U.S. patent application number 14/304387 was filed with the patent office on 2016-12-22 for method for the production of recombinant virus, dna constructs, recombinant virus and vaccine compositions.
The applicant listed for this patent is Myrna Cristina Bonaldo, Ricardo Galler. Invention is credited to Myrna Cristina Bonaldo, Ricardo Galler.
Application Number | 20160367656 14/304387 |
Document ID | / |
Family ID | 38006220 |
Filed Date | 2016-12-22 |
United States Patent
Application |
20160367656 |
Kind Code |
A9 |
Bonaldo; Myrna Cristina ; et
al. |
December 22, 2016 |
METHOD FOR THE PRODUCTION OF RECOMBINANT VIRUS, DNA CONSTRUCTS,
RECOMBINANT VIRUS AND VACCINE COMPOSITIONS
Abstract
The purpose of the present invention is the production of
recombinant virus through the cloning and expression of sequences
of coding nucleotides of the whole or part of heterolog proteins,
through the following method: (a) modification of the heterolog
nucleotides sequences in such way they when cloned and expressed in
the vector virus, the present in the 5' region nucleotides present
in the 5' edge of the gene NS1 of this vector virus or of other
virus or equivalent functional sequences, and in its 3' region, the
correspondent genome region in the whole or part of the spheres of
the steam and anchor of the protein E of this vector virus or
equivalent functional sequences, and not comprising the structure
and the replication of the mention vector virus; (b) insertion of
the modified heterolog sequences in (a) in the intergene region at
the structural protein E level and of nonstructural NS1 vector
virus; (c) obtention of the non pathogenic recombinant virus and
owner of the immunologic properties, having the heterolog sequences
integrated in the viral genome according to the insertion described
in (b) and, like that, expressing the heterolog antigene in such
way that it can induce an appropriate immune response. The present
invention is also addressed to vaccine compositions to immune
against the Flavivirus and/or other pathogens.
Inventors: |
Bonaldo; Myrna Cristina;
(Rio de Janeiro, BR) ; Galler; Ricardo; (Niteroi,
BR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bonaldo; Myrna Cristina
Galler; Ricardo |
Rio de Janeiro
Niteroi |
|
BR
BR |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20150024003 A1 |
January 22, 2015 |
|
|
Family ID: |
38006220 |
Appl. No.: |
14/304387 |
Filed: |
June 13, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12084387 |
Jul 15, 2008 |
8828687 |
|
|
PCT/BR2006/000237 |
Oct 31, 2006 |
|
|
|
14304387 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2770/24143
20130101; A61K 2039/525 20130101; C12N 7/00 20130101; C07K 2319/40
20130101; A61K 2039/575 20130101; C07K 2319/02 20130101; C07K
14/005 20130101; Y02A 50/386 20180101; A61K 39/12 20130101; A61P
37/04 20180101; A61K 2039/5256 20130101; A61P 31/14 20180101; Y02A
50/30 20180101; C07K 2319/03 20130101; C12N 2770/24134 20130101;
C12N 2770/24171 20130101; Y02A 50/388 20180101; C12N 2770/24122
20130101 |
International
Class: |
A61K 39/12 20060101
A61K039/12 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 31, 2005 |
BR |
PI0504945-8 |
Claims
1. A recombinant vaccine virus comprising nucleotide sequences
encoding at least one heterologous protein, or fragments thereof,
wherein said vector virus sequence comprises nucleotide sequences
encoding the NS1 protein and the E protein sequence of a
Flavivirus; further wherein the heterologous sequence is inserted
in the E/NS1 intergenic region, further wherein the nucleotides
present at the 5' end of the NS1 gene and the whole or part of the
domains of stem and anchor of the E protein are present at either
end of the heterologous sequence; and wherein when the heterologous
protein is expressed it will be processed normally by a host cell
and can induce an immune response.
2. The virus of claim 1 wherein the virus is a Flavivirus.
3. The virus of claim 1 wherein the virus is a Yellow Fever virus
correspondent to 17D strain.
4. The virus of claim 1 wherein the virus comprises a genome of SEQ
ID No. 13 or its equivalent functional sequences, exempting the
nucleotide sequence EGFP, or its equivalent functional sequences,
exempting the nucleotide sequence of EGFP protein, which may be
substituted by any heterolog sequence.
5. A vaccine composition comprising the virus of claim 1.
6. A vaccine composition comprising the virus of claim 3.
7. The vaccine composition of claim 5, further comprising at least
one pharmaceutically acceptable carrier.
8. The vaccine composition of claim 8, further comprising at least
one pharmaceutically acceptable carrier.
Description
[0001] The present invention is related to the genetic manipulation
of virus, including, but not limited to, Flavivirus, mainly the
vaccine amarilico virus 17D strain or its derivatives; resulting in
recombinant virus containing heterolog nucleotides coming from
other pathogens among the genes which codify the viral proteins E
and NS1. Such recombinant virus, resulting from its attenuation
characteristics, immunogeneticity and genetic stability, may be
applied in the development of attenuated alive vaccines to human
and animal use, granting immune response not only to the Yellow
Fever or any other disease caused by virus, but also to diseases
caused by other pathogens.
BACKGROUND OF INVENTION
[0002] The Flaviviridae family includes three genera: Flavivirus,
having as main representatives the virus of the yellow fever, the
virus of dengue, the virus of the Japanese encephalite; the genera
Hepacivirus (virus of hepatite C) and the genera of Pestivirus
(virus of diarrhea bovine). Eventhough they belong to different
genera, with distinct biological properties and without crossed
sorological reactivity, the virus of the 3 types share a great
similarity in the viral morphology, in the genomic organization and
in the replication strategy (Rice, C. M. 1996. Flaviviridae: the
viruses and their replication, Third ed, vol. 1. Lippincott-Raven,
Philadelphia, Pa.).
[0003] The virus of the yellow fever is the prototype of the genera
Flavivirus from the family Flaviviridae, which includes about 0.70
virus. The flavivirus are small (40-60 nm), spherical, enclosed,
with RNA genome of single strain, with the majority of these
arbovirus called as such due to their transmission by
arthropod-born viruses ("arthropod-borne viruses"), as mosquitos or
ticks, causing important diseases on man and animals.
[0004] FIG. 1 presents the genomic organization of the Flavivirus
(Chambers, T. J., C. S. Hahn, R. Caller, and C. M. Rice. 1990.
Flavivirus genome organization, expression, and replication. Annu
Rev Microbiol 44:649-88). The genome is represented on the top
part, with the indication of the 5' and 3' non translated sequences
and the open reading phase of 10.862 nucleotides. On this reading
phase, 5'.fwdarw.3' direction, the three structural proteins (C,
prM and E) and the seven genes to the non structural proteins (NS1,
NS2A, NS2B, NS3, NS4A, NS4B e NS5) are codified. The arrows
indicated the proteolitic clivage sites performed by the viral
protease (NS2B/NS3); and the lozenges, the cleavages by the
cellular signalase (occurs inside the endoplasmatic reticule). The
asterisks indicate the glicosilation sites linked to
asparagines.
[0005] The yellow fever virus (FIG. 1) has a genome constituted by
one single RNA molecule with 10.862 nucleotides (nt), one CAP
structure at the 5' edge (.sup.m7'GpppG, to be recognized by the
ribossomes), 5' region non translated short (118 nt) and a 3' edge
not poliadenilated (511 nt). Such data were obtained from the first
nucleotide sequencing of flavivirus genome--the vaccine virus
vacinal 17D-204 (Rice, C. M., E. M. Lenches, S. R. Eddy, S. J.
Shin, R. L. Sheets, and J. H. Strauss. 1985. Nucleotide sequence of
yellow fever virus: implications for flavivirus gene expression and
evolution. Science 229:726-33).
[0006] In the cytoplasm of the host cell, the viral RNA is used as
a shape to the synthesis of the negative complementary strain,
which, by its turn, will be the shape to the synthesis of more
positive strains to be used in the set up of new viral particles.
The replication is a semi conservative process and involves
replicative intermediates, as well as replicative ways. The
formation of viral particles occurs through the relationship of the
viral nucleocapsid, with the envelope protein anchored on the
membrane of the cellular Endoplasmatic Reticule (RER). The set up
of viral particles occurs in very close association with the RER.
The viral particles are carried through vesicles and, from that
point, released by the exocytose through the Golgy system.
[0007] The RNA is also the viral messenger and the transduction of
infected cells results in the synthesis of a poliprotein forerunner
of 3.411 aminoacids, which, when proteolitically processed, create
the 10 viral polypeptides. From the 5' edge, the order of genes is
C; prM/M; E; NS1; NS2A; NS2B; NS3; NS4A; NS4B and NS5. The three
first genes codify the structural viral proteins, that means, the
ones which form the virus together with the encapsid RNA molecule,
being denominated as capsid (C, 12-14 kDa), membrane (M of 8 kDa,
and its forerunner prM of 18-22 kDa) and envelope (E, 52-54 kDa).
These three genes are transcoded in the first quarter of the
genome. The remaining genome codifies the non structural proteins
(NS), numbered from 1 to 5 (NS1a NS5), in accordance with the order
of synthesis (Rice, C. M., E. M. Lenches, S. R. Eddy, S. J. Shin,
R. L. Sheets, and J. H. Strauss. 1985. Nucleotide sequence of
yellow fever virus: implications for flavivirus gene expression and
evolution. Science 229:726-33).
[0008] Among the different. Flavivirus, three great non structural
proteins have very well conserved sequences: NS1 (38-41 kDa), NS3
(68-70 kDa) and NS5 (100-103 kDa).
[0009] The first one (NS1) has an important role in the replication
of the negative strand of RNA (Lindenbach, B. D., and C. M. Rice.
1999. Genetic interaction of flavivirus nonstructural proteins NS1
and NS4A as a determinant of replicase function. J Virol
73:4611-21; Lindenbach, B. D., and C. M. Rice. 1997.
trans-Complementation of yellow fever virus NS1 reveals a role in
early RNA replication. J Virol 71:9608-17; Muylaert, I. R., T. J.
Chambers, R. Galler, and C. M. Rice. 1996. Mutagenesis of the
N-linked glycosylation sites of the yellow fever virus NS1 protein:
effects on virus replication and mouse neurovirulence. Virology
222:159-68; Muylaert, I. R., R. Galler, and C. M. Rice. 1997.
Genetic analysis of the yellow fever virus NS1 protein:
identification of a temperature-sensitive mutation which blocks RNA
accumulation. J Virol 71:291-8). Released extracellularly as
hexameric structure, may be located in the cellular surface.
Antibodies against NS1 do not neutralize the viral infectivity, but
exert protective immunity through mediation of the complement
lyzing infected cells (Rice, C. M. 1996. Flaviviridae: the viruses
and their replication., Third ed, vol. 1. Lippincott-Raven,
Philadelphia, Pa.).
[0010] The second one, NS3, make up three distinct enzymatic
activities: (1) protease, being responsible for the proteolytic
process of the viral poliprotein in sites where the cellular
protease does not act (Lee, E., C. E. Stocks, S. M. Amberg, C. M.
Rice, and M. Lobigs. 2000. Mutagenesis of the signal sequence of
yellow fever virus prM protein: enhancement of signalase cleavage
In vitro is lethal for virus production. J Virol 74:24-32; Stocks,
C. E., and M. Lobigs. 1995. Posttranslational signal peptidase
cleavage at the flavivirus C-prM junction in vitro. J Virol
69:8123-6; Yamshchikov, V. F., and R. W. Compans. 1995. Formation
of the flavivirus envelope: role of the viral NS2B-NS3 protease. J
Virol 69:1995-2003; Yamshchikov, V. F., D. W. Trent, and R. W.
Compans. 1997. Upregulation of signalase processing and induction
of prM-E secretion by the flavivirus NS2B-NS3 protease: roles of
protease components. J Virol 71:4364-71); (2) helicase and (3)
nucleotide-trifosfatase (Gorbalenya, A. E., E. V. Koonin, A. P.
Donchenko, and V. M. Blinov. 1989. Two related superfamilies of
putative helicases involved in replication, recombination, repair
and expression of DNA and RNA genomes. Nucleic Acids Res
17:4713-30; Wengler, G., and G. Wengler. 1993. The NS 3
nonstructural protein of flaviviruses contains an RNA
triphosphatase activity. Virology 197:265-73; Wu, J., A. K. Bera,
R. J. Kuhn, and J. L. Smith. 2005. Structure of the Flavivirus
helicase: implications for catalytic activity, protein
interactions, and proteolytic processing. J Virol 79:10268-77). The
two last ones give to this protein an important role also in the
replication of the viral RNA.
[0011] The third one, NS5, is the greatest and most conserved viral
protein, making up the viral RNA polimerase, since its sequence
contains several structural elements characteristic of RNA
polymerases (Chambers, T. J., C. S. Hahn, R. Galler, and C. M.
Rice. 1990. Flavivirus genome organization, expression, and
replication. Annu Rev Microbiol 44:649-88) and still exhibits RNA
polimerase activity, dependent of RNA (Steffens, S., H. J. Thiel,
and S. E. Behrens. 1999. The RNA-dependent RNA polymerases of
different members of the family Flaviviridae exhibit similar
properties in vitro. J Gen Virol 80 (Pt 10):2583-90).
[0012] The four small proteins NS2A, NS2B, NS4A and NS4B are not
enough conserved in its aminoacid sequence, but not in its patterns
of multiple hydrophobic parts. These small proteins were related,
up to the moment, to some processes of viral propagation: NS2A
seems to be necessary to the correct processing of NS1 (Falgout,
B., R. Chanock, and C. J. Lai. 1989. Proper processing of dengue
virus nonstructural glycoprotein NS1 requires the N-terminal
hydrophobic signal sequence and the downstream nonstructural
protein NS2a. J Virol 63:1852-60) and to the set up of the viral
particle together with NS3 (Kummerer, B. M., and C. M. Rice. 2002.
Mutations in the yellow fever virus nonstructural protein NS2A
selectively block production of infectious particles. J Virol
76:4773-84); NS2B is associated with NS3, acting as a complex
proteolitic viral cofactor (Chambers, T. J., A. Nestorowicz, S. M.
Amberg, and C. M. Rice. 1993. Mutagenesis of the yellow fever virus
NS2B protein: effects on proteolytic processing, NS2B-NS3 complex
formation, and viral replication. J Virol 67:6797-807; Falgout, B.,
M. Pethel, Y. M. Zhang, and C. J. Lai. 1991. Both nonstructural
proteins NS2B and NS3 are required for the proteolytic processing
of dengue virus nonstructural proteins. J Virol 65:2467-75; Jan, L.
R., C. S. Yang, D. W. Trent, B. Falgout, and C. J. Lai. 1995.
Processing of non-structural Japanese encephalitis virus proteins:
NS2B-NS3 complex and heterologous proteases. J Gen Virol 76 (Pt
3):573-80); NS4A would interact with NS1, allowing its integration
in the citoplasmatic process of RNA replication (Lindenbach, B. D.,
and C. M. Rice. 1999. Genetic interaction of flavivirus
nonstructural proteins NS1 and NS4A as a determinant of replicase
function. J Virol 73:4611-21). Considering that the synthesis of
the viral RNA occurs in the cellular cytoplasm in association with
membranes of RER, it is assumed that these viral hydrophobic viral
proteins would be immersed in membranes and, through interactions
with NS3 and NS5, they would be participating with them in complex
viral replicatives.
[0013] Structural elements present in the non translated 5' and 3'
edges (NTR) are also important in the replication and wrapping of
the viral RNA (Chambers, T. J., C. S. Hahn, R. Galler, and C. M.
Rice. 1990. Flavivirus genome organization, expression, and
replication. Annu Rev Microbiol 44:649-88; Cologna, R., and R.
Rico-Hesse. 2003. American genotype structures decrease dengue
virus output from human monocytes and dendritic cells. J Virol
77:3929-38; Elghonemy, S., W. G. Davis, and M. A. Brinton. 2005.
The majority of the nucleotides in the top loop of the genomic 3'
terminal stem loop structure are cis-acting in a West Nile virus
infectious clone. Virology 331:238-46; Hanley, K. A., L. R.
Manlucu, G. G. Manipon, C. T. Hanson, S. S. Whitehead, B. R.
Murphy, and J. E. Blaney, Jr. 2004. Introduction of mutations into
the non-structural genes or 3' untranslated region of an attenuated
dengue virus type 4 vaccine candidate further decreases replication
in rhesus monkeys while retaining protective immunity. Vaccine
22:3440-8; Khromykh, A. A., H. Meka, K. J. Guyatt, and E. G.
Westaway. 2001. Essential role of cyclization sequences in
flavivirus RNA replication. J Virol 75:6719-28; Thurner, C., C.
Witwer, I. L. Hofacker, and P. F. Stadler. 2004. Conserved RNA
secondary structures in Flaviviridae genomes. J Gen Virol
85:1113-24; Tilgner, M., T. S. Deas, and P. Y. Shi. 2005. The
flavivirus-conserved penta-nucleotide in the 3' stem-loop of the
West Nile virus genome requires a specific sequence and structure
for RNA synthesis, but not for viral translation. Virology
331:375-86; Tilgner, M., and P. Y. Shi. 2004. Structure and
function of the 3' terminal six nucleotides of the west nile virus
genome in viral replication. J Virol 78:8159-71; Yu, L., and L.
Markoff. 2005. The topology of bulges in the long stem of the
flavivirus 3' stem-loop is a major determinant of RNA replication
competence. J Virol 79:2309-24).
[0014] The protein C of the capsid interacts with the viral RNA,
forming the viral nucleocapsid (Chambers, T. J., C. S. Hahn, R.
Galler, and C. M. Rice. 1990. Flavivirus genome organization,
expression, and replication. Annu Rev Microbiol 44:649-88). The
protein prM is a glicosilated forerunner of the membrane protein.
It is present on the surface of immature viral particles, with the
cleavage by cellular proteases furina type at the level of the
Golgy complex, before the release of viral particles, in such way
that the mature virus contains the protein M. The role of the prM
is to stabilize the protein E, avoiding the premature show off of
the fusion peptide to the reduced pH found in the exocite via
(Heinz, F. X., and S. L. Allison. 2003. Flavivirus structure and
membrane fusion. Adv Virus Res 59:63-97). The retention of prM
protein may affect the conformation and antigenicity of the protein
E and reduce the infectivity, inhibiting the acid-dependent
fusion.
[0015] On FIG. 2, the immature (intracellular form) and mature
(extracellular form) viral particles of the Flavivirus are
represented. The capsid of the virus has an icosahedra symmetry,
but the shape is not necessarily the one presented on the Figure,
which also shows the genome of the virus associated with the
internal side of the capsid. Here are represented the envelope
proteins (E) and its dimeric form, the protein of the membrane (M)
and its forerunner (prM), which is still present in the envelope in
an extracellular shape. Oppositely to the extracellular particles,
the intracellular particles are not infective (Chambers, T. J., C.
S. Hahn, R. Galler, and C. M. Rice. 1990. Flavivirus genome
organization, expression, and replication. Annu Rev Microbiol
44:649-88).
[0016] The protein E is the main component of the viral envelope.
It promotes the linkage to glicoproteic receptors on the cellular
surface and the internalization by dependent fusion of pH,
processes that trigger a viral infection. This protein has multiple
determinant antigens and it is the main target to the
immune-protective response of the vertebrate host. Therefore, it
plays a key role in the cellular infections, in the viral tropism,
in virulence and in the immunity.
[0017] The discovery of the three-dimensional atomic structure of
the protein E of the mature viral particle of flavivirus TBE
(tick-borne encephalitis virus), reveals that this protein exists
as a homodimers, about 110 kDa, with three defined spheres,
anchored by the hydrophobic carboxylic edge on the envelope surface
(Rey, F. A., F. X. Heinz, C. Mandl, C. Kunz, and S. C. Harrison.
1995. The envelope glycoprotein from tick-borne encephalitis virus
at 2 A resolution. Nature 375:291-8). This model has been seen
applied to all Flavivirus, contributing mainly to the detection of
antigen tracers and the study of mutations linked to the increase
or decrease of virulence (Arroyo, J., F. Guirakhoo, S. Fenner, Z.
X. Zhang, T. P. Monath, and T. J. Chambers, 2001. Molecular basis
for attenuation of neurovirulence of a yellow fever Virus/Japanese
encephalitis virus chimera vaccine (ChimeriVax-JE). J Virol
75:934-42; Guirakhoo, F., Z. Shang, G. Myers, B. W. Johnson, K.
Pugachev, R. Nichols, N. Brown, I. Levenbook, K. Draper, S. Cyrek,
J. Lang, C. Fournier, B. Barrere, S. Delagrave, and T. P. Monath.
2004. A single amino acid substitution in the envelope protein of
chimeric yellow fever-dengue 1 vaccine virus reduces neurovirulence
for suckling mice and viremia/viscerotropism for monkeys. J Virol
78:9998-10008; Halstead, S. B., F. X. Heinz, A. D. Barrett, and J.
T. Roehrig. 2005. Dengue virus: molecular basis of cell entry and
pathogenesis, 25-27 Jun. 2003, Vienna, Austria. Vaccine 23:849-56;
Hurrelbrink, R. J., and P. C. McMinn. 2003. Molecular determinants
of virulence: the structural and functional basis for flavivirus
attenuation. Adv Virus Res 60:1-42; Kolaskar, A. S., and U.
Kulkarni-Kale. 1999. Prediction of three-dimensional structure and
mapping of conformational epitopes of envelope glycoprotein of
Japanese encephalitis virus. Virology 261:31-42; Lee, E., R. A.
Hall, and M. Lobigs. 2004. Common E protein determinants for
attenuation of glycosaminoglycan-binding variants of Japanese
encephalitis and West Nile viruses. J Virol 78:8271-80; Lee, E.,
and M. Lobigs. 2000. Substitutions at the putative receptor-binding
site of an encephalitic flavivirus alter virulence and host cell
tropism and reveal a role for glycosaminoglycans in entry. J Virol
74:8867-75; Lee, E., C. E. Stocks, S. M. Amberg, C. M. Rice, and M.
Lobigs. 2000. Mutagenesis of the signal sequence of yellow fever
virus prM protein: enhancement of signalase cleavage In vitro is
lethal for virus production. J Virol 74:24-32; Mandl, C. W., S. L.
Allison, H. Holzmann, T. Meixner, and F. X. Heinz. 2000.
Attenuation of tick-borne encephalitis virus by structure-based
site-specific mutagenesis of a putative flavivirus receptor binding
site. J Virol 74:9601-9; Nickells, M., and T. J. Chambers. 2003.
Neuroadapted yellow fever virus 17D: determinants in the envelope
protein govern neuroinvasiveness for SCID mice. J Virol
77:12232-42; Ryman, K. D., H. Xie, T. N. Ledger, G. A. Campbell,
and A. D. Barrett. 1997. Antigenic variants of yellow fever virus
with an altered neurovirulence phenotype in mice. Virology
230:376-80; Shirato, K., H. Miyoshi, A. Goto, Y. Ako, T. Ueki, H.
Kariwa, and I. Takashima. 2004. Viral envelope protein
glycosylation is a molecular determinant of the neuroinvasiveness
of the New York strain of West Nile virus. J Gen Virol
85:3637-45).
[0018] The bonding of protein E to cell receptors leads to the
formation of de endocitic vesicles, covered by clatrine. After the
internalization by endocitose mediated by receptor, the virus are
released in the cytoplasm through conformation changes, induced by
acidic pH which takes the peptide of fusion to be exposed after the
trimerization of protein E (Bonaldo, M. C., R. C. Garratt, R. S.
Marchevsky, E. S. Coutinho, A. V. Jabor, L. F. Almeida, A. M.
Yamamura, A. S. Duarte, P. J. Oliveira, J. O. Lizeu, L. A. Camacho,
M. S. Freire, and R. Galler. 2005. Attenuation of recombinant
yellow fever 17D viruses expressing foreign protein epitopes at the
surface. J Virol 79:8602-13; Bressanelli, S., K. Stiasny, S. L.
Allison, E. A. Stura, S. Duquerroy, J. Lescar, F. X. Heinz, and F.
A. Rey. 2004. Structure of a flavivirus envelope glycoprotein in
its low-pH-induced membrane fusion conformation. Embo J 23:728-38;
Heinz, F. X., and S. L. Allison. 2003. Flavivirus structure and
membrane fusion. Adv Virus Res 59:63-97; Stiasny, K., S.
Bressanelli, J. Lepault, F. A. Rey, and F. X. Heinz. 2004.
Characterization of a membrane-associated trimeric low-pH-induced
Form of the class II viral fusion protein E from tick-borne
encephalitis virus and its crystallization. J Virol
78:3178-83).
[0019] In 1927, the virus which causes the yellow fever was
isolated in the Rhesus (Macaca mulatta), through the straight
inoculation of blood from an African patient named Asibi (Stokes A,
B. J., Hudson N P. 1928, The transmission of yellow fever to
Macacus rhesus. Rev Med. Virol. 11:141-148). After the set up of a
pattern of an animal model sensitive to the virus, new perspectives
showed up and the viral propagation and the clinical evaluation
became possible. The Asibi virus, the original sample, is one of
the most virulent among the yellow fever virus ever studied. When
inoculated in monkeys, through subcutaneous via, in 4 to 7 days it
caused death in 95% of the animals, and high rates of viremia are
detected in the blood of theses infected animals.
[0020] The serial passage of Asibi cepa, in different types of
cultivation, as described priorly, lead to the production of the
parental 17D cepa, in the passage 180, to 17DD in the passage 195,
and to 17D-204 cepa in the passage 204. The 17DD cepa was
cultivated afterwards until the passage 243 and suffered 43 extra
passages in chicken embryo (passage 286). The 17D-204 cepa, by its
turn, created by cultivation, to Colombia 88 cepa, that by its
turn, originated the different seed shares used in France (I.
Pasteur, passage 235) and in the United States (Connaught, passage
234). The 17D-204 and 17DD virus are the two sub cepas of the 17D
cepas used actually to produce vaccines in the world, which
accumulated the genotype and phenotype differences due to the
independent serial passages (Galler, R., P. R. Post, C. N. Santos,
and Ferreira, I I. 1998. Genetic variability among yellow fever
virus 17D substrains. Vaccine 16:1024-8; Marchevsky, R. S., M. S.
Freire, E. S. Coutinho, and R. Galler. 2003. Neurovirulence of
yellow fever 17DD vaccine virus to rhesus monkeys. Virology
316:55-63; Post, P. R., R. de Carvalho, M. da Silva Freire, and R.
Galler. 2001. The early use of yellow fever virus strain 17D for
vaccine production in Brazil--a review. Mem Inst Oswaldo Cruz
96:849-57). However, both are equally immunogenic and safe for
human vaccine (Camacho, L. A., S. G. Aguiar, M. D. Freire, M. D.
Leal, J. P. Nascimento, T. Iguchi, J. A. Lozana, and R. H. Farias.
2005. Reactogenicity of yellow fever vaccines in a randomized,
placebo-controlled trial. Rev Saude Publica 39:413-420; Camacho, L.
A., S. Freire Mda, L. Leal Mda, S. G. Aguiar, J. P. Nascimento, T.
Iguchi, A. Lozana Jde, and R. H. Farias. 2004. Immunogenicity of
WHO-17D and Brazilian 17DD yellow fever vaccines: a randomized
trial. Rev Saude Publica 38:671-8).
[0021] The attenuated alive virus vaccine of the yellow fever (FA)
17D strain, constitutes one of the best and sager vaccines
nowadays, having a well established methodology of production and a
serious quality control, including the monkey neurovirulence test.
Besides, it promotes lifetime immunity (Monath, T. 2003. Yellow
Fever Vaccine, 4th ed. W.B. Saunders Company, USA) and it is
capable of inducing both cellular immune and humoral responses (Co,
M. D., M. Terajima, J. Cruz, F. A. Ennis, and A. L. Rothman. 2002.
Human cytotoxic T lymphocyte responses to live attenuated 17D
yellow fever vaccine: identification of HLA-B35-restricted CTL
epitopes on nonstructural proteins NS1, NS2b, NS3, and the
structural protein E. Virology 293:151-63); in addition to being
low cost and one single dose. Its use was estimated in 400 million
doses.
[0022] Due to this, its characteristics make it appropriate for the
development of 17D virus as a vaccine expression vector of the
heterolog antigens.
[0023] But, for the development of the flavivirus, expressing
heterolog antigens, it is necessary to: [0024] (a) the sketch of
strategies that allow the introduction of heterolog antigens,
without compromise of the structure and replication of the virus;
[0025] (b) ensure that the construction of the cDNA (and the RNA
transcripts) generate a non-pathogenic virus and moreover that the
foreign sequence stays integrated in the viral genome; and [0026]
(c) guarantee that the FA recombinant virus, besides being
attenuated, keeps the immunologic properties, expressing the
heterolog antigens, inserted in a way that it induces the
appropriated immune response. It is also important that the
replication capacity in certified cells for production of vaccines
is maintained.
[0027] The development of the recombinant DNA technology made it
possible the progress in the studies of structure and expression of
viral RNA genome. To manipulate the genomic RNA, it is necessary
that the complementary DNA become available. Genetic modifications
may be introduced in determined sites of the viral genome.
[0028] The pioneer study of David Baltimore (Racaniello, V. R., and
D. Baltimore. 1981. Cloned poliovirus complementary DNA is
infectious in mammalian cells. Science 214:916-9), was the first
one to demonstrate that it possible to regenerate virus for the
complementary DNA of the poliomyelitis virus. With the development
of efficient systems in vitro transcription, it made it possible to
the complete synthesis of viral RNA viral in vitro with efficiency
much greater than the cDNA transcription in the cell. The
development of efficient methods of cells transfection with nucleic
acids, as for example electroporation and the use of cationic
liposome's contributed to the increase of the transfection
efficiency of cell transfection with RNA and viral regeneration.
The basis of methodology of the infectious clone is established and
has been used to obtain infectious clones to other virus of the
positive strand.
[0029] The infectious clones may be used to better understand the
molecular bases of diverse biological phenomena such as: the
virulence, attenuation, mechanism of cell penetration, replication,
relation with the host, conditional mutant and the design of
mutants for the required functions (Bonaldo, M. C., P. S. Caufour,
M. S. Freire, and R. Galler. 2000. The yellow fever 170 vaccine
virus as a vector for the expression of foreign proteins:
development of new live flavivirus vaccines. Mem Inst Oswaldo Cruz
95 Suppl 1:215-23; Bonaldo, M. C., R. C. Garratt, P. S. Caufour, M.
S. Freire, M. M. Rodrigues, R. S. Nussenzweig, and R. Galler. 2002.
Surface expression of an immunodominant malaria protein B cell
epitope by yellow fever virus. J Mol Biol 315:873-85).
[0030] The construction of a complete cDNA shape of the 17D vaccine
virus, that can be transcript in vitro, producing RNA infectious
virus, was described for the first time by Rice and colleagues
(Rice, C. M., A. Grakoui, R. Galler, and T. J. Chambers. 1989.
Transcription of infectious yellow fever RNA from full-length cDNA
templates produced by in vitro ligation. New Biol 1:285-96). The
virus--obtained from cDNA--was indistinguished from the parental
virus, the 17D-204 subcepa, by different criteria (Rice, C. M., A.
Grakoui, R. Galler, and T. J. Chambers. 1989. Transcription of
infectious yellow fever RNA from full-length cDNA templates
produced by in vitro ligation. New Biol 1:285-96).
[0031] The acquisition of vaccines shares seeds from cDNA in good
production practices was described by the first time by Marchevsky
and collaborators (Marchevsky, R. S., J. Mariano, V. S. Ferreira,
E. Almeida, M. J. Cerqueira, R. Carvalho, J. W. Pissurno, A. P. da
Rosa, M. C. Simoes, and C. N. Santos. 1995. Phenotypic analysis of
yellow fever virus derived from complementary DNA. Am J Trop Med
Hyg 52:75-80), and later by Galler and Freire (patent documents
U.S. Pat. No. 6,171,854 and U.S. Pat. No. 6,859,522) and Freire and
collaborators (document of patent BRPI 9804283). The production
process described by Freire and collaborators (patent document BRPI
9804283) may also be, in a near future, the modernization of the
production of the amarilic vaccine; making it possible a
significative increase in the production and improvement of the
product quality (Freire, M. S., G. F. Mann, R. S. Marchevsky, A. M.
Yamamura, L. F. Almeida, A. V. Jabor, J. M. Malachias, E. S.
Coutinho, and R. Galler. 2005. Production of yellow fever 17DD
vaccine virus in primary culture of chicken embryo fibroblasts:
yields, thermo and genetic stability, attenuation and
immunogenicity. Vaccine 23:2501-12).
[0032] This work created the perspective for the use of the 17D
virus as an expression vector for heterolog antigens. There are
several ways to obtain an expression vector from the virus with
positive string RNA genome, some of which are described in
published revisions by our research group (Bonaldo, M. C., P. S.
Caufour, M. S. Freire, and R. Galler. 2000. The yellow fever 170
vaccine virus as a vector for the expression of foreign proteins:
development of new live flavivirus vaccines. Mem Inst Oswaldo Cruz
95 Suppl 1:215-23; Galler, R., M. S. Freire, A. V. Jabor, and G. F.
Mann. 1997. The yellow fever 17D vaccine virus: molecular basis of
viral attenuation and its use as an expression vector. Braz J Med
Biol Res 30:157-68).
[0033] One of the alternatives in which our research group is
working refers to the substitution of the prM/E proteins of yellow
fever by the equivalent proteins of the dengue virus, so it can be
obtained a chimeric virus. This approach has the advantage of the
previous immunity against the vector wouldn't be a limit, since the
envelope E protein contains all the epitops for viral
neutralization.
[0034] The approach of change of prM/E genes among the flavivirus
was described for the first time in the patent document U.S. Pat.
No. 6,184,024 and U.S. Pat. No. 6,676,936, which described the new
virus with the prM/E genes of dengue 1 or 2 and the remaining of
the virus genome Den 4. The first chimeric virus from 17D genome
was created by change of prM/E genes of the Japanese encephalitis
virus (JE) (Chambers, T. J., A. Nestorowicz, P. W. Mason, and C. M.
Rice. 1999. Yellow fever/Japanese encephalitis chimeric viruses:
construction and biological properties. J Viral 73:3095-101). This
Chimeric was immunogenic and attenuated in monkeys, so it could
promote a total protection to these animals, in face of a
intracerebral challenge (IC) with the wild JE virus (Monath, T. P.,
I. Levenbook, K. Soike, Z. X. Zhang, M. Ratterree, K. Draper, A. D.
Barrett, R. Nichols, R. Weltzin, J. Arroyo, and F. Guirakhoo. 2000.
Chimeric yellow fever virus 17D-Japanese encephalitis virus
vaccine: dose-response effectiveness and extended safety testing in
rhesus monkeys. J Virol 74:1742-51). Recently, a clinical study in
humans demonstrated that the chimerical vaccine FA/JE is safe and
immunogenic in man, in similar levels to the FA 17D, with a high
possibility of use, in the future, for the prevention of the
Japanese encephalitis in travelers and residents in endemic regions
(Monath, T. P. 2002. Japanese encephalitis vaccines: current
vaccines and future prospects. Curr Top Microbiol Immunol
267:105-38; Monath, T. P., F. Guirakhoo, R. Nichols, S. Yoksan, R.
Schrader, C. Murphy, P. Blum, S. Woodward, K. McCarthy, D. Mathis,
C. Johnson, and P. Bedford. 2003. Chimeric live, attenuated vaccine
against Japanese encephalitis (ChimeriVax-JE): phase 2 clinical
trials for safety and immunogenicity, effect of vaccine dose and
schedule, and memory response to challenge with inactivated
Japanese encephalitis antigen. J Infect Dis 188:1213-30).
[0035] Our research group constituted four chimeric virus
containing the cDNA of different dengue 2 cepas, and one of these
constructions was selected for immunogenicity tests. Theses tests
were performed in murine model, the results being published with
the characterization of the growth and viral attenuation (Caufour,
P. S., M. C. Motta, A. M. Yamamura, S. Vazquez, Ferreira, I I, A.
V. Jabor, M. C. Bonaldo, M. S. Freire, and R. Galler. 2001.
Construction, characterization and immunogenicity of recombinant
yellow fever 17D-dengue type 2 viruses. Virus Res 79:1-14).
[0036] In this strategy it was also used the creation of a chimeric
virus FA 17D for the creation of a tetravalent vaccine against the
different sorotypes of dengue virus (Guirakhoo, F., J. Arroyo, K.
V. Pugachev, C. Miller, Z. X. Zhang, R. Weltzin, K. Georgakopoulos,
J. Catalan, S. Ocran, K. Soike, M. Ratterree, and T. P. Monath.
2001. Construction, safety, and immunogenicity in nonhuman primates
of a chimeric yellow fever-dengue virus tetravalent vaccine. J
Virol 75:7290-304; Guirakhoo, F., K. Pugachev, J. Arroyo, C.
Miller, Z. X. Zhang, R. Weltzin, K. Georgakopoulos, J. Catalan, S.
Ocran, K. Draper, and T. P. Monath. 2002. Viremia and
immunogenicity in nonhuman primates of a tetravalent yellow
fever--dengue chimeric vaccine: genetic reconstructions, dose
adjustment, and antibody responses against wild-type dengue virus
isolates. Virology 298:146-59; Guirakhoo, F., K. Pugachev, Z.
Zhang, G. Myers, I. Levenbook, K. Draper, J. Lang, S. Ocran, F.
Mitchell, M. Parsons, N. Brown, S. Brandler, C. Fournier, B.
Barrere, F. Rizvi, A. Travassos, R. Nichols, D. Trent, and T.
Monath. 2004. Safety and efficacy of chimeric yellow Fever--dengue
virus tetravalent vaccine formulations in nonhuman primates. J
Viral 78:4761-75, US patent Documents U.S. Pat. No. 6,696,281 and
WO0139802). In tissue culture, these chimera grow in high degrees,
and were immunogenic in inoculated monks with individual
formulations and tetravalent of these recombinants. But, we may
stress that a higher immune response against one of the
recombinant, the chimera FA/den2, due, probably, to a grater
replication rate of this virus.
[0037] An ideal vaccine against the four sorotypes, as well as
inducing a long-lasting response, should protect the individual
against the four sorotypes efficiently, because an incomplete
immunization may unleash the sickness in its more serious form.
Later, other formulations were tested in monkeys, with the
intention of reducing the dominant immunogenicity of the chimera
FA/Den2 (Guirakhoo, F., K. Pugachev, J. Arroyo, C. Miller, Z. X.
Zhang, R. Weltzin, K. Georgakopoulos, J. Catalan, S. Ocran, K.
Draper, and T. P. Monath. 2002. Viremia and immunogenicity in
nonhuman primates of a tetravalent yellow fever--dengue chimeric
vaccine: genetic reconstructions, dose adjustment, and antibody
responses against wild-type dengue virus isolates. Virology
298:146-59). In the meantime, the adjustment of the dose for the
chimera den2 resulted, in spite of a more balanced reply against
the chimeric viruses types 1, 2 and 3, in a more accented reply
against the chimera type 4. These results indicate that the
development of a tetravalent vaccine should pass by tests with
different formulations, so that an ideal adjustment may be obtained
to be tested in monkeys before an optimum formulation may be
attained to be used in tests of safety and immunogenicity in humans
in a phase I clinical study.
[0038] The second approach refers to the insertion of the protein
epitopes in the virus 17D genome of. Such insertions may be done in
very immunogenic proteins of the amarilic virus, through
duplication of the processing signals of the viral polyprotein by
viral protease and the creation of expression cassettes--as was
done with an epitope of ovalbumin, response inductor of the
lymphocyte T cytotoxic, that was inserted between the genes NS2B
and NS3 (McAllister, A., A. E. Arbetman, S. Mandl, C. Pena-Rossi,
and R. Andino. 2000. Recombinant yellow fever viruses are effective
therapeutic vaccines for treatment of murine experimental solid
tumors and pulmonary metastases. J Virol 74:9197-205), patent
Documents U.S. Pat. No. 6,589,531 and US20030157128). Immunization
of mice with the recombinant virus induced protection against a
lethal dose of malignant melanoma cells that expressed the same
epitope. It is important that the new viruses be attenuated with
the 1.0 vaccine 17D, that they are genetically stable and retain
the immunogenic properties do heterologous antigen, promoting the
correct induction of the immune response. In this sense, it should
be noted that the expression of the epitope de Plasmodium yoelii
through its insertion between the NS2B-NS3 genes of the virus 17D
(Tao, D., G. Barba-Spaeth, U. Rai, V. Nussenzweig, C. M. Rice, and
R. S. Nussenzweig. 2005. Yellow fever 17D as a vaccine vector for
microbial CTL epitopes: protection in a rodent malaria model. J Exp
Med 201:201-9).
[0039] It became interesting to test this system for the expression
of larger genetic fragments. In this sense, our research group
opted to insert the green fluorescent algae genes (GFP). This gene
facilitates monitoring the infectiousness of the transcribed RNA in
vitro, as from plasmidial molds, to allow the direct visualization
of the synthesized proteins in transfected cultures through
fluorescent microscopy.
[0040] The insertion strategy is described in FIG. 3, in which the
upper part represents the genomic structure and the genetic
expression. The Flavivirus genome is translated into a single
polyprotein, which is cleaved by cellular proteases (.dwnarw.) or
viral (). Black vertical bars indicate transmembrane hydrophobic
domains, and the asterisks indicate glycosylation sites connected
to asparagine. Shadowed areas in C and prM/E represent as
structural proteins present in the mature infectious viruses. The
lower part presents the general genome structure, the sequences in
the cleavage sites and the proteolytic cleavages necessary for the
insertion of the gene reporter between NS2A and 2B. Such strategy
applies to the other sites cleaved by viral protease, situated
between C-prM, NS2B-3, NS3-4A, NS4A-4B and NS4B-5.
[0041] The GFP gene was inserted between NS2A-2B and NS2B-NS3
without the recovery of the infectious virus, suggesting that the
insertion of larger genetic fragments in the virus 17D genome
through this approach is not possible (Bonaldo M C and Galler R,
data not published).
[0042] Another manner of developing recombinant amarylic viruses
having various pathogenic epitopes was the expression of protean
epitopes previously classified as important in some kinds of immune
replies, whether humoral or cellular, by direct insertion in the
viral polyprotein. The different viral proteins contain epitopes
related to the induction of the cellular reply (CTL) and humoral
(formation of antibodies), in such a way that there are different
possibilities of optimizing expression and immunogenicity.
[0043] A new version of the FA infectious clone was developed,
containing restriction sites in the viral envelope protein gene
that allowed the insertion "in-frame" of the heterologous epitopes.
This was possible due to the availability of their
three-dimensional structure, which allowed an analysis of the areas
where insertions would be viable. A site for the insertion of the
epitopes was identified in these three-dimensional analyses (f-g
loop of the envelope protein), and various epitopes of different
microorganisms were already inserted and expressed in the f-g loop,
including epitopes de Plasmodium sp, dengue and arenavirus
(Bonaldo, M. C., R. C. Garratt, M. S. Freire, and R. Galler. 2005.
Novel Flavivirus vector useful for expressing heterologous antigens
comprises foreign gene sequences inserted at sites in the level of
its envelope protein. Great-Britain).
[0044] With relation to the Plasmodium sp epitopes, a total of 16
new viruses were created, which expressed epitopes related to the
response by the T CD4+ or T CD8+ cells or the B cells. A repetitive
humoral epitope of the CS surface protein of the sporozoite form of
the P. falciparum was inserted in the fg loop and the virus
regenerated. This virus was classified in terms of the culture
growth of the cells, neutralization by soros against yellow fever
and monoclonal against the epitope, this experiment proved its
correct presentation in the viral surface as expected from the
three-dimensional modeling, and attenuation and immunogenicity in
mice (Bonaldo, M. C., R. C. Garratt, P. S. Caufour, M. S. Freire,
M. M. Rodrigues, R. S. Nussenzweig, and R. Galler. 2002. Surface
expression of an immunodominant malaria protein B cell epitope by
yellow fever virus. J Mol Biol 315:873-85).
[0045] A recombinant Virus 17D expressing an epitope of the P.
yoelii T CD8 cell, through insertion in the f-g loop, also was
constructed. This virus did not have its growth in vitro
characteristics altered, but showed itself more attenuated in the
virulence test in mice than the virus vaccine 17DD. This epitope
was correctly presented on the viral surface and is immunogenic,
based on the results of immunization of mice and the Elispot tests
and response with P. yoelii sporozoites, response against which was
observed a protection of 70%.
[0046] Our research group also made a more detailed evaluation of
the attenuation of the chimeric viruses, expressing the humoral
epitopes P. falciparum and P. yoelii T CD8 through the
intracerebral inoculation test in rhesus monkeys, in accordance
with the requirements established by the World Health Organization
for the amarilic virus vaccine. The results suggest that both the
viruses are, at the minimum, as attenuated as the 17DD virus
vaccine used in human vaccination. A comparative analysis of the
virus envelope containing the two insertions showed that the
original structural "design" of the insertion, long from the domain
III involved in the connection to the receptor/tropism, was enough
to not cause any alteration in the viral virulence, a fundamental
aspect in the validation of this approach (Bonaldo, M. C., R. C.
Garratt, R. S. Marchevsky, E. S. Coutinho, A. V. Jabor, L. F.
Almeida, A. M. Yamamura, A. S. Duarte, P. J. Oliveira, J. O. Lizeu,
L. A. Camacho, M. S. Freire, and R. Galler. 2005. Attenuation of
recombinant yellow fever 17D viruses expressing foreign protein
epitopes at the surface. J Virol 79:8602-13). This approach
constitutes a recently conceded patent (Bonaldo M C, Garrat R C,
Freire M S & Galler R (2001) Use of Flaviviruses for the
expression of foreign protein epitopes and the development of new
live attenuated vaccines for immunization against Flaviviruses and
other infectious agents, GB 0105877.5 e PCT PCT/BR02/00036).
[0047] A fourth approach in the use of the 17D virus as an
expression vector refers to the insertion of genes in the non
translated 3'' region (NTR). This approach was done a lot in
function of the variability of the length of this region in the FA
virus (from Filippis, A. M., R. M. Nogueira, H. G. Schatzmayr, D.
S. Tavares, A. V. Jabor, S. C. Diniz, J. C. Oliveira, E. Moreira,
M. P. Miagostovich, E. V. Costa, and R. Galler. 2002. Outbreak of
jaundice and hemorrhagic fever in the Southeast of Brazil in 2001:
detection and molecular characterization of yellow fever virus. J
Med Virol 68:620-7; Mutebi, J. P., R. C. Rijnbrand, H. Wang, K. D.
Ryman, E. Wang, L. D. Fulop, R. Titball, and A. D. Barrett. 2004.
Genetic relationships and evolution of genotypes of yellow fever
virus and other members of the yellow fever virus group within the
Flavivirus genus based on the 3' noncoding region. J Virol
78:9652-65).
[0048] This methodology was described by Andino and collaborators
(Andino, P. R., Mcallister, M. N., 2002, Recombinant Bicistronic
Flaviviruses and Methods of Use Thereof, WO 02/089840) and,
basically, involved the creation of restriction sites for the
insertion of expression modules. These modules, for their part,
were constituted of a sequence derived from the enterovirus (Mengo
or poliovirus) or from a Pest virus (Bovine Diarrhea virus), to
which is directed the connection of the ribosomal sub-units in a
manner that the translation of the heterologous gene may happen
almost at the 3' NTR extremity, without needing a start in the 5'
NTR region, as is characteristic of eukaryotic RNA. In this manner,
the viral RNA acts as a bi-cystronic messenger, allowing the
initiation of protein synthesis as from 2 RNA points, independently
of the viral protein synthesis. These sequences are known as
internal ribosome entry sites (IRES) Such modules vary in size,
depending on the origin of the IRES and the heterologous gene to be
expressed.
[0049] FIG. 4 represents the insertion of the heterologous
sequences in the 3' NTR regions of the 17D virus. The insertions of
the Mengo enterovirus IRES (569 nt) and polio (663 nt) were done
through cloning in restriction sites (AscI and NotI), which are
adjacent to the protein P24 (693 nt) gene sequence of the human 1
immunodeficiency virus (through the NotI and PacI enzymes). The
total length of the insertions varied from 1090 to 1356 nt. The
restriction sites were initially introduced, as a set (AscI, NotI
and PacI), exactly 25 nucleotides after the termination codon
(nucleotide 10379 as from the 5' extremity).
[0050] The transfection of the Vero in culture cells with RNA
transcription in vitro, as from the cADN molds, allowed the viral
regeneration referent to the constructions traced out in FIG. 3.
Analysis of the resulting virus genomes, by means of nucleotide
sequencing of the amplification products of this region, showed the
elimination of the nucleotides. In the case of the construction
with the Mengo virus IRES, the genetic instability became evident
early in the first pass. The 17D-IRES-P24 virus present floating on
the culture surface, presenting a cytopathic effect, had lost part
of the 3' NTR region. The termination codon remained like that as
well as the first 25 nucleotides that extended up to the AscI site
and more than the 22 initial IRES nucleotides. 1437 nucleotides
were eliminated from this point, leaving only the last 339
nucleotides (from 508) in this region of the 17D virus. In the case
of the 17D-IRES-Polio-P24 virus, the genetic instability was
demonstrated by the sequencing of the 3' NTR region of the virus
present on the surface of the second pass in Vero cells. The
termination codon remained intact in the genome of this virus and
the first 19 nucleotides after it, following the elimination of a
total of 1398 nucleotides, including the IRES and P24. The last 484
nucleotides of the original 17D virus 3'NTR region remained intact.
This data showed that instability of the longer insertions in this
genome region.
[0051] The genetic instability of insertions in the Flavivirus
genome in the 3' NTR region is also corroborated by the data of
Pierson and collaborators (Pierson, T. C., M. S. Diamond, A. A.
Ahmed, L. E. Valentine, C. W. Davis, M. A. Samuel, S. L. Hanna, B.
A. Puffer, and R. W. Doms. 2005. An infectious West Nile virus that
expresses a GFP reporter gene. Virology 334:28-40), to obtain the
insertion of the expression modules similar to that described
above, but using the GFP gene as an indicator of viral replication.
Various virals isolated, analyzed after 2 passes in culture cells,
led to the loss of the nucleotides that compose the IRES, as well
as part do gene that codes the GFP.
[0052] The sixth possible approach in the use of the FA 17D virus
for the expression of heterologous antigens refers to the
development of replicons. These molecules correspond to parts of
the viral genome from which the structural genes necessary for the
production of viral particles were removed, although they
maintained all the elements necessary for the replication of the
RNA in itself. The amplification of the RNA in the transfected
cells cytoplasm allows the transitory expression of heterologous
genes, expression that suggests the possibility of the in
vaccination (Harvey, T. J., W. J. Liu, X. J. Wang, R. Linedale, M.
Jacobs, A. Davidson, T. T. Le, I. Anraku, A. Suhrbier, P. Y. Shi,
and A. A. Khromykh. 2004. Tetracycline-inducible packaging cell
line for production of Flavivirus replicon particles. J Virol
78:531-8; Khromykh, A. A. 2000. Replicon-based vectors of positive
strand RNA viruses. Curr Opin Mol Ther 2:555-69; Tannis, L. L., A.
Gauthier, C. Evelegh, R. Parsons, D. Nyholt, A. Khromykh; and J. L.
Bramson. 2005. Semliki forest virus and Kunjin virus RNA replicons
elicit comparable cellular immunity but distinct humoral immunity.
Vaccine 23:4189-94; Westaway, E. G., J. M. Mackenzie, and A. A.
Khromykh. 2003. Kunjin RNA replication and applications of Kunjin
replicons. Adv Virus Res 59:99-140). Jones and collaborators
(Jones, C. T., C. G. Patkar, and R. J. Kuhn. 2005. Construction and
applications of yellow fever virus replicons. Virology 331:247-59)
recently described a series of replicons based on the 17D virus
genome. These replicons consist of the 17D virus genome deprived of
the structural region that codifies the genes of the C-prM-E
proteins (nucleotides 179 to 2382). Only the first 21 amino acids
of C and the last 24 residues of E were kept. Three heterologous
genes were inserted and expressed in the replicons in a manner
dependent on the RNA replication, substituting the structural gene
sequences. Meanwhile, no evidence of genetic stability of the
heterologous genes, as well as studies on the immunogenicity of
their products has been approached. The expression levels of the
heterologous proteins also were not specified, in a way that use of
this system for the development of new vaccines was not
established. The principal applications of this expressions system,
based on the 17D virus genome, are limited to studies on RNA viral
replication mechanisms, RNA packaging and formation of viral
particles.
[0053] It should be considered that the various methodologies
described in this document for the insertion and expression of
heterologous genes into recombinants flavivirus, as well as the
object of this document, are also approaches with broad application
in the expression of the whole or part of the viral genome in
plasmids and DNA and RNA replicons, or even in other non-infective
or infective viral systems. Khromykh, A. A., Westaway, E. G., 1997.
Subgenomic replicons of the flavivirus Kunjin: construction and
applications. J. Virol. 71 (2), 1497-1505; Kofler, R. M., Aberle,
J. H., Aberle, S. W., Allison, S. L., Heinz, F. X., Mandl, C. W.,
2004. Mimicking live flavivirus immunization with a noninfectious
RNA vaccine. Proc. Natl. Acad. Sci. U.S.A. 101, 1951-1956; Aberle,
J. H., Aberle, S. W., Kofler, R. M., Mandl, C. W., 2005. Humoral,
and cellular immune response to RNA immunization with flavivirus
replicons derived from tick-borne encephalitis virus. J. Virol. 79,
15107-15113; Aleshin, S. E., Timofeev, A. V., Khoretonenko, M. V.,
Zakharova, L. G., Pashvykina, G. V., Stephenson, J. R., Shneider,
A. M., Altstein, A. D. 2005. Combined prime-boost vaccination
against tick-borne encephalitis (TBE) using a recombinant vaccinia
virus and a bacterial plasmid both expressing TBE virus
non-structural NS1 protein. BMC Microbiology 5:45-49; Konishi, E.,
Kosugi, S., Imoto, J. 2006. Dengue tetravalent DNA vaccine inducing
neutralizing antibody and an amnestic responses to four serotypes
in mice Vaccine 24: 2200-2207; Mason, P. W., Shustov, A. V.,
Frolov, I. 2006). Production and characterization of vaccines based
on flaviviruses defective in replication. Virology 351 432-443.
[0054] The seventh and last possible approach up to the moment,
using the FA 17D virus as an expression vector, refers to the
object of this current invention. In this case, given the
impossibility of regenerating 17D Viruses containing insertions
longer than viral epitopes (>36 amino acids), whether in
inter-genetic regions cleaved by viral protease or in the 3'NTR
region, our group established a new approach for this purpose. This
alternative is based on the insertion of the heterologous
sequences--including, but not limited to those of the 10 to 2000
nucleotides--between the genes that code the E and NS1 proteins of
the 17D virus. This approach is similar, theoretically, to the
insertion between genes that code proteins cleaved by viral
protease. Meanwhile, the cleavage between E and NS1 is done by a
cellular enzyme (signalase) present in the endoplasmatic reticule,
in such a manner that the cleavage sites and other structural
elements necessary of viral viability are different, constituting a
novelty in this methodology.
[0055] The endoplasmatic reticule serves as an entrance port for
the proteins destined to all the compartments of the secreting via,
that is, for the plasmatic membrane, the cell exterior and
endocytic organelles. The majority of the membrane proteins and
secreting via are co-traductionally integrated in the RE membrane,
or pass by this to the RE lumen via specific membrane sites.
[0056] The addressing of the proteins to the RE is triggered by the
presence of signal sequences in these proteins. The signal
sequences are highly degenerated and essentially, uncharged, with a
predominance of hydrophobic residues, and with an average size of 7
to 12 protein amino acids (von Heijne, G. 1990. The signal peptide.
J Membr Biol 115:195-201).
[0057] In a first stage, the signal sequence is recognized,
beginning to emerge from the tunnel exit of the ribosome during the
proteic translation, by a signal recognition particle, of a
ribonucleoproteic nature (SRP: "signal recognition particle);
(Halic, M., and R. Beckmann. 2005. The signal recognition particle
and its interactions during protein targeting. Curr Opin Struct
Biol 15:116-25; Walter, P., and A. E. Johnson. 1994. Signal
sequence recognition and protein targeting to the endoplasmic
reticulum membrane. Annu Rev Cell Biol 10:87-119). Then a
connection of the motif to a hydrophobic split occurs composed of a
group of methionines in the SRP 54 kDa sub-unit (Keenan, R. J., D.
M. Freymann, P. Walter, and R. M. Stroud. 1998. Crystal structure
of the signal sequence binding subunit of the signal recognition
particle. Cell 94:181-91; Lutcke, H., S. High, K. Romisch, A. J.
Ashford, and B. Dobberstein. 1992. The methionine-rich domain of
the 54 kDa subunit of signal recognition particle is sufficient for
the interaction with signal sequences. Embo J 11:1543-51; Zopf, D.,
H. D. Bernstein, A. E. Johnson, and P. Walter. 1990. The
methionine-rich domain of the 54 kd protein subunit of the signal
recognition particle contains an RNA binding site and can be cross
linked to a signal sequence. Embo J 9:4511-7). In eukaryotes, this
association causes a delay in the elongation of polypeptide
synthesis during the translation process. This complex connects
itself to the RE membrane by a specific receptor (Keenan, R. J., D.
M. Freymann, R. M. Stroud, and P. Walter. 2001. The signal
recognition particle. Annu Rev Biochem 70:755-75). Both the SRP
complex receptor--signal peptide and the SRP are GTPases (Egea, P.
F., S. O, Shan, J. Napetschnig, D. F. Savage, P. Walter, and R. M.
Stroud. 2004. Substrate twinning activates the signal recognition
particle and its receptor. Nature 427:215-21; Focia, P. J., I. V.
Shepotinovskaya, J. A. Seidler, and D. M. Freymann. 2004.
Heterodimeric GTPase core of the SRP targeting complex. Science
303:373-7), that undergo reciprocal activation, causing the signal
peptide to be released from the addressing complex and taken to the
ribosome tunnel exit alignment, as to the aquatic entrance channel
of the RE protein, or translocon (Beckmann, R., C. M. Spahn, N.
Eswar, J. Helmers, P. A. Penczek, A. Sali, J. Frank, and G. Blobel.
2001. Architecture of the protein-conducting channel associated
with the translating 80S ribosome. Cell 107:361-72; Menetret, J.
F., A. Neuhof, D. G. Morgan, K. Plath, M. Radermacher, T. A.
Rapoport, and C. W. Akey. 2000. The structure of ribosome-channel
complexes engaged in protein translocation. Mol Cell
6:1219-32).
[0058] The translocons are comprised of various RE membrane
proteins that associate themselves in such a manner as to form an
aqueous pore, through which secreted proteins and domain protein
lumen from the membrane pass from the cytosol to the RE (Johnson,
A. E., and M. A. van Waes. 1999. The translocon: a dynamic gateway
at the ER membrane. Annu Rev Cell Dev Biol 15:799-842). The
translocon has an important role in the integration of the membrane
proteins (Do, H., D. Falcone, J. Lin, D. W. Andrews, and A. E.
Johnson. 1996. The cotranslational integration of membrane proteins
into the phospholipid bi-layer is a multi-step process. Cell
85:369-78; Heinrich, S. U., W. Mothes, J. Brunner, and T. A.
Rapoport. 2000. The Sec61p complex mediates the integration of a
membrane protein by allowing lipid partitioning of the
transmembrane domain. Cell 102:233-44; Higy, M., T. Junne, and M.
Spiess. 2004. Topogenesis of membrane proteins at the endoplasmic
reticulum. Biochemistry 43:12716-22; Martoglio, B., and B.
Dobberstein. 1995. Protein insertion into the membrane of the
endoplasmic reticulum: the architecture of the translocation site.
Cold Spring Harb Symp Quant Biol 60:41-5; Mothes, W., S. U.
Heinrich, R. Graf, I. Nilsson, G. von Heijne, J. Brunner, and T. A.
Rapoport. 1997. Molecular mechanism of membrane protein integration
into the endoplasmic reticulum. Cell 89:523-33), therefore, in the
topology of these proteins. The mechanism by which the topology of
a protein is directed by the cellular translocation machinery is
complex. Thus, a protein with a single membrane domain needs to
translocate certain RE Lumen domains, leave others in the cytosol
and guide the transmembrane segment and move the aqueous
utranslocation channel to the lipidic bi-layer. Characteristics
such as size and hydrophobic of the transmembrane segments, Charge
distribution of the regulatory residues and size and state of the
binding regulatory residues may affect the protein topology in the
membrane (Beltzer, J. P., K. Fiedler, C. Fuhrer, 1. Geffen, C.
Handschin, H. P. Wessels, and M. Spiess. 1991. Charged residues are
major determinants of the transmembrane orientation of a
signal-anchor sequence. J. Biol Chem 266:973-8; Gafvelin, G., M.
Sakaguchi, H. Andersson, and G. von Heijne. 1997. Topological rules
for membrane protein assembly in eukaryotic cells. J Biol Chem
272:6119-27; Higy, M., T. Junne, and M. Spiess. 2004. Topogenesis
of membrane proteins at the endoplasmic reticulum. Biochemistry
43:12716-22; Parks, G. D., and R. A. Lamb. 1991. Topology of
eukaryotic type II membrane proteins: importance of N-terminal
positively charged residues flanking the hydrophobic domain. Cell
64:777-87; Sakaguchi, M., R. Tomiyoshi, T. Kuroiwa, K. Mihara, and
T. Omura. 1992. Functions of signal and signal-anchor sequences are
determined by the balance between the hydrophobic segment and the
N-terminal charge. Proc Natl Acad Sci USA 89:16-9; Spiess, M. 1995.
Heads or tails--what determines the orientation of proteins in the
membrane. FEBS Lett 369:76-9; von Heijne, G. 1989. Control of
topology and mode of assembly of a polytopic membrane protein by
positively charged residues. Nature 341:456-8; Wahlberg, J. M., and
M. Spiess. 1997. Multiple determinants direct the orientation of
signal-anchor proteins: the topogenic role of the hydrophobic
signal domain. J Cell Biol 137:555-62).
[0059] At the translocon entrance, the signal peptide is guided in
relation to the membrane to the start of the translocation of its
N- or C-terminal sequence through the membrane. The hydrophilic
fraction of the polypeptide is transferred then, by the aqueous
channel to the RE lumen, and the signal released laterally in the
lipidic membrane. On the other side, other protein segments may
stop or restart their transference to the RE or integrate
themselves to the RE lipidic bi-layer as transmembrane domains
(TM), and may generate proteins with multiple insertions of alpha
helices in the lipidic bi-layer (Higy, M., T. Junne, and M. Spiess.
2004. Topogenesis of membrane proteins at the endoplasmic
reticulum. Biochemistry 43:12716-22). The TM domains that promote
integration to the membrane generally consist of 20 to 25 non polar
amino acids, a size sufficient to transpass the membrane lipidic
bi-layer.
[0060] FIG. 5 is referent to the processing of the Flavivirus
polyprotein by cellular and viral proteases. In (A), viral
polyprotein protelic sites for generation of the structural
proteins, and non structural viral envelope components involved in
the viral replication process. The stars (.star-solid.) represent
the glycosilation connected to the asparagine of certain vital
proteins, the grey arrows highlight the signal peptidase cleavage
sites, and the gray triangles represent the sites for the
proteolysis of the viral proteolytic complex (NS2B/NS3). The (?)
symbol represents the cleavage point between the NS1/NS2A viral
proteins, in which acts a still undetermined cellular protease. The
prM protein is later processed by the furine protease in the
release of the cell viral particle (Stadler, K., Allison, S. L.,
Schalich, J. and Heinz, F. X. 1997. Proteolytic activation of
tick-borne encephalitis virus by furin. J. Virol. 71:8475-8481). In
(B), topology of the prM and E structural protein membranes, which
are translocated to the cellular RE and are found associated to
their membrane by means of two domains of transmembranar helices,
that are indicated by cylinders. The signalase cleavage sites and
the NS2B/NS3 viral protease are signed according to the
nomenclature below the figure.
[0061] In Flavivirus, the polyprotein viral precursor of the
structural and non structural proteins pass through the RE membrane
at various points and are processed thus: on the lumen side of the
RE membrane, by the cellular enzymes, signalases, and on the
cytoplasmic side, by the NS2B/NS3 proteolytic viral complex, (FIG.
5A). The RE and the viral particle assembly site, which are formed
by the transport of the virions to the cell exterior, by means of
the exotic or secretory via (Mackenzie, J. M., and E. G. Westaway.
2001. Assembly and maturation of the flavivirus Kunjin virus appear
to occur in the rough endoplasmic reticulum and along the secretory
pathway, respectively. J Viral 75:10787-99).
[0062] Cleavage of the polyprotein in the C/prM, prM/E and E/NS1
intergenic sites, done by signalase, generate the prM and E
structural proteins, that remain anchored in the luminal face of
the RE membrane and form the flavivirus viral envelope. The prM and
E proteins of the flavivirus envelope are type I membrane proteins
(Higy, M., T. Junne, and M. Spiess. 2004. Topogenesis of membrane
proteins at the endoplasmic reticulum. Biochemistry 43:12716-22;
Paetzel, M., A. Karla, N. C. Strynadka, and R. E. Dalbey. 2002.
Signal peptidases. Chem Rev 102:4549-80); That is, the
translocation of these proteins to the RE lumen is started by the
amino extremity of the polypeptide chain, which associates itself
to the translocon, undergoing cleavage by signalase. This leads to
the removal of the signal peptide and consequent release of the
processed N-terminal from the protein to the RE lumen RE (FIG. 5
B). The prM and E proteins are anchored by their carboxi-terminal
in the cellular and viral membranes. These domains are composed of
two hydrophobic stretches separated by a small fragment containing
at least one hydrophobic residue. Thus, on the side of the RE
lumen, prM and E form a stable heterodimer that will form the viral
envelope (Allison, S. L., K. Stadler, C. W. Mandl, C. Kunz, and F.
X. Heinz. 1995. Synthesis and secretion of recombinant tick-borne
encephalitis virus protein E in soluble and particulate form. J
Virol 69:5816-20; Konishi, E., and P. W. Mason. 1993. Proper
maturation of the Japanese encephalitis virus envelope glycoprotein
requires cosynthesis with the premembrane protein. J Virol
67:1672-5; Lorenz, I. C., S. L. Allison, F. X. Heinz, and A.
Helenius. 2002. Folding and dimerization of tick-borne encephalitis
virus envelope proteins prM and E in the endoplasmic reticulum. J
Virol 76:5480-91). Thus, the prM and E viral envelope proteins have
two transmembrane domains (TM1 and 2; FIG. 5, panel B), which
promote their association to the lipidic bi-layer, the first, in
the direction amino to the carboxi terminal of the polypeptide
chain, consists of a sequence of transference stops of the protein
to the RE lumen, and the second, from the signal sequence for
importation and processing in the RE.
[0063] The two TM domains of the E and prM proteins form
anti-parallel alpha-helices, without contact between themselves,
which cross the RE Lumen membrane to the cytoplasm and Lumen again
(FIG. 5, panel B). For their part, the fragment of 4 to 6 amino
acids, rich in polar residues that serve as a connection between
these two TM domains, appear to be associated to the internal layer
of the phospholipid polar groups of the membrane (Allison, S. L.,
K. Stiasny, K. Stadler, C. W. Mandl, and F. X. Heinz. 1999. Mapping
of functional elements in the stem-anchor region of tick-borne
encephalitis virus envelope protein E. Viral 73:5605-12;
Mukhopadhyay, S., R. J. Kuhn, and M. G. Rossmann. 2005. A
structural perspective of the flavivirus life cycle. Nat Rev
Microbiol 3:13-22; Stiasny, K., S. L. Allison, A. Marchler-Bauer,
C. Kunz, and F. X. Heinz. 1996. Structural requirements for
low-pH-induced rearrangements in the envelope glycoprotein of
tick-borne encephalitis virus. J Virol 70:8142-7; Zhang, W., P. R.
Chipman, J. Corver, P. R. Johnson, Y. Zhang, S. Mukhopadhyay, T. S.
Baker, J. H. Strauss, M. G. Rossmann, and R. J. Kuhn. 2003.
Visualization of membrane protein domains by cryo-electron
microscopy of dengue virus. Nat Struct Biol 10:907-12).
[0064] The protein of capsid (C) is separated from the prM,
precursor protein of the membrane protein or M, by a signal
sequence that directs the translation of the prM. Meanwhile, so
that cleavage of the peptide signal occurs and formation of the
COOH terminal of the C protein C and the prM N-terminal, it is
strictly necessary that the NS2B/NS3 proteolytic complex first
catalyzes the COOH terminal COOH of the C protein on the
cytoplasmatic side of the RE membrane RE (FIG. 5 B). This is the
only site of the polyprotein region containing the structural
proteins that are processed by this enzyme (Amberg, S. M., A.
Nestorowicz, D. W. McCourt, and C. M. Rice. 1994. NS2B-3
proteinase-mediated processing in the yellow fever virus structural
region: in vitro and in vivo studies. J Virol 68:3794-802; Lobigs,
M. 1993. Flavivirus premembrane protein cleavage and spike
heterodimer secretion require the function of the viral proteinase
NS3. Proc Natl Acad Sci USA 90:6218-22; Yamshchikov, V. F., and R.
W. Compans. 1993. Regulation of the late events in flavivirus
protein processing and maturation. Virology 192:38-51). It is only
after this cleavage that the cleavage of the signal peptide by the
signal peptidase happens, probably due to the conversion of the
cleavage signal peptidase site from a cryptic conformation to an
accessible one (Lobigs, M. 1993. Flavivirus premembrane protein
cleavage and spike heterodimer secretion require the function of
the viral proteinase NS3. Proc Natl Acad Sci USA 90:6218-22). The
cleavage process of the prM protein signal peptide by the signal
peptidase is modulated by the initial hydrolysis of the C protein
C-terminal by viral protease. Thus, it is only after the cleavage
and generation of the mature C protein that the hydrolysis of the
signal peptide occurs, and the consequent release of the prM
protein N-terminal in the RE lumen. This stage is preserved between
the Flavivirus, indicating its regulatory nature during the
processing of the polyprotein structural region (Amberg, S. M., and
C. M. Rice. 1999. Mutagenesis of the NS2B-NS3-mediated cleavage
site in the Flavivirus capsid protein demonstrates a requirement
for coordinated processing. J Virol 73:8083-94; Stocks, C. E., and
M. Lobigs. 1998. Signal peptidase cleavage at the flavivirus C-prM
junction: dependence on the viral NS2B-3 protease for efficient
processing requires determinants in C, the signal peptide, and prM.
J Virol 72:2141-9). In this sense, it was shown that this
coordinated processing is critical for the incorporation of the
nucleocapsid during the formation of the viral particles in the RE
(Lee, E., C. E. Stocks, S. M. Amberg, C. M. Rice, and M. Lobigs.
2000. Mutagenesis of the signal sequence of yellow fever virus prM
protein: enhancement of signalase cleavage In vitro is lethal for
virus production. J Virol 74:24-32; Lobigs, M., and E. Lee. 2004.
Inefficient signalase cleavage promotes efficient nucleocapsid
incorporation into budding flavivirus membranes. J Virol 78:178-86;
Stocks, C. E., and M. Lobigs. 1998. Signal peptidase cleavage at
the flavivirus C-prM junction: dependence on the viral NS2B-3
protease for efficient processing requires determinants in C, the
signal peptide, and prM. J Virol 72:2141-9). Therefore, for
coordination of the cytosolic cleavages, and the RE lumen RE in the
C/prM junction, it is indispensable that an efficient incorporation
of the nucleocapsid to the membranes containing the viral envelope
proteins occurs, because the brewing of the subviral particles,
containing only the viral envelope proteins, do not depend on the C
protein or the assembly of the nucleocapsid (Allison, S. L., K.
Stadler, C. W. Mandl, C. Kunz, and F. X. Heinz. 1995. Synthesis and
secretion of recombinant tick-borne encephalitis virus protein E in
soluble and particulate form. J Virol 69:5816-20; Lorenz, I. C., S.
L. Allison, F. X. Heinz, and A. Helenius. 2002. Folding and
dimerization of tick-borne encephalitis virus envelope proteins prM
and E in the endoplasmic reticulum. J Virol 76:5480-91).
[0065] The C-terminal portion of the prM protein contains two
adjacent hydrophobic stretches, interrupted by a charged residue;
that act, the first transmembrane stretch, as a stop signal for the
prM transference, and the second, as a signal sequence for the
translocation of the E protein to the RE (Markoff, L. 1989. In
vitro processing of dengue virus structural proteins: cleavage of
the premembrane protein. J Virol 63:3345-52; Ruiz-Linares, A., A.
Cahour, P. Despres, M. Girard, and M. Bouloy. 1989. Processing of
yellow fever virus polyprotein: role of cellular proteases in
maturation of the structural proteins. J Viral 63:4199-209). Two
adjacent transmembrane sequences act in the same manner, through
the stoppage of the E protein translocation and the entrance of the
RE from the NS1 protein. In a general fashion, the processing by
signal peptidases is important for the importation of the prM, E
and NS1 proteins to the RE, and for the generation of their extreme
N-terminal.
[0066] Cocquerel and collaborators (Cocquerel, L., C. Wychowski, F.
Minner, F. Penin, and J. Dubuisson. 2000. Charged residues in the
transmembrane domains of hepatitis C virus glycoproteins play a
major role in the processing, sub-cellular localization, and
assembly of these envelope proteins. J Virol 74:3623-33), when they
analyzed the C-terminal sequences of the Flavivirus viral envelope
proteins, could demonstrate that this organization is very similar
to that found in the Hepatitis C virus and in other members of the
Flaviviridae Family. It can also be determined, that the sequences
which connect the two TM domains, within the different groups, have
specific standards related to these different virus groups; but the
presence of at least one positively charged group (R or K) in this
region was general, indicating an important function. The
comparison of this fragment between different virus groups of the
Flaviviridae family point to a wide variability of the amino acid
sequences of the connection segment of the TM domains TM between
these different groups, indicating that these should be related to
molecular interactions that would occur specifically within these
groups (Cocquerel, L., C. Wychowski, F. Minner, F. Penin, and J.
Dubuisson. 2000. Charged residues in the transmembrane domains of
hepatitis C virus glycoproteins play a major role in the
processing, sub-cellular localization, and assembly of these
envelope proteins. J Virol 74:3623-33). Notably, the connection
segments of the TM segments of the structural proteins in
Flavivirus are longer than their counterparts in other groups,
presenting various polar residues preserved (N, Q, S and/or T).
Another characteristic consists of the fact that the second
Flavivirus TM domain is noticeably larger, with around 19-residues,
in relation to the other viral groups of the family, with around 12
to 13 residues. Mutations in the prM and E TM domains affect the
formation of the subviral particles or effective viruses, but
appear not to affect the heterodimerization capacity of the prM and
E proteins, indicating that these domains are sensitive to a change
in their amino acid sequence, and the interactions between the
alpha helices of the domains have a role in the formation of the
viral envelope (Op De Beeck, A., R. Molenkamp, M. Caron, A. Ben
Younes, P. Bredenbeek, and J. Dubuisson. 2003. Role of the
transmembrane domains of prM and E proteins in the formation of
yellow fever virus envelope. J Virol 77:813-20). Recently, it could
be established that the chimeric proteins, expressing these
Flavivirus prM and E protein transmembrane domains, situated
themselves mainly in the RE, indicating that these domains contain
retention signals in the RE. It is probable that accumulation of
these proteins in the RE occurs, leading to the heterodimerization
of these and the brewing of the immature viral particles in the RE
lumen, as from which will start the secretion via of the virions to
the extracellular medium.
[0067] In relation to the Flavivirus E protein, these TM domains
make part of other structural elements situated in the last one
hundred amino acid residues of the C-terminal of this protein, a
region denominated stem-anchor (Allison, S. L., K. Stiasny, K.
Stadler, C. W. Mandl, and F. X. Heinz. 1999. Mapping of functional
elements in the stem-anchor region of tick-borne encephalitis virus
envelope protein E. J Virol 73:5605-12). This region is not part of
the three-dimensional structure elucidated for the E protein
ectodomain of different Flaviviruses, due to its hydrophobic
character (Modis, Y., S. Ogata, D. Clements, and S. C. Harrison.
2003. A ligand-binding pocket in the dengue virus envelope
glycoprotein. Proc Natl Acad Sci USA 100:6986-91; Rey, F. A., F. X.
Heinz, C. Mandl, C. Kunz, and S. C. Harrison. 1995. The envelope
glycoprotein from tick-borne encephalitis virus at 2 A resolution.
Nature 375:291-8). In the TBE virus E protein, the stem-anchor
region covers the residues from 401 to 496 (Allison, S. L., K.
Stiasny, K. Stadler, C. W. Mandl, and F. X. Heinz. 1999. Mapping of
functional elements in the stem-anchor region of tick-borne
encephalitis virus envelope protein E. J Virol 73:5605-12; Stiasny,
K., S. L. Allison, A. Marchler-Bauer, C. Kunz, and F. X. Heinz.
1996. Structural requirements for low-pH-induced rearrangements in
the envelope glycoprotein of tick-borne encephalitis virus. J Virol
70:8142-7)
[0068] The stem region connects the E protein ectodomain with the
transmembrane region. This domain is composed of two alpha-helices,
denominated H1 and H2, separated by a connection sequence (CS)
highly preserved in the Flavivirus, see FIG. 7A (Stiasny, K.,
Allison, S. L., Marchler-Bauer, A., Kunz, C. and F. X. Heinz. 1996.
Structural requirements for low-pH-induced rearrangements in the
envelope glycoprotein of tick-borne encephalitis virus. J. Virol.
70: 8142-8147; Allison, S. L., Stiasny, K., Stadler, K., Mandl, C.
W. and F. X. Heinz. 1999. Mapping of functional elements in the
stem-anchor region of tick-borne encephalitis virus envelope
protein E. J. Virol. 73, 5605-5612). The first helix, H1, forms an
angle with the external layer of membrane lipids and the second, H2
finds itself placed above the side of the external membrane, with
the hydrophobic side turned to the hydrophobic side of the membrane
(Mukhopadhyay, S., R. J. Kuhn, and M. G. Rossmann. 2005. A
structural perspective of the flavivirus life cycle. Nat Rev
Microbiol 3:13-22; Zhang, W., P. R. Chipman, J. Corver, P. R.
Johnson, Y. Zhang, S. Mukhopadhyay, T. S. Baker, J. H. Strauss, M.
G. Rossmann, and R. J. Kuhn. 2003. Visualization of membrane
protein domains by cryo-electron microscopy of dengue virus. Nat
Struct Biol 10:907-12). It is postulated that the stem region makes
contact with the side of the E protein closest to the lipidic
membrane, neutralizing the electrostatic repulsion between the
phospholipid radicals of the external lipidic membrane and the
interior surface of the E protein ectodomain (Zhang, Y., W. Zhang,
S. Ogata, D. Clements, J. H. Strauss, T. S. Baker, R. J. Kuhn, and
M. G. Rossmann. 2004. Conformational changes of the flavivirus E
glycoprotein. Structure (Camb) 12:1607-18). The H1 region appears
to be involved in the formation of E protein homotrimers during the
fusion process (Allison, S. L., K. Stiasny, K. Stadler, C. W.
Mandl, and F. X. Heinz. 1999. Mapping of functional elements in the
stem-anchor region of tick-borne encephalitis virus envelope
protein E. J Viral 73:5605-12). In this way, truncated proteins
lacking the stem-anchor domains are secreted as dimers, undergo
dissociation in acid pH, which causes the fusion process, but does
not manage to form trimers. On the other side, proteins truncated
immediately after H1 may form trimers in low pH, indicating that
this region may be involved in the conversion of monomers to
trimers during the fusion process to the endosomic membrane. The
second stem element, CS, is highly preserved in Flavivirus
(Stiasny, K., S. L. Allison, A. Marchler-Bauer, C. Kunz, and F. X.
Heinz. 1996. Structural requirements for low-pH-induced
rearrangements in the envelope glycoprotein of tick-borne
encephalitis virus. J Virol 70:8142-7), indicating a still
undefined important function.
[0069] The second anphipatic element of the stem--H2, jointly with
the first transmembrane domain (TM1), are important for the
stability of the prM/E dimer and may be interacting directly with
prM.
[0070] As was previously discussed, the two TM1 and TM2
transmembrane elements of the E protein C-terminal constitute a
membrane double anchor. The TM2 domain appears to be dispensable in
the formation of subviral particles (Allison, S. L., K. Stiasny, K.
Stadler, C. W. Mandl, and F. X. Heinz. 1999. Mapping of functional
elements in the stem-anchor region of tick-borne encephalitis virus
envelope protein E. J Virol 73:5605-12), meanwhile it is an
important functional component in the formation of viral particles
and viral infection, because it functions as a signal peptide for
the translocation of the NS1 protein to the RE lumen.
SUMMARY OF THE INVENTION
[0071] The object of the current invention is the development of a
vaccine virus, in especial a Flavivirus vaccine, obtained from a
cloned viral cDNA, having phenotypical characteristics of
attenuation and immunogenicity, and that is capable of expressing
and inducing a response immune to proteins or fragments of
heterologous proteins.
[0072] The first discovery of the current invention is related to a
method for the production of the recombinant virus containing
sequences of codifying nucleotides of all or part of the
heterologous proteins, characterized by the following steps: [0073]
a) modification of the heterologous sequences in such a manner that
they when cloned and expressed in the vector virus, they have in
their 5' portion, nucleotides present at the extreme 5' of the NS1
gene of this vector virus or the other viruses or functionally
equivalent sequences, and in their 3' portion, the genomic region
corresponding to all or part of the stem and anchor domains of the
E of this vector virus or other viruses functionally equivalent
sequences, and thus do not compromise the structure and the
replication of said vector virus; [0074] b) insertion of the
modified heterologous sequences in (a) in the intergenic region at
the E protein structural level and of the non structural NS1 of the
vector virus; [0075] c) obtaining the non pathogenic recombinant
virus and holder of the immunological properties, containing the
heterologous sequences stably integrated in the viral genome
according to the insertion in the region described in (b) and, like
this, expressing the heterologous antigen in such a way that it
induces the appropriate immune response.
[0076] The second discovery of the current invention is referent to
a DNA construction, which consists essentially of (i) a vector
itself; (ii) a genetically stable virus genome, in which will be
inserted modified heterologous sequences; and (iii) the said
modified heterologous sequences and introduced into an insertion
site in the intergenic region at the E protein structural and the
NS1 non structural viral level during stage (a) of the method cited
above.
[0077] The third discovery of this invention is associated to the
recombinant virus produced according to the above cited method,
which contains sequences of codifying nucleotides of all or part of
the modified heterologous proteins according to stage (a) of the
current invention's method and inserted in the intergenic region at
the E protein structural and the NS1 non structural of the vector
virus stably integrated into the viral genome; for not being
pathogenic; for having immunological properties and for expressing
the heterologous antigen in a manner that it induces an appropriate
immune response, directed to the vector virus or virulent forms
homologous to it and the exogenous protein expressed by it.
[0078] The fourth discovery of the current invention corresponds to
the vaccine composition to immunize against the vector virus of
virulent forms homologous to it and/or other pathogens, of which
the gene of the heterologous protein, expressed by the recombinant
virus originated, to which it is constituted, principally, by the
said virus obtained according to the above cited method.
BRIEF DESCRIPTION OF DRAWINGS
[0079] FIG. 1: Genome organization of Flaviviruses.
[0080] FIG. 2: Scheme of structural organization of Flaviviruses,
representing the viral particle under its immature intracell and
mature extracell forms.
[0081] FIG. 3: Strategy for inserting a reporter gene into FA 17D
virus genome in the intergenic regions processed by NS2B/NS3 viral
protease.
[0082] FIG. 4: Insertion of heterologous sequences in the 3'NTR
region of 17D virus.
[0083] FIG. 5: Processing of polyprotein of flaviviruses by cell
and virus proteases.
[0084] FIG. 6: Cleavage point of the signal peptidase in the E and
NS1 intergenic region of the flaviviruses.
[0085] FIG. 7: Comparison of E and EGFP protein topology cloned and
expressed in the intergenic region between E and NS1 proteins, in
the membrane of ER in a recombining flavivirus.
[0086] FIG. 8: Regions of E and NS1 protein used in the assembly of
the cassette of EGFP protein Expression, at FA 17D infectious
clone.
[0087] FIG. 9: Sequence of amino acids foreseen for heterologous
insertion, containing the gene of EGFP cloned in the E/NS1
intergenic region.
[0088] FIG. 10: Map of the T3 Esa EGFP recombining plasmid.
[0089] FIG. 11: Analysis of the Vero cells monolayer infection
kinetics by the 17D/Esa/5.1.sub.glic virus by confocal
microscopy.
[0090] FIG. 12: Comparative diagram of the genome region, comprised
between prM and NS1 proteins, in virus of 17D vaccinal phenotype
and recombining 17D/Esa/5.1glic, and the respective genome
positions.
[0091] FIG. 13: Propagation properties of the recombining
17D/Esa/5.1.sub.glic FA virus in comparison to vaccinal 17D/14 and
17DD Vero cells monolayers.
[0092] FIG. 14: Analysis of the EGFP fluorescent protein expression
kinetics by the 17D/Esa/5.1.sub.glic recombining virus in Vero
cells and by flow cytometry.
[0093] FIG. 15: Degree of protection afforded by immunization of
BABL/c mice with the 17D/Esa/5.1.sub.glicT3 virus, on the challenge
through intracerebral inoculation with 6.000 PFU of the virus of
yellow fever vaccinal strain 17DD.
[0094] FIG. 16: 0.8% agarose gel electrophoreses analysis of
obtained fragments by PCR reactions of T3 and T3 Esa EGFP plasmids
and viral RNA preparations of control 17D/E200 and recombinant
17D/Esa/5.1.sub.glic viruses. Schematic illustrations of potential
experimental synthesis resulting from direct replications of 288
nucleotides that occur in the genome of recombinant 17D/Esa/5.1glic
virus.
[0095] FIG. 17: Genetic stability of 17D/Esa/5.1 glic virus after
ten serial passages in Vero cell monolayers. Analysis of two
independent series of serial passages, using RT-PCR and FACS
methods.
[0096] FIG. 18: Genetic stability of viral 6 clone, purified by
lyse plaque isolation of 17D/Esa/5.1 glic virus, and submitted to
15 serial passages in Vero cell monolayers. Sample Analysis using
RT-PCR e FACS methods.
[0097] FIG. 19: Physical map of recombinant pNSK Den4/FA/Esa/EGFP
plasmid with 14,498 base pairs.
[0098] FIG. 20: (A) Position scheme of heterologous expression
cartridge between E gene of Den4 virus and NS1 protein gene of FA
virus. (B) Position of structural genes, of NS1 gene and of
different domains of heterologous expression cartridge in the
genome of 17D/Den4/FA/Esa/EGFP/6 virus.
[0099] FIG. 21: Kinetics spreading proprieties of chemiric
17D/Den4/FA/Esa/EGFP/6 virus in Vero cell monolayers.
[0100] FIG. 22: Genetic stability of 17D/Den4/FA/Esa/EGFP/6 virus
after serial seeding in Vero cell monolayers (20 passages in
total).
[0101] FIG. 23: Physical map of recombinant T3 Esa.sub.trun EGFP
plasmid.
[0102] FIG. 24: Analysis by fluorescence optical microscopy of Vero
cell monolayers infected by 17D/Esa.sub.trun/4.sub.glic and
17D/Esa/5.1.sub.glic viruses 72 and 96 hours after infection.
[0103] FIG. 25: Regional scheme of viral genome included within prM
protein and NS1 encoding genes in recombinant
17D/Esa.sub.trun/4.sub.glic, virus, detailing amino acid sequence
of truncated stem anchor region associated to heterologous
expression cartridge.
[0104] FIG. 26: Kinetics graphics of Vero cell monolayer infections
by 17D/Esa.sub.trun/4.sub.glic virus in a 0.02 moi.
DETAILED DESCRIPTION OF THE INVENTION
[0105] Initially, important definitions are presented for the
perfect understanding of the scope of this invention, namely:
[0106] Vector virus: virus obtainable from a cDNA template, the
genomic sequence of which was modified so as to allow cloning and
expression of nucleotide sequences which codify proteins or parts
of heterologous proteins originating from other pathogens,
specifically in the intergenic region at structural E protein level
and non structural NS1. This virus can be, but is not limited to, a
Flavivirus, especially the 17D strain amarilic virus or its
offshoot. Additionally, it may be a wild virus, attenuated or
genetically modified. [0107] Recombining virus: a virus that
contains, inserted in its genome, specifically in the intergenic
region at E structural and NS1 non structural protein level,
sequences of codifying nucleotides of the whole or part of
heterologous proteins from other pathogens. This virus can be,
though not limited to, a Flavivirus, especially the 17D strain
amarilic virus or its offshoot. Additionally, it can be a wild
virus, attenuated or genetically modified. The recombining
flaviviruses can also be chimerical viruses in which the prM/E
genes of a flavivirus are replaced by homologous genes of another
flavivirus. Such viruses are useful in the development of vaccines
for human and animal use, granting immune response not only in
relation to Yellow fever or other virus occasioned disease, as well
as in relation to diseases provoked by said other pathogens. And,
in the specific case of such vaccinal application, they should be
produced in embryonated hen eggs or in certified cells culture for
the production of vaccines for human use (such as Vero cells,
MRC-5, primary cultures of chick embryo fibroblast or others in
which the recombining viruses will replicate) And, subsequently,
may be utilized, in conjunction with at least one pharmaceutically
acceptable vehicle, in vaccinal compositions. [0108] Attenuated
virus: a virus which ability for causing an accentuated infection
and, consequently, produce disease, is lesser when compared with
non attenuated, or wild virus. [0109] Wild virus: a virus that can
be found, or isolated from living things in their natural
environment, existing in the form of laboratorial stock, whose
characteristics of pathogenicity are maintained despite being kept
in laboratories without intermediary passages in a natural host.
This wild virus may also exist in the form of a wild recombining
virus after undergoing genetic manipulation in laboratory. [0110]
Offshoot of 17D strain amarilic virus: constitutes of
ramifications, or substrains, of the vaccinal strain of the 17D
yellow fever virus, that are obtained from this through a
differentiated historic of passages in different kinds of cellular
substracts permissible to viral replication. Nowadays, the vaccines
for human use are derived from two distinct substrains, the 17D-204
and the 17DD. [0111] Virulent forms homologous to the vector virus:
constitutes of--as virulent forms homologous to the vector virus--a
more pathogenic virus, being homologous to the attenuated one and
differing from same in only some positions in the viral genome. For
example, in the case of the vaccinal virus of FA (17D), this one
differs from the virulent wild virus, of which it derived by serial
passages in culture (process through which the genetic mutations
accumulated), in only 48 nucleotides in the viral genome of 10862
nucleotides (0.44% of nucleotide difference), representing only
about 22 aminoacid alterations along the 3411 aminoacids of the
viral polyprotein (about 0.65% of differences from the aminoacid
sequence). [0112] Functionally Equivalent Sequences: sequences can
be denominated equivalent if they play the same role, without being
identical from the aminoacid or nucleotidic sequence viewpoint,
over a considered utilization or application. The equivalent
sequences may be the result of variability, meaning, any
modification, spontaneous or induced, in a sequence, be it
substitution and/or deletion and/or insertion of nucleotides,
and/or extension and/or shortening of the sequence at one of its
ends. A non natural variability may result from genetic engineering
techniques. [0113] nucleotidic heterologous (or exogenous) modified
sequences: sequences (including, but not limited to those of 10 to
2000 nucleotides) from viruses or other pathogens, which are
modified before the insertion in the vector virus. Such
modification is carried out so that the same, when cloned and
expressed in the vector virus, possess, in its 5' portion,
nucleotides present at the 5' end of the NS1 gene of this vector
virus or of other functionally equivalent virus or sequences, and
in its 3' portion, a genome region corresponding to the whole or a
part of the domains of stalk and anchor of the E protein of this
vector virus or of other functionally equivalent virus or
sequences. [0114] Heterologous expression cartridge: expression
genic construction in viral genome or functional equivalents,
structured to enable viral sequences fusion to heterologous gene to
be expressed in a manner in which its expression effectiveness is
improved. In this matter, EGFP gene suffers a fusion of its 5'
encoding terminal edge to 27 nucleotides corresponding to NS1
protein N-terminal and of its 3' encoding element to the complete
genic sequence, or part of it, of the stem and anchor domains.
[0115] This way, this invention relates to the genetic manipulation
of viruses, including, though not limited to, Flavivirus,
preferably the 17D strain vaccinal amarilic virus (the sequence of
which is represented by SEQ ID No 15) or its derivatives;
envisaging its utilization as heterologous antigen expression
vector and the development of new attenuated live vaccines.
[0116] The following method is one of the objects of this
invention, namely:
[0117] Method for the production of recombining virus containing
sequences of codifying nucleotides of whole or part of heterologous
proteins, characterized by the following phases: [0118] a)
Modification of heterologous nucleotide sequences so as the same,
when cloned and expressed in the vector virus, will possess, in
their 5' portion, nucleotides present at the 5' end of the NS1 gene
of this vector virus or of other functionally equivalent viruses or
sequences, and in their 3' portion, a genome region corresponding
to the whole or part of the stem and anchor domains of the E
protein of this vector virus or of other functionally equivalent
viruses or sequences, and so not jeopardizing the structure and the
said vector virus replication; [0119] b) Insertion of the
heterologous sequences modified in a) in the intergenic region at
structural E protein level and of non structural NS1 of the vector
virus; [0120] c) Obtention of recombining non pathogenic virus and
holder of immunologic properties, containing the heterologous
sequences stabilized integrated in the viral genome according to
insertion in the region described in (b) and, therefore expressing
the heterologous antigen so that the same induces an adequate
immune response.
[0121] In an embodiment of this invention, the abovementioned
method is characterized by the fact that heterologous nucleotide
sequences are modified in (a) so that the same, when cloned and
expressed in the virus, will possess, in their 5' portion, the
nucleotides described in SEQ ID No. 1 (codifiers of SEQ ID No 5) or
their functionally equivalent sequences and, in their 3' portion,
the genome region corresponding the domains of stalk and anchor of
the viral E protein as described in SEQ ID No. 3 (codifiers of SEQ
ID No 7) or their functionally equivalent sequences.
[0122] However, for the development of the present method and the
consequent obtention of these recombining viruses, especially of
flavivirus, expressing heterologous antigens, it has been
necessary: [0123] (a) the drawing of strategies to allow the
introduction of heterologous antigens, without jeopardizing the
structure and replication of the vector virus; [0124] (b) to ensure
that the construction of cDNA (and its RNA transcripts) generates a
non-pathogenic recombining virus and the foreign sequence, beyond
that, be stably integrated in the viral genome; and [0125] (c) to
guarantee that the recombining virus resulting from the
abovementioned method, besides being attenuated, will retain its
immunologic properties, expressing the heterologous antigen,
inserted so as the same will induce an adequate immune response
(measured by the formation of antibodies against the viral and
recombining proteins), directed both to the vector virus (or
virulent forms homologous thereto) and to the heterologous antigen.
It is also important the maintenance of the replication capability
in cultures of certified cells for the production of vaccines.
[0126] In this sense, the presence of specific sequences
(nucleotides present at the 5' end of the NS1 gene and a genome
region corresponding to the whole or part of the domains of stalk
and anchor of the E protein) of this vector virus or of other
virus, especially flavivirus, associated with protein Exogenous,
envisages to minimize or eliminate potential negative effects in
the viral replication in function of heterologous insertion in the
E/NS1 intergenic region, since: [0127] (1) the 5' end of the NS1
protein is part of the recognition region of the cellular signalase
for the generation of the E and NS1 proteins, so as the Exogenous
protein undergoes the same kind of processing, not disturbing the
obtention of protein, and allowing the heterologous protein to be
correctly processed by cellular signalase in the membrane of the
endoplasmic reticulum; [0128] (2) The whole or part of the stalk
and anchor domains of the E protein, that are added to protein
Exogenous, allow normal processing of the NS1 viral protein to
occur, given that it possesses the sequence signal for processing
by E/NS1 junction signalase.
[0129] Therefore, it is prudent to stress that the capability of
introducing genetic modifications in the animal viruses has
promoted knowledge on the mechanisms involved in the viral
propagation, besides allowing these to begin to be used as
heterologous proteins expression vectors. DNA viruses--such as
SV40, vaccinia, and herpes--are examples of viral vectors for the
expression of exogenous insertions.
[0130] The advance in the molecular cloning techniques has led,
more recently, to the development of RNA viruses, positive or
negative ribbon, such as viral vectors (Palese, P. 1998. RNA vector
virus: where are we and where do we need to go? Proc Natl Acad Sci
USA. 95:12.750-12.752). These are, potentially, more advantageous
than the DNA viruses, since they do not have a DNA phase and are
not capable of integration in the genome of the host.
[0131] One of the most promising positive ribbon Viral RNA vectors
is the virus of the Flavivirus genus. Among these, is the yellow
fever virus, for which there is the sole licensed attenuated virus
vaccine against this group of human pathogens.
[0132] The yellow fever vaccine is composed by 17D strain vaccinal
virus. This vaccine is extremely efficient, promoting about 95% of
seroconversion and lasting imunity in the inoculated individuals;
detection of neutralizing antibodies being possible, even after
periods of over 30 years post inoculation, as can be evidenced in a
study made by Poland et al. (Poland, J. D., C. H. Calisher, T. P.
Monath, W. G. Downs, and K. Murphy. 1981. Persistence of
neutralizing antibody 30-35 years after immunization with 17D
yellow fever vaccine. Bull World Health Organ 59:895-900).
Additionally, the yellow fever vaccine has other attractive
properties that subsidize its development as a recombining vaccinal
vector, which would be: [0133] (i) a very well defined production
methodology; [0134] (ii) consisting of a cheap single shot vaccine;
and [0135] (iii) its estimated use is of about 400 million shots
administered, with occurrence of few cases of adverse side effects
(Monath, T. P. 2001. Yellow fever: an update. Lancet Infect Dis
1:11-20).
[0136] Due to these good properties, the FA 17D vaccine platform is
being utilized in the development of human recombining vaccines
against other pathogens, for which, hitherto, no established
vaccines exist, as per the example given by some diseases caused by
flavivirus, like the Japanese encephalitis (Chambers, T. J., A.
Nestorowicz, P. W. Mason, and C. M. Rice. 1999. Yellow
fever/Japanese encephalitis chimeric viruses: construction and
biological properties. J Virol 73:3095-101; Monath, T. P., F.
Guirakhoo, R. Nichols, S. Yoksan, R. Schrader, C. Murphy, P. Blum,
S. Woodward, K. McCarthy, D. Mathis, C. Johnson, and P. Bedford.
2003. Chimeric live, attenuated vaccine against Japanese
encephalitis (ChimeriVax-JE): phase 2 clinical trials for safety
and immunogenicity, effect of vaccine dose and schedule, and memory
response to challenge with inactivated Japanese encephalitis
antigen. J Infect D is 188:1213-30) and dengue (Guirakhoo, F., K.
Pugachev, Z. Zhang, G. Myers, I. Levenbook, K. Draper, J. Lang, S.
Ocran, F. Mitchell, M. Parsons, N. Brown, S. Brandler, C. Fournier,
B. Barrere, F. Rizvi, A. Travassos, R. Nichols, D. Trent, and T.
Monath. 2004. Safety and efficacy of chimeric yellow Fever--dengue
virus tetravalent vaccine formulations in nonhuman primates. J
Virol 78:4761-75), malaria (Bonaldo, M. C., R. C. Garratt, P. S.
Caufour, M. S. Freire, M. M. Rodrigues, R. S, Nussenzweig, and R.
Galler. 2002. Surface expression of an immunodominant malaria
protein B cell epitope by yellow fever virus. J Mol Biol
315:873-85; Bonaldo, M. C., R. C. Garratt, R. S. Marchevsky, E. S.
Coutinho, A. V. Jabor, L. F. Almeida, A. M. Yamamura, A. S. Duarte,
P. J. Oliveira, J. O. Lizeu, L. A. Camacho, M. S. Freire, and R.
Galler. 2005. Attenuation of recombinant yellow fever 17D viruses
expressing foreign protein Epitopes at the surface. J Virol
79:8602-13; Tao, D., G. Barba-Spaeth, U. Rai, V. Nussenzweig, C. M.
Rice, and R. S, Nussenzweig. 2005. Yellow fever 17D as a vaccine
vector for microbial CTL epitopes: protection in a rodent malaria
model. J Exp Med 201:201-9) and, even as could be seen in a study
carried out on mice, directed towards melanoma cells (McAllister,
A., A. E. Arbetman, S. Mandl, C. Pena-Rossi, and R. Andino. 2000.
Recombinant yellow fever viruses are effective therapeutic vaccines
for treatment of murine experimental solid tumors and pulmonary
metastases. J Virol 74:9197-205).
[0137] RNA viruses are considered to have more resistance to the
introduction of heterologous genes, when compared to the DNA
viruses, which can be observed with the bicistronic vectors of the
West Nile fever and the yellow fever virus, which contained
interneal ribossomal entry sites (Patent Document WO02089840;
Pierson, T. C., M. S. Diamond, A. A. Ahmed, L. E. Valentine, C. W.
Davis, M. A. Samuel, S. L. Hanna, B. A. Puffer, and R. W. Doms.
2005. An infectious West Nile virus that expresses a GFP reporter
gene. Virology 334:28-40). However, one should consider that these
modifications were made in the 3' region not translated in the
Flaviviruses genome; region that, despite showing a certain
variability in FA virus size (de Filippis, A. M., R. M. Nogueira,
H. G. Schatzmayr, D. S. Tavares, A. V. Jabor, S. C. Diniz, J. C.
Oliveira, E. Moreira, M. P. Miagostovich, E. V. Costa, and R.
Galler. 2002. Outbreak of jaundice and hemorrhagic fever in the
Southeast of Brazil in 2001: detection and molecular
characterization of yellow fever virus. J Med Virol 68:620-7;
Mutebi, J. P., R. C. Rijnbrand, H. Wang, K. D. Ryman, E. Wang, L.
D. Fulop, R. Titball, and A. D. Barrett. 2004. Genetic
relationships and evolution of genotypes of yellow fever virus and
other members of the yellow fever virus group within the Flavivirus
genus based on the 3' noncoding region. J Virol 78:9652-65),
presents itself highly structured with regions forming much
conserved secondary structures (Holden, K. L., and E. Harris. 2004.
Enhancement of dengue virus translation: role of the 3'
untranslated region and the terminal 3' stem-loop domain. Virology
329:119-33; Thurner, C., C. Witwer, I. L. Hofacker, and P. F.
Stadler. 2004. Conserved RNA secondary structures in Flaviviridae
genomes. J Gen Virol 85:1113-24). These are involved in the control
of translation process (Chiu, W. W., R. M. Kinney, and T. W.
Dreher. 2005. Control of translation by the 5'- and 3'-terminal
regions of the dengue virus genome. J Virol 79:8303-15) and viral
replication (Tilgner, M., T. S. Deas, and P. Y. Shi. 2005. The
flavivirus-conserved penta-nucleotide in the 3' stem-loop of the
West Nile virus genome requires a specific sequence and structure
for RNA synthesis, but not for viral translation. Virology
331:375-86; You, S., B. Falgout, L. Markoff, and R. Padmanabhan.
2001. In vitro RNA synthesis from exogenous dengue viral RNA
templates requires long range interactions between 5'- and
3'-terminal regions that influence RNA structure. J Biol Chem
276:15581-91; Yu, L., and L. Markoff. 2005. The topology of bulges
in the long stem of the flavivirus 3' stem-loop is a major
determinant of RNA replication competence. J Virol 79:2309-24). The
insertion of sequences of the SIER kind, which form secondary
structures at the non translated 3' end of the viral genome, could,
then, interfere with these key processes to viral variability.
[0138] In this invention, a strategy for insertion--of proteins or
exogenous proteic domains--between the codifier gene of the E
protein and that of NS1 protein was developed.
[0139] This insertion site represents, firstly, a vital point in
the viral multiplication process. The same consists of the
transition of a genic block encoding the viral proteins
constituting the viral particle (C, prM and E), and the other
codifying the non structural proteins, that are involved in the
process of viral replication. The insertion of a heterologous
sequence between these blocks could be less harmful to the cascade
of molecular events that occurs in this region during replication,
since it would be in a intergenic region. And, in these, in
principle, there would be no need for special proximity between the
two adjacent viral proteins in the recently translated polyprotein;
such as for example, would be expected between the structural C,
prM and E proteins. The prM and E proteins are sequentially
translocated to the ER and interact, forming heterodimers, which,
in turn, will take part in the viral particle. Another example
would be between NS2B and NS3 proteins, where the insertion of long
sequences may result in considerable removal from NS2B, cofactor of
NS3, as well as the loss of proteolytic activity and inhibition of
the viral polyprotein processing after its synthesis (Bonaldo, M C
and Caller, R, unpublished information).
[0140] However, in order to be able to insert strange genes in this
region, it is necessary to comply with certain restrictions for the
viral polyprotein to be correctly processed and the virus be
feasible. In the first place, the ectodomain of the E protein is
bound to the cell membrane, or to that of the viral envelope, by
means of a region called stalk and anchor. This region is conserved
between the different members of flaviviruses, indicating an
important function (Cocquerel, L., C. Wychowski, F. Minner, F.
Penin, and J. Dubuisson. 2000. Charged residues in the
transmembrane domains of hepatitis C virus glycoproteins play a
major role in the processing, subcellular localization, and
assembly of these envelope proteins. J Virol 74:3623-33; Stiasny,
K., S. L. Allison, A. Marchler-Bauer, C. Kunz, and F. X. Heinz.
1996. Structural requirements for low-pH-induced rearrangements in
the envelope glycoprotein of tick-borne encephalitis virus. J Virol
70:8142-7). Such sequence is constituted by 96 aminoacid residues
of the C-terminal end of the protein (Allison, S. L., K. Stiasny,
K. Stadler, C. W. Mandl, and F. X. Heinz. 1999. Mapping of
functional elements in the stem-anchor region of tick-borne
encephalitis virus envelope E protein. J Virol 73:5605-12). The
stalk domain is composed of two potential alfa-helixes (H1 and H2,
connected by a sequence highly conserved in flavivirus (CS), the
function of which has not been established yet. The H1 segment
appears to be involved in the process of conversion of monomers
into trimers during the merger of the viral envelope to the
endossome membrane. The second amphipathic element of the stalk
(H2), along with the first transmembrane domain (TM1), are
important for the prM/E dimer stability. The second TM2 stretch
works as a signal sequence for the importation of NS1 for the ER.
This way, the E protein is anchored inside the ER lumen, through
two transmembrane domains, TM1 and TM2, which promote its
association to the lipid bilayer. During the process of
translocation of the E protein to the ER, TM1 has the function of
stopping the transference of E protein to the ER lumen, besides the
association to the ER membrane. TM2 consists of a signal sequence,
which promotes, in its turn, the translocation of the NS1 to the ER
lumen. The role of each of these different stalk and anchor
components of the E protein has not been elucidated yet; but, for
the correct topology of the E protein in the ER membrane, two
sequences equal or functionally similar to the anchor TM1 and TM2
sequences are needed. TM2 works as a signal peptide, which, when
processed by the signalase, results in the formation of the protein
carboxi-terminal and, besides promoting the translocation of the
NS1 protein to the ER.
[0141] For these reasons, initially, the attempt for coning and
expression of the EGFP autofluorescent protein gene--a variant of
the "Green Fluorescent Protein" or GFP of Aquorea Victoria
(Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996.
FACS-optimized mutants of the green fluorescent protein (GFP), Gene
173:33-8)--was traced in function of outflanking this exogenous
gene through these sequences. In this way, no considerable disturb
is provoked in the cellular addressing and proteolytic processing
of E and NS1 proteins. Another important aspect in this wise
relates to the existence of the correct sequence to be cleaved, by
the peptidase signal, in the junction between the TM2 anchor
sequence and the NS1 N-terminal. One may notice, in FIG. 6, that
the site--around the peptide bond hydrolysis point, for the
generation of the C-terminal ends of the E protein, and of
N-terminal end of the NS1 protein--is much preserved between
different flavivirus. This fact indicates that the same should be
important for the recognition and promotion of the proteolysis site
specified by the signal peptidase at the E/NS1 junction.
[0142] FIG. 6 is associated to the cleavage point of the signal
peptidase in the E and NS1 intergenic region of flaviviruses. In
(A), alignment of the last seven residues of the E protein
C-terminal and the nine initial residues of the NS1 protein
N-terminal around the cleavage point through the cellular
signalase. In (B), consensus motive around hydrolysis point of the
peptide bond (.dwnarw.). The sequences utilized in the alignment
are: TBE virus (Genbank NC 001672), yellow fever virus (Genbank
U17066), japanese encephalitis virus (JE; NC001437), west nile
fever (WN; NC001563), dengue 2 (Den 2; NC001474) and dengue 4
(Den4; M14931). Residues conserved between the species are
indicated by grey shading. X means lack of conservation at
position. The sequence alignment was carried out through the
CLUSTAL W (1.82) program, which consists of a method for
progressive alignment of multiple sequences. This analysis was done
at http://www.ebi.ac.uk/clustalW/index.html.
[0143] So, for the correct processing, both of E protein C-terminal
and of NS1 protein N-terminal, it is necessary that the Exogenous
protein presents, in its N-terminal, an aminoacid sequence of the
NS1 N-terminal and, in its C-terminal, a corresponding E protein
C-terminal aminoacid sequence.
[0144] Therefore, this invention is associated to the methodology
of inserting heterologous sequences between the structural and non
structural viral genes (including, though not limited to,
Flavivirus, preferably the 17D vaccinal strain amarilic virus or
its offshoot), through the strategy of translocation and anchoring
in several cellular compartments of the heterologous proteins
through the genetic merger with the regions called stalk and anchor
of any virus or of functionally equivalent sequences.
[0145] In a preferential embodiment of this invention the amarilic
virus is employed as vector virus. Therefore, once the amarilic
virus genome is made of ARN, in this invention, any manipulation
thereof is made at complementary ADN (cADN) level cloned in
bacterial plasmids. This manipulation is carried out through the
infectious clone technology, which consists in the ability of
regenerating viruses from cloned complementary ADN.
[0146] This invention is thoroughly described through the examples
shown below. It is necessary to stress that the invention is not
limited to these examples, but also includes variations and
modifications within the limits in which it works.
Example 1
Drawing of the EGFP Protein Expression Cassette in the Intergenic
Region
[0147] The EGFP gene and aminoacids sequence is presented,
respectively, in SEQ ID No. 2. and in SEQ ID No. 6.
[0148] One of the possible theoretic drawings of the cloning and
expression of an Exogenous protein in the intergenic
region--between the coding genes for the E and NS1
proteins--consists of the genomic insertion of this heterologous
sequence, outflanked by genomic flavivirus sequences duplicated in
this construction; in such a way that this will not disturb the
translocation and cellular location of the E and NS1 proteins. In
this sense, the strategy used was that of building the insertion so
that, at its coding 5' end, the 27 nucleotides corresponding to the
NS1 protein N-terminal were merged and, at its 3' end, the gene
region corresponding to E protein C-terminal stalk and anchor
domains (FIG. 7). Thus, with these duplicated flavivirus genome
regions outflanking the insert, there are conditions for adequate
processing of the E protein anchored in the ER membrane--in that
case, with the presence of the TM2 domain (which is a signal
sequence) and part of the NS1 amino end, which allows the
addressing to the ER and the specific site cleavage through the ER
membrane signal peptidase. This results in the formation of E
protein C-terminal and the recombining protein amino-terminal
release in the ER lumen. Additionally, the merger of stalk domain
and anchor to the exogenous protein C-terminal, promotes its
anchoring to the ER membrane; besides rendering possible that NS1
protein be translocated to the ER lumen, due to the presence of the
inner signal peptide in the TM2 domain.
[0149] FIG. 7 is associated to a comparison of E and EGFP protein
topology--cloned and expressed, in a recombining flavivirus, in the
intergenic region between the E and NS1 proteins in ER membrane. In
(A), the membrane topology expected for the E protein in a cell
infected by a non recombining flavivirus is presented. The black
arrow indicates o ponto de proteolytic processing, through the
signalase, for the formation of the carboxi terminal of this
protein and the NS1 protein amino terminal. In (B), the expression
in the recombining viruses of the EGFP protein inserted between the
E and NS1 proteins. The EGFP protein is fusioned, in its
amino-terminal with 9 residues of the NS1 protein
amino-terminal--SEQ ID No. 5 (black line), and the cellular
signalase cleaves at the indicated point (black arrow). In this
manner, there is formation of the E protein C-terminal anchored to
the membrane, releasing the amino-terminal of the NS1/EGFP merger
in the ER lumen. This very processing would be carried out in the
C-terminal region of the stalk domain anchor fusioned to EGFP,
which would promote the association of the EGFP to the ER membrane
and the liberation of NS1 protein to the ER lumen. The foreseen
sequence of this expression cassette contained in the viral
polyprotein is presented in the SEQ ID No. 14, as well as, the
expected aminoacid sequence of the recombining protein after the
phases of proteolytic processing (SEQ ID No. 8).
[0150] In the E protein homologous of the yellow fever virus, the
establishment of the regions corresponding to stalk and anchor
conserved domains, previously elucidated for the E protein of the
TBE virus (Allison, S. L., K. Stiasny, K. Stadler, C. W. Mandl, and
F. X. Heinz. 1999. Mapping of functional elements in the
stem-anchor region of tick-borne encephalitis virus envelope E
protein. J Virol 73:5605-12, Stiasny, K., S. L. Allison, A.
Marchler-Bauer, C. Kunz, and F. X. Heinz. 1996. Structural
requirements for low-pH-induced rearrangements in the envelope
glycoprotein of tick-borne encephalitis virus. J Virol 70:8142-7),
was effected through the alignment of C-terminal residues of both
proteins (FIG. 8A). After this alignment, the regions corresponding
to different stalk domain segments (H1, CS and H2) and anchor (TM1
and TM2) were located in the sequence of Yellow fever virus E
protein residues. This alignment allowed definition of the
aminoacids sequence segments to be added to EGFP protein in
accordance with the established strategy. A copy of this entire
region for the yellow fever virus, consisting of 288 nucleotides
(SEQ ID No. 3) corresponding to 96 E protein final carboxi
aminoacids residues (SEQ ID No. 7), was fusioned to the codifying
sequence of the EGFP autofluorescent reporter protein in its
corresponding C-terminal end, so as to reproduce all motives
contained in this sequence, and which are necessary for the correct
addressing and processing of the NS1 protein, located later.
[0151] A second additional type of aminoacid sequence, derived from
the yellow fever virus genome, was associated to the EGFP protein
N-terminal. This sequence represents the 9 residues of NS1 protein
N-terminal (FIG. 9B), which are also presented by SEQ ID No. 5.
Three out of four aminoacids of this peptide amino-terminal are
highly conserved among the flavivirus. In all likelihood, they are
important for recognition, and bond to the active center and
proteolitic cleavage through signal peptidase associated to ER
membrane. The use of this sequence, merged to the heterologous
protein N-terminal portion, helps promoting the correct cleavage
between this and the E protein, so as to form the mature E protein
C-terminal and the EGFP protein N-terminal. The utilization of part
of NS1 protein N-terminal was already reported, in plasmids of
expression of prM and E genes, for the production of subviral
particles of TBE in cultures of eucaryote cells, as described by
Allison et al. (Allison, S. L., C. W. Mandl, C. Kunz, and F. X.
Heinz. 1994. Expression of cloned envelope protein genes from the
flavivirus tick-borne encephalitis virus in mammalian cells and
random mutagenesis by PCR. Virus Genes 8:187-98). In the work of
these researchers, the first 30 codes (120 nt) of the NS1 protein
gene were utilized--a sequence considerably greater than that
utilized in this construction, with the equivalent to 9 codons of
the first yellow fever virus NS1 protein N-terminal aminoacid
residues (SEQ ID No. 5).
[0152] This way, the clonage of this kind of EGFP expression
cassette, or other exogenous protein, in the E/NS1 intergenic
region should promote the release of this protein amino terminal in
the ER lumen and the anchoring of its carboxi end to the ER
membrane, through the stalk and anchor domains or functionally
equivalent sequences.
[0153] In FIG. 8, regions of E and NS1 protein used in the assembly
of the EGFP protein expression cassette in the infectious clone FA
17D are presented. Particularly, FIG. 8(A) is relative to the stalk
and anchor domain of the Yellow fever virus E protein; as well as
the alignment of the aminoacid sequence of TBE virus E protein
stalk and anchor domains (residues of 401 to 496; Genbank NC
001672) and of yellow fever virus (residues of 398 to 493; Genbank
U17066). The residues conserved between species are indicated by *,
with conservative substitution for or less conservative for. (B)
Alignment of the nine residues of NS1 protein amino-terminal end of
different flaviviruses. The residues conserved are highlighted in
grey in the different viral sequences. The sequences used in the
alignment are, in part, the ones described in section (A). The
remaining ones are those described for the virus of Japanese
encephalitis (JE; NC001437), west of Nile fever (WN; N0001563),
dengue 2 (Den 2; NC001474) and dengue 4 (Den4; M14931). The
alignment of multiple sequences was made through the method of
CLUSTAL W, available at http://www.ebi.ac.uk/cgi-bin/clustalw/.
Example 2
Synthesis and Cloning of the EGFP Expression Cassette
[0154] For obtention of an EGFP protein expression cassette, two
DNA fragments were initially synthesized by PCR:
[0155] (1) a DNA fragment of 783 pb containing the EGFP gene,
utilizing the pEGFP-C2 plasmid (BD Biosciences Clontech) and the
synthetic RG 328 (SEQ ID No. 9) and RG 329 (SEQ ID No. 10)
oligonucleotides. The RG 328 (SEQ ID No. 9), of positive polarity,
contained sequencially the gene regions of 15 nucleotides
corresponding to the protein carboxi-terminal and, 27 nucleotides
corresponding to the first nine aminoacids of the NS1 protein;
beyond the 20 nucleotides of the EGFP gene 5' terminal. The RG 329
(SEQ ID No. 10), of negative polarity, contains sequentially the
gene regions of 24 nucleotides of the EGFP gene 3' terminal, 15
nucleotides corresponding to the E protein stalk and anchor domains
N-terminal;
[0156] (2) A second fragment de 339 pb was obtained, utilizing the
T3 plasmid and the RG 330 (SEQ ID No. 11) and RG 331 (SEQ ID No.
12) synthetic oligonucleotides, so as to obtain a DNA fragment
containing: from sense 5'' to 3' of the coding ribbon, the 24
nucleotides corresponding to the EGFP protein carboxi-terminal,
followed by gene region of 288 nucleotides (SEQ ID No. 3),
corresponding to E protein stalk and anchor domains (genome
position FA of 2165 to 2452); followed, finally, by the gene region
of 27 nucleotides, corresponding to 9 residues of the
amino-terminal of NS1 protein (genome position FA of 2453 to 2479)
as described in SEQ ID No. 5.
[0157] The merger of these two DNA fragments, for the generation of
the EGFP protein expression cassette to be cloned yellow fever
virus genome, was carried out by reaction of PCR with equimolar
quantities of the de 783 pb and 339 pb fragments, in the presence
of 20 .mu.M RG 328 (SEQ ID No. 9) and of RG 331 (SEQ ID No. 12).
All those PCR reactions were made with the Platinum Pfx Polymerase
enzyme (Invitrogen), in accordance with the manufacturer's
recommendations. The reaction products were analyzed in agarose gel
electroforesis at 1% and purified, subsequently, by PCR (Qiagen)
products purification system. FIG. 9B shows the expected product
sequence, that is decurrent from this sequence of viral origin
association strategy at the amino-ends and EGFP protein
carboxi-terminal.
[0158] The fragment resulting from 1071 pb was cloned in the pGEM-T
(Promega) plasmid, in accordance with the manufacturer's
specifications. Component bacteriae E. coli MC1061 were transformed
with 10 ng of the bond and plagued in selective means (LB a 1,5%
agar containing 50 .mu.g/mL ampicilin). Preparations of recombining
bacterial clones plasmidial DNA were obtained and submitted to
digestion with a Nar I enzyme, for confirmation of cloning of the
DNA cassette of 1029 pb (SEQ ID No. 4). One of the bacterial clones
was chosen, and the plasmidial DNA was purified as described in one
of the following sections.
[0159] Therefore, FIG. 98 shows an aminoacid sequence, that is
predicted for the heterologous insertion, and that contains o EGFP
gene cloned in E/NS1 intergenic region. (A) Aminoacid sequence in
the intergenic region between the TM2 domain of the E protein and o
NS1 protein N-terminal. (B) This same intergenic region containing
the insertion of the heterologous expression cassette. The gray
arrows indicate the cleavage site through the signal peptidase
associated to the ER membrane.
[0160] About 10 .mu.g of the pGEM-T plasmid, containing the EGFP
protein expression cassette, was digested with 3U of Nar I
(Promega). The sample was concentrated by precipitation with etanol
and resuspended in electroforesis sample buffer, besides being
submitted to electroforesis in agarose gel at 1%. The DNA strand of
1029 pb (SEQ ID No. 4) was purified from the gel through the DNA
purification system from agarose gels (Qiagen). The material was
quantified by espectrophotometry at 260 nm and analyzed in agarose
gel electroforesis at 1%.
[0161] The DNA fragment of about 1 kb, containing the cohesive Nar
I ends, was bound to the vector T3 plasmid. This plasmid is a
derivate from the original pYFM5.2, containing the 17D genome
central region, and which contains a restriction site of Nar I just
at the junction between the coding genes for the E and NS1 protein.
The bond was made with the T3 plasmid, previously digested with Nar
I, in the presence of a molar excess 20 times of the insertion
containing the EGFP gene, and of the T4 DNA ligase enzyme
(Invitrogene). The corresponding to 10 ng of the bond was
transformed into E. coli. Sure (Stratagene), which was plagued in
selective means LB 1.5% agar containing 50 .mu.g/mL of ampicilin.
Mini preparations of plasmidial DNA were made, from the ampicilin
resistant bacterial colonies; and the plasmidial DNA preparations,
that presented size superior to that of pT3 native control, were
submitted to digestion with Nar I for confirmation of the cassette
cloning. The verification of the correct sense of insertion was
carried out by nucleotidic sequencing. This way, the recombining
pT3 Esa EGFP plasmid was obtained, as in FIG. 10.
[0162] In FIG. 10, the physical map of the T3 Esa EGFP recombining
plasmid is presented. The original pT3 plasmid, that contains part
of the cloned viral cDNA (from the genome position of 1373 to
9428), was used for cloning EGFP protein expression cassette in the
Nar I site of insertion. This recombining plasmid was, afterwards,
used for assembling the viral cDNA template.
Example 3
Preparation of the cDNA Viral Template
[0163] The cDNA template, utilized in the obtention of the FA 17D
recombining virus, was obtained by the two-plasmid system (Rice, C.
M., A. Grakoui, R. Galler, and T. J. Chambers. 1989. Transcription
of infectious yellow fever RNA from full-length cDNA templates
produced by in vitro ligation. New Biol 1:285-96; patent Document
U.S. Pat. No. 6,171,854). In this, the original plasmids,
pYF5'3'IV--that contain part of the cloned genome in the form of
cDNA (the 5' ends, position of 1 to 2.276, and 3', position of
8.275 to 10.862)--and pYFM5.2--containing the central genomic
portion (nt of 1.373 to 9428)--are used for the assembly of
complete viral cDNA, by means of a series of cutting enzyme
reactions and DNA fragments bond. In the creation of EGFP
expression cassette, a derivate of pYF5'3'IV was used, called
pE200.sub.glic, which presents mutations in the 1568 nucleotide,
that result in the creation of an EcoRV site in the position of the
E protein 200 aminiacid. Such fact leads to change of two
aminoacids (E199 D and T200I), as described by Bonaldo et al.
(Bonaldo, M. C., R. C. Garratt, P. S. Caufour, M. S. Freire, M. M.
Rodrigues, R. S. Nussenzweig, and R. Galler. 2002. Surface
expression of an immunodominant malaria protein B cell epitope by
yellow fever virus. J Mol Biol 315:873-85), and the presence of the
N-glicosilation motive in the protein and, in 1436 and 1437 genome
positions. The second plasmid, in which exogenous protein
expression cassette was cloned, was a plasmid derived from pYFM5.2,
called pT3/Esa/EGFP plasmid. The template of viral cDNA was
prepared by cleavage of the plasmids with the Nsi I and Sal I
(Promega) restriction enzymes, in compliance with the conditions
recommended by the manufacturer. About en .mu.g of each plasmid
were digested with both enzymes. The cleavage was monitored by the
analysis of percentages equivalent to 200 ng of DNA in agarose gel
electroforesis at 0.8% in buffer TAE. Upon complete cleavage, the
enzymes were inactivated by heat. The NSiI/SalI cleavage products
of the plasmids were bound with T4 DNA ligase (Epicentre
Technologies) in compliance with the conditions set forth by the
manufacturer. The linearization of the different cDNA templates was
done by use of Xho I restriction endonuclease under the conditions
established by the manufacturer (Promega). The resulting products
were precipitated with ethanol and resuspended in Tris-EDTA buffer,
pH 7.5, free of nucleases. A sample of each preparation was
analyzed in agarose gel electroforesis for detection of the
template and its quantification. The preparations were stored at
-20.degree. C. until the phase of transcription in vitro.
Obtention of FA Virus from Viral cDNA: Transcription and
Transfection Phases.
[0164] From the cDNA templates representing the complete genome,
including the sequences of the pE200.sub.glic and pT3/Esa/EGFP
plasmids, preparations of viral RNA were obtained through the
transcription system in vitro of SP6 RNA (AmpliScribe SP6;
Epicentre Technologies). The synthesized preparations of RNA in
vitro were analyzed in electroforesis in gel of agarose 0.8% in
TAE. Percentages of the RNA preparations were transfected with
Lipofectamine (Invitrogen Life Sciences) in Vero cells monolayers,
as described by Bonaldo et al. (Bonaldo, M. C., R. C. Garratt, P.
S. Caufour, M. S. Freire, M. M. Rodrigues, R. S. Nussenzweig, and
R. Galler. 2002. Surface expression of an immunodominant malaria
protein B cell epitope by yellow fever virus. J Mol Biol
315:873-85).
Transfection of Viral RNA Synthesized In Vitro
[0165] The phase of transfection was carried out in a way similar
to that described in patent Document U.S. Pat. No. 6,171,854. The
transfection of the Viral RNA synthesized in vitro originated a
recombining virus, capable of growth in Vero cells. This new
recombining yellow fever virus was called 17D/Esa/5.1.sub.glic. Its
detection was carried out by the appearance of cytopathic effect in
the cellular monolayer through phase contrast microscopy. The
kinetic follow up of the EGFP protein expression was carried out in
the time intervals of 24, 48, 72, 96 and 120 hours in Vero cells
monolayers infected with the 17D/Esa/5.1.sub.glic with virus a
m.o.i of 0.02, and through fluorescence microscopy at 488 nm for
detection of the EGFP autofluorescent protein expression.
[0166] In order to determine the EGFP expression kinetics, Vero
cells were infected with recombining Viruses expressing EGFP at a
0.02 MOI. In the different times, the cellular monolayers were
washed twice with PBS, fixad with 4% paraformaldehyd in 0.1M
dibasic phosphate buffer for 10 minutes, and washed once with 0.2M
dibasic phosphate buffer. Upon fixation, the cells were dyed for 5
minutes with Evans Blue 1%, mounted on blades--with use of Slow
Fade containing DAPI (Slow Fade Gold reagent with DAPI--Molecular
Probes)--and observed through a Zeiss fluorescence confocal
microscope.
[0167] FIG. 11 shows the kinetics de Vero cells monolayer infection
by 17D/Esa/5.1.sub.glic virus. Preparations of 24 h, 48 h, 72 h, 96
h and 120 h post-infection were analyzed. The green fluorescent
marking indicates the presence of EGFP Exogenous protein, this
associated in the main to the cellular ER. For comparison, one of
the preparations of the control condition was placed, cells not
infected, that consist in the time of 96 hours post-infection (FIG.
11).
[0168] A viral stock was prepared, by infecting Vero cells
monolayers with the pos-transfection supernatant in a m.o.i of 0.1.
This stock showed a title of 6.0 log 10 PFU; mL and was used in all
phases of viral characterization.
[0169] FIG. 12 presents the comparative diagram of the genome
regions comprised between the prM and NS1 proteins of the 17D
vaccinal virus (A), and of the recombining 17D/Esa/5.1.sub.glic
(B). The genomic sequence of the 17D virus/Esa/5.1.sub.glic is
shown in SEQ ID No. 13.
Example 4
Characteristic of Viral Propagation Determination of the Viral
Growth Kinetics and Phenotype of Lyze Plaque in Vero Cells
Monolayers
[0170] The growth capability of the recombining FA virus obtained
was analyzed, in comparison with the FA vaccinal 17DD and 17D/14
viruses, through infection in Vero cells monolayers. Three
independent experiments were carried out on viral propagation
kinetics in Vero cell monolayers (62.500 cells/cm.sup.2), in a
number (m.o.i) of infection of 0.02. Percentages of the cellular
supernatant of the post-infection times (p.i.) of 24 h, 48 h, 72 h,
96 h, 120 h and 144 h were collected and titled.
[0171] In these experiments, two FA 17D viruses of vaccinal
phenotype were used as virus controls. The FA17D/14 experimental
vaccinal virus was obtained from a cDNA template with a sequence of
the 17D/204 sublineage, in which some genetic modifications were
introduced based on the 17DD sublineage sequence (Patent Document
U.S. Pat. No. 6,171,854). The FA17D/14 virus has great lyze plaque
and growth properties resembling the 17DD vaccinal virus. The
second virus is a 17DD strain vaccinal stock, that is the strain
utilized in the production of the yellow fever vaccine in Brazil,
that also has great plaque phenotype.
[0172] It can be verified that both experimental vaccinal
viruses--17D/14 and 17DD--present viral growth peaks at 72 hours
post-infection, with values of 7.08 and 6.97 log 10 PFU/mL,
respectively. On comparing the kinetic profiles of these two
viruses with the recombining 17D/Esa/5.1glic virus, it can be noted
that this shows a less pronounced growth than the two vaccinal
ones, that possess very similar growth profiles in Vero cells
monolayers. However, the recombining 17D/Esa/5.1.sub.glic virus
presents a viral growth peak of 6.63 log 10 PFU/mL in 120
hours.
[0173] Despite the recombining 17D/Esa/5.1.sub.glic virus showing
lesser propagation potential in Vero cells monolayers, the titles
obtained are still adequate for the vaccinal production scale.
[0174] FIG. 13. shows the replication capability of the recombining
17D/Esa/5.1glic FA virus, in comparison with 17D/14 and 17DD
vaccinal, in Vero cells monolayers. These cells are being used in
the production of vaccines for human use (Montagnon, B. J., J. C.
Vincent-Falquet. 1998. Experience with the Vero cell line. Dev Biol
Stand. 93:119-223; Handa R., S. Teo, R. Booy. 2004. Influenza:
current evidence and informed predictions. Expert Rev Vaccines.
2004 3(4):443-451; Monath, T. P., J. R. Caldwell, W. Mundt, J.
Fusco, C. S. Johnson, M. Buller, J. Liu, B. Gardner, G. Downing, P.
S. Blum, T. Kemp, R. Nichols, R. Weltzin. 2004. ACAM2000 clonal
Vero cell culture vaccinia virus (New York City Board of Health
strain)-a second-generation smallpox vaccine for biological
defense. Int J Infect Dis. 8 Suppl 2:S31-44).
Example 5
Determination of the Lyze Plaque Phenotype
[0175] The morfologic determination of the viruses lyze plaque was
made by plaqueing in Vera cells monolayers, grown at 62.500
cells/cm.sup.2 in 6 well plaques with a coverage of 3 mL of 0.5%
agarose of low melting point (Promega) in 199 mean supplemented
with 5% bovine fetal serum. In this experiment, two FA 17D viruses
of vaccinal phenotype were used as virus controls. The FA17D/E200
virus was created and recovered from an infectious clone containing
mutations in the 1568 nucleotide, creating a EcoRV site in the 200
aminiacid protein position and, that leads to the change of two
aminoacids (E199 D and T200I), which presents an intermediate
plaque phenotype, as described by Bonaldo et al. (Bonaldo, M. C.,
R. C. Garratt, P. S. Caufour, M. S. Freire, M. M. Rodrigues, R. S.
Nussenzweig, and R. Galler. 2002. Surface expression of an
immunodominant malaria protein B cell epitope by yellow fever
virus. J Mol Biol 315:873-885). It was also utilized as large lyze
plaque control, the 17D/14 virus, which was described above. For
visualizing the lyze plaques a solution of 10% formaldehyde was
added for fixation and a subsequent dying in 0.01% violet crystal.
The values assessed were obtained through the two independent
experiments, in which about 20 plaques/viruses/experiment were
measured. The values determined are shown in Table 1.
TABLE-US-00001 TABLE 1 Phenotypic Analysis of the lyze plaque size
of the virus in relation to two different experimental vaccinal
viruses, 17D/14 and 17D/E200. lysis plaque diameter (mm) virus
average deviation 17D/14 2.80 0.67 17D/E200 1.65 0.33
17D/Esa/5.1.sub.glic 0.99 0.24
Example 5
Analysis of the EGFP Exogenous Protein Expression by Flow Cytometry
of Vero Cells Infected by the 17D/Esa/5.1.sub.glic Virus
[0176] Along the viral infection, the EGFP autofluorescent protein
expression in monolayers of Vero cells was measured by flow
cytometry in FACScalibur equipment (Becton Dickison; 15 mW argon
laser, 488 nm) with a FL-1 filter, through analysis of 10.000
events by sample. The cells were infected in a moi of 0.02 and were
prepared in the post-infection times of 24 h, 48 h, 72 h, 96 h and
120 h post-infection. Vero cells were removed from cellular
monolayer by trypsinization, after washing of monolayer with PBS.
The cells were resuspended and washed twice in PBS supplemented
with 4 mg/mL BSA, counted and adjusted for the density of
2.0.times.10.sup.5 cells/mL in 1% paraformaldehyd for subsequent
analysis by cytometry.
[0177] In FIG. 14, it can be observed that the expression of EGFP
is specific of the Vero cells infected with 17D/Esa/5.1.sub.glic
virus, and that its detection is greater in the times of 72 to 120
hours of infection. The bar of 41.2% shows, in FIG. 14B, the
percentage of cells expressing EGFP with 120 hours of infection.
These results prove that the recombining 17D/Esa/5.1.sub.glic virus
is capable of promoting a significant expression of the
heterologous protein, even in cellular monolayers infected with a
reduced moi, and that the maximal points of the expression are
detected from 72 hours of incubation. The use of a reduced moi,
together with the high percentage of fluorescent cells, warrant the
virus capability for replicating and disseminating to the adjacent
cells.
[0178] FIG. 14 shows the analysis of the EGFP fluorescent protein
expression kinetics through recombining 17D/Esa/5.1glic virus, in
Vero cells and by flow cytometry. (A) Vero cells infected by yellow
fever virus, 17D/E200T3 control, that do not express the EGFP
protein. (B) yellow fever recombining 17D/Esa/5.1.sub.g1ic T3
virus, that expresses the EGFP autofluorescent Exogenous protein
cloned in the E/NS1 intergenic region.
Example 6
Determination of the Recombining 17D/Esa/5.1.sub.glic Virus
Attenuation in Mice
[0179] As a first step towards proving that the recombining
17D/Esa/5.1.sub.glic virus does not overstep the 17D vaccinal
virus, in relation to the phenotypic characteristic of
neurovirulence, tests were carried out in mice.
[0180] In these, groups of 10 Swiss Webster mice (three weeks' old)
were inoculated, through intracerebral via, with 3.0 log.sub.10 PFU
of the 17DD vaccinal control and the other viruses. The viral
inoculative, estimated in 1.000 PFU for 30 .mu.L, is assessed by
titling in Vero cells monolayers for determinatin of the viral
dose, and the animals are followed up for 21 days. The results,
contained in Table 2, represent the average of 3 to 5 independent
experiments, depending on the viral sample.
TABLE-US-00002 TABLE 2 Study of the viral attenuation by
neurovirulence test in four week old Swiss Webster mice. 17DD
17D/E200.sub.glic 17D/Esa/5.1.sub.glic medium Death rate 98.0 85.0
0.0 0.0 (%) Average 11.2 .+-. 0.55 11.8 .+-. 0.64 >21 >21
survival time (days) Average Dose 1090 .+-. 392 797 .+-. 592 802
.+-. 265 -- administered (PFU)
[0181] As can be evidenced in Table 2, the 17D yellow fever
recombining virus, expressing an EGFP heterologous protein in the
E/NS1 (17D/Esa/5.1glic) intergenic region, presents itself more
attenuated when compared to the 1700 controls and parental
17D/E200.sub.glic virus. The 17DD vaccinal virus promoted 98% of
mortality in the inoculated animals--with average time of 11.2 days
survival--and the parental 17D/E200.sub.glic virus, 85.0% over an
average survival time of 11.8 days, the intracerebral inoculation
with the recombining 17D/Esa/5.1glic virus does not result in death
in the 21 days of observation.
[0182] These results indicate that the alterations prompted by
cloning and expression of EGFP modified protein, of about 400
aminoacid residues, provoke an increase I the degree of viral
attenuation.
Example 7
Study of the Recombining 17D/Esa/5.1.sub.glic Virus
Immunogenicity
[0183] The immunogenicity of the 17D/Esa/5.1.sub.glic virus was
assessed in mice. A group of four week old BABL/c mice were
immunized with about 2 doses of 50.000 PFU, administered by
sub-cutaneous via, in the plantar pad at 15 day intervals. Thirty
days after the last dose, blood samples from the mice were obtained
by intra-orbital bleeding. The humoral immune response of
neutralizing antibodies, directed to the 17D yellow fever virus,
was assessed by the test essay of viral neutralization by plaqueing
reduction in Vero cells monolayers (PRNT in English, "Plaque
Reduction Neutralization Test"). The titles of neutralizing
antibodies are given in function of greater seric dilution capable
of inhibiting 50% of the lyze plaques number.
[0184] As can be verified at Table 3, the FA 17D recombining
viruses were able to induce response for specific neutralizing
antibodies at indexes comparable to the 17DD vaccinal virus. The
seroconversion for the FA virus took place in 100% of the animals
that were inoculated with the recombining 17D/Esa/5.1.sub.glic T3
virus. And, this immunization regime resulted in title of
neutralizing antibodies, directed to the yellow fever virus, from
1:65 to >1:520, which are in a range comparable to that
determined for the 17DD vaccinal control virus, of
1:85->1:1.260.
TABLE-US-00003 TABLE 3 Immunogenicity of 17D/E200.sub.glicT3 virus
in BALB/c mice. Number % average of sero- Answer range PRNT* dose
condition animals conversion (PRNT)* average (PFU) control 5 0
<1:20 <1:20 -- 17DD 10 90 1:85->1:1.260 >1:250 65.375
17D/E200 10 100 1:100-1:325 1:200 70917 glic T3 17D/Esa/ 15 100
1:65->1:520 1:200 18.250 5.1 Glic *Reciprocal value of the major
dilution of the immunized animal serum with each virus that should
have resulted in 50% of lyze plaque inhibition.
[0185] 30 days after the last shot, these animals and another
independent experimental set, vaccined with the same dose regime,
were challenged by intracerebral inoculation with an average dose
of 6.000 PFU of the 17DD yellow fever vaccinal virus. FIG. 15 shows
the mean protection values issued from two immunization and
challenge essays. The animals were followed up for 21 days, for
notification of deaths and days of occurrence. It can be verified,
in the FIG. 15, that the 17D/E200glicT3 parental virus and the
recombining 17D/Esa/5.1.sub.glicT3 promote the protection of 60 and
50%, respectively, of the animals challenged by intracerebral via
though 17DD vaccinal virus (with inoculative average of 6.000 PFU),
while the vaccinal virus presents a protection rate of about
90%.
[0186] FIG. 15 shows the degree of protection afforded by the
immunization of BABL/c mice with the 17D/Esa/5.1.sub.glicT3 virus,
in the faced of the challenge for intracerebral inoculation with
6.000 PFU of the 17DD vaccinal strain yellow fever virus. In the
upper part of the Figure, the histogram with the death rates in the
challenge of animals immunized with vaccinal phenotype virus (17DD
and E200.sub.glicT3), through the virus test
(17D/Esa/5.1.sub.glicT3) and through the negative control
(immunization with culture mean) is shown. In the lower part of the
Figure, the values obtained by the group relative to the death
percentage, the average time of sobrevida, number of animals per
group pf analysis and the average dose used in the vaccination
regime are shown.
Example 9
Genetic Stability of Virus 17D/Esa/5.1glic
[0187] The genetic stability of 17D/Esa/5.1glic virus insertion was
assessed by two series of ten independent passages through Vero
cell monolayers. Thus, when in vitro synthesized viral RNA was
obtained, as described in example 3, it was transfected into Vero
cell monolayers producing recombinant virus particles. This
preparation was named as first cell passage sample or 1P, and it
was then used to infect Vero cell monolayers in 175 cm.sup.2-T
bottles to create a virus sample batch which was employed in most
of the performed analysis with 17D/Esa/5.1 glic virus. After
cytopathic effect appeared, the viral supernatant, named as second
cell monolayer passage or 2P, was measured and store at -70.degree.
C. It was assessed a 2P-sample titration, as well as, in order to
verify if the insertion was completed in a heterologous manner, it
was conducted a viral RNA extraction of this preparation by the LS
Trizol-based method (Invitrogen, Life Technologies), and then the
RT-PCR procedure, using M-MLV enzyme (Promega Corporation) to allow
cDNA synthesis to take place in simple strips and PCR reaction of
Tag polymerase enzyme (Promega Corporation), as specified by the
manufacturer. In the PCR reaction performed in plasmid DNA samples,
Tag polymerase enzyme (Promega Corporation) was also used,
according to the manufacturer specifications. RG 174
oligonucleotides (SEQ ID 16) was used, in a positive and
corresponding direction to 1639 to 1659 FA genomic region, and RG
19 oligonucleotides (SEQ ID 17), in a negative and corresponding
direction to 2619 to 2639 genomic region in order to obtain a DNA
fragment with 2030 base pair (bp) intended length, which includes
all heterologous region. Thus, PCR products were obtained from T3
and T3 Esa EGFP plasmid DNA, and RT-PCR products from RNA virus
preparations were analyzed in 1% agarose gel medium with
EDTA-acetate buffer.
[0188] The yielding of different size products, in PCR experiments
conducted in samples of T3 Esa EGFP plasmid and 17D/Esa 5.1 glic
virus samples can be explained by the presence of direct
replications of 288 nucleotides corresponding to gene regions of
stem and anchor domains. This bidirectional synthesis of the PCR
reaction is promoted by positive-strip RG 174 oligonucleotides (SEQ
ID 16) alignment, which supplements the region with approximately
800 nucleotides before the 5' initial position of heterologous EGFP
cartridge expression (NS1 N-terminal, EGFP gene and E-protein stem
and anchor domains) and by negative-strip RG 19 (SEQ ID 17) which
aligns, in the back encoding region of NS1 protein, 187 nucleotides
after the end of such cartridge. It may occurs, after this
alignment step during PCR reaction, that the stem and anchor gene
region of this heterologous cartridge combines with the homology
region, located at the supplementary negative strip, corresponding
to the stem and anchor gene region of E protein (FIG. 16C). The
yield product would be shorter, with 1001-bp length, as it would
not include the insertion cartridge, and therefore, equivalent to
the vector virus gene region. On the other hand, an opposite
situation could also occur, in which a 288-nucleotide alignment
takes place in the encoding region of the stem and anchor domains
of E-protein with the negative-strip supplementary homology area of
the heterologous cartridge expression. Accordingly, it would be
produced a longer PCR fragment, with 3059 bp, including the
replicate EGFP gene (FIG. 16D), which, by its turn, is also
detected (FIG. 16 A), although to a lesser extent because of its
less effective synthesis due to its longer length. Because of the
manner in which this alignment occurs and these fragment syntheses,
they produce other minor products, as can be evidenced in FIG. 16,
bands 4 e 6.
[0189] Such initial evidences forced such samples analyses by other
supporting method to assess the viral genetic stability, since the
sole use of RT-PCR method would be insufficient to its
confirmation. Thus, the respective samples to different serial
passages were analyzed by flow cytometry approach, which would
enable the concurrent viral antigen and EGFP detection. A direct
signal relation between them, using as a common denominator the
quantity of infected cells, would indicate the presence and
functionality of heterologous cartridge expression cartridge.
Monolayers with approximately 10 Vero Cells were infected with
control and recombinant virus. After 72 hours of viral infection
(in a 0.02 medium), these monolayers were twice washed with 1 mL of
PBS/1 mM EDTA, and removed by cellular trypsination and submitted
to 2.000 g centrifugation for 7 minutes at 4.degree. C. The cells
were then resuspended in a 2% paraphormaldehyde solution, and
incubated for 20 minutes at 4.degree. C. It was added 0.5 mL of a
PBS/1 mg/mL BSA solution, containing 15% saponine, and the cells
were centrifuged at 2.000 g for 7 minutes at 4.degree. C. It was
then added 1 mL of PBS/BSA/15% saponine solution, and the cells
incubated for 10 minutes at 4.degree. C. and centrifuged at 2.000 g
for 7 minutes. This cell suspension was treated with 20 .mu.L of
anti-yellow fever antibody (yellow fever 17D hyperimmune ascitic
fluid--mouse--NIAID, code number V525701-562) diluted in a 1:80
ratio in a PBS/BSA/15% saponine solution for 1 hour at 4.degree. C.
It was then added 1 mL of PBS/BSA/15% saponine, and after a 2.000 g
centrifugation was performed for 7 minutes and the cells incubated
with 20 .mu.L of anti-mouse antibody conjugated with phycoeritrine
(DAKO; in a 1:40 dilution in a PBS/BSA/15% saponine solution) for
30 minutes at 4.degree. C. After adding 1 mL of a PBS/BSA/15%
saponine solution, the cells were centrifuged at 2.000 g for 7
minutes, and the supernatant discarded, and after the cells were
submitted to a suspension in 0.3 mL of a 2% paraphormaldehyde
solution. In order to obtain data, these cells were centrifuged at
2000 g for 7 minutes and suspended in 0.3 mL of a PBS solution and
an analysis was made with the FACScalibur flux cytometer (Becton
and Dickinson, USA). The data produced by, the cytometer were
assessed using the FlowJo Software (TreeStar Inc, USA).
[0190] Continuous seeding of this virus in Vero cell monolayers was
performed to assess 17D/Esa/5.1 glic virus genetic stability. In
Panel A of FIG. 17, it is shown a schematic figure of viral
regeneration and subsequent passages (10) of the virus which was
obtained after the transfection and in Panel B, the Vero cells
percentage which presented fluorescence to vaccine antigen and EGFP
after the infection by recombinant 17D/Esa/5.1 glic virus or only
by the vector virus. These results consist of two independent
series of serial passages; 5P1 and 10P1 samples corresponding to
one of the series and 5P2 and 10P2, corresponding to the other
independent experiment.
[0191] Based on flow cytometry analysis (FIG. 17B), it was
calculated a percentage ratio to each sample, that is the
relationship among infected cells which show double marking, EGFP's
and viral antigens', but only those which had shown viral antigens
without any fluorescence signs within EGFP detection range. This
figure represents therefore the percentage of infected cells by
17D/Esa/5.1 glic FA virus expressing EGFP protein. It was also
performed an electrophoresis analysis in 0.8% agarose gel of the
obtained fragments by RT-PCR reaction to identify these samples,
using the initial elements (RG174--SEQ ID 16 e RG19--SEQ ID 17)
from viral. RNA (FIG. 17C). Virus related to passages shown in
Panel A, and present in the supernatant of used cultures to obtain
cytometry data (Panel B) were used to extract RNA. Band 1, and
regenerated E200 vector virus from pT3 plasmid. Band 2-7, RT-PCR
products maximized from 17D/Esa/5.1 glic virus RNA in different
passage levels. Bands 2 and 3, RT-PCR from RNAs of viral stock
solutions obtained from one (1P) or two passages (2P) of the
resulting transfection virus, respectively. Bands 4-5 e 6-7
represent RT-PCR products, which were obtained from virus RNA in
the fifth and tenth passages of two independent strains (5P1 and
5P2; 10P1 and 10P2, respectively).
[0192] The concurrent analysis of viral samples, by RT-PCR and flow
cytometry methods, was performed to serial passages 1P, 2P, of
samples of two independent series of serial passages--(5P1 and
10P1; 5P2 and 10P2), as can be seen in FIG. 17.
[0193] Flow cytometry analysis revealed that the percentage for
positive cells to viral antigens and EGFP, after 17D/Esa/5.1glic
virus infection, ranged from 76% to 92% (FIG. 17B, sample 2P and
12, respectively). This includes the passages, with 85% of doubled
marked cells compared to the average value. In baseline, 17D/E200T3
FA control virus shown 0.8% of double marker cells (FIG. 17B).
These results suggest that in cells, positive in relation to viral
antigen, EGFP is also present. This conclusion is supported by
RT-PCR product analysis, using RG 174 (SEQ ID 16) and RG19 (SEQ ID
17) oligonucleotides, due to the presence of 2.0 kb band,
indicating that heterologous cartridge expression existed in Vero
cell monolayers infected by FA 17D/Esa/5.1 glic virus as far as the
tenth consecutive passage (FIG. 17C). 1 kb band, evidenced in all
RT-PCR reactions using RNA from 17D/Esa/5.1glic virus detected over
the passages, may be related to the device described in FIG. 16. To
confirm this interpretation, FIG. 18 shows the same kind of study
using a cloned viral population. The transfection supernatant of
17D/Esa/5.1glic 1P virus was placed in Vero cells monolayers
plates, with 0.5% agarose coating in 199 Earle's medium enriched by
5% fetal bovine solution (second cellular passage or 2P). After
4-day incubation at 37.degree. C., it was applied to this coating E
199 Earle's medium containing 0.1% neutral red, in order to allow
viewing lyse plates and its isolation by puncturing their coating
with a Pasteur pipette, to free the material in sterile PBS and the
placement in the plates of approximately 100 .mu.L of this
suspension in 24-microwell plates containing approximately 100,000
cells per microwell. This coating would mean a third cell passage,
but each lyse plate corresponds to a clone of the original
population of 17D/Esa/5.1glic virus.
[0194] One of these clones was randomly selected to be submitted to
genetic stability analysis and it was named clone 6 (FIG. 18).
Viral samples of this clone 6 was obtained as far as the fifth
tenth continuous passage through Vero cell monolayers and analyzed
using RT-PCR and FACS methods (FIG. 18), except the first clone
sample 3P, which was only analyzed by RT-PCR, due to the little
amount of sample that was obtained (FIG. 18 C). In FIG. 17, Panels
A to E, it is shown electrophoresis profiles of RNA amplification
by RT-PCR and fluorescence distribution of 17D/Esa/5.1 glic virus,
achieved by the transfection in passage 1 (Panel A) and passage 2
(Panel B), and passages. 5 and that of clone 6 (Panels D and E,
respectively). In Panel C, it is shown the electrophoresis profile
of RNA amplification by RT-PCR in clone 6 original stock solution
of 17D/Esa/5.1 glic virus, which was used for serial passages shown
in Panels D and E, and in Panel F, Vero cell percentage showing
fluorescence to vaccine antigens and EGFP after infection by
17D/Esa/5.1 glic virus from passage 1 (12) or two (2P) of the
resulting transfection virus, and clone 6 in passages 5 (52) and 15
(15P).
[0195] In all analyzed samples, it was possible to detect the same
band pattern previously established, that is, the occurrence of 2.0
kb and 1.0 kb bands, even in recently cloned viral preparation 3P
(FIG. 18C), confirming this RT-PRC technique limitations to assess
genetic stability of heterologous insertion in the genome of
17D/Esa/5.1glic virus. On the other hand, flow cytometry analysis
of Vero cells, infected by these different viral samples, indicates
once again the insertion stability of EGFP gene, since 95% of the
infected Vero cells by the viral preparations corresponding to
passages 5 and 15 of clone 6, expressed viral antigens and EGFP
(FIG. 18E).
Example 10
Cartridge Expression of Heterologous Expression for Chimeric
Flavivirus
[0196] Creation and Characterization of Chimeric Virus prM-E
17D/D4.
[0197] We constructed the chimeric virus 17D/DEN4/FA using prM/E
genes of dengue 4 virus, named Venezuela 88. DEN4 Ven88 virus was
isolated from blood sample of a patient who had classical dengue
disease, by direct spreading in C6/36 cells. The virus sample, as
well as the prM/E gene sequence of this virus, were gracefully
provided by Dr. F. Liprandi (IVIC, Venezuela). The viral chimeric
was constructed using 2-plasmid system of FA infectious clone
(Rice, C. M., A. Grakoui, R. Galler, and T. J. Chambers. 1989.
Transcription of infectious yellow fever RNA from full-length cDNA
templates produced by in vitro ligation. New Biol 1:285-96).
[0198] The prM/E genes of dengue 4 virus were amplified from
extracted RNA of infected cells with partially supplementary
synthetic oligonucleotides to edge 5' of prM gene of Den 4 virus
(RG 295: 5'-GCTTGATTCCCACCGGTATGGCGTTTTCCCTCAGCACAAGAGATGGC 3'; SEQ
ID No. 18) and to region 5' of gene E (RG 296: 5'
GGGCAGAATGCATGGCTCC 3'; SEQ ID No. 19), which code AgeI and NsiI
sites, respectively. This fragment was cloned in pG1/2 plasmid
(Caller, R. and Freire, M. S. 2003. Vaccines against infections
caused by YF virus; infectious cDNA, method for producing a
recombinant YF virus from the YF infectious cDNA and plasmids to
assemble the infectious cDNA. U.S. Pat. No. 6,589,522) to create
pG1/2 DEN4 plasmid. The assembly between gene C from FA and dengue
prM was conducted at the cleavage level by signalase (Caufour, P.
S., M. C. Motta, A. M. Yamamura, S. Vazquez, Ferreira, I I, A. V.
Jabor, M. C. Bonaldo, M. S. Freire, and R. Galler. 2001.
Construction, characterization and immunogenicity of recombinant
yellow fever 17D-dengue type 2 viruses. Virus Res 79:1-14). The
remaining part of dengue 4 gene E was cloned after amplifying it
with RG 297 oligonucleotides (5' GGAGCCATGCATTCTGCCC 3', including
NsiI site; SEQ ID No. 20) and RG 298 (5'
GACGCCACACAACCCATGTCGGCGCCAACTGTGAAGCCCAGAAACAGAG 3', including
NarI site; SEQ ID No. 21) in pYFMT3 plasmid (Galler, R. and Freire,
M. S. 2003. Vaccines against infections caused by YF virus;
infectious cDNA, method for producing a recombinant YF virus from
the YF infectious cDNA and plasmids to assemble the infectious
cDNA. U.S. Pat. No. 6,589,522), which contains a NarI site within E
and NS1 proteins, producing pT3D4Ven88 plasmid. The cDNA that
contains all 17D/DEN4 genome was constructed from the liaison of
three pieces: NotI-NsiI derived from pG1/2DEN4 (with SP6 promoter,
FA region 5' NTR-C and DEN4 prM-2/3 E), NsiI-MluI, derived from
pT3D4Ven88 (encoding region 3' of DEN4 gene E and FA gene NS1),
MluI-NotI derived from FA 17D/DEN1 clone (which has the remaining
part of the FA genome, cloned in low copy number vector pACNR1180;
Mateu, G. P. R. S. Marchevsky, F. Liprandi, M. C. Bonaldo, E. S. F.
Coutinho, M. Dieudonne, E. Caride, A. V. Jabor, M. S. Freire, R.
Galler. 2006. Construction and biological properties of Yellow
Fever 17D/Dengue type 1 recombinant virus. Trans R Soc Trop Med
Hyg, no prelo; Bonaldo, M. C., R. C. Garratt, P. S. Caufour, M. S.
Freire, M. M. Rodrigues, R. S. Nussenzweig, and R. Galler. 2002.
Surface expression of an immunodominant malaria protein B cell
epitope by yellow fever virus. J Mol Biol 315:873-85). All plasmids
were cultivated in E. coli XL-1 Blue.
[0199] It was obtained several transformers and 10 completed clones
were identified after transforming each strain, suggesting the
genetic stability of the construction. Four of them were selected
as they had the proper physical map, linearized with XhoI, and used
to in vitro transcription. RNA was used to viral regeneration by
electroporation of Vero Cells. At first, viral viability evidences
were viewed by cytopathic effect. The 4 identified clones generated
17D/DEN4 virus (clones 1, 2, 4 and 5), 5-7 days after
electroporation. RNA was extracted from the monolayers, and used to
RT-PCR reactions. Limitation analysis and amplicons nucleotide
sequencing confirmed the chimeric structure of the virus. It was
performed a new passage, from which working stock viral solution
were produced (titration around 6.0 log.sub.10PFU/ml). For further
working steps, involving molecular cloning of EGFP protein
expression cartridge of the chimeric virus Den4/FA genome, it was
selected clone number 5, which was named pNSK Den4/FA plasmid.
Molecular Cloning of EGFP Protein Expression Cartridge in Chimeric
Virus prM-E 17D/D4 Genome
[0200] Approximately 10 .mu.g of pGEM-T plasmid, obtained as
described in example 2 of this document, containing the expression
cartridge of EGFP protein, which was digested with 3U of Nar I
(Promega). This sample concentration was increased by
ethanol-precipitation and resuspended in electrophoresis sample
buffer, in addition to being submitted to 1% agarose gel
electrophoresis. DNA band containing 1029 bp (SEQ ID No. 4) was
purified from the gel by DNA purification system of agarose gels
(Qiagen). The material was quantitatively assessed by
spectrophotometry at 260 nm, and analyzed by 1% agarose gel
electrophoresis.
[0201] A DNA fragment of approximately 1 kb, including Nar cohesive
edges, was linked to pNSK Den4/FA plasmid, previously linearized
with restriction enzyme Nar I. As previously described, this site
is situated in this plasmid exactly in the linking point within
encoding genes to E protein of dengue 4 viruses and NS1 of yellow
fever virus. The liking was made with pNSK Den4/FA plasmid,
digested with Nar I, in 20-fold molar excess of insertion
containing EGFP gene and the gene of the enzyme T4 DNA liase
(Invitrogen). The equivalent amount of 10 ng of liaison was
transformed into E. coli DH5.alpha. (Stratagene), which was
transferred to plaques with LB 1.5 agar selective medium,
containing 25 .mu.g/mL of ampicilin. It was made mini DNA plasmid
preparations, from bacteria colonies resistant to ampicilin; and
these DNA plasmid preparation Were submitted to Nar I digestion to
confirm the cartridge cloning. The correct direction of the
insertion was verified by the nucleotide sequencing, using
synthetic RG 19 oligonucleotide (SEQ ID No. 17). Thus, it was
obtained a recombinant pNSK Den4/FA/Esa/EGFP plasmid, with 14.498
base paired-length, as illustrated in the map shown in FIG. 19, and
detailed in SEQ ID 22 sequence, in which viral genomic cDNA is
included within the 639 and 12,543 nucleotide positions,
corresponding to a 11,905 nucleotide viral genome, according to SEQ
ID 23. The positions inside the genome of 17D/FA/Den4/Esa/EGFP/6
virus of the sequences of C, prM and E genes and the sequence
constituents of the EGFP protein expression cartridge--The 27
encoding nucleotides of NS1 protein N-terminal, the EGFP gene and
the 288 nucleotides in the stem anchor part--are shown in FIG. 20B.
It should be noted that the heterologous insertion is allowed by
Nar I sites used in molecular cloning of flavivirus genome, as well
as by two stem-anchor regions: the first one located in the 5' part
of EGFP gene, is referred to the stem anchor part constituent of
the encoding gene for E protein of dengue 4 dengue, and the second
one, to the stem anchor part constituent of the encoding gene for E
protein of yellow fever virus, part of the heterologous cartridge
expression (FIG. 20A).
Obtaining Chimeric Virus 17D/Den4/FA/Esa/EGFP
[0202] The pNSK Den4/FA/Esa/EGFP plasmid was digested by the enzyme
Xho I, according to the manufacturer specifications (Promega) and
the resulting cDNA mould preparation was precipitated with ethanol,
and resuspended in Tris-EDTA buffer, pH 7.5, without nucleases. The
preparation sample was submitted to agarose gel electrophoresis to
detect its mould and quantification. The equivalent amount to 100
ng of linearized mould was used to an in vitro transcription step
of the viral RNA, using the enzyme SP6 RNA polymerase (Ampliscribe,
Epicentre Technologies), according to protocols previously
established (Galler, R. e Freire, M. S. 2003. Vaccines against
infections caused by YF virus; infectious cDNA, method for
producing a recombinant YF virus from the YF infectious cDNA and
plasmids to assemble the infectious cDNA. U.S. Pat. No. 6,589,522).
The integrity of the RNA transcripts was verified, using 0.8%/TAE
agarose gel electrophoresis. Viral RNA was transfected into Vero
cell monolayers, in the presence of Lipofectamine (Invitrogen),
which has a concentration of 20 .mu.g/mL in PBS. The culture
supernatant was collected after establishing cytopathic effect, and
used to obtain viral stock solutions.
Kinetics Assessment of Virus Growth of 17D/Den4/FA/Esa/EGFP Virus
Using Vero Cell Monolayers.
[0203] The growth capacity of the obtained recombinant
17D/Den4/FA/Esa/EGFP virus was analyzed, in relation to vaccine
FA17DD virus and parent chimeric 17D/Den4/FA virus, by means of
infection in Vero cell monolayers. Three independent experiment
were performed in respect of the viral spreading kinetics in Vero
cell monolayers (62,500 cells/cm.sup.2), in an infection
multiplicity (m.o.i) of 0.02. Aliquots of cellular supernatant at
24, 48, 72, 96, 120 and 144 hour post-infection (p.i.) were sampled
and tittered (FIG. 21).
[0204] The viral growth peaks of FA 17DD and 17D/Den4/FA occur 72
hours after infection, at 7.17 and 6.69 log 10 PFU/mL,
respectively. When these two viruses kinetics profiles are compared
to that of recombinant 17D/Den4/FA/Esa/EGFP virus, it can be
concluded that the later has a less marked growth, with viral
production of 6.31 log 10 PFU/mL 96 hours after infection (FIG.
21).
Genetic Stability of 17D/Den4/FA/Esa/EGFP Virus by Serial Passages
in Vero Cell Monolayers.
[0205] The genetic stability of the chimeric 17D/Den4/FA/Esa/EGFP
virus insertion was assessed by two series of independent passages
in Vero cell monolayers. After in vitro transfection of synthesized
viral RNA and the occurrence of cytopathic effect, viral
supernatant was collected and the obtained viral particle
preparation named first cellular passage or 1P, and it was then
used to a further infection of Vero cell monolayers in a 62,500
cells/cm.sup.2 density. The second cycle infection of this viral
supernatant was named second cellular monolayer passage or 2P, and
it was then collect, measured and stored at -70.degree. C., after
the occurrence of the cytopathic effect, approximately 96 hours
after the infection. Then, it was performed the titration of this
suspension in order to proceed to the next serial infection in a
0.02 moi. Afterwards, it was established two series of consecutive
viral infection in Vero cell monolayers, named P1 and P2. This
procedure was continuously repeated until the twentieth serial
passage was reached.
[0206] Passage samples 1P, 2P, 5P1, 5P2, 10P1, 10P2, 15P1, 15P2,
20P1 and 20P2 were submitted to viral RNA extraction by Trizol LS
method (Invitrogen), and then the RT-PRC procedure, using enzyme
M-MLV (Promega Corporation), was performed to achieve the syntheses
of simple strip cDNA and Tag polymerase enzyme to allow the PCR
reaction (Promega Corporation), according the manufacturer
specifications, aiming to verify the heterologous insertion
integrity.
[0207] It was used RG 367 (SEQ ID 24) oligonucleotides, positive
and corresponding direction to 1594-1612 genomic region of dengue 4
virus and RG 19 (SEQ ID 17) oligonucleotides, negative and
corresponding direction to 2619 a 2639 genomic region of yellow
fever virus. In the genome of 17D/Den4/FA/Esa/EGFP virus, these
oligonucleotides correspond to 2276-2294 and 4301-4321 genomic
regions, respectively. The intended length of DNA fragment,
containing EGFP heterologous cartridge expression cartridge would
be 2046 base pairs (bp), while this same region in parent
17D/Den4/FA virus, that is, without EGFP insertion, would have a
1017 bp-length. As can be noticed in FIG. 22, the band which
contains the heterologous insertion is kept as far as the twentieth
passage of two series of independent spreading, indicating the
construction stability expressed by the recombinant flavivirus.
Minimum quantities of 1,017 bp band can be noticed, reflecting the
spurious amplification detailed in example 9.
Example 11
Heterologous Protein Expression Fusioned to Genomic Region
Corresponding to Partial Stem and Anchor Domains of E Protein
[0208] Heterologous nucleotide sequences can also be cloned and
expressed in yellow fever vector virus, in a manner that its 5'
portion keeps nucleotides in the 5' portion of its NS1 gene or of
others virus and sequences of equivalent function, and in its 3'
portion, the genomic region correspondent to stem and anchor domain
parts of E protein of this vector virus. Thus, a yellow fever 17D
virus was obtained, in which it was cloned the gene that encodes
the reporting EGFP protein (SEQ ID 2) among encoding genes to E and
NS1 proteins, in such a manner that in its 5' encoding edge, 27
corresponding nucleotides to NS1 protein N-terminal (SEQ ID No. 1)
were fusioned, and to its 3' edge, the genic region of 1988
nucleotides (SEQ ID No. 25), corresponding to partial stem domain,
only H2 region, followed by anchor region, containing the two
transmembrane region, totalizing 66 amino acids (SEQ ID No. 26),
having as a result a 939 bp-heterologous gene (SEQ ID No. 29),
which corresponds to a protein with 313 amino acids (SEQ ID No.
30). The precursor polyprotein resulting from this recombinant FA
virus would be properly cleaved in the regions which side the
heterologous protein, because of sign sequences presence expressed
in E protein and heterologous protein C-terminal, in an analogous
manner as described in example 2.
Synthesis and Cloning of EGFP Expression Cartridge
[0209] In order to obtain an expression cartridge for EGFP protein,
it was firstly synthesized, using PCR, two DNA fragments:
[0210] (1) a 784 bp-DNA fragment, containing EGFP gene, using the
pEGFP-C2 plasmid (BD Biosciences Clontech) and the synthetic RG 328
(SEQ ID No. 9) and RG 332 (SEQ ID No. 27) oligonucleotides. The RG
328 (SEQ ID No. 9), of positive polarity, contained, in sequence to
15 nucleotide-genic regions corresponding to E protein
carboxyterminal, 27 nucleotides corresponding to the first nine
amino acids of NS1 protein; besides 20 nucleotides of EGFP 5' edge.
The RG 332 (SEQ ID No. 27), of negative polarity, contains, in
sequence to 22 nucleotide-genic regions of EGFP gene 3' edge, 28
nucleotides corresponding to H2 region N-terminal of the stem and
anchor domains of E protein.
[0211] (2) A second fragment with 247 bp was obtained, using T3
plasmid and a synthetic RG 33 oligonucleotides, positive polarity
(SEQ ID No. 28) with 50 nucleotides corresponding to a region with
22 encoding nucleotides of EGFP protein C-terminal and 28
nucleotides, corresponding to H2N-terminal region of the stem
domain and RG 331 (SEQ ID No. 12), inverted direction,
corresponding to 19 nucleotides which encode the carboxy terminal
of TM2 followed by 27 nucleotides encoding the NS1 protein
N-terminal. The resulting DNA fragment consists of, direction 5' to
3' of the encoding strip, 22 nucleotides, corresponding to the
carboxy terminal of EGFP protein, followed by 198 nucleotide genic
region (SEQ ID No. 25), which encodes 66 residual amino acids (SEQ
ID No. 26), corresponding to truncated stem domains (only H2
region) and E protein anchor domain (2255 to 2452 FA genomic
position); finally, followed by the genic region with 27
nucleotides, corresponding to 9 residual amine-terminal of NS1
protein (2453 to 2479 FA genomic position).
[0212] The fusion of these two DNA fragments, to generate EGFP
protein expression cartridge to be cloned in the genome of the
yellow fever virus, was carried out by PCR reaction with equivalent
molar amounts of fragments with 784 bp and 247 bp, in the presence
of 20 .mu.M RG 328 (SEQ ID No. 9) and of RG 331 (SEQ ID No. 12).
All PCR reaction was performed with the enzyme Platinum Pfx
Polymerase (Invitrogen), pursuant to the manufacturer
recommendations. The reaction products were analyzed in 1% agarose
gel electrophoresis and later purified by PCR product purifying
system (Qiagen).
[0213] The resulting fragment with 939 pb was cloned in pGEM-T
plasmid (Promega), as specified by the manufacturer. E. coil MC1061
competent bacteria were transformed with 10 ng of liaison and
placed on selective medium plates (1.5% Agar LB with 50 .mu.g/mL of
ampicilin). Plasmid DNA preparations of these bacterial clones were
obtained and submitted to digestion by the enzyme Nar I, in order
to confirm the cartridge cloning of 939 bp-DNA (SEQ ID No. 29) that
encodes a protein with 313 residual amino acids (SEQ ID No. 30).
One of these bacterial clones was selected, and its plasmid DNA was
sequenced to confirm the direction and integrity of its
insertion.
[0214] Approximately 10 .mu.g of pGEM-T plasmid, with expression
cartridge of EGFP protein, was digested by 30 of Nar (Promega). The
sample was concentrated with ethanol-precipitation, and resuspended
in electrophoresis sample buffer, in addition to being submitted to
1% agarose gel electrophoresis. DNA strip with 939 bp (SEQ ID No.
29) was separated from the gel using the DNA purifying system with
agarose gels (Qiagen). The material was quantified by
spectrophometry at 260 nm, and analyzed by 1% agarose gel
electrophoresis.
[0215] The DNA fragment with approximately 1 kb, containing Nar I
cohesive edges I, was linked to T3 vector plasmid, which includes
partial cloned viral cDNA (1373 to 9428 genomic position),
previously digested by Nar I, in a medium with 20-fold molar in
excess of the insertion containing EGFP and enzyme T4 DNA liaise
genes (Invitrogen). The corresponding amount to 10 ng of liaison
was transformed into E. coli Sure (Stratagene), which was placed in
plaques in a 1.5% Agar LB selective medium, with 50 .mu.g/mL of
ampicilin. It was then prepared mini plasmid DNA preparations from
bacteria colonies resistant to ampicilin; and plasmid DNA
preparations which had a higher length than the original pT3
control were submitted to Nar I digestion to confirm the cartridge
cloning. In order to verify the proper direction of the insertion
nucleotide sequencing was performed. Accordingly, recombinant pT3
Esa.sub.trun EGFP plasmid was obtained. In FIG. 23, it is shown the
physical map of recombinant T3 Esa.sub.trun EGFP plasmid.
Mould Preparation of Viral cDNA Viral
[0216] cDNA mould, used to obtain recombinant FA 17D virus, was
achieved using the same methodology as described in example 3 of
this document. Accordingly, pT3/Esa.sub.trun/EGFP and
pE200.sub.glic plasmids were cleaved with restriction enzymes Nsi I
and Sal I (Promega), according to conditions as recommended by the
manufacturer. Approximately 10 .mu.g of each plasmid were digested
with both enzymes. The cleavage was monitored by analysis of
aliquots equivalent to 200 ng of DNA in 0.8% agarose gel
electrophoresis in a 0.8% TAE buffer. After complete cleavage, the
enzymes were inactivated by heat treatment. The cleavage products
NsiI/SalI of these plasmids were linked by T4 DNA liaise (Epicentre
Technologies), according to conditions established by the
manufacturer. The linearization of cDNA different moulds was made
using restriction endonuclease Xho I, under condition as
established by the manufacturer (Promega). The resulting products
were subjected to ethanol precipitation and resuspended in a
Tris-EDTA buffer solution with pH 7.5 without nucleases. A sample
of each preparation was analyzed by agarose gel electrophoresis to
detect its mould and quantification. The preparations were stored
at -20.degree. C. until an in vitro transcription step.
Obtaining FA Virus from Viral cDNA: Transcription and Transfection
Steps
[0217] Using cDNA moulds, which represent the complete genome,
including plasmid sequences pE200.sub.glic and
pT3/Esa.sub.trun/EGFP, viral RNA preparations were obtained by in
vitro transcription system of RNA SP6 (AmpliScribe SP6; Epicentre
Technologies). The in vitro synthesized RNA preparations were
analyzed by 0.8% agarose gel electrophoresis in a TAE solution.
Aliquots of these RNA preparations were transfected with
Lipofectamine (Invitrogen Life Sciences) in Vero cell monolayers,
as described by Bonaldo and contributors (Bonaldo, M. C., R. C.
Garratt, P. S. Caufour, M. S. Freire, M. M. Rodrigues, R. S.
Nussenzweig, and R. Galler. 2002. Surface expression of an
immunodominant malaria protein B cell epitope by yellow fever
virus. J Mol Biol 315:873-85).
RNA Transfection Synthesized In Vitro
[0218] The transfection step was performed in a similar manner as
described in the U.S. Pat. No. 6,171,854 document. The viral RNA
transfection synthesized in vitro originates a recombinant virus,
with the capacity to grow in Vero cells. This new recombinant
yellow fever virus was named 17D/Esa.sub.trun/4.sub.glic. Its
detection was achieved when cytopathic effect appeared in the
cellular monolayer in phase contrast microscopy. The detection of
EGFP protein expression by this virus was performed within a time
range of 24, 48, 72, and 120 hours in Vero cells monolayers
infected by 17D/Esa.sub.trun/4.sub.glic virus with a 0.1 m.o.i
using fluorescence microscopy at 488 nm.
[0219] The cellular monolayers were washed twice with PBS, and
fixed with 4% paraphormaldehyde solution with 0.1 M dibase
phosphate buffer for 10 minutes, and washed once again with 0.2 M
dibase phosphate buffer. After fixing them, they were assembled in
plates and seen using a Nikon microscope (E600 eclipse model). The
highest fluorescence detection of EGFP protein expressed by
17D/Esa.sub.trun/4.sub.glic virus was at 72 and 96 hours after
infection, similarly to 17D/Esa/5.1.sub.glic virus, which has its
stem anchor region completely fusioned to this heterologous protein
carboxyterminal (FIG. 24).
[0220] FIG. 25 shows, in a schematic manner, the viral genome
region, included within prM protein and NS1 protein encoding genes
in the recombinant 17D/Esa.sub.trur/4.sub.glic virus, detailing
amino acid sequences of the truncated stem anchor region associated
to the heterologous expression cartridge, as well as restriction
enzyme Nar I sites which side this region, and were used in the
molecular cloning of this cartridge in the infectious clone of FA
17D virus. The location of prM, E genes, of heterologous cartridge
in the genome of recombinant 17D/Esa.sub.trun/4.sub.glic
virus--with their respective domains (27 nucleotides of NS1 gene,
EGFP gene and truncated stem and anchor)--and NS1 gene is also
shown in FIG. 25.
Characteristics of Viral Spreading: Kinetics Assessment of Viral
Growth in Vero Cell Monolayers
[0221] The capacity to grow of recombinant FA
17D/Esa.sub.trun/4.sub.glic virus was compared to that of
recombinant 17D/Esa/5.1.sub.glic virus and that of control 17DD
viruses--vaccine virus used in human immunization--and experimental
vaccine virus 17D/E200T3 infecting Vero cell monolayers (62,500
cells/cm.sup.2) in a 0.02 moi. At least three independent
experiments were performed for the kinetics of viral spreading
under these conditions. Aliquots of cellular supernatant of 24, 48,
72, 96h, 120 and 144 hour post-infection were collected and
tittered.
[0222] FIG. 26 shows graphically the infection kinetics of Vero
cell monolayers.
[0223] It can be noticed that, while the vaccine FA 17DD virus had
a viral growth peak 72 hours post-infection, with 6.88 log 10
PFU/mL, not only the experimental vaccine 17D/E200T3 virus, but the
recombinant viruses that express EGFP--17D/Esa.sub.trun/4glic and
17D/Esa/5.1glic--had very similar kinetics profiles with viral
production peaks in 96 hours, with values near to 6.40 log 10
PFU/mL.
[0224] A good spreading in Vero cell monolayers of recombinant
17D/Esa.sub.trun/4glic and 17D/Esa/5.1.sub.glic viruses suggests
that the production of recombinant vaccine 17D viruses, to make
insertions within E and NS1 proteins in a production level, is
feasible.
[0225] Although illustrated and described here with reference to
certain specific embodiments, the present invention is not meant to
be limited only to the details shown. Several modifications can be
made on the details within the ambit and reach of equivalents
without departing from the spirit of the invention.
Sequence CWU 1
1
47127DNAYellow Fever Virus 1gatcaaggat gcgccatcaa ctttggc
272714DNAYellow fever virus 2gtgagcaagg gcgaggagct gttcaccggg
gtggtgccca tcctggtcga gctggacggc 60gacgtaaacg gccacaagtt cagcgtgtcc
ggcgagggcg agggcgatgc cacctacggc 120aagctgaccc tgaagttcat
ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 180gtgaccaccc
tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag
240cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac
catcttcttc 300aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt
tcgagggcga caccctggtg 360aaccgcatcg agctgaaggg catcgacttc
aaggaggacg gcaacatcct ggggcacaag 420ctggagtaca actacaacag
ccacaacgtc tatatcatgg ccgacaagca gaagaacggc 480atcaaggtga
acttcaagat ccgccacaac atcgaggacg gcagcgtgca gctcgccgac
540cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga
caaccactac 600ctgagcaccc agtccgccct gagcaaagac cccaacgaga
agcgcgatca catggtcctg 660ctggagttcg tgaccgccgc cgggatcact
ctcggcatgg acgagctgta caag 7143288DNAYellow fever virus 3aagttgttca
ctcagaccat gaaaggcgtg gaacgcctgg ccgtcatggg agacaccgcc 60tgggatttca
gctccgctgg agggttcttc acttcggttg ggaaaggaat tcatacggtg
120tttggctctg cctttcaggg gctatttggc ggcttgaact ggataacaaa
ggtcatcatg 180ggggcggtac ttatatgggt tggcatcaac acaagaaaca
tgacaatgtc catgagcatg 240atcttggtag gagtgatcat gatgtttttg
tctctaggag ttggcgcc 28841029DNArecombinant yellow fever virus
4gatcaaggat gcgccatcaa ctttggcgtg agcaagggcg aggagctgtt caccggggtg
60gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc acaagttcag cgtgtccggc
120gagggcgagg gcgatgccac ctacggcaag ctgaccctga agttcatctg
caccaccggc 180aagctgcccg tgccctggcc caccctcgtg accaccctga
cctacggcgt gcagtgcttc 240agccgctacc ccgaccacat gaagcagcac
gacttcttca agtccgccat gcccgaaggc 300tacgtccagg agcgcaccat
cttcttcaag gacgacggca actacaagac ccgcgccgag 360gtgaagttcg
agggcgacac cctggtgaac cgcatcgagc tgaagggcat cgacttcaag
420gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca
caacgtctat 480atcatggccg acaagcagaa gaacggcatc aaggtgaact
tcaagatccg ccacaacatc 540gaggacggca gcgtgcagct cgccgaccac
taccagcaga acacccccat cggcgacggc 600cccgtgctgc tgcccgacaa
ccactacctg agcacccagt ccgccctgag caaagacccc 660aacgagaagc
gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg gatcactctc
720ggcatggacg agctgtacaa gaagttgttc actcagacca tgaaaggcgt
ggaacgcctg 780gccgtcatgg gagacaccgc ctgggatttc agctccgctg
gagggttctt cacttcggtt 840gggaaaggaa ttcatacggt gtttggctct
gcctttcagg ggctatttgg cggcttgaac 900tggataacaa aggtcatcat
gggggcggta cttatatggg ttggcatcaa cacaagaaac 960atgacaatgt
ccatgagcat gatcttggta ggagtgatca tgatgttttt gtctctagga
1020gttggcgcc 102959PRTyellow fever virus 5Asp Gln Gly Cys Ala Ile
Asn Phe Gly 1 5 6238PRTArtificial Sequenceamino acid sequence of
EGFP expressed by recombinant YF virus 6Val Ser Lys Gly Glu Glu Leu
Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp
Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly
Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr
Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu 50 55
60 Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln
65 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln
Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr
Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg
Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile
Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Tyr Asn Ser His Asn Val
Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Val
Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175 Gln
Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185
190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser
195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu
Phe Val 210 215 220 Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu
Tyr Lys 225 230 235 796PRTyellow fever virus 7Lys Leu Phe Thr Gln
Thr Met Lys Gly Val Glu Arg Leu Ala Val Met 1 5 10 15 Gly Asp Thr
Ala Trp Asp Phe Ser Ser Ala Gly Gly Phe Phe Thr Ser 20 25 30 Val
Gly Lys Gly Ile His Thr Val Phe Gly Ser Ala Phe Gln Gly Leu 35 40
45 Phe Gly Gly Leu Asn Trp Ile Thr Lys Val Ile Met Gly Ala Val Leu
50 55 60 Ile Trp Val Gly Ile Asn Thr Arg Asn Met Thr Met Ser Met
Ser Met 65 70 75 80 Ile Leu Val Gly Val Ile Met Met Phe Leu Ser Leu
Gly Val Gly Ala 85 90 95 8343PRTrecombinant yellow fever virus 8Asp
Gln Gly Cys Ala Ile Asn Phe Gly Val Ser Lys Gly Glu Glu Leu 1 5 10
15 Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn
20 25 30 Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala
Thr Tyr 35 40 45 Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly
Lys Leu Pro Val 50 55 60 Pro Trp Pro Thr Leu Val Thr Thr Leu Thr
Tyr Gly Val Gln Cys Phe 65 70 75 80 Ser Arg Tyr Pro Asp His Met Lys
Gln His Asp Phe Phe Lys Ser Ala 85 90 95 Met Pro Glu Gly Tyr Val
Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp 100 105 110 Gly Asn Tyr Lys
Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu 115 120 125 Val Asn
Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn 130 135 140
Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr 145
150 155 160 Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe
Lys Ile 165 170 175 Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala
Asp His Tyr Gln 180 185 190 Gln Asn Thr Pro Ile Gly Asp Gly Pro Val
Leu Leu Pro Asp Asn His 195 200 205 Tyr Leu Ser Thr Gln Ser Ala Leu
Ser Lys Asp Pro Asn Glu Lys Arg 210 215 220 Asp His Met Val Leu Leu
Glu Phe Val Thr Ala Ala Gly Ile Thr Leu 225 230 235 240 Gly Met Asp
Glu Leu Tyr Lys Lys Leu Phe Thr Gln Thr Met Lys Gly 245 250 255 Val
Glu Arg Leu Ala Val Met Gly Asp Thr Ala Trp Asp Phe Ser Ser 260 265
270 Ala Gly Gly Phe Phe Thr Ser Val Gly Lys Gly Ile His Thr Val Phe
275 280 285 Gly Ser Ala Phe Gln Gly Leu Phe Gly Gly Leu Asn Trp Ile
Thr Lys 290 295 300 Val Ile Met Gly Ala Val Leu Ile Trp Val Gly Ile
Asn Thr Arg Asn 305 310 315 320 Met Thr Met Ser Met Ser Met Ile Leu
Val Gly Val Ile Met Met Phe 325 330 335 Leu Ser Leu Gly Val Gly Ala
340 962DNArecombinant yellow fever virus 9ctaggagttg gcgccgatca
aggatgcgcc atcaactttg gcgtgagcaa gggcgaggag 60ct
621051DNArecombinant yellow fever virus 10gcctttcatg gtctgagtga
acaacttctt gtacagctcg tccatgccga g 511151DNArecombinant yellow
fever virus 11ctcggcatgg acgagctgta caagaagttg ttcactcaga
ccatgaaagg c 511246DNArecombinant yellow fever virus 12gccaaagttg
atggcgcatc cttgatcggc gccaactcct agagac 461311890DNArecombinant
yellow fever virus 13agtaaatcct gtgtgctaat tgaggtgcat tggtctgcaa
atcgagttgc taggcaataa 60acacatttgg attaatttta atcgttcgtt gagcgattag
cagagaactg accagaacat 120gtctggtcgt aaagctcagg gaaaaaccct
gggcgtcaat atggtacgac gaggagttcg 180ctccttgtca aacaaaataa
aacaaaaaac aaaacaaatt ggaaacagac ctggaccttc 240aagaggtgtt
caaggattta tctttttctt tttgttcaac attttgactg gaaaaaagat
300cacagcccac ctaaagaggt tgtggaaaat gctggaccca agacaaggct
tggctgttct 360aaggaaagtc aagagagtgg tggccagttt gatgagagga
ttgtcctcaa ggaaacgccg 420ttcccatgat gttctgactg tgcaattcct
aattttggga atgctgttga tgacgggtgg 480agtgaccttg gtgcggaaaa
acagatggtt gctcctaaat gtgacatctg aggacctcgg 540gaaaacattc
tctgtgggca caggcaactg cacaacaaac attttggaag ccaagtactg
600gtgcccagac tcaatggaat acaactgtcc caatctcagt ccaagagagg
agccagatga 660cattgattgc tggtgctatg gggtggaaaa cgttagagtc
gcatatggta agtgtgactc 720agcaggcagg tctaggaggt caagaagggc
cattgacttg cctacgcatg aaaaccatgg 780tttgaagacc cggcaagaaa
aatggatgac tggaagaatg ggtgaaaggc aactccaaaa 840gattgagaga
tggttcgtga ggaacccctt ttttgcagtg acggctctga ccattgccta
900ccttgtggga agcaacatga cgcaacgagt cgtgattgcc ctactggtct
tggctgttgg 960tccggcctac tcagctcact gcattggaat tactgacagg
gatttcattg agggggtgca 1020tggaggaact tgggtttcag ctaccctgga
gcaagacaag tgtgtcactg ttatggcccc 1080tgacaagcct tcattggaca
tctcactaga gacagtagcc attgatagac ctgctgaggt 1140gaggaaagtg
tgttacaatg cagttctcac tcatgtgaag attaatgaca agtgccccag
1200cactggagag gcccacctag ctgaagagaa cgaaggggac aatgcgtgca
agcgcactta 1260ttctgataga ggctggggca atggctgtgg cctatttggg
aaagggagca ttgtggcatg 1320cgccaaattc acttgtgcca aatccatgag
tttgtttgag gttgatcaga ccaaaattca 1380gtatgtcatc agagcacaat
tgcatgtagg ggccaagcag gaaaattgga ataccagcat 1440taagactctc
aagtttgatg ccctgtcagg ctcccaggaa gtcgagttca ttgggtatgg
1500aaaagctaca ctggaatgcc aggtgcaaac tgcggtggac tttggtaaca
gttacatcgc 1560agagatggat atcgagagct ggatagtgga cagacagtgg
gcccaggact tgaccctgcc 1620atggcagagt ggaagtggcg gggtgtggag
agagatgcat catcttgtcg aatttgaacc 1680tccgcatgcc gccactatca
gagtactggc cctgggaaac caggaaggct ccttgaaaac 1740agctcttact
ggcgcaatga gggttacaaa ggacacaaat gacaacaacc tttacaaact
1800acatggtgga catgtttctt gcagagtgaa attgtcagct ttgacactca
aggggacatc 1860ctacaaaata tgcactgaca aaatgttttt tgtcaagaac
ccaactgaca ctggccatgg 1920cactgttgtg atgcaggtga aagtgtcaaa
aggaaccccc tgcaggattc cagtgatagt 1980agctgatgat cttacagcgg
caatcaataa aggcattttg gttacagtta accccatcgc 2040ctcaaccaat
gatgatgaag tgctgattga ggtgaaccca ccttttggag acagctacat
2100tatcgttggg agaggagatt cacgtctcac ttaccagtgg cacaaagagg
gaagctcaat 2160aggaaagttg ttcactcaga ccatgaaagg cgtggaacgc
ctggccgtca tgggagacac 2220cgcctgggat ttcagctccg ctggagggtt
cttcacttcg gttgggaaag gaattcatac 2280ggtgtttggc tctgcctttc
aggggctatt tggcggcttg aactggataa caaaggtcat 2340catgggggcg
gtactcatat gggttggcat caacacaaga aacatgacaa tgtccatgag
2400catgatcttg gtaggagtga tcatgatgtt tttgtctcta ggagttggcg
ccgatcaagg 2460atgcgccatc aactttggcg tgagcaaggg cgaggagctg
ttcaccgggg tggtgcccat 2520cctggtcgag ctggacggcg acgtaaacgg
ccacaagttc agcgtgtccg gcgagggcga 2580gggcgatgcc acctacggca
agctgaccct gaagttcatc tgcaccaccg gcaagctgcc 2640cgtgccctgg
cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta
2700ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag
gctacgtcca 2760ggagcgcacc atcttcttca aggacgacgg caactacaag
acccgcgccg aggtgaagtt 2820cgagggcgac accctggtga accgcatcga
gctgaagggc atcgacttca aggaggacgg 2880caacatcctg gggcacaagc
tggagtacaa ctacaacagc cacaacgtct atatcatggc 2940cgacaagcag
aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg
3000cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg
gccccgtgct 3060gctgcccgac aaccactacc tgagcaccca gtccgccctg
agcaaagacc ccaacgagaa 3120gcgcgatcac atggtcctgc tggagttcgt
gaccgccgcc gggatcactc tcggcatgga 3180cgagctgtac aagaagttgt
tcactcagac catgaaaggc gtggaacgcc tggccgtcat 3240gggagacacc
gcctgggatt tcagctccgc tggagggttc ttcacttcgg ttgggaaagg
3300aattcatacg gtgtttggct ctgcctttca ggggctattt ggcggcttga
actggataac 3360aaaggtcatc atgggggcgg tacttatatg ggttggcatc
aacacaagaa acatgacaat 3420gtccatgagc atgatcttgg taggagtgat
catgatgttt ttgtctctag gagttggcgc 3480cgatcaagga tgcgccatca
actttggcaa gagagagctc aagtgcggag atggtatctt 3540catatttaga
gactctgatg actggctgaa caagtactca tactatccag aagatcctgt
3600gaagcttgca tcaatagtga aagcctcttt cgaagaaggg aagtgtggcc
taaattcagt 3660tgactccctt gagcatgaga tgtggagaag cagggcagat
gagattaata ccatttttga 3720ggaaaacgag gtggacattt ctgttgtcgt
gcaggatcca aagaatgttt accagagagg 3780aactcatcca ttttccagaa
ttcgggatgg tctgcagtat ggttggaaga cttggggtaa 3840gaaccttgtg
ttctccccag ggaggaagaa tggaagcttc atcatagatg gaaagtccag
3900gaaagaatgc ccgttttcaa accgggtctg gaattctttc cagatagagg
agtttgggac 3960gggagtgttc accacacgcg tgtacatgga cgcagtcttt
gaatacacca tagactgcga 4020tggatctatc ttgggtgcag cggtgaacgg
aaaaaagagt gcccatggct ctccaacatt 4080ttggatggga agtcatgaag
taaatgggac atggatgatc cacaccttgg aggcattaga 4140ttacaaggag
tgtgagtggc cactgacaca tacgattgga acatcagttg aagagagtga
4200aatgttcatg ccgagatcaa tcggaggccc agttagctct cacaatcata
tccctggata 4260caaggttcag acgaacggac cttggatgca ggtaccacta
gaagtgaaga gagaagcttg 4320cccagggact agcgtgatca ttgatggcaa
ctgtgatgga cggggaaaat caaccagatc 4380caccacggat agcgggaaag
ttattcctga atggtgttgc cgctcctgca caatgccgcc 4440tgtgagcttc
catggtagtg atgggtgttg gtatcccatg gaaattaggc caaggaaaac
4500gcatgaaagc catctggtgc gctcctgggt tacagctgga gaaatacatg
ctgtcccttt 4560tggtttggtg agcatgatga tagcaatgga agtggtccta
aggaaaagac agggaccaaa 4620gcaaatgttg gttggaggag tagtgctctt
gggagcaatg ctggtcgggc aagtaactct 4680ccttgatttg ctgaaactca
cagtggctgt gggattgcat ttccatgaga tgaacaatgg 4740aggagacgcc
atgtatatgg cgttgattgc tgccttttca atcagaccag ggctgctcat
4800cggctttggg ctcaggaccc tatggagccc tcgggaacgc cttgtgctga
ccctaggagc 4860agccatggtg gagattgcct tgggtggcgt gatgggcggc
ctgtggaagt atctaaatgc 4920agtttctctc tgcatcctga caataaatgc
tgttgcttct aggaaagcat caaataccat 4980cttgcccctc atggctctgt
tgacacctgt cactatggct gaggtgagac ttgccgcaat 5040gttcttttgt
gccatggtta tcataggggt ccttcaccag aatttcaagg acacctccat
5100gcagaagact atacctctgg tggccctcac actcacatct tacctgggct
tgacacaacc 5160ttttttgggc ctgtgtgcat ttctggcaac ccgcatattt
gggcgaagga gtatcccagt 5220gaatgaggca ctcgcagcag ctggtctagt
gggagtgctg gcaggactgg cttttcagga 5280gatggagaac ttccttggtc
cgattgcagt tggaggactc ctgatgatgc tggttagcgt 5340ggctgggagg
gtggatgggc tagagctcaa gaagcttggt gaagtttcat gggaagagga
5400ggcggagatc agcgggagtt ccgcccgcta tgatgtggca ctcagtgaac
aaggggagtt 5460caagctgctt tctgaagaga aagtgccatg ggaccaggtt
gtgatgacct cgctggcctt 5520ggttggggct gccctccatc catttgctct
tctgctggtc cttgctgggt ggctgtttca 5580tgtcagggga gctaggagaa
gtggggatgt cttgtgggat attcccactc ctaagatcat 5640cgaggaatgt
gaacatctgg aggatgggat ttatggcata ttccagtcaa ccttcttggg
5700ggcctcccag cgaggagtgg gagtggcaca gggaggggtg ttccacacaa
tgtggcatgt 5760cacaagagga gctttccttg tcaggaatgg caagaagttg
attccatctt gggcttcagt 5820aaaggaagac cttgtcgcct atggtggctc
atggaagttg gaaggcagat gggatggaga 5880ggaagaggtc cagttgatcg
cggctgttcc aggaaagaac gtggtcaacg tccagacaaa 5940accgagcttg
ttcaaagtga ggaatggggg agaaatcggg gctgtcgctc ttgactatcc
6000gagtggcact tcaggatctc ctattgttaa caggaacgga gaggtgattg
ggctgtacgg 6060caatggcatc cttgtcggtg acaactcctt cgtgtccgcc
atatcccaga ctgaggtgaa 6120ggaagaagga aaggaggagc tccaagagat
cccgacaatg ctaaagaaag gaatgacaac 6180tgtccttgat tttcatcctg
gagctgggaa gacaagacgt ttcctcccac agatcttggc 6240cgagtgcgca
cggagacgct tgcgcactct tgtgttggcc cccaccaggg ttgttctttc
6300tgaaatgaag gaggcttttc acggcctgga cgtgaaattc cacacacagg
ctttttccgc 6360tcacggcagc gggagagaag tcattgatgc catgtgccat
gccaccctaa cttacaggat 6420gttggaacca actagggttg ttaactggga
agtgatcatt atggatgaag cccatttttt 6480ggatccagct agcatagccg
ctagaggttg ggcagcgcac agagctaggg caaatgaaag 6540tgcaacaatc
ttgatgacag ccacaccgcc tgggactagt gatgaatttc cacattcaaa
6600tggtgaaata gaagatgttc aaacggacat acccagtgag ccctggaaca
cagggcatga 6660ctggatcctg gctgacaaaa ggcccacggc atggttcctt
ccatccatca gagctgcaaa 6720tgtcatggct gcctctttgc gtaaggctgg
aaagagtgtg gtggtcctga acaggaaaac 6780ctttgagaga gaatacccca
cgataaagca gaagaaacct gactttatat tggccactga 6840catagctgaa
atgggagcca acctttgcgt ggagcgagtg ctggattgca ggacggcttt
6900taagcctgtg cttgtggatg aagggaggaa ggtggcaata aaagggccac
ttcgtatctc 6960cgcatcctct gctgctcaaa ggagggggcg cattgggaga
aatcccaaca gagatggaga 7020ctcatactac tattctgagc ctacaagtga
aaataatgcc caccacgtct gctggttgga 7080ggcctcaatg ctcttggaca
acatggaggt gaggggtgga atggtcgccc cactctatgg 7140cgttgaagga
actaaaacac cagtttcccc tggtgaaatg agactgaggg atgaccagag
7200gaaagtcttc agagaactag tgaggaattg tgacctgccc gtttggcttt
cgtggcaagt 7260ggccaaggct ggtttgaaga cgaatgatcg taagtggtgt
tttgaaggcc ctgaggaaca 7320tgagatcttg aatgacagcg gtgaaacagt
gaagtgcagg gctcctggag gagcaaagaa 7380gcctctgcgc ccaaggtggt
gtgatgaaag ggtgtcatct gaccagagtg cgctgtctga 7440atttattaag
tttgctgaag gtaggagggg agctgctgaa gtgctagttg tgctgagtga
7500actccctgat ttcctggcta aaaaaggtgg agaggcaatg gataccatca
gtgtgttcct 7560ccactctgag gaaggctcta gggcttaccg caatgcacta
tcaatgatgc ctgaggcaat 7620gacaatagtc atgctgttta tactggctgg
actactgaca tcgggaatgg tcatcttttt 7680catgtctccc
aaaggcatca gtagaatgtc tatggcgatg ggcacaatgg ccggctgtgg
7740atatctcatg ttccttggag gcgtcaaacc cactcacatc tcctatgtca
tgctcatatt 7800ctttgtcctg atggtggttg tgatccccga gccagggcaa
caaaggtcca tccaagacaa 7860ccaagtggca tacctcatta ttggcatcct
gacgctggtt tcagcggtgg cagccaacga 7920gctaggcatg ctggagaaaa
ccaaagagga cctctttggg aagaagaact taattccatc 7980tagtgcttca
ccctggagtt ggccggatct tgacctgaag ccaggagctg cctggacagt
8040gtacgttggc attgttacaa tgctctctcc aatgttgcac cactggatca
aagtcgaata 8100tggcaacctg tctctgtctg gaatagccca gtcagcctca
gtcctttctt tcatggacaa 8160ggggatacca ttcatgaaga tgaatatctc
ggtcataatg ctgctggtca gtggctggaa 8220ttcaataaca gtgatgcctc
tgctctgtgg catagggtgc gccatgctcc actggtctct 8280cattttacct
ggaatcaaag cgcagcagtc aaagcttgca cagagaaggg tgttccatgg
8340cgttgccaag aaccctgtgg ttgatgggaa tccaacagtt gacattgagg
aagctcctga 8400aatgcctgcc ctttatgaga agaaactggc tctatatctc
cttcttgctc tcagcctagc 8460ttctgttgcc atgtgcagaa cgcccttttc
attggctgaa ggcattgtcc tagcatcagc 8520tgccttaggg ccgctcatag
agggaaacac cagccttctt tggaatggac ccatggctgt 8580ctccatgaca
ggagtcatga gggggaatca ctatgctttt gtgggagtca tgtacaatct
8640atggaagatg aaaactggac gccgggggag cgcgaatgga aaaactttgg
gtgaagtctg 8700gaagagggaa ctgaatctgt tggacaagcg acagtttgag
ttgtataaaa ggaccgacat 8760tgtggaggtg gatcgtgata cggcacgcag
gcatttggcc gaagggaagg tggacaccgg 8820ggtggcggtc tccaggggga
ccgcaaagtt aaggtggttc catgagcgtg gctatgtcaa 8880gctggaaggt
agggtgattg acctggggtg tggccgcgga ggctggtgtt actacgctgc
8940tgcgcaaaag gaagtgagtg gggtcaaagg atttactctt ggaagagacg
gccatgagaa 9000acccatgaat gtgcaaagtc tgggatggaa catcatcacc
ttcaaggaca aaactgatat 9060ccaccgccta gaaccagtga aatgtgacac
ccttttgtgt gacattggag agtcatcatc 9120gtcatcggtc acagaggggg
aaaggaccgt gagagttctt gatactgtag aaaaatggct 9180ggcttgtggg
gttgacaact tctgtgtgaa ggtgttagct ccatacatgc cagatgttct
9240tgagaaactg gaattgctcc aaaggaggtt tggcggaaca gtgatcagga
accctctctc 9300caggaattcc actcatgaaa tgtactacgt gtctggagcc
cgcagcaatg tcacatttac 9360tgtgaaccaa acatcccgcc tcctgatgag
gagaatgagg cgtccaactg gaaaagtgac 9420cctggaggct gacgtcatcc
tcccaattgg gacacgcagt gttgagacag acaagggacc 9480cctggacaaa
gaggccatag aagaaagggt tgagaggata aaatctgagt acatgacctc
9540ttggttttat gacaatgaca acccctacag gacctggcac tactgtggct
cctatgtcac 9600aaaaacctca ggaagtgcgg cgagcatggt aaatggtgtt
attaaaattc tgacatatcc 9660atgggacagg atagaggagg tcaccagaat
ggcaatgact gacacaaccc cttttggaca 9720gcaaagagtg tttaaagaaa
aagttgacac cagagcaaag gatccaccag cgggaactag 9780gaagatcatg
aaagttgtca acaggtggct gttccgccac ctggccagag aaaagagccc
9840cagactgtgc acaaaggaag aatttattgc aaaagtccga agtcatgcag
ccattggagc 9900ttacctggaa gaacaagaac agtggaagac tgccaatgag
gctgtccaag acccaaagtt 9960ctgggaactg gtggatgaag aaaggaagct
gcaccaacaa ggcaggtgtc ggacttgtgt 10020gtacaacatg atggggaaaa
gagagaagaa gctgtcagag tttgggaaag caaagggaag 10080ccgtgccata
tggtatatgt ggctgggagc gcggtatctt gagtttgagg ccctgggatt
10140cctgaatgag gaccattggg cttccaggga aaactcagga ggaggagtgg
aaggcattgg 10200cttacaatac ctaggatatg tgatcagaga cctggctgca
atggatggtg gtggattcta 10260cgcggatgac accgctggat gggacacgcg
catcacagag gcagaccttg atgatgaaca 10320ggagatcttg aactacatga
gcccacatca caaaaaactg gcacaagcag tgatggaaat 10380gacatacaag
aacaaagtgg tgaaagtgtt gagaccagcc ccaggaggga aagcctacat
10440ggatgtcata agtcgacgag accagagagg atccgggcag gtagtgactt
atgctctgaa 10500caccatcacc aacttgaaag tccaattgat cagaatggca
gaagcagaga tggtgataca 10560tcaccaacat gttcaagatt gtgatgaatc
agttctgacc aggctggagg catggctcac 10620tgagcacgga tgtaacagac
tgaagaggat ggcggtgagt ggagacgact gtgtggtccg 10680gcccatcgat
gacaggttcg gcctggccct gtcccatctc aacgccatgt ccaaggttag
10740aaaggacata tctgaatggc agccatcaaa agggtggaat gattgggaga
atgtgccctt 10800ctgttcccac cacttccatg aactacagct gaaggatggc
aggaggattg tggtgccttg 10860ccgagaacag gacgagctca ttgggagagg
aagggtgtct ccaggaaacg gctggatgat 10920caaggaaaca gcttgcctca
gcaaagccta tgccaacatg tggtcactga tgtattttca 10980caaaagggac
atgaggctac tgtcattggc tgtttcctca gctgttccca cctcatgggt
11040tccacaagga cgcacaacat ggtcgattca tgggaaaggg gagtggatga
ccacggaaga 11100catgcttgag gtgtggaaca gagtatggat aaccaacaac
ccacacatgc aggacaagac 11160aatggtgaaa aaatggagag atgtccctta
tctaaccaag agacaagaca agctgtgcgg 11220atcactgatt ggaatgacca
atagggccac ctgggcctcc cacatccatt tagtcatcca 11280tcgtatccga
acgctgattg gacaggagaa atacactgac tacctaacag tcatggacag
11340gtattctgtg gatgctgacc tgcaactggg tgagcttatc tgaaacacca
tctaacagga 11400ataaccggga tacaaaccac gggtggagaa ccggactccc
cacaacctga aaccgggata 11460taaaccacgg ctggagaacc gggctccgca
cttaaaatga aacagaaacc gggataaaaa 11520ctacggatgg agaaccggac
tccacacatt gagacagaag aagttgtcag cccagaaccc 11580cacacgagtt
ttgccactgc taagctgtga ggcagtgcag gctgggacag ccgacctcca
11640ggttgcgaaa aacctggttt ctgggacctc ccaccccaga gtaaaaagaa
cggagcctcc 11700gctaccaccc tcccacgtgg tggtagaaag acggggtcta
gaggttagag gagaccctcc 11760agggaacaaa tagtgggacc atattgacgc
cagggaaaga ccggagtggt tctctgcttt 11820tcctccagag gtctgtgagc
acagtttgct caagaataag cagacctttg gatgacaaac 11880acaaaaccac
11890143754PRTrecombinant yellow fever virus 14Met Ser Gly Arg Lys
Ala Gln Gly Lys Thr Leu Gly Val Asn Met Val 1 5 10 15 Arg Arg Gly
Val Arg Ser Leu Ser Asn Lys Ile Lys Gln Lys Thr Lys 20 25 30 Gln
Ile Gly Asn Arg Pro Gly Pro Ser Arg Gly Val Gln Gly Phe Ile 35 40
45 Phe Phe Phe Leu Phe Asn Ile Leu Thr Gly Lys Lys Ile Thr Ala His
50 55 60 Leu Lys Arg Leu Trp Lys Met Leu Asp Pro Arg Gln Gly Leu
Ala Val 65 70 75 80 Leu Arg Lys Val Lys Arg Val Val Ala Ser Leu Met
Arg Gly Leu Ser 85 90 95 Ser Arg Lys Arg Arg Ser His Asp Val Leu
Thr Val Gln Phe Leu Ile 100 105 110 Leu Gly Met Leu Leu Met Thr Gly
Gly Val Thr Leu Val Arg Lys Asn 115 120 125 Arg Trp Leu Leu Leu Asn
Val Thr Ser Glu Asp Leu Gly Lys Thr Phe 130 135 140 Ser Val Gly Thr
Gly Asn Cys Thr Thr Asn Ile Leu Glu Ala Lys Tyr 145 150 155 160 Trp
Cys Pro Asp Ser Met Glu Tyr Asn Cys Pro Asn Leu Ser Pro Arg 165 170
175 Glu Glu Pro Asp Asp Ile Asp Cys Trp Cys Tyr Gly Val Glu Asn Val
180 185 190 Arg Val Ala Tyr Gly Lys Cys Asp Ser Ala Gly Arg Ser Arg
Arg Ser 195 200 205 Arg Arg Ala Ile Asp Leu Pro Thr His Glu Asn His
Gly Leu Lys Thr 210 215 220 Arg Gln Glu Lys Trp Met Thr Gly Arg Met
Gly Glu Arg Gln Leu Gln 225 230 235 240 Lys Ile Glu Arg Trp Phe Val
Arg Asn Pro Phe Phe Ala Val Thr Ala 245 250 255 Leu Thr Ile Ala Tyr
Leu Val Gly Ser Asn Met Thr Gln Arg Val Val 260 265 270 Ile Ala Leu
Leu Val Leu Ala Val Gly Pro Ala Tyr Ser Ala His Cys 275 280 285 Ile
Gly Ile Thr Asp Arg Asp Phe Ile Glu Gly Val His Gly Gly Thr 290 295
300 Trp Val Ser Ala Thr Leu Glu Gln Asp Lys Cys Val Thr Val Met Ala
305 310 315 320 Pro Asp Lys Pro Ser Leu Asp Ile Ser Leu Glu Thr Val
Ala Ile Asp 325 330 335 Arg Pro Ala Glu Val Arg Lys Val Cys Tyr Asn
Ala Val Leu Thr His 340 345 350 Val Lys Ile Asn Asp Lys Cys Pro Ser
Thr Gly Glu Ala His Leu Ala 355 360 365 Glu Glu Asn Glu Gly Asp Asn
Ala Cys Lys Arg Thr Tyr Ser Asp Arg 370 375 380 Gly Trp Gly Asn Gly
Cys Gly Leu Phe Gly Lys Gly Ser Ile Val Ala 385 390 395 400 Cys Ala
Lys Phe Thr Cys Ala Lys Ser Met Ser Leu Phe Glu Val Asp 405 410 415
Gln Thr Lys Ile Gln Tyr Val Ile Arg Ala Gln Leu His Val Gly Ala 420
425 430 Lys Gln Glu Asn Trp Asn Thr Ser Ile Lys Thr Leu Lys Phe Asp
Ala 435 440 445 Leu Ser Gly Ser Gln Glu Val Glu Phe Ile Gly Tyr Gly
Lys Ala Thr 450 455 460 Leu Glu Cys Gln Val Gln Thr Ala Val Asp Phe
Gly Asn Ser Tyr Ile 465 470 475 480 Ala Glu Met Asp Ile Glu Ser Trp
Ile Val Asp Arg Gln Trp Ala Gln 485 490 495 Asp Leu Thr Leu Pro Trp
Gln Ser Gly Ser Gly Gly Val Trp Arg Glu 500 505 510 Met His His Leu
Val Glu Phe Glu Pro Pro His Ala Ala Thr Ile Arg 515 520 525 Val Leu
Ala Leu Gly Asn Gln Glu Gly Ser Leu Lys Thr Ala Leu Thr 530 535 540
Gly Ala Met Arg Val Thr Lys Asp Thr Asn Asp Asn Asn Leu Tyr Lys 545
550 555 560 Leu His Gly Gly His Val Ser Cys Arg Val Lys Leu Ser Ala
Leu Thr 565 570 575 Leu Lys Gly Thr Ser Tyr Lys Ile Cys Thr Asp Lys
Met Phe Phe Val 580 585 590 Lys Asn Pro Thr Asp Thr Gly His Gly Thr
Val Val Met Gln Val Lys 595 600 605 Val Ser Lys Gly Thr Pro Cys Arg
Ile Pro Val Ile Val Ala Asp Asp 610 615 620 Leu Thr Ala Ala Ile Asn
Lys Gly Ile Leu Val Thr Val Asn Pro Ile 625 630 635 640 Ala Ser Thr
Asn Asp Asp Glu Val Leu Ile Glu Val Asn Pro Pro Phe 645 650 655 Gly
Asp Ser Tyr Ile Ile Val Gly Arg Gly Asp Ser Arg Leu Thr Tyr 660 665
670 Gln Trp His Lys Glu Gly Ser Ser Ile Gly Lys Leu Phe Thr Gln Thr
675 680 685 Met Lys Gly Val Glu Arg Leu Ala Val Met Gly Asp Thr Ala
Trp Asp 690 695 700 Phe Ser Ser Ala Gly Gly Phe Phe Thr Ser Val Gly
Lys Gly Ile His 705 710 715 720 Thr Val Phe Gly Ser Ala Phe Gln Gly
Leu Phe Gly Gly Leu Asn Trp 725 730 735 Ile Thr Lys Val Ile Met Gly
Ala Val Leu Ile Trp Val Gly Ile Asn 740 745 750 Thr Arg Asn Met Thr
Met Ser Met Ser Met Ile Leu Val Gly Val Ile 755 760 765 Met Met Phe
Leu Ser Leu Gly Val Gly Ala Asp Gln Gly Cys Ala Ile 770 775 780 Asn
Phe Gly Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro 785 790
795 800 Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser
Val 805 810 815 Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu
Thr Leu Lys 820 825 830 Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro
Trp Pro Thr Leu Val 835 840 845 Thr Thr Leu Thr Tyr Gly Val Gln Cys
Phe Ser Arg Tyr Pro Asp His 850 855 860 Met Lys Gln His Asp Phe Phe
Lys Ser Ala Met Pro Glu Gly Tyr Val 865 870 875 880 Gln Glu Arg Thr
Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg 885 890 895 Ala Glu
Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu 900 905 910
Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu 915
920 925 Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys
Gln 930 935 940 Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn
Ile Glu Asp 945 950 955 960 Gly Ser Val Gln Leu Ala Asp His Tyr Gln
Gln Asn Thr Pro Ile Gly 965 970 975 Asp Gly Pro Val Leu Leu Pro Asp
Asn His Tyr Leu Ser Thr Gln Ser 980 985 990 Ala Leu Ser Lys Asp Pro
Asn Glu Lys Arg Asp His Met Val Leu Leu 995 1000 1005 Glu Phe Val
Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu 1010 1015 1020 Tyr
Lys Lys Leu Phe Thr Gln Thr Met Lys Gly Val Glu Arg Leu 1025 1030
1035 Ala Val Met Gly Asp Thr Ala Trp Asp Phe Ser Ser Ala Gly Gly
1040 1045 1050 Phe Phe Thr Ser Val Gly Lys Gly Ile His Thr Val Phe
Gly Ser 1055 1060 1065 Ala Phe Gln Gly Leu Phe Gly Gly Leu Asn Trp
Ile Thr Lys Val 1070 1075 1080 Ile Met Gly Ala Val Leu Ile Trp Val
Gly Ile Asn Thr Arg Asn 1085 1090 1095 Met Thr Met Ser Met Ser Met
Ile Leu Val Gly Val Ile Met Met 1100 1105 1110 Phe Leu Ser Leu Gly
Val Gly Ala Asp Gln Gly Cys Ala Ile Asn 1115 1120 1125 Phe Gly Lys
Arg Glu Leu Lys Cys Gly Asp Gly Ile Phe Ile Phe 1130 1135 1140 Arg
Asp Ser Asp Asp Trp Leu Asn Lys Tyr Ser Tyr Tyr Pro Glu 1145 1150
1155 Asp Pro Val Lys Leu Ala Ser Ile Val Lys Ala Ser Phe Glu Glu
1160 1165 1170 Gly Lys Cys Gly Leu Asn Ser Val Asp Ser Leu Glu His
Glu Met 1175 1180 1185 Trp Arg Ser Arg Ala Asp Glu Ile Asn Thr Ile
Phe Glu Glu Asn 1190 1195 1200 Glu Val Asp Ile Ser Val Val Val Gln
Asp Pro Lys Asn Val Tyr 1205 1210 1215 Gln Arg Gly Thr His Pro Phe
Ser Arg Ile Arg Asp Gly Leu Gln 1220 1225 1230 Tyr Gly Trp Lys Thr
Trp Gly Lys Asn Leu Val Phe Ser Pro Gly 1235 1240 1245 Arg Lys Asn
Gly Ser Phe Ile Ile Asp Gly Lys Ser Arg Lys Glu 1250 1255 1260 Cys
Pro Phe Ser Asn Arg Val Trp Asn Ser Phe Gln Ile Glu Glu 1265 1270
1275 Phe Gly Thr Gly Val Phe Thr Thr Arg Val Tyr Met Asp Ala Val
1280 1285 1290 Phe Glu Tyr Thr Ile Asp Cys Asp Gly Ser Ile Leu Gly
Ala Ala 1295 1300 1305 Val Asn Gly Lys Lys Ser Ala His Gly Ser Pro
Thr Phe Trp Met 1310 1315 1320 Gly Ser His Glu Val Asn Gly Thr Trp
Met Ile His Thr Leu Glu 1325 1330 1335 Ala Leu Asp Tyr Lys Glu Cys
Glu Trp Pro Leu Thr His Thr Ile 1340 1345 1350 Gly Thr Ser Val Glu
Glu Ser Glu Met Phe Met Pro Arg Ser Ile 1355 1360 1365 Gly Gly Pro
Val Ser Ser His Asn His Ile Pro Gly Tyr Lys Val 1370 1375 1380 Gln
Thr Asn Gly Pro Trp Met Gln Val Pro Leu Glu Val Lys Arg 1385 1390
1395 Glu Ala Cys Pro Gly Thr Ser Val Ile Ile Asp Gly Asn Cys Asp
1400 1405 1410 Gly Arg Gly Lys Ser Thr Arg Ser Thr Thr Asp Ser Gly
Lys Val 1415 1420 1425 Ile Pro Glu Trp Cys Cys Arg Ser Cys Thr Met
Pro Pro Val Ser 1430 1435 1440 Phe His Gly Ser Asp Gly Cys Trp Tyr
Pro Met Glu Ile Arg Pro 1445 1450 1455 Arg Lys Thr His Glu Ser His
Leu Val Arg Ser Trp Val Thr Ala 1460 1465 1470 Gly Glu Ile His Ala
Val Pro Phe Gly Leu Val Ser Met Met Ile 1475 1480 1485 Ala Met Glu
Val Val Leu Arg Lys Arg Gln Gly Pro Lys Gln Met 1490 1495 1500 Leu
Val Gly Gly Val Val Leu Leu Gly Ala Met Leu Val Gly Gln 1505 1510
1515 Val Thr Leu Leu Asp Leu Leu Lys Leu Thr Val Ala Val Gly Leu
1520 1525 1530 His Phe His Glu Met Asn Asn Gly Gly Asp Ala Met Tyr
Met Ala 1535 1540 1545 Leu Ile Ala Ala Phe Ser Ile Arg Pro Gly Leu
Leu Ile Gly Phe 1550 1555 1560 Gly Leu Arg Thr Leu Trp Ser Pro Arg
Glu Arg Leu Val Leu Thr 1565 1570 1575 Leu Gly Ala Ala Met Val Glu
Ile Ala Leu Gly Gly Val Met Gly 1580 1585 1590 Gly Leu Trp Lys Tyr
Leu Asn Ala Val Ser Leu Cys Ile Leu Thr 1595 1600 1605 Ile Asn Ala
Val Ala Ser Arg Lys Ala Ser Asn Thr Ile Leu Pro 1610
1615 1620 Leu Met Ala Leu Leu Thr Pro Val Thr Met Ala Glu Val Arg
Leu 1625 1630 1635 Ala Ala Met Phe Phe Cys Ala Met Val Ile Ile Gly
Val Leu His 1640 1645 1650 Gln Asn Phe Lys Asp Thr Ser Met Gln Lys
Thr Ile Pro Leu Val 1655 1660 1665 Ala Leu Thr Leu Thr Ser Tyr Leu
Gly Leu Thr Gln Pro Phe Leu 1670 1675 1680 Gly Leu Cys Ala Phe Leu
Ala Thr Arg Ile Phe Gly Arg Arg Ser 1685 1690 1695 Ile Pro Val Asn
Glu Ala Leu Ala Ala Ala Gly Leu Val Gly Val 1700 1705 1710 Leu Ala
Gly Leu Ala Phe Gln Glu Met Glu Asn Phe Leu Gly Pro 1715 1720 1725
Ile Ala Val Gly Gly Leu Leu Met Met Leu Val Ser Val Ala Gly 1730
1735 1740 Arg Val Asp Gly Leu Glu Leu Lys Lys Leu Gly Glu Val Ser
Trp 1745 1750 1755 Glu Glu Glu Ala Glu Ile Ser Gly Ser Ser Ala Arg
Tyr Asp Val 1760 1765 1770 Ala Leu Ser Glu Gln Gly Glu Phe Lys Leu
Leu Ser Glu Glu Lys 1775 1780 1785 Val Pro Trp Asp Gln Val Val Met
Thr Ser Leu Ala Leu Val Gly 1790 1795 1800 Ala Ala Leu His Pro Phe
Ala Leu Leu Leu Val Leu Ala Gly Trp 1805 1810 1815 Leu Phe His Val
Arg Gly Ala Arg Arg Ser Gly Asp Val Leu Trp 1820 1825 1830 Asp Ile
Pro Thr Pro Lys Ile Ile Glu Glu Cys Glu His Leu Glu 1835 1840 1845
Asp Gly Ile Tyr Gly Ile Phe Gln Ser Thr Phe Leu Gly Ala Ser 1850
1855 1860 Gln Arg Gly Val Gly Val Ala Gln Gly Gly Val Phe His Thr
Met 1865 1870 1875 Trp His Val Thr Arg Gly Ala Phe Leu Val Arg Asn
Gly Lys Lys 1880 1885 1890 Leu Ile Pro Ser Trp Ala Ser Val Lys Glu
Asp Leu Val Ala Tyr 1895 1900 1905 Gly Gly Ser Trp Lys Leu Glu Gly
Arg Trp Asp Gly Glu Glu Glu 1910 1915 1920 Val Gln Leu Ile Ala Ala
Val Pro Gly Lys Asn Val Val Asn Val 1925 1930 1935 Gln Thr Lys Pro
Ser Leu Phe Lys Val Arg Asn Gly Gly Glu Ile 1940 1945 1950 Gly Ala
Val Ala Leu Asp Tyr Pro Ser Gly Thr Ser Gly Ser Pro 1955 1960 1965
Ile Val Asn Arg Asn Gly Glu Val Ile Gly Leu Tyr Gly Asn Gly 1970
1975 1980 Ile Leu Val Gly Asp Asn Ser Phe Val Ser Ala Ile Ser Gln
Thr 1985 1990 1995 Glu Val Lys Glu Glu Gly Lys Glu Glu Leu Gln Glu
Ile Pro Thr 2000 2005 2010 Met Leu Lys Lys Gly Met Thr Thr Val Leu
Asp Phe His Pro Gly 2015 2020 2025 Ala Gly Lys Thr Arg Arg Phe Leu
Pro Gln Ile Leu Ala Glu Cys 2030 2035 2040 Ala Arg Arg Arg Leu Arg
Thr Leu Val Leu Ala Pro Thr Arg Val 2045 2050 2055 Val Leu Ser Glu
Met Lys Glu Ala Phe His Gly Leu Asp Val Lys 2060 2065 2070 Phe His
Thr Gln Ala Phe Ser Ala His Gly Ser Gly Arg Glu Val 2075 2080 2085
Ile Asp Ala Met Cys His Ala Thr Leu Thr Tyr Arg Met Leu Glu 2090
2095 2100 Pro Thr Arg Val Val Asn Trp Glu Val Ile Ile Met Asp Glu
Ala 2105 2110 2115 His Phe Leu Asp Pro Ala Ser Ile Ala Ala Arg Gly
Trp Ala Ala 2120 2125 2130 His Arg Ala Arg Ala Asn Glu Ser Ala Thr
Ile Leu Met Thr Ala 2135 2140 2145 Thr Pro Pro Gly Thr Ser Asp Glu
Phe Pro His Ser Asn Gly Glu 2150 2155 2160 Ile Glu Asp Val Gln Thr
Asp Ile Pro Ser Glu Pro Trp Asn Thr 2165 2170 2175 Gly His Asp Trp
Ile Leu Ala Asp Lys Arg Pro Thr Ala Trp Phe 2180 2185 2190 Leu Pro
Ser Ile Arg Ala Ala Asn Val Met Ala Ala Ser Leu Arg 2195 2200 2205
Lys Ala Gly Lys Ser Val Val Val Leu Asn Arg Lys Thr Phe Glu 2210
2215 2220 Arg Glu Tyr Pro Thr Ile Lys Gln Lys Lys Pro Asp Phe Ile
Leu 2225 2230 2235 Ala Thr Asp Ile Ala Glu Met Gly Ala Asn Leu Cys
Val Glu Arg 2240 2245 2250 Val Leu Asp Cys Arg Thr Ala Phe Lys Pro
Val Leu Val Asp Glu 2255 2260 2265 Gly Arg Lys Val Ala Ile Lys Gly
Pro Leu Arg Ile Ser Ala Ser 2270 2275 2280 Ser Ala Ala Gln Arg Arg
Gly Arg Ile Gly Arg Asn Pro Asn Arg 2285 2290 2295 Asp Gly Asp Ser
Tyr Tyr Tyr Ser Glu Pro Thr Ser Glu Asn Asn 2300 2305 2310 Ala His
His Val Cys Trp Leu Glu Ala Ser Met Leu Leu Asp Asn 2315 2320 2325
Met Glu Val Arg Gly Gly Met Val Ala Pro Leu Tyr Gly Val Glu 2330
2335 2340 Gly Thr Lys Thr Pro Val Ser Pro Gly Glu Met Arg Leu Arg
Asp 2345 2350 2355 Asp Gln Arg Lys Val Phe Arg Glu Leu Val Arg Asn
Cys Asp Leu 2360 2365 2370 Pro Val Trp Leu Ser Trp Gln Val Ala Lys
Ala Gly Leu Lys Thr 2375 2380 2385 Asn Asp Arg Lys Trp Cys Phe Glu
Gly Pro Glu Glu His Glu Ile 2390 2395 2400 Leu Asn Asp Ser Gly Glu
Thr Val Lys Cys Arg Ala Pro Gly Gly 2405 2410 2415 Ala Lys Lys Pro
Leu Arg Pro Arg Trp Cys Asp Glu Arg Val Ser 2420 2425 2430 Ser Asp
Gln Ser Ala Leu Ser Glu Phe Ile Lys Phe Ala Glu Gly 2435 2440 2445
Arg Arg Gly Ala Ala Glu Val Leu Val Val Leu Ser Glu Leu Pro 2450
2455 2460 Asp Phe Leu Ala Lys Lys Gly Gly Glu Ala Met Asp Thr Ile
Ser 2465 2470 2475 Val Phe Leu His Ser Glu Glu Gly Ser Arg Ala Tyr
Arg Asn Ala 2480 2485 2490 Leu Ser Met Met Pro Glu Ala Met Thr Ile
Val Met Leu Phe Ile 2495 2500 2505 Leu Ala Gly Leu Leu Thr Ser Gly
Met Val Ile Phe Phe Met Ser 2510 2515 2520 Pro Lys Gly Ile Ser Arg
Met Ser Met Ala Met Gly Thr Met Ala 2525 2530 2535 Gly Cys Gly Tyr
Leu Met Phe Leu Gly Gly Val Lys Pro Thr His 2540 2545 2550 Ile Ser
Tyr Val Met Leu Ile Phe Phe Val Leu Met Val Val Val 2555 2560 2565
Ile Pro Glu Pro Gly Gln Gln Arg Ser Ile Gln Asp Asn Gln Val 2570
2575 2580 Ala Tyr Leu Ile Ile Gly Ile Leu Thr Leu Val Ser Ala Val
Ala 2585 2590 2595 Ala Asn Glu Leu Gly Met Leu Glu Lys Thr Lys Glu
Asp Leu Phe 2600 2605 2610 Gly Lys Lys Asn Leu Ile Pro Ser Ser Ala
Ser Pro Trp Ser Trp 2615 2620 2625 Pro Asp Leu Asp Leu Lys Pro Gly
Ala Ala Trp Thr Val Tyr Val 2630 2635 2640 Gly Ile Val Thr Met Leu
Ser Pro Met Leu His His Trp Ile Lys 2645 2650 2655 Val Glu Tyr Gly
Asn Leu Ser Leu Ser Gly Ile Ala Gln Ser Ala 2660 2665 2670 Ser Val
Leu Ser Phe Met Asp Lys Gly Ile Pro Phe Met Lys Met 2675 2680 2685
Asn Ile Ser Val Ile Met Leu Leu Val Ser Gly Trp Asn Ser Ile 2690
2695 2700 Thr Val Met Pro Leu Leu Cys Gly Ile Gly Cys Ala Met Leu
His 2705 2710 2715 Trp Ser Leu Ile Leu Pro Gly Ile Lys Ala Gln Gln
Ser Lys Leu 2720 2725 2730 Ala Gln Arg Arg Val Phe His Gly Val Ala
Lys Asn Pro Val Val 2735 2740 2745 Asp Gly Asn Pro Thr Val Asp Ile
Glu Glu Ala Pro Glu Met Pro 2750 2755 2760 Ala Leu Tyr Glu Lys Lys
Leu Ala Leu Tyr Leu Leu Leu Ala Leu 2765 2770 2775 Ser Leu Ala Ser
Val Ala Met Cys Arg Thr Pro Phe Ser Leu Ala 2780 2785 2790 Glu Gly
Ile Val Leu Ala Ser Ala Ala Leu Gly Pro Leu Ile Glu 2795 2800 2805
Gly Asn Thr Ser Leu Leu Trp Asn Gly Pro Met Ala Val Ser Met 2810
2815 2820 Thr Gly Val Met Arg Gly Asn His Tyr Ala Phe Val Gly Val
Met 2825 2830 2835 Tyr Asn Leu Trp Lys Met Lys Thr Gly Arg Arg Gly
Ser Ala Asn 2840 2845 2850 Gly Lys Thr Leu Gly Glu Val Trp Lys Arg
Glu Leu Asn Leu Leu 2855 2860 2865 Asp Lys Arg Gln Phe Glu Leu Tyr
Lys Arg Thr Asp Ile Val Glu 2870 2875 2880 Val Asp Arg Asp Thr Ala
Arg Arg His Leu Ala Glu Gly Lys Val 2885 2890 2895 Asp Thr Gly Val
Ala Val Ser Arg Gly Thr Ala Lys Leu Arg Trp 2900 2905 2910 Phe His
Glu Arg Gly Tyr Val Lys Leu Glu Gly Arg Val Ile Asp 2915 2920 2925
Leu Gly Cys Gly Arg Gly Gly Trp Cys Tyr Tyr Ala Ala Ala Gln 2930
2935 2940 Lys Glu Val Ser Gly Val Lys Gly Phe Thr Leu Gly Arg Asp
Gly 2945 2950 2955 His Glu Lys Pro Met Asn Val Gln Ser Leu Gly Trp
Asn Ile Ile 2960 2965 2970 Thr Phe Lys Asp Lys Thr Asp Ile His Arg
Leu Glu Pro Val Lys 2975 2980 2985 Cys Asp Thr Leu Leu Cys Asp Ile
Gly Glu Ser Ser Ser Ser Ser 2990 2995 3000 Val Thr Glu Gly Glu Arg
Thr Val Arg Val Leu Asp Thr Val Glu 3005 3010 3015 Lys Trp Leu Ala
Cys Gly Val Asp Asn Phe Cys Val Lys Val Leu 3020 3025 3030 Ala Pro
Tyr Met Pro Asp Val Leu Glu Lys Leu Glu Leu Leu Gln 3035 3040 3045
Arg Arg Phe Gly Gly Thr Val Ile Arg Asn Pro Leu Ser Arg Asn 3050
3055 3060 Ser Thr His Glu Met Tyr Tyr Val Ser Gly Ala Arg Ser Asn
Val 3065 3070 3075 Thr Phe Thr Val Asn Gln Thr Ser Arg Leu Leu Met
Arg Arg Met 3080 3085 3090 Arg Arg Pro Thr Gly Lys Val Thr Leu Glu
Ala Asp Val Ile Leu 3095 3100 3105 Pro Ile Gly Thr Arg Ser Val Glu
Thr Asp Lys Gly Pro Leu Asp 3110 3115 3120 Lys Glu Ala Ile Glu Glu
Arg Val Glu Arg Ile Lys Ser Glu Tyr 3125 3130 3135 Met Thr Ser Trp
Phe Tyr Asp Asn Asp Asn Pro Tyr Arg Thr Trp 3140 3145 3150 His Tyr
Cys Gly Ser Tyr Val Thr Lys Thr Ser Gly Ser Ala Ala 3155 3160 3165
Ser Met Val Asn Gly Val Ile Lys Ile Leu Thr Tyr Pro Trp Asp 3170
3175 3180 Arg Ile Glu Glu Val Thr Arg Met Ala Met Thr Asp Thr Thr
Pro 3185 3190 3195 Phe Gly Gln Gln Arg Val Phe Lys Glu Lys Val Asp
Thr Arg Ala 3200 3205 3210 Lys Asp Pro Pro Ala Gly Thr Arg Lys Ile
Met Lys Val Val Asn 3215 3220 3225 Arg Trp Leu Phe Arg His Leu Ala
Arg Glu Lys Ser Pro Arg Leu 3230 3235 3240 Cys Thr Lys Glu Glu Phe
Ile Ala Lys Val Arg Ser His Ala Ala 3245 3250 3255 Ile Gly Ala Tyr
Leu Glu Glu Gln Glu Gln Trp Lys Thr Ala Asn 3260 3265 3270 Glu Ala
Val Gln Asp Pro Lys Phe Trp Glu Leu Val Asp Glu Glu 3275 3280 3285
Arg Lys Leu His Gln Gln Gly Arg Cys Arg Thr Cys Val Tyr Asn 3290
3295 3300 Met Met Gly Lys Arg Glu Lys Lys Leu Ser Glu Phe Gly Lys
Ala 3305 3310 3315 Lys Gly Ser Arg Ala Ile Trp Tyr Met Trp Leu Gly
Ala Arg Tyr 3320 3325 3330 Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn
Glu Asp His Trp Ala 3335 3340 3345 Ser Arg Glu Asn Ser Gly Gly Gly
Val Glu Gly Ile Gly Leu Gln 3350 3355 3360 Tyr Leu Gly Tyr Val Ile
Arg Asp Leu Ala Ala Met Asp Gly Gly 3365 3370 3375 Gly Phe Tyr Ala
Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile Thr 3380 3385 3390 Glu Ala
Asp Leu Asp Asp Glu Gln Glu Ile Leu Asn Tyr Met Ser 3395 3400 3405
Pro His His Lys Lys Leu Ala Gln Ala Val Met Glu Met Thr Tyr 3410
3415 3420 Lys Asn Lys Val Val Lys Val Leu Arg Pro Ala Pro Gly Gly
Lys 3425 3430 3435 Ala Tyr Met Asp Val Ile Ser Arg Arg Asp Gln Arg
Gly Ser Gly 3440 3445 3450 Gln Val Val Thr Tyr Ala Leu Asn Thr Ile
Thr Asn Leu Lys Val 3455 3460 3465 Gln Leu Ile Arg Met Ala Glu Ala
Glu Met Val Ile His His Gln 3470 3475 3480 His Val Gln Asp Cys Asp
Glu Ser Val Leu Thr Arg Leu Glu Ala 3485 3490 3495 Trp Leu Thr Glu
His Gly Cys Asn Arg Leu Lys Arg Met Ala Val 3500 3505 3510 Ser Gly
Asp Asp Cys Val Val Arg Pro Ile Asp Asp Arg Phe Gly 3515 3520 3525
Leu Ala Leu Ser His Leu Asn Ala Met Ser Lys Val Arg Lys Asp 3530
3535 3540 Ile Ser Glu Trp Gln Pro Ser Lys Gly Trp Asn Asp Trp Glu
Asn 3545 3550 3555 Val Pro Phe Cys Ser His His Phe His Glu Leu Gln
Leu Lys Asp 3560 3565 3570 Gly Arg Arg Ile Val Val Pro Cys Arg Glu
Gln Asp Glu Leu Ile 3575 3580 3585 Gly Arg Gly Arg Val Ser Pro Gly
Asn Gly Trp Met Ile Lys Glu 3590 3595 3600 Thr Ala Cys Leu Ser Lys
Ala Tyr Ala Asn Met Trp Ser Leu Met 3605 3610 3615 Tyr Phe His Lys
Arg Asp Met Arg Leu Leu Ser Leu Ala Val Ser 3620 3625 3630 Ser Ala
Val Pro Thr Ser Trp Val Pro Gln Gly Arg Thr Thr Trp 3635 3640 3645
Ser Ile His Gly Lys Gly Glu Trp Met Thr Thr Glu Asp Met Leu 3650
3655 3660 Glu Val Trp Asn Arg Val Trp Ile Thr Asn Asn Pro His Met
Gln 3665 3670 3675 Asp Lys Thr Met Val Lys Lys Trp Arg Asp Val Pro
Tyr Leu Thr 3680 3685 3690 Lys Arg Gln Asp Lys Leu Cys Gly Ser Leu
Ile Gly Met Thr Asn 3695 3700 3705 Arg Ala Thr Trp Ala Ser His Ile
His Leu Val Ile His Arg Ile 3710 3715 3720 Arg Thr Leu Ile Gly Gln
Glu Lys Tyr Thr Asp Tyr Leu Thr Val 3725 3730 3735 Met Asp Arg Tyr
Ser Val Asp Ala Asp Leu Gln Leu Gly Glu Leu 3740 3745 3750 Ile
1510861DNArecombinant yellow fever virus 15agtaaatcct gtgtgctaat
tgaggtgcat tggtctgcaa atcgagttgc taggcaataa 60acacatttgg attaatttta
atcgttcgtt gagcgattag cagagaactg accagaacat 120gtctggtcgt
aaagctcagg gaaaaaccct gggcgtcaat atggtacgac gaggagttcg
180ctccttgtca aacaaaataa aacaaaaaac aaaacaaatt ggaaacagac
ctggaccttc 240aagaggtgtt caaggattta tctttttctt tttgttcaac
attttgactg gaaaaaagat 300cacagcccac ctaaagaggt tgtggaaaat
gctggaccca agacaaggct tggctgttct 360aaggaaagtc
aagagagtgg tggccagttt gatgagagga ttgtcctcaa ggaaacgccg
420ttcccatgat gttctgactg tgcaattcct aattttggga atgctgttga
tgacgggtgg 480agtgaccttg gtgcggaaaa acagatggtt gctcctaaat
gtgacatctg aggacctcgg 540gaaaacattc tctgtgggca caggcaactg
cacaacaaac attttggaag ccaagtactg 600gtgcccagac tcaatggaat
acaactgtcc caatctcagt ccaagagagg agccagatga 660cattgattgc
tggtgctatg gggtggaaaa cgttagagtc gcatatggta agtgtgactc
720agcaggcagg tctaggaggt caagaagggc cattgacttg cctacgcatg
aaaaccatgg 780tttgaagacc cggcaagaaa aatggatgac tggaagaatg
ggtgaaaggc aactccaaaa 840gattgagaga tggttcgtga ggaacccctt
ttttgcagtg acggctctga ccattgccta 900ccttgtggga agcaacatga
cgcaacgagt cgtgattgcc ctactggtct tggctgttgg 960tccggcctac
tcagctcact gcattggaat tactgacagg gatttcattg agggggtgca
1020tggaggaact tgggtttcag ctaccctgga gcaagacaag tgtgtcactg
ttatggcccc 1080tgacaagcct tcattggaca tctcactaga gacagtagcc
attgatagac ctgctgaggt 1140gaggaaagtg tgttacaatg cagttctcac
tcatgtgaag attaatgaca agtgccccag 1200cactggagag gcccacctag
ctgaagagaa cgaaggggac aatgcgtgca agcgcactta 1260ttctgataga
ggctggggca atggctgtgg cctatttggg aaagggagca ttgtggcatg
1320cgccaaattc acttgtgcca aatccatgag tttgtttgag gttgatcaga
ccaaaattca 1380gtatgtcatc agagcacaat tgcatgtagg ggccaagcag
gaaaattgga ataccagcat 1440taagactctc aagtttgatg ccctgtcagg
ctcccaggaa gtcgagttca ttgggtatgg 1500aaaagctaca ctggaatgcc
aggtgcaaac tgcggtggac tttggtaaca gttacatcgc 1560agagatggat
atcgagagct ggatagtgga cagacagtgg gcccaggact tgaccctgcc
1620atggcagagt ggaagtggcg gggtgtggag agagatgcat catcttgtcg
aatttgaacc 1680tccgcatgcc gccactatca gagtactggc cctgggaaac
caggaaggct ccttgaaaac 1740agctcttact ggcgcaatga gggttacaaa
ggacacaaat gacaacaacc tttacaaact 1800acatggtgga catgtttctt
gcagagtgaa attgtcagct ttgacactca aggggacatc 1860ctacaaaata
tgcactgaca aaatgttttt tgtcaagaac ccaactgaca ctggccatgg
1920cactgttgtg atgcaggtga aagtgtcaaa aggaaccccc tgcaggattc
cagtgatagt 1980agctgatgat cttacagcgg caatcaataa aggcattttg
gttacagtta accccatcgc 2040ctcaaccaat gatgatgaag tgctgattga
ggtgaaccca ccttttggag acagctacat 2100tatcgttggg agaggagatt
cacgtctcac ttaccagtgg cacaaagagg gaagctcaat 2160aggaaagttg
ttcactcaga ccatgaaagg cgtggaacgc ctggccgtca tgggagacac
2220cgcctgggat ttcagctccg ctggagggtt cttcacttcg gttgggaaag
gaattcatac 2280ggtgtttggc tctgcctttc aggggctatt tggcggcttg
aactggataa caaaggtcat 2340catgggggcg gtactcatat gggttggcat
caacacaaga aacatgacaa tgtccatgag 2400catgatcttg gtaggagtga
tcatgatgtt tttgtctcta ggagttggcg ccgatcaagg 2460atgcgccatc
aactttggca agagagagct caagtgcgga gatggtatct tcatatttag
2520agactctgat gactggctga acaagtactc atactatcca gaagatcctg
tgaagcttgc 2580atcaatagtg aaagcctctt tcgaagaagg gaagtgtggc
ctaaattcag ttgactccct 2640tgagcatgag atgtggagaa gcagggcaga
tgagattaat accatttttg aggaaaacga 2700ggtggacatt tctgttgtcg
tgcaggatcc aaagaatgtt taccagagag gaactcatcc 2760attttccaga
attcgggatg gtctgcagta tggttggaag acttggggta agaaccttgt
2820gttctcccca gggaggaaga atggaagctt catcatagat ggaaagtcca
ggaaagaatg 2880cccgttttca aaccgggtct ggaattcttt ccagatagag
gagtttggga cgggagtgtt 2940caccacacgc gtgtacatgg acgcagtctt
tgaatacacc atagactgcg atggatctat 3000cttgggtgca gcggtgaacg
gaaaaaagag tgcccatggc tctccaacat tttggatggg 3060aagtcatgaa
gtaaatggga catggatgat ccacaccttg gaggcattag attacaagga
3120gtgtgagtgg ccactgacac atacgattgg aacatcagtt gaagagagtg
aaatgttcat 3180gccgagatca atcggaggcc cagttagctc tcacaatcat
atccctggat acaaggttca 3240gacgaacgga ccttggatgc aggtaccact
agaagtgaag agagaagctt gcccagggac 3300tagcgtgatc attgatggca
actgtgatgg acggggaaaa tcaaccagat ccaccacgga 3360tagcgggaaa
gttattcctg aatggtgttg ccgctcctgc acaatgccgc ctgtgagctt
3420ccatggtagt gatgggtgtt ggtatcccat ggaaattagg ccaaggaaaa
cgcatgaaag 3480ccatctggtg cgctcctggg ttacagctgg agaaatacat
gctgtccctt ttggtttggt 3540gagcatgatg atagcaatgg aagtggtcct
aaggaaaaga cagggaccaa agcaaatgtt 3600ggttggagga gtagtgctct
tgggagcaat gctggtcggg caagtaactc tccttgattt 3660gctgaaactc
acagtggctg tgggattgca tttccatgag atgaacaatg gaggagacgc
3720catgtatatg gcgttgattg ctgccttttc aatcagacca gggctgctca
tcggctttgg 3780gctcaggacc ctatggagcc ctcgggaacg ccttgtgctg
accctaggag cagccatggt 3840ggagattgcc ttgggtggcg tgatgggcgg
cctgtggaag tatctaaatg cagtttctct 3900ctgcatcctg acaataaatg
ctgttgcttc taggaaagca tcaaatacca tcttgcccct 3960catggctctg
ttgacacctg tcactatggc tgaggtgaga cttgccgcaa tgttcttttg
4020tgccatggtt atcatagggg tccttcacca gaatttcaag gacacctcca
tgcagaagac 4080tatacctctg gtggccctca cactcacatc ttacctgggc
ttgacacaac cttttttggg 4140cctgtgtgca tttctggcaa cccgcatatt
tgggcgaagg agtatcccag tgaatgaggc 4200actcgcagca gctggtctag
tgggagtgct ggcaggactg gcttttcagg agatggagaa 4260cttccttggt
ccgattgcag ttggaggact cctgatgatg ctggttagcg tggctgggag
4320ggtggatggg ctagagctca agaagcttgg tgaagtttca tgggaagagg
aggcggagat 4380cagcgggagt tccgcccgct atgatgtggc actcagtgaa
caaggggagt tcaagctgct 4440ttctgaagag aaagtgccat gggaccaggt
tgtgatgacc tcgctggcct tggttggggc 4500tgccctccat ccatttgctc
ttctgctggt ccttgctggg tggctgtttc atgtcagggg 4560agctaggaga
agtggggatg tcttgtggga tattcccact cctaagatca tcgaggaatg
4620tgaacatctg gaggatggga tttatggcat attccagtca accttcttgg
gggcctccca 4680gcgaggagtg ggagtggcac agggaggggt gttccacaca
atgtggcatg tcacaagagg 4740agctttcctt gtcaggaatg gcaagaagtt
gattccatct tgggcttcag taaaggaaga 4800ccttgtcgcc tatggtggct
catggaagtt ggaaggcaga tgggatggag aggaagaggt 4860ccagttgatc
gcggctgttc caggaaagaa cgtggtcaac gtccagacaa aaccgagctt
4920gttcaaagtg aggaatgggg gagaaatcgg ggctgtcgct cttgactatc
cgagtggcac 4980ttcaggatct cctattgtta acaggaacgg agaggtgatt
gggctgtacg gcaatggcat 5040ccttgtcggt gacaactcct tcgtgtccgc
catatcccag actgaggtga aggaagaagg 5100aaaggaggag ctccaagaga
tcccgacaat gctaaagaaa ggaatgacaa ctgtccttga 5160ttttcatcct
ggagctggga agacaagacg tttcctccca cagatcttgg ccgagtgcgc
5220acggagacgc ttgcgcactc ttgtgttggc ccccaccagg gttgttcttt
ctgaaatgaa 5280ggaggctttt cacggcctgg acgtgaaatt ccacacacag
gctttttccg ctcacggcag 5340cgggagagaa gtcattgatg ccatgtgcca
tgccacccta acttacagga tgttggaacc 5400aactagggtt gttaactggg
aagtgatcat tatggatgaa gcccattttt tggatccagc 5460tagcatagcc
gctagaggtt gggcagcgca cagagctagg gcaaatgaaa gtgcaacaat
5520cttgatgaca gccacaccgc ctgggactag tgatgaattt ccacattcaa
atggtgaaat 5580agaagatgtt caaacggaca tacccagtga gccctggaac
acagggcatg actggatcct 5640ggctgacaaa aggcccacgg catggttcct
tccatccatc agagctgcaa atgtcatggc 5700tgcctctttg cgtaaggctg
gaaagagtgt ggtggtcctg aacaggaaaa cctttgagag 5760agaatacccc
acgataaagc agaagaaacc tgactttata ttggccactg acatagctga
5820aatgggagcc aacctttgcg tggagcgagt gctggattgc aggacggctt
ttaagcctgt 5880gcttgtggat gaagggagga aggtggcaat aaaagggcca
cttcgtatct ccgcatcctc 5940tgctgctcaa aggagggggc gcattgggag
aaatcccaac agagatggag actcatacta 6000ctattctgag cctacaagtg
aaaataatgc ccaccacgtc tgctggttgg aggcctcaat 6060gctcttggac
aacatggagg tgaggggtgg aatggtcgcc ccactctatg gcgttgaagg
6120aactaaaaca ccagtttccc ctggtgaaat gagactgagg gatgaccaga
ggaaagtctt 6180cagagaacta gtgaggaatt gtgacctgcc cgtttggctt
tcgtggcaag tggccaaggc 6240tggtttgaag acgaatgatc gtaagtggtg
ttttgaaggc cctgaggaac atgagatctt 6300gaatgacagc ggtgaaacag
tgaagtgcag ggctcctgga ggagcaaaga agcctctgcg 6360cccaaggtgg
tgtgatgaaa gggtgtcatc tgaccagagt gcgctgtctg aatttattaa
6420gtttgctgaa ggtaggaggg gagctgctga agtgctagtt gtgctgagtg
aactccctga 6480tttcctggct aaaaaaggtg gagaggcaat ggataccatc
agtgtgttcc tccactctga 6540ggaaggctct agggcttacc gcaatgcact
atcaatgatg cctgaggcaa tgacaatagt 6600catgctgttt atactggctg
gactactgac atcgggaatg gtcatctttt tcatgtctcc 6660caaaggcatc
agtagaatgt ctatggcgat gggcacaatg gccggctgtg gatatctcat
6720gttccttgga ggcgtcaaac ccactcacat ctcctatgtc atgctcatat
tctttgtcct 6780gatggtggtt gtgatccccg agccagggca acaaaggtcc
atccaagaca accaagtggc 6840atacctcatt attggcatcc tgacgctggt
ttcagcggtg gcagccaacg agctaggcat 6900gctggagaaa accaaagagg
acctctttgg gaagaagaac ttaattccat ctagtgcttc 6960accctggagt
tggccggatc ttgacctgaa gccaggagct gcctggacag tgtacgttgg
7020cattgttaca atgctctctc caatgttgca ccactggatc aaagtcgaat
atggcaacct 7080gtctctgtct ggaatagccc agtcagcctc agtcctttct
ttcatggaca aggggatacc 7140attcatgaag atgaatatct cggtcataat
gctgctggtc agtggctgga attcaataac 7200agtgatgcct ctgctctgtg
gcatagggtg cgccatgctc cactggtctc tcattttacc 7260tggaatcaaa
gcgcagcagt caaagcttgc acagagaagg gtgttccatg gcgttgccaa
7320gaaccctgtg gttgatggga atccaacagt tgacattgag gaagctcctg
aaatgcctgc 7380cctttatgag aagaaactgg ctctatatct ccttcttgct
ctcagcctag cttctgttgc 7440catgtgcaga acgccctttt cattggctga
aggcattgtc ctagcatcag ctgccttagg 7500gccgctcata gagggaaaca
ccagccttct ttggaatgga cccatggctg tctccatgac 7560aggagtcatg
agggggaatc actatgcttt tgtgggagtc atgtacaatc tatggaagat
7620gaaaactgga cgccggggga gcgcgaatgg aaaaactttg ggtgaagtct
ggaagaggga 7680actgaatctg ttggacaagc gacagtttga gttgtataaa
aggaccgaca ttgtggaggt 7740ggatcgtgat acggcacgca ggcatttggc
cgaagggaag gtggacaccg gggtggcggt 7800ctccaggggg accgcaaagt
taaggtggtt ccatgagcgt ggctatgtca agctggaagg 7860tagggtgatt
gacctggggt gtggccgcgg aggctggtgt tactacgctg ctgcgcaaaa
7920ggaagtgagt ggggtcaaag gatttactct tggaagagac ggccatgaga
aacccatgaa 7980tgtgcaaagt ctgggatgga acatcatcac cttcaaggac
aaaactgata tccaccgcct 8040agaaccagtg aaatgtgaca cccttttgtg
tgacattgga gagtcatcat cgtcatcggt 8100cacagagggg gaaaggaccg
tgagagttct tgatactgta gaaaaatggc tggcttgtgg 8160ggttgacaac
ttctgtgtga aggtgttagc tccatacatg ccagatgttc ttgagaaact
8220ggaattgctc caaaggaggt ttggcggaac agtgatcagg aaccctctct
ccaggaattc 8280cactcatgaa atgtactacg tgtctggagc ccgcagcaat
gtcacattta ctgtgaacca 8340aacatcccgc ctcctgatga ggagaatgag
gcgtccaact ggaaaagtga ccctggaggc 8400tgacgtcatc ctcccaattg
ggacacgcag tgttgagaca gacaagggac ccctggacaa 8460agaggccata
gaagaaaggg ttgagaggat aaaatctgag tacatgacct cttggtttta
8520tgacaatgac aacccctaca ggacctggca ctactgtggc tcctatgtca
caaaaacctc 8580aggaagtgcg gcgagcatgg taaatggtgt tattaaaatt
ctgacatatc catgggacag 8640gatagaggag gtcaccagaa tggcaatgac
tgacacaacc ccttttggac agcaaagagt 8700gtttaaagaa aaagttgaca
ccagagcaaa ggatccacca gcgggaacta ggaagatcat 8760gaaagttgtc
aacaggtggc tgttccgcca cctggccaga gaaaagagcc ccagactgtg
8820cacaaaggaa gaatttattg caaaagtccg aagtcatgca gccattggag
cttacctgga 8880agaacaagaa cagtggaaga ctgccaatga ggctgtccaa
gacccaaagt tctgggaact 8940ggtggatgaa gaaaggaagc tgcaccaaca
aggcaggtgt cggacttgtg tgtacaacat 9000gatggggaaa agagagaaga
agctgtcaga gtttgggaaa gcaaagggaa gccgtgccat 9060atggtatatg
tggctgggag cgcggtatct tgagtttgag gccctgggat tcctgaatga
9120ggaccattgg gcttccaggg aaaactcagg aggaggagtg gaaggcattg
gcttacaata 9180cctaggatat gtgatcagag acctggctgc aatggatggt
ggtggattct acgcggatga 9240caccgctgga tgggacacgc gcatcacaga
ggcagacctt gatgatgaac aggagatctt 9300gaactacatg agcccacatc
acaaaaaact ggcacaagca gtgatggaaa tgacatacaa 9360gaacaaagtg
gtgaaagtgt tgagaccagc cccaggaggg aaagcctaca tggatgtcat
9420aagtcgacga gaccagagag gatccgggca ggtagtgact tatgctctga
acaccatcac 9480caacttgaaa gtccaattga tcagaatggc agaagcagag
atggtgatac atcaccaaca 9540tgttcaagat tgtgatgaat cagttctgac
caggctggag gcatggctca ctgagcacgg 9600atgtaacaga ctgaagagga
tggcggtgag tggagacgac tgtgtggtcc ggcccatcga 9660tgacaggttc
ggcctggccc tgtcccatct caacgccatg tccaaggtta gaaaggacat
9720atctgaatgg cagccatcaa aagggtggaa tgattgggag aatgtgccct
tctgttccca 9780ccacttccat gaactacagc tgaaggatgg caggaggatt
gtggtgcctt gccgagaaca 9840ggacgagctc attgggagag gaagggtgtc
tccaggaaac ggctggatga tcaaggaaac 9900agcttgcctc agcaaagcct
atgccaacat gtggtcactg atgtattttc acaaaaggga 9960catgaggcta
ctgtcattgg ctgtttcctc agctgttccc acctcatggg ttccacaagg
10020acgcacaaca tggtcgattc atgggaaagg ggagtggatg accacggaag
acatgcttga 10080ggtgtggaac agagtatgga taaccaacaa cccacacatg
caggacaaga caatggtgaa 10140aaaatggaga gatgtccctt atctaaccaa
gagacaagac aagctgtgcg gatcactgat 10200tggaatgacc aatagggcca
cctgggcctc ccacatccat ttagtcatcc atcgtatccg 10260aacgctgatt
ggacaggaga aatacactga ctacctaaca gtcatggaca ggtattctgt
10320ggatgctgac ctgcaactgg gtgagcttat ctgaaacacc atctaacagg
aataaccggg 10380atacaaacca cgggtggaga accggactcc ccacaacctg
aaaccgggat ataaaccacg 10440gctggagaac cgggctccgc acttaaaatg
aaacagaaac cgggataaaa actacggatg 10500gagaaccgga ctccacacat
tgagacagaa gaagttgtca gcccagaacc ccacacgagt 10560tttgccactg
ctaagctgtg aggcagtgca ggctgggaca gccgacctcc aggttgcgaa
10620aaacctggtt tctgggacct cccaccccag agtaaaaaga acggagcctc
cgctaccacc 10680ctcccacgtg gtggtagaaa gacggggtct agaggttaga
ggagaccctc cagggaacaa 10740atagtgggac catattgacg ccagggaaag
accggagtgg ttctctgctt ttcctccaga 10800ggtctgtgag cacagtttgc
tcaagaataa gcagaccttt ggatgacaaa cacaaaacca 10860c
108611621DNAyellow fever virus 16cggggtgtgg agagagatgc a
211721DNAyellow fever virus 17gggagtcaac tgaatttagg c
211847DNADengue 4 virus 18gcttgattcc caccggtatg gcgttttccc
tcagcacaag agatggc 471919DNAdengue 4 virus 19gggcagaatg catggctcc
192019DNAdengue 4 virus 20ggagccatgc attctgccc 192149DNAdengue 4
virus 21gacgccacac aacccatgtc ggcgccaact gtgaagccca gaaacagag
492214498DNArecombinant E.coli 22gtgaccacgg gataataccg cgccacatag
cagaacttta aaagtgctca tcattggaaa 60acgttcttcg gggcgaaaac tctcaaggat
cttaccgctg ttgagatcca gttcgatgta 120acccactcgt gcacccaact
gatcttcagc atcttttact ttcaccagcg tttctgggtg 180agcaaaaaca
ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg
240aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt
attgtctcat 300gagcggatac atatttgaat gtatttagaa aaataaacaa
ataggggttc cgcgcacatt 360tccccgaaaa gtgccacctg acgtcgatcg
cggccgctag cgatgaccct gctgattggt 420tcgctgacca tttccgggtg
cgggacggcg ttaccagaaa ctcagaaggt tcgtccaacc 480aaaccgactc
tgacggcagt ttacgagaga gatgataggg tctgcatcag taagccagat
540gctacacaat taggcttgta catattgtcg ttagaacgcg gctacaatta
atacataacc 600ttatgtatca tacacatacg atttaggtga cactatagag
taaatcctgt gtgctaattg 660aggtgcattg gtctgcaaat cgagttgcta
ggcaataaac acatttggat taattttaat 720cgttcgttga gcgattagca
gagaactgac cagaacatgt ctggtcgtaa agctcaggga 780aaaaccctgg
gcgtcaatat ggtacgacga ggagttcgct ccttgtcaaa caaaataaaa
840caaaaaacaa aacaaattgg aaacagacct ggaccttcaa gaggtgttca
aggatttatc 900tttttctttt tgttcaacat tttgactgga aaaaagatca
cagcccacct aaagaggttg 960tggaaaatgc tggacccaag acaaggcttg
gctgttctaa ggaaagtcaa gagagtggtg 1020gccagtttga tgagaggatt
gtcctcaagg aaacgccgtt cccatgatgt tctgactgtg 1080caattcctaa
ttttgggaat gctgttgatg accggtatgg cgttttccct cagcacaaga
1140gatggcgaac ccctcatgat agtggcaaaa catgaaaggg ggagacctct
cttgtttaag 1200acaacagagg ggatcaacaa atgcactctc attgccatgg
acttgggtga aatgtgtgag 1260gacactgtca cgtataaatg ccccctactg
gtcaataccg aacctgaaga cattgattgc 1320tggtgcaacc tcacgtctac
ctgggtcatg tatgggacat gcacccagag cggagaacgg 1380agacgagaga
agcgctcagt agctttaaca ccacattcag gaatgggatt ggaaacaaga
1440gctgagacat ggatgtcatc ggaaggggct tggaagcatg ctcagagagt
agagagctgg 1500atactcagaa acccaggatt cgcgctcttg gcaggattta
tggcttatat gattgggcaa 1560acaggaatcc agcgaactgt cttctttgtc
ctaatgatgc tggtcgcccc atcctacgga 1620atgcgatgcg taggagtagg
aaacagagac tttgtggaag gagtctcagg tggagcatgg 1680gtcgacctgg
tgctagaaca tggaggatgc gtcacaacca tggcccaggg aaaaccaacc
1740ttggattttg aactgactaa gacaacagcc aaggaagtgg ctctgttaag
aacctattgc 1800attgaagcct caatatcaaa cataactacg gcaacaagat
gtccaacgca aggagagcct 1860tatctgaaag aggaacagga ccaacagtac
atttgccgga gagatgtggt agacagaggg 1920tggggcaatg gctgtggctt
gtttggaaaa ggaggagttg tgacatgtgc gaagttttca 1980tgttcgggga
agataacagg caatttggtc caaattgaga accttgaata cacagtggtt
2040gtaacagtcc acaatggaga cacccatgca gtaggaaatg acacatccaa
tcatggagtt 2100acagccatga taactcccag gtcaccatcg gtggaagtca
aattgccgga ctatggagaa 2160ctaacactcg attgtgaacc caggtctgga
attgacttta atgagatgat tctgatgaaa 2220atgaaaaaga aaacatggct
cgtgcataag caatggtttt tggatctgcc tcttccatgg 2280acagcaggag
cagacacatc agaggttcac tggaattaca aagagagaat ggtgacattt
2340aaggttcctc atgccaagag acaggatgtg acagtgctgg gatctcagga
aggagccatg 2400cattctgccc tcgctggagc cacagaagtg gactccggtg
atggaaatca catgtttgca 2460ggacatctca agtgcaaagt ccgtatggag
agattgagaa tcaagggaat gtcatacacg 2520atgtgttcag gaaagttttc
aattgacaaa gagatggcag aaacacagca tgggacaaca 2580gtgatgaaag
tcaagtatga aggtgctgga gctccgtgta aagtccccat agagataaga
2640gatgtaaaca aggaaaaagt ggttgggcgt atcatctcat ccaccccttt
ggctgagaat 2700accaacagtg taaccaacat agaattagaa cccccctttg
gggacagcta catagtgata 2760ggtgttggaa acagcgcatt aacactccac
tggttcagga aagggagttc cattggcaag 2820atgtttgagt ccacatacag
aggtgcaaaa cgaatggcca ttctaggtga aacagcttgg 2880gattttggtt
ccgttggtgg actgttcaca tcattgggaa aggctgtgca ccaggttttt
2940ggaagtgtgt acacaaccat gtttggagga gtctcatgga tgattagaat
cctaattggg 3000ttcttagtgt tgtggattgg cacgaactca aggaacactt
caatggctat gacgtgcata 3060gctgttggag gaatcactct gtttctgggc
ttcacagttg gcgccgatca aggatgcgcc 3120atcaactttg gcgtgagcaa
gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 3180gagctggacg
gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat
3240gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct
gcccgtgccc 3300tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt
gcttcagccg ctaccccgac 3360cacatgaagc agcacgactt cttcaagtcc
gccatgcccg aaggctacgt ccaggagcgc 3420accatcttct tcaaggacga
cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 3480gacaccctgg
tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc
3540ctggggcaca agctggagta caactacaac agccacaacg tctatatcat
ggccgacaag 3600cagaagaacg gcatcaaggt gaacttcaag atccgccaca
acatcgagga cggcagcgtg 3660cagctcgccg accactacca gcagaacacc
cccatcggcg acggccccgt gctgctgccc 3720gacaaccact acctgagcac
ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 3780cacatggtcc
tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg
3840tacaagaagt tgttcactca gaccatgaaa ggcgtggaac gcctggccgt
catgggagac 3900accgcctggg atttcagctc cgctggaggg ttcttcactt
cggttgggaa aggaattcat 3960acggtgtttg gctctgcctt tcaggggcta
tttggcggct tgaactggat aacaaaggtc 4020atcatggggg cggtacttat
atgggttggc atcaacacaa gaaacatgac aatgtccatg 4080agcatgatct
tggtaggagt gatcatgatg tttttgtctc taggagttgg cgccgatcaa
4140ggatgcgcca tcaactttgg caagagagag ctcaagtgcg gagatggtat
cttcatattt 4200agagactctg atgactggct gaacaagtac tcatactatc
cagaagatcc tgtgaagctt 4260gcatcaatag tgaaagcctc tttcgaagaa
gggaagtgtg gcctaaattc agttgactcc 4320cttgagcatg agatgtggag
aagcagggca gatgagatta ataccatttt tgaggaaaac 4380gaggtggaca
tttctgttgt cgtgcaggat ccaaagaatg tttaccagag aggaactcat
4440ccattttcca gaattcggga tggtctgcag tatggttgga agacttgggg
taagaacctt 4500gtgttctccc cagggaggaa gaatggaagc ttcatcatag
atggaaagtc caggaaagaa 4560tgcccgtttt caaaccgggt ctggaattct
ttccagatag aggagtttgg gacgggagtg 4620ttcaccacac gcgtgtacat
ggacgcagtc tttgaataca ccatagactg cgatggatct 4680atcttgggtg
cagcggtgaa cggaaaaaag agtgcccatg gctctccaac attttggatg
4740ggaagtcatg aagtaaatgg gacatggatg atccacacct tggaggcatt
agattacaag 4800gagtgtgagt ggccactgac acatacgatt ggaacatcag
ttgaagagag tgaaatgttc 4860atgccgagat caatcggagg cccagttagc
tctcacaatc atatccctgg atacaaggtt 4920cagacgaacg gaccttggat
gcaggtacca ctagaagtga agagagaagc ttgcccaggg 4980actagcgtga
tcattgatgg caactgtgat ggacggggaa aatcaaccag atccaccacg
5040gatagcggga aagttattcc tgaatggtgt tgccgctcct gcacaatgcc
gcctgtgagc 5100ttccatggta gtgatgggtg ttggtatccc atggaaatta
ggccaaggaa aacgcatgaa 5160agccatctgg tgcgctcctg ggttacagct
ggagaaatac atgctgtccc ttttggtttg 5220gtgagcatga tgatagcaat
ggaagtggtc ctaaggaaaa gacagggacc aaagcaaatg 5280ttggttggag
gagtagtgct cttgggagca atgctggtcg ggcaagtaac tctccttgat
5340ttgctgaaac tcacagtggc tgtgggattg catttccatg agatgaacaa
tggaggagac 5400gccatgtata tggcgttgat tgctgccttt tcaatcagac
cagggctgct catcggcttt 5460gggctcagga ccctatggag ccctcgggaa
cgccttgtgc tgaccctagg agcagccatg 5520gtggagattg ccttgggtgg
cgtgatgggc ggcctgtgga agtatctaaa tgcagtttct 5580ctctgcatcc
tgacaataaa tgctgttgct tctaggaaag catcaaatac catcttgccc
5640ctcatggctc tgttgacacc tgtcactatg gctgaggtga gacttgccgc
aatgttcttt 5700tgtgccatgg ttatcatagg ggtccttcac cagaatttca
aggacacctc catgcagaag 5760actatacctc tggtggccct cacactcaca
tcttacctgg gcttgacaca accttttttg 5820ggcctgtgtg catttctggc
aacccgcata tttgggcgaa ggagtatccc agtgaatgag 5880gcactcgcag
cagctggtct agtgggagtg ctggcaggac tggcttttca ggagatggag
5940aacttccttg gtccgattgc agttggagga ctcctgatga tgctggttag
cgtggctggg 6000agggtggatg ggctagagct caagaagctt ggtgaagttt
catgggaaga ggaggcggag 6060atcagcggga gttccgcccg ctatgatgtg
gcactcagtg aacaagggga gttcaagctg 6120ctttctgaag agaaagtgcc
atgggaccag gttgtgatga cctcgctggc cttggttggg 6180gctgccctcc
atccatttgc tcttctgctg gtccttgctg ggtggctgtt tcatgtcagg
6240ggagctagga gaagtgggga tgtcttgtgg gatattccca ctcctaagat
catcgaggaa 6300tgtgaacatc tggaggatgg gatttatggc atattccagt
caaccttctt gggggcctcc 6360cagcgaggag tgggagtggc acagggaggg
gtgttccaca caatgtggca tgtcacaaga 6420ggagctttcc ttgtcaggaa
tggcaagaag ttgattccat cttgggcttc agtaaaggaa 6480gaccttgtcg
cctatggtgg ctcatggaag ttggaaggca gatgggatgg agaggaagag
6540gtccagttga tcgcggctgt tccaggaaag aacgtggtca acgtccagac
aaaaccgagc 6600ttgttcaaag tgaggaatgg gggagaaatc ggggctgtcg
ctcttgacta tccgagtggc 6660acttcaggat ctcctattgt taacaggaac
ggagaggtga ttgggctgta cggcaatggc 6720atccttgtcg gtgacaactc
cttcgtgtcc gccatatccc agactgaggt gaaggaagaa 6780ggaaaggagg
agctccaaga gatcccgaca atgctaaaga aaggaatgac aactgtcctt
6840gattttcatc ctggagctgg gaagacaaga cgtttcctcc cacagatctt
ggccgagtgc 6900gcacggagac gcttgcgcac tcttgtgttg gcccccacca
gggttgttct ttctgaaatg 6960aaggaggctt ttcacggcct ggacgtgaaa
ttccacacac aggctttttc cgctcacggc 7020agcgggagag aagtcattga
tgccatgtgc catgccaccc taacttacag gatgttggaa 7080ccaactaggg
ttgttaactg ggaagtgatc attatggatg aagcccattt tttggatcca
7140gctagcatag ccgctagagg ttgggcagcg cacagagcta gggcaaatga
aagtgcaaca 7200atcttgatga cagccacacc gcctgggact agtgatgaat
ttccacattc aaatggtgaa 7260atagaagatg ttcaaacgga catacccagt
gagccctgga acacagggca tgactggatc 7320ctggctgaca aaaggcccac
ggcatggttc cttccatcca tcagagctgc aaatgtcatg 7380gctgcctctt
tgcgtaaggc tggaaagagt gtggtggtcc tgaacaggaa aacctttgag
7440agagaatacc ccacgataaa gcagaagaaa cctgacttta tattggccac
tgacatagct 7500gaaatgggag ccaacctttg cgtggagcga gtgctggatt
gcaggacggc ttttaagcct 7560gtgcttgtgg atgaagggag gaaggtggca
ataaaagggc cacttcgtat ctccgcatcc 7620tctgctgctc aaaggagggg
gcgcattggg agaaatccca acagagatgg agactcatac 7680tactattctg
agcctacaag tgaaaataat gcccaccacg tctgctggtt ggaggcctca
7740atgctcttgg acaacatgga ggtgaggggt ggaatggtcg ccccactcta
tggcgttgaa 7800ggaactaaaa caccagtttc ccctggtgaa atgagactga
gggatgacca gaggaaagtc 7860ttcagagaac tagtgaggaa ttgtgacctg
cccgtttggc tttcgtggca agtggccaag 7920gctggtttga agacgaatga
tcgtaagtgg tgttttgaag gccctgagga acatgagatc 7980ttgaatgaca
gcggtgaaac agtgaagtgc agggctcctg gaggagcaaa gaagcctctg
8040cgcccaaggt ggtgtgatga aagggtgtca tctgaccaga gtgcgctgtc
tgaatttatt 8100aagtttgctg aaggtaggag gggagctgct gaagtgctag
ttgtgctgag tgaactccct 8160gatttcctgg ctaaaaaagg tggagaggca
atggatacca tcagtgtgtt cctccactct 8220gaggaaggct ctagggctta
ccgcaatgca ctatcaatga tgcctgaggc aatgacaata 8280gtcatgctgt
ttatactggc tggactactg acatcgggaa tggtcatctt tttcatgtct
8340cccaaaggca tcagtagaat gtctatggcg atgggcacaa tggccggctg
tggatatctc 8400atgttccttg gaggcgtcaa acccactcac atctcctatg
tcatgctcat attctttgtc 8460ctgatggtgg ttgtgatccc cgagccaggg
caacaaaggt ccatccaaga caaccaagtg 8520gcatacctca ttattggcat
cctgacgctg gtttcagcgg tggcagccaa cgagctaggc 8580atgctggaga
aaaccaaaga ggacctcttt gggaagaaga acttaattcc atctagtgct
8640tcaccctgga gttggccgga tcttgacctg aagccaggag ctgcctggac
agtgtacgtt 8700ggcattgtta caatgctctc tccaatgttg caccactgga
tcaaagtcga atatggcaac 8760ctgtctctgt ctggaatagc ccagtcagcc
tcagtccttt ctttcatgga caaggggata 8820ccattcatga agatgaatat
ctcggtcata atgctgctgg tcagtggctg gaattcaata 8880acagtgatgc
ctctgctctg tggcataggg tgcgccatgc tccactggtc tctcatttta
8940cctggaatca aagcgcagca gtcaaagctt gcacagagaa gggtgttcca
tggcgttgcc 9000aagaaccctg tggttgatgg gaatccaaca gttgacattg
aggaagctcc tgaaatgcct 9060gccctttatg agaagaaact ggctctatat
ctccttcttg ctctcagcct agcttctgtt 9120gccatgtgca gaacgccctt
ttcattggct gaaggcattg tcctagcatc agctgcctta 9180gggccgctca
tagagggaaa caccagcctt ctttggaatg gacccatggc tgtctccatg
9240acaggagtca tgagggggaa tcactatgct tttgtgggag tcatgtacaa
tctatggaag 9300atgaaaactg gacgccgggg gagcgcgaat ggaaaaactt
tgggtgaagt ctggaagagg 9360gaactgaatc tgttggacaa gcgacagttt
gagttgtata aaaggaccga cattgtggag 9420gtggatcgtg atacggcacg
caggcatttg gccgaaggga aggtggacac cggggtggcg 9480gtctccaggg
ggaccgcaaa gttaaggtgg ttccatgagc gtggctatgt caagctggaa
9540ggtagggtga ttgacctggg gtgtggccgc ggaggctggt gttactacgc
tgctgcgcaa 9600aaggaagtga gtggggtcaa aggatttact cttggaagag
acggccatga gaaacccatg 9660aatgtgcaaa gtctgggatg gaacatcatc
accttcaagg acaaaactga tatccaccgc 9720ctagaaccag tgaaatgtga
cacccttttg tgtgacattg gagagtcatc atcgtcatcg 9780gtcacagagg
gggaaaggac cgtgagagtt cttgatactg tagaaaaatg gctggcttgt
9840ggggttgaca acttctgtgt gaaggtgtta gctccataca tgccagatgt
tcttgagaaa 9900ctggaattgc tccaaaggag gtttggcgga acagtgatca
ggaaccctct ctccaggaat 9960tccactcatg aaatgtacta cgtgtctgga
gcccgcagca atgtcacatt tactgtgaac 10020caaacatccc gcctcctgat
gaggagaatg aggcgtccaa ctggaaaagt gaccctggag 10080gctgacgtca
tcctcccaat tgggacacgc agtgttgaga cagacaaggg acccctggac
10140aaagaggcca tagaagaaag ggttgagagg ataaaatctg agtacatgac
ctcttggttt 10200tatgacaatg acaaccccta caggacctgg cactactgtg
gctcctatgt cacaaaaacc 10260tcaggaagtg cggcgagcat ggtaaatggt
gttattaaaa ttctgacata tccatgggac 10320aggatagagg aggtcaccag
aatggcaatg actgacacaa ccccttttgg acagcaaaga 10380gtgtttaaag
aaaaagttga caccagagca aaggatccac cagcgggaac taggaagatc
10440atgaaagttg tcaacaggtg gctgttccgc cacctggcca gagaaaagag
ccccagactg 10500tgcacaaagg aagaatttat tgcaaaagtc cgaagtcatg
cagccattgg agcttacctg 10560gaagaacaag aacagtggaa gactgccaat
gaggctgtcc aagacccaaa gttctgggaa 10620ctggtggatg aagaaaggaa
gctgcaccaa caaggcaggt gtcggacttg tgtgtacaac 10680atgatgggga
aaagagagaa gaagctgtca gagtttggga aagcaaaggg aagccgtgcc
10740atatggtata tgtggctggg agcgcggtat cttgagtttg aggccctggg
attcctgaat 10800gaggaccatt gggcttccag ggaaaactca ggaggaggag
tggaaggcat tggcttacaa 10860tacctaggat atgtgatcag agacctggct
gcaatggatg gtggtggatt ctacgcggat 10920gacaccgctg gatgggacac
gcgcatcaca gaggcagacc ttgatgatga acaggagatc 10980ttgaactaca
tgagcccaca tcacaaaaaa ctggcacaag cagtgatgga aatgacatac
11040aagaacaaag tggtgaaagt gttgagacca gccccaggag ggaaagccta
catggatgtc 11100ataggtcgac gagaccagag aggatccggg caggtagtga
cttatgctct gaacaccatc 11160accaacttga aagtccaatt gatcagaatg
gcagaagcag agatggtgat acatcaccaa 11220catgttcaag attgtgatga
atcagttctg accaggctgg aggcatggct cactgagcac 11280ggatgtaaca
gactgaagag gatggcggtg agtggagacg actgtgtggt ccggcccatc
11340gatgacaggt tcggcctggc cctgtcccat ctcaacgcca tgtccaaggt
tagaaaggac 11400atatctgaat ggcagccatc aaaagggtgg aatgattggg
agaatgtgcc cttctgttcc 11460caccacttcc atgaactaca gctgaaggat
ggcaggagga ttgtggtgcc ttgccgagaa 11520caggacgagc tcattgggag
aggaagggtg tctccaggaa acggctggat gatcaaggaa 11580acagcttgcc
tcagcaaagc ctatgccaac atgtggtcac tgatgtattt tcacaaaagg
11640gacatgaggc tactgtcatt ggctgtttcc tcagctgttc ccacctcatg
ggttccacaa 11700ggacgcacaa catggtcgat tcatgggaaa ggggagtgga
tgaccacgga agacatgctt 11760gaggtgtgga acagagtatg gataaccaac
aacccacaca tgcaggacaa gacaatggtg 11820aaaaaatgga gagatgtccc
ttatctaacc aagagacaag acaagctgtg cggatcactg 11880attggaatga
ccaatagggc cacctgggcc tcccacatcc atttagtcat ccatcgtatc
11940cgaacgctga ttggacagga gaaatacact gactacctaa cagtcatgga
caggtattct 12000gtggatgctg acctgcaact gggtgagctt atctgaaaca
ccatctaaca ggaataaccg 12060ggatacaaac cacgggtgga gaaccggact
ccccacaacc tgaaaccggg atataaacca 12120cggctggaga accgggctcc
gcacttaaaa tgaaacagaa accgggataa aaactacgga 12180tggagaaccg
gactccacac attgagacag aagaagttgt cagcccagaa ccccacacga
12240gttttgccac tgctaagctg tgaggcagtg caggctggga cagccgacct
ccaggttgcg 12300aaaaacctgg tttctgggac ctcccacccc agagtaaaaa
gaacggagcc tccgctacca 12360ccctcccacg tggtggtaga aagacggggt
ctagaggtta gaggagaccc tccagggaac 12420aaatagtggg accatattga
cgccagggaa agaccggagt ggttctctgc ttttcctcca 12480gaggtctgtg
agcacagttt gctcaagaat aagcagacct ttggatgaca aacacaaaac
12540cactcgagca agacgtttcc cgttgaatat ggctcataac accccttgta
ttactgttta 12600tgtaagcaga cagttttatt gttcatgatg atatattttt
atcttgtgca atgtaacatc 12660agagattttg agacacaacg tggctttgtt
gaataaatcg aacttttgct gagttgaagg 12720atcagatcac gcatcttccc
gacaacgcag accgttccgt ggcaaagcaa aagttcaaaa 12780tcaccaactg
gtccacctac aacaaagctc tcatcaaccg tggctccctc actttctggc
12840tggatgatgg ggcgattcag gcctggtatg agtcagcaac accttcttca
cgaggcagac 12900ctcagcgcta gcggagtgta tactggctta ctatgttggc
actgatgagg gtgtcagtga 12960agtgcttcat gtggcaggag aaaaaaggct
gcaccggtgc gtcagcagaa tatgtgatac 13020aggatatatt ccgcttcctc
gctcactgac tcgctacgct cggtcgttcg actgcggcga 13080gcggaaatgg
cttacgaacg gggcggagat ttcctggaag atgccaggaa gatacttaac
13140agggaagtga gagggccgcg gcaaagccgt ttttccatag gctccgcccc
cctgacaagc 13200atcacgaaat ctgacgctca aatcagtggt ggcgaaaccc
gacaggacta taaagatacc 13260aggcgtttcc cctggcggct ccctcgtgcg
ctctcctgtt cctgcctttc ggtttaccgg 13320tgtcattccg ctgttatggc
cgcgtttgtc tcattccacg cctgacactc agttccgggt 13380aggcagttcg
ctccaagctg gactgtatgc acgaaccccc cgttcagtcc gaccgctgcg
13440ccttatccgg taactatcgt cttgagtcca acccggaaag acatgcaaaa
gcaccactgg 13500cagcagccac tggtaattga tttagaggag ttagtcttga
agtcatgcgc cggttaaggc 13560taaactgaaa ggacaagttt tggtgactgc
gctcctccaa gccagttacc tcggttcaaa 13620gagttggtag ctcagagaac
cttcgaaaaa ccgccctgca aggcggtttt ttcgttttca 13680gagcaagaga
ttacgcgcag accaaaacga tctcaagaag atcatcttat taaggggtct
13740gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt
atcaaaaagg 13800atcttcacct agatcctttt aaattaaaaa tgaagtttta
aatcaatcta aagtatatat 13860gagtaaactt ggtctgacag ttaccaatgc
ttaatcagtg aggcacctat ctcagcgatc 13920tgtctatttc gttcatccat
agttgcctga ctccccgtcg tgtagataac tacgatacgg 13980gagggcttac
catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct
14040ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag
tggtcctgca 14100actttatccg cctccatcca gtctattaat tgttgccggg
aagctagagt aagtagttcg 14160ccagttaata gtttgcgcaa cgttgttgcc
attgctgcag gcatcgtggt gtcacgctcg 14220tcgtttggta tggcttcatt
cagctccggt tcccaacgat caaggcgagt tacatgatcc 14280cccatgttgt
gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag
14340ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct
tactgtcatg 14400ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
ccaagtcatt ctgagaatag 14460tgtatgcggc gaccgagttg ctcttgcccg
gcgtcaac 144982311905DNArecombinant chimeric yellow fever dengue 4
virus 23agtaaatcct gtgtgctaat tgaggtgcat tggtctgcaa atcgagttgc
taggcaataa 60acacatttgg attaatttta atcgttcgtt gagcgattag cagagaactg
accagaacat 120gtctggtcgt aaagctcagg gaaaaaccct gggcgtcaat
atggtacgac gaggagttcg 180ctccttgtca aacaaaataa aacaaaaaac
aaaacaaatt ggaaacagac ctggaccttc 240aagaggtgtt caaggattta
tctttttctt tttgttcaac attttgactg gaaaaaagat 300cacagcccac
ctaaagaggt tgtggaaaat gctggaccca agacaaggct tggctgttct
360aaggaaagtc aagagagtgg tggccagttt gatgagagga ttgtcctcaa
ggaaacgccg 420ttcccatgat gttctgactg tgcaattcct aattttggga
atgctgttga tgaccggtat 480ggcgttttcc ctcagcacaa gagatggcga
acccctcatg atagtggcaa aacatgaaag 540ggggagacct ctcttgttta
agacaacaga ggggatcaac aaatgcactc tcattgccat 600ggacttgggt
gaaatgtgtg aggacactgt cacgtataaa tgccccctac tggtcaatac
660cgaacctgaa gacattgatt gctggtgcaa cctcacgtct acctgggtca
tgtatgggac 720atgcacccag agcggagaac ggagacgaga gaagcgctca
gtagctttaa caccacattc 780aggaatggga ttggaaacaa gagctgagac
atggatgtca tcggaagggg cttggaagca 840tgctcagaga gtagagagct
ggatactcag aaacccagga ttcgcgctct tggcaggatt 900tatggcttat
atgattgggc aaacaggaat ccagcgaact gtcttctttg tcctaatgat
960gctggtcgcc ccatcctacg gaatgcgatg cgtaggagta ggaaacagag
actttgtgga 1020aggagtctca ggtggagcat gggtcgacct ggtgctagaa
catggaggat gcgtcacaac 1080catggcccag ggaaaaccaa ccttggattt
tgaactgact aagacaacag ccaaggaagt 1140ggctctgtta agaacctatt
gcattgaagc ctcaatatca aacataacta cggcaacaag 1200atgtccaacg
caaggagagc cttatctgaa agaggaacag gaccaacagt acatttgccg
1260gagagatgtg gtagacagag ggtggggcaa tggctgtggc ttgtttggaa
aaggaggagt 1320tgtgacatgt gcgaagtttt catgttcggg gaagataaca
ggcaatttgg tccaaattga 1380gaaccttgaa tacacagtgg ttgtaacagt
ccacaatgga gacacccatg cagtaggaaa 1440tgacacatcc aatcatggag
ttacagccat gataactccc aggtcaccat cggtggaagt 1500caaattgccg
gactatggag aactaacact cgattgtgaa cccaggtctg gaattgactt
1560taatgagatg attctgatga aaatgaaaaa gaaaacatgg ctcgtgcata
agcaatggtt 1620tttggatctg cctcttccat ggacagcagg agcagacaca
tcagaggttc actggaatta 1680caaagagaga atggtgacat ttaaggttcc
tcatgccaag agacaggatg tgacagtgct 1740gggatctcag gaaggagcca
tgcattctgc cctcgctgga gccacagaag tggactccgg 1800tgatggaaat
cacatgtttg caggacatct caagtgcaaa gtccgtatgg agagattgag
1860aatcaaggga atgtcataca cgatgtgttc aggaaagttt tcaattgaca
aagagatggc 1920agaaacacag catgggacaa cagtgatgaa agtcaagtat
gaaggtgctg gagctccgtg 1980taaagtcccc atagagataa gagatgtaaa
caaggaaaaa gtggttgggc gtatcatctc 2040atccacccct ttggctgaga
ataccaacag tgtaaccaac atagaattag aacccccctt 2100tggggacagc
tacatagtga taggtgttgg aaacagcgca ttaacactcc actggttcag
2160gaaagggagt tccattggca agatgtttga gtccacatac agaggtgcaa
aacgaatggc 2220cattctaggt gaaacagctt gggattttgg ttccgttggt
ggactgttca catcattggg 2280aaaggctgtg caccaggttt ttggaagtgt
gtacacaacc atgtttggag gagtctcatg 2340gatgattaga atcctaattg
ggttcttagt gttgtggatt ggcacgaact caaggaacac 2400ttcaatggct
atgacgtgca tagctgttgg aggaatcact ctgtttctgg gcttcacagt
2460tggcgccgat caaggatgcg ccatcaactt tggcgtgagc aagggcgagg
agctgttcac 2520cggggtggtg cccatcctgg tcgagctgga cggcgacgta
aacggccaca agttcagcgt 2580gtccggcgag ggcgagggcg atgccaccta
cggcaagctg accctgaagt tcatctgcac 2640caccggcaag ctgcccgtgc
cctggcccac cctcgtgacc accctgacct acggcgtgca 2700gtgcttcagc
cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc
2760cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact
acaagacccg 2820cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc
atcgagctga agggcatcga 2880cttcaaggag gacggcaaca tcctggggca
caagctggag tacaactaca acagccacaa 2940cgtctatatc atggccgaca
agcagaagaa cggcatcaag gtgaacttca agatccgcca 3000caacatcgag
gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg
3060cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg
ccctgagcaa 3120agaccccaac gagaagcgcg atcacatggt cctgctggag
ttcgtgaccg ccgccgggat 3180cactctcggc atggacgagc tgtacaagaa
gttgttcact cagaccatga aaggcgtgga 3240acgcctggcc gtcatgggag
acaccgcctg ggatttcagc tccgctggag ggttcttcac 3300ttcggttggg
aaaggaattc atacggtgtt tggctctgcc tttcaggggc tatttggcgg
3360cttgaactgg ataacaaagg tcatcatggg ggcggtactt atatgggttg
gcatcaacac 3420aagaaacatg acaatgtcca tgagcatgat cttggtagga
gtgatcatga tgtttttgtc 3480tctaggagtt ggcgccgatc aaggatgcgc
catcaacttt ggcaagagag agctcaagtg 3540cggagatggt atcttcatat
ttagagactc tgatgactgg ctgaacaagt actcatacta 3600tccagaagat
cctgtgaagc ttgcatcaat agtgaaagcc tctttcgaag aagggaagtg
3660tggcctaaat tcagttgact cccttgagca tgagatgtgg agaagcaggg
cagatgagat 3720taataccatt tttgaggaaa acgaggtgga catttctgtt
gtcgtgcagg atccaaagaa 3780tgtttaccag agaggaactc atccattttc
cagaattcgg gatggtctgc agtatggttg 3840gaagacttgg ggtaagaacc
ttgtgttctc cccagggagg aagaatggaa gcttcatcat 3900agatggaaag
tccaggaaag aatgcccgtt ttcaaaccgg gtctggaatt ctttccagat
3960agaggagttt gggacgggag tgttcaccac acgcgtgtac atggacgcag
tctttgaata 4020caccatagac tgcgatggat ctatcttggg tgcagcggtg
aacggaaaaa agagtgccca 4080tggctctcca acattttgga tgggaagtca
tgaagtaaat gggacatgga tgatccacac 4140cttggaggca ttagattaca
aggagtgtga gtggccactg acacatacga ttggaacatc 4200agttgaagag
agtgaaatgt tcatgccgag atcaatcgga ggcccagtta gctctcacaa
4260tcatatccct ggatacaagg ttcagacgaa cggaccttgg atgcaggtac
cactagaagt 4320gaagagagaa gcttgcccag ggactagcgt gatcattgat
ggcaactgtg atggacgggg 4380aaaatcaacc agatccacca cggatagcgg
gaaagttatt cctgaatggt gttgccgctc 4440ctgcacaatg ccgcctgtga
gcttccatgg tagtgatggg
tgttggtatc ccatggaaat 4500taggccaagg aaaacgcatg aaagccatct
ggtgcgctcc tgggttacag ctggagaaat 4560acatgctgtc ccttttggtt
tggtgagcat gatgatagca atggaagtgg tcctaaggaa 4620aagacaggga
ccaaagcaaa tgttggttgg aggagtagtg ctcttgggag caatgctggt
4680cgggcaagta actctccttg atttgctgaa actcacagtg gctgtgggat
tgcatttcca 4740tgagatgaac aatggaggag acgccatgta tatggcgttg
attgctgcct tttcaatcag 4800accagggctg ctcatcggct ttgggctcag
gaccctatgg agccctcggg aacgccttgt 4860gctgacccta ggagcagcca
tggtggagat tgccttgggt ggcgtgatgg gcggcctgtg 4920gaagtatcta
aatgcagttt ctctctgcat cctgacaata aatgctgttg cttctaggaa
4980agcatcaaat accatcttgc ccctcatggc tctgttgaca cctgtcacta
tggctgaggt 5040gagacttgcc gcaatgttct tttgtgccat ggttatcata
ggggtccttc accagaattt 5100caaggacacc tccatgcaga agactatacc
tctggtggcc ctcacactca catcttacct 5160gggcttgaca caaccttttt
tgggcctgtg tgcatttctg gcaacccgca tatttgggcg 5220aaggagtatc
ccagtgaatg aggcactcgc agcagctggt ctagtgggag tgctggcagg
5280actggctttt caggagatgg agaacttcct tggtccgatt gcagttggag
gactcctgat 5340gatgctggtt agcgtggctg ggagggtgga tgggctagag
ctcaagaagc ttggtgaagt 5400ttcatgggaa gaggaggcgg agatcagcgg
gagttccgcc cgctatgatg tggcactcag 5460tgaacaaggg gagttcaagc
tgctttctga agagaaagtg ccatgggacc aggttgtgat 5520gacctcgctg
gccttggttg gggctgccct ccatccattt gctcttctgc tggtccttgc
5580tgggtggctg tttcatgtca ggggagctag gagaagtggg gatgtcttgt
gggatattcc 5640cactcctaag atcatcgagg aatgtgaaca tctggaggat
gggatttatg gcatattcca 5700gtcaaccttc ttgggggcct cccagcgagg
agtgggagtg gcacagggag gggtgttcca 5760cacaatgtgg catgtcacaa
gaggagcttt ccttgtcagg aatggcaaga agttgattcc 5820atcttgggct
tcagtaaagg aagaccttgt cgcctatggt ggctcatgga agttggaagg
5880cagatgggat ggagaggaag aggtccagtt gatcgcggct gttccaggaa
agaacgtggt 5940caacgtccag acaaaaccga gcttgttcaa agtgaggaat
gggggagaaa tcggggctgt 6000cgctcttgac tatccgagtg gcacttcagg
atctcctatt gttaacagga acggagaggt 6060gattgggctg tacggcaatg
gcatccttgt cggtgacaac tccttcgtgt ccgccatatc 6120ccagactgag
gtgaaggaag aaggaaagga ggagctccaa gagatcccga caatgctaaa
6180gaaaggaatg acaactgtcc ttgattttca tcctggagct gggaagacaa
gacgtttcct 6240cccacagatc ttggccgagt gcgcacggag acgcttgcgc
actcttgtgt tggcccccac 6300cagggttgtt ctttctgaaa tgaaggaggc
ttttcacggc ctggacgtga aattccacac 6360acaggctttt tccgctcacg
gcagcgggag agaagtcatt gatgccatgt gccatgccac 6420cctaacttac
aggatgttgg aaccaactag ggttgttaac tgggaagtga tcattatgga
6480tgaagcccat tttttggatc cagctagcat agccgctaga ggttgggcag
cgcacagagc 6540tagggcaaat gaaagtgcaa caatcttgat gacagccaca
ccgcctggga ctagtgatga 6600atttccacat tcaaatggtg aaatagaaga
tgttcaaacg gacataccca gtgagccctg 6660gaacacaggg catgactgga
tcctggctga caaaaggccc acggcatggt tccttccatc 6720catcagagct
gcaaatgtca tggctgcctc tttgcgtaag gctggaaaga gtgtggtggt
6780cctgaacagg aaaacctttg agagagaata ccccacgata aagcagaaga
aacctgactt 6840tatattggcc actgacatag ctgaaatggg agccaacctt
tgcgtggagc gagtgctgga 6900ttgcaggacg gcttttaagc ctgtgcttgt
ggatgaaggg aggaaggtgg caataaaagg 6960gccacttcgt atctccgcat
cctctgctgc tcaaaggagg gggcgcattg ggagaaatcc 7020caacagagat
ggagactcat actactattc tgagcctaca agtgaaaata atgcccacca
7080cgtctgctgg ttggaggcct caatgctctt ggacaacatg gaggtgaggg
gtggaatggt 7140cgccccactc tatggcgttg aaggaactaa aacaccagtt
tcccctggtg aaatgagact 7200gagggatgac cagaggaaag tcttcagaga
actagtgagg aattgtgacc tgcccgtttg 7260gctttcgtgg caagtggcca
aggctggttt gaagacgaat gatcgtaagt ggtgttttga 7320aggccctgag
gaacatgaga tcttgaatga cagcggtgaa acagtgaagt gcagggctcc
7380tggaggagca aagaagcctc tgcgcccaag gtggtgtgat gaaagggtgt
catctgacca 7440gagtgcgctg tctgaattta ttaagtttgc tgaaggtagg
aggggagctg ctgaagtgct 7500agttgtgctg agtgaactcc ctgatttcct
ggctaaaaaa ggtggagagg caatggatac 7560catcagtgtg ttcctccact
ctgaggaagg ctctagggct taccgcaatg cactatcaat 7620gatgcctgag
gcaatgacaa tagtcatgct gtttatactg gctggactac tgacatcggg
7680aatggtcatc tttttcatgt ctcccaaagg catcagtaga atgtctatgg
cgatgggcac 7740aatggccggc tgtggatatc tcatgttcct tggaggcgtc
aaacccactc acatctccta 7800tgtcatgctc atattctttg tcctgatggt
ggttgtgatc cccgagccag ggcaacaaag 7860gtccatccaa gacaaccaag
tggcatacct cattattggc atcctgacgc tggtttcagc 7920ggtggcagcc
aacgagctag gcatgctgga gaaaaccaaa gaggacctct ttgggaagaa
7980gaacttaatt ccatctagtg cttcaccctg gagttggccg gatcttgacc
tgaagccagg 8040agctgcctgg acagtgtacg ttggcattgt tacaatgctc
tctccaatgt tgcaccactg 8100gatcaaagtc gaatatggca acctgtctct
gtctggaata gcccagtcag cctcagtcct 8160ttctttcatg gacaagggga
taccattcat gaagatgaat atctcggtca taatgctgct 8220ggtcagtggc
tggaattcaa taacagtgat gcctctgctc tgtggcatag ggtgcgccat
8280gctccactgg tctctcattt tacctggaat caaagcgcag cagtcaaagc
ttgcacagag 8340aagggtgttc catggcgttg ccaagaaccc tgtggttgat
gggaatccaa cagttgacat 8400tgaggaagct cctgaaatgc ctgcccttta
tgagaagaaa ctggctctat atctccttct 8460tgctctcagc ctagcttctg
ttgccatgtg cagaacgccc ttttcattgg ctgaaggcat 8520tgtcctagca
tcagctgcct tagggccgct catagaggga aacaccagcc ttctttggaa
8580tggacccatg gctgtctcca tgacaggagt catgaggggg aatcactatg
cttttgtggg 8640agtcatgtac aatctatgga agatgaaaac tggacgccgg
gggagcgcga atggaaaaac 8700tttgggtgaa gtctggaaga gggaactgaa
tctgttggac aagcgacagt ttgagttgta 8760taaaaggacc gacattgtgg
aggtggatcg tgatacggca cgcaggcatt tggccgaagg 8820gaaggtggac
accggggtgg cggtctccag ggggaccgca aagttaaggt ggttccatga
8880gcgtggctat gtcaagctgg aaggtagggt gattgacctg gggtgtggcc
gcggaggctg 8940gtgttactac gctgctgcgc aaaaggaagt gagtggggtc
aaaggattta ctcttggaag 9000agacggccat gagaaaccca tgaatgtgca
aagtctggga tggaacatca tcaccttcaa 9060ggacaaaact gatatccacc
gcctagaacc agtgaaatgt gacacccttt tgtgtgacat 9120tggagagtca
tcatcgtcat cggtcacaga gggggaaagg accgtgagag ttcttgatac
9180tgtagaaaaa tggctggctt gtggggttga caacttctgt gtgaaggtgt
tagctccata 9240catgccagat gttcttgaga aactggaatt gctccaaagg
aggtttggcg gaacagtgat 9300caggaaccct ctctccagga attccactca
tgaaatgtac tacgtgtctg gagcccgcag 9360caatgtcaca tttactgtga
accaaacatc ccgcctcctg atgaggagaa tgaggcgtcc 9420aactggaaaa
gtgaccctgg aggctgacgt catcctccca attgggacac gcagtgttga
9480gacagacaag ggacccctgg acaaagaggc catagaagaa agggttgaga
ggataaaatc 9540tgagtacatg acctcttggt tttatgacaa tgacaacccc
tacaggacct ggcactactg 9600tggctcctat gtcacaaaaa cctcaggaag
tgcggcgagc atggtaaatg gtgttattaa 9660aattctgaca tatccatggg
acaggataga ggaggtcacc agaatggcaa tgactgacac 9720aacccctttt
ggacagcaaa gagtgtttaa agaaaaagtt gacaccagag caaaggatcc
9780accagcggga actaggaaga tcatgaaagt tgtcaacagg tggctgttcc
gccacctggc 9840cagagaaaag agccccagac tgtgcacaaa ggaagaattt
attgcaaaag tccgaagtca 9900tgcagccatt ggagcttacc tggaagaaca
agaacagtgg aagactgcca atgaggctgt 9960ccaagaccca aagttctggg
aactggtgga tgaagaaagg aagctgcacc aacaaggcag 10020gtgtcggact
tgtgtgtaca acatgatggg gaaaagagag aagaagctgt cagagtttgg
10080gaaagcaaag ggaagccgtg ccatatggta tatgtggctg ggagcgcggt
atcttgagtt 10140tgaggccctg ggattcctga atgaggacca ttgggcttcc
agggaaaact caggaggagg 10200agtggaaggc attggcttac aatacctagg
atatgtgatc agagacctgg ctgcaatgga 10260tggtggtgga ttctacgcgg
atgacaccgc tggatgggac acgcgcatca cagaggcaga 10320ccttgatgat
gaacaggaga tcttgaacta catgagccca catcacaaaa aactggcaca
10380agcagtgatg gaaatgacat acaagaacaa agtggtgaaa gtgttgagac
cagccccagg 10440agggaaagcc tacatggatg tcataggtcg acgagaccag
agaggatccg ggcaggtagt 10500gacttatgct ctgaacacca tcaccaactt
gaaagtccaa ttgatcagaa tggcagaagc 10560agagatggtg atacatcacc
aacatgttca agattgtgat gaatcagttc tgaccaggct 10620ggaggcatgg
ctcactgagc acggatgtaa cagactgaag aggatggcgg tgagtggaga
10680cgactgtgtg gtccggccca tcgatgacag gttcggcctg gccctgtccc
atctcaacgc 10740catgtccaag gttagaaagg acatatctga atggcagcca
tcaaaagggt ggaatgattg 10800ggagaatgtg cccttctgtt cccaccactt
ccatgaacta cagctgaagg atggcaggag 10860gattgtggtg ccttgccgag
aacaggacga gctcattggg agaggaaggg tgtctccagg 10920aaacggctgg
atgatcaagg aaacagcttg cctcagcaaa gcctatgcca acatgtggtc
10980actgatgtat tttcacaaaa gggacatgag gctactgtca ttggctgttt
cctcagctgt 11040tcccacctca tgggttccac aaggacgcac aacatggtcg
attcatggga aaggggagtg 11100gatgaccacg gaagacatgc ttgaggtgtg
gaacagagta tggataacca acaacccaca 11160catgcaggac aagacaatgg
tgaaaaaatg gagagatgtc ccttatctaa ccaagagaca 11220agacaagctg
tgcggatcac tgattggaat gaccaatagg gccacctggg cctcccacat
11280ccatttagtc atccatcgta tccgaacgct gattggacag gagaaataca
ctgactacct 11340aacagtcatg gacaggtatt ctgtggatgc tgacctgcaa
ctgggtgagc ttatctgaaa 11400caccatctaa caggaataac cgggatacaa
accacgggtg gagaaccgga ctccccacaa 11460cctgaaaccg ggatataaac
cacggctgga gaaccgggct ccgcacttaa aatgaaacag 11520aaaccgggat
aaaaactacg gatggagaac cggactccac acattgagac agaagaagtt
11580gtcagcccag aaccccacac gagttttgcc actgctaagc tgtgaggcag
tgcaggctgg 11640gacagccgac ctccaggttg cgaaaaacct ggtttctggg
acctcccacc ccagagtaaa 11700aagaacggag cctccgctac caccctccca
cgtggtggta gaaagacggg gtctagaggt 11760tagaggagac cctccaggga
acaaatagtg ggaccatatt gacgccaggg aaagaccgga 11820gtggttctct
gcttttcctc cagaggtctg tgagcacagt ttgctcaaga ataagcagac
11880ctttggatga caaacacaaa accac 119052419DNADengue 4 virus
24catggacagc aggagcaga 1925198DNAYellow fever virus 25acttcggttg
ggaaaggaat tcatacggtg tttggctctg cctttcaggg gctatttggc 60ggcttgaact
ggataacaaa ggtcatcatg ggggcggtac ttatatgggt tggcatcaac
120acaagaaaca tgacaatgtc catgagcatg atcttggtag gagtgatcat
gatgtttttg 180tctctaggag ttggcgcc 1982666PRTYellow fever virus
26Thr Ser Val Gly Lys Gly Ile His Thr Val Phe Gly Ser Ala Phe Gln 1
5 10 15 Gly Leu Phe Gly Gly Leu Asn Trp Ile Thr Lys Val Ile Met Gly
Ala 20 25 30 Val Leu Ile Trp Val Gly Ile Asn Thr Arg Asn Met Thr
Met Ser Met 35 40 45 Ser Met Ile Leu Val Gly Val Ile Met Met Phe
Leu Ser Leu Gly Val 50 55 60 Gly Ala 65 2750DNArecombinant yellow
fever virus 27ccgtatgaat tcctttccca accgaagtct tgtacagctc
gtccatgccg 502850DNArecombinant yellow fever virus 28cggcatggac
gagctgtaca agacttcggt tgggaaagga attcatacgg 5029939DNArecombinant
yellow fever virus 29gatcaaggat gcgccatcaa ctttggcgtg agcaagggcg
aggagctgtt caccggggtg 60gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc
acaagttcag cgtgtccggc 120gagggcgagg gcgatgccac ctacggcaag
ctgaccctga agttcatctg caccaccggc 180aagctgcccg tgccctggcc
caccctcgtg accaccctga cctacggcgt gcagtgcttc 240agccgctacc
ccgaccacat gaagcagcac gacttcttca agtccgccat gcccgaaggc
300tacgtccagg agcgcaccat cttcttcaag gacgacggca actacaagac
ccgcgccgag 360gtgaagttcg agggcgacac cctggtgaac cgcatcgagc
tgaagggcat cgacttcaag 420gaggacggca acatcctggg gcacaagctg
gagtacaact acaacagcca caacgtctat 480atcatggccg acaagcagaa
gaacggcatc aaggtgaact tcaagatccg ccacaacatc 540gaggacggca
gcgtgcagct cgccgaccac taccagcaga acacccccat cggcgacggc
600cccgtgctgc tgcccgacaa ccactacctg agcacccagt ccgccctgag
caaagacccc 660aacgagaagc gcgatcacat ggtcctgctg gagttcgtga
ccgccgccgg gatcactctc 720ggcatggacg agctgtacaa gacttcggtt
gggaaaggaa ttcatacggt gtttggctct 780gcctttcagg ggctatttgg
cggcttgaac tggataacaa aggtcatcat gggggcggta 840cttatatggg
ttggcatcaa cacaagaaac atgacaatgt ccatgagcat gatcttggta
900ggagtgatca tgatgttttt gtctctagga gttggcgcc
93930313PRTrecombinant yellow fever virus 30Asp Gln Gly Cys Ala Ile
Asn Phe Gly Val Ser Lys Gly Glu Glu Leu 1 5 10 15 Phe Thr Gly Val
Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn 20 25 30 Gly His
Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr 35 40 45
Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val 50
55 60 Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr Gly Val Gln Cys
Phe 65 70 75 80 Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe
Lys Ser Ala 85 90 95 Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile
Phe Phe Lys Asp Asp 100 105 110 Gly Asn Tyr Lys Thr Arg Ala Glu Val
Lys Phe Glu Gly Asp Thr Leu 115 120 125 Val Asn Arg Ile Glu Leu Lys
Gly Ile Asp Phe Lys Glu Asp Gly Asn 130 135 140 Ile Leu Gly His Lys
Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr 145 150 155 160 Ile Met
Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile 165 170 175
Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln 180
185 190 Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn
His 195 200 205 Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn
Glu Lys Arg 210 215 220 Asp His Met Val Leu Leu Glu Phe Val Thr Ala
Ala Gly Ile Thr Leu 225 230 235 240 Gly Met Asp Glu Leu Tyr Lys Thr
Ser Val Gly Lys Gly Ile His Thr 245 250 255 Val Phe Gly Ser Ala Phe
Gln Gly Leu Phe Gly Gly Leu Asn Trp Ile 260 265 270 Thr Lys Val Ile
Met Gly Ala Val Leu Ile Trp Val Gly Ile Asn Thr 275 280 285 Arg Asn
Met Thr Met Ser Met Ser Met Ile Leu Val Gly Val Ile Met 290 295 300
Met Phe Leu Ser Leu Gly Val Gly Ala 305 310 3116PRTYellow fever
virus 31Leu Ser Leu Gly Val Gly Ala Asp Gln Gly Cys Ala Ile Asn Phe
Gly 1 5 10 15 3216PRTJapanese encephalitis virus 32Leu Ala Thr Asn
Val His Ala Asp Thr Gly Cys Ala Ile Asp Ile Thr 1 5 10 15
3316PRTDengue virus type 2 33Leu Gly Val Met Val Gln Ala Asp Ser
Gly Cys Val Val Ser Trp Lys 1 5 10 15 3416PRTDengue virus type 4
34Leu Gly Phe Thr Val Gln Ala Asp Met Gly Cys Val Ala Ser Trp Ser 1
5 10 15 3516PRTWest Nile virus 35Leu Ser Val Asn Val His Ala Asp
Thr Gly Cys Ala Ile Asp Ile Gly 1 5 10 15 3616PRTTick-borne
encephalitis virus 36Met Thr Leu Gly Val Gly Ala Asp Val Gly Cys
Ala Val Asp Thr Glu 1 5 10 15 377PRTArtificial SequenceDesigned
peptide based on consense motif of flavivirus 37Val Xaa Ala Asp Xaa
Gly Cys 1 5 3896PRTTick-borne encephalitis
virusmisc_featureC-TERMINAL OF E PROTEIN OF TICK-BORNE ENCEPHALITIS
VIRUS 38Arg Val Phe Gln Lys Thr Lys Lys Gly Ile Glu Arg Leu Thr Val
Ile 1 5 10 15 Gly Glu His Ala Trp Asp Phe Gly Ser Ala Gly Gly Phe
Leu Ser Ser 20 25 30 Ile Gly Lys Ala Val His Thr Val Leu Gly Gly
Ala Phe Asn Ser Ile 35 40 45 Phe Gly Gly Val Gly Phe Leu Pro Lys
Leu Leu Leu Gly Val Ala Leu 50 55 60 Ala Trp Leu Gly Leu Asn Met
Arg Asn Pro Thr Met Ser Met Ser Phe 65 70 75 80 Leu Leu Ala Gly Gly
Leu Val Leu Ala Met Thr Leu Gly Val Gly Ala 85 90 95 3996PRTYellow
fever virusmisc_featureC-TERMINAL OF E PROTEIN OF YELLOW FEVER
VIRUS 39Lys Leu Phe Thr Gln Thr Met Lys Gly Val Glu Arg Leu Ala Val
Met 1 5 10 15 Gly Asp Thr Ala Trp Asp Phe Ser Ser Ala Gly Gly Phe
Phe Thr Ser 20 25 30 Val Gly Lys Gly Ile His Thr Val Phe Gly Ser
Ala Phe Gln Gly Leu 35 40 45 Phe Gly Gly Leu Asn Trp Ile Thr Lys
Val Ile Met Gly Ala Val Leu 50 55 60 Ile Trp Val Gly Ile Asn Thr
Arg Asn Met Thr Met Ser Met Ser Met 65 70 75 80 Ile Leu Val Gly Val
Ile Met Met Phe Leu Ser Leu Gly Val Gly Ala 85 90 95 409PRTYellow
fever virusmisc_featureN-TERMINAL OF NS1 PROTEIN OF YELLOW FEVER
VIRUS 40Asp Gln Gly Cys Ala Ile Asn Phe Gly 1 5 419PRTJapanese
encephalitis virusmisc_featureN-TERMINAL OF NS1 PROTEIN OF JAPANESE
ENCEPHALITIS VIRUS 41Asp Thr Gly Cys Ala Ile Asp Ile Thr 1 5
429PRTDengue virus type 2misc_featureN-TERMINAL OF NS1 PROTEIN OF
DENGUE 2 VIRUS 42Asp Ser Gly Cys Val Val Ser Trp Lys 1 5
439PRTDengue virus type 4misc_featureN-TERMINAL OF NS1 PROTEIN OF
DENGUE 4 VIRUS 43Asp Met Gly Cys Val Ala Ser Trp Ser 1 5 449PRTWest
Nile virusmisc_featureN-TERMINAL OF NS1 PROTEIN OF WEST NILE VIRUS
44Asp Thr Gly Cys Ala Ile Asp Ile Gly 1 5 459PRTTick-borne
encephalitis virusmisc_featureN-TERMINAL OF NS1 PROTEIN OF TICK
BORNE VIRUS 45Asp Val Gly Cys Ala Val Asp Thr Glu 1 5 4632PRTYellow
fever virusmisc_featureAMINO ACID RESIDUES CORRESPONDING TO THE 23
AMINO ACID OF THE CARBOXI END OF YELLOW FEVER VIRUS E PROTEIN AND
THE 9 N-TERMINAL AMINO ACID RESIDUES OF YELLOW FEVER NS1 PROTEIN
TOTAL OF 32 RESIDUES 46Met Thr Met Ser Met Ser Met Ile Leu Val Gly
Val Ile Met Met Phe 1 5 10 15 Leu Ser Leu Gly Val Gly Ala
Asp Gln Gly Cys Ala Ile Asn Phe Gly 20 25 30 47375PRTYellow fever
virusmisc_featureRECOMBINANT POLYPROTEIN REGION (375 AMINO ACID
RESIDUES) ENCOMPASSING THE LAST 23 RESIDUES OF YF E PROTEIN, THE
RECOMBINANT GFP PROTEIN (343 AMINO ACID RESIDUES) AND THE
N-TERMINAL OF YF NS1 PROTEIN (9 AMINO ACID RESIDUES) 47Met Thr Met
Ser Met Ser Met Ile Leu Val Gly Val Ile Met Met Phe 1 5 10 15 Leu
Ser Leu Gly Val Gly Ala Asp Gln Gly Cys Ala Ile Asn Phe Gly 20 25
30 Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
35 40 45 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser
Gly Glu 50 55 60 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu
Lys Phe Ile Cys 65 70 75 80 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro
Thr Leu Val Thr Thr Leu 85 90 95 Thr Tyr Gly Val Gln Cys Phe Ser
Arg Tyr Pro Asp His Met Lys Gln 100 105 110 His Asp Phe Phe Lys Ser
Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 115 120 125 Thr Ile Phe Phe
Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 130 135 140 Lys Phe
Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 145 150 155
160 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
165 170 175 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys
Asn Gly 180 185 190 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu
Asp Gly Ser Val 195 200 205 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr
Pro Ile Gly Asp Gly Pro 210 215 220 Val Leu Leu Pro Asp Asn His Tyr
Leu Ser Thr Gln Ser Ala Leu Ser 225 230 235 240 Lys Asp Pro Asn Glu
Lys Arg Asp His Met Val Leu Leu Glu Phe Val 245 250 255 Thr Ala Ala
Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Lys Leu 260 265 270 Phe
Thr Gln Thr Met Lys Gly Val Glu Arg Leu Ala Val Met Gly Asp 275 280
285 Thr Ala Trp Asp Phe Ser Ser Ala Gly Gly Phe Phe Thr Ser Val Gly
290 295 300 Lys Gly Ile His Thr Val Phe Gly Ser Ala Phe Gln Gly Leu
Phe Gly 305 310 315 320 Gly Leu Asn Trp Ile Thr Lys Val Ile Met Gly
Ala Val Leu Ile Trp 325 330 335 Val Gly Ile Asn Thr Arg Asn Met Thr
Met Ser Met Ser Met Ile Leu 340 345 350 Val Gly Val Ile Met Met Phe
Leu Ser Leu Gly Val Gly Ala Asp Gln 355 360 365 Gly Cys Ala Ile Asn
Phe Gly 370 375
* * * * *
References