U.S. patent application number 15/354604 was filed with the patent office on 2017-03-09 for nucleic acid constructs encoding reprogramming factors linked by self-cleaving peptides.
The applicant listed for this patent is Whitehead Institute for Biomedical Research. Invention is credited to Bryce Woodbury Carey, Rudolf Jaenisch.
Application Number | 20170067081 15/354604 |
Document ID | / |
Family ID | 41417431 |
Filed Date | 2017-03-09 |
United States Patent
Application |
20170067081 |
Kind Code |
A1 |
Jaenisch; Rudolf ; et
al. |
March 9, 2017 |
NUCLEIC ACID CONSTRUCTS ENCODING REPROGRAMMING FACTORS LINKED BY
SELF-CLEAVING PEPTIDES
Abstract
The disclosure relates to a method of reprogramming one or more
somatic cells, e.g., partially differentiated or fully/terminally
differentiated somatic cells, to a less differentiated state, e.g.,
a pluripotent or multipotent state. In further embodiments the
invention also relates to reprogrammed somatic cells produced by
methods of the invention, to chimeric animals comprising
reprogrammed somatic cells of the invention, to uses of said cells,
and to methods for identifying agents useful for reprogramming
somatic cells.
Inventors: |
Jaenisch; Rudolf;
(Brookline, MA) ; Carey; Bryce Woodbury; (New
York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Whitehead Institute for Biomedical Research |
Cambridge |
MA |
US |
|
|
Family ID: |
41417431 |
Appl. No.: |
15/354604 |
Filed: |
November 17, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12997815 |
Oct 21, 2011 |
9497943 |
|
|
PCT/US2009/047423 |
Jun 15, 2009 |
|
|
|
15354604 |
|
|
|
|
61061525 |
Jun 13, 2008 |
|
|
|
61077068 |
Jun 30, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2740/15041
20130101; C12N 5/0696 20130101; C12N 2501/608 20130101; C12N
2740/16043 20130101; G01N 33/5008 20130101; C12N 2510/00 20130101;
C12N 2501/602 20130101; C12N 2740/15043 20130101; C12N 2501/603
20130101; C12N 15/85 20130101; C12N 2501/606 20130101; C12N
2800/108 20130101; C12N 5/0606 20130101; C12N 2501/604 20130101;
C12N 2506/11 20130101; C12N 2506/115 20130101; C12N 15/79 20130101;
C07K 14/4705 20130101; C12N 15/86 20130101; A01K 67/0271 20130101;
C12N 2501/605 20130101; C12N 2501/60 20130101; C12N 2799/027
20130101; C12N 2840/203 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86; C07K 14/47 20060101 C07K014/47 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention was made with government support under
5-RO1-HD045022, 5-R37-CA084198 and 5-RO1-CA087869 awarded by The
National Institutes of Health. The government has certain rights in
the invention.
Claims
1. A nucleic acid construct comprising at least three coding
regions, a first coding region encoding a first reprogramming
factor, a second coding region encoding a second reprogramming
factor, and a third coding region that encodes a third
reprogramming factor, wherein the first and second coding regions
are linked by a nucleic acid that encodes a first self-cleaving
peptide and the second and third coding regions are linked by a
nucleic acid that encodes a second self-cleaving peptide so as to
form a single open reading frame, wherein expression of the first,
second, and third reprogramming factors is sufficient for
reprogramming a mammalian somatic cell to pluripotency, and wherein
the nucleic acid construct does not comprise Oct 3/4, Sox 2 and
Klf4 ligated across the 2A sequence of foot-and-mouth disease virus
in the order of Oct 3/4, Klf4 and Sox2.
2. The nucleic acid construct of claim 1, further comprising a
fourth coding region that encodes a fourth reprogramming
factor.
3. The nucleic acid construct of claim 1, wherein: the first or
second self-cleaving peptide is a viral 2A peptide or the first and
second self-cleaving peptide are a viral 2A peptide.
4. The nucleic acid construct of claim 3, wherein the viral 2A
peptide is an aphthovirus 2A peptide.
5. The nucleic acid construct of claim 3, wherein the viral 2A
peptide is selected from the group consisting of: a foot-and-mouth
disease virus (FMDV) peptide, an equine rhinitis A virus (ERAV) 2A
peptide, a Thosea asigna virus (TaV) 2A peptide, a porcine
teschovirus-1 (PTV-1) 2A peptide, a Theilovirus 2A peptide, and an
encephalomyocarditis virus 2A peptide.
6. The nucleic acid construct of claim 1, wherein the coding
regions encode a set of reprogramming factors comprise at least
Oct4.
7. The nucleic acid construct of claim 1, wherein the coding
regions encode a set of reprogramming factors selected from the
group consisting of Oct4, Klf4, and Sox2.
8. The nucleic acid construct of claim 1, wherein: (a) the
reprogramming factors are selected from the group consisting of:
Oct4, Nanog, Sox2, Klf4, and Lin28; or (b) the construct does not
encode one of the reprogramming factors selected from the group
consisting of: Oct4, Klf4, Sox2, c-Myc, Lin28, and Nanog.
9. An expression cassette comprising: the nucleic acid construct of
claim 1 operably linked to a promoter, wherein the promoter drives
transcription of a polycistronic message that encodes the
reprogramming factors.
10. An expression vector comprising: the expression cassette of
claim 9.
11. The expression cassette of claim 10, further comprising one or
more sites that mediate integration into the genome of a mammalian
cell.
12. The expression vector of claim 10, wherein (a) the vector is
retroviral, viral, or a plasmid; or (b) the promoter is
inducible.
13. An isolated mammalian cell comprising: the expression cassette
of claim 10.
14. The isolated mammalian cell of claim 13, wherein the cell
expresses three reprogramming factors from the expression
cassette.
15. The isolated mammalian cell of claim 13, wherein the cell
expresses three reprogramming factors from the expression cassette,
wherein the three reprogramming factors are not sufficient to
reprogram mammalian fibroblasts with an efficiency of at least
0.05%.
16. The isolated mammalian cell of claim 13, wherein: (a) the cell
is selected from the group consisting of: a somatic cell, a
terminally differentiated somatic cell, and an iPS cell; or (b) the
cell is a human cell; or (c) the cell further comprises a reporter
gene integrated at a locus whose activation serves as a marker of
reprogramming to pluripotency.
17. The isolated mammalian cell of claim 13, wherein the cell
expresses three reprogramming factors from the expression cassette,
wherein the three reprogramming factors are sufficient to reprogram
mammalian fibroblasts with an efficiency of at least 0.05%.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/997,815, filed Oct. 21, 2011, now U.S. Pat.
No. 9,497,943, which is a national stage filing under 35 U.S.C. 371
of International Application No. PCT/US2009/047423, filed Jun. 15,
2009, which claims the benefit of U.S. Provisional Application No.
61/061,525, filed Jun. 13, 2008, and U.S. Provisional Application
No. 61/077,068, filed Jun. 30, 2008. The entire teachings of these
applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] Embryonic development and cellular differentiation are
considered unidirectional pathways because cells undergo a
progressive loss of developmental potency during cell fate
specification. Two categories of pluripotent stem cells are known
to date: embryonic stem cells and embryonic germ cells. Embryonic
stem cells are pluripotent stem cells that are derived directly
from an embryo. Embryonic germ cells are pluripotent stem cells
that are derived directly from the fetal tissue of aborted fetuses.
For purposes of simplicity, embryonic stem cells and embryonic germ
cells will be collectively referred to as "ES" cells herein.
[0004] The generation of live animals by nuclear transfer (NT)
demonstrated that the epigenetic state of somatic cells, including
that of terminally differentiated cells, is labile and can be reset
to an embryonic state that is capable of directing development of a
new organism. The nuclear cloning technology is of potential
interest for transplantation medicine but any medical application
is hampered by the inefficiency of the cloning process, the lack of
knowledge of the underlying mechanisms and ethical concerns. A
major breakthrough in solving these issues has been the in vitro
derivation of reprogrammed somatic cells (designated as "induced
Pluripotent Stem" or "iPS" cells) by the ectopic expression of the
four transcription factors Oct4, Sox2, c-myc and Klf4 by Yamanaka
(designated below as "reprogramming factors" or "factors")
(Takahashi and Yamanaka, Cell 126:663-676 (2006)).
[0005] Further advancement in the area of reprogramming would be
facilitated by establishing robust methods for reprogramming human
somatic cells and defining effective protocols for manipulating
human ES and iPS cells.
SUMMARY OF THE INVENTION
[0006] The invention relates generally to the dedifferentiation of
differentiated somatic cells, to methods of generating secondary
iPS cells and the secondary iPS cells produced by the methods, to
chimeric animals, e.g., mice, produced from said secondary iPS
cells, and to methods of screening for reprogramming agents
utilizing the secondary iPS cells and chimeric animals.
[0007] In one embodiment the invention relates to a method of
reprogramming a differentiated somatic cell to a pluripotent state,
comprising the steps of contacting a differentiated somatic cell
with at least one reprogramming agent that contributes to
reprogramming of said cell to a pluripotent state; maintaining said
cell under conditions appropriate for proliferation of the cell and
for activity of the at least one reprogramming agent for a period
of time sufficient to begin reprogramming of the cell; and
functionally inactivating the at least one reprogramming agent.
[0008] In another embodiment the invention relates to a method of
reprogramming a differentiated somatic cell to a pluripotent state,
comprising the steps of providing a differentiated somatic cell
that contains at least one exogenously introduced factor that
contributes to reprogramming of said cell to a pluripotent state;
maintaining the cell under conditions appropriate for proliferation
of the cell and for activity of the at least one exogenously
introduced factor for a period of time sufficient to activate at
least one endogenous pluripotency gene; and functionally
inactivating the at least one exogenously introduced factor.
[0009] In a further embodiment the invention pertains to a method
of selecting a differentiated somatic cell that has been
reprogrammed to a pluripotent state, comprising the steps of
providing a differentiated somatic cell that contains at least one
exogenously introduced factor that contributes to reprogramming of
the cell to a pluripotent state; maintaining the cell under
conditions appropriate for proliferation of the cell and for
activity of the at least one exogenously introduced factor for a
period of time sufficient to activate at least one endogenous
pluripotency gene; functionally inactivating the at least one
exogenously introduced factor; and differentiating or
distinguishing between cells which display one or more markers of
pluripotency and cells which do not. In one embodiment
differentiating or distinguishing between cells which display one
or more markers of pluripotency and cells which do not comprises
selection or enrichment for cells displaying one or more markers of
pluripotency and/or selection against cells which do not display
one or more markers of pluripotency.
[0010] In some embodiments of the invention the differentiated
somatic cell is partially differentiated. In other embodiments of
the invention the differentiated somatic cell is fully
differentiated.
[0011] In some embodiments of the invention the differentiated
somatic cell is cell of hematopoetic lineage or is a mesenchymal
stem cell; in some embodiments the differentiated somatic cell is
obtained from peripheral blood. In one embodiment of the invention
the differentiated somatic cell is an immune system cell. In one
embodiment the differentiated somatic cell is a macrophage. In one
embodiment the differentiated somatic cell is a lymphoid cell. In
other embodiments of the invention the differentiated somatic cell
is a B cell, such as an immature (e.g., pro-B cell or pre-B cell)
or mature (e.g., non-naive) B-cell. In still other embodiments the
differentiated cell is a neural progenitor cell, an adrenal gland
cell, a keratinocyte, a muscle cell, or an intestinal epithelium
cell.
[0012] In some embodiments of the invention the at least one
exogenously introduced factor is a polynucleotide. In other
embodiments the at least one exogenously introduced factor is a
polypeptide. In one embodiment the at least one exogenously
introduced factor is selected from the group consisting of Oct4,
Sox2, Klf-4, Nanog, Lin28, c-Myc and combinations thereof. In
particular embodiments of the invention the differentiated somatic
cell contains exogenously introduced Oct4, Sox2, and Klf-4
exogenously introduced Oct4, Sox2, Klf-4 and c-Myc.
[0013] In one embodiment of the invention the at least one
exogenously introduced factor is selected from the group consisting
of Oct4, Sox2, Klf-4, c-Myc and combinations thereof and the
differentiated somatic cell further contains at least one
exogenously introduced factor (e.g., a polynucleotide or
polypeptide) capable of inducing dedifferentiation of the
differentiated somatic cell. In some embodiments the factor capable
of inducing dedifferentiation of said differentiated somatic cell
is selected from the group consisting of at least one
polynucleotide which downregulates B cell late specific markers, at
least one polynucleotide which inhibits expression of Pax5, at
least one polypeptide which downregulates B cell late specific
markers, at least one polypeptide which inhibits expression of
Pax5, and combinations thereof. In one embodiment of the invention
the factor capable of inducing dedifferentiation of said
differentiated somatic cell is C/EBP.alpha. or a human homolog of
C/EBP.alpha..
[0014] In particular embodiments of the invention the at least one
exogenously introduced factor is introduced using a vector, e.g.,
an inducible vector or a conditionally expressed vector. In one
aspect the at least one exogenously introduced factor is introduced
using a vector which is not subject to methylation-mediated
silencing. In yet another embodiment the at least one exogenously
introduced factor is introduced using a viral vector such as a
retroviral or lentiviral vector.
[0015] The present invention also provides methods for producing a
cloned animal. In the methods, a somatic cell is isolated from an
animal having desired characteristics, and reprogrammed using the
methods of the invention to produce one or more reprogrammed
pluripotent somatic cell ("RPSC"). The RPSCs are then inserted into
a recipient embryo, and the resulting embryo is cultured to produce
an embryo of suitable size for implantation into a recipient
female, which is then transferred into a recipient female to
produce a pregnant female. The pregnant female is maintained under
conditions appropriate for carrying the embryo to term to produce
chimeric animal progeny. The chimeric animal can furter be mated to
a wild type animal as desired. The invention further relates to a
chimeric animal, e.g., a chimeric mouse, produced by the methods of
the invention.
[0016] The invention further relates to an isolated pluripotent
cell produced by a method comprising (a) providing a differentiated
somatic cell that contains at least one exogenously introduced
factor that contributes to reprogramming of said cell to a
pluripotent state; (b) maintaining said cell under conditions
appropriate for proliferation of said cell and for activity of said
at least one exogenously introduced factor for a period of time
sufficient to activate at least one endogenous pluripotency gene;
(c) functionally inactivating said at least one exogenously
introduced factor; and (d) differentiating cells which display one
or more markers of pluripotency from cells which do not.
[0017] The invention also relates to a purified population of
somatic cells comprising at least 70% pluripotent cells derived
from reprogrammed differentiated somatic cells produced by a method
comprising (a) providing a differentiated somatic cell that
contains at least one exogenously introduced factor that
contributes to reprogramming of said cell to a pluripotent state;
(b) maintaining said cell under conditions appropriate for
proliferation of said cell and for activity of said at least one
exogenously introduced factor for a period of time sufficient begin
reprogramming of said cell or to activate at least one endogenous
pluripotency gene; (c) functionally inactivating said at least one
exogenously introduced factor; and (d) differentiating cells which
display one or more markers of pluripotency and cells which do
not.
[0018] In another aspect the invention relates to a method of
producing a pluripotent cell from a somatic cell, comprising the
steps of (a) providing one or more somatic cells that each contain
at least one exogenously introduced factor that contributes to
reprogramming of said cell to a pluripotent state, wherein said
exogenously introduced factor is introduced using an inducible
vector which is not subject to methylation-induced silencing; (b)
maintaining said one or more cells under conditions appropriate for
proliferation of said cells and for activity of said at least one
exogenously introduced factor for a period of time sufficient begin
reprogramming of said cell or to activate at least one endogenous
pluripotency gene; (c) functionally inactivating said at least one
exogenously introduced factor; (d) selecting one or more cells
which display a marker of pluripotency; (e) generating a chimeric
embryo utilizing said one or more cells which display a marker of
pluripotency; (f) obtaining one or more somatic cells from said
chimeric embryo; (g) maintaining said one or more somatic cells
under conditions appropriate for proliferation of said cells and
for activity of said at least one exogenously introduced factor for
a period of time sufficient to begin reprogramming said cell or to
activate at least one endogenous pluripotency gene; and (h)
differentiating between cells which display one or more markers of
pluripotency and cells which do not. In a particular embodiment the
method yields a purified population of somatic cells comprising at
least 70% pluripotent cells derived from reprogrammed
differentiated somatic cells
[0019] The invention also relates to an isolated pluripotent cell
produced by a method comprising (a) providing one or more somatic
cells that each contain at least one exogenously introduced factor
that contributes to reprogramming of said cell to a pluripotent
state, wherein said exogenously introduced factor is introduced
using an inducible vector which is not subject to
methylation-induced silencing; (b) maintaining said one or more
cells under conditions appropriate for proliferation of said cells
and for activity of said at least one exogenously introduced factor
for a period of time sufficient to begin reprogramming said cell or
to activate at least one endogenous pluripotency gene; (c)
functionally inactivating said at least one exogenously introduced
factor; (d) selecting one or more cells which display a marker of
pluripotency; (e) generating a chimeric embryo utilizing said one
or more cells which display a marker of pluripotency; (f) obtaining
one or more somatic cells from said chimeric embryo; (g)
maintaining said one or more somatic cells under conditions
appropriate for proliferation of said cells and for activity of
said at least one exogenously introduced factor for a period of
time sufficient to activate at least one endogenous pluripotency
gene; and (h) differentiating cells which display one or more
markers of pluripotency and cells which do not.
[0020] In preferred embodiments of the invention the methods yield
a purified population of somatic cells comprising at least 70%
(e.g., 70%, 75%, 80%, 85%, 90%, 95%, 99%) pluripotent cells derived
from reprogrammed differentiated somatic cells. In particular
embodiments the pluripotent cells are genetically homogenous.
[0021] The invention also relates to a method of identifying a
reprogramming agent comprising (a) providing one or more somatic
cells that each contain at least one exogenously introduced factor
that contributes to reprogramming of said cell to a pluripotent
state, wherein each of said exogenously introduced factors is
introduced using an inducible vector which is not subject to
methylation-induced silencing and the expression of which is
controlled by regulatory elements induced by distinct inducers; (b)
maintaining said one or more cells under conditions appropriate for
proliferation of said cells and for activity of said at least one
exogenously introduced factor for a period of time sufficient to
reprogram said cell or to activate at least one endogenous
pluripotency gene; (c) functionally inactivating said at least one
exogenously introduced factor; (d) selecting one or more cells
which display a marker of pluripotency; (e) generating a chimeric
embryo utilizing said one or more cells which display a marker of
pluripotency; (f) obtaining one or more somatic cells from said
chimeric embryo; (g) maintaining said one or more somatic cells
under conditions appropriate for proliferation of said cells and
for activity of said at least one exogenously introduced factor
wherein activity of said at least one exogenously introduced factor
is insufficient by itself to activate at least one endogenous
pluripotency gene; (h) contacting the somatic cell of (g) with one
or more candidate reprogramming agents; and (i) identifying cells
contacted with said one or more candidate reprogramming agents
which display one or more markers of pluripotency, wherein
candidate reprogramming agents which induce the somatic cell of (g)
to display one or more markers of pluripotency are identified as
reprogramming agents.
[0022] The invention also relates to methods utilizing known
inducible promoter systems. As one example, inducible vectors,
e.g., DOX and tamoxifen inducible lentiviral vectors, are
encompassed. DOX inducible retroviral vectors have been important
to define the sequential activation of pluripotency markers and the
minimum time of vector expression during reprogramming of somatic
mouse cells. As described herein we have generated inducible
lentiviral vectors that will allow the temporally restricted
expression of the reprogramming factors. Following the same
strategy as used for murine genes, we have generated lentiviral
vectors that transduce the human OCT4, SOX2, KLF4 and C-MYC c-DNAs
either constitutively or under the control of a DOX inducible
promoter. To generate a DOX inducible system we infected human
fibroblasts with a lentiviral vector carrying the rtTA
transactivator.
[0023] To enable independent inducible control of vectors we also
generated OCT4, SOX2 and C-MYC estrogen receptor (ER) fusion
constructs by fusing the factors to the estrogen ligand binding
domain to allow for tamoxifen dependent expression. Addition of
tamoxifen to cells transduced with a SOX2-ER fusion construct leads
to translocation of the SOX2 protein from the cytoplasm to the
nucleus as expected for drug induced activation. These results show
that the DOX and ER fusion inducible systems can be used to
independently control the expression of transduced factors.
[0024] One embodiment of the invention relates to the use of
multiple, e.g., two, different regulatable systems, each
controlling expression of a subset of the factors. For example, one
might place 3 of the factors under control of a first inducible
(e.g., dox-inducible) promoter and the 4th factor under control of
a second inducible (e.g., tamoxifen-inducible) promoter. Then, one
could generate an iPS cell by inducing expression from both
promoters, generate a mouse from this iPS cell, and isolate
fibroblasts (or any other cell type) from the mouse. These
fibroblasts would be genetically homogenous and would be
reprogrammable without need for viral infection. One would then
attempt to reprogram the fibroblasts under conditions in which only
the first promoter is active, in the presence of different small
molecules that could potentially substitute for the 4th factor, in
order to identify small molecule "reprogramming agents" or optimize
transient transfection or other protocols for introducing the 4th
factor. A number of variations are possible; for example, one might
stably induce expression of 3 factors and transiently induce
expression of the 4th factor, etc. Any combination of factors can
be assessed using the described methods. Also, one can modulate
expression levels of the factors by using different concentrations
of inducing agent.
[0025] Another approach is to place the gene that encodes one of
the factors between sites for a recombinase and then induce
expression of the recombinase to turn off expression of that
factor. For example, a heterologous sequence could be positioned
between the promoter and the coding sequence, wherein the
heterologous sequence is located between sites for a recombinase;
the heterologous sequence prevents expression. A recombinase is
introduced into the cells (e.g., by introducing an expression
vector that encodes the recombinase, e.g., Adenovirus-Cre) and
causes excision of the heterologous sequence, thereby allowing
expression of the transgene. Also, transgenes can be integrated at
a variety of non-essential loci (e.g., loci whose disruption
doesn't significantly affect development, exemplified by Collagen I
or Rosa26 loci).
[0026] These systems are useful, e.g., for identifying
reprogramming agents and studying the requirements and events that
occur in reprogramming (including discovering cell-type specific
differences).
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0028] FIGS. 1A-1D illustrate the generation of genetically
homogenous cell cultures for epigenetic reprogramming. FIG. 1A
shows a scheme for infection of puromycin-resistant, Nanog-GFP or
Nanog-neo primary MEFs expressing the reverse tetracycline
transactivator (M2rtTA) with dox-inducible lentiviruses encoding
the 4 reprogramming factors followed by induction of reprogramming,
primary iPS colony selection, dox withdrawal, chimera formation,
and puromycin selection for iPS-derived secondary somatic cells.
FIG. 1B illustrates that NNeo secondary MEFs isolated from chimeras
undergo complete epigenetic reprogramming. Dox-independent cultures
express the pluripotency-associated genes alkaline phosphatase,
SSEA1, and Nanog. FIG. 1C shows that MEF-derived NNeo and NGFP2
secondary iPS cells generate cells of all three germ layers in
teratoma formation assays, and contribute to chimera formation when
injected into blastocysts, as indicated by the presence of
iPS-derived agouti coat color on a black background (FIG. 1D).
[0029] FIGS. 2A-2E illustrate that reprogramming kinetics and
efficiencies vary between MEFs from distinct iPS cell lines. As
shown in FIG. 2A, secondary MEFs from three `primary` iPS cell
lines were treated with dox and reprogramming was monitored
visually. The different MEF populations exhibited morphologic
differences 6 days after dox administration, but all formed
colonies with ES cell morphology within 12 days (arrows). FIG. 2B
shows that neomycin resistant and alkaline phosphate positive
colonies were present in NNeo cultures when the drug was added to
the media as early as day 4 after dox induction. FIG. 2C
illustrates flow cytometric analysis for reactivation of SSEA1 and
the Nanog-GFP reporter allele (in NGFP2 and NGFP3 lines) over 18
days of dox culture. As shown in FIG. 2D secondary NGFP2 MEFs were
plated at densities varying from 0.025-500 cells/mm.sup.2 followed
by dox addition. GFP+ colonies were counted 4 weeks later. As shown
in FIG. 2E, single secondary MEFs were plated in 96 well plates
containing a .gamma.-irradiated MEF feeder layer followed by dox
induction. The percentage of single cells able to proliferate
sufficiently to form a visible colony on the MEF feeder layer
(light grey bars) and the percentage of single cells able to form
GFP+ or Neo resistant secondary iPS colonies (dark grey bars) were
scored 4 weeks later.
[0030] FIGS. 3A-3F show the requirement and expression of 4 factor
transgenes in secondary MEFs. FIG. 3A shows quantitative RT-PCR
examining induction of expression of the 4 reprogramming factors in
response to 72 hours of dox treatment, relative to Gapdh levels.
FIG. 3B shows immunofluorescence detection of Oct4 and Sox2 in
secondary MEF cultures 72 hours after dox induction. As shown in
FIG. 3C, NGFP2 secondary MEFs were cultured in the presence of dox
for the indicated time (5-22 days, red bars) followed by dox
withdrawal. Cultures were monitored daily for the first instance of
GFP activation (green bars). Blue bars indicate periods in which
GFP+ colonies appeared during dox treatment. FIG. 3D shows that
NGFP2 MEFs were cultured in the presence of dox for 10-15 days, at
which point dox was withdrawn, and GFP+ colonies were scored at day
34. As illustrated in FIG. 3E NGFP2 MEFs were cultured in the
presence of dox for either 9 (blue) or 22 days (red line), and the
appearance of GFP+ colonies was scored daily until day 29. Note the
appearance of GFP-positive colonies as late as 15 days after dox
withdrawal (blue line). As illustrated in FIG. 3F, NGFP3 secondary
MEFs were cultured in the presence or absence of dox, dox+5-Aza, or
dox+TSA, and GFP+ colonies were scored 3 weeks later.
[0031] FIGS. 4A-4N show reprogramming of intestinal epithelial
cells. As shown in FIG. 4A, NNeo secondary intestinal epithelial
crypt-villus structures were isolated from chimeras, and after 24
hours of culture in the presence of dox, spheroids began appearing
in suspension (FIG. 4B, inset). FIG. 4C illustrates that within 72
hours of dox culture, suspended spheroids attached to the
.gamma.-irradiated feeder layer and took on ES-like morphology. As
shown in FIG. 4D, colonies continued to grow during two weeks of
dox treatment, but differentiated and became indistinguishable from
the feeder layer upon dox withdrawal (FIG. 4E). FIG. 4F shows that
sox-dependent intestinal epithelial colonies were neomycin
resistant two weeks after dox administration. FIG. 4G shows
bisulfite sequencing of the endogenous Oct4 and Nanog promoters in
freshly isolated NNeo secondary intestinal epithelium, partially
reprogrammed dox dependent cells, fully reprogrammed NNeo iPS cells
after infection with Sox2 and Klf4 viruses. As shown in FIG. 4H,
qRT-PCR analyses of expression of the 4 factors and Nanog revealed
that dox-dependent NNeo intestinal epithelial colonies express high
levels of Oct4 and cMyc in comparison with ES cells, but very low
amounts of Sox2 and Klf4. FIG. 4I shows that NGFP2 secondary
intestinal epithelial cells formed spheroids in suspension within
24 hours of dox addition and took on ES-like morphology within 72
hours (FIG. 4J). FIGS. 4K and 4L illustrates that NGFP2 intestinal
epithelium gave rise to dox-independent secondary iPS colonies that
express GFP from the endogenous Nanog locus. As shown in FIG. 4M,
EDTA-DTT based fractionation of intestinal villi from
differentiated cells of the tip (fraction 1) to the progenitor
cells of the crypt (fraction 7).sup.28 followed by 4 days dox
induction demonstrates that crypt fractions in both NNeo and NGFP2
secondary lines are more efficient at initial colony formation. As
shown in FIG. 4N, qRT-PCR analysis showed that with the exception
of Klf4, the transgenes were more efficiently induced in fraction 7
(crypt) than in fraction 1 (villus tip) of the NNeo and NGFP2
intestinal epithelial cells.
[0032] FIGS. 5A-5L show reprogramming of other somatic cell types.
FIGS. 5A and 5B show NNeo mesenchymal stem cells (MSCs) before and
after 3 weeks of dox administration. FIGS. 5C and 5D show NGFP2
MSCs before and after 10 days of dox treatment forming ES-like
colonies. FIGS. 5E and 5F show that NGFP2 MSCs gave rise to
dox-independent iPS colonies that express GFP from the endogenous
Nanog locus. As shown in FIG. 5G, colonies of dermal keratinocytes
from NNeo chimeras with typical epithelial morphology (inset) began
to exhibit ES cell morphology within 12 days of dox treatment (FIG.
5H). These cells fully reprogrammed to form neomycin resistant
secondary iPS colonies (FIG. 5I). As illustrated in FIG. 5J, after
expansion in serum-free media, plated NNeo-derived neurospheres
readily differentiated into astrocytic cells in response to dox and
serum-containing ES cell media. When plated neurosphere cells were
expanded in adherent conditions with EGF and FGF2 for another 3
weeks and then exposed to dox-containing media iPS cell-like
colonies appeared both in ES cell (FIG. 5K) and serum-free media
(FIG. 5L).
[0033] FIG. 6 shows that fully reprogrammed NGFP2 secondary MEFs
reactivated the endogenous Nanog locus, express Oct4, AP, and
SSEA1, and could be maintained in the absence of dox.
[0034] FIGS. 7A-7C show additional analysis. FIG. 7A shows qRT-PCR
analysis of endogenous Oct4, Sox2, Klf4, and c-Myc transcripts in
NGFP2 MEFs during the time course of reprogramming in response to
dox treatment. Also shown are expression levels in two ES cell RNA
preparations (V6.5 line) and the NGFP2 iPS cell line. FIG. 7B shows
a comparison of the interexperimental variability in iPS colony
formation efficiency between direct infection and the secondary
system. 3.times.10.sup.5 Oct4-neo MEFs' were infected with the 4
factors encoded by Moloney-based retroviral vectors on a 10 cm
plate, neomycin selection was initiated on day 6, and resistant
colonies were counted on day 20 (left--direct infection).
3.times.10.sup.4 secondary NGFP2 MEFs were plated in a 6 well dish,
exposed to dox-containing media, and GFP-positive colonies were
counted 3 weeks later (right--secondary system). The bars represent
colony numbers in each of the 4 independent experiments. FIG. 7C
shows Southern analysis of secondary iPS lines NGFP3, NGFP2, and
NNeo with Klf4, c-Myc, Sox2, and Oct4 cDNA probes. Endogenous bands
are marked with an arrow, and proviral insertions are marked with
an arrowhead, with the exception of Oct4 in the NNeo line, which is
a transgene targeted to the collagen I locus.
[0035] FIGS. 8A-8D show FIG. 8A shows NGFP2 secondary tail tip
fibroblasts successfully reprogrammed into dox-independent, GFP+
iPS cells. FIG. 8B shows that iPS cells derived from NGFP2
secondary intestinal epithelium express endogenous Nanog and SSEA1.
FIG. 8C shows that iPS cells derived from NGFP2 secondary
mesenchymal stem cells express endogenous Nanog and SSEA1. As shown
in FIG. 8D, primary mesenchymal stem cells harboring the reverse
tetracycline transactivator at the Rosa 26 locus and the Oct4
coding sequence under control of the Tet-operator16 were infected
with viruses encoding Sox2, c-Myc, and Klf4. Addition of dox to the
infected MSCs resulted in fully reprogrammed, dox-independent iPS
cells that express endogenous Nanog protein
(immunofluorescence).
[0036] FIGS. 9A-9G show successful reprogramming of cell cultures
derived from the adrenal gland (FIG. 9A), kidney (FIG. 9B), muscle
(FIG. 9C), keratinocytes (FIG. 9D), and neurospheres (FIG. 9E) of
NNeo secondary chimeras determined by dox independence, neomycin
resistance, and Nanog expression (red, immunofluorescence). FIG. 9F
shows secondary intestinal epithelium isolated from NNeo chimeras
and cultured in the presence of dox for 8, 10, or 12 days and
stained for alkaline phosphatase activity. As shown in FIG. 9G,
NNeo secondary intestinal epithelial cells became doxindependent
iPS cells after infection with additional Sox2 and Klf4 viruses.
Immunofluorescence analysis (red, top row) revealed expression of
Oct4, Sox2, Nanog, and SSEA1 in fully reprogrammed cells (blue,
bottom row represents the nuclear DAPI stain).
[0037] FIG. 10A-10D shows homologous insertion of GFP into the OCT4
locus. H9 huES cells were electroporated with the GFP-puroR gene
trap vector targeted to the 3' UTR of the OCT4 locus as shown in
FIG. 10A. A correctly targeted clones, identified by Southern
analysis (FIG. 10B) stained for GFP and was puro resistant (FIGS.
10C, 10D) when undifferentiated but the marker and drug resistance
genes were silenced when differentiated (not shown).
[0038] FIGS. 11A-11B show DOX and tamoxifen inducible factor
expression. As shown in FIG. 11A, human fibroblasts were infected
with lentivirus vectors carrying DOX inducible factors (Brambrink
et al., Cell Stem Cell, February 7, 2(2):151-159 (2008)). When DOX
was added to the cultures, analysis by qPCR detected strong factor
expression, whereas little if any transcript was seen in the
absence of DOX. Also, iPS cells derived from the infected
fibroblasts displayed DOX dependent expression (right two panels).
As shown in FIG. 11B, fibroblasts were infected with vectors
containing a SOX2-ER fusion construct. Tamoxifen addition to the
medium resulted in translocation of the cytoplasmic protein to the
nucleus indicating drug dependent protein activation.
[0039] FIGS. 12A-12C show generation of iPS cells from human
fibroblasts. As shown in FIG. 12A, OCT4 and NANOG expression was
quantitated by qPCR and shown to be in a similar range as in
control huES cells. FIG. 12B shows examples of iPS cells generated
from adult human fibroblasts. The human iPS cells formed tight
colonies and stained for SSEA4, TRA 160 and OCT4. FIG. 12C shows
teratomas with differentiated cell types formed after injection of
the iPS cells into SCID mice.
[0040] FIGS. 13A-13C show reprogramming of mouse fibroblasts after
transduction of the four factors via a polycistronic retroviral
vector. FIG. 13A shows a schematic illustration of vectors carrying
the four transcription factors Sox2, Oct4, Klf4 and c-myc, each
separated by 2A sequences or various combinations of 3 or 2
factors. As shown in FIG. 13B, fibroblasts were co-infected with
the 4 factor polycistronic vector shown in the upper part of the
panel and a single Oct4 virus. Reprogrammed iPS cells expressed
alkaline phosphatase (AP), SSEA1, Nanog and Oct4. FIG. 13C shows
the results of Southern blot analysis for proviral integrations of
3 independent iPS lines. The DNA was digested with Spe1 which
cleaves once in the PBS of the vector (giving 1 band per provirus)
and the blots were sequentially probed with a Sox2, Klf4, c-myc and
Oct4 probe. Lines 4FO#5 and #9 carried one and line 4FO#14 two
polycistronic vectors (one of the latter was truncated and had lost
the 5' cMYC sequences). However, hybridization with an Oct4 probe
revealed between 8 and 11 additional Oct4 proviruses.
[0041] FIGS. 14A-14E show generation of murine iPS cells using a
single 4F2A polycistronic virus. FIG. 14A shows FUW lentivirus
constructs tested by transient transfection (also shown in the
previous figure). In total four 2A peptides (F2A, T2A, E2A, and
P2A) were used. FIG. 14B shows transient transfection of 293 cells
with FUW 2A lentiviruses. Cells were harvested after 48 hours and
analyzed by western blot (WB). Efficient protein expression was
observed in all constructs tested, indicating four unique 2A
peptides support robust protein expression. NOTE: Sox2 protein is
not detected in ES cells because only a short exposure was used.
FIG. 14C shows a schematic of the 4F2A DOX-inducible lentivirus
containing three types of 2A peptides (P2A, T2A, and E2A). Murine
cDNAs for Oct4, Sox2, Klf4, and c-Myc. This particular sequence of
factors and 2A peptides is subsequently referred to as "4F2A." FIG.
14 D shows RT-PCR anaylsis of mRNA induction in cells transduced
with OSKM 4F2A+rtTA for 3-days. Total Oct4 or Sox2 induction was
used to test levels of 4F2A induction relative to ES cells.
E2A-cMyc primers were used to detect viral-specific transcripts.
Error bars represent s.d. of the mean of triplicate reactions. FIG.
14E shows the results of Western blot analysis of MEFs transduced
with 4F2A+rtTA for three days. Cells infected with 4F2A
DOX-inducible lentivirus+rtTA produce all four reprogramming
factors upon addition of doxycycline, DOX.
[0042] FIGS. 15A-15C illustrate that 4F2A iPS cells express
pluripotency markers. As shown in FIG. 15A, immunostaining of Oct4
protein indicates high titre infections can be achieved with the
4F2A. MEFs were cultured in DOX media for 2 days after transduction
with 4F2A+rtTA. FIG. 15B illustrates morphology changes in
NanogGFP-MEFs transduced with 4F2A+rtTA cultured in ES media+DOX.
Colonies appeared .about.8 days similar to cells infected with
single viruses, Nanog GFP+ colonies were observed by day 25 after
DOX media removal at day 20. Two columns show typical colonies
observed on the plate. FIG. 15C shows 4F2A iPS lines generated from
Nanog-GFP MEFs or 14-week tail-tip fibroblasts (TTFs) that stain
positive for pluripotency markers AP, SSEA1, Oct4 and have
reactivated the endogenous Nanog locus (GFP+ for MEFs and by
immunostaining for TTF).
[0043] FIGS. 16A-16C illustrates that 4F2A iPS cells are
pluripotent and contain between 1-3 proviral integrations. FIG. 16A
shows in vivo differentiation of 4F2A MEF-iPS lines #1, 2, and 4.
Histological analysis of teratomas induced after subcutaneous
injection into SCID mice indicates iPS lines contribute to all
three germ layers. FIG. 16B shows moderate to high contribution
postnatal chimeric mice as detected by agouti coat color from 4F2A
iPS line #4. FIG. 16C shows the results of Southern blot analysis
of 4F2A proviral integrations in MEF-iPS cell lines #1-4. iPS cell
DNA was digested with BamHI. Hybridization of the same molecular
weight fragment using all four probes indicates presence of 4F2A
provirus. Red arrow highlights iPS line #4 which contained one
proviral copy of the 4F2A. * indicates endogenous allele.
[0044] FIGS. 17A-17E show generation of human iPS lines using a
single 4F2A polycistronic virus. FIG. 17A shows Neonatal human
foreskin keritinocytes (NHFK) transduced with 4F2A (carrying mouse
cDNAs)+rtTA. On day 22 a single colony was picked and expanded,
giving rise to colonies resembling hES colonies. These colonies
were picked and a stable hiPS line was established. FIG. 17B shows
Ker hiPS #1.1 immunostaining for pluripotency markers AP, Oct4,
Nanog, SSEA-4, Tra1-60, and Tra1-81. DAPI stain is in lower panels.
FIG. 17C illustrates thatkaryotype of Ker hiPS #1.1 is normal 46
XY. FIG. 17D shows in vivo differentiation of Ker hiPS #1.1.
Hematoxylin and eosin staining of teratoma sections generated by
Ker hiPS #1.1. FIG. 17E shows in vitro differentiation of Ker hiPS
#1.1. (Left) Ker-iPS #1.1-derived neural precursors exposed to
differentiation conditions for 6 days produce terminally
differentiated neurons as detected by anti-Tuj1 immunostaining
(green). (Right) Ker-iPS #1.1 neural precursors (NPs) undergo
spontaneous differentiation. NPs were detected by anti-Nestin
immunostaining and differentiated neurons by anti-Tuj1 (red). DAPI
stain for DNA in both pictures is blue.
[0045] FIGS. 18A-18B show Southern blot of MEF-derived iPS lines
and dox-withdrawl, indicating 8 days is sufficient to generate iPS
lines. FIG. 18A shows Southern blot analysis of 4F2A MEF iPS lines.
A second digest was performed (XbaI) to confirm the proviral copy
number. In this digest iPS line #2 and #4 show 1 proviral copy,
however only #4 had 1 proviral copy in both digests. FIG. 18B shows
Dox-withdrawl after 8 days post-infection of Nanog GFP MEFs with
rtTA+OSKM generated two iPS lines. Both generated stable iPS lines
after 1-2 passages.
[0046] FIG. 19 shows relative efficiencies of reprogramming using
4F2A in MEFs. NanogGFP MEFs were infected with 4F2A+rtTA and
cultured in ES media (+/-DOX) for 48 hours. Cells were fixed and
stained for Oct4 protein. Estimated infection efficiency was
.about.70%. The same virus was also used to infect 0.2 5.times.10 6
Nanog GFP MEFs and cells were cultured on DOX for 20 days. After
withdrawl of DOX at day 20, GFP+ colonies were counted at day 25,
in three plates 10, 10, and 17 GFP+ colonies were observed.
[0047] FIGS. 20A-20B illustrate infection efficiency and
pluripotency analysis of keratinocyte-derived human iPS lines. FIG.
20A shows infection efficiency from two experiments as detected by
Oct4 immunostaining in Keratinocytes infected with 4F2A+rtTA and
cultured in hES media+DOX for 48 hours. Efficiency of infection was
.about.10-20% based on fraction of cells positive for Oct4 protein.
FIG. 20B shows human iPS lines stain positive for pluripotency
markers expressed in hES cells (Ker iPS #3 is shown).
[0048] FIGS. 21A-21B show proviral copy number of
Keratinocyte-derived human iPS lines. FIG. 21A shows Southern blot
analysis of Ker-iPS lines. 10 mg of genomic DNA was harvested and
digested with XbaI. Hybridization of the same molecular weight
fragment indicates presence of 4F2A provirus. Probes for Sox2,
Klf4, and c-Myc suggested 2 (#1.1) and 1 (#3) proviral copies.
Common bands observed between the two iPS lines are not viral
integration as these were derived from independent infections. FIG.
21B shows Southern blot analysis of Ker-iPS lines. 10 mg of genomic
DNA was harvested and digested with BamHI. Hybridization of the
same molecular weight fragment indicates presence of 4F2A provirus.
Probes for Oct4 and c-Myc indicate 3 (#1.1) and 2 (#3) proviral
copies.
[0049] FIG. 22 illustrates a strategy for generating iPS cells with
single polycistronic construct at defined genomic locations.
[0050] FIGS. 23A-23B show generation of secondary fibroblasts
carrying DOX inducible vectors, permitting reprogramming without
viral transduction. As illustrated in FIG. 23A "primary"
fibroblasts carrying GFP in the OCT4 locus were transduced with all
four factors using DOX inducible vectors as well as a vector
carrying the tet rtTA transactivator, and "primary" iPS cells were
generated after DOX induction. The cells were differentiated in the
absence of DOX to "secondary" fibroblasts carrying the same
combination of vectors that had allowed the derivation of the
primary iPS cells. As shown in FIG. 23B, reprogramming the
secondary fibroblasts to secondary iPS cells requires only DOX
induction of the proviruses instead of infection with new
viruses.
[0051] FIG. 24 shows reprogramming without vector-mediated factor
transduction. Primary fibroblasts will be derived from huES cells
carrying the OCT4-GFP marker, the tet transactivator M2rtTA, and
the DOX inducible polycistronic construct expressing 3
reprogramming factors (in this example OCT4, SOX2, cMYC) described
in FIG. 13 inserted into the COL1A1 locus. The cells will be
infected with a vector flanked by 2Lox sites (Ventura et al., Proc
Natl Acad Sci USA, July 13; 101(28):10380-5 (2004)) carrying the
KF4 cDNA. DOX treatment will generate primary iPS cells which,
after Cre expression, will delete the KLF4 vector. Secondary
fibroblasts will be derived that, upon DOX treatment, will allow
screening for small molecules that replace the deleted KLF4
factor.
[0052] FIG. 25 shows a scheme for quantifying the efficiency of
reprogramming by testing for different markers. Cells carrying the
GFP and puro marker in the OCT4 locus were transduced with 3 or 4
factors. The fraction of drug resistant or GFP positive colonies
and the appearance of cells that stain for alkaline phosphatase
(AP), SSEA4, TRA61 or Nanog were determined in cell populations at
different times after infection.
[0053] FIG. 26 illustrates screening for small molecules using
secondary fibroblasts with factors that can be independently
induced. Primary fibroblasts carrying the viral M2rtTA and the
OCT4-GFP marker will be transduced with tamoxifen inducible vectors
transducing 3 factors and with a DOX inducible vector transducing
the 4th factor (in this case cMYC). Primary iPS cells will be
derived by culture in tamoxifen and DOX and secondary fibrboalsts
will be derived. These cells, when cultured in tamoxifen, can be
screened for small molecules that replace cMYC for reprogramming to
secondary iPS cells.
[0054] FIGS. 27A-27C show characterization of DOX-inducible hiPSCs
derived from fibroblasts from PD patients. FIG. 27A shows phase
contrast picture and immunofluorescence staining of hiPSC lines
M.sup.3F-1 (non-PD hiPSCs), PDA.sup.3F-1, PDB.sup.3F-5,
PDC.sup.3F-1, PDD.sup.3F-1, and PDE.sup.3F-3 for pluripotency
markers SSEA4, Tra-1-60, OCT4, SOX2 and NANOG. FIG. 28A shows
quantitative RT-PCR for the reactivation of the endogenous
pluripotency related genes NANOG, OCT4 and SOX2 in independent
hiPSC lines, hESCs and primary fibroblasts. Relative expression
levels were normalized to expression of these genes in fibroblasts.
FIG. 28C shows methylation analysis of the OCT4 promoter region.
Light gray squares indicate unmethylated and black squares indicate
methylated CpGs in the OCT4 promoter of hiPSCs and parental primary
fibroblasts cells.
[0055] FIGS. 28A-28C illustrate that PD patient-derived hiPSCs
carry low copy numbers of viral integrations. FIG. 28A shows
hematoxylin and eosin staining of teratoma sections generated from
hiPSC lines A6 (non-PD hiPSCs), PDA.sup.3F-1, PDB.sup.3F-1,
PDC.sup.3F-1, PDD.sup.3F-1, and PDE.sup.3F-3 showing: Top row
panels: pigmented neural epithelium; 2nd row panels: neural
rosettes; 3rd row panels: intestinal epithelium; 4th row panels:
bone/cartilage; bottom row panels: smooth muscle. FIG. 28B shows
the results of Southern blot analysis of hESC line BG01, mouse
embryonic fibroblast (MEF) feeder cells and the indicated PD
patient-derived hiPSCs (and non-PD hiPSC line M.sup.3F-1) for
proviral integrations of XbaI digested genomic DNA using
32P-labelled DNA probes against OCT4, KLF4, SOX2 and c-MYC. FIG.
28C is a table summarizing the approximate number of proviral
integrations for the four reprogramming factors in hiPSCs based on
Southern blot analysis shown in 28B.
[0056] FIGS. 29A-29C show generation of PD patient-derived hiPSCs
using loxP excisable reprogramming factors. FIG. 29A is a schematic
drawing of the DOX-inducible lentiviral construct FUW-tetO-loxP,
the genomic locus after proviral integration (2lox) and after
Cre-recombinase mediated excision (1lox). The FUW-TetO-loxP vector
contains a tetracycline response element (TRE) located 5' of a
minimal CMV promoter and a unique MfeI site used for diagnostic
Southern blot digests. The reprogramming factors are flanked by
EcoRI restriction sites. The 3' LTR of this lentiviral vector
contains a single loxP site, which is duplicated during proviral
replication into the 5'LTR. This duplication results in a transgene
flanked by 2 loxP sites after genomic integration of the provirus
(2lox). This allows the excision of the transgene in combination
with the complete promoter sequences using Cre-recombinase (1lox).
(WRE=Woodchuck Response Element). FIG. 29B shows phase contrast
picture and immunofluorescence staining of hiPSC lines
PDB.sup.2lox-17 and PDB-21 for pluripotency markers SSEA4,
Tra-1-60, OCT4, SOX2 and NANOG. PDB.sup.2lox-17 and PDB.sup.2lox-21
were derived by expression of the three reprogramming factors OCT4,
SOX2 and KLF4 from the FUW-tetO-loxP virus shown in A. In these
cells all three reprogramming factors are flanked by loxP sites at
their genomic integration site. FIG. 29C shows hematoxylin and
eosin staining of a teratoma section generated from PDB.sup.2lox-17
and PDB.sup.2lox-21 cells carrying excisable reprogramming
factors.
[0057] FIGS. 30A-30D show generation and characterization of
reprogramming factor-free hiPSCs. FIG. 30A is a schematic overview
of Cre-mediated excision of the transgenes to generate
reprogramming factor free hiPSCs. IPS PDB.sup.2lox cells were
derived using FUW-tetO-loxP lentiviral vectors transducing 3
reprogramming factors OCT4, KLF4 and SOX2. FIG. 30B shows Southern
blot analysis for proviral integrations of parental fibroblasts
(PDB), provirus-carrying PDB.sup.2lox clones (PDB.sup.2lox-17 and
PDB.sup.2lox-21) and the indicated PDB.sup.1lox clones after
Cre-recombinase mediated excision of the transgenes. Puro indicates
PDB.sup.1lox clones, which were isolated by puromycin selection;
GFP indicates PDB.sup.1lox clones isolated by FACS sorting for EGFP
(as shown in 30A). Genomic DNA was digested with XbaI and probed
for proviral integrations using .sup.32P-labelled DNA probes
against OCT4, KLF4, and SOX2. PDB.sup.1lox clones indicated in blue
were disregarded because of remaining transgene integrations based
on the MfeI digest shown in FIG. 34. FIG. 30C shows cytogenetic
analysis of hiPSC lines PDB.sup.1lox-17Puro-5, and
PDB.sup.1lox-21Puro-12 shows normal karyotype after Cre-mediated
excision of the transgenes. FIG. 30D is a summary of the generation
of factor-free hiPSCs.
[0058] FIGS. 31A-31E shows characterization of reprogramming
factor-free hiPSCs. FIG. 31A shows phase contrast picture and
immunofluorescence staining of reprogramming factor-free hiPSC
lines PDB.sup.1lox-17Puro-5 and PDB.sup.1lox-21Puro-12 for
pluripotency markers SSEA4, Tra-1-60, OCT4, SOX2 and NANOG. FIG.
31B shows quantitative RT-PCR for the reactivation of the
endogenous pluripotency related genes NANOG, OCT4 and SOX2 in
hESCs, fibroblasts (PDB), provirus-carrying PDB.sup.2lox clones
(PDB.sup.2lox-17 and PDB.sup.2lox-21) and indicated PDB.sup.1lox
clones after Cre-recombinase mediated excision of the transgenes.
Relative expression levels were normalized to expression of these
genes in fibroblasts. FIG. 31C shows hematoxylin and eosin staining
of a teratoma sections generated from factor-free
PDB.sup.1lox-17puro-5 and PDB.sup.1lox-21puro-26 cells. FIG. 31D
shows quantitative RT-PCR for residual transgene expression of
OCT4, KLF4 and SOX2 in hESCs (BG01), primary fibroblasts (PDB),
primary infected fibroblasts (PDD.sup.3F+/-DOX), hiPSCs
(M3.sup.F3-1), PD-derived hiPSCs (PDA.sup.3F-1, PDB.sup.3F-5,
PDC.sup.3F-1, PDD.sup.3F-1, PDE.sup.3F-3), provirus carrying
PDB.sup.2lox clones (PDB.sup.2lox-17 and PDB.sup.2lox-21) and the
reprogramming factor free PDB.sup.1lox clones
(PDB.sup.1lox-17Puro-5, PDB.sup.1lox-17Puro-31,
PDB.sup.1lox-21Puro-12, PDB.sup.1lox-21Puro-20). Relative
expression levels are normalized to DOX-induced expression in
primary infected fibroblasts. FIG. 31E is a Venn diagram displaying
the number of differentially expressed genes (p<0.05 determined
by moderated t-test, corrected for false discovery rate) between
provirus-carrying PDB.sup.2lox lines (PDB.sup.2lox-5,
PDB.sup.2lox-17, PDB.sup.2lox-21, PDB.sup.2lox-22) compared to
hESCs (H9, BG01) or reprogramming factor-free PDB.sup.lox lines
(PDB.sup.1lox-17Puro-5, PDB.sup.1lox-17Puro-10,
PDB.sup.1lox-21Puro-20, PDB.sup.1lox-21Puro-26) compared to hESCs
(H9, BG01) respectively.
[0059] FIGS. 32A-32D show that transgene expression for 8 days is
sufficient to reprogram human fibroblasts after primary infections.
FIG. 32A shows Immunofluorescence staining of primary fibroblasts
(PDB) transduced with the 4 reprogramming factors OCT4, KLF4, SOX2
and c-MYC. Cells were fixed and stained for the expression of NANOG
(red) and Tra-1-60 (green) at different time points (top panel at
day 8; bottom panel at day 10) after DOX-induced transgene
expression. No NANOG/Tra-1-60 positive cells were detected earlier
than 8 days or in cultures that were not treated with DOX. NANOG
and Tra-1-60 colonies were also detectable in all cultures that
were stained at later time points (12, 14, 16, 18, 20 days). FIG.
32B shows immunofluorescence staining for pluripotency related
markers SSEA4, TRA-1-60, OCT4, SOX2 and NANOG of hiPSC clones
PDB.sup.4F-1 and PDB.sup.3F-12d. To determine the temporal
requirement for transgene expression, primary fibroblasts (PDB)
were infected with DOX-inducible lentiviruses carrying the
reprogramming factors. Transgene expression was induced by the
addition of DOX. At different time points the medium was changed to
hESC medium without DOX and iPSCs were isolated at 24 days after
initial DOX addition. The left panel shows hiPSC clone PDB.sup.4F-1
that was isolated from a culture that was transduced with the four
reprogramming factors and exposed to DOX for 8 days. The right
panel shows the hiPSC clone PDB.sup.3F-12d that was isolated from a
culture that was transduced with the three reprogramming factors
and exposed to DOX for 12 days. FIG. 32C shows quantitative RT-PCR
for the reactivation of the endogenous pluripotency related genes
NANOG, OCT4 and SOX2 in the following lines: hiPSC lines
PDB.sup.4F-1 and PDB.sup.4F-2, D4, A6, hESCs and primary
fibroblasts. Relative expression levels were normalized to
expression of these genes in fibroblasts. PDB.sup.4F-1 and
PDB.sup.4F-2 iPSCs were isolated after 8 days of transgene
expression of the four reprogramming factors OCT4, SOX2, KLF4 and
c-MYC.
[0060] FIG. 32D shows hematoxylin and eosin staining of teratoma
sections generated from hiPSC line PDB.sup.3F-12d and PDB.sup.4F-2.
PDB.sup.3F-12d was derived by DOX-induced transgene expression of
the three reprogramming factors OCT4, SOX2, KLF4 for 12 days.
PDB.sup.4F-2 was derived by DOX-induced transgene expression of the
four reprogramming factors OCT4, SOX2, KLF4 and c-MYC for 8
days.
[0061] FIG. 33 shows generation of hiPSCs carrying Cre-recombinase
excisable viral reprogramming factors. Southern blot analysis of
the indicated iPS PDB.sup.2lox clones for proviral integrations of
XbaI digested genomic DNA using .sup.32P-labeled DNA probes against
OCT4, KLF4, and SOX2. All PDB.sup.2lox clones were derived by
retroviral transduction with Cre-recombinase excisable lentiviral
vectors (FUW-tetO-loxP) for the 3 reprogramming factors OCT4, SOX2
and KLF4.
[0062] FIG. 34 shows Southern blot analysis for excision of the
reprogramming factors in hiPSCs. Southern blot analysis for
proviral integrations of parental fibroblasts (PDB),
provirus-carrying PDB.sup.2lox clones (PDB.sup.2lox-17 and
PDB.sup.2lox-21) and the indicated PDB.sup.1lox clones after
Cre-recombinase mediated excision of the transgenes. Puro indicates
clones, which were isolated by puromycin selection; GFP indicates
clones isolated by FACS sorting for EGFP (as shown in FIG. 5A).
Genomic DNA was digested with MfeI and probed for proviral
integrations using .sup.32P-labeled DNA probes against OCT4, KLF4,
and SOX2. Based on this Southern blot analysis, the PDB.sup.1lox
clones indicated in blue (PDB.sup.1lox-17GFP-10, PDB.sup.1lox-17
GFP-18, PDB.sup.1lox-21Puro35 and PDB.sup.1lox-21GFP-28) were
regarded as either partially deleted or mixed cellular populations
with partial deletions of the transgenes.
[0063] FIG. 35 shows Southern blot analysis for FUW-M2rtTA.
Southern blot analysis of parental fibroblasts (PDB),
provirus-carrying PDB.sup.2lox clones (PDB.sup.2lox-17 and
PDB.sup.2lox-21) and the indicated PDB.sup.1lox clones for proviral
integration of FUW-M2rtTA. Puro indicates clones which were
isolated by puromycin selection; GFP indicates clones isolated by
FACS sorting for EGFP (as shown in FIG. 30A). Genomic DNA was
digested with MfeI and probed for proviral integrations using
.sup.32P-labeled DNA probes against FUW-M2rtTA.
[0064] Table 1: Human iPS cells derived from factor transduced
embryonic or adult human fibroblasts. Fibroblasts were infected
with constitutive or DOX inducible Lenti virus vectors transducing
different combinations of factors. Between 50 and 100 clones were
picked in each experiment. Southern blots for viral integrations
showed that the iPS lines were derived from independently infected
fibroblasts. (O=OCT4, S=SOX2, K=KLF4, M=C-MYC, L=LIN28,
N=NANOG).
[0065] Table 2: Summary of transgenic human ES or iPS cell lines
used in this proposal. DOX inducible polycistronic vectors carrying
different combinations of factors will be integrated into the 3'UTR
of the COL1A1 locus or GFP will be inserted into the OCT4 locus or
the indicated neural specific genes. The table also indicates the
specific aims where the cells will be used.
DETAILED DESCRIPTION OF THE INVENTION
[0066] The teachings of PCT Application Serial No. PCT/US08/004516,
filed Apr. 7, 2008, and U.S. patent application Ser. No.
10/997,146, filed Nov. 24, 2004, are incorporated herein by
reference in their entirety. It is contemplated that the various
embodiments and aspects of the invention described herein are
applicable to all different aspects and embodiments of the
invention. It is also contemplated that any of the embodiments or
aspects can be freely combined with one or more other such
embodiments or aspects whenever appropriate.
[0067] The study of induced pluripotency is complicated by the need
for infection with high titer retroviral vectors resulting in
genetically heterogeneous cell populations. We generated
genetically homogeneous "secondary" somatic cells that carry the
reprogramming factors as defined doxycycline (dox)-inducible
transgenes. These cells were produced by infecting fibroblasts with
dox-inducible lentiviruses, reprogramming by dox addition,
selecting iPS cells, and producing chimeric mice. Cells derived
from these chimeras efficiently reprogram upon dox exposure without
the need for viral infection. Utilizing this system we demonstrate
that (i) various induction levels of the reprogramming factors can
induce pluripotency, (ii) the duration of transgene activity
directly correlates with reprogramming efficiency, (iii) cells from
many somatic tissues can be reprogrammed and, (iv) different cell
types require different induction levels. This system facilitates
the characterization of reprogramming and provides a unique
platform for genetic or chemical screens to enhance reprogramming
or replace individual factors.
[0068] It has recently been shown that mouse.sup.1-4 and
human.sup.5-8 fibroblasts can be reprogrammed to a pluripotent
state through retroviral-mediated introduction of four
transcription factors Oct4, Sox2, Klf4, and c-Myc. Reprogramming
can also be achieved in the absence of c-Myc though with decreased
efficiency.sup.9, 10. Nevertheless, with these approaches only a
very small fraction of cells infected with all 4 factors will
eventually reprogram.sup.11. The random viral infection results in
genetic heterogeneity in the infected cell culture that likely
plays a significant role in the low observed frequency of induced
pluripotent stem (iPS) cell formation. Therefore, faithfully
reprogrammed cells must be selected for by the reactivation of
endogenous pluripotency genes.sup.1-3, or based on morphological
criteria.sup.11, 12. The reprogramming process has been shown to
require approximately 10 to 12 days of sustained transgene
expression after viral transduction and follows a sequential
activation of pluripotency markers, with initial activation of
alkaline phosphatase and stage-specific embryonic antigen (SSEA1)
followed by reactivation of the endogenous Oct4 and Nanog genes,
after which the cultures are able to sustain the pluripotent state
in the absence of transgene activity.sup.13, 14.
[0069] The cellular and genetic heterogeneity of randomly infected
fibroblasts complicates the exploration of important molecular
events occurring during reprogramming and limits the scalability
required for high throughput analyses. To overcome these problems
we developed a system to generate genetically identical cell
populations amenable to reprogramming without any further genetic
interference. To this end primary fibroblasts were infected with
doxycycline-inducible lentiviruses encoding the 4 reprogramming
factors. Following blastocyst injection chimeric mice were
generated consisting of tissue types clonally derived from
reprogrammed fibroblasts. From these mice homogeneous donor cell
populations could be derived harboring pre-selected vector
integrations permissible for reprogramming, allowing for the robust
and simple doxycycline-induced reprogramming of primary cell types
without the need for direct viral transduction of the reprogramming
factors. This technology facilitates the generation of large
numbers of genetically identical donor cells and represents a
powerful platform for genetic or chemical screening applications to
improve reprogramming. In addition, the same approach can be
utilized to screen for small molecules replacing each of the 4
factors by genetic deletion of one particular factor in the
pluripotent, reprogrammed fibroblasts.sup.15. Furthermore, this
tool is not limited to fibroblast cultures but can in principle be
similarly applied to all other somatic cell types, providing an
attractive way to induce genes in cell types that are difficult to
infect with retroviruses such as lymphocytes or intestinal
epithelial cells.
Results
Generation of Genetically Homogenous Cell Populations for
Drug-Inducible Reprogramming
[0070] To generate cell populations homogenous with respect to the
number and location of proviral integrations, we utilized a
doxycycline (dox)-inducible transgene system.sup.16, 17 and
constructed dox-inducible lentiviral vectors encoding the 4
reprogramming factors. Mouse embryonic fibroblasts (MEFs)
containing both a reverse tetracycline transactivator and a PGK
promoter-driven puromycin resistance gene targeted to the ROSA
locus (ROSA-M2rtTA) in addition to a green fluorescent protein
(GFP) targeted to the endogenous Nanog locus (NGFP) were infected
with the 4 lentiviruses. Similarly, we infected Rosa-M2rtTA MEFs
harboring the Oct4 cDNA under control of the tetracycline operator
targeted to the Type I Collagen locus.sup.16 and a neomycin
resistance gene in the endogenous Nanog locus.sup.1, 18 (NNeo) with
dox-inducible lentiviruses encoding Klf4, Sox2, and c-Myc (FIG.
1a).
[0071] After viral transduction, doxycycline was added to the
culture medium to activate the transgenes and initiate the
reprogramming process. As expected, Nanog-GFP positive and
Nanog-neo resistant iPS colonies appeared and clonal iPS cell lines
were established. All iPS cell lines could be expanded in the
absence of dox, exhibited alkaline phosphatase activity and
homogenously expressed the pluripotency markers SSEA1, and Nanog
(not shown). This indicates that these "primary" iPS cell lines had
activated their endogenous pluripotency core transcriptional
network and no longer relied upon exogenous expression of the 4
reprogramming factors.sup.19. To generate somatic tissues that were
composed of genetically homogenous cells carrying identical
proviral insertions known to achieve reprogramming in primary
fibroblasts, we injected several of these clonal primary iPS lines
into blastocysts. The resulting dox-inducible iPS cell chimeras
were allowed to gestate until E13.5, at which point MEFs were
isolated. Puromycin selection was then used to select against cells
derived from the host blastocyst leaving only iPS-derived cells. We
will refer to such cells as "secondary" MEFs as they are derived
from the primary iPS cells and thus carry a specific set of
proviral insertions that is able to reprogram somatic cells (FIG.
1A).
[0072] Secondary MEFs were isolated from chimeric iPS cell embryos
generated from three distinct, clonal primary iPS cell lines (one
Nanog-neo and two Nanog-GFP lines) and were cultured in the
presence of dox to determine whether the integrated lentiviral
vectors retained competence to mediate epigenetic reprogramming
after differentiation in the developing embryo. The addition of dox
to these cultures initiated dramatic morphological changes and
"secondary" iPS cell lines were efficiently isolated from these
cultures by neo selection or GFP expression and subsequently
propagated in the absence of dox. Immunofluorescence demonstrated
that secondary iPS cells had reactivated the ES cell pluripotency
markers alkaline phosphatase, SSEA1, and the endogenous Nanog gene
(FIG. 1B and FIG. 6). The pluripotency of these cell lines was
confirmed by their ability to form cells of endodermal, ectodermal,
and mesodermal lineages in teratoma formation assays and by their
ability to contribute to adult chimeric mice upon blastocyst
injection (FIG. 1C, 1D).
Transgene Induction Levels, Reprogramming Kinetics, and
Efficiencies Vary Between Secondary MEFs Derived from Distinct iPS
Cell Lines
[0073] While secondary MEFs derived from all three dox-inducible
iPS cell lines underwent reprogramming to form secondary iPS cell
lines, we noticed differences with respect to their morphological
changes and proliferation rates after dox treatment. Initially,
MEFs from both Nanog-GFP lines proliferated to form a confluent
fibroblastic monolayer after exposure to dox. The cells from
Nanog-GFP line 3 (NGFP3) then underwent robust post confluent
proliferation including growth of cells in suspension, while cells
from NanogGFP line 2 (NGFP2) grew slower, forming discreet,
alkaline phosphatase positive, ES like colonies upon the
fibroblastic monolayer (FIG. 2A). The fibroblasts derived from the
Nanog-neo line never formed a confluent monolayer upon dox
addition, but generated large, three-dimensional colonies. After 12
days of dox administration, iPS cell colonies with ES cell
morphology were readily visible in all three cultures (FIG. 2A,
arrows).
[0074] To evaluate the reprogramming kinetics in more detail, MEFs
from the three lines were cultured in dox-containing media and flow
cytometric analysis was utilized to monitor the reactivation of
SSEA1 and GFP (FIG. 2C). All three secondary MEFs exhibited a
gradual increase of SSEA1-positive cells over the time course, but
some differences in timing were observed. The NNeo MEFs showed the
earliest increase of SSEA1-positive cells from 1.3% to 17.8%
between days 8 and 11. The NGFP2 MEFs showed a similar increase but
at a much later time point (from 4.4% to 29% between days 14 and
18). In contrast, MEFs from the iPS cell line NGFP3 exhibited a
slower, gradual activation of SSEA1 reaching about 10% on day 14.
The first GFP-positive cells were detected as early as day 14 in
NGFP2 and on day 18 in NGFP3 MEFs.
[0075] To monitor the timing of reactivation of the endogenous
Nanog locus in NNeo secondary MEFs, we plated cells and began drug
selection at various time points after dox treatment. In contrast
to activation of the Nanog-GFP reporter gene around 2 weeks after
induction, NNeo MEFs were neomycin resistant when neo was added to
the cultures as early as day 4 (FIG. 2B). This might reflect a
faster reactivation of the Nanog locus similar to what we observed
for SSEA1 expression in this line (FIG. 2C). Alternatively, neo
resistant colonies may appear earlier because a low level of Nanog
gene activation is sufficient to give drug resistance in contrast
to GFP detection which necessitates higher expression.sup.14, 20.
Although the generation of secondary cells selects for a specific
set of proviral integrations the expression of which is able to
induce the formation of primary iPS cell lines, the overall
kinetics of pluripotency marker activation were similar to that
seen in direct infection of MEFs.sup.1, 13, 14. This supports the
notion that the reprogramming process requires a series of
sequential epigenetic changes.sup.11, 20.
[0076] Next we compared the reprogramming efficiencies of the
various secondary MEFs. To determine the optimal plating density,
we plated secondary NGFP2 MEFs at densities ranging from 0.025-500
cells/mm.sup.2 in dox-containing media and counted GFP-positive
colonies 4 weeks later. As shown in FIG. 2D, the plating density
had a profound effect on iPS formation. Remarkably, both low and
high plating densities completely inhibited GFP-positive colony
formation. We speculate that paracrine factors might initially be
required to facilitate growth, and essential cell proliferation is
impeded if cells are contact inhibited prior to activation of the
transgenes.
[0077] In order to stringently determine the reprogramming
efficiency in the secondary system we plated single fibroblasts
from the NNeo and NGFP2 lines into 96 well plates containing
.gamma.-irradiated MEFs as feeder cells to provide optimal growth
support. We observed that only .about.14% and .about.8% of the
seeded cells from the NNeo and NGFP2 MEFs, respectively, had
proliferated sufficiently to form distinct colonies after dox
administration (light grey bars in FIG. 2E). However, approximately
one quarter of those colonies eventually became neomycin resistant
or GFP-positive after 4 weeks in culture resulting in an overall
reprogramming efficiency of .about.4% for the NNeo line and
.about.2% for the NGFP2 line (dark grey bars in FIG. 2E). This is
25-50 times more efficient than what was originally reported for
drug resistance-based iPS selection.sup.1, 12 and between 4-8 times
more efficient than morphology-based iPS selection in cultures of
primary infected fibroblasts.sup.11.
[0078] We next compared the reproducibility of the secondary MEF
system with direct infections. We infected Oct4-neo MEFs.sup.1 with
Moloney-based viruses encoding the 4 reprogramming factors and
counted neo-resistant colonies on day 20. Four independent
experiments revealed a high degree of inter-experimental
variability of iPS formation using this method (FIG. 7B). In
contrast, we noticed a much smaller degree of variability in the
secondary system when we counted Nanog-GFP positive colonies from
doxycycline-treated NGFP2 MEFs in 4 independent experiments.
[0079] To correlate the phenotypic behavior of the three secondary
MEF populations with transgene induction, equal numbers of
secondary MEFs were plated in the presence or absence of dox for 72
hours at which point the total transcript levels of the 4 factors
were determined by quantitative RT-PCR. Surprisingly, both
Nanog-GFP lines induced Oct4 at much lower levels than the NNeo
line which expressed Oct4 from the transgene in the collagen 1A1
locus at levels similar to ES cells (FIG. 3A). Conversely, Sox2
induction in the Nanog-GFP lines reached levels much closer to that
of endogenous Sox2 in ES cells, whereas NNeo expressed Sox2 at
significantly lower levels in response to dox. c-Myc expression was
higher in uninduced MEFs in comparison to ES cells, and the
addition of dox resulted in a dramatic induction of transcript
levels in all three secondary MEF lines. In contrast, total Klf4
levels were similar to those in ES cells in all 3 secondary MEF
populations after transgene induction. The observation that total
Oct4 levels in doxtreated NNeo secondary MEFs was closest to ES
cells might explain the faster and more efficient reprogramming
kinetics observed in this line (see above). We then determined the
expression levels at later stages of reprogramming in NGFP2 MEFs.
Sox2, Klf4, and c-Myc were always robustly induced with only little
variation whereas Oct4 expression slowly increased over time (FIG.
7A). This might reflect the selection of cells with higher Oct4
induction over time in culture. Southern blot analysis indicated
the genomic integration of 1-2 c-Myc, 1-3 Oct4, 1-3 Sox2, and 3-4
Klf4 proviruses in the three lines studied (FIG. 7C).
[0080] Despite their genetic homogeneity, dox induction resulted in
activation of the transgenes that varied at the single cell level
as determined by immunofluorescence analysis of Oct4 and Sox2 (FIG.
3B). Since not all secondary MEFs induced the transgenes equally in
response to dox, we cannot rule out the possibility that a specific
stoichiometry of transgene expression is required for reprogramming
and occurs in only a subset of the secondary MEFs.
Effect of Transgene Expression on Reprogramming Efficiency and
Timing
[0081] To investigate how long expression of the 4 reprogramming
factors was required for stable reprogramming to occur, secondary
NGFP2 MEFs were plated at optimal density (see above), exposed to
doxycycline for various periods of time ranging from 5 to 22 days
and monitored daily for GFP fluorescence. The minimum length of dox
exposure resulting in GFP+ colonies was 9 days, with the first GFP+
colonies appearing seven days after dox removal at day 16 (FIG.
3C). Strikingly, additional exposure to dox did not accelerate the
appearance of GFP+ colonies, with GFP appearing between days 16 and
18 regardless of the length of dox administration. Similarly, NNeo
secondary MEFs were found to require 11-13 days of dox exposure
before stable, neomycin-resistant secondary iPS colonies could be
established.
[0082] To correlate the duration of transgene expression with
overall reprogramming efficiency we exposed secondary NGFP2 MEFs to
doxycycline for 10-15 days and quantified GFP-positive colonies on
day 34. We found a striking correlation between the length of
transgene expression and number of GFP-positive colonies.sup.14
(FIG. 3D). We then monitored the appearance of newly evolving
GFP-positive colonies over time in the same dish. Surprisingly,
MEFs that were exposed to doxycycline for only 9 days continued to
generate GFP-positive colonies up to day 25 (15 days after dox
withdrawal) (FIG. 3E, blue line). Twenty-two days of dox treatment
yielded a much more pronounced increase in GFP-positive colony
formation over time (FIG. 3E, red line). These findings are
consistent with reprogramming being a gradual stochastic process
even in this genetically homogenous system and are in agreement
with previous conclusions based upon primary infections.sup.11, 13,
14, 20. Furthermore, the reprogramming process continues and can be
completed long after the 4 transgenes are down regulated in
response to dox withdrawal.
[0083] We also tested whether the secondary cells could be used to
assess the effect of drugs on the efficiency of reprogramming. For
this we explored the effects of the DNA demethylating compound
5-Aza-deoxycytidine (5-Aza) and the histone deacetylase inhibitor
trichostatin A (TSA). Because of their action on chromatin
modifications both small molecules are candidates to improve the 5
reprogramming efficiency. FIG. 3F shows that addition of 5-Aza to
the medium increased the reprogramming efficiency of MEFs from the
NGFP3 line whereas TSA treatment had no obvious effect on the
number of colonies.
Reprogramming of Other Cell Types
[0084] We sought to determine what range of tissue types are
amenable to reprogramming by isolating secondary cells from iPS
cell chimeras generated from the NNeo and NGFP2 lines and examined
the reprogramming ability of multiple cell types derived from these
chimeras. As summarized in Table 1, some cell types could readily
be reprogrammed when isolated from the NGFP2 line but the same cell
types isolated from the NNeo line did not yield iPS cells
suggesting that different cell types require different transgene
induction levels, which may result from the different proviral
integration sites between the lines studied.
TABLE-US-00001 TABLE 1 Summary of secondary iPS cell generation
from multiple tissue and cell types derived from NNeo and NGFP
chimeras Tissue/Cell Type NNeo NGFP2 Neural Progenitor + N/D
Adrenal Gland + N/D Keratinocyte + N/D Muscle + N/D Intestinal
Epithelium-+ Mesenchymal Stem Cell-+ Hematopoietic lineage-+ MEF++
Tail Tip fibroblast-+
Intestinal Epithelial Cells
[0085] Purified intestinal epithelial cells from both secondary
NGFP2 and NNeo chimeras responded remarkably quickly to doxycycline
treatment and formed spheroids in suspension within 48 hours which
subsequently adhered to the MEF feeder layer and took on ES-like
morphology within 3-4 days (FIGS. 4A-4C and 4I-4J). Alkaline
phosphatase activity, however, was not detected prior to 10-12 days
of culture with dox (FIG. 9F). Using a mechanical fractionation
protocol (see Methods) we found that these colonies formed much
more efficiently from fraction 7 (mostly crypt-derived cells) than
from earlier fractions (enriched for villus tip-derived cells)
(FIG. 4M). Cells derived from NGFP2 chimeras developed into
dox-independent iPS cells that expressed endogenous Nanog after
approximately two weeks of culture in the presence of dox (FIG.
4K-4L, FIG. 8B).
[0086] In contrast, cells derived from the NNeo chimera became neo
resistant after two weeks of dox culture, but were unstable and
lost their ES like morphology upon dox withdrawal (FIG. 4D-4F).
Bisulfite sequencing revealed some degree of demethylation of the
Nanog promoter but only minimal demethylation of the Oct4 promoter
(FIG. 4G), and when injected under the skin of SCID mice, these
cells were unable to generate teratomas in the presence or absence
of doxycycline. Quantitative RT-PCR showed that these cells failed
to induce Nanog and expressed only very low levels of Sox2 and Klf4
but high levels of Oct4 and c-Myc (FIG. 4H). Additional infection
with Sox2 and Klf4 lead to the generation of fully reprogrammed,
dox independent iPS cells expressing pluripotency markers and
showing complete demethylation of their Oct4 and Nanog promoters
(FIG. 4G and FIG. 9G).
[0087] Comparison of transgene induction levels in NGFP2 and NNeo
intestinal epithelial cells 48 hours after dox treatment revealed
differences in induction levels similar to what was observed in
secondary MEFs from these lines (FIG. 4N, compare to FIG. 3A).
Intestinal epithelial cells derived from the crypt induced most
transgenes more readily than cells from the villus, offering an
explanation for their increased colony formation rate. These
findings indicate the proviral integration sites in the NNeo line,
while permissible for reprogramming of MEFs, are not competent to
mediate full reprogramming in intestinal epithelial cells, in
contrast to those present in NGFP2.
[0088] Mesenchymal Stem Cells and Tail Tip Fibroblasts
[0089] We next compared the reprogramming ability of bone marrow
derived mesenchymal stem cells (MSCs) and tail tip fibroblasts
(TTFs) isolated from NNeo and NGFP2 chimeras. These cells represent
two mesenchymal populations that are amenable to reprogramming by
direct infection.sup.1, 4, 12 (Supplementary FIG. 8D). As with
intestinal cells, secondary NGFP2 MSCs and TTFs were capable of
generating iPS cells in response to dox, while those derived from
NNeo chimeras were not (FIG. 5A-5F, FIG. 8A,8C).
Keratinocytes
[0090] Cells isolated from the epidermis of NNeo chimeras were
first propagated in the absence of doxycycline in growth conditions
optimized for keratinocytes.sup.21. Homogeneous epithelial cultures
were obtained (FIG. 5G), and doxycycline was added to the media.
Clusters of epithelial cells proliferated and changed their
morphology over time. After twelve days the medium was changed to
doxycycline containing ES cell medium (FIG. 5H), and seven days
later neomycin was added. Neo-resistant cells growing in tight
colonies resembled ES cells (FIG. 5I) and were passaged onto
.gamma.-irradiated feeder cells at which point the cultures were
maintained in the absence of dox and expressed endogenous Nanog
(FIG. 9D).
Neural Progenitor Cells
[0091] Brains from NNeo chimeras were dissected and a tissue block
around the lateral ventricles was dissociated into single cells and
plated onto uncoated culture dishes in EGF and FGF2-containing
serum-free media (N3EF) in the presence of puromycin to select for
secondary cells. 4 weeks later neurospheres had formed that were
subsequently plated onto polyornithine/laminin coated dishes in
either ES cell or N3EF media containing dox to activate the
lentiviral transgenes. As expected for neural precursors, the cells
exposed to the serum-containing ES cell media differentiated into
flat astrocytic cells and stopped dividing (FIG. 5J). In contrast,
the cells plated in N3EF media continued to proliferate robustly
resembling undifferentiated neuroepithelial cells. Three weeks
later these proliferating cells were split, plated in either ES
cell or N3EF media containing doxycycline. The cells exposed to
serum mostly adopted a flat morphology, whereas in N3EF the cells
maintained a bipolar morphology. In contrast to the previous
passage however, small ES-like colonies appeared in both conditions
over the next 2 weeks (FIG. 5K, 5L). When passaged onto
.gamma.-irradiated feeder MEFs, neo-resistant, doxindependent iPS
cell lines expressing endogenous Nanog were readily established
(FIG. 9E).
Other Tissues
[0092] In addition, we also succeeded in generating secondary iPS
cell lines from cells explanted from the adrenal gland, kidney, and
muscle of NNeo chimeras. These tissues were dissected, dissociated
in trypsin, and plated in ES cell media containing doxycycline.
After 6-12 days in the presence of dox, colonies with ES cell
morphology appeared that ultimately became neomycin resistant,
dox-independent, and had activated Nanog (FIG. 9A-9C).
[0093] Reprogramming of the somatic epigenome to a pluripotent,
embryonic state through the ectopic expression of the 4
transcription factors Klf4, Sox2, c-Myc, and Oct4 is a slow and
inefficient process. The current method for induction of
reprogramming is through retroviral gene delivery resulting in
heterogeneous cell populations with proviral integrations varying
in both number and genomic location, offering an explanation for
the variability and inefficiency of direct reprogramming. Here we
describe a novel system for reprogramming genetically homogeneous
cell populations. Reprogramming with doxycycline-inducible
lentiviral vectors and subsequent chimera formation yields tissues
comprised of genetically homogenous cells that harbor identical
proviral integrations and re-express the reprogramming factors upon
exposure to doxycycline. This strategy selects for cells that carry
the correct number of proviruses inserted at genomic loci that are
favorable to drug-induced activation and eliminates the
heterogeneity inherent in de novo viral infection of target cells.
Surprisingly the timing of reprogramming in this system was similar
to directly infected primary fibroblasts. The minimum length of
time that dox was required to initiate reprogramming was 9-13 days.
This timescale is consistent with the 10-14 day time frame observed
in cells that have been directly infected with vectors.sup.13, 14.
We also observed that when dox was withdrawn from the cultures as
early as day 9, GFP+ secondary iPS colonies continually appeared
for the next several weeks in the absence of doxycycline. These
results support the notion that reprogramming is driven by a
stochastic sequence of epigenetic modifications requiring a minimum
period of transgene expression.
[0094] The observed reprogramming efficiency of secondary MEFs was
as high as 4% which is comparable to the reprogramming efficiency
of mature B-cells.sup.22 and vastly higher than the estimated 0.1%
efficiency using de novo infection and drug selection, and about 8
fold higher than what has been reported using morphological
selection criteria.sup.1, 11, 12. It has been well documented that
iPS cells derived from infected MEFs carry on average 15 different
proviral copies suggesting strong selection for the small fraction
of the infected cells that carry the "correct" number of
proviruses, or that express the 4 factors with the appropriate
stoichiometry for successful reprogramming. Thus, the reprogramming
frequency of secondary MEFs would be expected to be higher because
these cells have been clonally derived from infected cells that
carried the "correct" combination of proviruses. If so, why would
4% but not most, or all dox treated secondary cells give rise to
secondary iPS cells? We consider several non-mutually exclusive
explanations. (i) It has been established that genetically
identical subclones of directly infected MEFs become reprogrammed
at significantly different times or not at all.sup.11, 20. As
discussed previously, this suggests that reprogramming involves a
sequence of stochastic events such that cells carrying an identical
number of proviral copies will activate the endogenous pluripotency
genes at different times. (ii) Our data also show that dox
treatment does not activate the proviruses uniformly in all cells
but rather that differences in induction levels exist between
individual cells. Because of these variegated expression levels
only a fraction of secondary MEFs may achieve high enough
expression levels of or the correct relative expression levels
between the factors and therefore be capable of generating
secondary iPS cells.
[0095] While reprogramming is induced by viral transduction of the
4 factors, the maintenance of the pluripotent state depends on the
re-establishment of the autoregulatory loop involving the
activation of the four endogenous pluripotency factors Oct4, Nanog,
Sox2 and Tcf3.sup.20, 23 and silencing of exogenous factors.
Similarly, secondary MEFs were capable of being fully reprogrammed
to a pluripotent state that was maintained in the absence of
transgene expression.
[0096] We also utilized the secondary system to examine the
reprogramming potential of several additional adult somatic cell
types. iPS cells could be derived from many other tissues including
brain, epidermis, intestinal epithelium, mesenchymal stem cells,
tail tip fibroblasts, kidney, muscle and adrenal gland through dox
treatment indicating that the proviruses were appropriately
activated in cell types other than MEFs. This demonstrates that the
4 reprogramming factors can mediate epigenetic reprogramming in
cells with different developmental origins and epigenetic states
and highlights the usefulness of the secondary system for the study
of reprogramming in a broad range of cell types. Although special
care was taken to avoid other contaminating cell types, we cannot
unequivocally demonstrate the cells of origin of iPS cells from
these various tissue types. Genetic lineage tracing experiments
have in fact demonstrated that iPS cells can be derived from liver
and pancreas cells after transduction with Oct4, Sox2, c-Myc and
Klf4.sup.24, 25. However, not all cell types are permissive to
reprogramming by these four factors. We have shown that
reprogramming of mature but not of immature B cells required the
transduction of an additional factor (c/EBP-alpha) or the
inhibition of the B cells specific transcription factor
Pax5.sup.22. It is possible that additional and as yet unknown
factors are required to reprogram certain cell types. One practical
advantage of the system described here is that cell types including
those that might be refractory to ex vivo culture and retroviral
infection such as intestinal epithelial cells can be studied.
[0097] The drug-inducible system described here represents a novel
reprogramming platform with predictable and highly reproducible
kinetics and efficiencies (see Supplementary FIG. 7B) that should
facilitate the study of early molecular events leading to
epigenetic reprogramming. In addition, the genetic homogeneity of
secondary cell types provides the feasibility of chemical and
genetic screening approaches to enhance the reprogramming
efficiency. As one example, we demonstrate that the DNA
demethylating agent 5-Aza-deoxycytidine substantially enhances the
reprogramming efficiency. Furthermore, such screens can also be
applied to identify compounds replacing the original reprogramming
factors. Because the reprogrammed state is not dependent on the
exogenous factors, the transgenes can be genetically excised and
secondary cells can be generated by chimera formation that lack a
particular reprogramming factor.sup.15.
EXAMPLES
[0098] The teachings of all references cited herein are
incorporated herein by reference in their entirety.
Example 1
Viral Preparation and Infection
[0099] Construction of lentiviral vectors containing Klf4, Sox2,
Oct4, and c-Myc under control of the tetracycline operator and a
minimal CMV promoter has been described previously.sup.14.
Replication-incompetent lentiviral particles were packaged in 293T
cells with a VSV-G coat and used to infect MEFs containing M2rtTA
and PGK-Puro resistance gene at the R26 locus.sup.17, as well as
either a neomycin resistance or GFP allele targeted to the
endogenous Nanog locus.sup.1, 11. Viral supernatants from cultures
packaging each of the 4 viruses were pooled, filtered through a
0.45 .mu.M filter and mixed 1:1 with ES-cell medium (DMEM
supplemented w/10% FBS (Hyclone, Logan, Utah), leukemia inhibitory
factor, beta-mercaptoethanol (SIGMA-Aldrich),
penicillin/streptomycin, L-glutamine, and nonessential amino acids
(all from Invitrogen, Carlsbad, Calif.) before being applied to
MEFs.
Primary iPS Isolation, Teratoma, and Chimera Formation
[0100] Approximately three weeks after the addition of dox
(Sigma-Aldrich St. Louis Mo. 2 .mu.g/mL), GFP+ or neomycin
resistant iPS colonies were isolated and expanded in the absence of
dox. The NanogGFP2 iPS line was picked from the same plate as line
NanogGFP1 (described in.sup.22 as MEF-iPS#1 line) whereas line
NanogGFP3 was derived from an independent experiment. iPS lines
were injected into C57/B6 x DBA/1 F1 blastocysts. Blastocysts were
placed in a drop of DMEM with 15% FBS under mineral oil. A flat-tip
microinjection pipette with an internal diameter of 12-15 mm was
used for iPS cell injection using a Piezo micromanipulator. About
10 iPS cells were injected into the blastocyst cavity and
blastocysts were placed in KSOM (Specialty Media, Phillipsburg,
N.J.) and incubated at 37.degree. C. until they were transferred to
recipient females. Fifteen injected blastocysts were transferred to
the uterine horns of psuedopregnant C57/B6 x DBA/1 F1 females at
2.5 days post coitum. For teratoma generation, 2.times.10.sup.6
cells were injected subcutaneously into the flanks of recipient
SCID mice, and tumors were isolated for histological analysis 3-6
weeks later. All animals were treated in accordance with
institutional IACUC guidelines.
Secondary Somatic Cell Isolation and Culture
[0101] For MEF isolation, chimeric embryos were isolated at E13.5
and the head and internal (including reproductive) organs were
removed. Remaining tissue was physically dissociated and incubated
in trypsin at 37.degree. C. for 20 minutes, after which cells were
resuspended in MEF media containing puromycin (2 .mu.g/mL) and
expanded for two passages prior to freezing. Secondary MEFs used
for the described experiments were thawed and experiments plated
1-2 passages after thawing. Kinetic experiments (FIG. 2) were
performed by plating 4.times.10.sup.4 secondary MEFs per well in 6
well plates and plates were stained or analyzed at the indicated
times. Cell density experiments were performed in 12 well plates
and GFP+ iPS colonies were scored 4 weeks after dox induction.
Single cell efficiency experiments were performed by plating single
secondary MEFs onto a layer of wildtype feeder MEFS in 96 well
plates prior to dox induction (using limiting dilutions, which were
confirmed by eye in replicate plates lacking feeder MEFs). iPS
formation was scored 4 weeks later. Representative experiments from
2-3 biological replicates are shown. For 5-Aza and TSA experiments,
1.times.10.sup.6 secondary MEFs were plated in 6 well plates
(approx 100 cells/mm.sup.2) and pretreated with ES cell media
containing 5-Aza (1 .mu.M) or TSA (1 .mu.M) for 48 h. After 48 h,
secondary MEFs were cultured in ES cell media plus dox lacking
5-Aza or TSA. MEFS were exposed to 5-Aza or TSA for a second 48 h
period between days 8-10 after induction, followed by culture with
dox only until scoring GFP+ colonies on day 21.
[0102] Somatic organs were isolated from 3 to 4 month old chimeras.
Epidermal keratinocytes were isolated and cultured as previously
described.sup.21, 26. Neural progenitor cells were isolated and
cultured as previously described.sup.27. Total intestinal
epithelium was dissociated using a solution of 3 mM EDTA and 0.05
mM DTT in PBS for 30 minutes at room temperature. The musculature
was discarded and purified crypts/villi were plated on
.gamma.-irradiated feeder MEFs in the presence of dox. For
crypt-villus fractionation, the same EDTA-DTT solution was used,
but fractions were collected by gentle shaking for 10, 6, 5, 5, 9,
10, and 25 minutes (corresponding to fractions 1-7, respectively,
with 1 representing the villus tip to 7 representing the crypt)
after incubation as described in.sup.28. 8.times.10.sup.6
epithelial cells from each fraction were plated on a MEF feeder
layer in ES media containing 2 .mu.g/mL dox. No growth was observed
in cultures lacking dox. Whole marrow was isolated from secondary
chimeric mice (or from Coll1-TetO-Oct4, Rosa26-M2rtTA mice.sup.16
for direct infections) from the femur and tibia after removal of
the condyles at the growth plate by flushing with a syringe and
30-gauge needle containing DMEM+5% Fetal BovineSerum (FBS)
(Hyclone, Thermo Fisher Scientific). Mesenchymal stem cells were
selected through differential plating on tissue culture plates for
72 hours in .alpha.-MEM supplemented with 15% FBS (HyClone). Colony
formation of MSCs in culture was carried out by plating
4.times.10.sup.6 nucleated cells from freshly isolated whole marrow
onto 10 cm plates and allowed to expand for 5 days in the presence
of puromycin to eliminate host-blastocyst derived cells, after
which dox was introduced to induce reprogramming. Cultures derived
from adrenal glands, muscle, and kidneys were dissected,
mechanically dissociated, and digested in trypsin at 37.degree. C.
for 20 minutes prior to plating on gelatin-coated culture dishes
with ES media containing dox.
Antibodies
[0103] For flow cytometric analysis we used an APC conjugated
anti-mouse SSEA1 (R&D systems, Minneapolis, Minn.) and an
alkaline phosphatase substrate kit: Vector Red substrate kit
(Vector Laboratories, Burlingame, Calif.). For immunofluorescence,
cells were fixed in 4% paraformaldehyde and we used mouse
monoclonal antibodies against SSEA1 (Developmental Studies
Hybridoma Bank), goat anti Sox2 (R&D Systems), mouse anti Oct4
(Santa Cruz), and rabbit anti Nanog (Bethyl). Fluorophore-labeled,
appropriate secondary antibodies were purchased from Jackson
ImmunoResearch.
Flow Cytometry
[0104] Cells were trypsinized, washed once in PBS and resuspended
in FACS buffer (PBS+5% fetal bovine serum). 10.sup.6 cells were
stained with 10 .mu.l of APC-conjugated anti-SSEA1 antibody in a
100 .mu.l volume for 30 minutes, cells were then washed twice in
PBS. Cells were then washed once with wash buffer and resuspended
in FACS buffer for analysis on a FACS-calibur cell sorter.
Bisulfite Sequencing and Southern Blotting
[0105] Bisulfite treatment of DNA was done using the CpGenome DNA
Modification Kit (Chemicon, Temecula, Calif.) following the
manufacturer's instructions. The resulting modified DNA was
amplified by nested polymerase chain reaction (PCR) using two
forward (F) primers and one reverse (R) primer: Oct4 (F1,
GTTGTTTTGTTTTGGTTTTGGATAT; SEQ ID NO: 1); (F2,
ATGGGTTGAAATATTGGGTTTATTTA; SEQ ID NO: 2); (R,
CCACCCTCTAACCTTAACCTCTAAC; SEQ ID NO: 3) and Nanog (F1,
GAGGATGTTTTTTAAGTTTTTTTT, SEQ ID NO: 4; F2,
AATGTTTATGGTGGATTTTGTAGGT, SEQ ID NO: 5; R,
CCCACACTCATATCAATATAATAAC, SEQ ID NO: 6). The first round of PCR
was done as follows: 94.degree. C. for 4 minutes; five cycles of
94.degree. C. for 30 seconds, 56.degree. C. for 1 minute
(-1.degree. C. per cycle), 72.degree. C. for 1 minute; and 30
cycles of 94.degree. C. for 30 seconds, 51.degree. C. for 45
seconds, and 72.degree. C. for 1 minute, 20 seconds. The second
round of PCR was 94.degree. C. for 4 minutes; 30 cycles of
94.degree. C. for 30 seconds, 53.5.degree. C. for 1 minute, and
72.degree. C. for 1 minute 20 seconds. The resulting amplified
products were gel-purified (Zymogen, Zymo Research, Orange,
Calif.), subcloned into the TOPO TA vector (Invitrogen), and
sequenced. Southern blotting of genomic DNA was carried out by
digesting 10 .mu.g of DNA with SpeI (which cuts once in the
lentiviral vector backbone) followed by hybridization with random
primed full-length cDNA probes for the four factors.
Quantitative RT-PCR
[0106] Total RNA was isolated using Trizol reagent (Invitrogen,
Carlsbad, Calif.). Five micrograms of total RNA was treated with
DNase I to remove potential contamination of genomic DNA using a
DNA Free RNA kit (Zymo Research, Orange, Calif.). One microgram of
DNase I-treated RNA was reverse transcribed using a First Strand
Synthesis kit (Invitrogen) and ultimately resuspended in 100 .mu.l
of water. Quantitative PCR analysis was performed in triplicate
using 1/50 of the reverse transcription reaction in an ABI Prism
7000 (Applied Biosystems, Foster City, Calif.) with Platinum SYBR
green qPCR SuperMix-UDG with ROX (Invitrogen). Primers used for
amplification were as follows: Oct4 F, 5'-ACATCGCCAATCAGCTTGG-3'
SEQ ID NO: 7 and R, 5'AGAACCATACTCGAACCACATCC-3' SEQ ID NO: 8;
c-myc F, 5'-CCACCAGCAGCGACTCTGA3' SEQ ID NO: 9 and R,
5'-TGCCTCTTCTCCACAGACACC-3' SEQ ID NO: 10; Klf4 F,
5'-GCACACCTGCGAACTCACAC-3' SEQ ID NO: 11 and R,
5'-CCGTCCCAGTCACAGTGGTAA-3' SEQ ID NO: 12; Sox2 F,
5'-ACAGATGCAACCGATGCACC-3' SEQ ID NO: 13 and R,
5'-TGGAGTTGTACTGCAGGGCG-3' SEQ ID NO: 14; Nanog F,
5'-CCTCCAGCAGATGCAAGAACTC3' SEQ ID NO: 15 and R,
5'-CTTCAACCACTGGTTTTTCTGCC-3' SEQ ID NO: 16. To ensure equal
loading of cDNA into RT reactions, GAPDH mRNA was amplified using
the following: F, 5-TTCACCACCATGGAGAAGGC-3' SEQ ID NO: 17; and R,
5'-CCCTTTTGGCTCCACCCT-3' SEQ ID NO: 18. Data were extracted from
the linear range of amplification. All graphs of qRT-PCR data shown
represent samples of RNA that were DNase treated, reverse
transcribed, and amplified in parallel to avoid variation inherent
in these procedures. Error bars represent standard deviation of the
mean of triplicate reactions.
REFERENCES FOR EXAMPLE 1
[0107] 1) Wernig, M. et al. In vitro reprogramming of fibroblasts
into a pluripotent ES-cell-like state. Nature 448, 318-324 (2007).
[0108] 2) Okita, K., Ichisaka, T. & Yamanaka, S. Generation of
germline-competent induced pluripotent stem cells. Nature 448,
313-317 (2007). [0109] 3) Maherali, N. et al. Directly Reprogrammed
Fibroblasts Show Global Epigenetic Remodeling and Widespread Tissue
Contribution. Cell Stem Cell 1, 55-70 (2007). [0110] 4) Takahashi,
K. & Yamanaka, S. Induction of pluripotent stem cells from
mouse embryonic and adult fibroblast cultures by defined factors.
Cell 126, 663-676 (2006). [0111] 5) Yu, J. et al. Induced
pluripotent stem cell lines derived from human somatic cells.
Science 318, 1917-1920 (2007). [0112] 6) Takahashi, K. et al.
Induction of pluripotent stem cells from adult human fibroblasts by
defined factors. Cell 131, 861-872 (2007). [0113] 7) Park, I. H. et
al. Reprogramming of human somatic cells to pluripotency with
defined factors. Nature 451, 141-146 (2008). [0114] 8) Lowry, W. E.
et al. Generation of human induced pluripotent stem cells from
dermal fibroblasts. Proc Natl Acad Sci USA 105, 2883-2888 (2008).
[0115] 9) Wernig, M., Meissner, A., Cassady, J. P. & Jaenisch,
R. c-Myc Is Dispensable for Direct Reprogramming of Mouse
Fibroblasts. Cell Stem Cell 2, 10-12 (2008). [0116] 10) Nakagawa,
M. et al. Generation of induced pluripotent stem cells without Myc
from mouse and human fibroblasts. Nat Biotechnol 26, 101-106
(2008). [0117] 11) Meissner, A., Wernig, M. & Jaenisch, R.
Direct reprogramming of genetically unmodified fibroblasts into
pluripotent stem cells. Nat Biotechnol 25, 1177-1181 (2007). [0118]
12) Takahashi, K., Okita, K., Nakagawa, M. & Yamanaka, S.
Induction of pluripotent stem cells from fibroblast cultures. Nat
Protoc 2, 3081-3089 (2007). [0119] 13) Stadtfeld, M., Maherali, N.,
D. T., B. & Hochedlinger, K. Defining Molecular Cornerstones
during Fibroblast to iPS Cell Reprogramming in Mouse. Cell Stem
Cell 2, 230-240 (2008). [0120] 14) Brambrink, T. et al. Sequential
Expression of Pluripotency Markers during Direct Reprogramming of
Mouse Somatic Cells. Cell Stem Cell 2, 151-159 (2008). [0121] 15)
Hanna, J. et al. Treatment of sickle cell anemia mouse model with
iPS cells generated from autologous skin. Science 318, 1920-1923
(2007). [0122] 16) Hochedlinger, K., Yamada, Y., Beard, C. &
Jaenisch, R. Ectopic expression of Oct-4 blocks progenitor-cell
differentiation and causes dysplasia in epithelial tissues. [0123]
17) Cell 121, 465-477 (2005). [0124] 18) Beard, C., Hochedlinger,
K., Plath, K., Wutz, A. & Jaenisch, R. Efficient method to
generate single-copy transgenic mice by site-specific integration
in embryonic stem cells. Genesis 44, 23-28 (2006). [0125] 19)
Mitsui, K. et al. The homeoprotein Nanog is required for
maintenance of pluripotency in mouse epiblast and ES cells. Cell
113, 631-642 (2003). [0126] 20) Boyer, L. A. et al. Core
transcriptional regulatory circuitry in human embryonic stem cells.
Cell 122, 947-956 (2005). [0127] 21) Jaenisch, R. & Young, R.
Stem cells, the molecular circuitry of pluripotency and nuclear
reprogramming. Cell 132, 567-582 (2008). [0128] 22) Jones, P. H.
& Watt, F. M. Separation of human epidermal stem cells from
transit amplifying cells on the basis of differences in integrin
function and expression. Cell 73, 713-724 (1993). [0129] 23) Hanna,
J. et al. Direct reprogramming of terminally differentiated mature
B lymphocytes to pluripotency. Cell 133, 250-264 (2008). [0130] 24)
Cole, M. F., Johnstone, S. E., Newman, J. J., Kagey, M. H. &
Young, R. A. Tcf3 is an integral component of the core regulatory
circuitry of embryonic stem cells. Genes Dev 22, 746-755 (2008).
[0131] 25) Aoi, T. et al. Generation of Pluripotent Stem Cells from
Adult Mouse Liver and Stomach Cells. Science (2008). [0132] 26)
Stadtfeld, M., Brennand, K. & Hochedlinger, K. Reprogramming of
Pancreatic beta Cells into Induced Pluripotent Stem Cells. Curr
Biol (2008). [0133] 27) Rheinwald, J. in Cell Growth and Division:
A Practical Approach. (ed. R. Baserga) 81-94 (Oxford Press, Oxford;
1989). [0134] 28) Vescovi, A. L., Galli, R. & Gritti, A. in
Neural Stem Cells: Methods and Protocols. (eds. T. Zigova, P. R.
Sanberg & J. R. Sanchez-Ramos) 115-123 (Humana Press, 2002).
[0135] 29) Ferraris, R. P., Villenas, S. A. & Diamond, J.
Regulation of brush-border enzyme activities and enterocyte
migration rates in mouse small intestine. Am J Physiol 262,
G1047-1059 (1992).
Example 2
I. Overview
A. Generation of Tools for the Genetic Manipulation of Human ES and
iPS Cells
[0136] Work described herein provides robust approaches for
targeting genes in huES cells and to generate tools for the
reprogramming of somatic cells into iPS cells. More specifically,
homologous recombination is used to insert GFP into key neural
lineage genes of huES and iPS cells. The GFP marker is used to
isolate neuronal precursor cells from manipulated iPS cells to
assess their developmental potential. The current reprogramming
protocols rely on retroviral vector-mediated transduction of
transcription factors resulting in multiple proviral insertions in
the iPS cells. This work describes methods that either avoid the
use of multiple viral infections or all but eliminate the
requirement for virus-mediated reprogramming.
1. DOX and Tamoxifen Inducible Retroviral Vectors
[0137] DOX inducible retroviral vectors have been important to
define the sequential activation of pluripotency markers and the
minimum time of vector expression during reprogramming of somatic
mouse cells. We have generated inducible lentiviral vectors that
will allow the temporally restricted expression of the
reprogramming factors.
(a) DOX inducible lentivirus vectors: Following the same strategy
as used for murine genes we have generated lentiviral vectors that
transduce the human OCT4, SOX2, KLF4 and C-MYC c-DNAs either
constitutively or under the control of a DOX inducible promoter
[Brambrink, 2008 #6877]. To generate a DOX inducible system we
infected human fibroblasts with a lentiviral vector carrying the
rtTA transactivator. FIG. 11A shows high DOX-dependent expression
of OCT4, SOX2, and KLF4 in fibroblasts transduced with the
respective DOX inducible vectors. Similarly, robust DOX dependent
transgene expression was observed in iPS cells derived from the
infected fibroblasts (right two panels of FIG. 11A). (b) Tamoxifen
inducible lentivirus vectors: To enable independent inducible
control of vectors we also generated OCT4, SOX2 and C-MYC estrogen
receptor (ER) fusion constructs by fusing the factors to the
estrogen ligand binding domain to allow for tamoxifen dependent
expression [Grandori, 1996 #6505]. As shown in FIG. 11B, addition
of tamoxifen to cells transduced with a SOX2-ER fusion construct
leads to translocation of the SOX2 protein from the cytoplasm to
the nucleus as expected for drug induced activation. These results
show that the DOX and ER fusion inducible systems can be used to
independently control the expression of transduced factors.
[0138] One important concept is the use of two different
regulatable systems, each controlling expression of a subset of the
factors. For example, one might place 3 of the factors under
control of a first inducible (e.g., dox-inducible) promoter and the
4.sup.th factor under control of a second inducible (e.g.,
tamoxifen-inducible) promoter. Then, one could generate an iPS cell
by inducing expression from both promoters, generate a mouse from
this iPS cell, and isolate fibroblasts (or any other cell type)
from the mouse. These fibroblasts would be genetically homogenous
and would be reprogrammable without need for viral infection. One
would then attempt to reprogram the fibroblasts under conditions in
which only the first promoter is active, in the presence of
different small molecules that could potentially substitute for the
4.sup.th factor, in order to identify small molecule "reprogramming
agents" or optimize transient transfection or other protocols for
introducing the 4.sup.th factor. A number of variations are
possible; for example, one might stably induce expression of 3
factors and transiently induce expression of the 4.sup.th factor,
etc. Also, one can modulate expression levels of the factors by
using different concentrations of inducing agent.
[0139] Another approach is to place the gene that encodes one of
the factors between sites for a recombinase and then induce
expression of the recombinase to turn off expression of that
factor. Recombinase expression could be induced by infecting with a
viral vector (e.g., Adenovirus-Cre). Hanna, et al, Science, 318,
1920-1923 (2007) describes such an approach, which was used to
reduce the potential risk of tumor formation due to c-Myc transgene
expression--Cells were infected with retroviruses encoding for
Oct4, Sox2, and Klf4 factors and a lentivirus encoding a 2-lox
c-Myc cDNA. iPS cells generated from these cells were infected with
an adenovirus encoding Cre recombinase to delete the
lentivirus-transduced c-Myc copies.
[0140] These systems are useful, e.g., for identifying
reprogramming agents and studying the requirements and events that
occur in reprogramming (including discovering cell-type specific
differences).
2. Generation of Human iPS Cells Confirming that the Inducible
System Works as Expected in Human as Well as Mouse.
[0141] A number of different strategies have been shown to induce
iPS cells from mouse or human somatic donor cells including the
constitutive or inducible expression of the four transcription
factors Oct4, Sox2, Klf4 and c-myc or a subset of the four factors
or alternative factor combinations [Lowry, 2008 #6827; Park, 2008
#6783; Takahashi, 2007 #6769; Yu, 2007 #6793]. The utility of the
different vector systems described in FIG. 11A for the
reprogramming of human fibroblasts was compared. Table 1 shows that
iPS cells were obtained by transduction of 4 or 3 (minus C-MYC)
constitutively expressed or DOX inducible transcription factors.
When the DOX inducible lentiviruses were used iPS clones appeared
with a similar frequency and after about the same time in the
infected cultures as has been published by others [Takahashi, 2007
#6769]. FIG. 12A shows that the endogenous OCT4 and NANOG genes
were expressed in 2 iPS lines at similar levels as in huES cells.
The reprogrammed iPS cells grew as tight colonies with morphology
typical of human ES cells and they expressed the appropriate
pluripotency markers (FIG. 12B). To test for pluripotency the iPS
cells were injected into SCID mice. Histological examination of the
resulting tumors showed typical teratomas containing multiple
differentiated cell types (FIG. 12C).
B. Generation of Mouse and Human iPS Cells by a Polycistronic
Retroviral Vector
[0142] Many current protocols to generate iPS cells call for
transduction of the 4 transcription factors Oct4, Sox2, c-myc and
Klf4 by four different retroviral vectors. Reprogramming in this
manner involves the selection for the small fraction of infected
cells that carry multiple integrated vectors (up to 15 or more
proviruses:) raising concerns of cancer due to the use of powerful
oncogenes and/or retrovirus induced insertional mutagenesis. To
reduce the number of independent proviral integrations required for
reprogramming we have designed and used a polycistronic vector that
can transduce any combination of the factors with a goal of
reducing the number of proviral integrations.
[0143] Internal ribosomal entry sites (IRES) are widely used to
express multiple genes from one promoter but this frequently leads
to non-stoichiometric expression of the genes. The self-cleaving
18-22 amino acids long 2A peptides mediate `ribosomal skipping`
between the proline and glycine residues and inhibit peptide bond
formation without affecting downstream translation. These peptides
allow multiple proteins to be encoded as polyproteins, which
dissociate into component proteins upon translation. Use of the
term "self-cleaving" is not intended to imply proteolytic cleavage
reaction.
[0144] Self-cleaving peptides are found in members of the
Picornaviridae virus family, including aphthoviruses such as
foot-and-mouth disease virus (FMDV), equine rhinitis A virus
(ERAV), Thosea asigna virus (TaV) and porcine teschovirus-1 (PTV-1)
(Donnelly, M L, et al., J. Gen. Virol., 82, 1027-101 (2001); Ryan,
M D, et al., J. Gen. Virol., 72, 2727-2732 (2001) and cardioviruses
such as Theilovirus (e.g., Theiler's murine encephalomyelitis) and
encephalomyocarditis viruses. The 2A peptides derived from FMDV,
ERAV, PTV-1, and TaV are sometimes referred to herein as "F2A",
"E2A", "P2A", and "T2A", respectively. Aphthovirus 2A polypeptides
are typically .about.18-22 amino acids long and contain a Dx1Ex2NPG
(SEQ ID NO: 34), where x1 is often valine or isoleucine. As noted
above, the 2A sequence is believed to mediate `ribosomal skipping`
between the proline and glycine, impairing normal peptide bond
formation between the P and G without affecting downstream
translation. An exemplary 2A sequence is VKQTLNFDLLKLAGDVESNPGP
(SEQ ID NO: 35) from FMDV, where underlined residues are conserved
in many 2A peptides. The C terminus of cardiovirus 2A peptides is
conserved, shows a high degree of similarity with FMDV 2A peptide,
and has been shown to also mediate self-cleavage (Donnelly, M L, et
al., J. Gen. Virol., 78, 13-21 (1997). FDMV 2A peptide has been
shown to mediate cleavage of an artificial polyprotein (Ryan, M D
and Drew, J., EMBO J., 13, 928-933 (1994). The ability to express
four proteins efficiently and stoichiometrically from one
polycistron in vivo was demonstrated recently using self-processing
2A peptides to express the four CD3 proteins (Szymczak et al.,
Nature Biotech. 5, 589-594, 2004). Polycistronic transgenes in
which the individual cDNAs are separated by 2A peptides have been
shown to promote polycistronic gene expression in transfected cells
including huES cells (Hasegawa, K., et al., Stem Cells. 2007 July;
25(7):1707-12, 2007).
[0145] The present invention provides polycistronic nucleic acid
constructs, expression cassettes, and vectors useful for generating
induced pluripotent stem (iPS) cells. In certain embodiments the
polycistronic nucleic acid constructs comprise a portion that
encodes a self-cleaving peptide. The invention provides a
polycistronic nucleic acid construct comprising at least two coding
regions, wherein the coding regions are linked to each by a nucleic
acid that encodes a self-cleaving peptide so as to form a single
open reading frame, and wherein the coding regions encode first and
second reprogramming factors capable, either alone or in
combination with one or more additional reprogramming factors, of
reprogramming a mammalian somatic cell to pluripotency. In some
embodiments of the invention the construct comprises two coding
regions separated by a self-cleaving peptide. In some embodiments
of the invention the construct comprises three coding regions each
encoding a reprogramming factor, wherein adjacent coding regions
are separated by a self-cleaving peptide. In some embodiments of
the invention the construct comprises four coding regions each
encoding a reprogramming factor, wherein adjacent coding regions
are separated by a self-cleaving peptide. The invention thus
provides constructs that encode a polyprotein that comprises 2, 3,
or 4 reprogramming factors, separated by self-cleaving peptides. In
some embodiments the construct comprises expression control
element(s), e.g., a promoter, suitable to direct expression in
mammalian cells, wherein the portion of the construct that encodes
the polyprotein is operably linked to the expression control
element(s). The invention thus provides an expression cassette
comprising a nucleic acid that encodes a polyprotein comprising the
reprogramming factors, each reprogramming factor being linked to at
least one other reprogramming factor by a self-cleaving peptide,
operably linked to a promoter (or other suitable expression control
element). The promoter drives transcription of a polycistronic
message that encodes the reprogramming factors, each reprogramming
factor being linked to at least one other reprogramming factor by a
self-cleaving peptide. The promoter can be a viral promoter (e.g.,
a CMV promoter) or a mammalian promoter (e.g., a PGK promoter). The
expression cassette or construct can comprise other genetic
elements, e.g., to enhance expression or stability of a transcript.
In some embodiments of the invention any of the foregoing
constructs or expression cassettes may further include a coding
region that does not encode a reprogramming factor, wherein the
coding region is separated from adjacent coding region(s) by a
self-cleaving peptide. In some embodiments the additional coding
region encodes a selectable marker.
[0146] Specific reprogramming factors that may be encoded by the
polycistronic construct include transcription factors Oct4, Sox2,
Klf4, c-Myc, and Nanog, which are further described herein and
known in the art. The invention encompasses all combinations of two
or more of the foregoing factors, in each possible order. For
purposes of brevity, not all of these combinations are individually
listed herein. In some embodiments, the construct encodes Oct4,
Klf4, and Sox2, separated by 2A peptides. In some embodiments the
construct does not encode c-Myc. In some embodiments, the construct
contains a coding region that encodes Lin28. In some embodiments,
the construct contains a coding region that encodes C/EBP
alpha.
[0147] In some embodiments the construct comprises one or more
sites that mediates or facilitates integration of the construct
into the genome of a mammalian cell. In some embodiments the
construct comprises one or more sites that mediates or facilitates
targeting the construct to a selected locus in the genome of a
mammalian cell. For example, the construct could comprise one or
more regions homologous to a selected locus in the genome.
[0148] In some embodiments the construct comprises sites for a
recombinase that is functional in mammalian cells, wherein the
sites flank at least the portion of the construct that comprises
the coding regions for the factors (i.e., one site is positioned 5'
and a second site is positioned 3' to the portion of the construct
that encodes the polyprotein), so that the sequence encoding the
factors can be excised from the genome after reprogramming. The
recombinase can be, e.g., Cre or Flp, where the corresponding
recombinase sites are LoxP sites and Frt sites. In some embodiments
the recombinase is a transposase. It will be understood that the
recombinase sites need not be directly adjacent to the region
encoding the polyprotein but will be positioned such that a region
whose eventual removal from the genome is desired is located
between the sites. In some embodiments the recombinase sites are on
the 5' and 3' ends of an expression cassette. Excision may result
in a residual copy of the recombinase site remaining in the genome,
which in some embodiments is the only genetic change resulting from
the reprogramming process.
[0149] In some embodiments the construct comprises a single
recombinase site, wherein the site is copied during insertion of
the construct into the genome such that at least the portion of the
construct that encodes polyprotein comprising the factors (and,
optionally, any other portion of the construct whose eventual
removal from the genome is desired) is flanked by two recombinase
sites after integration into the genome. For example, the
recombinase site can be in the 3' LTR of a retroviral (e.g.,
lentiviral) vector (see, e.g., Example 4).
[0150] In some aspects, the invention provides vectors comprising
the polycistronic nucleic acid constructs. In some embodiments the
vectors are retroviral vectors, e.g., lentiviral vectors. In other
embodiments the vectors are non-retroviral vectors, e.g., which may
be viral (e.g., adenoviral) or non-viral. Exemplary polycistronic
nucleic acid constructs, expression cassettes, and vectors are
described in Example 3
[0151] In some aspects, the invention provides cells and cell lines
(e.g., somatic cells and cell lines such as fibroblasts,
keratinocytes, and cells of other types discussed herein) in which
a polycistronic nucleic acid construct or expression cassette
(e.g., any of the constructs or expression cassettes described
herein) is integrated into the genome. In some embodiments the
cells are rodent cells, e.g., a murine cells. In some embodiments
the cells are primate cells, e.g., human cells.
[0152] In some embodiments at least the portion of the construct
that encodes the polyprotein is flanked by sites for a recombinase.
After a reprogrammed cell is derived, a recombinase can be
introduced into the cell, e.g., by protein transduction, or a gene
encoding the recombinase can be introduced into the cell, e.g.,
using a vector such as an adenoviral vector. The recombinase
excises the sequences encoding the exogenous reprogramming factors
from the genome. In some embodiments the cells contain an inducible
gene that encodes the recombinase, wherein the recombinase is
expressed upon induction and excises the cassette. In some
embodiments the inducible gene is integrated into the genome. In
some embodiments the inducible gene is on an episome. In some
embodiments the cells do not contain an inducible gene encoding the
recombinase.
[0153] In some embodiments, the nucleic acid construct or cassette
is targeted to a specific locus in the genome, e.g., using
homologous recombination. In some embodiments the locus is one that
is dispensable for normal development of most or all cell types in
the body of a mammal. In some embodiments the locus is one into
which insertion does not affect the ability to derive pluripotent
iPS cells from a somatic cell having an insertion in the locus. In
some embodiments the locus is one into which insertion would not
perturb pluripotency of an ES cell. In some embodiments the locus
is the COL1A1 locus or the AAV integration locus. In some
embodiments the locus comprises a constitutive promoter. In some
embodiments the construct or cassette is targeted so that
expression of the polycistronic message encoding the polypeptide
comprising the factors is driven from an endogenous promoter
present in the locus to which the construct or cassette is
targeted.
[0154] The invention further provides pluripotent reprogrammed
cells (iPS cells) generated from the somatic cells that harbor the
nucleic acid construct or expression cassette in their genome. The
iPS cells can be used for any purpose contemplated for pluripotent
cells. Further provided are differentiated cell lines (e.g., neural
cells, hematopoietic cells, muscle cells, cardiac cells), derived
from the pluripotent reprogrammed cells. Exemplary somatic cells
and iPS cell generated therefrom are described in Example 3.
[0155] The present invention establishes that the reprogramming
factors possess the requisite structural features to allow
efficient processing of the 2A sequence when located between
reprogramming factors, an important finding since it is recognized
that cleavage is a structure-based event (Szymczak, supra). The
present disclosure establishes that transcription factors having
the additional .about.17-21 amino acids from the 2A peptide at
their C-terminus retain the ability to enter the nucleus and
perform their functions. The present disclosure also establishes
that reprogramming factors can tolerate the presence of the
additional .about.17-21 amino acids from the 2A peptide that remain
on the C-terminus of the upstream protein and remain functional in
reprogramming.
[0156] While reprogramming by infecting with high titer retroviral
vectors to express the required reprogramming factors is highly
reproducible, the process is relatively inefficient and the precise
requirements in terms of timing and order of expression of the
factors, as well as the absolute and relative levels of expression
required, remain incompletely understood. Moreover, when iPS cells
are generated by infecting cells with multiple viruses, each
encoding a single factor, in many current protocols, each virus has
been shown to cause integrations at between 2-6 locations,
resulting in .about.14-20 insertion events throughout the genome.
This process creates iPS cells that are genetically modified and
may contain unknown insertion-generated mutations. Furthermore,
since only a small fraction of infected cells become reprogrammed,
the results obtained using these multi-virus protocols leave open
the question as to whether the location of the integrations and/or
the relative timing at which expression from the transgenes occurs
is an important determinant of whether a cell will become
reprogrammed. The instant invention establishes that essentially
simultaneous expression of multiple factors from a polycistronic
transcript and at relative levels dependent on the efficiency of
the 2A cleavage event, is effective to induce reprogramming.
Furthermore, the invention establishes that a single copy of the
factors is sufficient for reprogramming. Because the four factors
are expressed from a defined location in certain embodiments of the
invention (e.g., a location that is preselected or one that is
determined after integration of the vector) the polycistronic
vector system may simplify the study of reprogramming mechanisms
and facilitates the excision of the vector. In some embodiments,
such excision results in removal of at least the exogenous
sequences encoding the reprogramming factors. In some embodiments,
such excision results in iPS cells that carry no genetic
modification other than, in some embodiments, a residual
recombinase site. In other embodiments, there are no more than 2,
3, 4, or 5 residual recombinase sites. Without wishing to be bound
by theory, reprogramming cells containing a single integrated
construct will increase the likelihood or ease of recovering
transgene-free iPS cells using recombinase-based approaches. It is
also contemplated that polycistronic vectors encoding 2, 3, or 4
factors may be used in combination with small molecules, proteins,
or other agents that enhance reprogramming and/or that substitute
for one or more factors not encoded by the polycistronic
vector.
[0157] Example 4 describes experiments in which human induced
pluripotent stem cells (hiPSCs) free of reprogramming factors were
derived using Cre-recombinase excisable viruses from fibroblasts
from individuals with Parkinson's disease (PD). In some embodiments
of the invention, iPS cells carrying no exogenous genes encoding
reprogramming factors are derived as described in Example 4 or
using similar methods, except that a single vector comprising a
polycistronic nucleic acid construct encoding a polyprotein
comprising multiple (2, 3, or 4 factors) is used rather than
multiple vectors encoding single factors. Of course the methods
described in Example 4 can also be used with multiple vectors
encoding individual factors in order to obtain iPS cells without
exogenous genes encoding reprogramming factors, wherein the
resulting iPS cells have only a small number of residual
recombinase sites. While fibroblasts from individuals with PD were
used as an exemplary cell type in Example 4, the methods are
applicable to derive iPS cells with minimal genetic alteration from
normal somatic cells (e.g., fibroblasts or other cell types such as
keratinocytes, intestinal cells, blood cells) or from somatic cells
from individuals with a disease of interest. In some embodiments,
the gene encoding the transactivator is also flanked by recombinase
sites, so that it is removed from the genome as well.
[0158] The iPS cells and differentiated cells obtained from them
are of use for research purposes (e.g., as a model system to study
the disease and/or identify therapeutic agents for the disease)
and/or for the development of cell-based therapies, which in some
embodiments are patient-specific cell-based therapies.
C. Developmental Potential of Human iPS Cells and Derivation from
Peripheral Blood
[0159] An exciting potential of the iPS system is to derive patient
specific pluripotent cells. Work described herein describes
protocols that will allow the study of complex human diseases in
vitro using patient specific iPS cells. For example, at present
patient specific iPS cells are derived from deep skin biopsies. In
an effort to establish a potentially more simple protocol to
isolate iPS cells in a clinical setting procedures described here
use peripheral blood as donor material for generating iPS
cells.
D. Screen for Small Molecules
[0160] Work described herein provides high throughput systems for
identifying small molecules that improve reprogramming efficiency.
This allows for the establishment of a reprogramming method that
does not require the genetic manipulation or insertion of exogenous
genetic elements such as vector mediated transduction of oncogenes
like C-MYC or KLF4.
II. Experimental Approach
[0161] In the mouse system the use of vectors that allowed for drug
inducible expression of the transcription factors has been crucial
to define the molecular events that cause reprogramming. These
experiments indicated that reprogramming involves the sequential
activation of ES cell markers such as alkaline phosphatase, SSEA1,
Oct4 and Nanog and that the transduced transcription factors needed
to be expressed for at least 12 days in order to give rise to iPS
cells [Brambrink, 2008 #6877]. A major goal of aim A is to generate
tools that will help in reprogramming somatic cells and allow the
genetic manipulation of human ES and iPS cells. These tools will be
important for aim B which focuses on the mechanism of human somatic
cell reprogramming. The goal of aim C is establishing experimental
systems to evaluate the potential of human iPS cells to
differentiate into functional neuronal cells in vitro as well as in
vivo in chimeric mice. Furthermore, we will design protocols to
generate iPS cells from human peripheral blood. Finally, the focus
of aim D is to screen for chemical compounds as alternatives to
activating reprogramming pathways by genetic means.
A. Generation of Tools for the Genetic Manipulation of Human ES and
iPS Cells
[0162] The ability to genetically alter endogenous genes by
homologous recombination has revolutionized biology and, in
combination with embryonic stem cells, holds great promise for
molecular medicine. Although gene targeting is a routine procedure
in mouse ES cells, it has previously been difficult to transfer
this technology to human embryonic stem cells [Giudice, 2008
#6863]. Indeed, only 4 publications have appeared reporting
successful targeting of an endogenous gene since the first
isolation of human ES cells by Thomson 10 years ago [Davis, 2008
#6860; Irion, 2007 #6857; Zwaka, 2003 #6223; Urbach, 2004 #6163].
The difficulties of genetically modifying endogenous genes need to
be overcome to realize the full potential of human ES cells.
[0163] The focus of this work is to establish tools that will allow
for the efficient genetic manipulation of human ES and iPS cells.
To produce huES cells carrying marker in lineage specific genes we
will use two different approaches, genetically modified human ES
cells were created carrying markers in key developmental regulators
using conventional homologous recombination. These markers,
inserted in lineage specific genes, will be used in subsequent aims
for differentiation of iPS cells into specific neuronal lineages.
An experimental system that allows for the efficient reprogramming
of somatic cells in the absence of retrovirus mediated factor
transduction was also developled.
Targeting of Lineage Specific Genes by Homologous Recombination
[0164] The derivation of differentiated cells from undifferentiated
ES cells is facilitated by markers inserted into lineage specific
endogenous genes that can be used for the isolation of a desired
differentiated cell type. Our preliminary experiments demonstrated
targeting of the OCT4 as well as the COL1A1 locus with GFP or drug
resistance markers. Accordingly a goal was togenerate ES and iPS
cells that carry drug resistance markers and/or GFP (or other
detectable marker) sequences in genes that are expressed in cells
of the neural or other lineage and can be used for screening or
selection of differentiated cell types that are affected in
diseases such as Alzheimer's and Parkinson's.
(i) Gene targeting of neural lineage specific target genes by
homologous recombination:
[0165] In contrast to mouse ES cells, human ES cells are usually
passaged mechanically using only limited enzymatic digestion as
cellular cloning selects for chromosomal aberrations that enhance
single cell growth. This as well as the slow growth may be
important reasons that gene targeting has been so inefficient in
huES cells. Recently, application of the ROCK inhibitor Y-27632 to
huES cells has been shown to markedly diminish dissociation-induced
apoptosis and to increase cloning efficiency [Watanabe, 2007
#6549]. All experiments will, therefore, be done in the presence of
this inhibitor.
[0166] For homologous recombination, targeting vectors containing
GFP and neo resistance markers separated by 2A sequences will be
constructed from isogenic genomic DNA of BGO2 or H9 ES cells using
routine procedures. The DNA will be electroporated into the cells
following published procedures [Costa, 2007 #6868], and DNA from
drug resistant colonies will be isolated and analyzed for correct
targeting. We will target genes that are activated at different
times during neural differentiation and in different subsets of
neurons as detailed below.
SOX1: The transcription factor SOX1 is the earliest known gene that
is exclusively expressed in neural precursors of the mouse [Aubert,
2003 #6841]. GFP inserted into this gene will serve as a convenient
marker for selecting huES or iPS cell-derived neural precursor
cells. FOXG1: Expression of this gene has been demonstrated in
proliferating telencephalic precursor cells and in
acetyl-cholinergic neurons of the basal forebrain [Hebert, 2000
#6844], cells that are affected in Alzheimer's. PITX3: This
homeodomain transcription factor is selectively expressed during
terminal differentiation of tyrosine hydroxylase positive neurons
and sorting of differentiated ES cells derived from PITX3-GFP
transgenic mice has been shown to enrich for dopaminergic neurons
[Hedlund, 2008 #6845; Zhao, 2004 #6846]. LMX1: This homeodomain
transcription factor appears to be a crucial determinant of
proliferating dopaminergic precursor cells [Andersson, 2006
#6840].
[0167] The marking of relevant lineage specific genes by GFP has
been shown to aid in establishing robust differentiation protocols
that allow for the isolation of enriched or even homogeneous
populations of differentiated cells. HuES cells carrying GFP in the
4 genes will allow enrichment for precursors as well as more
differentiated cells that are relevant for the study of iPS cells
derived from patients with diseases such as Alzheimer's or
Parkinson's disease.
[0168] The difficulty of establishing efficient methods of
homologous recombination has greatly impeded the utility of the
huES cell system. Preliminary data are encouraging and demonstrate
that two endogenous loci, OCT4 and COL1A1, have been targeted with
GFP and puromycin resistance cDNAs (FIG. 10). However, so far only
genes that are expressed in ES cells (OCT4, HPRT, ROSA26 [Irion,
2007 #6857; Zwaka, 2003 #6223; Urbach, 2004 #6163]) or that are
poised to be expressed such as MOXL1 [Davis, 2008 #6860] have been
targeted in human ES cells. Also, the COL1A1 locus is highly
recombinogenic in mouse cells [Beard, 2006 #6199] and targeting of
this locus may not be representative of other non-expressed genes.
Thus, because our intent is to target non-expressed genes by
homologous recombination, this aim poses a challenge.
"Secondary" iPS Cells Carrying Different Combinations of
Reprogramming Factors
[0169] We have shown that mouse iPS cells may carry 15 or more
proviral inserts [Wernig, 2007 #6641] suggesting a strong selection
for the small fraction of cells that harbor multiple copies of each
vector to achieve high levels or a certain stoichiometry of factor
expression required for the initiation of the reprogramming
process. Described herein is a system that circumvents the need for
viral transduction and thus eliminates the necessity to select for
the small fraction of cells carrying the "right" combination of
proviruses. Indeed, the generation of "secondary" fibroblasts that
were clonally derived from "primary" iPS cells and carried the
appropriate number of DOX inducible proviruses that had achieved
reprogramming in the first place allowed us to reprogram mature B
cells to a pluripotent state [Hanna, 2008 #6842]. This approach was
adapted to human cells and generated secondary fibroblasts that
carry the reprogramming factors (i) either as proviral vectors
integrated into pre-selected chromosomal positions or (ii) inserted
by homologous recombination into a genomic expression locus. This
system can be used to determine the mechanisms of reprogramming and
to screen for small molecules that enhance reprogramming or replace
any of the factors.
(i). Secondary fibroblasts carrying pre-selected proviruses: To
pre-select for cells that carry the "right" combination and number
of retroviral copies, a two-step protocol may be utilized. FIGS.
23A-23B outline the approach, which follows the same logic utilized
to reprogram mouse B cells into iPS cells [Hanna, 2008 #6842].
First, ES or iPS cells carrying the GFP marker in the OCT4 gene as
well as a lentivirus transduced tet rtTA transactivator will be
differentiated into fibroblasts. These "primary" fibroblasts will
be transduced with all four factors using DOX inducible vectors and
cultured in the presence of DOX and screened for OCT4 activation to
isolate reprogrammed "primary" iPS cells. These iPS cells will be
differentiated in the absence of DOX to generate "secondary"
fibroblasts (FIG. 23A). The rationale for this approach is that
secondary fibroblasts carry the "right" combination of vector
copies because they were selected as "primary" iPS cells in the
first step. These secondary fibroblasts are genetically homogenous
since they arise from a single iPS colony. Upon addition of DOX to
such cultures the integrated vectors will be reactivated resulting
in the consistent generation of "secondary" iPS cells without
requiring the new transduction of factors (FIG. 23B). This can be
used to generate human secondary iPS cells (or mouse, monkey,
etc.), without going through the process of generating an animal
from the primary iPS cell. Alternatively, DOX inducible
polycistronic vectors (FIG. 13A-13C) can be used instead of the
single-factor vectors for the generation of primary iPS cells.
(ii). Secondary fibroblasts carrying reprogramming factors in the
COL1A1 locus: In an effort to avoid all retrovirus infection
secondary fibroblasts that carry all reprogramming factors in the
COL1A1 locus or other non-essential locus such as ROSA26 or AAVS1
locus (a specific locus into which Adeno-associated virus (AAV)
integrates) are produced. In mouse ES cells we have shown that the
Col1a1 locus can be efficiently targeted resulting in reproducible
ubiquitous or inducible expression of inserted transgenes [Beard,
2006 #6199; Hochedlinger, 2005 #5758]. Reporter cells will be
constructed that carry, in addition to the Dox inducible rtTA
transactivator and the OCT4 GFP reporter a polycistronic vector
inserted into the COL1A locus encoding all or a subset of the
reprogramming factors under the control of the tet operator (FIG.
24). In this illustration, OCT4, SOX2 and cMYC have been inserted
into the COL1A1 locus. Primary fibroblasts will be derived in vitro
and will be infected with a KLF4 virus flanked by two Lox sites.
Primary iPS cells will be selected as above with the three factors
being induced by DOX, the KLF4 virus will be deleted by Cre
transduction [Hanna, 2007 #6781] and secondary fibroblasts lacking
vKLF4 will be derived by in vitro differentiation. These cells can
be screened for small molecules that replace the need for KLF4 in
reprogramming (see later, Aim D) or for streamlining transient
transfection protocols (Aim B.2, 4).
[0170] Reprogramming selects for the small fraction of iPS cells
that carry a high number of proviral insertions. The experiments
proposed in this aim seek to establish an experimental system that
allows a more efficient and reproducible reprogramming as the
process would be independent of random proviral insertions that
select the rare iPS cells. The goal is to generate secondary
fibroblasts that carry any combination of 2 or 3 DOX inducible
factors and thus would allow screening for small molecules that
replace the missing factor(s) for our aim to screen for small
molecules that can enhance or induce reprogramming (Aim D). Also,
this system will be important for studying the molecular mechanisms
of reprogramming (Aim B.4).
B. In Vitro Reprogramming of Somatic Human Cells
[0171] The DOX inducible lentivirus system has been used to define
the reprogramming kinetics of mouse fibroblasts. Work described
herein uses the tools described above to determine the kinetics and
minimal vector expression for reprogramming of human somatic cells.
Furthermore, we will develop methods of reprogramming that would
minimize or circumvent genetic alterations and we will use
insertional mutagenesis to isolate additional genes that enhance
reprogramming. Finally, we will define the epigenetic state of iPS
cells as well as of intermediate stages of reprogramming.
C. Developmental Potential and Derivation from Blood Donor
Cells
[0172] The most important application of patient specific iPS cells
is their potential use in studying complex human diseases in the
test tube. For this application robust experimental approaches need
to be established before this technology can be used in a clinical
setting. Work described herein establishes procedures that allow
the reproducible in vitro differentiation of iPS and huES cells and
the evaluation of the in vivo potential of iPS cells. Isolation of
iPS cells from peripheral human blood samples may also be
performed.
3. B Cells, T Cells and Macrophages as Donors
[0173] It is of interest to directly reprogram cells obtained from
peripheral blood samples instead of from deep skin biopsies, as
this would facilitate generating patient specific iPS cells in a
clinical setting. We have recently shown that immature and mature
mouse B cells can efficiently be reprogrammed to pluripotent iPS
cells and that these cells carried the donor cell specific genetic
rearrangements of the immunoglobulin locus [Hanna, 2008 #6842].
Surprisingly, the efficiency of reprogramming mature mouse B cells
was 3%, which is substantially higher than that of adult
fibroblasts or MEFs. This aim will seek to adapt the methods used
for reprogramming of mouse lymphoid cells to human peripheral blood
samples.
Donor cells: Transduction with the c/EBPa transcription factor was
required to render mature mouse B cells susceptible to the action
of the four reprogramming factors [Hanna, 2008 #6842]. We will
isolate various cell populations from human peripheral blond and
test their susceptibility to reprogramming. (i) B and T cells: In
an effort to adapt the protocol for mouse B cell reprogramming we
will use established procedures to stimulate proliferation of B and
T cells [Mercier-Letondal, 2008 #6855] and infect the cells with
vectors transducing c/EBPa and the tet rtTA transactivator. After a
few days of culture in cytokines the cells will be transduced with
the four DOX inducible reprogramming factors OCT4, SOX2, C-MYC and
KLF4 and cultured in ES cell medium. Reprogrammed colonies will be
isolated by morphology and tested for the expression of
pluripotency markers such as TRA160, SSEA3/4, NANOG and OCT4. To
verify the donor cell origin of the iPS cells we will analyze
genomic DNA for the presence of Ig or TCR rearrangements. (ii)
Monocytes: Our results with mouse suggested that an intermediate
step in the reprogramming of mature B cells might be a
macrophage-like cell [Hanna, 2008 #6842]. Monocytes will be
isolated from buffy coats of human volunteers by Ficoll gradient
centrifugation and adherent cells will be collected. The cells will
be grown in IL4 and GM-CSF following established procedures [Damaj,
2007 #6854]. We will then transduce the cells with the four factors
OCT4, SOX2, cMYC and KLF4 as above and continue cultivation in ES
cell medium in the presence of DOX. Colonies with iPS morphology
will be picked and analyzed for the expression of pluripotency
markers as above. The developmental potential of the blood-derived
iPS cells will be assessed by standard procedures such as teratoma
formation and in vitro differentiation.
[0174] Presently, the strategy of isolating patient specific iPS
cells envisions the reprogramming of donor cells derived from deep
skin biopsies, a procedure that is more complex and painful than
collecting blood. For the routine clinical application it would be
of obvious interest to design reproducible protocols for the
routine isolation of patient specific iPS cells from peripheral
blood samples. We anticipate that the proposed experiments will
help in establishing such protocols.
[0175] Given the ease and efficiency of mouse B cell reprogramming
we are encouraged that this protocol should also be effective in
reprogramming human peripheral blood derived cells. Because B or T
cell-derived iPS cells would carry genetic rearrangements at the Ig
or TCR locus, respectively, it may be advantageous for potential
therapeutic applications to use macrophages or monocytes as donors
as they would harbor no genetic changes. Although we do not know
the mechanism that causes c/EBPalpha to render mature B cells
susceptible to reprogramming by OCT4, SOX2, cMYC and KLF4, it may
involve the conversion of B cell identity to that of macrophages
[Xie, 2004 #5447]. These considerations suggest that deriving iPS
cells from human monocytes may be straightforward. However, if the
procedures developed in the mouse fail to yield blood derived human
iPS cells, we will screen for additional factors using established
approaches.
D. Screen for Small Molecules
[0176] The induction of reprogramming by retroviral vector mediated
gene transfer, in particular the transduction of oncogenes,
represents a serious impediment to the eventual therapeutic
application of this approach. For example, we and others [Okita,
2007 #6542] have seen that tumors form in chimeras produced with
iPS cells due to v-myc c-Myc activation. It is, therefore, of
interest to identify small molecules that would either improve
reprogramming efficiency or would activate a relevant pathway and
thus could replace the need for expressing a given factor such as
C-MYC or KLF4. The goal of this aim is to establish high-throughput
cell-based assay systems to screen chemical libraries for such
compounds.
D.1 Experimental Design and Reporter Cells for Small Molecule
Library Screens
[0177] To detect reprogramming in a high-throughput screen we need
cells carrying a marker such as GFP inserted into the endogenous
OCT4 or NANOG locus. Such cells will not express the marker but can
be used to screen for compounds that activate either of the
endogenous genes.
[0178] For setting up a high-throughput screen for reprogramming we
consider two major constraints that limit the experimental design.
[0179] Heterogeneous cell population: Arguably, the most critical
limitation is that transduction of fibroblasts with the four
factors will produce a genetically heterogeneous population of
cells. As discussed above in V.A.3, it is likely that only the
small fraction of infected cells that carry a specific number of
viral vectors generating the "right" expression level or the
"right" combination of expression levels of the four factors are
the ones that are being selected when screening for reprogramming.
Thus, infected cells in individual wells will differ with respect
to viral integration and viral copy numbers precluding a meaningful
comparison of wells exposed to different compounds in a screen.
[0180] Frequency of marker activation, sensitivity and time
constraints of assay: Another important consideration for setting
up the screen concerns the sensitivity of the detection system: how
many cells need to express the OCT4-GFP reporter gene to be
detectable in a given well? Reporter gene expression is an
important constraint as the fraction of reprogrammed cells needs to
be high enough to produce at least a single detectable
reprogramming event in a well with an active compound. Furthermore,
reprogrammed cells appear in a population of fibroblasts only 3 to
5 weeks after infection with the four factors. Thus, the infected
cells need to survive and proliferate in 96- or 384-well formats
for this time period, which limits the number of cells that can be
plated.
[0181] To overcome these limitations we will generate fibroblast
populations that are genetically homogenous because they (i) carry
the identical number of vector integrations or (ii) carry various
combinations of reprogramming factors inserted into an endogenous
expression locus by homologous recombination.
(i). "Secondary" clonal fibroblasts that carry a specific and
predetermined combination of proviruses: We have recently shown
that "secondary" mouse iPS cells can be derived from "primary" iPS
cells that had been generated by infection of fibroblasts with DOX
inducible lentiviruses transducing the four transcription factors
Oct4, Sox2, c-myc and Klf4 [Hanna, 2008 #6842]. Because the "right"
combination and number of proviral copies was carried in the
"secondary" fibroblasts, no viral infection was needed to induce
reprogramming of B cells to secondary iPS cells.
[0182] We will follow a similar protocol to pre-select for cells
that carry the "right" combination and number of retroviral copies.
As shown in FIG. 23A-23B, "secondary" fibroblasts will be derived
from "primary" iPS cells by in vitro differentiation without DOX.
Instead of using vectors that transduce a single factor we will
alternatively use a polycistronic construct as described in FIGS.
13A-13C and 14A-14E for transduction of different combinations of
factors. As outlined in VI.A.3, this approach of using "secondary"
fibroblasts or B cells resulted in efficient and DOX dependent
activation of the reprogramming factors leading to iPS formation
without requiring any additional virus infections [Hanna, 2008
#6842]. To assess the fraction of iPS cells that arise upon DOX
addition we will plate 500 to 1000 cells per well of 96-well plates
and about 100 cells per well in 384-well plates and assess the
fraction of GFP positive cells. The results in the mouse system
indicated that secondary iPS cells arise only two to three weeks
after DOX induction. Because the cells can be cultured for only
about 7 days in 96- or 384-well plates we will pre-treat the
secondary fibroblasts with DOX for different times prior to
plating.
(ii). Transgenic fibroblasts that carry DOX-inducible reprogramming
factors in the COL1A1 locus: We have shown that transgenes inserted
into the Col1a1 locus are highly expressed in transgenic mice and,
if under the control of the tet operator, are reproducibly
activated in all tissues upon DOX application [Beard, 2006 #6199;
Hochedlinger, 2005 #5758]. We will insert polycistronic constructs
expressing different combinations of 3 or of all four reprogramming
factors under the control of the tet operator into the COL1A1 locus
of huES cells carrying the GFP marker in the OCT4 locus (FIG. 10).
In addition, the cells will be infected with a lentivirus vector
transducing the rtTA transactivator. The cells will be
differentiated into secondary fibroblasts that can be screened for
compounds that enhance reprogramming or replace a given factor (see
later, FIG. 24). D.2 Screen for Compounds that Enhance
Reprogramming Efficiency
[0183] To screen for compounds that increase reprogramming
efficiency we will culture secondary iPS cells carrying the "right"
combination of all four factors or fibroblasts carrying all four
factors in the COL1A1 locus in the presence of DOX (FIG. 24). In
preliminary experiments we will determine the fraction of GFP
positive cells that can be detected in the screens. Given that the
fraction of reprogrammed cells arising from fibroblasts transduced
with the four factors is low it may be difficult or impossible to
detect a single reprogrammed cell in the 1000 or 100 cells that can
be plated per 96- or 384-well plate, respectively, unless a given
compound would significantly increase the fraction of reprogrammed
cells. The assay has, however, a very low background that
compensates for the inherently low signal.
[0184] In pilot screens we will test the fraction of GFP positive
cells arising in the four factor reporter cells, which are cultured
in the presence of DOX and have or have not been treated with
5-azadC or infected with the DNMT1 siRNA vector, both of which will
decrease global DNA methylation levels, a treatment which has been
shown to enhance reprogramming of mouse fibroblasts [Mikkelsen,
2008 #6891]. The fraction of GFP positive cells under any of these
conditions will determine how many cells need to be plated per well
to detect a compound that enhances the fraction of GFP positive
cells in a less stringent screen. A more stringent screen would use
cells that have not been treated with 5-azadC or infected with the
DNMT1 siRNA vector as this would monitor non-sensitized cells for
compounds that more efficiently activate the reporter than
above.
D.3 Screen for Compounds that Replace any of the Four Factors
[0185] To screen for compounds that could replace any of the
retrovirus transduced factors we will transduce cells with vectors
that can be independently regulated. The concept of the approach is
that 3 factors will be under the control of one inducible system
and the fourth factor under independent inducible control. We will
use two different strategies to produce the cells used for
screening.
[0186] (i) Tamoxifen inducible vectors: We have generated vectors
transducing OCT4, SOX2, KLF4 and C-MYC estrogen receptor (ER)
fusion constructs [Grandori, 1996 #6505] whose expression is
activated by the addition of tamoxifen to the medium (FIG. 11B). As
outlined in FIG. 26, OCT4-GFP reporter primary fibroblasts will be
transduced with retroviruses expressing three tamoxifen inducible
factors with the fourth factor expressed from a DOX dependent
vector. The infected cells will be grown in medium containing
tamoxifen and DOX and "primary" iPS cells will be selected by
screening for GFP expression. As described above, secondary
fibroblasts will be derived, exposed to tamoxifen to activate the
three tamoxifen-dependent factors and will be screened for small
molecule compounds that activate the GFP reporter in the absence of
DOX and cMYC expression.
[0187] (ii) Transgenic fibroblasts carrying different combinations
of factors in the COL1A1 locus: We will pursue an alternative
strategy that avoids retroviral infection as outlined in FIG. 24.
Primary fibroblasts will be derived from huES cells carrying in
addition to the OCT4-GFP marker and a virus transduced tet M2rtTA
transactivator a polycistronic construct encoding any combination
of three reprogramming factors in the COL1A1 locus [Beard, 2006
#6199; Hochedlinger, 2005 #5758]; compare FIG. 13A-13C, 14A-14E).
The fibroblasts will be transduced with a Lox flanked vector
carrying the missing 4.sup.th factor (KLF4 in FIG. 24) and primary
iPS cells will be derived. After Cre transduction to delete the
KLF4 vector secondary fibroblasts will be derived. DOX exposure
will activate the three DOX dependent factors inserted into the
COL1A1 locus and the cells will be screened for small molecules
that activate the GFP reporter in the absence of the missing
4.sup.th factor (in this case KLF4). To sensitize the screen we
will use cells that have been treated with 5-aza-dC.
D.4 Screening Platforms
[0188] The screening of small molecule libraries will be performed
in collaboration with the laboratory of S. Ding at Scripps (see
letter by S. Ding). For example, the Ding laboratory has developed
and optimized cell-based phenotypic high throughput screens [Xu,
2008 #6875] and identified the small molecule pluripotin that
sustains self renewal of ES cells in chemically defined medium and
in the absence of LIF [Chen, 2006 #6871]. The screen was based upon
the expression of an Oct4 promoter driven GFP marker. We will
screen the OCT4-GFP transgenic fibroblasts carrying the different
combinations of factors as described above for GFP activation.
[0189] The activity of any compounds that score positive in the
screens will be verified under defined culture conditions. A major
issue will be to investigate the molecular pathways that are
involved in the reprogramming process.
[0190] Possible outcome and interpretation: We expect that the
screen for activation of the OCT4 gene will identify compounds that
facilitate the transition from a somatic epigenetic state to one
that is characteristic of pluripotent cells and thus render the
reprogramming process more efficient. Another important goal of
these experiments is to find small molecule compounds that could
replace the need for genetic manipulations involving transduction
of genes encoding oncogenes such as cMYC, OCT4 or KLF4.
[0191] The two most significant potential problems for a
high-throughput screen are (i) the time required for reprogramming
to take place and (ii) whether a rare reprogramming event can be
detected in the limited number of cells that can be plated per well
of a 96 or 384 well plate. As discussed above, we will precondition
the cells to carry the "right" number and combination of factors
and further sensitize the cells to increase the frequency of
reprogramming-induced activation of the various reporter genes.
Once compounds have been identified which increase reprogramming
efficiency they will be used as sensitizers in subsequent screens
for additional compounds that could further enhance iPS cell
formation.
[0192] Significance: The present strategies to induce reprogramming
rely on the transduction of powerful oncogenes, a stumbling block
to any therapeutic application. This goal seeks to identify small
molecules that could activate relevant pathways and thus would
improve efficiency and possibly minimize the genetic alterations
required for inducing reprogramming.
Significance and Long Term Implications
[0193] The method of the in vitro generation of pluripotent iPS
cells promises to revolutionize the study of complex human diseases
and has significant implications for the eventual treatment of
degenerative diseases. In vitro reprogramming of mouse somatic
cells to a pluripotent state has been shown to be reasonably
efficient and the underlying molecular mechanisms of this process
are being actively studied. However, reprogramming of human cells
has proved to be more laborious and difficult and major technical
issues need to be resolved before this technology could be adapted
for clinical use. Work described herein seeks to define the
molecular mechanisms that bring about the conversion of human
somatic cells to a pluripotent state, to devise strategies for
assessing the developmental potential of human iPS cells and to
achieve reprogramming without the need for genetic manipulation.
Work described herein will contribute to solving some of the
crucial obstacles that presently hamper the application of the
technology to study human diseases and to its eventual use for
transplantation therapy of degenerative diseases.
Example 3
Reprogramming of Murine and Human Somatic Cells Using a Single
Polycistronic Vector
Materials and Methods
Viral Preparation and Infection.
[0194] Construction of 4F2A lentiviral vectors containing Oct4,
Sox2, Klf4, and c-Myc under control of the tetracycline operator
and a minimal CMV promoter was generated after EcoRI cloning from a
FUW lentivirus backbone. All constructs were generated using unique
restriction sites after amplification by PCR to place an individual
factor between a respective 2A peptide (1.sup.st XbaI-NheI;
2.sup.nd SphI; 3.sup.rd XhoI; 4.sup.th AscI). Respective 2A
sequences:
TABLE-US-00002 (SEQ ID NO: 21)
P2A-GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAA ACCCCGGGCCT;
(SEQ ID NO: 22) T2A-GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATC
CCGGCCCT; (SEQ ID NO: 23)
E2A-CAGTGTACTAATTATGCTCTCTTGAAATTGGCTGGAGATGTTGAGA
GCAACCCAGGTCCC.
[0195] Replication-incompetent lentiviral particles (4F2A and
M2rtTA) were packaged in 293T cells with a VSV-G coat and used to
infect MEFs containing a GFP allele targeted to the endogenous
Nanog locus (25) (7). 14-week old tail tip fibroblasts were derived
from mice previously published (12). Human keratinocytes (NHFK)
were obtained from Coriell Institute for Medical Research Camden,
N.J. Viral supernatants from cultures packaging each of the two
viruses were pooled, filtered through a 0.45 muM filter and
subjected to ultracentrifugation for concentration. Virus pellets
were resuspended in ES cell medium (DMEM supplemented with 10% FRS
(Hyclone), leukemia inhibitory factor, .beta.-mercaptoethanol
(Sigma-Aldrich), penicillin/streptomycin, L-glutamine and
nonessential amino acids (all from Invitrogen) before being applied
to cells for 24 hours.
Western Blot
[0196] 100 .mu.l of lysis buffer containing 2% SDS, 10 mM
dithiothreitol, 10% glycerol, 12% urea, 10 mM Tris-HCl (pH 7.5), 1
mM phenylmethylsulfonyl fluoride, 1.times. protease inhibitor
mixture (Roche), 25 .mu.M MG132 proteosome inhibitor, and boiled
for 5 min. Proteins were then quantified using Bradford reagent
(Pierce) and taking spectrophotometric readings at 590 nm.
Concentrations were estimated against a standard curve generated
using bovine serum albumin. Total protein (5 .mu.g) was subjected
to electrophoreses in a denaturing 10% polyacrylamide gel
containing 10% SDS. Proteins were then transferred onto Immobilon-P
membranes (Millipore) using a semi-dry transfer apparatus.
Membranes were blocked in PBS, 0.01% Tween 20 containing 2% nonfat
powdered milk (Bio-Rad). Proteins were detected by incubating with
antibodies at a concentration of 50 ng/ml in blocking solution.
Antibodies used were Oct4 (h-134 Santa Cruz Biotechnology); Sox2
(mouse monoclonal R&D Biosystems); c-Myc (06-340 Upstate); Klf4
(H-180 Santa Cruz Biotechnology); GAPDH (sc-25778 Santa Cruz
Biotechnology).
Quantitative RT-PCR
[0197] Total RNA was isolated using Trizol reagent (Invitrogen).
Five micrograms of total RNA was treated with DNase I to remove
potential contamination of genomic DNA using a DNA Free RNA kit
(Zymo Research). One microgram of DNase treated RNA was reverse
transcribed using a First Strand Synthesis kit (Invitrogen) and
ultimately is in 100 mul of water. Quantitative PCR analysis was
performed in triplicate using 1/50 of the reverse transcription
reaction in an ABI Prism 7000 (Applied Biosystems) with Platinum
SYBR green qPCR SuperMix-UDG with ROX (Invitrogen). Equal loading
was achieved by amplifying GAPDH mRNA and all reactions were
performed in triplicate. Primers used for amplification were as
follows:
TABLE-US-00003 Oct4 (SEQ ID NO: 24) F, 5'-ACATCGCCAATCAGCTTGG-3'
and (SEQ ID NO: 25) R, 5'-AGAACCATACTCGAACCACATCC-3' Sox2 (SEQ ID
NO: 26) F, 5'-ACAGATGCAACCGATGCACC-3' and (SEQ ID NO: 27) R,
5'-TGGAGTTGTACTGCAGGGCG-3' 4F2A (E2A-cMyc) (SEQ ID NO: 28) F,
5'-GGCTGGAGATGTTGAGAGCAA-3' and (SEQ ID NO: 29) R,
5'-AAAGGAAATCCAGTGGCGC-3' GAPDH (SEQ ID NO: 30) F,
5'-TTCACCACCATGGAGAAGGC-3' and (SEQ ID NO: 31) R,
5'-CCCTTTTGGCTCCACCCT-3'
Error bars represent s.d. of the mean of triplicate reactions.
Southern Blotting
[0198] 10 .mu.g of BamHI digested genomic DNA was separated on a
0.7% agarose gel, transferred to a nylon membrane (Amersham) and
hybridized with .sup.32P random primer (Stratagene) labeled probes
for OCT4 (EcoRI-PstI fragment of pFUW-tetO-OCT4 plasmid), KLF4
(full length KLF4 cDNA), c-MYC (full length c-MYC cDNA) and SOX2
(full length fragment of pFUW-tetO-SOX2 plasmid).
Immunofluorescent Staining
[0199] Cells were fixed in 4% paraformaldehyde for 20 minutes at
25.degree. C., washed 3 times with PBS and blocked for 15 min with
5% FBS in PBS containing 0.1% Triton-X. After incubation with
primary antibodies against Oct4 (Santa Cruz h-134), Sox2 (R&D
Biosystems), Nanog (anti-ms R&D and anti-h), Tra-1-60, (mouse
monoclonal, Chemicon International); hNANOG (goat polyclonal
R&D Systems); mNANOG (Bethyl A300-398A), Tra1-81 (mouse
monoclonal, Chemicon International), SSEA4 and SSEA1 (monoclonal
mouse, Developmental Studies Hybridoma Bank) for 1 h in 1% FBS in
PBS containing 0.1% Triton-X, cells were washed 3 times with PBS
and incubated with fluorophore-labeled appropriate secondary
antibodies purchased from Jackson Immunoresearch. Specimens were
analyzed on an Olympus Fluorescence microscope and images were
acquired with a Zeiss Axiocam camera.
Mouse Chimera and Teratoma Formation
[0200] Diploid blastocysts (94-98 h after hCG injection) were
placed in a drop of Hepes-CZB medium under mineral oil. A flat tip
microinjection pipette with an internal diameter of 16 .mu.m was
used for iPS cell injections. Each blastocyst received 8-10 iPS
cells. After injection, blastocysts were cultured in potassium
simplex optimization medium (KSOM) and placed at 37.degree. C.
until transferred to recipient females. About 10 injected
blastocysts were transferred to each uterine horn of
2.5-day-postcoitum pseudo-pregnant B6D2F1 female. Pups were
recovered at day 19.5 and fostered to lactating B6D2F1 mothers when
necessary. Teratoma formation was performed by depositing
2.times.10 6 cells under the flanks of recipient SCID or Rag2-/-
mice. Tumors were isolated 3-6 weeks later for histological
analysis.
Human Teratoma Formation and Analysis
[0201] hiPSCs were collected by collagenase treatment (1.5 mg/ml)
and separated from feeder cells by subsequent washes with medium
and sedimentation of iPSC colonies. iPSC aggregates were collected
by centrifugation and resuspended in a ratio of 10 6 cells in 250
.mu.l of iPSC culture media. iPSCs were injected subcutaneously by
21 gauge needle in the back of SCID mice (Taconic). A tumor
developed within 6 weeks and the animal was sacrificed before tumor
size exceeded 1.5 cm in diameter. Teratomas were isolated after
sacrificing the mice and fixed in formalin. After sectioning,
teratomas were diagnosed base on hematoxylin and eosin staining.
Karyotype analysis was done with CLGenetics (Madison, Wis.).
In Vitro Differentiation of Human IPS Cells into Neuronal
Progenitors:
[0202] Human keratinocyte iPS cells were allowed to outgrow in
culture without pasaging for 2 weeks with daily medium change. At
day 15 after passage distinct neural rossets were observed and
picked mechanically by pooled glass pipett (26). Rosettes were
replated on dishes precoated with 15 .mu.g/ml polyornithin/10
.mu.g/ml of laminin (Po/Lam) in N2B27 medium supplemented with FGF2
(20 ng/ml) EGF (20 ng/ml) (Ail R&D Systems). After 5-7 d cells
were dissociated by scraping with cell lifter and pippeting to
single cells in N2B27 medium and replated to Po/Lam culture
dishes.
Differentiation and Immunocytochemistry
[0203] Induction of differentiation of neural progenitors was
performed by withdrowal of FGF2 and EGF from culture medium for 5
days. Cells were fixed in 4% paraformaldehyde for 20 min and
stained for human nestin (Chemicon; 1:100) and Tuj-1 (1:100) and
subsequently washed 3 times with PBS and incubated with
fluorophore-labeled appropriate secondary antibodies purchased from
Jackson Immunoresearch. Specimens were analyzed on an Olympus
Fluorescence microscope and images were acquired with a Zeiss
Axiocam camera.
Results
[0204] Vectors were constructed with different combinations of two,
three, or all four reprogramming factors from one promoter. The
goal was to generate polycistronic viral vectors that would express
multiple reprogramming genes from a single promoter using 2A
peptides. For this one, two, or three 2A oligopeptides containing
unique restriction sites were ligated into FUW lentivirus (18)
backbones to allow efficient cloning of Oct4, Sox2, c-Myc and Klf4
each separated by a different 2A sequence. Vectors carrying four,
three or two factors consecutively with different combinations of
F2A, T2A, E2A or P2A sequences (FIGS. 13A and 14A) were tested for
their ability to express individual factors by transient
transfection in human 293 cells. Western blot analysis demonstrated
that 2A peptides support efficient expression of two, three or all
four cistrons from a single polycistronic vector (FIG. 14B).
[0205] To test the utility of polycistronic vectors for
reprogramming we initially transduced retroviral vectors carrying
different combinations of 2 or 3 reprogramming factors into MEFs
and showed that these constructs were able to generate iPS cells in
combination with vectors carrying the additional single
factor-eDNA(s). Importantly, a polycistronic vector carrying all
four factors was able to generate iPS cells. In this preliminary
experiment we co-infected Oct4-GFP fibroblasts with the
polycistronic Sox2-Oct4-Klf4-myc vector and an additional Oct4
vector (to account for the possibility that relatively more Oct4
protein might be needed for reprogramming; FIG. 13B). FIG. 13B
shows that iPS cells were obtained that expressed AP, SSEA1, Nanog
and Oct4. Moreover adult chimeras have been generated from iPS
lines infected with the four-factor 2A vector plus Oct4 Moloney
virus. To determine the number of proviral integrations, a Southern
blot was sequentially hybridized with a Sox2, Klf4, c-myc and Oct4
probe. FIG. 13C shows that a single polycistronic vector was
integrated in 2 of 3 different tested iPS lines and 2 proviruses
were carried in the third line (in this line, 4FO#14, the c-myc
sequences were deleted in one of the proviruses). Surprisingly, an
additional 8 to 11 Oct 4 proviruses were carried in each of the iPS
lines, suggesting strong selection for multiple integrations of the
Oct4 provirus. Because we have never seen more than 4 or 5 Oct4
proviruses iii iPS cells induced by the four separately transduced
factors, it is unlikely though cannot be excluded that selection
was for high Oct4 expression. An alternative interpretation is that
the selection for multiple proviruses was due to selection for
insertional activation of an unknown cellular gene. These initial
data suggested that at least 3 reprogramming factors can be
expressed from a single polycistronic provirus to induce
reprogramming. As further described below, we proceeded to
successfully generated murine iPS cells using only a polycistronic
vector carrying the four factors and have also used the
polycistronic vector system for generating human iPS cells carrying
minimal genetic alteration.
[0206] A tetracycline inducible lentivirus vector was constructed
where expression of the genes was controlled from the tetracycline
operator minimal promoter (tetOP; FIG. 14C). To test whether all
four genes of a single four-factor (Oct4/Sox2/Klf4/c-Myc) virus
could be expressed upon DOX addition, MEFs were infected with the
polycistronic vector (referred below to as "4F2A") as well as a
constitutive FUW lentivirus carrying the tetracycline controllable
trans-activator (M2rtTA; abbreviated as rtTA). Two independent
experiments were performed and drug inducible expression of the
virus was tested 3 days post-infection by qRT-PCR. Using primers
for viral specific transcripts (E2A-cMyc), robust induction was
observed (7-10 fold) in cells cultured with DOX as compared to
control medium (FIG. 14D). To test the relative induction compared
to ES cells, Oct4 and Sox2 primers that cannot discriminate between
viral or endogenous transcripts were utilized and in both
experiments infected DOX induced MEFs were significantly higher
than in ES cells (.about.3.5- and .about.17-fold over ES levels
respectively). Western blot analysis of cells isolated at 3 days
after infection demonstrated that little or no protein was
expressed when the cells were cultured without DOX whereas robust
induction was seen in the presence of DOX with levels of Oct4 and
Sox2 protein being similar to that in ES cells (FIG. 14E).
[0207] To test whether the 4F2A vector was able to reprogram
somatic cells to a pluripotent state MEFs containing a GFP reporter
driven by the endogenous Nanog promoter were infected with virus
(4F2A+rtTA). 85-90% of the cells stained for Oct4 at 48 hours after
transduction indicating high titre infection (FIG. 15A).
Morphological changes were observed a few days after addition of
DOX (data not shown) with distinct colonies appearing after about 8
days and Nanog-GFP+ cells at approximately 25 days after DOX
induction (FIG. 15B). After mechanical isolation and subsequent
passage the cells had the typical morphology of ES cells and grew
independently of DOX. Four independent 4F2A iPS cell lines were
established that were positive for the pluripotency markers AP,
SSEA1 and Nanog-GFP (FIG. 15C).
[0208] To investigate whether adult somatic cells could be
reprogrammed using the 4F2A vector, we infected tail-tip
fibroblasts (TTFs) from 14 week-old mice with the 4F2A+rtTA
vectors. Similar to MEFs, typical morphological changes were
observed a few days after addition of DOX media. Colonies appeared
around 8 days and continued to expand until they were picked (day
16) based on morphology. After several passages four stable iPS
cell lines were established that stained positive for all
pluripotency markers (Nanog, Oct4, SSEA1, AP) (FIG. 15C). MEF iPS
cell lines were injected subcutaneously into SCID mice and were
shown to induce teratomas that contained differentiated cells of
all three germ layers (FIG. 16A). Finally, injection of MEF iPS
cells (#4) into blastocysts generated postnatal chimeras (FIG. 16B)
demonstrating that a single 4F2A polycistronic virus can reprogram
MEFs to a pluripotent state.
[0209] To determine the number of proviruses carried in the 4F2A
iPS cell lines, DNA was extracted and subjected to Southern blot
analysis using an enzyme that does not cut in the vector sequences.
Using Oct4, Sox2, c-Myc and Klf4 probes for hybridization, we
detected bands of identical molecular weight confirming that the
factor sequences were carried in one provirus. The total number of
proviruses was between one and three with iPS cell line #4 carrying
a single viral insert (FIG. 16C). One of two integrations from iPS
cell line #1 failed to produce a band after c-Myc hybridization,
suggesting a 3' deletion of the c-Myc sequences may have occurred.
A second digest confirmed the proviral copy numbers (FIG. 18A).
[0210] To estimate reprogramming efficiency MEFs were infected with
the 4F2A and rtTA vectors and plated at 0.25.times.10 .sup.6 per 10
cm plate culture dish. About 70% of the MEFs were infected as
estimated by immunostaining of Oct4 at 48 hours after infection
(FIG. 19A). Cells were cultured in ES media containing DOX for 20
days and subsequently transferred to ES cell medium until GFP+
colonies were counted on day 25. An average of .about.14.7.+-.4
colonies were detected in three independent dishes (10+10+17)
indicating a relative efficiency of 0.0001%. This is one to two
orders of magnitude lower than that of `primary` infected
fibroblasts (3, 7).
[0211] To test the kinetics of reprogramming using the 4F2A virus
we performed dox-withdrawl experiments where at specified days
(i.e. 2, 4, 8, 12 etc) DOX containing media is replaced with ES
media and the number of Nanog-GFP+ colonies are counted at day 25.
Using separate drug-inducible viruses to deliver the four factors
it has been reported that .about.9-12 days is the minimum time
required for the generation of stable iPS cells (20, 21). Cells are
not passaged during this time in order to minimize duplication of
reprogramming events. Two independent experiments were performed
and in both cases single Nanog-GFP+ colonies were present on plates
cultured in DOX media for 8 days, similar to the minimum time
required using separate viruses (FIG. 14B).
[0212] These data demonstrate that a single polycistronic virus
containing the four factors linked by three 2A peptides allows
factor expression sufficient to generate iPS cells from embryonic
or adult somatic cells. Importantly, our results also show that a
single polycistronic proviral copy is sufficient to reprogram
somatic cells to pluripotency.
Generation of Human iPS Cells Using a Single Polycistronic
Virus
[0213] To investigate whether human cells could be reprogrammed
with the polycistronic vector, neonatal human foreskin
keratinocytes (NHFK) were transduced with both the constitutive
rtTA and DOX-inducible 4F2A vectors. The fraction of infected cells
was 10% as determined by staining for Oct4 at 48 hours after
transduction (FIG. 20A). Cells were incubated in keratinocyte
medium+DOX and allowed to grow for 6 days until they were passaged
and cultured in hESC media+DOX on gelatinized plates. Colonies were
first detected at day 12 and most displayed transformed morphology
with a few colonies exhibiting a distinct appearance that resembled
hESC-like morphology. Two such colonies generated in independent
infections were picked between 22 and 35 days after infection and
found to expand as distinct colonies with morphology similar to
hESC (FIG. 17A). These cells were expanded in the absence of DOX
and gave rise to a homogenous population identical to hESC
(Ker-iPS) after an additional 2-5 passages. The cells stained for
the pluripotency markers AP, Oct4, Nanog, Sox2, SSEA4, Tra1-60,
Tra1-81 (FIG. 17B, FIG. 10B) and had a normal karyotype (FIG. 17C).
DNA fingerprinting excluded that such Ker-iPS cell lines were
contamination from previously established human iPS cells or hES
lines from our lab (data not shown): To determine proviral copy
number in Ker-iPS cell lines genomic DNA was extracted and
subjected to Southern blot analysis using an enzyme that does not
cut in the vector sequences. Probes for all four reprogramming
factors show hybridization to similar molecular weight band(s)
again indicating they were carried on a single virus. Two different
digests (XbaI & BamHI) show the 4F2A proviral copy number is
three (#1.1) and two (#3) respectively (FIG. 21A-B).
[0214] To test for pluripotency, one line, Ker-iPS #1.1, was
injected subcutaneously into SCID mice. These cells induced
teratomas and after histological examination differentiated into
cells of all three, germ layers (FIG. 17D). In addition, Ker-iPS
#1.1 cells, when subjected to an in-vitro neural differentiation
protocol produced nestin+neural progenitor cell populations as well
as Tuj1+ post-mitotic neurons as detected by immunostaining. (FIG.
17E).
DISCUSSION
[0215] The experiments described above show that up to four
different reprogramming factors inserted into a polycistronic
vector separated by 2A sequences can be expressed at levels
sufficient to achieve reprogramming. Embryonic and adult murine
fibroblasts as well as postnatal human keratinocytes were induced
to form pluripotent iPS cells when infected with the FUW rtTA and
2A vector transducing Oct4, Sox2, Klf4 and c-Myc.
[0216] We observe a reprogramming efficiency significantly lower
than previous experiments using single vectors to transduce each of
the four factors (FIG. 19B and Table 3).
TABLE-US-00004 TABLE 3 Table summarizing pluripotency tests as well
as relative efficiencies for all iPS lines generated. GFP, GFP
reporter gene present; ES, expression of ES cell markers (AP,
SSEA1, Oct4 or Sox2); TF, teratoma formation; PC, postnatal
chimeras. Mouse chimerism was estimated by agouti coat color.
Efficiency (iPS/input, Source of cells GFP iPS lines %) ES TF PC
(m) embryonic fib Nanog 5 0.0001% Yes Yes Yes (m) adult fib No 4 ND
Yes No No (h) Keratinocytes No 2 0.00001% Yes Yes No Cell line
Blast injected Live pups # chimeric chimerism (%) MEF iPS #4 60 30
2 30-50 MEF iPS #2 20 14 1 10
[0217] It is possible that the lower reprogramming efficiency is
due to the stochiometry of factor expression from the polycistronic
vector, which may be suboptimal for inducing reprogramming.
Transduction with separate vectors allows integration of different
numbers of proviruses for each factor, therefore reprogramming may
select for a specific set of proviral integrations that result in
high expression or an optimal stochiometry between the different
factors. However, the 2A system, has been reported to support near
equimolar protein expression in vivo (17). Also, when separate
vectors transducing each of the four factors were used for
induction of iPS cells, Nanog-GFP positive cells were detected as
early as 16 days after DOX induction in contrast to GFP positive
cells observed 22-25 days after 4F2A vector transduction,
consistent with less optimal reprogramming. Moreover, whereas iPS
cells frequently carry multiple Oct4 or Klf4 proviruses,
consistently fewer Sox2 proviruses were found suggesting that a
high level of Sox2 expression may perhaps be unfavorable for
reprogramming (24).
[0218] In other experiments, the flp-in transgenic system is used
to create multiple murine cell lines containing 4-, 3- and 2-factor
2A constructs in the collagen gene locus (FIG. 22) (20). The system
contains two components: tetracycline controllable trans-activator
(rtTA) and tetracycline operator minimal promoter (tetOP) driving
the gene of interest. After addition of media containing
doxycycline the trans-activator drives expression of the transgene
at the collagen locus. If desired, inserting a GFP reporter
construct at the Nanog gene allows detection of complete
reactivation of the Nanog locus and act as a marker of genome-wide
epigenetic reprogramming.
REFERENCES FOR EXAMPLE 3
[0219] 1. Lowry W E, Richter L, Yachechko R, et al. (2008)
Generation of human induced pluripotent stem cells from dermal
fibroblasts Proc Natl Acad Sci USA 105, 2883-2888. [0220] 2.
Maherali N, Sridharan R, Xie W, et al. (2007) Directly reprogrammed
fibroblasts show global epigenetic remodeling and widespread tissue
contribution Cell Stem Cell 1, 55-70. [0221] 3. Okita K, Ichisaka
T, & Yamanaka S (2007) Generation of germline-competent induced
pluripotent stem cells Nature 448, 313-317. [0222] 4. Park I H,
Zhao R, West J A, et al. (2008) Reprogramming of human somatic
cells to pluripotency with defined factors Nature 451, 141-146.
[0223] 5. Takahashi K, Tanabe K, Ohnuki M, et al. (2007) Induction
of pluripotent stem cells from adult human fibroblasts by defined
factors Cell 131, 861-872. [0224] 6. Takahashi K & Yamanaka S
(2006) Induction of pluripotent stem cells from mouse embryonic and
adult fibroblast cultures by defined factors Cell 126, 663-676.
[0225] 7. Wernig M, Meissner A, Foreman R, et al. (2007) In vitro
reprogramming of fibroblasts into a pluripotent ES-cell-like state
Nature 448, 318-324. [0226] 8. Yu J, Vodyanik M A, Smuga-Otto K, et
al. (2007) Induced pluripotent stem cell lines derived from human
somatic cells Science 318, 1917-1920. [0227] 9. Hanna J, Markoulaki
S, Schorderet P, et al. (2008) Direct reprogramming of terminally
differentiated mature B lymphocytes to pluripotency Cell 133,
250-264. [0228] 10. Kim J B, Zaehres H, Wu G, et al. (2008)
Pluripotent stem cells induced from adult neural stem cells by
reprogramming with two factors Nature 454, 646-650. [0229] 11.
Stadtfeld M, Brennand K, & Hochedlinger K (2008) Reprogramming
of pancreatic beta cells into induced pluripotent stem cells Curr
Biol 18, 890-894. [0230] 12. Hanna J, Wernig M, Markoulaki S, et
al. (2007) Treatment of sickle cell anemia mouse model with iPS
cells generated from autologous skin Science 318, 1920-1923. [0231]
13. Wernig M, Zhao J P, Pruszak J, et al. (2008) Neurons derived
from reprogrammed fibroblasts functionally integrate into the fetal
brain and improve symptoms of rats with Parkinson's disease Proc
Natl Acad Sci USA 105, 5856-5861. [0232] 14. Ryan M D & Drew J
(1994) Foot-and-mouth disease virus 2A oligopeptide mediated
cleavage of an artificial polyprotein Embo J 13, 928-933. [0233]
15. Ryan M D, King A M, & Thomas G P (1991) Cleavage of
foot-and-mouth disease virus polyprotein is mediated by residues
located within a 19 amino acid sequence J Gen Virol 72 (Pt 11),
2727-2732. [0234] 16. Doronina V A, Wu C, de Felipe P, et al.
(2008) Site-specific release of nascent chains from ribosomes at a
sense codon Mol Cell Biol 28, 4227-4239. [0235] 17. Szymczak A L,
Workman C J, Wang Y, et al. (2004) Correction of multi-gene
deficiency in vivo using a single `self-cleaving` 2A peptide-based
retroviral vector Nat Biotechnol 22, 589-594. [0236] 18. Lois C,
Hong E J, Pease S, et al. (2002) Germline transmission and
tissue-specific expression of transgenes delivered by lentiviral
vectors Science 295, 868-872. [0237] 19. Wernig M, Lengner C J,
Hanna J, et al. (2008) A drug-inducible transgenic system for
direct reprogramming of multiple somatic cell types Nat Biotechnol
26, 916-924. [0238] 20. Brambrink T, Foreman R, Welstead G G, et
al. (2008) Sequential expression of pluripotency markers during
direct reprogramming of mouse somatic cells Cell Stem Cell 2,
151-159. [0239] 21. Stadtfeld M, Maherali N, Breault D T, et al.
(2008) Defining molecular cornerstones during fibroblast to iPS
cell reprogramming in mouse Cell Stem Cell 2, 230-240. [0240] 22.
Okita K, Nakagawa M, Hyenjong H, et al. (2008) Generation of Mouse
Induced Pluripotent Stem Cells Without Viral Vectors Science 322,
949-953 [0241] 23. Stadtfeld M, Nagaya M, Utikal J, et al. (2008)
Induced Pluripotent Stem Cells Generated Without Viral Integration
Science 322, 945-949. [0242] 24. Eminli S, Utikal J S, Arnold K, et
al. (2008) Reprogramming of Neural Progenitor Cells into iPS Cells
in the Absence of Exogenous Sox2 Expression Stem Cells. [0243] 25.
Meissner A, Wernig M, & Jaenisch R (2007) Direct reprogramming
of genetically unmodified fibroblasts into pluripotent stem cells
Nat Biotechnol 25, 1177-1181. [0244] 26. Zhang S C, Wernig M,
Duncan I D, et al. (2001) In vitro differentiation of
transplantable neural precursors from human embryonic stem cells
Nat Biotechnol 19, 1129-1133. [0245] 27. Hockemeyer D, Soldner F,
Cook E G, et al. (2008) A drug-inducible system for direct
reprogramming of human somatic cells to pluripotency Cell Stem Cell
3, 346-353.
Example 4
Human Induced Pluripotent Stem Cells Free of Viral Reprogramming
Factors
Experimental Procedures
Cell Culture
[0246] All primary fibroblast cell lines described in this paper
were purchased from the Coriell Cell Repository. Fibroblasts were
cultured in fibroblast medium [DMEM supplemented with 15% FBS
(Hyclone), 1 mM glutamine (Invitrogen), 1% nonessential amino acids
(Invitrogen) and penicillin/streptomycin (Invitrogen)]. HiPSCs and
the hESC lines BG01 and BG02 (NIH Code: BG01 and BG02; BresaGen,
Inc., Athens, Ga.) were maintained on mitomycin C (MMC)-inactivated
mouse embryonic fibroblast (MEF) feeder layers in hESC medium
[DMEM/F12 (Invitrogen) supplemented with 15 FBS (Hyclone), 5%
KnockOut.TM. Serum Replacement (Invitrogen), 1 mM glutamine
(Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM
.beta.-mercaptoethanol (Sigma) and 4 ng/ml FGF2 (R&D systems)].
Cultures were passaged every 5 to 7 days either manually or
enzymatically with collagenase type IV (Invitrogen; 1.5 mg/ml).
Human embryonic stem cells H9 (NIH Code: WA09, Wisconsin Alumni
Research Foundation, Madison, Wis.) were maintained on
MMC-inactivated MEFs or on MMC-inactivated human fibroblasts (D551;
American Type Culture Collection, Manassas, Va.) according to the
manufacturer's protocol. For EB induced differentiation, ESC/hiPSC
colonies were harvested using 1.5 mg/ml collagenase type IV
(Invitrogen), separated from the MEF feeder cells by gravity,
gently triturated and cultured for 10 days in non-adherent
suspension culture dishes (Corning) in DMEM supplemented with 15%
FBS.
[0247] For Cre-recombinase mediated vector excision, hiPSC lines
were cultured in Rho Kinase (ROCK)-inhibitor (Calbiochem; Y-27632)
24 hours prior to electroporation. Cell were harvested using 0.05%
trypsin/EDTA solution (Invitrogen) and 1.times.10.sup.7 cells
resuspended in PBS were transfected with either pCre-PAC (50 .mu.g;
Taniguchi et al., 1998) or co-transfected with pTurbo-Cre (40
.mu.g; Genbank Accession Number AF334827) and pEGFP-N1 (10 .mu.g;
Clontech) by electroporation as described previously (Costa et al.,
2007; Gene Pulser Xcell System, Bio-Rad: 250 V, 500 .mu.F, 0.4 cm
cuvettes). Cells were subsequently plated on MEF feeder layers (DR4
MEFs for puromycin selection) in hESC medium supplemented with
ROCK-inhibitor for the first 24 hours. Cre-recombinase expressing
cells were selected using one of the following methods: 1) addition
of puromycin (2 .mu.g/ml) 2 days after electroporation for a period
of 48 hours. 2) FACS sorting (FACS-Aria; BD-Biosciences) of a
single cell suspension for EGFP expressing cells 60 hours after
electroporation followed by replating at a low density in
ROCK-inhibitor containing hESC medium. Individual colonies were
picked 10 to 14 days after electroporation.
Viral Constructs
[0248] The FUW-M2rtTA lentiviral vector and lentiviral vectors
containing the human c-DNAs for KLF4 (FUW-tetO-hKLF4), OCT4
(FUW-tetO-hOCT4), SOX2 (FUW-tetO-hSOX2), and c-MYC (FUW-tetO-hMYC)
under the control of the tetracycline operator and a minimal CMV
promoter have been described previously (Hockemeyer et al., 2008).
To generate the Cre-recombinase excisable DOX-inducible lentiviral
vectors, a Not I/Bsu36 I fragment containing the tetracycline
operator/minimal CMV promoter and the human c-DNAs for either KLF4,
OCT4 or SOX2 were subcloned from each FUW-tetO vector into the Not
I/BSU36 I sites of the FUGW-loxP, which contains a loxP site in the
3'LTR (Hanna et al., 2007).
Lentiviral Infection and hiPSC Derivation
[0249] VSVG coated lentiviruses were generated in 293 cells as
described previously (Brambrink et al., 2008). Briefly, culture
medium was changed 12 hours post-transfection and virus-containing
supernatant was collected 60-72 hours post transfection. Viral
supernatant was filtered through a 0.45 .mu.m filter.
Virus-containing supernatants were pooled for 3 and 4 factor
infections and supplemented with FUW-M2rtTA virus and an equal
volume of fresh culture medium. 1.times.10.sup.6 human fibroblasts
were seeded 24 hours before transduction in T75 flasks. Four
consecutive infections in the presence of 2 .mu.g/ml of polybrene
were performed over a period of 48 hours. Culture medium was
changed 12 hours after the last infection. Five days after
transduction, fibroblasts were passaged using trypsin and re-plated
at different densities between 5.times.10.sup.4 and
2.times.10.sup.5 cells per 10 cm.sup.2 on gelatin coated dishes. To
induce reprogramming, culture medium was replaced 48 hours later by
hESC medium supplemented with DOX (Sigma-Aldrich; 2 .mu.g/ml).
HiPSCs colonies were picked manually based on morphology between 3
and 5 weeks after DOX-induction and manually maintained and
passaged according hESC protocols in the absence of DOX. To
determine reprogramming efficiencies, 1.times.10.sup.5 human
fibroblasts were seeded onto 10 cm.sup.2 gelatin coated dishes.
Reprogramming efficiencies were calculated after 20 days based on
immunocytochemistry for the pluripotency markers Tra-1-60 and
NANOG.
Microarray Gene Expression Analysis
[0250] RNA was isolated from hESCs and iPSCs, which were
mechanically separated from feeder cells, using the RNeasy Mini Kit
(Qiagen). 2 .mu.g total RNA was used to prepare biotinylated cRNA
according to the manufacturer's protocol (Affymetrix One Cycle cDNA
Synthesis Kit). Briefly, this method involves SuperScript
II-directed reverse transcription using a T7-Oligo(dT) Promoter
Primer to create first strand cDNA. RNase H-mediated second strand
cDNA synthesis is followed by T7 RNA Polymerase directed in vitro
transcription, which incorporates a biotinylated nucleotide analog
during cRNA amplification. Samples were prepared for hybridization
using 15 .mu.g biotinylated cRNA in a 1.times. hybridization
cocktail according the Affymetrix hybridization manual. GeneChip
arrays (Human U133 2.0) were hybridized in a GeneChip Hybridization
Oven at 45.degree. C. for 16 hours at 60 RPM. Washing was done
using a GeneChip Fluidics Station 450 according to the
manufacturer's instructions, using the buffers provided in the
Affymetrix GeneChip Hybridization, Wash and Stain Kit. Arrays were
scanned on a GeneChip Scanner 3000 and images were extracted and
analyzed using GeneChip Operating Software v1.4.
[0251] U133 Plus 2.0 microarrays (Affymetrix) were processed using
the MASS algorithm and absent/present calls for each probeset were
determined using the standard Affymetrix algorithm, both as
implemented in Bioconductor. Probesets that were absent in all
samples were removed for subsequent analysis. Differential
expression was determined a moderated t-test using the `limma`
package in R (corrected for false discovery rate) or by fold
change. Where a gene was represented by multiple probesets (based
on annotation from Affymetrix), gene expression log-ratios and
p-values were calculated as the mean and minimum of these
probesets, respectively. Hierarchical clustering was performed on
log-transformed gene expression ratios using uncentered Pearson
correlation and pairwise average linkage. Correlations were
compared using Fisher's Z transformation. Confidence of the
hierarchical clustering was computed using multiscale bootstrap
resampling with the R package `pvclust`.
Reverse Transcription of Total RNA and Real-Time PCR
[0252] RNA was isolated from EBs or hESCs and iPSCs, which were
mechanically separated from feeder cells, using either the RNeasy
Mini Kit (Qiagen) or Trizol extraction and subsequent ethanol
precipitation. Reverse transcription was performed on 1 .mu.g of
total RNA using oligo dT priming and Thermoscript reverse
transcriptase at 50.degree. C. (Invitrogen). Real-time PCR was
performed in an ABI Prism 7000 (Applied Biosystems) with Platinum
SYBR green pPCR SuperMIX-UDG with ROX (Invitrogen) using primers
that were in part previously described (Hockemeyer et al., 2008; Yu
et al., 2007) and in part are described in Soldner, et al., 2009,
Supplemental Experimental Procedures.
Teratoma Formation and Analysis
[0253] HiPSCs were collected by collagenase treatment (1.5 mg/ml)
and separated from feeder cells by subsequent washes with medium
and sedimentation by gravity. HiPSC aggregates were collected by
centrifugation and resuspended in 250 .mu.l of phosphate buffered
saline (PBS). HiPSCs were injected subcutaneously in the back of
SCID mice (Taconic). Tumors generally developed within 4-8 weeks
and animals were sacrificed before tumor size exceeded 1.5 cm in
diameter. Teratomas were isolated after sacrificing the mice and
fixed in formalin. After sectioning, teratomas were diagnosed based
on hematoxylin and eosin staining.
Methylation Analysis
[0254] Genomic DNA was collected from hESCs and hiPSCs by
mechanical separation from feeder cells. DNA was proteinase K
treated and phenol chloroform extracted and 1 .mu.g of DNA was
subjected to conversion using the Qiagen EpiTect Bisulfite Kit.
Promoter regions of OCT4 were amplified using previously described
primers (Yu et al., 2007):
TABLE-US-00005 OCT4 Forward: (SEQ ID NO: 32)
ATTTGTTTTTTGGGTAGTTAAAGGT OCT4 Reverse: (SEQ ID NO: 33)
CCAACTATCTTCATCTTAATAACATCC
PCR products were cloned using the pCR2.1-TOPO vector and sequenced
using M13 forward and reverse primers.
Immunocytochemistry
[0255] Cells were fixed in 4% paraformaldehyde in PBS and
immunostained according to standard protocols using the following
primary antibodies: SSEA4 (mouse monoclonal, Developmental Studies
Hybridoma Bank); Tra 1-60, (mouse monoclonal, Chemicon
International); hSOX2 (goat polyclonal, R&D Systems); Oct-3/4
(mouse monoclonal, Santa Cruz Biotechnology); hNANOG (goat
polyclonal R&D Systems); appropriate Molecular Probes Alexa
Fluor.RTM. dye conjugated secondary antibodies (Invitrogen) were
used.
Southern Blotting
[0256] XbaI, EcoRI or MfeI digested genomic DNA was separated on a
0.7% agarose gel, transferred to a nylon membrane (Amersham) and
hybridized with .sup.32P random primer (Stratagene) labeled probes
for OCT4 (EcoRI-PstI fragment of pFUW-tetO-hOCT4 plasmid), KLF4
(full length hKLF4 cDNA), c-MYC (full length c-MYC cDNA), SOX2
(FspI-EcoRI fragment of pFUW-tetO-hSOX2 plasmid) and M2rtTA (380 bp
C-terminal fragment of the M2rtTA c-DNA).
Accession Numbers
[0257] Microarray data are available at the NCBI Gene Expression
Omnibus database under the series accession number GSE14711.
Overview
[0258] In this example we show that fibroblasts from five patients
with idiopathic Parkinson's disease (PD) can be efficiently
reprogrammed. Moreover, we derived human induced pluripotent stem
cells (hiPSCs) free of reprogramming factors using Cre-recombinase
excisable viruses. Factor-free iPSCs maintain a pluripotent state
and shown global gene expression profile, more closely related to
hESCs than to hiPSCs carrying the transgenes. Our results indicate
that residual transgene expression in virus-carrying hiPSCs can
affect their molecular characteristics and suggest that factor-free
hiPSCs therefore represent a more suitable source of cells for
modeling of human disease.
Results
[0259] Reprogramming of Fibroblasts from PD Patients by
DOX-Inducible Lentiviral Vectors
[0260] Dermal fibroblasts from five patients with idiopathic PD
(age of biopsy between 53 and 85 years) and from two unaffected
subjects were obtained from the Coriell Institute for Medical
Research (see Table 4). To induce reprogramming, 1.times.10.sup.6
fibroblasts were infected with a constitutively active lentivirus
expressing the reverse tetracycline transactivator (FUW-M2rtTA)
together with DOX-inducible lentiviruses transducing either 4
(OCT4, SOX2, c-MYC, KLF4) or 3 (OCT4, SOX2, KLF4) reprogramming
factors. We will subsequently refer to hiPSC lines derived by
transduction of 4 factors as hiPSC.sup.4F and those obtained by 3
factors as hiPSC.sup.3F. Colonies with well-defined hESC like
morphology were selected and manually picked 3 to 5 weeks after
DOX-induced transgene expression. All fibroblasts obtained from PD
patients and non-PD patients gave rise to stable hiPSCs that were
maintained in the absence of DOX for more than 30 passages. At
least one cell line from each donor fibroblast line was analyzed in
detail (Table 4). All of these hiPSCs uniformly expressed the
pluripotency markers Tra-1-60, SSEA4, OCT4, SOX2 and NANOG as
determined by immunocytochemistry (FIG. 27A). In addition, all
hiPSC lines analyzed by quantitative RT-PCR showed reactivation of
the endogenous pluripotency related genes OCT4, SOX2 and NANOG with
similar levels of expression as seen in hESCs (FIG. 27B). As
expected for hiPSCs, the OCT4 promoter region of PD patient-derived
hiPSCs was found to be hypomethylated in contrast to its
hypermethylated state in the parental fibroblasts (FIG. 27C). In
order to test for pluripotency, hiPSCs isolated from each donor
fibroblast line were injected into SCID mice. All hiPSCs formed
teratomas comprised of tissues developing from all embryonic germ
layers including cartilage, bone, smooth muscle (mesoderm), neural
rosettes, pigmented neural epithelium (ectoderm) and intestinal
epithelium with goblet- and Paneth-like cells (endoderm) (FIG.
28A).
[0261] Cytogenetic analysis of PD specific hiPSC lines revealed a
normal karyotype in 11 out of 12 lines (see Supplemental FIG. 1 of
Soldner, 2009). Only one out of three clones derived from the
fibroblast line PDD that had been transduced with 4 factors (iPS
PDD.sup.4F-5), showed an unbalanced translocation between the
long-arm of chromosome 18 and the long arm of chromosome 22
resulting in a derivative chromosome 18 and a single copy of
chromosome 22. Two independent hiPSCs derived from a non-PD patient
fibroblast line (iPS M.sup.3F-1 and iPS M.sup.3F-2) showed a
balanced translocation between the short and long arms of
chromosomes 4 and 7, suggesting that the 4;7 translocation was
already present in the donor fibroblasts (see Soldner, et al.,
2009, Supplemental FIG. 1). DNA fingerprinting of the PD
patient-derived hiPSCs and the parental fibroblasts were performed
to confirm the origin of the hiPSCs and to rule out cross
contaminations with existing pluripotent cell lines (data not
shown). Southern blot analysis probing for lentiviral integrations
showed distinct patterns for each of the hiPSC lines confirming
that each line analyzed was derived from independently infected
fibroblasts carrying a total of 4 to 10 proviral copies (FIG. 28B,
28C).
[0262] In order to further characterize the usefulness of this
system, we determined the reprogramming efficiencies for one
fibroblast line (PDB) in detail. Reprogramming efficiencies were
calculated after 20 days based on immunocytochemistry for the
pluripotency markers Tra-1-60 and NANOG. HiPSCs arose with an
efficiency of approximately 0.005% after transduction with 3
factors and approximately 0.01% after transduction with 4 factors.
This is comparable to previously reported efficiencies using either
Moloney-based retroviral vectors or constitutively active
lentiviral vectors (Nakagawa et al., 2008; Takahashi et al., 2007;
Yu et al., 2007). Immunocytochemistry for NANOG and Tra-1-60 at
different time points after DOX addition revealed that small
pluripotent colonies could be detected in 4 factor transduced
fibroblasts as early as 8 days after transgene induction (FIG.
32A). We also determined the temporal requirement for the
expression of the reprogramming factors by varying the time of
DOX-induced transgene expression in fibroblasts transduced with
either 3 or 4 reprogramming factors. After 24 days we were able to
isolate hiPSC colonies from 4 factor transduced fibroblasts exposed
to D for only 8 days (PDB.sup.4F-1, 2, 3) whereas hiPSCs from 3
factor transduced cells could be isolated only after exposure to
DOX for at least 12 days (PDB.sup.3F-d12). Although the
reprogramming factors were only expressed for a limited period, all
of the picked cells gave rise to fully reprogrammed hiPSCs which
stained for pluripotency markers (FIG. 32B), reactivated the
endogenous OCT4, NANOG and SOX2 genes (FIG. 32C), and formed
teratomas comprised of cells derived from the three developmental
germ layers (FIG. 32D). Our results suggest that reprogramming by 3
factors is less efficient and takes longer than reprogramming by 4
factors in agreement with previous observations (Nakagawa et al.,
2008; Wernig et al., 2008). However, we find that derivation of
hiPSCs using 3 factors is more practical, since the infected
fibroblast cultures are not overgrown by granulated, fast growing
non-hiPSC colonies as has been described previously for cultures
infected with 4 factors (Nakagawa et al., 2008; Takahashi et al.,
2007).
[0263] The results described so far show that DOX-inducible
delivery of the reprogramming factors can efficiently generate
hiPSCs from skin biopsies obtained from PD patients in the absence
of c-MYC with similar kinetics and efficiencies as previously
reported using other approaches. Importantly, 8 of 13 3 factor
hiPSCs carried a total of only 3 to 5 proviral integrations (FIG.
28B, 28C), which is significantly less than observed in previous
studies (Wernig et al., 2007).
Generation of PD Patient-Derived hiPSCs Free of Viral Reprogramming
Factors
[0264] In order to derive hiPSCs that were free of proviruses, we
generated lentiviral vectors that could be excised after
integration using Cre-recombinase. The human ubiquitin promoter of
the FUGW-loxP lentivirus, which contains a loxP site in the 3'LTR
(Hanna et al., 2007), was replaced with a DOX-inducible, minimal
CMV promoter followed by the human c-DNAs for OCT4, KLF4 or SOX2.
Upon proviral replication, the loxP site in the 3'LTR is duplicated
into the 5'LTR resulting in an integrated transgene flanked by loxP
sites in both LTRs (FIG. 4A). 1.times.10.sup.6 fibroblasts (PDB)
were transduced simultaneously with these 3 viruses as well as a
constitutively active lentivirus expressing the reverse
tetracycline transactivator (FUW-M7rtTA). 24 hiPSC lines
(PDB.sup.2lox-1 to 24) were isolated 3 to 4 weeks after DOX
addition with similar kinetics and efficiency as described above.
Southern blot analysis for 12 cell lines showed that 4 PDB.sup.2lox
lines (PDB.sup.2lox-5, PDB.sup.2lox-17, PDB.sup.2lox-21,
PDB.sup.2lox-22) contained only 5 to 7 integrations of the
reprogramming factors (FIG. 33). These PDB.sup.2lox cell lines were
maintained in the absence of DOX for more than 20 passages and
displayed all of the characteristics of hiPSCs such as expression
of pluripotency related marker proteins Tra-1-60, SSEA4, OCT4, SOX2
and NANOG (FIG. 29B) and the reactivation of the endogenous
pluripotency related genes OCT4, NANOG and SOX2 (included in FIG.
31B). Furthermore all tested PDB.sup.2lox clones (PDB.sup.2lox-5,
PDB.sup.2lox-17, PDB.sup.2lox-21, PDB.sup.2lox-22) demonstrated in
vitro multi-lineage differentiation in EBs (data not shown) and
formed teratomas with contributions to all three embryonic germ
layers after subcutaneous injection into SCID mice (FIG. 29C).
[0265] We focused on two clones, with either 5 (PDB.sup.2lox-21) or
7 (PDB.sup.2lox-17) total integrations of the reprogramming factors
to test whether the excision of the loxP site-flanked lentiviral
vectors would generate transgene-free cells. Two different
strategies for Cre-mediated vector excision were used (FIG. 30A):
(1) Transient expression of a vector encoding Cre-recombinase and
the puromycin resistance marker (pCre-PAC). Following
electroporation, the cells were selected with puromycin for 48
hours to enrich for cells that transiently expressed
Cre-recombinase and puromycin. (2) Co-transfection of
Cre-recombinase with an EGFP expression plasmid and subsequent FACS
sorting for EGFP positive and Cre-expressing cells 60 hours after
transfection. Using these two methods we isolated a total of 180
clones 10 to 14 days after electroporation (FIG. 30A). Initial
Southern blot analysis to screen for the excision of KLF4 (highest
number of integrations) using an internal EcoRI digest showed that
48 clones were negative for KLF4 lentiviral integrations (Data not
shown). Subsequent Southern blot analysis for KLF4, OCT4 and SOX2
proviral integrations using an external XbaI restriction digest
revealed that 7 clones derived from PDB.sup.2lox-17 and 9 clones
derived from PDB.sup.2lox-21 had no integration of any of the
reprogramming factors (FIG. 30B, referred to as PDB.sup.1lox
clones). Excision of all reprogramming factors was confirmed by an
additional Southern blot analysis using a different restriction
digest (FIG. 34). Furthermore, PCR of genomic DNA using primers
specific for Cre-recombinase confirmed that none of the
PDB.sup.1lox clones had stably integrated the electroporated
plasmids (data not shown). Southern blot analysis for the
integration of the reverse tetracycline transactivator M2rtTA
showed one integration for line PDB.sup.2lox-17 and two
integrations for line PDB.sup.2lox-21 (FIG. 35). This means that
the overall number of proviral integrations including the
transactivator in line PDB.sup.2lox-21 is the same as the number of
excised transgenes from PDB.sup.2lox-17 suggesting that the
excision of all transgenes including the transactivator should be
possible. Cytogenetic analysis demonstrated that 14 out of 14
analyzed clones showed a normal karyotype after Cre-mediated
transgene excision (FIG. 30C and data not shown).
[0266] All virus-free clones retained a stable hESC like morphology
upon prolonged culture for more than 15 passages and maintained all
the characteristics of hIPSCs such as expression of the hESC
related marker proteins Tra-1-60, SSEA4, OCT4, SOX2 and NANOG as
shown by immunocytochemistry (FIG. 31A), and the expression of the
endogenous pluripotency related genes OCT4, SOX2 and NANOG (FIG.
31B) at levels comparable to hESCs and to the parental hiPSCs
before excision of the transgenes. In order to demonstrate that the
reprogramming factor-free PDB.sup.1lox clones maintain pluripotency
after the excision of the reprogramming factors, independent
PDB.sup.1lox clones were differentiated in vitro by EB formation or
injected subcutaneously into SCID mice. All tested PDB.sup.1lox
clones showed multi-lineage differentiation in vitro and developed
into teratomas with contributions to all three embryonic germ
layers (FIG. 31C).
[0267] In order to compare residual transgene expression between
distinct hiPSCs with integrated transgenes and factor-free hiPSCs,
we performed quantitative RT-PCR using transgene-specific PCR
primers. As reported previously using either lentiviral or
Moloney-based retroviral vectors (Dimon et al., 2008; Ebert et al.,
2008; Hockemeyer et al., 2008; Park et al., 2008a; Yu et al., 2007)
we detected residual expression of the reprogramming factors for
most of the transgenes in all cell lines with integrated viruses
but not in uninfected fibroblasts, hESCs, or PDB.sup.1lox lines
(FIG. 31D). Our results indicate that the use of loxP flanked
vectors for reprogramming followed by Cre-mediated excision can
efficiently generate reprogramming factor-free hiPSCs.
[0268] To address whether residual transgene expression could
affect the overall gene expression profile of the reprogrammed
cells, we compared hESCs, the parental fibroblasts, and hiPSCs
before and after transgene excision by genome-wide gene expression
analysis. Initial correlation analysis based on all genes which
show at least a 4-fold expression difference between fibroblasts
and hESCs confirmed that all hiPSCs are closely related to hESCs
regardless of whether the transgenes were removed or not (see
Soldner, et al. 2009, Supplemental FIG. 7). Despite the similarity
of hESCs and hiPSCs statistical analysis comparing PDB.sup.1lox and
PDB.sup.2lox cells in correlation to hESCs demonstrated that
PDB.sup.1lox cells are more similar to hESCs than the parental
PDB.sup.2lox cells (Soldner, et al. 2009, Supplemental FIG. 7).
Notably, correlation analysis based on all genes showing at least a
2-fold expression difference between hiPSCs either with or without
transgenes confirmed, that the gene expression profile of each
individual PDB.sup.1lox line was more closely related to hESCs than
to PDB.sup.2lox lines. (data not shown). In hiPSCs with viral
integrations, 271 genes showed statistically significant
differential expression as compared to hESCs (p<0.05) (FIG.
31E). Similar differences have been reported previously (Takahashi
et al., 2007). In contrast only 48 genes were differentially
expressed between transgene-free hiPSCs and hESCs (FIG. 31E). This
represents a reduction of more than 80% of deregulated genes upon
removal of the reprogramming factors. The remaining differentially
expressed genes in factor-free hiPSCs are most likely due to either
the diverse genetic background of hESCs and hiPSCs or the
expression of the transactivator or a genetic memory of the
reprogrammed somatic cell of origin. A detailed list of the
differentially regulated genes is shown in Supplemental Table 1 of
Soldner, et al., 2009.
DISCUSSION
[0269] In the work described in this example we derived hiPSCs from
skin biopsies obtained from patients with idiopathic PD. We
developed a robust reprogramming protocol that allows the
reproducible generation of patient-specific hiPSCs carrying a low
number of proviral vector integrations. The use of modified
lentiviruses carrying a loxP site flanking the integrated
proviruses allowed the efficient removal of all transgene sequences
and generated reprogramming-factor-free hiPSCs. The factor-free
hiPSCs were pluripotent and, using molecular criteria, were more
similar to embryo-derived hESCs than to the conventional
vector-carrying parental hiPSCs. Efforts to understand the
underlying pathophysiology of many neurodegenerative diseases such
as PD are hampered by the lack of genuine in vitro models. Using
hiPSC technology we established hiPSC lines from five patients with
idiopathic PD using DOX-inducible lentiviral vectors transducing
either 3 or 4 reprogramming factors. These cells were shown to have
all of the features of pluripotent ES cells including the ability
to differentiate into cell types of all embryonic lineages.
[0270] Our results indicate that removal of the integrated
transgenes by Cre/lox mediated recombination can lead to
vector-free hiPSCs. A previous report failed to excise transgenes
flanked by loxP sites (Takahashi and Yamanaka, 2006). Without being
bound by theory, this is probably due to the high number of
retroviral integrations (more than 20) which made complete removal
of all proviruses impossible or caused catastrophic genomic
instability. Our results, based upon DOX-inducible lentiviral
transduction, show that hiPSCs carrying as few as 3 or 4 viral
integrations can be generated. Using DOX-inducible lentiviral
vectors with a loxP site within the 3'LTR, we derived PD
patient-specific reprogramming factor-free hiPSCs after
Cre-recombinase mediated excision of the transgenes. Removal of the
promoter and transgene sequences in self-inactivating (SIN)
lentiviral vectors is expected to considerably reduce the risk of
oncogenic transformation due to virus mediated oncogene activation
and/or re-expression of the transduced transcription factors (Allen
and Berns, 1996; von Kalle et al., 2004). The remaining risk of
gene disruption could be eliminated by targeting the reprogramming
factors as a polycistronic single expression vector flanked by loxP
sites into a genomic safe-harbor locus.
Factor-Free hiPSCs Maintain a Pluripotent ESC Like State
[0271] Although silencing of transgene expression has been reported
for several hiPSCs, all hiPSCs generated to date (including the
lines described in this example prior to removal of the
reprogramming factors), sustain a low but detectable residual
transgene expression (Dimos et al., 2008; Ebert et al., 2008;
Hockemeyer et al., 2008; Park et al., 2008a; Yu et al., 2007). The
question of whether hiPSCs depend on the expression of the
reprogramming factors to maintain a pluripotent ESC-like state has
therefore not been conclusively resolved. The observation that
factor-free hiPSCs were morphologically and biological
indistinguishable from the parental hiPSCs and maintained all the
characteristics of hESCs demonstrates that human somatic cells can
be reprogrammed to a self-sustaining pluripotent state which can be
maintained in the complete absence of the exogenous reprogramming
factors. These results provide additional proof that hiPSCs
reestablish a pluripotency related autoregulatory loop that has
been proposed to rely on the activation of the four endogenous
transcription factors OCT4, NANOG, SOX2 and TCF3 (Jaenisch and
Young, 2008).
Residual Transgene Expression from Partially Silenced Viral Vectors
Perturbs the Transcriptional Profile of hiPSCs
[0272] Because the genomic integration site of a particular
provirus influences proviral silencing as well as its risk of being
reactivated, hiPSCs with identical and predictable properties
cannot be generated by approaches relying on stochastic silencing.
Residual transgene expression might affect the differentiation
properties of iPSCs. Indeed, significant differences between mouse
ES cells and iPSCs in their ability to differentiate into
cardiomyocytes (K. Hochedlinger, personal communication) as well as
partially blocked EB induced differentiation along with incomplete
OCT4 and NANOG downregulation of distinct hiPSC clones (Yu et al.,
2007) have been observed. These observations are consistent with
the possibility that the variable basal transcription of only
partially silenced vectors might influence the generation of
functional differentiated cells.
[0273] In an effort to assess whether the removal of the vectors
would affect the properties of the hiPSCs, we compared overall gene
expression patterns in parental provirus-carrying hiPSCs,
factor-free hiPSCs, and in embryo-derived hESCs. As reported
previously (Park et al., 2008b; Takahashi et al., 2007; Yu et al.,
2007), the provirus-carrying hiPSCs and factor-free hiPSCs
clustered closely with the hESCs when compared to the donor
fibroblasts. However, a more detailed analysis of the most
divergent genes between the different hiPSCs cell types revealed
that embryo-derived hESCs and factor-free hiPSCs were more closely
related to each other than to the provirus-carrying parental
hiPSCs. It is possible that the remaining small difference in gene
expression between the vector-free hiPSCs and hESCs may be due to
expression of the transactivator that had not been excised in our
experiments. These results presented here provide clear evidence
that the basal expression of proviruses carried in conventional iPS
cells can affect the molecular characteristics of the cells. The
system described here provides the basis to further elucidate the
effect of residual transgene expression, e.g., in the context of in
vitro and in vivo differentiation paradigms. Furthermore, these
results demonstrate that the derivation of reprogramming
factor-free hiPSCs is of great benefit not only for potential
therapeutic applications, but also for biomedical research in order
to develop more reliable and reproducible in vitro models of
disease. To this end, we suggest that generating transgene-free
hiPSCs by Cre-mediated excision offers significant advantages such
as its high efficiency and experimental simplicity. The system
described here has the potential to become a routine technology for
the derivation of hiPSCs that will allow the generation of
standardized hiPSCs from different sources using different
combinations of reprogramming factors.
TABLE-US-00006 TABLE 4 Summary of hiPSCs Derived from Primary
Fibroblasts Age at Number of iPSC Parental Onset Age at
Reprogramming iPSC Clones Clone Cell Line Donor.sup.a of PD Biopsy
Factors Characterized ID AG20443 Parkinson's NA 71 FUW-tetO 3 2
PDA.sup.3F- (PDA) disease factors (OCT4, 1, -5 patient, SOX2, KLF4)
idopathic, male AG20442 Parkinson's 51 53 FUW-tetO 3 .sup. 5.sup.b
PDB.sup.3F- (PDB) disease factors (OCT4, 1, -5, -8, patient, SOX2,
KLF4) -9, idopathic, PDB.sup.3F- male d12 AG20442 Parkinson's 51 53
FUW-tetO 4 .sup. 5.sup.c PDB.sup.4F- (PDB) disease factors (OCT4,
1, -2, -3, patient, SOX2, KLF4, c- -4, -5 idopathic, MYC) male
AG20446 Parkinson's 50 57 FUW-tetO 3 1 PDC.sup.3F-1 (PDC) disease
factors (OCT4, patient, SOX2, KLF4) idopathic, male AG20445
Parkinson's 44 60 FUW-tetO 3 3 PDD.sup.3F- (PDD) disease factors
(OCT4, 1, -4, -7 patient, SOX2, KLF4) idopathic, male AG20445
Parkinson's 44 60 FUW-tetO 4 5 PDA.sup.4F- (PDD) disease factors
(OCT4, 1, -4, -5, patient, SOX2, KLF4, c- -8, -9 idopathic, MYC)
male AG08395 Parkinson's 83 85 FUW-tetO 3 2 PDE.sup.3F- (PDE)
disease factors (OCT4, 3, -4 patient, SOX2, KLF4) idopathic, female
GM01786 Dyskeratosis -- 30 FUW-tetO 3 2 M.sup.3F-1, -2 congenital
factors (OCT4, carrier, SOX2, KLF4) female GM01660 Lesh-Nyhan -- 11
FUW-tetO 3 .sup. 2.sup.d A1, A6 carrier, factors (OCT4, female
SOX2, KLF4) MRC-5 male, FUW-tetO 4 .sup. 2.sup.d D1, D4 embryonic
factors (OCT4, fibroblasts SOX2, KLF4, c- MYC) N/A Not available
.sup.aAdditional information about these fibroblast cell lines can
be obtained from the Coriell Institute. .sup.bPDB.sup.3F-12d was
isolated in experiments to determine the temporal requirements of
transgene expression. PDB.sup.3F-12d was isolated from cultures
exposed for 12 days to doxycycline. .sup.cThese cells were derived
in experiments to determine the temporal requirements of transgene
expression. PDB.sup.4F-1 to -3 were isolated from cultures exposed
for 8 days to doxycyline, whereas PDB.sup.4F-4 and -5 were exposed
to doxycycline for 10 and 12 days, respectively. .sup.dThese hiPSCs
cells have been previously characterized in Hockemeyer et al.,
2008.
REFERENCES FOR EXAMPLE 4
[0274] Aasen, T., Raya, A., Barrero, M. J., Garreta, E., Consiglio,
A., Gonzalez, F., Vassena, R., Bilic, J., Pekarik, V., Tiscornia,
G., et al. (2008). Efficient and rapid generation of induced
pluripotent stem cells from human keratinocytes. Nat Biotechnol 26,
1276-1284. [0275] Allen, J. D., and Berns, A. (1996).
Complementation tagging of cooperating oncogenes in knockout mice.
Semin Cancer Biol 7, 299-306. [0276] Brambrink, T., Foreman, R.,
Welstead, G. G., Lengner, C. J., Wernig, M., Suh, H., and Jaenisch,
R. (2008). Sequential expression of pluripotency markers during
direct reprogramming of mouse somatic cells. Cell Stem Cell 2,
151-159. [0277] Carey, B. W., Markoulaki, S., Hanna, J., Saha, K.,
Gao, Q., Mitalipova, M., and Jaenisch, R. (2009). Reprogramming of
murine and human somatic cells using a single polycistronic vector.
Proc Natl Acad Sci USA 106, 157-162. [0278] Costa, M., Dottori, M.,
Sourris, K., Jamshidi, P., Hatzistavrou, T., Davis, R., Azzola, L.,
Jackson, S., Lim, S. M., Pera, M., et al. (2007). A method for
genetic modification of human embryonic stem cells using
electroporation. Nat Protoc 2, 792-796. [0279] de Lau, L. M., and
Breteler, M. M. (2006). Epidemiology of Parkinson's disease. Lancet
Neurol 5, 525-535. [0280] Dimos, J. T., Rodolfa, K. T., Niakan, K.
K., Weisenthal, L. M., Mitsumoto, H., Chung, W., Croft, G. F.,
Saphier, G., Leibel, R., Goland, R., et al. (2008). Induced
pluripotent stem cells generated from patients with ALS can be
differentiated into motor neurons. Science 321, 1218-1221. [0281]
Ebert, A. D., Yu, J., Rose, F. F., Jr., Mattis, V. B., Lorson, C.
L., Thomson, J. A., and Svendsen, C. N. (2009). Induced pluripotent
stem cells from a spinal muscular atrophy patient. Nature 457,
277-280. [0282] Elkabetz, Y., Panagiotakos, G., Al Shamy, G.,
Socci, N. D., Tabar, V., and Studer, L. (2008). Human ES
cell-derived neural rosettes reveal a functionally distinct early
neural stem cell stage. Genes Dev 22, 152-165. [0283] Gasser, T.
(2007). Update on the genetics of Parkinson's disease. Mov Disord
22 Suppl 17, S343-350. [0284] Hanna, J., Wernig, M., Markoulaki,
S., Sun, C. W., Meissner, A., Cassady, J. P., Beard, C., Brambrink,
T., Wu, L. C., Townes, T. M., et al. (2007). Treatment of sickle
cell anemia mouse model with iPS cells generated from autologous
skin. Science 318, 1920-1923. [0285] Hochedlinger, K., Yamada, Y.,
Beard, C., and Jaenisch, R. (2005). Ectopic expression of Oct-4
blocks progenitor-cell differentiation and causes dysplasia in
epithelial tissues. Cell 121, 465-477. [0286] Hockemeyer, D.,
Soldner, F., Cook, E. G., Gao, Q., Mitalipova, M., and Jaenisch, R.
(2008). A drug-inducible system for direct reprogramming of human
somatic cells to pluripotency. Cell Stem Cell 3, 346-353. [0287]
Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A.,
Chen, S., Muhlestein, W., and Melton, D. A. (2008). Induction of
pluripotent stem cells from primary human fibroblasts with only
Oct4 and Sox2. Nat Biotechnol 26, 1269-1275. [0288] Jaenisch, R.,
and Young, R. (2008). Stem cells, the molecular circuitry of
pluripotency and nuclear reprogramming. Cell 132, 567-582. [0289]
Kim, B. K., Kim, S. E., Shim, J. H., Woo, D. H., Gil, J. E., Kim,
S. K., and Kim, J. H. (2006). Neurogenic effect of vascular
endothelial growth factor during germ layer formation of human
embryonic stem cells. FEBS Lett 580, 5869-5874. [0290] Lowry, W.
E., Richter, L., Yachechko, R., Pyle, A. D., Tchieu, J., Sridharan,
R., Clark, A. T., and Plath, K. (2008). Generation of human induced
pluripotent stem cells from dermal fibroblasts. Proc Natl Acad Sci
USA 105, 2883-2888. [0291] Maherali, N., Ahfeldt, T., Rigamonti,
A., Utikal, J., Cowan, C., and Hochedlinger, K. (2008). A
high-efficiency system for the generation and study of human
induced pluripotent stem cells. Cell Stem Cell 3, 340-345. [0292]
Markoulaki, S., Hanna, J., Beard, C., Carey, B. W., Cheng, A. W.,
Lengner, C. J., Dausman, J. A., Fu, D., Gao, Q., Wu, S., et al.
(2009). Transgenic mice with defined combinations of drug-inducible
reprogramming factors. Nat Biotechnol. [0293] Nakagawa, M.,
Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T.,
Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S. (2008).
Generation of induced pluripotent stem cells without Myc from mouse
and human fibroblasts. Nat Biotechnol 26, 101-106. [0294] Okita,
K., Ichisaka, T., and Yamanaka, S. (2007). Generation of
germline-competent induced pluripotent stem cells. Nature 448,
313-317.) [0295] Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka,
T., and Yamanaka, S. (2008). Generation of mouse induced
pluripotent stem cells without viral vectors. Science 322, 949-953.
[0296] Park, I. H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T.,
Shimamura, A., Lensch, M. W., Cowan, C., Hochedlinger, K., and
Daley, G. Q. (2008a). Disease-Specific Induced Pluripotent Stem
Cells. Cell. [0297] Park, I. H., Zhao, R., West, J. A., Yabuuchi,
A., Huo, H., Ince, T. A., Lerou, P. H., Lensch, M. W., and Daley,
G. Q. (2008b). Reprogramming of human somatic cells to pluripotency
with defined factors. Nature 451, 141-146. [0298] Perrier, A. L.,
Tabar, V., Barberi, T., Rubio, M. E., Bruses, J., Topf, N.,
Harrison, N. L., and Studer, L. (2004). Derivation of midbrain
dopamine neurons from human embryonic stem cells. Proc Natl Acad
Sci USA 101, 12543-12548. [0299] Roy, N. S., Cleren, C., Singh, S.
K., Yang, L., Beal, M. F., and Goldman, S. A. (2006). Functional
engraftment of human ES cell-derived dopaminergic neurons enriched
by coculture with telomerase-immortalized midbrain astrocytes. Nat
Med 12, 1259-1268. [0300] Schulz, J. B. (2008). Update on the
pathogenesis of Parkinson's disease. J Neurol 255 Suppl 5, 3-7.
[0301] Shi, Y., Desponts, C., Do, J. T., Hahm, H. S., Scholer, H.
R., and Ding, S. (2008a). Induction of pluripotent stem cells from
mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule
compounds. Cell Stem Cell 3, 568-574. [0302] Shi, Y., Do, J. T.,
Desponts, C., Hahm, H. S., Scholer, H. R., and Ding, S. (2008b). A
combined chemical and genetic approach for the generation of
induced pluripotent stem cells. Cell Stem Cell 2, 525-528. [0303]
Soldner F, Hockemeyer D, Beard C, Gao Q, Bell G W, Cook E G, Hargus
G, Blak A, Cooper O, Mitalipova M, Isacson O, Jaenisch R. (2009)
Parkinson's disease patient-derived induced pluripotent stem cells
free of viral reprogramming factors. Cell. 136(5):964-77. [0304]
Sonntag, K. C., Pruszak, J., Yoshizaki, T., van Arensbergen, J.,
Sanchez-Pernaute, R., and Isacson, O. (2007). Enhanced yield of
neuroepithelial precursors and midbrain-like dopaminergic neurons
from human embryonic stem cells using the bone morphogenic protein
antagonist noggin. Stem Cells 25, 411-418. [0305] Stadtfeld, M.,
Nagaya, M., Utikal, J., Weir, G., and Hochedlinger, K. (2008).
Induced pluripotent stem cells generated without viral integration.
Science 322, 945-949. [0306] Takahashi, K., Tanabe, K., Ohnuki, M.,
Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007).
Induction of pluripotent stem cells from adult human fibroblasts by
defined factors. Cell 131, 861-872. [0307] Takahashi, K., and
Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell
126, 663-676. [0308] Taniguchi, M., Sanbo, M., Watanabe, S.,
Naruse, I., Mishina, M., and Yagi, T. (1998). Efficient production
of Cre-mediated site-directed recombinants through the utilization
of the puromycin resistance gene, pac: a transient gene-integration
marker for ES cells. Nucleic Acids Res 26, 679-680. [0309]
Trounson, A. (2009). Rats, cats, and elephants, but still no
unicorn: induced pluripotent stem cells from new species. Cell Stem
Cell 4, 3-4. [0310] von Kalle, C., Fehse, B., Layh-Schmitt, G.,
Schmidt, M., Kelly, P., and Baum, C. (2004). Stem cell clonality
and genotoxicity in hematopoietic cells: gene activation side
effects should be avoidable. Semin Hematol 41, 303-318. [0311]
Wernig, M., Meissner, A., Cassady, J. P., and Jaenisch, R. (2008).
c-Myc is dispensable for direct reprogramming of mouse fibroblasts.
Cell Stem Cell 2, 10-12. [0312] Wernig, M., Meissner, A., Foreman,
R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B. E., and
Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a
pluripotent ES-cell-like state. Nature 448, 318-324. [0313] Yu, J.,
Vodyanik, M. A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.
L., Tian, S., Nie, J., Jonsdottir, G. A., Ruotti, V., Stewart, R.,
et al. (2007). Induced pluripotent stem cell lines derived from
human somatic cells. Science 318, 1917-1920.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 35 <210> SEQ ID NO 1 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 forward primer <400>
SEQUENCE: 1 gttgttttgt tttggttttg gatat 25 <210> SEQ ID NO 2
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Oct4
forward primer <400> SEQUENCE: 2 atgggttgaa atattgggtt tattta
26 <210> SEQ ID NO 3 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 reverse primer <400>
SEQUENCE: 3 ccaccctcta accttaacct ctaac 25 <210> SEQ ID NO 4
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog forward primer <400> SEQUENCE: 4 gaggatgttt tttaagtttt
tttt 24 <210> SEQ ID NO 5 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Nanog forward primer <400>
SEQUENCE: 5 aatgtttatg gtggattttg taggt 25 <210> SEQ ID NO 6
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog reverse primer <400> SEQUENCE: 6 cccacactca tatcaatata
ataac 25 <210> SEQ ID NO 7 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 primer <400> SEQUENCE: 7
acatcgccaa tcagcttgg 19 <210> SEQ ID NO 8 <211> LENGTH:
23 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Oct4 primer
<400> SEQUENCE: 8 agaaccatac tcgaaccaca tcc 23 <210>
SEQ ID NO 9 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: c-myc primer <400> SEQUENCE: 9 ccaccagcag
cgactctga 19 <210> SEQ ID NO 10 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: c-myc primer <400>
SEQUENCE: 10 tgcctcttct ccacagacac c 21 <210> SEQ ID NO 11
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Klf4
primer <400> SEQUENCE: 11 gcacacctgc gaactcacac 20
<210> SEQ ID NO 12 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Klf4 primer <400> SEQUENCE: 12
ccgtcccagt cacagtggta a 21 <210> SEQ ID NO 13 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Sox2 primer
<400> SEQUENCE: 13 acagatgcaa ccgatgcacc 20 <210> SEQ
ID NO 14 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: Sox2 primer <400> SEQUENCE: 14 tggagttgta
ctgcagggcg 20 <210> SEQ ID NO 15 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Nanog primer <400>
SEQUENCE: 15 cctccagcag atgcaagaac tc 22 <210> SEQ ID NO 16
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog primer <400> SEQUENCE: 16 cttcaaccac tggtttttct gcc 23
<210> SEQ ID NO 17 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: GAPDH primer <400> SEQUENCE:
17 ttcaccacca tggagaaggc 20 <210> SEQ ID NO 18 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: GAPDH primer
<400> SEQUENCE: 18 cccttttggc tccaccct 18 <210> SEQ ID
NO 19 <400> SEQUENCE: 19 000 <210> SEQ ID NO 20
<400> SEQUENCE: 20 000 <210> SEQ ID NO 21 <211>
LENGTH: 57 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: 2A peptide
vector sequence <400> SEQUENCE: 21 gccacgaact tctctctgtt
aaagcaagca ggagatgttg aagaaaaccc cgggcct 57 <210> SEQ ID NO
22 <211> LENGTH: 54 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: 2A peptide vector sequence <400> SEQUENCE: 22
gagggcagag gaagtcttct aacatgcggt gacgtggagg agaatcccgg ccct 54
<210> SEQ ID NO 23 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: 2A peptide vector sequence
<400> SEQUENCE: 23 cagtgtacta attatgctct cttgaaattg
gctggagatg ttgagagcaa cccaggtccc 60 <210> SEQ ID NO 24
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Oct4
primer <400> SEQUENCE: 24 acatcgccaa tcagcttgg 19 <210>
SEQ ID NO 25 <211> LENGTH: 23 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: Oct4 primer <400> SEQUENCE: 25 agaaccatac
tcgaaccaca tcc 23 <210> SEQ ID NO 26 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Sox2 primer <400>
SEQUENCE: 26 acagatgcaa ccgatgcacc 20 <210> SEQ ID NO 27
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Sox2
primer <400> SEQUENCE: 27 tggagttgta ctgcagggcg 20
<210> SEQ ID NO 28 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: 4F2A primer <400> SEQUENCE: 28
ggctggagat gttgagagca a 21 <210> SEQ ID NO 29 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: 4F2A primer
<400> SEQUENCE: 29 aaaggaaatc cagtggcgc 19 <210> SEQ ID
NO 30 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: GAPDH primer <400> SEQUENCE: 30 ttcaccacca
tggagaaggc 20 <210> SEQ ID NO 31 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: GAPDH primer <400>
SEQUENCE: 31 cccttttggc tccaccct 18 <210> SEQ ID NO 32
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Oct4
primer <400> SEQUENCE: 32 atttgttttt tgggtagtta aaggt 25
<210> SEQ ID NO 33 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 primer <400> SEQUENCE: 33
ccaactatct tcatcttaat aacatcc 27 <210> SEQ ID NO 34
<211> LENGTH: 7 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Aphthovirus 2A peptide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (2)..(2) <223> OTHER
INFORMATION: Xaa can be valine or isoleucine <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (4)..(4)
<223> OTHER INFORMATION: Xaa can be any naturally occurring
amino acid <400> SEQUENCE: 34 Asp Xaa Glu Xaa Asn Pro Gly 1 5
<210> SEQ ID NO 35 <211> LENGTH: 22 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Aphthovirus 2A peptide <400>
SEQUENCE: 35 Val Lys Gln Thr Leu Asn Phe Asp Leu Leu Lys Leu Ala
Gly Asp Val 1 5 10 15 Glu Ser Asn Pro Gly Pro 20
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 35 <210>
SEQ ID NO 1 <211> LENGTH: 25 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: Oct4 forward primer <400> SEQUENCE: 1
gttgttttgt tttggttttg gatat 25 <210> SEQ ID NO 2 <211>
LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Oct4 forward
primer <400> SEQUENCE: 2 atgggttgaa atattgggtt tattta 26
<210> SEQ ID NO 3 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 reverse primer <400>
SEQUENCE: 3 ccaccctcta accttaacct ctaac 25 <210> SEQ ID NO 4
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog forward primer <400> SEQUENCE: 4 gaggatgttt tttaagtttt
tttt 24 <210> SEQ ID NO 5 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Nanog forward primer <400>
SEQUENCE: 5 aatgtttatg gtggattttg taggt 25 <210> SEQ ID NO 6
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog reverse primer <400> SEQUENCE: 6 cccacactca tatcaatata
ataac 25 <210> SEQ ID NO 7 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 primer <400> SEQUENCE: 7
acatcgccaa tcagcttgg 19 <210> SEQ ID NO 8 <211> LENGTH:
23 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Oct4 primer
<400> SEQUENCE: 8 agaaccatac tcgaaccaca tcc 23 <210>
SEQ ID NO 9 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial <220> FEATURE: <223>
OTHER INFORMATION: c-myc primer <400> SEQUENCE: 9 ccaccagcag
cgactctga 19 <210> SEQ ID NO 10 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: c-myc primer <400>
SEQUENCE: 10 tgcctcttct ccacagacac c 21 <210> SEQ ID NO 11
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Klf4
primer <400> SEQUENCE: 11 gcacacctgc gaactcacac 20
<210> SEQ ID NO 12 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Klf4 primer <400> SEQUENCE: 12
ccgtcccagt cacagtggta a 21 <210> SEQ ID NO 13 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Sox2 primer
<400> SEQUENCE: 13 acagatgcaa ccgatgcacc 20 <210> SEQ
ID NO 14 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: Sox2 primer <400> SEQUENCE: 14 tggagttgta
ctgcagggcg 20 <210> SEQ ID NO 15 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Nanog primer <400>
SEQUENCE: 15 cctccagcag atgcaagaac tc 22 <210> SEQ ID NO 16
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Nanog primer <400> SEQUENCE: 16 cttcaaccac tggtttttct gcc 23
<210> SEQ ID NO 17 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: GAPDH primer <400> SEQUENCE:
17 ttcaccacca tggagaaggc 20 <210> SEQ ID NO 18 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: GAPDH primer
<400> SEQUENCE: 18 cccttttggc tccaccct 18 <210> SEQ ID
NO 19 <400> SEQUENCE: 19 000 <210> SEQ ID NO 20
<400> SEQUENCE: 20 000 <210> SEQ ID NO 21 <211>
LENGTH: 57 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: 2A peptide
vector sequence <400> SEQUENCE: 21 gccacgaact tctctctgtt
aaagcaagca ggagatgttg aagaaaaccc cgggcct 57 <210> SEQ ID NO
22 <211> LENGTH: 54
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: 2A peptide vector sequence
<400> SEQUENCE: 22 gagggcagag gaagtcttct aacatgcggt
gacgtggagg agaatcccgg ccct 54 <210> SEQ ID NO 23 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: 2A peptide
vector sequence <400> SEQUENCE: 23 cagtgtacta attatgctct
cttgaaattg gctggagatg ttgagagcaa cccaggtccc 60 <210> SEQ ID
NO 24 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: Oct4 primer <400> SEQUENCE: 24 acatcgccaa
tcagcttgg 19 <210> SEQ ID NO 25 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: Oct4 primer <400>
SEQUENCE: 25 agaaccatac tcgaaccaca tcc 23 <210> SEQ ID NO 26
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION: Sox2
primer <400> SEQUENCE: 26 acagatgcaa ccgatgcacc 20
<210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Sox2 primer <400> SEQUENCE: 27
tggagttgta ctgcagggcg 20 <210> SEQ ID NO 28 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: 4F2A primer
<400> SEQUENCE: 28 ggctggagat gttgagagca a 21 <210> SEQ
ID NO 29 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial <220> FEATURE: <223> OTHER
INFORMATION: 4F2A primer <400> SEQUENCE: 29 aaaggaaatc
cagtggcgc 19 <210> SEQ ID NO 30 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial <220>
FEATURE: <223> OTHER INFORMATION: GAPDH primer <400>
SEQUENCE: 30 ttcaccacca tggagaaggc 20 <210> SEQ ID NO 31
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
GAPDH primer <400> SEQUENCE: 31 cccttttggc tccaccct 18
<210> SEQ ID NO 32 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Oct4 primer <400> SEQUENCE: 32
atttgttttt tgggtagtta aaggt 25 <210> SEQ ID NO 33 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
<220> FEATURE: <223> OTHER INFORMATION: Oct4 primer
<400> SEQUENCE: 33 ccaactatct tcatcttaat aacatcc 27
<210> SEQ ID NO 34 <211> LENGTH: 7 <212> TYPE:
PRT <213> ORGANISM: Artificial <220> FEATURE:
<223> OTHER INFORMATION: Aphthovirus 2A peptide <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(2)..(2) <223> OTHER INFORMATION: Xaa can be valine or
isoleucine <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (4)..(4) <223> OTHER INFORMATION: Xaa
can be any naturally occurring amino acid <400> SEQUENCE: 34
Asp Xaa Glu Xaa Asn Pro Gly 1 5 <210> SEQ ID NO 35
<211> LENGTH: 22 <212> TYPE: PRT <213> ORGANISM:
Artificial <220> FEATURE: <223> OTHER INFORMATION:
Aphthovirus 2A peptide <400> SEQUENCE: 35 Val Lys Gln Thr Leu
Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val 1 5 10 15 Glu Ser Asn
Pro Gly Pro 20
* * * * *