U.S. patent application number 15/287940 was filed with the patent office on 2017-01-26 for genetic loci associated with phytophthora tolerance in soybean and methods of use.
The applicant listed for this patent is Pioneer Hi-Bred International, Inc.. Invention is credited to JULIAN M CHAKY, Holly J. Jessen, Joshua M. Shendelman, Paul A. Stephens, David M. Webb, John B. Woodward, Meizhu Yang.
Application Number | 20170022575 15/287940 |
Document ID | / |
Family ID | 50975042 |
Filed Date | 2017-01-26 |
United States Patent
Application |
20170022575 |
Kind Code |
A1 |
CHAKY; JULIAN M ; et
al. |
January 26, 2017 |
GENETIC LOCI ASSOCIATED WITH PHYTOPHTHORA TOLERANCE IN SOYBEAN AND
METHODS OF USE
Abstract
Various methods and compositions are provided for identifying
and/or selecting soybean plants or soybean germplasm with tolerance
or improved tolerance to Phytophthora infection. In certain
embodiments, the method comprises detecting at least one marker
locus that is associated with tolerance to Phytophthora infection.
In other embodiments, the method further comprises detecting at
least one marker profile or haplotype associated with tolerance to
Phytophthora infection. In further embodiments, the method
comprises crossing a selected soybean plant with a second soybean
plant. Further provided are markers, primers, probes and kits
useful for identifying and/or selecting soybean plants or soybean
germplasm with tolerance or improved tolerance to Phytophthora
infection.
Inventors: |
CHAKY; JULIAN M; (Urbandale,
IA) ; Jessen; Holly J.; (Chanhassen, MN) ;
Shendelman; Joshua M.; (Ankeny, IA) ; Stephens; Paul
A.; (Urbandale, IA) ; Webb; David M.;
(Zionsville, IN) ; Woodward; John B.; (Ankeny,
IA) ; Yang; Meizhu; (Johnston, IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Pioneer Hi-Bred International, Inc. |
Johnston |
IA |
US |
|
|
Family ID: |
50975042 |
Appl. No.: |
15/287940 |
Filed: |
October 7, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13782013 |
Mar 1, 2013 |
9493843 |
|
|
15287940 |
|
|
|
|
61740262 |
Dec 20, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01H 5/10 20130101; C12Q
2600/13 20130101; A01H 4/00 20130101; C12Q 2600/156 20130101; A01H
1/04 20130101; C12Q 2600/172 20130101; C12Q 1/6895 20130101; A01H
1/02 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A01H 1/04 20060101 A01H001/04 |
Claims
1. A method of identifying a first soybean plant or a first soybean
germplasm that displays tolerance or improved tolerance to
Phytophthora infection, the method comprising detecting in the
genome of said first soybean plant or in the genome of said first
soybean germplasm at least one marker locus that is associated with
the tolerance, wherein: (a) the at least one marker locus comprises
S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked
thereto on linkage group N; (b) the at least one marker locus
comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k
marker loci in Table 1B or a marker closely linked thereto on
linkage group N; (c) the at least one marker locus comprises
S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a
marker closely linked thereto on linkage group J; (d) the at least
one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker
closely linked thereto on linkage group F; or (e) the at least one
marker locus comprises S08442-1, S08341-1 or a marker closely
linked thereto on linkage group G.
2. The method of claim 1, wherein at least two marker loci are
detected.
3. The method of claim 2, wherein the at least two marker loci
comprise a haplotype or a marker profile that is associated with
said tolerance.
4. The method of claim 1, wherein the germplasm is a soybean
variety.
5. The method of claim 1, wherein the method further comprises
selecting the first soybean plant or first soybean germplasm or a
progeny thereof having the at least one marker locus.
6. The method of claim 5, further comprising crossing the selected
first soybean plant or first soybean germplasm with a second
soybean plant or second soybean germplasm.
7. The method of claim 6, wherein the second soybean plant or
second soybean germplasm comprises an exotic soybean strain or an
elite soybean strain.
8. The method of claim 1, wherein the detecting comprises DNA
sequencing of at least one of said marker loci.
9. The method of claim 1, wherein the detecting comprises
amplifying at least one of said marker loci and detecting the
resulting amplified marker amplicon.
10. The method of claim 9, wherein the amplifying comprises: a)
admixing an amplification primer or amplification primer pair for
each marker locus being amplified with a nucleic acid isolated from
the first soybean plant or the first soybean germplasm, wherein the
primer or primer pair is complementary or partially complementary
to a variant or fragment of the genomic locus comprising the marker
locus, and is capable of initiating DNA polymerization by a DNA
polymerase using the soybean nucleic acid as a template; and b)
extending the primer or primer pair in a DNA polymerization
reaction comprising a DNA polymerase and a template nucleic acid to
generate at least one amplicon.
11. The method of claim 10, wherein said method comprises (a)
amplifying a variant or fragment of one or more polynucleotides
comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348,
1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359,
1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370,
1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381,
1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392,
1393 or 1394; (b) amplifying a variant or fragment of one or more
polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177,
178, 179 or 180; (c) amplifying a variant or fragment of one or
more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185
or 186; or (d) amplifying a variant or fragment of one or more
polynucleotides comprising SEQ ID NOs: 187, 188, 189 or 190.
12. The method of claim 10, wherein said primer or primer pair
comprises (a) a variant or fragment of one or more polynucleotides
comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348,
1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359,
1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370,
1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381,
1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392,
1393, 1394 or complements thereof; (b) a variant or fragment of one
or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176,
177, 178, 179, 180 or complements thereof; (c) a variant or
fragment of one or more polynucleotides comprising SEQ ID NOs: 181,
182, 183, 184, 185, 186 or complements thereof; or (d) a variant or
fragment of one or more polynucleotides comprising SEQ ID NOs: 187,
188, 189, 190 or complements thereof.
13. The method of claim 12, wherein said primer or primer pair
comprises a nucleic acid sequence comprising (a) a nucleic acid
sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants
or fragments thereof; (b) a nucleic acid sequence comprising SEQ ID
NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof; (c) a
nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments
thereof; or (d) a nucleic acid sequence comprising SEQ ID NOs: 93,
94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or
fragments thereof.
14. The method of claim 13, wherein said primer pair comprises: a)
SEQ ID NO: 1 and SEQ ID NO:2, SEQ ID NO: 9 and SEQ ID NO:10, SEQ ID
NO: 20 and SEQ ID NO:21, SEQ ID NO: 22 and SEQ ID NO: 23, SEQ ID
NO: 24 and SEQ ID NO: 25, SEQ ID NO: 36 and SEQ ID NO: 37, SEQ ID
NO: 38 and SEQ ID NO: 39 or SEQ ID NO: 1339 and SEQ ID NO: 1340;
(b) SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 46 and SEQ ID NO:
47, SEQ ID NO: 52 and SEQ ID NO: 53, SEQ ID NO: 58 and SEQ ID NO:
59, SEQ ID NO: 64 and SEQ ID NO: 65 or SEQ ID NO: 75 and SEQ ID NO:
76; (c) SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 89 and SEQ ID
NO: 90 or SEQ ID NO: 91 and SEQ ID NO: 92; or (d) SEQ ID NO: 95 and
SEQ ID NO: 96 or SEQ ID NO: 101 and SEQ ID NO: 102.
15. The method of claim 10, wherein the method further comprises
providing one or more labeled nucleic acid probes suitable for
detection of each marker locus being amplified.
16. The method of claim 15, wherein said labeled nucleic acid probe
comprises a nucleic acid sequence comprising: (a) a variant or
fragment of one or more polynucleotides comprising SEQ ID NOs: 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352,
1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363,
1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374,
1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385,
1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements
thereof; (b) a variant or fragment of one or more polynucleotides
comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or
complements thereof; (c) a variant or fragment of one or more
polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186
or complements thereof; or (d) a variant or fragment of one or more
polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or
complements thereof.
17. The method of claim 16, wherein the labeled nucleic acid probe
comprises: (a) a nucleic acid sequence comprising SEQ ID NOs: 105,
106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119,
120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342; (b) a nucleic
acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133,
134, 135, 136, 137, 138 or 139; (c) a nucleic acid sequence
comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148
or 149; or (d) a nucleic acid sequence comprising SEQ ID NOs: 150,
151, 152, 153 or 154.
18. An isolated polynucleotide capable of detecting a marker locus
of the soybean genome comprising: (a) S08291-1, S07292-1, S08242-1,
S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the
Rps1k marker loci in Table 1B or a marker closely linked thereto on
linkage group N; (b) S06862-1, S06863-1, S06864-1, S06865-1,
S11652-1, S11682-1 or a marker closely linked thereto on linkage
group J; (c) S09018-1, S08342-1, S07163-1 or a marker closely
linked thereto on linkage group F; or (d) S08442-1, S08341-1 or a
marker closely linked thereto on linkage group G.
19. The isolated polynucleotide of claim 18, wherein the
polynucleotide comprises: (a) a polynucleotide comprising: (i) SEQ
ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 1339 or 1340; (ii) SEQ ID NOs: 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77
or 78; (iii) SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91 or 92; or (iv) SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103 or 104; (b) a polynucleotide comprising: (i) SEQ
ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or
1342; (ii) SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136,
137, 138 or 139; (iii) SEQ ID NOs: 140, 141, 142, 143, 144, 145,
146, 147, 148 or 149; or (iv) SEQ ID NOs: 150, 151, 152, 153 or
154; (c) a polynucleotide having at least 90% sequence identity to
the polynucleotides set forth in parts (a) or (b); or (d) a
polynucleotide comprising at least 10 contiguous nucleotides of the
polynucleotides set forth in parts (a) or (b).
20. A kit for detecting or selecting at least one soybean plant or
soybean germplasm with tolerance or improved tolerance to
Phytophthora infection, the kit comprising: (a) primers or probes
for detecting one or more marker loci associated with tolerance to
Phytophthora infection, wherein the primers or probes are capable
of detecting a marker locus, wherein: (i) the at least one marker
locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a
marker closely linked thereto on linkage group N; (ii) the at least
one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1,
any of the Rps1k marker loci in Table 1B or a marker closely linked
thereto on linkage group N; (iii) the at least one marker locus
comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1,
S11682-1 or a marker closely linked thereto on linkage group J;
(iv) the at least one marker locus comprises S09018-1, S08342-1,
S07163-1 or a marker closely linked thereto on linkage group F; or
(v) the at least one marker locus comprises S08442-1, S08341-1 or a
marker closely linked thereto on linkage group G; and (b)
instructions for using the primers or probes for detecting the one
or more marker loci and correlating the detected marker loci with
predicted tolerance to Phytophthora infection.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. application Ser.
No. 13/782,013, filed Mar. 1, 2013, which claims the benefit of
U.S. Provisional Application No. 61/740,262, filed Dec. 20, 2012,
all of which are hereby incorporated herein in its entirety by
reference.
FIELD OF THE INVENTION
[0002] This invention relates to methods of identifying and/or
selecting soybean plants or germplasm that display tolerance or
improved tolerance to Phytophthora infection.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA
EFS-WEB
[0003] The official copy of the sequence listing is submitted
concurrently with the specification as a text file via EFS-Web, in
compliance with the American Standard Code for Information
Interchange (ASCII), with a file name of
20161006_3170USDIV_SeqLst.txt, a creation date of Oct. 6, 2016 and
a size of 785 KB. The sequence listing filed via EFS-Web is part of
the specification and is hereby incorporated in its entirety by
reference herein.
BACKGROUND
[0004] Soybeans (Glycine max L. Merr.) are a major cash crop and
investment commodity in North America and elsewhere. Soybean oil is
one of the most widely used edible oils, and soybeans are used
worldwide both in animal feed and in human food production.
Additionally, soybean utilization is expanding to industrial,
manufacturing, and pharmaceutical applications.
[0005] Phytophthora is a major soybean fungal pathogen that induces
stem and root rot in infected plants, causing severe losses in
soybean viability and overall yield. Phytophthora root rot is
caused by a pathogenic infection of Phytophthora sojae. Resistance
to Phytophthora infection is conditioned by naturally occurring
variation at the Resistance to Phytophthora sojae (Rps) loci. As
races of Phytophthora in the fields shift, previously effective
resistance sources are breaking down, causing damage and
compromised yields in grower fields.
[0006] There remains a need for soybean plants with tolerance or
improved tolerance to Phytophthora infection and methods for
identifying and selecting such plants.
SUMMARY
[0007] Various methods and compositions are provided for
identifying and/or selecting soybean plants or soybean germplasm
with tolerance or improved tolerance to Phytophthora infection. In
certain embodiments, the method comprises detecting at least one
marker locus that is associated with tolerance to Phytophthora
infection. In other embodiments, the method further comprises
detecting at least one marker profile or haplotype associated with
tolerance to Phytophthora infection. In further embodiments, the
method comprises crossing a selected soybean plant with a second
soybean plant. Further provided are markers, primers, probes and
kits useful for identifying and/or selecting soybean plants or
soybean germplasm with tolerance or improved tolerance to
Phytophthora infection.
BRIEF DESCRIPTION OF THE FIGURES
[0008] FIG. 1 A-C provides a genetic map for loci on linkage group
(LG) N.
[0009] FIG. 2 A-D provides a genetic map for loci on LG F.
[0010] FIG. 3 A-C provides a genetic map for loci on LG J.
[0011] FIG. 4 A-E provides a genetic map for loci on LG G.
DETAILED DESCRIPTION
[0012] Before describing the present invention in detail, it is to
be understood that this invention is not limited to particular
embodiments, which can, of course, vary. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to be
limiting.
[0013] Certain definitions used in the specification and claims are
provided below. In order to provide a clear and consistent
understanding of the specification and claims, including the scope
to be given such terms, the following definitions are provided:
[0014] As used in this specification and the appended claims, terms
in the singular and the singular forms "a," "an," and "the," for
example, include plural referents unless the content clearly
dictates otherwise. Thus, for example, reference to "plant," "the
plant," or "a plant" also includes a plurality of plants; also,
depending on the context, use of the term "plant" can also include
genetically similar or identical progeny of that plant; use of the
term "a nucleic acid" optionally includes, as a practical matter,
many copies of that nucleic acid molecule; similarly, the term
"probe" optionally (and typically) encompasses many similar or
identical probe molecules.
[0015] Additionally, as used herein, "comprising" is to be
interpreted as specifying the presence of the stated features,
integers, steps, or components as referred to, but does not
preclude the presence or addition of one or more features,
integers, steps, or components, or groups thereof. Thus, for
example, a kit comprising one pair of oligonucleotide primers may
have two or more pairs of oligonucleotide primers. Additionally,
the term "comprising" is intended to include examples encompassed
by the terms "consisting essentially of" and "consisting of."
Similarly, the term "consisting essentially of" is intended to
include examples encompassed by the term "consisting of."
[0016] "Agronomics," "agronomic traits," and "agronomic
performance" refer to the traits (and underlying genetic elements)
of a given plant variety that contribute to yield over the course
of a growing season. Individual agronomic traits include emergence
vigor, vegetative vigor, stress tolerance, disease resistance or
tolerance, insect resistance or tolerance, herbicide resistance,
branching, flowering, seed set, seed size, seed density,
standability, threshability, and the like.
[0017] "Allele" means any of one or more alternative forms of a
genetic sequence. In a diploid cell or organism, the two alleles of
a given sequence typically occupy corresponding loci on a pair of
homologous chromosomes. With regard to a SNP marker, allele refers
to the specific nucleotide base present at that SNP locus in that
individual plant.
[0018] The term "amplifying" in the context of nucleic acid
amplification is any process whereby additional copies of a
selected nucleic acid (or a transcribed form thereof) are produced.
An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid
that is produced by amplifying a template nucleic acid by any
available amplification method.
[0019] An "ancestral line" is a parent line used as a source of
genes, e.g., for the development of elite lines.
[0020] An "ancestral population" is a group of ancestors that have
contributed the bulk of the genetic variation that was used to
develop elite lines.
[0021] "Backcrossing" is a process in which a breeder crosses a
progeny variety back to one of the parental genotypes one or more
times.
[0022] The term "chromosome segment" designates a contiguous linear
span of genomic DNA that resides in planta on a single chromosome.
"Chromosome interval" refers to a chromosome segment defined by
specific flanking marker loci.
[0023] "Cultivar" and "variety" are used synonymously and mean a
group of plants within a species (e.g., Glycine max) that share
certain genetic traits that separate them from other possible
varieties within that species. Soybean cultivars are inbred lines
produced after several generations of self-pollinations.
Individuals within a soybean cultivar are homogeneous, nearly
genetically identical, with most loci in the homozygous state.
[0024] An "elite line" is an agronomically superior line that has
resulted from many cycles of breeding and selection for superior
agronomic performance. Numerous elite lines are available and known
to those of skill in the art of soybean breeding.
[0025] An "elite population" is an assortment of elite individuals
or lines that can be used to represent the state of the art in
terms of agronomically superior genotypes of a given crop species,
such as soybean.
[0026] An "exotic soybean strain" or an "exotic soybean germplasm"
is a strain or germplasm derived from a soybean not belonging to an
available elite soybean line or strain of germplasm. In the context
of a cross between two soybean plants or strains of germplasm, an
exotic germplasm is not closely related by descent to the elite
germplasm with which it is crossed. Most commonly, the exotic
germplasm is not derived from any known elite line of soybean, but
rather is selected to introduce novel genetic elements (typically
novel alleles) into a breeding program.
[0027] A "genetic map" is a description of genetic association or
linkage relationships among loci on one or more chromosomes (or
linkage groups) within a given species, generally depicted in a
diagrammatic or tabular form.
[0028] "Genotype" is a description of the allelic state at one or
more loci.
[0029] "Germplasm" means the genetic material that comprises the
physical foundation of the hereditary qualities of an organism. As
used herein, germplasm includes seeds and living tissue from which
new plants may be grown; or, another plant part, such as leaf,
stem, pollen, or cells, that may be cultured into a whole plant.
Germplasm resources provide sources of genetic traits used by plant
breeders to improve commercial cultivars.
[0030] An individual is "homozygous" if the individual has only one
type of allele at a given locus (e.g., a diploid individual has a
copy of the same allele at a locus for each of two homologous
chromosomes). An individual is "heterozygous" if more than one
allele type is present at a given locus (e.g., a diploid individual
with one copy each of two different alleles). The term
"homogeneity" indicates that members of a group have the same
genotype at one or more specific loci. In contrast, the term
"heterogeneity" is used to indicate that individuals within the
group differ in genotype at one or more specific loci.
[0031] "Introgression" means the entry or introduction of a gene,
QTL, haplotype, marker profile, trait, or trait locus from the
genome of one plant into the genome of another plant.
[0032] The terms "label" or "detectable label" refer to a molecule
capable of detection. A detectable label can also include a
combination of a reporter and a quencher, such as are employed in
FRET probes or TaqMan.TM. probes. The term "reporter" refers to a
substance or a portion thereof which is capable of exhibiting a
detectable signal, which signal can be suppressed by a quencher.
The detectable signal of the reporter is, e.g., fluorescence in the
detectable range. The term "quencher" refers to a substance or
portion thereof which is capable of suppressing, reducing,
inhibiting, etc., the detectable signal produced by the reporter.
As used herein, the terms "quenching" and "fluorescence energy
transfer" refer to the process whereby, when a reporter and a
quencher are in close proximity, and the reporter is excited by an
energy source, a substantial portion of the energy of the excited
state non-radiatively transfers to the quencher where it either
dissipates non-radiatively or is emitted at a different emission
wavelength than that of the reporter.
[0033] A "line" or "strain" is a group of individuals of identical
parentage that are generally inbred to some degree and that are
generally homozygous and homogeneous at most loci (isogenic or near
isogenic). A "subline" refers to an inbred subset of descendants
that are genetically distinct from other similarly inbred subsets
descended from the same progenitor. Traditionally, a subline has
been derived by inbreeding the seed from an individual soybean
plant selected at the F3 to F5 generation until the residual
segregating loci are "fixed" or homozygous across most or all loci.
Commercial soybean varieties (or lines) are typically produced by
aggregating ("bulking") the self-pollinated progeny of a single F3
to F5 plant from a controlled cross between 2 genetically different
parents. While the variety typically appears uniform, the
self-pollinating variety derived from the selected plant eventually
(e.g., F8) becomes a mixture of homozygous plants that can vary in
genotype at any locus that was heterozygous in the originally
selected F3 to F5 plant. Marker-based sublines that differ from
each other based on qualitative polymorphism at the DNA level at
one or more specific marker loci are derived by genotyping a sample
of seed derived from individual self-pollinated progeny derived
from a selected F3-F5 plant. The seed sample can be genotyped
directly as seed, or as plant tissue grown from such a seed sample.
Optionally, seed sharing a common genotype at the specified locus
(or loci) are bulked providing a subline that is genetically
homogenous at identified loci important for a trait of interest
(e.g., yield, tolerance, etc.).
[0034] "Linkage" refers to the tendency for alleles to segregate
together more often than expected by chance if their transmission
was independent. Typically, linkage refers to alleles on the same
chromosome. Genetic recombination occurs with an assumed random
frequency over the entire genome. Genetic maps are constructed by
measuring the frequency of recombination between pairs of traits or
markers, the lower the frequency of recombination, and the greater
the degree of linkage.
[0035] "Linkage disequilibrium" is a non-random association of
alleles at two or more loci and can occur between unlinked markers.
It is based on allele frequencies within a population and is
influenced by but not dependent on linkage.
[0036] "Linkage group" (LG) refers to traits or markers that
generally co-segregate. A linkage group generally corresponds to a
chromosomal region containing genetic material that encodes the
traits or markers.
[0037] "Locus" is a defined segment of DNA.
[0038] A "map location" or "map position" is an assigned location
on a genetic map relative to linked genetic markers where a
specified marker can be found within a given species. Map positions
are generally provided in centimorgans (cM), unless otherwise
indicated, genetic positions provided are based on the Glycine max
consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci
50:960-968. A "physical position" or "physical location" or
"physical map location" is the position, typically in nucleotides
bases, of a particular nucleotide, such as a SNP nucleotide, on a
chromosome. Unless otherwise indicated, the physical position
within the soybean genome provided is based on the Glyma 1.0 genome
sequence described in Schmutz et al. (2010) Nature 463:178-183,
available from the Phytozome website
(phytozome-dot-net/soybean).
[0039] "Mapping" is the process of defining the association and
relationships of loci through the use of genetic markers,
populations segregating for the markers, and standard genetic
principles of recombination frequency.
[0040] "Marker" or "molecular marker" or "marker locus" is a term
used to denote a nucleic acid or amino acid sequence that is
sufficiently unique to characterize a specific locus on the genome.
Any detectable polymorphic trait can be used as a marker so long as
it is inherited differentially and exhibits linkage disequilibrium
with a phenotypic trait of interest.
[0041] "Marker assisted selection" refers to the process of
selecting a desired trait or traits in a plant or plants by
detecting one or more nucleic acids from the plant, where the
nucleic acid is linked to the desired trait, and then selecting the
plant or germplasm possessing those one or more nucleic acids.
[0042] "Haplotype" refers to a combination of particular alleles
present within a particular plant's genome at two or more linked
marker loci, for instance at two or more loci on a particular
linkage group. For instance, in one example, two specific marker
loci on LG-N are used to define a haplotype for a particular plant.
In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, or more linked marker loci are used to
define a haplotype for a particular plant.
[0043] As used herein, a "marker profile" means a combination of
particular alleles present within a particular plant's genome at
two or more marker loci which are not linked, for instance two or
more loci on two or more different linkage groups or two or more
chromosomes. For instance, in one example, a particular combination
of marker loci or a particular combination of haplotypes define the
marker profile of a particular plant.
[0044] The term "plant" includes reference to an immature or mature
whole plant, including a plant from which seed or grain or anthers
have been removed. Seed or embryo that will produce the plant is
also considered to be the plant.
[0045] "Plant parts" means any portion or piece of a plant,
including leaves, stems, buds, roots, root tips, anthers, seed,
grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls,
pods, flowers, shoots, stalks, tissues, tissue cultures, cells and
the like.
[0046] "Polymorphism" means a change or difference between two
related nucleic acids. A "nucleotide polymorphism" refers to a
nucleotide that is different in one sequence when compared to a
related sequence when the two nucleic acids are aligned for maximal
correspondence.
[0047] "Polynucleotide," "polynucleotide sequence," "nucleic acid,"
"nucleic acid molecule," "nucleic acid sequence," "nucleic acid
fragment," and "oligonucleotide" are used interchangeably herein to
indicate a polymer of nucleotides that is single- or
multi-stranded, that optionally contains synthetic, non-natural, or
altered RNA or DNA nucleotide bases. A DNA polynucleotide may be
comprised of one or more strands of cDNA, genomic DNA, synthetic
DNA, or mixtures thereof.
[0048] "Primer" refers to an oligonucleotide which is capable of
acting as a point of initiation of nucleic acid synthesis or
replication along a complementary strand when placed under
conditions in which synthesis of a complementary strand is
catalyzed by a polymerase. Typically, primers are about 10 to 30
nucleotides in length, but longer or shorter sequences can be
employed. Primers may be provided in double-stranded form, though
the single-stranded form is more typically used. A primer can
further contain a detectable label, for example a 5' end label.
[0049] "Probe" refers to an oligonucleotide that is complementary
(though not necessarily fully complementary) to a polynucleotide of
interest and forms a duplexed structure by hybridization with at
least one strand of the polynucleotide of interest. Typically,
probes are oligonucleotides from 10 to 50 nucleotides in length,
but longer or shorter sequences can be employed. A probe can
further contain a detectable label.
[0050] "Quantitative trait loci" or "QTL" refer to the genetic
elements controlling a quantitative trait.
[0051] "Recombination frequency" is the frequency of a crossing
over event (recombination) between two genetic loci. Recombination
frequency can be observed by following the segregation of markers
and/or traits during meiosis.
[0052] "Tolerance and "improved tolerance" are used interchangeably
herein and refer to any type of increase in resistance or tolerance
to, or any type of decrease in susceptibility. A "tolerant plant"
or "tolerant plant variety" need not possess absolute or complete
tolerance. Instead, a "tolerant plant," "tolerant plant variety,"
or a plant or plant variety with "improved tolerance" will have a
level of resistance or tolerance which is higher than that of a
comparable susceptible plant or variety.
[0053] "Self-crossing" or "self-pollination" or "selfing" is a
process through which a breeder crosses a plant with itself; for
example, a second generation hybrid F2 with itself to yield progeny
designated F2:3.
[0054] "SNP" or "single nucleotide polymorphism" means a sequence
variation that occurs when a single nucleotide (A, T, C, or G) in
the genome sequence is altered or variable. "SNP markers" exist
when SNPs are mapped to sites on the soybean genome.
[0055] The term "yield" refers to the productivity per unit area of
a particular plant product of commercial value. For example, yield
of soybean is commonly measured in bushels of seed per acre or
metric tons of seed per hectare per season. Yield is affected by
both genetic and environmental factors.
[0056] As used herein, an "isolated" or "purified" polynucleotide
or polypeptide, or biologically active portion thereof, is
substantially or essentially free from components that normally
accompany or interact with the polynucleotide or polypeptide as
found in its naturally occurring environment. Typically, an
"isolated" polynucleotide is free of sequences (optimally protein
encoding sequences) that naturally flank the polynucleotide (i.e.,
sequences located at the 5' and 3' ends of the polynucleotide) in
the genomic DNA of the organism from which the polynucleotide is
derived. For example, the isolated polynucleotide can contain less
than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequence that naturally flank the polynucleotide in
genomic DNA of the cell from which the polynucleotide is derived. A
polypeptide that is substantially free of cellular material
includes preparations of polypeptides having less than about 30%,
20%, 10%, 5%, or 1% (by dry weight) of contaminating protein
culture media or other chemical components.
[0057] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning:
A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold
Spring Harbor, 1989 (hereinafter "Sambrook").
[0058] Methods are provided for identifying and/or selecting a
soybean plant or soybean germplasm that displays tolerance or
improved tolerance to Phytophthora infection. The method comprises
detecting in the soybean plant or germplasm, or a part thereof, at
least one marker locus associated with tolerance to Phytophthora
infection. Also provided are isolated polynucleotides and kits for
use in identifying and/or detecting a soybean plant or soybean
germplasm that displays tolerance or improved tolerance to
Phytophthora infection, and soybean plants, cells, and/or seeds
comprising at least one marker locus conferring improved tolerance
to Phytophthora.
[0059] Provided herein, marker loci associated with tolerance to
Phytophthora infection have been identified and mapped to genomic
loci on linkage groups F, G, J and N.
[0060] The marker loci provided herein are associated with various
Phytophthora multi-race resistance genes. In some embodiments, the
marker loci are associated with the Rps1a, Rps1c, Rps1d or Rps1k
loci on linkage group N. In another embodiment, the marker loci are
associated with the Rps2 locus on linkage group J. In other
embodiments, the marker loci are associated with the Rps3a or Rps3c
loci on linkage group F. In yet another embodiment, the marker loci
are associated with the Rps6 loci on linkage group G.
[0061] These findings have important implications for soybean
production, as identifying markers that can be used for selection
of Phytophthora tolerance will greatly expedite the development of
Phytophthora tolerance into elite cultivars.
[0062] Marker loci, haplotypes and marker profiles associated with
tolerance or improved tolerance to Phytophthora infection, are
provided. Further provided are genomic loci that are associated
with soybean tolerance or improved tolerance to Phytophthora.
[0063] In certain embodiments, soybean plants or germplasm are
identified that have at least one favorable allele, marker locus,
haplotype or marker profile that positively correlates with
tolerance or improved tolerance to Phytophthora infection. However,
in other embodiments, it is useful for exclusionary purposes during
breeding to identify alleles, marker loci, haplotypes, or marker
profiles that negatively correlate with tolerance, for example, to
eliminate such plants or germplasm from subsequent rounds of
breeding.
[0064] In one embodiment, marker loci useful for identifying a
first soybean plant or first soybean germplasm that displays
tolerance or improved tolerance to Phytophthora infection are
associated with the Rps1a, Rps1c or Rps1d loci on linkage group N.
In a specific embodiment, the marker locus comprises one or more of
S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked
thereto on linkage group N.
[0065] In another embodiment, marker loci useful for identifying a
first soybean plant or first soybean germplasm that displays
tolerance or improved tolerance to Phytophthora infection are
associated with the Rps1k locus on linkage group N. In a specific
embodiment, the marker locus comprises one or more of S07963-2,
S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in
Table 1B or a marker closely linked thereto on linkage group N.
[0066] In another embodiment, marker loci useful for identifying a
first soybean plant or first soybean germplasm that displays
tolerance or improved tolerance to Phytophthora infection are
associated with the Rps2 locus on linkage group J. In a specific
embodiment, the marker locus comprises one or more of S06862-1,
S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker
closely linked thereto on linkage group J.
[0067] In another embodiment, marker loci useful for identifying a
first soybean plant or first soybean germplasm that displays
tolerance or improved tolerance to Phytophthora infection are
associated with the Rps3a or Rps3c loci on linkage group F. In a
specific embodiment, the marker locus comprises one or more of
S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on
linkage group F.
[0068] In another embodiment, marker loci useful for identifying a
first soybean plant or first soybean germplasm that displays
tolerance or improved tolerance to Phytophthora infection are
associated with the Rps6 locus on linkage group G. In a specific
embodiment, the marker locus comprises one or more of S08442-1,
S08341-1 or a marker closely linked thereto on linkage group G.
[0069] Non-limiting examples of marker loci located within, linked
to, or closely linked to these genomic loci are provided in Tables
1A and 1B and in FIG. 1 A-C, FIG. 2 A-D, FIG. 3 A-C and FIG. 4
A-D.
Table 1: Marker Positions for Marker Loci Associated with Tolerance
to Phytophthora.
TABLE-US-00001 TABLE 1A Flanking Physical Gene/ Linkage Public
Region Genetic Position Physical Allele Marker ID Locus Group
Markers* (CM)* (cM)* Region** Position** (R/S) Source S08291-1
Rps1a N satt009 22.58 3905604 G/A S07292-1 Rps1c N satt641 23.17
4464524 T/G S08242-1 Rps1c N 23.05 4343399 C/T Arksoy S16592-001
Rps1d N 22.58 3927035-37377161 3904033 A/T S07963-2 Rps1k N satt009
22.63 3951705 T/C S07372-1 Rps1k N satt530 24.46 5227883 C/T
S00009-01 Rps1k N satt009 22.61 3927056 C/T Kingwa S08013-1 Rps1k N
23.17 4458273 C/T S06862-1 Rps2 J satt431 81-90 83.71
36085130-37377161 36085130 T/G CNS, L76- 1988 S06863-1 Rps2 J 81-90
86.53 36085130-37377161 36692217 G/A CNS, L76- 1988 S06864-1 Rps2 J
81-90 88.83 36085130-37377161 37262813 T/C CNS, L76- 1988 S06865-1
Rps2 J 81-90 89.27 36085130-37377161 37377161 G/A CNS, L76- 1988
S11652-1 Rps2 J sat_395 81-90 86.95 36085130-37377161 36775973 G/T
CNS, L76- 1988 S11682-1 Rps2 J sat_395 81-90 85.69
36085130-37377161 36563064 G/T CNS, L76- 1988 S09018-1 Rps3a F
satt334 51.85 29110641 C/G PI171442 S08342-1 Rps3a F 51.79 29049150
[T/A]/ PI171442 [T/C]/ [C/A] S07163-1 Rps3c F satt334 51.79
29049184 T/C PI340046 S08442-1 Rps6 G sat_064 102.18 60745556 T/C
Archer S08341-1 Rps6 G 102.27 60777851 [A/T]/ Archer [G/T]
TABLE-US-00002 TABLE 1B Physical Allele Marker ID Locus LG Position
[R/S] Source Gm03:3915646 Rps1k N 3915646 [A/T] Kingwa Gm03:3917778
Rps1k N 3917778 [A/C] Kingwa Gm03:3918853 Rps1k N 3918853 [T/C]
Kingwa Gm03:3920367 Rps1k N 3920367 [A/G] Kingwa Gm03:3926721 Rps1k
N 3926721 [T/G] Kingwa Gm03:3926775 Rps1k N 3926775 [A/G] Kingwa
Gm03:3927474 Rps1k N 3927474 [T/A] Kingwa Gm03:3927724 Rps1k N
3927724 [G/T] Kingwa Gm03:3929330 Rps1k N 3929330 [A/G] Kingwa
Gm03:3929383 Rps1k N 3929383 [A/G] Kingwa Gm03:3930408 Rps1k N
3930408 [A/C] Kingwa Gm03:3930551 Rps1k N 3930551 [T/C] Kingwa
Gm03:3930806 Rps1k N 3930806 [T/C] Kingwa Gm03:3932629 Rps1k N
3932629 [T/G] Kingwa Gm03:3932974 Rps1k N 3932974 [T/C] Kingwa
Gm03:3933370 Rps1k N 3933370 [A/T] Kingwa Gm03:3933900 Rps1k N
3933900 [G/A] Kingwa Gm03:3933945 Rps1k N 3933945 [C/T] Kingwa
Gm03:3934403 Rps1k N 3934403 [G/A] Kingwa Gm03:3934964 Rps1k N
3934964 [G/A] Kingwa Gm03:3935036 Rps1k N 3935036 [G/A] Kingwa
Gm03:3935832 Rps1k N 3935832 [G/A] Kingwa Gm03:3935884 Rps1k N
3935884 [T/C] Kingwa Gm03:3939831 Rps1k N 3939831 [C/G] Kingwa
Gm03:3939836 Rps1k N 3939836 [G/A] Kingwa Gm03:3939936 Rps1k N
3939936 [T/A] Kingwa Gm03:3939939 Rps1k N 3939939 [G/T] Kingwa
Gm03:3940174 Rps1k N 3940174 [T/C] Kingwa Gm03:3940396 Rps1k N
3940396 [C/T] Kingwa Gm03:3940836 Rps1k N 3940836 [T/C] Kingwa
Gm03:3941262 Rps1k N 3941262 [A/G] Kingwa Gm03:3941484 Rps1k N
3941484 [A/G] Kingwa Gm03:3941769 Rps1k N 3941769 [T/G] Kingwa
Gm03:3942973 Rps1k N 3942973 [C/G] Kingwa Gm03:3943092 Rps1k N
3943092 [A/G] Kingwa Gm03:3944671 Rps1k N 3944671 [T/C] Kingwa
Gm03:3944738 Rps1k N 3944738 [C/A] Kingwa Gm03:3945112 Rps1k N
3945112 [A/T] Kingwa Gm03:3945208 Rps1k N 3945208 [T/C] Kingwa
Gm03:3947836 Rps1k N 3947836 [T/C] Kingwa Gm03:3947860 Rps1k N
3947860 [G/T] Kingwa Gm03:3949250 Rps1k N 3949250 [C/T] Kingwa
Gm03:3949680 Rps1k N 3949680 [A/C] Kingwa Gm03:3951187 Rps1k N
3951187 [G/A] Kingwa Gm03:3951201 Rps1k N 3951201 [G/A] Kingwa
Gm03:3951485 Rps1k N 3951485 [C/G] Kingwa Gm03:3951603 Rps1k N
3951603 [C/T] Kingwa Gm03:3951705 Rps1k N 3951705 [A/G] Kingwa
Gm03:3951715 Rps1k N 3951715 [G/C] Kingwa Gm03:3952778 Rps1k N
3952778 [T/A] Kingwa Gm03:3952811 Rps1k N 3952811 [T/A] Kingwa
Gm03:3955716 Rps1k N 3955716 [T/A] Kingwa Gm03:3956414 Rps1k N
3956414 [T/C] Kingwa Gm03:3958402 Rps1k N 3958402 [A/G] Kingwa
Gm03:3960626 Rps1k N 3960626 [T/C] Kingwa Gm03:3962904 Rps1k N
3962904 [A/G] Kingwa Gm03:3967880 Rps1k N 3967880 [T/G] Kingwa
Gm03:3968334 Rps1k N 3968334 [G/A] Kingwa Gm03:3971607 Rps1k N
3971607 [C/T] Kingwa Gm03:3971640 Rps1k N 3971640 [C/A] Kingwa
Gm03:3971692 Rps1k N 3971692 [T/C] Kingwa Gm03:3975817 Rps1k N
3975817 [T/C] Kingwa Gm03:3975824 Rps1k N 3975824 [T/A] Kingwa
Gm03:3976645 Rps1k N 3976645 [T/C] Kingwa Gm03:3980566 Rps1k N
3980566 [T/A] Kingwa Gm03:3981623 Rps1k N 3981623 [A/G] Kingwa
Gm03:3981822 Rps1k N 3981822 [A/G] Kingwa Gm03:3982138 Rps1k N
3982138 [C/T] Kingwa Gm03:3982678 Rps1k N 3982678 [A/C] Kingwa
Gm03:3984554 Rps1k N 3984554 [C/T] Kingwa Gm03:3986094 Rps1k N
3986094 [T/C] Kingwa Gm03:3987393 Rps1k N 3987393 [C/T] Kingwa
Gm03:3990954 Rps1k N 3990954 [T/G] Kingwa Gm03:3992071 Rps1k N
3992071 [C/A] Kingwa Gm03:3995556 Rps1k N 3995556 [C/T] Kingwa
Gm03:3996269 Rps1k N 3996269 [C/A] Kingwa Gm03:3996600 Rps1k N
3996600 [T/A] Kingwa Gm03:3997028 Rps1k N 3997028 [C/T] Kingwa
Gm03:3998157 Rps1k N 3998157 [G/C] Kingwa Gm03:3998162 Rps1k N
3998162 [G/A] Kingwa Gm03:3998381 Rps1k N 3998381 [T/C] Kingwa
Gm03:3998421 Rps1k N 3998421 [T/C] Kingwa Gm03:3999241 Rps1k N
3999241 [T/G] Kingwa Gm03:3999386 Rps1k N 3999386 [C/A] Kingwa
Gm03:3999666 Rps1k N 3999666 [A/G] Kingwa Gm03:4000684 Rps1k N
4000684 [C/G] Kingwa Gm03:4001327 Rps1k N 4001327 [A/G] Kingwa
Gm03:4001783 Rps1k N 4001783 [A/T] Kingwa Gm03:4002016 Rps1k N
4002016 [C/T] Kingwa Gm03:4005770 Rps1k N 4005770 [T/C] Kingwa
Gm03:4008187 Rps1k N 4008187 [G/A] Kingwa Gm03:4008673 Rps1k N
4008673 [A/G] Kingwa Gm03:4008687 Rps1k N 4008687 [A/G] Kingwa
Gm03:4010191 Rps1k N 4010191 [C/T] Kingwa Gm03:4018588 Rps1k N
4018588 [A/G] Kingwa Gm03:4019384 Rps1k N 4019384 [T/C] Kingwa
Gm03:4019896 Rps1k N 4019896 [A/G] Kingwa Gm03:4020751 Rps1k N
4020751 [T/C] Kingwa Gm03:4021281 Rps1k N 4021281 [G/A] Kingwa
Gm03:4021291 Rps1k N 4021291 [A/G] Kingwa Gm03:4022234 Rps1k N
4022234 [T/A] Kingwa Gm03:4022275 Rps1k N 4022275 [T/C] Kingwa
Gm03:4022530 Rps1k N 4022530 [A/T] Kingwa Gm03:4022872 Rps1k N
4022872 [A/G] Kingwa Gm03:4022934 Rps1k N 4022934 [A/G] Kingwa
Gm03:4023283 Rps1k N 4023283 [T/C] Kingwa Gm03:4023522 Rps1k N
4023522 [C/T] Kingwa Gm03:4024184 Rps1k N 4024184 [C/A] Kingwa
Gm03:4024294 Rps1k N 4024294 [T/C] Kingwa Gm03:4024485 Rps1k N
4024485 [A/G] Kingwa Gm03:4024630 Rps1k N 4024630 [T/C] Kingwa
Gm03:4024844 Rps1k N 4024844 [T/C] Kingwa Gm03:4025056 Rps1k N
4025056 [A/G] Kingwa Gm03:4026652 Rps1k N 4026652 [T/A] Kingwa
Gm03:4028481 Rps1k N 4028481 [G/T] Kingwa Gm03:4028849 Rps1k N
4028849 [A/G] Kingwa Gm03:4028961 Rps1k N 4028961 [A/G] Kingwa
Gm03:4029068 Rps1k N 4029068 [A/G] Kingwa Gm03:4029809 Rps1k N
4029809 [T/G] Kingwa Gm03:4031277 Rps1k N 4031277 [G/T] Kingwa
Gm03:4031983 Rps1k N 4031983 [C/A] Kingwa Gm03:4031997 Rps1k N
4031997 [G/C] Kingwa Gm03:4032705 Rps1k N 4032705 [T/C] Kingwa
Gm03:4035600 Rps1k N 4035600 [T/C] Kingwa Gm03:4035918 Rps1k N
4035918 [A/G] Kingwa Gm03:4036376 Rps1k N 4036376 [A/C] Kingwa
Gm03:4040874 Rps1k N 4040874 [A/G] Kingwa Gm03:4041301 Rps1k N
4041301 [T/C] Kingwa Gm03:4041795 Rps1k N 4041795 [A/G] Kingwa
Gm03:4042572 Rps1k N 4042572 [G/A] Kingwa Gm03:4042679 Rps1k N
4042679 [T/C] Kingwa Gm03:4042697 Rps1k N 4042697 [A/G] Kingwa
Gm03:4043007 Rps1k N 4043007 [A/G] Kingwa Gm03:4043140 Rps1k N
4043140 [A/G] Kingwa Gm03:4043823 Rps1k N 4043823 [T/G] Kingwa
Gm03:4043978 Rps1k N 4043978 [C/T] Kingwa Gm03:4044534 Rps1k N
4044534 [T/C] Kingwa Gm03:4044555 Rps1k N 4044555 [T/C] Kingwa
Gm03:4044972 Rps1k N 4044972 [A/G] Kingwa Gm03:4045630 Rps1k N
4045630 [A/G] Kingwa Gm03:4046313 Rps1k N 4046313 [C/A] Kingwa
Gm03:4049555 Rps1k N 4049555 [T/C] Kingwa Gm03:4049791 Rps1k N
4049791 [T/C] Kingwa Gm03:4049877 Rps1k N 4049877 [T/C] Kingwa
Gm03:4050197 Rps1k N 4050197 [A/G] Kingwa Gm03:4053685 Rps1k N
4053685 [T/C] Kingwa Gm03:4053838 Rps1k N 4053838 [T/C] Kingwa
Gm03:4054927 Rps1k N 4054927 [T/C] Kingwa Gm03:4055100 Rps1k N
4055100 [A/G] Kingwa Gm03:4055384 Rps1k N 4055384 [A/G] Kingwa
Gm03:4055427 Rps1k N 4055427 [T/C] Kingwa Gm03:4055483 Rps1k N
4055483 [A/G] Kingwa Gm03:4062751 Rps1k N 4062751 [A/C] Kingwa
Gm03:4062885 Rps1k N 4062885 [A/T] Kingwa Gm03:4064351 Rps1k N
4064351 [T/C] Kingwa Gm03:4064592 Rps1k N 4064592 [A/G] Kingwa
Gm03:4064759 Rps1k N 4064759 [T/G] Kingwa Gm03:4064811 Rps1k N
4064811 [T/C] Kingwa Gm03:4064957 Rps1k N 4064957 [C/T] Kingwa
Gm03:4065083 Rps1k N 4065083 [T/C] Kingwa Gm03:4066234 Rps1k N
4066234 [A/T] Kingwa Gm03:4066331 Rps1k N 4066331 [A/T] Kingwa
Gm03:4067099 Rps1k N 4067099 [A/T] Kingwa Gm03:4067514 Rps1k N
4067514 [T/A] Kingwa Gm03:4069037 Rps1k N 4069037 [T/G] Kingwa
Gm03:4069603 Rps1k N 4069603 [T/A] Kingwa Gm03:4070422 Rps1k N
4070422 [G/A] Kingwa Gm03:4072567 Rps1k N 4072567 [T/C] Kingwa
Gm03:4074190 Rps1k N 4074190 [T/C] Kingwa Gm03:4075232 Rps1k N
4075232 [G/A] Kingwa Gm03:4076404 Rps1k N 4076404 [T/A] Kingwa
Gm03:4078299 Rps1k N 4078299 [T/C] Kingwa Gm03:4078902 Rps1k N
4078902 [C/T] Kingwa Gm03:4080136 Rps1k N 4080136 [A/T] Kingwa
Gm03:4081056 Rps1k N 4081056 [T/A] Kingwa Gm03:4081889 Rps1k N
4081889 [A/G] Kingwa Gm03:4082200 Rps1k N 4082200 [G/A] Kingwa
Gm03:4082590 Rps1k N 4082590 [C/G] Kingwa Gm03:4082701 Rps1k N
4082701 [A/C] Kingwa Gm03:4082781 Rps1k N 4082781 [G/C] Kingwa
Gm03:4082871 Rps1k N 4082871 [A/G] Kingwa Gm03:4083114 Rps1k N
4083114 [T/C] Kingwa Gm03:4084001 Rps1k N 4084001 [G/T] Kingwa
Gm03:4084095 Rps1k N 4084095 [A/G] Kingwa Gm03:4085042 Rps1k N
4085042 [T/A] Kingwa Gm03:4085524 Rps1k N 4085524 [T/G] Kingwa
Gm03:4086286 Rps1k N 4086286 [A/T] Kingwa Gm03:4086887 Rps1k N
4086887 [T/C] Kingwa Gm03:4087383 Rps1k N 4087383 [T/C] Kingwa
Gm03:4088310 Rps1k N 4088310 [T/G] Kingwa Gm03:4090188 Rps1k N
4090188 [C/T] Kingwa Gm03:4092799 Rps1k N 4092799 [A/C] Kingwa
Gm03:4092928 Rps1k N 4092928 [T/C] Kingwa Gm03:4093195 Rps1k N
4093195 [G/A] Kingwa Gm03:4093240 Rps1k N 4093240 [T/C] Kingwa
Gm03:4097291 Rps1k N 4097291 [T/A] Kingwa Gm03:4097563 Rps1k N
4097563 [A/G] Kingwa Gm03:4097729 Rps1k N 4097729 [A/G] Kingwa
Gm03:4098328 Rps1k N 4098328 [A/T] Kingwa Gm03:4100831 Rps1k N
4100831 [A/T] Kingwa Gm03:4101257 Rps1k N 4101257 [A/T] Kingwa
Gm03:4103342 Rps1k N 4103342 [C/T] Kingwa Gm03:4103449 Rps1k N
4103449 [T/C] Kingwa Gm03:4103450 Rps1k N 4103450 [G/C] Kingwa
Gm03:4103515 Rps1k N 4103515 [T/C] Kingwa Gm03:4103547 Rps1k N
4103547 [T/C] Kingwa Gm03:4103633 Rps1k N 4103633 [T/C] Kingwa
Gm03:4104502 Rps1k N 4104502 [T/C] Kingwa Gm03:4106406 Rps1k N
4106406 [C/A] Kingwa Gm03:4109228 Rps1k N 4109228 [A/C] Kingwa
Gm03:4110012 Rps1k N 4110012 [C/T] Kingwa Gm03:4110449 Rps1k N
4110449 [A/G] Kingwa Gm03:4110821 Rps1k N 4110821 [G/A] Kingwa
Gm03:4111538 Rps1k N 4111538 [T/C] Kingwa Gm03:4113757 Rps1k N
4113757 [A/G] Kingwa Gm03:4116726 Rps1k N 4116726 [T/A] Kingwa
Gm03:4117330 Rps1k N 4117330 [T/G] Kingwa Gm03:4117375 Rps1k N
4117375 [G/A] Kingwa Gm03:4117779 Rps1k N 4117779 [C/G] Kingwa
Gm03:4117890 Rps1k N 4117890 [C/G] Kingwa Gm03:4117986 Rps1k N
4117986 [G/A] Kingwa Gm03:4120433 Rps1k N 4120433 [T/C] Kingwa
Gm03:4120705 Rps1k N 4120705 [G/A] Kingwa Gm03:4122180 Rps1k N
4122180 [C/T] Kingwa Gm03:4129251 Rps1k N 4129251 [T/C] Kingwa
Gm03:4129479 Rps1k N 4129479 [T/C] Kingwa Gm03:4129635 Rps1k N
4129635 [T/C] Kingwa Gm03:4130393 Rps1k N 4130393 [T/C] Kingwa
Gm03:4131257 Rps1k N 4131257 [T/G] Kingwa Gm03:4132032 Rps1k N
4132032 [C/A] Kingwa Gm03:4132192 Rps1k N 4132192 [A/G] Kingwa
Gm03:4133520 Rps1k N 4133520 [C/T] Kingwa Gm03:4134606 Rps1k N
4134606 [A/G] Kingwa Gm03:4134679 Rps1k N 4134679 [A/G] Kingwa
Gm03:4136487 Rps1k N 4136487 [T/C] Kingwa Gm03:4136724 Rps1k N
4136724 [T/G] Kingwa Gm03:4136742 Rps1k N 4136742 [T/C] Kingwa
Gm03:4136791 Rps1k N 4136791 [A/T] Kingwa Gm03:4136972 Rps1k N
4136972 [T/A] Kingwa Gm03:4137137 Rps1k N 4137137 [T/G] Kingwa
Gm03:4137521 Rps1k N 4137521 [C/T] Kingwa Gm03:4137540 Rps1k N
4137540 [G/A] Kingwa Gm03:4137645 Rps1k N 4137645 [A/G] Kingwa
Gm03:4138435 Rps1k N 4138435 [T/C] Kingwa Gm03:4138980 Rps1k N
4138980 [A/G] Kingwa
Gm03:4139156 Rps1k N 4139156 [A/G] Kingwa Gm03:4139395 Rps1k N
4139395 [C/A] Kingwa Gm03:4140035 Rps1k N 4140035 [C/T] Kingwa
Gm03:4140071 Rps1k N 4140071 [T/G] Kingwa Gm03:4140976 Rps1k N
4140976 [A/G] Kingwa Gm03:4141074 Rps1k N 4141074 [T/C] Kingwa
Gm03:4141090 Rps1k N 4141090 [A/T] Kingwa Gm03:4141251 Rps1k N
4141251 [T/C] Kingwa Gm03:4141363 Rps1k N 4141363 [T/C] Kingwa
Gm03:4141488 Rps1k N 4141488 [A/G] Kingwa Gm03:4142353 Rps1k N
4142353 [A/G] Kingwa Gm03:4142380 Rps1k N 4142380 [C/T] Kingwa
Gm03:4142693 Rps1k N 4142693 [T/C] Kingwa Gm03:4142800 Rps1k N
4142800 [T/C] Kingwa Gm03:4142810 Rps1k N 4142810 [T/C] Kingwa
Gm03:4143060 Rps1k N 4143060 [A/C] Kingwa Gm03:4143112 Rps1k N
4143112 [A/T] Kingwa Gm03:4143113 Rps1k N 4143113 [T/G] Kingwa
Gm03:4144137 Rps1k N 4144137 [T/C] Kingwa Gm03:4144350 Rps1k N
4144350 [T/C] Kingwa Gm03:4144639 Rps1k N 4144639 [T/C] Kingwa
Gm03:4145737 Rps1k N 4145737 [A/G] Kingwa Gm03:4145959 Rps1k N
4145959 [C/G] Kingwa Gm03:4145974 Rps1k N 4145974 [G/C] Kingwa
Gm03:4146284 Rps1k N 4146284 [A/G] Kingwa Gm03:4147289 Rps1k N
4147289 [C/G] Kingwa Gm03:4147425 Rps1k N 4147425 [C/T] Kingwa
Gm03:4148248 Rps1k N 4148248 [A/G] Kingwa Gm03:4148643 Rps1k N
4148643 [C/T] Kingwa Gm03:4148732 Rps1k N 4148732 [A/G] Kingwa
Gm03:4149880 Rps1k N 4149880 [A/G] Kingwa Gm03:4149919 Rps1k N
4149919 [A/G] Kingwa Gm03:4150189 Rps1k N 4150189 [C/T] Kingwa
Gm03:4150330 Rps1k N 4150330 [T/C] Kingwa Gm03:4151366 Rps1k N
4151366 [A/G] Kingwa Gm03:4152106 Rps1k N 4152106 [T/C] Kingwa
Gm03:4153221 Rps1k N 4153221 [A/T] Kingwa Gm03:4153413 Rps1k N
4153413 [A/T] Kingwa Gm03:4153505 Rps1k N 4153505 [C/T] Kingwa
Gm03:4153885 Rps1k N 4153885 [C/T] Kingwa Gm03:4154059 Rps1k N
4154059 [A/C] Kingwa Gm03:4156891 Rps1k N 4156891 [A/G] Kingwa
Gm03:4158622 Rps1k N 4158622 [G/T] Kingwa Gm03:4159661 Rps1k N
4159661 [C/G] Kingwa Gm03:4160698 Rps1k N 4160698 [C/T] Kingwa
Gm03:4162268 Rps1k N 4162268 [A/G] Kingwa Gm03:4163423 Rps1k N
4163423 [G/A] Kingwa Gm03:4164061 Rps1k N 4164061 [T/C] Kingwa
Gm03:4164065 Rps1k N 4164065 [T/C] Kingwa Gm03:4164142 Rps1k N
4164142 [A/G] Kingwa Gm03:4164401 Rps1k N 4164401 [A/G] Kingwa
Gm03:4164507 Rps1k N 4164507 [T/C] Kingwa Gm03:4164719 Rps1k N
4164719 [A/G] Kingwa Gm03:4164807 Rps1k N 4164807 [A/G] Kingwa
Gm03:4166307 Rps1k N 4166307 [C/A] Kingwa Gm03:4166432 Rps1k N
4166432 [G/A] Kingwa Gm03:4167439 Rps1k N 4167439 [C/T] Kingwa
Gm03:4167591 Rps1k N 4167591 [C/T] Kingwa Gm03:4167701 Rps1k N
4167701 [A/G] Kingwa Gm03:4168907 Rps1k N 4168907 [T/A] Kingwa
Gm03:4169729 Rps1k N 4169729 [A/G] Kingwa Gm03:4169784 Rps1k N
4169784 [A/G] Kingwa Gm03:4169863 Rps1k N 4169863 [G/A] Kingwa
Gm03:4169950 Rps1k N 4169950 [T/C] Kingwa Gm03:4169995 Rps1k N
4169995 [G/C] Kingwa Gm03:4171393 Rps1k N 4171393 [C/T] Kingwa
Gm03:4171766 Rps1k N 4171766 [A/T] Kingwa Gm03:4172171 Rps1k N
4172171 [A/C] Kingwa Gm03:4173195 Rps1k N 4173195 [A/G] Kingwa
Gm03:4173316 Rps1k N 4173316 [A/G] Kingwa Gm03:4173405 Rps1k N
4173405 [T/C] Kingwa Gm03:4173524 Rps1k N 4173524 [A/C] Kingwa
Gm03:4175127 Rps1k N 4175127 [A/G] Kingwa Gm03:4177056 Rps1k N
4177056 [A/T] Kingwa Gm03:4177689 Rps1k N 4177689 [A/G] Kingwa
Gm03:4177690 Rps1k N 4177690 [G/A] Kingwa Gm03:4178958 Rps1k N
4178958 [A/G] Kingwa Gm03:4179972 Rps1k N 4179972 [T/C] Kingwa
Gm03:4180458 Rps1k N 4180458 [A/G] Kingwa Gm03:4182337 Rps1k N
4182337 [G/A] Kingwa Gm03:4184380 Rps1k N 4184380 [T/G] Kingwa
Gm03:4184951 Rps1k N 4184951 [T/G] Kingwa Gm03:4184971 Rps1k N
4184971 [T/A] Kingwa Gm03:4185234 Rps1k N 4185234 [A/G] Kingwa
Gm03:4185400 Rps1k N 4185400 [G/A] Kingwa Gm03:4185863 Rps1k N
4185863 [T/C] Kingwa Gm03:4187256 Rps1k N 4187256 [A/G] Kingwa
Gm03:4188732 Rps1k N 4188732 [T/C] Kingwa Gm03:4189845 Rps1k N
4189845 [C/T] Kingwa Gm03:4189964 Rps1k N 4189964 [T/C] Kingwa
Gm03:4190679 Rps1k N 4190679 [G/C] Kingwa Gm03:4191313 Rps1k N
4191313 [A/G] Kingwa Gm03:4191519 Rps1k N 4191519 [T/C] Kingwa
Gm03:4192359 Rps1k N 4192359 [T/C] Kingwa Gm03:4192478 Rps1k N
4192478 [A/G] Kingwa Gm03:4192513 Rps1k N 4192513 [T/C] Kingwa
Gm03:4192621 Rps1k N 4192621 [C/T] Kingwa Gm03:4192738 Rps1k N
4192738 [G/A] Kingwa Gm03:4193009 Rps1k N 4193009 [T/C] Kingwa
Gm03:4193030 Rps1k N 4193030 [G/T] Kingwa Gm03:4193039 Rps1k N
4193039 [G/T] Kingwa Gm03:4193483 Rps1k N 4193483 [T/C] Kingwa
Gm03:4196188 Rps1k N 4196188 [T/C] Kingwa Gm03:4196542 Rps1k N
4196542 [T/C] Kingwa Gm03:4197697 Rps1k N 4197697 [T/A] Kingwa
Gm03:4197774 Rps1k N 4197774 [A/T] Kingwa Gm03:4198285 Rps1k N
4198285 [A/G] Kingwa Gm03:4198508 Rps1k N 4198508 [C/A] Kingwa
Gm03:4198711 Rps1k N 4198711 [A/C] Kingwa Gm03:4198914 Rps1k N
4198914 [A/G] Kingwa Gm03:4199748 Rps1k N 4199748 [G/A] Kingwa
Gm03:4200094 Rps1k N 4200094 [A/C] Kingwa Gm03:4203253 Rps1k N
4203253 [G/C] Kingwa Gm03:4203462 Rps1k N 4203462 [G/A] Kingwa
Gm03:4203594 Rps1k N 4203594 [C/T] Kingwa Gm03:4203626 Rps1k N
4203626 [C/G] Kingwa Gm03:4204747 Rps1k N 4204747 [A/G] Kingwa
Gm03:4204867 Rps1k N 4204867 [A/G] Kingwa Gm03:4205828 Rps1k N
4205828 [C/G] Kingwa Gm03:4205953 Rps1k N 4205953 [T/C] Kingwa
Gm03:4206870 Rps1k N 4206870 [G/A] Kingwa Gm03:4207703 Rps1k N
4207703 [G/A] Kingwa Gm03:4215115 Rps1k N 4215115 [C/T] Kingwa
Gm03:4215690 Rps1k N 4215690 [T/G] Kingwa Gm03:4215950 Rps1k N
4215950 [A/G] Kingwa Gm03:4217736 Rps1k N 4217736 [G/T] Kingwa
Gm03:4218032 Rps1k N 4218032 [C/A] Kingwa Gm03:4218527 Rps1k N
4218527 [C/A] Kingwa Gm03:4218716 Rps1k N 4218716 [G/A] Kingwa
Gm03:4218990 Rps1k N 4218990 [G/T] Kingwa Gm03:4219539 Rps1k N
4219539 [A/T] Kingwa Gm03:4219667 Rps1k N 4219667 [A/G] Kingwa
Gm03:4221288 Rps1k N 4221288 [T/C] Kingwa Gm03:4222312 Rps1k N
4222312 [A/C] Kingwa Gm03:4223122 Rps1k N 4223122 [A/G] Kingwa
Gm03:4223821 Rps1k N 4223821 [T/C] Kingwa Gm03:4224501 Rps1k N
4224501 [T/C] Kingwa Gm03:4225137 Rps1k N 4225137 [G/A] Kingwa
Gm03:4225960 Rps1k N 4225960 [A/C] Kingwa Gm03:4226471 Rps1k N
4226471 [T/A] Kingwa Gm03:4227488 Rps1k N 4227488 [C/G] Kingwa
Gm03:4228931 Rps1k N 4228931 [A/G] Kingwa Gm03:4229006 Rps1k N
4229006 [C/T] Kingwa Gm03:4229247 Rps1k N 4229247 [A/C] Kingwa
Gm03:4230412 Rps1k N 4230412 [A/G] Kingwa Gm03:4230665 Rps1k N
4230665 [A/G] Kingwa Gm03:4230768 Rps1k N 4230768 [C/T] Kingwa
Gm03:4231904 Rps1k N 4231904 [G/A] Kingwa Gm03:4231979 Rps1k N
4231979 [G/A] Kingwa Gm03:4233068 Rps1k N 4233068 [T/C] Kingwa
Gm03:4233431 Rps1k N 4233431 [G/C] Kingwa Gm03:4233493 Rps1k N
4233493 [G/C] Kingwa Gm03:4233550 Rps1k N 4233550 [T/C] Kingwa
Gm03:4234109 Rps1k N 4234109 [C/T] Kingwa Gm03:4234194 Rps1k N
4234194 [A/G] Kingwa Gm03:4234277 Rps1k N 4234277 [A/G] Kingwa
Gm03:4234310 Rps1k N 4234310 [T/A] Kingwa Gm03:4235089 Rps1k N
4235089 [G/A] Kingwa Gm03:4235183 Rps1k N 4235183 [T/C] Kingwa
Gm03:4235519 Rps1k N 4235519 [T/C] Kingwa Gm03:4235634 Rps1k N
4235634 [A/C] Kingwa Gm03:4235844 Rps1k N 4235844 [G/A] Kingwa
Gm03:4236123 Rps1k N 4236123 [T/C] Kingwa Gm03:4236298 Rps1k N
4236298 [C/T] Kingwa Gm03:4239026 Rps1k N 4239026 [T/C] Kingwa
Gm03:4242434 Rps1k N 4242434 [G/T] Kingwa Gm03:4243529 Rps1k N
4243529 [C/T] Kingwa Gm03:4244201 Rps1k N 4244201 [T/C] Kingwa
Gm03:4244338 Rps1k N 4244338 [A/C] Kingwa Gm03:4244497 Rps1k N
4244497 [T/G] Kingwa Gm03:4245348 Rps1k N 4245348 [G/A] Kingwa
Gm03:4245390 Rps1k N 4245390 [T/C] Kingwa Gm03:4245678 Rps1k N
4245678 [A/G] Kingwa Gm03:4246770 Rps1k N 4246770 [A/G] Kingwa
Gm03:4246837 Rps1k N 4246837 [T/G] Kingwa Gm03:4247592 Rps1k N
4247592 [A/G] Kingwa Gm03:4247726 Rps1k N 4247726 [C/T] Kingwa
Gm03:4252413 Rps1k N 4252413 [A/T] Kingwa Gm03:4252569 Rps1k N
4252569 [G/A] Kingwa Gm03:4252894 Rps1k N 4252894 [G/A] Kingwa
Gm03:4252928 Rps1k N 4252928 [G/A] Kingwa Gm03:4253518 Rps1k N
4253518 [T/C] Kingwa Gm03:4257596 Rps1k N 4257596 [A/C] Kingwa
Gm03:4257995 Rps1k N 4257995 [G/C] Kingwa Gm03:4258161 Rps1k N
4258161 [T/G] Kingwa Gm03:4258545 Rps1k N 4258545 [T/C] Kingwa
Gm03:4260785 Rps1k N 4260785 [A/G] Kingwa Gm03:4260901 Rps1k N
4260901 [C/T] Kingwa Gm03:4261372 Rps1k N 4261372 [T/A] Kingwa
Gm03:4261626 Rps1k N 4261626 [A/T] Kingwa Gm03:4262516 Rps1k N
4262516 [C/G] Kingwa Gm03:4262869 Rps1k N 4262869 [G/A] Kingwa
Gm03:4263876 Rps1k N 4263876 [A/G] Kingwa Gm03:4264709 Rps1k N
4264709 [C/T] Kingwa Gm03:4265916 Rps1k N 4265916 [A/G] Kingwa
Gm03:4266927 Rps1k N 4266927 [A/G] Kingwa Gm03:4267296 Rps1k N
4267296 [A/G] Kingwa Gm03:4268640 Rps1k N 4268640 [C/G] Kingwa
Gm03:4268852 Rps1k N 4268852 [G/A] Kingwa Gm03:4295832 Rps1k N
4295832 [A/G] Kingwa Gm03:4302907 Rps1k N 4302907 [G/C] Kingwa
Gm03:4302936 Rps1k N 4302936 [A/T] Kingwa Gm03:4306709 Rps1k N
4306709 [T/C] Kingwa Gm03:4307835 Rps1k N 4307835 [C/A] Kingwa
Gm03:4307996 Rps1k N 4307996 [G/A] Kingwa Gm03:4308161 Rps1k N
4308161 [T/A] Kingwa Gm03:4308286 Rps1k N 4308286 [C/T] Kingwa
Gm03:4308323 Rps1k N 4308323 [G/T] Kingwa Gm03:4308522 Rps1k N
4308522 [T/A] Kingwa Gm03:4313900 Rps1k N 4313900 [C/T] Kingwa
Gm03:4314212 Rps1k N 4314212 [G/T] Kingwa Gm03:4314464 Rps1k N
4314464 [G/C] Kingwa Gm03:4315256 Rps1k N 4315256 [A/G] Kingwa
Gm03:4317574 Rps1k N 4317574 [G/C] Kingwa Gm03:4318530 Rps1k N
4318530 [A/G] Kingwa Gm03:4319271 Rps1k N 4319271 [C/G] Kingwa
Gm03:4320841 Rps1k N 4320841 [A/G] Kingwa Gm03:4321243 Rps1k N
4321243 [C/T] Kingwa Gm03:4321515 Rps1k N 4321515 [T/G] Kingwa
Gm03:4328502 Rps1k N 4328502 [G/T] Kingwa Gm03:4329219 Rps1k N
4329219 [C/G] Kingwa Gm03:4329504 Rps1k N 4329504 [T/C] Kingwa
Gm03:4330121 Rps1k N 4330121 [A/G] Kingwa Gm03:4330318 Rps1k N
4330318 [T/C] Kingwa Gm03:4331246 Rps1k N 4331246 [A/G] Kingwa
Gm03:4331889 Rps1k N 4331889 [A/G] Kingwa Gm03:4337173 Rps1k N
4337173 [G/A] Kingwa Gm03:4338377 Rps1k N 4338377 [G/C] Kingwa
Gm03:4338505 Rps1k N 4338505 [A/G] Kingwa Gm03:4338559 Rps1k N
4338559 [T/A] Kingwa Gm03:4339885 Rps1k N 4339885 [T/A] Kingwa
Gm03:4341064 Rps1k N 4341064 [A/G] Kingwa Gm03:4342692 Rps1k N
4342692 [T/C] Kingwa Gm03:4342727 Rps1k N 4342727 [A/T] Kingwa
Gm03:4343201 Rps1k N 4343201 [A/G] Kingwa Gm03:4343212 Rps1k N
4343212 [T/C] Kingwa Gm03:4348211 Rps1k N 4348211 [T/C] Kingwa
Gm03:4350556 Rps1k N 4350556 [A/T] Kingwa Gm03:4350658 Rps1k N
4350658 [A/G] Kingwa Gm03:4350767 Rps1k N 4350767 [G/A] Kingwa
Gm03:4351326 Rps1k N 4351326 [T/G] Kingwa Gm03:4351612 Rps1k N
4351612 [T/G] Kingwa Gm03:4351617 Rps1k N 4351617 [T/G] Kingwa
Gm03:4351674 Rps1k N 4351674 [A/C] Kingwa Gm03:4352353 Rps1k N
4352353 [T/G] Kingwa Gm03:4353932 Rps1k N 4353932 [T/C] Kingwa
Gm03:4354036 Rps1k N 4354036 [C/G] Kingwa Gm03:4355046 Rps1k N
4355046 [C/G] Kingwa Gm03:4362911 Rps1k N 4362911 [A/G] Kingwa
Gm03:4363385 Rps1k N 4363385 [A/T] Kingwa Gm03:4363855 Rps1k N
4363855 [T/C] Kingwa
Gm03:4364133 Rps1k N 4364133 [A/G] Kingwa Gm03:4364176 Rps1k N
4364176 [G/T] Kingwa Gm03:4364200 Rps1k N 4364200 [A/C] Kingwa
Gm03:4364469 Rps1k N 4364469 [A/G] Kingwa Gm03:4385480 Rps1k N
4385480 [G/A] Kingwa Gm03:4385781 Rps1k N 4385781 [A/G] Kingwa
Gm03:4386327 Rps1k N 4386327 [A/G] Kingwa Gm03:4386398 Rps1k N
4386398 [G/C] Kingwa Gm03:4386633 Rps1k N 4386633 [G/A] Kingwa
Gm03:4386927 Rps1k N 4386927 [C/T] Kingwa Gm03:4387264 Rps1k N
4387264 [T/C] Kingwa Gm03:4388736 Rps1k N 4388736 [A/T] Kingwa
Gm03:4388954 Rps1k N 4388954 [T/C] Kingwa Gm03:4388982 Rps1k N
4388982 [A/G] Kingwa Gm03:4389208 Rps1k N 4389208 [T/C] Kingwa
Gm03:4389211 Rps1k N 4389211 [A/G] Kingwa Gm03:4389280 Rps1k N
4389280 [A/C] Kingwa Gm03:4389696 Rps1k N 4389696 [T/A] Kingwa
Gm03:4390074 Rps1k N 4390074 [G/A] Kingwa Gm03:4390738 Rps1k N
4390738 [A/T] Kingwa Gm03:4390827 Rps1k N 4390827 [C/T] Kingwa
Gm03:4390979 Rps1k N 4390979 [C/A] Kingwa Gm03:4392217 Rps1k N
4392217 [A/T] Kingwa Gm03:4392314 Rps1k N 4392314 [C/G] Kingwa
Gm03:4392891 Rps1k N 4392891 [G/A] Kingwa Gm03:4392913 Rps1k N
4392913 [G/T] Kingwa Gm03:4394477 Rps1k N 4394477 [C/G] Kingwa
Gm03:4394831 Rps1k N 4394831 [A/G] Kingwa Gm03:4395386 Rps1k N
4395386 [T/C] Kingwa Gm03:4395962 Rps1k N 4395962 [A/C] Kingwa
Gm03:4397872 Rps1k N 4397872 [A/G] Kingwa Gm03:4398299 Rps1k N
4398299 [A/T] Kingwa Gm03:4398919 Rps1k N 4398919 [T/C] Kingwa
Gm03:4399399 Rps1k N 4399399 [G/A] Kingwa Gm03:4400461 Rps1k N
4400461 [C/G] Kingwa Gm03:4404444 Rps1k N 4404444 [C/T] Kingwa
Gm03:4410393 Rps1k N 4410393 [A/G] Kingwa Gm03:4410565 Rps1k N
4410565 [T/C] Kingwa Gm03:4411187 Rps1k N 4411187 [T/C] Kingwa
Gm03:4412149 Rps1k N 4412149 [A/T] Kingwa Gm03:4412417 Rps1k N
4412417 [A/G] Kingwa Gm03:4412774 Rps1k N 4412774 [A/G] Kingwa
Gm03:4413415 Rps1k N 4413415 [C/T] Kingwa Gm03:4446891 Rps1k N
4446891 [T/C] Kingwa Gm03:4447988 Rps1k N 4447988 [A/C] Kingwa
Gm03:4448825 Rps1k N 4448825 [C/A] Kingwa Gm03:4449634 Rps1k N
4449634 [T/A] Kingwa Gm03:4449956 Rps1k N 4449956 [T/G] Kingwa
Gm03:4450328 Rps1k N 4450328 [C/T] Kingwa Gm03:4450331 Rps1k N
4450331 [G/A] Kingwa Gm03:4450888 Rps1k N 4450888 [T/A] Kingwa
Gm03:4451295 Rps1k N 4451295 [A/T] Kingwa Gm03:4451491 Rps1k N
4451491 [A/C] Kingwa Gm03:4451503 Rps1k N 4451503 [T/G] Kingwa
Gm03:4451847 Rps1k N 4451847 [T/A] Kingwa Gm03:4452060 Rps1k N
4452060 [A/G] Kingwa Gm03:4452118 Rps1k N 4452118 [A/G] Kingwa
Gm03:4452820 Rps1k N 4452820 [T/A] Kingwa Gm03:4456305 Rps1k N
4456305 [T/C] Kingwa Gm03:4458273 Rps1k N 4458273 [G/A] Kingwa
Gm03:4458399 Rps1k N 4458399 [A/T] Kingwa Gm03:4461465 Rps1k N
4461465 [T/A] Kingwa Gm03:4462225 Rps1k N 4462225 [A/C] Kingwa
Gm03:4471412 Rps1k N 4471412 [T/C] Kingwa Gm03:4474352 Rps1k N
4474352 [A/G] Kingwa Gm03:4477946 Rps1k N 4477946 [A/G] Kingwa
Gm03:4477947 Rps1k N 4477947 [C/G] Kingwa Gm03:4478247 Rps1k N
4478247 [C/T] Kingwa Gm03:4478479 Rps1k N 4478479 [G/C] Kingwa
Gm03:4478554 Rps1k N 4478554 [A/T] Kingwa Gm03:4478921 Rps1k N
4478921 [A/G] Kingwa Gm03:4479127 Rps1k N 4479127 [T/A] Kingwa
Gm03:4506056 Rps1k N 4506056 [A/G] Kingwa Gm03:4506139 Rps1k N
4506139 [A/G] Kingwa Gm03:4506147 Rps1k N 4506147 [T/C] Kingwa
Gm03:4507198 Rps1k N 4507198 [A/T] Kingwa Gm03:4525141 Rps1k N
4525141 [A/G] Kingwa Gm03:4525736 Rps1k N 4525736 [C/T] Kingwa
Gm03:4526278 Rps1k N 4526278 [C/T] Kingwa Gm03:4526393 Rps1k N
4526393 [C/T] Kingwa Gm03:4526446 Rps1k N 4526446 [G/C] Kingwa
Gm03:4527054 Rps1k N 4527054 [A/T] Kingwa Gm03:4533559 Rps1k N
4533559 [A/T] Kingwa Gm03:4539866 Rps1k N 4539866 [A/G] Kingwa
Gm03:4541294 Rps1k N 4541294 [A/G] Kingwa *Gm composite 2003
Genetic Map ** Physical positions are based on Public JGI Glyma1
Williams82 reference.
[0070] In certain embodiments, multiple marker loci that
collectively make up a Phytophthora tolerance haplotype of interest
are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
of the various marker loci provided herein can comprise a
Phytophthora tolerance haplotype. In some embodiments, the
haplotype comprises: (a) two or more marker loci associated with
the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b)
two or more marker loci comprising S08291-1, S07292-1, S08242-1,
S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the
Rps1k marker loci in Table 1B, or a closely linked marker on
linkage group N; (c) two or more marker loci associated with the
Rps2 locus found on linkage group J; (d) two or more marker loci
comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1,
S11682-1 or a marker closely linked thereto on linkage group J; (e)
two or more marker loci associated with the Rps3a or Rps3c loci
found on linkage group F; (f) two or more marker loci comprising
S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on
linkage group F; (g) two or more marker loci associated with the
Rps6 locus found on linkage group G; or (h) two or more marker loci
comprising S08442-1, S08341-1 or a marker closely linked thereto on
linkage group G.
[0071] In one embodiment, the method of identifying a first soybean
plant or a first soybean germplasm that displays tolerance or
improved tolerance to Phytophthora infection comprises detecting in
the genome of the first soybean plant or in the genome of the first
soybean germplasm at least one haplotype that is associated with
the tolerance, wherein the at least one haplotype comprises at
least two of the various marker loci provided herein.
[0072] In certain embodiments, two or more marker loci or
haplotypes can collectively make up a marker profile. The marker
profile can comprise any two or more marker loci comprising: (a)
any marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k
loci found on linkage group N; (b) marker loci comprising S08291-1,
S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01,
S08013-1, any of the Rps1k marker loci in Table 1B, or a closely
linked marker on linkage group N; (c) any marker loci associated
with the Rps2 locus found on linkage group J; (d) marker loci
comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1,
S11682-1 or a marker closely linked thereto on linkage group J; (e)
any marker loci associated with the Rps3a or Rps3c loci found on
linkage group F; (f) marker loci comprising S09018-1, S08342-1,
S07163-1 or a marker closely linked thereto on linkage group F; (g)
any marker loci associated with the Rps6 locus found on linkage
group G; and/or (h) marker loci comprising S08442-1, S08341-1 or a
marker closely linked thereto on linkage group G.
[0073] Any marker loci associated with Phytophthora tolerance can
be combined in the marker profile with any of the marker loci
disclosed herein. For example, the marker profile can comprise 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or
more marker loci or haplotypes associated with tolerance to
Phytophthora infection provided herein (i.e. the various marker
loci provided in Tables 1A and 1B and in FIGS. 1-4).
[0074] In one embodiment, a method of identifying a first soybean
plant or a first soybean germplasm that displays tolerance or
improved tolerance to Phytophthora infection comprises detecting in
the genome of the first soybean plant or in the genome of the first
soybean germplasm at least one marker profile that is associated
with the tolerance, wherein the at least one marker profile
comprises at least two of the various marker loci provided herein.
In some embodiments, the marker profile comprises any combination
of two or more marker loci from any of the various Rps loci, for
example, Rps1, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
[0075] Not only can one detect the various markers provided herein,
it is recognized that one could detect any markers that are closely
linked to the various markers discussed herein. Non-limiting
examples of markers closely linked the various markers discussed
herein are provided in Tables 1A and 1B and in FIGS. 1-4.
[0076] In addition to the markers discussed herein, information
regarding useful soybean markers can be found, for example, on the
USDA's Soybase website, available at www.soybase.org. One of skill
in the art will recognize that the identification of favorable
marker alleles may be germplasm-specific. The determination of
which marker alleles correlate with tolerance (or susceptibility)
is determined for the particular germplasm under study. One of
skill will also recognize that methods for identifying the
favorable alleles are routine and well known in the art, and
furthermore, that the identification and use of such favorable
alleles is well within the scope of the invention.
[0077] Various methods are provided to identify soybean plants
and/or germplasm with tolerance or improved tolerance to
Phytophthora infection. In one embodiment, the method of
identifying comprises detecting at least one marker locus
associated with tolerance to Phytophthora. The term "associated
with" in connection with a relationship between a marker locus and
a phenotype refers to a statistically significant dependence of
marker frequency with respect to a quantitative scale or
qualitative gradation of the phenotype. Thus, an allele of a marker
is associated with a trait of interest when the allele of the
marker locus and the trait phenotypes are found together in the
progeny of an organism more often than if the marker genotypes and
trait phenotypes segregated separately.
[0078] Any combination of the marker loci provided herein can be
used in the methods to identify a soybean plant or soybean
germplasm that displays tolerance or improved tolerance to
Phytophthora infection. Any one marker locus or any combination of
the markers set forth in Table 1, or any closely linked marker can
be used to aid in identifying and selecting soybean plants or
soybean germplasm with tolerance or improved tolerance to
Phytophthora infection.
[0079] In one embodiment, a method of identifying a first soybean
plant or a first soybean germplasm that displays tolerance or
improved tolerance to Phytophthora infection is provided. The
method comprises detecting in the genome of the first soybean plant
or first soybean germplasm at least one marker locus that is
associated with tolerance. In such a method, the at least one
marker locus: (a) can be associated with the Rps1a, Rps1c, Rps1d or
Rps1k loci found on linkage group N; (b) can comprise one or more
of the marker loci S08291-1, S07292-1, S08242-1, S16592-001,
S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker
loci in Table 1B, or a closely linked marker on linkage group N;
(c) can be associated with the Rps2 locus found on linkage group J;
(d) can comprise one or more of the marker loci S06862-1, S06863-1,
S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked
thereto on linkage group J; (e) can be associated with the Rps3a or
Rps3c loci found on linkage group F; (f) can comprise one or more
of the marker loci S09018-1, S08342-1, S07163-1 or a marker closely
linked thereto on linkage group F; (g) can be associated with the
Rps6 locus found on linkage group G; and/or (h) can comprise one or
more of the marker loci S08442-1, S08341-1 or a marker closely
linked thereto on linkage group G.
[0080] In other embodiments, two or more marker loci are detected
in the method. In a specific embodiment, the germplasm is a soybean
variety.
[0081] In other embodiments, the method further comprises crossing
the selected first soybean plant or first soybean germplasm with a
second soybean plant or second soybean germplasm. In a further
embodiment of the method, the second soybean plant or second
soybean germplasm comprises an exotic soybean strain or an elite
soybean strain.
[0082] In specific embodiments, the first soybean plant or first
soybean germplasm comprises a soybean variety. Any soybean line
known to the art or disclosed herein may be used. Non-limiting
examples of soybean varieties and their associated Phytophthora
tolerance alleles encompassed by the methods provided herein
include, for example, those listed in Table 1.
[0083] In another embodiment, the detection method comprises
amplifying at least one marker locus and detecting the resulting
amplified marker amplicon. In such a method, amplifying comprises
(a) admixing an amplification primer or amplification primer pair
for each marker locus being amplified with a nucleic acid isolated
from the first soybean plant or the first soybean germplasm such
that the primer or primer pair is complementary or partially
complementary to a variant or fragment of the genomic locus
comprising the marker locus and is capable of initiating DNA
polymerization by a DNA polymerase using the soybean nucleic acid
as a template; and (b) extending the primer or primer pair in a DNA
polymerization reaction comprising a DNA polymerase and a template
nucleic acid to generate at least one amplicon. In such a method,
the primer or primer pair can comprise a variant or fragment of one
or more of the genomic loci provided herein.
[0084] In one embodiment, the method involves amplifying a variant
or fragment of one or more polynucleotides associated with the
Rps1a, Rps1c, Rps1d, or Rps1k loci comprising SEQ ID NOS: 155, 156,
157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191,
192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204,
205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217,
218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230,
231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243,
244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256,
257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269,
270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282,
283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295,
296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308,
309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321,
322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334,
335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347,
348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360,
361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373,
374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386,
387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399,
400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412,
413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425,
426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438,
439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451,
452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464,
465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477,
478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490,
491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503,
504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516,
517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529,
530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542,
543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555,
556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568,
569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581,
582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594,
595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607,
608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620,
621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633,
634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646,
647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659,
660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672,
673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685,
686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698,
699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711,
712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724,
725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737,
738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750,
751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763,
764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776,
777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789,
790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802,
803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815,
816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828,
829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841,
842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854,
855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867,
868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880,
881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893,
894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906,
907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919,
920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932,
933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945,
946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958,
959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971,
972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984,
985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997,
998, 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008,
1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019,
1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030,
1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041,
1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052,
1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063,
1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074,
1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085,
1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096,
1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107,
1108, 1109, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118,
1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129,
1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140,
1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151,
1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162,
1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173,
1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184,
1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195,
1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206,
1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217,
1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228,
1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239,
1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250,
1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261,
1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272,
1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283,
1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294,
1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1343, 1345, 1346,
1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357,
1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368,
1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379,
1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390,
1391, 1392, 1393, 1394 or variants or fragments thereof. It is
recognized that reference to any one of SEQ ID NOS: 191-1302
explicitly denotes each of the SEQ ID NOS recited above.
[0085] In one embodiment, the primer or primer pair can comprise a
variant or fragment of one or more polynucleotides comprising SEQ
ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166,
167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351,
1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362,
1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373,
1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384,
1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or
complements thereof. In specific embodiments, the primer or primer
pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 1339, 1340 or variants or fragments thereof. In a further
embodiment, the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2;
SEQ ID NO: 9 and SEQ ID NO:10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ
ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ
ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or
SEQ ID NO: 1339 and SEQ ID NO: 1340.
[0086] In another embodiment, the method involves amplifying a
variant or fragment of one or more polynucleotides associated with
the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178,
179, 180 or variants or fragments thereof. In one embodiment, the
primer or primer pair can comprise a variant or fragment of one or
more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176,
177, 178, 179, 180 or complements thereof. In specific embodiments,
the primer or primer pair comprises a nucleic acid sequence
comprising SEQ ID NOS: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67,
68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments
thereof. In a further embodiment, the primer pair comprises SEQ ID
NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID
NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID
NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
[0087] In another embodiment, the method involves amplifying a
variant or fragment of one or more polynucleotides associated with
the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184,
185, 186 or variants or fragments thereof. In one embodiment, the
primer or primer pair can comprise a variant or fragment of one or
more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184,
185, 186 or complements thereof. In specific embodiments, the
primer or primer pair comprises a nucleic acid sequence comprising
SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92
or variants or fragments thereof. In a further embodiment, the
primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO:
89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
[0088] In yet another embodiment, the method involves amplifying a
variant or fragment of one or more polynucleotides associated with
the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or
variants or fragments thereof. In one embodiment, the primer or
primer pair can comprise a variant or fragment of one or more
polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or
complements thereof. In specific embodiments, the primer or primer
pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93,
94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or
fragments thereof. In a further embodiment, the primer pair
comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and
SEQ ID NO: 102.
[0089] The method further comprises providing one or more labeled
nucleic acid probes suitable for detection of each marker locus
being amplified. In such a method, the labeled nucleic acid probe
can comprise a sequence comprising a variant or fragment of one or
more of the genomic loci provided herein.
[0090] In one embodiment, the labeled nucleic acid probe can
comprise a sequence associated with the Rps1a, Rps1c, Rps1d or
Rps1k loci comprising a variant or fragment of one or more
polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159,
160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345,
1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356,
1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367,
1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378,
1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389,
1390, 1391, 1392, 1393, 1394 or complements thereof. In specific
embodiments, the labeled nucleic acid probe comprises a nucleic
acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110,
112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124,
125, 126, 127, 1341, 1342 or variants or fragments thereof.
[0091] In another embodiment, the labeled nucleic acid probe can
comprise a sequence associated with the Rps2 locus comprising a
variant or fragment of one or more polynucleotides comprising SEQ
ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements
thereof. In specific embodiments, the labeled nucleic acid probe
comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or
fragments thereof.
[0092] In another embodiment, the labeled nucleic acid probe can
comprise a sequence associated with the Rps3a or Rps3c loci
comprising a variant or fragment of one or more polynucleotides
comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements
thereof. In specific embodiments, the labeled nucleic acid probe
comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141,
142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments
thereof.
[0093] In yet another embodiment, the labeled nucleic acid probe
can comprise a sequence associated with the Rps6 locus comprising a
variant or fragment of one or more polynucleotides comprising SEQ
ID NOS: 187, 188, 189, 190 or complements thereof. In specific
embodiments, the labeled nucleic acid probe comprises a nucleic
acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or
variants or fragments thereof.
[0094] Non-limiting examples of primers, probes, genomic loci and
amplicons that can be used in the methods and compositions provided
herein are summarized in Tables 2, 3, 4 and 5, respectively.
TABLE-US-00003 TABLE 2 Non-Limiting Examples of Primer Sequences.
TaqMan Marker Gene/ Assay Primer SEQ Allele position* Locus LG
Locus Name Name ID NO Primer Sequence (R/S) 3905604 Rps1a N
S08291-1 Q5 S08291-F3 1 AAAAATGCCTCGTGGAGAGA G/A Q5 S08291-R3 2
GAAAATATGTAAAAGAAGAACTGCCAGA G/A Q1 S08291-F1 3
TGGAGAGACAAAACAGGAGATTT G/A Q1 S08291-R1 4
ATACACAATGGAAGATTGTTTAGCA G/A Q4 S08291-F2 5 GAAAGAGAAACTGGGATTCTGG
G/A Q4 S08291-R2 6 TATACACAATGGAAGATTGTTTAGCA G/A Q6 S08291-F4 7
CCTCGTGGAGAGACAAAACAG G/A Q6 S08291-R4 8
CGAGAAAATATGTAAAAGAAGAACTGC G/A 4464524 Rps1c N S07292-1 Q7
S07292-F5 9 AGATTCAAGGAGTCCAGACGAT T/G Q7 S07292-R6 10
CTCCAGCGGGAGATTTGC T/G Q1, Q2 S07292-F1 11 TCAAGGAGTCCAGACGATGC T/G
Q1, Q2 S07292-R1 12 YGTCATGCTCAAGCTGTTCG T/G Q3, Q4 S07292-F2 13
AAGCTGCCAAGGGACAATTA T/G Q3 S07292-R2 14 CGGGAGATTTGCTTCTTCAA T/G
Q4 S07292-R3 15 CAAGCTAGTAAGGCCATTTTGC T/G Q5 S07292-F3 16
CTGCCAAGGGACAATTAGACTT T/G Q5 S07292-R4 17 CCAGCGGGAGATTTGCTT T/G
Q6 S07292-F4 18 ATTCAAGGAGTCCAGACGATG T/G Q6 S07292-R5 19
CTAGTAAGGCCATTTTGCTTCAG T/G 4343399 Rps1c N S08242-1 Primer 1 20
CTTGCATTCTGGAGGTGCTA C/T Primer 2 21 CCATCCCCTATTCTTTGGTG C/T
3904033 Rps1d N S16592-001 S16592-F001 1339 GGGAAGAATCCCAGTTGGAG
A/T S16592-R001 1340 CAAACAAACTTGCGTTGCAG A/T 3951705 Rps1k N
S07963-2 Q1 S07963-F2 22 ATGAGGACACAATGCCATGA T/C Q1 S07963-R2 23
TGAGAAGGCCAATCCTATGC T/C 5227883 Rps1k N S07372-1 Q11, Q6,
S07372-F5 24 ATTTTGGGCAAATGATGAAGC C/T Q8, Q12 Q11, Q8, S07372-R4
25 CTCAGCTAAAGACACCCTGCAAT C/T Q12 Q2, Q7 S07372-F1 26
TTGGGCAAATGATGAAGCTA C/T Q2, Q3, S07372-R2 27 GAGGGCTCATCAGCACAAA
C/T Q4 Q3 S07372-F2 28 AAATGGTTTGTGGGAGGTTAGA C/T Q4 S07372-F3 29
AGAATAAATGGTTTGTGGGAGGTTA C/T Q5 S07372-F4 30
TGAAGATATGCAAATTCTTTTCAAATTA C/T Q5 S07372-R3 31 ACCATGGAGGGCTCATCA
C/T Q6 S07372-R4 32 CTCAGCTAAAGACACCCTGCAAT C/T Q7 S07372-R1 33
CAAAAGGGCATCCTCAAAAG C/T 86061 34 TGGGAGGTTAGATTTTCTGAACGAAGA C/T
82582 35 CATCAGCACAAAAGGGCATCCTCA C/T 3927056 Rps1k N S00009-01
Primer 1 36 TGACACGTGGTGCGTTAGGAATTTT C/T Primer 2 37
TGAAACGCATTAGTTCAGGTGGTAACTTCT C/T 4458273 Rps1k N S08013-1 Q1
S08013-F1 38 GAAAACGAAAATTGTAAGAGCAACTT C/T Q1 S08013-R1 39
ATGGAATGAGTTTGGGATGG C/T 36085130 Rps2 J S06862-1 Q1 S06862-1-Q1F
40 CCAAAGCTGTCTTGGAGGAA T/G Q1 S06862-1-Q1R 41
CAAAACAGATGCTTTTAACATGAAC T/G Q2 S06862-1-Q2F 42
GCTGTCTTGGAGGAACTTGAA T/G Q2 S06862-1-Q2R 43 TTTCACAACACGAGGCTGTC
T/G Q3 S06862-1-Q3F 44 GTTGCCAAAGCTGTCTTGGA T/G Q3 S06862-1-Q3R 45
CACGAGGCTGTCTACTCTCTTCA T/G 36692217 Rps2 J S06863-1 Q1
S06863-1-Q1F 46 TCACACAAGGAAATTTAACACTACAT G/A Q1 S06863-1-Q1R 47
TTCTCACCTTCTGTTGTATTGGA G/A Q2 S06863-1-Q2F 48 CGCCAAATGGCTTACTTCTC
G/A Q2 S06863-1-Q2R 49 ACCAATGAATCACACAAGGAAA G/A Q3 S06863-1-Q3F
50 GGCGCCAAATGGCTTACT G/A Q3 S06863-1-Q3R 51
TGAATCACACAAGGAAATTTAACACT G/A 37262813 Rps2 J S06864-1 Q1
S06864-1-Q1F 52 AACCATGCCCTTGAACAGTC T/C Q1 S06864-1-Q1R 53
TTTGTGAAGGACATTTTGATTTG T/C Q2 S06864-1-Q2F 54 TGAACAGTCTGCCCTCAGAA
T/C Q2 S06864-1-Q2R 55 TCTCAAAATCGGCATGAGGT T/C Q3 S06864-1-Q3F 56
CCTTGAACAGTCTGCCCTCA T/C Q3 S06864-1-Q3R 57
TGAACTTTGTGAAGGACATTTTGA T/C 37377161 Rps2 J S06865-1 Q1
S06865-1-Q1F 58 59 G/A Q1 S06865-1-Q1R 59 TTTGTGCAATTCTCCCATCA G/A
Q2 S06865-1-Q2F 60 TGTTTACACGTTCTCCAATCAAA G/A Q2 S06865-1-Q2R 61
TGTGCAATTCTCCCATCAAA G/A Q3 S06865-1-Q3F 62
CAAGTGTTGTTTACACGTTCTCCA G/A Q3 S06865-1-Q3R 63
TTCCATAGGTGCTGTTTGTGC G/A 36775973 Rps2 J S11652-1 Q1 S11652-F1 64
TTTCACTGCAAGAGGGAAGG G/T Q1, Q4 S11652-R1 65 ATTCCTGCAGCTTCTCCATC
G/T Q2 S11652-F2 66 GAAGGGCTGTTGGTTATACCG G/T Q2 S11652-R2 67
CATCTTATCTTTGAACCTTTCCTGA G/T Q3 S11652-F3 68 AGGGAAGGGCTGTTGGTT
G/T Q3 S11652-R3 69 TCCATCTTATCTTTGAACCTTTCC G/T Q4 S11652-F4 70
GCAAGAGGGAAGGGCTGTT G/T 36563064 Rps2 J S11682-1 Q1 S11682-F1 71
ACAACACCTCCAGAGCATCC G/T Q1 S11682-R1 72 GCTTGTCAACATCATCTAAAATCAA
G/T Q2 S11682-F2 73 GGTTACAACACCTCCAGAGCA G/T Q2 S11682-R2 74
TGCTTGTCAACATCATCTAAAATCA G/T Q3 S11682-F3 75 CTCCAGAGCATCCTTCTTCG
G/T Q3 S11682-R3 76 TCATGCTTGTCAACATCATCTAAA G/T Q4 S11682-F4 77
CAACACCTCCAGAGCATCC G/T Q4 S11682-R4 78 GATGATGACTCTACTGCCTGGA G/T
29110641 Rps3a F S09018-1 Q1 S09018-F1 79 AAGTGGCAGAGTGAACAGCA C/G
Q1 S09018-R1 80 TAAGCGCATTTTCAAAGCTG C/G Q2 S09018-F2 81
GACCGTAGAGAAAGTGGCAGA C/G Q2 S09018-R2 82 AATAAGCGCATTTTCAAAGCTG
C/G Q3 S09018-F3 83 GGAGGAAAGGACCGTAGAGAA C/G Q3 S09018-R3 84
AGCGCATTTTCAAAGCTGA C/G Q4 S09018-F4 85 TGTTGCTCTTCCAAAAGATGAC C/G
Q4 S09018-R4 86 TGCATAACGTTTCAGAAGGAAA C/G Q5 S09018-F5 87
CCAGTGAACTATGTTGCTCTTCC C/G Q5 S09018-R5 88
CCAAATTTACAATGCATAACGTTTC C/G 29049150 Rps3a F S08342-1 Primer 1 89
AAAGAAGTTTAATTTGCAAATAGCTTGAAT [T/A]/ TTTTCAAA [T/C]/[C/A] Primer 2
90 TACTCCAATCAGAGTTTCCATGGCAAAGTT [T/A]/ AG [T/C]/[C/A] 29049184
Rps3c F S07163-1 Q1-Q4 S07163-1-F1 91 CAGGAAAGTTGAATTGCTTTATCC T/C
Q1-Q4 S07163-1-R1 92 CAGAGTTTCCATGGCAAAGTTA T/C 60745556 Rps6 G
S08442-1 Q5 S08442-F3 93 GGCCTTTTGTTATTTCTTCAGC T/C Q5 S08442-R4 94
GAGTATGGAGACAGCCCACAA T/C Q4 S08442-F1 95 CACATTATAGGGGCCTTTTGTTA
T/C Q4 S08442-R3 96 TTGCATATTTTCTCCCACCTG T/C Q1 S08442-F1 97
CACATTATAGGGGCCTTTTGTTA T/C Q1 S08442-R1 98
TTAGCTTGTGTAGAGTATGGAGACAG T/C Q2 S08442-F2 99
AGGGGCCTTTTGTTATTTCTTC T/C Q2 S08442-R2 100 TTTCTCCCACCTGTGCATTT
T/C 60777851 Rps6 G S08341-1 p10792-6-F2 101 CGTCCGAGATTGGAAATTGT
[A/T]/[G/T] p10792-6-R4 102 TGGACTTTGGAATTGAACCAG [A/T]/[G/T]
p10792-6-R2 103 TGTGAGACAAACTCCTGCATAAA [A/T]/[G/T] p10792-6-R3 104
TTATTGTGAGACAAACTCCTGCAT [A/T]/[G/T] * Physical positions are based
on Public JGI Glyma1 Williams82 reference.
TABLE-US-00004 TABLE 3 Non-Limiting Examples of Probe Sequences.
Probe 1 Probe 2 Marker Gene/ Marker Probe 1 SEQ ID Probe 1 Probe 2
SEQ ID Probe 2 Position* Locus LG Name Name NO Sequence Name NO
Sequence 3905604 Rps1a N S08291-1 S08291- 105 6FAM- S08291- 106
VIC- 1-PB1 CCTCACA 1-PB2 CCTCACA TACACAT TACACAT CAG TAG 3905604
Rps1a N S08291-1 S08291- 107 6FAM- S08291- 108 VIC- 1-PB3 ACATACA
1-PB4 ACACATT CATCAGC AGCAAC AAC CC 3905604 Rps1a N S08291-1
S08291- 109 6FAM- S08291- 110 VIC- 1-PB5 TCACATA 1-PB6 TCACATA
CACATCA CACATTA GCA GCA 4464524 Rps1c N S07292-1 S07292- 111 6FAM-
S07292- 112 VIC- 1-PB1 TTGCCAA 1-PB2 CCAACCT CCTGATA GATCGA GA GA
4464524 Rps1c N S07292-1 S07292- 113 6FAM- S07292- 114 VIC- 1-PB3
TTCTCTAT 1-PB4 TTGCACA CAGGTTG TCTTCTC GC GAT 4343399 Rps1c N
S08242-1 Probe 1 115 6FAM- Probe 2 116 VIC- TTCCCTGT TTCCCTG GTTTGC
CGTTTGC 3904033 Rps1d N S16592- S16592- 1341 6FAM- S16592- 1342
VIC- 001 001- tcatcTgt 001- tcatcAg X001 cccgatcc X002 tcccgat cc
3951705 Rps1k N S07963-2 S07963- 117 CCAGATC S07963- 118 CAGATC
2-PB1 ATATATC 2-PB2 ACATATC GC GC 5227883 Rps1k N S07372-1 S07372-
119 6FAM- S07372- 120 VIC- 1-PBS CTCCTTAA 1-PB4 AGCACTC GGTAATT
CTTAAGA AA TAA 5227883 Rps1k N S07372-1 102408 121 6FAM- 102409 122
VIC- CACTCCTT CACTCCT AAGGTAA TAAGAT T AAT 5227883 Rps1k N S07372-1
S07372- 119 6FAM- 148644 123 VIC- 1-PBS CTCCTTAA AGCACTC GGTAATT
CTTAAGA AA TAA 3927056 Rps1k N S00009- Probe 1 124 6FAM- Probe 2
125 VIC- 01 CATGTGG CATGTGG CTCAATTT CTTAATT T 4458273 Rps1k N
S08013-1 S08013- 126 TCATCTTT S08013- 127 ATCTTTT 1-PB1 TCATCCA
1-PB2 CATTCAG GTGC TGCAT 36085130 Rps2 J S06862-1 S06862- 128 6FAM-
S06862- 129 VIC- 1-FAM CTTACTTT 1-VIC TAGCTTG TGCACAT TTGGTTG GTA
CAC 36692217 Rps2 J S06863-1 S06863- 130 6FAM- S06863- 131 VIC-
1-FAM TTTGGAA 1-VIC TTTGGAA CTGCACC TTGCACC TC TCA 37262813 Rps2 J
S06864-1 S06864- 132 6FAM- S06864- 133 VIC- 1-FAM CTGCTGT 1-VIC
CTGCTGT ACTAATC ACTAGTC ATAT ATAT 37377161 Rps2 J S06865-1 S06865-
134 6FAM- S06865- 135 VIC- 1-FAM ATGCAAATT 1-VIC ATGCAAAT TCTATCTTG
TTTTATCTT GC 36775973 Rps2 J S11652-1 S11652- 136 6FAM- S11652- 137
VIC- 1-PB1 CAAAGTCGA 1-PB2 CTTTTACAA TCCTTC AGTAGATC CT 36563064
Rps2 J S11682-1 S11682- 138 6FAM- S11682- 139 VIC- 1-PB1 CAACATCGG
1-PB2 ACAACATA CTTCA GGCTTCA 29110641 Rps3a F S09018-1 S09018- 140
6FAM- S09018- 141 VIC- 1-PB1 CTAATTTGA 1-PB2 CTAATTTG CTCCTGAAT
ACTCGTGA C ATC 29049150 Rps3a F S08342-1 Probe 1 142 6FAM- Probe 2
143 VIC- ACCATACTA ACCATACT AAAAATT CAAAAAT 29049184 Rps3c F
S07163-1 S07163- 144 6FAM- S07163- 145 VIC- 1-P1 GGAACGTTA 1-P2
TGGAACAT CCGGA TACCGGAC 29049184 Rps3c F S07163-1 S07163- 146 6FAM-
S07163- 147 VIC- 1-PB1 TGGGTCCGG 1-PB2 TCCGGTAA TAACGT TGTTCC
29049184 Rps3c F S07163-1 S07163- 148 6FAM- S07163- 149 VIC- 1-PB3
TGGAACGTT 1-PB4 CGTGGAAC ACCGGAC ATTACC 60745556 Rps6 G S08442-1
S08442- 150 6FAM- S08442- 151 VIC- 1-PB1 CAAATTAAC 1-PB2 CAAATTAA
ACATCAACA CACGTCAA CA 60777851 Rps6 G S08341-1 102379 152 6FAM-
102380 153 VIC- (allele 1) ATCTTTTTGG (allele 2) TCTTTTTGG
AAGTTATAC AAGATATA C 60777851 Rps6 G S08341-1 102381 154 6FAM-
(allele 3) CATCTTTTTG GAATATATA C *Physical positions are based on
Public JGI Glyma1 Williams82 reference.
TABLE-US-00005 TABLE 4 Non-Limiting Examples of Genomic Loci
Comprising the Various Marker Loci Provided Herein.* Ref. Seq.
Marker Gene/ SEQ ID Name Locus LG NO (R/S) Reference Sequence
S08291-1 Rps1a N 155/156
TYSRWAATGGGGCCACCCATATTATTTTGCTACCGAAATAGAATA
CGAAAATGGGGGTAGTGACCTTRTGGCCATAGAGTTGAAGCAAGC
TAATTCTGACWCGTGGCTTCCCATGCAGCGTTCATGGGGTGCAAG
GTGGGCTTTGAATTTAGGTTTACAATTACAAGCACCATTATCTAT
TAAGCTCACAGAACAAGGCAAGGGCTATTACAAGACAATTGTGGC
TGATAGTGTAATTCCACATGGCTGGCAACCTGGCCAAGTTTATCG
ATCTGTTGTTAATTTTTAAACTCTGTTTAAAATCATGACATCAAT
CGAGAAAATATGTAAAAGAAGAACTGCCAGATTATATAAATAAGT
TTATCCTTGTCAGTTCATATATATATACACAATGGAAGATTGTTT
AGCAATAWTTCTTTGCATTTCTTTTATGTGATAAAAAGTATGTGT
AATAATATGGGGGTTGCT[G/A]ATGTGTATGTGAGGTTGTGAAA
CTTTGTTTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCTCT
CCACGAGGCATTTTTTCCTAATAAYCCAGAATCCCAGTTTCTCTT
TCCCRTGAACACTTCCTTCTTCTTGGTTTGCAGTTTTTTAAAATA
AAAGGTTATTATTTTCTATAAAAAAAATGAAAAGCAATCACCTGC AAGACATGGTCATAGCCKKTT
S07292-1 Rps1c N 157/158
ATTGKTKGTSTGKKCCTVSMYRTTTGAAGCTGAATTTGTTTGCTG
CTCTGTTATCAAGCTAGTAAGGCCATTTTGCTTCAGRTAGGTCTC
CAGCGGGAGATTTGCTTCTTCAAGAAGACTYGTCATGCTCAAGCT
GTTCGGCCCAGCTTGCACATCTTCTC[T/G]ATCAGGTTGGCAAT
TCAAGTCTAATTGTCCCTTGGCAGCTTCAGCCACCGCATCGTCTG
GACTCCTTGAATCTAATTCATTTTGCACCCTTACTTCATTCTCCA
AACCGTCAACTGGAGTTAAATGGCGAGAGGTGCTATCTACTTCTG
ATTCATCTTTCGTCCGCCATGATAACTGATTTCTCTGAGCAATCT
CTGCTTCACGTTCRGATTGCYGCTTCTYCTTTCGCAKCATCAGGG
TTTTAAACCGACGTTTAACTGTCATGCACACATTGCAGGTGCATG
TAGGTTTGTGTTTGCCCTTCCCACTTGGTGGCTGGATACARACAA
TGCAAGAGCACCCAGGTCTATGCCGAGGATGTTTTGTGGTGGTAA
CAACTGGTGTTCTGCCAGAGTCACTTGCATCATCTCCCAGTATTG CTGCATTTGCCATGGTCATAG
S08242-1 Rps1c N 159/160
GCAAGCCTGCTTCAAGGACTTGCGTGGTGCACGTATGAAGAATAG
TGGCGTGAATGGGAGCTAACCTGGATTGTGAAAATGGAATACAAA
TTGCAAAATCATCAATGATTTYTAGAATATTTCCTTTATACAAAA
TGACAAATTCTATTATTAGGGAAGTGGTATAAATAAAAGCATTTG
TAAACCATTGAGGGATATGAATGAACAAAATACAAGCTTCCTTTC
CTTCRGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGT
GCTAGTCCCGAATCCAGCAATTTCCCTG[C/T]GTTTGCACGTAA
CATAGTTTCTAGTATTAGTTAAAGGGCAAAACTAAAAAATATGTG
CACCAAAGAATAGGGGATGGTTAGTTTTTATGTTAGAATCTTACG
ACAATTTGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTA
ATTTTTTTTTYKATCATTAAATTAATTTTATATCTTTGGATATTT
TATTTATTATTATTAATTATTAAAAGAAAGWGCAGAGAGTATTGT
TAGCATTTCTATTATAATTAATCTGAAATTGAACAATGTATGTAT
TCAACAAAACAGTGAAGCAGTGAATTTGAAGATGGAAGGAATCAA GAAAGTACAAGTG
S16592-001 Rps1d N 1343
CRCCGGAGTGTCCAYKGGTGTTGAGTCCTAATATTTCTTTGTGSC
TCTAGGTCATGATTTAAATACTTAAAGACCCTTGAAAATTTACAA
ACAAACTTGCGTTGCAGATATATTTCAAAACCCTAGCATACRTCT
AGCATGGGAGGGGTGCAACCAGTCACTACAAAAATCATTTGAAAA
AATTAATTGCGGATCGGGACWGATGACAACTGTGCGTACCTTAAA
GGGAAYCAGCRAATGAGAGGGTACATATAAAATTGAAGGTGTGAA
ACTCCTAGCCTCCAACTGGGATTCTTCCCRCAAGTGTCGTTTGAA
GTTAAGCCGCAAAAGAAGCTATGACTGGCTATGGYTGGCTATGGG
GGGTTGTGCACGTTGTCCTGGGTTAGGGTATATATTGTATA S07963-2 Rps1k N 161/162
CTTTCTYYTTNGCTTTTcnGAGAAGAAGAGATAAGATCAACCAAA
GAATGAAGGAATTGCAAAAGCTGGTCCCAAATTCCAGTAAGGTAA
AGAAAGAATGGTTGTAACTTAGCCAAGTTTTTGGTATAAAATTAT
GTTCCCAATCTTTTTTCAAATTCTCTATTATGTAAGAAAGTGGCC
ATACGTAACATGATAAAGCTGCAACATTGATCCTCTCTTTAATTT
CTTTCCCTGTTCACCAATTAATCGGTTCAGTGGTCCCATGAGGAC
ACAATGCCATGAASCCCAGATCA[T/C]ATATCGCATCTCCWTAT
AGTATATGTTTCATTTTGTGTCTGCATAGGATTGGCCTTCTCATA
AAGCAAACGCATTTCAGAAATCAATTGGAATCCTTTTATRTCTCT
TTGAAGAACTTCTTAAAGGAATATGTGCCTAAATGACAAAATTCA
GTTTCAATCTTTAAGTTTGYTCGAAATAAAAAGGTTTCACTTTTG
ATTAATAATTGAGTTACTAACASAAAGACAATTAGACTCTATGTC
TACACATCTTGGTGAGAATCCTCTACTGACTACTGATAAGATAAT
ACTTTTAGATCCGATTGATACATTGTTGTAGTTTAATTATCATTC
TCGAGTTTAAGTTTTTGATATGAATTACATTATATTGCAAAGWAA
ATTTTGTCTAGTATTATATGATTACTCGAWAATATTAATATTGGA
GAGAAAATTGCCYYTCACATGGTCATA S07372-1 Rps1k N 163/164
CTGCAGTGTTGTCTCTCGGAGTTGCTTCAATTGCTCATACTCTTT
GGGATAACCACTCATTTCAAAGATGTACTAGTTTAAAACATGCAA
AAAGA:TAAAGTTAATGTGTATTTTGTATGTTGTAGGGAAGCACA
AAGTATCTTGATTGAATTAGGAAGATTACACGAGCCGTATGCATC
AGAATAAATGGTTTGTGGGAGGTTAGATTTTCTGAACGAAGATGA
AGATATGCAAATTCTTTTCAAATTAATTTTGGGCAAATGATGAAG
CTAGACTGATAATTGATTAATTTTGGGCAAATAATATTATATTAC
ATGTATGAGATTGATTTTAAGTGTATATGCATACATGAAGCAATA
GACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGACTTTTGAGG
ATGCCCTTTTGTGCTGATGAGCCCTCCATGGTTGACATACAAAGC
AAATTGCAGGGTGTCTTTAGCTGAGGTTTTTGCTGCTTCGAAGTG
GCAATTGAATCAGCTCCGTTGGACAGTGACATGGTGATGGTGGTG
ATAATTAATTCGGCTTAAGGGTAAGTACAACTTCTTAGCTCTGTA
AGCAAAGGATGCCTTGTGGAGTTGGTTCATCTAATCCACGTATAT
ATAGGGCTGAACGAGGGAACAAGAGTTTTCAATCAATGATTACAA
TTCCACACTCTCGCCTCTAAAGTGCATCCCTCACATTGAAGCATC
CTCCAAATCCCAAAATATTATTATTACCACTTAAAGCTATTACAA ATCAGAAAACACTGCAG
S00009-01 Rps1k N 165/166
TCAAAGTANNNNAAGTTATTAGACATGAAATTGTTTAWGATAAAT
AATCTATTGTAATTAAGCAAGCCATGTTGGGCTAGGAACACTATC
AACTAGTAGGATTTAAGTCTAGTCTCTTTAAGCGAATTTACAAGT
TTATGGATAGCATTCAATGTATTTCTTAAGGTGGTATCACCCTCG
WTGATMATTTTCACAAATTGACACGTGGTGCGTTAGGAATTTTGT
TTTTAATAATTTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/
T]AATTTTTTTTTAAAAAAAAAATTGAATTAACACTMATGTGACA
TTTTTATGTGGAACATGTCAACCTATATAAGTAATAATTTAGAAG
TTACCACCTGAACTAATGCGTTTCAAATTCAAATGATAATATATG
ATTTATGTGACTGYTAGTTCATTTTATTTAAAAAATATTMAMAAR
ATCACWAGAMAYTRKMAATTGTCAATTCACKATTTGATAATGATA
TGACAAATAATTCCATATTAGTAAATTWTTTCAAAATAATTCCCT
TGTAATATTTCAAAATAGGATAAAYTACCATATTTGAGTCATTAA
TTGTGTAAGCGTGGTCGCATTAATCC S08013-1 Rps1k N 167/168
YYCTNANANTTGTTTACATCTTATACAGAACTTGAGTTTGAAAAC
GAAAATTGTAAGAGCAACTTTTAATCATCTTTTCAT[C/T]CAGT
GCATGCTTGAAAACTTTGTCAGAAGACAAATTAGTGKAAGCATAT
ATATTAATTTCAATAATTTATTATGGAATTATCATATGATACCAT
CCCAAACTCATTCCATGTTTCCCAAACAGAATGAATAATGATATT
ASGCACCGTTCAAATTCAACATGATTTTGACAATARAAATCCAGC
CAGATTAAATTTTTGTTCCACTATATCTCACACAAGCTTTACAAT
CGGACAAACTGGTTACTATACAACTACTATGTTTTTTCTTTTCTT
TTCTTTTAATCTCTGTTCCCATTTTATCACAAGTATTTCTTTTTT
GTCATTTATWAAAAAAAANGTAAGRAAAATTAATACTGTAAATTA
TAAAYACATGCCATATAAAANTTGTGTAAAAAAANNAAATAAACG
CATNGCCATATNNAAAAACACATGTCATAAANCAANCGTTTTAAA
TTGTGGTNCTCTNGGTCAGCAGCCACWTGG S06862-1 Rps2 J 169/170
TGTTTTGTTACGCTTCTTTTTTGTACACAGTTATGCCAATTTTGA
TTTCTTGTTTTAATTATGTGTTGTGTGGCTTGGTTTTGTGTTTCA
GTGACTCGTGCTATTGTTCCGAGAATGAACTTGGACGAGCTGTTT
GAGCAGAAGGGTGAGGTTGCCAAAGCTGTCTTGGAGGAACTTGAA
AAGGTATCTTACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGA
ATTAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATTAGTTGTT
GTTCACAAAATATCAAATTATTTCATTTCCTTTTAAAATTATACT
AGCTTGTTGAGTACTGGTGAAGAGAGTAGACAGCCTCGTGTTGTG
AAAAGGGTTGGGGGAGGGGGGGGTGGACTAAGAAGGACTTTGGAG
GAAATTGTTAAAAGGGACCTCGTCTTAANTNNTNTTCCNGAAANT
TGGNNNTNNCNTNNCNCANNGATNTCNNGTGNNTNNNGNNNNTGG S06863-1 Rps2 J
171/172 GCGGCAGATGGGCGTCTAGAGATATGTGGTATGATATATATATAA
ATATATAATATGTAGCCCCGAAATAACTTCACTTGATTTTTATCC
CATTCACGAGAGTAGCTAGATTGAAACAACATTGTCCGTTGGCCT
AAGTTCAAATAGTCAACCAGAATAAAATGCAGGCTGATCATATCT
ATTTTTGATTTTGACTATTTACCAAAACCAATCAAATGGAAGTTG
TCTAGCTAGTCTATTCTGGCGCCAAATGGCTTACTTCTCACCTTC
TGTTGTATTGGAGTAAGTATGAGGTGCA[G/A]TTCCAAATCTCA
TAGAAGTGAGAAAAAAAACATATAAAATGAGTAAAAGATTCATAA
ACCTAATCTTTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCC
TTGTGTGATTCATTGGTATAAATCTTTAGTTCAGTGAAATGGGAC
CAGGGTTATGATGTTACTGCTCATTTTCTTGACTATTAGCAGATG
AGGGATGGTTACAGTGATCAACTCTTTGTTCAGTTACTGGGAAAA
GCAGTTTATCAGCTTTGGCAAGACTACAAGGCTAAGTATGGCACC
AGTTAAGAGGCTATGAGAGCTTTGCATGTTATTTTTTAAAAATAT
AAGCGAGTATATATGTCGCAATCTATTTGTATATAGGTTAATTTG
TATTAATTCTATGTTTATTCAGCGGAATGGCATGGTCATAGCCTG TT S06864-1 Rps2 J
173/174 GTACACTTTGCTTAACCAACTCAACTCAACTTTTTAGTGCCTTTA
AAAGTAGAAAAAGGAAGTCGTGTTTGAGAGAAAAAGATAAACTTG
AAACTGAAGAAAAAGCTAAGAGCTTAACCTCTCTCCTAAAAGCTA
ACTAAAACTAACAGAATGTGCACCCTCGCATGTGGCAACCCCACT
AAGCTCCTACATGTCAGTTCCCTCCTAACCAACTCCCTGCTCATC
AGGGTTGATTTTCTTCTCTTTCAAAGGCTTTCAGCCTTTGTTCTG
ACTAAACTAAGCCCAATTTCTATCTGCTAGCCTGGTCTAACAGAA
GGGGATATGATWTAACATCGTATTCTCAAAATTGGCACGGATAGA
TCCTATTATTTAATCTTAAACTTGTTAAAGGATATAATCTTATAT
TCTCAAAATCGGCATGAGGTGGTCCTATTATTTACACTTGAACTT
TGTGAAGGACATTTTGATTTGTATCTTTGAACTTTATAATATGA
[T/C]TAGTACAGCAGTATGGAATTTGTGAAGATATTTTCTGAGG
GCAGACTGTTCAAGGGCATGGTTTTAATTTTTTTATGTATGAACC
CCATAGTTTCTGTCCACATCATCATGCCCATGGTCATAGCYKKTT S06865-1 Rps2 J
175/176 TATCGTACCTGATAAWTGTCAAAAACCTTTCCAACTCCATGGTAT
AGACATCAACAGCTTGTTCCAAGACGGTGATTTGTTCCATTTTTC
TATCAAATTATACCCAGAGAGAGAAGATAAAGTGTTACAAAAATC
CTCCATGTTCTAAAAGACTACCAAAACACCACATCTTCCATGGAA
GGAAATTAAAAAGCCTCTCAATCTCTCTAAAAAATAGAACAAGTC
CCATAAACAGCTTGTGAGCTGACACCAAATGGAAGCAAGATGTCC
AATTCTGTATCATGATAAAATGATGGGCAAAACTTATATAAGGTT
CCATAGGTGCTGTTTGTGCAATTCTCCCATCAAAATTGGAGTTTT
AACTTGGCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGATT
ATGCAAATTACCTTGGTGAAACTCCAATTTTGATTGGAGAACGTG
TAAACAACACTTGAGGAACTGTAAACAAGTTATTTCCTAAAATAA
CCTTCTAGCTCAAATGAGTTCTAAAACATCACTTAACCGAAGCGC
CAAATAAAAGAAAACAAGGAACATCTCAACAAGACGACCCTTGTT
CTCAGTTCCATGATATGCACACGATTCCATGGTCATAGCYKKKT S11652-1 Rps2 J
177/178 TCCYYGACATAYTYCCAATAAACTYGTATTCATATGMRYCTCTGT
TTCAAACAAACAAAAAAGTTCTGATGAAGTCAGCCTAAAATCCTT
GCATCCATGTCTTGATAGGTACATTAATTGTCAAGGTTAACAAGA
GCATTTCTTTTCTATTTAAATTTKACTAGTTAAATCAATMGACAA
GTAAAACCTAATCCAATAAAAACCATAAAGTAAAWTATATTAGTA
TGATTGTATACCCATCTTTGAAATGAGAGCCAGACAAGTCAGCTA
CTTGTTTCAAAGCCATCCTCCATTCCTGCAGCTTCTCCATCTTAT
CTTTGAACCTTTCCTGATGCTTAGTCATTGCTTCTCCATAACTAC
CTTTCTGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAAAG
ACCGGTATAACCAACAGCCCTTCCCTCTTGCAGTGAAAGATGGTT
ACAAGTTCATCTAAACAAAATGAGGAAAAAGCATAGTTTTCAGAA
AGCACAATAATAGCAACCCTGGAATCTTGAATTGCCTTCAAAAGT
GCAGGTGTTATTTCCTCTCCGCTGTGAAGCTTGTCTTCGTCAAAG
AAGGTATGAAATCCCTTGTCACAAAGAGCCTTGTAGAGATWGCCA
GTAAAACCATAGCGTGTGTCTGTCCCTCTGA S11682-1 Rps2 J 179/180
TKGGACCTATCACTTCCAAAGCTAATGGAAGGCCAGAAGCATAAA
TWACTACATCATTCAAGACCTCCTTATAACTTGGATCAACCTTTT
CGGTTTTAAAAGATTTCCATGTAAGCAATTGAAGAGCATTGTTCT
CATTCAATAGTTCCACTTCATATGTTCTTTTAACCCCATGAGATG
CTAGCAGTTGTTTGTCCCGAGTGGTGATGATGACTCTACTGCCTG
GACCAAACCAACAAGGTCTTCCAACAATAGCCTGTAATTGTTCAT
GCTTGTCAACATCATCTAAAATCAAGAGAACCTTCTTTCGCTGAA
GCC[G/T]ATGTTGTATAATTGAAGCTCCTTGTTCAACACTTGCT
AAGTTGATTTCCTTCTCTCCAAKTATTTCCCGAAGAAGGATGCTC
TGGAGGTGTTGTAACCCCTTCTTGTTTGATTTTTCTCTCAAATCT
TTAAGAAAACATGAACCATCAAAATGRCAAGCAATCAAATTATAA
ACTGCTATAGCAAGTGTTGATTTTCCTATCCCACCAATTCCATGG
ATCCCTATCATGTAGACACCAWCATCAGATTCAACATCCAAAAGC
TTTGTTACTTCTAGKAATCTTGATTCTAGTCCAACCGGGTAATCC CATGGTCAWAGCYKKTT
S09018-1 Rps3a F 181/182
TTTTTGGTTcaGGTCTGCAACAAAAAAGCCTCTGGGTCAGAGCAC
TCATGCTAACACCATACTTGGGACACCAACTGGGCGTCGAATGCT
TTCGACGCCTTCTGGCCGCCATGGAAACTCAGGAGGAAAGGACCG
TAGAGAAAGTGGCAGAGTGAACAGCATAATTCCAGTGAACTATGT
TGCTCTTCCAAAAGATGACTMTGTTTCTAGGGGGAATTAAGGGCT
GCCCTCTAATTTGACTC[C/G]TGAATCAGTCAGCTTTGAAAATG
CGCTTATTSTACAAGCTCTATTATGTTTCCTTCTGAAACGTTATG
CATTGTAAATTTGGTAAATGACAAATGAATGACCCATTCTAGGCT
TGATATAGAAGATTGTACAAGTCACGGGCTAAATAGATTACAAAT
ATAAAAAGAAGTCATTCTTGTTCTTTCATGTGTGTAAGTTGTCTG
ATTTGATTCTTCAAAAATGAGGTGTACTTTAGAGAATAAAGGGTA
CTTATAATTAATTTATCAGAAAATTAATAGTTGAGAAGTTTGATA
AAATTAGATACATATATGRCAATTTAGAKWTRAYRWTYTARWKTW WAW S08342-1 Rps3a F
183/184 TTAAGTGACTTTAAAATATGACACATTGAAATGACCTGTTTGGAT
ATTAAATTTAAAGAATTTTCAAAAATGATGAGAAATTTATTGGAA
TTTTTTTTTAAAATAAAATAGAATTACAAAACGCTGACAAGGTGT
TTTGGTAGGGAGAGATTCTTTTCAATTTCTTAGAAATCTTGGAAG
TGTTAAATTCCTATATTTGATATAACTATTTTAATGATCATTTTC
ATAAATCTAAAATTCACAAGAATCATTTTTGAATAAGTCTTCTAC
TAAACGTGGTTCGGTGGAGAGACTCTACAAAATGAGGTCAGACAT
CGTAGGATGTTAGTCAAGCATCGGCCAAACCAGTAAATACTTCAT
ATCATATCAATCATATGATGATAAAAAAACGCTTTCTTAAGACAC
CGTGAACTCTAGAAAACACATAAAATGAAATCTGCACAAGCTTAA
AGCACATGACTAAATAACTTTATCAAAATAAAAAACTAAAATACA
GGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAAACGAAAG
AAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACCATAC[T/
C][C/A]AAAAATTACCTTGATTTTTCTGGGTCCGGTAA[C/T]G
TTCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGATTG
GAGTAACGGAGGATGCACACATCATACCATAGGATAGCGGTAACA
CTGTCAGGACACAGCCGAGAGATTTCATTGACAGCAGTGGTGAGA
CAGAACTGGCAGAAGTATCCTGTGATGTCGTATCTGCAG S07163-1 Rps3c F 185/186
GAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGAT
GCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCG
CCCTTCAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAA
ACGAAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACC
ATACTCAAAAATTACCTTGATTTTTCTGGGTCCGGTAA[T/C]GT
TCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGAAGGG
CGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCG GTACCAAGCTTGGCGTAAT
S08442-1 Rps6 G 187/188
KTKRATTGGCTACTAAAACAAATGCTATATTTGTAAATATATACC
AATATAGCAATACAGGGGTAATTGAAAATTCTGATTAACTGTTRA
TCTACAGGTTAACAGTCTTCGGCAGGAACTACAACTTCTTGCTAG
AGATAGATCAATCACTATTGTAAATGCAAGTGGAACAGGTACTGG
TTAGCTACTTTCTTATACACATTATAGGGGCCTTTTGTTATTTCT
TCAGCAATTTAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCC
ATGATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCTRCACAA
GCTAAMCAATGTTTCCTTATTATTTTTTACTCCTKTTTTATTTTC
TGACTTGTTTGGGAAATGCACAGGTGGGAGAAAATATGCAACAGT
GATTGTTATTGTTGTGGTAGGATATGGATACGTTTGGTGGAAGGT
AATGYCTTTTCTCTCTCAATTKTTGATTTAAGTAACAGGATGCTG
TAGTGATACATTCTTRTTGGAAGCTTTATGGCTAATTTGAATTTR
AATATTGGTGCTTWTAACGAGTGCCATCTGCTCTTTGCACAYGGA TACTCTCCACTTAA
S08341-1 Rps6 G 189/190
TTGATGGAAATTCATTTGAAGGGAATATTCCGTCCGAGATTGGAA
ATTGTAGCTCTCTTTACTTGCTGTATGCATCCTATTTCTCAAGCT
CTAGTGTCATTTCTYTTAACACATCTTTTTGGA[A/T][G/T]AT
ATACTAATTCCTATCTATTTTATGCAGGAGTTTGTCTCACAATAA
TTTGACTGGTTCAATTCCAAAGTCCATGTCAAAGCTAAACAAGCT
CAAAATCCTCAAGCTGGAATTCAATGAACTAAGTGGANANATACC
AATGGAGCTTGGAATGCTTCAGAGTCTTCTTGCTGTAAACATATC
ATACAACAGGCTCACAGGAAGGCTTCCTACAAGTAGCATATTTCA
GAACTTGGACAAAAGTTCCTTGGAAGGAAACCTGGGTCTTTGTTC
ACCCTTGTTGAAGGGTCCATGTAANATGAATGTCCCCAAACCACT
WGTGCTTGACCCAAATGCCTATAACAACCAAATAAGTCCTCAAAG
GCAAACAAACNAATCATCTGAGTCTGGCCCAGTCCATCGCCACAG
GTTCCTTAGTGTATCTGCTATTGTAGCAATATCTGCATCCTTTGT
CATTGTATTAGGAGTGATTGCTGTTAGCCTACTTAATGTTTCTGT
AAGGANAAGCTAACATTTTTGGATAATG *The reference sequences for the
remaining Rps1k markers are summarized in Table 8.
TABLE-US-00006 TABLE 5 Non-limiting Examples of Amplicons
Comprising the Various Marker Loci Provided Herein Amplicon Marker
Gene/ SEQ ID NO Name Locus LG (R/S) Amplicon Sequence S08291-1
Rps1a N 1303/1304 GAAAATATGTAAAAGAAGAACTGCCAGATTATATA
AATAAGTTTATCCTTGTCAGTTCATATATATATACAC
AATGGAAGATTGTTTAGCAATATTTCTTTGCATTTCT
TTTATGTGATAAAAAGTATGTGTAATAATATGGGGG
TTGCT[G/A]ATGTGTATGTGAGGTTGTGAAACTTTGT
TTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCT CTCCACGAGGCATTTTT S07292-1
Rps1c N 1305/1306 CTCCAGCGGGAGATTTGCTTCTTCAAGAAGACTCGT
CATGCTCAAGCTGTTCGGCCCAGCTTGCACATCTTCT
C[T/G]ATCAGGTTGGCAATTCAAGTCTAATTGTCCCT
TGGCAGCTTCAGCCACCGCATCGTCTGGACTCCTTG AATCT S08242-1 Rps1c N
1307/1308 CTTGCATTCTGGAGGTGCTAGTCCCGAATCCAGCAA
TTTCCCTG[C/T]GTTTGCACGTAACATAGTTTCTAGT
ATTAGTTAAAGGGCAAAACTAAAAAATATGTGCACC AAAGAATAGGGGATGG S16592-001
Rps1d N 1344 CAAACAAACTTGCGTTGCAGATATATTTCAAAACCC
TAGCATACRTCTAGCATGGGAGGGGTGCAACCAGTC
ACTACAAAAATCATTTGAAAAAATTAATTGCGGATC
GGGACWGATGACAACTGTGCGTACCTTAAAGGGAA
YCAGCRAATGAGAGGGTACATATAAAATTGAAGGT
GTGAAACTCCTAGCCTCCAACTGGGATTCTTCCC S07963-2 Rps1k N 1309/1310
ATGAGGACACAATGCCATGAACCCCAGATCA[T/C]A
TATCGCATCTCCTTATAGTATATGTTTCATTTTGTGT CTGCATAGGATTGGCCTTCTCA
S07372-1 Rps1k N 1311/1312 ATTTTGGGCAAATGATGAAGCTAGACTGATAATTGA
TTAATTTTGGGCAAATAATATTATATTACATGTATGA
GATTGATTTTAAGTGTATATGCATACATGAAGCAAT
AGACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGAC
TTTTGAGGATGCCCTTTTGTGCTGATGAGCCCTCCAT
GGTTGACATACAAAGCAAATTGCAGGGTGTCTTTAG CTGAG S00009-01 Rps1k N
1313/1314 TGACACGTGGTGCGTTAGGAATTTTGTTTTTAATAAT
TTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/T]A
ATTTTTTTTTAAAAAAAAAATTGAATTAACACTMAT
GTGACATTTTTATGTGGAACATGTCAACCTATATAA
GTAATAATTTAGAAGTTACCACCTGAACTAATGCGT TTCA S08013-1 Rps1k N
1315/1316 GAAAACGAAAATTGTAAGAGCAACTTTTAATCATCT
TTTCAT[C/T]CAGTGCATGCTTGAAAACTTTGTCAGA
AGACAAATTAGTGKAAGCATATATATTAATTTCAAT
AATTTATTATGGAATTATCATATGATACCATCCCAA ACTCATTCCAT S06862-1 Rps2 J
1317/1318 CCAAAGCTGTCTTGGAGGAACTTGAAAAGGTATCTT
ACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGAAT
TAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATT
AGTTGTTGTTCACAAAATATCAAATTATTTCATTTCC
TTTTAAAATTATACTAGCTTGTTG[T/G]TTGCACATG
TAAAAGAGTTCATGTTAAAAGCATCTGTTTTG S06863-1 Rps2 J 1319/1320
TTCTCACCTTCTGTTGTATTGGAGTAAGTATGAGGTG
CA[G/A]TTCCAAATCTCATAGAAGTGAGAAAAAAAA
CATATAAAATGAGTAAAAGATTCATAAACCTAATCT
TTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCCT TGTGTGA S06864-1 Rps2 J
1321/1322 TGAACTTTGTGAAGGACATTTTGATTTGTATCTTTGA
ACTTTATAATATGA[T/C]TAGTACAGCAGTATGGAAT
TTGTGAAGATATTTTCTGAGGGCAGACTGTTCAAGG S06865-1 Rps2 J 1323/1324
TGTGCAATTCTCCCATCAAAATTGGAGTTTTAACTTG
GCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGA
TTATGCAAATTACCTTGGTGAAACTCCAATTTTGATT GGAGAACGTGTAAACA S11652-1
Rps2 J 1325/1326 ATTCCTGCAGCTTCTCCATCTTATCTTTGAACCTTTC
CTGATGCTTAGTCATTGCTTCTCCATAACTACCTTTC
TGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAA
AGACCGGTATAACCAACAGCCCTTCCCTCTTGCAGT GAAA S11682-1 Rps2 J 1327/1328
TCATGCTTGTCAACATCATCTAAAATCAAGAGAACC
TTCTTTCGCTGAAGCC[G/T]ATGTTGTATAATTGAAG
CTCCTTGTTCAACACTTGCTAAGTTGATTTCCTTCTC
TCCAAGTATTTCCCGAAGAAGGATGCTCTGGAG S09018-1 Rps3a F 1329/1330
GACCGTAGAGAAAGTGGCAGAGTGAACAGCATAAT
TCCAGTGAACTATGTTGCTCTTCCAAAAGATGACTCT
GTTTCTAGGGGGAATTAAGGGCTGCCCTCTAATTTG
ACTC[C/G]TGAATCAGTCAGCTTTGAAAATGCGCTTA TT S08342-1 Rps3a F
1331/1332 AAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCA
AATACCATAC[T/C][C/A]AAAAATTACCGATTTTTCT
GGGTCCGGTAA[C/T]GTTCCACGTTGGGCTTAAACTA ACTTTGCCATGGAAACTCATTGGAGTA
S07163-1 Rps3c F 1333/1334 CAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTA
AAAAACGAAAGAAGTTTAATTTGCAAATAGCTTGAA
TTTTTCAAATACCATACTCAAAAATTACCTTGATTTT
TCTGGGTCCGGTAA[T/C]GTTCCACGTTGGGCTTAAA CTAACTTTGCCATGGAAACTCTG
S08442-1 Rps6 G 1335/1336 CACATTATAGGGGCCTTTTGTTATTTCTTCAGCAATT
TAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCCAT
GATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCT
ACACAAGCTAAACAATGTTTCCTTATTATTTTTTACT
CCTGTTTTATTTTCTGACTTGTTTGGGAAATGCACAG GTGGGAGAAAATATGCAA S08341-1
Rps6 G 1337/1338 CGTCCGAGATTGGAAATTGTAGCTCTCTTTACTTGCT
GTATGCATCCTATTTCTCAAGCTCTAGTGTCATTTCT
YTTAACACATCTTTTTGGA[A/T][G/T]ATATACTAA
TTCCTATCTATTTTATGCGGAGTTTGTCTCACA
[0095] In another embodiment, the method of detecting comprises DNA
sequencing of at least one of the marker loci provided herein. As
used herein, "sequencing" refers to sequencing methods for
determining the order of nucleotides in a molecule of DNA. Any DNA
sequencing method known in the art can be used in the methods
provided herein. Non-limiting examples of DNA sequencing methods
useful in the methods provided herein include Next Generation
Sequencing (NGS) technologies, for example, as described in Egan,
A. N, et al. (2012) American Journal of Botany 99(2):175-185;
genotyping by sequencing (GB S) methods, for example, as described
in Elshire, R. J., et al. (2011) PLoS ONE 6(5):e19379; Molecular
Inversion Probe (MIP) genotyping, as described, for example, in
Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673-678; or
high throughput genotyping by whole-genome resequencing, as
described, for example in Huang, X et al., (2009) Genome Research
19:1068-1076. Each of the above references is incorporated by
reference in their entirety herein.
[0096] An active variant of any one of SEQ ID NOS: 1-1394 can
comprise a polynucleotide having at least 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ
ID NOS: 1-1394 as long as it is capable of amplifying and/or
detecting the marker locus of interest. By "fragment" is intended a
portion of the polynucleotide. A fragment or portion can comprise
at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous
nucleotides of SEQ ID NOS: 1-1394 as long as it is capable of
amplifying and/or detecting the marker locus of interest.
[0097] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
using the following parameters: % identity and % similarity for a
nucleotide sequence using GAP Weight of 50 and Length Weight of 3,
and the nwsgapdna.cmp scoring matrix; or any equivalent program
thereof. By "equivalent program" is intended any sequence
comparison program that, for any two sequences in question,
generates an alignment having identical nucleotide residue matches
and an identical percent sequence identity when compared to the
corresponding alignment generated by GAP Version 10.
[0098] Traits or markers are considered to be linked if they
co-segregate. A 1/100 probability of recombination per generation
is defined as a map distance of 1.0 centiMorgan (1.0 cM). Genetic
elements or genes located on a single chromosome segment are
physically linked. Two loci can be located in close proximity such
that recombination between homologous chromosome pairs does not
occur between the two loci during meiosis with high frequency,
e.g., such that linked loci co-segregate at least about 90% of the
time, e.g., 91%, 92%, 93, 94, 95, 96%, 97, 98%, 99, 99.5%, 99.75%,
or more of the time. Genetic elements located within a chromosome
segment are also genetically linked, typically within a genetic
recombination distance of less than or equal to 50 centimorgans
(cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or
0.25 cM or less. That is, two genetic elements within a single
chromosome segment undergo recombination during meiosis with each
other at a frequency of less than or equal to about 50%, e.g.,
about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or
0.25% or less. Closely linked markers display a cross over
frequency with a given marker of about 10% or less (the given
marker is within about 10 cM of a closely linked marker). In
specific embodiments, a closely linked marker is with 10 cM, 9 cM,
8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM or 1 cM of any given
marker disclosed herein. In further embodiments, a marker
associated with one of the markers disclosed herein can be within
75 Kb, 60 Kb, 50 Kb, 40 Kb, 30 Kb, 20K, 10 Kb, 5 Kb or less of the
disclosed marker. Put another way, closely linked loci co-segregate
at least about 90% of the time. Genetic linkage as evaluated by
recombination frequency is impacted by the chromatin structure of
the region comprising the loci. Typically, the region is assumed to
have a euchromatin structure during initial evaluations. However,
some regions, such are regions closer to centrosomes, have a
heterochromatin structure. Without further information, the
predicted physical distance between genetic map positions is based
on the assumption that the region is euchromatic, however if the
region comprises heterochromatin the markers may be physically
closer together. With regard to physical position on a chromosome,
closely linked markers can be separated, for example, by about 1
megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000
nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100
Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb,
about 1 Kb, about 500 nucleotides, about 250 nucleotides, or
less.
[0099] When referring to the relationship between two genetic
elements, such as a genetic element contributing to tolerance and a
proximal marker, "coupling" phase linkage indicates the state where
the "favorable" allele at the tolerance locus is physically
associated on the same chromosome strand as the "favorable" allele
of the respective linked marker locus. In coupling phase, both
favorable alleles are inherited together by progeny that inherit
that chromosome strand. In "repulsion" phase linkage, the
"favorable" allele at the locus of interest (e.g., a QTL for
tolerance) is physically linked with an "unfavorable" allele at the
proximal marker locus, and the two "favorable" alleles are not
inherited together (i.e., the two loci are "out of phase" with each
other).
[0100] Markers are used to define a specific locus on the soybean
genome. Each marker is therefore an indicator of a specific segment
of DNA, having a unique nucleotide sequence. Map positions provide
a measure of the relative positions of particular markers with
respect to one another. When a trait is stated to be linked to a
given marker it will be understood that the actual DNA segment
whose sequence affects the trait generally co-segregates with the
marker. More precise and definite localization of a trait can be
obtained if markers are identified on both sides of the trait. By
measuring the appearance of the marker(s) in progeny of crosses,
the existence of the trait can be detected by relatively simple
molecular tests without actually evaluating the appearance of the
trait itself, which can be difficult and time-consuming because the
actual evaluation of the trait requires growing plants to a stage
and/or under environmental conditions where the trait can be
expressed. Molecular markers have been widely used to determine
genetic composition in soybeans.
[0101] Favorable genotypes associated with at least trait of
interest may be identified by one or more methodologies. In some
examples one or more markers are used, including but not limited to
AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular
inversion probes, microarrays, sequencing, and the like. In some
methods, a target nucleic acid is amplified prior to hybridization
with a probe. In other cases, the target nucleic acid is not
amplified prior to hybridization, such as methods using molecular
inversion probes (see, for example Hardenbol et al. (2003) Nat
Biotech 21:673-678). In some examples, the genotype related to a
specific trait is monitored, while in other examples, a genome-wide
evaluation including but not limited to one or more of marker
panels, library screens, association studies, microarrays, gene
chips, expression studies, or sequencing such as whole-genome
resequencing and genotyping-by-sequencing (GB S) may be used. In
some examples, no target-specific probe is needed, for example by
using sequencing technologies, including but not limited to
next-generation sequencing methods (see, for example, Metzker
(2010) Nat Rev Genet 11:31-46; and, Egan et al. (2012) Am J Bot
99:175-185) such as sequencing by synthesis (e.g., Roche 454
pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or
Proton systems), sequencing by ligation (e.g., SOLiD from Applied
Biosystems, and Polnator system from Azco Biotech), and single
molecule sequencing (SMS or third-generation sequencing) which
eliminate template amplification (e.g., Helicos system, and PacBio
RS system from Pacific BioSciences). Further technologies include
optical sequencing systems (e.g., Starlight from Life
Technologies), and nanopore sequencing (e.g., GridION from Oxford
Nanopore Technologies). Each of these may be coupled with one or
more enrichment strategies for organellar or nuclear genomes in
order to reduce the complexity of the genome under investigation
via PCR, hybridization, restriction enzyme (see, e.g., Elshire et
al. (2011) PLoS ONE 6:e19379), and expression methods. In some
examples, no reference genome sequence is needed in order to
complete the analysis.
[0102] The use of marker assisted selection (MAS) to select a
soybean plant or germplasm which has a certain marker locus,
haplotype or marker profile is provided. For instance, in certain
examples a soybean plant or germplasm possessing a certain
predetermined favorable marker locus or haplotype will be selected
via MAS. In certain other examples, a soybean plant or germplasm
possessing a certain predetermined favorable marker profile will be
selected via MAS.
[0103] Using MAS, soybean plants or germplasm can be selected for
markers or marker alleles that positively correlate with
Phytophthora tolerance, without actually raising soybean and
measuring for tolerance (or, contrawise, soybean plants can be
selected against if they possess markers that negatively correlate
with tolerance). MAS is a powerful tool to select for desired
phenotypes and for introgressing desired traits into cultivars of
soybean (e.g., introgressing desired traits into elite lines). MAS
is easily adapted to high throughput molecular analysis methods
that can quickly screen large numbers of plant or germplasm genetic
material for the markers of interest and is much more cost
effective than raising and observing plants for visible traits.
[0104] In some embodiments, the molecular markers or marker loci
are detected using a suitable amplification-based detection method.
In these types of methods, nucleic acid primers are typically
hybridized to the conserved regions flanking the polymorphic marker
region. In certain methods, nucleic acid probes that bind to the
amplified region are also employed. In general, synthetic methods
for making oligonucleotides, including primers and probes, are well
known in the art. For example, oligonucleotides can be synthesized
chemically according to the solid phase phosphoramidite triester
method described by Beaucage and Caruthers (1981) Tetrahedron Letts
22:1859-1862, e.g., using a commercially available automated
synthesizer, e.g., as described in Needham-VanDevanter, et al.
(1984) Nucleic Acids Res. 12:6159-6168. Oligonucleotides, including
modified oligonucleotides, can also be ordered from a variety of
commercial sources known to persons of skill in the art.
[0105] It will be appreciated that suitable primers and probes to
be used can be designed using any suitable method. It is not
intended that the invention be limited to any particular primer,
primer pair or probe. For example, primers can be designed using
any suitable software program, such as LASERGENE.RTM. or
Primer3.
[0106] It is not intended that the primers be limited to generating
an amplicon of any particular size. For example, the primers used
to amplify the marker loci and alleles herein are not limited to
amplifying the entire region of the relevant locus. In some
embodiments, marker amplification produces an amplicon at least 20
nucleotides in length, or alternatively, at least 50 nucleotides in
length, or alternatively, at least 100 nucleotides in length, or
alternatively, at least 200 nucleotides in length.
[0107] Non-limiting examples of polynucleotide primers useful for
detecting the marker loci provided herein are provided in Table 2
and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339, 1340 or variants
or fragments thereof.
[0108] PCR, RT-PCR, and LCR are in particularly broad use as
amplification and amplification-detection methods for amplifying
nucleic acids of interest (e.g., those comprising marker loci),
facilitating detection of the markers. Details regarding the use of
these and other amplification methods are well known in the art and
can be found in any of a variety of standard texts. Details for
these techniques can also be found in numerous journal and patent
references, such as Mullis, et al. (1987) U.S. Pat. No. 4,683,202;
Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; Kwoh, et al.
(1989) Proc. Natl. Acad. Sci. USA 86:1173; Guatelli, et al., (1990)
Proc. Natl. Acad. Sci. USA87:1874; Lomell, et al., (1989) J. Clin.
Chem. 35:1826; Landegren, et al., (1988) Science 241:1077-1080; Van
Brunt, (1990) Biotechnology 8:291-294; Wu and Wallace, (1989) Gene
4:560; Barringer, et al., (1990) Gene 89:117, and Sooknanan and
Malek, (1995) Biotechnology 13:563-564.
[0109] Such nucleic acid amplification techniques can be applied to
amplify and/or detect nucleic acids of interest, such as nucleic
acids comprising marker loci. Amplification primers for amplifying
useful marker loci and suitable probes to detect useful marker loci
or to genotype SNP alleles are provided. For example, exemplary
primers and probes are provided in SEQ ID NOS: 1-154, 1339-1342 and
in Tables 2 and 3, and the genomic loci comprising the various
marker loci provided herein are provided in SEQ ID NOS: 155-1302,
1343, 1345-1394 and in Table 4. Non-limiting examples of amplicon
sequences comprising the marker loci provided herein are provided
in SEQ ID NOS: 1303-1338, 1344 and in Table 5. However, one of
skill will immediately recognize that other primer and probe
sequences could also be used. For instance primers to either side
of the given primers can be used in place of the given primers, so
long as the primers can amplify a region that includes the allele
to be detected, as can primers and probes directed to other SNP
marker loci. Further, it will be appreciated that the precise probe
to be used for detection can vary, e.g., any probe that can
identify the region of a marker amplicon to be detected can be
substituted for those examples provided herein. Further, the
configuration of the amplification primers and detection probes
can, of course, vary. Thus, the compositions and methods are not
limited to the primers and probes specifically recited herein.
[0110] In certain examples, probes will possess a detectable label.
Any suitable label can be used with a probe. Detectable labels
suitable for use with nucleic acid probes include, for example, any
composition detectable by spectroscopic, radioisotopic,
photochemical, biochemical, immunochemical, electrical, optical, or
chemical means. Useful labels include biotin for staining with
labeled streptavidin conjugate, magnetic beads, fluorescent dyes,
radiolabels, enzymes, and colorimetric labels. Other labels include
ligands, which bind to antibodies labeled with fluorophores,
chemiluminescent agents, and enzymes. A probe can also constitute
radiolabelled PCR primers that are used to generate a radiolabelled
amplicon. Labeling strategies for labeling nucleic acids and
corresponding detection strategies can be found, e.g., in Haugland
(1996) Handbook of Fluorescent Probes and Research Chemicals Sixth
Edition by Molecular Probes, Inc. (Eugene Oreg.); or Haugland
(2001) Handbook of Fluorescent Probes and Research Chemicals Eighth
Edition by Molecular Probes, Inc. (Eugene Oreg.).
[0111] Detectable labels may also include reporter-quencher pairs,
such as are employed in Molecular Beacon and TaqMan.TM. probes. The
reporter may be a fluorescent organic dye modified with a suitable
linking group for attachment to the oligonucleotide, such as to the
terminal 3' carbon or terminal 5' carbon. The quencher may also be
an organic dye, which may or may not be fluorescent, depending on
the embodiment. Generally, whether the quencher is fluorescent or
simply releases the transferred energy from the reporter by
non-radiative decay, the absorption band of the quencher should at
least substantially overlap the fluorescent emission band of the
reporter to optimize the quenching. Non-fluorescent quenchers or
dark quenchers typically function by absorbing energy from excited
reporters, but do not release the energy radiatively.
[0112] Selection of appropriate reporter-quencher pairs for
particular probes may be undertaken in accordance with known
techniques. Fluorescent and dark quenchers and their relevant
optical properties from which exemplary reporter-quencher pairs may
be selected are listed and described, for example, in Berlman,
Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed.,
Academic Press, New York, 1971, the content of which is
incorporated herein by reference. Examples of modifying reporters
and quenchers for covalent attachment via common reactive groups
that can be added to an oligonucleotide in the present invention
may be found, for example, in Haugland, Handbook of Fluorescent
Probes and Research Chemicals, Molecular Probes of Eugene, Oreg.,
1992, the content of which is incorporated herein by reference.
[0113] In certain examples, reporter-quencher pairs are selected
from xanthene dyes including fluoresceins and rhodamine dyes. Many
suitable forms of these compounds are available commercially with
substituents on the phenyl groups, which can be used as the site
for bonding or as the bonding functionality for attachment to an
oligonucleotide. Another useful group of fluorescent compounds for
use as reporters are the naphthylamines, having an amino group in
the alpha or beta position. Included among such naphthylamino
compounds are 1-dimethylaminonaphthyl-5 sulfonate,
1-anilino-8-naphthalene sulfonate and 2-p-touidinyl-6-naphthalene
sulfonate. Other dyes include 3-phenyl-7-isocyanatocoumarin;
acridines such as 9-isothiocyanatoacridine;
N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes;
pyrenes and the like. In certain other examples, the reporters and
quenchers are selected from fluorescein and rhodamine dyes. These
dyes and appropriate linking methodologies for attachment to
oligonucleotides are well known in the art.
[0114] Suitable examples of reporters may be selected from dyes
such as SYBR green, 5-carboxyfluorescein (5-FAM.TM. available from
Applied Biosystems of Foster City, Calif.), 6-carboxyfluorescein
(6-FAM), tetrachloro-6-carboxyfluorescein (TET),
2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein,
hexachloro-6-carboxyfluorescein (HEX),
6-carboxy-2',4,7,7'-tetrachlorofluorescein (6-TET.TM. available
from Applied Biosystems), carboxy-X-rhodamine (ROX),
6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (6-JOE.TM.
available from Applied Biosystems), VIC.TM. dye products available
from Molecular Probes, Inc., NED.TM. dye products available from
Applied Biosystems, and the like. Suitable examples of quenchers
may be selected from 6-carboxy-tetramethyl-rhodamine,
4-(4-dimethylaminophenylazo) benzoic acid (DABYL),
tetramethylrhodamine (TAMRA), BHQ-0.TM., BHQ-1.TM., BHQ-2.TM., and
BHQ-3.TM., each of which are available from Biosearch Technologies,
Inc. of Novato, Calif., QSY-7.TM., QSY-9.TM., QSY-21.TM. and
QSY-35.TM., each of which are available from Molecular Probes,
Inc., and the like.
[0115] In one aspect, real time PCR or LCR is performed on the
amplification mixtures described herein, e.g., using molecular
beacons or TaqMan.TM. probes. A molecular beacon (MB) is an
oligonucleotide which, under appropriate hybridization conditions,
self-hybridizes to form a stem and loop structure. The MB has a
label and a quencher at the termini of the oligonucleotide; thus,
under conditions that permit intra-molecular hybridization, the
label is typically quenched (or at least altered in its
fluorescence) by the quencher. Under conditions where the MB does
not display intra-molecular hybridization (e.g., when bound to a
target nucleic acid, such as to a region of an amplicon during
amplification), the MB label is unquenched. Details regarding
standard methods of making and using MBs are well established in
the literature and MBs are available from a number of commercial
reagent sources. See also, e.g., Leone, et al., (1995) Molecular
beacon probes combined with amplification by NASBA enable
homogenous real-time detection of RNA, Nucleic Acids Res.
26:2150-2155; Tyagi and Kramer, (1996) Molecular beacons: probes
that fluoresce upon hybridization, Nature Biotechnology 14:303-308;
Blok and Kramer, (1997) Amplifiable hybridization probes containing
a molecular switch, Mol Cell Probes 11:187-194; Hsuih. et al.,
(1997) Novel, ligation-dependent PCR assay for detection of
hepatitis C in serum, J Clin Microbiol 34:501-507; Kostrikis, et
al., (1998) Molecular beacons: spectral genotyping of human
alleles, Science 279:1228-1229; Sokol, et al., (1998) Real time
detection of DNA:RNA hybridization in living cells, Proc. Natl.
Acad. Sci. U.S.A. 95:11538-11543; Tyagi, et al., (1998) Multicolor
molecular beacons for allele discrimination, Nature Biotechnology
16:49-53; Bonnet, et al., (1999) Thermodynamic basis of the
chemical specificity of structured DNA probes, Proc. Natl. Acad.
Sci. U.S.A. 96:6171-6176; Fang, et al. (1999) Designing a novel
molecular beacon for surface-immobilized DNA hybridization studies,
J. Am. Chem. Soc. 121:2921-2922; Marras, et al., (1999) Multiplex
detection of single-nucleotide variation using molecular beacons,
Genet. Anal. Biomol. Eng. 14:151-156; and Vet, et al., (1999)
Multiplex detection of four pathogenic retroviruses using molecular
beacons, Proc. Natl. Acad. Sci. U.S.A. 96:6394-6399. Additional
details regarding MB construction and use is found in the patent
literature, e.g., U.S. Pat. Nos. 5,925,517; 6,150,097; and
6,037,130.
[0116] Another real-time detection method is the 5'-exonuclease
detection method, also called the TaqMan.TM. assay, as set forth in
U.S. Pat. Nos. 5,804,375; 5,538,848; 5,487,972; and 5,210,015, each
of which is hereby incorporated by reference in its entirety. In
the TaqMan.TM. assay, a modified probe, typically 10-25 nucleic
acids in length, is employed during PCR which binds intermediate to
or between the two members of the amplification primer pair. The
modified probe possesses a reporter and a quencher and is designed
to generate a detectable signal to indicate that it has hybridized
with the target nucleic acid sequence during PCR. As long as both
the reporter and the quencher are on the probe, the quencher stops
the reporter from emitting a detectable signal. However, as the
polymerase extends the primer during amplification, the intrinsic
5' to 3' nuclease activity of the polymerase degrades the probe,
separating the reporter from the quencher, and enabling the
detectable signal to be emitted. Generally, the amount of
detectable signal generated during the amplification cycle is
proportional to the amount of product generated in each cycle.
[0117] It is well known that the efficiency of quenching is a
strong function of the proximity of the reporter and the quencher,
i.e., as the two molecules get closer, the quenching efficiency
increases. As quenching is strongly dependent on the physical
proximity of the reporter and quencher, the reporter and the
quencher are preferably attached to the probe within a few
nucleotides of one another, usually within 30 nucleotides of one
another, more preferably with a separation of from about 6 to 16
nucleotides. Typically, this separation is achieved by attaching
one member of a reporter-quencher pair to the 5' end of the probe
and the other member to a nucleotide about 6 to 16 nucleotides
away, in some cases at the 3' end of the probe.
[0118] Separate detection probes can also be omitted in
amplification/detection methods, e.g., by performing a real time
amplification reaction that detects product formation by
modification of the relevant amplification primer upon
incorporation into a product, incorporation of labeled nucleotides
into an amplicon, or by monitoring changes in molecular rotation
properties of amplicons as compared to unamplified precursors
(e.g., by fluorescence polarization).
[0119] Further, it will be appreciated that amplification is not a
requirement for marker detection--for example, one can directly
detect unamplified genomic DNA simply by performing a Southern blot
on a sample of genomic DNA. Procedures for performing Southern
blotting, amplification e.g., (PCR, LCR, or the like), and many
other nucleic acid detection methods are well established and are
taught, e.g., in Sambrook, et al., Molecular Cloning--A Laboratory
Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y., 2000 ("Sambrook"); Current Protocols in
Molecular Biology, F. M. Ausubel, et al., eds., Current Protocols,
a joint venture between Greene Publishing Associates, Inc. and John
Wiley & Sons, Inc., (supplemented through 2002) ("Ausubel"))
and PCR Protocols A Guide to Methods and Applications (Innis, et
al., eds) Academic Press Inc. San Diego, Calif. (1990) (Innis).
Additional details regarding detection of nucleic acids in plants
can also be found, e.g., in Plant Molecular Biology (1993) Croy
(ed.) BIOS Scientific Publishers, Inc.
[0120] Other techniques for detecting SNPs can also be employed,
such as allele specific hybridization (ASH). ASH technology is
based on the stable annealing of a short, single-stranded,
oligonucleotide probe to a completely complementary single-stranded
target nucleic acid. Detection is via an isotopic or non-isotopic
label attached to the probe. For each polymorphism, two or more
different ASH probes are designed to have identical DNA sequences
except at the polymorphic nucleotides. Each probe will have exact
homology with one allele sequence so that the range of probes can
distinguish all the known alternative allele sequences. Each probe
is hybridized to the target DNA. With appropriate probe design and
hybridization conditions, a single-base mismatch between the probe
and target DNA will prevent hybridization.
[0121] Real-time amplification assays, including MB or TaqMan.TM.
based assays, are especially useful for detecting SNP alleles. In
such cases, probes are typically designed to bind to the amplicon
region that includes the SNP locus, with one allele-specific probe
being designed for each possible SNP allele. For instance, if there
are two known SNP alleles for a particular SNP locus, "A" or "C,"
then one probe is designed with an "A" at the SNP position, while a
separate probe is designed with a "C" at the SNP position. While
the probes are typically identical to one another other than at the
SNP position, they need not be. For instance, the two
allele-specific probes could be shifted upstream or downstream
relative to one another by one or more bases. However, if the
probes are not otherwise identical, they should be designed such
that they bind with approximately equal efficiencies, which can be
accomplished by designing under a strict set of parameters that
restrict the chemical properties of the probes. Further, a
different detectable label, for instance a different
reporter-quencher pair, is typically employed on each different
allele-specific probe to permit differential detection of each
probe. In certain examples, each allele-specific probe for a
certain SNP locus is 11-20 nucleotides in length, dual-labeled with
a florescence quencher at the 3' end and either the 6-FAM
(6-carboxyfluorescein) or VIC
(4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein) fluorophore at
the 5' end.
[0122] To effectuate SNP allele detection, a real-time PCR reaction
can be performed using primers that amplify the region including
the SNP locus, for instance the sequences listed in Table 4, the
reaction being performed in the presence of all allele-specific
probes for the given SNP locus. By then detecting signal for each
detectable label employed and determining which detectable label(s)
demonstrated an increased signal, a determination can be made of
which allele-specific probe(s) bound to the amplicon and, thus,
which SNP allele(s) the amplicon possessed. For instance, when
6-FAM- and VIC-labeled probes are employed, the distinct emission
wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured. A
sample that is homozygous for one allele will have fluorescence
from only the respective 6-FAM or VIC fluorophore, while a sample
that is heterozygous at the analyzed locus will have both 6-FAM and
VIC fluorescence.
[0123] The KASPar.RTM. and Illumina.RTM. Detection Systems are
additional examples of commercially-available marker detection
systems. KASPar.RTM. is a homogeneous fluorescent genotyping system
which utilizes allele specific hybridization and a unique form of
allele specific PCR (primer extension) in order to identify genetic
markers (e.g. a particular SNP locus associated with Phytophthora
tolerance). Illumina.RTM. detection systems utilize similar
technology in a fixed platform format. The fixed platform utilizes
a physical plate that can be created with up to 384 markers. The
Illumina.RTM. system is created with a single set of markers that
cannot be changed and utilizes dyes to indicate marker
detection.
[0124] These systems and methods represent a wide variety of
available detection methods which can be utilized to detect markers
associated with tolerance or improved tolerance to Phytophthora,
but any other suitable method could also be used.
[0125] Introgression of Phytophthora tolerance into non-tolerant or
less-tolerant soybean germplasm is provided. Any method for
introgressing one or more marker loci into soybean plants known to
one of skill in the art can be used. Typically, a first soybean
germplasm that contains Phytophthora tolerance derived from a
particular marker locus, haplotype or marker profile and a second
soybean germplasm that lacks such tolerance derived from the marker
locus, haplotype or marker profile are provided. The first soybean
germplasm may be crossed with the second soybean germplasm to
provide progeny soybean germplasm. These progeny germplasm are
screened to determine the presence of Phytophthora tolerance
derived from the marker locus, haplotype or marker profile, and
progeny that tests positive for the presence of tolerance derived
from the marker locus, haplotype or marker profile are selected as
being soybean germplasm into which the marker locus, haplotype or
marker profile has been introgressed. Methods for performing such
screening are well known in the art and any suitable method can be
used.
[0126] One application of MAS is to use the tolerance markers,
haplotypes or marker profiles to increase the efficiency of an
introgression or backcrossing effort aimed at introducing a
tolerance trait into a desired (typically high yielding)
background. In marker assisted backcrossing of specific markers
from a donor source, e.g., to an elite genetic background, one
selects among backcross progeny for the donor trait and then uses
repeated backcrossing to the elite line to reconstitute as much of
the elite background's genome as possible.
[0127] Thus, the markers and methods can be utilized to guide
marker assisted selection or breeding of soybean varieties with the
desired complement (set) of allelic forms of chromosome segments
associated with superior agronomic performance (tolerance, along
with any other available markers for yield, disease tolerance,
etc.). Any of the disclosed marker loci, marker alleles,
haplotypes, or marker profiles can be introduced into a soybean
line via introgression, by traditional breeding (or introduced via
transformation, or both) to yield a soybean plant with superior
agronomic performance. The number of alleles associated with
tolerance that can be introduced or be present in a soybean plant
ranges from 1 to the number of alleles disclosed herein, each
integer of which is incorporated herein as if explicitly
recited.
[0128] The markers and methods provided herein can also be utilized
to guide marker assisted selection or breeding of soybean varieties
comprising other Phytophthora tolerance markers or alleles to
create a molecular stack for Phytophthora tolerance. Any of the
marker loci provided herein can be introduced into a soybean line
having one or more of the Phytophthora tolerance alleles rps1,
rps2, rps3, rps4, rps5, rps6, rps7 or rps8. For example, the
stacked combinations can include Rps1c and Rps3; Rps1k and Rps6;
Rps1k and Rps3; Rps1c, Rps1k and Rps3; or Rps1c, Rps1k and Rps6.
Rps1c, Rps1k and Rps6; Rps1c and Rps1k; or any combination of one
or more of Rps1a, Rps1b, Rps1c, Rps1d, Rps1k, Rps2, Rps3a, Rps3b,
Rps3c, Rps4, Rps5, Rps6, Rps7, Rps8 and Rps Yu25. The Rps loci are
described, for example, in Sugimoto, Takuma, et al. "Pathogenic
diversity of Phytophthora sojae and breeding strategies to develop
Phytophthora-resistant soybeans." Breeding Science 61.5 (2012):
511-522; Sun, S., et al. 2011. Characterization and mapping of
RpsYu25, a novel resistance gene to Phytophthora sojae. Plant
Breed. 30:139-143; and Gordon, S. G., et al. 2007. Molecular marker
analysis of soybean plant introductions with resistance to
Phytophthora sojae. Phytopathology 97:113-118; each of which is
herein incorporated by reference in their entirety.
[0129] In one embodiment, any one or more of the marker loci
provided herein can be stacked with the rps1 allele. In another
embodiment, any one or more of the marker loci provided herein can
be stacked with the rps2 allele. In another embodiment, any one or
more of the marker loci provided herein can be stacked with the
rps3 allele. In yet another embodiment, any one or more of the
marker loci provided herein can be stacked with the rps6
allele.
[0130] This also provides a method of making a progeny soybean
plant and these progeny soybean plants, per se. The method
comprises crossing a first parent soybean plant with a second
soybean plant and growing the female soybean plant under plant
growth conditions to yield soybean plant progeny. Methods of
crossing and growing soybean plants are well within the ability of
those of ordinary skill in the art. Such soybean plant progeny can
be assayed for alleles associated with tolerance and, thereby, the
desired progeny selected. Such progeny plants or seed can be sold
commercially for soybean production, used for food, processed to
obtain a desired constituent of the soybean, or further utilized in
subsequent rounds of breeding. At least one of the first or second
soybean plants is a soybean plant in that it comprises at least one
of the marker loci or marker profiles, such that the progeny are
capable of inheriting the marker locus or marker profile.
[0131] Often, a method is applied to at least one related soybean
plant such as from progenitor or descendant lines in the subject
soybean plants pedigree such that inheritance of the desired
tolerance can be traced. The number of generations separating the
soybean plants being subject to the methods provided herein will
generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or
3 generations of separation, and quite often a direct descendant or
parent of the soybean plant will be subject to the method (i.e., 1
generation of separation).
[0132] Genetic diversity is important for long term genetic gain in
any breeding program. With limited diversity, genetic gain will
eventually plateau when all of the favorable alleles have been
fixed within the elite population. One objective is to incorporate
diversity into an elite pool without losing the genetic gain that
has already been made and with the minimum possible investment. MAS
provides an indication of which genomic regions and which favorable
alleles from the original ancestors have been selected for and
conserved over time, facilitating efforts to incorporate favorable
variation from exotic germplasm sources (parents that are unrelated
to the elite gene pool) in the hopes of finding favorable alleles
that do not currently exist in the elite gene pool.
[0133] For example, the markers, haplotypes, primers, probes, and
marker profiles can be used for MAS in crosses involving
elite.times.exotic soybean lines by subjecting the segregating
progeny to MAS to maintain major yield alleles, along with the
tolerance marker alleles herein.
[0134] As an alternative to standard breeding methods of
introducing traits of interest into soybean (e.g., introgression),
transgenic approaches can also be used to create transgenic plants
with the desired traits. In these methods, exogenous nucleic acids
that encode a desired marker loci, marker profile or haplotype are
introduced into target plants or germplasm. For example, a nucleic
acid that codes for a tolerance trait is cloned, e.g., via
positional cloning, and introduced into a target plant or
germplasm.
[0135] Experienced plant breeders can recognize tolerant soybean
plants in the field, and can select the tolerant individuals or
populations for breeding purposes or for propagation. In this
context, the plant breeder recognizes "tolerant" and "non-tolerant"
or "susceptible" soybean plants. However, plant tolerance is a
phenotypic spectrum consisting of extremes in tolerance and
susceptibility, as well as a continuum of intermediate tolerance
phenotypes. Evaluation of these intermediate phenotypes using
reproducible assays are of value to scientists who seek to identify
genetic loci that impart tolerance, to conduct marker assisted
selection for tolerant populations, and to use introgression
techniques to breed a tolerance trait into an elite soybean line,
for example.
[0136] By "improved tolerance" is intended that the plants show a
decrease in the disease symptoms that are the outcome of plant
exposure to Phytophthora. That is, the damage caused by
Phytophthora infection is prevented, or alternatively, the disease
symptoms caused by Phytophthora infection is minimized or lessened.
Thus, improved tolerance to Phytophthora can result in reduction of
the disease symptoms by at least about 2% to at least about 6%, at
least about 5% to about 50%, at least about 10% to about 60%, at
least about 30% to about 70%, at least about 40% to about 80%, or
at least about 50% to about 90% or greater. Hence, the methods
provided herein can be utilized to protect plants from Phytophthora
infection.
[0137] Screening and selection of Phytophthora tolerant soybean
plants may be performed, for example, by exposing plants to
Phytophthora and selecting those plants showing tolerance to
Phytophthora. Various assays can be used to measure tolerance or
improved tolerance to Phytophthora. For example, Phytophthora
tolerance can be determined by visual observations after plant
exposure to a particular race of Phytophthora.
[0138] Non-limiting examples of Phytophthora tolerance phenotypic
screening are described in detail below.
PHYTOPHTHORA FIELD TOLERANCE. Tolerance to Phytophthora root rot is
rated on a scale of 1 to 9, with a score of 1 indicating the plants
have no tolerance to Phytophthora, ranging to a score of 9 being
the best or highest tolerance. PRTLAB indicates the tolerance was
scored using plants in lab assay experiments. Preliminary scores
are reported as double digits, for example `55` indicates a
preliminary score of 5 on the scale of 1 to 9. PHYTOPHTHORA
RESISTANCE GENE (Rps). Various Phytophthora resistance genes are
known and include but are not limited to: Rps1-a=resistance to
races 1-2, 10-11, 13-8, 24; Rps1-c=resistance to races 1-3, 6-11,
13, 15, 17, 21, 23, 24, 26, 28-30, 32, 34, 36; Rps1-k=resistance to
races 1-11, 13-15, 17, 18, 21-24, 26, 36, 37; Rps3-a=resistance to
races 1-5, 8, 9, 11, 13, 14, 16, 18, 23, 25, 28, 29, 31-35, 39-41,
43-45, 47-52, 54; Rps3-c=resistance to races 1-4, 10-16, 18-36,
38-54; Rps6=resistance to races 1-4, 10, 12, 14-16, 18-21, 25, 28,
33-35; and, Rps8=resistance to races 1-5, 9, 13-15, 21, 25, 29, 32.
RESISTANCE. As used herein, resistance is synonymous with tolerance
and is used to describe the ability of a plant to withstand
exposure to an insect, disease, herbicide, environmental stress, or
other condition. A resistant plant variety will be able to better
withstand the insect, disease pathogen, herbicide, environmental
stress, or other condition as compared to a non-resistant or
wild-type variety.
[0139] Genes that confer resistance to Phytophthora Root Rot, such
as Rps1, Rps1-a, Rps1-b, Rps1-c, Rps1-d, Rps1-e, Rps1-k, Rps2,
Rps3-a, Rps3-b, Rps3-c, Rps4, Rps5, Rps6, Rps7, Rps8, and other Rps
genes. See, for example, Shoemaker et al. "Phytophthora Root Rot
Resistance Gene Mapping in Soybean", Plant Genome IV Conference,
San Diego, Calif. (1995).
[0140] Phytophthora sojae is maintained by refrigeration on agar.
It is transferred to fresh agar plates to make inoculum for the
test.
[0141] Test and check lines are grown in growth chambers under
controlled light and controlled temperature conditions. The lines
are inoculated at the seedling stage by injecting mycelium into the
hypocotyl. The unclassified lines are incubated in conditions
conducive for Phytophthora infection, and then evaluated when the
known susceptible controls die. The plants can be inoculated with
at least one of: Phytophthora race 4 (PMG04); Phytophthora race 7
(PMG07); and/or Phytophthora race 25 (PMG25). Experiments are
scored 2-3 days following inoculation, depending on the reaction of
susceptible and resistant checks. Infection phenotypes are
classified based on the number of seedlings alive divided by the
total number of seedlings inoculated. For example,
9=9 of 9 plants alive and healthy 5=5 of 9 plants alive and healthy
1=1 or 0 of 9 plants alive and healthy M=no or poor germ (<5
seeds germinate)
[0142] The level of tolerance of soybean varieties to Phytophthora
Root Rot can be evaluated and characterized in the field.
Phytophthora Root Rot is well known to those skilled in the art
(see, e.g., Schmitthenner and Walker, Tolerance versus resistance
for control of Phytophthora root rot of soybeans. p. 35-44 In H. D.
Loden and D. Wilkenson (ed.) Proceedings of the 9.sup.th Soybean
Seed Research Conference, Chicago, Ill. 13-14 Dec. 1979. American
Seed Trade Association, Washington, D.C.; Walker and Schmitthenner
(1984) Crop Science 24:487-489; and, Schmitthenner and Bhat. 1994.
Useful methods for studying Phytophthora in the laboratory.
Department of Plant Pathology. Ohio Agricultural Research and
Development Center. Circular 143).
[0143] For testing, seed samples from experimental and check lines
are not treated with any seed treatment. A known set of
differential checks is used. One or more races of Phytophthora are
chosen. Normally, at least Race 25 Phytophthora sojae is used.
Experimental lines and checks are sown in vermiculite in trays that
are inoculated with mycelium. The trays are moved outside to a
location covered with 30% sunlight block netting.
[0144] Differential checks with low tolerance show symptoms 1-2
weeks after planting. Experimental lines are scored approximately
three weeks after planting by removing the plants and root mass
intact from the vermiculite. The vermiculite is removed by tapping
the roots, without damaging the roots. All experimental entries are
scored relative to the appearance of the root system of one or more
check variety(s) and the known performance chart score of each
check. Scores are assigned on a scale of 1-9, and are relative to
the differential checks and based upon total root mass, general
appearance of plants and roots, and extent of necrosis.
1=all plants die after emerging 2=50% less root mass than 9306
3=equal to 9306 4=50% less root mass than Conrad, 25% more than
9306 5=25% less root mass than Conrad 6=equal to Conrad 7=equal to
92B38 and/or 93B67 8=equal to 93B45 9=equal to 9242
[0145] In some examples, a kit or an automated system for detecting
marker loci, haplotypes, and marker profiles, and/or correlating
the marker loci, haplotypes, and marker profiles with a desired
phenotype (e.g., Phytophthora tolerance) are provided. As used
herein, "kit" refers to a set of reagents for the purpose of
performing the various methods of detecting or identifying herein,
more particularly, the identification and/or the detection of a
soybean plant or germplasm having tolerance or improved tolerance
to Phytophthora.
[0146] In one embodiment, a kit for detecting or selecting at least
one soybean plant or soybean germplasm with tolerance or improved
tolerance to Phytophthora infection is provided. Such a kit
comprises (a) primers or probes for detecting one or more marker
loci associated with tolerance to Phytophthora infection, wherein
at least one of the primers and probes in the kit are capable of
detecting a marker locus, wherein the marker locus is: (i)
associated with the Rps1a, Rsp1c, Rps1d or Rps1k loci on linkage
group N; (ii) associated with Rps2 locus on linkage group J; (iii)
associated with the Rps3a or Rps3c loci on linkage group F; or (iv)
associated with the Rps6 locus on linkage group G; and (b)
instructions for using the primers or probes for detecting the one
or more marker loci and correlating the detected marker loci with
predicted tolerance to Phytophthora infection.
[0147] In a specific embodiment, the primers and probes of the kit
are capable of detecting a marker locus comprising: (a) S08291-1,
S07292-1, S08242-1, S16592-001 or a marker closely linked thereto
on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1,
the Rps1k marker loci in Table 1B or a marker closely linked
thereto on linkage group N, such as, for example, the markers
provided in FIG. 1A-C; (c) S06862-1, S06863-1, S06864-1, S06865-1,
S11652-1, S11682-1 or a marker closely linked thereto on linkage
group J, such as, for example, the markers provided in FIG. 3 A-C;
(d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto
on linkage group F, such as, for example, those markers provided in
FIG. 2 A-D; or (e) S08442-1, S08341-1 or a marker closely linked
thereto on linkage group G, such as, for example, the markers
provided in FIG. 4 A-E.
[0148] Thus, a typical kit or system can include a set of marker
probes or primers configured to detect at least one favorable
allele of one or more marker loci associated with tolerance to
Phytophthora infection, for instance a favorable marker locus,
haplotype or marker profile. These probes or primers can be
configured, for example, to detect the marker loci noted in the
tables and examples herein, e.g., using any available allele
detection format, such as solid or liquid phase array based
detection, microfluidic-based sample detection, etc. The systems
and kits can further include packaging materials for packaging the
probes, primers, or instructions, controls such as control
amplification reactions that include probes, primers or template
nucleic acids for amplifications, molecular size markers, or the
like.
[0149] A typical system can also include a detector that is
configured to detect one or more signal outputs from the set of
marker probes or primers, or amplicon thereof, thereby identifying
the presence or absence of the allele. A wide variety of signal
detection apparatus are available, including photo multiplier
tubes, spectrophotometers, CCD arrays, scanning detectors,
phototubes and photodiodes, microscope stations, galvo-scans,
microfluidic nucleic acid amplification detection appliances and
the like. The precise configuration of the detector will depend, in
part, on the type of label used to detect the marker allele, as
well as the instrumentation that is most conveniently obtained for
the user. Detectors that detect fluorescence, phosphorescence,
radioactivity, pH, charge, absorbance, luminescence, temperature,
magnetism or the like can be used. Typical detector examples
include light (e.g., fluorescence) detectors or radioactivity
detectors. For example, detection of a light emission (e.g., a
fluorescence emission) or other probe label is indicative of the
presence or absence of a marker allele. Fluorescent detection is
generally used for detection of amplified nucleic acids (however,
upstream and/or downstream operations can also be performed on
amplicons, which can involve other detection methods). In general,
the detector detects one or more label (e.g., light) emission from
a probe label, which is indicative of the presence or absence of a
marker allele. The detector(s) optionally monitors one or a
plurality of signals from an amplification reaction. For example,
the detector can monitor optical signals which correspond to "real
time" amplification assay results.
[0150] System or kit instructions that describe how to use the
system or kit or that correlate the presence or absence of the
favorable allele with the predicted tolerance are also provided.
For example, the instructions can include at least one look-up
table that includes a correlation between the presence or absence
of the favorable alleles, haplotypes, or marker profiles and the
predicted tolerance. The precise form of the instructions can vary
depending on the components of the system, e.g., they can be
present as system software in one or more integrated unit of the
system (e.g., a microprocessor, computer or computer readable
medium), or can be present in one or more units (e.g., computers or
computer readable media) operably coupled to the detector. As
noted, in one typical example, the system instructions include at
least one look-up table that includes a correlation between the
presence or absence of the favorable alleles and predicted
tolerance. The instructions also typically include instructions
providing a user interface with the system, e.g., to permit a user
to view results of a sample analysis and to input parameters into
the system.
[0151] Isolated polynucleotides comprising the nucleic acid
sequences of the primers and probes provided herein are also
encompassed herein. In one embodiment, the isolated polynucleotide
comprises a polynucleotide capable of detecting a marker locus of
the soybean genome comprising (a) S08291-1, S07292-1, S08242-1,
S16592-001 or a marker closely linked thereto on linkage group N;
(b) S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k
marker loci in Table 1B or a marker closely linked thereto on
linkage group N; (c) S06862-1, S06863-1, S06864-1, S06865-1,
S11652-1, S11682-1 or a marker closely linked thereto on linkage
group J; (d) S09018-1, S08342-1, S07163-1 or a marker closely
linked thereto on linkage group F; or (e) S08442-1, S08341-1 or a
marker closely linked thereto on linkage group G.
[0152] In specific embodiments, the isolated polynucleotide
comprises: (a) a polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,
74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339
or 1340; (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107,
108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133,
134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146,
147, 148, 149, 150, 151, 152, 153, 154, 1341 or 1342; (c) a
polynucleotide having at least 90% sequence identity to SEQ ID NOs:
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339,
1340, 1341 or 1342; or (d) a polynucleotide comprising at least 10
contiguous nucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108,
109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121,
122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134,
135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147,
148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342.
[0153] In certain embodiments, the isolated nucleic acids are
capable of hybridizing under stringent conditions to nucleic acids
of a soybean cultivar tolerant to Phytophthora, for instance to
particular SNPs that comprise a marker locus, haplotype or marker
profile.
[0154] As used herein, a substantially identical or complementary
sequence is a polynucleotide that will specifically hybridize to
the complement of the nucleic acid molecule to which it is being
compared under high stringency conditions. A polynucleotide is said
to be the "complement" of another polynucleotide if they exhibit
complementarity. As used herein, molecules are said to exhibit
"complete complementarity" when every nucleotide of one of the
polynucleotide molecules is complementary to a nucleotide of the
other. Two molecules are said to be "minimally complementary" if
they can hybridize to one another with sufficient stability to
permit them to remain annealed to one another under at least
conventional "low-stringency" conditions. Similarly, the molecules
are said to be "complementary" if they can hybridize to one another
with sufficient stability to permit them to remain annealed to one
another under conventional "high-stringency" conditions.
[0155] Appropriate stringency conditions which promote DNA
hybridization, for example, 6.times.sodium chloride/sodium citrate
(SSC) at about 45.degree. C., followed by a wash of 2.times.SSC at
50.degree. C., are known to those skilled in the art or can be
found in Current Protocols in Molecular Biology, John Wiley &
Sons, N.Y. (1989), 6.3.1-6.3.6. Typically, stringent conditions for
hybridization and detection will be those in which the salt
concentration is less than about 1.5 M Na ion, typically about 0.01
to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and
the temperature is at least about 30.degree. C. for short probes
(e.g., 10 to 50 nucleotides) and at least about 60.degree. C. for
long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Optionally, wash buffers may comprise about 0.1% to
about 1% SDS. Duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours. The duration of
the wash time will be at least a length of time sufficient to reach
equilibrium.
[0156] Non-limiting examples of methods and compositions disclosed
herein are as follows:
1. A method of identifying a first soybean plant or a first soybean
germplasm that displays tolerance or improved tolerance to
Phytophthora infection, the method comprising detecting in the
genome of said first soybean plant or in the genome of said first
soybean germplasm at least one marker locus that is associated with
the tolerance, wherein:
[0157] (a) the at least one marker locus comprises S08291-1,
S07292-1, S08242-1, S16592-001 or a marker closely linked thereto
on linkage group N;
[0158] (b) the at least one marker locus comprises S07963-2,
S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in
Table 1B or a marker closely linked thereto on linkage group N;
[0159] (c) the at least one marker locus comprises S06862-1,
S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker
closely linked thereto on linkage group J;
[0160] (d) the at least one marker locus comprises S09018-1,
S08342-1, S07163-1 or a marker closely linked thereto on linkage
group F; or
[0161] (e) the at least one marker locus comprises S08442-1,
S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of embodiment 1, wherein at least two marker loci are
detected. 3. The method of embodiment 2, wherein the at least two
marker loci comprise a haplotype that is associated with said
tolerance. 4. The method of embodiment 2, wherein the at least two
marker loci comprise a marker profile that is associated with said
tolerance. 5. The method of any one of embodiments 1-4, wherein the
germplasm is a soybean variety. 6. The method of any one of
embodiments 1-5, wherein the method further comprises selecting the
first soybean plant or first soybean germplasm or a progeny thereof
having the at least one marker locus. 7. The method of embodiment
6, further comprising crossing the selected first soybean plant or
first soybean germplasm with a second soybean plant or second
soybean germplasm. 8. The method of embodiment 7, wherein the
second soybean plant or second soybean germplasm comprises an
exotic soybean strain or an elite soybean strain. 9. The method of
any one of embodiments 1-8, wherein the detecting comprises DNA
sequencing of at least one of said marker loci. 10. The method of
any one of embodiments 1-8, wherein the detecting comprises
amplifying at least one of said marker loci and detecting the
resulting amplified marker amplicon. 11. The method of embodiment
10, wherein the amplifying comprises:
[0162] a) admixing an amplification primer or amplification primer
pair for each marker locus being amplified with a nucleic acid
isolated from the first soybean plant or the first soybean
germplasm, wherein the primer or primer pair is complementary or
partially complementary to a variant or fragment of the genomic
locus comprising the marker locus, and is capable of initiating DNA
polymerization by a DNA polymerase using the soybean nucleic acid
as a template; and
[0163] b) extending the primer or primer pair in a DNA
polymerization reaction comprising a DNA polymerase and a template
nucleic acid to generate at least one amplicon.
12. The method of embodiment 11, wherein said method comprises
amplifying a variant or fragment of one or more polynucleotides
comprising SEQ ID NOs:155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348,
1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359,
1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370,
1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381,
1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392,
1393 or 1394. 13. The method of embodiment 11, wherein said primer
or primer pair comprises a variant or fragment of one or more
polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159,
160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345,
1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356,
1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367,
1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378,
1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389,
1390, 1391, 1392, 1393 or 1394 or complements thereof. 14. The
method of embodiment 13, wherein said primer or primer pair
comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 1339, 1340 or variants or fragments thereof. 15. The method of
embodiment 14, wherein said primer pair comprises:
[0164] a) SEQ ID NO: 1 and SEQ ID NO:2;
[0165] b) SEQ ID NO: 9 and SEQ ID NO:10;
[0166] c) SEQ ID NO: 20 and SEQ ID NO:21;
[0167] d) SEQ ID NO: 22 and SEQ ID NO: 23;
[0168] e) SEQ ID NO: 24 and SEQ ID NO: 25;
[0169] f) SEQ ID NO: 36 and SEQ ID NO: 37;
[0170] g) SEQ ID NO: 38 and SEQ ID NO: 39; or
[0171] h) SEQ ID NO: 1339 and SEQ ID NO: 1340.
16. The method of embodiment 11, wherein said method comprises
amplifying a variant or fragment of SEQ ID NOs: 173, 174, 175, 176,
177, 178, 179 or 180. 17. The method of embodiment 11, wherein said
primer or primer pair comprises a variant or fragment of SEQ ID
NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
18. The method of embodiment 17, wherein said primer or primer pair
comprises a nucleic acid sequence comprising SEQ ID NOs: 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,
59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,
76, 77, 78 or variants or fragments thereof. 19. The method of
embodiment 18, wherein said primer pair comprises:
[0172] a) SEQ ID NO: 40 and SEQ ID NO: 41;
[0173] b) SEQ ID NO: 46 and SEQ ID NO: 47;
[0174] c) SEQ ID NO: 52 and SEQ ID NO: 53;
[0175] d) SEQ ID NO: 58 and SEQ ID NO: 59;
[0176] e) SEQ ID NO: 64 and SEQ ID NO: 65; or
[0177] f) SEQ ID NO: 75 and SEQ ID NO: 76.
20. The method of embodiment 11, wherein said method comprises
amplifying a variant or fragment of SEQ ID NOs: 181, 182, 183, 184,
185 or 186. 21. The method of embodiment 11, wherein said primer or
primer pair comprises a variant or fragment of SEQ ID NOs: 181,
182, 183, 184, 185, 186 or complements thereof. 22. The method of
embodiment 21, wherein said primer or primer pair comprises a
nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments
thereof. 23. The method of embodiment 22, wherein said primer pair
comprises:
[0178] a) SEQ ID NO: 81 and SEQ ID NO: 82;
[0179] b) SEQ ID NO: 89 and SEQ ID NO: 90; or
[0180] c) SEQ ID NO: 91 and SEQ ID NO: 92.
24. The method of embodiment 11, wherein said method comprises
amplifying a variant or fragment of SEQ ID NOs: 187, 188, 189 or
190. 25. The method of embodiment 11, wherein said primer or primer
pair comprises a variant or fragment of SEQ ID NOs: 187, 188, 189,
190 or complements thereof. 26. The method of embodiment 25,
wherein said primer or primer pair comprises a nucleic acid
sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100,
101, 102, 103, 104 or variants or fragments thereof. 27. The method
of embodiment 26, wherein said primer pair comprises:
[0181] a) SEQ ID NO: 95 and SEQ ID NO: 96; or
[0182] b) SEQ ID NO: 101 and SEQ ID NO: 102.
28. The method of embodiment 11, wherein the method further
comprises providing one or more labeled nucleic acid probes
suitable for detection of each marker locus being amplified. 29.
The method of embodiment 28, wherein said labeled nucleic acid
probe comprises a nucleic acid sequence comprising a variant or
fragment of one or more polynucleotides comprising SEQ ID NOs: 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352,
1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363,
1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374,
1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385,
1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or
complements thereof. 30. The method of embodiment 29, wherein the
labeled nucleic acid probe comprises a nucleic acid sequence
comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114,
115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127,
1341 or 1342. 31. The method of embodiment 28, wherein said labeled
nucleic acid probe comprises a nucleic acid sequence comprising a
variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178,
179, 180 or complements thereof. 32. The method of embodiment 31,
wherein the labeled nucleic acid probe comprises a nucleic acid
sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134,
135, 136, 137, 138 or 139. 33. The method of embodiment 28, wherein
said labeled nucleic acid probe comprises a nucleic acid sequence
comprising a variant or fragment of SEQ ID NOs: 181, 182, 183, 184,
185, 186 or complements thereof. 34. The method of embodiment 33,
wherein the labeled nucleic acid probe comprises a nucleic acid
sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146,
147, 148 or 149. 35. The method of embodiment 28, wherein said
labeled nucleic acid probe comprises a nucleic acid sequence
comprising a variant or fragment of SEQ ID NOs: 187, 188, 189, 190
or complements thereof. 36. The method of embodiment 35, wherein
the labeled nucleic acid probe comprises a nucleic acid sequence
comprising SEQ ID NOs: 150, 151, 152, 153 or 154. 37. An isolated
polynucleotide capable of detecting a marker locus of the soybean
genome comprising S08291-1, S07292-1, S08242-1, S16592-001,
S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker
loci in Table 1B or a marker closely linked thereto on linkage
group N. 38. The isolated polynucleotide of embodiment 37, wherein
the polynucleotide comprises:
[0183] (a) a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
1339 or 1340;
[0184] (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107,
108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
[0185] (c) a polynucleotide having at least 90% sequence identity
to the polynucleotides set forth in parts (a) or (b); or
[0186] (d) a polynucleotide comprising at least 10 contiguous
nucleotides of the polynucleotides set forth in parts (a) or
(b).
39. An isolated polynucleotide capable of detecting a marker locus
of the soybean genome comprising S06862-1, S06863-1, S06864-1,
S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on
linkage group J. 40. The isolated polynucleotide of embodiment 39,
wherein the polynucleotide comprises:
[0187] (a) a polynucleotide comprising SEQ ID NOs: 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77
or 78;
[0188] (b) a polynucleotide comprising SEQ ID NOs: 128, 129, 130,
131, 132, 133, 134, 135, 136, 137, 138 or 139;
[0189] (c) a polynucleotide having at least 90% sequence identity
to the polynucleotides set forth in parts (a) or (b); or
[0190] (d) a polynucleotide comprising at least 10 contiguous
nucleotides of the polynucleotides set forth in parts (a) or
(b).
41. An isolated polynucleotide capable of detecting a marker locus
of the soybean genome comprising S09018-1, S08342-1, S07163-1 or a
marker closely linked thereto on linkage group F. 42. The isolated
polynucleotide of embodiment 41, wherein the polynucleotide
comprises:
[0191] (a) a polynucleotide comprising SEQ ID NOs: 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90, 91 or 92;
[0192] (b) a polynucleotide comprising SEQ ID NOs: 140, 141, 142,
143, 144, 145, 146, 147, 148 or 149;
[0193] (c) a polynucleotide having at least 90% sequence identity
to the polynucleotides set forth in parts (a) or (b); or
[0194] (d) a polynucleotide comprising at least 10 contiguous
nucleotides of the polynucleotides set forth in parts (a) or
(b).
43. An isolated polynucleotide capable of detecting a marker locus
of the soybean genome comprising S08442-1, S08341-1 or a marker
closely linked thereto on linkage group G. 44. The isolated
polynucleotide of embodiment 43, wherein the polynucleotide
comprises:
[0195] (a) a polynucleotide comprising SEQ ID NOs: 93, 94, 95, 96,
97, 98, 99, 100, 101, 102, 103 or 104;
[0196] (b) a polynucleotide comprising SEQ ID NOs: 150, 151, 152,
153 or 154;
[0197] (c) a polynucleotide having at least 90% sequence identity
to the polynucleotides set forth in parts (a) or (b); or
[0198] (d) a polynucleotide comprising at least 10 contiguous
nucleotides of the polynucleotides set forth in parts (a) or
(b).
45. A kit for detecting or selecting at least one soybean plant or
soybean germplasm with tolerance or improved tolerance to
Phytophthora infection, the kit comprising:
[0199] (a) primers or probes for detecting one or more marker loci
associated with tolerance to Phytophthora infection, wherein the
primers or probes are capable of detecting a marker locus, wherein:
[0200] (i) the at least one marker locus comprises S08291-1,
S07292-1, S08242-1, S16592-001 or a marker closely linked thereto
on linkage group N; [0201] (ii) the at least one marker locus
comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k
marker loci in Table 1B or a marker closely linked thereto on
linkage group N; [0202] (iii) the at least one marker locus
comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1,
S11682-1 or a marker closely linked thereto on linkage group J;
[0203] (iv) the at least one marker locus comprises S09018-1,
S08342-1, S07163-1 or a marker closely linked thereto on linkage
group F; or [0204] (v) the at least one marker locus comprises
S08442-1, S08341-1 or a marker closely linked thereto on linkage
group G.
[0205] (b) instructions for using the primers or probes for
detecting the one or more marker loci and correlating the detected
marker loci with predicted tolerance to Phytophthora infection.
EXPERIMENTAL
[0206] The following examples are offered to illustrate, but not to
limit the claimed invention. It is understood that the examples and
embodiments described herein are for illustrative purposes only,
and persons skilled in the art will recognize various reagents or
parameters that can be altered without departing from the spirit of
the invention or the scope of the appended claims.
Example 1
Marker Loci Associated with Phytophthora Tolerance at Rps1 Loci
[0207] Markers were developed to characterize, identify, and/or
select resistant or susceptible alleles at the Rps1 locus on
linkage group N (ch 3). Markers were screened against various known
resistant and susceptible parents.
A. Rps1a
[0208] A marker to locus S08291-1 was developed to identify alleles
associated with the phytophthora resistance phenotype, this marker
detects a G/A polymorphism associated with Rps1a. A panel of lines
used for development for markers to identify Rps1c included lines
with Rps1k and Rps1a, and provided information for alleles in the
Rps1a genomic region. During development, this marker was validated
and confirmed against a panel of about 30 resistant and susceptible
varieties which included proprietary experimental lines,
proprietary commercial lines, and public lines. Further development
and testing was done to optimize the marker system for high
throughput analysis of soybean. From this testing, S08291-1-Q5 was
chosen for high throughput analysis needs, but other versions can
be used to detect the polymorphism. This marker was used to
fingerprint about 2000 lines.
[0209] Genomic DNA was extracted for testing using a standard CTAB
protocol and exemplary amplification conditions are described
below.
Cycle settings: Taqman.TM. assay
TABLE-US-00007 94.degree. C. 2 min 1 cycle 94.degree. C. 30 sec 40
cycles 60.degree. C. 60 sec
Amplification Mix (in microliters):
TABLE-US-00008 H2O 3.625 hottub buffer 0.5 dNTP (2.5 mM each) 0.375
primer1 + primer2 (10 uM each) 0.15 primer3 + primer4 (10 uM each)
0.15 probe 1 (10 uM) 0.05 Probe 2 (10 uM) 0.05 hottub enzyme 0.025
Invitrogen rox dye (50X) 0.075 DNA 0.05 Total 5.05
B. Rps1c
[0210] Several populations were developed in order to identify and
characterize Phytophthora resistance loci and polymorphisms for
marker development. The following biparental crosses were made and
phenotyped for the Phytophthora races (PMG Race) indicated, as
shown in Table 6.
TABLE-US-00009 TABLE 6 Parent 1 Parent 2 Gene Entries PMG Race(s)
92M61 93Y13 Deletion/Rps1c 120 7 91Y20 93Y13 Rps1k/Rps1c 92 7 &
4 93M42 XB18S09 Rps1a/Rps1c 92 7 & 1 92M61 XB18S09
Deletion/Rps1c 92 7
[0211] Markers to the S07292-1 locus and the S08242 locus were
developed to identify alleles associated with the Phytophthora
resistance phenotype associated with Rps1c. During development,
these markers were validated and confirmed against a panel of about
30 varieties which included proprietary experimental lines,
proprietary commercial lines, and public lines. Further development
and testing was done to optimize each marker system for high
throughput analysis of soybean.
C. Rps1d
[0212] Rps1d was mapped near Rps1k and may be an alternate allele
of the Rps1 locus (Sugimoto et al., 2008. Identification of SSR
markers linked to the Phytophthora resistance gene Rps1-d in
soybean (2008) Plant Breeding, 127 (2): 154-159). SNPs that could
be used for marker assisted selection of Rps1d were identified near
the Rps1k region through sequencing of amplicons generated using
extracted DNA from EX23U07, a progeny of the Rps1d donor PI103091.
EX23U07 has the minor allele at SNP, S16592-001, which was found to
be at low allele frequency across a diverse set of germplasm
(.about.6.2%, see table below). The Taqman assay S16592-001-Q001
was designed to assay this SNP and will be useful for MAS of
Rps1d.
TABLE-US-00010 TABLE 7 The following lines were genotyped using the
Taqman marker S16592-001-Q001. Column three indicates the predicted
allele at the Rps1 locus within the respective line based on
phenotypic screens of phytophthora resistance. S16592- Sample Name
001 Trait EX23U07 A Rps1d ARKSOY A Rps1c Ralsoy A Rps1c 91Y41 A
Rps1c 91Y92 A Rps1c 92M81 A Rps1c 93M14 A Rps1c 93Y80 A Rps1c
ARKSOY A Rps1c Ralsoy A Rps1c Sheyenne A -- 92B38 T None 92M33 T
None 92M61 T None 92Y70 T None 93Y23 T None 93Y30 T None 93Y70 T
None 93Y72 T None 93Y92 T None 94M80 T None 94Y50 T None 94Y70 T
None 94Y80 T None 94Y90 T None 95M50 T None 95Y01 T None 95Y20 T
None 95Y30 T None 95Y31 T None 90M01 T Rps1k 90M02 T Rps1k 90M91 T
Rps1k 90M92 T Rps1k 90Y21 T Rps1k 90Y41 T Rps1k 90Y42 T Rps1k 90Y50
T Rps1k 90Y70 T Rps1k 91B42 T Rps1k 91M01 T Rps1k 91M13 T Rps1k
91M30 T Rps1k 91M41 T Rps1k 91M51 T Rps1k 91M61 T Rps1k 91Y20 T
Rps1k 91Y21 T Rps1k 91Y70 T Rps1k 91Y72 T Rps1k 91Y80 T Rps1k 92B12
T Rps1k 92M02 T Rps1k 92M11 T Rps1k 92M21 T Rps1k 92M72 T Rps1k
92M76 T Rps1k 92M91 T Rps1k 92Y10 T Rps1k 92Y20 T Rps1k 92Y21 T
Rps1k 92Y30 T Rps1k 92Y51 T Rps1k 92Y52 T Rps1k 92Y54 T Rps1k 92Y60
T Rps1k 92Y61 T Rps1k 92Y72 T Rps1k 92Y80 T Rps1k 92Y82 T Rps1k
92Y90 T Rps1k 92Y91 T Rps1k 93B82 T Rps1k 93B86 T Rps1k 93M11 T
Rps1k 93M82 T Rps1k 93M92 T Rps1k 93M96 T Rps1k 93Y02 T Rps1k 93Y04
T Rps1k 93Y05 T Rps1k 93Y10 T Rps1k 93Y11 T Rps1k 93Y15 T Rps1k
93Y20 T Rps1k 93Y21 T Rps1k 93Y40 T Rps1k 93Y50 T Rps1k 93Y51 T
Rps1k 93Y60 T Rps1k 93Y81 T Rps1k 93Y90 T Rps1k 93Y91 T Rps1k 93Y93
T Rps1k 94B73 T Rps1k 94M30 T Rps1k 94Y01 T Rps1k 94Y10 T Rps1k
94Y20 T Rps1k 94Y30 T Rps1k 94Y40 T Rps1k 94Y60 T Rps1k 94Y91 T
Rps1k 95Y40 T Rps1k 93M42 T 1A 93Y82 T 1A 95Y10 T 1A KINGWA T Rps1k
9071 T Rps1c 9181 T Rps1c 900Y71 T Rps1c 90B43 T Rps1c 90B51 T
Rps1c 90M60 T Rps1c 90M80 T Rps1c 90Y90 T Rps1c 94Y21 T Rps1c A1564
T -- A2943 T -- A3127 T -- A3733 T -- A4715 T -- A5979 T -- A6297 T
-- ADAMS T -- BAVENDERSPECIALA T -- BLACKHAWK T -- Capital T --
CLARK T -- CLARK63 T -- CNS T -- DORMAN T -- Dunfield T -- ESSEX T
-- FC31745 T -- FOWLER T -- Haberlandt T -- HAROSOY T -- HAWKEYE T
-- Illini T -- JACKSON T -- Kanro T -- KS3406 T -- L15 T -- LEE T
-- Lincoln T -- LP14575198 T -- MT95-123720 T -- Mukden T -- OGDEN
T -- P2981 T -- Palmetto T -- Patoka T -- Peking T -- PERRY T --
PI084674 T -- PI171442 T -- PI180501 T -- PI248404 T -- PI391589 T
-- PI424195B T -- PI437151 T -- PI54610 T -- PI605891B T -- PI81041
T -- PI84946-2 T -- PI88788 T -- PI91110-1 T -- Pintado T --
Richland T -- S-100 T -- SENECA T -- ST2250 T -- ST2660 T -- Tokyo
T -- WAYNE T -- Williams T --
D. Rps1k
[0213] Markers to loci S00009-1, S07963-2, and S08013 were
developed in order to characterize and identify lines having a
Rps1k resistance allele. It was observed that over time marker
S00009-01-A did not always identify lines known to have Rps1k. It
was hypothesized that this could be due to a recombination event in
the region. A new target region was selected near the Rps1k locus
and sequenced. Markers S07963-2-Q1 and S08013-1Q were designed
based on the SNP profile of the sequenced region. These markers
were tested on a panel of public and proprietary lines which
included known Rps1k lines, susceptible lines, and other test
lines. The allele and haplotype data are summarized below in Table
8.
TABLE-US-00011 TABLE 8 # Phenotype lines S00009-01-A S07963-2-Q1
S08013-1-Q1 1k 5 C T C SUS 17 T C T 1k + 3a C T C 1k 1 -- -- -- 1k
+ unknown 1 C T C Unknown 5 T C T 1k 1 T T C SUS 3 C C T
[0214] Markers S07963-2-Q1 and S08013-1Q were further evaluated and
validated against four F3 mapping populations using the following
amplification conditions.
PCR Cycle Settings
TABLE-US-00012 [0215] 94.degree. C. 10 min 1 cycle 94.degree. C. 30
sec 40 cycles 60.degree. C. 60 sec 40 cycles
TAQMAN.TM. Amplification Mix (Volumes in Microliters)
TABLE-US-00013 [0216] DNA (dried down) 16 ng Water 2.42 KlearKall
Mastermix 2.5 Forward Primer (100 .mu.m) 0.0375 Reverse Primer (100
.mu.m) 0.0375 Probe 1 (100 .mu.m) 0.005 Probe 2 (100 .mu.m) 0.005
Total 5
Case Control Association Analysis
[0217] Using a case-control association analysis, the Rps1k locus
which conditions variation in phytophthora root rot resistance, was
fine-mapped between 3915646-4533559 bp on Gm03 (Lg N). A set of 581
SNPs were identified in this region that perfectly differentiate
resistant from susceptible lines. These markers are ideal
candidates for marker-assisted selection of resistance to
phytophthora root rot from the Rps1k locus.
[0218] Phenotypic data from lab screening for Phytophthora
resistance was used in the study. DNA was prepped using standard
Illumina TruSeq Chemistry. Selected resistant and susceptible lines
formed the case groups and were sequenced to .about.0.5-40x genome
coverage on an Illumina HiSeq2000. SNPs were called using a
proprietary software to automate the process, missing data was
imputed using a separate proprietary software. Haploview was used
to conduct a case-control association analysis on a set of 15537
SNPs identified in the region from 34000026-5085535 bp on Gm03. The
case group comprised 57 proprietary soybean lines resistant to
phytophthora and the control group comprised 9 proprietary
susceptible lines. Following Haploview filtering using the settings
noted below, 7491 SNPs remained in the analysis. Nine SNPs had all
missing values in the control group and were removed from
additional analysis.
Haploview Settings:
[0219] Do Association Test [0220] Case/Control Data [0221] Ignore
Pairwise comparisons of markers>10 kb apart [0222] Exclude
individuals with >50% missing genotypes [0223] HW p-value
cutoff: 0.0 [0224] Min genotype % 50 [0225] Max # mendel errors: 1
[0226] Minimum minor allele freq. 0.05
[0227] The presence of haplotypes were also observed in a panel of
lines not included in the association study.
[0228] A plot of chi square values from case-control analysis
versus physical position of 7482 SNPs reveals a peak of SNP to
trait association between 3915646-4533559 bp on Gm03, suggesting
that a locus conditioning phytophthora resistance is in this
region. A total of 581 SNPs have a perfect association between 9
susceptible (control) and 57 resistant (case) lines (Table 9).
These markers are ideal for TaqMan.TM. assay design or for
evaluation by other methods, including sequencing, hybridization,
or other technologies. Numerous additional SNPs analyzed here that
are linked to region but are not in perfect LD with trait could be
very informative markers when used in select germplasm.
TABLE-US-00014 TABLE 9 Ref. Ref. Sequence Sequence Assoc Case,
Control Case, Control Chi SEQ ID NO SEQ ID NO Name Allele Ratio
Counts Frequencies Square P-value (Res.) (Sus.) Gm03:3915646 A
112:0, 0:8 1.000, 0.000 120 6.33E-28 1345 1346 Gm03:3917778 A
114:0, 0:14 1.000, 0.000 128 1.12E-29 191 747 Gm03:3918853 T 114:0,
0:14 1.000, 0.000 128 1.12E-29 192 748 Gm03:3920367 A 114:0, 0:18
1.000, 0.000 132 1.50E-30 193 749 Gm03:3926721 T 114:0, 0:18 1.000,
0.000 132 1.50E-30 194 750 Gm03:3926775 A 114:0, 0:18 1.000, 0.000
132 1.50E-30 195 751 Gm03:3927474 T 114:0, 0:16 1.000, 0.000 130
4.10E-30 196 752 Gm03:3927724 G 114:0, 0:18 1.000, 0.000 132
1.50E-30 197 753 Gm03:3929330 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 198 754 Gm03:3929383 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 199 755 Gm03:3930408 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 200 756 Gm03:3930551 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 201 757 Gm03:3930806 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 202 758 Gm03:3932629 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 203 759 Gm03:3932974 T 114:0, 0:16 1.000, 0.000 130
4.10E-30 204 760 Gm03:3933370 A 112:0, 0:8 1.000, 0.000 120
6.33E-28 1347 1348 Gm03:3933900 G 114:0, 0:18 1.000, 0.000 132
1.50E-30 205 761 Gm03:3933945 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 206 762 Gm03:3934403 G 114:0, 0:18 1.000, 0.000 132
1.50E-30 207 763 Gm03:3934964 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 208 764 Gm03:3935036 G 114:0, 0:16 1.000, 0.000 130
4.10E-30 209 765 Gm03:3935832 G 114:0, 0:16 1.000, 0.000 130
4.10E-30 210 766 Gm03:3935884 T 114:0, 0:16 1.000, 0.000 130
4.10E-30 211 767 Gm03:3939831 C 112:0, 0:18 1.000, 0.000 130
4.10E-30 212 768 Gm03:3939836 G 114:0, 0:18 1.000, 0.000 132
1.50E-30 213 769 Gm03:3939936 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 214 770 Gm03:3939939 G 114:0, 0:6 1.000, 0.000 120
6.33E-28 215 771 Gm03:3940174 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 216 772 Gm03:3940396 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 217 773 Gm03:3940836 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 218 774 Gm03:3941262 A 112:0, 0:16 1.000, 0.000 128
1.12E-29 219 775 Gm03:3941484 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 220 776 Gm03:3941769 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 221 777 Gm03:3942973 C 114:0, 0:12 1.000, 0.000 126
3.07E-29 222 778 Gm03:3943092 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 223 779 Gm03:3944671 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 224 780 Gm03:3944738 C 114:0, 0:6 1.000, 0.000 120
6.33E-28 225 781 Gm03:3945112 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 226 782 Gm03:3945208 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 227 783 Gm03:3947836 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 228 784 Gm03:3947860 G 114:0, 0:6 1.000, 0.000 120
6.33E-28 229 785 Gm03:3949250 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 230 786 Gm03:3949680 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 231 787 Gm03:3951187 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 232 788 Gm03:3951201 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 233 789 Gm03:3951485 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 234 790 Gm03:3951603 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 235 791 Gm03:3951705 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 236 792 Gm03:3951715 G 114:0, 0:16 1.000, 0.000 130
4.10E-30 237 793 Gm03:3952778 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 1349 1350 Gm03:3952811 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 1351 1352 Gm03:3955716 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 238 794 Gm03:3956414 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 239 795 Gm03:3958402 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 240 796 Gm03:3960626 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 241 797 Gm03:3962904 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 242 798 Gm03:3967880 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 243 799 Gm03:3968334 G 114:0, 0:14 1.000, 0.000 128
1.12E-29 1353 1354 Gm03:3971607 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 244 800 Gm03:3971640 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 245 801 Gm03:3971692 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 246 802 Gm03:3975817 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 247 803 Gm03:3975824 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 248 804 Gm03:3976645 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 249 805 Gm03:3980566 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 250 806 Gm03:3981623 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 251 807 Gm03:3981822 A 112:0, 0:6 1.000, 0.000 118
1.73E-27 252 808 Gm03:3982138 C 114:0, 0:12 1.000, 0.000 126
3.07E-29 253 809 Gm03:3982678 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 254 810 Gm03:3984554 C 114:0, 0:4 1.000, 0.000 118
1.73E-27 255 811 Gm03:3986094 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 256 812 Gm03:3987393 C 114:0, 0:4 1.000, 0.000 118
1.73E-27 257 813 Gm03:3990954 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 258 814 Gm03:3992071 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 259 815 Gm03:3995556 C 112:0, 0:18 1.000, 0.000 130
4.10E-30 260 816 Gm03:3996269 C 114:0, 0:8 1.000, 0.000 122
2.31E-28 261 817 Gm03:3996600 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 262 818 Gm03:3997028 C 114:0, 0:16 1.000, 0.000 130
4.10E-30 263 819 Gm03:3998157 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 264 820 Gm03:3998162 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 265 821 Gm03:3998381 T 112:0, 0:18 1.000, 0.000 130
4.10E-30 266 822 Gm03:3998421 T 110:0, 0:18 1.000, 0.000 128
1.12E-29 267 823 Gm03:3999241 T 114:0, 0:16 1.000, 0.000 130
4.10E-30 268 824 Gm03:3999386 C 114:0, 0:16 1.000, 0.000 130
4.10E-30 269 825 Gm03:3999666 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 270 826 Gm03:4000684 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 1355 1356 Gm03:4001327 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 271 827 Gm03:4001783 A 112:0, 0:6 1.000, 0.000 118
1.73E-27 272 828 Gm03:4002016 C 112:0, 0:12 1.000, 0.000 124
8.42E-29 273 829 Gm03:4005770 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 274 830 Gm03:4008187 G 114:0, 0:16 1.000, 0.000 130
4.10E-30 275 831 Gm03:4008673 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 276 832 Gm03:4008687 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 277 833 Gm03:4010191 C 114:0, 0:16 1.000, 0.000 130
4.10E-30 278 834 Gm03:4018588 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 279 835 Gm03:4019384 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 280 836 Gm03:4019896 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 281 837 Gm03:4020751 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 282 838 Gm03:4021281 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 283 839 Gm03:4021291 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 284 840 Gm03:4022234 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 285 841 Gm03:4022275 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 286 842 Gm03:4022530 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 287 843 Gm03:4022872 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 288 844 Gm03:4022934 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 289 845 Gm03:4023283 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 290 846 Gm03:4023522 C 114:0, 0:8 1.000, 0.000 122
2.31E-28 291 847 Gm03:4024184 C 114:0, 0:16 1.000, 0.000 130
4.10E-30 292 848 Gm03:4024294 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 293 849 Gm03:4024485 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 294 850 Gm03:4024630 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 295 851 Gm03:4024844 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 296 852 Gm03:4025056 A 114:0, 0:8 1.000, 0.000 122
2.31E-28 297 853 Gm03:4026652 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 298 854 Gm03:4028481 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 299 855 Gm03:4028849 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 300 856 Gm03:4028961 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 301 857 Gm03:4029068 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 302 858 Gm03:4029809 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 303 859 Gm03:4031277 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 304 860 Gm03:4031983 C 114:0, 0:8 1.000, 0.000 122
2.31E-28 305 861 Gm03:4031997 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 306 862 Gm03:4032705 T 114:0, 0:14 1.000, 0.000 128
1.12E-29 307 863 Gm03:4035600 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 308 864 Gm03:4035918 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 1357 1358 Gm03:4036376 A 114:0, 0:14 1.000, 0.000 128
1.12E-29 309 865 Gm03:4040874 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 310 866 Gm03:4041301 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 311 867 Gm03:4041795 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 312 868 Gm03:4042572 G 114:0, 0:18 1.000, 0.000 132
1.50E-30 313 869 Gm03:4042679 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 314 870 Gm03:4042697 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 315 871 Gm03:4043007 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 316 872 Gm03:4043140 A 114:0, 0:18 1.000, 0.000 132
1.50E-30 317 873 Gm03:4043823 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 318 874 Gm03:4043978 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 319 875 Gm03:4044534 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 320 876 Gm03:4044555 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 321 877 Gm03:4044972 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 322 878 Gm03:4045630 A 114:0, 0:16 1.000, 0.000 130
4.10E-30 323 879 Gm03:4046313 C 114:0, 0:18 1.000, 0.000 132
1.50E-30 324 880 Gm03:4049555 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 325 881 Gm03:4049791 T 114:0, 0:18 1.000, 0.000 132
1.50E-30 326 882 Gm03:4049877 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 327 883 Gm03:4050197 A 112:0, 0:16 1.000, 0.000 128
1.12E-29 328 884 Gm03:4053685 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 329 885 Gm03:4053838 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 330 886 Gm03:4054927 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 331 887 Gm03:4055100 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 332 888 Gm03:4055384 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 333 889 Gm03:4055427 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 334 890 Gm03:4055483 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 1359 1360 Gm03:4062751 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 335 891 Gm03:4062885 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 1361 1362 Gm03:4064351 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 336 892 Gm03:4064592 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 337 893 Gm03:4064759 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 338 894 Gm03:4064811 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 339 895 Gm03:4064957 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 340 896 Gm03:4065083 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 341 897 Gm03:4066234 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 342 898 Gm03:4066331 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 343 899 Gm03:4067099 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 344 900 Gm03:4067514 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 345 901 Gm03:4069037 T 114:0, 0:6 1.000, 0.000 120
6.33E-28 346 902 Gm03:4069603 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 347 903 Gm03:4070422 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 348 904 Gm03:4072567 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 349 905 Gm03:4074190 T 112:0, 0:10 1.000, 0.000 122
2.31E-28 350 906 Gm03:4075232 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 351 907 Gm03:4076404 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 352 908 Gm03:4078299 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 353 909 Gm03:4078902 C 114:0, 0:12 1.000, 0.000 126
3.07E-29 354 910 Gm03:4080136 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 355 911 Gm03:4081056 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 356 912 Gm03:4081889 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 357 913 Gm03:4082200 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 358 914 Gm03:4082590 C 114:0, 0:12 1.000, 0.000 126
3.07E-29 359 915 Gm03:4082701 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 360 916 Gm03:4082781 G 114:0, 0:12 1.000, 0.000 126
3.07E-29 361 917 Gm03:4082871 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 362 918 Gm03:4083114 T 114:0, 0:12 1.000, 0.000 126
3.07E-29 363 919 Gm03:4084001 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 364 920 Gm03:4084095 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 365 921 Gm03:4085042 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 366 922 Gm03:4085524 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 367 923 Gm03:4086286 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 368 924 Gm03:4086887 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 369 925 Gm03:4087383 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 370 926 Gm03:4088310 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 371 927 Gm03:4090188 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 372 928 Gm03:4092799 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 373 929 Gm03:4092928 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 374 930 Gm03:4093195 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 375 931 Gm03:4093240 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 376 932 Gm03:4097291 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 377 933 Gm03:4097563 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 378 934 Gm03:4097729 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 379 935 Gm03:4098328 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 380 936 Gm03:4100831 A 114:0, 0:6 1.000, 0.000 120
6.33E-28 1363 1364 Gm03:4101257 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 381 937 Gm03:4103342 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 382 938 Gm03:4103449 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 383 939 Gm03:4103450 G 114:0, 0:8 1.000, 0.000 122
2.31E-28 384 940 Gm03:4103515 T 114:0, 0:8 1.000, 0.000 122
2.31E-28 385 941 Gm03:4103547 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 386 942 Gm03:4103633 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 387 943 Gm03:4104502 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 388 944 Gm03:4106406 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 389 945 Gm03:4109228 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 390 946 Gm03:4110012 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 391 947 Gm03:4110449 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 392 948 Gm03:4110821 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 393 949 Gm03:4111538 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 394 950 Gm03:4113757 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 395 951 Gm03:4116726 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 396 952 Gm03:4117330 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 397 953 Gm03:4117375 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 398 954 Gm03:4117779 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 399 955 Gm03:4117890 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 400 956 Gm03:4117986 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 401 957 Gm03:4120433 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 402 958 Gm03:4120705 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 403 959 Gm03:4122180 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 404 960 Gm03:4129251 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 405 961 Gm03:4129479 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 406 962 Gm03:4129635 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 407 963 Gm03:4130393 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 408 964 Gm03:4131257 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 409 965 Gm03:4132032 C 114:0, 0:8 1.000, 0.000 122
2.31E-28 410 966 Gm03:4132192 A 114:0, 0:12 1.000, 0.000 126
3.07E-29 411 967 Gm03:4133520 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 412 968 Gm03:4134606 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 413 969 Gm03:4134679 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 414 970 Gm03:4136487 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 415 971 Gm03:4136724 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 416 972 Gm03:4136742 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 417 973 Gm03:4136791 A 114:0, 0:10 1.000, 0.000 124
8.42E-29 418 974 Gm03:4136972 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 419 975 Gm03:4137137 T 114:0, 0:10 1.000, 0.000 124
8.42E-29 420 976 Gm03:4137521 C 114:0, 0:10 1.000, 0.000 124
8.42E-29 421 977 Gm03:4137540 G 114:0, 0:10 1.000, 0.000 124
8.42E-29 422 978
Gm03:4137645 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 423 979
Gm03:4138435 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 424 980
Gm03:4138980 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 425 981
Gm03:4139156 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 426 982
Gm03:4139395 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 1365 1366
Gm03:4140035 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 427 983
Gm03:4140071 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 428 984
Gm03:4140976 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 429 985
Gm03:4141074 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 430 986
Gm03:4141090 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 431 987
Gm03:4141251 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 432 988
Gm03:4141363 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 433 989
Gm03:4141488 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 434 990
Gm03:4142353 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 435 991
Gm03:4142380 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 436 992
Gm03:4142693 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 437 993
Gm03:4142800 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 438 994
Gm03:4142810 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 439 995
Gm03:4143060 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 440 996
Gm03:4143112 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 441 997
Gm03:4143113 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 442 998
Gm03:4144137 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 443 999
Gm03:4144350 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 444 1000
Gm03:4144639 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 445 1001
Gm03:4145737 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 446 1002
Gm03:4145959 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 447 1003
Gm03:4145974 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 448 1004
Gm03:4146284 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 449 1005
Gm03:4147289 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 450 1006
Gm03:4147425 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 451 1007
Gm03:4148248 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 452 1008
Gm03:4148643 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 453 1009
Gm03:4148732 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 454 1010
Gm03:4149880 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 1367 1368
Gm03:4149919 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 455 1011
Gm03:4150189 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 456 1012
Gm03:4150330 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 457 1013
Gm03:4151366 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 458 1014
Gm03:4152106 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 459 1015
Gm03:4153221 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 460 1016
Gm03:4153413 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 461 1017
Gm03:4153505 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 462 1018
Gm03:4153885 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 463 1019
Gm03:4154059 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 464 1020
Gm03:4156891 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 465 1021
Gm03:4158622 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 466 1022
Gm03:4159661 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 467 1023
Gm03:4160698 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 468 1024
Gm03:4162268 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 469 1025
Gm03:4163423 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 470 1026
Gm03:4164061 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 471 1027
Gm03:4164065 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 472 1028
Gm03:4164142 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 473 1029
Gm03:4164401 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 474 1030
Gm03:4164507 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 475 1031
Gm03:4164719 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 476 1032
Gm03:4164807 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 477 1033
Gm03:4166307 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 478 1034
Gm03:4166432 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 479 1035
Gm03:4167439 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 480 1036
Gm03:4167591 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 481 1037
Gm03:4167701 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 482 1038
Gm03:4168907 T 112:0, 0:12 1.000, 0.000 124 8.42E-29 483 1039
Gm03:4169729 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 484 1040
Gm03:4169784 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 485 1041
Gm03:4169863 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 1369 1370
Gm03:4169950 T 114:0, 0:4 1.000, 0.000 118 1.73E-27 486 1042
Gm03:4169995 G 112:0, 0:6 1.000, 0.000 118 1.73E-27 487 1043
Gm03:4171393 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 488 1044
Gm03:4171766 A 112:0, 0:10 1.000, 0.000 122 2.31E-28 1371 1372
Gm03:4172171 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 489 1045
Gm03:4173195 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 490 1046
Gm03:4173316 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 491 1047
Gm03:4173405 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 492 1048
Gm03:4173524 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 493 1049
Gm03:4175127 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 494 1050
Gm03:4177056 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 495 1051
Gm03:4177689 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 496 1052
Gm03:4177690 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 497 1053
Gm03:4178958 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 498 1054
Gm03:4179972 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 499 1055
Gm03:4180458 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 500 1056
Gm03:4182337 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 501 1057
Gm03:4184380 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 502 1058
Gm03:4184951 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 503 1059
Gm03:4184971 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 504 1060
Gm03:4185234 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 505 1061
Gm03:4185400 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 506 1062
Gm03:4185863 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 507 1063
Gm03:4187256 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 508 1064
Gm03:4188732 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 509 1065
Gm03:4189845 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 510 1066
Gm03:4189964 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 511 1067
Gm03:4190679 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 512 1068
Gm03:4191313 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 513 1069
Gm03:4191519 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 514 1070
Gm03:4192359 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 515 1071
Gm03:4192478 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 516 1072
Gm03:4192513 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 517 1073
Gm03:4192621 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 518 1074
Gm03:4192738 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 519 1075
Gm03:4193009 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 520 1076
Gm03:4193030 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 1373 1374
Gm03:4193039 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 521 1077
Gm03:4193483 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 522 1078
Gm03:4196188 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 523 1079
Gm03:4196542 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 524 1080
Gm03:4197697 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 1375 1376
Gm03:4197774 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 525 1081
Gm03:4198285 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 526 1082
Gm03:4198508 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 527 1083
Gm03:4198711 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 528 1084
Gm03:4198914 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 529 1085
Gm03:4199748 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 530 1086
Gm03:4200094 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 531 1087
Gm03:4203253 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 532 1088
Gm03:4203462 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 533 1089
Gm03:4203594 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 534 1090
Gm03:4203626 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 535 1091
Gm03:4204747 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 536 1092
Gm03:4204867 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 537 1093
Gm03:4205828 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 538 1094
Gm03:4205953 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 539 1095
Gm03:4206870 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 540 1096
Gm03:4207703 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 541 1097
Gm03:4215115 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 542 1098
Gm03:4215690 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 543 1099
Gm03:4215950 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 544 1100
Gm03:4217736 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 545 1101
Gm03:4218032 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 546 1102
Gm03:4218527 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 547 1103
Gm03:4218716 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 548 1104
Gm03:4218990 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 549 1105
Gm03:4219539 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 550 1106
Gm03:4219667 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 551 1107
Gm03:4221288 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 552 1108
Gm03:4222312 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 553 1109
Gm03:4223122 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 554 1110
Gm03:4223821 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 555 1111
Gm03:4224501 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 556 1112
Gm03:4225137 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 557 1113
Gm03:4225960 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 558 1114
Gm03:4226471 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 559 1115
Gm03:4227488 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 560 1116
Gm03:4228931 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 561 1117
Gm03:4229006 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 562 1118
Gm03:4229247 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 563 1119
Gm03:4230412 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 564 1120
Gm03:4230665 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 565 1121
Gm03:4230768 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 566 1122
Gm03:4231904 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 567 1123
Gm03:4231979 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 568 1124
Gm03:4233068 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 569 1125
Gm03:4233431 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 570 1126
Gm03:4233493 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 571 1127
Gm03:4233550 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 572 1128
Gm03:4234109 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 573 1129
Gm03:4234194 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 574 1130
Gm03:4234277 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 575 1131
Gm03:4234310 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 576 1132
Gm03:4235089 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 577 1133
Gm03:4235183 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 578 1134
Gm03:4235519 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 579 1135
Gm03:4235634 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 580 1136
Gm03:4235844 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 581 1137
Gm03:4236123 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 582 1138
Gm03:4236298 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 583 1139
Gm03:4239026 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 584 1140
Gm03:4242434 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 585 1141
Gm03:4243529 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 586 1142
Gm03:4244201 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 587 1143
Gm03:4244338 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 588 1144
Gm03:4244497 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 589 1145
Gm03:4245348 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 590 1146
Gm03:4245390 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 591 1147
Gm03:4245678 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 592 1148
Gm03:4246770 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 593 1149
Gm03:4246837 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 594 1150
Gm03:4247592 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 595 1151
Gm03:4247726 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 596 1152
Gm03:4252413 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 597 1153
Gm03:4252569 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 598 1154
Gm03:4252894 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 599 1155
Gm03:4252928 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 600 1156
Gm03:4253518 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 601 1157
Gm03:4257596 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 1377 1378
Gm03:4257995 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 602 1158
Gm03:4258161 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 603 1159
Gm03:4258545 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 604 1160
Gm03:4260785 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 605 1161
Gm03:4260901 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 606 1162
Gm03:4261372 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 607 1163
Gm03:4261626 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 608 1164
Gm03:4262516 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 609 1165
Gm03:4262869 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 610 1166
Gm03:4263876 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 611 1167
Gm03:4264709 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 612 1168
Gm03:4265916 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 613 1169
Gm03:4266927 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 614 1170
Gm03:4267296 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 615 1171
Gm03:4268640 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 616 1172
Gm03:4268852 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 617 1173
Gm03:4295832 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 618 1174
Gm03:4302907 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 619 1175
Gm03:4302936 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 620 1176
Gm03:4306709 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 621 1177
Gm03:4307835 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 622 1178
Gm03:4307996 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 623 1179
Gm03:4308161 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 624 1180
Gm03:4308286 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 625 1181
Gm03:4308323 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 626 1182
Gm03:4308522 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 627 1183
Gm03:4313900 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 628 1184
Gm03:4314212 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 629 1185
Gm03:4314464 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 630 1186
Gm03:4315256 A 114:0, 0:6 1.000, 0.000 120 6.33E-28 631 1187
Gm03:4317574 G 114:0, 0:16 1.000, 0.000 130 4.10E-30 632 1188
Gm03:4318530 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 633 1189
Gm03:4319271 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 634 1190
Gm03:4320841 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 635 1191
Gm03:4321243 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 636 1192
Gm03:4321515 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 637 1193
Gm03:4328502 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 638 1194
Gm03:4329219 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 639 1195
Gm03:4329504 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 640 1196
Gm03:4330121 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 641 1197
Gm03:4330318 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 642 1198
Gm03:4331246 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 643 1199
Gm03:4331889 A 110:0, 0:12 1.000, 0.000 122 2.31E-28 644 1200
Gm03:4337173 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 645 1201
Gm03:4338377 G 112:0, 0:6 1.000, 0.000 118 1.73E-27 646 1202
Gm03:4338505 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 647 1203
Gm03:4338559 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 648 1204
Gm03:4339885 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 649 1205
Gm03:4341064 A 112:0, 0:14 1.000, 0.000 126 3.07E-29 650 1206
Gm03:4342692 T 110:0, 0:8 1.000, 0.000 118 1.73E-27 651 1207
Gm03:4342727 A 112:0, 0:12 1.000, 0.000 124 8.42E-29 652 1208
Gm03:4343201 A 112:0, 0:12 1.000, 0.000 124 8.42E-29 653 1209
Gm03:4343212 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 654 1210
Gm03:4348211 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 655 1211
Gm03:4350556 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 656 1212
Gm03:4350658 A 110:0, 0:10 1.000, 0.000 120 6.33E-28 657 1213
Gm03:4350767 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 658 1214
Gm03:4351326 T 110:0, 0:10 1.000, 0.000 120 6.33E-28 659 1215
Gm03:4351612 T 112:0, 0:12 1.000, 0.000 124 8.42E-29 660 1216
Gm03:4351617 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 661 1217
Gm03:4351674 A 114:0, 0:6 1.000, 0.000 120 6.33E-28 662 1218
Gm03:4352353 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 663 1219
Gm03:4353932 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 664 1220
Gm03:4354036 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 665 1221
Gm03:4355046 C 112:0, 0:8 1.000, 0.000 120 6.33E-28 666 1222
Gm03:4362911 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 667 1223
Gm03:4363385 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 668 1224
Gm03:4363855 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 669 1225
Gm03:4364133 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 670 1226
Gm03:4364176 G 114:0, 0:18 1.000, 0.000 132 1.50E-30 671 1227
Gm03:4364200 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 672 1228
Gm03:4364469 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 673 1229
Gm03:4385480 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 674 1230
Gm03:4385781 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 675 1231
Gm03:4386327 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 676 1232
Gm03:4386398 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 677 1233
Gm03:4386633 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 678 1234
Gm03:4386927 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 679 1235
Gm03:4387264 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 680 1236
Gm03:4388736 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 681 1237
Gm03:4388954 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 682 1238
Gm03:4388982 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 683 1239
Gm03:4389208 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 684 1240
Gm03:4389211 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 685 1241
Gm03:4389280 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 686 1242
Gm03:4389696 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 687 1243
Gm03:4390074 G 114:0, 0:4 1.000, 0.000 118 1.73E-27 1379 1380
Gm03:4390738 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 688 1244
Gm03:4390827 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 689 1245
Gm03:4390979 C 114:0, 0:4 1.000, 0.000 118 1.73E-27 690 1246
Gm03:4392217 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 1381 1382
Gm03:4392314 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 691 1247
Gm03:4392891 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 692 1248
Gm03:4392913 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 693 1249
Gm03:4394477 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 1383 1384
Gm03:4394831 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 694 1250
Gm03:4395386 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 695 1251
Gm03:4395962 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 696 1252
Gm03:4397872 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 697 1253
Gm03:4398299 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 698 1254
Gm03:4398919 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 699 1255
Gm03:4399399 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 700 1256
Gm03:4400461 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 701 1257
Gm03:4404444 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 702 1258
Gm03:4410393 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 703 1259
Gm03:4410565 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 704 1260
Gm03:4411187 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 705 1261
Gm03:4412149 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 706 1262
Gm03:4412417 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 707 1263
Gm03:4412774 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 708 1264
Gm03:4413415 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 709 1265
Gm03:4446891 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 710 1266
Gm03:4447988 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 711 1267
Gm03:4448825 C 114:0, 0:6 1.000, 0.000 120 6.33E-28 712 1268
Gm03:4449634 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 713 1269
Gm03:4449956 T 112:0, 0:18 1.000, 0.000 130 4.10E-30 714 1270
Gm03:4450328 C 114:0, 0:6 1.000, 0.000 120 6.33E-28 715 1271
Gm03:4450331 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 716 1272
Gm03:4450888 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 717 1273
Gm03:4451295 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 1385 1386
Gm03:4451491 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 718 1274
Gm03:4451503 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 719 1275
Gm03:4451847 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 1387 1388
Gm03:4452060 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 720 1276
Gm03:4452118 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 721 1277
Gm03:4452820 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 1389 1390
Gm03:4456305 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 722 1278
Gm03:4458273 G 114:0, 0:18 1.000, 0.000 132 1.50E-30 723 1279
Gm03:4458399 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 724 1280
Gm03:4461465 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 725 1281
Gm03:4462225 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 726 1282
Gm03:4471412 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 1391 1392
Gm03:4474352 A 112:0, 0:8 1.000, 0.000 120 6.33E-28 1393 1394
Gm03:4477946 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 727 1283
Gm03:4477947 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 728 1284
Gm03:4478247 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 729 1285
Gm03:4478479 G 112:0, 0:8 1.000, 0.000 120 6.33E-28 730 1286
Gm03:4478554 A 112:0, 0:10 1.000, 0.000 122 2.31E-28 731 1287
Gm03:4478921 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 732 1288
Gm03:4479127 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 733 1289
Gm03:4506056 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 734 1290
Gm03:4506139 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 735 1291
Gm03:4506147 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 736 1292
Gm03:4507198 A 112:0, 0:8 1.000, 0.000 120 6.33E-28 737 1293
Gm03:4525141 A 112:0, 0:16 1.000, 0.000 128 1.12E-29 738 1294
Gm03:4525736 C 112:0, 0:14 1.000, 0.000 126 3.07E-29 739 1295
Gm03:4526278 C 110:0, 0:14 1.000, 0.000 124 8.42E-29 740 1296
Gm03:4526393 C 112:0, 0:16 1.000, 0.000 128 1.12E-29 741 1297
Gm03:4526446 G 112:0, 0:16 1.000, 0.000 128 1.12E-29 742 1298
Gm03:4527054 A 112:0, 0:16 1.000, 0.000 128 1.12E-29 743 1299
Gm03:4533559 A 112:0, 0:14 1.000, 0.000 126 3.07E-29 744 1300
Gm03:4539866 A 112:0, 0:12 1.000, 0.000 124 8.42E-29 745 1301
Gm03:4541294 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 746 1302
Example 2
Marker Loci Associated with Phytophthora Tolerance--Rps2 Locus
[0229] Markers were developed to characterize, identify, and/or
select resistant or susceptible alleles at the Rps2 locus on
linkage group J (ch 16). Markers were screened against various
known resistant and susceptible parents.
[0230] Markers to loci S06862, S06863, S06864, S06865, S11652-1 and
S11682-1 were developed and validated for their ability to identify
the allele(s) associated with resistance at Rps2, for example
alleles derived from resistant line L76-1988. Marker S06862
appeared to be within a region which is deleted in some lines, and
did not amplify in several geneotypes. Therefore, genomic regions
outside of the apparent deletion were targeted for marker
development by sequencing 1588 regions in 25 soybean lines to
develop a SNP profile. Markers to S11652 and S11682 were made based
on the SNP profile and were screened and verified in known
resistant and susceptible varieties. Further development and
testing was done to optimize markers to these for high throughput
analysis of soybean.
[0231] An F2 mapping population derived from a cross of L76-1988 X
susceptible consisting 256 individuals was used to fine map QTL for
Rps2 on LG-J. A total of 9 polymorphic markers were utilized to
construct the linkage group and perform QTL analysis. Three Rps2
phenotypic data sets were used: Score 1, Score 2, and an average
score. Phenotypic distributions of all 3 datasets were consistent.
A major QTL was detected on all the three data sets. The QTL was
closely linked with marker S11652-1-Q1 and flanked by markers to
form an interval which explained .about.69% of phenotypic variation
(averaged score).
Initial Map Manager Parameters were set to:
[0232] 1) Linkage Evaluation: Intercross
[0233] 2) Search Criteria: P=1e.sup.-5
[0234] 3) Map Function: Kosambi
[0235] 4) Cross Type: Line Cross
The permutation test simulation was done for each score established
significance boundaries in order to identify QTLs as follows:
TABLE-US-00015 Rps2 Score1 Rps2 Score2 Rps2_Avg Suggestive 0.7 0.7
0.7 Significant 5.3 5.4 5.8 Highly significant 13.6 11.1 13.7
[0236] Markers 511652-1-Q1, 50683-1-Q1, and 511682-1-Q1 on LG J
were identified as highly significant using Map ManagerQTX (Manly
et al. (2001) Mammalian Genome 12:930-932) marker regression
analysis of each of the 3 phenotypic datasets. Each had a p value
of 0.00000, a % values from 56-68%, and stat values from
152.2-242.7 across the 3 regressions.
Example 3
Marker Loci Associated with Phytophthora Tolerance in Rps3 Loci
[0237] Markers were developed to characterize, identify, and/or
select resistant or susceptible alleles at the Rps3 locus on
linkage group F (ch 13). Markers were screened against various
known resistant and susceptible varieties.
[0238] A marker to loci S07361-1, S08342-1, S09081-1 was developed
to identify alleles associated with the phytophthora phenotype.
Markers to S08342-1, S09081-1 detect res/sus polymorphisms for
Rps3a, and markers to S07361-1 detect res/sus polymorphisms for
Rps3c. During development, each marker was validated and confirmed
against a panel of about 30 resistant and susceptible varieties
which included proprietary experimental lines, proprietary
commercial lines, and public lines. Further development and testing
was done to optimize each marker system for high throughput
analysis of soybean.
[0239] An F2:3 population 95Y40xExpSUS, segregating for
phytophthora root rot response, was used for Rps3c marker
refinement. Parental line 95Y40 carries both the Rps3c and Rps1k
phytophthora resistance alleles, ExpSUS is a proprietary
experimental line susceptible to Phytophthora. No significant QTLs
were detected in this study. One suggestive QTL was found on each
chromosome F_(13) and chromosome N_(3), however there was no
significant association between the resistant phenotype and the
Rps3c (S07163-1-Q3) and Rps1k (S00009-01-A) MAS markers located on
the chromosomes, respectively.
[0240] The F2:3 population consisted of 90 progeny. Genomic DNA was
extracted using a standard CTAB method and used for genotyping.
Eight polymorphic markers were selected from LG-F, as well as 6
polymorphic markers selected from LG-N flanking and including the
MAS markers S07163-1-Q1 and S00009-01-A and used to genotype the
population. Phenotypic scores categorized the progeny as Resistant,
Susceptible, and Heterozygous. The classes were assigned numbers 9,
1, and 5, respectively for QTL analysis. Map Manager QTX.b20 was
used to construct the linkage map with the following
parameters:
[0241] 1) Linkage Evaluation: Intercross
[0242] 2) Search Criteria: P=1e.sup.-5
[0243] 3) Map Function: Kosambi
[0244] 4) Cross Type: Line Cross
[0245] Marker regression (p=0.001) and interval mapping were
executed using Map Manager QTX.b20 and the results were confirmed
using single marker analysis and composite interval mapping in QTL
Cartographer 2.5. A permutation test was run in Map Manager 1000
times (free model), and in QTL Cartographer 500 times (p=0.5) to
establish the threshold for statistical significance. Preliminary
analysis indicated all 14 markers showed severe segregation
distortion (chi square test statistic p=0.001) using the expected
F2 segregation ratios. Instead, the observed genotypic ratios fit
an F3 model well. In addition, three progeny matched parental calls
across all 14 markers and were removed from subsequent analysis.
The allele calls were converted to the A (maternal), B (paternal),
H (heterozygous) convention for mapping analysis.
[0246] The phenotypic distribution of the 87 progeny employed in
this analysis was evaluated using both percent dead scores, and the
distribution after grouping into classes. In each case, the
distributions were essentially normal. The resistant parent's
average phenotypic score was 66% dead, placing the value near the
mid-point of the population phenotypic distribution rather than the
tail.
[0247] In the mapping analysis markers formed two linkage groups on
LG F and LG N, with one marker remaining unlinked. Marker
regression (Map Manager) and single marker analysis (QTL
Cartographer) were performed, each indicating two suggestive
regions of interest, a region on LG F comprising S07163-1-Q3, and a
region on LG N comprising S00009-01-A. Neither reached the LRS
cutoff for significance in this study.
Example 4
Marker Loci Associated with Phytophthora Tolerance in the Rps6
Locus
[0248] Markers were developed to characterize, identify, and/or
select resistant or susceptible alleles at the Rps6 locus on
linkage group G (ch 18). Markers were screened against various
known resistant and susceptible parents.
[0249] A marker to locus S08442 was developed to identify alleles
associated with the phytophthora phenotype. Sequencing was done to
develop a SNP profile for marker development. During development,
this marker was validated against Phytophthora resistant line
Archer, and a susceptible line. The marker was further validated
and confirmed against a panel of about 30 varieties which included
proprietary experimental lines, proprietary commercial lines, and
public lines. This marker was additionally used to fingerprint
approximately 2000 soybean lines.
[0250] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0251] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20170022575A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20170022575A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References