U.S. patent application number 15/179051 was filed with the patent office on 2017-03-02 for cardiomyocytes from induced pluripotent stem cells from patients and methods of use thereof.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Paul W. Burridge, Feng Lan, Andrew Stephen Lee, Michael T. Longaker, Robert C. Robbins, Ning Sun, Joseph Wu.
Application Number | 20170058263 15/179051 |
Document ID | / |
Family ID | 47558518 |
Filed Date | 2017-03-02 |
United States Patent
Application |
20170058263 |
Kind Code |
A1 |
Sun; Ning ; et al. |
March 2, 2017 |
Cardiomyocytes From Induced Pluripotent Stem Cells From Patients
and Methods of Use Thereof
Abstract
Human somatic cells obtained from individuals with a genetic
heart condition are reprogrammed to become induced pluripotent stem
cells (iPS cells), and differentiated into cardiomyocytes for use
in analysis, screening programs, and the like.
Inventors: |
Sun; Ning; (Shanghai,
CN) ; Longaker; Michael T.; (Atherton, CA) ;
Robbins; Robert C.; (Stanford, CA) ; Wu; Joseph;
(Stanford, CA) ; Lan; Feng; (Menlo Park, CA)
; Lee; Andrew Stephen; (Palo Alto, CA) ; Burridge;
Paul W.; (Stanford, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
47558518 |
Appl. No.: |
15/179051 |
Filed: |
June 10, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13554946 |
Jul 20, 2012 |
9395354 |
|
|
15179051 |
|
|
|
|
61510422 |
Jul 21, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 5/0657 20130101;
C12N 2501/602 20130101; C12N 2506/45 20130101; C12N 2501/606
20130101; G01N 2800/325 20130101; C12N 2501/604 20130101; A61P 9/00
20180101; C12N 2506/1307 20130101; G01N 2800/324 20130101; G01N
33/5073 20130101; G01N 33/5061 20130101; C12N 2501/603 20130101;
C12N 5/0696 20130101; C12N 2510/00 20130101 |
International
Class: |
C12N 5/077 20060101
C12N005/077; G01N 33/50 20060101 G01N033/50 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with Government support under
contract HL099776 awarded by the National Institutes of Health. The
Government has certain rights in the invention.
Claims
1-32. (canceled)
33. An in vitro-generated cardiomyocyte wherein: a. the
in-vitro-generated cardiomyocyte is generated from a pluripotent
stem cell or a reprogrammed cell in vitro; b. the
in-vitro-generated cardiomyocyte comprises at least one mutation in
a gene encoding a sarcomeric protein; and c. the in-vitro-generated
cardiomyocyte displays a phenotype associated with hypertrophic
cardiomyopathy.
34. The in vitro-generated cardiomyocyte of claim 33, wherein the
in-vitro-generated cardiomyocyte exhibits, relative to a normal
cardiomyocyte, one or more phenotypes selected from the group
consisting of: an electrophysiological phenotype, contractile
arrhythmia, an increased intracellular calcium level, and an
increased ratio of .beta.-myosin expression to .alpha.-myosin
expression.
35. The in-vitro-generated cardiomyocyte of claim 33, wherein the
in-vitro-generated cardiomyocyte is generated from the pluripotent
stem cell, and the pluripotent stem cell is an induced pluripotent
stem cell.
36. The in-vitro-generated cardiomyocyte of claim 35, wherein the
induced pluripotent stem cell is derived from a subject with
hypertrophic cardiomyopathy, arrhythmia, or both.
37. The in-vitro-generated cardiomyocyte of claim 33, wherein the
gene encoding a sarcomeric protein is cardiac troponin T (TNNT2),
myosin heavy chain (MYH7), tropomyosin 1 (TPM1), myosin binding
protein C (MYBPC3), 5'-AMP-activated protein kinase subunit gamma-2
(PRKAG2), troponin I type 3 (TNNI3), titin (UN), myosin light chain
2 (MYL2), actin alpha cardiac muscle 1 (ACTC1), or cardiac LIM
protein (CSRP3).
38. The in-vitro-generated cardiomyocyte of claim 33, further
comprising at least one mutation in caveolin 3 (CAV3),
galactosidase alpha (GLA), lysosomal-associated membrane protein 2
(LAMP2), mitochondrial transfer RNA glycine (MTTG), mitochondrial
transfer RNA isoleucine (MTTI), mitochondrial transfer RNA lysine
(MTTK), mitochondrial transfer RNA glutamine (MTTQ), myosin light
chain 3 (MYL3), troponin C (TNNC1), Transthyretin (TTR), GATA4, or
a combination thereof.
39. The in-vitro-generated cardiomyocyte of claim 33, wherein the
at least one mutation is in MYH7.
40. The in-vitro-generated cardiomyocyte of claim 33, wherein the
at least one mutation is a MYH7 R663H mutation
41. The in-vitro-generated cardiomyocyte of claim 33, wherein the
phenotype associated with hypertrophic cardiomyopathy comprises,
relative to a normal cardiomyocyte, electrophysiological
arrhythmia, contractile arrhythmia, an increased intracellular
calcium level, an increased ratio of .beta.-myosin expression to
.alpha.-myosin expression, an increased cell size, irregular
calcium transient, an increased intracellular calcium level,
calcineurin activation, nuclear translocation of nuclear factor of
activated T-cells (NFAT), or an increased hypertrophic response to
a positive inotropic stress.
42. A population or panel of cells, wherein the population or panel
of cells comprises the in-vitro-generated cardiomyocyte of claim
33.
43. The population or panel of cells of claim 42, wherein the
population or panel of cells has a cardiomyocyte purity of greater
than 60%.
44. A cell culture comprising: a) the in-vitro-generated
cardiomyocyte of claim 33; and b) a candidate agent selected from
the group consisting of: a calcium channel blocker, a sodium
channel blocker, a potassium channel blocker, a beta blocker, and a
combination thereof.
45. A method for screening a candidate agent, the method
comprising: a) contacting the candidate agent with a cardiomyocyte
in vitro, wherein the cardiomyocyte i) comprises at least one
mutation in a gene encoding a sarcomeric protein; and ii) displays
a phenotype associated with hypertrophic cardiomyopathy; and b)
using an in vitro assay to detect an effect of the candidate agent
on the phenotype associated with hypertrophic cardiomyopathy.
46. The method of claim 45, wherein the candidate agent comprises a
drug candidate.
47. The method of claim 45, wherein the in vitro assay comprises
atomic force microscopy, microelectrode array recordings, patch
clamping, single cell PCR, or calcium imaging.
48. The method of claim 45, wherein the cardiomyocyte is generated
from a pluripotent stem cell in vitro.
49. The method of claim 45, wherein the gene encoding a sarcomeric
protein is TNNT2, MYH7, TPM1, MYBPC3, PRKAG2, TNNI3, UN, MYL2,
ACTC1, CSRP3, CAV3, GLA, LAMP2, MTTG, MTTI, MTTK, MTTQ, MYL3,
TNNC1, TTR, or GATA4.
50. The method of claim 45, wherein the phenotype associated with
hypertrophic cardiomyopathy comprises, relative to a normal
cardiomyocyte, electrophysiological arrhythmia, contractile
arrhythmia, an increased intracellular calcium level, an increased
ratio of .beta.-myosin expression to .alpha.-myosin expression, an
increased cell size, irregular calcium transient, an increased
intracellular calcium level, calcineurin activation, nuclear
translocation of NFAT, or an increased hypertrophic response to a
positive inotropic stress.
51. The method of claim 45, further comprising subjecting the
cardiomyocyte to electrical stimulation.
52. The method of claim 45, further comprising subjecting the
cardiomyocyte to drug stimulation.
53. The method of claim 45, further comprising, prior to the
contacting the cardiomyocyte with the candidate agent, generating
the cardiomyocyte from a pluripotent stem cell derived from a
subject with hypertrophic cardiomyopathy.
54. The method of claim 53, further comprising administering the
candidate agent to the subject with hypertrophic cardiomyopathy
based on the effect of the candidate agent on the phenotype.
55. The method of claim 45, wherein the candidate agent is a
calcium channel blocker or a sodium channel blocker.
Description
CROSS-REFERENCE
[0001] This application claims benefit and is a Continuation of
Application of Ser. No. 13/554,946 filed Jul. 20, 2012, which
claims benefit of U.S. Provisional Patent Application No.
61/510,422, filed Jul. 21, 2011, which applications are
incorporated herein by reference in their entirety.
BACKGROUND OF THE INVENTION
[0003] A variety of cardiac disorders have an underlying genetic
cause. For example, dilated cardiomyopathy (DCM) is a cardiac
disease characterized by ventricular dilatation and systolic
dysfunction. DCM is the most common cause of heart failure after
coronary artery disease and hypertension, as well as the leading
indication for heart transplantations. The cost for management of
DCM in the US alone has been estimated at between $4 and $10
billion. Another important condition for therapy is hypertrophic
cardiomyopathy (HCM), in which the sarcomeres replicate, causing
cardiomyocytes to increase in size. In addition, the normal
alignment of cardiomyocytes is disrupted, a phenomenon known as
myocardial disarray. HCM is most commonly due to a mutation in one
of nine sarcomeric genes.
[0004] Mutations in genes encoding sarcomeric, cytoskeletal,
mitochondrial, and nuclear membrane proteins, as well as proteins
involved in calcium metabolism, are associated with approximately a
third to half the cases of DCM. Cardiac troponin T (cTnT) is one of
the 3 subunits of the troponin complex (Troponin T, C, and I) that
regulate the sarcomeric thin filament activity and muscle
contraction in cardiomyocytes (CMs). cTnT is essential for
sarcomere assembly, contraction, and force production. Mutations in
the cardiac troponin T gene (TNNT2) often lead to DCM and are
frequently expressed as a malignant phenotype with sudden cardiac
death and heart failure at an early age. In vitro biochemical
studies have found that decreased Ca.sup.2+ sensitivity and/or
ATPase activity, which lead to impaired force production, may be
the underlying mechanisms for certain TNNT2-mutation induced
DCM.
[0005] Mouse models of TNNT2 mutations recapitulate the human DCM
phenotype and have provided extensive insight into the possible
mechanisms of the disease. However, several differences exist
between the mouse and human models. For example, mouse resting
heart rate is approximately 10-fold faster than human. The
electrical properties, ion channel contributions, and cardiac
development of mouse CMs are also different from those of human.
The lack of complex intracellular interactions within
cardiomyocytes for in vitro biochemical assays and species
differences for mouse models undercut the value of these
methodologies for understanding the cellular and physiological
processes of DCM as well as for drug screening.
[0006] In addition, cardiac tissues from DCM patients are difficult
to obtain and do not survive in long-term culture. Effective
cellular models for dilated cardiomyopathy and other genetic
cardiac conditions are of great interest for screening and
development of effective therapies.
[0007] Pharmaceutical drug discovery, a multi-billion dollar
industry, involves the identification and validation of therapeutic
targets, as well as the identification and optimization of lead
compounds. The explosion in numbers of potential new targets and
chemical entities resulting from genomics and combinatorial
chemistry approaches over the past few years has placed enormous
pressure on screening programs. The rewards for identification of a
useful drug are enormous, but the percentages of hits from any
screening program are generally very low. Desirable compound
screening methods solve this problem by both allowing for a high
throughput so that many individual compounds can be tested; and by
providing biologically relevant information so that there is a good
correlation between the information generated by the screening
assay and the pharmaceutical effectiveness of the compound.
[0008] Some of the more important features for pharmaceutical
effectiveness are specificity for the targeted cell or disease, a
lack of toxicity at relevant dosages, and specific activity of the
compound against its molecular target. The present invention
addresses this issue.
PUBLICATIONS
[0009] Methods to reprogram primate differentiated somatic cells to
a pluripotent state include differentiated somatic cell nuclear
transfer, differentiated somatic cell fusion with pluripotent stem
cells and direct reprogramming to produce induced pluripotent stem
cells (iPS cells) (Takahashi K, et al. (2007) Cell 131:861-872;
Park I H, et al. (2008) Nature 451:141-146; Yu J, et al. (2007)
Science 318:1917-1920; Kim D, et al. (2009) Cell Stem Cell
4:472-476; Soldner F, et al. (2009) Cell. 136:964-977; Huangfu D,
et al. (2008) Nature Biotechnology 26:1269-1275; Li W, et al.
(2009) Cell Stem Cell 4:16-19).
[0010] Additional publications of interest include Stadtfeld et al.
Science 322, 945-949 (2008); Okita et al. Science 322, 949-953
(2008); Kaji et al. Nature 458, 771-775 (2009); Soldner et al. Cell
136, 964-977 (2009); Woltjen et al. Nature 458, 766-770 (2009); Yu
et al. Science (2009).
SUMMARY OF THE INVENTION
[0011] Compositions and methods are provided for disease-relevant
screening of cardiomyocytes for therapeutic drugs and treatment
regimens, where the methods utilize in vitro cell cultures or
animal models derived therefrom. Diseases of particular interest
include dilated cardiomyopathy (DCM); hypertrophic cardiomyopathy
(HCM); anthracycline-induced cardiotoxicity; arrhythmogenic right
ventricular dysplasia (ARVD); left ventricular non-compaction
(LVNC); double inlet left ventricle (DILV); and long QT (Type-1)
syndrome (LQT-1), in which there is a genetic basis for the
disease. The methods utilize induced human pluripotent stem cells
(iPS cells), which may be obtained from patient or carrier cell
samples, e.g. adipocytes, fibroblasts, and the like.
[0012] In some embodiments of the invention, in vitro cell cultures
of disease-relevant cardiomyocytes are provided, where the
cardiomyocytes are differentiated from induced human pluripotent
stem cells (iPS cells) comprising at least one allele encoding a
mutation associated with a cardiac disease. Mutations of interest
include mutations in the genes: cardiac troponin T (TNNT2); myosin
heavy chain (MYH7); tropomyosin 1 (TPM1); myosin binding protein C
(MYBPC3); 5'-AMP-activated protein kinase subunit gamma-2 (PRKAG2);
troponin I type 3 (TNNI3); titin (TTN); myosin, light chain 2
(MYL2); actin, alpha cardiac muscle 1 (ACTC1); potassium
voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1);
plakophilin 2 (PKP2); and cardiac LIM protein (CSRP3). Specific
mutations of interest include, without limitation, MYH7 R663H
mutation; TNNT2 R173W; PKP2 2013delC mutation; PKP2 Q617X mutation;
and KCNQ1 G269S missense mutation.
[0013] In some embodiments a panel of such cardiomyocytes are
provided, where the panel includes two or more different
disease-relevant cardiomyocytes. In some embodiments a panel of
such cardiomyocytes are provided, where the cardiomyocytes are
subjected to a plurality of candidate agents, or a plurality of
doses of a candidate agent. Candidate agents include small
molecules, i.e. drugs, genetic constructs that increase or decrease
expression of an RNA of interest, electrical changes, and the like.
In some embodiments the disease-relevant cardiomyocytes are
introduced or induced to differentiate from iPS cells in an in vivo
environment, for example as an explant in an animal model. In some
embodiments a panel refers to a system or method utilizing
patient-specific cardiomyocytes from two or more distinct cardiac
conditions, and may be three or more, four or more, five or more,
six or more, seven or more distinct conditions, where the
conditions are selected from: dilated cardiomyopathy (DCM);
hypertrophic cardiomyopathy (HCM); anthracycline-induced
cardiotoxicity; arrhythmogenic right ventricular dysplasia (ARVD);
left ventricular non-compaction (LVNC); double inlet left ventricle
(DILV); and long QT (Type-1) syndrome (LQT-1).
[0014] In some embodiments of the invention, methods are provided
for determining the activity of a candidate agent on a
disease-relevant cardiomyocyte, the method comprising contacting
the candidate agent with one or a panel of cardiomyocytes
differentiated from induced human pluripotent stem cells (iPS
cells) comprising at least one allele encoding a mutation
associated with a cardiac disease; and determining the effect of
the agent on morphologic, genetic or functional parameters,
including without limitation calcium transient amplitude,
intracellular Ca.sup.2+ level, cell size contractile force
production, beating rates, sarcomeric .alpha.-actinin distribution,
and gene expression profiling. Methods of analysis at the single
cell level are of particular interest, e.g. atomic force
microscopy, microelectrode array recordings, patch clamping, single
cell PCR, calcium imaging, and the like.
[0015] Where the disease is DCM, the cardiomyocytes may be
stimulated with positive inotropic stress, such as a
.beta.-adrenergic agonist before, during or after contacting with
the candidate agent. In some embodiments the .beta.-adrenergic
agonist is norepinephrine. It is shown herein that DMC
cardiomyocytes have an initially positive chronotropic effect in
response to positive inotropic stress, that later becomes negative
with characteristics of failure such as reduced beating rates,
compromised contraction, and significantly more cells with abnormal
sarcomeric .alpha.-actinin distribution. .beta.-adrenergic blocker
treatment and over-expression of sarcoplasmic reticulum Ca.sup.2+
ATPase (Serca2a) improve the function. DCM cardiomyocytes may also
be tested with genetic agents in the pathways including factors
promoting cardiogenesis, integrin and cytoskeletal signaling, and
ubiquitination pathway, for example as shown in Table 8. Compared
to the control healthy individuals in the same family cohort, DCM
cardiomyocytes exhibit decreased calcium transient amplitude,
decreased contractility, and abnormal sarcomeric .alpha.-actinin
distribution.
[0016] Where the disease is HCM the cardiomyocytes may be
stimulated with positive inotropic stress, such as a
.beta.-adrenergic agonist before, during or after contacting with
the candidate agent. Under such conditions, HCM cardiomyocytes
display higher hypertrophic responses, which can be reversed by a
.beta.-adrenergic blocker. Compared to healthy individuals, HCM
cardiomyocytes exhibit increased cell size and up-regulation of HCM
related genes, and more irregularity in contractions characterized
by immature beats, including a higher frequency of abnormal
Ca.sup.2+ transients, characterized by secondary immature
transients. These cardiomyocytes have increased intracullar
Ca.sup.2+ levels, and in some embodiments candidate agents that
target calcineurin or other targets associated with calcium
affinity.
[0017] Also provided are pluripotent stem cell populations
comprising at least one allele encoding a mutation associated with
a cardiac disease. Mutations of interest include mutations in the
genes: cardiac troponin T (TNNT2); myosin heavy chain (MYH7);
tropomyosin 1 (TPM1); myosin binding protein C (MYBPC3);
5'-AMP-activated protein kinase subunit gamma-2 (PRKAG2); troponin
I type 3 (TNNI3); titin (TTN); myosin, light chain 2 (MYL2); actin,
alpha cardiac muscle 1 (ACTC1); potassium voltage-gated channel,
KQT-like subfamily, member 1 (KCNQ1); plakophilin 2 (PKP2); and
cardiac LIM protein (CSRP3). Specific mutations of interest
include, without limitation, MYH7 R663H mutation; TNNT2 R173W; PKP2
2013delC mutation; PKP2 Q617X mutation; and KCNQ1 G269S missense
mutation. The pluripotent stem cell populations may be provided as
a cell culture, optionally a feeder-layer free cell culture.
Various somatic cells find use as a source of iPS cells; of
particular interest are adipose-derived stem cells, fibroblasts,
and the like. The pluripotent cells and cardiomyocytes derived
therefrom may be used for transplantation, for experimental
evaluation, as a source of lineage and cell specific products, and
the like. These and other objects, advantages, and features of the
invention will become apparent to those persons skilled in the art
upon reading the details of the subject methods and compositions as
more fully described below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The invention is best understood from the following detailed
description when read in conjunction with the accompanying
drawings. The patent or application file contains at least one
drawing executed in color. Copies of this patent or patent
application publication with color drawing(s) will be provided by
the Office upon request and payment of the necessary fee. It is
emphasized that, according to common practice, the various features
of the drawings are not to-scale. On the contrary, the dimensions
of the various features are arbitrarily expanded or reduced for
clarity. Included in the drawings are the following figures.
[0019] FIG. 1. Generation of patient-specific DCM iPSCs. (a)
Schematic pedigree of the seven member DCM family recruited in this
study. Filled squares (male) and circles (female) represent
individuals carrying the specific TNNT2 R173W mutation on
chromosome 1 in one of the two alleles. (b) The R173W point
mutation was confirmed to be present on exon 12 of the TNNT2 gene
in the DCM patients by PCR and DNA sequencing. CON, control. (c) A
representative image of the patient-derived skin fibroblasts
expanded from the skin biopsies. Representative images of an (d)
ESC-like and (e) TRA-1-60 positive colony derived from
reprogramming the patient-derived skin fibroblasts with Yamanaka
factors. (f) Immunofluorescence and alkaline phosphatase staining
of the patient skin fibroblasts-derived iPSCs. (g) Quantitative
bisulphite pyrosequencing analysis of the methylation status at the
promoter regions of Oct4 and Nanog in the patient-specific iPSCs.
Both the Nanog and Oct4 promoter regions were highly demethylated
in the patient-specific iPSCs. (h) Teratomas derived from the
patient-specific iPSCs injected into the kidney capsule of
immunodeficient mice showing tissues of all three embryonic germ
layers. Bars, 200 .mu.m.
[0020] FIG. 2. DCM iPSC-CMs exhibited a significant higher number
of cells with abnormal sarcomeric .alpha.-actinin distribution and
early failure after NE treatment. (a) Immunostaining of sarcomeric
.alpha.-actinin and cTnT at day 30 post differentiation. Single DCM
iPSC-CMs exhibited punctate sarcomeric .alpha.-actinin distribution
pattern suggesting a disorganized myofilament structure. Enlarged
views of the boxed areas of the merged micrographs showing detailed
.alpha.-actinin and cTnT staining pattern in the cells. Bars, 20
.mu.m. (b) Compared to control iPSC-CMs (n=368), a significant
higher percentage of DCM iPSC-CMs (n=391) showed punctate
sarcomeric .alpha.-actinin staining pattern in greater than one
fourth of the total cellular area (**p=0.008). (c) No significant
difference was observed in cell size between control (n=36) and DCM
iPSC-CMs (n=39). (d) A representative MEA assay tracking
contraction properties of both control (n=14) and DCM (n=14)
beating EBs overtime with or without NE treatment. EBs were seeded
in a dual chamber MEA probe with one side treated with NE and the
other without. Electrical signals were recorded simultaneously
during the experiments. Beating frequencies were normalized to
those of EBs without NE treatment. (e) Normalized beating
frequencies of CM clusters (n=10) over time after NE treatment by
video imaging. (f) Representative images of sarcomeric
.alpha.-actinin immunostaining on single control and DCM iPSC-CMs
after 7 days of NE treatment. Compared to the controls, long term
NE treatment significantly aggravated sarcomeric organization of
DCM cells. Bar, 20 .mu.m. (g) Percentage of CMs with disorganized
sarcomeric staining pattern with (control, n=210; DCM, n=255) or
without (control, n=261; DCM, n=277) NE treatment. NE treatment
markedly increased the number of disorganized CMs in DCM group
(**p<0.001), and had a less significant effect on control
iPSC-CMs (*p=0.05). (h) Tracking morphological and contractility
changes of iPSC-CMs overtime after NE treatment. Bar, 200 .mu.m.
Data are presented as mean.+-.s.e.m.
[0021] FIG. 3. DCM iPSC-CMs exhibited smaller [Ca.sup.2+].sub.i
transients. (a) Representative line-scan images and (b) spontaneous
calcium transients in CON (left) and DCM iPSC-CMs (right). (c)
Frequency of spontaneous calcium transients in control and DCM
iPSC-CMs. (d) Integration of [Ca.sup.2+].sub.i transients in
control and DCM iPSC-CMs showed less Ca.sup.2+ released in each
transient in DCM relative to control cells (control, n=87 cells;
DCM, n=40, **P=0.002). There were no significant differences in the
(e) irregularity of timing (standard deviation/mean) or (f)
amplitude of the spontaneous calcium transients between CON and DCM
cells.
[0022] FIG. 4. Over-expression of Serca2a restored contractility of
DCM iPSC-CMs. (a), Western blotting of Serca2a expression after
adenoviral transduction of DCM iPSC-CMs. Serca2a protein level was
upregulated in cells transduced with Ad.Serca2a but not in cells
transduced with Ad.GFP. (b) A representative image showing the AFM
cantilever approaching GFP positive single beating CMs. Bar, 50
.mu.m. (c) Histograms of contraction forces of all the single
iPSC-CMs measured by AFM over 100-400 beats. Over-expression of
Serca2a significantly restored the contraction force of DCM
iPSC-CMs to a level close to that of the controls. (d) Dot plots of
mean contraction force of single CMs measured by AFM. One-way ANOVA
analysis indicated that there was significant difference among the
mean of all the groups (**p=0.002). Tukey's Multiple Comparison
Test indicated that both control iPSC-CMs (n=13) (P=0.001) and
Ad.Serca2a (n=12) (P=0.005) transduced DCM iPSC-CMs exhibited
significantly stronger contraction force than that transduced by
Ad.GFP (n=17). Ad.Serca2a transduced DCM iPSC-CMs showed comparable
contraction force to that of the control iPSC-CMs (p=0.578). (e)
Representative spontaneous calcium transients in single DCM
iPSC-CMs transduced with Ad.GFP and Ad.Serca2a, respectively. (f)
DCM iPSC-CMs transduced with Ad.Serca2a (n=22) exhibited increased
global calcium transients compared to cells transduced with Ad.GFP
(n=14). (*p=0.04) (two-tailed Student's t-test). (g) Percentage of
CMs with disorganized sarcomeric staining pattern in DCM iPSC-CMs
with Ad.Serca2a (n=40) or Ad.GFP (n=40) over-expression. No
significant difference was observed between the two groups
(two-tailed Student's t-test). Data are presented as
mean.+-.s.e.m.
[0023] FIG. 5. R173W mutation in the iPSCs derived from DCM
patients in the family. Genomic PCR of the locus of TNNT2 and DNA
sequencing indicate that iPSCs from all DCM patients carried the
R173W (C to T) mutation.
[0024] FIG. 6. Comparison of the global mRNA expression patterns of
human ESCs (H7), skin fibroblasts, and patient-specific iPSCs by
microarray. Both Pearson correlation and scatter plots indicate
that the global gene expression pattern of patient-specific iPSCs
was highly similar to that of human ESCs.
[0025] FIG. 7. Patient-specific iPSCs maintained normal karyotype
after extended culture. Representative images from two DCM iPSC
lines were shown after culturing for 20 passages.
[0026] FIG. 8. Quantitative-PCR of relative expression levels of
total versus endogenous Yamanaka reprogramming factors. By
comparing the total and endogenous gene expression level of each
reprogramming factor, exogenous transgenes Oct4, Sox2, Klf4, and
c-MYC were silenced in most of the established patient-specific
iPSCs. Endogenous Nanog expression was up-regulated in all the
patient-specific iPSCs, indicating a pluripotency state of each
cell line. Note that the Nanog expression levels were normalized to
that of the H7 human ESCs (not shown). Primer information used for
quantitative PCR are listed in Supplementary Table 6.
[0027] FIG. 9. Patient-specific iPSCs can differentiate into cells
from the 3 germ layers in vitro. Different cell types, such as
neurons, endothelial cells, red blood cells, as well as cells
expressing mesoderm marker smooth muscle actin (SMA), endoderm
marker .alpha.-fetoprotein (AFP), and ectoderm marker (Tuj-1) were
detected from spontaneous differentiation of all the
patient-specific iPSCs. Bars, 100 .mu.m.
[0028] FIG. 10. Relative cardiac differentiation efficiency of the
patient-specific iPSCs. The cardiac differentiation efficiency is
represented as percentage of beating EBs (n=3 for each line, data
are presented as mean.+-.s.e.m).
[0029] FIG. 11. (a) and (b) FACS analysis of percentage of cTnT
positive CMs within beating EBs derived from control and DCM iPSCs.
.about.50-60% cells in beating EBs were cTnT positive
cardiomyocytes.
[0030] FIG. 12. Allele-specific PCR of wild type (Wt) and mutant
(R173W) TNNT2 expression in DCM and control iPSC-CMs. Patient IIa,
IIb, and IIIa were confirmed to express the mutant TNNT2 in their
respective iPSC-derived CMs. The primers used for allelic PCR are
listed in Supplementary Table 6.
[0031] FIG. 13. Multi-electrode arrays (MEA) examining
electrophysiologic properties of iPSC-derived beating EBs. (a) The
MEA probe and a representative image of 4 beating EBs seeded. (b)
The electrical signals recorded by MEA reflecting field potentials
of the 4 beating EBs shown in (a). (c) Extracted MEA field
potential graphs showing field potential duration (FPD), maximum
positive amplitude (MPA), maximum negative amplitude (MNA), and
interspike interval (ISI).
[0032] FIG. 14. Single cell PCR analyzing gene expression levels in
24 control and 24 DCM iPSC-CMs at day 30 post differentiation. Gene
expression of (a) cardiac specific transcription factors, (b)
calcium handling related proteins, (c) ion channels, (d) sarcomeric
proteins, and (e) skeletal muscle specific proteins relative to
gene expression level of .alpha.-tubulin were analyzed. No
significant differences were observed between control and DCM CMs.
Data are presented as mean.+-.s.e.m. Statistical difference was
tested using two tailed Student's T-test.
[0033] FIG. 15. iPSC-CMs expressed cardiac-specific proteins. Both
control and DCM iPSC-CMs expressed cardiac specific proteins
sarcomeric .alpha.-actinin, cTnT, connexin43, and MLC2a. Arrows
indicate positive connexin43 staining at the cell-cell contact.
Bars, 20 .mu.m.
[0034] FIG. 16. Enlarged view of immunostaining of sarcomeric
.alpha.-actinin and cTnT in the single CMs shown in FIG. 2a. Bar,
20 .mu.m.
[0035] FIG. 17. Double immunostaining of sarcomeric .alpha.-actinin
and cTnT in the single CMs shown in FIG. 2f. Bar, 20 .mu.m.
[0036] FIG. 18. Enlarged view of merged graph of each cell shown in
FIG. 2f. Note that after NE treatment, some single DCM iPSC CMs
showed complete degeneration of myofilaments, which was not
observed in control CMs. Bar, 20 .mu.m.
[0037] FIG. 19. (a-c) Real time PCR on single DCM iPSC-CMs versus
control iPSC-CMs showed gene expression changes after one week of
NE treatment. Control and DCM iPSC-CMs were seeded on culture
dishes at day 19 post differentiation and were treated with or
without 10 .mu.M NE 48 h later for 7 days. Single CMs from control
(treated with NE, n=8; without NE, n=8) and DCM (treated with NE,
n=8; without NE, n=8) iPSCs were picked and PCR were performed as
described in the Method section. Net threshold cycle (CT) values
between cells treated with NE and without NE were first calculated.
Data were then presented as the net CT values of the DCM group
relative to the net ct values of control group. Genes were grouped
as upregulated (>1 cycle difference in CT), downregulated (>1
cycle difference in CT), and no expression changes (<1 cycle
difference in CT) after NE treatment.
[0038] FIG. 20. Electrophysiological features of iPSC-CMs measured
by patch clamping. (a) Three types of spontaneous AP were observed
in both control and DCM iPSC-CMs (left, ventricular-like; center,
atrial-like; right, nodal-like). An estimated 70-80% cells were
ventricular-like CMs, whereas the others were atrial- and/or
nodal-like cells. There is no significant difference in cardiac
cell fate between control and DCM iPSCs (data not shown). (b)
Spontaneous AP in control and DCM ventricular myocytes using
current-clamp recording. DCM ventricular cells had slightly shorter
APs compared to control cells (P=0.112) (c). There was no
significant difference in the frequency (d), the peak amplitude of
AP (e), or in the resting membrane potential (f) between control
and DCM cells at the time of measurements (day 19-day 25 post
differentiation) (control, n=18; DCM, n=17). Statistical difference
was tested using the two tailed Student's T-test.
[0039] FIG. 21. Atomic force microscopy (AFM) measurement of
contraction force of iPSC-CMs. (a) Schematic of the process of
force measurement by AFM at a single cardiomyocyte level. (b) A
representative image showing AFM cantilever probing a single
cardiomyocyte. Bar, 20 .mu.m. (c) A representative graph showing
the signals acquired by AFM and the parameters examined (force,
frequency, and beat duration).
[0040] FIG. 22. Beat frequency and duration of single iPSC-CMs
measured by AFM. (a) Dot plots of mean beat frequency measured by
AFM. No significant difference in beat frequency and rhythm was
observed between control iPSC-CMs (n=13), Ad.Serca2a (n=12) and
Ad.GFP (n=17) transduced DCM iPSC-CMs. (b) Dot plots of mean beat
duration measured by AFM. Over-expression of Serca2a significantly
shortened the beat duration (*p=0.029). Statistical difference was
tested using one-way ANOVA followed by Tukey's Multiple Comparison
Test. (c) Histograms of beat frequency and (d) beat duration of all
the single iPSC-CMs measured by AFM over 100-400 beats.
[0041] FIG. 23. Dot plots of relative cell size versus contraction
force for each single cell measured by AFM. There is no significant
linear relationship between cell size and contraction force in (a)
control (R.sup.2=0.006), (b) DCM/DCM-Ad.GFP (R.sup.2=0.105), and
(c) DCM-Ad.Serca2a (R.sup.2=0.061) groups.
[0042] FIG. 24. Normalized percentage of beating foci in culture
dish over time after Serca2a and GFP over-expression. Data
represent averages of three independent replicates of experiments
(mean.+-.s.e.m.).
[0043] FIG. 25. Ca.sup.2+ imaging of iPSC-CMs transduced with
Ad.Serca2a or Ad.GFP adenoviruses with red fluorescent Ca.sup.2+
indicator Rhod-2 AM. (a) Merged confocal images showing the GFP
positive CMs uptook the Rhod-2 dye. (b) The same cell in (a) was
scanned with the arrow line indicated in the picture. (c) The line
scan images recorded for the particular CM shown in (a) and (b).
Bar, 20 .mu.m.
[0044] FIG. 26. Contractility of control iPSC-CMs transduced with
Ad.Serca2a or Ad.GFP as measured by AFM. (a) Dot plots of
contraction force, (b) beat frequency, and (c) beat duration of
control iPSC-CMs transduced with Ad.Serca2a (n=10) or Ad.GFP
(n=10). No significant statistical differences were observed
between the mean of each group. Statistical difference was tested
using two tailed Student's T-test. (d) Histograms of contraction
force, (e) beat frequency, and (f) beat duration of all the single
control iPSC-CMs measured by AFM over 100-400 beats.
[0045] FIG. 27. Gene expression profiling of DCM iPSC-CMs with
Serca2a over-expression identified enriched pathways that may
function in rescuing the DCM phenotype. (a) Heatmap of the 191
genes with greater than 1.5-fold difference in expression in
biological replicates of control iPSC-CMs and Serca2a-treated DCM
iPSC-CMs compared with DCM iPSC-CMs without Serca2a treatment. (b)
Heatmap of enriched pathways that may be involved in rescuing the
DCM phenotype by Serca2a over-expression.
[0046] FIG. 28. Metoprolol treatment improved sarcomeric
organization of DCM iPSC-CMs and alleviate the aggravation effect
of NE treatment. (a) Ten .mu.M metoprolol treatment increased the
number of DCM iPSC-CMs with intact sarcomeric integrity (untreated,
n=100; treated, n=86, *p=0.023). (b) Metoprolol treatment prevented
the aggravation of DCM iPSC-CMs induced by NE treatment. Both 1
.mu.M (n=107, **p=0.008) and 10 .mu.M (n=101, **p=0.001) metoprolol
significantly decreased the number of disorganized cells compared
to those without metoprolol treatment (n=108). (c) Ten .mu.M
metoprolol treatment had no significant effect on the sarcomeric
integrity of control iPSC-CMs (untreated, n=88; treated, n=75).
Data are presented as mean.+-.s.e.m. Statistical difference was
tested using the two tailed Student's T-test.
[0047] FIG. 29. Similar functional properties of DCM iPSC-ECs and
control iPSC-ECs. (a) FACS analyses indicated the efficiency of
differentiation of both DCM and control iPSCs to CD31.sup.+ ECs
were similar. (b) The FACS isolated CD31.sup.+ cells from
differentiated DCM and control iPSCs expressed both the endothelial
cell markers CD31 and CD144. (c) Both DCM and control iPSC-derived
ECs exhibited uptake capability of low density lipoprotein (LDL)
(red fluorescence). (d) Both control and DCM iPSC-derived ECs were
able to form web-like tubules on Matrigel surface. Bars, 100
.mu.m.
[0048] FIG. 30. Schematic of potential mechanisms by Serca2a gene
therapy in DCM iPSC-CM. The mutation in cardiac troponin T
negatively affects contractility, sarcomere formation, and calcium
signaling, which causes changes in calcium-related genes such as
calsequestrin, NFAT, and TRIC channels. However, electrical
excitation was normal in the TNNT2 R173W DCM iPSC-CMs. Delivery of
Serca2a, the SR/ER membrane calcium pump, restored the level of
calcium handling molecules, reversed the compromised calcium
transients and contractility, and thereby improved the overall DCM
iPSC-CM function. cTnT, cardiac troponin T; LTC, L-type calcium
channel; RyR, ryanodine receptor calcium release channel; CSQ,
calsequestrin; PM, plasma membrane.
[0049] FIG. 31. Generation and characterization of patient-specific
HCM iPSC-CMs. (A) Representative long-axis MRI images of the
proband and a control matched family member at end systole and end
diastole demonstrating asymmetric hypertrophy of the inferior wall.
(B) Confirmation of the Arg663His missense mutation on exon 18 of
the MYH7 gene in HCM patients (II-1, III-1, III-2, III-3, and
III-8) by PCR and sequence analysis. (C) Schematic pedigree of the
proband carrying the Arg663His mutation in MYH7 recruited for this
study (II-1) as well as her husband (II-2), and eight children
(III-1 through III-8). Circles represent female family members and
squares represent males. Solid symbols indicate clinical
presentation of the HCM phenotype, whereas open symbols represent
absence of presentation. "+" and "-" signs underneath family
members indicate presence and absence of the Arg663His mutation
respectively. Two individuals (III-3 and III-8) were found to carry
the Arg663His mutation but had yet to present the HCM phenotype due
to young age. (D) Representative immunostaining for cardiac
troponin T and F-actin demonstrating increased cellular size and
multinucleation in HCM iPSC-CMs as compared to control iPSC-CMs.
(E) Quantification of cell size for 4 control iPSCCM lines (II-2,
III-4, III-6, III-7) (n=55 per patient line) and 4 HCM iPSC-CM
lines (II-1, III-1, III-2, III-8) (n=59 per patient line) 40 days
after induction of cardiac differentiation. (F) Quantification of
multi-nucleation in control (n=55, 4 patient lines) and HCM
iPSC-CMs (n=59, 4 patient lines). (G) Representative
immunofluorescence staining reveals elevated ANF expression in HCM
iPSC-CMs as compared to controls. (H) Changes in ANF gene
expression as measured by single cell quantitative PCR in control
and HCM iPSC-CMs at days 20, 30, and 40 following induction of
cardiac differentiation (n=32 per time point, 5 patient lines). (I)
Quantification of MYH7/MYH6 expression ratio in HCM iPSC-CMs and
controls (n=32 per time point, 5 patient lines). (J) Representative
immunofluorescence staining images revealing nuclear translocation
of NFATC4 in HCM iPSC-CMs. (K) Percentage of cardiomyocytes
exhibiting positive NFATC4 staining in control (n=187, 5 patient
lines) and HCM iPSC-CMs (n=169, 5 patient lines). (L)
Quantification of cell size in control and HCM iPSC-CMs following
treatment with calcineurin inhibitors Cs-A and FK506 for 5
continuous days (n=50, 5 patient lines per group). (M) Heat map
representations of gene expression in single control and HCM
iPSC-CMs for genes associated with cardiac hypertrophy at days 20,
30, and 40 following induction of cardiac differentiation. *
denotes P<0.05 HCM vs control, ** denotes P<0.0001 HCM vs
control.
[0050] FIG. 32. Assessment of arrhythmia and irregular Ca.sup.2+
regulation in HCM iPSC-CMs. (A) Electrophysiological measurements
of spontaneous action potentials in control and HCM iPSCCMs
measured by patch clamp in current-clamp mode. Boxes indicate
underlined portions of HCM iPSC-CM waveforms at expanded timescales
demonstrating DAD-like arrhythmias. (B) Quantification of DAD
occurrence in control (n=144, 5 patient lines) and HCM iPSC-CMs
(n=131, 5 patient lines). DAD rate is defined as total DADs/total
beats. (C) Quantification of percentage of control (n=144, 5
patient lines) and HCM iPSC-CMs (n=131, 5 patient lines) exhibiting
putative DADs. (D) Representative line-scan images and spontaneous
Ca.sup.2+ transients in control and HCM iPSC-CMs. Red arrows
indicate tachyarrhythmia-like waveforms observed in HCM cells but
not control. (E) Quantification of percentages for control and HCM
iPSC-CMs exhibiting irregular Ca.sup.2+ transients at days 20, 30,
and 40 following induction of cardiac differentiation (n=50, 5
patient lines per timepoint). (F) Representative line-scan images
and spontaneous Ca.sup.2+ transients for H9 hESC-CMs and hESC-CMs
stably transduced with lentivirus driving expression of wild type
MYH7 or mutant MYH7 carrying the Arg663His mutation. Red arrowheads
indicate irregular Ca.sup.2+ waveforms. (G) Quantification of cells
exhibiting irregular Ca.sup.2+ transients in WA09 hESC-CMs,
hESC-CMs overexpressing wild-type MYH7, and hESCCMs overexpressing
MYH7 carrying the Arg663His mutation (n=40, 5 patient lines per
group). (H) Spontaneous action potentials recorded in current-clamp
mode for hESC-CMs, hESC-CMs overexpressing wild type MYH7, and
hESC-CMs overexpressing MYH7 carrying the Arg663His mutation. Red
arrowheads indicate DAD-like waveforms. (I) Quantification of cells
exhibiting DAD-like waveforms in hESC-CMs, hESC-CMs stably
transduced with lentivirus driving expression of wild type MYH7 or
mutant MYH7 carrying the Arg663His mutation (n=20, 5 patient lines
per group). (J) Quantification of baseline Fluo-4 Ca.sup.2+ dye
intensities for control (n=122, 4 patient lines) and HCM iPSC-CMs
(n=105, 4 patient lines). (K) Representative Ca.sup.2+ transients
of control and HCM iPSC-CMs using the Indo-1 ratiometric Ca.sup.2+
dye. (L) Quantification of resting Ca.sup.2+ levels by measurement
of Indo-1 ratio in control (n=17, 4 patient lines) and HCM iPSC-CMs
(n=26, 4 patient lines). (M) Representative Ca.sup.2+ transient
traces from control and HCM iPSC-CMs followed by caffeine exposure.
(N) Mean peak amplitudes of .DELTA.F/F0 ratios after caffeine
administration representing release of SR Ca.sup.2+load for control
(n=23, 3 lines) and HCM iPSC-CMs (n=35, 3 lines). * denotes
P<0.05 HCM vs control, ** denotes P<0.01 HCM vs control.
[0051] FIG. 33. Exacerbation of the HCM phenotype by positive
inotropic stress. (A) Inotropic stimulation of control (n=50, 5
patient lines) and HCM iPSC-CMs (n=50, 5 patient lines) by the
.beta.-agonist isoproterenol accelerated presentation of cellular
hypertrophy in HCM iPSC-CMs as compared to control counterparts.
Co-administration of the .beta.-blocker propranolol prevented 20
catecholamine-induced hypertrophy in HCM iPSC-CMs (B)
Representative Ca.sup.2+ line scans and waveforms in control and
HCM iPSC-CMs following positive inotropic stimulation by
isoproterenol. Black arrowheads indicate abnormal Ca.sup.2+
waveforms. (C) Quantification of control (n=50, 5 patient lines)
and HCM iPSC-CMs (n=50, 5 patient lines) exhibiting irregular
Ca.sup.2+ transients in response to treatment by isoproterenol and
co-administration of propranolol. (D) Electrophysiological
measurement of spontaneous action potentials and arrhythmia in
control and HCM iPSC-CMs at baseline, followed by positive
inotropic stimulation by isoproterenol. Red arrows indicate
DAD-like waveforms. (E) Quantification of DAD rate in control and
HCM iPSC-CMs following isoproterenol administration (total
DADs/total beats). * denotes P<0.05 HCM vs control, ** denotes
P<0.001 HCM vs control, ## denotes P<0.01 iso+pro vs iso.
[0052] FIG. 34. Treatment of HCM iPSC-CMs by verapamil
significantly mitigates development of the HCM phenotype. (A)
Representative immunostaining images of HCM iPSC-CMs treated with 0
nM, 50 nM, and 100 nM of the L-type Ca.sup.2+ channel blocker
verapamil for 5 continuous days beginning 25 days after induction
of cardiac differentiation. Quantification of relative cell sizes
for HCM iPSC-CMs treated with verapamil (n=50, 5 patient lines per
treatment group). (B) Representative Ca.sup.2+ line scan images and
waveforms of HCM iPSC-CMs treated with 0 nM, 50 nM, and 100 nM of
verapamil for 5 continuous days. Quantification of percentages of
HCM iPSC-CMs found to exhibit irregular Ca.sup.2+ transients
following treatment with verapamil (n=40, 5 patient lines per
treatment group). (C) Representative electrophysiological
recordings of spontaneous action potentials in HCM iPSC-CMs treated
with 0 nM, 50 nM, and 100 nM of verapamil for 5 continuous days.
Quantification of DAD frequencies in HCM iPSC-CMs 21 following
treatment with verapamil (n=25, 5 patient lines per treatment
group). (D) Schematic for development of the HCM phenotype as
caused by HCM mutations in MYH7. Red boxes indicate potential
methods to mitigate development of the disease. * denotes P<0.01
untreated vs 50 nM verapamil vs 100 nM verapamil.
[0053] The invention is best understood from the following detailed
description when read in conjunction with the accompanying
drawings.
DETAILED DESCRIPTION OF THE INVENTION
[0054] Before the present compositions and methods are described,
it is to be understood that this invention is not limited to
particular compositions and methods described, as such may, of
course, vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular embodiments
only, and is not intended to be limiting, since the scope of the
present invention will be limited only by the appended claims.
[0055] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0056] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, some potential and preferred methods and materials are
now described. All publications mentioned herein are incorporated
herein by reference to disclose and describe the methods and/or
materials in connection with which the publications are cited. It
is understood that the present disclosure supersedes any disclosure
of an incorporated publication to the extent there is a
contradiction.
[0057] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a reprogramming factor polypeptide" includes
a plurality of such polypeptides, and reference to "the induced
pluripotent stem cells" includes reference to one or more induced
pluripotent stem cells and equivalents thereof known to those
skilled in the art, and so forth.
[0058] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
DEFINITIONS
[0059] Dilated cardiomyopathy (DCM) is one of the cardiomyopathies,
a group of diseases that primarily affect the myocardium. In DCM a
portion of the myocardium is dilated, often without any obvious
cause. Left or right ventricular systolic pump function of the
heart is impaired, leading to progressive cardiac enlargement and
hypertrophy, a process called remodeling. Although in many cases no
etiology is apparent, dilated cardiomyopathy can result from a
variety of toxic, metabolic, or infectious agents. About 25-35% of
patients have familial forms of the disease, with most mutations
affecting genes encoding cytoskeletal proteins, while some affect
other proteins involved in contraction. The disease is genetically
heterogeneous, but the most common form of its transmission is an
autosomal dominant pattern. Cytoskeletal proteins involved in DCM
include cardiac troponin T (TNNT2), .alpha.-cardiac actin, desmin,
and the nuclear lamins A and C, and various other contractile
proteins.
[0060] Hypertrophic cardiomyopathy (HCM), is a condition in which
sarcomeres replicate causing heart muscle cells to increase in
size, which results in the thickening of the heart muscle. In
addition, the normal alignment of muscle cells is disrupted, a
phenomenon known as myocardial disarray. HCM also causes
disruptions of the electrical functions of the heart. HCM is most
commonly due to a mutation in one of 9 sarcomeric genes that
results in a mutated protein in the sarcomere. Myosin heavy chain
mutations are associated with development of familial hypertrophic
cardiomyopathy. Hypertrophic cardiomyopathy is usually inherited as
an autosomal dominant trait, which mutations reported in cardiac
troponin T (TNNT2); myosin heavy chain (MYH7); tropomyosin 1
(TPM1); myosin binding protein C (MYBPC3); 5'-AMP-activated protein
kinase subunit gamma-2 (PRKAG2); troponin I type 3 (TNNI3); titin
(TTN); myosin, light chain 2 (MYL2); actin, alpha cardiac muscle 1
(ACTC1); and cardiac LIM protein (CSRP3). An insertion/deletion
polymorphism in the gene encoding for angiotensin converting enzyme
(ACE) alters the clinical phenotype of the disease. The D/D
(deletion/deletion) genotype of ACE is associated with more marked
hypertrophy of the left ventricle and may be associated with higher
risk of adverse outcomes.
[0061] Anthracycline-induced cardiotoxicity (and resistance to
anthracycline-induced toxicity). Anthracyclines such as doxorubicin
are frontline chemotherapeutic agents that are used to treat
leukemias, Hodgkin's lymphoma, and solid tumors of the breast,
bladder, stomach, lung, ovaries, thyroid, and muscle, among other
organs. The primary side effect of anthracyclines is
cardiotoxicity, which results in severe heart failure for many of
the recipients receiving regimens utilizing this chemotherapeutic
agent.
[0062] Arrhythmogenic right ventricular dysplasia (ARVD). ARVD is
an autosomal dominant disease of cardiac desmosomes that results in
arrhythmia of the right ventricle and sudden cardiac death. It is
second only to hypertrophic cardiomyopathy as a leading cause for
sudden cardiac death in the young.
[0063] Left Ventricular Non-Compaction (LVNC, aka non-compaction
cardiomyopathy). LVNC is a hereditary cardiac disease which results
from impaired development of the myocardium (heart muscle) during
embryogenesis. Patients with mutations causing LVNC develop heart
failure and abnormal cardiac electrophysiology early in life.
[0064] Double Inlet Left Ventricle (DILV). DILV is a congenital
heart defect in which both the left and right atria feed into the
left ventricle. As a result, children born with this defect only
have one functional ventricular chamber, and trouble pumping
oxygenated blood into the general circulation.
[0065] Long QT (Type-1) Syndrome (LQT-1, KCNQ1 mutation). Long QT
syndrome (LQT) is a hereditary arrhythmic disease in which the QT
phase of the electrocardiogram is prolonged, resulting in increased
susceptibility for arrhythmia and sudden cardiac death. There are
13 known genes associated with LQT.
[0066] By "pluripotency" and pluripotent stem cells it is meant
that such cells have the ability to differentiate into all types of
cells in an organism. The term "induced pluripotent stem cell"
encompasses pluripotent cells, that, like embryonic stem (ES)
cells, can be cultured over a long period of time while maintaining
the ability to differentiate into all types of cells in an
organism, but that, unlike ES cells (which are derived from the
inner cell mass of blastocysts), are derived from differentiated
somatic cells, that is, cells that had a narrower, more defined
potential and that in the absence of experimental manipulation
could not give rise to all types of cells in the organism. iPS
cells have an hESC-like morphology, growing as flat colonies with
large nucleo-cytoplasmic ratios, defined borders and prominent
nuclei. In addition, iPS cells express one or more key pluripotency
markers known by one of ordinary skill in the art, including but
not limited to alkaline phosphatase, SSEA3, SSEA4, Sox2, Oct3/4,
Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, FoxD3, GDF3, Cyp26a1, TERT,
and zfp42. In addition, the iPS cells are capable of forming
teratomas. In addition, they are capable of forming or contributing
to ectoderm, mesoderm, or endoderm tissues in a living
organism.
[0067] As used herein, "reprogramming factors" refers to one or
more, i.e. a cocktail, of biologically active factors that act on a
cell to alter transcription, thereby reprogramming a cell to
multipotency or to pluripotency. Reprogramming factors may be
provided to the cells, e.g. cells from an individual with a family
history or genetic make-up of interest for heart disease such as
fibroblasts, adipocytes, etc.; individually or as a single
composition, that is, as a premixed composition, of reprogramming
factors. The factors may be provided at the same molar ratio or at
different molar ratios. The factors may be provided once or
multiple times in the course of culturing the cells of the subject
invention. In some embodiments the reprogramming factor is a
transcription factor, including without limitation, Oct3/4; Sox2;
Klf4; c-Myc; Nanog; and Lin-28.
[0068] Somatic cells are contacted with reprogramming factors, as
defined above, in a combination and quantity sufficient to
reprogram the cell to pluripotency. Reprogramming factors may be
provided to the somatic cells individually or as a single
composition, that is, as a premixed composition, of reprogramming
factors. In some embodiments the reprogramming factors are provided
as a plurality of coding sequences on a vector.
[0069] Genes may be introduced into the somatic cells or the iPS
cells derived therefrom for a variety of purposes, e.g. to replace
genes having a loss of function mutation, provide marker genes,
etc. Alternatively, vectors are introduced that express antisense
mRNA or ribozymes, thereby blocking expression of an undesired
gene. Other methods of gene therapy are the introduction of drug
resistance genes to enable normal progenitor cells to have an
advantage and be subject to selective pressure, for example the
multiple drug resistance gene (MDR), or anti-apoptosis genes, such
as bcl-2. Various techniques known in the art may be used to
introduce nucleic acids into the target cells, e.g.
electroporation, calcium precipitated DNA, fusion, transfection,
lipofection, infection and the like, as discussed above. The
particular manner in which the DNA is introduced is not critical to
the practice of the invention.
[0070] The iPS cells may also be differentiated into cardiac muscle
cells. Inhibition of bone morphogenetic protein (BMP) signaling may
result in the generation of cardiac muscle cells (or
cardiomyocytes), see, e.g., Yuasa et al., (2005), Nat. Biotechnol.,
23(5):607-11. Thus, in an exemplary embodiment, the induced cells
are cultured in the presence of noggin for from about two to about
six days, e.g., about 2, about 3, about 4, about 5, or about 6
days, prior to allowing formation of an embryoid body, and
culturing the embryoid body for from about 1 week to about 4 weeks,
e.g., about 1, about 2, about 3, or about 4 weeks.
[0071] Cardiomyocyte differentiation may be promoted by including
cardiotropic agents in the culture, such as activin A and/or bone
morphogenetic protein-4 (see the Examples herein, Xu et al. Regen
Med. 2011 January; 6(1):53-66; Mignone et al. Circ J. 2010
74(12):2517-26; Takei et al. Am J Physiol Heart Circ Physiol. 2009
296(6):H1793-803, each herein specifically incorporated by
reference). Examples of such protocols also include, for example,
addition of a Wnt agonist, such as Wnt 3A, optionally in the
presence of cytokines such as BMP4, VEGF and Activin A; followed by
culture in the presence of a Wnt antagonist, such a soluble
frizzled protein. However, any suitable method of inducing
cardiomyocyte differentiation may be used, for example, Cyclosporin
A described by Fujiwara et al. PLoS One. 2011 6(2):e16734; Dambrot
et al. Biochem J. 2011 434(1):25-35; equiaxial cyclic stretch,
angiotensin II, and phenylephrine (PE) described by Foldes et al. J
Mol Cell Cardiol. 2011 50(2):367-76; ascorbic acid,
dimethylsulfoxide and 5-aza-2'-deoxycytidine described by Wang et
al. Sci China Life Sci. 2010 53(5):581-9, endothelial cells
described by Chen et al. J Cell Biochem. 2010 111(1):29-39, and the
like, which are herein specifically incorporated by reference.
[0072] The cells are harvested at an appropriate stage of
development, which may be determined based on the expression of
markers and phenotypic characteristics of the desired cell type
e.g. at from about 1 to 4 weeks. Cultures may be empirically tested
by staining for the presence of the markers of interest, by
morphological determination, etc. The cells are optionally enriched
before or after the positive selection step by drug selection,
panning, density gradient centrifugation, etc. In another
embodiment, a negative selection is performed, where the selection
is based on expression of one or more of markers found on ES cells,
fibroblasts, epithelial cells, and the like. Selection may utilize
panning methods, magnetic particle selection, particle sorter
selection, and the like.
[0073] Cardiomyocytes.
[0074] Phenotypes of cardiomyocytes that arise during development
of the mammalian heart can be distinguished: primary
cardiomyocytes; nodal cardiomyocytes; conducting cardiomyocytes and
working cardiomyocytes. All cardiomyocytes have sarcomeres and a
sarcoplasmic reticulum (SR), are coupled by gap junctions, and
display automaticity. Cells of the primary heart tube are
characterized by high automaticity, low conduction velocity, low
contractility, and low SR activity. This phenotype largely persists
in nodal cells. In contrast, atrial and ventricular working
myocardial cells display virtually no automaticity, are well
coupled intercellularly, have well developed sarcomeres, and have a
high SR activity. Conducting cells from the atrioventricular
bundle, bundle branches and peripheral ventricular conduction
system have poorly developed sarcomeres, low SR activity, but are
well coupled and display high automaticity.
[0075] For .alpha.-Mhc, .beta.-Mhc and cardiac Troponin I and slow
skeletal Troponin I, developmental transitions have been observed
in differentiated ES cell cultures. Expression of Mlc2v and Anf is
often used to demarcate ventricular-like and atrial-like cells in
ES cell cultures, respectively, although in ESDCs, Anf expression
does not exclusively identify atrial cardiomyocytes and may be a
general marker of the working myocardial cells.
[0076] A "cardiomyocyte precursor" is defined as a cell that is
capable of giving rise to progeny that include cardiomyocytes.
[0077] In addition to various uses as an in vitro cultured cells,
the cardiomyocytes may be tested in a suitable animal model. At one
level, cells are assessed for their ability to survive and maintain
their phenotype in vivo. Cell compositions are administered to
immunodeficient animals (such as nude mice, or animals rendered
immunodeficient chemically or by irradiation). Tissues are
harvested after a period of regrowth, and assessed as to whether
the administered cells or progeny thereof are still present, and
may be phenotyped for response to a treatment of interest.
Suitability can also be determined in an animal model by assessing
the degree of cardiac recuperation that ensues from treatment with
the differentiating cells of the invention. A number of animal
models are available for such testing. For example, hearts can be
cryoinjured by placing a precooled aluminum rod in contact with the
surface of the anterior left ventricle wall (Murry et al., J. Clin.
Invest. 98:2209, 1996; Reinecke et al., Circulation 100:193, 1999;
U.S. Pat. No. 6,099,832). In larger animals, cryoinjury can be
inflicted by placing a 30-50 mm copper disk probe cooled in liquid
N.sub.2 on the anterior wall of the left ventricle for
approximately 20 min (Chiu et al., Ann. Thorac. Surg. 60:12, 1995).
Infarction can be induced by ligating the left main coronary artery
(Li et al., J. Clin. Invest. 100:1991, 1997). Injured sites are
treated with cell preparations of this invention, and the heart
tissue is examined by histology for the presence of the cells in
the damaged area. Cardiac function can be monitored by determining
such parameters as left ventricular end-diastolic pressure,
developed pressure, rate of pressure rise, rate of pressure decay,
etc.
[0078] The terms "treatment", "treating", "treat" and the like are
used herein to generally refer to obtaining a desired pharmacologic
and/or physiologic effect. The effect may be prophylactic in terms
of completely or partially preventing a disease or symptom thereof
and/or may be therapeutic in terms of a partial or complete
stabilization or cure for a disease and/or adverse effect
attributable to the disease. "Treatment" as used herein covers any
treatment of a disease in a mammal, particularly a human, and
includes: (a) preventing the disease or symptom from occurring in a
subject which may be predisposed to the disease or symptom but has
not yet been diagnosed as having it; (b) inhibiting the disease
symptom, i.e., arresting its development; or (c) relieving the
disease symptom, i.e., causing regression of the disease or
symptom.
[0079] The terms "individual," "subject," "host," and "patient,"
are used interchangeably herein and refer to any mammalian subject
for whom diagnosis, treatment, or therapy is desired, particularly
humans.
METHODS OF THE INVENTION
[0080] Methods are provided for the obtention and use of in vitro
cell cultures of disease-relevant cardiomyocytes, where the
cardiomyocytes are differentiated from induced human pluripotent
stem cells (iPS cells) comprising at least one allele encoding a
mutation associated with a cardiac disease, as described above.
Specific mutations of interest include, without limitation, MYH7
R663H mutation, TNNT2 R173W; PKP2 2013delC mutation; PKP2 Q617X
mutation; and KCNQ1 G269S missense mutation. In some embodiments a
panel of such cardiomyocytes are provided, where the panel includes
two or more different disease-relevant cardiomyocytes. In some
embodiments a panel of such cardiomyocytes are provided, where the
cardiomyocytes are subjected to a plurality of candidate agents, or
a plurality of doses of a candidate agent. Candidate agents include
small molecules, i.e. drugs, genetic constructs that increase or
decrease expression of an RNA of interest, electrical changes, and
the like.
[0081] Methods are provided for determining the activity of a
candidate agent on a disease-relevant cardiomyocyte, the method
comprising contacting the candidate agent with one or a panel of
cardiomyocytes differentiated from induced human pluripotent stem
cells (iPS cells) comprising at least one allele encoding a
mutation associated with a cardiac disease; and determining the
effect of the agent on morphologic, genetic or functional
parameters, including without limitation calcium transient
amplitude, intracellular Ca.sup.2+ level, cell size contractile
force production, beating rates, sarcomeric .alpha.-actinin
distribution, and gene expression profiling.
[0082] Where the disease is DCM, the cardiomyocytes may be
stimulated with positive inotropic stress, such as a
.beta.-adrenergic agonist before, during or after contacting with
the candidate agent. In some embodiments the .beta.-adrenergic
agonist is norepinephrine. It is shown herein that DMC
cardiomyocytes have an initially positive chronotropic effect in
response to positive inotropic stress, that later becomes negative
with characteristics of failure such as reduced beating rates,
compromised contraction, and significantly more cells with abnormal
sarcomeric .alpha.-actinin distribution. .beta.-adrenergic blocker
treatment and over-expression of sarcoplasmic reticulum Ca.sup.2+
ATPase (Serca2a) improve the function. DCM cardiomyocytes may also
be tested with genetic agents in the pathways including including
factors promoting cardiogenesis, integrin and cytoskeletal
signaling, and ubiquitination pathway, for example as shown in
Table 8. Compared to the control healthy individuals in the same
family cohort, DCM cardiomyocytes exhibit decreased calcium
transient amplitude, decreased contractility, and abnormal
sarcomeric .alpha.-actinin distribution.
[0083] Where the disease is HCM the cardiomyocytes may be
stimulated with positive inotropic stress, such as a
.beta.-adrenergic agonist before, during or after contacting with
the candidate agent. Under such conditions, HCM cardiomyocytes
display higher hypertrophic responses, which can be reversed by a
.beta.-adrenergic blocker. Compared to healthy individuals, HCM
cardiomyocytes exhibit increased cell size and up-regulation of HCM
related genes, and more irregularity in contractions characterized
by immature beats, including a higher frequency of abnormal
Ca.sup.2+ transients, characterized by secondary immature
transients. These cardiomyocytes have increased intracullar
Ca.sup.2+ levels, and in some embodiments candidate agents that
target calcineurin or other targets associated with calcium
affinity.
[0084] In screening assays for the small molecules, the effect of
adding a candidate agent to cells in culture is tested with a panel
of cells and cellular environments, where the cellular environment
includes one or more of: electrical stimulation including
alterations in ionicity, drug stimulation, and the like, and where
panels of cells may vary in genotype, in prior exposure to an
environment of interest, in the dose of agent that is provided,
etc., where usually at least one control is included, for example a
negative control and a positive control. Culture of cells is
typically performed in a sterile environment, for example, at
37.degree. C. in an incubator containing a humidified 92-95%
air/5-8% CO.sub.2 atmosphere. Cell culture may be carried out in
nutrient mixtures containing undefined biological fluids such as
fetal calf serum, or media which is fully defined and serum free.
The effect of the altering of the environment is assessed by
monitoring multiple output parameters, including morphogical,
functional and genetic changes.
[0085] In the screening assays for genetic agents, polynucleotides
are added to one or more of the cells in a panel in order to alter
the genetic composition of the cell. The output parameters are
monitored to determine whether there is a change in phenotype. In
this way, genetic sequences are identified that encode or affect
expression of proteins in pathways of interest. The results can be
entered into a data processor to provide a screening results
dataset. Algorithms are used for the comparison and analysis of
screening results obtained under different conditions.
[0086] Methods for analysis include calcium imaging, where cells
are loaded with an appropriate dye and exposed to calcium in a
condition of interest, and imaged, for example with a confocal
microscope. Ca.sup.2+ responses may be quantified, and the
time-dependent Ca.sup.2+ response was then analyzed for
irregularities in timing of successive Ca.sup.2+ transients and for
the total Ca.sup.2+ influx per transient. The total Ca.sup.2+
released during each transient was determined by integrating the
area underneath each wave with respect to the baseline.
[0087] Atomic force microscopy (AFM) can be used to measure
contractile forces. Beating cells are interrogated by AFM using a
cantilever. To measure forces, cells are gently contacted by the
cantilever tip, then the cantilever tip remains in the position for
intervals while deflection data are collected. Statistics can be
calculated for the forces, intervals between beats, and duration of
each contraction for each cell.
[0088] Cells can also analyzed by microelectrode array (MEA), where
beating cardiomyocytes are plated on MEA probes, and the field
potential duration (FPD) measured and determined to provide
electrophysiological parameters.
[0089] Methods of analysis at the single cell level are of
particular interest, e.g. as described above: atomic force
microscopy, microelectrode array recordings, patch clamping, single
cell PCR, calcium imaging, flow cytometry and the like.
[0090] Parameters are quantifiable components of cells,
particularly components that can be accurately measured, desirably
in a high throughput system. A parameter can also be any cell
component or cell product including cell surface determinant,
receptor, protein or conformational or posttranslational
modification thereof, lipid, carbohydrate, organic or inorganic
molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived
from such a cell component or combinations thereof. While most
parameters will provide a quantitative readout, in some instances a
semi-quantitative or qualitative result will be acceptable.
Readouts may include a single determined value, or may include
mean, median value or the variance, etc. Variability is expected
and a range of values for each of the set of test parameters will
be obtained using standard statistical methods with a common
statistical method used to provide single values.
[0091] Parameters of interest include detection of cytoplasmic,
cell surface or secreted biomolecules, frequently biopolymers, e.g.
polypeptides, polysaccharides, polynucleotides, lipids, etc. Cell
surface and secreted molecules are a preferred parameter type as
these mediate cell communication and cell effector responses and
can be more readily assayed. In one embodiment, parameters include
specific epitopes. Epitopes are frequently identified using
specific monoclonal antibodies or receptor probes. In some cases
the molecular entities comprising the epitope are from two or more
substances and comprise a defined structure; examples include
combinatorially determined epitopes associated with heterodimeric
integrins. A parameter may be detection of a specifically modified
protein or oligosaccharide. A parameter may be defined by a
specific monoclonal antibody or a ligand or receptor binding
determinant.
[0092] Candidate agents of interest are biologically active agents
that encompass numerous chemical classes, primarily organic
molecules, which may include organometallic molecules, inorganic
molecules, genetic sequences, etc. An important aspect of the
invention is to evaluate candidate drugs, select therapeutic
antibodies and protein-based therapeutics, with preferred
biological response functions. Candidate agents comprise functional
groups necessary for structural interaction with proteins,
particularly hydrogen bonding, and typically include at least an
amine, carbonyl, hydroxyl or carboxyl group, frequently at least
two of the functional chemical groups. The candidate agents often
comprise cyclical carbon or heterocyclic structures and/or aromatic
or polyaromatic structures substituted with one or more of the
above functional groups. Candidate agents are also found among
biomolecules, including peptides, polynucleotides, saccharides,
fatty acids, steroids, purines, pyrimidines, derivatives,
structural analogs or combinations thereof.
[0093] Included are pharmacologically active drugs, genetically
active molecules, etc. Compounds of interest include
chemotherapeutic agents, anti-inflammatory agents, hormones or
hormone antagonists, ion channel modifiers, and neuroactive agents.
Exemplary of pharmaceutical agents suitable for this invention are
those described in, "The Pharmacological Basis of Therapeutics,"
Goodman and Gilman, McGraw-Hill, New York, N.Y., (1996), Ninth
edition, under the sections: Drugs Acting at Synaptic and
Neuroeffector Junctional Sites; Cardiovascular Drugs; Vitamins,
Dermatology; and Toxicology, all incorporated herein by
reference.
[0094] Test compounds include all of the classes of molecules
described above, and may further comprise samples of unknown
content. Of interest are complex mixtures of naturally occurring
compounds derived from natural sources such as plants. While many
samples will comprise compounds in solution, solid samples that can
be dissolved in a suitable solvent may also be assayed. Samples of
interest include environmental samples, e.g. ground water, sea
water, mining waste, etc.; biological samples, e.g. lysates
prepared from crops, tissue samples, etc.; manufacturing samples,
e.g. time course during preparation of pharmaceuticals; as well as
libraries of compounds prepared for analysis; and the like. Samples
of interest include compounds being assessed for potential
therapeutic value, i.e. drug candidates.
[0095] The term samples also includes the fluids described above to
which additional components have been added, for example components
that affect the ionic strength, pH, total protein concentration,
etc. In addition, the samples may be treated to achieve at least
partial fractionation or concentration. Biological samples may be
stored if care is taken to reduce degradation of the compound, e.g.
under nitrogen, frozen, or a combination thereof. The volume of
sample used is sufficient to allow for measurable detection,
usually from about 0.1:I to 1 ml of a biological sample is
sufficient.
[0096] Compounds, including candidate agents, are obtained from a
wide variety of sources including libraries of synthetic or natural
compounds. For example, numerous means are available for random and
directed synthesis of a wide variety of organic compounds,
including biomolecules, including expression of randomized
oligonucleotides and oligopeptides. Alternatively, libraries of
natural compounds in the form of bacterial, fungal, plant and
animal extracts are available or readily produced. Additionally,
natural or synthetically produced libraries and compounds are
readily modified through conventional chemical, physical and
biochemical means, and may be used to produce combinatorial
libraries. Known pharmacological agents may be subjected to
directed or random chemical modifications, such as acylation,
alkylation, esterification, amidification, etc. to produce
structural analogs.
[0097] As used herein, the term "genetic agent" refers to
polynucleotides and analogs thereof, which agents are tested in the
screening assays of the invention by addition of the genetic agent
to a cell. The introduction of the genetic agent results in an
alteration of the total genetic composition of the cell. Genetic
agents such as DNA can result in an experimentally introduced
change in the genome of a cell, generally through the integration
of the sequence into a chromosome. Genetic changes can also be
transient, where the exogenous sequence is not integrated but is
maintained as an episomal agents. Genetic agents, such as antisense
oligonucleotides, can also affect the expression of proteins
without changing the cell's genotype, by interfering with the
transcription or translation of mRNA. The effect of a genetic agent
is to increase or decrease expression of one or more gene products
in the cell.
[0098] Introduction of an expression vector encoding a polypeptide
can be used to express the encoded product in cells lacking the
sequence, or to over-express the product. Various promoters can be
used that are constitutive or subject to external regulation, where
in the latter situation, one can turn on or off the transcription
of a gene. These coding sequences may include full-length cDNA or
genomic clones, fragments derived therefrom, or chimeras that
combine a naturally occurring sequence with functional or
structural domains of other coding sequences. Alternatively, the
introduced sequence may encode an anti-sense sequence; be an
anti-sense oligonucleotide; RNAi, encode a dominant negative
mutation, or dominant or constitutively active mutations of native
sequences; altered regulatory sequences, etc.
[0099] Antisense and RNAi oligonucleotides can be chemically
synthesized by methods known in the art. Preferred oligonucleotides
are chemically modified from the native phosphodiester structure,
in order to increase their intracellular stability and binding
affinity. A number of such modifications have been described in the
literature, which alter the chemistry of the backbone, sugars or
heterocyclic bases. Among useful changes in the backbone chemistry
are phosphorothioates; phosphorodithioates, where both of the
non-bridging oxygens are substituted with sulfur;
phosphoroamidites; alkyl phosphotriesters and boranophosphates.
Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate,
3'-S-5'-O-phosphorothioate, 3'-CH2-5'-O-phosphonate and
3'-NH-5'-O-phosphoroamidate. Peptide nucleic acids replace the
entire ribose phosphodiester backbone with a peptide linkage. Sugar
modifications are also used to enhance stability and affinity, e.g.
morpholino oligonucleotide analogs. The .quadrature.-anomer of
deoxyribose may be used, where the base is inverted with respect to
the natural .quadrature.-anomer. The 2'-OH of the ribose sugar may
be altered to form 2'-O-methyl or 2'-O-allyl sugars, which provides
resistance to degradation without comprising affinity.
[0100] Agents are screened for biological activity by adding the
agent to at least one and usually a plurality of cells, in one or
in a plurality of environmental conditions, e.g. following
stimulation with a .beta.-adrenergic agonist, following electric or
mechanical stimulation, etc. The change in parameter readout in
response to the agent is measured, desirably normalized, and the
resulting screening results may then be evaluated by comparison to
reference screening results, e.g. with cells having other mutations
of interest, normal cardiomyocytes, cardiomyocytes derived from
other family members, and the like. The reference screening results
may include readouts in the presence and absence of different
environmental changes, screening results obtained with other
agents, which may or may not include known drugs, etc.
[0101] The agents are conveniently added in solution, or readily
soluble form, to the medium of cells in culture. The agents may be
added in a flow-through system, as a stream, intermittent or
continuous, or alternatively, adding a bolus of the compound,
singly or incrementally, to an otherwise static solution. In a
flow-through system, two fluids are used, where one is a
physiologically neutral solution, and the other is the same
solution with the test compound added. The first fluid is passed
over the cells, followed by the second. In a single solution
method, a bolus of the test compound is added to the volume of
medium surrounding the cells. The overall concentrations of the
components of the culture medium should not change significantly
with the addition of the bolus, or between the two solutions in a
flow through method.
[0102] Preferred agent formulations do not include additional
components, such as preservatives, that may have a significant
effect on the overall formulation. Thus preferred formulations
consist essentially of a biologically active compound and a
physiologically acceptable carrier, e.g. water, ethanol, DMSO, etc.
However, if a compound is liquid without a solvent, the formulation
may consist essentially of the compound itself.
[0103] A plurality of assays may be run in parallel with different
agent concentrations to obtain a differential response to the
various concentrations. As known in the art, determining the
effective concentration of an agent typically uses a range of
concentrations resulting from 1:10, or other log scale, dilutions.
The concentrations may be further refined with a second series of
dilutions, if necessary. Typically, one of these concentrations
serves as a negative control, i.e. at zero concentration or below
the level of detection of the agent or at or below the
concentration of agent that does not give a detectable change in
the phenotype.
[0104] Various methods can be utilized for quantifying the presence
of selected parameters, in addition to the functional parameters
described above. For measuring the amount of a molecule that is
present, a convenient method is to label a molecule with a
detectable moiety, which may be fluorescent, luminescent,
radioactive, enzymatically active, etc., particularly a molecule
specific for binding to the parameter with high affinity
Fluorescent moieties are readily available for labeling virtually
any biomolecule, structure, or cell type. Immunofluorescent
moieties can be directed to bind not only to specific proteins but
also specific conformations, cleavage products, or site
modifications like phosphorylation. Individual peptides and
proteins can be engineered to autofluoresce, e.g. by expressing
them as green fluorescent protein chimeras inside cells (for a
review see Jones et al. (1999) Trends Biotechnol. 17(12):477-81).
Thus, antibodies can be genetically modified to provide a
fluorescent dye as part of their structure
[0105] Depending upon the label chosen, parameters may be measured
using other than fluorescent labels, using such immunoassay
techniques as radioimmunoassay (RIA) or enzyme linked
immunosorbance assay (ELISA), homogeneous enzyme immunoassays, and
related non-enzymatic techniques. These techniques utilize specific
antibodies as reporter molecules, which are particularly useful due
to their high degree of specificity for attaching to a single
molecular target. U.S. Pat. No. 4,568,649 describes ligand
detection systems, which employ scintillation counting. These
techniques are particularly useful for protein or modified protein
parameters or epitopes, or carbohydrate determinants. Cell readouts
for proteins and other cell determinants can be obtained using
fluorescent or otherwise tagged reporter molecules. Cell based
ELISA or related non-enzymatic or fluorescence-based methods enable
measurement of cell surface parameters and secreted parameters.
Capture ELISA and related non-enzymatic methods usually employ two
specific antibodies or reporter molecules and are useful for
measuring parameters in solution. Flow cytometry methods are useful
for measuring cell surface and intracellular parameters, as well as
shape change and granularity and for analyses of beads used as
antibody- or probe-linked reagents. Readouts from such assays may
be the mean fluorescence associated with individual fluorescent
antibody-detected cell surface molecules or cytokines, or the
average fluorescence intensity, the median fluorescence intensity,
the variance in fluorescence intensity, or some relationship among
these.
[0106] Both single cell multiparameter and multicell multiparameter
multiplex assays, where input cell types are identified and
parameters are read by quantitative imaging and fluorescence and
confocal microscopy are used in the art, see Confocal Microscopy
Methods and Protocols (Methods in Molecular Biology Vol. 122.)
Paddock, Ed., Humana Press, 1998. These methods are described in
U.S. Pat. No. 5,989,833 issued Nov. 23, 1999.
[0107] The quantitation of nucleic acids, especially messenger
RNAs, is also of interest as a parameter. These can be measured by
hybridization techniques that depend on the sequence of nucleic
acid nucleotides. Techniques include polymerase chain reaction
methods as well as gene array techniques. See Current Protocols in
Molecular Biology, Ausubel et al., eds, John Wiley & Sons, New
York, N.Y., 2000; Freeman et al. (1999) Biotechniques
26(1):112-225; Kawamoto et al. (1999) Genome Res 9(12):1305-12; and
Chen et al. (1998) Genomics 51(3):313-24, for examples.
[0108] The comparison of a screening results obtained from a test
compound, and a reference screening results(s) is accomplished by
the use of suitable deduction protocols, AI systems, statistical
comparisons, etc. Preferably, the screening results is compared
with a database of reference screening results. A database of
reference screening results can be compiled. These databases may
include reference results from panels that include known agents or
combinations of agents, as well as references from the analysis of
cells treated under environmental conditions in which single or
multiple environmental conditions or parameters are removed or
specifically altered. Reference results may also be generated from
panels containing cells with genetic constructs that selectively
target or modulate specific cellular pathways.
[0109] The readout may be a mean, average, median or the variance
or other statistically or mathematically derived value associated
with the measurement. The parameter readout information may be
further refined by direct comparison with the corresponding
reference readout. The absolute values obtained for each parameter
under identical conditions will display a variability that is
inherent in live biological systems and also reflects individual
cellular variability as well as the variability inherent between
individuals.
[0110] For convenience, the systems of the subject invention may be
provided in kits. The kits could include the cells to be used,
which may be frozen, refrigerated or treated in some other manner
to maintain viability, reagents for measuring the parameters, and
software for preparing the screening results. The software will
receive the results and perform analysis and can include reference
data. The software can also normalize the results with the results
from a control culture. The composition may optionally be packaged
in a suitable container with written instructions for a desired
purpose, such as screening methods, and the like.
[0111] For further elaboration of general techniques useful in the
practice of this invention, the practitioner can refer to standard
textbooks and reviews in cell biology, tissue culture, embryology,
and cardiophysiology. With respect to tissue culture and embryonic
stem cells, the reader may wish to refer to Teratocarcinomas and
embryonic stem cells: A practical approach (E. J. Robertson, ed.,
IRL Press Ltd. 1987); Guide to Techniques in Mouse Development (P.
M. Wasserman et al. eds., Academic Press 1993); Embryonic Stem Cell
Differentiation in Vitro (M. V. Wiles, Meth. Enzymol. 225:900,
1993); Properties and uses of Embryonic Stem Cells: Prospects for
Application to Human Biology and Gene Therapy (P. D. Rathjen et
al., Reprod. Fertil. Dev. 10:31, 1998). With respect to the culture
of heart cells, standard references include The Heart Cell in
Culture (A. Pinson ed., CRC Press 1987), Isolated Adult
Cardiomyocytes (Vols. I & II, Piper & Isenberg eds, CRC
Press 1989), Heart Development (Harvey & Rosenthal, Academic
Press 1998).
[0112] General methods in molecular and cellular biochemistry can
be found in such standard textbooks as Molecular Cloning: A
Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory
Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel
et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag
et al., John Wiley & Sons 1996); Nonviral Vectors for Gene
Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors
(Kaplift & Loewy eds., Academic Press 1995); Immunology Methods
Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue
Culture: Laboratory Procedures in Biotechnology (Doyle &
Griffiths, John Wiley & Sons 1998). Reagents, cloning vectors,
and kits for genetic manipulation referred to in this disclosure
are available from commercial vendors such as BioRad, Stratagene,
Invitrogen, Sigma-Aldrich, and ClonTech.
[0113] Each publication cited in this specification is hereby
incorporated by reference in its entirety for all purposes.
[0114] It is to be understood that this invention is not limited to
the particular methodology, protocols, cell lines, animal species
or genera, and reagents described, as such may vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
limit the scope of the present invention, which will be limited
only by the appended claims.
[0115] As used herein the singular forms "a", "and", and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a cell" includes a
plurality of such cells and reference to "the culture" includes
reference to one or more cultures and equivalents thereof known to
those skilled in the art, and so forth. All technical and
scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this
invention belongs unless clearly indicated otherwise.
[0116] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
EXAMPLES
Example 1
[0117] Dilated cardiomyopathy (DCM) is the most common
cardiomyopathy, characterized by ventricular dilatation, systolic
dysfunction, and progressive heart failure. DCM is the most common
diagnosis leading to heart transplantation and places a
considerable burden on healthcare worldwide. Here we generated
cardiomyocytes (CMs) from iPSCs derived from patients of a DCM
family carrying a point mutation (R173W) in the gene that encodes
sarcomeric protein cardiac troponin T. Compared to the control
healthy individuals in the same family cohort, DCM iPSC-CMs
exhibited decreased calcium transient amplitude, decreased
contractility, and abnormal sarcomeric .alpha.-actinin
distribution. When stimulated with .beta.-adrenergic agonist, DCM
iPSC-CMs showed characteristics of failure such as reduced beating
rates, compromised contraction, and significantly more cells with
abnormal sarcomeric .alpha.-actinin distribution. .beta.-adrenergic
blocker treatment and over-expression of sarcoplasmic reticulum
Ca.sup.2+ ATPase (Serca2a) improved the function of DCM iPSC-CMs.
Our study demonstrated that human DCM iPSC-CMs recapitulated the
disease phenotypes morphologically and functionally, and thus can
serve as a useful platform for exploring molecular and cellular
mechanisms and optimizing treatment of this particular disease.
[0118] We recruited a cohort of seven individuals from a DCM
proband carrying an autosomal dominant point mutation on exon 12 of
the gene TNNT2, which causes an Arginine (R) to Tryptophan (W)
mutation at amino acid position 173 in the protein cTnT. The causal
effect for DCM of this particular point mutation was confirmed by
genetic screening of a panel of 17 primary DCM associated genes
(Table 1) and genetic co-segregation studies (Table 2). This
mutation was also reported in a completely independent Belgian
family. The seven recruited individuals covered 3 generations (I,
II, and III) (FIG. 1a). Four patients (Ia, IIa, IIb, and IIIa) were
confirmed to carry the TNNT2 R173W mutation in one of the two
alleles by PCR amplifying the genomic locus of TNNT2 and DNA
sequencing, while the other 3 individuals (Ib, IIc, and IIIb) were
confirmed normal and served as controls in the subsequent studies
(FIG. 1b). All four patients who carry the specific R173W mutation
manifested clinical DCM symptoms with dilated left ventricle and
decreased ejection fraction, and were treated medically (Table 2).
A 14-year-old diseased patient (IIIa) had an orthotopic heart
transplant due to severe clinical symptoms. Further genetic
screening by exome sequencing of this particular patient IIIa with
a panel of 32 most updated DCM-associated genes did not find any
other additional variants that associate with the disease (Table
3).
[0119] To generate patient-specific iPSCs for the seven
individuals, skin fibroblasts were expanded from skin biopsies
taken from each individual (FIG. 1c) and reprogrammed with
lentiviral Yamanaka 4 factors (Oct4, Sox2, Klf4, and c-MYC) under
feeder-free condition. Colonies with TRA-1-60.sup.+ staining and
human embryonic stem cell (hESC)-like morphology (FIGS. 1d and 1e)
were picked, expanded, and established as individual iPSC lines.
For each individual, 3-4 iPSC lines were established for subsequent
analyses. All of the DCM iPSC lines were confirmed to contain the
specific R173W mutation by genomic PCR and DNA sequencing (FIG. 5).
All established iPSC lines expressed the pluripotency markers Oct4,
Nanog, TRA-1-81, and SSEA-4, and were positive for alkaline
phosphatase (FIG. 1f). Microarray analyses indicated these iPSC
lines were distinct from the parental skin fibroblasts, expressing
a global gene pattern more similar to hESCs (FIG. 6). Quantitative
bisulphite sequencing showed that the promoter regions of Oct4 and
Nanog were hypomethylated in all the tested iPSC lines, indicating
active transcription of the pluripotency genes (FIG. 1g). The
established iPSC lines maintained a normal karyotype after extended
passage (FIG. 7) and the majority of them exhibited silencing of
exogenous transgenes and re-expression of endogenous Nanog (FIG.
8). iPSC lines with incomplete transgene silencing were removed
from the subsequent studies. These patient-specific iPSCs were able
to differentiate in vitro into cells of all three germ layers (FIG.
9) and form teratomas following injection into the kidney capsules
of immunodeficient mice (FIG. 1h).
[0120] We next differentiated the DCM iPSCs into the cardiovascular
lineage using a well-established 3D differentiation protocol
developed by Yang, L., et al. Human cardiovascular progenitor cells
develop from a KDR+ embryonic-stem-cell-derived population. Nature
453, 524-528 (2008). Two iPSC lines from each individual were
selected to be differentiated into spontaneous beating embryoid
bodies (EBs). Spontaneous beating was observed as early as day 8
post differentiation. The efficiency of differentiation to cardiac
lineage varied among different lines (FIG. 10). Beating EBs derived
from control and patient iPSCs contained approximately 50-60% cTnT
positive CMs (FIG. 11). Allele-specific PCR of beating EBs derived
from three iPSC clones of 3 DCM patients indicated bi-allelic
expression of the wild type and mutant (R173W) TNNT2 gene (FIG.
12). The beating EBs from the control iPSCs and DCM iPSCs were
seeded on multi-electrode array (MEA) probe (FIG. 13a) and their
electrophysiological properties recorded (FIG. 13b). Both control
(n=45) and DCM (n=57) iPSC-derived beating EBs exhibited comparable
beat frequencies, field potentials, interspike intervals, and field
potential durations (FPD) at baseline (Table 4 and FIG. 13c).
[0121] We next dissociated the beating EBs into small beating
clusters and single beating CMs for further analyses. Single cell
PCR analysis using microfluidics technology on control (n=24) and
DCM (n=24) iPSC-CMs indicated that there are no significant
differences in the gene expression of the selected cardiac-related
transcription factors, sarcomeric proteins, and ion channels (FIG.
14). We next assessed the organization of myofibrils in the
iPSC-CMs by immunocytochemistry. Both control and DCM iPSC-CMs
expressed sarcomeric proteins cTnT, sarcomeric .alpha.-actinin, and
myosin light chain 2a (MLC2a), as well as the cardiac marker gap
junction protein connexin 43 (FIG. 15). However, compared to
control iPSC-CMs (n=368) at day 30 post differentiation, a
significant higher percentage of DCM iPSC-CMs (n=391) showed a
punctate distribution of sarcomeric .alpha.-actinin over one fourth
of the total cellular area (p=0.008) (FIG. 2a, 2b and FIG. 16).
There were no significant differences in cell size between control
and DCM iPSC-CMs (FIG. 2c) at this stage. This phenotype was
consistently observed in two different DCM iPSC lines each from the
4 DCM patients, suggesting a homogeneous correlation to the
disease-causing R173W mutation. Notably, the majority of CMs with
punctate sarcomeric .alpha.-actinin distribution were single cells
or cells at the periphery of a beating cluster. Sarcomeric
.alpha.-actinin is an excellent marker for sarcomeric integrity and
degeneration. These results also suggest a higher tendency for
individual DCM iPSC-CMs to malfunction in maintaining sarcomere
integrity.
[0122] Positive inotropic stress can induce DCM phenotype in
transgenic mouse models of DCM and aggravate the disease in
clinical patients. We next examined whether treatment with positive
inotropic reagent, such as .beta.-adrenergic agonists, can expedite
the phenotypic response of DCM iPSC-CMs. Indeed, 10 .mu.M
norepinephrine (NE) treatment induced an initial positive
chronotropic effect that later became negative, eventually leading
to the failure of spontaneous contraction in DCM iPSC-derived
beating EBs (n=14) as reflected by MEA recording. By contrast, the
control iPSC-derived beating EBs (n=14) exhibited prolonged
positive chronotropic activities (FIG. 2d). One week of NE
treatment markedly increased the number of CMs with punctate
sarcomeric .alpha.-actinin distribution from DCM iPSC clones, with
almost 90% of the DCM iPSC-CMs found to have the disorganized
sarcomeric pattern (FIG. 2f, 2g, FIGS. 17 and 18). A few single DCM
iPSC-CMs showed complete degeneration of myofilaments after
prolonged NE treatment, which was not observed in control cells.
Tracking with video imaging of individual beating clusters of both
control and DCM iPSC-CMs treated with NE over time showed distinct
outcomes. Decreased inotropic and chronotropic activities were
observed in the DCM iPSC-CMs, but not in the control iPSC-CMs (FIG.
2e, 2h). Single cell PCR analysis also revealed distinct gene
expression changes in DCM (n=16) versus control iPSC-CMs (n=16)
after NE treatment (FIG. 19). These results indicated that
.beta.-adrenergic stimulation aggravated the phenotype of DCM
iPSC-CMs.
[0123] CM contraction starts from the electrical excitation of the
myocytes, as reflected by the membrane action potentials (APs). To
investigate the possible underlying mechanism of DCM, we assessed
whether the DCM-linked R173W mutation in cTnT affects the
electrical excitation of the CMs. We examined the electrical
activities of the dissociated single beating iPSC-CMs by patch
clamping. Three types of spontaneous APs (ventricular-like,
atrial-like, and nodal-like) were observed in both control and DCM
iPSC-CMs (FIG. 20a). DCM ventricular myocytes (n=17) exhibited
normal APs that were comparable to control (n=18) (FIG. 20b). The
average action potential duration at 90% repolarization (APD90) of
the DCM iPSC-CMs was not significantly different from that seen in
control iPSC-CMs (FIG. 20c). The average AP frequency, peak
amplitude, and resting potential were also very similar between the
2 groups (FIGS. 20d, 20e, and 20f). These results indicated that
the electrical excitation activities of control and DCM iPSC-CMs at
baseline were normal.
[0124] To further investigate the underlying DCM disease mechanism,
we measured the Ca.sup.2+ handling properties at the
excitation-contraction coupling level by fluorescent Ca.sup.2+
imaging. DCM iPSC-CMs (n=40) exhibited rhythmic frequency, timing,
and amplitude of global [Ca.sup.2+], transients comparable to those
of the control iPSC-CMs (n=87) (FIGS. 3a, 3b, 3c, 3e, and 3f).
However, DCM iPSC-CMs exhibited significantly smaller [Ca.sup.2+],
transient amplitudes compared to those of the control iPSC-CMs
(p=0.002) (FIG. 3d), indicating the [Ca.sup.2+].sub.i available for
each contraction of DCM iPSC-CMs was significantly lower. The
smaller [Ca.sup.2+].sub.i transients of CMs were consistently
observed in all examined DCM iPSC lines derived from the 4 DCM
patients, suggesting weaker force production in DCM iPSC-CMs.
[0125] Deficiency in contractile force production is one of the
most important mechanisms responsible for inducing DCM and heart
failure. To further investigate this, we next measured the
contraction force of iPSC-CMs using atomic force microscopy (AFM),
which has been used to measure cultured chicken embryonic CMs. The
AFM allowed us to probe the contractile properties at a single cell
level (FIG. 21). Compared to single control iPSC-CMs (n=13), DCM
iPSC-CMs (n=17) showed similar beat frequency and duration but
significantly weaker contraction forces (FIG. 4c, 4d, FIG. 22, and
Table 5). There was no correlation between the cell size and
contraction force from each single cell measured by AFM (FIG.
23).
[0126] Previous studies have shown that Serca2a over-expression, a
treatment investigated in a pre-clinical trial, mobilized
intracellular Ca.sup.2+ and restored contractility of
cardiomyocytes in failing human hearts and improved failing heart
functions in animal models. Given our results showing smaller
Ca.sup.2+ transients and compromised contractility in DCM iPSC-CMs,
we hypothesized that over-expression of Serca2a can rescue the
phenotypes of DCM iPSC-CMs. Transduction of DCM iPSC-CMs with
adenoviruses carrying Serca2a co-expressing GFP (Ad.Seca2a) (see
Methods section) at a multiplicity of infection (MOI) of 100 led to
over-expression of Serca2a in these cells (FIG. 4a). Compared to
DCM iPSC-CMs transduced with adenoviruses carrying GFP only
(Ad.GFP) (MOI 100), over-expression of Serca2a resulted in a higher
number of spontaneous contraction foci in vitro over time (FIG.
24). Co-expression of GFP along with Serca2a allowed us to
recognize the transduced cells and measure the contractile force by
AFM (FIG. 4b). Over-expression of Serca2a (n=12) restored the
contractile force of single DCM iPSC-CMs to a level similar to that
seen in control iPSC-CMs (FIG. 4c, 4d, and Table 5), but without
improvement in sarcomeric organization (FIG. 4g). Calcium imaging
using the red fluorescent Ca.sup.2+ indicator Rhod-2 AM (FIG. 25)
indicated that DCM iPSC-CMs transduced with Ad.Serca2a
co-expressing GFP (n=22) had significantly increased global
[Ca.sup.2+].sub.i transients compared to cells transduced with
Ad.GFP only (n=14) (FIGS. 4e and 4f) (p=0.04), which is consistent
with the restored force production. By contrast, over-expression of
Serca2a in control iPSC-CMs failed to produce a statistically
significant increase in contractility (FIG. 26), suggesting natural
differences in calcium handling between control and DCM iPSC-CMs.
Altogether, these results indicated that over-expression of Serca2a
increased the [Ca.sup.2+].sub.i transients and contraction force of
DCM iPSC-CMs and improved their function.
[0127] Although Serca2a gene therapy is now in clinical trial, the
overall mechanism of individual CM cellular response after Serca2a
gene therapy has not been extensively studied previously. Hence we
set out to investigate the mechanisms in which Serca2a delivery
restores defects in DCM iPSC-CMs. Gene expression profiling of DCM
iPSC-CMs after Serca2a over-expression showed that 191 genes (65
upregulated and 126 downregulated) had greater than 1.5 fold
expression changes and were rescued to an expression level similar
to those in control iPSC-CMs (FIG. 27a). Enriched pathways analysis
indicated that several previously known pathways, such as calcium
signaling, protein kinase A signaling, and G-protein coupled
receptor signaling, are significantly involved in rescuing the DCM
phenotype by Serca2a over-expression. Interestingly, several
pathways not previously linked to DCM, including factors promoting
cardiogenesis, integrin and cytoskeletal signaling, and
ubiquitination pathway, were also found to participate in rescuing
the DCM CM function (FIG. 27b and Table 7).
[0128] Clinical studies have shown that metoprolol, a
.beta.1-selective .beta.-adrenergic blocker, has a beneficial
effect on the clinical symptoms and hemodynamic status of DCM
patients. When treated with 10 .mu.M metoprolol, DCM iPSC-CMs
showed an improvement in the sarcomeric organization as indicated
by sarcomeric .alpha.-actinin staining (FIG. 28a). Metoprolol
treatment also prevented aggravation of the DCM iPSC-CMs that is
induced by NE treatment (FIG. 28b). We observed no significant
effect on sarcomeric .alpha.-actinin distribution in control
iPSC-CMs treated with metoprolol (FIG. 28c). These results suggest
that blockade of .beta.-adrenergic pathway helped DCM iPSC-CMs
resist mechanical deterioration.
[0129] In summary, we have generated patient-specific iPSCs from a
DCM family carrying a single point mutation in the sarcomeric
protein cTnT and derived CMs from these iPSCs. This has allowed us
to generate a large number of DCM-specific CMs and to analyze their
functional properties, explore the underlying disease mechanisms,
and test effective therapies (Table 8). Although the baseline
electrophysiological activities of the DCM iPSC-CMs were not
significantly different from those of the controls, DCM iPSC-CMs
exhibited significantly smaller [Ca.sup.2+].sub.i transients and
decreased contractile force. A weaker ability to resist mechanical
stimulation was also associated with DCM iPSC-CMs. NE stimulation
induced a cessation of their spontaneous contraction and markedly
exacerbated sarcomeric organization as reflected by sarcomeric
.alpha.-actinin staining. This TNNT2 R173W mutation seems to affect
only the CM function and not other cells from cardiovascular
lineage (FIG. 29). Taken together, our data indicated that the
TNNT2 R173W mutation caused impairment in force production of CMs,
which might be the primary reason for the eventual appearance of
the DCM clinical phenotype in patients (FIG. 30). We showed both
.beta.-blocker metoprolol can rescue the DCM iPSC-CM phenotype. In
addition, over-expression with Serca2a, a novel gene therapy
treatment for heart failure currently in clinical trials, can
significantly improve the function of DCM iPSC-CMs. Gene expression
profiling further identified several novel pathways, including
ubiquitination and integrin signaling pathways, that are involved
in Serca2a rescue. Taken together, our findings demonstrate that
the iPSC platform opens new, exciting areas of research on
investigating disease mechanisms and therapeutic targets for
DCM.
Methods
[0130] Patient-specific iPSC derivation, culture, and
characterization. All the protocols for this study were approved by
the Stanford University Human Subjects Research Institutional
Review Board. Generation, maintenance, and characterization of
patient-specific iPSC lines were performed as previously
described.
[0131] Immunofluorescence and alkaline phosphatase staining.
Alkaline phosphatase (AP) staining was performed using the
Quantitative Alkaline Phosphatase ES Characterization Kit
(Chemicon) following the manufacturer's instruction.
Immunofluorescence was performed using appropriate primary
antibodies and AlexaFluor conjugated secondary antibodies
(Invitrogen) as previously described. The primary antibodies for
Oct3/4 (Santa Cruz), Sox2 (Biolegend), SSEA-3 (Millipore), SSEA-4
(Millipore), Tra-1-60 (Millipore), Tra-1-81 (Millipore), Nanog
(Santa Cruz), AFP (Santa Cruz), smooth muscle actin (SMA) (Sigma),
Tuj-1 (Covance), cTnT (Thermo Scientific), sarcomeric
.alpha.-actinin (Clone EA-53, Sigma), Connexin-43 (Millipore), and
Myosin light chain (MLC-2a) (Synaptic Systems) were used in this
study.
[0132] Bisulphite pyrosequencing. One .mu.g of sample DNA was
bisulfate treated using the Zymo DNA Methylation Kit (Zymo
Research) following the manufacturer's instruction. The PCR product
was then converted to single-stranded DNA templates and sequenced
by Pyrosequencing PSQ96 HS System (Biotage). The methylation status
of each locus was analyzed individually as a T/C SNP using QCpG
software (Biotage).
[0133] Cardiac differentiation of human ESCs and iPSCs.
Differentiation of H7 ESCs and derived iPSC lines into the cardiac
lineage was performed using the well established protocol described
by Yang et al. Beating EBs were dissociated with type I collagenase
(Sigma) and seeded on gelatin coated culture dishes, glass chamber
slides, or glass coverslips for functional analyses.
[0134] Calcium imaging. Dissociated iPSC-CMs were seeded in
gelatin-coated 4-well LAB-TEK.RTM. II chambers (Nalge Nunc
International, chamber #1.5 German coverglass system) for calcium
imaging. Cells were loaded with 5 .mu.M Fluo-4 AM or Rhod-2 AM (for
cells expressing GFP) and 0.02% Pluronic F-127 (all from Molecular
Probes) in the Tyrodes solution (140 mM NaCl, 5.4 mM KCl, 1 mM
MgCl.sub.2, 10 mM glucose, 1.8 mM CaCl.sub.2, and 10 mM HEPES pH
7.4 with NaOH at 25.degree. C.) for 15 min at 37.degree. C. Cells
were then washed three times with the Tyrodes solution. Calcium
imaging was conducted with a confocal microscope (Carl Zeiss, LSM
510 Meta) with a 63.times. lens (NA=1.4) using Zen software.
Spontaneous Ca.sup.2+ transients were acquired at room temperature
using line scan mode at a sampling rate of 1.92 ms/line. A total of
10,000 lines were acquired for 19.2 s recoding.
[0135] Analysis of calcium imaging traces. Ca.sup.2+ responses were
quantified using Fiji, a derivative of ImageJ (National Institutes
of Health) to average the fluorescence intensity of each line. The
time-dependent Ca.sup.2+ response was then analyzed for
irregularities in timing of successive Ca.sup.2+ transients and for
the total Ca.sup.2+ influx per transient using MATLAB. Time between
transients (timing) was defined as the time between the peaks of
two successive spikes. The spikes were determined by calculating
the zero crossing of the second derivative using MATLAB's Signal
Processing Toolbox. The total Ca.sup.2+ released during each
transient was determined by integrating the area underneath each
wave with respect to the baseline. The baseline was defined as the
median of all minima. Irregularity for both spike timing and
amplitude was defined as the ratio of the standard deviation (s.d.)
to the mean of a set of measurements.
[0136] Atomic force microscopy (AFM). iPSC-CMs were seeded on glass
bottom petri dishes before each experiment, switched from culture
media to warm Tyrode's solution. Cells were maintained at
36.degree. C. for the entire experiment. Beating cells were
interrogated by AFM (MFP-3D Bio, Asylum Research) using a silicon
nitride cantilever (spring constants .about.0.04 N/m,
BudgetSensors). To measure forces, cells were gently contacted by
the cantilever tip with 100 pN of force, with a typical cellular
indentation of around 100-200 nm, then the cantilever tip remained
in the position without Z-piezo feedback for multiple sequential
two minute intervals while deflection data were collected at a
sample rate of 2 kHz. Typical noise during these measurements was
around 20 pN. Deflection data were converted to force by
multiplying by the spring constant. Typically, 100-400 beats were
collected for each single cell, and statistics were calculated for
the forces, intervals between beats, and duration of each
contraction for each cell. Forces across cells were compared using
two tailed Student's t-test.
[0137] Adenovirus transduction of iPSC-CMs. First-generation type 5
recombinant adenoviruses carrying cytomegalovirus (CMV) promoter
driving Serca2a plus a separate CMV promoter driving GFP
(Ad.Serca2a) and adenoviruses carrying CMV promoter driving GFP
only (Ad.GFP) as control were used. iPSC-CMs dissociated from
beating EBs were transduced at MOI 100 overnight and then refreshed
with culture medium (DMEM supplemented with 10% FBS). Cells were
used for subsequent experiments 48 hours after transduction.
[0138] Statistical analysis. Data were analyzed using either Excel
or R. Statistical differences among two groups were tested using
two tailed Student's t-tests. Statistical differences among more
than two groups were analyzed using one-way ANOVA tests followed by
Tukey's Multiple Comparison Test. Significant differences were
determined when p value is less than 0.05.
[0139] Genetic testing. Peripheral blood was drawn in EDTA from the
patients and sent to GeneDx Laboratories (Gaithersburg, Md.) for
isolation of genomic DNA and commercial genetic testing. The DNA
was amplified and sequenced using a "next generation" solid-state
sequence-by synthesis method (Illumine). The DCM gene panel
includes sequencing of the complete coding regions and splice
junctions of the following genes: LMNA, MYH7, TNNT2, ACTC1, DES,
MYBPC3, TPM1, TNNI3, LDB3, TAZ, PLN, TTR, LAMP2, SGCD, MTTL1, MTTQ,
MTTH, MTTK, MTTS1, MTTS2, MTND1, MTND5, and MTND6. Results were
compared with the human reference sequence (c DNA NM_00108005).
Possible disease associated sequences were confirmed by dideoxy DNA
sequencing. The presence of candidate disease associated variants
was also determined in 335 presumed healthy controls of mixed
ethnicity. A variant was identified (p.Arg173Trp) in the TNNT2
gene. This is a non-conservative amino acid substitution of a
hydrophilic, positive arginine with a hydrophobic, neutral
tyrosine. This arginine is highly conserved at position 173 across
several species. In silico analysis (PolyPhen) predicts the amino
acid substitution to be damaging to the cardiac troponin T2 protein
structure and function. This variant was not found in 335 control
individuals of mixed descent.
[0140] Exome sequencing and data analysis. Genomic DNA from
individual IIIa was subjected to exome sequencing using the
Nimblegen SeqCap EZ Exome Library v2.0 (Roche Molecular
Biochemicals). Thirty two most updated autosomal genes underlying
DCM.sup.1 (Supplementary Table 3) were examined for mutations. All
of these genes were targeted in the exome capture and in total
covered 190 kb. Sequencing with one lane of HiSeq (Illumina)
generated median coverage of 217.times. (interquartile range
152.times. to 243.times.). Single nucleotide variant (SNVs) were
found by using an analysis pipeline comprised of Novoalign, Picard,
SAMtools, GATK, and ANNOVAR. SNPs were confirmed by comparing the
SNPs data base dbSNP132. Deleterious SNVs were identified by the
SIFT algorithm.
[0141] Microarray hybridization and data analysis. Total RNA
samples from biological duplicates of of undifferentiated iPSCs or
4-week-old CMs derived from control and DCM iPSCs (treated with or
without Serca2a over-expression) were hybridized to Affymetrix
GeneChip Human Gene 1.0 ST Array, and then normalized and annotated
by the Affymetrix Expression Console software. The Pearson
Correlation Coefficient was calculated for each pair of samples
using the expression level of transcripts which show standard
deviation greater than 0.2 among all samples. For hierarchical
clustering, we used Pearson correlation for average linkage
clustering. Ingenuity Pathway Analysis (IPA) tool was used to
identify the enriched pathways. Only those pathways with the number
of genes >5 were selected.
[0142] Cardiac differentiation of human ESCs and iPSCs. Human ESCs
and iPSCs were cultured on Matrigel (BD Biosciences)-coated surface
with mTESR-1 human pluripotent stem cell culture medium (STEMCELL
Technologies) to 80% confluence. On day 0, cells were dissociated
with Accutase (Sigma) to small clumps containing 10-20 cells and
resuspended in 2 ml basic media (StemPro34, Invitrogen, containing
2 mM glutamine, Invitrogen, 0.4 mM monothioglycerol, Sigma, 50
.mu.g/ml ascorbic acid, Sigma, and 0.5 ng/ml.sup.- BMP4, R&D
Systems) to form embryoid bodies (EBs). On day 1-4, BMP4 (10
ng/ml), human bFGF (5 ng/ml), and activin A (3 ng/ml) were added to
the basic media for cardiac specification. On day 4-8, EBs were
refreshed with basic media containing human DKK1(50 ng/ml) and
human VEGF (10 ng/ml), followed by basic media containing human
bFGF (5 ng/ml) and human VEGF (10 ng/ml) starting day 8. All
factors were obtained from R&D Systems. Cultures were
maintained in a 5% CO.sub.2/air environment.
[0143] Microelectrode array (MEA) recordings. One to six beating
iPSC-CM EBs were plated 1-3 days prior to experiments at day 19-47
post differentiation on gelatin coated MEA probes (Alpha Med
Scientific). Signals were acquired at 20 kHz with a MED64 amplifier
(Alpha Med Scientific) and digitized using National Instruments A/D
cards and a PC with MED64 Mobius QT software. Field potential
duration (FPD) was measured and determined as described, and
corrected offline using IGOR Pro (Lake Oswego) and MS Excel. FPD
was normalized to the beat frequency using the Bazzet correction
formula: cFPD=FPD/AlInterspike interval. Statistical analyses
comparing the DCM and control iPSC-CM electrophysiological
parameters were performed using two tailed Student's t-tests.
[0144] Patch clamping. Dissociated iPSC-CMs were seeded on
gelatin-coated 15 mm round coverslips in 24-well plates for
experiments. Whole-cell patch clamp recordings in CMs generated
from control and DCM iPSCs on coverslips were conducted using
EPC-10 patch-clamp amplifier (HEKA) and an inverted microscope
(Nikon, TE2000-U). Glass pipettes were prepared using borosilicate
glasses with a filament (Sutter Instrument, #BF150-110-10) using
the following parameters (Heat, Velocity, Time): 1) 740, 20, 250;
2) 730, 20, 250; 3) 730, 20, 250; 4) 710, 47, 250, using a
micropipette puller (Sutter Instrument, Model P-87). Recordings
were conducted using the following pipette solution: 120 mM K
D-gluconate, 25 mM KCl, 4 mM MgATP, 2 mM NaGTP, 4 mM
Na2-phospho-creatin, 10 mM EGTA, 1 mM CaCl2 and 10 mM HEPES (pH 7.4
with KCl at 25.degree. C.) in Tyrodes solution (140 mM NaCl, 5.4 mM
KCl, 1 mM MgCl.sub.2, 10 mM glucose, 1.8 mM CaCl.sub.2, and 10 mM
HEPES pH 7.4 with NaOH at 25.degree. C.). Statistical analyses were
performed using two tailed Student's t-tests.
[0145] Single cell microfluidic PCR. Single beating CMs were picked
manually under the microscope. Each cell was introduced into PCR
tubes containing 10 .mu.l of a mixture of reaction buffer
(CellsDirect kit, Invitrogen), TE buffer (Ambion), primers of
interest (Applied Biosystems) and SuperScript III Reverse
Transcriptase/Platinum Taq Mix (Invitrogen). Reverse transcription
and specific transcript amplification were performed on the
thermocycler (ABI Veriti) as follows: 50.degree. C. for 15 min,
70.degree. C. for 2 min, 94.degree. C. for 2 min, then 94.degree.
C. for 15 sec, 60.degree. C. for 30 sec, and 68.degree. C. for 45
sec for 18 cycles, then 68.degree. C. for 7 minutes. The amplified
cDNA was loaded into Biomark 48.48 Dynamic Array chips using the
Nanoflex IFC controller (Fluidigm). Threshold cycle (CT) as a
measurement of relative fluorescence intensity was extracted by the
BioMark Real-Time PCR Analysis software (Fluidigm).
[0146] Endothelial cell differentiation. iPSCs were dispersed into
cell aggregates containing approximately 500 to 1,000 cells using 1
mg/ml collagenase IV (Invitrogen). Cell aggregates were suspension
cultured in ultra-low attachment cell culture dishes in Knockout
DMEM containing 20% ES-Qualified FBS (Invitrogen) supplemented with
inductive cytokines (R&D Systems) as follows: day 0-7: 20 ng/ml
BMP4; day 1-4: 10 ng/ml Activin A; day 2-14: 8 ng/ml FGF-2; day
4-14: 25 ng/ml VEGF-A. Endothelial progenitor cells were
magnetically separated using mouse anti-human CD31 antibody (BD
Biosciences) and expanded in EGM-2 endothelial cell culture medium
(Lonza).
TABLE-US-00001 TABLE 1 Genetic screening of the DCM gene panel by
next generation sequencing (Illumina) Gene Symbol Protein Coded
NCBI Ref Gene No. Mutation(s) LMNA lamin A/C NG_008692 None MYH7
beta-myosin heavy chain NG_007884 None TNNT2 cardiac muscle
troponin T NG_007556 p.Arg173Trp ACTC1 alpha-cardiac actin
NG_007553 None DES desmin NG_008043 None MYBPC3 cardiac
myosin-binding protein C NG_007667 None TPM1 alpha tropomyosin
NG_007557 None TNNI3 cardiac muscle troponin I NG_007866 None LDB3
LIM domain binding 3 (ZASP) NG_008876 None TAZ tafazzin NG_009634
None PLN phospholamban NG_009082 None TTR transthyretin NG_009490
None LAMP2 lysosomal-associated membrane protein 2 NG_007995 None
SGCD delta sarcoglycan NG_008693 None MTTL1 mitochondrially encoded
tRNA leucine 1 NC_012920_TRNL1 None MTTQ mitochondrially encoded
tRNA glutamine NC_012920_TRNQ None MTTH mitochondrially encoded
tRNA histidine NC_012920_TRNH None MTTK mitochondrially encoded
tRNA lysine NC_012920_TRNK None MTTS1 mitochondrially encoded tRNA
serine 1 NC_012920_TRNS1 None MTTS2 mitochondrially encoded tRNA
serine 1 NC_012920_TRNS2 None MTND1 mitochondrially encoded NADH
NC_012920_ND1 None dehydrogenase 1 MTND5 mitochondrially encoded
NADH NC_012920_ND5 None dehydrogenase 5 MTND6 mitochondrially
encoded NADH NC_012920_ND6 None dehydrogenase 6
TABLE-US-00002 TABLE 2 Clinical characteristics of the R173W DCM
family Genotype RV Size LA Size Pedigree Age Clinical TNNT2 LVEDD
Ejection in Diastole in Systole ID (yrs) Diagnosis (p.Arg173Trp)
(cm) Fraction (%) (cm) (cm) Ia 75 DCM Arg173Trp 6.0 25-30% 2.7 4.2
Ib 77 -- Reference NA NA NA NA IIa 46 DCM Arg173Trp 5.6 35%(2006),
WNL WNL 50%(2011) IIb 50 DCM Arg173Trp WNL 40-45% 3.32 WNL IIc 48
-- Reference 5.3 65-70% WNL 4.0 IIIa 16 DCM Arg173Trp 6.7 19% 1.8
4.7 IIIb 18 -- Reference WNL 58% 2.9 3.6 LVEDD, Left Ventricular
End Diastolic Diameter Normal LVEDD Range (Adult), <5.5 cm
Normal ejection fraction (EF), >55% WNL = Within Normal Limits
Normal right ventricle (RV) diastole size = <3.8 cm Normal left
atrium (LA) size systole = <4.2 cm
TABLE-US-00003 TABLE 3 Exome sequencing and screening of 32
recently updated list of genes causing DCM for patient IIIa did not
uncover additional single nucleotide variants which could
potentially account for the disease phenotype Whole exome SNVs
called* 49,143 Number of called SNVs in dbSNP132 45,501 Among 32
DCM genes (MYH6, MYH7, MYPN, TNNT2, SCN5A, MYBPC3, RBM20, TMPO,
LAMA4, VCL, LDB3, TCAP, PSEN1, PSEN2, ACTN2, CRYAB, TPM1, ABCC9,
ACTC1, PDLIM3, ILK, TNNC1, TNNI3, PLN, DES, SGCD, CSRP3, TTN, EYA4,
ANKRD1, DMD, TAZ) SNVs called 83 Number of called SNVs in dbSNP132
78 Non-synonymous SNVs 37 Deleterious by SIFT 24 Deleterious and
absent in dbSNP132 chr1: 201332477 C->T, TNNT2 R173W chr2:
179634421 T->G, TTN T2917P chr2: 179422181 C->T, TTN V20205I
chr2: 179398195 C->G, TTN E25318Q chr1: 201332477 C->T, TNNT2
R173W Segregate with DCM and verified by genomic PCR and DNA
sequencing chr2: 179634421 T->G, TTN T2917P Exome sequencing
error verified by genomic PCR and DNA sequencing chr2: 179422181
C->T, TTN V20205I Not segregate with DCM and verified by genomic
PCR and DNA sequencing chr2: 179398195 C->G, TTN E25318Q Not
segregate with DCM and verified by genomic PCR and DNA sequencing
*Using default GATK filter parameters for PASS SNVs, single
nucleotide variants
TABLE-US-00004 TABLE 4 Baseline electrophysiological parameters of
iPSC-derived beating EBs obtained via MEA Recordings Corrected
Field Field Potential Potential Minimum Maximum Beats Per Duration
Duration Amplitude Amplitude iPSC-EBs Minute (ms) (ms) (uV) (uV)
Control 70.29 .+-. 2.74 466.56 .+-. 18.15 494.00 .+-. 17.70 -325.90
.+-. 82.01 189.82 .+-. 39.54 (n = 45) DCM 64.88 .+-. 3.25 471.89
.+-. 20.81 470.66 .+-. 19.70 -199.67 .+-. 33.79 106.20 .+-. 14.64
(n = 57) Mean .+-. s.e.m.
TABLE-US-00005 TABLE 5 Parameters of single DCM iPSC-CMs measured
by AFM Cell Type Frequency (sec) Force (nN) Beat Duration (sec)
Control (n = 13) 1.01 .+-. 0.28 3.56 .+-. 0.97 0.34 .+-. 0.06
DCM/DCM-Ad.GFP 0.76 .+-. 0.09 0.65 .+-. 0.05 0.37 .+-. 0.07 (n =
17) DCM-Ad.Serca2a 1.09 .+-. 0.17 4.35 .+-. 1.01 0.16 .+-. 0.02 (n
= 12) Mean .+-. s.e.m.
TABLE-US-00006 TABLE 6 Primers used for real time quantitative-PCR
and allelic-PCR Amplicon Forward Primer Reverse Primer ACTB
TGAAGTGTGACGTGGACATC GGAGGAGCAATGATCTTGAT (SEQ ID NO: 1) (SEQ ID
NO: 2) OCT4 Total AGCGAACCAGTATCGAGAAC TTACAGAACCACACTCGGAC (SEQ ID
NO: 3) (SEQ ID NO: 4) OCT4 CCTCACTTCACTGCACTGTA CAG
GTTTTCTTTCCCTAGCT Endogenous (SEQ ID NO: 5) (SEQ ID NO: 6) SOX2
Total AGCTACAGCATGATGCAGGA GGTCATGGAGTTGTACTGCA (SEQ ID NO: 7) (SEQ
ID NO: 8) Sox2 Endogenous CCCAGCAGACTTCACATGT CCTCCCATTTCCCTCGTTTT
(SEQ ID NO: 9) (SEQ ID NO: 10) Klf4 Total TCTCAAGGCACACCTGCGAA
TAGTGCCTGGTCAGTTCATC (SEQ ID NO: 11) (SEQ ID NO: 12) Klf4
Endogenous GATGAACTGACCAGGCACTA GTGGGTCATATCCACTGTCT (SEQ ID NO:
13) (SEQ ID NO: 14) C-MYC Total ACTCTGAGGAGGAACAAGAA
TGGAGACGTGGCACCTCTT (SEQ ID NO: 15) (SEQ ID NO: 16) C-MYC
TGCCTCAAATTGGACTTTGG GATTGAAATTCTGTGTAACTGC Endogenous (SEQ ID NO:
17) (SEQ ID NO: 18) Nanog Total TGAACCTCAGCTACAAACAG
TGGTGGTAGGAAGAGTAAAG (SEQ ID NO: 19) (SEQ ID NO: 20) TNNT2 Wt
GGAGGAGGAGCTCGTTTCTCTCA CATGTTGGACAAAGCCTTCTTCTT AAG (SEQ ID NO:
21) CCG (SEQ ID NO: 22) TNNT2 mutant GGAGGAGGAGCTCGTTTCTCTCA
CATGTTGGACAAAGCCTTCTTCTT AAG (SEQ ID NO: 23) CCA (SEQ ID NO:
24)
TABLE-US-00007 TABLE 7 Selected enriched pathways for rescued genes
after Serca2a over-expression in DCM iPSC-CMs Canonical Pathways
Genes Factors Promoting SMAD2, BMP4, LEF1, DKK1, BMP10, PDGFRB
Cardiogenesis in Vertebrates Calcium Signaling HDAC9, NFATC1,
CASQ2, ACTA1. TMEM38B, NECAB1, ATP1A3, ATP2A2 Integrin
Signaling/Cytoskeletal TSPAN7, ITGA8, TSPAN2, ACTA1, ITGB3, ACTA1,
ITGB3, KIF1A, MAP2, DYNLT3, ITGA8 Human Embryonic Stem Cell SMAD2,
BMP4, LEF1, BMP10, PDGFRB Pluripotency Protein Ubiquitination
Pathway UBD, DNAJB4, USP17, DNAJB9, HSPA4L, USP17L2, USP17L6P,
UGT2B7, UHRF1, UIMC1 Wnt/.beta.-catenin Signaling UBD, GNA01, LEF1,
DKK1, SOX5 G-Protein Coupled Receptor Signaling GPR124, NPY1R,
FSHR, GNA01, VN1R1, BDKRB1, OR4F16, OR4F17, OR52N5, OR5R1 Protein
Kinase A Signaling LEF1, NFATC1, HIST1H1B, HIST2H3C, HIST1H3F,
HIST1H3J, HIST2H3A, HIST2H3D
TABLE-US-00008 TABLE 8 Spread of iPSC lines analyzed by each assay
Phenotype DCM CON Individual Ia IIa IIb IIIa Ib IIc IIb
Lines/Clones 1 2 1 2 1 3 1 3 1 4 2 3 1 2 Teratoma assay x x x x x x
x x x x x x x x Karyotyping x x x x x x x x x x x x x x Bisulphite
x x x x x x x x x x x x x x Beating EBs MEA x x x x x x x x x x x
baseline Patch clamping x x x x x x x x x x single CMs MEA NE
treatment x x x x x x beating EBs Calcium imaging x x x x x x x x x
x x x single CMs CMs sarcomeric x x x x x x x x x x x x x x
integrity analysis Sarcomeric integrity x x x x x x after NE
treatment AFM single CMs x x x x Metoprolol treatment x x x x
Serca2a Treatment x x x x Microarray Serca2a x x x x Treatment
Example 2
Cardiomyocytes from Patients with Hypertrophic Cardiomyopathy
[0147] Hypertrophic cardiomyopathy (HCM) is an autosomal dominant
disease of the cardiac sarcomere, and is estimated to be the most
prevalent hereditary heart condition in the world. Patients with
HCM exhibit abnormal thickening of the left ventricular (LV)
myocardium in the absence of increased hemodynamic burden and are
at heightened risk for clinical complications such as progressive
heart failure, arrhythmia, and sudden cardiac death (SCD).
Molecular genetic studies from the past two decades have
demonstrated that HCM is caused by mutations in genes encoding for
proteins in the cardiac sarcomere. While identification of specific
mutations has defined the genetic causes of HCM, the pathways by
which sarcomeric mutations lead to myocyte hypertrophy and
ventricular arrhythmia are not well understood. Efforts to
elucidate the mechanisms underlying development of HCM have yielded
conflicting results, paradoxically supporting models of both loss
in myosin function and gain in myosin function to explain
development of the disease. Attempts to resolve these discrepancies
have been hampered by difficulties in obtaining human cardiac
tissue and the inability to propagate heart samples in culture.
[0148] To circumvent these hurdles, we generated induced
pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) from a
family of 10 individuals, half of whom carry an autosomal dominant
missense mutation on exon 18 of the .beta. myosin heavy chain gene
(MYH7) encoding for an Arginine to Histidine substitution at amino
acid position 663 (Arg663His). The generation of patient-specific
iPSC-CMs allows for recapitulation of HCM at the single cell level
and that preclinical modeling of HCM iPSC-CMs can elucidate the
mechanisms underlying development of the disease. These findings
validate iPSC technology as a novel method to understand how
sarcomeric mutations cause the development of HCM and to identify
new therapeutic targets for the disease.
[0149] Recruitment of HCM family cohort and evaluation of disease
genotype and phenotype. A 10 member family cohort that spanned two
generations (II and III) was recruited for isolation of dermal
fibroblasts. The proband was a 53-year old African American female
patient (II-1) who presented at the hospital with palpitations,
shortness of breath, and exertional chest pain. Results from
comprehensive testing revealed concentric left ventricular
hypertrophy (LVH) with prominent thickening of the inferior septum
and inferior wall (FIG. 31A). To confirm presence of an HCM causing
mutation, the proband's genomic DNA was screened for mutations with
a panel of 18 genes associated with HCM. Nucleotide sequence
analysis demonstrated a known familial HCM missense mutation on
exon 18 of the .beta.-myosin heavy chain gene, which causes an
Arginine to Histidine substitution at amino acid position 663
(Arg663His; FIG. 31B). Subsequent genetic evaluation of the
proband's family revealed that four of her eight children (III-1,
III-2, III-3, III-8; ages 21, 18, 14, 10) carried the Arg663His
mutation (FIG. 31C). The proband's family underwent the same
comprehensive clinical evaluation, which revealed mild LVH in the
two eldest carriers on echocardiography and MRI as well as
occasional premature ventricular contractions on ambulatory
monitoring. The two younger carriers (III-3 and III-8; ages 14 and
10) had not fully developed the phenotype, but did exhibit
hyperdynamic function by echocardiography. The proband's husband
(II-2; age 55) and other four children (III-4, III-5, III-6, III-7;
ages 20, 16, 5 14, 13)
TABLE-US-00009 TABLE 9 Genes Screened Gene Symbol Protein Code NCBI
Ref Gene No. Mutation(s) ACTC1 alpha-cardiac actin NG_007553 None
CAV3 caveolin 3 NG_008797 None GLA galactosidase alpha NG_007119
None LAMP2 lysosomal-associated membrane protein 2 NG_007993 None
MTTG mitochondrial transfer RNA glycine NC_012920_TRNG None MTTI
mitochondrial transfer RNA isoleucine NC_01296_TRNI None MTTK
mitochondrial transfer RNA lysine NC_012920_TRNK None MTTQ
mitochondrial transfer RNA glutamine NC_012920_TRNQ None MYBPC3
cardiac myosin-binding protein C NG_007667 None MYH7 beta-myosin
heavy chain NG_007884 Arg663His MYL2 myosin regulatory light chain
2 NG_007554 None MYL3 myosin light chain 3 NG_007555 None PRKAG2
5'-AMP-activated protein kinase subunit gamma-2 NG_007486 None
TNNC1 troponin C NG_008963 None TNNI3 cardiac muscle troponin I
NG_007866 None TNNT2 cardiac muscle troponin T MG_007556 None TPM1
alpha tropomyosin NG_007553 None TTR Transthyretin NG_009490
None
[0150] Generation of patient-specific iPSCs and confirmation of
pluripotency Patient-specific iPSCs were generated from primary
fibroblasts of all 10 individuals through lentiviral infection with
the reprogramming factors Oct-4, Sox-2, Klf-4 and c-Myc. A minimum
of 3 distinct lines was generated per patient, and assayed for
pluripotency through a battery of tests. Established iPSCs
exhibited positive immunostaining for the ESC markers SSEA-4,
TRA-1-60, TRA-1-81, Oct4, Sox2, Nanog, and alkaline phosphatase, as
well as protein expression for the transcription factors Oct4,
Sox2, and Nanog. Quantitative bisulfite pyrosequencing and
quantitative RT-PCR demonstrated hypomethylation of Nanog and Oct-4
promoters, activation of endogenous pluripotency transcription
factors, and silencing of lentiviral transgenes. Microarray
analyses comparing whole genome expression profiles of dermal
fibroblasts, iPSCs, and human ESCs (WA09 line) further confirmed
successful reprogramming of all cell lines. Karyotyping
demonstrated stable chromosomal integrity in all iPSC lines through
passage 30. Spontaneous embryoid body (EB) and teratoma formation
assays yielded cellular derivatives of all three germ layers in
vitro and in vivo, confirming the pluripotent nature of generated
iPSCs. Restriction enzyme digestion and sequencing verified the
presence and absence of the Arg663His mutation in the MYH7 locus of
HCM and control iPSCs respectively.
[0151] Differentiation of patient-specific iPSCs into
cardiomyocytes. Established iPSC lines from all subjects were
differentiated into cardiomyocyte lineages (iPSC-CMs) using
standard 3D EB differentiation protocols. Ten to twenty days
following the initiation of differentiation, spontaneously
contracting EBs were observed to appear under light microscopy.
Immunostaining for cardiac Troponin T indicated beating EBs from
both control and HCM iPSC lines contained cardiomyocyte purities
between 60-80%. Beating EBs were seeded on multi-electrode array
(MEA) probes for evaluation of electrophysiological properties.
Both control and HCM iPSC-derived EBs exhibited comparable beat
frequencies, field potentials, and upstroke velocities at baseline.
EBs were subsequently dissociated into single iPSC-CMs and plated
on gelatin coated chamber slides for further analysis. Single
dissociated iPSC-CMs from both HCM and control family members
maintained spontaneous contraction and exhibited positive staining
for sarcomeric proteins such as cardiac troponin T and myosin light
chain (FIG. 31D).
[0152] iPSC-CMs carrying the Arg663His mutation recapitulate HCM
phenotype in vitro Following cardiac differentiation and
dissociation to single beating cells, diseased and control-matched
iPSC-CMs were characterized in vitro for recapitulation of the HCM
phenotype. Hypertrophic iPSC-CMs exhibited features of HCM such as
cellular enlargement and multinucleation beginning in the sixth
week following induction of cardiac differentiation (Arad et al.,
2002). At day 40 post-induction, HCM iPSC-CMs were noticeably
larger (1859+517 pixels; n=236, 4 patient lines) than control
matched iPSC-CMs (1175+328 pixels; n=220, 4 patient lines) and
exhibited significantly higher frequencies of multinucleation (HCM:
49.7+8.5%; n=236, 4 lines vs control: 23.0+3.7%; n=220, 4 lines)
(FIG. 31D-F). Mutant iPSC-CMs also demonstrated other hallmarks of
HCM including expression of atrial natriuretic factor (ANF),
elevation of .beta.-myosin/.alpha.-myosin ratio, calcineurin
activation, and nuclear translocation of nuclear factor of
activated T-cells (NFAT) as detected by immunostaining (FIG.
31G-K). As calcineurin-NFAT signaling is a key transcriptional
activator for induction of hypertrophy in adult cardiomyocytes, we
sought to test the importance of this pathway to hypertrophic
development in HCM iPSC-CMs. Blockade of calcineurin-NFAT
interaction in HCM iPSC-CMs by cyclosporin A (CsA) and FK506
reduced hypertrophy by over 40% (FIG. 31L). In the absence of
inhibition, NFAT-activated mediators of hypertrophy such as GATA4
and MEF2C were found to be significantly upregulated in HCM
iPSC-CMs beginning day 40 post-induction of cardiac
differentiation, but not prior to this point. Taken together, these
results indicate that calcineurin-NFAT signaling plays a central
role in the development of the HCM phenotype as caused by the
Arg663His mutation.
[0153] Single cell gene expression profiling demonstrates
activation of HCM associated genes Clinical presentation of HCM
typically occurs over the course of several decades in affected
individuals. To investigate the temporal effects of the Arg663His
mutation upon HCM development at the cellular level, we assessed
the expression of hypertrophic-related genes in single purified
iPSC-CMs from both HCM and control patients. Single contracting
cardiomyocytes were manually lifted from culture dishes at days 20,
30, and 40 from initiation of differentiation and subjected to
single cell quantitative PCR analysis using a panel of 32
cardiomyocyte-related transcripts. Beginning at day 40,
hypertrophic related genes such as GATA4, TNNT2, MYL2, and MYH7
were found to be upregulated in HCM iPSC-CMs (FIG. 31M). No
significant increases in expression of HCM related genes were found
prior to this time point.
[0154] iPSC-CMs carrying the Arg663His mutation exhibit
electrophysiological and contractile arrhythmia at the single cell
level Arrhythmia is a clinical hallmark of HCM, and is responsible
for a significant portion of morbidity and mortality associated
with the disease including sudden cardiac death. We therefore next
examined the electrophysiological properties of iPSCCMs carrying
the Arg663His mutation by whole cell patch clamping. Both HCM and
control iPSC-CMs contained myocyte populations characterized by
nodal-like, ventricular-like, and atrial-like electrical waveforms.
In the first four weeks following induction of differentiation,
cells from both groups displayed similar action potential
frequencies, peak amplitudes, and resting potentials. However,
starting at day 30, a large subfraction (40.4+12.9%; n=131, 5
patient lines) of HCM myocytes as compared to controls (5.1+7.1%;
n=144, 5 patient lines) were observed to exhibit arrhythmic
waveforms including frequent small depolarizations that resembled
delayed afterdepolarizations (DADs) that failed to trigger action
potentials and clustered beats (FIG. 32A1, 32A2, 32B-C). Time-lapse
videos of single beating iPSC-CMs under light microscopy confirmed
that electrophysiological deficiencies resulted in contractile
arrhythmia. Compared to control iPSCCMs (1.4+1.9%; n=68, 5 patient
lines), which had regular beat intervals, HCM iPSC-CMs contained
numerous cells (12.4+5.0%; n=64, 5 patient lines) that beat at
irregular frequencies. Analysis of single cell video recordings by
pixel quantification software confirmed the arrhythmic nature of
HCM iPSC-CM contraction. Taken together, these findings demonstrate
sarcomeric mutations are capable of inducing electrophysiological
and contractile arrhythmia at the single cell level.
[0155] Overexpression of the Arg663His mutation in normal hESC-CMs
recapitulates calcium handling abnormalities of HCM iPSC-CMs
Calcium (Ca.sup.2+) plays a fundamental role in regulation of
excitation-contraction coupling and electrophysiological signaling
in the heart. To investigate the possible mechanisms underlying
arrhythmia in myocytes carrying the Arg663His mutation, we next
analyzed Ca.sup.2+ handling properties of iPSC-CMs from control and
HCM patients using the fluorescent Ca.sup.2+ dye Fluo-4
acetoxymethyl ester (AM). Compared to iPSC-CMs derived from healthy
individuals, HCM iPSC-CMs demonstrated significant Ca.sup.2+
transient irregularities such as multiple events possibly related
to triggered arrhythmia-like voltage waveforms, which were
virtually absent in control cells (FIG. 32D-E). Interestingly,
irregular Ca.sub.2+ transients were observed to occur in HCM
iPSC-CMs prior to the onset of cellular hypertrophy, suggesting
that abnormal Ca.sup.2+ handling may be a causal factor for the
induction of the hypertrophic phenotype. Because variations
inherent to spontaneous contractions can potentially confound
Ca.sup.2+ transients, we subjected HCM and control iPSC-CMs to 1 Hz
pacing during line scanning. Consistent with data from spontaneous
contraction, abnormal Ca.sub.2+ transients were found to be common
in HCM iPSC-CMs (12.5+4.9%; n=19, 5 patient lines) and absent in
control iPSC-CMs (n=20, 5 patient lines). To further ensure that
observed deficiencies in electrophysiology and Ca.sup.2+ regulation
were due to the Arg663His mutation, we next over-expressed the
mutant form of myosin in human embryonic stem cell-derived
cardiomyocytes (hESC-CMs; WA09 line). hESC-CMs overexpressing the
Arg663His mutant MYH7 transcript were found to exhibit similar
arrhythmias and abnormal Ca.sup.2+ transients (FIG. 32F-I).
[0156] Previous reports have linked intracellular Ca.sup.2+
([Ca.sup.2+].sub.i) elevation as a trigger for arrhythmia and
cellular hypertrophy. We therefore further compared
[Ca.sup.2+].sub.i in control and diseased iPSC-CMs. Preliminary
quantification of [Ca.sup.2+].sub.i by Fluo-4 baseline intensity
suggested that [Ca.sup.2+].sub.i was approximately 30% higher in
HCM iPSCCMs (n=105, 4 patient lines) than control counterparts
(n=122, 4 patient lines) at day 30 postinduction (FIG. 32J). To
confirm diastolic [Ca.sup.2+].sub.i differences, we also used the
ratiometric Ca.sup.2+ dye Indo-1 in control and HCM iPSC-CMs.
Indo-1 imaging demonstrated that diastolic [Ca.sup.2+].sub.i was
higher (25.1% increase in Indo-1 ratio) in iPSC-CMs carrying the
Arg663His mutation (n=26, 4 patient lines) as compared to control
cells (n=17, 4 patient lines), and that arrhythmic activity was
apparent in only the Arg663His myocytes. These findings emphasize a
role for irregular Ca.sup.2+ cycling in the pathogenesis of HCM
(FIG. 32K-L).
[0157] Measurement of sarcoplasmic reticulum (SR) Ca.sup.2+ stores
further supported findings of elevated [Ca.sub.2+].sub.i in
diseased iPSC-CMs as cytoplasmic retention of Ca.sup.2+ has been
shown to decrease SR Ca.sup.2+ load by impeding SR Ca.sup.2+
uptake. HCM and control iPSC-CMs were loaded with Fluo-4 and
exposed to caffeine, which induces release of SR Ca.sub.2+ stores
into the cytoplasm. Myocytes carrying the Arg663His mutation were
characterized by significantly smaller SR Ca.sup.2+ release (mean
peak .DELTA.F/F0 ratio=3.05+0.20, n=35, 3 patient lines) as
compared to control iPSC-CMs (mean peak .DELTA.F/F0
ratio=3.96+0.18, n=23, 3 patient lines) (FIG. 32M-N). These
findings demonstrate a central role for Ca.sub.2+ cycling
dysfunction and elevated [Ca.sup.2+].sub.i in the pathogenesis of
HCM as caused by the Arg663His mutation.
[0158] Inotropic stimulation exacerbates HCM phenotype in diseased
iPSC-CMs Because iPSC-CMs carrying the Arg663His mutation
recapitulated numerous aspects of the HCM phenotype in vitro, we
hypothesized that our platform could also be used as a screening
tool to assess the effect of pharmaceutical drugs upon HCM at the
single cell level. To test the capacity of HCM iPSC-CMs to
accurately model pharmaceutical drug response, we first subjected
single control and diseased iPSC-CMs to positive inotropic
stimulation, a known trigger for myocyte hypertrophy and
ventricular tachycardia. Patient-specific cardiomyocytes were
incubated .beta.-adrenergic agonist (200 .mu.M isoproterenol) on a
daily basis for 5 days beginning 30 days after induction of
differentiation. Previously HCM iPSC-CMs typically did not exhibit
cellular hypertrophy until day 40 post-induction (FIG. 31E), but
were found to increase in cell size by 1.7-fold between day 30 and
35 as compared to control counterparts when treated with
isoproterenol (FIG. 33A). .beta.-adrenergic stimulation was also
found to severely exacerbate presentation of irregular Ca.sub.2+
transients and arrhythmia in HCM iPSC-CMs (FIG. 33B-C).
Importantly, co-administration of .beta.-adrenergic blocker (400
.mu.M propranolol) with isoproterenol significantly ameliorated
catecholamine-induced exacerbation of hypertrophy, Ca.sup.2+
handling deficiencies, and arrhythmia.
[0159] Treatment of Ca.sup.2+ dysregulation prevents development of
the HCM phenotype We therefore assessed whether pharmaceutical
inhibition of Ca.sup.2+ entry could help prevent HCM phenotype
development by treating control and mutant iPSC-CMs with the L-type
Ca.sup.2+ channel blocker verapamil. Compared to control cells, the
spontaneous beating rate in HCM iPSC-CMs was relatively resistant
to verapamil as detected by MEA dose-response experiments (HCM
IC.sub.50=930.61+80.0 nM, control IC.sub.50=103.0+6.0 nM),
consistent with the elevated [Ca.sup.2+].sub.i in iPSC-CMs carrying
the Arg663His mutation. Remarkably, continuous addition of
verapamil at therapeutic dosages (50-100 .mu.M) to single diseased
iPSC-CMs for 10-20 sequential days significantly ameliorated all
aspects of the HCM phenotype including myocyte hypertrophy,
Ca.sup.2+ handling abnormalities, and arrhythmia (FIG. 34A-C).
[0160] Arrhythmic iPSC-CMs can be screened for potential
pharmaceutical treatments at the single cell level As current
pharmaceutical therapy for HCM includes the use of .beta.-blockers
and antiarrhythmics in addition to Ca.sup.2+ channel blockers we
further screened a panel of 12 other drugs used clinically to treat
HCM for their potential to ameliorate the HCM phenotype at the
single cell level. While verapamil was the only agent found to be
capable of preventing cellular hypertrophy, anti-arrhythmic drugs
which inhibit Na.sub.+ influx such as lidocaine, mexiletine, and
ranolazine also demonstrated potential to restore normal beat
frequency in HCM iPSC-CMs, possibly through limiting Ca.sup.2+
entry into the cell by the Na.sub.+/Ca.sub.2+ exchanger. Other
anti-arrhythmic agents targeting K.sub.+ channels and
.beta.-blockers administered in the absence of inotropic
stimulation did not have any therapeutic effects in single cells.
Altogether, these results implicate imbalances in Ca.sub.2+
regulation as a central mechanism underlying development of HCM at
the cellular level and demonstrate the potential of
patient-specific iPSC-CMs as a powerful tool for the identification
of novel pharmaceutical agents to treat HCM.
TABLE-US-00010 TABLE 10 Drugs that were Screened Video Therapeutic
Concentrations Drug Class Target Analysis Effect Tested Quinidine
Ia Na.sup.+ channel blocker X no 0.1-20 uM (intermediate
association/dissociation) Procainamide Ia Na.sup.+ channel blocker
.circleincircle. no 1-200 uM (intermediate
association/dissociation) Lidocaine Ib Na.sup.+ channel blocker
(fast .circleincircle. yes 1-100 nM association/dissociation)
Mexiletine Ib Na.sup.+ channel blocker (fast .circleincircle. yes
1-50 uM association/dissociation) Ranolazine NA Late Na.sup.+
channel blocker .circleincircle. yes 0.1-10 uM Flecainide Ic
Na.sup.+ channel blocker (slow .circleincircle. no 0.1-5 uM
association/dissociation Propafenone Ic Na.sup.+ channel blocker
(slow .circleincircle. no 1-100 uM association/dissociation
Propranolol II Beta-blocker .circleincircle. no 1-400 uM Metoprolol
II Beta-blocker X no 0.1-20 uM Amiodarone II K.sup.+ channel
blocker X no 0.1-10 uM Sotalol III K.sup.+ channel blocker X no
1-400 uM Dofetilide III K.sup.+ channel blocker X no 0.1-20 uM
Verapamil IV Ca.sup.2+ channel blocker X yes* 1-100 uM *Verapamil
was only observed to have a therapeutic effect upon HCM iPSC-CMs
following continuous addition to the culture media for 5 or more
days in a row. Treatment for a period of time less than 5 days was
not observed to have any therapeutic effects upon Ca.sup.2+
handling or arrhythmogenicity. All other durg screening assays were
conducted by incubating cells with respective pharmaceutical
compunds at the listed concentrations for 10 minutes followed by
washout.
The genetic causes of HCM were initially identified several decades
ago. However, the mechanisms by which mutations in genes encoding
for the cardiac sarcomere can cause development of HCM remain
unclear. Generation of patient-specific iPSC-CMs has allowed for in
depth modeling of hereditary cardiovascular disorders including
dilated cardiomyopathy, LEOPARD and long QT syndrome. To elucidate
the signaling pathways underlying HCM development, we utilized iPSC
technology to generate functional cardiomyocytes from dermal
fibroblasts of a 10-member family cohort, half of whom possess the
HCM Arg663His mutation in the MYH7 gene. Patient-specific iPSC-CMs
recapitulated a number of characteristics of HCM including cellular
hypertrophy, calcineurin-NFAT activation, upregulation of
hypertrophic transcription factors, and contractile arrhythmia.
Irregular Ca.sup.2+ transients and elevation of diastolic
[Ca.sup.2+].sub.i were observed to precede the presentation of
other phenotypic abnormalities, strongly implicating dysregulation
of Ca.sup.2+ cycling as a central mechanism for pathogenesis of the
disease. Imbalances in Ca.sup.2+ homeostasis have been described as
a key characteristic of HCM in numerous reports. However, little
evidence exists to delineate whether these abnormalities are a
symptom of HCM or a causal factor.
[0161] In this study, we present several lines of evidence for a
crucial role of Ca.sup.2+ in development of HCM as caused by the
Arg663His mutation. Specifically, our findings show that an
elevation in [Ca.sup.2+].sub.i mediated by the Arg663His mutation
can induce both cellular hypertrophy and contractile arrhythmia.
The sustained elevation of [Ca.sup.2+].mu.s a known trigger for
activation of calcineurin, a Ca.sup.2+ dependent phosphatase that
is a critical effector of hypertrophy in myocytes under conditions
of stress. Activated calcineurin dephosphorylates NFAT3
transcription factors, allowing their translocation to the nucleus
for direct interaction with classical mediators of hypertrophy such
as GATA4 and MEF2. Time-based gene expression profiling of single
iPSC-CMs following induction of cardiac differentiation confirmed
this model as expression of downstream effectors of hypertrophy was
observed to be dependent on [Ca.sup.2+].sub.i elevation and nuclear
translocation of NFAT. Inhibition of calcineurin activity by CsA
and FK506 as well as reduction of Ca.sup.2+ influx by verapamil
mitigated cellular hypertrophy, confirming the role of Ca.sup.2+
dysfunction and calcineurin-NFAT signaling in HCM pathogenesis
(FIG. 34D). Alterations in Ca.sup.2+ cycling are a common trigger
for cardiac arrhythmias, which are a serious clinical complication
of HCM due to their potential to induce stroke or sudden cardiac
death.
[0162] The mechanisms underlying arrhythmia in patients with HCM
are not well understood, although reports have implicated
interstitial fibrosis, abnormal cardiac anatomy, myocyte disarray,
increased cell size, and dysfunction in Ca.sup.2+ homeostasis as
possible mediators. Our findings demonstrate for the first time
that the Arg663His mutation in the MYH7 gene can directly result in
electrophysiological and contractile arrhythmia at the single cell
level even in the absence of cellular hypertrophy. The most likely
mechanism for development of arrhythmia in individual HCM iPSC-CMs
is buildup of [Ca.sup.2+].sub.i, which induces delayed after
depolarizations (DADs) whereby sarcoplasmic reticulum Ca.sup.2+
release triggers transient inward current following action
potential repolarization. Continued presentation of DADs can in
turn lead to ventricular tachycardia and sudden cardiac death, as
in patients suffering from recurrent arrhythmia.
[0163] Whole cell current clamp experiments of HCM iPSC-CMs
supported this hypothesis through demonstration of frequent
spontaneous DAD-like waveforms in diseased myocytes. We believe
these results are the first report to demonstrate that specific HCM
mutations such as Arg663His can act as direct triggers for
arrhythmia at the single cell level.
[0164] The mechanistic role of elevated myocyte Ca.sup.2+ loading
seems to be central to both hypertrophy and arrhythmogenesis.
Pharmaceutical drug screening of mutant iPSC-CMs further supported
elevated [Ca.sup.2+].sub.i as a central mechanism for arrhythmia
development. Of the 13 agents we used, only pharmaceutical blockade
of Ca.sup.2+ and Na.sup.+ entry mitigated contractile arrhythmia in
HCM iPSC-CMs. Reduction of Na.sup.+ influx limits [Ca.sup.2+].sub.i
by allowing Na.sup.+/Ca.sup.2+ exchange to remove Ca.sup.2+ more
readily. Our results demonstrate the utility of iPSC-based
technology to model development of HCM and associated triggered
arrhythmias, as well as to identify potential therapeutic agents
for the disease. These results are the first to provide direct
evidence of imbalances in Ca.sup.2+ homeostasis as an initiating
factor in the development of HCM at the single cell level.
Experimental Procedures
[0165] Patient recruitment. Clinical evaluation of the proband and
family included physical examination, ECG, cardiac magnetic
resonance imaging (MRI), and 24-hour Holter monitoring. Results
revealed hyperdynamic ventricular systolic function with near
complete obliteration of the apical walls at end systole in the
proband (II-1) and the eldest two carriers (III-1 and III-2). No
delayed enhancement was found on contrast enhanced MRI in the
proband or carriers. Ambulatory monitoring revealed occasional
premature ventricular contractions. The youngest two carriers
(III-3 and III-8; ages 14 and 10) exhibited hyperdynamic cardiac
function but no other clinical features of HCM most likely due to
their young age.
[0166] Isolation and maintenance of fibroblast cells. Freshly
isolated skin biopsies were rinsed with PBS and transferred into a
1.5 ml tube. Tissue was minced in collagenase I (1 mg/ml in
Dulbecco's modified Eagle medium (DMEM), Invitrogen, Carlsbad,
Calif.) and allowed to digest for 6 hours at 37.degree. C.
Dissociated dermal fibroblasts were plated and maintained with DMEM
containing 10% FBS (Invitrogen), Glutamax (Invitrogen), 4.5 g/L
glucose (Invitrogen), 110 mg/L sodium pyruvate (Invitrogen), 50
U/mL penicillin (Invitrogen), and 50 g/mL streptomycin (Invitrogen)
at 37.degree. C., 95% air, and 5% CO2 in a humidified incubator.
All cells were used for reprogramming within five passages.
[0167] Lentivirus production and transduction. 293FT cells
(Invitrogen) were plated at 80% confluency on 100-mm dishes and
transfected with 12 .mu.g of the lentiviral vectors (Oct4, Sox2,
Klf4, and c-MYC) plus 8 .mu.g of packaging pPAX2 and 4 .mu.g of
VSVG plasmids using Lipofectamine 2000 (Invitrogen) following the
manufacturer's instructions. Supernatant was collected 48 h after
transfection, filtered through a 0.45-.mu.m pore-size cellulose
acetate filter (Millipore, Billerica, Mass.), and mixed with PEG-it
Virus Concentration Solution (System Biosciences, Mountain View,
Calif.) overnight at 4.degree. C. Viruses were precipitated at
1,500 g the next day and resuspended with Opti-MEM medium
(Invitrogen).
[0168] Derivation of patient-specific iPSCs. Generation,
maintenance, and characterization of patient-specific iPSC lines
were performed as previously described using lentivirus as produced
above on Matrigel-coated tissue culture dishes (BD Biosciences, San
Jose, Calif.) with mTESR-1 hESC Growth Medium (StemCell Technology,
Vancouver, Canada)
[0169] Alkaline phosphatase staining. Alkaline phosphatase (AP)
staining was conducted as in previous studies using the
Quantitative Alkaline Phosphatase ES Characterization KitS
(Millipore) using the manufacturer's instructions.
[0170] Immunofluorescence staining. Immunofluorescent stains were
performed using the following primary antibodies: SSEA-3, SSEA-4,
Tra-1-60, Tra-1-81, ANF, Tuj-1 (Millipore), Oct3/4, Nanog, AFP
(Santa Cruz, Calif.), Sox2 (Biolegend, San Diego, Calif.), smooth
muscle actin (Biolegend), sarcomeric .alpha.-actinin (Sigma, St.
Louis, Mo.), (cTnT (Thermo Scientific Barrington, Ill.), Alexa
Fluor 488 Phalloidin (invitrogen), Myosin light chain 2a (MLC2a),
Myosin light chain 2v (MLC2v) (Synaptic Systems, Goettingen,
Germnay), and AlexaFluor conjugated secondary antibodies
(Invitrogen) as previously described.
[0171] Bisulphite pyrosequencing. The Zymo DNA Methylation Kit
(Zymo Research, Irvine, Calif.) was used to treat 1 .mu.g of sample
DNA with bisulfite as per the manufacturer's instructions.
Following PCR, cDNA was converted to single-stranded DNA templates
and sequenced by a Pyrosequencing PSQ96 HS System (Biotage,
Charlotte, N.C.). QCpG software (Biotage) was used to analyze each
individual locus as a T/C SNP.
[0172] Microarray hybridization and data analysis. RNA was isolated
from iPSCs and hybridized to a Affymetrix GeneChip Human Gene 1.0
ST Array (Affymetrix, Santa Clara, Calif.). Expression was
normalized and annotated by the Affymetrix Expression Console
software (Affymetrix). The Pearson Correlation Coefficient was
calculated for each pair of samples using the expression level of
transcripts which shows standard deviation greater than 0.2 among
all samples.
[0173] Spontaneous in vitro differentiation. For embroid body (EB)
formation, iPSC colonies were dissociated on Matrigel coated plates
with collagenase IV (Invitrogen), and seeded into low attachment
6-well plates in Knockout DMEM (Invitrogen) containing 15% KSR
(Invitrogen), Glutamax (Invitrogen), 4.5 g/L glucose (Invitrogen),
110 mg/L sodium pyruvate (Invitrogen), 50 U/mL penicillin
(Invitrogen), and 50 g/mL streptomycin (Invitrogen) to form embroid
bodies (EBs). After 5 days, EBs were transferred to adherent,
gelatin-coated chamber slides and cultured in the same medium for
another 8 days.
[0174] Teratoma formation. 1.times.10.sup.6 undifferentiated iPSCs
were suspended in 10 .mu.L Matrigel (BD Biosciences) and delivered
by a 28.5 gauge syringe to the subrenal capsule of 8 week old SCID
Beige mice. Eight weeks after cell delivery, tumors were explanted
for hematoxylin and eosin staining.
[0175] Western blot. Whole cell extracts were isolated using RIPA
buffer and 10 .mu.g protein was analyzed by Western blot using
specific antibodies against Oct4, c-Myc, Klf4, Actin (Santa Cruz),
Sox2 (Biolegend).
[0176] Cardiac differentiation of human ESCs and iPSCs. Human H9
ESCs and iPSCs were differentiated into cardiomyocytes as
previously described. Briefly, pluripotent stem cells were
dissociated with accutase (Sigma) at 80% confluence into small
clumps of 10-20 cells. Cells were resuspended in 2 ml basic media
containing StemPro34 (Invitrogen), 2 mM glutamine (Invitrogen), 0.4
mM monothioglycerol (Sigma), 50 .mu.g/ml ascorbic acid (Sigma), and
0.5 ng/ml BMP4 (R&D Systems, Minneapolis, Minn.) to form EBs.
For days 1-4 of cardiac differentiation, cells were treated with 10
ng/ml BMP4, 5 ng/ml human bFGF (R&D Systems), and 3 ng/ml
activin A (R&D Systems) added to the basic media. From days
4-8, EBs were refreshed with basic media containing human 50 ng/ml
DKK1 (R&D Systems) and 10 ng/ml human VEGF (R&D Systems).
From day 8 onwards, cells were treated with basic media containing
5 ng/ml human bFGF and 10 ng/ml human VEGF. Cultures were
maintained in a 5% CO.sub.2/air environment.
[0177] Measurement of cardiomyocyte size. For single cell
cardiomyocyte analysis, beating EBs were plated on gelatin-coated
dishes. Three days after plating, EBs were trypsinized, filtered
through a 40-mm size pore-size filter, and single cells re-plated
at low density on gelatin-coated chamber slides (Nalgene Nunc
International, Rochester, N.Y.). Three days after re-plating, cells
were fixed with 4% paraformaldehyde (Sigma), permeabilized in 0.3%
Triton (Sigma), blocked using 5% BSA, and stained for cardiac
troponin T (1:200, Thermo Fisher) overnight at 4.degree. C. Stained
cells were washed three times with PBS, and then incubated with the
Alexa Fluor 488 phalloidin (Invitrogen), Alexa Fluor 594
donkey-anti-mouse antibody (Invitrogen) and DAPI (Invitrogen) for 1
h. Cellular areas of normal and HCM iPSC-CMs were analyzed using
the ImageJ software package (National Institutes of Health,
Bethesda, Md.).
[0178] Single cell microfluidic PCR. Single beating iPSC-CMs were
picked manually under light microscopy and placed into separate PCR
tubes for reverse transcription and cDNA amplification with
specified primers as previously described. Amplified cDNA was
loaded into Biomark 48.48 Dynamic Array chips (Fluidigm, South San
Francisco, Calif.) for analysis by the BioMark Real-Time PCR
Analysis software (Fluidigm).
[0179] Calcium (Ca.sup.2+) imaging. iPSC-CMs were dissociated and
seeded in gelatin-coated 8-well LAB-TEK.RTM. II chambers (Nalgene
Nunc International) for calcium imaging. Cells were loaded with 5
.mu.M Fluo-4 AM (Invitrogen) and 0.02% Pluronic F-127 (Invitrogen)
in Tyrodes solution (140 mM NaCl, 5.4 mM KCl, 1 mM MgCl.sub.2, 10
mM glucose, 1.8 mM CaCl.sup.2, and 10 mM HEPES pH 7.4 with NaOH at
25.degree. C.) for 15 min at 37.degree. C. Following Fluo-4
loading, cells were washed three times with Tyrodes solution.
Imaging was conducted with a confocal microscope (Carl Zeiss, LSM
510 Meta, Gottingen, Germany) with a 63.times. lens using Zen
software (Carl Zeiss). For paced calcium dye imaging, fluorescence
was measured at 495+20 nm excitation and 515.+-.20 nm emission.
Videos were taken at 20 fps for 10 s recording durations. Cells
were stimulated at 1 and 2 Hz. Measurements were taken on an
AxioObserver Z1 (Carl Zeiss) inverted microscope equipped with a
Lambda DG-4 300 W Xenon light source (Sutter Instruments, Novato,
Calif.), an ORCA-ER CCD camera (Hamamatsu, Bridgewater, N.J.), and
AxioVison 4.7 software (Carl Zeiss). In each video frame, regions
of interest (ROls) were analyzed for changes in dye intensity f/f0,
with the resting fluorescence value f0 determined at the first
frame of each video. Background intensity was subtracted from all
values, and plots were normalized to zero.
[0180] Measurement of basal [Ca.sup.2+].sub.i using Indo-1-AM.
Cardiomyocytes were loaded in a culture medium containing 5 .mu.M
Indo-1 AM (Invitrogen) and 0.02% Pluronic F-127 (Invitrogen) for 20
minutes at 37.degree. C. After Indo-1 loading, cells were washed
three times with 2 mM Ca.sup.2+ Ringer (155 mM NaCl, 4.5 mM KCl, 2
mM CaCl.sub.2, 1 mM MgCl.sub.2, 10 mM D-glucose, and 5 mM Na-HEPES,
pH 7.4) and incubated for 20 minutes at room temperature to allow
for Indo-1 de-esterification. Cardiomyocytes were imaged in
Ca.sup.2+ Ringer at 32.degree. C. using a Zeiss Axiovert 200M
epifluorescence microscope. Indo-1 was excited at 350.+-.10 nm
using a 0.6 UVND filter (to attenuate excitation intensity) and a
400 DCLP. The emitted light was separated using a Cairn Optosplit
II (425 dichroic, 488/22 bandpass filter, Kent, UK). Spontaneous
Ca.sup.2+ transients were collected with 4.times.4 pixel binning in
stream acquisition mode using Metamorph software (Molecular
Devices, Sunnyvale, Calif.) at 100 ms exposures. For image
analysis, short and long wavelength emission channels were aligned
using the Cairn Image Splitter ImageJ plugin.
[0181] Caffeine treatment of iPSC-CMs. Cells were perfused with PBS
containing 1.8 mM Ca.sup.2+ and 1 mM Magnesium and paced at 1 Hz to
view regular transients. A two second puff of 20 mM stock caffeine
solution was delivered through a perfusion apparatus. Pacing was
turned off prior to caffeine reaching the cells in order to
accurately measure Ca.sub.2+ release.
[0182] Analysis of calcium imaging linescans. Average fluorescence
intensity for Ca.sup.2+ linescans was quantified using Fiji
(National Institutes of Health). Timing between transients was
defined as the time between the peaks of two successive spikes. The
Ca.sup.2+ baseline was defined as the median of all minima of
transients. Irregularity for spike timing was defined as the ratio
of the standard deviation (s.d.) to the mean.
[0183] Microelectrode array (MEA) recordings. Control and HCM iPSCs
were differentiated into beating EBs ranging from 60-80% purity of
CMs and seeded onto multi-electrode 40 arrays for recording of
field potential duration (FPD) and beating frequency (beats per
minute, BPM) and interspike intervals (ISI). Beating iPSC-CM EBs
were plated on gelatin-coated MEA probes (Alpha Med Scientific,
Osaka, Japan) prior to experiments 20-40 days post-differentiation.
Signals were acquired at 20 kHz with a MED64 amplifier (Alpha Med
Scientific) and digitized using a PC with PCI -6071 ND cards
(National Instruments, Austin, Tex.) running MED64 Mobius QT
software (Witwerx, Inc., Tustin, Calif.). All experiments were
performed at 35.8 to 37.5.degree. C. in DMEM without serum or
antibiotics. Stock verapamil solutions were made in double
distilled water at a 50 mM concentration. Dose-response experiments
were performed by adding 0.4 to 2 .mu.L of 1000.times. verapamil
concentrations in DMEM to the 1-2 ml volume in the MEA probe for 10
minutes at each dose. Beating frequencies and field potential
waveform data were extracted offline using Mobius QT and saved as
CSV files. Waveform data was imported into IGOR Pro (Wavemetrics,
Portland, Oreg.) for FPD and Vmax measurements. Beat frequencies
were normalized to baseline for verapamil dose-response experiments
and FPDs were adjusted to the beat frequency using the Bazett
correction formula: cFPD=FPD/ Interspike interval.
[0184] Patch clamping. Whole-cell patch-clamp recordings were
conducted using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht,
Germany). Contracting EBs were mechanically isolated, enzymatically
dispersed into single cells and attached to gelatincoated glass
coverslips (CS-22/40, Warner, Hamden, Conn.). While recordings, the
coverslips containing plated cardiomyocytes or the hERG-HEK293
cells were transferred to a RC-26C recording chamber (Warner)
mounted on to the stage of an inverted microscope (Nikon, Tokyo,
Japan). The glass pipettes were prepared using thin-wall
borosilicate glass (Warner) using a micropipette puller (Sutter
Instrument, Novato, Calif.), polished using a microforge
(Narishige, Tokyo, Japan) and had resistances between 2-4 MO.
Extracellular solution perfusion was continuous using a rapid
solution exchanger (Bio-logic, Grenoble, France) with solution
exchange requiring 1 min. Data were acquired using PatchMaster
software (HEKA, Germany) and digitized at 1.0 kHz. Data were
analyzed using PulseFit (HEKA), Igor Pro (Wavemetrics, Portland,
Oreg.), Origin 6.1 (Microcal, Northampton, Mass.), and Prism
(Graphpad, La Jolla, Calif.). For the whole-cell patch clamp
recordings of human cardiomyocytes generated from iPSCs,
temperature was maintained constant by a TC-324B heating system
(Warner) at 36-37.degree. C. Current clamp recordings were
conducted in normal Tyrode solution containing 140 mM NaCl, 5.4 mM
KCl, 1 mM MgCl.sub.2, 10 mM glucose, 1.8 mM CaCl.sub.2 and 10 mM
HEPES (pH 7.4 with NaOH at 25.degree. C.). The pipette solution
contained 120 mM KCl, 1 mM MgCl.sub.2, 10 mM HEPES, 3 mM Mg-ATP, 10
mM EGTA (pH 7.2 with KOH at 25.degree. C.). Verapamil (Sigma) was
dissolved in H.sub.2O and prepared as a 10 mM stock in a glass
vial. The stock solution was mixed vigorously for 10 min at room
temperature. For testing, the compound was diluted in a glass vial
using external solution; the dilution was prepared no longer than
30 min before using. Equal amounts of DMSO (0.1%) were present at
final dilution.
[0185] Quantitative RT-PCR. Total mRNA was isolated using TRIZOL
and 1 .mu.g was used to synthesize cDNA using the Superscript II
cDNA synthesis kit (Invitrogen). 0.25 .mu.L of the reaction mixture
was used to quantify gene expression by qPCR using SYBR.RTM. Green
Master Mix (Invitrogen). Expression values were normalized to the
average expression of GAPDH.
[0186] Drug treatment. Single contracting iPSC-CMs were treated
with pharmaceutical agents for 10 minutes for immediate analysis
followed by wash out. For inotropic stimulation experiments, 200
.mu.M isoproterenol and 400 .mu.M propranolol were added to the
cell medium for 5 continuous days. Verapamil treatment was
conducted by adding 50 .mu.M and 100 .mu.M to the culture medium of
iPSC-CMs for 10-20 continuous days on a daily basis.
Example 3
Cardiomyocytes from Patients with Anthracycline Toxicity
[0187] Anthracycline-induced cardiotoxicity (and resistance to
anthracycline-induced toxicity). Anthracyclines such as doxorubicin
are frontline chemotherapeutic agents that are used to treat
leukemias, Hodgkin's lymphoma, and solid tumors of the breast,
bladder, stomach, lung, ovaries, thyroid, and muscle, among other
organs. The primary side effect of anthracyclines is
cardiotoxicity, which results in severe heart failure for many of
the recipients receiving regimens utilizing this chemotherapeutic
agent. Patient specific iPSC-cardiomyocytes (iPSC-CMs) were derived
from individuals who are susceptible to anthracycline-induced
cardiotoxicity as well as from individuals who are not susceptible
to anthracycline-induced cardiotoxicity.
[0188] These cells are useful to detect and titrate cardiotoxic
chemotherapeutic drugs, as well as identify genes responsible for
susceptibility/resistance to anthracycline-induced cardiotoxicity.
Age matched patients receiving anthracycline based chemo regimens
were recruited, and assessed whether the patients developed
anthracycline-induced heart failure. Skin samples were collected
from the patients and generated iPSC-CMs from the fibroblasts.
[0189] Methods for the isolation and maintenance of fibroblast
cells; derivation of patient-specific iPSC cell lines; and cardiac
differentiation of cells was performed as described in Example 1 or
Example 2.
Example 4
Cardiomyocytes from Patients with ARVD
[0190] Arrhythmogenic right ventricular dysplasia (ARVD). ARVD is
an autosomal dominant disease of cardiac desmosomes that results in
arrhythmia of the right ventricle and sudden cardiac death. It is
second only to hypertrophic cardiomyopathy as a leading cause for
sudden cardiac death in the young. Patient specific
iPSC-cardiomyocytes (iPSC-CMs) were derived from a cohort of
patients carrying a hereditary mutation for ARVD as well as from
family matched controls. These cell lines may be used for drug
screening and to identify molecular targets responsible for the
disease phenotype.
[0191] Methods for the isolation and maintenance of fibroblast
cells; derivation of patient-specific iPSC cell lines; and cardiac
differentiation of cells was performed as described in Example 1 or
Example 2.
[0192] The iPSC-CMs were made from the blood of 6 patients. 2
patients had a P672fsX740 2013delC mutation in the PKP2 gene, 2
patients had a Q617X 1849C>T mutation in the PKP2 gene, and 2
patients were family matched control subjects.
Example 5
Cardiomyocytes from Patients with LVNC
[0193] Left Ventricular Non-Compaction (LVNC, aka non-compaction
cardiomyopathy). LVNC is a hereditary cardiac disease which results
from impaired development of the myocardium (heart muscle) during
embryogenesis. Patients with mutations causing LVNC develop heart
failure and abnormal cardiac electrophysiology early in life.
[0194] Patient specific iPSC-cardiomyocytes (iPSC-CMs) were derived
from a cohort of LVNC patients as well as family matched control
subjects. These cell lines may be used for drug screening and to
identify molecular targets responsible for the disease
phenotype.
[0195] Methods for the isolation and maintenance of fibroblast
cells; derivation of patient-specific iPSC cell lines; and cardiac
differentiation of cells was performed as described in Example 1 or
Example 2.
Example 6
Cardiomyocytes from Patients with DILV
[0196] Double Inlet Left Ventricle (DILV). DILV is a congenital
heart defect in which both the left and right atria feed into the
left ventricle. As a result, children born with this defect only
have one functional ventricular chamber, and trouble pumping
oxygenated blood into the general circulation.
[0197] Patient specific iPSC-cardiomyocytes (iPSC-CMs) were derived
from one individual with this diease. These cell lines may be used
for drug screening and to identify molecular targets responsible
for the disease phenotype.
[0198] Methods for the isolation and maintenance of fibroblast
cells; derivation of patient-specific iPSC cell lines; and cardiac
differentiation of cells was performed as described in Example 1 or
Example 2.
Example 7
Cardiomyocytes from Patients with Long QT
[0199] Long QT (Type-1) Syndrome (LQT-1, KCNQ1 mutation). Long QT
syndrome (LQT) is a hereditary arrhythmic disease in which the QT
phase of the electrocardiogram is prolonged, resulting in increased
susceptibility for arrhythmia and sudden cardiac death. There are
13 known genes associated with LQT.
[0200] Patient specific iPSC-cardiomyocytes (iPSC-CMs) were derived
from a cohort of LQT patients carrying a mutation in the KCNQ1
gene, which is the most commonly mutated LQT gene and responsible
for 30-35% of all cases of the disease. The gene had a G269S
missense mutation. These cell lines may be used for drug screening
and to identify molecular targets responsible for the disease
phenotype.
[0201] Methods for the isolation and maintenance of fibroblast
cells; derivation of patient-specific iPSC cell lines; and cardiac
differentiation of cells was performed as described in Example 1 or
Example 2.
[0202] The preceding merely illustrates the principles of the
invention. It will be appreciated that those skilled in the art
will be able to devise various arrangements which, although not
explicitly described or shown herein, embody the principles of the
invention and are included within its spirit and scope.
Furthermore, all examples and conditional language recited herein
are principally intended to aid the reader in understanding the
principles of the invention and the concepts contributed by the
inventors to furthering the art, and are to be construed as being
without limitation to such specifically recited examples and
conditions. Moreover, all statements herein reciting principles,
aspects, and embodiments of the invention as well as specific
examples thereof, are intended to encompass both structural and
functional equivalents thereof. Additionally, it is intended that
such equivalents include both currently known equivalents and
equivalents developed in the future, i.e., any elements developed
that perform the same function, regardless of structure. The scope
of the present invention, therefore, is not intended to be limited
to the exemplary embodiments shown and described herein. Rather,
the scope and spirit of present invention is embodied by the
appended claims.
Sequence CWU 1
1
34120DNAHomo sapiens 1tgaagtgtga cgtggacatc 20220DNAHomo sapiens
2ggaggagcaa tgatcttgat 20320DNAHomo sapiens 3agcgaaccag tatcgagaac
20420DNAHomo sapiens 4ttacagaacc acactcggac 20520DNAHomo sapiens
5cctcacttca ctgcactgta 20620DNAHomo sapiens 6caggttttct ttccctagct
20720DNAHomo sapiens 7agctacagca tgatgcagga 20820DNAHomo sapiens
8ggtcatggag ttgtactgca 20919DNAHomo sapiens 9cccagcagac ttcacatgt
191020DNAHomo sapiens 10cctcccattt ccctcgtttt 201120DNAHomo sapiens
11tctcaaggca cacctgcgaa 201220DNAHomo sapiens 12tagtgcctgg
tcagttcatc 201320DNAHomo sapiens 13gatgaactga ccaggcacta
201420DNAHomo sapiens 14gtgggtcata tccactgtct 201520DNAHomo sapiens
15actctgagga ggaacaagaa 201619DNAHomo sapiens 16tggagacgtg
gcacctctt 191720DNAHomo sapiens 17tgcctcaaat tggactttgg
201822DNAHomo sapiens 18gattgaaatt ctgtgtaact gc 221920DNAHomo
sapiens 19tgaacctcag ctacaaacag 202020DNAHomo sapiens 20tggtggtagg
aagagtaaag 202126DNAHomo sapiens 21ggaggaggag ctcgtttctc tcaaag
262227DNAHomo sapiens 22catgttggac aaagccttct tcttccg 272326DNAHomo
sapiens 23ggaggaggag ctcgtttctc tcaaag 262427DNAHomo sapiens
24catgttggac aaagccttct tcttcca 272513DNAHomo sapiens 25gaggcccgga
aga 132613DNAHomo sapiens 26gaggcctgga aga 132733DNAHomo sapiens
27ggctgaggat gaggcctgga agaagaaggc ttt 332833DNAHomo sapiens
28ggctgaggat gaggcctgga agaagaaggc ttt 332933DNAHomo sapiens
29ggctgaggat gaggcctgga agaagaaggc ttt 333033DNAHomo sapiens
30ggctgaggat gaggcctgga agaagaaggc ttt 333133DNAHomo sapiens
31ggctgacgat gaggcctgga agaagaaggc ttt 333233DNAHomo sapiens
32ggctgaggat gaggcctgga agaagaaggc ttt 333333DNAHomo sapiens
33ggctgaggat gaggcctgga agaagaaggc ttt 333433DNAHomo sapiens
34ggctgaggat gaggcctgga agaagaaggc ttt 33
* * * * *