U.S. patent application number 15/302449 was filed with the patent office on 2017-02-02 for production of engineered t-cells by sleeping beauty transposon coupled with methotrexate selection.
The applicant listed for this patent is Seattle Children's Hospital (dba Seattle Children' Research Institute). Invention is credited to Michael C. Jensen, Nataly Kacherovsky, Suzie Pun.
Application Number | 20170029774 15/302449 |
Document ID | / |
Family ID | 54288361 |
Filed Date | 2017-02-02 |
United States Patent
Application |
20170029774 |
Kind Code |
A1 |
Jensen; Michael C. ; et
al. |
February 2, 2017 |
PRODUCTION OF ENGINEERED T-CELLS BY SLEEPING BEAUTY TRANSPOSON
COUPLED WITH METHOTREXATE SELECTION
Abstract
Aspects of the invention described herein include methods of
treating, inhibiting, ameliorating and/or eliminating a virus or
cancer cells in a subject utilizing genetically engineered human
T-cells having receptors for a molecule presented by the virus or
the cancer cells, wherein the genetically engineered T cells are
isolated utilizing a two-stage MTX selection that employs
increasing concentrations of MTX.
Inventors: |
Jensen; Michael C.;
(Bainbridge Island, WA) ; Pun; Suzie; (Seattle,
WA) ; Kacherovsky; Nataly; (Seattle, WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Seattle Children's Hospital (dba Seattle Children' Research
Institute) |
Seattle |
WA |
US |
|
|
Family ID: |
54288361 |
Appl. No.: |
15/302449 |
Filed: |
April 8, 2015 |
PCT Filed: |
April 8, 2015 |
PCT NO: |
PCT/US2015/024868 |
371 Date: |
October 6, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61977751 |
Apr 10, 2014 |
|
|
|
61986479 |
Apr 30, 2014 |
|
|
|
62058973 |
Oct 2, 2014 |
|
|
|
62088363 |
Dec 5, 2014 |
|
|
|
62089730 |
Dec 9, 2014 |
|
|
|
62090845 |
Dec 11, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 35/28 20130101;
C12N 9/12 20130101; A61K 39/3955 20130101; A61P 25/00 20180101;
A61K 2039/505 20130101; C07K 14/71 20130101; C07K 2317/622
20130101; C07K 16/2818 20130101; C07K 2317/53 20130101; A61K
2039/5158 20130101; A61K 2039/572 20130101; C07K 16/32 20130101;
C07K 14/70517 20130101; C07K 2317/526 20130101; A61K 38/1793
20130101; A61P 43/00 20180101; A61K 38/179 20130101; C07K 16/2803
20130101; C07K 14/7051 20130101; A61P 15/00 20180101; A61K 2035/124
20130101; C07K 2317/73 20130101; C07K 14/70578 20130101; C12Y
207/10001 20130101; A61P 1/04 20180101; A61P 31/12 20180101; A61K
2039/5156 20130101; A61P 1/18 20180101; C07K 2317/524 20130101;
C07K 2319/33 20130101; A61P 37/06 20180101; C12N 2510/00 20130101;
A61K 35/17 20130101; A61P 35/02 20180101; C07K 2319/02 20130101;
C07K 14/7151 20130101; C07K 2319/03 20130101; C12N 5/0636 20130101;
A61K 38/1774 20130101; A61P 13/12 20180101; C12N 2800/90 20130101;
C07K 14/70521 20130101; C12N 15/85 20130101; A61P 35/00 20180101;
C07K 2317/14 20130101 |
International
Class: |
C12N 5/0783 20060101
C12N005/0783; C12N 15/85 20060101 C12N015/85 |
Claims
1. A gene delivery polynucleotide for stable insertion of a nucleic
acid into an oligonucleotide, wherein the nucleic acid for
insertion is flanked by inverted terminal repeat gene sequences in
the gene delivery polynucleotide and, wherein the gene delivery
polynucleotide is selectable, the gene delivery polynucleotide
comprising: a first sequence, wherein the first sequence comprises
a first inverted terminal repeat gene sequence; a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence; a third sequence, wherein the third sequence
comprises a promoter region sequence; a fourth sequence, wherein
the fourth sequence comprises at least one gene, wherein the at
least one gene encodes a protein or encodes a sequence for mRNA
transcription, and wherein the fourth sequence is optimized; a
fifth sequence, wherein the fifth sequence comprises at least one
selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used to select
for cells transduced with the gene delivery polynucleotide to
enhance the ratio of cells expressing the at least one gene and
wherein the fifth sequence is optimized; a sixth sequence, wherein
the sixth sequence comprises a first attachment site (attP); and a
seventh sequence, wherein the seventh sequence comprises a second
attachment site (attB); wherein each of the first sequence, second
sequence, third sequence, fourth sequence, fifth sequence, sixth
sequence, and seventh sequence have a 5' terminus and a 3'
terminus, and wherein the 3' terminus of the first sequence
comprising the first inverted terminal repeat gene sequence is
adjacent to the 5' terminus of the third sequence, the 3' terminus
of the third sequence is adjacent to the 5' terminus of the fourth
sequence, the 3' terminus of the fourth sequence is adjacent to the
5' terminus of the fifth sequence and the 3' terminus of the fifth
sequence is adjacent to the 5' terminus of the second sequence
comprising a second inverted terminal repeat.
2.-64. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of priority to
U.S. Provisional Patent Application No. 62/058,973, filed Oct. 2,
2014, U.S. Provisional Patent Application No. 61/977,751, filed
Apr. 10, 2014, U.S. Provisional Patent Application No. 61/986,479,
filed Apr. 30, 2014, U.S. Provisional Patent Application No.
62/089,730 filed Dec. 9, 2014, U.S. Provisional Patent Application
No. 62/090,845, filed Dec. 11, 2014, and U.S. Provisional Patent
Application No. 62/088,363, filed Dec. 5, 2014. The entire
disclosures of the aforementioned applications are hereby expressly
incorporated by reference in their entireties.
REFERENCE TO SEQUENCE LISTING, TABLE, OR COMPUTER PROGRAM
LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled SCRI.077PR.TXT, created Mar. 20, 2015, which is 4 kb
in size. The information is the electronic format of the Sequence
Listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] Aspects of the invention described herein include methods of
treating, inhibiting, ameliorating and/or eliminating a virus or
cancer cells in a subject utilizing genetically engineered human
T-cells having receptors for a molecule presented by the virus or
the cancer cells.
BACKGROUND OF THE INVENTION
[0004] Engineered human T-cells are a promising therapeutic route
for cancer immunotherapy and viral therapy. T-cells expressing
chimeric antigen receptors combined with additional genes to
enhance T-cell proliferation, survival, or tumor homing can further
improve efficacy but require multiple stable gene transfer events.
Accordingly, methods are needed to increase production efficiency
for multiplexed engineered cells. Efficient, stable transduction of
T-cells can be achieved using a Sleeping Beauty transposon system
in minicircles that are introduced by nucleofection. Rapid
selection of transduced cells with methotrexate (MTX) for cells
expressing a mutant dihydrofolate reductase (DHFRdm) resistant to
metabolic inhibition can also be achieved.
SUMMARY OF THE INVENTION
[0005] Described herein are approaches for the preferential
amplification of T cells expressing multiple transgenes, preferably
encoding receptors or chimeric receptors specific for a molecule
presented by a virus or a cancer cell. In some alternatives,
selection pressure on transformed T cells is applied in a two-stage
MTX selection utilizing increasing concentrations of MTX.
[0006] In one alternative, a gene delivery polynucleotide for
stable insertion of a nucleic acid into an oligonucleotide is
provided, wherein the nucleic acid for insertion is flanked by
inverted terminal repeat gene sequences in the gene delivery
polynucleotide and wherein the gene delivery polynucleotide is
selectable is provided, wherein the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encodes a protein
or encodes a sequence for mRNA transcription, and wherein the
fourth sequence is optimized, a fifth sequence, wherein the fifth
sequence comprises at least one selectable marker cassette encoding
a double mutant of dihydrofolate reductase, wherein the double
mutant of dihydrofolate reductase has a 15,000 fold or about 15,000
fold reduced affinity for methotrexate, wherein the methotrexate
can be used to select for cells transduced with the gene delivery
polynucleotide to enhance the ratio of cells expressing the at
least one gene and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized for expression in humans and/or to reduce the total GC/AT
ratio of the fifth sequence. In preferred alternatives, the fifth
sequence is optimized by codon optimization for expression in
humans. In some alternatives, the protein is a protein for therapy.
In some alternatives, the codon optimization and/or a consensus
sequence is generated by comparing the variability of sequence
and/or nucleobases utilized in a plurality of related sequences. In
some alternatives, the protein comprises an antibody or a portion
thereof, which may be humanized. In some alternatives, the double
mutant of dihydrofolate reductase comprises amino acid mutations of
L22F and F31S. In some alternatives, the T cells are precursor T
cells. In some alternatives, the precursor T cells are
hematopoietic stem cells.
[0007] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided,
wherein the method comprises providing a gene delivery
polynucleotide, introducing the gene delivery polynucleotide into a
T-cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the T cells are precursor T cells.
In some alternatives, the precursor T cells are hematopoietic stem
cells.
[0008] In some alternatives, a method of increasing protein
production in a T-cell is provided, wherein the method comprises
providing a polynucleotide of, introducing the polynucleotide into
a cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, 150 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the T cells are precursor T cells.
In some alternatives, the precursor T cells are hematopoietic stem
cells.
[0009] In some alternatives, an engineered multiplexed T-cell for
adoptive T-cell immunotherapy generated by any one of the methods
of is provided. In some alternatives, the engineered multiplexed
T-cells for adoptive T-cell immunotherapy is generated by a method,
wherein the method comprises providing a gene delivery
polynucleotide, introducing the gene delivery polynucleotide into a
T-cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the T cells are precursor T cells.
In some alternatives, the precursor T cells are hematopoietic stem
cells.
[0010] In some alternatives, a method of treating, inhibiting, or
ameliorating cancer or a disease in a subject is provided, wherein
the method comprises administering to the subject the modified or
engineered multiplexed T-cell generated as described below. In some
alternatives, the engineered multiplexed T-cells for adoptive
T-cell immunotherapy is generated by a method, wherein the method
comprises providing a gene delivery polynucleotide, introducing the
gene delivery polynucleotide into a T-cell, providing a vector
encoding a Sleeping Beauty transposase, introducing the vector
encoding the Sleeping Beauty transposase into the T-cell, selecting
the cells comprising the gene delivery polynucleotide wherein
selecting comprises a first round of selection and a second round
of selection, wherein the first round of selection comprises adding
a selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, wherein the second concentration range
is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the T-cells expressing
a phenotype under selective pressure. In some alternatives, the
gene delivery polynucleotide comprises a first sequence, wherein
the first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene encoding a protein, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used as a
selection mechanism to selectively amplify cells transduced with
the gene delivery polynucleotide and wherein the fifth sequence is
optimized, a sixth sequence, wherein the sixth sequence comprises a
first attachment site (attP) and a seventh sequence, wherein the
seventh sequence comprises a second attachment site (attB) wherein
each of the first sequence, second sequence, third sequence, fourth
sequence, fifth sequence, sixth sequence, and seventh sequence have
a 5' terminus and a 3' terminus, and wherein the 3' terminus of the
first sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is a minicircle. In some
alternatives, the gene delivery polynucleotide is at least 1 kB to
5 kB. In some alternatives, the promoter region comprises an EF1
promoter sequence. In some alternatives, the fourth sequence
comprises one, two, three, four, or five genes that encode
proteins. In some alternatives, the fourth sequence is codon
optimized to reduce the total GC/AT ratio of the fourth sequence.
In some alternatives, the fourth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
fourth sequence is a consensus sequence generated from a plurality
of nucleic acids that encode a plurality of related proteins. In
some alternatives, the fourth sequence is a consensus sequence
generated from a plurality of nucleic acids that encode a plurality
of related proteins, such as a plurality of antibody binding
domains, which are specific for the same epitope. In some
alternatives, the plurality of related proteins comprise a
plurality of antibody binding domains, wherein the plurality of
antibody binding domains are specific for the same epitope. In some
alternatives, the fifth sequence is codon optimized to reduce the
total GC/AT ratio of the fifth sequence. In some alternatives, the
fifth sequence is optimized by codon optimization for expression in
humans. In some alternatives, the protein is a protein for therapy.
In some alternatives, the codon optimization and/or consensus
sequence is generated by comparing the variability of sequence
and/or nucleobases utilized in a plurality of related sequences. In
some alternatives, the protein comprises an antibody or a portion
thereof, which may be humanized. In some alternatives, the double
mutant of dihydrofolate reductase comprises amino acid mutations of
L22F and F31S. In some alternatives, the double mutant of
dihydrofolate reductase comprises amino acid mutations of L22F and
F31S. In some alternatives, the T cells are precursor T cells. In
some alternatives, the precursor T cells are hematopoietic stem
cells. In some alternatives, the introducing is performed by
electroporation. In some alternatives, the selecting is performed
by increasing selective pressure through the selective marker
cassette. In some alternatives, the selection reagent comprises an
agent for selection. In some alternatives, the agent for selection
is methotrexate. In some alternatives, the first concentration
range is at least 50 nM-100 nM and the second concentration range
is at least 75 to 150 nM. In some alternatives, the first
concentration is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or
any concentration that is between a range of concentrations defined
by any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the subject is human.
[0011] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided,
wherein the method comprises providing a gene delivery
polynucleotide, introducing the gene delivery polynucleotide into a
T-cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the T cells comprise precursor T
cells. In some alternatives, the precursor T cells are
hematopoietic stem cells.
[0012] In some alternatives, a method of generating engineered
cells for adoptive T-cell immunotherapy comprising, providing a
gene delivery polynucleotide, introducing the gene delivery
polynucleotide into a precursor T cell, providing a vector encoding
a Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the precursor T cell, selecting
the precursor T cells comprising the gene delivery polynucleotide;
wherein selecting comprises a first round of selection and a second
round of selection, wherein the first round of selection comprises
adding a selection reagent at a first concentration range and the
second round of selection comprises adding the selection reagent at
a second concentration range, wherein the second concentration
range is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the precursor T-cells
expressing a phenotype under selective pressure. In some
alternatives, the gene delivery polynucleotide is for stable
insertion of a nucleic acid into an oligonucleotide wherein the
nucleic acid for insertion is flanked by inverted terminal repeat
gene sequences in the gene delivery polynucleotide and wherein the
gene delivery polynucleotide is selectable, wherein the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene, wherein the at least one gene encodes a protein or encodes a
sequence for mRNA transcription, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used to select
for cells transduced with the gene delivery polynucleotide, to
enhance the ratio of cells expressing the at least one gene and
wherein the fifth sequence is optimized, a sixth sequence, wherein
the sixth sequence comprises a first attachment site (attP) and a
seventh sequence, wherein the seventh sequence comprises a second
attachment site (attB); wherein each of the first sequence, second
sequence, third sequence, fourth sequence, fifth sequence, sixth
sequence, and seventh sequence have a 5' terminus and a 3'
terminus, and wherein the 3' terminus of the first sequence
comprising the first inverted terminal repeat gene sequence is
adjacent to the 5' terminus of the third sequence, the 3' terminus
of the third sequence is adjacent to the 5' terminus of the fourth
sequence, the 3' terminus of the fourth sequence is adjacent to the
5' terminus of the fifth sequence and the 3' terminus of the fifth
sequence is adjacent to the 5' terminus of the second sequence
comprising a second inverted terminal repeat. In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
codon optimization and/or consensus sequence is generated by
comparing the variability of sequence and/or nucleobases utilized
in a plurality of related sequences. In some alternatives, the
protein is a protein for therapy. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the introducing is performed by electroporation.
In some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
range is at least 75 nM-150 nM and the second concentration range
is at least 112.5 nM to 225 nM. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the first
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first round of selection comprises exposing the
T-cells to the selection agent for 2, 3, 4, 5, 6 or 7 days before
the second round of selection. In some alternatives, the second
round of selection comprises exposing the T-cells to the selection
agent for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14
days or any time that is between a range of times defined by any
two of the aforementioned time points before isolation. In some
alternatives, the T cell precursor is a hematopoietic stem
cell.
[0013] In some alternatives, a method of increasing protein
production in a precursor T-cell is provided wherein the method
comprises providing a polynucleotide, introducing the
polynucleotide into a cell, providing a vector encoding a Sleeping
Beauty transposase; introducing the vector encoding the Sleeping
Beauty transposase into the precursor T-cell, selecting the
precursor T cells comprising the gene delivery polynucleotide,
wherein selecting comprises a first round of selection and a second
round of selection, wherein the first round of selection comprises
adding a selection reagent at a first concentration range and the
second round of selection comprises adding the selection reagent at
a second concentration range, wherein the second concentration
range is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the precursor T cells
expressing a phenotype under selective pressure. In some
alternatives, the gene delivery polynucleotide is for stable
insertion of a nucleic acid into an oligonucleotide wherein the
nucleic acid for insertion is flanked by inverted terminal repeat
gene sequences in the gene delivery polynucleotide and wherein the
gene delivery polynucleotide is selectable, wherein the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene, wherein the at least one gene encodes a protein or encodes a
sequence for mRNA transcription, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used to select
for cells transduced with the gene delivery polynucleotide, to
enhance the ratio of cells expressing the at least one gene and
wherein the fifth sequence is optimized, a sixth sequence, wherein
the sixth sequence comprises a first attachment site (attP) and a
seventh sequence, wherein the seventh sequence comprises a second
attachment site (attB); wherein each of the first sequence, second
sequence, third sequence, fourth sequence, fifth sequence, sixth
sequence, and seventh sequence have a 5' terminus and a 3'
terminus, and wherein the 3' terminus of the first sequence
comprising the first inverted terminal repeat gene sequence is
adjacent to the 5' terminus of the third sequence, the 3' terminus
of the third sequence is adjacent to the 5' terminus of the fourth
sequence, the 3' terminus of the fourth sequence is adjacent to the
5' terminus of the fifth sequence and the 3' terminus of the fifth
sequence is adjacent to the 5' terminus of the second sequence
comprising a second inverted terminal repeat. In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
codon optimization and/or consensus sequence is generated by
comparing the variability of sequence and/or nucleobases utilized
in a plurality of related sequences. In some alternatives, the
protein is a protein for therapy. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the introducing is performed by electroporation.
In some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate.
[0014] In some alternatives, wherein the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
range is at least 75 nM-150 nM and the second concentration range
is at least 112.5 nM to 225 nM. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the second
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first round of selection comprises exposing the
cells to the selection agent for 2, 3, 4, 5, 6 or 7 days before the
second round of selection. In some alternatives, the second round
of selection comprises exposing the cells to the selection agent
for at least 2, 3, 4, 5, 6, or 7 days before isolation. In some
alternatives, the precursor T cells are hematopoietic stem
cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 shows an overall schematic of the gene delivery
minicircle producer plasmid, MC_T3/FP-DHFRdm. The minicircle with
T3 generation of Sleeping Beauty transposon comprises an EF1a
promoter, a fusion of fluorescent protein (FP; maxGFP, mCherry, or
Blue Fluorescent protein (BFP)), Thosea asigna virus 2A peptide
(T2A), and double mutant of dihydrofolate reductase (DHFRdm)
insensitive to methotrexate (MTX), positioned between inverted
terminal repeats (ITRs, arrows). Recombination at attB/attP sites
generates a minicircle while the remaining bacterial backbone is
enzymatically degraded.
[0016] FIG. 2 shows a series of bar graphs that demonstrate the
optimization of the transposon:transposase DNA ratio. H9 cells were
nucleofected with 2 .mu.g of MC_T3/eGFP-T2A-DHFRdm DNA (transposon)
and increasing amounts of MC_SB100X (transposase) DNA (0.5, 1, 2,
4, 8 ug). Flow cytometry was performed at 24 hours (striped bars)
and at 7 days (black bars) after nucleofection to assess transient
and stable transfection efficiency. Numbers above the bars indicate
integration efficiency, which is calculated as percent of stable
over transient GFP expression.
[0017] FIG. 3 shows a series of bar graphs, which demonstrate the
effect of MTX concentration during the selection process. Flow
cytometric analysis of H9 cell populations stably transfected with
T3/GFP-T2A-DHFRdm transposon DNA grown in the presence of
increasing concentrations of MTX (0, 50, 100, and 200 nM) at 3 days
(white bars), 5 days (horizontal stripes), 7 days (vertical
stripes), and 10 days (black bars) was performed. Panel A of FIG. 3
shows the percent GFP+/PI- and Panel B of FIG. 3 shows the mean GFP
relative fluorescence units (RFU).
[0018] FIG. 4 shows a series of bar graphs that demonstrate the
transgene persistence after MTX withdrawal. As shown is the flow
cytometric analysis of H9 cell populations that were stably
transfected with T3/GFP-T2A-DHFRdm transposon grown in media
supplemented with different concentrations of MTX (50, 100, and 200
nM) for 2 weeks (black bars), after which MTX selection was
withdrawn and data collected at different time points afterwards: 1
week (horizontal stripes), 2 weeks (vertical stripes), 3 weeks
(checked bars), and 4 weeks (white bars). Panel A of FIG. 4 shows
the percent GFP+/PI-; Panel B of FIG. 4 shows the mean GFP relative
fluorescence units (RFU).
[0019] FIG. 5A shows the transposon copy number per human haploid
genome. Genomic DNA was isolated from populations of H9 cells
stably transfected with T3/GFP-T2A-DHFRdm transposon DNA before and
after selection with different concentrations of MTX (50, 100, and
200 nM). The average transposon copy number was determined by
quantitative PCR. The "Gold standard" was generated by the limiting
dilution method. The "Sorted" population was created by sorting the
original H9 population (8% of integrated transposon) to 100% GFP
positive cells. The asterisk (*) above the bracketed bar graphs
indicates the difference between 200 nM MTX and sorted population
was significantly different according to a Student's T-test
(P=0.04).
[0020] FIG. 5B shows the distribution of transposon integration
events. Sixty clones were isolated by limited dilution method from
an H9 population that was previously selected with 200 nM MTX to
100% cells with integrated T3/GFP-T2A-DHFRdm transposon. Genomic
DNA was isolated and transposon copy number determined by relative
RT-qPCR. Numbers were rounded to the nearest integer value (e.g.,
0.5-1.5 was rounded to 1). N=60; mean.+-.standard
deviation=1.78.+-.0.69. Probabilities of integration events and
standard error were calculated from these data (inset table).
[0021] FIG. 6 shows a series of pie graphs representing the
analysis of the multiplexing of transposons. As shown in Panels A-C
are the flow cytometric analysis of H9 cell populations
nucleofected with 3 minicircles carrying transposons with different
fluorescent proteins (FPs) (MC_T3/GFP-T2A-DHFRdm,
MC_T3/BFP-T2A-DHFRdm, MC_T3/mCherry-T2A-DHFRdm), 2 .mu.g each and 6
.mu.g of MC_SB100X DNA at different time points: (Panel A) 24 hours
after transfection (transient expression), (Panel B) 1 week (stable
integration), and (Panel C) 1 week of selection with 200 nM of
MTX.
[0022] FIG. 7 shows the bar graph analysis of step selection of the
distribution of expression of single, double, and triple FPs. H9
cell population stably transfected with three transposons was
selected with 200 nM MTX for a week and then was exposed to higher
MTX concentrations of 500 and 1000 nM.
[0023] FIG. 8 shows an example of the flow analysis for the stable
expression of transposon DNA with Sleeping Beauty in lymphocytes
after MTX selection. Freshly thawed PBMC cells were electroporated
with minicircle GFP (mcGFP) DNA (MC_T3/GFP-T2A-DHFRdm) and Sleeping
Beauty transposase DNA (MC_SB100X), then stimulated with Miltenyi
Transact beads which selectively activate T-cells by binding to CD3
and CD28. 1 week after electroporation, samples of the PBMC cells
were selected using 25, 50 and 100 nM MTX for 12 days (50 nM shown
here). Panels A, B, and C show the sequential selection for
lymphocytes (A), single cells (B), and live cells (C). Shown in
Panel D are the high levels of GFP expression in both the CD8+ and
CD8- populations. Note that for this donor, the majority of
lymphocytes after stimulation are CD8+ T cells.
[0024] FIG. 9 shows histograms of the initial expression of
transposon DNA with Sleeping Beauty in lymphocytes. PBMC were
transfected with either mcGFP DNA alone (10 ug), mcGFP (10 ug) and
MC_SB100X DNA (5 ug) at a mcGFP:MC_SB100X ratio of 2:1, mcGFP (10
ug) and MC_SB100X DNA (10 ug) at a mcGFP:MC_SB100X ratio of 1:1, a
pMAXGFP (10 ug) control, or a no DNA control. Shown in Panel A are
the results for cells in which Transact beads were not added, two
days after transfection as an example of the initial
electroporation efficiency. Shown in Panel B are the results in
cells exposed to transact beads after five days. While by day 5 the
levels of mcGFP DNA decline to near control levels, the expression
of mcGFP in cells co-transfected with transposase remain
elevated.
[0025] FIG. 10 shows the expression of GFP transposon DNA and the
levels of cell growth in transfected lymphocytes in the week before
MTX addition. PBMC were transfected with either mcGFP DNA alone,
mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of 2:1, mcGFP
and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of 1:1, a pMAXGFP
control (10 ug), or a no DNA control. Panel A shows the decreasing
levels of GFP expression from day 2 to day 7. Panel B shows the
level of live cells from day 0 to day 7 of the transfected cell
samples which had been treated with Miltenyi Transact beads on d0.
Panel C shows the level of live cells from day 0 to day 7 of the
transfected cell samples in the absence of Transact beads. As
shown, there is a slow growth of the cells transfected with mcGFP
DNA in the presence of Miltenyi Transact beads.
[0026] FIG. 11 shows the stable expression of transposon DNA with
Sleeping Beauty in T-cells following 1 week of MTX selection. Shown
are the flow cytometry scattergrams in which GFP production and
proliferation of T-cells modified to express GFP after transfection
with transposon DNA and Sleeping Beauty transposase DNA were
investigated. Panels A, B, E, and F show the scatter profiles to
identify lymphocytes, while Panels C, D, G, and H show CD8 and GFP
expression. Panels A-D show the flow cytometry analysis of cells
treated with 100 nM MTX. Panels E-H shows the flow cytometry
analysis of cells that were not treated with MTX. Shown in Panels
A, C, E and G, are samples transfected with mcGFP alone. Panels B,
D, F and H show the flow cytometry results of cells transfected
with mcGFP and MC_SB100X (Sleeping Beauty transposase) DNA at 2:1.
As demonstrated in Panel D, in T-cells (both CD8+ and CD8-)
co-transfected with mcGFP and SB100X such that the GFP gene is
stably inserted into the cellular genome, about 95% of the cells
stably express GFP in the presence of MTX at 100 nM while only
about 23% express GFP in the absence of MTX.
[0027] FIG. 12 shows the proliferation and the GFP/CD8 expression
in transposon-transfected lymphocytes after 14 days of MTX
selection. Cell samples were transfected with no DNA (control),
mcGFP alone, mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of
2:1 ratio, or mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of
1:1. After 1 week, the cells were selected using 0 nM MTX
(control), 25 nM MTX, 50 nM MTX, or 100 nM MTX. The lymphocyte
window, shown in the first, third, fifth and seventh columns,
demonstrates the survival of only stably transfected cells in the
presence of higher concentrations of MTX. The live, single
lymphocytes were gated for GFP and CD8 detection in the second,
fourth, sixth and eighth columns. For the cell samples transfected
with mcGFP alone, GFP expression is lost over time (second column).
However cells transfected with both mcGFP and MC_SB100X stably
express GFP both with MTX selection (>90%) and without MTX
selection (.about.20%) (columns four and six). As shown in the
samples transfected with mcGFP and MC_SB100X DNA, MTX was effective
for selection at concentrations of 50 and 100 nM MTX and no
significant difference was seen between the ratios 2:1 or 1:1. Note
that the majority of lymphocytes are CD8+ T-cells.
[0028] FIG. 13 shows both the lymphocyte window and GFP/CD8
expression in transposon-transfected cells after 19 days of MTX
selection. Cell samples were transfected with no DNA (control),
mcGFP alone, mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of
2:1 ratio, or mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of
1:1. The cells were selected using 0 nM MTX (control), 25 nM MTX,
50 nM MTX, or 100 nM MTX. The lymphocyte window is shown in the
first, third, fifth and seventh columns, showing the survival of
only stably transfected cells in the presence of MTX. The live,
single lymphocytes were gated for GFP and CD8 detection in the
second, fourth, sixth and eighth columns. For the cell samples
transfected with mcGFP alone, GFP expression is lost over time
(second column). However cells transfected with both mcGFP and
MC_SB100X stably express GFP both with MTX selection (>90%) and
without MTX selection (.about.20%) (columns four and six). As shown
in the samples transfected with mcGFP and MC_SB100X DNA, MTX was
effective for selection at concentrations of 50 and 100 nM MTX, and
slightly less for 25 nM. The mcGFP:SB ratios 2:1 or 1:1 were
similarly effective.
[0029] FIG. 14 shows the live cell counts of cells that stably
express transposon DNA and undergoes MTX selection. Trypan blue
cell counts were taken at 7, 14, and 19 days post transfection.
PBMC samples were transfected with no DNA (control), mcGFP alone,
mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of 2:1 ratio, or
mcGFP and MC_SB100X DNA at a mcGFP:MC_SB100X ratio of 1:1. The
cells were selected on day 7 using 0 nM MTX (control), 25 nM MTX,
50 nM MTX, or 100 nM MTX. Panel A, shows the level of live cells in
the absence of MTX. Panel B shows the levels of live cells after
exposure to 100 nM MTX. Panel C shows the levels of live cells
after exposure to 50 nM. Panel D shows the levels of live cells
after exposure to 25 nM MTX. As MTX slows the growth of cells by
inhibiting the metabolism of folic acid, only cells that were
transfected with both the mcGFP transposon co-expressing the
MTX-resistance gene (DHFRdm) and the MC_SB100X plasmid encoding the
Sleeping Beauty Transposase were able to proliferate in the
presence of high MTX, due to stable expression of the integrated
transposon DNA.
[0030] FIG. 15 shows an analysis of GFP expression by lymphocytes
stably expressing GFP transposon DNA with Sleeping Beauty
transposase under MTX selection. PBMC samples were transfected with
mcGFP alone, mcGFP and MC_SB100X at a mcGFP:MC_SB100X ratio of 2:1,
mcGFP and MC_SB100X at a mcGFP:MC_SB100X ratio of 1:1, pMAXGFP (10
ug), and no DNA (control). Cells were exposed to MTX on day 7 after
transfection, and GFP expression was measured for live, single
lymphocytes. Panel A shows the level of GFP expression on days 2,
5, 7, 14, and 19 in the absence of MTX. Panel B shows the level of
GFP expression from days 7, 14, and 19 of lymphocytes transfected
with mcGFP alone under MTX selection at MTX concentrations of 0 nM,
25 nM, 50 nM and 100 nM. Panel C shows the GFP expression of
T-cells transfected with mcGFP and MC_SB100X at a mcGFP:MC_SB100X
ratio of 2:1 under MTX selection of 0 nM, 25 nM, 50 nM and 100 nM.
Panel D shows the GFP expression of T-cells transfected with mcGFP
and MC_SB100X at a mcGFP:MC_SB100X ratio of 1:1 under control of
MTX selection concentrations of 0 nM, 25 nM, 50 nM and 100 nM. As
shown, the results from transfecting with mcGFP and MC_SB100X with
a 2:1 and a 1:1 ratio were similar, with approximately 75% GFP
expression at 25 nM and approximately 90% GFP expression at 50 and
100 nM after 1 week of MTX. Additionally, there was minimal
difference in the GFP expression between the treatment with 50 nM
MTX and 100 nM MTX.
[0031] FIG. 16: Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
[0032] FIG. 17: As shown are several scattergrams of cells
transfected with Sleeping Beauty transposons carrying a gene for
expression of GFP. As shown are the cells fourteen days after
transfection. Cells were electroporated with SB100X or transposons
carrying genes for GFP.
[0033] FIG. 18. Sleeping Beauty Transposons and MTX: GFP
transposon. As shown, cells were transfected with different ratios
of mcGFP plasmids and the Sleeping Beauty transposon carrying a
gene for expression of GFP (McGFP: SB at a 1:1 and 2:1 ratio). As
shown, GFP expression was low with no MTX was added after 18 days.
With the Sleeping Beauty transposon, it is shown that there is an
increase in GFP expression in the presence of MTX.
[0034] FIG. 19. Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
[0035] FIG. 20. Sleeping Beauty Transposons and MTX:GFP
transposon--SB100X DNA and RNA. Cells were electroporated with
SB100X (DNA or RNA) or transposons carrying genes for GFP, CARs, or
GFP/mCherry/BFP.
[0036] FIG. 21. Sleeping Beauty Transposons and MTX: GFP
transposon--SB100X DNA and RNA. As shown in the figure are several
scattergrams of the cells that are transfected with GFP gene
carrying transposons. Several samples of cells are transfected with
DNA comprising a gene for GFP expression (2.5 ug and 5 ug), mcGFP
only, and RNA (1 ug and 3 ug). The samples are split and grown
under the influence of varying concentrations of MTX at 0 uM, 50 uM
and 100 uM.
[0037] FIG. 22. Sleeping Beauty Transposons and MTX: GFP
transposon--SB100X DNA and RNA. Cells were transfected with
Sleeping Beauty transposons carrying a gene for GFP expression at
different concentrations as seen in the top left panel. MTX was
then added at day 7 after transfection. As shown, cells transfected
with 50 ug to 100 ug can express GFP after day 7 to day 14.
[0038] FIG. 23. GFP expressing DNA and RNA in the presence of MTX.
As shown cells transfected with mcGFP, GFP: SB, and GFP:SB RNA were
grown and exposed to MTX seven days after transfection. As a
control, cells were grown to fourteen days without exposure to MTX
(top left panel).
[0039] FIG. 24. Expression of GFP in cells transfected with GFP:
SB. As shown in the left panel, cells were transfected with varying
concentrations of GFP: SB (2.5 ug, 5 ug) and exposed to different
concentrations of MTX (50 uM and 100 uM). As shown, cells were able
to express GFP in the presence of MTX optimally at 50 uM MTX when
they were transfected with 5 ug of GFP: SB. This experiment was
also performed using RNA, however, DNA has a higher efficiency for
leading to expression of the protein.
[0040] FIG. 25. Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
[0041] FIG. 26. Expression of CD19CAR. A Sleeping Beauty construct
carrying a gene for CD19CAR was constructed (SB: CD19CAR). Cells
were transfected with either DNA (2.5 ug or 5 ug), or RNA (1 ug or
3 ug). As shown, cells that were transfected with DNA or RNA at
both concentrations were able to express the CD19CAR in the
presence of 50 uM MTX. This was also shown for cells that were
transfected with the RNA at 1 ug in the presence of 100 uM MTX.
[0042] FIG. 27. Expression of CD19CAR. A Sleeping Beauty construct
carrying a gene for CD19CAR was constructed (SB: CD19CAR). Cells
were transfected with either DNA (2.5 ug or 5 ug), or RNA (1 ug or
3 ug). Cells were grown and at day seven after transfection, were
exposed to MTX. The CD19CAR also included an EGFRt tag. As shown,
detection of the tag correlates to the expression of the CD19CAR.
After exposure to MTX, detection of the tag was seen in cells that
were transfected with the DNA carrying the Sleeping Beauty
construct carrying a gene for CAR19 as well as the cells
transfected with the RNA carrying the Sleeping Beauty construct
carrying a gene for CAR19.
[0043] FIG. 28. Sleeping Beauty Transposons and MTX: CD19 CAR: CD8+
cell growth. Expression of CD19CAR. A Sleeping Beauty construct
carrying a gene for CD19CAR was constructed (SB: CD19CAR). Cells
were transfected with either DNA (2.5 ug or 5 ug), or RNA (1 ug or
3 ug). Cells were grown and at day seven after transfection, were
exposed to MTX. As shown, the CD8+ cells were able to grow when a
lower concentration of DNA was transfected. However, with RNA, it
was seen that a higher concentration led to better expression, but
a lower concentration led to better initial growth of the
cells.
[0044] FIG. 29. Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
[0045] FIG. 30. Sleeping Beauty Transposons and MTX: Multiplex 3
FP's. Cells were electroporated with DNA or mcFP and grown in the
presence of MTX. Afterwards, cells were analyzed for expression of
mCherry, BFP, and/or GFP as indicated by the scattergrams.
[0046] FIG. 31. Sleeping Beauty Transposons and MTX: Multiplex 3
FP's.
[0047] FIG. 32. Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
[0048] FIG. 33. As shown, cells electroporated with DNA comprising
Sleeping Beauty transposons were subjected to different
concentrations of MTX at the second round of selection.
[0049] FIG. 34. Expression of Smarker proteins in cells
electroporated with DNA comprising Sleeping Beauty transposons in
the presence of different concentrations of MTX (2, 100 nM, 250 nM,
and 500 nM).
[0050] FIG. 35. Sleeping Beauty Transposons: minicircle constructs.
As shown in the figure are the schematics of several sleeping
beauty constructs designed for several alternatives described
herein.
DETAILED DESCRIPTION
[0051] The following definitions are provided to facilitate
understanding of the embodiments or alternatives of the
invention.
[0052] As used herein, "a" or "an" can mean one or more than
one.
[0053] As used herein, the term "about" indicates that a value
includes the inherent variation of error for the method being
employed to determine a value, or the variation that exists among
experiments.
[0054] As used herein, "nucleic acid" or "nucleic acid molecule"
refers to polynucleotides, such as deoxyribonucleic acid (DNA) or
ribonucleic acid (RNA), oligonucleotides, fragments generated by
the polymerase chain reaction (PCR), and fragments generated by any
of ligation, scission, endonuclease action, and exonuclease action.
Nucleic acid molecules can be composed of monomers that are
naturally-occurring nucleotides (such as DNA and RNA), or analogs
of naturally-occurring nucleotides (e.g., enantiomeric forms of
naturally-occurring nucleotides), or a combination of both.
Modified nucleotides can have alterations in sugar moieties and/or
in pyrimidine or purine base moieties. Sugar modifications include,
for example, replacement of one or more hydroxyl groups with
halogens, alkyl groups, amines, and azido groups, or sugars can be
functionalized as ethers or esters. Moreover, the entire sugar
moiety can be replaced with sterically and electronically similar
structures, such as aza-sugars and carbocyclic sugar analogs.
Examples of modifications in a base moiety include alkylated
purines and pyrimidines, acylated purines or pyrimidines, or other
well-known heterocyclic substitutes. Nucleic acid monomers can be
linked by phosphodiester bonds or analogs of such linkages. Analogs
of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the
like. The term "nucleic acid molecule" also includes so-called
"peptide nucleic acids," which comprise naturally-occurring or
modified nucleic acid bases attached to a polyamide backbone.
Nucleic acids can be either single stranded or double stranded. In
some alternatives described herein, a gene delivery polynucleotide
for stable insertion of a nucleic acid into a gene is provided.
"Oligonucleotide" can be used interchangeable with nucleic acid and
can refer to DNA or RNA, either double stranded or a single
stranded piece or DNA or RNA.
[0055] A "gene" is the molecular unit of heredity of a living
organism, describing some stretches of deoxyribonucleic acids (DNA)
and ribonucleic acids (RNA) that code for a polypeptide or for an
RNA chain that has a function in the organism, and can be a
locatable region in the genome of an organism. In some alternatives
described herein, a gene delivery polynucleotide for stable
insertion of a nucleic acid into a gene, wherein the nucleic acid
for insertion is flanked by inverted terminal repeat gene sequences
in the gene delivery polynucleotide and wherein the gene delivery
polynucleotide is selectable, is provided.
[0056] A "chromosome," is a packaged and organized chromatin, a
complex of macromolecules found in cells, consisting of DNA,
protein and RNA. In some alternatives, a gene delivery
polynucleotide for stable insertion of a nucleic acid into a gene,
wherein the nucleic acid for insertion is flanked by inverted
terminal repeat gene sequences in the gene delivery polynucleotide
and wherein the gene delivery polynucleotide is selectable, the
gene delivery polynucleotide, is provided. In some alternatives,
the nucleic acid is inserted into a gene of a chromosome.
[0057] A "promoter" is a nucleotide sequence that directs the
transcription of a structural gene. In some alternatives, a
promoter is located in the 5' non-coding region of a gene, proximal
to the transcriptional start site of a structural gene. Sequence
elements within promoters that function in the initiation of
transcription are often characterized by consensus nucleotide
sequences. These promoter elements include RNA polymerase binding
sites, TATA sequences, CAAT sequences, differentiation-specific
elements (DSEs; McGehee et al., Mol. Endocrinol. 7:551 (1993);
incorporated by reference in its entirety), cyclic AMP response
elements (CREs), serum response elements (SREs; Treisman, Seminars
in Cancer Biol. 1:47 (1990); incorporated by reference in its
entirety), glucocorticoid response elements (GREs), and binding
sites for other transcription factors, such as CRE/ATF (O'Reilly et
al., J. Biol. Chem. 267:19938 (1992); incorporated by reference in
its entirety), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994);
incorporated by reference in its entirety), SP1, cAMP response
element binding protein (CREB; Loeken, Gene Expr. 3:253 (1993);
incorporated by reference in its entirety) and octamer factors
(see, in general, Watson et al., eds., Molecular Biology of the
Gene, 4th ed. (The Benjamin/Cummings Publishing Company, Inc. 1987;
incorporated by reference in its entirety)), and Lemaigre and
Rousseau, Biochem. J. 303:1 (1994); incorporated by reference in
its entirety). As used herein, a promoter can be constitutively
active, repressible or inducible. If a promoter is an inducible
promoter, then the rate of transcription increases in response to
an inducing agent. In contrast, the rate of transcription is not
regulated by an inducing agent if the promoter is a constitutive
promoter. Repressible promoters are also known. In some
alternatives, a gene delivery polynucleotide is provided. In some
alternatives, the gene delivery polynucleotide comprises a promoter
sequence.
[0058] "Selectable marker cassette," is a gene introduced into a
vector or a cell that confers a trait for artificial selection. A
selectable marker cassette can be a screenable marker to allow a
researcher to distinguish between wanted and unwanted cells, or to
enrich for a specific cell type. In some alternatives, a gene
delivery polynucleotide is provided. In some alternatives, the gene
delivery polynucleotide comprises a selectable marker cassette.
[0059] "Dihydrofolate reductase", or DHFR, as described herein, is
an enzyme that reduces dihydrofolic acid to tetrahydrofolic acid,
using NADPH as electron donor, which can be converted to the kinds
of tetrahydrofolate cofactors used in 1-carbon transfer chemistry.
In some alternatives described herein, a gene delivery
polynucleotide is provided. In some alternatives, the gene delivery
polynucleotide comprises at least one selectable marker cassette
encoding for a double mutant of dihydrofolate reductase.
[0060] "Methotrexate" (MTX), as described herein, is an
antimetabolite and antifolate drug. It acts by inhibiting the
metabolism of folic acid. In some alternatives, a method of
generating engineered multiplexed T-cells for adoptive T-cell
immunotherapy is provided. In the broadest sense, the method can
comprise providing the gene delivery polynucleotide of any of the
alternatives described herein, introducing the gene delivery
polynucleotide into a T-cell, providing a vector encoding a
Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the T-cell, selecting the cells
comprising the gene delivery polynucleotide, wherein the selecting
comprises a first round of selection and a second round of
selection, wherein the first round of selection comprises adding a
selection reagent at a first concentration range and the second
round of selection comprises adding the same selection reagent at a
second concentration range, wherein the second concentration range
is greater than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range, and isolating the T-cells expressing
a phenotype under this selective pressure. In some alternatives
described herein, the selection reagent comprises an agent for
selection. In some alternatives, the selection reagent is MTX.
[0061] An "inverted repeat" or IR is a sequence of nucleotides
followed downstream by its reverse complement. Inverted repeats can
have a number of important biological functions. They can define
the boundaries in transposons and indicate regions capable of
self-complementary base pairing (regions within a single sequence
which can base pair with each other). These properties play an
important role in genome instability and contribute to cellular
evolution, genetic diversity and also to mutation and disease. In
some alternatives, a gene delivery polynucleotide is provided. In
some alternatives, the gene delivery polynucleotide comprises a
first inverted terminal repeat gene sequence and a second inverted
terminal repeat gene sequence. In some alternatives, the gene
delivery polynucleotide comprises a sleeping beauty transposon
positioned between two inverted repeat sequences.
[0062] Sleeping beauty transposase binds specific binding sites
that are located on the IR of the Sleeping beauty transposon. The
sequence of IR (Inverted repeat) is as follows
TABLE-US-00001 (SEQ ID NO: 1)
cagttgaagtcggaagtttacatacacttaagttggagtcattaaaac
tcgtttttcaactacTccacaaatttcttgttaacaaacaatagtttt
ggcaagtcagttaggacatctactttgtgcatgacacaagtcattttt
ccaacaattgtttacagacagattatttcacttataattcactgtatc
acaattccagtgggtcagaagtttacatacactaagttgactgtgcct
ttaaacagcttggaaaattccagaaaatgatgtcatggctttagaagc
ttctgatagactaattgacatcatttgagtcaattggaggtgtacctg
tggatgtatttcaagg
[0063] A "polypeptide" is a polymer of amino acid residues joined
by peptide bonds, whether produced naturally or synthetically.
Polypeptides of less than about 10 amino acid residues are commonly
referred to as "peptides."
[0064] A "protein" is a macromolecule comprising one or more
polypeptide chains. A protein can also comprise non-peptide
components, such as carbohydrate groups. Carbohydrates and other
non-peptide substituents can be added to a protein by the cell in
which the protein is produced, and will vary with the type of cell.
Proteins are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are generally
not specified, but can be present nonetheless. In some
alternatives, a gene delivery polynucleotide for stable insertion
of a nucleic acid into a gene, wherein the nucleic acid for
insertion is flanked by inverted terminal repeat gene sequences in
the gene delivery polynucleotide and wherein the gene delivery
polynucleotide is selectable, the gene delivery polynucleotide, is
provided. In some alternatives, the gene delivery polynucleotide
further comprises a sequence for at least one protein.
[0065] An "antibody" as described herein refers to a large Y-shape
protein produced by plasma cells that is used by the immune system
to identify and neutralize foreign objects such as bacteria and
viruses. The antibody protein can comprise four polypeptide chains;
two identical heavy chains and two identical light chains connected
by disulfide bonds. Each chain is composed of structural domains
called immunoglobulin domains. These domains can contain about
70-110 amino acids and are classified into different categories
according to their size and function. In some alternatives, a gene
delivery polynucleotide for stable insertion of a nucleic acid into
a gene, wherein the nucleic acid for insertion is flanked by
inverted terminal repeat gene sequences in the gene delivery
polynucleotide and wherein the gene delivery polynucleotide is
selectable, the gene delivery polynucleotide, is provided. In some
alternatives, the gene delivery polynucleotide further comprises a
sequence for at least one protein. In some alternatives, the gene
delivery polynucleotide can comprise a sequence for an antibody or
a portion thereof, which may be humanized.
[0066] A "chimeric antigen receptor" (CARs), also known as chimeric
T-cell receptors, refers to artificial T-cell receptors that are
engineered receptors, which graft an arbitrary specificity onto an
immune effector cell. These receptors can be used to graft the
specificity of a monoclonal antibody onto a T-cell, for example;
with transfer of their coding sequence facilitated by retroviral
vectors. The structure of the CAR can comprise single-chain
variable fragments (scFv) derived from monoclonal antibodies, fused
to CD3-zeta transmembrane and endodomain. Such molecules result in
the transmission of a zeta signal in response to recognition by the
scFv of its target. Some alternatives utilize a gene delivery
polynucleotide for stable insertion of a nucleic acid into a gene,
wherein the nucleic acid for insertion is flanked by inverted
terminal repeat gene sequences in the gene delivery polynucleotide,
and wherein the gene delivery polynucleotide is selectable. In some
alternatives, the gene delivery polynucleotide further comprises a
sequence for at least one protein. In some alternatives, the
protein is a chimeric antigen receptor. Chimeric receptor can also
be referred to as artificial T cell receptors, chimeric T cell
receptors, chimeric immunoreceptors, and chimeric antigen receptors
(CARs). These CARs are engineered receptors that can graft an
arbitrary specificity onto an immune receptor cell. Chimeric
antigen receptors or "CARs" are considered by some investigators in
some contexts to include the antibody or antibody fragment, spacer,
signaling domain, and transmembrane region. However, due to the
surprising effects of modifying the different components or domains
of the CAR, such as the epitope binding region (for example,
antibody fragment, scFv, or portion thereof), spacer, transmembrane
domain, and/or signaling domain), the components of the CAR are
described herein in some contexts to include these features as
independent elements. The variation of the different elements of
the CAR can, for example, lead to stronger binding affinity for a
specific epitope.
[0067] Artificial T-cell receptors, or CARs can be used as a
therapy for cancer or viral infection using a technique called
adoptive cell transfer. T-cells are removed from a patient and
modified so that they express receptors specific for a molecule
displayed on a cancer cell or virus, or virus-infected cell. The
genetically engineered T-cells, which can then recognize and kill
the cancer cells or the virus infected cells or promote clearance
of the virus, are reintroduced into the patient. In some
alternatives, the gene delivery polynucleotide can comprise a
sequence for a chimeric antigen receptor. In some alternatives, a
method of generating engineered multiplexed T-cells for adoptive
T-cell immunotherapy is provided. In the broadest sense the method
can comprise providing the gene delivery polynucleotide of any one
of the alternatives described herein, introducing the gene delivery
polynucleotide into a T-cell, providing a vector encoding a
Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the T-cell, selecting the cells
comprising the gene delivery polynucleotide, wherein selecting
comprises a first round of selection and a second round of
selection, wherein the first round of selection comprises adding a
selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, and wherein the second concentration
range is at least 1.5 fold higher than that of the first
concentration range and isolating the T-cells expressing a
phenotype under selective pressure. In some alternatives, the
selection reagent is MTX.
[0068] T-cell co-stimulation is desired for development of an
effective immune response and this event occurs during the
activation of lymphocytes. A co-stimulatory signal, is antigen
non-specific and is provided by the interaction between
co-stimulatory molecules expressed on the membrane of the antigen
bearing cell and the T-cell. Co-stimulatory molecules can include
but are not limited to CD28, CD80, and CD86. In some alternatives,
a method for generating engineered multiplexed T-cell for adoptive
T-cell immunotherapy is provided. In some alternatives, the T-cell
is a chimeric antigen receptor bearing T-cell. In some
alternatives, the chimeric antigen receptor bearing T-cell is
engineered to express co-stimulatory ligands. In some alternatives,
methods are provided for treating, inhibiting, or ameliorating
cancer or a viral infection in a subject. In the broadest sense the
method can comprise administering to the subject a T-cell of any of
the alternatives described herein. Preferably, genetically
engineered T cells are used to treat, inhibit, or ameliorate a
cancer or a viral disease, wherein the genetically engineered T
cells are obtained by preferential amplification of T cells that
are transformed to express multiple transgenes encoding receptors
or chimeric receptors specific for a molecule presented by a virus
or a cancer cell and selection pressure on the transformed T cells
is applied in a two-stage MTX selection, utilizing increasing
concentrations of MTX. In some of these alternatives, the subject
is an animal, such as domestic livestock or a companion animal and
on other alternatives, the subject is a human. In some of these
alternatives, the chimeric antigen bearing T-cell is engineered to
express a co-stimulatory molecule. In some alternatives, the gene
delivery polynucleotide comprises a sequence for at least one
co-stimulatory molecule. In some alternatives, the gene delivery
polynucleotide is circular. In some alternatives, the gene delivery
polynucleotide is at least 1 kB to 6 kB. In some alternatives, the
gene delivery polynucleotide is a minicircle.
[0069] "T cell precursors" as described herein refers to lymphoid
precursor cells that can migrate to the thymus and become T cell
precursors, which do not express a T cell receptor. All T cells
originate from hematopoietic stem cells in the bone marrow.
Hematopoietic progenitors (lymphoid progenitor cells) from
hematopoietic stem cells populate the thymus and expand by cell
division to generate a large population of immature thymocytes. The
earliest thymocytes express neither CD4 nor CD8, and are therefore
classed as double-negative (CD4.sup.-CD8.sup.-) cells. As they
progress through their development, they become double-positive
thymocytes (CD4.sup.+CD8.sup.+), and finally mature to
single-positive (CD4.sup.+CD8.sup.- or CD4.sup.-CD8.sup.+)
thymocytes that are then released from the thymus to peripheral
tissues.
[0070] About 98% of thymocytes die during the development processes
in the thymus by failing either positive selection or negative
selection, whereas the other 2% survive and leave the thymus to
become mature immunocompetent T cells.
[0071] The double negative (DN) stage of the precursor T cell is
focused on producing a functional .beta.-chain whereas the double
positive (DP) stage is focused on producing a functional
.alpha.-chain, ultimately producing a functional .alpha..beta. T
cell receptor. As the developing thymocyte progresses through the
four DN stages (DN1, DN2, DN3, and DN4), the T cell expresses an
invariant .alpha.-chain but rearranges the .beta.-chain locus. If
the rearranged .beta.-chain successfully pairs with the invariant
.alpha.-chain, signals are produced which cease rearrangement of
the .beta.-chain (and silence the alternate allele) and result in
proliferation of the cell. Although these signals require this
pre-TCR at the cell surface, they are dependent on ligand binding
to the pre-TCR. These thymocytes will then express both CD4 and CD8
and progresses to the double positive (DP) stage where selection of
the .alpha.-chain takes place. If a rearranged .beta.-chain does
not lead to any signaling (e.g. as a result of an inability to pair
with the invariant .alpha.-chain), the cell may die by neglect
(lack of signaling).
[0072] "Hematopoietic stem cells" or "HSC" as described herein, are
precursor cells that can give rise to myeloid cells such as, for
example, macrophages, monocytes, macrophages, neutrophils,
basophils, eosinophils, erythrocytes, megakaryocytes/platelets,
dendritic cells and lymphoid lineages (such as, for example,
T-cells, B-cells, NK-cells). HSCs have a heterogeneous population
in which three classes of stem cells exist, which are distinguished
by their ratio of lymphoid to myeloid progeny in the blood
(L/M).
[0073] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided,
wherein the method comprises providing a gene delivery
polynucleotide, introducing the gene delivery polynucleotide into a
T-cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the T cells comprise precursor T
cells. In some alternatives, the precursor T cells are
hematopoietic stem cells.
[0074] In some alternatives, a method of generating engineered
cells for adoptive T-cell immunotherapy comprising, providing a
gene delivery polynucleotide, introducing the gene delivery
polynucleotide into a precursor T cell, providing a vector encoding
a Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the precursor T cell, selecting
the precursor T cells comprising the gene delivery polynucleotide;
wherein selecting comprises a first round of selection and a second
round of selection, wherein the first round of selection comprises
adding a selection reagent at a first concentration range and the
second round of selection comprises adding the selection reagent at
a second concentration range, wherein the second concentration
range is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the precursor T-cells
expressing a phenotype under selective pressure. In some
alternatives, the gene delivery polynucleotide is for stable
insertion of a nucleic acid into an oligonucleotide wherein the
nucleic acid for insertion is flanked by inverted terminal repeat
gene sequences in the gene delivery polynucleotide and wherein the
gene delivery polynucleotide is selectable, wherein the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene, wherein the at least one gene encodes a protein or encodes a
sequence for mRNA transcription, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used to select
for cells transduced with the gene delivery polynucleotide, to
enhance the ratio of cells expressing the at least one gene and
wherein the fifth sequence is optimized, a sixth sequence, wherein
the sixth sequence comprises a first attachment site (attP) and a
seventh sequence, wherein the seventh sequence comprises a second
attachment site (attB); wherein each of the first sequence, second
sequence, third sequence, fourth sequence, fifth sequence, sixth
sequence, and seventh sequence have a 5' terminus and a 3'
terminus, and wherein the 3' terminus of the first sequence
comprising the first inverted terminal repeat gene sequence is
adjacent to the 5' terminus of the third sequence, the 3' terminus
of the third sequence is adjacent to the 5' terminus of the fourth
sequence, the 3' terminus of the fourth sequence is adjacent to the
5' terminus of the fifth sequence and the 3' terminus of the fifth
sequence is adjacent to the 5' terminus of the second sequence
comprising a second inverted terminal repeat. In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
codon optimization and/or consensus sequence is generated by
comparing the variability of sequence and/or nucleobases utilized
in a plurality of related sequences. In some alternatives, the
protein is a protein for therapy. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the introducing is performed by electroporation.
In some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
range is at least 75 nM-150 nM and the second concentration range
is at least 112.5 nM to 225 nM. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the first
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first round of selection comprises exposing the
T-cells to the selection agent for 2, 3, 4, 5, 6 or 7 days before
the second round of selection. In some alternatives, the second
round of selection comprises exposing the T-cells to the selection
agent for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14
days or any time that is between a range of times defined by any
two of the aforementioned time points before isolation. In some
alternatives, the T cell precursor is a hematopoietic stem
cell.
[0075] In some alternatives, a method of increasing protein
production in a precursor T-cell is provided wherein the method
comprises providing a polynucleotide, introducing the
polynucleotide into a cell, providing a vector encoding a Sleeping
Beauty transposase; introducing the vector encoding the Sleeping
Beauty transposase into the precursor T-cell, selecting the
precursor T cells comprising the gene delivery polynucleotide,
wherein selecting comprises a first round of selection and a second
round of selection, wherein the first round of selection comprises
adding a selection reagent at a first concentration range and the
second round of selection comprises adding the selection reagent at
a second concentration range, wherein the second concentration
range is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the precursor T cells
expressing a phenotype under selective pressure. In some
alternatives, the gene delivery polynucleotide is for stable
insertion of a nucleic acid into an oligonucleotide wherein the
nucleic acid for insertion is flanked by inverted terminal repeat
gene sequences in the gene delivery polynucleotide and wherein the
gene delivery polynucleotide is selectable, wherein the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene, wherein the at least one gene encodes a protein or encodes a
sequence for mRNA transcription, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used to select
for cells transduced with the gene delivery polynucleotide, to
enhance the ratio of cells expressing the at least one gene and
wherein the fifth sequence is optimized, a sixth sequence, wherein
the sixth sequence comprises a first attachment site (attP) and a
seventh sequence, wherein the seventh sequence comprises a second
attachment site (attB); wherein each of the first sequence, second
sequence, third sequence, fourth sequence, fifth sequence, sixth
sequence, and seventh sequence have a 5' terminus and a 3'
terminus, and wherein the 3' terminus of the first sequence
comprising the first inverted terminal repeat gene sequence is
adjacent to the 5' terminus of the third sequence, the 3' terminus
of the third sequence is adjacent to the 5' terminus of the fourth
sequence, the 3' terminus of the fourth sequence is adjacent to the
5' terminus of the fifth sequence and the 3' terminus of the fifth
sequence is adjacent to the 5' terminus of the second sequence
comprising a second inverted terminal repeat. In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
codon optimization and/or consensus sequence is generated by
comparing the variability of sequence and/or nucleobases utilized
in a plurality of related sequences. In some alternatives, the
protein is a protein for therapy. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the introducing is performed by electroporation.
In some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate.
[0076] In some alternatives, wherein the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
range is at least 75 nM-150 nM and the second concentration range
is at least 112.5 nM to 225 nM. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the second
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first round of selection comprises exposing the
cells to the selection agent for 2, 3, 4, 5, 6 or 7 days before the
second round of selection. In some alternatives, the second round
of selection comprises exposing the cells to the selection agent
for at least 2, 3, 4, 5, 6, or 7 days before isolation. In some
alternatives, the precursor T cells are hematopoietic stem
cells.
[0077] A peptide or polypeptide encoded by a non-host DNA molecule
is a "heterologous" peptide or polypeptide.
[0078] An "integrated genetic element" is a segment of DNA that has
been incorporated into a chromosome of a host cell after that
element is introduced into the cell through human manipulation.
Within the present alternatives, integrated genetic elements can be
derived from minicircles that are introduced into the cells by
electroporation or other techniques. Integrated genetic elements
are passed from the original host cell to its progeny. In some
alternatives, an integrated genetic element is incorporated into a
chromosome of a host cell by a gene delivery polynucleotide is
circular. In some alternatives, the gene delivery polynucleotide is
at least 1 kB to 6 kB. In some alternatives, the gene delivery
polynucleotide is a minicircle.
[0079] A "cloning vector" or vector is a nucleic acid molecule,
such as a minicircle, plasmid, cosmid, plastome, or bacteriophage
that has the capability of replicating autonomously in a host cell.
Cloning vectors typically contain one or a small number of
restriction endonuclease recognition sites that allow insertion of
a nucleic acid molecule in a determinable fashion without loss of
an essential biological function of the vector, as well as
nucleotide sequences encoding a marker gene that is suitable for
use in the identification and selection of cells transduced with
the cloning vector. Marker genes typically include genes that
provide tetracycline resistance or ampicillin resistance but in
some alternatives can include a methotrexate resistance gene.
[0080] An "expression vector" is a nucleic acid molecule encoding a
gene that is expressed in a host cell. Typically, an expression
vector comprises a transcription promoter, a gene, and a
transcription terminator. Gene expression is usually placed under
the control of a promoter, and such a gene is said to be "operably
linked to" the promoter. Similarly, a regulatory element and a core
promoter are operably linked if the regulatory element modulates
the activity of the core promoter. In some alternatives, an
expression vector is provided. In some alternatives, the expression
vector encodes a transposase. In some alternatives, the transposase
is a Sleeping Beauty transposase. In some alternatives, expression
vector is circular. In some alternatives, the expression vector is
at least 1 kB to 6 kB. In some alternatives, the expression vector
is a minicircle.
[0081] "Minicircles," as described herein, are small circular
plasmid derivatives that have been freed from all prokaryotic
vector parts. Minicircles can serve as an expression vector, where
they have been applied as transgene carriers for the genetic
modification of mammalian cells, with the advantage that, since
they contain no bacterial DNA sequences, they are less likely to be
perceived as foreign and destroyed. As such, typical transgene
delivery methods involve plasmids, which contain foreign DNA. The
smaller size of minicircles also extends their cloning capacity and
facilitates their delivery into cells. Without being limiting, the
preparation of minicircles can follow a two-step procedure, which
can involve production of a parental plasmid (bacterial plasmid
with eukaryotic inserts) in E. coli and induction of a
site-specific recombinase at the end of this process but still in
bacteria. These steps can be followed by the excision of
prokaryotic vector parts via two recombinase-target sequences at
both ends of the insert and recovery of the resulting minicircle
(vehicle for the highly efficient modification of the recipient
cell) and the miniplasmid by capillary gel electrophoresis
(CGE).
[0082] The purified minicircle can be transferred into the
recipient cell by transfection, by electroporation, or by other
methods known to those skilled in the art. Conventional minicircles
can lack an origin of replication, so they cannot replicate within
the target cells and the encoded genes will disappear as the cell
divides (which can be either an advantage or disadvantage depending
on whether the application demands persistent or transient
expression). Some alternatives utilize a gene delivery
polynucleotide for stable insertion of a nucleic acid into a gene,
wherein the nucleic acid for insertion is flanked by inverted
terminal repeat gene sequences in the gene delivery polynucleotide,
and wherein the gene delivery polynucleotide is selectable. In some
alternatives, the gene delivery polynucleotide is a minicircle.
[0083] As used herein, "nucleofection", refers to a transfection
method of exogenous nucleic acid(s) into a host cell and is
performed by electroporation. In some alternatives, a method of
generating engineered multiplexed T-cells for adoptive T-cell
immunotherapy is provided. In the broadest sense the method can
comprise providing the gene delivery polynucleotide of any of the
alternatives described herein, introducing the gene delivery
polynucleotide into a T-cell, selecting the cells comprising the
gene delivery polynucleotide, wherein selecting comprises a first
round of selection and a second round of selection, wherein the
first round of selection comprises adding a selection reagent at a
first concentration range and the second round of selection
comprises adding the selection reagent at a second concentration
range, wherein the second concentration range is higher than the
first concentration range and, wherein the second concentration
range is at least 1.5 fold higher than that of the first
concentration range and isolating the T-cells expressing a
phenotype under selective pressure. In some alternatives, the
selection reagent is MTX. In some alternatives, introducing the
gene delivery polynucleotide into a T-cell can be performed by
electroporation.
[0084] "Host cell" as described herein, is a cell that contains one
or more nucleases, for example endonucleases, end-processing
enzymes, and/or endonuclease/end-processing enzyme fusion proteins
encompassed by the present alternatives or a vector encoding the
same that supports the replication, and/or transcription or
transcription and translation (expression) of one or more
nucleases, for example endonucleases, end-processing enzymes,
and/or endonuclease/end-processing enzyme fusion proteins. In some
alternatives, host cells for use in the present alternatives can be
eukaryotic cells. Host cells of the immune system can include
T-cells. In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided.
In some alternatives, the method can comprise providing the gene
delivery polynucleotide of any one of the alternatives described
herein, introducing the gene delivery polynucleotide into a T-cell,
providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide, wherein the selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the selection reagent is MTX.
[0085] As described herein, "transposable element" (TE), transposon
or retrotransposon, can be referred to as a DNA sequence that can
change its position within the genome, sometimes creating or
reversing mutations and altering the cell's genome size.
Transposition often results in duplication of the TE. TEs can make
up a large fraction of the C-value of eukaryotic cells. "C-values,"
as described herein, refers to amount, in picograms, of DNA
contained within a haploid nucleus of one half the amount in a
diploid somatic cells of a eukaryotic organism. In some cases, the
terms C-value and genome size are used interchangeably, however in
polyploids the C-value can represent two or more genomes contained
within the same nucleus. In Oxytricha, which has a unique genetic
system, they play a critical role in development. They are also
very useful to researchers as a means to alter DNA inside a living
organism. In some alternatives, a gene delivery polynucleotide for
stable insertion of a nucleic acid into a gene, wherein the nucleic
acid for insertion is flanked by inverted terminal repeat gene
sequences in the gene delivery polynucleotide and wherein the gene
delivery polynucleotide is selectable, the gene delivery
polynucleotide, is provided. In some alternatives, the gene
delivery polynucleotide comprises a transposon.
[0086] The "Sleeping Beauty transposon system" as described herein,
is composed of a Sleeping Beauty (SB) transposase and a transposon
that was designed in 1997 to insert specific sequences of DNA into
genomes of vertebrate animals. DNA transposons can translocate from
one DNA site to another in a simple, cut-and-paste manner.
Transposition is a precise process in which a defined DNA segment
is excised from one DNA molecule and moved to another site in the
same or different DNA molecule or genome.
[0087] An SB transposase can insert a transposon into a TA
dinucleotide base pair in a recipient DNA sequence. The insertion
site can be elsewhere in the same DNA molecule, or in another DNA
molecule (or chromosome). In mammalian genomes, including humans,
there are approximately 200 million TA sites. The TA insertion site
is duplicated in the process of transposon integration. This
duplication of the TA sequence is a hallmark of transposition and
used to ascertain the mechanism in some experiments. The
transposase can be encoded either within the transposon or the
transposase can be supplied by another source, in which case the
transposon becomes a non-autonomous element.
[0088] In some alternatives, a gene delivery polynucleotide for
stable insertion of a nucleic acid into a gene, wherein the nucleic
acid for insertion is flanked by inverted terminal repeat gene
sequences in the gene delivery polynucleotide and wherein the gene
delivery polynucleotide is selectable, the gene delivery
polynucleotide, is provided. In some alternatives, the gene
delivery polynucleotide comprises a transposon. In some
alternatives, the transposon is a Sleeping Beauty transposon. In
some alternatives, the nucleic acid to be inserted is a Sleeping
Beauty transposon flanked by inverted terminal repeat gene
sequences.
[0089] In some alternatives, the gene delivery polynucleotide for
stable insertion of nucleic acid is a minicircle. In some
alternatives, the gene delivery polynucleotide for stable insertion
of nucleic acid comprises a Sleeping Beauty transposon. In some
alternatives, methods of generating engineered multiplexed T-cells
are provided. In some alternatives, the method comprises delivering
a Sleeping Beauty transposase to a cell. In some alternatives,
methods of increasing protein production in a T-cell are provided.
In some alternatives, the method comprises providing a vector
encoding a Sleeping Beauty transposase. In some alternatives, the
method comprises delivering a vector encoding a Sleeping Beauty
transposase to a cell.
[0090] "Codon optimization" as described herein, refers to the
design process of altering codons to codons known to increase
maximum protein expression efficiency in a desired cell. In some
alternatives, codon optimization is described, wherein codon
optimization can be performed by using algorithms that are known to
those skilled in the art to create synthetic genetic transcripts
optimized for high protein yield. Programs containing alogorithms
for codon optimization are known to those skilled in the art.
Programs can include, for example, OptimumGene.TM., GeneGPS.RTM.
algorithms, etc. Additionally synthetic codon optimized sequences
can be obtained commercially for example from Integrated DNA
Technologies and other commercially available DNA sequencing
services. In some alternatives, a gene delivery polynucleotide for
stable insertion of a nucleic acid into a gene, wherein the nucleic
acid for insertion is flanked by inverted terminal repeat gene
sequences in the gene delivery polynucleotide and wherein the gene
delivery polynucleotide is selectable, is provided. In some
alternatives, the gene delivery polynucleotides are described,
wherein the genes for the complete gene transcript are codon
optimized for expression in humans. In some alternatives, the genes
are optimized to have selected codons specifically for maximal
protein expression in human cells, which can increase the
concentration of proteins or CARs of a T-cell.
[0091] Codon optimization can be performed to reduce the occurrence
of secondary structure in a polynucleotide, as well. In some
alternatives, codon optimization can also be performed to reduce
the total GC/AT ratio. Strict codon optimization can also lead to
unwanted secondary structure or an undesirable GC content that
leads to secondary structure. As such the secondary structures
affect transcriptional efficiency. Programs such as GeneOptimizer
can be used after codon usage optimization, for secondary structure
avoidance and GC content optimization. These additional programs
can be used for further optimization and troubleshooting after an
initial codon optimization to limit secondary structures that may
occur after the first round of optimization. Alternative programs
for optimization are known to those skilled in the art. In some
alternatives, a gene delivery polynucleotide for stable insertion
of a nucleic acid into a gene, wherein the nucleic acid for
insertion is flanked by inverted terminal repeat gene sequences in
the gene delivery polynucleotide and wherein the gene delivery
polynucleotide is selectable, provided. In some alternatives, the
gene delivery polynucleotide comprises sequences that are codon
optimized for expression in humans and/or to remove secondary
structure and/or to reduce the total GC/AT ratio. In some
alternatives, the sequences are optimized for secondary structure
avoidance. In some alternatives, the sequences are optimized to
reduce the total GC/AT ratio.
[0092] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided.
In the broadest sense, the method can comprise providing the gene
delivery polynucleotide of any one of the alternatives described
herein, introducing the gene delivery polynucleotide into a T-cell,
providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide, wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration
range, and isolating the T-cells expressing a phenotype under
selective pressure. In some alternatives, the selection reagent is
MTX.
Adoptive Immunotherapy for Cancer or a Viral Disease.
[0093] The premise of adoptive immunotherapy for cancer is
transferring a patient's own tumor-specific T-cells into patients
to facilitate the destruction of malignant cells. T-cells can be
genetically-engineered to recognize tumor-specific antigens and
exert cytotoxic activity against cancer cells. A method of adoptive
immunotherapy for cancer is to isolate patient T-cells and
introduce tumor recognition capability by expressing chimeric
antigen receptors (CARs), membrane proteins that contain an
extracellular tumor-binding domain linked to an intracellular
signaling domain via a transmembrane segment. "Adoptive
immunotherapy" or "T-cell adoptive transfer" refers to use of
T-cell based cytotoxic response to attack cancer cells or specific
cell targets. T-cells that have a natural or genetically engineered
reactivity to a patient's cancer can be generated in vitro and then
transferred back into the subject in need. Without being limiting,
an example of adoptive transfer can be achieved by removing T-cells
from a subject that has cancer or a viral disease and these T cells
can be genetically engineered to express receptors specific for
biomarkers found on a cancer cell or virus such that the
genetically engineered T cells attack the cancer cells or virus or
virus infected cells once the genetically engineered T-cells are
transferred back into the subject. In some alternatives, a method
of generating engineered multiplexed T-cells for adoptive T-cell
immunotherapy is provided. In some alternatives, methods of
targeting malignant cells for destruction are provided. In some
alternatives a method of treating, inhibiting, or ameliorating a
cancer or a viral disease in a subject is provided. In some
alternatives the method of treating, inhibiting, or ameliorating a
cancer or a viral disease in a subject comprises administering to
the subject an engineered multiplexed T-cells for adoptive T-cell
immunotherapy. In some alternatives, the subject is human.
[0094] The co-integration of additional genes can further increase
the anti-tumor or antiviral activity of CAR-expressing T-cells.
Comprehensive T-cell activation requires, in addition to initial
tumor or viral recognition and signal initiation by CAR, engagement
of costimulatory and cytokine receptors, which may not be present
within the immunosuppressive environment of the tumor or the viral
infected subject. To address this immunosuppressive environment of
the tumor, for example, expression of co-stimulatory ligands such
as CD80 and 4-1BBL in engineered, CAR-expressing T-cells can result
in greater T-cell expansion due to auto-co-stimulation compared to
expression of co-stimulatory ligands on tumor cells. Another
challenge in T-cell immunotherapy is cell survival after infusion
into patients. Induced expression of anti-apoptotic proteins has
been shown to improve in vivo survival of T-cells. Tumor homing and
infiltration can be increased by introduction of chemokine
receptors in engineered T-cells and this approach can be especially
useful for tumors that express chemokines that are not normally
recognized by T-cells. Finally, T-cells can be engineered to better
resist the immunosuppressive tumor microenvironment or the
immunocompromised virally infected subject through, for example,
induced cytokine expression. Thus, methods to rapidly generate
engineered T-cells expressing multiple transgenes are important and
advantageous for clinical translation of T-cell immunotherapy. In
some alternatives, methods of generating engineered multiplexed
T-cells for adoptive T-cell immunotherapy are provided. In some
alternatives, the T-cells express chimeric antigen receptors. In
some alternatives, T-cells expressing chimeric antigen receptors
are engineered to express co-stimulatory ligands. In some
alternatives, the T-cells expressing chimeric antigen receptors
express co-stimulatory ligands. In some alternatives the
co-stimulatory ligands are CD80. In some alternatives, the
co-stimulatory ligands are 4-1BBL.
[0095] Adoptive cell transfer can refer to the transfer of cells,
immune-derived cells, back into the same patient or into a
different recipient host. For isolation of immune cells for
adoptive transfer, blood can be drawn into tubes containing
anticoagulant and the PBM (buffy coat) cells are isolated,
typically by density barrier centrifugation. In T-cell based
therapies, the cells can be expanded in vitro using cell culture
methods relying heavily on the immunomodulatory action of
interleukin-2 and returned to the patient in large numbers
intravenously in an activated state. Anti-CD3 antibody can be used
to promote the proliferation of T-cells in culture. Research into
interleukin-21 indicates that it can also play an important role in
enhancing the efficacy of T-cell based therapies prepared in vitro.
Cells used in adoptive cell transfer can be used to deliver
genetically modified lymphocytes, using recombinant DNA technology
to achieve any number of goals. In alternatives described herein,
adoptive cell transfer is used to transfer cells into a subject,
wherein the cells are CAR expressing lymphocytes. In some
alternatives, CAR expressing lymphocytes are host cells in methods
for generating engineered multiplexed T-cells for adoptive T-cell
immunotherapy. In some alternatives, the method comprises providing
the gene delivery polynucleotide of the alternatives described
herein, introducing the gene delivery polynucleotide into a T-cell,
providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide, wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration
range, and isolating the T-cells expressing a phenotype under
selective pressure. In some alternatives, the gene delivery
polynucleotide comprises a sequence for a co-stimulatory ligand. In
some alternatives, the gene delivery polynucleotide comprises a
sequence for a chimeric antigen receptor. In some alternatives, the
T-cell expresses a CAR. In alternatives described herein, the CAR
expressing lymphocytes are genetically modified by minicircles
wherein the minicircles comprise Sleeping Beauty transposons. In
some alternatives, the selection reagent is MTX.
[0096] By way of example and not of limitation, genetically
engineered T-cells can be created by infecting patient's cells with
a transferring virus that contain a copy of a T-cell receptor (TCR)
gene that is specialized to recognize, for example, tumor or viral
antigens. It is important that the transferring virus is not able
to reproduce within the cell however, but should integrate into the
human genome. This is beneficial as new TCR gene remains stable in
the T-cell. A patient's own T-cells are exposed to these
transferring viruses and then are expanded non-specifically or
stimulated using the genetically engineered TCR. The cells are then
transferred back into the patient and are ready to mount an immune
response against the tumor, virus, or viral infected cell. The use
of adoptive cell transfer with genetically engineered T-cells is a
promising new approach for the treatment of a variety of cancers or
viral infections. In some alternatives, methods of adoptive
immunotherapy for cancer are provided. In some alternatives,
methods of adoptive immunotherapy for viral infections are
provided.
[0097] The method of making genetically engineered T-cells by using
a viral vector can have several drawbacks. Genetic modification of
T-cells is typically accomplished using .gamma.-retroviral or
lentiviral vectors. While effective, drawbacks include cost of
production, limited gene packaging capacity, and potential safety
issues. Plasmids containing transposon systems such as Sleeping
Beauty (SB) or piggyBac offer a non-viral approach for stably
introducing genes into T-cells. Recently, the piggyBac system was
used to produce stably-transfected mammalian cells expressing
multiple transgenes of interest by delivery of multiple
transposons. The SB system, first reactivated for mammalian cell
use by Ivics and coworkers, has been used as the gene delivery
modality in clinical trials of T-cell immunotherapy. Gene
integration by SB has weaker preference for transcriptional units
and their regulatory sequences compared to the .gamma.-retroviral
and lentiviral vectors and is therefore considered to be safer. In
some alternatives described herein, genetic modification by
minicircles comprising the Sleeping Beauty system are contemplated.
In some alternatives described herein, genetic modification by
minicircles comprising the piggyBac system are contemplated. In
some alternatives described herein, genetic modification by
minicircles comprising the Sleeping Beauty system are
contemplated.
[0098] Minicircles are particularly attractive as transfection
platforms for three reasons. First, the transfection efficiency of
minicircles by electroporation is superior to that of their plasmid
analogues. Second, transposition efficiency is higher in
minicircles due to the shorter distance between the two transposon
ends, which has been shown to affect transposase efficiency.
Finally, as cell viability after nucleofection decreases with
increasing construct size, minicircles are more advantageous given
their smaller size compared to their analogous plasmids. To further
improve transposition efficiency, the optimized SB100X hyperactive
transposase developed by Izsvak et al. (Nature Genet. 2009, 41,
753-761; incorporated by reference in its entirety) can be used in
combination with the T3 generation of SB previously by Yant et al
(Mol. Cell. Biol. 2004, 24, 9239-9247; incorporated by reference in
its entirety). In several alternatives described herein, methods
for making a genetically modified T-cell for adoptive cell transfer
are contemplated. In some alternatives, the methods comprise
introducing a minicircle into a T-cell. In some alternatives, the
introduction comprises electroporation delivery.
[0099] Another challenge in T-cell immunotherapy is cell survival
after infusion into patients. Induced expression of anti-apoptotic
proteins has been shown to improve in vivo survival of T-cells.
Tumor homing and infiltration has been increased by introduction of
chemokine receptors in engineered T-cells; this approach can be
especially useful for tumors that express chemokines that are not
normally recognized by T-cells. Finally, T-cells can be engineered
to better resist the immunosuppressive tumor microenvironment
through, for example, induced cytokine expression. Thus, methods to
rapidly generate engineered T-cells expressing multiple transgenes
are important and advantageous for clinical translation of T-cell
immunotherapy. In some alternatives described herein, methods of
introducing co-integration of additional genes for co-integration
to further increase the anti-tumor activity of CAR-expressing
T-cells are contemplated. In some alternatives, the additional
genes encode co-stimulatory ligands. In some alternatives, the
co-stimulatory ligand is CD80. In some alternatives, the
co-stimulatory ligand is 4-1BBL. In some alternatives, the
additional genes encode anti-apoptotic proteins. In some
alternatives the additional genes encode chemokine receptors.
[0100] In some alternatives, methods of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy are provided.
In the broadest sense, the method can comprise providing the gene
delivery polynucleotide of any of the alternatives described
herein, introducing the gene delivery polynucleotide into a T-cell,
providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide, wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration
range, and isolating the T-cells expressing a phenotype under
selective pressure. In some alternatives, the T-cells are chimeric
antigen receptor (CAR) expressing T-cells. In some alternatives,
the selection reagent is MTX.
[0101] In some alternatives, methods of increasing protein
production in a T-cell are provided. In the broadest sense, the
method can comprise providing the gene delivery polynucleotide of
any of the alternatives described herein, introducing the gene
delivery polynucleotide into a T-cell, providing a vector encoding
a Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the T-cell, selecting the cells
comprising the gene delivery polynucleotide, wherein selecting
comprises a first round of selection and a second round of
selection, wherein the first round of selection comprises adding a
selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, wherein the second concentration range
is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range, and isolating the T-cells expressing
a phenotype under selective pressure. In some alternatives, the
selection reagent is MTX. In some alternatives, the T-cells are
chimeric antigen receptor (CAR) expressing T-cells.
[0102] As described herein, an alternative of the system comprises
an engineered, non-viral gene delivery system comprising three key
features: (1) Sleeping Beauty transposon system for stable gene
expression, (2) minicircles for enhanced transfection, and (3) a
double mutant of human dihydrofolate reductase (DHFRdm) as a
selection mechanism (FIG. 1).
[0103] Minicircles are particularly attractive as transfection
platforms for three reasons. First, the transfection efficiency of
minicircles by electroporation is superior to that of their plasmid
analogues. Second, transposition efficiency is higher in
minicircles due to the shorter distance between the two transposon
ends, which has been shown to affect transposase efficiency.
Finally, as cell viability after nucleofection decreases with
increasing construct size, minicircles are more desirable given
their smaller size compared to their analogous plasmids. To further
improve transposition efficiency, the optimized SB100X hyperactive
transposase developed by Izsvak et al. (Nature Genet. 2009, 41,
753-761; incorporated herein by reference in its entirety) was used
in combination with the T3 generation of SB transposon previously
by Yant et al (Mol. Cell. Biol. 2004, 24, 9239-9247; incorporated
herein by reference in its entirety). In some alternatives
described herein, genetic modification of T-cells is performed
using minicircles. In some alternatives, the minicircles comprise
transposons. In some alternatives, the transposons comprise
Sleeping Beauty transposons. In some alternatives, an optimized
SB100X hyperactive transposase is used in combination with a T3
generation of SB transposon.
[0104] A selection mechanism for rapid selection of engineered
T-cells can also be employed. The double mutant of human
dihydrofolate reductase (DHFRdm, with amino acid mutations L22F and
F31S) exhibits a 15,000-fold reduced affinity for methotrexate, a
potent inhibitor of DHFR that results in blockade of thymidylate
and purine synthesis. Expression of DHFRdm in T-cells imparts MTX
resistance without compromising proliferative ability, expression
of T-cell markers, or cytolytic ability. Additional advantages of
this selection system include availability of clinical grade MTX,
the use of a non-genotoxic drug, and the small gene size of DHFRdm
(561 bp). Therefore, MTX can be used as a selection mechanism to
selectively amplify SB-transduced cells. In some alternatives, the
minicircles comprise a genetic sequence encoding a double mutant of
human dihydrofolate reductase. In some alternatives, a selection
method for rapid selection of engineered T-cells is provided. In
some alternatives, the selection method comprises contacting
engineered T-cells with clinical grade methotrexate. In some
alternatives, the T-cells comprise a minicircle wherein the
minicircle comprises a sequence for a double mutant of human
dihydrofolate reductase. In some alternatives, the double mutant of
human dihydrofolate reductase exhibits a 15,000 fold or about
15,000 fold reduced specificity for methotrexate. In some
alternatives, methotrexate can be used to contact the T-cells for
selectively amplifying cells transduced with minicircles, wherein
the minicircles comprise a sequence for the double mutant of human
dihydrofolate reductase. In some alternatives, the gene encoding
the double mutant of human dihydrofolate reductase comprises the
DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3).
[0105] Stable transfer of up to three transgenes into the H9 T-cell
line using multiplexed delivery of minicircles containing SB
transposons followed by methotrexate (MTX) selection can be
performed. Cells with higher number of gene integrations can be
preferentially obtained by increasing selection pressure with MTX.
Using a two-step selection method through two successive MTX
selection rounds, 50% of cells expressing three transgene products
can be obtained. In some alternatives, a method of stably
transferring transgenes into a cell line is provided. In some
alternatives, a method of introducing minicircles into a cell line
is provided. In some alternatives, the minicircles comprise
Sleeping Beauty transposons. In some alternatives, the method
further comprises increasing selection pressure with methotrexate,
wherein increasing the selection pressure comprises contacting the
cell line with increasing concentrations of methotrexate. In some
alternatives, the two rounds of methotrexate selection are
performed.
Additional Alternatives
[0106] In some alternatives, a gene delivery polynucleotide for
stable insertion of a nucleic acid into a gene, wherein the nucleic
acid for insertion is flanked by inverted terminal repeat gene
sequences in the gene delivery polynucleotide and wherein the gene
delivery polynucleotide is selectable, the gene delivery
polynucleotide, is provided. In the broadest sense, the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene encoding a protein, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used as a
selection mechanism to selectively amplify cells transduced with
the gene delivery polynucleotide and wherein the fifth sequence is
optimized, a sixth sequence, wherein the sixth sequence comprises a
first attachment site (attP), and a seventh sequence, wherein the
seventh sequence comprises a second attachment site (attB); wherein
each of the first sequence, second sequence, third sequence, fourth
sequence, fifth sequence, sixth sequence, and seventh sequence have
a 5' terminus and a 3' terminus, and wherein the 3' terminus of the
first sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 6 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is a consensus sequence generated from a plurality
of nucleic acids that encode a plurality of related proteins, such
as a plurality of antibody binding domains, which are specific for
the same epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fourth sequence.
In some alternatives, the codon optimization and/or consensus
sequence is generated by comparing the variability of sequence
and/or nucleobases utilized in a plurality of related sequences. In
some alternatives, the protein is a protein for therapy. In some
alternatives, the protein comprises an antibody or a portion
thereof. In some alternatives, the double mutant of dihydrofolate
reductase comprises amino acid mutations of L22F and F31S. In some
alternatives, the minicircle comprises a sequence for the double
mutant of dihydrofolate reductase, the sequence comprising the DNA
sequence ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of dihydrofolate reductase comprises the protein
sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT TSSVEGKQNL
VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL TEQPELANKV
DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL PEYPGVLSDV
QEEKGIKYKF EVYEKND (SEQ ID NO: 3).
[0107] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided.
In the broadest sense, the method can comprise providing the gene
delivery polynucleotide of any of the alternatives described
herein, introducing the gene delivery polynucleotide into a T-cell,
providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide, wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration
range, and isolating the T-cells expressing a phenotype under
selective pressure. In some alternatives, introducing is performed
by electroporation. In some alternatives, the selecting is
performed by increasing selective pressure through the selective
marker cassette. In some alternatives, the selection reagent
comprises an agent for selection. In some alternatives, the agent
for selection is methotrexate. In some alternatives, the first
concentration range is at least 50 nM-100 nM and the second
concentration range is at least 75 to 150 nM. In some alternatives,
the first concentration is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or
100 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 75 nM, 80 nM,
90 nM, 100 nM, 110 nM, 120 nM, 130 nM, 140 nM, or 150 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first concentration range is at least 75 nM-150 nM and the
second concentration range is at least 112.5 nM to 225 nM. In some
alternatives, the first concentration is 75 nM, 85 nM, 95 nM, 105
nM, 115 nM, 125 nM, 135 nM, 145 nM, or 150 nM or any concentration
that is between a range of concentrations defined by any two of the
aforementioned concentrations, and the second concentration range
is 112 nM, 122 nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM,
192 nM, 202 nM, 212 nM, or 225 nM or any concentration that is
between a range of concentrations defined by any two of the
aforementioned concentrations. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the first
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first concentration is 300 nM, 350 nM, 400 nM,
450 nM, 500 nM, 550 nM, 600 nM, 650 nM, or 675 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700
nM, 750 nM, 800 nM, 850 nM, 900 nM, 1000 nM, or 1012 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first round of selection comprises exposing the T-cells to the
selection agent for 2, 3, 4, 5, 6 or 7 days before the second round
of selection. In some alternatives, the second round of selection
comprises exposing the T-cells to the selection agent for at least
2, 3, 4, 5, 6 or 7 days before isolation.
[0108] In some alternatives, a method of increasing protein
production in a cell is provided. In the broadest sense, the method
can comprise providing the gene delivery polynucleotide of any one
of the alternatives described herein, introducing the gene delivery
polynucleotide into a T-cell, providing a vector encoding a
Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the T-cell, selecting the cells
comprising the gene delivery polynucleotide, wherein selecting
comprises a first round of selection and a second round of
selection, wherein the first round of selection comprises adding a
selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, wherein the second concentration range
is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range, and isolating the T-cells expressing
a phenotype under selective pressure. In some alternatives,
introducing is performed by electroporation. In some alternatives,
selecting is performed by increasing selective pressure through the
selective marker cassette. In some alternatives, the selection
reagent comprises an agent for selection. In some alternatives, the
agent for selection is methotrexate. In some alternatives, the low
or first concentration range is at least 50 nM-100 nM and the
higher or second concentration range is at least 75 to 150 nM. In
some alternatives, the low or first concentration range is at least
75 nM-150 nM and the higher or second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the low or first
concentration range is at least 300 nM-675 nM and the higher or
second concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first round of selection comprises exposing the
T-cells to the selection agent for 2, 3, 4, 5, 6 or 7 days before
the second round of selection. In some alternatives, the second
round of selection comprises exposing the T-cells to the selection
agent for at least 2, 3, 4, 5, 6 or 7 days before isolation.
[0109] In some alternatives, an engineered multiplexed T-cell for
adoptive T-cell immunotherapy generated by any one of the methods
of is provided. In some alternatives, the engineered multiplexed
T-cells for adoptive T-cell immunotherapy is generated by a method,
wherein the method comprises providing a gene delivery
polynucleotide, introducing the gene delivery polynucleotide into a
T-cell, providing a vector encoding a Sleeping Beauty transposase,
introducing the vector encoding the Sleeping Beauty transposase
into the T-cell, selecting the cells comprising the gene delivery
polynucleotide wherein selecting comprises a first round of
selection and a second round of selection, wherein the first round
of selection comprises adding a selection reagent at a first
concentration range and the second round of selection comprises
adding the selection reagent at a second concentration range,
wherein the second concentration range is higher than the first
concentration range and, wherein the second concentration range is
at least 1.5 fold higher than that of the first concentration range
and isolating the T-cells expressing a phenotype under selective
pressure. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation.
[0110] In some alternatives, a method of treating, inhibiting, or
ameliorating cancer or a disease in a subject is provided, wherein
the method comprises administering to the subject the modified or
engineered multiplexed T-cell as described below. In some
alternatives, the engineered multiplexed T-cells for adoptive
T-cell immunotherapy is generated by a method, wherein the method
comprises providing a gene delivery polynucleotide, introducing the
gene delivery polynucleotide into a T-cell, providing a vector
encoding a Sleeping Beauty transposase, introducing the vector
encoding the Sleeping Beauty transposase into the T-cell, selecting
the cells comprising the gene delivery polynucleotide wherein
selecting comprises a first round of selection and a second round
of selection, wherein the first round of selection comprises adding
a selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, wherein the second concentration range
is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the T-cells expressing
a phenotype under selective pressure. In some alternatives, the
gene delivery polynucleotide comprises a first sequence, wherein
the first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene encoding a protein, and wherein the fourth sequence is codon
optimized for expression in humans, a fifth sequence, wherein the
fifth sequence comprises at least one selectable marker cassette
encoding a double mutant of dihydrofolate reductase, wherein the
double mutant of dihydrofolate reductase has a 15,000 fold or about
15,000 fold reduced affinity for methotrexate, wherein the
methotrexate can be used as a selection mechanism to selectively
amplify cells transduced with the gene delivery polynucleotide and
wherein the fifth sequence is codon optimized for expression in
humans, a sixth sequence, wherein the sixth sequence comprises a
first attachment site (attP) and a seventh sequence, wherein the
seventh sequence comprises a second attachment site (attB) wherein
each of the first sequence, second sequence, third sequence, fourth
sequence, fifth sequence, sixth sequence, and seventh sequence have
a 5' terminus and a 3' terminus, and wherein the 3' terminus of the
first sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is a minicircle. In some
alternatives, the gene delivery polynucleotide is at least 1 kB to
5 kB. In some alternatives, the promoter region comprises an EF1
promoter sequence. In some alternatives, the fourth sequence
comprises one, two, three, four, or five genes that encode
proteins. In some alternatives, the fourth sequence is codon
optimized to reduce the total GC/AT ratio of the fourth sequence.
In some alternatives, the fourth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
fourth sequence is a consensus sequence generated from a plurality
of nucleic acids that encode a plurality of related proteins. In
some alternatives, the fourth sequence is a consensus sequence
generated from a plurality of nucleic acids that encode a plurality
of related proteins, such as a plurality of antibody binding
domains, which are specific for the same epitope. In some
alternatives, the plurality of related proteins comprise a
plurality of antibody binding domains, wherein the plurality of
antibody binding domains are specific for the same epitope. In some
alternatives, the fifth sequence is codon optimized to reduce the
total GC/AT ratio of the fifth sequence. In some alternatives, the
fifth sequence is optimized by codon optimization for expression in
humans. In some alternatives, the protein is a protein for therapy.
In some alternatives, the codon optimization and/or consensus
sequence is generated by comparing the variability of sequence
and/or nucleobases utilized in a plurality of related sequences. In
some alternatives, the protein comprises an antibody or a portion
thereof, which may be humanized. In some alternatives, the double
mutant of dihydrofolate reductase comprises amino acid mutations of
L22F and F31S. In some alternatives, the double mutant of
dihydrofolate reductase comprises amino acid mutations of L22F and
F31S. In some alternatives, the introducing is performed by
electroporation. In some alternatives, the selecting is performed
by increasing selective pressure through the selective marker
cassette. In some alternatives, the selection reagent comprises an
agent for selection. In some alternatives, the agent for selection
is methotrexate. In some alternatives, the first concentration
range is at least 50 nM-100 nM and the second concentration range
is at least 75 to 150 nM. In some alternatives, the first
concentration is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or
any concentration that is between a range of concentrations defined
by any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation. In some alternatives, the subject is human.
[0111] Several of the material and methods are described in greater
detail below.
[0112] Plasmids.
[0113] The pMC_T3/GFP-T2A-DHFRdm mini-circle (MC) plasmid that
carries the T3 SB transposon cassette containing an EF1a promoter,
maxGFP gene, Thoseaasigna virus 2A peptide (T2A) and a double
mutant of dihydrofolate reductase (DHFRdm) insensitive to
methotrexate (MTX) was constructed using pMC_T3/eGFP_IRES_FGFR
(Nucleic Acids Research, 2012, 1-10 doi:10.1093/nar/gks213,
incorporated in its entirety herein) as a backbone, implementing
the cloning strategy described previously (Cold Spring Harbor
Protoc; 2012; doi:10.1101/pdb.ip067876) to create the
GFP-T2A-DHFRdm cassette. MaxGFP (Lonza) and
pEGFRt-T2A-IMPDHdm-T2A-DHFRdm (generously provided by Michael
Jensen) plasmids were used as templates for PCR. BmtI and BamHI
sites were introduced for swapping genes for fluorescent proteins.
Plasmid MC_SB100X was described previously (Nucleic Acids Research,
2012, 1-10 doi:10.1093/nar/gks213, incorporated in its entirety
herein). Minicircles were produced and purified according to the
System Biosciences user manual for minicircle DNA vector
technology. All plasmids were amplified under endotoxin free
conditions using an Endofree Plasmid Kit (Qiagen).
[0114] H9 Culture and Transfection.
[0115] H9 cells were cultured in DMEM with 10% FBS. The optimized
nucleofection protocol for H9 cells (Lonza) was followed (program
X-001, Nucleofector Kit V). Per nucleofection, 1.times.10.sup.6
cells were used with varying amounts of MC DNA. Cells were grown
for a week after nucleofection to achieve stable transfection. For
MTX selection, cells were cultured in DMEM with 10% FBS
supplemented with different concentrations of MTX.
[0116] Flow Cytometry Analysis.
[0117] Live cells were selected based on propidium iodide exclusion
by adding propidium iodide in the flow cytometry buffer to 2 ug/ml.
Flow cytometry analysis was carried out on a MACSQuant Analyzer
(Miltenyi Biotec) and LSRII (BD Biosciences). Collected data was
analyzed with FlowJo software. Appropriate negative controls
(untransfected H9 cells with and without propidium iodide staining,
as well as cells transfected with single genes for GFP, BFP, and
mCherry) were used for compensation and gating. A Becton Dickinson
FACSAria II was used for cell sorting. Part of flow cytometry work
was conducted at the UW Immunology Flow Cytometry Facility.
[0118] Determination of Transposon Copy Number.
[0119] Genomic DNA was extracted with Puregene Kit A according to
the manufacturer's instructions (Qiagen), and qPCR was performed
using a 7300 Real-Time PCR System (Applied Biosystems) using
Universal SYBR Green Supermix (BioRad). Primers for qPCR were
designed using Primer3 software: maxGFP forward primer:
5'-ACAAGATCATCCGCAGCAAC-3' (SEQ ID NO: 4); reverse primer:
5'-TTGAAGTGCATGTGGCTGTC-3'(SEQ ID NO: 5); GAPDH forward primer:
5'-ACAACTTTGGTATCGTGGAAGG-3'(SEQ ID NO: 6); GAPDH reverse primer:
5'-GCCATCACGCCACAGTTTC-3' (SEQ ID NO: 7). MaxGFP primers are
specific for the maxGFP gene in the transposon. Standard curves
were generated using genomic DNA of a H9 clone with a single
insertion of transposon ("gold standard") obtained by limiting
dilution method. Copy number was calculated using the AACT method
(Schmittgen, T. D. and Livak, K. J. (2008), incorporated in its
entirety herein).
[0120] Characterization of SBTS Integration Distribution.
[0121] A population of T3/GFP-T2A-DHFRdm transfected-H9 cells
selected with 200 nM MTX was plated in 96 well plates at a
concentration of 0.5 cells/well in DMEM 10% FBS along with
irradiated (5000 R) H9 feeder cells at 5,000 cells/well. Plates
were incubated for 2-3 weeks, after which clonal populations were
moved to larger plates and expanded. GFP expression was confirmed
by flow cytometry. Relative RT-qPCR analysis was performed using
DNA of 60 individual clones in order to determine transposon copy
number.
[0122] Optimization of Stable Gene Transfer to H9 Cells.
[0123] Minicircle constructs, which have bacterial plasmid
sequences removed, were used for all gene transfer studies.
Minicircles can be generated as described previously by Kay et al.
and colleagues (Chen, Z. Y.; He, C. Y.; Ehrhardt, A.; Kay, M. A.
Molecular Therapy 2003, 8, 495-500 and Kay, M. A.; He, C. Y.; Chen,
Z. Y. Nat. Biotechnol. 2010, 28, 1287-U96; incorporated herein by
reference in their entirety). Three reporter minicircles containing
transposons expressing different fluorescent proteins (maxGFP,
mCherry, or BFP) under the EF1 alpha promoter were constructed. The
selection gene, a double mutant of dihydrofolate reductase (DHFRdm)
that confers metabolic resistance to MTX, was cloned in frame after
the T2A sequence. The SB100X transposase gene was also prepared in
a separate minicircle construct for co-delivery with transposon
minicircles.
[0124] There are four transposase binding sites in a transposon
(two per inverted terminal repeat). Bound transposase were proposed
to interact with each other to promote juxtaposition of the two
transposon ends. Overexpression of transposase has been
hypothesized to lead to inhibition of transposition due to
interaction of free transposase with bound transposase, thus
preventing the juxtaposition step. Therefore, the optimal
transposon/transposase ratio needed to be determined whether these
genes are delivered on separate constructs. Reports of the
inhibition phenomenon have been varied.
[0125] The efficiency of transient transfection were evaluated at
24 hours post-nucleofection and at stable transposition (7 days
post-nucleofection) at various transposon/transposase ratios using
the reporter minicircle expressing maxGFP by flow cytometry.
Attention is drawn to FIG. 2, which shows the optimization of
transposon:transposase ratio. The H9 T-cell line was used as the
transfection test-bed. Initial transfection efficiency ranged from
47.5%.+-.2.2% to 66.9%.+-.4.5%, increasing with increased amount of
transposase minicircle. In the absence of transposase, minimal
stable transfection (<1%) was detected 7 days
post-nucleofection. The percentage of GFP.sup.+ cells increased
with the transposon/transposase ratio, reaching 39.2%.+-.3.0% at
1:4 ratio, which reflects 58.6% integration efficiency of the
initial transiently-integrated population. Higher ratios were not
tested due to reduced cell viability. The overexpression inhibition
effect was not observed in this tested range of
transposon/transposase ratios. Therefore, from the results, the
transduction experiments were carried out using this optimized
transposon/transposase ratio of 1:4.
[0126] Selection of Engineered Cells with Methotrexate.
[0127] It was hypothesized that cells can be selected with multiple
integration events using higher MTX concentrations due to increased
selection pressure for DHFRdm expression. Cells stably transduced
with the T3/maxGFP-T2A-DHRFdm transposon were therefore grown in
the presence of increasing MTX concentrations (ranging from 50 to
200 nM) and GFP expression was evaluated by flow cytometry over 10
days. Attention is drawn to FIG. 3, which shows the effect of
methotrexate (MTX) concentration during selection. The initial
selection efficiency, assessed with 3 days of MTX selection, was
decreased with increasing MTX concentration (FIG. 3, panel A).
However, populations with >94% GFP+ cells were obtained by 7
days post-selection under all conditions. The mean GFP fluorescence
in GFP.sup.+ cells increased with selection pressure (FIG. 3, panel
B); the mean fluorescence in cells selected with 200 nM MTX was
6.4-fold higher than unselected cells and 3.3-fold higher than
cells selected with 50 nM MTX. As shown, the positive correlation
between mean GFP expression in GFP+ cells and MTX concentration
suggests that increasing MTX concentration selects for cells with
increased DHFRdm expression and therefore, multiple integration
events.
[0128] The amplified cell populations selected with 2 weeks of MTX
treatment maintained most of their transgene expression even upon
MTX withdrawal up to 4 weeks. Attention is drawn to FIG. 4, which
shows the transgene persistence after methotrexate (MTX)
withdrawal. Four weeks post-MTX withdrawal, the GFP.sup.+
population remained >90% in all populations (FIG. 4, panel A),
although cells selected with 200 nM MTX had the highest GFP.sup.+
population (97%), likely due to selection of cells with multiple
integration events. The mean GFP expression in all populations
decreased by 21%, 27%, and 28% for 200 nM, 100 nM, and 50 nM MTX
selection, respectively by 4 weeks post-MTX withdrawal (FIG. 4,
panel B). As such, the decrease in mean GFP expression might be due
to promoter silencing or preferential expansion of cells with lower
GFP expression at the absence of selective pressure.
[0129] Analysis of Distribution of Integration.
[0130] To test the hypothesis that increased MTX selection pressure
would select for cells with multiple integration events, the
average number of transposon copy numbers in MTX-selected cell
populations was determined using RT-qPCR with GFP primers. First, a
"gold standard" clone with a single copy of integrated transposon
was generated by limiting dilution method. The average number of
integrations in the original stably-transduced population before
MTX selection was determined by RT-qPCR analysis of the GFP.sup.+
cells obtained by cell sorting. A trend of increasing average
transposon copy number with increasing selection pressure was
observed. Attention is drawn to FIG. 5A, which shows the transposon
copy number per human haploid genome. The average integration
events in cells selected with 200 nM MTX was 2.1.+-.0.45 compared
to an average of 1.1.+-.0.02 integration events in GFP+ cells
before MTX selection. RT-qPCR was performed in triplicates and data
represents a single biological replica for the sorted population
and 3 biological replicas for MTX selection. Statistical difference
was assessed by Student's t-test.
[0131] The distribution of integration events in cells selected
with 200 nM MTX was then analyzed. Sixty clones were generated by
limiting dilution method, GFP expression confirmed by flow
cytometry, genomic DNA isolated, and the number of GFP genes per
haploid genome analyzed by RT-PCR. The distribution of integration
events is shown in FIG. 5B. Most clones (.about.65%) contained
multiple copies of GFP. The average number of integration events
was 1.8 which correlates well with the average transposon copy
number in the cell population selected with 200 nM MTX (FIG.
5A).
[0132] Demonstration of Multiplexed Gene Integration.
[0133] Since it was previously demonstrated that a majority of the
population of transduced cells amplified under 200 nM MTX selection
pressure contained multiple transposon copies, multiplexed gene
integration was then assessed under these conditions. H9 cells were
nucleofected with three minicircles containing three different
reporter genes (maxGFP, mCherry, and BFP) in transposon cassettes
and the SB100X transposase minicircle. Stably-transduced cells were
then selected for 7 days with 200 nM and cell population assessed
by flow cytometry analysis. Attention is drawn to FIG. 6, which
shows the flow cytometric analysis of H9 cell populations
nucleofected with 3 minicircles carrying transposons with different
fluorescent proteins (MC_T3/GFP-T2A-DHFRdm, MC_T3/BFP-T2A-DHFRdm,
MC_T3/mCherry-T2A-DHFRdm), 2 .mu.g each and 6 .mu.g of MC_SB100X
DNA at different time points after transfection. Initial
transfection efficiency assessed 24 hours after nucleofection, was
68% (FIG. 6 panel A). The stably transduced population was
37.+-.1.4%, reflecting 54% integration efficiency. Of this
population, 19.+-.0.6% expressed two or three different fluorescent
proteins. Stably-transduced cells grown for 1 week in the presence
of 200 nM MTX were then analyzed; 23.+-.1.0% of this selected
population expressed all three reporter proteins (FIG. 6 panel A).
In order to further increase the population of cells expressing
triple transgenes, cells selected by 200 nM MTX were subjected to a
second selection step with increased MTX concentrations. Attention
is drawn to FIG. 7, which shows a bar graph demonstrating the
results of an H9 cell population stably transfected with three
transposons selected with 200 nM MTX for a week and then exposed to
higher MTX concentrations of 500 and 1000 nM. As shown, cells that
were cultured in 500 nM or 1000 nM MTX for an additional week
resulting in an increased population (38.5.+-.1.0% and
53.1.+-.0.3%, respectively) of cells expressing triple transgenes.
Cell viability rebounded to .about.70% during the second round of
selection due to further selection for overexpression of the DHFRdm
gene.
[0134] Stable Expression of Transposon DNA with Sleeping Beauty in
T-Cells with Methotrexate Selection.
[0135] Freshly thawed peripheral blood mononuclear cells (PBMCs)
were electroporated using Amaxa.TM. Nucleofector.TM. Technology.
The cells were transfected with 10 .mu.g of minicircle GFP
(MC_T3/GFP-T2A-DHFRdm) and different amounts of SB100X hyperactive
transposase (0, 5, or 10 .mu.g). Control cells were transfected
with either the non-minicircle pMAXGFP vector (10 ug) or with no
DNA. The cells were then stimulated with Miltenyi Transact beads 4
to 6 hours after transfection in the presence of IL-2 and IL-15.
The cells were then aliquoted so that there were 400,000 cells per
well of a 96-well U-bottomed plate. The cells were treated with
methotrexate at 7 days after transfection with 0, 25, 50, or 100 nM
of methotrexate. At days 2, 5, 7, 14, and 19, the cells were
counted by trypan blue, stained, and analyzed.
[0136] Attention is drawn to FIG. 8 which shows an example of the
flow analysis of the lymphocytes expressing GFP after minicircle
transfection. Single cells (panel B) from the lymphocyte window
(panel A) were analyzed for viability with the Invitrogen LIVE/DEAD
red stain (panel C). Live lymphocytes were then analyzed for CD8
and GFP expression (panel D). As shown in FIG. 8 panel D, after
selecting with 50 nM methotrexate, the majority of lymphocytes were
CD8+ and expressed GFP.
[0137] Stable Expression of Transposon DNA with Sleeping Beauty in
T-Cells after One Week.
[0138] In order to assess the expression of the minicircle DNA in
the week before MTX selection, flow analysis was performed and then
compared for cells transfected with pMAXGFP, 1:1 ratio of GFP
transposon:SB100X, 1:2 ratio of transposon:SB100X, mcGFP alone, or
no DNA control. Attention is drawn to FIG. 9, which shows the
results of a FACS assay on cells at two days (in the absence of
Transact beads) and five days (in the presence of Transact beads)
after electroporation. As shown, there is a loss of GFP expression
over time without MTX. However, GFP expression persists in cells
transfected with GFP transposon DNA only if there were
co-transfected with SB100X transposase.
[0139] Attention is drawn to FIG. 10, which shows graphs of the
levels of GFP expression and cell growth from days 2 to 7. As shown
in panel A of FIG. 10, the amounts of percent GFP expression
decreases over time (pMAXGFP (10 ug), mcGFP: MC_SB100X 1:1, and
mcGFP: MC_SB100X 2:1). There was a slow increase of live cells in
the presence of Transact beads (panel B), but not without the beads
(panel C), indicating the importance of the beads for cell
growth.
[0140] Cell Selection with MTX for 7 Days and 12 Days.
[0141] After 1 week, samples of the transfected cells were exposed
to different levels of MTX (25, 50, or 100 nM) to enrich for cells
expressing the minicircle transposon. Cells that stably express the
DHFRdm MTX-resistance gene as well as GFP due to transposase
integration should survive higher MTX concentrations. Attention is
drawn to FIG. 11, which shows the results of a FACS assay of the
transfected cells after treatment with 100 nM methotrexate for 7
days. In cells treated with 100 nM MTX, only cells transfected with
both transposon and transposase DNA express GFP. As shown, 100 nM
MTX selection was effective with GFP expression at both ratios of
mcGFP to SB at a 2:1 mcGFP: MC_SB100X ratio and at a 1:1 mcGFP:
MC_SB100X ratio after cell selection with MTX for seven days.
[0142] Attention is drawn to FIG. 12 and FIG. 13 which show the
results of a FACS assay of the transfected cells after treatment
with methotrexate for 7 and 12 days, respectively. Scatter plots
and CD8+/GFP expression for live lymphocytes are shown for each
condition. Percent GFP expression in lymphocytes is given in boxes
in FIG. 12.
[0143] As shown in FIG. 12 at 7 days, cells treated with 0 or 25 nM
MTX show about 25% or 75% of the cells expressing GFP,
respectively. In contrast, at least 90% of the cells express GFP at
50 and 100 nM MTX. As shown, MTX selection was equally effective
for enrichment of GFP expression at 50 nM and 100 nM, and at both
ratios of mcGFP to SB at a 2:1 mcGFP: MC_SB100X ratio and a 1:1
mcGFP: MC_SB100X ratio. As expected, in the absence of SB
transposase and in the no DNA controls there is no appreciable GFP
expression. Note that the expression of GFP is similar in CD8+ and
CD8- lymphocytes.
[0144] Stable Expression of Transposon DNA with Sleeping Beauty in
T-Cells with Methotrexate Selection-Cell Counts.
[0145] The cell growth of PBMC that stably expressing the
transposon DNA under MTX selection, was later assessed. Note that
due to stimulation with Transact beads and growth in the presence
of IL2 and IL-15, the majority of the surviving cells are T cells
by 1 week. As shown in FIG. 14, the amounts of live cells following
treatment with MTX at 0 nM, 25 nM, 50 nM, and 100 nM methotrexate
was determined with trypan blue cell counts at days 7, 14, and 19
days (days 0, 7, and 12 of MTX). In the control (0 nM MTX), the
number of live cells increased over time for all DNA conditions.
However, in the presence of MTX, only the cells that were
transfected with both the SB transposase and the minicircle
transposon that coexpresses GFP and the DHFRdm resistance gene were
able to divide, indicating that SB is required for stable
expression of the transposon.
[0146] Stable Expression of Transposon DNA with Sleeping Beauty in
T-Cells with Methotrexate Selection-GFP Expression.
[0147] The stable expression of transposon DNA with Sleeping Beauty
in T-cells during MTX selection was assessed by determining the GFP
expression of the transfected cells over 19 days. Attention is
drawn to FIG. 14 which shows increasing GFP expression over time in
cells transfected with transposon DNA and Sleeping Beauty in
T-cells following methotrexate selection starting at day 7 (0, 25,
50, and 100 nM). As shown in the control with no methotrexate
selection from days 2, 5, 7, 14, and 19, the expression of GFP in
the cells transfected with mcGFP and SB is maintained at
.about.20%, while the expression steadily decreases in the mcGFP
alone and pMAXGFP controls. In the presence of MTX selection, GFP
expression increases over time, with highest levels seen with 50
and 100 nM MTX. As shown, the ratios of mcGFP: MC_SB100X had no
difference between a ratio of 1:1 and 2:1. Additionally there was
minimal difference in the mean fluorescence intensity in cells that
were exposed to either 50 nM or 100 nM MTX. The low levels of GFP
expression (.about.20%) with mcGFP alone in the presence of MTX is
likely due to transposon-independent stable integration, and the
absolute number of cells in these conditions is very low as shown
in FIG. 14.
[0148] In one alternative, a gene delivery polynucleotide for
stable insertion of a nucleic acid into a gene, wherein the nucleic
acid for insertion is flanked by inverted terminal repeat gene
sequences in the gene delivery polynucleotide and wherein the gene
delivery polynucleotide is selectable is provided, wherein the gene
delivery polynucleotide comprises a first sequence, wherein the
first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene encoding a protein, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used as a
selection mechanism to selectively amplify cells transduced with
the gene delivery polynucleotide and wherein the fifth sequence is
optimized, a sixth sequence, wherein the sixth sequence comprises a
first attachment site (attP) and a seventh sequence, wherein the
seventh sequence comprises a second attachment site (attB) wherein
each of the first sequence, second sequence, third sequence, fourth
sequence, fifth sequence, sixth sequence, and seventh sequence have
a 5' terminus and a 3' terminus, and wherein the 3' terminus of the
first sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the gene delivery polynucleotide is a
minicircle. In some alternatives, the promoter region comprises an
EF1 promoter sequence. In some alternatives, the fourth sequence
comprises one, two, three, four, or five genes that encode
proteins. In some alternatives, the fourth sequence is codon
optimized to reduce the total GC/AT ratio of the fourth sequence.
In some alternatives, the fourth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
fourth sequence is a consensus sequence generated from a plurality
of nucleic acids that encode a plurality of related proteins. In
some alternatives, the fourth sequence is a consensus sequence
generated from a plurality of nucleic acids that encode a plurality
of related proteins, such as a plurality of antibody binding
domains, which are specific for the same epitope. In some
alternatives, the plurality of related proteins comprise a
plurality of antibody binding domains, wherein the plurality of
antibody binding domains are specific for the same epitope. In some
alternatives, the fifth sequence is codon optimized to reduce the
total GC/AT ratio of the fifth sequence. In some alternatives, the
fifth sequence is optimized by codon optimization for expression in
humans. In some alternatives, the protein is a protein for therapy.
In some alternatives, the codon optimization and/or consensus
sequence is generated by comparing the variability of sequence
and/or nucleobases utilized in a plurality of related sequences. In
some alternatives, the protein comprises an antibody or a portion
thereof, which may be humanized. In some alternatives, the double
mutant of dihydrofolate reductase comprises amino acid mutations of
L22F and F31S.
[0149] In some alternatives, a method of generating engineered
multiplexed T-cells for adoptive T-cell immunotherapy is provided,
wherein the method comprises providing a gene delivery
polynucleotide as described herein, introducing the gene delivery
polynucleotide into a T-cell, providing a vector encoding a
Sleeping Beauty transposase, introducing the vector encoding the
Sleeping Beauty transposase into the T-cell, selecting the cells
comprising the gene delivery polynucleotide wherein selecting
comprises a first round of selection and a second round of
selection, wherein the first round of selection comprises adding a
selection reagent at a first concentration range and the second
round of selection comprises adding the selection reagent at a
second concentration range, wherein the second concentration range
is higher than the first concentration range and, wherein the
second concentration range is at least 1.5 fold higher than that of
the first concentration range and isolating the T-cells expressing
a phenotype under selective pressure. In some alternatives, the
gene delivery polynucleotide comprises a first sequence, wherein
the first sequence comprises a first inverted terminal repeat gene
sequence, a second sequence, wherein the second sequence comprises
a second inverted terminal repeat gene sequence, a third sequence,
wherein the third sequence comprises a promoter region sequence, a
fourth sequence, wherein the fourth sequence comprises at least one
gene encoding a protein, and wherein the fourth sequence is
optimized, a fifth sequence, wherein the fifth sequence comprises
at least one selectable marker cassette encoding a double mutant of
dihydrofolate reductase, wherein the double mutant of dihydrofolate
reductase has a 15,000 fold or about 15,000 fold reduced affinity
for methotrexate, wherein the methotrexate can be used as a
selection mechanism to selectively amplify cells transduced with
the gene delivery polynucleotide and wherein the fifth sequence is
optimized, a sixth sequence, wherein the sixth sequence comprises a
first attachment site (attP) and a seventh sequence, wherein the
seventh sequence comprises a second attachment site (attB) wherein
each of the first sequence, second sequence, third sequence, fourth
sequence, fifth sequence, sixth sequence, and seventh sequence have
a 5' terminus and a 3' terminus, and wherein the 3' terminus of the
first sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the promoter region comprises an EF1 promoter
sequence. In some alternatives, the fourth sequence comprises one,
two, three, four, or five genes that encode proteins. In some
alternatives, the fourth sequence is codon optimized to reduce the
total GC/AT ratio of the fourth sequence. In some alternatives, the
fourth sequence is optimized by codon optimization for expression
in humans. In some alternatives, the fourth sequence is a consensus
sequence generated from a plurality of nucleic acids that encode a
plurality of related proteins. In some alternatives, the fourth
sequence is a consensus sequence generated from a plurality of
nucleic acids that encode a plurality of related proteins, such as
a plurality of antibody binding domains, which are specific for the
same epitope. In some alternatives, the plurality of related
proteins comprise a plurality of antibody binding domains, wherein
the plurality of antibody binding domains are specific for the same
epitope. In some alternatives, the fifth sequence is codon
optimized to reduce the total GC/AT ratio of the fifth sequence. In
some alternatives, the fifth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
protein is a protein for therapy. In some alternatives, the codon
optimization and/or consensus sequence is generated by comparing
the variability of sequence and/or nucleobases utilized in a
plurality of related sequences. In some alternatives, the protein
comprises an antibody or a portion thereof, which may be humanized.
In some alternatives, the double mutant of dihydrofolate reductase
comprises amino acid mutations of L22F and F31S. In some
alternatives, the introducing is performed by electroporation. In
some alternatives, the selecting is performed by increasing
selective pressure through the selective marker cassette. In some
alternatives, the selection reagent comprises an agent for
selection. In some alternatives, the agent for selection is
methotrexate. In some alternatives, the first concentration range
is at least 50 nM-100 nM and the second concentration range is at
least 75 to 150 nM. In some alternatives, the first concentration
is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 75 nM, 80 nM, 90 nM, 100 nM, 110 nM, 120 nM,
130 nM, 140 nM, or 150 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 75 nM-150 nM and the second concentration range is at
least 112.5 nM to 225 nM. In some alternatives, the first
concentration is 75 nM, 85 nM, 95 nM, 105 nM, 115 nM, 125 nM, 135
nM, 145 nM, or 150 nM or any concentration that is between a range
of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 112 nM, 122
nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM, 192 nM, 202 nM,
212 nM, or 225 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first concentration range
is at least 300 nM-675 nM and the first concentration range is at
least 450 nM to 1012 nM. In some alternatives, the first
concentration is 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM,
600 nM, 650 nM, or 675 nM or any concentration that is between a
range of concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 450 nM, 500
nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM,
1000 nM, or 1012 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations. In some alternatives, the first round of selection
comprises exposing the T-cells to the selection agent for 2, 3, 4,
5, 6 or 7 days before the second round of selection. In some
alternatives, the second round of selection comprises exposing the
T-cells to the selection agent for at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, or 14 days or any time that is between a range of
times defined by any two of the aforementioned time points before
isolation.
[0150] In some alternatives, a method of increasing protein
production in a T-cell is provided, wherein the method comprises
providing a polynucleotide described herein, introducing the
polynucleotide into a cell, providing a vector encoding a Sleeping
Beauty transposase, introducing the vector encoding the Sleeping
Beauty transposase into the T-cell, selecting the cells comprising
the gene delivery polynucleotide wherein selecting comprises a
first round of selection and a second round of selection, wherein
the first round of selection comprises adding a selection reagent
at a first concentration range and the second round of selection
comprises adding the selection reagent at a second concentration
range, wherein the second concentration range is higher than the
first concentration range and, wherein the second concentration
range is at least 1.5 fold higher than that of the first
concentration range and isolating the cells expressing a phenotype
under selective pressure. In some alternatives, the introducing is
performed by electroporation. In some alternatives, the selecting
is performed by increasing selective pressure through the selective
marker cassette. In some alternatives, the selection reagent
comprises an agent for selection. In some alternatives, the agent
for selection is methotrexate. In some alternatives, the first
concentration range is at least 50 nM-100 nM and the second
concentration range is at least 75 to 150 nM. In some alternatives,
the first concentration is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or
100 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 75 nM, 80 nM,
90 nM, 100 nM, 110 nM, 120 nM, 130 nM, 140 nM, or 150 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first concentration range is at least 75 nM-150 nM and the
second concentration range is at least 112.5 nM to 225 nM. In some
alternatives, the first concentration is 75 nM, 85 nM, 95 nM, 105
nM, 115 nM, 125 nM, 135 nM, 145 nM, or 150 nM or any concentration
that is between a range of concentrations defined by any two of the
aforementioned concentrations, and the second concentration range
is 112 nM, 122 nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM,
192 nM, 202 nM, 212 nM, or 225 nM or any concentration that is
between a range of concentrations defined by any two of the
aforementioned concentrations. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the first
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first concentration is 300 nM, 350 nM, 400 nM,
450 nM, 500 nM, 550 nM, 600 nM, 650 nM, or 675 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700
nM, 750 nM, 800 nM, 850 nM, 900 nM, 1000 nM, or 1012 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first round of selection comprises exposing the T-cells to the
selection agent for 2, 3, 4, 5, 6 or 7 days before the second round
of selection. In some alternatives, the second round of selection
comprises exposing the T-cells to the selection agent for at least
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days or any time that
is between a range of times defined by any two of the
aforementioned time points before isolation.
[0151] In some alternatives, the gene delivery polynucleotide
comprises a first sequence, wherein the first sequence comprises a
first inverted terminal repeat gene sequence, a second sequence,
wherein the second sequence comprises a second inverted terminal
repeat gene sequence, a third sequence, wherein the third sequence
comprises a promoter region sequence, a fourth sequence, wherein
the fourth sequence comprises at least one gene encoding a protein,
and wherein the fourth sequence is optimized, a fifth sequence,
wherein the fifth sequence comprises at least one selectable marker
cassette encoding a double mutant of dihydrofolate reductase,
wherein the double mutant of dihydrofolate reductase has a 15,000
fold or about 15,000 fold reduced affinity for methotrexate,
wherein the methotrexate can be used as a selection mechanism to
selectively amplify cells transduced with the gene delivery
polynucleotide and wherein the fifth sequence is optimized, a sixth
sequence, wherein the sixth sequence comprises a first attachment
site (attP) and a seventh sequence, wherein the seventh sequence
comprises a second attachment site (attB) wherein each of the first
sequence, second sequence, third sequence, fourth sequence, fifth
sequence, sixth sequence, and seventh sequence have a 5' terminus
and a 3' terminus, and wherein the 3' terminus of the first
sequence comprising the first inverted terminal repeat gene
sequence is adjacent to the 5' terminus of the third sequence, the
3' terminus of the third sequence is adjacent to the 5' terminus of
the fourth sequence, the 3' terminus of the fourth sequence is
adjacent to the 5' terminus of the fifth sequence and the 3'
terminus of the fifth sequence is adjacent to the 5' terminus of
the second sequence comprising a second inverted terminal repeat.
In some alternatives, the gene encoding the double mutant of human
dihydrofolate reductase comprises the DNA sequence:
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCA
AGAACGGGGACTTCCCCTGGCCACCGCTCAGGAATGAATCCAGATATTTCCAGA
GAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTA
AGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTA
ATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTC
CAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAAT
CACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTG
ACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCC
AGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGT
ATATGAGAAGAATGATTAA (SEQ ID NO: 2). In some alternatives, the
double mutant of human dihydrofolate reductase comprises the
protein sequence: MVGSLNCIVA VSQNMGIGKN GDFPWPPLRN ESRYFQRMTT
TSSVEGKQNL VIMGKKTWFS IPEKNRPLKG RINLVLSREL KEPPQGAHFL SRSLDDALKL
TEQPELANKV DMVWIVGGSS VYKEAMNHPG HLKLFVTRIM QDFESDTFFP EIDLEKYKLL
PEYPGVLSDV QEEKGIKYKF EVYEKND (SEQ ID NO: 3). In some alternatives,
the gene delivery polynucleotide is circular. In some alternatives,
the gene delivery polynucleotide is at least 1 kB to 5 kB. In some
alternatives, the gene delivery polynucleotide is a minicircle. In
some alternatives, the gene delivery polynucleotide is a
minicircle. In some alternatives, the promoter region comprises an
EF1 promoter sequence. In some alternatives, the fourth sequence
comprises one, two, three, four, or five genes that encode
proteins. In some alternatives, the fourth sequence is codon
optimized to reduce the total GC/AT ratio of the fourth sequence.
In some alternatives, the fourth sequence is optimized by codon
optimization for expression in humans. In some alternatives, the
fourth sequence is a consensus sequence generated from a plurality
of nucleic acids that encode a plurality of related proteins. In
some alternatives, the fourth sequence is a consensus sequence
generated from a plurality of nucleic acids that encode a plurality
of related proteins, such as a plurality of antibody binding
domains, which are specific for the same epitope. In some
alternatives, the plurality of related proteins comprise a
plurality of antibody binding domains, wherein the plurality of
antibody binding domains are specific for the same epitope. In some
alternatives, the fifth sequence is codon optimized to reduce the
total GC/AT ratio of the fifth sequence. In some alternatives, the
fifth sequence is optimized by codon optimization for expression in
humans. In some alternatives, the codon optimization and/or
consensus sequence is generated by comparing the variability of
sequence and/or nucleobases utilized in a plurality of related
sequences. In some alternatives, the protein comprises an antibody
or a portion thereof, which may be humanized. In some alternatives,
the double mutant of dihydrofolate reductase comprises amino acid
mutations of L22F and F31S. In some alternatives, the introducing
is performed by electroporation. In some alternatives, the
selecting is performed by increasing selective pressure through the
selective marker cassette. In some alternatives, the selection
reagent comprises an agent for selection. In some alternatives, the
agent for selection is methotrexate. In some alternatives, the
first concentration range is at least 50 nM-100 nM and the second
concentration range is at least 75 to 150 nM. In some alternatives,
the first concentration is 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or
100 nM or any concentration that is between a range of
concentrations defined by any two of the aforementioned
concentrations, and the second concentration range is 75 nM, 80 nM,
90 nM, 100 nM, 110 nM, 120 nM, 130 nM, 140 nM, or 150 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first concentration range is at least 75 nM-150 nM and the
second concentration range is at least 112.5 nM to 225 nM. In some
alternatives, the first concentration is 75 nM, 85 nM, 95 nM, 105
nM, 115 nM, 125 nM, 135 nM, 145 nM, or 150 nM or any concentration
that is between a range of concentrations defined by any two of the
aforementioned concentrations, and the second concentration range
is 112 nM, 122 nM, 132 nM, 142 nM, 152 nM, 162 nM, 172 nM, 182 nM,
192 nM, 202 nM, 212 nM, or 225 nM or any concentration that is
between a range of concentrations defined by any two of the
aforementioned concentrations. In some alternatives, the first
concentration range is at least 300 nM-675 nM and the first
concentration range is at least 450 nM to 1012 nM. In some
alternatives, the first concentration is 300 nM, 350 nM, 400 nM,
450 nM, 500 nM, 550 nM, 600 nM, 650 nM, or 675 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations, and the second
concentration range is 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700
nM, 750 nM, 800 nM, 850 nM, 900 nM, 1000 nM, or 1012 nM or any
concentration that is between a range of concentrations defined by
any two of the aforementioned concentrations. In some alternatives,
the first round of selection comprises exposing the T-cells to the
selection agent for 2, 3, 4, 5, 6 or 7 days before the second round
of selection. In some alternatives, the second round of selection
comprises exposing the T-cells to the selection agent for at least
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days or any time that
is between a range of times defined by any two of the
aforementioned time points before isolation.
[0152] In some alternatives, a method of treating, inhibiting, or
ameliorating cancer or a disease in a subject, the method
comprising administering to the subject a modified T-cell as
described herein. In some alternatives, the subject is human.
[0153] With respect to the use of substantially any plural and/or
singular terms herein, those having skill in the art can translate
from the plural to the singular and/or from the singular to the
plural as is appropriate to the context and/or application. The
various singular/plural permutations may be expressly set forth
herein for sake of clarity.
[0154] It will be understood by those within the art that, in
general, terms used herein, and especially in the appended claims
(e.g., bodies of the appended claims) are generally intended as
"open" terms (e.g., the term "including" should be interpreted as
"including but not limited to," the term "having" should be
interpreted as "having at least," the term "includes" should be
interpreted as "includes but is not limited to," etc.). It will be
further understood by those within the art that if a specific
number of an introduced claim recitation is intended, such an
intent will be explicitly recited in the claim, and in the absence
of such recitation no such intent is present. For example, as an
aid to understanding, the following appended claims may contain
usage of the introductory phrases "at least one" and "one or more"
to introduce claim recitations. However, the use of such phrases
should not be construed to imply that the introduction of a claim
recitation by the indefinite articles "a" or "an" limits any
particular claim containing such introduced claim recitation to
embodiments containing only one such recitation, even when the same
claim includes the introductory phrases "one or more" or "at least
one" and indefinite articles such as "a" or "an" (e.g., "a" and/or
"an" should be interpreted to mean "at least one" or "one or
more"); the same holds true for the use of definite articles used
to introduce claim recitations. In addition, even if a specific
number of an introduced claim recitation is explicitly recited,
those skilled in the art will recognize that such recitation should
be interpreted to mean at least the recited number (e.g., the bare
recitation of "two recitations," without other modifiers, means at
least two recitations, or two or more recitations). Furthermore, in
those instances where a convention analogous to "at least one of A,
B, and C, etc." is used, in general such a construction is intended
in the sense one having skill in the art would understand the
convention (e.g., "a system having at least one of A, B, and C"
would include but not be limited to systems that have A alone, B
alone, C alone, A and B together, A and C together, B and C
together, and/or A, B, and C together, etc.). In those instances
where a convention analogous to "at least one of A, B, or C, etc."
is used, in general such a construction is intended in the sense
one having skill in the art would understand the convention (e.g.,
"a system having at least one of A, B, or C" would include but not
be limited to systems that have A alone, B alone, C alone, A and B
together, A and C together, B and C together, and/or A, B, and C
together, etc.). It will be further understood by those within the
art that virtually any disjunctive word and/or phrase presenting
two or more alternative terms, whether in the description, claims,
or drawings, should be understood to contemplate the possibilities
of including one of the terms, either of the terms, or both terms.
For example, the phrase "A or B" will be understood to include the
possibilities of "A" or "B" or "A and B."
[0155] In addition, where features or aspects of the disclosure are
described in terms of Markush groups, those skilled in the art will
recognize that the disclosure is also thereby described in terms of
any individual member or subgroup of members of the Markush group
Sequence CWU 1
1
71352DNAArtificial SequenceSynthetic DNA transposon of copied
inverted repeat in description from Tanichthys albonubes
1cagttgaagt cggaagttta catacactta agttggagtc attaaaactc gtttttcaac
60tactccacaa atttcttgtt aacaaacaat agttttggca agtcagttag gacatctact
120ttgtgcatga cacaagtcat ttttccaaca attgtttaca gacagattat
ttcacttata 180attcactgta tcacaattcc agtgggtcag aagtttacat
acactaagtt gactgtgcct 240ttaaacagct tggaaaattc cagaaaatga
tgtcatggct ttagaagctt ctgatagact 300aattgacatc atttgagtca
attggaggtg tacctgtgga tgtatttcaa gg 3522564DNAArtificial
SequenceHuman protein with dihydrofolate reductase double mutation
2atggttggtt cgctaaactg catcgtcgct gtgtcccaga acatgggcat cggcaagaac
60ggggacttcc cctggccacc gctcaggaat gaatccagat atttccagag aatgaccaca
120acctcttcag tagaaggtaa acagaatctg gtgattatgg gtaagaagac
ctggttctcc 180attcctgaga agaatcgacc tttaaagggt agaattaatt
tagttctcag cagagaactc 240aaggaacctc cacaaggagc tcattttctt
tccagaagtc tagatgatgc cttaaaactt 300actgaacaac cagaattagc
aaataaagta gacatggtct ggatagttgg tggcagttct 360gtttataagg
aagccatgaa tcacccaggc catcttaaac tatttgtgac aaggatcatg
420caagactttg aaagtgacac gttttttcca gaaattgatt tggagaaata
taaacttctg 480ccagaatacc caggtgttct ctctgatgtc caggaggaga
aaggcattaa gtacaaattt 540gaagtatatg agaagaatga ttaa
5643187PRTArtificial SequenceHuman protein with dihydrofolate
reductase double mutation 3Met Val Gly Ser Leu Asn Cys Ile Val Ala
Val Ser Gln Asn Met Gly 1 5 10 15 Ile Gly Lys Asn Gly Asp Phe Pro
Trp Pro Pro Leu Arg Asn Glu Ser 20 25 30 Arg Tyr Phe Gln Arg Met
Thr Thr Thr Ser Ser Val Glu Gly Lys Gln 35 40 45 Asn Leu Val Ile
Met Gly Lys Lys Thr Trp Phe Ser Ile Pro Glu Lys 50 55 60 Asn Arg
Pro Leu Lys Gly Arg Ile Asn Leu Val Leu Ser Arg Glu Leu65 70 75 80
Lys Glu Pro Pro Gln Gly Ala His Phe Leu Ser Arg Ser Leu Asp Asp 85
90 95 Ala Leu Lys Leu Thr Glu Gln Pro Glu Leu Ala Asn Lys Val Asp
Met 100 105 110 Val Trp Ile Val Gly Gly Ser Ser Val Tyr Lys Glu Ala
Met Asn His 115 120 125 Pro Gly His Leu Lys Leu Phe Val Thr Arg Ile
Met Gln Asp Phe Glu 130 135 140 Ser Asp Thr Phe Phe Pro Glu Ile Asp
Leu Glu Lys Tyr Lys Leu Leu145 150 155 160 Pro Glu Tyr Pro Gly Val
Leu Ser Asp Val Gln Glu Glu Lys Gly Ile 165 170 175 Lys Tyr Lys Phe
Glu Val Tyr Glu Lys Asn Asp 180 185 420DNAArtificial SequencePrimer
4acaagatcat ccgcagcaac 20520DNAArtificial SequencePrimer
5ttgaagtgca tgtggctgtc 20622DNAArtificial SequencePrimer
6acaactttgg tatcgtggaa gg 22719DNAArtificial SequencePrimer
7gccatcacgc cacagtttc 19
* * * * *