Repertoire Of Allo-restricted Peptide-specific T Cell Receptor Sequences And Use Thereof

Abstract

The present invention is directed to a kit-of-parts or composition containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are independently directed against the tyrosinase antigen, the melan-A antigen and the survivin antigen. The invention is further directed to a kit-of-parts or composition containing at least three groups of transgenic lymphocytes transformed with vectors coding for TCR against said antigens. Furthermore, the present invention provides a pharmaceutical composition and its use in the treatment of diseases involving malignant cells expressing said tumor-associated antigens. The invention further relates to a nucleic acid molecule coding for a TCR that recognizes the survivin antigen, a TCR encoded thereby and a T cell expressing said TCR. Further, the invention discloses a vector, a cell and a pharmaceutical composition encoding/containing same and their use in the treatment of diseases involving malignant cells expressing survivin.

Description

FIELD OF THE INVENTION

[0001] The present invention is directed to a kit-of-parts or composition containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are independently directed against the tyrosinase antigen, the melan-A antigen and the survivin antigen. The invention is further directed to a kit-of-parts or composition containing at least three groups of transgenic lymphocytes transformed with vectors coding for TCR against said antigens. Furthermore, the present invention provides a pharmaceutical composition and its use in the treatment of diseases involving malignant cells expressing said tumor-associated antigens. The invention further relates to a nucleic acid molecule coding for a TCR that recognizes the survivin antigen, a TCR encoded thereby and a T cell expressing said TCR. Further, the invention discloses a vector, a cell and a pharmaceutical composition encoding/containing same and their use in the treatment of diseases involving malignant cells expressing survivin.

BACKGROUND OF THE INVENTION

[0002] T cell responses against tumors are often directed against self-MHC molecules presenting peptides derived from over-expressed self-proteins. In general, T cells with high avidity for self-peptide/self-MHC ligands are eliminated by negative selection to prevent autoimmunity. The TCR affinity of remaining T cells specific for self-ligands is normally low, however high-avidity T cells are needed to effectively eradicate tumors. Because negative selection is limited to self-MHC molecules, T cells that recognize allogeneic MHC molecules have not undergone negative selection. Thus, if peptides are presented by allogeneic MHC molecules, it is feasible to obtain high-avidity T cells specific for common tumor-associated ligands derived from over-expressed self-proteins. T cells that recognize allogeneic MHC molecules irrespective of a specific peptide can be distinguished in vitro from allo-restricted peptide-specific T cells at the clonal level and excluded.

[0003] Significant tumor regression can occur following adoptive transfer of T cells with anti-tumor specificity. However, patient-derived T cells may have sub-optimal activity. Furthermore, T cells with appropriate specificity and function for effective tumor eradication are often not available for patients with rapidly progressing tumors. Therefore, there is current interest in using pre-characterized TCR genes to create designer lymphocytes for adoptive cell therapies. Expression of TCR-transgenes in activated lymphocytes can imbue recipient lymphocytes with anti-tumor activities comparable to the original T cells (Morris et al. Blood Rev (2006) 20, 61-69; Schumacher et al., Nat. Rev. Immunol. (2002) 2, 512-519). Moreover, some transgenic TCR can displace endogenous TCR sequences, yielding lymphocytes that express monoclonal TCR.

[0004] The first clinical trials using adoptive transfer of TCR-transgenic T cells in melanoma patients achieved clinical disease-free status in 2 of 17 patients with rapidly progressing disease (Morgan et al. Science (2006) 314, 126-129). Higher rates of clinical efficacy were obtained in patients receiving TCR transgenic lymphocytes transduced with a TCR of higher affinity but some undesired responses were noted against normal tissues. These results demonstrated the therapeutic potential of this approach however they also revealed the need to evaluate a variety of TCR sequences that recognize the same ligand but have different affinities in order to identify the most suitable TCR sequences for clinical development that can be used to achieve optimal elimination of tumor cells while showing the lowest undesired activity directed against normal, non-malignant tissues.

[0005] A number of T cell clones with specificity for various tumor-associated antigens have been reported over the years. Most of these TCR are restricted by self-MHC molecules. Further, available TCR are often of low-avidity. Multiple TCR with good capacity to recognize tumor cells via different tumor-associated antigens (TAA) are often lacking.

[0006] In the prior art, several scientific and patent documents are existing which describe TCR that are able to recognise and bind specific antigens, for example tyrosinase. Visseren et al. (Int. J. Cancer (1997) 72, 1122-1128) describe the affinity and specificity of several tyrosinase-specific TCR and suggest to use these TCR as a specific treatment of melanoma patients. Roszkowski et al. (J. Immunol. (2003) 170, 2582-2589 and Cancer Res. (2005) 65, 1570-1576) are likewise characterising tyrosinase-specific TCR.

[0007] U.S. Pat. No. 5,906,936 is directed to cytotoxic T-cells which kill non-MHC-restricted target cells independent of MHC-restriction and not to T-cells, which utilize specific TCR sequences that recognize MHC-restricted ligands.

[0008] WO97/32603 is directed to a method for producing non-human TCR and TCR specific for human HLA-restricted tumor antigens. Furthermore, the TCR-nucleic acids and recombinant T-cells are described as well as the administration of TCR recombinant T-cells for the treatment of several diseases.

[0009] WO2007/065957 describes an effector T-cell transfected with an antigen specific TCR coding RNA wherein the transfected T-cell recognizes the antigen in a complex with the MHC-molecule and binds the same. As potential tumor antigens, MART-1 (melan-A), tyrosinase and survivin are named.

[0010] WO20081039818 discloses MART-1 and tyrosinase-specific TCR sequences and describes the enhancement of antigen recognition by substitution in the CDR2 region.

[0011] The above prior art TCR sequences are all derived from autologous or xenogeneic, but not allogeneic, sources.

[0012] For example, TCR sequences are from peripheral blood or from tumor-infiltrating lymphocytes of HLA-A2-positive melanoma patients. This means that all these TCR are HLA-A2 self-restricted TCRs, or, are HLA-DP4 self-restricted, NY-ESO-1 specific, both derived from autologous sources. As an alternative, as disclosed in WO97/32603, the TCR is derived from an HLA-A2 transgenic mouse and, therefore, the sequence is xenogeneic in this case.

[0013] However, the available prior art documents do not show TCR sequences, which are allo-restricted and specific for the survivin, tyrosinase and melan A antigens.

[0014] Thus, there is still an important need to find means to generate T cells that bear TCR with high functional avidity that have the capacity to recognize specific ligands on tumor cells.

[0015] Immune selection of tumor cells poses a severe problem in TCR-based therapies. Tumors tend to be genetically unstable and may lose their antigens by mutation. This instability may lead to the generation of antigen-loss variants which are able to escape the immune response. Therefore, if tumor cells are attacked by T cells recognizing only one single TAA specificity, this might lead to a reduced or even absent success of therapy due to outgrowth of tumor cells lacking expression of the specific TAA.

[0016] Therefore, there is a further need existing to provide a clinical approach to effectively minimize immune selection of tumor cells and to provide a broad and specific attack on tumor cells.

SUMMARY OF THE INVENTION

[0017] Therefore, it is an object of the present invention to provide a TCR-based approach in order to overcome the drawbacks of the prior art therapies, in particular to effectively minimize immune selection of tumor cells. It is a further object of the invention to provide a repertoire of TCR which can be effectively used in the treatment of diseases involving malignant cells expressing tyrosinase and/or melan-A and/or survivin, preferably melanomas, gliomas, glioblastomas, and/or rare tumors of ectodermal origin, the like to provide mixtures of TCR-transgenic lymphocytes to target tumors via several different MHC-peptide ligands in order to avoid immune selection of tumor cells that lack expression of a specific TAA. It is a further object of the present invention to provide TCR or functional parts thereof, such as CDR3 regions, which show high affinity against the survivin antigen. It is a still further object of the invention to provide pharmaceutical compositions for use in adoptive cell therapy which allow an effective treatment of diseases involving malignant cells expressing survivin.

[0018] These objects are solved by the subject-matter of the independent claims. Preferred embodiments are indicated in the dependent claims.

[0019] It is a great advantage to administer mixtures of TCR-transgenic specific T cells to patients to target their tumors via several different MHC-peptide ligands in order to avoid immune selection of tumor cells that lack TAA expression if they are attacked by T cells with only a single specificity.

[0020] The inventors generated high-avidity, allo-restricted peptide-specific T cells that provide suitable sources of TCR sequences for selection of TCR that can be developed for clinical application. Furthermore, the inventors have generated a series of T cell clones and demonstrated their high-avidity and tumor-specificity for three distinct melanoma-associated antigens. In addition, one of the antigens for which they have generated a repertoire of TCR sequences, namely survivin, is broadly expressed in a variety of tumors and therefore, these sequences can also be used for treatment of tumors other than melanoma.

[0021] The use of repertoires of TCR with different specificities does not only provide a broader basis of an attack of tumor cells, helping to avoid immune selection of TAA loss variants, but will also allow patients to be treated if their tumors naturally fail to express any one of the individual TAA that are targeted by the TCR. Thereby, future adoptive T cell therapies can be realized for more patients by employing these TCR sequences to develop "off the shelf" reagents for transduction of patient-derived lymphocytes.

[0022] The combination of TCR used in the present invention, i.e. TCR directed against the survivin, tyrosinase and optionally melan A antigen, is particularly effective in vivo in minimizing immune selection of tumor cells and in defeating malignancies. In other words, also in case of immune selection, there is still a high probability that the tumor to be attacked still expresses at least one of the named TAA and thus can be effectively recognized and defeated. This is in contrast to prior art approaches, where tumor cells are attacked by T cells recognizing only one single TAA specificity, potentially leading to a reduced or even absent success of therapy due to outgrowth of tumor cells lacking expression of the specific TAA.

DETAILED DESCRIPTION OF THE INVENTION

[0023] According to a first aspect, the invention provides a kit-of-parts or composition comprising: [0024] a) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the tyrosinase antigen; [0025] b) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the melan-A antigen; and [0026] c) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the survivin antigen.

[0027] As used herein, the term "kit-of-parts" shall encompass an entity of physically separated components, which are intended for individual use, but in functional relation to each other. This means that the individual parts of the kit are provided for simultaneous or subsequent administration. If all components (or groups) are provided in mixed form, they are defined herein as a "composition" and not as a kit-of-parts.

[0028] In an embodiment, the vector used in the kit-of-parts or composition is a plasmid, shuttle vector, phagemide, cosmid, expression vector, retroviral vector, adenoviral vector or particle. In the context of the present invention, a "vector" shall mean a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known to those of ordinary skill in the art. A vector preferably is an expression vector that includes a nucleic acid according to the present invention operably linked to sequences allowing for the expression of said nucleic acid.

[0029] In a preferred embodiment, the kit-of-parts or composition contains the following selection of vectors:

The vectors of group a) are comprising at least one CDR3 sequence according to SEQ ID NO: 1-10, or at least one nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 29-38 and/or the vectors of group b) are comprising at least one CDR3 sequence according to SEQ ID NO: 11-20 or at least one nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 39-48, and/or the vectors of group c) are comprising at least one CDR3 sequence according to SEQ ID NO: 21-28 or at least one nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 49-56.

[0030] It is noted that within each group, a ranking of the most promising sequences is existing, being from the most to the less preferred sequence:

Directed against the tyrosinase antigen: CDR3 sequence according to SEQ ID NO: 1, 2, 8, 9, 10, 3, 4, 5, 6, 7 or the nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 29, 30, 36, 37, 38, 31, 32, 33, 34, 35. Directed against the melan-A antigen: CDR3 sequence according to SEQ ID NO: 19, 20, 15, 16, 17, 18, 11, 12, 13, 14 or the nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 47, 48, 43, 44, 45, 46, 39, 40, 41, 42. Directed against the survivin antigen: CDR3 sequence according to SEQ ID NO: 27, 28, 23, 24, 25, 26, 21, 22 or the nucleic acid sequence coding for the amino acid sequence of SEQ ID NO: 55, 56, 51, 52, 53, 54, 49, 50.

[0031] It is further noted that, in the present invention, SEQ ID NO:s defining the alpha and beta chains of a precise TCR are not grouped separately. Although it is contemplated that all alpha chain sequences may be combined with all beta chain sequences (if directed against the same antigen), it is preferred that the alpha and the beta chain sequences derived from the same clone are used in combination. For example, a preferred TCR against the survivin antigen may comprise SEQ ID NO: 27 for the alpha chain sequence and SEQ ID NO: 28 for the beta chain sequence (both derived from the same clone, i.e. SW-Surv-72).

[0032] The invention further provides derivatives of said CDR3 sequences wherein the CDR3 region has been altered by one or more additions and/or deletions of an overall number of from 1-5 amino acids, but not more than 1-3 contiguous amino acids and/or conservative substitutions of from 1-6 amino acids and wherein the tumor antigen recognizing characteristics are maintained or improved.

[0033] This means, more precisely, that additions or deletions may be performed to an extent that 1-5 amino acids are added or deleted in the CDR3 region. If more than one addition or deletion is performed, the overall number of added or deleted amino acids may not exceed 5 amino acids. Further, one single addition or deletion at one site may only be in the range of 1-3 amino acids, i.e. 1-3 contiguous amino acids, since the ligand binding capacity might be deteriorated by performing larger additions/deletions.

[0034] In a further embodiment, the vectors are each comprising a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes the respective tumor antigen, the vectors comprising

a) the nucleic acid sequence of SEQ ID NO: 57, 59, 61, 62, 64, or 65 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 58, 60, 63, or 66 coding for the .beta.-chain of a TCR directed against the tyrosinase antigen, b) the nucleic acid sequence of SEQ ID NO: 67, 69, 71, 73, or 75 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 68, 70, 72, 74, or 76 coding for the .beta.-chain of said TCR directed against the melan-A antigen, and c) the nucleic acid sequence of SEQ ID NO: 77, 79, 81, or 83 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 78, 80, 82, or 84 coding for the .beta.-chain of said TCR directed against the survivin antigen, or a derivative of these sequences, coding for the .alpha.- or .beta.-chain, wherein the chain has been altered by one or more additions or deletions of from 1-15 amino acids, the additions or deletions being outside the CDR3 region of each chain and/or by conservative substitutions of from 1-15 amino acids, wherein the tumor antigen recognizing characteristics are maintained or improved.

[0035] Also here, a ranking of the most promising sequences is existing, being from the most to the less preferred sequence:

Directed against the tyrosinase antigen: the nucleic acid sequence of SEQ ID NO: 57, 59, 64, 65, 61, 62, coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 58, 60, 66, 63 coding for the .beta.-chain of a TCR directed against the tyrosinase antigen. Directed against the melan-A antigen: the nucleic acid sequence of SEQ ID NO: 75, 71, 73, 67, 69 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 76, 72, 74, 68, 70 coding for the .beta.-chain of said TCR directed against the melan-A antigen. Directed against the survivin antigen: the nucleic acid sequence of SEQ ID NO: 83, 79, 81, and 77 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 84, 80, 82, and 78 coding for the .beta.-chain of said TCR directed against the survivin antigen,

[0036] The term "nucleic acid" as used herein refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the cell from which it is derived. For example, a nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent. Thus, a nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, or adenovirus). In addition, an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.

[0037] Furthermore, the term "nucleic acid" as used herein also includes artificially produced DNA or RNA sequences, such as those sequences generated by DNA or RNA synthesis based on in silico information.

[0038] The invention is also directed to a kit-of-parts or composition comprising TCR, preferably soluble TCR, encoded by the above indicated nucleic acids and directed against the survivin, melan-A and tyrosinase antigens. These TCR may as an alternative be synthetic proteins.

[0039] The nucleic acids of the invention can comprise natural nucleotides, modified nucleotides, analogues of nucleotides, or mixtures of the foregoing as long as they are capable of causing the expression of a polypeptide in vitro, and preferably, in a T cell. The nucleic acids of the invention are preferably RNA, and more preferably DNA.

[0040] Furthermore, the present invention also comprises derivatives of the above described nucleic acid molecules, wherein, related to the above sequences, the sequence has been altered by additions, deletions and/or substitutions and wherein the tumor antigen recognizing characteristics are maintained or improved.

[0041] More precisely, such a derivative is coding for the .alpha.- or .beta.-chain, wherein the chain has been altered by one or more additions or deletions of from 1-15 amino acids, the additions or deletions being outside the CDR3 region of each chain, and/or by conservative substitutions of from 1-15 amino acids. It is noted in this connection that also the CDR3 region may be altered, but to a lesser extent. The definition of those amendments is indicated above for the derivatives of fragments coding for the CDR3 region.

[0042] Useful changes in the overall nucleic acid sequence in particular are related to codon optimization and the addition of epitope tags, which will be explained in detail below. Such codon optimization can include optimization of expression levels, optimization of avidity for target cells, or both.

[0043] In general, it should, however, be noted that the alterations should not diminish or alter the ability of the encoded polypeptide to form part of a TCR that recognizes tumor associated antigens in the context of an MHC molecule, but should facilitate destruction of a tumor cell, and preferably facilitate the regression of a tumor, or other cancerous state.

[0044] For example, alterations can be made which lead to conservative substitutions within the expressed amino acid sequence. These variations can be made in complementarity determining and non-complementarity determining regions of the amino acid sequence of the TCR chain that do not affect function. However, as noted above, additions and deletions should not be performed in the CDR3 region (for example an addition of epitope tags).

[0045] The concept of "conservative amino acid substitutions" is understood by the skilled artisan, and preferably means that codons encoding positively-charged residues (H, K, and R) are substituted with codons encoding positively-charged residues, codons encoding negatively-charged residues (D and E) are substituted with codons encoding negatively-charged residues, codons encoding neutral polar residues (C, G, N, Q, S, T, and Y) are substituted with codons encoding neutral polar residues, and codons encoding neutral non-polar residues (A, F, I, L, M, P, V, and W) are substituted with codons encoding neutral non-polar residues. These variations can spontaneously occur, be introduced by random mutagenesis, or can be introduced by directed mutagenesis. Those changes can be made without destroying the essential characteristics of these polypeptides, which are to recognize antitumor antigens in the context of an MHC with high avidity so as to enable the destruction of cancer cells. The ordinarily skilled artisan can readily and routinely screen variant amino acids and/or the nucleic acids encoding them to determine if these variations substantially lessen or destroy the ligand binding capacity by methods known in the art.

[0046] As outlined above, the TCR nucleic sequences may have been altered in order to provide codon optimization. Codon optimization is a generic technique to achieve optimal expression of a foreign gene in a cell system. Selection of optimum codons depends on codon usage of the host genome and the presence of several desirable and undesirable sequence motifs. It is noted that codon optimization will not lead to an altered amino acid sequence and, thus, will not fall under the definition of a conservative substitution as contained in this application.

[0047] In a still further embodiment, the vectors contain nucleic acids coding for functional TCR .alpha. and/or .beta. chain fusion proteins, comprising:

a) at least one epitope-tag, and b) the amino acid sequence of an .alpha. and/or .beta. chain of a TCR as defined hereinabove, wherein said epitope-tag is selected from i) an epitopc-tag added to the N- and/or C-terminus of said .alpha. and/or .beta. chain, or added into the .alpha. and/or .beta. chain sequence, but outside the CDR3 region, ii) an epitope-tag inserted into a constant region of said .alpha. and/or .beta. chain, and iii) an epitope-tag replacing a number of amino acids in a constant region of said .alpha. and/or .beta. chain.

[0048] Epitope tags are short stretches of amino acids to which a specific antibody can be raised, which in some embodiments allows one to specifically identify and track the tagged protein that has been added to a living organism or to cultured cells. Detection of the tagged molecule can be achieved using a number of different techniques. Examples of such techniques include: immunohistochemistry, immunoprecipitation, flow cytometry, immunofluorescence micro-scopy, ELISA, immunoblotting ("Western"), and affinity chromatography. Epitope tags add a known epitope (antibody binding site) on the subject protein, to provide binding of a known and often high-affinity antibody, and thereby allowing one to specifically identify and track the tagged protein that has been added to a living organism or to cultured cells.

[0049] In the context of the present invention, a "functional" T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein shall mean an .alpha.- and/or .beta.-chain fusion protein that, although the chain includes the epitope-tag and/or has a tag attached to it, maintains at least substantial fusion protein biological activity in the fusion. In the case of the .alpha.- and/or .beta.-chain of a TCR, this shall mean that both chains remain able to form a T-cell receptor (either with a non-modified .alpha.- and/or .beta.-chain or with another inventive fusion protein .alpha.- and/or .beta.-chain) which exerts its biological function, in particular binding to the specific peptide-MHC complex of said TCR, and/or functional signal transduction upon peptide activation.

[0050] Preferred is a functional T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein according to the present invention, wherein said epitope-tag has a length of between 6 to 15 amino acids, preferably 9 to 11 amino acids.

[0051] Even more preferred is a functional T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein according to the present invention, wherein said T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein comprises two or more epitope-tags, either spaced apart or directly in tandem. Embodiments of the fusion protein can contain 2, 3, 4, 5 or even more epitope-tags, as long as the fusion protein maintains its biological activity/activities ("functional").

[0052] Preferred is a functional T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein according to the present invention, wherein said epitope-tag is selected from, but not limited to, CD20 or Her2/neu tags, or other conventional tags such as a myc-tag, FLAG-tag, T7-tag, HA (hemagglutinin)-tag, His-tag, S-tag, GST-tag, or GFP-tag. The myc, T7, GST, GFP tags are epitopes derived from existing molecules. In contrast, FLAG is a synthetic epitope tag designed for high antigenicity (see, e.g., U.S. Pat. Nos. 4,703,004 and 4,851,341). The myc tag can preferably be used because high quality reagents are available to be used for its detection. Epitope tags can of course have one or more additional functions, beyond recognition by an antibody. The sequences of these tags are described in the literature and well known to the person of skill in art.

[0053] In the functional T-cell receptor (TCR) .alpha.- and/or .beta.-chain fusion protein according to the present invention, said fusion protein may be for example selected from two myc-tag sequences that are attached to the N-terminus of an .alpha.-TCR-chain and/or 10 amino acids of a protruding loop region in the .beta.-chain constant domain being exchanged for the sequence of two myc-tags.

[0054] In an embodiment of the present invention, the inventors inserted an amino acid sequence that corresponds to a part of the myc protein (myc-tag) at several reasonable sites into the structure of a T cell receptor and transduced this modified receptor into T cells (see examples below). By introducing a tag into the TCR structure, it is possible to deplete the modified cells by administering the tag-specific antibody to the patient.

[0055] Those functional TCR fusion proteins may be used in a method for selecting a host cell population expressing a fusion protein selected from the group consisting of a fusion protein comprising a) at least one epitope-providing amino acid sequence (epitope-tag), and b) the amino acid sequence of an .alpha.- and/or .beta.-chain of a TCR as defined above, wherein said epitope-tag is selected from an epitope-tag added to the N- and/or C-terminus of said .alpha.- and/or .beta.-chain or added into the .alpha.- and/or .beta.-chain sequence, but outside the CDR3 region, an epitope-tag inserted into a constant region of said .alpha.- and/or .beta.-chain, and an epitope-tag replacing a number of amino acids in a constant region of said .alpha.- and/or .beta.-chain; and a TCR comprising at least one fusion protein as above on the surface of the host cell; comprising contacting host cells in a sample with a binding agent that immunologically binds to the epitope-tag, and selection of said host cells based on said binding.

[0056] The present invention further provides an immunoglobulin molecule, anticaline, TCR .gamma./.delta. chain having a CDR3 region as defined herein (or a derivative thereof) inserted. Therefore, the kit-of-parts or composition may also comprise a repertoire of said molecules, i.e. a group directed against the tyrosinase antigen, a group directed against the melan-A antigen, and a group directed against the survivin antigen.

[0057] In a second aspect, the present invention provides a kit-of-parts or composition comprising at least three groups of transgenic lymphocytes. [0058] a) a group of transgenic lymphocytes transformed with vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the tyrosinase antigen; [0059] b) a group of transgenic lymphocytes transformed with vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the melan-A antigen; and [0060] c) a group of transgenic lymphocytes transformed with vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the survivin antigen, wherein the vectors and the nucleic acid sequences contained therein are defined as above.

[0061] The lymphocytes preferably are CD4.sup.+ or CD8.sup.+ T lymphocytes, or natural killer cells, and, more preferably, are autologous or allogeneic to the patient.

[0062] In a further aspect, the present invention is directed to a kit-of-parts or composition as defined above, comprising groups a) and c) of the vectors or of the transgenic lymphocytes. This kit-of-parts or composition according to the invention, thus, is directed against the tyrosinase antigen and the survivin antigen, but not necessarily against the melan-A antigen. The above disclosed principles regarding the kit-of-parts or composition also apply here.

[0063] In a still further aspect, the invention is directed to a pharmaceutical composition which comprises the kit-of-parts or composition as defined above and a pharmaceutically acceptable carrier.

[0064] The active components of the present invention are preferably used in such a pharmaceutical composition in doses mixed with an acceptable carrier or carrier material, that the disease can be treated or at least alleviated. Such a composition can (in addition to the active component and the carrier) include filling material, salts, buffer, stabilizers, solubilizers and other materials, which are known state of the art.

[0065] The term "pharmaceutically acceptable" defines a non-toxic material, which does not interfere with effectiveness of the biological activity of the active component. The choice of the carrier is dependent on the application.

[0066] The pharmaceutical composition can contain additional components which enhance the activity of the active component or which supplement the treatment. Such additional components and/or factors can be part of the pharmaceutical composition to achieve synergistic effects or to minimize adverse or unwanted effects.

[0067] Techniques for the formulation or preparation and application/medication of active components of the present invention are published in "Remington's Pharmaceutical Sciences", Mack Publishing Co., Easton, Pa., latest edition. An appropriate application is a parenteral application, for example intramuscular, subcutaneous, intramedular injections as well as intrathecal, direct intraventricular, intravenous, intranodal, intraperitoneal or intratumoral injections. The intravenous injection is the preferred treatment of a patient.

[0068] According to a preferred embodiment, the pharmaceutical composition is an infusion or an injection.

[0069] An injectable composition is a pharmaceutically acceptable fluid composition comprising at least one active ingredient, e.g., an expanded T-cell population (for example autologous or allogenic to the patient to be treated) expressing a TCR. The active ingredient is usually dissolved or suspended in a physiologically acceptable carrier, and the composition can additionally comprise minor amounts of one or more non-toxic auxiliary substances, such as emulsifying agents, preservatives, and pH buffering agents and the like. Such injectable compositions that are useful for use with the fusion proteins of this disclosure are conventional; appropriate formulations are well known to those of ordinary skill in the art.

[0070] In another aspect, the present invention is directed to a method of treating a patient in need of adoptive cell therapy, said method comprising administering to said patient a pharmaceutical composition as defined above to said patient. The patient to be treated preferably belongs to the group of HLA-A2-positive patients.

[0071] Preferably, said patient suffers from a disease involving malignant cells expressing tyrosinase and/or melan-A and/or survivin antigens, preferably melanomas, gliomas, glioblastomas, and/or rare tumors of ectodermal origin.

[0072] In another aspect, kit-of-parts or composition are used for the manufacture of a medicament for use in adoptive cell therapy.

[0073] According to a further aspect, the present invention discloses a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes the survivin antigen and comprising the nucleic acid sequence of SEQ ID NO: 77, 79, 81, or 83 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 78, 80, 82, or 84 coding for the .beta.-chain of said TCR, or a derivative thereof, coding for the .alpha.- or .beta.-chain, wherein the chain has been altered by one or more additions or deletions of from 1-15 amino acids, the additions or deletions being outside the CDR3 region of each chain and/or by conservative substitutions of from 1-15 amino acids, wherein the survivin antigen recognizing characteristics are maintained or improved,

or a fragment thereof coding for a CDR3 region of a TCR recognizing the survivin antigen and having the nucleic acid sequence of SEQ ID NO: 21-28 or coding for the amino acid sequences of SEQ ID NO: 49-56, or a derivative of said fragment, wherein the CDR3 region has been altered by one or more additions and/or deletions of an overall number of from 1-5 amino acids, but not more than 1-3 contiguous amino acids and/or conservative substitutions of from 1-6 amino acids and wherein the survivin antigen recognizing characteristics are maintained or improved.

[0074] Also here, a ranking of the most promising sequences is existing, being from the most to the less preferred sequence: the nucleic acid sequence of SEQ ID NO: 83, 79, 81, and 77 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 84, 80, 82, and 78 coding for the .beta.-chain of said TCR directed against the survivin antigen,

[0075] For the CDR3 region of a TCR recognizing the survivin antigen, the ranking of the nucleic acid sequence is: SEQ ID NO: 27, 28, 23, 24, 25, 26, 21, 22 or the amino acid sequences of SEQ ID NO: 55, 56, 51, 52, 53, 54, 49, 50.

[0076] The above remarks regarding fragments or derivatives (variants) do also apply here.

[0077] In a further aspect, the invention provides a TCR, preferably a soluble TCR, encoded by a nucleic acid as defined above or comprising one or more the amino acid sequences of SEQ ID NO: 49-56. This preferably also encompasses a functional TCR .alpha. and/or .beta. chain fusion protein, comprising:

a) at least one epitope-tag, and b) the amino acid sequence of an .alpha. and/or .beta. chain of a TCR against the survivin antigen as defined above, wherein said epitope-tag is selected from i) an epitope-tag added to the N- and/or C-terminus of said .alpha. and/or .beta. chain, or added into the .alpha. and/or .beta. chain sequence, but outside the CDR3 region, ii) an epitope-tag inserted into a constant region of said .alpha. and/or .beta. chain, and iii) an epitope-tag replacing a number of amino acids in a constant region of said .alpha. and/or .beta. chain.

[0078] The preferred ranking is: SEQ ID NO: 55, 56, 51, 52, 53, 54, 49, 50.

[0079] Further provided is a T cell expressing a TCR as above directed against the survivin antigen, or a TCR comprising one of the CDR3 regions as defined above or an immunoglobulin molecule, anticaline, TCR .gamma./.delta. chain having a CDR3 region as above inserted.

[0080] Furthermore, the invention provides for a vector, preferably a plasmid, shuttle vector, phagemide, cosmid, expression vector, retroviral vector, adenoviral vector or particle and/or vector to be used in gene therapy, which comprises one or more of the nucleic acids as defined above.

[0081] In a still further aspect, the invention is directed to a cell, preferably a PBL which has been transformed with the above vector. The step of cloning the T cell receptor (TCR) of the isolated T cells and/or expressing the TCR transgenes in PBMC can be done according to established methods such as those described in Sommermeyer et al., Eur. J. Immunol. (2006) 36, 3052-3059.

[0082] In addition, a pharmaceutical composition is provided which comprises a TCR, a T cell, an immunoglobulin molecule, anticaline, TCR .gamma./.delta. chain as above and a pharmaceutically acceptable carrier. For further information, see above.

[0083] The pharmaceutical composition preferably is used for the manufacture of a medicament for use in adoptive cell therapy, preferably for treating a disease in patients, the disease involving malignant cells expressing the survivin antigen. Survivin is known to be expressed across most carcinoma cell types and at the same time is absent in normal non-malignant cells. Therefore, the pharmaceutical composition may be used in the treatment of nearly all conceivable carcinomas.

[0084] The present invention now will be illustrated by the enclosed Figures and the Examples. The following examples further illustrate the invention but, of course, should not be construed as limiting its scope.

DESCRIPTION OF THE FIGURES

[0085] FIG. 1 shows the results of these evaluations for four HLA-A*0201-allo-restricted T cell clones specific for the tyrosinase peptide YMDGTMSQV: T cell avidity (FIG. 1a); multimer off-rate (FIG. 1b); IFN-.gamma. secretion assay (FIG. 1c) and cytotoxic killing of melanoma cells (FIG. 1d).

[0086] FIG. 2 shows the results of these evaluations for five HLA-A*0201-allo-restricted T cells clones specific for the melan-A peptide ELAGIGILTV: T cell avidity (FIG. 2a); multimer off-rate (FIG. 2b); IFN-.gamma. secretion assay (FIG. 2c) and cytotoxic killing of melanoma cells (FIG. 2d).

[0087] FIG. 3 shows the results of these evaluations for four HLA-A*0201-allo-restricted T cells clones specific for the survivin peptide LMLGEFLKL: T cell avidity (FIG. 3a); multimer off-rate (FIG. 3b); IFN-.gamma. secretion assay (FIG. 3c) and cytotoxic killing of melanoma cells (FIG. 3d).

EXAMPLES

[0088] To isolate high-avidity T cells bearing TCR that recognize peptides presented by allogeneic major histocompatibility complex (MHC) molecules (i.e. allo-restricted T cells) and efficiently kill tumor cells with corresponding ligands, autologous dendritic cells (DC) obtained from HLA-A*0201-negative healthy donors were used for T cell priming following co-transfection with RNA encoding allogeneic HLA-A*0201 molecules and RNA encoding a selected TAA. Tyrosinase, melan-A and survivin were selected as the TAA; these are self-proteins that are often over-expressed in melanomas, and in the case of survivin many other types of tumors, and serve as examples of common tumor-associated antigens (TAA). DC were used to prime purified, autologous CD.sup.8+ T cells using two rounds of stimulation with freshly prepared RNA-pulsed DC. Prior to activation and after stimulation, the frequency of CD8.sup.+ T cells with TCR recognizing HLA-A2-peptide complexes was measured using HLA-multimers. Double-positive T cells were assessed after DC stimulation in the established cultures and CD8.sup.+ multimer.sup.+ cells were isolated by fluorescence-activated cell sorting (Wolfl et al. Cytometry A (2004) 57, 120-130. Sorted cells were cloned in limiting dilution cultures and expanded in vitro using antigen-independent stimulation.

[0089] The isolated T cell clones were tested for function and specificity and their TCR sequences were determined. Multiple T cell clones showing the required tumor specificity, good T cell avidity, and various TCR multimer off-rates, were identified and the cDNAs encoding their TCR sequences were isolated by RT-PCR and the sequences of the TCR alpha and beta chains were determined (Tables 1-3).

[0090] These selected TCR sequences can be expressed in various gene vectors (e.g. retroviral vectors or lentiviral vectors, perhaps even as RNAs for transient expression) in order to allow them to be introduced into recipient lymphocytes. The primary sequences can be changed by codon optimization and other genetic modifications to improve TCR protein expression and alpha and beta chain pairing to provide better TCR expression in recipient lymphocytes.

[0091] Four assays were used to demonstrate the tumor-associated specificity of the T cell clones that serve as the sources of TCR sequences for the three different melanoma-associated antigens: Functional T cell avidity for MHC-peptide ligand recognition was measured in a .sup.51Cr-release assay using HLA-A2.sup.+ T2 cells pulsed with graded amounts of exogenous peptide as target cells. The peptide concentration needed for 50% relative lysis defined the value of half-maximum lysis. This assay also confirmed that the T cell clones recognized the specific peptide used for their multimer selection.

[0092] HLA-multimer off-rate was used to assess structural TCR-MHC/peptide binding affinity. A slower off-rate indicates that TCR-ligand interactions are more stable and of higher structural affinity.

[0093] Interferon-gamma (IFN-.gamma.) secretion assays were used to evaluate function and specificity. The clones were co-cultured with cell lines that express HLA-A2 molecules but differ with respect to expression of the TAAs. The desired specificity was demonstrated when the T cell clones secreted IFN-.gamma. after co-culture with tumor cells expressing both HLA-A2 and the TAA protein but released only background levels of cytokine when co-cultured with HLA-A2 positive cells lacking TAA protein expression.

[0094] A standard .sup.51Cr-release assay was used to assess the capacity of the TCR to activate T cell killing after stimulation with MHC-peptide ligand expressed by melanoma tumor cells. Control tumor cell lines expressing HLA-A2 but not expressing the corresponding TAA were used as negative controls.

[0095] The results indicated in the Figures show that for each TAA the selected T cell clones recognize T2 cells pulsed with the appropriate peptide and they show a range of half-maximum responses, indicating that they vary with respect to functional T cell avidity. The clones also vary with respect to multimer off-rates with some showing loss of multimer binding at 1 h and others retaining multimer binding at 2 h. These differences indicate that the TCR of individual clones interact differently with the MHC-peptide ligands and thereby vary in their structural binding affinity.

[0096] In all cases, the clones showed functional recognition via IFN-.gamma. secretion and tumor cell killing of target cells expressing the MHC-peptide ligands used respectively for their multimer sorting. These responses were specific since tumor cells failing to express the appropriate TAA were unable to activate either function in the different T cell clones.

Materials and Methods

Cell Lines

[0097] The human melanoma cell lines, Mel-A375 (HLA-A2.sup.+, tyrosinase.sup.-, melan-A.sup.-; CRL-1619, American Type Culture Collection (ATCC), Bethesda, Md.), Mel-93.04A12 (HLA-A2.sup.+, tyrosinase.sup.+, melan-A.sup.+; gift of P. Schrier, Department of Immunohematology, Leiden University Hospital, The Netherlands), Mel-62438 (HLA-A.sup.2+, tyrosinase.sup.+, survivin.sup.+, gift of M. C. Panelli, National Institutes of Health, Bethesda, Md.) as well as the lymphoid cell line T2 (CRL-1992, ATCC) were cultured in RPMI 1640 medium supplemented with 12% fetal bovine serum (FBS). 2 mM L-glutamine and 1 mM sodium-pyruvate and non-essential amino acids.

Production of Tyrosinase, Melan-A, Survivin and HLA-A2 Ivt-RNA

[0098] The plasmid pCDM8-HLA-A2 with HLA-A*0201 cDNA, pZeoSV2+/huTyr with tyrosinase cDNA, pcDNA/Amp/Aa1 with melan-A cDNA and the pGEM4Z/survivin/A64 plasmid were linearized and used as in vitro transcription templates to produce RNA with the aid of the mMESSAGE mMACHINE T7 kit (Ambion, Austin, Tex.) according to the manufacturer's instructions.

De Novo Priming of T Cells with RNA-Pulsed DC

[0099] Blood samples from healthy donors were collected after informed consent and with approval of the Institutional Review Board of the University Hospital of the Ludwig-Maximilians-University, Munich, Germany. Peripheral blood lymphocytes (PBL) were isolated by Ficoll density gradient centrifugation. PBL were resuspended in 15 ml very low endotoxin (VLE) RPMI 1640 medium (Biochrom, Berlin. Germany) supplemented with 1.5% human serum (DC medium) at 7.5.times.10.sup.6 cells per 75 cm.sup.2 culture flask and incubated at 37.degree. C. and 5% CO.sub.2 for 1 h. Non-adherent cells were carefully removed by washing. Mature DC were prepared from adherent monocytes and transfected with ivt RNA via electroporation as previously described (Javorovic et al. J. Immunather (2008) 31, 52-62.) DC of HLA-A2.sup.+ donors were loaded with 24 .mu.g tyrosinase, melan-A or survivin ivt-RNA and DC of HLA-A2.sup.- donors were co-transfected with 24 .mu.g of the individual TAA-encoding RNA and 48 .mu.g HLA-A2 ivt-RNA. On the same day, autologous CD8.sup.+ T lymphocytes were enriched from PBL via negative selection using a commercial kit according to the manufacturer's instructions (CD8.sup.+ T cell Isolation Kit II (human), Miltenyi, Bergisch Gladbach, Germany). Co-cultures were initiated 10 h after DC electroporation in 24-well plates (TPP, Trasadingen, Switzerland) by adding 1.times.10.sup.5 RNA-pulsed DC to 1.times.10.sup.6 CD.sup.8+ T cells in RPMI 1640, supplemented with 10% heat-inactivated human serum, 4 mM L-glutamine, 12.5 mM HEPES, 50 .mu.M .beta.-mercaptoethanol and 100 U/ml penicillin/streptomycin (T cell medium). IL-7 (5 ng/ml) (Promokine, Heidelberg, Germany) was added on day 0 and 50 U/ml IL-2 (Chiron Behring, Marburg, Germany) was added after 2 days and then on every 3.sup.rd subsequent day. Addition of IL-2 was delayed to decrease proliferation of non-specific CD8.sup.+ T cells. The 2.sup.nd stimulation of primed T cells was made after seven days using freshly prepared RNA-pulsed DC.

HLA-Multimer Staining and Sorting

[0100] Prior to stimulation and six days after the 2.sup.nd stimulation of CD8-enriched T cells with RNA-pulsed DC, HLA-A2-restricted tyrosinase-specific T cells were detected by staining with a PE-labeled HLA-A*0201/htyr.sub.369-377 peptide/human .beta..sub.2m multimer, anti-CD8-APC antibody (clone RPA-T8, BD Pharmingen, Franklin Lakes, N.J.) and propidium iodide (PI: 2 .mu.g/ml). Up to 1.times.10 of cells were incubated in 50 .mu.l volume for 25 min with 4 .mu.g PE-labeled multimer on ice in the dark. For sorting, up to 5.times.10.sup.6 cells were incubated with 12 .mu.g multimer in 100 .mu.l PBS+0.5% human serum. CD8-APC antibody was then added at 1/50 for an additional 25 min. After staining cells were washed twice and either fixed in FACS buffer with 1% paraformaldehyde and analysed by flow cytometry using a FACSCalibur (BD Biosciences) or diluted in PBS+0.5% human serum with PI for sorting. 20-50.times.10.sup.6 total cells per priming culture were stained for sorting. PI-negative cells were gated and CD8*multimer T cells were sorted on a FACSAria cell sorter (BD Biosciences) with a 70 .mu.m nozzle, at a rate of 15,000 events/s. A PE-labeled HLA-A*0201/hmel.A.sub.27-35 peptide/human .beta..sub.2m multimer was used for isolation of HLA-A2-restricted melan-A-specific T cells and an R-PE-labeled Pro5.RTM. MHC pentamer, HLA-A*0201/hsurvivin.sub.96-104 peptide (Proimmune, Oxford, United Kingdom), was used for sorting of HLA-A2-restricted survivin-specific T cells. Pentamer staining was performed according to the manufacturer's instructions.

[0101] For HLA-multimer off-rate assays, cells were washed after multimer binding and resuspended in FACS buffer containing saturating amounts of BB7.2 monoclonal antibody to capture detached multimers and prevent rebinding to T cells. After 1 or 2 h, samples were fixed and analysed by flow cytometry.

Culture of Peptide-Specific T Cell Clones

[0102] Multimer-sorted T cells were cloned by limiting dilution. Clones were plated in 96-well round-bottom plates (TPP) in 200 .mu.l/well T cell medium. 50 IU/ml IL-2 was supplemented every 3 days with 5 ng/ml IL-7 and 10 ng/ml IL-15 (PeproTech Inc., Rocky Hill, N.J.) every 7 days. T cell clones were stimulated non-specifically with anti-CD3 antibody (0.1 .mu.g/ml; OKT-3) and provided with 1.times.10.sup.5 feeder cells per 96-well, consisting of irradiated (50 Gy) PBL derived from a pool of five unrelated donors and 1.times.10.sup.4 irradiated (150 Gy) EBV-transformed allogeneic B-LCL every two weeks. Proliferating T cells were transferred into 24-well plates (TPP) and cultured in 1.5 ml T cell medium plus cytokines. 1.times.10.sup.6 allogeneic irradiated PBL and 1.times.10.sup.5 irradiated EBV-transformed allogeneic B-LCL were added per well as feeder cells in 24-well plates. Clonality was determined by TCR .beta.-chain sequence determination.

Peptide Loading of T2 Cells

[0103] For exogenous peptide pulsing, 1.times.10.sup.6 T2 cells were incubated at 37.degree. C. and 5% CO.sub.2 for 2 h with 10 .mu.g/ml human .beta..sub.2-microglobulin (Calbiochem, San Diego, Calif.) and titrating amounts, ranging from 10.sup.-5 M to 10.sup.-11 M, of the following peptides: tyrosinase peptide YMD (tyrosinase.sub.369-377 YMDGTMSQV, Metabion, Martinaried, Germany), melan-A peptide ELA (melan-A.sub.27-35 ELAGIGILTV, Metabion) and survivin peptide LML (survivin.sub.96-104 LMLGEFLKL, Metabion). T2 cells pulsed with 10.sup.-5 M of influenza peptide GIL (influenza matrix proteins.sub.58-66 GILGFVTL. Metabion) served as control. After washing, peptide-loaded T2 cells were used as target cells in cytotoxicity assays.

IFN-.gamma. Release Assay

[0104] For investigation of specificity, T cell clones (2.times.10.sup.3 cells in 100 .mu.l) were incubated with the respective melanoma cell lines (1.times.10.sup.4 cells in 100 .mu.l). Culture supernatants were harvested after 24 h co-culture and assessed by a standard ELISA using the OptEIA.TM. Human IFN-.gamma. Set (BD Biosciences Pharmingen). Data represent mean values.

Cytotoxicity Assay

[0105] Cytotoxic activity of T cell clones was analysed in a standard 4 h 51-chromium release assay. Melanoma cell lines and peptide-loaded T2 cells were used as target cells. Briefly, 1.times.10.sup.6 target cells were labelled with 100 .mu.Ci Na.sub.2.sup.51 CrO.sub.4 (ICN Biochemicals, Irvine, Calif.) for 1-1.5 h. .sup.51Cr-labelled target cells were cultured with T cells in 100 .mu.l/well RPMI 1640 with 12% FCS in V-bottom 96-well tissue culture plates (Greiner, Solingen. Germany). T cells were serially diluted and co-cultured with 1.times.10.sup.3 melanoma target cells/well to provide graded effector cell to target cell (E:T) ratios from 2.5:1 to 10:1. For determination of functional avidity, 1.times.10.sup.4 T cells were added to 1.times.10.sup.3 peptide-pulsed T2 cells loaded with titrated amounts of peptide, giving a constant E:T of 10:1.

[0106] After 4 h co-culture at 37.degree. C., 50 .mu.l of supernatant were collected and radioactivity was measured in a gamma counter. The percentage of specific lysis was calculated as: 100.times.(experimental release-spontaneous release)/(maximum release-spontaneous release). Spontaneous release was assessed by incubating target cells in the absence of effector cells and was generally less than 15%. For the calculation of percent relative lysis, the maximum percent specific lysis was set to the reference value of 100% and corresponding values were calculated corresponding to this reference. To determine half-maximum lysis, percent relative lysis was plotted against peptide concentration. The peptide concentration at which the curve crossed 50% relative lysis was taken as the value of half-maximum lysis.

TCR Analysis

[0107] For the T-cell receptor analysis of the tyrosinase-, melan-A- and survivin-specific clones, part of the TCR alpha-chains and beta-chains containing the CDR3 region was amplified by RT-PCR using a panel of TCR V.alpha. and TCR V.beta. primers combined with a respective TCR constant region primer. Products were sequenced and assigned according to IMGT (Table 1-3; IMGT, the international ImMunoGeneTics Information System.RTM., http://imgt.cines.fr).

TABLE-US-00001 TABLE 1 TCR-CDR3 sequences of tyrosinase-specific allorestricted T cell clones tyrosinase-specific T58 alpha-chain: TRAV1-2 AJ28 TGTGCTGTGACATACTCTGGGGCTGGGAGTTACCAACTC (SEQ ID NO: 1) C A V T Y S G A G S Y Q L (SEQ ID NO: 29) T58 beta chain: TRBV13 BD1 BJ1-4 TGTGCCAGCAGTCAGAAACAGGGCTGGGAAAAACTG (SEQ ID NO: 2) C A S S Q K Q G W E K L (SEQ ID NO: 30) tyrosinase-specific T43 alpha-chain: TRAV3 AJ28 TGTGCTGTGAGAGACCCTGGGGCTGGGAGTTACCAACTC (SEQ ID NO: 3) C A V R D P G A G S Y Q L (SEQ ID NO: 31) T43 beta-chain: TRBV11-3 BD2 BJ2-1 TGTGCCAGCAGCTTAGAACGGGAGGGAACCAATGAGCAG (SEQ ID NO: 4) C A S S L E R E G T N E Q (SEQ ID NO: 32) tyrosinase-specific Di111 alpha-chain 1: TRAV8-2 AJ20 TGTGTTGTGAGTTCTAACGACTACAAGCTC (SEQ ID NO: 5) C V V S S N D Y K L (SEQ ID NO: 33) Di111 alpha-chain 2: TRAV3 AJ28 TGTGCTGTGAGAGACCCTGGGGCTGGGAGTTACCAACTCACT (SEQ ID NO: 6) C A V R D P G A G S Y Q L T (SEQ ID NO: 34) Di111 beta-chain: TRTIV18 BD2 BJ2-7 TGTGCCAGCTCACCTTCCGAGGGGTACTCCTACGAGCAG (SEQ ID NO: 7) C A S S P S E G Y S Y E Q (SEQ ID NO: 35) tyrosinase-specific B12 alpha-chain 1: TRAV1-2 A138 TGTGCTGTGAGACCCGTTAATGCTGGCAACAACCGTAAGCTG (SEQ ID NO: 8) C A V R P V N A G N N R K L (SEQ ID NO: 36) B12 alpha-chain 2: TRAV38-1 A128 TGTGCTTTCATTAACTCTGGGGCTGGGAGTTACCAACTC (SEQ ID NO: 9) C A F I N S G A G S Y Q L (SEQ ID NO: 37) B12 beta-chain: TRBV7-9 BD2 BJ2-3 TGTGCCAGCAGCTCCATTAGCTTACCTAGCACAGATACGCAG (SEQ ID NO: 10) C A S S S I S L P S T D T Q (SEQ ID NO: 38)

[0108] TCR alpha-chain (VJ region), TCR beta-Chain (VDJ region) and CDR3 lengths are designated according to IMGT (IMGT, the international ImMunoGeneTics information System.RTM., http://imgt.cincs.fr)

TABLE-US-00002 TABLE 2 TCR-CDR3 sequences of melan-A-specific allorestricted T cell clones melan-A-specific SW-M1-9 alpha-chain: TRAV12-2 AJ 40 TGTGCCGTGACCGGAACCTACAAATAC (SEQ ID NO: 11) C A V T G T Y K Y (SEQ ID NO: 39) SW-M1-9 beta-chain: TRBV3-1 BD2 BJ2-7 TGTGCCAGCAGCCCCCTGGGACTAGCGGAGGTTTCCGAGCAG (SEQ ID NO: 12) C A S S P L G L A E V S E Q (SEQ ID NO: 40) melan-A-specific SW-M1-29 alpha-chain: TRAV30 AJ31 TGCGGAGGTAACAATGCCAGACTC (SEQ ID NO: 13) C G G N N A R L (SEQ ID NO: 41) SW-M1-29 beta-chain: TRBV27 BD1 BJ2-2 TGTGCCAGCAGGCCCGGGACAGGAATTT'FTGACGGGGAGCTG (SEQ ID NO: 14) C A S R P G T G I F D G E L (SEQ ID NO: 42) melan-A-specific SW-M1-54 alpha-chain: TRAV12-2 AJ31 TGTGCCCCAAACAATGCCAGACTC (SEQ ID NO. 15) C A P N N A R L (SEQ ID NO: 43) SW-M1-54 beta-chain: TRBV12-3 BD2 BJ2-2 TGTGCCAGCAGCCCCACGATCCTGGTGGAGGCGTACACCGGGGAGC TG (SEQ ID NO: 16) C A S S P T I L V E A Y T G E L (SEQ ID NO: 44) melan-A-specific SW-M1-66 alpha-chain: TRAV12-2 AJ30 TGTGCCGTCGGGGGTGACAAGATC (SEQ ID NO: 17) C A V G G D K I (SEQ ID NO: 45) SW-M1-66 beta-chain: TRBV12-3 BD1 BJI-5 TGTGCCAGCAGTTTGGGACAGGGCTGGCCCCAG (SEQ ID NO: 18) C A S S L G Q G W P Q (SEQ ID NO: 46) melan-A-specific SW-M1-67 alpha-chain: TRAV12-2 AJ29 TGTGCCGTGAGGACACCTCTT (SEQ ID NO: 19) C A Y R T P L (SEQ ID NO: 47) SW-M1-67 beta-chain: TRBV30 BD2 BJ2-1 TGTGCCTGGAGTTCAAGCGGTTTGGGCGTTGAGCAG (SEQ ID NO: 20) C A W S S S G L G V E Q (SEQ ID NO: 48)

[0109] TCR alpha-chain (VJ region), TCR beta-Chain (VDJ region) and CDR3 lengths are designated according to IMGT (IMGT, the international ImMunoGeneTics information System.RTM., http://imgt.cines.fr)

TABLE-US-00003 TABLE 3 TCR-CDR3 sequences of survivin-specific allorestricted T cell clones survivin-specific SW-Surv-22 alpha-chain: TRAV20 AJ41 TGTGCTGTGCAGGCTTACTCAAATTCCGGGTATGCACTC (SEQ ID NO: 21) C A V Q A Y S N S G Y A L (SEQ ID NO: 49) SW-Surv-22 beta-chain: TRBV29-1 BD1 BJ1-2 TGCAGCGTTGAAGACAGCTATGGCTAC (SEQ ID NO: 22) C S V E D S Y G Y (SEQ ID NO: 50) survivin-specific SW-Surv-66 alpha-chain: TRAV13-1 AJ39 TGTGCAGCAAGGGCAGGCAACATGCTC (SEQ ID NO: 23) C A A R A G N M L (SEQ ID NO: 51) SW-Surv-66 beta-chain: TRBV30 BD2 BJ2-7 TGTGCCTGGGGTACGGGACTAGCGCTTTACGAGCAG (SEQ ID NO: 24) C A W G T G L A L Y E Q (SEQ ID NO: 52) survivin-specific SW-Surv-71 alpha-chain: TRAV12-2 AJ31 TGTGCCGTGAACAATGCCAGACTC (SEQ ID NO: 25) C A V N N A R L (SEQ ID NO: 53) SW-Surv-71 beta-chain: TRBV30 BD2 BJ2-1 TGTGCCTGGAGCATAGGCGCTGAGCAGTTC (SEQ ID NO: 26) C A W S I G A E Q F (SEQ ID NO: 54) survivin-specific SW-Surv-72 alpha-chain: TRAV14 A34 TGTGCAATGAGAGAGGGCGGGGGCTACAATAAGCTG (SEQ ID NO: 27) C A M R E G G G Y N K L (SEQ ID NO: 55) SW-Surv-72 beta-chain: TRBV30 BD1 BJ1-1 TGTGCCGGACAGGATTTGAACACTGAAGCT (SEQ ID NO: 28) C A G Q D L N T E A (SEQ ID NO: 56)

[0110] TCR alpha-chain (VJ region) TCR beta-chain (VDJ region) and CDR3 lengths are designated according to IMGT (IMGT, the international ImMunoGeneTics information System.RTM., http://imgt.cines.fr)

REFERENCES

[0111] Murris, E., et al. Generation of tumor-specific T-cell therapies. Blood Rev 20, 61-69 (2006). [0112] Schumacher, T. N. T-cell-receptor gene therapy. Nat Rev Immunol 2, 512-519 (2002). [0113] Sommermeyer, D, et al. Designer T cells by T cell receptor replacement. Eur J Immunol 36, 3052-3059 (2006). [0114] Morgan, R A., et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126-129 (2006). [0115] Wolfl, M, et al. Quantitation of MHC tetramer-positive cells from whole blood: evaluation of a single-platform, six-parameter flow cytometric method. Cytometry A 57, 120-130 (2004). [0116] Javorovic, M., et al. Inhibitory effect of RNA pool complexity on stimulatory capacity of RNA-pulsed dendritic cells. J Immunother 31, 52-62 (2008).

Sequence CWU 1

1

88139DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T58 alpha-chain TRAV1-2 AJ28 1tgtgctgtga catactctgg ggctgggagt taccaactc 39236DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T58 beta chain TRBV13 BD1 BJ1-4 2tgtgccagca gtcagaaaca gggctgggaa aaactg 36339DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T43 alpha-chain TRAV3 AJ28 3tgtgctgtga gagaccctgg ggctgggagt taccaactc 39439DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T43 beta-chain TRBV11-3 BD2 BJ2-1 4tgtgccagca gcttagaacg ggagggaacc aatgagcag 39530DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 alpha-chain 1 TRAV8-2 AJ20 5tgtgttgtga gttctaacga ctacaagctc 30642DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 alpha-chain 2 TRAV3 AJ28 6tgtgctgtga gagaccctgg ggctgggagt taccaactca ct 42739DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 beta-chain TRBV18 BD2 BJ2-7 7tgtgccagct caccttccga ggggtactcc tacgagcag 39842DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 alpha-chain 1 TRAV1-2 AJ38 8tgtgctgtga gacccgttaa tgctggcaac aaccgtaagc tg 42939DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 alpha-chain 2 TRAV38-1 AJ28 9tgtgctttca ttaactctgg ggctgggagt taccaactc 391042DNAArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 beta-chain TRBV7-9 BD2 BJ2-3 10tgtgccagca gctccattag cttacctagc acagatacgc ag 421127DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-9 alpha-chain TRAV12-2 AJ 40 11tgtgccgtga ccggaaccta caaatac 271242DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-9 beta-chain TRBV3-1 BD2 BJ2-7 12tgtgccagca gccccctggg actagcggag gtttccgagc ag 421324DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-29 alpha-chain TRAV30 AJ31 13tgcggaggta acaatgccag actc 241442DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-29 beta-chain TRBV27 BD1 BJ2-2 14tgtgccagca ggcccgggac aggaattttt gacggggagc tg 421524DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-54 alpha-chain TRAV12-2 AJ31 15tgtgccccaa acaatgccag actc 241648DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-54 beta-chain TRBV12-3 BD2 BJ2-2 16tgtgccagca gccccacgat cctggtggag gcgtacaccg gggagctg 481724DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-54 alpha-chain TRAV12-2 AJ31 17tgtgccgtcg ggggtgacaa gatc 241833DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-66 beta-chain TRBV12-3 BD1 BJ1-5 18tgtgccagca gtttgggaca gggctggccc cag 331921DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-67 alpha-chain TRAV12-2 AJ29 19tgtgccgtga ggacacctct t 212036DNAArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-67 beta-chain TRBV30 BD2 BJ2-1 20tgtgcctgga gttcaagcgg tttgggcgtt gagcag 362139DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-22 alpha-chain TRAV20 AJ41 21tgtgctgtgc aggcttactc aaattccggg tatgcactc 392227DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-22 beta-chain TRBV29-1 BD1 BJ1-2 22tgcagcgttg aagacagcta tggctac 272327DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-66 alpha-chain TRAV13-1 AJ39 23tgtgcagcaa gggcaggcaa catgctc 272436DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-66 beta-chain TRBV30 BD2 BJ2-7 24tgtgcctggg gtacgggact agcgctttac gagcag 362524DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-71 alpha-chain TRAV12-2 AJ31 25tgtgccgtga acaatgccag actc 242630DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-71 beta-chain TRBV30 BD2 BJ2-1 26tgtgcctgga gcataggcgc tgagcagttc 302736DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-72 alpha-chain TRAV14 AJ4 27tgtgcaatga gagagggcgg gggctacaat aagctg 362830DNAArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-72 beta-chain TRBV30 BD1 BJ1-1 28tgtgccggac aggatttgaa cactgaagct 302913PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T58 alpha-chain TRAV1-2 AJ28 29Cys Ala Val Thr Tyr Ser Gly Ala Gly Ser Tyr Gln Leu 1 5 10 3012PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T58 beta chain TRBV13 BD1 BJ1-4 30Cys Ala Ser Ser Gln Lys Gln Gly Trp Glu Lys Leu 1 5 10 3113PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T43 alpha-chain TRAV3 AJ28 31Cys Ala Val Arg Asp Pro Gly Ala Gly Ser Tyr Gln Leu 1 5 10 3213PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone T43 beta-chain TRBV11-3 BD2 BJ2-1 32Cys Ala Ser Ser Leu Glu Arg Glu Gly Thr Asn Glu Gln 1 5 10 3310PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 alpha-chain 1 TRAV8-2 AJ20 33Cys Val Val Ser Ser Asn Asp Tyr Lys Leu 1 5 10 3414PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 alpha-chain 2 TRAV3 AJ28 34Cys Ala Val Arg Asp Pro Gly Ala Gly Ser Tyr Gln Leu Thr 1 5 10 3513PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone Di111 beta-chain TRBV18 BD2 BJ2-7 35Cys Ala Ser Ser Pro Ser Glu Gly Tyr Ser Tyr Glu Gln 1 5 10 3614PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 alpha-chain 1 TRAV1-2 AJ38 36Cys Ala Val Arg Pro Val Asn Ala Gly Asn Asn Arg Lys Leu 1 5 10 3713PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 alpha-chain 2 TRAV38-1 AJ28 37Cys Ala Phe Ile Asn Ser Gly Ala Gly Ser Tyr Gln Leu 1 5 10 3814PRTArtificialTCR-CDR3 sequence of tyrosinase-specific allorestricted T cell clone B12 beta-chain TRBV7-9 BD2 BJ2-3 38Cys Ala Ser Ser Ser Ile Ser Leu Pro Ser Thr Asp Thr Gln 1 5 10 399PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-9 alpha-chain TRAV12-2 AJ 40 39Cys Ala Val Thr Gly Thr Tyr Lys Tyr 1 5 4014PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-9 beta-chain TRBV3-1 BD2 BJ2-7 40Cys Ala Ser Ser Pro Leu Gly Leu Ala Glu Val Ser Glu Gln 1 5 10 418PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-29 alpha-chain TRAV30 AJ31 41Cys Gly Gly Asn Asn Ala Arg Leu 1 5 4214PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-29 beta-chain TRBV27 BD1 BJ2-2 42Cys Ala Ser Arg Pro Gly Thr Gly Ile Phe Asp Gly Glu Leu 1 5 10 438PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-54 alpha-chain TRAV12-2 AJ31 43Cys Ala Pro Asn Asn Ala Arg Leu 1 5 4416PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-54 beta-chain TRBV12-3 BD2 BJ2-2 44Cys Ala Ser Ser Pro Thr Ile Leu Val Glu Ala Tyr Thr Gly Glu Leu 1 5 10 15 458PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-66 alpha-chain TRAV12-2 AJ30 45Cys Ala Val Gly Gly Asp Lys Ile 1 5 4611PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-66 beta-chain TRBV12-3 BD1 BJ1-5 46Cys Ala Ser Ser Leu Gly Gln Gly Trp Pro Gln 1 5 10 477PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-67 alpha-chain TRAV12-2 AJ29 47Cys Ala Val Arg Thr Pro Leu 1 5 4812PRTArtificialTCR-CDR3 sequence of melan-A-specific allorestricted T cell clone SW-M1-67 beta-chain TRBV30 BD2 BJ2-1 48Cys Ala Trp Ser Ser Ser Gly Leu Gly Val Glu Gln 1 5 10 4913PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-22 alpha-chain TRAV20 AJ41 49Cys Ala Val Gln Ala Tyr Ser Asn Ser Gly Tyr Ala Leu 1 5 10 509PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-22 beta-chain TRBV29-1 BD1 BJ1-2 50Cys Ser Val Glu Asp Ser Tyr Gly Tyr 1 5 519PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-66 alpha-chain TRAV13-1 AJ39 51Cys Ala Ala Arg Ala Gly Asn Met Leu 1 5 5212PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-66 beta-chain TRBV30 BD2 BJ2-7 52Cys Ala Trp Gly Thr Gly Leu Ala Leu Tyr Glu Gln 1 5 10 538PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-71 alpha-chain TRAV12-2 AJ31 53Cys Ala Val Asn Asn Ala Arg Leu 1 5 5410PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-71 beta-chain TRBV30 BD2 BJ2-1 54Cys Ala Trp Ser Ile Gly Ala Glu Gln Phe 1 5 10 5512PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-72 alpha-chain TRAV14 AJ4 55Cys Ala Met Arg Glu Gly Gly Gly Tyr Asn Lys Leu 1 5 10 5610PRTArtificialTCR-CDR3 sequence of survivin-specific allorestricted T cell clone SW-Surv-72 beta-chain TRBV30 BD1 BJ1-1 56Cys Ala Gly Gln Asp Leu Asn Thr Glu Ala 1 5 10 57813DNAArtificialtyrosinase-directed TCR alpha-chain T58 alpha (VJ region) 57atgtggggag ttttccttct ttatgtttcc atgaagatgg gaggcactac aggacaaaac 60attgaccagc ccactgagat gacagctacg gaaggtgcca ttgtccagat caactgcacg 120taccagacat ctgggttcaa cgggctgttc tggtaccagc aacatgctgg cgaagcaccc 180acatttctgt cttacaatgt tctggatggt ttggaggaga aaggtcgttt ttcttcattc 240cttagtcggt ctaaagggta cagttacctc cttttgaagg agctccagat gaaagactct 300gcctcttacc tctgtgctgt gacatactct ggggctggga gttaccaact cactttcggg 360aaggggacca aactctcggt cataccaaat atccagaacc ctgaccctgc cgtgtaccag 420ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780ctgctcatga cgctgcggct gtggtccagc tga 81358957DNAArtificialtyrosinase-directed TCR beta-chain T58 beta (VDJ region) 58atgcttagtc ctgacctgcc tgactctgcc tggaacacca ggctcctctg ccatgtcatg 60ctttgtctcc tgggagcagt ttcagtggct gctggagtca tccagtcccc aagacatctg 120atcaaagaaa agagggaaac agccactctg aaatgctatc ctatccctag acacgacact 180gtctactggt accagcaggg tccaggtcag gacccccagt tcctcatttc gttttatgaa 240aagatgcaga gcgataaagg aagcatccct gatcgattct cagctcaaca gttcagtgac 300tatcattctg aactgaacat gagctccttg gagctggggg actcagccct gtacttctgt 360gccagcagtc agaaacaggg ctgggaaaaa ctgttttttg gcagtggaac ccagctctct 420gtcttggagg acctgaacaa ggtgttccca cccgaggtcg ctgtgtttga gccatcagaa 480gcagagatct cccacaccca aaaggccaca ctggtgtgcc tggccacagg cttcttccct 540gaccacgtgg agctgagctg gtgggtgaat gggaaggagg tgcacagtgg ggtcagcacg 600gacccgcagc ccctcaagga gcagcccgcc ctcaatgact ccagatactg cctgagcagc 660cgcctgaggg tctcggccac cttctggcag aacccccgca accacttccg ctgtcaagtc 720cagttctacg ggctctcgga gaatgacgag tggacccagg atagggccaa acccgtcacc 780cagatcgtca gcgccgaggc ctggggtaga gcagactgtg gctttacctc ggtgtcctac 840cagcaagggg tcctgtctgc caccatcctc tatgagatcc tgctagggaa ggccaccctg 900tatgctgtgc tggtcagcgc ccttgtgttg atggccatgg tcaagagaaa ggatttc 95759828DNAArtificialtyrosinase-directed TCR alpha-chain T43 alpha (VJ region) 59atggcctctg cacccatctc gatgcttgcg atgctcttca cattgagtgg gctgagagct 60cagtcagtgg ctcagccgga agatcaggtc aacgttgctg aagggaatcc tctgactgtg 120aaatgcacct attcagtctc tggaaaccct tatctttttt ggtatgttca ataccccaac 180cgaggcctcc agttccttct gaaatacatc acaggggata acctggttaa aggcagctat 240ggctttgaag ctgaatttaa caagagccaa acctccttcc acctgaagaa accatctgcc 300cttgtgagcg actccgcttt gtacttctgt gctgtgagag accctggggc tgggagttac 360caactcactt tcgggaaggg gaccaaactc tcggtcatac caaatatcca gaaccctgac 420cctgccgtgt accagctgag agactctaaa tccagtgaca agtctgtctg cctattcacc 480gattttgatt ctcaaacaaa tgtgtcacaa agtaaggatt ctgatgtgta tatcacagac 540aaaactgtgc tagacatgag gtctatggac ttcaagagca acagtgctgt ggcctggagc 600aacaaatctg actttgcatg tgcaaacgcc ttcaacaaca gcattattcc agaagacacc 660ttcttcccca gcccagaaag ttcctgtgat gtcaagctgg tcgagaaaag ctttgaaaca 720gatacgaacc taaactttca aaacctgtca gtgattgggt tccgaatcct cctcctgaaa 780gtggccgggt ttaatctgct catgacgctg cggctgtggt ccagctga 82860939DNAArtificialtyrosinase-directed TCR beta-chain T43 beta (VDJ region) 60atgggtacca ggctcctctg ctgggtggcc ttctgtctcc tggtggaaga actcatagaa 60gctggagtgg ttcagtctcc cagatataag attatagaga aaaaacagcc tgtggctttt 120tggtgcaatc ctatttctgg ccacaatacc ctttactggt acctgcagaa cttgggacag 180ggcccggagc ttctgattcg atatgagaat gaggaagcag tagacgattc acagttgcct 240aaggatcgat tttctgcaga gaggctcaaa ggagtagact ccactctcaa gatccagcct 300gcagagcttg gggactcggc cgtgtatctc tgtgccagca gcttagaacg ggagggaacc 360aatgagcagt tcttcgggcc agggacacgg ctcaccgtgc tagaggacct gaaaaacgtg 420ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 480gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg 540gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag 600cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 660tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 720gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg 780ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 840atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 900gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 93961819DNAArtificialtyrosinase-directed TCR alpha-chain Di111 alpha chain 1 (VJ region) 61atgctcctgc tgctcgtccc agtgctcgag gtgattttta ctctgggagg aaccagagcc 60cagtcggtga cccagcttga cagccacgtc tctgtctctg aaggaacccc ggtgctgctg 120aggtgcaact actcatcttc ttattcaccg tctctcttct ggtatgtgca acaccccaac 180aaaggactcc agcttctcct gaagtacaca tcagcggcca ccctggttaa aggtatcaac 240ggttttgagg ctgaatttaa gaagagtgaa acctccttcc acctgacgaa accctcagcc 300catatgagcg acgcggctga gtacttctgt gttgtgagtt ctaacgacta caagctcagc 360tttggagccg gaaccacagt aactgtaaga gcaaatatcc agaaccctga ccctgccgtg 420taccagctga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 480tctcaaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 540ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 600gactttgcat gtgcaaacgc cttcaacaac

agcattattc cagaagacac cttcttcccc 660agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 720ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 780tttaatctgc tcatgacgct gcggctgtgg tccagctga 81962828DNAArtificialtyrosinase-directed TCR alpha-chain Di111 alpha chain 2 (VJ region) 62atggcctctg cacccatctc gatgcttgcg atgctcttca cattgagtgg gctgagagct 60cagtcagtgg ctcagccgga agatcaggtc aacgttgctg aagggaatcc tctgactgtg 120aaatgcacct attcagtctc tggaaaccct tatctttttt ggtatgttca ataccccaac 180cgaggcctcc agttccttct gaaatacatc acaggggata acctggttaa aggcagctat 240ggctttgaag ctgaatttaa caagagccaa acctccttcc acctgaagaa accatctgcc 300cttgtgagcg actccgcttt gtacttctgt gctgtgagag accctggggc tgggagttac 360caactcactt tcgggaaggg gaccaaactc tcggtcatac caaatatcca gaaccctgac 420cctgccgtgt accagctgag agactctaaa tccagtgaca agtctgtctg cctattcacc 480gattttgatt ctcaaacaaa tgtgtcacaa agtaaggatt ctgatgtgta tatcacagac 540aaaactgtgc tagacatgag gtctatggac ttcaagagca acagtgctgt ggcctggagc 600aacaaatctg actttgcatg tgcaaacgcc ttcaacaaca gcattattcc agaagacacc 660ttcttcccca gcccagaaag ttcctgtgat gtcaagctgg tcgagaaaag ctttgaaaca 720gatacgaacc taaactttca aaacctgtca gtgattgggt tccgaatcct cctcctgaaa 780gtggccgggt ttaatctgct catgacgctg cggctgtggt ccagctga 82863941DNAArtificialtyrosinase-directed TCR beta-chain Di111 beta chain (VDJC2*02) 63atggacacca gagtactctg ctgtgcggtc atctgtcttc tgggggcagg tctctcaaat 60gccggcgtca tgcagaaccc aagacacctg gtcaggagga ggggacagga ggcaagactg 120agatgcagcc caatgaaagg acacagtcat gtttactggt atcggcagct cccagaggaa 180ggtctgaaat tcatggttta tctccagaaa gaaaatatca tagatgagtc aggaatgcca 240aaggaacgat tttctgctga atttcccaaa gagggcccca gcatcctgag gatccagcag 300gtagtgcgag gagattcggc agcttatttc tgtgccagct caccttccga ggggtactcc 360tacgagcagt acttcgggcc gggcaccagg ctcacggtca cagaggacct gaaaaacgtg 420ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 480gccacactgg tatgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg 540gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag 600cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 660tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 720gacgagtgga cccaggatag ggccaaaccc gtcacccaga tcgtcagcgc cgaggcctgg 780ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 840atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 900gtgctgatgg ccatggtgtc aagagaaagg attccagagg c 94164816DNAArtificialtyrosinase-directed TCR alpha-chain B12 alpha chain 1 (VJ region) 64atgtggggag ttttccttct ttatgtttcc atgaagatgg gaggcactac aggacaaaac 60attgaccagc ccactgagat gacagctacg gaaggtgcca ttgtccagat caactgcacg 120taccagacat ctgggttcaa cgggctgttc tggtaccagc aacatgctgg cgaagcacct 180acatttctgt cttacaatgt tctggatggt ttggaggaga aaggtcgttt ttcttcattc 240cttagtcggt ctaaagggta cagttacctc cttttgaagg agctccagat gaaagactct 300gcctcttacc tctgtgctgt gagacccgtt aatgctggca acaaccgtaa gctgatttgg 360ggattgggaa caagcctggc agtaaatccg aatatccaga accctgaccc tgccgtgtac 420cagctgagag actctaaatc cagtgacaag tctgtctgcc tattcaccga ttttgattct 480caaacaaatg tgtcacaaag taaggattct gatgtgtata tcacagacaa aactgtgcta 540gacatgaggt ctatggactt caagagcaac agtgctgtgg cctggagcaa caaatctgac 600tttgcatgtg caaacgcctt caacaacagc attattccag aagacacctt cttccccagc 660ccagaaagtt cctgtgatgt caagctggtc gagaaaagct ttgaaacaga tacgaaccta 720aactttcaaa acctgtcagt gattgggttc cgaatcctcc tcctgaaagt ggccgggttt 780aatctgctca tgacgctgcg gctgtggtcc agctga 81665834DNAArtificialB12 alpha chain 2 (VJC) 65atgacacgag ttagcttgct gtgggcagtc gtggtctcca cctgtcttga atccggcatg 60gcccagacag tcactcagtc tcaaccagag atgtctgtgc aggaggcaga gactgtgacc 120ctgagttgca catatgacac cagtgagaat aattattatt tgttctggta caagcagcct 180cccagcaggc agatgattct cgttattcgc caagaagctt ataagcaaca gaatgcaacg 240gagaatcgtt tctctgtgaa cttccagaaa gcagccaaat ccttcagtct caagatctca 300gactcacagc tgggggacac tgcgatgtat ttctgtgctt tcattaactc tggggctggg 360agttaccaac tcactttcgg gaaggggacc aaactctcgg tcataccaaa tatccagaac 420cctgaccctg ccgtgtacca gctgagagac tctaaatcca gtgacaagtc tgtctgccta 480ttcaccgatt ttgattctca aacaaatgtg tcacaaagta aggattctga tgtgtatatc 540acagacaaaa ctgtgctaga catgaggtct atggacttca agagcaacag tgctgtggcc 600tggagcaaca aatctgactt tgcatgtgca aacgccttca acaacagcat tattccagaa 660gacaccttct tccccagccc agaaagttcc tgtgatgtca agctggtcga gaaaagcttt 720gaaacagata cgaacctaaa ctttcaaaac ctgtcagtga ttgggttccg aatcctcctc 780ctgaaagtgg ccgggtttaa tctgctcatg acgctgcggc tgtggtccag ctga 83466942DNAArtificialtyrosinase-directed TCR beta-chain B12 beta chain (VDJ region) 66atgggcacca gcctcctctg ctggatggcc ctgtgtctcc tgggggcaga tcacgcagat 60actggagtct cccagaaccc cagacacaag atcacaaaga ggggacagaa tgtaactttc 120aggtgtgatc caatttctga acacaaccgc ctttattggt accgacagac cctggggcag 180ggcccagagt ttctgactta cttccagaat gaagctcaac tagaaaaatc aaggctgctc 240agtgatcggt tctctgcaga gaggcctaag ggatctttct ccaccttgga gatccagcgc 300acagagcagg gggactcggc catgtatctc tgtgccagca gctccattag cttacctagc 360acagatacgc agtattttgg cccaggcacc cggctgacag tgctcgagga cctgaaaaac 420gtgttcccac ccgaggtcgc tgtgtttgag ccatcagaag cagagatctc ccacacccaa 480aaggccacac tggtgtgcct ggccacaggc ttctaccccg accacgtgga gctgagctgg 540tgggtgaatg ggaaggaggt gcacagtggg gtcagcacag acccgcagcc cctcaaggag 600cagcccgccc tcaatgactc cagatactgc ctgagcagcc gcctgagggt ctcggccacc 660ttctggcaga acccccgcaa ccacttccgc tgtcaagtcc agttctacgg gctctcggag 720aatgacgagt ggacccagga tagggccaaa cctgtcaccc agatcgtcag cgccgaggcc 780tggggtagag cagactgtgg cttcacctcc gagtcttacc agcaaggggt cctgtctgcc 840accatcctct atgagatctt gctagggaag gccaccttgt atgccgtgct ggtcagtgcc 900ctcgtgctga tggccatggt caagagaaag gattccagag gc 94267816DNAArtificialSW-M1-9 alpha chain (VJC) 67atgaaatcct tgagagtttt actagtgatc ctgtggcttc agttgagctg ggtttggagc 60caacagaagg aggtggagca gaattctgga cccctcagtg ttccagaggg agccattgcc 120tctctcaact gcacttacag tgaccgaggt tcccagtcct tcttctggta cagacaatat 180tctgggaaaa gccctgagtt gataatgttc atatactcca atggtgacaa agaagatgga 240aggtttacag cacagctcaa taaagccagc cagtatgttt ctctgctcat cagagactcc 300cagcccagtg attcagccac ctacctctgt gccgtgaccg gaacctacaa atacatcttt 360ggaacaggca ccaggctgaa ggttttagca aatatccaga accctgaccc tgccgtgtac 420cagctgagag actctaaatc cagtgacaag tctgtctgcc tattcaccga ttttgattct 480caaacaaatg tgtcacaaag taaggattct gatgtgtata tcacagacaa aactgtgcta 540gacatgaggt ctatggactt caagagcaac agtgctgtgg cctggagcaa caaatctgac 600tttgcatgtg caaacgcctt caacaacagc attattccag aagacacctt cttccccagc 660ccagaaagtt cctgtgatgt caagctggtc gagaaaagct ttgaaacaga tacgaaccta 720aactttcaaa acctgtcagt gattgggttc cgaatcctcc tcctgaaagt ggccgggttt 780aatctgctca tgacgctgcg gctgtggtcc agctga 81668939DNAArtificialmelan-A-directed TCR alpha-chain SW-M1-9 beta chain (VDJ region) 68atgggctgca ggctcctctg ctgtgtggtc ttctgcctcc tccaagcagg tcccttggac 60acagctgttt cccagactcc aaaatacctg gtcacacaga tgggaaacga caagtccatt 120aaatgtgaac aaaatctggg ccatgatact atgtattggt ataaacagga ctctaagaaa 180tttctgaaga taatgtttag ctacaataat aaggagctca ttataaatga aacagttcca 240aatcgcttct cacctaaatc tccagacaaa gctcacttaa atcttcacat caattccctg 300gagcttggtg actctgctgt gtatttctgt gccagcagcc ccctgggact agcggaggtt 360tccgagcagt acttcgggcc gggcaccagg ctcacggtca cagaggacct gaaaaacgtg 420ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 480gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg 540gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag 600cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 660tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 720gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg 780ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 840atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 900gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 93969810DNAArtificialmelan-A-directed TCR alpha-chain SW-M1-29 alpha chain (VJ region) 69atggagactc tcctgaaagt gctttcaggc accttgttgt ggcagttgac ctgggtgaga 60agccaacaac cagtgcagag tcctcaagcc gtgatcctcc gagaagggga agatgctgtc 120atcaactgca gttcctccaa ggctttatat tctgtacact ggtacaggca gaagcatggt 180gaagcacccg tcttcctgat gatattactg aagggtggag aacagaaggg tcatgaaaaa 240atatctgctt catttaatga aaaaaagcag caaagctccc tgtaccttac ggcctcccag 300ctcagttact caggaaccta cttctgcgga ggtaacaatg ccagactcat gtttggagat 360ggaactcagc tggtggtgaa gcccaatatc cagaaccctg accctgccgt gtaccagctg 420agagactcta aatccagtga caagtctgtc tgcctattca ccgattttga ttctcaaaca 480aatgtgtcac aaagtaagga ttctgatgtg tatatcacag acaaaactgt gctagacatg 540aggtctatgg acttcaagag caacagtgct gtggcctgga gcaacaaatc tgactttgca 600tgtgcaaacg ccttcaacaa cagcattatt ccagaagaca ccttcttccc cagcccagaa 660agttcctgtg atgtcaagct ggtcgagaaa agctttgaaa cagatacgaa cctaaacttt 720caaaacctgt cagtgattgg gttccgaatc ctcctcctga aagtggccgg gtttaatctg 780ctcatgacgc tgcggctgtg gtccagctga 81070939DNAArtificialmelan-A-directed TCR beta-chain SW-M1-29 beta chain (VDJ region) 70atgggccccc agctccttgg ctatgtggtc ctttgccttc taggagcagg ccccctggaa 60gcccaagtga cccagaaccc aagatacctc atcacagtga ctggaaagaa gttaacagtg 120acttgttctc agaatatgaa ccatgagtat atgtcctggt atcgacaaga cccagggctg 180ggcttaaggc agatctacta ttcaatgaat gttgaggtga ctgataaggg agatgttcct 240gaagggtaca aagtctctcg aaaagagaag aggaatttcc ccctgatcct ggagtcgccc 300agccccaacc agacctctct gtacttctgt gccagcaggc ccgggacagg aatttttgac 360ggggagctgt tttttggaga aggctctagg ctgaccgtac tggaggacct gaaaaacgtg 420ttcccacccg aggtcgctgt gtttgagcca tcagaagcag agatctccca cacccaaaag 480gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg 540gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag 600cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 660tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 720gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg 780ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 840atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 900gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 93971813DNAArtificialmelan-A-directed TCR alpha-chain SW-M1-54 alpha chain (VJ region) 71atgaaatcct tgagagtttt actagtgatc ctgtggcttc agttgagctg ggtttggagc 60caacagaagg aggtggagca gaattctgga cccctcagtg ttccagaggg agccattgcc 120tctctcaact gcacttacag tgaccgaggt tcccagtcct tcttctggta cagacaatat 180tctgggaaaa gccctgagtt gataatgttc atatactcca atggtgacaa agaagatgga 240aggtttacag cacagctcaa taaagccagc cagtatgttt ctctgctcat cagagactcc 300cagcccagtg attcagccac ctacctctgt gccccaaaca atgccagact catgtttgga 360gatggaactc agctggtggt gaagcccaat atccagaacc ctgaccctgc cgtgtaccag 420ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780ctgctcatga cgctgcggct gtggtccagc tga 81372948DNAArtificialmelan-A-directed TCR beta-chain SW-M1-54 beta chain (VDJ region) 72atggactcct ggaccttctg ctgtgtgtcc ctttgcatcc tggtagcgaa gcatacagat 60gctggagtta tccagtcacc ccgccatgag gtgacagaga tgggacaaga agtgactctg 120agatgtaaac caatttcagg ccacaactcc cttttctggt acagacagac catgatgcgg 180ggactggagt tgctcattta ctttaacaac aacgttccga tagatgattc agggatgccc 240gaggatcgat tctcagctaa gatgcctaat gcatcattct ccactctgaa gatccagccc 300tcagaaccca gggactcagc tgtgtacttc tgtgccagca gccccacgat cctggtggag 360gcgtacaccg gggagctgtt ttttggagaa ggctctaggc tgaccgtact ggaggacctg 420aaaaacgtgt tcccacccga ggtcgctgtg tttgagccat cagaagcaga gatctcccac 480acccaaaagg ccacactggt gtgcctggcc acaggcttct accccgacca cgtggagctg 540agctggtggg tgaatgggaa ggaggtgcac agtggggtca gcacagaccc gcagcccctc 600aaggagcagc ccgccctcaa tgactccaga tactgcctga gcagccgcct gagggtctcg 660gccaccttct ggcagaaccc ccgcaaccac ttccgctgtc aagtccagtt ctacgggctc 720tcggagaatg acgagtggac ccaggatagg gccaaacctg tcacccagat cgtcagcgcc 780gaggcctggg gtagagcaga ctgtggcttc acctccgagt cttaccagca aggggtcctg 840tctgccacca tcctctatga gatcttgcta gggaaggcca ccttgtatgc cgtgctggtc 900agtgccctcg tgctgatggc catggtcaag agaaaggatt ccagaggc 94873813DNAArtificialmelan-A-directed TCR alpha-chain SW-M1-66 alpha chain (VJ region) 73atgaaatcct tgagagtttt actagtgatc ctgtggcttc agttgagctg ggtttggagc 60caacagaagg aggtggagca gaattctgga cccctcagtg ttccagaggg agccattgcc 120tctctcaact gcacttacag tgaccgaggt tcccagtcct tcttctggta cagacaatat 180tctgggaaaa gccctgagtt gataatgttc atatactcca atggtgacaa agaagatgga 240aggtttacag cacagctcaa taaagccagc cagtatgttt ctctgctcat cagagactcc 300cagcccagtg attcagccac ctacctctgt gccgtcgggg gtgacaagat catctttgga 360aaagggacac gacttcatat tctccccaat atccagaacc ctgaccctgc cgtgtaccag 420ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780ctgctcatga cgctgcggct gtggtccagc tga 81374927DNAArtificialmelan-A-directed TCR beta-chain SW-M1-66 beta chain (VDJ region) 74atggactcct ggaccttctg ctgtgtgtcc ctttgcatcc tggtagcgaa gcatacagat 60gctggagtta tccagtcacc ccgccatgag gtgacagaga tgggacaaga agtgactctg 120agatgtaaac caatttcagg ccacaactcc cttttctggt acagacagac catgatgcgg 180ggactggagt tgctcattta ctttaacaac aacgttccga tagatgattc agggatgccc 240gaggatcgat tctcagctaa gatgcctaat gcatcattct ccactctgaa gatccagccc 300tcagaaccca gggactcagc tgtgtacttc tgtgccagca gtttgggaca gggctggccc 360cagcattttg gtgatgggac tcgactctcc atcctagagg acctgaacaa ggtgttccca 420cccgaggtcg ctgtgtttga gccatcagaa gcagagatct cccacaccca aaaggccaca 480ctggtgtgcc tggccacagg cttcttccct gaccacgtgg agctgagctg gtgggtgaat 540gggaaggagg tgcacagtgg ggtcagcacg gacccgcagc ccctcaagga gcagcccgcc 600ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac cttctggcag 660aacccccgca accacttccg ctgtcaagtc cagttctacg ggctctcgga gaatgacgag 720tggacccagg atagggccaa acccgtcacc cagatcgtca gcgccgaggc ctggggtaga 780gcagactgtg gctttacctc ggtgtcctac cagcaagggg tcctgtctgc caccatcctc 840tatgagatcc tgctagggaa ggccaccctg tatgctgtgc tggtcagcgc ccttgtgttg 900atggccatgg tcaagagaaa ggatttc 92775810DNAArtificialmelan-A-directed TCR alpha-chain SW-M1-67 alpha chain (VJ region) 75atgaaatcct tgagagtttt actagtgatc ctgtggcttc agttgagctg ggtttggagc 60caacagaagg aggtggagca gaattctgga cccctcagtg ttccagaggg agccattgcc 120tctctcaact gcacttacag tgaccgaggt tcccagtcct tcttctggta cagacaatat 180tctgggaaaa gccctgagtt gataatgttc atatactcca atggtgacaa agaagatgga 240aggtttacag cacagctcaa taaagccagc cagtatgttt ctctgctcat cagagactcc 300cagcccagtg attcagccac ctacctctgt gccgtgagga cacctcttgt ctttggaaag 360ggcacaagac tttctgtgat tgcaaatatc cagaaccctg accctgccgt gtaccagctg 420agagactcta aatccagtga caagtctgtc tgcctattca ccgattttga ttctcaaaca 480aatgtgtcac aaagtaagga ttctgatgtg tatatcacag acaaaactgt gctagacatg 540aggtctatgg acttcaagag caacagtgct gtggcctgga gcaacaaatc tgactttgca 600tgtgcaaacg ccttcaacaa cagcattatt ccagaagaca ccttcttccc cagcccagaa 660agttcctgtg atgtcaagct ggtcgagaaa agctttgaaa cagatacgaa cctaaacttt 720caaaacctgt cagtgattgg gttccgaatc ctcctcctga aagtggccgg gtttaatctg 780ctcatgacgc tgcggctgtg gtccagctga 81076927DNAArtificialmelan-A-directed TCR beta-chain SW-M1-67 beta chain (VDJ region) 76atgctctgct ctctccttgc ccttctcctg ggcactttct ttggggtcag atctcagact 60attcatcaat ggccagcgac cctggtgcag cctgtgggca gcccgctctc tctggagtgc 120actgtggagg gaacatcaaa ccccaaccta tactggtacc gacaggctgc aggcaggggc 180ctccagctgc tcttctactc cgttggtatt ggccagatca gctctgaggt gccccagaat 240ctctcagcct ccagacccca ggaccggcag ttcatcctga gttctaagaa gctccttctc 300agtgactctg gcttctatct ctgtgcctgg agttcaagcg gtttgggcgt tgagcagttc 360ttcgggccag ggacacggct caccgtgcta gaggacctga aaaacgtgtt cccacccgag 420gtcgctgtgt ttgagccatc agaagcagag atctcccaca cccaaaaggc cacactggtg 480tgcctggcca caggcttcta ccccgaccac gtggagctga gctggtgggt gaatgggaag 540gaggtgcaca gtggggtcag cacagacccg cagcccctca aggagcagcc cgccctcaat 600gactccagat actgcctgag cagccgcctg agggtctcgg ccaccttctg gcagaacccc 660cgcaaccact tccgctgtca agtccagttc tacgggctct cggagaatga cgagtggacc 720caggataggg ccaaacctgt cacccagatc gtcagcgccg aggcctgggg tagagcagac 780tgtggcttca cctccgagtc ttaccagcaa ggggtcctgt ctgccaccat cctctatgag 840atcttgctag ggaaggccac cttgtatgcc gtgctggtca gtgccctcgt gctgatggcc 900atggtcaaga gaaaggattc cagaggc 92777825DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-22 alpha (VJ region) 77atggagaaaa tgttggagtg tgcattcata gtcttgtggc ttcagcttgg ctggttgagt 60ggagaagacc aggtgacgca

gagtcccgag gccctgagac tccaggaggg agagagtagc 120agtctcaact gcagttacac agtcagcggt ttaagagggc tgttctggta taggcaagat 180cctgggaaag gccctgaatt cctcttcacc ctgtattcag ctggggaaga aaaggagaaa 240gaaaggctaa aagccacatt aacaaagaag gaaagctttc tgcacatcac agcccctaaa 300cctgaagact cagccactta tctctgtgct gtgcaggctt actcaaattc cgggtatgca 360ctcaacttcg gcaaaggcac ctcgctgttg gtcacacccc atatccagaa ccctgaccct 420gccgtgtacc agctgagaga ctctaaatcc agtgacaagt ctgtctgcct attcaccgat 480tttgattctc aaacaaatgt gtcacaaagt aaggattctg atgtgtatat cacagacaaa 540actgtgctag acatgaggtc tatggacttc aagagcaaca gtgctgtggc ctggagcaac 600aaatctgact ttgcatgtgc aaacgccttc aacaacagca ttattccaga agacaccttc 660ttccccagcc cagaaagttc ctgtgatgtc aagctggtcg agaaaagctt tgaaacagat 720acgaacctaa actttcaaaa cctgtcagtg attgggttcc gaatcctcct cctgaaagtg 780gccgggttta atctgctcat gacgctgcgg ctgtggtcca gctga 82578912DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-22 beta (VDJ region) 78atgctgagtc ttctgctcct tctcctggga ctaggctctg tgttcagtgc tgtcatctct 60caaaagccaa gcagggatat ctgtcaacgt ggaacctccc tgacgatcca gtgtcaagtc 120gatagccaag tcaccatgat gttctggtac cgtcagcaac ctggacagag cctgacactg 180atcgcaactg caaatcaggg ctctgaggcc acatatgaga gtggatttgt cattgacaag 240tttcccatca gccgcccaaa cctaacattc tcaactctga ctgtgagcaa catgagccct 300gaagacagca gcatatatct ctgcagcgtt gaagacagct atggctacac cttcggttcg 360gggaccaggt taaccgttgt agaggacctg aacaaggtgt tcccacccga ggtcgctgtg 420tttgagccat cagaagcaga gatctcccac acccaaaagg ccacactggt gtgcctggcc 480acaggcttct tccctgacca cgtggagctg agctggtggg tgaatgggaa ggaggtgcac 540agtggggtca gcacggaccc gcagcccctc aaggagcagc ccgccctcaa tgactccaga 600tactgcctga gcagccgcct gagggtctcg gccaccttct ggcagaaccc ccgcaaccac 660ttccgctgtc aagtccagtt ctacgggctc tcggagaatg acgagtggac ccaggatagg 720gccaaacccg tcacccagat cgtcagcgcc gaggcctggg gtagagcaga ctgtggcttt 780acctcggtgt cctaccagca aggggtcctg tctgccacca tcctctatga gatcctgcta 840gggaaggcca ccctgtatgc tgtgctggtc agcgcccttg tgttgatggc catggtcaag 900agaaaggatt tc 91279813DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-66 alpha chain (VJ region) 79atgacatcca ttcgagctgt atttatattc ctgtggctgc agctggactt ggtgaatgga 60gagaatgtgg agcagcatcc ttcaaccctg agtgtccagg agggagacag cgctgttatc 120aagtgtactt attcagacag tgcctcaaac tacttccctt ggtataagca agaacttgga 180aaaagacctc agcttattat agacattcgt tcaaatgtgg gcgaaaagaa agaccaacga 240attgctgtta cattgaacaa gacagccaaa catttctccc tgcacatcac agagacccaa 300cctgaagact cggctgtcta cttctgtgca gcaagggcag gcaacatgct cacctttgga 360gggggaacaa ggttaatggt caaaccccat atccagaacc ctgaccctgc cgtgtaccag 420ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780ctgctcatga cgctgcggct gtggtccagc tga 81380927DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-66 beta chain (VDJ region) 80atgctctgct ctctccttgc ccttctcctg ggcactttct ttggggtcag atctcagact 60attcatcaat ggccagcgac cctggtgcag cctgtgggca gcccgctctc tctggagtgc 120actgtggagg gaacatcaaa ccccaaccta tactggtacc gacaggctgc aggcaggggc 180ctccagctgc tcttctactc cgttggtatt ggccagatca gctctgaggt gccccagaat 240ctctcagcct ccagacccca ggaccggcag ttcatcctga gttctaagaa gctccttctc 300agtgactctg gcttctatct ctgtgcctgg ggtacgggac tagcgcttta cgagcagtac 360ttcgggccgg gcaccaggct cacggtcaca gaggacctga aaaacgtgtt cccacccgag 420gtcgctgtgt ttgagccatc agaagcagag atctcccaca cccaaaaggc cacactggtg 480tgcctggcca caggcttcta ccccgaccac gtggagctga gctggtgggt gaatgggaag 540gaggtgcaca gtggggtcag cacagacccg cagcccctca aggagcagcc cgccctcaat 600gactccagat actgcctgag cagccgcctg agggtctcgg ccaccttctg gcagaacccc 660cgcaaccact tccgctgtca agtccagttc tacgggctct cggagaatga cgagtggacc 720caggataggg ccaaacctgt cacccagatc gtcagcgccg aggcctgggg tagagcagac 780tgtggcttca cctccgagtc ttaccagcaa ggggtcctgt ctgccaccat cctctatgag 840atcttgctag ggaaggccac cttgtatgcc gtgctggtca gtgccctcgt gctgatggcc 900atggtcaaga gaaaggattc cagaggc 92781813DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-71 alpha chain (VJ region) 81atgaaatcct tgagagtttt actagtgatc ctgtggcttc agttgagctg ggtttggagc 60caacagaagg aggtggagca gaattctgga cccctcagtg ttccagaggg agccattgcc 120tctctcaact gcacttacag tgaccgaggt tcccagtcct tcttctggta cagacaatat 180tctgggaaaa gccctgagtt gataatgttc atatactcca atggtgacaa agaagatgga 240aggtttacag cacagctcaa taaagccagc cagtatgttt ctctgctcat cagagactcc 300cagcccagtg attcagccac ctacctctgt gccgtgaaca atgccagact catgtttgga 360gatggaactc agctggtggt gaagcccaat atccagaacc ctgaccctgc cgtgtaccag 420ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 480acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 540atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 600gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 660gaaagttcct gtgatgtcaa gctggtcgag aaaagctttg aaacagatac gaacctaaac 720tttcaaaacc tgtcagtgat tgggttccga atcctcctcc tgaaagtggc cgggtttaat 780ctgctcatga cgctgcggct gtggtccagc tga 81382918DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-71 beta chain (VDJ region) 82atgctctgct ctctccttgc ccttctcctg ggcactttct ttggggtcag atctcagact 60attcatcaat ggccagcgac cctggtgcag cctgtgggca gcccgctctc tctggagtgc 120actgtggagg gaacatcaaa ccccaaccta tactggtacc gacaggctgc aggcaggggc 180ctccagctgc tcttctactc cgttggtatt ggccagatca gctctgaggt gccccagaat 240ctctcagcct ccagacccca ggaccggcag ttcatcctga gttctaagaa gctccttctc 300agtgactctg gcttctatct ctgtgcctgg agcataggcg ctgagcagtt cttcgggcca 360gggacacggc tcaccgtgct agaggacctg aaaaacgtgt tcccacccga ggtcgctgtg 420tttgagccat cagaagcaga gatctcccac acccaaaagg ccacactggt gtgcctggcc 480acaggcttct accccgacca cgtggagctg agctggtggg tgaatgggaa ggaggtgcac 540agtggggtca gcacagaccc gcagcccctc aaggagcagc ccgccctcaa tgactccaga 600tactgcctga gcagccgcct gagggtctcg gccaccttct ggcagaaccc ccgcaaccac 660ttccgctgtc aagtccagtt ctacgggctc tcggagaatg acgagtggac ccaggatagg 720gccaaacctg tcacccagat cgtcagcgcc gaggcctggg gtagagcaga ctgtggcttc 780acctccgagt cttaccagca aggggtcctg tctgccacca tcctctatga gatcttgcta 840gggaaggcca ccttgtatgc cgtgctggtc agtgccctcg tgctgatggc catggtcaag 900agaaaggatt ccagaggc 91883831DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-72 alpha chain (VJ region) 83atgtcacttt ctagcctgct gaaggtggtc acagcttcac tgtggctagg acctggcatt 60gcccagaaga taactcaaac ccaaccagga atgttcgtgc aggaaaagga ggctgtgact 120ctggactgca catatgacac cagtgatcaa agttatggtc tattctggta caagcagccc 180agcagtgggg aaatgatttt tcttatttat caggggtctt atgacgagca aaatgcaaca 240gaaggtcgct actcattgaa tttccagaag gcaagaaaat ccgccaacct tgtcatctcc 300gcttcacaac tgggggactc agcaatgtat ttctgtgcaa tgagagaggg cgggggctac 360aataagctga tttttggagc agggaccagg ctggctgtac acccatatat ccagaaccct 420gaccctgccg tgtaccagct gagagactct aaatccagtg acaagtctgt ctgcctattc 480accgattttg attctcaaac aaatgtgtca caaagtaagg attctgatgt gtatatcaca 540gacaaaactg tgctagacat gaggtctatg gacttcaaga gcaacagtgc tgtggcctgg 600agcaacaaat ctgactttgc atgtgcaaac gccttcaaca acagcattat tccagaagac 660accttcttcc ccagcccaga aagttcctgt gatgtcaagc tggtcgagaa aagctttgaa 720acagatacga acctaaactt tcaaaacctg tcagtgattg ggttccgaat cctcctcctg 780aaagtggccg ggtttaatct gctcatgacg ctgcggctgt ggtccagctg a 83184915DNAArtificialsurvivin-directed TCR alpha-chain SW-Surv-72 beta chain (VDJ region) 84atgctctgct ctctccttgc ccttctcctg ggcactttct ttggggtcag atctcagact 60attcatcaat ggccagcgac cctggtgcag cctgtgggca gcccgctctc tctggagtgc 120actgtggagg gaacatcaaa ccccaaccta tactggtacc gacaggctgc aggcaggggc 180ctccagctgc tcttctactc cgttggtatt ggccagatca gctctgaggt gccccagaat 240ctctcagcct ccagacccca ggaccggcag ttcatcctga gttctaagaa gctcctcctc 300agtgactctg gcttctatct ctgtgccgga caggatttga acactgaagc tttctttgga 360caaggcacca gactcacagt tgtagaggac ctgaacaagg tgttcccacc cgaggtcgct 420gtgtttgagc catcagaagc agagatctcc cacacccaaa aggccacact ggtgtgcctg 480gccacaggct tcttccctga ccacgtggag ctgagctggt gggtgaatgg gaaggaggtg 540cacagtgggg tcagcacgga cccgcagccc ctcaaggagc agcccgccct caatgactcc 600agatactgcc tgagcagccg cctgagggtc tcggccacct tctggcagaa cccccgcaac 660cacttccgct gtcaagtcca gttctacggg ctctcggaga atgacgagtg gacccaggat 720agggccaaac ccgtcaccca gatcgtcagc gccgaggcct ggggtagagc agactgtggc 780tttacctcgg tgtcctacca gcaaggggtc ctgtctgcca ccatcctcta tgagatcctg 840ctagggaagg ccaccctgta tgctgtgctg gtcagcgccc ttgtgttgat ggccatggtc 900aagagaaagg atttc 915859PRTArtificialsynthetic tyrosinase peptide YMD, tyrosinase-369-377 85Tyr Met Asp Gly Thr Met Ser Gln Val 1 5 8610PRTArtificialsynthetic Melan-A peptide ELA, melan-A-27-35 86Glu Leu Ala Gly Ile Gly Ile Leu Thr Val 1 5 10 879PRTArtificialsynthetic survivin peptide LML, survivin-96-104 87Leu Met Leu Gly Glu Phe Leu Lys Leu 1 5 888PRTArtificialsynthetic influenza peptide GIL control, influenza matrix protein-58-66 88Gly Ile Leu Gly Phe Val Thr Leu 1 5

Claims

1. A nucleic acid molecule coding for the V(D)J regions of a T cell receptor (TCR) that recognizes the survivin antigen and comprising the nucleic acid sequence of SEQ ID NO: 83, 79, 81, or 77 coding for the .alpha.-chain and/or the nucleic acid sequence of SEQ ID NO: 84, 80, 82, or 78 coding for the 1-chain of said TCR, or a derivative thereof, coding for the .alpha.- or .beta.-chain, wherein the chain has been altered by one or more additions or deletions of from 1-15 amino acids, the additions or deletions being outside the CDR3 region of each chain and/or by conservative substitutions of from 1-15 amino acids, wherein the survivin antigen recognizing characteristics are maintained or improved, or a fragment thereof coding for a CDR3 region of a TCR recognizing the survivin antigen and having the nucleic acid sequence of SEQ ID NO: 27, 28, 23, 24, 25, 26, 21, 22 or coding for the amino acid sequences of SEQ ID NO: 55, 56, 51, 52, 53, 54, 49, 50, or a derivative of said fragment, wherein the CDR3 region has been altered by one or more additions and/or deletions of an overall number of from 1-5 amino acids. but not more than 1-3 contiguous amino acids and/or conservative substitutions of from 1-6 amino acids and wherein the survivin antigen recognizing characteristics are maintained or improved.

2. A TCR encoded by a nucleic acid of claim 1 or comprising one or more of the amino acid sequences of SEQ ID NO: 55, 56, 51, 53, 54, 49, 50.

3. A functional TCR .alpha. and/or .beta. chain fusion protein, comprising: a) at least one epitope-tag, and b) the amino acid sequence of an .alpha. and/or .beta. chain of a TCR according to claim 2, wherein said epitope-tag is selected from i) an epitope-tag added to the N- and/or C-terminus of said .alpha. and/or .beta. chain, or added into the .alpha. and/or .beta. chain sequence, but outside the CDR3 region, ii) an epitope-tag inserted into a constant region of said .alpha. and/or .beta. chain, and iii) an epitope-tag replacing a number of amino acids in a constant region of said .alpha. and/or .beta. chain.

4. A T cell expressing a TCR of claim 2.

5. An immunoglobulin molecule, anticaline, TCR .gamma./.delta. chain having a CDR3 region of claim 1 inserted.

6. A vector, which comprises one or more of the nucleic acids of claim 1.

7. A cell which has been transformed with the vector of claim 6.

8. A pharmaceutical composition which comprises a TCR of claim 2 and a pharmaceutically acceptable carrier.

9. A method of performing adoptive cell therapy, the method comprising administering the pharmaceutical composition of claim 8 to a patient in need thereof.

10. A method of treating a disease involving malignant cells expressing survivin in a patient in need thereof, the method comprising administering the pharmaceutical composition of claim 8 to the patient, thereby treating the disease.

11. A kit-of-parts or composition comprising: a) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the tyrosinase antigen; b) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR, wherein the TCR are directed against the melan-A antigen; and c) a group of vectors containing nucleic acid sequences coding for high-avidity, allo-restricted TCR. wherein the TCR are directed against the survivin antigen.

12-22. (canceled)

23. A pharmaceutical composition which comprises the kit-of-parts or composition of claim 11 and a pharmaceutically acceptable carrier, preferably an infusion or injection.

24-25. (canceled)

26. The TCR of claim 2, wherein the TCR is a soluble TCR.

27. The vector of claim 6, wherein the vector is a plasmid, shuttle vector, phagemid, cosmid, expression vector, retroviral vector, adenoviral vector or particle and/or vector to be used in gene therapy.

28. The cell of claim 7, wherein the cell is a peripheral blood lymphocyte (PBL).

29. The pharmaceutical composition of claim 8, wherein the composition is formulated for administration by infusion or injection.

30. A pharmaceutical composition which comprises a T cell of claim 4 and a pharmaceutically acceptable carrier.

31. A method of performing adoptive cell therapy, the method comprising administering the pharmaceutical composition of claim 30 to a patient in need thereof.

32. A method of treating a disease involving malignant cells expressing survivin in a patient in need thereof, the method comprising administering the pharmaceutical composition of claim 30 to the patient, thereby treating the disease.