U.S. patent application number 15/369465 was filed with the patent office on 2017-03-23 for facultatively attenuated bacterial species and methods of preparation and use thereof.
The applicant listed for this patent is ADURO BIOTECH, INC.. Invention is credited to William G. HANSON, Peter M. LAUER, Justin SKOBLE.
Application Number | 20170081673 15/369465 |
Document ID | / |
Family ID | 50622722 |
Filed Date | 2017-03-23 |
United States Patent
Application |
20170081673 |
Kind Code |
A1 |
HANSON; William G. ; et
al. |
March 23, 2017 |
FACULTATIVELY ATTENUATED BACTERIAL SPECIES AND METHODS OF
PREPARATION AND USE THEREOF
Abstract
The present invention provides facultatively attenuated
bacterial species and methods of preparation and use thereof. The
term "facultatively attenuated" as used herein refers to a
bacterium which comprises a set of defined recombinant
modifications which have substantially no effect on the ability of
the bacterium to grow by multiplication when the bacterium is
outside of its host organism, but which result in deletion of one
or more genes essential for multiplication of the bacterium when
the bacterium is introduced into its host organism, for example
within host cells of a vaccinate recipient. These recombinant
modifications take advantage of regulatory sequences which
preferentially induce expression of genes within the mammalian
host.
Inventors: |
HANSON; William G.; (Walnut
Creek, CA) ; SKOBLE; Justin; (Berkeley, CA) ;
LAUER; Peter M.; (Albany, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ADURO BIOTECH, INC. |
Berkeley |
CA |
US |
|
|
Family ID: |
50622722 |
Appl. No.: |
15/369465 |
Filed: |
December 5, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14073737 |
Nov 6, 2013 |
9511129 |
|
|
15369465 |
|
|
|
|
61723234 |
Nov 6, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 31/04 20180101;
C12N 2800/30 20130101; A61K 2039/522 20130101; C12Y 207/07
20130101; C12N 9/1241 20130101; Y02A 50/403 20180101; A61K 39/02
20130101; A61K 39/0208 20130101; Y02A 50/478 20180101; C12N 15/74
20130101; Y02A 50/30 20180101 |
International
Class: |
C12N 15/74 20060101
C12N015/74; C12N 9/12 20060101 C12N009/12 |
Claims
1. A bacterium comprising: (i) a nucleic acid encoding a
recombinase heterologous to the bacterium operably connected to
regulatory sequences which preferentially induce expression of the
recombinase when the bacterium is in a mammalian host, and (ii) a
first attachment site for the recombinase introduced upstream from
one or more genes in the bacterial genome which are essential for
multiplication of the bacterium, and a second attachment site for
the recombinase introduced downstream from the gene(s) genes in the
bacterial genome which are essential for multiplication of the
bacterium, wherein the first and second attachment sites are
configured to provide recombinase-catalyzed removal of the one or
more genes in the bacterial genome which are essential for
multiplication of the bacterium upon expression of the
recombinase.
2. A bacterium according to claim 1, wherein the bacterium is a
facultative intracellular bacterium, and the regulatory sequences
preferentially induce expression of the recombinase when the
bacterium is in a mammalian host cell.
3. A bacterium according to claim 1, wherein the bacterium is of a
genus selected from the group consisting of Listeria, Neisseria,
Mycobacterium, Francisella, Bacillus, Salmonella, Shigella,
Yersinia, Brucella, Legionella, Rickettsia, and Chlamydia.
4. A bacterium according to claim 1, wherein the bacterium is
Listeria monocytogenes.
5. A method according to claim 4, wherein the Listeria
monocytogenes is .DELTA.ActA/.DELTA.InlB.
6. A bacterium according to claim 4, wherein the regulatory
sequences comprise a Listeria monocytogenes promoter which is
PrfA-dependent.
7. A bacterium according to claim 6, wherein PrfA-dependent
promoter is selected from the group consisting of the inlA
promoter, the inlB promoter, the inlC promoter, the hpt promoter,
the hly promoter, the plcA promoter, the mpl promoter, and the actA
promoter.
8. A bacterium according to claim 7, wherein the PrfA-dependent
promoter is an actA promoter.
9. A bacterium according to claim 1, wherein the recombinase is
selected from the group consisting of .phi.C31 integrase, R4
integrase, TP901 integrase, .phi.BT1 integrase, B.times.B1
integrase, PSA integrase, Cre recombinase, Flp recombinase, XerC
recombinase, .lamda. integrase, HK01 integrase, P1 integrase, HP1
integrase, L5 integrase, .gamma..delta. recombinase, Tn3
recombinase, gin recombinase, RV integrase, SPBc integrase, TG1
integrase, .phi.C1 integrase, MR11 integrase, .phi.370 integrase,
.phi.K38 integrase, W.beta. integrase, and BL3 integrase.
10. A bacterium according to claim 1, wherein the first attachment
site is an attB site and the second attachment site is an attP
site.
11. A bacterium according to claim 1, wherein the one or more genes
essential for multiplication of the bacterium comprise at least one
gene involved in DNA replication.
12. A bacterium according to claim 11, wherein the at least one
gene involved in DNA replication is selected from the group
consisting of ori, dnaA, dnaN, gyrA, gyrB, polC, dnaE, ftsK, ftsZ,
ligA, dnaG, parC, parE, holB, dnaX, SMC, and ftsY.
13. A bacterium according to claim 1, wherein the one or more genes
essential for multiplication of the bacterium are part of an
operon, and the first attachment site is upstream of all or a
portion of the operon, and the second attachment site is downstream
of all or a portion of the operon.
14. A bacterium according to claim 13, wherein the first attachment
site is upstream of the operon, and the second attachment site is
downstream of the operon.
15. A bacterium according to claim 1, wherein the recombinase is a
Cre recombinase, the regulatory sequences comprise an actA
promoter, the first and second attachment sites comprise loxP
sites, and the gene(s) essential for multiplication of the
bacterium flanked by the first and second attachment sites comprise
the bacterium's origin of replication.
16. A bacterium according to claim 15, wherein the bacterium is
Listeria monocytogenes.
17. A bacterium according to claim 1, wherein the first and second
attachment sites flank a nucleic acid sequence about 20 kb in
length or less.
18. A bacterium according to claim 17, wherein the nucleic acid
sequence is 10 kb in length or less.
19. A bacterium according to claim 18, wherein the nucleic acid
sequence is about 6 kb in length.
20. A bacterium according to claim 1, wherein the bacterium
comprises within the bacterial genome an exogenous nucleic acid
sequence encoding a heterologous polypeptide, wherein the exogenous
nucleic acid sequence is operably connected to regulatory sequences
which preferentially induce expression of the heterologous
polypeptide when the bacterium is in a mammalian host.
Description
CROSS REFERENCES TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/073,737, filed Nov. 6, 2013, now U.S. Pat.
No. 9,511,129, issued Dec. 6, 2016, which claims the benefit of
U.S. Provisional Application No. 61/723,234, filed Nov. 6, 2012,
which is hereby incorporated in its entirety including all tables,
figures, and claims.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Dec. 5, 2016, is named ANZ7000CT_SeqList_Text.txt and is 20,677
bytes in size.
BACKGROUND OF THE INVENTION
[0003] The following discussion of the background of the invention
is merely provided to aid the reader in understanding the invention
and is not admitted to describe or constitute prior art to the
present invention.
[0004] Pathogenic organisms are, by definition, capable of causing
disease in an infected host. For clinical use of such organisms,
attenuated vaccine strains are often created which exhibit reduced
or eliminated virulence, but which still retain sufficient
viability to stimulate a desired immune response against the
pathogen or heterologous antigen(s) of interest. Attenuated vector
platforms have been demonstrated to elicit protective responses
specific for encoded heterologous antigens in a number of
experimental models, including infectious and malignant
diseases.
[0005] Although most attenuated vaccine vectors are viral,
bacterial vaccine vector platforms have been developed for both
prophylactic and therapeutic applications. Attenuated strains of
many otherwise pathogenic bacteria are now available and the ease
of manipulation for generating recombinant strains provides a means
for using bacteria as efficacious delivery vehicles for a number of
foreign proteins such as antigens associated with infectious
diseases and cancer. Live attenuated bacterial vaccine strains have
been developed from, inter alia, Listeria, Escherichia, Salmonella,
Shigella, Lactobacillus, and Yersinia species.
[0006] While such vaccine strains may exhibit reduced virulence,
their safety, particularly in immune compromised individuals,
remains a concern. One example of a strategy to further reduce the
risk of bacterial vaccines is the so-called Killed But
Metabolically Active ("KBMA") approach. KBMA vaccine strains are
constructed by abrogating the capacity for nucleotide excision
repair through deletion of DNA repair genes such as uvrA and uvrB.
The gene deletion renders the bacteria exquisitely sensitive to
photochemical inactivation through the combined treatment of
psoralens and UVA. Because of their inability to repair the
psoralen-induced DNA cross-links formed, KBMA bacterial strains are
unable to replicate and are thus functionally noninfectious. This
characteristic provides an improved safety profile in comparison to
live attenuated strains. The very limited number of cross-links,
however, preserves their metabolic activity, including antigen
expression, and thus their immune potential. Manufacturing of KBMA
strains exhibiting consistent properties, however, may be
difficult, as titration of the number of cross-links is dependent
on a number of difficult to control variables.
[0007] There remains a need in the art to provide attenuated
bacterial vaccine strains with advantageous safety profiles for use
treatment or prevention of diseases having a risk-benefit profile
not appropriate for live attenuated vaccines.
BRIEF SUMMARY OF THE INVENTION
[0008] The present invention provides facultatively attenuated
bacterial species and methods of preparation and use thereof. The
term "facultatively attenuated" as used herein refers to a
bacterium which comprises a set of defined recombinant
modifications which have substantially no effect on the ability of
the bacterium to grow by multiplication when the bacterium is
outside of its host organism, but which result in deletion of one
or more genes essential for multiplication of the bacterium when
the bacterium is introduced into its host organism, for example
within host cells of a vaccinate recipient. These recombinant
modifications take advantage of regulatory sequences which
preferentially induce expression of genes within the mammalian
host.
[0009] As described hereinafter, the bacterium is most preferably
an intracellular pathogen, such as Listeria monocytogenes.
[0010] In a first aspect of the invention, the invention relates to
methods of configuring a bacterium to delete one or more genes in
the bacterial genome which are essential for multiplication of the
bacterium, the deletion occurring preferentially when the bacterium
is introduced into a host. These methods comprise: [0011] (i)
recombinantly introducing into the bacterium a nucleic acid
encoding a recombinase heterologous to the bacterium, wherein the
nucleic acid encoding the recombinase is operably connected to
regulatory sequences which preferentially induce expression of the
recombinase in a mammalian host cell, and [0012] (ii) recombinantly
introducing in the bacterial genome a first attachment site for the
recombinase upstream from the gene(s) essential for multiplication
of the bacterium, and a second attachment site for the recombinase
downstream from the gene(s) essential for multiplication of the
bacterium.
[0013] The recombinase, when specifically induced and expressed in
the mammalian host cell, catalyzes a site specific recombination
event which deletes the gene(s) essential for multiplication of the
bacterium flanked by the first and second attachment sites.
Following this site specific recombination event the bacterium is
deficient for multiplication.
[0014] The phrase "substantially no effect on the ability of the
bacterium to grow by multiplication" as used herein refers to a
bacterium in which colony formation is at least 75% of that of a
bacterium which is otherwise identical, but which lacks the defined
recombinant modifications described above. For convenience, such a
bacterium which lacks the recombinantly introduced recombinase
sequence and the recombinantly introduced first and second
attachment sites are referred to herein as a "wild type" bacterium.
In preferred embodiments, colony formation is at least 80% of that
of a wild type bacterium, more preferably at least 90% of a wild
type bacterium, and most preferably at least 95% of a wild type
bacterium. Colony formation is determined in an in vitro colony
formation assay, and is expressed as colony-forming units
(CFU).
[0015] As used herein with regard to a gene (or genes), the term
"essential for multiplication" refers to a gene that, when deleted,
results in a bacterium in which colony formation is reduced to 1%
of wild type or less, and/or in which the growth of the bacterium
(measured by CFU) in host cells contained in the organism is
reduced by at least 1000-fold relative to wild type. Preferably,
colony formation is reduced to 0.01% of wild type or less. A
bacterium in which such a gene (or genes) has been deleted is
referred to herein as being "deficient for multiplication."
[0016] In the context of the present invention, deletion of a gene
(or genes) essential for multiplication occurs preferentially when
the bacterium is introduced into a host organism. As used herein, a
deletion event occurs "preferentially in a host" if introduction of
the bacterium into the host organism converts a bacterium in which
colony formation is at least 75% of that of a wild type bacterium
into a bacterium in which colony formation is reduced to 1% of wild
type or less. Preferably, colony formation is reduced to 0.01% of
wild type or less.
[0017] The term "regulatory sequences which preferentially induce
expression of the recombinase in the host cell" refer to regulatory
sequences which induce expression of a gene under control thereof
by at least 10-fold upon introduction of the bacterium into a host
organism. By way of example only, expression of genes under the
actA promoter of Listeria is dependent upon a regulatory factor
known as PrfA for transcriptional activation. Relative to
broth-grown Listeria, gene expression under actA/PrfA regulation is
induced approximately 200-fold when Listeria is present in host
cells. Thus, in certain embodiments the regulatory sequences
comprise a Listeria monocytogenes promoter which is PrfA-dependent.
PrfA-dependent promoters may be selected from the group consisting
of the inlA promoter, the inlB promoter, the inlC promoter, the hpt
promoter, the hly promoter, the plcA promoter, the mpl promoter,
and the actA promoter. Similar systems to induce gene expression in
host organisms for other bacterial species are described
hereinafter. In preferred embodiments, such preferentially induced
expression increases at least 50-fold, more preferably at least
100-fold, and still more preferably at least 1000-fold, upon
introduction of the bacterium into a host organism.
[0018] The term "host organism" as used herein refer to an organism
in which the bacterium of interest is able to multiply in the
absence of deletion of a gene (or genes) essential for
multiplication as described herein. In certain embodiments, a host
organism is a mammalian species, most preferably a human. Also, in
certain embodiments, the bacterium is an intracellular pathogen,
and the regulatory sequences preferentially induce expression of
the recombinase when the bacterium is in a mammalian host cell.
Preferred bacterial genuses are selected from the group consisting
of Listeria, Neisseria, Mycobacterium, Francisella, Bacillus,
Salmonella, Shigella, Yersinia, Brucella, Legionella, Rickettsia,
and Chlamydia. This list is not meant to be limiting. Most
preferably, the bacterium is a facultative intracellular bacterium
such as Listeria, Salmonella, Shigella, Francisella, Mycobacterium,
Legionella, Burkholderia and Brucella. In certain exemplary
embodiments described hereinafter, the bacterium is Listeria
monocytogenes, including modified such as Listeria monocytogenes
.DELTA.ActA/.DELTA.InlB (a L. monocytogenes in which the native
ActA and InlB genes have been deleted or rendered functionally
deleted by mutation).
[0019] As noted above, a recombinase sequence which is
recombinantly introduced into a bacterium is heterologous to the
bacterium. As used herein, this term refers to a recombinase which
is not a normal constituent of the bacterial genome. In various
embodiments, the recombinase may be selected from the group
consisting of .phi.C31 integrase, R4 integrase, TP901 integrase,
.phi.BT1 integrase, B.times.B1 integrase, PSA integrase, Cre
recombinase, Flp recombinase, XerC recombinase, .lamda. integrase,
HK022 integrase, P22 integrase, HP1 integrase, L5 integrase,
.gamma..delta. recombinase, Tn3 recombinase, gin recombinase, RV
integrase, SPBc integrase, TG1 integrase, .phi.C1 integrase, MR11
integrase, .phi.370 integrase, .phi.K38 integrase, W.beta.
integrase, and BL3 integrase. Suitable recombinase attachment sites
can include recombinantly introduced attB and attP sites.
[0020] In certain embodiments, the gene(s) essential for
multiplication of the bacterium comprise at least one gene involved
in DNA replication. Such genes may be selected from the group
consisting of ori, dnaA, dnaN, gyrA, gyrB, polC, dnaE, ftsK, ftsZ,
ligA, dnaG, parC, parE, holB, dnaX, SMC, and ftsY.
[0021] As described hereinafter, a plurality of genes essential for
multiplication of the bacterium are often grouped together as a
single operon. In this case, the first attachment site may be
preferentially recombinantly introduced upstream of a portion of
the operon, and the second attachment site recombinantly introduced
downstream of a portion of the operon, such that the site specific
recombination event deletes a plurality of such genes in a single
event. Preferably, the first attachment site is upstream of the
operon, and the second attachment site is downstream of the operon.
The first and second attachment sites can flank a nucleic acid
sequence about 20 kb in length or less, about 10 kb in length or
less, and about 6 kb in length. The term "about" in this context
refers to +/-10% of a given length.
[0022] In certain embodiments, the bacterium is utilized as an
expression platform for expressing one or more genes which are
heterologous to the bacterium, for example for purposes of
generating an immune response to the heterologous proteins
expressed from those genes. In these embodiments, the bacterium can
comprise within the bacterial genome an exogenous nucleic acid
sequence encoding a heterologous polypeptide(s), wherein the
exogenous nucleic acid sequence is operably connected to regulatory
sequences which preferentially induce expression of the
heterologous polypeptide when the bacterium is in a mammalian
host.
[0023] In a related aspect, the invention relates to methods of
deleting one or more genes in a bacterial genome which are
essential for multiplication of a bacterium. These methods comprise
introducing the facultatively attenuated bacterium described herein
to a host organism host under conditions wherein the recombinase is
expressed by the bacterium, and wherein the expressed recombinase
deletes the one or more genes essential for multiplication of the
bacterium by the site specific recombination event.
[0024] In yet another aspect, the present invention relates to a
facultatively attenuated bacterium, or population thereof such as a
bacterial culture, as described herein. Such a bacterium
comprises:
(i) a nucleic acid encoding a recombinase heterologous to the
bacterium, wherein the nucleic acid encoding the recombinase is
operably connected to regulatory sequences which preferentially
induce expression of the recombinase in the host, and (ii) a first
attachment site for the recombinase upstream from the gene(s)
essential for multiplication of the bacterium, and a second
attachment site for the recombinase downstream from the gene(s)
essential for multiplication of the bacterium, wherein the first
and second attachment sites are operably linked such that the
recombinase, when expressed in the mammalian host, catalyzes a site
specific recombination event which deletes the gene(s) essential
for multiplication of the bacterium flanked by the first and second
attachment sites.
[0025] As noted above, in certain embodiments the bacterium is an
intracellular pathogen, and is most preferably a facultative
intracellular bacterium, and the regulatory sequences
preferentially induce expression of the recombinase when the
bacterium is in a mammalian host cell. A suitable bacterium is of a
genus selected from the group consisting of Listeria, Neisseria,
Mycobacterium, Francisella, Bacillus, Salmonella, Shigella,
Yersinia, Brucella, Legionella, Rickettsia, and Chlamydia. This
list is not meant to be limiting. Most preferably, the bacterium is
a facultative intracellular bacterium such as Listeria, Salmonella,
Shigella, Francisella, Mycobacterium, Legionella, Burkholderia, and
Brucella. In certain exemplary embodiments described hereinafter,
the bacterium is Listeria monocytogenes, including modified such as
Listeria monocytogenes .DELTA.ActA/.DELTA.InlB. In certain
embodiments, the gene(s) essential for multiplication of the
bacterium comprise at least one gene involved in DNA replication.
Such genes may be selected from the group consisting of ori, dnaA,
dnaN, gyrA, gyrB, polC, dnaE, ftsK, ftsZ, ligA, dnaG, parC, parE,
holB, dnaX, SMC, and ftsY.
[0026] As also noted above, a recombinase sequence which is
recombinantly introduced into a bacterium is heterologous to the
bacterium. As used herein, this term refers to a recombinase which
is not a normal constituent of the bacterial genome. In various
embodiments, the recombinase may be selected from the group
consisting of .phi.C31 integrase, R4 integrase, TP901 integrase,
.phi.BT1 integrase, B.times.B1 integrase, PSA integrase, Cre
recombinase, Flp recombinase, XerC recombinase, .lamda. integrase,
HK022 integrase, P22 integrase, HP1 integrase, L5 integrase,
.gamma..delta. recombinase, Tn3 recombinase, gin recombinase, RV
integrase, SPBc integrase, TG1 integrase, .phi.C1 integrase, MR11
integrase, .phi.370 integrase, .phi.K38 integrase, W.beta.
integrase, and BL3 integrase. Suitable recombinase attachment sites
can include recombinantly introduced attB and attP sites.
[0027] As described hereinafter, a plurality of genes essential for
multiplication of the bacterium are often grouped together as a
single operon. In this case, the first attachment site may be
preferentially recombinantly introduced upstream of a portion of
the operon, and the second attachment site recombinantly introduced
downstream of a portion of the operon, such that the site specific
recombination event deletes a plurality of such genes in a single
event. Preferably, the first attachment site is upstream of the
operon, and the second attachment site is downstream of the operon.
The first and second attachment sites can flank a nucleic acid
sequence about 20 kb in length or less, about 10 kb in length or
less, about 6 kb in length, or of any length that is sufficient to
inactivate multiplication of the bacterium in the host cell. The
term "about" in this context refers to +/-10% of a given
length.
[0028] The bacterium of the present invention may be utilized as an
expression platform for expressing one or more genes which are
heterologous to the bacterium, for example for purposes of
generating an immune response to the heterologous proteins
expressed from those genes. In these embodiments, the bacterium can
comprise within the bacterial genome an exogenous nucleic acid
sequence encoding a heterologous polypeptide, wherein the exogenous
nucleic acid sequence is operably connected to regulatory sequences
which preferentially induce expression of the heterologous
polypeptide when the bacterium is in a mammalian host.
BRIEF DESCRIPTION OF THE FIGURES
[0029] FIG. 1. Schematic representation of Lm-RIID. (A) In broth
culture or fermentation, Lm-RIID do not express the recombinase,
thus allowing growth and manufacturing of vaccines. (B) After
vaccination, Lm-RIID enter dendritic cells where they
simultaneously express the recombinase that results in bacterial
death and the vaccine antigen which results in specific
immunogenicity.
[0030] FIG. 2. Overview of regions deleted in Lm-RIID strains
[0031] FIG. 3. Deletion 1. (A) Lox recombinase sites flanking
gyrase region (yaaA, recF, gyrB, gyrA); (B) Growth curve in broth
culture; (C) Intracellular growth curve in DC2.4 cells.
[0032] FIG. 4. Deletion 2. (A) Lox recombinase sites flanking
lmo2587, origin, dnaA, dnaN, and lmo0003; (B) Growth curve in BHI
Broth; (C) Intracellular growth curve in DC2.4 cells.
[0033] FIG. 5. Deletion 3. (A) Lox recombinase sites flanking
lmo2582-origin-gyrA region; (B) In vitro growth curve in BHI; (C)
Intracellular growth curve in DC2.4 cells.
[0034] FIG. 6. Deletion 4. (A) Frt recombinase sites flanking the
gyrase region (yaaA, recF, gyrB, gyrA); (B) In vitro growth curve
in BHI; (C) Intracellular growth curve in DC2.4 cells.
[0035] FIG. 7. Comparison of intracellular expression of various
antigens from live attenuated (Lm11) and Lm-RIID (BH3618)
platforms. A-D: Intracellular Western blot of four pairs of strains
in the Lm11 or BH3618 strain background. (A) Lane 1: live Lm strain
Lm11; Lane 2: Lm-RIID strain BH3618; platform strains without added
antigen. (B) Lane 3: live Lm strain BH3943; lane 4: Lm-RIID strain
BH3953; Antigen: ActAN100-Ny-ESO-1-MAGE A3 fusion protein (<).
(C) Lane 5: Live Lm strain BH3947; lane 6: Lm-RIID strain BH3957;
Antigen: ActAN100-HBV Polymerase-HBxAg fusion protein (*). (D) Lane
9: Live Lm strain BH3951; lane 10: Lm-RIID strain BH3961; Antigen:
ActAN100-Plasmodium falciparum CSP fusion protein ().
[0036] FIG. 8. Accelerated clearance and safety of Lm-RIID strains
in immune-competent and immune-deficient mice.
[0037] FIG. 9. Immunogenicity of Lm-RIID strains. Open circles:
unstimulated; gray: stimulated with peptide noted above.
[0038] FIG. 10. Protective immunity to heterologous challenge. (A)
Protection from WT-Lm challenge with live attenuated, KBMA, and
Lm-RIID strains. (B) Protection from a heterologous challenge with
WT vaccinia virus with live-attenuated, KBMA, and Lm-RIID
strains.
[0039] FIG. 11. Therapeutic efficacy of Lm-RIID vaccines in a CT-26
tumor model.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention relates to compositions and methods
for preparing and using facultatively attenuated bacterial species.
The present invention can provide attenuated bacterial vaccine
strains with advantageous safety profiles for use treatment or
prevention of diseases having a risk-benefit profile not
appropriate for live attenuated vaccines.
[0041] While described hereinafter in detail with regard to
Listeria monocytogenes, the skilled artisan will understand that
the methods and compositions described herein are generally
applicable to bacterial species, and in particular to facultative
intracellular bacterial species.
[0042] Listeria monocytogenes (Lm) is a facultative intracellular
bacterium characterized by its ability to induce a profound innate
immune response that leads to robust and highly functional CD4 and
CD8 T cell immunity specific for vaccine-encoded Ags. Lm is a
food-borne bacterium with increased pathogenicity among immune
compromised individuals, including patients with cancer or other
viral-induced immune deficiencies, pregnant women, the elderly and
infants.
[0043] Live-attenuated recombinant Lm vaccine platforms engineered
to encode a designated antigen(s) relevant to a selected targeted
pathogenic agent or malignancy have formed the basis for several
human clinical trials. In particular, genetically defined
live-attenuated Lm .DELTA.actA.DELTA.inlB, which is deleted of two
virulence genes and is attenuated >3 logs in the mouse
listeriosis model, retains its immunologic potency and has been
shown to induce robust CD4 and CD8 T cell immunity in both mouse
models of human disease as well as in humans, and has been shown to
be safe and well-tolerated in clinical settings among patients with
various solid tumor malignancies.
[0044] To prime a desired CD8 T cell response, Lm-based vaccines
must retain the ability to escape from the vacuole of infected
dendritic cells (DCs) in a process mediated by expression of a
pore-forming cytolysin known as listeriolysin O (LLO), and desired
antigens are engineered to be expressed and secreted from bacteria
in the cytoplasm, where they are subsequently processed and
presented on MHC class I molecules. Thus, inactivated Lm vaccines,
such as those inactivated by heat (Heat-Killed Lm; HKLM) and are
not metabolically active and cannot induce a desired CD8 T cell
response that can effectively protect against challenge with a
pathogen containing the vaccine immunogen or conferring efficacy in
tumor-bearing animals. This dichotomy is well-known in the field
and represents a challenge to vaccinologists developing Lm vaccine
platforms that retain immunologic potency that is comparable to
live-attenuated Lm vaccine platforms, yet have the safety of
HKLM.
[0045] Facultatively attenuated Lm, referred to herein as
Recombinase-Induced Intracellular Death (Lm-RIID), has been
developed to address the need for safe and immunologically potent
Lm-based vaccine platforms. Lm-RIID vaccines concurrently express
the vaccine antigen of interest and induce the deletion of genes
essential for bacterial viability after the Lm vaccine strain
escapes into the cytosol of the host cell. Lm-RIID vaccines grow in
broth culture with the same properties as live-attenuated Lm
vaccines such as Lm .DELTA.actA.DELTA.inlB based vaccines, but
commit suicide once inside host cells. This is achieved by flanking
essential target Lm genes with recombinase (e.g., loxP) sites, and
driving expression of a sequence-specific recombinase (e.g., Cre
recombinase) as well as vaccine antigen expression, from promoters
that are specifically induced in the host organism, in this case in
the host cytoplasm. This results in a self-limiting infection even
when administered intravenously into a host animal. As described
hereinafter, Lm-RIID vaccines can be derived from previously
described live-attenuated Lm vaccine strains, for example Lm
.DELTA.actA.DELTA.inlB. Expression of the ActA protein is induced
>200-fold with infected host mammalian cells, compared to broth
culture. However, the PrfA-dependent actA promoter is NOT
substantially induced in broth culture. Lm-RIID vaccines can be
manufactured with the same methods used for growth of
live-attenuated Lm vaccines, such as the Lm .DELTA.actA.DELTA.inlB
strain.
[0046] It is to be understood that the invention is not limited in
its application to the details of construction and to the
arrangements of the components set forth in the following
description or illustrated in the drawings. The invention is
capable of embodiments in addition to those described and of being
practiced and carried out in various ways. Also, it is to be
understood that the phraseology and terminology employed herein, as
well as the abstract, are for the purpose of description and should
not be regarded as limiting.
[0047] As such, those skilled in the art will appreciate that the
conception upon which this disclosure is based may readily be
utilized as a basis for the designing of other structures, methods
and systems for carrying out the several purposes of the present
invention. It is important, therefore, that the claims be regarded
as including such equivalent constructions insofar as they do not
depart from the spirit and scope of the present invention.
1. DEFINITIONS
[0048] Abbreviations used to indicate a mutation in a gene, or a
mutation in a bacterium comprising the gene, are as follows. By way
of example, the abbreviation "L. monocytogenes .DELTA.actA" means
that part, or all, of the actA gene was deleted. The delta symbol
(.DELTA.) means deletion. An abbreviation including a superscripted
minus sign (Listeria ActA.sup.-) means that the actA gene was
mutated, e.g., by way of a deletion, point mutation, or frameshift
mutation, but not limited to these types of mutations.
[0049] "Administration" as it applies to a human, mammal, mammalian
subject, animal, veterinary subject, placebo subject, research
subject, experimental subject, cell, tissue, organ, or biological
fluid, refers without limitation to contact of an exogenous ligand,
reagent, placebo, small molecule, pharmaceutical agent, therapeutic
agent, diagnostic agent, or composition to the subject, cell,
tissue, organ, or biological fluid, and the like. "Administration"
can refer, e.g., to therapeutic, pharmacokinetic, diagnostic,
research, placebo, and experimental methods. Treatment of a cell
encompasses contact of a reagent to the cell, as well as contact of
a reagent to a fluid, where the fluid is in contact with the cell.
"Administration" also encompasses in vitro and ex vivo treatments,
e.g., of a cell, by a reagent, diagnostic, binding composition, or
by another cell.
[0050] An "agonist," as it relates to a ligand and receptor,
comprises a molecule, combination of molecules, a complex, or a
combination of reagents, that stimulates the receptor. For example,
an agonist of granulocyte-macrophage colony stimulating factor
(GM-CSF) can encompass GM-CSF, a mutein or derivative of GM-CSF, a
peptide mimetic of GM-CSF, a small molecule that mimics the
biological function of GM-CSF, or an antibody that stimulates
GM-CSF receptor.
[0051] An "antagonist," as it relates to a ligand and receptor,
comprises a molecule, combination of molecules, or a complex, that
inhibits, counteracts, downregulates, and/or desensitizes the
receptor. "Antagonist" encompasses any reagent that inhibits a
constitutive activity of the receptor. A constitutive activity is
one that is manifest in the absence of a ligand/receptor
interaction. "Antagonist" also encompasses any reagent that
inhibits or prevents a stimulated (or regulated) activity of a
receptor. By way of example, an antagonist of GM-CSF receptor
includes, without implying any limitation, an antibody that binds
to the ligand (GM-CSF) and prevents it from binding to the
receptor, or an antibody that binds to the receptor and prevents
the ligand from binding to the receptor, or where the antibody
locks the receptor in an inactive conformation.
[0052] As used herein, an "analog" or "derivative" with reference
to a peptide, polypeptide or protein refers to another peptide,
polypeptide or protein that possesses a similar or identical
function as the original peptide, polypeptide or protein, but does
not necessarily comprise a similar or identical amino acid sequence
or structure of the original peptide, polypeptide or protein. An
analog preferably satisfies at least one of the following: (a) a
proteinaceous agent having an amino acid sequence that is at least
30%, at least 35%, at least 40%, at least 45%, at least 50%, at
least 55%, at least 60%, at least 65%, at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95% or at least
99% identical to the original amino acid sequence (b) a
proteinaceous agent encoded by a nucleotide sequence that
hybridizes under stringent conditions to a nucleotide sequence
encoding the original amino acid sequence; and (c) a proteinaceous
agent encoded by a nucleotide sequence that is at least 30%, at
least 35%, at least 40%, at least 45%, at least 50%, at least 55%,
at least 60%, at least 65%, at least 70%, at least 75%, at least
80%, at least 85%, at least 90%, at least 95% or at least 99%
identical to the nucleotide sequence encoding the original amino
acid sequence.
[0053] "Antigen presenting cells" (APCs) are cells of the immune
system used for presenting antigen to T cells. APCs include
dendritic cells, monocytes, macrophages, marginal zone Kupffer
cells, microglia, Langerhans cells, T cells, and B cells. Dendritic
cells occur in at least two lineages. The first lineage encompasses
pre-DC1, myeloid DC1, and mature DC1. The second lineage
encompasses CD34.sup.+CD45RA.sup.- early progenitor multipotent
cells, CD34.sup.+CD45RA.sup.+ cells,
CD34.sup.+CD45RA.sup.+CD4.sup.+IL-3Ra.sup.+ pro-DC2 cells,
CD4.sup.+CD11c.sup.- plasmacytoid pre-DC2 cells, lymphoid human DC2
plasmacytoid-derived DC2s, and mature DC2s.
[0054] "Attenuation" and "attenuated" encompasses a bacterium,
virus, parasite, infectious organism, prion, tumor cell, gene in
the infectious organism, and the like, that is modified to reduce
toxicity to a host. The host can be a human or animal host, or an
organ, tissue, or cell. The bacterium, to give a non-limiting
example, can be attenuated to reduce binding to a host cell, to
reduce spread from one host cell to another host cell, to reduce
extracellular growth, or to reduce intracellular growth in a host
cell. Attenuation can be assessed by measuring, e.g., an indicum or
indicia of toxicity, the LD.sub.50, the rate of clearance from an
organ, or the competitive index (see, e.g., Auerbuch, et al. (2001)
Infect. Immunity 69:5953-5957). Generally, an attenuation results
an increase in the LD.sub.50 and/or an increase in the rate of
clearance by at least 25%; more generally by at least 50%; most
generally by at least 100% (2-fold); normally by at least 5-fold;
more normally by at least 10-fold; most normally by at least
50-fold; often by at least 100-fold; more often by at least
500-fold; and most often by at least 1000-fold; usually by at least
5000-fold; more usually by at least 10,000-fold; and most usually
by at least 50,000-fold; and most often by at least
100,000-fold.
[0055] "Attenuated gene" encompasses a gene that mediates toxicity,
pathology, or virulence, to a host, growth within the host, or
survival within the host, where the gene is mutated in a way that
mitigates, reduces, or eliminates the toxicity, pathology, or
virulence. The reduction or elimination can be assessed by
comparing the virulence or toxicity mediated by the mutated gene
with that mediated by the non-mutated (or parent) gene. "Mutated
gene" encompasses deletions, point mutations, and frameshift
mutations in regulatory regions of the gene, coding regions of the
gene, non-coding regions of the gene, or any combination
thereof.
[0056] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, a conservatively modified variant refers to nucleic
acids encoding identical amino acid sequences, or amino acid
sequences that have one or more conservative substitutions. An
example of a conservative substitution is the exchange of an amino
acid in one of the following groups for another amino acid of the
same group (U.S. Pat. No. 5,767,063 issued to Lee, et al.; Kyte and
Doolittle (1982) J. Mol. Biol. 157:105-132).
(1) Hydrophobic: Norleucine, Ile, Val, Leu, Phe, Cys, Met;
[0057] (2) Neutral hydrophilic: Cys, Ser, Thr;
(3) Acidic: Asp, Glu;
(4) Basic: Asn, Gln, His, Lys, Arg;
[0058] (5) Residues that influence chain orientation: Gly, Pro;
(6) Aromatic: Trp, Tyr, Phe; and
[0059] (7) Small amino acids: Gly, Ala, Ser.
[0060] "Effective amount" encompasses, without limitation, an
amount that can ameliorate, reverse, mitigate, prevent, or diagnose
a symptom or sign of a medical condition or disorder. Unless
dictated otherwise, explicitly or by context, an "effective amount"
is not limited to a minimal amount sufficient to ameliorate a
condition.
[0061] An "extracellular fluid" encompasses, e.g., serum, plasma,
blood, interstitial fluid, cerebrospinal fluid, secreted fluids,
lymph, bile, sweat, fecal matter, and urine. An "extracelluar
fluid" can comprise a colloid or a suspension, e.g., whole blood or
coagulated blood.
[0062] The term "fragments" in the context of polypeptides include
a peptide or polypeptide comprising an amino acid sequence of at
least 5 contiguous amino acid residues, at least 10 contiguous
amino acid residues, at least 15 contiguous amino acid residues, at
least 20 contiguous amino acid residues, at least 25 contiguous
amino acid residues, at least 40 contiguous amino acid residues, at
least 50 contiguous amino acid residues, at least 60 contiguous
amino residues, at least 70 contiguous amino acid residues, at
least 80 contiguous amino acid residues, at least 90 contiguous
amino acid residues, at least 100 contiguous amino acid residues,
at least 125 contiguous amino acid residues, at least 150
contiguous amino acid residues, at least 175 contiguous amino acid
residues, at least 200 contiguous amino acid residues, or at least
250 contiguous amino acid residues of the amino acid sequence of a
larger polypeptide.
[0063] "Gene" refers to a nucleic acid sequence encoding an
oligopeptide or polypeptide. The oligopeptide or polypeptide can be
biologically active, antigenically active, biologically inactive,
or antigenically inactive, and the like. The term gene encompasses,
e.g., the sum of the open reading frames (ORFs) encoding a specific
oligopeptide or polypeptide; the sum of the ORFs plus the nucleic
acids encoding introns; the sum of the ORFs and the operably linked
promoter(s); the sum of the ORFS and the operably linked
promoter(s) and any introns; the sum of the ORFS and the operably
linked promoter(s), intron(s), and promoter(s), and other
regulatory elements, such as enhancer(s). In certain embodiments,
"gene" encompasses any sequences required in cis for regulating
expression of the gene. The term gene can also refer to a nucleic
acid that encodes a peptide encompassing an antigen or an
antigenically active fragment of a peptide, oligopeptide,
polypeptide, or protein. The term gene does not necessarily imply
that the encoded peptide or protein has any biological activity, or
even that the peptide or protein is antigenically active. A nucleic
acid sequence encoding a non-expressable sequence is generally
considered a pseudogene. The term gene also encompasses nucleic
acid sequences encoding a ribonucleic acid such as rRNA, tRNA, or a
ribozyme.
[0064] "Growth" of a bacterium such as Listeria encompasses,
without limitation, functions of bacterial physiology and genes
relating to colonization, replication, increase in protein content,
and/or increase in lipid content. Unless specified otherwise
explicitly or by context, growth of a Listeria encompasses growth
of the bacterium outside a host cell, and also growth inside a host
cell. Growth related genes include, without implying any
limitation, those that mediate energy production (e.g., glycolysis,
Krebs cycle, cytochromes), anabolism and/or catabolism of amino
acids, sugars, lipids, minerals, purines, and pyrimidines, nutrient
transport, transcription, translation, and/or replication. In some
embodiments, "growth" of a Listeria bacterium refers to
intracellular growth of the Listeria bacterium, that is, growth
inside a host cell such as a mammalian cell. While intracellular
growth of a Listeria bacterium can be measured by light microscopy
or colony forming unit (CFU) assays, growth is not to be limited by
any technique of measurement. Biochemical parameters such as the
quantity of a Listerial antigen, Listerial nucleic acid sequence,
or lipid specific to the Listeria bacterium, can be used to assess
growth. In some embodiments, a gene that mediates growth is one
that specifically mediates intracellular growth. In some
embodiments, a gene that specifically mediates intracellular growth
encompasses, but is not limited to, a gene where inactivation of
the gene reduces the rate of intracellular growth but does not
detectably, substantially, or appreciably, reduce the rate of
extracellular growth (e.g., growth in broth), or a gene where
inactivation of the gene reduces the rate of intracellular growth
to a greater extent than it reduces the rate of extracellular
growth. To provide a non-limiting example, in some embodiments, a
gene where inactivation reduces the rate of intracellular growth to
a greater extent than extracellular growth encompasses the
situation where inactivation reduces intracellular growth to less
than 50% the normal or maximal value, but reduces extracellular
growth to only 1-5%, 5-10%, or 10-15% the maximal value. The
invention, in certain aspects, encompasses a Listeria attenuated in
intracellular growth but not attenuated in extracellular growth, a
Listeria not attenuated in intracellular growth and not attenuated
in extracellular growth, as well as a Listeria not attenuated in
intracellular growth but attenuated in extracellular growth.
[0065] A composition that is "labeled" is detectable, either
directly or indirectly, by spectroscopic, photochemical,
biochemical, immunochemical, isotopic, or chemical methods. For
example, useful labels include .sup.32P, .sup.33P, .sup.35S,
.sup.14C, .sup.3H, .sup.125I, stable isotopes, epitope tags,
fluorescent dyes, electron-dense reagents, substrates, or enzymes,
e.g., as used in enzyme-linked immunoassays, or fluorettes (see,
e.g., Rozinov and Nolan (1998) Chem. Biol. 5:713-728).
[0066] "Ligand" refers to a small molecule, peptide, polypeptide,
or membrane associated or membrane-bound molecule, that is an
agonist or antagonist of a receptor. "Ligand" also encompasses a
binding agent that is not an agonist or antagonist, and has no
agonist or antagonist properties. By convention, where a ligand is
membrane-bound on a first cell, the receptor usually occurs on a
second cell. The second cell may have the same identity (the same
name), or it may have a different identity (a different name), as
the first cell. A ligand or receptor may be entirely intracellular,
that is, it may reside in the cytosol, nucleus, or in some other
intracellular compartment. The ligand or receptor may change its
location, e.g., from an intracellular compartment to the outer face
of the plasma membrane. The complex of a ligand and receptor is
termed a "ligand receptor complex." Where a ligand and receptor are
involved in a signaling pathway, the ligand occurs at an upstream
position and the receptor occurs at a downstream position of the
signaling pathway.
[0067] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single stranded,
double-stranded form, or multi-stranded form. Non-limiting examples
of a nucleic acid are a, e.g., cDNA, mRNA, oligonucleotide, and
polynucleotide. A particular nucleic acid sequence can also
implicitly encompasses "allelic variants" and "splice
variants."
[0068] "Operably linked" in the context of a promoter and a nucleic
acid encoding a mRNA means that the promoter can be used to
initiate transcription of that nucleic acid.
[0069] The terms "percent sequence identity" and "% sequence
identity" refer to the percentage of sequence similarity found by a
comparison or alignment of two or more amino acid or nucleic acid
sequences. Percent identity can be determined by a direct
comparison of the sequence information between two molecules by
aligning the sequences, counting the exact number of matches
between the two aligned sequences, dividing by the length of the
shorter sequence, and multiplying the result by 100. An algorithm
for calculating percent identity is the Smith-Waterman homology
search algorithm (see, e.g., Kann and Goldstein (2002) Proteins
48:367-376; Arslan, et al. (2001) Bioinformatics 17:327-337).
[0070] By "purified" and "isolated" is meant, when referring to a
polypeptide, that the polypeptide is present in the substantial
absence of the other biological macromolecules with which it is
associated in nature. The term "purified" as used herein means that
an identified polypeptide often accounts for at least 50%, more
often accounts for at least 60%, typically accounts for at least
70%, more typically accounts for at least 75%, most typically
accounts for at least 80%, usually accounts for at least 85%, more
usually accounts for at least 90%, most usually accounts for at
least 95%, and conventionally accounts for at least 98% by weight,
or greater, of the polypeptides present. The weights of water,
buffers, salts, detergents, reductants, protease inhibitors,
stabilizers (including an added protein such as albumin), and
excipients, and molecules having a molecular weight of less than
1000, are generally not used in the determination of polypeptide
purity. See, e.g., discussion of purity in U.S. Pat. No. 6,090,611
issued to Covacci, et al.
[0071] "Peptide" refers to a short sequence of amino acids, where
the amino acids are connected to each other by peptide bonds. A
peptide may occur free or bound to another moiety, such as a
macromolecule, lipid, oligo- or polysaccharide, and/or a
polypeptide. Where a peptide is incorporated into a polypeptide
chain, the term "peptide" may still be used to refer specifically
to the short sequence of amino acids. A "peptide" may be connected
to another moiety by way of a peptide bond or some other type of
linkage. A peptide is at least two amino acids in length and
generally less than about 25 amino acids in length, where the
maximal length is a function of custom or context. The terms
"peptide" and "oligopeptide" may be used interchangeably.
[0072] "Protein" generally refers to the sequence of amino acids
comprising a polypeptide chain. Protein may also refer to a three
dimensional structure of the polypeptide. "Denatured protein"
refers to a partially denatured polypeptide, having some residual
three dimensional structure or, alternatively, to an essentially
random three dimensional structure, i.e., totally denatured. The
invention encompasses reagents of, and methods using, polypeptide
variants, e.g., involving glycosylation, phosphorylation,
sulfation, disulfide bond formation, deamidation, isomerization,
cleavage points in signal or leader sequence processing, covalent
and non-covalently bound cofactors, oxidized variants, and the
like. The formation of disulfide linked proteins is described (see,
e.g., Woycechowsky and Raines (2000) Curr. Opin. Chem. Biol.
4:533-539; Creighton, et al. (1995) Trends Biotechnol.
13:18-23).
[0073] "Recombinant" when used with reference, e.g., to a nucleic
acid, cell, animal, virus, plasmid, vector, or the like, indicates
modification by the introduction of an exogenous, non-native
nucleic acid, alteration of a native nucleic acid, or by derivation
in whole or in part from a recombinant nucleic acid, cell, virus,
plasmid, or vector. Recombinant protein refers to a protein
derived, e.g., from a recombinant nucleic acid, virus, plasmid,
vector, or the like. "Recombinant bacterium" encompasses a
bacterium where the genome is engineered by recombinant methods,
e.g., by way of a mutation, deletion, insertion, and/or a
rearrangement. "Recombinant bacterium" also encompasses a bacterium
modified to include a recombinant extra-genomic nucleic acid, e.g.,
a plasmid or a second chromosome, or a bacterium where an existing
extra-genomic nucleic acid is altered.
[0074] "Sample" refers to a sample from a human, animal, placebo,
or research sample, e.g., a cell, tissue, organ, fluid, gas,
aerosol, slurry, colloid, or coagulated material. The "sample" may
be tested in vivo, e.g., without removal from the human or animal,
or it may be tested in vitro. The sample may be tested after
processing, e.g., by histological methods. "Sample" also refers,
e.g., to a cell comprising a fluid or tissue sample or a cell
separated from a fluid or tissue sample. "Sample" may also refer to
a cell, tissue, organ, or fluid that is freshly taken from a human
or animal, or to a cell, tissue, organ, or fluid that is processed
or stored.
[0075] A "selectable marker" encompasses a nucleic acid that allows
one to select for or against a cell that contains the selectable
marker. Examples of selectable markers include, without limitation,
e.g.: (1) A nucleic acid encoding a product providing resistance to
an otherwise toxic compound (e.g., an antibiotic), or encoding
susceptibility to an otherwise harmless compound (e.g., sucrose);
(2) A nucleic acid encoding a product that is otherwise lacking in
the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) A
nucleic acid encoding a product that suppresses an activity of a
gene product; (4) A nucleic acid that encodes a product that can be
readily identified (e.g., phenotypic markers such as
beta-galactosidase, green fluorescent protein (GFP), cell surface
proteins, an epitope tag, a FLAG tag); (5) A nucleic acid that can
be identified by hybridization techniques, for example, PCR or
molecular beacons.
[0076] "Specifically" or "selectively" binds, when referring to a
ligand/receptor, nucleic acid/complementary nucleic acid,
antibody/antigen, or other binding pair (e.g., a cytokine to a
cytokine receptor) indicates a binding reaction which is
determinative of the presence of the protein in a heterogeneous
population of proteins and other biologics. Thus, under designated
conditions, a specified ligand binds to a particular receptor and
does not bind in a significant amount to other proteins present in
the sample. Specific binding can also mean, e.g., that the binding
compound, nucleic acid ligand, antibody, or binding composition
derived from the antigen-binding site of an antibody, of the
contemplated method binds to its target with an affinity that is
often at least 25% greater, more often at least 50% greater, most
often at least 100% (2-fold) greater, normally at least ten times
greater, more normally at least 20-times greater, and most normally
at least 100-times greater than the affinity with any other binding
compound.
[0077] In a typical embodiment an antibody will have an affinity
that is greater than about 10.sup.9 liters/mol, as determined,
e.g., by Scatchard analysis (Munsen, et al. (1980) Analyt. Biochem.
107:220-239). It is recognized by the skilled artisan that some
binding compounds can specifically bind to more than one target,
e.g., an antibody specifically binds to its antigen, to lectins by
way of the antibody's oligosaccharide, and/or to an Fc receptor by
way of the antibody's Fc region.
[0078] "Spread" of a bacterium encompasses "cell to cell spread,"
that is, transmission of the bacterium from a first host cell to a
second host cell, as mediated, for example, by a vesicle. Functions
relating to spread include, but are not limited to, e.g., formation
of an actin tail, formation of a pseudopod-like extension, and
formation of a double-membraned vacuole.
[0079] The term "subject" as used herein refers to a human or
non-human organism. Thus, the methods and compositions described
herein are applicable to both human and veterinary disease. In
certain embodiments, subjects are "patients," i.e., living humans
that are receiving medical care for a disease or condition. This
includes persons with no defined illness who are being investigated
for signs of pathology.
[0080] The "target site" of a recombinase is the nucleic acid
sequence or region that is recognized, bound, and/or acted upon by
the recombinase (see, e.g., U.S. Pat. No. 6,379,943 issued to
Graham, et al.; Smith and Thorpe (2002) Mol. Microbiol. 44:299-307;
Groth and Calos (2004) J. Mol. Biol. 335:667-678; Nunes-Duby, et
al. (1998) Nucleic Acids Res. 26:391-406).
[0081] "Therapeutically effective amount" is defined as an amount
of a reagent or pharmaceutical composition that is sufficient to
induce a desired immune response specific for encoded heterologous
antigens, show a patient benefit, i.e., to cause a decrease,
prevention, or amelioration of the symptoms of the condition being
treated. When the agent or pharmaceutical composition comprises a
diagnostic agent, a "diagnostically effective amount" is defined as
an amount that is sufficient to produce a signal, image, or other
diagnostic parameter. Effective amounts of the pharmaceutical
formulation will vary according to factors such as the degree of
susceptibility of the individual, the age, gender, and weight of
the individual, and idiosyncratic responses of the individual (see,
e.g., U.S. Pat. No. 5,888,530 issued to Netti, et al.).
[0082] "Treatment" or "treating" (with respect to a condition or a
disease) is an approach for obtaining beneficial or desired results
including and preferably clinical results. For purposes of this
invention, beneficial or desired results with respect to a disease
include, but are not limited to, one or more of the following:
improving a condition associated with a disease, curing a disease,
lessening severity of a disease, delaying progression of a disease,
alleviating one or more symptoms associated with a disease,
increasing the quality of life of one suffering from a disease,
and/or prolonging survival. Likewise, for purposes of this
invention, beneficial or desired results with respect to a
condition include, but are not limited to, one or more of the
following: improving a condition, curing a condition, lessening
severity of a condition, delaying progression of a condition,
alleviating one or more symptoms associated with a condition,
increasing the quality of life of one suffering from a condition,
and/or prolonging survival.
[0083] "Vaccine" encompasses preventative vaccines. Vaccine also
encompasses therapeutic vaccines, e.g., a vaccine administered to a
mammal that comprises a condition or disorder associated with the
antigen or epitope provided by the vaccine. A number of bacterial
species have been developed for use as vaccines and can be used in
the present invention, including, but not limited to, Shigella
flexneri, Escherichia coli, Listeria monocytogenes, Yersinia
enterocolitica, Salmonella typhimurium, Salmonella typhi or
mycobacterium species. This list is not meant to be limiting. See,
e.g., WO04/006837; WO07/103225; and WO07/117371, each of which is
hereby incorporated by reference in its entirety, including all
tables, figures, and claims. The bacterial vector used in the
vaccine composition may be a facultative, intracellular bacterial
vector. The bacterium may be used to deliver a polypeptide
described herein to antigen-presenting cells in the host organism.
As described herein, L. monocytogenes provides a preferred vaccine
platform for expression of the antigens of the present
invention.
2. TARGETING ESSENTIAL GENES FOR FACULTATIVE DELETION
[0084] Bacteria engineered for Recombinase-Induced Intracellular
Death (RIID) are programmed to "commit suicide" by linking
expression of a recombinantly introduced recombinase gene to a
promoter that is facultatively expressed when the bacterium is in a
host organism. By way of example below, expression of the
recombinase can be made facultative in Listeria using a
PrfA-dependent promoter which may be selected from the inlA
promoter, the inlB promoter, the inlC promoter, the hpt promoter,
the hly promoter, the plcA promoter, the mpl promoter, and the actA
promoter. PrfA is a transcription factor activated intracellularly
which induces expression of linked genes in appropriately
engineered vaccine strains.
[0085] The sequence of L. monocytogenes PrfA is as follows (SEQ ID
NO: 1):
TABLE-US-00001 MNAQAEEFKK YLETNGIKPK QFHKKELIFN QWDPQEYCIF
LYDGITKLTS 50 ISENGTIMNL QYYKGAFVIM SGFIDTETSV GYYNLEVISE
QATAYVIKIN 100 ELKELLSKNL THFFYVFQTL QKQVSYSLAK FNDFSINGKL
GSICGQLLIL 150 TYVYGKETPD GIKITLDNLT MQELGYSSGI AHSSAVSRII
SKLKQEKVIV 200 YKNSCFYVQN LDYLKRYAPK LDEWFYLACP ATWGKLN 237
[0086] As noted above, in the following examples expression of the
actA gene is responsive to PrfA, and the actA promoter is a PrfA
responsive regulatory element. The actA promoter is a suitable
promoter for facultative high-level expression of recombinase
genes, as ActA is the most abundantly expressed Listeria protein
and its expression is induced >200-fold within infected cells as
compared to in vitro culture conditions.
[0087] Other regulatory systems which may be used in a manner
similar to that of Listeria PrfA include the following:
TABLE-US-00002 genus species regulator Mycobacterium tuberculosis
PhoP, ArsR Francisella tularensis MigR Salmonella enterica SlyA,
SsrB Shigella flexneri VirB Burkholderia cenocepacia ShvR Brucella
melitensis BlxR Legionella pneumophila PmrA Yersinia pestis,
enterocolitica RovA Bacillus anthracis AtxA Staphylococcus aureus
SarA
[0088] In the following examples, expression of Cre recombinase is
linked to the actA promoter for expression in Listeria. In
alternatives, recombinases such as .phi.C31 integrase, R4
integrase, TP901 integrase, .phi.BT1 integrase, B.times.B1
integrase, PSA integrase, Cre recombinase, Flp recombinase, XerC
recombinase, .lamda. integrase, HK022 integrase, P22 integrase, HP1
integrase, L5 integrase, .gamma..delta. recombinase, Tn3
recombinase, gin recombinase, RV integrase, SPBc integrase, TG1
integrase, .phi.C1 integrase, MR11 integrase, .phi.370 integrase,
.phi.K38 integrase, W.beta. integrase, and BL3 integrase may find
use in the present invention in a manner similar to that shown
below for Cre recombinase.
[0089] Upon expression, Cre excises a bacterial gene required for
viability that has been targeted for deletion by the recombinant
introduction of flanking recombinase binding sites (e.g., loxP).
Advantageously, mutant recombinase sites such as lox66 and lox71
mutant lox P sites may be utilized. Unlike native loxP, lox66 and
lox71 sites which are joined following excision of the targeted
gene(s) cannot be used subsequently as a template for Cre-mediated
recombination, thus driving the equilibrium of excision to
completion.
[0090] Targeting deletion genes essential for DNA replication
(e.g., gyrA, gyrB) results in bacterial cell death in infected
cells, as compared to its isogenic parent Listeria strain. However,
because the actA promoter is not induced during fermentation,
growth of RIID Lm in bacterial growth media is indistinguishable
from the parent strain. Expression of Lm-encoded antigens can also
be induced in the infected APC using a PrfA-dependent promoter such
as ActA, where synthesized antigens are secreted from the listerial
bacterium into the cytosol through linkage with a bacterial signal
peptide/chaperone and then processed and presented via the MHC
class I pathway. Although RIID Lm strain is programmed for death
post-infection of APCs, the vaccine still elicits potent CD8 T cell
responses that are comparable to vaccination with an isogenic
live-attenuated Lm vaccine strain.
[0091] The following is a non-limiting list of exemplary genes
involved in DNA replication which may be targeted for excision in
the RIID approach.
ori (origin of replication) dnaA (replication initiation) dnaN (DNA
polymerase III, beta subunit) gyrA (DNA gyrase, subunit A) gyrB
(DNA gyrase, subunit B) polC (DNA polymerase III, alpha subunit)
dnaE (DNA polymerase III, alpha subunit) ftsK (DNA translocase,
chromosome separation) ftsZ (tubulin-like, septation) ligA (DNA
ligase) dnaG (DNA primase) parC (topo IV subunit) parE (topo IV
subunit) holB (DNA polymerase III, delta subunit) dnaX (DNA
polymerase III, gamma and tau subunits) SMC (chromosome
segregation)
[0092] Preferred but non-limiting examples of genes to target for
deletion include those that are involved in replication and
bacterial cell division such as polC, dnaE, ftsK, ftsZ, ligA, dnaG,
parC, parE, holB, dnaX, SMC, and ftsY. There are additional gene
targets that are essential for the multiplication of Listeria that
may be targeted for intracellular excision as an alternative, or in
addition to, genes involved in DNA replication. Since Lm RIID
strains have utility as a vaccine platform, in which Ag expression
de novo is required for vaccine potency (Brockstedt et. al., 2005),
one must consider the impact of the excised gene(s) on antigen
expression/secretion to select gene targets. In a preferred
embodiment, genes encoding proteins involved in RNA transcription
and protein synthesis should be avoided because of a potential
decrease of immunologic potency, which may not be desired for
particular uses. Other preferred non-limiting examples include
targeting bacterial genes affecting virulence, such as hly and
dacA. It will be clear to the skilled artisan that any gene
targeted for deletion in the cytosol of the infected host cell can
be accomplished by the methods described herein, accordingly:
First, the inter-genic regions upstream and downstream of the
essential gene(s) to be deleted is identified; second PCR primers
that include the desired loxP variants are designed; third, the
corresponding allelic exchange vectors to insert the lox sites in
the non-essential/inter-genic space are constructed; and, fourth,
the lox sites are sequentially inserted into the Listeria vaccine
strain by allelic exchange. Alternatively, it will be apparent to
the skilled artisan that if the gene to be targeted for deletion is
small, than both lox sites can be added with a single allelic
exchange step. In still a further embodiment, the PactA-Cre
cassette for induction of Cre recombinase expression in the cytosol
of the infected cell can be introduced at alternate locations that
are either amenable to site-specific integration (e.g. comK using
pPL1) or any chromosomal location that is amenable to insertion
using allelic exchange methodology. In yet another embodiment,
PrfA-dependent promoters other than actA can be used for the
cytosolic induced expression of Cre recombinase; inlC is a
non-limiting example of an alternative promoter.
[0093] As an alternative to the Cre/lox strategy discussed above,
genes essential for the multiplication of Listeria that can also be
targeted for intracellular excision with FLP recombinase and frt
sites. First, the inter-genic regions upstream and downstream of
the essential gene(s) to be deleted is identified; second PCR
primers that include the desired frt sites are designed; third, the
corresponding allelic exchange vectors to insert the frt sites in
the non-essential/inter-genic space are constructed; and, fourth,
the frt sites are sequentially inserted into the Listeria vaccine
strain by allelic exchange. Alternatively, it will be apparent to
the skilled artisan that if the gene to be targeted for deletion is
small, than both frt sites can be added with a single allelic
exchange step. In still a further embodiment, the PactA-FLP
cassette for induction of FLP recombinase expression in the cytosol
of the infected cell can be introduced at alternate locations that
are either amenable to site-specific integration (e.g. comK using
pPL1) or any chromosomal location that is amenable to insertion
using allelic exchange methodology.
4. ANTIGENIC CONSTRUCTS
[0094] Target Antigens
[0095] A preferred feature of the RIID bacteria described herein
when used as a vaccine platform is the ability to initiate both the
innate immune response as well as an antigen-specific T cell
response against the recombinantly expressed antigen(s). For
example, L. monocytogenes expressing the antigen(s) described
herein can induce Type 1 interferon (IFN-.alpha./.beta.) and a
cascade of co-regulated chemokine and cytokine protein which shape
the nature of the vaccine-induce immune response. In response to
this immune stimulation, NK cells and antigen presenting cells
(APCs) are recruited to the liver following intravenous vaccination
routes, or, alternatively to the vaccination site following other
routes of vaccination, for example, by intramuscular, subcutaneous,
or intradermal immunization routes. In certain embodiments, the
vaccine platform of the present invention induces an increase at 24
hours following delivery of the vaccine platform to the subject in
the serum concentration of one or more, and preferably all,
cytokines and chemokines selected from the group consisting of
IL-12p70, IFN-.gamma., IL-6, TNF .alpha., and MCP-1; and induces a
CD4+ and/or CD8+ antigen-specific T cell response against one or
more antigens expressed by the vaccine platform. In other
embodiments, the vaccine platform of the present invention also
induces the maturation of resident immature liver NK cells as
demonstrated by the upregulation of activation markers such as DX5,
CD11b, and CD43 in a mouse model system, or by NK cell-mediated
cytolytic activity measured using .sup.51Cr-labeled YAC-1 cells
that were used as target cells.
[0096] The ability of L. monocytogenes to serve as a vaccine vector
has been reviewed in Wesikirch, et al., Immunol. Rev. 158:159-169
(1997). A number of desirable features of the natural biology of L.
monocytogenes make it an attractive platform for application to a
therapeutic vaccine. The central rationale is that the
intracellular lifecycle of L. monocytogenes enables effective
stimulation of CD4+ and CD8+ T cell immunity. Multiple pathogen
associated molecular pattern (PAMP) receptors including TLRs (TLR2,
TLR5, TLR9) nucleotide-binding oligomerization domains (NOD), and
Stimulator of Interferon Genes (STING) are triggered in response to
interaction with L. monocytogenes macromolecules upon infection,
resulting in the pan-activation of innate immune effectors and
release of Th-1 polarizing cytokines, exerting a profound impact on
the development of a CD4+ and CD8+ T cell response against the
expressed antigens.
[0097] Strains of L. monocytogenes have recently been developed as
effective intracellular delivery vehicles of heterologous proteins
providing delivery of antigens to the immune system to induce an
immune response to clinical conditions that do not permit injection
of the disease-causing agent, such as cancer and HIV. See, e.g.,
U.S. Pat. No. 6,051,237; Gunn et al., J. Immunol., 167:6471-6479
(2001); Liau, et al., Cancer Research, 62: 2287-2293 (2002); U.S.
Pat. No. 6,099,848; WO 99/25376; WO 96/14087; and U.S. Pat. No.
5,830,702), each of which is hereby incorporated by reference in
its entirety, including all tables, figures, and claims. A
recombinant L. monocytogenes vaccine expressing an lymphocytic
choriomeningitis virus (LCMV) antigen has also been shown to induce
protective cell-mediated immunity to the antigen (Shen et al.,
Proc. Natl. Acad. Sci. USA, 92: 3987-3991 (1995).
[0098] In certain embodiments, the L. monocytogenes used in the
vaccine compositions of the present invention is RIID strain which
further comprises an attenuating mutation in actA and/or inlB, and
preferably a deletion of all or a portion of actA and inlB
(referred to herein as "Lm .DELTA.actA/.DELTA.inlB"), and contains
recombinant DNA encoding for the expression of the one or more
antigen(s) of interest. The antigen(s) are preferably under the
control of bacterial expression sequences and are stably integrated
into the L. monocytogenes genome.
[0099] The invention also contemplates a Listeria attenuated in at
least one regulatory factor, e.g., a promoter or a transcription
factor. The following concerns promoters. ActA expression is
regulated by two different promoters (Vazwuez-Boland, et al. (1992)
Infect. Immun. 60:219-230). Together, InlA and InlB expression is
regulated by five promoters (Lingnau, et al. (1995) Infect. Immun.
63:3896-3903). The transcription factor prfA is required for
transcription of a number of L. monocytogenes genes, e.g., hly,
plcA, ActA, mpl, prfA, and iap. PrfA's regulatory properties are
mediated by, e.g., the PrfA-dependent promoter (PinlC) and the
PrfA-box. The present invention, in certain embodiments, provides a
nucleic acid encoding inactivated, mutated, or deleted in at least
one of ActA promoter, inlB promoter, PrfA, PinlC, PrfA box, and the
like (see, e.g., Lalic Mullthaler, et al. (2001) Mol. Microbiol.
42:111-120; Shetron-Rama, et al. (2003) Mol. Microbiol.
48:1537-1551; Luo, et al. (2004) Mol. Microbiol. 52:39-52). PrfA
can be made constitutively active by a Gly145Ser mutation,
Gly155Ser mutation, or Glu77Lys mutation (see, e.g., Mueller and
Freitag (2005) Infect. Immun. 73:1917-1926; Wong and Freitag (2004)
J. Bacteriol. 186:6265-6276; Ripio, et al. (1997) J. Bacteriol.
179:1533-1540).
[0100] Examples of target antigens that may find use in the
invention are listed in the following table. The target antigen may
also be a fragment or fusion polypeptide comprising an
immunologically active portion of the antigens listed in the table.
This list is not meant to be limiting.
TABLE-US-00003 TABLE 1 Antigens. Antigen Reference Tumor antigens
Mesothelin GenBank Acc. No. NM_0005823; U40434; NM_013404; BC003512
(see also, e.g., Hassan, et al. (2004) Clin. Cancer Res. 10:
3937-3942; Muminova, et al. (2004) BMC Cancer 4: 19;
Iacobuzio-Donahue, et al. (2003) Cancer Res. 63: 8614-8622). Wilms'
tumor-1 WT-1 isoform A (GenBank Acc. Nos. NM_000378; NP_000369).
associated protein WT-1 isoform B (GenBank Acc. Nos. NM_024424;
NP_077742). (Wt-1), including WT-1 isoform C (GenBank Acc. Nos.
NM_024425; NP_077743). isoform A; isoform B; WT-1 isoform D
(GenBank Acc. Nos. NM_024426; NP_077744). isoform C; isoform D.
Stratum corneum GenBank Acc. No. NM_0005046; NM_139277; AF332583.
See also, chymotryptic enzyme e.g., Bondurant, et al. (2005) Clin.
Cancer Res. 11: 3446-3454; Santin, (SCCE), and variants et al.
(2004) Gynecol. Oncol. 94: 283-288; Shigemasa, et al. (2001)
thereof. Int. J. Gynecol. Cancer 11: 454-461; Sepehr, et al. (2001)
Oncogene 20: 7368-7374. MHC class I See, e.g., Groh, et al. (2005)
Proc. Natl. Acad. Sci. USA 102: 6461- chain-related protein A 6466;
GenBank Acc. Nos. NM_000247; BC_016929; AY750850; (MICA); MHC class
I NM_005931. chain-related protein A (MICB). Gastrin and peptides
Harris, et al. (2004) Cancer Res. 64: 5624-5631; Gilliam, et al.
(2004) derived from gastrin; Eur. J. Surg. Oncol. 30: 536-543;
Laheru and Jaffee (2005) Nature gastrin/CCK-2 receptor Reviews
Cancer 5: 459-467. (also known as CCK-B). Glypican-3 (an antigen
GenBank Acc. No. NM_004484. Nakatsura, et al. (2003) Biochem. of,
e.g., hepatocellular Biophys. Res. Commun. 306: 16-25; Capurro, et
al. (2003) carcinoma and Gasteroenterol. 125: 89-97; Nakatsura, et
al. (2004) Clin. Cancer Res. melanoma). 10: 6612-6621).
Coactosin-like protein. Nakatsura, et al. (2002) Eur. J. Immunol.
32: 826-836; Laheru and Jaffee (2005) Nature Reviews Cancer 5:
459-467. Prostate stem cell GenBank Acc. No. AF043498; AR026974;
AR302232 (see also, e.g., antigen (PSCA). Argani, et al. (2001)
Cancer Res. 61: 4320-4324; Christiansen, et al. (2003) Prostate 55:
9-19; Fuessel, et al. (2003) 23: 221-228). Prostate acid Small, et
al. (2000) J. Clin. Oncol. 18: 3894-3903; Altwein and phosphatase
(PAP); Luboldt (1999) Urol. Int. 63: 62-71; Chan, et al. (1999)
Prostate 41: 99- prostate-specific 109; Ito, et al. (2005) Cancer
103: 242-250; Schmittgen, et al. (2003) antigen (PSA); PSM; Int. J.
Cancer 107: 323-329; Millon, et al. (1999) Eur. Urol. 36: 278-
PSMA. 285. Six-transmembrane See, e.g., Machlenkin, et al. (2005)
Cancer Res. 65: 6435-6442; epithelial antigen of GenBank Acc. No.
NM_018234; NM_001008410; NM_182915; prostate (STEAP). NM_024636;
NM_012449; BC011802. Prostate carcinoma See, e.g., Machlenkin, et
al. (2005) Cancer Res. 65: 6435-6442; tumor antigen-1 GenBank Acc.
No. L78132. (PCTA-1). Prostate See, e.g., Machlenkin, et al. (2005)
Cancer Res. 65: 6435-6442). tumor-inducing gene-1 (PTI-1).
Prostate-specific gene See, e.g., Machlenkin, et al. (2005) Cancer
Res. 65: 6435-6442). with homology to G protein-coupled receptor.
Prostase (an antrogen See, e.g., Machlenkin, et al. (2005) Cancer
Res. 65: 6435-6442; regulated serine GenBank Acc. No. BC096178;
BC096176; BC096175. protease). Proteinase 3. GenBank Acc. No.
X55668. Cancer-testis antigens, GenBank Acc. No. NM_001327
(NY-ESO-1) (see also, e.g., Li, et al. e.g., NY-ESO-1; SCP- (2005)
Clin. Cancer Res. 11: 1809-1814; Chen, et al. (2004) Proc. 1;
SSX-1; SSX-2; SSX- Natl. Acad. Sci. USA. 101(25): 9363-9368;
Kubuschok, et al. (2004) 4; GAGE, CT7; CT8; Int. J. Cancer. 109:
568-575; Scanlan, et al. (2004) Cancer Immun. CT10; MAGE-1; 4: 1;
Scanlan, et al. (2002) Cancer Res. 62: 4041-4047; Scanlan, et al.
MAGE-2; MAGE-3; (2000) Cancer Lett. 150: 155-164; Dalerba, et al.
(2001) Int. J. Cancer MAGE-4; MAGE-6; 93: 85-90; Ries, et al.
(2005) Int. J. Oncol. 26: 817-824. LAGE-1. MAGE-A1, Otte, et al.
(2001) Cancer Res. 61: 6682-6687; Lee, et al. (2003) Proc. MAGE-A2;
Natl. Acad. Sci. USA 100: 2651-2656; Sarcevic, et al. (2003)
MAGE-A3; Oncology 64: 443-449; Lin, et al. (2004) Clin. Cancer Res.
10: 5708- MAGE-A4; 5716. MAGE-A6; MAGE-A9; MAGE-A10; MAGE-A12;
GAGE-3/6; NT-SAR-35; BAGE; CA125. GAGE-1; GAGE-2; De Backer, et al.
(1999) Cancer Res. 59: 3157-3165; Scarcella, et al. GAGE-3; GAGE-4;
(1999) Clin. Cancer Res. 5: 335-341. GAGE-5; GAGE-6; GAGE-7;
GAGE-8; GAGE-65; GAGE-11; GAGE-13; GAGE-7B. HIP1R; LMNA; Scanlan,
et al. (2002) Cancer Res. 62: 4041-4047. KIAA1416; Seb4D; KNSL6;
TRIP4; MBD2; HCAC5; MAGEA3. DAM family of genes, Fleishhauer, et
al. (1998) Cancer Res. 58: 2969-2972. e.g., DAM-1; DAM-6. RCAS1.
Enjoji, et al. (2004) Dig. Dis. Sci. 49: 1654-1656. RU2. Van Den
Eynde, et al. (1999) J. Exp. Med. 190: 1793-1800. CAMEL. Slager, et
al. (2004) J. Immunol. 172: 5095-5102; Slager, et al. (2004) Cancer
Gene Ther. 11: 227-236. Colon cancer associated Scanlan, et al.
(2002) Cancer Res. 62: 4041-4047. antigens, e.g., NY-CO-8; NY-CO-9;
NY-CO-13; NY-CO-16; NY-CO-20; NY-CO-38; NY-CO-45; NY-CO-9/HDAC5;
NY-CO-41/MBD2; NY-CO-42/TRIP4; NY-CO-95/KIAA1416; KNSL6; seb4D.
N-Acetylglucosaminyl- Dosaka-Akita, et al. (2004) Clin. Cancer Res.
10: 1773-1779. tranferase V (GnT-V). Elongation factor 2 Renkvist,
et al. (2001) Cancer Immunol Immunother. 50: 3-15. mutated (ELF2M).
HOM-MEL-40/SSX2 Neumann, et al. (2004) Int. J. Cancer 112: 661-668;
Scanlan, et al. (2000) Cancer Lett. 150: 155-164. BRDT. Scanlan, et
al. (2000) Cancer Lett. 150: 155-164. SAGE; HAGE. Sasaki, et al.
(2003) Eur. J. Surg. Oncol. 29: 900-903. RAGE. See, e.g., Li, et
al. (2004) Am. J. Pathol. 164: 1389-1397; Shirasawa, et al. (2004)
Genes to Cells 9: 165-174. MUM-1 (melanoma Gueguen, et al. (1998)
J. Immunol. 160: 6188-6194; Hirose, et al. ubiquitous mutated);
(2005) Int. J. Hematol. 81: 48-57; Baurain, et al. (2000) J.
Immunol. MUM-2; MUM-2 Arg- 164: 6057-6066; Chiari, et al. (1999)
Cancer Res. 59: 5785-5792. Gly mutation; MUM-3. LDLR/FUT fusion
Wang, et al. (1999) J. Exp. Med. 189: 1659-1667. protein antigen of
melanoma. NY-REN series of renal Scanlan, et al. (2002) Cancer Res.
62: 4041-4047; Scanlan, et al. cancer antigens. (1999) Cancer Res.
83: 456-464. NY-BR series of breast Scanlan, et al. (2002) Cancer
Res. 62: 4041-4047; Scanlan, et al. cancer antigens, e.g., (2001)
Cancer Immunity 1: 4. NY-BR-62; NY- BR-75; NY-BR-85; NY-BR-62;
NY-BR-85. BRCA-1; BRCA-2. Stolier, et al. (2004) Breast J. 10:
475-480; Nicoletto, et al. (2001) Cancer Treat Rev. 27: 295-304.
DEK/CAN fusion Von Lindern, et al. (1992) Mol. Cell. Biol. 12:
1687-1697. protein. Ras, e.g., wild type ras, GenBank Acc. Nos.
P01112; P01116; M54969; M54968; P01111; ras with mutations at
P01112; K00654. See also, e.g., GenBank Acc. Nos. M26261; codon 12,
13, 59, or 61, M34904; K01519; K01520; BC006499; NM_006270;
NM_002890; e.g., mutations G12C; NM_004985; NM_033360; NM_176795;
NM_005343. G12D; G12R; G12S; G12V; G13D; A59T; Q61H. K-RAS; H-RAS;
N-RAS. BRAF (an isoform of Tannapfel, et al. (2005) Am. J. Clin.
Pathol. 123: 256-260l; Tsao and RAF). Sober (2005) Dermatol. Clin.
23: 323-333. Melanoma antigens, GenBank Acc. No. NM_206956;
NM_206955; NM_206954; including HST-2 NM_206953; NM_006115;
NM_005367; NM_004988; AY148486; melanoma cell U10340; U10339;
M77481. See, eg., Suzuki, et al. (1999) J. antigens. Immunol. 163:
2783-2791. Survivin GenBank Acc. No. AB028869; U75285 (see also,
e.g., Tsuruma, et al. (2004) J. Translational Med. 2: 19 (11
pages); Pisarev, et al. (2003) Clin. Cancer Res. 9: 6523-6533;
Siegel, et al. (2003) Br. J. Haematol. 122: 911-914; Andersen, et
al. (2002) Histol. Histopathol. 17: 669- 675). MDM-2 NM_002392;
NM_006878 (see also, e.g.. Mayo, et al. (1997) Cancer Res. 57:
5013-5016; Demidenko and Blagosklonny (2004) Cancer Res. 64:
3653-3660). Methyl-CpG-binding Muller, et al. (2003) Br. J. Cancer
89: 1934-1939; Fang, et al. (2004) proteins (MeCP2; World J.
Gastreenterol. 10: 3394-3398. MBD2). NA88-A. Moreau-Aubry, et al.
(2000) J. Exp. Med. 191: 1617-1624. Histone deacetylases Waltregny,
et al. (2004) Eur. J. Histochem. 48: 273-290; Scanlan, et (HDAC),
e.g., HDAC5. al. (2002) Cancer Res. 62: 4041-4047. Cyclophilin B
(Cyp-B). Tamura, et al. (2001) Jpn. J. Cancer Res. 92: 762-767. CA
15-3; CA 27.29. Clinton, et al. (2003) Biomed. Sci. Instrum. 39:
408-414. Heat shock protein Faure, et al. (2004) Int. J. Cancer
108: 863-870. Hsp70. GAGE/PAGE family, Brinkmann, et al. (1999)
Cancer Res. 59: 1445-1448. e.g., PAGE-1; PAGE-2; PAGE-3; PAGE-4;
XAGE-1; XAGE-2; XAGE-3. MAGE-A, B, C, and D Lucas, et al. (2000)
Int. J. Cancer 87: 55-60; Scanlan, et al. (2001) families. MAGE-B5;
Cancer Immun. 1: 4. MAGE-B6; MAGE-C2; MAGE-C3; MAGE-3; MAGE-6.
Kinesin 2; TATA Scanlan, et al. (2001) Cancer Immun. 30: 1-4.
element modulatory factor 1; tumor protein D53; NY
Alpha-fetoprotein Grimm, et al. (2000) Gastroenterol. 119:
1104-1112. (AFP) SART1; SART2; Kumamuru, et al. (2004) Int. J.
Cancer 108: 686-695; Sasatomi, et al. SART3; ART4. (2002) Cancer
94: 1636-1641; Matsumoto, et al. (1998) Jpn. J. Cancer Res. 89:
1292-1295; Tanaka, et al. (2000) Jpn. J. Cancer Res. 91: 1177-
1184. Preferentially expressed Matsushita, et al. (2003) Leuk.
Lymphoma 44: 439-444; Oberthuer, et antigen of melanoma al. (2004)
Clin. Cancer Res. 10: 4307-4313. (PRAME). Carcinoembryonic GenBank
Acc. No. M29540; E03352; X98311; M17303 (see also, antigen (CEA),
e.g., Zaremba (1997) Cancer Res. 57: 4570-4577; Sarobe, et al.
(2004) CAP1-6D enhancer Curr. Cancer Drug Targets 4: 443-454;
Tsang, et al. (1997) Clin. agonist peptide. Cancer Res. 3:
2439-2449; Fong, et al. (2001) Proc. Natl. Acad. Sci. USA 98:
8809-8814). HER-2/neu. Disis, et al. (2004) J. Clin. Immunol. 24:
571-578; Disis and Cheever (1997) Adv. Cancer Res. 71: 343-371.
Cdk4; cdk6; p16 Ghazizadeh, et al. (2005) Respiration 72: 68-73;
Ericson, et al. (2003) (INK4); Rb protein. Mol. Cancer Res. 1:
654-664. TEL; AML1; Stams, et al. (2005) Clin. Cancer Res. 11:
2974-2980. TEL/AML1. Telomerase (TERT). Nair, et al. (2000) Nat.
Med. 6: 1011-1017. 707-AP. Takahashi, et al. (1997) Clin. Cancer
Res. 3: 1363-1370. Annexin, e.g., Zimmerman, et al. (2004) Virchows
Arch. 445: 368-374. Annexin II. BCR/ABL; BCR/ABL Cobaldda, et al.
(2000) Blood 95: 1007-1013; Hakansson, et al. (2004) p210; BCR/ABL
p190; Leukemia 18: 538-547; Schwartz, et al. (2003) Semin. Hematol.
CML-66; CML-28. 40: 87-96; Lim, et al. (1999) Int. J. Mol. Med. 4:
665-667. BCL2; BLC6; Iqbal, et al. (2004) Am. J. Pathol. 165:
159-166. CD10 protein. CDC27 (this is a Wang, et al. (1999) Science
284: 1351-1354. melanoma antigen). Sperm protein 17 Arora, et al.
(2005) Mol. Carcinog. 42: 97-108. (SP17); 14-3-3-zeta; MEMD;
KIAA0471; TC21. Tyrosinase-related GenBank Acc. No. NM_001922. (see
also, e.g., Bronte, et al. (2000) proteins 1 and 2 (TRP-1 Cancer
Res. 60: 253-258). and TRP-2). Gp100/pmel-17. GenBank Acc. Nos.
AH003567; U31798; U31799; U31807; U31799 (see also, e.g., Bronte,
et al. (2000) Cancer Res. 60: 253-258). TARP. See, e.g., Clifton,
et al. (2004) Proc. Natl. Acad. Sci. USA 101: 10166- 10171; Virok,
et al. (2005) Infection Immunity 73: 1939-1946. Tyrosinase-related
GenBank Acc. No. NM_001922. (see also, e.g., Bronte, et al. (2000)
proteins 1 and 2 (TRP-1 Cancer Res. 60: 253-258). and TRP-2).
Melanocortin 1 receptor Salazar-Onfray, et al. (1997) Cancer Res.
57: 4348-4355; Reynolds, et (MC1R); MAGE-3; al. (1998) J. Immunol.
161: 6970-6976; Chang, et al. (2002) Clin. gp100; tyrosinase;
Cancer Res. 8: 1021-1032. dopachrome tautomerase (TRP-2); MART-1.
MUC-1; MUC-2. See, e.g., Davies, et al. (1994) Cancer Lett. 82:
179-184; Gambus, et al. (1995) Int. J. Cancer 60: 146-148; McCool,
et al. (1999) Biochem. J. 341: 593-600. Spas-1. U.S. Published Pat.
Appl. No. 20020150588 of Allison, et al. CASP-8; FLICE;
Mandruzzato, et al. (1997) J. Exp. Med. 186: 785-793. MACH.
CEACAM6; CAP-1. Duxbury, et al. (2004) Biochem. Biophys. Res.
Commun. 317: 837- 843; Morse, et al. (1999) Clin. Cancer Res. 5:
1331-1338. HMGB1 (a DNA Brezniceanu, et al. (2003) FASEB J. 17:
1295-1297. binding protein and cytokine). ETV6/AML1. Codrington, et
al. (2000) Br. J. Haematol. 111: 1071-1079. Mutant and wild type
Clements, et al. (2003) Clin. Colorectal Cancer 3: 113-120;
Gulmann, forms of adenomatous et al. (2003) Appl. Immunohistochem.
Mol. Morphol. 11: 230-237; polyposis coli (APC); Jungck, et al.
(2004) Int. J. Colorectal. Dis. 19: 438-445; Wang, et al.
beta-catenin; c-met; (2004) J. Surg. Res. 120: 242-248; Abutaily,
et al. (2003) J. Pathol. p53; E-cadherin; 201: 355-362; Liang, et
al. (2004) Br. J. Surg. 91: 355-361; Shirakawa, cyclooxygenase-2 et
al. (2004) Clin. Cancer Res. 10: 4342-4348. (COX-2). Renal cell
carcinoma Mulders, et al. (2003) Urol. Clin. North Am. 30: 455-465;
Steffens, et antigen bound by mAB al. (1999) Anticancer Res. 19:
1197-1200. G250. EphA2 See, e.g., U.S. Patent Publication No.
2005/0281783 A1; Genbank Accession No. NM_004431 (human); Genbank
Accession No. NM_010139 (Mouse); Genbank Accession No. AB038986
(Chicken, partial sequence); GenBank Accession Nos. NP_004422,
AAH37166, and AAA53375 (human); GenBank Accession Nos. NP_034269
(mouse), AAH06954 (mouse), XP_345597 (rat), and BAB63910 (chicken).
EGFRvIII See, e.g., WO/2012/068360 Francisella tularensis antigens
Francisella tularensis Complete genome of subspecies Schu S4
(GenBank Acc. No. A and B. AJ749949); of subspecies Schu 4 (GenBank
Acc. No. NC_006570). Outer membrane protein (43 kDa) Bevanger, et
al. (1988) J. Clin. Microbiol. 27: 922-926; Porsch-Ozcurumez, et
al. (2004) Clin. Diagnostic. Lab. Immunol. 11: 1008-1015).
Antigenic components of F. tularensis include, e.g., 80 antigens,
including 10 kDa and 60 kDa chaperonins (Havlasova, et al. (2002)
Proteomics 2: 857-86), nucleoside diphosphate kinase, isocitrate
dehydrogenase, RNA-binding protein Hfq, the chaperone ClpB
(Havlasova, et al. (2005) Proteomics 5: 2090-2103). See also, e.g.,
Oyston and Quarry (2005) Antonie Van Leeuwenhoek 87: 277-281;
Isherwood, et al. (2005) Adv. Drug Deliv. Rev. 57: 1403-1414;
Biagini, et al. (2005) Anal. Bioanal. Chem. 382: 1027-1034.
Malarial antigens Circumsporozoite See, e.g., Haddad, et al. (2004)
Infection Immunity 72: 1594-1602; protein (CSP); SSP2; Hoffman, et
al. (1997) Vaccine 15: 842-845; Oliveira-Ferreira and HEP17; Exp-1
Daniel-Ribeiro (2001) Mem. Inst. Oswaldo Cruz, Rio de Janeiro
orthologs found in 96: 221-227. CSP (see, e.g., GenBank Acc. No.
AB121024). SSP2 P. falciparum; and (see, e.g., GenBank Acc. No.
AF249739). LSA-1 (see, e.g., GenBank LSA-1. Acc. No. Z30319).
Ring-infected See, e.g., Stirnadel, et al. (2000) Int. J.
Epidemiol. 29: 579-586; erythrocyte survace Krzych, et al. (1995)
J. Immunol. 155: 4072-4077. See also, Good, et protein (RESA); al.
(2004) Immunol. Rev. 201: 254-267; Good, et al. (2004) Ann. Rev.
merozoite surface Immunol. 23: 69-99. MSP2 (see, e.g., GenBank Acc.
No. X96399; protein 2 (MSP2); X96397). MSP1 (see, e.g., GenBank
Acc. No. X03371). RESA (see, Spf66; merozoite e.g., GenBank Acc.
No. X05181; X05182). surface protein 1(MSP1); 195A; BVp42. Apical
membrane See, e.g., Gupta, et al. (2005) Protein Expr. Purif. 41:
186-198. AMA1 antigen 1 (AMA1). (see, e.g., GenBank Acc. No. A'13;
AJ494905; AJ490565). Viruses and viral antigens Hepatitis A GenBank
Acc. Nos., e.g., NC_001489; AY644670; X83302; K02990; M14707.
Hepatitis B Complete genome (see, e.g., GenBank Acc. Nos. AB214516;
NC_003977; AB205192; AB205191; AB205190; AJ748098; AB198079;
AB198078; AB198076; AB074756). Hepatitis C Complete genome (see,
e.g., GenBank Acc. Nos. NC_004102; AJ238800; AJ238799; AJ132997;
AJ132996; AJ000009; D84263). Hepatitis D GenBank Acc. Nos, e.g.
NC_001653; AB118847; AY261457. Human papillomavirus, See, e.g.,
Trimble, et al. (2003) Vaccine 21: 4036-4042; Kim, et al. including
all 200+ (2004) Gene Ther. 11: 1011-1018; Simon, et al. (2003) Eur.
J. Obstet. subtypes (classed in Gynecol. Reprod. Biol. 109:
219-223; Jung, et al. (2004) J. Microbiol. 16 groups), such as the
42: 255-266; Damasus-Awatai and Freeman-Wang (2003) Curr. Opin.
high risk subtypes 16, Obstet. Gynecol. 15: 473-477; Jansen and
Shaw (2004) Annu. Rev. 18, 30, 31, 33, 45. Med. 55: 319-331; Roden
and Wu (2003) Expert Rev. Vaccines 2: 495- 516; de Villiers, et al.
(2004) Virology 324: 17-24; Hussain and Paterson (2005) Cancer
Immunol. Immunother. 54: 577-586; Molijn, et al. (2005) J. Clin.
Virol. 32 (Suppl. 1) S43-S51. GenBank Acc. Nos. AY686584; AY686583;
AY686582; NC_006169; NC_006168; NC_006164; NC_001355; NC_001349;
NC_005351; NC_001596). Human T-cell See, e.g., Capdepont, et al.
(2005) AIDS Res. Hum. Retrovirus 21: 28- lymphotropic virus 42;
Bhigjee, et al. (1999) AIDS Res. Hum. Restrovirus 15: 1229-1233;
(HTLV) types I and II, Vandamme, et al. (1998) J. Virol. 72:
4327-4340; Vallejo, et al. (1996) including the J. Acquir. Immune
Defic. Syndr. Hum. Retrovirol. 13: 384-391. HTLV type I subtypes
HTLV type I (see, e.g., GenBank Acc. Nos. AY563954; AY563953.
Cosmopolitan, Central HTLV type II (see, e.g., GenBank Acc. Nos.
L03561; Y13051; African, and AF139382). Austro-Melanesian, and the
HTLV type II subtypes Iia, Iib, Iic, and Iid. Coronaviridae, See,
e.g., Brian and Baric (2005) Curr. Top. Microbiol. Immunol.
including 287: 1-30; Gonzalez, et al. (2003) Arch. Virol. 148:
2207-2235; Smits, Coronaviruses, such as et al. (2003) J. Virol.
77: 9567-9577; Jamieson, et al. (1998) J. Infect. SARS-coronavirus
Dis. 178: 1263-1269 (GenBank Acc. Nos. AY348314; NC_004718;
(SARS-CoV), and AY394850). Toroviruses. Rubella virus. GenBank Acc.
Nos. NC_001545; AF435866. Mumps virus, including See, e.g., Orvell,
eta l. (2002) J. Gen. Virol. 83: 2489-2496. See, e.g., the
genotypes A, C, D, GenBank Acc. Nos. AY681495; NC_002200; AY685921;
AF201473. G, H, and I. Coxsackie virus A See, e.g., Brown, et al.
(2003) J. Virol. 77: 8973-8984. GenBank Acc. including the
serotypes Nos. AY421768; AY790926: X67706. 1, 11, 13, 15, 17, 18,
19, 20, 21, 22, and 24 (also known as Human enterovirus C; HEV-C).
Coxsackie virus B, See, e.g., Ahn, et al. (2005) J. Med. Virol. 75:
290-294; Patel, et al. including subtypes 1-6. (2004) J. Virol.
Methods 120: 167-172; Rezig, et al. (2004) J. Med. Virol. 72:
268-274. GenBank Acc. No. X05690. Human enteroviruses See, e.g.,
Oberste, et al. (2004) J. Virol. 78: 855-867. Human including,
e.g., human enterovirus A (GenBank Acc. Nos. NC_001612); human
enterovirus A (HEV-A, enterovirus B (NC_001472); human enterovirus
C (NC_001428); CAV2 to CAV8, human enterovirus D (NC_001430).
Simian enterovirus A (GenBank CAV10, CAV12, Acc. No. NC_003988).
CAV14, CAV16, and EV71) and also including HEV-B (CAV9, CBV1 to
CBV6, E1 to E7, E9, E11 to E21, E24 to E27, E29 to E33, and EV69
and E73), as well as HEV. Polioviruses including See, e.g., He, et
al. (2003) J. Virol. 77: 4827-4835; Hahsido, et al. PV1, PV2, and
PVB. (1999) Microbiol. Immunol. 43: 73-77. GenBank Acc. No.
AJ132961 (type 1); AY278550 (type 2); X04468 (type 3). Viral
encephalitides See, e.g., Hoke (2005) Mil. Med. 170: 92-105;
Estrada-Franco, et al. viruses, including (2004) Emerg. Infect.
Dis. 10: 2113-2121; Das, et al. (2004) Antiviral equine
encephalitis, Res. 64: 85-92; Aguilar, et al. (2004) Emerg. Infect.
Dis. 10: 880-888; Venezuelan equine Weaver, et al. (2004) Arch.
Virol. Suppl. 18: 43-64; Weaver, et al. encephalitis (VEE) (2004)
Annu. Rev. Entomol. 49: 141-174. Eastern equine encephalitis
(including subtypes IA, (GenBank Acc. No. NC_003899; AY722102);
Western equine IB, IC, ID, IIIC, IIID), encephalitis (NC_003908).
Eastern equine encephalitis (EEE),
Western equine encephalitis (WEE), St. Louis encephalitis, Murray
Valley (Australian) encephalitis, Japanese encephalitis, and
tick-born encephalitis. Human herpesviruses, See, e.g., Studahl, et
al. (2000) Scand. J. Infect. Dis. 32: 237-248; including Padilla,
et al. (2003) J. Med. Virol. 70 (Suppl. 1) S103-S110;
cytomegalovirus Jainkittivong and Langlais (1998) Oral Surg. Oral
Med. 85: 399-403. (CMV), Epstein-Barr GenBank Nos. NC_001806
(herpesvirus 1); NC_001798 virus (EBV), human (herpesvirus 2);
X04370 and NC_001348 (herpesvirus 3); herpesvirus-1 (HHV-1),
NC_001345 (herpesvirus 4); NC_001347 (herpesvirus 5); X83413 HHV-2,
HHV-3, and NC_000898 (herpesvirus 6); NC_001716 (herpesvirus 7).
HHV-4, HHV-5, Human herpesviruses types 6 and 7 (HHV-6; HHV-7) are
disclosed HHV-6, HHV-7, by, e.g., Padilla, et al. (2003) J. Med.
Virol. 70 (Suppl. 1)S103-S110. HHV-8, herpes B virus, Human
herpesvirus 8 (HHV-8), including subtypes A-E, are disclosed herpes
simplex virus in, e.g., Treurnicht, et al. (2002) J. Med. Virul.
66: 235-240. types 1 and 2 (HSV-1, HSV-2), and varicella zoster
virus (VZV). HIV-1 including group See, e.g., Smith, et al. (1998)
J. Med. Virol. 56: 264-268. See also, M (including subtypes e.g.,
GenBank Acc. Nos. DQ054367; NC_001802; AY968312; A to J) and group
O DQ011180; DQ011179; DQ011178; DQ011177; AY588971; (including any
AY588970; AY781127; AY781126; AY970950; AY970949; distinguishable
AY970948; X61240; AJ006287; AJ508597; and AJ508596. subtypes)
(HIV-2, including subtypes A-E. Epstein-Barr virus See, e.g., Peh,
et al. (2002) Pathology 34: 446-450. Epstein-Barr virus (EBV),
including strain B95-8 (GenBank Acc. No. V01555). subtypes A and B.
Reovirus, including See, e.g., Barthold, et al. (1993) Lab. Anim.
Sci. 43: 425-430; Roner, serotypes and strains 1, et al. (1995)
Proc. Natl. Acad. Sci. USA 92: 12362-12366; Kedl, et al. 2, and 3,
type 1 Lang, (1995) J. Virol. 69: 552-559. GenBank Acc. No. K02739
(sigma-3 type 2 Jones, and type 3 gene surface protein). Dearing.
Cytomegalovirus See, e.g., Chern, et al. (1998) J. Infect. Dis.
178: 1149-1153; Vilas (CMV) subtypes Boas, et al. (2003) J. Med.
Virol. 71: 404-407; Trincado, et al. (2000) include CMV subtypes J.
Med. Virol. 61: 481-487. GenBank Acc. No. X17403. I-VII.
Rhinovirus, including Human rhinovirus 2 (GenBank Acc. No. X02316);
Human all serotypes. rhinovirus B (GenBank Acc. No. NC_001490);
Human rhinovirus 89 (GenBank Acc. No. NC_001617); Human rhinovirus
39 (GenBank Acc. No. AY751783). Adenovirus, including AY803294;
NC_004001; AC_000019; AC_000018; AC_000017; all serotypes.
AC_000015; AC_000008; AC_000007; AC_000006; AC_000005; AY737798;
AY737797; NC_003266; NC_002067; AY594256; AY594254; AY875648;
AJ854486; AY163756; AY594255; AY594253; NC_001460; NC_001405;
AY598970; AY458656; AY487947; NC_001454; AF534906; AY45969;
AY128640; L19443; AY339865; AF532578. Filoviruses, including See,
e.g., Geisbert and Jahrling (1995) Virus Res. 39: 129-150; Marburg
virus and Hutchinson, et al. (2001) J. Med. Virol. 65: 561-566.
Marburg virus Ebola virus, and strains (see, e.g., GenBank Acc. No.
NC_001608). Ebola virus (see, e.g., such as Ebola-Sudan GenBank
Acc. Nos. NC_006432; AY769362; NC_002549; (EBO-S), Ebola-Zaire
AF272001; AF086833). (EBO-Z), and Ebola-Reston (EBO-R).
Arenaviruses, including Junin virus, segment S (GenBank Acc. No.
NC_005081); Junin virus, lymphocytic segment L (GenBank Acc. No.
NC_005080). choriomeningitis (LCM) virus, Lassa virus, Junin virus,
and Machupo virus. Rabies virus. See, e.g., GenBank Acc. Nos.
NC_001542; AY956319; AY705373; AF499686; AB128149; AB085828;
AB009663. Arboviruses, including Dengue virus type 1 (see, e.g.,
GenBank Acc. Nos. AB195673; West Nile virus, AY762084). Dengue
virus type 2 (see, e.g., GenBank Acc. Nos. Dengue viruses 1 to 4,
NC_001474; AY702040; AY702039; AY702037). Dengue virus type
Colorado tick fever 3 (see, e.g., GenBank Acc. Nos. AY923865;
AT858043). Dengue virus, Sindbis virus, virus type 4 (see, e.g.,
GenBank Acc. Nos. AY947539; AY947539; Togaviraidae, AF326573).
Sindbis virus (see, e.g., GenBank Acc. Nos. NC_001547;
Flaviviridae, AF429428; J02363; AF103728). West Nile virus (see,
e.g., GenBank Bunyaviridae, Acc. Nos. NC_001563; AY603654).
Reoviridae, Rhabdoviridae, Orthomyxoviridae, and the like. Poxvirus
including Viriola virus (see, e.g., GenBank Acc. Nos. NC_001611;
Y16780; orthopoxvirus (variola X72086; X69198). virus, monkeypox
virus, vaccinia virus, cowpox virus), yatapoxvirus (tanapox virus,
Yaba monkey tumor virus), parapoxvirus, and molluscipoxvirus.
Yellow fever. See, e.g., GenBank Acc. No. NC_002031; AY640589;
X03700. Hantaviruses, including See, e.g., Elgh, et al. (1997) J.
Clin. Microbiol. 35: 1122-1130; serotypes Hantaan Sjolander, et al.
(2002) Epidemiol. Infect. 128: 99-103; Zeier, et al. (HTN), Seoul
(SEO), (2005) Virus Genes 30: 157-180. GenBank Acc. No. NC_005222
and Dobrava (DOB), Sin NC_005219 (Hantavirus). See also, e.g.,
GenBank Acc. Nos. Nombre (SN), Puumala NC_005218; NC_005222;
NC_005219. (PUU), and Dobrava-like Saaremaa (SAAV). Flaviviruses,
including See, e.g., Mukhopadhyay, et al. (2005) Nature Rev.
Microbiol. 3: 13- Dengue virus, Japanese 22. GenBank Acc. Nos
NC_001474 and AY702040 (Dengue). encephalitis virus, West GenBank
Acc. Nos. NC_001563 and AY603654. Nile virus, and yellow fever
virus. Measles virus. See, e.g., GenBank Acc. Nos. AB040874 and
AY486084. Human Human parainfluenza virus 2 (see, e.g., GenBank
Acc. Nos. parainfluenzaviruses AB176531; NC003443). Human
parainfluenza virus 3 (see, e.g., (HPV), including HPV GenBank Acc.
No. NC_001796). types 1-56. Influenza virus, Influenza nucleocapsid
(see, e.g., GenBank Acc. No. AY626145). including influenza
Influenza hemagglutinin (see, e.g., GenBank Acc. Nos. AY627885;
virus types A, B, and C. AY555153). Influenza neuraminidase (see,
e.g., GenBank Acc. Nos. AY555151; AY577316). Influenza matrix
protein 2 (see, e.g., GenBank Acc. Nos. AY626144(.Influenza basic
protein 1 (see, e.g., GenBank Acc. No. AY627897). Influenza
polymerase acid protein (see, e.g., GenBank Acc. No. AY627896).
Influenza nucleoprotein (see, e.g., GenBank Acc. Nno. AY627895).
Influenza A virus Hemagglutinin of H1N1 (GenBank Acc. No. S67220).
Influenza A subtypes, e.g., swine virus matrix protein (GenBank
Acc. No. AY700216). Influenza virus viruses (SIV): H1N1 A H5H1
nucleoprotein (GenBank Acc. No. AY646426). H1N1 influenzaA and
swine haemagglutinin (GenBank Acc. No. D00837). See also, GenBank
influenza virus. Acc. Nos. BD006058; BD006055; BD006052. See also,
e.g., Wentworth, et al. (1994) J. Virol. 68: 2051-2058; Wells, et
al. (1991) J.A.M.A. 265: 478-481. Respiratory syncytial Respiratory
syncytial virus (RSV) (see, e.g., GenBank Acc. Nos. virus (RSV),
including AY353550; NC_001803; NC001781). subgroup A and subgroup
B. Rotaviruses, including Human rotavirus C segment 8 (GenBank Acc.
No. AJ549087); human rotaviruses A to Human rotavirus G9 strain
outer capsid protein (see, e.g., GenBank E, bovine rotavirus, Acc.
No. DQ056300); Human rotavirus B strain non-structural protein
rhesus monkey 4 (see, e.g., GenBank Acc. No. AY548957); human
rotavirus A strain rotavirus, and major inner capsid protein (see,
e.g., GenBank Acc. No. AY601554). human-RVV reassortments.
Polyomavirus, See, e.g., Engels, et al. (2004) J. Infect. Dis. 190:
2065-2069; Vilchez including simian and Butel (2004) Clin.
Microbiol. Rev. 17: 495-508; Shivapurkar, et virus 40 (SV40), JC
al. (2004) Cancer Res. 64: 3757-3760; Carbone, et al. (2003) virus
(JCV) and BK Oncogene 2: 5173-5180; Barbanti-Brodano, et al. (2004)
Virology virus (BKV). 318: 1-9) (SV40 complete genome in, e.g.,
GenBank Acc. Nos. NC_001669; AF168994; AY271817; AY271816;
AY120890; AF345344; AF332562). Coltiviruses, including Attoui, et
al. (1998) J. Gen. Virol. 79: 2481-2489. Segments of Eyach Colorado
tick fever virus (see, e.g., GenBank Acc. Nos. AF282475; AF282472;
virus, Eyach virus. AF282473; AF282478; AF282476; NC_003707;
NC_003702; NC_003703; NC_003704; NC_003705; NC_003696; NC_003697;
NC_003698; NC_003699; NC_003701; NC_003706; NC_003700; AF282471;
AF282477). Calciviruses, including Snow Mountain virus (see, e.g.,
GenBank Acc. No. AY134748). the genogroups Norwalk, Snow Mountain
group (SMA), and Saaporo. Parvoviridae, including See, e.g., Brown
(2004) Dev. Biol. (Basel) 118: 71-77; Alvarez- dependovirus,
Lafuente, et al. (2005) Ann. Rheum. Dis. 64: 780-782; Ziyaeyan, et
al. parvovirus (including (2005) Jpn. J. Infect. Dis. 58: 95-97;
Kaufman, et al. (2005) Virology parvovirus B19), and 332: 189-198.
erythrovirus.
Other organisms for which suitable antigens are known in the art
include, but are not limited to, Chlamydia trachomatis,
Streptococcus pyogenes (Group A Strep), Streptococcus
agalactia(Group B Strep), Streptococcus pneumonia, Staphylococcus
aureus, Escherichia coli, Haemophilus influenzae, Neisseria
meningitidis, Neisseria gonorrheae, Vibrio cholerae, Salmonella
species (including typhi, typhimurium), enterica (including
Helicobactor pylori Shigella flexneri and other Group D shigella
species), Burkholderia mallei, Burkholderia pseudomallei,
Klebsiella pneumonia, Clostridium species (including C. difficile),
Vibrio parahaemolyticus and V. vulnificus. This list is not meant
to be limiting.
[0101] In certain embodiments, antigen sequence(s) may be expressed
as a single polypeptide fused to an amino-terminal portion of the
L. monocytogenes ActA protein which permits expression and
secretion of a fusion protein from the bacterium within the
vaccinated host. In these embodiments, the antigenic construct may
be a polynucleotide comprising a promoter operably linked to a
nucleic acid sequence encoding a fusion protein, wherein the fusion
protein comprises (a) modified ActA and (b) one or more antigenic
epitopes to be expressed as a fusion protein following the modified
ActA sequence.
[0102] By "modified ActA" is meant a contiguous portion of the L.
monocytogenes ActA protein which comprises at least the ActA signal
sequence, but does not comprise the entirety of the ActA sequence,
or that has at least about 80% sequence identity, at least about
85% sequence identity, at least about 90% sequence identity, at
least about 95% sequence identity, or at least about 98% sequence
identity to such an ActA sequence. The ActA signal sequence is
MGLNRFMRAMMVVFITANCITINPDIIFA (SEQ ID NO: 2). In some embodiments,
the promoter is ActA promoter from WO07/103225; and WO07/117371,
each of which is incorporated by reference in its entirety
herein.
[0103] By way of example, the modified ActA may comprise at least
the first 59 amino acids of ActA, or a sequence having at least
about 80% sequence identity, at least about 85% sequence identity,
at least about 90% sequence identity, at least about 95% sequence
identity, or at least about 98% sequence identity to at least the
first 59 amino acids of ActA. In some embodiments, the modified
ActA comprises at least the first 100 amino acids of ActA, or a
sequence having at least about 80% sequence identity, at least
about 85% sequence identity, at least about 90% sequence identity,
at least about 95% sequence identity, or at least about 98%
sequence identity to the first 100 amino acids of ActA. In other
words, in some embodiments, the modified ActA sequence corresponds
to an N-terminal fragment of ActA (including the ActA signal
sequence) that is truncated at residue 100 or thereafter.
[0104] ActA-N100 has the following sequence (SEQ ID NO: 3):
TABLE-US-00004 VGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT
DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI
AMLKAKAEKG 100
[0105] In this sequence, the first residue is depicted as a valine;
the polypeptide is synthesized by Listeria with a methionine in
this position. Thus, ActA-N100 may also have the following sequence
(SEQ ID NO:4):
TABLE-US-00005 MGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT
DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI
AMLKAKAEKG 100
[0106] ActA-N100 may also comprise one or more additional residues
lying between the C-terminal residue of the modified ActA and the
antigen sequence. In the following sequences, ActA-N100 is extended
by two residues added by inclusion of a BamH1 site (SEQ ID NO:
5):
TABLE-US-00006 VGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT
DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI
AMLKAKAEKG 100 GS
which when synthesized with a first residue methionine has the
sequence (SEQ ID NO: 6):
TABLE-US-00007 MGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT
DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI
AMLKAKAEKG 100 GS.
[0107] As sequences encoded by one organism are not necessarily
codon optimized for optimal expression in a chosen vaccine platform
bacterial strain, the present invention also provides nucleic acids
that are altered by codon optimized for expressing by a bacterium
such as L. monocytogenes.
[0108] In various embodiments, at least one percent of any
non-optimal codons are changed to provide optimal codons, more
normally at least five percent are changed, most normally at least
ten percent are changed, often at least 20% are changed, more often
at least 30% are changed, most often at least 40%, usually at least
50% are changed, more usually at least 60% are changed, most
usually at least 70% are changed, optimally at least 80% are
changed, more optimally at least 90% are changed, most optimally at
least 95% are changed, and conventionally 100% of any non-optimal
codons are codon-optimized for Listeria expression (Table 2).
TABLE-US-00008 TABLE 2 Optimal codons for expression in Listeria.
Amino Acid A R N D C Q E G H I Optimal GCA CGU AAU GAU UGU CAA GAA
GGU CAU AUU Listeria codon Amino Acid L K M F P S T W Y V Optimal
UUA AAA AUG UUU CCA AGU ACA UGG UAU GUU Listeria codon
[0109] The invention supplies a number of Listeria species and
strains for making or engineering an attenuated bacterium of the
present invention. The Listeria of the present invention is not to
be limited by the species and strains disclosed in Table 3.
TABLE-US-00009 TABLE 3 Strains of Listeria suitable for use in the
present invention, e.g., as a vaccine or as a source of nucleic
acids. L. monocytogenes 10403S wild type. Bishop and Hinrichs
(1987) J. Immunol. 139: 2005-2009; Lauer, et al. (2002) J. Bact.
184: 4177-4186. L. monocytogenes DP-L4056 (phage cured). Lauer, et
al. (2002) J. Bact. 184: 4177-4186. The prophage-cured 10403S
strain is designated DP-L4056. L. monocytogenes DP-L4027, which is
Lauer, et al. (2002) J. Bact. 184: 4177-4186; DP-L2161, phage
cured, deleted in hly gene. Jones and Portnoy (1994) Infect.
Immunity 65: 5608-5613. L. monocytogenes DP-L4029, which is DP-
Lauer, et al. (2002) J. Bact. 184: 4177-4186; L3078, phage cured,
deleted in ActA. Skoble, et al. (2000) J. Cell Biol. 150: 527- 538.
L. monocytogenes DP-L4042 (delta PEST) Brockstedt, et al. (2004)
Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting
information. L. monocytogenes DP-L4097 (LLO-S44A). Brockstedt, et
al. (2004) Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting
information. L. monocytogenes DP-L4364 (delta lplA; Brockstedt, et
al. (2004) Proc. Natl. Acad. lipoate protein ligase). Sci. USA 101:
13832-13837; supporting information. L. monocytogenes DP-L4405
(delta inlA). Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA
101: 13832-13837; supporting information. L. monocytogenes DP-L4406
(delta inlB). Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA
101: 13832-13837; supporting information. L. monocytogenes CS-L0001
(delta ActA-delta Brockstedt, et al. (2004) Proc. Natl. Acad.
inlB). Sci. USA 101: 13832-13837; supporting information. L.
monocytogenes CS-L0002 (delta ActA-delta Brockstedt, et al. (2004)
Proc. Natl. Acad. lplA). Sci. USA 101: 13832-13837; supporting
information. L. monocytogenes CS-L0003 (L461T-delta Brockstedt, et
al. (2004) Proc. Natl. Acad. lplA). Sci. USA 101: 13832-13837;
supporting information. L. monocytogenes DP-L4038 (delta ActA-LLO
Brockstedt, et al. (2004) Proc. Natl. Acad. L461T). Sci. USA 101:
13832-13837; supporting information. L. monocytogenes DP-L4384
(S44A-LLO Brockstedt, et al. (2004) Proc. Natl. Acad. L461T). Sci.
USA 101: 13832-13837; supporting information. L. monocytogenes.
Mutation in lipoate protein O'Riordan, et al. (2003) Science 302:
462- ligase (LplA1). 464. L. monocytogenes DP-L4017 (10403S U.S.
Provisional patent application Ser. No. hly (L461T) point mutation
in hemolysin gene. 60/490,089 filed Jul. 24, 2003. L. monocytogenes
EGD. GenBank Acc. No. AL591824. L. monocytogenes EGD-e. GenBank
Acc. No. NC_003210. ATCC Acc. No. BAA-679. L. monocytogenes strain
EGD, complete GenBank Acc. No. AL591975 genome, segment 3/12 L.
monocytogenes. ATCC Nos. 13932; 15313; 19111-19120; 43248-43251;
51772-51782. L. monocytogenes DP-L4029 deleted in uvrAB. U.S.
Provisional patent application Ser. No. 60/541,515 filed Feb. 2,
2004; U.S. Provisional patent application Ser. No. 60/490,080 filed
Jul. 24, 2003. L. monocytogenes DP-L4029 deleted in uvrAB U.S.
Provisional patent application Ser. No. treated with a psoralen.
60/541,515 filed Feb. 2, 2004. L. monocytogenes delta actA delta
inlB delta Brockstedt (2005) Nature Medicine and uvrAB KBMA patent
L. monocytogenes delta actA delta inlB delta Brockstedt (2005)
Nature Medicine and uvrAB treated with psoralen KBMA patent L.
monocytogenes delta actA delta inlB delta Lauer et al, (2008)
Infect. Immun. And WO uvrAB prfA(G155S) 2009/143085 L.
monocytogenes delta actA delta inlB delta Lauer et al, (2008)
Infect. Immun. And WO uvrAB prfA(G155S) treated with psoralen
2009/143085 L. monocytogenes ActA-/inlB- double mutant. Deposited
with ATCC on Oct. 3, 2003. Acc. No. PTA-5562. L. monocytogenes lplA
mutant or hly mutant. U.S. patent Applic. No. 20040013690 of
Portnoy, et al. L. monocytogenes DAL/DAT double mutant. U.S. patent
Applic. No. 20050048081 of Frankel and Portnoy. L. monocytogenes
str. 4b F2365. GenBank Acc. No. NC_002973. Listeria ivanovii ATCC
No. 49954 Listeria innocua Clip11262. GenBank Acc. No. NC_003212;
AL592022. Listeria innocua, a naturally occurring Johnson, et al.
(2004) Appl. Environ. hemolytic strain containing the
PrfA-regulated Microbiol. 70: 4256-4266. virulence gene cluster.
Listeria seeligeri. Howard, et al. (1992) Appl. Eviron. Microbiol.
58: 709-712. Listeria innocua with L. monocytogenes Johnson, et al.
(2004) Appl. Environ. pathogenicity island genes. Microbiol. 70:
4256-4266. Listeria innocua with L. monocytogenes See, e.g.,
Lingnau, et al. (1995) Infection internalin A gene, e.g., as a
plasmid or as a Immunity 63: 3896-3903; Gaillard, et al. genomic
nucleic acid. (1991) Cell 65: 1127-1141). The present invention
encompasses reagents and methods that comprise the above Listerial
strains, as well as these strains that are modified, e.g., by a
plasmid and/or by genomic integration, to contain a nucleic acid
encoding one of, or any combination of, the following genes: hly
(LLO; listeriolysin); iap (p60); inlA; inlB; inlC; dal (alanine
racemase); daaA (dat; D-amino acid aminotransferase); plcA; plcB;
ActA; or any nucleic acid that mediates growth, spread, breakdown
of a single walled vesicle, breakdown of a double walled vesicle,
binding to a host cell, uptake by a host cell. The present
invention is not to be limited by the particular strains disclosed
above.
4. THERAPEUTIC COMPOSITIONS
[0110] The vaccine compositions described herein can be
administered to a host, either alone or in combination with a
pharmaceutically acceptable excipient, in an amount sufficient to
induce an appropriate immune response. The immune response can
comprise, without limitation, specific immune response,
non-specific immune response, both specific and non-specific
response, innate response, primary immune response, adaptive
immunity, secondary immune response, memory immune response, immune
cell activation, immune cell proliferation, immune cell
differentiation, and cytokine expression. The vaccines of the
present invention can be stored, e.g., frozen, lyophilized, as a
suspension, as a cell paste, or complexed with a solid matrix or
gel matrix.
[0111] In certain embodiments, after the subject has been
administered an effective dose of a first vaccine to prime the
immune response, a second vaccine is administered. This is referred
to in the art as a "prime-boost" regimen. In such a regimen, the
compositions and methods of the present invention may be used as
the "prime" delivery, as the "boost" delivery, or as both a "prime"
and a "boost." Any number of "boost" immunizations can be delivered
in order to maintain the magnitude or effectiveness of a
vaccine-induced immune response.
[0112] As an example, a first vaccine comprised of killed but
metabolically active Listeria that encodes and expresses the
antigen polypeptide(s) may be delivered as the "prime," and a
second vaccine comprised of attenuated (live or killed but
metabolically active) Listeria that encodes the antigen
polypeptide(s) may be delivered as the "boost." It should be
understood, however, that each of the prime and boost need not
utilize the methods and compositions of the present invention.
Rather, the present invention contemplates the use of other vaccine
modalities together with the bacterial vaccine methods and
compositions of the present invention. The following are examples
of suitable mixed prime-boost regimens: a DNA (e.g., plasmid)
vaccine prime/bacterial vaccine boost; a viral vaccine
prime/bacterial vaccine boost; a protein vaccine prime/bacterial
vaccine boost; a DNA prime/bacterial vaccine boost plus protein
vaccine boost; a bacterial vaccine prime/DNA vaccine boost; a
bacterial vaccine prime/viral vaccine boost; a bacterial vaccine
prime/protein vaccine boost; a bacterial vaccine prime/bacterial
vaccine boost plus protein vaccine boost; etc. This list is not
meant to be limiting
[0113] The prime vaccine and boost vaccine may be administered by
the same route or by different routes. The term "different routes"
encompasses, but is not limited to, different sites on the body,
for example, a site that is oral, non-oral, enteral, parenteral,
rectal, intranode (lymph node), intravenous, arterial,
subcutaneous, intradermal, intramuscular, intratumor, peritumor,
infusion, mucosal, nasal, in the cerebrospinal space or
cerebrospinal fluid, and so on, as well as by different modes, for
example, oral, intravenous, and intramuscular.
[0114] An effective amount of a prime or boost vaccine may be given
in one dose, but is not restricted to one dose. Thus, the
administration can be two, three, four, five, six, seven, eight,
nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen,
seventeen, eighteen, nineteen, twenty, or more, administrations of
the vaccine. Where there is more than one administration of a
vaccine or vaccines in the present methods, the administrations can
be spaced by time intervals of one minute, two minutes, three,
four, five, six, seven, eight, nine, ten, or more minutes, by
intervals of about one hour, two hours, three, four, five, six,
seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24 hours, and so on. In the context of hours, the term
"about" means plus or minus any time interval within 30 minutes.
The administrations can also be spaced by time intervals of one
day, two days, three days, four days, five days, six days, seven
days, eight days, nine days, ten days, 11 days, 12 days, 13 days,
14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21
days, and combinations thereof. The invention is not limited to
dosing intervals that are spaced equally in time, but encompass
doses at non-equal intervals, such as a priming schedule consisting
of administration at 1 day, 4 days, 7 days, and 25 days, just to
provide a non-limiting example.
[0115] In certain embodiments, administration of the boost
vaccination can be initiated at about 5 days after the prime
vaccination is initiated; about 10 days after the prime vaccination
is initiated; about 15 days; about 20 days; about 25 days; about 30
days; about 35 days; about 40 days; about 45 days; about 50 days;
about 55 days; about 60 days; about 65 days; about 70 days; about
75 days; about 80 days, about 6 months, and about 1 year after
administration of the prime vaccination is initiated. Preferably
one or both of the prime and boost vaccination comprises delivery
of a composition of the present invention.
[0116] A "pharmaceutically acceptable excipient" or "diagnostically
acceptable excipient" includes but is not limited to, sterile
distilled water, saline, phosphate buffered solutions, amino acid
based buffers, or bicarbonate buffered solutions. An excipient
selected and the amount of excipient used will depend upon the mode
of administration. Administration may be oral, intravenous,
subcutaneous, dermal, intradermal, intramuscular, mucosal,
parenteral, intraorgan, intralesional, intranasal, inhalation,
intraocular, intramuscular, intravascular, intranodal, by
scarification, rectal, intraperitoneal, or any one or combination
of a variety of well-known routes of administration. The
administration can comprise an injection, infusion, or a
combination thereof.
[0117] Administration of the vaccine of the present invention by a
non-oral route can avoid tolerance. Methods are known in the art
for administration intravenously, subcutaneously, intradermally,
intramuscularly, intraperitoneally, orally, mucosally, by way of
the urinary tract, by way of a genital tract, by way of the
gastrointestinal tract, or by inhalation.
[0118] An effective amount for a particular patient may vary
depending on factors such as the condition being treated, the
overall health of the patient, the route and dose of administration
and the severity of side effects. Guidance for methods of treatment
and diagnosis is available (see, e.g., Maynard, et al. (1996) A
Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca
Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical
Practice, Urch Publ., London, UK).
[0119] The vaccines of the present invention can be administered in
a dose, or dosages, where each dose comprises at least 100
bacterial cells/kg body weight or more; in certain embodiments 1000
bacterial cells/kg body weight or more; normally at least 10,000
cells; more normally at least 100,000 cells; most normally at least
1 million cells; often at least 10 million cells; more often at
least 100 million cells; typically at least 1 billion cells;
usually at least 10 billion cells; conventionally at least 100
billion cells; and sometimes at least 1 trillion cells/kg body
weight. The present invention provides the above doses where the
units of bacterial administration is colony forming units (CFU),
the equivalent of CFU prior to psoralen treatment, or where the
units are number of bacterial cells.
[0120] The vaccines of the present invention can be administered in
a dose, or dosages, where each dose comprises between 10.sup.7 and
10.sup.8 bacteria per 70 kg body weight (or per 1.7 square meters
surface area; or per 1.5 kg liver weight); 2.times.10.sup.7 and
2.times.10.sup.8 bacteria per 70 kg body weight (or per 1.7 square
meters surface area; or per 1.5 kg liver weight); 5.times.10.sup.7
and 5.times.10.sup.8 bacteria per 70 kg body weight (or per 1.7
square meters surface area; or per 1.5 kg liver weight); 10.sup.8
and 10.sup.9 bacteria per 70 kg body weight (or per 1.7 square
meters surface area; or per 1.5 kg liver weight); between
2.0.times.10.sup.8 and 2.0.times.10.sup.9 bacteria per 70 kg (or
per 1.7 square meters surface area, or per 1.5 kg liver weight);
between 5.0.times.10.sup.8 to 5.0.times.10.sup.9 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); between 10.sup.9 and 10.sup.10 bacteria per 70 kg (or per
1.7 square meters surface area, or per 1.5 kg liver weight);
between 2.times.10.sup.9 and 2.times.10.sup.10 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); between 5.times.10.sup.9 and 5.times.10.sup.10 bacteria
per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg
liver weight); between 10.sup.11 and 10.sup.12 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); between 2.times.10.sup.11 and 2.times.10.sup.12 bacteria
per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg
liver weight); between 5.times.10.sup.11 and 5.times.10.sup.12
bacteria per 70 kg (or per 1.7 square meters surface area, or per
1.5 kg liver weight); between 10.sup.12 and 10.sup.13 bacteria per
70 kg (or per 1.7 square meters surface area); between
2.times.10.sup.12 and 2.times.10.sup.13 bacteria per 70 kg (or per
1.7 square meters surface area, or per 1.5 kg liver weight);
between 5.times.10.sup.12 and 5.times.10.sup.13 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); between 10.sup.13 and 10.sup.14 bacteria per 70 kg (or per
1.7 square meters surface area, or per 1.5 kg liver weight);
between 2.times.10.sup.13 and 2.times.10.sup.14 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); 5.times.10.sup.13 and 5.times.10.sup.14 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); between 10.sup.14 and 10.sup.15 bacteria per 70 kg (or per
1.7 square meters surface area, or per 1.5 kg liver weight);
between 2.times.10.sup.14 and 2.times.10.sup.15 bacteria per 70 kg
(or per 1.7 square meters surface area, or per 1.5 kg liver
weight); and so on, wet weight.
[0121] Also provided is one or more of the above doses, where the
dose is administered by way of one injection every day, one
injection every two days, one injection every three days, one
injection every four days, one injection every five days, one
injection every six days, or one injection every seven days, where
the injection schedule is maintained for, e.g., one day only, two
days, three days, four days, five days, six days, seven days, two
weeks, three weeks, four weeks, five weeks, or longer. The
invention also embraces combinations of the above doses and
schedules, e.g., a relatively large initial bacterial dose,
followed by relatively small subsequent doses, or a relatively
small initial dose followed by a large dose.
[0122] A dosing schedule of, for example, once/week, twice/week,
three times/week, four times/week, five times/week, six times/week,
seven times/week, once every two weeks, once every three weeks,
once every four weeks, once every five weeks, and the like, is
available for the invention. The dosing schedules encompass dosing
for a total period of time of, for example, one week, two weeks,
three weeks, four weeks, five weeks, six weeks, two months, three
months, four months, five months, six months, seven months, eight
months, nine months, ten months, eleven months, and twelve
months.
[0123] Provided are cycles of the above dosing schedules. The cycle
can be repeated about, e.g., every seven days; every 14 days; every
21 days; every 28 days; every 35 days; 42 days; every 49 days;
every 56 days; every 63 days; every 70 days; and the like. An
interval of non dosing can occur between a cycle, where the
interval can be about, e.g., seven days; 14 days; 21 days; 28 days;
35 days; 42 days; 49 days; 56 days; 63 days; 70 days; and the like.
In this context, the term "about" means plus or minus one day, plus
or minus two days, plus or minus three days, plus or minus four
days, plus or minus five days, plus or minus six days, or plus or
minus seven days.
[0124] The present invention encompasses a method of administering
Listeria that is oral. Also provided is a method of administering
Listeria that is intravenous. Moreover, what is provided is a
method of administering Listeria that is oral, intramuscular,
intravenous, intradermal and/or subcutaneous. The invention
supplies a Listeria bacterium, or culture or suspension of Listeria
bacteria, prepared by growing in a medium that is meat based, or
that contains polypeptides derived from a meat or animal product.
Also supplied by the present invention is a Listeria bacterium, or
culture or suspension of Listeria bacteria, prepared by growing in
a medium that does not contain meat or animal products, prepared by
growing on a medium that contains vegetable polypeptides, prepared
by growing on a medium that is not based on yeast products, or
prepared by growing on a medium that contains yeast
polypeptides.
[0125] Methods for co-administration with an additional therapeutic
agent are well known in the art (Hardman, et al. (eds.) (2001)
Goodman and Gilman's The Pharmacological Basis of Therapeutics,
10th ed., McGraw-Hill, New York, N.Y.; Poole and Peterson (eds.)
(2001) Pharmacotherapeutics for Advanced Practice: A Practical
Approach, Lippincott, Williams & Wilkins, Phila., Pa.; Chabner
and Longo (eds.) (2001) Cancer Chemotherapy and Biotherapy,
Lippincott, Williams & Wilkins, Phila., Pa.).
[0126] Additional agents which are beneficial to raising a
cytolytic T cell response may be used as well. Such agents are
termed herein carriers. These include, without limitation, B7
costimulatory molecule, interleukin-2, interferon-.gamma., GM-CSF,
CTLA-4 antagonists, OX-40/OX-40 ligand, CD40/CD40 ligand,
sargramostim, levamisol, vaccinia virus, Bacille Calmette-Guerin
(BCG), liposomes, alum, Freund's complete or incomplete adjuvant,
detoxified endotoxins, mineral oils, surface active substances such
as lipolecithin, pluronic polyols, polyanions, peptides, and oil or
hydrocarbon emulsions. Carriers for inducing a T cell immune
response which preferentially stimulate a cytolytic T cell response
versus an antibody response are preferred, although those that
stimulate both types of response can be used as well. In cases
where the agent is a polypeptide, the polypeptide itself or a
polynucleotide encoding the polypeptide can be administered. The
carrier can be a cell, such as an antigen presenting cell (APC) or
a dendritic cell. Antigen presenting cells include such cell types
as macrophages, dendritic cells and B cells. Other professional
antigen-presenting cells include monocytes, marginal zone Kupffer
cells, microglia, Langerhans' cells, interdigitating dendritic
cells, follicular dendritic cells, and T cells. Facultative
antigen-presenting cells can also be used. Examples of facultative
antigen-presenting cells include astrocytes, follicular cells,
endothelium and fibroblasts. The carrier can be a bacterial cell
that is transformed to express the polypeptide or to deliver a
polynucleotide which is subsequently expressed in cells of the
vaccinated individual. Adjuvants, such as aluminum hydroxide or
aluminum phosphate, can be added to increase the ability of the
vaccine to trigger, enhance, or prolong an immune response.
Additional materials, such as cytokines, chemokines, and bacterial
nucleic acid sequences, like CpG, a toll-like receptor (TLR) 9
agonist as well as additional agonists for TLR 2, TLR 4, TLR 5, TLR
7, TLR 8, TLR9, including lipoprotein, LPS, monophosphoryl lipid A,
lipoteichoic acid, imiquimod, resiquimod, and other like immune
modulators such as cyclic dinucleotide STING agonists including
c-di-GMP, c-di-AMP, c-di-IMP, and c-AMP-GMP, used separately or in
combination with the described compositions are also potential
adjuvants. Other representative examples of adjuvants include the
synthetic adjuvant QS-21 comprising a homogeneous saponin purified
from the bark of Quillaja saponaria and Corynebacterium parvum
(McCune et al., Cancer, 1979; 43:1619). It will be understood that
the adjuvant is subject to optimization. In other words, the
skilled artisan can engage in routine experimentation to determine
the best adjuvant to use.
[0127] An effective amount of a therapeutic agent is one that will
decrease or ameliorate the symptoms normally by at least 10%, more
normally by at least 20%, most normally by at least 30%, typically
by at least 40%, more typically by at least 50%, most typically by
at least 60%, often by at least 70%, more often by at least 80%,
and most often by at least 90%, conventionally by at least 95%,
more conventionally by at least 99%, and most conventionally by at
least 99.9%.
[0128] The reagents and methods of the present invention provide a
vaccine comprising only one vaccination; or comprising a first
vaccination; or comprising at least one booster vaccination; at
least two booster vaccinations; or at least three booster
vaccinations. Guidance in parameters for booster vaccinations is
available. See, e.g., Marth (1997) Biologicals 25:199-203; Ramsay,
et al. (1997) Immunol. Cell Biol. 75:382-388; Gherardi, et al.
(2001) Histol. Histopathol. 16:655-667; Leroux-Roels, et al. (2001)
ActA Clin. Belg. 56:209-219; Greiner, et al. (2002) Cancer Res.
62:6944-6951; Smith, et al. (2003) J. Med. Virol.
70:Supp1.1:S38-541; Sepulveda-Amor, et al. (2002) Vaccine
20:2790-2795).
[0129] Formulations of therapeutic agents may be prepared for
storage by mixing with physiologically acceptable carriers,
excipients, or stabilizers in the form of, e.g., lyophilized
powders, slurries, aqueous solutions or suspensions (see, e.g.,
Hardman, et al. (2001) Goodman and Gilman's The Pharmacological
Basis of Therapeutics, McGraw-Hill, New York, N.Y.; Gennaro (2000)
Remington: The Science and Practice of Pharmacy, Lippincott,
Williams, and Wilkins, New York, N.Y.; Avis, et al. (eds.) (1993)
Pharmaceutical Dosage Forms: Parenteral Medications, Marcel Dekker,
NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms:
Tablets, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990)
Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY;
Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel
Dekker, Inc., New York, N.Y.).
Examples
[0130] The following examples serve to illustrate the present
invention. These examples are in no way intended to limit the scope
of the invention.
Example 1
Construction of Lm RIID (Listeria monocytogenes Recombinase Induced
Intracellular Death) Strains
[0131] DNA manipulations, purification and vector assembly.
[0132] Recombinase recognition sites (loxP, lox66 and lox71
variants, or frt) were inserted in the intergenic regions 5' and 3'
of essential Listeria monocytogenes (Lm) gene sets using allelic
exchange (Camilli, 1993). Recombinase sites were added to allelic
exchange vectors by PCR using 10403S (Bishop, 1987) DNA as
template. PCR was performed using the high-fidelity enzyme Phusion
DNA polymerase (NEB, Ipswich, Mass.) in a MyCycler thermocycler
(BioRad, Hercules Calif.). The oligonucleotides (oligos)
(Integrated DNA Technologies, Coralville, Iowa) used for cloning
are listed in the following table.
TABLE-US-00010 TABLE 4 Oligonucleotides Oligo name Sequence (SOE
overlap underlined) RE site PL1536
tttCGGCCGatgagtaacctattaactgttcat (SEQ ID NO: 7) EagI PL1537
tttGGATCCttagtctccatcttctaataat (SEQ ID NO: 8) BamHI PL2861
tttGGTACCggtcatgatgacattaatacaaca (SEQ ID NO: 9) KpnI PL2862
tttGAGCTCtatcctaaatggctttatatcagt (SEQ ID NO: 10) SadI PL2863
tttAAGCTTttggaaattcgattaccccact (SEQ ID NO: 11) HindIII PL2864
tttGGTACCtggttattttcgtcgaataactgcc (SEQ ID NO: 12) KpnI PL2865
tttGGTACCtttGAGCTCttttagtaaaaaaacgccagagaagc (SEQ ID NO: 13)
KpnI/SacI PL2866 tttGAATTCtccgttgttgcaatattcgct (SEQ ID NO: 14)
EcoRI PL2876 tttAAGCTTtccctgaagaagaagtagcaatta (SEQ ID NO: 15)
HindIII PL2868 tttGGTACCagcttgattttattcttctatgtcgc (SEQ ID NO: 16)
KpnI PL2869 tttGGTACCtttGAGCTCggaaatgactctaatttgcgaat (SEQ ID NO:
17) KpnI/SacI PL2870 tttGAATTCtccatgtatacccaatcgtttagga (SEQ ID NO:
18) EcoRI PL3139
ataacttcgtatagcatacattatacgaacggtaggaaatgactctaatttgcgaat (SEQ ID
NO: 19) PL3140 tttGAATTCtccatgtatacccaatcgtttagga (SEQ ID NO: 20)
EcoRI PL3141 tttAAGCTTtccctgaagaagaagtagcaatta (SEQ ID NO: 21)
HindIII PL3142
taccgttcgtataatgtatgctatacgaagttatagcttgattttattcttctatgtcgc (SEQ
ID NO: 22) PL3246 tttGAATTCacagaaggagattgtgaaatg (SEQ ID NO: 23)
EcoRI PL3247 gggTCTAGAtttGGTACCaatagaagcgtactgcgact (SEQ ID NO: 24)
KpnI/XbaI PL3248 gggTCTAGAgtttcacgtgaaacattcta (SEQ ID NO: 25) XbaI
PL3249 tttAAGCTTcggaattggttcaagactgg (SEQ ID NO: 26) HindIII PL3339
attGGTACCttcgaggagtaaacttcccaa (SEQ ID NO: 27) KpnI PL3340
aacTCTAGAcaccgcggtggcggccgataa (SEQ ID NO: 28) XbaI PL3378
tatGCGGCCGCgggaagcagttggggttaact (SEQ ID NO: 29) NotI PL3379
aacTCTAGActtagtctccatcttctaata (SEQ ID NO: 30) XbaI PL3469
aaaggaagttcctattctctagaaagtataggaacttctgcggaaatgactctaatttgc (SEQ
ID NO: 31) PL3470
gcagaagttcctatactttctagagaataggaacttcctttagcttgattttattcttct (SEQ
ID NO: 32) PL3471
aaaggaagttcctattctctagaaagtataggaacttctgcttttagtaaaaaaacgcca (SEQ
ID NO: 33) PL3472
gcagaagttcctatactttctagagaataggaacttccttttggttattttcgtcgaata (SEQ
ID NO: 34) PL3546 tttCTGCAGgtggatagaactcataaaggac (SEQ ID NO: 35)
PstI PL3547 tttGGTACCtcagttaaccccaactgcttc (SEQ ID NO: 36) KpnI
PL3548 tttGGTACCtttAGATCTaaacacagaacgaaagaaaaag (SEQ ID NO: 37)
KpnI/BglII PL3549 tttGAATTCccagtaggttccactgtatc (SEQ ID NO: 38)
EcoRI PL3552 tttCTGCAGtccatgtatacccaatcgtttagga (SEQ ID NO: 39)
PstI PL3553 tttAAGCTTtccctgaagaagaagtagcaatta (SEQ ID NO: 40)
HindIII PL4017 tttAGATCTaaatggtttttctctctataa (SEQ ID NO: 41) BglII
PL4018 tAGATCTataacttcgtatagcatacattatacgaacggtattcgaaaattattgcgtta
(SEQ ID NO: 42) BglII PL4075 tttCTGCAGatgattcaatccttcttgctt (SEQ ID
NO: 43) PstI PL4076 gggTCTAGAgagttatacaaaacgggaata (SEQ ID NO: 44)
XbaI
[0133] The following table provides a list of sequences used in the
following examples.
TABLE-US-00011 TABLE 5 Sequences Name Sequence lox66
Ataacttcgtatagcatacattatacgaacggta (SEQ ID NO: 45) lox71
Taccgttcgtatagcatacattatacgaagttat (SEQ ID NO: 46) loxP
Ataacttcgtataatgtatgctatacgaagttat (SEQ ID NO: 47) actA promoter
gggaagcagttggggttaactgattaacaaatgttagagaaaaattaattctccaagtgatattctta
aaataattcatgaatattttttcttatattagctaattaagaagataattaactgctaatccaatttt
taacggaataaattagtgaaaatgaaggccgaattttccttgttctaaaaaggttgtattagcgtatc
acgaggagggagtataa (SEQ ID NO: 48) Cre
atgagtaacctattaactgttcatcaaaatttaccagcattaccagtggatgcaacatcagatgaagt
(codon optimized)
aagaaaaaatttaatggatatgtttagagaccgacaagccttttcggagcatacatggaaaatgttat
tatctgtttgtagatcatgggcagcatggtgcaaacttaacaatagaaaatggtttccagcagaacca
gaagatgtacgagattatttattataccttcaagcaagaggattagcagtaaaaaccattcaacaaca
tttaggacaattaaatatgttacatagacgatcaggattaccaagacctagcgattctaacgcagtta
gtttagttatgagaagaattagaaaagaaaatgtcgatgcaggcgaacgagcaaaacaagcactagca
tttgaacgtacagatttcgaccaagtaagatcattaatggaaaatagcgaccgttgtcaagacatccg
aaacttagcttttttaggaatagcatacaacacattattaagaatagcagaaatagccagaattagag
taaaagacattagtagaacagatggaggaagaatgttaattcatattggaagaacaaaaacattagta
tcaacagccggggtagaaaaagcgttatcattaggagttacaaaattagtagaacgatggatttcagt
ttcaggagtggcagatgacccaaataattatttattttgtagagtacgaaaaaacggagtagcagcac
cttcagcaacaagtcaattaagtacaagagcattagaaggaatattcgaagcaacacatcgactaatt
tacggagcaaaagatgatagtggacaacgatatttagcttggagtggacacagtgcgcgagtaggagc
agcaagagatatggcaagagcgggagttagtataccagaaataatgcaagcaggaggatggacaaatg
taaatattgtaatgaattatattagaaatttagatagtgaaaccggtgcaatggtacgattattagaa
gatggagactaa (SEQ ID NO: 49) frt Gaagttcctattctctagaaagtataggaacttc
(SEQ ID NO: 50) FLP
atgtcgcaatttgatatactatgtaaaactccacctaaagtattagtgcgtcaatttgttgaacgttt
(codon optimized)
tgaacgaccaagtggcgaaaagatagcttcctgtgccgcggaacttacttacttgtgttggatgatta
cacataatggcactgcaatcaaaagagcaacattcatgtcatacaacaccatcatttctaattcttta
tcatttgatattgttaacaaaagtttacaattcaaatacaaaactcaaaaagcgacgattcttgaagc
tagtttgaaaaagttaatcccagcatgggagtttaccatcattccttacaatggacagaaacaccaat
ccgacattacagacattgtttctagtttacaactacaatttgaaagcagtgaagaagcggataaaggg
aactcacattcgaagaaaatgttaaaggctttgttatctgaaggagaatctatctgggagattacaga
aaagattctaaactcttttgagtatacttcacgctttactaaaaccaaaacgttataccagtttcttt
ttctagctacattcattaactgcggtcgatttagtgacattaagaatgtagatcctaaatcgttcaag
ttagtccaaaacaagtatctaggtgtcatcattcaatgcttagttacggaaacaaaaacgagtgtaag
tagacatatctatttcttttctgctagaggtagaattgatccgcttgtatacttagatgaatttctac
gtaattcagagccggtgcttaaacgcgttaatcgtacaggaaatagctcaagcaataagcaagaatat
caacttttgaaagacaatttggtgcgtagctataacaaagcgttaaagaagaatgcaccatatccgat
attcgccatcaaaaacgggccaaaatcccacattggtcgccatcttatgactagcttcctttcgatga
aaggattaacggagttaacaaatgtggtaggtaattggtccgacaaaagagcgagtgctgtagcacga
acgacatatacacatcagattacagctattccagatcactactttgcattagttagtagatactatgc
atatgatccaatttccaaagaaatgattgctcttaaagatgaaacaaatccaatagaagaatggcaac
atatcgaacaacttaaaggatcggcagaaggctctatacgttatcctgcatggaatggtatcatttct
caagaagttttagactatttgtcaagctatatcaatcgtcgcatttaa (SEQ ID NO:
51)
[0134] PCR products were purified with QIAquick purification
columns (Qiagen, Valencia, Calif.), digested with appropriate
restriction enzymes (NEB) and ligated to pKSVoriT, a derivative of
the temperature sensitive allelic exchange vector pKSV7 (Smith,
1992), using T4 DNA ligase (NEB, Ipswich, Mass.). All vectors used
for cloning were treated with calf intestinal alkaline phosphatase,
(CIP), NEB, Ipswich Mass.)). Bacterial strains used for cloning,
conjugation and the Lm parental strains are listed in Table 6
hereinafter. Escherichia coli SM10 was made chemically competent
with the Z-Competent Kit (Zymo Research, Irvine Calif.).
Transformations of both XL1-blue and SM10 were cultured in
Luria-Bertani broth (LB) at 37.degree. C. with appropriate
antibiotic selection (pKSVoriT: 75 .mu.g/ml carbenicillin;
pPL2-based vectors: 20 .mu.g/ml chloramphenicol. Lm strains were
grown in vegetable peptone phosphate broth (VPP) (Basingstoke, UK).
Lm was selected on VPP plates supplemented with 7.5 .mu.g/ml
chloramphenicol and 200 .mu.g/ml streptomycin (Teknova, Hollister
Calif.). Allelic exchange vectors were confirmed by diagnostic
colony PCR, restriction digest, and sequencing (SeqXcel, San Diego
Calif.). Confirmed plasmids were transformed into SM10 cells and
conjugated into Lm as described. Recombinase genes were cloned
downstream of the actA in the site-specific integration vector pPL2
or derivatives thereof (Lauer, 2002).
Example 2
Engineering of Cre/Lox-Mediated Lm RIID Strains
[0135] A non-limiting example that is illustrative of Lm RIID
strains was based on targeting bacterial genes involved in the
winding/unwinding of the bacterial genome during DNA replication,
gyrB (lmo0006) and gyrA (lmo0007), encoding the two subunits of the
Lm gyrase. The first step in the construction involved the
placement of lox71 (Albert et al., 1995) between coding sequences
of MATE efflux (lmo0003) and yaaA (lmo0004), upstream of recF
(lmo0005), and was accomplished by allelic exchange, as described
previously (Camilli et al., 1993). To engineer the allelic exchange
vector used to generate the Lm RIID strain, the upstream flanking
region of the target genes was amplified by PCR using primers
PL2863/PL2864, and the downstream flanking region with primers
PL2865/PL2866. The PCR products were then cloned into a derivative
of the shuttle vector plasmid pKSV7 (Smith et al., 1992) that was
modified to contain an oriT (pKSVoriT), resulting in plasmid
pBHE1937. The lox71 sequence was inserted between the
lmo0003/lmo0004 flanking regions, by amplifying a 400 bp region
containing lox71 from an existing vector by PCR and subsequent
cloning into pBHE1937, resulting in plasmid pBHE2099. The plasmid
was sequence verified and transformed into E. coli SM10 for
conjugation into Lm. The SM10 strain was mated with Lm strain
BH1959, a live-attenuated derivative of DP-L4056 in which the actA,
inlB, uvrAB coding sequences were deleted. In addition, this strain
contains an antigen expression cassette at the inlB locus (as
described in Lauer et al., 2008) for monitoring immunogenicity of
the suicidal strain and its non-suicidal control. Allelic exchange
was performed on transconjugants ultimately resulting in Lm strain
BH3141.
[0136] The second mutant loxP site (lox66) was introduced
downstream of lox71 (Table 5) between gyrA (lmo0007) and
cardiolipin synthase (lmo0008) using splicing by overlap extension
(SOE) PCR as described previously (Horton, 1993). The region
adjacent to gyrA was amplified with primers PL3141/PL3142 and the
downstream region (adjacent to lmo0008) was amplified with
PL3139/PL3140. The lox66 sequence was included in primers PL3139
and PL3142. The primary SOE PCR products were then combined by a
second PCR step, and this SOE product was then cloned into
pKSV7oriT, resulting in the plasmid pBHE2193. Allelic exchange with
pBHE2193 into the lox71-containing strain BH3141 was performed,
resulting in Lm strain BH3210. This strain contained the genomic
region composed of yaaA-recF-gyrB-gyrA flanked by lox71 and lox66
(FIG. 2B).
[0137] The final step in generating the Lm-RIID strain involved the
cloning and integration of a plasmid encoding Cre recombinase that
was functionally linked to the actA promoter, restricting
recombinase gene expression to the cytosol of infected cells in the
vaccinated recipient. The nucleotide sequence of Cre was codon
optimized for expression in Lm (Blue Heron, Bothell, Wash.). The
Cre sequence was amplified with primers PL1536/PL1537 and cloned as
an EagI/BamHI fragment into a pPL2-based plasmid (allowing
site-specific integration at the tRNA.sup.Arg locus) containing the
actA promoter (221 bp, Table 5), resulting in plasmid pBHE2130.
This plasmid was conjugated into both the parental strain (BH1959)
and the lox71/lox66-containing variant (BH3210), resulting in
BH3099 (non-suicidal control) and BH3226 (Lm RIID),
respectively.
[0138] As a second non-limiting illustrative example of Lm-RIID
vaccines, a second set of essential genes for excision was targeted
by placing a lox66 site on the other side of the bacterial origin
in the strain BH3141, which contains a lox71 between BH3141 lmo0003
and lmo0004. The region deleted in this second strain includes
lmo2587, the origin of replication (oriC), the essential
replication initiator genes dnaA and dnaN (encoding a subunit of
DNA polymerase III), and lmo0003 (FIG. 2C). The allelic exchange
vector, pBHE2724, was engineered by first amplifying a region
extending from the 3' end of rnpA through 150 bp downstream of rpmH
by PCR, using oligo set PL4075/PL4017 (flanking region 1). The
second flanking region, composed of the majority of lmo2857, was
amplified using oligo set PL4018/PL4076 (flanking region 2). The
lox66 sequence was included in the forward primer PL4018. The two
flanking regions were assembled into the vector pKSVoriT using
restriction enzyme mediated three-way ligation. The same allelic
exchange process was repeated to embed lox66 in the intergenic
region between rpmH and lmo2857. After confirming insertion of the
lox66-containing sequence in strain BH3141, the new strain was
designated BH3901. pBHE2130 (containing the PactA-Cre cassette) was
introduced by conjugation resulting in the Lm RIID strain
BH3908.
[0139] Using similar methods, a third non-limiting illustrative
example of Lm-RIID vaccines was generated through targeting a
deletion spanning the 14 kilobase region from lmo2582 through gyrA
(FIG. 2D). The first flanking region spanning 1031 bp including
lmo2851 was amplified by PCR using the primers PL3246/PL3247. The
second flanking region spanning 1029 bp including lmo2852 and most
of lmo2853, was amplified by PCR using oligos PL3248/PL3249. Both
fragments were cloned into pKSVoriT in the vector pBHE2292. Lox71
from pBHE2099 (described above) was amplified by PCR using the
primers PL3339/PL3340 and cloned into the KpnI/XbaI sites of
pBHE2292, resulting in pBHE2358. To allow the simultaneous
incorporation of both the lox71 site and the PactA-Cre cassette in
the same allelic exchange, the Cre cassette of pBHE2130 was
amplified with PL3378/PL3379 and cloned into pBHE2358 between lox71
and the lmo2852 flanking region, resulting in allelic exchange
vector pBHE2382. The lox66 site was introduced into the live
attenuated Lm11 strain (live-attenuated Lm .DELTA.actA .DELTA.inlB
vaccine strain) using pBHE2193 (described above), resulting in
intermediate strain BH3291. A second allelic exchange was performed
to insert lox71 and PactA-Cre between lmo2851 and lmo2852 with that
contained in pBHE2382 in BH3291 resulting in the Lm-RIID strain
BH3410.
[0140] A fourth Lm-RIID strain was constructed in the Lm
.DELTA.actA .DELTA.inlB strain background, which allowed various
vaccine antigen compositions to be subsequently introduced at the
tRNA.sup.Arg locus and tested and tested in immunogenicity studies.
The same sequential allelic exchange process that gave rise to
BH3210 was repeated in the Lm11 strain background. First, pBHE2193
was used to insert the lox66 site downstream of gyrA, then pBHE2099
was used to insert the lox71 site upstream of yaaA. The strain
containing the lox71-yaaA-recF-gyrB-gyrA-lox66 composition (FIG.
2B) was designated BH3339. The PactA-Cre cassette was introduced by
allelic exchange at the deleted actA locus of the Lm .DELTA.actA
.DELTA.inlB strain, allowing vaccine antigen expression cassettes
to be subsequently introduced at the tRNA.sup.Arg locus to generate
vaccine strains for evaluation in animal studies. The actA-upstream
flanking region including 825 bp of the mpl gene was amplified by
PCR using primers PL3546/PL3547. The actA-downstream flanking
region that includes 797 bp of the plcB gene was amplified by PCR
with primers PL3548/PL3549. The PCR products were cloned into
pKSVoriT by three-way ligation resulting in the vector pBHE2519.
The pBHE2519 plasmid vector contained unique KpnI and BglII sites
between the two flanking regions. The PactA-Cre cassette was
subcloned from pBHE2130 into pBHE2519 resulting in pBHE2525.
Allelic exchange was used to introduce the PactA-Cre cassette at
the .DELTA.actA locus, resulting in Lm-RIID strain BH3618.
Example 3
Of FLP/Frt-Based RIID Strains
[0141] It will be apparent to the skilled artisan that additional
recombinase methods can be used to selectively delete Lm genes
required for multiplication in the cytosol of the infected host
cell. A non-limiting example is to utilize the yeast recombinase
FLP with the frt recombination sites instead of the Cre/loxP system
to generate Lm-RIID vaccines. A strain that was analogous in
composition to BH3226 (FIG. 2B) was generated by replacing the
lox66 and lox71 sites with frt recombination sites (FIG. 2E) and
utilizing FLP recombinase instead of Cre recombinase. An allelic
exchange vector analogous to pBHE1937 (described in example 1) was
constructed by inserting a frt site between lmo0003 and lmo0004 as
follows: PCR was performed on 10403S DNA with primer pairs
PL2863/PL3472 (MATE efflux, lmo0003) and PL3471/PL2866 (yaaA,
lmo0004). Primers PL3471 and PL3472 added frt sequences to the
native Listeria sequences. Secondary SOE PCR was used to combine
PCR products into a single DNA fragment that contained the two
flanking regions with an intervening frt site. This construct was
cloned into pKSV7oriT as a PstI/EcoRI fragment, giving rise to
pBHE2503. pBHE2503 was introduced into Lm11 by conjugation and
allelic exchange was performed, resulting in BH3558. A second set
of SOE PCR reactions were used to assemble the allelic exchange
vector, pBHE2522 which introduced a frt recombination site between
gyrA and lmo0008. Similar flanking regions found in pBHE2193
(described in example 1), were amplified with primer sets
PL3553/PL3470 (gyrA) and PL3469/PL3552 (lmo0008). Primers PL3469
and PL3470 added a frt sequence to the native Listeria sequence.
SOE PCR was used to assemble a DNA fragment with the two flanking
regions with an intervening frt site, and the PCR product was
cloned into pKVS7oriT as a HindIII/PstI fragment, resulting in
pBHE2522. pBHE2522 was introduced into BH3558 bp conjugation and,
after allelic exchange, resulted in the strain where the gyrase
region is flanked with frt sites, BH3578 (FIG. 4E). Finally, a
vector was constructed to express FLP recombinase from the actA
promoter. The FLP recombinase coding sequence was codon optimized
for expression in Listeria (DNA2.0, Menlo Park Calif.) and
synthesized de novo and cloned, resulting in the vector pJ201:64349
as a ClaI/EagI fragment. The actA promoter was cloned into an
erythromycin resistant derivative of pPL2 (Lauer, 2008), and the
FLP coding sequence was subcloned from pJ201:64349 downstream of
the actA promoter, resulting vector pBHE2516. pBHE2516 was sequence
verified, introduced into strain BH3578 bp conjugation, and
integrated at the tRNA.sup.Arg locus, resulting in the
FLP/frt-based Lm RIID strain BH3602.
Example 4
Laboratory Analysis Methods
[0142] In Vitro Growth Curves
[0143] Cultures grown overnight in BHI (BD Difco, Franklin Lakes,
N.J.) were diluted 1:100 into fresh BHI and grown at 37.degree. C.
shaking at 250 rpm. Optical density (OD.sub.600 nm) was measured in
a BioRad SmartSpec 3000 (BioRad, Hercules, Calif.). Alternatively,
overnight BHI cultures were diluted 1:100 and 150 .mu.L/well was
aliquoted into a 96-well, flat bottomed plate and monitored for
growth using a Versa max microplate reader (Molecular Devices,
Sunnyvale Calif.).
[0144] Intracellular Growth Curves
[0145] Growth curves in the dendritic cell line DC2.4 (Shen, 1997)
were performed in 24-well tissue-culture plates (Costar 3524,
Corning, N.Y.). 2.times.10.sup.5 DC2.4 cells were seeded per well
in RPMI 1640 (Thermo Scientific, Waltham, Mass.) supplemented with
10% heat-inactivated fetal bovine serum (Hyclone), 23.8 mM sodium
bicarbonate (Sigma), 1.times. non-essential amino acids (Cellgro),
2 mM L-glutamine (Cellgro), 1.times.10.sup.-2M HEPES buffer
(Gibco), 1 mM sodium pyruvate (Sigma), and 50 .mu.M
.beta.-mercaptoethanol (Sigma, St. Louis, Mo.). For infection, Lm
strains were grown overnight in BHI at 30.degree. C. without
agitation, then diluted into RPMI to a final concentration
4.times.10.sup.6 cfu/mL, 0.5 mL was used to infect each well for a
final multiplicity of infection (moi) of 20. Cells were infected
for 45 min, washed with 1 ml DPBS (HyClone, South Logan Utah), and
RPMI complete medium containing 50 .mu.g/mL gentamycin was added to
prevent growth of extracellular bacteria. Intracellular bacterial
growth was monitored at several time-points by aspiration of the
media, washing cell monolayers with DPBS and lysing the cell
monolayer hypotonically with 1 mL of sterile water. Serial 10 fold
dilutions were plated on BHI agar plates supplemented with 200
.mu.g/ml streptomycin (Teknova, Hollister Calif.). Plates were
incubated overnight at 37.degree. C. and enumerated for calculation
of cfu/well.
[0146] Western Blots
[0147] Semi-quantitative intracellular Western blots were performed
in DC2.4 cells. 3.times.10.sup.5 DC2.4 cells were seeded in each
well of a 12-well tissue culture plate and incubated overnight.
Cells were infected with 6.times.10.sup.6 of test Lm strains per
well (MOI 20). Cells were incubated for 1 hour, rinsed with DPBS,
and RPMI complete medium containing 50 .mu.g/mL gentamycin was
added. Cells were cultured seven additional hours at 37.degree.
C./5% CO.sub.2 before washing each well with 1 mL DPBS and lysing
cells in 150 .mu.L 1.times.LDS (250 .mu.L 4.times.LDS buffer (Life
Technologies, Grand Island N.Y.), 650 .mu.L TE buffer (Fisher
Scientific, Waltham Mass.) 100 .mu.L sample reducing agent (Life
Technologies, Grand Island N.Y.)). Cell lysates were heated in a
block at 95.degree. C. for 10 min and 20 .mu.L aliquots were run on
4-12% Bis-Tris PAGE gels in 1.times.MES buffer (Invitrogen) and
transferred to nitrocellulose membranes for detection. Membranes
were incubated in Odyssey blocking buffer (Li-Cor, Lincoln Nebr.).
Heterologous antigens were detected using the A18K polyclonal
rabbit antibody which recognizes the mature 18 amino acid amino
terminus of the ActA protein, used as a fusion for antigen
expression at 1:4000 dilution. Expression levels were normalized to
the Listeria P60 protein using a monoclonal antibody MAB8001 at
1:4000 dilution (Fisher Scientific). P60 expression level
correlates with cfu. Secondary antibodies, .alpha.-MS 800 Cw and
.alpha.-Rb 680 (Li-Cor) were used at 1:1000 dilutions. Westerns
were scanned and quantitated on a Li-Cor Odyssey system.
[0148] Animals
[0149] C57BL/6, BALB/c, CD1, CD1.sup.nu/nu and SCID beige mice were
obtained from Charles River Laboratories (Wilmington, Mass.). Mice
were treated according to National Institutes of Health guidelines.
All animal protocols were approved by the Aduro BioTech IACUC. All
vaccinations of Listeria were given intravenously at
5.times.10.sup.6 cfu unless otherwise stated.
[0150] ELISpot Assay
[0151] Immunogenicity was monitored during the experiments by
ELISpot assays performed with lymphocytes isolated from whole mouse
blood using Lympholyte-Mammal (Cedarlane Labs, Burlington, N.C.)
and a murine IFN-.gamma. ELISpot pair (BD Biosciences, San Jose,
Calif.). At the termination of the experiments, ELISpot assays were
performed on splenocytes. 2.times.10.sup.5 cells/well were
incubated with the appropriate peptide overnight at 37.degree. C.
in anti-murine IFN-.gamma. coated ELISpot plate (Millipore,
Billerica, Mass.). Cells were incubated with no peptide as a
negative control. Murine ELISpots were developed using alkaline
phosphatase detection reagents (Invitrogen, Carlsbad, Calif.) and
scanned and quantified using Immunospot plate reader and software
(CTL Ltd, Cleveland, Ohio).
[0152] WT Listeria Challenge
[0153] C57BL/6 mice were vaccinated once with 5.times.10.sup.6 cfu
of each Lm strain. 34 days later, mice were challenged with
2.times.LD.sub.50 of the WT Lm strain DP-L4056 (Lauer, 2002). Three
days later, spleens and livers were harvested and homogenized.
Dilutions were plated on BHI plates containing 200 .mu.g/mL
streptomycin to determine cfu/organ.
[0154] Vaccinia Challenge
[0155] C57BL/6 mice were vaccinated on day 0 and day 29 with
5.times.10.sup.6 cfu of various Lm strains. Mice were challenged 49
days post second vaccination with WT vaccinia intraperitoneally
with 1.times.10.sup.6 pfu. Ovaries were harvested 5 days later and
plaque assays were performed to determine the level of protection
(Brockstedt, 2005).
[0156] Tumor Studies
[0157] BALB/c mice were challenged intravenously on day 0 with
2.times.10.sup.5 the CT26 tumor cell line engineered to express
human mesothelin. Mice were vaccinated 4 days later with
5.times.10.sup.6 cfu Lm RIID, along with appropriate controls, and
boosted with the same vaccination dose 14 days later. Mice were
weighed and monitored daily. At the time of death, lungs were
harvested and metastases enumerated.
Example. 5
Results
[0158] To be effective, vaccines require a balance between
immunogenicity, potency and safety. For practical reasons, it is
further desirable that vaccines can be easily manufactured at large
scale using establish fermentation methods. Lm constitutes an
immunologically potent vaccine platform due to its properties of
cytosolic access, where it multiplies, and can be engineered
further to express and secrete encoded antigens which are
subsequently processed and presented on MHC class I molecules, and
priming of antigen-specific CD8+ T cell responses (Brockstedt and
Dubensky, 2008). Wild-type or live-attenuated Lm strains such as Lm
.DELTA.actA/.DELTA.inlB grow and multiply in broth culture and also
grow and multiply in cells where they can also deliver antigenic
target proteins to the host cytosol inducing an immune response.
Lm-RIID vaccines have been developed to readily grow in broth
culture and to deliver vaccine antigens to the host cell, but have
been further engineered to initiate a program within the cytosol of
the infected cell to "commit suicide," preventing bacterial
multiplication and increasing the safety of the vaccine platform
(FIG. 1).
[0159] To evaluate the growth characteristics of the Lm-RIID
vaccine platform, the Lm-RIID strains BH3226 and BH3618 that delete
the gyrase region, termed Deletion 1 (FIG. 3A) to the parent strain
BH3210 (which contains both lox66 and lox71 sites but lacks the Cre
recombinase expression cassette; genotypes and strain
characteristics for all strains are listed in Table 6), were
compared for growth characteristics in vitro (fermentation in broth
culture) and in host cells. Growth in vitro was measured following
optical density over time in BHI broth culture over the course of 8
hours (as described in Example 1). In vitro growth curves were very
similar for all strains (FIG. 3A), demonstrating that both the
parent strain and Lm-RIID strain can be propagated by conventional
fermentation methods. Next, the intracellular growth kinetics for
the BH3210 parental Lm strain and the Lm-RIID strains BH3226 and
BH3618 were in the DC2.4 mouse dendritic cell line were compared.
BH3210 grew like a typical wild-type Lm strain, multiplying
approximately 2 logs over the course of 7 hours (Portnoy et al.,
1988). In contrast, both BH3226 and BH3618 Lm-RIID strains lost the
ability to generate colony forming units over the same time frame
by 2 to 4 logs (FIG. 3C). These results demonstrate that while
Lm-RIID strains can be propagated by conventional methods in
fermentation culture, following infection of host mammalian cells,
the expression of Cre recombinase is induced, resulting in the
subsequent excision of the region containing the essential gyrase
genes gyrB and gyrA, and loss of viability.
[0160] As an additional non-limiting illustration of the approach,
the kinetics of growth in broth culture and intracellular growth of
Lm-RIID strains that targeted a second set of essential genes were
determined. The Lm-RIID Deletion 2 strain that was engineered to
delete the chromosomal origin of replication (oriC), as well as the
essential replication initiation genes dnaA and dnaN (FIG. 4A).
Lm-RIID BH3908 strain contains lox66 and lox71 sites flanking oriC,
dnaA, and dnaN, and grew in broth culture with the same kinetics as
did the parental BH1959 strain (FIG. 4B). In contrast, following
infection of DC2.4 mouse dendritic cells, the Lm-RIID BH3908 strain
rapidly lost viability (>2 logs in cfu) over the 7 hour time
course, while the parental Lm BH1959 strain multiplied by >2
logs in cfu, a 4 to 5-log difference compared to the Lm-RIID
strain. These results provide a second non-limiting example that
while Lm-RIID strains can be propagated by conventional methods in
fermentation culture, following infection of host mammalian cells,
the expression of Cre recombinase is induced, resulting in the
subsequent excision of the region containing the essential oriC,
dnaA, and dnaN genes and loss of viability.
[0161] As yet a further non-limiting illustration of the approach,
the kinetics of growth in broth culture and intracellular growth of
Lm-RIID strains that targeted a third set of essential genes were
determined. Lm-RIID strains were constructed that contained a
Deletion 3 composition, which spanned both Deletion 1 and Deletion
2 described herein, and also included 5 additional identified open
reading frames in the Listeria genome (lmo2852 through rpmH) (FIG.
5A). The growth characteristics of Lm-RIID strain BH3410 in broth
culture was compared to the parental strain BH3408, which contained
a single lox71 site between lmo2851 and lmo2852 and the PactA-Cre
cassette inserted in the same intergenic region. The growth
characteristics between the Lm-RIID strain and the parental strain
were indistinguishable, demonstrating once again that Lm-RIID
strains can be propagated by conventional broth culture
fermentation (FIG. 5B). Additionally, intracellular growth curves
closely approximated the data from strains Deletion 1 and Deletion
2. In contrast, following infection of DC2.4 mouse dendritic cells,
the Lm-RIID BH3410 strain rapidly lost viability (approximately 3
logs in cfu) over the 7 hour time course, while the Lm BH3408
parental strain multiplied by >2 logs in cfu, a 5-log difference
compared to the Lm-RIID strain (FIG. 5C).
[0162] The skilled artisan will recognize that alternative
recombinase systems can be used to selectively delete Lm genes
required for multiplication in the cytosol of the infected host
cell. The growth characteristics of Lm-RIID strain BH3602 in broth
culture and after infection of DC2.4 cells was compared to the
live-attenuated parental strain Lm11 (Lm .DELTA.actA/.DELTA.inlB).
BH3602 targeted essential genes yaaA, recF, gyrB, gyrA for
deletion, which was similar to the genes targeted in Deletion 1 of
Lm-RIID strains BH3226 and BH3618, except Lm-RIID strain BH3602
utilizes the alternate recombinase system FLP/frt (FIG. 6A). The in
vitro growth kinetics of the Lm-RIID strain BH3602 and the Lm11
parental strain were indistinguishable. In contrast, following
infection of DC2.4 mouse dendritic cells, the Lm-RIID strain BH3602
rapidly lost viability (approximately 2 logs in cfu) over the 7
hour time course, while the Lm 11 parental strain multiplied by
>2 logs in cfu, a 4-log difference compared to the Lm-RIID
strain (FIG. 5C).
[0163] The following table provides a list of bacterial strains
prepared as described herein:
TABLE-US-00012 TABLE 6 Bacterial strains. Parent Recombinase expr.
Antigen expr. cassette & Strain Genotype Strain cassette &
locus locus Lm11 .DELTA.actA, .DELTA.inlB none none BH1959
.DELTA.actA, .DELTA.inlB, .DELTA.uvrAB none inlB::ActAN100- QuadVac
BH1960 .DELTA.actA, .DELTA.inlB, .DELTA.uvrAB, none inlB::ActAN100-
prfAG155S QuadVac BH3141 .DELTA.actA, .DELTA.inlB, .DELTA.uvrAB,
BH1959 none inlB::ActAN100- lmo0003-lox71-yaaA QuadVac BH3210
.DELTA.actA, .DELTA.inlB, .DELTA.uvrAB, BH3141 none inlB::ActAN100-
lmo0003-lox71-yaaA, gyrA- QuadVac lox66-lmo0008 BH3226 .DELTA.actA,
.DELTA.inlB, .DELTA.uvrAB, BH3210 tRNA.sup.Arg::PactA-Cre
inlB::ActAN100- lmo0003-lox71-yaaA, gyrA- QuadVac lox66-lmo0008
BH3099 .DELTA.actA .DELTA.inlB .DELTA.uvrAB BH1959
tRNA.sup.Arg::PactA-Cre inlB::ActAN100- QuadVac BH3291 .DELTA.actA,
.DELTA.inlB, gyrA-lox66- Lm11 none none lmo0008 BH3339 .DELTA.actA,
.DELTA.inlB, lmo0003-lox71- BH3291 none none yaaA,
gyrA-lox66-lmo0008 BH3618 .DELTA.actA, .DELTA.inlB, lmo0003-lox71-
BH3339 .DELTA.actA::PactA-Cre none yaaA, gyrA-lox66-lmo0008 BH3408
.DELTA.actA, .DELTA.inlB, lmo2851-lox71- Lm11 lmo2851-PactA-Cre-
none lmo2852 lmo2852 BH3410 .DELTA.actA, .DELTA.inlB,
lmo2851-lox71- BH3291 lmo2851-PactA-Cre- none lmo2852,
gyrA-lox66-lmo0008 lmo2852 BH3558 .DELTA.actA, .DELTA.inlB,
lmo0003-frt- Lm11 none none yaaA BH3578 .DELTA.actA, .DELTA.inlB,
lmo0003-frt- BH3558 none none yaaA, gyrA-frt-lmo0008 BH3602
.DELTA.actA, .DELTA.inlB, lmo0003-frt- BH3578
tRNA.sup.Arg::PactA-FLP none yaaA, gyrA-frt-lmo0008 BH3943
.DELTA.actA, .DELTA.inlB Lm11 none tRNA.sup.Arg::ActAN100-NY-
ESO-1-MAGE A3 BH3953 .DELTA.actA, .DELTA.inlB, lmo0003-lox71-
BH3816 .DELTA.actA::PactA-Cre tRNA.sup.Arg::ActAN100-NY- yaaA,
gyrA-lox66-lmo0008 ESO-1-MAGE A3 BH3947 .DELTA.actA, .DELTA.inlB
Lm11 none tRNA.sup.Arg::ActAN100- HBV Polymerase-HBxAg BH3957
.DELTA.actA, .DELTA.inlB, lmo0003-lox71- BH3816
.DELTA.actA::PactA-Cre tRNA.sup.Arg::ActAN100- yaaA,
gyrA-lox66-lmo0008 HBV Polymerase-HBxAg BH3951 .DELTA.actA,
.DELTA.inlB Lm11 none tRNA.sup.Arg::ActAN100- PfCSP BH3961
.DELTA.actA, .DELTA.inlB, lmo0003-lox71- BH3816
.DELTA.actA::PactA-Cre tRNA.sup.Arg::ActAN100- yaaA,
gyrA-lox66-lmo0008 PfCSP BH892 .DELTA.actA, .DELTA.inlB Lm11 none
tRNA.sup.Arg::ActAN100- OVA BH3709 .DELTA.actA, .DELTA.inlB,
lmo0003-lox71- BH3816 .DELTA.actA::PactA-Cre
tRNA.sup.Arg::ActAN100- yaaA, gyrA-lox66-lmo0008 AH1-OVA
Example 6
Use as an Antigen Expression Platform
[0164] A prerequisite for vaccine potency is delivery of the target
antigen in an immunologically relevant context. For Lm-based
vaccines, antigens must be expressed and delivered to the host
antigen presenting cell (e.g., dendritic cells) cytosol, were
encoded antigens are expressed, secreted from the bacterium into
the cytosol, where subsequent antigen processing and presentation
on MHC class I molecules results in CD8+ T cell priming. It will be
appreciated by the skilled artisan that the magnitude of antigen
expression can impact the magnitude of the vaccine-induced immune
response. The intracellular level of encoded heterologous antigen
expression by Lm-RIID vaccines following infection of mouse DC2.4
dendritic cells was measured. As a non-limiting example, the
antigen expression level of four independent Lm-RIID strains
encoding distinct heterologous was measured. All antigen expression
cassette constructs encoded a fusion protein consisting of the
amino terminal 100 amino acids of the Listeria ActA protein
(ActAN100) cloned the in-frame with the heterologous antigen, as
described previously (Lauer et. al., 2008). Detection of
intracellular antigen expression was by Western blot analysis of
infected cell lysates, using a polyclonal antibody raised against
the mature amino terminus of ActA (described in Example 1).
Expression of all antigens was functionally linked the actA
promoter, which is minimally expressed in broth culture, and
induced approximately 200-fold in the host cell cytosol
(Shetron-Rama et al., 2002). The actA promoter was also used for
Cre or FLP recombinase expression, to link the temporal expression
of the vaccine antigen with the intracellular death of the
bacterium in the cytosol of the infected host cell of the
vaccinated recipient. All antigen expression cassettes were cloned
into a derivative of the site-specific integration vector pPL2 and
integrated at the tRNA.sup.Arg locus of both Lm11 (live-attenuated)
and BH3618 (Lm-RIID) strains, as described previously (Lauer et.
al., 2008).
[0165] Genes for all antigens were codon-optimized for expression
in Listeria and synthesized de novo (DNA2.0, Menlo Park, Calif.).
Fusions were then assembled by PCR and cloning for a fusion of the
cancer antigens NY-ESO-1 and MAGE A3 (FIG. 7B), and the infectious
disease antigens HBV polymerase and HBxAg (FIG. 7C) or the
Plasmodium falciparum circumsporozoite protein (PfCSP) (FIG. 7D).
Expression was normalized to the Listeria P60 protein as described
in Example 1. Relative expression from Lm-RIID was calculated as
the ratio of expression measured from the Lm-RIID strain divided by
the expression from the paired live attenuated control strain. The
measured ratio of expression were 1.times. for NY-ESO-1-MAGE A3,
1.1.times. for the HBV polymerase-HBxAg fusion, and 1.8.times. for
the PfCSP antigen construct. These results demonstrate that
concurrently with intracellular bacterial death, Lm-RIID strains
expressed robust levels of encoded vaccine antigens and delivered
them to the host-cell for processing and the induction of an immune
response, significantly at levels that were comparable with that
observed with parental recombinant live-attenuated Lm vaccine
strains.
Example 7
Clearance of Lm-RIID Vaccine Strains In Vivo
[0166] The principal organs that are infected in the mouse
following intravenous (IV) administration of L. monocytogenes (Lm)
are the liver and spleen (Portnoy et al., 2002). The acute toxicity
determined by median lethality of the live-attenuated Lm
.DELTA.actA/.DELTA.inlB vaccine platform is attenuated by more than
3 logs in the mouse listeriosis model as compared to wild-type Lm
(WT Lm), which is reflected by rapid clearance in the liver and
spleen in infected mice, measured by quantification of colony
forming units (cfu) in cell lysates prepared from harvested organs
(Brockstedt et al., 2004).
[0167] As shown in the examples contained herein, Lm-RIID can be
derived from the live-attenuated Lm .DELTA.actA/.DELTA.inlB (i.e.,
deletion or mutation of actA and inlB virulence genes) vaccine
strain. However, in contrast to Lm .DELTA.actA/.DELTA.inlB, Lm-RIID
vaccines are pre-programmed (i.e., engineered) to spontaneously
initiate its own suicide within the context of infected cells of
the vaccinated mammal. To illustrate the increased safety profile
of vaccine strains based on Lm-RIID vaccines compared to Lm
.DELTA.actA/.DELTA.inlB vaccines, the kinetics of clearance in both
immune competent C57BL/6 mice and in immune deficient SCID-Beige
mice lacking functional innate and adaptive immunity were compared.
Groups of 5 female C57BL/6 mice were given 5.times.10.sup.6 cfu of
Lm-RIID (BH3226) or Lm .DELTA.actA/.DELTA.inlB (BH3099) vaccine
strains by IV injection, and the bacterial burden in the livers and
spleens were determined by plating on nutrient agar serial
dilutions of clarified lysates processed from harvested organs at
0.2, 4 and 24 hours post injection. The amount of Lm
.DELTA.actA/.DELTA.inlB (BH3099) vaccine strain measured in the
liver or spleen was at similar levels at the 4 and 24 hour time
points; i.e., the Lm .DELTA.actA/.DELTA.inlB (BH3099) vaccine
strain bacterial burden did not diminish during this period (FIG.
8A). In striking contrast, the quantity of Lm-RIID (BH3226) rapidly
decreased at 4 hours post injection as compared to the 0.2 hours
post injection time point, and no Lm-RIID (BH3226) colonies could
be detected by culture at the final time point evaluated at 24
hours post infection (FIG. 8A).
[0168] These results provide unequivocal evidence that Lm-RIID
(BH3226) is cleared significantly more rapidly from the livers and
spleens of mice following IV administration as compared to
live-attenuated Lm .DELTA.actA/.DELTA.inlB (BH3099). To assess the
dependence of the host immune response on the clearance of
live-attenuated Lm .DELTA.actA/.DELTA.inlB and Lm-RIID vaccine
strains, in a separate experiment, groups of 4 female SCID/Beige
immune deficient mice were given 5.times.10.sup.6 cfu of Lm-RIID
(BH3226) or Lm .DELTA.actA/.DELTA.inlB (BH3099) vaccine strains by
IV injection, and the bacterial burden in the spleens were
determined by plating on nutrient agar serial dilutions of
clarified lysates processed from organs harvested at 20 minutes, 1,
2 and 4 days post injection. The bacterial burden measured in the
spleens of SCID/Beige immune mice given live-attenuated Lm
.DELTA.actA/.DELTA.inlB (BH3099) increased at 1 day compared to the
level measured at 20 minutes after injection, indicating
multiplication of the input bacteria. The peak level of bacteria
observed at 1 day post injection with Lm .DELTA.actA/.DELTA.inlB
(BH3099) was at least 5.times.10.sup.6 cfu per spleen, and then
decreased over the next 2 time points evaluated to a level of about
5.times.10.sup.4 cfu per spleen measured at the last 4 day post
injection time point evaluated (FIG. 8B). In striking contrast, no
multiplication of bacteria, as determined by an increase in cfu
between time points, could be measured in the spleens of SCID/Beige
immune mice given Lm-RIID (BH3226) vaccine strain; the bacterial
burden rapidly declined following the first time point evaluated at
20 minutes post injection, and by the 4 day post injection time
point, no Lm-RIID (BH3226) colonies could be detected in the
spleens (FIG. 8B). Taken together, the results shown in FIGS. 8A
and 8B demonstrate that Lm-RIID vaccine strains spontaneously
initiate its own clearance from the vaccinated host, and,
essentially, a functioning immune response is not required for
clearance. The skilled artisan will recognize that this
characteristic of spontaneous clearance is a desirable feature for
broad application of Lm-RIID based strains for both prophylactic
and therapeutic vaccines.
Example 8
Immunogenicity of Lm-RIID Strains
[0169] Recombinant L. monocytogenes has been shown to induce potent
CD4+ and CD8+ T cell immunity to encoded heterologous antigens in
mice and in humans (Brockstedt et al., 2004; Le et al., 2012). The
immunogenicity of Lm-RIID in mice was compared to live-attenuated
Lm .DELTA.actA/.DELTA.inlB and Killed But Metabolically Active
(KBMA; Lm .DELTA.actA/.DELTA.inlB/.DELTA.uvrAB) was compared. To
enable the immunogenicity of the Lm-RIID, Lm
.DELTA.actA/.DELTA.inlB, and KBMA vaccines to be compared, each
vaccine strain contained the same Ag expression cassette encoding
five defined H-2.sup.b-restricted major histocompatibility complex
(MHC) class I epitopes that have previously been shown to elicit a
range of CD8+ T-cell responses in mice, when encoded by
live-attenuated Lm .DELTA.actA/.DELTA.inlB, and KBMA vaccines
(Lauer et al., 2008). The use of an array of precise class I
restricted epitopes provides an optimized method for assessing
immunogenicity in vivo, simplifying comparisons of the Lm-RIID, Lm
.DELTA.actA/.DELTA.inlB, and KBMA vaccine platforms.
[0170] The Ag expression cassette construct encodes four tandemly
spaced vaccinia virus (A42R, C4L, K3L, and B8R) class I epitopes
and the chicken OVA (SL8) epitope, and was synthesized and then
cloned under the control of the PrfA-regulated actA promoter as a
fusion protein with the 100 N-terminal amino acids of ActA (Lauer
et al., 2008). The construct is known as Quadvac and was cloned
into a derivative of the pPL2 integration vector and then
integrated into the tRNA.sup.Arg site of Lm-RIID, Lm
.DELTA.actA/.DELTA.inlB, and KBMA vaccine strains as described
previously (Lauer et al., 2002; Lauer et al., 2008).
[0171] To evaluate relative immunogenicity, groups of 5 female
C57BL/6 (H-2.sup.b) mice were immunized twice at an interval of 36
days with the Lm-RIID, Lm .DELTA.actA/.DELTA.inlB, and KBMA vaccine
strains each encoding Quadvac, at a dose level of 5.times.10.sup.6
colony forming units (CFU). The KBMA vaccine dose level was
measured prior to photochemical inactivation, as described
previously (Brockstedt et al., 2005). Five days following the
second immunization, spleens were harvested from vaccinated mice,
and the magnitude of the CD8+ T cell responses specific for the 5
encoded epitopes was measured by ELISpot analysis of splenocytes
following overnight stimulation with 1 .mu.M of peptides
corresponding to each of the MHC class I epitopes having the amino
acid sequence as follows, as described previously: A42R.sub.88-96,
YAPVSPIVI (SEQ ID NO: 52); C4L.sub.125-132, LNFRFENV (SEQ ID NO:
53); K3L.sub.6-15, YSLPNAGDVI (SEQ ID NO: 54); B8R.sub.20-27,
TSYKFESV (SEQ ID NO: 55); and, SL8.sub.257-264, SIINFEKL (SEQ ID
NO: 56) (Lauer et al., 2008; Moutaftsi et al., 2006). Lm-RIID
vaccines induced CD8+ T cell responses specific for the 5 MHC class
I epitopes that were comparable in magnitude to mice immunized with
live-attenuated Lm .DELTA.actA/.DELTA.inlB vaccine strains, and
that were significantly higher than the magnitude of the CD8+ T
cell responses measured in mice immunized with KBMA vaccines (FIG.
9).
[0172] These results demonstrate that although Lm-RIID vaccines are
engineered initiate a program to commit suicide within infected
cells of the vaccinated recipient and do not require a functional
immune response for clearance, surprisingly, Lm-RIID vaccines
retain the capacity to induce a robust specific CD8 T cell response
that is comparable to live-attenuated Lm vaccines. The skilled
artisan will understand that these results demonstrate that Lm-RIID
vaccines have general utility for preventative or therapeutic
vaccination in humans to induce a T cell response specific for
desired Ags, due to the characteristics of having similar
immunologic potency to live-attenuated Lm vaccines, but having a
significantly improved safety profile due to its feature of
immune-response independent spontaneous clearance.
Example 9
Protective Immunity Afforded by Vaccination with Lm-RIID Based
Vaccine Strains
[0173] The Examples provided herein demonstrate that Lm-RIID
vaccines self-initiate a pre-programmed suicide within the host
cell, do not require a functioning immune response for clearance
from the vaccinated host, yet retain the capacity to induce
cellular immunity specific for an encoded antigen that is
comparable to vaccination with live-attenuated Lm
.DELTA.actA/.DELTA.inlB vaccine strains. However, the skilled
artisan will recognize that one important measure of effective
immunization is whether a vaccine candidate can confer protection
against subsequent challenge with a virulent pathogen.
[0174] It is well-recognized in the field that a single
immunization of mice with sub-lethal doses of wild-type Lm (WT Lm)
or appropriate live-attenuated strains affords life-long protection
against lethal challenge with WT Lm, measured by bacterial burden
in the liver or spleen at three days post challenge (Bahjat et al.,
2006). The correlates of protection are CD4+ and CD8+ T cell
immunity, and humoral immunity plays no role in protection (Berche
et al., 1987). To evaluate the relative capacity of Lm-RIID
vaccination to provide protective immunity, groups of 5 female
C57BL/6 mice were vaccinated with Hanks-balanced salt solution
(HBSS) as a negative control, or with 5.times.10.sup.6 cfu of
Lm-RIID or live-attenuated Lm .DELTA.actA/.DELTA.inlB vaccines, or
with 1.times.10.sup.8 cfu (determined prior to photochemical
inactivation) of KBMA vaccines. Vaccinated and control mice were
challenged at 41 days post vaccination in order to assess the
capacity of the vaccine-induced memory T cell response to provide
protection against lethal bacterial challenge with 20 LD.sub.50
doses (2.times.10.sup.5 cfu) of WT Lm.
[0175] Vaccination with Lm-RIID provided 4 logs of protection
against WT Lm challenge as compared to the HBSS negative control
group (FIG. 10A). While the level of protection afforded by Lm-RIID
was approximately 20-fold less than vaccination with Lm
.DELTA.actA/.DELTA.inlB, it was more than 3 logs better compared to
vaccination with KBMA vaccines (FIG. 10A). As a second measure to
assess the functional capacity of Lm-RIID vaccine-induced T cell
responses to afford protection against pathogen challenge, we
utilized the vaccinia virus challenge model. With this model,
protection is measured by quantitating challenge virus in the
ovaries of mice by plaque assay 5 days following challenge with
vaccinia virus encoding an antigen that is cognate to the test
vaccine used for immunization (Belyakov et al., 1998; Brockstedt et
al., 2005). To assess protective immunity, mice were vaccinated
twice with an interval of 29 days with 5.times.10.sup.6 cfu of
Lm-RIID or live-attenuated Lm .DELTA.actA/.DELTA.inlB vaccines, or
with 1.times.10.sup.8 cfu (determined prior to photochemical
inactivation) of KBMA vaccines. All test vaccines encoded the
Quadvac vaccinia virus CD8+ T cell epitopes and SL8 CD8+ T cell
epitope described in Example 9. 49 days following the boost
vaccination, mice were challenged by intraperitoneal challenge with
1.times.10.sup.6 plaque forming units (pfu) with vaccinia virus
encoding chicken Ovalbumin, and pfu in the ovaries was measured 4
days later by plaque assay on BSC cells of serial dilutions of
clarified processed organ homogenates. S
[0176] Strikingly, the level of protection afforded by immunization
with Lm-RIID or live-attenuated Lm .DELTA.actA/.DELTA.inlB vaccines
was indistinguishable, and was greater than 1000-fold compared to
the HBSS negative control group, and was more than 100-fold better
than the level of protection afforded by vaccination with KBMA
vaccines (FIG. 10B). The skilled artisan will readily recognize
that the Lm-RIID vaccines have a desirable safety profile compared
to live-attenuated Lm .DELTA.actA/.DELTA.inlB vaccines, yet provide
comparable immunologic potency, as measured by the extent of
protection against pathogen challenge.
Example 10
Lm-RIID Vaccine Induced Therapeutic Anti-Tumor Efficacy
[0177] Having demonstrated that Lm-RIID vaccines stimulate CD4+ and
CD8+ T cell immunity specific for vector encoded antigens which
function to provide protection against challenge with a pathogen
encoding the cognate antigen, that is comparable to live-attenuated
Lm .DELTA.actA/.DELTA.inlB vaccine strains, the skilled artisan
will recognize that Lm-RIID vaccines will also have application for
cancer immunotherapy. It is well-appreciated that barriers to
effective immune therapies include tolerance to the targeted
tumor-associated antigen(s) that can limit induction of cytotoxic
CD8+ T cells of appropriate magnitude and function, poor
trafficking of the generated T cells to sites of malignant cells,
and poor persistence of the induced T cell response (Blankenstein
et al., 2012; Topalian et al., 2011). One measure of potency is to
evaluate the capacity of a selected platform to reverse tumor
progression and increase survival time compared to controls, when
administered to tumor-bearing animals.
[0178] The CT-26 murine colon tumor cell line was used to test the
benefit of therapeutic vaccination with Lm-RIID vaccines (Slansky
et al., 2000). The CT-26 tumor cells were given by intravenous (IV)
inoculation, which results in the establishment of lung tumor
nodules that can be quantitated in the lungs harvested from treated
mice at desired time points post implantation, or, alternatively,
mice can be monitored for survival, and sacrificed when moribund,
due to excessive tumor growth preventing adequate respiration.
Therapeutic efficacy in the CT26 tumor model requires breaking of
self-tolerance to the H-2L.sup.d-restricted immunodominant epitope
AH1 from the gp70 endogenous tumor antigen (Slansky et al., 2000).
Lm-RIID vaccines were constructed that expressed the altered
peptide ligand AH1-A5 epitope (SPSYAYHQF (SEQ ID NO: 57)),
containing a heteroclitic valine to alanine change in the fifth
position of the MHC class I epitope, embedded in-frame within a
unique Ava II restriction endonuclease site in chicken ovalbumin
(OVA), as described previously (Brockstedt et al., 2004). To
evaluate the therapeutic efficacy of Lm-RIID, 30 Female BALB/c mice
were each given 2.times.10.sup.5 CT26 cells suspended in 100 .mu.l
of HBSS by tail vein injection, and then randomized to 3 groups of
10 mice. 4 days later, the 3 groups of mice were given 100 .mu.l of
HBSS, or 5.times.10.sup.6 cfu of live-attenuated Lm
.DELTA.actA/.DELTA.inlB expressing OVA (BH892), or 5.times.10.sup.6
cfu of Lm RIID expressing OVA-AH1-A5 (BH3709). Fourteen days later,
the same injections were given to all 3 groups of mice, and all
mice were then monitored daily for survival.
[0179] Tumor-bearing animals in negative controls groups treated
with HBSS or live-attenuated Lm .DELTA.actA/.DELTA.inlB expressing
OVA had a median survival time of about 24 days post CT-26 tumor
cell implantation (FIG. 11). In striking contrast, the group of
mice given Lm RIID expressing OVA-AH1-A5 had a median survival time
of 55 days, that was significantly longer than either control group
(p<0.001, log-rank Mantel-Cox test) (FIG. 11). Furthermore, 30%
of the animals treated with Lm-RIID vaccines expressing OVA-AH1-A5
were long-term survivors, when the experiment was terminated 160
days following tumor cell implantation (FIG. 11). These results
provide unequivocal evidence that Lm-RIID vaccines although
pre-programmed to commit suicide within host cells of the
vaccinated recipient, retain the capacity to initiate a functional
tumor-specific CD8+ T cell response in tumor-bearing animals, and
provide significant benefit and overall survival, as compared to
negative controls. The skilled artisan will recognize that Lm-RIID
vaccines are a platform with direct application to clinical cancer
immunotherapy, due to the combined properties of safety and
therapeutic efficacy.
Example 11
REFERENCES
[0180] 1. Albert, H., Dale, E. C., Lee, E., and Ow, D. W. (1995).
Site-specific integration of DNA into wild-type and mutant lox
sites placed in the plant genome. The Plant Journal: For Cell And
Molecular Biology 7, 649-659. [0181] 2. Bahjat, K. S., Liu, W.,
Lemmens, E. E., Schoenberger, S. P., Portnoy, D. A., Dubensky, T.
W., Jr., and Brockstedt, D. G. (2006). Cytosolic entry controls
CD8+-T-cell potency during bacterial infection. Infect Immun 74,
6387-6397. [0182] 3. Belyakov, I. M., Ahlers, J. D., Brandwein, B.
Y., Earl, P., Kelsall, B. L., Moss, B., Strober, W., and Berzofsky,
J. A. (1998). The importance of local mucosal HIV-specific CD8(+)
cytotoxic T lymphocytes for resistance to mucosal viral
transmission in mice and enhancement of resistance by local
administration of IL-12. J Clin Invest 102, 2072-2081. [0183] 4.
Berche, P., Gaillard, J. L., and Sansonetti, P. J. (1987).
Intracellular growth of Listeria monocytogenes as a prerequisite
for in vivo induction of T cell-mediated immunity. J Immunol 138,
2266-2271. [0184] 5. Bishop, D. K., and Hinrichs, D. J. (1987).
Adoptive transfer of immunity to Listeria monocytogenes. The
influence of in vitro stimulation on lymphocyte subset
requirements. J Immunol 139, 2005-2009. [0185] 6. Blankenstein, T.,
Coulie, P. G., Gilboa, E., and Jaffee, E. M. (2012). The
determinants of tumour immunogenicity. Nature reviews. Cancer 12,
307-313. [0186] 7. Brockstedt, D. G., Bahjat, K. S., Giedlin, M.
A., Liu, W., Leong, M., Luckett, W., Gao, Y., Schnupf, P., Kapadia,
D., Castro, G., et al. (2005). Killed but metabolically active
microbes: a new vaccine paradigm for eliciting effector T-cell
responses and protective immunity. Nat Med 11, 853-860. [0187] 8.
Brockstedt, D. G., Giedlin, M. A., Leong, M. L., Bahjat, K. S.,
Gao, Y., Luckett, W., Liu, W., Cook, D. N., Portnoy, D. A., and
Dubensky, T. W., Jr. (2004). Listeria-based cancer vaccines that
segregate immunogenicity from toxicity. Proc Natl Acad Sci USA 101,
13832-13837. [0188] 9. Camilli, A., Tilney, L. G., and Portnoy, D.
A. (1993). Dual roles of plcA in Listeria monocytogenes
pathogenesis. Mol Microbiol 8, 143-157. [0189] 10. Horton, R. M.
(1993). In Vitro Recombination and Mutagenesis of DNA: SOEing
Together Tailor-Made Genes. Methods Mol Biol 15, 251-261. [0190]
11. Lauer, P., Chow, M. Y., Loessner, M. J., Portnoy, D. A., and
Calendar, R. (2002). Construction, characterization, and use of two
Listeria monocytogenes site-specific phage integration vectors. J
Bacteriol 184, 4177-4186. [0191] 12. Lauer, P., Hanson, B.,
Lemmens, E. E., Liu, W., Luckett, W. S., Leong, M. L., Allen, H.
E., Skoble, J., Bahjat, K. S., Freitag, N. E., et al. (2008).
Constitutive Activation of the PrfA regulon enhances the potency of
vaccines based on live-attenuated and killed but metabolically
active Listeria monocytogenes strains. Infect Immun 76, 3742-3753.
[0192] 13. Le, D. T., Brockstedt, D. G., Nir-Paz, R., Hampl, J.,
Mathur, S., Nemunaitis, J., Sterman, D. H., Hassan, R., Lutz, E.,
Moyer, B., et al. (2012). A live-attenuated Listeria vaccine
(ANZ-100) and a live-attenuated Listeria vaccine expressing
mesothelin (CRS-207) for advanced cancers: phase I studies of
safety and immune induction. Clin Cancer Res 18, 858-868. [0193]
14. Moutaftsi, M., Peters, B., Pasquetto, V., Tscharke, D. C.,
Sidney, J., Bui, H. H., Grey, H., and Sette, A. (2006). A consensus
epitope prediction approach identifies the breadth of murine T
(CD8+)-cell responses to vaccinia virus. Nat Biotechnol 24,
817-819. [0194] 15. Portnoy, D. A., Auerbuch, V., and Glomski, I.
J. (2002). The cell biology of Listeria monocytogenes infection:
the intersection of bacterial pathogenesis and cell-mediated
immunity. J Cell Biol 158, 409-414. [0195] 16. Portnoy, D. A.,
Jacks, P. S., and Hinrichs, D. J. (1988). Role of hemolysin for the
intracellular growth of Listeria monocytogenes. J Exp Med 167,
1459-1471. [0196] 17. Shen, Z., Reznikoff, G., Dranoff, G., and
Rock, K. L. (1997). Cloned dendritic cells can present exogenous
antigens on both MHC class I and class II molecules. J Immunol 158,
2723-2730. [0197] 18. Shetron-Rama, L. M., Marquis, H., Bouwer, H.
G., and Freitag, N. E. (2002). Intracellular induction of Listeria
monocytogenes actA expression. Infect Immun 70, 1087-1096. [0198]
19. Simon, R., Priefer, U., and Pulhler, A. (1983). A broad host
range mobilization system for in vivo genetic engineering:
transposon mutagenesis in gram negative bacteria. Nature Biotech 1,
784-791. [0199] 20. Slansky, J. E., Rattis, F. M., Boyd, L. F.,
Fahmy, T., Jaffee, E. M., Schneck, J. P., Margulies, D. H., and
Pardoll, D. M. (2000). Enhanced antigen-specific antitumor immunity
with altered peptide ligands that stabilize the MHC-peptide-TCR
complex. Immunity 13, 529-538. [0200] 21. Smith, K., and Youngman,
P. (1992). Use of a new integrational vector to investigate
compartment-specific expression of the Bacillus subtilis spoIIM
gene. Biochimie 74, 705-711. [0201] 22. Topalian, S. L., Weiner, G.
J., and Pardoll, D. M. (2011). Cancer immunotherapy comes of age.
Journal of clinical oncology: official journal of the American
Society of Clinical Oncology 29, 4828-4836.
[0202] One skilled in the art readily appreciates that the present
invention is well adapted to carry out the objects and obtain the
ends and advantages mentioned, as well as those inherent therein.
The examples provided herein are representative of preferred
embodiments, are exemplary, and are not intended as limitations on
the scope of the invention.
[0203] It will be readily apparent to a person skilled in the art
that varying substitutions and modifications may be made to the
invention disclosed herein without departing from the scope and
spirit of the invention.
[0204] All patents and publications mentioned in the specification
are indicative of the levels of those of ordinary skill in the art
to which the invention pertains. All patents and publications are
herein incorporated by reference to the same extent as if each
individual publication was specifically and individually indicated
to be incorporated by reference.
[0205] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of" and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed. Thus, it should be understood that although the
present invention has been specifically disclosed by preferred
embodiments and optional features, modification and variation of
the concepts herein disclosed may be resorted to by those skilled
in the art, and that such modifications and variations are
considered to be within the scope of this invention as defined by
the appended claims.
[0206] Other embodiments are set forth within the following claims.
Sequence CWU 1
1
571237PRTListeria monocytogenes 1Met Asn Ala Gln Ala Glu Glu Phe
Lys Lys Tyr Leu Glu Thr Asn Gly 1 5 10 15 Ile Lys Pro Lys Gln Phe
His Lys Lys Glu Leu Ile Phe Asn Gln Trp 20 25 30 Asp Pro Gln Glu
Tyr Cys Ile Phe Leu Tyr Asp Gly Ile Thr Lys Leu 35 40 45 Thr Ser
Ile Ser Glu Asn Gly Thr Ile Met Asn Leu Gln Tyr Tyr Lys 50 55 60
Gly Ala Phe Val Ile Met Ser Gly Phe Ile Asp Thr Glu Thr Ser Val 65
70 75 80 Gly Tyr Tyr Asn Leu Glu Val Ile Ser Glu Gln Ala Thr Ala
Tyr Val 85 90 95 Ile Lys Ile Asn Glu Leu Lys Glu Leu Leu Ser Lys
Asn Leu Thr His 100 105 110 Phe Phe Tyr Val Phe Gln Thr Leu Gln Lys
Gln Val Ser Tyr Ser Leu 115 120 125 Ala Lys Phe Asn Asp Phe Ser Ile
Asn Gly Lys Leu Gly Ser Ile Cys 130 135 140 Gly Gln Leu Leu Ile Leu
Thr Tyr Val Tyr Gly Lys Glu Thr Pro Asp 145 150 155 160 Gly Ile Lys
Ile Thr Leu Asp Asn Leu Thr Met Gln Glu Leu Gly Tyr 165 170 175 Ser
Ser Gly Ile Ala His Ser Ser Ala Val Ser Arg Ile Ile Ser Lys 180 185
190 Leu Lys Gln Glu Lys Val Ile Val Tyr Lys Asn Ser Cys Phe Tyr Val
195 200 205 Gln Asn Leu Asp Tyr Leu Lys Arg Tyr Ala Pro Lys Leu Asp
Glu Trp 210 215 220 Phe Tyr Leu Ala Cys Pro Ala Thr Trp Gly Lys Leu
Asn 225 230 235 229PRTListeria monocytogenes 2Met Gly Leu Asn Arg
Phe Met Arg Ala Met Met Val Val Phe Ile Thr 1 5 10 15 Ala Asn Cys
Ile Thr Ile Asn Pro Asp Ile Ile Phe Ala 20 25 3100PRTListeria
monocytogenes 3Val Gly Leu Asn Arg Phe Met Arg Ala Met Met Val Val
Phe Ile Thr 1 5 10 15 Ala Asn Cys Ile Thr Ile Asn Pro Asp Ile Ile
Phe Ala Ala Thr Asp 20 25 30 Ser Glu Asp Ser Ser Leu Asn Thr Asp
Glu Trp Glu Glu Glu Lys Thr 35 40 45 Glu Glu Gln Pro Ser Glu Val
Asn Thr Gly Pro Arg Tyr Glu Thr Ala 50 55 60 Arg Glu Val Ser Ser
Arg Asp Ile Glu Glu Leu Glu Lys Ser Asn Lys 65 70 75 80 Val Lys Asn
Thr Asn Lys Ala Asp Leu Ile Ala Met Leu Lys Ala Lys 85 90 95 Ala
Glu Lys Gly 100 4100PRTListeria monocytogenes 4Met Gly Leu Asn Arg
Phe Met Arg Ala Met Met Val Val Phe Ile Thr 1 5 10 15 Ala Asn Cys
Ile Thr Ile Asn Pro Asp Ile Ile Phe Ala Ala Thr Asp 20 25 30 Ser
Glu Asp Ser Ser Leu Asn Thr Asp Glu Trp Glu Glu Glu Lys Thr 35 40
45 Glu Glu Gln Pro Ser Glu Val Asn Thr Gly Pro Arg Tyr Glu Thr Ala
50 55 60 Arg Glu Val Ser Ser Arg Asp Ile Glu Glu Leu Glu Lys Ser
Asn Lys 65 70 75 80 Val Lys Asn Thr Asn Lys Ala Asp Leu Ile Ala Met
Leu Lys Ala Lys 85 90 95 Ala Glu Lys Gly 100 5102PRTListeria
monocytogenes 5Val Gly Leu Asn Arg Phe Met Arg Ala Met Met Val Val
Phe Ile Thr 1 5 10 15 Ala Asn Cys Ile Thr Ile Asn Pro Asp Ile Ile
Phe Ala Ala Thr Asp 20 25 30 Ser Glu Asp Ser Ser Leu Asn Thr Asp
Glu Trp Glu Glu Glu Lys Thr 35 40 45 Glu Glu Gln Pro Ser Glu Val
Asn Thr Gly Pro Arg Tyr Glu Thr Ala 50 55 60 Arg Glu Val Ser Ser
Arg Asp Ile Glu Glu Leu Glu Lys Ser Asn Lys 65 70 75 80 Val Lys Asn
Thr Asn Lys Ala Asp Leu Ile Ala Met Leu Lys Ala Lys 85 90 95 Ala
Glu Lys Gly Gly Ser 100 6102PRTListeria monocytogenes 6Met Gly Leu
Asn Arg Phe Met Arg Ala Met Met Val Val Phe Ile Thr 1 5 10 15 Ala
Asn Cys Ile Thr Ile Asn Pro Asp Ile Ile Phe Ala Ala Thr Asp 20 25
30 Ser Glu Asp Ser Ser Leu Asn Thr Asp Glu Trp Glu Glu Glu Lys Thr
35 40 45 Glu Glu Gln Pro Ser Glu Val Asn Thr Gly Pro Arg Tyr Glu
Thr Ala 50 55 60 Arg Glu Val Ser Ser Arg Asp Ile Glu Glu Leu Glu
Lys Ser Asn Lys 65 70 75 80 Val Lys Asn Thr Asn Lys Ala Asp Leu Ile
Ala Met Leu Lys Ala Lys 85 90 95 Ala Glu Lys Gly Gly Ser 100
733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7tttcggccga tgagtaacct attaactgtt cat
33831DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8tttggatcct tagtctccat cttctaataa t
31933DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9tttggtaccg gtcatgatga cattaataca aca
331033DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10tttgagctct atcctaaatg gctttatatc agt
331131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11tttaagcttt tggaaattcg attaccccac t
311234DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12tttggtacct ggttattttc gtcgaataac tgcc
341344DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13tttggtacct ttgagctctt ttagtaaaaa aacgccagag aagc
441430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14tttgaattct ccgttgttgc aatattcgct
301533DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15tttaagcttt ccctgaagaa gaagtagcaa tta
331635DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16tttggtacca gcttgatttt attcttctat gtcgc
351741DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17tttggtacct ttgagctcgg aaatgactct aatttgcgaa t
411834DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18tttgaattct ccatgtatac ccaatcgttt agga
341957DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19ataacttcgt atagcataca ttatacgaac ggtaggaaat
gactctaatt tgcgaat 572034DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 20tttgaattct ccatgtatac
ccaatcgttt agga 342133DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 21tttaagcttt ccctgaagaa
gaagtagcaa tta 332260DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 22taccgttcgt ataatgtatg
ctatacgaag ttatagcttg attttattct tctatgtcgc 602330DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23tttgaattca cagaaggaga ttgtgaaatg 302438DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24gggtctagat ttggtaccaa tagaagcgta ctgcgact 382529DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25gggtctagag tttcacgtga aacattcta 292629DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26tttaagcttc ggaattggtt caagactgg 292730DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27attggtacct tcgaggagta aacttcccaa 302830DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28aactctagac accgcggtgg cggccgataa 302932DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29tatgcggccg cgggaagcag ttggggttaa ct 323030DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30aactctagac ttagtctcca tcttctaata 303160DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31aaaggaagtt cctattctct agaaagtata ggaacttctg cggaaatgac tctaatttgc
603260DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 32gcagaagttc ctatactttc tagagaatag gaacttcctt
tagcttgatt ttattcttct 603360DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 33aaaggaagtt cctattctct
agaaagtata ggaacttctg cttttagtaa aaaaacgcca 603460DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34gcagaagttc ctatactttc tagagaatag gaacttcctt ttggttattt tcgtcgaata
603531DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 35tttctgcagg tggatagaac tcataaagga c
313630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36tttggtacct cagttaaccc caactgcttc
303740DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37tttggtacct ttagatctaa acacagaacg aaagaaaaag
403829DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38tttgaattcc cagtaggttc cactgtatc
293934DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39tttctgcagt ccatgtatac ccaatcgttt agga
344033DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 40tttaagcttt ccctgaagaa gaagtagcaa tta
334130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 41tttagatcta aatggttttt ctctctataa
304260DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42tagatctata acttcgtata gcatacatta tacgaacggt
attcgaaaat tattgcgtta 604330DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 43tttctgcaga tgattcaatc
cttcttgctt 304430DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 44gggtctagag agttatacaa aacgggaata
304534DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45ataacttcgt atagcataca ttatacgaac ggta
344634DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46taccgttcgt atagcataca ttatacgaag ttat
344734DNAListeria monocytogenes 47ataacttcgt ataatgtatg ctatacgaag
ttat 3448221DNAListeria monocytogenes 48gggaagcagt tggggttaac
tgattaacaa atgttagaga aaaattaatt ctccaagtga 60tattcttaaa ataattcatg
aatatttttt cttatattag ctaattaaga agataattaa 120ctgctaatcc
aatttttaac ggaataaatt agtgaaaatg aaggccgaat tttccttgtt
180ctaaaaaggt tgtattagcg tatcacgagg agggagtata a
221491032DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 49atgagtaacc tattaactgt tcatcaaaat
ttaccagcat taccagtgga tgcaacatca 60gatgaagtaa gaaaaaattt aatggatatg
tttagagacc gacaagcctt ttcggagcat 120acatggaaaa tgttattatc
tgtttgtaga tcatgggcag catggtgcaa acttaacaat 180agaaaatggt
ttccagcaga accagaagat gtacgagatt atttattata ccttcaagca
240agaggattag cagtaaaaac cattcaacaa catttaggac aattaaatat
gttacataga 300cgatcaggat taccaagacc tagcgattct aacgcagtta
gtttagttat gagaagaatt 360agaaaagaaa atgtcgatgc aggcgaacga
gcaaaacaag cactagcatt tgaacgtaca 420gatttcgacc aagtaagatc
attaatggaa aatagcgacc gttgtcaaga catccgaaac 480ttagcttttt
taggaatagc atacaacaca ttattaagaa tagcagaaat agccagaatt
540agagtaaaag acattagtag aacagatgga ggaagaatgt taattcatat
tggaagaaca 600aaaacattag tatcaacagc cggggtagaa aaagcgttat
cattaggagt tacaaaatta 660gtagaacgat ggatttcagt ttcaggagtg
gcagatgacc caaataatta tttattttgt 720agagtacgaa aaaacggagt
agcagcacct tcagcaacaa gtcaattaag tacaagagca 780ttagaaggaa
tattcgaagc aacacatcga ctaatttacg gagcaaaaga tgatagtgga
840caacgatatt tagcttggag tggacacagt gcgcgagtag gagcagcaag
agatatggca 900agagcgggag ttagtatacc agaaataatg caagcaggag
gatggacaaa tgtaaatatt 960gtaatgaatt atattagaaa tttagatagt
gaaaccggtg caatggtacg attattagaa 1020gatggagact aa
10325034DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50gaagttccta ttctctagaa agtataggaa cttc
34511272DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 51atgtcgcaat ttgatatact atgtaaaact
ccacctaaag tattagtgcg tcaatttgtt 60gaacgttttg aacgaccaag tggcgaaaag
atagcttcct gtgccgcgga acttacttac 120ttgtgttgga tgattacaca
taatggcact gcaatcaaaa gagcaacatt catgtcatac 180aacaccatca
tttctaattc tttatcattt gatattgtta acaaaagttt acaattcaaa
240tacaaaactc aaaaagcgac gattcttgaa gctagtttga aaaagttaat
cccagcatgg 300gagtttacca tcattcctta caatggacag aaacaccaat
ccgacattac agacattgtt 360tctagtttac aactacaatt tgaaagcagt
gaagaagcgg ataaagggaa ctcacattcg 420aagaaaatgt taaaggcttt
gttatctgaa ggagaatcta tctgggagat tacagaaaag 480attctaaact
cttttgagta tacttcacgc tttactaaaa ccaaaacgtt ataccagttt
540ctttttctag ctacattcat taactgcggt cgatttagtg acattaagaa
tgtagatcct 600aaatcgttca agttagtcca aaacaagtat ctaggtgtca
tcattcaatg cttagttacg 660gaaacaaaaa cgagtgtaag tagacatatc
tatttctttt ctgctagagg tagaattgat 720ccgcttgtat acttagatga
atttctacgt aattcagagc cggtgcttaa acgcgttaat 780cgtacaggaa
atagctcaag caataagcaa gaatatcaac ttttgaaaga caatttggtg
840cgtagctata acaaagcgtt aaagaagaat gcaccatatc cgatattcgc
catcaaaaac 900gggccaaaat cccacattgg tcgccatctt atgactagct
tcctttcgat gaaaggatta 960acggagttaa caaatgtggt aggtaattgg
tccgacaaaa gagcgagtgc tgtagcacga 1020acgacatata cacatcagat
tacagctatt ccagatcact actttgcatt agttagtaga 1080tactatgcat
atgatccaat ttccaaagaa atgattgctc ttaaagatga aacaaatcca
1140atagaagaat ggcaacatat cgaacaactt aaaggatcgg cagaaggctc
tatacgttat 1200cctgcatgga atggtatcat ttctcaagaa gttttagact
atttgtcaag ctatatcaat 1260cgtcgcattt aa 1272529PRTVaccinia virus
52Tyr Ala Pro Val Ser Pro Ile Val Ile 1 5 538PRTVaccinia virus
53Leu Asn Phe Arg Phe Glu Asn Val 1 5 5410PRTVaccinia virus 54Tyr
Ser Leu Pro Asn Ala Gly Asp Val Ile 1 5 10 558PRTVaccinia virus
55Thr Ser Tyr Lys Phe Glu Ser Val 1 5 568PRTGallus sp. 56Ser Ile
Ile Asn Phe Glu Lys Leu 1 5 579PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 57Ser Pro Ser Tyr Ala Tyr His
Gln Phe 1 5
* * * * *