U.S. patent application number 14/865652 was filed with the patent office on 2017-01-26 for method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf).
This patent application is currently assigned to EXCALIARD PHARMACEUTICALS, INC.. The applicant listed for this patent is Excaliard Pharmaceuticals, Inc.. Invention is credited to Nicholas M. Dean, J. Gordon Foulkes, Gregory Hardee, Mark Jewell, Lincoln Krochmal, Niall O'Donnell, Leroy Young.
Application Number | 20170022501 14/865652 |
Document ID | / |
Family ID | 46603079 |
Filed Date | 2017-01-26 |
United States Patent
Application |
20170022501 |
Kind Code |
A1 |
Dean; Nicholas M. ; et
al. |
January 26, 2017 |
METHOD OF TREATING KELOIDS OR HYPERTROPHIC SCARS USING ANTISENSE
COMPOUNDS TARGETING CONNECTIVE TISSUE GROWTH FACTOR (CTGF)
Abstract
This invention provides methods of preventing formation of, or
treating, fibrotic lesions, including skin scars such as keloids
and hypertrophic scars which comprise administering to the subject
by one or more injection a compound which comprises a modified
oligonucleotide, such as a modified antisense oligonucleotide,
siRNA, or oligodeoxyribonucleotide, which inhibits expression of
protein involved in fibrosis. Dosing of the antisense using an
intradermal threading technique is also described.
Inventors: |
Dean; Nicholas M.;
(Encinitas, CA) ; Krochmal; Lincoln; (Los Gatos,
CA) ; Hardee; Gregory; (Del Mar, CA) ;
Foulkes; J. Gordon; (Encinitas, CA) ; O'Donnell;
Niall; (St. Louis, MO) ; Young; Leroy;
(Wildwood, MO) ; Jewell; Mark; (Eugene,
OR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Excaliard Pharmaceuticals, Inc. |
New York |
NY |
US |
|
|
Assignee: |
EXCALIARD PHARMACEUTICALS,
INC.
New York
NY
|
Family ID: |
46603079 |
Appl. No.: |
14/865652 |
Filed: |
September 25, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13364547 |
Feb 2, 2012 |
9173894 |
|
|
14865652 |
|
|
|
|
61527821 |
Aug 26, 2011 |
|
|
|
61488666 |
May 20, 2011 |
|
|
|
61438879 |
Feb 2, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 45/06 20130101;
A61P 17/00 20180101; C12N 2310/3341 20130101; C12N 2320/30
20130101; C12N 2310/14 20130101; C12N 15/1136 20130101; C12N
2310/341 20130101; A61K 31/712 20130101; A61P 17/02 20180101; C12N
2310/11 20130101; C12N 2310/322 20130101; A61K 31/7088 20130101;
A61P 43/00 20180101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A method for treating a keloid, or preventing the formation,
reformation, or growth of a keloid after an injury to the skin, in
a subject in need thereof, which comprises administering to the
subject by one or more injections at the site of the keloid or of
the injury to the skin, a composition which comprises a modified
oligonucleotide consisting of 12-30 linked nucleosides, at least a
12 nucleobase sequence portion of which is present within a
sequence selected from the group consisting of SEQ ID NOs:38, 39,
40 and 166, or a salt or ester thereof, in an amount effective to
treat, or to prevent the formation, reformation, or growth of, the
keloid, wherein the effective amount is from 0.1 to 50 mg of the
modified oligonucleotide per injection per linear centimeter of the
keloid or of the injury to the skin.
2. A method for treating a hypertrophic scar, or preventing the
formation, reformation, or growth of a hypertrophic scar after an
injury to the skin, in a subject in need thereof, which comprises
administering to the subject by one or more injections at the site
of the hypertrophic scar or of the injury to the skin, a
composition which comprises a modified oligonucleotide consisting
of 12-30 linked nucleosides, at least a 12 nucleobase sequence
portion of which is present within a sequence selected from the
group consisting of SEQ ID NOs:38, 39, 40 and 166, or a salt or
ester thereof, in an amount effective to treat, or to prevent the
formation, reformation, or growth of, the hypertrophic scar,
wherein the effective amount is from 0.1 to 25 mg of the modified
oligonucleotide per injection per linear centimeter of the
hypertrophic scar or of the injury to the skin.
3. A method for reducing formation, reformation, or growth of a
scar or keloid at a site of an injury to the skin, or of treating a
pre-existing scar or keloid, in a subject in need thereof, which
comprises administering to the subject by one or more threading
injections at the site of the injury or of the pre-existing scar or
keloid, the composition of claim 1, or a salt or ester thereof,
targeted to a nucleic acid encoding a connective tissue growth
factor (CTGF) protein involved in fibrosis in an amount effective
to inhibit expression of the protein and thereby reduce scar or
keloid formation, reformation, or growth at the site of the injury
or to treat the pre-existing scar or keloid.
4. The method of claim 3, wherein the one or more threading
injections comprise multiple intradermal threading injections per
scar.
5. A method for reducing formation, reformation, or growth of a
fibrotic lesion at a site of an injury, or of treating a
pre-existing fibrotic lesion, in a subject in need thereof, which
comprises administering to the subject by one or more threading
injections at the site of the injury or of the pre-existing
fibrotic lesion, the composition of claim 1, or a salt or ester
thereof, targeted to a nucleic acid encoding a connective tissue
growth factor (CTGF) protein involved in fibrosis in an amount
effective to inhibit expression of the protein and thereby reduce
formation, reformation, or growth of the fibrotic lesion at the
site of the injury or to treat the pre-existing fibrotic
lesion.
6-13. (canceled)
14. The method of claim 3, wherein the effective amount is from 0.1
to 25 mg of the modified oligonucleotide per injection per linear
centimeter of the site of the injury to the skin or of the
pre-existing scar.
15. The method of claim 3, wherein the modified oligonucleotide is
administered at least once every two weeks for at least four weeks,
at least once every three weeks for at least six weeks, at least
once every four weeks for at least eight weeks, at least once every
eight weeks for at least sixteen weeks, over a period of at least
nine weeks, or over a period of 26 weeks.
16-20. (canceled)
21. The method of claim 6, wherein the modified oligonucleotide
consists of 12-30 linked nucleosides, at least a 10 nucleobase
sequence portion of which is present within a nucleic acid sequence
selected from the group consisting of SEQ ID NOs: 38, 39, 40 and
166.
22-24. (canceled)
25. The method of claim 21, wherein the modified oligonucleotide
consists of 12-30 linked nucleosides, at least a 10 nucleobase
sequence portion of which is present within a nucleic acid sequence
selected from the group consisting of SEQ ID NOs: 38, 39, and
40.
26. (canceled)
27. The method of claim 25, wherein the modified oligonucleotide
exhibits at least 67% inhibition of human CTGF mRNA expression.
28. (canceled)
29. The method of claim 22, wherein the modified oligonucleotide
has a sequence which is 100% identical over its length to a portion
of any one of the sequences set forth in SEQ ID NOs: 38, 39, 40, or
166.
30. The method of claim 29, wherein the modified oligonucleotide
comprises at least one modified internucleoside linkage.
31-32. (canceled)
33. The method of claim 29, wherein at least one nucleoside
comprises a modified sugar and wherein at least one nucleoside
comprises a modified nucleobase.
34-42. (canceled)
43. The method of claim 33, wherein the modified oligonucleotide
comprises: (a) a gap segment consisting of thirteen linked
deoxynucleosides; (b) a 5' wing segment consisting of two linked
modified nucleosides; and (c) a 3' wing segment consisting of five
linked modified nucleosides; wherein the gap segment is positioned
between the 5' wing segment and the 3' wing segment, wherein each
modified nucleoside within each wing segment comprises a
2'-O-methoxyethyl sugar; and wherein each internucleoside linkage
is a phosphorothioate linkage.
44. (canceled)
45. The method of claim 22, wherein the sequence of the nucleobase
is the sequence set forth in SEQ ID NO: 40.
46-54. (canceled)
55. The method of claim 3, wherein the modified oligonucleotide is
present in a conjugate with a moiety which enhances uptake of the
compound into, and/or increases residence time of the compound in,
the subject, wherein the residence time is 7 to 60 days or in a
delivery system which enhances uptake of the compound into, and/or
increases residence time of the compound in, the subject, wherein
the residence time is 7 to 60 days.
56-60. (canceled)
61. The method of claim 3, wherein the effective amount is about 5
mg of the modified oligonucleotide per injection per linear
centimeter of the keloid, the injury to the skin, the site of the
injury, or the pre-existing scar.
62-66. (canceled)
67. The method of claim 3, wherein the modified oligonucleotide is
administered adjacent to the keloid, the injury to the skin, the
site of the injury, or the pre-existing scar; along the entire
length of the keloid, the injury to the skin, the site of the
injury, or the pre-existing scar; along each side of the keloid,
the injury to the skin, the site of the injury, or the pre-existing
scar; or directly into the keloid, the injury to the skin, the site
of the injury, or the pre-existing scar.
68. (canceled)
69. The method of claim 67, wherein the modified oligonucleotide is
administered along each side of the keloid, the hypertrophic scar,
the injury to the skin, the site of the injury, the pre-existing
scar, or the pre-existing fibrotic lesion.
70-71. (canceled)
72. The method of claim 3, wherein the modified oligonucleotide is
administered intradermally by threading technique.
73-76. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 13/364,547, filed Feb. 2, 2012, now
U.S. Pat. No. 9,173,894, which claims priority to U.S. Provisional
Patent Application No. 61/438,879, filed Feb. 2, 2011; U.S.
Provisional Patent Application No. 61/488,666, filed May 20, 2011;
and U.S. Provisional Patent Application No. 61/527,821 filed Aug.
26, 2011, all of which are incorporated by reference herein in
their entirety.
SEQUENCE LISTING
[0002] This application contains a Sequence Listing submitted as an
electronic text file named "P035467B_Sequence_Listing.txt", having
a size in bytes of 62,000 bytes, and created on Apr. 8, 2016. The
information contained in this electronic file is hereby
incorporated by reference in its entirety.
INCORPORATION BY REFERENCE
[0003] Throughout this application, various patents and
publications are referenced. The disclosures of these patents and
publications in their entireties are hereby incorporated by
reference into this application in order to more fully describe the
state of the art to which this invention relates.
FIELD OF INVENTION
[0004] This invention concerns methods of preventing formation of,
or treating, fibrotic lesions, including skin scars such as keloids
and hypertrophic scars.
BACKGROUND OF THE INVENTION
[0005] Antisense compounds are an effective means for reducing the
expression of specific gene products and may be uniquely useful in
a number of therapeutic applications, for example, for the
modulation of expression of proteins involved in fibrosis such as
connective tissue growth factor (CTGF). (See U.S. Pat. No.
6,965,025B2 to Gaarde et al.)
[0006] Antisense compounds are oligomeric compounds that are
capable of hybridizing to a target nucleic acid (e.g. a target mRNA
molecule) and inhibiting expression of the target nucleic acid.
[0007] Antisense compounds, compositions and methods for modulating
expression of CTGF and for treating diseases associated with
expression of CTGF are disclosed in U.S. Pat. No. 6,965,025B2.
However, there remains a need for additional such compounds capable
of providing enhanced inhibition of CTGF expression as well as
other advantageous properties.
[0008] Connective tissue growth factor (CTGF; also known as
ctgrofact, fibroblast inducible secreted protein, fisp-12, NOV2,
insulin-like growth factor-binding protein-related protein 2,
IGFBP-rP2, IGFBP-8, HBGF-0.8, Hcs24, and ecogenin) is a member of
the CCN (CTGF/CYR61/NOV) family of modular proteins, named for the
first family members identified, connective tissue growth factor,
cysteine-rich (CYR61), and nephroblastoma overexpressed (NOV), but
the family also includes the proteins ELM-1 (expressed in
low-metastatic cells), WISP-3 (Wnt-1-induced secreted protein), and
COP-1 (WISP-2). CCN proteins have been found to be secreted,
extracellular matrix-associated proteins that regulate cellular
processes such as adhesion, migration, mitogenesis,
differentiation, survival, angiogenesis, atherosclerosis,
chondrogenesis, wound healing, tumorigenesis, and vascular and
fibrotic diseases like scleroderma (Lau and Lam, Exp. Cell Res.,
1999, 248, 44-57). The connective tissue growth factor protein was
shown to stimulate DNA synthesis and promote chemotaxis of
fibroblasts (Bradham et al., J. Cell Biol., 1991, 114,
1285-1294).
[0009] Connective tissue growth factor is expressed in fibroblasts
during normal differentiation processes that involve extracellular
matrix (ECM) production and remodeling. Connective tissue growth
factor is also frequently overexpressed in fibrotic skin disorders
such as systemic sclerosis, localized skin sclerosis, keloids, scar
tissue, eosinophilic fasciitis, nodular fasciitis, and Dupuytren's
contracture. Connective tissue growth factor mRNA or protein levels
are elevated in fibrotic lesions of major organs and tissues
including the liver, kidney, lung, cardiovascular system, pancreas,
bowel, eye, and gingiva. In mammary, pancreatic and
fibrohistiocytic tumors characterized by significant connective
tissue involvement, connective tissue growth factor is
overexpressed in the stromal compartment.
The Role of CTGF in Keloid Diseases
[0010] Keloid disease (KD) is a benign dermal fibro-proliferative
tumor characterized by an excessive accumulation of extracellular
matrix proteins, leading to an overabundance of collagen formation.
Abnormal skin scarring can occur, post-injury in genetically
susceptible individuals. KD can also be a familial condition,
occurring more commonly in ethnic groups with darker skin. The
highest incidence of keloids is found in the black population,
where it has been estimated to be around 4-6% and up to 16% in
random samples of black Africans. Various modes of inheritance have
been proposed for KD ranging from autosomal recessive to autosomal
dominant with incomplete clinical penetrance and variable
expression. The majority of keloids can lead to considerable
cosmetic defects, but can also grow large enough to become
symptomatic, by causing deformity or limiting joint mobility.
[0011] Although low levels of CTGF are expressed in normal skin,
CTGF becomes up-regulated following dermal injury, and it becomes
persistently over-expressed when scarring is severe, as in keloids
or systemic sclerosis. Fibroblasts cultured from both hypertrophic
scars, keloids, and scleroderma lesions express increased basal
CTGF (Exp. Cell Res. 2000, 259: 213-224), and cells cultured from
hypertrophic scars and keloids were shown to express more CTGF
basally and also elaborate more CTGF in response to stimulation
with TGF-.beta. (Plast. Reconstr. Surg. 2005, 116: 1387-90).
Similarly, transcription of CTGF after serum stimulation was
significantly higher in keloid versus normal fibroblasts in cell
culture (Ann. Surg. 2007, 246(5):886-95).
[0012] In keloid tissue, fibroblasts expressing CTGF mRNA were
found distributed throughout the lesions, especially in the
peripheral areas (J. Invest. Derm. 1996, 106:729-733). CTGF mRNA
expression levels have been compared in normal skin, keloid scars,
hypertrophic scars, and mature scars. CTGF mRNA was strongly
detected in all cases of the keloids, although not in mature scars.
There was a significant difference between levels found in keloids
and normal skin (J. Japan Soc. Plastic Reconstr. Surg. 2002,
22:560-565). Recent data also suggests that, relative to normal
fibroblasts, keloid scar fibroblasts synthesize 100-150-fold more
CTGF in response to exogenous TGF-.beta.1 than do normal
fibroblasts (Plast. Reconstr. Surg. 2005, 116:1387-1390). When
compared to normal skin, increased localization of CTGF was seen in
the basal layer of keloid epidermis and higher expression of CTGF
was observed in keloid tissue extract (J. Cell Physiol. 2006,
208(2):336-43). Previously no data has been generated to validate
the role of CTGF in keloid disease by showing that inhibition of
CTGF expression inhibits keloid growth.
[0013] Currently, no effective single therapeutic regimen has been
established for treatment of keloids or prevention of keloids
growth after surgery. Existing therapeutic approaches include
occlusive dressings, compression therapy, intra-lesional steroid
injections, cryosurgery, surgical excision, laser treatment,
radiation therapy, Kenalog (triamcinolone), interferon therapy,
bleomycin, 5-flouracil, verapamil, imiquimod cream, and
combinations thereof. Both silicone and non-silicone-based
occlusive dressings have been a widely used clinical option for
keloids for the last 30 years, but all of these methods result in
very limited efficacy and it is widely understood that a new
therapy for keloids is urgently needed.
[0014] Various forms of radiotherapy have been attempted as a
mono-therapy for keloids, but remain quite controversial because of
anecdotal reports of carcinogenesis after treatment. Laser therapy
using argon, CO.sub.2, and pulse dye have been repeatedly attempted
during the last 40 years, but none of them have proven to be
efficacious. All three forms of laser therapy, according to
multiple studies, have recurrence rates of upwards of 90%, showing
little to no benefit. Cryotherapy has been used as a mono-therapy.
However, side effects associated with this approach include pain at
the therapeutic site and hypo- or hyper-pigmentation.
Intra-lesional triamcinolone acetone injections, a type of
corticosteroid, is frequently used as first-line therapy for the
treatment of keloids, but again, actual reported clinical efficacy
varies widely. In addition, the need for multiple injections, along
with the side effects of injection pain, skin atrophy,
telangiectasias, and altered pigmentation have caused clinicians
and researchers to continue seeking other means of treatment.
[0015] Consequently, there remains a long felt need for additional
methods and agents to effectively prevent the formation of keloids,
hypertrophic scars, and other types of fibrotic lesions as well as
to treat keloids, hypertrophic scars and fibrotic lesion so as to
eliminate or reduce them and/or to prevent their reoccurrence. The
clinical results described herein clearly demonstrate for the first
time the ability of an antisense oligonucleotide targeting CTGF to
reduce the growth and severity of keloids post surgery.
Antisense Dosing into Skin
[0016] It has also been demonstrated for the first time that
antisense oligonucleotides do not diffuse laterally very far after
dosing into skin (see Example 2) which could lead to irregular
effects of this class of drug on a linear incision/healing scar or
keloid if dosing was conducted as a single bolus type of
administration, resulting in variable concentrations of antisense
along the length of the developing scar. To overcome this drawback,
a method for delivering antisense oligonucleotides by an
intradermal threading technique has been developed. This technique
effectively delivers a constant amount of antisense drug along the
full length of the scar, and results in effective and consistent
scar reduction along the full length of the scar or keloid.
Intradermal threading consists of introducing a needle into the
dermis at an angle as parallel to the skin as possible, and
threading the needle into and along the dermis for a distance of
typically between 1 and 5 cm. At this point, the needle is
withdrawn and drug injected into the dermis along the full length
of the needle tract as the needle is withdrawn, resulting in an
equal amount and volume of drug being deposited along the full
length of the needle tract.
SUMMARY OF THE INVENTION
[0017] This invention provides a method for treating a keloid, or
preventing the formation, reformation, or growth of a keloid after
an injury to the skin, in a subject in need thereof, which
comprises administering to the subject by one or more injections at
the site of the keloid or of the injury to the skin, a composition
which comprises a modified oligonucleotide consisting of 12-30
linked nucleosides, at least a 12 nucleobase sequence portion of
which is present within a region selected from nucleotides 553-611,
718-751, 1388-1423, 1457-1689, 2040-2069, 2120-2147, 2728-2797,
2267-2301, 1394-1423, 1469-1508, 1559-1605, 1659-1689, 2100-2129
and 1399-1423 of SEQ ID NO: 9, or a salt or ester thereof, in an
amount effective to treat, or to prevent the formation,
reformation, or growth of, the keloid, wherein the effective amount
is from 0.1 to 50 mg of the modified oligonucleotide per injection
per linear centimeter of the keloid or of the injury to the
skin.
[0018] This invention also provides a method for treating a
hypertrophic scar, or preventing the formation, reformation, or
growth of a hypertrophic scar after an injury to the skin, in a
subject in need thereof, which comprises administering to the
subject by one or more injections at the site of the hypertrophic
scar or of the injury to the skin, a composition which comprises a
modified oligonucleotide consisting of 12-30 linked nucleosides, at
least a 12 nucleobase sequence portion of which is present within a
region selected from nucleotides 553-611, 718-751, 1388-1423,
1457-1689, 2040-2069, 2120-2147, 2728-2797, 2267-2301, 1394-1423,
1469-1508, 1559-1605, 1659-1689, 2100-2129 and 1399-1423 of SEQ ID
NO: 9, or a salt or ester thereof, in an amount effective to treat,
or to prevent the formation, reformation, or growth of, the
hypertrophic scar, wherein the effective amount is from 0.1 to 25
mg of the modified oligonucleotide per injection per linear
centimeter of the hypertrophic scar or of the injury to the
skin.
[0019] The invention further provides a method for reducing
formation, reformation, or growth of a scar or keloid at a site of
an injury to the skin, or of treating a pre-existing scar or
keloid, in a subject in need thereof, which comprises administering
to the subject by one or more threading injections at the site of
the injury or of the pre-existing scar or keloid, a composition
which comprises a modified oligonucleotide, or a salt or ester
thereof, targeted to a nucleic acid encoding a protein involved in
fibrosis in an amount effective to inhibit expression of the
protein and thereby reduce scar or keloid formation, reformation,
or growth at the site of the injury or to treat the pre-existing
scar or keloid.
[0020] This invention still further provides a method for reducing
formation, reformation, or growth of a fibrotic lesion at a site of
an injury, or of treating a pre-existing fibrotic lesion, in a
subject in need thereof, which comprises administering to the
subject by one or more threading injections at the site of the
injury or of the pre-existing fibrotic lesion, a composition which
comprises a modified oligonucleotide, or a salt or ester thereof,
targeted to a nucleic acid encoding a protein involved in fibrosis
in an amount effective to inhibit expression of the protein and
thereby reduce formation, reformation, or growth of the fibrotic
lesion at the site of the injury or to treat the pre-existing
fibrotic lesion.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1A and FIG. 1B show that 2'MOE containing antisense
oligonucleotides diffuse over relatively short distances
(.about.0.5-1.0 cm) in rabbit skin when given by intradermal
injection (described in Example 2).
[0022] FIGS. 2A and 2B show that treatment of keloids in an animal
model, with a CTGF antisense oligonucleotide resulted in reduction
in both CTGF (FIG. 2A) and Col3a1 (FIG. 2B) mRNA expression in
intact human keloid tissue transplanted into mice (described in
Example 3).
[0023] FIGS. 3A and 3B show that treatment with a CTGF antisense
oligonucleotide, (EXC 001 or SEQ ID NO: 39) inhibits growth of both
hypertrophic scars and keloids at 24 weeks post scar revision
surgery in humans. The scores below each set of pictures represent
the degree of improvement between placebo- and EXC 001-treated
keloids. A negative score represents an improvement in scarring
resulting from EXC 001 treatment. FIG. 3A shows placebo- and EXC
001-treated hypertrophic scars 24 weeks post scar revision surgery.
FIG. 3B shows placebo- and EXC 001-treated keloid scars 24 weeks
post scar revision surgery (described in Example 4).
[0024] FIG. 4 shows that treatment with CTGF antisense
oligonucleotide, (EXC 001 or SEQ ID NO: 39) inhibits the formation
and growth of a hypertrophic scar 12 weeks post abdominoplasty
surgery. The scores below the pictures represent the degree of
improvement between placebo- and EXC 001-treated scar. A negative
score represents an improvement in scarring resulting from EXC 001
treatment (described in Example 5).
[0025] FIG. 5 shows the limited diffusion of EXC 001 when dosed
adjacent to a scar (described in Example 5). The section of the
abdominoplasty scar on the right side of the scar (to the right of
the vertical line) was treated with EXC 001 whereas the scar to the
left of the vertical line did not receive any treatment. Clearly
the scar severity to the right is less than to the left. This
example demonstrates that the EXC 001 therapeutic benefit is
limited to the region of scar directly adjacent to the site of drug
delivery by intradermal threading. Therefore the drug appears to
have limited diffusion away from the site of administration and
will require dosing immediately adjacent to and along the length of
the potential scar site, for example by intradermal threading.
[0026] FIG. 6 shows an example of the ability of EXC 001 to reduce
the growth and formation of hypertrophic scars (described in
Example 6). In this example, two matching 2 cm abdominal scars are
shown, one treated with 5 mg/cm EXC 001 and one with placebo. The
severity of the EXC 001 treated scar is less than the placebo
treated scar. Histological analysis of these two scars also
revealed an EXC 001 mediated reduction in the expression of CTGF
protein (by immunohistochemistry) clearly demonstrating that EXC
001 is functioning to reduce the expression of its intended target
(CTGF).
[0027] FIGS. 7A-7E show the effects of EXC 001 on mRNA expression
in abdominal scars of various genes at various timespost treatment
(described in Example 6). FIG. 7A shows the effect of EXC 001 in
suppressing CTGF mRNA expression. FIG. 7B shows the effect of EXC
001 in suppressing Collagen III-a1 (Col3A1) mRNA expression. FIG.
7C shows the effect of EXC 001 in suppressing elastin (ELASF) mRNA
expression. FIGS. 7D and 7E show there was no significant
inhibition of either SMAD3 or TGF-.beta.1 mRNA expression by EXC
001 as compared to placebo.
DETAILED DESCRIPTION OF THE INVENTION
[0028] This invention provides a method for treating a keloid, or
preventing the formation, reformation, or growth of a keloid after
an injury to the skin, in a subject in need thereof, which
comprises administering to the subject by one or more injections at
the site of the keloid or of the injury to the skin, a composition
which comprises a modified oligonucleotide consisting of 12-30
linked nucleosides, at least a 12 nucleobase sequence portion of
which is present within a region selected from nucleotides 553-611,
718-751, 1388-1423, 1457-1689, 2040-2069, 2120-2147, 2728-2797,
2267-2301, 1394-1423, 1469-1508, 1559-1605, 1659-1689, 2100-2129
and 1399-1423 of SEQ ID NO: 9, or a salt or ester thereof, in an
amount effective to treat, or to prevent the formation,
reformation, or growth of, the keloid, wherein the effective amount
is from 0.1 to 50 mg of the modified oligonucleotide per injection
per linear centimeter of the keloid or of the injury to the
skin.
[0029] This invention also provides a method for treating a
hypertrophic scar, or preventing the formation, reformation, or
growth of a hypertrophic scar after an injury to the skin, in a
subject in need thereof, which comprises administering to the
subject by one or more injections at the site of the hypertrophic
scar or of the injury to the skin, a composition which comprises a
modified oligonucleotide consisting of 12-30 linked nucleosides, at
least a 12 nucleobase sequence portion of which is present within a
region selected from nucleotides 553-611, 718-751, 1388-1423,
1457-1689, 2040-2069, 2120-2147, 2728-2797, 2267-2301, 1394-1423,
1469-1508, 1559-1605, 1659-1689, 2100-2129 and 1399-1423 of SEQ ID
NO: 9, or a salt or ester thereof, in an amount effective to treat,
or to prevent the formation, reformation, or growth of, the
hypertrophic scar, wherein the effective amount is from 0.1 to 25
mg of the modified oligonucleotide per injection per linear
centimeter of the hypertrophic scar or of the injury to the
skin.
[0030] This invention further provides a method for reducing
formation, reformation, or growth of a scar or keloid at a site of
an injury to the skin, or of treating a pre-existing scar or
keloid, in a subject in need thereof, which comprises administering
to the subject by one or more threading injections at the site of
the injury or of the pre-existing scar or keloid, a composition
which comprises a modified oligonucleotide, or a salt or ester
thereof, targeted to a nucleic acid encoding a protein involved in
fibrosis in an amount effective to inhibit expression of the
protein and thereby reduce scar or keloid formation, reformation,
or growth at the site of the injury or of treat the pre-existing
scar or keloid. This invention still further provides a method for
reducing formation, reformation, or growth of a fibrotic lesion at
a site of an injury, or of treating a pre-existing fibrotic lesion,
in a subject in need thereof, which comprises administering to the
subject by one or more threading injections at the site of the
injury or of the pre-existing fibrotic lesion, a composition which
comprises a modified oligonucleotide, or a salt or ester thereof,
targeted to a nucleic acid encoding a protein involved in fibrosis
in an amount effective to inhibit expression of the protein and
thereby reduce formation, reformation, or growth of the fibrotic
lesion at the site of the injury or to treat the pre-existing
fibrotic lesion.
[0031] In one embodiment of the preceding methods, the one or more
threading injections comprise multiple intradermal threading
injections per scar.
[0032] In the preceding methods, the protein involved in fibrosis
may be connective tissue growth factor, transforming growth factor
beta-1, mothers against decapentaplegic homolog-3, early growth
response-1, monocyte chemotactic protein-1, a collagen, or an
elastin. Examples of suitable collagens are Collagen 3A1, Collagen
1A2, and Collagen 1A1.
[0033] In certain embodiments of the methods of this invention, the
effective amount is from 0.1 to 50 mg, e.g. 0.1 to 25 mg, of the
modified oligonucleotide per injection per linear centimeter of the
site of the injury to the skin or of the pre-existing scar.
[0034] In certain embodiments, the modified oligonucleotide is
administered at least once every two weeks for at least four weeks,
i.e. at least twice.
[0035] In other embodiments, the modified oligonucleotide is
administered at least once every three weeks for at least six
weeks, i.e. at least twice.
[0036] In still other embodiments, the modified oligonucleotide is
administered at least once every four weeks for at least eight
weeks. In yet other embodiments, the modified oligonucleotide is
administered at least once every eight weeks for at least sixteen
weeks.
[0037] It is currently contemplated that it may be preferable that
the modified oligonucleotide is administered over a period of at
least nine weeks, for example over a period of 26 weeks.
[0038] In certain embodiments, the modified oligonucleotide
consists of 12-30 linked nucleosides, at least a 12 nucleobase
sequence portion of which is present within a region selected from
the group consisting of nucleotides 553-611, 718-751, 1388-1423,
1457-1689, 2040-2069, 2120-2147, 2728-2797, 2267-2301, 1394-1423,
1469-1508, 1559-1605, 1659-1689, 2100-2129, and 1399-1423 of SEQ ID
NO: 9.
[0039] In certain embodiments, at least a 12 nucleobase sequence
portion of the modified oligonucleotide is present within the
nucleobase sequence set forth in any of the sequences set forth in
SEQ ID NO: 28, 30, 39, 40, 43, 44, 45, 50, Si, 52, 56, 78, 125, or
166.
[0040] In certain embodiments, the modified oligonucleotide
consists of at least 14, e.g. 20, linked nucleosides.
[0041] In certain embodiments, the modified oligonucleotide is a
single-stranded oligonucleotide. In others, the modified
oligonucleotide is a double-stranded oligonucleotide.
[0042] In still other embodiments, the modified oligonucleotide
comprises at least one oligodeoxyribonucleotide or at least one
oligoribonucleotide.
[0043] In certain embodiments, the modified oligonucleotide has a
sequence which is 100% identical over its length to a portion of
any one of the sequences set forth in SEQ ID NO: 28, 30, 39, 40,
43, 44, 45, 50, 51, 52, 56, 78, 125, or 166.
[0044] In certain embodiments, the modified oligonucleotide
comprises at least one modified internucleoside linkage, e.g. a
phosphorothioate internucleoside linkage, such that some or all of
the internucleoside linkages may be phosphorothioate
internucleoside linkages.
[0045] In certain embodiments, at least one nucleoside in the
modified oligonucleotide comprises a modified sugar, such as a
bicyclic sugar. In some such embodiments, at least one of the
modified sugar comprises a 2'-O-methoxyethyl.
[0046] In other embodiments, the modified oligonucleotide comprises
at least one tetrahydropyran modified nucleoside wherein a
tetrahydropyran ring replaces the furanose ring.
[0047] In some such embodiments, each of the at least one
tetrahydropyran modified nucleoside has the structure:
##STR00001##
wherein Bx is an optionally protected heterocyclic base moiety.
[0048] In certain embodiments, at least one nucleoside comprises a
modified nucleobase, e.g. a modified deoxynucleoside, a
ribonucleoside, or a 5'-methylcytosine.
[0049] In certain embodiments, the modified oligonucleotide
comprises: [0050] (a) a gap segment consisting of linked
deoxynucleosides; [0051] (b) a 5' wing segment consisting of linked
modified nucleosides; and [0052] (c) a 3' wing segment consisting
of linked modified nucleosides; wherein the gap segment is
positioned between the 5' wing segment and the 3' wing segment and
wherein each modified nucleoside within each wing segment comprises
a modified sugar.
[0053] In certain currently preferred embodiments, the modified
oligonucleotide comprises: [0054] (a) a gap segment consisting of
thirteen linked deoxynucleosides; [0055] (b) a 5' wing segment
consisting of two linked modified nucleosides; and [0056] (c) a 3'
wing segment consisting of five linked modified nucleosides;
wherein the gap segment is positioned between the 5' wing segment
and the 3' wing segment, wherein each modified nucleoside within
each wing segment comprises a 2'-O-methoxyethyl sugar; and wherein
each internucleoside linkage is a phosphorothioate linkage.
[0057] In certain embodiments, the sequence of the nucleobase is
the sequences set forth in SEQ ID NO: 39.
[0058] In other embodiments, the sequence of the nucleobase is the
sequences set forth in SEQ ID NO: 40.
[0059] In still other embodiments, the sequence of the nucleobase
is the sequences set forth in SEQ ID NO: 45.
[0060] In yet other embodiments, the sequence of the nucleobase is
the sequences set forth in SEQ ID NO: 52.
[0061] In yet other embodiments, the sequence of the nucleobase is
the sequences set forth in SEQ ID NO: 166.
[0062] In certain embodiments, the composition comprises the
modified oligonucleotide or a salt thereof, and a pharmaceutically
acceptable carrier or diluent.
[0063] In certain embodiments, the modified oligonucleotide
directly or indirectly inhibits expression of collagen or elastin
or both, so as to treat the keloid, prevent the formation,
reformation, or growth of the keloid, treat the hypertrophic scar,
prevent the formation, reformation, or growth of the hypertrophic
scar, reduce scar formation at the site of the injury, treat the
pre-existing scar, reduce formation of the fibrotic lesion at the
site of the injury, or treat the pre-existing fibrotic lesion.
[0064] It is currently contemplated that the preceding methods
further comprise administering to the subject a second
compound.
[0065] In certain embodiments, the second compound may be an
antisense compound targeting the same or a different sequence, and
the modified oligonucleotide and the second compound may be
administered simultaneously or sequentially.
[0066] In certain embodiments, the modified oligonucleotide is
present in a conjugate with a moiety which enhances uptake of the
compound into, and/or increases residence time of the compound in,
the subject, wherein the residence time is preferably 7 to 60 days.
The conjugate moiety is polyethylene glycol, hyaluronic acid,
cholesterol, adamantine acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-.beta.-(hexadecyl)glycerol,
hexadecylglycerol, hexadecylamine, geranyloxyhexyl, palmitic acid,
myristic acid, spermine, spermidine, folic acid, vitamin E, a
carbohydrate cluster, a peptide (including antennapedia helix, HIV
Tat fragments, integrin binding peptide), transportin, or
porphyrin.
[0067] In certain embodiments, the modified oligonucleotide is
administered in a delivery system which enhances uptake of the
compound into, and/or increases residence time of the compound in,
the subject, wherein the residence time is preferably 7 to 60 days.
The delivery system comprises a cationic lipid, a liposome, a
microparticle, a nanoparticle, a liquid formulation with suspended
particles with or without drug in the solution for immediate
release or with drug depot in particles (particularly PLGA and
poly-Arg particles), a liquid formulation that gels after
injections such as thermosetting/responsive liquids (e.g. pluronic
gels), liquids that contain a polymer and drug in a biocompatible
solvent that precipitate when the solvent is diluted by body fluids
(e.g. atrigel), a gel, a semi-solid formulation such as hydrogel
(with a matrix backing or as a spray solution), a powder to be
sprinkled on during surgery, a resorbable suture, or a fast
dissolving gel or polymer strip.
[0068] In certain embodiments, the modified oligonucleotide is
administered to the subject following a surgical excision of the
keloid, scar, or fibrotic lesion.
[0069] In certain embodiments, the injury to the skin is the result
of a surgical incision, a biopsy, a skin piercing, a skin removal,
a burn, or a wound.
[0070] In certain embodiments, the effective amount is about 5 mg
of the modified oligonucleotide per injection per linear centimeter
of the keloid, the hypertrophic scar, the injury to the skin, the
site of the injury, the pre-existing scar, or the pre-existing
fibrotic lesion.
[0071] In certain embodiments, the modified oligonucleotide is
administered for up to 6 months. In other embodiments, the modified
oligonucleotide is administered for up to 1 year.
[0072] In certain embodiments, the preceding methods further
comprise administering to the subject another therapeutic agent
which may be a steroid, a silicone wrap, TGF-.beta.3 (i.e.
Juvista), collagenase (i.e. Xyflex), 17.beta.-estrodiol (i.e.
Zesteem), IL-10 (i.e. Prevascar), mannose 6-phosphate (i.e.
Juvidex), a smooth muscle relaxant (i.e. AZX100, a 24-amino acid
synthetic peptide), a stem cell therapy (i.e. GBT009), serum
amyloid protein, antibodies targeting integrin avr.beta.6, CTGF,
TGF.beta., or molecules that inhibit the activity of ALK-4 and/or
ALK-5 (the TGF beta receptors), any inhibitor designed to block TNF
activity (for example etanercept), occlusive dressings, compression
therapy, cryosurgery, surgical excision, laser treatment, radiation
therapy, interferon therapy, bleomycin, 5-fluorouracil, verapamil,
imiquimod cream, one capable of promoting wound healing, such as
Dermagraft, Apligraf, PDGF (i.e. Regranex), electrical stimulation,
"growth factors" as a category, dressings as a category, small
intestinal submucosa (SIS), Promogran, hyperbaric oxygen, or
combinations thereof.
[0073] In certain embodiments, the modified oligonucleotide is
administered by means of a formulation, ultrasound,
electroporation, iontophoresis or micro-needle.
[0074] In certain embodiments, the modified oligonucleotide is
administered adjacent to the keloid, the hypertrophic scar, the
injury to the skin, the site of the injury, the pre-existing scar,
or the pre-existing fibrotic lesion.
[0075] In other embodiments, the modified oligonucleotide is
administered along the entire length of the keloid, the
hypertrophic scar, the injury to the skin, the site of the injury,
the pre-existing scar, or the pre-existing fibrotic lesion.
[0076] In still other embodiments, the modified oligonucleotide is
administered along each side of the keloid, the hypertrophic scar,
the injury to the skin, the site of the injury, the pre-existing
scar, or the pre-existing fibrotic lesion.
[0077] In yet other embodiments, the modified oligonucleotide is
administered directly into the keloid, the hypertrophic scar, the
injury to the skin, the site of the injury, the pre-existing scar,
or the pre-existing fibrotic lesion.
[0078] In certain embodiments, the subject is genetically
predisposed to formation of keloids or hypertrophic scars or
both.
[0079] In certain embodiments, the modified oligonucleotide is
administered intradermally.
[0080] In other embodiments, the modified oligonucleotide is
administered intradermally by threading technique.
[0081] In still other embodiments, the modified oligonucleotide is
administered sub-cutaneously.
[0082] In yet other embodiments, the modified oligonucleotide is
administered topically.
[0083] This invention also provides a kit which comprises: [0084]
a. a device pre-filled with the composition comprising the modified
oligonucleotide; and [0085] b. instruction for uses.
[0086] In a certain embodiment the antisense oligonucleotide is
complementary to a portion of the region of CTGF targeted by active
oligonucleotides which stretches from target sites 1396 through
1424. This is the sequence space targeted by oligo 418899, 412295
and 412294/EXC 001(SEQ ID NOs: 166, 40 and 39, respectively).
[0087] This invention also provides a modified oligonucleotide
comprising at least 12, preferably at least 14, linked nucleosides,
the nucleobase sequence of which is a portion of one of the
nucleobase sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 43,
44, 45, 50, 51, 52, 56, 78, 125 and 166.
[0088] The antisense compounds described herein can comprise an
oligonucleotide having 12 to 30, 12 to 20, and preferably 14 to 20
linked nucleosides.
[0089] In one embodiment of the invention, the modified
oligonucleotide is a single-stranded or a double-stranded
oligonucleotide.
[0090] The present invention employs oligomeric compounds,
particularly antisense oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding proteins involved in
fibrosis, ultimately modulating the amount of protein produced.
This is accomplished by providing antisense compounds which
specifically hybridize with one or more nucleic acids encoding a
protein involved in fibrosis. As used herein, the terms "target
nucleic acid" and "nucleic acid encoding connective tissue growth
factor" encompass DNA encoding a protein involved in fibrosis, RNA
(including pre-mRNA and mRNA) transcribed from such DNA, and also
cDNA derived from such RNA.
[0091] The specific hybridization of an oligomeric compound with
its target nucleic acid interferes with the normal function of the
nucleic acid. This modulation of function of a target nucleic acid
by compounds which specifically hybridize to it is generally
referred to as "antisense". The functions of DNA to be interfered
with include replication and transcription. The functions of RNA to
be interfered with include all vital functions such as, for
example, translocation of the RNA to the site of protein
translation, translation of protein from the RNA, splicing of the
RNA to yield one or more mRNA species, and catalytic activity which
may be engaged in or facilitated by the RNA. The overall effect of
such interference with target nucleic acid function is modulation
of the expression of connective tissue growth factor. In the
context of the present invention, "modulation" means either an
increase (stimulation) or a decrease (inhibition) in the expression
of a gene. In the context of the present invention, inhibition is
the preferred form of modulation of gene expression and mRNA is a
preferred target.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0092] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process.
[0093] It is understood that the sequence set forth in each SEQ ID
NO in the Examples contained herein is independent of any
modification to a sugar moiety, an internucleoside linkage, or a
nucleobase. As such, antisense compounds defined by a SEQ ID NO may
comprise, independently, one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase. Antisense
compounds described by Isis Number (Isis No) indicate a combination
of nucleobase sequence and motif.
[0094] In one embodiment, a target region is a structurally defined
region of the nucleic acid. For example, a target region may
encompass a 3' UTR, a 5' UTR, an exon, an intron, a coding region,
a translation initiation region, translation termination region, or
other defined nucleic acid region. The structurally defined regions
for the nucleic acid can be obtained by accession number from
sequence databases such as NCBI and such information is
incorporated herein by reference. In other embodiments, a target
region may encompass the sequence from a 5' target site of one
target segment within the target region to a 3' target site of
another target segment within the target region.
[0095] Targeting includes determination of at least one target
segment to which an antisense compound hybridizes, such that a
desired effect occurs. In certain embodiments, the desired effect
is a reduction in mRNA target nucleic acid levels. In other
embodiments, the desired effect is reduction of levels of protein
encoded by the target nucleic acid or a phenotypic change
associated with the target nucleic acid.
[0096] A target region may contain one or more target segments.
Multiple target segments within a target region may be overlapping.
Alternatively, they may be non-overlapping. In one embodiment,
target segments within a target region are separated by no more
than about 300 nucleotides. In other embodiments, target segments
within a target region are separated by no more than about, 250,
200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on
the target nucleic acid. In another embodiment, target segments
within a target region are separated by no more than about 5
nucleotides on the target nucleic acid. In additional embodiments,
target segments are contiguous.
[0097] Suitable target segments may be found within a 5' UTR, a
coding region, a 3' UTR, an intron, or an exon. Target segments
containing a start codon or a stop codon are also suitable target
segments. A suitable target segment may specifically exclude a
certain structurally defined region such as the start codon or stop
codon.
[0098] The determination of suitable target segments may include a
comparison of the sequence of a target nucleic acid to other
sequences throughout the genome. For example, the BLAST algorithm
may be used to identify regions of similarity amongst different
nucleic acids. This comparison can prevent the selection of
antisense compound sequences that may hybridize in a non-specific
manner to sequences other than a selected target nucleic acid
(i.e., non-target or off-target sequences).
[0099] There may be variation in activity (e.g., as defined by
percent reduction of target nucleic acid levels) of the antisense
compounds within an active target region. In one embodiment,
reductions in CTGF mRNA levels are indicative of inhibition of CTGF
expression. Reductions in levels of a CTGF protein are also
indicative of inhibition of target mRNA expression. Further,
phenotypic changes are indicative of inhibition of CTGF
expression.
Antisense Compounds
[0100] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target and increased stability in the
presence of nucleases.
[0101] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics.
[0102] Antisense compound means an oligomeric compound capable of
undergoing hybridization to a target nucleic acid through hydrogen
bonding. Antisense compounds include, but are not limited to
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, antisense oligonucleotides, siRNA, RNAi,
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other oligonucleotides which hybridize to the
target nucleic acid and modulate its expression.
[0103] In certain embodiments, an antisense compound has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted. In certain such embodiments,
an antisense oligonucleotide has a nucleobase sequence that, when
written in the 5' to 3' direction, comprises the reverse complement
of the target segment of a target nucleic acid to which it is
targeted.
[0104] In certain embodiments, an antisense compound targeted to a
nucleic acid is 12 to 30 subunits in length. In other words,
antisense compounds are from 12 to 30 linked subunits. In other
embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30,
18 to 24, 19 to 22, or 20 linked subunits. In certain such
embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80
linked subunits in length, or a range defined by any two of the
above values. In some embodiments the antisense compound is an
antisense oligonucleotide, and the linked subunits are
nucleotides.
[0105] In one preferred embodiment of the invention, the compound
comprises 20 or at least 14 linked nucleosides, wherein the
modified oligonucleotide has a sequence which is 100% identical to
one of the sequences set forth in SEQ ID NOs: 28, 30, 39, 40, 45,
52, 56, 78, 125 and 166. In another preferred embodiment, the lead
compound of interest has the sequence set forth in SEQ ID No: 39
(ISIS 412294).
[0106] In certain embodiments, a shortened or truncated antisense
compound targeted to a nucleic acid has a single subunit deleted
from the 5' end (5' truncation), or alternatively from the 3' end
(3' truncation). A shortened or truncated antisense compound
targeted to a nucleic acid may have two subunits deleted from the
5' end, or alternatively may have two subunits deleted from the 3'
end, of the antisense compound. Alternatively, the deleted
nucleosides may be dispersed throughout the antisense compound, for
example, in an antisense compound having one nucleoside deleted
from the 5' end and one nucleoside deleted from the 3' end.
[0107] When a single additional subunit is present in a lengthened
antisense compound, the additional subunit may be located at the 5'
or 3' end of the antisense compound. When two are more additional
subunits are present, the added subunits may be adjacent to each
other, for example, in an antisense compound having two subunits
added to the 5' end (5' addition), or alternatively to the 3' end
(3' addition), of the antisense compound. Alternatively, the added
subunits may be dispersed throughout the antisense compound, for
example, in an antisense compound having one subunit added to the
5' end and one subunit added to the 3' end.
[0108] It is possible to increase or decrease the length of an
antisense compound, such as an antisense oligonucleotide, and/or
introduce mismatch bases without eliminating activity. For example,
in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a
series of antisense oligonucleotides 13-25 nucleobases in length
were tested for their ability to induce cleavage of a target RNA in
an oocyte injection model. Antisense oligonucleotides 25
nucleobases in length with 8 or 11 mismatch bases near the ends of
the antisense oligonucleotides were able to direct specific
cleavage of the target mRNA, albeit to a lesser extent than the
antisense oligonucleotides that contained no mismatches. Similarly,
target specific cleavage was achieved using 13 nucleobase antisense
oligonucleotides, including those with 1 or 3 mismatches.
[0109] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March
2001) demonstrated the ability of an oligonucleotide having 100%
complementarity to the bcl-2 mRNA and having 3 mismatches to the
bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in
vitro and in vivo. Furthermore, this oligonucleotide demonstrated
potent anti-tumor activity in vivo.
[0110] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988)
tested a series of tandem 14 nucleobase antisense oligonucleotides,
and a 28 and 42 nucleobase antisense oligonucleotides comprised of
the sequence of two or three of the tandem antisense
oligonucleotides, respectively, for their ability to arrest
translation of human DHFR in a rabbit reticulocyte assay. Each of
the three 14 nucleobase antisense oligonucleotides alone was able
to inhibit translation, albeit at a more modest level than the 28
or 42 nucleobase antisense oligonucleotides.
[0111] Bhanot et al. (PCT/U52007/068401) provided short antisense
compounds, including compounds comprising chemically-modified
high-affinity monomers 8 to 16 monomers in length. These short
antisense compounds were shown to be useful for reducing target
nucleic acids and/or proteins in cells, tissues, and animals with
increased potency and improved therapeutic index. Short antisense
compounds were effective at lower doses than previously described
antisense compounds, allowing for a reduction in toxicity and cost
of treatment. In addition, the described short antisense compounds
have greater potential for oral dosing.
Hybridizations
[0112] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0113] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds.
Identity
[0114] The antisense compounds provided herein may also have a
defined percent identity to a particular nucleotide sequence, SEQ
ID NO, or compound represented by a specific oligo (Isis) number.
As used herein, an antisense compound is identical to the sequence
disclosed herein if it has the same nucleobase pairing ability. For
example, a RNA which contains uracil in place of thymidine in a
disclosed DNA sequence would be considered identical to the DNA
sequence since both uracil and thymidine pair with adenine.
Shortened and lengthened versions of the antisense compounds
described herein as well as compounds having non-identical bases
relative to the antisense compounds provided herein also are
contemplated. The non-identical bases may be adjacent to each other
or dispersed throughout the antisense compound. Percent identity of
an antisense compound is calculated according to the number of
bases that have identical base pairing relative to the sequence to
which it is being compared.
[0115] In one embodiment, the antisense compounds are at least 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to
one or more of the antisense compounds or SEQ ID NOs, or a portion
thereof, disclosed herein.
Modifications
[0116] In a certain embodiment of the invention, modifications to
antisense compounds encompass substitutions or changes to
internucleoside linkages, sugar moieties, or nucleobases.
[0117] In one embodiment of the invention the compound comprises at
least one modification selected from the group consisting of a
modified internucleoside linkage, a modified sugar, and a modified
nucleobase.
[0118] Although antisense oligonucleotides containing a variety of
modified internucleoside linkages may be employed, the currently
preferred modified internucleoside linkage is a phosphorothioate
linkage between one or more of the nucleosides or wherein all of
the internucleoside linkages are phosphorothioate internucleoside
linkages.
[0119] In general, it is also preferred that the antisense
oligonucleotide contains at least one and typically more than one
modified sugar, wherein the sugar is a bicyclic sugar. Although
various modified sugars may be employed it is presently preferred
to employ a 2'-O-methoxyethyl sugar.
[0120] Further, at least one and typically more than one of the
nucleobases contained in the antisense oligonucleotide will be a
modified nucleotide such as a 5-methylcytosine.
[0121] A nucleoside is a base-sugar combination. The nucleobase
(also known as base) portion of the nucleoside is normally a
heterocyclic base moiety. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to the 2', 3' or 5'
hydroxyl moiety of the sugar. Oligonucleotides are formed through
the covalent linkage of adjacent nucleosides to one another, to
form a linear polymeric oligonucleotide. Within the oligonucleotide
structure, the phosphate groups are commonly referred to as forming
the internucleoside linkages of the oligonucleotide.
[0122] Modifications to antisense compounds encompass substitutions
or changes to internucleoside linkages, sugar moieties, or
nucleobases. Modified antisense compounds are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for nucleic acid
target, increased stability in the presence of nucleases, or
increased inhibitory activity.
[0123] Chemically modified nucleosides may also be employed to
increase the binding affinity of a shortened or truncated antisense
oligonucleotide for its target nucleic acid. Consequently,
comparable results can often be obtained with shorter antisense
compounds that have such chemically modified nucleosides.
Modified Intemucleofide Linkages
[0124] The naturally occurring internucleoside linkage of RNA and
DNA is a 3' to 5' phosphodiester linkage. Antisense compounds
having one or more modified, i.e. non-naturally occurring,
internucleoside linkages are often selected over antisense
compounds having naturally occurring internucleoside linkages
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for target nucleic acids, and
increased stability in the presence of nucleases.
[0125] Oligonucleotides having modified internucleoside linkages
include internucleoside linkages that retain a phosphorus atom as
well as internucleoside linkages that do not have a phosphorus
atom. Representative phosphorus containing internucleoside linkages
include, but are not limited to, phosphodiesters, phosphotriesters,
methylphosphonates, phosphoramidate, and phosphorothioates. Methods
of preparation of phosphorous-containing and
non-phosphorous-containing linkages are well known.
[0126] In one embodiment, antisense compounds targeted to a CTGF
nucleic acid comprise one or more modified internucleoside
linkages. In some embodiments, the modified internucleoside
linkages are phosphorothioate linkages. In other embodiments, each
internucleoside linkage of an antisense compound is a
phosphorothioate internucleoside linkage.
[0127] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound.
[0128] In turn the respective ends of this linear polymeric
structure can be further joined to form a circular structure,
however, open linear structures are generally preferred. Within the
oligonucleotide structure, the phosphate groups are commonly
referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0129] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0130] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotri-esters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thiono-phosphoramidates,
thionoalkylphosphonates, thionoalkylphospho-triesters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0131] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0132] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0133] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0134] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0135] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2-] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
Modified Sugar Moieties
[0136] Modified oligonucleotides may also contain one or more
substituted sugar moieties. For example, the furanosyl sugar ring
can be modified in a number of ways including substitution with a
substituent group, bridging to form a bicyclic nucleic acid "BNA"
and substitution of the 4'-O with a heteroatom such as S or N(R) as
described in U.S. Pat. No. 7,399,845 to Seth et al., hereby
incorporated by reference herein in its entirety. Other examples of
BNAs are described in published International Patent Application
No. WO2007/146511, hereby incorporated by reference herein in its
entirety.
[0137] Antisense compounds of the invention can optionally contain
one or more nucleotides having modified sugar moieties. Sugar
modifications may impart nuclease stability, binding affinity or
some other beneficial biological property to the antisense
compounds. The furanosyl sugar ring of a nucleoside can be modified
in a number of ways including, but not limited to: addition of a
substituent group, particularly at the 2' position; bridging of two
non-geminal ring atoms to form a bicyclic nucleic acid (BNA); and
substitution of an atom or group such as --S--, --N(R)-- or
--C(R1)(R2) for the ring oxygen at the 4'-position. Modified sugars
include, but are not limited to: substituted sugars, especially
2'-substituted sugars having a 2'-F, 2'-OCH.sub.2 (2'-OMe) or a
2'-O(CH.sub.2).sub.2--OCH.sub.3 (2'-O-methoxyethyl or 2'-MOE)
substituent group; and bicyclic modified sugars (BNAs), having a
4'-(CH.sub.2).sub.n--O-2' bridge, where n=1 or n=2. Methods for the
preparations of modified sugars are well known to those skilled in
the art.
[0138] In certain embodiments, a 2'-modified nucleoside has a
bicyclic sugar moiety. In certain such embodiments, the bicyclic
sugar moiety is a D sugar in the alpha configuration. In certain
such embodiments, the bicyclic sugar moiety is a D sugar in the
beta configuration. In certain such embodiments, the bicyclic sugar
moiety is an L sugar in the alpha configuration. In certain such
embodiments, the bicyclic sugar moiety is an L sugar in the beta
configuration.
[0139] In certain embodiments, the bicyclic sugar moiety comprises
a bridge group between the 2' and the 4'-carbon atoms. In certain
such embodiments, the bridge group comprises from 1 to 8 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises from 1 to 4 linked biradical groups. In certain
embodiments, the bicyclic sugar moiety comprises 2 or 3 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises 2 linked biradical groups. In certain embodiments, a
linked biradical group is selected from --O--, --S--,
--N(R1)--C(R1)(R2)--C(R1)=C(R1)-C(R1)=N--, --C(.dbd.NR1)-,
--Si(R1)(R2)-, --S(.dbd.O)2-, --S(.dbd.O)--, --C(.dbd.O)-- and
--C(.dbd.S)--; where each R1 and R2 is, independently, H, hydroxyl,
C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted
C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20
aryl, substituted C5-C20 aryl, a heterocycle radical, a substituted
hetero-cycle radical, heteroaryl, substituted heteroaryl, C5-C7
alicyclic radical, substituted C5-C7 alicyclic radical, halogen,
substituted oxy (--O--), amino, substituted amino, azido, carboxyl,
substituted carboxyl, acyl, substituted acyl, ON, thiol,
substituted thiol, sulfonyl (S(.dbd.O)2-H), substituted sulfonyl,
sulfoxyl (S(.dbd.O)--H) or substituted sulfoxyl; and each
substituent group is, independently, halogen, C1-C12 alkyl,
substituted C1-C12 alkyl, 02-012 alkenyl, substituted C2-C12
alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, amino,
substituted amino, acyl, substituted acyl, C1-C12 aminoalkyl,
C1-C12 aminoalkoxy, substituted C1-C12 aminoalkyl, substituted
C1-C12 aminoalkoxy or a protecting group.
[0140] In some embodiments, the bicyclic sugar moiety is bridged
between the 2' and 4' carbon atoms with a biradical group selected
from --O--(CH.sub.2)p-, --O--CH.sub.2--, --O--CH.sub.2CH.sub.2--,
--O--CH(alkyl)-, --NH--(CH.sub.2)p-, --N(alkyl)-(CH.sub.2)p-,
--O--CH(alkyl)-, --(CH(alkyl))-(CH.sub.2)p-, --NH--O--(CH.sub.2)p-,
--N(alkyl)-O--(CH.sub.2)p-, or --O--N(alkyl)-(CH.sub.2)p-, wherein
p is 1, 2, 3, 4 or 5 and each alkyl group can be further
substituted. In certain embodiments, p is 1, 2 or 3.
[0141] In one aspect, each of said bridges is, independently,
--[C(R1)(R2)]n-, --(C(R1)(R2)]n-O--, --C(R1R2)-N(R1)-O-- or
--C(R1R2)-O--N(R1)-. In another aspect, each of said bridges is,
independently, 4'-(CH.sub.2).sub.3-2', 4'-(CH.sub.2).sub.2-2',
4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R1)-2' and
4'-CH.sub.2--N(R1)-O-2'- wherein each R1 is, independently, H, a
protecting group or C1-C12 alkyl.
[0142] In nucleotides having modified sugar moieties, the
nucleobase moieties (natural, modified or a combination thereof)
are maintained for hybridization with an appropriate nucleic acid
target.
[0143] In one embodiment, antisense compounds targeted to a nucleic
acid comprise one or more nucleotides having modified sugar
moieties.
[0144] In a preferred embodiment, the modified sugar moiety is
2'-MOE. In other embodiments, the 2'-MOE modified nucleotides are
arranged in a gapmer motif.
[0145] Currently preferred oligonucleotides comprise one of the
following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or
N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the
alkyl, alkenyl and alkynyl may be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Particularly preferred are O[(CH.sub.2).sub.n O].sub.m
CH.sub.3, O(CH.sub.2).sub.n OCH.sub.3, O(CH.sub.2).sub.n NH.sub.2,
O(CH.sub.2).sub.n CH.sub.3, O(CH.sub.2).sub.n ONH.sub.2, and
O(CH.sub.2).sub.n ON[((CH.sub.2).sub.n CH.sub.3)].sub.2, where n
and m are from 1 to about 10. Other preferred oligonucleotides
comprise one of the following at the 2' position: C.sub.1 to
C.sub.10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, ON, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. A preferred modification includes
2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2 OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON (CH.sub.3).sub.2 group, also known as 2'-DMAOE,
and 2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2. A further preferred
modification includes bicylic nucleic acid (also referred to as
locked nucleic acids (LNAs)) in which the 2'-hydroxyl group is
linked to the 3' or 4' carbon atom of the sugar ring thereby
forming a bicyclic sugar moiety. The linkage is preferably a
methylene (--CH.sub.2--).sub.n group bridging the 2' oxygen atom
and the 4' carbon atom wherein n is 1 or 2 including
a-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA, .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA and Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2')
BNA. Bicyclic modified sugars also include (6'S)-6' methyl BNA,
Aminooxy (4'-CH.sub.2--O--N(R)-2') BNA, Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA wherein, R is, independently, H, a
protecting group, or C1-C12 alkyl. LNAs also form duplexes with
complementary DNA, RNA or LNA with high thermal affinities.
Circular dichroism (CD) spectra show that duplexes involving fully
modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA
duplex. Nuclear magnetic resonance (NMR) examination of an LNA:DNA
duplex confirmed the 3'-endo conformation of an LNA monomer.
Recognition of double-stranded DNA has also been demonstrated
suggesting strand invasion by LNA. Studies of mismatched sequences
show that LNAs obey the Watson-Crick base pairing rules with
generally improved selectivity compared to the corresponding
unmodified reference strands.
[0146] LNAs in which the 2'-hydroxyl group is linked to the 4'
carbon atom of the sugar ring thereby forming a 2'-C,
4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety.
The linkage may be a methylene (--CH.sub.2--).sub.n group bridging
the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2
(Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and LNA
analogs display very high duplex thermal stabilities with
complementary DNA and RNA (Tm=+3 to +10.degree. C.), stability
towards 3'-exonucleolytic degradation and good solubility
properties. Other preferred bridge groups include the
2'-deoxy-2'-CH.sub.2OCH.sub.2-4' bridge. LNAs and preparation
thereof are described in published International Patent Application
Nos. WO 98/39352 and WO 99/14226.
[0147] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics or surrogates (sometimes referred to as DNA
analogs) such as cyclobutyl moieties in place of the pentofuranosyl
sugar. Representative United States patents that teach the
preparation of such modified sugar structures include, but are not
limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and
5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety. In certain embodiments, nucleosides are modified
by replacement of the ribosyl ring with a surrogate ring system
such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring
or a tetrahydropyranyl ring such as one having one of the
formulae:
##STR00002##
[0148] Many other bicyclo and tricyclo sugar surrogate ring systems
are also know in the art that can be used to modify nucleosides for
incorporation into antisense compounds (see for example review
article: Leumann, Christian J.,). Such ring systems can undergo
various additional substitutions to enhance activity.
[0149] In one embodiment of the invention, the compound comprising
at least one tetrahydropyran modified nucleoside wherein a
tetrahydropyran ring replaces the furanose ring.
[0150] In another embodiment of the invention, wherein each of the
at least one tetrahydropyran modified nucleoside has the
structure:
##STR00003##
wherein Bx is an optionally protected heterocyclic base moiety.
Modified Nucleobases
[0151] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions.
Nucleobase modifications or substitutions are structurally
distinguishable from, yet functionally interchangeable with,
naturally occurring or synthetic unmodified nucleobases. Both
natural and modified nucleobases are capable of participating in
hydrogen bonding. Such nucleobase modifications may impart nuclease
stability, binding affinity or some other beneficial biological
property to antisense compounds. Modified nucleobases include
synthetic and natural nucleobases such as, for example,
5-methylcytosine (5-me-C). Certain nucleobase substitutions,
including 5-methylcytosine substitutions, are particularly useful
for increasing the binding affinity of an antisense compound for a
target nucleic acid. For example, 5-methylcytosine substitutions
have been shown to increase nucleic acid duplex stability by
0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B.,
eds., Antisense Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278).
[0152] Additional unmodified nucleobases include 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine and other
alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine.
[0153] Heterocyclic base moieties may also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Nucleobases that are particularly useful for increasing
the binding affinity of antisense compounds include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted
purines, including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine.
[0154] In one embodiment, antisense compounds targeted to a CTGF
nucleic acid comprise one or more modified nucleobases. In an
additional embodiment, gap-widened antisense oligonucleotides
targeted to a CTGF nucleic acid comprise one or more modified
nucleobases. In some embodiments, the modified nucleobase is
5-methylcytosine. In further embodiments, each cytosine is a
5-methylcytosine.
[0155] As used herein, "unmodified" or "natural" nucleobases
include the purine bases adenine (A) and guanine (G), and the
pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified
nucleobases include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0156] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which has
an owner in common with the owners of the instant application and
also herein incorporated by reference.
Antisense Compound Motifs
[0157] In certain embodiment of the invention, the compound
comprises a modified oligonucleotide comprised of (a) a gap segment
consisting of linked deoxynucleosides, preferably consists of a
thirteen linked modified deoxynucleosides; (b) a 5' wing segment
consisting of linked modified nucleosides, preferably consists of
two linked modified nucleosides; and (c) a 3' wing segment
consisting of linked modified nucleosides, preferably consists of
five linked nucleosides; wherein the gap segment is positioned
between the 5' wing segment and the 3' wing segment, and wherein
each modified nucleoside within each wing segment comprises a
modified sugar, preferably comprises a 2'-O-methoxyethyl sugar; and
wherein each internucleoside linkage is a phosphorothioate
linkage.
[0158] These patterns of modified nucleotides in an antisense
compound are called motif. These motifs, confer to the antisense
compounds properties such to enhance the inhibitory activity,
increase binding affinity for a target nucleic acid, or increase
resistance to degradation by in vivo nucleases.
[0159] In certain embodiments, antisense compounds targeted to a
CTGF nucleic acid have chemically modified subunits arranged in
patterns, or motifs, to confer to the antisense compounds
properties such as enhanced the inhibitory activity, increased
binding affinity for a target nucleic acid, or resistance to
degradation by in vivo nucleases.
[0160] Chimeric antisense compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, increased binding affinity
for the target nucleic acid, and/or increased inhibitory activity.
A second region of a chimeric antisense compound may optionally
serve as a substrate for the cellular endonuclease RNase H, which
cleaves the RNA strand of an RNA:DNA duplex.
[0161] Antisense compounds having a gapmer motif are considered
chimeric antisense compounds. In a gapmer an internal region having
a plurality of nucleotides that supports RNaseH cleavage is
positioned between external regions having a plurality of
nucleotides that are chemically distinct from the nucleosides of
the internal region. In the case of an antisense oligonucleotide
having a gapmer motif, the gap segment generally serves as the
substrate for endonuclease cleavage, while the wing segments
comprise modified nucleosides. In a preferred embodiment, the
regions of a gapmer are differentiated by the types of sugar
moieties comprising each distinct region. The types of sugar
moieties that are used to differentiate the regions of a gapmer may
in some embodiments include .beta.-D-ribonucleosides,
.beta.-D-deoxy-ribonucleosides, 2'-modified nucleosides (such
2'-modified nucleosides may include 2'-MOE, and 2'-O--CH.sub.3,
among others), and bicyclic sugar modified nucleosides (such
bicyclic sugar modified nucleosides may include those having a
4'-(CH.sub.2)n-O-2' bridge, where n=1 or n=2). Preferably, each
distinct region comprises uniform sugar moieties. The wing-gap-wing
motif is frequently described as "X--Y--Z", where "X" represents
the length of the 5' wing region, "Y" represents the length of the
gap region, and "Z" represents the length of the 3' wing region.
Any of the antisense compounds described herein can have a gapmer
motif. In some embodiments, X and Z are the same, in other
embodiments they are different. In a preferred embodiment, Y is
between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30
or more nucleotides. Thus, gapmers of the present invention
include, but are not limited to, for example 2-13-5, 5-10-5, 4-8-4,
4-12-3, 4-12-4, 3-14-3, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1 or
2-8-2.
[0162] In some embodiments, the antisense compound as a "wingmer"
motif, having a wing-gap or gap-wing configuration, i.e. an X--Y or
Y--Z configuration as described above for the gapmer configuration.
Thus, wingmer configurations of the present invention include, but
are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2,
18-1, 10-3, 2-10, 1-10 or 8-2.
[0163] In one embodiment, antisense compounds targeted to a nucleic
acid possess a 2-13-5 gapmer motif.
[0164] In some embodiments, an antisense compound targeted to a
CTGF nucleic acid has a gap-widened motif. In other embodiments, an
antisense oligonucleotide targeted to a CTGF nucleic acid has a
gap-widened motif.
[0165] In one embodiment, a gap-widened antisense oligonucleotide
targeted to a CTGF nucleic acid has a gap segment of fourteen
2'-deoxyribonucleotides positioned between wing segments of three
chemically modified nucleosides. In one embodiment, the chemical
modification comprises a 2'-sugar modification. In another
embodiment, the chemical modification comprises a 2'-MOE sugar
modification.
[0166] Antisense compounds having a gapmer motif are considered
"chimeric" antisense compounds or "chimeras," which contain two or
more chemically distinct regions, each made up of at least one
monomer unit, i.e., a nucleotide in the case of an oligonucleotide
compound. These oligonucleotides typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, increased binding affinity
for the target nucleic acid, and/or increased inhibitory activity.
It is not necessary for all positions in a given compound to be
uniformly modified, and in fact more than one of the aforementioned
modifications may be incorporated in a single compound or even at a
single nucleoside within an oligonucleotide.
[0167] An additional region of the oligonucleotide may serve as a
substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA
hybrids. By way of example, RNase H is a cellular endonuclease
which cleaves the RNA strand of an RNA:DNA duplex. Activation of
RNase H, therefore, results in cleavage of the RNA target, thereby
greatly enhancing the efficiency of oligonucleotide inhibition of
gene expression. Consequently, comparable results can often be
obtained with shorter oligonucleotides when chimeric
oligonucleotides are used, compared to phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0168] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0169] In the case of an antisense oligonucleotide having a gapmer
motif, the gap segment generally serves as the substrate for
endonuclease cleavage, while the wing segments comprise modified
nucleosides. In a preferred embodiment, the regions of a gapmer are
differentiated by the types of sugar moieties comprising each
distinct region. The types of sugar moieties that are used to
differentiate the regions of a gapmer may include
.beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides,
2'-modified nucleosides (such 2'-modified nucleosides may include
2'-MOE), and bicyclic sugar modified nucleosides.
[0170] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. The
compounds of the invention can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve oligomer
uptake, enhance oligomer resistance to degradation, and/or
strengthen sequence-specific hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomer uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International Patent Application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.,
1994, 4, 1053-1060), a thioether, e.g., hexyl-5-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FESS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a
polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a
palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264,
229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0171] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0172] In another embodiment of the invention, the compound
comprises the modified oligonucleotide consists of 20 linked
nucleosides.
[0173] In a preferred embodiment of the invention, the compound
comprises the nucleobase sequence is the sequence set forth in SEQ
ID NOs: 39, 40, 45, 52 and 166.
[0174] In one embodiment of the invention the composition comprises
a modified oligonucleotide comprising linked nucleosides, the
nucleobase sequence of which is a sequence set forth in one of SEQ
ID NOs: 28, 30, 39, 40, 43, 44, 45, 50, 51, 52, 56, 78, 125 and 166
or a salt thereof, and a pharmaceutically acceptable carrier or
diluent. Examples of pharmaceutically acceptable salts are well
known to those skilled in the art.
[0175] In one embodiment of the invention, the antisense compound
is complementary within a range of nucleotides on the CTGF
sequence. In certain embodiments the antisense compound is
complementary within the range of nucleotides 718-751, 1388-1423,
1457-1689, 2040-2069, 2120-2147, or 2267-2301 of SEQ ID NO: 9. In a
certain embodiment the antisense compound is complementary within
the range of nucleotides 2728-2797 of SEQ ID NO: 10. Compounds
targeted to these ranges demonstrate at least 50% inhibition (i.e.
SEQ ID NOs: 15, 29, 31, 42, 46-49, 53, 72, 81, 82, 152-154, 164,
and 165). Certain target sites listed in Table 1 also demonstrate
at least 50% inhibition (i.e. SEQ ID NOs: 12, 20, 33, 34, 76, 107,
129, 132, 134, 136, and 146). In certain embodiments the antisense
compound is complementary within the range of nucleotides 553-611,
1394-1423, 1469-1508, 1559-1605, 1659-1689 or 2100-2129 of SEQ ID
NO: 9 and 2623-2647 of SEQ ID NO: 10. Compounds targeted therein
demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 27, 28, 38,
39, 40, 43, 44, 45, 50, 51, 52, 54, 55, 56, 77, 78, 79, 138 and
139). Certain additional target sites listed in Table 1 also
demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 24, 30, 61,
63, 67, 69, 73, 86, 125, 128, and 161). In certain embodiments the
antisense compound is complementary within the range of nucleotides
1399-1423. Compounds targeted therein demonstrate at least 70%
inhibition (i.e. SEQ ID NOs: 39 and 40). Certain target sites
listed in Table 1 also demonstrate at least 70% inhibition (i.e.
SEQ ID NOs: 28, 30, 44, 45, 51, 56, 78, 128, and 138). One target
site listed in Table 1 also demonstrates at least 80% inhibition
(i.e. SEQ ID NO: 44). In certain embodiments, the percent
inhibition is achieved when the antisense compound is delivered to
HuVec cells at a concentration of 50 nm. Refer to Example 8,
provided herein below, for more details.
[0176] In an embodiment of the composition, the modified
oligonucleotide is a single-stranded or double stranded
oligonucleotide. In another embodiment of the invention, comprising
a modified oligonucleotide, wherein the modified oligonucleotide
consists of 20 linked nucleosides
[0177] In another embodiment of the invention, provides a method
for inhibiting expression of connective tissue growth factor in a
cell or a tissue which comprises contacting the cell or tissue with
the compound of interest under conditions such that expression of
connective tissue growth factor is inhibited.
[0178] Antisense oligonucleotides may be combined with
pharmaceutically acceptable active and/or inert substances for the
preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions are dependent upon a number of criteria, including,
but not limited to, route of administration, extent of disease, or
dose to be administered.
[0179] Antisense compound targeted to a nucleic acid can be
utilized in pharmaceutical compositions by combining the antisense
compound with a suitable pharmaceutically acceptable diluent or
carrier. A pharmaceutically acceptable diluent includes
phosphate-buffered saline (PBS). PBS is a diluent suitable for use
in compositions to be delivered parenterally. Accordingly, in one
embodiment, employed in the methods described herein is a
pharmaceutical composition comprising an antisense compound
targeted to a nucleic acid and a pharmaceutically acceptable
diluent. In one embodiment, the pharmaceutically acceptable diluent
is PBS. In another embodiment, the pharmaceutically acceptable
diluent is pharmaceutical grade saline or pharmaceutical grade PBS.
In other embodiments, the antisense compound is an antisense
oligonucleotide.
[0180] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters, or any other oligonucleotide which, upon
administration to an animal, including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0181] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an antisense compound which are
cleaved by endogenous nucleases within the body, to form the active
antisense compound. In particular, prodrug versions of the
oligonucleotides of the invention are prepared as SATE
[(S-acetyl-2-thioethyl)phosphate] derivatives according to the
methods disclosed in WO 93/24510 to Gosselin et al., published Dec.
9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et
al.
[0182] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0183] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfonic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0184] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0185] In certain embodiment of the invention, a pharmaceutically
acceptable carrier or diluent is an ingredient in a composition
that lacks pharmacological activity, but is pharmaceutically
necessary or desirable as a solvent, suspending agent or any other
pharmaceutically inert vehicle for delivering one or more nucleic
acids to a human or non-human animal. Pharmaceutical carriers are
well known to those skilled in the art.
Carriers
[0186] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or 4-acetamido-4'
isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense
Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl.
Acid Drug Dev., 1996, 6, 177-183).
Excipients
[0187] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0188] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which does not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0189] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0190] In one embodiment of the invention, the composition
comprises a modified oligonucleotide comprises a single-stranded or
a double-stranded oligonucleotide, and wherein the modified
oligonucleotide consists of 20 linked nucleosides.
[0191] In another embodiment of the invention involves a method for
inhibiting expression of connective tissue growth factor in a cell
or a tissue which comprises contacting the cell or tissue with any
one of the above-mentioned compounds under conditions such that
expression of connective tissue growth factor is inhibited.
[0192] In certain embodiment of the invention involves a method of
treating an animal having a disease or condition associated with
expression of connective tissue growth factor which comprises
administering to the animal an amount of the compound described
hereinabove effective to inhibit expression of connective tissue
growth factor so as to thereby treat the animal.
[0193] In the practice of the method of this invention, an animal
includes a human as well as a non-human animal, preferably
human.
[0194] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be by intradermal administration,
including intradermal threading of the injection needle,
subcutaneous, topical (including ophthalmic and to mucous membranes
including vaginal and rectal delivery), pulmonary, e.g., by
inhalation or insufflation of powders or aerosols, including by
nebulizer; intratracheal, intranasal, epidermal and transdermal),
oral or parenteral. Parenteral administration includes intravenous,
intraarterial, subcutaneous, intraperitoneal or intramuscular
injection or infusion; or intracranial, e.g., intrathecal or
intraventricular, administration.
[0195] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Preferred
intradermal and topical formulations include those in which the
oligonucleotides of the invention are in admixture with a topical
delivery agent such as lipids, liposomes, fatty acids, fatty acid
esters, steroids, chelating agents and surfactants. Preferred
lipids and liposomes include neutral (e.g. dioleoylphosphatidyl
DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC,
distearolyphosphatidyl choline) negative (e.g.
dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl
ethanolamine DOTMA). Oligonucleotides of the invention may be
encapsulated within liposomes or may form complexes thereto, in
particular to cationic liposomes. Alternatively, oligonucleotides
may be complexed to lipids, in particular to cationic lipids.
Preferred fatty acids and esters include but are not limited
arachidonic acid, oleic acid, eicosanoic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0196] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0197] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0198] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
syringes, pre-filed syringes, tablets, capsules, gel capsules,
liquid syrups, soft gels, suppositories, and enemas. The
compositions of the present invention may also be formulated as
suspensions in aqueous, non-aqueous or mixed media. Aqueous
suspensions may further contain substances which increase the
viscosity of the suspension including, for example, sodium
carboxymethyl-cellulose, sorbitol and/or dextran. The suspension
may also contain stabilizers.
[0199] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
Liposomes
[0200] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0201] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0202] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0203] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
[0204] Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0205] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0206] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for intradermal and topical administration,
liposomes present several advantages over other formulations. Such
advantages include reduced side-effects related to high systemic
absorption of the administered drug, increased accumulation of the
administered drug at the desired target, and the ability to
administer a wide variety of drugs, both hydrophilic and
hydrophobic, into the skin.
[0207] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0208] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0209] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0210] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0211] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0212] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
[0213] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEES
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0214] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
galactocerebroside sulfate and phosphatidylinositol to improve
blood half-lives of liposomes. These findings were expounded upon
by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949).
U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al.,
disclose liposomes comprising (1) sphingomyelin and (2) the
ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S.
Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising
sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499
(Lim et al.).
[0215] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.12 15 G, that contains a PEG moiety. Illum et al. (FEBS
Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FESS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanol-amine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935
(Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe
PEG-containing liposomes that can be further derivatized with
functional moieties on their surfaces.
[0216] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0217] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0218] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0219] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0220] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0221] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0222] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0223] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
Penetration Enhancers
[0224] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0225] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.
92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0226] Surfactants: In connection with the present invention,
surfactants (or "surface-active agents") are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0227] Fatty Acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651-654).
[0228] Bile Salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxy-cholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0229] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines)(Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0230] Non-Chelating Non-Surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0231] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0232] Other agents may be utilized to enhance the penetration of
the administered nucleic acids into and through the skin, including
glycols such as ethylene glycol and propylene glycol, pyrrols such
as 2-pyrrol, azones, and terpenes such as limonene and
menthone.
Other Components
[0233] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage
levels.
[0234] Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0235] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0236] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0237] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. The compounds of the
invention may also be admixed, encapsulated, conjugated or
otherwise associated with other molecules, molecule structures or
mixtures of compounds, as for example, liposomes, receptor targeted
molecules, oral, rectal, topical or other formulations, for
assisting in uptake, distribution and/or absorption. Representative
United States patents that teach the preparation of such uptake,
distribution and/or absorption assisting formulations include, but
are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
Certain Indications
[0238] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0239] In one embodiment of the invention the method comprises
treating a disease or condition, wherein the disease or disorder is
a fibrotic disease. In one embodiment of the method of the
invention, the fibrotic disease is hypertrophic scarring, keloids,
skin scarring, liver fibrosis, pulmonary fibrosis, renal fibrosis,
cardiac fibrosis, or restenosis.
[0240] In another embodiment of the invention, the method further
comprises treating the above-mentioned disease or condition,
wherein the disease or disorder is joint fibrosis (including frozen
shoulder syndrome, tendon and peripheral nerve damage), surgical
adhesions, spinal cord damage, coronary bypass, abdominal and
peritoneal adhesions (including endometriosis, uterine leiomyomata
and fibroids), radial keratotomy and photorefractive keratectomy,
retinal reattachment surgery, device mediated fibrosis (in for
example diabetes), tendon adhesions, Dupuytren contracture, or
scleroderma.
[0241] In another embodiment of the invention also provides a
method for reducing hypertropic scarring or keloids resulting from
dermal wound healing in a subject in need thereof which comprises
administering to the subject an amount of compound of an antisense
oligonucleotide effective to inhibit expression of connective
tissue growth factor (CTGF) in the subject so as to thereby reduce
scarring.
[0242] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. In general, dosage from 0.1 to 25 mg per injection per
linear cm of scar is used, and may be given daily, weekly, every 3
weeks, monthly or bi-monthly.
[0243] In another embodiment of this invention, the method further
comprises reducing hypertropic scarring or keloids resulting from
dermal wound healing, wherein wound healing is healing at a wound
selected from the group consisting of skin breakage, surgical
incisions and burns.
[0244] In certain embodiments, the invention provides methods of
treating an individual comprising administering one or more
pharmaceutical compositions of the present invention. In certain
embodiments, the individual has one of the above mentioned
disorders. In certain embodiments, the individual is at risk for
one of the above mentioned disorders. In certain embodiments, the
individual has been identified as in need of therapy. In certain
embodiments the invention provides methods for prophylactically
reducing CTGF expression in an individual.
[0245] Certain embodiments include treating an individual in need
thereof by administering to an individual a therapeutically
effective amount of an antisense compound targeted to a CTGF
nucleic acid.
[0246] In one embodiment, administration of a therapeutically
effective amount of an antisense compound targeted to a CTGF
nucleic acid is accompanied by monitoring of CTGF levels in the
skin and/or serum of an individual, to determine an individual's
response to administration of the antisense compound. An
individual's response to administration of the antisense compound
is used by a physician to determine the amount and duration of
therapeutic intervention.
[0247] In one embodiment, administration of an antisense compound
targeted to a CTGF nucleic acid results in reduction of CTGF
expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65,
70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of
these values. In one embodiment, administration of an antisense
compound targeted to a CTGF nucleic acid results in a change in a
measure of CTGF as measured by a standard test, for example, but
not limited to, CTGF. In some embodiments, administration of a CTGF
antisense compound decreases the measure by at least 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a
range defined by any two of these values.
[0248] In certain embodiments pharmaceutical composition comprising
an antisense compound targeted to CTGF is used for the preparation
of a medicament for treating a patient suffering or susceptible to
any one of the above-mentioned disorders.
Certain Combination Therapies
[0249] In certain embodiments, one or more pharmaceutical
compositions of the present invention are co-administered with one
or more other pharmaceutical agents. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat the
same disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat a
different disease or condition as the one or more pharmaceutical
compositions of the present invention. In certain embodiments, such
one or more other pharmaceutical agents are designed to treat an
undesired effect of one or more pharmaceutical compositions of the
present invention. In certain embodiments, one or more
pharmaceutical compositions of the present invention are
co-administered with another pharmaceutical agent to treat an
undesired effect of that other pharmaceutical agent. In certain
embodiments, one or more pharmaceutical compositions of the present
invention and one or more other pharmaceutical agents are
administered at the same time. In certain embodiments, one or more
pharmaceutical compositions of the present invention and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared together in a single
formulation. In certain embodiments, one or more pharmaceutical
compositions of the present invention and one or more other
pharmaceutical agents are prepared separately.
[0250] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition of the present
invention include a second therapeutic agent. In certain such
embodiments, pharmaceutical agents that may be co-administered with
a pharmaceutical composition of the present invention include, but
are not limited to second therapeutic agent. In certain such
embodiments, the second therapeutic agent is administered prior to
administration of a pharmaceutical composition of the present
invention. In certain such embodiments, the second therapeutic
agent is administered following administration of a pharmaceutical
composition of the present invention. In certain such embodiments
the second therapeutic agent is administered at the same time as a
pharmaceutical composition of the present invention. In certain
such embodiments the dose of a co-administered second therapeutic
agent is the same as the dose that would be administered if the
second therapeutic agent was administered alone. In certain such
embodiments the dose of a co-administered second therapeutic agent
is lower than the dose that would be administered if the second
therapeutic agent was administered alone. In certain such
embodiments the dose of a co-administered second therapeutic agent
is greater than the dose that would be administered if the second
therapeutic agent was administered alone.
[0251] In certain embodiments, the co-administration of a second
compound enhances the therapeutic effect of a first compound, such
that co-administration of the compounds results in a therapeutic
effect that is greater than the effect of administering the first
compound alone, a synergistic effect. In other embodiments, the
co-administration results in therapeutic effects that are additive
of the effects of the compounds when administered alone. In other
embodiments, the co-administration results in therapeutic effects
that are supra-additive of the effects of the compounds when
administered alone. In some embodiments, the first compound is an
antisense compound. In some embodiments, the second compound is an
antisense compound.
[0252] This invention is illustrated in the Examples Section which
follows. This section is set forth to aid in an understanding of
the invention but is not intended to, and should not be construed
to limit in any way the invention as set forth in the claims which
follow thereafter.
EXAMPLES
Example 1
Selection of Lead Human Connective Tissue Growth Factors (CTGF)
Antisense Oligonucleotides Candidate
Introduction
[0253] A series of oligonucleotides were designed to target
different regions of the human connective tissue growth factor RNA,
using published sequences (GenBank accession number NM_001901.2,
incorporated herein as SEQ ID NO: 9, and GenBank accession number
NT_025741.14, incorporated herein as SEQ ID NO: 10).
[0254] This study analyzes available sequence space and modified
antisense oligonucleotides targeting both exonic and intronic space
of CTGF. Approximately 150 novel sequences per target were
synthesized and evaluated for activity against CTGF in
cell-culture. The oligonucleotides are shown in Table 1. All
compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of either ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotides "wings" or 13
2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by two- and five-nucleotides "wings," respectively. The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cystidine residuals are
5-methycytidines. The compounds were analyzed for their effect on
human connective tissue growth factor mRNA levels by quantitative
real-time PCR as described later. Data are averages from two
experiments. If present, "N.D." indicates "no data".
TABLE-US-00001 TABLE 1 Inhibition of human connective tissue growth
factor mRNA levels by chimeric phosphorothioate oligonucleotides
having 2'-MOE wings and a deoxy gap TARGET SEQ ID TARGET SEQ ISIS #
REGION NO SITE SEQUENCE % INHIB ID NO. 124173 CDS 9 380
CCAGCTGCTTGGCGCAGACG 35 11 124189 CDS 9 1003 GCCAGAAAGCTCAAACTTGA
57 12 124212 3'-UTR 9 1783 CCACAAGCTGTCCAGTCTAA 47 13 124235 3'-UTR
9 2267 GGTCACACTCTCAACAAATA 47 14 124238 3'-UTR 9 2282
AAACATGTAACTTTTGGTCA 53 15 412271 5'-UTR 9 4 GGGAAGAGTTGTTGTGTGAG 0
16 412272 5'-UTR 9 38 AGGGTGGAGTCGCACTGGCT 46 17 412273 CDS 9 228
ACGAAGGCGACGCGGACGGG 35 18 412274 CDS 9 265 GCCGACGGCCGGCCGGCTGC 40
19 412275 CDS 9 475 GGTGCACACGCCGATCTTGC 52 20 412276 CDS 9 483
TCTTTGGCGGTGCACACGCC 0 21 412277 CDS 9 489 GCACCATCTTTGGCGGTGCA 0
22 412278 CDS 9 496 GCAGGGAGCACCATCTTTGG 16 23 412279 CDS 9 501
AAGATGCAGGGAGCACCATC 63 24 412280 CDS 9 507 CCACCGAAGATGCAGGGAGC 0
25 412281 CDS 9 512 CCGTACCACCGAAGATGCAG 47 26 412282 CDS 9 553
GTACTTGCAGCTGCTCTGGA 68 27 412283 CDS 9 592 GGGCATGCAGCCCACCGCCC 72
28 412284 CDS 9 718 AGGCCCAACCACGGTTTGGT 59 29 412285 CDS 9 723
AGGGCAGGCCCAACCACGGT 79 30 412286 CDS 9 732 TAAGCCGCGAGGGCAGGCCC 55
31 412287 CDS 9 829 CCCACAGGTCTTGGAACAGG 30 32 412288 CDS 9 839
AGATGCCCATCCCACAGGTC 55 33 412289 3'-UTR 9 1273
CCAGTCTAATGAGTTAATGT 56 34 412290 3'-UTR 9 1281
TTCAAGTTCCAGTCTAATGA 10 35 412291 3'-UTR 9 1361
TTTTCCCCCAGTTAGAAAAA 38 36 412292 3'-UTR 9 1388
CACAATGTTTTGAATTGGGT 50 37 412293 3'-UTR 9 1394
ACATGGCACAATGTTTTGAA 67 38 412294 3'-UTR 9 1399
GTTTGACATGGCACAATGTT 73 39 412295 3'-UTR 9 1404
TATTTGTTTGACATGGCACA 74 40 412296 3'-UTR 9 1412
TGATAGACTATTTGTTTGAC 35 41 412297 3'-UTR 9 1457
GTTCCACTGTCAAGTCTTAA 55 42 412298 3'-UTR 9 1469
TGTACTAATGTAGTTCCACT 69 43 412299 3'-UTR 9 1482
CATTCTGGTGCTGTGTACTA 86 44 412300 3'-UTR 9 1489
TAATATACATTCTGGTGCTG 76 45 412301 3'-UTR 9 1495
ACACCTTAATATACATTCTG 54 46 412302 3'-UTR 9 1502
TAAAGCCACACCTTAATATA 54 47 412303 3'-UTR 9 1520
GTACCCTCCCACTGCTCCTA 53 48 412304 3'-UTR 9 1554
AAGATGCTATCTGATGATAC 52 49 412305 3'-UTR 9 1559
CGTATAAGATGCTATCTGAT 69 50 412306 3'-UTR 9 1577
AATAGCAGGCATATTACTCG 74 51 412307 3'-UTR 9 1586
TACACTTCAAATAGCAGGCA 66 52 412308 3'-UTR 9 1591
TCAATTACACTTCAAATAGC 50 53 412309 3'-UTR 9 1659
GGAGAATGCACATCCTAGCT 66 54 412310 3'-UTR 9 1665
ATGGCTGGAGAATGCACATC 60 55 412311 3'-UTR 9 1670
TCTTGATGGCTGGAGAATGC 71 56 412312 3'-UTR 9 1729
GAATCAGAATGTCAGAGCTG 37 57 412313 3'-UTR 9 1946
CATTGAAATATCAAAGCATT 0 58 412314 3'-UTR 9 1952 GGCTAACATTGAAATATCAA
25 59 412315 3'-UTR 9 1958 AATTGAGGCTAACATTGAAA 1 60 412316 3'-UTR
9 1965 GTTCAGAAATTGAGGCTAAC 65 61 412317 3'-UTR 9 1971
TATGGTGTTCAGAAATTGAG 13 62 412318 3'-UTR 9 1976
CTACCTATGGTGTTCAGAAA 61 63 412319 3'-UTR 9 1982
TACATTCTACCTATGGTGTT 38 64 412320 3'-UTR 9 1991
GACAAGCTTTACATTCTACC 24 65 412321 3'-UTR 9 1996
GATCAGACAAGCTTTACATT 37 66 412322 3'-UTR 9 2007
ATGCTTTGAACGATCAGACA 64 67 412323 3'-UTR 9 2012
ATTTCATGCTTTGAACGATC 44 68 412324 3'-UTR 9 2018
GTATCCATTTCATGCTTTGA 60 69 412325 3'-UTR 9 2026
CCATATAAGTATCCATTTCA 48 70 412326 3'-UTR 9 2032
GAATTTCCATATAAGTATCC 28 71 412327 3'-UTR 9 2040
TCTGAGCAGAATTTCCATAT 58 72 412328 3'-UTR 9 2050
TGTCATTCTATCTGAGCAGA 61 73 412329 3'-UTR 9 2060
TTTGACGGACTGTCATTCTA 47 74 412330 3'-UTR 9 2070
AACAATCTGTTTTGACGGAC 48 75 412331 3'-UTR 9 2088
TGATGCCTCCCCTTTGCAAA 53 76 412332 3'-UTR 9 2100
TGCCAAGGACACTGATGCCT 68 77 412333 3'-UTR 9 2105
CAGCCTGCCAAGGACACTGA 75 78 412334 3'-UTR 9 2110
GAAATCAGCCTGCCAAGGAC 60 79 412335 3'-UTR 9 2115
ACCTAGAAATCAGCCTGCCA 46 80 412336 3'-UTR 9 2120
TTCCTACCTAGAAATCAGCC 51 81 412337 3'-UTR 9 2128
TACCACATTTCCTACCTAGA 59 82 412338 3'-UTR 9 2134
TGAGGCTACCACATTTCCTA 0 83 412339 3'-UTR 9 2140 TAAAAGTGAGGCTACCACAT
48 84 412340 3'-UTR 9 2213 CAAATGCTTCCAGGTGAAAA 49 85 412341 3'-UTR
9 2219 TAGAAACAAATGCTTCCAGG 66 86 412342 3'-UTR 9 2230
TCATATCAAAGTAGAAACAA 12 87 412343 3'-UTR 9 2242
TCCGAAAAACAGTCATATCA 24 88 412368 Intron 1 10 1308
ACCCGGCTGCAGAGGGCGAG 0 89 412369 Intron 1 10 1313
CGCTTACCCGGCTGCAGAGG 0 90 412370 Intron 1 10 1410
GACAGGGCGGTCAGCGGCGC 0 91 412371 Intron 2 10 1730
AGTCCGAGCGGTTTCTTTTT 0 92 412372 Intron 2 10 1735
AACTCAGTCCGAGCGGTTTC 19 93 412373 Intron 2 10 1740
AAAGAAACTCAGTCCGAGCG 10 94 412374 Intron 2 10 1745
TGGAGAAAGAAACTCAGTCC 45 95 412375 Intron 2 10 1750
GCAGCTGGAGAAAGAAACTC 14 96 412376 Intron 2 10 1755
TGGCAGCAGCTGGAGAAAGA 46 97 412377 Intron 2 10 1887
AGGGAGCACCATCTTTGGCT 20 98 412378 Intron 3 10 2125
TCACCCGCGAGGGCAGGCCC 33 99 412379 Intron 3 10 2137
GGAAGACTCGACTCACCCGC 0 100 412380 Intron 3 10 2142
TTAGAGGAAGACTCGACTCA 0 101 412381 Intron 3 10 2150
ACCCTGACTTAGAGGAAGAC 47 102 412382 Intron 3 10 2155
TCACGACCCTGACTTAGAGG 31 103 412383 Intron 3 10 2160
GAGAATCACGACCCTGACTT 2 104 412384 Intron 3 10 2165
TGGGAGAGAATCACGACCCT 31 105 412385 Intron 3 10 2170
CTCCCTGGGAGAGAATCACG 0 106 412386 Intron 3 10 2191
GGTCGGCACAGTTAGGACTC 53 107 412387 Intron 3 10 2196
CGTTCGGTCGGCACAGTTAG 30 108 412388 Intron 3 10 2216
CCTGGATAAGGTATTTCCCC 0 109 412389 Intron 3 10 2235
ACAAACACCATGTAAAACGC 11 110 412390 Intron 3 10 2241
GAGCACACAAACACCATGTA 0 111 412391 Intron 3 10 2251
TGCGAGAGCAGAGCACACAA 0 112 412392 Intron 3 10 2256
TAAGCTGCGAGAGCAGAGCA 2 113 412393 Intron 3 10 2261
GTCGGTAAGCTGCGAGAGCA 23 114 412394 Intron 3 10 2266
TTCCAGTCGGTAAGCTGCGA 15 115 412395 Intron 4 10 2472
ACATGTACCTTAATGTTCTC 0 116 412396 Intron 4 10 2477
GCAGAACATGTACCTTAATG 0 117 412397 Intron 4 10 2482
TAGGAGCAGAACATGTACCT 9 118 412398 Intron 4 10 2487
GTTAATAGGAGCAGAACATG 19 119 412399 Intron 4 10 2496
TGAAAAATAGTTAATAGGAG 0 120 412400 Intron 4 10 2511
CCACTGTTTTTCCTGTGAAA 10 121 412401 Intron 4 10 2525
AAGTTGGGTCCTATCCACTG 28 122 412402 Intron 4 10 2530
GCCCTAAGTTGGGTCCTATC 20 123 412403 Intron 4 10 2535
CAAGAGCCCTAAGTTGGGTC 0 124 412404 Intron 4 10 2540
CGTGGCAAGAGCCCTAAGTT 64 125 412405 Intron 4 10 2558
CGGGCTTATACTAACAAGCG 6 126 412406 Intron 4 10 2563
GATAACGGGCTTATACTAAC 33 127 412407 Intron 4 10 2568
TTGGAGATAACGGGCTTATA 73 128 412408 Intron 4 10 2573
TAGTTTTGGAGATAACGGGC 51 129 412409 Intron 4 10 2578
TTAGATAGTTTTGGAGATAA 24 130 412410 Intron 4 10 2584
CAATGGTTAGATAGTTTTGG 36 131
412411 Intron 4 10 2589 CAGCTCAATGGTTAGATAGT 53 132 412412 Intron 4
10 2594 CAAAACAGCTCAATGGTTAG 34 133 412413 Intron 4 10 2599
TCCAGCAAAACAGCTCAATG 59 134 412414 Intron 4 10 2604
CTCATTCCAGCAAAACAGCT 42 135 412415 Intron 4 10 2609
AAGCTCTCATTCCAGCAAAA 57 136 412416 Intron 4 10 2614
TACACAAGCTCTCATTCCAG 44 137 412417 Intron 4 10 2623
GGTTGCTATTACACAAGCTC 72 138 412418 Intron 4 10 2628
CTGGTGGTTGCTATTACACA 61 139 412419 Intron 4 10 2633
GAAAACTGGTGGTTGCTATT 29 140 412420 Intron 4 10 2638
TAGTGGAAAACTGGTGGTTG 5 141 412421 Intron 4 10 2663
TTAACTAACCCTGTGGAAGA 15 142 412422 Intron 4 10 2672
TGTCTTGAATTAACTAACCC 4 143 412423 Intron 4 10 2677
TGGAATGTCTTGAATTAACT 0 144 412424 Intron 4 10 2691
GCCAGAGCCTCTCTTGGAAT 36 145 412425 Intron 4 10 2698
AAAAATAGCCAGAGCCTCTC 59 146 412426 Intron 4 10 2703
TGTCCAAAAATAGCCAGAGC 28 147 412427 Intron 4 10 2708
TGCTATGTCCAAAAATAGCC 15 148 412428 Intron 4 10 2713
TCATTTGCTATGTCCAAAAA 28 149 412429 Intron 4 10 2718
GAGTCTCATTTGCTATGTCC 20 150 412430 Intron 4 10 2723
AGTTTGAGTCTCATTTGCTA 30 151 412431 Intron 4 10 2728
GAGGAAGTTTGAGTCTCATT 55 152 412432 Intron 4 10 2763
CTTCTGTTGTCTGACTTCTG 55 153 412433 Intron 4 10 2778
CCTCTGTGTTTTAGTCTTCT 56 154 412434 Intron 4 10 2788
TTTCTTCAACCCTCTGTGTT 15 155 412435 Intron 4 10 2796
GGAGTGGCTTTCTTCAACCC 43 156 412436 Intron 4 10 2849
AGGAAGACAAGGGAAAAGAG 20 157 412437 Intron 4 10 2854
TTCTAAGGAAGACAAGGGAA 0 158 412438 Intron 4 10 2859
TGCCCTTCTAAGGAAGACAA 31 159 412439 Intron 2 10 1791
GGATGCGAGTTGGGATCTGG 0 160 412440 CDS 9 380 CCAGCTGCTTGGCGCAGACG 64
161 412441 CDS 9 1003 GCCAGAAAGCTCAAACTTGA 37 162 412442 3'-UTR 9
1783 CCACAAGCTGTCCAGTCTAA 32 163 412443 3'-UTR 9 2267
GGTCACACTCTCAACAAATA 59 164 412444 3'-UTR 9 2282
AAACATGTAACTTTTGGTCA 55 165 418899 3'-UTR 9 1391
TGACATGGCACAATGTTTTG ND* 166 *ND-i.e. not determined in the
experiment but was highly active in another assay.
[0255] As shown in Table 1, SEQ ID NOs 11-15, 17-20, 24, 26-34,
36-57, 59, 61, 63-82, 84-86, 88, 95, 97, 99, 102, 103, 105, 107,
108, 122, 125, 127-140, 145, 146, 149, 151-154, 156, 159, 161-165
demonstrated at least 24% inhibition of human connective tissue
growth factor expression in this assay and are therefore preferred.
The target sites to which these preferred sequences are
complementary are herein referred to as "active sites" and are
therefore preferred sites for targeting by compounds of the present
invention.
[0256] The antisense compound is complementary within a range of
nucleotides on the CTGF sequence, i.e. within the range of
nucleotides 718-751, 1388-1423, 1457-1689, 2040-2069, 2120-2147, or
2267-2301 of SEQ ID NO: 9. In a certain embodiment the antisense
compound is complementary within the range of nucleotides 2728-2797
of SEQ ID NO: 10. Compounds targeted to these ranges demonstrate at
least 50% inhibition (i.e. SEQ ID NOs: 15, 29, 31, 42, 46-49, 53,
72, 81, 82, 152-154, 164, and 165). Certain target sites listed in
Table 1 also demonstrate at least 50% inhibition (i.e. SEQ ID NOs:
12, 20, 33, 34, 76, 107, 129, 132, 134, 136, and 146).
[0257] In certain embodiments the antisense compound is
complementary within the range of nucleotides 553-611, 1394-1423,
1469-1508, 1559-1605, 1659-1689 or 2100-2129. Compounds targeted
therein demonstrate at least 60% inhibition (i.e. SEQ ID NOs: 27,
38, 43, 50, 52, 54, 55, 77, 79, and 86). Certain target sites
listed in Table 1 also demonstrate at least 60% inhibition (i.e.
SEQ ID NOs: 24, 61, 63, 67, 69, 73, 125, 139 and 161).
[0258] The antisense compound is also complementary within the
range of nucleotides 1399-1423. Compounds targeted therein
demonstrate at least 70% inhibition (i.e. SEQ ID NOs: 39 and 40).
Certain target sites listed in Table 1 also demonstrate at least
70% inhibition (i.e. SEQ ID NOs: 28, 30, 45, 51, 56, 78, 128, and
138). One target site listed in Table 1 also demonstrates at least
80% inhibition (i.e. SEQ ID NO: 44). In certain embodiments, the
percent inhibition is achieved when the antisense compound is
delivered to HuVec cells at a concentration of 50 nm.
[0259] Multiple leads with apparent activity greater than the
historical ASO lead sequence, SEQ ID No. 15 (ISIS124238), were
identified in both exonic and intronic sequences.
Materials and Methods
[0260] Oligonucleotides were evaluated and activity confirmed at a
concentration 50 nM in human umbilical vein endothelial cells
(HuVEC) using Lipofectin mediated transfection. HuVEC cells from
Cascade Biologics (Portland, Oreg.) maintained in Medium 200
supplemented with Low Serum Growth Supplement (from Cascade
Biologics) were plated into 96-well plates at 5,000 cells per well
and incubated overnight at 37.degree. C. in the presence of 5%
CO.sub.2. The following day the medium was aspirated and replaced
with prewarmed Opti-MEM I (Invitrogen) containing
Oligo-Lipofectamine 2000 (Invitrogen) mixture (3 mg of
Lipofectamine 2000 per 1 ml of Opti-MEM I medium). After 4 hours,
the transfection mixture was exchanged for fresh Medium 200
supplemented with Low Serum Growth Supplement and incubated at
37.degree. C. in the presence of 5% CO.sub.2. After 16-24 hours, at
approximately 80% confluence, the cells were washed with phosphate
buffer saline (PBS) and lysed for RNA purification with the Qiagen
RNeasy Kit. CTGF message was measured by quantitative real time
polymerase chain reaction (RT-PCR) (Primer/Probe sets shown below)
and the results were normalized to total RNA.
Statistical Analysis
[0261] Each sample was analyzed in duplicate, and vertical bars
represent the spread between the two measurements.
Results and Discussion
[0262] Of the approximately 150 novel sequences per target
synthesized and evaluated for activity against CTGF in
cell-culture, the CTGF oligonucleotides (SEQ ID NOs: 28, 30, 39,
40, 45, 52, 56, 78, 125, and 166) show excellent inhibition of
human CTGF mRNA expression.
Example 2
A Single-Dose Intra-Dermal Pharmacokinetic Study of CTGF Antisense
Oligonucleotide in Rabbits
Study Objective
[0263] The purpose of this pharmacokinetic study in rabbit is to
evaluate the diffusion and concentration of a CTGF antisense
oligonucleotide (SEQ ID NO:39, ISIS 412294) in rabbit skin at
different times subsequent to a single intra-dermal injection.
Study Design
[0264] On day 0 of the study all animals were dosed intra-dermally
(ID) with a single 100 .mu.L injection of CTGF antisense
oligonucleotide SEQ ID NO:39 at a concentration of 50 mg/mL (5 mg
total dose). The animals were dosed with the antisense
oligonucleotide in a site to the left of the spinal mid-line,
roughly parallel to the rabbit's shoulders and adjacent to a suture
3 cm incisional wound (FIG. 1A). The needle was inserted so that
the test material was injected down towards the base of the
animal's body. On days 1, 3, 7 or 14, the rabbits were euthanized
and two full-thickness 1.0 cm punch biopsies were obtained, one
centered over the original injection site and the other vertically
below spaced 0.5 cm apart. The samples were snap frozen and stored
at -80.degree. C. prior to analysis of the antisense
oligonucleotide drug levels using a hybridization capture method.
Results represent the mean antisense oligonucleotide levels from
both biopsies at the indicated time.
Results and Conclusions
[0265] Significant levels of the antisense oligonucleotide are
present up to 14 days after intradermal dosing (see FIG. 1B). The
antisense oligonucleotide also remains close to the original site
of injection (<1 cm), with very limited lateral diffusion distal
to the site of administration (FIG. 1B). For example, levels of ASO
are very low at distances 1.5 cm distal to the injection site at
all times post injection. Therefore the pharmacological effects of
this class of molecule will be limited to areas of skin immediately
adjacent to the injection site. To overcome this limitation, an
intradermal injection threading technique has been developed (and
used in clinical studies) which delivers equal amounts of antisense
along the full length of the developing scar. These results
demonstrate two novel findings. First, that there is a prolonged
residence time of a 2'MOE antisense oligonucleotide with this
chemical configuration in skin; and second, antisense
oligonucleotides have very limited lateral diffusion in skin. The
latter limitation of this class of molecule can be overcome by
dosing the antisense oligonucleotide by a threading technique as
described previously.
Example 3
Animal Study with CTGF Antisense Oligonucleotide Targeting Human
Keloids in an In Vivo Model System
Study Objective
[0266] The purpose of this study was to evaluate the efficacy of
antisense oligonucleotides targeting human CTGF in an in vivo model
system using a human keloid/mouse xenograft model. The
oligonucleotide tested was antisense oligonucleotide No. 412300
(SEQ ID NO: 45).
Methods
Human Keloid/Mouse Xenograft Model.
[0267] A human keloid/mouse xenograft model using transplanted
human keloid tissue into nude mice was used.
[0268] Fresh specimens of keloid tissue were obtained anonymously,
from discarded tissue of patients undergoing elective excision of
keloids for cosmetic reasons. The keloid samples were processed
into 10.times.5.times.5 mm samples and weighed on an analytical
balance. The keloid samples were then implanted into the mice as
described below.
[0269] Mice were anaesthetized using 3% isoflurane. Buprenorphine
was given before surgery and post-operatively, as needed
(Buprenorphine at 0.3 mg/ml; 2 mg/kg; SC).
[0270] After achieving general anesthesia and prepping the animal,
two 10 mm incisions were made in the skin, over the left and right
scapula, and a pouch created using fine-tipped scissors, between
subcutaneous fat and the fascia. One keloid sample was inserted
into each pouch. The incisions were closed with veterinary grade
cyanoacrylate glue (VetBond or Nexaband) and the area swabbed with
70% ethanol. The area was then dressed with sterile semi-permeable
membranes (OpSite.TM., Smith and Nephew).
Evaluation of ASOs In Vivo Against Keloids
[0271] An ASO targeting human (and not mouse) CTGF was used
(antisense oligonucleotide No. 412300; SEQ ID NO: 45). To test the
efficacy of the ASO in the in vivo model system described above,
keloid implants were injected with either ASO (dissolved in PBS) or
PBS control. There were two groups of animals with 8 animals per
group (with two keloids/animal). Animals were allowed to acclimate
for approximately 2 weeks post keloids implantation prior to ASO
dosing.
[0272] A total dose of 500 .mu.g of oligo per keloid sample was
administered in a total volume of 100 .mu.l (from a stock solution
of 5.0 mg/ml). The ASO or PBS control was administered immediately
adjacent to each implant for a total of 4 weeks, twice a week. One
week after the last injection, one implant was removed and
subjected to qRT-PCR for gene expression analysis, and the
contralateral keloid removed and analyzed histology for the
collagen content using integrated density of fluorescence
(IDF).
[0273] Total RNA was isolated and either CTGF or collagen, type
III, alpha 1 (Col3A1) mRNA determined by quantitative real-time PCR
using primer pairs that have been shown to be specific for human
mRNA sequences. The mRNA levels were correlated with the GAPDH
levels in the same samples, and any changes in the ASO-treated
samples over the control treated by PBS alone were calculated.
Results
[0274] Results following 4 weeks of treatment with 500 .mu.g of
antisense oligonucleotide No. 412300 (SEQ ID NO: 45) in a total
volume of 100 .mu.l per keloid sample indicates reduction in CTGF
and Col3A1 mRNA expression in individual keloid samples. Treatment
with the CTGF ASO reduced CTGF mRNA expression in the keloid tissue
to 67% control (p=0.082) (FIG. 2A). Treatment with the CTGF ASO
reduced Col3a1 mRNA expression in the keloid tissue to 45% control
(p=0.153) (FIG. 2B).
Conclusion
[0275] Keloids are characterized by abnormal proliferation of
fibroblasts and overproduction of different forms of collagen.
Histo-pathologically, they are characterized by the presence of
whorls and nodules of thick, hyalinized collagen bundles or
keloidal collagen with mucinous ground substance and relatively few
fibroblasts in the dermis of keloid scars. The large thick collagen
bundles and numerous thin fibrils are closely packed together. Type
III collagen is the second most abundant collagen found in the
skin, and is very abundant in keloids. Col3A1 is significantly
elevated in keloids compared to normal skin.
[0276] It has been demonstrated here for the first time, the
ability of 2'MOE chemically modified ASOs to reduce CTGF in intact,
human keloid tissue. Treatment of the human keloid tissues with an
ASO CTGF reduced the target CTGF mRNA expression by 33%. This has
also resulted in a reduction in Col3A1 expression of 55%. This
reduction in Col3A1 expression would lead to a significant
therapeutic benefit in patients suffering from keloid growth, and
demonstrate the utility of a 2'MOE ASO as a novel drug for the
treatment of keloids.
Example 4
Breast Scar Revision Study in Humans
Study Objective
[0277] This is a randomized, double-blind, within-subject
controlled clinical study evaluating efficacy and safety of a CTGF
antisense oligonucleotides (EXC 001) in subjects undergoing
elective revision of scars resulting from prior breast surgery.
This study requires that the subjects to have pre-existing scars of
sufficient severity to warrant scar revision surgery. Thus, this
study pre-screen for subjects who could be expected to have a high
rate of hypertrophic scar or keloids formation in the revised
placebo-treated scars.
[0278] In patients who have had prior surgery of the breast and now
have bilateral matching scars at the same anatomic locations, EXC
001 (SEQ ID NO:39) or placebo was administered to the portion of
the revised breast scars via intradermal threading injections. The
primary objective of the study was to assess the efficacy of EXC
001 in reducing subsequent skin scarring. The secondary objective
of the study was to assess the safety of EXC 001.
Methods
[0279] A 6 cm section of either side of the revised breast
wound/scar was treated with 4 doses of EXC 001 or placebo, at 2, 5,
8, and 11 weeks after the surgical incision was closed.
Randomization determined which side was treated with EXC 001 or
placebo in each subject.
[0280] Dosage of EXC 001 used was 5 mg per linear centimeter.
Concentration of EXC 001 used was 25 mg/ml and 100 .mu.l of EXC 001
was injected per linear centimeter of the revised breast
wound/scar. Injections were made on both sides of each incision,
with half of the amount per linear centimeter administered on each
side. The injections on a given side were 3 cm apart. In order to
deliver placebo or EXC 001 adjacent to and along the length of the
incision, intradermal needles (3 cm long) were used for injections.
The needle is inserted immediately adjacent to the surgical
incision on each side by a threading technique, and EXC 001 or
placebo is injected as needle is withdrawn, so that equal amounts
of antisense drug are administered along the length of the
scar.
[0281] The study duration was approximately 31 weeks. The subjects
receive the scar revisions on Day 1, followed by 4 doses of EXC 001
and placebo, at 2, 5, 8, and 11 weeks after the surgical incisions
were closed. Scar observation and assessment were performed at week
24.
[0282] Efficacy was determined by rating each matched pair of
incisions from individual patients (within subject analysis).
Efficacy was evaluated at week 24 following scar revision surgery,
using three methods of rating severity of incisional scars: [0283]
Subject assessment of their scars. On a scale of 1-10 the patient
rated their "overall" opinion on the appearance of the scar. [0284]
Physician (investigator) assessment of the scars. On a scale of
1-10 the physician rated overall opinion of scar appearance. [0285]
Expert Panel assessment of pairs of blinded scar photographs, using
a 100 mm Visual Analog Scale (VAS), where 0=best possible scar and
100=worst possible scar. This method gives information on the
absolute severity of the scars as well as the differences between
the two scars in the pair.
Results
[0286] 21 subjects completed this study. Examination of the week 24
post-surgery photographs indicate that nearly all of the subjects
show recurrence of hypertrophic scars on at least one side
following scar revision surgery. In some cases, the scars extend
beyond the boundaries of the original incisions and are therefore
keloidal scars.
[0287] This study achieved statistically significant results in
favor of EXC 001 in all three endpoints (a negative score
represents the difference between placebo and EXC 001 treated, in
favor of EXC 001--see Table 2 below). [0288] The subject assessment
of their scars: [0289] The "overall" rating was statistically
significant in favor of EXC 001 (p=0.033). [0290] The physician
assessment of the scars: [0291] The "overall" rating was highly
statistically significant in favor of EXC 001 (p<0.001). [0292]
Expert panel VAS rating of photographs was also highly
statistically significant in favor of EXC 001 (p<0.001).
TABLE-US-00002 [0292] TABLE 2 Difference between placebo Scar
Assessment Scale and EXC 001 p-value Subject Overall -2.4 0.003
Physician Overall -2.3 <0.001 Expert VAS -26.0 <0.001
[0293] FIG. 3A shows that treatment with the CTGF antisense
oligonucleotide, (EXC 001 or SEQ ID NO: 39), inhibits formation and
growth of a hypertrophic scar at 24 weeks post surgery. FIG. 3B
shows results from a different subject, also at 24 weeks. In this
second example, the patient has developed a keloid at 24 weeks post
revision surgery in the placebo treated scar. In contrast, the
formation and growth of a keloid scar at the adjacent scar revision
site was almost completely prevented by treatment with EXC 001.
[0294] Therefore, in these two examples, the growth of both
hypertrophic scars and keloid scars are inhibited by treatment with
EXC 001. The scores below each set of pictures represent the degree
of improvement between placebo- and EXC 001-treated scars. For
example, an expert VAS score of -19.3 indicates that the placebo
scar is worse than the corresponding EXC 001-treated scar by 19.3
on a 100 point scale. The physician and subject scores of -1 means
that the placebo-treated scar is worse than the corresponding EXC
001-treated scar by 1 point on a 10 point scale. The result
demonstrates that EXC 001 reduces the severity of both hypertrophic
scars and keloid scars.
Example 5
Primary Prevention Abdominoplasty Study in Humana
Study Objective
[0295] This is a randomized, double-blind, within-subject
controlled clinical study evaluating efficacy and safety of a CTGF
antisense oligonucleotides (EXC 001) in subjects undergoing
elective abdominoplast surgery.
Method
[0296] Study duration was 24 weeks. Subjects received the
abdominoplasty on day 1, followed by treatment with either EXC 001
or placebo over a 9 week period.
[0297] Dosage of EXC 001 used was 5 mg per linear centimeter.
Concentration of EXC 001 used was 25 mg/ml and 100 ul of EXC 001
was injected per linear centimeter of the abdominoplasty
wound/scar. Injections were made on both sides of each incision,
with half of the amount per linear centimeter administered on each
side. Either drug or placebo was dosed along two 6 cm portions of
the scar at each lateral end of the scar, and so the dosed sections
are separated by at least 10 cm untreated scar. The injections on a
given side were 3 cm apart. In order to deliver placebo or EXC 001
adjacent to and along the length of the incision, intradermal
needles (3 cm long) were used for injections. The needle is
inserted immediately adjacent to the surgical incision on each side
using a threading technique, and EXC 001 or placebo is injected as
needle is withdrawn.
[0298] The subjects receive the scar revisions on Day 1, followed
by 4 doses of EXC 001 and placebo, at 2, 5, 8, and 11 weeks after
the surgical incisions were closed. Scar observation and assessment
were performed at week 12.
[0299] Efficacy is determined by rating each matched portion of the
dosed incision (placebo treated compared to EXC 001 treated) using
the three methods of rating scar severity of incisional scars as
described in the previous example.
Results
[0300] EXC 001 is efficacious by these criteria at week 12. An
example of the efficacy is shown in FIG. 4. In this example, the
reduction in scar severity resulting from EXC 001 dosing compared
to placebo dosing is clearly seen. The placebo treated section of
the incision has developed into a hypertrophic scar whereas the EXC
001 treated section of the scar is more fine-line.
[0301] Another example of the ability of EXC 001 to reduce the
formation of hypertrophic scars is shown in FIG. 5. In this
example, the section of the abdominoplasty on the right side of the
scar (to the right of the vertical line) was treated with EXC 001
whereas the scar to the left of the vertical line did not receive
any treatment. Clearly the scar severity to the right is less
severe than to the left.
[0302] This example also demonstrates that the EXC 001 therapeutic
benefit is limited to the region of scar directly adjacent to the
site of drug intradermal threading dosing. Therefore the drug
appears to have limited diffusion away from the sire of
administration and will require dosing immediately adjacent to the
scar, for example by intradermal threading.
Example 6
Biomarker Study Demonstrating Effect of EEC 001 on mRNA Expression
of Various Genes in Humans
Method
[0303] 13 weeks prior to an abdominoplasty procedure, an area
between the umbilicus and the suprapubic hairline was used as a
site to create a total of twenty 2 cm incisions. The 2 cm long
incisions were in four columns of four incisions (A, B, C, D) and
were used for RNA analysis at week 13 post-incisions. Two
additional incisions lateral to these columns on each side of the
abdomen (a, b, and c, d) were used for 4 or 8 weeks post-incisions
mRNA analysis. Each column was separated by at least 4 cm and each
incision separated by at least 3 cm.
[0304] Treatments of incisional wounds with either EXC 001 or
placebo were randomly assigned to two treatment groups. All four
incisional wounds in each of the columns A, B, C, and D received
the same EXC 001 or placebo dose. All the incisional wounds/scars
on one side of the abdomen received injections of EXC 001 and the
other side received injections of placebo. All injections were
blinded to the individual receiving the test agents. All
incisions/scars in a given subject were treated on the same dosage
schedule.
[0305] Thirty subjects were randomly assigned to one of three
cohorts of 10 subjects each; each cohort was treated on a different
dosage schedule (but the high and low doses were the same for all
cohorts):
Cohort #1: Intradermal injections at weeks 2, 4, 6, 8, and 10
Cohort #2: Intradermal injections at weeks 2, 5, 8, and 11 Cohort
#3: Intradermal injections at weeks 2, 6, and 10
[0306] A 27 gauge needle, approximately 38 mm long, was inserted
intradermally 2 cm (the entire length of each incision), parallel
to and approximately 3 mm from the incisional wound/scar
(intradermal threading technique). Either EXC 001 or placebo was
then injected while gradually withdrawing the needle so that the
correct amount per linear centimeter was evenly deposited into the
dermis along the incision line.
Biopsy of Incisions
[0307] One 6 mm punch biopsy on each side adjacent to the lateral
incisions were taken at day 1 for mRNA analysis and used as control
for unwounded skin samples. At week 4, the 9 patients in cohort 1,
and at week 8, the 20 patients in cohorts 2 and 3 were biopsied
from their lateral incisions (a, b, c, d). Two of these incisions
received EXC 001, and two received placebo through randomized
assignment. Just prior to the abdominoplasty surgery (at week 13),
each of the scars in columns A, B, C, and D were scored for scar
severity (by Physician and Expert Panel Scales, see Example 5
above), and also sampled for both histological and RNA
analysis.
Results
[0308] There was a statistically significant improvement observed
for EXC 001 treated vs placebo treated scars for the Physician
Overall Opinion when all cohorts were combined at the high dose
level (8.7%, p-value=0.018). There was also a statistically
significant mean difference observed for the Overall evaluation of
all cohorts combined and all doses combined (5.9%, p-value=0.016).
These results again demonstrate the ability of EXC 001 to reduce
scar severity.
[0309] An example of the ability of EXC 001 to reduce the growth
and formation of hypertrophic scars is shown in FIG. 6. In this
example, two matching scars are shown, one treated with 5 mg/cm EXC
001 and one with placebo. The severity of the EXC 001 treated scar
is less than the placebo treated scar.
[0310] Histological analysis of these two scars also revealed an
EXC 001 mediated reduction in the expression of CTGF protein (by
immunohistochemistry) clearly demonstrating that EXC 001 is
functioning to reduce the expression of its intended target (CTGF).
Analysis of expression of 9 different mRNA transcripts was also
performed at 4, 8, and 13 weeks post wounding (Table 3)
TABLE-US-00003 TABLE 3 mRNA transcripts analyzed by XP-PCR
Identifier Gene Measured (Accession) Collagen1-a1 (COL1A1)
NM_000088 Collagen1-a2 (COL1A2) NM_000089 Collagen III-a1 (COL3A1)
NM_000090 Connective Tissue Growth Factor (CTGF) NM_001901
Transforming Growth factor-beta1 (TGF-.beta.1) NM_000660 Mothers
Against Decapentaplegic Homolog 3 (SMAD3) NM_005902 Elastin M_36860
Matrix metalloproteinase 1 (MMP-1) NM_002421 .alpha.-smooth muscle
actin (.alpha.-SMA/ACTA2) NM_001613
[0311] Following post-surgical wounding, increased mRNA expression
of CTGF and collagen genes were anticipated. CTGF mRNA expression
in the scars was increased from baseline unwounded skin at all
three times points, and in all three cohorts (approximately 2-5
fold). Increased expression of a variety of genes known to be
associated with scarring, including the collagen genes, such as
Col1A2 (5-8 fold) and Col3A1 (3-7 fold), was also observed, as
would be expected in developing scar tissues.
[0312] When compared to the corresponding placebo treated scar at
all three time-points measured, suppression of CTGF mRNA induction
was observed following EXC 001 injections. As shown in FIG. 7A, at
week 13, the overall (across all 3 cohorts) EXC 001 mediated
reduction in CTGF mRNA induction was 53%. The degree of CTGF mRNA
suppression also varied with time and cohort dosing. For example,
in one cohort a single dose of 5 mg/cm reduced the induction in
expression of CTGF by 74% (p=0.011) to an induction of only 140%
expression compared to unwounded skin (measurement taken two weeks
after the last dose of EXC 001) (FIG. 7D). In addition, the overall
induced mRNA expression levels of Col1A2, Col3A1 (FIG. 7B), and
elastin fibers (ELASF) (FIG. 7C) were also significantly decreased
(by 40% (p=0.0013), 69% (p<0.0001), and 63% (p=0.0004),
respectively) by EXC 001 treatment, when measured at week 13
(across all three cohorts).
[0313] Complete inhibition of collagen gene expression would likely
not be a desirable outcome of drug treatment, as some collagen gene
expression is required to facilitate normal wound repair and
healing processes. As shown in FIGS. 70 and 7E, there was no
significant inhibition of either SMAD3 or TGF.beta.1 mRNA
expression by EXC 001 treatment compared to placebo at weeks 4 or
13.
[0314] These data demonstrate a mechanism of action for EXC 001 in
human. These data also demonstrate a mechanism by which EXC 001 is
able to reduce the severity of skin scarring.
Sequence CWU 1
1
167120DNAArtificial SequencePositive control oligonucleotide
directed to human H-ras 1tccgtcatcg ctcctcaggg 2022075DNAHomo
sapiensexon(130)..(1180) 2cccggccgac agccccgaga cgacagcccg
gcgcgtcccg gtccccacct ccgaccaccg 60ccagcgctcc aggccccgcg ctccccgctc
gccgccaccg cgccctccgc tccgcccgca 120gtgccaacc atg acc gcc gcc agt
atg ggc ccc gtc cgc gtc gcc ttc gtg 171 Met Thr Ala Ala Ser Met Gly
Pro Val Arg Val Ala Phe Val 1 5 10 gtc ctc ctc gcc ctc tgc agc cgg
ccg gcc gtc ggc cag aac tgc agc 219Val Leu Leu Ala Leu Cys Ser Arg
Pro Ala Val Gly Gln Asn Cys Ser 15 20 25 30 ggg ccg tgc cgg tgc ccg
gac gag ccg gcg ccg cgc tgc ccg gcg ggc 267Gly Pro Cys Arg Cys Pro
Asp Glu Pro Ala Pro Arg Cys Pro Ala Gly 35 40 45 gtg agc ctc gtg
ctg gac ggc tgc ggc tgc tgc cgc gtc tgc gcc aag 315Val Ser Leu Val
Leu Asp Gly Cys Gly Cys Cys Arg Val Cys Ala Lys 50 55 60 cag ctg
ggc gag ctg tgc acc gag cgc gac ccc tgc gac ccg cac aag 363Gln Leu
Gly Glu Leu Cys Thr Glu Arg Asp Pro Cys Asp Pro His Lys 65 70 75
ggc ctc ttc tgt gac ttc ggc tcc ccg gcc aac cgc aag atc ggc gtg
411Gly Leu Phe Cys Asp Phe Gly Ser Pro Ala Asn Arg Lys Ile Gly Val
80 85 90 tgc acc gcc aaa gat ggt gct ccc tgc atc ttc ggt ggt acg
gtg tac 459Cys Thr Ala Lys Asp Gly Ala Pro Cys Ile Phe Gly Gly Thr
Val Tyr 95 100 105 110 cgc agc gga gag tcc ttc cag agc agc tgc aag
tac cag tgc acg tgc 507Arg Ser Gly Glu Ser Phe Gln Ser Ser Cys Lys
Tyr Gln Cys Thr Cys 115 120 125 ctg gac ggg gcg gtg ggc tgc atg ccc
ctg tgc agc atg gac gtt cgt 555Leu Asp Gly Ala Val Gly Cys Met Pro
Leu Cys Ser Met Asp Val Arg 130 135 140 ctg ccc agc cct gac tgc ccc
ttc ccg agg agg gtc aag ctg ccc ggg 603Leu Pro Ser Pro Asp Cys Pro
Phe Pro Arg Arg Val Lys Leu Pro Gly 145 150 155 aaa tgc tgc gag gag
tgg gtg tgt gac gag ccc aag gac caa acc gtg 651Lys Cys Cys Glu Glu
Trp Val Cys Asp Glu Pro Lys Asp Gln Thr Val 160 165 170 gtt ggg cct
gcc ctc gcg gct tac cga ctg gaa gac acg ttt ggc cca 699Val Gly Pro
Ala Leu Ala Ala Tyr Arg Leu Glu Asp Thr Phe Gly Pro 175 180 185 190
gac cca act atg att aga gcc aac tgc ctg gtc cag acc aca gag tgg
747Asp Pro Thr Met Ile Arg Ala Asn Cys Leu Val Gln Thr Thr Glu Trp
195 200 205 agc gcc tgt tcc aag acc tgt ggg atg ggc atc tcc acc cgg
gtt acc 795Ser Ala Cys Ser Lys Thr Cys Gly Met Gly Ile Ser Thr Arg
Val Thr 210 215 220 aat gac aac gcc tcc tgc agg cta gag aag cag agc
cgc ctg tgc atg 843Asn Asp Asn Ala Ser Cys Arg Leu Glu Lys Gln Ser
Arg Leu Cys Met 225 230 235 gtc agg cct tgc gaa gct gac ctg gaa gag
aac att aag aag ggc aaa 891Val Arg Pro Cys Glu Ala Asp Leu Glu Glu
Asn Ile Lys Lys Gly Lys 240 245 250 aag tgc atc cgt act ccc aaa atc
tcc aag cct atc aag ttt gag ctt 939Lys Cys Ile Arg Thr Pro Lys Ile
Ser Lys Pro Ile Lys Phe Glu Leu 255 260 265 270 tct ggc tgc acc agc
atg aag aca tac cga gct aaa ttc tgt gga gta 987Ser Gly Cys Thr Ser
Met Lys Thr Tyr Arg Ala Lys Phe Cys Gly Val 275 280 285 tgt acc gac
ggc cga tgc tgc acc ccc cac aga acc acc acc ctg ccg 1035Cys Thr Asp
Gly Arg Cys Cys Thr Pro His Arg Thr Thr Thr Leu Pro 290 295 300 gtg
gag ttc aag tgc cct gac ggc gag gtc atg aag aag aac atg atg 1083Val
Glu Phe Lys Cys Pro Asp Gly Glu Val Met Lys Lys Asn Met Met 305 310
315 ttc atc aag acc tgt gcc tgc cat tac aac tgt ccc gga gac aat gac
1131Phe Ile Lys Thr Cys Ala Cys His Tyr Asn Cys Pro Gly Asp Asn Asp
320 325 330 atc ttt gaa tcg ctg tac tac agg aag atg tac gga gac atg
gca tga a 1180Ile Phe Glu Ser Leu Tyr Tyr Arg Lys Met Tyr Gly Asp
Met Ala 335 340 345 gccagagagt gagagacatt aactcattag actggaactt
gaactgattc acatctcatt 1240tttccgtaaa aatgatttca gtagcacaag
ttatttaaat ctgtttttct aactggggga 1300aaagattccc acccaattca
aaacattgtg ccatgtcaaa caaatagtct atcttcccca 1360gacactggtt
tgaagaatgt taagacttga cagtggaact acattagtac acagcaccag
1420aatgtatatt aaggtgtggc tttaggagca gtgggagggt accggcccgg
ttagtatcat 1480cagatcgact cttatacgag taatatgcct gctatttgaa
gtgtaattga gaaggaaaat 1540tttagcgtgc tcactgacct gcctgtagcc
ccagtgacag ctaggatgtg cattctccag 1600ccatcaagag actgagtcaa
gttgttcctt aagtcagaac agcagactca gctctgacat 1660tctgattcga
atgacactgt tcaggaatcg gaatcctgtc gattagactg gacagcttgt
1720ggcaagtgaa tttgcctgta acaagccaga ttttttaaaa tttatattgt
aaatattgtg 1780tgtgtgtgtg tgtgtgtata tatatatata tatgtacagt
tatctaagtt aatttaaagt 1840tgtttgtgcc tttttatttt tgtttttaat
gctttgatat ttcaatgtta gcctcaattt 1900ctgaacacca taggtagaat
gtaaagcttg tctgatcgtt caaagcatga aatggatact 1960tatatggaaa
ttctgctcag atagaatgac agtccgtcaa aacagattgt ttgcaaaggg
2020gaggcatcag tgtcttggca ggctgatttc taggtaggaa atgtggtagc tcacg
2075322DNAArtificial SequenceForward PCR primer directed to human
connective tissue growth factor (CTGF) 3acaagggcct cttctgtgac tt
22422DNAArtificial SequenceReverse PCR primer directed to human
connective tissue growth factor (CTGF) 4ggtacaccgt accaccgaag at
22523DNAArtificial SequencePCR probe directed to human connective
tissue growth factor (CTGF) 5tgtgcaccgc caaagatggt gct
23619DNAArtificial SequenceForward PCR primer directed to human
GAPDH 6gaaggtgaag gtcggagtc 19720DNAArtificial SequenceReverse PCR
primer directed to human GAPDH 7gaagatggtg atgggatttc
20820DNAArtificial SequencePCR probe directed to human GAPDH
8caagcttccc gttctcagcc 2092358DNAHomo sapiensexon(207)..(1256)
9aaactcacac aacaactctt ccccgctgag aggagacagc cagtgcgact ccaccctcca
60gctcgacggc agccgccccg gccgacagcc ccgagacgac agcccggcgc gtcccggtcc
120ccacctccga ccaccgccag cgctccaggc cccgccgctc cccgctcgcc
gccaccgcgc 180cctccgctcc gcccgcagtg ccaacc atg acc gcc gcc agt atg
ggc ccc gtc 233 Met Thr Ala Ala Ser Met Gly Pro Val 1 5 cgc gtc gcc
ttc gtg gtc ctc ctc gcc ctc tgc agc cgg ccg gcc gtc 281Arg Val Ala
Phe Val Val Leu Leu Ala Leu Cys Ser Arg Pro Ala Val 10 15 20 25 ggc
cag aac tgc agc ggg ccg tgc cgg tgc ccg gac gag ccg gcg ccg 329Gly
Gln Asn Cys Ser Gly Pro Cys Arg Cys Pro Asp Glu Pro Ala Pro 30 35
40 cgc tgc ccg gcg ggc gtg agc ctc gtg ctg gac ggc tgc ggc tgc tgc
377Arg Cys Pro Ala Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys
45 50 55 cgc gtc tgc gcc aag cag ctg ggc gag ctg tgc acc gag cgc
gac ccc 425Arg Val Cys Ala Lys Gln Leu Gly Glu Leu Cys Thr Glu Arg
Asp Pro 60 65 70 tgc gac ccg cac aag ggc ctc ttc tgt gac ttc ggc
tcc ccg gcc aac 473Cys Asp Pro His Lys Gly Leu Phe Cys Asp Phe Gly
Ser Pro Ala Asn 75 80 85 cgc aag atc ggc gtg tgc acc gcc aaa gat
ggt gct ccc tgc atc ttc 521Arg Lys Ile Gly Val Cys Thr Ala Lys Asp
Gly Ala Pro Cys Ile Phe 90 95 100 105 ggt ggt acg gtg tac cgc agc
gga gag tcc ttc cag agc agc tgc aag 569Gly Gly Thr Val Tyr Arg Ser
Gly Glu Ser Phe Gln Ser Ser Cys Lys 110 115 120 tac cag tgc acg tgc
ctg gac ggg gcg gtg ggc tgc atg ccc ctg tgc 617Tyr Gln Cys Thr Cys
Leu Asp Gly Ala Val Gly Cys Met Pro Leu Cys 125 130 135 agc atg gac
gtt cgt ctg ccc agc cct gac tgc ccc ttc ccg agg agg 665Ser Met Asp
Val Arg Leu Pro Ser Pro Asp Cys Pro Phe Pro Arg Arg 140 145 150 gtc
aag ctg ccc ggg aaa tgc tgc gag gag tgg gtg tgt gac gag ccc 713Val
Lys Leu Pro Gly Lys Cys Cys Glu Glu Trp Val Cys Asp Glu Pro 155 160
165 aag gac caa acc gtg gtt ggg cct gcc ctc gcg gct tac cga ctg gaa
761Lys Asp Gln Thr Val Val Gly Pro Ala Leu Ala Ala Tyr Arg Leu Glu
170 175 180 185 gac acg ttt ggc cca gac cca act atg att aga gcc aac
tgc ctg gtc 809Asp Thr Phe Gly Pro Asp Pro Thr Met Ile Arg Ala Asn
Cys Leu Val 190 195 200 cag acc aca gag tgg agc gcc tgt tcc aag acc
tgt ggg atg ggc atc 857Gln Thr Thr Glu Trp Ser Ala Cys Ser Lys Thr
Cys Gly Met Gly Ile 205 210 215 tcc acc cgg gtt acc aat gac aac gcc
tcc tgc agg cta gag aag cag 905Ser Thr Arg Val Thr Asn Asp Asn Ala
Ser Cys Arg Leu Glu Lys Gln 220 225 230 agc cgc ctg tgc atg gtc agg
cct tgc gaa gct gac ctg gaa gag aac 953Ser Arg Leu Cys Met Val Arg
Pro Cys Glu Ala Asp Leu Glu Glu Asn 235 240 245 att aag aag ggc aaa
aag tgc atc cgt act ccc aaa atc tcc aag cct 1001Ile Lys Lys Gly Lys
Lys Cys Ile Arg Thr Pro Lys Ile Ser Lys Pro 250 255 260 265 atc aag
ttt gag ctt tct ggc tgc acc agc atg aag aca tac cga gct 1049Ile Lys
Phe Glu Leu Ser Gly Cys Thr Ser Met Lys Thr Tyr Arg Ala 270 275 280
aaa ttc tgt gga gta tgt acc gac ggc cga tgc tgc acc ccc cac aga
1097Lys Phe Cys Gly Val Cys Thr Asp Gly Arg Cys Cys Thr Pro His Arg
285 290 295 acc acc acc ctg ccg gtg gag ttc aag tgc cct gac ggc gag
gtc atg 1145Thr Thr Thr Leu Pro Val Glu Phe Lys Cys Pro Asp Gly Glu
Val Met 300 305 310 aag aag aac atg atg ttc atc aag acc tgt gcc tgc
cat tac aac tgt 1193Lys Lys Asn Met Met Phe Ile Lys Thr Cys Ala Cys
His Tyr Asn Cys 315 320 325 ccc gga gac aat gac atc ttt gaa tcg ctg
tac tac agg aag atg tac 1241Pro Gly Asp Asn Asp Ile Phe Glu Ser Leu
Tyr Tyr Arg Lys Met Tyr 330 335 340 345 gga gac atg gca tga
agccagagag tgagagacat taactcatta gactggaact 1296Gly Asp Met Ala
tgaactgatt cacatctcat ttttccgtaa aaatgatttc agtagcacaa gttatttaaa
1356tctgtttttc taactggggg aaaagattcc cacccaattc aaaacattgt
gccatgtcaa 1416acaaatagtc tatcaacccc agacactggt ttgaagaatg
ttaagacttg acagtggaac 1476tacattagta cacagcacca gaatgtatat
taaggtgtgg ctttaggagc agtgggaggg 1536taccagcaga aaggttagta
tcatcagata gcatcttata cgagtaatat gcctgctatt 1596tgaagtgtaa
ttgagaagga aaattttagc gtgctcactg acctgcctgt agccccagtg
1656acagctagga tgtgcattct ccagccatca agagactgag tcaagttgtt
ccttaagtca 1716gaacagcaga ctcagctctg acattctgat tcgaatgaca
ctgttcagga atcggaatcc 1776tgtcgattag actggacagc ttgtggcaag
tgaatttgcc tgtaacaagc cagatttttt 1836aaaatttata ttgtaaatat
tgtgtgtgtg tgtgtgtgtg tatatatata tatatgtaca 1896gttatctaag
ttaatttaaa gttgtttgtg cctttttatt tttgttttta atgctttgat
1956atttcaatgt tagcctcaat ttctgaacac cataggtaga atgtaaagct
tgtctgatcg 2016ttcaaagcat gaaatggata cttatatgga aattctgctc
agatagaatg acagtccgtc 2076aaaacagatt gtttgcaaag gggaggcatc
agtgtccttg gcaggctgat ttctaggtag 2136gaaatgtggt agcctcactt
ttaatgaaca aatggccttt attaaaaact gagtgactct 2196atatagctga
tcagtttttt cacctggaag catttgtttc tactttgata tgactgtttt
2256tcggacagtt tatttgttga gagtgtgacc aaaagttaca tgtttgcacc
tttctagttg 2316aaaataaagt gtatattttt tctataaaaa aaaaaaaaaa aa
2358106001DNAHomo sapiens 10tatattattc actgtcaatc ttagtttata
tccagataca acagggtaca ctgctcttgt 60aatggaatca gacttcttat tttaacaaga
caaaccaaat ccaatccaca tttgaagatt 120ataggtttta atataagaaa
atgcactcat ttctcaaaga ccctagtgaa gctgtgttta 180aatgctccta
ggtgaacccc ctttgcatcc cagtgttccc accctgacac ccagagcccc
240tacctaccca acacagaatc atttgctctg atagaacaat ggatcccttt
ttctggaaac 300attgatggcc actcctccct tgtccttgcc tatataaaac
tcctacatat attaagagaa 360aactaagcaa gagttttgga aatctgcccc
aggagactgc atcctgagtc acacgcgtct 420ttgttctctt tcttgtccca
aaaccgttac ctcaagtgac aaatgatcaa atctcaaata 480tagaattcag
ggttttacag gtaggcatct tgaggatttc aaatggttaa aagcaactca
540ctccttttct actctttgga gagtttcaag agcctatagc ctctaaaacg
caaatcattg 600ctaagggttg ggggggagaa accttttcga attttttagg
aattcctgct gtttgcctct 660tcagctacct acttcctaaa aaggatgtat
gtcagtggac agaacagggc aaacttattc 720gaaaaagaaa taagaaataa
ttgccagtgt gtttataaat gatatgaatc aggagtggtg 780cgaagaggat
agggaaaaaa aaattctatt tggtgctgga aatactgcgc tttttttttt
840cctttttttt tttttctgtg agctggagtg tgccagcttt ttcagacgga
ggaatgctga 900gtgtcaaggg gtcaggatca atccggtgtg agttgatgag
gcaggaaggt ggggaggaat 960gcgaggaatg tccctgtttg tgtaggactc
cattcagctc attggcgagc cgcggccgcc 1020cggagcgtat aaaagcctcg
ggccgcccgc cccaaactca cacaacaact cttccccgct 1080gagaggagac
agccagtgcg actccaccct ccagctcgac ggcagccgcc ccggccgaca
1140gccccgagac gacagcccgg cgcgtcccgg tccccacctc cgaccaccgc
cagcgctcca 1200ggccccgccg ctccccgctc gccgccaccg cgccctccgc
tccgcccgca gtgccaacca 1260tgaccgccgc cagtatgggc cccgtccgcg
tcgccttcgt ggtcctcctc gccctctgca 1320gccgggtaag cgccgggagc
ccccgctgcg gccggcggct gccagggagg gactcggggc 1380cggccgggga
gggcgtgcgc gccgaccgag cgccgctgac cgccctgtcc tccctgcagc
1440cggccgtcgg ccagaactgc agcgggccgt gccggtgccc ggacgagccg
gcgccgcgct 1500gcccggcggg cgtgagcctc gtgctggacg gctgcggctg
ctgccgcgtc tgcgccaagc 1560agctgggcga gctgtgcacc gagcgcgacc
catgcgaccc gcacaagggc ctattctgtc 1620acttcggctc cccggccaac
cgcaagatcg gcgtgtgcac cggtaagacc cgcagccccc 1680accgctaggt
gtccggccgc ctcctccctc acgcccaccc gcccgctgga aaaagaaacc
1740gctcggactg agtttctttc tccagctgct gccagcccgc cccctgcagc
ccagatccca 1800actcgcatcc ctgacgctct ggatgtgaga gtgccccaat
gcctgacctc tgcatccccc 1860acccctctct tcccttcctc ttctccagcc
aaagatggtg ctccctgcat cttcggtggt 1920acggtgtacc gcagcggaga
gtccttccag agcagctgca agtaccagtg cacgtgcctg 1980gacggggcgg
tgggctgcat gcccctgtgc agcatggacg ttcgtctgcc cagccctgac
2040tgccccttcc cgaggagggt caagctgccc gggaaatgct gcgaggagtg
ggtgtgtgac 2100gagcccaagg accaaaccgt ggttgggcct gccctcgcgg
gtgagtcgag tcttcctcta 2160agtcagggtc gtgattctct cccagggagg
gagtcctaac tgtgccgacc gaacggggga 2220aataccttat ccaggcgttt
tacatggtgt ttgtgtgctc tgctctcgca gcttaccgac 2280tggaagacac
gtttggccca gacccaacta tgattagagc caactgcctg gtccagacca
2340cagagtggag cgcctgttcc aagacctgtg ggatgggcat ctccacccgg
gttaccaatg 2400acaacgcctc ctgcaggcta gagaagcaga gccgcctgtg
catggtcagg ccttgcgaag 2460ctgacctgga agagaacatt aaggtacatg
ttctgctcct attaactatt tttcacagga 2520aaaacagtgg ataggaccca
acttagggct cttgccacgc ttgttagtat aagcccgtta 2580tctccaaaac
tatctaacca ttgagctgtt ttgctggaat gagagcttgt gtaatagcaa
2640ccaccagttt tccactacga aatcttccac agggttagtt aattcaagac
attccaagag 2700aggctctggc tatttttgga catagcaaat gagactcaaa
cttcctcccc tcaaaatata 2760aacagaagtc agacaacaga agactaaaac
acagagggtt gaagaaagcc actcctcttg 2820tagagtcgct gatttttttt
tttcctctct cttttccctt gtcttcctta gaagggcaaa 2880aagtgcatcc
gtactcccaa aatctccaag cctatcaagt ttgagctttc tggctgcacc
2940agcatgaaga cataccgagc taaattctgt ggagtatgta ccgacggccg
atgctgcacc 3000ccccacagaa ccaccaccct gccggtggag ttcaagtgcc
ctgacggcga ggtcatgaag 3060aagaacatga tgttcatcaa gacctgtgcc
tgccattaca actgtcccgg agacaatgac 3120atctttgaat cgctgtacta
caggaagatg tacggagaca tggcatgaag ccagagagtg 3180agagacatta
actcattaga ctggaacttg aactgattca catctcattt ttccgtaaaa
3240atgatttcag tagcacaagt tatttaaatc tgtttttcta actgggggaa
aagattccca 3300cccaattcaa aacattgtgc catgtcaaac aaatagtcta
tcaaccccag acactggttt 3360gaagaatgtt aagacttgac agtggaacta
cattagtaca cagcaccaga atgtatatta 3420aggtgtggct ttaggagcag
tgggagggta ccagcagaaa ggttagtatc atcagatagc 3480atcttatacg
agtaatatgc ctgctatttg aagtgtaatt gagaaggaaa attttagcgt
3540gctcactgac ctgcctgtag ccccagtgac agctaggatg tgcattctcc
agccatcaag 3600agactgagtc aagttgttcc ttaagtcaga acagcagact
cagctctgac attctgattc 3660gaatgacact gttcaggaat cggaatcctg
tcgattagac tggacagctt gtggcaagtg
3720aatttgcctg taacaagcca gattttttaa aatttatatt gtaaatattg
tgtgtgtgtg 3780tgtgtgtgta tatatatata tatgtacagt tatctaagtt
aatttaaagt tgtttgtgcc 3840tttttatttt tgtttttaat gctttgatat
ttcaatgtta gcctcaattt ctgaacacca 3900taggtagaat gtaaagcttg
tctgatcgtt caaagcatga aatggatact tatatggaaa 3960ttctgctcag
atagaatgac agtccgtcaa aacagattgt ttgcaaaggg gaggcatcag
4020tgtccttggc aggctgattt ctaggtagga aatgtggtag cctcactttt
aatgaacaaa 4080tggcctttat taaaaactga gtgactctat atagctgatc
agttttttca cctggaagca 4140tttgtttcta ctttgatatg actgtttttc
ggacagttta tttgttgaga gtgtgaccaa 4200aagttacatg tttgcacctt
tctagttgaa aataaagtgt atattttttc tataaagggc 4260ttggttattc
atttatcctt ctaaacattt ctgagttttc ttgagcataa ataggaagtt
4320cttattaatc ataagataat tcaccaataa ttttctaaat atctttaatt
attctataca 4380ttaataaatt gattattcca tagaattttt atgtaaacat
acttcacact gaatcaagta 4440tcacagactt gcaggcatac acaccacatt
gactatacag ccattttttt tgttatcttc 4500acagaacttt atagacactt
taaattcaat tctctctaga ttacttcagt ctccattaac 4560cctgttgtat
tacacttggt ccttttggca tttgtacctc tctggccgtt ataggttagt
4620ttccaaccct tcacatcaca aactagtcta tgtgccttgc acgtggaaaa
tgtttacatt 4680ttttaaaaat tttatgctct aggtctgttt ctgaacttca
ttaccttact gttaaatctg 4740aaaattatga aatgaaatcc tcatttaaat
ggagctattt cataagtctt gttttgtata 4800attccgtttt tggttgccat
gataaccaat gacaaacaga tggcataaat agaaaaggga 4860ggatgagcaa
atcttccatt cattaacatt aatagaaatt tgttttgaaa gtaattcctc
4920catttgccca agtctttagc tttatcagac ttccagatta atgcatccta
ccttaccaag 4980tggtttatac atgagaaaat ggaattgttc aagaagcctc
atgtggaaac aatattgtac 5040ctacccaggt aggtttttac taaagagtga
accaaagtga atggtaaaca aaagcaatac 5100accaaaggca actagaatct
tctccacatg aggatagctg aggattctag gggaaaaaaa 5160aattgcagac
agactaactt ttcccaaggt aattagcaac gttgtagtgc caatgtcatt
5220tggacagaca aaaatacacc tgaaaataaa gactagctct acaaacaact
gtccacacca 5280caaaccaaag ggaaaacttc ccgtgttcag aatgtgaaaa
tttatggtca aaactctggg 5340ctttaaggat acacccacat ctgtatatag
cagtgctgcc aggagcagca ccccacctcc 5400ccaaataaat gcgcatgtac
acatacacat aggcacacac acagagtaca ctgttagttc 5460acacttcctt
tctgtcaatt aattcctaac tgcaaagatg aagggccatg catgataaac
5520gagactgact actgaattag agcattctgg aaatatagaa gcagcaggaa
aagcatagat 5580ttcacatttt ccaaataccc acattaaaga aaaaaaaaag
agtcactaga ttgcaaaaca 5640aaaatcccac aggcaatgtt tctacaaaaa
ttagatggca atgcacactt tcacccccca 5700aatatcggag gtagggggtg
ccaaatcatc aaccaccgta agatctgcac cgtgtcagca 5760catgtgtgag
aaaagcagag aaacaacaag gtatctgatg cttctgagaa cacgagagct
5820ctcaaacagc cagcaggtag tcactagata tatagaaggc caggctgaca
gcagctgttg 5880aatctagtag gggtttggcc tagcactcca acaaagctta
caagccaggg ctgcctccca 5940ggagaagatc ctcatactcc tggaagtgga
atctaaattg agcaggtcac cagacagatg 6000t 60011120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 11ccagctgctt ggcgcagacg 201220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 12gccagaaagc tcaaacttga 201320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 13ccacaagctg tccagtctaa 201420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 14ggtcacactc tcaacaaata 201520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 15aaacatgtaa cttttggtca 201620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 16gggaagagtt gttgtgtgag 201720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 17agggtggagt cgcactggct 201820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 18acgaaggcga cgcggacggg 201920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 19gccgacggcc ggccggctgc 202020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 20ggtgcacacg ccgatcttgc 202120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 21tctttggcgg tgcacacgcc 202220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 22gcaccatctt tggcggtgca 202320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 23gcagggagca ccatctttgg 202420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 24aagatgcagg gagcaccatc 202520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 25ccaccgaaga tgcagggagc 202620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 26ccgtaccacc gaagatgcag 202720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 27gtacttgcag ctgctctgga 202820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 28gggcatgcag cccaccgccc 202920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 29aggcccaacc acggtttggt 203020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 30agggcaggcc caaccacggt 203120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 31taagccgcga gggcaggccc 203220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 32cccacaggtc ttggaacagg 203320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 33agatgcccat cccacaggtc 203420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 34ccagtctaat gagttaatgt 203520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 35ttcaagttcc agtctaatga 203620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 36ttttccccca gttagaaaaa 203720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 37cacaatgttt tgaattgggt 203820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 38acatggcaca atgttttgaa 203920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 39gtttgacatg gcacaatgtt 204020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 40tatttgtttg acatggcaca 204120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 41tgatagacta tttgtttgac 204220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 42gttccactgt caagtcttaa 204320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 43tgtactaatg tagttccact 204420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 44cattctggtg ctgtgtacta 204520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 45taatatacat tctggtgctg 204620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 46acaccttaat atacattctg 204720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 47taaagccaca ccttaatata 204820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 48gtaccctccc actgctccta 204920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 49aagatgctat ctgatgatac 205020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 50cgtataagat gctatctgat 205120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 51aatagcaggc atattactcg 205220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 52tacacttcaa atagcaggca 205320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 53tcaattacac ttcaaatagc 205420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 54ggagaatgca catcctagct 205520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 55atggctggag aatgcacatc 205620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 56tcttgatggc tggagaatgc 205720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 57gaatcagaat gtcagagctg 205820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 58cattgaaata tcaaagcatt 205920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 59ggctaacatt gaaatatcaa 206020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 60aattgaggct aacattgaaa 206120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 61gttcagaaat tgaggctaac 206220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 62tatggtgttc agaaattgag 206320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 63ctacctatgg tgttcagaaa 206420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 64tacattctac ctatggtgtt 206520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 65gacaagcttt acattctacc 206620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 66gatcagacaa gctttacatt 206720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 67atgctttgaa cgatcagaca 206820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 68atttcatgct ttgaacgatc 206920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 69gtatccattt catgctttga 207020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 70ccatataagt atccatttca 207120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 71gaatttccat ataagtatcc 207220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 72tctgagcaga atttccatat 207320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 73tgtcattcta tctgagcaga 207420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 74tttgacggac tgtcattcta 207520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 75aacaatctgt tttgacggac 207620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 76tgatgcctcc cctttgcaaa 207720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 77tgccaaggac actgatgcct 207820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 78cagcctgcca aggacactga 207920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 79gaaatcagcc tgccaaggac 208020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 80acctagaaat cagcctgcca 208120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 81ttcctaccta gaaatcagcc 208220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 82taccacattt cctacctaga 208320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 83tgaggctacc acatttccta 208420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 84taaaagtgag gctaccacat 208520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 85caaatgcttc caggtgaaaa 208620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 86tagaaacaaa tgcttccagg 208720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 87tcatatcaaa gtagaaacaa 208820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 88tccgaaaaac agtcatatca 208920DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 89acccggctgc agagggcgag 209020DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 90cgcttacccg gctgcagagg 209120DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 91gacagggcgg tcagcggcgc 209220DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 92agtccgagcg gtttcttttt 209320DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 93aactcagtcc gagcggtttc 209420DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 94aaagaaactc agtccgagcg 209520DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 95tggagaaaga aactcagtcc 209620DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 96gcagctggag aaagaaactc 209720DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 97tggcagcagc tggagaaaga 209820DNAArtificial
SequenceAntisense directed to human connective tissue growth factor
(CTGF) 98agggagcacc atctttggct 209920DNAArtificial
SequenceAntisense
directed to human connective tissue growth factor (CTGF)
99tcacccgcga gggcaggccc 2010020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
100ggaagactcg actcacccgc 2010120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
101ttagaggaag actcgactca 2010220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
102accctgactt agaggaagac 2010320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
103tcacgaccct gacttagagg 2010420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
104gagaatcacg accctgactt 2010520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
105tgggagagaa tcacgaccct 2010620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
106ctccctggga gagaatcacg 2010720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
107ggtcggcaca gttaggactc 2010820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
108cgttcggtcg gcacagttag 2010920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
109cctggataag gtatttcccc 2011020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
110acaaacacca tgtaaaacgc 2011120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
111gagcacacaa acaccatgta 2011220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
112tgcgagagca gagcacacaa 2011320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
113taagctgcga gagcagagca 2011420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
114gtcggtaagc tgcgagagca 2011520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
115ttccagtcgg taagctgcga 2011620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
116acatgtacct taatgttctc 2011720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
117gcagaacatg taccttaatg 2011820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
118taggagcaga acatgtacct 2011920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
119gttaatagga gcagaacatg 2012020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
120tgaaaaatag ttaataggag 2012120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
121ccactgtttt tcctgtgaaa 2012220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
122aagttgggtc ctatccactg 2012320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
123gccctaagtt gggtcctatc 2012420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
124caagagccct aagttgggtc 2012520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
125cgtggcaaga gccctaagtt 2012620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
126cgggcttata ctaacaagcg 2012720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
127gataacgggc ttatactaac 2012820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
128ttggagataa cgggcttata 2012920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
129tagttttgga gataacgggc 2013020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
130ttagatagtt ttggagataa 2013120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
131caatggttag atagttttgg 2013220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
132cagctcaatg gttagatagt 2013320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
133caaaacagct caatggttag 2013420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
134tccagcaaaa cagctcaatg 2013520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
135ctcattccag caaaacagct 2013620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
136aagctctcat tccagcaaaa 2013720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
137tacacaagct ctcattccag 2013820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
138ggttgctatt acacaagctc 2013920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
139ctggtggttg ctattacaca 2014020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
140gaaaactggt ggttgctatt 2014120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
141tagtggaaaa ctggtggttg 2014220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
142ttaactaacc ctgtggaaga 2014320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
143tgtcttgaat taactaaccc 2014420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
144tggaatgtct tgaattaact 2014520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
145gccagagcct ctcttggaat 2014620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
146aaaaatagcc agagcctctc 2014720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
147tgtccaaaaa tagccagagc 2014820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
148tgctatgtcc aaaaatagcc 2014920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
149tcatttgcta tgtccaaaaa 2015020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
150gagtctcatt tgctatgtcc 2015120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
151agtttgagtc tcatttgcta 2015220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
152gaggaagttt gagtctcatt 2015320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
153cttctgttgt ctgacttctg 2015420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
154cctctgtgtt ttagtcttct 2015520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
155tttcttcaac cctctgtgtt 2015620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
156ggagtggctt tcttcaaccc 2015720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
157aggaagacaa gggaaaagag 2015820DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
158ttctaaggaa gacaagggaa 2015920DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
159tgcccttcta aggaagacaa 2016020DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
160ggatgcgagt tgggatctgg 2016120DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
161ccagctgctt ggcgcagacg 2016220DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
162gccagaaagc tcaaacttga 2016320DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
163ccacaagctg tccagtctaa 2016420DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
164ggtcacactc tcaacaaata 2016520DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
165aaacatgtaa cttttggtca 2016620DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
166tgacatggca caatgttttg 2016720DNAArtificial SequenceAntisense
directed to human connective tissue growth factor (CTGF)
167ccttccctga aggttcctcc 20
* * * * *