U.S. patent application number 15/368188 was filed with the patent office on 2017-03-23 for high expression cereal phytase gene.
The applicant listed for this patent is AARHUS UNIVERSITET. Invention is credited to Henrik Brinch-Pedersen, Giuseppe Dionisio, Preben Bach Holm, Claus Krogh Madsen.
Application Number | 20170081648 15/368188 |
Document ID | / |
Family ID | 44501831 |
Filed Date | 2017-03-23 |
United States Patent
Application |
20170081648 |
Kind Code |
A1 |
Brinch-Pedersen; Henrik ; et
al. |
March 23, 2017 |
HIGH EXPRESSION CEREAL PHYTASE GENE
Abstract
The present invention provides mutant cereal plants and mature
grain thereof, characterised by enhanced levels of the enzyme
phytase in the grain, and methods for inducing, detecting and
selecting the mutant cereal plants. The invention further relates
to animal feed comprising said grain having enhanced amounts of
phytase.
Inventors: |
Brinch-Pedersen; Henrik;
(Skaelskor, DK) ; Madsen; Claus Krogh; (Ringsted,
DK) ; Dionisio; Giuseppe; (Slagelse, DK) ;
Holm; Preben Bach; (Valby, DK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AARHUS UNIVERSITET |
Aarhus C |
|
DK |
|
|
Family ID: |
44501831 |
Appl. No.: |
15/368188 |
Filed: |
December 2, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14110763 |
Jan 23, 2014 |
9540633 |
|
|
PCT/EP2012/057515 |
Apr 25, 2012 |
|
|
|
15368188 |
|
|
|
|
61479689 |
Apr 27, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 1/6895 20130101; C12N 15/01 20130101; C12Y 301/03026 20130101;
C12N 15/8243 20130101; C12N 15/8234 20130101; C12N 9/16 20130101;
A01H 5/10 20130101; A23K 10/30 20160501; C12Y 301/03008 20130101;
A23K 20/10 20160501; C12Q 2600/158 20130101; C12Q 2600/13
20130101 |
International
Class: |
C12N 9/16 20060101
C12N009/16; A01H 5/10 20060101 A01H005/10; A23K 10/30 20060101
A23K010/30; A23K 20/10 20060101 A23K020/10; C12Q 1/68 20060101
C12Q001/68; C12N 15/01 20060101 C12N015/01 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 27, 2011 |
EP |
11163875.5 |
Claims
1-15. (canceled)
16: A Tricticum variety capable of producing an average phytase
endosperm content of greater than 4300 FTU/kg, produced by the
following: a) obtaining a Tricticum plant which has been identified
as having a nucleotide at the 5' end of a polynucleotide having the
nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V is
a cytosine. b) breeding said Tricticum plant comprising said
nucleotide sequence with a second Tricticum variety plant which
produces an average phytase content of about 1200 FTU/kg, to
produce grains, c) growing at least one Tricticum plant from said
grains; d) assaying said grains to confirm the presence of said
nucleotide sequence in that said variety produces an average
phytase endosperm content of greater than 4300 FTU/kg.
17: The variety of claim 16 wherein said Tricticum plant has been
identified by a) obtaining a sample of nucleic acids from a
Tricticum plant or portion thereof; b) detecting in said sample the
presence of the nucleotide t the 5' end of a polynucleotide having
the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO:1] wherein V
is a cytosine.
18: The plant or variety according to claim 17, wherein said sample
of nucleic acids comprises a first polynucleotide located 5'
upstream of and operably linked to a second polynucleotide, wherein
said first polynucleotide comprises the nucleotide sequence ACA VGA
GTC ATG CAT (SEQ ID NO:1) [SEQ ID NO:1] wherein V is a cytosine,
and wherein said second polynucleotide encodes a phytase
polypeptide having myo-inositol hexakisphosphate phosphohydrolase
activity.
19: A population of Tricticum plants grown from variety of claim 16
and having an average phytase grain content of greater than 4300
FTU/kg.
20: Grain having an average phytase content of greater than
4300FTU/kg, said grain harvested from the population of claim
19.
21: A method of producing a milled cereal composition having an
average phytase content of greater than 4300FTU/kg, comprising:
Obtaining the grain of claim 20 and milling said grain to produce a
milled cereal composition.
22: The method of claim 21 further comprising the step of cleaning
or conditioning the grain.
23: The method of claim 21 further comprising the step of gristing
the grain.
24: The method of claim 21 further comprising the step of breaking
the grain into its cereal parts cereal grain germ, bran and
endosperm.
25: The method of claim 21 wherein said milled composition is
flour.
26: A milled grain composition produced by the method of claim
21.
27: The method of claim 21 further comprising the step a combining
said cereal grain composition with fodder ingredients to form an
animal feed.
28: The method of claim 21 further comprising the step of reducing
the microbial population in said animal feed.
29: The method of claim 28 where said microbial population is
reduced by introducing said animal feed to a using a steam
pelleting machine for a sufficient time to reduce the microbial
population to safe levels for animal consumption.
30: The method of claim 28 further comprising the step of pelleting
said animal feed.
31: An animal feed comprising the milled cereal gain with an
average phytase activity of about 4300 FTU/kg produced by the
method of claim 21.
32: Flour having an average phytase activity of about 4300 FTU/kg
produced by the method of claim 21.
33: Bread dough with enhanced inorganic phosphate levels and
mineral content and improved dough mixing made from the flour of
claim 32.
34: A Tricticum variety produced by the following: a) Obtaining a
plant with capable of producing an average phytase endosperm
content of greater than 4300 FTU/kg; b) Cultivating said plant to
produce sufficient grain for breeding; c) Growing said grain d)
Determining the presence of a nucleotide sequence ACA VGA GTC ATG
CAT (SEQ ID NO: 1), and wherein said V is a cytosine said plant
producing an average phytase endosperm content of greater than 4300
FTU/kg; e) Repeating steps c and d until a variety with an average
average phytase endosperm content of greater than 4300 FTU/kg is
created.
35: A Tricticum plant wherein an ancestor of said plant is the
plant of claim 16.
36: A cultivated Tricticum variety having a nucleotide sequence ACA
VGA GTC ATG CAT [SEQ ID NO:1] wherein V is a cytosine, capable of
producing grain with an average phytase endosperm content of
greater than 4300 FTU/kg.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation application of U.S. Ser.
No. 14/110,763 filed Jan. 23, 2014, which is a 371 of international
application of PCT/EP2012/057515 filed Apr. 25, 2012, which claims
benefit of U.S. Provisional Application No. 61/479,689, filed Apr.
27, 2011, which is herein incorporated by reference in its
entirety.
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates to mutant cereal plants and
mature grain thereof, characterised by an enhancer polynucleotide
capable of directed enhanced expression of a operably-linked gene,
in particular a operably-linked gene encoding the enzyme phytase,
causing enhanced levels of phytase in the grain. The invention
further relates to animal feed comprising said cereal grain having
enhanced amounts of phytase.
BACKGROUND DESCRIPTION OF THE INVENTION
[0003] Phytases (myo-inositol hexakisphosphate phosphohydrolase)
[EC 3.1.3.26 and EC 3.1.3.8] are phosphatases that initiate the
sequential liberation of orthophosphate groups from phytate (InsP6,
myo-inositol 1,2,3,4,5,6-hexakisphosphate), providing phosphate,
inositol phosphates and inositol required for a range of cellular
activities (Brinch-Pedersen et al., 2002). A number of enzymes with
phytase activity are known from plants, animals and microorganisms
(Dvorakova, 1998).
[0004] Phytases are of particular importance during seed
germination where they mobilize phosphate from phytate, the major
reserve of phosphorus (P) in plant seeds accounting for .about.70%
of the total P (Lott, 1984). Different plant species have developed
various strategies for phytase mediated degradation of phytate
during germination. Among cereals, barley (Hordeum vulgare L.),
wheat (Triticum aestivum and durum L.) and rye (Secale cereale L.)
synthesize and accumulate phytase during grain development and the
mature seed has a significant level of preformed phytase activity.
Levels of phytase activity of 582, 1193 and 5130 U kg.sup.-1 have
been detected in mature grain of barley, wheat and rye respectively
(Eeckhout and de Paepe, 1994). Preformed phytase catalyses the
first wave of phytate hydrolysis during early germination. Other
cereals possess little (maize (Zea mays L.) .about.41 U kg.sup.-1)
or close to no (rice (Oryza sativa L.)) preformed phytase activity
in the mature seed and depend entirely on de novo synthesis during
germination (Eeckhout and de Paepe, 1994).
[0005] The spatial and temporal regulation of phytase biosynthesis
in plant seeds has profound effects on phosphate bioavailability
when dry grains are used as food and feed. Monogastric animals such
as pigs, poultry and humans have little or no phytase activity in
their digestive tracts and thus depend on either a phosphate
supplement or on the presence of the enzyme phytase in their diet,
in order to meet their nutritional phosphate requirements. In most
cases the amount of preformed phytase activity in mature cereal
grain is not sufficient to ensure sufficient phytate degradation
when included in animal feed. As a consequence, most of the cereal
grain phytate consumed by an animal is excreted, thereby adding to
the phosphate load on the environment which can be massive in areas
with intense livestock production. One current solution to this
problem has been to supplement animal feed, on a large scale, with
inorganic phosphate, in order to meet an animal's need for
phosphate. However, this solution can only continue in the short
term since phosphate is a non-renewable resource, which will be
depleted within a few decades. An alternative solution relies on
the addition of phytase enzyme, in particular microbial-derived
phytase, to feed intended for intense pig and poultry production.
It has become common practise to include the enzyme phytase in
pre-mixes for addition to animal fodder, and animal fodder, which
is an additional cost factor. Thus there exists a need for
alternative cheaper methods for enhancing the bioavailability of
phosphate in cereals used for animal feed.
[0006] A DNA sequence comprising a coding sequence for wheat
phytase has been deposited in GenBank (AX298209). Patent
application (WO2001/083763A2) describes said wheat phytase as a 66
kDa PAPhy with the same temperature and pH optima as PHYI
(Rasmussen et al., 2004), and describes the production of
transgenic wheat plants comprising said coding sequence.
SUMMARY OF THE INVENTION
[0007] According to a first embodiment, the present invention
provides a mutant cereal plant comprising a polynucleotide selected
from any one of: [0008] a. ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T
AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2] wherein V is any nucleotide
other than T, more preferably where V is C or G, [0009] b.
polynucleotide comprising a nucleotide sequence selected from SEQ
ID NO: 5, 6, 14, 15 and 44, [0010] c. polynucleotide comprising a
nucleotide sequence selected from SEQ ID NO: 1, 5, 6, 14, 15 and
44, wherein said polynucleotide is operably linked to a second
polynucleotide encoding a polypeptide, wherein said polynucleotide
is capable of enhancing gene expression in a grain of said plant,
and, and wherein said cereal is selected from Avena L species,
Hordeum L species; Oryza L species; Secale L species; Sorghum L
species; Triticum aestivum, Triticum durum; Triticum spelta and Zea
species.
[0011] In a further embodiment, the polypeptide of the mutant
cereal plant is phytase [EC 3.1.3.26 and EC 3.1.3.8] and has
myo-inositol hexakisphosphate phosphohydrolase activity.
[0012] Further to the first embodiment according to (a), the
genomic DNA of the mutant cereal plant comprises a first
polynucleotide located 5' upstream of a second polynucleotide, and
operably-linked to the second polynucleotide, wherein said first
polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG
CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], and
wherein said second polynucleotide encodes a phytase polypeptide
having myo-inositol hexakisphosphate phosphohydrolase activity.
[0013] Further to the above embodiments, the mutant cereal plant is
selected from Avena sativa, (Oats); Hordeum vulgare (Barley); Oryza
sativa (rice); Secale cereale (Rye); Sorghum bicolor; Triticum
aestivum, Triticum durum, Triticum spelta (wheat species); Zea mays
(maize).
[0014] Further to the above embodiments, the mutant cereal plant is
a Triticum spp., and the phytase polypeptide has an amino acid
sequence having at least 70% sequence identity to a sequence
selected from SEQ ID NO: 18, 20, and 22.
[0015] Further to the above embodiments, the mutant cereal plant is
a Secale spp., and the phytase polypeptide has an amino acid
sequence having at least 70% sequence identity to a sequence
selected from SEQ ID NO: 26 or 28.
[0016] Further to the above embodiments, the mutant cereal plant is
a Hordeum spp., and the phytase polypeptide has an amino acid
sequence having at least 70% sequence identity to a sequence
selected from SEQ ID NO: 30.
[0017] Further to the above embodiments, the mutant cereal plant is
selected from a mutant of Triticum aestivum having Deposit No:
PTA-11732 [TaHighPhy 01], and PTA-11731 [TaHighPhy 02]; and a
mutant of Secale cereale having Deposit No PTA-11730 [ScHighPhy
01], said plants being deposited with ATCC Patent Depository, 10801
University Blvd., Manassas, Va. 20110,
[0018] Further to the above embodiments, the mutant cereal plant is
a grain.
[0019] According to a second embodiment, the invention provides a
plant part (e.g. grain or caryopsis) derived from a mutant cereal
plant of the first embodiment or further embodiments of the
invention.
[0020] According to a third embodiment, the invention teaches the
use of grain derived from a mutant cereal plant according to the
first or further embodiments of the invention, for the manufacture
of a composition, wherein said composition is any one of: a milled
grain composition; animal fodder; and steam-pelleted animal
fodder.
[0021] According to a fourth embodiment, the invention provides a
composition comprising a mutant cereal plant according to the first
or further embodiments of the invention, wherein said composition
is any one of: a milled grain composition; animal fodder and
steam-pelleted animal fodder.
[0022] According to a fifth embodiment, the invention teaches a use
of a composition, comprising a mutant cereal plant, according to
the fourth embodiment as animal fodder.
[0023] According to a sixth embodiment, the invention teaches a
method for detecting a mutant cereal plant, said plant comprising a
polynucleotide selected from one of: [0024] a) ACA VGA GTC ATG CAT
[SEQ ID NO: 1]; [0025] b) a polynucleotide comprising a nucleotide
sequence selected from SEQ ID NO: 5, 6, 12, 14 and 15, and [0026]
c) polynucleotide comprising a nucleotide sequence selected from
SEQ ID NO: 1, 5, 6, 12, 14 and 15, wherein said polynucleotide is
operably linked to a second polynucleotide encoding a polypeptide,
and wherein said polynucleotide is capable of enhancing gene
expression in a grain of said plant, comprising the steps of: (i)
isolating genomic DNA from said plant, and (ii) detecting the
presence of the nucleotide V at the 5' end of a polynucleotide
having the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1]
or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], wherein said
polynucleotide is comprised in said genomic DNA.
[0027] According to a seventh embodiment, the invention teaches a
method for inducing and selecting a mutant cereal plant, said plant
comprising a polynucleotide selected from one of:
TABLE-US-00001 [SEQ ID NO: 1] a) ACA VGA GTC ATG CAT;
[0028] b) a polynucleotide comprising a nucleotide sequence
selected from SEQ ID NO: 5, 6, 12, 14 and 15, and [0029] c)
polynucleotide comprising a nucleotide sequence selected from SEQ
ID NO: 1, 5, 6, 12, 14 and 15, wherein said polynucleotide is
operably linked to a second polynucleotide encoding a polypeptide,
and wherein said polynucleotide is capable of enhancing gene
expression in a grain of said plant, comprising the steps of: (i)
treating a cereal plant, or plant part thereof, with a chemical
mutagen; (ii) growing and/or multiplying the treated plant, or
plant part; (iii) isolating genomic DNA from said plant or progeny
thereof, and (d) detecting the presence of a polynucleotide having
the nucleotide sequence ACA VGA GTC ATG CAT [SEQ ID NO: 1] or T AGA
ACA VGA GTC ATG CAT [SEQ ID NO: 2], wherein said polynucleotide is
comprised in said genomic DNA.
[0030] Further to the sixth or seventh embodiments, the genomic DNA
comprises a first polynucleotide located 5' upstream of and
operably-linked to a second polynucleotide, wherein the first
polynucleotide comprises the nucleotide sequence ACA VGA GTC ATG
CAT [SEQ ID NO: 1] or T AGA ACA VGA GTC ATG CAT [SEQ ID NO: 2], and
wherein the second polynucleotide encodes a phytase polypeptide
having myo-inositol hexakisphosphate phosphohydrolase activity.
[0031] Further to the sixth or seventh embodiments, the cereal is
selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L
spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum
monococcum; and Zea spp.
[0032] Further to the sixth or seventh embodiments, the cereal is
selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L
spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum
monococcum; and Zea spp, and the amino acid sequence of the phytase
polypeptide has at least 70% sequence identity to a sequence
selected from SEQ ID NO: 18, 20, 22, 24, 26, 28, and 30.
[0033] Further to the sixth or seventh embodiments, the cereal is
selected from Avena L spp, Hordeum L spp; Oryza L spp; Secale L
spp; Sorghum L spp; Triticum aestivum, Triticum durum; Triticum
monococcum; and Zea spp, and the amino acid sequence of the phytase
polypeptide has at least 70% sequence identity to a sequence
selected from SEQ ID NO: 18, 20, 22, 24, 26, 28, and 30, wherein
said polypeptide is encoded by a polynucleotide having a nucleotide
sequence having at least 70% sequence identity to a sequence
selected from SEQ ID NO: 17, 19, 21, 23, 25, 27, 29, and
nucleotides 2091-4090 of 45, respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0034] Listing of the figures:
[0035] FIG. 1. Phytase activity in mature whole grain derived from
52 individual lines of wheat (Triticum aestivum).
[0036] FIG. 2. Phytase activity in mature whole grain, bran and
endosperm fractions of grain derived from 52 individual lines of
wheat (Triticum aestivum).
[0037] FIG. 3. Cartoon showing the exon-intron structure of a
TaPAPhy a1 gene isolated from Triticum aestivum cv Skagen (TaG2)
corresponding to SEQ ID NO: 45.
[0038] FIG. 4. Pair wise comparison of the nucleotide sequence of
the 1000 bp 5'flanking promoter region of phytase genes amplified
from 9 T. aestivum cultivars and the corresponding promoter region
from two HighPhy T. aestivum cultivars. The upper comparison counts
differences, whereas the lower comparison shows the identity in
percent.
[0039] FIG. 5. Pair wise comparison of the nucleotide sequence of
the 288 bp 5'flanking promoter region of phytase genes amplified
from eight T. aestivum cultivars, two T. tauschii accession lines
(NGB90403; NGB9855), and the corresponding promoter regions from
two HighPhy T. aestivum cultivars. The upper comparison counts
differences, whereas the lower comparison shows the identity in
percent.
[0040] FIG. 6. Multiple alignment of the start codon and 288 bp 5'
flanking promoter region 7 T. aestivum cultivars (cv Skagen; cv Bob
White; cv Pentium; cv Flair; cv landrace 01; cv Landrace 02; cv
Spelt, which share SEQ ID NO: 7), two T. tauschii accession lines
(NGB90403; NGB9855, which share SEQ ID NO: 8), and the
corresponding promoter regions from two HighPhy T. aestivum lines
(HighPhy 01; HighPhy 02 which share SEQ ID NO: 5). The 5'flanking
promoter region of the T. aestivum cv Skagen is represented by both
the lambda clone TaG2 and a PCR amplicon, with SEQ ID NO: 7. The
enhancer sequence [ACA CGA GTC ATG CAT] in the HighPhy 01 and 02
cultivars is located a position: -247 to -237 in the 5' flanking
region. Note that SEQ ID NO: 5, 7 and 8 are identical to the
corresponding sequences in FIG. 6, but with the exception that the
last 3 nucleotides (ATG) of each corresponding sequence in FIG. 6
are excluded from the sequence given in the SEQ ID NO listing.
[0041] FIG. 7. Multiple alignment of the start codon and 5'flanking
promoter region 5 wild type T. aestivum cultivars (TaPAPhy_a1:
NormPhy [SEQ ID NO: 9]; TaPAPhy_a3 [SEQ ID NO: 10], TaPAPhy_a4 [SEQ
ID NO: 11]; TaPAPhy_a5; TaPAPhy_a6) and the corresponding promoter
region from a High Phytase T. aestivum line (TaPaPhy_a1: HighPhy
[SEQ ID NO: 6]). The 5'flanking promoter region of the T.
monococcum (TmPAPhy_a1 [SEQ ID NO: 12]); Hordeum vulgare
(HvPAPhy_a1 [SEQ ID NO: 13]) and high and normal phytase Secale
cereale (ScPAPhy_a1 HighPhy [SEQ ID NO: 15]) and (ScPAPhy_a1
NormPhy [SEQ ID NO: 16]). Note that SEQ ID NO: 6, 9, 10, 11, 13,
13, 15 and 16 are identical to the corresponding sequences in FIG.
7, but with the exception that that the last 3 nucleotides (ATG) of
each corresponding sequence in FIG. 6 excluded from the sequence
given in the SEQ ID NO listing.
[0042] The nucleotide sequence of the polynucleotides comprised
within the NormalPhy element and the HighPhy enhancer element are
included in the alignment.
[0043] FIG. 8. Phytase activity in mature whole grain derived from
5 individual lines of rye (Secale cereale). One line (LPP03) has
low phytase activity and 4 lines have medium to high phytase
activity.
[0044] FIG. 9. Phytase activities in Bob White wild type (BW) and
HighPhy T. aestivum (HIGHPHY) wheat flour after 0, 10, 20 and 40
min of incubation at 80.degree. C. in 100% relative humidity.
[0045] FIG. 10. Phytase activities in HighPhy Secale cereale (rye)
flour after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of incubation
at 80.degree. C. in 100% relative humidity.
[0046] FIG. 11. Phytate content in Bob White wild type (BW) and
HighPhy T. aestivum (HIGHPHY) wheat dough during the
fermentation
[0047] FIG. 12. Percentage residual phytate in flour of Bob White
wild type and HighPhy T. aestivum (HIGHPHY) wheat after 0.5, 1,
1.5, 2 and 3 hrs of fermentation.
[0048] FIG. 13. UPGMA tree of the HIGHPHY and TaPAPhy_a1, _a2 and
a_3 genes.
ABBREVIATIONS
[0049] AS-PCR: Allele specific--polymerase chain reaction; CTP:
cytosine 5'-triphosphate; dNTP: Deoxynucleotide Triphosphate;
PAPhy: Purple acid phosphates (PAP) with phytase activity; also
called PAP phytases
(PAPhy);
[0050] Pfu: plaque forming units; SNP: single-nucleotide
polymorphism is a DNA sequence variation occurring when a single
nucleotide (A, T, C, or G) in the genome differs between members of
a species or paired chromosomes in an individual 1.times.SSPE
buffer: 150 mM Sodium Chloride, 10 mM Sodium Hydrogen Phosphate, 1
mM EDTA, pH 7.4); SPP: species; V: is the nucleotide A or C or G
(not T), where B is the nucleotide in the complementary
sequence.
DEFINITIONS
[0051] Cereal: A plant belonging to the Poaceae family, in
particular a plant belonging to the Genus and species thereof:
Avena L (e.g. Avena sativa, Oats); Hordeum L e.g. Hordeum vulgare,
Barley); Oryza L (e.g. Oryza sativa, rice); Secale L (e.g. Secale
cereale, Rye); Sorghum L (e.g. Sorghum bicolor); Triticum (e.g.
Triticum aestivum, Triticum durum; Triticum monococcum, Triticum
spelta, wheat); Zea (e.g. Zea mays, maize). Promoter
operably-linked to a gene: a promoter is a DNA molecule that is
located on the same DNA strand and upstream (towards the 5' region
of the sense strand) of the transcriptional start site of a
down-stream gene, where the operational function of the promoter is
to regulate the expression of the down-stream gene to which it is
operably-linked. DNA molecules, whose function is to regulate
expression of a down-stream gene, typically comprise a smaller DNA
molecule that acts as an "enhancer", the enhancer serving to
modulate expression levels of the down-stream gene. An "Enhancer"
is characterised by a conserved nucleotide sequence, often
comprising various conserved sequence motifs whose function is to
modulate gene expression levels. A gene is defined to include a
polynucleotide molecule comprising coding and optionally non-coding
sequence(s), the coding sequence(s) encoding a polypeptide, e.g.
phytase. Triticum aestivum: line of T. aestivum, cultivar of T.
aestivum is a cultivated variety of T. aestivum that has been
created or selected intentionally for specific desirable
characteristics and maintained through cultivation. Sequence
identity: Identity can be measured as percent identity. The term
"percent sequence identity" indicates a quantitative measure of the
degree of homology between two nucleotide sequences of equal
length. When the two sequences to be compared are not of equal
length, they are aligned to give the best possible fit, by allowing
the insertion of gaps or, alternatively, truncation at the ends of
the nucleotide sequences. The (Nref-Ndlf)100 can be calculated as
<Nref>, wherein Nd[iota]f is the total number of
non-identical residues in the two sequences when aligned and
wherein Nref is the number of residues in one of the sequences. The
percent sequence identity between one or more sequence may also be
based on alignments using the clustalW software
(http://www.ebi.ac.uk/clustalW/index.html).
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
[0052] It is recognised that, in most cases, the amount of
preformed phytase activity in mature cereal grain is not sufficient
to ensure sufficient phytate degradation when included in animal
feed. It is further recognised that bread dough having a low
phytate content has superior mixing properties, and the resulting
bread has a higher nutritional value, due to an enhanced
availability of minerals, including inorganic phosphate. One
solution to this problem has been to produce genetically modified
cereal plants having higher levels of phytase in the grain, for
example by expressing a transgene encoding a heterologous or
homologous gene encoding phytase. Current agricultural policy in
many parts of the world, in particular Europe, has restricted the
growth of transgenic crop plants. Furthermore, organic farming,
based on methods that are internationally regulated and legally
enforced by many nations, are not certified to use genetically
modified plants or feed enzymes derived from microbial phytases.
Accordingly, there remains a need for non-transgenic plants
producing grain having a high phytase phenotype. The present
invention addresses this need.
I. A Polynucleotide Acting as an Enhancer of Grain-Specific Gene
Expression in Mutant Cereal Plant
[0053] One embodiment of the invention provides a mutant cereal
plant whose genome comprises an enhancer polynucleotide having the
nucleotide sequence:
TABLE-US-00002 [SEQ ID NO: 1] ACA VGA GTC ATG CAT, or [SEQ ID NO:
2] T AGA ACA VGA GTC ATG CAT,
wherein said polynucleotide is capable of enhancing grain-specific
gene expression. The enhancer polynucleotide comprises a mutation
whereby the nucleotide V is any nucleotide other than T (i.e. C or
G or A), as compared to the corresponding polynucleotide in a wild
type cereal plant having normal wild type levels of phytase (e.g.
the enhancer in the wild type normal phytase polynucleotide ACA TGA
GTC ATG CAT [SEQ ID NO: 3] from wheat). In a preferred embodiment,
the enhancer polynucleotide has SEQ ID NO: 1, wherein the
nucleotide residue designated as V, is either G or C.
[0054] A series of four overlapping motifs have been identified in
the polynucleotide having the sequence:
TABLE-US-00003 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA
which comprises the enhancer of the wild type wheat phytase gene.
These motifs include an "odd base palindrome sequence" and a "GCN4
motif", a "skn-1 motif" and a "palindomic RY-repeat". The odd base
palindrome and GCN4 motif have been shown to interact with Opaque2,
a maize basic leucine zipper (bZIP) transcription factor that is
involved in the regulation of seed storage protein expression
[3,4], whereas the RY-repeat has been shown to interact with
transcription factors containing the B3 domain.
[0055] Cereal plants comprising the mutant enhancer polynucleotide,
show enhanced grain-specific expression of an operably-linked gene
located down-stream of the enhancer polynucleotide, indicating that
the mutant polynucleotide acts to regulate enhanced gene expression
in a tissue-specific manner. Proteins encoded by the
operably-linked gene, whose expression in cereal plants is
regulated by a structurally- and operably-linked upstream promoter
polynucleotide molecule comprising the enhancer polynucleotide
having SEQ ID NO: 1 or 2, accumulate enhanced levels of the encoded
protein in the grain when compared to wild-type cereal plants
having the wild-type enhancer sequence (see Example 1 and 7).
[0056] The enhancer polynucleotide according to the invention is
further characterised by an altered expression pattern of its
operably-linked gene in the grain. The enhancer causes both
increased gene expression throughout the grain, but also
preferential expression in the endosperm tissue of the grain, which
constitutes the majority of the grain as measured by weight
(Example 1 and 13). The enhanced gene expression leads to enhanced
levels of the gene-encoded proteins in the endosperm of the grain,
having the advantage that down-stream grain processing steps, such
a dehusking/milling does not lead to a loss the protein as is the
case for proteins expressed in the aleurone tissue, and outer
layers/coat of the grain.
II. A Mutant Cereal Plant, Whose Genome has a Promoter
Polynucleotide Comprising an Enhancer of Grain-Specific Gene
Expression
[0057] A further embodiment of the invention provides a mutant
cereal plant, whose genome comprises a promoter polynucleotide
molecule, said molecule comprising the enhancer polynucleotide
having SEQ ID NO: 1 or 2. The mutant cereal plant of the invention
is a member of the Poaceae family, preferably belonging to the
Genus L, and Species (spp) thereof of the following: Avena L (e.g.
Avena sativa); Hordeum L (e.g. Hordeum vulgare); Oryza L (e.g.
Oryza sativa); Secale L (e.g. Secale cereale); Sorghum L (e.g.
sorghum bicolor); Triticum spp selected from Triticum aestivum,
Triticum durum, and Triticum spelta; and Zea (e.g. Zea mays).
[0058] In one example, the mutant cereal plant is a mutant Triticum
aestivum, whose genome comprises the enhancer polynucleotide having
SEQ ID NO: 1 or 2. The genome of the mutant Triticum aestivum may
comprise a promoter polynucleotide having SEQ ID NO: 5 or 6 or 44,
this promoter itself comprising the enhancer polynucleotide having
SEQ ID NO: 2. Wheat plants comprising a promoter having SEQ ID NO:
5 or 6 show enhanced endosperm-specific expression of a
operably-linked gene located down-stream of this promoter,
indicating that the promoter acts to regulate enhanced gene
expression in a tissue-specific manner. The corresponding promoter
polynucleotide in wild-type Triticum aestivum cv's and Triticum
tauschii that lack the enhancing properties of the mutant are
provided as SEQ ID NO: 7, 10 and 11 and in 8 respectively.
[0059] In one example, the mutant cereal plant is a mutant Secale
cereale whose genome comprises the enhancer polynucleotide having
SEQ ID NO: 1 or 2. The genome of the mutant Secale cereale may
comprise a promoter polynucleotide having SEQ ID NO: 15, this
promoter itself comprising the enhancer polynucleotide having SEQ
ID NO: 2. The corresponding promoter polynucleotide in wild-type
Secale cereale that lacks the enhancing properties of the mutant is
provided as SEQ ID NO: 16.
[0060] In one example, the mutant cereal plant is a mutant Hordeum
vulgare whose genome comprises the enhancer polynucleotide having
SEQ ID NO: 1 or 2. The genome of the mutant Hordeum vulgare may
comprise a promoter polynucleotide having SEQ ID NO: 14, this
promoter itself comprising the enhancer polynucleotide having SEQ
ID NO: 1. The corresponding promoter polynucleotide in wild-type
Hordeum vulgare that lacks the enhancing properties of the mutant
is provided as SEQ ID NO: 13.
III. A Mutant Wheat Plant with High Phytase Grain
[0061] A further embodiment of the invention provides a mutant
cereal plant comprising a promoter polynucleotide, said promoter
comprising the enhancer polynucleotide having SEQ ID NO: 1 or 2,
wherein said promoter polynucleotide lies upstream and is operably
linked to a cognate phytase gene encoding a polypeptide having
myo-inositol hexakisphosphate phosphohydrolase activity (phytase
[EC 3.1.3.26 and EC 3.1.3.8]). In one example, the cereal plant is
a mutant Triticum aestivum plant comprising the enhancer
polynucleotide having SEQ ID NO: 1 or 2, where the promoter
polynucleotide preferably has SEQ ID NO: 5 or 6, or 44, and the
cognate phytase gene encodes a polypeptide having both myo-inositol
hexakisphosphate phosphohydrolase activity and an amino acid
sequence having at least 70, 75, 80, 85, 90, 95 or 98% sequence
identity to a sequence selected from SEQ ID NO: 18, 20, and 22. In
a further embodiment, said phytase polypeptide having an amino acid
sequence selected from SEQ ID NO: 18, 20, and 22 is encoded by a
polynucleotide having a nucleotide sequence that has at least 70,
75, 80, 85, 90, 95 or 98% sequence identity to a sequence selected
from SEQ ID NO: 17, 19, 21, and 45 (nucleotides 2091-4090),
respectively.
[0062] In one example, the cereal plant is a mutant Secale cereale
plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or
2, where the promoter polynucleotide preferably has SEQ ID NO: 15,
and the cognate phytase gene encodes a phytase polypeptide having
both myo-inositol hexakisphosphate phosphohydrolase activity and an
amino acid sequence having at least 70, 75, 80, 85, 90 or 95%
sequence identity to a SEQ ID NO: 26 or 28. In a further
embodiment, said phytase polypeptide having an amino acid sequence
of SEQ ID NO: 26 or 28 is encoded by a polynucleotide having
nucleotide sequence that has at least 70, 75, 80, 85, 90 or 95%
sequence identity to SEQ ID NO: 25 or 27, respectively.
[0063] In one example, the cereal plant is a mutant Hordeum vulgare
plant comprising the enhancer polynucleotide having SEQ ID NO: 1 or
2, where the promoter polynucleotide preferably has SEQ ID NO: 14,
and the cognate phytase gene encodes a phytase polypeptide having
both myo-inositol hexakisphosphate phosphohydrolase activity and an
amino acid sequence having at least 70, 75, 80, 85, 90 or 95%
sequence identity to a SEQ ID NO: 30. In a further embodiment, said
phytase polypeptide having an amino acid sequence of SEQ ID NO: 30
is encoded by a polynucleotide having nucleotide sequence that has
at least 70, 75, 80, 85, 90 or 95% sequence identity to SEQ ID NO:
29.
III. Methods for Detecting a Cereal Germplasm Comprising the
HighPhy SNP
[0064] The polynucleotide:
TABLE-US-00004 ACA.sup.VGAGTCATGCATG
in genomic DNA of a cereal plant e.g. Triticum spp, characteristic
of the HighPhy SNP, can be detected using standard DNA analysis
protocols (see Example 5). For example, amplification of genomic
DNA comprising the HighPhy SNP with the forward
TTTCAAGCTACACTTTGTAGAACAC [SEQ ID NO: 39] and reverse
GCACTAGCCAAGTTTGGACG [SEQ ID NO: 40] primers will generate a 66 bp
PCR product when using Taq polymerase, whereas amplification of
genomic DNA comprising a "wildtype cereal" with wild-type levels of
normal phytase will give a similar product with forward
TTTCAAGCTACACTTTGTAGAACAT [SEQ ID NO: 41] and reverse
GCACTAGCCAAGTTTGGACG [SEQ ID NO: 42] primers (where the second
primer [SEQ ID NO: 42] is universal).
IV Methods for Inducing and Selecting Cereal Germplasm Comprising
the HighPhy SNP
[0065] HighPhy cereals (e.g. Triticum spp) can be generated by
mutagenesis and subsequent screening for individuals where the
polynucleotide:
[0066] ACA TGA GTC ATG CAT, corresponding to the wild type
(NormPhy) enhancer, in the cereal genome has been converted into
the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT, where V can be
A or C or G.
[0067] In one embodiment the mutagenesis is carried out with sodium
azide which preferentially generates A:T to G:C substitutions in
the cereal, barley (8). Screening mutagenized populations for the
desired mutation could be done by allele specific polymerase chain
reaction (AS-PCR), as described in Example 6.
[0068] In an alternative embodiment, mutagenesis is carried out on
cereal grain using methylene Methyl Sulphonate (MMS) to generate a
population of M1 plants with random point mutations in their
genome. MMS treatment leads to errors during DNA replication and
thus introduces mutations. Typically this means T/A nucleotides
within a sequence are converted to G/C by transversion. The M1
plants are self-fertilised and the M2 seed harvested and sown. The
M2 germplasm will allow recessive and lethal alleles to be
recovered as heterozygotes. DNA is individually extracted from M2
plants into 96 well plates and their seed stored for further
propagation. To increase throughput of analysis, the M2 DNA samples
are 8.times. pooled and amplified, using gene specific primers,
located up- and down-stream of the mutant (HighPhy) enhancer: ACA
VGA GTC ATG CAT that is to be detected. Preferably each primer
carries a different fluorescent label. For example, the forward
strand may be labelled with FAM [5-Carboxyfluorescein;
3',6'-Dihydroxy-3-oxospiro[2-benzofuran-1,9'-xanthene]-5-carboxylic
acid, CAS #: 76823-03-5] and the reverse strand with HEX [HEX being
a hexa-chloro derivative of FAM]. In the presence of a mutant, the
amplification products when heated and cooled will form mismatched
heteroduplexes between the wild type and mutated DNA. To enable
identification of the point mutations induced by EMS, the
amplification products are incubated with a plant endonuclease
called CEL I which preferentially cleaves at sites of heteroduplex
mismatches that occur between wild-type and mutant DNA. The
cleavage products are size-separated on a DNA sequencing
instrument, for example a capillary DNA sequencer and the
fluorescently labelled traces are analysed. The differential
end-labelling of the amplification products permits the two
cleavage fragments to be observed and to identify the position of
the mismatch. When a mutation is detected in the pooled DNA, the
DNA samples in the pool are individually sequenced to identify the
specific plant carrying the mutation.
[0069] The amount of phytase enzyme in the grain of plants having
the mutant (HighPhy) enhancer: ACA VGA GTC ATG CAT in their genome,
is then determined to confirm that the selected mutant has the high
phytase phenotype, for example by employing the phytase assay
described in Example 1.
V Use of High-Phytase Cereal Grain for Producing a Composition
[0070] Processing of cereal grain (for example wheat of rye grain)
having phytase activity in accordance with the present invention,
is carried out using traditional processing steps including one or
more of the following steps:
[0071] i. Cleaning/conditioning cereal grain: First the grain is
cleaned. For example the grain may be passed through magnets and/or
metal detectors to remove any metal contamination. Machines can be
used to separate any other seeds, stones or dust that may have got
mixed with the wheat.
[0072] ii. Gristing grain: The cleaned and conditioned grain is
blended with other types of grain in different proportions to make
different kinds of flour.
[0073] The gristed grain passes through special rollers called
break rolls. They break each grain into its three parts: cereal
grain germ, bran and endosperm. Sieves sift the three separated
parts into different streams.
[0074] iii Mixing: The bran, germ and endosperm fractions, having
been separated out, can optionally be blended, and can be milled to
make different types of milled cereal grain composition, such as
Wholemeal flour using all parts of the grain; Brown flour contains
about 85% of the original grain, but with some bran and germ
removed; and White flour is made from the endosperm only. A flour
mix comprising flour prepared from high-phytase cereal grains of
the invention has particular value for bread making, due to the
rapid degradation of phytate during dough fermentation (see Example
12) that confers both improved dough mixing properties and enhances
the nutritional value (by increasing mineral uptake from the diet,
in particular zinc, iron, calcium and and inorganic phosphate ions)
of the bread produced with the dough.
[0075] iv. Steam pelleting: Milled cereal grain composition may be
combined with other fodder ingredients in a steam-pelleting
machine, where the components are exposed to steam at a temperature
of about 80.degree. C.-90.degree. C. for a period of time
sufficient to reduce the microbial population to levels safe for
animal consumption, and the product is converted to dried pellets.
Steam pelleted animal feed prepared from HighPhy cereal grain of
the invention retain sufficiently high levels of phytase activity
following steam-treatment, that addition of supplementary phytase
granules can be avoided.
VI A Composition Comprising High-Phytase Cereal Grain
[0076] In a further embodiment, the present invention provides
animal fodder comprising grain derived from the mutant cereal plant
of the present invention (for example a wheat, rye or barley
high-phytase mutant), where the grain are characterized by enhanced
levels of phytase. Animal fodder comprising grain from the mutant
wheat plant have the advantage, that the need to supplement the
fodder with phytase is considerably reduced and preferably avoided,
and at the same time the added high phytase cereal grain has the
advantage that it is not classified as genetically modified
material.
VII A Wild-Type Triticum aestivum Gene TaPAPhy_a1
[0077] In a further embodiment, the present invention provides an
isolated full-length Triticum aestivum gene TaPAPhy_a1 (SEQ ID NO:
45), comprising a promoter sequence (SEQ ID NO: 7) and down-stream
coding sequence comprising 5 exons and 4 introns (FIG. 3). Part, or
all, of the isolated TaPAPhy_a1 gene can be used for the
construction of gene constructs for transformation into wheat.
Example 1
Phytase Activity of Different Triticum aestivum Cultivars
[0078] 1.1 Comparative Levels of Total Phytase Enzymatic Activity
in Mature Wheat Grain
[0079] The phytase activity was measured in mature seeds of 52
individual cultivars or lines of wheat (Triticum aestivum). Mature
seeds were milled and protein was extracted from 0.250 g of flour
by adding 2.5 ml 220 mM Na-acatete buffer (pH 5.5) including 68 mM
CaCl.sub.2 and Tween 20 (100 mg/1). The suspension was vortexed for
1 hour at room temperature and subsequently centrifuged at
3000.times.g for 10 min. The supernatant was collected and assayed
for phytase activity as described by Engelen et al., 1994 [1]. One
phytase unit (U) is defined as 1 .mu.mol of Pi released upon
phytate hydrolysis at 37.degree. C. at the enzymes pH optimum.
[0080] Phytase activity ranged from .about.650 to .about.1900
FTU/kg in grain from 50 of the wheat lines (FIG. 1). Similar levels
of phytase activity have previously been reported [2], in 13
individual wheat lines. However in two lines, HIGHGPHY01 and
HIGHPHY02, the level of phytase activity was .about.6000 FTU/kg and
.about.4300 FTU/kg respectively, exceeding all other wheat lines
analysed.
[0081] 2.2 Distribution of Phytase Enzymatic Activity in Mature
Wheat Grain
[0082] The distribution of phytase activity between outer layers
and endosperm tissues of wheat grain derived from HIGHPHY wheat
lines and wild type wheat lines was determined. The wheat grain
samples were milled and divided into outer bran and inner endosperm
fractions. The phytase activities were measured in each fraction
(FIG. 2). In wild-type wheat grains with a total activity on 1200
FTU/kg, phytase activity was mainly localised in the bran fraction
with 3500 FTU/kg, while phytase activity in endosperm tissue was
about .about.600 FTU/kg. A significantly different distribution was
seen in HIGHPHY01 grain, where the activity in the endosperm was
6900 FTU/kg, exceeding the level of phytase activity in both bran
(5300 FTU/kg) and whole grains (6300 FTU/kg).
Example 2
Isolation of a Wheat Phytase Gene
[0083] 2.1 Construction of a Genomic Library from Genomic DNA from
Triticum aestivum, Cv Skagen:
[0084] A genomic library of DNA extracted from Triticum aestivum,
cultivar Skagen, was generated using the Lambda Fix II/Xho I
Partial Fill-In Vector Kit (Agilent Technologies-Stratagene
Products) according to the manufacturer's instructions. The initial
library was titered and the size found to be 5.times.10.sup.6 pfu.
Given the constraints of the vector, which will accommodate inserts
of 9-23 kb, this corresponds to 45000-115000 Mb or 2.8-7.2 times
the size of the wheat genome. The library was amplified on 150
120.times.120 mm NZY agar plates according to the manufacturer's
instructions to achieve a final titer of 3.times.10.sup.6
pfu/.mu.L.
[0085] 2.2 Screening a Triticum aestivum, Cv Skagen Genomic Library
for a Phytase Gene:
[0086] The amplified library was plated out on 240.times.240 mm NZY
agar plates at a density of 600 pfu/cm.sup.2. Plaque lifts were
performed with Hybond N+ membranes (GE Healthcare), and the DNA was
fixed on the membrane by alkaline denaturation and UV cross
linking. The membranes were prehybridized in 0.25 M sodium
phosphate buffer, pH 7.2, with 7% SDS and 0.17 mg/mL salmon sperm
DNA at 65.degree. C. for two hours in rolling tubes. The membranes
were then hybridised in a solution comprising the radiolabelled
Triticeae PAPhy specific Probe (20 microcuries), 0.25 M sodium
phosphate buffer, pH 7.2, with 7% SDS at 65.degree. C. overnight.
Preparation of the probe is set out below. Ten membranes were
washed at a time for 15 min in the hybridization tubes at
65.degree. C. with 1.times.SSPE buffer followed by one wash for one
hour at 65.degree. C. in 1 L 1.times.SSPE buffer and 10 seconds in
room temperature 1.times.SSPE. Finally the membranes were blot
dried on filter paper for 10 min and sealed in plastic
envelopes.
[0087] X-ray films were exposed with the membranes at -80.degree.
C., and the developed films subsequently analysed radiolabel
signals. Positive clones were cut from the original plate and
isolated by successive rounds of plaque screenings.
[0088] 2.3 a Triticeae PAPhy Phytase Gene Specific Probe:
[0089] A 20 .mu.Ci .sup.32P labelled probe was generated by PCR
using [.alpha.P32]dCTP and the primers:
TABLE-US-00005 (SEQ ID NO: 31) PAP ex3 Fw: CTTGAGCCTGGGACGAAGT and
(SEQ ID NO: 32) PAP ex3 Rv: GAGAAGGACCCGCTCTCC,
[0090] and a template consisting of a plasmid comprising a cDNA
molecule whose nucleotide sequence encoded the wheat Purple Acid
Phosphatase Phytase b (TaPAPhy_b). The primers amplified a portion
of the cDNA molecule whose nucleotide sequence corresponds to the
highly conserved third exon of the Triticeae PAPhy_b gene. The
amplified sequence generated a DNA probe of 479 nucleotides in
length. Remaining unincorporated dNTPs were removed with an
Illustra MicroSpin G-50 Column (GE Healthcare). The probe was
denaturated by boiling followed by shock cooling in 500 .mu.L of 10
.mu.g/.mu.L sonicated salmon sperm DNA.
[0091] 2.4 Isolation and Characterisation of Triticeae PAPhy
Phytase Gene:
[0092] Isolated lambda (2) clones, selected by the Triticeae PAPhy
specific probe, were amplified on five to twenty 82 mm diameter NZY
agar plates and .lamda. DNA was isolated from the phage harvested
from the plates using the Lambda midi kit (Qiagen) according to the
manufacturer's instructions.
[0093] One isolated .lamda. clone, comprising the genomic DNA
molecule designated TaG2, was sequenced (SEQ ID NO: 45) and found
to comprise a polynucleotide comprising a 2000 bp promoter region
having the sequence (SEQ ID NO: 43).
Example 3
Amplification and Characterization of Phytase Gene Promotors from
Different Triticum aestivum and Triticum tauschii Cultivars
[0094] 3.1 Isolation of Phytase Gene Promoters by PCR
[0095] Genomic DNA was isolated from 10 cultivars of T. aestivum
and 2 accessions of T. tauschii (also known as Ae. Tauschii), as
shown in table 1.
TABLE-US-00006 TABLE 1 Cultivars and accessions from which the
TaPAPhy_a1 promoter was amplified. Cultivar/accession Notes Bob
White T. aestivum model cultivar Skagen T. aestivum commercial
cultivar Flair T. aestivum commercial cultivar Spelt T. aestivum
spp spelta commercial sample Pentium T. aestivum commercial
cultivar Landrace 01 T. aestivum Landrace Landrace 02 T. aestivum
Landrace HighPhy 01 Novel high phytase T. aestivum cultivar HighPhy
02 Novel high phytase T. aestivum cultivar NGB90403 T. tauschii
NGB9855 T. tauschii
[0096] TaPAPhy_a1 promoter region was amplified from genomic DNA
isolated from each of the above cultivars using primer pairs based
on the sequence of the high phytase gene, designated, .lamda.
clone: TaG2. The first primer pair was designed for amplifying the
first exon and 2041 bp 5' upstream flanking region (promoter) of
the TaPAPhy_a1 gene:
TABLE-US-00007 (SEQ ID NO: 33) TaPAPhy_a1-pro-ex1 Fw:
TTATGTGTCCGCGTGAAGTG and (SEQ ID NO: 34) TaPAPhy_a1-pro-ex1 Rv:
ACCAAGAGTCAATGCCATCC
[0097] An additional primer pair was designed to amplify a shorter
sequence which includes 288 bp of the 5' flanking region (promoter)
and 147 bp of the first exon of the TaPAPhy_a1 gene:
TABLE-US-00008 (SEQ ID NO: 35) TaPAPhy_a1 -311 cons Fw:
TTTGGACGAGCCATAGCTGCATA and (SEQ ID NO: 36) TaPAPhy_a1 167 Rv:
CGCTGCACCCGGGGGTCCGT
[0098] The latter primer pair was used with cultivars where the
first primer pair failed to yield an amplification product.
[0099] PCR was performed with Herculase II (Agilent
Technologies--Stratagene Products) according to the manufacturer's
instructions, but with the modification that 6% DMSO was used in
the reaction mixture.
[0100] Amplicons of the expected size were isolated from agarose
gels and cloned in the pCR4Blunt TOPO vector (Invitrogen) and
sequenced.
[0101] 3.2 Characterization of the Promoter Region of Isolated T.
aestivum and T. tauschii Phytase Genes--Alignment of 1000 bp
[0102] The long PCR amplicon, (corresponding to 2041 bp 5' upstream
flanking promoter region the first exon and of the TaPAPhy_a1 gene)
was obtained from 10 cultivars of T. aestivum, whereas only the
short amplicon (corresponding to 147 bp of the first exon and 288
bp of the 5' flanking promoter region of the TaPAPhy_a1 gene) was
obtained from two accessions of T. tauschii. The 1000 bp 5'flanking
region and start codon of each of the T. aestivum genes were
aligned, and used for a pair wise comparison (see FIG. 4).
[0103] The T. aestivum PAPhy phytase gene (in .lamda. clone TaG2)
and the PCR amplicon obtained from amplifying genomic DNA from the
same cultivar, Skagen, had the same nucleotide sequence, and are
included in FIG. 4. The nucleotide sequence of the 1000 bp
5'flanking promoter region of each of the T. aestivum genes share
at least 99.7% identity, whereas the nucleotide sequence of the
corresponding promoter regions from two HighPhy cultivars only
share 97.7-98.1% sequence identity to the other T. aestivum genes.
The nucleotide sequence of the promoter regions of the two HighPhy
cultivars [SEQ ID NO: 5 and 6], however, share 99.8% sequence
identity with each other, differing in nucleotide sequence by only
two base pairs. A polynucleotide comprising a .about.2000 bp
promoter region from the HighPhy cultivars, corresponding to the
promoter region of the wild type T. aestivum PAPhy phytase gene,
has the nucleotide sequence (SEQ ID NO: 44).
[0104] 3.3 Characterization of the Promoter Region of Isolated T.
aestivum and T. tauschii Phytase Genes--Alignment of 288 bp
[0105] The 288 bp 5'flanking region and start codon of each of the
T. aestivum genes together with the corresponding sequence from T.
tauschii were aligned, and used for a pair wise comparison (FIG.
5).
[0106] The amplified 288 bp 5'flanking promoter region from each
of: wild-type T. aestivum cultivars; HighPhy T. aestivum cultivars;
and T. tauschii cultivars shared nucleotide sequence identity
within each of the three groups. However, the nucleotide sequence
of the promoter regions of the two HighPhy T. aestivum cultivars
differs from the wild-type 9 T. aestivum cultivars in two
nucleotides, and differs from the two T. tauschii cultivars in 3
nucleotides. In turn the nucleotide sequence of the promoter
regions from the two T. tauschii cultivars differs from wild-type
T. aestivum cultivars in 3 nucleotides.
[0107] It can be seen from the alignment in FIG. 6, that the
5'flanking promoter region of the two HighPhy T. aestivum cultivars
[SEQ ID NO: 5] comprises a single nucleotide polymorphism (SNP)
(-244 T.fwdarw.C), that is unique to these HighPhy cultivars, when
compared to the wild type cultivars [SEQ ID NO: 7 and 8].
Example 4
Genomic Context of the SNP in HighPhy T. aestivum Cultivars
[0108] Sequence analyses of the immediate surroundings of the
HighPhy SNP reveals sequence motifs known to be involved in gene
regulation. Consider first the sequence found in wild type T.
aestivum (wheat) cultivars (wt):
TABLE-US-00009 [SEQ ID NO: 4] AACATGAGTCATGCATGGGA
[0109] It consists of four overlapping motifs:
[0110] In bold font, the odd base palindrome sequence reported by
[3];
[0111] In enlarged font, GCN4 motif, involved in endosperm specific
gene expression [4];
[0112] In italic font, the skn-1 motif reported by [5];
[0113] In underlined font, the palindomic RY-repeat identical to
that reported by [6].
[0114] Note that the skn-1 and GCN4 motifs are contained within the
odd base palindrome. The odd base palindrome and GCN4 motif have
been shown to interact with Opaque2, a maize basic leucine zipper
(bZIP) transcription factor involved in the regulation of seed
storage proteins [3,4], whereas the RY-repeat has been shown to
interact with transcription factors containing the B3 domain. It is
known to be an enhancer of seed-specific expression and a repressor
of vegetative expression in A. thaliana [7].
[0115] Consider now the sequence from the HighPhy T. aestivum
cultivars:
TABLE-US-00010 ##STR00001##
[0116] The mutation, identified by the elevated "C", abolishes the
odd base palindrome and the GCN4 motif, but leaves the skn-1 motif
and the RY-repeat unchanged. A new motif, boxed, is thereby
introduced. This motif shows similarity to the G-box CACGTG (1) but
lacks the highly conserved palindromic nature of the G-box, and
represents a completely novel motif, acting as a cis-acting
regulatory element. This mutation, found in HighPhy T. aestivum
cultivars, is either the result of the abolition of the odd base
palindrome or the result of the introduction of the novel motif
Example 5
Method for Detecting the HighPhy SNP in the Genome of Cereal
Plants
[0117] The SNP in the genome of a cereal plant that is located in a
polynucleotide comprising the enhancer element having the
nucleotide sequence
TABLE-US-00011 CGAGTCATGCATGGGA
was detected using the technique of "High Resolution Amplicon
Melting Analysis" [10]. PCR was performed in 10 .quadrature.L
volumes in a LightCycler (Roche Applied Systems) with programmed
transitions of 20.degree. C./s unless otherwise indicated. The
amplification mixture included 50 ng genomic DNA as template, 200
.quadrature.M each deoxynucleotide triphosphate (dNTP), 0.4 U
KlenTaq1 polymerase (ABPeptides), 88 ng TaqStart antibody
(ClonTech), 3 mM MgCl2, 50 mM Tris (pH 8.3), 500 ng/.quadrature.L
bovine serum albumin, 0.5 .quadrature.M primers located upstream
and downstream of the SNP and 1-10 .quadrature.M LCGreen, in order
to amplify an polynucleotide of around 40-300 nucleotides in
length. Melting analysis was performed on the LightCycler. After
amplification, the samples are heated momentarily in the
LightCycler to 94.degree. C. and cooled to 40.degree. C. The
LightCycler capillary is then transferred to the high-resolution
melting instrument and heated at 0.3.degree. C./s. Sample
temperature and fluorescence signals are converted to 16-bit
digital signals, which are then analysed to detect the SNP.
Example 6
Method for Inducing and Selecting Wheat Germplasm Comprising the
HighPhy SNP and Grain with High Levels of the Enzyme Phytase
[0118] HighPhy wheat can be generated by mutagenesis and subsequent
screening for individuals where the polynucleotide TGAGTCATGCATG,
corresponding to the wild type (NormPhy) element, in the wheat
genome has been converted into the mutant (HighPhy) element
CGAGTCATGCATG. The mutagenesis is carried out with sodium azide
which preferentially generates A:T to G:C substitutions in barley
(8). Screening mutagenized populations for the desired mutation
could be done by allele specific polymerase chain reaction
(AS-PCR).
[0119] Procedure: Wheat grains are presoaked for 15 hours in
demineralised water at 5.degree. C. and then treated with an
oxygenated solution of 1 mM sodium azide at pH 3 for 2 hours. The
grains are washed and sown out, and grown to mature plants. Genomic
DNA is isolated from leaves of each individual plant before the
plant begins to senesce, using a standard DNA extraction procedure
[9], whereas grains are harvested at maturity. Grains from
individual plants are kept apart and labelled so they can be
matched with the corresponding DNA isolates. The DNA isolates are
screened by AS-PCR using the following primer pair:
TABLE-US-00012 [SEQ ID NO: 37] HighPhy Fw: 5'CAAGCTACACTTTGTAGAACAC
3' [SEQ ID NO: 38] PAPhy Rv: 5'CGCTGCACCCGGGGGTCCGT 3'
[0120] The first 21 nucleotides of the HighPhy Fw primer anneal 5'
to the HighPhy enhancer polynucleotide, whereas the 3'C nucleotide
anneals to the actual SNP, this SNP being the distinguishing
nucleotide between the HighPhy and NormPhy element polynucleotides.
The PAPhy Rv primer anneals to a highly conserved part of the
coding sequence of the PAPhy phytase gene, and can thus be expected
to anneal to all known loci in the genome containing the wheat
PAPhy phytase gene. The AS-PCR is performed using a
non-proofreading polymerase to ensure specificity, and detection of
the SNP. A series of replicate AS-PCR, using the HighPhy Fw primer
and PAPhy Rv primer pair, are performed under conditions of
increasing stringency (e.g. increasing PCR annealing temperature),
on control genomic DNA samples isolated from HIGHPHY01 wheat grain
of the invention and a wildtype NormPhy wheat plant. Under selected
conditions of stringency, AS-PCR is then performed on DNA isolated
from HighPhy mutation positive plants to amplify an amplicon of 300
to 700 bp in length, which can be identified by agarose gel
electrophoresis, whereas plants lacking the HighPhy mutation will
not produce an amplicon. The amplified product is then cloned and
sequenced to confirm that the presence of the mutant (HighPhy)
element CGAGTCATGCATG in the genomic DNA isolate. AS-PCR conditions
that are sufficiently stringent to selectively amplify HighPhy
mutation positive plants, are then employed to screen genomic DNA
isolated from each individual mutagenized plant. Grain from HighPhy
mutation positive plants can then be cultivated further to generate
sufficient grain for subsequence breeding and crop production.
Example 7
Phytase Activity of Different Secale cereale Cultivars
[0121] 7.1 Comparative Levels of Total Phytase Enzymatic Activity
in Mature Secale cereale (Rye) Grain
[0122] The phytase activity was measured in mature seeds of 5
individual cultivars rye, as described for seeds of Triticum
aestivum, detailed in Example 1.1. Phytase activity ranged from
.about.1600 to .about.6000 FTU/kg in grain from the 5 rye line
(FIG. 8). In one line, LPPO3, the level of phytase activity was
1600 FTU/kg, which was lower than levels measured in the other 4
lines, of which one line had 6000 FTU/kg.
Example 8
Amplification and Characterization of Phytase Gene Promotors from
Different Secale cereale and Hordeum vulgare Cultivars
[0123] 8.1 Isolation of Phytase Gene Promoters by PCR
[0124] Genomic DNA was isolated from Secale cereale and Hordeum
vulgare cultivars and the phytase gene promoter was amplified by
PCR as described in Example 3.1.
Example 9
Structural Characterisation of Cereal Phytase Enzymes and the
Coding Sequence of their Cognate Genes
[0125] The promoter of the invention comprising an enhancer
polynucleotide having SEQ ID NO: 1 or 2, is structurally and
operably linked to a polynucleotide molecule comprising a coding
sequence encoding a phytase enzyme. The polynucleotide molecule in
the genome of a cereal plant encoding a phytase enzyme comprises a
coding sequence (comprising one or more exon) and a non-coding
sequence (comprising one or more intron). The amino sequence and
the nucleotide sequence of the coding sequence encoding a phytase
enzyme derived from the Triticum aestivum cv., (Ta); Secale cereale
cv (Sc); and Hordeum vulgare cv., (Hv) are as follows: [0126]
TaPAPhy_a1 phytase (SEQ ID NO: 18) encoded by TaPAPhy_a1 cDNA (SEQ
ID NO: 17); [0127] TaPAPhy_a2 phytase (SEQ ID NO: 20) encoded by
TaPAPhy_a2 cDNA (SEQ ID NO: 19); [0128] TaPAPhy_a3 phytase (SEQ ID
NO: 22) encoded by TaPAPhy_a3 cDNA (SEQ ID NO: 21); [0129]
TmPAPhy_a4 phytase (SEQ ID NO: 24) encoded by TmPAPhy_a4 cDNA (SEQ
ID NO: 23); [0130] ScPAPhy_a1 phytase (SEQ ID NO: 26) encoded by
ScPAPhy_a1 cDNA (SEQ ID NO: 25); [0131] ScPAPhy_a2 phytase (SEQ ID
NO: 28) encoded by ScPAPhy_a1 cDNA (SEQ ID NO: 26); [0132]
HvPAPhy_a1 phytase (SEQ ID NO: 30) encoded by HvPAPhy_a1 cDNA (SEQ
ID NO: 29);
[0133] The phytase enzyme in mutant HighPhy Triticum aestivum has
an amino acid sequence similar to the phytase enzyme in wild type
Triticum aestivum cv's Bobwhite and Skagen. Their amino acid
sequences differ by the deletion of three amino acid residues and
the substitution of three residues in the HighPhy cultivar when
compared to cv's Bobwhite and Skagen, these differences being
located within the 120 residue long signal peptide region at the
amino-terminus. The substitutions are conservative, G.fwdarw.A and
S.fwdarw.T.
Example 10
Stability of Phytase Activity in Wheat Flour Subjected to Steam
Treatment
[0134] Animal feed comprising milled cereal grain, is commonly
subjected to steam pelleting, which is a two-step process of
conditioning followed by pelleting. During conditioning the milled
feed is mixed and simultaneously heated to about 80.degree. C. and
its moisture content is increased by exposure to steam. The
experimental set up used in this example simulates the combination
of heat and moisture used during conditioning.
[0135] The experimental setup consisted of a GFL 1083 water bath
with a plastic tray floating on the surface of the water and
occupying approximately half of the surface area of the water. A
thermometer, placed inside the tray, was used to monitor the
headspace temperature before and after incubation. The water bath
was equipped with a thermostat and a lid so a constant temperature
and steam-filled headspace with 100% relative humidity could be
maintained. The water bath was set to 80.degree. C., and once this
temperature was reached, it was allowed to equilibrate for one
hour. The headspace temperature was found to be 80.degree. C. at
this point.
[0136] Eight to nine grams of sample wheat grains were milled on a
Retsch RM100 mortar grinder mill, and the resulting flour was
distributed in weighing boats, 500 mg in each. The steam treatment
consisted of incubating the weighing boats with samples on the
plastic tray for various periods of time. The lid of the water bath
remained closed for the duration of the incubation and the
temperature of 80.degree. C. in the headspace was verified before
and after each incubation. Following steam treatment, the wheat
flour samples were dessicated overnight in an exicator with silica
gel.
[0137] Once dried, the phytase activity of the wheat flour samples
was assayed using the assay described by (Engelen, Vanderheeft,
Randerheeft & Smidt, 1994 [1])
[0138] Two measurements, (A) and (B), of phytase activities of wild
type wheat (T. aestivum cv. Bobwhite (BW)) and HighPhy (HIGHPHY)
wheat, after 0, 10, 20 and 40 min of incubation at 80.degree. C. at
100% relative humidity, are shown in FIG. 9. At t=0, the phytase
activities of BW and HIGHPHY were 1286 and 4311 FTU/kg,
respectively. After 10 min of incubation, HIGHPHY still exhibited a
very substantial phytase activity of 3046 FTU/kg, while BW only
exhibited 940 FTU/kg. After 20 min of incubation, HIGHPHY had 1801
FTU/kg residual phytase activity, still higher than the starting
level in BW, while in BW the activity was only 667 FTU/kg. The most
extreme incubation of 40 min reduced phytase activity in the
HIGHPHY to 962 FTU/kg, while levels in BW were reduced to 476
FTU/kg.
[0139] The experimental conditions used to test phytate stability
were more extreme than those of commercial steam-pelleting, where
the duration of steam treatment of normally around 1 minute. It is
thus expected that the residual phytase activity in pelleted feed
made from HighPhy cereal grains of the invention will lie above the
level at which supplementary phytase is required (circa 2500
FTU/kg).
Example 11
Stability of Phytase Activity in HighPhy Secale cereale (Rye)
Subjected to Steam Treatment
[0140] Grain of HighPhy rye were milled and the resulting flour was
subjected to simulated conditioning, using the same experimental
set up as used for wheat flour in example 10. A single measurement
of phytase activity of HighPhy rye, after 0, 1, 2, 3, 4, 5, 10, 30,
45 and 60 min of incubation at 80.degree. C. at 100% relative
humidity, are shown in FIG. 10. At t=0, the phytase activities of
HighPhy rye was 4013 FTU/kg, and after 10 min still exhibited a
very substantial phytase activity of 3818 FTU/kg. After 30 min of
incubation phytase activities in the flour dropped to 1746
FTU/kg.
Example 12
Enhanced Phytate Degradation in High-Phy Wheat Flour
[0141] Phytase degradation during fermentation of dough improves
its nutritional and bread-making quality, since phytase degradation
enhances inorganic phosphate levels and mineral content in bread,
and is known to improve dough mixing quality. Dough made from
HighPhy wheat is shown to provide these advantages.
[0142] Wild type wheat (T. aestivum cv Bobwhite (BW)) and HighPhy
wheat (HP) grains were milled on a Retsch RM100 mortar grinder
mill. The phytate content in the resulting flour was determined
using the procedure described by (Vaintraub & Lapteva, 1988).
Flour (250 mg) was mixed with 0.1 ml of bakers yeast water stock
(dry yeast in 3 mg/ml water). An additional 0.2 ml of water was
added to form a dough. The dough was fermented at 25.degree. C. for
0.5, 1, 3 and 3 hrs. After fermentation, the phytate content was
determined again, using the same procedure (Vaintraub and Lapteva,
1988).
[0143] The initial phytate content of HP wheat flour was a little
higher than that of BW wheat (FIG. 11). However during
fermentation, phytate levels were decreased to a lower level in
flour from HP than BW wheat. Thus, phytate levels were reduced
significantly more during fermentation in wheat dough from HP in
comparison to dough from BW, both in terms of percentage and in the
final phytate levels. Already after 0.5 hr, phytate was reduced
more in HP than in BW wheat (FIG. 12 and table 2). After 3 hrs,
only .about.44% of the initial phytate was left in the HP wheat,
whereas .about.68% was left in the wild type BW wheat.
TABLE-US-00013 TABLE 2 Percent residual phytate (IP6) in dough of
wild-type (BW) and HighPhy (HP) wheat flour BW HP Time residual IP6
(%) residual IP6 (%) 0 100 100 0.5 97.8 85.9 1.0 91.9 82.7 1.5 86.2
66.9 2.0 73.8 53.6 3.0 68.3 43.8
Example 13
The HighPhy Enhancer in the Barley Phytase Gene Confers Both
Aleurone and Endosperm-Specific Expression in Developing Barley
Grain
[0144] 13.1 Cloning of Promoter-GUS Constructs for Examination of
the HighPhy Mutation:
[0145] The HighPhy mutation was introduced in the
pCLEAN-G185-PAPhy_a construct with the mutagenic primers:
TABLE-US-00014 (SEQ ID No. 46) HvPAPhy_a SDmut Fw
5'GTAGAACACGAGCCATGCATGAGAC3' (SEQ ID No. 47) HvPAPhy_a SDmut Rv
5'TGGCTCGTGTTCTACAAAATGTAGC3'
[0146] This yielded the pCLEAN-G185-HP-PAPhy_a construct.
[0147] The two constructs pCLEAN-G185-PAPhy_a and
pCLEAN-G185-HP-PAPhy_a were further modified to serve as
promoter-reporter gene constructs. To achieve this, the PAPhy_a
coding open reading frame and terminator was replaced by the UidA
open reading frame followed by the NOS terminator. The cloning was
performed with the "In-Fusion" technology as described in (Zhu,
Cai, Hall and Freeman, 2007). This approach ensured seamless
joining of the promoter and reporter gene so the start codon
context was preserved.
[0148] The vector backbone and promoter of both constructs were
amplified using the primers:
TABLE-US-00015 (SEQ ID No. 48) Cis to GUS Fw 5'
TCGAGTCGACGTTCCTTGAC3' (SEQ ID No. 49) Cis to GUS Rv 5'
GTTGATGTTGTTGCTTGGCATTG3'
[0149] The UidA and NOS terminator were amplified from pGUSN which
is a pUC18 plasmid comprising an UidA gene and a downstream NOS
terminator, using the primers:
TABLE-US-00016 GUS Fw m. overhang (SEQ ID No. 50) 5'
AGCAACAACATCAACATGTTACGTCCTGTAGAAACC3' GUS Rv m. overhang (SEQ ID
No. 52) 5' GGAACGTCGACTCGACTATGACCATGATTACGAATTCC3'
[0150] Performing the In-Fusion with the resulting amplicons gave
the two GUS reporter constructs, pCLEAN-G185-wt-proGUS (SEQ ID No.
52) and pCLEAN-G185-HP-proGUS (SEQ ID No. 54).
[0151] 13.2: Constructing Randomized Phytase Gene Enhancer Element
Sequences to Confirm the Criticality of the Promoter Enhancer
Element Comprising the HighPhy Mutation.
[0152] The enhancer element motifs surrounding the HighPhy mutation
were removed by sequence randomization by taking the 20 bp
corresponding to SEQ ID 4 in the pCLEAN-G185-PAPhy_a construct and
subjecting the sequence to a nucleotide randomizer
(http://molbiol.ru/eng/scripts/(01_16.html) using settings designed
to preserve the nucleotide ratios of the original sequence. The
resulting sequence, 5' gcatacgaagcatagtacga3', was only identical
to the original in three nucleotide positions and did not contain
any regulatory elements known by PlantCARE*. The original 20 bp in
pCLEAN-G185-wt-proGUS was replaced by the randomized sequence as
described by Zhu and co-workers using the primers:
TABLE-US-00017 Kill triad Fw (SEQ ID No. 56) 5'
gcatacgaagcatagtacgaCGTAGGCGTCCAAACTTTG3'; Kill triad Rv (SEQ ID
No. 57) 5' tcgtactatgcttcgtatgcCTACAAAATGTAGCTTGAAATTAAAG AG3'
[0153] The resulting construct was pCLEAN-G185-KOtriad-proGUS (SEQ
ID No. 58).
[0154] 13.3 Transient Expression in Developing Barley Endosperm and
Aleurone:
[0155] The three constructs were individually introduced into
developing (from 14 to 35 days after pollination) barley endosperm
and aleurone cells by particle gun bombardment. Immature barley
seeds were sterilized, and cultured on media and bombarded in a
DuPont PDS 1100 helium biolistic delivery system using the
procedures described in (BrinchPedersen, Galili, Knudsen, &
Holm, 1996). Expression of the uidA gene was assayed in the plant
tissues two days after bombardment, using the gus reaction buffer,
as described in Jefferson, Kavanagh, & Bevan, 1987. Gus
expression was scored by localizing blue spots on the bombarded
tissues.
[0156] In tissues bombarded with the pCLEAN-G185-wt-proGUS plasmid,
blue spots were mainly identified in the aleurone layers, with very
limited expression in the endosperm. In pCLEAN-G185-HP-proGUS
bombarded tissues more expression could be observed in the
endosperm tissue. No expression was detected in grain bombarded
with the pCLEAN-G185-KOtriad-proGUS. These data confirm that the
HighPhy mutation in the context of the barley phytase gene enhancer
confers both aleurone and endosperm-specific expression
Example 14
Identification of the Wild Type Locus in the Wheat Genome
Corresponding to the HighPhy Phytase Gene
[0157] The mutant gene was aligned to the three homeologous PAPhy_a
genes from the wild type cultivar "Chinese spring". The alignment
was adjusted to include only the exons and introns of the gene. An
UPGMA tree was generated with 1000 bootstrap replications (FIG.
13). The tree clearly points to TaPAPhy_a1 as the wild type locus
corresponding to the HighPhy gene.
[0158] 14.1 Chromosomal Mapping of the TaPAPhy_a1 Gene:
[0159] Wheat chromosomal mapping was performed using the Chinese
Spring nullisomic-tetrasomic lines described by (Kimber &
Sears, 1979. There are 42 possible nullisomic-tetrasomic lines, of
which two were missing in the present set of lines (the nullisomic
(N) 2A tetrasomic (T) 2B and the N4BT4D lines), but their absence
did not compromise the mapping. The following primers where
designed to specifically amplify a 522 basepair segment of the
TaPAPhy_a1 gene:
TABLE-US-00018 Forward 5'GAGATTCCGAGACCAACGAA3' Reverse
5'TTTGCCTCCACTCTGCCTAC3'
[0160] The amplicon was exclusively absent from two lines nulisomic
for chromosome 5D and tetrasomic for chromosome 5A and 5B
respectively (N5DT5A and N5DT5B). Thus, TaPAPhy_a1 maps to
chromosome 5D.
LITERATURE CITED
[0161] [1] Engelen A J, Heeft F C yen der, Randsdorp P H G, Smit E
L C (1994) Simple and rapid determination of phytase activity. J
AOAC Internat 77: 760-764. [0162] [2] Eeckhout W, Depaepe M (1994)
Total phosphorus, phytate-phosphorus and phytase activity in plant
feedstuffs. Anim Feed Sci Tech 47: 19-29. [0163] [3] Depater S,
Katagiri F, Kijne J, Chua N H (1994) Bzip Proteins Bind to A
Palindromic Sequence Without An Acgt Core Located in A
Seed-Specific Element of the Pea Lectin Promoter. Plant Journal 6:
133-140 [0164] [4] Wu C Y, Suzuki A, Washida H, Takaiwa F (1998)
The GCN4 motif in a rice glutelin gene is essential for
endosperm-specific gene expression and is activated by Opaque-2 in
transgenic rice plants. Plant Journal 14: 673-683 [0165] [5]
Blackwell T K, Bowerman B, Priess J R, Weintraub H (1994) Formation
of A Monomeric Dna-Binding Domain by Skn-1 Bzip and Homeodomain
Elements. Science 266: 621-628 [0166] [6) Baumlein H, Nagy I,
Villarroel R, Inze D, Wobus U (1992) Cis-Analysis of A Seed Protein
Gene Promoter--the Conservative Ry Repeat Catgcatg Within the
Legumin Box Is Essential for Tissue-Specific Expression of A
Legumin Gene. Plant Journal 2: 233-239 [0167] [7] Fujiwaraa, T.,
Nambara, E., Yamagishi, K., Goto, D. B., Naito, S. (2002) Storage
Proteins. The Arabidopsis Book, 2002 American Society of Plant
Biologists. [0168] [8] Olsen, O., et al. Proc. Natl. Acad. Sci. USA
(1993) Vol. 90, pp. 8043-8047. [0169] [9] Sambrook, Fritsch and
Maniatis (2001) Molecular Cloning: A Laboratory Manual (2nd
Edition) Cold Spring Harbor Laboratory Press. [0170] [10] Wittwer,
C. T., et al., (2003) High resolution genotyping by amplicon
melting analysis using LCgreen Clinical Chemistry: 49:6 853-860.
[0171] BrinchPedersen, H., Galili, G., Knudsen, S., & Holm, P.
B. (1996). Engineering of the aspartate family biosynthetic pathway
in barley (Hordeum vulgare L) by transformation with heterologous
genes encoding feed-back-insensitive aspartate kinase and
dihydrodipicolinate synthase. Plant Molecular Biology, 32(4),
611-620. [0172] Engelen, A. J., Vanderheeft, F. C., Randsdorp, P.
H. G., & Smit, E. L. C. (1994). Simple and Rapid-Determination
of Phytase Activity. Journal of Aoac International, 77(3), 760-764.
[0173] Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W.
(1987). GUS FUSIONS--BETA-GLUCURONIDASE AS A SENSITIVE AND
VERSATILE GENE FUSION MARKER IN HIGHER-PLANTS. Embo Journal, 6(13),
3901-3907. [0174] Kimber, G., & Sears, E. G. (1979). Use of
wheat aneuploids. Basic Life Sciences, 13, 427. Vaintraub, I. A.,
& Lapteva, N. A. (1988). COLORIMETRIC DETERMINATION OF PHYTATE
IN UNPURIFIED EXTRACTS OF SEEDS AND THE PRODUCTS OF THEIR
PROCESSING. Analytical Biochemistry, 175(1), 227-230. doi:
10.1016/0003-2697(88)90382-x [0175] Zhu, B. G., Cai, G. F., Hall,
E. O., & Freeman, G. J. (2007). In-Fusion (TM) assembly:
seamless engineering of multidomain fusion proteins, modular
vectors, and mutations. Biotechniques, 43(3), 356-359. doi:
10.2144/000112536 [0176] PlantCARE, a database of plant cis-acting
regulatory elements and a portal to tools for in silico analysis of
promoter sequences: [0177] Magali Lescot, Patrice Dehais, Gert
Thijs, Kathleen Marchal, Yves Moreau, Yves Van de Peer, Pierre
Rouze and Stephane Rombauts Nucleic Acids Res. 2002 Jan. 1; 30(1):
325-327
Sequence CWU 1
1
59115DNATriticum aestivummutant cereal
enhancer(1)..(15)modified_base(4)..(4)V = C, G or A 1acavgagtca
tgcat 15219DNATriticum aestivummutant cereal
enhancer(1)..(19)modified_base(8)..(8)V = C, G or A 2tagaacavga
gtcatgcat 19315DNATriticum aestivumwild type cereal
enhancer(1)..(15) 3acatgagtca tgcat 15420DNATriticum aestivumWild
type enhancer(1)..(20) 4aacatgagtc atgcatggga 205288DNATriticum
aestivumHigh Phy TaPAPhy mutant promoter(1)..(288)Mutant promoter
and 5' untranslated region 5ttttgttgct tgcgctttag tttcaagcta
cactttgtag aacacgagtc atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct
gcctgcgcgt tcacaaggca ccaaagcgca 120ggcggcaaag tttgctcgtt
tattatcttg gcggtccaag atgggcggca ggttccagac 180gatggacgaa
gacccaccga gttccacttc cggctccaac ctcctctgcc cgattcatat
240aagtttcctg ccaaaggcat cccaattctg tcaatgccaa gcaacaac
2886271DNATriticum aestivumHigh Phy TaPAPhy mutant
Promoter(1)..(271)TaPAPhy_a1 mutant promoter and 5' untranslated
region 6tagtttcaag ctacactttg tagaacacga gtcatgcatg ggacgaaggc
gtccaaactt 60ggctagtgca gctgcctgcg cgttcacaag gcaccaaagc gcaggcggca
aagtttgctc 120gtttattatc ttggcggtcc aagatgggcg gcaggttcca
gacgatggac gaagacccac 180cgagttccac ttccggctcc aacctcctct
gcccgattca tataagtttc ctgccaaagg 240catcccaatt ctgtcaatgc
caagcaacaa c 2717288DNATriticum aestivumWild typeTaPAPhy
Promoter(1)..(288)Wild typeTaPAPhy Promoter and 5' untranslated
region 7ttttgttgct tgcgctttag tttcaagcta cactttgtag aacatgagtc
atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct gcctgcgcgt tcacaaggca
ccaaagcgca 120ggcggcaaag tttgctcgtt tattatcttg gcggtccaag
atgggcggca ggttccagac 180gatggacgaa gacccaccga gttccacttc
cggctccaac ctcctctgcc cgattcatat 240aagtttcctg ccaaaggcat
tccaattctg tcaatgccaa gcaacaac 2888288DNATriticum tauschiiWild type
TtPAPhy promoter(1)..(288)Wild typeTtPAPhy Promoter and 5'
untranslated region 8ttttgttgct tgcgctttag tttcaagcta cattttgtag
aacatgagtc atgcatggga 60cgaaggcgtc caaacttggc tagtgcagct gcgtgcgcgt
tcacaaggca ccaaagcgca 120ggcggcaaag tttgctcgtt tattatcttg
gcggtccaag atgggcggca ggttccagac 180gatggacgaa gacccaccga
gttccacttc cggctccaac ctcctctgcc cgattcatat 240aagtttcctg
ccaaaggcat cccaattctg tcaatgccaa gcaacaac 2889271DNATriticum
aestivumWild type TaPAPhy_a1 promoter(1)..(271)Wild typeTaPAPhy_a1
Promoter and 5' untranslated region 9tagtttcaag ctacactttg
tagaacatga gtcatgcatg ggacgaaggc gtccaaactt 60ggctagtgca gctgcctgcg
cgttcacaag gcaccaaagc gcaggcggca aagtttgctc 120gtttattatc
ttggcggtcc aagatgggcg gcaggttcca gacgatggac gaagacccac
180cgagttccac ttccggctcc aacctcctct gcccgattca tataagtttc
ctgccaaagg 240cattccaatt ctgtcaatgc caagcaacaa c
27110287DNATriticum aestivumWild type TaPAPhy_a3
promoter(1)..(287)Wild type TaPAPhy_a3 promoter and 5' non-coding
region 10tagtttcaag ctacattttg tagaacatga gtcatgcatg ggacgaaggt
gtccaaagtc 60caaactcggc tagtgcagct gcctgcacgt tctgacgttc acaaggcacc
aaagcgcagg 120cggcaaactt tgctcgttta ttatctcgcc ggtccaagat
gggcggcaag ttctagacgc 180tggacgaaga cccaccgaat tccatttccg
gctcccaacc tcctctgccc gattcctgta 240agtttcctgc caaaatcatc
ccaattctct caatgccaag caacacc 28711240DNATriticum aestivumWild type
TaPAPhy_a4 promoter(1)..(240)Wild type TaPAPhy_a4 promoter and 5'
non-coding region 11tattttcaag ctacattttg tagaacatga gtcatgcatg
ggacgaaggt ggccaaagtc 60caaacttggc aggcggcaaa gtttgctcgt ttatcatctt
gccggtccaa gatgggcggc 120aggttccagg cgatggacga agacccaccg
agtcccactt ccggctccca acctcctctg 180cccgattcat ataagtttcc
tgccaaaggc atcctaattc tgtcaatacc aagcaacaac 24012278DNATriticum
monococcumHigh Phy TmPAPhy mutant promoter(1)..(278)High Phy
TmPAPhy mutant promoter and 5' untranslated region 12tagtttcaag
ctacattttg tagaacagga gtcatgcatg gacgaaggtg tccaaagtcc 60aaacttggct
agcgcagctg cctgcacgtt cacaaggcac caaagcgcag gcggcaaagt
120ttgctcgttt attatcttgc cggtccaaga cgggcggcag gttccagacg
atggacgaag 180acccaccgaa ttccatttcc ggctcccaac ctcctctgcc
cgattcctac aagtttcctg 240ccaaaggcat cccaattctg tcaatgccaa gcaacgcc
27813262DNAHordeum vulgareWild type HvPAPhy promoter(1)..(262)Wild
type HvPAPhy promoter and 5' untranslated region 13taatttcaag
ctacattttg tagaacatga gccatgcatg agacgtaggc gtccaaactt 60tggctagcgc
agctgcatgc acgtccacaa ggcaccaaag gcgcaggcgg caactttgct
120cgtttatttt cttgcgggtc caagatgagt tccagaccat ggacgaattc
cacttcgggc 180tcccaatctc ctctgccgga ttcctataag tttcctgcca
agaagcatcc caatcccctc 240aatgccaagc aacaacatca ac
26214262DNAHordeum vulgareHigh Phy HvPAPhy mutant
promoter(1)..(262)High Phy HvPAPhy mutant promoter and 5'
non-coding region 14taatttcaag ctacattttg tagaacacga gccatgcatg
agacgtaggc gtccaaactt 60tggctagcgc agctgcatgc acgtccacaa ggcaccaaag
gcgcaggcgg caactttgct 120cgtttatttt cttgcgggtc caagatgagt
tccagaccat ggacgaattc cacttcgggc 180tcccaatctc ctctgccgga
ttcctataag tttcctgcca agaagcatcc caatcccctc 240aatgccaagc
aacaacatca ac 26215270DNASecale cerealeHighPhy ScPAPhy_a1
promoter(1)..(270)HighPhy ScPAPhy_a1 promoter and 5' non-coding
region 15tagtttcaag ctacattttc tagaacacga gtcatgcatg ggacgaaggt
gtccaaagtc 60caaacttggc ttttgtgcag ctgcctgcac gttcacaagg caccaaagcg
caggcggcaa 120acttaatttg ctcgttcatt atcttgctgg tccaagatgg
gcggcaggtt gcacccaccg 180agttccactt ccggctccca atctcctgtg
cctgattcct ataagtttcc tgccaaaagc 240atcccaattc tgtcaatgcc
aagcaacaac 27016280DNASecale cerealeWild type ScPAPhy_a2
promoter(1)..(280)Wild type ScPAPhy_a2 promoter and 5' non-coding
region 16agtttcaagc tacattttgt agaacatgag tcatgcatgg gacgaaggtg
tccaaagtcc 60aaacttggct tttgtgcagc tgcctgcacg ttcacaaggc accaaagcgc
aggcggcaaa 120ctttgctcgt tcattatctt gctggtccaa gatgggcggc
aggttgcaga agatggacga 180agacccaccg agttccactt ccggctccca
atcgcctctg cccgattcct ataagtttcc 240tgccaaaggc atcccaattc
tgtcaatgcc aagcaacaac 280171749DNATriticum aestivumTaPAPhy_a1
phytase cDNA(1)..(1749)CDS(27)..(1670)Coding sequence for phytase
17caattctgtc aatgccaagc aacaac atg tgg tgg ggg tcg ctg ctg ctg ctg
53 Met Trp Trp Gly Ser Leu Leu Leu Leu 1 5 ctg ctg ctc gcg gcc gcg
gtg gcg gcg gct gct gag ccg gcg tcg acg 101Leu Leu Leu Ala Ala Ala
Val Ala Ala Ala Ala Glu Pro Ala Ser Thr 10 15 20 25 ctc acg ggc ccg
tca cgg ccg gtc acg gtg gcg ctg cgg gaa gac agg 149Leu Thr Gly Pro
Ser Arg Pro Val Thr Val Ala Leu Arg Glu Asp Arg 30 35 40 ggc cac
gcg gtg gac ctg ccg gac acg gac ccc cgg gtg cag cgc cgg 197Gly His
Ala Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg 45 50 55
gcc acg ggc tgg gct ccc gag cag atc gcc gtc gcg ctc tcc gcc gct
245Ala Thr Gly Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala
60 65 70 ccc acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag
atg ggc 293Pro Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln
Met Gly 75 80 85 ggc acc gtc aag ccg ctg gac ccc ggc acg gtc ggc
agc gtc gtg cgc 341Gly Thr Val Lys Pro Leu Asp Pro Gly Thr Val Gly
Ser Val Val Arg 90 95 100 105 tac ggg ctc gcc gcc gat tct ttg gtt
cgc cag gcc agc ggc gac gcg 389Tyr Gly Leu Ala Ala Asp Ser Leu Val
Arg Gln Ala Ser Gly Asp Ala 110 115 120 ctc gtg tac agc cag ctc tac
ccc ttc gag ggt ctc cag aac tac acc 437Leu Val Tyr Ser Gln Leu Tyr
Pro Phe Glu Gly Leu Gln Asn Tyr Thr 125 130 135 tcc ggc atc atc cac
cac gtc cgc ctc caa ggg ctt gag cct gcg acg 485Ser Gly Ile Ile His
His Val Arg Leu Gln Gly Leu Glu Pro Ala Thr 140 145 150 aag tac tac
tac cag tgc ggc gac ccg gcc ctc ccg ggg gcg atg agc 533Lys Tyr Tyr
Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Ala Met Ser 155 160 165 gcc
gtc cac gcg ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac 581Ala
Val His Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr 170 175
180 185 ccg ggg agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac
acc 629Pro Gly Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn
Thr 190 195 200 acc tcc acc gtg gac cac atg gcg agc aac cgg ccg gac
ctg gtc ctc 677Thr Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp
Leu Val Leu 205 210 215 ctc gtc ggc gac gtg tgc tac gcc aac atg tac
ctc acc aac ggc acc 725Leu Val Gly Asp Val Cys Tyr Ala Asn Met Tyr
Leu Thr Asn Gly Thr 220 225 230 gga gcg gac tgc tac tcg tgc gcg ttc
ggc aag tcg acg ccc atc cac 773Gly Ala Asp Cys Tyr Ser Cys Ala Phe
Gly Lys Ser Thr Pro Ile His 235 240 245 gag acg tac cag ccg cgc tgg
gac tac tgg gga agg tac atg gag gcg 821Glu Thr Tyr Gln Pro Arg Trp
Asp Tyr Trp Gly Arg Tyr Met Glu Ala 250 255 260 265 gtg acg tcg ggg
acg ccg atg atg gtg gtg gaa ggg aac cat gag ata 869Val Thr Ser Gly
Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile 270 275 280 gag gag
cag atc ggg aac aag acg ttc gcg gcc tac cgc tcc cgg ttc 917Glu Glu
Gln Ile Gly Asn Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe 285 290 295
gcg ttc ccg tcg acg gag agc ggg tcc ttc tcc ccc ttc tac tac tcg
965Ala Phe Pro Ser Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser
300 305 310 ttc gac gcc ggc ggg atc cat ttc ctc atg ctc ggc gcc tac
gcc gac 1013Phe Asp Ala Gly Gly Ile His Phe Leu Met Leu Gly Ala Tyr
Ala Asp 315 320 325 tac ggc agg tca ggg gag cag tac aga tgg ctg gag
aag gac ctg gcg 1061Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu
Lys Asp Leu Ala 330 335 340 345 aag gtg gac agg tcg gtg acg ccg tgg
ctg gtc gcc ggc tgg cac gcg 1109Lys Val Asp Arg Ser Val Thr Pro Trp
Leu Val Ala Gly Trp His Ala 350 355 360 cca tgg tac acc acc tac aag
gct cac tac agg gag gtg gag tgc atg 1157Pro Trp Tyr Thr Thr Tyr Lys
Ala His Tyr Arg Glu Val Glu Cys Met 365 370 375 aga gtg gcc atg gag
gag ctg ctc tac tcc cac ggc ctc gac atc gcc 1205Arg Val Ala Met Glu
Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala 380 385 390 ttc acc ggc
cat gtg cac gcg tat gag cgc tcc aac cgg gtg ttc aac 1253Phe Thr Gly
His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn 395 400 405 tac
acg ctg gac ccg tgc ggc gcc gtg cac atc tcg gtg ggc gac ggc 1301Tyr
Thr Leu Asp Pro Cys Gly Ala Val His Ile Ser Val Gly Asp Gly 410 415
420 425 ggg aac cgc gag aag atg gcc acc acc cac gcc gac gag ccg ggg
cac 1349Gly Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly
His 430 435 440 tgc ccg gac ccg cgg ccc aag ccc aac gcc ttc atc ggc
ggc ttc tgc 1397Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly
Gly Phe Cys 445 450 455 gcc tcc aac ttc acg tcc ggc ccg gcc gcc ggc
agg ttc tgc tgg gac 1445Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala Gly
Arg Phe Cys Trp Asp 460 465 470 cgg cag ccg gac tac agc gcc tac cgg
gag agc agc ttc ggc cac ggc 1493Arg Gln Pro Asp Tyr Ser Ala Tyr Arg
Glu Ser Ser Phe Gly His Gly 475 480 485 atc ctc gag gtg aag aac gag
acg cac gct ctg tgg aga tgg cac agg 1541Ile Leu Glu Val Lys Asn Glu
Thr His Ala Leu Trp Arg Trp His Arg 490 495 500 505 aac cag gac cac
tac ggg agc gcc gga gat gag att tac att gtc cgg 1589Asn Gln Asp His
Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg 510 515 520 gag ccg
cac agg tgc ttg cac aag cac aac tcg agc agg ccg gca cac 1637Glu Pro
His Arg Cys Leu His Lys His Asn Ser Ser Arg Pro Ala His 525 530 535
ggt cga tca aac acc aca cgg gaa tcg gga ggt taaccgttgt accactggag
1690Gly Arg Ser Asn Thr Thr Arg Glu Ser Gly Gly 540 545 tagatcgcgt
ggtgtaatgg caactgtata gacggttcgc ccaagcgtgg aaataaaaa 1749
18548PRTTriticum aestivum 18Met Trp Trp Gly Ser Leu Leu Leu Leu Leu
Leu Leu Ala Ala Ala Val 1 5 10 15 Ala Ala Ala Ala Glu Pro Ala Ser
Thr Leu Thr Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg
Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro
Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu 50 55 60 Gln Ile
Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80
Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asp 85
90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala Ala Asp
Ser 100 105 110 Leu Val Arg Gln Ala Ser Gly Asp Ala Leu Val Tyr Ser
Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly
Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Ala Thr
Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu Pro Gly
Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val
Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp
Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205
Ala Ser Asn Arg Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys Tyr 210
215 220 Ala Asn Met Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser
Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr
Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val
Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu
Ile Glu Glu Gln Ile Gly Asn Lys 275 280 285 Thr Phe Ala Ala Tyr Arg
Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser 290 295 300 Gly Ser Phe Ser
Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe
Leu Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Gln 325 330
335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser Val Thr
340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr
Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala
Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe
Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val
Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser
Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His
Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro
Asn Ala Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly 450 455
460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala
465 470
475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn
Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His
Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro
His Arg Cys Leu His 515 520 525 Lys His Asn Ser Ser Arg Pro Ala His
Gly Arg Ser Asn Thr Thr Arg 530 535 540 Glu Ser Gly Gly 545
191743DNATriticum aestivumTaPAPhy_a2 Phytase
cDNA(1)..(1743)CDS(22)..(1665)CDS encoding phytase 19ctctcaatgc
caagcaacac c atg tgg tgg ggg tcg ctg cgg ctg ctg ctg 51 Met Trp Trp
Gly Ser Leu Arg Leu Leu Leu 1 5 10 ctg ctc gcg gcg gcg gtg gcg gcg
gct gct gag ccg gcg tcg acg ctc 99Leu Leu Ala Ala Ala Val Ala Ala
Ala Ala Glu Pro Ala Ser Thr Leu 15 20 25 acc ggc ccg tcg cgg ccg
gtg acg gtg gcg ctg cgg aaa gac agg ggc 147Thr Gly Pro Ser Arg Pro
Val Thr Val Ala Leu Arg Lys Asp Arg Gly 30 35 40 cac gcg gtg gac
ctg ccg gac acg gac ccc cgg gtg cag cgc cgg gcc 195His Ala Val Asp
Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala 45 50 55 acg ggc
tgg gct ccc gag cag atc acc gtc gcg ctc tcc gcc gct ccc 243Thr Gly
Trp Ala Pro Glu Gln Ile Thr Val Ala Leu Ser Ala Ala Pro 60 65 70
acc tct gcc tgg gtc tcc tgg atc acc ggc gaa ttc cag atg ggc ggc
291Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly
75 80 85 90 acc gtc aag ccg ctg aac ccc ggc acg gtc gcc agc gtc gtg
cgc tac 339Thr Val Lys Pro Leu Asn Pro Gly Thr Val Ala Ser Val Val
Arg Tyr 95 100 105 ggg ctc gcc gcc gat tct ttg gtt cac gag gcc acc
ggc gac gcg ctc 387Gly Leu Ala Ala Asp Ser Leu Val His Glu Ala Thr
Gly Asp Ala Leu 110 115 120 gtg tac agc cag ctc tac ccc ttc gag ggc
ctc cag aac tac acc tcc 435Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly
Leu Gln Asn Tyr Thr Ser 125 130 135 ggc atc atc cac cac gtc cgc ctc
caa ggg ctt gag cct gcg acg aag 483Gly Ile Ile His His Val Arg Leu
Gln Gly Leu Glu Pro Ala Thr Lys 140 145 150 tac tac tac cag tgc ggc
gac ccg ggc atc ccg ggg gcg atg agc gcc 531Tyr Tyr Tyr Gln Cys Gly
Asp Pro Gly Ile Pro Gly Ala Met Ser Ala 155 160 165 170 gtc cac gcg
ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac ccg 579Val His Ala
Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro 175 180 185 ggg
agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acc 627Gly
Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr 190 195
200 tcg acc gtg gac cac atg gtc agc aac cgg ccc gac ctg gtc ctc ctc
675Ser Thr Val Asp His Met Val Ser Asn Arg Pro Asp Leu Val Leu Leu
205 210 215 gtc ggc gac gtg tgc tac gcc aac atg tac ctc acc aac ggc
acc gga 723Val Gly Asp Val Cys Tyr Ala Asn Met Tyr Leu Thr Asn Gly
Thr Gly 220 225 230 gcg gac tgc tac tcg tgc gcg ttc ggc aag tcg acg
ccc atc cac gag 771Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr
Pro Ile His Glu 235 240 245 250 acg tac cag ccg cgc tgg gac tac tgg
gga agg tac atg gag gcg gtg 819Thr Tyr Gln Pro Arg Trp Asp Tyr Trp
Gly Arg Tyr Met Glu Ala Val 255 260 265 acg tcg ggc acg ccg atg atg
gtg gtg gaa ggg aac cat gag ata gag 867Thr Ser Gly Thr Pro Met Met
Val Val Glu Gly Asn His Glu Ile Glu 270 275 280 gag cag atc ggc aac
aag acg ttc gcg gcc tac cgc tcc cgg ttc gcg 915Glu Gln Ile Gly Asn
Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala 285 290 295 ttc ccg tcg
acg gag agc ggc tcc ttc tcc ccc ttc tac tac tcg ttc 963Phe Pro Ser
Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe 300 305 310 gac
gcc ggc ggg atc cat ttc atc atg ctc gcc gcc tac gcc gat tac 1011Asp
Ala Gly Gly Ile His Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr 315 320
325 330 agc agg tca ggg gag cag tac aga tgg ctg gtg aag gac ctg gcg
aag 1059Ser Arg Ser Gly Glu Gln Tyr Arg Trp Leu Val Lys Asp Leu Ala
Lys 335 340 345 gtg gac agg gcg gtg acc ccc tgg ctg gtc gcc ggc tgg
cac gcg cca 1107Val Asp Arg Ala Val Thr Pro Trp Leu Val Ala Gly Trp
His Ala Pro 350 355 360 tgg tac acc acc tac aag gct cac tac agg gag
gtg gag tgc atg aga 1155Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu
Val Glu Cys Met Arg 365 370 375 gtg gcc atg gag gag ctg ctc tac tcc
cac ggc ctc gac atc gcc ttc 1203Val Ala Met Glu Glu Leu Leu Tyr Ser
His Gly Leu Asp Ile Ala Phe 380 385 390 acc ggc cat gtg cac gcg tac
gag cgc tcc aac cgg gtg ttc aac tac 1251Thr Gly His Val His Ala Tyr
Glu Arg Ser Asn Arg Val Phe Asn Tyr 395 400 405 410 acg ctg gac ccg
tgc ggc gcg gtg cac atc tcg gtg ggc gac ggc ggg 1299Thr Leu Asp Pro
Cys Gly Ala Val His Ile Ser Val Gly Asp Gly Gly 415 420 425 aac cgg
gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc 1347Asn Arg
Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys 430 435 440
ccg gac ccg cgg ccc aag ccc aac gcc ttc atc ggc tgc ttc tgc gcc
1395Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Cys Phe Cys Ala
445 450 455 ttc aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc tgg
gac cgg 1443Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys Trp
Asp Arg 460 465 470 cag ccg gac tac agc gcc tac cgg gag agc agc ttc
ggc cac ggc atc 1491Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe
Gly His Gly Ile 475 480 485 490 ctc gag gtg aag aac gag acg cac gct
ctg tgg aga tgg cac agg aac 1539Leu Glu Val Lys Asn Glu Thr His Ala
Leu Trp Arg Trp His Arg Asn 495 500 505 cag gac cac tac gga agc gcc
gga gat gag att tac att gtc cgg gag 1587Gln Asp His Tyr Gly Ser Ala
Gly Asp Glu Ile Tyr Ile Val Arg Glu 510 515 520 ccg cac agg tgc ttg
cac aag cac aac tcg acc agg ccg gca cac ggt 1635Pro His Arg Cys Leu
His Lys His Asn Ser Thr Arg Pro Ala His Gly 525 530 535 cga caa aac
acc aca cgg gaa tcg gga ggt taactgctgt actgctggag 1685Arg Gln Asn
Thr Thr Arg Glu Ser Gly Gly 540 545 tagatcgcgc ggtgtaatgg
caactttata gatgattcgc ccaagcgtgg aaataaaa 174320548PRTTriticum
aestivum 20Met Trp Trp Gly Ser Leu Arg Leu Leu Leu Leu Leu Ala Ala
Ala Val 1 5 10 15 Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly
Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu Arg Lys Asp Arg Gly
His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp Pro Arg Val Gln Arg
Arg Ala Thr Gly Trp Ala Pro Glu 50 55 60 Gln Ile Thr Val Ala Leu
Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70 75 80 Trp Ile Thr Gly
Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu Asn 85 90 95 Pro Gly
Thr Val Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110
Leu Val His Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115
120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His
Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr
Gln Cys Gly 145 150 155 160 Asp Pro Gly Ile Pro Gly Ala Met Ser Ala
Val His Ala Phe Arg Thr 165 170 175 Met Pro Ala Val Gly Pro Arg Ser
Tyr Pro Gly Arg Ile Ala Val Val 180 185 190 Gly Asp Leu Gly Leu Thr
Tyr Asn Thr Thr Ser Thr Val Asp His Met 195 200 205 Val Ser Asn Arg
Pro Asp Leu Val Leu Leu Val Gly Asp Val Cys Tyr 210 215 220 Ala Asn
Met Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys 225 230 235
240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp
245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr
Pro Met 260 265 270 Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln
Ile Gly Asn Lys 275 280 285 Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala
Phe Pro Ser Thr Glu Ser 290 295 300 Gly Ser Phe Ser Pro Phe Tyr Tyr
Ser Phe Asp Ala Gly Gly Ile His 305 310 315 320 Phe Ile Met Leu Ala
Ala Tyr Ala Asp Tyr Ser Arg Ser Gly Glu Gln 325 330 335 Tyr Arg Trp
Leu Val Lys Asp Leu Ala Lys Val Asp Arg Ala Val Thr 340 345 350 Pro
Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360
365 Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu
370 375 380 Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val
His Ala 385 390 395 400 Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr
Leu Asp Pro Cys Gly 405 410 415 Ala Val His Ile Ser Val Gly Asp Gly
Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr Thr His Ala Asp Glu Pro
Gly His Cys Pro Asp Pro Arg Pro Lys 435 440 445 Pro Asn Ala Phe Ile
Gly Cys Phe Cys Ala Phe Asn Phe Thr Ser Gly 450 455 460 Pro Ala Ala
Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala 465 470 475 480
Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu 485
490 495 Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His Tyr Gly
Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg
Cys Leu His 515 520 525 Lys His Asn Ser Thr Arg Pro Ala His Gly Arg
Gln Asn Thr Thr Arg 530 535 540 Glu Ser Gly Gly 545
211734DNATriticum aestivumTaPAPhy_a3 phytase
cDNA(1)..(1734)CDS(22)..(1638)phytase coding sequence 21ctgtcaatac
caagcaacaa c atg tgg tgg ggg tcg ctg cgg ctg ctg ctg 51 Met Trp Trp
Gly Ser Leu Arg Leu Leu Leu 1 5 10 ctg ctc gcg gcg gcg gtg gcg gcg
gct gct gag cca gcg tcg acg ctc 99Leu Leu Ala Ala Ala Val Ala Ala
Ala Ala Glu Pro Ala Ser Thr Leu 15 20 25 acg ggg ccg tcg cgg ccg
gtg acg gtg acg ctt cgg gaa gac agg ggc 147Thr Gly Pro Ser Arg Pro
Val Thr Val Thr Leu Arg Glu Asp Arg Gly 30 35 40 cac gcg gtg gac
ctg ccg gac acg gac ccc cgg gtg cag cgc cgg gcc 195His Ala Val Asp
Leu Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala 45 50 55 acg ggc
tgg gct ccc gag cag atc gcc gtc gcg ctc tcc gcc gct ccc 243Thr Gly
Trp Ala Pro Glu Gln Ile Ala Val Ala Leu Ser Ala Ala Pro 60 65 70
acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag atg ggc ggc
291Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly
75 80 85 90 acc gtc aag ccg ctg gac ccc ggc acg gtc gcc agc gtc gtg
cgc tac 339Thr Val Lys Pro Leu Asp Pro Gly Thr Val Ala Ser Val Val
Arg Tyr 95 100 105 ggg ctc gcc gcc gat tct ttg gtt cgc cag gcc acc
ggc gac gcg ctc 387Gly Leu Ala Ala Asp Ser Leu Val Arg Gln Ala Thr
Gly Asp Ala Leu 110 115 120 gtg tac agc cag ctc tac ccc ttc gag ggc
ctc cag aac tac acc tcc 435Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly
Leu Gln Asn Tyr Thr Ser 125 130 135 ggc atc atc cac cac gtc cgc ctc
caa ggg ctt gag cct gcg acg aag 483Gly Ile Ile His His Val Arg Leu
Gln Gly Leu Glu Pro Ala Thr Lys 140 145 150 tac tac tac cag tgt ggc
gac ccg gcc ctc ccg ggg gcg atg agc gcc 531Tyr Tyr Tyr Gln Cys Gly
Asp Pro Ala Leu Pro Gly Ala Met Ser Ala 155 160 165 170 gtc cac gcg
ttc cgg acg atg ccg gcg gtg ggg ccg cgg agc tac ccg 579Val His Ala
Phe Arg Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro 175 180 185 ggg
agg atc gcc gtg gtg gga gac ctc ggg ctc acg tac aac acc acg 627Gly
Arg Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr 190 195
200 tcg acc gtg gac cac atg gcg agc aac cgg ccg gac ctg gtc ctc ctc
675Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp Leu Val Leu Leu
205 210 215 ctc ggt gac gtc agc tac gcc aac ctg tac ctc acc aac ggc
acc gga 723Leu Gly Asp Val Ser Tyr Ala Asn Leu Tyr Leu Thr Asn Gly
Thr Gly 220 225 230 gcg gac tgc tac tcg tgc gcg ttc ggc aag tcc acg
ccc atc cac gag 771Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr
Pro Ile His Glu 235 240 245 250 acg tac cag ccg cgc tgg gac tac tgg
gga agg tac atg gag gcg gtg 819Thr Tyr Gln Pro Arg Trp Asp Tyr Trp
Gly Arg Tyr Met Glu Ala Val 255 260 265 acg tcg ggg acg ccg atg gtg
gtg gtg gag ggg aac cat gag ata gag 867Thr Ser Gly Thr Pro Met Val
Val Val Glu Gly Asn His Glu Ile Glu 270 275 280 gag cag atc ggc aac
aag acg ttc gcg gcc tac cgc tcc cgg ttc gcg 915Glu Gln Ile Gly Asn
Lys Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala 285 290 295 ttc ccg tcg
acg gag agc ggg tcc ttc tcc ccc ttc tac tac tcg ttc 963Phe Pro Ser
Thr Glu Ser Gly Ser Phe Ser Pro Phe Tyr Tyr Ser Phe 300 305 310 gac
gcc ggg ggg atc cat ttc gtc atg ctc ggc gcc tac gcc gac tac 1011Asp
Ala Gly Gly Ile His Phe Val Met Leu Gly Ala Tyr Ala Asp Tyr 315 320
325 330 ggc agg tca ggg gag cag tac aga tgg ctc gag aag gac ctg gcg
aag 1059Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ala
Lys 335 340 345 gtg gac agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg
cac gcg cca 1107Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp
His Ala Pro 350 355 360 tgg tac acc acc tat aag gct cac tac agg gag
gtg gag tgc atg aga 1155Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu
Val Glu Cys Met Arg 365 370 375 gtg gcc atg gag gag ctg ctc tac tcc
cac ggc ctc gac atc gcc ttc 1203Val Ala Met Glu Glu Leu Leu Tyr Ser
His Gly Leu Asp Ile Ala Phe 380 385 390
acc ggc cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac tac
1251Thr Gly His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr
395 400 405 410 acg ctg gac ccg tgc ggc gcc gtg cac atc tcg gtg ggc
gac ggc ggg 1299Thr Leu Asp Pro Cys Gly Ala Val His Ile Ser Val Gly
Asp Gly Gly 415 420 425 aac cgc gag aag atg gcc acc acc cac gcc gac
gag ccg ggg cac tgc 1347Asn Arg Glu Lys Met Ala Thr Thr His Ala Asp
Glu Pro Gly His Cys 430 435 440 ccg gaa ccg cgg gcc aag ccc aac gcc
ttc atc ggc ggc ttc tgc gcc 1395Pro Glu Pro Arg Ala Lys Pro Asn Ala
Phe Ile Gly Gly Phe Cys Ala 445 450 455 ttt aac ttc acg tcc ggc ccg
gcc gcc ggc agg ttc tgc tgg gac cgg 1443Phe Asn Phe Thr Ser Gly Pro
Ala Ala Gly Arg Phe Cys Trp Asp Arg 460 465 470 cag ccg gac tac agc
gcc tac cgg gag agc agc ttc ggc cac ggc atc 1491Gln Pro Asp Tyr Ser
Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile 475 480 485 490 ctc gag
gtg aag aac gag acg cac gct ctg tgg aga tgg cac agg aac 1539Leu Glu
Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His Arg Asn 495 500 505
cag gac atg tac ggg agc gcc gga gat gag att tac att gtc cgg gag
1587Gln Asp Met Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu
510 515 520 ccc cac agg tgc ttg cac aaa cac aac tcg acc agg ccg aca
cac ggt 1635Pro His Arg Cys Leu His Lys His Asn Ser Thr Arg Pro Thr
His Gly 525 530 535 cga taaaacatca cacgggaatc tggaggtact actggagtaa
acctcccggt 1688Arg gtaataatgg caactattga cggttcgtcc aagcgtggaa
ataaaa 173422539PRTTriticum aestivum 22Met Trp Trp Gly Ser Leu Arg
Leu Leu Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Ala Ala Ala Ala Glu
Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro 20 25 30 Val Thr Val
Thr Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp
Thr Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro Glu 50 55
60 Gln Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser
65 70 75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro
Leu Asp 85 90 95 Pro Gly Thr Val Ala Ser Val Val Arg Tyr Gly Leu
Ala Ala Asp Ser 100 105 110 Leu Val Arg Gln Ala Thr Gly Asp Ala Leu
Val Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr
Thr Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu
Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala
Leu Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met
Pro Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185
190 Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met
195 200 205 Ala Ser Asn Arg Pro Asp Leu Val Leu Leu Leu Gly Asp Val
Ser Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp
Cys Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His
Glu Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met
Glu Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Val Val Val Glu Gly
Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys 275 280 285 Thr Phe Ala
Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thr Glu Ser 290 295 300 Gly
Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310
315 320 Phe Val Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu
Gln 325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg
Ser Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp
Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met
Arg Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp
Ile Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser
Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val
His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430
Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Glu Pro Arg Ala Lys 435
440 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala Phe Asn Phe Thr Ser
Gly 450 455 460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp
Tyr Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile
Leu Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His
Arg Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr
Ile Val Arg Glu Pro His Arg Cys Leu His 515 520 525 Lys His Asn Ser
Thr Arg Pro Thr His Gly Arg 530 535 231730DNATriticum
monococcumTmPAPhy_a1 phytase cDNA(1)..(1730)CDS(17)..(1651)Phytase
coding sequence 23aatgccaagc aacgcc atg tgg tgg ggg gcg ctg cag ctg
ctg ctg ctg ctc 52 Met Trp Trp Gly Ala Leu Gln Leu Leu Leu Leu Leu
1 5 10 gtg gcg gcg gct gct gag ccg gcg tcg acg ctc acc ggc ccg tcg
cgg 100Val Ala Ala Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser
Arg 15 20 25 ccg gtg acg gtg gcg ctg cgg aaa gac agg ggc cac gcg
gtg gac ctg 148Pro Val Thr Val Ala Leu Arg Lys Asp Arg Gly His Ala
Val Asp Leu 30 35 40 ccg gac acg gac ccc cgg gtg cag cgc cgg gcc
acg ggc tgg gct ccc 196Pro Asp Thr Asp Pro Arg Val Gln Arg Arg Ala
Thr Gly Trp Ala Pro 45 50 55 60 gag cag atc acc gtc gcg ctc tcc gcc
gct ccc acc tct gcc tgg gtc 244Glu Gln Ile Thr Val Ala Leu Ser Ala
Ala Pro Thr Ser Ala Trp Val 65 70 75 tcc tgg atc acc ggg gaa ttc
cag atg ggc ggc aca gtc aag ccg ctg 292Ser Trp Ile Thr Gly Glu Phe
Gln Met Gly Gly Thr Val Lys Pro Leu 80 85 90 cac ccc ggc acg gtc
gcc agc gtc gtg cgc tac ggg ctc gcc gcc gat 340His Pro Gly Thr Val
Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp 95 100 105 tct ttg gtt
cgc gag gcc acc ggc gac gcg ctt gtg tac agc cag ctc 388Ser Leu Val
Arg Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu 110 115 120 tac
ccc ttc gag ggc ctc cag aac tac acc tcc ggc atc atc cac cac 436Tyr
Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His 125 130
135 140 gtc cgc ctc caa ggg ctt gag cct gcg acg aag tac tac tac cag
tgc 484Val Arg Leu Gln Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln
Cys 145 150 155 ggc gac ccg ggc atc ccg ggg gcg atg agc gcc gtc cac
gcg ttc cgg 532Gly Asp Pro Gly Ile Pro Gly Ala Met Ser Ala Val His
Ala Phe Arg 160 165 170 acg atg ccg gcg gtg ggg ccg cgg agc tac ccg
ggg agg atc gcc gtg 580Thr Met Pro Ala Val Gly Pro Arg Ser Tyr Pro
Gly Arg Ile Ala Val 175 180 185 gtg gga gac ctc ggg ctc acg tac aac
acc acc tcc acc gtg gac cac 628Val Gly Asp Leu Gly Leu Thr Tyr Asn
Thr Thr Ser Thr Val Asp His 190 195 200 atg gtc agc aac cgg ccg gac
ctg gtc ctc ctc gtc ggc gac gtg tgc 676Met Val Ser Asn Arg Pro Asp
Leu Val Leu Leu Val Gly Asp Val Cys 205 210 215 220 tac gcc aac atg
tac ctc acc aac ggc acc gga gcg gac tgc tac tcg 724Tyr Ala Asn Met
Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser 225 230 235 tgc gcg
ttc ggc aag tcg acg ccc atc cac gag acg tac cag ccg cgc 772Cys Ala
Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg 240 245 250
tgg gac tac tgg gga agg tac atg gag gcg gtg acg tcg ggg acg ccg
820Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro
255 260 265 atg atg gtg gtg gaa ggg aac cat gag atc gag gag cag atc
cgc aac 868Met Met Val Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile
Arg Asn 270 275 280 agg acg ttc gcg gcc tac cgc tcc cgg ttc gcg ttc
ccg tcg acg gag 916Arg Thr Phe Ala Ala Tyr Arg Ser Arg Phe Ala Phe
Pro Ser Thr Glu 285 290 295 300 agc ggc tcc ttc tcc ccc ttc tac tac
tcc ttc gac gcc ggc ggg atc 964Ser Gly Ser Phe Ser Pro Phe Tyr Tyr
Ser Phe Asp Ala Gly Gly Ile 305 310 315 cat ttc gtc atg ctc gcc gcg
tac gcc gac tac agc agg tca ggg gag 1012His Phe Val Met Leu Ala Ala
Tyr Ala Asp Tyr Ser Arg Ser Gly Glu 320 325 330 cag tac aga tgg ctg
aag aag gac ctg gcg aag gtg gac agg gcg gtg 1060Gln Tyr Arg Trp Leu
Lys Lys Asp Leu Ala Lys Val Asp Arg Ala Val 335 340 345 acc ccc tgg
ctg gtc gcc ggc tgg cac gcg cca tgg tac acc acc tac 1108Thr Pro Trp
Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr 350 355 360 aag
gct cac tac agg gag gtg gag tgc atg aga gtg gcc atg gag gag 1156Lys
Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu 365 370
375 380 ctg ctc tac tcc cac ggc ctc gac atc gcc ttc acc ggc cat gtg
cac 1204Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr Gly His Val
His 385 390 395 gcg tac gag cgc tcc aac cgg gtg ttc aac tac acg ctg
gac ccg tgc 1252Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu
Asp Pro Cys 400 405 410 ggc gcg gtg cac atc tcg gtg ggc gac ggc ggg
aac cgg gag aag atg 1300Gly Ala Val His Ile Ser Val Gly Asp Gly Gly
Asn Arg Glu Lys Met 415 420 425 gcc acc acc cac gcc gac gag ccg ggg
cac tgc ccg gac ccg cgg ccc 1348Ala Thr Thr His Ala Asp Glu Pro Gly
His Cys Pro Asp Pro Arg Pro 430 435 440 aag ccc aac gcc ttc atc ggc
ggc ttc tgc gcc tcc aac ttc acg tcc 1396Lys Pro Asn Ala Phe Ile Gly
Gly Phe Cys Ala Ser Asn Phe Thr Ser 445 450 455 460 ggc ccg gcc gcc
ggc agg ttc tgc tgg gac cgg cag ccg gac tac agc 1444Gly Pro Ala Ala
Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser 465 470 475 gcc tac
cgg gaa agc agc ttc ggc cac ggc atc ctc gag gtg aag aac 1492Ala Tyr
Arg Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn 480 485 490
gag acg cac gct ctg tgg aga tgg cac agg aac cag gac cac tac gga
1540Glu Thr His Ala Leu Trp Arg Trp His Arg Asn Gln Asp His Tyr Gly
495 500 505 agc gcc gga gat gag att tac att gtc cgg gag ccg cac agg
tgc ttg 1588Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg
Cys Leu 510 515 520 cac aag cac aac tcg acc agg ccg gca cac ggt cga
caa aac acc aca 1636His Lys His Asn Ser Thr Arg Pro Ala His Gly Arg
Gln Asn Thr Thr 525 530 535 540 cgg gaa tcg gga ggc taactgctgt
actgctggag tagatcgcgc ggtgtaatgg 1691Arg Glu Ser Gly Gly 545
caactatata gacggttcgc ccaagcgtgg aaataaaaa 173024545PRTTriticum
monococcum 24Met Trp Trp Gly Ala Leu Gln Leu Leu Leu Leu Leu Val
Ala Ala Ala 1 5 10 15 Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser
Arg Pro Val Thr Val 20 25 30 Ala Leu Arg Lys Asp Arg Gly His Ala
Val Asp Leu Pro Asp Thr Asp 35 40 45 Pro Arg Val Gln Arg Arg Ala
Thr Gly Trp Ala Pro Glu Gln Ile Thr 50 55 60 Val Ala Leu Ser Ala
Ala Pro Thr Ser Ala Trp Val Ser Trp Ile Thr 65 70 75 80 Gly Glu Phe
Gln Met Gly Gly Thr Val Lys Pro Leu His Pro Gly Thr 85 90 95 Val
Ala Ser Val Val Arg Tyr Gly Leu Ala Ala Asp Ser Leu Val Arg 100 105
110 Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu
115 120 125 Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val Arg
Leu Gln 130 135 140 Gly Leu Glu Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys
Gly Asp Pro Gly 145 150 155 160 Ile Pro Gly Ala Met Ser Ala Val His
Ala Phe Arg Thr Met Pro Ala 165 170 175 Val Gly Pro Arg Ser Tyr Pro
Gly Arg Ile Ala Val Val Gly Asp Leu 180 185 190 Gly Leu Thr Tyr Asn
Thr Thr Ser Thr Val Asp His Met Val Ser Asn 195 200 205 Arg Pro Asp
Leu Val Leu Leu Val Gly Asp Val Cys Tyr Ala Asn Met 210 215 220 Tyr
Leu Thr Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly 225 230
235 240 Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr
Trp 245 250 255 Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met
Met Val Val 260 265 270 Glu Gly Asn His Glu Ile Glu Glu Gln Ile Arg
Asn Arg Thr Phe Ala 275 280 285 Ala Tyr Arg Ser Arg Phe Ala Phe Pro
Ser Thr Glu Ser Gly Ser Phe 290 295 300 Ser Pro Phe Tyr Tyr Ser Phe
Asp Ala Gly Gly Ile His Phe Val Met 305 310 315 320 Leu Ala Ala Tyr
Ala Asp Tyr Ser Arg Ser Gly Glu Gln Tyr Arg Trp 325 330 335 Leu Lys
Lys Asp Leu Ala Lys Val Asp Arg Ala Val Thr Pro Trp Leu 340 345 350
Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr 355
360 365 Arg Glu Val Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr
Ser 370 375 380 His Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala
Tyr Glu Arg 385 390 395 400 Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp
Pro Cys Gly Ala Val His 405 410 415 Ile Ser Val Gly Asp Gly Gly Asn
Arg Glu Lys Met Ala Thr Thr His 420 425 430 Ala Asp Glu Pro Gly His
Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala 435 440 445 Phe Ile Gly Gly
Phe Cys Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala 450 455 460 Gly Arg
Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu 465 470 475
480 Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu Thr His Ala
485 490 495 Leu Trp Arg Trp His Arg Asn Gln Asp His
Tyr Gly Ser Ala Gly Asp 500 505 510 Glu Ile Tyr Ile Val Arg Glu Pro
His Arg Cys Leu His Lys His Asn 515 520 525 Ser Thr Arg Pro Ala His
Gly Arg Gln Asn Thr Thr Arg Glu Ser Gly 530 535 540 Gly 545
251744DNASecale cerealeScPAPhy_a1 phytase
cDNA(1)..(1744)CDS(17)..(1639) 25aatgccaagc aacaac atg tgg cgg ggg
tcg ctg cgg ctg ctg ctg ctg ctc 52 Met Trp Arg Gly Ser Leu Arg Leu
Leu Leu Leu Leu 1 5 10 gcg gcg gcg gtg acg gcg gct gct gag ccg ggg
tcg acg ctc atg ggc 100Ala Ala Ala Val Thr Ala Ala Ala Glu Pro Gly
Ser Thr Leu Met Gly 15 20 25 ccg tca cgg ccg gtt acg gtg gcg ctg
cgg gaa gac agg ggc cac gcg 148Pro Ser Arg Pro Val Thr Val Ala Leu
Arg Glu Asp Arg Gly His Ala 30 35 40 gtg gac ctg ccg gac acg gac
ccg cgg gtg cag cgc cgg gca aat ggc 196Val Asp Leu Pro Asp Thr Asp
Pro Arg Val Gln Arg Arg Ala Asn Gly 45 50 55 60 tgg gct cct gag cag
atc gcc gtc gcg ctc tcc gct gct ccc acc tct 244Trp Ala Pro Glu Gln
Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser 65 70 75 gcc tgg gtc
tcc tgg atc aca ggg gaa ttc cag atg ggc ggc acc gtc 292Ala Trp Val
Ser Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val 80 85 90 aag
ccg ctg gac ccc ggc acg gtc ggt agc gtc gtg cgc tac ggg ctc 340Lys
Pro Leu Asp Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu 95 100
105 gcc gcc gat tct ttg gtt cgt gtg gcc acc ggc gac gcg ctc gtg tac
388Ala Ala Asp Ser Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr
110 115 120 agc cag ctc tac cca ttc gag ggc ctc cag aac tac acc tcc
ggc atc 436Ser Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser
Gly Ile 125 130 135 140 atc cac cac gtc cgc ctc caa ggg ctt gag cct
ggg acg aag tac tac 484Ile His His Val Arg Leu Gln Gly Leu Glu Pro
Gly Thr Lys Tyr Tyr 145 150 155 tac cag tgc ggc gac ccg gcc ctc ccg
ggg gcg atg agc gcc gtc cac 532Tyr Gln Cys Gly Asp Pro Ala Leu Pro
Gly Ala Met Ser Ala Val His 160 165 170 gcg ttc cgg acg atg ccg gcg
gtg ggg ccg cgg agc tac ccg ggg agg 580Ala Phe Arg Thr Met Pro Ala
Val Gly Pro Arg Ser Tyr Pro Gly Arg 175 180 185 atc gcc gtg gtg gga
gac ctc ggg ctc acg tac aac acc acc tcc acc 628Ile Ala Val Val Gly
Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr 190 195 200 gtg gac cac
atg gtg agc aac cgg ccg gac ctg gtg gtc ctc gtc ggc 676Val Asp His
Met Val Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly 205 210 215 220
gac gtg agc tac gcc aac ctg tac ctc acc aac ggc acc gga gcg gac
724Asp Val Ser Tyr Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp
225 230 235 tgc tac tcg tgc gcg ttc ggc aag tcg acg ccc atc cac gag
acg tac 772Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu
Thr Tyr 240 245 250 cag ccg cgc tgg gac tac tgg ggg agg tac atg gag
gcg gtg acg tcg 820Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu
Ala Val Thr Ser 255 260 265 ggg acg ccg atg atg gtg gtg gag ggg aac
cat gag ata gag gag cag 868Gly Thr Pro Met Met Val Val Glu Gly Asn
His Glu Ile Glu Glu Gln 270 275 280 atc ggt aaa aag acg ttc gag gcg
tac cgc tcc cgg ttc gcg ttc ccg 916Ile Gly Lys Lys Thr Phe Glu Ala
Tyr Arg Ser Arg Phe Ala Phe Pro 285 290 295 300 tcg gcg gag agc ggg
tcc ttc tcc ccc ttc tac tac tcc ttc gac gcc 964Ser Ala Glu Ser Gly
Ser Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala 305 310 315 ggc ggg atc
cat ttc atc atg ctc gcc gcc tac gac gac tac agc agg 1012Gly Gly Ile
His Phe Ile Met Leu Ala Ala Tyr Asp Asp Tyr Ser Arg 320 325 330 tca
gga gag cag tac cga tgg ctg gag aag gac ctg tcg aag gtg gac 1060Ser
Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp Leu Ser Lys Val Asp 335 340
345 agg tcg gtg acg ccg tgg ctg gtc gcc ggc tgg cac gcg cca tgg tac
1108Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr
350 355 360 acc acc tac aag gct cac tac agg gag gtg gag tgc atg aga
gtg tcc 1156Thr Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg
Val Ser 365 370 375 380 atg gag gag ctg ctc tac tcc cac ggc ctc gac
atc gcc ttc acc ggc 1204Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp
Ile Ala Phe Thr Gly 385 390 395 cat gtg cac gcg tac gag cgc tcc aac
cgg gtg ttc aac tac acg ctg 1252His Val His Ala Tyr Glu Arg Ser Asn
Arg Val Phe Asn Tyr Thr Leu 400 405 410 gac ccg tgc ggt gcc gtg cac
atc tcg gtg ggc gac ggc ggg aac cgc 1300Asp Pro Cys Gly Ala Val His
Ile Ser Val Gly Asp Gly Gly Asn Arg 415 420 425 gag aag atg gcc acc
acc cac gcc gac gag ccg ggg cac tgc ccg gac 1348Glu Lys Met Ala Thr
Thr His Ala Asp Glu Pro Gly His Cys Pro Asp 430 435 440 ccg cgg ccc
aag ccc aac gcc ttc atc ggc ggc ttc tgc ggc ttt aac 1396Pro Arg Pro
Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn 445 450 455 460
ttc acg tcc ggc ccg gcc gcc gga agg tac tgc tgg gac cgg cag ccg
1444Phe Thr Ser Gly Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro
465 470 475 gac tac agc gcc tac cgg gag agc agc ttt ggc cac ggc atc
ctc gag 1492Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly His Gly Ile
Leu Glu 480 485 490 gtg aag aac gag acg cac gct ctg tgg aga tgg cac
agg aac cag gac 1540Val Lys Asn Glu Thr His Ala Leu Trp Arg Trp His
Arg Asn Gln Asp 495 500 505 atg tac ggg agc gcc gga gat gag att tac
att gtc cgg gag ccg gag 1588Met Tyr Gly Ser Ala Gly Asp Glu Ile Tyr
Ile Val Arg Glu Pro Glu 510 515 520 agg tgc ttg cac aag cac aag cac
aac tcg acc agg ccg gca cac ggc 1636Arg Cys Leu His Lys His Lys His
Asn Ser Thr Arg Pro Ala His Gly 525 530 535 540 cga taaacaccac
gcgggaatcg ggaggttaac tgctgtactg ctggagtaga 1689Arg tcgcgcggtg
taatgacaac tatatagacg gttcgccaaa gcgtggaaat aaaaa
174426541PRTSecale cereale 26Met Trp Arg Gly Ser Leu Arg Leu Leu
Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Thr Ala Ala Ala Glu Pro Gly
Ser Thr Leu Met Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu
Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp
Pro Arg Val Gln Arg Arg Ala Asn Gly Trp Ala Pro Glu 50 55 60 Gln
Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70
75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu
Asp 85 90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala
Ala Asp Ser 100 105 110 Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val
Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr
Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro
Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu
Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro
Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190
Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195
200 205 Val Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly Asp Val Ser
Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys
Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu
Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu
Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn
His Glu Ile Glu Glu Gln Ile Gly Lys Lys 275 280 285 Thr Phe Glu Ala
Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser 290 295 300 Gly Ser
Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315
320 Phe Ile Met Leu Ala Ala Tyr Asp Asp Tyr Ser Arg Ser Gly Glu Gln
325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ser Lys Val Asp Arg Ser
Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr
Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg
Val Ser Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile
Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn
Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His
Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr
Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440
445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn Phe Thr Ser Gly
450 455 460 Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro Asp Tyr
Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu
Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg
Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile
Val Arg Glu Pro Glu Arg Cys Leu His 515 520 525 Lys His Lys His Asn
Ser Thr Arg Pro Ala His Gly Arg 530 535 540 271734DNASecale
cerealeScPAPhy_a2 phytase cDNA(1)..(1734)CDS(14)..(1630)Phytase
coding sequence 27aatgccaagc aac atg tgg ctg ggg tcg ctg cgg ctg
ctg ctg ctg ctc 49 Met Trp Leu Gly Ser Leu Arg Leu Leu Leu Leu Leu
1 5 10 gcg gcg gcg gtg acg gcg gct gct gag ccg gcg tcc acg ctc atg
ggc 97Ala Ala Ala Val Thr Ala Ala Ala Glu Pro Ala Ser Thr Leu Met
Gly 15 20 25 ccg tca cgg ccg gtt acg gtg gcg ctg cgg gaa gac agg
ggc cac gcg 145Pro Ser Arg Pro Val Thr Val Ala Leu Arg Glu Asp Arg
Gly His Ala 30 35 40 gtg gac ctg ccg gac acg gac ccg cgg gtg cag
cgc cgg gca aat ggc 193Val Asp Leu Pro Asp Thr Asp Pro Arg Val Gln
Arg Arg Ala Asn Gly 45 50 55 60 tgg gct cct gag cag atc gcc gtc gcg
ctc tcc gct gct ccc acc tct 241Trp Ala Pro Glu Gln Ile Ala Val Ala
Leu Ser Ala Ala Pro Thr Ser 65 70 75 gcc tgg gtc tcc tgg atc acc
ggg gaa ttc cag atg ggt ggc acc gtc 289Ala Trp Val Ser Trp Ile Thr
Gly Glu Phe Gln Met Gly Gly Thr Val 80 85 90 aag ccg ctg gac ccc
ggc acg gtc ggt agc gtc gtg cgc tac gga ctc 337Lys Pro Leu Asp Pro
Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu 95 100 105 gcc gcc gat
tct ttg gtt cgc gtg gcc acc ggc gac gcg ctc gtg tac 385Ala Ala Asp
Ser Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val Tyr 110 115 120 agc
cag ctc tac ccc ttc gag ggc ctc cag aac tac acc tcc ggc atc 433Ser
Gln Leu Tyr Pro Phe Glu Gly Leu Gln Asn Tyr Thr Ser Gly Ile 125 130
135 140 atc cac cac gtc cgc ctc caa ggg ctt gag cct ggg acg aag tac
tac 481Ile His His Val Arg Leu Gln Gly Leu Glu Pro Gly Thr Lys Tyr
Tyr 145 150 155 tac cag tgc ggc gac ccg gcc ctc ccg ggg acg atg agc
gcc gtc cac 529Tyr Gln Cys Gly Asp Pro Ala Leu Pro Gly Thr Met Ser
Ala Val His 160 165 170 gcg ttc cgg acg atg ccg gcg gtc ggg ccg cgg
agc tac ccg ggg agg 577Ala Phe Arg Thr Met Pro Ala Val Gly Pro Arg
Ser Tyr Pro Gly Arg 175 180 185 atc gcc gtg gtg gga gac ctc ggg ctc
acg tac aac acc acc tcc acc 625Ile Ala Val Val Gly Asp Leu Gly Leu
Thr Tyr Asn Thr Thr Ser Thr 190 195 200 gtg gac cac atg atg agc aac
cgg ccg gat ctg gtc gtc ctc gtc ggc 673Val Asp His Met Met Ser Asn
Arg Pro Asp Leu Val Val Leu Val Gly 205 210 215 220 gac gtg agc tac
gcc aac ctg tac ctc acc aac ggc acc gga gcg gac 721Asp Val Ser Tyr
Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp 225 230 235 tgc tac
tcg tgc gcg ttc ggc aag tcg acg ccc atc cac gag acg tac 769Cys Tyr
Ser Cys Ala Phe Gly Lys Ser Thr Pro Ile His Glu Thr Tyr 240 245 250
cag ccg cgc tgg gac tac tgg gga agg tac atg gag gcg gtg acg tcg
817Gln Pro Arg Trp Asp Tyr Trp Gly Arg Tyr Met Glu Ala Val Thr Ser
255 260 265 ggc acg ccg atg atg gtg gtg gag ggg aac cat gag ata gag
gag cag 865Gly Thr Pro Met Met Val Val Glu Gly Asn His Glu Ile Glu
Glu Gln 270 275 280 atc ggc aaa aag acg ttc gag gcg tac cgc tcc cgg
ttc gcg ttt ccg 913Ile Gly Lys Lys Thr Phe Glu Ala Tyr Arg Ser Arg
Phe Ala Phe Pro 285 290 295 300 tcg gcg gag aac ggg tcc ttc tcc ccc
ttc tac tac tcc ttc gac gcc 961Ser Ala Glu Asn Gly Ser Phe Ser Pro
Phe Tyr Tyr Ser Phe Asp Ala 305 310 315 ggc ggg atc cat ttc atc atg
ctc gcc gcc tac gcc gac tac agc aag 1009Gly Gly Ile His Phe Ile Met
Leu Ala Ala Tyr Ala Asp Tyr Ser Lys 320 325 330 tca ggg gag cag tac
aga tgg ctg gag aag gac ctg gca aag gtg gac 1057Ser Gly Glu Gln Tyr
Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp 335 340 345 agg tcg gtg
acg ccg tgg ctg gtc gcc ggc tgg cac gcg cca tgg tac 1105Arg Ser Val
Thr Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr 350 355 360 acc
acc tac aag gct cac tac agg gag gtg gag tgc atg aga gtg gcc 1153Thr
Thr Tyr Lys Ala His Tyr Arg Glu Val Glu Cys Met Arg Val Ala 365 370
375 380 atg gag gag ctg ctc tac tcc cac ggc ctg gac atc gct ttc acc
ggc 1201Met Glu Glu Leu Leu Tyr Ser His Gly Leu Asp Ile Ala Phe Thr
Gly 385 390 395 cat gtg cac gcg tac gag cgc tcc aac cgg gtg ttc aac
tac acg ctg 1249His Val His Ala Tyr Glu Arg Ser Asn Arg Val Phe Asn
Tyr Thr Leu 400 405 410 gat ccg tgc ggc gcc gtg cac atc tcg gtg ggc
gac ggc ggg aac cgc 1297Asp Pro Cys Gly Ala Val His Ile Ser Val Gly
Asp Gly Gly Asn Arg 415 420 425
gag aag atg gcc acc acc cac gcc gac gag ccg ggg cac tgc ccg gac
1345Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro Gly His Cys Pro Asp
430 435 440 ccg cgg ccc aag ccc aac gcc ttc atc ggc ggc ttc tgc ggc
ttt aac 1393Pro Arg Pro Lys Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly
Phe Asn 445 450 455 460 ttc acg tcc ggc ccg gcc gcc ggc agg tac tgc
tgg gac cgg cag ccg 1441Phe Thr Ser Gly Pro Ala Ala Gly Arg Tyr Cys
Trp Asp Arg Gln Pro 465 470 475 gac tac agc gcc tac cgg gag agc agc
ttc ggc cac ggc atc ctc gag 1489Asp Tyr Ser Ala Tyr Arg Glu Ser Ser
Phe Gly His Gly Ile Leu Glu 480 485 490 gtg aag aac gag acg cac gct
ctg tgg aga tgg cac agg aac cag gac 1537Val Lys Asn Glu Thr His Ala
Leu Trp Arg Trp His Arg Asn Gln Asp 495 500 505 atg tac ggg agc gcc
gga gat gag att tac att gtc cgg gag ccg gag 1585Met Tyr Gly Ser Ala
Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu 510 515 520 agg tgc ttg
cac aag cac aac tcg acc agg ccg gca cac ggc cga 1630Arg Cys Leu His
Lys His Asn Ser Thr Arg Pro Ala His Gly Arg 525 530 535 taaacaccac
gcgggaatcg ggagcttaac tgctgtactg ctggagtaga tcgcgcggtg
1690taatgataac tatatagacg gttcgcccaa gcgtggaaat aaaa
173428539PRTSecale cereale 28Met Trp Leu Gly Ser Leu Arg Leu Leu
Leu Leu Leu Ala Ala Ala Val 1 5 10 15 Thr Ala Ala Ala Glu Pro Ala
Ser Thr Leu Met Gly Pro Ser Arg Pro 20 25 30 Val Thr Val Ala Leu
Arg Glu Asp Arg Gly His Ala Val Asp Leu Pro 35 40 45 Asp Thr Asp
Pro Arg Val Gln Arg Arg Ala Asn Gly Trp Ala Pro Glu 50 55 60 Gln
Ile Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser 65 70
75 80 Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Val Lys Pro Leu
Asp 85 90 95 Pro Gly Thr Val Gly Ser Val Val Arg Tyr Gly Leu Ala
Ala Asp Ser 100 105 110 Leu Val Arg Val Ala Thr Gly Asp Ala Leu Val
Tyr Ser Gln Leu Tyr 115 120 125 Pro Phe Glu Gly Leu Gln Asn Tyr Thr
Ser Gly Ile Ile His His Val 130 135 140 Arg Leu Gln Gly Leu Glu Pro
Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly 145 150 155 160 Asp Pro Ala Leu
Pro Gly Thr Met Ser Ala Val His Ala Phe Arg Thr 165 170 175 Met Pro
Ala Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val 180 185 190
Gly Asp Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met 195
200 205 Met Ser Asn Arg Pro Asp Leu Val Val Leu Val Gly Asp Val Ser
Tyr 210 215 220 Ala Asn Leu Tyr Leu Thr Asn Gly Thr Gly Ala Asp Cys
Tyr Ser Cys 225 230 235 240 Ala Phe Gly Lys Ser Thr Pro Ile His Glu
Thr Tyr Gln Pro Arg Trp 245 250 255 Asp Tyr Trp Gly Arg Tyr Met Glu
Ala Val Thr Ser Gly Thr Pro Met 260 265 270 Met Val Val Glu Gly Asn
His Glu Ile Glu Glu Gln Ile Gly Lys Lys 275 280 285 Thr Phe Glu Ala
Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Asn 290 295 300 Gly Ser
Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His 305 310 315
320 Phe Ile Met Leu Ala Ala Tyr Ala Asp Tyr Ser Lys Ser Gly Glu Gln
325 330 335 Tyr Arg Trp Leu Glu Lys Asp Leu Ala Lys Val Asp Arg Ser
Val Thr 340 345 350 Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr
Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu Cys Met Arg
Val Ala Met Glu Glu Leu 370 375 380 Leu Tyr Ser His Gly Leu Asp Ile
Ala Phe Thr Gly His Val His Ala 385 390 395 400 Tyr Glu Arg Ser Asn
Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly 405 410 415 Ala Val His
Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 420 425 430 Thr
Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys 435 440
445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Gly Phe Asn Phe Thr Ser Gly
450 455 460 Pro Ala Ala Gly Arg Tyr Cys Trp Asp Arg Gln Pro Asp Tyr
Ser Ala 465 470 475 480 Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Leu
Glu Val Lys Asn Glu 485 490 495 Thr His Ala Leu Trp Arg Trp His Arg
Asn Gln Asp Met Tyr Gly Ser 500 505 510 Ala Gly Asp Glu Ile Tyr Ile
Val Arg Glu Pro Glu Arg Cys Leu His 515 520 525 Lys His Asn Ser Thr
Arg Pro Ala His Gly Arg 530 535 291773DNAHordeum vulgareHvPAPhy_a1
phytase cDNA(1)..(1773)CDS(40)..(1650)Phytase coding sequence
29agcatcccaa tcctctcaat gccaagcaac aacatcaac atg tgg tgg ggg tcg 54
Met Trp Trp Gly Ser 1 5 ctg ctg ctg ctc gcg gcg gcg gtg gcg gtg gct
gcc gct gag ccg ccg 102Leu Leu Leu Leu Ala Ala Ala Val Ala Val Ala
Ala Ala Glu Pro Pro 10 15 20 tcg acg ctc gct ggc ccg tcg cgg ccg
gtg acg gtg acg ccg cgg gaa 150Ser Thr Leu Ala Gly Pro Ser Arg Pro
Val Thr Val Thr Pro Arg Glu 25 30 35 aac agg ggc cac gcg gtg gac
ctg ccg gac acg gac ccc cgg gtg cag 198Asn Arg Gly His Ala Val Asp
Leu Pro Asp Thr Asp Pro Arg Val Gln 40 45 50 cgc cgg gcc acg ggc
tgg gct ccc gag cag gtc gcc gtc gcg ctc tcc 246Arg Arg Ala Thr Gly
Trp Ala Pro Glu Gln Val Ala Val Ala Leu Ser 55 60 65 gcc gct ccc
acc tct gcc tgg gtc tcc tgg atc acc ggg gaa ttc cag 294Ala Ala Pro
Thr Ser Ala Trp Val Ser Trp Ile Thr Gly Glu Phe Gln 70 75 80 85 atg
ggc ggc acc gtg aag ccg ctg gac ccc cgc acg gtc ggc agc gtc 342Met
Gly Gly Thr Val Lys Pro Leu Asp Pro Arg Thr Val Gly Ser Val 90 95
100 gtg cgc tac ggg ctc gcc gcc gac tct ttg gtt cgc gag gcc acc ggc
390Val Arg Tyr Gly Leu Ala Ala Asp Ser Leu Val Arg Glu Ala Thr Gly
105 110 115 gac gcg ctc gtg tac agc cag ctc tac ccc ttc gag ggc ctc
cac aac 438Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu Gly Leu
His Asn 120 125 130 tac acc tcc ggc atc atc cac cac gtc cgc ctc caa
ggg ctt gag cct 486Tyr Thr Ser Gly Ile Ile His His Val Arg Leu Gln
Gly Leu Glu Pro 135 140 145 ggg acc aag tac tac tac cag tgc ggc gac
ccg gcc atc ccg ggg gcg 534Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp
Pro Ala Ile Pro Gly Ala 150 155 160 165 atg agc gcc gtc cac gcg ttc
cgg acg atg ccg gcg gcg ggg ccg cgg 582Met Ser Ala Val His Ala Phe
Arg Thr Met Pro Ala Ala Gly Pro Arg 170 175 180 agc tac ccg ggg agg
atc gcc gtg gtg gga gac ctc ggg ctc acg tac 630Ser Tyr Pro Gly Arg
Ile Ala Val Val Gly Asp Leu Gly Leu Thr Tyr 185 190 195 aac acc acc
tcg acc gtg gac cac atg acg agc aac cgg ccg gac ctg 678Asn Thr Thr
Ser Thr Val Asp His Met Thr Ser Asn Arg Pro Asp Leu 200 205 210 gtc
gtc ctc gtc ggc gac gtc agc tac gcc aac atg tac ctc acc aac 726Val
Val Leu Val Gly Asp Val Ser Tyr Ala Asn Met Tyr Leu Thr Asn 215 220
225 ggc acc gga acg gac tgc tac tcc tgc tcc ttc ggc aag tca acg ccc
774Gly Thr Gly Thr Asp Cys Tyr Ser Cys Ser Phe Gly Lys Ser Thr Pro
230 235 240 245 atc cac gaa acc tac cag ccg cgc tgg gac tac tgg gga
agg tac atg 822Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly
Arg Tyr Met 250 255 260 gag ccg gtg acg tcg agc acg ccg atg atg gtg
gtg gaa ggg aac cac 870Glu Pro Val Thr Ser Ser Thr Pro Met Met Val
Val Glu Gly Asn His 265 270 275 gag ata gag gag cag atc ggc aac aag
acg ttc gcg gcc tac cgc tcc 918Glu Ile Glu Glu Gln Ile Gly Asn Lys
Thr Phe Ala Ala Tyr Arg Ser 280 285 290 cgg ttc gcg ttc ccg tcg gcg
gag agc ggg tcc ttc tcc ccc ttc tac 966Arg Phe Ala Phe Pro Ser Ala
Glu Ser Gly Ser Phe Ser Pro Phe Tyr 295 300 305 tac tcc ttc gac gcc
ggc ggg atc cac ttc atc atg ctc ggc gcc tac 1014Tyr Ser Phe Asp Ala
Gly Gly Ile His Phe Ile Met Leu Gly Ala Tyr 310 315 320 325 gcc gac
tac ggc agg tca ggg gag cag tac aga tgg ctg gag aag gac 1062Ala Asp
Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys Asp 330 335 340
ctg gcg aag gtg gac agg tcg gtg acc ccc tgg ctg gtg gcc ggc tgg
1110Leu Ala Lys Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly Trp
345 350 355 cac gcg cca tgg tac acc acg tac aag gct cac tac agg gag
gtg gag 1158His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu
Val Glu 360 365 370 tgc atg aga gtg gcc atg gag gag ctg ctc tac tcc
cac ggc ctc gac 1206Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr Ser
His Gly Leu Asp 375 380 385 atc gcc ttc acc ggc cat gtg cac gcg tac
gag cgc tcc aac cgg gtg 1254Ile Ala Phe Thr Gly His Val His Ala Tyr
Glu Arg Ser Asn Arg Val 390 395 400 405 ttc aac tac acg ctg gac ccg
tgc ggc gcc gtg tac atc tcg gtg ggc 1302Phe Asn Tyr Thr Leu Asp Pro
Cys Gly Ala Val Tyr Ile Ser Val Gly 410 415 420 gac ggc ggg aac cgg
gag aag atg gcc acc acc cac gcc gac gag ccg 1350Asp Gly Gly Asn Arg
Glu Lys Met Ala Thr Thr His Ala Asp Glu Pro 425 430 435 ggg cac tgc
ccg gac ccg cgg cca aag ccc aac gcc ttc att gcc ggc 1398Gly His Cys
Pro Asp Pro Arg Pro Lys Pro Asn Ala Phe Ile Ala Gly 440 445 450 ttc
tgc gcc ttt aac ttc acg tcc ggc ccg gcc gcc ggc agg ttc tgc 1446Phe
Cys Ala Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys 455 460
465 tgg gac cgg cag ccg gac tac agc gcg tac cgg gag agc agc ttc ggc
1494Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly
470 475 480 485 cat ggc atc ctc gag gtg aag aac gag acg cac gct ctg
tgg aga tgg 1542His Gly Ile Leu Glu Val Lys Asn Glu Thr His Ala Leu
Trp Arg Trp 490 495 500 cac agg aac cag gac ctg tac ggg agc gcc gga
gat gag att tac att 1590His Arg Asn Gln Asp Leu Tyr Gly Ser Ala Gly
Asp Glu Ile Tyr Ile 505 510 515 gtt cgg gag ccg gag agg tgc ttg cac
aag cac aac tcg acc agg ccc 1638Val Arg Glu Pro Glu Arg Cys Leu His
Lys His Asn Ser Thr Arg Pro 520 525 530 gca cac ggt ccg taaaaatggc
aactacagac ggttcgccca agccggagat 1690Ala His Gly Pro 535 taactgttct
accactactg gagtatatcg ccccgtgcaa taatggcaac tatagacggt
1750tcgcccatgc gtggaaataa aaa 177330537PRTHordeum vulgare 30Met Trp
Trp Gly Ser Leu Leu Leu Leu Ala Ala Ala Val Ala Val Ala 1 5 10 15
Ala Ala Glu Pro Pro Ser Thr Leu Ala Gly Pro Ser Arg Pro Val Thr 20
25 30 Val Thr Pro Arg Glu Asn Arg Gly His Ala Val Asp Leu Pro Asp
Thr 35 40 45 Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp Ala Pro
Glu Gln Val 50 55 60 Ala Val Ala Leu Ser Ala Ala Pro Thr Ser Ala
Trp Val Ser Trp Ile 65 70 75 80 Thr Gly Glu Phe Gln Met Gly Gly Thr
Val Lys Pro Leu Asp Pro Arg 85 90 95 Thr Val Gly Ser Val Val Arg
Tyr Gly Leu Ala Ala Asp Ser Leu Val 100 105 110 Arg Glu Ala Thr Gly
Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe 115 120 125 Glu Gly Leu
His Asn Tyr Thr Ser Gly Ile Ile His His Val Arg Leu 130 135 140 Gln
Gly Leu Glu Pro Gly Thr Lys Tyr Tyr Tyr Gln Cys Gly Asp Pro 145 150
155 160 Ala Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr Met
Pro 165 170 175 Ala Ala Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val
Val Gly Asp 180 185 190 Leu Gly Leu Thr Tyr Asn Thr Thr Ser Thr Val
Asp His Met Thr Ser 195 200 205 Asn Arg Pro Asp Leu Val Val Leu Val
Gly Asp Val Ser Tyr Ala Asn 210 215 220 Met Tyr Leu Thr Asn Gly Thr
Gly Thr Asp Cys Tyr Ser Cys Ser Phe 225 230 235 240 Gly Lys Ser Thr
Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr 245 250 255 Trp Gly
Arg Tyr Met Glu Pro Val Thr Ser Ser Thr Pro Met Met Val 260 265 270
Val Glu Gly Asn His Glu Ile Glu Glu Gln Ile Gly Asn Lys Thr Phe 275
280 285 Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser Gly
Ser 290 295 300 Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile
His Phe Ile 305 310 315 320 Met Leu Gly Ala Tyr Ala Asp Tyr Gly Arg
Ser Gly Glu Gln Tyr Arg 325 330 335 Trp Leu Glu Lys Asp Leu Ala Lys
Val Asp Arg Ser Val Thr Pro Trp 340 345 350 Leu Val Ala Gly Trp His
Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His 355 360 365 Tyr Arg Glu Val
Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr 370 375 380 Ser His
Gly Leu Asp Ile Ala Phe Thr Gly His Val His Ala Tyr Glu 385 390 395
400 Arg Ser Asn Arg Val Phe Asn Tyr Thr Leu Asp Pro Cys Gly Ala Val
405 410 415 Tyr Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala
Thr Thr 420 425 430 His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg
Pro Lys Pro Asn 435 440 445 Ala Phe Ile Ala Gly Phe Cys Ala Phe Asn
Phe Thr Ser Gly Pro Ala 450 455 460 Ala Gly Arg Phe Cys Trp Asp Arg
Gln Pro Asp Tyr Ser Ala Tyr Arg 465 470 475 480 Glu Ser Ser Phe Gly
His Gly Ile Leu Glu Val Lys Asn Glu Thr His 485 490 495 Ala Leu Trp
Arg Trp His Arg Asn Gln Asp Leu Tyr Gly Ser Ala Gly 500 505 510 Asp
Glu Ile Tyr Ile Val Arg Glu Pro Glu Arg Cys Leu His Lys His 515 520
525 Asn Ser Thr Arg Pro Ala His Gly Pro 530 535 3119DNATriticum
sp.Triticum spp PAPhy gene forward primer(1)..(19)PAP ex3 Fw primer
31cttgagcctg ggacgaagt
193218DNATriticum sp.Triticum spp PAPhy gene reverse
primer(1)..(18)PAP ex3 Rv primer 32gagaaggacc cgctctcc
183320DNATriticum sp.Triticum spp PAPhy promoter forward
primer(1)..(20)TaPAPhy_a1-pro-ex1 Fw 33ttatgtgtcc gcgtgaagtg
203420DNATriticum sp.Triticum spp PAPhy promoter reverse
primer(1)..(20)TaPAPhy_a1-pro-ex1 Rv 34accaagagtc aatgccatcc
203523DNATriticum sp.Triticum spp PAPhy promoter forward primer
2(1)..(23)TaPAPhy_a1 -311 cons Fw 35tttggacgag ccatagctgc ata
233620DNATriticum sp.Triticum spp PAPhy promoter reverse primer
2(1)..(20)TaPAPhy_a1 167 Rv 36cgctgcaccc gggggtccgt
203722DNATriticum sp.Triticum spp PAPhy enhancer forward
primer(1)..(22)AS-PCR enhancer forward primer 37caagctacac
tttgtagaac ac 223820DNATriticum sp.Triticum spp PAPhy gene reverse
primer(1)..(20)AS-PCR enhancer reverse primer 38cgctgcaccc
gggggtccgt 203925DNATriticum sp.HighPhy SNP forward primer(1)..(25)
39tttcaagcta cactttgtag aacac 254020DNATriticum sp.HighPhy SNP
reverse primer(1)..(20) 40gcactagcca agtttggacg 204125DNATriticum
sp.Wildtype Phy SNP forward primer(1)..(25) 41tttcaagcta cactttgtag
aacat 254220DNATriticum sp.Wildtype Phy SNP reverse primer(1)..(20)
42gcactagcca agtttggacg 20432090DNATriticum aestivumWild type
TaPAPhy-a1 promoter(1)..(2090)Wild type TaPAPhy-a1 promoter and 5'
untranslated region 43aactcatgct cctaatgtga agcataaaat tatgtgtccg
cgtgaagtgc atgtgtactc 60catgaaaaac ctataaaatg agaaaaccca aaaaaactag
aaaaatcttt gcaaaatcca 120aaaacctaaa aaaaatcccc caaaaaagat
tcatgtggag gtgtacgcta tgtggcgaca 180actgaatgca ccacgtggcg
cggtcgtgtg ctcacaccgg ggaaagtgcc accgtggggt 240accccctaat
tatttgctcc aaaagtttgt tgctttgtaa aaaagttata aatcaaacat
300aatgggcctg atctcattca gctcgaactc cacacacaaa gctagatcga
atgctctaac 360tttgcgaagc tggaatccat cgtctccaag aggcctagtg
cgatttttcg aagctagtat 420ttcatgattt aaaaattcac tatgtttatg
aacaactctc gactagagag tattcttagt 480aatgtgataa gagtaacaca
acgatttttt taatataggt ttggtttgca attgtattga 540tagagcgaga
cctaatccta tttgggaagg cctcaggtag ttaggacggt tgtagctcag
600tcgaggtcag tttgagtcgt aatgcaactc ttcgcacttg acttcaaaat
gacttggggc 660tattgaaagg tccaaaagca acgatgtcgc cgatgagttt
attcaaagtg agagtacatg 720tccatgaggc taagagaagg ggtgccttga
caaattatca agactgcacc aaggcgatgg 780taggatatga gaggtatgat
gataagtcta tatccatgag tccataaaag tagtcaaagg 840tggatccata
gtccatggta cattaatcat tttcatccat gtgtgaatgg acctttagct
900agttgggcct catttagatt tgggctcatt tccttctata cttcattctt
gactctcttt 960ttttttgcga aaaggattag atctcttata aaaattcatc
ggaggtacaa agtatctcaa 1020acataataaa aactacatcg agattccgag
accaacgaac gaccaccact gccactagaa 1080taagctgctg acgcgccacc
ggagccgcct tgaccttgtc aatgacagcc gggaagtctt 1140cacgcacgta
cccctaagga ccaacgctct ggagtcgcag tcgtcgccat tgaacgcttg
1200catagatctg aagcatttga caccaaatct cgccacatga cgagaaaacg
ctaaccccac 1260cgccccaaga agacaacaag aatctatgtc ggagctccgt
caactaccca gatgagtgaa 1320ctcgaggagg atcggagccc ggaagacaaa
ctcgaagaag aagccttgcc atccacccga 1380aggccgcacc tatgaggact
aaaaaaacct aacctaattt tttttgataa aagaagggtt 1440ttccccttcc
gattttcatt aaagaaaacc aaaccaaacc taaactacta accggagcga
1500aggcatcggg attctcgtcc gcgccaccgg ccgccggagc ggtaggcaga
gtggaggcaa 1560atccacggac tcaccggtga agtctagagg ggtctagccg
cctaggatca ttatgggagg 1620taaacaagag tgatttcaat gttgactttg
acctttcatt ttttgccttc tccttttatt 1680tgttgaccat gcaattttgc
ttggacttct attaatcttg ttaatggagt tggatatatg 1740cgttgatcgt
tttagacctt attcaccggc ttgaactttt ttggacgagc catagctgca
1800tattttgttg cttgcgcttt agtttcaagc tacactttgt agaacatgag
tcatgcatgg 1860gacgaaggcg tccaaacttg gctagtgcag ctgcctgcgc
gttcacaagg caccaaagcg 1920caggcggcaa agtttgctcg tttattatct
tggcggtcca agatgggcgg caggttccag 1980acgatggacg aagacccacc
gagttccact tccggctcca acctcctctg cccgattcat 2040ataagtttcc
tgccaaaggc attccaattc tgtcaatgcc aagcaacaac 2090442060DNATriticum
aestivumHighPhy mutant TaPAPhy-a1 promoter(1)..(2060)HighPhy mutant
TaPAPhy-a1 promoter and 5' untranslated region 44ttatgtgtcc
gcgtgaagtg catctgtact ccatgaaaaa cctataaaat gagaaaaccc 60aaaaaaaact
agaaaaatct ttgcaaaatc caaaaaccta aaaaaaatcc cccaaaaaag
120attcatgtgg aggtgtacgc tatgtggcga caactgaatg caccacgtgg
cgcggtcgtg 180tgctcacacc ggggaaagtg ccaccgtggg gtacccccta
attatttgct ccaaaagttt 240gttgctttgt aaaaaaaata taaatcaaac
ataatgggcc tgatctcatt cagctcgaac 300tccacacaca aagctagatc
gaatgctcta actttgcgaa gctggaatcc atcgtctcca 360agaggcctag
tgcgattttt cgaagctagt atttcatgat ttaaaaattc actatgttta
420tgaacaactc tcgactagag agtattctta gtaatgtgat aagagtaaca
cagcgatttt 480tttaatatag gttcggtttg caattgtatt gatagagcga
gacctaatcc tatttgggaa 540ggcctcaggt agttaggacg gttgtagctc
agtcgaggtc agtttgagtc gtaatgcaac 600tcttcgcact tgacttcaaa
atgacttggg gctattgaaa ggtccaaaag caacgatgtc 660gccgatgagt
ttattcaaag tgagagtaca tgtccatgag gctaagagaa ggggtgcctt
720gacaaattat caagactgca ccaaggcgat ggtaggatat gagaggtatg
atgataagtc 780tatatccatg agtccataaa agtagtcaag ggtggatcca
tagtccatgg tacattaatc 840attttcatcc atgtgtgaat ggacctttag
ctagttgggc ctcatttaga tttgggctca 900tttccttcta gacttcattc
ttgactcttt tttttgcgaa aaggattaga tctcttataa 960aaattcatcg
gaggtacaaa gtatctcaaa cataataaaa actacatcga gattccgagc
1020ccaacgaacg accaccactg ccactagaat aagctgctga cgcgccaccg
gagccgcctt 1080gaccttgtca atgacagccg ggaagtcttc acgcacgtac
ccctaaggat cgacgctttg 1140gagtcgcagt cattgccatt gaacacttgc
atagatctga agcatttgac accaaatctc 1200gccacatgac gagaaaccct
aaccccaccg ccccaagaag acaacaagaa tctacgtcgg 1260agctccgtca
actacccaga tgagtgaact cgaggaggat cggagcccgg aagacaaact
1320cgaagaagaa gccttgccat ccacccgaag gccgcactta cgaggactaa
aaaaacctaa 1380cctaaatttt tttttgataa aagaagggtt ttccccttcc
gattttcatt aaagaaaacc 1440aaacctaacc taaactacta accggagcga
aggcatcggg attctcgtcc gcgccatcgg 1500ccgccggagc ggtaggcaga
gtggaggcaa atccacggac tcaccggtga agtctggagg 1560ggtctagccg
tctaggatca ttatgggagg taaacaagag tgatttcaat gttgactttg
1620acctttcatt ttttgccttc tccttttatt tgttgaccat gcaattttgc
ttggacttct 1680attaatcttg ttaatggagt tggatatatg cgttgatcgt
tttagacctt attcaccggc 1740ttgaactttt ttggacgagc catagctgca
tattttgttg cttgcgcttt agtttcaagc 1800tacactttgt agaacacgag
tcatgcatgg gacgaaggcg tccaaacttg gctagtgcag 1860ctgcctgcgc
gttcacaagg caccaaagcg caggcggcaa agtttgctcg tttattatct
1920tggcggtcca agatgggcgg caggttccag acgatggacg aagacccacc
gagttccact 1980tccggctcca acctcctctg cccgattcat ataagtttcc
tgccaaaggc atcccaattc 2040tgtcaatgcc aagcaacaac
2060454814DNATriticum aestivumpromoter(1)..(2090)Promoter and '5'
untranslated region 45aactcatgct cctaatgtga agcataaaat tatgtgtccg
cgtgaagtgc atgtgtactc 60catgaaaaac ctataaaatg agaaaaccca aaaaaactag
aaaaatcttt gcaaaatcca 120aaaacctaaa aaaaatcccc caaaaaagat
tcatgtggag gtgtacgcta tgtggcgaca 180actgaatgca ccacgtggcg
cggtcgtgtg ctcacaccgg ggaaagtgcc accgtggggt 240accccctaat
tatttgctcc aaaagtttgt tgctttgtaa aaaagttata aatcaaacat
300aatgggcctg atctcattca gctcgaactc cacacacaaa gctagatcga
atgctctaac 360tttgcgaagc tggaatccat cgtctccaag aggcctagtg
cgatttttcg aagctagtat 420ttcatgattt aaaaattcac tatgtttatg
aacaactctc gactagagag tattcttagt 480aatgtgataa gagtaacaca
acgatttttt taatataggt ttggtttgca attgtattga 540tagagcgaga
cctaatccta tttgggaagg cctcaggtag ttaggacggt tgtagctcag
600tcgaggtcag tttgagtcgt aatgcaactc ttcgcacttg acttcaaaat
gacttggggc 660tattgaaagg tccaaaagca acgatgtcgc cgatgagttt
attcaaagtg agagtacatg 720tccatgaggc taagagaagg ggtgccttga
caaattatca agactgcacc aaggcgatgg 780taggatatga gaggtatgat
gataagtcta tatccatgag tccataaaag tagtcaaagg 840tggatccata
gtccatggta cattaatcat tttcatccat gtgtgaatgg acctttagct
900agttgggcct catttagatt tgggctcatt tccttctata cttcattctt
gactctcttt 960ttttttgcga aaaggattag atctcttata aaaattcatc
ggaggtacaa agtatctcaa 1020acataataaa aactacatcg agattccgag
accaacgaac gaccaccact gccactagaa 1080taagctgctg acgcgccacc
ggagccgcct tgaccttgtc aatgacagcc gggaagtctt 1140cacgcacgta
cccctaagga ccaacgctct ggagtcgcag tcgtcgccat tgaacgcttg
1200catagatctg aagcatttga caccaaatct cgccacatga cgagaaaacg
ctaaccccac 1260cgccccaaga agacaacaag aatctatgtc ggagctccgt
caactaccca gatgagtgaa 1320ctcgaggagg atcggagccc ggaagacaaa
ctcgaagaag aagccttgcc atccacccga 1380aggccgcacc tatgaggact
aaaaaaacct aacctaattt tttttgataa aagaagggtt 1440ttccccttcc
gattttcatt aaagaaaacc aaaccaaacc taaactacta accggagcga
1500aggcatcggg attctcgtcc gcgccaccgg ccgccggagc ggtaggcaga
gtggaggcaa 1560atccacggac tcaccggtga agtctagagg ggtctagccg
cctaggatca ttatgggagg 1620taaacaagag tgatttcaat gttgactttg
acctttcatt ttttgccttc tccttttatt 1680tgttgaccat gcaattttgc
ttggacttct attaatcttg ttaatggagt tggatatatg 1740cgttgatcgt
tttagacctt attcaccggc ttgaactttt ttggacgagc catagctgca
1800tattttgttg cttgcgcttt agtttcaagc tacactttgt agaacatgag
tcatgcatgg 1860gacgaaggcg tccaaacttg gctagtgcag ctgcctgcgc
gttcacaagg caccaaagcg 1920caggcggcaa agtttgctcg tttattatct
tggcggtcca agatgggcgg caggttccag 1980acgatggacg aagacccacc
gagttccact tccggctcca acctcctctg cccgattcat 2040ataagtttcc
tgccaaaggc attccaattc tgtcaatgcc aagcaacaac atg tgg 2096 Met Trp 1
tgg ggg tcg ctg ctg ctg ctg ctg ctg ctc gcg gcc gcg gtg gcg gcg
2144Trp Gly Ser Leu Leu Leu Leu Leu Leu Leu Ala Ala Ala Val Ala Ala
5 10 15 gct gct gag ccg gcg tcg acg ctc acg ggc ccg tca cgg ccg gtc
acg 2192Ala Ala Glu Pro Ala Ser Thr Leu Thr Gly Pro Ser Arg Pro Val
Thr 20 25 30 gtg gcg ctg cgg gaa gac agg ggc cac gcg gtg gac ctg
ccg gac acg 2240Val Ala Leu Arg Glu Asp Arg Gly His Ala Val Asp Leu
Pro Asp Thr 35 40 45 50 gac ccc cgg gtg cag cgc cgg gcc acg ggc tgg
gct ccc gag cag atc 2288Asp Pro Arg Val Gln Arg Arg Ala Thr Gly Trp
Ala Pro Glu Gln Ile 55 60 65 gcc gtc gcg ctc tcc gcc gct ccc acc
tct gcc tgg gtc tcc tgg atc 2336Ala Val Ala Leu Ser Ala Ala Pro Thr
Ser Ala Trp Val Ser Trp Ile 70 75 80 acc ggt agtaatctgc tcaccggact
ctgattcctg ggttggatgg cattgactct 2392Thr Gly tggttccgca ggg gaa ttc
cag atg ggc ggc acc gtc aag ccg ctg gac 2441 Glu Phe Gln Met Gly
Gly Thr Val Lys Pro Leu Asp 85 90 95 ccc ggc acg gtc ggc agc gtc
gtg cgc tac ggg ctc gcc gcc gat tct 2489Pro Gly Thr Val Gly Ser Val
Val Arg Tyr Gly Leu Ala Ala Asp Ser 100 105 110 ttg gtt cgc cag gcc
agc ggc gac gcg ctc gtg tac agc cag ctc tac 2537Leu Val Arg Gln Ala
Ser Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr 115 120 125 ccc ttc gag
ggt ctc cag aac tac acc tcc ggc atc atc cac cac gtc 2585Pro Phe Glu
Gly Leu Gln Asn Tyr Thr Ser Gly Ile Ile His His Val 130 135 140 cgc
ctc caa ggt gaccgccgtc gttcgttgat cccctgttcc acaatcaatt 2637Arg Leu
Gln Gly 145 tttttttttg catatttttt gggagtgcaa tgaagtatct gcatgcaggg
ctt gag 2693 Leu Glu 150 cct gcg acg aag tac tac tac cag tgc ggc
gac ccg gcc ctc ccg ggg 2741Pro Ala Thr Lys Tyr Tyr Tyr Gln Cys Gly
Asp Pro Ala Leu Pro Gly 155 160 165 gcg atg agc gcc gtc cac gcg ttc
cgg acg atg ccg gcg gtg ggg ccg 2789Ala Met Ser Ala Val His Ala Phe
Arg Thr Met Pro Ala Val Gly Pro 170 175 180 cgg agc tac ccg ggg agg
atc gcc gtg gtg gga gac ctc ggg ctc acg 2837Arg Ser Tyr Pro Gly Arg
Ile Ala Val Val Gly Asp Leu Gly Leu Thr 185 190 195 tac aac acc acc
tcc acc gtg gac cac atg gcg agc aac cgg ccg gac 2885Tyr Asn Thr Thr
Ser Thr Val Asp His Met Ala Ser Asn Arg Pro Asp 200 205 210 ctg gtc
ctc ctc gtc ggc gac gtg tgc tac gcc aac atg tac ctc acc 2933Leu Val
Leu Leu Val Gly Asp Val Cys Tyr Ala Asn Met Tyr Leu Thr 215 220 225
230 aac ggc acc gga gcg gac tgc tac tcg tgc gcg ttc ggc aag tcg acg
2981Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly Lys Ser Thr
235 240 245 ccc atc cac gag acg tac cag ccg cgc tgg gac tac tgg gga
agg tac 3029Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr Trp Gly
Arg Tyr 250 255 260 atg gag gcg gtg acg tcg ggg acg ccg atg atg gtg
gtg gaa ggg aac 3077Met Glu Ala Val Thr Ser Gly Thr Pro Met Met Val
Val Glu Gly Asn 265 270 275 cat gag ata gag gag cag atc ggg aac aag
acg ttc gcg gcc tac cgc 3125His Glu Ile Glu Glu Gln Ile Gly Asn Lys
Thr Phe Ala Ala Tyr Arg 280 285 290 tcc cgg ttc gcg ttc ccg tcg acg
gag agc ggg tcc ttc tcc ccc ttc 3173Ser Arg Phe Ala Phe Pro Ser Thr
Glu Ser Gly Ser Phe Ser Pro Phe 295 300 305 310 tac tac tcg ttc gac
gcc ggc ggg atc cat ttc ctc atg ctc ggc gcc 3221Tyr Tyr Ser Phe Asp
Ala Gly Gly Ile His Phe Leu Met Leu Gly Ala 315 320 325 tac gcc gac
tac ggc agg tca ggg gag cag tac aga tgg ctg gag aag 3269Tyr Ala Asp
Tyr Gly Arg Ser Gly Glu Gln Tyr Arg Trp Leu Glu Lys 330 335 340 gac
ctg gcg aag gtg gac agg tcg gtg acg ccg tgg ctg gtc gcc ggc 3317Asp
Leu Ala Lys Val Asp Arg Ser Val Thr Pro Trp Leu Val Ala Gly 345 350
355 tgg cac gcg cca tgg tac acc acc tac aag gct cac tac agg gag gtg
3365Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His Tyr Arg Glu Val
360 365 370 gag tgc atg aga gtg gcc atg gag gag ctg ctc tac tcc cac
ggc ctc 3413Glu Cys Met Arg Val Ala Met Glu Glu Leu Leu Tyr Ser His
Gly Leu 375 380 385 390 gac atc gcc ttc acc ggc cat gta aca cct caa
tca cac cct ctg act 3461Asp Ile Ala Phe Thr Gly His Val Thr Pro Gln
Ser His Pro Leu Thr 395 400 405 gac acg gat cga cct acc tcc gtt ctc
tgg aca ttg gca agc agc cga 3509Asp Thr Asp Arg Pro Thr Ser Val Leu
Trp Thr Leu Ala Ser Ser Arg 410 415 420 gag tga tca ctc gct tgc tgt
gtg atg cag gtg cac gcg tat gag cgc 3557Glu Ser Leu Ala Cys Cys Val
Met Gln Val His Ala Tyr Glu Arg 425 430 435 tcc aac cgg gtg ttc aac
tac acg ctg gac ccg tgc ggc gcc gtg cac 3605Ser Asn Arg Val Phe Asn
Tyr Thr Leu Asp Pro Cys Gly Ala Val His 440 445 450 atc tcg gtg ggc
gac ggc ggg aac cgc gag aag atg gcc acc acc cac 3653Ile Ser Val Gly
Asp Gly Gly Asn Arg Glu Lys Met Ala Thr Thr His 455 460 465 gcc gac
gag ccg ggg cac tgc ccg gac ccg cgg ccc aag ccc aac gcc 3701Ala Asp
Glu Pro Gly His Cys Pro Asp Pro Arg Pro Lys Pro Asn Ala 470 475 480
485 ttc atc ggc ggc ttc tgc gcc tcc aac ttc acg tcc ggc ccg gcc gcc
3749Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly Pro Ala Ala
490 495 500 ggc agg ttc tgc tgg gac cgg cag ccg gac tac agc gcc tac
cgg gag 3797Gly Arg Phe Cys Trp Asp Arg Gln Pro Asp Tyr Ser Ala Tyr
Arg Glu 505 510 515 agc agc ttc ggc cac ggc atc ctc gag gta
cgtacgtacg aggaaaacaa 3847Ser Ser Phe Gly His Gly Ile Leu Glu Val
520 525 gatcgaagag aattctgacc agctagatat atggttcgtt tgaccgatgt
gagacgacgc 3907aattggttca cgcaggtg aag aac gag acg cac gct ctg tgg
aga tgg cac 3958 Lys Asn Glu Thr His Ala Leu Trp Arg Trp His 530
535 agg aac cag gac cac tac ggg agc gcc gga gat gag att tac att gtc
4006Arg Asn Gln Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val
540 545 550
cgg gag ccg cac agg tgc ttg cac aag cac aac tcg agc agg ccg gca
4054Arg Glu Pro His Arg Cys Leu His Lys His Asn Ser Ser Arg Pro Ala
555 560 565 570 cac ggt cga tca aac acc aca cgg gaa tcg gga ggt
taaccgttgt 4100His Gly Arg Ser Asn Thr Thr Arg Glu Ser Gly Gly 575
580 accactggag tagatcgcgt ggtgtaatgg caactgtata gacggttcgc
ccaagcgtgg 4160aaataaaaag ttataccaac taaaacatgg attgggcagt
gctaggcgct ggccggccgg 4220ccggcccaaa tttccaacgg tcgtgctagc
cgcccgacac cagtcgcact ggccgttgga 4280tctagcaaaa aaaaaaaaaa
accggttcgc gaagctcccc accccaccca caatctcgcg 4340cagctaaccc
cgttgccgcg ctcaccctcc acctgggcgg cgacaccctc cacctatgcc
4400cgccggcgct cgtccttggt ttcgtgcgtt tctgctccgg tgctcccctc
ctgggctgaa 4460cgcgaggtgg aaaaacacat cgacggccag gatgaaccaa
aaacggttaa taacgagggg 4520cacgatcgtc tttgttgccc cgcgtatagc
cgtcgaggag cccagggagg cccgtacgag 4580cccggttaga tcgtatgccc
ggccgtatac gtatttgtat atggcggcgt ttcgtgcacg 4640cgtggagccg
cccgcgcgtg gggcagcacg tgtcacgggt agattccaaa atcgtcccat
4700catataaatg tggacggcaa ccacctccgg ccgcatcgcc caccattccc
ccccgccgca 4760tcgtctccct ctccccactc ccaattcccc actccgtttc
ctctccaaca ttct 48144625DNAHordeum vulgareHvPAPhy_a SDmut Fw
primer(1)..(25)HvPAPhy_a SDmut Fw primer for mutant enhancer
46gtagaacacg agccatgcat gagac 254725DNAHordeum vulgareHvPAPhy_a
SDmut Rv primer(1)..(25)HvPAPhy_a SDmut Rv primer for mutant
enhancer 47tggctcgtgt tctacaaaat gtagc 254820DNAHordeum vulgareCis
to GUS Fw primer(1)..(20) 48tcgagtcgac gttccttgac 204923DNAHordeum
vulgareCis to GUS Rv primer(1)..(23) 49gttgatgttg ttgcttggca ttg
235036DNAEscherichia coliGUS Fw m. overhang primer(1)..(36)
50agcaacaaca tcaacatgtt acgtcctgta gaaacc 365138DNAEscherichia
coliGUS Rv m. overhang primer(1)..(38) 51ggaacgtcga ctcgactatg
accatgatta cgaattcc 38528132DNAHordeum
vulgarepCLEAN-G185-wt-proGUS(1)..(8132)Vector backbone,
pCLEAN-G185(1)..(2599)HvPAPhy_a
promoter(2600)..(4799)CDS(4800)..(6611)UidA gene encoding GUS
52catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt
60tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg
120gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct
ccctcgtgcg 180ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc
gcctttctcc cttcgggaag 240cgtggcgctt tctcatagct cacgctgtag
gtatctcagt tcggtgtagg tcgttcgctc 300caagctgggc tgtgtgcacg
aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 360ctatcgtctt
gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg
420taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga
agtggtggcc 480taactacggc tacactagaa gaacagtatt tggtatctgc
gctctgctga agccagttac 540cttcggaaga agagttggta gctcttgatc
cggcaaacaa accaccgctg gtagcggtgg 600tttttttgtt tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt 660gatcttttct
acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
720catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat
gaagttttaa 780atcaatctaa agtatatatg tgtaacattg gtctagtgat
tagaaaaact catcgagcat 840caaatgaaac tgcaatttat tcatatcagg
attatcaata ccatattttt gaaaaagccg 900tttctgtaat gaaggagaaa
actcaccgag gcagttccat aggatggcaa gatcctggta 960tcggtctgcg
attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa
1020aataaggtta tcaagtgaga aatcaccatg agtgacgact gaatccggtg
agaatggcaa 1080aagtttatgc atttctttcc agacttgttc aacaggccag
ccattacgct cgtcatcaaa 1140atcactcgca tcaaccaaac cgttattcat
tcgtgattgc gcctgagcga gacgaaatac 1200gcgatcgctg ttaaaaggac
aattacaaac aggaatcgaa tgcaaccggc gcaggaacac 1260tgccagcgca
tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc
1320tgttttccct gggatcgcag tggtgagtaa ccatgcatca tcaggagtac
ggataaaatg 1380cttgatggtc ggaagaggca taaattccgt cagccagttt
agtctgacca tctcatctgt 1440aacaacattg gcaacgctac ctttgccatg
tttcagaaac aactctggcg catcgggctt 1500cccatacaat cggtagattg
tcgcacctga ttgcccgaca ttatcgcgag cccatttata 1560cccatataaa
tcagcatcca tgttggaatt taatcgcggc cttgagcaag acgtttcccg
1620ttgaatatgg ctcataacac cccttgtatt actgtttatg taagcagaca
gttttattgt 1680tcatgatgat atatttttat cttgtgcaat gtaacatcag
agattttgag acacaacgtg 1740gctttgttga ataaatcgaa cttttgctga
gttgaaggat cagatcacgc atcttcccga 1800caacgcagac cgttccgtgg
caaagcaaaa gttcaaaatc accaactggt ccacctacaa 1860caaagctctc
atcaaccgtg gctccctcac tttctggctg gatgatgggg cgattcaggc
1920gatccccatc caacagcccg ccgtcgagcg ggctttttta tccccggaag
cctgtggata 1980gagggtagtt atccacgtga aaccgctaat gccccgcaaa
gccttgattc acggggcttt 2040ccggcccgct ccaaaaacta tccacgtgaa
atcgctaatc agggtacgtg aaatcgctaa 2100tcggagtacg tgaaatcgct
aataaggtca cgtgaaatcg ctaatcaaaa aggcacgtga 2160gaacgctaat
agccctttca gatcaacagc ttgcaaacac ccctcgctcc ggcaagtagt
2220tacagcaagt agtatgttca attagctttt caattatgaa tatatatatc
aattattggt 2280cgcccttggc ttgtggacaa tgcgctacgc gcaccggctc
cgcccgtgga caaccgcaag 2340cggttgccca ccgtcgagcg cctttgccca
caacccggcg gccggccgca acagatcgtt 2400ttataaattt ttttttttga
aaaagaaaaa gcccgaaagg cggcaacctc tcgggcttct 2460ggatttccga
tccccggaat tagatccgtt taaactacgt aagatcttgg caggatatat
2520tgtggtgtaa acgttcctgc ggcggtcgag atggatcttg gcaggatata
ttgtggtgta 2580aacgttcctg cggccgcatc ttgggcaaca tatcaggggc
agcgccattg ccctgcgact 2640gacggcggcg gtggaggagc ttggggcaga
catgagctga gaacgacgag agagaggagt 2700ggtggcgggc gagacagagg
agcgacatga ttgaagaaga gcagcgggat tgaggattag 2760ggattcctgc
gattttacac ttgacctctc cataaaagat tggcctaatc gaagctgaga
2820acgtggaggt caacaagtgg tcaaacgagc ctgtacgcac cgcatacgag
caacagtgat 2880cggattttca cgtcacatcg tatatagtga tcgtaaaagc
catattctaa agttggatga 2940ccgtattgtg cttccatgtc aactgcaagg
accgtgagtg tatttatctc taaaatataa 3000atcaaatata atggtgggct
tcttcagacc tcattcagct caaaatccgc ccatgaagcc 3060aatttgaatg
ctctaacttt tgcgaagctg gaatctattg tatccaagac tagtgttttc
3120aaagatagtc ttttcggaat ttcaaaatca ctatgtgtgt tcgtcgtatg
aacaactctc 3180gactagagag tattcttaat aatgcgataa gagtataaca
taacaatttt tttgaatgta 3240ggtttagttg gtctccatgg agcgagacct
agtcctattt ggggaggcct ctcgtagttt 3300ggatggacat agttctgtcg
gttcaggttg taatgcaact cctcgcactt gactctaaaa 3360tgacttaggc
tattgaaagg cccaaaaaca atagtattct tcccttgagt tcattcaagt
3420gagagtatat gtccatgggg ctaagagaag gggtcccttg acaaatgatc
aaggttgcgc 3480aaggtgatga taggtatatt ggtaaatctg tatccacgag
ttcatgaagt attcaaaggt 3540gggggtctat agtccatggt acatcaatca
tttccaccca tgtatgaatg ggcctttggc 3600tagttgggct catttagatt
tgggctcagt tacttcttgc cttaaatatt gactttgaca 3660tttcattttg
gtttcccttt ttatttgttg accatgataa tttgcttggc cttttattta
3720attttttatg gttttgatta ttttttaaac acaatacaga cgaaaacatt
catgtacaca 3780cacatgcatt catctttatg aacatacaca tccacatcat
gtccctatca tcttgaaatt 3840tatgaagtca tagtagacac ctagtcgtcg
aggggaattc tcctcggatt gaatgtgtat 3900cgtcgaaaat tgtgaaataa
atgtgagcgc caggacttga atcttgatgg actaggataa 3960cacagtttct
ctaaccatcc aaccgtatgt tggttcgcga tagtttggat tgcttaccac
4020atgtgtcatg tggttgctag gacttccatt aatctggccg aaccttgtta
attgagttgg 4080atatttcttg accattttag accttattaa gagcatcttc
aacaacagtg taaaaaatcc 4140gcgcccaata aatttttagc gcgccactgt
agcactttta aagcgcgggg acggaagcat 4200cttcaataga cacgcgctaa
tgcggcgccc aatccacccc ggtccagcga cccacccaca 4260acagctcaga
gtttgctgcg cgcgcaagcc ggcacaccaa atatgctgtc cgcgatagcg
4320tttttaagcg cgtgcccaaa attttttagt gcgagcacag ttttgcagcg
tctgttggag 4380ctgttcggcg ccaaaaaacg aatcttttaa cgcgcggtgt
agttttgagg cgtctgttgg 4440agatggtcta accggcttga accgtgttga
aaaaaaaacc cggcttgaat ttttgttgac 4500gagccatagt tgcatattac
gtacgttact tgctctttaa tttcaagcta cattttgtag 4560aacatgagcc
atgcatgaga cgtaggcgtc caaactttgg ctagcgcagc tgcatgcacg
4620tccacaaggc accaaaggcg caggcggcaa ctttgctcgt ttattttctt
gcgggtccaa 4680gatgagttcc agaccatgga cgaattccac ttcgggctcc
caatctcctc tgccggattc 4740ctataagttt cctgccaaga agcatcccaa
tcccctcaat gccaagcaac aacatcaac 4799atg tta cgt cct gta gaa acc cca
acc cgt gaa atc aaa aaa ctc gac 4847Met Leu Arg Pro Val Glu Thr Pro
Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 ggc ctg tgg gca ttc agt
ctg gat cgc gaa aac tgt gga att gat cag 4895Gly Leu Trp Ala Phe Ser
Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 cgt tgg tgg gaa
agc gcg tta caa gaa agc cgg gca att gct gtg cca 4943Arg Trp Trp Glu
Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 ggc agt
ttt aac gat cag ttc gcc gat gca gat att cgt aat tat gcg 4991Gly Ser
Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60
ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca
5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala
65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc gat gcg gtc act cat tac
ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr
Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag
ggc ggc tat acg 5135Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln
Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc gat gtc acg ccg tat gtt
att gcc ggg aaa agt gta 5183Pro Phe Glu Ala Asp Val Thr Pro Tyr Val
Ile Ala Gly Lys Ser Val 115 120 125 cgt atc acc gtt tgt gtg aac aac
gaa ctg aac tgg cag act atc ccg 5231Arg Ile Thr Val Cys Val Asn Asn
Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 ccg gga atg gtg att acc
gac gaa aac ggc aag aaa aag cag tct tac 5279Pro Gly Met Val Ile Thr
Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 ttc cat gat
ttc ttt aac tat gcc gga atc cat cgc agc gta atg ctc 5327Phe His Asp
Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 tac
acc acg ccg aac acc tgg gtg gac gat atc acc gtg gtg acg cat 5375Tyr
Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185
190 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc
5423Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala
195 200 205 aat ggt gat gtc agc gtt gaa ctg cgt gat gcg gat caa cag
gtg gtt 5471Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln
Val Val 210 215 220 gca act gga caa ggc act agc ggg act ttg caa gtg
gtg aat ccg cac 5519Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val
Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc
tat gaa ctg tgc gtc aca gcc 5567Leu Trp Gln Pro Gly Glu Gly Tyr Leu
Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa agc cag aca gag tgt gat
atc tac ccg ctt cgc gtc ggc atc cgg 5615Lys Ser Gln Thr Glu Cys Asp
Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 tca gtg gca gtg aag
ggc gaa cag ttc ctg att aac cac aaa ccg ttc 5663Ser Val Ala Val Lys
Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 tac ttt act
ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa 5711Tyr Phe Thr
Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga
ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg gac tgg 5759Gly
Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310
315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac cct tac gct gaa
gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu
Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc atc gtg gtg att
gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile
Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc tct tta ggc att
ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile
Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac agc gaa
gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu Leu Tyr Ser Glu
Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg
att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala His Leu Gln Ala
Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 aac cac cca agc
gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 6047Asn His Pro Ser
Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg
caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa gca acg 6095Arg Pro
Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430
cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc aat gta atg ttc
6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe
435 440 445 tgc gac gct cac acc gat acc atc agc gat ctc ttt gat gtg
ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val
Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa agc ggc
gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly
Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt
ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu Glu Lys Glu Leu
Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg att atc atc acc
gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro Ile Ile Ile Thr
Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tca atg tac
acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu His Ser Met Tyr
Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520 525 tgg ctg gat
atg tat cac cgc gtc ttt gat cgc gtc agc gcc gtc gtc 6431Trp Leu Asp
Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 ggt
gaa cag gta tgg aat ttc gcc gat ttt gcg acc tcg caa ggc ata 6479Gly
Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln Gly Ile 545 550
555 560 ttg cgc gtt ggc ggt aac aag aaa ggg atc ttc act cgc gac cgc
aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe Thr Arg Asp Arg
Lys 565 570 575 ccg aag tcg gcg gct ttt ctg ctg caa aaa cgc tgg act
ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu Leu Gln Lys Arg Trp Thr
Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag gga ggc aaa caa
tga atcaacaact 6621Phe Gly Glu Lys Pro Gln Gln Gly Gly Lys Gln 595
600 ctcctggcgc accatcgtcg gctacagcct cgggaattgc taccgagctc
gaatttcccc 6681gatcgttcaa acatttggca ataaagtttc ttaagattga
atcctgttgc cggtcttgcg 6741atgattatca tataatttct gttgaattac
gttaagcatg taataattaa catgtaatgc 6801atgacgttat ttatgagatg
ggtttttatg attagagtcc cgcaattata catttaatac 6861gcgatagaaa
acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct
6921atgttactag atcgggaatt cgtaatcatg gtcatagtcg agtcgacgtt
ccttgacagg 6981atatattggc gggtaaacta agtcgctgta tgtgtttgtt
tgagatcctc tagggcatgc 7041aggctcgcgg cggacgcacg acgccggggc
gagaccatag gcgatctcct aaatcaatag 7101tagctgtaac ctcgaagcgt
ttcacttgta acaacgattg agaatttttg tcataaaatt 7161gaaatacttg
gttcgcattt ttgtcatccg cggtcagccg caattctgac gaactgccca
7221tttagctgga gatgattgta catccttcac gtgaaaattt ctcaagcgct
gtgaacaagg 7281gttcagattt tagattgaaa ggtgagccgt tgaaacacgt
tcttcttgtc gatgacgacg 7341tcgctatgcg gcatcttatt attgaatacc
ttacgatcca cgccttcaaa gtgaccgcgg 7401tagccgacag cacccagttc
acaagagtac tctcttccgc gacggtcgat gtcgtggttg 7461ttgatctaaa
tttaggtcgt gaagatgggc tcgagatcgt tcgtaatctg gcggcaaagt
7521ctgatattcc aatcataatt atcagtggcg accgccttga ggagacggat
aaagttgttg 7581cactcgagct aggagcaagt gattttatcg ctaagccgtt
cagtatcaga gagtttctag 7641cacgcattcg ggttgccttg cgcgtgcgcc
ccaacgttgt ccgctccaaa gaccgacggt 7701ctttttgttt tactgactgg
acacttaatc tcaggcaacg tcgcttgatg tccgaagctg 7761gcggtgaggt
gaaacttacg gcaggtgagt tcaatcttct cctcgcgttt ttagagaaac
7821cccgcgacgt tctatcgcgc gagcaacttc tcattgccag tcgagtacgc
gacgaggagg 7881tttatgacag gagtatagat gttctcattt tgaggctgcg
ccgcaaactt gaggcggatc 7941cgtcaagccc tcaactgata aaaacagcaa
gaggtgccgg ttatttcttt gacgcggacg
8001tgcaggtttc gcacgggggg acgatggcag cctgagccaa ttgcatttgc
ctcttaatta 8061tctggctcaa agggtgactg aggagtaagc gatgtgccca
tcacactgcg catgcaagct 8121gatctggatc t 813253603PRTHordeum vulgare
53Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1
5 10 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp
Gln 20 25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile
Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp
Ile Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val
Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg
Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn
Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu
Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg
Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135
140 Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr
145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser
Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile
Thr Val Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser
Val Asp Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu
Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly
Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp
Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255
Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260
265 270 Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro
Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu
Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His
Ala Leu Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr
Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp
Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly
Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys
Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380
Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385
390 395 400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro
Asp Thr 405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu
Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr
Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile
Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly
Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys
Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His
Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505
510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala
515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala
Val Val 530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr
Ser Gln Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly
Ile Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu
Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro
Gln Gln Gly Gly Lys Gln 595 600 548132DNAHordeum
vulgarepCLEAN-G185-HP-proGUS(1)..(8132)Vector backbone,
pCLEAN-G185(1)..(2599)HighPhy HvPAPhy_a
promoter(2600)..(4799)HighPhy enhancer
mutation(4565)..(4565)CDS(4800)..(6611)UidA gene (encoding GUS)
54catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt
60tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg
120gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct
ccctcgtgcg 180ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc
gcctttctcc cttcgggaag 240cgtggcgctt tctcatagct cacgctgtag
gtatctcagt tcggtgtagg tcgttcgctc 300caagctgggc tgtgtgcacg
aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 360ctatcgtctt
gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg
420taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga
agtggtggcc 480taactacggc tacactagaa gaacagtatt tggtatctgc
gctctgctga agccagttac 540cttcggaaga agagttggta gctcttgatc
cggcaaacaa accaccgctg gtagcggtgg 600tttttttgtt tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt 660gatcttttct
acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
720catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat
gaagttttaa 780atcaatctaa agtatatatg tgtaacattg gtctagtgat
tagaaaaact catcgagcat 840caaatgaaac tgcaatttat tcatatcagg
attatcaata ccatattttt gaaaaagccg 900tttctgtaat gaaggagaaa
actcaccgag gcagttccat aggatggcaa gatcctggta 960tcggtctgcg
attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa
1020aataaggtta tcaagtgaga aatcaccatg agtgacgact gaatccggtg
agaatggcaa 1080aagtttatgc atttctttcc agacttgttc aacaggccag
ccattacgct cgtcatcaaa 1140atcactcgca tcaaccaaac cgttattcat
tcgtgattgc gcctgagcga gacgaaatac 1200gcgatcgctg ttaaaaggac
aattacaaac aggaatcgaa tgcaaccggc gcaggaacac 1260tgccagcgca
tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc
1320tgttttccct gggatcgcag tggtgagtaa ccatgcatca tcaggagtac
ggataaaatg 1380cttgatggtc ggaagaggca taaattccgt cagccagttt
agtctgacca tctcatctgt 1440aacaacattg gcaacgctac ctttgccatg
tttcagaaac aactctggcg catcgggctt 1500cccatacaat cggtagattg
tcgcacctga ttgcccgaca ttatcgcgag cccatttata 1560cccatataaa
tcagcatcca tgttggaatt taatcgcggc cttgagcaag acgtttcccg
1620ttgaatatgg ctcataacac cccttgtatt actgtttatg taagcagaca
gttttattgt 1680tcatgatgat atatttttat cttgtgcaat gtaacatcag
agattttgag acacaacgtg 1740gctttgttga ataaatcgaa cttttgctga
gttgaaggat cagatcacgc atcttcccga 1800caacgcagac cgttccgtgg
caaagcaaaa gttcaaaatc accaactggt ccacctacaa 1860caaagctctc
atcaaccgtg gctccctcac tttctggctg gatgatgggg cgattcaggc
1920gatccccatc caacagcccg ccgtcgagcg ggctttttta tccccggaag
cctgtggata 1980gagggtagtt atccacgtga aaccgctaat gccccgcaaa
gccttgattc acggggcttt 2040ccggcccgct ccaaaaacta tccacgtgaa
atcgctaatc agggtacgtg aaatcgctaa 2100tcggagtacg tgaaatcgct
aataaggtca cgtgaaatcg ctaatcaaaa aggcacgtga 2160gaacgctaat
agccctttca gatcaacagc ttgcaaacac ccctcgctcc ggcaagtagt
2220tacagcaagt agtatgttca attagctttt caattatgaa tatatatatc
aattattggt 2280cgcccttggc ttgtggacaa tgcgctacgc gcaccggctc
cgcccgtgga caaccgcaag 2340cggttgccca ccgtcgagcg cctttgccca
caacccggcg gccggccgca acagatcgtt 2400ttataaattt ttttttttga
aaaagaaaaa gcccgaaagg cggcaacctc tcgggcttct 2460ggatttccga
tccccggaat tagatccgtt taaactacgt aagatcttgg caggatatat
2520tgtggtgtaa acgttcctgc ggcggtcgag atggatcttg gcaggatata
ttgtggtgta 2580aacgttcctg cggccgcatc ttgggcaaca tatcaggggc
agcgccattg ccctgcgact 2640gacggcggcg gtggaggagc ttggggcaga
catgagctga gaacgacgag agagaggagt 2700ggtggcgggc gagacagagg
agcgacatga ttgaagaaga gcagcgggat tgaggattag 2760ggattcctgc
gattttacac ttgacctctc cataaaagat tggcctaatc gaagctgaga
2820acgtggaggt caacaagtgg tcaaacgagc ctgtacgcac cgcatacgag
caacagtgat 2880cggattttca cgtcacatcg tatatagtga tcgtaaaagc
catattctaa agttggatga 2940ccgtattgtg cttccatgtc aactgcaagg
accgtgagtg tatttatctc taaaatataa 3000atcaaatata atggtgggct
tcttcagacc tcattcagct caaaatccgc ccatgaagcc 3060aatttgaatg
ctctaacttt tgcgaagctg gaatctattg tatccaagac tagtgttttc
3120aaagatagtc ttttcggaat ttcaaaatca ctatgtgtgt tcgtcgtatg
aacaactctc 3180gactagagag tattcttaat aatgcgataa gagtataaca
taacaatttt tttgaatgta 3240ggtttagttg gtctccatgg agcgagacct
agtcctattt ggggaggcct ctcgtagttt 3300ggatggacat agttctgtcg
gttcaggttg taatgcaact cctcgcactt gactctaaaa 3360tgacttaggc
tattgaaagg cccaaaaaca atagtattct tcccttgagt tcattcaagt
3420gagagtatat gtccatgggg ctaagagaag gggtcccttg acaaatgatc
aaggttgcgc 3480aaggtgatga taggtatatt ggtaaatctg tatccacgag
ttcatgaagt attcaaaggt 3540gggggtctat agtccatggt acatcaatca
tttccaccca tgtatgaatg ggcctttggc 3600tagttgggct catttagatt
tgggctcagt tacttcttgc cttaaatatt gactttgaca 3660tttcattttg
gtttcccttt ttatttgttg accatgataa tttgcttggc cttttattta
3720attttttatg gttttgatta ttttttaaac acaatacaga cgaaaacatt
catgtacaca 3780cacatgcatt catctttatg aacatacaca tccacatcat
gtccctatca tcttgaaatt 3840tatgaagtca tagtagacac ctagtcgtcg
aggggaattc tcctcggatt gaatgtgtat 3900cgtcgaaaat tgtgaaataa
atgtgagcgc caggacttga atcttgatgg actaggataa 3960cacagtttct
ctaaccatcc aaccgtatgt tggttcgcga tagtttggat tgcttaccac
4020atgtgtcatg tggttgctag gacttccatt aatctggccg aaccttgtta
attgagttgg 4080atatttcttg accattttag accttattaa gagcatcttc
aacaacagtg taaaaaatcc 4140gcgcccaata aatttttagc gcgccactgt
agcactttta aagcgcgggg acggaagcat 4200cttcaataga cacgcgctaa
tgcggcgccc aatccacccc ggtccagcga cccacccaca 4260acagctcaga
gtttgctgcg cgcgcaagcc ggcacaccaa atatgctgtc cgcgatagcg
4320tttttaagcg cgtgcccaaa attttttagt gcgagcacag ttttgcagcg
tctgttggag 4380ctgttcggcg ccaaaaaacg aatcttttaa cgcgcggtgt
agttttgagg cgtctgttgg 4440agatggtcta accggcttga accgtgttga
aaaaaaaacc cggcttgaat ttttgttgac 4500gagccatagt tgcatattac
gtacgttact tgctctttaa tttcaagcta cattttgtag 4560aacacgagcc
atgcatgaga cgtaggcgtc caaactttgg ctagcgcagc tgcatgcacg
4620tccacaaggc accaaaggcg caggcggcaa ctttgctcgt ttattttctt
gcgggtccaa 4680gatgagttcc agaccatgga cgaattccac ttcgggctcc
caatctcctc tgccggattc 4740ctataagttt cctgccaaga agcatcccaa
tcccctcaat gccaagcaac aacatcaac 4799atg tta cgt cct gta gaa acc cca
acc cgt gaa atc aaa aaa ctc gac 4847Met Leu Arg Pro Val Glu Thr Pro
Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15 ggc ctg tgg gca ttc agt
ctg gat cgc gaa aac tgt gga att gat cag 4895Gly Leu Trp Ala Phe Ser
Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20 25 30 cgt tgg tgg gaa
agc gcg tta caa gaa agc cgg gca att gct gtg cca 4943Arg Trp Trp Glu
Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val Pro 35 40 45 ggc agt
ttt aac gat cag ttc gcc gat gca gat att cgt aat tat gcg 4991Gly Ser
Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala 50 55 60
ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca
5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile Pro Lys Gly Trp Ala
65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc gat gcg gtc act cat tac
ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe Asp Ala Val Thr His Tyr
Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag
ggc ggc tat acg 5135Val Trp Val Asn Asn Gln Glu Val Met Glu His Gln
Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc gat gtc acg ccg tat gtt
att gcc ggg aaa agt gta 5183Pro Phe Glu Ala Asp Val Thr Pro Tyr Val
Ile Ala Gly Lys Ser Val 115 120 125 cgt atc acc gtt tgt gtg aac aac
gaa ctg aac tgg cag act atc ccg 5231Arg Ile Thr Val Cys Val Asn Asn
Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 ccg gga atg gtg att acc
gac gaa aac ggc aag aaa aag cag tct tac 5279Pro Gly Met Val Ile Thr
Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150 155 160 ttc cat gat
ttc ttt aac tat gcc gga atc cat cgc agc gta atg ctc 5327Phe His Asp
Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Leu 165 170 175 tac
acc acg ccg aac acc tgg gtg gac gat atc acc gtg gtg acg cat 5375Tyr
Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val Val Thr His 180 185
190 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc
5423Val Ala Gln Asp Cys Asn His Ala Ser Val Asp Trp Gln Val Val Ala
195 200 205 aat ggt gat gtc agc gtt gaa ctg cgt gat gcg gat caa cag
gtg gtt 5471Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gln Gln
Val Val 210 215 220 gca act gga caa ggc act agc ggg act ttg caa gtg
gtg aat ccg cac 5519Ala Thr Gly Gln Gly Thr Ser Gly Thr Leu Gln Val
Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc
tat gaa ctg tgc gtc aca gcc 5567Leu Trp Gln Pro Gly Glu Gly Tyr Leu
Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa agc cag aca gag tgt gat
atc tac ccg ctt cgc gtc ggc atc cgg 5615Lys Ser Gln Thr Glu Cys Asp
Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270 tca gtg gca gtg aag
ggc gaa cag ttc ctg att aac cac aaa ccg ttc 5663Ser Val Ala Val Lys
Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275 280 285 tac ttt act
ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa 5711Tyr Phe Thr
Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga
ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg gac tgg 5759Gly
Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310
315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac cct tac gct gaa
gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu
Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc atc gtg gtg att
gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly Ile Val Val Ile
Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc tct tta ggc att
ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu Ser Leu Gly Ile
Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac agc gaa
gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu Leu Tyr Ser Glu
Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg
att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala His Leu Gln Ala
Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400 aac cac cca agc
gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 6047Asn His Pro Ser
Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg
caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa gca acg 6095Arg Pro
Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430
cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc aat gta atg ttc
6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val Asn Val Met Phe
435 440 445 tgc gac gct cac acc gat acc atc agc gat ctc ttt gat gtg
ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp Leu Phe Asp Val
Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa agc ggc
gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gln Ser Gly
Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt
ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu Glu Lys Glu Leu
Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg att atc atc acc
gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro Ile Ile Ile Thr
Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tca atg tac
acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu His Ser Met Tyr
Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala
515 520 525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc agc gcc
gtc gtc 6431Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala
Val Val 530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc
tcg caa ggc ata 6479Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr
Ser Gln Gly Ile 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg
atc ttc act cgc gac cgc aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly
Ile Phe Thr Arg Asp Arg Lys 565 570 575 ccg aag tcg gcg gct ttt ctg
ctg caa aaa cgc tgg act ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu
Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg
cag cag gga ggc aaa caa tga atcaacaact 6621Phe Gly Glu Lys Pro Gln
Gln Gly Gly Lys Gln 595 600 ctcctggcgc accatcgtcg gctacagcct
cgggaattgc taccgagctc gaatttcccc 6681gatcgttcaa acatttggca
ataaagtttc ttaagattga atcctgttgc cggtcttgcg 6741atgattatca
tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc
6801atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata
catttaatac 6861gcgatagaaa acaaaatata gcgcgcaaac taggataaat
tatcgcgcgc ggtgtcatct 6921atgttactag atcgggaatt cgtaatcatg
gtcatagtcg agtcgacgtt ccttgacagg 6981atatattggc gggtaaacta
agtcgctgta tgtgtttgtt tgagatcctc tagggcatgc 7041aggctcgcgg
cggacgcacg acgccggggc gagaccatag gcgatctcct aaatcaatag
7101tagctgtaac ctcgaagcgt ttcacttgta acaacgattg agaatttttg
tcataaaatt 7161gaaatacttg gttcgcattt ttgtcatccg cggtcagccg
caattctgac gaactgccca 7221tttagctgga gatgattgta catccttcac
gtgaaaattt ctcaagcgct gtgaacaagg 7281gttcagattt tagattgaaa
ggtgagccgt tgaaacacgt tcttcttgtc gatgacgacg 7341tcgctatgcg
gcatcttatt attgaatacc ttacgatcca cgccttcaaa gtgaccgcgg
7401tagccgacag cacccagttc acaagagtac tctcttccgc gacggtcgat
gtcgtggttg 7461ttgatctaaa tttaggtcgt gaagatgggc tcgagatcgt
tcgtaatctg gcggcaaagt 7521ctgatattcc aatcataatt atcagtggcg
accgccttga ggagacggat aaagttgttg 7581cactcgagct aggagcaagt
gattttatcg ctaagccgtt cagtatcaga gagtttctag 7641cacgcattcg
ggttgccttg cgcgtgcgcc ccaacgttgt ccgctccaaa gaccgacggt
7701ctttttgttt tactgactgg acacttaatc tcaggcaacg tcgcttgatg
tccgaagctg 7761gcggtgaggt gaaacttacg gcaggtgagt tcaatcttct
cctcgcgttt ttagagaaac 7821cccgcgacgt tctatcgcgc gagcaacttc
tcattgccag tcgagtacgc gacgaggagg 7881tttatgacag gagtatagat
gttctcattt tgaggctgcg ccgcaaactt gaggcggatc 7941cgtcaagccc
tcaactgata aaaacagcaa gaggtgccgg ttatttcttt gacgcggacg
8001tgcaggtttc gcacgggggg acgatggcag cctgagccaa ttgcatttgc
ctcttaatta 8061tctggctcaa agggtgactg aggagtaagc gatgtgccca
tcacactgcg catgcaagct 8121gatctggatc t 813255603PRTHordeum vulgare
55Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1
5 10 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp
Gln 20 25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile
Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp
Ile Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val
Phe Ile Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg
Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn
Gln Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu
Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg
Ile Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135
140 Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr
145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser
Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile
Thr Val Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser
Val Asp Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu
Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly
Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp
Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255
Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260
265 270 Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro
Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu
Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His
Ala Leu Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr
Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp
Glu His Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly
Phe Asn Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys
Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380
Gln Gln Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385
390 395 400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro
Asp Thr 405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu
Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr
Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile
Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly
Trp Tyr Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys
Val Leu Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His
Gln Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505
510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala
515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala
Val Val 530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr
Ser Gln Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly
Ile Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu
Leu Gln Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro
Gln Gln Gly Gly Lys Gln 595 600 5639DNAHordeum vulgareKill triad Fw
primer(1)..(39)Kill triad Fw primer to randomise mutant enhancer
56gcatacgaag catagtacga cgtaggcgtc caaactttg 395748DNAHordeum
vulgareKill triad Rv primer(1)..(48)Kill triad Rv primer to
randomise mutant enhancer 57tcgtactatg cttcgtatgc ctacaaaatg
tagcttgaaa ttaaagag 48588132DNAHordeum
vulgarepCLEAN-G185-KOtriad-ProGUS(1)..(8132)Vector backbone,
pCLEAN-G185(1)..(2599)KOtriad HvPAPhy_a
promoter(2600)..(4799)Randomized sequence replacing the enhancer
triad (GCN4, skn1, RY-element)(4561)..(4580)CDS(4800)..(6611)UidA
gene (encoding GUS) 58catgtgagca aaaggccagc aaaaggccag gaaccgtaaa
aaggccgcgt tgctggcgtt 60tttccatagg ctccgccccc ctgacgagca tcacaaaaat
cgacgctcaa gtcagaggtg 120gcgaaacccg acaggactat aaagatacca
ggcgtttccc cctggaagct ccctcgtgcg 180ctctcctgtt ccgaccctgc
cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 240cgtggcgctt
tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc
300caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct
tatccggtaa 360ctatcgtctt gagtccaacc cggtaagaca cgacttatcg
ccactggcag cagccactgg 420taacaggatt agcagagcga ggtatgtagg
cggtgctaca gagttcttga agtggtggcc 480taactacggc tacactagaa
gaacagtatt tggtatctgc gctctgctga agccagttac 540cttcggaaga
agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg
600tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag
aagatccttt 660gatcttttct acggggtctg acgctcagtg gaacgaaaac
tcacgttaag ggattttggt 720catgagatta tcaaaaagga tcttcaccta
gatcctttta aattaaaaat gaagttttaa 780atcaatctaa agtatatatg
tgtaacattg gtctagtgat tagaaaaact catcgagcat 840caaatgaaac
tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg
900tttctgtaat gaaggagaaa actcaccgag gcagttccat aggatggcaa
gatcctggta 960tcggtctgcg attccgactc gtccaacatc aatacaacct
attaatttcc cctcgtcaaa 1020aataaggtta tcaagtgaga aatcaccatg
agtgacgact gaatccggtg agaatggcaa 1080aagtttatgc atttctttcc
agacttgttc aacaggccag ccattacgct cgtcatcaaa 1140atcactcgca
tcaaccaaac cgttattcat tcgtgattgc gcctgagcga gacgaaatac
1200gcgatcgctg ttaaaaggac aattacaaac aggaatcgaa tgcaaccggc
gcaggaacac 1260tgccagcgca tcaacaatat tttcacctga atcaggatat
tcttctaata cctggaatgc 1320tgttttccct gggatcgcag tggtgagtaa
ccatgcatca tcaggagtac ggataaaatg 1380cttgatggtc ggaagaggca
taaattccgt cagccagttt agtctgacca tctcatctgt 1440aacaacattg
gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt
1500cccatacaat cggtagattg tcgcacctga ttgcccgaca ttatcgcgag
cccatttata 1560cccatataaa tcagcatcca tgttggaatt taatcgcggc
cttgagcaag acgtttcccg 1620ttgaatatgg ctcataacac cccttgtatt
actgtttatg taagcagaca gttttattgt 1680tcatgatgat atatttttat
cttgtgcaat gtaacatcag agattttgag acacaacgtg 1740gctttgttga
ataaatcgaa cttttgctga gttgaaggat cagatcacgc atcttcccga
1800caacgcagac cgttccgtgg caaagcaaaa gttcaaaatc accaactggt
ccacctacaa 1860caaagctctc atcaaccgtg gctccctcac tttctggctg
gatgatgggg cgattcaggc 1920gatccccatc caacagcccg ccgtcgagcg
ggctttttta tccccggaag cctgtggata 1980gagggtagtt atccacgtga
aaccgctaat gccccgcaaa gccttgattc acggggcttt 2040ccggcccgct
ccaaaaacta tccacgtgaa atcgctaatc agggtacgtg aaatcgctaa
2100tcggagtacg tgaaatcgct aataaggtca cgtgaaatcg ctaatcaaaa
aggcacgtga 2160gaacgctaat agccctttca gatcaacagc ttgcaaacac
ccctcgctcc ggcaagtagt 2220tacagcaagt agtatgttca attagctttt
caattatgaa tatatatatc aattattggt 2280cgcccttggc ttgtggacaa
tgcgctacgc gcaccggctc cgcccgtgga caaccgcaag 2340cggttgccca
ccgtcgagcg cctttgccca caacccggcg gccggccgca acagatcgtt
2400ttataaattt ttttttttga aaaagaaaaa gcccgaaagg cggcaacctc
tcgggcttct 2460ggatttccga tccccggaat tagatccgtt taaactacgt
aagatcttgg caggatatat 2520tgtggtgtaa acgttcctgc ggcggtcgag
atggatcttg gcaggatata ttgtggtgta 2580aacgttcctg cggccgcatc
ttgggcaaca tatcaggggc agcgccattg ccctgcgact 2640gacggcggcg
gtggaggagc ttggggcaga catgagctga gaacgacgag agagaggagt
2700ggtggcgggc gagacagagg agcgacatga ttgaagaaga gcagcgggat
tgaggattag 2760ggattcctgc gattttacac ttgacctctc cataaaagat
tggcctaatc gaagctgaga 2820acgtggaggt caacaagtgg tcaaacgagc
ctgtacgcac cgcatacgag caacagtgat 2880cggattttca cgtcacatcg
tatatagtga tcgtaaaagc catattctaa agttggatga 2940ccgtattgtg
cttccatgtc aactgcaagg accgtgagtg tatttatctc taaaatataa
3000atcaaatata atggtgggct tcttcagacc tcattcagct caaaatccgc
ccatgaagcc 3060aatttgaatg ctctaacttt tgcgaagctg gaatctattg
tatccaagac tagtgttttc 3120aaagatagtc ttttcggaat ttcaaaatca
ctatgtgtgt tcgtcgtatg aacaactctc 3180gactagagag tattcttaat
aatgcgataa gagtataaca taacaatttt tttgaatgta 3240ggtttagttg
gtctccatgg agcgagacct agtcctattt ggggaggcct ctcgtagttt
3300ggatggacat agttctgtcg gttcaggttg taatgcaact cctcgcactt
gactctaaaa 3360tgacttaggc tattgaaagg cccaaaaaca atagtattct
tcccttgagt tcattcaagt 3420gagagtatat gtccatgggg ctaagagaag
gggtcccttg acaaatgatc aaggttgcgc 3480aaggtgatga taggtatatt
ggtaaatctg tatccacgag ttcatgaagt attcaaaggt 3540gggggtctat
agtccatggt acatcaatca tttccaccca tgtatgaatg ggcctttggc
3600tagttgggct catttagatt tgggctcagt tacttcttgc cttaaatatt
gactttgaca 3660tttcattttg gtttcccttt ttatttgttg accatgataa
tttgcttggc cttttattta 3720attttttatg gttttgatta ttttttaaac
acaatacaga cgaaaacatt catgtacaca 3780cacatgcatt catctttatg
aacatacaca tccacatcat gtccctatca tcttgaaatt 3840tatgaagtca
tagtagacac ctagtcgtcg aggggaattc tcctcggatt gaatgtgtat
3900cgtcgaaaat tgtgaaataa atgtgagcgc caggacttga atcttgatgg
actaggataa 3960cacagtttct ctaaccatcc aaccgtatgt tggttcgcga
tagtttggat tgcttaccac 4020atgtgtcatg tggttgctag gacttccatt
aatctggccg aaccttgtta attgagttgg 4080atatttcttg accattttag
accttattaa gagcatcttc aacaacagtg taaaaaatcc 4140gcgcccaata
aatttttagc gcgccactgt agcactttta aagcgcgggg acggaagcat
4200cttcaataga cacgcgctaa tgcggcgccc aatccacccc ggtccagcga
cccacccaca 4260acagctcaga gtttgctgcg cgcgcaagcc ggcacaccaa
atatgctgtc cgcgatagcg 4320tttttaagcg cgtgcccaaa attttttagt
gcgagcacag ttttgcagcg tctgttggag 4380ctgttcggcg ccaaaaaacg
aatcttttaa cgcgcggtgt agttttgagg cgtctgttgg 4440agatggtcta
accggcttga accgtgttga aaaaaaaacc cggcttgaat ttttgttgac
4500gagccatagt tgcatattac gtacgttact tgctctttaa tttcaagcta
cattttgtag 4560gcatacgaag catagtacga cgtaggcgtc caaactttgg
ctagcgcagc tgcatgcacg 4620tccacaaggc accaaaggcg caggcggcaa
ctttgctcgt ttattttctt gcgggtccaa 4680gatgagttcc agaccatgga
cgaattccac ttcgggctcc caatctcctc tgccggattc 4740ctataagttt
cctgccaaga agcatcccaa tcccctcaat gccaagcaac aacatcaac 4799atg tta
cgt cct gta gaa acc cca acc cgt gaa atc aaa aaa ctc gac 4847Met Leu
Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15
ggc ctg tgg gca ttc agt ctg gat cgc gaa aac tgt gga att gat cag
4895Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln
20 25 30 cgt tgg tgg gaa agc gcg tta caa gaa agc cgg gca att gct
gtg cca 4943Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala
Val Pro 35 40 45 ggc agt ttt aac gat cag ttc gcc gat gca gat att
cgt aat tat gcg 4991Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile
Arg Asn Tyr Ala 50 55 60 ggc aac gtc tgg tat cag cgc gaa gtc ttt
ata ccg aaa ggt tgg gca 5039Gly Asn Val Trp Tyr Gln Arg Glu Val Phe
Ile Pro Lys Gly Trp Ala 65 70 75 80 ggc cag cgt atc gtg ctg cgt ttc
gat gcg gtc act cat tac ggc aaa 5087Gly Gln Arg Ile Val Leu Arg Phe
Asp Ala Val Thr His Tyr Gly Lys 85 90 95 gtg tgg gtc aat aat cag
gaa gtg atg gag cat cag ggc ggc tat acg 5135Val Trp Val Asn Asn Gln
Glu Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 cca ttt gaa gcc
gat gtc acg ccg tat gtt att gcc ggg aaa agt gta 5183Pro Phe Glu Ala
Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 cgt atc
acc gtt tgt gtg aac aac gaa ctg aac tgg cag act atc ccg 5231Arg Ile
Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140
ccg gga atg gtg att acc gac gaa aac ggc aag aaa aag cag tct tac
5279Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr
145 150 155 160 ttc cat gat ttc ttt aac tat gcc gga atc cat cgc agc
gta atg ctc 5327Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser
Val Met Leu 165 170 175 tac acc acg ccg aac acc tgg gtg gac gat atc
acc gtg gtg acg cat 5375Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile
Thr Val Val Thr His 180 185 190 gtc gcg caa gac tgt aac cac gcg tct
gtt gac tgg cag gtg gtg gcc 5423Val Ala Gln Asp Cys Asn His Ala Ser
Val Asp Trp Gln Val Val Ala 195 200 205 aat ggt gat gtc agc gtt gaa
ctg cgt gat gcg gat caa cag gtg gtt 5471Asn Gly Asp Val Ser Val Glu
Leu Arg Asp Ala Asp Gln Gln Val Val 210 215 220 gca act gga caa ggc
act agc ggg act ttg caa gtg gtg aat ccg cac 5519Ala Thr Gly Gln Gly
Thr Ser Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 ctc tgg
caa ccg ggt gaa ggt tat ctc tat gaa ctg tgc gtc aca gcc 5567Leu Trp
Gln Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255
aaa agc cag aca gag tgt gat atc tac ccg ctt cgc gtc ggc atc cgg
5615Lys Ser Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg
260 265 270 tca gtg gca gtg aag ggc gaa cag ttc ctg att aac cac aaa
ccg ttc 5663Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys
Pro Phe 275 280 285
tac ttt act ggc ttt ggt cgt cat gaa gat gcg gac ttg cgt ggc aaa
5711Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys
290 295 300 gga ttc gat aac gtg ctg atg gtg cac gac cac gca tta atg
gac tgg 5759Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met
Asp Trp 305 310 315 320 att ggg gcc aac tcc tac cgt acc tcg cat tac
cct tac gct gaa gag 5807Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr
Pro Tyr Ala Glu Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc
atc gtg gtg att gat gaa act 5855Met Leu Asp Trp Ala Asp Glu His Gly
Ile Val Val Ile Asp Glu Thr 340 345 350 gct gct gtc ggc ttt aac ctc
tct tta ggc att ggt ttc gaa gcg ggc 5903Ala Ala Val Gly Phe Asn Leu
Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa
ctg tac agc gaa gag gca gtc aac ggg gaa act 5951Asn Lys Pro Lys Glu
Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg
cac tta cag gcg att aaa gag ctg ata gcg cgt gac aaa 5999Gln Gln Ala
His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395 400
aac cac cca agc gtg gtg atg tgg agt att gcc aac gaa ccg gat acc
6047Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr
405 410 415 cgt ccg caa ggt gca cgg gaa tat ttc gcg cca ctg gcg gaa
gca acg 6095Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu
Ala Thr 420 425 430 cgt aaa ctc gac ccg acg cgt ccg atc acc tgc gtc
aat gta atg ttc 6143Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val
Asn Val Met Phe 435 440 445 tgc gac gct cac acc gat acc atc agc gat
ctc ttt gat gtg ctg tgc 6191Cys Asp Ala His Thr Asp Thr Ile Ser Asp
Leu Phe Asp Val Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat
gtc caa agc ggc gat ttg gaa acg 6239Leu Asn Arg Tyr Tyr Gly Trp Tyr
Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg
gaa aaa gaa ctt ctg gcc tgg cag gag aaa ctg 6287Ala Glu Lys Val Leu
Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 cat cag ccg
att atc atc acc gaa tac ggc gtg gat acg tta gcc ggg 6335His Gln Pro
Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg
cac tca atg tac acc gac atg tgg agt gaa gag tat cag tgt gca 6383Leu
His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520
525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc agc gcc gtc gtc
6431Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val
530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc tcg caa
ggc ata 6479Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln
Gly Ile 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg atc ttc
act cgc gac cgc aaa 6527Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe
Thr Arg Asp Arg Lys 565 570 575 ccg aag tcg gcg gct ttt ctg ctg caa
aaa cgc tgg act ggc atg aac 6575Pro Lys Ser Ala Ala Phe Leu Leu Gln
Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag
gga ggc aaa caa tga atcaacaact 6621Phe Gly Glu Lys Pro Gln Gln Gly
Gly Lys Gln 595 600 ctcctggcgc accatcgtcg gctacagcct cgggaattgc
taccgagctc gaatttcccc 6681gatcgttcaa acatttggca ataaagtttc
ttaagattga atcctgttgc cggtcttgcg 6741atgattatca tataatttct
gttgaattac gttaagcatg taataattaa catgtaatgc 6801atgacgttat
ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac
6861gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc
ggtgtcatct 6921atgttactag atcgggaatt cgtaatcatg gtcatagtcg
agtcgacgtt ccttgacagg 6981atatattggc gggtaaacta agtcgctgta
tgtgtttgtt tgagatcctc tagggcatgc 7041aggctcgcgg cggacgcacg
acgccggggc gagaccatag gcgatctcct aaatcaatag 7101tagctgtaac
ctcgaagcgt ttcacttgta acaacgattg agaatttttg tcataaaatt
7161gaaatacttg gttcgcattt ttgtcatccg cggtcagccg caattctgac
gaactgccca 7221tttagctgga gatgattgta catccttcac gtgaaaattt
ctcaagcgct gtgaacaagg 7281gttcagattt tagattgaaa ggtgagccgt
tgaaacacgt tcttcttgtc gatgacgacg 7341tcgctatgcg gcatcttatt
attgaatacc ttacgatcca cgccttcaaa gtgaccgcgg 7401tagccgacag
cacccagttc acaagagtac tctcttccgc gacggtcgat gtcgtggttg
7461ttgatctaaa tttaggtcgt gaagatgggc tcgagatcgt tcgtaatctg
gcggcaaagt 7521ctgatattcc aatcataatt atcagtggcg accgccttga
ggagacggat aaagttgttg 7581cactcgagct aggagcaagt gattttatcg
ctaagccgtt cagtatcaga gagtttctag 7641cacgcattcg ggttgccttg
cgcgtgcgcc ccaacgttgt ccgctccaaa gaccgacggt 7701ctttttgttt
tactgactgg acacttaatc tcaggcaacg tcgcttgatg tccgaagctg
7761gcggtgaggt gaaacttacg gcaggtgagt tcaatcttct cctcgcgttt
ttagagaaac 7821cccgcgacgt tctatcgcgc gagcaacttc tcattgccag
tcgagtacgc gacgaggagg 7881tttatgacag gagtatagat gttctcattt
tgaggctgcg ccgcaaactt gaggcggatc 7941cgtcaagccc tcaactgata
aaaacagcaa gaggtgccgg ttatttcttt gacgcggacg 8001tgcaggtttc
gcacgggggg acgatggcag cctgagccaa ttgcatttgc ctcttaatta
8061tctggctcaa agggtgactg aggagtaagc gatgtgccca tcacactgcg
catgcaagct 8121gatctggatc t 813259603PRTHordeum vulgare 59Met Leu
Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Lys Lys Leu Asp 1 5 10 15
Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly Ile Asp Gln 20
25 30 Arg Trp Trp Glu Ser Ala Leu Gln Glu Ser Arg Ala Ile Ala Val
Pro 35 40 45 Gly Ser Phe Asn Asp Gln Phe Ala Asp Ala Asp Ile Arg
Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gln Arg Glu Val Phe Ile
Pro Lys Gly Trp Ala 65 70 75 80 Gly Gln Arg Ile Val Leu Arg Phe Asp
Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val Asn Asn Gln Glu
Val Met Glu His Gln Gly Gly Tyr Thr 100 105 110 Pro Phe Glu Ala Asp
Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Val 115 120 125 Arg Ile Thr
Val Cys Val Asn Asn Glu Leu Asn Trp Gln Thr Ile Pro 130 135 140 Pro
Gly Met Val Ile Thr Asp Glu Asn Gly Lys Lys Lys Gln Ser Tyr 145 150
155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met
Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp Ile Thr Val
Val Thr His 180 185 190 Val Ala Gln Asp Cys Asn His Ala Ser Val Asp
Trp Gln Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu Leu Arg
Asp Ala Asp Gln Gln Val Val 210 215 220 Ala Thr Gly Gln Gly Thr Ser
Gly Thr Leu Gln Val Val Asn Pro His 225 230 235 240 Leu Trp Gln Pro
Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 Lys Ser
Gln Thr Glu Cys Asp Ile Tyr Pro Leu Arg Val Gly Ile Arg 260 265 270
Ser Val Ala Val Lys Gly Glu Gln Phe Leu Ile Asn His Lys Pro Phe 275
280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly
Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu
Met Asp Trp 305 310 315 320 Ile Gly Ala Asn Ser Tyr Arg Thr Ser His
Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp Glu His
Gly Ile Val Val Ile Asp Glu Thr 340 345 350 Ala Ala Val Gly Phe Asn
Leu Ser Leu Gly Ile Gly Phe Glu Ala Gly 355 360 365 Asn Lys Pro Lys
Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 Gln Gln
Ala His Leu Gln Ala Ile Lys Glu Leu Ile Ala Arg Asp Lys 385 390 395
400 Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thr
405 410 415 Arg Pro Gln Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu
Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro Ile Thr Cys Val
Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr Ile Ser Asp
Leu Phe Asp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly Trp Tyr
Val Gln Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys Val Leu
Glu Lys Glu Leu Leu Ala Trp Gln Glu Lys Leu 485 490 495 His Gln Pro
Ile Ile Ile Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 Leu
His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gln Cys Ala 515 520
525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val
530 535 540 Gly Glu Gln Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gln
Gly Ile 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly Ile Phe
Thr Arg Asp Arg Lys 565 570 575 Pro Lys Ser Ala Ala Phe Leu Leu Gln
Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro Gln Gln
Gly Gly Lys Gln 595 600
* * * * *
References