ ID NO: 99) CDR3: MAEGRYDAMDY Where
X.sub.1 is Ser ot Thr Where X.sub.2 is Ile or Phe Where X.sub.3 is
Ile or Ala 7E3 Hu VH version 3-66 (SEQ ID NO: 52) ##STR00022##
##STR00023## ##STR00024## (SEQ ID NO: 97) CDR1: TYNIGVG (SEQ ID NO:
98) CDR2: HIWWNDNIYYNTVLKS (SEQ ID NO: 99) CDR3: HAEGRYDAMDY Where
X.sub.1 is Phe or Ala Where X.sub.2 is Val or Leu Where X.sub.3 is
Ile or Phe Where X.sub.4 is Lys or Arg Where X.sub.5 is Leu or Val
Where X.sub.6 is Ile or Ala 7E3 Hu VL version L19 (SEQ ID NO: 53)
##STR00025## ##STR00026## (SEQ ID NO: 100) CDR1: RASQDITNYLN (SEQ
ID NO: 101) CDR2: YTSKLHS (SEQ ID NO: 102) CDR3: QQGNTFPWT Where
X.sub.1 is Phe or Tyr Where X.sub.2 is Tyr or Phe
[0396] Tables 7 and 8 present alignments of the amino acid
sequences that were used to design the humanized 15C1 VH
regions:
[0397] The positions of framework segments (FR1, FR2, FR3, and FR4)
and the complementarity-determining regions (CDR1, CDR2, and CDR3)
are shown in column one. (*) indicates parts of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue. Boxed entries represent human residues
conserved in the reshaped human version.
[0398] The positions of framework segments (FR1, FR2, FR3, and FR4)
and the complementarity-determining regions (CDR1, CDR2, and CDR3)
are shown in column one. (*) indicates parts of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue. Boxed entries represent human residues
conserved in the reshaped human version.
[0399] Table 9 presents alignments of the amino acid sequences that
were used to design the humanized 15C1 V.sub.L region:
[0400] As used in Table 9, (*) represents part of main canonical
structure for the CDR loops as defined by Chothia et al. (1989).
Bolded entries, not underlined, represent positions in FRs and CDRs
where the human and mouse amino acid residues are identical.
Italicized entries represent positions in FRs where the human
residue differs from the analogous mouse residue number. Underlined
entries (bolded or not bolded) represent positions in FRs and CDRs
where the human amino acid residue was replaced by the
corresponding mouse residue. Boxed entries represent human germline
gene residues
Example 36: hu18H10 Binds hTLR4 hMD2 Expressed on CHO Cells
[0401] In order to demonstrate the ability of the hu18H10 humanized
monoclonal antibody to bind to the human TLR4/MD-2 complex, flow
cytometry experiments (as described above) were performed using
chimeric 18H10 as a positive control. FIG. 39 shows that hu18H10
bound TLR4/MD-2 in a manner very similar to that of the 18H10
chimeric antibody described above.
Example 37: hu7E3 Humanized Monoclonal Antibodies Bind hTLR4 hMD2
Expressed on CHO Cells
[0402] In order to demonstrate the ability of the hu7E3 humanized
monoclonal antibodies to bind to the human TLR4/MD-2 complex, flow
cytometry experiments (as described above) were performed using
chimeric 7E3 as a positive control. The hu7E3 antibodies tested
included a hu7E3 antibody that includes V.sub.H 2-70 shown in SEQ
ID NO: 51 and the V.sub.L L19 shown in SEQ ID NO: 53 ("7E3
2-70/L19") and a hu7E3 antibody that includes V.sub.H 3-66 shown in
SEQ ID NO: 52 and the V.sub.L L19 shown in SEQ ID NO: 53 ("7E3
3-66/L19") FIG. 40 shows that hu7E3 MAbs bound TLR4/MD-2 in a
manner similar to that of the 7E3 chimeric antibody described
above.
Example 38: hu15C1 Humanized Monoclonal Antibodies Bind hTLR4 hMD2
Expressed on CHO Cells
[0403] In order to demonstrate the ability of the hu7E3 humanized
monoclonal antibodies to bind to the human TLR4/MD-2 complex, flow
cytometry experiments (as described above) were performed using
chimeric 15C1 as a positive control. The hu15C1 antibodies tested
included the hu15C1 antibody that includes V.sub.H 4-28 shown in
SEQ ID NO: 45 and the V.sub.L A26 shown in SEQ ID NO: 48 ("15C1
4-28/A26") and variants thereof in which residues at certain
positions (QC ##, Kabat numbering) have been replaced by the
corresponding amino acids in the given human germline ("15C1 4-28
QC 30/A26"; "15C1 4-28 QC 48/A26"; "15C1 4-28 QC 67/A26" and "15C1
4-28 QC 69/A26", see TABLE 1). Other hu15C1 antibodies tested
include a hu15C1 antibody that includes V.sub.H 3-66 shown in SEQ
ID NO: 46 and the V.sub.L L6 shown in SEQ ID NO: 47 ("15C1
3-66/L6") and a hulSC1 antibody that includes V.sub.H 3-66 shown in
SEQ ID NO: 46 and the V.sub.L A26 shown in SEQ ID NO: 48 ("15C1
3-66/L6"). FIGS. 41 and 42 demonstrate that the hulSC1 antibodies
MAbs bound TLR4/MD-2 in a manner similar to that of the 15C1
chimeric antibody described above.
Example 39: TLR4 and MD2 Epitope Mapping Studies
[0404] hu15C1, hu7E3 and hu18H10 are three monoclonal antibodies
(MAbs) showing specificity for the human TLR4/MD-2 receptor
complex. This receptor complex is activated by lipopolysaccharide
(LPS) the major component of the outer membrane of gram-negative
bacteria. All three MAbs are capable of inhibiting receptor
activation and subsequent intracellular signaling via LPS, but
interestingly, all three have distinct specificities. hu15C1 binds
TLR4 independently of the presence of MD-2. hu7E3 binds to TLR4,
but binding is greatly enhanced by the presence of MD-2, suggesting
that the presence of the latter causes a conformational change in
TLR4 exposing an epitope bound by hu7E3. hu18H10 binds to MD-2, but
requires the presence of TLR4, as the MAb does not bind soluble
forms of MD-2.
[0405] The aim of this study was to identify small regions and
individual amino acids of both the TLR4 and MD-2 sequences
important for the binding of hu15C1, hu7E3 and hu18H10. The amino
acid sequence of human TLR4 (GenBank Accession No. 000206) is shown
in FIG. 43. The amino acid sequence of Human MD2 (GenBank Accession
No. Q9Y6Y9) is shown in FIG. 33B.
[0406] As none of the hu15C1, hu7E3 and hu18H10 MAbs demonstrate
cross-reactivity to the mouse TLR4/MD-2 receptor complex, a
strategy utilizing mouse-human hybrids, whereby segments of the
human TLR4 and MD-2 proteins were replaced by the equivalent mouse
segments was used to identify defined linear regions of human TLR4
and MD-2 essential for the binding of the MAbs. Furthermore, these
regions were mutated at amino acid residues differing between the
human and mouse sequences in order to identify individual amino
acids essential for the binding of these MAbs.
Generation of Mouse-Human Hybrid TLR4 Mutants.
[0407] To generate the mouse-human-human-human (MHHH), human TLR4,
cloned into the mammalian expression vector pCDNA3.1(-)hygro
(Invitrogen) was modified by introducing a novel HpaI site and
destroying an existing HpaI site by site-directed mutagenesis with
the following oligonucleotides: 5' GACCATTGAAGAATTCCGGTTCTCTTGCTCTC
CTCG 3' (SEQ ID NO: 55); 5' CGAGGTAGTAGTCTAAGTATGTTAACCGGAATTCTTC
AATGGTC 3' (SEQ ID NO: 56) (introduction of novel HpaI site) and 5'
GGCAACATTTAG AATTAGTCAA CTGTAAATTTGGACAG 3' (SEQ ID NO: 57); 5'
CTGTCCAAATTTACA GTTGACTAATTCTAAATGTTGCC 3' (SEQ ID NO: 58)
(destruction of existing HpaI site). Site-directed mutagenesis was
performed using the QuikChange.TM. kit (Stratagene) following the
manufacturer's instructions. The N-terminal region of mouse TLR4
was amplified by PCR using the following oligonucleotides: 5'
ATTTGTATAGTTAACCTGAACTCATC 3' (SEQ ID NO: 59) and 5'
GGGGCGGCCGCGGGAAGCTTG AATCCCTGCATAG 3' (SEQ ID NO: 60). This mouse
DNA fragment replaced the corresponding human DNA fragment in the
HpaI-mutated human TLR4 vector (above) by cloning at the unique
NotI and HpaI restriction sites.
[0408] To generate HHHM, the C-terminal region of mouse TLR4 was
amplified by PCR using the following oligonucleotides: 5'
GGGGATATCTTTGCAAACACAACAAA CTTGAC 3' (SEQ ID NO: 61) and 5'
GGGCTCGAGCTTGTACATATAACAG GTAG 3' (SEQ ID NO: 62). This mouse DNA
fragment replaced the corresponding human DNA fragment in the human
TLR4 vector by cloning at the unique EcoRV and XhoI restriction
sites.
[0409] To generate MMHH, the MHHH construct was modified by
site-directed mutagenesis (as above) to introduce a unique AgeI
restriction site into the TLR4 sequence using the following
oligonucleotides: 5' GCTTTTTCAGAAGTTGATCTACCGGTCCTTG
AGTTTCTAGATCTCAGT 3' (SEQ ID NO: 63) and 5' ACTGAGATCTAGAAACTCA
AGGACCGGTAGATCAACTTCTGAAAAAGC 3' (SEQ ID NO: 64). In parallel, an
internal region of mouse TLR4 was amplified by PCR using the
following oligonucleotides: 5' CATTGATGAGTTCAGGTTAAC 3' (SEQ ID NO:
65) and 5' ATGCACCGGTAGG GCCACTTTTTTAAAACTG 3' (SEQ ID NO: 66).
This mouse DNA fragment replaced the corresponding human DNA
fragment in the AgeI-mutated MHHH vector (above) by cloning at the
unique HpaI and AgeI restriction sites.
[0410] To generate the mouse-human-mouse-human (MHMH) hybrid, an
internal region of mouse TLR4 was amplified by PCR using the
following oligonucleotides: 5' ATG CACCGGTTCTCAGCTATCTAGATCTTAG 3'
(SEQ ID NO: 67) and 5' ATGCGATATCT GAAAGGGTGTTGTCTTTGAAAG 3' (SEQ
ID NO: 68). This mouse DNA fragment replaced the corresponding
human DNA fragment in the AgeI-mutated MHHH vector (above) by
cloning at the unique AgeI and EcoRV restriction sites.
[0411] To generate MMHHa, an internal region of human TLR4 was
amplified by PCR using the following oligonucleotides: 5'
CCGTTAACATATACAAATGATTTTTCAGATG
ATATTGTTAAGTTCCATTGCTTGGCGAATGTTTCTGCAATGTCTCTGGCAGGTGTGA
CTATTGAAAGGGTAAAAG 3' (SEQ ID NO: 69) and 5' CCACCGGTAGATCAACTTCT
GAAAAAGC 3' (SEQ ID NO: 70). This DNA fragment replaced the
corresponding human DNA fragment in the AgeI-mutated MHHH vector
(above) by cloning at the unique HpaI and AgeI restriction
sites.
[0412] To generate MMHHb, an internal region of human TLR4 was
amplified by PCR using the following oligonucleotides: 5'
CCGTTAACATACTTAGACTACTA C 3' (SEQ ID NO: 71) and 5'
GATATCTGAAAGGGTGTTGTCTTTGAAAGAATTGCCAGCCATTT
TTAATGTGTTGAGACTGGTCAAGCCAAGAAATATACCATCGAAGTCAATTTTGGTG
TTAGTATGAGAAATGTCAAG 3' (SEQ ID NO: 72). This DNA fragment replaced
the corresponding human DNA fragment in the AgeI-mutated MHHH
vector (above) by cloning at the unique HpaI and AgeI restriction
sites.
[0413] Generation of Mouse-Human Hybrid MD-2 Mutants.
[0414] Firstly, human MD-2, cloned into the mammalian expression
vector pCDNA3.1(-) (Invitrogen) was modified by site-directed
mutagenesis (as above) to introduce a novel AflII restriction site
with the following oligonucleotides: 5' CTCTTTTTGCAGAGCTC
TTAAGGGAGAGACTGTGAA 3' (SEQ ID NO: 73) and 5' TTCACAGTCTCTCCCTT
AAGAGCTCTGCAAAAAGAG 3' (SEQ ID NO: 74).
[0415] In order to generate MHH, the N-terminal region of mouse
MD-2 was amplified by PCR using the following oligonucleotides: 5'
GGAAGCTTAACCACCATG TTGCC 3' (SEQ ID NO: 84) and 5'
CCGGATCCCCTCAGTCTTATGC 3' (SEQ ID NO: 75). This mouse DNA fragment
replaced the corresponding human DNA fragment in the AflII-mutated
human MD-2 vector (above) by cloning at the unique HindIII and
BamHI restriction sites.
[0416] In order to generate HMH, an internal region of mouse MD-2
was amplified by PCR using the following oligonucleotides: 5'
CCGGATCCAATGGATTTGTG CATG 3' (SEQ ID NO: 76) and 5'
GGCTTAAGAGCTCTGCAAAAAGAATAGTC 3' (SEQ ID NO: 77). This mouse DNA
fragment replaced the corresponding human DNA fragment in the
AflII-mutated human MD-2 vector (above) by cloning at the unique
BamHI and AflII restriction sites.
[0417] In order to generate HHM, the C-terminal region of mouse
MD-2 was amplified by PCR using the following oligonucleotides: 5'
GGCTTAAGGGAGAGACTG TGAATACATC 3' (SEQ ID NO: 78) and 5'
CCGCTAGCATTGACATCACGGC 3' (SEQ ID NO: 79). This mouse DNA fragment
replaced the corresponding human DNA fragment in the AflII-mutated
human MD-2 vector (above) by cloning at the unique AflII and NheI
restriction sites.
Generation of Human TLR4 and MD-2 Alanine Scanning Mutants.
[0418] All mutants were generated by site-directed mutagenesis
using the QuikChange.TM. kit (Stratagene) as above. DNA
oligonucleotides housing the appropriate mismatch mutations were
used with either human TLR4 in pCDNA3.1(-)hygro or human MD-2 in
pCDNA3.1(-) as appropriate. Introduction of the desired mutations
was verified by DNA sequencing.
Transient Transfection of HEK 293 Cells.
[0419] HEK 293 cells, expressing both the large T and EBNA antigens
to allow for episomal plasmid replication, were plated in 1 ml
culture medium at 1.times.10.sup.5 cells/well in 24 well culture
plates. The following day, cells were transfected with 1 .mu.g
DNA/well (0.5 .mu.g+0.5 .mu.g of each plasmid for co-transfections)
using 1.5 .mu.l/well Fugene6.TM. transfection reagent (Roche),
following the manufacture's guidelines. Cells were analyzed 48-72
hours post-transfection.
Flow Cytometry.
[0420] Binding of MAb to the surface of TLR4/MD-2 transfected HEK
293 cells was measured by flow cytometry. 1.times.10.sup.5 cells
were incubated in 96 well V-bottom plates with the appropriate MAb
at a final concentration of 10 .mu.g/ml in a volume of 50-100 .mu.l
inFACS buffer (1.times.PBS, 100 .mu.g/ml BSA, 0.05% NaN.sub.3).
Following a 30 minute incubation at 4.degree. C., cells were
pelleted, washed once with 200 .mu.l FACS buffer, repelleted and
resuspended with allophycocyanin (APC) conjugated secondary
antibody (Molecular Probes) at a 1:250 dilution in FACS buffer.
Following a 30 minute incubation at 4.degree. C., cells were washed
once in 200 .mu.l FACS buffer, fixed in 1% paraformaldehyde,
1.times.PBS and analyzed for fluorescence using a FACScalibur
(Becton Dickenson) in the FL-4 channel.
hu15C1 and hu7E3 Bind to an 87 Amino Acid Internal Region of
TLR4.
[0421] Four mouse-human hybrid mutants of TLR4 were generated in
order to determine the precise region of TLR4 responsible for
binding to hu15C1 and hu7E3. Transient transfection of HEK 293
cells allowed presentation of either wild type (wt) or mutated
forms of TLR4 along with wt MD-2 on the cell surface. FACS analysis
(FIGS. 34 a and b) revealed that the complex was correctly
expressed in three of the four cases (as shown by c-myc and FLAG
staining). TLR4 mutant version MHMH was poorly expression on the
cell surface and did not support interaction with MD-2, suggesting
that the protein was not conformationally correct. This observation
meant that results of binding with hu15C1 and hu7E3 could not be
taken into account. Whilst versions MHHH and HHHM bound both hu15C1
and hu7E3 well, MMHH was negative for binding of both antibodies,
suggesting that an 87 amino acid internal region of TLR4
(highlighted in FIG. 34a) is essential for interaction between TLR4
and either hu15C1 or hu7E3.
[0422] In order to determine in more detail the residues important
for hu15C1 and hu7E3 binding, two additional mutants were generated
whereby either the first 30 amino acids (MMHHa) or the last 32
amino acids (MMHHb) of this internal region were replaced by the
corresponding mouse sequence (FIG. 35a). FACS analysis (FIGS. 35 a
and b) of transfected HEK 293 cells revealed that the complex was
correctly expressed in both cases (as shown by c-myc and FLAG
staining). hu15C1 bound well to MMHHa but showed no binding to
MMHHb, suggesting that residues situated towards the C terminus of
this internal region are critical for binding. Conversely, hu7E3
bound well to MMHHb but showed no binding to MMHHa, suggesting that
residues situated towards the N terminus of this internal region
are critical for binding.
HTA 125 Recognizes an N-Terminal Region of TLR4.
[0423] HTA125 is a commercially available non-neutralizing MAb
directed against human TLR4 (E-biosciences). HTA125 was tested
against the four mouse-human hybrids and found, in contrast to the
neutralizing MAbs 15C1 and 7E3, an absence of binding when the
N-terminal region of TLR4 was changes from human to mouse (FIGS. 34
a and c).
TLR4 Amino Acid Residues Essential for hu15C1 and hu7E3
Binding.
[0424] In order to identify important residues within the 87 amino
acid region of TLR4 identified above, the human sequence was
aligned to the corresponding mouse TLR4 sequence within this region
(alignments performed using the b12seq program). Since hu15C1 and
hu7E3 do not cross-react with mouse TLR4/MD-2, it was assumed that
residues essential for MAb binding would not be conserved between
the two species. All non-conserved residues in the human sequence
were mutated to alanine. 20 mutant (QC 1 to QC 20) versions were
constructed, each one containing two or three residues converted to
alanines (FIG. 36a).
[0425] Following transient transfection of these mutants along with
wt MD-2 in HEK 293 cells, C-myc and hu18H10 MAbs were used to
detect the presence of TLR4 and MD-2 respectively on the cell
surface. FACS analysis (FIG. 36b) showed that all TLR4 mutants were
expressed at a level well above background. All mutants bound MD-2
well with the exception of QC 6. In order to determine the level of
binding of hu15C1 and hu7E3 to the mutant TLR4, a "normalized"
value was obtained by dividing the mean fluorescence intensity
(MFI) obtained with the MAb by that obtained with C-myc. This
allowed for variation in the level of expression at the cell
surface between the TLR4 mutants. For hu15C1, normalized binding
was seen to be greatly diminished for versions QC 10, QC 15 and QC
20. For hu7E3, QC 1, QC 2, QC 6 and QC 7 showed greatly reduced
hu7E3 binding, although as hu7E3 required the presence of MD-2 for
binding, lack of binding to QC 6 could simply be explained by the
absence of MD-2 on the cell surface (see hu18H10 MFI for QC 6).
These results confirm that residues important for hu15C1 binding
are located at the C terminal end of the 87 amino acid section
identified above, whereas residues important for hu15C1 binding are
located towards the N terminal end.
hu18H10 Binds to a 39 Amino Acid N-Terminal Region of MD-2.
[0426] Three mouse-human hybrid mutants of MD-2 were generated in
order to determine the precise region of the protein responsible
for binding to hu18H10. Transient transfection of HEK 293 cells
allowed presentation of either wild type (wt) or mutated forms of
MD-2 along with wt TLR4 on the cell surface. FACS analysis (FIGS.
37 A and B) revealed that the complex was correctly expressed in
all three cases (as shown by hu15C1 and C-myc staining). Whilst
versions HMH and HHM bound both hu18H10 well, MHH was negative for
binding, suggesting that a 39 amino acid N-terminal region of MD-2
(highlighted in FIG. 37A) is essential for interaction between MD-2
and hu18H10.
MD-2 Amino Acid Residues Essential for hu18H10 Binding.
[0427] In order to identify important residues within the 39 amino
acid region of MD-2 identified above, the human sequence was
aligned to the corresponding mouse MD-2 sequence within this region
(alignments performed using the b12seq program). Since hu18H10 does
not cross-react with mouse TLR4/MD-2, it was assumed that residues
essential for MAb binding would not be conserved between the two
species. Therefore, mutate all non-conserved residues in the human
sequence were mutated to alanine. 14 mutant (QC 1 to QC 14)
versions were constructed, each one containing a single residue
converted to alanine (FIG. 38a).
[0428] Following transient transfection of these mutants along with
wt TLR4 in HEK 293 cells, hu15C1 and anti-6.times.HIS MAbs were
used to detect the presence of TLR4 and MD-2 respectively on the
cell surface. FACS analysis (FIG. 38b) showed that all TLR4 mutants
were expressed at a level well above background, with the exception
of QC7 which appears to be poorly expressed or has lost its ability
to interact with TLR4 (n.b. TLR4 was well expressed upon
co-transfection with QC 7). In order to determine the level of
binding of hu18H10 to the mutated versions MD-2, a "normalized"
value was obtained by dividing the mean fluorescence intensity
(MFI) obtained with the hu18H10 by that obtained with C-myc. This
allowed for variation in the level of expression at the cell
surface between the MD-2 mutants. For hu18H10, normalized binding
was seen to be greatly diminished for version QC 13. These results
confirm that a residue important for hu18H10 binding is located
within the 37 amino acid N terminal section of MD-2 identified
above.
Example 40: hu18H10 Humanized Monoclonal Antibody Inhibits
LPS-Induced IL-6 Production in Human Whole Blood
[0429] In order to demonstrate the neutralizing capacity of the
hu18H10 humanized monoclonal antibody for LPS, the ability of
hu18H10 to inhibit LPS dependent IL-6 induction of human whole
blood is tested (as described above). The ability of the hu18H10
antibody to inhibit the effects of LPS on blood leucocytes is
compared to that of the 18H10 chimeric antibody described
above.
Example 41: hu7E3 Humanized Monoclonal Antibody Inhibits
LPS-Induced IL-6 Production in Human Whole Blood
[0430] To demonstrate the neutralizing capacity of hu7E3 humanized
monoclonal antibodies for LPS, the ability of the hu7E3 antibody to
inhibit LPS dependent IL-6 induction of human whole blood is tested
(as described above). The ability of the hu7E3 antibody to inhibit
the effects of LPS on blood leucocytes is compared to that of the
7E3 chimeric antibody described above.
Example 42: hu15C1 Humanized Monoclonal Antibody Inhibits
LPS-Induced IL-6 Production in Human Whole Blood
[0431] To demonstrate the neutralizing capacity of hu15C1 humanized
monoclonal antibodies for LPS, the ability of the hu15C1 antibody
to inhibit LPS dependent IL-6 induction of human whole blood was
tested (as described above). The ability of the hu15C1 antibody to
inhibit the effects of LPS on blood leucocytes was compared to that
of the 15C1 chimeric antibody described above (FIG. 44).
Other Embodiments
[0432] While the invention has been described in conjunction with
the detailed description thereof, the foregoing description is
intended to illustrate and not limit the scope of the invention,
which is defined by the scope of the appended claims. Other
aspects, advantages, and modifications are within the scope of the
following claims.
Sequence CWU 1
1
1021360DNAMus musculus 1caggtgcaac tgcagcagtc tggggctgat cttgtgaggc
caggggcctt agtcaagttg 60tcctgcacag cttctggctt caacattaaa gactcctata
tacactgggt gaagaagagg 120cctgaatggg gcctggagtg gattggatgg
actgatcctg agaatgttaa ttctatatat 180gacccgaggt ttcagggcaa
ggccagtata acagcagaca catcctccaa cacagccttc 240cttcagctca
ccagcctgac atctgaggac actgccgtct attactgtgc taggggttat
300aacggtgttt actatgctat ggactactgg ggccaaggga cctcagtcac
cgtctcctca 3602120PRTMus musculus 2Gln Val Gln Leu Gln Gln Ser Gly
Ala Asp Leu Val Arg Pro Gly Ala 1 5 10 15 Leu Val Lys Leu Ser Cys
Thr Ala Ser Gly Phe Asn Ile Lys Asp Ser 20 25 30 Tyr Ile His Trp
Val Lys Lys Arg Pro Glu Trp Gly Leu Glu Trp Ile 35 40 45 Gly Trp
Thr Asp Pro Glu Asn Val Asn Ser Ile Tyr Asp Pro Arg Phe 50 55 60
Gln Gly Lys Ala Ser Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Phe 65
70 75 80 Leu Gln Leu Thr Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Gly Tyr Asn Gly Val Tyr Tyr Ala Met Asp
Tyr Trp Gly Gln 100 105 110 Gly Thr Thr Val Thr Val Ser Ser 115 120
35PRTMus musculus 3Asp Ser Tyr Ile His 1 5 417PRTMus musculus 4Trp
Thr Asp Pro Glu Asn Val Asn Ser Ile Tyr Asp Pro Arg Phe Gln 1 5 10
15 Gly 511PRTMus musculus 5Gly Tyr Asn Gly Val Tyr Tyr Ala Met Asp
Tyr 1 5 10 6321DNAMus musculus 6caaattgttc tcacccagtc tccatcaatc
atgtctgcgt ctctagggga ggagatcacc 60ctaacctgca gtgccagctc gagtgtaatt
tacatgcact ggtaccagca gaagtcaggc 120acttctccca aactcttgat
ttataggaca tacaacctgg cttctggagt cccttctcgc 180ttcagtggca
gtgggtctgg gaccttttat tctctcacaa tcagcagtgt ggaggctgaa
240gatgctgccg attattactg ccatcagtgg agtagttttc cgtacacgtt
cggagggggg 300accaagctgg aaatcaaacg g 3217107PRTMus musculus 7Gln
Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Ala Ser Leu Gly 1 5 10
15 Glu Glu Ile Thr Leu Thr Cys Ser Ala Ser Ser Ser Val Ile Tyr Met
20 25 30 His Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Leu Leu
Ile Tyr 35 40 45 Arg Thr Tyr Asn Leu Ala Ser Gly Val Pro Ser Arg
Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Phe Tyr Ser Leu Thr Ile
Ser Ser Val Glu Ala Glu 65 70 75 80 Asp Ala Ala Asp Tyr Tyr Cys His
Gln Trp Ser Ser Phe Pro Tyr Thr 85 90 95 Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys Arg 100 105 810PRTMus musculus 8Ser Ala Ser Ser Ser
Val Ile Tyr Met His 1 5 10 97PRTMus musculus 9Arg Thr Tyr Asn Leu
Ala Ser 1 5 109PRTMus musculus 10His Gln Trp Ser Ser Phe Pro Tyr
Thr 1 5 11353DNAMus musculus 11aggtgaaact gcaggagtct ggagctgagc
tgatgaagcc tggggcctca gtgaagatat 60cctgcaaggc tactggctac aaattcagtg
actactggat agagtggata aaacagaggc 120ctggacatgg ccttgagtgg
attggagaga ttttgcctgg aagtggtagt actaactaca 180atgaggactt
caaggacaag gccacattca cttcagatac atcctccaac acagcctaca
240tgcaactcag cagcctgaca tctgaagact ctgccgtcta ttactgtgca
aaagaggaga 300gggcgtacta ctttggctat tggggccaag ggaccacggt
caccgtctcc tca 35312118PRTMus musculus 12Gln Val Lys Leu Gln Glu
Ser Gly Ala Glu Leu Met Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile
Ser Cys Lys Ala Thr Gly Tyr Lys Phe Ser Asp Tyr 20 25 30 Trp Ile
Glu Trp Ile Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile 35 40 45
Gly Glu Ile Leu Pro Gly Ser Gly Ser Thr Asn Tyr Asn Glu Asp Phe 50
55 60 Lys Asp Lys Ala Thr Phe Thr Ser Asp Thr Ser Ser Asn Thr Ala
Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys 85 90 95 Ala Lys Glu Glu Arg Ala Tyr Tyr Phe Gly Tyr
Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser 115
135PRTMus musculus 13Asp Tyr Trp Ile Glu 1 5 1417PRTMus musculus
14Glu Ile Leu Pro Gly Ser Gly Ser Thr Asn Tyr Asn Glu Asp Phe Lys 1
5 10 15 Asp 159PRTMus musculus 15Glu Glu Arg Ala Tyr Tyr Phe Gly
Tyr 1 5 16339DNAMus musculus 16gatgttttga tgacccaaac tccactctcc
ctgcctgtca gtcttggaga tcaagcctcc 60atctcttgca ggtctagtca gagccttgaa
aacagtaatg gaaacaccta tttgaactgg 120tacctccaga aaccaggcca
gtctccacag ctcctgatct acagggtttc caaccgattt 180tctggggtcc
tagacaggtt cagtggtagt ggatcaggga cagatttcac actgaaaatc
240agcagagtgg aggctgagga tttgggagtt tatttctgcc tccaagttac
acatgtccct 300cccacgttcg gtgctgggac caagctggaa ctgaaacgg
33917113PRTMus musculus 17Asp Val Glu Met Thr Gln Thr Pro Leu Ser
Leu Pro Val Ser Leu Gly 1 5 10 15 Asp Gln Ala Ser Ile Ser Cys Arg
Ser Ser Gln Ser Leu Glu Asn Ser 20 25 30 Asn Gly Asn Thr Tyr Leu
Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu
Ile Tyr Arg Val Ser Asn Arg Phe Ser Gly Val Leu 50 55 60 Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Leu Gln Val 85
90 95 Thr His Val Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
Lys 100 105 110 Arg 1816PRTMus musculus 18Arg Ser Ser Gln Ser Leu
Glu Asn Ser Asn Gly Asn Thr Tyr Leu Asn 1 5 10 15 197PRTMus
musculus 19Arg Val Ser Asn Arg Phe Ser 1 5 209PRTMus musculus 20Leu
Gln Val Thr His Val Pro Pro Thr 1 5 21354DNAMus musculus
21gatgtgcagc ttcaggagtc aggacctgac ctaatacaac cttctcagtc actttcactc
60acctgcactg tcactggcta ctccatcacc ggtggttata gctggcactg gatccggcag
120tttccaggaa acaaactgga atggatgggc tacatccact acagtggtta
cactgacttc 180aacccctctc tcaaaactcg aatctctatc actcgagaca
catccaagaa ccagttcttc 240ctgcagttga attctgtgac tactgaagac
acagccacat attactgtgc aagaaaagat 300ccgtccgacg gatttcctta
ctggggccaa gggactctgg tcactgtctc tgca 35422118PRTMus musculus 22Asp
Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Ile Gln Pro Ser Gln 1 5 10
15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Gly Gly
20 25 30 Tyr Ser Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu
Glu Trp 35 40 45 Met Gly Tyr Ile His Tyr Ser Gly Tyr Thr Asp Phe
Asn Pro Ser Leu 50 55 60 Lys Thr Arg Ile Ser Ile Thr Arg Asp Thr
Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Gln Leu Asn Ser Val Thr Thr
Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Lys Asp Pro Ser
Asp Gly Phe Pro Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val
Ser Ala 115 236PRTMus musculus 23Gly Gly Tyr Ser Trp His 1 5
2416PRTMus musculus 24Tyr Ile His Tyr Ser Gly Tyr Thr Asp Phe Asn
Pro Ser Leu Lys Thr 1 5 10 15 259PRTMus musculus 25Lys Asp Pro Ser
Asp Gly Phe Pro Tyr 1 5 26321DNAMus musculus 26gacattgtga
tgacccagtc tccagccacc ctgtctgtga ctccaggtga tagagtctct 60ctttcctgca
gggccagcca gagtatcagc gaccacttac actggtatca acaaaaatca
120catgagtctc cacggcttct catcaaatat gcttcccatg ccatttctgg
gatcccctcc 180aggttcagtg gcagtggatc agggacagat ttcactctca
gcatcaaaag tgtggaacct 240gaagatattg gggtgtatta ctgtcaaaat
ggtcacagtt ttccgctcac gttcggtgct 300gggaccaagc tggagctgaa a
32127108PRTMus musculus 27Asp Ile Val Met Thr Gln Ser Pro Ala Thr
Leu Ser Val Thr Pro Gly 1 5 10 15 Asp Arg Val Ser Leu Ser Cys Arg
Ala Ser Gln Ser Ile Ser Asp His 20 25 30 Leu His Trp Tyr Gln Gln
Lys Ser His Glu Ser Pro Arg Leu Leu Ile 35 40 45 Lys Tyr Ala Ser
His Ala Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly
Ser Gly Thr Asp Phe Thr Leu Ser Ile Lys Ser Val Glu Pro 65 70 75 80
Glu Asp Ile Gly Val Tyr Tyr Cys Gln Asn Gly His Ser Phe Pro Leu 85
90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg 100 105
2811PRTMus musculus 28Arg Ala Ser Gln Ser Ile Ser Asp His Leu His 1
5 10 297PRTMus musculus 29Tyr Ala Ser His Ala Ile Ser 1 5 309PRTMus
musculus 30Gln Asn Gly His Ser Phe Pro Leu Thr 1 5 31363DNAMus
musculus 31caggttactc tgaaagagtc tggccctggg atattgcagc cctcccagac
cctcagtctg 60acttgttctt tctctgggtt ttcactgacc acttataata taggagtagg
ctggattcgt 120cagccttcag ggaagggtct ggagtggctg gcacacattt
ggtggaatga taatatttac 180tataatacag tccttaagag ccgactcaca
ttctccaagg atacctccaa caaccaggtt 240ttcctcaaga tcgccagtgt
ggacattgca gatactgcca catattactg tattcgaatg 300gctgagggaa
ggtacgacgc tatggactac tggggtcaag gaacctcagt caccgtctcc 360tca
36332121PRTMus musculus 32Gln Val Thr Leu Lys Glu Ser Gly Pro Gly
Ile Leu Gln Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Phe
Ser Gly Phe Ser Leu Thr Thr Tyr 20 25 30 Asn Ile Gly Val Gly Trp
Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu 35 40 45 Trp Leu Ala His
Ile Trp Trp Asn Asp Asn Ile Tyr Tyr Asn Thr Val 50 55 60 Leu Lys
Ser Arg Leu Thr Phe Ser Lys Asp Thr Ser Asn Asn Gln Val 65 70 75 80
Phe Leu Lys Ile Ala Ser Val Asp Ile Ala Asp Thr Ala Thr Tyr Tyr 85
90 95 Cys Ile Arg Met Ala Glu Gly Arg Tyr Asp Ala Met Asp Tyr Trp
Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115 120
337PRTMus musculus 33Thr Tyr Asn Ile Gly Val Gly 1 5 3416PRTMus
musculus 34His Ile Trp Trp Asn Asp Asn Ile Tyr Tyr Asn Thr Val Leu
Lys Ser 1 5 10 15 3511PRTMus musculus 35Met Ala Glu Gly Arg Tyr Asp
Ala Met Asp Tyr 1 5 10 36324DNAMus musculus 36gctatccaga tgacacagag
tacatcctcc ctgtctgcct ctctgggaga cagagtcacc 60atcaattgca gggcaagtca
ggacatcacc aattatttaa attggtatca gcagaaacca 120gatggaactg
tcagactcct gatctattat acatcaaaat tacactcagg agccccatca
180aggttcagtg gccgtgggtc tggaacagat tattctctca ccattagtaa
cctggagcaa 240gaggatattg ccacttactt ttgccaacag ggtaatacgt
ttccgtggac gttcggtgga 300ggcaccaaac tggaaatcaa acgt 32437108PRTMus
musculus 37Ala Ile Gln Met Thr Gln Ser Thr Ser Ser Leu Ser Ala Ser
Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Asn Cys Arg Ala Ser Gln Asp
Ile Thr Asn Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly
Thr Val Arg Leu Leu Ile 35 40 45 Tyr Tyr Thr Ser Lys Leu His Ser
Gly Ala Pro Ser Arg Phe Ser Gly 50 55 60 Arg Gly Ser Gly Thr Asp
Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln 65 70 75 80 Glu Asp Ile Ala
Thr Tyr Phe Cys Gln Gln Gly Asn Thr Phe Pro Trp 85 90 95 Thr Phe
Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 100 105 3811PRTMus musculus
38Arg Ala Ser Gln Asp Ile Thr Asn Tyr Leu Asn 1 5 10 397PRTMus
musculus 39Tyr Thr Ser Lys Leu His Ser 1 5 409PRTMus musculus 40Gln
Gln Gly Asn Thr Phe Pro Trp Thr 1 5 41866DNAHomo sapiens
41ggcacgagcg gcacgagccc accatgaagg gtttcacagc cactctcttc ctctggactc
60tgatttttcc cagctgcagt ggaggcggcg gtgggaaagc ctggcccaca cacgtggtct
120gtagcgacag cggcttggaa gtgctctacc agagttgcga tccattacaa
gattttggct 180tttctgttga aaagtgttcc aagcaattaa aatcaaatat
caacattaga tttggaatta 240ttctgagaga ggacatcaaa gagctttttc
ttgacctagc tctcatgtct caaggctcat 300ctgttttgaa tttctcctat
cccatctgtg aggcggctct gcccaagttt tctttctgtg 360gaagaaggaa
aggagagcag atttactatg ctgggcctgt caataatcct gaatttacta
420ttcctcaggg agaataccag gttttgctgg aactgtacac tgaaaaacgg
tccaccgtgg 480cctgtgccaa tgctactatc atgtgctcct gactgtggcc
tgtagcaaaa atcacagcca 540gctgcatctc gtgggacctc caagctcctc
tgactgaacc tacgtgggag gagaagcagt 600ctgatgacag agagaggctc
tacaaagaag cgcccccaaa gagtgcagct gctaatttta 660gtcccaggac
cagacatccc cagactccac agatgtaatg aagtccccga atgtatctgt
720ttctaaggag cctcttggca gtccttaagc agtcttgagg gtccatcctt
tttctctaat 780tggtcgcctc ccaccagact cacctgcttt tcaacttttt
aggagtgctt cctcacagtt 840accaagaata aagaaagctg gccacc
86642162PRTHomo sapiens 42Met Lys Gly Phe Thr Ala Thr Leu Phe Leu
Trp Thr Leu Ile Phe Pro 1 5 10 15 Ser Cys Ser Gly Gly Gly Gly Gly
Lys Ala Trp Pro Thr His Val Val 20 25 30 Cys Ser Asp Ser Gly Leu
Glu Val Leu Tyr Gln Ser Cys Asp Pro Leu 35 40 45 Gln Asp Phe Gly
Phe Ser Val Glu Lys Cys Ser Lys Gln Leu Lys Ser 50 55 60 Asn Ile
Asn Ile Arg Phe Gly Ile Ile Leu Arg Glu Asp Ile Lys Glu 65 70 75 80
Leu Phe Leu Asp Leu Ala Leu Met Ser Gln Gly Ser Ser Val Leu Asn 85
90 95 Phe Ser Tyr Pro Ile Cys Glu Ala Ala Leu Pro Lys Phe Ser Phe
Cys 100 105 110 Gly Arg Arg Lys Gly Glu Gln Ile Tyr Tyr Ala Gly Pro
Val Asn Asn 115 120 125 Pro Glu Phe Thr Ile Pro Gln Gly Glu Tyr Gln
Val Leu Leu Glu Leu 130 135 140 Tyr Thr Glu Lys Arg Ser Thr Val Ala
Cys Ala Asn Ala Thr Ile Met 145 150 155 160 Cys Ser 43624DNAHomo
sapiens 43ggcgggccgc tcccacttcg gcacgagggg cacgaggtaa atcttttctg
cttactgaaa 60aggaagagtc tgatgattag ttactgatcc tctttgcatt tgtaaagctt
tggagatatt 120gaatcatgtt accatttctg tttttttcca ccctgttttc
ttccatattt actgaagctc 180agaagcagta ttgggtctgc aactcatccg
atgcaagtat ttcatacacc tactgtgata 240aaatgcaata cccaatttca
attaatgtta acccctgtat agaattgaaa ggatccaaag 300gattattgca
cattttctac attccaagga gagatttaaa gcaattatat ttcaatctct
360atataactgt caacaccatg aatcttccaa agcgcaaaga agttatttgc
cgaggatctg 420atgacgatta ctctttttgc agagctctga agggagagac
tgtgaataca acaatatcat 480tctccttcaa gggaataaaa ttttctaagg
gaaaatacaa atgtgttgtt gaagctattt 540ctgggagccc agaagaaatg
ctcttttgct tggagtttgt catcctacac caacctaatt 600caaattagaa
taaattgagt attt 62444160PRTHomo sapiens 44Met Leu Pro Phe Leu Phe
Phe Ser Thr Leu Phe Ser Ser Ile Phe Thr 1 5 10 15 Glu Ala Gln Lys
Gln Tyr Trp Val Cys Asn Ser Ser Asp Ala Ser Ile 20 25 30 Ser Tyr
Thr Tyr Cys Asp Lys Met Gln Tyr Pro Ile Ser Ile Asn Val 35 40 45
Asn Pro Cys Ile Glu Leu Lys Gly Ser Lys Gly Leu Leu His Ile Phe 50
55 60 Tyr Ile Pro Arg Arg Asp Leu Lys Gln Leu Tyr Phe Asn Leu Tyr
Ile 65 70 75 80 Thr Val Asn Thr Met Asn Leu Pro Lys Arg Lys Glu Val
Ile Cys Arg 85 90 95 Gly Ser Asp Asp Asp Tyr Ser Phe Cys Arg Ala
Leu Lys Gly Glu Thr 100 105 110 Val Asn Thr Thr Ile Ser Phe Ser Phe
Lys Gly Ile Lys Phe Ser Lys 115 120 125 Gly Lys Tyr Lys Cys Val Val
Glu Ala Ile Ser Gly Ser Pro Glu Glu 130 135 140 Met Leu Phe Cys Leu
Glu Phe Val Ile Leu His Gln Pro Asn Ser Asn 145 150 155 160
45118PRTHomo sapiensMISC_FEATURE(30)..(30)Xaa is Thr or Ser 45Gln
Val Gln Leu Gln Glu
Ser Gly Pro Gly Leu Val Lys Pro Ser Asp 1 5 10 15 Thr Leu Ser Leu
Thr Cys Ala Val Ser Gly Tyr Ser Ile Xaa Gly Gly 20 25 30 Tyr Ser
Trp His Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45
Xaa Gly Tyr Ile His Tyr Ser Gly Tyr Thr Asp Phe Asn Pro Ser Leu 50
55 60 Lys Thr Arg Xaa Thr Xaa Ser Arg Asp Thr Ser Lys Asn Gln Phe
Ser 65 70 75 80 Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val
Tyr Tyr Cys 85 90 95 Ala Arg Lys Asp Pro Ser Asp Gly Phe Pro Tyr
Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115
46118PRTHomo sapiensMISC_FEATURE(24)..(24)Xaa is Ala or Val 46Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10
15 Ser Leu Arg Leu Ser Cys Ala Xaa Ser Gly Tyr Ser Ile Thr Gly Gly
20 25 30 Tyr Ser Trp His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp 35 40 45 Xaa Ser Tyr Ile His Tyr Ser Gly Tyr Thr Asp Phe
Asn Pro Ser Leu 50 55 60 Lys Thr Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Xaa Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Lys Asp Pro Ser
Asp Gly Phe Pro Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val
Ser Ser 115 47107PRTHomo sapiensMISC_FEATURE(49)..(49)Xaa is Lys or
Tyr 47Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro
Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile
Ser Asp His 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala
Pro Arg Leu Leu Ile 35 40 45 Xaa Tyr Ala Ser His Ala Ile Ser Gly
Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe
Thr Leu Thr Ile Ser Ser Leu Glu Pro 65 70 75 80 Glu Asp Phe Ala Val
Tyr Tyr Cys Gln Asn Gly His Ser Phe Pro Leu 85 90 95 Thr Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys 100 105 48107PRTHomo sapiens 48Glu
Ile Val Leu Thr Gln Ser Pro Asp Phe Gln Ser Val Thr Pro Lys 1 5 10
15 Glu Lys Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Asp His
20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Asp Gln Ser Pro Lys Leu
Leu Ile 35 40 45 Lys Tyr Ala Ser His Ala Ile Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Asn Ser Leu Glu Ala 65 70 75 80 Glu Asp Ala Ala Thr Tyr Tyr Cys
Gln Asn Gly His Ser Phe Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys 100 105 49120PRTHomo
sapiensMISC_FEATURE(48)..(48)Xaa is Met or Ile 49Gln Val Gln Leu
Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Phe Asn Ile Lys Asp Ser 20 25 30
Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Xaa 35
40 45 Gly Trp Thr Asp Pro Glu Asn Val Asn Ser Ile Tyr Asp Pro Arg
Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Xaa Ser Thr Ser
Thr Ala Tyr 65 70 75 80 Xaa Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Tyr Asn Gly Val Tyr Tyr
Ala Met Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Thr Val Thr Val Ser
Ser 115 120 50106PRTHomo sapiensMISC_FEATURE(70)..(70)Xaa is Phe or
Thr 50Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro
Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Ser Ala Ser Ser Ser Val
Ile Tyr Met 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro
Arg Leu Leu Ile Tyr 35 40 45 Arg Thr Tyr Asn Leu Ala Ser Gly Ile
Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Xaa Thr
Leu Thr Ile Ser Ser Leu Glu Pro Glu 65 70 75 80 Asp Phe Ala Val Tyr
Tyr Cys His Gln Trp Ser Ser Phe Pro Tyr Thr 85 90 95 Phe Gly Gln
Gly Thr Lys Val Glu Ile Lys 100 105 51121PRTHomo
sapiensMISC_FEATURE(30)..(30)Xaa is Ser or Thr 51Gln Val Thr Leu
Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln 1 5 10 15 Thr Leu
Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Xaa Thr Tyr 20 25 30
Asn Ile Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35
40 45 Trp Leu Ala His Ile Trp Trp Asn Asp Asn Ile Tyr Tyr Asn Thr
Val 50 55 60 Leu Lys Ser Arg Leu Thr Xaa Ser Lys Asp Thr Ser Lys
Asn Gln Val 65 70 75 80 Val Leu Thr Met Thr Asn Met Asp Pro Val Asp
Thr Ala Thr Tyr Tyr 85 90 95 Cys Xaa Arg Met Ala Glu Gly Arg Tyr
Asp Ala Met Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val
Ser Ser 115 120 52121PRTHomo sapiensMISC_FEATURE(24)..(24)Xaa is
Phe or Ala 52Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln
Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Xaa Ser Gly Phe
Ser Leu Thr Thr Tyr 20 25 30 Asn Ile Gly Val Gly Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu 35 40 45 Trp Xaa Ser His Ile Trp Trp
Asn Asp Asn Ile Tyr Tyr Asn Thr Val 50 55 60 Leu Lys Ser Arg Leu
Thr Xaa Ser Xaa Asp Asn Ser Lys Asn Thr Xaa 65 70 75 80 Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 85 90 95 Cys
Xaa Arg Met Ala Glu Gly Arg Tyr Asp Ala Met Asp Tyr Trp Gly 100 105
110 Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 53107PRTHomo
sapiensMISC_FEATURE(71)..(71)Xaa is Phe or Tyr 53Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Thr Asn Tyr 20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35
40 45 Tyr Tyr Thr Ser Lys Leu His Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60 Ser Gly Ser Gly Thr Asp Xaa Thr Leu Thr Ile Ser Ser
Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Xaa Cys Gln Gln Gly
Asn Thr Phe Pro Trp 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu
Ile Lys 100 105 54839PRTHomo sapiens 54Met Met Ser Ala Ser Arg Leu
Ala Gly Thr Leu Ile Pro Ala Met Ala 1 5 10 15 Phe Leu Ser Cys Val
Arg Pro Glu Ser Trp Glu Pro Cys Val Glu Val 20 25 30 Val Pro Asn
Ile Thr Tyr Gln Cys Met Glu Leu Asn Phe Tyr Lys Ile 35 40 45 Pro
Asp Asn Leu Pro Phe Ser Thr Lys Asn Leu Asp Leu Ser Phe Asn 50 55
60 Pro Leu Arg His Leu Gly Ser Tyr Ser Phe Phe Ser Phe Pro Glu Leu
65 70 75 80 Gln Val Leu Asp Leu Ser Arg Cys Glu Ile Gln Thr Ile Glu
Asp Gly 85 90 95 Ala Tyr Gln Ser Leu Ser His Leu Ser Thr Leu Ile
Leu Thr Gly Asn 100 105 110 Pro Ile Gln Ser Leu Ala Leu Gly Ala Phe
Ser Gly Leu Ser Ser Leu 115 120 125 Gln Lys Leu Val Ala Val Glu Thr
Asn Leu Ala Ser Leu Glu Asn Phe 130 135 140 Pro Ile Gly His Leu Lys
Thr Leu Lys Glu Leu Asn Val Ala His Asn 145 150 155 160 Leu Ile Gln
Ser Phe Lys Leu Pro Glu Tyr Phe Ser Asn Leu Thr Asn 165 170 175 Leu
Glu His Leu Asp Leu Ser Ser Asn Lys Ile Gln Ser Ile Tyr Cys 180 185
190 Thr Asp Leu Arg Val Leu His Gln Met Pro Leu Leu Asn Leu Ser Leu
195 200 205 Asp Leu Ser Leu Asn Pro Met Asn Phe Ile Gln Pro Gly Ala
Phe Lys 210 215 220 Glu Ile Arg Leu His Lys Leu Thr Leu Arg Asn Asn
Phe Asp Ser Leu 225 230 235 240 Asn Val Met Lys Thr Cys Ile Gln Gly
Leu Ala Gly Leu Glu Val His 245 250 255 Arg Leu Val Leu Gly Glu Phe
Arg Asn Glu Gly Asn Leu Glu Lys Phe 260 265 270 Asp Lys Ser Ala Leu
Glu Gly Leu Cys Asn Leu Thr Ile Glu Glu Phe 275 280 285 Arg Leu Ala
Tyr Leu Asp Tyr Tyr Leu Asp Asp Ile Ile Asp Leu Phe 290 295 300 Asn
Cys Leu Thr Asn Val Ser Ser Phe Ser Leu Val Ser Val Thr Ile 305 310
315 320 Glu Arg Val Lys Asp Phe Ser Tyr Asn Phe Gly Trp Gln His Leu
Glu 325 330 335 Leu Val Asn Cys Lys Phe Gly Gln Phe Pro Thr Leu Lys
Leu Lys Ser 340 345 350 Leu Lys Arg Leu Thr Phe Thr Ser Asn Lys Gly
Gly Asn Ala Phe Ser 355 360 365 Glu Val Asp Leu Pro Ser Leu Glu Phe
Leu Asp Leu Ser Arg Asn Gly 370 375 380 Leu Ser Phe Lys Gly Cys Cys
Ser Gln Ser Asp Phe Gly Thr Thr Ser 385 390 395 400 Leu Lys Tyr Leu
Asp Leu Ser Phe Asn Gly Val Ile Thr Met Ser Ser 405 410 415 Asn Phe
Leu Gly Leu Glu Gln Leu Glu His Leu Asp Phe Gln His Ser 420 425 430
Asn Leu Lys Gln Met Ser Glu Phe Ser Val Phe Leu Ser Leu Arg Asn 435
440 445 Leu Ile Tyr Leu Asp Ile Ser His Thr His Thr Arg Val Ala Phe
Asn 450 455 460 Gly Ile Phe Asn Gly Leu Ser Ser Leu Glu Val Leu Lys
Met Ala Gly 465 470 475 480 Asn Ser Phe Gln Glu Asn Phe Leu Pro Asp
Ile Phe Thr Glu Leu Arg 485 490 495 Asn Leu Thr Phe Leu Asp Leu Ser
Gln Cys Gln Leu Glu Gln Leu Ser 500 505 510 Pro Thr Ala Phe Asn Ser
Leu Ser Ser Leu Gln Val Leu Asn Met Ser 515 520 525 His Asn Asn Phe
Phe Ser Leu Asp Thr Phe Pro Tyr Lys Cys Leu Asn 530 535 540 Ser Leu
Gln Val Leu Asp Tyr Ser Leu Asn His Ile Met Thr Ser Lys 545 550 555
560 Lys Gln Glu Leu Gln His Phe Pro Ser Ser Leu Ala Phe Leu Asn Leu
565 570 575 Thr Gln Asn Asp Phe Ala Cys Thr Cys Glu His Gln Ser Phe
Leu Gln 580 585 590 Trp Ile Lys Asp Gln Arg Gln Leu Leu Val Glu Val
Glu Arg Met Glu 595 600 605 Cys Ala Thr Pro Ser Asp Lys Gln Gly Met
Pro Val Leu Ser Leu Asn 610 615 620 Ile Thr Cys Gln Met Asn Lys Thr
Ile Ile Gly Val Ser Val Leu Ser 625 630 635 640 Val Leu Val Val Ser
Val Val Ala Val Leu Val Tyr Lys Phe Tyr Phe 645 650 655 His Leu Met
Leu Leu Ala Gly Cys Ile Lys Tyr Gly Arg Gly Glu Asn 660 665 670 Ile
Tyr Asp Ala Phe Val Ile Tyr Ser Ser Gln Asp Glu Asp Trp Val 675 680
685 Arg Asn Glu Leu Val Lys Asn Leu Glu Glu Gly Val Pro Pro Phe Gln
690 695 700 Leu Cys Leu His Tyr Arg Asp Phe Ile Pro Gly Val Ala Ile
Ala Ala 705 710 715 720 Asn Ile Ile His Glu Gly Phe His Lys Ser Arg
Lys Val Ile Val Val 725 730 735 Val Ser Gln His Phe Ile Gln Ser Arg
Trp Cys Ile Phe Glu Tyr Glu 740 745 750 Ile Ala Gln Thr Trp Gln Phe
Leu Ser Ser Arg Ala Gly Ile Ile Phe 755 760 765 Ile Val Leu Gln Lys
Val Glu Lys Thr Leu Leu Arg Gln Gln Val Glu 770 775 780 Leu Tyr Arg
Leu Leu Ser Arg Asn Thr Tyr Leu Glu Trp Glu Asp Ser 785 790 795 800
Val Leu Gly Arg His Ile Phe Trp Arg Arg Leu Arg Lys Ala Leu Leu 805
810 815 Asp Gly Lys Ser Trp Asn Pro Glu Gly Thr Val Gly Thr Gly Cys
Asn 820 825 830 Trp Gln Glu Ala Thr Ser Ile 835 5536DNAArtificial
SequenceChemically synthesized 55gaccattgaa gaattccggt tctcttgctc
tcctcg 365644DNAArtificial SequenceChemically synthesized
56cgaggtagta gtctaagtat gttaaccgga attcttcaat ggtc
445738DNAArtificial SequenceChemically synthesized 57ggcaacattt
agaattagtc aactgtaaat ttggacag 385838DNAArtificial
SequenceChemically synthesized 58ctgtccaaat ttacagttga ctaattctaa
atgttgcc 385926DNAArtificial SequenceChemically synthesized
59atttgtatag ttaacctgaa ctcatc 266034DNAArtificial
SequenceChemically synthesized 60ggggcggccg cgggaagctt gaatccctgc
atag 346132DNAArtificial SequenceChemically synthesized
61ggggatatct ttgcaaacac aacaaacttg ac 326229DNAArtificial
SequenceChemically synthesized 62gggctcgagc ttgtacatat aacaggtag
296348DNAArtificial SequenceChemically synthesized 63gctttttcag
aagttgatct accggtcctt gagtttctag atctcagt 486448DNAArtificial
SequenceChemically synthesized 64actgagatct agaaactcaa ggaccggtag
atcaacttct gaaaaagc 486521DNAArtificial SequenceChemically
synthesized 65cattgatgag ttcaggttaa c 216631DNAArtificial
SequenceChemically synthesized 66atgcaccggt agggccactt ttttaaaact g
316731DNAArtificial SequenceChemically synthesized 67atgcaccggt
tctcagctat ctagatctta g 316833DNAArtificial SequenceChemically
synthesized 68atgcgatatc tgaaagggtg ttgtctttga aag
3369106DNAArtificial SequenceChemically synthesized 69ccgttaacat
atacaaatga tttttcagat gatattgtta agttccattg cttggcgaat 60gtttctgcaa
tgtctctggc aggtgtgact attgaaaggg taaaag 1067028DNAArtificial
SequenceChemically synthesized 70ccaccggtag atcaacttct gaaaaagc
287123DNAArtificial SequenceChemically synthesized 71ccgttaacat
acttagacta cta 2372120DNAArtificial SequenceChemically synthesized
72gatatctgaa agggtgttgt ctttgaaaga attgccagcc atttttaatg tgttgagact
60ggtcaagcca agaaatatac catcgaagtc aattttggtg ttagtatgag aaatgtcaag
1207336DNAArtificial SequenceChemically synthesized 73ctctttttgc
agagctctta agggagagac tgtgaa 367436DNAArtificial SequenceChemically
synthesized 74ttcacagtct
ctcccttaag agctctgcaa aaagag 367522DNAArtificial SequenceChemically
synthesized 75ccggatcccc tcagtcttat gc 227624DNAArtificial
SequenceChemically synthesized 76ccggatccaa tggatttgtg catg
247729DNAArtificial SequenceChemically synthesized 77ggcttaagag
ctctgcaaaa agaatagtc 297828DNAArtificial SequenceChemically
synthesized 78ggcttaaggg agagactgtg aatacatc 287922DNAArtificial
SequenceChemically synthesized 79ccgctagcat tgacatcacg gc
228087PRTHomo sapiens 80Arg Leu Ala Tyr Leu Asp Tyr Tyr Leu Asp Asp
Ile Ile Asp Leu Phe 1 5 10 15 Asn Cys Leu Thr Asn Val Ser Ser Phe
Ser Leu Val Ser Val Thr Ile 20 25 30 Glu Arg Val Lys Asp Phe Ser
Tyr Asn Phe Gly Trp Gln His Leu Glu 35 40 45 Leu Val Asn Cys Lys
Phe Gly Gln Phe Pro Thr Leu Lys Leu Lys Ser 50 55 60 Leu Lys Arg
Leu Thr Phe Thr Ser Asn Lys Gly Gly Asn Ala Phe Ser 65 70 75 80 Glu
Val Asp Leu Pro Ser Leu 85 8186PRTMus musculus 81Arg Leu Thr Tyr
Thr Asn Asp Phe Ser Asp Asp Ile Val Lys Phe His 1 5 10 15 Cys Leu
Ala Asn Val Ser Ala Met Ser Leu Ala Gly Val Ser Ile Lys 20 25 30
Tyr Leu Glu Asp Val Pro Lys His Phe Lys Trp Gln Ser Leu Ser Ile 35
40 45 Ile Arg Cys Gln Leu Lys Gln Phe Pro Thr Leu Asp Leu Pro Phe
Leu 50 55 60 Lys Ser Leu Thr Leu Thr Met Asn Lys Gly Ser Ile Ser
Phe Lys Lys 65 70 75 80 Val Ala Leu Pro Ser Leu 85 8239PRTHomo
sapiens 82Gln Lys Gln Tyr Trp Val Cys Asn Ser Ser Asp Ala Ser Ile
Ser Tyr 1 5 10 15 Thr Tyr Cys Asp Lys Met Gln Tyr Pro Ile Ser Ile
Asn Val Asn Pro 20 25 30 Cys Ile Glu Leu Lys Gly Ser 35 8339PRTMus
musculus 83Glu Lys Gln Gln Trp Phe Cys Asn Ser Ser Asp Ala Ile Ile
Ser Tyr 1 5 10 15 Ser Tyr Cys Asp His Leu Lys Phe Pro Ile Ser Ile
Ser Ser Glu Pro 20 25 30 Cys Ile Arg Leu Arg Gly Thr 35
8423DNAArtificial SequenceChemically synthesized 84ggaagcttaa
ccaccatgtt gcc 23856PRTHomo sapiens 85Gly Gly Tyr Ser Trp His 1 5
8616PRTHomo sapiens 86Tyr Ile His Tyr Ser Gly Tyr Thr Asp Phe Asn
Pro Ser Leu Lys Thr 1 5 10 15 879PRTHomo sapiens 87Lys Asp Pro Ser
Asp Gly Phe Pro Tyr 1 58811PRTHomo sapiens 88Arg Ala Ser Gln Ser
Ile Ser Asp His Leu His 1 5 10 897PRTHomo sapiens 89Tyr Ala Ser His
Ala Ile Ser 1 5 909PRTHomo sapiens 90Gln Asn Gly His Ser Phe Pro
Leu Thr 1 5 915PRTHomo sapiens 91Asp Ser Tyr Ile His 1 5
9217PRTHomo sapiens 92Trp Thr Asp Pro Glu Asn Val Asn Ser Ile Tyr
Asp Pro Arg Phe Gln 1 5 10 15 Gly 9311PRTHomo sapiens 93Gly Tyr Asn
Gly Val Tyr Tyr Ala Met Asp Tyr 1 5 10 9410PRTHomo sapiens 94Ser
Ala Ser Ser Ser Val Ile Tyr Met His 1 5 10 957PRTHomo sapiens 95Arg
Thr Tyr Asn Leu Ala Ser 1 5 969PRTHomo sapiens 96His Gln Trp Ser
Ser Phe Pro Tyr Thr 1 5 977PRTHomo sapiens 97Thr Tyr Asn Ile Gly
Val Gly 1 5 9816PRTHomo sapiens 98His Ile Trp Trp Asn Asp Asn Ile
Tyr Tyr Asn Thr Val Leu Lys Ser 1 5 10 15 9911PRTHomo sapiens 99Met
Ala Glu Gly Arg Tyr Asp Ala Met Asp Tyr 1 5 10 10011PRTHomo sapiens
100Arg Ala Ser Gln Asp Ile Thr Asn Tyr Leu Asn 1 5 10 1017PRTHomo
sapiens 101Tyr Thr Ser Lys Leu His Ser 1 5 1029PRTHomo sapiens
102Gln Gln Gly Asn Thr Phe Pro Trp Thr 1 5
* * * * *
References