U.S. patent application number 15/304225 was filed with the patent office on 2017-02-16 for methods for rapid detection and identification of viral nucleic acids.
The applicant listed for this patent is The Unite States of America, as represented by the Secretary, Dept. of Health and Human Services, The Unite States of America, as represented by the Secretary, Dept. of Health and Human Services. Invention is credited to Dougbeh-Chris Nyan, Maria Rios, Kevin L. Swinson, Deborah R. Taylor, Laura E. Ulitzky.
Application Number | 20170044631 15/304225 |
Document ID | / |
Family ID | 52829493 |
Filed Date | 2017-02-16 |
United States Patent
Application |
20170044631 |
Kind Code |
A1 |
Nyan; Dougbeh-Chris ; et
al. |
February 16, 2017 |
METHODS FOR RAPID DETECTION AND IDENTIFICATION OF VIRAL NUCLEIC
ACIDS
Abstract
Disclosed herein are methods of detecting viral nucleic acids in
a sample that include contacting the sample with one or more sets
of loop-mediated isothermal amplification (LAMP) primers specific
for a viral nucleic acid of interest (such as hepatitis B virus,
hepatitis C virus, hepatitis E virus, human immunodeficiency virus,
West Nile virus, or Dengue virus nucleic acids) under conditions
sufficient to produce an amplification product and detecting the
amplification product(s). In some examples, the amplification
product is detected by gel electrophoresis, while in other
examples, the amplification product is detected by detecting signal
from a label included in one or more of the LAMP primers. Primers
and kits for use for detection of viral nucleic acids by LAMP are
also disclosed herein.
Inventors: |
Nyan; Dougbeh-Chris;
(Germantown, MD) ; Taylor; Deborah R.; (Frederick,
MD) ; Swinson; Kevin L.; (Ellicott City, MD) ;
Rios; Maria; (Bethesda, MD) ; Ulitzky; Laura E.;
(Rockville, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Unite States of America, as represented by the Secretary, Dept.
of Health and Human Services |
Bethesda |
MD |
US |
|
|
Family ID: |
52829493 |
Appl. No.: |
15/304225 |
Filed: |
April 3, 2015 |
PCT Filed: |
April 3, 2015 |
PCT NO: |
PCT/US2015/024320 |
371 Date: |
October 14, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61979446 |
Apr 14, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/707 20130101;
C12Q 2600/156 20130101; C12Q 1/706 20130101; C12Q 2600/16 20130101;
C12Q 1/701 20130101; C12Q 1/703 20130101 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Claims
1. A method of detecting presence of human immunodeficiency virus
(HIV) nucleic acid in a sample, comprising: contacting the sample
with a set of loop-mediated isothermal amplification (LAMP) primers
specific for an HIV nucleic acid under conditions sufficient for
amplification of the HIV nucleic acid, wherein the set of LAMP
primers comprises six primers comprising a nucleic acid sequence
having at least 90% sequence identity to any one of SEQ ID NOs:
38-48 and 81, thereby producing an HIV amplification product; and
detecting the HIV amplification product, thereby detecting presence
of HIV nucleic acid in the sample.
2. The method of claim 1, wherein the set of LAMP primers comprises
six primers comprising or consisting of the nucleic acid sequences
of SEQ ID NOs: 38, 41, 42, 45, 47, and 48.
3. A method of detecting presence of one or more viral nucleic
acids comprising one or more of human immunodeficiency virus (HIV)
nucleic acid, hepatitis B virus (HBV) nucleic acid, hepatitis C
virus (HCV) nucleic acid, hepatitis E virus (HEV) nucleic acid,
West Nile virus (WNV) nucleic acid, or Dengue virus (DENV) nucleic
acid in a sample, comprising: contacting the sample with one or
more sets of loop-mediated isothermal amplification (LAMP) primers
specific for one or more of an HIV nucleic acid, an HBV nucleic
acid, an HCV nucleic acid, an HEV nucleic acid, a WNV nucleic acid
or a DENV nucleic acid under conditions sufficient for
amplification of the one or more viral nucleic acids, thereby
producing one or more viral nucleic acid amplification products;
and detecting the one or more viral nucleic acid amplification
products.
4. The method of claim 2, wherein the one or more sets of LAMP
primers comprise: (a) a set of LAMP primers specific for an HIV
nucleic acid comprising six primers comprising or consisting of the
nucleic acid sequences of SEQ ID NOs: 38, 41, 42, 45, 47, and 48;
(b) a set of LAMP primers specific for an HBV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 1-6; (c) a set of LAMP primers specific
for an HCV nucleic acid comprising six primers comprising or
consisting of the nucleic acid sequences of SEQ ID NOs: 7-12, SEQ
ID NOs: 13 and 15-19, SEQ ID NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID
NOs: 26-31, or SEQ ID NOs: 32-37; (d) a set of LAMP primers
specific for an HEV nucleic acid comprising six primers comprising
or consisting of the nucleic acid sequences of SEQ ID NOs: 49-54;
(e) a set of LAMP primers specific for a WNV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61; or (f)
a set of LAMP primers specific for a DENV nucleic acid comprising
four to six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 62-67, SEQ ID NOs: 66-71, SEQ ID NOs:
68-71, SEQ ID NOs: 72-75, or SEQ ID NOs: 66, 67, and 72-75.
5. The method of claim 3 or claim 4, wherein the method comprises
contacting the sample with a set of LAMP primers specific for an
HBV nucleic acid comprising six primers comprising or consisting of
the nucleic acid sequences of SEQ ID NOs: 1-6 and a set of LAMP
primers specific for an HCV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID NOs: 14-19.
6. The method of claim 3 or claim 4, wherein the method comprises
contacting the sample with a set of LAMP primers specific for an
HBV nucleic acid comprising six primers comprising or consisting of
the nucleic acid sequences of SEQ ID NOs: 1-6, a set of LAMP
primers specific for an HCV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID NOs: 14-19, and a
set of LAMP primers specific for a WNV nucleic acid comprising six
primers comprising or consisting of the nucleic acid sequences of
SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61.
7. The method of claim 3 or claim 4, wherein the method comprises
contacting the sample with a set of LAMP primers specific for an
HBV nucleic acid comprising six primers comprising or consisting of
the nucleic acid sequences of SEQ ID NOs: 1-6; a set of LAMP
primers specific for an HCV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID NOs: 14-19, SEQ ID NOs:
20-25, SEQ ID NOs: 26-31, or SEQ ID NOs: 32-37; and a set of LAMP
primers specific for an HIV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 38, 41, 42, 45, 47, and 48.
8. The method of claim 3 or claim 4, wherein the method comprises
contacting the sample with a set of LAMP primers specific for an
HBV nucleic acid comprising six primers comprising or consisting of
the nucleic acid sequences of SEQ ID NOs: 1-6; a set of LAMP
primers specific for an HCV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID NOs: 14-19, SEQ ID NOs:
20-25, SEQ ID NOs: 26-31, or SEQ ID NOs: 32-37; a set of LAMP
primers specific for an HIV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 38, 41, 42, 45, 47, and 48; and a set of LAMP primers specific
for an HEV nucleic acid comprising six primers comprising or
consisting of the nucleic acid sequences of SEQ ID NOs: 49-54.
9. The method of claim 3 or claim 4, wherein the method comprises
contacting the sample with a set of LAMP primers specific for an
HBV nucleic acid comprising six primers comprising or consisting of
the nucleic acid sequences of SEQ ID NOs: 1-6; a set of LAMP
primers specific for an HCV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID NOs: 14-19, SEQ ID NOs:
20-25, SEQ ID NOs: 26-31, or SEQ ID NOs: 32-37; a set of LAMP
primers specific for an HIV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 38, 41, 42, 45, 47, and 48; a set of LAMP primers specific for
an HEV nucleic acid comprising six primers comprising or consisting
of the nucleic acid sequences of SEQ ID NOs: 49-54; a set of LAMP
primers specific for a WNV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 55 and 57-61 or SEQ ID NOs: 56-61; and a set of LAMP primers
specific for a DENV nucleic acid comprising four to six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 62-67, SEQ ID NOs: 66-71, SEQ ID NOs: 68-71, SEQ ID NOs:
72-75, or SEQ ID NOs: 66, 67, and 72-75.
10. The method of any one of claims 3 to 9, wherein the sample is
contacted with the one or more sets of LAMP primers in a single
reaction vessel.
11. A method of detecting presence of hepatitis B virus (HBV)
nucleic acid in a sample, comprising: contacting the sample with a
set of loop-mediated isothermal amplification (LAMP) primers
specific for an HBV nucleic acid under conditions sufficient for
amplification of the HBV nucleic acid, wherein the set of LAMP
primers comprises primers comprising a nucleic acid sequence having
at least 90% sequence identity to each of SEQ ID NOs: 1-6, thereby
producing an HBV amplification product; and detecting the HBV
amplification product, thereby detecting presence of HBV nucleic
acid in the sample.
12. The method of claim 11, wherein the set of LAMP primers
comprises six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 1-6.
13. A method of detecting presence of hepatitis C virus (HCV)
nucleic acid in a sample, comprising: contacting the sample with at
least one set of loop-mediated isothermal amplification (LAMP)
primers specific for an HCV nucleic acid under conditions
sufficient for amplification of the HCV nucleic acid, wherein the
set of LAMP primers comprises a set of primers comprising a nucleic
acid sequence having at least 90% sequence identity to any one of
SEQ ID NOs: 7-37, thereby producing an HCV amplification product;
and detecting the HCV amplification product, thereby detecting
presence of HCV nucleic acid in the sample.
14. The method of claim 13, wherein the set of LAMP primers
comprises six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID
NOs: 14-19.
15. The method of claim 14, wherein the at least one set of LAMP
primers is specific for an HCV genotype 1 (HCV-1) nucleic acid, an
HCV genotype 2 (HCV-2) nucleic acid, or an HCV genotype 3 (HCV-3)
nucleic acid.
16. The method of claim 15, wherein the set of LAMP primers is
specific for an HCV-1 nucleic acid and comprises six primers
comprising or consisting of SEQ ID NOs: 20-25.
17. The method of claim 15, wherein the set of LAMP primers is
specific for an HCV-2 nucleic acid and comprises six primers
comprising or consisting of SEQ ID NOs: 26-31.
18. The method of claim 15, wherein the set of LAMP primers is
specific for an HCV-3 nucleic acid and comprises six primers
comprising or consisting of SEQ ID NOs: 32-37.
19. A method of detecting presence of hepatitis E virus (HEV)
nucleic acid in a sample, comprising: contacting the sample with a
set of loop-mediated isothermal amplification (LAMP) primers
specific for an HEV nucleic acid under conditions sufficient for
amplification of the HEV nucleic acid, wherein the set of LAMP
primers comprises primers comprising a nucleic acid sequence having
at least 90% sequence identity to each of SEQ ID NOs: 49-54,
thereby producing an HEV amplification product; and detecting the
HEV amplification product, thereby detecting presence of HEV
nucleic acid in the sample.
20. The method of claim 19, wherein the set of LAMP primers
comprises six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 49-54.
21. A method of detecting presence of West Nile virus (WNV) nucleic
acid in a sample, comprising: contacting the sample with a set of
loop-mediated isothermal amplification (LAMP) primers specific for
an WNV nucleic acid under conditions sufficient for amplification
of the WNV nucleic acid, wherein the set of LAMP primers comprises
one or more primers comprising a nucleic acid sequence having at
least 90% sequence identity to any one of SEQ ID NOs: 55-61,
thereby producing an WNV amplification product; and detecting the
WNV amplification product, thereby detecting presence of WNV
nucleic acid in the sample.
22. The method of claim 21, wherein the set of LAMP primers
comprises six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61.
23. A method of detecting presence of Dengue virus (DENV) nucleic
acid in a sample, comprising: contacting the sample with a set of
loop-mediated isothermal amplification (LAMP) primers specific for
an DENV nucleic acid under conditions sufficient for amplification
of the DENV nucleic acid, wherein the set of LAMP primers comprises
one or more primers comprising a nucleic acid sequence having at
least 90% sequence identity to any one of SEQ ID NOs: 62-75,
thereby producing an DENV amplification product; and detecting the
DENV amplification product, thereby detecting presence of DENV
nucleic acid in the sample.
24. The method of claim 23, wherein the set of LAMP primers
comprises four to six primers comprising or consisting of the
nucleic acid sequences of SEQ ID NOs: 62-67, SEQ ID NOs: 66-71, SEQ
ID NOs: 68-71, SEQ ID NOs: 72-75, or SEQ ID NOs: 66, 67, and
72-75.
25. The method of any one of claims 1 to 24, wherein at least one
primer in the set of LAMP primers comprises a detectable label.
26. The method of claim 25, wherein the detectable label comprises
a fluorophore.
27. The method of claim 25 or 26, wherein the primer further
comprises a fluorescence quencher.
28. The method of claim 27, wherein the fluorescence quencher
comprises a dark quencher.
29. The method of any one of claims 25 to 28, wherein the at least
one primer comprising the detectable label comprises any one of SEQ
ID NOs: 5, 6, 11, 12, 18, 19, 24, 25, 30, 31, 36, 37, 46-48, 53,
54, 60, 61, 66, or 67.
30. The method of any one of claims 1 to 29, further comprising
contacting the sample with a reverse transcriptase under conditions
sufficient for reverse transcription of the viral nucleic acid.
31. The method of any one of claims 1 to 30, wherein detecting the
viral nucleic acid amplification product comprises turbidity
measurement, fluorescence detection, or gel electrophoresis.
32. The method of any one of claims 1 to 31, wherein the sample
comprises isolated DNA, isolated RNA, blood, plasma, serum, urine,
saliva, tissue biopsy, fine needle aspirate, or a surgical
specimen.
33. An isolated nucleic acid primer comprising a nucleic acid
sequence at least 90% identical to any one of SEQ ID NOs: 1-75 and
81.
34. The isolated nucleic acid primer of claim 33, comprising the
nucleic acid sequence of any one of SEQ ID NOs: 1-75 and 81.
35. The isolated nucleic acid primer of claim 34, consisting of the
nucleic acid sequence of any one of SEQ ID NOs: 1-75 and 81.
36. The isolated nucleic acid primer of any one of claims 33 to 35,
further comprising a fluorophore, a fluorescent quencher, or
both.
37. The isolated nucleic acid primer of claim 36, wherein the
nucleic acid sequence of the primer comprises or consists of SEQ ID
NOs: 6, 12, 19, 25, 31, 37, 48, 54, 61, or 67.
38. A kit comprising at least one set of LAMP primers in a
container, wherein the at least one set of LAMP primers comprises:
(a) a set of LAMP primers specific for an HIV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 38, 41, 42, 45, 47, and 48; (b) a set of
LAMP primers specific for an HBV nucleic acid comprising six
primers comprising or consisting of the nucleic acid sequences of
SEQ ID NOs: 1-6; (c) a set of LAMP primers specific for an HCV
nucleic acid comprising six primers comprising or consisting of the
nucleic acid sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and
15-19, SEQ ID NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, or
SEQ ID NOs: 32-37; (d) a set of LAMP primers specific for an HEV
nucleic acid comprising six primers comprising or consisting of the
nucleic acid sequences of SEQ ID NOs: 49-54; (e) a set of LAMP
primers specific for a WNV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 55 and 57-61 or SEQ ID NOs: 56-61; or (f) a set of LAMP
primers specific for a DENV nucleic acid comprising four to six
primers comprising or consisting of the nucleic acid sequences of
SEQ ID NOs: 62-67, SEQ ID NOs: 66-71, SEQ ID NOs: 68-71, SEQ ID
NOs: 72-75, or SEQ ID NOs: 66, 67, and 72-75.
39. The kit of claim 38, wherein the kit comprises two or more sets
of LAMP primers in a single container.
40. The kit of claim 39, wherein the kit comprises a set of LAMP
primers specific for an HBV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 1-6 and a set of LAMP primers specific for an HCV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID
NOs: 14-19 in a single container.
41. The kit of claim 39, wherein the kit comprises a set of LAMP
primers specific for an HBV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 1-6, a set of LAMP primers specific for an HCV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID
NOs: 14-19, and a set of LAMP primers specific for a WNV nucleic
acid comprising six primers comprising or consisting of the nucleic
acid sequences of SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61 in
a single container.
42. The kit of claim 39, wherein the kit comprises a set of LAMP
primers specific for an HBV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 1-6; a set of LAMP primers specific for an HCV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID
NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, or SEQ ID NOs:
32-37; and a set of LAMP primers specific for an HIV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 38, 41, 42, 45, 47, and 48 in a single
container.
43. The kit of claim 39, wherein the kit comprises a set of LAMP
primers specific for an HBV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 1-6; a set of LAMP primers specific for an HCV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID
NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, or SEQ ID NOs:
32-37; a set of LAMP primers specific for an HIV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 38, 41, 42, 45, 47, and 48; and a set of
LAMP primers specific for an HEV nucleic acid comprising six
primers comprising or consisting of the nucleic acid sequences of
SEQ ID NOs: 49-54 in a single container.
44. The kit of claim 39, wherein the kit comprises a set of LAMP
primers specific for an HBV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 1-6; a set of LAMP primers specific for an HCV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID
NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, or SEQ ID NOs:
32-37; a set of LAMP primers specific for an HIV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 38, 41, 42, 45, 47, and 48; a set of LAMP
primers specific for an HEV nucleic acid comprising six primers
comprising or consisting of the nucleic acid sequences of SEQ ID
NOs: 49-54; a set of LAMP primers specific for a WNV nucleic acid
comprising six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61; and a
set of LAMP primers specific for a DENV nucleic acid comprising
four to six primers comprising or consisting of the nucleic acid
sequences of SEQ ID NOs: 62-67, SEQ ID NOs: 66-71, SEQ ID NOs:
68-71, SEQ ID NOs: 72-75, or SEQ ID NOs: 66, 67, and 72-75 in a
single container.
45. The kit of any one of claims 38 to 44, further comprising a
buffer comprising 2% D-mannitol, 0.2% Triton.RTM.-X100, 40 mM
Tris-HCl, 20 mM KCl, 20 mM (NH.sub.4).sub.2SO.sub.4, 6 mM
MgSO.sub.4, 0.5 M L-proline, 10 mM Tris acetate, 1.6 mM magnesium
acetate, 15 mM potassium acetate and 2 mM each of dATP, dCTP, dGTP,
and dTTP.
46. A nucleic acid amplification buffer comprising 2% D-mannitol,
0.2% Triton.RTM.-X100, 40 mM Tris-HCl, 20 mM KCl, 20 mM
(NH.sub.4).sub.2SO.sub.4, 6 mM MgSO.sub.4, 0.5 M L-proline, 10 mM
Tris acetate, 1.6 mM magnesium acetate, 15 mM potassium acetate and
2 mM each of dATP, dCTP, dGTP, and dTTP.
47. The buffer of claim 46, wherein the buffer has a pH of about
7.8.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This claims the benefit of U.S. Provisional Application No.
61/979,446, filed Apr. 14, 2014, which is incorporated herein by
reference in its entirety.
FIELD
[0002] This disclosure relates to methods for detecting human
immunodeficiency virus, hepatitis virus, Dengue virus, and West
Nile virus nucleic acids, particularly using isothermal
amplification methods.
BACKGROUND
[0003] Hepatitis B virus (HBV), hepatitis C virus (HCV), and the
emerging hepatitis E virus (HEV) together infect approximately 700
million people world-wide and may lead to chronic active hepatitis
or hepatocellular carcinoma. Infection with human immunodeficiency
virus (HIV) compromises the immune system, while Dengue virus
(DENV) causes hemorrhagic fever and West Nile virus (WNV) can cause
encephalitis and other neuroinflammatory symptoms. Infection with
these viruses causes significant morbidity and mortality worldwide.
Furthermore, as these viruses are transmitted primarily by
blood-borne routes, the presence of infected individuals in the
population raises the risk of blood or blood-products from infected
donors being transfused to uninfected individuals.
SUMMARY
[0004] There is a continuing need for rapid, sensitive, and
specific assays for HIV, HBV, HCV, HEV, DENV, and WNV, both for
diagnosis (and clinical intervention) for infected individuals and
to ensure the safety of the blood and blood-products supply.
Disclosed herein are methods of detecting HIV, HBV, HCV, HEV, DENV,
and/or WNV in a sample. In some embodiments, the methods include
loop-mediated isothermal amplification (LAMP) or reverse
transcription-LAMP (RT-LAMP) methods to detect viral nucleic acids
in a sample. The disclosed methods include individual detection
assays (such as singleplex assays) as well as simultaneous
detection and/or discrimination of two or more viral nucleic acids
(such as multiplex assays).
[0005] Disclosed herein are methods of detecting viral nucleic
acids in a sample that include contacting the sample with one or
more sets of LAMP primers specific for a viral nucleic acid of
interest (such as HBV, HCV, HEV, HIV, WNV, and/or DENV nucleic
acids) under conditions sufficient to produce an amplification
product and detecting the amplification product(s). In some
examples, the amplification product is detected by gel
electrophoresis, while in other examples, the amplification product
is detected by detecting signal from a nucleic acid stain (such as
a DNA intercalating dye) or a detectable label included in one or
more of the LAMP primers.
[0006] Primers for detecting viral nucleic acids by LAMP are
disclosed herein. In some examples, the primers include primers for
detection of HBV nucleic acids (such as SEQ ID NOs: 1-6), HCV (such
as SEQ ID NOs: 13-37), HIV (such as SEQ ID NOs: 38-48 and 81), HEV
(such as SEQ ID NOs: 49-54), WNV (such as SEQ ID NOs: 55-61), and
DENV (such as SEQ ID NOs: 62-75) are provided. Kits including one
or more sets of LAMP primers are also disclosed herein.
[0007] The foregoing and other features of the disclosure will
become more apparent from the following detailed description, which
proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1 shows a partial sequence of HBV genomic sequence (SEQ
ID NO: 76) and the position of the universal HBV LAMP primers.
[0009] FIGS. 2A and 2B show detection of HBV genotypes A-F with
LAMP using the HBV universal primer set. FIG. 2A is a digital image
of gel electrophoresis of reaction products. FIG. 2B is a digital
image of reaction tubes with addition of GelGreen.TM. fluorescent
dye under ultraviolet (UV) light. Lane M=50 bp Marker; Lanes
A-F=HBV genotypes A to F; NTC=No Template Control (water);
NP=Negative plasma.
[0010] FIGS. 3A-3D is a series of panels showing sensitivity and
specificity of HBV LAMP assay primers. FIG. 3A is a digital image
of gel electrophoresis of reaction products showing detection to
about 10 International Units (IU) of HBV DNA (.about.50 copies).
Lane M=100 bp Marker; NTC=No Template Control (water). FIG. 3B is a
digital image of reaction tubes with the addition of GelGreen.TM.
fluorescent dye, showing a fluorescent-glow with decreasing
intensity from 10.sup.4 to 0.1 IU/reaction. FIG. 3C is a digital
image of gel eletrophoresis of reaction products with DNA extracted
from Cytomegalovirus (CMV)-positive and Parvovirus (PV)-positive
donor plasma specimens and subjected to HBV LAMP reaction. Lane
M=100 bp DNA ladder; Lane 1=NTC (no template control); Lanes 2 and
3=CMV DNA; Lanes 4 and 5=PV DNA; Lanes 6 and 7=HBV-A DNA. FIG. 3D
is a digital image of gel electrophoresis of reaction products from
HBV LAMP reaction using DNA of Trypanosoma cruzi (lanes 3 and 4),
Leishmania major, (lanes 5 and 6), and L. tropica (lanes 7 and 8)
DNA. Lane 1=100 bp marker; Lane 2=NTC (no template control); Lane
3=NP (negative human plasma); Lanes 9-10=HBV-A DNA; Lanes
11-12=HBV-B DNA.
[0011] FIGS. 4A and 4B show detection of HBV DNA in donor plasma
specimens. FIG. 4A is a digital image of gel electrophoresis of DNA
extracted from donor plasma specimens subjected to HBV LAMP. FIG.
4B is a digital image of gel electrophoresis of HBV LAMP using the
same samples as in FIG. 4A that were first heat-treated (without
DNA extraction), centrifuged, and then the supernatant was used in
the LAMP reaction. Lane M=100 bp DNA ladder; NEG=Negative (plasma)
control; PC=positive control HBV genotype-A DNA (10.sup.3
IU/reaction), lanes 12-21, donor plasma samples.
[0012] FIG. 5 is a digital image of gel electrophoresis of HBV LAMP
reactions with 50 or 100 IU HBV DNA at defined time points. M=100
bp marker; NTC=No Template Control (water).
[0013] FIGS. 6A-6C is a series of panels showing stability of
mannitol acetate reaction buffer (MAB). FIG. 6A is a digital image
of gel electrophoresis of HBV LAMP using fresh buffer (stored at
-20.degree. C.). FIG. 6B is a digital image of gel electrophoresis
of HBV LAMP using room temperature-stored buffer. FIG. 6C is a
digital image of gel electrophoresis of HBV LAMP using
thermo-stressed MAB. M=100 bp DNA ladder; NTC=No Template Control
(water); NC=negative control.
[0014] FIGS. 7A-D are HCV nucleic acid sequences used to design HCV
primer sets. FIG. 7A is an HCV-4a nucleic acid sequence (SEQ ID NO:
77) used to design the HCV universal primer set (GenBank Accession
No. Y11604). FIG. 7B is an HCV-1a nucleic acid sequence (SEQ ID NO:
78) used to design the HCV-1 primer set (GenBank Accession No.
AF009606). FIG. 7C is an HCV-2a nucleic acid sequence (SEQ ID NO:
79) used to design the HCV-2 primer set (GenBank Accession No.
AF333324). FIG. 7D is an HCV-3a nucleic acid sequence (SEQ ID NO:
80) used to design the HCV-3 primer set (GenBank Accession No.
D17763). For each, underlined nucleic acids indicate sequences
included in primers.
[0015] FIGS. 8A and 8B are digital images showing detection of
HCV-1, HCV-2, and HCV-4 using the universal HCVU LAMP primers. FIG.
8A is a digital image of gel electrophoresis of RT-LAMP reaction
products using total RNA extracted from plasma standards of HCV
genotypes 1, 2, and 4. Lane M=100 bp marker; Lane 1=No-Template
Control (NTC); Lane 2: W=West Nile Virus (2.85.times.10.sup.6
copies/rxn); Lane 3: HCV-1a (10.sup.6 IU/rxn); Lane 4: HCV-1b
(5.times.10.sup.5 IU/rxn); Lane 5: HCV-2a (5.times.10.sup.4
IU/rxn); Lane 6: HCV-2a/c (5.times.10.sup.5 IU/rxn); and, Lane 7:
HCV-4a (180 IU/rxn). FIG. 8B is a digital image of reactions with
addition of 1 .mu.l of 10.times. GelGreen.TM. dye to the final
reaction tubes and visualized under UV illumination at 302 nm.
Tubes correspond to the lanes in FIG. 8A.
[0016] FIGS. 9A-9D are digital images of electrophoresis of
reaction products of RT-LAMP assays with HCV genotype-specific
primer sets. FIG. 9A shows HCV-1 primer set. FIG. 9B shows HCV-2
primer set. FIG. 9C shows HCV-3 primer set. FIG. 9D juxtaposes the
positive samples from FIGS. 9A-C to demonstrate the unique banding
pattern obtained with each primer set (indicated with the lines
between lanes in each panel). In FIGS. 9A-9C, Lane M=100 bp marker;
Lane 1=No-Template Control (NTC); Lane 2: D=Dengue Virus RNA
(4.times.10.sup.6 copies/rxn); Lane 3: W=West Nile Virus
(2.85.times.10.sup.6 copies/rxn); Lane 4: HCV-1a (10.sup.6 IU/rxn);
Lane 5: HCV-1b (5.times.10.sup.5 IU/rxn); Lane 6: HCV-2a
(5.times.10.sup.4 IU/rxn); Lane 7: HCV-2a/c (5.times.10.sup.4
IU/rxn); Lanes 8 and 9=HCV-3 (5 ng); and Lane 10: HCV-4a (180
IU/rxn).
[0017] FIGS. 10A-10C are digital images showing detection of known
amounts of HCV plasma standard or extracted RNA with HCV universal
primer RT-LAMP assay. FIG. 10A shows gel electrophoresis of
reaction products of serial dilutions of heat-treated HCV genotype
1a plasma standard. Lane M=100 bp marker; NTC=No Template Control;
NP=Negative Human Plasma; D=Dengue Virus RNA (5.times.10.sup.6
copies/rxn); W=West Nile virus RNA (5.times.10.sup.6
copies/reaction). FIG. 10B shows gel electrophoresis of reaction
products of serial dilutions of extracted RNA of HCV genotype 1a.
FIG. 10C is a digital image of reactions with addition of
GelGreen.TM. dye to the final reaction tubes and visualized under
UV illumination at 302 nm. Tubes correspond to the lanes in FIG.
10B.
[0018] FIGS. 11A-11C shows detection of HCV in total RNA extracted
from donor plasma or serum specimens with HCV LAMP primers sets.
FIG. 11A shows gel electrophoresis of reaction products from donor
plasma samples of unknown genotype with HCV-1 LAMP primer set. FIG.
11B shows gel electrophoresis of reaction products from the same
samples as in FIG. 11A with HCV-2 LAMP primer set. FIG. 11C shows
gel electrophoresis of reaction products from known HCV-4a-infected
donor serum samples with universal HCV LAMP primer set. All panels:
Lane M=100 bp marker; Lane NTC=No Template control (water); Lanes
NC or D=Negative Control Dengue Virus RNA (5.times.10.sup.6
copies/rxn); Panel A: Lane PC=Positive Control HCV-1a
(.about.10.sup.3 IU/rxn); Panel B: Lane PC=Positive Control HCV-2a
(.about.10.sup.4 IU/rxn); Panel C: Lane H=Positive Control HCV-4a
(180 IU/rxn).
[0019] FIGS. 12A and 12B show the time course of detection of
HCV-4a RNA with universal HCV primer set. Reactions contained 15
IU/reaction (FIG. 12A) or 75 IU/reaction (FIG. 12B) of HCV RNA.
[0020] FIG. 13 is a digital image of electrophoresis of LAMP
reaction products using HIV-1 primer set. Lane M=100 bp marker;
Lanes 1-2=No Template Control (NTC); Lane 3: HBV genotype A (90
IU/rxn); Lane 4: HBV genotype B (90 IU/rxn); Lane 5: HCV-1a
(10.sup.5 IU/rxn); Lane 6: HCV-2a/c (10.sup.4 IU/rxn); Lanes 7-9:
HIV (10.sup.3 IU/rxn).
[0021] FIG. 14 is a digital image of electrophoresis of LAMP
reaction products using WNV primer set. Lane M=100 bp marker; NTC:
No Template Control; Lane 1: HCV-1a (10.sup.5 IU/rxn); Lane 2:
HCV-2b (10.sup.5 IU/rxn); Lane 3: HBV genotype A (180 IU/rxn); Lane
4: DENV (10.sup.4 copies/rxn); Lane 5: WNV (10.sup.4
copies/rxn).
[0022] FIG. 15 is a digital image of electrophoresis of LAMP
reaction products using DENV D1 primer set. NTC=No-Template
Control; D=DENV-1 (10.sup.4 copies/rxn).
[0023] FIGS. 16A and 16B are digital images of electrophoresis of
LAMP reaction products using HEV primer set. FIG. 16A shows gel
electrophoresis of reaction products using HEV-3 (Kernow C-1
strain). NTC=no template control; 10-fold (3 ng) and 100-fold (1.5
ng) dilutions of HEV. FIG. 16B shows gel electrophoresis of 10-fold
(38.5 ng) and 100-fold (3.85 ng) dilutions of HEV-1. M=100 bp
marker; NTC=no template control.
[0024] FIGS. 17A-17D are digital images showing multiplex LAMP
assay reaction products. FIG. 17A shows gel electrophoresis of
reaction products from a multiplex LAMP assay including both HBV
universal primer set and HCV universal primer set. M: 100 bp
marker; Lane 1: no template control; Lane 2: DENV; Lane 3: WNV;
Lanes 4-5: HBV; Lanes 6-7: HCV. FIG. 17B shows gel electrophoresis
of reaction products from a multiplex LAMP assay including HBV,
HCV, and WNV primer sets. M: 100 bp marker; Lane 1: no template
control; Lane 2: DENV; Lanes 3-4: HBV; Lanes 5-6: HCV; Lanes 7-8:
WNV. FIG. 17C shows gel electrophoresis of reaction products from a
multiplex LAMP assay including HBV, HCV, HIV, and HEV primer sets.
Each reaction contained RNA from the indicated viruses. FIG. 17D
shows gel electrophoresis of reaction products from a multiplex
LAMP assay including HIV, HBV, HCV, HEV, DENV, and WNV primer sets.
M: 100 bp marker; NTC: no template control; PV: parvovirus; CMV:
cytomegalovirus.
[0025] FIGS. 18A-18C are digital images showing multiplex LAMP
assay reaction products detected by gel electrophoresis or by
fluorescence (fluorophore included on the indicated LR primer
("fluoro-oligo")). FIG. 18A is a digital image of a multiplex LAMP
assay with HBV, HCV, and HIV primer sets with HCV fluoro-oligo,
detected by gel electrophoresis (top) or UV illumination (bottom).
Numbers on the tubes indicate relative fluorescence units (RFU) for
each sample. The HCV fluoro-oligo was SEQ ID NO: 12 labeled with
TexasRed (5') and BHQ1 (3'). FIG. 18B is a digital image of a
multiplex LAMP assay with HBV, HCV, HEV and HIV primer sets with
HIV fluoro-oligo, detected by gel electrophoresis (top) or UV
illumination (bottom). Numbers on the tubes indicate relative
fluorescence units (RFU) for each sample. The HIV fluoro-oligo was
SEQ ID NO: 48 labeled with 6-FAM (5') and BHQ1 (3'). FIG. 18C is a
digital image of a multiplex LAMP assay with HBV, HCV, HEV, and HIV
primer sets with HCV fluoro-oligo and HIV fluoro-oligo, detected by
gel electrophoresis (top) or UV illumination (bottom). Numbers on
the tubes indicate relative fluorescence units (RFU) for each
sample. The fluoro-oligos were labeled with 6-FAM (5') and BHQ1
(3').
SEQUENCE LISTING
[0026] Any nucleic acid and amino acid sequences listed herein are
shown using standard letter abbreviations for nucleotide bases and
amino acids, as defined in 37 C.F.R. .sctn.1.822. In at least some
cases, only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand.
[0027] SEQ ID NOs: 1-6 are nucleic acid sequences of exemplary
universal HBV LAMP primers.
[0028] SEQ ID NOs: 7-12 are nucleic acid sequences of exemplary
universal HCV LAMP primers.
[0029] SEQ ID NOs: 13-19 are nucleic acid sequences of alternative
universal HCV LAMP primers.
[0030] SEQ ID NOs: 20-25 are nucleic acid sequences of exemplary
HCV-1 LAMP primers.
[0031] SEQ ID NOs: 26-31 are nucleic acid sequences of exemplary
HCV-2 LAMP primers.
[0032] SEQ ID NOs: 32-37 are nucleic acid sequences of exemplary
HCV-3 LAMP primers.
[0033] SEQ ID NOs: 38-48 and 81 are nucleic acid sequences of
exemplary HIV-1 LAMP primers.
[0034] SEQ ID NOs: 49-54 are nucleic acid sequences of exemplary
HEV LAMP primers.
[0035] SEQ ID NOs: 55-61 are nucleic acid sequences of exemplary
WNV LAMP primers.
[0036] SEQ ID NOs: 62-75 are nucleic acid sequences of exemplary
DENV LAMP primers.
[0037] SEQ ID NO: 76 is the nucleic acid sequence of a partial HBV
genomic sequence.
[0038] SEQ ID NOs: 77-80 are partial HCV genomic nucleic acid
sequences.
DETAILED DESCRIPTION
I. Abbreviations
[0039] DENV Dengue virus
[0040] HBV hepatitis B virus
[0041] HCV hepatitis C virus
[0042] HEV hepatitis E virus
[0043] HIV human immunodeficiency virus
[0044] IU international units
[0045] LAMP loop-mediated isothermal amplification
[0046] MAB mannitol acetate buffer
[0047] NCR non-coding region
[0048] RFU relative fluorescence units
[0049] RT reverse transcriptase
[0050] RT-LAMP reverse transcription-loop-mediated isothermal
amplification
[0051] UV ultraviolet
[0052] WNV West Nile virus
II. Terms
[0053] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found in Lewin's Genes X, ed. Krebs et al, Jones and
Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.),
The Encyclopedia of Molecular Biology, published by Blackwell
Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.),
Molecular Biology and Biotechnology: a Comprehensive Desk
Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN
0471186341); and George P. Redei, Encyclopedic Dictionary of
Genetics, Genomics, Proteomics and Informatics, 3rd Edition,
Springer, 2008 (ISBN: 1402067534).
[0054] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art to practice the present disclosure. The
singular forms "a," "an," and "the" refer to one or more than one,
unless the context clearly dictates otherwise. For example, the
term "comprising a nucleic acid molecule" includes single or plural
nucleic acid molecules and is considered equivalent to the phrase
"comprising at least one nucleic acid molecule." As used herein,
"comprises" means "includes." Thus, "comprising A or B," means
"including A, B, or A and B," without excluding additional
elements.
[0055] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety for all purposes. All sequences associated with GenBank
Accession Nos. mentioned herein are incorporated by reference in
their entirety as were present on Apr. 14, 2014, to the extent
permissible by applicable rules and/or law. In case of conflict,
the present specification, including explanations of terms, will
control.
[0056] Although methods and materials similar or equivalent to
those described herein can be used to practice or test the
disclosed technology, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting.
[0057] In order to facilitate review of the various embodiments of
this disclosure, the following explanations of specific terms are
provided:
[0058] Amplification: Increasing the number of copies of a nucleic
acid molecule, such as a gene or fragment of a gene, for example at
least a portion of an HIV, HBV, HCV, DENV, or WNV nucleic acid
molecule. The products of an amplification reaction are called
amplification products. An example of in vitro amplification is the
polymerase chain reaction (PCR), in which a sample (such as a
biological sample from a subject) is contacted with a pair of
oligonucleotide primers, under conditions that allow for
hybridization of the primers to a nucleic acid molecule in the
sample. The primers are extended under suitable conditions,
dissociated from the template, and then re-annealed, extended, and
dissociated to amplify the number of copies of the nucleic acid
molecule. Other examples of in vitro amplification techniques
include real-time PCR, quantitative real-time PCR (qPCR), reverse
transcription PCR (RT-PCR), quantitative RT-PCR (qRT-PCR),
loop-mediated isothermal amplification (LAMP; see Notomi et al.,
Nucl. Acids Res. 28:e63, 2000); reverse-transcriptase LAMP
(RT-LAMP); strand displacement amplification (see U.S. Pat. No.
5,744,311); transcription-free isothermal amplification (see U.S.
Pat. No. 6,033,881); repair chain reaction amplification (see WO
90/01069); ligase chain reaction amplification (see EP-A-320 308);
gap filling ligase chain reaction amplification (see U.S. Pat. No.
5,427,930); coupled ligase detection and PCR (see U.S. Pat. No.
6,027,889); and NASBA.TM. RNA transcription-free amplification (see
U.S. Pat. No. 6,025,134).
[0059] Conditions sufficient for: Any environment that permits the
desired activity, for example, that permits specific binding or
hybridization between two nucleic acid molecules or that permits
reverse transcription and/or amplification of a nucleic acid. Such
an environment may include, but is not limited to, particular
incubation conditions (such as time and/or temperature) or presence
and/or concentration of particular factors, for example in a
solution (such as buffer(s), salt(s), metal ion(s), detergent(s),
nucleotide(s), enzyme(s), and so on).
[0060] Contact: Placement in direct physical association; for
example in solid and/or liquid form. For example, contacting can
occur in vitro with one or more primers and/or probes and a
biological sample (such as a sample including nucleic acids) in
solution.
[0061] Dengue virus (DENV): Dengue virus (DENV) is a mosquito-borne
flavivirus including four serotypes (DENV-1, DENV-2, DENV-3, and
DENV-4). It is estimated that as many as 400 million individuals
are infected with DENV yearly worldwide and over 100 million cases
of Dengue fever occur annually. DENV infection causes Dengue fever
with symptoms including high fever, severe headache, severe joint,
muscle, and bone pain, and rash. DENV also causes Dengue
hemorrhagic fever, characterized by a fever lasting 2-7 days,
followed by persistent vomiting, severe abdominal pain, and
hemorrhagic manifestations, including ascites, pleural effusions,
or hemorrhagic shock. Dengue hemorrhagic fever may arise when an
individual previously infected with one DENV serotype is infected
with another DENV serotype and antibody-dependent enhancement
occurs due to the presence of cross-reactive but non-neutralizing
antibodies.
[0062] DENV nucleic acid and protein sequences are available in
public databases, including GenBank. Exemplary DENV sequences
include GenBank Accession Nos. NC_001477, AF180817, and U88536
(DEN-1); NC_001474 and U87411 (DEN-2); NC_001475, AY099336, and
AF317645 (DEN-3); and NC_002640 and AF326825 (DEN-4), all of which
are incorporated by reference as included in GenBank on Apr. 14,
2014.
[0063] Detectable label: A compound or composition that is
conjugated directly or indirectly to another molecule (such as a
nucleic acid molecule) to facilitate detection of that molecule.
Specific, non-limiting examples of labels include fluorescent and
fluorogenic moieties (e.g., fluorophores), chromogenic moieties,
haptens (such as biotin, digoxigenin, and fluorescein), affinity
tags, and radioactive isotopes (such as .sup.32P, .sup.33P,
.sup.35S, and .sup.125I). The label can be directly detectable
(e.g., optically detectable) or indirectly detectable (for example,
via interaction with one or more additional molecules that are in
turn detectable). Methods for labeling nucleic acids, and guidance
in the choice of labels useful for various purposes, are discussed,
e.g., in Sambrook and Russell, in Molecular Cloning: A Laboratory
Manual, 3.sup.rd Ed., Cold Spring Harbor Laboratory Press (2001)
and Ausubel et al., in Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley-Intersciences (1987, and
including updates).
[0064] Fluorophore: A chemical compound, which when excited by
exposure to a particular stimulus, such as a defined wavelength of
light, emits light (fluoresces), for example at a different
wavelength (such as a longer wavelength of light).
[0065] Fluorophores are part of the larger class of luminescent
compounds. Luminescent compounds include chemiluminescent
molecules, which do not require a particular wavelength of light to
luminesce, but rather use a chemical source of energy. Therefore,
the use of chemiluminescent molecules (such as aequorin) eliminates
the need for an external source of electromagnetic radiation, such
as a laser.
[0066] Examples of particular fluorophores that can be used in the
probes and primers disclosed herein are known to those of skill in
the art and include
4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid; acridine
and derivatives such as acridine and acridine isothiocyanate,
5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS),
4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate
(Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide,
anthranilamide; Brilliant Yellow; coumarin and derivatives such as
coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),
7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanosine;
4',6-diaminidino-2-phenylindole (DAPI);
5',5''-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red);
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin;
diethylenetriamine pentaacetate;
4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid;
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid;
5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl
chloride); 4-dimethylaminophenylazophenyl-4'-isothiocyanate
(DABITC); eosin and derivatives such as eosin isothiocyanate;
erythrosin and derivatives such as erythrosin B and erythrosin
isothiocyanate; ethidium; fluorescein and derivatives such as
5-carboxyfluorescein (FAM),
5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF),
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE),
fluorescein, fluorescein isothiocyanate (FITC), QFITC (XRITC),
6-carboxy-fluorescein (HEX), and TET (tetramethyl fluorescein);
fluorescamine; IR144; IR1446; Malachite Green isothiocyanate;
4-methylumbelliferone; ortho-cresolphthalein; nitrotyrosine;
pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde;
pyrene and derivatives such as pyrene, pyrene butyrate, and
succinimidyl 1-pyrene butyrate; Reactive Red 4 (CJBACRON.TM.
Brilliant Red 3B-A); rhodamine and derivatives such as
6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine
rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B,
rhodamine 123, rhodamine X isothiocyanate,
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl
rhodamine, and tetramethyl rhodamine isothiocyanate (TRITC);
sulforhodamine B; sulforhodamine 101 and sulfonyl chloride
derivative of sulforhodamine 101 (Texas Red); riboflavin; rosolic
acid and terbium chelate derivatives; LightCycler Red 640; Cy5.5;
and Cy56-carboxyfluorescein; boron dipyrromethene difluoride
(BODIPY); acridine; stilbene; Cy3; Cy5, VICO (Applied Biosystems);
LC Red 640; LC Red 705; and Yakima yellow amongst others.
Additional examples of fluorophores include Quasar.RTM. 670,
Quasar.RTM. 570, CalRed 590, CalRed 610, CalRed615, CalRed 635,
CalGreen 520, CalGold 540, and CalOrange 560 (Biosearch
Technologies, Novato, Calif.). One skilled in the art can select
additional fluorophores, for example those available from Molecular
Probes/Life Technologies (Carlsbad, Calif.).
[0067] In particular examples, a fluorophore is used as a donor
fluorophore or as an acceptor fluorophore. "Acceptor fluorophores"
are fluorophores which absorb energy from a donor fluorophore, for
example in the range of about 400 to 900 nm (such as in the range
of about 500 to 800 nm). Acceptor fluorophores generally absorb
light at a wavelength which is usually at least 10 nm higher (such
as at least 20 nm higher) than the maximum absorbance wavelength of
the donor fluorophore, and have a fluorescence emission maximum at
a wavelength ranging from about 400 to 900 nm. Acceptor
fluorophores have an excitation spectrum that overlaps with the
emission of the donor fluorophore, such that energy emitted by the
donor can excite the acceptor. Ideally, an acceptor fluorophore is
capable of being attached to a nucleic acid molecule.
[0068] In a particular example, an acceptor fluorophore is a dark
quencher, such as Dabcyl, QSY7 (Molecular Probes), QSY33 (Molecular
Probes), BLACK HOLE QUENCHERS.TM. (Biosearch Technologies; such as
BHQ0, BHQ1, BHQ2, and BHQ3), ECLIPSE Dark Quencher (Epoch
Biosciences), or IOWA BLACK.TM. (Integrated DNA Technologies). A
quencher can reduce or quench the emission of a donor
fluorophore.
[0069] "Donor Fluorophores" are fluorophores or luminescent
molecules capable of transferring energy to an acceptor
fluorophore, in some examples generating a detectable fluorescent
signal from the acceptor. Donor fluorophores are generally
compounds that absorb in the range of about 300 to 900 nm, for
example about 350 to 800 nm. Donor fluorophores have a strong molar
absorbance coefficient at the desired excitation wavelength, for
example greater than about 10.sup.3 M.sup.-1 cm.sup.-1.
[0070] Hepatitis B virus (HBV): HBV is a DNA virus with a circular
genome of partially double-stranded DNA that is a member of the
family Hepadnaviridae. HBV causes acute disease, characterized by
liver inflammation, vomiting, and jaundice, as well as chronic
infection which may lead to cirrhosis or hepatocellular carcinoma.
HBV infection may be asymptomatic.
[0071] There are eight genotypes of HBV (A-H), HBV-A is most
commonly found in the Americas, Africa, India, and Western Europe,
HBV-B and HBV-C are most commonly found in Asia and the United
States, and HBV-D is most commonly found in Southern Europe, India,
and the United States. The HBV genotypes differ by at least 8% of
their sequence across the genome (Okamoto et al., J. Gen. Virol.
69:2575-2583, 1988). HBV nucleic acid and protein sequences are
available in public databases, including GenBank. Exemplary HBV
sequences include GenBank Accession No. AB116094 (HBV genotype A),
which is incorporated by reference herein as present in GenBank on
Apr. 14, 2014. One of skill in the art can identify additional HBV
sequences.
[0072] Hepatitis C virus (HCV): HCV is a single-stranded positive
strand RNA virus that is a member of the family Flaviviridae. HCV
is transmitted primarily by blood-borne routes, including
intravenous drug use and transfusions. Acute HCV infection has
generally mild symptoms, which frequently resolves spontaneously.
About 80% of infected individuals develop chronic infection which
is generally asymptomatic initially, but eventually can lead to
cirrhosis or hepatocellular carcinoma.
[0073] There are at least seven genotypes of HCV (1-7), with
subtypes within each genotype (indicated by lower case letters).
HCV genotypes 1a and 1b are the most common worldwide. HCV
responsiveness to therapy varies by genotype, with genotypes 1 and
4 being less responsive to interferon-based therapy than genotypes
2 and 3. HCV nucleic acid and protein sequences are available in
public databases, including GenBank. Exemplary HCV sequences
include GenBank Accession Nos. Y11604 (HCV-4), AF009606 (HCV-1),
AF333324 (HCV-2), and D17763 (HCV-3), all of which are incorporated
by reference herein as present in GenBank on Apr. 14, 2014. One of
skill in the art can identify additional HCV sequences. Hepatitis E
virus (HEV): HEV is a non-enveloped single-stranded positive sense
RNA virus that is a member of the family Hepeviridae. HEV is
transmitted by the fecal-oral route. HEV causes an acute and
self-limiting infection in most cases. Immunocompromised or
immunosuppressed individuals, such as organ transplant recipients
are at highest risk for chronic HEV infection. It is most prevalent
in India, Southeast Asia, north-central Africa, and Central
America.
[0074] There are four known genotypes of HEV (1-4). HEV nucleic
acid and protein sequences are available in public databases,
including GenBank. Exemplary HEV sequences include GenBank
Accession No. HQ389543, which is incorporated by reference herein
as present in GenBank on Apr. 14, 2014. One of skill in the art can
identify additional HEV sequences.
[0075] Human immunodeficiency virus (HIV): HIV is a retrovirus that
causes immunosuppression in humans (HIV disease), and leads to
disease states known as acquired immunodeficiency syndrome (AIDS)
and AIDS related complex (ARC). "HIV disease" refers to a
well-recognized constellation of signs and symptoms (including the
development of opportunistic infections) in persons who are
infected by an HIV virus, as determined by antibody or western blot
studies or detection of HIV nucleic acids. Laboratory findings
associated with this disease are a progressive decline in T cells.
HIV includes HIV type 1 (HIV-1) and HIV type 2 (HIV-2). Related
viruses that are used as animal models include simian
immunodeficiency virus (SIV) and feline immunodeficiency virus
(FIV).
[0076] HIV nucleic acid and protein sequences are available in
public databases, including GenBank and the HIV Database (available
on the World Wide Web at www.hiv.lanl.gov/). Exemplary reference
sequences include HXB2 for HIV-1 (e.g., GenBank Accession Nos.
K03455 or M38432) and MAC239 for HIV-2 (GenBank Accession No.
M33262). One of skill in the art can identify additional HIV
sequences.
[0077] Isolated: An "isolated" biological component (such as a
nucleic acid) has been substantially separated or purified away
from other biological components in which the component naturally
occurs, such as other chromosomal and extrachromosomal DNA, RNA,
and proteins. Nucleic acids that have been "isolated" include
nucleic acids purified (or "extracted") by standard purification
methods. The term also embraces nucleic acids prepared by
recombinant expression in a host cell as well as chemically
synthesized nucleic acid molecules. Isolated does not require
absolute purity, and can include protein, peptide, or nucleic acid
molecules that are at least 50% isolated, such as at least 75%,
80%, 90%, 95%, 98%, 99%, or even 99.9% isolated.
[0078] Loop-mediated isothermal amplification (LAMP): A method for
amplifying DNA. The method is a single-step amplification reaction
utilizing a DNA polymerase with strand displacement activity (e.g.,
Notomi et al., Nucl. Acids. Res. 28:E63, 2000; Nagamine et al.,
Mol. Cell. Probes 16:223-229, 2002; Mori et al., J. Biochem.
Biophys. Methods 59:145-157, 2004). At least four primers, which
are specific for eight regions within a target nucleic acid
sequence, are typically used for LAMP. The primers include a
forward outer primer (F3), a reverse outer primer (R3), a forward
inner primer (FTP), and a reverse inner primer (RIP). A forward
loop primer (LF), and a reverse loop primer (LR) can also be
included in some embodiments. The amplification reaction produces a
stem-loop DNA with inverted repeats of the target nucleic acid
sequence. Reverse transcriptase can be added to the reaction for
amplification of RNA target sequences. This variation is referred
to as RT-LAMP.
[0079] Primer: Primers are short nucleic acids, generally DNA
oligonucleotides 10 nucleotides or more in length (such as 12, 15,
18, 20, 25, 30, 35, 40, or more nucleotides in length). Primers may
be annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, and then extended along the target DNA strand by a DNA
polymerase enzyme. In some examples, primer pairs can be used for
amplification of a nucleic acid sequence, e.g., by the polymerase
chain reaction (PCR) or other nucleic acid amplification methods
known in the art.
[0080] Probe: A probe typically comprises an isolated nucleic acid
(for example, at least 10 or more nucleotides in length) with an
attached detectable label or reporter molecule. Typical labels
include radioactive isotopes, ligands, chemiluminescent agents,
fluorophores, and enzymes. Methods for labeling oligonucleotides
and guidance in the choice of labels appropriate for various
purposes are discussed, e.g., in Sambrook et al. (2001) and Ausubel
et al. (1987).
[0081] Sample (or biological sample): A biological specimen
containing DNA (for example, genomic DNA or cDNA), RNA (including
mRNA), protein, or combinations thereof. Examples include, but are
not limited to isolated nucleic acids, cells, cell lysates,
chromosomal preparations, peripheral blood, serum, plasma, urine,
saliva, tissue biopsy (such as a tumor biopsy or lymph node
biopsy), surgical specimen, bone marrow, amniocentesis samples, and
autopsy material. In one example, a sample includes viral nucleic
acids, for example, viral DNA, viral RNA, or cDNA reverse
transcribed from viral RNA. In particular examples, samples are
used directly (e.g., fresh or frozen), or can be manipulated prior
to use, for example, by heat-treatment, purification of nucleic
acids, fixation (e.g., using formalin) and/or embedding in wax
(such as FFPE tissue samples).
[0082] Subject: Any multi-cellular vertebrate organism, such as
human and non-human mammals (including non-human primates). In one
example, a subject is known to be or is suspected of being infected
with one or more viruses.
[0083] West Nile virus (WNV): A member of the Japanese encephalitis
serocomplex in the genus Flavivirus, family Flaviviridae. WNV is
most commonly transmitted to humans by mosquitoes, but can also be
transmitted through blood transfusions, organ transplants, and from
mother to baby during pregnancy, delivery, or breastfeeding. In
nature, WNV cycles between mosquitoes and birds and can be
transmitted to humans, horses, and other mammals through bite by an
infected mosquito. Until the mid-1990s, WNV caused sporadic
outbreaks of illness in Africa, the Middle East, and Western Asia.
However, since 1996, West Nile encephalitis has been reported more
frequently in Europe, the Middle East, northern and western Africa,
and Russia. WNV emerged in the western hemisphere in 1999. Most
people infected with WNV do not develop any symptoms. About 20% of
infected individuals develop a fever with headache, body aches,
joint pain, vomiting, diarrhea, or rash. Less than 1% of infected
individuals develop encephalitis or meningitis, which can result in
permanent neurological damage or death (about 10% of those with
neurologic infection).
[0084] WNV nucleic acid and protein sequences are available in
public databases, including GenBank. WNV sequences include GenBank
Accession Nos.: AY278441, AF202541, AF404754, AF260967, AY660002,
AF481864, AY268133, AF404757, and AY277251, all of which are
incorporated by reference as included in GenBank on Apr. 14, 2014.
One of skill in the art can identify additional WNV sequences.
III. Methods of Detecting Viral Nucleic Acids
[0085] Disclosed herein are methods of detecting viral nucleic
acids in a sample (such as a sample from a subject infected with or
suspected to be infected with a virus). The disclosed methods
include LAMP or RT-LAMP assays for detection of viral nucleic acids
in a sample, including one or more of HBV, HCV, HEV, HIV, WNV,
and/or DENV nucleic acids. In some examples, the methods include
detecting HBV in a sample and/or discriminating HBV genotypes (for
example detecting and/or discriminating HBV-A, HBV-B, HBV-C, HBV-D,
HBV-E, or HBV-F). In other examples, the methods include detecting
HCV in a sample and/or discriminating HCV genotypes, for example
detecting and/or discriminating HCV-1 (such as HCV-1a, HCV-1b, or
HCV-1c), HCV2 (such as HCV-2a, HCV-2b, or HCV-2c), HCV3 (such as
HCV-3a or HCV-3b), or HCV4 (such as HCV-4a). In further examples,
the methods include detecting and/or discriminating HEV (such as
HEV-1 or HEV-3) in a sample. In other examples, the methods include
detecting HIV in a sample (such as HIV-1). In additional examples,
the methods include detecting WNV in a sample or detecting DENV in
a sample (for example detecting and/or discriminating DEN-1, DEN-2,
DEN-3, or DEN-4). Primers and probes for use in the disclosed
methods are provided herein.
[0086] The methods described herein may be used for any purpose for
which detection of viral nucleic acids, such as HBV, HCV, HEV, HIV,
WNV, or DENV nucleic acids, is desirable, including diagnostic and
prognostic applications, such as in laboratory and clinical
settings. Appropriate samples include any conventional biological
samples, including clinical samples obtained from a human or
veterinary subject. Suitable samples include all biological samples
useful for detection of infection in subjects, including, but not
limited to, cells (such as buccal cells or peripheral blood
mononuclear cells), tissues, autopsy samples, bone marrow
aspirates, bodily fluids (for example, blood, serum, plasma, urine,
cerebrospinal fluid, middle ear fluids, bronchoalveolar lavage,
tracheal aspirates, sputum, nasopharyngeal aspirates, oropharyngeal
aspirates, or saliva), oral swabs, eye swabs, cervical swabs,
vaginal swabs, rectal swabs, stool, and stool suspensions. The
sample can be used directly or can be processed, such as by adding
solvents, preservatives, buffers, or other compounds or substances.
In some examples, nucleic acids are isolated from the sample. In
other examples, isolation of nucleic acids from the sample is not
necessary prior to use in the methods disclosed herein and the
sample (such as a plasma or serum sample) is used directly (without
nucleic acid extraction, but potentially with heat-treatment or
other processing step). In further examples, the sample is
pre-treated with a lysis buffer, but nucleic acids are not isolated
prior to use in the disclosed methods.
[0087] Samples also include isolated nucleic acids, such as DNA or
RNA isolated from a biological specimen from a subject, a viral
isolate, or other source of nucleic acids. Methods for extracting
nucleic acids such as RNA or DNA from a sample are known to one of
skill in the art; such methods will depend upon, for example, the
type of sample in which the nucleic acid is found. Nucleic acids
can be extracted using standard methods. For instance, rapid
nucleic acid preparation can be performed using a commercially
available kit (such as kits and/or instruments from Qiagen (such as
QiaAmpO, DNEasy.RTM. or RNEasy.RTM. kits), Roche Applied Science
(such as MagNA Pure kits and instruments), Thermo Scientific
(KingFisher mL), bioMerieux (Nuclisens.RTM. NASBA Diagnostics), or
Epicentre (Masterpure.TM. kits)). In other examples, the nucleic
acids may be extracted using guanidinium isothiocyanate, such as
single-step isolation by acid guanidinium
isothiocyanate-phenol-chloroform extraction (Chomczynski et al.
Anal. Biochem. 162:156-159, 1987).
[0088] The disclosed methods are highly sensitive and/or specific
for detection of HBV, HCV, HIV, HEV, WNV, and DENV nucleic acids.
In some examples, the disclosed methods can detect presence of at
least 1 International Unit (IU; about 5 copies) of HBV, HCV, or HEV
nucleic acids (for example at least 10, 25, 50, 10.sup.2, 10,
10.sup.4, 10.sup.5, 10.sup.6, or more IU of HBV, HCV, or HEV
nucleic acids) in a sample or reaction volume. In other examples,
the disclosed methods can detect presence of at least 1 copy of
HBV, HCV, HEV, HIV, WNV, or DENV nucleic acids (for example at
least 10, 25, 50, 10.sup.2, 10, 10.sup.4, 10.sup.5, 10.sup.6, or
more copies) in a sample or reaction volume. In some examples, the
disclosed methods can predict with a sensitivity of at least 75%
and a specificity of at least 75% for presence of one or more of
HBV, HCV, HEV, HIV, WNV, or DENV nucleic acids in a sample, such as
a sensitivity of at least 80%, 85%, 90%, 95%, or even 100% and a
specificity of at least of at least 80%, 85%, 90%, 95%, or even
100%.
[0089] In some embodiments, the methods for detecting viral nucleic
acids in a sample utilize LAMP or RT-LAMP methods of amplification
and detection. LAMP is a one-step isothermal amplification method
that can produce amplified nucleic acids in a short period of time
using a DNA polymerase with strand displacement activity (see,
e.g., Notomi et al., Nucl. Acids Res. 28:e63, 2000). LAMP can be
used for amplification of RNA targets with the addition of reverse
transcriptase (RT) to the reaction without an additional heat step
(referred to as RT-LAMP). The isothermal nature of LAMP and RT-LAMP
allows for assay flexibility because it can be used with simple and
inexpensive heating devices, which can facilitate viral detection
in settings other than centralized clinical laboratories. In
addition, LAMP and RT-LAMP assays are rapid, specific, and
sensitive.
[0090] LAMP or RT-LAMP can also be multiplexed through the addition
of multiple LAMP primer sets with different specificities in a
single reaction vessel (such as a tube, well, or other container).
This capability is advantageous, for example, because it allows for
incorporation of internal control(s), amplification of two or more
regions within the same target, or detection of two or more targets
or pathogens in a single reaction. In some examples, the disclosed
methods include a multiplex LAMP or RT-LAMP assay for detection
and/or discrimination of one or more of HBV, HCV, HEV, HIV, WNV,
and DENV in a single reaction.
[0091] The sample and LAMP primer set(s) are contacted under
conditions sufficient for amplification of a viral nucleic acid(s),
producing an amplification product. The sample is contacted with
the set(s) of LAMP primers at a concentration sufficient to support
amplification of the particular viral nucleic acid(s) for the LAMP
primer set(s). In some examples, the amount of each primer is about
0.1 .mu.M to about 5 .mu.M (such as about 0.2 .mu.M to about 2
.mu.M, or about 0.5 .mu.M to about 2 .mu.M). Each primer can be
included at a different concentration, and appropriate
concentrations for each primer can be selected by one of skill in
the art using routine methods. Exemplary primer concentrations are
provided in Examples 2-5, below.
[0092] In some examples, the LAMP or RT-LAMP reaction is carried
out in a mixture including a suitable buffer (such as a phosphate
buffer or Tris buffer). The buffer may also include additional
components, such as salts (such as KCl or NaCl, magnesium salts
(e.g., MgCl.sub.2 or MgSO.sub.4), ammonium (e.g.,
(NH.sub.4).sub.2SO.sub.4)), detergents (e.g., TRITONO-X100), or
other additives (such as betaine or dimethylsulfoxide). The buffer
or reaction mixture also includes nucleotides or nucleotide
analogs. In some examples, an equimolar mixture of dATP, dCTP,
dGTP, and dTTP (referred to as dNTPs) is included, for example
about 0.5-5 mM dNTPs (such as about 1-3 mM dNTPs). In one example,
the buffer is MAB buffer, described in Section IV. In other
examples, the buffer is Loopamp.RTM. reaction mix (Eiken Chemical
Co., Ltd., Tochigi, Japan) or another commercially available
polymerase or RT reaction buffer. One of skill in the art can
select an appropriate buffer and any additives using routine
methods.
[0093] A DNA polymerase with strand displacement activity is also
included in the reaction mixture. Exemplary DNA polymerases include
Bst DNA polymerase, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart.TM.
DNA polymerase (New England Biolabs, Ipswich, Mass.), Phi29 DNA
polymerase, Bsu DNA polymerase, OmniAmp.TM. DNA polymerase
(Lucigen, Middleton, Mich.), Taq DNA polymerase, Vent.sub.R.RTM.
and Deep Vent.sub.R.RTM. DNA polymerases (New England Biolabs),
9.degree.N.sub.m.TM. DNA polymerase (New England Biolabs), Klenow
fragment of DNA polymerase I, PhiPRD1 DNA polymerase, phage M2 DNA
polymerase, T4 DNA polymerase, and T5 DNA polymerase. In some
examples, about 1 to 20 U (such as about 1 to 15 U, about 2 to 12
U, about 10 to 20 U, about 2 to 10 U, about 5 to 10 U, or 8 U) of
DNA polymerase is included in the reaction. In some examples, the
polymerase has strand displacement activity and lacks 5'-3'
exonuclease activity. In one non-limiting example, the DNA
polymerase is Bst DNA polymerase.
[0094] In some embodiments, the target nucleic acid is DNA (such as
an HBV nucleic acid). In other embodiments, the target nucleic acid
is RNA (such as an HCV nucleic acid, an HEV nucleic acid, an HIV
nucleic acid, a WNV nucleic acid, or a DENV nucleic acid), and a
reverse transcriptase is additionally included in the LAMP assay
(called an RT-LAMP assay). Exemplary reverse transcriptases include
MMLV reverse transcriptase, AMY reverse transcriptase, and
ThermoScript.TM. reverse transcriptase (Life Technologies, Grand
Island, N.Y.), Thermo-X.TM. reverse transcriptase (Life
Technologies, Grand Island, N.Y.). In some examples, about 0.1 to
50 U (such as about 0.2 to 40 U, about 0.5 to 20 U, about 1 to 10
U, about 2 to 8 U, or about 5 U) of RT is included in the
reaction.
[0095] The reaction mixture, including sample, LAMP primers,
buffers, nucleotides, DNA polymerase, optionally reverse
transcriptase, and any other components, is incubated for a period
of time and at a temperature sufficient for production of an
amplification product. In some examples, the reaction conditions
include incubating the reaction mixture at about 37.degree. C. to
about 80.degree. C. (such as about 40.degree. C. to about
70.degree. C., about 50.degree. C. to about 65.degree. C., or about
60.degree. C. to about 65.degree. C.), for example about 40.degree.
C., about 45.degree. C., about 50.degree. C., about 55.degree. C.,
about 60.degree. C., about 65.degree. C., about 70.degree. C.,
about 75.degree. C., or about 80.degree. C. In particular examples,
the reaction mixture is incubated at about 60.degree. C.,
63.5.degree. C., or 65.degree. C. The reaction mixture is incubated
for at least about 5 minutes (such as about 10, about 15, about 20,
about 30, about 40, about 50, about 60, about 70, about 80 about
90, about 100, about 110, about 120 minutes or more), for example
about 10-120 minutes, about 15-90 minutes, about 20-70 minutes, or
about 30-60 minutes.
[0096] Following incubation of the reaction mixture, the
amplification product is detected by any suitable method. The
detection methods may be quantitative, semi-quantitative, or
qualitative. In some examples, accumulation of an amplification
product is detected by measuring the turbidity of the reaction
mixture (for example, visually or with a turbidometer). In other
examples, amplification product is detected using gel
electrophoresis, for example by detecting presence or amount of
amplification product with agarose gel electrophoresis. The
particular viral nucleic acid may be determined in some cases by
the band pattern observed on gel electrophoresis (for example,
HCV-1, HCV-2, and HCV-3 can be discriminated by the pattern of
bands on gel electrophoresis). In some examples, amplification
product is detected using a colorimetric assay, such as with an
intercalating dye (for example, propidium iodide, SYBRO green,
GelRed.TM., or GelGreen.TM. dyes). In further examples,
amplification product is detected with a metal ion sensitive
fluorescent molecule (for example, calcein, which is a fluorescence
dye that is quenched by manganese ions and has increased
fluorescence when bound to magnesium ions). In other examples,
amplification products are detected using a detectable label
incorporated in one or more of the LAMP primers (discussed below).
The detectable label may be optically detectable, for example, by
eye or using a spectrophotometer or fluorimeter. In some examples,
the detectable label is a fluorophore, such as those described
above. In some examples, the label is detected using a fluorescence
scanner (such as ESEQuant Tube Scanner, Qiagen; NanoDrop.TM. 3300
Fluorospectrometer, Thermo Scientific). One of skill in the art can
select one or more detectable labels for use in the methods
disclosed herein.
[0097] Thus, in some examples, the disclosed methods include
detecting fluorescence from a detectable label incorporated in one
or more LAMP primers. In some examples, the sample is identified as
containing a viral nucleic acid (for example is "positive" for the
virus) if an increase in fluorescence is detected compared to a
control (such as a no template control sample or a known negative
sample). In other examples, the amount of viral nucleic acid in a
sample is determined semi-quantitatively or quantitatively. For
example, the amount of viral nucleic acid in a test sample can be
determined by comparing the amount of fluorescence obtained in a
LAMP assay with fluorescence obtained in a LAMP assay with samples
containing known amounts of the viral nucleic acid of interest or a
standard curve prepared from such samples.
[0098] In particular embodiments, one of the LAMP primers in a set
includes a detectable label, such as a fluorophore. In some
examples, a LAMP primer including a detectable label may be
referred to herein as a "probe." In a specific example, an LR
primer (for example, SEQ ID NOs: 6, 12, 19, 25, 31, 37, 48, 54, 61,
or 67) includes a fluorophore, for example attached to the 5' end
or the 3' end of the primer. In another example, an LF primer (for
example, SEQ ID NOs: 5, 11, 18, 24, 30, 36, 46, 47, 53, 60, or 66)
includes a fluorophore, for example attached to the 5' end or the
3' end of the primer. Any fluorophore can be used; in some
non-limiting examples, the fluorophore is TET, FAM, Cy3, or
TexasRed. In additional examples, the labeled LAMP primer also
includes an acceptor fluorophore (a quencher). In some examples,
the quencher includes a BLACK HOLE quencher, for example, attached
to the 5' end or the 3' end of the primer.
[0099] Exemplary quenchers include BHQ1, BHQ2, or BHQ3.
[0100] A. HBV LAMP Assay
[0101] In some embodiments, the methods include contacting a sample
(such as a sample including or suspected to include HBV nucleic
acids) with at least one set of LAMP primers specific for an HBV
nucleic acid under conditions sufficient for amplification of the
HBV nucleic acid, producing an amplification product. In some
examples, the LAMP primers amplify an HBV large S protein and
partially overlapping polymerase region nucleic acid having at
least 80% sequence identity (such as at least 85%, 90%, 95%, 98%,
or more sequence identity) to SEQ ID NO: 76, or a portion thereof
(FIG. 1). In some embodiments, the set of LAMP primers amplifies an
HBV genotype A nucleic acid, an HBV genotype B nucleic acid, an HBV
genotype C nucleic acid, an HBV genotype D nucleic acid, an HBV
genotype E nucleic acid, and/or an HBV genotype F nucleic acid. The
amplification product is detected by any suitable method, such as
detection of turbidity, fluorescence (qualitatively or
quantitatively), or by gel electrophoresis. In some examples, the
HBV genotype (e.g., HBV-A, HBV-B, HBV-C, HBV-D, etc.) is determined
by visualizing the pattern of bands on gel electrophoresis of the
reaction products.
[0102] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of HBV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 1,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 2,
an FIP primer with at least 90% sequence identity to SEQ ID NO: 3,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 4,
an LF primer with at least 90% sequence identity to SEQ ID NO: 5,
and an LR primer with at least 90% sequence identity to SEQ ID NO:
6, or the reverse complement of any one thereof. In one example,
the set of LAMP primers for HBV includes primers comprising,
consisting essentially of, or consisting of the nucleic acid
sequence each of SEQ ID NOs: 1-6. In some examples, the set of LAMP
primers includes an LR primer with at least 90% sequence identity
to SEQ ID NO: 6 or the reverse complement thereof, further
including a fluorophore (for example at the 5' end of the LR
primer) and/or a quencher (for example at the 3' end of the LR
primer).
[0103] B. HCV LAMP Assay
[0104] In other embodiments, the methods include contacting a
sample (such as a sample including or suspected to include HCV
nucleic acids) with at least one set of LAMP primers specific for
an HCV nucleic acid under conditions sufficient for amplification
of the HCV nucleic acid, producing an amplification product. In
some examples, the LAMP primers amplify a 5' non-coding region
(NCR) nucleic acid having at least 80% sequence identity (such as
at least 85%, 90%, 95%, 98%, or more sequence identity) to any one
of SEQ ID NOs: 77-80 (FIGS. 7A-7D), or a portion thereof. In some
embodiments, the set of LAMP primers specifically amplifies an HCV
genotype 1 nucleic acid (such as an HCV-1a, HCV-1b, and/or HCV-1c
nucleic acid), an HCV genotype 2 nucleic acid (such as an HCV-2a,
HCV-2b, and/or HCV-2c nucleic acid), an HCV genotype 3 nucleic acid
(such as an HCV-3a and/or HCV-3b nucleic acid), or an HCV genotype
4 nucleic acid (such as an HCV-4a nucleic acid). The amplification
product is detected by any suitable method, such as detection of
turbidity, fluorescence (qualitatively or quantitatively), or by
gel electrophoresis. In some examples, the HCV genotype is
determined by visualizing the pattern of bands on gel
electrophoresis of the reaction products. As described in Example
3, each of HCV-1, HCV-2, and HCV-3 can be discriminated based on
the distinct pattern of bands produced by a LAMP assay using the
set of primers of SEQ ID NOs: 7-12. In other examples, the HCV
genotype is determined by using a set of HCV LAMP primers specific
for a single HCV genotype.
[0105] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of HCV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 7,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 8,
an FIP primer with at least 90% sequence identity to SEQ ID NO: 9,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 10,
an LF primer with at least 90% sequence identity to SEQ ID NO: 11
and an LR primer with at least 90% sequence identity to SEQ ID NO:
12, or the reverse complement of any one thereof. In one example,
the sample is contacted with a set of LAMP primers for HCV
including primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 7-12.
In some examples, the set of LAMP primers includes an LR primer
with at least 90% sequence identity to SEQ ID NO: 12 or the reverse
complement thereof, further including a fluorophore (for example at
the 5' end of the LR primer) and or a quencher (for example at the
3' end of the LR primer).
[0106] In other examples, a sample is contacted with a set of LAMP
primers for amplification of HCV nucleic acids that includes an F3
primer with at least 90% sequence identity to SEQ ID NO: 13 or SEQ
ID NO: 14, an R3 primer with at least 90% sequence identity to SEQ
ID NO: 15, an FIP primer with at least 90% sequence identity to SEQ
ID NO: 16, an RIP primer with at least 90% sequence identity to SEQ
ID NO: 17, an LF primer with at least 90% sequence identity to SEQ
ID NO: 18 and an LR primer with at least 90% sequence identity to
SEQ ID NO: 19, or the reverse complement of any one thereof. In one
example, the sample is contacted with a set of LAMP primers for HCV
including primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 13 and
15-19 or a set of LAMP primers for HCV including primers
comprising, consisting essentially of, or consisting of the nucleic
acid sequence each of SEQ ID NOs: 14-19. In some examples, the set
of LAMP primers includes an LR primer with at least 90% sequence
identity to SEQ ID NO: 19 or the reverse complement thereof,
further including a fluorophore (for example at the 5' end of the
LR primer) and/or a quencher (for example at the 3' end of the LR
primer).
[0107] In further examples, a sample is contacted with a set of
LAMP primers for amplification of HCV-1 nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 20,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 21,
an FIP primer with at least 90% sequence identity to SEQ ID NO: 22,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 23,
an LF primer with at least 90% sequence identity to SEQ ID NO: 24,
and an LR primer with at least 90% sequence identity to SEQ ID NO:
25, or the reverse complement of any one thereof. In one example,
the sample is contacted with a set of LAMP primers specific for
HCV-1 including primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 20-25.
In some examples, the set of LAMP primers includes an LR primer
with at least 90% sequence identity to SEQ ID NO: 25 or the reverse
complement thereof, further including a fluorophore (for example at
the 5' end of the LR primer) and/or a quencher (for example at the
3' end of the LR primer).
[0108] In other examples, a sample is contacted with a set of LAMP
primers for amplification of HCV-2 nucleic acids that includes an
F3 primer with at least 90% sequence identity to SEQ ID NO: 26, an
R3 primer with at least 90% sequence identity to SEQ ID NO: 27, an
FIP primer with at least 90% sequence identity to SEQ ID NO: 28, an
RIP primer with at least 90% sequence identity to SEQ ID NO: 29, an
LF primer with at least 90% sequence identity to SEQ ID NO: 30 and
an LR primer with at least 90% sequence identity to SEQ ID NO: 31,
or the reverse complement of any one thereof. In one example, the
sample is contacted with a set of LAMP primers specific for HCV-2
including primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 26-31.
In some examples, the set of LAMP primers includes an LR primer
with at least 90% sequence identity to SEQ ID NO: 31 or the reverse
complement thereof further including a fluorophore (for example at
the 5' end of the LR primer) and/or a quencher (for example at the
3' end of the LR primer).
[0109] In further examples, a sample is contacted with a set of
LAMP primers for amplification of HCV-3 nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 32,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 33,
an FIP primer with at least 90% sequence identity to SEQ ID NO: 34,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 35,
an LF primer with at least 90% sequence identity to SEQ ID NO: 36,
and an LR primer with at least 90% sequence identity to SEQ ID NO:
37, or the reverse complement of any one thereof. In one example,
the sample is contacted with a set of LAMP primers specific for
HCV-3 including primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 32-37.
In some examples, the set of LAMP primers includes an LR primer
with at least 90% sequence identity to SEQ ID NO: 37 or the reverse
complement thereof, further including a fluorophore (for example at
the 5' end of the LR primer) and/or a quencher (for example at the
3' end of the LR primer).
[0110] C. HIV LAMP Assay
[0111] In some embodiments, the methods include contacting a sample
(such as a sample including or suspected to include HIV nucleic
acids) with at least one set of LAMP primers specific for an HIV
nucleic acid (such as an HIV-1 nucleic acid) under conditions
sufficient for amplification of the HIV nucleic acid, producing an
amplification product. In some examples, the LAMP primers amplify a
p24-specific portion of an HIV gag nucleic acid having at least 80%
sequence identity (such as at least 85%, 90%, 95%, 98%, or more
sequence identity) to nucleotides 570-760 of GenBank Accession No.
J416161 (incorporated by reference as present on Apr. 14, 2014), or
a portion thereof. The amplification product is detected by any
suitable method, such as detection of turbidity, fluorescence
(qualitatively or quantitatively), or by gel electrophoresis.
[0112] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of HIV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 38
or SEQ ID NO: 81, an R3 primer with at least 90% sequence identity
to any one of SEQ ID NOs: 39-41, an FTP primer with at least 90%
sequence identity to SEQ ID NOs: 42 or 43, an RIP primer with at
least 90% sequence identity to SEQ ID NOs: 44 or 45, an LF primer
with at least 90% sequence identity to SEQ ID NOs: 46 or 47, and an
LR primer with at least 90% sequence identity to SEQ ID NO: 48, or
the reverse complement of any one thereof. In one example, the set
of LAMP primers for HIV includes primers comprising, consisting
essentially of, or consisting of the nucleic acid sequence each of
SEQ ID NOs: 38, 41, 42, 45, 47, and 48; however, any combination of
F3, R3, FIP, RIP, LF, and LR primers from SEQ ID NOs: 38-48 and 81
can be used in an HIV-1 LAMP assay. In some examples, the set of
LAMP primers includes an LR primer with at least 90% sequence
identity to SEQ ID NO: 48 or the reverse complement thereof further
including a fluorophore (for example at the 5' end of the LR
primer) and/or a quencher (for example at the 3' end of the LR
primer).
[0113] D. HEV LAMP Assay
[0114] In some embodiments, the methods include contacting a sample
(such as a sample including or suspected to include HEV nucleic
acids) with at least one set of LAMP primers specific for an HEV
nucleic acid under conditions sufficient for amplification of the
HEV nucleic acid, producing an amplification product. In some
examples, the LAMP primers amplify an HEV capsid nucleic acid
having at least 80% sequence identity (such as at least 85%, 90%,
95%, 98%, or more sequence identity) to nucleotides 5280-5490 of
GenBank Accession No. AB437318 (incorporated herein by reference as
present on Apr. 14, 2014), or a portion thereof. The amplification
product is detected by any suitable method, such as detection of
turbidity, fluorescence (qualitatively or quantitatively), or by
gel electrophoresis. In some examples, the HEV genotype is
determined by visualizing the pattern of bands on gel
electrophoresis of the reaction products. For example, at least
HEV-1 and HEV-3 can be discriminated based on the distinct pattern
of bands produced by a LAMP assay.
[0115] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of HEV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 49,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 50,
an FTP primer with at least 90% sequence identity to SEQ ID NO: 51,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 52,
an LF primer with at least 90% sequence identity to SEQ ID NO: 53,
and an LR primer with at least 90% sequence identity to SEQ ID NO:
54, or the reverse complement of any one thereof. In one example,
the set of LAMP primers for HEV includes primers comprising,
consisting essentially of, or consisting of the nucleic acid
sequence each of SEQ ID NOs: 49-54. In some examples, the set of
LAMP primers includes an LR primer with at least 90% sequence
identity to SEQ ID NO: 54 or the reverse complement thereof further
including a fluorophore (for example at the 5' end of the LR
primer) and/or a quencher (for example at the 3' end of the LR
primer).
[0116] E. WNV LAMP Assay
[0117] In some embodiments, the methods include contacting a sample
(such as a sample including or suspected to include WNV nucleic
acids) with at least one set of LAMP primers specific for a WNV
nucleic acid under conditions sufficient for amplification of the
WNV nucleic acid, producing an amplification product. In some
examples, the LAMP primers amplify a WNV nucleic acid. The
amplification product is detected by any suitable method, such as
detection of turbidity, fluorescence (qualitatively or
quantitatively), or by gel electrophoresis.
[0118] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of WNV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 55
or 56, an R3 primer with at least 90% sequence identity to SEQ ID
NO: 57, an FIP primer with at least 90% sequence identity to SEQ ID
NO: 58, an RIP primer with at least 90% sequence identity to SEQ ID
NO: 59, an LF primer with at least 90% sequence identity to SEQ ID
NO: 60, and an LR primer with at least 90% sequence identity to SEQ
ID NO: 61, or the reverse complement of any one thereof. In one
example, the set of LAMP primers for WNV includes primers
comprising, consisting essentially of, or consisting of the nucleic
acid sequence each of SEQ ID NOs: 55 and 57-61 or the set of LAMP
primers for WNV includes primers comprising, consisting essentially
of, or consisting of the nucleic acid sequence each of SEQ ID NOs:
56-61. In some examples, the set of LAMP primers includes an LR
primer with at least 90% sequence identity to SEQ ID NO: 61 or the
reverse complement thereof, further including a fluorophore (for
example at the 5' end of the LR primer) and/or a quencher (for
example at the 3' end of the LR primer).
[0119] F. DENV LAMP Assay
[0120] In some embodiments, the methods include contacting a sample
(such as a sample including or suspected to include DENV nucleic
acids) with at least one set of LAMP primers specific for an DENV
nucleic acid under conditions sufficient for amplification of the
DENV nucleic acid, producing an amplification product. In some
examples, the LAMP primers amplify a DENV nucleic acid. In some
embodiments, the set of LAMP primers amplifies a DENV serotype 1
nucleic acid. In other embodiments, the set of LAMP primers
amplifies a DENV serotype 1 nucleic acid, a DENV serotype 2 nucleic
acid, a DENV serotype 3 nucleic acid, and/or a DENV serotype 4
nucleic acid. The amplification product is detected by any suitable
method, such as detection of turbidity, fluorescence (qualitatively
or quantitatively), or by gel electrophoresis. In some examples,
the DENV serotype is determined by visualizing the pattern of bands
on gel electrophoresis of the reaction products. For example, each
of DENV-1, DENV-2, DENV-3, and DENV-4 can be discriminated based on
the distinct pattern of bands produced by a LAMP assay.
[0121] In particular examples, a sample is contacted with a set of
LAMP primers for amplification of DENV nucleic acids that includes
an F3 primer with at least 90% sequence identity to SEQ ID NO: 62,
an R3 primer with at least 90% sequence identity to SEQ ID NO: 63,
an FTP primer with at least 90% sequence identity to SEQ ID NO: 64,
an RIP primer with at least 90% sequence identity to SEQ ID NO: 65,
an LF primer with at least 90% sequence identity to SEQ ID NO: 66
and an LR primer with at least 90% sequence identity to SEQ ID NO:
67, or the reverse complement of any one thereof. In one example,
the set of LAMP primers for DENV includes primers comprising,
consisting essentially of, or consisting of the nucleic acid
sequence each of SEQ ID NOs: 62-67. In some examples, the set of
LAMP primers includes an LR primer with at least 90% sequence
identity to SEQ ID NO: 67 or the reverse complement thereof further
including a fluorophore (for example at the 5' end of the LR
primer) and or a quencher (for example at the 3' end of the LR
primer).
[0122] In other examples, a sample is contacted with a set of LAMP
primers for amplification of DENV nucleic acids that includes an F3
primer with at least 90% sequence identity to SEQ ID NO: 68, an R3
primer with at least 90% sequence identity to SEQ ID NO: 69, an FIP
primer with at least 90% sequence identity to SEQ ID NO: 70, and an
RIP primer with at least 90% sequence identity to SEQ ID NO: 71,
and optionally, an LF primer with at least 90% sequence identity to
SEQ ID NO: 66 and an LR primer with at least 90% sequence identity
to SEQ ID NO: 67, or the reverse complement of any one thereof. In
one example, the set of LAMP primers for DENV includes primers
comprising, consisting essentially of, or consisting of the nucleic
acid sequence each of SEQ ID NOs: 68-71 or the set of LAMP primers
for DENV includes primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 66-71.
In some examples, the set of LAMP primers includes an LR primer
with at least 90% sequence identity to SEQ ID NO: 67 or the reverse
complement thereof, further including a fluorophore (for example at
the 5' end of the LR primer) and/or a quencher (for example at the
3' end of the LR primer).
[0123] In further examples, a sample is contacted with a set of
LAMP primers for amplification of DENV-1 nucleic acids that
includes an F3 primer with at least 90% sequence identity to SEQ ID
NO: 72, an R3 primer with at least 90% sequence identity to SEQ ID
NO: 73, an FTP primer with at least 90% sequence identity to SEQ ID
NO: 74, and an RIP primer with at least 90% sequence identity to
SEQ ID NO: 75, and optionally, an LF primer with at least 90%
sequence identity to SEQ ID NO: 66, and an LR primer with at least
90% sequence identity to SEQ ID NO: 67, or the reverse complement
of any one thereof. In one example, the set of LAMP primers for
DENV includes primers comprising, consisting essentially of, or
consisting of the nucleic acid sequence each of SEQ ID NOs: 72-75
or the set of LAMP primers for DENV includes primers comprising,
consisting essentially of, or consisting of the nucleic acid
sequence each of SEQ ID NOs: 66, 67, and 72-75. In some examples,
the set of LAMP primers includes an LR primer with at least 90%
sequence identity to SEQ ID NO: 67 or the reverse complement
thereof further including a fluorophore (for example at the 5' end
of the LR primer) and/or a quencher (for example at the 3' end of
the LR primer).
[0124] G. Multiplex Assays
[0125] The LAMP and RT-LAMP methods disclosed herein can be used
with a single set of LAMP primers (such as a set of LAMP primers
for HBV, HCV, HIV, HEV, WNV, or DENV, for example, those described
above). In other examples, the methods include multiplex LAMP or
RT-LAMP reactions, which include contacting a sample with two or
more sets of LAMP primers for amplification of target nucleic acids
from different genotypes or serotypes of a virus (such as HCV-1,
HCV-2, HCV-3, and/or HCV-4), or target nucleic acids from different
viruses or other pathogens (such as HBV, HCV, HEV, HIV, WNV, and/or
DENV).
[0126] In a particular example, a multiplex LAMP or RT-LAMP
reaction includes contacting a sample with a set of HBV LAMP
primers (such as SEQ ID NOs: 1-6) and at least one set of HCV LAMP
primers (such as SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID
NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, and/or SEQ ID
NOs: 32-37) under conditions sufficient for amplification of an HBV
and/or HCV nucleic acid. In another example, a multiplex LAMP or
RT-LAMP reaction includes contacting a sample with a set of HBV
LAMP primers (such as SEQ ID NOs: 1-6), at least one set of HCV
LAMP primers (such as SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19,
SEQ ID NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, and/or SEQ
ID NOs: 32-37), and at least one set of HIV LAMP primers (such as a
set of LAMP primers selected from SEQ ID NOs: 38-48 and 81; for
example, SEQ ID NOs: 38, 41, 42, 45, 47, and 48) under conditions
sufficient for amplification of an HBV, HCV, and/or HIV nucleic
acid. In yet another example, a multiplex LAMP or RT-LAMP reaction
includes contacting a sample with a set of HBV LAMP primers (such
as SEQ ID NOs: 1-6), at least one set of HCV LAMP primers (such as
SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID NOs: 14-19, SEQ
ID NOs: 20-25, SEQ ID NOs: 26-31, and/or SEQ ID NOs: 32-37), at
least one set of HIV LAMP primers (such as a set of LAMP primers
selected from SEQ ID NOs: 38-48 and 81; for example, SEQ ID NOs:
38, 41, 42, 45, 47, and 48), and a set of HEV LAMP primers (such as
SEQ ID NOs: 49-54) under conditions sufficient for amplification of
an HBV, HCV, HIV, and/or HEV nucleic acid.
[0127] In a still further example, a multiplex LAMP or RT-LAMP
reaction includes contacting a sample with a set of HBV LAMP
primers (such as SEQ ID NOs: 1-6), at least one set of HCV LAMP
primers (such as SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, SEQ ID
NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, and/or SEQ ID
NOs: 32-37), at least one set of HIV LAMP primers (such as a set of
LAMP primers selected from SEQ ID NOs: 38-48 and 81; for example,
SEQ ID NOs: 38, 41, 42, 45, 47, and 48), a set of HEV LAMP primers
(such as SEQ ID NOs: 49-54), and at least one set of WNV LAMP
primers (such as SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61)
under conditions sufficient for amplification of an HBV, HCV, HIV,
HEV and/or WNV nucleic acid. In another example, a multiplex LAMP
or RT-LAMP reaction includes contacting a sample with a set of HBV
LAMP primers (such as SEQ ID NOs: 1-6), at least one set of HCV
LAMP primers (such as SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19,
SEQ ID NOs: 14-19, SEQ ID NOs: 20-25, SEQ ID NOs: 26-31, and/or SEQ
ID NOs: 32-37), at least one set of HIV LAMP primers (such as a set
of LAMP primers selected from SEQ ID NOs: 38-48 and 81; for
example, SEQ ID NOs: 38, 41, 42, 45, 47, and 48), a set of HEV LAMP
primers (such as SEQ ID NOs: 49-54), a set of WNV LAMP primers
(such as SEQ ID NOs: 55 and 57-61 or 56-61), and at least one set
of DENV primers (such as a set of DENV LAMP primers selected from
SEQ ID NOs: 62-75, for example SEQ ID NOs: 61-67, SEQ ID NOs:
69-71, or SEQ ID NOs: 2-75) under conditions sufficient for
amplification of HBV, HCV, HIV, HEV, WNV, and/or DENV nucleic
acids.
[0128] In some embodiments, the multiplex methods include
contacting the sample with at least one LR primer that includes a
fluorophore and optionally a quencher (referred to herein in some
examples as a "fluoro-oligo"). In some examples, the multiplex set
of primers includes a single fluoro-oligo, specific for one of the
viral nucleic acids that can be detected by the assay. In other
examples, the multiplex set of primers includes two or more
fluoro-oligos, each with the same or different fluorophores and/or
quenchers. In some examples, each set of LAMP primers included in
the set contacted with the sample includes a fluoro-oligo, each
with a different fluorophore. This enables one-tube detection of
one or more viral nucleic acids present in the sample by detecting
presence of fluorescence from each fluoro-oligo. An increase in
fluorescence over background, non-template control, or a known
negative sample indicates the presence of the particular viral
nucleic acid in the sample.
IV. Assay Buffer
[0129] Disclosed herein is a novel assay buffer that can be used
for nucleic acid detection and/or amplification assays, including
LAMP assays, PCR, and reverse transcription. The buffer can also
act as a cell lysis buffer, and thus can be used directly with
samples such as blood, serum, or plasma, without prior nucleic acid
extraction.
[0130] In some embodiments, the buffer (referred to herein as
mannitol acetate buffer, or MAB) has a pH of about 7.8 (such as
about 7.7-7.9) and includes about 2% D-mannitol, about 0.2%
Triton.RTM.-X100, about 40 mM Tris-HCl, about 20 mM KCl, about 20
mM (NH.sub.4).sub.2SO.sub.4, about 6 mM MgSO.sub.4, about 0.5 M
L-proline, about 10 mM Tris acetate, about 1.6 mM magnesium
acetate, and about 15 mM potassium acetate. In some examples, the
MAB also includes one or more dNTPs, such as dATP, dCTP, dGTP,
and/or dTTP. In some examples, the MAB includes about 2 mM each of
dATP, dCTP, dGTP, and dTTP. In other examples, the MAB is as listed
above, however, D-mannitol is included at 1-3%, L-proline is
included at 0.2-0.5 M, and/or Triton.RTM.-X100 is included at
0.1-0.3%.
[0131] The MAB is highly stable at a range of temperatures and for
long periods of time. For example, LAMP reactions can still be
successfully performed following storage of the MAB at room
temperature for extended periods of time and/or following exposure
of the MAB to heating. In some examples, the MAB is stable when
stored at room temperature (about 20-27.degree. C., such as about
22-25.degree. C.) for 1 day to at least about 6 months. In
particular examples, the MAB is stable at room temperature for at
least about 6 months, at least about 12 months, at least about 18
months, at least about 24 months, or more. In other examples, the
MAB is stable when heated to at least about 60.degree. C. for 30-60
minutes and cooled to room temperature one or more times.
[0132] In some examples, the MAB buffer is used in nucleic acid
synthesis or amplification reactions, such as PCR, RT-PCR, LAMP,
RT-LAMP, or reverse transcription. For example, MAB can be used in
place of other commercially available reaction buffers in nucleic
acid synthesis or amplification reactions. In other examples, the
MAB buffer is used for cell lysis. Thus, MAB can be used in single
tube reactions that include a sample containing cells (such as a
blood, plasma, or serum sample), primers (such as one or more sets
of LAMP primers disclosed herein), enzymes (such as DNA polymerase
and in some cases reverse transcriptase), and other reagents.
[0133] The MAB buffer provides several advantages over conventional
reaction and/or lysis buffers. As discussed above, MAB is extremely
stable over a range of storage times and temperature exposures. In
addition, without being bound by theory, it is believed that the
buffer has a destabilizing effect on double-stranded nucleic acids,
lowers the T.sub.m of DNA, and/or stabilizes DNA polymerase. As a
result, decreased reaction times and/or temperatures can be used
for reactions including MAB as compared to conventional buffers.
For example, use of MAB can decrease the necessary reaction times
for reverse transcription, PCR,
[0134] RT-PCR, LAMP, or RT-LAMP reactions by at least 10% (such as
at least 25%, 50%, 75%, or more) compared with reactions using
conventional (e.g., commercially available reaction buffers).
V. Primers, Probes, and Kits
[0135] Primers and probes (such as isolated nucleic acid primers
and/or probes) suitable for use in the disclosed methods are
described herein. The disclosed primers and probes are suitable for
detecting viral nucleic acids (such as HBV, HCV, HIV, HEV, DENV, or
WNV nucleic acids) using LAMP or RT-LAMP.
[0136] In some embodiments, the disclosed primers and/or probes are
between 10 and 60 nucleotides in length, such as 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 29, 30,
31, 32, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides
in length and are capable of hybridizing to, and in some examples,
amplifying the disclosed nucleic acid molecules. In some examples,
the primers and/or probes are at least 10, 15, 20, 25, 30, 35, 40,
45, 50, 55, or 60 nucleotides in length. In other examples, the
primers and/or probes may be no more than 10, 15, 20, 25, 30, 35,
40, 45, 50, 55, or 60 nucleotides in length.
[0137] In some embodiments, the disclosed primers include LAMP
primers for amplification of HBV nucleic acids, including primers
with at least 90% sequence identity to any one of SEQ ID NOs: 1-6.
In some examples, the disclosed HBV primers are "universal"
primers, for example, are capable of amplifying nucleic acids from
multiple HBV genotypes (for example, one or more of HBV-A, HBV-B,
HBV-C, HBV-D, HBV-E, and/or HBV-F). In some examples, the primers
have at least 95% sequence identity to any one of SEQ ID NOs: 1-6,
comprise the sequence of any one of SEQ ID NOs: 1-6, or consist of
the sequence of any one of SEQ ID NOs: 1-6.
[0138] In other embodiments, the primers include LAMP primers for
amplification of HCV nucleic acids, including primers with at least
90% sequence identity to any one of SEQ ID NOs: 7-12 or SEQ ID NOs:
13-19 (e.g., HCV universal primers). In further examples, the
primers include LAMP primers for amplification of specific HCV
genotypes, such as primers with at least 90% sequence identity to
SEQ ID NOs: 20-25 (HCV-1, such as genotypes 1a, 1b, and/or 1c), SEQ
ID NOs: 26-31 (HCV-2, such as genotypes 2a, 2b, and/or 2c), or SEQ
ID NOs: 32-37 (HCV-3, such as genotypes 3a and/or 3b). In some
examples, the HCV primers have at least 95% sequence identity to
any one of SEQ ID NOs: 7-37, comprise the sequence of any one of
SEQ ID NOs: 7-37, or consist of the sequence of any one of SEQ ID
NOs: 7-37.
[0139] In additional embodiments, the disclosed primers include
LAMP primers for amplification of HIV nucleic acids, including
primers with at least 90% sequence identity to any one of SEQ ID
NOs: 38-48 and 81. In some examples, the disclosed HIV primers are
capable of amplifying nucleic acids from HIV-1. In some examples,
the HIV primers have at least 95% sequence identity to any one of
SEQ ID NOs: 38-48 and 81, comprise the sequence of any one of SEQ
ID NOs: 38-48 and 81, or consist of the sequence of any one of SEQ
ID NOs: 38-48 and 81.
[0140] In further embodiments, the disclosed primers include LAMP
primers for amplification of HEV nucleic acids, including primers
with at least 90% sequence identity to any one of SEQ ID NOs:
49-54. In some examples, the HEV primers have at least 95% sequence
identity to any one of SEQ ID NOs: 49-54, comprise the sequence of
any one of SEQ ID NOs: 49-54, or consist of the sequence of any one
of SEQ ID NOs: 49-54.
[0141] In other embodiments, the disclosed primers include LAMP
primers for amplification of WNV nucleic acids, including primers
with at least 90% sequence identity to any one of SEQ ID NOs:
55-61. In some examples, the WNV primers have at least 95% sequence
identity to any one of SEQ ID NOs: 55-61, comprise the sequence of
any one of SEQ ID NOs: 55-61, or consist of the sequence of any one
of SEQ ID NOs: 55-61.
[0142] In still further embodiments, the disclosed primers include
LAMP primers for amplification of DENV nucleic acids, including
primers with at least 90% sequence identity to any one of SEQ ID
NOs: 62-75. In some examples, the primers are capable of amplifying
nucleic acids from one or more DENV serotypes (for example, one or
more of DEN-1, DEN-2, DEN-3, and/or DEN-4), such as SEQ ID NOs:
62-71. In some examples, the primers have at least 95% sequence
identity to any one of SEQ ID NOs: 62-71, comprise the sequence of
any one of SEQ ID NOs: 62-71, or consist of the sequence of any one
of SEQ ID NOs: 62-71. In particular examples, the primers amplify a
DENV-1 nucleic acid and have at least 90% or 95% sequence identity
to any one of SEQ ID NOs: 72-75, comprise the sequence of any one
of SEQ ID NOs: 72-75, or consist of the sequence of any one of SEQ
ID NOs: 72-75.
[0143] In some examples, at least one of the disclosed primers
includes a detectable label, such as a fluorophore. In particular
examples, an LR primer (e.g., any one of SEQ ID NOs: 6, 12, 19, 25,
31, 37, 48, 54, 61, or 67) includes a fluorophore at the 5' or 3'
end. In other examples, the LF primer (e.g., any one of SEQ ID NOs:
5, 11, 18, 24, 30, 36, 46, 47, 53, 60, or 66) includes a
fluorophore at the 5' or 3' end. In non-limiting examples, the
fluorophore can be TET, FAM, or TexasRed. In other examples, the LR
or LF primer includes a fluorescence quencher at the 5' or 3' end,
such as a dark quencher, which in one non-limiting example is a
Black Hole Quencher (such as BHQ1).
[0144] Also provided by the present disclosure are probes or
primers that include variations to the nucleotide sequences shown
in any of SEQ ID NOs: 1-75 and 81, as long as such variations
permit detection and/or amplification of the target nucleic acid
molecule. For example, a probe or primer can have at least 90%
sequence identity such as at least 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99% identity to a nucleic acid including the sequence
shown in any of SEQ ID NOs: 1-75 and 81. In such examples, the
number of nucleotides does not change, but the nucleic acid
sequence shown in any of SEQ ID NOs: 1-75 and 81 can vary at a few
nucleotides, such as changes at 1, 2, 3, 4, or 5 nucleotides.
[0145] The present application also provides probes and primers
that are slightly longer or shorter than the nucleotide sequences
shown in any of SEQ ID NOs: 1-75 and 81, as long as such deletions
or additions permit amplification and/or detection of the desired
target nucleic acid molecule. For example, a probe or primer can
include a few nucleotide deletions or additions at the 5'- and/or
3'-end of the probe or primers shown in any of SEQ ID NOs: 1-75 and
81, such as addition or deletion of 1, 2, 3, or 4 nucleotides from
the 5'- or 3'-end, or combinations thereof (such as a deletion from
one end and an addition to the other end). In some examples, the
number of nucleotides changes.
[0146] Also provided are probes and primers that are degenerate at
one or more positions (such as 1, 2, 3, 4, 5, or more positions),
for example, a probe or primer that includes a mixture of
nucleotides (such as 2, 3, or 4 nucleotides) at a specified
position in the probe or primer. In some examples, the probes and
primers disclosed herein include one or more synthetic bases or
alternative bases (such as inosine). In other examples, the probes
and primers disclosed herein include one or more modified
nucleotides or nucleic acid analogues, such as one or more locked
nucleic acids (see, e.g., U.S. Pat. No. 6,794,499) or one or more
superbases (Nanogen, Inc., Bothell, Wash.). In other examples, the
probes and primers disclosed herein include a minor groove binder
conjugated to the 5' or 3' end of the oligonucleotide (see, e.g.,
U.S. Pat. No. 6,486,308).
[0147] The nucleic acid primers and probes disclosed herein can be
supplied in the form of a kit for use in the detection or
amplification of one or more viral nucleic acids (such as one or
more of HBV, HCV, HEV, HIV, WNV, and/or DENV). In such a kit, an
appropriate amount of one or more of the nucleic acid probes and/or
primers (such as one or more of SEQ ID NOs: 1-75 and 81) are
provided in one or more containers or in one or more individual
wells of a multiwell plate or card (such as a microfluidic card). A
nucleic acid probe and/or primer may be provided suspended in an
aqueous solution or as a freeze-dried or lyophilized powder, for
instance. The container(s) in which the nucleic acid(s) are
supplied can be any conventional container that is capable of
holding the supplied form, for instance, microfuge tubes,
multi-well plates, ampoules, or bottles. The kits can include
either labeled or unlabeled nucleic acid probes (for example, 1, 2,
3, 4, 5, or more probes, such as LR primers with an incorporated
fluorophore and/or quencher) and/or primers (for example, 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more primers) for use
in amplification and/or detection of viral nucleic acids. One or
more control probes, primers, and or nucleic acids also may be
supplied in the kit. An exemplary control is RNase P; however one
of skill in the art can select other suitable controls.
[0148] In some examples, one or more probes and/or one or more
primers (such as one or more sets of primers suitable for LAMP),
may be provided in pre-measured single use amounts in individual,
typically disposable, tubes, wells, or equivalent containers. In
this example, the sample to be tested for the presence of the
target nucleic acids can be added to the individual tube(s) or
well(s) and amplification and/or detection can be carried out
directly. In some examples, the containers may also contain
additional reagents for amplification reactions, such as buffer
(for example, the MAB buffer disclosed herein), enzymes (such as
reverse transcriptase and/or DNA polymerase), dNTPs, or other
reagents. In some embodiments, the container includes all of the
components required for the reaction except the sample (and water,
if the reagents are supplied in dried or lyophilized form). In some
examples, the kits include at least one detectably labeled primer,
such as a detectably labeled LR primer (e.g., at least one of SEQ
ID NOs: 6, 19, 25, 31, 37, 48, 54, 61, or 67 with a covalently
attached detectable label, such as a fluorophore).
[0149] In particular examples, the kits include at least one set of
LAMP primers for amplification and/or detection of HBV nucleic
acids, for example in a single tube, well, or other container. In
one example, the kit includes a set of primers including SEQ ID
NOs: 1-6.
[0150] In other examples, the kits include at least one set of LAMP
primers for amplification and/or detection of HCV nucleic acids
(such as 1, 2, 3, 4, or 5 sets of LAMP primers). In some examples,
each set of LAMP primers is in a single tube, well, or other
container. In some examples, the kit includes at least one set of
LAMP primers including SEQ ID NOs: 7-12, a set of LAMP primers
including SEQ ID NOs: 13 and 15-19, a set of LAMP primers including
SEQ ID NOs: 14-19, a set of LAMP primers including SEQ ID NOs:
20-25, a set of LAMP primers including SEQ ID NOs: 26-31, and/or a
set of LAMP primers including SEQ ID NOs: 32-37.
[0151] In still further examples, the kits include at least one set
of LAMP primers for amplification and/or detection of HIV, for
example in a single tube, well, or other container. In some
examples, the kit includes a set of LAMP primers selected from SEQ
ID NOs: 38-48 and 81. In one example, the kit includes a set of
LAMP primers comprising or consisting of SEQ ID NOs: 38, 41, 42,
45, 47, and 48.
[0152] In additional examples, the kits include at least one set of
LAMP primers for amplification and/or detection of HEV, for example
in a single tube, well, or other container. In one example, the kit
includes a set of LAMP primers including SEQ ID NOs: 49-54.
[0153] In further examples, the kits include at least one set of
LAMP primers for amplification and/or detection of WNV, for example
in a single tube, well, or other container. In some examples, the
kit includes a set of LAMP primers including SEQ ID NOs: 55 and
57-61 or a set of LAMP primers including SEQ ID NOs: 56-61.
[0154] In still further examples, the kits include at least one set
of LAMP primers for amplification and/or detection of DENV, for
example in a single tube, well, or other container. In some
examples, the kit includes a set of LAMP primers including SEQ ID
NOs: 62-67, a set of LAMP primers including SEQ ID NOs: 68-71, a
set of LAMP primers including SEQ ID NOs: 66-71, a set of LAMP
primers including SEQ ID NOs: 72-75, or a set of LAMP primers
including SEQ ID NOs: 66, 67, and 72-75.
[0155] In some embodiments, disclosed herein are kits for multiplex
detection of two or more viral nucleic acids in a sample. Thus, in
some examples, the kits include two or more sets of LAMP primers
(such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sets of LAMP primers)
for detection of viral nucleic acids, in a single container (such
as a single tube, well, or other container). In some examples, the
kit includes in a single container two or more sets of LAMP primers
(optionally with detectably labeled LR primers in each set)
selected from a set of LAMP primers including SEQ ID NOs: 1-6
(HBV), a set of LAMP primers including SEQ ID NOs: 7-12 (HCV
universal), a set of LAMP primers including SEQ ID NOs: 13 and
15-19 (HCV universal), a set of LAMP primers including SEQ ID NOs:
14-19 (HCV universal), a set of LAMP primers including SEQ ID NOs:
20-25 (HCV-1), a set of LAMP primers including SEQ ID NOs: 26-31
(HCV-2), a set of LAMP primers including SEQ ID NOs: 32-37 (HCV-3),
a set of LAMP primers selected from SEQ ID NOs: 38-48 and 81 (HIV;
for example, SEQ ID NOs: 38, 41, 42, 45, 47, and 48), a set of LAMP
primers including SEQ ID NOs: 49-54 (HEV), a set of LAMP primers
including SEQ ID NOs: 55 and 57-61 (WNV), a set of LAMP primers
including SEQ ID NOs: 56-61 (WNV), and a set of LAMP primers
selected from SEQ ID NOs: 62-75 (DENV; for example, SEQ ID NOs:
62-67, SEQ ID NOs: 68-71, SEQ ID NOs: 66-71, SEQ ID NOs: 72-75, or
SEQ ID NOs: 66, 67, and 72-75). The set(s) of LAMP primers
optionally include a detectably labeled primer, such as detectably
labeled LR primer. In some embodiments, the kit includes two or
more detectably labeled LR primers with different labels (for
example, each with a fluorophore with a different emission
wavelength).
[0156] In one example, a kit includes in a single container (either
in liquid or dried form) a set of LAMP primers including SEQ ID
NOs: 1-6 (HBV) and a set of LAMP primers including SEQ ID NOs:
7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID NOs: 14-19 (HCV). In an
additional example, a kit includes in a single container (either in
liquid or dried form) a set of LAMP primers including SEQ ID NOs:
1-6 (HBV), a set of LAMP primers including SEQ ID NOs: 7-12, SEQ ID
NOs: 13 and 15-19, or SEQ ID NOs: 14-19 (HCV), and a set of LAMP
primers selected from SEQ ID NOs: 38-48 and 81 (HIV; for example,
SEQ ID NOs: 38, 41, 42, 45, 47, and 48). In another example, a kit
includes in a single container (either in liquid or dried form) a
set of LAMP primers including SEQ ID NOs: 1-6 (HBV), a set of LAMP
primers including SEQ ID NOs: 7-12, SEQ ID NOs: 13 and 15-19, or
SEQ ID NOs: 14-19 (HCV), and a set of LAMP primers including SEQ ID
NOs: 55 and 57-61 or SEQ ID NOs: 56-61 (WNV). In a further example,
a kit includes in a single container (either in liquid or dried
form) a set of LAMP primers including SEQ ID NOs: 1-6 (HBV), a set
of LAMP primers including SEQ ID NOs: 7-12, SEQ ID NOs: 13 and
15-19, or SEQ ID NOs: 14-19 (HCV), a set of LAMP primers including
SEQ ID NOs: 49-54 (HEV), and a set of LAMP primers selected from
SEQ ID NOs: 38-48 and 81 (HIV; for example, SEQ ID NOs: 38, 41, 42,
45, 47, and 48).
[0157] In yet another example, a kit includes in a single container
(either in liquid or dried form) a set of LAMP primers including
SEQ ID NOs: 1-6 (HBV), a set of LAMP primers including SEQ ID NOs:
7-12, SEQ ID NOs: 13 and 15-19, or SEQ ID NOs: 14-19 (HCV), a set
of LAMP primers selected from SEQ ID NOs: 38-48 and 81 (HIV; for
example, SEQ ID NOs: 38, 41, 42, 45, 47, and 48), a set of LAMP
primers including SEQ ID NOs: 49-54 (HEV), a set of LAMP primers
including SEQ ID NOs: 55 and 57-61 or SEQ ID NOs: 56-61 (WNV), and
a set of LAMP primers selected from SEQ ID NOs: 62-75 (DENV; for
example, SEQ ID NOs: 62-67, SEQ ID NOs: 68-71, SEQ ID NOs: 66-71,
SEQ ID NOs: 72-75, or SEQ ID NOs: 66, 67, and 72-75). In a further
example, a kit includes in a single container (either in liquid or
dried form) a set of LAMP primers including SEQ ID NOs: 7-12, SEQ
ID NOs: 13 and 15-19, or SEQ ID NOs: 14-19 (HCV "universal"), a set
of LAMP primers including SEQ ID NOs: 20-25 (HCV-1), a set of LAMP
primers including SEQ ID NOs: 26-31 (HCV-2), and a set of LAMP
primers including SEQ ID NOs: 32-37 (HCV-3).
[0158] The kits disclosed herein may also include one or more
control probes and/or primers. In some examples, the kit includes
at least one probe that is capable of hybridizing to an RNase P
nucleic acid and/or one or more primers capable of amplifying an
RNase P nucleic acid. One of skill in the art can identify and
select primers for a suitable control nucleic acid. In additional
examples, the kit may include one or more positive control samples
(such as a sample including a particular viral nucleic acid) and/or
one or more negative control samples (such as a sample known to be
negative for a particular viral nucleic acid).
[0159] The present disclosure is illustrated by the following
non-limiting Examples.
Example 1
Assay Reagents
[0160] Sets of primers were designed for LAMP assays for HBV, HCV,
HEV, HIV-1, WNV, and DENV (Table 1). For each set, the LR primer
included a fluorophore at the 5' end and a quencher at the 3'
end.
TABLE-US-00001 TABLE 1 LAMP primer sequences Primer SEQ ID Virus
Name Primer Sequence (5'-3') NO: HBV HBU-F3 TCCTCACAATACCGCAGAGT 1
Universal HBU-R3 GCAGCAGGATGAAGAGGAAT 2 HBU-FIP
GTTGGGGACTGCGAATTTTGGCTTTTTAGACT 3 CGTGGTGGACTTCT HBU-RIP
TCACTCACCAACCTCCTGTCCTTTTTAAAACG 4 CCGCAGACACAT HBU-LF
GGTGATCCCCCTAGAAAATTGAG 5 HBU-LR AATTTGTCCTGGTTATCGCTGG 6 HCV
HCVU-F3 GAGTGTTGTACAGCCTCCAGGA 7 Universal HCVU-R3
ATTGGGCGGCGGTTGGTG 8 (set 1) HCVU-FIP
CTCGGCTAGCAGTCTTGCGGTTTTGATGACCG 9 GGTCCTTTCTTG HCVU-RIP
TAGTGTTGGGTCGCGAAAGGCTTTTCACGGTC 10 TACGAGACCTCC HCVU-LF
GGGCATTGAGCGGGTTAATC 11 HCVU-LR TTGCGGTACTGCCTGATAGG 12 HCV HCU-F3
CGGGAGAGCCATAGTGGT 13 Universal HCU-F3a GGCGACACTCCACCATAGAT 14
(set 2) HCU-R3 CACGGTCTACGAGACCTCC 15 HCU-FIP
GGCATTGAGCGGGTTGATCCAATTTTTGCGGA 16 ACCGGTGAGTAC HCU-RIP
CGCGAGACTGCTAGCCGAGTTTTTACCCTATC 17 AGGCAGTACCAC HCU-LF
TCGTCCTGGCAATTCCGG 18 HCU-LR GTGTTGGGTCGCGAAAGG 19 HCV1 HCV1-F3
GGCGACACTCCACCATGAAT 20 HCV1-R3 CTATCAGGCAGTACCACAAGGC 21 HCV1-FIP
CACTATGGCTCTCCCGGGAGTTTTCGTCTAGC 22 CATGGCGTTAG HCV1-RIP
GGAACCGGTGAGTACACCGGTTTTCCCAAATC 23 TCCAGGCATTGA HCV1-LF
AGGCTGCACGACACTCATA 24 HCV1-LR GACCGGGTCCTTTCTTGGA 25 HCV2 HCV2-F3
CGCAGAAAGCGTCTAGCCA 26 HCV2-R3 CGTACTCGCAAGCACCCTATC 27 HCV2-FIP
ATGACCGGGCATAGAGTGGGTTTTTGTGGTCT 28 GCGGAACCGGTGA HCV2-RIP
GCCCCCGCAAGACTGCTAGCTTTTCTCGCAAG 29 CACCCTATCAGGC HCV2-LF
AAAGGACCCAGTCTTCCCGG 30 HCV2-LR AGCGTTGGGTTGCGAAAGGCC 31 HCV3
HCV3-F3 CCCAGAAATTTGGGCGTGCC 32 HCV3-R3 GGAACTTGACGTCCTGTGG 33
HCV3-FIP GCAAGCACCCTATCAGGCAGTATTTTCGCGAG 34 ATCACTAGCCGA HCV3-RIP
GGAGGTCTCGTAGACCGTGCATTTTGCGACGG 35 ATGGTGTTTCT HCV3-LF
CTTTCGCGACCCAACACTA 36 HCV3-LR CATGAGCACACTTCCTAAACCTCAA 37 HIV-1
HIV1-F3 ACACAGTGGGGGGACATCAAGC 38 HIV1-F3A AACACCATGCTAAACACAGTGG
81 HIV1-R3 GTCATCCATGCTATTTGTTCCTG 39 HIV1-R3A
TCCATGCTATTTGTTCCTGAAGGG 40 HIV1-R3B CCTGAAGGGTACTAGTAGTTCCTG 41
HIV1-FIP GATGCAATCTATCCCATTCTGTTTTGCCATGC 42 AAATGTTAAAAG HIV1-FIPA
GATGCAATCTATCCCATTCTGTTTTGCCATGC 43 AAATGTTAAAAGAGACC HIV1-RIP
AGTGCATGCAGGGCCTATTGCACTTTTGTTCC 44 TGCTATGTCACTTCC HIV1-RIP2
AGTCCATGGAGGGCCTATTGCACTTTTGTTCC 45 TGCTATGTCACTTCC HIV1-LF
TCAGCTTCCTCATTGATGGTC 46 HIV1-LF2 CAGCTTCCTCATTGATGGTCT 47 HIV1-LR
CAGGCCAGATGAGAGAACCAA 48 HEV HEV-F3a CGGTGGTTTCTGGGGTGACA 49 HEV-R3
GAGATAGCAGTCAACGGCGC 50 HEY-FTP AGGGCGAGCTCCAGCCCCGGTTTTGCCCTTCG 51
CCCTCCCCTATATT HEV-RIP CCAGTCCCAGCGCCCCTCCGTTTTAGCTGG 52
GGCAGATCGACGAC HEV-LF TGTGAAACGACATCGGCGGC 53 HEV-LR
CGTCGATCTGCCCCAGCTGG 54 WNV WF3 GGGGCCAATACGATTTGTGT 55 WF3a
CGATTTGTGTTGGCTCTCTTGGCGT 56 WR3 AGGCCAATCATGACTGCAAT 57 WFIP
CTCTCCATCGATCCAGCACTGCTTTTCTTGGC 58 GTTCTTCAGGTTCA WRIP
ACTAGGGACCTTGACCAGTGCTTTTTTCCGGT 59 CTTTCCTCCTCTT WLF
CGGGTCGGAGCAATTGCTG 60 WLR TCAATCGGCGGAGCTCAAAAC 61 DENV DVF3
AGCTTCATCGTGGGGATGT 62 DVR3 CTCTCCCAGCGTCAATATGC 63 DVFIP
GGAGGGGTCTCCTCTAACCACTTTTTGGCTGC 64 AACCCATGGAAG DVRIP
CAAAACATAACGCAGCAGCGGGTTTTGGGGG 65 TCTCCTCTAACCTC DVLF
TGCTACCCCATGCGTACAG 66 DVLR CAACACCAGGGGAAGCTGT 67 DENV DF3
ATGGAAGCTGTACGCATGG 68 (set 2) DR3 GCGTTCTGTGCCTGGAATG 69 DFIP
AGGATACAGCTTCCCCTGGTGTTTTTGTGGTT 70 AGAGGAGACCCCT DRIP
AGAGGTTAGAGGAGACCCCCGTTTTAGCAGG 71 ATCTCTGGTCTCTC DENV-1 D1F3
GGCTGCAACCCATGGAAG 72 D1R3 TGCCTGGAATGATGCTGTAG 73 D1FIP
CGCTGCTGCGTTATGTTTTGGGTTTTCTGTACG 74 CATGGGGTAGC D1RIP
AGAGGTTAGAGGAGACCCCCGTTTTAGCAGG 75 ATCTCTGGTCTCTC
[0161] A thermostable reaction buffer, the mannitol acetate buffer
(MAB; pH 7.8) was formulated and used for LAMP reactions. MAB
consisted of 2% D-mannitol; 0.2% Triton.RTM.-X100; 0.5 M L-proline;
10 mM Tris acetate; 1.6 mM magnesium-acetate; 15 mM potassium
acetate; 40 mM Tris-HCl; 20 mM KCl; 20 mM (NH.sub.4).sub.2SO.sub.4;
6 mM MgSO.sub.4; and 2 mM each dNTPs.
Example 2
LAMP Assay for Detection of Hepatitis B Virus
[0162] The subject matter of this example is included in Nyan et
al. (Clin. Infect. Dis. doi: 10.1093/cid/ciu210, 2014), which is
incorporated herein by reference in its entirety,
Introduction
[0163] Hepatitis B virus (HBV) is a blood-borne pathogen which
infects over 4 million people yearly. About 350 million people
world-wide are chronically infected and are infectious carriers of
the virus. Mainly transmitted through blood-borne methods,
HBV-infection can lead to hepatitis, liver cirrhosis, and
hepatocellular carcinoma, and often co-infects with HCV and HIV
(Liang, Hepatology 49:S13-S21, 2009; Arababadi et al, Clin. Res.
Hepatol. Gastroenterol. 35:554-559, 2011; Kim et al., BMC Infect.
Dis. 12:160, 2012).
[0164] HBV is a circular, partially double-stranded DNA virus of
3.2 kilobases. There are 8 known genotypes (A to H) that are
divergent by >8% across the entire genome and are distributed
world-wide (Okamoto et al., J. Gen Virol. 69:2575-2583, 1988; Wai
et al., Clin. Liver Dis. 8:321-352, 2004; Wong et al., Curr. Opin.
Infect. Dis. 25:570-577, 2012). Describing epidemiology of HBV does
add to the literature, but treatment remains far-fetched in the
developing world due to the high cost of anti-virals. However, a
tool capable of generally detecting the major HBV genotypes may
help in understanding the global geographic prevalence of HBV, aid
in addressing the burden that HBV infection places on health care
systems, and guide public health and clinicians in designing
preventive and therapeutic measures.
[0165] Infection with HBV is a global public health problem,
particularly in poorer countries where health care resources are
limited and inaccessible. According to the WHO, countries in
regions of Asia, Africa, and South/Central America have high HBV
carrier rates of over 8% (Franco et al., World J. Hepatol. 4:74-80,
2012; Ott et al., Vaccine 30:2212-2219, 2012). This problem is
compounded by the lack of advanced medical and diagnostic
laboratory services for donor screening or routine testing of
patients.
[0166] In many developed countries, blood-donors are screened for
HBV surface antigen, antibodies to the core of HBV, and HBV-DNA in
order to ensure safe blood-supply and clinical diagnosis. Such
tests are conventionally performed with tests including, ELISA and
real-time PCR. These tests are time-consuming, expensive, and
require skilled personnel and elaborate equipment to perform
(Caliendo et al., J. Clin. Microbiol. 49:2854-2858, 2011; Kao,
Expert Rev. Gastroenterol. Hepatol 2:553-562, 2008; Wang et al., J.
Biomed. Nanotechnol. 8:786-790, 2012). Hence, there is a need for a
rapid and cost-effective detection tool for screening blood-donors
and testing patient specimens for HBV infection in endemic as well
as resource-limited environments.
[0167] A simple, sensitive, and specific loop-mediated isothermal
amplification assay (HBV-LAMP) for rapid and universal detection of
all the major HBV genotypes in peripheral blood is described
herein. LAMP is a DNA amplification method that uses 2 to 3 pairs
of sequence-specific primers and a DNA strand-displacement process
for amplification under isothermal conditions. The amplification
results in multiple inverted repeats of amplicons that form a
ladder-like banding pattern. This unique and portable detection
tool has the potential for use in point-of-care settings for
blood-screening and patient follow-up.
Methods
[0168] Specimens, Standards, and DNA Preparation:
[0169] HBV genotyping reference plasma-panels containing various
titers of WHO-International standards (OptiQuant, AcroMetrix/Life
Technologies, Grand Island, N.Y.) and the Worldwide HBV-DNA
Performance-Panel (WWHD301, SeraCare Life Sciences, Milford, Mass.)
were used. A total of 182 donor-plasma specimens were also used for
assay development and evaluation. DNA extraction was performed
using the QIAamp.RTM. DNA Blood-Mini-Kit (Qiagen, Germantown, Md.)
according to manufacturer's protocol. DNA was extracted from
200-400 .mu.L of plasma-standards and eluted in 50-150 .mu.L of
Qiagen Buffer AE. Nucleic acid from the clinical specimens was
concentrated by addition of 0.5 M Ammonium-Acetate and 0.05 mg/mL
glycerol (Ambion/Life Technologies, Grand Island, N.Y.),
precipitated with one volume of 100% Isopropanol (Sigma-Aldrich,
St. Louis, Mo.), centrifuged, and the DNA pellet re-suspended in
25-35 .mu.L of Buffer AE. Finally, the DNA was measured using
NanoDrop.TM.-1000 spectrophotometer (Thermo-Scientific, Waltham,
Mass.), aliquoted, and stored at -80.degree. C. until needed for
testing.
[0170] Heat-Treatment of Donor Plasma Specimens as Substrate:
[0171] Substrate for HBV-LAMP was also prepared by heat-treatment
of donor plasma without DNA extraction. Briefly, 25 .mu.L of
specimens were diluted 2-fold with nuclease-free water. The mixture
was briefly vortexed and heated at 95.degree. C. for 5 minutes,
then at 100.degree. C. for approximately 5 minutes. The mixture was
then centrifuged at 12,000.times.g for 3 minutes. The supernatant
was reserved and 3-10 .mu.L used in isothermal amplification for
detection of HBV. Design of oligonucleotides: Sequences of HBV
genotypes (n=197) were retrieved from the GenBank database of the
NCBI and from the European Nucleotide Archive of the European
Molecular Biology Laboratory (EMBL). The sequences were analyzed
using ClustalW2. HBV genotype-A (GenBank Accession Number AB116094)
was used for primer development and targeted conserved sequences
within the S-gene and the partially overlapping Polymerase regions
of the HBV genome (FIG. 1). Primers were manually designed, aided
by PrimerExplorer4 and Primer3 web-interfaces, and synthesized by
Integrated DNA Technologies (Coralville, Iowa) and EuroFins MWG
Operon (Huntsville, Ala.). The primer sequences are shown in Table
1 (Example 1). The primers are stable for at least 3 years at
-20.degree. C. and -80.degree. C.
[0172] Accelerated Stability Studies of Reaction Buffer:
[0173] Aliquots of the MAB (Example 1) were stored at room
temperature (22-25.degree. C.) under sterile condition for
approximately 6 months and then evaluated in LAMP for its stability
when used to amplify nucleic acid. Also, accelerated stability
studies were performed by heating freshly formulated MAB at
60.degree. C. for 60 minutes, cooling to room temperature, and
heating again for an additional 30 minutes (3 times daily for 5
days), then used in LAMP reactions for detection of HBV-DNA.
[0174] Reaction Mixture and Conditions:
[0175] Isothermal amplification of the HBV-DNA was performed in a
25 .mu.L total reaction mixture. Reaction cocktail consisted of
12.5 .mu.L of 2.times.MAB, 1.2 .mu.M each of HBU-FIP and HBU-RIP,
0.8 .mu.M each of HBU-LF and HBU-LR, 0.4 .mu.M each of HBU-F3 and
HBU-R3, and 8 Units of Bst DNA-polymerase (New England Biolabs,
Ipswich, Mass.). Three to 10 .mu.L of DNA or heat-treated plasma
was applied as template. A no-template (water) control and DNA
extracted from HBV-negative plasma were used as negative controls.
DNA of known HBV genotypes was used as positive controls.
Isothermal-amplification was performed at 60.degree. C. for 60
minutes on a simple digital heat-block. All reagents were prepared
in a PCR chamber and experiments were performed in a unidirectional
flow-process with precautionary measures observed to avoid
cross-contamination.
[0176] Analysis of Reaction Products:
[0177] Five-microliters of HBV-LAMP products were
electrophoretically analyzed on a 2.8% agarose-gel stained with
GelRed.TM. nucleic acid stain (Phenix-Research, Candler, N.C.), run
in 1.times.TAE-buffer at 100-volts for 50 to 55 minutes, and
visualized with a UV-transilluminator at 302 nm. Amplification
products were also visualized in the original reaction-tube by
adding 0.5 .mu.L of a 10.times. GelGreen.TM. fluorescence dye
(Phenix Research) to 10 .mu.L of LAMP reaction products and
visualizing with a UV-transilluminator at 302 nm.
[0178] Analytical Sensitivity and Specificity of HBV-LAMP
Assay:
[0179] Analytical sensitivity was evaluated by testing 10-fold
serial dilutions of HBV DNA. The assay detection limit was
determined by analysis of 4 to 7 replicates of serially diluted HBV
DNA (OptiQuant HBV-DNA Quantification-Panel). The analytical
specificity of the HBV LAMP assay was investigated by testing
HBV-specific primers against DNA (.about.30 ng) extracted from
Cytomegalovirus-positive and Parvovirus-positive plasma specimens.
Specificity of the HBV oligonucleotides was further evaluated by
testing DNA (.about.50 ng) of Leishmania major, Leishmania tropica,
and Trypanosoma cruzi.
[0180] Assay Diagnostic Sensitivity and Specificity:
[0181] The diagnostic sensitivity and specificity of HBV-LAMP assay
was investigated by blind testing a total of 182 donor plasma
specimens that were pre-selected using the Procleix.RTM.
Ultrio.RTM. assay (Gen-Probe-Corporation, Emeryville, Calif.).
[0182] Time-Point of Assay Detection:
[0183] In order to determine the time-point at which HBV-DNA is
amplified by the LAMP assay, time-course amplification studies were
performed at 10, 20, 30, 40, and 60 minute time-points using 50 and
100 IU of HBV DNA per reaction. At the end of the indicated
time-points, reaction tubes containing HBV DNA were removed from
the heat-block and placed on ice to terminate the reaction.
Results
[0184] Detection of HBV-DNA:
[0185] HBV DNA extracted from plasma standards of various HBV
genotypes were used in the assay. Electrophoretic analysis of the
LAMP products demonstrated successful detection of all 6 major
HBV-genotypes (A to F) with a universal set of HBV-LAMP primers
(FIG. 2A). The LAMP-reaction resulted in a unique laddering pattern
of amplicons common to all genotypes detected (FIG. 2A).
UV-visualization of LAMP products with GelGreen.TM. dye revealed a
greenish-fluorescent glow in the reaction tubes that were positive
for amplified HBV-DNA (FIG. 2B). No fluorescence or laddering
pattern was observed for the no-template (water) control or the
normal human plasma (FIGS. 2A and 2B).
[0186] Analytical and Diagnostic Sensitivity of HBV-LAMP Assay:
[0187] Assay sensitivity was evaluated by testing 10-fold serial
dilutions of HBV DNA in the LAMP-reaction. The assay detected down
to 10 IU per reaction of HBV-DNA (FIG. 3A). Addition of
GelGreen.TM. fluorescent-dye to the reaction-tubes revealed a
fluorescent glow with decreasing intensity from 10.sup.4 to 0.1
IU/reaction (FIG. 3B). Also, donor plasma samples (n=75) were
tested to evaluate the diagnostic sensitivity of the assay. Test
results revealed that the assay detected 69 of 75 (92%) as
HBV-positive (Table 2). The undetected samples (n=6) had DNA levels
below the assay detection-limit (.about.7-10 IU/reaction).
[0188] Analytical and Diagnostics Specificity of HBV-LAMP
Assay:
[0189] The analytical specificity of the HBV-LAMP assay was
investigated by testing DNA of CMV and PV, respectively.
Electrophoretic analysis of test results revealed no detection
(FIG. 3C). Also, specificity of the HBV oligonucleotides was
evaluated by testing DNA of L. major, L. tropica, and T. cruzi in
LAMP-assay. Results of the test also demonstrated no detection
(FIG. 3D). In order to assess the diagnostic specificity of the
assay, healthy human plasma specimens (n=107) were tested and all
samples tested negative (100%) by the HBV-LAMP assay (Table 2).
TABLE-US-00002 TABLE 2 Clinical plasma specimens evaluated by the
HBV LAMP assay DNA Extraction DNA Amplification Sensitivity Plasma
Reaction In-put HBV- Specificity Total Detection volume volume
volume positive Healthy/negative specimens Method (.mu.L) (.mu.L)
(.mu.L) plasma human plasma tested HBV- 400 25 10 69/75 107/107
(100%) 182 LAMP (92%) Procleix 500 >500 500 75/75 107/107 (100%)
182 Ultrio.sup.a (100%) .sup.aProcleix sensitivity not absolute;
based on positive donor-cohort.
[0190] Evaluation of HBV-LAMP Assay:
[0191] To determine the field and clinical utility of the HBV-LAMP
assay, experiments were conducted using donor plasma specimens from
which DNA was extracted. Aliquots of the identical plasma samples
were also heat-treated (without DNA extraction) and directly tested
in the LAMP reaction. The results of agarose-gel electrophoresis
demonstrated detection of HBV DNA using both extracted DNA and
heat-treated plasma samples (FIGS. 4A and 4B). The assay detected
two additional samples (#15 and 21) when extracted DNA was used,
suggesting that the assay is more sensitive under those
conditions.
[0192] Limit of Detection:
[0193] To determine the limit of detection of the HBV-LAMP assay, 4
to 7 replicates of serially diluted HBV DNA that was extracted from
the OptiQuant HBV-DNA quantification plasma panel were assayed and
analyzed. Results revealed a 100% detection rate for 25, 50,
10.sup.2, 10, and 10.sup.4 IU of HBV DNA molecules per reaction,
while 1 and 10 IU of HBV DNA were detected at 25% and 57% rates,
respectively (Table 3).
TABLE-US-00003 TABLE 3 Probit data on LAMP assay amplification of
various concentrations of HBV DNA. Replicates HBV DNA Tested in
Number of Times Rate of (IU/reaction) Reaction Detected Detection
(%) 10.sup.4 7 7 100 10.sup.3 7 7 100 10.sup.2 7 7 100 50 7 7 100
25 7 7 100 10 7 4 57 1 4 1 25 0.1 4 0 0
[0194] Time-Point of Detection:
[0195] One of the advantages of the LAMP-assay is its rapid
detection process. In order to evaluate the earliest time-point at
which detection occurs, amplification of HBV DNA was tested at
defined time intervals. Results of experiments revealed the assay
detection of 50 IU of HBV DNA appeared at the 30-minute time-point,
while 100 IU of HBV DNA was detected at the 20-minute time-point
(FIG. 5).
[0196] Stability of Reaction Buffer:
[0197] The stability of the Mannitol-Acetate-Buffer was evaluated
as described in the method section. Electrophoretic analysis showed
successful amplification of 25 IU/reaction of HBV DNA using fresh
buffer regularly stored at -20.degree. C., 10 IU/reaction of
HBV-DNA when room-temperature-stored buffer (22-25.degree. C.) was
used, and 50 IU/reaction HBV-DNA when accelerated-aged buffer was
used (FIGS. 6A-6C).
Discussion
[0198] The prevalence of HBV infection in underprivileged
communities and regions of the world has generated heightened
concerns in health care circles world-wide. HBV screening and
diagnosis in resource-limited environments is often a challenging
situation, because of time and cost-limitations, thus leaving
infected individuals undiagnosed for several years. This
underscores the need for a simple and rapid diagnostic and
screening tool that is applicable not only in resource-limited
settings, but also in any region of the world with high prevalence
of HBV infections. In the developed world, the HBV LAMP assay could
be useful to verify that a patient undergoing HBV treatment has
achieved full virological suppression.
[0199] This example describes development and validation of a
sensitive and rapid isothermal amplification assay for
pan-detection of HBV-genotypes (A-F) in plasma specimens. The HBV
LAMP assay offers several advantages over conventional "gold
standard" methods like real-time PCR or ELISA: (i) the assay does
not require sophisticated equipment and costly reagents; (ii) it
requires less time (<60 minutes) to conduct; (iii) the assay is
performed on a simple digital heat-block; and, (iv) it does not
require high-level technical expertise. Thus, in regions with
struggling national economies and lack of high-tech diagnostic
equipment, these advantages make the HBV LAMP assay well-suited for
use in such resource-limited settings for blood-screening and
diagnosis of HBV infection.
[0200] The sensitivity of the HBV-LAMP assay was evaluated in order
to assess its clinical and field applicability, using characterized
standards and blinded clinical plasma specimens. When compared to
the FDA-licensed Procleix.RTM. Ultrio.RTM.-Plus dHBV test, the
HBV-LAMP assay detected 69 of 75 (92%) HBV positive donor plasma
specimens. The assay sensitivity approaches 100% with the use of
fluorophores for detection (data not shown). As shown by the Probit
data, the HBV LAMP Assay also revealed a 100% detection rate for
25, 50, 10.sup.2, 10.sup.3, and 10.sup.4 IU of HBV DNA per
reaction, while 1 IU and 10 IU of HBV DNA were detected at 25% and
57% rates, respectively. These findings suggest that the LAMP-assay
performed efficiently when used in testing and analysis of clinical
specimens for HBV-infection.
[0201] Sample enrichment and volume play a critical role in
detection sensitivity. The HBV-LAMP assay employed a smaller
starting-volume for nucleic acid extraction and a smaller
input-volume for amplification than the Procleix.RTM. Ultra.RTM.
assay, yet yielded a sensitivity of 92%. Thus, given its plausible
performance vis-a-vis the clinical and epidemiological relevance of
HBV infection, the HBV LAMP assay is potentially applicable in
field environment and in clinical-settings for screening and rapid
detection of HBV-infection.
[0202] Notably, the HBV LAMP assay also successfully detected HBV
DNA in heat-treated plasma, irrespective of the possible presence
of potential amplification inhibitory substances that are found in
blood-products (Al-Soud et al., J. Clin. Microbiol. 38:345-350,
2000; Al-Soud et al., J. Clin. Microbiol. 39:485-493, 2001). This
method of template preparation (as opposed to nucleic acid
extraction) contributed to the rapidity of the assay and simplified
the detection process; however, an increase in the volume of
starting material from 25 .mu.L to a larger volume (for example,
100 .mu.L) may improve the sensitivity of detection when using
heat-treated plasma for the reaction.
[0203] In consideration of detection specificity and accuracy in
clinical diagnostics, primers in this assay were designed that
specifically targeted conserved sequences of the S-gene and
overlapping polymerase regions which show about 96% sequence
identity and homology across the HBV genotypes (Osiowy et al. J.
Clin. Microbiol. 41:5473-5477, 2003). The LAMP assay detected
various HBV-genotypes (A-F), thereby demonstrating its global
coverage of HBV detection. When healthy donor plasma samples
(n=107) were tested, the HBV-LAMP assay revealed a diagnostic
specificity of 100%, as no amplification of HBV-DNA was observed in
these specimens. This characteristic of the HBV-LAMP assay was also
confirmed by its detection of only the target HBV-DNA without
cross-reaction with CMV, PV, T. cruzi, and the Leishmania spp.
[0204] Within the context of today's globalization, people have
been moving across international borders either for
socio-politico-economic reasons or for recreational purposes. This
rapid trend of human migration has influenced the spread of viral
hepatitis and its changing epidemiology from Afghanistan to
Pakistan, from the Indian sub-continent and Asia to Eastern
Mediterranean, North Africa and the United States. Hence, the
severity and prevalence of HBV emphasizes the need for a rapid and
affordable diagnostic-screening tool as described herein, which
could be used to investigate HBV-prevalence in different regions of
the world.
[0205] A noteworthy advantage of the LAMP-assay described herein is
its use of a thermo-stable reaction buffer
(Mannitol-Acetate-Buffer) and the Bst DNA-polymerase, two major
components that allowed preparation of reaction-mixture at room
temperature as well as performance of amplification under
isothermal conditions without compromising sensitivity. Bst DNA
polymerase has DNA strand-displacement activity, while L-Proline
has a destabilizing effect on the DNA double-helix, lowers the
T.sub.m of DNA, confers salinity tolerance, and aids in DNA
polymerase stability (Walker et al., Nucl. Acids Res. 20:1691-1696,
1992; Walker, PCR Meth. Appl. 3:1-6, 1993; Rajendrakumar et al.,
FEBS Lett. 410:201-205, 1997). In addition, D-Mannitol, a
hygroscopic and osmopotent material also promoted buffer stability
and robustness under thermo-stressed conditions (Dittmar et al.,
Ind. Eng. Chem. 27:333-335, 1935; Ohrem et al., Pharm. Dev.
Technol. 19:257-262, 2014). As demonstrated by the accelerated
stability tests, the MAB surprisingly retained a considerable level
of stability and robustness.
[0206] The advent of nucleic acid amplification tests in clinical
diagnosis and donor blood-screening brought tremendous improvement
by ensuring safety of blood-products and prevention of disease
transmission. Yet, diagnostic tools such as PCR-based tests have
inherent limitations which include the lack of rapidity, laborious
performance process, use of cumbersome equipment, and being easily
prone to contamination. In contrast, the HBV LAMP assay described
herein demonstrates ease of performance, rapidity, sensitivity, and
the use of multiple-primers that makes the assay highly specific
and less liable to cross-contamination. Considered in aggregate,
this HBV LAMP detection assay is rapid, simple to use, and
specific.
Example 3
RT-LAMP Assay for Detection of Hepatitis C Virus
Introduction
[0207] Hepatitis C virus (HCV) is a single-stranded RNA virus of
the Flaviviridae family (Moratorio et al., Virol. J. 4:79, 2007).
Primarily transmitted through transfusion of contaminated blood,
infection with HCV may go silent for several years and lead to
chronic-active hepatitis and hepatocellular carcinoma (Ghany et
al., Hepatology 4:1335-1374, 2009; Liang et al., Ann. Int. Med.
132:296-305, 2000; NIH Consensus Statement on Management of
Hepatitis C; NIH Consens. Sci. Statements 19:1-46, 2002).
Approximately 170 million people globally are infected with HCV. In
the United States alone about 3.7 million people are diagnosed with
HCV infection, wherein HCV genotypes 1 and 2 account for a majority
of infections (Armstrong et al., Ann. Int. Med. 144:704-714, 2006;
Zein, Clin. Microbiol. Rev. 13:223-235, 2000). There are six major
genotypes of HCV with several subtypes found in different regions
of the world (Lamballerie et al., J. Gen. Virol. 78:45-51, 1997;
Simmonds, Hepatology 21:570-583, 1995; Simmonds et al., Hepatology
10:1321-1324, 1994). Thus, screening for HCV in blood is important
in providing information on its prevalence in various populations
and communities around the world, while identification of the
specific HCV genotype is clinically important for implementing
effective antiviral treatment (de Leuw et al., Liv. Intl. 31:3-12,
2011; Alestig et al., BMC Inf. Dis. 11:124, 2011; Etoh et al., BMC
Res. Notes 4:316, 2011). Therefore, there is a need for a specific,
sensitive, simple, and robust diagnostic-screening test that can
detect HCV infection in blood-derivatives and simultaneously
provide genotypic information.
[0208] A plethora of diagnostic tests for detection and genotyping
of HCV infection have been designed. These tests are expensive,
labor-intensive, and require well-equipped laboratories and highly
trained personnel to conduct (Rho et al., J. Microbiol. 46:81-87,
2008; Nolte et al., J. Clin. Microbiol. 33:1775-1778, 1995; Sabato
et al., J. Clin. Microbiol. 45:2529-2536, 2007). Additionally,
these tests are prone to cross-contamination and are further
limited in their ability to detect and simultaneously identify the
specific HCV genotype (Corless et al., J. Clin. Microbiol.
38:1747-1752, 2000; Duarte et al., PLoS One 5:e12822, 2010). These
limitations render current methods unsuitable for use in clinical
settings in the developed-world setting and in resource-limited
facilities mainly found in developing countries where sophisticated
biomedical diagnostic equipment may be lacking.
[0209] The HCV RT-LAMP assay described in this example is simple,
rapid, sensitive, and specific, and is performed on the basis of
strand-displacement DNA synthesis which produces long stem-loop
products of multiple inverted repeats. The amplification process is
accomplished within 60 minutes, utilizing thermostable enzymes, a
robust thermostable reaction-buffer, and three sets of
oligonucleotide that target conserved as well as sparsely
polymorphic sequences in the 5'-non coding region (NCR) of the HCV
genome. This example describes a novel approach to HCV genotyping
that has clinical and epidemiological applications in addition to
its utility in resource-limited environments and developed
world-settings.
Materials and Methods
[0210] Design of Oligonucleotides:
[0211] Full-length sequences of various HCV genotypes (n=148) were
obtained from the GenBank database and analyzed using CLUSTALW2.
Primers were designed manually and electronically with the aid of
PrimerExplorer-4 and Primer-3 web interfaces, using the 5'-NCR of
selected HCV-candidate sequences (FIGS. 7A-7D). In order to ensure
genotype distinction, primers were designed to target sequences
with sparse nucleotide diversity or polymorphism within the
conserved 5'-NCR (Bukh et al., Proc. Natl. Acad. Sci. USA
89:4942-4946, 1992). A universal primer set and one set for each
genotype were made (Table 1; Example 1). In order to ensure broader
coverage for HCV-2 isolates, the 5'-end of primer sequence HCV2-R3
(SEQ ID NO: 27) was designed with a "G" to "C"
reverse-complementary nucleotide substitution at position one and a
"C" to "T" substitution at position three. The oligonucleotides
were synthesized by EuroFins-MWG-Operon (Huntsville, Ala.) and
Integrated-DNA-Technologies (Coralville, Iowa).
[0212] Isolation of RNA:
[0213] Total RNA was extracted from HCV reference and genotyping
panels of WHO International Standard (OptiQuant-AcroMetrix/Life
Technologies, Benicia, Calif. and SeraCare, SeraCare Life Sciences,
Milford, Mass., respectively), and from blind clinical donor plasma
(n=15). RNA was also isolated from the following materials: LB-piVE
culture supernatant of HCV-1b (Silberstein et al., PLoS Pathogen
6:e1000910, 2010); HCV-2a strain J6/JFH-1 (supplied by C. M. Rice,
Rockefeller University); HCV-3a clinical plasma samples (n=2;
supplied Dr. Jack T. Stapleton, University of Iowa); and HCV-4a
clinical serum specimens (n=3; provided by Dr. Marc Ghany and
colleagues of the NIH Clinical Center, Bethesda-Maryland). RNA was
also extracted from negative/normal human plasma (n=50). Extraction
was performed with the QiaAmp.RTM. Viral RNA mini kit protocol
(Qiagen, Germantown, Md.) with some modifications that included the
following: (1) use of 200 .mu.L of plasma, serum or
culture-supernatant; (2) addition of RNAsecure.TM. (Ambion/Life
Technologies, Grand Island, N.Y.) to a 1.times. final concentration
in the lysis process and to the eluted RNA in order to protect the
released/extracted nucleic acid from degradation; and (3)
performance of all centrifugations at 6000.times.g for 1 minute.
The eluted RNA was aliquoted and stored at -80.degree. C. until
needed for testing.
[0214] HCV Standards and Controls:
[0215] Quantified RNA standards of HCV 1a, 1b, and 2a/c, as well as
Dengue and West Nile viruses (Armored RNA.RTM., Asuragen, Austin,
Tex.) were used. Total RNA extracted from titered plasma panels of
WHO International Standards containing HCV 1, 2, 3, and 4
(OptiQuant, AcroMetrix/Life Technologies and SeraCare) was also
used. RNAs were serially diluted in nuclease-free water and used in
amplification reactions.
[0216] HCV Diagnostic Genotyping Assay:
[0217] Diagnosis and genotyping of HCV was performed by
reverse-transcription isothermal amplification in a 25 .mu.L total
reaction mixture. The mixture included 12.5 .mu.L of 2.times.MAB
(described in Example 1), 1 .mu.M each of primers FIP and RIP; 0.6
.mu.M each of primers LF and LR; 0.5 .mu.M each of primers F3 and
R3; 8 Units of Bst DNA polymerase (New England Biolabs); 5 U of
cloned-AMY reverse-transcriptase (Invitrogen/Life Technologies);
and 10 U of RNaseOut.TM. (Invitrogen/Life Technologies). RNA
template volume of 1-5 .mu.L was applied to the reaction. A
no-template (water) control was included in all amplification runs
in order to control for reagent integrity. Positive controls
included known genotypes of HCV-RNA standards, while Dengue virus,
West Nile virus (Asuragen), and normal human plasma served as
negative controls. All reaction reagents were prepared in a PCR
work-station (Plas Labs, Lansing, Mich.), with precautionary
measures observed to prevent cross-contamination. Reactions were
performed at 63.5.degree. C. for 60 minutes on a portable digital
heat-block (myBlock.TM., Benchmark Scientific, Edison, N.J.) and
terminated by placing reaction tubes on ice. Analysis of Amplicons:
Reaction products were analyzed by running 5 .mu.L of reaction
products on a 2.8% agarose gel made up in 1.times.TAE (40 mM Tris,
20 mM acetic acid, 1 mM EDTA) and stained with GelRed.TM. dye
(Phenix Research, Candler, N.C.). Products were electrophoresed for
50 minutes at 100 volts in 1.times.TAE buffer and visualized under
UV transilluminator at 302 nm. Gels were photographed and
documented using the G:Box gel documentation system (Syngene,
Frederick, Md.). For rapid acquisition of results, 0.5 .mu.L of a
10.times. GelGreen.TM. dye (Phenix Research) was added to 10 .mu.L
of reaction products in 0.2 mL reaction tubes. The tubes were then
visualized under UV-transilluminator at 302 nm. Analysis of
banding-patterns on the gel as well as visual interpretation of
fluorescent color-change in reaction tubes was performed by at
least three different laboratory personnel.
[0218] Sensitivity and Specificity Studies:
[0219] Sensitivity of the RT-LAMP genotyping assay was evaluated by
testing serial dilutions of quantitated HCV RNA or plasma
standards. At the end of the reactions, GelGreen.TM. fluorescent
dye was added to the reaction-tubes in order to evaluate
fluorescent-intensity in relations to level of HCV RNA
detected.
[0220] Primer specificity and cross-reactivity were evaluated by
cross-testing of oligonucleotides with HCV genotypes 1, 2, 3, and 4
and with RNA of Dengue and West Nile viruses. Primer sets were also
evaluated for their ability to produce distinctly unique banding
patterns for the HCV genotypes targeted for identification.
[0221] Time-Course for Detection of HCV RNA:
[0222] In order to determine the time point at which HCV RNA was
amplified, time-course experiments were conducted by testing
approximately 15 and 75 IU/reaction of extracted HCV RNA using the
universal primers set and defined reaction time intervals. Reaction
tubes containing RNA were sequentially taken off the heat-block at
designated time points (25, 35, 45, and 60 minutes), while negative
control reactions ran for 60 minutes. The resulting products were
analyzed by agarose-gel electrophoresis.
[0223] Preparation of Plasma as Substrate for Target:
[0224] Plasma material was heated for viral lysis and applied to
the reaction in order to evaluate the ability of the assay to
detect HCV RNA using heat-treatment without RNA extraction.
Therefore, 25 .mu.L of plasma standards of varying HCV titers
(OptiQuant-AcroMetrix/Life Technologies) were thawed on ice,
briefly vortexed and then heated at 33.5.degree. C. for 5 minutes
on a digital heating block; the tubes were pulse-vortexed again and
heated for an additional 5 minutes. Next, 3-5 .mu.L of heat-treated
plasma material was directly applied to the reaction-mixture and
subjected to the 63.5.degree. C. amplification-reaction for
concurrent viral-lysis and detection of HCV RNA.
[0225] Assay Evaluation with Donor Specimens:
[0226] The HCV RT-LAMP genotyping assay was validated by testing
donor plasma specimen (n=17) and donor serum specimens (n=3)
mentioned above. Also, normal/healthy human plasma specimens (n=50)
were used. Total RNA was extracted from the specimens and 3-5 .mu.L
was subjected to isothermal amplification as described above.
Reaction products were resolved on a 2.8% agarose gel to analyze
the resulting banding pattern.
Results
[0227] Specificity and Analysis of Products:
[0228] RT-LAMP assay was used to detect HCV-RNA with universal or
genotype-specific HCV primers. The cross-reactivity of the primers
and their ability to specifically amplify the 5'-NCR of specific
HCV genotypes were evaluated. Plasma standards from patients
infected with known genotypes of HCV were used. Electrophoretic
analysis demonstrated successful amplification of RNAs of HCV
genotypes 1, 2, and 4 by the universal primer set (HCVU; Table 1).
The oligonucleotide-set produced a ladder-like banding pattern
common to HCV 1, 2, and 4 (FIG. 8A). For rapid acquisition of
results, GelGreen.TM. intercalating dye was added to the reaction
tubes at the end of the amplification and revealed an intense
greenish fluorescent color in reaction tubes with amplified
products (FIG. 8B).
[0229] Genotype-specific primer sets were designed to detect HCV
genotypes 1, 2, and 3 (Table 1, Example 1). The specific primer
sets produced a banding pattern of amplicons that were distinct and
unique to each genotype (FIGS. 9A-9D). The primer set targeting HCV
genotype 1 detected both genotypes 1a and 1b, but did not detect
genotypes 2, 3 or 4 (FIG. 9A). Similarly, the primer sets that
targeted HCV-genotypes 2 and 3 specifically detected the
appropriate genotype (FIGS. 9B and 9C). None of the primer sets
reacted with RNA of Dengue or West Nile viruses (FIGS. 9A-9D),
demonstrating that the primers did not cross-react with other
Flaviviridae.
[0230] Assay Sensitivity:
[0231] The assay sensitivity was determined by testing serial
dilutions of known concentrations of extracted HCV RNA from plasma
standards and heat-treated plasma standards
(OptiQuant-AcroMetrix/Life Technologies and SeraCare) as
quantitated by the manufacturer. Results of electrophoretic
analysis demonstrated detection of 25 IU/reaction of HCV RNA using
heat-treated plasma without RNA extraction (FIG. 10A). When
purified RNA from plasma standards was tested, the assay showed
detection of 7 IU of HCV-RNA per reaction (FIG. 10B). Addition of
GelGreen.TM. fluorescent dye to the reaction-tubes revealed a
fluorescent-glow with decreasing intensity from 180 to 1.4 IU/rxn
of HCV-RNA (FIG. 10C).
[0232] Detection of HCV Genotypes in Donor Specimens:
[0233] In order to determine the clinical applicability of the
RT-LAMP genotyping assay, total RNA was extracted from donor plasma
specimens (n=17) and serum specimens (n=3) and then tested using
the genotype-specific primers (FIGS. 12A and 12B). Thirteen donor
plasma specimens tested positive for HCV-1, two (2) specimens
tested positive for HCV-2, while two (2) specimens tested positive
for HCV-3 (Table 4). Electrophoretic results are shown for some of
the HCV-1 (FIG. 11A) and HCV-2 (FIG. 11B) samples. The three known
HCV genotype 4 serum specimens tested positive for HCV as indicated
by the presence of banding-pattern generated by the universal
primer set (FIG. 11C; Table 4). Hence, all the infected donor
plasma and serum specimens (n=20) tested positive for the presence
of HCV and with genotype distinction (Table 4), while all the
normal/negative human plasma specimens (n=50) tested negative (data
not shown).
TABLE-US-00004 TABLE 4 Detection and validation of HCV RT-LAMP
genotyping assay with donor plasma and serum specimens RT-LAMP HCV
Genotype Sample ID Specimen Type Results Identified P10 Plasma + 1
P28 Plasma + 1 P30 Plasma + 2 P31 Plasma + 1 P32 Plasma + 2 P37
Plasma + 1 P50 Plasma + 1 P53 Plasma + 1 P55 Plasma + 1 P65 Plasma
+ 1 P71 Plasma + 1 FDA-019 Plasma + 1 FDA-034 Plasma + 1 FDA-035
Plasma + 1 FDA-036 Plasma + 1 P154 *Plasma + 3 P390 *Plasma + 3 S1
.sup.fSerum + 4 S2 .sup.fSerum + 4 S3 .sup.fSerum + 4 Positive
detection (+); *Plasma previously identified to be HCV3-positive;
.sup.fSerum previously known to be HCV4-positive;
[0234] Time Course for Detection and Rapid Visualization:
[0235] To establish the time point at which amplification occurs,
15 and 75 IU of RNA were tested per reaction using primers-set
HCVU. Results demonstrated amplification of 15 IU of RNA at 60
minutes (FIG. 12A), while amplification of 75 IU was observed at 35
minutes (FIG. 12B).
Discussion
[0236] This example describes a specific, simple, sensitive and
rapid isothermal amplification assay for genotyping of HCV and
rapid detection of infection. This assay demonstrates salient
advantages over methods that require intensive labor and exotic
equipment. First, the HCV RT-LAMP genotyping assay was performed as
a one-step-procedure, thus obviating the need for an extra
cDNA-synthesis step; it utilized two thermostable enzymes (Bst DNA
polymerase and cloned-AMY reverse-transcriptase) that catalyzed
both synthesis and amplification of the HCV-RNA in a single
reaction-tube, using a single temperature. Second, the assay
employed three pairs of gene-specific primers directed at specific
regions on the HCV genome, thus ensuring specificity and
amplification efficiency. Third, the assay detected and
simultaneously identified the HCV-genotype tested without
requirement for extra genotyping procedure. Fourth, test-results
were available in approximately 75 minutes, instead of the 3 to 5
hours required for other genotyping and detection-formats in which
products are separately genotyped by restriction enzyme analysis,
reverse hybridization, or nested RT-PCR.
[0237] In regions of the world with high prevalence of HCV
infection, surveillance and epidemiological studies are
periodically conducted in order to establish distribution patterns.
This requires a diagnostic assay that is sensitive and specific. In
this example, the HBV RT-LAMP genotyping assay demonstrated a
detection sensitivity of 25 IU/reaction of HCV-RNA using
heat-treated template (without RNA extraction), while detection of
7 IU/reaction of HCV-RNA was achieved when extracted RNA was used.
Addition of GelGreen.TM. intercalating dye to the tubes at the end
of the reactions allowed for naked-eye rapid visualization of the
assay detection-level of as little as 1.4 IU of HCV-RNA. In
addition, the assay detected HCV-RNA in all 20 infected clinical
donor specimens, thus revealing a 100% diagnostic sensitivity. The
primer specificity of this assay is highly plausible as the
amplification yielded detection of only HCV-RNA and the specific
HCV-genotypes tested for, but reacted negative to RNAs of
phylogenetically related viruses (Dengue and West Nile).
[0238] The 5'-NCR of the HCV genome was utilized for primer design
due to its highly conserved nature across the HCV genotypes. For
genotype-identification, primer design exploited the sparse
nucleotide diversity and polymorphism that exist within the 5'-NCR
among the HCV genotypes. This approach contributed to the high
specificity of genotype-identification, thereby clearly and
accurately distinguishing between HCV 1, 2, and 3 as indicated by
the difference in the banding-patterns for each genotype. This
characteristic of the assay was validated by testing clinical
samples. When donor plasma samples were tested by the
RT-LAMP-Genotyping method, the test detected and accurately
differentiated the clinical samples that were positive for HCV-1,
2, and 3. All 50 negative/normal human plasma tested negative,
thereby demonstrating a diagnostic specificity of 100%.
Furthermore, when donor serum samples were employed as
test-substrates, the assay detected the presence of HCV in all
three serum-specimens using the universal primer set-HCVU. HCV-3
was not tested with the universal primer set, because of its
unavailability at the time of testing. Collectively considered,
these results demonstrate the capability of the assay to detect
HCV, including genotype 4, in plasma and serum. The results have
also demonstrated the specificity of the isothermal assay for
detection and simultaneous genotyping of HCV, thus rendering the
assay potentially applicable in clinical settings where genotype
information is important in designing targeted therapeutic
management of infected patients.
[0239] A major defining characteristic of the HBV RT-LAMP assay is
the demonstration of specificity not only by absence of
non-specific bands in the amplification products, but by the
demonstration of genotype-specific banding patterns of the targeted
genomic sequences. This enables an investigator or end-user to
distinguish true positive amplification patterns from atypical
band-laddering that may occur in a reaction due to non-specific
priming (Curtis et al., J. Med. Virol. 81:966-972, 2009). A review
of the literature revealed studies which utilized the 5'-NCR for
primer design and have attempted the use of the RT-LAMP method for
HCV detection (Esfahani et al., Af J. Microbiol. Res. 4:2580-2586,
2010; Wang et al., FEMS Immunol. Med. Microbiol. 63:144-147, 2011).
Notably, these studies were confined only to detection, while
another study was performed as a two-step method. Also, these
studies failed to demonstrate distinguishing pattern-formation of
amplicons of the HCV genotypes tested (Esfahani et al., Af J.
Microbiol. Res. 4:2580-2586, 2010; Wang et al., FEMS Immunol. Med.
Microbiol. 63:144-147, 2011). In contrast, our test was performed
as: (1) a one-step procedure, (2) a detection and genotyping
method, and (3) demonstrated distinctive genotype-unique
banding-patterns of HCV 1, 2, and 3.
[0240] Rapid, simple, and accurate identification of pathogens are
important for timely therapeutic intervention, and for disease
control and surveillance. This concern was addressed by simplifying
the substrate preparation process. Plasma standards were
heat-treated and used as a template in the amplification-reaction,
thereby obviating the extra RNA extraction step and saving time.
Use of fluorescence dyes for immediate end-point-read-out also
added to the rapidity and simplicity of the assay by obviating
gel-end-point analysis. Additionally, the assay accurately detected
HCV RNA without assay efficiency being compromised by PCR
inhibitory substances that are usually found in blood components
and tend to inhibit PCR methods (Al-Soud et al., J. Clin.
Microbiol. 38:345-350, 2000; Al-Soud et al., J. Clin. Microbiol.
39:485-493, 2001).
[0241] In conclusion, the HCV RT-LAMP genotyping assay described in
this example has demonstrated its sensitivity, specificity,
robustness, and ability to accurately identify HCV-RNA at the
genotypic level. This assay may be used to aid clinicians in
designing genotype-targeted therapy and follow-up of patients on
antiviral treatments. Due to its simplicity and lack of
requirements for elaborate equipment or extensive freezer storage
conditions, this HCV RT-LAMP assay has also shown its suitability
for clinical point-of-care application and epidemiological studies
in resource-limited environments, HCV-endemic regions, and in
developed world-settings.
Example 4
RT-LAMP Assays for Detection of Human Immunodeficiency Virus,
Hepatitis E Virus, Dengue Virus, and West Nile Virus
Methods
[0242] LAMP Assays:
[0243] Genotyping of HIV, HEV, DENV, and WNV was performed by
reverse-transcription isothermal amplification in a 25 .mu.L total
reaction mixture. The mixture included 12.5 .mu.L of 2.times.MAB
(described in Example 1), 1 .mu.M each of primers FTP and RIP; 0.6
.mu.M each of primers LF and LR; 0.5 .mu.M each of primers F3 and
R3; 8 Units of Bst DNA polymerase (New England Biolabs); 5 U of
cloned-AMY reverse-transcriptase (Invitrogen/Life Technologies);
and 10 U of RNaseOut.TM. (Invitrogen/Life Technologies). RNA
template volume of 1-5 .mu.L (extracted RNA or quantitated human
plasma standard) was applied to the reaction. A no-template (water)
control was included in all amplification runs in order to control
for reagent integrity. All reaction reagents were prepared in a PCR
work-station (Plas Labs, Lansing, Mich.), with precautionary
measures observed to prevent cross-contamination. Reactions were
performed at 60.degree. C. for 60 minutes on a portable digital
heat-block (myBlock.TM., Benchmark Scientific, Edison, N.J.) and
terminated by placing reaction tubes on ice.
[0244] Reaction products were analyzed by running 5 .mu.L of
reaction products on a 2.8% agarose gel made up in 1.times.TAE (40
mM Tris, 20 mM acetic acid, 1 mM EDTA) and stained with GelRed.TM.
dye (Phenix Research, Candler, N.C.). Products were electrophoresed
for 50 minutes at 100 volts in 1.times.TAE buffer and visualized
under UV transilluminator at 302 nm. Gels were photographed and
documented using the G:Box gel documentation system (Syngene,
Frederick, Md.).
Results
[0245] RT-LAMP assays were developed to detect HIV, WNV, DENV, or
HEV with specific LAMP primer sets (Table 1). The cross-reactivity
of the primers and their ability to specifically amplify the
specific virus were evaluated. Electrophoretic analysis
demonstrated successful amplification of HIV-1 RNA (using the
primer set of SEQ ID NOs: 38, 41, 42, 45, 47, and 48), but not HBV
or HCV (FIG. 13). Similarly, a WNV-specific primer set (SEQ ID NOs:
56-61) amplified WNV RNA, but not HCV, HBV, or DENV (FIG. 14). The
DENV primer set D1 (SEQ ID NOs: 72-75) successfully amplified DENV
RNA (FIG. 15). Finally, the HEV-specific primer set (SEQ ID NOs:
49-54) successfully amplified HEV-3 RNA (FIG. 16A). The HEV primer
set could also detect HEV-1 RNA at 10.times. dilution, but not
100.times. dilution, while it could detect HEV-3 RNA at both
10.times. and 100.times. dilutions (FIG. 16B).
Example 5
Multiplex LAMP Assay for Viral Detection
Introduction
[0246] For several decades transfusion and clinical medicine have
been bridled with issues of contaminated blood from infected
donors. This has led to routine testing of potential blood donors
in the United States and in many developed countries for
blood-borne pathogens. The ultimate public health goal has been to
ensure safety of the blood and blood-products supply as well as
ensure early diagnosis for immediate therapeutic invention.
Hepatitis B virus (HBV), Hepatitis C virus (HCV), and the emerging
Hepatitis E virus (HEV) together infect approximately 700 million
people globally and may lead to chronic active hepatitis and
hepatocellular carcinoma. On the other hand, infection with the
human immunodeficiency virus (HIV) compromises the immune system,
while Dengue virus (DENV) and West Nile Virus (WNV) cause
hemorrhagic fever and neurodegenerative symptoms, respectively.
[0247] Serological and nucleic acid test methods, including ELISA
and quantitative (reverse transcription) polymerase chain reaction
or q-(RT)-PCR, have traditionally been used to test for these
viruses and other pathogens. Performance of ELISA is laborious,
employs antibody for detection, is less sensitive, and may miss the
window-period of some infections, such as HBV, HCV and HIV. On the
other hand, quantitative RT-PCR uses oligoprobes that hybridize to
the nucleic acid target and allows not only for specific detection,
but also for quantitation of target DNA or RNA in real-time.
[0248] However, these methods are time-consuming and expensive.
These methods of pathogen detection also require elaborate machines
and highly trained personnel to perform. Also, quantitative RT-PCR
requires thermocycling for amplification. On the other hand, the
quantitative multiplex fluoro-isothermal assay described in this
example is simple and inexpensive. It utilizes three pairs of
pathogen-specific oligonucleotides, with a strategically attached
reporter/fluorophore-quencher pair that emits fluorescent signal or
glow when the fluoro-oligo hybridizes to the specific target. This
new multiplex isothermal amplification assay can be used for
detection and identification pathogens as well as quantitation of
pathogen burden in blood.
Methods
[0249] DNA and RNA Preparation:
[0250] DNA and total RNA were extracted from standard reference and
genotyping plasma panels of WHO International Standard
(OptiQuant-AcroMetrix/Life Technology, Benicia, Calif. and
SeraCare, Milford, Mass., respectively). Nucleic acids were also
extracted from blind clinical donor plasma using the QiaAmp.RTM.
Viral RNA Mini kit and the QIAamp.RTM. DNA Blood Mini kit modified
protocol (Qiagen, Germantown, Md.) as described in Example 2.
[0251] Oligonucleotides and Oligofluorophores:
[0252] Oligonucleotides for detection were designed by analyzing
full-length sequences (n=739) of various pathogens, including HBV,
HCV, HEV, HIV, WNV, and DENV obtained from the GenBank database
using CLUSTALW2. Primers were designed manually with the aid of
PrimerExplorer-4 and IDT OligoAnalyzer 3.1 web interfaces. Primer
sets consisted of the following: Forward Inner Primer (FTP);
Reverse Inner Primer (RIP); Loop Forward Primer (LF); Loop Reverse
Primer (LR); Forward Outer Primer (F3), and Reverse Outer Primer
(R3). The two sequences of FTP and RIP were spaced with "TTTT"
linker, while the Loop Reverse Primers were specifically designed
to carry designated probes and quenchers at the 5' and 3' ends,
respectively (Example 1). The oligonucleotides and
oligofluorophores were synthesized by EuroFins MWG Operon
(Huntsville, Ala.) and Integrated DNA Technologies (Coralville,
Iowa).
[0253] Standards and Controls:
[0254] Standard quantitated samples of HIV, HCV, HBV as well as
Dengue and West Nile viruses were used. DNA and total RNA were
extracted from quantitated plasma panels of WHO International
Standard (Armored RNA, Asuragen; OptiQuant AcroMetrix/Life
Technologies, and SeraCare) serially diluted in nuclease-free
water, and used in amplification reactions. HEV was a kind gift of
Dr. Sue Emerson of the National Institutes of Health, Bethesda,
Md.-USA.
[0255] Multiplex Amplification Assay:
[0256] Detection and identification of the various pathogens was
performed by (reverse-transcription)-isothermal amplification in a
25 .mu.L reaction mixture. The mixture included 12.5 .mu.L of
2.times.MAB (Example 1) and following components: 0.95 .mu.M each
of primers FIP and RIP; 0.56 .mu.M each of primers LF and LR; 0.44
.mu.M each of primers F3 and R3. Primer components of the DNA were
as follows: 1.0 .mu.M each of primers FIP and RIP; 0.66 .mu.M each
of primers LF and LR; 0.33 .mu.M each of primers F3 and R3.
Concentrations of oligofluorophores (LRp) ranging from 0.3-0.8
.mu.M of the respective pathogens were added to the single reaction
mixture. Also, 12 Units of Bst DNA polymerase (New England
Biolabs), 5 U of cloned AMY reverse-transcriptase (Invitrogen/Life
Technologies), and 7 U of RnaseOut.TM. (Invitrogen/Life
Technologies) were used to catalyze the reaction. Nucleic acid
template volume of 1-5 .mu.L was applied. A no-template (water)
control was included in all amplification runs to control for
reagent integrity. Known amounts or concentrations of HIV, HCV,
HBV, HEV, DENV, and WNV were used either as positive or negative
controls depending on experimental design, while normal human
plasma served as negative control at all times. Preparation of
reaction mixtures was performed in PCR work-stations (Plas Lab,
Lansing, Mich.) and precautions observed in order to prevent
cross-contamination. Amplification-reactions were conducted at
60.degree. C. for 30 to 60 minutes on a portable digital heat-block
(myBlock.TM., Benchmark Scientific, Edison, N.J.). Reactions were
terminated by placing reaction tubes on ice.
[0257] Quantitation and Analysis of Products:
[0258] At the end of the reaction, 1.5-2 .mu.L of product was
tested on the NanoDrop 3300 Fluorospectrophotometer in order to
read fluorescent emission of amplified products and quantitate the
corresponding viral load. Amplicons were analyzed by running 5
.mu.L of reaction products on a 2.8% agarose gel made up in
1.times.TBE and stained with GelRed (Phenix-Research, NC, USA).
Products were run for 50 minutes at 100 volts in 1.times.TBE buffer
and visualized under UV-transilluminator at 302 nm. Gels were
photographed using the G:Box gel documentation system (Syngene,
Frederick, Md.). Rapid acquisition of results was accomplished by
visualizing reaction tubes under UV transilluminator at 302 nm.
Analysis of banding-patterns on the gel as well as visual
interpretation of fluorescent color-intensity in reaction tubes was
performed by at least three laboratory personnel.
[0259] Specificity Studies:
[0260] Specificity and cross-reactivity of oligonucleotides and
oligofluorophores were evaluated by cross-testing nucleic acids of
HIV, HBV, HCV, HEV, DENV, and WNV in multiplexed reactions. Primer
sets were evaluated for their ability to produce distinctly unique
banding patterns for the pathogens targeted for identification. The
specific-oligofluorophores were analyzed for their ability to
produce an intense fluorescence glow when the targeted pathogen was
amplified. Assay sensitivity was evaluated by testing serial
dilutions of quantitated DNA and RNA of HBV and HCV,
respectively.
[0261] Assay Validation with Clinical Specimens:
[0262] Validation of the quantitative multiplex assay was performed
by testing donor plasma specimen of the various pathogens. Also,
normal/healthy human plasma specimens (n=100) were tested in this
study. DNA/total RNA was extracted from the specimens and 3-5 .mu.L
subjected to isothermal amplification as described above. Reaction
products were analyzed as described above.
Results
[0263] Assay Specificity:
[0264] Nucleic acid extracted from donor plasma samples and
quantitated plasma standards of various pathogens were subjected to
multiplex reaction for detection. Pathogen-specific primers and
oligofluorophores were used. Cross-reactivity of the primers and
oligofluorophores were also investigated for their ability to
specifically amplify and detect pathogen of interest.
Electrophoretic analysis demonstrated successful amplification of
all pathogens tested for by their specific oligonucleotide-set,
producing distinctive ladder-like banding pattern unique to the
specific pathogen detected (FIGS. 17A-17D).
[0265] Quantitative Analysis of Products:
[0266] pathogen-specific fluorophores were used to for detection of
specific agents of infections test in this study. When analyzed
with the fluorospectrophotometer, the results produced quantitative
numbers that corresponded to the concentration of the pathogen
detected (FIGS. 18A-18C).
[0267] Pathogen Detection in Clinical Specimens:
[0268] The applicability of the quantitative multiplex test was
also evaluated using clinical donor plasma specimens. All donor
plasma specimens tested positive by their respective
oligofluorophores and primers as indicated by their intense
fluorescent glow and quantification value and all normal human
plasma specimens (n=100) tested negative (data not shown).
[0269] In view of the many possible embodiments to which the
principles of the disclosure may be applied, it should be
recognized that the illustrated embodiments are only examples and
should not be taken as limiting the scope of the invention. Rather,
the scope of the invention is defined by the following claims. We
therefore claim as our invention all that comes within the scope
and spirit of these claims.
Sequence CWU 1
1
81120DNAArtificial SequenceSynthetic oligonucleotide - HBV
universal F3 primer 1tcctcacaat accgcagagt 20220DNAArtificial
SequenceSynthetic oligonucleotide - HBV universal R3 primer
2gcagcaggat gaagaggaat 20346DNAArtificial SequenceSynthetic
oligonucleotide - HBV universal FIP primer 3gttggggact gcgaattttg
gctttttaga ctcgtggtgg acttct 46444DNAArtificial SequenceSynthetic
oligonucleotide - HBV universal RIP primer 4tcactcacca acctcctgtc
ctttttaaaa cgccgcagac acat 44523DNAArtificial SequenceSynthetic
oligonucleotide - HBV universal LF primer 5ggtgatcccc ctagaaaatt
gag 23622DNAArtificial SequenceSynthetic oligonucleotide - HBV
universal LR primer 6aatttgtcct ggttatcgct gg 22722DNAArtificial
SequenceSynthetic oligonucleotide - HCV universal set 1 F3 primer
7gagtgttgta cagcctccag ga 22818DNAArtificial SequenceSynthetic
oligonucleotide - HCV universal set 1 R3 primer 8attgggcggc
ggttggtg 18944DNAArtificial SequenceSynthetic oligonucleotide - HCV
universal set 1 FIP primer 9ctcggctagc agtcttgcgg ttttgatgac
cgggtccttt cttg 441044DNAArtificial SequenceSynthetic
oligonucleotide - HCV universal set 1 RIP primer 10tagtgttggg
tcgcgaaagg cttttcacgg tctacgagac ctcc 441120DNAArtificial
SequenceSynthetic oligonucleotide - HCV universal set 1 LF primer
11gggcattgag cgggttaatc 201220DNAArtificial SequenceSynthetic
oligonucleotide - HCV universal set 1 LR primer 12ttgcggtact
gcctgatagg 201318DNAArtificial SequenceSynthetic oligonucleotide -
HCV universal set 2 F3 primer 13cgggagagcc atagtggt
181420DNAArtificial SequenceSynthetic oligonucleotide - HCV
universal set 2 F3 primer 2 14ggcgacactc caccatagat
201519DNAArtificial SequenceSynthetic oligonucleotide - HCV
universal set 2 R3 primer 15cacggtctac gagacctcc
191644DNAArtificial SequenceSynthetic oligonucleotide - HCV
universal set 2 FIP primer 16ggcattgagc gggttgatcc aatttttgcg
gaaccggtga gtac 441744DNAArtificial SequenceSynthetic
oligonucleotide - HCV universal set 2 RIP primer 17cgcgagactg
ctagccgagt ttttacccta tcaggcagta ccac 441818DNAArtificial
SequenceSynthetic oligonucleotide - HCV universal set 2 LF primer
18tcgtcctggc aattccgg 181918DNAArtificial SequenceSynthetic
oligonucleotide - HCV universal set 2 LR primer 19gtgttgggtc
gcgaaagg 182020DNAArtificial SequenceSynthetic oligonucleotide -
HCV1 F3 primer 20ggcgacactc caccatgaat 202122DNAArtificial
SequenceSynthetic oligonucleotide - HCV1 R3 primer 21ctatcaggca
gtaccacaag gc 222243DNAArtificial SequenceSynthetic oligonucleotide
- HCV1 FIP primer 22cactatggct ctcccgggag ttttcgtcta gccatggcgt tag
432344DNAArtificial SequenceSynthetic oligonucleotide - HCV1 RIP
primer 23ggaaccggtg agtacaccgg ttttcccaaa tctccaggca ttga
442419DNAArtificial SequenceSynthetic oligonucleotide - HCV1 LF
primer 24aggctgcacg acactcata 192519DNAArtificial SequenceSynthetic
oligonucleotide - HCV1 LR primer 25gaccgggtcc tttcttgga
192619DNAArtificial SequenceSynthetic oligonucleotide - HCV2 F3
primer 26cgcagaaagc gtctagcca 192721DNAArtificial SequenceSynthetic
oligonucleotide - HCV2 R3 primer 27cgtactcgca agcaccctat c
212845DNAArtificial SequenceSynthetic oligonucleotide - HCV2 FIP
primer 28atgaccgggc atagagtggg tttttgtggt ctgcggaacc ggtga
452945DNAArtificial SequenceSynthetic oligonucleotide - HCV2 RIP
primer 29gcccccgcaa gactgctagc ttttctcgca agcaccctat caggc
453020DNAArtificial SequenceSynthetic oligonucleotide - HCV2 LF
primer 30aaaggaccca gtcttcccgg 203121DNAArtificial
SequenceSynthetic oligonucleotide - HCV2 LR primer 31agcgttgggt
tgcgaaaggc c 213220DNAArtificial SequenceSynthetic oligonucleotide
- HCV3 F3 primer 32cccagaaatt tgggcgtgcc 203319DNAArtificial
SequenceSynthetic oligonucleotide - HCV3 R3 primer 33ggaacttgac
gtcctgtgg 193444DNAArtificial SequenceSynthetic oligonucleotide -
HCV3 FIP primer 34gcaagcaccc tatcaggcag tattttcgcg agatcactag ccga
443543DNAArtificial SequenceSynthetic oligonucleotide - HCV3 RIP
primer 35ggaggtctcg tagaccgtgc attttgcgac ggatggtgtt tct
433619DNAArtificial SequenceSynthetic oligonucleotide - HCV3 LF
primer 36ctttcgcgac ccaacacta 193725DNAArtificial SequenceSynthetic
oligonucleotide - HCV3 LR primer 37catgagcaca cttcctaaac ctcaa
253822DNAArtificial SequenceSynthetic oligonucleotide - HIV1 F3
primer 38acacagtggg gggacatcaa gc 223923DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 R3 primer 39gtcatccatg
ctatttgttc ctg 234024DNAArtificial SequenceSynthetic
oligonucleotide- HIV1 R3 primer 2 40tccatgctat ttgttcctga aggg
244124DNAArtificial SequenceSynthetic oligonucleotide- HIV1 R3
primer 3 41cctgaagggt actagtagtt cctg 244244DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 FIP primer 42gatgcaatct
atcccattct gttttgccat gcaaatgtta aaag 444349DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 FIP primer 2 43gatgcaatct
atcccattct gttttgccat gcaaatgtta aaagagacc 494447DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 RIP primer 44agtgcatgca
gggcctattg cacttttgtt cctgctatgt cacttcc 474547DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 RIP primer 2 45agtccatgga
gggcctattg cacttttgtt cctgctatgt cacttcc 474621DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 LF primer 46tcagcttcct
cattgatggt c 214721DNAArtificial SequenceSynthetic oligonucleotide-
HIV1 LF primer 2 47cagcttcctc attgatggtc t 214821DNAArtificial
SequenceSynthetic oligonucleotide- HIV1 LR primer 48caggccagat
gagagaacca a 214920DNAArtificial SequenceSynthetic oligonucleotide
- HEV F3 primer 49cggtggtttc tggggtgaca 205020DNAArtificial
SequenceSynthetic oligonucleotide - HEV R3 primer 50gagatagcag
tcaacggcgc 205146DNAArtificial SequenceSynthetic oligonucleotide -
HEV FIP primer 51agggcgagct ccagccccgg ttttgccctt cgccctcccc tatatt
465244DNAArtificial SequenceSynthetic oligonucleotide - HEV RIP
primer 52ccagtcccag cgcccctccg ttttagctgg ggcagatcga cgac
445320DNAArtificial SequenceSynthetic oligonucleotide - HEV LF
primer 53tgtgaaacga catcggcggc 205420DNAArtificial
SequenceSynthetic oligonucleotide - HEV LR primer 54cgtcgatctg
ccccagctgg 205520DNAArtificial SequenceSynthetic oligonucleotide -
WNV F3 primer 55ggggccaata cgatttgtgt 205625DNAArtificial
SequenceSynthetic oligonucleotide - WNV F3 primer 2 56cgatttgtgt
tggctctctt ggcgt 255720DNAArtificial SequenceSynthetic
oligonucleotide - WNV R3 primer 57aggccaatca tgactgcaat
205846DNAArtificial SequenceSynthetic oligonucleotide - WNV FIP
primer 58ctctccatcg atccagcact gcttttcttg gcgttcttca ggttca
465945DNAArtificial SequenceSynthetic oligonucleotide - WNV RIP
primer 59actagggacc ttgaccagtg cttttttccg gtctttcctc ctctt
456019DNAArtificial SequenceSynthetic oligonucleotide - WNV LF
primer 60cgggtcggag caattgctg 196121DNAArtificial SequenceSynthetic
oligonucleotide - WNV LR primer 61tcaatcggcg gagctcaaaa c
216219DNAArtificial SequenceSynthetic oligonucleotide - DENV F3
primer 62agcttcatcg tggggatgt 196320DNAArtificial SequenceSynthetic
oligonucleotide - DENV R3 primer 63ctctcccagc gtcaatatgc
206444DNAArtificial SequenceSynthetic oligonucleotide - DENV FIP
primer 64ggaggggtct cctctaacca ctttttggct gcaacccatg gaag
446545DNAArtificial SequenceSynthetic oligonucleotide - DENV RIP
primer 65caaaacataa cgcagcagcg ggttttgggg gtctcctcta acctc
456619DNAArtificial SequenceSynthetic oligonucleotide - DENV LF
primer 66tgctacccca tgcgtacag 196719DNAArtificial SequenceSynthetic
oligonucleotide - DENV LR primer 67caacaccagg ggaagctgt
196819DNAArtificial SequenceSynthetic oligonucleotide - DENV set 2
F3 primer 68atggaagctg tacgcatgg 196919DNAArtificial
SequenceSynthetic oligonucleotide - DENV set 2 R3 primer
69gcgttctgtg cctggaatg 197045DNAArtificial SequenceSynthetic
oligonucleotide - DENV set 2 FIP primer 70aggatacagc ttcccctggt
gtttttgtgg ttagaggaga cccct 457145DNAArtificial SequenceSynthetic
oligonucleotide - DENV set 2 RIP primer 71agaggttaga ggagaccccc
gttttagcag gatctctggt ctctc 457218DNAArtificial SequenceSynthetic
oligonucleotide - DEN1 F3 primer 72ggctgcaacc catggaag
187320DNAArtificial SequenceSynthetic oligonucleotide - DEN1 R3
primer 73tgcctggaat gatgctgtag 207444DNAArtificial
SequenceSynthetic oligonucleotide - DEN1 FIP primer 74cgctgctgcg
ttatgttttg ggttttctgt acgcatgggg tagc 447545DNAArtificial
SequenceSynthetic oligonucleotide - DEN1 RIP primer 75agaggttaga
ggagaccccc gttttagcag gatctctggt ctctc 4576360DNAHepatitis B virus
76aatctcctcg aggactgggg accctgcacc gaacatggag aacatcacat caggattcct
60aggacccctg ctcgtgttac aggcggggtt tttcttgttg acaagaatcc tcacaatacc
120gcagagtcta gactcgtggt ggacttctct caattttcta gggggatcac
ccgtgtgtct 180tggccaaaat tcgcagtccc caacctccaa tcactcacca
acctcctgtc ctccaatttg 240tcctggttat cgctggatgt gtctgcggcg
ttttatcata ttcctcttca tcctgctgct 300atgcctcatc ttcttattgg
ttcttctgga ttatcagggt atgttgcccg tttgtcctct 36077420DNAHepatitis C
virus 77ttcacgcaga aagcgtctag ccatggcgtt agtatgagtg ttgtacagcc
tccaggaccc 60cccctcccgg gagagccata gtggtcttcg gaaccggtga gtacaccgga
atcgccggga 120tgaccgggtc ctttcttgga ttaacccgct caatgcccgg
aaatttgggc gtgcccccgc 180aagactgcta gccgagtagt gttgggtcgc
gaaaggcctt gcggtactgc ctgatagggt 240gcttgcgagt gccccgggag
gtctcgtaga ccgtgcacca tgagcacgaa tcctaaacct 300caaagaaaaa
ccaaacgtaa caccaaccgc cgcccaatgg acgttaagtt cccgggtggt
360ggccagatcg ttggcggagt ttacttgttg ccgcgcaggg gccccagatt
gggtgtgcgc 42078420DNAHepatitis C virus 78gccagccccc tgatgggggc
gacactccac catgaatcac tcccctgtga ggaactactg 60tcttcacgca gaaagcgtct
agccatggcg ttagtatgag tgtcgtgcag cctccaggac 120cccccctccc
gggagagcca tagtggtctg cggaaccggt gagtacaccg gaattgccag
180gacgaccggg tcctttcttg gataaacccg ctcaatgcct ggagatttgg
gcgtgccccc 240gcaagactgc tagccgagta gtgttgggtc gcgaaaggcc
ttgtggtact gcctgatagg 300gtgcttgcga gtgccccggg aggtctcgta
gaccgtgcac catgagcacg aatcctaaac 360ctcaaagaaa aaccaaacgt
aacaccaacc gtcgcccaca ggacgtcaag ttcccgggtg 42079420DNAHepatitis C
virus 79acccgcccct aataggggcg acactccgcc atgaaccact cccctgtgag
gaactactgt 60cttcacgcag aaagcgtcta gccatggcgt tagtatgagt gtcgtacagc
ctccaggccc 120ccccctcccg ggagagccat agtggtctgc ggaaccggtg
agtacaccgg aattgccggg 180aagactgggt cctttcttgg ataaacccac
tctatgcccg gtcatttggg cgtgcccccg 240caagactgct agccgagtag
cgttgggttg cgaaaggcct tgtggtactg cctgataggg 300tgcttgcgag
tgccccggga ggtctcgtag accgtgcacc atgagcacaa atcctaaacc
360tcaaagaaaa accaaaagaa acaccaaccg tcgcccacaa gacgttaagt
ttccgggcgg 42080420DNAHepatitis C virus 80acctgcctct tacgaggcga
cactccacca tggatcactc ccctgtgagg aacttctgtc 60ttcacgcgga aagcgcctag
ccatggcgtt agtacgagtg tcgtgcagcc tccaggaccc 120cccctcccgg
gagagccata gtggtctgcg gaaccggtga gtacaccgga atcgctgggg
180tgaccgggtc ctttcttgga gcaacccgct caatacccag aaatttgggc
gtgcccccgc 240gagatcacta gccgagtagt gttgggtcgc gaaaggcctt
gtggtactgc ctgatagggt 300gcttgcgagt gccccgggag gtctcgtaga
ccgtgcaaca tgagcacact tcctaaacct 360caaagaaaaa ccaaaagaaa
caccatccgt cgcccacagg acgtcaagtt cccgggtggc 4208122DNAArtificial
SequenceSynthetic oligonucleotide - HIV1 F3 primer 2 81aacaccatgc
taaacacagt gg 22
* * * * *
References