U.S. patent application number 15/065777 was filed with the patent office on 2017-02-16 for treatment of complement-associated disorders.
The applicant listed for this patent is GENENTECH, INC.. Invention is credited to Avi Ashkenazi, Sherman Fong, Audrey Goddard, Austin L. Gurney, Karim Yussef Helmy, Kenneth James Katschke, Jr., Menno Van Lookeren, William I. Wood.
Application Number | 20170042967 15/065777 |
Document ID | / |
Family ID | 36149042 |
Filed Date | 2017-02-16 |
United States Patent
Application |
20170042967 |
Kind Code |
A1 |
Ashkenazi; Avi ; et
al. |
February 16, 2017 |
TREATMENT OF COMPLEMENT-ASSOCIATED DISORDERS
Abstract
The present invention concerns a recently discovered macrophage
specific receptor, CRIg, and its use in the treatment of
complement-associated disorders.
Inventors: |
Ashkenazi; Avi; (San Mateo,
CA) ; Helmy; Karim Yussef; (San Francisco, CA)
; Fong; Sherman; (Alameda, CA) ; Goddard;
Audrey; (San Francisco, CA) ; Gurney; Austin L.;
(San Francisco, CA) ; Katschke, Jr.; Kenneth James;
(Millbrae, CA) ; Lookeren; Menno Van; (San
Francisco, CA) ; Wood; William I.; (Hillsborough,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GENENTECH, INC. |
South San Francisco |
CA |
US |
|
|
Family ID: |
36149042 |
Appl. No.: |
15/065777 |
Filed: |
March 9, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13327523 |
Dec 15, 2011 |
|
|
|
15065777 |
|
|
|
|
11159919 |
Jun 22, 2005 |
8088386 |
|
|
13327523 |
|
|
|
|
10964263 |
Oct 12, 2004 |
7419663 |
|
|
11159919 |
|
|
|
|
10767904 |
Jan 29, 2004 |
7211400 |
|
|
10964263 |
|
|
|
|
10767374 |
Jan 29, 2004 |
7282565 |
|
|
10767904 |
|
|
|
|
PCT/US03/31207 |
Oct 1, 2003 |
|
|
|
10767374 |
|
|
|
|
10633008 |
Jul 31, 2003 |
7192589 |
|
|
PCT/US03/31207 |
|
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
10633008 |
|
|
|
|
09953499 |
Sep 14, 2001 |
6838554 |
|
|
10265542 |
|
|
|
|
09380138 |
Aug 25, 1999 |
|
|
|
PCT/US99/05028 |
Mar 8, 1999 |
|
|
|
09953499 |
|
|
|
|
09254465 |
Mar 5, 1999 |
6410708 |
|
|
PCT/US98/24855 |
Nov 20, 1998 |
|
|
|
09380138 |
|
|
|
|
60078936 |
Mar 20, 1998 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 31/14 20180101;
A61K 38/17 20130101; A61P 37/08 20180101; A61P 19/02 20180101; A61P
37/02 20180101; A61K 2039/505 20130101; A61P 7/06 20180101; Y02A
50/463 20180101; A61P 17/06 20180101; A61P 25/00 20180101; A61K
38/1709 20130101; A61P 13/12 20180101; A61P 17/00 20180101; A61P
29/00 20180101; A61P 11/00 20180101; A61P 41/00 20180101; C07K
2317/77 20130101; A61P 9/00 20180101; A61P 27/02 20180101; A61P
31/12 20180101; C07K 14/705 20130101; A61K 38/177 20130101; A61P
3/10 20180101; A61P 11/06 20180101; Y02A 50/30 20180101; A61P 1/00
20180101; C07K 2319/30 20130101; C07K 16/28 20130101; A61K 38/17
20130101; A61K 2300/00 20130101 |
International
Class: |
A61K 38/17 20060101
A61K038/17; C07K 14/705 20060101 C07K014/705 |
Claims
1. A method for the prevention or treatment of a
complement-associated diseases or condition, comprising treating a
subject in need of such treatment with a prophylactially or
therapeutically effective amount of a CRIg polypeptide or an
agonist thereof.
2. The method of claim 1 wherein said CRIg polypeptide is selected
from the group consisting of CRIg polypeptides of SEQ ID NO: 2, 4,
6, 8, and the extracellular regions of such polypeptides.
3. The method of claim 2 wherein said CRIg polypeptide is fused to
an immunoglobulin sequence.
4. The method of claim 3 wherein the immunoglobulin sequence is an
immunoglobulin constant region sequence.
5. The method of claim 4 wherein the immunoglobulin constant region
sequence is that of an immunoglobulin heavy chain.
6. The method of claim 5 wherein said immunoglobulin heavy chain
constant region sequence is fused to an extracellular region of a
CRIg polypeptide of SEQ ID NO: 2, 4, 6, or 8.
7. The method of claim 6 wherein said immunoglobulin heavy chain
constant region sequence is that of an IgG.
8. The method of claim 7 wherein said IgG is selected from IgG-1
and IgG-3.
9. The method of claim 7 wherein the IgG-1 heavy chain constant
region sequence comprises at least a hinge, CH2 and CH3 region.
10. The method of claim 7 wherein the IgG-1 heavy chain constant
region sequence comprised a hinge, CH1, CH2 and CH3 region.
11. The method of claim 1 wherein said complement-associated
disease is an inflammatory disease or an autoimmune disease.
12. The method of claim 11 wherein said complement-associated
disease is selected from the group consisting of rheumatoid
arthritis (RA), adult respiratory distress syndrome (ARDS), remote
tissue injury after ischemia and reperfusion, complement activation
during cardiopulmonary bypass surgery, dermatomyositis, pemphigus,
lupus nephritis and resultant glomerulonephritis and vasculitis,
cardiopulmonary bypass, cardioplegia-induced coronary endothelial
dysfunction, type II membranoproliferative glomerulonephritis, IgA
nephropathy, acute renal failure, cryoglobulemia, antiphospholipid
syndrome, age-related macular degeneration, uveitis, diabetic
retinopathy, allo-transplantation, hyperacute rejection,
hemodialysis, chronic occlusive pulmonary distress syndrome (COPD),
asthma, aspiration pneumonia, utricaria, chronic idiopathic
utricaria, hemolytic ureinic syndrome, endometriosis, cardiogenic
shock, ischemia reperfusio injury, and multiple schlerosis
(MS).
13. The method of claim 11 wherein said complement-associated
disease is selected from the group consisting of inflammatory bowel
disease (IBD), systemic lupus erythematosus, rheumatoid arthritis,
juvenile chronic arthritis, spondyloarthropathies, systemic
sclerosis (scleroderma), idiopathic inflammatory myopathies
(dermatomyositis, polymyositis), Sjogren's syndrome, systemic
vaculitis, sarcoidosis, autoimmune hemolytic anemia (immune
pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune
thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection, graft-versus host disease, Alzheimer's disease,
paroxysmal nocturnal hemoglobinurea, hereditary angioedema and
atherosclerosis.
14. The method of claim 11 wherein said complement-associated
disease is rheumatoid arthritis (RA), psoriasis or asthma.
15. The method of claim 2 wherein said subject is a mammal.
16. The method of claim 14 wherein said mammal is a human.
17. A method for inhibition of the production of C3b complement
fragment in a mammal comprising administering to said mammal an
effective amount of a CRIg polypeptide or an agonist thereof.
18. The method of claim 16 wherein said CRIg polypeptide is
selected from the group consisting of CRIg polypeptides of SEQ ID
NO: 2, 4, 6, 8, and the extracellular regions of such
polypeptides.
19. The method of claim 17 wherein said CRIg polypeptide is fused
to an immunoglobulin sequence.
20. The method of claim 18 wherein the immunoglobulin sequence is
an immunoglobulin constant region sequence.
21. The method of claim 19 wherein the immunoglobulin constant
region sequence is that of an immunoglobulin heavy chain.
22. The method of claim 20 wherein said immunoglobulin heavy chain
constant region sequence is fused to an extracellular region of a
CRIg polypeptide of SEQ ID NO: 2, 4, 6, or 8.
23. The method of claim 21 wherein said immunoglobulin heavy chain
constant region sequence is that of an IgG.
24. The method of claim 22 wherein said IgG is selected from IgG-1
and IgG-3.
25. The method of claim 23 wherein the IgG-1 heavy chain constant
region sequence comprises at least a hinge, CH2 and CH3 region.
26. The method of claim 23 wherein the IgG-1 heavy chain constant
region sequence comprised a hinge, CH1, CH2 and CH3 region.
27. A method for selective inhibition of the alternative complement
pathway in a mammal, comprising administering to said mammal an
effective amount of CRIg polypeptide or an agonist thereof.
28. A method for the prevention or treatment of age-related macular
degeneration (AMD) or choroidal neovascularization (CNV) in a
subject, comprising administering to said subject an effective
amount of a complement inhibitor.
29. The method of claim 28 wherein the complement inhibitor is a
selective inhibitor of the alternative complement pathway.
30. The method of claim 29 wherein said complement inhibitor is an
antibody or an antibody fragment.
31. The method of claim 29 wherein said complement inhibitor is a
fusion protein.
32. The method of claim 31 wherein said fusion protein is an
immunoadhesin.
33. The method of claim 29 wherein said complement inhibitor is a
peptide or non-peptide small molecule.
34. The method of claim 29 wherein said complement inhibitor is
CRIg or an agonist thereof.
35. The method of claim 34 wherein said agonist is a soluble
CRIg.
36. The method of claim 34 wherein said agonist is a CRIg-Ig fusion
protein.
37. The method of claim 34 wherein said agonist is a CRIg antibody
or antibody fragment.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of copending U.S.
application Ser. No. 10/964,263, filed on Oct. 12, 2004, which is a
continuation-in-part of Ser. Nos. 10/767,374 and 10/767,904, each
filed on Jan. 29, 2004, which are divisional applications of U.S.
application Ser. No. 09/953,499 filed on Sep. 14, 2001. This
application is also a continuation-in-part of copending PCT
application No. PCT/US03/31207 filed on Oct. 1, 2003, which is a
continuation-in-part of U.S. application Ser. No. 10/633,008 filed
on Jul. 31, 2003, which is a continuation-in-part of U.S.
application Ser. No. 10/265,542 filed on Oct. 3, 2002, which is a
continuation-in-part of U.S. application Serial No. 09/09/953,499
filed on Sep. 14, 2001, which is a continuation of application Ser.
No. 09/254,465 filed on Mar. 5, 1999, now U.S. Pat. No. 6,410,708,
and where U.S. application Ser. No. 09/953,499 is also a
continuation-in-part of U.S. application Ser. No. 09/380,138 filed
Aug. 25, 1999 (now abandoned), which is a national stage
application under 35 U.S.C. .sctn.371 of PCT application No.
PCT/U599/05028 filed Mar. 8, 1999, which is a continuation-in-part
of U.S. application Ser. No. 09/254,465 filed on Mar. 5, 1999, now
U.S. Pat. No. 6,410,708, which is a national stage application
under 35 U.S.C. .sctn.371 of PCT/U598/24855 filed Nov. 20, 1998,
which claims priority under 35 U.S.C .sctn.119 to provisional
application Ser. No. 60/078,936 filed on Mar. 20, 1998, now
abandoned.
FIELD OF THE INVENTION
[0002] The present invention concerns a recently discovered
macrophage specific receptor, CRIg (earlier referred to as CRIg),
and its use in the treatment of complement-associated
disorders.
BACKGROUND OF THE INVENTION
[0003] The complement system is a complex enzyme cascade made up of
a series of serum glycoproteins, that normally exist in inactive,
pro-enzyme form. Two main pathways, the classical and the
alternative pathway, can activate complement, which merge at the
level of C3, where two similar C3 convertases cleave C3 into C3a
and C3b.
[0004] Classical pathway components are labeled with a C and a
number (e.g. C1, C3). Because of the sequence in which they were
identified, the first four components are numbered C1, C4, C2, and
C3. Alternative pathway components are lettered (e.g. B, P, D).
Cleavage fragments are designated with a small letter following the
designation of the component (e.g. C3a and C3b are fragments of
C3). Inactive C3b is designated iC3b. Polypeptide chains of
complement proteins are designated with a Greek letter after the
component (e.g. C3a and C3.beta. are the .alpha. and .beta.-chains
of C3). Cell membrane receptors for C3 are abbreviated CR1, CR2,
CR3, and CR4.
[0005] The classical pathway of the complement system is a major
effector of the humoral branch of the human immune response. The
trigger activating the classical pathway is either IgG or IgM
antibody bound to antigen. Binding of antibody to antigen exposes a
site on the antibody which is a binding site for the first
complement component, C1. C1 binds to the exposed regions of at
least two antigen-bound antibodies, and as a result, its C1r and
C1s subunits are activated. Activated C1s is responsible for the
cleavage of the next two involved complement components, C4 and C2.
C4 is cleaved into two fragments, of which the larger C4b molecule
attaches to the target membrane nearby while the small C4a molecule
leaves. An exposed site on deposited C4b is available to interact
with the next complement component, C2. Just as in the previous
step, activated C1s cleaves the C2 molecule into two pieces, of
which the fragment C2a remains, while the smaller C2b fragment
leaves. C4b2a, also known as the C3 convertase, remains bound to
the membrane. This C3 convertase converts the next complement
component, C3 into its active form.
[0006] Activation of the alternative complement pathway begins when
C3b binds to the cell wall and other cell components of the
pathogens and/or to IgG antibodies. Factor B then combines with
cell-bound C3b and forms C3bB. C3bB is then split into Bb and Ba by
factor B, to forming the alternative pathway C3 convertase, C3bBb.
Properdin, a serum protein, then binds C3bBb and forms C3bBbP that
functions as a C3 convertase, which enzymatically splits C3
molecules into C3a and C3b. At this point, the alternative
complement pathway is activated. Some of C3b binds to C3bBb to form
C3bBb3b, which is capable of splitting C5 molecules into C5a and
C5b.
[0007] The alternative pathway is a self-amplifying pathway and is
important in the clearance and recognition of bacteria and other
pathogens in the absence of antibodies. The alternative pathway can
also amplify complement activation after initial complement
activation by either the lectin and/or classical pathway. The
rate-limiting step of activation of the alternative pathway in
humans is the enzymatic action of factor D on the cleavage of
factor B to form the alternative pathway C3 convertase, C3bBb.
(Stahl et al., American Journal of Pathology 162:449-455 (2003)).
There is strong evidence for the role of complement activation and
deposition in adjuvant-induced arthritis (AIA), and
collagen-induced arthritis (CIA) and in a variety of other diseases
and conditions.
[0008] The role of the complement system in inflammatory conditions
and associated tissue damage, autoimmune diseases, and
complement-associated diseases is well known.
[0009] It has been suggested that the alternative pathway plays an
important role in inflammation (Mollnes et al., Trends in
Immunology 23:61-64 (2002)), local and remote tissue injury after
ischemia and reperfusion (Stahl et al., supra); adult respiratory
distress syndrome (ARDS, Schein et al., Chest 91:850-854 (1987));
complement activation during cardiopulmonary bypass surgery (Fung
et al., J Thorac Cardiovasc Surg 122:113-122 (2001));
dermatomyositis (Kissel, J T et al., NFAI 314:329-334 (1986)); and
pemphigus (Honguchi et al., J Invest Dermatol 92:588-592 (1989)).
The alternative complement pathway has also been implicated in
autoimmune diseases, such as, for example, lupus nephritis and
resultant glomerulonephritis and vasculitis (see, e.g. Watanabe et
al., J. Immunol. 164:786-794 (2000)); and rheumatoid arthritis,
such as juvenile rheumatoid arthritis (Aggarwal et al.,
Rheumatology 29:189-192 (2000); and Neumann E et al., Arthritis
Rheum. 4:934-45 (2002)).
[0010] Local increase in complement deposition and activation
correlate with disease severity (Atkinson, J Clin Invest
112:1639-1641 (2003)). C5a receptor antagonists, such as peptides
and small organic molecules, have been tested for the treatment of
arthritis (Woodruf et al., Arthritis & Rheumatism
46(9):2476-2485 (2002)), and various other immunoinflammatory
diseases (Short et al., Br J Pharmacol 126:551-554 (1999); Finch et
al., J Med Chem 42:1965-1074 (1999)); and companies, such as
Promics (Australia) have been conducting human clinical trials to
test the efficacy of C5a antagonists in similar indications. C5a
has also been implicated in dermatomyositis, and pemphigus.
(Kissel, J T et al, NEJM 314:329-334 (1986)). Anti-C5a monoclonal
antibodies have been shown to reduce cardiopulmonary bypass and
cardioplegia-induced coronaiy endothelial dysfunction (Tofulcuji et
at, J Thorac. Cardiovasc. Surg. 116:1060-1069 (1998)), prevent
collagen-induced arthritis and ameliorate established disease (Wang
et al., Proc. Natl. Acad. Sci. USA 92(19):8955-8959 (1995)).
[0011] Opsonophagocytosis, the process of deposition of complement
fragments on the surface of particles and the subsequent uptake by
phagocytic cells, is crucial for the clearance of circulating
particles including immune complexes, apoptotic cells or cell
debris and pathogens (Gasque, P., Mol Immunol. 41:1089-1098
(2004)). Tissue resident macrophages are known to play an important
role in the complement mediated clearance of particles from the
circulation. Kupffer cells, constituting over 90% of the tissue
resident macrophages, are continuously exposed to blood from the
hepatic portal vein and are strategically positioned in liver
sinusoids to efficiently clear opsonized viruses, tumor cells,
bacteria, fungi, parasites and noxious substances from the
gastrointestinal tract. This clearance process is for a large part
dependent on the presence of complement C3 as an opsonin (Fujita et
al., Immunol. Rev. 198:185-202 (2004)). Upon binding to bacterial
surfaces via a thoesther, C3 is cleaved and amplifies the
alternative pathway of complement. This reaction leads to further
deposition of C3 fragments that can serve as ligands for complement
receptors on macrophages. The importance of this pathway is shown
by the high susceptibility of humans lacking C3 to bacterial and
viral infections (ref).
[0012] The complement receptors characterized so far, CR1, 3 and 4
internalize C3b and phagocytosis C3 opsonized particles only after
PKC activation or Fc receptor stimulation (Carpentier et al., Cell
Regul 2, 41-55 (1991); Sengelov, Crit. Rev. Immunol. 15: 107-131
(1995); Sengelov et al., J. Immunol. 153:804-810 (1994). Moreover,
CR1 is not expressed on the surface of murine Kupffer cells (Fang
et al., J. Immunol. 160:5273-5279 (1998) Complement receptors that
aid KCs in the constitutive clearance of circulating particles have
not been described so far.
[0013] An anti-C3b(i) antibody has been reported to enhance
complement activation, C3b(i) deposition, and killing of CD20.sup.+
cells by rituximab (Kennedy et al., Blood 101(3):1071-1079
(2003)).
[0014] In view of the known involvement of the complement cascade
in a variety of diseases, there is a need for identification and
development of new pharmaceuticals for the prevention and/or
treatment of complement-associated diseases.
SUMMARY OF THE INVENTION
[0015] The present invention is based on the identification of a
novel member of the complement receptor family and the first
immunoglobulin (Ig) superfamily member that interacts with the
complement system.
[0016] In one aspect, the invention concerns a method for the
prevention or treatment of a complement-associated diseases or
condition, comprising treating a subject in need of such treatment
with a prophylactically or therapeutically effective amount of a
CRIg polypeptide or an agonist thereof.
[0017] In another aspect, the invention concerns a method for
inhibition of the production of C3b complement fragment in a mammal
comprising administering to said mammal an effective amount of a
CRIg polypeptide or an agonist thereof.
[0018] In yet another aspect, the invention concerns method for
selective inhibition of the alternative complement pathway in a
mammal, comprising administering to said mammal an effective amount
of CRIg polypeptide or an agonist thereof.
[0019] In all aspects, the CRIg polypeptide may, for example, be
selected from the group consisting of CRIg polypeptides of SEQ ID
NO: 2, 4, 6, 8, and the extracellular regions of such
polypeptides.
[0020] In other embodiments of the methods of the invention, the
CRIg polypeptide is fused to an immunoglobulin sequence. The
immunoglobulin sequence may, for example, be an immunoglobulin
constant region sequence, such as a constant region sequence of an
immunoglobulin heavy chain. In another embodiment, the
immunoglobulin heavy chain constant region sequence is fused to an
extracellular region of a CRIg polypeptide of SEQ ID NO: 2, 4, 6,
or 8.
[0021] In a further embodiment, the immunoglobulin heavy chain
constant region sequence is that of an IgG, such as an IgG-1 or
IgG-3, where the IgG-1 heavy chain constant region sequence may,
for example, comprise at least a hinge, CH2 and CH3 region, or the
hinge CH1, CH2 and CH3 regions.
[0022] The complement-associated disease may, for example, be an
inflammatory disease or an autoimmune disease.
[0023] In one specific embodiment, the complement-associated
disease is selected from the group consisting of rheumatoid
arthritis (RA), adult respiratory distress syndrome (ARDS), remote
tissue injury after ischemia and reperfusion, complement activation
during cardiopulmonary bypass surgery, dermatomyositis, pemphigus,
lupus nephritis and resultant glomerulonephritis and vasculitis,
cardiopulmonary bypass, cardioplegia-induced coronary endothelial
dysfunction, type II membranoproliferative glomerulonephritis, IgA
nephropathy, acute renal failure, cryoglobulemia, antiphospholipid
syndrome, age-related macular degeneration, uveitis, diabetic
retinopathy, allo-transplantation, hyperacute rejection,
hemodialysis, chronic occlusive pulmonary distress syndrome (COPD),
asthma, Alzheimer's disease, atherosclerosis, hereditary
angioedema, paroxysmal nocturnal hemglobinurea and aspiration
pneumonia.
[0024] In another specific embodiment, the complement-associated
disease is selected from the group consisting of inflammatory bowel
disease (IBD), systemic lupus erythematosus, rheumatoid arthritis,
juvenile chronic arthritis, spondyloarthropathies, systemic
sclerosis (scleroderma), idiopathic inflammatory myopathies
(dermatomyositis, polymyositis), Sjogren's syndrome, systemic
vaculitis, sarcoidosis, autoimmune hemolytic anemia (immune
pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune
thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nontiepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection and graft-versus host disease.
[0025] In yet another specific embodiment, the
complement-associated disease is rheumatoid arthritis (RA),
psoriasis or asthma.
[0026] In all embodiments, the subject may be a mammal, such as a
human patient.
[0027] In a further aspect, the invention concerns a method for the
prevention or treatment of age-related macular degeneration (AMD)
or choroidal neovascularization (CNV) in a subject, comprising
administering to the subject an effective amount of a complement
inhibitor.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A-1B shows the nucleotide and amino acid sequences of
a 321-amino acid human CRIg polypeptide (SEQ ID NOS: 1 and 2,
respectively).
[0029] FIGS. 2A-2B shows the nucleotide and amino acid sequences of
the 399-amino acid full-length long form of native human CRIg
(huCRIg, SEQ ID NOS: 3 and 4, respectively).
[0030] FIGS. 3A-3B shows the nucleotide and amino acid sequences of
the 305-amino acid short form of native human CRIg (huCRIg-short,
SEQ ID NOS: 5 and 6, respectively).
[0031] FIGS. 4A-4C shows the nucleotide and amino acid sequence of
the 280-amino acid native murine CRIg (muCRIg, SEQ ID NOS: 7 and 8,
respectively).
[0032] FIG. 5 shows the amino acid sequence of full-length huCRIg
(SEQ ID NO: 4) and huCRIg-short (SEQ ID NO: 6) in alignment with
muCRIg (SEQ ID NO: 8). The hydrophobic signal sequence, IgV, IgC
and transmembrane regions are shown. muCRIg has a predicted single
N-linked glycosylation site at position 170 (NGTG). The Ig domain
boundaries, deduced from the exon-intron boundaries of the human
CRIg gene, are indicated.
[0033] FIG. 6 shows in situ hybridization of CRIg in mouse liver
frozen sections.
[0034] FIG. 7 shows in situ hybridization of CRIg in human liver
frozen sections.
[0035] FIG. 8 shows in situ hybridization of CRIg in activated
colon and adrenal macrophages, Kupffer cells, and placental
Hofbauer cells.
[0036] FIG. 9 shows in situ hybridization of CRIg mRNA in RA
synovial cells.
[0037] FIG. 10 shows in situ hybridization of CRIg mRNA in brain
microglia cells.
[0038] FIG. 11 shows in situ hybridization of CRIg mRNA in cells
from human asthmatic tissue.
[0039] FIG. 12 shows in situ hybridization of CRIg mRNA in cells
from human chronic hepatitis tissue.
[0040] FIG. 13 shows immunohistochemical analysis of CRIg in
adrenal gland macrophages.
[0041] FIG. 14 shows immunohistochemical analysis of CRIg in liver
Kupffer cells.
[0042] FIG. 15 shows immunohistochemical analysis of CRIg in brain
microglial cells.
[0043] FIG. 16 shows immunohistochemical analysis of CRIg in
placental Hofbauer cells.
[0044] FIG. 17. Northern blot analysis showing expression of huCRIg
in a variety of tissues. Two transcripts of 1.5 and 1.8 kb were
present in the human tissues expressing CRIg.
[0045] FIG. 18. (A) TAQMAN.TM. PCR analysis showing increased
expression of huCRIg in myelomonocytic cell lines HL60 and THP-1
and in differentiated macrophages. Low levels of expression were
found in Jurkat T cells, MOLT3, MOLT4 and RAMOS B-cell lines. (B)
Increased expression of huCRIg mRNA during in vitro monocyte
differentiation. Monocytes isolated from human peripheral blood
were differentiated by adhering to plastic over 7 day period. Total
RNA was extracted at different time points during differentiation.
(C) Increased expression of huCRIg protein during monocyte to
macrophage differentiation. Monocytes were treated as indicated in
(B), whole cell lysates were run on a gel and transferred to
nitrocellulose membrane that was incubated with a polyclonal
antibody (4F7) to huCRIg. The polyclonal antibody recognized a 48
and 38 kDa band possibly representing the long and the short form
of huCRIg.
[0046] FIG. 19. Molecular characterization of huCRIg protein in
cell lines. (A) huCRIg-gd was transiently expressed in 293E cells,
immunoprecipitated with anti-gd and blots incubated with anti-gd or
a polyclonal antibody to the extracellular domain of CRIg. (B)
huCRIg expressed in 293 cells is a monomeric N-glycosylated
protein. CRIg is tyrosine phosphorylated upon treatment of HEK293
cells with sodium pervanadate but does not recruit Syk kinase
Phosphorylated CRIg migrated at a slightly higher molecular mass
compared to non-phosphorylated CRIg.
[0047] FIG. 20. Selective expression of huCRIg on human
monocyte-derived macrophages. Peripheral blood mononuclear cells
were stained with antibodies specific for B, T, NK cells, monocytes
and with a ALEXA.TM. A488 conjugated monoclonal antibody (3C9) to
CRIg. Expression was absent in all peripheral blood leukocytes as
well as in monocyte derived dendritic cells, but was expressed in
in vitro differentiated macrophages.
[0048] FIGS. 21A-B. CRIg mRNA and protein expression was increased
by IL-10 and dexamethasone. (A) Real-time PCR shows increased
expression of CRIg mRNA following treatment with IL-10, TGF.beta.
and was highly induced by dexamethasone but was down-regulated by
treatment with LPS, IFN.gamma., and TNF.alpha.. (B)
Ficoll-separated peripheral blood mononuclear cells were treated
with various cytokines and dexamethasone for 5 days and
double-stained with anti-CD14 and anti-CRIg. Flow analysis showed a
dramatic increase in CRIg expression on the surface of monocytes
treated with dexamethasone and after treatment with IL-10 and
LPS.
[0049] FIG. 22. Subcellular localization of CRIg in
monocyte-derived macrophages. Monocytes were cultured for 7 days in
macrophage differentiation medium, fixed in acetone and stained
with polyclonal anti-CRIg antibody 6F1 or CD63 and secondary
goat-anti-rabbit FITC. Cells were studied in a confocal microscope.
CRIg is found in the cytoplasm were it co-localizes with the
lysosomal membrane protein CD63. CRIg was also expressed at the
trailing and leading edges of macrophages in a pattern similar to
that of F-actin. Scale bar=10 .mu.m.
[0050] FIG. 23. Localization of CRIg mRNA in chronic inflammatory
diseases. In situ hybridization showed the presence of CRIg mRNA in
alveolar macrophages obtained from tissue of a patient with
pneumonia (A, B) or a patient with chronic asthma (C, D). CRIg mRNA
was also expressed in liver Kupffer cells in tissue obtained from a
liver biopsy of a patient with chronic hepatitis (E, F).
[0051] FIG. 24. CRIg mRNA expression was increased in inflamed
synovium. CRIg mRNA was low or absent in synovial membranes of a
joint obtained from a knee replacement of a patient with no joint
inflammation (A, C) but was highly expressed in cells, potentially
synoviocytes or synovial macrophages, in the pannus of a patient
with osteoarthritis (B, D).
[0052] FIG. 25. Detection of CRIg protein with polyclonal antibody
6F1 in cells lining the synovium of a patient with degenerative
joint disease (A, B, C). No immunohistochemical detection of CRIg
was found in a control synovium (D).
[0053] FIG. 26. CRIg protein was expressed in a subtype of tissue
resident macrophages and its expression was increased in chronic
inflammatory diseases. (A) CRIg was expressed on the membrane of
CHO cells stably expressing CRIg. High expression of CRIg protein
was found in alveolar macrophages (B) in tissues obtained from a
patient with chronic asthma (C) Expression of CRIg in histiocytes
of the human small intestine. The section was obtained from
surgically removed tissue and could have contained a neoplasm. (D)
Expression of CRIg protein in Hofbauer cells in human pre-term
placenta. High expression of CRIg protein in macrophages was
present in the adrenal gland (E) and in Kupffer cells of human
liver (F). Staining was performed on 5 lam thick acetone-fixed
sections using DAB as the chromogen. Images were photographed at a
20.times. and 40.times. magnification.
[0054] FIG. 27. Immunohistochemical staining of CD68 and CRIg on a
vascular plaque obtained from a patient with atherosclerosis.
Consecutive sections were fixed and stained with a monoclonal
antibody to human CD68 (A, B) and a polyclonal antibody 6F1 raised
against human CRIg (C, D). CRIg appeared in a population of
macrophages and phoam cells present in the atherosclerotic plaque,
and overlapped with CD68 positive macrophages, as judged from
staining on consecutive sections. Magnification: 10.times. (A, C)
and 20.times. (B, D).
[0055] FIG. 28. Co-staining of CRIg and CD68 on heart interstitial
macrophages. 5 .mu.m sections were obtained from a human heart
(autopsy) and stained with a monoclonal antibody to CRIg (3C9) and
a secondary anti-mouse FITC-labeled antibody. CD68 was detected by
staining with a PE-labeled monoclonal antibody to CD68.
Magnification: 20.times..
[0056] FIG. 29. CRIg mRNA levels are significantly elevated in
colon tissue obtained from patients with ulcerative colitis,
Croluts disease, chronic occlusive pulmonary disease (COPD) and
asthma Real-time PCR was performed on total RNA extracted from the
various tissues. mRNA for CRIg was significantly increased in
tissues obtained from patients with ulcerative colitis, Croluts
disease and COPD. Statistical analysis was performed using the
Mann-Whitney U-test.
[0057] FIG. 30. Cells expressing human CRIg showed increased
adherence to human endothelial cells. (A) CRIg was stably expressed
in a human Jurkat T-cell line. (B) Cells were preloaded with the
fluorescent dye BCECF (Molecular Probes, Oregon) and added to a 96
well plate coated with a monolayer of human umbilical vein
endothelial cells (HUVEC) treated with or without 10 ng/ml
TNF.alpha. After 3 washes, fluorescence was counted in a
spectro-fluorometer which indicated the number of cells that remain
adherent to the HUVEC cells. The graph was representative of 4
independent experiments.
[0058] FIG. 31. Inhibition of progression of collagen-induced
arthritis (CIA) mouse model by muCRIg IgG-Fc fusion protein. A
group of (CIA) mice (n=7) was given 100 .mu.g of muCRIg IgG-Fc
fusion protein (squares), whereas a CIA mouse control group (n-8)
received 100 .mu.g of murine IgG1 (circles), 3 times per week for 6
weeks. Mice were examined daily for signs of inflammation and
scored on a scale of 0-16 (details in Example 25) and the results
were plotted graphically (mean.+-.SD, Students T test
p-value=0.0004 for control IgG1 vs. test muCRIg protein).
[0059] FIG. 32 is the nucleotide sequence of DNA42257 (consensus
sequence) (SEQ ID NO: 9).
[0060] FIG. 33 shows reduction in joint swelling in CRIg-Fc treated
mice.
[0061] FIG. 34 shows that muCRIg inhibits joint inflammation.
[0062] FIG. 35 shows preservation of cortical bone volume in joints
of mice treated with muCRIg-Fc.
[0063] FIG. 36 shows that CRIg-Fc treatment does not alter the
number nor the morphology of tissue resident macrophages.
[0064] FIG. 37 shows that muCRIg treatment does not affect serum
anti-collagen antibody titers.
[0065] FIG. 38 shows that muCRIg does not alter T-independent B
cell responses in vivo.
[0066] FIG. 39 shows macrophage infiltration in joints following
antibody-induced arthritis (AIA), generated with F4/80 staining in
undecalcified frozen joints.
[0067] FIG. 40 shows that muCRIg-Fc prevents joint swelling
following antibody-induced arthritis in balb/c mice.
[0068] FIG. 41 shows that muCRIg inhibits joint inflammation in
antibody-induced arhritis.
[0069] FIG. 42 shows that murine CRIg-Fc fusion protein binds to
C3-opsonized sheep red blood cells (E-IgM).
[0070] FIG. 43 shows that binding of human CRIg-Fc to E-IgM is C3
dependent.
[0071] FIG. 44 shows the binding of serum-opsonized particles to
CRIg-expressing CHO cells.
[0072] FIG. 45 shows that murine CRIg-Fc binds complement C3b and
iC3b but does not bind C2, C4, C3c, and C3d.
[0073] FIG. 46 shows that murine and human CRIg-Fc bind complement
C3b, C3bi and C3c but do not bind C1, C2, C4, C3a, and C3d.
[0074] FIG. 47A shows that murine and human CRIg-Fc inhibit C3
deposition of zymosan.
[0075] FIG. 47B shows that murine CRIg-Fc inhibits C3 activation is
serum.
[0076] FIG. 48 shows that murine CRIg inhibits alternative
pathway-induced hemolysis but does not affect classical pathway
hemolysis.
[0077] FIGS. 49A-E shows that CRIg ECD inhibits C3 and C5
alternative pathway convertases.
[0078] (A) CRIg inhibits hemolysis of rabbit erythrocytes in Clq
deficient serum (alternative pathway) but not of IgM-opsonized
sheep erythrocytes in fB deficient serum (classical pathway).
[0079] (B) CRIg inhibits fluid phase C3 convertase activity.
[0080] (C) CRIg does not function as a cofactor of factor I
mediated cleavage of C3.
[0081] (D) CRIg does not function as an accelerator of decay of the
C3 convertase.
[0082] (E) CRIg inhibits alternative pathway C5 convertase formed
on zymosan particles.
[0083] FIGS. 50A-D CRIg is selectively expressed on a subpopulation
of tissue resident macrophages.
[0084] (A) CRIg is a single transmembrane immunoglobulin
superfamily member consisting of one (human CRIg short (huCRIg(S))
and murine CRIg (muCRIg) or two (huCRIgL) immunoglobulin domains.
The scale at the top of the left panel indicates size in amino
acids. The panel on the right shows that hu and muCRIg are
distantly related to junctional adhesion molecule-A (JAM-A) and A33
antigen. The scale on the top of the right panel indicates % amino
acid similarity.
[0085] (B) CRIg is expressed in macrophages but not in monocytes.
human CD14+ monocytes and CD14+ monocytes cultured for 7 days in
10% autologous serum and 20% fetal bovine serum were analyzed for
huCRIg staining by flow cytometry using anti-human CRIg MAb (3C9).
Mouse CD11 b+ and F4/80+ liver Kupffer cells were analyzed for
muCRIg staining using an anti-muCRIg MAb (14G6).
[0086] (C) Western blot analysis of human and mouse macrophages.
Lysates from human CD14+ monocytes cultured for the indicated
periods of time or mouse peritoneal macrophages were boiled in
reducing SDS buffer, loaded on a 4-10% Tris-glycine gel and
incubated with a polyclonal anti-CRIg antibody (6F1, left panel) or
an anti-muCRIg monoclonal antibody (14C6, right panel). Pre-immune
IgG (left panel) and rat IgG2b (right panel) were used as isotype
controls. Arrows in the left panel indicate the position of a 57
and 50 kDa band possibly representing huCRIg(L) and -(S).
[0087] (D) Co-localization of CRIg with CD68 on liver Kupffer
cells. Immunostaining was performed on sections obtained from human
and mouse liver using monoclonal anti-CRIg (3C9 human and 14G6
mouse), and monclonal anti-CD68 antibodies.
[0088] FIGS. 51A-B. Flow cytometry analysis of CRIg expression on
peripheral blood leukocytes and analysis of binding of C3 fragments
C3 opsonized particles to CRIg expressing CHO cells.
[0089] (A) Flow cytometry analysis of CRIg expression on human and
mouse peripheral human and mouse lekocytes.
[0090] (B) Binding of soluble C3 fragments or complement opsonized
pathogens to CHO cells expressing murine CRIg, but not to JAM-2
expressing CHO cells. Cells in suspension were incubated with
A488-labeled complement opsonized particles under continuous
rotation for 30 minutes at room temperature. Cells were washed
three times and the binding of the particles was monitored by flow
cytometric analyses. Results are representative of 3 independent
experiments.
[0091] FIGS. 52A-E. Soluble and cell surface-expressed CRIg binds
to C3 fragments in solution or deposited on the cell surface.
[0092] (A) CRIg(L)-transfected Jurkat cells (Jurkat-CRIg), but not
empty vector-transfected Jurkat cells (Jurkat-control), form
rosettes with C3 and IgM-opsonized sheep erythrocytes (E-IgM).
Histogram (left panel) shows CRIg expression on Jurkat cells stably
transfected with human CRIg(L). E-IgM opsonized with C3 deficient
(C3-) or C3 sufficient (C3+) serum were mixed with CRIg or control
vector transfected Jurkat for 1 hour. The experiment was
representative of three independent experiments.
[0093] (B) CIg(L)-Fc binding to IgM-opsonized sheep red blood cells
(E-IgM) is dependent on the presence of C3 in serum. E-IgM were
opsonized with C3 depleted human serum to which increasing
concentrations of purified human C3 were added. E-IgM were
subsequently incubated with a huCRIg(L)-Fc fusion protein which was
in turn detected with an anti-human Fc polyclonal antibody detected
by flow cytometry. The experiment was representative of three
independent experiments.
[0094] (C) ELISA showing binding of CRIg(L)- and CRIg(S)-Fc to C3b
and iC3b. Increasing concentrations of huCRIg(L)- and huCRIg(S)-Fc
fusion proteins were added to maxisorb plates coated with purified
C3b and iC3b. Binding was detected using an HRPO-conjugated
anti-huFc antibody. The results shown are representative of 4
independent experiments using different batches of fusion protein
and purified complement components.
[0095] (D) Kinetic binding data showing soluble C3b dimers binding
to huCRIg(L)-Fc. The affinity for C3b to the CRIg fusion proteins
was determined using surface plasmon resonance. CRIg proteins were
captured on a CM5 sensor chip via amine coupling of an antibody
directed to the Fc fusion tag. Dimeric C3b was then injected for
sufficient time to reach saturation. The Kd was calculated from a
binding curve showing response at equilibrium plotted against the
concentration. C3b dimers bound to huCRIg(S) with a calculated
affinity of 44 nM and to huCRIg(L) with 131 nM affinity.
[0096] (E) CRIg expressed on the cell surface binds to A488-labeled
C3b dimer (C3b)2) but not to native C3. Left panel shows expression
levels of huCRIg(L) on transfected THP-1 cells by flow-cytometry
analysis. (C3b)2 shows saturateable binding to CRIg-transfected
THP-1 cells. (C3b)2 binding to THP-1 CRIg was competed off with
(C3b)2, C3b and the extracellular domain of CRIg (CRIg-ECD), but
not by C3. The results shown are representative of 3 independent
experiments.
[0097] FIGS. 53A-E. Generation and characterization of CRIg ko
mice
[0098] (A) Generation of a targeting vector used for homologous
recombination in ES cells.
[0099] (B) Southern blot confirmation of homologous recombination
of the SRIg allele in heterozygous female offspring from chimeric
mice bred to wt mice.
[0100] (C) Comparison of leukocyte numbers in the peripheral blood
of wt and ko male and female mice.
[0101] (D) FACS analysis showing the absence of CR1, CR2 and CD11c
expression in KCs.
[0102] (E) FACS analysis of C3-A488 and C3c-A488 binding to wt and
ko KCs.
[0103] FIGS. 54A-D. Expression of CRIg on Kupffer cells is
necessary for binding of C3b and iC3b.
[0104] (A) CRIg protein is absent on macrophages obtained from CRIg
KO mice. Peritoneal macrophages obtained from CRIg wt, het or ko
mice were incubated with an anti-muCRIg mAb (14G6; left panel).
Kupffer cells (KCs) obtained from CRIg wt and ko mice were
incubated with antibody 14G6 and analyzed by flow cytometry.
[0105] (B) Expression levels of CD11b and CD18, the alpha and beta
chains of complement receptor 3 and Crry are similar on Kupffer
cells obtained from CRIg we and CRIg ko mice. Kupffer cells
isolated for CRIg wt or ko mice were incubated with antibodies to
CD11b, CD18 and Crry and analyzed by flow cytometry.
[0106] (C) Kupffer cells isolated from CRIg wt or ko mice were
incubated with activated mouse serum (activated through incubations
for 30 minutes at 37.degree. C.), C3b, (C3b)2 and iC3b. Binding of
the purified complement components to the cell surface was detected
with a polyclonal antibody recognizing the various C3-deried
fragments. Results shown are representative of 4 experiments.
[0107] (D) KCs isolated from CRIg ko mice show decreased resetting
with IgM-coated sheep red blood cells (E-IgM) opsonized in C3
sufficient mouse serum. KCs isolated from livers of CRIg wt and ko
mice were incubated with complement C3-opsonized E-IgM for 30
minutes in the presence of control IgG or anti-CR3 blocking
antibody (M1/70). Cells were fixed and the number of KCs that
formed rosettes with E-IgM were counted and expressed as a
percentage of the total number of KCs. *=p<0.05. Results shown
are representative of 2 independent experiments.
[0108] FIGS. 55A-C. CRIg on Kupffer cells recycles
[0109] (A) Kupffer cells (KCs) from C3 wt (panels 1, 3, 4 and 6) or
C3 ko mice (panels 2, 5) were incubated with A488-labeled anti-CRIg
antibody (14G6) and (C3b)2 for one hour at 4.degree. C. (panel 1-3)
or for 10 minutes at 37.degree. C. (panel 4-6). Cells were
subsequently transferred to 4.degree. C. and incubated with
anti-A488 antibody (red histogram) or without antibody (black
histogram) to distinguish cytoplasmic from cell surface expressed
anti-CRIg or C3b.
[0110] (B) Internalization and co-localization of CRIg and C3b in
CRIg wt, but not CRIg ko, KCs. KCs isolated from the livers of CRIg
wt and ko mice were cultured in chamber slides for 2 days and
incubated with A455-conjugated anti-CRIg antibodies and
A488-conjugated C3b for 30 minutes at 37.degree. C., mounted and
photographed.
[0111] (C) CRIg, but not Lamp1, antibodies recycle to the cell
surface. Kupffer cells were loaded with A488-conjugated anti-muCRIg
or anti-muLamp1 antibodies for 10 minutes at 37.degree. C., washed
and subsequently incubated for indicated time periods at 37.degree.
C. in the presence of anti-A488 quenching antibody. Results shown
are representative of 3 independent experiments
[0112] FIGS. 56A-C. CRIg is expressed on recycling endosomes that
are recruited to sites of particle ingestion.
[0113] (A) Cell surface-expressed CRIg is localized to
F-actin-positive membrane ruffles. Monocyte-derived macrophages
cultures for 7 days were incubated at 4.degree. C. with
A488-conjugated anti-CRIg A488 mAb 3C9 (A1 and green channel in A3)
and Alexa 546-phalloidin (A2 and red channel in A3). Arrowheads
indicate membrane ruffles where both CRIg and actin staining are
more intense than over the rest of the cell surface (yellow in the
merged images in A3). Scale bar is 20 lam.
[0114] (B) CRIg and C3b co-localize with transferrin in recycling
endosomes. Macrophages were incubated for 1 hour on ice with
CRIg-A488 (B1, green channel in B4) or C30A488 (B2, red channel in
B4) then chased for 10 minutes at 37.degree. C. in the presence of
A647-transferrin (B3, blue channel in B4). Scale bar=20 .mu.m.
[0115] (C) CRIg is recruited to the phagocytic cup and the
phagosome membrane. Macrophages were incubated with IgM-coated
erythrocytes opsonized with C3 sufficient serum for 10 minutes
(C1-4) or 2 hours (C5-8) at 37.degree. C. in the presence of
A647-labeled transferrin (C2, 6 and blue channel C4, 8). Cells were
subsequently fixed, permeabilized and stained with anti-CRIg
polyclonal antibodies (C1, 2 and green channel in C4, 5) and
A555-conjugated antibody to LAMP-1 (C3, 7 and red channel in C4,
8).
[0116] FIGS. 57A-E. Trafficking of CRIg in human monocyte-derived
macrophages
[0117] (A) FACS plot showing saturatable binding of C3b-A488 to
CRIg on day 7 MDMs.
[0118] (B) MDMs were pulsed for 10 minutes at 37.degree. C. with
anti-CRIg antibody and C3b-A488 n the presence of a 10 fold molar
excess of huCRIg(L)-ECD. Binding and uptake of anti-CRIg antibody
was specific for CRIg since it could be abolished by co-incubation
of the antibody with a 10-fold molar excess of CRIg-ECD (panel 1)
while leaving the uptake of transferrin intact (panel 2).
[0119] (C) MDMs 20 h at 37.degree. C. in the presence of lysosomal
protease inhibitors, then the cells were washed, fixed with 1% PFA
and the uptaken antibody detected with Cy3-labeled anti-ouse IgG (C
panel 1, and red channel in panel 3). The cells were co-stained in
10 .mu.g/ml rabbit anti-CRIg 6F1 followed by FITC-anti rabbit to
detect the total CRIg distribution (C panel 2 and green channel in
C panel 3). The uptaken antibody almost completely overlapped with
the endogenous CRIg signal (yellow in the merged image in C panel
3), indicating that the antibody uptake does no influence CRIg
trafficking. Scale bar is 20 .mu.m and 5 .mu.m in the 4.times.
magnified inset of the boxed regions shown in the lower right of
each channel. C panel 4 Human macrophages were incubated in
C3-depleted serum for 13 h, then fixed and labeled with rabbit
anti-CRIg F1 and FITC anti-rabbit. The CRIg distribution was
essentially identical to that in C3 sufficient serum, both
overlapping almost entirely with the recycling endosomal marker
transferrin (data not shown). Scale bar is 20 .mu.m.
[0120] (D) MDMs were incubated with 1 .mu.g/ml anti-CRIg-A488
(panel 1) transferrin-A647 (panel 2) for 10 minutes at 37.degree.
C., fixe in 4% PFA, permeabilized with saponin buffer and incubated
with mouse-anti-human Lamp-1-A555 (panel 3). Arrows indicate
co-localization of CRIg and transferring in the recycling
compartment.
[0121] (E) MDMs were incubated with 1 .mu.g/ml anti-CRIg-A488
(panel 1, green channel in panel 4), transferrin-A647 (panel 2,
blue channel in panel 4) for 30 minutes at 37.degree. C., washed
and incubated with PKH-stained, compartment C3-opsonized sheep red
blood cells (SRBCs, panel 3, red channel in panel 4) at a 1:10
macrophages:SRBC ratio.
[0122] FIGS. 58A-E. Mice lacking CRIg are susceptivle to Listeria
Monocytogenes (LM) infection.
[0123] (A) Survival curves of female CRIg wt and CRIg ko mice
infected with the indicated doses of LM following injection into
the lateral tail vein, n=5-7 per group. Sttistical analysis
(Wilcoxon): wt vs ko p<0.005 for 2.times.10e4 colony forming
units (CFUs), p<0.0001 for 5.times.10e4 and 2.times.10e5 CFUs.
\
[0124] (B) Analysis of bacterial counts in heart, liver, blood, and
spleen 10 min following LM infection (2.times.10e7 CFUs, n=5 per
groups). Statistical analysis (paired t-test): **p<0.01,
*p<0.05.
[0125] (C) Increased concentrations of cytokines and chemokines in
the serum of CRIg ko mice one day following LM infections.
Statistical analysis (unpaired t-test): ***p<0.001.
[0126] (D) Reduced uptake of LM-A488 in KCs in CRIg ko mice. Mice
were infected with 2.times.10e7 LM-A488. One hour later, livers
were perfused, incubated with antibodies to F4/80 and analyzed by
flow cytometry. F4/80 positive KCs were subsequently sorted by FACS
and collected on poly-1-lysine coated slides for observation by
fluorescent microscopy. The number of internalized LM-A488 was
counted in a confocal microscope and the phagocytic index
calculated. Results are representative of at least two
experiments.
[0127] (E) CRIg mice have a reduced clearance of LM from the
circulation. CRIg and C3 double or single ko mice were injected
i.v. with 2.times.10e7 CFUs LM. CFUs in blood were counted 10
minutes post infection. In the presence of C3, CRIg ko mice had a
significantly reduced clearance of LM from the circulation
(p<0.001). In the absence of C3, there was no significant
difference in clearance of LM in CRIg wt or ko mice.
[0128] FIG. 59 shows the nucleotide sequence of a human
CRIg(short)-IgG fusion. (SEQ ID NO: 20).
[0129] FIG. 60 shows the nucleotide sequence of a human
CRIg(long)-IgG fusion (SEQ ID NO: 21).
[0130] FIG. 61 illustrates the CRIg (STIgMA)-Fc junction in two
different contructs, both of which are inserted into a pRK5 vector
at a ClaI-XbaI site.
[0131] FIG. 62 shows that muCRIg-Fc fusion protein (but not control
Fc fusion protein) inhibits clearance of LM from the circulation in
wt but not CRIg ko cells. CRIg wt and ko mice were treated with 2
injections of 12 mg/kg muCRIg-Fc or control-Fc fusion proteins 24
his and 16 his prior to injection i.v. with 2.times.10.sup.7 CFUs
LM. CFUs in blood were counted 10 minutes post infection. CRIg wt
mice treated with muCRIg-Fc had a significantly reduced clearance
of LM from the circulation as compared to control-Fe treated wt
mice (p<0.001, nonpaired Students t-test). In CRIg ko mice,
treatment with muCRIg-Fc had no effect on LM clearance.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
I. Definitions
[0132] The terms "PR0362," "JAM4," "STIgMA," and "CRIg" are used
interchangeably, and refer to native sequence and variant CRIg
polypeptides.
[0133] A "native sequence" CRIg, is a polypeptide having the same
amino acid sequence as a CRIg polypeptide derived from nature,
regardless of its mode of preparation. Thus, native sequence CRIg
can be isolated from nature or can be produced by recombinant
and/or synthetic means. The term "native sequence CRIg",
specifically encompasses naturally-occurring truncated or secreted
forms of CRIg (e.g., an extracellular domain sequence),
naturally-occurring variant forms (e.g., alternatively spliced
forms) and naturally-occurring allelic variants of CRIg. Native
sequence CRIg polypeptides specifically include the 321 amino acids
long human CRIg polypeptide of SEQ ID NO: 2 (shown in FIG. 1), with
or without the N-terminal signal sequence, with or without the
initiating methionine at position 1, and with or without any or all
of the transmembrane domain at about amino acid positions 277 to
307 of SEQ ID NO: 2. Native sequence CRIg polypeptides further
include the full-length 399 amino acids long human CRIg polypeptide
of SEQ ID NO: 4 (huCRIg, shown in FIGS. 2 and 5), with or without
an N-terminal signal sequence, with or without the initiating
methionine at position 1, and with or without any or all of the
transmembrane domain at about amino acid positions 277 to 307 of
SEQ ID NO: 4. In a still further embodiment, the native sequence
CRIg polypeptide is the 305-amino acid, short form of human CRIg
(huCRIg-short, SEQ ID NO: 6, shown in FIG. 3), with or without an
N-terminal signal sequence, with or without the initiating
methionine at position 1, and with or without any or all of the
transmembrane domain at about positions 183 to 213 of SEQ ID NO: 6.
In a different embodiment, the native sequence CRIg polypeptide is
a 280 amino acids long, full-length murine CRIg polypeptide of SEQ
ID NO: 8 (muCRIg, shown in FIGS. 4 and 5), with or without an
N-terminal signal sequence, with or without the initiating
methionine at position 1, and with or without any or all of the
transmembrane domain at about amino acid positions 181 to 211 of
SEQ ID NO: 8. CRIg polypeptides of other non-human animals,
including higher primates and mammals, are specifically included
within this definition.
[0134] "CRIg variant" means an active CRIg polypeptide as defined
below having at least about 80% amino acid sequence identity to a
native sequence CRIg polypeptide, including, without limitation,
the C-terminally truncated 321-amino acid huCRig (SEQ ID NO: 2),
the full-length huCRIg (SEQ ID NO: 4), huCRIg-short (SEQ ID NO: 6),
and muCRIg (SEQ ID NO: 8), each with or without the N-terminal
initiating methionine, with or without the N-terminal signal
sequence, with or without all or part of the transmembrane domain
and with or without the intracellular domain. In a particular
embodiment, the CRIg variant has at least about 80% amino acid
sequence homology with the mature, full-length polypeptide from
within the sequence of the sequence of SEQ ID NO: 2. In another
embodiment, the CRIg variant has at least about 80% amino acid
sequence homology with the mature, full-length polypeptide from
within the sequence of SEQ ID NO: 4. In yet another embodiment, the
CRIg variant has at least about 80% amino acid sequence homology
with the mature, full-length polypeptide from within the sequence
of SEQ ID NO: 6. In a still further embodiment, the CRIg variant
has at least about 80% amino acid sequence homology with the
mature, full-length polypeptide from within the sequence of SEQ ID
NO: 8. Such CRIg polypeptide variants include, for instance, CRIg
polypeptides wherein one or more amino acid residues are inserted,
substituted and/or deleted, at the N- or C-terminus of the sequence
of SEQ ID NO: 2, 4, 6, or 8. Other variants have one or more amino
acids inserted, substituted and/or deleted within the transmembrane
regions of the indicated polypeptide sequences.
[0135] Ordinarily, a CRIg variant will have at least about 80%
amino acid sequence identity, or at least about 85% amino acid
sequence identity, or at least about 90% amino acid sequence
identity, or at least about 95% amino acid sequence identity, or at
least about 98% amino acid sequence identity, or at least about 99%
amino acid sequence identity with the mature amino acid sequence
from within SEQ ID NO: 2, 4, 6, or 8. Preferably, the highest
degree of sequence identity occurs within the extracellular domains
(ECDs) (amino acids 1 or about 21 to X of SEQ ID NO: 2 or 4, where
X is any amino acid residue from position 271 to 281; or amino
acids 1 or about 21 to X of SEQ ID NO: 6, where X is any amino acid
residue from position 178 to 186, or amino acids 1 or about 21 to X
of SEQ ID NO: 8, where X is any amino acid residue from position
176 to 184).
[0136] The CRIg (PR0362) "extracellular domain" or "ECD" refers to
a form of the CRIg polypeptide, which is essentially free of the
transmembrane and cytoplasmic domains of the respective full length
molecules. Ordinarily, the CRIg ECD will have less than 1% of such
transmembrane and/or cytoplasmic domains and preferably, will have
less than 0.5% of such domains. As discussed above, optionally,
CRIg ECD will comprise amino acid residues 1 or about 21 to X of
SEQ ID NO: 2, 4, 6, or 8, where X is any amino acid from about 271
to 281 in SEQ ID NO: 2 or 4, any amino acid from about 178 to 186
in SEQ ID NO: 6, and any amino acid from about 176 to 184 in SEQ ID
NO: 8.
[0137] "Percent (%) amino acid sequence identity" with respect to
the CRIg (PR0362) sequences identified herein is defined as the
percentage of amino acid residues in a candidate sequence that are
identical with the amino acid residues in the CRIg sequence,
respectively, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity, and
not considering any conservative substitutions as part of the
sequence identity. Alignment for purposes of determining percent
amino acid sequence identity can be achieved in various ways that
are within the skill in the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR) software. Those skilled in the art can determine
appropriate parameters for measuring alignment, including any
algorithms needed to achieve maximal alignment over the full length
of the sequences being compared. Sequence identity is then
calculated relative to the longer sequence, i.e. even if a shorter
sequence shows 100% sequence identity with a portion of a longer
sequence, the overall sequence identity will be less than 100%.
[0138] "Percent (%) nucleic acid sequence identity" with respect to
the CRIg (PR0362)-encoding sequences identified herein (e.g.,
DNA45416) is defined as the percentage of nucleotides in a
candidate sequence that are identical with the nucleotides in the
CRIg-encoding sequence, respectively, after aligning the sequences
and introducing gaps, if necessary, to achieve the maximum percent
sequence identity. Alignment for purposes of determining percent
nucleic acid sequence identity can be achieved in various ways that
are within the skill in the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR) software. Those skilled in the art can determine
appropriate parameters for measuring alignment, including any
algorithms needed to achieve maximal alignment over the full length
of the sequences being compared. Sequence identity is then
calculated relative to the longer sequence, i.e. even if a shorter
sequence shows 100% sequence identity with a portion of a longer
sequence, the overall sequence identity will be less than 100%.
[0139] An "isolated" nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the nucleic acid. An isolated
nucleic acid molecule is other than in the form or setting in which
it is found in nature. Isolated nucleic acid molecules therefore
are distinguished from the nucleic acid molecule as it exists in
natural cells. However, an isolated nucleic acid molecule includes
nucleic acid molecules contained in cells that ordinarily express
an encoded polypeptide where, for example, the nucleic acid
molecule is in a chromosomal location different from that of
natural cells.
[0140] An "isolated" CRIg polypeptide-encoding nucleic acid
molecule is a nucleic acid molecule that is identified and
separated from at least one contaminant nucleic acid molecule with
which it is ordinarily associated in the natural source of the
CRIg-encoding nucleic acid. An isolated CRIg polypeptide-encoding
nucleic acid molecule is other than in the form or setting in which
it is found in nature. Isolated CRIg polypeptide-encoding nucleic
acid molecules therefore are distinguished from the encoding
nucleic acid molecule(s) as they exists in natural cells. However,
an isolated CRIg-encoding nucleic acid molecule includes
CRIg-encoding nucleic acid molecules contained in cells that
ordinarily express CRIg where, for example, the nucleic acid
molecule is in a chromosomal location different from that of
natural cells.
[0141] The term "complement-associated disease" is used herein in
the broadest sense and includes all diseases and pathological
conditions the pathogenesis of which involves abnormalities of the
activation of the complement system, such as, for example,
complement deficiencies. The term specifically include diseases and
pathological conditions that benefit from the inhibition of C3
convertase. The term additionally includes diseases and
pathological conditions that benefit from inhibition, including
selective inhibition, of the alternative complement pathway.
Complement-associated diseases include, without limitation,
inflammatory diseases and autoimmune diseases, such as, for
example, rheumatoid arthritis (RA), acute respiratory distress
syndrome (ARDS), remote tissue injury after ischemia and
reperfusion, complement activation during cardiopulmonary bypass
surgery, dermatomyositis, pemphigus, lupus nephritis and resultant
glomerulonephritis and vasculitis, cardiopulmonary bypass,
cardioplegia-induced coronary endothelial dysfunction, type II
membranoproliferative glomerulonephritis, IgA nephropathy, acute
renal failure, cryoglobulemia, antiphospholipid syndrome,
age-related macular degeneration, uveitis, diabetic retinopathy,
allo-transplantation, hyperacute rejection, hemodialysis, chronic
occlusive pulmonary distress syndrome (COPD), asthma, and
aspiration pneumonia.
[0142] The term "inflammatory disease" and "inflammatory disorder"
are used interchangeably and mean a disease or disorder in which a
component of the immune system of a mammal causes, mediates or
otherwise contributes to an inflammatory response contributing to
morbidity in the mammal. Also included are diseases in which
reduction of the inflammatory response has an ameliorative effect
on progression of the disease. Included within this term are
immune-mediated inflammatory diseases, including autoimmune
diseases.
[0143] The term "T-cell mediated" disease means a disease in which
T cells directly or indirectly mediate or otherwise contribute to
morbidity in a mammal. The T cell mediated disease may be
associated with cell mediated effects, lymphokine mediated effects,
etc. and even effects associated with B cells if the B cells are
stimulated, for example, by the lymphokines secreted by T
cells.
[0144] Examples of immune-related and inflammatory diseases, some
of which are T cell mediated, include, without limitation,
inflammatory bowel disease (IBD), systemic lupus erythematosus,
rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vaculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection, graft-versus host disease, Alzheimer's disease, and
atherosclerosis.
[0145] "Tumor", as used herein, refers to all neoplastic cell
growth and proliferation whether malignant or benign, and all
pre-cancerous cells and tissues.
[0146] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
More particular examples of such cancers include breast cancer,
prostate cancer, colon cancer, squamous cell cancer, small-cell
lung cancer, non-small cell lung cancer, gastrointestinal cancer,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer, bladder cancer, hepatoma, colorectal cancer,
endometrial carcinoma, salivary gland carcinoma, kidney cancer,
liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and
various types of head and neck cancer.
[0147] "Treatment" is an intervention performed with the intention
of preventing the development or altering the pathology of a
disorder. Accordingly, "treatment" refers to both therapeutic
treatment and prophylactic or preventative measures. Those in need
of treatment include those already with the disorder as well as
those in which the disorder is to be prevented. In treatment of an
immune related disease, a therapeutic agent may directly alter the
magnitude of response of a component of the immune response, or
render the disease more susceptible to treatment by other
therapeutic agents, e.g., antibiotics, antifungals,
anti-inflammatory agents, chemotherapeutics, etc.
[0148] The "pathology" of a disease, such as a
complement-associated disease, includes all phenomena that
compromise the well-being of the patient. This includes, without
limitation, abnormal or uncontrollable cell growth (neutrophilic,
eosinophilic, monocytic, lymphocytic cells), antibody production,
auto-antibody production, complement production, interference with
the normal functioning of neighboring cells, release of cytokines
or other secretory products at abnormal levels, suppression or
aggravation of any inflammatory or immunological response,
infiltration of inflammatory cells (neutrophilic, eosinophilic,
monocytic, lymphocytic) into cellular spaces, etc.
[0149] The term "mammal" as used herein refers to any animal
classified as a mammal, including, without limitation, humans,
domestic and farm animals, and zoo, sports or pet animals such
horses, pigs, cattle, dogs, cats and ferrets, etc. In a preferred
embodiment of the invention, the mammal is a human.
[0150] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0151] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are growth hormone such as human growth hormone, N-methionyl human
growth hormone, and bovine growth hormone, parathyroid hormone,
thyroxine, insulin, proinsulin, relaxin, prorelaxin, glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid
stimulating hormone (TSH), and luteinizing hormone (LH), hepatic
growth factor, fibroblast growth factor, prolactin, placental
lactogen, tumor necrosis factor-.alpha. and -.beta.,
mullerian-inhibiting substance, mouse gonadotropin-associated
peptide, inhibin, activin, vascular endothelial growth factor,
integrin, thrombopoietin (TPO), nerve growth factors such as
NGF-.beta. platelet-growth factor, transforming growth factors
(TGFs) such as TGF-.alpha. and TGF-.beta., insulin-like growth
factor-I and -II, erythropoietin (EPO), osteoinductive factors,
interferons such as interferon-.alpha., -.beta., and -.gamma.;
colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF),
granulocyte-macrophage-CSF (GM-CSF), and granulocyte-CSF (G-CSF),
interleukins (ILs) such as IL-1, IL-1 .alpha., IL-2, IL-3, IL-4,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, a tumor necrosis factor
such as TNF-.alpha. or TNF-.beta., and other polypeptide factors
including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines.
[0152] "Therapeutically effective amount" is the amount of active
CRIg, CRIg agonists and antagonists which is required to achieve a
measurable improvement in the state, e.g. pathology, of the target
disease or condition, such as, for example, a complement-associated
disease or condition, or cancer.
[0153] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0154] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0155] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature that can
be used. As a result, it follows that higher relative temperatures
would tend to make the reaction conditions more stringent, while
lower temperatures less so. For additional details and explanation
of stringency of hybridization reactions, see Ausubel et al.,
Current Protocols in Molecular Biology, Wiley Interscience
Publishers, (1995).
[0156] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42 C; or (3) employ
50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate),
50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate,
5.times.Denhardt's solution, sonicated salmon sperm DNA (50
.mu.gimp, 0.1% SDS, and 10% dextran sulfate at 42.degree. C., with
washes at 42.degree. C. in 0.2.times.SSC (sodium chloride/sodium
citrate) and 50% formamide at 55.degree. C., followed by a
high-stringency wash consisting of 0.1.times.SSC containing EDTA at
55.degree. C.
[0157] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0158] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a polypeptide of the invention
fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against which an antibody can be
made, yet is short enough such that it does not interfere with
activity of the polypeptide to which it is fused. The tag
polypeptide preferably also is fairly unique so that the antibody
does not substantially cross-react with other epitopes. Suitable
tag polypeptides generally have at least six amino acid residues
and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid residues).
[0159] "Active" or "activity" in the context of variants of the
CRIg polypeptides of the invention refers to form(s) of such
polypeptides which retain the biological and/or immunological
activities of a native or naturally-occurring polypeptide of the
invention. A preferred biological activity is the ability to bind
C3b, and/or to affect complement or complement activation, in
particular to inhibit the alternative complement pathway and/or C3
convertase. Inhibition of C3 convertase can, for example, be
measured by measuring the inhibition of C3 turnover in normal serum
during collagen- or antibody-induced arthritis, or inhibition of C3
deposition is arthritic joints.
[0160] "Biological activity" in the context of an antibody,
polypeptide or another molecule that mimic CRIg biological
activity, and can be identified by the screening assays disclosed
herein (e.g. an organic or inorganic small molecule, peptide, etc.)
refers, in part, to the ability of such molecules to bind C3b
and/or to affect complement or complement activation, in
particular, to inhibit the alternative complement pathway and/or C3
convertase.
[0161] The term CRIg "agonist" is used in the broadest sense, and
includes any molecule that mimics a qualitative biological activity
(as hereinabove defined) of a native sequence CRIg polypeptide.
[0162] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a qualitative biological activity of a native
polypeptide, such as a native sequence CRIg polypeptide.
[0163] Suitable agonist or antagonist molecules specifically
include agonist or antagonist antibodies or antibody fragments,
fragments, fusions or amino acid sequence variants of native
polypeptides of the invention, peptides, small molecules, including
small organic molecules, etc.
[0164] A "small molecule" is defined herein to have a molecular
weight below about 600, preferably below about 1000 daltons.
[0165] The term "antibody" is used in the broadest sense and
specifically covers, without limitation, single anti-CRIg
monoclonal antibodies (including agonist, antagonist, and
neutralizing antibodies) and anti-CRIg antibody compositions with
polyepitopic specificity. The term "monoclonal antibody" as used
herein refers to an antibody obtained from a population of
substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are identical except for
possible naturally-occurring mutations that may be present in minor
amounts.
[0166] "Antibodies" (Abs) and "immunoglobulins" (Igs) are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules which lack antigen specificity. Polypeptides of the
latter kind are, for example, produced at low levels by the lymph
system and at increased levels by myelomas. The term "antibody" is
used in the broadest sense and specifically covers, without
limitation, intact monoclonal antibodies, polyclonal antibodies,
multispecific antibodies (e.g. bispecific antibodies) formed from
at least two intact antibodies, and antibody fragments so long as
they exhibit the desired biological activity.
[0167] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain
(V.sub.H) followed by a number of constant domains Each light chain
has a variable domain at one end (V.sub.L) and a constant domain at
its other end; the constant domain of the light chain is aligned
with the first constant domain of the heavy chain, and the light
chain variable domain is aligned with the variable domain of the
heavy chain. Particular amino acid residues are believed to form an
interface between the light and heavy chain variable domains.
[0168] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity-determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework (FR). The variable domains of native heavy and light
chains each comprise four FR regions, largely adopting a beta-sheet
configuration, connected by three CDRs, which form loops
connecting, and in some cases forming part of, the beta-sheet
structure. The CDRs in each chain are held together in close
proximity by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages
647-669 (1991)). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector
functions, such as participation of the antibody in
antibody-dependent cellular toxicity.
[0169] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng. 8(10):1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments.
[0170] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment. The
designation "Fe" reflects the ability to crystallize readily.
Pepsin treatment yields an F(ab').sub.2 fragment that has two
antigen-combining sites and is still capable of cross-linking
antigen.
[0171] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRs of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0172] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab fragments differ from Fab fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0173] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa (.kappa.) and lambda (.lamda.), based on the
amino acid sequences of their constant domains.
[0174] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called .gamma., .mu., .delta.,
.DELTA., and .epsilon., respectively. The subunit structures and
three-dimensional configurations of different classes of
immunoglobulins are well known.
[0175] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity, the
monoclonal antibodies are advantageous in that they are synthesized
by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal" indicates the character of the antibody
as being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature, 256:495 [1975], or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in Clackson et al., Nature, 352:624-628 [1991]
and Marks et al., J. Mol. Biol., 222: 581-597 (1991), for example.
See also U.S. Pat. Nos. 5,750,373, 5,571,698, 5,403,484 and
5,223,409 which describe the preparation of antibodies using
phagemid and phage vectors.
[0176] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No. 4,816,567; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)).
[0177] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which several or all residues from a complementarity-determining
region (CDR) of the recipient are replaced by residues from a CDR
of a non-human species (donor antibody) such as mouse, rat or
rabbit having the desired specificity, affinity, and capacity. In
some instances, certain Fv framework region (FR) residues of the
human immunoglobulin can also be replaced by corresponding
non-human residues. Furthermore, humanized antibodies may comprise
residues which are found neither in the recipient antibody nor in
the imported CDR or framework sequences. These modifications are
made to further refine and maximize antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the CDR regions correspond to those of a
non-human immunoglobulin and all or substantially all of the FR
regions are those of a human immunoglobulin sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature, 321:
522-525 (1986); Reichmann et al., Nature, 332: 323-329 [1988]; and
Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992). The humanized
antibody includes a "primatized" antibody where the antigen-binding
region of the antibody is derived from an antibody produced by
immunizing macaque monkeys with the antigen of interest. Antibodies
containing residues from Old World monkeys are also possible within
the invention. See, for example, U.S. Pat. Nos. 5,658,570;
5,693,780; 5,681,722; 5,750,105; and 5,756,096.
[0178] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of antibody, wherein these domains are
present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994).
[0179] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993).
[0180] An "isolated" polypeptide, such as an antibody, is one which
has been identified and separated and/or recovered from a component
of its natural environment. Contaminant components of its natural
environment are materials which would interfere with diagnostic or
therapeutic uses for the antibody, and may include enzymes,
hormones, and other proteinaceous or nonproteinaceous solutes. In
preferred embodiments, the polypeptide, including antibodies, will
be purified (1) to greater than 95% by weight of the antibody as
determined by the Lowry method, and most preferably more than 99%
by weight, (2) to a degree sufficient to obtain at least 15
residues of N-terminal or internal amino acid sequence by use of a
spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under
reducing or nonreducing conditions using Coomassie blue or,
preferably, silver stain. Isolated compound, e.g. antibody or other
polypeptide, includes the compound in situ within recombinant cells
since at least one component of the compound's natural environment
will not be present. Ordinarily, however, isolated compound will be
prepared by at least one purification step.
[0181] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to a compound, e.g. antibody or polypeptide, so as to generate a
"labeled" compound. The label may be detectable by itself (e.g.
radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which is detectable.
[0182] By "solid phase" is meant a non-aqueous matrix to which the
compound of the present invention can adhere. Examples of solid
phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled pore glass), polysaccharides
(e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol
and silicones. In certain embodiments, depending on the context,
the solid phase can comprise the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography
column). This term also includes a discontinuous solid phase of
discrete particles, such as those described in U.S. Pat. No.
4,275,149.
[0183] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as the anti-ErbB2 antibodies disclosed
herein and, optionally, a chemotherapeutic agent) to a mammal. The
components of the liposome are commonly arranged in a bilayer
formation, similar to the lipid arrangement of biological
membranes.
[0184] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4-subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
II. Detailed Description
[0185] The present invention concerns the use of a novel
macrophage-associated receptor with homology to the A33 antigen and
JAM1, which was cloned from a fetal lung library and identified as
a single transmembrane Ig superfamily member macrophage associated
(STigMA) or Complement Receptor of the Immunoglobulin family (CRIg)
polypeptide. Native human CRIg is expressed as two spliced
variants, one containing an N-terminal IgV like domain and a
C-terminal IgC2 like domain and a spliced form lacking the
C-terminal domain (SEQ ID NOs: 4 and 6, respectively). Both
receptors have a single transmembrane domain and a cytoplasmic
domain, containing tyrosine residues which are constitutively
phosphorylated in macrophages in Intro. A mouse homologue was found
with 67% sequence homology to human CRIg (SEQ ID NO: 2). The
full-length human CRIg polypeptide also has a shorter version, with
an N-terminal segment missing (SEQ ID NO: 2).
[0186] As shown in the Examples below, CRIg binds complement C3b
and inhibits C3 convertase. CRIg is selectively expressed on tissue
resident macrophages, and its expression is upregulated by
dexamethasone and IL-10, and down-regulated by LPS and IFN-.gamma.,
and inhibits collagen- and antibody-induced arthritis independent
of B or T cell responses.
[0187] In addition it has been found that CRIg is highly expressed
on Kupffer cells, binds to the C3b and iC3b opnonins and is
required for the rapid clearance of pathogens in the circulation.
Structurally, CRIg differs from the known complement receptors in
that it lacks combined C3b- and C4b-binding short consensus repeat
sequences in CR1 and CR2, as well as the integring-line domains
present in C3 and CR4. Whereas complement receptors CR1-4 are
expressed on a wide variety of cell types, CRIg expression is
confined to tissue resident macrophages including liver Kupffer
cells.
[0188] Depletion studies have established a role for Kupffer cells
in the rapid C3-dependent clearance of Listeria early during an
infection (Kaufmann, Annu Rev. Immunol. 11:129-163 (1993); Gregory
et al., J. Immunol. 168:308-315 (2002)) but the receptors involved
in this process have do far not been identified. The studies
presented in the Examples below demonstrate that
macrophage-expressed CRIg binds C3b and iC3b deposited on the
surface of pathogen. Due to this dual binding activity to C3b and
iC3b, CRIg is required for efficient clearance of Listeria
Monocytogenes (LM) opsonized with both C3 degradation
components.
[0189] The importance of CRIg in the rapid hepatic clearance of C3
opsonized particles is further supported by the failure of CRIg
knock out (ko) mice to efficiently clear C3-opsonized LM from the
circulation, leading to elevated loads of pathogens in various
organs and increased mortality. In the absence of C3, CRIg ko
wild-type (wt) mice cleared Listeria equally well, indicating
dependence of CRIg function on the presence of C3.
[0190] The role of complement receptors CR1-4 in clearance of LM by
liver Kupffer cells has not been well established. CR1 and CR2 are
absent on tissue resident macrophages and are predominantly
expressed on follicular dendritic cells and B-cells where they
serve as role in regulating T- and B-cell responses (Krych-Goldber
and Atkinson, Immunol. Rev. 180:112-122 (2001); Molina et al., J.
Exp. Med. 175:121-129 (1992)), and Examples). CR3 is expressed at
low levels on KCs, but ko mice lacking the CD18 common beta chain
of both CR3 and CR4 resulting in non-functional receptors showed
reduced, rather than enhanced, susceptibility for infection (Wu et
al., Infect. Immun. 71:5986-5993 (2003)). Thus CRIg represents a
major component of the reticulo-endothelial phagocytic system in
rapid clearance of C3-opsonized particles.
[0191] In addition to its expression on liver Kupffer cells, CRIg
is present on subpopulations of macrophages in various tissues
including peritoneum, heart, lung, adrenal gland and intestine.
These macrophages are known to serve a central role ion
phagocytosis of dead cells and cell debris (Almeida et al., Ann.
N.Y. Acad. Sci. 1019:135-140 (2004); Castellucci and Zaccheo, Prog.
Clin. Biol. Res. 296:443-451 (1989); Taylor et al., Annu. Rev.
Immunol. 23:901-944 (2005)). CRIg expression on these resident
macrophages may mediate complement-dependent opsonophagocytosis of
various particles. This is supported by the finding that CRIg ko
mice exhibit decreased LM in their heart and liver tissues despite
increased circulatory LM load. Hence, CRIg represents a novel
receptor expressed in tissue macrophages and served as a kep portal
for rapid clearance of complement opsonized pathogens.
[0192] The results presented in the Examples below further
demonstrate that CRIg is expressed on an intracellular pool of
recycling vesicles, thereby insuring a continuous supply of CRIg on
the cell surface for binding to C3 opsonized particles. In
addition, CRIg-expressing endosomes are rapidly recruited to sites
of particle contact where they may aid in delivering membrane to
the forming phagosome. The importance of CRIg in phagocytosis of
C3-opsonized particles is shown by the inability of KCs lacking
CRIg to bind C3b and iC3b resulting in reduced phagocytosis of C3
opsonized Listeria Monocytogenes (see Examples).
[0193] The subcellular localization and intracellular trafficking
of CRIg differ from the known complement C3 receptors. Whereas CRIg
is localized on constitutively recycling endosomes, CR1, CR3, and
CR4 are located on secretory vesicles that fuse with the plasma
membrane upon cytokine stimulation of the cells (Sengelov et al.,
J. Immunol. 153:804-810 (1994); and Sengelov et al., Crit. Rev.
Immunol. 15:107-131 (1995)) and internalize ligand through a
macropinocytotic process only after cross-linking of the receptor
(Carpentier et al., Cell Regul. 2:41-55 (1991); Brown et al., Curr.
Opin. Immunol. 3:76=82 (1991)). As a consequence, CRIg expression
on the surface of cells is down/regulated following stimulation of
the cells, whereas CR1 and CR3 cell surface expression increases
following stimulation. This increase serves as an important step in
binding and phagocytosis, and like CRIg, CR3 concentrates in the
phagocytic cup and the phagosome surrounding C3 opsonized particles
(Aderem and Underhill, Annu. Rev. Immunol. 17:593-623 (1999)). The
constitutive recycling and endocytosis of ligand by CRIg in resting
macrophages first with a role in binding of complement-opsonized
particles during the initial phase of a bacterial infection prior
to an inflammatory response (e.g. the recruitment of activated
phagocytes), as well as during removal of particles from the
circulation under non-inflammatory conditions.
[0194] Complement plays a crucial role in the body's defense, and,
together with other components of the immune system, protect the
individual from pathogens invading the body. However, if not
properly activated or controlled, complement can also cause injury
to host tissues. Inappropriate activation of complement is involved
in the pathogenesis of a variety of diseases, referred to as
complement associated diseases or disorders, such as immune complex
and autoimmune diseases, and various inflammatory conditions,
including complement-mediated inflammatory tissue damage. The
pathology of complement-associated diseases varies, and might
involve complement activation for a long or short period of time,
activation of the whole cascade, only one of the cascades (e.g.
classical or alternative pathway), only some components of the
cascade, etc. In some diseases complement biological activities of
complement fragments result in tissue injury and disease.
Accordingly, inhibitors of complement have high therapeutic
potential. Selective inhibitors of the alternative pathway would be
particularly useful, because clearance of pathogens and other
organisms from the blood through the classical pathway will remain
intact.
[0195] C3b is known to covalently opsonize surfaces of
microorganisms invading the body, and act as a ligand for
complement receptors present on phagocytic cells, which ultimately
leads to phagocytosis of the pathogens. In many pathological
situations, such as those listed above, complement will be
activated on cell surfaces, including the vascular wall, cartilage
in the joints, glomeruli in the liver or cells which lack intrinsic
complement inhibitors. Complement activation leads to inflammation
caused by the chemoattractant properties of the anaphylatoxins C3a
and C5a and can cause damage to self-cells by generating a membrane
attack complex. Without being bound by any particular theory, by
binding C3b, CRIg is believed to inhibit C3 convertase, thereby
preventing or reducing complement-mediated diseases, examples of
which have been listed hereinabove.
[0196] Compounds of the Invention
[0197] 1. Native Sequence and Variant CRIg Polvpeptides
[0198] The preparation of native CRIg molecules, along with their
nucleic acid and polypeptide sequences, have been discussed above.
Example 1 shows the cloning of full-length huCRIg of SEQ ID NO: 4.
CRIg polypeptides can be produced by culturing cells transformed or
transfected with a vector containing CRIg nucleic acid. It is, of
course, contemplated that alternative methods, which are well known
in the art, may be employed to prepare CRIg. For instance, the CRIg
sequence, or portions thereof, may be produced by direct peptide
synthesis using solid-phase techniques [see, e.g., Stewart et al.,
Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco,
Calif. (1969); Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963)].
In vitro protein synthesis may be performed using manual techniques
or by automation. Automated synthesis may be accomplished, for
instance, using an Applied Biosystems Peptide Synthesizer (Foster
City, Calif.) using manufacturer's instructions. Various portions
of CRIg may be chemically synthesized separately and combined using
chemical or enzymatic methods to produce the full-length CRIg.
[0199] CRIg variants can be prepared by introducing appropriate
nucleotide changes into the DNA encoding a native sequence CRIg
polypeptide, or by synthesis of the desired CRIg polypeptide. Those
skilled in the art will appreciate that amino acid changes may
alter post-translational processes of CRIg, such as changing the
number or position of glycosylation sites or altering the membrane
anchoring characteristics.
[0200] Variations in the native sequence CRIg polypeptides
described herein can be made, for example, using any of the
techniques and guidelines for conservative and non-conservative
mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or
more codons encoding a native sequence or variant CRIg that results
in a change in its amino acid sequence as compared with a
corresponding native sequence or variant CRIg. Optionally the
variation is by substitution of at least one amino acid with any
other amino acid in one or more of the domains of a native sequence
CRIg polypeptide. Guidance in determining which amino acid residue
may be inserted, substituted or deleted without adversely affecting
the desired activity may be found by comparing the sequence of the
CRIg with that of homologous known protein molecules and minimizing
the number of amino acid sequence changes made in regions of high
homology.
[0201] Amino acid substitutions can be the result of replacing one
amino acid with another amino acid having similar structural and/or
chemical properties, such as the replacement of a leucine with a
serine, i.e., conservative amino acid replacements. Insertions or
deletions may optionally be in the range of 1 to 5 amino acids. The
variation allowed may be determined by systematically making
insertions, deletions or substitutions of amino acids in the
sequence and testing the resulting variants for activity in the in
vitro assay described in the Examples below.
[0202] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res. 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the CRIg variant DNA.
[0203] Scanning amino acid analysis can also be employed to
identify one or more amino acids that may be varied along a
contiguous sequence. Among the preferred scanning amino acids are
relatively small, neutral amino acids. Such amino acids include
alanine, glycine, serine, and cysteine. Alanine is typically a
preferred scanning amino acid among this group because it
eliminates the side-chain beyond the beta-carbon and is less likely
to alter the main-chain conformation of the variant. Alanine is
also typically preferred because it is the most common amino acid.
Further, it is frequently found in both buried and exposed
positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.);
Chothia, J. Mot Biol., 150:1 (1976)]. If alanine substitution does
not yield adequate amounts of variant, an isoteric amino acid can
be used.
[0204] It has been found that removal or inactivation of all or
part of the transmembrane region and/or cytoplasmic region does not
compromise CRIg biological activity. Therefore, transmembrane
region and/or cytoplasmic region deleted/inactivated CRIg variants
are specifically within the scope herein. Similarly, the IgC2
region can be removed without compromising biological activity, as
demonstrated by the existence of a biologically active native short
form of huCRIg and a murine homologue.
[0205] Covalent modifications of native sequence and variant CRIg
polypeptides are included within the scope of this invention. One
type of covalent modification includes reacting targeted amino acid
residues of CRIg with an organic derivatizing agent that is capable
of reacting with selected side chains or the N- or C-terminal
residues of the CRIg polypeptide. Derivatization with bifunctional
agents is useful, for instance, for crosslinking CRIg to a
water-insoluble support matrix or surface, for example, for use in
the method for purifying anti-CRIg antibodies. Commonly used
crosslinking agents include, e.g.,
1,1-bis(diazo-acetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidyl-propionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl)dithio]propioimidate.
[0206] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0207] Another type of covalent modification of the CRIg
polypeptides included within the scope of this invention comprises
altering the native glycosylation pattern of the polypeptides.
"Altering the native glycosylation pattern" is intended for
purposes herein to mean deleting one or more carbohydrate moieties
found in native sequence CRIg, and/or adding one or more
glycosylation sites that are not present in the native sequence
CRIg, and/or alteration of the ratio and/or composition of the
sugar residues attached to the glycosylation site(s). A predicted
native glycosylation site on murine CRIg is found at position 170
in the sequence NGTG.
[0208] Addition of glycosylation sites to the CRIg polypeptide may
be accomplished by altering the amino acid sequence. The alteration
may be made, for example, by the addition of, or substitution by,
one or more serine or threonine residues to the native sequence
CRIg (for O-linked glycosylation sites). The CRIg amino acid
sequence may optionally be altered through changes at the DNA
level, particularly by mutating the DNA encoding the CRIg
polypeptide at preselected bases such that codons are generated
that will translate into the desired amino acids.
[0209] Another means of increasing the number of carbohydrate
moieties on the CRIg polypeptide is by chemical or enzymatic
coupling of glycosides to the polypeptide. Such methods are
described in the art, e.g., in WO 87/05330 published 11 Sep. 1987,
and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306
(1981).
[0210] Removal of carbohydrate moieties present on the a CRIg
polypeptide may be accomplished chemically or enzymatically or by
mutational substitution of codons encoding for amino acid residues
that serve as targets for glycosylation. Chemical deglycosylation
techniques are known in the art and described, for instance, by
Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by
Edge et al., Anal. Biochem. 118:131 (1981). Enzymatic cleavage of
carbohydrate moieties on polypeptides can be achieved by the use of
a variety of endo- and exo-glycosidases as described by Thotakura
et al., Meth. Enzymol., 138:350 (1987).
[0211] Another type of covalent modification of CRIg comprises
linking the CRIg polypeptide to one of a variety of
nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene
glycol, or polyoxyalkylenes, for example in the manner set forth in
U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
[0212] The native sequence and variant CRIg of the present
invention may also be modified in a way to form a chimeric molecule
comprising CRIg, including fragments of CRIg, fused to another,
heterologous polypeptide or amino acid sequence. In one embodiment,
such a chimeric molecule comprises a fusion of CRIg with a tag
polypeptide which provides an epitope to which an anti-tag antibody
can selectively bind. The epitope tag is generally placed at the
amino- or carboxyl-terminus of the CRIg polypeptide. The presence
of such epitope-tagged forms of the CRIg polypeptide can be
detected using an antibody against the tag polypeptide. Also,
provision of the epitope tag enables the CRIg polypeptide to be
readily purified by affinity purification using an anti-tag
antibody or another type of affinity matrix that binds to the
epitope tag. Various tag polypeptides and their respective
antibodies are well known in the art. Examples include
poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly)
tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et
al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the
8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al.,
Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes
Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et
al., Protein Engineering, 3(6)547-553 (1990)]. Other tag
polypeptides include the Flag-peptide [Hopp et al., BioTechnology,
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science, 255:192-194 (1992)]; an .quadrature.-tubulin epitope
peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)];
and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al.,
Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].
[0213] In another embodiment, the chimeric molecule may comprise a
fusion of the CRIg polypeptide or a fragment thereof with an
immunoglobulin or a particular region of an immunoglobulin. For a
bivalent form of the chimeric molecule, such a fusion could be to
the Fc region of an IgG molecule. These fusion polypeptides are
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains, and are often referred to as
immunoadhesins. Structurally, the immunoadhesins comprise a fusion
of an amino acid sequence with the desired binding specificity
which is other than the antigen recognition and binding site of an
antibody (i.e., is "heterologous"), and an immunoglobulin constant
domain sequence. The adhesin part of an immunoadhesin molecule
typically is a contiguous amino acid sequence comprising at least
the binding site of a receptor or a ligand. The immunoglobulin
constant domain sequence in the immunoadhesin may be obtained from
any immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes,
IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
[0214] Chimeras constructed from a receptor sequence linked to an
appropriate immunoglobulin constant domain sequence
(immunoadhesins) are known in the art. Inununoadhesins reported in
the literature include fusions of the T cell receptor (Gascoigne et
al., Proc. Natl. Acad. Sci. USA, 84: 2936-2940 (1987)); CD4 (Capon
et al., Nature 337: 525-531 (1989); Traunecker et al., Nature, 339:
68-70 (1989); Zettmeissl et al., DNA Cell Biol. USA, 9: 347-353
(1990); Byrn et al., Nature, 344: 667-670 (1990)); L-selectin
(homing receptor) ((Watson et al., J. Cell. Biol.,
110:2221-2229(1990); Watson et al., Nature, 349: 164-167 (1991));
CD44 (Aruffo et al., Cell, 61: 1303-1313 (1990)); CD28 and B7
(Linsley et al., J. Exp. Med., 173: 721-730 (1991)); CTLA-4 (Lisley
et al., J. Exp. Med. 174: 561-569 (1991)); CD22 (Stamenkovic et
al., Cell, 66:1133-11144 (1991)); TNF receptor (Ashkenazi et al.,
Proc. Natl. Acad. Sci. USA, 88: 10535-10539(1991); Lesslauer et
al., Eur. J. Immunol., 27:2883-2886(1991); Peppel et al., J. Exp.
Med., 174:1483-1489(1991)); NP receptors (Bennett et al., J. Biol.
Chem. 266:23060-23067(1991)); and IgE receptor .alpha. (Ridgway et
al., J. Cell. Biol., 115:abstr. 1448 (1991)).
[0215] The simplest and most straightforward immunoadhesin design
combines the binding region(s) of the "adhesin" protein with the
hinge and Fc regions of an immunoglobulin heavy chain. Ordinarily,
when preparing the CRIg-immunoglobulin chimeras of the present
invention, nucleic acid encoding the extracellular domain of CRIg
will be fused C-terminally to nucleic acid encoding the N-terminus
of an immunoglobulin constant domain sequence, however N-terminal
fusions are also possible.
[0216] Typically, in such fusions the encoded chimeric polypeptide
will retain at least functionally active hinge and CH2 and CH3
domains of the constant region of an immunoglobulin heavy chain.
Fusions are also made to the C-terminus of the Fc portion of a
constant domain, or immediately N-terminal to the CH1 of the heavy
chain or the corresponding region of the light chain.
[0217] The precise site at which the fusion is made is not
critical; particular sites are well known and may be selected in
order to optimize the biological activity, secretion or binding
characteristics of the CRIg-immunoglobulin chimeras.
[0218] In some embodiments, the CRIg-immunoglobulin chimeras are
assembled as monomers, or hetero- or homo-multimer, and
particularly as dimers or tetramers, essentially as illustrated in
WO 91/08298.
[0219] In a preferred embodiment, the CRIg extracellular domain
sequence is fused to the N-terminus of the C-terminal portion of an
antibody (in particular the Fc domain), containing the effector
functions of an immunoglobulin, e.g. immunoglobulin G.sub.1 (IgG
1). It is possible to fuse the entire heavy chain constant region
to the CRIg extracellular domain sequence. However, more
preferably, a sequence beginning in the hinge region just upstream
of the papain cleavage site (which defines IgG Fc chemically;
residue 216, taking the first residue of heavy chain constant
region to be 114, or analogous sites of other immunoglobulins) is
used in the fusion. In a particularly preferred embodiment, the
CRIg amino acid sequence is fused to the hinge region and CH2 and
CH3, or to the CH1, hinge, CH2 and CH3 domains of an IgG1, gG2, or
IgG3 heavy chain. The precise site at which the fusion is made is
not critical, and the optimal site can be determined by routine
experimentation. Specific CRIg-Ig immunoadhesin structures are
illustrated in FIGS. 59-61.
[0220] In some embodiments, the CRIg-immunoglobulin chimeras are
assembled as multimer, and particularly as homo-dimers or
-tetramers. Generally, these assembled immunoglobulins will have
known unit structures. A basic four chain structural unit is the
form in which IgG, IgD, and IgE exist. A four unit is repeated in
the higher molecular weight immunoglobulins; IgM generally exists
as a pentamer of basic four units held together by disulfide bonds.
IgA globulin, and occasionally IgG globulin, may also exist in
multimeric form in serum. In the case of multimer, each four unit
may be the same or different.
[0221] Alternatively, the CRIg extracellular domain sequence can be
inserted between immunoglobulin heavy chain and light chain
sequences such that an immunoglobulin comprising a chimeric heavy
chain is obtained. In this embodiment, the CRIg sequence is fused
to the 3' end of an immunoglobulin heavy chain in each arm of an
immunoglobulin, either between the hinge and the CH2 domain, or
between the CH2 and CH3 domains Similar constructs have been
reported by Hoogenboom et al., Mol. Immunol., 28:1027-1037
(1991).
[0222] Although the presence of an immunoglobulin light chain is
not required in the immunoadhesins of the present invention, an
immunoglobulin light chain might be present either covalently
associated to a CRIg-immunoglobulin heavy chain fusion polypeptide,
or directly fused to the CRIg extracellular domain. In the former
case, DNA encoding an immunoglobulin light chain is typically
coexpressed with the DNA encoding the CRIg-immunoglobulin heavy
chain fusion protein. Upon secretion, the hybrid heavy chain and
the light chain will be covalently associated to provide an
immunoglobulin-like structure comprising two disulfide-linked
immunoglobulin heavy chain-light chain pairs. Methods suitable for
the preparation of such structures are, for example, disclosed in
U.S. Pat. No. 4,816,567 issued Mar. 28, 1989.
[0223] 2. Preparation of Native Sequence and Variant CRIg
Polypeptides
[0224] DNA encoding native sequence CRIg polypeptides may be
obtained from a cDNA library prepared from tissue believed to
possess the CRIg mRNA and to express it at a detectable level.
Accordingly, human CRIg DNA can be conveniently obtained from a
cDNA library prepared from human tissue, such as described in
Example 1. The CRIg-encoding gene may also be obtained from a
genomic library or by oligonucleotide synthesis.
[0225] Libraries can be screened with probes (such as antibodies to
CRIg or oligonucleotides of at least about 20-80 bases) designed to
identify the gene of interest or the protein encoded by it.
Screening the cDNA or genomic library with the selected probe may
be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor Laboratory Press, 1989). An alternative means to
isolate the gene encoding CRIg is to use PCR methodology [Sambrook
et al., supra; Dieffenbach et al., PCR Primer: A Laboratory Manual
(Cold Spring Harbor Laboratory Press, 1995).
[0226] Example 1 describes techniques for screening a cDNA library.
The oligonucleotide sequences selected as probes should be of
sufficient length and sufficiently unambiguous that false positives
are minimized. The oligonucleotide is preferably labeled such that
it can be detected upon hybridization to DNA in the library being
screened. Methods of labeling are well known in the art, and
include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0227] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined through sequence
alignment using computer software programs such as BLAST, BLAST-2,
ALIGN, DNAstar, and INHERIT which employ various algorithms to
measure homology.
[0228] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0229] Host cells are transfected or transformed with expression or
cloning vectors described herein for CRIg production and cultured
in conventional nutrient media modified as appropriate for inducing
promoters, selecting transformants, or amplifying the genes
encoding the desired sequences. The culture conditions, such as
media, temperature, pH and the like, can be selected by the skilled
artisan without undue experimentation. In general, principles,
protocols, and practical techniques for maximizing the productivity
of cell cultures can be found in Mammalian Cell Biotechnology: A
Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook
et al., supra.
[0230] Methods of transfection are known to the ordinarily skilled
artisan, for example, CaPO4 and electroporation. Depending on the
host cell used, transformation is performed using standard
techniques appropriate to such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra,
or electroporation is generally used for prokaryotes or other cells
that contain substantial cell-wall barriers. Infection with
Agrobacterium tumefaciens is used for transformation of certain
plant cells, as described by Shaw et al., Gene, 23:315 (1983) and
WO 89/05859 published 29 Jun. 1989. For mammalian cells without
such cell walls, the calcium phosphate precipitation method of
Graham and van der Eb, Virology, 52:456-457 (1978) can be employed.
General aspects of mammalian cell host system transformations have
been described in U.S. Pat. No. 4,399,216. Transformations into
yeast are typically carried out according to the method of Van
Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al., Proc.
Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for
introducing DNA into cells, such as by nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may also be used. For
various techniques for transforming mammalian cells, see Keown et
al., Methods in Enzymology, 185:527-537 (1990) and Mansour et al.,
Nature, 336:348-352 (1988).
[0231] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5 772 (ATCC 53,635).
[0232] in addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for CRIg-encoding vectors. Saccharomyces cerevisiae is a commonly
used lower eukaryotic host microorganism.
[0233] Suitable host cells for the expression of glycosylated CRIg
are derived from multicellular organisms. Examples of invertebrate
cells include insect cells such as Drosophila S2 and Spodoptera
Sf9, as well as plant cells. Examples of useful mammalian host cell
lines include Chinese hamster ovary (CHO) and COS cells. More
specific examples include monkey kidney CV1 cells transformed by
5V40 (COS-7, ATCC CRL 1651); human embryonic kidney cells (293 or
293 cells subcloned for growth in suspension culture, Graham et
al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary
cells/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA,
77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod.,
23:243-251 (1980)); human lung cells (W138, ATCC CCL 75); human
liver cells (Hep G2, HB 8065); and mouse mammary tumor cells (MMT
060562, ATCC CCL51). The selection of the appropriate host cell is
deemed to be within the skill in the art.
[0234] The nucleic acid (e.g., cDNA or genomic DNA) encoding CRIg
may be inserted into a replicable vector for cloning (amplification
of the DNA) or for expression. Various vectors are publicly
available. The vector may, for example, be in the form of a
plasmid, cosmid, viral particle, or phage. The appropriate nucleic
acid sequence may be inserted into the vector by a variety of
procedures. In general, DNA is inserted into an appropriate
restriction endonuclease site(s) using techniques known in the art.
Vector components generally include, but are not limited to, one or
more of a signal sequence, an origin of replication, one or more
marker genes, an enhancer element, a promoter, and a transcription
termination sequence. Construction of suitable vectors containing
one or more of these components employs standard ligation
techniques which are known to the skilled artisan.
[0235] The CRIg polypeptides may be produced recombinantly not only
directly, but also as a fusion polypeptide with a heterologous
polypeptide, which may be a signal sequence or other polypeptide
having a specific cleavage site at the N-terminus of the mature
protein or polypeptide. In general, the signal sequence may be a
component of the vector, or it may be a part of the CRIg DNA that
is inserted into the vector. The signal sequence may be a
prokaryotic signal sequence selected, for example, from the group
of the alkaline phosphatase, penicillinase, 1pp, or heat-stable
enterotoxin II leaders. For yeast secretion the signal sequence may
be, e.g., the yeast invertase leader, alpha factor leader
(including Saccharomyces and Kluyveromyces "factor leaders, the
latter described in U.S. Pat. No. 5,010,182), or acid phosphatase
leader, the C. albicans glucoamylase leader (EP 362,179 published 4
Apr. 1990), or the signal described in WO 90/13646 published 15
Nov. 1990. In mammalian cell expression, mammalian signal sequences
may be used to direct secretion of the protein, such as signal
sequences from secreted polypeptides of the same or related
species, as well as viral secretory leaders.
[0236] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the 2:
plasmid origin is suitable for yeast, and various viral origins
(5V40, polyoma, adenovirus, VSV or BPV) are useful for cloning
vectors in mammalian cells.
[0237] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0238] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the CRIg nucleic acid, such as DHFR or thymidine kinase.
An appropriate host cell when wild-type DHFR is employed is the CHO
cell line deficient in DHFR activity, prepared and propagated as
described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216
(1980). A suitable selection gene for use in yeast is the trp1 gene
present in the yeast plasmid YRp7 [Stinchcomb et al., Nature,
282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et
al., Gene, 10:157 (1980)]. The trp1 gene provides a selection
marker for a mutant strain of yeast lacking the ability to grow in
tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics,
85:12 (1977)].
[0239] Expression and cloning vectors usually contain a promoter
operably linked to the CRIg nucleic acid sequence to direct mRNA
synthesis. Promoters recognized by a variety of potential host
cells are well known. Promoters suitable for use with prokaryotic
hosts include the .beta.-lactamase and lactose promoter systems
[Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature,
281:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter
system [Goeddel, Nucleic Acids Res 8:4057 (1980); EP 36,776], and
hybrid promoters such as the tac promoter [deBoer et al., Proc.
Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in
bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding CRIg.
[0240] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0241] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0242] CRIg transcription from vectors in mammalian host cells is
controlled, for example, by promoters obtained from the genomes of
viruses such as polyoma virus, fowlpox virus (UK 2,211,504
published 5 Jul. 1989), adenovirus (such as Adenovirus 2), bovine
papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and Simian Virus 40 (5V40), from
heterologous mammalian promoters, e.g., the actin promoter or an
immunoglobulin promoter, and from heat-shock promoters, provided
such promoters are compatible with the host cell systems.
[0243] Transcription of a DNA encoding the CRIg polypeptides by
higher eukaryotes may be increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300 bp, that act on a promoter to increase
its transcription. Many enhancer sequences are now known from
mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein,
and insulin). Typically, however, one will use an enhancer from a
eukaryotic cell virus. Examples include the 5V40 enhancer on the
late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus enhancers.
The enhancer may be spliced into the vector at a position 5 or 3'
to the CRIg coding sequence, but is preferably located at a site 5'
from the promoter.
[0244] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3,
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding
CRIg.
[0245] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of CRIg in recombinant vertebrate cell
culture are described in Gething et al., Nature, 293:620-625
(1981); Mantei et al., Nature, 281:40-46 (1979); EP 117,060; and EP
117,058.
[0246] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0247] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal Conveniently, the antibodies may be prepared against
a native sequence CRIg polypeptide or against a synthetic peptide
based on the DNA sequences provided herein or against exogenous
sequence fused to CRIg DNA and encoding a specific antibody
epitope.
[0248] Forms of CRIg may be recovered from culture medium or from
host cell lysates. If membrane-bound, it can be released from the
membrane using a suitable detergent solution (e.g. Triton-X 100) or
by enzymatic cleavage. Cells employed in expression of CRIg can be
disrupted by various physical or chemical means, such as
freeze-thaw cycling, sonication, mechanical disruption, or cell
lysing agents.
[0249] It may be desired to purify CRIg from recombinant cell
proteins or polypeptides. The following procedures are exemplary of
suitable purification procedures: by fractionation on an
ion-exchange column; ethanol precipitation; reverse phase HPLC;
chromatography on silica or on a cation-exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation;
gel filtration using, for example, Sephadex G-75; protein A
Sepharose columns to remove contaminants such as IgG; and metal
chelating columns to bind epitope-tagged forms of the CRIg
polypeptide. Various methods of protein purification may be
employed and such methods are known in the art and described for
example in Deutscher, Methods in Enzymology, 182 (1990); Scopes,
Protein Purification. Principles and Practice, Springer-Verlag, New
York (1982). The purification step(s) selected will depend, for
example, on the nature of the production process used and the
particular CRIg produced.
[0250] 3. Agonists of CRIg Polypeptides
[0251] Agonists of the CRIg polypeptides will mimic a qualitative
biological activity of a native sequence CRIg polypeptide.
Preferably, the biological activity is the ability to bind C3b,
and/or to affect complement or complement activation, in particular
to inhibit the alternative complement pathway and/or C3 convertase.
Agonists include, for example, the immunoadhesins, peptide
mimetics, and non-peptide small organic molecules mimicking a
qualitative biological activity of a native CRIg.
[0252] CRIg-IG immunoadhesins have been discussed above.
[0253] Another group of CRIg agonists are peptide mimetics of
native sequence CRIg polypeptides. Peptide mimetics include, for
example, peptides containing non-naturally occurring amino acids
provided the compound retains CRIg biological activity as described
herein. Similarly, peptide mimetics and analogs may include
non-amino acid chemical structures that mimic the structure of
important structural elements of the CRIg polypeptides of the
present invention and retain CRIg biological activity. The term
"peptide" is used herein to refer to constrained (that is, having
some element of structure as, for example, the presence of amino
acids which initiate a .beta. turn or .beta. pleated sheet, or for
example, cyclized by the presence of disulfide bonded Cys residues)
or unconstrained (e.g., linear) amino acid sequences of less than
about 50 amino acid residues, and preferably less than about 40
amino acids residues, including multimers, such as dimers thereof
or there between. Of the peptides of less than about 40 amino acid
residues, preferred are the peptides of between about 10 and about
30 amino acid residues and especially the peptides of about 20
amino acid residues. However, upon reading the instant disclosure,
the skilled artisan will recognize that it is not the length of a
particular peptide but its ability to bind C3b and inhibit C3
convertase, in particular C3 convertase of the alternative
complement pathway, that distinguishes the peptide.
[0254] Peptides can be conveniently prepared using solid phase
peptide synthesis (Merrifield, J. Am. Chem. Soc. 85:2149 (1964);
Houghten, Proc. Natl. Acad. Sci. USA 82:5132 (1985)). Solid phase
synthesis begins at the carboxyl terminus of the putative peptide
by coupling a protected amino acid to an inert solid support. The
inert solid support can be any macromolecule capable of serving as
an anchor for the C-terminus of the initial amino acid. Typically,
the macromolecular support is a cross-linked polymeric resin (e.g.,
a polyamide or polystyrene resin), as shown in FIGS. 1-1 and 1-2,
on pages 2 and 4 of Stewart and Young, supra. In one embodiment,
the C-terminal amino acid is coupled to a polystyrene resin to form
a benzyl ester. A macromolecular support is selected such that the
peptide anchor link is stable under the conditions used to
deprotect the .alpha.-amino group of the blocked amino acids in
peptide synthesis. If a base-labile .alpha.-protecting group is
used, then it is desirable to use an acid-labile link between the
peptide and the solid support. For example, an acid-labile ether
resin is effective for base-labile Fmoc-amino acid peptide
synthesis, as described on page 16 of Stewart and Young, supra.
Alternatively, a peptide anchor link and .alpha.-protecting group
that are differentially labile to acidolysis can be used. For
example, an aminomethyl resin such as the phenylacetamidomethyl
(Pam) resin works well in conjunction with Boc-amino acid peptide
synthesis, as described on pages 11-12 of Stewart and Young,
supra.
[0255] After the initial amino acid is coupled to an inert solid
support, the .alpha.-amino protecting group of the initial amino
acid is removed with, for example, trifluoroacetic acid (TFA) in
methylene chloride and neutralizing in, for example, triethylamine
(TEA). Following deprotection of the initial amino acid's
.alpha.-amino group, the next .alpha.-amino and sidechain protected
amino acid in the synthesis is added. The remaining alpha.-amino
and, if necessary, side chain protected amino acids are then
coupled sequentially in the desired order by condensation to obtain
an intermediate compound connected to the solid support.
Alternatively, some amino acids may be coupled to one another to
form a fragment of the desired peptide followed by addition of the
peptide fragment to the growing solid phase peptide chain.
[0256] The condensation reaction between two amino acids, or an
amino acid and a peptide, or a peptide and a peptide can be carried
out according to the usual condensation methods such as the axide
method, mixed acid anhydride method, DCC
(N,N'-dicyclohexylcarbodiimide) or DIC
(N,N'-diisopropylcarbodiimide) methods, active ester method,
p-nitrophenyl ester method, BOP (benzotriazole-1-yl-oxy-tris
[dimethylamino] phosphonium hexafluorophosphate) method,
N-hydroxysuccinic acid imido ester method, etc, and Woodward
reagent K method.
[0257] It is common in the chemical syntheses of peptides to
protect any reactive side-chain groups of the amino acids with
suitable protecting groups. Ultimately, these protecting groups are
removed after the desired polypeptide chain has been sequentially
assembled. Also common is the protection of the .alpha.-amino group
on an amino acid or peptide fragment while the C-terminal carboxyl
group of the amino acid or peptide fragment reacts with the free
N-terminal amino group of the growing solid phase polypeptide
chain, followed by the selective removal of the .alpha.-amino group
to permit the addition of the next amino acid or peptide fragment
to the solid phase polypeptide chain. Accordingly, it is common in
polypeptide synthesis that an intermediate compound is produced
which contains each of the amino acid residues located in the
desired sequence in the peptide chain wherein individual residues
still carry side-chain protecting groups. These protecting groups
can be removed substantially at the same time to produce the
desired polypeptide product following removal from the solid
phase.
[0258] .alpha.- and .epsilon.-amino side chains can be protected
with benzyloxycarbonyl (abbreviated Z), isonicotinyloxycarbonyl
(iNOC), o-chlorobenzyloxycarbonyl [Z(2C1)],
p-nitrobenzyloxycarbonyl [Z(NO.sub.2)], p-methoxybenzyloxycarbonyl
[Z(OMe))], t-butoxycarbonyl (Boc), t-amyloxycarbonyl (Aoc),
isobornyloxycarbonyl, adamantyloxycarbonyl,
2-(4-biphenyl)-2-propyloxycarbonyl (Bpoc),
9-fluorenylmethoxycarbonyl (Fmoc), methylsulfonyethoxycarbonyl
(Msc), trifluoroacetyl, phthalyl, formyl, 2-nitrophenylsulphenyl
(NPS), diphenylphosphinothioyl (Ppt), and dimethylphosphinothioyl
(Mpt) groups, and the like.
[0259] Protective groups for the carboxyl functional group are
exemplified by benzyl ester (OBz1), cyclohexyl ester (Chx),
4-nitrobenzyl ester (ONb), t-butyl ester (Obut), 4-pyridylmethyl
ester (OPic), and the like. It is often desirable that specific
amino acids such as arginine, cysteine, and serine possessing a
functional group other than amino and carboxyl groups are protected
by a suitable protective group. For example, the guanidino group of
arginine may be protected with nitro, p-toluenesulfonyl,
benzyloxycarbonyl, adamantyloxycarbonyl, p-methoxybenzesulfonyl,
4-methoxy-2,6-dimethylbenzenesulfonyl (Nds),
1,3,5-trimethylphenysulfonyl (Mts), and the like. The thiol group
of cysteine can be protected with p-methoxybenzyl, trityl, and the
like.
[0260] Many of the blocked amino acids described above can be
obtained from commercial sources such as Novabiochem (San Diego,
Calif.), Bachem CA (Torrence, Calif.) or Peninsula Labs (Belmont,
Calif.).
[0261] Stewart and Young, supra, provides detailed information
regarding procedures for preparing peptides. Protection of
.alpha.-amino groups is described on pages 14-18, and side chain
blockage is described on pages 18-28. A table of protecting groups
for amine, hydroxyl and sulThydryl functions is provided on pages
149-151.
[0262] After the desired amino acid sequence has been completed,
the peptide can be cleaved away from the solid support, recovered
and purified. The peptide is removed from the solid support by a
reagent capable of disrupting the peptide-solid phase link, and
optionally deprotects blocked side chain functional groups on the
peptide. In one embodiment, the peptide is cleaved away from the
solid phase by acidolysis with liquid hydrofluoric acid (HF), which
also removes any remaining side chain protective groups.
Preferably, in order to avoid alkylation of residues in the peptide
(for example, alkylation of methionine, cysteine, and tyrosine
residues), the acidolysis reaction mixture contains thio-cresol and
cresol scavengers. Following HF cleavage, the resin is washed with
ether, and the free peptide is extracted from the solid phase with
sequential washes of acetic acid solutions. The combined washes are
lyophilized, and the peptide is purified.
[0263] 4. Antagonists of CRIg Polypepticles
[0264] Antagonists of native sequence CRIg polypeptides find
utility in the treatment of condition benefiting from excessive
complement activation, including the treatment of tumors.
[0265] A preferred group of antagonists includes antibodies
specifically binding a native CRIg. Exemplary antibodies include
polyclonal, monoclonal, humanized, bispecific and heteroconjugate
antibodies.
[0266] Methods of preparing polyclonal antibodies are known to
skilled artisan. Polyclonal antibodies can be raised in a mammal,
for example, by one or more injections of an immunizing agent, and,
if desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the
CRIg polypeptide of the invention or a fragment or fusion protein
thereof. It may be useful to conjugate the immunizing agent to a
protein known to be immunogenic in the mammal being immunized
Examples of such immunogenic proteins include but are not limited
to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin,
and soybean trypsin inhibitor. Examples of adjuvants which may be
employed include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The
immunization protocol may be selected by one skilled in the art
without undue experimentation.
[0267] Antibodies which recognize and bind to the polypeptides of
the invention or which act as antagonists thereto may,
alternatively be monoclonal antibodies. Monoclonal antibodies may
be prepared using hybridoma methods, such as those described by
Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method,
a mouse, hamster, or other appropriate host animal, is typically
immunized with an immunizing agent to elicit lymphocytes that
produce or are capable of producing antibodies that will
specifically bind to the immunizing agent. Alternatively, the
lymphocytes may be immunized in vitro.
[0268] The immunizing agent will typically include the CRIg
polypeptide of the invention, an antigenic fragment or a fusion
protein thereof. Generally, either peripheral blood lymphocytes
("PBLs") are used if cells of human origin are desired, or spleen
cells or lymph node cells are used if non-human mammalian sources
are desired. The lymphocytes are then fused with an immortalized
cell line using a suitable fusing agent, such as polyethylene
glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies:
Principles and Practice, Academic Press, (1986) pp. 59-103].
Immortalized cell lines are usually transformed mammalian cells,
particularly myeloma cells of rodent, bovine and human origin.
Usually, rat or mouse myeloma cell lines are employed. The
hybridoma cells may be cultured in a suitable culture medium that
preferably contains one or more substances that inhibit the growth
or survival of the unfused, immortalized cells. For example, if the
parental cells lack the enzyme hypoxanthine guanine phosphoribosyl
transferase (HGPRT or HPRT), the culture medium for the hybridomas
typically will include hypoxanthine, aminopterin, and thymidine
("HAT medium"), which substances prevent the growth of
HGPRT-deficient cells.
[0269] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol, 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0270] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the polypeptide of the invention or having similar
activity as the polypeptide of the invention. Preferably, the
binding specificity of monoclonal antibodies produced by the
hybridoma cells is determined by immunoprecipitation or by an in
vitro binding assay, such as radioimmunoassay (RIA) or
enzyme-linked immunoabsorbent assay (ELISA). Such techniques and
assays are known in the art. The binding affinity of the monoclonal
antibody can, for example, be determined by the Scatchard analysis
of Munson and Pollard, Anal. Biochem., 107:220 (1980).
[0271] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0272] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxyapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0273] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences [U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0274] The antibodies are preferably monovalent antibodies. Methods
for preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0275] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art.
[0276] The antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary
determining region (CDR) of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin [Jones et
al., Nature, 321:522-525 (1986); Riechmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596
(1992)].
[0277] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain Humanization can be essentially performed following
the method of Winter and coworkers [Jones et al., Nature,
321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988);
Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Pat. No. 4,816,567), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized antibodies are typically human antibodies in
which some CDR residues and possibly some FR residues are
substituted by residues from analogous sites in rodent
antibodies.
[0278] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
[Hoogenboom and Winter, J. Mol Biol., 227:381 (1991); Marks et al.,
I Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and
Boemer et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985); Boemer et al., J.
Immunol., 147(1):86-95 (1991); U.S. Pat. No. 5,750,373]. Similarly,
human antibodies can be made by introducing of human immunoglobulin
loci into transgenic animals, e.g., mice in which the endogenous
immunoglobulin genes have been partially or completely inactivated.
Upon challenge, human antibody production is observed, which
closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This
approach is described, for example, in U.S. Pat. Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the
following scientific publications: Marks et al., Bio/Technology 10,
779-783 (1992); Lonberg et al., Nature 368 856-859 (1994);
Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature
Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology
14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93
(1995).
[0279] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities may be for the polypeptide of the invention, the
other one is for any other antigen, and preferably for a
cell-surface protein or receptor or receptor subunit.
[0280] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the coexpression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
[1983]). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps
Similar procedures are disclosed in WO 93/08829, published 13 May
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0281] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are cotransfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0282] Heteroconjugate antibodies are composed of two covalently
joined antibodies. Such antibodies have, for example, been proposed
to target immune system cells to unwanted cells (U.S. Pat. No.
4,676,980), and for treatment of HIV infection (WO 91/00360; WO
92/200373; EP 03089). It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving crosslinking agents. For
example, immunotoxins may be constructed using a disulfide exchange
reaction or by forming a thioether bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0283] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance the
effectiveness of the antibody in treating an immune related
disease, for example. For example cysteine residue(s) may be
introduced in the Fc region, thereby allowing interchain disulfide
bond formation in this region. The homodimeric antibody thus
generated may have improved internalization capability and/or
increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC). See Caron et al., J. Exp. Med.
176:1191-1195 (1992) and Shopes, B., J. Immunol. 148:2918-2922
(1992). Homodimeric antibodies with enhanced anti-tumor activity
may also be prepared using heterobifunctional cross-linkers as
described in Wolff et al. Cancer Research 53:2560-2565 (1993).
Alternatively, an antibody can be engineered which has dual Fc
regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson et al., Anti-Cancer Drug Design,
3:219-230 (1989).
[0284] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, toxin (e.g. an enzymatically active toxin
of bacterial, fungal, plant or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
[0285] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y and .sup.186Re.
[0286] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See W094/11026.
[0287] In another embodiment, the antibody may be conjugated to a
"receptor" (such streptavidin) for utilization in tissue
pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g. avidin) which is conjugated to a
cytotoxic agent (e.g. a radionucleotide).
[0288] 5. Target Diseases and Treatment Methods
[0289] The CRIg polypeptides of the present invention and their
agonists, especially CRIg-Ig immunoadhesins, find utility in the
prevention and/or treatment of complement-associated diseases and
pathological conditions. Such diseases and conditions include,
without limitation, inflammatory and autoimmune diseases.
[0290] Specific examples of complement-associated diseases include,
without limitation, rheumatoid arthritis (RA), acute respiratory
distress syndrome (ARDS), remote tissue injury after ischemia and
reperfusion, complement activation during cardiopulmonary bypass
surgery, dermatomyositis, pemphigus, lupus nephritis and resultant
glomerulonephritis and vasculitis, cardiopulmonary bypass,
cardioplegia-induced coronary endothelial dysfunction, type II
membranoproliferative glomerulonephritis, IgA nephropathy, acute
renal failure, cryoglobulemia, antiphospholipid syndrome, macular
degenerative diseases and other complement-associated eye
conditions, such as age-related macular degeneration (AMD),
including non-exudative and exudative-type AMD, diabetic
retinopathy (DR), and endophthalmitis, uveitis,
allo-transplantation, xeno-transplantation, hyperacute rejection,
hemodialysis, chronic occlusive pulmonary distress syndrome (COPD),
asthma, hereditary angioedema, paroxysma nocturnal
hemoglobulinurea, Alzheimers disease, atherosclerosis, aspiration
pneumonia, utricaria, such as chronic idiopathic utricaria,
hemolytic uremic syndrome, endometriosis, caridogenic shock,
ischemia reperfusio injury, multiple schlerosis (MS).
[0291] AMD is age-related degeneration of the macula, which is the
leading cause of irreversible visual dysfunction in individuals
over the age of 60. Two types of AMD exist, non-exudative (dry) and
exudative (wet) AMD. The dry, or nonexudative, form involves
atrophic and hypertrophic changes in the retinal pigment epithelium
(RPE) underlying the central retina (macula) as well as deposits
(drusen) on the RPE. Patients with nonexudative ARMD can progress
to the wet, or exudative, form of ARMD, in which abnormal blood
vessels called choroidal neovascular membranes (CNVMs) develop
under the retina, leak fluid and blood, and ultimately cause a
blinding disciform scar in and under the retina. Nonexudative ARMD,
which is usually a precursor of exudative ARMD, is more common. The
presentation of nonexudative ARMD varies; hard drusen, soft drusen,
RPE geographic atrophy, and pigment clumping can be present.
Complement components are deposited on the RPE early in AMD and are
major constituents of drusen. It has been recently reported that
complement factor H (CFH) polymorphism accounts for 50% of the
attributable risk of AMD (Klein et al., Science 308:385-9
(2005)).
[0292] The present invention specifically concerns the treatment of
high risk AMD, including category 3 and category 4 AMD. Category 3
AMD is characterized by the absence of advanced AMD in both eyes,
at least one eye halving a visual acuity of 20/32 or better, at
least one large druse (e.g. 125 .mu.m), extensive (as measured by
drusen area) intermediate drusen, or geographic atrophy (GA) that
does not involve the center of the macula, or any combination of
these. Category 4 high risk AMD is characterized by a visual acuity
of 20/32 or better and no advanced AMD (GA involving the center of
the macula or features of choroidal neovascularization) in index
eye. Fellow eye is characterized by advanced AMD, or visual acuity
less than 20/32 attributable to AMD maculopathy. Typically, high
risk AMD, if untreated, rapidly progresses into choroidal
neovascularization (CNV), at a rate about 10-30-times higher than
the rate of progression for category 1 or 2 (not high risk) AMD.
Accordingly, CRIg finds utility in the prevention and treatment of
CNV and AMD.
[0293] In addition, in view of strong evidence for a link of
complement activation and age-related macular degeneration (AMD),
the present invention provides a new method for the prevention and
treatment of CNV and AMD by complement inhibition, in particular,
by inhibiting the alternative pathway. Inhibitors of the
alternative pathway, other than CRIg, include fusion proteins (e.g.
immunoadhesins), agonist anti-CRIg antibodies and peptide and
non-peptide small molecules.
[0294] A more extensive list of inflammatory conditions as examples
of complement-associated diseases includes, for example,
inflammatory bowel disease (IBD), systemic lupus erythematosus,
rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vaculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection and graft-versus host disease.
[0295] In systemic lupus erythematosus, the central mediator of
disease is the production of auto-reactive antibodies to self
proteins/tissues and the subsequent generation of immune-mediated
inflammation. Antibodies either directly or indirectly mediate
tissue injury. Though T lymphocytes have not been shown to be
directly involved in tissue damage, T lymphocytes are required for
the development of auto-reactive antibodies. The genesis of the
disease is thus T lymphocyte dependent. Multiple organs and systems
are affected clinically including kidney, lung, musculoskeletal
system, mucocutaneous, eye, central nervous system, cardiovascular
system, gastrointestinal tract, bone marrow and blood.
[0296] Rheumatoid arthritis (RA) is a chronic systemic autoimmune
inflammatory disease that mainly involves the synovial membrane of
multiple joints with resultant injury to the articular cartilage.
The pathogenesis is T lymphocyte dependent and is associated with
the production of rheumatoid factors, auto-antibodies directed
against self IgG, with the resultant formation of immune complexes
that attain high levels in joint fluid and blood. These complexes
in the joint may induce the marked infiltrate of lymphocytes and
monocytes into the synovium and subsequent marked synovial changes;
the joint space/fluid is infiltrated by similar cells with the
addition of numerous neutrophils. Tissues affected are primarily
the joints, often in symmetrical pattern. However, extra-articular
disease also occurs in two major forms. One form is the development
of extra-articular lesions with ongoing progressive joint disease
and typical lesions of pulmonary fibrosis, vasculitis, and
cutaneous ulcers. The second form of extra-articular disease is the
so called Felty's syndrome which occurs late in the RA disease
course, sometimes after joint disease has become quiescent, and
involves the presence of neutropenia, thrombocytopenia and
splenomegaly. This can be accompanied by vasculitis in multiple
organs with formations of infarcts, skin ulcers and gangrene.
Patients often also develop rheumatoid nodules in the subcutis
tissue overlying affected joints; the nodules late stages have
necrotic centers surrounded by a mixed inflammatory cell
infiltrate. Other manifestations which can occur in RA include:
pericarditis, pleuritis, coronary arteritis, interstitial
pneumonitis with pulmonary fibrosis, keratoconjunctivitis sicca,
and rheumatoid nodules.
[0297] Juvenile chronic arthritis is a chronic idiopathic
inflammatory disease which begins often at less than 16 years of
age. Its phenotype has some similarities to RA; some patients which
are rheumatoid factor positive are classified as juvenile
rheumatoid arthritis. The disease is sub-classified into three
major categories: pauciarticular, polyarticular, and systemic. The
arthritis can be severe and is typically destructive and leads to
joint ankylosis and retarded growth. Other manifestations can
include chronic anterior uveitis and systemic amyloidosis.
[0298] Spondyloarthropathies are a group of disorders with some
common clinical features and the common association with the
expression of HLA-B27 gene product. The disorders include:
ankylosing spondylitis, Reiter's syndrome (reactive arthritis),
arthritis associated with inflammatory bowel disease, spondylitis
associated with psoriasis, juvenile onset spondyloarthropathy and
undifferentiated spondyloarthropathy. Distinguishing features
include sacroileitis with or without spondylitis; inflammatory
asymmetric arthritis; association with HLA-B27 (a serologically
defined allele of the HLA-B locus of class I MEC); ocular
inflammation, and absence of autoantibodies associated with other
rheumatoid disease. The cell most implicated as key to induction of
the disease is the CD8+ T lymphocyte, a cell which targets antigen
presented by class I MEC molecules. CD8+ T cells may react against
the class I MEC allele HLA-B27 as if it were a foreign peptide
expressed by MEC class I molecules. It has been hypothesized that
an epitope of HLA-B27 may mimic a bacterial or other microbial
antigenic epitope and thus induce a CD8+ T cells response.
[0299] Systemic sclerosis (scleroderma) has an unknown etiology. A
hallmark of the disease is induration of the skin; likely this is
induced by an active inflammatory process. Scleroderma can be
localized or systemic; vascular lesions are common and endothelial
cell injury in the microvasculature is an early and important event
in the development of systemic sclerosis; the vascular injury may
be immune mediated. An immunologic basis is implied by the presence
of mononuclear cell infiltrates in the cutaneous lesions and the
presence of anti-nuclear antibodies in many patients. ICAM-1 is
often upregulated on the cell surface of fibroblasts in skin
lesions suggesting that T cell interaction with these cells may
have a role in the pathogenesis of the disease. Other organs
involved include: the gastrointestinal tract: smooth muscle atrophy
and fibrosis resulting in abnormal peristalsis/motility; kidney:
concentric subendothelial intimal proliferation affecting small
arcuate and interlobular arteries with resultant reduced renal
cortical blood flow, results in proteinuria, azotemia and
hypertension; skeletal muscle: atrophy, interstitial fibrosis;
inflammation; lung: interstitial pneumonitis and interstitial
fibrosis; and heart: contraction band necrosis,
scarring/fibrosis.
[0300] Idiopathic inflammatory myopathies including
dermatomyositis, polymyositis and others are disorders of chronic
muscle inflammation of unknown etiology resulting in muscle
weakness. Muscle injury/inflammation is often symmetric and
progressive. Autoantibodies are associated with most forms. These
myositis-specific autoantibodies are directed against and inhibit
the function of components, proteins and RNA's, involved in protein
synthesis.
[0301] Sjogren's syndrome is due to immune-mediated inflammation
and subsequent functional destruction of the tear glands and
salivary glands. The disease can be associated with or accompanied
by inflammatory connective tissue diseases. The disease is
associated with autoantibody production against Ro and La antigens,
both of which are small RNA-protein complexes. Lesions result in
keratoconjunctivitis sicca, xerostomia, with other manifestations
or associations including bilary cirrhosis, peripheral or sensory
neuropathy, and palpable purpura.
[0302] Systemic vasculitis includes diseases in which the primary
lesion is inflammation and subsequent damage to blood vessels which
results in ischemia/necrosis/degeneration to tissues supplied by
the affected vessels and eventual end-organ dysfunction in some
cases. Vasculitides can also occur as a secondary lesion or
sequelae to other immune-inflammatory mediated diseases such as
rheumatoid arthritis, systemic sclerosis, etc., particularly in
diseases also associated with the formation of immune complexes.
Diseases in the primary systemic vasculitis group include: systemic
necrotizing vasculitis: polyarteritis nodosa, allergic angiitis and
granulomatosis, polyangiitis; Wegener's granulomatosis;
lymphomatoid granulomatosis; and giant cell arteritis.
Miscellaneous vasculitides include: mucocutaneous lymph node
syndrome (MLNS or Kawasaki's disease), isolated CNS vasculitis,
Behet's disease, thromboangiitis obliterans (Buerger's disease) and
cutaneous necrotizing venulitis. The pathogenic mechanism of most
of the types of vasculitis listed is believed to be primarily due
to the deposition of immunoglobulin complexes in the vessel wall
and subsequent induction of an inflammatory response either via
ADCC, complement activation, or both.
[0303] Sarcoidosis is a condition of unknown etiology which is
characterized by the presence of epithelioid granulomas in nearly
any tissue in the body; involvement of the lung is most common. The
pathogenesis involves the persistence of activated macrophages and
lymphoid cells at sites of the disease with subsequent chronic
sequelae resultant from the release of locally and systemically
active products released by these cell types.
[0304] Autoimmune hemolytic anemia including autoimmune hemolytic
anemia, immune pancytopenia, and paroxysmal noctural hemoglobinuria
is a result of production of antibodies that react with antigens
expressed on the surface of red blood cells (and in some cases
other blood cells including platelets as well) and is a reflection
of the removal of those antibody coated cells via complement
mediated lysis and/or ADCC/Fc-receptor-mediated mechanisms.
[0305] In autoimmune thrombocytopenia including thrombocytopenic
purpura, and immune-mediated thrombocytopenia in other clinical
settings, platelet destruction/removal occurs as a result of either
antibody or complement attaching to platelets and subsequent
removal by complement lysis, ADCC or FC-receptor mediated
mechanisms.
[0306] Thyroiditis including Grave's disease, Hashimoto's
thyroiditis, juvenile lymphocytic thyroiditis, and atrophic
thyroiditis, are the result of an autoimmune response against
thyroid antigens with production of antibodies that react with
proteins present in and often specific for the thyroid gland.
Experimental models exist including spontaneous models: rats (BUF
and BB rats) and chickens (obese chicken strain); inducible models:
immunization of animals with either thyroglobulin, thyroid
microsomal antigen (thyroid peroxidase).
[0307] Type I diabetes mellitus or insulin-dependent diabetes is
the autoimmune destruction of pancreatic islet .beta. cells; this
destruction is mediated by auto-antibodies and auto-reactive T
cells. Antibodies to insulin or the insulin receptor can also
produce the phenotype of insulin-non-responsiveness.
[0308] Immune mediated renal diseases, including glomerulonephritis
and tubulointerstitial nephritis, are the result of antibody or T
lymphocyte mediated injury to renal tissue either directly as a
result of the production of autoreactive antibodies or T cells
against renal antigens or indirectly as a result of the deposition
of antibodies and/or immune complexes in the kidney that are
reactive against other, non-renal antigens. Thus other
immune-mediated diseases that result in the formation of
immune-complexes can also induce immune mediated renal disease as
an indirect sequelae. Both direct and indirect immune mechanisms
result in inflammatory response that produces/induces lesion
development in renal tissues with resultant organ function
impairment and in some cases progression to renal failure. Both
humoral and cellular immune mechanisms can be involved in the
pathogenesis of lesions.
[0309] Demyelinating diseases of the central and peripheral nervous
systems, including Multiple Sclerosis; idiopathic demyelinating
polyneuropathy or Guillain-Barr syndrome; and Chronic Inflammatory
Demyelinating Polyneuropathy, are believed to have an autoimmune
basis and result in nerve demyelination as a result of damage
caused to oligodendrocytes or to myelin directly. In MS there is
evidence to suggest that disease induction and progression is
dependent on T lymphocytes. Multiple Sclerosis is a demyelinating
disease that is T lymphocyte-dependent and has either a
relapsing-remitting course or a chronic progressive course. The
etiology is unknown; however, viral infections, genetic
predisposition, environment, and autoimmunity all contribute.
Lesions contain infiltrates of predominantly T lymphocyte mediated,
microglial cells and infiltrating macrophages; CD4+T lymphocytes
are the predominant cell type at lesions. The mechanism of
oligodendrocyte cell death and subsequent demyelination is not
known but is likely T lymphocyte driven.
[0310] Inflammatory and Fibrotic Lung Disease, including
eosinophilic pneumonia, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis may involve a disregulated
immune-inflammatory response. Inhibition of that response would be
of therapeutic benefit.
[0311] Autoimmune or Immune-mediated Skin Disease including Bullous
Skin Diseases, Erythema Multiforme, and Contact Dermatitis are
mediated by auto-antibodies, the genesis of which is T
lymphocyte-dependent.
[0312] Psoriasis is a T lymphocyte-mediated inflammatory disease.
Lesions contain infiltrates of T lymphocytes, macrophages and
antigen processing cells, and some neutrophils. Allergic diseases,
including asthma; allergic rhinitis; atopic dermatitis; food
hypersensitivity; and urticaria are T lymphocyte dependent. These
diseases are predominantly mediated by T lymphocyte induced
inflammation, IgE mediated-inflammation or a combination of
both.
[0313] Transplantation associated diseases, including Graft
rejection and Graft-Versus-Host-Disease (GVHD) are T
lymphocyte-dependent; inhibition of T lymphocyte function is
ameliorative.
[0314] For the prevention, treatment or reduction in the severity
of complement-associated (immune related) disease, the appropriate
dosage of a compound of the invention will depend on the type of
disease to be treated, as defined above, the severity and course of
the disease, whether the agent is administered for preventive or
therapeutic purposes, previous therapy, the patients clinical
history and response to the compound, and the discretion of the
attending physician. The compound is suitably administered to the
patient at one time or over a series of treatments. Preferably, it
is desirable to determine the dose-response curve and the
pharmaceutical composition of the invention first in vitro, and
then in useful animal models prior to testing in humans.
[0315] For example, depending on the type and severity of the
disease, about 1 .mu.g/kg to 15 mg/kg (e.g. 0.1-20 mg/kg) of
polypeptide is an initial candidate dosage for administration to
the patient, whether, for example, by one or more separate
administrations, or by continuous infusion. A typical daily dosage
might range from about 1 .mu.g/kg to 100 mg/kg or more, depending
on the factors mentioned above. For repeated administrations over
several days or longer, depending on the condition, the treatment
is sustained until a desired suppression of disease symptoms
occurs. However, other dosage regimens may be useful. The progress
of this therapy is easily monitored by conventional techniques and
assays.
[0316] CRIg antagonists, such as antibodies to CRIg, can be used in
immunoadjuvant therapy for the treatment of tumors (cancer). It is
now well established that T cells recognize human tumor specific
antigens. One group of tumor antigens, encoded by the MAGE, BAGE
and GAGE families of genes, are silent in all adult normal tissues,
but are expressed in significant amounts in tumors, such as
melanomas, lung tumors, head and neck tumors, and bladder
carcinomas. DeSmet, C. et al., (1996) Proc. Natl. Acad. Sci. USA,
93:7149. It has been shown that costimulation of T cells induces
tumor regression and an antitumor response both in vitro and in
vivo. Melero, I. et al., Nature Medicine (1997) 3:682; Kwon, E. D.
et al., Proc. Natl. Acad. Sci. USA (1997) 94:8099; Lynch, D. H. et
al., Nature Medicine (1997) 3:625; Finn, 0. J. and Lotze, M. T., J.
Immunol. (1998) 21:114. The CRIg antagonists of the invention can
be administered as adjuvants, alone or together with a growth
regulating agent, cytotoxic agent or chemotherapeutic agent, to
stimulate T cell proliferation/activation and an antitumor response
to tumor antigens. The growth regulating, cytotoxic, or
chemotherapeutic agent may be administered in conventional amounts
using known administration regimes. Immunostimulating activity by
the CRIg antagonists of the invention allows reduced amounts of the
growth regulating, cytotoxic, or chemotherapeutic agents thereby
potentially lowering the toxicity to the patient.
[0317] Although some macrophages are involved in tumor eradication,
many solid tumors are known to contain macrophages that support
tumor growth (Bingle et al., J Pathol 196:254-265 (2002); Mantovani
et al., Trends Immunol 23:549-555 (2002)). These macrophages may
contain CRIg on their surface Antibodies that block the capacity of
CRIg to inhibit complement activation could be used to activate
complement on tumor cells and help irradicate the tumor through
complement-mediated lysis. This approach would be particularly
useful in tumors that contain CRIg positive macrophages.
[0318] 6. Screening Assays and Animal Models
[0319] CRIg and potential agonists of CRIg can be evaluated in a
variety of cell-based assays and animal models of
complement-associated diseases or disorders.
[0320] Thus, for example, efficacy in the prevention and/or
treatment of arthritis can be evaluated in a collagen-induced
arthritis model (Terato et al. Brit. J. Rheum. 35:828-838 (1966)),
as shown in Example 7 below. Potential arthritis
prophylactics/therapeutics can also be screened in a model of
antibody-mediated arthritis induced by the intravenous injection of
a cocktail of four monoclonal antibodies, as described by Terato et
al., J. Immunol. 148:2103-8 (1992); Terato et al., Autoimmunity
22:137-47 (1995), and in Example 8 below. Candidates for the
prevention and/or treatment of arthritis can also be studied in
transgenic animal models, such as, for example, TNF-.alpha.
transgenic mice (Taconic). These animals express human tumor
necrosis factor (TNF-.alpha.), a cytokine which has been implicated
in the pathogenesis of human rheumatoid arthritis. The expression
of TNF-.alpha. in these mice results in severe chronic arthritis of
the forepaws and hind paws, and provides a simple mouse model of
inflammatory arthritis.
[0321] In recent years, animal models of psoriasis have also been
developed. Thus, Asebia (ab), flaky skin (fsw), and chronic
proliferative dermatitis (cpd) are spontaneous mouse mutations with
psoriasis-like skin alterations. Transgenic mice with cutaneous
overexpression of cytokines, such as interferon-.gamma.,
interleukin-1.alpha., keratinocyte growth factor, transforming
growth factor-.alpha., interferon-6, vascular endothelial growth
factor, or bone morphogenic protein-6, can also be used to study in
vivo psoriasis and to identify therapeutics for the treatment of
psoriasis. Psoriasis-like lesions were also described in
.beta..sub.2-integrin hypomorphic mice backcrossed to the PL/J
strain and in .beta..sub.1-integrin transgenic mice, scid/scid mice
reconstituted with CD4.sup.+/CD45RB.sup.hi T lymphocytes as well as
in HLA-B27/h.beta..sub.2 m transgenic rats. Xenotransplantation
models using human skin grafted on to immunodeficient mice are also
known. Thus, the compounds of the invention can be tested in the
scid/scid mouse model described by Schon, M. P. et al., Nat. Med.
(1997) 3:183, in which the mice demonstrate histopathologic skin
lesions resembling psoriasis. Another suitable model is the human
skin/scid mouse chimera prepared as described by Nickoloff, B. J.
et al., Am. J. Path. (1995) 146:580. For further details see, e.g.
Schon, M. P., J Invest Dermatology 112:405-410 (1999).
[0322] Recombinant (transgenic) animal models can be engineered by
introducing the coding portion of the genes of interest into the
genome of animals of interest, using standard techniques for
producing transgenic animals Animals that can serve as a target for
transgenic manipulation include, without limitation, mice, rats,
rabbits, guinea pigs, sheep, goats, pigs, and non-human primates,
e.g. baboons, chimpanzees and other monkeys. Techniques known in
the art to introduce a transgene into such animals include
pronucleic microinjection (Hoppe and Wanger, U.S. Pat. No.
4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et at, Proc. Natl. Acad. Sci. USA 82,
6148-615 [1985]); gene targeting in embryonic stem cells (Thompson
et al., Cell 56, 313-321 [1989]); electroporation of embryos (Lo,
Mol. Cell. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer
(Lavitrano et al., Cell 57, 717-73 [1989]). For review, see, for
example, U.S. Pat. No. 4,736,866.
[0323] For the purpose of the present invention, transgenic animals
include those that carry the transgene only in part of their cells
("mosaic animals") The transgene can be integrated either as a
single transgene, or in concatamers, e.g., head-to-head or
head-to-tail tandems. Selective introduction of a transgene into a
particular cell type is also possible by following, for example,
the technique of Lasko et al., Proc. Natl. Acad. Sci. USA 89,
623-636 (1992).
[0324] The expression of the transgene in transgenic animals can be
monitored by standard techniques. For example, Southern blot
analysis or PCR amplification can be used to verify the integration
of the transgene. The level of mRNA expression can then be analyzed
using techniques such as in situ hybridization, Northern blot
analysis, PCR, or immunocytochemistry.
[0325] The animals may be further examined for signs of immune
disease pathology, for example by histological examination to
determine infiltration of immune cells into specific tissues.
Blocking experiments can also be performed in which the transgenic
animals are treated with CRIg or a candidate agonist to determine
the extent of effects on complement and complement activation,
including the classical and alternative pathways, or T cell
proliferation. In these experiments, blocking antibodies which bind
to the polypeptide of the invention, are administered to the animal
and the biological effect of interest is monitored.
[0326] Alternatively, "knock out" animals can be constructed which
have a defective or altered gene encoding CRIg, as a result of
homologous recombination between the endogenous gene encoding the
CRIg polypeptide and altered genomic DNA encoding the same
polypeptide introduced into an embryonic cell of the animal. For
example, cDNA encoding CRIg can be used to clone genomic DNA
encoding CRIg in accordance with established techniques. A portion
of the genomic DNA encoding CRIg can be deleted or replaced with
another gene, such as a gene encoding a selectable marker which can
be used to monitor integration. Typically, several kilobases of
unaltered flanking DNA (both at the 5' and 3 ends) are included in
the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for
a description of homologous recombination vectors]. The vector is
introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has
homologously recombined with the endogenous DNA are selected [see
e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are then
injected into a blastocyst of an animal (e g, a mouse or rat) to
form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas
and Embryonic Stem Cells: A Practical Approach, E. J. Robertson,
ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then
be implanted into a suitable pseudopregnant female foster animal
and the embryo brought to term to create a "knock out" animal
Progeny harboring the homologously recombined DNA in their germ
cells can be identified by standard techniques and used to breed
animals in which all cells of the animal contain the homologously
recombined DNA. Knockout animals can be characterized for instance,
for their ability to defend against certain pathological conditions
and for their development of pathological conditions due to absence
of the CRIg polypeptide.
[0327] Thus, the biological activity of CRIB or its potential
agonists can be further studied in murine CRIg knock-out mice, as
described in Example 7 below.
[0328] A model of asthma has been described in which
antigen-induced airway hyper-reactivity, pulmonary eosinophilia and
inflammation are induced by sensitizing an animal with ovalbumin
and then challenging the animal with the same protein delivered by
aerosol. Several animal models (guinea pig, rat, nonhuman primate)
show symptoms similar to atopic asthma in humans upon challenge
with aerosol antigens. Murine models have many of the features of
human asthma. Suitable procedures to test CRIg and CRIg agonists
for activity and effectiveness in the treatment of asthma are
described by Wolyniec, W. W. et al., Am. J. Respir. Cell Mal. Biol.
(1998) 18:777 and the references cited therein.
[0329] Contact hypersensitivity is a simple in vivo assay of cell
mediated immune function. In this procedure, epidermal cells are
exposed to exogenous haptens which give rise to a delayed type
hypersensitivity reaction which is measured and quantitated.
Contact sensitivity involves an initial sensitizing phase followed
by an elicitation phase. The elicitation phase occurs when the
epidermal cells encounter an antigen to which they have had
previous contact. Swelling and inflammation occur, making this an
excellent model of human allergic contact dermatitis. A suitable
procedure is described in detail in Current Protocols in
Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies,
E. M. Shevach and W. Strober, John Wiley & Sons, Inc., 1994,
unit 4.2. See also Grabbe, S. and Schwarz, T, Immun. Today
19(1):37-44 (1998).
[0330] Graft-versus-host disease occurs when immunocompetent cells
are transplanted into immunosuppressed or tolerant patients. The
donor cells recognize and respond to host antigens. The response
can vary from life threatening severe inflammation to mild cases of
diarrhea and weight loss. Graft-versus-host disease models provide
a means of assessing T cell reactivity against MHC antigens and
minor transplant antigens. A suitable procedure is described in
detail in Current Protocols in Immunology, supra, unit 4.3.
[0331] An animal model for skin allograft rejection is a means of
testing the ability of T cells to mediate in vivo tissue
destruction which is indicative of and a measure of their role in
anti-viral and tumor immunity. The most common and accepted models
use murine tail-skin grafts. Repeated experiments have shown that
skin allograft rejection is mediated by T cells, helper T cells and
killer-effector T cells, and not antibodies. Auchincloss, H. Jr.
and Sachs, D. H., Fundamental Immunology, 2nd ed., W. E. Paul ed.,
Raven Press, N Y, 1989, 889-992. A suitable procedure is described
in detail in Current Protocols in Immunology, supra, unit 4.4.
Other transplant rejection models which can be used to test CRIg
and CRIg agonists are the allogeneic heart transplant models
described by Tanabe, M. et al., Transplantation (1994) 58:23 and
Tinubu, S. A. et al., J. Immunol. (1994) 4330-4338.
[0332] Animal models for delayed type hypersensitivity provides an
assay of cell mediated immune function as well. Delayed type
hypersensitivity reactions are a T cell mediated in vivo immune
response characterized by inflammation which does not reach a peak
until after a period of time has elapsed after challenge with an
antigen. These reactions also occur in tissue specific autoimmune
diseases such as multiple sclerosis (MS) and experimental
autoimmune encephalomyelitis (EAE, a model for MS). A suitable
procedure is described in detail in Current Protocols in
Immunology, above, unit 4.5.
[0333] EAE is a T cell mediated autoimmune disease characterized by
T cell and mononuclear cell inflammation and subsequent
demyelination of axons in the central nervous system. EAE is
generally considered to be a relevant animal model for MS in humans
Bolton, C., Multiple Sclerosis (1995) 1:143. Both acute and
relapsing-remitting models have been developed. CRIg and its
agonists and antagonists can be tested for T cell stimulatory or
inhibitory activity against immune mediated demyelinating disease
using the protocol described in Current Protocols in Immunology,
above, units 15.1 and 15.2. See also the models for myelin disease
in which oligodendrocytes or Schwann cells are grafted into the
central nervous system as described in Duncan, I. D. et al., Molec.
Med. Today (1997) 554-561.
[0334] An animal model of age-related macular degeneration (AMD)
consists of mice with a null mutation in Ccl-2 or Ccr-2 gnes. These
mice develop cardinal features of AMD, including accumulation of
lipofuscin in and drusen beneath the retinal pigmented epithelium
(RPE), photoreceptor atrophy and choroidal neovascularization
(CNV). These features develop beyond 6 months of age. CRIg and CRIg
agonists can be tested for the formation of drusen, photoreceptor
atrophy and choroidal neovascularization.
[0335] Models of myocardial ischemia-reperfusion can be performed
in mice or rats. Animals are tracheostomized and ventilated with a
small animal ventilator. Polyethylene catheters are placed in the
internal carotid artery and the external jugular vein for
measurement of mean arterial blood pressure. Myocardial ischemia
reperfusion is initiated by ligating the left anterior descending
artery (LAD) with a 6-0 suture. Ischemia is produced by tightening
the reversible ligature around the LAD to completely occlude the
vessel. The ligature is removed after 30 min and the heart perfused
for 4 hours. CRIg and CRIg agonists can be tested for their
efficacy by measuring heart infarct size, heart creatine kinase
activity, myeloperoxidase activity and immunohistochemistry using
anti C3 antibodies
[0336] A model of diabetic retinopathy involves treatment of mice
or rats with streptozotocin. CRIg and CRIg agonists can be tested
on their effect on venule dilatation, intraretinal microvascular
abnormalities, and neovascularization of the retina and vitreous
cavity
[0337] A model for membranopgoliferative glomerulonephritis can be
established as follows: Female mice are immunized i.p. with 0.5 mg
control rabbit IgG in CFA (day -7). Seven days later (day 0), 1 mg
of the rabbit anti-mouse glomerular basement membrane (GBM)
antibody is injected i.v. via the tail vein. Elevation of
anti-rabbit IgG antibody in the serum is measured by ELISA. 24-h
urine samples are collected from the mice in metabolic cages, and
mouse renal function is assessed by the measurement of urinary
protein in addition to blood urea nitrogen.
[0338] 7. Pharmaceutical Compositions
[0339] The active molecules of the invention, including
polypeptides and their agonists, as well as other molecules
identified by the screening assays disclosed above, can be
administered for the treatment of inflammatory diseases, in the
form of pharmaceutical compositions.
[0340] Therapeutic formulations of the active molecule, preferably
a CRIg polypeptide or CRIg agonist of the invention, are prepared
for storage by mixing the active molecule having the desired degree
of purity with optional pharmaceutically acceptable carriers,
excipients or stabilizers (Remington's Pharmaceutical Sciences 16th
edition, Osol, A. Ed. [1980]), in the form of lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients,
or stabilizers are nontoxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, and other organic acids; antioxidants including ascorbic
acid and methionine; preservatives (such as octadecyldimethylbenzyl
ammonium chloride; hexamethonium chloride; benzalkonium chloride,
benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl
parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less
than about 10 residues) polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g. Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.TM., PLURONICS.TM. or
polyethylene glycol (PEG).
[0341] Compounds identified by the screening assays of the present
invention can be formulated in an analogous manner, using standard
techniques well known in the art.
[0342] Lipofections or liposomes can also be used to deliver the
polypeptide, antibody, or an antibody fragment, into cells. Where
antibody fragments are used, the smallest fragment which
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable region sequences of
an antibody, peptide molecules can be designed which retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology (see, e.g. Marasco et al., Proc. Natl. Acad. Sci. USA
90, 7889-7893 [1993]).
[0343] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise a cytotoxic agent, cytokine or growth
inhibitory agent. Such molecules are suitably present in
combination in amounts that are effective for the purpose
intended.
[0344] The active molecules may also be entrapped in microcapsules
prepared, for example, by coascervation techniques or by
interfacial polymerization, for example, hydroxymethylcellulose or
gelatin-microcapsules and poly-(methylmethacylate) microcapsules,
respectively, in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles and
nanocapsules) or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980).
[0345] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0346] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g. films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .quadrature. ethyl-L-glutamate, non-degradable
ethylene-vinyl acetate, degradable lactic acid-glycolic acid
copolymers such as the LUPRON DEPOT.TM. (injectable microspheres
composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such
as ethylene-vinyl acetate and lactic acid-glycolic acid enable
release of molecules for over 100 days, certain hydrogels release
proteins for shorter time periods. When encapsulated antibodies
remain in the body for a long time, they may denature or aggregate
as a result of exposure to moisture at 37 C, resulting in a loss of
biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0347] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0348] All patent and literature references cited in the present
specification are hereby expressly incorporated by reference in
their entirety.
EXAMPLES
[0349] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, 10801 University
Boulevard, Manassas, Va. 20110-2209.
Example 1
Isolation of cDNA Clones Encoding Human CRIB (PR0362)
[0350] The extracellular domain (ECD) sequences (including the
secretion signal, if any) of about 950 known secreted proteins from
the Swiss-Prot public protein database were used to search
expressed sequences tag (EST) databases. The EST databases included
public EST databases (e.g., GenBank) and a proprietary EST DNA
database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto, Calif.).
The search was performed using the computer program BLAST or
BLAST-2 (e.g., Altshul et al., Methods in Enzymology 266: 460-480
(1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST sequence. Those comparisons resulting in a
BLAST score 70 (or in some cases 90) or greater that did not encode
known proteins were clustered and assembled into consensus DNA
sequences with the program "phrap" (Phil Green, University of
Washington, Seattle, Wash.
[0351] A consensus DNA sequence was assembled relative to other EST
sequences using phrap. This consensus sequence is herein designated
DNA42257 (SEQ ID NO: 9) (see FIG. 32). Based on the DNA42257 (SEQ
ID NO: 9) consensus sequence shown in FIG. 32, oligonucleotides
were synthesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest, and 2) for use as probes to
isolate a clone of the full-length coding sequence for CRIg.
Forward and reverse PCR primers generally range from 20 to 30
nucleotides and are often designed to give a PCR product of about
100-1000 bp in length. The probe sequences are typically 40-55 bp
in length. In some cases, additional oligonucleotides are
synthesized when the consensus sequence is greater than about 1-1.5
kbp. In order to screen several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per
Ausubel et al., Current Protocols in Molecular Biology, with the
PCR primer pair. A positive library was then used to isolate clones
encoding the gene of interest using the probe oligonucleotide and
one of the primer pairs.
[0352] PCR primers (forward and reverse) were synthesized:
TABLE-US-00001 forward PCR primer 1 (42257.f1) (SEQ ID NO: 10)
5'-TATCCCTCCAATTGAGCACCCTGG-3' forward PCR primer 2 (42257.12) (SEQ
ID NO: 11) 5'-GTCGGAAGACATCCCAACAAG-3' reverse PCR primer 1
(42257.r1) (SEQ ID NO: 12) 5'-CTTCACAATGTCGCTGTGCTGCTC-3' reverse
PCR primer 2 (42257.r2) (SEQ ID NO: 13)
5'-AGCCAAATCCAGCAGCTGGCTTAC-3'
[0353] Additionally, a synthetic oligonucleotide hybridization
probe was constructed from the consensus DNA42257 sequence which
had the following nucleotide sequence:
TABLE-US-00002 Hybridization probe (42257.p1) (SEQ ID NO: 14)
5'-TGGATGA CCGGA GCCA CTACACGTGTGAAGTCACCTGGC AGACTCCTGAT-3'.
[0354] In order to screen several libraries for a source of a
full-length clone, DNA from the libraries was screened by PCR
amplification with the PCR primer pairs identified above. A
positive library was then used to isolate clones encoding the CRIg
gene using the probe oligonucleotide and one of the PCR
primers.
[0355] RNA for construction of the cDNA libraries was isolated from
human fetal brain tissue (LIB153). The cDNA libraries used to
isolate the cDNA clones were constructed by standard methods using
commercially available reagents such as those from Invitrogen, San
Diego, Calif. The cDNA was primed with oligo dT containing a NotI
site linked with blunt to Sall hemikinased adaptors, cleaved with
Not1, sized appropriately be gel electrophoresis, and cloned in a
defined orientation into a suitable cloning vector (such as pRKB or
pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI
site; see Holmes et al., Science 253: 1278-1280 (1991)) in the
unique XhoI and NotI sites.
[0356] DNA sequencing of the clones isolated as described gave the
DNA sequence for an isolated CRIg polypeptide (herein designated as
UNQ317 (DNA45416-1251) (SEQ ID NO: 1).
[0357] The entire nucleotide sequence of UNQ317 (DNA45416-1251) is
shown in FIG. 1 (SEQ ID NO: 1). Clone UNQ367 (DNA45416-1251) (SEQ
ID NO: 1) contains a single open reading frame with an apparent
translational initiation site at nucleotide positions 1082-1084
(FIG. 1, SEQ ID NO: 1). The predicted polypeptide precursor is 321
amino acids long (FIG. 1, SEQ ID NO: 2). The CRIg protein shown in
FIG. 1 has an estimated molecular weight of about 35,544 daltons
and a pI of about 8.51. Analysis of the 321-amino acid CRIg
polypeptide as shown in FIG. 1 (SEQ ID NO: 2) evidences the
presence of a glycosaminoglycan attachment site at about amino acid
149 to about amino acid 152 and a transmembrane domain from about
amino acid 276 to about amino acid 306. Clone UNQ317
(DNA45416-1251) has been deposited with ATCC deposit No.:
209620.
[0358] Similar to JAM family members, CRIg (PR0362), more recently
referred to as CRIg, is a type 1 transmembrane molecule and a
member of the immunoglobulin superfamily. The extracellular domain
of the long form of human CRIg (huCRIg(L)) encodes both V and a C2
type terminal Ig domains (Smith and Xue, J. Mol. Biol. 274:530-545
(1997)), while the short form (huCRIg(S)) encodes only a single
V-type Ig, resembling murine CRIg (muCRIg) (FIG. 42A). The C
terminal cytoplasmic domain of human and murine CRIg contain
consensus AP-2 internalization motifs (YARL and DSQALI,
respectively Bonafacino & Traub Ann Rev Biochem 72 p 395
(2003)). HuCRIgs and muCRIg share 67% overall sequence homology
with 83% homology residing in the IgV domain Among the JAM family
members, huCRIg is most closely related to JAM-A. Sequence
similarity is confined to a conserved stretch of residues forming
the Ig domain fold (FIG. 42A). Both human and murine CRIg are
located on chromosome X position Xq12 and have a syntenic position
on the chromosome flanked by hephaestin and moesin.
Example 2
Protein Production and Purification
[0359] The extracellular domains of hu and muCRIg were cloned into
a modified pRK5 expression vector encoding the human or murine IgG1
Fc region downstream of the CRIg sequence. The Fc portion of mouse
IgG1 contains a double mutation (D265A, N297A) preventing Fc
receptor binding (Gong et al., J. Immunol. 174:817-826 (2005)) was
used to control for Fc receptor regulation Human 1REM-1 and mouse
CLM-1 Fc fusion protein or a murine anti-gp120 IgG antibody were
used as controls. LFH tagged CRIg was made by fusing the ECD of
CRIg to a yeast leucine zipper, a Flag and an C-terminal (6)
histidine. Proteins were overexpressed in CHO cells by transient
transfections. Cells were grown in fully automated bioreactors
using F-12/Dulbecco's modified Eagle's medium-based media
supplemented with Ultra-Low IgG serum (Invitrogen) and Primatone HS
(Sigma). The culture was maintained for 7-12 days until harvest. Fc
fusion proteins were purified by protein A affinity chromatography
and subsequent Sephaciyl S-300 gel filtration. LFH fuson protein
was purified over a nickle column. Human CRIg-ECD protein was
affinity-purified over a Millipore Glyceryl-CPG (173700404) column
to which monoclonal antibody 3C9 was absorbed. Protein was eluted
at pH 3.0. hu and muCRIg-HIS were generated by cloning the CRIg ECD
into a baculovirus expression vector containing C-terminal (6)
histidines. Plasmid DNA was transfected into Sf9 cells, the
supernatant was used to infect H5 cells and proteins were purified
over a nickel column. The identities of all purified proteins were
verified by N-terminal sequence analysis and the lipopolysaccharide
concentration was <5 Eu/mg for all human or murine CRIg
preparations.
Example 3
Preparation of Antibodies
[0360] Polyclonal antibodies were generated by immunizing New
Zealand rabbits with 200 .mu.g huCRIg(L)-His in complete Freuds
adjuvant followed by a boost 6 weeks following first immunization
Monoclonal antibodies to muCRIg and huCRIg were generated by
immuniziling Wistar rats and Balb/c mice with 50 .mu.g of
his-tagged CRIg fusion protein via footpad injection. Clones were
selected based on reactivity with human and murine CRIg-ECD by
ELISA, FACS, Western blotting and immunohistochemistry. Unless
otherwise indicated, the antibodies obtained were used in
subsequent tests.
Example 4
Inflammatory Cell Infiltrates into Guinea Pig Skin
[0361] The following example shows that huCRIg (PR0362) is
proinflammatory in that it stimulates inflammatory cell infiltrates
(i.e., neutrophilic, eosinophilic, monocytic or lymphocytic) into
guinea pig skin. The assay described herein monitors the capacity
of this protein to induce an inflammatory cell infiltrate into the
skin of a guinea pig. Compounds which stimulate inflammatory
infiltration are useful therapeutically where enhancement of an
inflammatory response is beneficial. Compounds which inhibit
proliferation of lymphocytes are useful therapeutically where
suppression of an inflammatory response is beneficial. A
therapeutic agent may take the form, for example, of murine-human
chimeric, humanized or human antibodies against CRIg, small
molecules, peptides, etc. that mimic CRIg biological activity,
CRIg-Ig fusion proteins, CRIg extracellular region, and the
like.
[0362] Hairless guinea pigs (Charles River Labs) weighing 350 grams
or more were anesthetized with ketamine (75-80 mg/kg body weight)
and xylazine (5 mg/kg body weight) intramuscularly. The protein
samples of huCRIg and control proteins were injected intradermally
into the backs of each animal at a volume of 100 .mu.l per
injection site. There were approximately 16-24 injection sites per
animal One mL of Evans blue dye (1% in physiological buffered
saline) was injected intracardially. The animals were euthanized
after 6 hours and each skin injection site was biopsied and fixed
in formalin. The skins were prepared for histopathological
evaluation. Each site was evaluated for inflammatory cell
infiltration into the skin. Sites with visible inflammatory cells
were scored as positive. Samples inducing an inflammatory cell
infiltrate were scored as proinflammatory substances. CRIg tested
positive in this assay, which indicates antiinflammatory
activity.
Example 5
CRIg (PR0362) mRNA and Polypeptide Expression
[0363] A. In Situ Hybridization and Immunohistochemistry
[0364] Expression of CRIg mRNA was evaluated by in situ
hybridization, immunohistochemistry and RT-PCR in various types of
tissues.
[0365] For in situ hybridization, tissues were fixed (4% formalin),
paraffin-embedded, sectioned (3-5 .mu.m thick), deparaffinized,
deproteinated (20 .mu.g/ml) with proteinase K (15 minutes at
37.degree. C.), and processed for in situ hybridization. Probes to
the polypeptides of the invention were produced by PCR. Primers
included T7 or T3 RNA polymerase initiation sites to allow for in
vitro transcription of sense or antisense probes from the amplified
products. .sup.33P-UTP labeled sense and antisense probes were
hybridized overnight (55.degree. C.), washed (0.1.times.SSC for 2
hours at 55.degree. C.), dipped in NBT2 nuclear track emulsion
(Eastman Kodak, Rochester, N.Y.), exposed (4-6 weeks at 4.degree.
C.), and developed and counterstained with hematoxylin and eosin.
Representative paired bright and darkfield images are typically
shown.
[0366] Immunohistochemical staining was performed on 5 mm thick
frozen sections using a DAKO Autostainer. Endogenous peroxidase
activity was blocked with Kirkegaard and Perry Blocking Solution
(1:10, 4 minutes at 20.degree. C.). 10% NGS in TBS/0.05% Tween-20
(DAKO) was used for dilution and blocking. MAb 4F722.2 anti-CRIg
(anti-PR0362) or mouse IgG was used at 0.13 mg/ml. Biotinylated
goat anti-mouse IgG (Vector Labs), Burlingame, Calif.) was used at
1:200 and detected with Vector Labs Standard ABC Elite Kit (Vector
Labs, Burlingame, Calif.). Slides were developed using Pierce
metal-enhanced diaminobenzidine (Pierce Chemicals, Rockford, Ill.).
Dual immunohistochemistry for CRIg (PRO362) and CD68 expression was
performed on frozen sections to demonstrate localization of CRIg
expression to macrophages. mAb 4F7.22.2 anti-CRIg and anti-CD68 mAb
KP-1 from (DAKO) were utilized and detected by phycoerythrin and
FITC markers, respectively.
[0367] 1. Tissues Examined
[0368] Expression was examined in a wide variety of tissues and
cell types from humans and other mammals.
[0369] a. Normal Tissue
[0370] Normal human adult tissues that were examined included
tonsil, lymph node, spleen, kidney, urinary bladder, lung, heart,
aorta, coronary artery, liver, gall bladder, prostate, stomach,
small intestine, colon, pancrease, thyroid gland, skin, adrenal
gland, placenta, uterus, ovary, testis, retina, and brain
(cerebellum, brainstem, cerebral cortex). Normal human fetal
tissues including E12-E16 week-old brain, spleen, bowel and thyroid
were also tested. In addition, expression was investigated in
murine liver.
[0371] b. Inflamed Tissue
[0372] Inflamed tissues examined by in situ hybridization included
tissues with chronic inflammatory disease such as lungs with
chronic asthma, chronic bronchopneumonia, chronic
bronchitis/chronic obstructive pulmonary disease, kidneys with
chronic lymphocytic interstitial nephritis, and livers with chronic
inflammation and cirrhosis due to chronic hepatitis C infection,
autoimmune hepatitis or alcoholic cirrhosis.
[0373] c. Primary Neoplasms
[0374] Primary human neoplasms that were examined by in situ
hybridization for PR0362 expression included breast carcinoma,
pulmonary squamous cell carcinoma, pulmonary adenocarcinoma,
prostatic adenocarcinoma, and colonic adenocarcinoma.
[0375] 2. Results
[0376] CRIg (PR0362) was found to be expressed in mouse liver
frozen sections (FIG. 6), human liver frozen sections (FIG. 7) and
a number of tissue macrophage-like cells, including colon
macrophages (FIG. 8A), Kupffer cells (FIG. 8B), adrenal macrophages
(FIG. 8C), Hofbauer cells (FIG. 8D), synovial cells (FIG. 9),
alveolar macrophages, resident macrophages in the intestinal lamina
propria and interstitial macrophages in many tissues. CRIg was also
significantly expressed in brain microglia (FIG. 10). The
expression of CRIg was significantly increased in these tissues
when activated by the presence of neoplasia or inflammatory
disease, including rheumatoid arthritis (FIG. 9), inflammatory
bowel disease, chronic hepatitis (FIG. 12), pneumonia, chronic
asthma (FIG. 11), glioma, and bronchitis.
[0377] To further examine expression of CRIg, immunohistochemical
staining was performed on various tissue types. Dual
immunohistochemical staining for CRIg and CD68 was performed on
tissue macrophages, including adrenal gland macrophages, liver
Kupffer cells, brain microglial cells, and placental Hofbauer cells
was performed to determine whether CRIg and CD68 are expressed in
the same tissues.
[0378] CRIg was found to be coexpressed with CD68 on adrenal gland
macrophages (FIG. 13), liver Kupffer cells (FIG. 14), brain
microglial cells (FIG. 15), and placental Hofbauer cells (FIG.
16).
Example 6
Involvement of CRIg (PR0362) in Chronic Inflammation
[0379] The novel macrophage associated receptor with homology to
A33 antigen and JAM1 was cloned as described in Example 1 and
below, and was identified as a single transmembrane Ig superfamily
member macrophage associated polypeptide (CRIg or PR0362).
[0380] CRIg is expressed as two spliced variants. One variant is a
399-amino acid polypeptide containing an N-terminal IgV like domain
and a C-terminal IgC2 like domain, referred to as huCRIg or
huCRIg-long (SEQ ID NO: 4). The spliced form, which is 355 amino
acids long, lacking the C-terminal domain, is referred to as
huCRIg-short (SEQ ID NO: 6). Both receptors have a single
transmembrane domain and a cytoplasmic domain containing tyrosine
residues which are constitutively phosphorylated in macrophages in
vitro.
[0381] The present study demonstrates that CRIg is selectively
expressed on a subset of tissue resident macrophages, and is
associated with chronic inflammation.
Materials and Methods
[0382] Cells
[0383] Blood was obtained from healthy adult volunteers after
informed consent by venous puncture and separated using
Ficoll-Paque PLUS (Amersham Pharmacia Biotech) per manufacturers
instruction. PBMCs were obtained from the interface, washed in cold
PBS, lysed with 0.2% NaCl for 30 s and neutralized with 1.6% NaCl.
Cells were counted and kept on ice until use. To isolate peripheral
blood subsets, untouched MACS kits (Miltenyi Biotech, Auburn,
Calif.) were used following the manufacturer's instructions.
D8fferentiation to a macrophage phenotype was induced by culturing
CD14.sup.+ monocytes for up to 2 weeks in HG-DMEM medium containing
10% (v/v) autologous human serum, 20% fetal bovine serum and 10 mM
1-glutamine, penicillin and streptomycin. Medium was replaced at
day 5. For flow cytometric analysis, cells were dissociated from
the culture dish using ice-cold cell dissociation solution (Sigma).
Lysates for Western blot analysis were prepared by adding 0.5 ml
lysis buffer directly to the wells. Lysates were mixed with sample
buffer containing SDS and beta-mercaptoethanol, run on a
Tris-Glycine gel and transferred to a nitrocellulose membrane. Cell
viability was assessed by trypan blue exclusion.
[0384] Flow Cvtometry
[0385] Cells for use in flow cytometric analysis were blocked for
30 min at 4.degree. C. with PBS containing 2% fetal bovine serum
and 5 .mu.g/ml human IgG (Calbiochem, San Diego, Calif.). Next,
cells were incubated with 3C9, an anti-CRIg (anti-PR0362)
monoclonal antibody. After washing in PBS, cells were stained with
phycoerythrin (PE)-conjugated antibodies to CD11b, CD14, CD163,
CD15, CD68 were obtained from Pharmingen.
[0386] Cell-Cell Adhesion Studies
[0387] A pRK expression vector containing full length CRIg was
stably expressed in a human Jurkat T-cell line using neomycin
selection and autoclone sorting as described elsewhere. Cells were
preloaded with the fluorescent dye BCECF (Molecular Probes, Oregon)
and added to a 96 well Maxisorb plate (CORNING.TM.) coated with a
monolayer of human umbilical vein endothelial cells (HUVEC) treated
with or without 10 ng/ml TNFalpha. Cells were gently washed by
loading the wells with incubation buffer (HBSS contained 10 mM
CaCl, 10 mM magnesium and 1.5 mM NaCl) followed by inverting the
plate on a piece of blotting paper. After 3 washes, fluorescence
was counted in a fluorospectrometer. The fluorescent readout is
representative of the number of cells that remain adherent to the
HUVEC cells.
[0388] Northern Blot Analysis
[0389] Multiple tissue Northern blots (CLONTECH) were probed with a
.sup.32P labeled probe of random-primed full-length CRIg cDNA using
Ambion kit according to manufacturers recommendations. Blots were
exposed to a phosphorimaging screen for 4 hours at 22.degree. C.
Blots were stripped and re-probed with a commercially available
probe to human or mouse .beta.-actin (Clontech) to assess the
loading and quantity of RNA in each lane, and analyzed with a
Storm.RTM. phosphorImager (Molecular Dynamics, Sunnyvale,
Calif.).
[0390] Real Time RtPCR Analysis
[0391] For quantitative PCR analysis (TAQMAN.TM.), total mRNA from
human tissues or primary cells (100 ng) was recommended
(PerkinElmer Life Sciences) with primers based on the coding
sequence of CRIg.
[0392] Fc- and his-Fusion Protein Production
[0393] Human CRIg was cloned into the baculovirus expression vector
pHIF (Pharmingen). The HIS-tagged CRIg fusion protein consisted of
the extracellular domain of CRIg fused to 8 histidines. His-tagged
fusion protein was purified from the supernatant of
baculovirus-infected insect cells grown in suspension using nickel
affinity resin.
[0394] Monoclonal and Polvclonal Antibody Production
[0395] For the present experiments, BALBc females were immunized
and boosted with 10 .mu.g CRIg-His8 via footpad injections, as
previously described Ghilardi et al., J. Biol. Chem. 277:
16831-16836 (2002). Single clones were screened against CRIg-His by
ELISA. Selected clones selected clones were tested against JAM
family members and human IgG Fe. Clones were titrated out to single
cell densities and rescreened. Clone 3C9 (IgG1) was found to be
selectively reactive to CRIg. Clones were used for ascites
generation and purified over protein G (Amersham Pharmacia
Biotech); protein concentration was determined using the Pierce BCA
reagent (Pierce, Rockford, Ill.).
[0396] Polyclonal antibodies were generated by injecting 150 .mu.g
CRIg-His in New Zealand Rabbits. Serum titers were determined by
ELISA. Serum was collected at the peak of circulating IgG levels
and purified over a protein A column.
[0397] In Situ Hybridization
[0398] PCR primers (upper 5'-TCTCTGTCTCCAAGCCCACAG (SEQ ID NO: 18),
and lower, 5'-CTTTGAGGAGTCTTTGACC (SEQ ID NO: 19) were designed to
amplify a 700 bp fragment of huJAM4. Primers included T7 or T3 RNA
polymerase initiation sites to allow for in vitro transcription of
sense or antisense probes, respectively, from the amplified
products. Normal human tissues included tonsil, lymph node, spleen,
kidney, lung and heart. Tissues with chronic inflammatory disease
included lung with chronic asthma, chronic bronchitis, livers with
chronic inflammation and cirrhosis due to chronic hepatitis C
infection. Tissues were fixed in 4% formalin, paraffin embedded,
sectioned (3-5 .mu.m thick) deparaffinized, deproteinated with 20
.mu.g/ml proteinase K (15 min at 37.degree. C.) and processed for
in situ hybridization as described elsewhere.
[0399] Immunohistochemistry
[0400] Human liver was obtained from Ardais Corporation, Lexington,
Mass. Immunohistochemical staining was performed on 5-6-.mu.m thick
frozen liver sections using a DAKO autostainer. Endogenous
peroxidase activity was blocked with Kirkegaard and Perry blocking
solution (1:10, 4 min 20.degree. C.). Normal goat serum (NGS) at
10% in TB S/0.05% Tween-20 was used for dilution and blocking. Mab
3C9 was used at 1 ug/ml. Slides were developed using metal-enhanced
diaminobenzidine (Pierce Chemicals). For immunofluoresence staining
of sections, sections were blocked with PBS/10% NGS and incubated
with mAb 3C9 for 1 hr at 20.degree. C. A rabbit-anti mouse
FITC-labeled secondary antibody conjugated to FITS was used as
detections agent. For double staining procedure, sections were
subsequently stained with a PE-conjugated monoclonal antibody to
human CD68.
[0401] Results
[0402] As described in Example 1, huCRIg was cloned from a human
fetal cDNA library using degenerate primers recognizing conserved
Ig domains of human JAM1. Sequencing of several clones revealed an
open reading frame of 321 amino acids (FIG. 1, SEQ ID NO: 2). Blast
searches confirmed similarity to Z39Ig, a type 1 transmembrane
protein (Langnaese et al., Biochim Biophys Acta 1492:522-525
(2000)). It was later found that this 321-amino acid protein missed
some C-terminal amino acid residues. The full-length huSIgMA
protein has been determined to have 399 amino acid residues, as
shown in FIG. 2 (SEQ ID NO: 4). The extracellular region of CRIg
consisted of 2 Ig-like domains, comprising an N-terminal V-set
domain and a C-terminal C2-set domain Using 3 and 5' primers, a
splice variant of CRIg, CRIg-short (305 amino acids, FIG. 3, SEQ ID
NO: 6), which lacks the membrane proximal IgC domain, was
cloned.
[0403] Cloning of Murine CRIg and Sequence Comparison with Human
CRIg
[0404] The murine expressed sequence tags (EST) database was
searched using the full open reading frame of huCRIg and the
tblastn algorithm. DNA sequencing of 3 clones gave rise to
identical complete open reading frames of 280 amino acids. Primers
to the 3 prime regions were used to clone a full length transcript
from a mouse spleen library. The murine clone resembled the spliced
form of huCRIg in that, it lacked the C-terminal Ig-like domain.
The extracellular IgV-domain was well conserved between the human
and murine receptor with 93% identity. The murine cytoplasmic
domain was poorly conserved being 20 amino acids shorter than its
human counterpart and was 40% identical. The nucleic acid encoding
murine CRIg (muCRIg) and the deduced amino acid sequence are shown
in FIG. 4 and as SEQ ID NOS: 7 and 8, respectively.
[0405] CRIg is Expressed on a Subset of Resident Macrophages in
Diverse Tissues and its Expression is Increased in Inflammation
[0406] Northern blot analysis of huCRIg showed two transcripts of
1.5 and 1.8 kb (FIG. 17), with highest expression in the adrenal
gland, lung, heart and placenta, and lower expression in other
organs, such as, spinal chord, thyroid gland, mammary gland, and
lymph node. In all tissues, the 1.8 kb transcript was the most
abundantly expressed transcript and presumably, encodes the long
form of CRIg. A single transcript of about 1.4 kb was detected in
mouse liver and heart.
[0407] TAQMAIV.TM. Real-Time PCR Analysis
[0408] To identify specific cell lines expressing CRIg, real-time
quantitative PCR and primers/probes specific for the N-terminal Ig
domain were used. Low but detectable mRNA expression was found in
the myeloid cell line HL-60 treated with PMA and the monocytic cell
line THP-1. Expression was absent in B- and T-cell lines (FIG.
18A).
[0409] CRIg Expression on Differentiated Monocytes.
[0410] In order to establish details of when CRIg was expressed in
differentiating monocytes/macrophages, we determined CRIg mRNA
levels in non-adherent monocytes and in adherent monocytes, induced
to differentiate in the presence of human autologous serum. CRIg
mRNA levels gradually increased over time and reached maximum
levels at 7 days following plating (FIG. 18B). At this
differentiation stage, mRNA levels were 100 fold higher as compared
to those in undifferentiated monocytes.
[0411] Western blotting of monocyte/macrophage lysates showed an
increase in CRIg protein expression (FIG. 18C) in parallel with the
increase in CRIg mRNA expression, indicating that CRIg was
expressed when monocytes differentiated to form macrophages. A band
of 48 kDa and a band of 40 kDa appeared on the blot, presumably
representing the long and the short forms of human CRIg.
[0412] Molecular Characterization of CRIg
[0413] CRIg migrated similarly under reduced and non-reduced
conditions indicating that it was expressed as a monomer (FIG.
19A). Only slight changes in migration patterns were observed when
CRIg was deglycosylated using PNGase F, indicating insignificant
N-glycosylation. CRIg was phosphorylated when CRIg overexpressing
cells were treated with pervanadate (FIG. 19B). Phosphorylated CRIg
migrated as a slightly higher Mw protein (55 kDa). In human HEK 293
cells, tyrosine-phosphorylated CRIg cytoplasmic domain does not
recruit Syk kinase (results not shown).
[0414] Flow Cytometry Analysis of CRIg Expression on Peripheral
Blood Mononuclear Cells
[0415] In order to determine the expression pattern of CRIg in
circulating leukocytes, flow cytometric analysis was performed on
lymphocytes isolated from blood from a healthy donor using
monoclonal anti-human CRIg antibody 3C9. Antibodies were made by
immunizing Balb/C mice with octa-His-tagged human CRIg
extracellular domain. The antibody is a non-blocking antibody that
can be used to detect native protein in acetone-fixed frozen
sections directly conjugated with ALEXA.TM. A488. Counterstaining
was performed with PE conjugate antibodies to several immune-cell
surface antigens. CRIg was absent on the surface of all leukocytes,
including B-T-NK cells, monocytes and granulocytes (FIG. 20). CRIg
was however expressed on monocytes cultured for 7 days in
macrophage differentiation medium.
[0416] Regulation of CRIg Expression in Monocytes
[0417] In order to study the regulation of expression of CRIg, 7
day macrophages were cultured in the presence of various pro- and
anti-inflammatory cytokines and CRIg expression levels were
determined by real-time PCR or flow analysis. Expression of CRIg
mRNA was increased after treatment of macrophages for 2 days with
IL-10 and TGF-.beta. and down regulated by IL-4, IL13 and LPS (FIG.
21A). Treatment with dexamethasone increased expression to 5 fold
compared to control non-treated macrophages. In order to determine
the regulation of cell-surface expressed CRIg, flow cytometry was
performed on peripheral blood monocytes treated with various
cytokines and dexamethasone for 5 days. CRIg was detected using
monoclonal antibody clone 3C9 conjugated to ALEXA.TM. A488. Cells
were co-stained with anti CD-14 antibodies. Increased surface
expression of CRIg was found following treatment of monocytes with
IL-10 and LPS for 5 days (FIG. 21B). A dramatic increase in surface
CRIg expression was found after treatment with dexamethasone.
[0418] Subcellular Distribution of CRIg
[0419] In order to study the subcellular distribution of CRIg,
monocyte-derived macrophages (MDMs) were kept in culture for 15
days after which they were fixed and stained with a monoclonal
antibody (clone 3C9) or polyclonal rabbit antibody 4F7 followed by
FITC conjugated secondary antibody and a PE-labeled anti CD63
antibody. Confocal microscopy showed high expression of CRIg in the
perinuclear cytoplasm, overlapping with the expression of the
lysosomal membrane protein CD63 (FIG. 22). CRIg was also expressed
in the leading and trailing edges of the macrophages where its
staining pattern did not overlap with that of CD63.
[0420] Expression of CRIg in Normal and Disease Tissues
[0421] CRIg expression in tissue resident macrophages and changes
in its expression in tissues with chronic inflammatory diseases was
studied. Using in situ hybridization, CRIg mRNA expression was
determined on panels of paraformaldehyde-fixed human tissues. High
expression levels were found in alveolar macrophages obtained from
a lung autopsy of a patient with pneumonia or chronic asthma (FIGS.
23, A, B, C, and D). High mRNA expression was found in Kupffer
cells in the liver of a patient with chronic hepatitis (FIGS. 23, E
and F).
[0422] In a previous study (Walker, Biochimica et, Biophysica Acta
1574:387-390(2002)), and in electronic screening of libraries, high
expression of CRIg mRNA was found in the synovium of patients with
rheumatoid arthritis. Therefore, the expression pattern of CRIg in
synovium obtained from patients with rheumatoid arthritis,
osteoarthritis and degenerative bone disease was studied. High
expression of CRIg mRNA was found in synovial cells obtained from a
patient with osteoarthritis (FIG. 24, B). Synovial cells in the
superficial layers had the highest expression of CRIg (FIG. 24, D).
In addition, polyclonal antibody 6F1 was used to study CRIg
expression in frozen sections of human synovium obtained from a
patient with rheumatoid arthritis. CRIg was expressed in a subset
of synovial cells (20-40%) and in tissue macrophages in the
synovium (FIG. 25, A, B, C. These cells were, most likely, type A
macrophage-like synovial cells. Staining was absent in control
synovium (FIG. 25, D).
[0423] Expression of CRIg protein was found on macrophages in a
number of different tissues. Frozen sections prepared from CHO
cells stably expressing CRIg show membrane localization of CRIg
(FIG. 26 A). CRIg protein was found in alveolar macrophages (FIG.
26, B), histiocytes in the lamina propria of the small intestine
(FIG. 26, C), Hofbauer cells in the placenta (FIG. 26, D),
macrophages in the adrenal gland (FIG. 26, E) and Kupffer cells in
the liver (FIG. 26, F).
[0424] Atherosclerotic plaques contained a high number of
macrophages or macrophage-foam cells that adhered tightly to the
luminal wall of the aorta. Considering a role for CRIg in
macrophage-endothelium adhesion, the expression of CRIg in
atherosclerotic plaques was studied. Alternate sections of plaques
were stained with anti-CD63 (FIGS. 27, A and B) or anti-CRIg (FIGS.
27, C and D). Overlapping staining patterns of anti-CD63 and CRIg
was found on foam cells aligning the vessel wall indicating a role
for CRIg in atherosclerosis.
[0425] In order to determine whether CRIg was selectively expressed
on macrophages, double staining immunofluorescence was performed on
heart interstitial macrophages (FIG. 28). As shown in the overlay
(FIG. 28, third panel) most of the interstitial macrophages
positive for CRIg were also positive for CD68. Not all CD68
positive macrophages were positive for CRIg, indicating that the
latter was specific for a subtype of tissue resident
macrophages.
[0426] In order to quantitatively determine mRNA expression levels
in inflammatory bowel disease (IBD) syndrome, mRNA was extracted
from colon tissue obtained from patients with ulcerative colitis,
Crohn's disease or from patients with no manifestation of IBD. Real
time PCR was performed using primers specific for CRIg, to measure
relative expression levels. Expression levels were 16 fold higher
in a patient with ulcerative colitis and, 5 fold higher in a
patient with Crohn's disease, as compared to control tissue (FIG.
29, A). Similarly, relative RNA equivalents were determined in lung
tissue and was found to be highest in tissue from a patient with
chronic occlusive pulmonary disease (COPD: 14 fold over normal) and
was not significantly different from normal in a patient with
asthma (FIG. 29, B).
[0427] Molecules of the Ig superfamily are well known to mediate
cell surface recognition and cell-cell adhesion. Since CRIg
expression was high in interstitial macrophages aligning blood
vessels, CRIg involvement in macrophage-endothelial cell adhesion
was studied. A Jurkat cell line, stably transfected with full
length CRIg-long (FIG. 30A) was loaded with the fluorescent dye
BCECF and added to the wells of a 96 well maxisorb plate on which a
monolayer of HUVEC cells had been cultured. Adhesion was measured
by the amount of fluorescence retained after 3 gentle washes.
Jurkat cells expressing CRIg were more adherent to both, control
and TNF.alpha. stimulated endothelium, as compared to Jurkat cells
stably transfected with a control plasmid (FIG. 30B).
DISCUSSION
[0428] This study, for the first time, described the tissue
distribution, regulation of expression and molecular
characterization of a novel Ig superfamily member CRIg/Z39Ig and
confirmed its selective expression in tissue resident
macrophages.
[0429] CRIg expression was found on resident macrophages which had
a fully differentiated phenotype. Its expression was increased in
tissues with chronic inflammation like, rheumatoid arthritis and
inflammatory bowel disease. The increase of CRIg expression in
these diseases, which was often characterized as Th2 type diseases,
may be in line with the regulation of its expression by Th2
cytokines in vitro. Whether this increased expression is due to an
increased presence of CRIg positive macrophages or an increased
expression on the inflammatory macrophages has yet to be
determined.
[0430] CRIg may mediate one of the effector functions of human
macrophages, which include bacterial recognition, phagocytosis,
antigen presentation and cytokine release. These results indicated
a role for CRIg in adhesion, and possibly motility, of macrophages
to the endothelial cell wall of vessels.
[0431] CRIg expression was increased in non-microbial inflammatory
diseases like ulcerative colitis and chronic occlusive pulmonary
disease (COPD) but was downregulated in isolated macrophages upon
treatment with LPS or other bacterial cell wall components like
lipoteichoic acid and bacterial lipoprotein. Long term treatment,
over 2 days, with LPS caused an increase in the expression of CRIg.
This could be due to an autocrine effect of IL-10 secreted by
LPS-stimulated macrophages. A striking up-regulation of CRIg, both
at the mRNA and protein levels, was observed upon treatment of
monocytes or macrophages with dexamethasone. Few
monocyte/macrophage surface receptors have been found to increase
in expression upon dexamethasone treatment. One example is CD163,
but its induction by dexamethasone is far less dramatic. The
up-regulation of CRIg by anti-inflammatory cytokines IL10 and
TGF.beta. was of considerable interest and indicates that CRIg may
mediate the anti-inflammatory role of glucocorticosteroids.
[0432] As described here, CRIg was expressed on a subset of CD68
positive macrophages which may represent activated macrophages.
Using blocking and activating antibodies to CRIg and CRIg-Fc fusion
protein, its role in macrophage effector function, adhesion and
migration and its role in chronic inflammatory diseases has been
investigated, and is described in Example 7.
[0433] Only few cell surface markers were specifically expressed on
differentiated macrophages, such as CD68 and CD163. Although CD68
was apparently expressed on all human macrophage populations, the
antigen could also be detected on other myeloid cells and also on
certain non-myeloid cells. Therefore, CRIg represents the first
cell surface antigen selectively expressed on a subset of
interstitial mature macrophages.
Example 7
CRIg Fusion Proteins in Collagen-Induced Arthritis (CIA) in DBA-1J
Mice
[0434] This experiment aimed to compare CRIg fusion proteins to
control murine IgG1 in the development of disease and progression
of CIA (collagen-induced arthritis, an experimental animal model
system of rheumatoid arthritis).
[0435] As discussed in Example 4, CRIg is highly and specifically
expressed on a subset of macrophages and is elevated in tissues
with chronic inflammation. Murine CRIg is highly expressed in
macrophages and synoviocytes in inflamed joints of mice with
collagen-induced arthritis. In vitro studies have shown that CRIg
is involved in adhesion of macrophages to endothelium. CRIg-Fc
fusion protein influences the course of an autoimmune disease, in
this case collagen-induced arthritis in mice, either by influencing
the properties of tissue macrophages or by influencing immune
response of other cells (e.g. T cells, B cell, epithelial cells,
endothelial cells). This may result in alleviation of inflammation,
swelling and long term bone erosion in joints.
[0436] A muCRIg-Fc fusion protein was generated by fusing the
hinge, CH2 and CH3 domains of murine IgG1 to the extra cellular
domain (aa 1-200) of murine CRIg. A fusion containing a double
mutation preventing Fc receptor binding was used to control for Fc
receptor regulation. The nucleotide sequence of the muCRIg-Fc
fusion protein is shown as SEQ ID NO: 17. (The coding sequences of
similar huCRIg-Ig and huCRIg-short-Ig are shown as SEQ ID NOS: 15
and 16, respectively.) Protein was produced in CHO cells by
transient transfections of plasmid DNA. The fusion protein was
purified by running the cell supernatant over a protein A column
followed by ion-exchange chromatography to eliminate aggregates.
Serum half life was estimated by injecting a single dose of 4 mg/kg
CRIg-Fc in a C57B6 mouse followed by obtaining serum from the mice
at specified time intervals. The serum levels of murine CRIg-Fc was
determined by a sandwich ELISA using to anti CRIg mAbs recognizing
different epiotpes on the extracellular domain of CRIg.
[0437] Animal Model Species: Mouse
[0438] Strain(s): DBA-1J
[0439] Supplier(s): JACKSON
[0440] Age Range: 7 to 8 week old
[0441] The mouse was chosen as the species to study
collagen-induced arthritis (CIA) because CIA is an inflammatory
polyarthritis with clinical and pathological features similar to
human rheumatoid arthritis (RA). This animal model has been used by
many laboratories and the histopathology of CIA resembles those
seen in RA with synovial proliferation that progresses to pannus
formation, cartilage degeneration/destruction and marginal bone
erosions with subsequent joint deformities. Also, mouse is
phylogenetically the lowest mammal. In addition, there is no in
vitro model available to mimic the complex, multifactorial
pathogenesis of RA.
[0442] Experimental Design
[0443] Treatment Groups:
[0444] 1) mIgG1 isotype 6 mg/kg in 200 .mu.l saline subcutaneous
(SC) 3 times/wk for 7 weeks (n=8).
[0445] 2) muCRIg 4 mg/kg in 100 .mu.l saline SC 3 times/wk for 7
weeks (n=8).
[0446] Mice were immunized interdermally with bovine CII (100 ug,
Sigma, St Louis) emulsified in CFS (Difco). Mice were rechallenged
with CII in IFA (Difco) 21 days later. Starting on day 24, one
group of mice (n=7) was given 100 ug muCRIg (PR0362) Fc three times
per week for 6 weeks, and the second group (n=8) received 100 ug of
murine IgG1, as a control. Mice were examined daily for signs of
joint inflammation and scored as follows: 0, normal; 1, erythema
and mild swelling confined to the ankle joint; 2, erythema and mild
swelling extending from the ankle to metatarsal and metacarpal
joints; 3 erythema and moderate swelling extending from the ankle
to metatarsal or metacarpal joints. 4, erythema and severe swelling
extending from the ankle to the digits. The maximum arthritic score
per paw was 4, and the maximal score per mouse was 16 (FIG.
31).
[0447] All mice were immunized with 100 ug bovine collagen type II
in 100 .mu.l complete Freunds Adjuvant (CFA) on day 0. Collagen
type II in CFA was injected intradermally at the base of the tail
on the right side. On day 21, a 2nd immunization with 100 ug bovine
collagen type II in 100 .mu.l of incomplete Freunds adjuvant was
given i.d. at the left side of the tail. Animals were checked daily
(M-F) by the investigative staff. Nestlets were used as an
enrichment device, and to provide extra padding for the animals. If
necessary, moistened food was provided at the bottom of the cages.
Debilitated animals were sacrificed after consultation with the
veterinary staff. Terminal faxitron X-Rays and microCT were taken
at the end of study and joint lesion/erosion was evaluated. In
addition, animals were weighed before treatment and at
termination.
[0448] On day 35 and at the termination of the study, mice in
Groups 1 to 8 were bled for serum pK and to determine anti-collagen
type II antibody titer (100 .mu.l orbital bleed).
[0449] On day 70 all mice were terminally bled intracardially under
3% isoflurane for a terminal hemogram, for a differential leukocyte
count and for serum pK (G3) evaluation.
[0450] The mice were euthanized at day 70, post induction of
arthritis. All four limbs were collected for radiographs, 5CT and
histopathology.
Results
[0451] Systemic injection of the CRIg fusion protein, muCRIg-Fc,
into a collagen-induced arthritic mouse (animal model for
rheumatoid arthritis) showed significant (see FIG. 31:
p-value=0.0004) reduction in the progression of CIA in the test
group of mice that received the CRIg fusion protein (squares)
versus the control group of mice that received IgG1 (circles).
Collagen-induced arthritis was induced by injection of bovine
collagen type II emulsified in complete Freud's adjuvant. A booster
immunization was given 21 days after the first immunization Animals
were treated 3.times. per week with either murine CRIg-Fc fusion
protein or with anti gp120 IgG1. Dosing was 4 mg/kg in 100 ul PBS
subcutaneous. Treatment started on day 21 and continued until day
70. Mice were observed daily for swelling of the hind paw as a sign
of arthritis. The severity of arthritis was graded on a 1-16 scale
as follows: 0=No evidence of erythema and swelling, 1=Erythema and
mild swelling confined to the mid-foot (tarsal) or ankle,
2=Erythema and mild swelling extending from the ankle to the
mid-foot, 3=Erythema and moderate swelling extending from the ankle
to the metatarsal joints, 4=Erythema and severe swelling encompass
the ankle, foot and digits.
Repeat Experiment
[0452] The protocol described above was modified to repeat and
confirm the results of the previous experiment in the
collagen-induced arthritis (CIA) model. The modified protocol
included investigation of the potential effect of radiation
exposure as a result of in vivo microCT imagig on disease and
development progression.
[0453] 70 DBA-1J 7 to mice (7 to 8 weeks old, Jackson Laboratories)
were divided into 5 treatment groups, two groups (G1 and G3) with
15 mice per group, two groups (G4 and G5) with 10 mice per group,
and one group (G2) with 20 mice.
[0454] Treatment groups:
[0455] G1: MuIgG1 isotype 4 mg/kg in 100 .mu.l saline, s.c.,
3-times per week for 7 weeks (n=15).
[0456] G2: MuCRIg-IgG1 4 mg/kg in 100 al saline, s.c., 3-times per
week for 7 weeks (n=20).
[0457] G3: MuTNFRII-IgG1 isotype 4 mg/kg in 100 .mu.l saline, s.c.,
3-times per week for 7 weeks (n=15).
[0458] G4: MuIgG1 isotype 4 mg/kg in 100 .mu.l saline, s.c.,
3-times per week for 7 weeks, anaesthesia with in vivo microCT
(n=10).
[0459] G5: MuTNFRII-IgG1 1.0 mg/kg in 100 al saline, s.c., 3-times
per week for 7 weeks, anesthesia with in vivo microCT (n=10).
[0460] TNF is a cytokine secreted by mononuclear phagocytes,
Ag-stimulated T cells, NK cells and mast cells. It is involved in
normal inflammatory and immune responses. TNF-.alpha. plays an
important role in the pathogenesis of rheumatoid arthritis (RA).
Elevated levels of TNF were found in synovial fluid of RA patients.
In this protocol, mTNFRII-Fc was used as a positive control, to
block the interaction between TNF and its cell surface
receptors.
[0461] All mice from G1 to G5 were immunized with 100 .mu.g bovine
collagen type II in 100 .mu.l Complete Freund's Adjuvant (CFA) on
thy). The collagen type II in CFA was injected intradermally at the
base of the tail on the right side. At day 21, a second
immunization with 100 .mu.g bovine collagen type II in 100 .mu.l of
incomplete Freund's Adjuvant was given intradermally at the left
side of the tail.
[0462] Animals were checked daily. Mice in the G4-5 groups were
anesthesized with isoflurane and in vivo microCt was performed
weekly. Terminal faxitron X-Rays and microCT were taken at the end
of study, ad joint lesion/erosion was evaluated.
[0463] On day 35 and at the termination of the study, mice in
groups G1-5 were bled from serum pK and anti-collagen type II
antibody titer (100 .mu.l orbital bleed). On day 70 all mice were
terminally bled intracardiac under 3% isoflurane for terminal
hemogram and differential leukocyte count and serum for pK
(G3).
[0464] The mice were euthanized at day 70 pest induction of
arthritis. All four limbs were collected for radiographs, microCT
and histopathology.
[0465] FIG. 33 shows significant reduction in joint swelling in
CRIg-Fc treated mice.
[0466] Immunohistochemistry performed on formalin-fixed,
paraffin-embedded tissue (H&E staining), obtained from
muCRIg-Fc treated animals at day 70, shows inhibition of joint
inflammation as a result of treatment. FIG. 34 shows H&E
stained sections of a meta-tarsal joint of a DBA 1/J mouse 70 days
after immunization with collagen type II. A. Massive inflammatory
cell infiltrate is found in the areas surrounding tendon sheats and
the area surrounding the joint cavity; B. Detail of A; C. Low
degree of inflammatory infiltrate in the joint of a mouse treated
with CRIg-Fc. Few inflammatory cells were found in the areas
surrounding the tendon sheats and the joint cavity; D. Detail of
B.
[0467] FIG. 35 shows that cortical bone volume was preserved in
joints of mice treated with muCRIg-Fc. Mice in control IgG- and
CRIg-Fc-treated groups were sacrificed 70 days after collagen
injection, and joints were scanned by .mu.CT. Bone erosion and loss
of bone density in joints of mice representative of CRIg-Fc and
control IgG groups are shown in the left figure as compared to
muIgG1 treated animals Preservation of cortical bone volume was
significantly greater in muCRIg-Fc treated animals. The images are
a three-dimensional surface rendering created from the .mu.CT data
using Analyze image analysis software.
[0468] FIG. 36 shows that CRIg-Fc treatment does not alter the
number nor the morphology of tissue resident macrophages. Livers
and lungs from mice treated with either anti-gp120 IgG1 (left
figures) or CRIg-Fc (right figures) were dissected, fixed in
formalin and embedded in paraffin wax. Seven micron sections were
stained using an antibody to F4/80. Careful examination of the
sections shows equal numbers of F4/80 positive macrophages in both
treatment groups. In addition, there were no differences observed
in the morphology of the macrophages
[0469] FIG. 37 shows that muCRIg-Fc treatment does not affect serum
anti-collagen antibody titers. Serum titers of anti collagen
antibodies were determined 70 days following immunization No
differences were found in the serum titers of IgG1, IgG2a and IgM
subclasses of antibodies in CRIg-Fc treated versus anti gp120
treated animals. This means that CRIg-Fc does not affect antibody
responses in mice immunized with collagen type II. FIG. 38 shows
that muCRIg-Fc decreases the number of circulating inflammatory
macrophages. Peripheral blood was obtained from CRIg-Fc and anti
gp-120 treated animals 70 days after immunization and analysed by
flow cytometry using markers for inflammatory and non-inflammatory
monocytes. CRIg-Fc treated animals showed a significant increase in
the number of inflammatory monocytes and a decrease in the number
of non-inflammatory monocytes as compared to the anti gp120 treated
group.
[0470] In conclusion, the results of the experiments described in
the present Example demonstrate that the muCRIg-Fc fusion protein
inhibits collagen-induced arthritis. In particular, the results
show that CRIg-Fc inhibits joint swelling, inhibits inflammation,
preserves cortical joint bone volume, and decreases the number of
circulating inflammatory macrophages.
[0471] Other experiments have shown that CRIg-Fc does not affect in
vivo B- or T-cell responses.
Example 8
CRIg Fusion Proteins in Antibody-Mediated CIA in Mice
[0472] Antibody-mediated arthritis differs from collagen-induced
arthritis in that instead of injecting the antigen (bovine collagen
type II), antibodies recognizing type II collagen are injected. In
this way, adaptive B and T cell responses are circumvented to
directly induce effector functions on macrophages and neutrophils
through Fc receptor and complement-mediated activation.
[0473] Antibody-mediated CIA can be induced by i.v. injection of a
combination of four different monoclonal antibodies generated by
the Arthrogen-CIA.RTM. mouse B-hybridoma cell lines (Terato et al.,
J. Immunol. 148:2103-8 (1992)). Three of the monoclonal antibodies
recognize autoantigenic epitopes clustered within an 84 amino acid
residue fragment, LyC2 (the smallest arthritogenic fragment of type
II collagen) of CB11 and the fourth monoclonal antibody reacts with
LyC1. All four antibodies recognize the conserved epitopes shared
by various species of type II collagen and cross-react with
homologous and heterologous type II collagen (Terato et al., supra;
Terato et al., Autoimmunity 22:137-47 (1995)). The
Arthrogen-CIA.RTM. arthritis inducing monoclonal antibody cocktail
is commercially available (Chemicon International, Inc., Temecula,
Calif., catalog No. 90035). Protocol
[0474] 10 BALB-c mice(CR/Hollister) of 4-5 weeks, were divide into
two groups, with 5 mice in each group.
[0475] Animals were treated daily with 100 .mu.g muCRIg-Fc or 100
.mu.g control-Fc (anti-gp120 IgG1), starting the day prior to the
injection of the antibody cocktail (day -1), and continuing until
day 14. At day 14. Animals were checked at least two-times per day,
and written records of observations were kept. The extent of
disease was scored by visual observation.
[0476] Visual scoring system:
[0477] 0=No evidence of erythema and swelling
[0478] 1=Erythema and mild swelling confined to the mid-foot
[0479] 2=Erythema and mild swelling extending from the ankle to the
mid-foot
[0480] 3=Erythema and moderate swelling extending from the ankle to
the metatarsal joints
[0481] 4=- -Erythema and severe swelling encompass the ankle, foot
and digits
[0482] Nestlets were used as an enrichment device and to provide
extra padding for the animals.
[0483] All animals were sacrificed on day 14, and joints were
harvested for immunohistochemical staining or haematoxylin-eosin
staining Blood was sampled for hematological analysis.
Results
[0484] FIG. 39 shows macrophage infiltration in joints following
antibody-induced arthritis (AIA), generated with F4/80 staining in
undecalcified frozen joints. Female Balb/C mice were injected with
2 mg of anti collagen antibodies (arthrogen) i.v. followed 3 days
later by injection with 25 ug LPS i.p. 14 days following antibody
injection, mice were euthanized and the paws were collected, and
embedded in polyvinyl alcohol. 7 .mu.m thick sections were cut from
the frozen joints and stained with antibodies to murine CRIg and to
F4/80, a macrophage specific marker.
[0485] FIG. 40 demonstrates that muCRIg prevents joint swelling
following antibody-induced arthritis in Balb/c mice. Arthritis was
induced by the method of Terato and colleagues (Terato et al.,
(1992), supra; Terato et al., (1995) supra) using a mixture of 4
monoclonal antibodies recognizing a conserved epitope on callegn
type II (Chemicon). Female Balb/C mice, 6 weeks old, were injected
i.v. with 2 mg anti CII antibody followed 3 days later with an i.p.
injection of 25 .mu.g LPS. Animals were treated daily either with
murine CRIg-Fe fusion protein or with a control-Fe fusion protein.
Dosing was 4 mg/kg in 100 .mu.l PBS subcutaneous. Treatment started
the day prior to anti collagen antibody injection and continued
until them ice were euthanized at day 14. Mice were observed daily
post LPS injection for swelling of the hind paw as a sign of
arthritis. The severely of arthritis was graded on a 1-16 scale as
follows: 0=No evidence of erythema and swelling, 1=Erythema and
mild swelling confined to the mid-foot (tarsal) or ankle,
2=Erythema and mild swelling extending from the ankle to the
mid-foot, 3=Erythema and moderate swelling extending from the ankle
to the metatarsal joints, 4=Erythema and severe swelling encompass
the ankle, foot and digits.
[0486] Therapeutic treatment was performed similar to prophylactic
treatment apart from the treatment start which was at day 4 rather
than day -1. muCRIg-Fc treatment reduced levels of inflammatory
cytokines in paws of AIA mice. Measurement of cytokine, C3a and C5a
concentration in arthritic hindpaw performed according to the
method of Kagari et al., J. Immunol. 169:1459-66 (2002). In short,
at the indicated time points following the induction of
antibody-induced arthritis, paws were collected and frozen in
liquid nitrogen. Subsequently, paws were pulverized on a liquid
nitrogen-cooled metal plate and dispersed in ice-cold PBS
containing 0.1% PMSF (Sigma). The samples were homogenized with a
Vitatron (NL) homogenizer on ice, insoluble parts were removed by
spinning at 14000 g for 10 min and collection of supernatant.
Cytokines in the supernatant were measure using cytokine ELISAs
from BD Pharmingen.
[0487] muCRIg-Fc treatment inhibits deposition of complement C3 but
not of IgG2a on cartilage in AIA. Female Balb/C mice were injected
with 2 mg of anti collagen antibodies (arthrogen) i.v. followed 3
days later by injection with 25 ug LPS i.p. 14 days following
antibody injection, mice were euthanized and the paws were
collected, embedded in polyvinyl alcohol and frozen in ispenthane
cooled on dry iced. 7 um thick sections were cut from the frozen
joints and stained with a FITC-coupled polyclonal antibody to
murine C3 (Calbiochem) and a polyclonal A594-coupled antibody to
murine IgG2a (Jackson Immunoresearch). Sections were photographed
in a Leitz fluorescent microscope
[0488] The results of immunohistochemistry performed with H&E
staining are shown in FIG. 41. Control-treated mice (muIgG1) had
moderate to severe arthritis (left panel), muCRIg-treated mice has
minimal to no arthritis (right panel). The results show that muCRIg
inhibits joint inflammation in antibody-induced arthritis.
[0489] In conclusion, animals treated with murine CRIg-Fc had
significantly reduced clinical scores as compared to animals
treated with anti-gp120 IgG1. CRIg demonstrated both prophylactic
and therapeutic efficacy in this animal model. The decrease in
severity of arthritis was also reflected by a decrease in
inflammatory cells, especially neutrophils, in the joints. There
was an increased number of neutrophils in the circulation possibly
reflecting a decrease in neutrophil migration into the joint.
muCRIg-Fc inhibited local IL-1.beta. and IL-6 production in
parallel with clinical manifestation of RA. muCRIg treatment did
not affect immune complex deposition, but inhibited complement C3
deposition on cartilage. The effector function was found to be
independent of Fc receptor binding. huCRIg-short-Fc has also
demonstrated significant prophylactic activity.
Example 9
Murine CRIg-Fc Binds to C3-Opsonized Sheep Red Blood Cells
(E-IgM)
[0490] SRBC (MP Biomedicals, ICN/Cappel) were coated with rat IgM
(E-IgM) (Forssman Ag, Pharmingen). E-IgM were opsonized with normal
mouse serum or serum from a C3 knockout mouse. Opsonized E-IgM were
incubated with different concentrations of murine CRIg-Fc. Binding
of the fusion protein to E-IgM was monitored by flow cytometry
using a FITC-labeled antibody to the Fc portion of the fusion
protein.
[0491] As shown in FIG. 42, murine CRIg bound dose-dependently to
E-IgM opsonized with normal mouse serum but not to E-IgM opsonized
with C3 deficient serum, indicating selective binding of CRIg to
murine C3 or a fragment of C3.
Example 10
Binding of Human CRIg-Fc to E-IgM is C3 Dependent
[0492] SRBC (MP Biomedicals, ICN/Cappel) were coated with rat IgM
(E-IgM) (Forssman Ag, Pharmingen). E-IgM was opsonized with human
serum deficient in C3 or C5. Opsonized E-IgM were incubated with
different concentrations of human CRIg-Fc. Binding of the fusion
protein to E-IgM was monitored by flow cytometry using a
FITC-labeled antibody to the Fc portion of the fusion protein.
[0493] As shown in FIG. 43, human CRIg bound dose-dependently to
E-IgM opsonized with C5 deficient serum but not to E-IgM opsonized
with C3 deficient serum, indicating selective binding of CRIg to
human C3 or a fragment of C3. Similar results were obtained with
human CRIg ECD.
Example 11
Binding of Serum-Opsonized Particles to CRIg-Expressing CHO
Cells
[0494] 50 .mu.l fresh C57B6 female serum+20 ug/ml mCRIg-mFc
(PUR5270-B) or mPIGR-mFc (4699) were mixed together. A488
particles, zymosan, S. aureus or E. coli from Molecular Probes were
added for 60 min at 37.degree. C. in PBS/0.2% gelatin/0.18%
glucose/1 mM MgCl2 (PBSgg++). Opsonized particles were washed
2.times. in PBS and added to CHO cells expressing murine CRIg
(clone 5C10) or human JAM2 in the presence or absence of CRIg-Fc or
control-Fc protein for 30 min at 37.degree. C. Cells washed
2.times. in PBS and analysed for binding of particles to the cell
surface in a FACS Caliber.
[0495] As shown in FIG. 44, particles opsonized with C3 sufficient
serum bound to CR1g expressing CHO cells but not to JAM2 expressing
CHO cells. Binding was abrogated in the presence of a CRIg-Fc
fusion protein but not in the presence of a control-Fc fusion
protein indicating that the binding site for CRIg to C3b resides in
the extracellular domain.
Example 12
MuCRIg Fc Binds C3b
[0496] Real-time monitored surface plasmon resonance assays were
performed using a Biacore.RTM.-2000 instrument, and the data were
analyzed using the BiaEvaluation 3.0 software (Biacore AB, Uppsala,
Sweden). Carboxylated dextran chips (sensor chip CM5, research
grade from Biacore AB) were used in all the assays. Flow cells of
the CM5 chips were used either for a standard amine coupling
procedure or prepared for the direct enzymatic coupling of C3b by
using a standard activation-deactivation procedure without adding
any protein between the steps. The activation step was performed
with fresh solution containing N-hydroxysuccinimide and
N-ethyl-/N'-(dimethylaminopropyl)-carbodiimide (Biacore AB,
7-15-min injection at a flow rate of 5 .mu.l/min) and was followed
by deactivation with ethanolamine-HCl (1.0 M at pH 8.5) (Biacore
AB, 7-15-min injection). Hepes-buffered saline (Biagrade, Biacore
AB) or VBS was used as the flow buffer throughout. After these
initial steps VBS or VBS was used as the continuous flow buffer at
5 .mu.l/min; only degassed buffers were used.
[0497] Amine Coupling of Proteins onto the Biacore.RTM.--
[0498] Chip C3b, iC3b, C3c, and C3d were coupled onto the CM5 chip
using the standard amine coupling procedure as recommended by the
manufacturer. The proteins to be coupled were dialyzed against 10
mM acetate buffer (pH 5.0-5.7) to achieve a negative net charge for
the amine coupling. Briefly, the chip surface was activated with
N-ethyl-N-(dimethylaminopropyl)-carbodiimide (7-15-min injection, 5
.mu.l/min), and either purified C3b (50 .mu.g/ml, 20 .mu.l), C3c
(70 .mu.g/ml, 30 .mu.l), or C3d (130 .mu.g/ml, 20 .mu.l) was
injected to reach an appropriate level of coupling for the binding
experiments, i.e. 1,000-5,000 resonance units (RU). Afterward, the
flow cells were deactivated as described above. Before the
experiments, the flow cells were washed thoroughly with VBS and 3 M
NaCl in 10 mM acetate buffer, pH 4.6
[0499] Binding Assays Using Biacore.RTM.--
[0500] We tested the binding of CRIg-Fc to amine-coupled C3b, C3c,
and C3d. For Biacore.RTM. injections the reagents were dialyzed
against VBS, diluted with VBS, and filtered (0.20 .mu.m
Minisart.RTM., Sartorius Corp., Edgewood, N.Y.) or centrifuged (10
min at 14,000.sup.x g). The protein concentrations of the dialyzed
reagents were measured using the BCA Protein Assay (Pierce). The
fusion proteins were injected separately through a control flow
cell (activated and deactivated flow cell without any coupled
proteins, "blank channel") and through the flow cell with the
coupled protein using a flow rate of 5 .mu.l/min at 22.degree. C.
All the binding assays were performed at least in duplicate using
independently prepared sensor chips.
[0501] As shown in FIG. 45, murine CRIg-Fc shows specific binding
of C3b to the sensor chip with a calculated Kd of 250 nM.
Example 13
Mouse and Human CRIg-Fc Bind Complement C3b
[0502] Maxisorb plates were coated o/n with 3 ug/ml C1, C3a,b,c,d,
C4, C6 in PBS. Plates were blocked for 2 hrs in PBS+4% BSA and
incubated with various concentrations of murine or human CRIg-Fc
fusion protein for 1 hr at Rt in PBS+4% BSA+0.1% Tween. Plates were
washed and incubated with a goat-anti mouse or goat-anti human Fc
antibody conjugated to peroxidase. Following washes, the plates
were incubated with TNB sustrate and OD read on a plate reader.
[0503] Results shown in FIG. 46 represent a concentration dependent
increase in murine and human CRIg binding to C3b, C3c and C3bi and
absence of binding to C1, C2, C4, C3a, and C3d.
Example 14
Mouse and Human CRIg-Fc Ihibit C3 Deposition on Zymosan
[0504] Inhibition of the alternative pathway was studied using a
method that utilizes flow cytometric analysis of C3 deposition on
zymosan A particles (Sigma) (Quigg et al., J. Immunol.
160:4553-4560 (1998)). Briefly, 50 mg of zymosan particles in 10 ml
of 0.15 M NaCl were first activated by boiling for 60 min, followed
by washing twice in PBS. In each alternative pathway assay
condition, 2.times.10.sup.7 particles were added to reaction tubes
containing a final concentration of 10 mM EGTA and 5 mM MgCl.sub.2.
Samples as described in the text were then added containing either
10 mM EDTA (negative control) or increasing amounts of murine
CRIg-Fc. Ten microliters of BALB/c serum as a source of complement
were added, and all samples were brought to 100 .mu.l with PBS.
Samples were incubated at 37.degree. C. for 20 min, and the
reaction was stopped by adding 10 mM EDTA. The particles were
centrifuged, and supernatants were removed and frozen for later
analysis. The particles were then washed twice with cold PBS, 1%
BSA, and then incubated with FITC-conjugated goat anti-mouse C3
(Cappel, Durham, N.C.) for 1 h on ice. The samples were then washed
twice in cold PBS, 1% BSA, resuspended in PBS, and then analyzed by
flow cytometry using an EPICS cytometer (Coulter, Hialeah, Fla.).
Percentage inhibition was calculated using the formula [1-[sample
mean channel fluorescence-background (10 mM EDTA
condition)/positive control mean channel fluorescence (no
Crry-Ig)-background]].times.100.
[0505] Supernatants from the reaction were also analyzed by Western
blotting to determine the extent of C3 cleavage. In this analysis,
5 .mu.l of the supernatant was mixed with an equal amount of
SDS-PAGE loading buffer with 10% 2-ME. The samples were subjected
to SDS-PAGE on a 7.5% acrylamide gel, transferred to Hybond
enhanced chemoluminescence (ECL) paper (Amersham, Arlington
Heights, Ill.) overnight in 0.19 M Tris, 0.025 M glycine, 20%
methanol buffer. Following this, membranes were blocked in PBS,
0.1% Tween with 10% milk for 1 h. Anti-C3 mAb RmC11H9 (Quigg et
al., supra) that had been pretitered was then added to the blot in
the same buffer with 1% BSA. Following washing, horseradish
peroxidase-conjugated goat anti-rat IgG (Southern Biotechnology,
Birmingham, Ala.) (preadsorbed against mouse IgG) was added for 1
h, and then the blot was washed and developed using the enhanced
chemoluminescence (ECL) system (Amersham).
[0506] The inhibition of complement activation by CRIg-Fc on
zymosan particles was analyzed following flow cytometry to detect
surface-bound C3 (FIG. 47A), or when an aliquot of the zymosan
reaction supernatant was analyzed by Western blotting and detection
using anti-C3 mAb (FIG. 47B). Positions of the intact C3 and C3
chains in B are shown by arrows at right. The 10 mM EDTA lane
represents the negative control, and increasing doses of CRIg-Fc
are shown at the top in lanes 2 to 7.
Example 15
CRIg Inhibits Alternative Pathway Hemolysis of SRBC
[0507] For alternative pathway: Rabbit-red blood cells (RRBCs) were
washed in veronal buffer (Bio Whittacker) containing 0.1% gelating
and resuspend to 1.times.10e9 cells/ml in GVB. 10 .mu.l of the cell
suspension was added to 10 .mu.l of Clq depleted serum containing
the inhibitors. The mixture was incubated for 35 min at 37 C in a
warm room while shaking. 200 ul GVB containing 10 mM EDTA was
added, cells were centrifuged at 2500 rpm for 5 min and 100 .mu.l
aliquots were read at 412 nm wavelength.
[0508] For classical pathway, sheep erythrocytes opsonized with IgM
(E-IgM) were incubated in fB deficient serum. Methodology was
similar to alternative pathway measurements
[0509] The results set forth in FIG. 48 show that murine CRIg
inhibits alternative pathway-induced hemolysis but does not affect
classical pathway hemolysis. Similar results were obtained with
human CRIg.
Example 16
CRIg Selectively Inhibits Alternative Pathway of Complement
Hemolytic Assays Using Whole Serum
[0510] Alternative pathway of complement was assessed with rabbit
erythrocytes (Er) as described y Kostavasili et al. (J. Immununol.
158:1763-71 (1997)). Briefly, Er (Colorado Serum, Denver, Colo.)
were washed 3.times. in GVB and resuspended to 1.times.109/ml. 10
.mu.l Er were added to 10 .mu.l GVB/EGTA (0.1 M EGTA/0.1 M MgCl2),
inhibitors, 10 .mu.l Clq depleted human serum and volume adjusted
to 100 .mu.l with GVB then incubated at 37.degree. C. for 30
minutes. 250 .mu.l-GVB/10 mM EDTA was added to stop the reaction,
and centrifuged for 5 min at 500.times.g. Hemolysis was determined
by absorbance of 200 .mu.g supernatant at 412 nm. The percentage of
lysis was normalized by considering 100% lysis equal to the lysis
occurring in the absence of the inhibitor.
[0511] To determine the effect of CRIg on the classical pathway of
complement, a similar procedure was followed, except that Er were
replaced with E-IgM and the assay was performed in fB deficient
human serum in GVB++.
[0512] Measurement of C3 Convertase-Mediated Cleavage of C3
[0513] The effect of CRIg on fluid phase C3 cleavage by C3
convertase (C3b.Bb) (from Kostavasili et al., supra) was examined
by incubating 0.4 .mu.M purified C3 with huCRIg-long, huCRIg-short,
muCRIg or factor H in GVB (20 .mu.l volume) at 37.degree. C. for 15
minutes. Thereafter, 0.4 .mu.M factor B and 0.04 .mu.M factor D
were added in the presence of 50 mM MgEGTA, in a total volume of 30
.mu.l to activate the pathway. After 30 minutes at 37.degree. C.,
the reaction mixtures were stopped with 30 .mu.l Laemmli's sample
buffer (BioRad) containing 2-ME, boiled for 3 minutes, and
electrophoresed on an 8% SDS-PAGE gel (Invitrogen). Proteins were
visualized by staining the gel with SimplyBlue stain (Invitrogen,
Carlsbad, Calif.). The gel was scanned for densitometric analysis,
and the percentage of C3 cleaved was calculated. Controls were
incubated in GVBE (GVB with 10 mM EDTA) to inhibit cleavage.
[0514] The microtiter plate assay for the alternative pathway DAA
was performed as described previously (Krych-Goldberg et al. J.
Biol. Chem. 274:31160-8 (1999)). Microtiter plates were coated
overnight with 5 .mu.g/ml C3b (Advanced Research Technologies) in
phosphate-buffered saline. Plates were blocked for 2 hours at
37.degree. C. with phosphate-buffered saline containing 1% bovine
serum albumin and 0.1% Tween 20 and incubated for 15 minutes at
37.degree. C. with 10 ng of factor B, 1 ng of factor D, and 0.8 mM
NiCl2 in 2.5 mM veronal buffer, pH 7.4, containing 71 mM NaCL and
0.05% Tween 20. Using the same buffer, sequential 1-hour
incubations were performed with 0.01-1 .mu.g of CRIg-Fc, 0.129
.mu.g of goat anti-human factor B antibody, and 100 .mu.g of a
1:15,000 dilution of anti-goal antibody conjugated to horseradish
perozidase (Jackson Immunoresearch Laboratories, West Grove, Pa.).
Color was developed with O-phenylenediamine. In this assay, DAF and
factor H behave as expected, as mediators of decoy accelerating
activity, and C3a release was detected using the Amersham Pharmacia
Biotech des-Arg RIA kit.
[0515] C5 Convertase Assay
[0516] C3b was deposited on zymosan by resuspending 1.times.1010
zymosan particles in 0.2 ml of 10 mg/ml C3 and adding 5 .mu.g of
trypsin, followed y a 10-minute incubation at 22.degree. C. The
deposition of C3b by trypsin was repeated and the cells washed six
times with 5 ml GVB. The zymosan particles were resuspended in 100
.mu.l GVB and mixed with 50 .mu.l GVB containing factors B (35
.mu.g) and D (0.5 .mu.g) and 50 .mu.l of 10 mM NiCl2. After 5
minutes of incubation at 22.degree. C., 5 jil of 0.2 M EDTA was
added. The bound C3b was amplified by adding 50 .mu.l C3 (500
.mu.g) and incubating the cells for 30 minutes at 22.degree. C. The
zymosan particles bearing C3b were washed and the amplification
procedure was repeated until the desired numbers of C3b/zymosan
were obtained.
[0517] Because formation of C5 convertase took less than one
minute, enzyme was formed in the same reaction mixture in which the
assays were performed. Enzyme velocities were determined under
saturating concentrations of factors B and D, and C6, in 0.5 ml
siliconized microfuge tubes as described previously. Assay mixtures
contained varying concentrations of C5 (preincubated for 20 minutes
at 37.degree. C. to eliminate freeze/thaw-generated background
C5b,6-like activity), factor B (1.2 .mu.g, 516 nMO, factor D (0.1
.mu.g, 167 nM), C6 (2.5 .mu.g, 833 nMO, and 0.5 mM NiCl2. The
reaction was started by the addition of ZymC3b, ESC3b, or ERC3b.
Depending on the density of C3b per cell, the concentration of
cells was adjusted so as to have 9-35 ng of bound C3b in a final
volume of 25 .mu.g GVB resulting in 2-8 nM enzyme concentration.
After 15 minutes of incubation at 37.degree. C., further cleavage
of C5 was prevented by transferring the assay tubes to an ice bath
and adding ice-cold GVBE. Appropriately diluted assay mixtures were
immediately titrated for C5b,6 formation by hemolytic assays using
EC. C5b,6 was quantitate using standard curves generated with
purified C5b,6. Controlls established that the cold temperature and
the dilution were sufficient to reduce the cleavage of C5 during
subsequent steps to undetectable levels. Lysis of rabbit
erythtocytes (ER) or sheep erythrocytes (ES) was shown to
contribute <2% to C5b,6 titers using lysis of EC as the
endpoint.
[0518] C5b,6 was measured hemolytically using the sensitivity of EC
to hemolytic lysis by human C5b-9, To an aliquot (25 .mu.l) of the
diluted sample from C5 convertase assays was added a mixture of
1.2.times.107 EC and 5 .mu.l of pooled normal human serum (NHS) as
a source of complement proteins C7-C9 in a final volume, of 225
.mu.l GVBE. The reaction mixtures were incubated for 10 minutes at
37.degree. C. after which the unlysed cells were removed by
centrifugation for 1 minute at 10,000.times.g. The amount of
hemoglobin released was quantitated spectrophotometrically at 414
nm. One-hundred percent lysis was measured as EC lysed in 2%
Nonidet P-40. Controls containing C5 and C6 but no C5 convertase,
were subtracted as the background. Controls containing C5
convertase but no purified C5 or C6 demonstrated that no
significant amount of C5b,6 was formed from NHS used as a source of
C7-9 during the lysis of EC.
[0519] Results
[0520] The results are shown in FIGS. 49(A)-(E).
[0521] FIG. 49(A) shows that CRIg inhibits hemolysis of rabbit
erythrocytes in Clq deficient serum (alternative pathway) but not
of IgM-opsonized sheep erythrocytes in fB deficient serum
(classical pathway) indicating that CRIg selectively inhibits the
alternative pathway of complement.
[0522] As shown in FIG. 49(B), CRIg inhibits fluid phase C3
convertagse activity. The gel shows inhibition of the cleavage of
the 115 kDa alpha chain of C3 with increasing concentration of
human CRIg-ECD (10-100 nM).
[0523] FIGS. 49(C) and (D) show that CRIg does not function as a
cofactor of factor I mediated cleavage of C3 nor as an accelerator
of decay of the C3 convertase.
[0524] The data set forth in FIG. 49(E) show that CRIg inhibits
alternative pathway C5 convertase formed on zymosan particles.
Example 17
CRIg is Expressed on a Subset of Tissue Macrophages
[0525] Monoclonal antibodies specific for human and mouse CRIg were
generated and utilized to define the expression of CRIg, as
described in Example 3. While CRIg was absent on peripheral blood
C14+ monocytes, it was readily detected on monocyte-derived
macrophages by flow cytometry (FIG. 50B). huCRIg was absent on
peripheral blood CD4.sup.+ and CD8.sup.+ T cells, CD19.sup.+
B-cells, CD56.sup.+ NK cells, CD15.sup.+ granulocytes (FIG. 51A)
Similar to huCRIg, muCRIg was absent on peripheral blood and
splenic leukocytes, including CD11b.sup.+ myeloid cells, but
detected on liver Kupffer cells (KCs, FIG. 50B). Expression of
huCRIg(L) and (S) protein was confirmed at 55 and 48 K Mr proteins
as monocytes differentiated into macrophages (FIG. 50C). Similarly
mouse CRIg was detected as a 48 K Mr glycoprotein in peritoneal
macrophages (PM). MuCRIg has a predicted N-linked glycosylation
site and is glycosylated, accounting for a--5 kDa mobility shift on
a gel (results ot shown).
[0526] As CRIg mRNA was highly detected in the liver, CRIg
expression in the liver was further analyzed by
immunohisochemistry. CRIg was expressed in expressed on CD68+ KCs
in human and mouse liver but was also detected on macrophages of
the adrenal gland, placenta, synovium, intestine and peritoneum
(data not shown). CRIg was absent from human splenic macrophages,
Langerhan cells, microgial cells and bone-marrow derived
macrophages, as well as a variety of human and mouse macrophage
cell lines (THP-1, RAW275, PU1.1, J774; results not shown).
Together, these results indicate that CRIg is highly expressed on a
population of resident macrophages in diverse tissues.
Example 18
CRIg Binds C3b and iC3b
[0527] Materials and Methods
[0528] Complement Proteins
[0529] Human and mouse C3 was isolated according to the method of
Hammer et al. (J Biol. Chem. 256(8):3995-4006 (1981)) with an
additional Protein A column to remove contaminating IgGs. To obtain
hC3b, hC3 was incubated with CVF, hfB, ug, hfD in 10:10:1 molar
ratio at 37.degree. C. for one hour in the presence of 10 mM MgCl2.
The hC3b fragment was subsequently isolated by a strong anion
exchanger monoQ 5/50 (Amersham Biosciences, Piscataway, N.J.) and
Superdex S-200 10/300 GL gel filtration column (Amersham
Biosciences, Piscataway, N.J.) for a puriy of >95% by Coomassie
Blue-stained gel. To generate C3b dimers, C3b prepared as above was
reacted for 3 days at 4.degree. C. in PBS pH 7.0 with
bismaleiidohexane (Pierce) in methanol in a 2.2:1 molar ratio.
Cross-linking was generated through the free sulfhdryl group by
breaking the thioeser bond. With this procedure, the yield was over
50%. The dimers were purifiee by a Superdex S-200 10/300 GL gel
filtration column (Amersham Biosciences, Piscataway, N.J.). The
dimers were 95% pure based on a Coomassie Blue-stained gel.
Hydrolyzed C3 was produced with an addition of 2M methylamine pH
7.0 to C3 in PBS with 10 mM EDTA for a final concentration of 50 mM
in the reaction volumn. The reaction was run for 4 hours at
37.degree. C., after which time it was purified over a Superdex
S-200 10/300 GL gel filtration column (Amersham Biosciences,
Piscataway, N.J.), iC3b and C3c (Advanced Research Technologies)
were purified over an Superdex S-200 10/300 GL gel filtration
column to separate monomers from dimers. C3d, Factors B, D, and P,
complement components C1-9, antibody-sensitices sheep erythrocytes
and cobra venom factor were obtained from Advanced Research
Technologies (San Diego, Calif.).
[0530] Results
[0531] The expression of CRIg on a population of highly phagocytic
cells, prompted us to explore whether CRIg was involved in binding
of opsonized particles. Complement and Fc receptors have been
demonstrated to mediate phagocytosis. (reviewed by Aderem and
Underhill, Annu. Rev. Immunol. 17:593-623 (1999), Underhill and
Ozinsky, Annu Rev. Immunol. 20:825-852 (2002)). In order to
determine whether CRIg binds to complement C3, sheep erythrocytes
coated with either rabbit IgG (E-IgG) or mouse IgM (E-IgM) were
analyzed for their ability to rosette with a Jurkat T-cell line
expressing CRIgL in the presence of C3 or C5-deficient human serum.
CRIg(L) expressing but not control Jurkat cells, formed rosettes
with E-IgM in the presence (C3+), but not absence (C3-), of C3
(FIG. 52A) CRIg did not appear to be involved in Fc-receptor
mediated binding since Es opsonized with IgG did not rosette with
Jurkat CRIg cells (results not shown).
[0532] To test whether CRIg can directly bind to complement
components on cell surfaces, a soluble form of human CRIg was
generated in which the ECD of CRIg was fused to the Fc portion of
human IgG1. The huCRIg-long-Fc, but not control-Fc, fusion protein
bound to E-IgM opsonized in the presence, but not in the absence,
of C3 (FIG. 52B). Binding was restored when C3 deficient serum was
reconstituted with purified human C3. The V-type Ig domain was
sufficient for binding since both huCRIg(S)-Fc and muCRIg-Fc were
capable of binding to E-Igm (results not shown).
[0533] As a result of complement activation inducing a cascade of
enzymatic reactions, C3 is cleaved into its multiple breakdown
products C3b, iC3b, C3c, C3dg and C3d, each of which could serve as
a binding partner for CRIg. Using a plate bound ELISA, huCRIg(L)
and huCRIg(S)-Fc, but not control Fc demonstrated satureable
binding to C3b nd iC3b (FIG. 52C), but not to C3, C3a, C3c or C3d
(results not shown) Similar binding was observed for huCRIgL-ECD,
lacking the Fc portion, and muCRIg-Fc, and binding to iC3b was
greater than to C3b (results not shown). Conversely, soluble C3b
also bound to plate-coated huCRIg(L)-Fc and was competed for by
huCRIg(L)-ECD (results not shown). Hence, CRIg can bind C3b and
iC3b in solution or when C3b and iC3b are bound to a substrate.
Since C3b is present as a multimeric form when deposited on cell
surfaces, the binding of CRIg was further assessed to artificially
assembled C3b dimers (C3b2). C3b2 bound to huCRIg(L) with a Kd of
131 nM (FIG. 52D) and to huCRIg(S) with a Kd of 44 nM, as measured
by surface plasmon resonance (FIG. 52D).
[0534] To complement these biochemical studies, we evaluated the
binding specificity of cell surface CRIg for C3-derived products.
A488-labeled dimeric form of C3b2 bound to the surface of CRIg+,
but not CRIg-, THP-1 cells (FIG. 52E). Binding was specific since
it was competed for by the addition of soluble unlabeled C3b2, C3b
monomer, and huCRIg(L)-ECD but not by native C3. In addition to
binding to soluble complement fragments, muCIg expressed on the
surface of a CHO cell line also bound to various particles
opsonized in C3 sufficient, but not in C3 deficient, serum (FIG.
51B). Together, these studies demonstrate that CRIg expressed on
the cell surface as well as soluble CRIg (CRIg-FC) is a receptor
for iC3b and C3b.
Example 19
CRIg Expression on Kupffer Cells in Necessary for Binding of
Soluble or Particle-Bound C3 Fragments
[0535] Materials and Methods
[0536] 1. Generation of CRIg Knock Out (Ko) Mice
[0537] All animals were held under Sterile Pathogen Free conditions
and animal experiments were approved by the institutional animal
care and use committee of Genentech. CRIg ko embryonic stem cells
were generated by electroporation of a linearized targeting vector
replacing exon 1 with a neomycin-resistance gene (FIG. 53A) into
C2B6 embryonic stem (ES) cells. Clones resistant to neomycin were
selected, and homologous recombination was confirmed by Southern
blotting. Seven out of 100 clones screened were positive for
homologous recombination Two targeted clones were injected into
C57VL/6 blastocysts and transferred to pseudopregnant foster
mothers, and the resultant male chimeric mice were bred to C57BL/6
females to obtain +/-mice. Germline transmission was verified for
the 2E5 cloned by Southern blot analysis or tail DNA from F1
offspring (FIG. 42B). Interbreeding of +/-mice was performed to
generate -/-CRIg mice. The phenotypes of the two clones were
identical. For routine genotyping by a PCR method, a common sense
primer 5'-CCACTGGTCCCAGAGAAAGT-3 (SEQ ID NO: 22), and a wild-type
specific (5'-CACTATTAGGTGGCCCAGGA-3') (SEQ ID NO: 23) and knock out
specific (5'-GGGAGGATTGGGAAGACAAT-3') (SEQ ID NO: 24) antisense
primer were used, amplifying a 306 bp fragment for the wild-type
allele and a 406 bp fragment for the mutant allele. The generation
of C3 ko mice has been described previously (Naughton et al.,
Immunol. 156:3051-3056 (1996). To generate CRIg/C3 double knock out
mice, C3 ko mice on a mixed s129/B6 background (F2) were crossed
with CRIg ko mice. The F1 females heterozygous for both alleles
were subsequently crossed with C3 heterozygous males, hemizygous
for the CRIg allele. The offspring from this mating was used in the
studies. C57B6 mice used for analysis of CRIg expression by flow
cytometry were purchased from Jackson Laboratories (Bar
Harbor).
[0538] 2. Western Blotting and Deglycosylation
[0539] Human and murins macrophages were lysed in PBS containing 1%
SDS, 0.1% Triton X-100 and a protease inhibitor cocktail
(Boehringer). Following cntrifugation at 10,000 g, the soluble
fraction was run on a SDS gel and transferred to nitrocellulose
membranes. CRIg proein was visualized using anti-CRIg antibodies
and HRPO-conjugated secondary antibodied followed by
chemiluminescence detection of bound antibody by ECL (Amersham).
For determination of the glycosylation state of CRIg, CRIg-gD
expressing cells were immunoprecipitated wi\th an anti-gD antibody,
treated with PNGase, O-glycosydase and neuraminidse according to
the manufacturer's instructions (Biolabs, NE), and subjected to
Western blot analysis using bioinylated anti-gD antibodies.
[0540] Results
[0541] To study the biological function of CRIg, mice with a null
mutation in the CRIg gene were generated by homologous
recombination as described above and shown in FIG. 42A. Deletion
was confirmed by Southern blotting (FIG. 53B), Western blotting of
peritoneal exudates cell lysates (FIG. 54A) and flow cytometry
(FIG. 54B). Mice were bodn at the expected Mendelian ratios and
exhibited no gross phenotypic or histopathological abnormalities.
Absolute numbers of immune cells in different lymphoid compartments
were similar in blood, spleen and lymph nodes from wt and ko
animals (FIG. 53C). In addition, no differences were observed in
the number of F4/80+ KCs and hert macrophages when analyzed by flow
cytometry and immunohistochemistry, respectively (results not
shown). Expression levels of other compertment inding proteins,
including the .alpha. and .beta. chains of CR3 and
complement-receptor related gene y (Crry) on KCs were not altered
(FIG. 54C). Similarly, the low or undetectable expression CR1, CR2
or CD11c, the beta chain of CR4, were comparable between wt or ko
KCs (FIG. 53D).
[0542] Next, the binding capacity of CRIg wt and CRIg ko KCs for C3
degradation products was tested. The C3 fragments (C3b, C3b2 and
iC3b) were readily deposited on the surface of CRIg wt KCs (FIG.
54B). In contrast, no binding of C3b, C3b2, iC3b or iC3b2 were
detected in CRIg ko KCs. Little or no binding of C3 and C3c to
either wt or ko KCs was detected (FIG. 53E).
[0543] To extend the analysis from the binding of soluble C3
fragments to the binding of C3 fragments bound to cell surfaces,
the role for CRIg on KCs to bind C3-opsonized IgM-coated
erythrocytes was examined. CRIg ko KCs demonstrated an .about.60%
reduction in E-IgM rosetting when compared to CRIg wt KCs (FIG.
54D). CR3 had a minor contribution to the total binding activity as
a further reduction (<20%) in rosette formation was observed
with the addition of CR3 blocking antibody. Hence, CRIg expression
is necessary for binding of C3 degradation products and
C3-opsonized particles to Kupffer cells.
Example 20
CRIg Internalizes and is Expressed on Recycling Endosomes
[0544] As binding of C3 opsonized particles to its receptors may
trigger their subsequent endocytosis (Fearon et al., J. Exp. Med.
153:1615-1628 (1981); Sengelov, Crit. Rev. Immunol. 15:107-131
(1995)), polyclonal antibodies that quench the Alexa488
fluorochrome (Austin et al., Mol. Biol. Cell 15:5268-5282 (2004))
were used to analyze whether CRIg and C3b internalize in KCs.
A488-conjugated anti-CRIg mAbs were pre-incubated with KCs at
4.degree. C. Addition of anti-A488 antibody at 4.degree. C.
suppressed fluorescence of surface-bound anti-CRIg antibodies as
shown in FIG. 47A, panel 1. When A488-conjugated anti-CRIg mAbs
were incubated with KCs at 37.degree. C. for 30 minutes followed by
incubation with anti-A488 antibodies, fluorescence was no
suppressed (FIG. 55A, panel 4) indicating that the anti-CRIg
antibodies internalized upon transfer of cells from 4.degree. C. to
37.degree. C. and therefore were not accessible to the quenching
anti-A488 antibodies. A similar result was found for C3b (FIG. 55A,
panels 3 and 6). Internalization of anti-CRIg antibodies was not
dependent on the presence of C3 since uptake of the antibody
occurred in KCs isolated from C3 ko mice (FIG. 55A, panels 2 and 5)
and in the absence of serum (results not shown).
Immunohistochemistry further confirmed the presence of anti-CRIg
antibodies and C3b in the cytoplasm of KCs from CRIg wt, but not
ko, mice (FIG. 55B). Over time, when KCs coated with
A488-conjugated anti-CRIg antibodies were incubated in the presence
of extracellular anti-A488 antibodies, a decrease in fluorescence
over time was observed and suggests that anti-CRIg antibodies
recycle back to the cell surface (FIG. 55C). The time course of
recycling was again independent of C3 since the kinetics of
quenching was similar in the presence and absence of C3 (results
not shown). In contrast, antibodies to the lysosomal proein Lamp1
remained intracellular and did not diminish with time. These
results indicate that CRIg functions as a receptor for C3b located
on a pool of constitutively recycling membranes.
[0545] To further determine the subcellular compartments in which
CRIg recycles, human monocyte-derived macrophages (MDMs) were
visualized using deconvolution microscopy using transferring as a
marker for recycling endosomes and Lamp1 as a marker for lysosomes.
MDMs cultured for 7 days express CRIg on 60% of the cells that show
saturatable binding of C3b (FIG. 55A) that can be competed off with
the extracellular domain of huCRIg(L) (results not shown).
Macrophages coated with anti-CRIg antibody at 4.degree. C.
demonstrate focal CRIg expression in F-actin rich filopodial
extensions (arrowheads, FIG. 56A, panels 1-3). In addition, the
CRIg antibody co-localized with C3b to the cell surface (results
not shown). Transfer of cells from 4.degree. C. to 37.degree. C.
followed by a 10 minute incubation at 37.degree. C. (FIG. 56B)
resulted in rapid internalization of CRIg antibody and C3b into a
transferrin.sup.+ endosome compartment located in the periphery of
the cell (FIG. 56B, panels 1-4, arrows) and bordering the
Lamp1.sup.+ compartment (arrows FIG. 57D, panel 1-4). CRIg remained
localized within the endosomal compartment and was not degraded in
the lysosome with prolonged chase times up to 24 hours (results not
shown). Incubation of macrophages with anti-CRIg antibodies did not
influence CRIg distribution since internalized CRIg antibody
completely overlapped with the total pool of CRIg detected post
fixation with a polyclonal antibody (FIG. 57C, panels 1-3) and was
independent of the presence of C3 in the medium (FIG. 57C, panel
4). Together, these results indicate that CRIg is present on
recycling and early endosomes and that internalization of CRIg
takes place in the absence of ligand or cross-linking antibody.
[0546] Since the majority of C3b and iC3b was deposited on
particles exposed to seum (Brown, Curr. Opin. Immunol. 3:76-82
(1991)), next we explored the localization of CRIg positive
endosomes in macrophages during phagocytosis of C3 opsonized
particles. Upon encounter with iC3b-opsonized sheep red blood cells
(E-IgM), CRIg rapidly (10 minutes) redistributed from transferrin
positive vesicles to the forming phagosome visible as a ring around
the engulfed erythrocytes (FIG. 56C, panels 1 and 4, arrows). After
2 hours following incubation of macrophages with C3 opsonized
particles, phagosomes had matured as shown by their translocation
into the lysosomal compartment (FIG. 56C, panels 5-8). CRIg was
highly expressed on the phagosomal membranes surrounding the C3
opsonized particles (FIG. 56C, panels 5 and 8, arrows) and in most
macrophages were no longer present within the transferrin endosomal
compartment. While CRIg remained present on a subset of phagosomes
in the lysosomal compartment, its expression did not overlap with
that of LAW-1 (FIG. 56C, panels 7 ad 8, arrowheads). The absence of
CRIg in the LAMP-1.sup.+ membranes was unlikely the result of
lysosomal degradation of CRIg since protease inhibitors were
continuously present during incubation. In some of the macrophages
that has ingested E-IgM but 1ck CRIg.sup.+ phagosomes, CRIg.sup.+
was co-localized with the transferrin compartment (thick arrow,
FIG. 56C5, panels 5 and 8, thick arrows) suggesting CRIg.sup.+
returns to the recycling compartment following transfer of the
E-IgM to the lysosomal compartment.
[0547] Taken together, these results indicate that CRIg is
recruited from endoomes to sites of particle ingestion and
participates in the initial stages of Phagosome formation, but
excapes from the phagosome upon phagosome-lysome fusion to return
to the endosome compartment.
Example 21
Mice Lacking CRIg are Susceptible to Infection with Listeria
Monoctogenes
[0548] Materials and Methods
[0549] 1. Microorganisms, Infection of Mice and Evaluation of
Listerial Growth by Determination of CFU Counts
[0550] Virulent L. monocytogenes (LM) (ATCC strain 43251), was used
in all experiments. Bacterial virulence was maintained by serial
passage in BALB/c mice. Fresh isolates were obtained from infected
spleens, grown in brain heart infusion (liquid) or brain heart
infusion plates (Difco Laboratories, Detroit, Mich.). Bacteria were
washed repeatedly, resuspended in sterile phosphate-buffered saline
(PBS), and then stored at -80.degree. C. in small aliquots in PBS
containing 40% glycerol. Mice were inoculated intraveneously in the
tail vein with L. monocytogenes at various doses. For the
observation of bacterial growth in the various organs, we injected
intravenously 1.times.10.sup.4 colony-forming units (CFUs) of
Listeria, a dose not lethal to either CRIg ko or CRIg wt mice. The
number of viable bacteria in the inoculum, homogenates of the liver
and spleen, and infected cells was determined by plating 10-fold
serial dilutions on brain-heart infusion agar (Difco Laboratories)
plates. The numbers of CFUs were counted after incubation for 24
hours at 37.degree. C.
[0551] 2. Determination of Listeria-A488 Uptake in Kupffer
Cells
[0552] Live L. Monocytogenes was labeled with A-488 labeling kit
according to the manufacturers instructions (Molecular Probes,
Oregon). The number of live Listeria after the labeling procedure
was assessed by colony counts. CRIg wt or CRIg ko mice were
injected intravenously with 10 million CFU LM. One hour later,
livers were perfused and Kupffer cells were isolated according to
the methods described above. Cells were stained with a PE-labeled
antibody to F4/80, and positive cells were isolated using anti PE
beads (Miletnyi) followed by sorting with a MoFlo flow cytometer
(DakoCytomation, Ft. Collins, Colo.). F4/80 positive cells were
collected on coverslips and the number of internalized labeled
bacteria was estimated using confocal and light microscopy. Number
of bacteria per cell was counted in 400 cells from 4 different
fields per slide. Phagocytic index was calculated by multiplying
average number of bacteria per cell with percentage of kupffer
cells containing at least one bacteria. The results show average
and standard deviations of phagocytic index obtained from four
different animals.
[0553] Results
[0554] Based on the binding of CRIg to C3b/iC3b-opsonized
particles, to explore a role for CRIg in phagocytosis of complement
opsonized particles in vivo, CRIg wt and KO mice were infected with
various doses of Listeria Monocytogenes (LM), a gram-positive
facultative bacterium that, when exposed to serum, activates the
alternative pathway of complement which predominantly depostis C3b
and iC3b on the bacterial surface (Croize et al., Infec. Immunol.
61:5134-5139 (1993)). CRIg KO mice were significantly more
susceptible to LM infection as shown by an increased lethality
(FIG. 58A). Conversely, pretreatment with CRIg-Ig fusion protein
increased susceptibility of CRIg wt, but not CRIg ko mice (FIG.
62).
[0555] In line with a role of CRIg in binding and phagocytosis of
complement C3 opsonized particles, CRIg ko mice had a reduced
clearance of LM from the blood that resulted in an increased LM
burden in the spleen and lung (FIG. 58B). There was also a
decreased LM burden in the liver and heart of infected mice which
likely reflects the presence of CRIg expressing macrophages in
these tissues (FIG. 58B). Inflammation responses were elevated in
CRIg ko mice reflected by increased serum levels of IFN-.gamma.,
TNF-.alpha. and IL-6 (FIG. 58C). Consistent with the requirement of
CRIg in the clearance of C3-opsonized particles, CRIg ko KCs
demonstrated significantly reduced binding and phagocytosis of LM
as compared to CRIg wt KCs (FIG. 58D). Finally, the increased
Listeria load detected in the blood of CRIg ko mice was dependent
on C3 as infection of C3 ko mice abrogated the difference in
bacterial titer in CRIg ko vs. wt mice (FIG. 58E). Interestingly,
the circulating levels of bacteria were significantly lower in C3
ko mice as compared to C3 sufficient mice, and likely reflect the
increased involvement of C3-independent mechanisms responsible for
Listeria clearance in C3 ko mice. The rapid clearance in the
absence of C3, however, does not result in efficient pathogen
elimnation in the long term since C3 deficient mice dye within 2
days following gram-positive bacterial infection (Cunnion et al.,
J. Lab. Clin. Med. 143:358-365 (2004)). These results strongly
indicate that CRIg expressed on liver Kupffer cells plays a
critical role in the rapid clearance of complement C3 oposonized
pathogen from the circulation.
Deposit of Material
[0556] The following material has been deposited with the American
Type Culture Collection, 10801 University Boulevard, Manassas, Va.
20110-2209, USA (ATCC):
TABLE-US-00003 Designation ATCC Dep. No. Deposit Date DNA45416-1251
209620 Feb. 5, 1998
[0557] This deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC '122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14
with particular reference to 886 OG 638).
[0558] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0559] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
2412181DNAhomo sapiens 1cccacgcgtc cgcccacgcg tccgcccacg ggtccgccca
cgcgtccggg ccaccagaag 60tttgagcctc tttggtagca ggaggctgga agaaaggaca
gaagtagctc tggctgtgat 120ggggatctta ctgggcctgc tactcctggg
gcacctaaca gtggacactt atggccgtcc 180catcctggaa gtgccagaga
gtgtaacagg accttggaaa ggggatgtga atcttccctg 240cacctatgac
cccctgcaag gctacaccca agtcttggtg aagtggctgg tacaacgtgg
300ctcagaccct gtcaccatct ttctacgtga ctcttctgga gaccatatcc
agcaggcaaa 360gtaccagggc cgcctgcatg tgagccacaa ggttccagga
gatgtatccc tccaattgag 420caccctggag atggatgacc ggagccacta
cacgtgtgaa gtcacctggc agactcctga 480tggcaaccaa gtcgtgagag
ataagattac tgagctccgt gtccagaaac tctctgtctc 540caagcccaca
gtgacaactg gcagcggtta tggcttcacg gtgccccagg gaatgaggat
600tagccttcaa tgccaggctc ggggttctcc tcccatcagt tatatttggt
ataagcaaca 660gactaataac caggaaccca tcaaagtagc aaccctaagt
accttactct tcaagcctgc 720ggtgatagcc gactcaggct cctatttctg
cactgccaag ggccaggttg gctctgagca 780gcacagcgac attgtgaagt
ttgtggtcaa agactcctca aagctactca agaccaagac 840tgaggcacct
acaaccatga catacccctt gaaagcaaca tctacagtga agcagtcctg
900ggactggacc actgacatgg atggctacct tggagagacc agtgctgggc
caggaaagag 960cctgcctgtc tttgccatca tcctcatcat ctccttgtgc
tgtatggtgg tttttaccat 1020ggcctatatc atgctctgtc ggaagacatc
ccaacaagag catgtctacg aagcagccag 1080gtaagaaagt ctctcctctt
ccatttttga ccccgtccct gccctcaatt ttgattactg 1140gcaggaaatg
tggaggaagg ggggtgtggc acagacccaa tcctaaggcc ggaggccttc
1200agggtcagga catagctgcc ttccctctct caggcacctt ctgaggttgt
tttggccctc 1260tgaacacaaa ggataattta gatccatctg ccttctgctt
ccagaatccc tgggtggtag 1320gatcctgata attaattggc aagaattgag
gcagaagggt gggaaaccag gaccacagcc 1380ccaagtccct tcttatgggt
ggtgggctct tgggccatag ggcacatgcc agagaggcca 1440acgactctgg
agaaaccatg agggtggcca tcttcgcaag tggctgctcc agtgatgagc
1500caacttccca gaatctgggc aacaactact ctgatgagcc ctgcatagga
caggagtacc 1560agatcatcgc ccagatcaat ggcaactacg cccgcctgct
ggacacagtt cctctggatt 1620atgagtttct ggccactgag ggcaaaagtg
tctgttaaaa atgccccatt aggccaggat 1680ctgctgacat aattgcctag
tcagtccttg ccttctgcat ggccttcttc cctgctacct 1740ctcttcctgg
atagcccaaa gtgtccgcct accaacactg gagccgctgg gagtcactgg
1800ctttgccctg gaatttgcca gatgcatctc aagtaagcca gctgctggat
ttggctctgg 1860gcccttctag tatctctgcc gggggcttct ggtactcctc
tctaaatacc agagggaaga 1920tgcccatagc actaggactt ggtcatcatg
cctacagaca ctattcaact ttggcatctt 1980gccaccagaa gacccgaggg
aggctcagct ctgccagctc agaggaccag ctatatccag 2040gatcatttct
ctttcttcag ggccagacag cttttaattg aaattgttat ttcacaggcc
2100agggttcagt tctgctcctc cactataagt ctaatgttct gactctctcc
tggtgctcaa 2160taaatatcta atcataacag c 21812321PRThomo sapiens 2Met
Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp 1 5 10
15Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly Pro
20 25 30Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln
Gly 35 40 45Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser
Asp Pro 50 55 60Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His Ile
Gln Gln Ala65 70 75 80Lys Tyr Gln Gly Arg Leu His Val Ser His Lys
Val Pro Gly Asp Val 85 90 95Ser Leu Gln Leu Ser Thr Leu Glu Met Asp
Asp Arg Ser His Tyr Thr 100 105 110Cys Glu Val Thr Trp Gln Thr Pro
Asp Gly Asn Gln Val Val Arg Asp 115 120 125Lys Ile Thr Glu Leu Arg
Val Gln Lys Leu Ser Val Ser Lys Pro Thr 130 135 140Val Thr Thr Gly
Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met Arg145 150 155 160Ile
Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro Ile Ser Tyr Ile 165 170
175Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu Pro Ile Lys Val Ala Thr
180 185 190Leu Ser Thr Leu Leu Phe Lys Pro Ala Val Ile Ala Asp Ser
Gly Ser 195 200 205Tyr Phe Cys Thr Ala Lys Gly Gln Val Gly Ser Glu
Gln His Ser Asp 210 215 220Ile Val Lys Phe Val Val Lys Asp Ser Ser
Lys Leu Leu Lys Thr Lys225 230 235 240Thr Glu Ala Pro Thr Thr Met
Thr Tyr Pro Leu Lys Ala Thr Ser Thr 245 250 255Val Lys Gln Ser Trp
Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly 260 265 270Glu Thr Ser
Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala Ile Ile 275 280 285Leu
Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala Tyr Ile 290 295
300Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu Ala
Ala305 310 315 320Arg31372DNAhomo sapiens 3ccaactgcac ctcggttcta
tcgataggag gctggaagaa aggacagaag tagctctggc 60tgtgatgggg atcttactgg
gcctgctact cctggggcac ctaacagtgg acacttatgg 120ccgtcccatc
ctggaagtgc cagagagtgt aacaggacct tggaaagggg atgtgaatct
180tccctgcacc tatgaccccc tgcaaggcta cacccaagtc ttggtgaagt
ggctggtaca 240acgtggctca gaccctgtca ccatctttct acgtgactct
tctggagacc atatccagca 300ggcaaagtac cagggccgcc tgcatgtgag
ccacaaggtt ccaggagatg tatccctcca 360attgagcacc ctggagatgg
atgaccggag ccactacacg tgtgaagtca cctggcagac 420tcctgatggc
aaccaagtcg tgagagataa gattactgag ctccgtgtcc agaaactctc
480tgtctccaag cccacagtga caactggcag cggttatggc ttcacggtgc
cccagggaat 540gaggattagc cttcaatgcc aggctcgggg ttctcctccc
atcagttata tttggtataa 600gcaacagact aataaccagg aacccatcaa
agtagcaacc ctaagtacct tactcttcaa 660gcctgcggtg atagccgact
caggctccta tttctgcact gccaagggcc aggttggctc 720tgagcagcac
agcgacattg tgaagtttgt ggtcaaagac tcctcaaagc tactcaagac
780caagactgag gcacctacaa ccatgacata ccccttgaaa gcaacatcta
cagtgaagca 840gtcctgggac tggaccactg acatggatgg ctaccttgga
gagaccagtg ctgggccagg 900aaagagcctg cctgtctttg ccatcatcct
catcatctcc ttgtgctgta tggtggtttt 960taccatggcc tatatcatgc
tctgtcggaa gacatcccaa caagagcatg tctacgaagc 1020agccagggca
catgccagag aggccaacga ctctggagaa accatgaggg tggccatctt
1080cgcaagtggc tgctccagtg atgagccaac ttcccagaat ctgggcaaca
actactctga 1140tgagccctgc ataggacagg agtaccagat catcgcccag
atcaatggca actacgcccg 1200cctgctggac acagttcctc tggattatga
gtttctggcc actgagggca aaagtgtctg 1260ttaaaaatgc cccattaggc
caggatctgc tgacataatc tagagtcgac ctgcagaagc 1320ttggccgcca
tggcccaact tgtttattgc agcttataat ggttacaaat aa 13724399PRThomo
sapiens 4Met Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr
Val Asp 1 5 10 15Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser
Val Thr Gly Pro 20 25 30Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr
Asp Pro Leu Gln Gly 35 40 45Tyr Thr Gln Val Leu Val Lys Trp Leu Val
Gln Arg Gly Ser Asp Pro 50 55 60Val Thr Ile Phe Leu Arg Asp Ser Ser
Gly Asp His Ile Gln Gln Ala65 70 75 80Lys Tyr Gln Gly Arg Leu His
Val Ser His Lys Val Pro Gly Asp Val 85 90 95Ser Leu Gln Leu Ser Thr
Leu Glu Met Asp Asp Arg Ser His Tyr Thr 100 105 110Cys Glu Val Thr
Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp 115 120 125Lys Ile
Thr Glu Leu Arg Val Gln Lys Leu Ser Val Ser Lys Pro Thr 130 135
140Val Thr Thr Gly Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met
Arg145 150 155 160Ile Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro
Ile Ser Tyr Ile 165 170 175Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu
Pro Ile Lys Val Ala Thr 180 185 190Leu Ser Thr Leu Leu Phe Lys Pro
Ala Val Ile Ala Asp Ser Gly Ser 195 200 205Tyr Phe Cys Thr Ala Lys
Gly Gln Val Gly Ser Glu Gln His Ser Asp 210 215 220Ile Val Lys Phe
Val Val Lys Asp Ser Ser Lys Leu Leu Lys Thr Lys225 230 235 240Thr
Glu Ala Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser Thr 245 250
255Val Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly
260 265 270Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala
Ile Ile 275 280 285Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr
Met Ala Tyr Ile 290 295 300Met Leu Cys Arg Lys Thr Ser Gln Gln Glu
His Val Tyr Glu Ala Ala305 310 315 320Arg Ala His Ala Arg Glu Ala
Asn Asp Ser Gly Glu Thr Met Arg Val 325 330 335Ala Ile Phe Ala Ser
Gly Cys Ser Ser Asp Glu Pro Thr Ser Gln Asn 340 345 350Leu Gly Asn
Asn Tyr Ser Asp Glu Pro Cys Ile Gly Gln Glu Tyr Gln 355 360 365Ile
Ile Ala Gln Ile Asn Gly Asn Tyr Ala Arg Leu Leu Asp Thr Val 370 375
380Pro Leu Asp Tyr Glu Phe Leu Ala Thr Glu Gly Lys Ser Val Cys385
390 39551090DNAhomo sapiens 5gtccaactgc acctcggttc tatcgatagg
aggctggaag aaaggacaga agtagctctg 60gctgtgatgg ggatcttact gggcctgcta
ctcctggggc acctaacagt ggacacttat 120ggccgtccca tcctggaagt
gccagagagt gtaacaggac cttggaaagg ggatgtgaat 180cttccctgca
cctatgaccc cctgcaaggc tacacccaag tcttggtgaa gtggctggta
240caacgtggct cagaccctgt caccatcttt ctacgtgact cttctggaga
ccatatccag 300caggcaaagt accagggccg cctgcatgtg agccacaagg
ttccaggaga tgtatccctc 360caattgagca ccctggagat ggatgaccgg
agccactaca cgtgtgaagt cacctggcag 420actcctgatg gcaaccaagt
cgtgagagat aagattactg agctccgtgt ccagaaacac 480tcctcaaagc
tactcaagac caagactgag gcacctacaa ccatgacata ccccttgaaa
540gcaacatcta cagtgaagca gtcctgggac tggaccactg acatggatgg
ctaccttgga 600gagaccagtg ctgggccagg aaagagcctg cctgtctttg
ccatcatcct catcatctcc 660ttgtgctgta tggtggtttt taccatggcc
tatatcatgc tctgtcggaa gacatcccaa 720caagagcatg tctacgaagc
agccagggca catgccagag aggccaacga ctctggagaa 780accatgaggg
tggccatctt cgcaagtggc tgctccagtg atgagccaac ttcccagaat
840ctgggcaaca actactctga tgagccctgc ataggacagg agtaccagat
catcgcccag 900atcaatggca actacgcccg cctgctggac acagttcctc
tggattatga gtttctggcc 960actgagggca aaagtgtctg ttaaaaatgc
cccattaggc caggatctgc tgacataatc 1020tagagtcgac ctgcagaagc
ttggccgcca tggcccaact tgtttattgc agcttataat 1080ggttacaata
10906305PRThomo sapiens 6Met Gly Ile Leu Leu Gly Leu Leu Leu Leu
Gly His Leu Thr Val Asp 1 5 10 15Thr Tyr Gly Arg Pro Ile Leu Glu
Val Pro Glu Ser Val Thr Gly Pro 20 25 30Trp Lys Gly Asp Val Asn Leu
Pro Cys Thr Tyr Asp Pro Leu Gln Gly 35 40 45Tyr Thr Gln Val Leu Val
Lys Trp Leu Val Gln Arg Gly Ser Asp Pro 50 55 60Val Thr Ile Phe Leu
Arg Asp Ser Ser Gly Asp His Ile Gln Gln Ala65 70 75 80Lys Tyr Gln
Gly Arg Leu His Val Ser His Lys Val Pro Gly Asp Val 85 90 95Ser Leu
Gln Leu Ser Thr Leu Glu Met Asp Asp Arg Ser His Tyr Thr 100 105
110Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp
115 120 125Lys Ile Thr Glu Leu Arg Val Gln Lys His Ser Ser Lys Leu
Leu Lys 130 135 140Thr Lys Thr Glu Ala Pro Thr Thr Met Thr Tyr Pro
Leu Lys Ala Thr145 150 155 160Ser Thr Val Lys Gln Ser Trp Asp Trp
Thr Thr Asp Met Asp Gly Tyr 165 170 175Leu Gly Glu Thr Ser Ala Gly
Pro Gly Lys Ser Leu Pro Val Phe Ala 180 185 190Ile Ile Leu Ile Ile
Ser Leu Cys Cys Met Val Val Phe Thr Met Ala 195 200 205Tyr Ile Met
Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu 210 215 220Ala
Ala Arg Ala His Ala Arg Glu Ala Asn Asp Ser Gly Glu Thr Met225 230
235 240Arg Val Ala Ile Phe Ala Ser Gly Cys Ser Ser Asp Glu Pro Thr
Ser 245 250 255Gln Asn Leu Gly Asn Asn Tyr Ser Asp Glu Pro Cys Ile
Gly Gln Glu 260 265 270Tyr Gln Ile Ile Ala Gln Ile Asn Gly Asn Tyr
Ala Arg Leu Leu Asp 275 280 285Thr Val Pro Leu Asp Tyr Glu Phe Leu
Ala Thr Glu Gly Lys Ser Val 290 295 300Cys30571590DNAmus musculus
7gtccaactgc acctcggttc tatcgattcg aattcggcca cactggccgg atcctctaga
60gatccctcga cctcgaccca cgcgtccgag cagcaagagg atggaaggat gaatagaagt
120agcttcaaat aggatggaga tctcatcagg cttgctgttc ctgggccacc
taatagtgct 180cacctatggc caccccaccc taaaaacacc tgagagtgtg
acagggacct ggaaaggaga 240tgtgaagatt cagtgcatct atgatcccct
gagaggctac aggcaagttt tggtgaaatg 300gctggtaaga cacggctctg
actccgtcac catcttccta cgtgactcca ctggagacca 360tatccagcag
gcaaagtaca gaggccgcct gaaagtgagc cacaaagttc caggagatgt
420gtccctccaa ataaataccc tgcagatgga tgacaggaat cactatacat
gtgaggtcac 480ctggcagact cctgatggaa accaagtaat aagagataag
atcattgagc tccgtgttcg 540gaaatataat ccacctagaa tcaatactga
agcacctaca accctgcact cctctttgga 600agcaacaact ataatgagtt
caacctctga cttgaccact aatgggactg gaaaacttga 660ggagaccatt
gctggttcag ggaggaacct gccaatcttt gccataatct tcatcatctc
720cctttgctgc atagtagctg tcaccatacc ttatatcttg ttccgctgca
ggacattcca 780acaagagtat gtctatggag tgagcagggt gtttgccagg
aagacaagca actctgaaga 840aaccacaagg gtgactacca tcgcaactga
tgaaccagat tcccaggctc tgattagtga 900ctactctgat gatccttgcc
tcagccagga gtaccaaata accatcagat caacaatgtc 960tattcctgcc
tgctgaacac agtttccaga aactaagaag ttcttgctac tgaagaaaat
1020aacatctgct aaaatgcccc tactaagtca aggtctactg gcgtaattac
ctgttactta 1080tttactactt gccttcaaca tagctttctc cctggcttcc
tttcttctta gacaacctaa 1140agtatctatc tagtctgcca attctggggc
cattgagaaa tcctgggttt ggctaagaat 1200atactacatg cacctcaaga
aatctagctt ctgggcttca cccagaacaa ttttcttcct 1260agggccttca
caactcttct ccaaacagca gagaaattcc atagcagtag aggttcttta
1320tcatgcctcc agacagcgtg agtctcagtc ctacaaactc agacaagcac
atgggtctag 1380gattactcct ctttctctag ggccagatga cttttaattg
atattactat tgctacatta 1440tgaatctaat gcacatgtat tcttttgttg
ttaataaatg tttaatcatg acatcaaaaa 1500aaaaaaaaaa aagggcggcc
gcgactctag agtcgacctg cagtagggat aacagggtaa 1560taagcttggc
cgccatggcc caacttgttt 15908280PRTmus musculus 8Met Glu Ile Ser Ser
Gly Leu Leu Phe Leu Gly His Leu Ile Val Leu 1 5 10 15Thr Tyr Gly
His Pro Thr Leu Lys Thr Pro Glu Ser Val Thr Gly Thr 20 25 30Trp Lys
Gly Asp Val Lys Ile Gln Cys Ile Tyr Asp Pro Leu Arg Gly 35 40 45Tyr
Arg Gln Val Leu Val Lys Trp Leu Val Arg His Gly Ser Asp Ser 50 55
60Val Thr Ile Phe Leu Arg Asp Ser Thr Gly Asp His Ile Gln Gln Ala65
70 75 80Lys Tyr Arg Gly Arg Leu Lys Val Ser His Lys Val Pro Gly Asp
Val 85 90 95Ser Leu Gln Ile Asn Thr Leu Gln Met Asp Asp Arg Asn His
Tyr Thr 100 105 110Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln
Val Ile Arg Asp 115 120 125Lys Ile Ile Glu Leu Arg Val Arg Lys Tyr
Asn Pro Pro Arg Ile Asn 130 135 140Thr Glu Ala Pro Thr Thr Leu His
Ser Ser Leu Glu Ala Thr Thr Ile145 150 155 160Met Ser Ser Thr Ser
Asp Leu Thr Thr Asn Gly Thr Gly Lys Leu Glu 165 170 175Glu Thr Ile
Ala Gly Ser Gly Arg Asn Leu Pro Ile Phe Ala Ile Ile 180 185 190Phe
Ile Ile Ser Leu Cys Cys Ile Val Ala Val Thr Ile Pro Tyr Ile 195 200
205Leu Phe Arg Cys Arg Thr Phe Gln Gln Glu Tyr Val Tyr Gly Val Ser
210 215 220Arg Val Phe Ala Arg Lys Thr Ser Asn Ser Glu Glu Thr Thr
Arg Val225 230 235 240Thr Thr Ile Ala Thr Asp Glu Pro Asp Ser Gln
Ala Leu Ile Ser Asp 245 250 255Tyr Ser Asp Asp Pro Cys Leu Ser Gln
Glu Tyr Gln Ile Thr Ile Arg 260 265 270Ser Thr Met Ser Ile Pro Ala
Cys 275 28091503DNAhomo sapiens 9gcaggcaaag taccagggcc gcctgcatgt
gagccacaag gttccaggag atgtatccct 60ccaattgagc accctggaga tggatgaccg
gagccactac acgtgtgaag tcacctggca 120gactcctgat ggcaaccaag
tcgtgagaga taagattact gagctccgtg tccagaaact 180ctctgtctcc
aagcccacag tgacaactgg cagcggttat ggcttcacgg tgccccaggg
240aatgaggatt agccttcaat gccagggttc ggggttctcc tcccatcagt
tatatttggt 300ataagcaaca gactaataac cagggaaccc atcaaagtag
caaccctaag taccttactc 360ttcaagcctg cggtgatagc cgactcaggc
tcctatttct gcactgccaa gggccaggtt 420ggctctgagc agcacagcga
cattgtgaag tttgtggtca aagactcctc aaagctactc 480aagaccaaga
ctgaggcacc tacaaccatg acatacccct tgaaagcaac atctacagtg
540aagcagtcct gggactggac cactgacatg gatggctacc ttggagagac
cagtgctggg
600ccaggaaaga gcctgcctgt ctttgccatc atcctcatca tctccttgtg
ctgtatggtg 660gtttttacca tggcctatat catgctctgt cggaagacat
cccaacaaga gcatgtctac 720gaagcagcca gggcacatgc cagagaggcc
aacgactctg gagaaaccat gagggtggcc 780atcttcgcaa gtggctgctc
cagtgatgag ccaacttccc agaatctggg gcaacaacta 840ctctgatgag
ccctgcatag gacaggagta ccagatcatc gcccagatca atggcaacta
900cgcccgcctg ctggacacag ttcctctgga ttatgagttt ctggccactg
agggcaaaag 960tgtctgttaa aaatgcccca ttaggccagg atctgctgac
ataattgcct agtcagtcct 1020tgccttctgc atggccttct tccctgctac
ctctcttcct ggatagccca aagtgtccgc 1080ctaccaacac tggagccgct
gggagtcact ggctttgccc tggaatttgc cagatgcatc 1140tcaagtaagc
cagctgctgg atttggctct gggcccttct agtatctctg ccgggggctt
1200ctggtactcc tctctaaata ccagagggaa gatgcccata gcactaggac
ttggtcatca 1260tgcctacaga cactattcaa ctttggcatc ttgccaccag
aagacccgag gggaggctca 1320gctctgccag ctcagaggac cagctatatc
caggatcatt tctctttctt cagggccaga 1380cagcttttaa ttgaaattgt
tatttcacag gccagggttc agttctgctc ctccactata 1440agtctaatgt
tctgactctc tcctggtgct caataaatat ctaatcataa cagcaaaaaa 1500aaa
15031024DNAArtificial SequenceSynthetic oligonucleotide probe
10tatccctcca attgagcacc ctgg 241121DNAArtificial SequenceSynthetic
oligonucleotide probe 11gtcggaagac atcccaacaa g 211224DNAArtificial
SequenceSynthetic oligonucleotide probe 12cttcacaatg tcgctgtgct
gctc 241324DNAArtificial SequenceSynthetic oligonucleotide probe
13agccaaatcc agcagctggc ttac 241450DNAArtificial SequenceSynthetic
oligonucleotide probe 14tggatgaccg gagccactac acgtgtgaag tcacctggca
gactcctgat 50157496DNAhomo sapiens 15ttcgagctcg cccgacattg
attattgact agttattaat agtaatcaat tacggggtca 60ttagttcata gcccatatat
ggagttccgc gttacataac ttacggtaaa tggcccgcct 120ggctgaccgc
ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta
180acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta
aactgcccac 240ttggcagtac atcaagtgta tcatatgcca agtacgcccc
ctattgacgt caatgacggt 300aaatggcccg cctggcatta tgcccagtac
atgaccttat gggactttcc tacttggcag 360tacatctacg tattagtcat
cgctattacc atggtgatgc ggttttggca gtacatcaat 420gggcgtggat
agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat
480gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa
caactccgcc 540ccattgacgc aaatgggcgg taggcgtgta cggtgggagg
tctatataag cagagctcgt 600ttagtgaacc gtcagatcgc ctggagacgc
catccacgct gttttgacct ccatagaaga 660caccgggacc gatccagcct
ccgcggccgg gaacggtgca ttggaacgcg gattccccgt 720gccaagagtg
acgtaagtac cgcctataga gtctataggc ccaccccctt ggcttggccc
780acccccttgg cttcgttaga acgcggctac aattaataca taaccttatg
tatcatacac 840atacgattta ggtgacacta tagaataaca tccactttgc
ctttcacatc cactttgcct 900ttctctccac aggtgtccac tcccaggtcc
aactgcacct cggttctatc gattaaacca 960ccatggggat cttactgggc
ctgctactcc tggggcacct aacagtggac acttatggcc 1020gtcccatcct
ggaagtgcca gagagtgtaa caggaccttg gaaaggggat gtgaatcttc
1080cctgcaccta tgaccccctg caaggctaca cccaagtctt ggtgaagtgg
ctggtacaac 1140gtggctcaga ccctgtcacc atctttctac gtgactcttc
tggagaccat atccagcagg 1200caaagtacca gggccgcctg catgtgagcc
acaaggttcc aggagatgta tccctccaat 1260tgagcaccct ggagatggat
gaccggagcc actacacgtg tgaagtcacc tggcagactc 1320ctgatggcaa
ccaagtcgtg agagataaga ttactgagct ccgtgtccag aaactctctg
1380tctccaagcc cacagtgaca actggcagcg gttatggctt cacggtgccc
cagggaatga 1440ggattagcct tcaatgccag gctcggggtt ctcctcccat
cagttatatt tggtataagc 1500aacagactaa taaccaggaa cccatcaaag
tagcaaccct aagtacctta ctcttcaagc 1560ctgcggtgat agccgactca
ggctcctatt tctgcactgc caagggccag gttggctctg 1620agcagcacag
cgacattgtg aagtttgtgg tcaaagactc ctcaaagcta ctcaagacca
1680agactgaggc acctacaacc atgacatacc ccttgaaagc aacatctaca
gtgaagcagt 1740cctgggactg gaccactgac atggatggcg ggcgcgccca
ggtcaccgac aaagctgcgc 1800actatactct gtgcccaccg tgcccagcac
ctgaactcct ggggggaccg tcagtcttcc 1860tcttcccccc aaaacccaag
gacaccctca tgatctcccg gacccctgag gtcacatgcg 1920tggtggtgga
cgtgagccac gaagaccctg aggtcaagtt caactggtac gtggacggcg
1980tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc
acgtaccgtg 2040tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa
tggcaaggag tacaagtgca 2100aggtctccaa caaagccctc ccagccccca
tcgagaaaac catctccaaa gccaaagggc 2160agccccgaga accacaggtg
tacaccctgc ccccatcccg ggaagagatg accaagaacc 2220aggtcagcct
gacctgcctg gtcaaaggct tctatcccag cgacatcgcc gtggagtggg
2280agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg
gactccgacg 2340gctccttctt cctctacagc aagctcaccg tggacaagag
caggtggcag caggggaacg 2400tcttctcatg ctccgtgatg catgaggctc
tgcacaacca ctacacgcag aagagcctct 2460ccctgtctcc gggtaaatga
gtgcgacggc cctagagtcg acctgcagaa gcttctagag 2520tcgacctgca
gaagcttggc cgccatggcc caacttgttt attgcagctt ataatggtta
2580caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac
tgcattctag 2640ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc
tggatcgatc gggaattaat 2700tcggcgcagc accatggcct gaaataacct
ctgaaagagg aacttggtta ggtaccttct 2760gaggcggaaa gaaccagctg
tggaatgtgt gtcagttagg gtgtggaaag tccccaggct 2820ccccagcagg
cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa
2880agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
tagtcagcaa 2940ccatagtccc gcccctaact ccgcccatcc cgcccctaac
tccgcccagt tccgcccatt 3000ctccgcccca tggctgacta atttttttta
tttatgcaga ggccgaggcc gcctcggcct 3060ctgagctatt ccagaagtag
tgaggaggct tttttggagg cctaggcttt tgcaaaaagc 3120tgttaattcg
aacacgcaga tgcagtcggg gcggcgcggt cccaggtcca cttcgcatat
3180taaggtgacg cgtgtggcct cgaacaccga gcgaccctgc agcgacccgc
ttaacagcgt 3240caacagcgtg ccgcagatct gatcaagaga caggatgagg
atcgtttcgc atgattgaac 3300aagatggatt gcacgcaggt tctccggccg
cttgggtgga gaggctattc ggctatgact 3360gggcacaaca gacaatcggc
tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc 3420gcccggttct
ttttgtcaag accgacctgt ccggtgccct gaatgaactg caggacgagg
3480cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg
ctcgacgttg 3540tcactgaagc gggaagggac tggctgctat tgggcgaagt
gccggggcag gatctcctgt 3600catctcacct tgctcctgcc gagaaagtat
ccatcatggc tgatgcaatg cggcggctgc 3660atacgcttga tccggctacc
tgcccattcg accaccaagc gaaacatcgc atcgagcgag 3720cacgtactcg
gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg
3780ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac
ggcgaggatc 3840tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat
ggtggaaaat ggccgctttt 3900ctggattcat cgactgtggc cggctgggtg
tggcggaccg ctatcaggac atagcgttgg 3960ctacccgtga tattgctgaa
gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt 4020acggtatcgc
cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct
4080tctgagcggg actctggggt tcgaaatgac cgaccaagcg acgcccaacc
tgccatcacg 4140agatttcgat tccaccgccg ccttctatga aaggttgggc
ttcggaatcg ttttccggga 4200cgccggctgg atgatcctcc agcgcgggga
tctcatgctg gagttcttcg cccaccccgg 4260gagatggggg aggctaactg
aaacacggaa ggagacaata ccggaaggaa cccgcgctat 4320gacggcaata
aaaagacaga ataaaacgca cgggtgttgg gtcgtttgtt cataaacgcg
4380gggttcggtc ccagggctgg cactctgtcg ataccccacc gagaccccat
tggggccaat 4440acgcccgcgt ttcttccttt tccccacccc aacccccaag
ttcgggtgaa ggcccagggc 4500tcgcagccaa cgtcggggcg gcaagcccgc
catagccacg ggccccgtgg gttagggacg 4560gggtccccca tggggaatgg
tttatggttc gtgggggtta ttcttttggg cgttgcgtgg 4620ggtcaggtcc
acgactggac tgagcagaca gacccatggt ttttggatgg cctgggcatg
4680gaccgcatgt actggcgcga cacgaacacc gggcgtctgt ggctgccaaa
cacccccgac 4740ccccaaaaac caccgcgcgg atttctggcg ccgccggacg
aactaaacct gactacggca 4800tctctgcccc ttcttcgctg gtacgaggag
cgcttttgtt ttgtattggt caccacggcc 4860gagtttccgc gggaccccgg
ccagggcacc tgtcctacga gttgcatgat aaagaagaca 4920gtcataagtg
cggcgacgat agtcatgccc cgcgcccacc ggaaggagct gactgggttg
4980aaggctctca agggcatcgg tcgagcggcc gcatcaaagc aaccatagta
cgcgccctgt 5040agcggcgcat taagcgcggc gggtgtggtg gttacgcgca
gcgtgaccgc tacacttgcc 5100agcgccctag cgcccgctcc tttcgctttc
ttcccttcct ttctcgccac gttcgccggc 5160tttccccgtc aagctctaaa
tcgggggctc cctttagggt tccgatttag tgctttacgg 5220cacctcgacc
ccaaaaaact tgatttgggt gatggttcac gtagtgggcc atcgccctga
5280tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg
actcttgttc 5340caaactggaa caacactcaa ccctatctcg ggctattctt
ttgatttata agggattttg 5400ccgatttcgg cctattggtt aaaaaatgag
ctgatttaac aaaaatttaa cgcgaatttt 5460aacaaaatat taacgtttac
aattttatgg tgcaggcctc gtgatacgcc tatttttata 5520ggttaatgtc
atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt
5580gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc
cgctcatgag 5640acaataaccc tgataaatgc ttcaataata ttgaaaaagg
aagagtatga gtattcaaca 5700tttccgtgtc gcccttattc ccttttttgc
ggcattttgc cttcctgttt ttgctcaccc 5760agaaacgctg gtgaaagtaa
aagatgctga agatcagttg ggtgcacgag tgggttacat 5820cgaactggat
ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc
5880aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg
atgacgccgg 5940gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat
gacttggttg agtactcacc 6000agtcacagaa aagcatctta cggatggcat
gacagtaaga gaattatgca gtgctgccat 6060aaccatgagt gataacactg
cggccaactt acttctgaca acgatcggag gaccgaagga 6120gctaaccgct
tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc
6180ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgccag
cagcaatggc 6240aacaacgttg cgcaaactat taactggcga actacttact
ctagcttccc ggcaacaatt 6300aatagactgg atggaggcgg ataaagttgc
aggaccactt ctgcgctcgg cccttccggc 6360tggctggttt attgctgata
aatctggagc cggtgagcgt gggtctcgcg gtatcattgc 6420agcactgggg
ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca
6480ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac
tgattaagca 6540ttggtaactg tcagaccaag tttactcata tatactttag
attgatttaa aacttcattt 6600ttaatttaaa aggatctagg tgaagatcct
ttttgataat ctcatgacca aaatccctta 6660acgtgagttt tcgttccact
gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg 6720agatcctttt
tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc
6780ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa
ctggcttcag 6840cagagcgcag ataccaaata ctgtccttct agtgtagccg
tagttaggcc accacttcaa 6900gaactctgta gcaccgccta catacctcgc
tctgctaatc ctgttaccag tggctgctgc 6960cagtggcgat aagtcgtgtc
ttaccgggtt ggactcaaga cgatagttac cggataaggc 7020gcagcggtcg
ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta
7080caccgaactg agatacctac agcgtgagca ttgagaaagc gccacgcttc
ccgaagggag 7140aaaggcggac aggtatccgg taagcggcag ggtcggaaca
ggagagcgca cgagggagct 7200tccaggggga aacgcctggt atctttatag
tcctgtcggg tttcgccacc tctgacttga 7260gcgtcgattt ttgtgatgct
cgtcaggggg gcggagccta tggaaaaacg ccagctggca 7320cgacaggttt
cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttacct
7380cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt
tgtgtggaat 7440tgtgagcgga taacaatttc acacaggaaa cagctatgac
catgattacg aattaa 7496167201DNAhomo sapiens 16ttcgagctcg cccgacattg
attattgact agttattaat agtaatcaat tacggggtca 60ttagttcata gcccatatat
ggagttccgc gttacataac ttacggtaaa tggcccgcct 120ggctgaccgc
ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta
180acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta
aactgcccac 240ttggcagtac atcaagtgta tcatatgcca agtacgcccc
ctattgacgt caatgacggt 300aaatggcccg cctggcatta tgcccagtac
atgaccttat gggactttcc tacttggcag 360tacatctacg tattagtcat
cgctattacc atggtgatgc ggttttggca gtacatcaat 420gggcgtggat
agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat
480gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa
caactccgcc 540ccattgacgc aaatgggcgg taggcgtgta cggtgggagg
tctatataag cagagctcgt 600ttagtgaacc gtcagatcgc ctggagacgc
catccacgct gttttgacct ccatagaaga 660caccgggacc gatccagcct
ccgcggccgg gaacggtgca ttggaacgcg gattccccgt 720gccaagagtg
acgtaagtac cgcctataga gtctataggc ccaccccctt ggcttggccc
780acccccttgg cttcgttaga acgcggctac aattaataca taaccttatg
tatcatacac 840atacgattta ggtgacacta tagaataaca tccactttgc
ctttcacatc cactttgcct 900ttctctccac aggtgtccac tcccaggtcc
aactgcacct cggttctatc gatgctctca 960ataaaccacc atggggatct
tactgggcct gctactcctg gggcacctaa cagtggacac 1020ttatggccgt
cccatcctgg aagtgccaga gagtgtaaca ggaccttgga aaggggatgt
1080gaatcttccc tgcacctatg accccctgca aggctacacc caagtcttgg
tgaagtggct 1140ggtacaacgt ggctcagacc ctgtcaccat ctttctacgt
gactcttctg gagaccatat 1200ccagcaggca aagtaccagg gccgcctgca
tgtgagccac aaggttccag gagatgtatc 1260cctccaattg agcaccctgg
agatggatga ccggagccac tacacgtgtg aagtcacctg 1320gcagactcct
gatggcaacc aagtcgtgag agataagatt actgagctcc gtgtccagaa
1380acactcctca aagctactca agaccaagac tgaggcacct acaaccatga
catacccctt 1440gaaagcaaca tctacagtga agcagtcctg ggactggacc
actgacatgg atggggggcg 1500cgcccaggtc accgacaaag ctgcgcacta
tactctgtgc ccaccgtgcc cagcacctga 1560actcctgggg ggaccgtcag
tcttcctctt ccccccaaaa cccaaggaca ccctcatgat 1620ctcccggacc
cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt
1680caagttcaac tggtacgtgg acggcgtgga ggtgcataat gccaagacaa
agccgcggga 1740ggagcagtac aacagcacgt accgtgtggt cagcgtcctc
accgtcctgc accaggactg 1800gctgaatggc aaggagtaca agtgcaaggt
ctccaacaaa gccctcccag cccccatcga 1860gaaaaccatc tccaaagcca
aagggcagcc ccgagaacca caggtgtaca ccctgccccc 1920atcccgggaa
gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta
1980tcccagcgac atcgccgtgg agtgggagag caatgggcag ccggagaaca
actacaagac 2040cacgcctccc gtgctggact ccgacggctc cttcttcctc
tacagcaagc tcaccgtgga 2100caagagcagg tggcagcagg ggaacgtctt
ctcatgctcc gtgatgcatg aggctctgca 2160caaccactac acgcagaaga
gcctctccct gtctccgggt aaatgagtgc gacggcccta 2220gagtcgacct
gcagaagctt ctagagtcga cctgcagaag cttggccgcc atggcccaac
2280ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa
tttcacaaat 2340aaagcatttt tttcactgca ttctagttgt ggtttgtcca
aactcatcaa tgtatcttat 2400catgtctgga tcgatcggga attaattcgg
cgcagcacca tggcctgaaa taacctctga 2460aagaggaact tggttaggta
ccttctgagg cggaaagaac cagctgtgga atgtgtgtca 2520gttagggtgt
ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct
2580caattagtca gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca
gaagtatgca 2640aagcatgcat ctcaattagt cagcaaccat agtcccgccc
ctaactccgc ccatcccgcc 2700cctaactccg cccagttccg cccattctcc
gccccatggc tgactaattt tttttattta 2760tgcagaggcc gaggccgcct
cggcctctga gctattccag aagtagtgag gaggcttttt 2820tggaggccta
ggcttttgca aaaattcgaa cacgcagatg cagtcggggc ggcgcggtcc
2880caggtccact tcgcatatta aggtgacgcg tgtggcctcg aacaccgagc
gaccctgcag 2940cgacccgctt aacagcgtca acagcgtgcc gcagatctga
tcaagagaca ggatgaggat 3000cgtttcgcat gattgaacaa gatggattgc
acgcaggttc tccggccgct tgggtggaga 3060ggctattcgg ctatgactgg
gcacaacaga caatcggctg ctctgatgcc gccgtgttcc 3120ggctgtcagc
gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga
3180atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc
gttccttgcg 3240cagctgtgct cgacgttgtc actgaagcgg gaagggactg
gctgctattg ggcgaagtgc 3300cggggcagga tctcctgtca tctcaccttg
ctcctgccga gaaagtatcc atcatggctg 3360atgcaatgcg gcggctgcat
acgcttgatc cggctacctg cccattcgac caccaagcga 3420aacatcgcat
cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc
3480tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc
aaggcgcgca 3540tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc
ctgcttgccg aatatcatgg 3600tggaaaatgg ccgcttttct ggattcatcg
actgtggccg gctgggtgtg gcggaccgct 3660atcaggacat agcgttggct
acccgtgata ttgctgaaga gcttggcggc gaatgggctg 3720accgcttcct
cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc
3780gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg
accaagcgac 3840gcccaacctg ccatcacgag atttcgattc caccgccgcc
ttctatgaaa ggttgggctt 3900cggaatcgtt ttccgggacg ccggctggat
gatcctccag cgcggggatc tcatgctgga 3960gttcttcgcc caccccggga
gatgggggag gctaactgaa acacggaagg agacaatacc 4020ggaaggaacc
cgcgctatga cggcaataaa aagacagaat aaaacgcacg ggtgttgggt
4080cgtttgttca taaacgcggg gttcggtccc agggctggca ctctgtcgat
accccaccga 4140gaccccattg gggccaatac gcccgcgttt cttccttttc
cccaccccaa cccccaagtt 4200cgggtgaagg cccagggctc gcagccaacg
tcggggcggc aagcccgcca tagccacggg 4260ccccgtgggt tagggacggg
gtcccccatg gggaatggtt tatggttcgt gggggttatt 4320cttttgggcg
ttgcgtgggg tcaggtccac gactggactg agcagacaga cccatggttt
4380ttggatggcc tgggcatgga ccgcatgtac tggcgcgaca cgaacaccgg
gcgtctgtgg 4440ctgccaaaca cccccgaccc ccaaaaacca ccgcgcggat
ttctggcgcc gccggacgaa 4500ctaaacctga ctacggcatc tctgcccctt
cttcgctggt acgaggagcg cttttgtttt 4560gtattggtca ccacggccga
gtttccgcgg ggcacctgtc ctacgagttg catgataaag 4620aagacagtca
taagtgcggc gacgatagtc atgccccgcg cccaccggaa ggagctgact
4680gggttgaagg ctctcaaggg catcggtcga gcggccgctc aaagcaacca
tagtacgcgc 4740cctgtagcgg cgcattaagc gcggcgggtg tggtggttac
gcgcagcgtg accgctacac 4800ttgccagcgc cctagcgccc gctcctttcg
ctttcttccc ttcctttctc gccacgttcg 4860ccggctttcc ccgtcaagct
ctaaatcggg ggctcccttt agggttccga tttagtgctt 4920tacggcacct
cgaccccaaa aaacttgatt tgggtgatgg ttcacgtagt gggccatcgc
4980cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat
agtggactct 5040tgttccaaac tggaacaaca ctcaacccta tctcgggcta
ttcttttgat ttataaggga 5100ttttgccgat ttcggcctat tggttaaaaa
atgagctgat ttaacaaaaa tttaacgcga 5160attttaacaa aatattaacg
tttacaattt tatggtgcag gcctcgtgat acgcctattt 5220ttataggtta
atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga
5280aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat
gtatccgctc 5340atgagacaat aaccctgata aatgcttcaa taatattgaa
aaaggaagag tatgagtatt 5400caacatttcc gtgtcgccct tattcccttt
tttgcggcat tttgccttcc tgtttttgct 5460cacccagaaa cgctggtgaa
agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5520tacatcgaac
tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt
5580tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc
ccgtgatgac 5640gccgggcaag agcaactcgg tcgccgcata cactattctc
agaatgactt ggttgagtac 5700tcaccagtca cagaaaagca tcttacggat
ggcatgacag taagagaatt atgcagtgct 5760gccataacca tgagtgataa
cactgcggcc aacttacttc tgacaacgat cggaggaccg 5820aaggagctaa
ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg
5880gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat
gccagcagca 5940atggcaacaa cgttgcgcaa
actattaact ggcgaactac ttactctagc ttcccggcaa 6000caattaatag
actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt
6060ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc
tcgcggtatc 6120attgcagcac tggggccaga tggtaagccc tcccgtatcg
tagttatcta cacgacgggg 6180agtcaggcaa ctatggatga acgaaataga
cagatcgctg agataggtgc ctcactgatt 6240aagcattggt aactgtcaga
ccaagtttac tcatatatac tttagattga tttaaaactt 6300catttttaat
ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc
6360ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat
caaaggatct 6420tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
aaacaaaaaa accaccgcta 6480ccagcggtgg tttgtttgcc ggatcaagag
ctaccaactc tttttccgaa ggtaactggc 6540ttcagcagag cgcagatacc
aaatactgtc cttctagtgt agccgtagtt aggccaccac 6600ttcaagaact
ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct
6660gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata
gttaccggat 6720aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
agcccagctt ggagcgaacg 6780acctacaccg aactgagata cctacagcgt
gagcattgag aaagcgccac gcttcccgaa 6840gggagaaagg cggacaggta
tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 6900gagcttccag
ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga
6960cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa
aaacgccagc 7020tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc
gcaacgcaat taatgtgagt 7080tacctcactc attaggcacc ccaggcttta
cactttatgc ttccggctcg tatgttgtgt 7140ggaattgtga gcggataaca
atttcacaca ggaaacagct atgaccatga ttacgaatta 7200a 7201175988DNAhomo
sapiens 17tcgagctcgc ccgacattga ttattgacta gttattaata gtaatcaatt
acggggtcat 60tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat
ggcccgcctg 120gctgaccgcc caacgacccc cgcccattga cgtcaataat
gacgtatgtt cccatagtaa 180cgccaatagg gactttccat tgacgtcaat
gggtggagta tttacggtaa actgcccact 240tggcagtaca tcaagtgtat
catatgccaa gtacgccccc tattgacgtc aatgacggta 300aatggcccgc
ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt
360acatctacgt attagtcatc gctattacca tggtgatgcg gttttggcag
tacatcaatg 420ggcgtggata gcggtttgac tcacggggat ttccaagtct
ccaccccatt gacgtcaatg 480ggagtttgtt ttggcaccaa aatcaacggg
actttccaaa atgtcgtaac aactccgccc 540cattgacgca aatgggcggt
aggcgtgtac ggtgggaggt ctatataagc agagctcgtt 600tagtgaaccg
tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagac
660accgggaccg atccagcctc cgcggccggg aacggtgcat tggaacgcgg
attccccgtg 720ccaagagtga cgtaagtacc gcctatagag tctataggcc
cacccccttg gcttggccca 780cccccttggc ttcgttagaa cgcggctaca
attaatacat aaccttatgt atcatacaca 840tacgatttag gtgacactat
agaataacat ccactttgcc tttcacatcc actttgcctt 900tctctccaca
ggtgtccact cccaggtcca actgcacctc ggttctatcg attgaattcc
960acgcgtccga gcagcaagag gatggaagga tgaatagaag tagcttcaaa
taggatggag 1020atctcatcag gcttgctgtt cctgggccac ctaatagtgc
tcacctatgg ccaccccacc 1080ctaaaaacac ctgagagtgt gacagggacc
tggaaaggag atgtgaagat tcagtgcatc 1140tatgatcccc tgagaggcta
caggcaagtt ttggtgaaat ggctggtaag acacggctct 1200gactccgtca
ccatcttcct acgtgactcc actggagacc atatccagca ggcaaagtac
1260agaggccgcc tgaaagtgag ccacaaagtt ccaggagatg tgtccctcca
aataaatacc 1320ctgcagatgg atgacaggaa tcactataca tgtgaggtca
cctggcagac tcctgatgga 1380aaccaagtaa taagagataa gatcattgag
ctccgtgttc ggaaatataa tccacctaga 1440atcaatactg aagcacctac
aaccctgcac tcctctttgg aagcaacaac tataatgagt 1500tcaacctctg
acttgaccac taatgggact ggaaaacttg aggagaccat tgctggttca
1560gggggggtca ccgacaagaa aattgtgccc agggattgtg gttgtaagcc
ttgcatatgt 1620acagtcccag aagtatcatc tgtcttcatc ttccccccaa
agcccaagga tgtgctcacc 1680attactctga ctcctaaggt cacgtgtgtt
gtggtagaca tcagcaagga tgatcccgag 1740gtccagttca gctggtttgt
agatgatgtg gaggtgcaca cagctcagac gcaaccccgg 1800gaggagcagt
tcaacagcac tttccgctca gtcagtgaac ttcccatcat gcaccaggac
1860tggctcaatg gcaaggagtt caaatgcagg gtcaacagtg cagctttccc
tgcccccatc 1920gagaaaacca tctccaaaac caaaggcaga ccgaaggctc
cacaggtgta caccattcca 1980cctcccaagg agcagatggc caaggataaa
gtcagtctga cctgcatgat aacagacttc 2040ttccctgaag acattactgt
ggagtggcag tggaatgggc agccagcgga gaactacaag 2100aacactcagc
ccatcatgga cacagatggc tcttacttcg tctacagcaa gctcaatgtg
2160cagaagagca actgggaggc aggaaatact ttcacctgct ctgtgttaca
tgagggcctg 2220cacaaccacc atactgagaa gagcctctcc cactctcctg
gtaaatgagt cgacctgcag 2280aagcttggcc gccatggccc aacttgttta
ttgcagctta taatggttac aaataaagca 2340atagcatcac aaatttcaca
aataaagcat ttttttcact gcattctagt tgtggtttgt 2400ccaaactcat
caatgtatct tatcatgtct ggatcgggaa ttaattcggc gcagcaccat
2460ggcctgaaat aacctctgaa agaggaactt ggttaggtac cttctgaggc
ggaaagaacc 2520agctgtggaa tgtgtgtcag ttagggtgtg gaaagtcccc
aggctcccca gcaggcagaa 2580gtatgcaaag catgcatctc aattagtcag
caaccaggtg tggaaagtcc ccaggctccc 2640cagcaggcag aagtatgcaa
agcatgcatc tcaattagtc agcaaccata gtcccgcccc 2700taactccgcc
catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct
2760gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag
ctattccaga 2820agtagtgagg aggctttttt ggaggcctag gcttttgcaa
aaagctgtta acagcttggc 2880actggccgtc gttttacaac gtcgtgactg
ggaaaaccct ggcgttaccc aacttaatcg 2940ccttgcagca catccccctt
tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg 3000cccttcccaa
cagttgcgca gcctgaatgg cgaatggcgc ctgatgcggt attttctcct
3060tacgcatctg tgcggtattt cacaccgcat acgtcaaagc aaccatagta
cgcgccctgt 3120agcggcgcat taagcgcggc gggtgtggtg gttacgcgca
gcgtgaccgc tacacttgcc 3180agcgccctag cgcccgctcc tttcgctttc
ttcccttcct ttctcgccac gttcgccggc 3240tttccccgtc aagctctaaa
tcgggggctc cctttagggt tccgatttag tgctttacgg 3300cacctcgacc
ccaaaaaact tgatttgggt gatggttcac gtagtgggcc atcgccctga
3360tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg
actcttgttc 3420caaactggaa caacactcaa ccctatctcg ggctattctt
ttgatttata agggattttg 3480ccgatttcgg cctattggtt aaaaaatgag
ctgatttaac aaaaatttaa cgcgaatttt 3540aacaaaatat taacgtttac
aattttatgg tgcactctca gtacaatctg ctctgatgcc 3600gcatagttaa
gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt
3660ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg
catgtgtcag 3720aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg
gcctcgtgat acgcctattt 3780ttataggtta atgtcatgat aataatggtt
tcttagacgt caggtggcac ttttcgggga 3840aatgtgcgcg gaacccctat
ttgtttattt ttctaaatac attcaaatat gtatccgctc 3900atgagacaat
aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt
3960caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc
tgtttttgct 4020cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
agttgggtgc acgagtgggt 4080tacatcgaac tggatctcaa cagcggtaag
atccttgaga gttttcgccc cgaagaacgt 4140tttccaatga tgagcacttt
taaagttctg ctatgtggcg cggtattatc ccgtattgac 4200gccgggcaag
agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac
4260tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt
atgcagtgct 4320gccataacca tgagtgataa cactgcggcc aacttacttc
tgacaacgat cggaggaccg 4380aaggagctaa ccgctttttt gcacaacatg
ggggatcatg taactcgcct tgatcgttgg 4440gaaccggagc tgaatgaagc
cataccaaac gacgagcgtg acaccacgat gcctgtagca 4500atggcaacaa
cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa
4560caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg
ctcggccctt 4620ccggctggct ggtttattgc tgataaatct ggagccggtg
agcgtgggtc tcgcggtatc 4680attgcagcac tggggccaga tggtaagccc
tcccgtatcg tagttatcta cacgacgggg 4740agtcaggcaa ctatggatga
acgaaataga cagatcgctg agataggtgc ctcactgatt 4800aagcattggt
aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt
4860catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat
gaccaaaatc 4920ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
tagaaaagat caaaggatct 4980tcttgagatc ctttttttct gcgcgtaatc
tgctgcttgc aaacaaaaaa accaccgcta 5040ccagcggtgg tttgtttgcc
ggatcaagag ctaccaactc tttttccgaa ggtaactggc 5100ttcagcagag
cgcagatacc aaatactgtt cttctagtgt agccgtagtt aggccaccac
5160ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt
accagtggct 5220gctgccagtg gcgataagtc gtgtcttacc gggttggact
caagacgata gttaccggat 5280aaggcgcagc ggtcgggctg aacggggggt
tcgtgcacac agcccagctt ggagcgaacg 5340acctacaccg aactgagata
cctacagcgt gagctatgag aaagcgccac gcttcccgaa 5400gggagaaagg
cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg
5460gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg
ccacctctga 5520cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
gcctatggaa aaacgccagc 5580aacgcggcct ttttacggtt cctggccttt
tgctggcctt ttgctcacat gttctttcct 5640gcgttatccc ctgattctgt
ggataaccgt attaccgcct ttgagtgagc tgataccgct 5700cgccgcagcc
gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca
5760atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg
gcacgacagg 5820tttcccgact ggaaagcggg cagtgagcgc aacgcaatta
atgtgagtta gctcactcat 5880taggcacccc aggctttaca ctttatgctt
ccggctcgta tgttgtgtgg aattgtgagc 5940ggataacaat ttcacacagg
aaacagctat gacatgatta cgaattaa 59881821DNAArtificial
SequenceSynthetic oligonucleotide probe 18tctctgtctc caagcccaca g
211919DNAArtificial SequenceSynthetic oligonucleotide probe
19ctttgaggag tctttgacc 19201293DNAArtificial
SequencehuCRIg-short-IgG fusion 20acctcggttc tatcgatgct ctcaataaac
caccatgggg atcttactgg gcctgctact 60cctggggcac ctaacagtgg acacttatgg
ccgtcccatc ctggaagtgc cagagagtgt 120aacaggacct tggaaagggg
atgtgaatct tccctgcacc tatgaccccc tgcaaggcta 180cacccaagtc
ttggtgaagt ggctggtaca acgtggctca gaccctgtca ccatctttct
240acgtgactct tctggagacc atatccagca ggcaaagtac cagggccgcc
tgcatgtgag 300ccacaaggtt ccaggagatg tatccctcca attgagcacc
ctggagatgg atgaccggag 360ccactacacg tgtgaagtca cctggcagac
tcctgatggc aaccaagtcg tgagagataa 420gattactgag ctccgtgtcc
agaaacactc ctcaaagcta ctcaagacca agactgaggc 480acctacaacc
atgacatacc ccttgaaagc aacatctaca gtgaagcagt cctgggactg
540gaccactgac atggacaaaa ctcacacatg cccaccgtgc ccagcacctg
aactcctggg 600gggaccgtca gtcttcctct tccccccaaa acccaaggac
accctcatga tctcccggac 660ccctgaggtc acatgcgtgg tggtggacgt
gagccacgaa gaccctgagg tcaagttcaa 720ctggtacgtg gacggcgtgg
aggtgcataa tgccaagaca aagccgcggg aggagcagta 780caacagcacg
taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg
840caaggagtac aagtgcaagg tctccaacaa agccctccca gcccccatcg
agaaaaccat 900ctccaaagcc aaagggcagc cccgagaacc acaggtgtac
accctgcccc catcccggga 960agagatgacc aagaaccagg tcagcctgac
ctgcctggtc aaaggcttct atcccagcga 1020catcgccgtg gagtgggaga
gcaatgggca gccggagaac aactacaaga ccacgcctcc 1080cgtgctggac
tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag
1140gtggcagcag gggaacgtct tctcatgctc cgtgatgcat gaggctctgc
acaaccacta 1200cacgcagaag agcctctccc tgtctccggg taaatgagtg
cgacggccct agagtcgacc 1260tgcagaagct tctagagtcg acctgcagaa gct
1293211556DNAArtificial SequencehuCRIg-long-IgG fusion 21atcgattaaa
ccaccatggg gatcttactg ggcctgctac tcctggggca cctaacagtg 60gacacttatg
gccgtcccat cctggaagtg ccagagagtg taacaggacc ttggaaaggg
120gatgtgaatc ttccctgcac ctatgacccc ctgcaaggct acacccaagt
cttggtgaag 180tggctggtac aacgtggctc agaccctgtc accatctttc
tacgtgactc ttctggagac 240catatccagc aggcaaagta ccagggccgc
ctgcatgtga gccacaaggt tccaggagat 300gtatccctcc aattgagcac
cctggagatg gatgaccgga gccactacac gtgtgaagtc 360acctggcaga
ctcctgatgg caaccaagtc gtgagagata agattactga gctccgtgtc
420cagaaactct ctgtctccaa gcccacagtg acaactggca gcggttatgg
cttcacggtg 480ccccagggaa tgaggattag ccttcaatgc caggctcggg
gttctcctcc catcagttat 540atttggtata agcaacagac taataaccag
gaacccatca aagtagcaac cctaagtacc 600ttactcttca agcctgcggt
gatagccgac tcaggctcct atttctgcac tgccaagggc 660caggttggct
ctgagcagca cagcgacatt gtgaagtttg tggtcaaaga ctcctcaaag
720ctactcaaga ccaagactga ggcacctaca accatgacat accccttgaa
agcaacatct 780acagtgaagc agtcctggga ctggaccact gacatggata
aaactcacac atgcccaccg 840tgcccagcac ctgaactcct ggggggaccg
tcagtcttcc tcttcccccc aaaacccaag 900gacaccctca tgatctcccg
gacccctgag gtcacatgcg tggtggtgga cgtgagccac 960gaagaccctg
aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag
1020acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt
cctcaccgtc 1080ctgcaccagg actggctgaa tggcaaggag tacaagtgca
aggtctccaa caaagccctc 1140ccagccccca tcgagaaaac catctccaaa
gccaaagggc agccccgaga accacaggtg 1200tacaccctgc ccccatcccg
ggaagagatg accaagaacc aggtcagcct gacctgcctg 1260gtcaaaggct
tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag
1320aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt
cctctacagc 1380aagctcaccg tggacaagag caggtggcag caggggaacg
tcttctcatg ctccgtgatg 1440catgaggctc tgcacaacca ctacacgcag
aagagcctct ccctgtctcc gggtaaatga 1500gtgcgacggc cctagagtcg
acctgcagaa gcttctagag tcgacctgca gaagct 15562220DNAArtificial
SequenceSynthetic Oligonucleotide Primer 22ccactggtcc cagagaaagt
202320DNAArtificial SequenceSynthetic Oligonucleotide Primer
23cactattagg tggcccagga 202420DNAArtificial SequenceSynthetic
Oligonucleotide Primer 24gggaggattg ggaagacaat 20
* * * * *