U.S. patent application number 15/218653 was filed with the patent office on 2017-02-16 for transposon activation during aging and neuronal decline.
This patent application is currently assigned to Cold Spring Harbor Laboratory. The applicant listed for this patent is Cold Spring Harbor Laboratory. Invention is credited to Joshua Dubnau, Wanhe Li, Lisa Prazak.
Application Number | 20170044531 15/218653 |
Document ID | / |
Family ID | 51538508 |
Filed Date | 2017-02-16 |
United States Patent
Application |
20170044531 |
Kind Code |
A1 |
Dubnau; Joshua ; et
al. |
February 16, 2017 |
Transposon Activation During Aging and Neuronal Decline
Abstract
The present invention relates to transposon activation and
mobilization, particularly in the brain, during normal aging;
reporter systems to detect such mobilization, along with cells and
transgenic animals containing such systems; methods of monitoring
neuronal function during normal aging; methods of determining the
risk of age-related neuronal decline and age-related mortality; and
the use of transposon inhibitors and apoptosis inhibitors to delay
age-related neuronal decline and age-related mortality.
Inventors: |
Dubnau; Joshua; (Huntington,
NY) ; Li; Wanhe; (New York, NY) ; Prazak;
Lisa; (Massapequa Park, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cold Spring Harbor Laboratory |
Cold Spring Harbor |
NY |
US |
|
|
Assignee: |
Cold Spring Harbor
Laboratory
Cold Spring Harbor
NY
|
Family ID: |
51538508 |
Appl. No.: |
15/218653 |
Filed: |
July 25, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14216491 |
Mar 17, 2014 |
9422605 |
|
|
15218653 |
|
|
|
|
61798994 |
Mar 15, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6881 20130101;
C12N 15/113 20130101; C12Q 1/6883 20130101; C12Q 2600/118 20130101;
C12N 2310/14 20130101; C12Q 2600/158 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under Grant
Number 5R01 N5067690-05 awarded by the National Institutes of
Health (NIH). The government has certain rights in the invention.
Claims
1-80. (canceled)
81. A method of delaying age-related neuronal decline, comprising
administering to a subject in need of such treatment an effective
amount of a transposon inhibitor.
82. The method of claim 81, wherein the transposon inhibitor is an
inhibitor of a protein encoded by a transposon.
83. The method of claim 82, wherein the protein encoded by the
transposon is a transposase; an integrase; a reverse transcriptase;
an endonuclease; a protein encoded by gag, pol, or env; an enzyme
encoded by ORF1 of a non-LTR transposon; or an enzyme encoded by
ORF2 of a non-LTR transposon.
84. The method of claim 81, wherein the transposon inhibitor is an
anti-retroviral drug; an inhibitor of reverse transcription; an
inhibitor of transposase or integrase activity; an inhibitor of
endonuclease activity; a zinc-finger that targets a transposon
promoter region; a repressor that inhibits a transposon; an innate
antiretroviral resistance factor; a small interfering RNAs (siRNA),
short hairpin RNA (shRNA), morpholino, or antisense oligonucleotide
directed to a TE transcript; or an inhibitor of post-translational
processing or proteolysis of a transposon-encoded protein.
85. The method of claim 81, wherein the transposon inhibitor is an
inhibitor of a retrotransposon.
86. The method of claim 85, wherein the retrotransposon is an LTR
retrotransposon.
87. The method of claim 86, wherein the LTR transposon includes a
gypsy element.
88. The method of claim 85, wherein the retrotransposon is a
non-LTR retrotransposon.
89. The method of claim 88, wherein the non-LTR retrotransposon is
a LINE-like element.
90. The method of claim 89, wherein the LINE-like element is R1 or
R2.
91. The method of claim 88, wherein the non-LTR retrotransposon is
a LINE element.
92. The method of claim 91, wherein the LINE element is L1.
93. The method of claim 88, wherein the non-LTR retrotransposon is
a SINE retrotransposon.
94. The method of claim 93, wherein the SINE retrotransposon is an
Alu sequence.
95. The method of claim 81, wherein the transposon inhibitor is an
inhibitor of reverse transcriptase activity.
96. The method of claim 81, wherein the transposon inhibitor is an
inhibitor of endonuclease activity.
97. The method of claim 81, wherein the transposon inhibitor is an
inhibitor of integrase activity.
98. The method of claim 81, wherein the transposon inhibitor is an
anti-retroviral drug.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/216,491, filed Mar. 17, 2014, issued as
U.S. Pat. No. 9,422,605, which claims the benefit under 35 U.S.C.
.sctn.119(e) to U.S. Provisional Application No. 61/798,994, filed
Mar. 15, 2013, each of which is incorporated herein by reference in
its entirety.
SUBMISSION OF SEQUENCE LISTING
[0003] The Sequence Listing associated with this application is
filed in electronic format via EFS-Web and hereby incorporated by
reference into the specification in its entirety. The name of the
text file containing the Sequence Listing is
402256_00503_Sequence_Listing. The size of the text file is 4 KB,
and the text file was created on Jul. 25, 2016.
FIELD OF THE INVENTION
[0004] The present invention relates to transposon activation and
mobilization, particularly in the brain during normal aging;
reporter systems to detect such mobilization; methods of monitoring
neuronal function during normal aging; methods of determining the
risk of age-related neuronal decline and age-related mortality; and
the use of transposon inhibitors and apoptosis inhibitors to delay
age-related neuronal decline and age-related mortality.
BACKGROUND OF THE INVENTION
[0005] Transposable elements (TEs; or transposons) are highly
abundant mobile genetic elements that comprise multiple classes and
constitute a large fraction of most eukaryotic genomes. The class
known as retrotransposons, for example, comprises about 40 and 30
percent of the human and Drosophila genomes, respectively.
(Belancio et al., Genome Res. 2008, 18, 343-358; Goodier and
Kazazian, Cell 2008, 135, 23-35; 2-5).
[0006] The movement and accumulation of TEs has been a major force
in shaping the genes and genomes of almost all organisms.
(Feschotte and Pritham, Annu. Rev. Genet. 2007, 41, 331-368; Hancks
and Kazazian, Curr. Opin. Gen. Dev. 2012, 22, 191-202; Burns and
Boeke, Cell 2012, 149, 740-752). This force is not without
potential adverse consequences, however: TEs represent a massive
reservoir of potential genomic stability and RNA-level toxicity
that must also be kept in check. Indeed, many TE appear static and
non-functional.
[0007] However, at least some TEs are capable of replicating and
mobilizing to new positions in the genome--and even immobile TE
copies can be expressed. And endogenous transposition itself has
been detected in the germline--where TEs have been most extensively
investigated (Belancio et al., Genome Res. 2008, 18, 343-358). In
addition, somatic transposition events have observed in early
embryonic development and during neurogenesis. (Goodier and
Kazazian, Cell 2008, 135, 23-35; 2-5; Muotri et al., Nature 2010,
468, 443-446; Baillie et al., Nature 2011, 479, 534-537; Coufal et
al., Proc. Natl. Acad. Sci. USA 2011, 108, 20382-20387).
[0008] These observations do not, however, address the extent to
which TEs are expressed or mobilized in the brain during normal
aging--much less the possible functional consequences of such
activation. Clarifying these issues may afford new mechanistic
insights into aging and related physiological processes. The
present invention meets these and other needs in art, providing new
tools, along with new diagnostic and therapeutic methods, as
disclosed herein.
SUMMARY OF THE INVENTION
[0009] In a first set of embodiments, the invention provides
methods of monitoring neuronal function during normal aging,
comprising measuring expression of at least one transposon in a
biological sample from a subject and determining whether the
measured transposon expression exceeds a predetermined level.
[0010] In a second set of embodiments, the invention provides
methods of determining the risk of age-related neuronal decline (or
age-related mortality). These methods comprise measuring expression
of at least transposon in a biological sample from a subject, and
determining whether the measured transposon expression exceeds a
predetermined level, wherein measured transposon expression that
exceeds the predetermined level indicates that the subject is at
risk of accelerated age-related neuronal decline (or accelerated
age-related mortality). In a specific aspect, the age-related
neuronal decline is a cognitive decline, in particular an
impairment in memory, and more particularly, an impairment in
long-term memory.
[0011] In the first and second set of embodiments, the transposon
can be a DNA transposon, and more particularly, an autonomous
element or a nonautonomous element. The transposon can also be a
retrotransposon, including an LTR retrotransposon and a non-LTR
retrotransposon. More specifically, an LTR retrotransposon can
include a gypsy element or an endogengous retrovirus (ERV); and a
non-LTR retrotransposon can include a SINE retrotransposon, such as
an Alu sequence; a LINE element, such as L1, or a LINE-like
element, such as R1 or R2.
[0012] In a more specific aspect, the first and second embodiments
can also include administering to the subject an effective amount
of a transposon inhibitor or an apoptosis inhibitor.
[0013] In a third set of embodiments, the invention provides
methods of delaying age-related neuronal decline or age-related
mortality, comprising administering to a subject in need of such
treatment an effective amount of a transposon inhibitor or
apoptosis inhibitor. In a specific aspect, the age-related neuronal
decline is a cognitive decline, in particular an impairment in
memory, and more particularly, an impairment in long-term
memory.
[0014] As used in the first, second, and third embodiments, the
transposon inhibitor may be an inhibitor of a protein encoded by a
transposon, such as an inhibitor of a transposase, an integrase, a
reverse transcriptase, an endonuclease; a protein encoded by gag,
pol, or env; an enzyme encoded by ORF1 of a non-LTR transposon; or
an enzyme encoded by ORF2 of a non-LTR transposon. The transposon
inhibitor can also be an anti-retroviral drug; an inhibitor of
reverse transcription; an inhibitor of transposase or integrase
activity; an inhibitor of endonuclease activity; a stimulator of
DNA repair machinery; a zinc-finger that targets a transposon
promoter region; a repressor that inhibits a transposon; an innate
antiretroviral resistance factor; a small interfering RNAs (siRNA),
short hairpin RNA (shRNA), morpholino, or antisense oligonucleotide
directed to a TE transcript; or an inhibitor of post-translational
processing or proteolysis of a transposon-encoded proteins. The
transposon inhibitor may also be an agent that blocks intercellular
transmission of transposon genetic material or protein, such as an
agent that prevents binding of a viral particle to a cell surface
receptor.
[0015] As used in the first, second, and third embodiments, the
apoptosis inhibitor includes an inhibitor of a checkpoint kinase,
and Checkpoint kinase 2, in particular. Apoptosis inhibitors also
include stimulators of the DNA repair machinery, as well as
endogenous inhibitors of apoptosis, such as those in human
Inhibitor of Apoptosis (IAP) family, whose members include Cp-IAP,
Op-IAP, XIAP, c-IAP1, c-IAP2, NAIP, and surviving. An apoptosis
inhibitor can also include antagonists directed to pro-apoptotic
proteins such as a caspase, Bak, and Bax, and agonists directed to
anti-apoptotic proteins such as Bcl-1.
[0016] In one aspect of the methods, the subject is an
invertebrate, more particularly, Drosophila. In another aspect, the
subject is a vertebrate, particularly a mammal, more particularly,
a human, and even more particularly, a healthy human.
[0017] In another aspect of the methods, the transposon inhibitor
or apoptosis inhibitor is formulated as a pharmaceutical
composition and is administered to the subject in a therapeutically
effective amount. The inhibitor may also be administered together
or in conjunction with other agents.
[0018] In other embodiments, the invention provides a recombinant
nucleic acid sequence for detecting de novo TE integration events,
comprising a promoter region; a reporter gene operably linked to
the promoter; and a fragment inserted between the promoter and
reporter gene, wherein the fragment comprises binding sites that
are necessary and sufficient to attract de novo TE insertions, and
does not itself does not disrupt expression of the reporter gene.
In a specific aspect, the reporter gene encodes an expression
disrupter, which can include GAL80. In another aspect, the fragment
is an ovo regulatory region containing multiple Ovo binding
sites.
[0019] The present invention also include a cell comprising any of
the disclosed recombinant nucleic acid sequences. Such a cell may
also include a second recombinant nucleic acid sequence, comprising
a second promoter region operably linked to a second reporter gene,
wherein expression of the second reporter gene is blocked by the
expression disruptor. In a particular aspect, expression of the
second reporter gene is mediated by GAL4. The invention also
includes a transgenic animal, including a transgenic vertebrate or
transgenic Drosophila, comprising any of the recombinant nucleic
sequences herein (or cell that contains any of them).
[0020] More generally, the invention is further directed to the
general and specific embodiments defined, respectively, by the
independent and dependent claims appended hereto, which are
incorporated by reference herein.
BRIEF DESCRIPTION OF FIGURES
[0021] For a more complete understanding of the invention,
reference is now made to the Detailed Description and Examples in
conjunction with the accompanying figures.
[0022] FIG. 1A is a histogram showing age-dependent expression of
transposable elements in normal Drosophila brain. Levels of
transcripts of R2, a LINE-like element and gypsy, an LTR element
were quantified by QPCR with RNA preparations from young (2-4-day)
and aged (.about.14-day, .about.21-day and .about.28-day) wild type
(WT) fly heads. Levels of TE transcripts are normalized to Actin.
Expression shown as fold changes relative to WT (means.+-.SEM).
[0023] FIG. 1B is a panel of images showing that ENV
immunofluorescence is progressively elevated in brains from older
animals (13-day, 23-day, 34-day) relative to brains from
.about.2-4-day old animals (these images were taken under identical
confocal settings). ENV labeling is shown as a confocal projection
through the central brain. Elevated levels of ENV are seen in aged
brains throughout the cortex layer that includes most of the cell
bodies as well as in neuropil areas of axons and dendrites (see
also individual confocal sections in FIGS. 3B and 6).
[0024] FIG. 2A-2E is a panel of images from screening studies for
de novo gypsy integration events in the mushroom body (MB) neurons
of Drosophila wild-type brain using control and experimental
"gypsy-TRAP" reporter systems. A .about.500 bp fragment from the
ovo regulatory region containing 5 Ovo binding sites is inserted
between Tub promoter and GAL80 gene. A mutated "gypsy-TRAP"
construct contains mutations that disrupt each of the 5 Ovo binding
sites. In the absence of gypsy insertions, GAL80 expression
suppresses GAL4, and UAS::mCD8::GFP is not expressed. In the
presence of gypsy integration into the "gypsy-TRAP", GAL80
expression is blocked, and UAS::mCD8::GFP is turned on (see FIG.
5). (FIG. 2A) Approximately 800 mushroom body Kenyon cell neurons
per brain hemisphere are labeled by MB247-GAL4-driven
UAS::mCD8::GFP. (FIG. 2B) An exemplary brain from 2-4-day old
mutated "gypsy-TRAP"; UAS::mCD8::GFP/+; MB247/+. No GFP labeled
neurons are seen. (FIG. 2C) An exemplary brain from .about.28-day
old mutated "gypsy-TRAP"; UAS::mCD8::GFP/+; MB247/+. No GFP labeled
neurons seen. (FIG. 2D) An exemplary brain from .about.2-4-day old
"gypsy-TRAP"; UAS::mCD8::GFP/+; MB247/+. No GFP labeled neurons are
seen. (FIG. 2E) Exemplary brains from .about.28-day old
"gypsy-TRAP"; UAS::mCD8::GFP/+; MB247/+. Several GFP-labeled MB
neurons seen in each brain. See Table 1 and FIG. 5 for statistical
summary and additional exemplary images.
[0025] FIG. 3A is a histogram showing that age-dependent TE
expression contributes to memory decline and age-dependent
mortality. Levels of transcripts of R1, R2 and gypsy were
quantified from young (2-4-day) and aged (.about.28-day) WT and
dAgo2 mutant animal heads. Within all genotypes, aged animals have
significantly elevated levels of each of the transposon transcripts
(R1, R2, and gypsy), compared to young animals (*, p<0.05, N=4
for both young and aged dAgo2.sup.414 groups, N=7 for both young
and aged WT and dAgo2.sup.51B groups), except for the comparison
between young and aged groups within dAgo2.sup.51B (p=0.085) for
gypsy, which also is elevated in young animals. For R2 and gypsy,
transcript levels in dAgo2.sup.51B young groups are as high as in
WT aged groups. .about.28-day old dAgo2.sup.51B animals exhibit
dramatically increased levels of R2 compared to aged WT group (*,
p<0.05). For R2, the 5' probe set was used in this experiment
(see Methods in the Examples Section herein).
[0026] FIG. 3B is a panel of images showing detection of ENV
immunoreactivity throughout the cortex layer that includes most of
the somata as well as in neuropil (see also FIGS. 1 and 8B).
Central projections are shown for whole mount brains. Brains from
dAgo2.sup.414 mutants exhibit higher levels of ENV immunolabeling
in .about.14-day old and .about.30-day old animals, as also is
observed with other dAgo2 alleles (See also FIG. 8B).
[0027] FIG. 3C is an image showing western blot detection of ENV
with a monoclonal antibody and age-dependent accumulation in heads
from dAgo2 mutant animals (see also FIG. 8A). Levels for
dAgo2.sup.51B appear increased although somewhat variable.
[0028] FIG. 3D is a histogram showing LTM performance
(means.+-.SEM) for 2-4-day old and .about.20-day old WT and
dAgo2.sup.414 mutant animals. 2-4-day old dAgo2.sup.414 mutants
exhibit significantly reduced LTM performance relative to 2-4-day
old WT animals, and show a dramatic further reduction in
performance in the 20-day old dAgo2.sup.414 mutant group (*,
p<0.05 and N=15). The specificity of these results was verified
by the analysis of olfactory acuity and shock reactivity, which
revealed no differences between the genotypes (data not shown).
[0029] FIG. 3E is a graph showing that lifespan is significantly
shortened for dAgo2.sup.414 and dAgo2.sup.51B animals relative to
WT (log-rank test).
[0030] FIG. 3F is a graph showing that knocking down gene
expression of loki (the Drosophila ortholog of Checkpoint kinase 2
(chk2)) with loki RNAi in neurons significant delays mortality
(Gehan-Breslow-Wilcoxon test) of the elav/+; lokiRNAi/+ animals
compared to heterozygous controls for transgenes (elav/+ and
lokiRNAi/+). (Such lokiRNAi-mediated knockdown also delays the
onset of age-dependent memory decline (FIG. 10)).
[0031] FIG. 4 is a histogram showing expression levels of dAGO2 and
Dcr-2 in fly heads from both 2-4 day old (young) animals and
.about.21 day-old aged animals, as measured by QPCR. A moderate
increase (*, p<0.05) of dAGO2 expression was observed with two
independent dAGO2 Taqman assays tested. A moderate increase (*,
p<0.05) of Dcr-2 expression was observed with one of two
independent Dcr-2 Taqman assays tested.
[0032] FIG. 5A is an illustration of the design and operation of
the "gypsy-TRAP." A .about.500 bp fragment from the ovo regulatory
region containing 5 Ovo binding sites is inserted between Tub
promoter and GAL80 gene. A mutated "gypsy-TRAP" construct contains
mutations that disrupt each of the 5 Ovo binding sites. In the
absence of gypsy insertions, GAL80 expression suppresses GAL4, and
UAS::mCD8::GFP is not expressed. In the presence of gypsy
integration into the "gypsy-TRAP", GAL80 expression is blocked, and
UAS::mCD8::GFP is turned on.
[0033] FIG. 5B is an image showing that "gypsy-TRAP" reporter
detects de novo integration of gypsy in neurons in aged wild-type
animals. As in FIG. 2, the "gypsy-TRAP" reporter was combined with
MB247-GAL4 line, and UAS::mCD8::GFP. In brains from aged animals
(28-35 day post eclosion) sparsely GFP labeled mushroom body
neurons are consistently observed (three examples shown in left
panels, see also FIG. 2 and Table 1). As is true in germline,
insertion of gypsy into this cassette requires the presence of Ovo
binding sites. No labeled neurons are seen with the mutated
"gypsy-TRAP" construct in which these sites are mutated (three
examples shown in right panels, see also FIG. 2 and Table 1).
[0034] FIG. 6A-6B is an illustration and image of a gel showing s
de novo insertion of gypsy into the ovo locus is detected in
dAgo2.sup.414 mutants with genomic PCR. (FIG. 6A) Cartoon of a
flybase GBrowse screenshot showing a 2 Kb window of the ovo locus
with the location and orientation of the gypsy retrotransposon
insertion that was detected by nested genomic PCR. The region of
the GBrowse highlighted in gray depicts the sequence present in the
"gypsy-TRAP" construct. Sequence results, from clones of the nested
PCR fragment from 28-day old dAgo2.sup.414 fly heads, at bottom
show the ovo/gypsy junction with the ovo sequence highlighted in
red followed by gypsy sequence in yellow. Arrows represent the
primers used for nested PCR. (FIG. 6B) Ethidium bromide stained gel
with a 1 Kb plus DNA ladder showing the presence of a 350 bp de
novo band from heads of 28-day old dAgo2.sup.414 mutant animals.
This product is not present in young animals. Because the genomic
DNA was extracted from whole heads, the possibility cannot be
formally excluded of a low rate of de novo insertions in young
animals that were not detectable by genomic PCR.
[0035] FIG. 7A-7E is a panel of histograms showing that dAgo2
mutants have increased R2 and gypsy expression and defective
olfactory memory. (FIG. 7A) Levels of transcripts from R1, R2 and
gypsy were quantified indAgo2 mutant animals relative to wild type
from 2-4-day old animals. For R2, two independent probes were
designed to target the 5' (R25') and 3' (R23') end of the R2
transcript. Significant elevated expression of R23' and gypsy are
seen in dAgo2.sup.414, dAgo2.sup.51B and dAgo2.sup.414/.sup.51B (*,
p<0.05 and N=4). With R25', a significant increase is seen in
dAgo251B (*, p<0.05 and N=8). (FIG. 7B-E) Behavioral performance
indices (means.+-.SEM) are shown for aversive Pavlovian olfactory
memory. (FIG. 7B) dAgo2 mutant animals exhibit normal STM (3
minutes memory measured after one training session) (n.s., not
significant and N=8). (FIG. 7C-E) dAgo2 mutant alleles exhibit
defective LTM (24 hr memory measured after 10.times. spaced
training (See Methods in the Examples Section herein). (C) Both
homozygous dAgo2.sup.414 and dAgo2.sup.51B animals exhibit
significantly lower LTM memory performance indices (*, p<0.05,
N=8) relative to that of WT flies. (FIG. 7D) dAgo2.sup.414 and
dAgo2.sup.51B fail to complement each-other for LTM performance as
dAgo2.sup.414/.sup.1B animals exhibit reduced performance (*;
p<0.05 and N=16) relative to WT controls or to animals that are
heterozygous either for dAgo2.sup.414 or dAgo2.sup.51B. (FIG. 7E)
The LTM defect can be rescued by expressing a UAS::dAgo2 transgene
under control of the pan-neuronal elav-Gal4 line (elav/+;
UAS::dAgo2/+; dAgo2.sup.414). Animals that are homozygous for
dAgo2414 and heterozygous for either the elav-Gal4 line or
UAS::dAgo2 (elav/+; +/+; dAgo2.sup.414 or UAS::dAgo2/+;
dAgo2.sup.414) exhibit defective LTM (*, p<0.05 and N=16).
[0036] FIG. 8A is a western blot showing the detection of increased
gypsy ENV protein level in heads from 2-4-day old dAgo2.sup.454
animals by western blot. The detected gypsy ENV band from fly heads
is identical in size to the gypsy ENV band from flam-/-
ovaries.
[0037] FIG. 8B is an image showing that increased gypsy ENV
expression is also detected in whole mount brains from
.about.14-day old dAgo2.sup.454 animals by ENV immunolabeling;
dAgo2.sup.454 allele is a recently identified dAgo2 null allele
(Hain 2010). Optical sections are shown for .about.14-day WT (left
panel) and dAgo2.sup.454 (right panel). Env (RED) and DiD
counterstain (grey) are shown. Increased gypsy EN protein
expression was also detected in whole mount brains from 0-4 day and
.about.28 day old dAgo2.sup.454 animals by ENV immunolabeling
(images not shown).
[0038] FIG. 8C is a graph showing that compared to wild-type
animals, dAgo2.sup.414 mutants show a shortened lifespan, and
dAgo2.sup.454 mutants show a severely shortened lifespan (log-rank
test).
[0039] FIG. 9A-9C is a panel of histograms showing examined the
expression of the 8 natural viruses that have been detected in
Drosophila melanogaster strains and cells (Wu 2010). (FIG. 9A, 9B)
Only one of these, Drosophila C virus (DCV) was detected in our
strains, but its expression levels do not correlate with age,
genotype or TE expression. (FIG. 9C) By bleach treating embryos,
detectable DCV can be eliminated; however, even in the absence of
virus following such bleach treatment, age-dependent activation of
TEs still occur. (In addition, the effects of dAgo2 on lifespan
remain (FIG. 3E)). Thus, the accelerated decline observed in dAgo2
mutants neither correlates with, nor depends upon, presence of
exogenous viruses. In contrast, the expression of R2 and gypsy
retrotransposons correlates with age dependent decline both in wild
type and dAgo2 mutants.
[0040] FIG. 10A-10C is a panel of histograms showing that lokiRNAi
is effective in suppressing expression of loki, the Drosophila
ortholog of Checkpoint kinase 2 (chk2), in heads from .about.28-day
old animals. When lokiRNAi is expressed in neurons with elav-GAL4
or glia cells with repo-GAL4, reduced loki expression levels are
observed in heads from .about.28-day old animals (FIG. 10A).
However, the effect on lifespan is only observed when lokiRNAi is
expressed in neurons with elav-GAL4 (FIG. 3F), but not in glia
cells with repo-GAL4 (data not shown). 24 hr memory after 10.times.
spaced training sessions is measured for lokiRNAi/+ and elav/+;
lokiRNAi/+ animals at both 2-4-day and .about.28-day time point
(FIG. 10B, 10C). The age-dependent memory decline in elav/+;
lokiRNAi/+ is significantly smaller than lokiRNAi/+ animals (FIG.
10C and Two-Way ANOVA for age and genotype interaction).
DETAILED DESCRIPTION OF THE INVENTION
[0041] The invention may be more fully appreciated by reference to
the following description, including the Examples. Unless otherwise
defined, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the
pharmaceutical arts. Although methods and materials similar or
equivalent to those described herein can be used in the practice or
testing of the present invention, suitable methods and materials
are described herein. In addition, the materials, methods, and
examples are illustrative only and are not intended to be
limiting.
[0042] General reference is made to standard textbooks of molecular
biology and pharmaceutics that contain definitions and methods and
means for carrying out basic techniques, which may be encompassed
by the present invention. See, e.g. Current Protocols in
Pharmacology, Enna et al. (eds.), John Wiley and Sons, Inc.,
Hoboken, N.J. (2011), Current Protocols in Molecular Biology,
Ausubel et al. (eds.), John Wiley & Sons, Inc., Hoboken, N.J.
(2011), Current Protocols in Cell Biology, Bonifacino et al.
(eds.), John Wiley & Sons, Inc.: Hoboken, N.J. (2011); Current
Protocols in Neuroscience, Gerfen et al. (eds.), John Wiley &
Sons, Inc., Hoboken, N.J. (2011); and the various references cited
therein.
[0043] All publications, including patent applications, patents,
and other citations mentioned herein, are incorporated by reference
in their entirety. Citation of any such publication, however, shall
not be construed as an admission that it is prior art to the
present invention.
TERMS AND DEFINITIONS
[0044] The use of subheadings such as "General," "Compositions,"
Formulations," etc., in this section, as well as in other sections
of this application, are solely for convenience of reference and
not intended to be limiting.
General
[0045] As used herein, the term "about" or "approximately" means
within an acceptable range for a particular value as determined by
one skilled in the art, and may depend in part on how the value is
measured or determined, e.g., the limitations of the measurement
system or technique. For example, "about" can mean a range of up to
20%, up to 10%, up to 5%, or up to 1% or less on either side of a
given value. Alternatively, with respect to biological systems or
processes, the term "about" can mean within an order of magnitude,
within 5-fold, or within 2-fold on either side of a value.
Numerical quantities given herein are approximate unless stated
otherwise, meaning that the term "about" or "approximately" can be
inferred when not expressly stated
[0046] To provide a more concise description, some of the
quantitative expressions given herein are not qualified with the
term "about". It is understood that, whether the term "about" is
used explicitly or not, every quantity given herein is meant to
refer to the actual given value, and it is also meant to refer to
the approximation of such given value that would reasonably be
inferred based on the ordinary skill in the art, including
equivalents and approximations due to the experimental and/or
measurement conditions for such given value. Whenever a yield is
given as a percentage, such yield refers to a mass of the entity
for which the yield is given with respect to the maximum amount of
the same entity for which that could be obtained under the
particular stoichiometric conditions. Concentrations that are given
as percentages refer to mass ratios, unless indicated
differently.
[0047] As used herein, the terms "a," "an," and "the" are to be
understood as meaning both singular and plural, unless explicitly
stated otherwise. Thus, "a," "an," and "the" (and grammatical
variations thereof where appropriate) refer to one or more.
[0048] A group of items linked with the conjunction "and" should
not be read as requiring that each and every one of those items be
present in the grouping, but rather should be read as "and/or"
unless expressly stated otherwise. Similarly, a group of items
linked with the conjunction "or" should not be read as requiring
mutual exclusivity among that group, but rather should also be read
as "and/or" unless expressly stated otherwise. Furthermore,
although items, elements or components of the invention may be
described or claimed in the singular, the plural is contemplated to
be within the scope thereof, unless limitation to the singular is
explicitly stated.
[0049] The terms "comprising" and "including" are used herein in
their open, non-limiting sense. Other terms and phrases used in
this document, and variations thereof, unless otherwise expressly
stated, should be construed as open ended, as opposed to limiting.
As examples of the foregoing: the term "example" is used to provide
exemplary instances of the item in discussion, not an exhaustive or
limiting list thereof; adjectives such as "conventional,"
"traditional," "normal," "criterion," "known" and terms of similar
meaning should not be construed as limiting the item described to a
given time period or to an item available as of a given time, but
instead should be read to encompass conventional, traditional,
normal, or criterion technologies that may be available or known
now or at any time in the future. Likewise, where this document
refers to technologies that would be apparent or known to one of
ordinary skill in the art, such technologies encompass those
apparent or known to the skilled artisan now or at any time in the
future.
[0050] The presence of broadening words and phrases such as "one or
more," "at least," "but not limited to" or other like phrases in
some instances shall not be read to mean that the narrower case is
intended or required in instances where such broadening phrases may
be absent. As will become apparent to one of ordinary skill in the
art after reading this document, the illustrated embodiments and
their various alternatives may be implemented without confinement
to the illustrated examples.
Agents and Compositions
[0051] The terms "pharmaceutical agent," "agent," "compound," or
"drug" may be used interchangeably herein, and include
pharmacologically active substances in isolated form, or mixtures
thereof. For example, a pharmaceutical agent, compound or drug may
be an isolated and structurally-defined product, an isolated
product of unknown structure, a mixture of several known and
characterized products, or an undefined composition comprising one
or more products. Examples of such undefined compositions include
for instance tissue samples, biological fluids, cell supernatants,
vegetal preparations, etc. The pharmaceutical agent, compound or
drug may be any organic or inorganic product, including a
polypeptide (or a protein or peptide), a nucleic acid, a lipid, a
polysaccharide, a chemical entity, or mixture or derivatives
thereof. The pharmaceutical agent, compound or drug may be of
natural or synthetic origin, and the compound(s) or modulators may
include libraries of compounds. In particular embodiments, the
nucleic acid may comprise an inhibitory RNA molecule such as an
siRNA, shRNA, or mico-RNA.
[0052] A pharmaceutical agent can decrease the amount, degree, or
nature of transposon expression in vivo, in vitro, or ex vivo,
relative to the amount, degree, or nature of transposon expression
in the absence of the agent or reagent. In certain embodiments,
treatment with such a pharmaceutical agent, such as a transposon
inhibitor, may decrease the amount, degree, or nature of transposon
expression by at least about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 40%,
50%, 60%, 70%, 80%, 90%, or 100%, compared to the amount, degree,
or nature of transposon expression in the absence of the agent,
under the conditions of the method used to detect or determine
transposon expression.
[0053] The term "composition", as in pharmaceutical composition, is
intended to encompass a product comprising the active
ingredient(s), and the inert ingredient(s) (pharmaceutically
acceptable excipients) that make up the carrier, as well as any
product which results, directly or indirectly, from combination,
complexation, or aggregation of any two or more of the ingredients,
or from dissociation of one or more of the ingredients, or from
other types of reactions or interactions of one or more of the
ingredients.
[0054] As used herein, the phrase "pharmaceutically acceptable"
refers to molecular entities and compositions that are generally
regarded as "safe," e.g., that are physiologically tolerable and do
not typically produce an allergic or similar untoward reaction,
such as gastric upset, dizziness and the like, or other significant
adverse events, when administered to a human. Preferably, as used
herein, the term "pharmaceutically acceptable" means approved by a
regulatory agency of the Federal or a state government of listed in
the U.S. Pharmacopeia or other generally recognized pharmacopeia
for use in animals, and more particularly in humans.
[0055] A "pharmaceutically acceptable excipient" refers to a
substance that is non-toxic, biologically tolerable, and otherwise
biologically suitable for administration to a subject, such as an
inert substance, added to a pharmacological composition or
otherwise used as a vehicle, carrier, or diluents to facilitate
administration of an agent and that is compatible therewith.
Examples of excipients include calcium carbonate, calcium
phosphate, various sugars and types of starch, cellulose
derivatives, gelatin, vegetable oils, and polyethylene glycols.
Suitable pharmaceutical carriers include those described in
Remington: The Science and Practice of Pharmacy, 21.sup.st Ed.,
Lippincott Williams & Wilkins (2005).
[0056] The term "carrier" refers to an adjuvant, vehicle, or
excipient, with which the compound is administered. In preferred
embodiments of this invention, the carrier is a solid carrier.
Suitable pharmaceutical carriers include those described in
Remington: The Science and Practice of Pharmacy, 21st Ed.,
Lippincott Williams & Wilkins (2005).
[0057] The term "dosage form," as used herein, is the form in which
the dose is to be administered to the subject or patient. The drug
is generally administered as part of a formulation that includes
nonmedical agents. The dosage form has unique physical and
pharmaceutical characteristics. Dosage forms, for example, may be
solid, liquid or gaseous. "Dosage forms" may include for example, a
capsule, tablet, caplet, gel caplet (gelcap), syrup, a liquid
composition, a powder, a concentrated powder, a concentrated powder
admixed with a liquid, a chewable form, a swallowable form, a
dissolvable form, an effervescent, a granulated form, and an oral
liquid solution. In a specific embodiment, the dosage form is a
solid dosage form, and more specifically, comprises a tablet or
capsule.
[0058] As used herein, the term "inert" refer to any inactive
ingredient of a described composition. The definition of "inactive
ingredient" as used herein follows that of the U.S. Food and Drug
Administration, as defined in 21 C.F.R. 201.3(b)(8), which is any
component of a drug product other than the active ingredient.
Methods and Uses
[0059] Methods of the present invention include the use of a
transposon inhibitor to treat disorders in a subject. As used
herein, the term "disorder" may be used interchangeably with
"condition" or "disease".
[0060] The terms "treating," "treatment," and "treat" cover
therapeutic methods directed to a disease-state in a subject and
include: (i) preventing the disease-state from occurring, in
particular, when the subject is predisposed to the disease-state
but has not yet been diagnosed as having it; (ii) inhibiting the
disease-state, e.g., arresting its development (progression) or
delaying its onset; and (iii) relieving the disease-state, e.g.,
causing regression of the disease state until a desired endpoint is
reached. Treating also includes ameliorating a symptom of a disease
(e.g., reducing the pain, discomfort, or deficit), wherein such
amelioration may be directly affecting the disease (e.g., affecting
the disease's cause, transmission, or expression) or not directly
affecting the disease.
[0061] As used in the present disclosure, the term "effective
amount" is interchangeable with "therapeutically effective amount"
and means an amount or dose of a compound or composition effective
in treating the particular disease, condition, or disorder
disclosed herein and thus "treating" includes producing a desired
preventative, inhibitory, relieving, or ameliorative effect. In
methods of treatment according to the invention, "an effective
amount" of at least one compound according to the invention is
administered to a subject (e.g., a mammal). An "effective amount"
also means an amount or dose of a compound or composition effective
to
[0062] The term "animal" is interchangeable with "subject" and may
be an invertebrate, particularly Drosophila. An animal may also be
a vertebrate, particularly a mammal, and more particularly, a
human. An animal also includes a laboratory animal in the context
of a clinical trial or screening or activity experiment.
[0063] As used herein, a "control animal" or a "normal animal" is
an animal that is of the same species as, and otherwise comparable
to (e.g., similar age, sex), the animal that is trained under
conditions sufficient to induce transcription-dependent memory
formation in that animal.
[0064] By "enhance," "enhancing" or "enhancement" is meant the
ability to potentiate, increase, improve or make greater or better,
relative to normal, a biochemical or physiological action or
effect. For example, enhancing long term memory formation refers to
the ability to potentiate or increase long term memory formation in
an animal relative to the normal long term memory formation of the
animal or controls. As a result, long term memory acquisition is
faster or better retained. Enhancing performance of a cognitive
task refers to the ability to potentiate or improve performance of
a specified cognitive task by an animal relative to the normal
performance of the cognitive task by the animal or controls.
[0065] As used herein, a "control subject" or a "normal subject" is
an animal that is of the same species as, and otherwise comparable
to (e g, similar age, sex), the animal that is being tested, e.g.,
a test subject with a neurodegenerative disorder being measured for
the expression level of at least one transposon in a biological
sample from the test subject.
[0066] The terms "inhibit," "down-regulate," or "reduce" include
decreasing expression of a gene, or level of RNA molecules or
equivalent RNA molecules encoding one or more proteins or protein
subunits, or activity of one or more gene products, proteins or
protein subunits below that observed in the absence of one or more
inhibitors, i.e., one or more transposon inhibitors, as defined
herein.
[0067] Reference will now be made to the embodiments of the present
invention, examples of which are illustrated by and described in
conjunction with the accompanying drawings and examples. While
certain embodiments are described herein, it is understood that the
described embodiments are not intended to limit the scope of the
invention. On the contrary, the present disclosure is intended to
cover alternatives, modifications, and equivalents that can be
included within the invention as defined by the appended
claims.
Compositions
[0068] Compounds, drugs, and agents, including inhibitors, in
accordance with the present invention can be administered alone, or
alternatively, in the form of pharmaceutical compositions. The
compounds (as well as compositions) of the present invention may
also be used in the manufacture of a medicament for the therapeutic
applications described herein. A pharmaceutical composition of the
invention comprises: (a) an effective amount of at least one active
agent in accordance with the invention; and (b) a pharmaceutically
acceptable excipient.
[0069] In particular embodiments, a pharmaceutical composition
comprises an apoptosis inhibitor or a transposon inhibitor, as
defined herein, or combinations thereof. A pharmaceutical
composition may also comprise other active ingredients.
Formulations and Administration
[0070] Numerous standard references are available that describe
procedures for preparing various formulations suitable for
administering the compounds according to the invention. Examples of
potential formulations and preparations are contained, for example,
in the Handbook of Pharmaceutical Excipients, American
Pharmaceutical Association (current edition); Pharmaceutical Dosage
Forms: Tablets (Lieberman, Lachman and Schwartz, editors) current
edition, published by Marcel Dekker, Inc., as well as Remington's
Pharmaceutical Sciences (Arthur Osol, editor), 1553-1593 (current
edition).
[0071] Any suitable route of administration may be employed for
providing a mammal, especially a human, with an effective dosage of
a compound of the present invention. For example, oral, rectal,
topical, parenteral, ocular, pulmonary, nasal, and the like may be
employed. Dosage forms include tablets, troches, dispersions,
suspensions, solutions, capsules, creams, ointments, aerosols, and
the like.
[0072] In some embodiments, the pharmaceutical compositions of the
present invention comprise a transposase inhibitor as an active
ingredient (or a pharmaceutically acceptable salt thereof), and may
also contain a pharmaceutically acceptable carrier and optionally
other therapeutic ingredients.
[0073] In other embodiments, the pharmaceutical compositions of the
present invention comprise an apoptosis inhibitor as an active
ingredient (or a pharmaceutically acceptable salt thereof), and may
also contain a pharmaceutically acceptable carrier and optionally
other therapeutic ingredients.
[0074] Suitable carriers, diluents and excipients are well known to
those skilled in the art and include materials such as
carbohydrates, waxes, water soluble and/or swellable polymers,
hydrophilic or hydrophobic materials, gelatin, oils, solvents,
water, and the like. The particular carrier, diluent or excipient
used will depend upon the means and purpose for which the compound
of the present invention is being applied. Solvents are generally
selected based on solvents recognized by persons skilled in the art
as safe (GRAS) to be administered to a mammal. In general, safe
solvents are non-toxic aqueous solvents such as water and other
non-toxic solvents that are soluble or miscible in water. Suitable
aqueous solvents include water, ethanol, propylene glycol,
polyethylene glycols (e.g., PEG400, PEG300), etc. and mixtures
thereof. The formulations may also include one or more buffers,
stabilizing agents, surfactants, wetting agents, lubricating
agents, emulsifiers, suspending agents, preservatives,
antioxidants, opaquing agents, glidants, processing aids,
colorants, sweeteners, perfuming agents, flavoring agents and other
known additives to provide an elegant presentation of the drug
(i.e., a compound of the present invention or pharmaceutical
composition thereof) or aid in the manufacturing of the
pharmaceutical product (i.e., medicament).
[0075] The formulations may be prepared using conventional
dissolution and mixing procedures. A compound (transposon
inhibitor) of the present invention is typically formulated into
pharmaceutical dosage forms to provide an easily controllable and
appropriate dosage of the drug.
[0076] The pharmaceutical composition (or formulation) for
application may be packaged in a variety of ways depending upon the
method used for administering the drug. Generally, an article for
distribution includes a container having deposited therein the
pharmaceutical formulation in an appropriate form. Suitable
containers are well-known to those skilled in the art and include
materials such as bottles (plastic and glass), sachets, ampoules,
plastic bags, metal cylinders, and the like. The container may also
include a tamper-proof assemblage to prevent indiscreet access to
the contents of the package. In addition, the container has
deposited thereon a label that describes the contents of the
container. The label may also include appropriate warnings.
[0077] Compounds may be systemically administered, e.g., orally, in
combination with a pharmaceutically acceptable vehicle such as an
inert diluent or an assimilable edible carrier. They may be
enclosed in hard or soft shell gelatin capsules, may be compressed
into tablets, or may be incorporated directly with the food of the
patient's diet. For oral therapeutic administration, the active
compound may be combined with one or more excipients and used in
the form of ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like. Such
compositions and preparations should contain at least 0.1% of
active compound. The percentage of the compositions and
preparations may, of course, be varied and may conveniently be
between about 2 to about 60% of the weight of a given unit dosage
form. The amount of active compound in such therapeutically useful
compositions is such that an effective dosage level will be
obtained.
[0078] The tablets, troches, pills, capsules, and the like may also
contain the following: binders such as gum tragacanth, acacia, corn
starch or gelatin; excipients such as dicalcium phosphate; a
disintegrating agent such as corn starch, potato starch, alginic
acid and the like; a lubricant such as magnesium stearate; and a
sweetening agent such as sucrose, fructose, lactose or aspartame or
a flavoring agent such as peppermint, oil of wintergreen, or cherry
flavoring may be added. When the unit dosage form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier, such as a vegetable oil or a polyethylene glycol. Various
other materials may be present as coatings or to otherwise modify
the physical form of the solid unit dosage form. For instance,
tablets, pills, or capsules may be coated with gelatin, wax,
shellac or sugar and the like. A syrup or elixir may contain the
active compound, sucrose or fructose as a sweetening agent, methyl
and propylparabens as preservatives, a dye and flavoring such as
cherry or orange flavor. Of course, any material used in preparing
any unit dosage form should be pharmaceutically acceptable and
substantially non-toxic in the amounts employed. In addition, the
active compound may be incorporated into sustained-release
preparations and devices.
[0079] The active compound may also be administered intravenously
or intraperitoneally by infusion or injection. Solutions of the
active compound or its salts can be prepared in water, optionally
mixed with a nontoxic surfactant. Dispersions can also be prepared
in glycerol, liquid polyethylene glycols, triacetin, and mixtures
thereof and in oils. Under ordinary conditions of storage and use,
these preparations contain a preservative to prevent the growth of
microorganisms.
[0080] The pharmaceutical dosage forms suitable for injection or
infusion can include sterile aqueous solutions or dispersions or
sterile powders comprising the active ingredient which are adapted
for the extemporaneous preparation of sterile injectable or
infusible solutions or dispersions, optionally encapsulated in
liposomes. In all cases, the ultimate dosage form should be
sterile, fluid and stable under the conditions of manufacture and
storage. The liquid carrier or vehicle can be a solvent or liquid
dispersion medium comprising, for example, water, ethanol, a polyol
(for example, glycerol, propylene glycol, liquid polyethylene
glycols, and the like), vegetable oils, nontoxic glyceryl esters,
and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the formation of liposomes, by the
maintenance of the required particle size in the case of
dispersions or by the use of surfactants. The prevention of the
action of microorganisms can be brought about by various
antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
many cases, it will be preferable to include isotonic agents, for
example, sugars, buffers or sodium chloride. Prolonged absorption
of the injectable compositions can be brought about by the use in
the compositions of agents delaying absorption, for example,
aluminum monostearate and gelatin.
[0081] Sterile injectable solutions are typically prepared by
incorporating the active compound in the required amount in the
appropriate solvent with various of the other ingredients
enumerated above, as required, followed by filter sterilization. In
the case of sterile powders for the preparation of sterile
injectable solutions, common methods of preparation are vacuum
drying and the freeze drying techniques, which yield a powder of
the active ingredient plus any additional desired ingredient
present in the previously sterile-filtered solutions.
[0082] For topical administration, the present compounds may be
applied in pure form, i.e., when they are liquids. However, it will
generally be desirable to administer them to the skin as
compositions or formulations, in combination with a
dermatologically acceptable carrier, which may be a solid or a
liquid.
[0083] Useful solid carriers include finely divided solids such as
talc, clay, microcrystalline cellulose, silica, alumina and the
like. Useful liquid carriers include water, alcohols or glycols or
water-alcohol/glycol blends, in which the present compounds can be
dissolved or dispersed at effective levels, optionally with the aid
of non-toxic surfactants. Adjuvants such as fragrances and
additional antimicrobial agents can be added to optimize the
properties for a given use. The resultant liquid compositions can
be applied from absorbent pads, used to impregnate bandages and
other dressings, or sprayed onto the affected area using pump-type
or aerosol sprayers.
[0084] Thickeners such as synthetic polymers, fatty acids, fatty
acid salts and esters, fatty alcohols, modified celluloses or
modified mineral materials can also be employed with liquid
carriers to form spreadable pastes, gels, ointments, soaps, and the
like, for application directly to the skin of the user.
Dosages
[0085] Useful dosages of inhibitors of the present invention,
including transposon inhibitors and apoptosis inhibitors, can be
determined by numerous means known in the art, such as comparing
their in vitro activity, and in vivo activity in animal models.
Methods for the extrapolation of effective dosages in mice, and
other animals, to humans are known to the art.
[0086] Optimal dosages to be administered in the therapeutic
methods of the present invention may be determined by those skilled
in the art and will depend on multiple factors, including the
particular composition in use, the strength of the preparation, the
mode and time of administration, and the advancement of the disease
or condition. Additional factors may include characteristics on the
subject being treated, such as age, weight, gender, and diet.
[0087] In general, however, a suitable dose will be in the range of
from about 0.01 to about 100 mg/kg, more specifically from about
0.1 to about 100/mg/kg, such as 10 to about 75 mg/kg of body weight
per day, 3 to about 50 mg per kilogram body weight of the recipient
per day, 0.5 to 90 mg/kg/day, or 1 to 60 mg/kg/day (or any other
value or range of values therein). The compound is conveniently
administered in unit dosage form; for example, containing 1 to 1000
mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of
active ingredient per unit dosage form.
[0088] The desired dose may conveniently be presented in a single
dose or as divided doses administered at appropriate intervals, for
example, as two, three, four or more sub-doses per day. The
sub-dose itself may be further divided, e.g., into a number of
temporally-distinct administrations used according to the
compositions and methods of the present invention.
[0089] Effective amounts or doses of the active agents of the
present invention may be ascertained by routine methods such as
modeling, dose escalation studies or clinical trials, and by taking
into consideration routine factors, e.g., the mode or route of
administration or drug delivery, the pharmacokinetics of the agent,
the severity and course of the disease, disorder, or condition, the
subject's previous or ongoing therapy, the subject's health status
and response to drugs, and the judgment of the treating physician.
Such compositions and preparations should contain at least 0.1% of
active compound. The percentage of the compositions and
preparations may, of course, be varied and may conveniently be
between 2 to about 60% of the weight of a given unit dosage form.
The amount of active compound in such therapeutically useful
composition is such that an effective dosage level will be
obtained. An exemplary dose is in the range of from about 0.001 to
about 200 mg of active agent per kg of subject's body weight per
day, preferably about 0.05 to 100 mg/kg/day, or about 1 to 35
mg/kg/day, or about 0.1 to 10 mg/kg/daily in single or divided
dosage units (e.g., BID, TID, QID). For a 70-kg human, an
illustrative range for a suitable dosage amount is from 1 to 200
mg/day, or about 5 to 50 mg/day.
Uses and Methods
Monitoring Neuronal Function
[0090] The present invention is partly based on the findings that
several TEs are highly active in the brain during normal aging in a
healthy subject. Accordingly, the present invention provides a
method of monitoring neuronal function during aging, comprising
measuring expression of at least one transposon in a biological
sample from a subject; and determining whether the measured
transposon expression exceeds a predetermined level.
Determining the Risk of Age-Related Neuronal Decline and
Age-Related Mortality
[0091] The present invention is also partly based on the findings
that premature TE activation leads to progressive age-related
neuronal decline and age-related mortality in otherwise normal
animals.
[0092] Accordingly, in one embodiment, the present invention
provides a method of determining the risk of age-related neuronal
decline, comprising measuring expression of at least one transposon
in a biological sample from a subject; and determining whether the
measured transposon expression exceeds a predetermined level,
wherein measured transposon expression that exceeds the
predetermined level indicates that the subject is at risk of
accelerated age-related cognitive decline.
[0093] In a second embodiment, the present invention provides a
method of determining the risk of age-related mortality, comprising
measuring the expression level of at least one transposon in a
biological sample from a subject; and determining whether the
measured transposon expression exceeds a predetermined level,
wherein measured transposon expression that exceeds the
predetermined level indicates that the subject is at risk of
accelerated age-related mortality.
Transposons
[0094] Several studies have reported somatic transposition in early
embryonic development and during neurogenesis, suggesting a
possible role in the brain (Goodier and Kazazian, Cell 2008, 135,
23-35; 2-5; Muotri et al., Nature 2010, 468, 443-446; Baillie et
al., Nature 2011, 479, 534-537; Coufal et al., Proc. Natl. Acad.
Sci. USA 2011, 108, 20382-20387). In addition, elevated expression
of certain TEs, including LINE, SINE and LTR elements, has been
observed in several neurodegenerative disorders and their animal
models, suggesting a possible role in the brain (Jeong et al.,
Clin. Virol. 2009, 47, 136-142; Lathe et al., Mol. Biol. 2009, 392,
813-822; Muotri et al., Nature 2010, 468, 443-446; Coufal et al.,
Proc. Natl. Acad. Sci. USA, 2011, 108, 20382-20387; Douville et
al., Ann. Neurol 2011, 69, 141-151; Keneko et al., Nature 2011,
471, 325-330; Tan et al., Hum. Mol. Genet. 2012, 57-65; Li et al.,
PLoS One 2012, 7, e44099).
[0095] Transposable elements (TEs), or transposons, can be grouped
into three groups, or classes, based on their overall organization
and mechanism of transposition. See, e.g., Ch. 11, Molecular
Biology of the Gene, Watson J. D., et al., 6.sup.th ed., CSHL
Press, N Y 2008. These groups comprise; (1) DNA transposons (also
referred to as DNA elements, or DNA mobile elements); (2) Long
terminal repeat (LTR) retrotransposons (also referred to as LTR
transposons, LTR elements, and virus-like (retro)transposons; and
(3) non-LTR retrotransposons (also referred to as non-viral
(retro)transposons, or poly(A) retrotransposons).
[0096] Collectively, LTR elements and non-LTR elements comprise
retroelements, which are able to amplify to new locations in the
genome through an RNA intermediate. Retroelements represent
approximately 40% of the human genome, while DNA transposons
account for about 2-3%. See, e.g., Lander et al., 2001, Nature 409,
860-921; Hua-Van et al., 2011, Biol. Dir. 6, 19. These three groups
will now be described in more detail.
DNA Transposons
[0097] DNA transposons have sequences that function as
recombination sites. These sites are at the two ends of the DNA
element, are organized as inverted-repeat sequences, and carry the
recognition sequences for recombination. DNA transposons can also
carry genes encoding proteins responsible for transposition
(usually called transposases, or sometimes, integrases). DNA
transposons can exist as both autonomous elements (carrying a pair
of inverted terminal repeats and a transposases gene), which have
everything needed to promote their own transposition; and
nonautonomous elements (carrying only the inverted terminal
repeats), which depend on a "helper" transposon to donate the
transposases needed for transposition.
[0098] DNA elements can move by non-replicative and replicative
mechanisms. The non-replicative recombination pathway is called
cut-and-past transposition, because it involves excision of the
transposon from its initial location in the host DNA, followed by
integration of the excised transposon into a new DNA site. The
replicative recombination pathway involves the duplication of the
element DNA during each round of transposition.
LTR Retrotransposons
[0099] LTR retrotransposons, which include retroviruses, make up a
significant fraction of the typical mammalian genome, comprising
about 8% of the human genome and 10% of the mouse genome. (Lander
et al., 2001, Nature 409, 860-921; Waterson et al., 2002, Nature
420, 520-562.) LTR elements include retrotransposons, endogenous
retroviruses (ERVs), and repeat elements with HERV origins, such as
SINE-R. LTR retrotransposons include two LTR sequences that flank a
region encoding two enzymes: integrase and reverse transcriptase
(RT).
[0100] ERVs include human endogenous retroviruses (HERVs), the
remnants of ancient germ-cell infections. While most HERV
proviruses have undergone extensive deletions and mutations, some
have retained ORFS coding for functional proteins, including and
the glycosylated env protein. The env gene confers the potential
for LTR elements to spread between cells and individuals. Indeed,
all three open reading frames (pol, gag, and env) have been
identified in humans, and evidence suggests that ERVs are active in
the germline. See, e.g., Wang et al., 2010, Genome Res. 20, 19-27.
Moreover, a few families, including the HERV-K (HML-2) group, have
been shown to form viral particles, and an apparently intact
provirus has recently been discovered in a small fraction of the
human population. See, e.g., Bannert and Kurth, 2006, Proc. Natl.
Acad. USA 101, 14572-14579.
[0101] LTR retrotransposons insert into new sites in the genome
using the same steps of DNA cleavage and DNA strand-transfer
observed in DNA transposons. In contrast to DNA transposons,
however, recombination of LTR retrotransposons involves an RNA
intermediate. LTR retrotransposons make up about 8% of the human
genome. See, e.g., Lander et al., 2001, Nature 409, 860-921;
Hua-Van et al., 2011, Biol. Dir. 6, 19.
Non-LTR Retrotransposons
[0102] A non-LTR element terminates in 5' and 3' untranslated
region (UTR) sequences and encodes two enzymes: ORF1, an
RNA-binding enzyme; and ORF2, an enzyme having both reverse
transcriptase and endonuclease activities. Like LTR
retrotransposons, non-LTR retrotransposons also move via an RNA
intermediate. But the mechanism for mobilization of non-LTR
retrotransposons--which is target-site primed reverse transcription
(or "reverse splicing")--is different from the mechanism used for
transposition by LTR retroelements.
[0103] Non-LTR retrotransposons include nonautonomous elements,
such as Alu elements and SVA (SINE-VNTR-Alu) elements. Non-LTR
transposons also include autonomous elements, such as LINEs ("long
interspersed nuclear elements). LINEs are abundant in the
vertebrate genome, comprising about 20% of the human genome.
LINE-like elements, such as R1 and R2, are also present in
invertebrates such as Drosophila.
[0104] A well-studied LINE in humans is L1, which so far appears to
be the only active autonomous retrotransposon in the human genome.
However, LINEs such as L1 can donate the proteins necessary to
reverse-transcribe and integrate another related class of
repetitive sequences: the nonautonomous poly(A) retrotransposons
known as SINEs ("short interspersed nuclear elements). Genome
sequences reveal the presence of huge numbers of SINEs, which are
typically between 100 and 400 bp in length. The Alu sequence is an
example of a widespread SINE in the human genome. The nonautonomous
Alu elements, as well as processed pseudogenes, are retrotransposed
in trans by the L1 retrotransposition proteins. Indeed, greater
than 30% of the human genome has been generated through
retrotransposition of LINE elements and other RNA species by the
LINE reverse transcriptase. (Cordaux and Batzer, 2009, Nat. Rev.
Genet. 10, 691-703). Retrotransposition is ongoing in human
populations as indicated by de novo L1, Alu, and SVA insertions
associated with disease and by the large number of polymorphic
insertions, many of which are at a low allele frequency in human
genomes. See, e.g., Pickeral et al., 2000, Genome Res. 21, 985-990;
Beck et al., 2010, Cell 141, 1159-1170; Huang et al., 2010, Cell
141, 1171-1182; Hormozdiari et al., 2011, Genome Res. 21,
840-849.
Delaying Age-Related Neuronal Decline and Age-Related Mortality
[0105] The present invention is also based on the discovery that
selectively disrupting somatic TE control in Drosophila accelerates
the age-dependent increase in TE transcripts (R2 and gypsy) and ENV
protein. The R2 and gypsy transcript levels in 2-4 day old
accelerated animals are comparable to that seen in .about.28 day
wild-type animals. In addition, TE activation is correlated with
age-dependent neuronal decline, as indicated by a deficit in
long-term memory. The present invention is also based on the
discovery that genetic manipulations--using an RNAi transgene to
target loki, the Drosophila ortholog of chk2 exclusively in neurons
in wild-type animals significant delays age-dependent mortality and
also yields a modest but significant delay in age-dependent memory
impairment.
[0106] Hence the present invention includes the use of a
transposase inhibitor or an apoptosis inhibitor to delay
age-related neuronal decline or age-dependent mortality.
[0107] Accordingly, in one embodiment, the present invention
includes steps and methods of delaying age-related neuronal
decline, comprising administering to a subject in need of such
treatment an effective amount of a transposon inhibitor.
[0108] Accordingly, in another embodiment, the present invention
includes steps and methods for delaying age-related neuronal
decline and age-dependent mortality, comprising administering to
administering to a subject in need of such treatment an effective
amount of an apoptosis inhibitor
Transposon Inhibitors
[0109] In some embodiments, the methods of the present invention
include administering to a subject an effective amount of a
transposon inhibitor. In a general aspect, a transposon inhibitor
can be an inhibitor of TE expression, such as an inhibitor of
transcription of an LTR transposon. In another aspect, a transposon
inhibitor can be an inhibitor of TE mobilization, for example,
prevent a TE from inserting into a new position in the genome.
[0110] In some embodiments, a transposon inhibitors include an
inhibitor of a protein encoded by a transposon. More particularly,
the protein encoded by the transposon can be a transposase; an
integrase; a reverse transcriptase; an endonuclease; a protein
encoded by gag, pol, or env; an enzyme encoded by ORF1 of a non-LTR
retrotransposon, or an enzyme encoded by ORF2 of a non-LTR
transposon.
[0111] Transposon inhibitors also include, but are not limited to,
anti-retroviral drugs (such as AZT, abacavir, etravirine, or
raltegravir); compounds that decrease TE RNA stability; inhibitors
of reverse transcription, including nucleoside analog inhibitors
(NRTIs) such as ddI, ddC, and stavudine, nucleotide analog
inhibitors (NtRTIs) such as tenofovir and adeforvir, and
non-nucleoside inhibitors (NNRTIs) such as nevirapine and
efavirenz; inhibitors of transposase or integrase activity,
inhibitors of endonuclease activity, and stimulators of DNA repair
machinery, such as doxorubicin and phleomycin.
[0112] Furthermore, a transposon inhibitor can include: a
zinc-finger protein ("zinc finger") that targets a transposon
promoter region; a repressor that inhibits a transposon; an innate
antiretroviral resistance factor, such as cAPOBEC3A or APOBEC3B,
two members of the APOBEC3 family in humans--which can enter the
nucleus and specifically inhibit both LINE-1 and Alu
retrotransposition (see, e.g., Bogerd et al., 2006, Proc. Natl.
Acad. Sci. USA 103, 8780-8785). Transposon inhibitors can also
include small interfering RNAs (siRNAs), short hairpin RNA
(shRNAs), morpholinos, and antisense oligonucleotides directed to
TE transcripts; and inhibitors of post-translational processing or
proteolysis of a transposon-encoded protein, such as the Env
protein encoded by some LTR retrotransposons. They also include
enzymes or repressors that inhibit TEs, for example, an enzyme that
inhibits L1 (such as the protein APOBEC3G) or a repressor that
inhibits L1 (such as MePC2 or Sox2).
[0113] Transposon inhibitors also include compounds that block
transmission of a retroviral particles. For example, they may block
binding of env-containing transposon particles to the corresponding
receptor for the Env protein.
[0114] More generally, transposon inhibitors include compounds that
prevent the spread of TEs between cells, i.e., that block
intercellular transmission of transposon genetic material or
protein. For example, inhibitors may be directed to the formation,
transport, and movement of transposon RNAs in exosomes. Exosomes
are formed by inward budding of late endosomes, producing
multivesicular bodies (MVBs), and are released into the environment
by fusion of the MVBs with the plasma membranes. Moreover, exosomes
released from cells can contain messenger RNA (mRNA) and microRNA
(miRNA) and can shuttle such RNAs and proteins from one cell to
another. Exosomes can therefore be transported between different
cells and influence physiological pathways in the recipient cells.
See, e.g., Bang and Thum, 2012, Int. J. Biochem. Cell Biol. 10,
2060-2064.
[0115] Transposon inhibitors also include inhibitors of cellular
receptors of endogenous retrovirus (ERV) movement, including, but
not limited to, ephrins and ephrin receptors, including members of
the Ephrin A family. (Stoye, Nat. Rev. Microbiol. 2012, 10,
395-406; Dewannieux et al., PLoS Pathog. 2011, 10, e1002309;
Apoptosis Inhibitors
[0116] As defined herein, an "apoptosis inhibitor" is a compound,
agent, or drug that prevents or inhibits apoptosis, i.e.,
programmed cell death. As used herein, "apoptosis" refers to the
art recognized use of the term for an active process of programmed
cell death characterized by morphological changes in the cell. More
particularly, apoptosis is a genetically programmed cellular event
characterized by well-defined morphological features that include
as cell shrinkage, chromatin condensation, nuclear fragmentation,
and membrane blebbing. (Kerr et al., Br. J. Cancer 1972, 26,
239-257; Wyllie et al., Int. Rev. Cytol. 1980, 68, 251-306. It
plays an important role in normal tissue development and
homeostasis, and defects in the apoptotic program are thought to
contribute to a wide range of human disorders ranging from
neurodegenerative and autoimmunity disorders to neoplasms.
(Thompson, Science 1995, 267, 1456-1462; Mullauer et al., Mutat.
Res. 2001, 488, 211-231).
[0117] One group of proteins that plays a key role in apoptosis is
a family of cysteine proteases, termed caspases, which appear to be
required for most pathways of apoptosis. Creagh & Martin (2001)
Biochem. Soc. Trans, 29, 696-701; Dales et al. (2001) Leuk.
Lymphoma, 41, 247-253. Caspases trigger apoptosis in response to
apoptotic stimuli by cleaving various cellular proteins, which
results in classic manifestations of apoptosis, including cell
shrinkage, membrane blebbing and DNA fragmentation. Chang &
Yang (2000) Microbiol. Mol. Biol. Rev., 64, 821-846.
[0118] Pro-apoptotic proteins, such as Bax or Bak, also play a key
role in the apoptotic pathway by releasing caspase-activating
molecules, such as mitochondrial cytochrome c, thereby promoting
cell death through apoptosis. Martinou & Green (2001) Nat. Rev.
Mol. Cell. Biol., 2, 63-67; Zou et al. (1997) Cell, 90, 405-413.
Anti-apoptotic proteins, such as Bcl-2, promote cell survival by
antagonizing the activity of the pro-apoptotic proteins, Bax and
Bak. Tsujimoto (1998) Genes Cells, 3, 697-707; Kroemer (1997)
Nature Med., 3, 614-620. The ratio of Bax:Bcl-2 is thought to be
one way in which cell fate is determined; an excess of Bax promotes
apoptosis and an excess of Bcl-2 promotes cell survival. Salomons
et al. (1997) Int. J. Cancer, 71, 959-965; Wallace-Brodeur &
Lowe (1999) Cell Mol. Life Sci., 55, 64-75.
[0119] Another key protein involved in apoptosis is that encoded by
the tumor suppressor gene p53. This protein is a transcription
factor that regulates cell growth and induces apoptosis in cells
that are damaged and genetically unstable, presumably through
up-regulation of Bax. Bold et al. (1997) Surgical Oncology, 6,
133-142; Ronen et al., 1996; Schuler & Green (2001) Biochem.
Soc. Trans., 29, 684-688; Ryan et al. (2001) Curr. Opin. Cell
Biol., 13, 332-337; Zornig et al. (2001) Biochem. Biophys. Acta,
1551, F1-F37.
[0120] In accordance with the present invention, an apoptosis
inhibitor can prevent programmed cell death by multiple mechanisms.
These include, for example, antagonists directed to pro-apoptotic
proteins such as a caspase, Bak, and Bax, and agonists directed to
anti-apoptotic proteins such as Bcl-1. An apoptosis inhibitor also
include stimulators of the DNA repair machinery, as well as
endogenous inhibitors of apoptosis, such as those in human IAP
(Inhibitor of Apoptosis) family, whose members include Cp-IAP,
Op-IAP, XIAP, c-IAP1, c-IAP2, NAIP, and surviving.
[0121] Other apoptosis inhibitors are known in the art. See, e.g.
U.S. Pat. No. 8,242,122, WO/1999/025346, US20110028491,
[0122] In a specific embodiment, the apoptosis inhibitor is an
inhibitor of a protein that mediates DNA damage-induced apoptosis,
such as an inhibitor of a checkpoint kinase, or an inhibitor of
Checkpoint kinase 2 specifically.
[0123] A pharmaceutical composition may also comprise a mixture of
apoptosis inhibiting compounds.
Recombinant Nucleic Acids, Cells, and Transgenic Animals
[0124] The present invention is also based on the discovery of a
system for detecting de novo transposition events in an aging
animal, including in the adult brain. Accordingly, the present
invention a recombinant nucleic acid sequence for detecting de novo
TE integration events, comprising a promoter region; a reporter
gene operably linked to the promoter; and a fragment inserted
between the promoter and reporter gene, wherein the fragment
comprises binding sites that are necessary and sufficient to
attract de novo TE insertions, and does not itself does not disrupt
expression of the reporter gene. In a specific aspect, the reporter
gene encodes an expression disrupter, which can include GAL80. In
another aspect, the fragment is an ovo regulatory region containing
multiple Ovo binding sites.
[0125] The present invention also include a cell comprising any of
the disclosed recombinant nucleic acid sequences. Such a cell may
also include a second recombinant nucleic acid sequence, comprising
a second promoter region operably linked to a second reporter gene,
wherein expression of the second reporter gene is blocked by the
expression disruptor. In a particular aspect, expression of the
second reporter gene is mediated by GAL4. The invention also
includes a transgenic animal, including a transgenic vertebrate or
transgenic Drosophila, comprising any of the recombinant nucleic
sequences herein (or cell that contains any of them).
EXAMPLES
[0126] The present disclosure will be further illustrated by the
following non-limiting Examples. These Examples are understood to
be exemplary only, and they are not to be construed as limiting the
scope of the invention as defined by the appended claims.
Methods
Fly Stocks
[0127] The wild type flies utilized in this study were w1118
(isoCJ1), a Canton-S derivative 21. The dAgo2 mutants and
UAS::dAgo2 transgenic strains were backcrossed to the above wild
type strain for at least five generations. Flies were cultured in
standard fly food and laboratory room temperature (22.5.degree.
C.).
[0128] The "gypsy-TRAP" transgenic flies were made by cloning a
.about.500 bp Ovo binding site (Labrador et al., Genetics, 2008,
180, 1367-1378) into the NotI site between Tubulin promoter and
GAL80 gene in the Tubp-GAL80 in pCaSpeR4 plasmid. The resulting
construct was injected into w1118 (isoCJ1) recipient embryos and
transformant lines were isolated by standard procedures at the
BestGene, Inc. The mutated "gypsy-TRAP" transgenic flies were made
by injecting a similar construct bearing mutations in Ovo binding
sites (Labrador et al., Genetics, 2008, 180, 1367-1378). The MB247,
Repo and Elav-Gal4 lines are as reported previously.
Behavioral Assays
[0129] Aversive Pavlovian olfactory task was performed by training
flies in a T-maze apparatus using a Pavlovian conditioning
paradigm. More particularly, proximately 50-100 flies were loaded
into an electrifiable training grid. For a single training session,
flies were exposed sequentially to one odor (the conditioned
stimulus, CS+), which was paired with a 60-volt electric shock and
then a second odor (the unconditioned stimulus, CS-) without shock.
Two minutes after this training session, the flies were tested and
allowed to choose between the two odors. A half performance index
was calculated by dividing the number of flies that chose
correctly, minus the flies that chose incorrectly by the total
number of flies in the experiment. The same protocol was then
performed with another group of 50-100 flies and reciprocal odor
presentation. The final PI was calculated by averaging both
reciprocal half PIs.
[0130] The long-term-memory (LTM) experiment was an adaptation of
this training protocol. Flies were subjected to ten such training
sessions in robotic trainers spaced out with a 15-minute rest
interval between each. Flies then were transferred into food vials
and incubated at 18.degree. C. until being tested 24 hours after
the training. All genotypes were trained and tested in parallel,
and rotated between all the robotic trainers to ensure a balanced
experiment. Odor pairs and concentrations used for these behavior
paradigms are: 3-Octanol (1.5.times.10-3 v/v) and
4-Methylcyclohexanol (1.times.10-3 v/v), or, 3-Octanol
(1.5.times.10-3 v/v) and Benzaldehyde (0.5.times.10-3 v/v). Pure
odors were purchased from Sigma and delivered as the stated
concentrations with air flow at 750 ml/min. In all cases, behavior
experiments within a figure were performed in parallel. Behavioral
data are normally distributed and are shown as means.+-.SEM.
One-Way ANOVA and post-hoc analyses were performed.
Lifespan
[0131] Lifespan were measured with .about.50-150 animals/genotype.
Equal numbers of male and female flies were used for each genotype.
Survival analyses were performed with the Kaplan-Meier Method.
Log-rank test and Gehan-Breslow-Wilcoxon test were used to compare
survival curves. Pair-wise comparisons were made with Bonferroni
corrections.
QPCR
[0132] The QPCR was performed according to the assay manual. In
brief, massive numbers of fly heads were collected for each
genotype and total RNA was purified with Trizol (Invitrogen) and
treated by DNaseI (Promega). Total RNA concentrations were
determined using a NanoDrop ND-1000 spectrophotometer. For the
reverse transcription (RT) reaction, each 20 .mu.l RT reaction was
performed with 2 .mu.g total RNA using the High capacity RNA-tocDNA
kit (Applied Biosystems). The QPCR reactions for each assay were
carried out in duplicate, and each 20 .mu.l reaction mixture
included 1 .mu.l previous RT products. The QPCR reaction was
carried out and analyzed in an Applied Biosystems 7900HT Fast
Real-Time PCR System in 96-well plates at 95.degree. C. for 10 min,
followed by 40 cycles of 95.degree. C. for 15 sec and 60.degree. C.
for 1 min. Linearity tests were performed on all custom designed
primers and probes to ensure linearity.
Custom TaqMan Probes
[0133] All TaqMan.RTM. Gene Expression Assays (Applied Biosystems)
utilized the FAM Reporter and MGB Quencher. TaqMan.RTM. probes for
each transcript were designed following the vendor's custom assay
design service manual. The customized gene-specific Taqman probes
and inventoried Taqman probes had the following sequences and Assay
IDs:
TABLE-US-00001 R1-ORF2 (Assay ID AID1TD0, FBgn0003908): (SEQ ID NO:
1) probe: 5'-ACATACGCCATAATCTG-3' Blood-ORF2 (assay ID AIFARJ8,
FBgn0000199) (SEQ ID NO: 2) Probe: 5'-TCGGTGCATAACTTAGTTAGTTCA-3'
GypsyORF2 (Assay ID AI5IO6V, FBgn0001167) (SEQ ID NO: 3) Probe:
5'-AAGCATTTGTGTTTGATTTC-3' Gypsy4-ORF2 (AID1TGU, FBgn0063433) (SEQ
ID NO: 4) Probe: 5'-CCCGATCTGGGTTGTC-3' ZAM-ORF2 (Assay IDAICSVAM,
FBgn0023131) (SEQ ID NO: 5) Probe: 5'-CCCCATGATTAGTCTTTACTG-3'
1731-ORF2 (Assay ID AICSU7S, FBgn0000007) (SEQ ID NO: 6) Probe:
5'-AAGCTGAAGACTGATTTATG-3' 297-ORF2 (Assay ID AI70LJB, FBgn0000005)
(SEQ ID NO: 7) Probe: 5'-TTGATCAAACATACAAATTAATTAC-3' R25' (Assay
ID AJ0IV12, FBgn0003909) (SEQ ID NO: 8) Probe:
5'-GAATGCCATTCCAAATGGAGAGCCC-3' R23' (Assay ID AJY9XVU,
FBgn0003909) (SEQ ID NO: 9) Probe: 5'-TAGAAAAATATTGGGCGAACAAGTT-3'
DBV (Assay ID AIV13YJ) (SEQ ID NO: 10) Probe:
5'-CCTATTAGTGATCCGCTCGCG-3' DTRV (Assay ID AIS07L3) (SEQ ID NO: 11)
Probe: 5'-CTTCGATCCGAGGTATGC-3' DAV (Assay ID AIX00AZ) (SEQ ID NO:
12) Probe: 5'-AAGGTAGTAGGTTACATTTGTC-3' Sigma V (Assay ID AIWR14R)
(SEQ ID NO: 13) Probe: 5'-CCGTAGTCCGATGGTTCC-3' Nora V (Assay ID
AIQJA9N) (SEQ ID NO: 14) Probe: 5'-CTGAGGCTTCTCTTGTTTAAT-3' DCV
(Assay ID AIPAC3F) (SEQ ID NO: 15) Probe: 5'-TTGTCGACGCAATTCTT-3'
DXV (Assay ID AIRR9FV) (SEQ ID NO: 16) Probe:
5'-TCATAGATGATGTCAAATTT-3' ANV (Assay ID AIT95SB) (SEQ ID NO: 17)
Probe: 5'-CAGACAATTTCTCAGAATCAT-3' Act5C (Assay ID Dm02361909_s1)
Loki (Assay ID Dm01811114_g1) Ago2 (Assay ID Dm01805432_g1 and
Dm01805433_g1) Dcr-2 (Assay ID Dm01821537_g1 and Dm01821540_g1)
Western Blots
[0134] Approximately 15 adult fly heads per sample were homogenized
in 20 .mu.l Nupage@ sample loading buffer, heated to 95.degree. C.
for 5 min and 10 .mu.l loaded onto Nupage@ 4-12% Bis-Tris gels,
then transferred to PVDF membrane (Invitrogen) and blotted by
standard protocols.
[0135] Primary antibodies used were anti-tubulin (1:10,000, E7,
Developmental Studies Hybridoma Bank), anti-ENV (1:5000). The
WesternBreeze.RTM. Chemiluminescent Kit-Anti-Mouse system was used
to visualize the blotted bands on films.
Bleach Treatment of Embryos
[0136] In order to remove virus infection in fly stocks, 2 hr
embryos from wild type controls and dAgo2 mutants were collected
and treated with 50% bleach 2 times for 20 minutes each. Treated
embryos were then grown in a virus free clean room equipped with UV
lamps to sterilize surfaces. Expanded fly stocks after bleach
treatment are proven to be virus-free. All strains also were grown
on a rotating set of 6 antibiotics.
Immunohistochemistry and GFP Imaging
[0137] Dissection, fixation, immunolabeling and confocal imaging
acquisition were performed as previously described (Qin, et al.,
Curr. Biol. 2012, 22, 608-614). Ascites containing anti-gypsy ENV
monoclonal antibody (mAb) was prepared from the anti-gypsy ENV 7B3
hybridoma cell line (Chen at al., PLoS Comput. Biol. 2008, 4,
e10000026). A 1:100 dilution of ENV primary mAb and a 1: 200
dilution of secondary antibody of Cy3-conjugated goat anti-mouse
IgG were used. 2 .mu.M DilC18(5)-DS lipophilic dye solution
(Molecular Probes) was used to label cell membranes throughout the
brain as counterstaining. For Env immunolabeling, multiple brains
of each genotype and age were imaged. Representative images are
shown in the Figures. Total numbers imaged for wild type were: 6
(0-4 day), 14 (14 day), 16 (21-28 day), 4 (70 day). For
dAgo2.sup.414, total number imaged were: 8 (14 day), 7 (21-28 day).
For dAgo2.sup.-51b, total number imaged were: 5 (0-4 day), 6 (14
day), 6 (21-28 day), 3 (70 day). For dAgo2.sup.454, total number
imaged were 9 (0-4 day), 13 (14 day), 6 (21-28 day).
Nested PCR
[0138] DNA was extracted from .about.300 fly heads of the indicated
ages. Standard PCR was performed in nested fashion with the first
round of PCR utilizing primer 1 and 3 followed by a second round of
PCR with primer 2 and 4. Primer sequences are listed below. Nested
PCR was then run on 0.9% agarose gel (Sigma) and the product size
was estimated according to 1 kb plus DNA ladder (Invitrogen). The
PCR product was then gel purified using illustra GFX PCR DNA and
Gel Band Purification Kit from GE Healthcare. The fragment was
cloned using the TOPO TA Cloning Kit for sequencing from Invitrogen
and sequenced by ELIM BIOPHARM using the Sanger sequencing method.
MacVector was used to display sequencing results.
TABLE-US-00002 Primers Primer 1 - CAACTCTGCACCCACGACTA (SEQ ID NO:
18) Primer 3 - CAGCGGAAAGCTGACACTTC (SEQ ID NO: 19) Primer 2 -
CACACACCCATGGAATTGAA (SEQ ID NO: 20) Primer 4 -
GGCTCATTGCCGTTAAACAT (SEQ ID NO: 21)
Statistical Testing
[0139] Behavioral data from the Pavlovian memory task are normally
distributed (Tully et al., Cell, 1994, 79, 35-47) and are shown in
all Figures as means.+-.SEM. For these data, one-Way ANOVA and
post-hoc analyses were performed. For the life-span curves,
survival analyses were performed with the Kaplan-Meier Method.
Log-rank test and Gehan-Breslow-Wilcoxon test were used to compare
survival curves. Pair-wise comparisons were made with Bonferroni
corrections.
Example 1
Age-Dependent TE Expression and
[0140] TE expression was first examined in Drosophila, where it is
feasible to manipulate the TE control mechanisms and to measure
physiological effects on the nervous system. Quantitative Real-Time
PCR (QPCR) was used to measure levels of several TE transcripts in
head tissues during normal aging by comparing transcript levels
from 2-4-day old adult wild-type flies with that of .about.14,
.about.21 and .about.28-day old counterparts. Surprisingly,
transcripts from R2 (a LINE-like element) and gypsy (an LTR
element) are dramatically elevated in aged relative to young
animals (FIG. 1A). R1, a second LINE-like element also shows
elevated expression with age (see below). Although these studies
have not exhaustively examined expression of the TE families in the
Drosophila genome, the age-dependent expression may impact certain
TEs specifically because not see effects were seen on gypsy4 or Zam
(data not shown).
[0141] In addition to the effects on transcripts from gypsy, R1 and
R2, an age-dependent increase in expression of the gypsy membrane
glycoprotein ENV was detected, using immunohistochemical staining
in whole mount brains (FIG. 1B). The ENV signal is most intense in
the cortical regions that contain most of the cell bodies, but also
is detected in neuropil, areas containing axons and dendrites
(central brain projections shown in FIG. 1B; see also individual
confocal sections FIGS. 3B and 8B).
[0142] This age-dependent derepression of TEs was not due to loss
of expression of either Dicer-2 or dAGO2, proteins required for TE
silencing in somatic tissues 14 (FIG. 4). To determine if
expression of gypsy in older animals is associated with physical
transposition, a "gypsy-TRAP" reporter system was designed to
detect de novo gypsy integration events. This was accomplished by
adapting a reporter system previously established for detecting
gypsy integration in the germline (Labrador, et al. Genetics 180,
2008, 108, 1367-1378). This was achieved by expressing GAL80, which
is an effective repressor of GAL4, under control of the ubiquitous
.alpha.-tubulin promoter. In the presence of GAL80 protein,
GAL4-mediated expression of GFP is effectively silenced. A
.about.500 bp fragment from the ovo regulatory region was placed
between the promoter and GAL80 in order to attract gypsy
insertional mutations (FIG. 5A). This fragment contains 5 Ovo
binding sites to which the Ovo protein normally binds in its own
regulatory region. In the germline, these Ovo binding sites are
necessary and sufficient to attract de novo gypsy insertions
(Labrador, et al. Genetics 180, 2008, 108, 1367-1378). In the
reporter system of the present invention, somatic integration of
gypsy downstream of the promoter or within the GAL80 transcription
unit disrupts expression of GAL80, permitting activation of GFP by
GAL4 (FIG. 2B).
[0143] This system was used to screen for de novo gypsy integration
events in the brain by focusing on neurons of the mushroom body
(MB) for which highly specific and strongly expressing GAL4 lines
exist. We used the MB247 GAL4 line16, which is known to label about
800 out of .about.2000-2500 mushroom body Kenyon cell neurons per
brain hemisphere (FIG. 2A). GAL80 expression from "gypsy-TRAP"
(Tubp-OvoSite-GAL80) transformant lines is sufficient to silence
GFP (FIGS. 2 and 5). In fact, no labeled neurons were observed in
2-4-day old animals containing this construct (0/26 brains from 2-4
day old animals, FIGS. 2B, 2C, 5). However, sparse GFP-labeled MB
Kenyon cells were observed at later ages in each of two
transformant lines containing "gypsy-TRAP" (Tubp-OvoSite-GAL80),
often in multiple neurons (14/39 brains labeled from 28-35 day old
animals, FIGS. 2E, 5). This effect of age was statistically
significant (Chi-square Analysis, p<0.01). The labeling appears
to be stochastic because both intra and inter-hemisphere variation
was seen.
[0144] The accumulation of GFP positive neurons also requires the 5
Ovo binding sites, as is true for gypsy insertions in the germline,
because there were no observed GFP-labeled cells in control
transformant lines containing a "gypsy-TRAP" with an ovo fragment
in which the binding sites are mutated (Tubp-MutatedOvoSite-GAL80)
(FIGS. 2B; 5; Chi-square Analysis, p<0.001). The results using
this reporter system strongly support the conclusion that gypsy not
only is expressed in neurons of aging animals, but also is actively
mobile in an age dependent manner.
[0145] These results from this analysis of mutated and non-mutated
"gypsy-TRAP" transgenic lines are summarized in Table 1:
TABLE-US-00003 TABLE 1 2-4-day ~14-day ~21-day 28-35-day mutated
gypsy "TRAP" transformant line #1 .sup. 0/15.sup.(1) 0/4 0/9 0/11
transformant line #2 0/8 0/2 -- 0/3 gypsy "TRAP" transformant line
#1 0/15 0/1 -- .sup. 4/16.sup.(2) transformant line #2 0/11 .sup.
2/3.sup.(1) 1/6 10/23
Example 2
Premature TE Activation in Young Animals Leads to Age-Dependent
Neuronal Decline and Reduced Life-Span
[0146] The dAgo2 gene was genetically manipulated to create a
situation in which transposons are unleashed prematurely in young
animals. In both animals and plants, TE control is mediated by
Argonaute proteins guided by small regulatory RNAs (Czech and
Hannon, Nat Rev Genet, 2011, 12, 19-31). Germline tissues are
protected against TEs by the concerted action of Argonaute proteins
of the PIWI clade and their small RNA partners, the piRNAs (Czech
et al., Nat Rev Genet, 2003, 12, 19-31).
[0147] While control of TEs in somatic tissues in Drosophila is
dependent on dAGO2 guided by endogenous small interfering RNAs, a
different Argonaute protein in flies, dAGO1, preferentially loads
the microRNAs that target cellular mRNAs, but has no known impact
on TEs. Therefore, using dAgo2 mutants creates condition allowing
selective disruption of the somatic TE control mechanism. Although
dAgo2 mutants have been shown to exhibit elevated TE expression in
somatic tissue, the phenotypic consequences of such mutations on
aging are not known.
[0148] Transcripts from R2 and gypsy were significantly elevated in
head tissue of young dAgo.sup.2414 and dAgo.sup.251B mutant
animals, as well as in trans-heterozygous dAgo.sup.2414/251B
animals (FIGS. 7A and 3A). In addition, the age-dependent elevation
of both R2 and gypsy expression is accelerated in the dAgo2 mutants
such that transcript levels of both R2 and gypsy in 2-4-day old
mutant animals are comparable to that seen in .about.28-day old
wild type animals. At the protein level, the results revealed an
accelerated age dependent increase in ENV in dAgo2 mutants (the
dAgo.sup.2414 and dAgo.sup.251B hypomorphic alleles and the
dAgo.sup.2454 null allele) both in whole mount brains (FIGS. 3B and
8B) and on western blots from adult heads (FIGS. 3C and 8A).
Furthermore, elevated expression of gypsy in dAgo2 mutants also is
associated with de novo insertions into the ovo locus, as detected
by genomic PCR and sequencing (FIG. 6).
[0149] To investigate the correlation between age-dependent
neuronal decline and TE activation, a robust and sensitive
Pavlovian learning and memory assay was used that is well
established in Drosophila (Dubnau and Chiang, Curr. Opin.
Neurobiol. 2013, 23, 84-91. The assay compared 24-hour LTM
performance in animals that were trained when they were young
(2-4-day) or trained versus when they were at an intermediate age
(.about.20-day). dAgo2 mutants already exhibit a partial reduction
in memory at 2-4-days old (FIGS. 7C, 7D, 3D), an effect which can
be rescued by neuronal expression of a dAgo2 transgene (FIG. 7E).
The mild defect seen in young animals becomes dramatically worse in
20-day old adults (FIG. 3D). In contrast, wild-type animals trained
at the .about.20-days age exhibited normal robust levels of LTM
that are equivalent to that seen in 2-4-day old wild type animals
(FIG. 3D), only developing impairment at .about.28-day of age (FIG.
10B).
[0150] The effects of dAgo2 mutations on longevity were also
examined, revealing that dAgo2414, dAgo251B and dAgo2454 mutants
exhibited significantly shorter lifespans than their wild type
counterparts (FIGS. 3E and 8C). This finding is consistent with
reports that mutations in Dicer-218 and loquacious (Liu et al.,
Nature, 2012, 482, 519-523) other components of the somatic small
RNA-dependent TE silencing pathway, also exhibit short lifespan.
Although dAgo2 mutants are susceptible to exogenous viruses, viral
infections do not contribute to the age-dependent decline in these
mutants an do not cause the observed induction of transposons (FIG.
9).
Example 3
Inhibiting DNA Damage-Induced-Apoptosis Delays Mortality and
Age-Dependent Memory Impairments
[0151] TE activation in the germline is sufficient to cause
sterility, at least in part by triggering Checkpoint kinase 2
(Chk2)-mediated DNA damage-induced apoptosis. In fact, disruption
of Chk2 in the germline prevents cells from undergoing programmed
cell death, which is sufficient to suppress TE dependent sterility
(Chen et al., Curr Biol, 2007, 17, 637-642).
[0152] To test whether DNA-damage leading to Chk2 signaling also
contributes to age dependent mortality in wild type animals, we
used an RNAi transgene to target loki, the Drosophila ortholog of
chk2. Remarkably, disrupting loki function exclusively in neurons
by expressing the lokiRNAi under control of the pan-neuronal
elav-GAL4 can significantly delay mortality (FIGS. 10A and 3F).
Moreover, this disruption of loki function also yields a modest but
significant delay in age dependent memory impairment (FIGS. 10B and
10C). These observations are consistent with a causal role for TE
activation and TE-induced DNA damage in age-related neuronal
decline.
[0153] The specification, including the examples, is intended to be
exemplary only, and it will be apparent to those skilled in the art
that various modifications and variations can be made in the
present invention without departing from the scope or spirit of the
invention as defined by the appended claims. Furthermore, while
certain details in the present disclosure are provided to convey a
thorough understanding of the invention as defined by the appended
claims, it will be apparent to those skilled in the art that
certain embodiments may be practiced without these details.
Moreover, in certain instances, well-known methods, procedures, or
other specific details have not been described to avoid
unnecessarily obscuring aspects of the invention defined by the
appended claims.
[0154] While certain embodiments are described herein, it will be
understood that the described embodiments are not intended to limit
the scope of the invention as defined by the appended claims. On
the contrary, the present disclosure is intended to cover
alternatives, modifications and equivalents that may be included
within the spirit and scope of the invention as defined by the
appended claims. Furthermore, certain details in the present
disclosure are provided to convey a thorough understanding of the
invention defined by the appended claims. However, it will be
apparent to those skilled in the art that certain embodiments may
be practiced without these details. In certain instances,
well-known methods, procedures, or other specific details have not
been described to avoid unnecessarily obscuring aspects of the
invention defined by the appended claims.
Sequence CWU 1
1
21117DNAArtificial SequenceProbe 1acatacgcca taatctg
17224DNAArtificial SequencePROBE 2tcggtgcata acttagttag ttca
24320DNAArtificial SequencePROBE 3aagcatttgt gtttgatttc
20416DNAArtificial SequencePROBE 4cccgatctgg gttgtc
16521DNAArtificial Sequenceprobe 5ccccatgatt agtctttact g
21620DNAArtificial Sequenceprobe 6aagctgaaga ctgatttatg
20725DNAArtificial SequencePROBE 7ttgatcaaac atacaaatta attac
25825DNAArtificial SequencePROBE 8gaatgccatt ccaaatggag agccc
25925DNAArtificial SequencePROBE 9tagaaaaata ttgggcgaac aagtt
251021DNAArtificial SequencePROBE 10cctattagtg atccgctcgc g
211118DNAArtificial SequencePROBE 11cttcgatccg aggtatgc
181222DNAArtificial SequencePROBE 12aaggtagtag gttacatttg tc
221318DNAArtificial SequencePROBE 13ccgtagtccg atggttcc
181421DNAArtificial SequencePROBE 14ctgaggcttc tcttgtttaa t
211517DNAArtificial SequencePROBE 15ttgtcgacgc aattctt
171620DNAArtificial SequencePROBE 16tcatagatga tgtcaaattt
201721DNAArtificial SequencePROBE 17cagacaattt ctcagaatca t
211820DNAArtificial SequencePRIMER 18caactctgca cccacgacta
201920DNAArtificial SequencePRIMER 19cagcggaaag ctgacacttc
202020DNAArtificial SequencePRIMER 20cacacaccca tggaattgaa
202120DNAArtificial SequencePRIMER 21ggctcattgc cgttaaacat 20
* * * * *