U.S. patent application number 15/250015 was filed with the patent office on 2016-12-15 for use of chec peptides to treat neurological and cardiovascular diseases and disorders.
The applicant listed for this patent is DREXEL UNIVERSITY. Invention is credited to Timothy J. Cunningham.
Application Number | 20160361379 15/250015 |
Document ID | / |
Family ID | 44763219 |
Filed Date | 2016-12-15 |
United States Patent
Application |
20160361379 |
Kind Code |
A1 |
Cunningham; Timothy J. |
December 15, 2016 |
Use of CHEC Peptides to Treat Neurological and Cardiovascular
Diseases and Disorders
Abstract
The present invention describes compositions and methods for
treating and preventing non-degenerative neurological diseases and
disorders associated with elevated sPLA2 activity as well as
cardiovascular diseases using a CHEC peptide to inhibit sPLA2
activity.
Inventors: |
Cunningham; Timothy J.;
(Fort Washington, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DREXEL UNIVERSITY |
Philadelphia |
PA |
US |
|
|
Family ID: |
44763219 |
Appl. No.: |
15/250015 |
Filed: |
August 29, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13640192 |
Feb 19, 2013 |
9452195 |
|
|
PCT/US2011/030192 |
Mar 28, 2011 |
|
|
|
15250015 |
|
|
|
|
61322540 |
Apr 9, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/08 20130101 |
International
Class: |
A61K 38/08 20060101
A61K038/08 |
Claims
1. A method of treating a mammal with ischemia having an elevated
level of secreted phospholipase A2 (sPLA2) activity, said method
comprising administering a pharmaceutical composition comprising an
effective amount of a sPLA2 inhibitor to said mammal, thereby
treating said ischemia in said mammal.
2. The method of claim 1, wherein said sPLA2 inhibitor is selected
from the group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
nucleic acid encoding a CHEC-9 peptide, and a nucleic acid encoding
a CHEC-7 peptide.
3. The method of claim 2, wherein said CHEC-9 peptide comprises the
amino acid sequence selected from the group consisting of SEQ ID
NO: 1 and SEQ ID NO: 2.
4. The method of claim 2, wherein said nucleic acid encoding the
CHEC-9 peptide comprises the nucleic acid sequence selected from
the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5.
5. The method of claim 2, wherein said CHEC-7 peptide comprises the
amino acid sequence of SEQ ID NO: 3.
6. The method of claim 2, wherein said nucleic acid encoding the
CHEC-7 peptide comprises the nucleic acid sequence selected from
the group consisting of SEQ ID NO: 6 and SEQ ID NO: 7.
7. The method of claim 1, wherein said sPLA2 inhibitor is selected
from the group consisting of an oxidized sPLA2 inhibitor, a
cyclized sPLA2 inhibitor, and an alkylated sPLA2 inhibitor.
8. The method of claim 1, wherein said mammal is a human.
9. A method of delivering a CHEC peptide to a cell in a mammal
having an elevated level of secreted phospholipase A2 (sPLA2)
activity, said method comprising administering a pharmaceutical
composition comprising an effective amount of a CHEC-9 peptide, a
CHEC-7 peptide, a nucleic acid encoding CHEC-9, or a nucleic acid
encoding CHEC-7 to said mammal, thereby delivering said CHEC
peptide to said cell in said mammal.
10. The method of claim 9, wherein said mammal has a
non-degenerative neurological disease or disorder associated with
elevated sPLA2 activity selected from the group consisting of
epilepsy, ischemia, schizophrenia, and a mood disorder.
11. The method of claim 9, wherein said mammal is afflicted with an
ischemic injury to a CNS tissue.
12. The method of claim 9, wherein said CHEC-9 peptide comprises
the amino acid sequence selected from the group consisting of SEQ
ID NO: 1 and SEQ ID NO: 2.
13. The method of claim 9, wherein said nucleic acid encoding the
CHEC-9 peptide comprises the nucleic acid sequence selected from
the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5.
14. The method of claim 9, wherein said CHEC-7 peptide comprises
the amino acid sequence of SEQ ID NO: 3.
15. The method of claim 9, wherein said nucleic acid encoding the
CHEC-7 peptide comprises the nucleic acid sequence selected from
the group consisting of SEQ ID NO: 6 and SEQ ID NO: 7.
16. The method of claim 9, wherein said mammal is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 13/640,192, filed Feb. 19, 2013, now allowed,
which is a U.S. national phase application filed under 35 U.S.C.
.sctn.371 claiming benefit to International Patent Application No.
PCT/US2011/030192, filed on Mar. 28, 2011, which is entitled to
priority under 35 U.S.C. .sctn.119(e) to U.S. Provisional Patent
Application No. 61/322,540 filed on Apr. 9, 2010, each of which
applications are hereby incorporated herein by reference in their
entirety.
BACKGROUND OF THE INVENTION
[0002] Phospholipase A2s (PLA2s) are an expanding super family of
esterases that cleave the acyl ester bond at the sn-2 position of
membrane phospholipids to produce a free fatty acid and
lysophospholipid (Farooqui et al., 2000, Neuroscientist 6:169-180).
Because a large proportion of cellular arachidonic acid is found
esterified at the sn-2 position of membrane phospholipids,
arachidonic acid and lysophospholipid are the major products of the
PLA2-catalyzed reaction. Under normal conditions, some arachidonic
acid is converted to inflammatory mediators, prostaglandins,
leukotrienes, and thromboxanes, whereas a majority of arachidonic
acid is reincorporated into brain phospholipids (Rapoport, 1999,
Neurochem. Res. 24:1403-1415; Leslie, 2004, Biochem. Cell. Biol.
82:1-17). Arachidonic acid not only acts via conversion to
inflammatory metabolites, but can also directly modulate neuronal
function by various mechanisms, such as altering membrane fluidity
and polarization state, activating protein kinase C, and regulating
gene transcription (Katsuki and Okuda, 1995, Prog. Neurobiol.
46:607-636; Farooqui et al., 1997Arachidonic acid, neurotrauma, and
neurodegenerative disease, in Handbook of Essential Fatty Acid
Biology (Yehuda and Mostofsky, eds.) pp 277-295, Humana Press,
Totowa, N.J.). Another product of PLA2 catalyzed reactions,
1-alkyl-2-lysophospholipid, is the immediate precursor of
platelet-activating factor (PAF), another potent inflammatory
mediator (Farooqui and Horrocks, 2004, Plasmalogens, platelet
activating factor, and other lipids, in Bioactive Lipids (Nicolaou
and Kokotos, eds.) pp 107-134, Oily Press, Bridgwater, U.K.).
[0003] Increased PLA2 activity and excessive production of
proinflammatory mediators, eicosanoids, and platelet activating
factor, may potentially lead to disease states and neuronal injury.
PLA2-generated mediators play a central role not only in acute
inflammatory responses in brain but also in oxidative stress
associated with progressive degenerative neurological disorders
such as Alzheimer's disease (AD), Parkinson's disease (PD), and
multiple sclerosis (MS) (Kalyvas and David, 2004, Neuron
41:323-335; Phillis and O'Regan, 2004, Brain Res. Rev. 44:13-47;
Sun et al., 2004, J. Lipid Res. 45:205-213). PLA2 contributes to
the pathogenesis of the above disorders by attacking neural
membrane phospholipids and releasing proinflammatory lipid
mediators such as prostaglandins, leukotrienes, and thromboxanes,
and PAF, and also by generating 4-hydroxynonenal (4-HNE).
[0004] Secretory phospholipase A2 (sPLA2) is synthesized
intracellularly, then secreted from the cell where it acts
extracellularly. PLA2 binds to two types of cell surface receptors,
namely the N type in neurons, and the M type in skeletal muscles,
(Hanasaki and Arita, 2002, prostaglandins Other Lipid Mediat.
68-69:71-82). Brain sPLA2 is present in all regions of mammalian
brain with the highest activities of sPLA2 are found in medulla
oblongata, pons, and hippocampus, moderate activities in the
hypothalamus, thalamus, and cerebral cortex, and low activities in
the cerebellum and olfactory bulb (Thwin et al., 2003, Exp. Brain
Res. 150:427-433).
[0005] Glutamate and its analogs stimulate sPLA2 activity in a
dose- and time-dependent manner (Kim et al., 1995, Biochem. J.
310:83-90; Xu et al., 2003, Free Radical Biol. Med. 34:1531-1543).
The neurotoxicity of glutamate is synergistically increased with
the addition of sPLA2 to cortical cultures, suggesting
glutamatergic synaptic activity may be modulated by sPLA2 and its
receptors on the neuronal surface (DeCoster et al., 2002, J.
Neurosci. Res. 67:634-645; Kolko et al., 2002, NeuroReport
13:1963-1966). In PC12 cells, sPLA2 induces neurite outgrowth.
Mutants with reduced sPLA2 activity exhibit a comparable reduction
in neurite-inducing activity (Nakashima et al., 2003, Biochem. J.
376:655-666), indicating that sPLA2 performs a neurotrophin-like
role in the central nervous system.
[0006] Neurons are more susceptible to free radical-mediated
neuroinflammation and oxidative stress than glial cells (Adibhatla
et al., 2003, J. Neurosci. Res. 73:308-315; Ajmone-Cat et al.,
2003, J. Neurochem. 87:1193-1203). In fact, activated glial cells,
including astroglia and microglia, sustain inflammatory processes
initiated by arachidonic acid-generated metabolites. This suggests
that signals modulating the induction, expression, and stimulation
of PLA2 isoforms may play an important role in neurodegenerative
diseases associated with Neuroinflammation and oxidative stress
(Farooqui and Horrocks, 1994, Int. Rev. Neurobio. 36:267-323;
Farooqui et al., 2003, Stimulation of lipases and phospholipases in
Alzheimer disease, in Nutrition and Biochemistry of Phospholipids
(Szuhaj and van Nieuwenhuyzen, eds.) pp 14-29 AOCS Press,
Champaign, IL; Farooqui and Horrocks, 2004, Plasmalogens, platelet
activating factor, and other lipids, in Bioactive Lipids (Nicolaou
and Kokotos, eds.) pp 107-134, Oily Press, Bridgwater, U.K.). For
the successful treatment of inflammatory and oxidative stress in
neurological disorders, timely delivery of a well-tolerated,
chronically active, and specific inhibitor of PLA2 that can bypass
or cross the blood-brain barrier without harm is required. Some
nonspecific PLA2 inhibitors have been used for the treatment of
neurological disorders such as ischemia, spinal cord injury, and AD
(Sano et al., 1997, New Eng. J. med. 336:1216-1222), but no
compound with real clinical potential has emerged.
[0007] The neuron survival-promoting peptide Y-P30 was originally
identified in the secretions of neural cells (neuroblastoma and
retinoblastoma) subjected to oxidative stress (Cunningham, et al.
1998, J. Neurosci. 18:7047-7060). Partially purified fractions of
conditioned culture medium were screened in vitro until the active
Y-P30 peptide was identified--the synthetic version of this peptide
was then tested in vitro and in vivo and found to support neural
cells which were degenerating for a variety of reasons, including
oxidative stress and central nervous system trauma (Cunningham, et
al. 1998, J. Neurosci. 18:7047-7060; Cunningham et al., 2000, Exp.
Neurol. 163:457-468). This peptide was later confirmed to be part
of an endogenous human polypeptide (-12 kiloDaltons) named DSEP
after identification of the human cDNA encoding DSEP and the locus
of the DSEP gene in human chromosomal region 12q (Cunningham, et
al. 2002, Exp. Neurol. 177:32-39). In that study, it was found that
overexpression of the full length polypeptide in neural cells made
them resistant to several forms of oxidative stress including that
resulting from immune cell attack. CHEC-9 and CHEC-7 are
anti-inflammatory and neuron survival-promoting peptides that
inhibit enzymes that initiate a cascade of changes during the early
stages of inflammation.
[0008] The stimulation of sPLA2 and subsequent biochemical cascade
are important events associated with acute neural trauma as well as
chronic neurological degenerative diseases (Farooqui et al., 2006,
Pharmacological Rev. 58:591-620). Similarly, atherosclerosis has
been proposed as both a disorder of inflammation and lipid
metabolism (Jaross et al., 1999, Atherosclerosis 144 (Supplement
1):119-120). The sPLA2s are a subclass of phospholipase A2 enzymes
that cleave the A2 fatty acid ester of phospholipids (Burke et al,
2009, J. Lipid Res. 50:S237-242). Several sPLA2s have been
identified and the contribution of specific enzyme isoforms
(principally groups II, V and X) and play a role in the formation
of atherosclerotic lesions (Rosenson, 2009, Cardiovascular Drugs
and Therapy 23:93-101). sPLA2 inhibitors are attractive therapeutic
targets. However, existing and available sPLA2 inhibitors lack
sufficient specificity, affecting not just other PLA2 isoforms, but
other enzymes such as cyclooxygenase and acyltransferase (Cummings
et al., 2000, J. Pharmacol. Exp. Ther. 294:793-799; Fuentes et al.,
2003, J. Biol. Chem. 278:44683-44690).
[0009] There is a long standing need in the art for specific and
potent sPLA2 inhibitors that are well-tolerated clinically for use
in methods of treating a variety of non-degenerative neurological
diseases or disorders and cardiovascular diseases. The present
invention fills this need.
SUMMARY OF THE INVENTION
[0010] The invention includes a method of treating a mammal
afflicted with a non-degenerative neurological disease or disorder
associated with elevated levels of secreted phospholipase A2
(sPLA2) activity. The method comprises administering a
pharmaceutical composition comprising an effective amount of a
sPLA2 inhibitor to the mammal, thereby treating the
non-degenerative neurological disease or disorder in the mammal.
Preferably, the mammal is a human.
[0011] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the non-degenerative neurological disease or disorder
is selected from the group consisting of epilepsy, ischemic injury,
schizophrenia, and a mood disorder.
[0012] The invention also includes a method of treating a mammal at
risk of developing a non-degenerative neurological disease or
disorder associated with an elevated level of secreted
phospholipase A2 (sPLA2) activity. The method comprises
administering a pharmaceutical composition comprising an effective
amount of a sPLA2 inhibitor to the mammal, thereby treating the
mammal at risk of developing the non-degenerative neurological
disease or disorder. Preferably, the mammal is a human.
[0013] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the non-degenerative neurological disease or disorder
is selected from the group consisting of epilepsy, ischemic injury,
schizophrenia, and a mood disorder.
[0014] The invention further includes a method of treating a mammal
afflicted with epilepsy wherein sPLA2 activity is elevated. The
method comprises administering a pharmaceutical composition
comprising an effective amount of a sPLA2 inhibitor to the mammal,
wherein when an effective amount of the sPLA2 inhibitor contacts a
neuron in the central nervous system, the sPLA2 inhibitor
specifically inhibits the sPLA2 activity in the neuron, wherein the
sPLA2 inhibitor treats the epilepsy in the mammal. Preferably, the
mammal is a human.
[0015] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide.
[0016] The invention further includes a method of treating a mammal
at risk of having a seizure wherein sPLA2 activity is elevated. The
method comprises administering a pharmaceutical composition
comprising an effective amount of a sPLA2 inhibitor to the mammal,
wherein when an effective amount of the sPLA2 inhibitor contacts a
neuron in the central nervous system, the sPLA2 inhibitor
specifically inhibits the sPLA2 activity in the neuron, wherein the
sPLA2 inhibitor treats the mammal at risk of having the seizure.
Preferably, the mammal is a human.
[0017] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide.
[0018] The invention further includes a method of treating a mammal
afflicted with a non-degenerative neurological disease or disorder
associated with an elevated level of secreted phospholipase A2
(sPLA2) activity. The method comprises administering a
pharmaceutical composition comprising an effective amount of a
sPLA2 inhibitor to the mammal, wherein when the sPLA2 inhibitor
contacts a neuron in the central nervous system, the sPLA2
inhibitor specifically inhibits the sPLA2 activity in the neuron,
thereby treating the non-degenerative neurological disease or
disorder in the mammal. Preferably, the mammal is a human.
[0019] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the non-degenerative neurological disease or disorder
is selected from the group consisting of epilepsy, ischemic injury,
schizophrenia, and a mood disorder.
[0020] The invention further includes a method of treating a mammal
at risk of developing a non-degenerative neurological disease or
disorder associated with an elevated level of secreted
phospholipase A2 (sPLA2) activity. The method comprises
administering a pharmaceutical composition comprising an effective
amount of a sPLA2 inhibitor to the mammal, wherein when the sPLA2
inhibitor contacts a neuron in the central nervous system, the
sPLA2 inhibitor specifically inhibits the sPLA2 activity in the
neuron, thereby treating the mammal at risk of developing the
non-degenerative neurological disease or disorder. Preferably, the
mammal is a human.
[0021] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the non-degenerative neurological disease or disorder
is selected from the group consisting of epilepsy, ischemic injury,
schizophrenia, and a mood disorder.
[0022] The invention further includes a method of treating a mammal
afflicted with epilepsy associated with an elevated level of
secreted phospholipase A2 (sPLA2) activity. The method comprises
administering a pharmaceutical composition comprising an effective
amount of a sPLA2 inhibitor to the mammal, wherein when the sPLA2
inhibitor contacts a neuron in the central nervous system, the
sPLA2 inhibitor specifically inhibits the sPLA2 activity in the
neuron, thereby treating the epilepsy in the mammal. Preferably,
the mammal is a human.
[0023] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide.
[0024] The invention further includes a method of treating a mammal
at risk of developing epilepsy associated with an elevated level of
secreted phospholipase A2 (sPLA2) activity. The method comprises
administering a pharmaceutical composition comprising an effective
amount of a sPLA2 inhibitor to the mammal, wherein when the sPLA2
inhibitor contacts a neuron in the central nervous system, the
sPLA2 inhibitor specifically inhibits the sPLA2 activity in the
neuron, thereby treating the mammal at risk of developing the
epilepsy. Preferably, the mammal is a human.
[0025] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide.
[0026] In invention further includes a method of treating a mammal
afflicted with a cardiovascular disease or disorder. The method
comprises administering a pharmaceutical composition comprising an
effective amount of a sPLA2 inhibitor to the mammal, thereby
treating the cardiovascular disease or disorder in the mammal.
Preferably, the mammal is a human.
[0027] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the cardiovascular disease or disorder is selected from
the group consisting of atherosclerosis, angina, cerebrovascular
accident (stroke), cerebrovascular disease, transient ischemic
incidents, congestive heart failure, coronary artery disease,
myocardial ischemia, myocardial infarction, and peripheral vascular
disease.
[0028] The invention further includes a method of treating a mammal
at risk of developing a cardiovascular disease or disorder. The
method comprises administering a pharmaceutical composition
comprising an effective amount of a sPLA2 inhibitor to the mammal,
thereby treating the mammal at risk of developing the
cardiovascular disease. Preferably, the mammal is a human.
[0029] In one embodiment, the sPLA2 inhibitor is selected from the
group consisting of a CHEC-9 peptide, a CHEC-7 peptide, a
derivative of a CHEC-9 peptide, a derivative of a CHEC-7 peptide,
and any combination thereof. In another embodiment, the sPLA2
inhibitor is selected from the group consisting of a nucleic acid
encoding CHEC-9, a nucleic acid encoding CHEC-7, a nucleic acid
encoding a derivative of a CHEC-9 peptide, and a nucleic acid
encoding a derivative of a CHEC-7 peptide. In yet another
embodiment, the cardiovascular disease or disorder is selected from
the group consisting of atherosclerosis, angina, cerebrovascular
accident (stroke), cerebrovascular disease, transient ischemic
incidents, congestive heart failure, coronary artery disease,
myocardial ischemia, myocardial infarction, and peripheral vascular
disease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] For the purpose of illustrating the invention, there are
depicted in the drawings certain embodiments of the invention.
However, the invention is not limited to the precise arrangements
and instrumentalities of the embodiments depicted in the
drawings.
[0031] FIG. 1, is a graph depicting multiunit activity recorded
from the CA1 cell field of the hippocampus of awake, freely moving
kainic acid-treated rats that have been treated either with CHEC-9
or vehicle. Multiunit activity is presented as impulses recorded
per second and provided as a percentage of baseline activity
measured prior to seizure induction.
[0032] FIG. 2 is an image of a gel depicting the results of a
Western blot analysis performed on urine samples obtained from
patients diagnosed with multiple sclerosis and probed for the
presence of neurofilament (NF) med (160 kDa). Patients with active
multiple sclerosis are designated (M) and healthy controls are
designated (C). The main band observed is consistent with an 82 kDa
calpain fragment of NF med.
[0033] FIG. 3 is a schematic diagram illustrating the various roles
sPLA2 plays in atherosclerosis.
DETAILED DESCRIPTION OF THE INVENTION
[0034] Previously, elevated sPLA2 activity was thought to be
associated only with neurological diseases and disorders
characterized by progressive neuronal death, apoptosis and
degeneration. The present invention is based on the discovery that
some non-degenerative neurological diseases and disorders are
associated with elevated sPLA2 activity that is detectable in a
body sample. As demonstrated for the first time herein, elevated
sPLA2 is a therapeutic target for treating and preventing these
non-degenerative neurological diseases and disorders. The present
invention identifies for the first time epilepsy, ischemic injury,
schizophrenia, and mood disorders as non-degenerative neurological
diseases and disorders associated with elevated sPLA2 activity. The
present invention should not be deemed to be limited to those
non-degenerative diseases and disorders recited herein, but rather
is intended to encompass all non-degenerative neurological diseases
and disorders associated with elevated sPLA2 activity, both known
and unknown.
[0035] In addition, the present invention is based on the discovery
that inhibiting sPLA2 activity can be used to treat and prevent
cardiovascular diseases and disorders, including atherosclerosis,
angina, cerebrovascular accident (stroke), cerebrovascular disease,
transient ischemic incidents, congestive heart failure, coronary
artery disease, myocardial ischemia, myocardial infarction, and
peripheral vascular disease.
[0036] CHEC-9 (SEQ ID NO. 1), a CHEC-9 peptide variant (SEQ ID NO.
2), CHEC-7 (SEQ ID NO. 3), as well as variants thereof, are
collectively referred to herein as CHEC peptides. Each CHEC peptide
is a potent sPLA2 inhibitor. The present invention therefore
provides compositions and methods to treat a mammal afflicted with,
or at risk of developing, a non-degenerative neurological disease
or disorder associated with elevated sPLA2 activity, or a
cardiovascular disease or disorder wherein the method comprises
administering to the mammal a CHEC peptide or an isolated nucleic
acid encoding a CHEC peptide.
Definitions:
[0037] Unless defined otherwise, all technical and scientific terms
used herein generally have the same meaning as commonly understood
by one of ordinary skill in the art to which this invention
belongs. Generally, the nomenclature used herein and the laboratory
procedures in cell culture, molecular genetics, organic chemistry,
and nucleic acid chemistry and hybridization are those well known
and commonly employed in the art.
[0038] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, genetics, and
immunology. See, e.g., Sambrook et al., 2001, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.; Ausubel et al. 2002, Current Protocols in Molecular
Biology, John Wiley & Sons, NY; Glover, 1985; Anand, 1992;
Guthrie and Fink, 1991. A general discussion of techniques and
materials for human gene mapping, including mapping of human
chromosome 1, is provided, e.g., in White and Lalouel, 1988.
[0039] As used herein, each of the following terms has the meaning
associated with it in this section.
[0040] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e. to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0041] The term "about" will be understood by persons of ordinary
skill in the art and will vary to some extent on the context in
which it is used.
[0042] By the term "applicator" as the term is used herein, is
meant any device including, but not limited to, a hypodermic
syringe, a pipette, and the like, for administering a CHAC peptide
of the invention to a mammal.
[0043] The phrase "body sample" as used herein, is intended any
sample comprising a cell, a tissue, or a bodily fluid in which
expression of sPLA2 or sPLA2 esterase activity can be detected.
Samples that are liquid in nature are referred to herein as "bodily
fluids." Body samples may be obtained from a patient by a variety
of techniques including, for example, by scraping or swabbing an
area or by using a needle to aspirate bodily fluids. Methods for
collecting various body samples are well known in the art.
[0044] The phrase "at-risk" as used herein refers to a subject with
a greater than average likelihood of developing a neurological
disease or disorder syndrome associated with elevated activity of
sPLA2.
[0045] A "disease" is a state of health of subject wherein the
subject cannot maintain homeostasis, and wherein if the disease is
not ameliorated then the subject's health continues to deteriorate.
In contrast, a "disorder" in a subject is a state of health in
which the subject is able to maintain homeostasis, but in which the
subject's state of health is less favorable than it would be in the
absence of the disorder. Left untreated, a disorder does not
necessarily cause a further decrease in the subject's state of
health. In preferred embodiments, the subject is an animal. In more
preferred embodiments, the subject is a mammal. In most preferred
embodiments, the subject is a human.
[0046] A "mood disorder" as used herein encompasses a group of
diagnoses provided in the Diagnostic and Statistical Manual of
mental Disorders (DSM IV TR) classification system where a
disturbance in a subject's mood is the principal presenting
feature. Two groups of mood disorders are broadly recognized as
depressive disorders and bipolar disorders. Depressive disorders
include major depressive disorder (MDD), commonly called clinical
depression or major depression, atypical depression, melancholic
depression, psychotic major depression, catatonic depression,
postpartum depression, seasonal afective disorder, dysthymia,
depressive disorder not otherwise specified, such as recurrant
brief depression and minor depressive disorder. Bipolar disorders
(BD), formerly known as "manic depression" and described by
intermittent periods of manic and depressed episodes, include
bipolar I, bipolar II, cyclothymia, and bipolar disorder not
otherwise specified. Other mood disordersinclude substance-induced
mood disorders, such as alcohol induced mood disorders and
benzodiazepine induced mood disorders.
[0047] The term "cardiovascular disease," as used herein, refers to
a class of diseases that involve the heart and blood vessels
(arteries and veins). Cardiovascular disease includes
atherosclerosis, angina, cerebrovascular accident (stroke),
cerebrovascular disease, transient ischemic incidents, congestive
heart failure, coronary artery disease, myocardial ischemia,
myocardial infarction, and peripheral vascular disease.
[0048] The term "atherosclerosis" as used herein refers to the
condition in which an artery wall thickens as the result of a
build-up of fatty materials such as cholesterol. It is a syndrome
affecting arterial blood vessels, a chronic inflammatory response
in the walls of arteries, in large part due to the accumulation of
macrophage white blood cells and promoted by low-density
lipoproteins (plasma proteins that carry cholesterol and
triglycerides) without adequate removal of fats and cholesterol
from the macrophages by functional high density lipoproteins (HDL).
It is commonly referred to as a hardening or furring of the
arteries. It is caused by the formation of multiple plaques within
the arteries
[0049] The term "coronary artery disease" (or CAD), as used herein,
refers to the end result of the accumulation of atheromatous
plaques within the walls of the coronary arteries that supply the
myocardium (the muscle of the heart) with oxygen and nutrients. As
the degree of coronary artery disease progresses, there may be
near-complete obstruction of the lumen of the coronary artery,
severely restricting the flow of oxygen-carrying blood to the
myocardium. Individuals with this degree of coronary artery disease
typically have suffered from one or more myocardial infarctions
(heart attacks), and may have signs and symptoms of chronic
coronary ischemia, including symptoms of angina at rest and flash
pulmonary edema.
[0050] The term "myocardial infarction" (MI) or "acute myocardial
infarction" (AMI), as used herein refer to the interruption of
blood supply to part of the heart, causing some heart cells to die.
This is most commonly due to occlusion (blockage) of a coronary
artery following the rupture of a vulnerable atherosclerotic
plaque, which is an unstable collection of lipids (fatty acids) and
white blood cells (especially macrophages) in the wall of an
artery. The resulting ischemia (restriction in blood supply) and
oxygen shortage, if left untreated for a sufficient period of time,
can cause damage or death (infarction) of heart muscle tissue
(myocardium).
[0051] The term "stroke", as used herein, refers to a rapidly
developing loss of brain function(s) due to disturbance in the
blood supply to the brain, caused by a blocked or burst blood
vessel. This can be due to ischemia (lack of glucose and oxygen
supply) caused by thrombosis or embolism or due to a hemorrhage. As
a result, the affected area of the brain is unable to function,
leading to, for example, inability to move one or more limbs on one
side of the body, inability to understand or formulate speech, or
inability to see one side of the visual field.
[0052] A "neurological disease" or "neurological disorder" as used
herein, is a disease or disorder that affects the nervous system of
a subject including a disease that affects the brain, spinal cord,
or peripheral nerves. A neurological disease or disorder may affect
the nerve cells or the supporting ells of the nervous system, such
as the glial cells. The causes of neurological disease or disorder
include infection, inflammation, ischemia, injury, tumor, or
inherited illness.
[0053] A disease or disorder is "alleviated" if the severity of a
symptom of the disease or disorder, or the frequency with which
such a symptom is experienced by a subject, or both, are
reduced.
[0054] The term "non-degenerative neurological disease," as used
herein, refers to a neurological disease or disorder that is not
characterized by progressive neuronal death or degeneration, but
that is associated with elevated sPLA2 levels or activity
detectable in a body sample obtained from a subject.
[0055] The terms "effective amount" and "pharmaceutically effective
amount" refer to a nontoxic but sufficient amount of an agent to
provide the desired biological result. That result can be reduction
and/or alleviation of the signs, symptoms, or causes of a disease
or disorder, or any other desired alteration of a biological
system. An appropriate effective amount in any individual case may
be determined by one of ordinary skill in the art using routine
experimentation.
[0056] As used herein "endogenous" refers to any material from or
produced inside an organism, cell, tissue or system.
[0057] As used herein, the term "exogenous" refers to any material
introduced from or produced outside an organism, cell, tissue or
system.
[0058] The term "expression" as used herein is defined as the
transcription and/or translation of a particular nucleotide
sequence.
[0059] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting there from. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0060] "Homologous" as used herein, refers to the subunit sequence
similarity between two polymeric molecules, e.g., between two
nucleic acid molecules, e.g., two DNA molecules or two RNA
molecules, or between two polypeptide molecules. When a subunit
position in both of the two molecules is occupied by the same
monomeric subunit, e.g., if a position in each of two DNA molecules
is occupied by adenine, then they are homologous at that position.
The homology between two sequences is a direct function of the
number of matching or homologous positions, e.g., if half (e.g.,
five positions in a polymer ten subunits in length) of the
positions in two compound sequences are homologous then the two
sequences are 50% homologous, if 90% of the positions, e.g., 9 of
10, are matched or homologous, the two sequences share 90%
homology. By way of example, the DNA sequences 5'-CCGTT-3' and
5'-CGGTAT-3' share 75% homology.
[0061] As used herein, the terms "gene" and "recombinant gene"
refer to nucleic acid molecules comprising an open reading frame
encoding a polypeptide of the invention. Such natural allelic
variations can typically result in 1-5% variance in the nucleotide
sequence of a given gene. Alternative alleles can be identified by
sequencing the gene of interest in a number of different
individuals. This can be readily carried out by using hybridization
probes to identify the same genetic locus in a variety of
individuals. Any and all such nucleotide variations and resulting
amino acid polymorphisms or variations that are the result of
natural allelic variation and that do not alter the functional
activity are intended to be within the scope of the invention.
[0062] "Instructional material," as that term is used herein,
includes a publication, a recording, a diagram, or any other medium
of expression which can be used to communicate the usefulness of
the composition and/or compound of the invention in a kit. The
instructional material of the kit may, for example, be affixed to a
container that contains the compound and/or composition of the
invention or be shipped together with a container which contains
the compound and/or composition. Alternatively, the instructional
material may be shipped separately from the container with the
intention that the recipient uses the instructional material and
the compound cooperatively. Delivery of the instructional material
may be, for example, by physical delivery of the publication or
other medium of expression communicating the usefulness of the kit,
or may alternatively be achieved by electronic transmission, for
example by means of a computer, such as by electronic mail, or
download from a web site.
[0063] By "nucleic acid" is meant any nucleic acid, whether
composed of deoxyribonucleosides or ribonucleosides, and whether
composed of phosphodiester linkages or modified linkages such as
phosphotriester, phosphoramidate, siloxane, carbonate,
carboxymethylester, acetamidate, carbamate, thioether, bridged
phosphoramidate, bridged methylene phosphonate, phosphorothioate,
methylphosphonate, phosphorodithioate, bridged phosphorothioate or
sulfone linkages, and combinations of such linkages. The term
nucleic acid also specifically includes nucleic acids composed of
bases other than the five biologically occurring bases (adenine,
guanine, thymine, cytosine and uracil). The term "nucleic acid"
typically refers to large polynucleotides.
[0064] Conventional notation is used herein to describe
polynucleotide sequences: the left-hand end of a single-stranded
polynucleotide sequence is the 5'-end; the left-hand direction of a
double-stranded polynucleotide sequence is referred to as the
5'-direction.
[0065] The direction of 5' to 3' addition of nucleotides to nascent
RNA transcripts is referred to as the transcription direction. The
DNA strand having the same sequence as an mRNA is referred to as
the "coding strand"; sequences on the DNA strand which are located
5' to a reference point on the DNA are referred to as "upstream
sequences"; sequences on the DNA strand which are 3' to a reference
point on the DNA are referred to as "downstream sequences."
[0066] By "expression cassette" is meant a nucleic acid molecule
comprising a coding sequence operably linked to promoter/regulatory
sequences necessary for transcription and, optionally, translation
of the coding sequence.
[0067] As used herein, the term "promoter/regulatory sequence"
means a nucleic acid sequence which is required for expression of a
gene product operably linked to the promoter/regulator sequence. In
some instances, this sequence may be the core promoter sequence and
in other instances, this sequence may also include an enhancer
sequence and other regulatory elements which are required for
expression of the gene product. The promoter/regulatory sequence
may, for example, be one which expresses the gene product in an
inducible manner.
[0068] An "inducible" promoter is a nucleotide sequence which, when
operably linked with a polynucleotide which encodes or specifies a
gene product, causes the gene product to be produced substantially
only when an inducer which corresponds to the promoter is
present.
[0069] "Polypeptide" refers to a polymer composed of amino acid
residues, related naturally occurring structural variants, and
synthetic non-naturally occurring analogs thereof linked via
peptide bonds. Synthetic polypeptides can be synthesized, for
example, using an automated polypeptide synthesizer.
[0070] The term "protein" typically refers to large
polypeptides.
[0071] The term "peptide" typically refers to short
polypeptides.
[0072] Conventional notation is used herein to portray polypeptide
sequences: the left-hand end of a polypeptide sequence is the
amino-terminus; the right-hand end of a polypeptide sequence is the
carboxyl-terminus.
[0073] A "polynucleotide" means a single strand or parallel and
anti-parallel strands of a nucleic acid. Thus, a polynucleotide may
be either a single-stranded or a double-stranded nucleic acid. In
the context of the present invention, the following abbreviations
for the commonly occurring nucleic acid bases are used. "A" refers
to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T"
refers to thymidine, and "U" refers to uridine.
[0074] The term "oligonucleotide" typically refers to short
polynucleotides, generally no greater than about 60 nucleotides. It
will be understood that when a nucleotide sequence is represented
by a DNA sequence (i.e., A, T, G, C), this also includes an RNA
sequence (i.e., A, U, G, C) in which "U" replaces "T."
[0075] The term "recombinant DNA" as used herein is defined as DNA
produced by joining pieces of DNA from different sources.
[0076] The term "recombinant polypeptide" as used herein is defined
as a polypeptide produced by using recombinant DNA methods.
[0077] By the term "specifically binds," as used herein, is meant a
molecule, such as an antibody, which recognizes and binds to
another molecule or feature, but does not substantially recognize
or bind other molecules or features in a sample.
[0078] A "prophylactic" treatment is a treatment administered to a
subject who does not exhibit signs of a disease or exhibits only
early signs of the disease for the purpose of decreasing the risk
of developing pathology associated with the disease.
[0079] "Preventing" a disease, as the term is used herein, means
that the onset of the disease is delayed, and/or that the symptoms
of the disease will be decreased in intensity and/or frequency,
when an inhibitor is administered compared with the onset and/or
symptoms in the absence of the inhibitor.
[0080] As used herein, the term "alleviate" refers to the
lessening, decrease, or diminishing of a symptom, state, or
condition. In one aspect, a symptom of a disease is alleviated when
the symptom decreases in severity of occurrence or effect in a
patient. In another aspect, a symptom of a disease is alleviated
when the symptom is completely eradicated or eliminated from the
patient.
[0081] The phrase "inhibit," as used herein, means to reduce a
molecule, a reaction, an interaction, a gene, an mRNA, and/or a
protein's expression, stability, function or activity by a
measurable amount or to prevent entirely. Inhibitors are compounds
that, e.g., bind to, partially or totally block stimulation,
decrease, prevent, delay activation, inactivate, desensitize, or
down regulate a protein, a gene, and an mRNA stability, expression,
function and activity, e.g., antagonists.
[0082] As used herein, the term "degeneration of a neuron" refers
to any decrease in activity, viability, or function of a neuron
from the normal healthy state of the neuron. In one aspect,
degeneration of a neuron refers to a minor decrease in activity,
viability, or function of a neuron from the normal healthy state of
the neuron. In another aspect, degeneration of a neuron refers to
the complete incapacitation of the neuron such that the neuron
cannot function in any capacity, and even death of the neuron. The
term "degeneration of axon" similarly refers to the activity,
viability or function of an axon.
[0083] The term "treatment," as used herein, refers to reversing,
alleviating, delaying the onset of, inhibiting the progress of,
and/or preventing a disease or disorder, or one or more symptoms
thereof, to which the term is applied in a subject. In some
embodiments, treatment may be applied after one or more symptoms
have developed. In other embodiments, treatment may be administered
in the absence of symptoms. For example, treatment may be
administered prior to symptoms (e.g., in light of a history of
symptoms and/or one or more other susceptibility factors), or after
symptoms have resolved, for example to prevent or delay their
reoccurrence.
[0084] "Variant" as the term is used herein, is a nucleic acid
sequence or a peptide sequence that differs in sequence from a
reference nucleic acid sequence or peptide sequence respectively,
but retains essential properties of the reference molecule. Changes
in the sequence of a nucleic acid variant may not alter the amino
acid sequence of a peptide encoded by the reference nucleic acid,
or may result in amino acid substitutions, additions, deletions,
fusions and truncations. Changes in the sequence of peptide
variants are typically limited or conservative, so that the
sequences of the reference peptide and the variant are closely
similar overall and, in many regions, identical. A variant and
reference peptide can differ in amino acid sequence by one or more
substitutions, additions, deletions in any combination. A variant
of a nucleic acid or peptide can be a naturally occurring such as
an allelic variant, or can be a variant that is not known to occur
naturally. Non-naturally occurring variants of nucleic acids and
peptides may be made by mutagenesis techniques or by direct
synthesis.
[0085] "Substantially similar function" refers to the function of a
modified nucleic acid or a modified protein, with reference to the
wild-type CHEC-9 or CHEC-7 nucleic acid or wild-type CHEC-9 or
CHEC-7 polypeptide. The modified polypeptide will be substantially
homologous to the wild-type CHEC-9 or CHEC-7 polypeptide and will
have substantially the same function. The modified polypeptide may
have an altered amino acid sequence and/or may contain modified
amino acids. In addition to the similarity of function, the
modified polypeptide may have other useful properties, such as a
longer half-life. The similarity of function (activity) of the
modified polypeptide may be substantially the same as the activity
of the wild-type CHEC-9 or CHEC-7 polypeptide. Alternatively, the
similarity of function (activity) of the modified polypeptide may
be higher than the activity of the wild-type CHEC-9 or CHEC-7
polypeptide. The modified polypeptide is synthesized using
conventional techniques, or is encoded by a modified nucleic acid
and produced using conventional techniques. The modified nucleic
acid is prepared by conventional techniques. A nucleic acid with a
function substantially similar to the wild-type CHEC-9 or CHEC-7
nucleic acid encodes the modified protein described above.
[0086] Throughout this disclosure, various aspects of this
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual and partial numbers within that range, for
example, 1, 2, 3, 4, 5, 5.5 and 6. This applies regardless of the
breadth of the range. It is understood that any and all whole or
partial integers between any ranges set forth herein are included
herein.
Description:
[0087] The present invention comprises compositions and methods of
treating a mammal afflicted with or at risk for developing a
non-degenerative neurological disease or associated with elevated
sPLA2 activity. The method comprises administering to a mammal an
effective amount of a sPLA2 inhibitor to a mammal as a prophylactic
or therapeutic treatment. The present invention further comprises
compositions and methods of treating a mammal afflicted with or at
risk for developing cardiovascular disease. Preferably, the mammal
is human.
[0088] A preferred sPLA2 inhibitor is a CHEC peptide, most
preferably a CHEC-9, CHEC-7, or a functionally equivalent variant
thereof. CHEC peptides, nucleic acids encoding CHEC peptides, and
pharmaceutical preparations comprising the same, have broad utility
in the treatment of neurological diseases and disorders where sPLA2
levels of activity are deleteriously elevated in a mammal and/or
have an inflammatory component. The uses of these materials in the
methods described herein below are intended to exemplify their
utility, and are not intended to limit the invention.
I. Compositions
[0089] A nine amino acid peptide CHEASAAQC (SEQ ID NO. 1)
designated CHEC-9 or CH-QC9 and a CHEC-9 peptide variant having the
sequence CAHAQAESC (SEQ ID NO. 2) have been found to inhibit
phospholipase A2 (U.S. Pat. No. 7,528,112, U.S. Pat. No. 6,262,024,
U.S. patent application Ser. No. 11/974,527; U.S. patent
application Ser. No. 11/988,253, and U.S. patent application Ser.
No. 12/436,066). A seven amino acid peptide, CHEC-7 having the
sequence CHEASQC (SEQ ID NO. 3), is even more potent as a sPLA2
inhibitor than CHEC-9 (U.S. patent application Ser. No.
11/974,527).
[0090] The nucleic acid sequence, TGCCATGAAGCATCAGCAGCTCAATGC (SEQ
ID NO. 4) or TGCCATGAAGCATCAGCAGCTCAATGT (SEQ ID NO. 5), encode the
CHEC-9 peptide where the last cysteine (C) of SEQ ID NO. 4 is used
to cyclize the peptide for certain applications. The nucleic acid
sequence, TGCCATGAAGCATCACAATGC (SEQ ID NO. 6) or
TGCCATGAAGCATCACAATGT (SEQ ID NO. 7), encode the CHEC-7 peptide
where the last cysteine (C) of SEQ ID NO. 6 is used to cyclize the
peptide for certain applications.
A. Preparation of CHEC-Encoding Nucleic Acid Molecules
[0091] Nucleic acid molecules encoding CHEC peptides of the
invention may be prepared by two general methods: (1) synthesis
from appropriate nucleotide triphosphates, or (2) isolation from
biological sources. Both methods utilize protocols well known in
the art. Preparation of an isolated nucleic acid molecule of the
invention may be by oligonucleotide synthesis. The nucleic acid
synthesized may be any combination of codons which encode a CHEC
peptide. Synthetic oligonucleotides may be prepared by the
phosphoramidite method employed in the Applied Biosystems 38A DNA
Synthesizer or similar devices. The resultant construct may be
purified according to methods known in the art, such as high
performance liquid chromatography (HPLC). Alternatively, nucleic
acid sequences encoding a CHEC peptide may be isolated from
appropriate biological sources using methods known in the art.
Suitable probes for this purpose are derived from sequences which
encode the amino acids of a CHEC peptide.
[0092] The nucleotide sequences encoding a CHEC peptide can
comprise sequence variations with respect to the original
nucleotide sequences, for example, substitutions, insertions and/or
deletions of one or more nucleotides, with the condition that the
resulting polynucleotide encodes a polypeptide according to the
invention. Therefore, the scope of the present invention includes
nucleotide sequences that are variants the nucleotide sequences
recited herein that encode a CHEC peptide.
[0093] A nucleotide sequence that is a variant or a nucleotide
sequence encoding a CHEC peptide can typically be isolated from a
recombinant cell or organism by means of introducing conservative
or non-conservative substitutions in the nucleic acid sequence that
encodes a CHEC peptide. Other examples of possible modifications
include the insertion of one or more nucleotides in the sequence,
the addition of one or more nucleotides in any of the ends of the
sequence, or the deletion of one or more nucleotides in any end or
inside the sequence.
[0094] In another aspect, the invention relates to a construct,
comprising a nucleotide sequence encoding a CHEC peptide. In a
particular embodiment, the construct is operatively bound to
transcription, and optionally translation, control elements. The
construct can incorporate an operatively bound regulatory sequence
of the expression of the nucleotide sequence of the invention, thus
forming an expression cassette.
[0095] In accordance with the present invention, nucleic acids
having the appropriate level of sequence homology with a nucleic
acid sequence encoding a CHEC peptide of the invention may be
identified by using hybridization and washing conditions of
appropriate stringency. For example, hybridizations may be
performed, according to the method of Sambrook et al., 2001,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., using a hybridization
solution comprising: 5.times.SSC, 5.times. Denhardt's reagent, 1.0%
SDS, 100 .mu.g/ml denatured, fragmented salmon sperm DNA, 0.05%
sodium pyrophosphate and up to 50% formarnide. Hybridization is
carried out at 37-42.degree. C. for at least six hours. Following
hybridization, filters are washed as follows: (1) 5 minutes at room
temperature in 2.times.SSC and 1% SDS; (2) 15 minutes at room
temperature in 2.times.SSC and 0.1% 5 SDS; (3) 30 minutes-1 hour at
37.degree. C. in 1.times.SSC and 1% SDS; (4) 2 hours at
42-65.degree. C. in 1.times.SSC and 1% SDS, changing the solution
every 30 minutes.
[0096] One common formula for calculating the stringency conditions
required to achieve hybridization between nucleic acid molecules of
a specified sequence homology (Sambrook et al., 1989) is as
follows:
T.sub.m=81.5.degree. C.+16.6 Log [Na.sup.+]+0.41 (% G+C)-0.63 (%
formamide)-600/#bp in duplex
[0097] As an illustration of the above formula, using
[Na.sup.+]=[0.368] and 50% formamide, with GC content of 42% and an
average probe size of 200 bases, the T.sub.m is 57.degree. C. The
T.sub.m of a DNA duplex decreases by 1-1.5.degree. C. with every 1%
decrease in homology. Thus, targets with greater than about 75%
sequence identity would be observed using a hybridization
temperature of 42.degree. C.
[0098] The stringency of the hybridization and wash depend
primarily on the salt concentration and temperature of the
solutions. In general, to maximize the rate of annealing of the
probe with its target, the hybridization is usually carried out at
salt and temperature conditions that are 20-25.degree. C. below the
calculated T.sub.m of the hybrid. Wash conditions should be as
stringent as possible for the degree of identity of the probe for
the target. In general, wash conditions are selected to be
approximately 12-20.degree. C. below the T.sub.m of the hybrid. In
regards to the nucleic acids of the current invention, a moderate
stringency hybridization is defined as hybridization in
6.times.SSC, 5.times. Denhardt's solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
2.times.SSC and 0.5% SDS at 55.degree. C. for 15 minutes. A high
stringency hybridization is 5 defined as hybridization in
6.times.SSC, 5.times. Denhardt's solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes. A very
high stringency hybridization is defined as hybridization in
6.times.SSC, 5.times. Denhardt's 10 solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
0.1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes.
[0099] CHEC peptide-encoding nucleic acid molecules of the
invention include cDNA, genomic DNA, RNA, and fragments thereof
which may be single- or double-stranded. Thus, this invention
provides oligonucleotides having sequences capable of hybridizing
with at least one sequence of a nucleic acid molecule of the
present invention. As mentioned previously, such oligonucleotides
are useful as probes for detecting or isolating related CHEC
peptide encoding nucleic acids.
[0100] It will be appreciated by persons skilled in the art that
variants (e.g., allelic variants) of nucleic acid sequences
encoding a CHEC peptide exist in the human population, and must be
taken into account when designing and/or utilizing oligonucleotides
of the invention. Accordingly, it is within the scope of the
present invention to encompass such variants, with respect to the
CHEC sequences disclosed herein or the oligonucleotides targeted to
specific locations on the respective genes or RNA transcripts.
Accordingly, the term "natural allelic variants" is used herein to
refer to various specific nucleotide sequences of the invention and
variants thereof that would occur in a human population. The usage
of different wobble codons and genetic polymorphisms which give
rise to conservative or neutral amino acid substitutions in the
encoded protein are examples of such variants.
B. Preparation of CHEC Peptides
[0101] CHEC-9 peptide, CHEC-7 peptide, and functional variants
thereof may be prepared in a variety of ways, according to known
methods. The peptide may be synthesized using an automated peptide
synthesizer. Alternatively, the peptide may be purified from
appropriate sources, e.g., transformed bacterial or animal cultured
cells or tissues, by immunoaffinity purification. The availability
of nucleic acid molecules encoding CHEC peptides enables production
of the peptide using in vitro expression methods known in the art.
For example, a CHEC-9 encoding polynucleotide may be cloned into an
appropriate in vitro transcription vector, such as pSP64 or pSP65
for in vitro transcription, followed by cell-free translation in a
suitable cell-free translation system, such as wheat germ or rabbit
reticulocyte lysates. In vitro transcription and translation
systems are commercially available, e.g., from Promega Biotech,
Madison, Wis. or Gibco-BRL, Gaithersburg, Md.
[0102] Alternatively, larger quantities of CHEC peptides may be
produced by expression in a suitable prokaryotic or eukaryotic
system. For example, part or all of a DNA molecule, such as a
nucleic acid encoding CHEC-9 may be inserted into a plasmid vector
adapted for expression in a bacterial cell, such as E. coli. Such
vectors comprise the regulatory elements necessary for expression
of the DNA in the host cell positioned in such a manner as to
permit expression of the DNA in the host cell. Such regulatory
elements required for expression include promoter sequences,
transcription initiation sequences and, optionally, enhancer
sequences.
[0103] A CHEC peptide produced by gene expression in a recombinant
prokaryotic or eukaryotic system may be purified according to
methods known in the art. In a preferred embodiment, a commercially
available expression/secretion system can be used, whereby the
recombinant peptide/protein is expressed and thereafter secreted
from the host cell, and readily purified from the surrounding
medium. If expression/secretion vectors are not used, an
alternative approach involves purifying the recombinant protein by
affinity separation, such as by immunological interaction with
antibodies that bind specifically to the recombinant protein or
nickel columns for isolation of recombinant proteins tagged with
6-8 histidine residues at their N- terminus or C-terminus.
Alternative tags may comprise the FLAG epitope or the hemagglutinin
epitope. Such methods are commonly used by skilled
practitioners.
[0104] A CHEC-9 peptide, CHEC-7 peptide, and functional homologs or
variants thereof, prepared by the aforementioned methods, may be
analyzed according to standard procedures. For example, such
proteins may be subjected to amino acid sequence analysis,
according to known methods. One such peptide variant which also has
neuron protective activity is the peptide having the sequence
CAHAQAESC (SEQ ID NO. 2).
[0105] A CHEC peptide may be oxidized (cyclized, e.g. as in SEQ ID
NO. 4 or SEQ ID NO. 6), or akylated (lineraized) or otherwise
post-translationally modified. For example, post-translational
modifications that fall within the scope of the present invention
include signal peptide cleavage, glycosylation, acetylation,
isoprenylation, proteolysis, myristoylation, protein folding and
proteolytic processing, etc. Some modifications or processing
events require introduction of additional biological machinery. For
example, processing events, such as signal peptide cleavage and
core glycosylation, are examined by adding canine microsomal
membranes or Xenopus egg extracts (U.S. Pat. No. 6,103,489) to a
standard translation reaction.
[0106] A polypeptide of the invention may include unnatural amino
acids formed by post-translational modification or by introducing
unnatural amino acids during translation. A variety of approaches
are available for introducing unnatural amino acids during protein
translation. By way of example, special tRNAs, such as tRNAs which
have suppressor properties, suppressor tRNAs, have been used in the
process of site-directed non-native amino acid replacement (SNAAR).
In SNAAR, a unique codon is required on the mRNA and the suppressor
tRNA, acting to target a non-native amino acid to a unique site
during the protein synthesis (described in WO90/05785). However,
the suppressor tRNA must not be recognizable by the aminoacyl tRNA
synthetases present in the protein translation system. In certain
cases, a non-native amino acid can be formed after the tRNA
molecule is aminoacylated using chemical reactions which
specifically modify the native amino acid and do not significantly
alter the functional activity of the aminoacylated tRNA. These
reactions are referred to as post-aminoacylation modifications. For
example, the epsilon-amino group of the lysine linked to its
cognate tRNA (tRNA.sub.LYS), could be modified with an amine
specific photoaffinity label.
[0107] A peptides of the invention may be developed using a
biological expression system. The use of these systems allows the
production of large libraries of random peptide sequences and the
screening of these libraries for peptide sequences that bind to
particular proteins. Libraries may be produced by cloning synthetic
DNA that encodes random peptide sequences into appropriate
expression vectors. (see Christian et al 1992, J. Mol. Biol.
227:711; Devlin et al, 1990 Science 249:404; Cwirla et al 1990,
Proc. Natl. Acad, Sci. USA, 87:6378). Libraries may also be
constructed by concurrent synthesis of overlapping peptides (see
U.S. Pat. No. 4,708,871).
[0108] The CHEC peptides of the invention may be converted into
pharmaceutical salts by reacting with inorganic acids such as
hydrochloric acid, sulfuric acid, hydrobromic acid, phosphoric
acid, etc., or organic acids such as formic acid, acetic acid,
propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic
acid, succinic acid, malic acid, tartaric acid, citric acid,
benzoic acid, salicylic acid, benezenesulfonic acid, and
toluenesulfonic acids.
II. Methods
[0109] The present invention provides a method of treating or
preventing a non-degenerative neurological disease or disorder
associated with an elevated level of sPLA2 activity in a mammal.
The method comprises administering to a mammal afflicted with a
non-degenerative neurological disease or disorder, or at-risk of
developing a non-degenerative neurological disease or disorder, a
therapeutically effective amount of at least one sPLA2 inhibitor,
wherein the sPLA2 inhibitor inhibits the activity of sPLA2, thereby
treating or preventing the non-degenerative neurological disease or
disorder. A preferred sPLA2 inhibitor of the invention is a CHEC-9
peptide, a CHEC-7 peptide, or a functionally equivalent variant
thereof.
[0110] Examples of non-degenerative neurological diseases and
disorders associated with elevated sPLA2 activity include, but are
not limited to, epilepsy, ischemic injury, schizophrenia, and mood
disorders. It will be understood by the skilled artisan that the
invention should not be limited to those diseases explicitly
recited herein, but that the instant invention has utility in the
treatment of any non-degenerative neurological disease or disorder
which might benefit from treatment using a phospholipase A2
inhibitor. Methods of prophylaxis (i.e., prevention or decreased
risk of disease), as well as reduction in the frequency or severity
of symptoms associated with elevated sPLA2 or any related disease
or disorder, are also encompassed by the present invention.
[0111] In a preferred embodiment, the mammal is a human.
[0112] In one embodiment, the present invention provides a method
of treating a mammal afflicted with or at risk of developing
epilepsy associated with elevated levels of sPLA2. The method
comprises administering a therapeutically effective amount of a
CHEC peptide, or a pharmaceutical composition comprising a
therapeutically effective amount of a CHEC peptide, to a mammal
afflicted with epilepsy, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating the epilepsy.
[0113] In another embodiment, the present invention provides a
method of treating a mammal at risk of having a seizure and where
sPLA2 levels are elevated. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
pharmaceutical composition comprising a therapeutically effective
amount of a CHEC peptide, to a mammal at risk of having a seizure,
wherein the CHEC peptide inhibits sPLA2 activity, thereby
preventing a seizure.
[0114] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing a non-degenerative neurological disease or disorder
associated with an elevated level of sPLA2 where the method
comprises administering a therapeutically effective amount of a
CHEC peptide, or a pharmaceutical composition comprising a
therapeutically effective amount of a CHEC peptide, to a mammal
afflicted with a non-degenerative neurological disease or disorder
associated with elevated sPLA2 activity, such that when the sPLA2
inhibitor contacts a neuron in the central or peripheral nervous
system, the sPLA2 inhibitor inhibits sPLA2 activity in the neuron
thereby treating the non-degenerative neurological disease or
disorder.
[0115] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
an ischemic injury to CNS tissue. The method comprises
administering a therapeutically effective amount of a CHEC peptide,
or a composition comprising a CHEC peptide, to a mammal afflicted
with ischemia or a mammal at risk of ischemic injury to CNS tissue,
wherein the CHEC peptide inhibits sPLA2 activity, thereby treating
or preventing the ischemic injury.
[0116] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing schizophrenia. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with schizophrenia, wherein the CHEC
peptide inhibits sPLA2 activity, thereby treating the
schizophrenia.
[0117] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing a mood disorder. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with a mood disorder, wherein the
CHEC peptide inhibits sPLA2 activity, thereby treating the mood
disorder.
[0118] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
a cardiovascular disease or disorder. The method comprises
administering a therapeutically effective amount of a CHEC peptide,
or a composition comprising a therapeutically effective amount of a
CHEC peptide, to a mammal afflicted with a cardiovascular disease
or disorder, wherein the CHEC peptide inhibits sPLA2 activity,
thereby treating the cardiovascular disease or disorder. In one
aspect, a cardiovascular disease or disorder is associated with
elevated sPLA2 expression or activity. In another aspect, a
cardiovascular disease or disorder is not be associated with
elevated sPLA2 expression or activity, but inhibition of sPLA2
expression or activity is still an efficacious treatment of the
disease or disorder. Methods of prophylaxis (i.e., prevention or
decreased risk of disease), as well as reduction in the frequency
or severity of symptoms associated with sPLA2 activity as it
relates to a cardiovascular disease or disorder, are also
encompassed by the present invention.
[0119] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
atherosclerosis. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
atherosclerosis, wherein the CHEC peptide inhibits sPLA2 activity,
thereby inhibiting, reducing, or preventing plaque formation in a
blood vessel and treating atherosclerosis.
[0120] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing angina. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
angina, wherein the CHEC peptide inhibits sPLA2 activity, thereby
treating angina.
[0121] In yet another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
cerebrovascular accident (stroke). The method comprises
administering a therapeutically effective amount of a CHEC peptide,
or a composition comprising a therapeutically effective amount of a
CHEC peptide, to a mammal afflicted with or at risk of developing
cerebrovascular accident, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating cerebrovascular accident (stroke).
[0122] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
cerebrovascular disease. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
cerebrovascular disease, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating cerebrovascular disease.
[0123] In yet another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
transient ischemic incidents. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
transient ischemic incidents, wherein the CHEC peptide inhibits
sPLA2 activity, thereby treating transient ischemic incidents.
[0124] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing congestive heart failure. The method comprises
administering a therapeutically effective amount of a CHEC peptide,
or a composition comprising a therapeutically effective amount of a
CHEC peptide, to a mammal afflicted with or at risk of developing
congestive heart failure, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating congestive heart failure.
[0125] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
coronary artery disease. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
coronary artery disease, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating coronary artery disease.
[0126] In yet another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
myocardial ischemia. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
myocardial ischemia, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating myocardial ischemia.
[0127] In still another embodiment, the present invention provides
a method of treating a mammal afflicted with or at risk of
developing myocardial infarction a. The method comprises
administering a therapeutically effective amount of a CHEC peptide,
or a composition comprising a therapeutically effective amount of a
CHEC peptide, to a mammal afflicted with or at risk of developing
myocardial infarction, wherein the CHEC peptide inhibits sPLA2
activity, thereby treating myocardial infarction.
[0128] In another embodiment, the present invention provides a
method of treating a mammal afflicted with or at risk of developing
peripheral vascular disease. The method comprises administering a
therapeutically effective amount of a CHEC peptide, or a
composition comprising a therapeutically effective amount of a CHEC
peptide, to a mammal afflicted with or at risk of developing
peripheral vascular disease, wherein the CHEC peptide inhibits
sPLA2 activity, thereby treating peripheral vascular disease.
Methods of Delivering a CHEC Peptide to a Cell
[0129] The present invention comprises a method for treating or
preventing a non-degenerative neurological disease or disorder in a
mammal where the disease or disorder is at least in part caused by
elevated activity of sPLA2. In particular, the present invention
comprises a method for treating or preventing epilepsy, ischemic
injury of CNS tissues, schizophrenia, and mood disorders.
Accordingly, the method comprises administering a therapeutic
amount of a sPLA2 inhibitor to a mammal.
[0130] The present invention further comprises a method of treating
or preventing cardiovascular disease in a mammal. In particular,
the present invention comprises a method of treating or preventing
atherosclerosis, angina, cerebrovascular accident (stroke),
cerebrovascular disease, transient ischemic incidents, congestive
heart failure, coronary artery disease, myocardial ischemia,
myocardial infarction, and peripheral vascular disease.
[0131] Nucleic acid molecules which encode a CHEC peptide, e.g. SEQ
ID NO. 4 or SEQ ID NO. 5, may be incorporated in a known manner
into an appropriate expression vector which ensures expression of
the CHEC peptide.
[0132] Therefore, in another aspect, the invention relates to a
vector, comprising the nucleotide sequence of the invention or the
construct of the invention. The choice of the vector will depend on
the host cell in which it is to be subsequently introduced. In a
particular embodiment, the vector of the invention is an expression
vector. Suitable host cells include a wide variety of prokaryotic
and eukaryotic host cells. In specific embodiments, the expression
vector is selected from the group consisting of a viral vector, a
bacterial vector and a mammalian cell vector. Prokaryote- and/or
eukaryote-vector based systems can be employed for use with the
present invention to produce polynucleotides, or their cognate
polypeptides. Many such systems are commercially and widely
available.
[0133] Further, the expression vector may be provided to a cell in
the form of a viral vector. Viral vector technology is well known
in the art and is described, for example, in Sambrook et al., 2001,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. and in Ausubel et al.
2002, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, and in other virology and molecular biology manuals.
Viruses, which are useful as vectors include, but are not limited
to, retroviruses, adenoviruses, adeno-associated viruses, herpes
viruses, and lentiviruses. In general, a suitable vector contains
an origin of replication functional in at least one organism, a
promoter sequence, convenient restriction endonuclease sites, and
one or more selectable markers. (See, e.g., WO 01/96584; WO
01/29058; and U.S. Pat. No. 6,326,193).
[0134] Vectors suitable for the insertion of the polynucleotides
are vectors derived from expression vectors in prokaryotes such as
pUC18, pUC19, Bluescript and the derivatives thereof, mp18, mp19,
pBR322, pMB9, ColE1, pCR1, RP4, phages and "shuttle" vectors such
as pSA3 and pAT28, expression vectors in yeasts such as vectors of
the type of 2 micron plasmids, integration plasmids, YEP vectors,
centromere plasmids and the like, expression vectors in insect
cells such as vectors of the pAC series and of the pVL, expression
vectors in plants such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA,
pGWB, pMDC, pMY, pORE series and the like, and expression vectors
in eukaryotic cells based on viral vectors (adenoviruses, viruses
associated to adenoviruses such as retroviruses and, particularly,
lentiviruses) as well as non-viral vectors such as pSilencer
4.1-CMV (Ambion), pcDNA3, pcDNA3.1/hyg, pHMCV/Zeo, pCR3.1,
pEFI/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV,
pUB6/V5-His, pVAX1, pZeoSV2, pCI, pSVL and PKSV-10, pBPV-1, pML2d
and pTDT1.
[0135] By way of illustration, the vector in which the nucleic acid
sequence is introduced can be a plasmid which is or is not
integrated in the genome of a host cell when it is introduced in
the cell. Illustrative, non-limiting examples of vectors in which
the nucleotide sequence of the invention or the gene construct of
the invention can be inserted include a tet-on inducible vector for
expression in eukaryote cells.
[0136] The vector may be obtained by conventional methods known by
persons skilled in the art (Sambrook et al., 2001, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). In a particular embodiment, the vector
is a vector useful for transforming animal cells.
[0137] The recombinant expression vectors may also contain nucleic
acid molecules which encode a protein which provides increased
expression of the recombinant CHEC peptide; increased solubility of
the recombinant CHEC peptide; and/or aid in the purification of the
recombinant CHEC peptide by acting as a ligand in affinity
purification. For example, a proteolytic cleavage site may be
inserted in the recombinant peptide to allow separation of the
recombinant CHEC peptide after purification of the fusion protein.
Examples of fusion expression vectors include pGEX (Amrad Corp.,
Melbourne, Australia), pMAL (New England Biolabs, Beverly, Mass.)
and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione
S-transferase (GST), maltose E binding protein, or protein A,
respectively, to the recombinant protein.
[0138] Additional promoter elements, i.e., enhancers, regulate the
frequency of transcriptional initiation. Typically, these are
located in the region 30-110 bp upstream of the start site,
although a number of promoters have recently been shown to contain
functional elements downstream of the start site as well. The
spacing between promoter elements frequently is flexible, so that
promoter function is preserved when elements are inverted or moved
relative to one another. In the thymidine kinase (tk) promoter, the
spacing between promoter elements can be increased to 50 bp apart
before activity begins to decline. Depending on the promoter, it
appears that individual elements can function either co-operatively
or independently to activate transcription.
[0139] A promoter may be one naturally associated with a gene or
polynucleotide sequence, as may be obtained by isolating the 5'
non-coding sequences located upstream of the coding segment and/or
exon. Such a promoter can be referred to as "endogenous."
Similarly, an enhancer may be one naturally associated with a
polynucleotide sequence, located either downstream or upstream of
that sequence. Alternatively, certain advantages will be gained by
positioning the coding polynucleotide segment under the control of
a recombinant or heterologous promoter, which refers to a promoter
that is not normally associated with a polynucleotide sequence in
its natural environment. A recombinant or heterologous enhancer
refers also to an enhancer not normally associated with a
polynucleotide sequence in its natural environment. Such promoters
or enhancers may include promoters or enhancers of other genes, and
promoters or enhancers isolated from any other prokaryotic, viral,
or eukaryotic cell, and promoters or enhancers not "naturally
occurring," i.e., containing different elements of different
transcriptional regulatory regions, and/or mutations that alter
expression. In addition to producing nucleic acid sequences of
promoters and enhancers synthetically, sequences may be produced
using recombinant cloning and/or nucleic acid amplification
technology, including PCR.TM., in connection with the compositions
disclosed herein (U.S. Pat. No. 4,683,202, U.S. Pat. No.
5,928,906). Furthermore, it is contemplated the control sequences
that direct transcription and/or expression of sequences within
non-nuclear organelles such as mitochondria, chloroplasts, and the
like, can be employed as well.
[0140] Naturally, it will be important to employ a promoter and/or
enhancer that effectively directs the expression of the DNA segment
in the cell type, organelle, and organism chosen for expression.
Those of skill in the art of molecular biology generally know how
to use promoters, enhancers, and cell type combinations for protein
expression, for example, see Sambrook et al., 2001, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. The promoters employed may be
constitutive, tissue-specific, inducible, and/or useful under the
appropriate conditions to direct high level expression of the
introduced DNA segment, such as is advantageous in the large-scale
production of recombinant proteins and/or peptides. The promoter
may be heterologous or endogenous.
[0141] A promoter sequence exemplified in the experimental examples
presented herein is the immediate early cytomegalovirus (CMV)
promoter sequence. This promoter sequence is a strong constitutive
promoter sequence capable of driving high levels of expression of
any polynucleotide sequence operatively linked thereto. However,
other constitutive promoter sequences may also be used, including,
but not limited to the simian virus 40 (SV40) early promoter, mouse
mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long
terminal repeat (LTR) promoter, Moloney virus promoter, the avian
leukemia virus promoter, Epstein-Barr virus immediate early
promoter, Rous sarcoma virus promoter, as well as human gene
promoters such as, but not limited to, the actin promoter, the
myosin promoter, the hemoglobin promoter, and the muscle creatine
promoter. Further, the invention should not be limited to the use
of constitutive promoters. Inducible promoters are also
contemplated as part of the invention. The use of an inducible
promoter in the invention provides a molecular switch capable of
turning on expression of the polynucleotide sequence which it is
operatively linked when such expression is desired, or turning off
the expression when expression is not desired. Examples of
inducible promoters include, but are not limited to a
metallothionine promoter, a glucocorticoid promoter, a progesterone
promoter, and a tetracycline promoter. Further, the invention
includes the use of a tissue specific promoter, which promoter is
active only in a desired tissue. Tissue specific promoters are well
known in the art and include, but are not limited to, neuron
specific promoters such as synapsin I, calcium/calmodulin-dependent
protein kinase II, tubulin beta 3, glial fibrillary acidic protein
(GFAP), neuron-specific enolase, and platelet-derived growth factor
beta chain promoters.
[0142] In a particular embodiment, the expression of the nucleic
acid is externally controlled. In a more particular embodiment, the
expression is externally controlled using the doxycycline Tet-On
system.
[0143] The recombinant expression vectors may also contain a
selectable marker gene which facilitates the selection of
transformed or transfected host cells. Suitable selectable marker
genes are genes encoding proteins such as G418 and hygromycin which
confer resistance to certain drugs, .beta.-galactosidase,
chloramphenicol acetyltransferase, firefly luciferase, or an
immunoglobulin or portion thereof such as the Fc portion of an
immunoglobulin preferably IgG. The selectable markers may be
introduced on a separate vector from the nucleic acid of
interest.
[0144] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. Reporter genes that encode for easily
assayable proteins are well known in the art. In general, a
reporter gene is a gene that is not present in or expressed by the
recipient organism or tissue and that encodes a protein whose
expression is manifested by some easily detectable property, e.g.,
enzymatic activity. Expression of the reporter gene is assayed at a
suitable time after the DNA has been introduced into the recipient
cells.
[0145] Suitable reporter genes may include genes encoding
luciferase, beta-galactosidase, chloramphenicol acetyl transferase,
secreted alkaline phosphatase, or the green fluorescent protein
gene (see, e.g., Ui-Tei et al., 2000 FEBS Lett. 479:79-82).
Suitable expression systems are well known and may be prepared
using well known techniques or obtained commercially. Internal
deletion constructs may be generated using unique internal
restriction sites or by partial digestion of non-unique restriction
sites. Constructs may then be transfected into cells that display
high levels of siRNA polynucleotide and/or polypeptide expression.
In general, the construct with the minimal 5' flanking region
showing the highest level of expression of reporter gene is
identified as the promoter. Such promoter regions may be linked to
a reporter gene and used to evaluate agents for the ability to
modulate promoter-driven transcription.
[0146] Recombinant expression vectors may be introduced into host
cells to produce a recombinant cell. The cells can be prokaryotic
or eukaryotic. The vector of the invention can be used to transform
eukaryotic cells such as yeast cells, Saccharomyces cerevisiae, or
mammal cells for example epithelial kidney 293 cells or U2OS cells,
or prokaryotic cells such as bacteria, Escherichia coli or Bacillus
subtilis, for example. Nucleic acid can be introduced into a cell
using conventional techniques such as calcium phosphate or calcium
chloride co-precipitation, DEAE-dextran-mediated transfection,
lipofectin, electroporation or microinjection. Suitable methods for
transforming and transfecting host cells may be found in Sambrook
et al., (2001, Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.), and other
laboratory textbooks. For example, a CHEC peptide may be expressed
in bacterial cells such as E. coli, insect cells (using
baculovirus), yeast cells or mammalian cells. Other suitable host
cells can be found in Goeddel, Gene Expression Technology: Methods
in Enzymology 185, Academic Press, San Diego, Calif. (1991).
III. Pharmaceutical Compositions and Therapies
[0147] Administration of a sPLA2 inhibitor comprising one or more
CHEC peptides, or a variant or derivative thereof, in a method of
treatment can be achieved in a number of different ways, using
methods known in the art. Such methods include, but are not limited
to, providing an exogenous CHEC peptide inhibitor to a subject or
expressing a recombinant CHEC peptide inhibitor expression
cassette.
[0148] The therapeutic and prophylactic methods of the invention
thus encompass the use of pharmaceutical compositions comprising a
sPLA2 inhibitor, preferably a CHEC peptide of the invention or an
isolated nucleic acid encoding a CHEC peptide of the invention to
practice the methods of the invention. The pharmaceutical
compositions useful for practicing the invention may be
administered to deliver a dose of between 1 ng/kg/day and 100
mg/kg/day. In one embodiment, the invention envisions
administration of a dose which results in a concentration of the
compound of the present invention between 1 .mu.M and 10 .mu.M in a
mammal.
[0149] Typically, dosages which may be administered in a method of
the invention to an animal, preferably a human, range in amount
from 0.5 .mu.g to about 50 mg per kilogram of body weight of the
animal. While the precise dosage administered will vary depending
upon any number of factors, including but not limited to, the type
of animal and type of disease state being treated, the age of the
animal and the route of administration. Preferably, the dosage of
the compound will vary from about 1 .mu.g to about 10 mg per
kilogram of body weight of the animal. More preferably, the dosage
will vary from about 3 .mu.g to about 1 mg per kilogram of body
weight of the animal.
[0150] The compound may be administered to an animal as frequently
as several times daily, or it may be administered less frequently,
such as once a day, once a week, once every two weeks, once a
month, or even less frequently, such as once every several months
or even once a year or less. The frequency of the dose will be
readily apparent to the skilled artisan and will depend upon any
number of factors, such as, but not limited to, the type and
severity of the disease being treated, the type and age of the
animal, etc. The formulations of the pharmaceutical compositions
described herein may be prepared by any method known or hereafter
developed in the art of pharmacology. In general, such preparatory
methods include the step of bringing the active ingredient into
association with a carrier or one or more other accessory
ingredients, and then, if necessary or desirable, shaping or
packaging the product into a desired single- or multi-dose
unit.
[0151] Although the description of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for ethical administration to
humans, it will be understood by the skilled artisan that such
compositions are generally suitable for administration to animals
of all sorts. Modification of pharmaceutical compositions suitable
for administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design and
perform such modification with merely ordinary, if any,
experimentation. Subjects to which administration of the
pharmaceutical compositions of the invention is contemplated
include, but are not limited to, humans and other primates, mammals
including commercially relevant mammals such as non-human primates,
cattle, pigs, horses, sheep, cats, and dogs.
[0152] Pharmaceutical compositions that are useful in the methods
of the invention may be prepared, packaged, or sold in formulations
suitable for ophthalmic, oral, parenteral, buccal, or another route
of administration. Other contemplated formulations include
projected nanoparticles, liposomal preparations, resealed
erythrocytes containing the active ingredient, and
immunologically-based formulations.
[0153] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in bulk, as a single unit dose, or as a
plurality of single unit doses. As used herein, a "unit dose" is
discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the
active ingredient is generally equal to the dosage of the active
ingredient which would be administered to a subject or a convenient
fraction of such a dosage such as, for example, one-half or
one-third of such a dosage.
[0154] The relative amounts of the active ingredient, the
pharmaceutically acceptable carrier, and any additional ingredients
in a pharmaceutical composition of the invention will vary,
depending upon the identity, size, and condition of the subject
treated and further depending upon the route by which the
composition is to be administered. By way of example, the
composition may comprise between 0.1% and 100% (w/w) active
ingredient.
[0155] In addition to the active ingredient, a pharmaceutical
composition of the invention may further comprise one or more
additional pharmaceutically active agents useful in the treatment
of epilepsy as well as other neurological diseases and disorders.
By way of a non-limiting example, active agents useful in the
treatment of epilepsy are well known in the art. Anticonvulsants
compounds include, but are not limited to, carbamazepine (common US
brand name Tegretol), clorazepate (Tranxene), clonazepam
(Klonopin), ethosuximide (Zarontin), felbamate (Felbatol),
fosphenytoin (Cerebyx), gabapentin (Neurontin), lacosamide
(Vimpat), lamotrigine (Lamictal), levetiracetam (Keppra),
oxcarbazepine (Trileptal), phenobarbital (Luminal), phenytoin
(Dilantin), pregabalin (Lyrica), primidone (Mysoline), tiagabine
(Gabitril), topiramate (Topamax), valproate semisodium (Depakote),
valproic acid (Depakene), and zonisamide (Zonegran), clobazam
(Frisium) and vigabatrin (Sabril), retigabine, brivaracetam, and
seletracetam, diazepam (Valium, Diastat) and lorazepam (Ativan),
paraldehyde (Paral), midazolam (Versed), and pentobarbital
(Nembutal), acetazolamide (Diamox), progesterone,
adrenocorticotropic hormone (ACTH, Acthar), various corticotropic
steroid hormones (prednisone), or bromide. Anxiolytics include, but
are not limited to, benzodiazepines, such as Alprazolam,
Chlordiazepoxide, Clonazepam, Diazepam, Lorazepam; 5-HT receptor
agonists, such as azapirones, barbiturates, hydroxyzine,
beta-blockers such as propranolol and oxprenolol.
[0156] In another embodiment, in addition to the active ingredient,
a pharmaceutical composition of the invention may further comprise
one or more additional pharmaceutically active agents useful in the
treatment of atherosclerosis as well as other cardiovascular
diseases and disorders. By way of a non-limiting example, active
agents useful in the treatment of atherosclerosis are well known in
the art and include include, but are not limited to, lipid-lowering
compounds, such as statins and niacin, which reduce blood levels of
fats such as cholesterol and triglycerides, and antithrombotic
drugs, including warfarin, low-dose aspirin, and clopidogrel, which
prevent further plaque accumulation, mitigate injuries from blood
clots caused by atherosclerosis, and treat heart disease.
[0157] Controlled- or sustained-release formulations of a
pharmaceutical composition of the invention may be made using
conventional technology.
[0158] As used herein, "parenteral administration" of a
pharmaceutical composition includes any route of administration
characterized by physical breaching of a tissue of a subject and
administration of the pharmaceutical composition through the breach
in the tissue. Parenteral administration thus includes, but is not
limited to, administration of a pharmaceutical composition by
injection of the composition, by application of the composition
through a surgical incision, by application of the composition
through a tissue-penetrating non-surgical wound, and the like. In
particular, parenteral administration is contemplated to include,
but is not limited to, intraocular, intravitreal, subcutaneous,
intraperitoneal, intramuscular, intrasternal injection,
intratumoral, and kidney dialytic infusion techniques.
[0159] Formulations of a pharmaceutical composition suitable for
parenteral administration comprise the active ingredient combined
with a pharmaceutically acceptable carrier, such as sterile water
or sterile isotonic saline. Such formulations may be prepared,
packaged, or sold in a form suitable for bolus administration or
for continuous administration. Injectable formulations may be
prepared, packaged, or sold in unit dosage form, such as in ampules
or in multi-dose containers containing a preservative. Formulations
for parenteral administration include, but are not limited to,
suspensions, solutions, emulsions in oily or aqueous vehicles,
pastes, and implantable sustained-release or biodegradable
formulations. Such formulations may further comprise one or more
additional ingredients including, but not limited to, suspending,
stabilizing, or dispersing agents. In one embodiment of a
formulation for parenteral administration, the active ingredient is
provided in dry (i.e. powder or granular) form for reconstitution
with a suitable vehicle (e.g. sterile pyrogen-free water) prior to
parenteral administration of the reconstituted composition.
[0160] The pharmaceutical compositions may be prepared, packaged,
or sold in the form of a sterile injectable aqueous or oily
suspension or solution. This suspension or solution may be
formulated according to the known art, and may comprise, in
addition to the active ingredient, additional ingredients such as
the dispersing agents, wetting agents, or suspending agents
described herein. Such sterile injectable formulations may be
prepared using a non-toxic parenterally-acceptable diluent or
solvent, such as water or 1,3-butane diol, for example. Other
acceptable diluents and solvents include, but are not limited to,
Ringer's solution, isotonic sodium chloride solution, and fixed
oils such as synthetic mono- or di-glycerides. Other
parentally-administrable formulations which are useful include
those which comprise the active ingredient in microcrystalline
form, in a liposomal preparation, or as a component of a
biodegradable polymer systems. Compositions for sustained release
or implantation may comprise pharmaceutically acceptable polymeric
or hydrophobic materials such as an emulsion, an ion exchange
resin, a sparingly soluble polymer, or a sparingly soluble
salt.
[0161] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for buccal
administration. Such formulations may, for example, be in the form
of tablets or lozenges made using conventional methods, and may,
for example, 0.1 to 20% (w/w) active ingredient, the balance
comprising an orally dissolvable or degradable composition and,
optionally, one or more of the additional ingredients described
herein. Alternately, formulations suitable for buccal
administration may comprise a powder or an aerosolized or atomized
solution or suspension comprising the active ingredient. Such
powdered, aerosolized, or aerosolized formulations, when dispersed,
preferably have an average particle or droplet size in the range
from about 0.1 to about 200 nanometers, and may further comprise
one or more of the additional ingredients described herein.
[0162] As used herein, "additional ingredients" include, but are
not limited to, one or more of the following: excipients; surface
active agents; dispersing agents; inert diluents; granulating and
disintegrating agents; binding agents; lubricating agents;
sweetening agents; flavoring agents; coloring agents;
preservatives; physiologically degradable compositions such as
gelatin; aqueous vehicles and solvents; oily vehicles and solvents;
suspending agents; dispersing or wetting agents; emulsifying
agents, demulcents; buffers; salts; thickening agents; fillers;
emulsifying agents; antioxidants; antibiotics; antifungal agents;
stabilizing agents; and pharmaceutically acceptable polymeric or
hydrophobic materials. Other "additional ingredients" which may be
included in the pharmaceutical compositions of the invention are
known in the art and described, for example in Remington's
Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co.,
Easton, Pa.), which is incorporated herein by reference.
IV. Kits
[0163] The invention also includes a kit comprising a sPLA2
inhibitor of the invention and an instructional material which
describes, for instance, administering the sPLA2 inhibitor to a
subject as a prophylactic or therapeutic treatment or a
non-treatment use as described elsewhere herein. A preferred sPLA2
inhibitor is a CHEC peptide, including CHEC-9, CHEC-7, or a
derivative or variant, thereof In an embodiment, this kit further
comprises a (preferably sterile) pharmaceutically acceptable
carrier suitable for dissolving or suspending the therapeutic
composition, comprising a sPLA2 inhibitor, or a combination thereof
of the invention, for instance, prior to administering the molecule
to a subject. Optionally, the kit comprises an applicator for
administering the inhibitor.
[0164] A kit providing a nucleic acid encoding a peptide or
antibody of the invention and an instructional material is also
provided.
EXPERIMENTAL EXAMPLES
[0165] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0166] The materials and methods employed in the experiments
disclosed herein are now described.
Synthesis of Peptides
[0167] Peptide synthesis was performed at the Protein Chemistry
Laboratory in the Department of Pathology and Laboratory Medicine
University of Pennsylvania as well as by Celtek Bioscience
(Nashville, Tenn.). The peptides were HPLC purified on a C18
column, dried, reconstituted in water and dried again. Peptide
stock solutions (200-250 .mu.g/ml, 218-273 .mu.M) were prepared in
50 mM tris pH=7.4 or DMEM and incubated at room temperature
overnight or for 2 hrs at 37.degree.. Free sulphydryls were
measured using Ellman's reagent (DTNB, 0.04 mg/ml) in 0.1M
NaH.sub.2PO.sub.4, 20 mM EDTA, pH=8 by mixing 25 .mu.l sample with
275 .mu.l reaction buffer. Absorbance of these samples was measured
at 450 nm with a 808-x1 microplate reader (Biotek Instruments), and
was at background levels after cross-linking. In addition, the
formation of intramolecular disulphide bond in selected samples was
verified by determining the exact molecular mass of the unfolded
versus folded peptides using electrospray mass spectrometry (LC-ZQ
Mass Spectrometer, Waters).
Kainic Acid Seizure Model
[0168] Kainic acid (KA) was administered intraperitoneal (IP) to
rats at doses ranging from 5-10 mg/kg. Rats age postnatal day (P)
12-15 were administered 2 mg/kg KA. Rats age P35-40 were
administered 6 mg/kg KA. The KA was delivered in a constant volume
of phosphate buffer (5 ml/kg) and reliably produced motor seizure
activity.
[0169] Following IP administration of KA, rats were video-recorded
for 3 hours, and then daily for 3 hours. The video recordings are
later scored blind. The severity and latency of seizures is graded
for P35 rats by a classical scale shown in Table 1 (Racine, 1972,
Electroencephalog. Clin. Neurophysiol. 32:281-294).
[0170] For younger rats (P12-15), the less severe motor seizure
stages consist of scratching-like movements of the hind paws and
"wet dog shakes." Increased seizure severity in P12-15 rats
includes clonic (and sometimes tonico-clonic) seizures involving
movements of all four paws and associated with head tremor. While
severe, these seizures do not usually evolve into status
epilepticus.
TABLE-US-00001 TABLE 1 Scale fro grading seizures in rats aged P
35-40. Stage Characteristic motor activity 1 hypoactivity, mouth
and facial automatism 2 head nodding and mastication 3 forelimb
clonus without rearing 4 bilateral forelimb clonus and rearing 5
rearing and loss of posture Status stage 4-5 lasting for 30 min.
epilepticus
[0171] Rats (250-300 g) are done in pairs and administered either a
control peptide/vehicle or CHEC peptide in vehicle at various
intervals pre- or post KA treatment. The route of administration is
either oral or subcutaneous, as indicated in the figure legends.
Control or CHEC peptide are administered either 4, 2 or 0.5 hours
pre-KA or 0.25, and 0.5 hrs post-KA. The effects of CHEC-7 and
CHEC-9 are compared because the peptides have different
pharmakinetic profiles in rat.
Histology
[0172] Following behavioral studies, all rats are deeply
anesthetized and perfused transcardially with 4% paraformaldehyde
in 0.1M phosphate buffer. Brains are removed and sectioned serially
at 20 .mu.m on a cryostat and stained using standard histological
techniques. Brain tissue sections are stained with cresyl violet to
analyze brain tissue integrity, or stained for the cell specific
markers for macrophages/microglia (ED-1) neuronal tubulin (TUJ1),
neuronal nuclei (neuN) or neurofilament (NFm) to demonstrate the
accumulation of macrophages and microglia.
[0173] The results of the experiments presented in this Example are
now described.
EXPERIMENTAL EXAMPLE 1
Effect of CHEC-9 on KA Induced Motor Seizures in Rats
[0174] Male (M; n=8) and female (F; n=6) rats (250-300 g) were
administered KA at the dosages shown in Table 2. Forty minutes
prior to KA administration, the rats were administered either
control peptide or CHEC-9 at the indicated dosages and routes of
administration. The resulting motor seizures were graded as
described elsewhere herein. Rats that were given vehicle control
were more likely to exhibit severe motor seizures than rats that
were administered CHEC-9. In one set of experiments, rats were
pre-fed lecithin or phosphatidylcholine prior to administering the
KA.
TABLE-US-00002 TABLE 2 C9 Dose KA Max Rat mg/kg- mg/kg Seizure no.
Gender route ip Stage** K F V 5 Stat Ep L F 0.5-sc 5 1 M M 0.5-sc 5
1 N M V 5 Stat Ep O M V 6 Died P M 0.5-sc 6 2 S M 1.0 po 5 1 T M V
5 1 U M 1.0 po 10 1 V M V 10 Stat Ep W F 1.0 po 10 3 X F V 10 Stat
Ep Y F V 10 4
EXPERIMENTAL EXAMPLE 2
Effect of CHEC-9 on Multiunit Activity in Hippocampus in Kainic
Acid Treated Rats
[0175] Rats were implanted with a multichannel electrode bundle
placed in the CA1 cell field of the hippocampus one week prior to
the experiment. Baseline hippocampal neuronal activity (impulses
per second) was collected during a 30 minute control period. After
30 minutes of baseline neuronal activity was collected, either
CHEC-9 (1 mg/kg) or vehicle was administered orally 40 min prior to
IP administration of kainic acid (10 mg/kg). The duration of the KA
administration varied. Neuronal activity in response to KA
administration is presented as % of baseline activity (FIG. 1). KA
reliably enhanced neuronal activity in a dose-dependent manner in
animals that were treated with vehicle. Animals that were treated
with CHEC-9 exhibit a much smaller effect of KA on neuronal
activity. The vehicle treated rat reached status epilepticus by the
end of the experiment, while the peptide treated rat showed no
obvious symptoms.
EXPERIMENTAL EXAMPLE 3
Plasma and Urinary sPLA2 Activity Following Seizure in Humans
[0176] Serum or urinary sPLA2 levels are expected to be elevated
following seizure activity for a limited time. In order to identify
this clinical window when patients are vulnerable to secondary
seizure, two patient groups of 25 patients each are assessed for
sPLA2 activity in urine and serum. Group 1 comprises "acute
patients" patients who had a seizure less than 7 days prior to
measurements. Group 2 comprises "stable patients" who had a seizure
more than 7days prior to measurements.
[0177] All subjects are screened for and excluded based on the
presence of inflammatory disorders or potential inflammatory
disorders, unrelated to their epilepsy. These include asthma, heart
disease, peripheral autoimmune disorders, infections, or any other
disorder suspected to have a significant inflammatory component
(e.g. diabetes, cystic fibrosis, persistent chronic allergies).
Patients that are obese (defined as BMI>95th centile of the 1990
reference data for age and sex) are excluded as are those that have
been treated with steroidal or non-steroidal anti-inflammatory
drugs in the 24hours prior to assessment or who have exercised
vigorously in the 18 hours prior to assessment, e.g. sporting
events, distance runs. In previous studies, these screening
procedures resulted in a relatively stable baseline for sPLA2
activity in control subjects.
[0178] Patients are also excluded with seizure disorders that have
inflammatory or potential inflammatory etiologies since the
inflammation accompanying the seizure would not be easily
differentiated from that due to the underlying disorder. For
example, patients who have febrile seizures or Rasmussen's
encephalitis are excluded, as well as patients whose seizures are
associated with diseases that have a strong inflammatory component.
Patients that have seizures that may be due to CNS tumors are not
included.
[0179] During this study, a significant percentage (>50%) of
samples are collected from patients that represent the extremes of
acute and stable population,s i.e. less than 48 hours and greater
than 6 months since last seizure. This bias maximizes the
difference in enzyme activity and levels of endogenous
mediators.
[0180] Excreted fragments of neuron/CNS-specific proteins,
including neurofilament protein (NF med), are measured either by
ELISA or Western blotting in urine or serum samples collected from
both acute and stable patients. It was found that NF med could be
detected in the urine of a significant percentage of patients with
multiple sclerosis compared with healthy controls, suggesting NF
med is a biomarker for neural damage (FIG. 2). Sections were also
immunostained for phosphorylated neurofilament (Sm-32, another
marker for neuronal injury), myelin basic protein (MBP), and
proteolipid protein (PLP). MBP and PLP identify CNS myelin epitopes
and MBP and glycoprotein Po for PNS myelin. These antibodies can be
applied to either urine or serum but the blots of the latter are
contaminated with large excesses of serum proteins such as albumin
or immunoglobulins, making the interpretation of the blots or ELISA
assays more difficult. Urine is straightforward after specific
proteolytic fragments of these proteins have been identified and
confirmed. Changes in levels of neuronal markers, specifically
those appearing under conditions of elevated sPLA2 activity after
seizures, are measured to obtain an estimate of neuronal
degeneration accompanying a seizure.
[0181] Urine samples are prepared and stored at -80.degree. C.
until analyzed. Samples are coded at the hospital and securely
stored with all relevant clinical details. These coded samples are
analyzed for sPLA2 activity, lipid mediators, and dialyzed for
whole band analysis of Western blots of specific protein fragments
as described above. All analyses are conducted blind without
patient identifiers or any knowledge of clinical history.
[0182] Measurements of sPLA2 activity in plasma and urine in the
acute patient group are compared to measurements made for the
stable patient group using a non-parametric statistical test (Mann
Whitney U). Variables such as seizure frequency, age, elapsed time
since last seizure, and seizure medication present at the time of
the seizure are tested for association with sPLA2 activity using a
statistical test such as Spearman rank correlations.
[0183] The principal goal in the development of anti-epilepsy drugs
(AEDs) has been to control hyperexcitability. It is only during the
last few years that the inflammatory component of the disease has
been recognized, a fact that has not significantly impacted
pharmacotherapy or drug development. Interestingly, ACTH and
corticosteroids have traditionally been considered an alternative
therapy for epilepsy, especially for intractable childhood
seizures. Their mechanism of action is unknown. In the proposed
study, the subjects are likely to be treated with one or more the
currently available anti-seizure medications, so possible effects
on the inflammatory response and cell death must be considered.
Some AEDs may exaggerate these responses, other are inhibitory. In
still other cases, anti-inflammatory effects are suspected but have
not been proved (e.g., compounds providing a non-opiate analgesia
are more likely to have an anti-inflammatory action). It is
recognized that attenuating elevated electrical activity is likely
to have neuroprotective effects, especially in the long term.
Unfortunately, the data concerning the systemic cytokine response
to AEDs in humans is diverse and often contradictory. Since
medications can be a significant variable, a list of all
medications that a patient is being administered is also compiled.
sPLA2 activity is then compared between a patient group identified
as taking a particular medication and a patient group identified as
not taking that particular medication using a Mann-Whitney U
statistical test.
[0184] Parameters significantly associated with sPLA2
(P.ltoreq.0.10), are verified for independent predictive value of
the initial classification (acute versus stable patient) with a
multivariate statistical procedure, namely multiple linear
regression.
[0185] These data provide the general timing of systemic sPLA2
activity changes in relation to the time elapsed since the latest
seizure. In an additional study, the period for systemic
inflammatory response to seizures is determined by following acute
patients longitudinally. The period of sPLA2 elevation (relative to
stable patients) represents the period of maximum vulnerability to
seizure-induce inflammatory destruction of CNS tissue, presumably
instigated by inflammatory mediators and cellular participants in
the immune response. Blots of neuronal protein fragments in urine
and serum obtained from patients suggest this neuronal
vulnerability.
[0186] Longitudinal data from patients is collected to determine
the length of time patients show elevated activity of inflammatory
mediators relative to the frequency and duration of their seizures.
For example, urinary sPLA2 activity (pM/min/mg total protein) is
compared to seizure magnitude=(estimated number of
seizures).times.(average seizure duration). These data identify a
clinical window during which the CNS is vulnerable to subsequent
seizure as well as damage from inflammatory processes that results
from seizure. During this time, the administration of CHEC peptides
or nucleic acids encoding CHEC peptides can prevent subsequent
seizure or CNS damage.
EXPERIMENTAL EXAMPLE 4
CHEC Peptide Inhibits Atherosclerotic Plaques in JCR:-cp Rat
[0187] As shown in FIG. 3, sPLA2 is an important component at
several stages of the biochemical cascade that leads to plaque
formation on vessel walls. To begin with, sPLA2s modify lipoprotein
particles to prolong their residence time in the circulation and
increase penetration into the sub endothelial space (Karabina et
al., 2006, FASEB J. 20:2547-2549; Sartipy et al., 1999, J. Biol.
Chem. 274:25913-25920; Wooten-Kee et al., 2004, Arterioscler.
Thromb. Vasc. Biol. 24:762-767). The remodeling of LDL in the
vessel intimae leads to aggregate formation, attack of the
aggregates by macrophages, and foam cell formation, the latter
facilitated by sPLA2-enhanced cholesterol loading of the cells. The
macrophage response and subsequent inflammatory cascade are also
sPLA2 dependent, and this continuing process exacerbates the lesion
further by increasing plaque size and stimulating collagen
deposition (Wooten-Kee et al,, 2004, Arterioscler. Thromb. Vase,
Biol. 24:762-767; Ivandic et al., 1999, Arterioscler. Thromb. Vasc.
Biol. 19:1284-1290; Ghesquiere et al., 2005, J. Lipid Res.
46:201-210). The CHEC peptides are active in several in vivo models
rats and humans (ex vivo) but were less active in mice, which,
unlike rats and humans, do not have the gene for the parent
polypeptide. Therefore, a suitable and highly reliable rat
metabolic model was chosen to test CHEC efficacy for reducing
atherosclerotic lesions and myocardial infarction.
[0188] The JCR:LA-cp rat is one of a number of strains
incorporating the autosomal recessive cp gene. Homozygous cp
(cp/cp) rats are obese from an early age, are insulin resistant,
and are hyperinsulinemic. They exhibit a marked hyperlipidemia due
to hepatic hypersecretion of VLDL. Males also exhibit spontaneous
atherosclerosis and ischemic myocardial lesions.
Anti-atherosclerotic treatments have been successfully tested in
this model (e.g. see O'Brien et al., 2000, Clin Invest Med.
23:124-31; Russell et al., 1998, J. Cardiovasc. Pharmacol.
31:971-977; Russell et al., 1995, Arterioscler Thromb Vasc Biol.
15:918-23).
[0189] The incidence of atherosclerotic lesions on the aortic arch
and of ischemic myocardial lesions in treated and control rats is
scored by expert pathological services. The influence of sPLA2
inhibition on specific metabolic parameters such as hyperlipemdemia
is tested. These measurements are made starting at 12 weeks and
extend to 39 weeks of age. The treatment paradigms comprise daily
dosing with CHEC peptides by mouth or gavage for several weeks.
During this period, systemic sPLA2 levels and the effects of CHEC
peptides on these levels are monitored. In addition, relevant
clinical parameters are also monitored such as weight, insulin
resistance, insulin levels, and circulating lipid levels. CHEC
peptides are administered during overnight watering, as
described.
[0190] A significant reduction in atherosclerosis related
pathologies obtained in an experimentally blinded pathological and
blood chemistry analysis suggests that the CHEC peptides are
effective therapeutic agents for the treatment of heart disease,
vascular disease, and stroke.
[0191] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety.
[0192] While the invention has been disclosed with reference to
specific embodiments, it is apparent that other embodiments and
variations of this invention may be devised by others skilled in
the art without departing from the true spirit and scope of the
invention. The appended claims are intended to be construed to
include all such embodiments and equivalent variations.
Sequence CWU 1
1
719PRTArtificial SequenceChemically synthesized 1Cys His Glu Ala
Ser Ala Ala Gln Cys 1 5 29PRTArtificial SequenceChemically
synthesized 2Cys Ala His Ala Gln Ala Glu Ser Cys 1 5
37PRTArtificial SequenceChemically synthesized 3Cys His Glu Ala Ser
Gln Cys 1 5 427DNAArtificial SequenceChemically synthesized
4tgccatgaag catcagcagc tcaatgc 27527DNAArtificial
SequenceChemically synthesized 5tgccatgaag catcagcagc tcaatgt
27621DNAArtificial SequenceChemically synthesized 6tgccatgaag
catcacaatg c 21721DNAArtificial SequenceChemically synthesized
7tgccatgaag catcacaatg t 21
* * * * *