U.S. patent application number 15/157678 was filed with the patent office on 2017-04-06 for administering antisense oligonucleotides complementary to human apolipoprotein b.
This patent application is currently assigned to Kastle Therapeutics, LLC. The applicant listed for this patent is Kastle Therapeutics, LLC. Invention is credited to Richard S. Geary, Diane Tribble, Mark K. Wedel, Zhengrong Yu.
Application Number | 20170096662 15/157678 |
Document ID | / |
Family ID | 39561976 |
Filed Date | 2017-04-06 |
United States Patent
Application |
20170096662 |
Kind Code |
A1 |
Geary; Richard S. ; et
al. |
April 6, 2017 |
ADMINISTERING ANTISENSE OLIGONUCLEOTIDES COMPLEMENTARY TO HUMAN
APOLIPOPROTEIN B
Abstract
Methods for long-term lowering of lipid levels in human subjects
and for the treatment of conditions associated with elevated
LDL-cholesterol and elevated ApoB are provided.
Inventors: |
Geary; Richard S.;
(Carlsbad, CA) ; Yu; Zhengrong; (Carlsbad, CA)
; Wedel; Mark K.; (Temecula, CA) ; Tribble;
Diane; (Asbury, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kastle Therapeutics, LLC |
Chicago |
IL |
US |
|
|
Assignee: |
Kastle Therapeutics, LLC
Chicago
IL
|
Family ID: |
39561976 |
Appl. No.: |
15/157678 |
Filed: |
May 18, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12532602 |
Apr 30, 2010 |
9347061 |
|
|
PCT/US2008/058072 |
Mar 24, 2008 |
|
|
|
15157678 |
|
|
|
|
60896914 |
Mar 24, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 9/10 20180101; C12N
2310/341 20130101; C12N 2310/3341 20130101; A61P 3/00 20180101;
C12N 2320/32 20130101; C12N 2310/346 20130101; C12N 2310/11
20130101; C12N 2310/315 20130101; A61P 9/00 20180101; A61P 43/00
20180101; A61P 3/06 20180101; C12N 2310/321 20130101; A61P 3/10
20180101; C12N 15/113 20130101; C12N 2310/321 20130101; C12N
2310/3525 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A method comprising administering to a subject a pharmaceutical
composition comprising an antisense oligonucleotide complementary
to a nucleic acid encoding human apolipoprotein B-100, wherein the
administering comprises an induction phase, wherein a dose of the
antisense oligonucleotide ranging from 100-300 mg is administered
once per week for at least 13 weeks, followed by a maintenance
phase, wherein a dose of the antisense oligonucleotide ranging from
80-200 mg is administered once per week or once every two weeks for
as long as needed, effective, and/or tolerated.
2. The method of claim 1, wherein the dose administered in the
induction phase is a 100 mg dose and the dose administered in the
maintenance phase is a 200 mg dose administered once per week.
3. The method of claim 1, wherein the dose administered in the
induction phase is a 200 mg dose, and the dose administered in the
maintenance phase is a 300 mg dose administered once per week.
4. The method of claim 1, wherein the dose administered in the
induction phase is a 100 mg dose and the dose administered in the
maintenance phase is a 200 mg dose administered once per week, and
wherein the tolerability or the effectiveness of the antisense
oligonucleotide are assessed during or at the end of the induction
period, or a portion thereof once per week during the maintenance
phase.
5. The method of claim 1, wherein the dose administered in the
induction phase is a 200 mg dose and the dose administered in the
maintenance phase is a 300 mg dose administered once per week, and
wherein the tolerability or the effectiveness of the antisense
oligonucleotide are assessed during or at the end of the induction
period, or a portion thereof.
6. The method of claim 1, wherein the dose administered in the
induction phase is a 100 mg dose and the dose administered in the
maintenance phase is a 100 mg dose administered once every two
weeks, and wherein the tolerability or the effectiveness of the
antisense oligonucleotide are assessed during or at the end of the
induction period, or a portion thereof.
7. The method of claim 1, wherein the dose administered in the
induction phase is a 200 mg dose and the dose administered in the
maintenance phase is a 200 mg dose administered once every two
weeks, and wherein the tolerability or the effectiveness of the
antisense oligonucleotide are assessed during or at the end of the
induction period, or a portion thereof.
8. The method of claim 1, wherein the dose administered in the
induction phase is from 100 mg to 200 mg and the dose administered
in the maintenance phase is from 200 mg to 300 mg and is
administered once per week.
9. The method of claim 1, wherein said administering comprises
parenteral administration.
10. The method of claim 1, wherein said parenteral administration
comprises subcutaneous administration.
11. The method of claim 1, wherein each induction dose and each
maintenance dose comprises a single injection.
12. The method of claim 1, wherein each induction dose and each
maintenance dose independently comprise two or more injections.
13. The method of claim 1, further comprising assessing the
tolerability or effectiveness of the antisense oligonucleotide
during or at the end of the induction period, or a portion
thereof.
14. The method of claim 13, wherein the tolerability and the
effectiveness of the antisense oligonucleotide are assessed.
15-144. (canceled)
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0092USC2SEQ_ST25.txt, created on May 17, 2016
which is 20 MB in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention provides compositions and methods for
lowering LDL-cholesterol and treatment of conditions associated
with elevated cholesterol levels. More specifically, the invention
relates to compositions and methods for inhibiting apolipoprotein B
expression in the liver.
BACKGROUND OF THE INVENTION
[0003] Coronary heart disease (CHD) has been the leading cause of
death in the United States for over a century, and complications
from atherosclerosis are the most common causes of death in Western
societies (Knopp, New Engl. J. Medicine, 1999, 341, 498-511; Davis
and Hui, Arterioscler. Thromb. Vasc. Biol., 2001, 21, 887-898;
Bonow, Circulation, 2002, 106, 3140-3141). Elevated low density
lipoprotein-cholesterol (LDL-cholesterol) is widely recognized as a
risk factor for CHD. However, despite pharmacologic intervention,
many subjects are unable to lower LDL-cholesterol levels.
[0004] The guidelines for lipid lowering therapy were established
by the Adult Treatment Panel III of the National Cholesterol
Education Program (NCEP) in 2001. Modifications to these guidelines
were recommended by the Coordinating Committee of the NCEP in 2004,
and included more aggressive treatment goals (Grundy et al.,
Circulation, 2004, 110, 227-239). These guidelines define 3
categories of risk for major coronary events and provide desirable
LDL-cholesterol target levels. Those at highest risk are subjects
with CHD or CHD risk equivalent and should maintain LDL-cholesterol
below 100 mg/dL. The most recent NCEP guidelines recommend that
subjects at very high risk for CHD use drug therapy to achieve
LDL-cholesterol levels of less than 70 mg/dL. CHD equivalent is
defined as subjects with diabetes, peripheral vascular disease,
abdominal aortic aneurysm, symptomatic carotid artery disease, and
those with multiple risk factors that confer a 10 year risk for CHD
greater than 20%. For the second category, those subjects at
moderately high risk for CHD with multiple (2 or more) risk factors
in whom the 10 year risk for CHD is 20%, the goal is
LDL-cholesterol of less than 130 mg/dL. The most recent
recommendations include a therapeutic option to lower
LDL-cholesterol levels to less than 100 mg/dL in the moderately
high-risk category. The third category includes subjects with 0-1
risk factors and the target LDL-cholesterol is less than 160 mg/dL.
The risk factors include age, cigarette smoking, hypertension, low
HDL-cholesterol, and family history of CHD. Drug therapy should be
initiated when serum LDL-cholesterol remains above 130, 160 and 190
mg/dL in the 3 risk groups, respectively, despite therapeutic
lifestyle changes (Grundy et al., Circulation, 2004, 110,
227-239).
[0005] Low density lipoproteins are one of five broad classes of
lipoproteins, which include the following: chylomicrons,
responsible for the transport dietary lipids from intestine to
tissues; very low density lipoproteins (VLDL); intermediate density
lipoproteins (IDL); low density lipoproteins (LDL); all of which
transport triacylglycerols and cholesterol from the liver to
tissues; and high density lipoproteins (HDL), which transport
endogenous cholesterol from tissues to the liver. Lipoprotein
particles undergo continuous metabolic processing and have variable
properties and compositions. The protein components of lipoproteins
are known as apolipoproteins. At least nine apolipoproteins, one of
which is apolipoprotein B, are distributed in significant amounts
among the various human lipoproteins.
[0006] Apolipoprotein B (also known as ApoB, apolipoprotein B-100;
ApoB-100, apolipoprotein B-48; ApoB-48 and Ag(x) antigen), is a
large glycoprotein involved in the assembly and secretion of lipids
and in the transport and receptor-mediated uptake and delivery of
distinct classes of lipoproteins. Apolipoprotein B performs a
variety of functions, including the absorption and processing of
dietary lipids, as well as the regulation of circulating
lipoprotein levels (Davidson and Shelness, Annu. Rev. Nutr., 2000,
20, 169-193).
[0007] Two forms of apolipoprotein B exist in mammals. ApoB-100
represents the full-length protein containing 4536 amino acid
residues, synthesized primarily in the human liver (Davidson and
Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). A truncated form
known as apoB-48 is colinear with the amino terminal 2152 residues
and is synthesized in the small intestine of all mammals (Davidson
and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). In humans,
apoB-48 circulates in association with chylomicrons and chylomicron
remnants and these particles are cleared by a distinct receptor
known as the LDL-receptor-related protein (Davidson and Shelness,
Annu. Rev. Nutr., 2000, 20, 169-193). ApoB-48 can be viewed as an
adaptation by which dietary lipid is delivered from the small
intestine to the liver, while apoB-100 participates in the
transport and delivery of cholesterol (Davidson and Shelness, Annu.
Rev. Nutr., 2000, 20, 169-193). ApoB is the major protein component
of LDL and contains the domain required for interaction of this
lipoprotein species with the LDL receptor. In addition, ApoB
contains an unpaired cysteine residue which mediates an interaction
with apolipoprotein(a) and generates lipoprotein(a) or Lp(a),
another distinct lipoprotein with atherogenic potential (Davidson
and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). Elevated plasma
levels of the ApoB-containing lipoprotein Lp(a) are associated with
increased risk for atherosclerosis and its manifestations, which
may include hypercholesterolemia (Seed et al., N. Engl. J. Med.,
1990, 322, 1494-1499), myocardial infarction (Sandkamp et al.,
Clin. Chem., 1990, 36, 20-23), and thrombosis (Nowak-Gottl et al.,
Pediatrics, 1997, 99, E11).
[0008] Apolipoprotein B is involved cholesterol homeostasis and its
overproduction has been associated with various diseases, including
familial hypercholesterolemia, familial defective ApoB and familial
combined hypercholesterolemia (Kane and Havel, The Metabolic and
Molecular Bases of Inherited Diseases, 2001, 8.sup.th edition,
2717-2751). Perturbations in the metabolism of ApoB that correspond
with an increased risk of CHD are also observed in diabetes and
obesity (Grundy, Am. J. Cardiol., 1998, 81, 18B-25B; Chan et al.,
Diabetes, 2002, 51, 2377-2386; Chan et al., Metabolism, 2002, 51,
1041-1046). Furthermore, genetic studies in mouse models have
demonstrated a correlation between elevated apolipoprotein B,
elevated cholesterol levels and atherosclerosis (Kim and Young, J.
Lipid Res., 1998, 39, 703-723; Nishina et al., J. Lipid Res., 1990,
31, 859-869).
[0009] In studies of subjects with familial hypobetalipoproteinemia
(FHBL), these subjects exhibit lowered serum apolipoprotein B
levels, lowered serum LDL-cholesterol levels and a reduced
incidence of coronary artery disease (Schonfeld et al., J. Lipid
Res., 2003, 44, 878-883). Murine studies have demonstrated that
mice having heterozygous deficiencies in apolipoprotein B exhibit
reduced serum LDL-cholesterol and apolipoprotein B levels, and,
furthermore, are protected from diet-induced hypercholesterolemia.
(Farese et al., Proc. Natl. Acad. Sci. U.S.A, 1995, 92,
1774-1778).
SUMMARY OF THE INVENTION
[0010] In a first aspect, provided herein are methods comprising
administering to a subject a pharmaceutical composition comprising
an antisense oligonucleotide complementary to a nucleic acid
encoding human apolipoprotein B-100, wherein the administering
comprises an induction phase, wherein a dose of the antisense
oligonucleotide ranging from 100-300 mg is administered once per
week for at least 13 weeks, followed by a maintenance phase,
wherein a dose of the antisense oligonucleotide ranging from 80-200
mg is administered once per week or once every two weeks for as
long as needed, effective, and/or tolerated.
[0011] In certain embodiments, the dose administered in the
induction phase is a 100 mg dose and the dose administered in the
maintenance phase is a 200 mg dose administered once per week. In
certain embodiments, the dose administered in the induction phase
is a 200 mg dose, and the dose administered in the maintenance
phase is a 300 mg dose administered once per week. In certain
embodiments, the dose administered in the induction phase is a 100
mg dose and the dose administered in the maintenance phase is a 200
mg dose administered once per week, and wherein the tolerability or
the effectiveness of the antisense oligonucleotide are assessed
during or at the end of the induction period, or a portion thereof
once per week during the maintenance phase. In certain embodiments,
the dose administered in the induction phase is a 200 mg dose and
the dose administered in the maintenance phase is a 300 mg dose
administered once per week, and wherein the tolerability or the
effectiveness of the antisense oligonucleotide are assessed during
or at the end of the induction period, or a portion thereof.
[0012] In certain embodiments, the dose administered in the
induction phase is a 100 mg dose and the dose administered in the
maintenance phase is a 100 mg dose administered once every two
weeks, and wherein the tolerability or the effectiveness of the
antisense oligonucleotide are assessed during or at the end of the
induction period, or a portion thereof. In certain embodiments, the
dose administered in the induction phase is a 200 mg dose and the
dose administered in the maintenance phase is a 200 mg dose
administered once every two weeks, and wherein the tolerability or
the effectiveness of the antisense oligonucleotide are assessed
during or at the end of the induction period, or a portion thereof.
In certain embodiments, the dose administered in the induction
phase is from 100 mg to 200 mg and the dose administered in the
maintenance phase is from 200 mg to 300 mg and is administered once
per week.
[0013] In certain embodiments, said administering comprises
parenteral administration. In certain embodiments, said parenteral
administration comprises subcutaneous administration. In certain
embodiments, each induction dose and each maintenance dose
comprises a single injection. In certain embodiments, each
induction dose and each maintenance dose independently comprise two
or more injections. In certain embodiments, the methods further
comprise assessing the tolerability or effectiveness of the
antisense oligonucleotide during or at the end of the induction
period, or a portion thereof. In certain embodiments, the
tolerability and the effectiveness of the antisense oligonucleotide
are assessed
[0014] In certain embodiments, the tolerability of the antisense
oligonucleotide is assessed by monitoring a rate of decrease of
ApoB concentration in the plasma of said subject. In certain
embodiments, the tolerability of the antisense oligonucleotide is
assessed by monitoring ApoB concentration in the plasma of said
subject. In certain embodiments, the tolerability of the antisense
oligonucleotide is assessed by monitoring a rate of decrease of
ApoB concentration and ApoB concentration in the plasma of said
subject. In certain embodiments, the tolerability of the antisense
oligonucleotide is assessed by monitoring ALT concentrations in the
liver of the subject. In certain embodiments, the tolerability of
the antisense oligonucleotide is assessed by monitoring ANT
concentrations in the liver of said subject. In certain
embodiments, the tolerability of the antisense oligonucleotide is
assessed by monitoring bilirubin concentrations in the plasma of
the subject.
[0015] In certain embodiments, a rate of decrease in the ApoB
concentration greater than about 30 mg/dL*day indicates that the
subject is not tolerating administration of the antisense
oligonucleotide. In certain embodiments, an ApoB concentration less
than about 60 mg/dL indicates that the subject is not tolerating
administration of the antisense oligonucleotide. In certain
embodiments, a rate of decrease in the ApoB concentration greater
than about 30 mg/dL*day and an ApoB concentration less than about
60 mg/dL indicates that the subject is not tolerating
administration of the antisense oligonucleotide. In certain
embodiments, the dose of antisense oligonucleotide is reduced
following an indication that administration of said antisense
oligonucleotide is not tolerated. In certain embodiments, the
frequency of administration of antisense oligonucleotide is reduced
following an indication that administration of said antisense
oligonucleotide is not tolerated. In certain embodiments, the dose
of antisense oligonucleotide is increased following an indication
that administration of said antisense oligonucleotide is tolerated.
In certain embodiments, the frequency of administration of
antisense oligonucleotide is increased following an indication that
administration of said antisense oligonucleotide is tolerated.
[0016] In certain embodiments, the effectiveness of the antisense
oligonucleotide is assessed by monitoring ApoB, LDL-C, VLDL-C,
IDL-C, non-HDL-C, serum triglycerides, liver triglycerides, Lp(a),
Ox-LDL-C, or small dense LDL particle concentration in the plasma
of said subject. In certain embodiments, a reduction of ApoB,
LDL-C, VLDL-C, IDL-C, non-HDL-C, serum triglycerides, liver
triglycerides, Lp(a), Ox-LDL-C, or small dense LDL particle
concentration indicates that the antisense oligonucleotide is
effective. In certain embodiments, the dose of antisense
oligonucleotide is reduced following an indication that
administration of said antisense oligonucleotide is effective. In
certain embodiments, the dose of antisense oligonucleotide is
increased following an indication that administration of said
antisense oligonucleotide is not effective. In certain embodiments,
the frequency of administration of antisense oligonucleotide is
reduced following an indication that administration of said
antisense oligonucleotide is effective. In certain embodiments, the
frequency of administration of antisense oligonucleotide is
increased following an indication that administration of said
antisense oligonucleotide is not effective.
[0017] In certain embodiments, said subject has elevated ApoB prior
to said administering. In certain embodiments, said subject has
elevated cholesterol prior to said administering. In certain
embodiments, said elevated cholesterol is selected from elevated
total cholesterol, elevated LDL-cholesterol, elevated
VLDL-cholesterol, elevated IDL-cholesterol, or elevated non-HDL
cholesterol prior to said administering. In certain embodiments,
said subject has elevated Lp(a) prior to said administering. In
certain embodiments, said subject has elevated serum triglycerides
prior to said administering. In certain embodiments, said subject
has elevated liver triglycerides prior to said administering. In
certain embodiments, said subject has elevated small dense LDL
particles prior to said administering.
[0018] In certain embodiments, said subject has
hypercholesterolemia. In certain embodiments, said subject has
polygenic hypercholesterolemia. In certain embodiments, said
subject has familial hypercholesterolemia. In certain embodiments,
said subject has homozygous familial hypercholesterolemia. In
certain embodiments, said subject has heterozygous familial
hypercholesterolemia. In certain embodiments, said subject has
mixed dyslipidemia. In certain embodiments, said subject has a
history of coronary heart disease.
[0019] In certain embodiments, said subject has one or more risk
factors for coronary heart disease. In certain embodiments, said
one or more risk factors is selected from age, smoking,
hypertension, low HDL-cholesterol, and a family history of early
coronary heart disease. In certain embodiments, said subject has
type II diabetes with dyslipidemia. In certain embodiments, said
subject has been treated by a statin. In certain embodiments, said
subject failed to meet LDL-cholesterol target on statin therapy. In
certain embodiments, said subject did not comply with recommended
therapy. In certain embodiments, said subject experienced side
effects of stain therapy. In certain embodiments, said subject has
low LDL-receptor activity. In certain embodiments, said subject
failed to meet LDL-cholesterol target on lipid-lowering therapy
prior to said administering.
[0020] In certain embodiments, said maintenance phase comprises
administering said pharmaceutical composition throughout the
lifetime of the subject. In certain embodiments, the duration of
said maintenance phase is one year, 2 years, 3 years, 4 years, 5
years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12
years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years,
19 years, or 20 years. In certain embodiments, the duration of said
maintenance phase is from one week to twenty years.
[0021] In certain embodiments, the induction dose is 100 mg. In
certain embodiments, the induction dose is 200 mg. In certain
embodiments, the induction dose is 300 mg. In certain embodiments,
the maintenance dose is 100 mg. In certain embodiments, the
maintenance dose is 200 mg.
[0022] In certain embodiments, said administering of said
pharmaceutical composition results in antisense oligonucleotide
plasma trough levels between 5 and 100 ng/mL. In certain
embodiments, said administering of said pharmaceutical composition
results in antisense oligonucleotide plasma trough levels between 5
and 50 ng/mL. In certain embodiments, said administering of said
pharmaceutical composition results in antisense oligonucleotide
plasma trough levels between 10 and 40 ng/mL. In certain
embodiments, said administering of said pharmaceutical composition
results in antisense oligonucleotide plasma trough levels between
15 and 35 ng/mL. In certain embodiments, said administering of said
pharmaceutical composition results in antisense oligonucleotide
plasma trough levels between 20 and 30 ng/mL.
[0023] In certain embodiments, said administering of said
pharmaceutical composition results in ApoB reduction of at least
10%. In certain embodiments, said ApoB reduction is at least 15%,
at least 20%, at least 25%, at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, or at least 100%. In certain
embodiments, said ApoB reduction is between 10% and 80%, between
20% and 70%, between 30% and 60%, or between 30% and 70%.
[0024] In certain embodiments, said administering of said
pharmaceutical composition results in a LDL-cholesterol reduction
of at least 10%. In certain embodiments, said LDL-cholesterol
reduction is at least 15%, at least 20%, at least 25%, at least
30%, at least 35%, at least 40%, at least 45%, at least 50%, at
least 55%, at least 60%, at least 65%, at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95%, or at least
100%. In certain embodiments, said administering of said
pharmaceutical composition results in a VLDL-cholesterol reduction
of at least 10%. In certain embodiments, said VLDL-cholesterol
reduction is at least 15%, at least 20%, at least 25%, at least
30%, at least 35%, at least 40%, at least 45%, at least 50%, at
least 55%, at least 60%, at least 65%, at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95%, or at least
100%.
[0025] In certain embodiments, said administering of said
pharmaceutical composition results in Lp(a) reduction of at least
10%. In certain embodiments, said Lp(a) reduction is at least 15%,
at least 20%, at least 25%, at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, or at least 100%. In certain
embodiments, said administering of said pharmaceutical composition
results in a small LDL-particle reduction of at least 10%. In
certain embodiments, said small LDL-particle reduction is at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, at least 50%, at least 55%, at least 60%,
at least 65%, at least 70%, at least 75%, at least 80%, at least
85%, at least 90%, at least 95%, or at least 100%.
[0026] In certain embodiments, said administering of said
pharmaceutical composition results in a non-HDL-cholesterol
reduction of at least 10%. In certain embodiments, said
non-HDL-cholesterol reduction is at least 15%, at least 20%, at
least 25%, at least 30%, at least 35%, at least 40%, at least 45%,
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, or at least 100%.
[0027] In certain embodiments, said administering of said
pharmaceutical composition results in reduced coronary heart
disease risk in the subject. In certain embodiments, said
administering of said pharmaceutical composition slows or stops the
progression of atherosclerosis in the subject. In certain
embodiments, said administering of said pharmaceutical composition
reduces the risk of developing atherosclerosis in the subject. In
certain embodiments, said administering of said pharmaceutical
composition results in improved cardiovascular outcome the subject.
In certain embodiments, said improved cardiovascular outcome is a
reduced risk of major cardiovascular adverse events in the subject.
In certain embodiments, said improved cardiovascular outcome is
improved carotid intimal media thickness. In certain embodiments,
said improved cardiovascular outcome is improved atheroma
thickness. In certain embodiments, said improved cardiovascular
outcome is increased HDL-cholesterol.
[0028] In certain embodiments, said administering results in lipid
lowering. In certain embodiments, said administering results in
reductions in LDL-cholesterol, triglycerides, or small LDL
particles, or a combination thereof. In certain embodiments, said
administering results in an improved LDL/HDL ratio. In certain
embodiments, said administering results in an HDL-cholesterol level
increase of at least 10%. In certain embodiments, said
HDL-cholesterol level increase is 15%, at least 20%, at least 25%,
at least 30%, at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 100%. In certain embodiments, said administering of
said pharmaceutical composition results in a liver triglyceride
level decrease of at least 10%.
[0029] In certain embodiments, said liver triglyceride level
decrease is at least 15%, at least 20%, at least 25%, at least 30%,
at least 35%, at least 40%, at least 45%, at least 50%, at least
55%, at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, or at least
100%. In certain embodiments, said administering of said
pharmaceutical composition results in a hepatic cholesterol ester
reduction of at least 10%. In certain embodiments, said reduced
hepatic cholesterol ester reduction 15%, at least 20%, at least
25%, at least 30%, at least 35%, at least 40%, at least 45%, at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, or at least 100%.
[0030] In certain embodiments, the methods further comprise
co-administration of said pharmaceutical composition and at least
one additional therapy. In certain embodiments, said
co-administration is simultaneous. In certain embodiments, said
pharmaceutical composition is administered prior to administration
of said additional therapy. The method of claim 100, wherein said
pharmaceutical composition is administered after administration of
said additional therapy. In certain embodiments, the interval
between administration of said pharmaceutical composition and said
additional therapy is about one hour, about 2 hours, about 3 hours,
about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8
hours, about 9 hours, about 10 hours, about 11 hours, or about 12
hours. In certain embodiments, the interval between administration
of said pharmaceutical composition and said additional therapy is
about 1 day, about 1 week, about 2 weeks, about 3 weeks, about 4
weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks,
about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks.
In certain embodiments, the interval between administration of said
pharmaceutical composition and said additional therapy is about 1
month, about 2 months, about 3 months, about 4 months, about 5
months, or about 6 months.
[0031] In certain embodiments, the methods further comprise
administering a single additional therapy. In certain embodiments,
the methods further comprise administering at 2 or more additional
therapies. In certain embodiments, said additional therapy is a
lipid-lowering therapy. In certain embodiments, said additional
lipid-lowering therapy is therapeutic lifestyle change. In certain
embodiments, said additional lipid-lowering therapy is an HMG-CoA
reductase inhibitor. In certain embodiments, the HMG-CoA reductase
inhibitor is selected from atorvastatin, rosuvastatin, or
simvastatin. In certain embodiments, said additional lipid-lowering
therapy is a cholesterol absorption inhibitor. In certain
embodiments, the cholesterol absorption inhibitor is ezetimibe. In
certain embodiments, said 2 or more additional therapies comprises
an HMG-CoA reductase inhibitor and a cholesterol absorption
inhibitor. In certain embodiments, said HMG-CoA reductase
inhibitors is simvastatin and said cholesterol absorption inhibitor
is ezetimibe. In certain embodiments, said additional
lipid-lowering therapy is LDL apheresis. In certain embodiments,
said administering of said additional therapy comprises intravenous
administration. In certain embodiments, said additional
lipid-lowering therapy is an MTP inhibitor.
[0032] In certain embodiments, said pharmaceutical composition
comprises a pharmaceutically acceptable excipient. In certain
embodiments, said pharmaceutically acceptable excipient is saline.
In certain embodiments, the dose of the antisense oligonucleotide
concentration is administered at a concentration of about 50 mg/ml,
about 75 mg/ml, about 100 mg/ml, about 125 mg/ml, about 150 mg/ml,
about 175 mg/ml, about 200 mg/ml, about 225 mg/ml, or about 250
mg/ml.
[0033] In certain embodiments, the antisense oligonucleotide
comprises at least one modified sugar moiety. In certain
embodiments, the modified sugar moiety comprises a 2'-methoxyethyl
sugar moiety. In certain embodiments, the modified sugar moiety
comprises a bicyclic nucleic acid sugar moiety.
[0034] In certain embodiments, the antisense oligonucleotide
comprises a 2'-deoxynucleotide gap segment positioned between wing
segments, wherein each nucleotide of the wing segments comprises a
modified sugar moiety. In certain embodiments, each nucleotide of
the wing segment comprises a 2'-O-methoxyethyl sugar moiety. In
certain embodiments, each nucleotide of the wing segment comprises
a bicyclic nucleic acid sugar moiety. In certain embodiments, the
gap segment comprises ten nucleotides and each wing segment
comprises five nucleotides.
[0035] In certain embodiments, at least one internucleoside linkage
is a phosphorothioate internucleoside linkage. In certain
embodiments, each internucleoside linkage is a phosphorothioate
internucleoside linkage.
[0036] In certain embodiments, at least one cytosine is a
5-methylcytosine. In certain embodiments, each cytosine is a
5-methylcytosine.
[0037] In certain embodiments, the antisense oligonucleotide is at
least 90% complementary to a nucleic acid encoding human ApoB. In
certain embodiments, the antisense oligonucleotide is at least 95%
complementary to a nucleic acid encoding human ApoB. In certain
embodiments, the antisense oligonucleotide is 100% complementary to
a nucleic acid encoding human ApoB.
[0038] In certain embodiments, the nucleic acid encoding human ApoB
comprises a sequence identified by Accession number NM_000384.1
(SEQ ID NO: 1).
[0039] In certain embodiments, the antisense oligonucleotide
comprises 12 to 30 nucleotides. In certain embodiments, the
antisense oligonucleotide comprises 15 to 25 nucleotides. In
certain embodiments, the antisense oligonucleotide comprises 17 to
23 nucleotides. In certain embodiments, the antisense
oligonucleotide comprises 18 to 22 nucleotides. In certain
embodiments, the antisense oligonucleotide comprises 19 to 21
nucleotides. In certain embodiments, the antisense oligonucleotide
comprises 20 nucleotides.
[0040] In certain embodiments, the antisense oligonucleotide is
ISIS 301012.
[0041] In certain embodiments of the present invention are methods
comprising administering to a subject a pharmaceutical composition
comprising an antisense oligonucleotide complementary to a nucleic
acid encoding human ApoB, wherein the administering comprises an
induction phase comprising at least one induction dose and a
maintenance phase comprising at least one maintenance dose, wherein
the duration of the induction phase is greater than five weeks.
[0042] In certain embodiments of the present invention are methods
comprising administering to a subject a pharmaceutical composition
comprising an antisense oligonucleotide complementary to a nucleic
acid encoding human ApoB, wherein the administering comprises an
induction phase comprising at least one induction dose and a
maintenance phase comprising at least one maintenance dose, wherein
an induction dose is less than a maintenance dose.
[0043] In certain embodiments of the present invention are methods
comprising administering to a subject a pharmaceutical composition
comprising an antisense oligonucleotide complementary to a nucleic
acid encoding human ApoB, wherein the administering comprises an
induction phase comprising at least one induction dose.
[0044] In certain embodiments of the present invention are methods
comprising administering to a subject having familial
hypercholesterolemia a pharmaceutical composition comprising an
antisense oligonucleotide complementary to a nucleic acid encoding
human ApoB, wherein the administering comprises an induction phase
comprising at least one induction dose and a maintenance phase
comprising at least one maintenance dose, wherein the induction
phase is at least 8 weeks.
[0045] In certain embodiments of the present invention are methods
comprising administering to a subject a pharmaceutical composition
comprising an antisense oligonucleotide complementary to a nucleic
acid encoding human apolipoprotein B-100, wherein the administering
comprises a maintenance phase comprising at least one maintenance
dose.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046] FIG. 1 shows the predicted LDL-C (% change from baseline)
after dosing at 200, 400, or 800 mg once monthly for 12 months.
[0047] FIG. 2 shows the predicted LDL-C (% change from baseline)
after dosing at 200 mg/wk for 1 month then 200, 400, or 600 mg once
monthly for 11 months.
[0048] FIG. 3 shows the predicted LDL-C (% change from baseline)
after dosing at 200 mg/wk for 3 months then 200, 400, or 600 mg
once monthly for 9 months.
DETAILED DESCRIPTION OF THE INVENTION
[0049] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0050] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose. U.S.
patent application Ser. Nos. 10/712,795 and 10/200,710 are hereby
expressly incorporated by reference in their entirety for any
purpose.
A. DEFINITIONS
[0051] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, chemical analysis, pharmaceutical preparation,
formulation and delivery, and treatment of subjects. Certain such
techniques and procedures may be found for example in "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990 and [other important formulations and drug delivery
references] which is hereby incorporated by reference for any
purpose.
[0052] As used herein, a "pharmaceutical composition" means a
mixture of substances suitable for administering to a subject. For
example, a pharmaceutical composition may comprise an antisense
oligonucleotide and a sterile aqueous solution.
[0053] As used herein, an "antisense oligonucleotide" means a
single-stranded oligonucleotide having a nucleobase sequence that
permits hybridization to a corresponding region of a target nucleic
acid. Such an antisense oligonucleotide is "targeted to" the
nucleic acid.
[0054] As used herein, "complementarity" means the capacity for
pairing between nucleobases of a first nucleic acid and a second
nucleic acid.
[0055] As used herein, "fully complementary" means each nucleobase
of an oligonucleotide is capable of precise base pairing with the
corresponding nucleobases of a target nucleic acid.
[0056] As used herein, "antisense inhibition" means reduction of
target nucleic acid levels in the presence of an olignucleotide
complementary to a target nucleic acid compared to target nucleic
acid levels in the absence of the oligonucleotide.
[0057] As used herein, the terms "target nucleic acid," "target
RNA," "target RNA transcript" and "nucleic acid target" all mean
any nucleic acid capable of being targeted by antisense
oligonucleotides. As used herein, the terms "ApoB target nucleic
acid" and "nucleic acid encoding ApoB" encompass nucleic acid,
including, for example, DNA (including, for example, cDNA), RNA
(including, for example pre-mRNA, and mRNA) transcribed from DNA
encoding ApoB, and also cDNA derived from such RNA. In one
embodiment, an ApoB target nucleic acid is the sequence of
GENBANK.RTM. Accession No. NM_000384.1, first deposited with
GENBANK.RTM. on Mar. 24, 1999.
[0058] As used herein, "a nucleic acid encoding human ApoB" means
DNA encoding ApoB, or RNA transcribed from DNA encoding ApoB.
[0059] As used herein, "administering" means providing a
pharmaceutical agent to a subject, and includes, but is not limited
to administering by a medical professional and
self-administering.
[0060] As used herein, a "subject" means a human or non-human
animal selected for treatment or therapy.
[0061] As used herein, "induction phase" means a dosing phase
during which administration is initiated and steady state
concentrations of active pharmaceutical agent are achieved in a
target tissue. For example, an induction phase is a dosing phase
during which steady state concentrations of antisense
oligonucleotide are achieved in liver.
[0062] As used herein, "maintenance phase" means a dosing phase
after target tissue steady state concentrations of drug have been
achieved.
[0063] As used herein, "duration" means the period of time during
which an activity or event continues. For example, the duration of
an induction phase is the period of time during which induction
doses are administered. For example, the duration of a maintenance
phase is the period of time during which maintenance doses are
administered.
[0064] As used herein, "parenteral administration," means
administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0065] As used herein, "subcutaneous administration" means
administration just below the skin. As used herein, "intravenous
administration" means administration into a vein.
[0066] As used herein, "maintenance dose" means a dose administered
at a single administration during the maintenance phase. As used
herein, "induction dose" means a dose administered at a single
administration during the induction phase.
[0067] As used herein, a "dose" means a specified quantity of a
pharmaceutical agent provided in a single administration. In
certain embodiments, a dose may be administered in two or more
boluses, tablets, or injections. For example, in certain
embodiments, where subcutaneous administration is desired, the
desired dose requires a volume not easily accommodated by a single
injection. In such embodiments, two or more injections may be used
to achieve the desired dose. In certain embodiments, a dose may be
administered in two or more injections to minimize injection site
reaction in a subject.
[0068] As used herein, a "dosage unit" means a form in which a
pharmaceutical agent is provided. In certain embodiments, a dosage
unit is a vial containing lyophilized ISIS 301012. In certain
embodiments, a dosage unit is a vial containing reconstituted ISIS
301012.
[0069] As used herein, a "dosing regimen" is a combination of doses
designed to achieve one or more desired effects. In certain
embodiments, a dose regimen is designed to provide a therapeutic
effect quickly. In certain embodiments a dose regimen is designed
to reduce and undesired side effect, for example, liver
toxicity.
[0070] As used herein, a "pharmaceutical agent" means a substance
provides a therapeutic benefit when administered to a subject. For
example, in certain embodiments, an antisense oligonucleotide
targeted to ApoB is pharmaceutical agent.
[0071] As used herein, "active pharmaceutical ingredient" means the
substance in a pharmaceutical composition that provides a desired
effect. For example, ISIS 301012 is the active pharmaceutical
ingredient in a pharmaceutical composition comprising ISIS 301012
and saline.
[0072] As used herein, "ApoB" means apolipoprotein B-100 protein.
Concentration of ApoB in serum (or plasma) is typically quantified
in mg/dL or nmol/L. "Serum ApoB" and "plasma ApoB" mean ApoB in the
serum and plasma, respectively.
[0073] As used herein, "low density lipoprotein-cholesterol
(LDL-C)" means cholesterol associated with low density lipoprotein
particles. Concentration of LDL-C in serum (or plasma) is typically
quantified in mg/dL or nmol/L. "Serum LDL-C" and "plasma LDL-C"
mean LDL-C in the serum and plasma, respectively.
[0074] As used herein, "very low density lipoprotein-cholesterol
(VLDL-C)" means cholesterol associated with very low density
lipoprotein particles. Concentration of VLDL-C in serum (or plasma)
is typically quantified in mg/dL or nmol/L. "Serum VLDL-C" and
"plasma VLDL-C" mean VLDL-C in the serum or plasma,
respectively.
[0075] As used herein, "intermediate low density
lipoprotein-cholesterol (IDL-C)" means cholesterol associated with
intermediate density lipoprotein. Concentration of IDL-C in serum
(or plasma) is typically quantified in mg/mL or nmol/L. "Serum
IDL-C" and "plasma IDL-C" mean IDL-C in the serum or plasma,
respectively.
[0076] As used herein, "non-high density lipoprotein-cholesterol
(Non-HDL-C)" means cholesterol associated with lipoproteins other
than high density lipoproteins, and includes, without limitation,
LDL-C, VLDL-C, and IDL-C.
[0077] As used herein, "high density lipoprotein-C(HDL-C)" means
cholesterol associated with high density lipoprotein particles.
Concentration of HDL-C in serum (or plasma) is typically quantified
in mg/dL or nmol/L. "Serum HDL-C" and "plasma HDL-C" mean HDL-C in
the serum and plasma, respectively.
[0078] As used herein, "total cholesterol" means all types of
cholesterol, including, but not limited to, LDL-C, HDL-C, IDL-C and
VLDL-C. Concentration of total cholesterol in serum (or plasma) is
typically quantified in mg/dL or nmol/L.
[0079] As used herein, "lipoprotein(a)" or "Lp(a)" means a
lipoprotein particle that is comprised of LDL-C, an
apolipoprotein(a) particle, and an apolipoproteinB-100
particle.
[0080] As used herein, "ApoA1" is apolipoprotein-A1 protein in
serum. Concentration of ApoA1 in serum is typically quantified in
mg/dL or nmol/L.
[0081] As used herein, "ApoB:ApoA1 ratio" is the ratio of ApoB
concentration to ApoA1 concentration.
[0082] As used herein, "ApoB-containing lipoprotein" means any
lipoprotein that has apolipoprotein B as its protein component, and
is understood to include LDL, VLDL, IDL, and lipoprotein(a).
[0083] As used herein, "small dense LDL particles" means a subclass
of LDL particles characterized by a smaller, denser size compared
to other LDL particles.
[0084] As used herein, "triglycerides" means lipids that are the
triesters of glycerol. "Serum triglycerides" mean triglycerides
present in serum. "Liver triglycerides" mean triglycerides present
in liver tissue.
[0085] As used herein, "serum lipids" include, but are not limited
to, serum cholesterol and serum triglycerides.
[0086] As used herein, "cholesteryl ester content" means the amount
of cholesteryl ester present in liver tissue. In certain
embodiments, serum cholesteryl ester concentration is used as an
indicator of hepatic cholesteryl ester content.
[0087] As used herein, "elevated total cholesterol" means total
cholesterol at a concentration in a subject at which lipid-lowering
therapy is recommended, and includes, without limitation, elevated
LDL-C", "elevated VLDL-C," "elevated IDL-C," and "elevated
non-HDL-C." In certain embodiments, total cholesterol
concentrations of less than 200 mg/dL, 200-239 mg/dL, and greater
than 240 mg/dL are considered desirable, borderline high, and high,
respectively. In certain embodiments, LDL-C concentrations of 100
mg/dL, 100-129 mg/dL, 130-159 mg/dL, 160-189 mg/dL, and greater
than 190 mg/dL are considered optimal, near optimal/above optimal,
borderline high, high, and very high, respectively.
[0088] As used herein, "elevated triglyceride" means concentrations
of triglyceride in the serum or liver at which lipid-lowering
therapy is recommended, and includes "elevated serum triglyceride"
and "elevated liver triglyceride." In certain embodiments, serum
triglyceride concentration of 150-199 mg/dL, 200-499 mg/dL, and
greater than or equal to 500 mg/dL is considered borderline high,
high, and very high, respectively.
[0089] As used herein, "elevated small dense LDL particles" means a
concentration of small dense LDL particles in a subject at which
lipid-lowering therapy is recommended.
[0090] As used herein, "elevated lipoprotein(a)" means a
concentration of lipoprotein(a) in a subject at which
lipid-lowering therapy is recommended.
[0091] As used herein, "low HDL-C" means a concentration of HDL-C
in a subject at which lipid-lowering therapy is recommended. In
certain embodiments lipid-lowering therapy is recommended when low
HDL-C is accompanied by elevations in non-HDL-C and/or elevations
in triglyceride. In certain embodiments, HDL-C concentrations of
less than 40 mg/dL are considered low. In certain embodiments,
HDL-C concentrations of less than 50 mg/dL are considered low.
[0092] As used herein, "C.sub.trough" or "plasma trough
concentration" means a minimum plasma concentration when plasma
pharmaceutical agent concentrations are in equilibrium with target
tissue pharmaceutical agent concentrations. For example, in certain
embodiments, a plasma trough concentration of ISIS 301012 is
achieved when plasma ISIS 301012 concentrations are in equilibrium
with liver tissue ISIS 301012 concentrations.
[0093] As used herein, "AUC.sub.trough" or "plasma trough AUC"
means the area under the concentration-time curve at a time when
plasma pharmaceutical agent concentrations are in equilibrium with
target tissue pharmaceutical agent concentrations.
[0094] As used herein, "LDL/HDL ratio" means the ratio of LDL-C to
HDL-C.
[0095] As used herein, "Oxidized-LDL" or "Ox-LDL-C" means LDL-C
that is oxidized following exposure to free radicals.
[0096] As used herein, "hypercholesterolemia" means a condition
characterized by elevated serum cholesterol. In certain
embodiments, hypercholesterolemia includes, but is not limited to,
polygenic hypercholesterolemia, heterozygous familial
hypercholesterolemia, and a homozygous familial
hypercholesterolemia.
[0097] As used herein, "hyperlipidemia" means a condition
characterized by elevated serum lipids.
[0098] As used herein, "hypertriglyceridemia" means a condition
characterized by elevated triglyceride levels.
[0099] As used herein, "non-familial hypercholesterolemia" means a
condition characterized by elevated cholesterol that is not the
result of a single gene mutation.
[0100] As used herein, "polygenic hypercholesterolemia" means a
condition characterized by elevated cholesterol that results from
the influence of a variety of genetic factors. In certain
embodiments, polygenic hypercholesterolemia may be exacerbated by
dietary intake of lipids.
[0101] As used herein, "familial hypercholesterolemia (FH)" means
an autosomal dominant metabolic disorder characterized by a
mutation in the LDL-receptor (LDL-R) gene, markedly elevated LDL-C
and premature onset of atherosclerosis. A diagnosis of familial
hypercholesterolemia is made when a subject meets one or more of
the following criteria: genetic testing confirming 2 mutated
LDL-receptor genes; genetic testing confirming one mutated
LDL-receptor gene; document history of untreated serum
LDL-cholesterol greater than 500 mg/dL; tendinous and/or cutaneous
xanthoma prior to age 10 years; or, both parents have documented
elevated serum LDL-cholesterol prior to lipid-lowering therapy
consistent with heterozygous familial hypercholesterolemia.
[0102] As used herein, "homozygous familial hypercholesterolemia"
or "HoFH" means a condition characterized by a mutation in both
maternal and paternal LDL-R genes.
[0103] As used herein, "Heterozygous familial hypercholesterolemia"
or "HeFH" is a condition characterized by a mutation in either the
maternal or paternal LDL-R gene.
[0104] As used herein, "mixed dyslipidemia" means a condition
characterized by elevated serum cholesterol and elevated serum
triglycerides.
[0105] As used herein, "diabetic dyslipidemia" or "Type II diabetes
with dyslipidemia" means a condition characterized by Type II
diabetes, reduced HDL-C, elevated serum triglycerides, and elevated
small, dense LDL particles.
[0106] As used herein, "CHD risk equivalents," means indicators of
clinical atherosclerotic disease that confer a high risk for
coronary heart disease, and include clinical coronary heart
disease, symptomatic carotid artery disease, peripheral arterial
disease, and/or abdominal aortic aneurysm.
[0107] As used herein, "Major risk factors" that contribute to a
high risk for coronary heart disease include cigarette smoking,
hypertension, low HDL-C, family history of coronary heart disease,
and age.
[0108] As used herein, "CHD risk factors" include CHD risk
equivalents and major risk factors.
[0109] As used herein, "coronary heart disease (CHD)" means a
narrowing of the small blood vessels that supply blood and oxygen
to the heart, which is often a result of atherosclerosis.
[0110] As used herein, "reduced coronary heart disease risk" means
a reduction in the likelihood that a subject will develop coronary
heart disease.
[0111] As used herein, "atherosclerosis" means a hardening of the
arteries affecting large and medium-sized arteries and is
characterized by the presence of fatty deposits. The fatty deposits
are called "atheromas" or "plaques," which consist mainly of
cholesterol and other fats, calcium and scar tissue, and damage the
lining of arteries.
[0112] As used herein, "history of coronary heart disease" means
the occurrence of clinically evident coronary heart disease in the
medical history of a subject or a subject's family member.
[0113] As used herein, "early onset coronary heart disease" means a
diagnosis of coronary heart disease prior to age 50.
[0114] As used herein, "statin intolerant subject" means a subject
who as a result of statin therapy experiences one or more of
creatine kinase increases, liver function test abnormalities,
muscle aches, or central nervous system side effects.
[0115] As used herein, "efficacy" means the ability to produce a
desired effect. For example, efficacy of a lipid-lowering therapy
may be reduction in the concentration of one or more of LDL-C,
VLDL-C, IDL-C, non-HDL-C, ApoB, lipoprotein(a), or
triglycerides.
[0116] As used herein, "acceptable safety profile" means a pattern
of side effects that is within clinically acceptable limits.
[0117] As used herein, "side effects" means physiological responses
attributable to a treatment other than desired effects. In the
present context, side effects include, without limitation,
injection site reactions, liver function test abnormalities, renal
function abnormalities, liver toxicity, renal toxicity, central
nervous system abnormalities, and myopathies. For example,
increased aminotransferase levels in serum may indicate liver
toxicity or liver function abnormality. For example, increased
bilirubin may indicate liver toxicity or liver function
abnormality.
[0118] As used herein, "injection site reaction" means inflammation
or abnormal redness of skin at a site of injection in a
subject.
[0119] As used herein, "subject compliance" means adherence to a
recommended or prescribed therapy by a subject.
[0120] As used herein, "lipid-lowering therapy" means a therapeutic
regimen provided to a subject to reduce one or more lipids in a
subject. In certain embodiments, a lipid-lowering therapy is
provide to reduce one or more of ApoB, total cholesterol, LDL-C,
VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles,
and Lp(a) in a subject.
[0121] As used herein, "lipid-lowering agent" means a
pharmaceutical agent provided to a subject to achieve a lowering of
lipids in the subject. For example, in certain embodiments, a
lipid-lowering agent is provided to a subject to reduce one or more
of ApoB, LDL-C, total cholesterol, and triglycerides.
[0122] As used herein, "LDL-C target" is an LDL-C level that is
desired following lipid-lowering therapy.
[0123] As used herein, "comply" as used herein means the adherence
to a recommended therapy by a subject.
[0124] As used herein, "recommended therapy" means a therapeutic
regimen recommended by a medical professional for the treatment,
amelioration, or prevention of a disease.
[0125] As used herein, "low LDL-receptor activity" means
LDL-receptor activity that is not sufficiently high to maintain
clinically acceptable levels of LDL-C in the bloodstream.
[0126] As used herein, "cardiovascular outcome" means the occurance
of major adverse cardiovascular events.
[0127] As used herein, "improved cardiovascular outcome" means a
reduction in the occurance of major adverse cardiovascular events,
or the risk thereof. Examples of major adverse cardiovascular
events include, without limitation, death, reinfarction, stroke,
cardiogenic shock, pulmonary edema, cardiac arrest, and atrial
dysrhythmia.
[0128] As used herein, "surrogate markers of cardiovascular
outcome" means indirect indicators of cardiovascular events, or the
risk thereof. For example, surrogate markers of cardiovascular
outcome include carotid intimal media thickness (CIMT). Another
example of a surrogate marker of cardiovascular outcome includes
atheroma size. Atheroma size may be determined by intravascular
ultrasound (IVUS).
[0129] As used herein, "increased HDL-C" means an increase in serum
HDL-C in a subject over time.
[0130] As used herein, "lipid-lowering" means a reduction in one or
more serum lipids in a subject over time.
[0131] As used herein, "co-administration" means administration of
two or more pharmaceutical agents to a subject. The two or more
pharmaceutical agents may be in a single pharmaceutical
composition, or may be in separate pharmaceutical compositions.
Each of the two or more pharmaceutical agents may be administered
through the same or different routes of administration.
Co-administration encompasses administration in parallel or
sequentially.
[0132] As used herein, "therapeutic lifestyle change" means dietary
and lifestyle changes intended to lower cholesterol and reduce the
risk of developing heart disease, and includes recommendations for
dietary intake of total daily calories, total fat, saturated fat,
polyunsaturated fat, monounsaturated fat, carbohydrate, protein,
cholesterol, insoluble fiber, as well as recommendations for
physical activity.
[0133] As used herein, "statin" means a pharmaceutical agent that
inhibits the activity of HMG-CoA reductase.
[0134] As used herein, "HMG-CoA reductase inhibitor" means a
pharmaceutical agent that acts through the inhibition of the enzyme
HMG-CoA reductase.
[0135] As used herein, "cholesterol absorption inhibitor" means a
pharmaceutical agent that inhibits the absorption of exogenous
cholesterol obtained from diet.
[0136] As used herein, "LDL apheresis" means a form of apheresis by
which LDL-C is removed from blood. Typically, a subject's blood is
removed from a vein, and separated into red cells and plasma. LDL-C
is filtered out of the plasma prior to return of the plasma and red
blood cells to the subject.
[0137] As used herein, "MTP inhibitor" means a pharmaceutical agent
that inhibits the enzyme microsomal triglyceride transfer
protein.
[0138] As used herein, "nucleoside" means a base-sugar
combination.
[0139] As used herein, "nucleobase" means a heterocyclic base
moiety.
[0140] As used herein, "nucleotide" means a nucleoside having a
phosphate group covalently linked to the sugar portion of the
nucleoside.
[0141] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides
[0142] As used herein "naturally occuring internucleoside linkage"
means a 3' to 5' phosphodiester linkage.
[0143] As used herein "oligonucleotide" means a polymer of linked
nucleotides, each of which can be, independently, modified or
unmodified.
[0144] As used herein "oligonucleoside" means an oligonucleotide in
which the internucleoside linkages do not contain a phosphorus
atom.
[0145] As used herein "unmodified" nucleobases mean the purine
bases adenine (A) and guanine (G), and the pyrimidine bases thymine
(T), cytosine (C) and uracil (U).
[0146] As used herein "modified sugar moiety" means a sugar moiety
having a substitution and/or any change from a natural sugar
moiety.
[0147] As used herein, a "natural sugar moiety" means a sugar
moiety found in DNA (2'-H) or RNA (2'-OH).
[0148] As used herein a "2'-O-methoxyethyl sugar moiety" means a
2'-substituted furosyl ring having a
2'-O(CH.sub.2).sub.2--OCH.sub.3 (2'-O-methoxyethyl or 2'-MOE)
substituent group.
[0149] As used herein, "2'-O-methoxyethyl nucleotide" means a
nucleotide comprising a 2'-O-methoxyethyl modified sugar
moiety.
[0150] As used herein "bicyclic nucleic acid sugar moiety" means a
furosyl ring modified by the bridging of two non-geminal ring
atoms.
[0151] As used herein "wing segment" means a plurality of
nucleosides modified to impart to an oligonucleotide properties
such as enhanced inhibitory activity, increased binding affinity
for a target nucleic acid, or resistance to degradation by in vivo
nucleases.
[0152] As used herein "gap segment" means a plurality of
nucleotides that supports cleavage by the endonuclease RNaseH.
[0153] As used herein "ISIS 301012" means a lipid-lowering agent
that is an antisense oligonucleotide having the sequence
"GCCTCAGTCTGCTTCGCACC" (SEQ ID NO: 2), where each internucleoside
linkage is a phosphorothioate internucleoside linkage, each
cytosine is a 5-methylcytosine, nucleotides 6-15 are
2'-deoxynucleotides, and nucleotides 1-5 and 16-20 are
2'-O-methoxyethyl nucleotides. ISIS 301012 is complementary to
nucleotides 3249-3268 of the sequence with GENBANK Accession No.
NM_000384.1 (SEQ ID NO: 1).
[0154] As used herein "Metabolic syndrome" means defined as a
clustering of lipid and non-lipid cardiovascular risk factors of
metabolic origin. In certain embodiments, metabolic syndrome is
identified by the presence of any 3 of the following factors: waist
circumference of greater than 102 cm in men or greater than 88 cm
in women; serum triglyceride of at least 150 mg/dL; HDL-C less than
40 mg/dL in men or less than 50 mg/dL in women; blood pressure of
at least 130/85 mmHg; and fasting glucose of at least 110 mg/dL
[0155] As used herein, a "therapeutically effective amount" means
an amount of a pharmaceutical agent that provides a therapeutic
benefit to a subject. For example, a therapeutically effective
amount of an antisense oligonucleotide complementary to a nucleic
acid encoding human apoB is an amount that results in reduced
LDL-C.
B. CERTAIN PHARMACEUTICAL COMPOSITIONS
[0156] In certain embodiments, the present invention provides
pharmaceutical compositions comprising one or more different
oligonucleotides. In certain such embodiments, those pharmaceutical
compositions comprise an antisense oligonucleotide complementary to
a nucleic acid encoding human apoB. In certain embodiments, such
pharmaceutical compositions comprise ISIS 301012. ISIS 301012 is a
pharmaceutical agent that, when administered to a subject, results
in dose-dependent reductions of ApoB, ApoB-containing lipoproteins,
including but not limited to LDL-C, triglycerides, and Lp(a). ISIS
301012 results in efficacy when administered alone, and also
results in efficacy when
[0157] In certain embodiments, pharmaceutical compositions comprise
an oligonucleotide having complementary to a target nucleic acid.
In certain such embodiments, a sufficient number of nucleobases of
the oligonucleotide can undergo hydrogen bonding with corresponding
nucleobases in a target nucleic acid such that a desired effect
occurs. In certain such embodiments, a desired effect is antisense
inhibition of a target nucleic acid. In certain such embodiments, a
desired effect is antisense inhibition of apoB. In certain such
embodiments, least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 96%, at least 97%, at least
98% or at least 99% of the nucleobases of an oligonucleotide can
undergo hydrogen bonding with a corresponding nucleobase of a
target nucleic acid. In certain such embodiments, 100% of the
nucleobases of an oligonucleotide can undergo hydrogen bonding with
a corresponding nucleobase of a target nucleic acid. In these
embodiments, oligonucleotides are fully complementary (i.e, 100%
complementary) to a target nucleic acid. In certain such
embodiments, oligonucleotides are fully complementary to a nucleic
acid encoding ApoB.
[0158] In certain embodiments, a nucleic acid encoding human ApoB
is ApoB mRNA. In certain embodiments, such ApoB mRNA may or may not
include some or all exons.
[0159] In certain embodiments, oligonucleotides are 12 to 30
nucleotides in length, i.e., the oligonucleotides are from 12 to 30
linked nucleotides. In certain such embodiments, oligonucleotides
are 15 to 25 nucleotides in length. In certain such embodiments,
oligonucleotides are 17 to 23 nucleotides in length. In certain
such embodiments, oligonucleotides are 18 to 22 nucleotides in
length. In certain such embodiments, oligonucleotides are 19 to 21
nucleotides in length. In certain such embodiments,
oligonucleotides are 20 nucleotides in length.
[0160] In certain embodiments, oligonucleotides comprise a percent
identity to a particular nucleotide sequence. An oligonucleotide
has identity to another oligonucleotide if the nucleobases of each
oligonucleotide have the same nucleobase pairing ability. In
certain such embodiments, an oligonucleotide has 90% identity to
another oligonucleotide. In certain such embodiments, an
oligonucleotide has 95% identity to another oligonucleotide. In
certain such embodiments, an oligonucleotide has 100% identity to
another oligonucleotide. In certain such embodiments, the identity
is over the full-length of the oligonucleotide. In certain such
embodiments, the identity is to a portion of an
oligonucleotide.
[0161] In certain embodiments, oligonucleotides comprise chemical
modifications. In certain such embodiments, modifications to
oligonucleotides encompass substitutions or changes to
internucleoside linkages, sugar moieties, or nucleobases. Modified
oligonucleotides are often preferred over native forms because of
desirable properties such as, for example, enhanced cellular
uptake, enhanced affinity for nucleic acid target, increased
stability in the presence of nucleases, or increased inhibitory
activity.
[0162] In certain embodiments, chemically modified nucleosides may
also be employed to increase the binding affinity of a shortened or
truncated antisense oligonucleotide for its target nucleic
acid.
[0163] In certain embodiments, oligonucleotides comprise one or
more modified, i.e. non-naturally occurring, internucleoside
linkages. In certain such embodiments, oligonucleotides having
modified internucleoside linkages include internucleoside linkages
that retain a phosphorus atom as well as internucleoside linkages
that do not have a phosphorus atom. Representative phosphorus
containing internucleoside linkages include, but are not limited
to, phosphodiesters, phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing linkages are
well known.
[0164] In certain embodiments, oligonucleotides comprise one or
more nucleotides comprising modified sugar moieties. In certain
such embodiments, the furanosyl sugar ring of a nucleoside is
modified in a number of ways including, but not limited to:
addition of a substituent group, particularly at the 2' position;
bridging of two non-geminal ring atoms to form a bicyclic nucleic
acid (BNA); and substitution of an atom or group such as --S--,
--N(R)-- or --C(R.sub.1)(R.sub.2) for the ring oxygen at the
4'-position. In certain such embodiments, modified sugars include,
but are not limited to: substituted sugars, especially
2'-substituted sugars having a 2'-F, 2'-OCH.sub.2 (2'-OMe) or a
2'-O(CH.sub.2).sub.2--OCH.sub.3 (2'-O-methoxyethyl or 2'-MOE)
substituent group; and bicyclic modified sugars (BNAs), having a
4'-(CH.sub.2).sub.n--O-2' bridge, where n=1 or n=2. Methods for the
preparations of modified sugars are well known to those skilled in
the art.
[0165] In certain embodiments, oligonucleotides comprise one or
more nucleotides comprising modified nucleobases. In such
embodiments, nucleobases are modified so as to maintain hydrogen
bonding. In certain such embodiments, modified nucleobases include,
but are not limited to, 5-methylcytosine (5-meC). Additional
modified nucleobases include 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine.
[0166] In certain embodiments, pharmaceutical compositions of the
present invention comprise one or more oligonucleotides and one or
more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulosem and
polyvinylpyrrolidone.
[0167] In certain embodiments, a pharmaceutical composition of the
present invention is prepared using known techniques, including,
but not limited to mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or tabletting
processes.
[0168] In certain embodiments, a pharmaceutical composition of the
present invention is a liquid (e.g., a suspension, elixir and/or
solution). In certain of such embodiments, a liquid pharmaceutical
composition is prepared using ingredients known in the art,
including, but not limited to, water, glycols, oils, alcohols,
flavoring agents, preservatives, and coloring agents.
[0169] In certain embodiments, a pharmaceutical composition of the
present invention is a solid (e.g., a powder, tablet, and/or
capsule). In certain of such embodiments, a solid pharmaceutical
composition comprising one or more oligonucleotides is prepared
using ingredients known in the art, including, but not limited to,
starches, sugars, diluents, granulating agents, lubricants,
binders, and disintegrating agents.
[0170] In certain embodiments, a pharmaceutical composition of the
present invention is formulated as a depot preparation. Certain
such depot preparations are typically longer acting than non-depot
preparations. In certain embodiments, such preparations are
administered by implantation (for example subcutaneously or
intramuscularly) or by intramuscular injection. In certain
embodiments, depot preparations are prepared using suitable
polymeric or hydrophobic materials (for example an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0171] In certain embodiments, a pharmaceutical composition of the
present invention comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0172] In certain embodiments, a pharmaceutical composition of the
present invention comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present invention to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0173] In certain embodiments, a pharmaceutical composition of the
present invention comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM., and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0174] In certain embodiments, a pharmaceutical composition of the
present invention comprises a sustained-release system. A
non-limiting example of such a sustained-release system is a
semi-permeable matrix of solid hydrophobic polymers. In certain
embodiments, sustained-release systems may, depending on their
chemical nature, release pharmaceutical agents over a period of
hours, days, weeks or months.
[0175] In certain embodiments, a pharmaceutical composition of the
present invention is prepared for oral administration. In certain
of such embodiments, a pharmaceutical composition is formulated by
combining one or more oligonucleotides with one or more
pharmaceutically acceptable carriers. Certain of such carriers
enable pharmaceutical compositions to be formulated as tablets,
pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions and the like, for oral ingestion by a subject. In
certain embodiments, pharmaceutical compositions for oral use are
obtained by mixing oligonucleotide and one or more solid excipient.
Suitable excipients include, but are not limited to, fillers, such
as sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). In
certain embodiments, such a mixture is optionally ground and
auxiliaries are optionally added. In certain embodiments,
pharmaceutical compositions are formed to obtain tablets or dragee
cores. In certain embodiments, disintegrating agents (e.g.,
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof, such as sodium alginate) are added.
[0176] In certain embodiments, dragee cores are provided with
coatings. In certain such embodiments, concentrated sugar solutions
may be used, which may optionally contain gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or
titanium dioxide, lacquer solutions, and suitable organic solvents
or solvent mixtures. Dyestuffs or pigments may be added to tablets
or dragee coatings.
[0177] In certain embodiments, pharmaceutical compositions for oral
administration are push-fit capsules made of gelatin. Certain of
such push-fit capsules comprise one or more pharmaceutical agents
of the present invention in admixture with one or more filler such
as lactose, binders such as starches, and/or lubricants such as
talc or magnesium stearate and, optionally, stabilizers. In certain
embodiments, pharmaceutical compositions for oral administration
are soft, sealed capsules made of gelatin and a plasticizer, such
as glycerol or sorbitol. In certain soft capsules, one or more
pharmaceutical agents of the present invention are be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin,
or liquid polyethylene glycols. In addition, stabilizers may be
added.
[0178] In certain embodiments, pharmaceutical compositions are
prepared for buccal administration. Certain of such pharmaceutical
compositions are tablets or lozenges formulated in conventional
manner.
[0179] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0180] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0181] In certain embodiments, a pharmaceutical composition is
prepared for administration by inhalation. Certain of such
pharmaceutical compositions for inhalation are prepared in the form
of an aerosol spray in a pressurized pack or a nebulizer. Certain
of such pharmaceutical compositions comprise a propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
certain embodiments using a pressurized aerosol, the dosage unit
may be determined with a valve that delivers a metered amount. In
certain embodiments, capsules and cartridges for use in an inhaler
or insufflator may be formulated. Certain of such formulations
comprise a powder mixture of a pharmaceutical agent of the
invention and a suitable powder base such as lactose or starch.
[0182] In certain embodiments, a pharmaceutical composition is
prepared for rectal administration, such as a suppositories or
retention enema. Certain of such pharmaceutical compositions
comprise known ingredients, such as cocoa butter and/or other
glycerides.
[0183] In certain embodiments, a pharmaceutical composition is
prepared for topical administration. Certain of such pharmaceutical
compositions comprise bland moisturizing bases, such as ointments
or creams. Exemplary suitable ointment bases include, but are not
limited to, petrolatum, petrolatum plus volatile silicones, lanolin
and water in oil emulsions such as Eucerin.TM., available from
Beiersdorf (Cincinnati, Ohio). Exemplary suitable cream bases
include, but are not limited to, Nivea.TM. Cream, available from
Beiersdorf (Cincinnati, Ohio), cold cream (USP), Purpose Cream.TM.,
available from Johnson & Johnson (New Brunswick, N.J.),
hydrophilic ointment (USP) and Lubriderm.TM., available from Pfizer
(Morris Plains, N.J.).
[0184] In certain embodiments, a pharmaceutical composition of the
present invention comprises an oligonucleotide in a therapeutically
effective amount. In certain embodiments, the therapeutically
effective amount is sufficient to prevent, alleviate or ameliorate
symptoms of a disease or to prolong the survival of the subject
being treated. Determination of a therapeutically effective amount
is well within the capability of those skilled in the art.
[0185] In certain embodiments, one or more oligonucleotides of the
present invention is formulated as a prodrug. In certain
embodiments, upon in vivo administration, a prodrug is chemically
converted to the biologically, pharmaceutically or therapeutically
more active form of the oligonucleotide. In certain embodiments,
prodrugs are useful because they are easier to administer than the
corresponding active form. For example, in certain instances, a
prodrug may be more bioavailable (e.g., through oral
administration) than is the corresponding active form. In certain
instances, a prodrug may have improved solubility compared to the
corresponding active form. In certain embodiments, prodrugs are
less water soluble than the corresponding active form. In certain
instances, such prodrugs possess superior transmittal across cell
membranes, where water solubility is detrimental to mobility. In
certain embodiments, a prodrug is an ester. In certain such
embodiments, the ester is metabolically hydrolyzed to carboxylic
acid upon administration. In certain instances the carboxylic acid
containing compound is the corresponding active form. In certain
embodiments, a prodrug comprises a short peptide (polyaminoacid)
bound to an acid group. In certain of such embodiments, the peptide
is cleaved upon administration to form the corresponding active
form.
[0186] In certain embodiments, a prodrug is produced by modifying a
pharmaceutically active compound such that the active compound will
be regenerated upon in vivo administration. The prodrug can be
designed to alter the metabolic stability or the transport
characteristics of a drug, to mask side effects or toxicity, to
improve the flavor of a drug or to alter other characteristics or
properties of a drug. By virtue of knowledge of pharmacodynamic
processes and drug metabolism in vivo, those of skill in this art,
once a pharmaceutically active compound is known, can design
prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal
Chemistry A Biochemical Approach, Oxford University Press, New
York, pages 388-392).
[0187] In certain embodiments, a pharmaceutical composition
comprising one or more pharmaceutical agents of the present
invention is useful for treating a conditions or disorders in a
mammalian, and particularly in a human, subject. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intraventricular, intraperitoneal,
intranasal, intraocular and parenteral (e.g., intravenous,
intramuscular, intramedullary, and subcutaneous). In certain
embodiments, pharmaceutical intrathecals are administered to
achieve local rather than systemic exposures. For example,
pharmaceutical compositions may be injected directly in the area of
desired effect (e.g., in the renal or cardiac area).
[0188] In certain embodiments, a pharmaceutical composition of the
present invention is administered in the form of a dosage unit
(e.g., tablet, capsule, bolus, etc.). In certain embodiments, such
pharmaceutical compositions comprise an oligonucleotide in a dose
selected from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60
mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105
mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg,
150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190
mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg,
235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 270
mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg,
320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360
mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg,
405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445
mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg,
490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530
mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg,
575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610 mg, 615
mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg, 655 mg,
660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695 mg, 700
mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg, 740 mg,
745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780 mg, 785
mg, 790 mg, 795 mg, and 800 mg. In certain such embodiments, a
pharmaceutical composition of the present invention comprises a
dose of oligonucleotide selected from 25 mg, 50 mg, 75 mg, 100 mg,
150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 600 mg, 700
mg, and 800 mg. In certain embodiments, a pharmaceutical
composition is comprises a dose of oligonucleotide selected from 50
mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, and 400 mg.
[0189] In a further aspect, a pharmaceutical agent is sterile
lyophilized oligonucleotide that is reconstituted with a suitable
diluent, e.g., sterile water for injection. The reconstituted
product is administered as a subcutaneous injection or as an
intravenous infusion after dilution into saline. The lyophilized
drug product consists of the oligonucleotide which has been
prepared in water for injection, adjusted to pH 7.0-9.0 with acid
or base during preparation, and then lyophilized. The lyophilized
oligonucleotide may be 25-800 mg of the oligonucleotide. It is
understood that this encompasses 25, 50, 75, 100, 125, 150, 175,
200, 225, 250, 275, 300, 325, 350, 375, 425, 450, 475, 500, 525,
550, 575, 600, 625, 650, 675, 700, 725, 750, 775, and 800 mg of
lyophilized oligonucleotide. The lyophilized drug product may be
packaged in a 2 mL Type I, clear glass vial (ammonium
sulfate-treated), stoppered with a bromobutyl rubber closure and
sealed with an aluminum FLIP-OFF.RTM. overseal. In one embodiment,
the lyophilized pharmaceutical agent comprises ISIS 301012.
[0190] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the oligonucleotide(s) of the
formulation.
C. CERTAIN DOSING REGIMENS
[0191] In certain embodiments, pharmaceutical compositions are
administered according to a dosing regimen. In certain such
embodiments, the dosing regimen comprises an induction phase and a
maintenance phase.
[0192] In certain embodiments, the induction phase includes one,
two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty, or more than twenty doses.
[0193] In certain embodiments, the induction phase lasts from one
day to six months. In certain embodiments an induction phase lasts
from one week to five months as measured from administration of the
first dose of the induction phase to administration of the first
dose of the maintenance phase. In certain embodiments an induction
phase lasts from one week to five months as measured from
administration of the first dose of the induction phase to
administration of the first dose of the maintenance phase. In
certain embodiments an induction phase lasts from two weeks to five
months as measured from administration of the first dose of the
induction phase to administration of the first dose of the
maintenance phase. In certain embodiments an induction phase lasts
from three weeks to four months as measured from administration of
the first dose of the induction phase to administration of the
first dose of the maintenance phase. In certain embodiments an
induction phase lasts from five weeks to three months as measured
from administration of the first dose of the induction phase to
administration of the first dose of the maintenance phase. In
certain embodiments an induction phase lasts five weeks as measured
from administration of the first dose of the induction phase to
administration of the first dose of the maintenance phase. In
certain embodiments an induction phase lasts six weeks as measured
from administration of the first dose of the induction phase to
administration of the first dose of the maintenance phase. In
certain embodiments an induction phase lasts seven weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts eight weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts nine weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts ten weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts eleven weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twelve weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts thirteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts fourteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts fifteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts sixteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts seventeen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts eighteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts nineteen weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty-one weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty-two weeks as
measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty-three weeks
as measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty-four weeks
as measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain embodiments an induction phase lasts twenty-five weeks
as measured from administration of the first dose of the induction
phase to administration of the first dose of the maintenance phase.
In certain such embodiments, the doses administered during the
induction phase are lower than the doses administered during the
maintenance phase.
[0194] In certain embodiments, the dose administered during the
induction phase is lower than the dose administered during the
maintenance phase to avoid undesired side effects. In certain
embodiments, the undesired side effect is liver toxicity. In
certain such embodiments, the undesired side effect is increased
ALT. In certain such embodiments, the lower induction dose provides
time for lipid metabolism in the liver to compensate for the
decreased production of ApoB. In certain such embodiments, mild
increases in ALT reflect rapid lipid-lowering activity.
[0195] In certain embodiments where the induction phase includes
more than one dose, the doses administered during the induction
phase are all the same amount as one another. In certain
embodiments, the doses administered during the induction phase are
not all the same amount. In certain such embodiments, the doses
increase over time. In certain embodiments, the doses decrease over
time.
[0196] In certain embodiments, an induction dose is administered by
parenteral administration. In certain such embodiments, the
parenteral administration is subcutaneous administration. In
certain such embodiments, the parenteral administration is
intravenous infusion.
[0197] In certain embodiments, the doses during the induction phase
are selected from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg,
60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105
mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg,
150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190
mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg,
235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 270
mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg,
320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360
mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg,
405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445
mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg,
490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530
mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg,
575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610 mg, 615
mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg, 655 mg,
660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695 mg, 700
mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg, 740 mg,
745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780 mg, 785
mg, 790 mg, 795 mg, and 800 mg. In certain such embodiments, the
doses during the induction phase are selected from 25 mg, 50 mg, 75
mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg,
600 mg, 700 mg, and 800 mg. In certain such embodiments, the doses
during the induction phase are selected from 100 mg, 125 mg, 150
mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg,
375 mg, and 400 mg. In certain such embodiments, the doses during
the induction phase are selected from 100 mg, 125 mg, 150 mg, 175
mg, 200 mg, 225 mg, and 250 mg. In certain embodiments, the dose
administered during the induction phase is 100 mg. In certain
embodiments, the dose administered during the induction phase is
125 mg. In certain embodiments the dose administered during the
induction phase is 150 mg. In certain embodiments the dose
administered during the induction phase is 175 mg. In certain
embodiments the dose administered during the induction phase is 200
mg. In certain embodiments the dose administered during the
induction phase is 225 mg. In certain embodiments the dose
administered during the induction phase is 250 mg. In certain
embodiments the dose administered during the induction phase is 300
mg. In certain embodiments the dose administered during the
induction phase is 325 mg. In certain embodiments the dose
administered during the induction phase is 350 mg. In certain
embodiments the dose administered during the induction phase is 375
mg. In certain embodiments the dose administered during the
induction phase is 400 mg.
[0198] In certain embodiments, where subcutaneous administration is
desired, an induction dose may be administered in two or more
subcutaneous injections. In certain such embodiments, when the
desired induction dose requires a volume not easily accommodated by
a single injection, two or more subcutaneous injections may be used
to achieve the desired induction dose. In certain such embodiments,
two or more subcutaneous injections may be used to administer the
desired induction dose and minimize or eliminate an injection site
reaction in a subject.
[0199] In certain embodiments, dose, dose frequency, and duration
of the induction phase may be selected to achieve a desired effect.
In certain embodiments, those variables are adjusted to result in a
desired concentration of pharmaceutical agent in a subject. For
example, in certain embodiments, dose and dose frequency are
adjusted to provide plasma concentration of a pharmaceutical agent
at an amount sufficient to achieve a desired effect. In certain of
such embodiments the plasma concentration is maintained above the
minimal effective concentration (MEC). In certain embodiments,
pharmaceutical compositions of the present invention are
administered with a dosage regimen designed to maintain a
concentration above the MEC for 10-90% of the time, between 30-90%
of the time, or between 50-90% of the time.
[0200] In certain embodiments, doses, dose frequency, and duration
of the induction phase may be selected to achieve a desired plasma
trough concentration of a pharmaceutical composition. In certain
such embodiments, the pharmaceutical composition is an
oligonucleotide. In certain such embodiments, the desired plasma
trough concentration is from 5-100 ng/mL. In certain such
embodiments, the desired plasma trough concentration is from 5-50
ng/mL. In certain such embodiments, the desired plasma trough
concentration is from 10-40 ng/mL. In certain such embodiments, the
desired plasma trough concentration is from 15-35 ng/mL. In certain
such embodiments, the desired plasma trough concentration is from
20-30 ng/mL.
[0201] In certain embodiments, dose, dose frequency, and duration
of the induction phase may be selected to achieve a desired effect
within five to thirteen weeks. In certain such embodiments, the
dose is the same and the dose frequency is varied to achieve the
desired effect within five to thirteen weeks. In certain such
embodiments, the dose increases over time and the dose frequency
remains constant. In certain such embodiments, doses and dose
frequency are selected to achieve a desired effect within six to 13
weeks. In certain such embodiments, doses and frequency are
selected to achieve a desired effect within six weeks. In certain
such embodiments, doses and frequency are selected to achieve a
desired effect within seven weeks. In certain such embodiments,
doses and frequency are selected to achieve a desired effect within
eight weeks. In certain such embodiments, doses and frequency are
selected to achieve a desired effect within nine weeks. In certain
such embodiments, doses and frequency are selected to achieve a
desired effect within ten weeks. In certain such embodiments, doses
and frequency are selected to achieve a desired effect within
eleven weeks. In certain such embodiments, doses and frequency are
selected to achieve a desired effect within twelve weeks. In
certain such embodiments, doses and frequency are selected to
achieve a desired effect within thirteen weeks. In certain such
embodiments, one or more doses of the induction phase is greater
than one or more doses of the maintenance phase. In certain such
embodiments, each of the induction doses is greater than each of
the maintenance doses.
[0202] In certain embodiments, doses, dose frequency, and duration
of the induction phase may be selected to achieve a desired effect
within 13 to 25 weeks. In certain such embodiments, the dose is the
same and the dose frequency is varied to achieve the desired effect
within 13 to 25 weeks. In certain such embodiments, the dose
increases over time and the dose frequency remains constant. In
certain such embodiments, doses and frequency are selected to
achieve a desired effect within thirteen weeks. In certain such
embodiments, doses and frequency are selected to achieve a desired
effect within fourteen weeks. In certain such embodiments, doses
and frequency are selected to achieve a desired effect within
fifteen weeks. In certain such embodiments, doses and frequency are
selected to achieve a desired effect within sixteen weeks. In
certain such embodiments, doses and frequency are selected to
achieve a desired effect within seventeen weeks. In certain such
embodiments, doses and frequency are selected to achieve a desired
effect within eighteen weeks. In certain such embodiments, doses
and frequency are selected to achieve a desired effect within
nineteen weeks. In certain such embodiments, doses and frequency
are selected to achieve a desired effect within twenty weeks. In
certain such embodiments, doses and frequency are selected to
achieve a desired effect within twenty-one weeks. In certain such
embodiments, doses and frequency are selected to achieve a desired
effect within twenty-two weeks. In certain such embodiments, doses
and frequency are selected to achieve a desired effect within
twenty-three weeks. In certain such embodiments, doses and
frequency are selected to achieve a desired effect within
twenty-four weeks. In certain such embodiments, doses and frequency
are selected to achieve a desired effect within twenty-five weeks.
In certain embodiments, one or more doses of the induction phase is
less than one or more doses of the maintenance phase. In certain
such embodiments, each dose of the induction phase is less than
each dose of the maintenance phase.
[0203] In certain embodiments, it is desirable to achieve a desired
effect as quickly as possible. In such embodiments, an induction
phase with a high dose and/or high dose frequency may be desirable.
Such embodiments may include administration to subjects with very
high cholesterol concentrations.
[0204] In certain embodiments, it is desirable to mitigate an
undesired side effect. In certain such embodiments, an induction
phase with a low dose and/or low dose frequency and/or long
duration may be desirable. For example, a long induction phase,
with relatively low doses, may result in better tolerance of the
pharmaceutical agent. Certain such embodiments, result in
physiological changes that result in reduced overall side effects.
In certain embodiments, such a dose regimen results in reduced
liver toxicity when compared to higher initial doses and/or
frequency. Such embodiments may include gradual increases of dose
over time.
[0205] In certain embodiments in which a pharmaceutical composition
is administered locally, the dosage regimen is selected to achieve
a desired local concentration of a pharmaceutical agent of the
present invention.
[0206] In certain embodiments, doses, dose frequency, and duration
of the induction phase may be selected to achieve an acceptable
safety profile. For example, in certain embodiments, such variables
may be selected to mitigate toxicity of the pharmaceutical
composition. In certain such embodiments, such variables are
selected to mitigate liver toxicity. In certain such embodiments,
such variables are selected to mitigate renal toxicity. In certain
such embodiments, doses increase over time. In certain embodiments,
one or more doses of the induction phase is lower than one or more
doses of the maintenance phase. In certain such embodiments, a
safety profile is not acceptable when ALT is 5-10 times the upper
limit of normal. In certain such embodiments, a safety profile is
not acceptable when ALT is 5-10 times the upper limit of normal,
and bilirubin is elevated two or more times the upper limit of
normal. In certain such embodiments, an acceptable safety profile
comprises ALT elevations that are above three times the upper limit
of normal, but do not exceed five times the upper limit of normal.
In certain such embodiments, and acceptable safety profile
comprises ALT elevations that are above three times the upper limit
of normal, but do not exceed five times the upper limit of normal,
and bilirubin elevations that do not exceed two times the upper
limit of normal. In certain such embodiments, when administration
of a pharmaceutical composition of the invention results in ALT
elevations that are above three times the upper limit of normal,
the dose and/or dose frequency is adjusted to mitigate the ALT
elevation. In certain such embodiments, when administration of a
pharmaceutical composition of the invention results in ALT
elevations that are above three times the upper limit of normal,
and bilirubin concentrations that are above two times the upper
limit of normal, the dose and/or dose frequency is adjusted to
mitigate the ALT elevation and bilirubin elevation. In certain such
embodiments, the dose and/or dose frequency is adjusted to mitigate
the bilirubin elevation alone.
[0207] In certain embodiments, the maintenance phase includes one,
two three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty, or more than twenty doses.
[0208] In certain embodiments, the maintenance phase lasts from one
day to the lifetime of the subject. In certain embodiments the
maintenance phase lasts from one week to twenty years as measured
from administration of the last dose of the induction phase to
administration of the last dose of the maintenance phase. In
certain embodiments the maintenance phase lasts from two weeks to
fifteen years as measured from administration of the last dose of
the induction phase to administration of the last dose of the
maintenance phase. In certain embodiments the maintenance phase
lasts three weeks to ten years as measured from administration of
the last dose of the induction phase to administration of the last
dose of the maintenance phase. In certain embodiments the
maintenance phase lasts from four weeks to ten years as measured
from administration of the last dose of the induction phase to
administration of the last dose of the maintenance phase. In
certain embodiments the maintenance phase lasts as long as the dose
continues to be needed, effective, and tolerated.
[0209] In certain embodiments where the maintenance phase includes
more than one dose, the doses administered during the maintenance
phase are all the same as one another. In certain embodiments, the
doses administered during the maintenance phase are not all the
same. In certain such embodiments, the doses increase over time. In
certain embodiments, the doses decrease over time.
[0210] In certain embodiments, a maintenance dose is administered
by parenteral administration. In certain such embodiments, the
parenteral administration is subcutaneous administration. In
certain such embodiments, the parenteral administration is
intravenous infusion.
[0211] In certain embodiments, the doses during the maintenance
phase are selected from 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg,
55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100
mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg,
145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185
mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg,
230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270
mg, 270 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg,
315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355
mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg,
400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440
mg, 445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg,
485 mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525
mg, 530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg,
570 mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610
mg, 615 mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg,
655 mg, 660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695
mg, 700 mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg,
740 mg, 745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780
mg, 785 mg, 790 mg, 795 mg, and 800 mg. In certain such
embodiments, the doses during the maintenance phase are selected
from 25 mg, 50 mg, 75 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg,
350 mg, 400 mg, 500 mg, 600 mg, 700 mg, and 800 mg. In certain such
embodiments, the doses during the maintenance phase are selected
from 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275
mg, 300 mg, 325 mg, 350 mg, 375 mg, and 400 mg. In certain such
embodiments, the doses during the maintenance phase are selected
from 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, and 250 mg. In
certain embodiments, the dose administered during the maintenance
phase is 100 mg. In certain embodiments, the dose administered
during the maintenance phase is 125 mg. In certain embodiments the
dose administered during the maintenance phase is 150 mg. In
certain embodiments the dose administered during the maintenance
phase is 175 mg. In certain embodiments the dose administered
during the maintenance phase is 200 mg. In certain embodiments the
dose administered during the maintenance phase is 225 mg. In
certain embodiments the dose administered during the maintenance
phase is 250 mg. In certain embodiments the dose administered
during the maintenance phase is 275 mg. In certain embodiments the
dose administered during the maintenance phase is 300 mg.
[0212] In certain embodiments, where subcutaneous administration is
desired, a maintenance dose may be administered in two or more
subcutaneous injections. In certain such embodiments, when the
desired maintenance dose requires a volume not easily accommodated
by a single injection, two or more subcutaneous injections may be
used to achieve the desired maintenance dose. In certain such
embodiments, two or more subcutaneous injections may be used to
administer the desired maintenance dose and minimize or eliminate
an injection site reaction in a subject.
[0213] In certain embodiments, doses, dose frequency, and duration
of the maintenance phase may be selected to achieve a desired
effect. In certain embodiments, those variables are adjusted to
result in a desired concentration of pharmaceutical agent in a
subject. For example, in certain embodiments, dose and dose
frequency are adjusted to provide plasma concentration of a
pharmaceutical agent of the present invention at an amount
sufficient to achieve a desired effect. In certain of such
embodiments the plasma concentration is maintained above the
minimal effective concentration (MEC). In certain embodiments,
pharmaceutical compositions of the present invention are
administered with a dosage regimen designed to maintain a
concentration above the MEC for 10-90% of the time, between 30-90%
of the time, or between 50-90% of the time.
[0214] In certain embodiments, doses, dose frequency, and duration
of the maintenance phase may be selected to achieve a desired
plasma trough concentration of a pharmaceutical composition. In
certain such embodiments, the pharmaceutical composition is an
oligonucleotide. In certain such embodiments, the desired plasma
trough concentration is from 5-100 ng/mL. In certain such
embodiments, the desired plasma trough concentration is from 5-50
ng/mL. In certain such embodiments, the desired plasma trough
concentration is from 10-40 ng/mL. In certain such embodiments, the
desired plasma trough concentration is from 15-35 ng/mL. In certain
such embodiments, the desired plasma trough concentration is from
20-30 ng/mL.
[0215] In certain embodiments, doses, dose frequency, and duration
of the maintenance phase may be selected to achieve a desired
safety profile. For example, in certain embodiments, such variables
may be selected to mitigate toxicity of the pharmaceutical
composition. In certain such embodiments, such variables are
selected to mitigate liver toxicity. In certain such embodiments,
such variables are selected to mitigate renal toxicity. In certain
such embodiments, doses increase over time.
[0216] In certain embodiments, doses, dose frequency, and duration
of the maintenance phase may be adjusted from time to time to
achieve a desired effect. In certain embodiments, subjects are
monitored for effects (therapeutic and/or toxic effects) and doses,
dose frequency, and/or duration of the maintenance phase may be
adjusted based on the results of such monitoring.
[0217] It will be recognized by one of ordinary skill in the art
that doses, dose frequency, and duration of the induction phase and
for the maintenance phase may be manipulated independently to
achieve a desired effect. For example, in certain embodiments, the
invention provides dosage regimens listed in Tables 1-6, below. One
of skill in the art will recognize that the variables in the table
can be selected and combined independently. The table is included
solely to illustrate how the variables may be combined and is does
not limit the invention. Moreover, the present invention is not
limited to the variables listed on the table.
[0218] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein an induction dose of 200-400 mg is administered once
per week for at least 8 weeks, followed by a maintenance phase,
wherein a maintenance dose of 100-300 mg is administered at
intervals ranging from one per week to once per three months, for
as long as needed to sustain the desired effect. In certain
embodiments the induction dose is administered once per week for
8-20 weeks. In certain embodiments the induction dose is
administered once per week for 10-15 weeks. In certain embodiments,
the induction dose is administered once per week for at least 12
weeks. In certain embodiments the induction dose is administered
once per week for at least 14 weeks. In certain embodiments the
induction dose is administered once per week for at least 16 weeks.
In certain such embodiments, the induction dose is 200 mg. In
certain such embodiments, the induction dose is 300 mg. In certain
such embodiments, the induction dose is 400 mg. In certain such
embodiments, the maintenance dose ranges from 200-300 mg. In
certain such embodiments, the maintenance dose is 150 mg. In
certain such embodiments, the maintenance dose is 200 mg. In
certain such embodiments, the maintenance dose is 250 mg. In
certain such embodiments, the maintenance dose is 300 mg. In
certain such embodiments, the maintenance dose is administered once
per week. In certain such embodiments, the maintenance dose is
administered once per month. In certain such embodiments, the
maintenance dose is administered once per three months. In certain
such embodiments, the maintenance dose is administered for at least
6 months. In certain such embodiments, the maintenance dose is
administered for at least one year. In certain such embodiments,
the maintenance dose is administered for up to five years. In
certain such embodiments the maintenance dose is administered for
up to ten years. In certain such embodiments the maintenance dose
is administered for as long as is necessary to sustain the desired
effect. In certain such embodiments, the frequency of
administration of the maintenance dose is adjusted to achieved
desired efficacy and/or desired safety profile. In certain such
embodiments, the frequency of the maintenance dose is adjusted to
achieve a desired plasma trough concentration of oligonucleotide.
In certain such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 15-40 ng/mL. In certain
such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 20-30 ng/mL. In certain
such embodiments, the desired effect is selected from reduced ApoB,
reduced LDL-C, reduced VLDL-C, reduced IDL-C, reduced non-HDL-C,
reduced serum triglycerides, reduced liver triglycerides, reduced
Lp(a), reduced Ox-LDL-C, and reduced small dense LDL particles. In
certain such embodiments, the subject has polygenic
hypercholesterolemia. In certain such embodiments, the subject has
familial hypercholesterolemia. In certain such embodiments, the
subject has homozygous familial hypercholesterolemia. In certain
such embodiments, the subject has heterozygous familial
hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 1.
TABLE-US-00001 TABLE 1 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 300 mg Once/week 8-20 weeks 150 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 300 mg Once/week
8-20 weeks 200 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years 300 mg Once/week 8-20 weeks 250 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 300 mg Once/week
12-16 weeks 150 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years 300 mg Once/week 12-16 weeks 200 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 300 mg Once/week
12-16 weeks 250 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years
[0219] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a 200 mg dose is administered once per week for 13
weeks, followed by a maintenance phase, wherein a dose ranging from
80-200 mg is administered at intervals ranging from once per week
to once per three months, for as long as needed to sustain the
desired effect. In certain such embodiments, the maintenance dose
ranges from 100-150 mg. In certain such embodiments, the
maintenance dose is 100 mg. In certain such embodiments, the
maintenance dose is 125 mg. In certain such embodiments, the
maintenance dose is 140 mg. In certain such embodiments, the
maintenance dose is 150 mg. In certain such embodiments, the
maintenance dose is 175 mg. In certain such embodiments, the
maintenance dose is 180 mg. In certain such embodiments, the
maintenance dose is 200 mg. In certain such embodiments, the
maintenance dose is administered once per week. In certain such
embodiments, the maintenance dose is administered once per month.
In certain such embodiments, the maintenance dose is administered
once per three months. In certain such embodiments, the maintenance
dose is administered for at least 6 months. In certain such
embodiments, the maintenance dose is administered for at least one
year. In certain such embodiments, the maintenance dose is
administered for up to five years. In certain such embodiments the
maintenance dose is administered for up to ten years. In certain
such embodiments the maintenance dose is administered for as long
as is necessary to sustain the desired effect. In certain such
embodiments, the frequency of administration of the maintenance
dose is adjusted to achieved desired efficacy and/or desired safety
profile. In certain such embodiments, the frequency of the
maintenance dose is adjusted to achieve a desired plasma trough
concentration of oligonucleotide. In certain such embodiments, the
plasma trough concentration of the administered antisense
oligonucleotide is 15-40 ng/mL. In certain such embodiments, the
plasma trough concentration of the administered antisense
oligonucleotide is 20-30 ng/mL. In certain such embodiments, the
desired effect is selected from reduced ApoB, reduced LDL-C,
reduced VLDL-C, reduced IDL-C, reduced non-HDL-C, reduced serum
triglycerides, reduced liver triglycerides, reduced Lp(a), reduced
Ox-LDL-C, and reduced small dense LDL particles. In certain such
embodiments, the subject has polygenic hypercholesterolemia. In
certain such embodiments, the subject has familial
hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 2.
TABLE-US-00002 TABLE 2 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 200 mg Once/week 13 weeks 80 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 200 mg Once/week 13
weeks 100 mg Once/week At least 6 months Once/two weeks At least
one year Once/three weeks At least two years Once/month At least
five years Once/two months Up to five years Once/three months Up to
ten years 200 mg Once/week 13 weeks 125 mg Once/week At least 6
months Once/two weeks At least one year Once/three weeks At least
two years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 200 mg Once/week 13 weeks
140 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
200 mg Once/week 13 weeks 150 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 200 mg Once/week 13 weeks
175 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
200 mg Once/week 13 weeks 180 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 200 mg Once/week 13 weeks
200 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten
years
[0220] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a 300 mg dose is administered once per week for 13
weeks, followed by a maintenance phase, wherein a dose ranging from
100-250 mg is administered at intervals ranging from once per week
to once per three months, for as long as needed to sustain the
desired effect. In certain such embodiments, the maintenance dose
is 100 mg. In certain such embodiments, the maintenance dose is 125
mg. In certain such embodiments, the maintenance dose is 150 mg. In
certain such embodiments, the maintenance dose is 175 mg. In
certain such embodiments, the maintenance dose is 200 mg. In
certain such embodiments, the maintenance dose is 250 mg. In
certain such embodiments, the maintenance dose is administered once
per week. In certain such embodiments, the maintenance dose is
administered once per month. In certain such embodiments, the
maintenance dose is administered once per three months. In certain
such embodiments, the maintenance dose is administered for at least
6 months. In certain such embodiments, the maintenance dose is
administered for at least one year. In certain such embodiments,
the maintenance dose is administered for up to five years. In
certain such embodiments the maintenance dose is administered for
up to ten years. In certain such embodiments the maintenance dose
is administered for as long as is necessary to sustain the desired
effect. In certain such embodiments, the frequency of
administration of the maintenance dose is adjusted to achieved
desired efficacy and/or desired safety profile. In certain such
embodiments, the frequency of the maintenance dose is adjusted to
achieve a desired plasma trough concentration of oligonucleotide.
In certain such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 15-40 ng/mL. In certain
such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 20-30 ng/mL. In certain
such embodiments, plasma trough concentration of the administered
antisense oligonucleotide is 15-40 ng/mL. In certain such
embodiments, the plasma trough concentration of the administered
antisense oligonucleotide is 20-30 ng/mL. In certain such
embodiments, the desired effect is selected from reduced ApoB,
reduced LDL-C, reduced VLDL-C, reduced IDL-C, reduced non-HDL-C,
reduced serum triglycerides, reduced liver triglycerides, reduced
Lp(a), reduced Ox-LDL-C, and reduced small dense LDL particles. In
certain such embodiments, the subject has polygenic
hypercholesterolemia. In certain such embodiments, the subject has
familial hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 3.
TABLE-US-00003 TABLE 3 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 300 mg Once/week 13 weeks 100 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 300 mg Once/week 13
weeks 125 mg Once/week At least 6 months Once/two weeks At least
one year Once/three weeks At least two years Once/month At least
five years Once/two months Up to five years Once/three months Up to
ten years 300 mg Once/week 13 weeks 150 mg Once/week At least 6
months Once/two weeks At least one year Once/three weeks At least
two years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 300 mg Once/week 13 weeks
200 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
300 mg Once/week 13 weeks 250 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years
[0221] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a 100 mg dose is administered once per week for 13
weeks, followed by a maintenance phase, wherein a dose ranging from
100-300 mg is administered at intervals ranging from once per week
to once per three months, for as long as needed to sustain the
desired effect. In certain such embodiments, the dose ranges from
150-250 mg. In certain such embodiments, the maintenance dose is
100 mg. In certain such embodiments, the maintenance dose is 125
mg. In certain such embodiments, the maintenance dose is 150 mg. In
certain such embodiments, the maintenance dose is 175 mg. In
certain such embodiments, the maintenance dose is 200 mg. In
certain such embodiments, the maintenance dose is 225 mg. In
certain such embodiments, the maintenance dose is 250 mg. In
certain such embodiments, the maintenance dose is 275 mg. In
certain such embodiments, the maintenance dose is 300 mg. In
certain such embodiments, the maintenance dose is administered once
per week. In certain such embodiments, the maintenance dose is
administered once per month. In certain such embodiments, the
maintenance dose is administered once per three months. In certain
such embodiments, the maintenance dose is administered for at least
6 months. In certain such embodiments, the maintenance dose is
administered for at least one year. In certain such embodiments,
the maintenance dose is administered for up to five years. In
certain such embodiments the maintenance dose is administered for
up to ten years. In certain such embodiments the maintenance dose
is administered for as long as is necessary to sustain the desired
effect. In certain such embodiments, the frequency of
administration of the maintenance dose is adjusted to achieved
desired efficacy and/or desired safety profile. In certain such
embodiments, the frequency of the maintenance dose is adjusted to
achieve a desired plasma trough concentration of oligonucleotide.
In certain such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 15-40 ng/mL. In certain
such embodiments, the plasma trough concentration of the
administered antisense oligonucleotide is 20-30 ng/mL. In certain
such embodiments, the desired effect is selected from reduced ApoB,
reduced LDL-C, reduced VLDL-C, reduced IDL-C, reduced non-HDL-C,
reduced serum triglycerides, reduced liver triglycerides, reduced
Lp(a), reduced Ox-LDL-C, and reduced small dense LDL particles. In
certain such embodiments, the subject has polygenic
hypercholesterolemia. In certain such embodiments, the subject has
familial hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 4.
TABLE-US-00004 TABLE 4 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 100 mg Once/week 13 weeks 100 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 100 mg Once/week 13
weeks 125 mg Once/week At least 6 months Once/two weeks At least
one year Once/three weeks At least two years Once/month At least
five years Once/two months Up to five years Once/three months Up to
ten years 100 mg Once/week 13 weeks 150 mg Once/week At least 6
months Once/two weeks At least one year Once/three weeks At least
two years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 100 mg Once/week 13 weeks
175 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
100 mg Once/week 13 weeks 200 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 100 mg Once/week 13 weeks
225 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
100 mg Once/week 13 weeks 250 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 100 mg Once/week 13 weeks
275 mg Once/week At least 6 months Once/two weeks At least one year
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
100 mg Once/week 13 weeks 300 mg Once/week At least 6 months
Once/two weeks At least one year Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years
[0222] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a dose ranging from 100-200 mg is administered once
per week for 13 weeks, followed by a maintenance phase, wherein a
dose ranging from 100-300 mg is administered at intervals ranging
from once per week to once per three months, for as long as needed
to sustain the desired effect. In certain such embodiments, the
induction dose is 100 mg. In certain such embodiments, the
induction dose is 125 mg. In certain such embodiments, the
induction dose is 150 mg. In certain such embodiments, the
induction dose is 175 mg. In certain such embodiments, the
induction dose is 200 mg. In certain such embodiments, an during an
induction phase four doses of 100 mg are followed by five doses of
150 mg which are followed by four doses of 200 mg. In certain such
embodiments during an induction phase four doses of 100 mg are
followed by four doses of 150 mg which are followed by five doses
of 200 mg. In certain such embodiments five doses of 100 mg are
followed by four doses of 150 mg which are followed by four doses
of 200 mg. In certain such embodiments, the maintenance dose is
higher than the induction dose. In certain such embodiments, the
maintenance dose is 100 mg. In certain such embodiments, the
maintenance dose is 125 mg. In certain such embodiments, the
maintenance dose is 150 mg. In certain such embodiments, the
maintenance dose is 175 mg. In certain such embodiments, the
maintenance dose is 200 mg. In certain such embodiments, the
maintenance dose is 225 mg. In certain such embodiments, the
maintenance dose is 250 mg. In certain such embodiments, the
maintenance dose is 275 mg. In certain such embodiments, the
maintenance dose is 300 mg. In certain such embodiments, the
maintenance dose is administered once per week. In certain such
embodiments, the maintenance dose is administered once per month.
In certain such embodiments, the maintenance dose is administered
once per three months. In certain such embodiments, the maintenance
dose is administered for at least 6 months. In certain such
embodiments, the maintenance dose is administered for at least one
year. In certain such embodiments, the maintenance dose is
administered for up to five years. In certain such embodiments the
maintenance dose is administered for up to ten years. In certain
such embodiments the maintenance dose is administered for as long
as is necessary to sustain the desired effect. In certain such
embodiments, the amount or frequency of the induction dose is
adjusted to achieve desired efficacy and/or desired safety profile.
In certain such embodiments, the amount or frequency of the
induction dose is adjusted to achieve a desired plasma trough
concentration of antisense oligonucleotide. In certain such
embodiments, the plasma trough concentration of the administered
antisense oligonucleotide is 15-40 ng/mL. In certain such
embodiments, the plasma trough concentration of the administered
antisense oligonucleotide is 20-30 ng/mL. In certain such
embodiments, the amount or frequency of administration of the
maintenance dose is adjusted to achieved desired efficacy and/or
desired safety profile. In certain such embodiments, the frequency
of the maintenance dose is adjusted to achieve a desired plasma
trough concentration of oligonucleotide. In certain such
embodiments, the plasma trough concentration of the administered
antisense oligonucleotide is 15-40 ng/mL. In certain such
embodiments, the plasma trough concentration of the administered
antisense oligonucleotide is 20-30 ng/mL. In certain such
embodiments, the desired effect is selected from reduced ApoB,
reduced LDL-C, reduced VLDL-C, reduced IDL-C, reduced non-HDL-C,
reduced serum triglycerides, reduced liver triglycerides, reduced
Lp(a), reduced Ox-LDL-C, and reduced small dense LDL particles. In
certain such embodiments, the subject has polygenic
hypercholesterolemia. In certain such embodiments, the subject has
familial hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 5.
TABLE-US-00005 TABLE 5 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 100 mg Once/week, 4-5 weeks 13 weeks 150 mg
Once/week At least 6 months 150 mg Once/week, 4-5 weeks total
Once/two weeks At least one year 200 mg Once/week, 4-5 weeks
Once/three weeks At least two years Once/month At least five years
Once/two months Up to five years Once/three months Up to ten years
100 mg Once/week, 4-5 weeks 13 weeks 175 mg Once/week At least 6
months 150 mg Once/week, 4-5 weeks total Once/two weeks At least
one year 200 mg Once/week, 4-5 weeks Once/three weeks At least two
years Once/month At least five years Once/two months Up to five
years Once/three months Up to ten years 100 mg Once/week, 4-5 weeks
13 weeks 200 mg Once/week At least 6 months 150 mg Once/week, 4-5
weeks total Once/two weeks At least one year 200 mg Once/week, 4-5
weeks Once/three weeks At least two years Once/month At least five
years Once/two months Up to five years Once/three months Up to ten
years 100 mg Once/week, 4-5 weeks 13 weeks 225 mg Once/week At
least 6 months 150 mg Once/week, 4-5 weeks total Once/two weeks At
least one year 200 mg Once/week, 4-5 weeks Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years
[0223] In certain embodiments, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a dose of 100 mg is administered once per week for
14-20 weeks, followed by a maintenance phase, wherein a dose
ranging from 100-300 mg is administered at a frequency ranging from
once per week to once per three months, for as long as needed to
sustain the desired effect. In certain such embodiments, the
induction phase is 16-20 weeks. In certain such embodiments, the
duration of the induction phase is 14 weeks. In certain such
embodiments, the duration of the induction phase is 15 weeks. In
certain such embodiments, the duration of the induction phase is 16
weeks. In certain such embodiments, the duration of the induction
phase is 17 weeks. In certain such embodiments, the duration of the
induction phase is 18 weeks. In certain such embodiments, the
duration of the induction phase is 19 weeks. In certain such
embodiments, the duration of the induction phase is 20 weeks. In
certain such embodiments, the maintenance dose is higher than the
induction dose. In certain such embodiments, the maintenance dose
ranges from 100-300 mg. In certain such embodiments, the
maintenance dose ranges from 100-200 mg. In certain such
embodiments, the maintenance dose is 100 mg. In certain such
embodiments, the maintenance dose is 125 mg. In certain such
embodiments, the maintenance dose is 150 mg. In certain such
embodiments, the maintenance dose is 175 mg. In certain such
embodiments, the maintenance dose is 200 mg. In certain such
embodiments, the maintenance dose is 225 mg. In certain such
embodiments, the maintenance dose is 250 mg. In certain such
embodiments, the maintenance dose is 275 mg. In certain such
embodiments, the maintenance dose is 300 mg. In certain such
embodiments, the maintenance dose is administered once per week. In
certain such embodiments, the maintenance dose is administered once
per month. In certain such embodiments, the maintenance dose is
administered once per three months. In certain such embodiments,
the maintenance dose is administered for at least 6 months. In
certain such embodiments, the maintenance dose is administered for
at least one year. In certain such embodiments, the maintenance
dose is administered for up to five years. In certain such
embodiments the maintenance dose is administered for up to ten
years. In certain such embodiments the maintenance dose is
administered for as long as is necessary to sustain the desired
effect. In certain such embodiments, the frequency of
administration of the maintenance dose is adjusted to achieved
desired efficacy and/or desired safety profile. In certain such
embodiments, the desired effect is selected from reduced ApoB,
reduced LDL-C, reduced VLDL-C, reduced IDL-C, reduced non-HDL-C,
reduced serum triglycerides, reduced liver triglycerides, reduced
Lp(a), reduced Ox-LDL-C, and reduced small dense LDL particles. In
certain such embodiments, the subject has polygenic
hypercholesterolemia. In certain such embodiments, the subject has
familial hypercholesterolemia. In certain such embodiments, the
pharmaceutical composition is co-administered with a statin. In
certain such embodiments, the subject is intolerant to statins. In
certain such embodiments, the subject is not meeting LDL-C target
on current therapy. Non-limiting examples of certain dosing
regimens are illustrated in Table 6.
TABLE-US-00006 TABLE 6 Certain Dosing Regimens Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 100 mg Once/week 14-20 weeks 100 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 100 mg Once/week
14-20 weeks 125 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years 100 mg Once/week 14-20 weeks 150 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 100 mg Once/week
14-20 weeks 175 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years 100 mg Once/week 14-20 weeks 200 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 100 mg Once/week
14-20 weeks 225 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years 100 mg Once/week 14-20 weeks 275 mg Once/week At
least 6 months Once/two weeks At least one year Once/three weeks At
least two years Once/month At least five years Once/two months Up
to five years Once/three months Up to ten years 100 mg Once/week
14-20 weeks 300 mg Once/week At least 6 months Once/two weeks At
least one year Once/three weeks At least two years Once/month At
least five years Once/two months Up to five years Once/three months
Up to ten years
[0224] In a particular embodiment, a method of administering a
pharmaceutical composition to a subject comprises an induction
phase, wherein a dose ranging from 100-300 mg is administered once
per week for 13 weeks, followed by a maintenance phase, wherein a
dose ranging from 80-200 mg is administered once per week for as
long as needed, effective, and/or tolerated. In certain of such
embodiments, the pharmaceutical composition is administered
subcutaneously during the induction phase and/or the maintenance
phase. In certain of such embodiments, the subject is afflicted
with familial hypercholesterolemia (either heterozygous or
homozygous), non-familial hypercholesterolemia, or polygenic
hypercholesterolemia. In certain of such embodiments, the
maintenance phase lasts from one day to the end of the subject's
lifetime or any fraction thereof as discussed above. In certain of
such embodiments, the induction dose is 100 mg, and the maintenance
dose is 80 mg, 100 mg, 140 mg, 180 mg, or 200 mg. In certain of
such embodiments, the induction dose is 200 mg, and the maintenance
dose is 80 mg, 100 mg, 140 mg, 180 mg, or 200 mg. In certain of
such embodiments, the induction dose is 300 mg, and the maintenance
dose is 80 mg, 100 mg, 140 mg, 180 mg, or 200 mg.
[0225] In certain of such embodiments, the administration at the
end of the induction phase achieves a reduction in plasma
concentration of ApoB of from about -28% to -65%. In certain of
such embodiments, the administration after 13 weeks of the
maintenance phase achieves a reduction in plasma concentration of
ApoB of from about -32% to -48%, from about -35% to about -52%,
from about -40% to about -60%, from about -43% to about -65%, or
from about -45% to about -67%. In certain of such embodiments, the
administration at the end of the induction phase achieves a
reduction in plasma concentration of LDL-Col from about -26% to
-60%. In certain of such embodiments, the administration after 13
weeks of the maintenance phase achieves a reduction in plasma
concentration of LDL-Col from about -29% to -44%, from about -32%
to about -48%, from about -37% to about -55%, from about -40% to
about -61%, or from about -42% to about -63%.
[0226] In certain of such embodiments, the administration at the
end of the induction phase achieves a plasma trough concentration
of an oligonucleotide administered as part of the pharmaceutical
composition of from about 11 to 38 ng/mL. In certain of such
embodiments, the administration after 13 weeks of the maintenance
phase achieves a plasma trough concentration of an oligonucleotide
administered as part of the pharmaceutical composition of from
about 7 to 27 ng/mL, from about 8 to 31 ng/mL, from about 11 to 38
ng/mL, from about 13 to 46 ng/mL, or from about 14 to 50 ng/mL. In
certain of such embodiments, the administration at the end of the
induction phase achieves a liver concentration of an
oligonucleotide administered as part of the pharmaceutical
composition of from about 55 to 190 .mu.g/G. In certain of such
embodiments, the administration after 13 weeks of the maintenance
phase achieves a liver concentration of an oligonucleotide
administered as part of the pharmaceutical composition of from
about 38 to 133 .mu.g/G, from about 44 to 152 .mu.g/G, from about
55 to 190 .mu.g/G, from about 66 to 228 .mu.g/G, or from about 7 to
247 .mu.g/G.
[0227] In certain of such embodiments, the administration at the
end of the induction phase achieves a reduction in plasma
concentration of ApoB of from about -34% to -77%. In certain of
such embodiments, the administration after 13 weeks of the
maintenance phase achieves a reduction in plasma concentration of
ApoB of from about -38% to -58%, from about -43% to about -65%,
from about -47% to about -70%, or from about -49% to about -74%. In
certain of such embodiments, the administration at the end of the
induction phase achieves a reduction in plasma concentration of
LDL-Col from about -31% to -73%. In certain of such embodiments,
the administration after 13 weeks of the maintenance phase achieves
a reduction in plasma concentration of LDL-Col from about -35% to
-54%, from about -40% to about -61%, from about -44% to about -66%,
or from about -46% to about -70%.
[0228] In certain of such embodiments, the administration at the
end of the induction phase achieves a plasma trough concentration
of an oligonucleotide administered as part of the pharmaceutical
composition of from about 16 to 57 ng/mL. In certain of such
embodiments, the administration after 13 weeks of the maintenance
phase achieves a plasma trough concentration of an oligonucleotide
administered as part of the pharmaceutical composition of from
about 10 to 37 ng/mL, from about 13 to 46 ng/mL, from about 16 to
55 ng/mL, or from about 18 to 65 ng/mL. In certain of such
embodiments, the administration at the end of the induction phase
achieves a liver concentration of an oligonucleotide administered
as part of the pharmaceutical composition of from about 82 to 285
.mu.g/G. In certain of such embodiments, the administration after
13 weeks of the maintenance phase achieves a liver concentration of
an oligonucleotide administered as part of the pharmaceutical
composition of from about 52 to 181 .mu.g/G, from about 66 to 228
.mu.g/G, from about 80 to 276 .mu.g/G, or from about 94 to 323
.mu.g/G.
[0229] In another particular embodiment, a method of administering
a pharmaceutical composition to a subject comprises an induction
phase, wherein a dose ranging from 100-300 mg is administered once
per week for 13 weeks, followed by a maintenance phase, wherein a
dose ranging from 100-200 mg is administered once per week for as
long as needed, effective, and/or tolerated, wherein the efficacy
and/or the tolerability of the antisense oligonucleotide is
monitored during the induction phase, the maintenance phase, or
both, or any portion thereof. In certain of such embodiments, the
pharmaceutical composition is administered subcutaneously during
the induction phase and/or the maintenance phase. In certain of
such embodiments, the subject is afflicted with familial
hypercholesterolemia (either heterozygous or homozygous),
non-familial hypercholesterolemia, or polygenic
hypercholesterolemia. In certain of such embodiments, the
maintenance phase lasts from one day to the end of the subject's
lifetime or any fraction thereof as discussed above.
[0230] In certain of such embodiments, the rate of reduction in the
plasma concentration of ApoB is monitored during the induction
and/or maintenance phases. In certain of such embodiments, the
plasma concentration of ApoB is monitored during the induction
and/or maintenance phases. In certain embodiments, if the rate of
reduction in the plasma concentration of ApoB exceeds 30 mg/dL*day,
the dose of pharmaceutical composition is altered, e.g., reduced.
In certain embodiments, if the rate of reduction in the plasma
concentration of ApoB exceeds 30 mg/dL*day, the frequency of
administration of pharmaceutical composition is altered, e.g.,
reduced. In certain embodiments, if the plasma concentration of
ApoB falls below about 50 mg/dL, the dose of pharmaceutical
composition is altered, e.g., reduced. In certain embodiments, if
the plasma concentration of ApoB falls below about 50 mg/dL, the
frequency of administration of pharmaceutical composition is
altered, e.g., reduced. In certain embodiments, if the plasma
concentration of ApoB falls below about 60 mg/dL, the dose of
pharmaceutical composition is altered, e.g., reduced. In certain
embodiments, if the plasma concentration of ApoB falls below about
60 mg/dL, the frequency of administration of pharmaceutical
composition is altered, e.g., reduced.
[0231] In certain embodiments, if the rate of reduction in the
plasma concentration of ApoB exceeds 30 mg/dL*day and the plasma
concentration of ApoB falls below about 50 mg/dL, the dose of
pharmaceutical composition is altered, e.g., reduced. In certain
embodiments, if the rate of reduction in the plasma concentration
of ApoB exceeds 30 mg/dL*day and the plasma concentration of ApoB
falls below about 50 mg/dL, the frequency of administration of
pharmaceutical composition is altered, e.g., reduced. In certain
embodiments, if the rate of reduction in the plasma concentration
of ApoB exceeds 30 mg/dL*day and the plasma concentration of ApoB
falls below about 60 mg/dL, the dose of pharmaceutical composition
is altered, e.g., reduced. In certain embodiments, if the rate of
reduction in the plasma concentration of ApoB exceeds 30 mg/dL*day
and the plasma concentration of ApoB falls below about 60 mg/dL,
the frequency of administration of pharmaceutical composition is
altered, e.g., reduced.
[0232] In another particular embodiment, a method of administering
a pharmaceutical composition to a subject comprises an induction
phase, wherein a dose ranging from 100 to 200 mg is administered
once per week for 13 weeks, and a maintenance phase, wherein a dose
ranging from 200 to 300 mg is administered once per week for as
long as needed, effective, and/or tolerated, wherein the
tolerability and/or efficacy of the pharmaceutical composition is
assessed during or at the end of the induction phase, or any
portion thereof. In certain of such embodiments, the dose of the
maintenance phase is increased relative to the dose of the
maintenance phase if the dose of the induction phase is
well-tolerated and treatment goals are not met. In certain of such
embodiments, the pharmaceutical composition is administered
subcutaneously during the induction phase and/or the maintenance
phase. In certain of such embodiments, the subject is afflicted
with familial hypercholesterolemia (either heterozygous or
homozygous), non-familial hypercholesterolemia, or polygenic
hypercholesterolemia. In certain of such embodiments, the
maintenance phase lasts from one day to the end of the subject's
lifetime or any fraction thereof as discussed above. In certain of
such embodiments, the induction dose is 100 mg, and the maintenance
dose is 200 mg. In certain of such embodiments, the induction dose
is 200 mg, and the maintenance dose is 300 mg. In certain
embodiments, the treatment goals are assessed by monitoring plasma
concentration of ApoB, LDL-C, VLDL-C, non-HDL-C, HDL-C, ApoA1,
total cholesterol, triglycerides, and Lp(a). In certain
embodiments, tolerability is assessed by monitoring ALT activity,
AST activity, and plasma bilirubin concentrations.
[0233] In certain of such embodiments, the administration at the
end of the induction phase achieves a reduction in plasma
concentration of ApoB of from about -17% to -40%. In certain of
such embodiments, the administration after 26 weeks of the
maintenance phase achieves a reduction in plasma concentration of
ApoB of from about -42% to -63%. In certain of such embodiments,
the administration at the end of the induction phase achieves a
reduction in plasma concentration of LDL-Col from about -14% to
-35%. In certain of such embodiments, the administration after 13
weeks of the maintenance phase achieves a reduction in plasma
concentration of LDL-Col from about -39% to -60%.
[0234] In certain of such embodiments, the administration at the
end of the induction phase achieves a plasma trough concentration
of an oligonucleotide administered as part of the pharmaceutical
composition of from about 5 to 19 ng/mL. In certain of such
embodiments, the administration after 26 weeks of the maintenance
phase achieves a plasma trough concentration of an oligonucleotide
administered as part of the pharmaceutical composition of from
about 12 to 44 ng/mL. In certain of such embodiments, the
administration at the end of the induction phase achieves a liver
concentration of an oligonucleotide administered as part of the
pharmaceutical composition of from about 27 to 95 .mu.g/G. In
certain of such embodiments, the administration after 26 weeks of
the maintenance phase achieves a liver concentration of an
oligonucleotide administered as part of the pharmaceutical
composition of from about 63 to 220 .mu.g/G.
[0235] In another particular embodiment, a method of administering
a pharmaceutical composition to a subject comprises an induction
phase, wherein a dose ranging from 100 to 200 mg is administered
once per week for 13 weeks, and a maintenance phase, wherein a dose
ranging from 200 to 300 mg is administered once every one or two
weeks for as long as needed, effective, and/or tolerated, wherein
the tolerability and/or efficacy of the pharmaceutical composition
is assessed during or at the end of the induction phase, or any
portion thereof. In certain of such embodiments, the frequency of
administration of dose during the maintenance phase is reduced
relative if the dose of the induction phase is not well-tolerated
and/or treatment goals are met. In certain of such embodiments, the
pharmaceutical composition is administered subcutaneously during
the induction phase and/or the maintenance phase. In certain of
such embodiments, the subject is afflicted with familial
hypercholesterolemia (either heterozygous or homozygous),
non-familial hypercholesterolemia, or polygenic
hypercholesterolemia. In certain of such embodiments, the
maintenance phase lasts from one day to the end of the subject's
lifetime or any fraction thereof as discussed above. In certain of
such embodiments, the induction dose is 100 mg, and the maintenance
dose is 200 mg. In certain of such embodiments, the induction dose
is 200 mg, and the maintenance dose is 300 mg. In certain
embodiments, the treatment goals are assessed by monitoring plasma
concentration of ApoB, LDL-C, VLDL-C, non-HDL-C, HDL-C, ApoA1,
total cholesterol, triglycerides, and Lp(a). In certain
embodiments, tolerability is assessed by monitoring ALT levels, AST
levels, plasma bilirubin concentrations or total bilirubin.
D. CERTAIN COMBINATION THERAPIES
[0236] In certain embodiments, one or more pharmaceutical
compositions of the present invention are co-administered with one
or more other pharmaceutical agents. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat the
same disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat a
different disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat an
undesired effect of one or more pharmaceutical compositions of the
present invention. In certain embodiments, one or more
pharmaceutical compositions of the present invention are
co-administered with another pharmaceutical agent to treat an
undesired effect of that other pharmaceutical agent. In certain
embodiments, one or more pharmaceutical compositions of the present
invention and one or more other pharmaceutical agents are
administered at the same time. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared together in a single
formulation. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared separately.
[0237] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include lipid-lowering agents. In certain such
embodiments, pharmaceutical agents that may be co-administered with
a pharmaceutical composition of the present invention include, but
are not limited to atorvastatin, simvastatin, rosuvastatin, and
ezetimibe. In certain such embodiments, the lipid-lowering agent is
administered prior to administration of a pharmaceutical
composition of the present invention. In certain such embodiments,
the lipid-lowering agent is administered following administration
of a pharmaceutical composition of the present invention. In
certain such embodiments the lipid-lowering agent is administered
at the same time as a pharmaceutical composition of the present
invention. In certain such embodiments the dose of a
co-administered lipid-lowering agent is the same as the dose that
would be administered if the lipid-lowering agent was administered
alone. In certain such embodiments the dose of a co-administered
lipid-lowering agent is lower than the dose that would be
administered if the lipid-lowering agent was administered alone. In
certain such embodiments the dose of a co-administered
lipid-lowering agent is greater than the dose that would be
administered if the lipid-lowering agent was administered
alone.
[0238] In certain embodiments, a co-administered lipid-lowering
agent is a HMG-CoA reductase inhibitor. In certain such embodiments
the HMG-CoA reductase inhibitor is a statin. In certain such
embodiments the statin is selected from atorvastatin, simvastatin,
pravastatin, fluvastatin, and rosuvastatin.
[0239] In certain embodiments, a co-administered lipid-lowering
agent is a cholesterol absorption inhibitor. In certain such
embodiments, cholesterol absorption inhibitor is ezetimibe.
[0240] In certain embodiments, a co-administered lipid-lowering
agent is a co-formulated HMG-CoA reductase inhibitor and
cholesterol absorption inhibitor. In certain such embodiments the
co-formulated lipid-lowering agent is ezetimibe/simvastatin.
[0241] In certain embodiments, a co-administered lipid-lowering
agent is a microsomal triglyceride transfer protein inhibitor.
[0242] In certain embodiments, a co-administered lipid-lowering
agent is an oligonucleotide selected from an oligonucleotide
targeted to PCSK9, an oligonucleotide targeted to ACAT-2, an
oligonucleotide targeted to endothelial lipase, and an
oligonucleotide targeted to CETP.
[0243] In certain embodiments, a co-administered pharmaceutical
agent is a bile acid sequestrant. In certain such embodiments, the
bile acid sequestrant is selected from cholestyramine, colestipol,
and colesevelam.
[0244] In certain embodiments, a co-administered pharmaceutical
agent is a nicotinic acid. In certain such embodiments, the
nicotinic acid is selected from immediate release nicotinic acid,
extended release nicotinic acid, and sustained release nicotinic
acid.
[0245] In certain embodiments, a co-administered pharmaceutical
agent is a fibric acid. In certain such embodiments, a fibric acid
is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate,
and ciprofibrate.
[0246] Further examples of pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include, but are not limited to, corticosteroids,
including but not limited to prednisone; immunoglobulins,
including, but not limited to intravenous immunoglobulin (IVIg);
analgesics (e.g., acetaminophen); anti-inflammatory agents,
including, but not limited to non-steroidal anti-inflammatory drugs
(e.g., ibuprofen, COX-1 inhibitors, and COX-2, inhibitors);
salicylates; antibiotics; antivirals; antifungal agents;
antidiabetic agents (e.g., biguanides, glucosidase inhibitors,
insulins, sulfonylureas, and thiazolidenediones); adrenergic
modifiers; diuretics; hormones (e.g., anabolic steroids, androgen,
estrogen, calcitonin, progestin, somatostan, and thyroid hormones);
immunomodulators; muscle relaxants; antihistamines; osteoporosis
agents (e.g., biphosphonates, calcitonin, and estrogens);
prostaglandins, antineoplastic agents; psychotherapeutic agents;
sedatives; poison oak or poison sumac products; antibodies; and
vaccines.
[0247] In certain embodiments, the pharmaceutical compositions of
the present invention may be administered in conjuction with a
lipid-lowering therapy. In certain such embodiments, a
lipid-lowering therapy is therapeutic lifestyle change. In certain
such embodiments, a lipid-lowering therapy is LDL apheresis.
E. CERTAIN INDICATIONS
[0248] In certain embodiments, the invention provides methods of
treating a subject comprising administering one or more
pharmaceutical agents of the present invention. In certain
embodiments, such subject has hypercholesterolemia, hyperlipidemia,
non-familial hypercholesterolemia, familial hypercholesterolemia,
heterozygous familial hypercholesterolemia, homozygous familial
hypercholesterolemia, coronary heart disease, atherosclerosis,
mixed dyslipidemia, diabetic dyslipidemia. In certain embodiments,
such subject has been identified as having one or more CHD risk
equivalents. In certain embodiments, such subject has been
identified has having major risk factors for coronary heart
disease. In certain embodiments, such subject has been identified
as having one or more CHD risk factors. In certain embodiments,
such subject has been identified being at risk for atherosclerosis.
In certain embodiments, such subject has been identified as having
a history of coronary heart disease. In certain embodiments, such
subject has been identified as having a family history of early
onset coronary heart disease.
[0249] In certain embodiments, the subject has been identified as
having elevated cholesterol. In certain embodiments, the subject
has been identified as in need of lipid lowering therapy. In
certain such embodiments, the subject has been identified as in
need of lipid-lowering therapy according to the guidelines
established by the Adult Treatment Panel III of the National
Cholesterol Education Program (NCEP) in 2001 and modified by the
Coordinating Committee of the NCEP in 2004 (Grundy et al.,
Circulation, 2004, 110, 227-239). In certain such embodiments, the
subject in need of lipid-lowering therapy has LDL-C above 190
mg/dL. In certain such embodiments, the subject in need of
lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such
embodiments the subject in need of lipid-lowering therapy has LDL-C
above 130 mg/dL. In certain such embodiments, the subject in need
of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In
certain such embodiments, the subject in need of lipid-lowering
therapy should maintain LDL-C below 130 mg/dL. In certain such
embodiments, the subject in need of lipid-lowering therapy should
maintain LDL-C below 100 mg/dL. In certain such embodiments the
subject should maintain LDL-C below 70 mg/dL.
[0250] In certain embodiments, the invention provides methods for
reducing ApoB concentration in a subject. In certain embodiments,
the invention provides method for reducing ApoB-containing
lipoprotein concentration in a subject. In certain embodiments, the
invention provides methods for reducing LDL-C concentration in a
subject. In certain embodiments, the invention provides methods for
reducing VLDL-C concentration in a subject. In certain embodiments,
the invention provides methods for reducing IDL-C concentration in
a subject. In certain embodiments, the invention provides methods
for reducing non-HDL-C concentration in a subject. In certain
embodiments, the invention provides methods for reducing Lp(a)
concentration in a subject. In certain embodiments, the invention
provides methods for reducing serum triglyceride concentration in a
subject. In certain embodiments the invention provides methods for
reducing Ox-LDL-C concentration in a subject. In certain such
embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total
cholesterol, non-HDL-C, Lp(a), triglycerides, or Ox-LDL-C is,
independently, selected from at least 10%, at least 15%, at least
20%, at least 25%, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, and at least 100%. In certain such embodiments,
the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol,
non-HDL-C, Lp(a), triglycerides, or Ox-LDL-C is, independently,
selected from at least 20%, at least 30%, at least 40%, at least
50%, at least 60%, and at least 70%. In certain such embodiments,
the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol,
non-HDL-C, Lp(a), triglycerides, or Ox-LDL-C is, independently,
selected from at least 40%, at least 50%, at least 60%, and at
least 70%.
[0251] In certain embodiments, the invention provides method for
raising HDL-C concentration in a subject.
[0252] In certain embodiments, the methods provided by the present
invention do not lower HDL-C. In certain embodiments, the methods
provided by the present invention do not result in accumulation of
lipids in the liver.
[0253] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a subject while reducing side
effects associated with treatment. In certain such embodiments, a
side effect is liver toxicity. In certain such embodiments, a side
effect is abnormal liver function. In certain such embodiments, a
side effect is liver inflammation or other adverse event that
occurs in the liver. In certain such embodiments, a side effect is
elevated alanine aminotransferase (ALT). In certain such
embodiments, a side effect is elevated aspartate aminotransferase
(AST). For example, certain dosing regimens of the present
invention result in effective lowering of ApoB concentration with
less liver toxicity than has been observed from studies employing
different dosing regimens. In certain embodiments, dosing regimens
of the present invention result in effective lowering of ApoB with
less elevation in ALT. In certain such embodiments, the amount of
an induction dose administered is lower than the amount of a
maintenance dose administered.
[0254] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a subject who is not reaching target
LDL-C levels as a result of lipid-lowering therapy. In certain such
embodiments, ISIS 301012 is the only lipid-lowering agent
administered to the subject. In certain such embodiments, the
subject has not complied with recommended lipid-lowering therapy.
In certain such embodiments, a pharmaceutical composition of the
invention is co-administered with an additional different
lipid-lowering therapy. In certain such embodiments, an additional
lipid-lowering therapy is LDL-apheresis. In certain such
embodiments, an additional lipid-lowering therapy is a statin. In
certain such embodiments, an additional lipid-lowering therapy is
ezetimibe.
[0255] In certain embodiments, the invention provides methods for
lowering ApoB concentration in a statin-intolerant subject. In
certain such embodiments, the subject has creatine kinase
concentration increases as a result of statin administration. In
certain such embodiments, the subject has liver function
abnormalities as a result of statin administration. In certain such
embodiments the subject has muscle aches as a result of statin
administration. In certain such embodiments the subject has central
nervous system side effects as a result of statin administration.
In certain embodiments, the subject has not complied with
recommended statin administration.
[0256] In certain embodiments, the invention provides methods for
lowering liver triglycerides in a subject. In certain such
embodiments, the subject has elevated liver triglycerides. In
certain such embodiments, the subject has steatohepatitis. In
certain such embodiments, the subject has steatosis. In certain
such embodiments, liver triglyceride levels are measured by
magnetic resonance imaging.
[0257] In certain embodiments, the invention provides methods for
reducing coronary heart disease risk in a subject. In certain
embodiments the invention provides methods for slowing the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for stopping the
progression of atherosclerosis in a subject. In certain such
embodiments the invention provides methods for reducing the size
and/or prevalence of atherosclerotic plaques in a subject. In
certain embodiments the methods provided reduce a subject's risk of
developing atherosclerosis.
[0258] In certain embodiments the methods provided improve the
cardiovascular outcome in a subject. In certain such embodiments
improved cardiovascular outcome is the reduction of the risk of
developing coronary heart disease. In certain such embodiments,
improved cardiovascular outcome is a reduction in the occurance of
one or more major cardiovascular events, which include, but are not
limited to, death, myocardial infarction, reinfarction, stroke,
cardiogenic shock, pulmonary edema, cardiac arrest, and atrial
dysrhythmia. In certain such embodiments, the improved
cardiovascular outcome is evidenced by improved carotid intimal
media thickness. In certain such embodiments, improved carotid
intimal media thickness is a decrease in thickness. In certain such
embodiments, improved carotid intimal media thickness is a
prevention an increase of intimal media thickness.
Nonlimiting Disclosure and Incorporation by Reference
[0259] While the present invention has been described with
specificity in accordance with certain embodiments, the following
examples serve only to illustrate the invention and are not
intended to limit the same. Each of the references, GenBank
accession numbers, and the like recited in the present application
is incorporated herein by reference in its entirety.
EXAMPLES
Example 1
Subjects
[0260] Three subjects were identified as having homozygous familial
hypercholesterolemia using the following criteria: (1) documented
history of LDL-C above 500 mg/dL in the absence of lipid-lowering
therapy; and (2) at least one of (a) genetic testing confirming 2
mutated LDL-receptor genes; (b) tendinous and/or cutaneous xanthoma
prior to age 10 years; or (c) documentation of elevated LDL-C prior
to lipid-lowering therapy consistent with heterozygous familial
hypercholesterolemia in both parents (if a parent's medical history
was not available, a history of coronary heart disease in a first
degree male relative younger than 55 years old or first degree
female relative younger than 60 years old was used as a criterion
in place of a parent's medical history).
Dose Regimen
[0261] The three subjects received a 300 mg dose of ISIS 301012 on
Days 1, 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85,
as summarized in the table, below. ISIS 301012 was administered
subcutaneously. The four doses on Days 1, 4, 8, and 11 were
administered to achieve estimated ISIS 301012 levels in liver
tissue that are approximately 60-90% of steady-state concentration.
The subjects were monitored for concentrations of ApoB, LDL-C,
VLDL-C, non-HDL-C, HDL-C, ApoA1, total cholesterol, triglycerides,
and Lp(a). Subjects were also monitored to ensure acceptable safety
profiles. The subjects also received one or more lipid-lowering
therapies.
TABLE-US-00007 TABLE 7 Co-administration of ISIS 301012 with one or
more additional lipid-lowering therapies in subjects with
homozygous familial hypercholesterolemia. Induction Phase
Maintenance Phase Doses Dose frequency Duration Doses Dose
Frequency Duration 300 mg Twice/week 2 weeks 300 mg Once/week 11
weeks
Results
[0262] At Day 43, after 9 doses of 301012, both ApoB and LDL-C were
reduced by approximately 30% (n=3) compared to the subject's
concentration at baseline, prior to ISIS 301012 administration.
[0263] At Day 78, after 14 doses of ISIS 301012, (n=2; one subject
had not yet received reached the 14.sup.th dose at time of this
writing) both ApoB and LDL-C were reduced by approximately 50%.
VLDL-C concentration was reduced by approximately 30%. Non-HDL-C
concentration reductions ranged from 32 to 50%. Total cholesterol
concentration reductions ranged from 30% to 46%. Triglyceride
concentration reductions ranged from 29% to 33%. Lp(a)
concentration reductions of 19%, 20%, and 54% were observed. HDL-C
concentration increases of 5%, 7%, and 40% were observed.
[0264] These data demonstrate that ISIS 301012 lowered lipid
concentrations in subjects having familial hypercholesterolemia.
LDL-C reductions in subjects having familial hypercholesterolemia
were observed later during the administration period relative to
LDL-C reductions in subjects having non-familial
hypercholesterolemia, suggesting that a longer induction period in
familial hypercholesterolemic subjects may provide a therapeutic
benefit such subjects. For example, an induction period of at least
8 weeks may provide a therapeutic benefit to subjects having
familial hypercholesterolemia, whereas shorter induction periods or
induction periods with lower doses may be sufficient for subjects
with non-familial hypercholesterolemia
Example 2--Rate and Magnitude of ApoB Reduction with ISIS
301012
[0265] Without being bound to a particular theory, it is believed
that mild increases in ALT levels seen during initial treatment
with ISIS 301012 in dose regimens having a high multi-dose loading
period, reflect extreme lipid lowering activity. Particularly, the
rise in ALT can be attributed to the rate and magnitude of lipid
lowering. An ALT rise can be lessened or prevented by a dosing
regimen that limits the rate and magnitude of ApoB reduction during
the induction or initial dosing period, approximately the first 15
to 90 days of treatment. Thus, for the first time, the rate and
magnitude of ApoB reduction has been correlated with ALT
levels.
Subjects
[0266] Hypercholesterolemics on stable statin therapy. ApoB levels
and ALT levels were determined for the subjects in the trial. Table
8 provides the ApoB levels for individual subjects and resulting
ALT levels.
TABLE-US-00008 TABLE 8 ApoB and ALT Levels for Individual Subjects
Rate of ApoB Min ApoB Max Reduction Concentration ALT Dose Subject
(mg/dL/day) (mg/dL) (U/L) 400 mg on day 5043 2.5 44 130 1, 8, 10,
12, 15, 22 and 29 400 mg on day 5044 1.7 60 175 1, 8, 10, 12, 15,
22 and 29 400 mg on day 5124 2.5 30 125 1, 8, 10, 12, 15, 22 and 29
300 mg on day 4097 3.5 55 190 1, 8, 10, 12, 15, 22 and 29 300 mg on
day 4011 2.8 45 100 1, 8, 10, 12, 15, 22 and 29 300 mg on day 4035
3.5 25 270 1, 8, 10, 12, 15, 22 and 29 200 mg on day 3083 2.3 60
140 1, 8, 10, 12, 15, 22 and 29 200 mg on day 3097 1.8 60 120 1, 8,
10, 12, 15, 22 and 29 200 mg on day 3174 1.8 50 125 1, 8, 10, 12,
15, 22 and 29 30 mg on day 1035 0.5 70 25 1, 8, 10, 12, 15, 22 and
29
Results
[0267] The data provided indicate that increases in ALT levels can
occur when subjects fall below two thresholds, a minimum ApoB
concentration of about 60 mg/dL or less during the first 15 to 60
days and an average rate of reduction of 1.5 mg/dL/day or greater
within the first 15 to 60 days of treatment can result in an
elevated ALT of about 100 U/L or greater. This may also be
considered in terms of approximately a 15% drop per day or greater
or a change of more than 30 mg/dL over the first 30 days. An ALT of
100 U/L is considered greater than three times the upper limit of
normal. The upper limit of normal for ALT concentration is
approximately 30 U/L. A value three times above such limit would be
considered unfavorable.
[0268] Two hundred and forty four subjects from 6 different
clinical trials including healthy volunteers, familial
hypercholesterolemic subject, polygenic hypercholesterolemic
subject and subject on statin therapy have been evaluated and
threshold levels of ApoB have been associated with ALT levels.
Table 8 shows the number of subjects having a positive slope (rate
of reduction of ApoB greater than 1 mg/dL/day) and who violated the
threshold for magnitude of reduction (ApoB concentration of less
than 60 mg/dL). 80% of such subjects (32 of 41) experienced and ALT
rise of 3XULN or above.
TABLE-US-00009 TABLE 9 Slope and Threshold Analysis Positive Slope
Negative Slope Threshold Violated 41 (32) 5 (0) Threshold Intact 24
(6) 156 (8) N = 244 18(0) - uninterpretable due to borderline
threshold levels
Example 3--Reduction in ApoB with ISIS 301012 in Subjects with
Polygenic Hypersholeterolemia
Subjects
[0269] Subjects were identified as having polygenic
hypercholesterolemia. Subjects typically had LDL-C levels greater
than about 130 mg/dL in the absence of lipid-lowering therapy.
Dosing
[0270] Three groups of 8 patients each were dosed. The groups were
dosed with 200, 300 or 400 mg of ISIS 301012 once per week for 13
weeks with no initial loading. ISIS 301012 was administered by
subcutaneous injection.
TABLE-US-00010 TABLE 10 ApoB levels and and ALT Elevations 200
mg/wk 300 mg/wk 400 mg/wk (mg/dL) (mg/dL) (mg/dL) ApoB Baseline 130
(93-150) 139 (109-160) 150 (118-172 ApoB at 2 wks -47 -61 >-70**
(% change from baseline) ALT Elevations* 0 0 5 *ALT elevations
.gtoreq. 3XULN on two consecutive measurements at least 7 days
apart **4 of 8 patients reached the lower limit of detection for
ApoB
Results
[0271] The drop in ApoB from baseline at 2 weeks for the 200 and
300 mg/kg dose groups resulted, on average in a rate and/or
magnitude drop that did not meet or exceed the threshold
requirements identified in example 2. There were no ALT elevations
in the three treatment groups during the dosing period. The drop in
ApoB from baseline at 2 weeks for the 400 mg/kg dose group resulted
on average in a rate and/or magnitude drop that did exceed the
threshold requirements identified in example 2 and resulted in ALT
increases 3XULN.
Example 4--Predictive Effect of Long Induction at High Dose
Subjects
[0272] Subjects are identified as having familial or polygenic
hypercholesterolemia. Subjects typically have LDL-C levels greater
than about 120 mg/dL in the absence of lipid-lowering therapy.
Dose Regimen
[0273] Subjects are initially dosed using a long induction at
higher dose then the maintenance dose. Group A receives a 200 mg
dose of ISIS 301012 once a week for 13 weeks. Group B receives a
300 mg dose of ISIS 301012 once a week for 13 weeks. After 13
weeks, subjects are placed on a reduced maintenance dose regimen.
Group A receives a 100 mg dose of ISIS 301012 once weekly and Group
B receives a 200 mg dose of ISIS 301012 once weekly. ISIS 301012
can be administered subcutaneously or by any other method provided
herein. The 13 week induction doses are administered to achieve
estimated ISIS 301012 levels in liver tissue that are approximately
60-90% of steady-state concentration. The subjects are monitored
for concentrations of ApoB, LDL-C, VLDL-C, non-HDL-C, HDL-C, ApoA1,
total cholesterol, triglycerides, and Lp(a). Subjects are also
monitored to ensure acceptable safety profiles including ALT, AST
and bilirubin.
TABLE-US-00011 TABLE 11 Administration of ISIS 301012 Induction
Phase Maintenance Phase Dose/Dose Dose/Dose Group frequency
Duration frequence Duration A 200 mg/wk 13 wks 100 mg/wk 52 B 300
mg/wk 13 wks 200 mg/wk 52
[0274] Although 100 and 200 mg/wk are exemplified above,
maintenance doses can be higher or lower. Table 9, 10, 11 and 12
provide predicted values based on modeled dosing regimens. The
models are based on the clinical trial data obtained to date and
particularly the polygenic monotherapy trials in Example 3. Based
on an induction of either 200 or 300 mg/wk, ApoB and LDL levels as
well as plasma trough and liver concentrations are predicted for
the induction and maintenance phases,
TABLE-US-00012 TABLE 12 Predicted Effect (% change from baseline)
at end of 13-week 200 mg/wk induction and 13-week maintenance ApoB
LDL Cohort Week Mean (95% C.I.) Mean (95% C.I.) Induction: 200
mg/wk 14 -46.9 (-65.3 to -28.5) -43.3 (-60.3 to -26.3) Maintenance:
80 mg/wk 28 -40.0 (-47.9 to -32.2) -36.3 (-43.4 to -29.2) 100 mg/wk
28 -43.7 (-52.2 to -35.1) -40.0 (-47.8 to -32.2) 140 mg/wk 28 -49.6
(-59.3 to -39.9) -46.0 (-55.1 to -37.0) 180 mg/wk 28 -54.2 (-64.8
to -43.5) -50.7 (-60.6 to -40.7) 200 mg/wk 28 -56.0 (-67.0 to
-45.0) -52.6 (-62.9 to -42.3)
TABLE-US-00013 TABLE 13 Predicted PK at end of 13-week 200 mg/wk
induction and 13-week maintenance Predicted Plasma Predicted Liver
Ctrough a (ng/mL) Conc. (.mu.g/g) Cohort Day Mean (95% C.I.) Mean
(95% C.I.) Induction: 200 mg/wk 92 24.5 (11.1 to 38.0) 123 (55.3 to
190) Maintenance: 80 mg/wk 183 17.2 (7.8 to 26.6) 86.0 (38.8 to
133) 100 mg/wk 183 19.7 (8.9 to 30.4) 98.3 (44.3 to 152) 140 mg/wk
183 24.6 (11.1 to 38.0) 123 (55.4 to 190) 180 mg/wk 183 29.5 (13.3
to 45.6) 147 (66.5 to 228) 200 mg/wk 183 31.9 .sup. (14.4 to 49.40
159 (72.0 to 247)
Group A Results
[0275] At the end of the 13 week induction phase, the mean liver
concentration of 301012 in Group A is predicted to be approximately
123 ug/g. This concentration is maintained at a maintenance dose of
about 100 mg/wk. At the end of the 13 week induction, the mean
percent change in ApoB levels from baseline is approximately 46.9%.
At week 13 of maintenance, the mean percent change in ApoB levels
from baseline is maintained. At the end of the 13 week induction,
the mean percent change in LDL levels from baseline is
approximately 43.3%. At week 13 of maintenance, the mean percent
change in LDL levels from baseline is maintained. At the end of the
13 week induction phase, plasma trough concentration is
approximately 24.5 ng/mL. At week 13 of maintenance, the plasma
trough concentration is maintained.
TABLE-US-00014 TABLE 14 Predicted Effect (% change from baseline)
at end of 13-week 300 mg induction and 13-week maintenance ApoB LDL
Cohort Week Mean (95% C.I.) Mean (95% C.I.) Induction: 300 mg/wk 14
-56.0 (-77.9 to -34.0) -52.5 (-73.1 to -31.9) Maintenance: 100
mg/wk 28 -48.3 (-57.8 to 38.8) -44.7 (-53.5 to -35.9) 150 mg/wk 28
-54.2 (-64.8 to -43.6) -50.7 (-60.6 to -40.7) 200 mg/wk 28 -58.4
(-69.9 to -47.0) -55.0 (-65.8 to -44.2) 250 mg/wk 28 -61.6 (-73.7
to -49.5) -58.3 (-69.7 to -46.8)
TABLE-US-00015 TABLE 15 Predicted PK at end of 13-week 300 mg
induction (based on polygenic monotherapy trials in Example 3) and
13-week maintenance Predicted Plasma Predicted Liver Ctrough a
(ng/mL) Conc. (.mu.g/g) Cohort Day Mean (95% C.I.) Mean (95% C.I.)
Induction: 300 mg/wk 92 36.8 (16.6 to 56.9) 184 (82.9 to 285)
Maintenance: 100 mg/wk 183 23.4 (10.5 to 36.2) 117 (52.7 to 181)
150 mg/wk 183 29.5 (13.3 to 45.7) 147 (66.5 to 228) 200 mg/wk 183
35.6 (16.1 to 55.1) 178 (80.3 to 276) 250 mg/wk 183 41.7 (18.8 to
64.6) 209 (94.2 to 323)
Group B Results
[0276] At the end of the 13 week induction phase, the mean liver
concentration of 301012 in Group B is predicted to be approximately
184 ug/g. This concentration is maintained at a maintenance dose of
about 200 mg/wk. At the end of the 13 week induction, the mean
percent change in ApoB levels from baseline is approximately 56%.
At week 13 of maintenance, the mean percent change in ApoB levels
from baseline is maintained. At the end of the 13 week induction,
the mean percent change in LDL levels from baseline is
approximately 52.5%. At week 13 of maintenance, the mean percent
change in LDL levels from baseline is maintained. At the end of the
13 week induction phase, plasma trough concentration is
approximately 36.8 ng/mL. At week 13 of maintenance, the plasma
trough concentration is maintained.
Example 5--Predictive Effect of Long Induction at Low Dose
Subjects
[0277] Subjects are identified as having polygenic or familial
hypercholesterolemia. Subjects typically have LDL-C levels greater
than about 130 mg/dL in the absence of lipid-lowering therapy.
Dose Regimen
[0278] Subjects are initially dosed using a long induction at lower
dose then the maintenance dose. Group A receives a 100 mg dose of
ISIS 301012 once a week for 13 weeks. Group B receives a 200 mg
dose of ISIS 301012 once a week for 13 weeks. After 13 weeks,
subjects are evaluated based on tolerability and effectiveness with
respect to treatment goals. If dosing is well tolerated and
treatment goals are not being met, patients are placed on an
elevated maintenance dose regimen. Group A receives a 200 mg dose
of ISIS 301012 once weekly and Group B receives a 300 mg dose of
ISIS 301012 once weekly. ISIS 301012 is administered
subcutaneously. The 13 week induction doses are administered to
achieve estimated ISIS 301012 levels in liver tissue that are
approximately 60-90% of steady-state concentration. The subjects
are monitored for concentrations of ApoB, LDL-C, VLDL-C, non-HDL-C,
HDL-C, ApoA1, total cholesterol, triglycerides, and Lp(a). Subjects
were also monitored to ensure acceptable safety profiles (including
ALT, AST and bilirubin.
TABLE-US-00016 TABLE 16 Administration of ISIS 301012 Induction
Phase Maintenance Phase Dose/Dose Dose/Dose Group frequency
Duration frequence Duration A 100 mg/wk 13 wks 200 mg/wk 52 B 200
mg/wk 13 wks 300 mg/wk 52
[0279] Table 14 and 15 provide predicted values based on a modeled
dosing regimen. The model is based on the clinical trial data
obtained to date and particularly the polygenic monotherapy trials
in Example 3. Based on an induction of either 100 mg/wk, ApoB and
LDL levels as well as plasma trough and liver concentrations are
predicted for the induction and maintenance phases,
TABLE-US-00017 TABLE 17 Predicted Effect (% change from baseline)
for a 6-month trial with a 13 week priming regimen of 100 mg/wk and
a 26 week maintenance of 200 mg/wk ApoB LDL Cohort Week Mean (95%
C.I.) Mean (95% C.I.) End of 13 weeks: 100 mg/wk 14 -28.4 (-39.5 to
-17.3) -24.5 (-34.0 to -14.9) for 13 wks End of 26 weeks: 200 mg/wk
28 -53.1 (-63.5 to -42.7) -49.6 (-59.3 to -39.9) for 13 wks
TABLE-US-00018 TABLE 18 Predicted PK for a 6-month trial with a 13
week priming regimen and a 26 week maintenance Predicted Plasma
Predicted Liver Ctrough a (ng/mL) Conc. (.mu.g/g) Cohort Day Mean
(95% C.I.) Mean (95% C.I.) End of 13 weeks: 100 mg/wkl 92 12.3 (5.5
to 19.0) 61.3 (27.6 to 95) for 13 wks End of 26 weeks: 200 mg/wk
183 28.2 (12.7 to 43.7) 141 (63.6 to 218) for 13 wks
Group A Results
[0280] At the end of the 13 week induction phase, the mean liver
concentration of 301012 in Group A is predicted to be approximately
61.3 ug/g. This concentration is increased to 141 after 13 weeks of
the 200 mg/wk maintenance dose. At the end of the 13 week
induction, the mean percent change in ApoB levels from baseline is
approximately 28.4%. At week 26 of dosing, the mean percent change
in ApoB levels from baseline is 53.1%. At the end of the 13 week
induction, the mean percent change in LDL levels from baseline is
approximately 24.5%. After 13 weeks of maintenance, the mean
percent change in LDL levels from baseline is increased to 49.6%.
At the end of the 13 week induction phase, plasma trough
concentration is approximately 12.3 ng/mL. At week 13 of
maintenance, the plasma trough concentration is predicted to
increased to 28.2 ng/mL.
Example 6--Once Every Other Week Interval Dosing
Subjects
[0281] Subjects were identified as having polygenic
hypercholesterolemia. Subjects typically had LDL-C levels greater
than about 120 mg/dL in the absence of lipid-lowering therapy.
Dose Regimen
[0282] ISIS 301012 was administered by s.c. injection at 200 mg
twice weekly for two weeks followed by a dose of 200 mg every other
week for 11 weeks.
TABLE-US-00019 TABLE 19 ApoB levels at Two and Fourteen Weeks of
Treatment 200 mg every other week(mg/dL) ApoB Baseline 129
(100-185) ApoB at 2 wks** -23 ApoB at 14 wks** -28.4 ALT
Elevations* 0 *ALT elevations .gtoreq. 3XULN **(% change from
baseline)
Results
[0283] The results show the effectiveness of delivering ISIS 301012
in a once every other week regimen with no associated ALT
elevations.
Example 7--Predicted Effect of Once Every Other Week Interval
Dosing with Induction Phase
Subjects
[0284] Subjects are identified as having familial
hypercholesterolemia and represent a lower tolerance population
such as diabetics and mix-hyperlipidemics. Subjects typically have
LDL-C levels greater than about 130 mg/dL in the absence of
lipid-lowering therapy.
Dose Regimen
[0285] ISIS 301012 is administered by s.c. injection at a dose of
200 mg every week for 13 weeks and then 200 mg every other week for
52 weeks.
TABLE-US-00020 TABLE 20 Predicted Effect (% change from baseline)
for a 6-month trial with a 13 week induction of 200 mg/wk and a
predicted 13 week maintenance of 200 mg every other week ApoB LDL
Cohort Week Mean (95% C.I.) Mean (95% C.I.) End of 13 weeks: 200
mg/wk 14 -46.9 (-65.3 to -28.5) -43.3 (-60.3 to -26.3) for 13 wks
End of 26 weeks: 200 mg 26 -43.7 (-52.2 to -35.1) -40.0 (-47.8 to
-32.2) every other wk for 13 wks
TABLE-US-00021 TABLE 21 Predicted PK for a 6-month trial with a 13
week induction of 200 mg/wk and a predicted 13 week maintenance of
200 mg every other week Predicted Plasma Predicted Liver Ctrough a
(ng/mL) Conc. (.mu.g/g) Cohort Week Mean (95% C.I.) Mean (95% C.I.)
End of 13 weeks: 200 mg/wk 14 24.5 (11.1 to 38.0) 123 (55.3 to 190)
for 13 wks End of 26 weeks: 200 mg 26 19.7 (8.9 to 30.4) 98.3 (44.3
to 152) every other wk for 13 wks
Results
[0286] The results show the delivering ISIS 301012 in a once every
other week regimen can be and effective regimen and is not likely
to result in elevated ALT levels.
Example 8--Predicted Effect of Once Monthly Interval Dosing with
Induction Phase
Subjects
[0287] Subjects are identified as having familial
hypercholesterolemia and represent a lower tolerance population
such as diabetics and mix-hyperlipidemics. Subjects typically have
LDL-C levels greater than about 130 mg/dL in the absence of
lipid-lowering therapy.
Dose Regimen
[0288] ISIS 301012 is administered by s.c. injection or by any
method provided herein. In certain embodiments, subjects can be
dosed at 200, 400 or 800 mg every month for 12 months (FIG. 1). In
other embodiments, subjects are dosed at 200 mg/wk for 1 month and
then 200, 400 or 600 mg once monthly for 11 months (FIG. 2). In
other embodiments, subjects are dosed at 200 mg/wk for 3 month and
then 200, 400 or 600 mg once monthly for 9 months (FIG. 3).
Results
[0289] The results predict that delivering ISIS 301012 in a once
monthly regimen with or without an induction period can be an
effective regimen and is not likely to result in elevated ALT
levels.
Sequence CWU 1
1
2114121DNAHomo sapiens 1attcccaccg ggacctgcgg ggctgagtgc ccttctcggt
tgctgccgct gaggagcccg 60cccagccagc cagggccgcg aggccgaggc caggccgcag
cccaggagcc gccccaccgc 120agctggcgat ggacccgccg aggcccgcgc
tgctggcgct gctggcgctg cctgcgctgc 180tgctgctgct gctggcgggc
gccagggccg aagaggaaat gctggaaaat gtcagcctgg 240tctgtccaaa
agatgcgacc cgattcaagc acctccggaa gtacacatac aactatgagg
300ctgagagttc cagtggagtc cctgggactg ctgattcaag aagtgccacc
aggatcaact 360gcaaggttga gctggaggtt ccccagctct gcagcttcat
cctgaagacc agccagtgca 420ccctgaaaga ggtgtatggc ttcaaccctg
agggcaaagc cttgctgaag aaaaccaaga 480actctgagga gtttgctgca
gccatgtcca ggtatgagct caagctggcc attccagaag 540ggaagcaggt
tttcctttac ccggagaaag atgaacctac ttacatcctg aacatcaaga
600ggggcatcat ttctgccctc ctggttcccc cagagacaga agaagccaag
caagtgttgt 660ttctggatac cgtgtatgga aactgctcca ctcactttac
cgtcaagacg aggaagggca 720atgtggcaac agaaatatcc actgaaagag
acctggggca gtgtgatcgc ttcaagccca 780tccgcacagg catcagccca
cttgctctca tcaaaggcat gacccgcccc ttgtcaactc 840tgatcagcag
cagccagtcc tgtcagtaca cactggacgc taagaggaag catgtggcag
900aagccatctg caaggagcaa cacctcttcc tgcctttctc ctacaacaat
aagtatggga 960tggtagcaca agtgacacag actttgaaac ttgaagacac
accaaagatc aacagccgct 1020tctttggtga aggtactaag aagatgggcc
tcgcatttga gagcaccaaa tccacatcac 1080ctccaaagca ggccgaagct
gttttgaaga ctctccagga actgaaaaaa ctaaccatct 1140ctgagcaaaa
tatccagaga gctaatctct tcaataagct ggttactgag ctgagaggcc
1200tcagtgatga agcagtcaca tctctcttgc cacagctgat tgaggtgtcc
agccccatca 1260ctttacaagc cttggttcag tgtggacagc ctcagtgctc
cactcacatc ctccagtggc 1320tgaaacgtgt gcatgccaac ccccttctga
tagatgtggt cacctacctg gtggccctga 1380tccccgagcc ctcagcacag
cagctgcgag agatcttcaa catggcgagg gatcagcgca 1440gccgagccac
cttgtatgcg ctgagccacg cggtcaacaa ctatcataag acaaacccta
1500cagggaccca ggagctgctg gacattgcta attacctgat ggaacagatt
caagatgact 1560gcactgggga tgaagattac acctatttga ttctgcgggt
cattggaaat atgggccaaa 1620ccatggagca gttaactcca gaactcaagt
cttcaatcct caaatgtgtc caaagtacaa 1680agccatcact gatgatccag
aaagctgcca tccaggctct gcggaaaatg gagcctaaag 1740acaaggacca
ggaggttctt cttcagactt tccttgatga tgcttctccg ggagataagc
1800gactggctgc ctatcttatg ttgatgagga gtccttcaca ggcagatatt
aacaaaattg 1860tccaaattct accatgggaa cagaatgagc aagtgaagaa
ctttgtggct tcccatattg 1920ccaatatctt gaactcagaa gaattggata
tccaagatct gaaaaagtta gtgaaagaag 1980ctctgaaaga atctcaactt
ccaactgtca tggacttcag aaaattctct cggaactatc 2040aactctacaa
atctgtttct cttccatcac ttgacccagc ctcagccaaa atagaaggga
2100atcttatatt tgatccaaat aactaccttc ctaaagaaag catgctgaaa
actaccctca 2160ctgcctttgg atttgcttca gctgacctca tcgagattgg
cttggaagga aaaggctttg 2220agccaacatt ggaagctctt tttgggaagc
aaggattttt cccagacagt gtcaacaaag 2280ctttgtactg ggttaatggt
caagttcctg atggtgtctc taaggtctta gtggaccact 2340ttggctatac
caaagatgat aaacatgagc aggatatggt aaatggaata atgctcagtg
2400ttgagaagct gattaaagat ttgaaatcca aagaagtccc ggaagccaga
gcctacctcc 2460gcatcttggg agaggagctt ggttttgcca gtctccatga
cctccagctc ctgggaaagc 2520tgcttctgat gggtgcccgc actctgcagg
ggatccccca gatgattgga gaggtcatca 2580ggaagggctc aaagaatgac
ttttttcttc actacatctt catggagaat gcctttgaac 2640tccccactgg
agctggatta cagttgcaaa tatcttcatc tggagtcatt gctcccggag
2700ccaaggctgg agtaaaactg gaagtagcca acatgcaggc tgaactggtg
gcaaaaccct 2760ccgtgtctgt ggagtttgtg acaaatatgg gcatcatcat
tccggacttc gctaggagtg 2820gggtccagat gaacaccaac ttcttccacg
agtcgggtct ggaggctcat gttgccctaa 2880aagctgggaa gctgaagttt
atcattcctt ccccaaagag accagtcaag ctgctcagtg 2940gaggcaacac
attacatttg gtctctacca ccaaaacgga ggtgatccca cctctcattg
3000agaacaggca gtcctggtca gtttgcaagc aagtctttcc tggcctgaat
tactgcacct 3060caggcgctta ctccaacgcc agctccacag actccgcctc
ctactatccg ctgaccgggg 3120acaccagatt agagctggaa ctgaggccta
caggagagat tgagcagtat tctgtcagcg 3180caacctatga gctccagaga
gaggacagag ccttggtgga taccctgaag tttgtaactc 3240aagcagaagg
tgcgaagcag actgaggcta ccatgacatt caaatataat cggcagagta
3300tgaccttgtc cagtgaagtc caaattccgg attttgatgt tgacctcgga
acaatcctca 3360gagttaatga tgaatctact gagggcaaaa cgtcttacag
actcaccctg gacattcaga 3420acaagaaaat tactgaggtc gccctcatgg
gccacctaag ttgtgacaca aaggaagaaa 3480gaaaaatcaa gggtgttatt
tccatacccc gtttgcaagc agaagccaga agtgagatcc 3540tcgcccactg
gtcgcctgcc aaactgcttc tccaaatgga ctcatctgct acagcttatg
3600gctccacagt ttccaagagg gtggcatggc attatgatga agagaagatt
gaatttgaat 3660ggaacacagg caccaatgta gataccaaaa aaatgacttc
caatttccct gtggatctct 3720ccgattatcc taagagcttg catatgtatg
ctaatagact cctggatcac agagtccctg 3780aaacagacat gactttccgg
cacgtgggtt ccaaattaat agttgcaatg agctcatggc 3840ttcagaaggc
atctgggagt cttccttata cccagacttt gcaagaccac ctcaatagcc
3900tgaaggagtt caacctccag aacatgggat tgccagactt ccacatccca
gaaaacctct 3960tcttaaaaag cgatggccgg gtcaaatata ccttgaacaa
gaacagtttg aaaattgaga 4020ttcctttgcc ttttggtggc aaatcctcca
gagatctaaa gatgttagag actgttagga 4080caccagccct ccacttcaag
tctgtgggat tccatctgcc atctcgagag ttccaagtcc 4140ctacttttac
cattcccaag ttgtatcaac tgcaagtgcc tctcctgggt gttctagacc
4200tctccacgaa tgtctacagc aacttgtaca actggtccgc ctcctacagt
ggtggcaaca 4260ccagcacaga ccatttcagc cttcgggctc gttaccacat
gaaggctgac tctgtggttg 4320acctgctttc ctacaatgtg caaggatctg
gagaaacaac atatgaccac aagaatacgt 4380tcacactatc atgtgatggg
tctctacgcc acaaatttct agattcgaat atcaaattca 4440gtcatgtaga
aaaacttgga aacaacccag tctcaaaagg tttactaata ttcgatgcat
4500ctagttcctg gggaccacag atgtctgctt cagttcattt ggactccaaa
aagaaacagc 4560atttgtttgt caaagaagtc aagattgatg ggcagttcag
agtctcttcg ttctatgcta 4620aaggcacata tggcctgtct tgtcagaggg
atcctaacac tggccggctc aatggagagt 4680ccaacctgag gtttaactcc
tcctacctcc aaggcaccaa ccagataaca ggaagatatg 4740aagatggaac
cctctccctc acctccacct ctgatctgca aagtggcatc attaaaaata
4800ctgcttccct aaagtatgag aactacgagc tgactttaaa atctgacacc
aatgggaagt 4860ataagaactt tgccacttct aacaagatgg atatgacctt
ctctaagcaa aatgcactgc 4920tgcgttctga atatcaggct gattacgagt
cattgaggtt cttcagcctg ctttctggat 4980cactaaattc ccatggtctt
gagttaaatg ctgacatctt aggcactgac aaaattaata 5040gtggtgctca
caaggcgaca ctaaggattg gccaagatgg aatatctacc agtgcaacga
5100ccaacttgaa gtgtagtctc ctggtgctgg agaatgagct gaatgcagag
cttggcctct 5160ctggggcatc tatgaaatta acaacaaatg gccgcttcag
ggaacacaat gcaaaattca 5220gtctggatgg gaaagccgcc ctcacagagc
tatcactggg aagtgcttat caggccatga 5280ttctgggtgt cgacagcaaa
aacattttca acttcaaggt cagtcaagaa ggacttaagc 5340tctcaaatga
catgatgggc tcatatgctg aaatgaaatt tgaccacaca aacagtctga
5400acattgcagg cttatcactg gacttctctt caaaacttga caacatttac
agctctgaca 5460agttttataa gcaaactgtt aatttacagc tacagcccta
ttctctggta actactttaa 5520acagtgacct gaaatacaat gctctggatc
tcaccaacaa tgggaaacta cggctagaac 5580ccctgaagct gcatgtggct
ggtaacctaa aaggagccta ccaaaataat gaaataaaac 5640acatctatgc
catctcttct gctgccttat cagcaagcta taaagcagac actgttgcta
5700aggttcaggg tgtggagttt agccatcggc tcaacacaga catcgctggg
ctggcttcag 5760ccattgacat gagcacaaac tataattcag actcactgca
tttcagcaat gtcttccgtt 5820ctgtaatggc cccgtttacc atgaccatcg
atgcacatac aaatggcaat gggaaactcg 5880ctctctgggg agaacatact
gggcagctgt atagcaaatt cctgttgaaa gcagaacctc 5940tggcatttac
tttctctcat gattacaaag gctccacaag tcatcatctc gtgtctagga
6000aaagcatcag tgcagctctt gaacacaaag tcagtgccct gcttactcca
gctgagcaga 6060caggcacctg gaaactcaag acccaattta acaacaatga
atacagccag gacttggatg 6120cttacaacac taaagataaa attggcgtgg
agcttactgg acgaactctg gctgacctaa 6180ctctactaga ctccccaatt
aaagtgccac ttttactcag tgagcccatc aatatcattg 6240atgctttaga
gatgagagat gccgttgaga agccccaaga atttacaatt gttgcttttg
6300taaagtatga taaaaaccaa gatgttcact ccattaacct cccatttttt
gagaccttgc 6360aagaatattt tgagaggaat cgacaaacca ttatagttgt
agtggaaaac gtacagagaa 6420acctgaagca catcaatatt gatcaatttg
taagaaaata cagagcagcc ctgggaaaac 6480tcccacagca agctaatgat
tatctgaatt cattcaattg ggagagacaa gtttcacatg 6540ccaaggagaa
actgactgct ctcacaaaaa agtatagaat tacagaaaat gatatacaaa
6600ttgcattaga tgatgccaaa atcaacttta atgaaaaact atctcaactg
cagacatata 6660tgatacaatt tgatcagtat attaaagata gttatgattt
acatgatttg aaaatagcta 6720ttgctaatat tattgatgaa atcattgaaa
aattaaaaag tcttgatgag cactatcata 6780tccgtgtaaa tttagtaaaa
acaatccatg atctacattt gtttattgaa aatattgatt 6840ttaacaaaag
tggaagtagt actgcatcct ggattcaaaa tgtggatact aagtaccaaa
6900tcagaatcca gatacaagaa aaactgcagc agcttaagag acacatacag
aatatagaca 6960tccagcacct agctggaaag ttaaaacaac acattgaggc
tattgatgtt agagtgcttt 7020tagatcaatt gggaactaca atttcatttg
aaagaataaa tgatgttctt gagcatgtca 7080aacactttgt tataaatctt
attggggatt ttgaagtagc tgagaaaatc aatgccttca 7140gagccaaagt
ccatgagtta atcgagaggt atgaagtaga ccaacaaatc caggttttaa
7200tggataaatt agtagagttg acccaccaat acaagttgaa ggagactatt
cagaagctaa 7260gcaatgtcct acaacaagtt aagataaaag attactttga
gaaattggtt ggatttattg 7320atgatgctgt gaagaagctt aatgaattat
cttttaaaac attcattgaa gatgttaaca 7380aattccttga catgttgata
aagaaattaa agtcatttga ttaccaccag tttgtagatg 7440aaaccaatga
caaaatccgt gaggtgactc agagactcaa tggtgaaatt caggctctgg
7500aactaccaca aaaagctgaa gcattaaaac tgtttttaga ggaaaccaag
gccacagttg 7560cagtgtatct ggaaagccta caggacacca aaataacctt
aatcatcaat tggttacagg 7620aggctttaag ttcagcatct ttggctcaca
tgaaggccaa attccgagag actctagaag 7680atacacgaga ccgaatgtat
caaatggaca ttcagcagga acttcaacga tacctgtctc 7740tggtaggcca
ggtttatagc acacttgtca cctacatttc tgattggtgg actcttgctg
7800ctaagaacct tactgacttt gcagagcaat attctatcca agattgggct
aaacgtatga 7860aagcattggt agagcaaggg ttcactgttc ctgaaatcaa
gaccatcctt gggaccatgc 7920ctgcctttga agtcagtctt caggctcttc
agaaagctac cttccagaca cctgatttta 7980tagtccccct aacagatttg
aggattccat cagttcagat aaacttcaaa gacttaaaaa 8040atataaaaat
cccatccagg ttttccacac cagaatttac catccttaac accttccaca
8100ttccttcctt tacaattgac tttgtcgaaa tgaaagtaaa gatcatcaga
accattgacc 8160agatgcagaa cagtgagctg cagtggcccg ttccagatat
atatctcagg gatctgaagg 8220tggaggacat tcctctagcg agaatcaccc
tgccagactt ccgtttacca gaaatcgcaa 8280ttccagaatt cataatccca
actctcaacc ttaatgattt tcaagttcct gaccttcaca 8340taccagaatt
ccagcttccc cacatctcac acacaattga agtacctact tttggcaagc
8400tatacagtat tctgaaaatc caatctcctc ttttcacatt agatgcaaat
gctgacatag 8460ggaatggaac cacctcagca aacgaagcag gtatcgcagc
ttccatcact gccaaaggag 8520agtccaaatt agaagttctc aattttgatt
ttcaagcaaa tgcacaactc tcaaacccta 8580agattaatcc gctggctctg
aaggagtcag tgaagttctc cagcaagtac ctgagaacgg 8640agcatgggag
tgaaatgctg ttttttggaa atgctattga gggaaaatca aacacagtgg
8700caagtttaca cacagaaaaa aatacactgg agcttagtaa tggagtgatt
gtcaagataa 8760acaatcagct taccctggat agcaacacta aatacttcca
caaattgaac atccccaaac 8820tggacttctc tagtcaggct gacctgcgca
acgagatcaa gacactgttg aaagctggcc 8880acatagcatg gacttcttct
ggaaaagggt catggaaatg ggcctgcccc agattctcag 8940atgagggaac
acatgaatca caaattagtt tcaccataga aggacccctc acttcctttg
9000gactgtccaa taagatcaat agcaaacacc taagagtaaa ccaaaacttg
gtttatgaat 9060ctggctccct caacttttct aaacttgaaa ttcaatcaca
agtcgattcc cagcatgtgg 9120gccacagtgt tctaactgct aaaggcatgg
cactgtttgg agaagggaag gcagagttta 9180ctgggaggca tgatgctcat
ttaaatggaa aggttattgg aactttgaaa aattctcttt 9240tcttttcagc
ccagccattt gagatcacgg catccacaaa caatgaaggg aatttgaaag
9300ttcgttttcc attaaggtta acagggaaga tagacttcct gaataactat
gcactgtttc 9360tgagtcccag tgcccagcaa gcaagttggc aagtaagtgc
taggttcaat cagtataagt 9420acaaccaaaa tttctctgct ggaaacaacg
agaacattat ggaggcccat gtaggaataa 9480atggagaagc aaatctggat
ttcttaaaca ttcctttaac aattcctgaa atgcgtctac 9540cttacacaat
aatcacaact cctccactga aagatttctc tctatgggaa aaaacaggct
9600tgaaggaatt cttgaaaacg acaaagcaat catttgattt aagtgtaaaa
gctcagtata 9660agaaaaacaa acacaggcat tccatcacaa atcctttggc
tgtgctttgt gagtttatca 9720gtcagagcat caaatccttt gacaggcatt
ttgaaaaaaa cagaaacaat gcattagatt 9780ttgtcaccaa atcctataat
gaaacaaaaa ttaagtttga taagtacaaa gctgaaaaat 9840ctcacgacga
gctccccagg acctttcaaa ttcctggata cactgttcca gttgtcaatg
9900ttgaagtgtc tccattcacc atagagatgt cggcattcgg ctatgtgttc
ccaaaagcag 9960tcagcatgcc tagtttctcc atcctaggtt ctgacgtccg
tgtgccttca tacacattaa 10020tcctgccatc attagagctg ccagtccttc
atgtccctag aaatctcaag ctttctcttc 10080cacatttcaa ggaattgtgt
accataagcc atatttttat tcctgccatg ggcaatatta 10140cctatgattt
ctcctttaaa tcaagtgtca tcacactgaa taccaatgct gaacttttta
10200accagtcaga tattgttgct catctccttt cttcatcttc atctgtcatt
gatgcactgc 10260agtacaaatt agagggcacc acaagattga caagaaaaag
gggattgaag ttagccacag 10320ctctgtctct gagcaacaaa tttgtggagg
gtagtcataa cagtactgtg agcttaacca 10380cgaaaaatat ggaagtgtca
gtggcaaaaa ccacaaaagc cgaaattcca attttgagaa 10440tgaatttcaa
gcaagaactt aatggaaata ccaagtcaaa acctactgtc tcttcctcca
10500tggaatttaa gtatgatttc aattcttcaa tgctgtactc taccgctaaa
ggagcagttg 10560accacaagct tagcttggaa agcctcacct cttacttttc
cattgagtca tctaccaaag 10620gagatgtcaa gggttcggtt ctttctcggg
aatattcagg aactattgct agtgaggcca 10680acacttactt gaattccaag
agcacacggt cttcagtgaa gctgcagggc acttccaaaa 10740ttgatgatat
ctggaacctt gaagtaaaag aaaattttgc tggagaagcc acactccaac
10800gcatatattc cctctgggag cacagtacga aaaaccactt acagctagag
ggcctctttt 10860tcaccaacgg agaacataca agcaaagcca ccctggaact
ctctccatgg caaatgtcag 10920ctcttgttca ggtccatgca agtcagccca
gttccttcca tgatttccct gaccttggcc 10980aggaagtggc cctgaatgct
aacactaaga accagaagat cagatggaaa aatgaagtcc 11040ggattcattc
tgggtctttc cagagccagg tcgagctttc caatgaccaa gaaaaggcac
11100accttgacat tgcaggatcc ttagaaggac acctaaggtt cctcaaaaat
atcatcctac 11160cagtctatga caagagctta tgggatttcc taaagctgga
tgtaaccacc agcattggta 11220ggagacagca tcttcgtgtt tcaactgcct
ttgtgtacac caaaaacccc aatggctatt 11280cattctccat ccctgtaaaa
gttttggctg ataaattcat tactcctggg ctgaaactaa 11340atgatctaaa
ttcagttctt gtcatgccta cgttccatgt cccatttaca gatcttcagg
11400ttccatcgtg caaacttgac ttcagagaaa tacaaatcta taagaagctg
agaacttcat 11460catttgccct caacctacca acactccccg aggtaaaatt
ccctgaagtt gatgtgttaa 11520caaaatattc tcaaccagaa gactccttga
ttcccttttt tgagataacc gtgcctgaat 11580ctcagttaac tgtgtcccag
ttcacgcttc caaaaagtgt ttcagatggc attgctgctt 11640tggatctaaa
tgcagtagcc aacaagatcg cagactttga gttgcccacc atcatcgtgc
11700ctgagcagac cattgagatt ccctccatta agttctctgt acctgctgga
attgtcattc 11760cttcctttca agcactgact gcacgctttg aggtagactc
tcccgtgtat aatgccactt 11820ggagtgccag tttgaaaaac aaagcagatt
atgttgaaac agtcctggat tccacatgca 11880gctcaaccgt acagttccta
gaatatgaac taaatgtttt gggaacacac aaaatcgaag 11940atggtacgtt
agcctctaag actaaaggaa cacttgcaca ccgtgacttc agtgcagaat
12000atgaagaaga tggcaaattt gaaggacttc aggaatggga aggaaaagcg
cacctcaata 12060tcaaaagccc agcgttcacc gatctccatc tgcgctacca
gaaagacaag aaaggcatct 12120ccacctcagc agcctcccca gccgtaggca
ccgtgggcat ggatatggat gaagatgacg 12180acttttctaa atggaacttc
tactacagcc ctcagtcctc tccagataaa aaactcacca 12240tattcaaaac
tgagttgagg gtccgggaat ctgatgagga aactcagatc aaagttaatt
12300gggaagaaga ggcagcttct ggcttgctaa cctctctgaa agacaacgtg
cccaaggcca 12360caggggtcct ttatgattat gtcaacaagt accactggga
acacacaggg ctcaccctga 12420gagaagtgtc ttcaaagctg agaagaaatc
tgcagaacaa tgctgagtgg gtttatcaag 12480gggccattag gcaaattgat
gatatcgacg tgaggttcca gaaagcagcc agtggcacca 12540ctgggaccta
ccaagagtgg aaggacaagg cccagaatct gtaccaggaa ctgttgactc
12600aggaaggcca agccagtttc cagggactca aggataacgt gtttgatggc
ttggtacgag 12660ttactcaaaa attccatatg aaagtcaagc atctgattga
ctcactcatt gattttctga 12720acttccccag attccagttt ccggggaaac
ctgggatata cactagggag gaactttgca 12780ctatgttcat aagggaggta
gggacggtac tgtcccaggt atattcgaaa gtccataatg 12840gttcagaaat
actgttttcc tatttccaag acctagtgat tacacttcct ttcgagttaa
12900ggaaacataa actaatagat gtaatctcga tgtataggga actgttgaaa
gatttatcaa 12960aagaagccca agaggtattt aaagccattc agtctctcaa
gaccacagag gtgctacgta 13020atcttcagga ccttttacaa ttcattttcc
aactaataga agataacatt aaacagctga 13080aagagatgaa atttacttat
cttattaatt atatccaaga tgagatcaac acaatcttca 13140atgattatat
cccatatgtt tttaaattgt tgaaagaaaa cctatgcctt aatcttcata
13200agttcaatga atttattcaa aacgagcttc aggaagcttc tcaagagtta
cagcagatcc 13260atcaatacat tatggccctt cgtgaagaat attttgatcc
aagtatagtt ggctggacag 13320tgaaatatta tgaacttgaa gaaaagatag
tcagtctgat caagaacctg ttagttgctc 13380ttaaggactt ccattctgaa
tatattgtca gtgcctctaa ctttacttcc caactctcaa 13440gtcaagttga
gcaatttctg cacagaaata ttcaggaata tcttagcatc cttaccgatc
13500cagatggaaa agggaaagag aagattgcag agctttctgc cactgctcag
gaaataatta 13560aaagccaggc cattgcgacg aagaaaataa tttctgatta
ccaccagcag tttagatata 13620aactgcaaga tttttcagac caactctctg
attactatga aaaatttatt gctgaatcca 13680aaagattgat tgacctgtcc
attcaaaact accacacatt tctgatatac atcacggagt 13740tactgaaaaa
gctgcaatca accacagtca tgaaccccta catgaagctt gctccaggag
13800aacttactat catcctctaa ttttttaaaa gaaatcttca tttattcttc
ttttccaatt 13860gaactttcac atagcacaga aaaaattcaa actgcctata
ttgataaaac catacagtga 13920gccagccttg cagtaggcag tagactataa
gcagaagcac atatgaactg gacctgcacc 13980aaagctggca ccagggctcg
gaaggtctct gaactcagaa ggatggcatt ttttgcaagt 14040taaagaaaat
caggatctga gttattttgc taaacttggg ggaggaggaa caaataaatg
14100gagtctttat tgtgtatcat a 14121220DNAArtificial
sequenceSynthetic oligonucleotide 2gcctcagtct gcttcgcacc 20
* * * * *