U.S. patent application number 15/024648 was filed with the patent office on 2016-12-08 for compositions and formulations for increasing renal function and treatment and prevention of renal diseases, and methods of production and use thereof.
The applicant listed for this patent is PRONUTRIA Biosciences, Inc.. Invention is credited to David Arthur BERRY, Andrew DOWNEY, David V. ERBE, Michael J. HAMILL, Nathaniel W. SILVER, Alison WILLIAMS.
Application Number | 20160354436 15/024648 |
Document ID | / |
Family ID | 52744707 |
Filed Date | 2016-12-08 |
United States Patent
Application |
20160354436 |
Kind Code |
A1 |
WILLIAMS; Alison ; et
al. |
December 8, 2016 |
Compositions and Formulations for Increasing Renal Function and
Treatment and Prevention of Renal Diseases, and Methods of
Production and Use Thereof
Abstract
Nutritive polypeptides are provided herein. Also provided are
various other embodiments including nucleic acids encoding the
polypeptides, recombinant microorganisms that make the
polypeptides, vectors for expressing the polypeptides, methods of
making the polypeptides using recombinant microorganisms,
compositions and formulations that comprise the polypeptides, and
methods of using the polypeptides, compositions and
formulations.
Inventors: |
WILLIAMS; Alison;
(Cambridge, MA) ; SILVER; Nathaniel W.;
(Cambridge, MA) ; DOWNEY; Andrew; (Lowell, MA)
; ERBE; David V.; (Arlington, MA) ; HAMILL;
Michael J.; (Wellesley, MA) ; BERRY; David
Arthur; (Brookline, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PRONUTRIA Biosciences, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
52744707 |
Appl. No.: |
15/024648 |
Filed: |
September 25, 2014 |
PCT Filed: |
September 25, 2014 |
PCT NO: |
PCT/US2014/057546 |
371 Date: |
March 24, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61906862 |
Nov 20, 2013 |
|
|
|
61882305 |
Sep 25, 2013 |
|
|
|
61882295 |
Sep 25, 2013 |
|
|
|
61882300 |
Sep 25, 2013 |
|
|
|
61882222 |
Sep 25, 2013 |
|
|
|
61882212 |
Sep 25, 2013 |
|
|
|
61882198 |
Sep 25, 2013 |
|
|
|
61882189 |
Sep 25, 2013 |
|
|
|
61882180 |
Sep 25, 2013 |
|
|
|
61882274 |
Sep 25, 2013 |
|
|
|
61882271 |
Sep 25, 2013 |
|
|
|
61882267 |
Sep 25, 2013 |
|
|
|
61882264 |
Sep 25, 2013 |
|
|
|
61882260 |
Sep 25, 2013 |
|
|
|
61882254 |
Sep 25, 2013 |
|
|
|
61882250 |
Sep 25, 2013 |
|
|
|
61882246 |
Sep 25, 2013 |
|
|
|
61882243 |
Sep 25, 2013 |
|
|
|
61882129 |
Sep 25, 2013 |
|
|
|
61882240 |
Sep 25, 2013 |
|
|
|
61882235 |
Sep 25, 2013 |
|
|
|
61882234 |
Sep 25, 2013 |
|
|
|
61882232 |
Sep 25, 2013 |
|
|
|
61882229 |
Sep 25, 2013 |
|
|
|
61882225 |
Sep 25, 2013 |
|
|
|
61882220 |
Sep 25, 2013 |
|
|
|
61882219 |
Sep 25, 2013 |
|
|
|
61882214 |
Sep 25, 2013 |
|
|
|
61882211 |
Sep 25, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/168 20130101;
C12Y 207/04003 20130101; A61P 3/02 20180101; G01N 33/6803 20130101;
A61P 35/00 20180101; A61P 21/06 20180101; G01N 33/6848 20130101;
A61P 31/18 20180101; A61P 37/00 20180101; A61K 38/16 20130101; A61K
38/164 20130101; A23L 33/18 20160801; A23L 2/66 20130101; A23V
2002/00 20130101; A61K 9/2054 20130101; A61K 38/1709 20130101; A61P
3/04 20180101; A61P 43/00 20180101; A23L 33/195 20160801; A61K
38/45 20130101; A61P 21/00 20180101; A61K 45/06 20130101; A23L
33/175 20160801; A23L 33/30 20160801; A61K 9/0053 20130101; A61K
38/38 20130101; G01N 33/6806 20130101; A61P 9/10 20180101; A61P
19/10 20180101; A61P 35/02 20180101; A61K 9/0095 20130101; A61K
38/1767 20130101; A61K 9/146 20130101; A61P 31/06 20180101; G01N
2500/00 20130101; A61K 38/00 20130101; A61P 29/00 20180101; A61P
31/14 20180101; G16B 20/00 20190201; A61K 9/2866 20130101; A61K
38/10 20130101; A61K 38/17 20130101; A61K 38/1703 20130101; A61P
37/06 20180101; A23L 33/40 20160801; A61P 3/10 20180101; A61P 35/04
20180101; A23L 33/17 20160801; A61K 9/0075 20130101; A61P 1/16
20180101 |
International
Class: |
A61K 38/17 20060101
A61K038/17; A23L 33/18 20060101 A23L033/18; A23L 33/00 20060101
A23L033/00; A61K 38/16 20060101 A61K038/16; A23L 2/66 20060101
A23L002/66 |
Claims
1.-44. (canceled)
45. A nutritive formulation for the treatment or prevention of a
muscle wasting disease, disorder or condition in a human subject
suffering from a renal disease, comprising an isolated nutritive
polypeptide comprising an amino acid sequence at least about 90%
identical over at least about 50 amino acids to a polypeptide
sequence selected from the group consisting of SEQID 00001-03909;
wherein the nutritive polypeptide is present in an amount
sufficient to provide a nutritional benefit to a human subject
having or at risk of having reduced protein absorption capacity;
wherein the isolated nutritive polypeptide has an aqueous
solubility at pH 7 of at least 12.5 g/L and wherein the isolated
nutritive polypeptide has a simulated gastric digestion half-life
of less than 30 minutes.
46. The formulation of claim 45, wherein the polypeptide sequence
comprises a ratio of essential amino acid residues to total amino
acid residues of at least 34% and wherein the polypeptide sequence
is nutritionally complete.
47. The formulation of claim 45, wherein the nutritive polypeptide
is formulated in a pharmaceutically acceptable carrier, or wherein
the nutritive polypeptide is formulated in or as a food or a food
ingredient; or wherein the nutritive polypeptide is formulated in
or as a beverage or a beverage ingredient.
48. The formulation of claim 45, wherein the amino acid sequence
encodes an enzyme having a primary activity, and wherein the
nutritive polypeptide substantially lacks the primary activity.
49. The formulation of claim 45, further comprising a component
selected from a tastant, a protein mixture, a polypeptide, a
peptide, a free amino acid, a carbohydrate, a lipid, a mineral or
mineral source, a vitamin, a supplement, an organism, a
pharmaceutical, and an excipient.
50. The formulation of claim 45, wherein the formulation is present
as a liquid, semi-liquid or gel in a volume not greater than about
500 ml or as a solid or semi-solid in a total mass not greater than
about 200 g.
51.-64. (canceled)
65. A method of treating or reducing the severity of a renal
disease in a human subject, comprising administering to the human
subject a nutritional formulation in an amount sufficient to treat
or prevent the renal disease, wherein the nutritional formulation
comprises an isolated nutritive polypeptide comprising an amino
acid sequence at least about 90% identical over at least about 50
amino acids to a polypeptide sequence selected from the group
consisting of SEQID 00001-03909.
66. The method of claim 65, wherein the isolated nutritive
polypeptide has an aqueous solubility at pH 7 of at least 12.5, 20,
30, 50, or 100 g/L.
67. The method of claim 65, wherein the isolated nutritive
polypeptide has a simulated gastric digestion half-life of less
than 2, 10, 30, or 60 minutes.
68. The method of claim 65, wherein the isolated nutritive
polypeptide does not form insoluble aggregates at 95.degree. C., pH
7.1, when present at 10 mg/ml.
69. The method of claim 65, wherein the formulation further
comprises a pharmaceutically acceptable carrier.
70. The method of claim 65, wherein the formulation is present as a
liquid, semi-liquid or gel in a volume not greater than about 500
ml or as a solid or semi-solid in a total mass not greater than
about 200 g; and wherein the formulation is substantially free of
non-comestible products.
71. The method of claim 65, wherein the formulation further
comprises a component selected from a tastant, a protein mixture, a
polypeptide, a peptide, a free amino acid, a carbohydrate, a lipid,
a mineral or mineral source, a vitamin, a supplement, an organism,
a pharmaceutical, and an excipient.
72. The method of claim 65, wherein the human subject is at risk of
developing malnutrition or protein malnutrition.
73. The method of claim 65, wherein the human subject has chronic
renal failure, acute renal failure, glomerulonephritis,
glomerulonephrosis, tubular nephritis, interstitial nephritis, or
nephrotic syndrome.
74. The method of claim 65, wherein the human subject has end-stage
renal disease or a nephrotic syndrome.
75. The method of claim 65, wherein the human subject has a urea
cycle disorder.
76. The method of claim 65, wherein the human subject suffers from
a muscle wasting condition.
77. The method of claim 65, wherein the nutritional formulation is
administered as an adjunct to administration of a pharmaceutical
composition.
78. The method of claim 65, wherein the human subject is suffering
from a renal disease and has received one or more doses of a
pharmaceutical composition, wherein i) the disease, disorder or
condition or ii) the administration of the pharmaceutical
composition, or both i) and ii) increases a risk of loss of muscle
mass and/or muscle function.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/882,211, filed Sep. 25, 2013, 61/882,214, filed
Sep. 25, 2013, 61/882,219, filed Sep. 25, 2013, 61/882,220, filed
Sep. 25, 2013, 61/882,225, filed Sep. 25, 2013, 61/882,229, filed
Sep. 25, 2013, 61/882,232, filed Sep. 25, 2013, 61/882,234, filed
Sep. 25, 2013, 61/882,235, filed Sep. 25, 2013, 61/882,240, filed
Sep. 25, 2013, 61/882,129, filed Sep. 25, 2013, 61/882,243, filed
Sep. 25, 2013, 61/882,246, filed Sep. 25, 2013, 61/882,250, filed
Sep. 25, 2013, 61/882,254, filed Sep. 25, 2013, 61/882,260, filed
Sep. 25, 2013, 61/882,264, filed Sep. 25, 2013, 61/882,267, filed
Sep. 25, 2013, 61/882,271, filed Sep. 25, 2013, 61/882,274, filed
Sep. 25, 2013, 61/882,180, filed Sep. 25, 2013, 61/882,189, filed
Sep. 25, 2013, 61/882,198, filed Sep. 25, 2013, 61/882,212, filed
Sep. 25, 2013, 61/882,222, filed Sep. 25, 2013, 61/882,300, filed
Sep. 25, 2013, 61/882,295, filed Sep. 25, 2013, and 61/882,305,
filed Sep. 25, 2013; the entire disclosures of which are hereby
incorporated by reference in their entirety for all purposes.
BACKGROUND
[0002] Dietary protein is an essential nutrient for human health
and growth. The World Health Organization recommends that dietary
protein should contribute approximately 10 to 15% of energy intake
when in energy balance and weight stable. Average daily protein
intakes in various countries indicate that these recommendations
are consistent with the amount of protein being consumed worldwide.
Meals with an average of 20 to 30% of energy from protein are
representative of high-protein diets when consumed in energy
balance. The body cannot synthesize certain amino acids that are
necessary for health and growth, and instead must obtain them from
food. These amino acids, called "essential amino acids", are
Histidine (H), Isoleucine (I), Leucine (L), Lysine (K), Methionine
(M), Phenylalanine (F), Threonine (T), Tryptophan (W), and Valine
(V). Dietary protein sources that provide all the essential amino
acids are referred to as "high quality" proteins. Animal foods such
as meat, fish, poultry, eggs, and dairy products are generally
regarded as high quality protein sources that provide a good
balance of essential amino acids. Casein (a protein commonly found
in mammalian milk, making up 80% of the proteins in cow milk) and
whey (the protein in the liquid that remains after milk has been
curdled and strained) are major sources of high quality dietary
protein. Foods that do not provide a good balance of essential
amino acids are referred to as "low quality" protein sources. Most
fruits and vegetables are poor sources of protein. Some plant foods
including beans, peas, lentils, nuts and grains (such as wheat) are
better sources of protein but may have allergenicity issues. Soy, a
vegetable protein manufactured from soybeans, is considered by some
to be a high quality protein. Studies of high protein diets for
weight loss have shown that protein positively affects energy
expenditure and lean body mass. Further studies have shown that
overeating produces significantly less weight gain in diets
containing at least 5% of energy from protein, and that a
high-protein diet decreases energy intake. Proteins commonly found
in foods do not necessarily provide an amino acid composition that
meets the amino acid requirements of a mammal, such as a human, in
an efficient manner. The result is that, in order to attain the
minimal requirements of each essential amino acid, a larger amount
of total protein must be consumed in the diet than would be
required if the quality of the dietary protein were higher. By
increasing the quality of the protein in the diet it is possible to
reduce the total amount of protein that must be consumed compared
to diets that include lower quality proteins. Traditionally,
desirable mixtures of amino acids, such as mixtures comprising
essential amino acids, have been provided by hydrolyzing a protein
with relatively high levels of essential amino acids, such as whey
protein, and/or by combining free amino acids in a mixture that
optionally also includes a hydrolyzed protein such as whey.
Mixtures of this type may have a bitter taste, undesirable
mouthfeel and are poorly soluble, and may be deemed unsuitable or
undesirable for certain uses. As a result, such mixtures sometimes
include flavoring agents to mask the taste of the free amino acids
and/or hydrolyzed protein. In some cases compositions in which a
proportion of the amino acid content is provided by polypeptides or
proteins are found to have a better taste than compositions with a
high proportion of total amino acids provided as free amino acids
and/or certain hydrolyzed proteins. The availability of such
compositions has been limited, however, because nutritional
formulations have traditionally been made from protein isolated
from natural food products, such as whey isolated from milk, or soy
protein isolated from soy. The amino acid profiles of those
proteins do not necessarily meet the amino acid requirements for a
mammal. In addition, commodity proteins typically consist of
mixtures of proteins and/or protein hydrolysates which can vary in
their protein composition, thus leading to unpredictability
regarding their nutritional value. Moreover, the limited number of
sources of such high quality proteins has meant that only certain
combinations of amino acids are available on a large scale for
ingestion in protein form. The agricultural methods required for
the supply of high quality animal protein sources such as casein
and whey, eggs, and meat, as well as plant proteins such as soy,
also require significant energy inputs and have potentially
deleterious environmental impacts.
[0003] Accordingly, it would be useful in certain situations to
have alternative sources and methods of supplying proteins for
mammalian consumption. One feature that can enhance the utility of
a nutritive protein is its solubility. Nutritive proteins with
higher solubility can exhibit desirable characteristics such as
increased stability, resistance to aggregation, and desirable taste
profiles. For example, a nutritive protein that exhibits enhanced
solubility can be formulated into a beverage or liquid formulation
that includes a high concentration of nutritive protein in a
relatively low volume of solution, thus delivering a large dose of
protein nutrition per unit volume. A soluble nutritive protein can
be useful in sports drinks or recovery drinks wherein a user (e.g.,
an athlete) wants to ingest nutritive protein before, during or
after physical activity. A nutritive protein that exhibits enhanced
solubility can also be particularly useful in a clinical setting
wherein a subject (e.g., a patient or an elderly person) is in need
of protein nutrition but is unable to consume solid foods or large
volumes of liquids.
SUMMARY OF THE INVENTION
[0004] In one aspect, the invention provides methods of preventing
or reducing loss of muscle mass and/or muscle function in a human
subject, including the steps of: i) identifying a human subject
suffering from or at risk of a renal disease, and ii) administering
to the human subject a nutritional formulation in an amount
sufficient to prevent or reduce a loss of muscle mass and/or muscle
function, wherein the nutritional formulation includes an isolated
nutritive polypeptide including an amino acid sequence at least
about 90% identical over at least about 50 amino acids to a
polypeptide sequence provided herein; wherein the formulation
includes at least 1.0 g of the nutritive polypeptide; wherein the
formulation is present as a liquid, semi-liquid or gel in a volume
not greater than about 500 ml or as a solid or semi-solid in a
total mass not greater than about 200 g; and wherein the
formulation is substantially free of non-comestible products. In
one embodiment, the human subject is suffering from a renal disease
and has received one or more doses of a pharmaceutical composition,
wherein administration of the pharmaceutical composition increases
a risk of loss of muscle mass and/or muscle function. In one
embodiment, the human subject is suffering from a renal disease and
has received one or more doses of a pharmaceutical composition,
wherein i) the disease, disorder or condition or ii) the
administration of the pharmaceutical composition, or both i) and
ii) increases a risk of loss of muscle mass and/or muscle
function.
[0005] In another aspect, the invention provides methods of
treating a muscle wasting disease, disorder or condition in a human
subject suffering from a renal disease, including the step of
administering to the human subject a nutritional formulation in an
amount sufficient to treat such muscle wasting disease, disorder or
condition, wherein the nutritional formulation includes an isolated
nutritive polypeptide including an amino acid sequence at least
about 90% identical over at least about 50 amino acids to a
polypeptide sequence provided herein: wherein the formulation
includes at least 1.0 g of the nutritive polypeptide. In one
embodiment, the formulation is administered on a dosage schedule
sufficient to provide substantial protein nutrition to the human
subject in the absence of consumption by the subject of an
agriculturally-derived food product.
[0006] In another aspect, the invention provides methods of
reducing the risk of a human subject developing a disease, disorder
or condition characterized or exacerbated by protein
malnourishment, including the steps of (i) identifying the human
subject as suffering from a renal disease and being at risk of
developing the protein malnourishment disease, disorder or
condition; and (ii) administering in one or more doses a
nutritional formulation including an isolated nutritive polypeptide
including an amino acid sequence at least about 90% identical over
at least about 50 amino acids to a polypeptide sequence provided
herein; wherein the formulation includes at least 1.0 g of the
nutritive polypeptide. In one embodiment, the human subject is at
risk of developing malnutrition or protein malnutrition. In one
embodiment, the human subject exhibits sarcopenia and/or cachexia.
In one embodiment, the human subject has an inflammatory reaction
or an autoimmune disorder. In one embodiment, the human subject has
end-stage renal disease. In one embodiment, the human subject has
chronic renal failure, acute renal failure, glomerulonephritis,
glomerulonephrosis, tubular nephritis, interstitial nephritis, or
nephrotic syndrome. In one embodiment, the human subject has
undergone a surgical procedure. In one embodiment, the human
subject has a urea cycle disorder. In one embodiment, the
nutritional formulation is administered in conjunction with a
surgical therapy. In one embodiment, the nutritional formulation is
administered in conjunction with an exercise regimen. In one
embodiment, the nutritional formulation is administered as an
adjunct to administration a pharmaceutical composition. In one
embodiment, the human subject has renal failure.
[0007] In another aspect, the invention provides methods of
increasing muscle anabolism in a human subject suffering from a
renal disease, including administering to a human subject in one or
more doses a nutritional formulation including an isolated
nutritive polypeptide including an amino acid sequence at least
about 90% identical over at least about 50 amino acids to a
polypeptide sequence provided herein; wherein the formulation
includes at least 1.0 g of the nutritive polypeptide, wherein the
nutritive formulation is administered to the human subject at a
frequency sufficient to increase muscle anabolism in the subject
after the administration thereof.
[0008] In another aspect, the invention provides methods of
formulating a nutritional product for use in treating a human
subject, including the steps of providing to a human subject
suffering from a renal disease, a nutritive composition including
an isolated nutritive polypeptide including an amino acid sequence
at least about 90% identical over at least about 50 amino acids to
a polypeptide sequence provided herein: and formulating the
nutritive polypeptide with an acceptable excipient, wherein the
isolated nutritive polypeptide has an aqueous solubility at pH 7 of
at least 12.5 g/L, and wherein the isolated nutritive polypeptide
has a simulated gastric digestion half-life of less than 30
minutes. In one embodiment, the methods further include combining
the nutritive composition with at least one of a tastant, a
nutritional carbohydrate and a nutritional lipid, wherein the
product is present as a liquid, semi-liquid or gel in a volume not
greater than about 500 ml or as a solid or semi-solid in a total
mass not greater than about 200 g. In one embodiment, the product
is substantially free of i) non-comestible products; and/or ii) a
salt selected from sodium, potassium and chloride; and/or iii) an
electrolyte selected from hydrogen phosphate, dihydrogen phosphate,
and hydrogen bicarbonate.
[0009] In another aspect, the invention provides methods for
selecting an amino acid sequence of a nutritive polypeptide wherein
the nutritive polypeptide is suitable for use in treating a human
subject suffering from a renal disease, including i) providing a
library of amino acid sequences including a plurality of amino acid
sequences, ii) identifying in the library one or more amino acid
sequences including at least one amino acid of interest, and iii)
selecting the one or more identified amino acid sequences, thereby
selecting an amino acid sequence of a nutritive polypeptide.
[0010] In another aspect, the invention provides methods for
selecting an amino acid sequence of a nutritive polypeptide wherein
the nutritive polypeptide is suitable for use in treating a human
subject suffering from a renal disease, including i) providing a
library of amino acid sequences including a plurality of amino acid
sequences, ii) identifying in the library one or more amino acid
sequences including a ratio of at least one amino acid residues of
interest to total amino acid residues greater than or equal to a
selected ratio, and iii) selecting the one or more identified amino
acid sequences, thereby selecting an amino acid sequence of a
nutritive polypeptide.
[0011] In another aspect, the invention provides methods for
selecting an amino acid sequence of a nutritive polypeptide wherein
the nutritive polypeptide is suitable for use in treating a human
subject suffering from a renal disease, including i) providing a
library of amino acid sequences including a plurality of amino acid
sequences, ii) identifying in the library one or more amino acid
sequences including a ratio of at least one amino acid residues of
interest to total amino acid residues less than or equal to a
selected ratio, and iii) selecting the one or more identified amino
acid sequences, thereby selecting an amino acid sequence of a
nutritive polypeptide.
[0012] In another aspect, the invention provides nutritive
formulations for the treatment or prevention of a muscle wasting
disease, disorder or condition in a human subject suffering from a
renal disease, including an isolated nutritive polypeptide
including an amino acid sequence at least about 90% identical over
at least about 50 amino acids to a polypeptide sequence provided
herein: wherein the nutritive polypeptide is present in an amount
sufficient to provide a nutritional benefit to a human subject
having or at risk of having reduced protein absorption capacity. In
one embodiment, the polypeptide sequence includes a ratio of
essential amino acid residues to total amino acid residues of at
least 34% and wherein the polypeptide sequence is nutritionally
complete. In one embodiment, the essential amino acids present in
the nutritive polypeptide are substantially bioavailable. In one
embodiment, the isolated nutritive polypeptide has an aqueous
solubility at pH 7 of at least 12.5 g/L. In one embodiment, the
isolated nutritive polypeptide has a simulated gastric digestion
half-life of less than 30 minutes. In one embodiment, the nutritive
polypeptide is formulated in a pharmaceutically acceptable carrier.
In one embodiment, the nutritive polypeptide is formulated in or as
a food or a food ingredient. In one embodiment, the nutritive
polypeptide is formulated in or as a beverage or a beverage
ingredient. In one embodiment, the amino acid sequence encodes an
enzyme having a primary activity, and wherein the nutritive
polypeptide substantially lacks the primary activity. In one
embodiment, the formulation is present as a liquid, semi-liquid or
gel in a volume not greater than about 500 ml or as a solid or
semi-solid in a total mass not greater than about 200 g. In one
embodiment, the nutritive polypeptide includes an amino acid
sequence at least about 90% identical to an edible species
polypeptide or fragment thereof at least 50 amino acids in length,
wherein the amino acid sequence has less than about 50% identity
over at least 25 amino acids to a known allergen. In one
embodiment, the formulations further include a component selected
from a tastant, a protein mixture, a polypeptide, a peptide, a free
amino acid, a carbohydrate, a lipid, a mineral or mineral source, a
vitamin, a supplement, an organism, a pharmaceutical, and an
excipient. In one embodiment, the human subject is suffering from
an acute kidney injury or a chronic kidney disease. In one
embodiment, the amino acid sequence contains a density of essential
amino acids about equal to or greater than the density of essential
chain amino acids present in a full-length reference nutritional
polypeptide or a reference polypeptide-containing mixture. In one
embodiment, the amino acid sequence contains: i) a density of at
least one selected branched chain amino acid about equal to or
greater than the density of the selected branched chain amino acid
present in a full-length reference nutritional polypeptide or a
reference polypeptide-containing mixture; ii) a density of arginine
about equal to or greater than the density of arginine present in
the full-length reference nutritional polypeptide or the reference
polypeptide-containing mixture; and/or iii) a density of glutamine
and/or glutamic acid lower than the density of glutamine and/or
glutamic acid present in the full-length reference nutritional
polypeptide or the reference polypeptide-containing mixture.
[0013] In another aspect, the invention provides formulations
including at least one nutritive polypeptide including an amino
acid sequence at least about 99% identical to an edible species
polypeptide capable of being secreted from a microorganism, wherein
the nutritive polypeptide is present in the formulation in an
amount sufficient to provide a nutritional benefit equivalent to or
greater than at least about 2% of a reference daily intake value of
protein.
[0014] In another aspect, the invention provides nutritive
formulations for the treatment or prevention of a muscle wasting
disease, disorder or condition in a human subject suffering from a
renal disease, including a nutritive amino acid composition
including a plurality of free amino acids including an amino acid
ratio at least about 90% identical to an amino acid ratio of a
polypeptide sequence provided herein, wherein the nutritive amino
acid composition is nutritionally complete; wherein the nutritive
amino acid composition is present in an amount sufficient to
provide a nutritional benefit to a human subject having reduced
protein absorption capacity. In one embodiment, the formulation is
present as a liquid, semi-liquid or gel in a volume not greater
than about 500 ml or as a solid or semi-solid in a total mass not
greater than about 200 g.
[0015] In another aspect, the invention provides methods of
treating or reducing the severity of a renal disease in a human
subject, including the steps of: i) identifying a human subject
suffering from or at risk of developing a renal disease, and ii)
administering to the human subject a nutritional formulation in an
amount sufficient to treat or prevent the renal disease, wherein
the nutritional formulation includes an isolated nutritive
polypeptide including an amino acid sequence at least about 90%
identical over at least about 50 amino acids to a polypeptide
sequence provided herein; wherein the formulation includes at least
1.0 g of the nutritive polypeptide; wherein the formulation is
present as a liquid, semi-liquid or gel in a volume not greater
than about 500 ml or as a solid or semi-solid in a total mass not
greater than about 200 g; and wherein the formulation is
substantially free of non-comestible products. In one embodiment,
the human subject has a nephrotic syndrome and suffers from a
muscle wasting condition.
BRIEF DESCRIPTION OF THE FIGURES
[0016] These and other features, aspects, and advantages of the
present invention will become better understood with regard to the
following description, and accompanying drawings, where:
[0017] FIG. 1 is an image demonstrating SDS-PAGE analysis of the
purification of SEQID-00105 by IMAC.
[0018] FIG. 2 is a chart demonstrating net charge per amino acid as
a function of pH for nutritive polypeptides predicted to bind to
either anion or cation exchange resin. (1) SEQID-00105, (2)
SEQID-00008, (3) SEQID-00009, (4) SEQID-00475, (5) SEQID-00472, (6)
SEQID-00640, (7) SEQID-00019.
[0019] FIG. 3 is a chart demonstrating total charge per amino acid
over a range of pHs for exemplary nutritive polypeptides. (1)
SEQID-00475, (2) SEQID-00009, (3) SEQID-00478, (4) SEQID-00433, (5)
SEQID-00472.
[0020] FIG. 4 is a chart demonstrating purity of SEQID-00009 is as
a function of ammonium sulfate concentration.
[0021] FIG. 5 is an image demonstrating SDS-PAGE analysis
demonstrating secretion of SEQID-00409 (left) and SEQID-00420
(right) with new signal peptide compared to native signal
peptide.
[0022] FIG. 6 is a chart demonstrating supernatant concentration of
GLP-1 (7-36) detected in the supernatant following stimulation,
error bars are the standard deviation of the technical
replicates.
[0023] FIG. 7 is a chart demonstrating average blood glucose values
over time during OGTT of vehicle, SEQID-00105, Arginine, and
SEQID-00338. The error bars shown are the standard errors of the
mean.
[0024] FIG. 8 is a chart demonstrating the area under curve for
blood glucose integrated from 0-120 minutes (Left) and from 0-60
minutes (Right) after acute dosing of SEQID-00105, Arginine, and
SEQID-00338.
[0025] FIG. 9 is a chart demonstrating average plasma insulin
concentration for n=6 rats per treatment group over time. The error
bars show the standard error of the mean.
[0026] FIG. 10 is a chart demonstrating plasma insulin area under
curve integrated between 0-240 and 0-60 minutes for all treatment
groups. The error bars show the standard error of the mean.
[0027] FIG. 11 is a chart demonstrating average plasma GLP-1
concentration for n=6 rats per treatment group over time. The error
bars shown here correspond to the standard error of the mean.
[0028] FIG. 12 is a chart demonstrating average blood glucose
values over time. The error bars shown are the standard errors of
the mean.
[0029] FIG. 13 is a chart demonstrating integrated AUC for each
treatment group between the time of glucose challenge (0 min.) and
60 minutes, and between time 0 and 120 minutes. The error bars
shown are the standard errors of the mean.
[0030] FIG. 14 is a chart demonstrating average plasma insulin
concentration for n=6 rats per treatment group in vehicle &
SEQID-00105 and n=5 rats per treatment group in the case of
SEQID-00338 over the course of the experiment. The error bars shown
are the standard errors of the mean.
[0031] FIG. 15 is a chart demonstrating integrated area under the
curve for vehicle, SEQID-00105 and SEQID-00338 between 0 and 90
minutes and between 0 and 60 minutes. Error bars shown here
correspond to the standard error of the mean.
[0032] FIG. 16 is a chart demonstrating average plasma GLP-1
concentration for n=6 rats per treatment group for vehicle and
SEQID-00105 and n=5 rats for SEQID-00338 over the course of the
experiment. Error bars shown here correspond to the standard error
of the mean.
[0033] FIG. 17 is a chart demonstrating area under curve for GLP-1
(7-36) for each treatment group integrated to 0-90 and 0-60
minutes. Error bars shown here correspond to the standard error of
the mean.
[0034] FIG. 18 is a chart demonstrating average blood glucose
values during KOGTT of vehicle, SEQID-00105, Alogliptin, and the
combination for n=6 rats per treatment group. Error bars shown here
correspond to the standard error of the mean.
[0035] FIG. 19 is a chart demonstrating AlphaLISA plasma insulin
over time for vehicle and SEQID-00105 administered at three
different doses. Error bars shown here are the standard error of
the mean.
[0036] FIG. 20 is a chart demonstrating AlphaLISA plasma insulin
over time for vehicle and SEQID-00426, SEQID-00338, SEQID-00341.
Error bars shown here are the standard error of the mean.
[0037] FIG. 21 is a chart demonstrating integrated area under
curves for plasma insulin concentrations for SEQID-00105 at three
doses between 0 and 240 minutes and between 0 and 60 minutes. Error
bars shown here are the standard error of the mean.
[0038] FIG. 22 is a chart demonstrating integrated area under
curves for plasma insulin concentrations for vehicle, SEQID-00426,
SEQID-00338, and SEQID-0034 I between 0 and 240 minutes and between
0 and 60 minutes. Error bars shown here are the standard error of
the mean.
[0039] FIG. 23 is a chart demonstrating AlphaLISA plasma insulin
over time for SEQID-00423, SEQID-00587, SEQID-00105. Error bars
shown here are the standard error of the mean.
[0040] FIG. 24 is a chart demonstrating AlphaLISA plasma insulin
over time for vehicle SEQID-00424, SEQID-00425, and SEQID-00429.
Error bars shown here are the standard error of the mean.
[0041] FIG. 25 is a chart demonstrating integrated area under
curves for plasma insulin concentrations for vehicle, SEQID-00423,
SEQID-00587, and SEQID-00105 between 0 and 240 minutes and between
0 and 60 minutes. Error bars shown here are the standard error of
the mean.
[0042] FIG. 26 is a chart demonstrating integrated area under
curves for plasma insulin concentrations for vehicle, SEQID-00424,
SEQID-00425, and SEQID-00429 between 0 and 240 minutes and between
0 and 60 minutes. Error bars shown here are the standard error of
the mean.
[0043] FIG. 27 is a chart demonstrating ELISA plasma insulin over
time for vehicle and SEQID-00105, SEQID-00240, and SEQID-00559.
Error bars shown here are the standard error of the mean.
[0044] FIG. 28 is a chart demonstrating integrated area under
curves for plasma insulin concentrations for vehicle, SEQID-00105,
SEQID-00240, and SEQID-00559 between 0 and 240 minutes and 0 and 60
minutes. Error bars shown here are the standard error of the
mean.
[0045] FIG. 29 is a chart demonstrating GLP-2 concentration over a
4 hour time course for vehicle and SEQID-00240, n=4 and n=5 rats,
respectively. Error bars shown are the standard error of the
mean.
[0046] FIG. 30 is a chart demonstrating integrated GLP-2 area under
the curve over the first hour and the full 4 hours. Error bars
shown are the 95% confidence interval.
[0047] FIG. 31 is a chart demonstrating average plasma insulin
response to SEQID-00105 of all subjects over time.
[0048] FIG. 32 is a chart demonstrating average plasma insulin fold
response to SEQID-00105 over baseline.
[0049] FIG. 33 is a chart demonstrating average plasma insulin
response to SEQID-00426 of all subjects over time.
[0050] FIG. 34 is a chart demonstrating average plasma insulin fold
response to SEQID-00426 over baseline.
[0051] FIG. 35 is a chart demonstrating average total Gastric
Inhibitory Polypeptide (GIP) response of all patients to
SEQID-00426.
[0052] FIG. 36 is a chart demonstrating a Gastric Inhibitory
Polypeptide (GIP) fold response of all patients to SEQID-00426.
[0053] FIG. 37 is a chart demonstrating alphascreen signal (y-axis)
measured at different Leucine concentrations. Error bars shown are
the standard deviation of replicates.
[0054] FIG. 38 is a chart demonstrating Leucine Dose Response in
Minimal Amino Acid Media in Primary RSKMC. Error bars shown are the
standard deviation.
[0055] FIG. 39 is a chart demonstrating In vitro Leucine Dose
Response of rps6 Phosphorylation in Isolate Soleus Muscle. Error
bars shown are the standard deviation.
[0056] FIG. 40 is a chart demonstrating In vitro Leucine Dose
Response of ips6 Phosphorylation in Isolated Gastrocnemius Muscle.
Error bars shown are the standard deviation.
[0057] FIG. 41 is a chart demonstrating In vitro Leucine Dose
Response of rps6 Phosphorylation in Isolate Extensor Digitorum
Longus Muscle. Error bars shown are the standard deviation.
[0058] FIG. 42 is a chart demonstrating Combined Activity of
Leu/Tyr/Arg on RPS6 Phosphorylation. Error bars shown are the
standard deviation.
[0059] FIG. 43 is a chart demonstrating Arginine Stimulation of
RPS6 in Leu/Tyr Background. Error bars shown are the standard
deviation.
[0060] FIG. 44 is a chart demonstrating Leucine Stimulation of RPS6
in Arg/Tyr Background. Error bars shown are the standard
deviation.
[0061] FIG. 45 is a chart demonstrating Tyrosine Stimulation of
RPS6 in Arg/Leu Background. Error bars shown are the standard
deviation.
[0062] FIG. 46 is a chart demonstrating a time-course of free Leu
release during Pancreatin digest of SEQID-00105.
[0063] FIG. 47 is a chart demonstrating viscosity measured in
centipoise for SEQID-0010S at 4 C (closed circles) and 25 C (open
circles) and whey at 4 C (closed squares) and 25 C (open squares)
over a range of protein concentrations.
[0064] FIG. 48 is a chart demonstrating (Left) Initial and final
(after heating to 90.degree. C. and then cooling to 20.degree. C.)
protein circular dichroism spectrum for SEQID-00105 and (Right)
change in ellipticity at a given wavelength over the temperature
range for that SEQID-00105.
[0065] FIG. 49 is an image demonstrating Western blot analysis for
mannose-containing glycans. A) Coomassie-stained gel. B) GNA
blotted membrane. In both panels, lanes are as follows: 1)
Pre-stained protein ladder, 2) SEQID-00363 (5 .mu.g) from A. niger,
3) whole cell extract (5 .mu.g) from E. coli transformed with an
expression vector encoding SEQID-00363, 4), GNA positive control
carboxypeptidase (5 .mu.g), 5) soluble lysate (5 .mu.g) from E.
coli transformed with an expression vector encoding
SEQID-00363.
[0066] FIG. 50 is an image demonstrating Western blot analysis for
Neu5Gc. A) Coomassie-stained gel. B) anti-Neu5Gc probed membrane.
In both panels, lanes are as follows: 1 & 10) Pre-stained
protein ladder (New England Biolab), 2& 11) beef extract (30
.mu.g), 3) pork extract (30 .mu.g), 4) deer extract (30 .mu.g), 5)
lamb extract (30 .mu.g), 6) turkey extract (30 .mu.g), 7) chicken
extract (30 .mu.g), 8) cod extract (30 .mu.g), 9) Protein Mixture 1
(10 .mu.g), 12-15) 168 nutritive polypeptide library (30 .mu.g)
expressed in 12) E. coli (IMAC-purified lysate), 13) B. subtilis
(supernatant), 14) B. subtilis (lysate), 15) B. subtilis
(IMAC-purified lysate), 16-20) cDNA Library (30 .mu.g) expressed in
16) B. subtilis (PH951 Grac lysate), 17) E. coli (Rosetta soluble
lysate), 18) E. coli (Rosetta whole cell), 19) E. coli (GamiB
lysate), and 20) E. coli (Gami2 lysate).
[0067] FIG. 51 is an image demonstrating Western blot analysis for
Xylose and Fucose. A) Coomassie-stained gel. B) anti-Neu5Gc probed
membrane. In western blot analysis of samples of protein extracted
from plants and fungi or recombinantly expressed by E. coli and A.
niger, xylose- and fucose-containing glycans in A)
Coomassie-stained gel. B) anti-NeuSGc-blotted membrane. In both
panels, lanes are as follows: 1 & 11) Pre-stained protein
ladder (New England Biolab), 2) yeast extract (30 .mu.g), 3)
flaxseed extract (30 .mu.g), 4) chicken extract (30 .mu.g), 5) corn
extract (30 .mu.g), 6) potato extract (30 .mu.g), 7) mushroom
extract (30 .mu.g), 8) Protein Mixture 2 (30 .mu.g), 9) HRP (2
.mu.g), 10) fetuin (2 .mu.g), 12) soy extract (30 .mu.g), 13) rice
extract (30 .mu.g), 14) broccoli extract (30 .mu.g), 15) tomato
extract (30 .mu.g), 16) blueberry extract (30 .mu.g), 17) grape
extract (30 .mu.g), 18) Protein Mixture 2 (30 .mu.g), 19) HRP (2
.mu.g), 20) fetuin (2 .mu.g).
[0068] FIG. 52 is a series of charts demonstrating change in
average area under the curve (AUC) (.+-.SD) of plasma amino acid
concentrations (M-h) measured in blood samples collected from rats
(n=2-4) over 4 h following oral administration of the indicated
nutritive polypeptides at the doses listed in Table E33A. BCAA:
branched chain amino acids, EAA: essential amino acids.
[0069] FIG. 53 is a series of charts demonstrating average plasma
amino acid concentration (.+-.SD)-time curve for rats (n=4) orally
administered of SEQID-00105 at 2.85 g/kg. BCAA: branched chain
amino acids, EAA: essential amino acids.
[0070] FIG. 54 is a series of charts demonstrating dose-response
effect of SEQID-00105. (Left) Average plasma Leu concentration
(.+-.SD)-time curve (Right) Average area under the curve (AUC)
(+SD) of plasma amino acid concentrations (.mu.h) measured in blood
samples collected from rats (n=4) over 4 h following oral
administration of SEQID-00105 at the doses listed in Table
E33A.
[0071] FIG. 55 is a series of charts demonstrating plasma amino
acid concentrations during rat pharmacokinetic studies of native
and modified forms of SEQID-00363. Plasma amino acid profile of
essential amino acids (EAAs) (A), Leucine (B), Serine (C), and
Threonine (D) following oral administration of saline (circle ( ),
solid line) (n=4), native SEQID-00363 (square (.box-solid.), solid
line) (n=4), deglycosylated SEQID-00363 (open circle
(.largecircle.), dashed line) (n=2), and hydrolyzed SEQID-00363
(open square (.quadrature.), dashed line) (n=4). Data represent the
mean.+-.the standard deviation of the mean for n=2-4 rats, as
indicated above.
[0072] FIG. 56 is a series of charts demonstrating change in
average FSR for WPI, SEQID-00105, and SEQID-363
[0073] FIG. 57 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0074] FIG. 58 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0075] FIG. 59 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0076] FIG. 60 is a series of charts demonstrating human plasma
time course of measured amino acid and the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA) for WPI and SEQID-00105.
[0077] FIG. 61 is a chart demonstrating integrated area under the
curve (AUC) of measured amino acids, for WPI and SEQID-00105.
[0078] FIG. 62 is a chart demonstrating integrated area under the
curve (AUC) of measured amino acids, for WPI and SEQID-00105.
[0079] FIG. 63 is a chart demonstrating integrated area under the
curve (AUC) of aggregate groups, essential amino acids (EAA),
branched chain amino acids (BCAA), and total amino acids (TAA), for
WPI and SEQID-00105.
[0080] FIG. 64 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0081] FIG. 65 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0082] FIG. 66 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00105.
[0083] FIG. 67 is a series of charts demonstrating human plasma
time course of measured amino acid and the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA) for WPI and SEQID-00105.
[0084] FIG. 68 is a chart demonstrating integrated area under the
curve (AUC) of measured amino acids, for WPI and SEQID-00105.
[0085] FIG. 69 is a chart demonstrating integrated area under the
curve (AUC) of measured amino acids, for WPI and SEQID-00105.
[0086] FIG. 70 is a chart demonstrating integrated area under the
curve (AUC) of aggregate groups, essential amino acids (EAA),
branched chain amino acids (BCAA), and total amino acids (TAA), for
WPI and SEQID-00105
[0087] FIG. 71 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00363.
[0088] FIG. 72 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00363.
[0089] FIG. 73 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00363.
[0090] FIG. 74 is a series of charts demonstrating human plasma
time course of measured amino acid and the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA) for WPI and SEQID-363.
[0091] FIG. 75 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00426.
[0092] FIG. 76 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00426.
[0093] FIG. 77 is a series of charts demonstrating human plasma
time course of measured amino acid s for WPI and SEQID-00426.
[0094] FIG. 78 is a series of charts demonstrating human plasma
time course of measured amino acid and the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA) for WPI and SEQID-00426.
DETAILED DESCRIPTION
[0095] Terms used in the claims and specification are defined as
set forth below unless otherwise specified.
[0096] It must be noted that, as used in the specification and the
appended claims, the singular forms "a," "an" and "the" include
plural referents unless the context clearly dictates otherwise.
DEFINITIONS
[0097] An "agriculturally-derived food product" is a food product
resulting from the cultivation of soil or rearing of animals.
[0098] The term "ameliorating" refers to any therapeutically
beneficial result in the treatment of a disease state. e.g.,
including prophylaxis, lessening in the severity or progression,
remission, or cure thereof.
[0099] As used herein, the term "autotrophic" refers to an organism
that produces complex organic compounds (such as carbohydrates,
fats, and proteins) from simple inorganic molecules using energy
from light (by photosynthesis) or inorganic chemical reactions
(chemosynthesis).
[0100] As used herein, a "body mass index" or "BMI" or "Quetelet
Index" is a subject's weight in kilograms divided by the square of
the subject's height in meters (kg/m.sup.2). For adults, a frequent
use of the BMI is to assess how much an individual's body weight
departs from what is normal or desirable for a person of his or her
height. The weight excess or deficiency may, in part, be accounted
for by body fat, although other factors such as muscularity also
affect BMI significantly. The World Health Organization regards a
BMI of less than 18.5 as underweight and may indicate malnutrition,
an eating disorder, or other health problems, while a BMI greater
than 25 is considered overweight and above 30 is considered obese.
(World Health Organization. BMI classification).
[0101] As used herein, a "branched chain amino acid" is an amino
acid selected from Leucine. Isoleucine, and Valine.
[0102] As used herein, "cachexia" refers to a multifaceted clinical
syndrome that results in muscle wasting and weight loss. It is a
complex condition where protein catabolism exceeds protein
anabolism, which makes muscle wasting a primary feature of the
condition. In addition to the metabolic derangements in protein
metabolism, it is also characterized by anorexia and inflammation.
These derangements plus impaired protein metabolism are responsive
to nutrition therapy to varying degrees.
[0103] As used herein, "calorie control" and "calorie restriction"
refer to the process of reducing a subject's calorie intake from
food products, either relative to the subject's prior calorie
intake or relative to an appropriate calorie intake standard.
[0104] Generally, the terms "cancer" and "cancerous" refer to or
describe the physiological condition in mammals that is typically
characterized by unregulated cell growth. More specifically,
cancers that are treated using any one or more tyrosine kinase
inhibitors, other drugs blocking the receptors or their ligands, or
variants thereof, and in connection with the methods provided
herein include, but are not limited to, carcinoma, lymphoma,
blastoma, sarcoma, leukemia, mesothelioma, squamous cell cancer,
lung cancer including small-cell lung cancer and non-small cell
lung cancer (which includes large-cell carcinoma, adenocarcinoma of
the lung, and squamous carcinoma of the lung), cancer of the
peritoneum, hepatocellular cancer, gastric or stomach cancer
(including gastrointestinal cancer and gastrointestinal stromal
cancer), pancreatic cancer, glioblastoma, cervical cancer, ovarian
cancer, liver cancer, bladder cancer, breast cancer, colon cancer,
colorectal cancer, endometrial or uterine carcinoma, salivary gland
carcinoma, kidney or renal cancer, prostate cancer, cervical
cancer, vulval cancer, thyroid cancer, head and neck cancer,
melanoma, superficial spreading melanoma, lentigo maligna melanoma,
acral lentiginous melanomas, nodular melanomas, T-cell lymphomas,
B-cell lymphomas (including low grade/follicular non-Hodgkin's
lymphoma (NHL); small lymphocytic (SL) NHL; intermediate
grade/follicular NHL; intermediate grade diffuse NHL; high grade
immunoblastic NHL; high grade lymphoblastic NHL; high grade small
non-cleaved cell NHL: bulky disease NHL: mantle cell lymphoma;
AIDS-related lymphoma; and Waldenstrom's Macroglobulinemia);
chronic lymphocytic leukemia (CLL); acute myeloid leukemia (AML);
chronic myeloid leukemia (CML); acute lymphoblastic leukemia (ALL);
Hairy cell leukemia; chronic myeloblastic leukemia; or
post-transplant lymphoproliferative disorder (PTLD), as well as
abnormal vascular proliferation associated with phakomatoses, edema
(such as that associated with brain tumors), and Meigs'
syndrome.
[0105] A "comestible product" includes an edible product, while a
"non-comestible product" is generally an inedible product or
contains an inedible product. To be "substantially free of
non-comestible products" means a composition does not have an
amount or level of non-comestible product sufficient to render the
composition inedible, dangerous or otherwise unfit for consumption
by its intended consumer. Alternatively, a polypeptide can be
substantially free of non-comestible products, meaning the
polypeptide does not contain or have associated therewith an amount
or level of non-comestible product sufficient to render a
composition containing the polypeptide inedible by, or unsafe or
deleterious to, its intended consumer. In preferred embodiments a
composition substantially free of non-comestible products can be
consumed in a nutritional amount by an intended consumer who does
not suffer or is not at increased risk of suffering a deleterious
event from such consumption. For example, levels of lead and other
metals are well-documented as having significant risk including
toxicity to humans when present in food, particularly foods
containing an agriculturally-derived product grown in soil
contaminated with lead and/or other metals. Thus, products such as
foods, beverages, and compounds containing industrially-produced
polypeptides having metal content above a certain parts per million
(ppm), are considered non-comestible products, such metal content
depending upon the metal as recognized in the art. For example,
inclusion of lead or cadmium in an industrially-produced
polypeptide at levels such that the lead will have a deleterious
biological effect when consumed by a mammal will generally render a
composition containing the industrially-produced polypeptide
non-comestible. Notwithstanding the above, some polypeptides have
certain amounts of metals complexed to or incorporated therein
(such as iron, zinc, calcium and magnesium) and such metals shall
not necessarily render the polypeptides non-comestible.
[0106] The term "control sequences" is intended to encompass, at a
minimum, any component whose presence is essential for expression,
and can also encompass an additional component whose presence is
advantageous, for example, leader sequences and fusion partner
sequences.
[0107] As used herein, a patient is "critically-medically ill" if
the patient, because of medical illness, experiences changes in at
least one of body mass index and muscle mass (e.g., sarcopenia). In
some embodiments the patient is confined to bed for at least 25%,
at least 50%, at least 60%, at least 70%, at least 80%, at least
90%, at least 95%, or 100% of their waking time. In some
embodiments the patient is unconscious. In some embodiments the
patient has been confined to bed as described in this paragraph for
at least 1 day, 2 days, 3 days, 4 days, 5 days, 10 days, 2 weeks, 3
weeks, 4 weeks, 5 weeks, 10 weeks or longer.
[0108] As used herein, the phrase "degenerate variant" of a
reference nucleic acid sequence encompasses nucleic acid sequences
that can be translated, according to the standard genetic code, to
provide an amino acid sequence identical to that translated from
the reference nucleic acid sequence. The term "degenerate
oligonucleotide" or "degenerate primer" is used to signify an
oligonucleotide capable of hybridizing with target nucleic acid
sequences that are not necessarily identical in sequence but that
are homologous to one another within one or more particular
segments.
[0109] As used herein a "desirable body mass Index" is a body mass
index of from about 18.5 to about 25. Thus, if a subject has a BMI
below about 18.5, then an increase in the subject's BMI is an
increase in the desirability of the subject's BMI. If instead a
subject has a BMI above about 25, then a decrease in the subject's
BMI is an increase in the desirability of the subject's BMI.
[0110] As used herein, the term "diabetes" includes any metabolic
disease in which a subject is unable to produce any or a sufficient
amount of insulin or is otherwise unable to regulate blood glucose
level. The term "pre-diabetes" is also termed "impaired fasting
glucose" includes a condition in which fasting glucose is above an
accepted normal limit
[0111] As used herein, an "elderly" mammal is one who experiences
age related changes in at least one of body mass index and muscle
mass (e.g., age related sarcopenia). In some embodiments an
"elderly" human is at least 50 years old, at least 60 years old, at
least 65 years old, at least 70 years old, at least 75 years old,
at least 80 years old, at least 85 years old, at least 90 years
old, at least 95 years old, or at least 100 years old. In some
embodiments and an elderly animal, mammal, or human is a human who
has experienced a loss of muscle mass from peak lifetime muscle
mass of at least 5%, at least 10%, at least 15%, at least 20%, at
least 25%, at least 30%, at least 35%, at least 40%, at least 45%,
at least 50%, at least 55%, or at least 60%. Because age related
changes to at least one of body mass index and muscle mass are
known to correlate with increasing age, in some embodiments an
elderly mammal is identified or defined simply on the basis of age.
Thus, in some embodiments an "elderly" human is identified or
defined simply by the fact that their age is at least 60 years old,
at least 65 years old, at least 70 years old, at least 75 years
old, at least 80 years old, at least 85 years old, at least 90
years old, at least 95 years old, or at least 100 years old, and
without recourse to a measurement of at least one of body mass
index and muscle mass.
[0112] As used herein, an "essential amino acid" is an amino acid
selected from Histidine, Isoleucine, Leucine, Lysine, Methionine,
Phenylalanine, Threonine, Tryptophan, and Valine. However, it
should be understood that "essential amino acids" can vary through
a typical lifespan, e.g., cysteine, tyrosine, and arginine are
considered essential amino acids in infant humans. Imura K, Okada A
(1998). "Amino acid metabolism in pediatric patients". Nutrition 14
(1): 143-8. In addition, the amino acids arginine, cysteine,
glycine, glutamine, histidine, proline, serine and tyrosine are
considered "conditionally essential" in adults, meaning they are
not normally required in the diet, but must be supplied exogenously
to specific populations that do not synthesize them in adequate
amounts. Furst P, Stehle P (1 Jun. 2004). "What are the essential
elements needed for the determination of amino acid requirements in
humans?". Journal of Nutrition 134 (6 Suppl): 1558S-1565S; and
Reeds P J (1 Jul. 2000). "Dispensable and indispensable amino acids
for humans". J. Nutr, 130 (7): 1835S-40S.
[0113] As used herein, "exercise" is, most broadly, any bodily
activity that enhances or maintains physical fitness and overall
health and wellness. Exercise is performed for various reasons
including strengthening muscles and the cardiovascular system,
honing athletic skills, weight loss or maintenance, as well as for
the purpose of enjoyment.
[0114] As used herein, an "exercise regimen" includes any course of
exercise for the promotion of health, or for the treatment or
prevention of disease.
[0115] As used herein, an "expression control sequence" refers to
polynucleotide sequences which are necessary to affect the
expression of coding sequences to which they are operatively
linked. Expression control sequences are sequences which control
the transcription, post-transcriptional events and translation of
nucleic acid sequences. Expression control sequences include
appropriate transcription initiation, termination, promoter and
enhancer sequences; efficient RNA processing signals such as
splicing and polyadenylation signals; sequences that stabilize
cytoplasmic mRNA; sequences that enhance translation efficiency
(e.g., ribosome binding sites); sequences that enhance protein
stability; and when desired, sequences that enhance protein
secretion. The nature of such control sequences differs depending
upon the host organism; in prokaryotes, such control sequences
generally include promoter, ribosomal binding site, and
transcription termination sequence.
[0116] As used herein, "function" and "functional performance"
refers to a functional test that simulates daily activities.
"Muscle function" or "functional performance" is measured by any
suitable accepted test, including timed-step test (step up and down
from a 4 inch bench as fast as possible 5 times), timed floor
transfer test (go from a standing position to a supine position on
the floor and thereafter up to a standing position again as fast as
possible for one repetition), and physical performance battery test
(static balance test, chair test, and a walking test) (Borsheim et
al., "Effect of amino acid supplementation on muscle mass, strength
and physical function in elderly," Clin Nutr 2008; 27: 189-195). As
used herein, a "performance-associated" injury or damage, such as a
tissue injury or tissue damage, results from a functional activity,
such as a physical or athletic performance.
[0117] The term "fusion protein" refers to a polypeptide comprising
a polypeptide or fragment coupled to heterologous amino acid
sequences. Fusion proteins are useful because they can be
constructed to contain two or more desired functional elements that
can be from two or more different proteins. A fusion protein
comprises at least 10 contiguous amino acids from a polypeptide of
interest, or at least 20 or 30 amino acids, or at least 40, 50 or
60 amino acids, or at least 75, 100 or 125 amino acids. The
heterologous polypeptide included within the fusion protein is
usually at least 6 amino acids in length, or at least 8 amino acids
in length, or at least 15, 20, or 25 amino acids in length. Fusions
that include larger polypeptides, such as an IgG Fc region, and
even entire proteins, such as the green fluorescent protein ("GFP")
chromophore-containing proteins, have particular utility. Fusion
proteins can be produced recombinantly by constructing a nucleic
acid sequence which encodes the polypeptide or a fragment thereof
in frame with a nucleic acid sequence encoding a different protein
or peptide and then expressing the fusion protein. Alternatively, a
fusion protein can be produced chemically by crosslinking the
polypeptide or a fragment thereof to another protein.
[0118] Sequence homology for polypeptides, which is also referred
to as percent sequence identity, is typically measured using
sequence analysis software. See, e.g., the Sequence Analysis
Software Package of the Genetics Computer Group (GCG), University
of Wisconsin Biotechnology Center, 910 University Avenue, Madison,
Wis. 53705. Protein analysis software matches similar sequences
using a measure of homology assigned to various substitutions,
deletions and other modifications, including conservative amino
acid substitutions. For instance, (CG contains programs such as
"Gap" and "Bestfit" which can be used with default parameters to
determine sequence homology or sequence identity between closely
related polypeptides, such as homologous polypeptides from
different species of organisms or between a wild-type polypeptide
and a mutein thereof. See, e.g., GCG Version 6. An exemplary
algorithm when comparing a particular polypeptide sequence to a
database containing a large number of sequences from different
organisms is the computer program BLAST (Altschul et al., J. Mol.
Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272
(1993); Madden et al., Meth. Enzymol. 266:131-141 (1996); Altschul
et al., Nucleic Acids Res. 25:3389-3402 (1997): Zhang and Madden,
Genome Res. 7:649-656 (1997)), especially blastp or tblastn
(Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).
[0119] As used herein, a "gastrointestinal disorder" or a
"gastrointestinal disease" includes any disorder or disease
involving the gastrointestinal tract or region thereof, namely the
esophagus, stomach, small intestine, large intestine or rectum, as
well as organs and tissues associated with digestion, e.g., the
pancreas, the gallbladder, and the liver.
[0120] As used herein, the term "heterotrophic" refers to an
organism that cannot fix carbon and uses organic carbon for
growth.
[0121] As used herein, a polypeptide has "homology" or is
"homologous" to a second polypeptide if the nucleic acid sequence
that encodes the polypeptide has a similar sequence to the nucleic
acid sequence that encodes the second polypeptide. Alternatively, a
polypeptide has homology to a second polypeptide if the two
polypeptides have similar amino acid sequences. (Thus, the term
"homologous polypeptides" is defined to mean that the two
polypeptides have similar amino acid sequences.) When "homologous"
is used in reference to polypeptides or peptides, it is recognized
that residue positions that are not identical often differ by
conservative amino acid substitutions. A "conservative amino acid
substitution" is one in which an amino acid residue is substituted
by another amino acid residue having a side chain (R group) with
similar chemical properties (e.g., charge or hydrophobicity). In
general, a conservative amino acid substitution will not
substantially change the functional properties of a polypeptide. In
cases where two or more amino acid sequences differ from each other
by conservative substitutions, the percent sequence identity or
degree of homology can be adjusted upwards to correct for the
conservative nature of the substitution. Means for making this
adjustment are well known to those of skill in the art. See, e.g.,
Pearson, 1994, Methods Mol. Biol. 24:307-31 and 25:365-89. The
following six groups each contain amino acids that are conservative
substitutions for one another: 1) Serine, Threonine; 2) Aspartic
Acid. Glutamic Acid; 3) Asparagine, Glutamine; 4) Arginine, Lysine;
5) Isoleucine, Leucine, Methionine, Alanine, Valine, and 6)
Phenylalanine. Tyrosine. Tryptophan. In some embodiments, polymeric
molecules (e.g., a polypeptide sequence or nucleic acid sequence)
are considered to be homologous to one another if their sequences
are at least 25%, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 96%, %, at least 97%, %, at least 98%,
or at least 99% identical. In some embodiments, polymeric molecules
are considered to be "homologous" to one another if their sequences
are at least 25%, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 96%, %, at least 97%, %, at least 98%,
or at least 99% similar. The term "homologous" necessarily refers
to a comparison between at least two sequences (nucleotides
sequences or amino acid sequences). In some embodiments, two
nucleotide sequences are considered to be homologous if the
polypeptides they encode are at least about 50% identical, at least
about 60% identical at least about 70% identical, at least about
80% identical, or at least about 90% identical for at least one
stretch of at least about 10, 15, 20, 25, 30, 35, 40, 45, 50 or
over 50 amino acids. In some embodiments, homologous nucleotide
sequences are characterized by the ability to encode a stretch of
at least 4-5 uniquely specified amino acids. Both the identity and
the approximate spacing of these amino acids relative to one
another must be considered for nucleotide sequences to be
considered homologous. In some embodiments of nucleotide sequences
less than 60 nucleotides in length, homology is determined by the
ability to encode a stretch of at least 4-5 uniquely specified
amino acids. In some embodiments, two polypeptide sequences are
considered to be homologous if the polypeptides are at least about
50% identical, at least about 60% identical, at least about 70%
identical, at least about 80% identical, or at least about 90%
identical for at least one stretch of at least about 20 amino
acids. In other embodiments, two polypeptide sequences are
considered to be homologous if the polypeptides are similar, such
as at least about 50% similar, at least about 60% similar, at least
about 70% similar, at least about 80% similar, or at least about
90% similar, or at least about 95% similar for at least one stretch
of at least about 20 amino acids. In some embodiments similarity is
demonstrated by fewer nucleotide changes that result in an amino
acid change (e.g., a nucleic acid sequence having a single
nucleotide change is more similar to a reference nucleic acid
sequence than a nucleic acid sequence having two nucleotide
changes, even if both changes result in an identical amino acid
substitution.
[0122] The term "in situ" refers to processes that occur in a
living cell growing separate from a living organism, e.g., growing
in tissue culture.
[0123] As used herein, the term "in vitro" refers to events that
occur in an artificial environment. e.g., in a test tube or
reaction vessel, in cell culture, in a Petri dish, etc., rather
than within an organism (e.g., animal, plant, or microbe). As used
herein, the term "ex vivo" refers to experimentation done in or on
tissue in an environment outside the organism.
[0124] The term "in vivo" refers to processes that occur in a
living organism.
[0125] As used herein, a "modified derivative" refers to
polypeptides or fragments thereof that are substantially homologous
in primary structural sequence to a reference polypeptide sequence
but which include, e.g., in vivo or in vitro chemical and
biochemical modifications or which incorporate amino acids that are
not found in the reference polypeptide. Such modifications include,
for example, acetylation, carboxylation, phosphorylation,
glycosylation, ubiquitination, labeling, e.g., with radionuclides,
and various enzymatic modifications, as will be readily appreciated
by those skilled in the art. A variety of methods for labeling
polypeptides and of substituents or labels useful for such purposes
are well known in the art, and include radioactive isotopes such as
125I, 32P, 35S, and 3H, ligands that bind to labeled antiligands
(e.g., antibodies), fluorophores, chemiluminescent agents, enzymes,
and antiligands that can serve as specific binding pair members for
a labeled ligand. The choice of label depends on the sensitivity
required, ease of conjugation with the primer, stability
requirements, and available instrumentation. Methods for labeling
polypeptides are well known in the art. See, e.g., Ausubel et al.,
Current Protocols in Molecular Biology, Greene Publishing
Associates (1992, and Supplements to 2002).
[0126] As used herein, "muscle strength" refers to the amount of
force a muscle can produce with a single maximal effort. There are
two types of muscle strength, static strength and dynamic strength.
Static strength refers to isometric contraction of a muscle, where
a muscle generates force while the muscle length remains constant
and/or when there is no movement in a joint. Examples include
holding or carrying an object, or pushing against a wall. Dynamic
strength refers to a muscle generating force that results in
movement. Dynamic strength can be isotonic contraction, where the
muscle shortens under a constant load or isokinetic contraction,
where the muscle contracts and shortens at a constant speed.
Dynamic strength can also include isoinertial strength. In
addition, the term "muscle strength" refers to maximum dynamic
muscle strength, as described by the term "one repetition maximum"
(1RM). This is a measurement of the greatest load (in kilograms)
that can be fully moved (lifted, pushed or pulled) once without
failure or injury. This value can be measured directly, but doing
so requires that the weight is increased until the subject fails to
carry out the activity to completion. Alternatively, 1RM is
estimated by counting the maximum number of exercise repetitions a
subject can make using a load that is less than the maximum amount
the subject can move. Leg extension and leg flexion are often
measured in clinical trials (Borsheim et al., "Effect of amino acid
supplementation on muscle mass, strength and physical function in
elderly," Clin Nutr 2008; 27:189-195; Paddon-Jones, et al.,
"Essential amino acid and carbohydrate supplementation ameliorates
muscle protein loss in humans during 28 days bed rest," J Clin
Endocrinol Metab 2004; 89:4351-4358).
[0127] As used herein, "muscle mass" refers to the weight of muscle
in a subject's body. Similarly, "muscle anabolism" includes the
synthesis of muscle proteins, and is a component of the process by
which muscle mass is gained. Muscle mass includes the skeletal
muscles, smooth muscles (such as cardiac and digestive muscles) and
the water contained in these muscles. Muscle mass of specific
muscles can be determined using dual energy x-ray absorptiometry
(DEXA) (Padden-Jones et al., 2004). Total lean body mass (minus the
fat), total body mass, and bone mineral content can be measured by
DEXA as well. In some embodiments a change in the muscle mass of a
specific muscle of a subject is determined, for example by DEXA,
and the change is used as a proxy for the total change in muscle
mass of the subject. Thus, for example, if a subject consumes a
nutritive protein as disclosed herein and experiences an increase
over a period of time in muscle mass in a particular muscle or
muscle group, it can be concluded that the subject has experienced
an increase in muscle mass. Changes in muscle mass can be measured
in a variety of ways including protein synthesis, fractional
synthetic rate, and certain key activities such mTor/mTorc. In
general, "lean muscle mass" refers to the mass of muscle tissue in
the absence of other tissues such as fat.
[0128] The term "nucleic acid fragment" as used herein refers to a
nucleic acid sequence that has a deletion, e.g., a 5'-terminal or
3'-terminal deletion compared to a full-length reference nucleotide
sequence. In an embodiment, the nucleic acid fragment is a
contiguous sequence in which the nucleotide sequence of the
fragment is identical to the corresponding positions in the
naturally-occurring sequence. In some embodiments, fragments are at
least 10, 15, 20, or 25 nucleotides long, or at least 20, 30, 40,
50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 nucleotides
long. In some embodiments a fragment of a nucleic acid sequence is
a fragment of an open reading frame sequence. In some embodiments
such a fragment encodes a polypeptide fragment (as defined herein)
of the protein encoded by the open reading frame nucleotide
sequence.
[0129] A composition, formulation or product is "nutritional" or
"nutritive" if it provides an appreciable amount of nourishment to
its intended consumer, meaning the consumer assimilates all or a
portion of the composition or formulation into a cell, organ,
and/or tissue. Generally such assimilation into a cell, organ
and/or tissue provides a benefit or utility to the consumer. e.g.,
by maintaining or improving the health and/or natural function(s)
of said cell, organ, and/or tissue. A nutritional composition or
formulation that is assimilated as described herein is termed
"nutrition." By way of non-limiting example, a polypeptide is
nutritional if it provides an appreciable amount of polypeptide
nourishment to its intended consumer, meaning the consumer
assimilates all or a portion of the protein, typically in the form
of single amino acids or small peptides, into a cell, organ, and/or
tissue. "Nutrition" also means the process of providing to a
subject, such as a human or other mammal, a nutritional
composition, formulation, product or other material. A nutritional
product need not be "nutritionally complete," meaning if consumed
in sufficient quantity, the product provides all carbohydrates,
lipids, essential fatty acids, essential amino acids, conditionally
essential amino acids, vitamins, and minerals required for health
of the consumer. Additionally, a "nutritionally complete protein"
contains all protein nutrition required (meaning the amount
required for physiological normalcy by the organism) but does not
necessarily contain micronutrients such as vitamins and minerals,
carbohydrates or lipids.
[0130] In preferred embodiments, a composition or formulation is
nutritional in its provision of polypeptide capable of
decomposition (i.e., the breaking of a peptide bond, often termed
protein digestion) to single amino acids and/or small peptides
(e.g., two amino acids, three amino acids, or four amino acids,
possibly up to ten amino acids) in an amount sufficient to provide
a "nutritional benefit." In addition, in certain embodiments
provided are nutritional polypeptides that transit across the
gastrointestinal wall and are absorbed into the bloodstream as
small peptides (e.g., larger than single amino acids but smaller
than about ten amino acids) or larger peptides, oligopeptides or
polypeptides (e.g., >11 amino acids). A nutritional benefit in a
polypeptide-containing composition can be demonstrated and,
optionally, quantified, by a number of metrics. For example, a
nutritional benefit is the benefit to a consuming organism
equivalent to or greater than at least about 0.5% of a reference
daily intake value of protein, such as about 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or greater than about 100%
of a reference daily intake value. Alternatively, a nutritional
benefit is demonstrated by the feeling and/or recognition of
satiety by the consumer. In other embodiments, a nutritional
benefit is demonstrated by incorporation of a substantial amount of
the polypeptide component of the composition or formulation into
the cells, organs and/or tissues of the consumer, such
incorporation generally meaning that single amino acids or short
peptides are used to produce polypeptides de novo intracellularly.
A "consumer" or a "consuming organism" means any animal capable of
ingesting the product having the nutritional benefit. Typically,
the consumer will be a mammal such as a healthy human, e.g., a
healthy infant, child, adult, or older adult. Alternatively, the
consumer will be a mammal such as a human (e.g., an infant, child,
adult or older adult) at risk of developing or suffering from a
disease, disorder or condition characterized by (i) the lack of
adequate nutrition and/or (ii) the alleviation thereof by the
nutritional products of the present invention. An "infant" is
generally a human under about age 1 or 2, a "child" is generally a
human under about age 18, and an "older adult" or "elderly" human
is a human aged about 65 or older.
[0131] In other preferred embodiments, a composition or formulation
is nutritional in its provision of carbohydrate capable of
hydrolysis by the intended consumer (termed a "nutritional
carbohydrate"). A nutritional benefit in a carbohydrate-containing
composition can be demonstrated and, optionally, quantified, by a
number of metrics. For example, a nutritional benefit is the
benefit to a consuming organism equivalent to or greater than at
least about 2% of a reference daily intake value of
carbohydrate.
[0132] A polypeptide "nutritional domain" as used herein means any
domain of a polypeptide that is capable of providing nutrition.
Preferably, a polypeptide nutritional domain provides one or more
advantages over the full-length polypeptide containing the
nutritional domain, such as the nutritional domain provides more
nutrition than the full-length polypeptide. For example, a
polypeptide nutritional domain has a higher concentration of
desirable amino acids, has a lower concentration of undesirable
amino acids, contains a site for cleavage by a digestive protease,
is easier to digest and/or is easier to produce from the digestion
of a larger polypeptide, has improved storage characteristics, or a
combination of these and/or other factors, in comparison to (i) a
reference polypeptide or a reference polypeptide-containing mixture
or composition, (ii) the protein(s) or polypeptide(s) present in an
agriculturally-derived food product, and/or (iii) the protein or
polypeptide products present in the diet of a mammalian subject.
Other advantages of a polypeptide nutritional domain includes
easier and/or more efficient production, different or more
advantageous physiochemical properties, and/or has different s or
more advantageous safety properties (e.g., elimination of one or
more allergy domains) relative to full-length polypeptide. A
reference polypeptide can be a naturally occurring polypeptide or a
recombinantly produced polypeptide, which in turn may have an amino
acid sequence identical to or different from a naturally occurring
polypeptide. A reference polypeptide may also be a consensus amino
acid sequence not present in a naturally-occurring polypeptide.
Additionally, a reference polypeptide-containing mixture or
composition can be a naturally-occurring mixture, such as a mixture
of polypeptides present in a dairy product such as milk or whey, or
can be a synthetic mixture of polypeptides (which, in turn, can be
naturally-occurring or synthetic). In certain embodiments the
nutritional domain contains an amino acid sequence having an
N-terminal amino acid and/or a C-terminal amino acid different from
the N-terminal amino acid and/or a C-terminal amino acid of a
reference secreted polypeptide, such as a full-length secreted
polypeptide. For example, a nutritional domain has an N-terminal
amino acid sequence that corresponds to an amino acid sequence
internal to a larger secreted polypeptide that contains the
nutritional domain. A nutritional domain may include or exclude a
signal sequence of a larger secreted polypeptide. As used herein, a
polypeptide that "contains" a polypeptide nutritional domain
contains the entirety of the polypeptide nutritional domain as well
as at least one additional amino acid, either N-terminal or
C-terminal to the polypeptide nutritional domain. Generally
polypeptide nutritional domains are secreted from the cell or
organism containing a nucleic acid encoding the nutritional domain,
and are termed "secreted polypeptide nutritional domains." and, in
circumstances wherein the nutritional domain is secreted from a
unicellular (or single celled) organism, it is termed a
"unicellular secreted polypeptide nutritional domain."
[0133] In other preferred embodiments, a composition or formulation
is nutritional in its provision of lipid capable of digestion,
incorporation, conversion, or other cellular uses by the intended
consumer (termed a "nutritional lipid"). A nutritional benefit in a
lipid-containing composition can be demonstrated and, optionally,
quantified, by a number of metrics. For example, a nutritional
benefit is the benefit to a consuming organism equivalent to or
greater than at least about 2% of a reference daily intake value of
lipid (i.e., fat).
[0134] As used herein, an "obese" subject has a level of excess
body fat that, increasing the likelihood of the subject suffering
from diseases including heart disease, type II diabetes,
osteoporosis and osteoarthritis, and cancer, while an "overweight"
subject is above a weight recognized as normal, acceptable, or
desirable, but not obese. In Western countries, a subject having a
BMI value exceeding 30 is considered obese, while a subject having
a BMI value between 25-30 is considered overweight.
[0135] As used herein, "operatively linked" or "operably linked"
expression control sequences refers to a linkage in which the
expression control sequence is contiguous with the gene of interest
to control the gene of interest, as well as expression control
sequences that act in trans or at a distance to control the gene of
interest.
[0136] The term "percent sequence identity" or "identical" in the
context of nucleic acid sequences refers to the residues in the two
sequences that are the same when aligned for maximum
correspondence. There are a number of different algorithms known in
the art that can be used to measure nucleotide sequence identity.
For instance, polynucleotide sequences can be compared using FASTA,
Gap or Bestfit, which are programs in Wisconsin Package Version
10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA provides
alignments and percent sequence identity of the regions of the best
overlap between the query and search sequences. Pearson. Methods
Enzymol. 183:63-98 (1990).
[0137] The term "polynucleotide," "nucleic acid molecule," "nucleic
acid," or "nucleic acid sequence" refers to a polymeric form of
nucleotides of at least 10 bases in length. The term includes DNA
molecules (e.g., cDNA or genomic or synthetic DNA) and RNA
molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA
or RNA containing non-natural nucleotide analogs, non-native
internucleoside bonds, or both. The nucleic acid can be in any
topological conformation. For instance, the nucleic acid can be
single-stranded, double-stranded, triple-stranded, quadruplexed,
partially double-stranded, branched, hairpinned, circular, or in a
padlocked conformation. A "synthetic" RNA, DNA or a mixed polymer
is one created outside of a cell, for example one synthesized
chemically. The term "nucleic acid fragment" as used herein refers
to a nucleic acid sequence that has a deletion, e.g., a 5'-terminal
or 3'-terminal deletion of one or more nucleotides compared to a
full-length reference nucleotide sequence. In an embodiment, the
nucleic acid fragment is a contiguous sequence in which the
nucleotide sequence of the fragment is identical to the
corresponding positions in the naturally-occurring sequence. In
some embodiments, fragments are at least 10, 15, 20, or 25
nucleotides long, or at least 20, 30, 40, 50, 60, 70, 80, 90, 100,
110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 450, 500, 550,
600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300,
1400, 1500, 1600, 1700, 1800 or greater than 1800 nucleotides long.
In some embodiments a fragment of a nucleic acid sequence is a
fragment of an open reading frame sequence. In some embodiments
such a fragment encodes a polypeptide fragment (as defined herein)
of the polypeptide encoded by the open reading frame nucleotide
sequence.
[0138] The terms "polypeptide" and "protein" can be interchanged,
and these terms encompass both naturally-occurring and
non-naturally occurring polypeptides, and, as provided herein or as
generally known in the art, fragments, mutants, derivatives and
analogs thereof. A polypeptide can be monomeric, meaning it has a
single chain, or polymeric, meaning it is composed of two or more
chains, which can be covalently or non-covalently associated.
Further, a polypeptide may comprise a number of different domains
each of which has one or more distinct activities. For the
avoidance of doubt, a polypeptide can be any length greater than or
equal to two amino acids. The term "isolated polypeptide" is a
polypeptide that by virtue of its origin or source of derivation
(1) is not associated with naturally associated components that
accompany it in any of its native states, (2) exists in a purity
not found in nature, where purity can be adjudged with respect to
the presence of other cellular material (e.g., is free of other
polypeptides from the same species or from the host species in
which the polypeptide was produced) (3) is expressed by a cell from
a different species, (4) is recombinantly expressed by a cell
(e.g., a polypeptide is an "isolated polypeptide" if it is produced
from a recombinant nucleic acid present in a host cell and
separated from the producing host cell, (5) does not occur in
nature (e.g., it is a domain or other fragment of a polypeptide
found in nature or it includes amino acid analogs or derivatives
not found in nature or linkages other than standard peptide bonds),
or (6) is otherwise produced, prepared, and/or manufactured by the
hand of man. Thus, an "isolated polypeptide" includes a polypeptide
that is produced in a host cell from a recombinant nucleic acid
(such as a vector), regardless of whether the host cell naturally
produces a polypeptide having an identical amino acid sequence. A
"polypeptide" includes a polypeptide that is produced by a host
cell via overexpression, e.g., homologous overexpression of the
polypeptide from the host cell such as by altering the promoter of
the polypeptide to increase its expression to a level above its
normal expression level in the host cell in the absence of the
altered promoter. A polypeptide that is chemically synthesized or
synthesized in a cellular system different from a cell from which
it naturally originates will be "isolated" from its naturally
associated components. A polypeptide may also be rendered
substantially free of naturally associated components by isolation,
using protein purification techniques well known in the art. As
thus defined, "isolated" does not necessarily require that the
protein, polypeptide, peptide or oligopeptide so described has been
physically removed from a cell in which it was synthesized.
[0139] The term "polypeptide fragment" or "protein fragment" as
used herein refers to a polypeptide or domain thereof that has less
amino acids compared to a reference polypeptide, e.g., a
full-length polypeptide or a polypeptide domain of a naturally
occurring protein. A "naturally occurring protein" or "naturally
occurring polypeptide" includes a polypeptide having an amino acid
sequence produced by a non-recombinant cell or organism. In an
embodiment, the polypeptide fragment is a contiguous sequence in
which the amino acid sequence of the fragment is identical to the
corresponding positions in the naturally-occurring sequence.
Fragments typically are at least 5, 6, 7, 8, 9 or 10 amino acids
long, or at least 12, 14, 16 or 18 amino acids long, or at least 20
amino acids long, or at least 25, 30, 35, 40 or 45, amino acids, or
at least 50, 60, 70, 80, 90 or 100 amino acids long, or at least
110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 amino acids
long, or 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475,
500, 525, 550, 575, 600 or greater than 600 amino acids long. A
fragment can be a portion of a larger polypeptide sequence that is
digested inside or outside the cell. Thus, a polypeptide that is 50
amino acids in length can be produced intracellularly, but
proteolyzed inside or outside the cell to produce a polypeptide
less than 50 amino acids in length. This is of particular
significance for polypeptides shorter than about 25 amino acids,
which can be more difficult than larger polypeptides to produce
recombinantly or to purify once produced recombinantly. The term
"peptide" as used herein refers to a short polypeptide or
oligopeptide, e.g., one that typically contains less than about 50
amino acids and more typically less than about 30 amino acids, or
more typically less than about 15 amino acids, such as less than
about 10, 9, 8, 7, 6, 5, 4, or 3 amino acids. The term as used
herein encompasses analogs and mimetics that mimic structural and
thus biological function.
[0140] As used herein, "polypeptide mutant" or "mutein" refers to a
polypeptide whose sequence contains an insertion, duplication,
deletion, rearrangement or substitution of one or more amino acids
compared to the amino acid sequence of a reference protein or
polypeptide, such as a native or wild-type protein. A mutein may
have one or more amino acid point substitutions, in which a single
amino acid at a position has been changed to another amino acid,
one or more insertions and/or deletions, in which one or more amino
acids are inserted or deleted, respectively, in the sequence of the
reference protein, and/or truncations of the amino acid sequence at
either or both the amino or carboxy termini. A mutein may have the
same or a different biological activity compared to the reference
protein. In some embodiments, a mutein has, for example, at least
85% overall sequence homology to its counterpart reference protein.
In some embodiments, a mutein has at least 90% overall sequence
homology to the wild-type protein. In other embodiments, a mutein
exhibits at least 95% sequence identity, or 98%, or 99%, or 99.5%
or 99.9% overall sequence identity.
[0141] As used herein, a "polypeptide tag for affinity
purification" is any polypeptide that has a binding partner that
can be used to isolate or purify a second protein or polypeptide
sequence of interest fused to the first "tag" polypeptide. Several
examples are well known in the art and include a His-6 tag, a FLAG
epitope, a c-myc epitope, a Strep-TAGII, a biotin tag, a
glutathione 5-transferase (GST), a chitin binding protein (CBP), a
maltose binding protein (MBP), or a metal affinity tag.
[0142] As used herein, "protein-energy malnutrition" refers to a
form of malnutrition where there is inadequate protein intake.
Types include Kwashiorkor (protein malnutrition predominant),
Marasmus (deficiency in both calorie and protein nutrition), and
Marasmic Kwashiorkor (marked protein deficiency and marked calorie
insufficiency signs present, sometimes referred to as the most
severe form of malnutrition). "Malnourishment" and "malnutrition"
are used equivalently herein.
[0143] The terms "purify," "purifying" and "purified" refer to a
substance (or entity, composition, product or material) that has
been separated from at least some of the components with which it
was associated either when initially produced (whether in nature or
in an experimental setting), or during any time after its initial
production. A substance such as a nutritional polypeptide will be
considered purified if it is isolated at production, or at any
level or stage up to and including a final product, but a final
product may contain other materials up to about 10%, about 20%,
about 30%, about 40%, about 50%, about 60%, about 70%, about 80%,
about 90%, or above about 90% and still be considered "isolated."
Purified substances or entities can be separated from at least
about 10%, about 20%, about 30%, about 40%, about 50%, about 60%,
about 70%, about 80%, about 90%, or more of the other components
with which they were initially associated. In some embodiments,
purified substances are more than about 80%, about 85%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98%, about 99%, or more than about 99% pure. In
the instance of polypeptides and other polypeptides provided
herein, such a polypeptide can be purified from one or more other
polypeptides capable of being secreted from the unicellular
organism that secretes the polypeptide. As used herein, a
polypeptide substance is "pure" if it is substantially free of
other components or other polypeptide components.
[0144] As used herein, "recombinant" refers to a biomolecule, e.g.,
a gene or polypeptide, that (1) has been removed from its naturally
occurring environment, (2) is not associated with all or a portion
of a polynucleotide in which the gene is found in nature, (3) is
operatively linked to a polynucleotide which it is not linked to in
nature, or (4) does not occur in nature. Also, "recombinant" refers
to a cell or an organism, such as a unicellular organism, herein
termed a "recombinant unicellular organism," a "recombinant host"
or a "recombinant cell" that contains, produces and/or secretes a
biomolecule, which can be a recombinant biomolecule or a
non-recombinant biomolecule. For example, a recombinant unicellular
organism may contain a recombinant nucleic acid providing for
enhanced production and/or secretion of a recombinant polypeptide
or a non-recombinant polypeptide. A recombinant cell or organism,
is also intended to refer to a cell into which a recombinant
nucleic acid such as a recombinant vector has been introduced. A
"recombinant unicellular organism" includes a recombinant
microorganism host cell and refers not only to the particular
subject cell but to the progeny of such a cell. Because certain
modifications may occur in succeeding generations due to either
mutation or environmental influences, such progeny may not, in
fact, be identical to the parent cell, but are still included
within the scope of the terms herein. The term "recombinant" can be
used in reference to cloned DNA isolates, chemically-synthesized
polynucleotide analogs, or polynucleotide analogs that are
biologically synthesized by heterologous systems, as well as
polypeptides and/or mRNAs encoded by such nucleic acids. Thus, for
example, a polypeptide synthesized by a microorganism is
recombinant, for example, if it is produced from an mRNA
transcribed from a recombinant gene or other nucleic acid sequence
present in the cell.
[0145] As used herein, an endogenous nucleic acid sequence in the
genome of an organism (or the encoded polypeptide product of that
sequence) is deemed "recombinant" herein if a heterologous sequence
is placed adjacent to the endogenous nucleic acid sequence, such
that the expression of this endogenous nucleic acid sequence is
altered. In this context, a heterologous sequence is a sequence
that is not naturally adjacent to the endogenous nucleic acid
sequence, whether or not the heterologous sequence is itself
endogenous (originating from the same host cell or progeny thereof)
or exogenous (originating from a different host cell or progeny
thereof). By way of example, a promoter sequence can be substituted
(e.g., by homologous recombination) for the native promoter of a
gene in the genome of a host cell, such that this gene has an
altered expression pattern. This gene would now become
"recombinant" because it is separated from at least some of the
sequences that naturally flank it. A nucleic acid is also
considered "recombinant" if it contains any modifications that do
not naturally occur to the corresponding nucleic acid in a genome.
For instance, an endogenous coding sequence is considered
"recombinant" if it contains an insertion, deletion or a point
mutation introduced artificially, e.g., by human intervention. A
"recombinant nucleic acid" also includes a nucleic acid integrated
into a host cell chromosome at a heterologous site and a nucleic
acid construct present as an episome.
[0146] The term "recombinant host cell" (or simply "recombinant
cell" or "host cell"), as used herein, is intended to refer to a
cell into which a recombinant nucleic acid such as a recombinant
vector has been introduced. In some instances the word "cell" is
replaced by a name specifying a type of cell. For example, a
"recombinant microorganism" is a recombinant host cell that is a
microorganism host cell and a "recombinant cyanobacteria" is a
recombinant host cell that is a cyanobacteria host cell. It should
be understood that such terms are intended to refer not only to the
particular subject cell but to the progeny of such a cell. Because
certain modifications may occur in succeeding generations due to
either mutation or environmental influences, such progeny may not,
in fact, be identical to the parent cell, but are still included
within the scope of the term "recombinant host cell," "recombinant
cell," and "host cell", as used herein. A recombinant host cell can
be an isolated cell or cell line grown in culture or can be a cell
which resides in a living tissue or organism.
[0147] As used herein, "sarcopenia" refers to the degenerative loss
of skeletal muscle mass (typically 0.5-1% loss per year after the
age of 25), quality, and strength associated with aging. Sarcopenia
is a component of the frailty syndrome. The European Working Group
on Sarcopenia in Older People (EWGSOP) has developed a practical
clinical definition and consensus diagnostic criteria for
age-related sarcopenia. For the diagnosis of sarcopenia, the
working group has proposed using the presence of both low muscle
mass and low muscle function (strength or performance). Sarcopenia
is characterized first by a muscle atrophy (a decrease in the size
of the muscle), along with a reduction in muscle tissue "quality,"
caused by such factors as replacement of muscle fibres with fat, an
increase in fibrosis, changes in muscle metabolism, oxidative
stress, and degeneration of the neuromuscular junction. Combined,
these changes lead to progressive loss of muscle function and
eventually to frailty. Frailty is a common geriatric syndrome that
embodies an elevated risk of catastrophic declines in health and
function among older adults. Contributors to frailty can include
sarcopenia, osteoporosis, and muscle weakness. Muscle weakness,
also known as muscle fatigue, (or "lack of strength") refers to the
inability to exert force with one's skeletal muscles. Weakness
often follows muscle atrophy and a decrease in activity, such as
after a long bout of bedrest as a result of an illness. There is
also a gradual onset of muscle weakness as a result of sarcopenia.
Thus, sarcopenia is an exemplary condition associated with muscle
wasting.
[0148] As used herein, "satiation" is the act of becoming full
while eating or a reduced desire to eat. This halts or diminishes
eating.
[0149] As used herein, "satiety" is the act of remaining full after
a meal which manifests as the period of no eating follow the
meal.
[0150] As used herein, "secrete." "secretion" and "secreted" all
refer to the act or process by which a polypeptide is relocated
from the cytoplasm of a cell of a multicellular organism or
unicellular organism into the extracellular milieu thereof. As
provided herein, such secretion may occur actively or passively.
Further, the terms "excrete," "excretion" and "excreted" generally
connote passive clearing of a material from a cell or unicellular
organism: however, as appropriate such terms can be associated with
the production and transfer of materials outwards from the cell or
unicellular organism.
[0151] In general, "stringent hybridization" is performed at about
25.degree. C. below the thermal melting point (Tm) for the specific
DNA hybrid under a particular set of conditions. "Stringent
washing" is performed at temperatures about 5.degree. C. lower than
the Tm for the specific DNA hybrid under a particular set of
conditions. The Tm is the temperature at which 50% of the target
sequence hybridizes to a perfectly matched probe. See Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), page
9.51, hereby incorporated by reference. For purposes herein,
"stringent conditions" are defined for solution phase hybridization
as aqueous hybridization (i.e., free of formamide) in 6.times.SSC
(where 20.times.SSC contains 3.0 M NaCl and 0.3 M sodium citrate),
1% SDS at 65.degree. C. for 8-12 hours, followed by two washes in
0.2.times.SSC, 0.1% SDS at 65.degree. C. for 20 minutes. It will be
appreciated by the skilled worker that hybridization at 65.degree.
C. will occur at different rates depending on a number of factors
including the length and percent identity of the sequences which
are hybridizing.
[0152] The term "substantial homology" or "substantial similarity,"
when referring to a nucleic acid or fragment thereof, indicates
that, when optimally aligned with appropriate nucleotide insertions
or deletions with another nucleic acid (or its complementary
strand), there is nucleotide sequence identity in at least about
76%, 80%, 85%, or at least about 90%, or at least about 95%, 96%,
97%, 98% or 99% of the nucleotide bases, as measured by any
well-known algorithm of sequence identity, such as FASTA, BLAST or
Gap, as discussed above.
[0153] The term "sufficient amount" means an amount sufficient to
produce a desired effect. e.g., an amount sufficient to modulate
protein aggregation in a cell.
[0154] A "synthetic" RNA, DNA or a mixed polymer is one created
outside of a cell, for example one synthesized chemically.
[0155] The term "therapeutically effective amount" is an amount
that is effective to ameliorate a symptom of a disease. A
therapeutically effective amount can be a "prophylactically
effective amount" as prophylaxis can be considered therapy.
[0156] As used herein, "thermogenesis" is the process of heat
production in a mammal. Thermogenesis is accompanied by an increase
in energy expenditure. Thermogenesis is specifically the energy
burned following the metabolism of a food component (such as
protein). This may also be referred to as the thermic effect of
food. Total energy expenditure by an individual equals the sum of
resting energy expenditure (energy consumed at rest in a fasting
state to support basal metabolism), the thermic effect of food, and
energy expenditure related to physical activity. Resting energy
expenditure accounts for about 65-75% of total energy expenditure
in humans. The amount and activity of muscle mass is one influencer
of resting energy expenditure. Adequate protein consumption to
support muscle also influences resting energy expenditure. The
ingestion of protein tends to increase energy expenditure following
a meal; this is the thermic effect of food. The thermic effect of
food accounts for about 10% of total energy expenditure in humans.
While this is a small proportion of total energy expenditure, small
increases in this value can impact body weight. Protein has a
higher thermic effect than fat or carbohydrate; this effect along
with other metabolic influences of protein makes it a useful
substrate for weight control, diabetes management and other
conditions.
[0157] As used herein, a "vector" is intended to refer to a nucleic
acid molecule capable of transporting another nucleic acid to which
it has been linked. One type of vector is a "plasmid," which
generally refers to a circular double stranded DNA loop into which
additional DNA segments can be ligated, but also includes linear
double-stranded molecules such as those resulting from
amplification by the polymerase chain reaction (PCR) or from
treatment of a circular plasmid with a restriction enzyme. Other
vectors include cosmids, bacterial artificial chromosomes (BAC) and
yeast artificial chromosomes (YAC). Another type of vector is a
viral vector, wherein additional DNA segments can be ligated into
the viral genome (discussed in more detail below). Certain vectors
are capable of autonomous replication in a host cell into which
they are introduced (e.g., vectors having an origin of replication
which functions in the host cell). Other vectors can be integrated
into the genome of a host cell upon introduction into the host
cell, and are thereby replicated along with the host genome.
Moreover, certain vectors are capable of directing the expression
of genes to which they are operatively linked. Such vectors are
referred to herein as "recombinant expression vectors" (or simply
"expression vectors").
Nutritive Polypeptides and Amino Acid Sequences
[0158] Proteins present in dietary food sources can vary greatly in
their nutritive value. Provided are nutritive polypeptides that
have enhanced nutritive value and physiological and pharmacological
effects due to their amino acid content and digestibility. Provided
are nutritive polypeptides that have enhanced levels of essential
amino acids, the inadequate availability of such essential amino
acids in a person negatively impacts general health and physiology
through the perturbation of a network of cellular functions, and is
associated with a wide array of health issues and diseases. Also
provided are nutritive polypeptides that have reduced levels of
certain amino acids, the presence or overabundance of such amino
acids in the diet of an affected subject results in increased
morbidity and mortality.
[0159] Traditionally, nutritionists and health researchers have
utilized specific source ingredients (e.g., whey protein, egg
whites, soya) or fractionates and isolates (e.g., soy protein
isolates) to modulate the relative concentration of total protein
in the diet, without the ability to modulate the specific amino
acid constituents.
[0160] Herein provided are nutritive polypeptides capable of
transforming health and treating, preventing and reducing the
severity of a multitude of diseases, disorders and conditions
associated with amino acid pathophysiology, as they are selected
for specific physiologic benefits to improve health and address
many nutrition-related conditions, including gastrointestinal
malabsorption, muscle wasting, diabetes or pre-diabetes, obesity,
oncology, metabolic diseases, and other cellular and systemic
diseases. Also provided are the compositions and formulations that
contain the nutritive polypeptides, as food, beverages, medical
foods, supplements, and pharmaceuticals.
[0161] Herein are provided important elucidations in the genomics,
proteomics, protein characterization and production of nutritive
polypeptides. The present invention utilizes the synergistic
advancements, described herein, of (a) the genomics of edible
species-those human food source organisms, and human genomics, (b)
substantial advances in protein identification and quantification
in food protein and food nucleic acid libraries, (c) new
correlations between protein physical chemistry, solubility,
structure-digestibility relationships and amino acid absorption and
metabolism in animals and humans. (d) physiology and
pathophysiology information of how amino acids, the components of
nutritive polypeptides, affect protein malnutrition, chronic
disease, responses to acute injury, and aging. (e) recombinant
nutritive polypeptide production utilizing a phylogenetically broad
spectrum of host organisms, (f) qualification of allergenicity and
toxicogenicity and in vitro and in vivo tests to assess human
safety of orally consumed nutritive polypeptides.
[0162] Identification and Selection of Amino Acid Sequences
Encoding Nutritive Polypeptides.
[0163] In its broadest sense, a nutritive polypeptide encompasses a
polypeptide capable of delivering amino acid and peptide nutrition
to its intended consumer, who derives a benefit from such
consumption. Each nutritive polypeptide contains one or more amino
acid sequences, and the present invention provides methods by which
an amino acid sequence is identified and utilized in production,
formulation and administration of the nutritive polypeptide having
such an amino acid sequence.
[0164] In some embodiments, the source of a nutritive polypeptide
amino acid sequence encompasses any protein-containing material,
e.g., a food, beverage, composition or other product, known to be
eaten, or otherwise considered suitable for consumption, without
deleterious effect by, e.g., a human or other organism, in
particular a mammal.
[0165] Nutritive Polypeptide Amino Acid Sequences Derived from
Edible Species.
[0166] In some embodiments a nutritive polypeptide comprises or
consists of a protein or fragment of a protein that naturally
occurs in an edible product, such as a food, or in the organism
that generates biological material used in or as the food. In some
embodiments an "edible species" is a species known to produce a
protein that can be eaten by humans without deleterious effect. A
protein or polypeptide present in an edible species, or encoded by
a nucleic acid present in the edible species, is termed an "edible
species protein" or "edible species polypeptide" or, if the edible
species is a species consumed by a human, the term "naturally
occurring human food protein" is used interchangeably herein. Some
edible products are an infrequent but known component of the diet
of only a small group of a type of mammal in a limited geographic
location while others are a dietary staple throughout much of the
world. In other embodiments an edible product is one not known to
be previously eaten by any mammal, but that is demonstrated to be
edible upon testing or analysis of the product or one or more
proteins contained in the product.
[0167] Food organisms include but are not limited to those
organisms of edible species disclosed in PCT/US2013/032232, filed
Mar. 15, 2013, PCT/US2013/032180, filed Mar. 15, 2013,
PCT/US2013/032225, filed Mar. 15, 2013, PCT/US2013/032218, filed
Mar. 15, 2013, PCT/US2013/032212, filed Mar. 15, 2013,
PCT/US2013/032206, filed Mar. 15, 2013, and PCT/US2013/038682,
filed Apr. 29, 2013 and any phylogenetically related organisms.
[0168] In some embodiments a nutritive polypeptide amino acid
sequence is identified in a protein that is present in a food
source, such as an abundant protein in food, or is a derivative or
mutein thereof, or is a fragment of an amino acid sequence of a
protein in food or a derivative or mutein thereof. An abundant
protein is a protein that is present in a higher concentration in a
food relative to other proteins present in the food. Alternatively,
a nutritive polypeptide amino acid sequence is identified from an
edible species that produces a protein containing the amino acid
sequence in relatively lower abundance, but the protein is
detectable in a food product derived from the edible species, or
from biological material produced by the edible species. In some
embodiments a nucleic acid that encodes the protein is detectable
in a food product derived from the edible species, or the nucleic
acid is detectable from a biological material produced by the
edible species. An edible species can produce a food that is a
known component of the diet of only a small group of a type of
mammal in a limited geographic location, or a dietary staple
throughout much of the world.
[0169] Exemplary edible species include animals such as goats,
cows, chickens, pigs and fish. In some embodiments the abundant
protein in food is selected from chicken egg proteins such as
ovalbumin. ovotransferrin, and ovomucuoid; meat proteins such as
myosin, actin, tropomyosin, collagen, and troponin; cereal proteins
such as casein, alpha1 casein, alpha2 casein, beta casein, kappa
casein, beta-lactoglobulin, alpha-lactalbumin. glycinin,
beta-conglycinin, glutelin, prolamine, gliadin, glutenin, albumin,
globulin; chicken muscle proteins such as albumin, enolase,
creatine kinase, phosphoglycerate mutase, triosephosphate
isomerase, apolipoprotein, ovotransferrin, phosphoglucomutase,
phosphoglycerate kinase, glycerol-3-phosphate dehydrogenase,
glyceraldehyde 3-phosphate dehydrogenase, hemoglobin, cofilin,
glycogen phosphorylase, fructose-1,6-bisphosphatase, actin, myosin,
tropomyosin a-chain, casein kinase, glycogen phosphorylase,
fructose-1,6-bisphosphatase, aldolase, tubulin, vimentin,
endoplasmin, lactate dehydrogenase, destrin, transthyretin,
fructose bisphosphate aldolase, carbonic anhydrase, aldehyde
dehydrogenase, annexin, adenosyl homocysteinase; pork muscle
proteins such as actin, myosin, enolase, titin, cotilin,
phosphoglycerate kinase, enolase, pyruvate dehydrogenase, glycogen
phosphorylase, triosephosphate isomerase, myokinase; and fish
proteins such as parvalbumin, pyruvate dehydrogenase, desmin, and
triosephosphate isomerase.
[0170] Nutritive polypeptides may contain amino acid sequences
present in edible species polypeptides. In one embodiment, a
biological material from an edible species is analyzed to determine
the protein content in the biological material. An exemplary method
of analysis is to use mass spectrometry analysis of the biological
material, as provided in the Examples below. Another exemplary
method of analysis is to generate a cDNA library of the biological
material to create a library of edible species cDNAs, and then
express the cDNA library in an appropriate recombinant expression
host, as provided in the Examples below. Another exemplary method
of analysis is query a nucleic acid and/or protein sequence
database as provided in the Examples below.
[0171] Determination of amino acid ratios and amino acid density in
a nutritive polypeptide. In some instances herein the portion of
amino acid(s) of a particular type within a polypeptide, protein or
a composition is quantified based on the weight ratio of the type
of amino acid(s) to the total weight of amino acids present in the
polypeptide, protein or composition in question. This value is
calculated by dividing the weight of the particular amino acid(s)
in the polypeptide, protein or a composition by the weight of all
amino acids present in the polypeptide, protein or a
composition.
[0172] In other instances the ratio of a particular type of amino
acid(s) residues present in a polypeptide or protein to the total
number of amino acids present in the polypeptide or protein in
question is used. This value is calculated by dividing the number
of the amino acid(s) in question that is present in each molecule
of the polypeptide or protein by the total number of amino acid
residues present in each molecule of the polypeptide or protein. A
skilled artisan appreciates that these two methods are
interchangeable and that the weight proportion of a type of amino
acid(s) present in a polypeptide or protein can be converted to a
ratio of the particular type of amino acid residue(s), and vice
versa.
[0173] In some aspects the nutritive polypeptide is selected to
have a desired density of one or more essential amino acids (EAA).
Essential amino acid deficiency can be treated or prevented with
the effective administration of the one or more essential amino
acids otherwise absent or present in insufficient amounts in a
subject's diet. For example, EAA density is about equal to or
greater than the density of essential amino acids present in a
full-length reference nutritional polypeptide, such as bovine
lactoglobulin, bovine beta-casein or bovine type I collagen, e.g.,
EAA density in a nutritive polypeptide is at least about 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500% or above 500%
greater than a reference nutritional polypeptide or the polypeptide
present in an agriculturally-derived food product.
[0174] In some aspects the nutritive polypeptide is selected to
have a desired density of aromatic amino acids ("AAA", including
phenylalanine, tryptophan, tyrosine, histidine, and thyroxine).
AAAs are useful, e.g., in neurological development and prevention
of exercise-induced fatigue. For example, AAA density is about
equal to or greater than the density of essential amino acids
present in a full-length reference nutritional polypeptide, such as
bovine lactoglobulin, bovine beta-casein or bovine type I collagen,
e.g., AAA density in a nutritive polypeptide is at least about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500% or above 500%
greater than a reference nutritional polypeptide or the polypeptide
present in an agriculturally-derived food product.
[0175] In some aspects the nutritive polypeptide is selected to
have a desired density of branched chain amino acids (BCAA). For
example, BCAA density, either individual BCAAs or total BCAA
content is about equal to or greater than the density of branched
chain amino acids present in a full-length reference nutritional
polypeptide, such as bovine lactoglobulin, bovine beta-casein or
bovine type I collagen, e.g., BCAA density in a nutritive
polypeptide is at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%,
200%, 300%, 400%, 500% or above 500% greater than a reference
nutritional polypeptide or the polypeptide present in an
agriculturally-derived food product. BCAA density in a nutritive
polypeptide can also be selected for in combination with one or
more attributes such as EAA density.
[0176] In some aspects the nutritive polypeptide is selected to
have a desired density of amino acids arginine, glutamine and/or
leucine (RQL amino acids). For example, RQL amino acid density is
about equal to or greater than the density of essential amino acids
present in a full-length reference nutritional polypeptide, such as
bovine lactoglobulin, bovine beta-casein or bovine type I collagen,
e.g., RQL amino acid density in a nutritive polypeptide is at least
about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500% or
above 500% greater than a reference nutritional polypeptide or the
polypeptide present in an agriculturally-derived food product.
[0177] In some aspects the nutritive polypeptide is selected to
have a desired density or distribution of post-translational
modifications (PTMs). For example, PTMs include addition, removal
or redistribution of biotinylation, pegylation, acylation,
alkylation, butyrylation glycosylation, hydroxylation, iodination,
oxidation, propionylation, malonylation, myristoylation,
palmitoylation, isoprenylation, succinylation, selenoylation,
SUMOylation, ubiquitination, and glypiation removal or
redistribution of disulfide bridges.
[0178] In certain embodiments herein the weight proportion of
branched chain amino acids, leucine, and/or essential amino acids
in whey, egg, or soy is used as a benchmark to measure the amino
acid composition of a polypeptide, a protein, or a composition
comprising at least one of a polypeptide and a protein. In those
embodiments it is understood that the two measures are not
completely equivalent, but it is also understood that the measures
result in measurements that are similar enough to use for this
purpose. For example, when a protein of interest is characterized
as comprising a ratio of branched chain amino acid residues to
total amino acid residues that is equal to or greater than 24% (the
weight proportion of branched chain amino acid residues present in
whey), that is a precise description of the branched chain amino
acid content of the protein. At the same time, the weight
proportion of branched chain amino acid residues present in that
protein is not necessarily exactly equal to 24%. Even so, the
skilled artisan understands that this is a useful comparison. If
provided with the total number of amino acid residues present in
the protein of interest the skilled artisan can also determine the
weight proportion of branched chain amino acid residues in the
protein of interest.
[0179] In some embodiments a protein according to this disclosure
comprises a first polypeptide sequence comprising a fragment of an
edible species polypeptide. In some embodiments of the nutritive
protein, the protein consists of the first polypeptide sequence. In
some embodiments of the nutritive protein, the protein consists of
the fragment of an edible species polypeptide.
[0180] In some embodiments a protein according to this disclosure
comprises a first polypeptide sequence that comprises ratio of
branched chain amino acid residues to total amino acid residues
that is equal to or greater than the ratio of branched chain amino
acid residues to total amino acid residues present in at least one
of whey protein, egg protein, and soy protein. Thus, in such
embodiments the protein comprises a first polypeptide sequence that
comprises a ratio of branched chain amino acid residues to total
amino acid residues that is equal to or greater than a ratio
selected from 24%, 20%, and 18%. In other embodiments, the protein
comprises a first polypeptide sequence that comprises a ratio of
branched chain amino acid residues to total amino acid residues
that is equal to or greater than a percentage ratio selected from
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
75, 80, 85, 90, 95, or 100%.
[0181] In some embodiments a protein according to this disclosure
comprises a first polypeptide sequence that comprises a ratio of L
(leucine) residues to total amino acid residues that is equal to or
greater than the ratio of L residues to total amino acid residues
present in at least one of whey protein, egg protein, and soy
protein. In other embodiments, the protein comprises a first
polypeptide sequence that comprises a ratio of leucine residues to
total amino acid residues that is equal to or greater than a
percentage ratio selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, II,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, or greater than 30%.
[0182] In some embodiments a protein according to this disclosure
comprises a first polypeptide sequence that comprises a ratio of
essential amino acid residues to total amino acid residues that is
equal to or greater than the ratio of essential amino acid residues
to total amino acid residues present in at least one of whey
protein, egg protein, and soy protein. In other embodiments, the
protein comprises a first polypeptide sequence that comprises a
ratio of essential chain amino acid residues to total amino acid
residues that is equal to or greater than a percentage ratio
selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 75, 80, 85, 90, 95, or 100%.
[0183] In some embodiments the protein comprises a first
polypeptide sequence that comprises a ratio of branched chain amino
acid residues to total amino acid residues that is equal to or
greater than the ratio of branched chain amino acid residues to
total amino acid residues present in at least one of whey protein,
egg protein, and soy protein; and/or comprises a first polypeptide
sequence that comprises a ratio of L (leucine) residues to total
amino acid residues that is equal to or greater than the ratio of L
residues to total amino acid residues present in at least one of
whey protein, egg protein, and soy protein, and/or comprises a
first polypeptide sequence that comprises a ratio of essential
amino acid residues to total amino acid residues that is equal to
or greater than the ratio of essential amino acid residues to total
amino acid residues present in at least one of whey protein, egg
protein, and soy protein.
[0184] In some embodiments the protein comprises a first
polypeptide sequence that comprises a ratio of branched chain amino
acid residues to total amino acid residues that is equal to or
greater than the ratio of branched chain amino acid residues to
total amino acid residues present in at least one of whey protein,
egg protein, and soy protein; and comprises a first polypeptide
sequence that comprises a ratio of essential amino acid residues to
total amino acid residues that is equal to or greater than the
ratio of essential amino acid residues to total amino acid residues
present in at least one of whey protein, egg protein, and soy
protein. In some embodiments the protein comprises a first
polypeptide sequence that comprises a ratio of branched chain amino
acid residues to total amino acid residues equal to or greater than
24% and a ratio of essential amino acid residues to total amino
acid residues that is equal to or greater than 49%. In some
embodiments the protein comprises a first polypeptide sequence that
comprises a ratio of branched chain amino acid residues to total
amino acid residues equal to or greater than 20% and a ratio of
essential amino acid residues to total amino acid residues that is
equal to or greater than 51%. In some embodiments the protein
comprises a first polypeptide sequence that comprises a ratio of
branched chain amino acid residues to total amino acid residues
equal to or greater than 18% and a ratio of essential amino acid
residues to total amino acid residues that is equal to or greater
than 40%.
[0185] In some embodiments the protein comprises a first
polypeptide sequence that comprises a ratio of L (leucine) residues
to total amino acid residues that is equal to or greater than the
ratio of L residues to total amino acid residues present in at
least one of whey protein, egg protein, and soy protein; and
comprises a first polypeptide sequence that comprises a ratio of
essential amino acid residues to total amino acid residues that is
equal to or greater than the ratio of essential amino acid residues
to total amino acid residues present in at least one of whey
protein, egg protein, and soy protein. In some embodiments the
protein comprises a first polypeptide sequence that comprises a
ratio of L (leucine) residues to total amino acid residues equal to
or greater than 11% and a ratio of essential amino acid residues to
total amino acid residues that is equal to or greater than 49%. In
some embodiments the protein comprises a first polypeptide sequence
that comprises a ratio of L (leucine) amino acid residues to total
amino acid residues equal to or greater than 9% and a ratio of
essential amino acid residues to total amino acid residues that is
equal to or greater than 51%. In some embodiments the protein
comprises a first polypeptide sequence that comprises a ratio of L
(leucine) amino acid residues to total amino acid residues equal to
or greater than 8% and a ratio of essential amino acid residues to
total amino acid residues that is equal to or greater than 40%. In
some embodiments of the protein, the first polypeptide sequence
comprises a first polypeptide sequence comprising a ratio of
branched chain amino acid residues to total amino acid residues
equal to or greater than 24%, a ratio of L (leucine) residues to
total amino acid residues that is equal to or greater than 11%, and
comprises at least one of every essential amino acid. In some
embodiments of the protein, the first polypeptide sequence
comprises a first polypeptide sequence comprising a ratio of
branched chain amino acid residues to total amino acid residues
equal to or greater than 24% and a ratio of essential amino acid
residues to total amino acid residues equal to or greater than
49%.
[0186] Provided are nutritive polypeptides that are nutritionally
complete. In some embodiments of the protein, the first polypeptide
sequence comprises a first polypeptide sequence that contains at
least one of every essential amino acid.
[0187] Nutritive Glycoproteins and Nutritive Polypeptides with
Modulated Glycosylation.
[0188] The term "glycan" or "glycoyl" refers to a polysaccharide or
oligosaccharide which may be linked to a polypeptide, lipid, or
proteoglycan. In some embodiments, a glycan is linked covalently or
non-covalently to the polypeptide. In some embodiments the linkage
occurs via a glycosidic bond. In some embodiments, the linkage is
directly between the glycan (or glycoyl) and polypeptide or via an
intermediary molecule. In some embodiments, the glycosidic bond is
N-linked or O-linked. The term "polysaccharide" or
"oligosaccharide" refers to one or more monosaccharide units joined
together by glycosidic bonds. In some embodiments, the
polysaccharide or oligosaccharide has a linear or branched
structure. In some embodiments, the monosaccharide units comprise
N-acetyl galactosamine, N-acetylglucosamine, galactose, neuraminic
acid, fructose, mannose, fucose, glucose, xylose,
N-acetylneuraminic acid, N-glycolylneuraminic acid,
O-lactyl-N-acetylneuraminic acid, O-acetyl-N-acetylneuraminic acid,
or O-methyl-N-acetylneuraminic acid. In some embodiments, the
monosaccharide is modified by a phosphate, sulfate, or acetate
group. The term "glycosylation acceptor site" refers to an amino
acid along a polypeptide which carries a glycan or glycoyl in the
native composition. In some embodiments the acceptor site consists
of a nucleophilic acceptor of a glycosidic bond. In some
embodiments, the nucleophilic acceptor site consists of an amino
group. In some embodiments the amino acid consists of an
asparagine, arginine, serine, threonine, hydroxyproline,
hydroxylysine, tryptophan, phosphothreonine, serine, or
phosphoserine. The term "exogenous glycosylation acceptor site"
refers to a glycosylation acceptor site not present in the native
composition of the polypeptide. In some embodiments the amino acid
for the exogenous glycosylation acceptor site did not carry a
glycan or glycoyl in the native composition. In some embodiments,
the amino acid does not occur in the primary sequence of the
polypeptide in the native composition. The term "exogenous glycan"
or "exogenous glycoyl" refers to a glycan or glycoyl that occupies
a glycosylation acceptor site, which was not present in the native
composition on the same glycosylation acceptor site. In some
embodiments, the glycosylation acceptor site is an exogenous
glycosylation site or a native glycosylation site. The term
"glycoprotein" refers to a polypeptide that is bound to at least
one glycan or glycoyl.
[0189] Disclosed herein are formulations containing isolated
nutritive polypeptides at least one exogenous glycosylation
acceptor site present on an amino acid of the nutritive
polypeptide. In some aspects, the at least one exogenous
glycosylation acceptor site is occupied by an exogenous glycoyl or
glycan, or alternatively, is unoccupied or is occupied by a
non-natively occupying glycol or glycan. In some embodiments, the
nutritive polypeptide is a polypeptide having an amino acid
sequence at least 90% identical to SEQID 00001-03909 and SEQID
04129-44483, or is an edible species polypeptide sequence or
fragment thereof at least 50 amino acids in length, or is a
polypeptide having substantial immunogenicity when the
glycosylation acceptor site is not present or is unoccupied. The
nutritive polypeptide is more thermostable, is more digestible,
and/or has a lower aggregation score than a reference polypeptide
that has an amino acid sequence identical to the nutritive
polypeptide but the glycosylation acceptor site is not present or
is unoccupied in the reference polypeptide. The amino acids, e.g.,
asparagine, arginine, serine, threonine, hydroxyproline, and
hydroxylysine, containing an exogenous glycosylation acceptor site
are resistant to proteolysis. Exemplary glycans are N-acetyl
galactosamine, N-acetylglucosamine, galactose, neuraminic acid,
fructose, mannose, fucose, glucose, xylose, N-acetylneuraminic
acid, N-glycolylneuraminic acid, O-lactyl-N-acetylneuraminic acid.
O-acetyl-N-acetylneuraminic acid, and O-methyl-N-acetylneuraminic
acid.
[0190] In some embodiments provided are formulations containing a
nutritive polypeptide that is identical to the amino acid sequence
of a polypeptide in a reference edible species glycoprotein, but
the carbohydrate component of the nutritive polypeptide differs
from a carbohydrate component of the reference edible species
glycoprotein. The nutritive polypeptide is produced, for example,
by expressing the polypeptide of the reference glycoprotein in a
non-native host such as Aspergillus, Bacillus. Saccharomyces or a
mammalian cell. Also provided are variant nutritive polypeptides,
where the amino acid sequence differs from the amino acid sequence
of a polypeptide in a reference glycoprotein by <1%, <5%,
<10%, or more than 10%, and the mass of the carbohydrate
component of the nutritive polypeptide is different from the mass
of the carbohydrate component of the reference glycoprotein. The
nutritive polypeptide variant is created by the insertion,
deletion, substitution, or replacement of amino acid residues in
the amino acid sequence of the polypeptide of the reference
glycoprotein. Preferably, the nutritive polypeptide has
distinguishable chemical biochemical, biophysical, biological, or
immunological properties from the reference glycoprotein. For
example, the nutritive polypeptide is more hygroscopic,
hydrophilic, or soluble in aqueous solutions than the reference
glycoprotein. Alternatively, the nutritive polypeptide is less
hygroscopic, hydrophilic, or soluble in aqueous solutions than the
reference glycoprotein.
[0191] In another example, the nutritive polypeptide is more
antigenic, immunogenic, or allergenic than the reference
glycoprotein, or alternatively, the nutritive polypeptide is less
antigenic, immunogenic, or allergenic than the reference
glycoprotein. The nutritive polypeptide is more stable or resistant
to enzymatic degradation than the reference glycoprotein or the
nutritive polypeptide is more unstable or susceptible to enzymatic
degradation than the reference glycoprotein. The carbohydrate
component of the nutritive polypeptide is substantially free of
N-glycolylneuraminic acid or has reduced N-glycolylneuraminic acid
in comparison to the reference glycoprotein. Alternatively, the
carbohydrate component of the nutritive polypeptide has elevated
N-glycolylneuraminic acid in comparison to the reference
glycoprotein.
[0192] Also provided is a nutritive polypeptide that has at least
one exogenous glycosylation acceptor site present on an amino acid
of the nutritive polypeptide, and the at least one exogenous
glycosylation acceptor site is occupied by an exogenous glycoyl or
glycan, and the nutritive polypeptide includes a polypeptide having
an amino acid sequence at least 90% identical to SEQID 00001-03909
and SEQID 04129-44483, where the nutritive polypeptide is present
in at least 0.5 g at a concentration of at least 10% on a mass
basis, and where the formulation is substantially free of
non-comestible products
[0193] Reference Nutritional Polypeptides and Reference Nutritional
Polypeptide Mixtures.
[0194] Three natural sources of protein generally regarded as good
sources of high quality amino acids are whey protein, egg protein,
and soy protein. Each source comprises multiple proteins. Table
RNP1 presents the weight proportional representation of each amino
acid in the protein source (g AA/g protein) expressed as a
percentage.
TABLE-US-00001 TABLE RNP1 Amino Acid Whey Egg Soy Isoleucine 6.5%
5.5% 5.0% Leucine 11.0% 8.6% 8.0% Lysine 9.1% 7.2% 6.3% Methionine
2.1% 3.1% 1.3% Phenylalanine 3.4% 5.3% 1.2% Threonine 7.0% 4.8%
3.7% Tryptophan 1.7% 1.2% 1.3% Valine 6.2% 6.1% 4.9% Histidine 2.0%
2.4% 2.7% Other 51.7% 49.5% 60.4%
[0195] Table RNP2 presents the weight proportion of each protein
source that is essential amino acids, branched chain amino acids
(L. I, and V), and leucine (L) (alone).
TABLE-US-00002 TABLE RNP2 Essential Amino Branched Chain Protein
Source Acids Amino Acids Leucine Whey 49.0% 23.7% 11.0% Egg 50.5%
20.1% 8.6% Soy 39.6% 17.9% 8.0%
[0196] The sources relied on to determine the amino acid content of
Whey are: Belitz H D., Grosch W., and Schieberle P. Food Chemistry
(4th Ed). Springer-Verlag, Berlin Heidelberg 2009:
gnc.com/product/index.jsp?productId=2986027;
nutrabio.com/Products/whey_protein_concentrate.htm; and
nutrabio.com/Products/whey_protein_isolate.htm. The amino acid
content values from those sources were averaged to give the numbers
presented in Tables RNP1 and RNP2. The source for soy protein is
Egg. National Nutrient Database for Standard Reference, Release 24
(ndb.nal.usda.gov/ndb/foods/list). The source for soy protein is
Self Nutrition Data
(nutritiondata.self.com/factsilegumes-and-legume-products/4389/2).
[0197] According to the USDA nutritional database whey can include
various non-protein components: water, lipids (such as fatty acids
and cholesterol), carbohydrates and sugars, minerals (such as Ca,
Fe, Mg, P, K, Na, and Zn), and vitamins (such as vitamin C,
thiamin, riboflavin, niacin, vitamin B-6, folate, vitamin B-12, and
vitamin A). According to the USDA nutritional database egg white
can include various non-protein components: water, lipids,
carbohydrates, minerals (such as Ca, Fe, Mg, P, K, Na, and Zn), and
vitamins (such as thiamin, riboflavin, niacin, vitamin B-6, folate,
and vitamin B-12). According to the USDA nutritional database soy
can include various non-protein components: water, lipids (such as
fatty acids), carbohydrates, minerals (such as Ca, Fe, Mg, P, K,
Na, and Zn), and vitamins (such as thiamin, riboflavin, niacin,
vitamin B-6, folate).
[0198] Engineered Nutritive Polypeptides
[0199] In some embodiments a protein comprises or consists of a
derivative or mutein of a protein or fragment of an edible species
protein or a protein that naturally occurs in a food product. Such
a protein can be referred to as an "engineered protein." In such
embodiments the natural protein or fragment thereof is a
"reference" protein or polypeptide and the engineered protein or a
first polypeptide sequence thereof comprises at least one sequence
modification relative to the amino acid sequence of the reference
protein or polypeptide. For example, in some embodiments the
engineered protein or first polypeptide sequence thereof is at
least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or
99.5% identical to at least one reference protein amino acid
sequence. Typically the ratio of at least one of branched chain
amino acid residues to total amino acid residues, essential amino
acid residues to total amino acid residues, and leucine residues to
total amino acid residues, present in the engineered protein or a
first polypeptide sequence thereof is greater than the
corresponding ratio of at least one of branched chain amino acid
residues to total amino acid residues, essential amino acid
residues to total amino acid residues, and leucine residues to
total amino acid residues present in the reference protein or
polypeptide sequence.
[0200] Nutritive Polypeptides--Orthologs and Homologs.
[0201] In another aspect, provided are nutritive polypeptides that
contain amino acid sequences homologous to edible species
polypeptides, which are optionally secreted from unicellular
organisms and purified therefrom. Such homologous polypeptides can
be 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or greater than 99% similar, or can be 70%, 75%, 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99%
identical to an edible species polypeptide. Such nutritive
polypeptides can be endogenous to the host cell or exogenous, can
be naturally secreted in the host cell, or both, and can be
engineered for secretion.
[0202] Also provided are orthologs of nutritive polypeptides. The
disclosure of a nutritive polypeptide sequence encompasses the
disclosure of all orthologs of such a nutritive polypeptide
sequence, from phylogenetically related organisms or,
alternatively, from a phylogenetically diverse organism that is
homologous to the nutritive polypeptide, such as 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or greater than 99% similar, or can be
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or greater than 99% identical.
[0203] Nutritive Polypeptide Fragments. Nutritive Polypeptide
Length.
[0204] In some embodiments herein a nutritive polypeptide contains
a fragment of an edible species polypeptide. In some embodiments
the fragment comprises at least 25 amino acids. In some embodiments
the fragment comprises at least 50 amino acids. In some embodiments
the fragment consists of at least 25 amino acids. In some
embodiments the fragment consists of at least 50 amino acids. In
some embodiments an isolated recombinant protein is provided. In
some embodiments the protein comprises a first polypeptide
sequence, and the first polypeptide sequence comprises a fragment
of at least 25 or at least 50 amino acids of an edible species
protein. In some embodiments the proteins is isolated. In some
embodiments the proteins are recombinant. In some embodiments the
proteins comprise a first polypeptide sequence comprising a
fragment of at least 50 amino acids of an edible species protein.
In some embodiments the proteins are isolated recombinant proteins.
In some embodiments the isolated recombinant proteins disclosed
herein are provided in a non-isolated and/or non-recombinant
form.
[0205] In some embodiments the protein comprises from 10 to 5,000
amino acids, from 20-2.000 amino acids, from 20-1,000 amino acids,
from 20-500 amino acids, from 20-250 amino acids, from 20-200 amino
acids, from 20-150 amino acids, from 20-100 amino acids, from 20-40
amino acids, from 30-50 amino acids, from 40-60 amino acids, from
50-70 amino acids, from 60-80 amino acids, from 70-90 amino acids,
from 80-100 amino acids, at least 10 amino acids, at least 11 amino
acids, at least 12 amino acids, at least 13 amino acids, at least
14 amino acids, at least 15 amino acids, at least 16 amino acids,
at least 17 amino acids, at least 18 amino acids, at least 19 amino
acids, at least 20 amino acids, at least 21 amino acids, at least
22 amino acids, at least 23 amino acids, at least 24 amino acids,
at least 25 amino acids, at least 30 amino acids, at least 35 amino
acids, at least 40 amino acids, at least 45 amino acids, at least
50 amino acids, at least 55 amino acids, at least 60 amino acids,
at least 65 amino acids, at least 70 amino acids, at least 75 amino
acids, at least 80 amino acids, at least 85 amino acids, at least
90 amino acids, at least 95 amino acids, at least 100 amino acids,
at least 105 amino acids, at least 110 amino acids, at least 115
amino acids, at least 120 amino acids, at least 125 amino acids, at
least 130 amino acids, at least 135 amino acids, at least 140 amino
acids, at least 145 amino acids, at least 150 amino acids, at least
155 amino acids, at least 160 amino acids, at least 165 amino
acids, at least 170 amino acids, at least 175 amino acids, at least
180 amino acids, at least 185 amino acids, at least 190 amino
acids, at least 195 amino acids, at least 200 amino acids, at least
205 amino acids, at least 210 amino acids, at least 215 amino
acids, at least 220 amino acids, at least 225 amino acids, at least
230 amino acids, at least 235 amino acids, at least 240 amino
acids, at least 245 amino acids, or at least 250 amino acids. In
some embodiments the protein consists of from 20 to 5,000 amino
acids, from 20-2.000 amino acids, from 20-1,000 amino acids, from
20-500 amino acids, from 20-250 amino acids, from 20-200 amino
acids, from 20-150 amino acids, from 20-100 amino acids, from 20-40
amino acids, from 30-50 amino acids, from 40-60 amino acids, from
50-70 amino acids, from 60-80 amino acids, from 70-90 amino acids,
from 80-100 amino acids, at least 25 amino acids, at least 30 amino
acids, at least 35 amino acids, at least 40 amino acids, at least
2455 amino acids, at least 50 amino acids, at least 55 amino acids,
at least 60 amino acids, at least 65 amino acids, at least 70 amino
acids, at least 75 amino acids, at least 80 amino acids, at least
85 amino acids, at least 90 amino acids, at least 95 amino acids,
at least 100 amino acids, at least 105 amino acids, at least 110
amino acids, at least 115 amino acids, at least 120 amino acids, at
least 125 amino acids, at least 130 amino acids, at least 135 amino
acids, at least 140 amino acids, at least 145 amino acids, at least
150 amino acids, at least 155 amino acids, at least 160 amino
acids, at least 165 amino acids, at least 170 amino acids, at least
175 amino acids, at least 180 amino acids, at least 185 amino
acids, at least 190 amino acids, at least 195 amino acids, at least
200 amino acids, at least 205 amino acids, at least 210 amino
acids, at least 215 amino acids, at least 220 amino acids, at least
225 amino acids, at least 230 amino acids, at least 235 amino
acids, at least 240 amino acids, at least 245 amino acids, or at
least 250 amino acids. In some aspects, a protein or fragment
thereof includes at least two domains: a first domain and a second
domain. One of the two domains can include a tag domain, which can
be removed if desired. Each domain can be 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
or greater than 25 amino acids in length. For example, the first
domain can be a polypeptide of interest that is 18 amino acids in
length and the second domain can be a tag domain that is 7 amino
acids in length. As another example, the first domain can be a
polypeptide of interest that is 17 amino acids in length and the
second domain can be a tag domain that is 8 amino acids in
length.
[0206] In some embodiments herein a fragment of an edible species
polypeptide is selected and optionally isolated. In some
embodiments the fragment comprises at least 25 amino acids. In some
embodiments the fragment comprises at least 50 amino acids. In some
embodiments the fragment consists of at least 25 amino acids. In
some embodiments the fragment consists of at least 50 amino acids.
In some embodiments an isolated recombinant protein is provided. In
some embodiments the protein comprises a first polypeptide
sequence, and the first polypeptide sequence comprises a fragment
of at least 25 or at least 50 amino acids of an edible species
protein. In some embodiments the proteins is isolated. In some
embodiments the proteins are recombinant. In some embodiments the
proteins comprise a first polypeptide sequence comprising a
fragment of at least 50 amino acids of an edible species protein.
In some embodiments the proteins are isolated recombinant proteins.
In some embodiments the isolated nutritive polypeptides disclosed
herein are provided in a non-isolated and/or non-recombinant
form.
[0207] Nutritive Polypeptide Physicochemical Properties.
[0208] Digestibility. In some aspects the nutritive polypeptide is
substantially digestible upon consumption by a mammalian subject.
Preferably, the nutritive polypeptide is easier to digest than at
least a reference polypeptide or a reference mixture of
polypeptides, or a portion of other polypeptides in the consuming
subject's diet. As used herein, "substantially digestible" can be
demonstrated by measuring half-life of the nutritive polypeptide
upon consumption. For example, a nutritive polypeptide is easier to
digest if it has a half-life in the gastrointestinal tract of a
human subject of less than 60 minutes, or less than 50, 40, 30, 20,
15, 10, 5, 4, 3, 2 minutes or 1 minute. In certain embodiments the
nutritive polypeptide is provided in a formulation that provides
enhanced digestion; for example, the nutritive polypeptide is
provided free from other polypeptides or other materials. In some
embodiments, the nutritive polypeptide contains one or more
recognition sites for one or more endopeptidases. In a specific
embodiment, the nutritive polypeptide contains a secretion leader
(or secretory leader) sequence, which is then cleaved from the
nutritive polypeptide. As provided herein, a nutritive polypeptide
encompasses polypeptides with or without signal peptides and/or
secretory leader sequences. In some embodiments, the nutritive
polypeptide is susceptible to cleavage by one or more
exopeptidases.
[0209] Digestion Assays
[0210] Digestibility is a parameter relevant to the benefits and
utility of proteins. Information relating to the relative
completeness of digestion can serve as a predictor of peptide
bioavailability (Daniel, H., 2003. Molecular and Integrative
Physiology of Intestinal Peptide Transport. Annual Review of
Physiology, Volume 66, pp. 361-384). In some embodiments proteins
disclosed herein are screened to assess their digestibility.
Digestibility of proteins can be assessed by any suitable method
known in the art. In some embodiments digestibility is assessed by
a physiologically relevant in vitro digestion reaction that
includes one or both phases of protein digestion, simulated gastric
digestion and simulated intestinal digestion (see, e.g., Moreno, et
al., 2005. Stability of the major allergen Brazil nut 2S albumin
(Ber e1) to physiologically relevant in vitro gastrointestinal
digestion. FEBS Journal, pp. 341-352; Martos, G., Contreras. P.,
Molina, E. & Lopez-Fandino, R., 2010. Egg White Ovalbumin
Digestion Mimicking Physiological Conditions. Journal of
Agricultural and food chemistry, pp. 5640-5648; Moreno, F. J.,
Mackie, A. R. & Clare Mills, E. N., 2005). Phospholipid
interactions protect the milk allergen a-Lactalbumin from
proteolysis during in vitro digestion. Journal of agricultural and
food chemistry, pp. 9810-9816). Briefly, test proteins are
sequentially exposed to a simulated gastric fluid (SGF) for 120
minutes (the length of time it takes 90% of a liquid meal to pass
from the stomach to the small intestine; see Kong., F. & Singh,
R. P., 2008. Disintegration of Solid Foods in Human Stomach.
Journal of Food Science, pp. 67-80) and then transferred to a
simulated duodenal fluid (SDF) to digest for an additional 120
minutes. Samples at different stages of the digestion (e.g., 2, 5,
15, 30, 60 and 120 min) are analyzed by electrophoresis (e.g., chip
electrophoresis or SDS-PAGE) to monitor the size and amount of
intact protein as well as any large digestion fragments (e.g.,
larger than 4 kDa). The disappearance of protein over time
indicates the rate at which the protein is digested in the assay.
By monitoring the amount of intact protein observed over time, the
half-life (.tau.1/2) of digestion is calculated for SGF and, if
intact protein is detected after treatment with SGF, the .tau.1/2
of digestion is calculated for SIF. This assay can be used to
assess comparative digestibility (i.e., against a benchmark protein
such as whey) or to assess absolute digestibility. In some
embodiments the digestibility of the protein is higher (i.e., the
SGF .tau.1/2 and/or SIF .tau.1/2 is shorter) than whey protein. In
some embodiments the protein has a SGF .tau.1/2 of 30 minutes or
less, 20 minutes or less, 15 minutes or less, 10 minutes or less, 5
minutes or less, 4 minutes or less, 3 minutes or less, 2 minutes or
less or 1 minute or less. In some embodiments the protein has a SIF
.tau.1/2 of 30 minutes or less, 20 minutes or less, 15 minutes or
less, 10 minutes or less, 5 minutes or less, 4 minutes or less, 3
minutes or less, 2 minutes or less or 1 minute or less. In some
embodiments the protein is not detectable in one or both of the SGF
and SIF assays by 2 minutes, 5 minutes, 15 minutes, 30 minutes, 60
minutes, or 120 minutes. In some embodiments the protein is
digested at a constant rate and/or at a controlled rate in one or
both of SGF and SIF. In such embodiments the rate of digestion of
the protein may not be optimized for the highest possible rate of
digestion. In such embodiments the rate of absorption of the
protein following ingestion by a mammal can be slower and the total
time period over which absorption occurs following ingestion can be
longer than for proteins of similar amino acid composition that are
digested at a faster initial rate in one or both of SGF and SIF. In
some embodiments the protein is completely or substantially
completely digested in SGF. In some embodiments the protein is
substantially not digested or not digested by SGF; in most such
embodiments the protein is digested in SIF.
[0211] Assessing protein digestibility can also provide insight
into a protein's potential allergenicity, as proteins or large
fragments of proteins that are resistant to digestive proteases can
have a higher risk of causing an allergenic reaction (Goodman, R.
E. et al., 2008. Allergenicity assessment of genetically modified
crops--what makes sense? Nature Biotechnology, pp. 73-81). To
detect and identify peptides too small for chip electrophoresis
analysis, liquid chromatography and mass spectrometry can be used.
In SGF samples, peptides can be directly detected and identified by
LC/MS. SIF protein digestions may require purification to remove
bile acids before detection and identification by LC/MS.
[0212] In some embodiments digestibility of a protein is assessed
by identification and quantification of digestive protease
recognition sites in the protein amino acid sequence. In some
embodiments the protein comprises at least one protease recognition
site selected from a pepsin recognition site, a trypsin recognition
site, and a chymotrypsin recognition site.
[0213] As used herein, a "pepsin recognition site" is any site in a
polypeptide sequence that is experimentally shown to be cleaved by
pepsin. In some embodiments it is a peptide bond after (i.e.,
downstream of) an amino acid residue selected from Phe, Trp, Tyr,
Leu, Ala, Glu, and Gln, provided that the following residue is not
an amino acid residue selected from Ala. Gly, and Val.
[0214] As used herein, a "trypsin recognition site" is any site in
a polypeptide sequence that is experimentally shown to be cleaved
by trypsin. In some embodiments it is a peptide bond after an amino
acid residue selected from Lys or Arg, provided that the following
residue is not a proline.
[0215] As used herein, a "chymotrypsin recognition site" is any
site in a polypeptide sequence that is experimentally shown to be
cleaved by chymotrypsin. In some embodiments it is a peptide bond
after an amino acid residue selected from Phe, Tip, Tyr, and
Leu.
[0216] Disulfide bonded cysteine residues in a protein tend to
reduce the rate of digestion of the protein compared to what it
would be in the absence of the disulfide bond. For example, it has
been shown that the rate of digestion of the protein
b-lactoglobulin is increased when its disulfide bridges are cleaved
(I. M. Reddy, N. K. D. Kella, and J. E. Kinsella. "Structural and
Conformational Basis of the Resistance of B-Lactoglobulin to Peptic
and Chymotryptic Digestion". J. Agric. Food Chem, 1988, 36,
737-741). Accordingly, digestibility of a protein with fewer
disulfide bonds tends to be higher than for a comparable protein
with a greater number of disulfide bonds. In some embodiments the
proteins disclosed herein are screened to identify the number of
cysteine residues present in each and in particular to allow
selection of a protein comprising a relatively low number of
cysteine residues. For example, edible species proteins or
fragments can be identified that comprise a no Cys residues or that
comprise a relatively low number of Cys residues, such as 10 or
fewer Cys residues, 9 or fewer Cys residues, 8 or fewer Cys
residues, 7 or fewer Cys residues, 6 or fewer Cys residues, 5 or
fewer Cys residues, 4 or fewer Cys residues, 3 or fewer Cys
residues, 2 or fewer Cys residues, 1 Cys residue, or no Cys
residues. In some embodiments one or more Cys residues in an edible
species protein or fragment thereof is removed by deletion and/or
by substitution with another amino acid. In some embodiments 1 Cys
residue is deleted or replaced, 1 or more Cys residues are deleted
or replaced, 2 or more Cys residues are deleted or replaced, 3 or
more Cys residues are deleted or replaced, 4 or more Cys residues
are deleted or replaced, 5 or more Cys residues are deleted or
replaced, 6 or more Cys residues are deleted or replaced, 7 or more
Cys residues are deleted or replaced, 8 or more Cys residues are
deleted or replaced, 9 or more Cys residues are deleted or
replaced, or 10 or more Cys residues are deleted or replaced. In
some embodiments the protein of this disclosure comprises a ratio
of Cys residues to total amino acid residues equal to or lower than
5%, 4%, 3%, 2%, or 1%. In some embodiments the protein comprises 10
or fewer Cys residues, 9 or fewer Cys residues, 8 or fewer Cys
residues, 7 or fewer Cys residues, 6 or fewer Cys residues, 5 or
fewer Cys residues, 4 or fewer Cys residues, 3 or fewer Cys
residues, 2 or fewer Cys residues, 1 Cys residue, or no Cys
residues. In some embodiments, the protein comprises 1 or fewer Cys
residues. In some embodiments, the protein comprises no Cys
residues.
[0217] Alternatively or in addition, disulfide bonds that are or
can be present in a protein can be removed. Disulfides can be
removed using chemical methods by reducing the disulfide to two
thiol groups with reducing agents such as beta-mercaptoethanol,
dithiothreitol (DTT), or tris(2-carboxyethyl)phosphine (TCEP). The
thiols can then be covalently modified or "capped" with reagents
such as iodoacetamide, N-ethylmaleimide, or sodium sulfite (see,
e.g., Crankshaw, M. W. and Grant, G. A, 2001. Modification of
Cysteine. Current Protocols in Protein Science.
15.1.1-15.1.18).
[0218] Nutritive Polypeptides and Nutritive Polypeptide
Formulations with Modulated Viscosity.
[0219] Disclosed herein are compositions, formulations, and food
products that contain viscosity-modulating nutritive polypeptides.
In one aspect, provided are formulations substantially free of
non-comestible products that contain nutritive polypeptides present
in a nutritional amount, and the nutritive polypeptide decreases
the viscosity of a food product. In some embodiments, the nutritive
polypeptide is present at about 10 g/l and the viscosity of the
formulation is from about 1,000 mPas to about 10,000 mPas at 25
degrees C., such as from about 2,500 mPas to about 5,000 mPas at 25
degrees C.
[0220] The formulations are incorporated into food products having
advantages over similar food products lacking the nutritive
polypeptides, or the formulations are incorporated into other
products such as beverage products or animal feed products. For
example, the food products have a reduced fat content, a reduced
sugar content, and/or a reduced calorie content compared to a food
product not having the nutritive polypeptide. Preferably, the
nutritive polypeptide is present in the food product such that
consumption of a nutritional amount of the food product is
satiating. In an embodiment of the invention, gelatin, an
animal-derived material, is replaced by a non-animal derived
product, containing one or more nutritive polypeptides. Typically
the nutritive polypeptide is present in an amount effective to
replace gelatin in the product. The gelatin replacement is
incorporated into a food product, a beverage product, or an animal
feed product, and the formulation is substantially free of
non-comestible products.
[0221] Also provided are formulations containing a nutritive
polypeptide present in a functional and/or nutritional amount,
which increases the viscosity of a food or beverage product, such
as formulations containing viscosity-increasing nutritive
polypeptides incorporated into food products having advantages over
similar food products lacking the nutritive polypeptides. For
example, the food products have a reduced fat content, a reduced
sugar content, and/or a reduced calorie content compared to a food
product not having the nutritive polypeptide. Viscous nutritive
polypeptides can be used as a nutritionally favorable low calorie
substitute for fat. Additionally, it may be desired to add to the
compositions and products one or more polysaccharides or
emulsifiers, resulting in a further improvement in the creamy
mouthfeel.
[0222] In some embodiments, the viscosity of nutritive
polypeptide-containing materials is enhanced by crosslinking the
nutritive polypeptides or crosslinking nutritive polypeptides to
other proteins present in the material. An example of an effective
crosslinker is transglutaminase, which crosslinks proteins between
an .di-elect cons.-aminogroup of a lysine residue and a
.gamma.-carboxamide group of glutamine residue, forming a stable
covalent bond. The resulting gel strength and emulsion strength of
nutritive polypeptides identified and produced as described herein
are examined by preparing a transglutaminase-coupled nutritive
protein composition, followed by gel strength and emulsion strength
assays. A suitable transglutaminase derived from microorganisms in
accordance with the teachings of U.S. Pat. No. 5,156,956 is
commercially available. These commercially available
transglutaminases typically have an enzyme activity of about 100
units. The amount of transglutaminase (having an activity of about
100 units) added to isolated nutritive polypeptide is expressed as
a transglutaminase concentration which is the units of
transglutaminase per 100 grams of isolated nutritive polypeptide.
The isolated nutritive polypeptide contains from 5 to 95%,
preferably 20 to 80%, preferably 58% to 72% protein and also
preferably from 62% to 68% protein. The transglutaminase
concentration is at least 0.15, preferably 0.25 and most preferably
0.30 units transglutaminase per gram protein up to 0.80 and
preferably 0.65 units transglutaminase per gram protein. Higher and
lower amounts may be used. This enzyme treatment can also be
followed by thermal processing to make a viscous solution
containing a nutritive polypeptide. To generate nutritive
polypeptide samples containing crosslinks, a sample is mixed with a
transglutaminase solution at pH 7.0 to give an enzyme to protein
weight ratio of 1:25. The enzyme-catalyzed cross-linking reaction
is conducted at 40.degree. C. in most of the experiments.
[0223] Oscillatory shear measurements can be used to investigate
the rheological properties of nutritive polypeptides. Also, to
determine the viscosity of nutritive polypeptide solutions and gels
viscoelasticity is investigated by dynamic oscillatory rheometry. A
2 mL sample of nutritive polypeptide solution or nutritive
polypeptide solution containing transglutaminase is poured into the
Couette-type cylindrical cell (2.5 cm i.d., 2.75 cm o.d.) of the
rheometer and covered with a thin layer of low-viscosity silicone
oil to prevent evaporation. For samples with enzyme present,
gelation is induced in situ by incubation at 40.degree. C. For
nutritive polypeptide samples without enzyme, gelation is induced
by subjecting the sample to the following thermal treatment
process: temperature increased at constant rate of 2 K min-1 from
40 to 90.degree. C., kept at 90.degree. C. for 30 min, cooled at 1
K min-1 from 90 to 30.degree. C., and kept at 30.degree. C. for 15
min. Some samples can be subjected to this thermal treatment after
the enzyme treatment. Small deformation shear rheological
properties are mostly determined in the linear viscoelastic regime
(maximum strain amplitude 0.5%) with storage and loss moduli (G'
and G'') measured at a constant frequency of 1 Hz. In addition,
some small deformation measurements are made as a function of
frequency e.g., 2.times.10-3 to 2 Hz, and some large deformation
measurements are carried out at strains up to nearly 100%.
[0224] Nutritive Polypeptides for Increasing Renal Function and
Treatment and Prevention of Renal Diseases
[0225] Provided are nutritive polypeptides, and compositions and
formulations containing nutritive polypeptides, which are useful
for increasing renal function and treatment and prevention of renal
diseases. The nutritive polypeptides are also useful for treating
and preventing loss of muscle mass and muscle function in a
subject, particularly a subject undergoing treatment for a renal
disease. Moreover, the nutritive polypeptides are further useful
for reducing or preventing a side effect (meaning a secondary
effect, usually undesirable, of a pharmaceutical agent or medical
treatment) of therapeutic or prophylactic regimens for renal
disease treatment, as such regimens may result in decreased amino
acid availability to the subject, in addition to causing loss of
muscle mass and muscle function.
[0226] Provided are nutritive polypeptides, and compositions and
formulations containing nutritive polypeptides, which are useful
for the treatment and prevention of kidney diseases, particularly
those suffering from chronic kidney disease (CKD) and urea cycle
disorders. As used herein, a "chronic kidney disease" includes any
pathological condition such that one or both of a subject's kidneys
are damaged and cannot filter blood comparable to a healthy kidney.
A "urea cycle disorder" includes any deficiency in one or more of
the enzymes or transporters that are involved in the urea
cycle.
[0227] The CDC estimates that more than 10% of adults in the United
States may have CKD, of varying levels of seriousness (CDC, US
Department of Health and Human Services, Centers for Disease
Control and Prevention (2014)). The likelihood of having CKD
increases with age and is most common among adults older than 70
years. Deterioration of the kidneys leads to kidney failure, a type
of CKD where waste is no longer effectively removed from the blood.
Kidney failure is also called end-stage renal disease (ESRD). In
2011, 113, 136 patients in the United States started treatment for
end stage renal disease. Health related consequences of CKD are
swelling in the arms and legs, high blood pressure, pulmonary
edema, pericarditis, hyperkalemia, weakened bone strength, anemia,
weakened immune system, depression, and malnourishment. A reduction
or prevention of each of these consequences is useful to
demonstrate efficacious treatment using nutritive polypeptides.
[0228] Exemplary kidney diseases include Alport Syndrome, Diabetic
Nephropathy, Fabry Disease, Focal Segmental Glomerulosclerosis,
Glomerulonephritis, IgA Nephropathy, Kidney Stones. Minimal Change
Disease, Nephrotic Syndrome, and Polycystic Kidney Disease.
[0229] Exemplary urea cycle disorders include NAGS deficiency.
Carbamoylphosphate synthetase I deficiency, Ornithine
transcarbamylase deficiency, Citrullinemia type I, Argininosuccinic
aciduria, Arginase deficiency, Ornithine Translocase Deficiency,
(Summar, et al. GeneClinics: Medical Genetics Knowledge Base.
Seattle, University of Washington (2005)).
[0230] Subjects with CKD undergo damage to the kidneys that results
in decreased kidney function, and as kidney function deteriorates,
waste products build to high levels in blood and diminish health.
Complications associated with chronic kidney disease include high
blood pressure, anemia (low blood count), weak bones, poor
nutritional health and nerve damage. As a result, subjects have an
increased risk of having heart and blood vessel disease.
Maintaining subject and kidney health prevents or slows progression
of disease to kidney failure, which requires dialysis or a kidney
transplant to maintain life. As a result of inadequate metabolic
and nutritional status, high mortality and morbidity rates remain
prevalent in patients suffering from CKD, particularly in those
with ESRD receiving dialysis. This altered status, deemed protein
energy wasting (PEW), is often caused by inadequate dietary protein
intake and amino acid utilization, and has a significant effect on
subject mortality rate. Dialysis depletes the body of amino acids,
and the compromised kidneys alter amino acid homeostasis in the
human body. PEW generally results in loss of muscle and protein
stores, compounding the effects of renal disease. To limit the
effects of PEW, attempts have been made to optimize dietary
nutrient intake, and provide appropriate treatment of metabolic
disturbances such as metabolic acidosis, systemic inflammation, and
hormonal deficiencies, and optimized dialytic regimens. (See, e.g.,
Ikikier, T. et al. Kidney international 84.6 (2013): 1096-1107). In
patients where oral dietary intake is insufficient, enteral or
parenteral nutrition supplementation is required to replenish
protein and energy stores. A nutritional polypeptide formulation as
described herein, provides a effective composition and formulation
to prevent and treat PEW. These treatments are beneficially
combined with exercise.
[0231] Uremic toxicity, where excess nitrogenous waste products
exist in circulation often occurs in CKD and, must be monitored.
CKD patients are sometimes placed on a low protein diet to prevent
uremic toxicity. Urea, the main nitrogenous metabolite from
ingestion of protein, may or may not be toxic alone, and can serve
as an indicator of accumulation of other toxins as a consequence of
altered renal function.
[0232] CKD patients are known to have abnormal amino acid profiles
in serum, in particular, low levels of essential amino acids (EAAs)
and branched chain amino acids (BCAAs). For example. Kim et. al.
report lower serum BCAAs levels in ESRD dialysis patients compared
to a control group. More specifically, lower levels of serine,
tyrosine and lysine as well as the BCAAs-valine, leucine and
isoleucine have been reported (Kim, D. H. Kor. Journ. Int. Med.
1998, 13(1): 33-40). Therefore, BCAA-enriched nutritive
polypeptides and/or EAA-enriched nutritive polypeptides are of
particular utility for patients with CKD.
[0233] Moreover, it has been shown that supplementation of free
BCAAs in the diet can improve the nutritional status and appetite
of dialysis patients. (Hiroshige, K. Nephr. Dial. Transplant. 2001,
16:1856-62). Levels of BCAAs were normalized by 12 g/day oral
supplements. Nutritive polypeptides high in BCAAs are an effective
treatment for patients compromised by renal disease. PEW can be
remedied by restoring the specific amino acids lost by dialysis and
diminished metabolic function by nutritive polypeptide
administration while diminishing stress on an already compromised
patient. A nutritive polypeptide selected for improving the status
of ESRD patients, particularly those with PEW, delivers effective
combinations of amino acids at a beneficial quantity, and in a
formulation that results in high compliance. Specifically, a
nutritive polypeptide high in BCAAs satisfies these requirements.
Optionally, the nutritive polypeptide is low in glutamine and
glutamic acid content, since patients with renal disease do not
efficiently excrete ammonia, a by-product of glutamic acid and
glutamine metabolism. Accumulation of ammonia in the blood, also
known as hyperammonemia, is a dangerous condition that may lead to
death (See, e.g., Sacks, G. S. Ann. Pharmacol. 1999,
33:348-354).
[0234] Uremic toxicity, where excess nitrogenous waste products
exist in circulation, is prevalent in CKD and should be monitored.
In order to prevent uremic toxicity, nutritive formulations are
administered to CKD subjects; currently, CKD patients are sometimes
placed on a low protein diet to prevent uremic toxicity, which
results in decreased amino acid availability, muscle loss, and
other effects of decreased amino acid levels. Urea, the main
nitrogenous metabolite from ingestion of protein, is a useful
indicator of accumulation of other toxins as a consequence of
altered renal function. Thus, a nutritive polypeptide is able to
deliver amino acids effectively to meet a subject's nutritional
needs, while diminishing risks of these side effects. In
particular, a high BCAA protein satisfies these requirements.
Whereas some ESRD patients are placed on a low protein diet, in
contrast dialysis patients are placed on a high protein diet due to
loss of amino acids that occur during the dialysis process.
Hyperphosphatemia is a complication of a poorly optimized high
protein diet, where high phosphorous levels from food can become
toxic in individuals with CKD (Mandayam, S. Nephrology. 2006,
11:53-57). Even mild increases in serum phosphorous levels
increased mortality rates in CKD patients (Kestenbaum, B. J. Am.
Soc. Nephrol. 2005, 16: 520-28). A nutritive polypeptide is
advantageous in CKD, as it counteracts the loss of amino acids,
while sparing the kidneys of extraneous dietary phosphorous.
[0235] Patients with urea cycle disorders have genetic mutations
that result in a deficiency of one of the enzymes or transporters
that are involved in the urea cycle, which are responsible for
removing ammonia from the blood. Disrupting the urea cycle limits
the removal of nitrogen from the blood by converting it into urea
and transferring to the urine. The accumulation of nitrogen in the
blood causes an increase in ammonia (hyperammonemia). Ammonia is
highly toxic and can cause irreversible brain damage, coma, and
possibly death. In some embodiments, the nutritive polypeptides
provided herein are useful to lower creatinine and urine
osmolality.
[0236] Urea cycle disorder (UCD) patients are treated or symptoms
prevented by administration of nutritive polypeptides. The urea
cycle is the main nitrogenous waste disposal pathway in humans. UCD
is a hereditary disorder caused by deficiency of one or more
enzymes in the cycle, ultimately resulting in hyperammonemia. UCD
patients present low BCAA serum levels. (Boneh, A. Mol. Genet.
Metab. 2014. S1096-7192). Disruption of the normal urea cycle
causes diminished synthesis of arginine, normally a nonessential
amino acid (Leonard, J. V. Journ. Pediatrics. 2001, 138(1):S40-45).
Arginine plays a major role in the urea cycle. The synthetic
pathway of arginine interacts closely with the urea cycle enzymes
in the liver and kidneys, and is made from omithine via citrulline
(Barbul A. J Parenter Enteral Nutr. 1986, 10: 227-238). Citrulline
and ornithine are required to be supplemented in UCD patients:
however, they are not found in natural proteins and are not
generally present in nutritive polypeptides. A nutritive
polypeptide indicated for urea cycle disorders contains high levels
of BCAAs and arginine. Supplementation of glutamine and glutamic
acid produces the nitrogenous waste product ammonia, so a nutritive
polypeptide useful for UCD is generally low in these amino acids. A
nutritive polypeptide provides an optimized therapy for UCD
patients, as it can deliver essential amino acids such as the
BCAAs, as well as arginine, without delivering excess free amino
acids.
[0237] Amino Acid Pharmacology.
[0238] Amino acids are organic molecules containing both amino and
acid groups. All amino acids have asymmetric carbon except for
glycine and all protein amino acids, except proline, have an
alpha-carbon bound to a carboxyl group and a primary amino
group.
[0239] Amino acids exhibit a diverse range of biochemical
properties and biological function due to their varying side
chains. They are stable in solution at physiological pH, save for
glutamine and cysteine. In the context of some proteins,
conditional upon the host and translational machinery, amino acids
can undergo post-translational modification. This can have
significant effects on their bioavailability, metabolic function,
and bioactivity in vivo. Sugar moieties appended to proteins
post-translationally may reduce the usefulness of the nutritive
proteins by affecting the gastrointestinal release of amino acids
and embedded peptides. A comparison of digestion of glycosylated
and non-glycosylated forms of the same proteins shows that the
non-glycosylated forms are digested more quickly than the
glycosylated forms (our data).
[0240] Although over 300 amino acids exist in nature, 20 serve as
building blocks in protein. Non-protein alpha-AAs and non-alpha AAs
are direct products of these 20 protein amino acids and play
significant roles in cell metabolism. Due to the metabolic
reactions of amino acid catabolism that drive the interconversion
between amino acids, a subset of 11 of the 20 standard protein
amino acids are considered non-essential for humans because they
can be synthesized from other metabolites (amino acids, ketones,
etc.) in the body: Alanine; Arginine; Asparagine; Aspartic acid;
Cysteine; Glutamic acid; Glutamine; Glycine; Proline; Serine; and
Tyrosine.
[0241] Arginine, cysteine, glycine, glutamine, histidine, proline,
serine and tyrosine are considered conditionally essential, as they
are not normally used in the diet, and are not synthesized in
adequate amounts in specific populations to meet optimal needs
where rates of utilization are higher than rates of synthesis.
Functional needs such as reproduction, disease prevention, or
metabolic abnormalities, however, can be taken into account when
considering whether an amino acid is truly non-essential or can be
conditionally essential in a population. The other 9 protein amino
acids, termed essential amino acids, are taken as food because
their carbon skeletons are not synthesized de novo by the body to
meet optimal metabolic requirements: Histidine; Isoleucine;
Leucine; Lysine; Methionine; Phenylalanine; Threonine; Tryptophan:
and Valine.
[0242] All 20 protein amino acids (and non-protein metabolites) are
used for normal cell functionality, and shifts in metabolism driven
by changing availability of a single amino acid can affect whole
body homeostasis and growth. Additionally, amino acids function as
signaling molecules and regulators of key metabolic pathways used
for maintenance, growth, reproduction, immunity.
[0243] In the body skeletal muscle represents the largest store of
both free and protein-bound amino acids due to its large
composition of body mass (around 40-45%). The small intestine is
another important site for amino acid catabolism, governing the
first pass metabolism and entry of dietary amino acids into the
portal vein and into the peripheral plasma, 30-50% of EAA in the
diet may be catabolized by the small intestine in first-pass
metabolism. The high activity of BCAA transaminases in the
intestinal mucosa leads to BCAA conversion to branched-chain
alpha-ketoacids to provide energy for enterocytes similar as is
done in skeletal muscle. Differences in physiological state of
muscle and small intestine metabolism have large implications on
amino acid biology systemically across tissues in humans.
[0244] Amino acids can exist in both L- and D-isoforms, except for
glycine (non-chiral). Almost all amino acids in proteins exist in
the L-isoform, except for cysteine (D-cys) due to its sulfur atom
at the second position of the side-chain, unless otherwise
enzymatically postranslationally modified or chemically treated for
storing or cooking purposes. Most D-amino acids, except for D-arg,
D-cys, D-his, D-lys, and D-thr, can be converted into the L
chirality by D-AA oxidases and transaminases. In order to be
catabolized, these D enantiomers are transported across the plasma
and other biological membranes and undergo D-oxidation or deaminate
the amino acid to convert to its alpha-ketoacid or racemization to
convert the D-AA to its L-isoform. The transport of D-isomers is
limited by a lower affinity of L-AA transporters to D-AAs. For this
reason the efficiency of D-AA utilization, on a molar basis of the
L-isomer, can range from 20-100% depending on the amino acid and
the species.
[0245] Alanine:
[0246] Alanine is a glucogenic non-essential amino acid due to its
ability to be synthesized in muscle cells from BCAAs and pyruvate
as part of the glucose-alanine cycle. This involves a tightly
regulated process by which skeletal muscle frees energy from
protein stores for the generation of glucose distally in the liver
for use by extrahepatic cells (including immunocytes) and tissues.
The resulting stimulation of gluconeogenesis provides a source of
energy in the form of glucose during periods of food deprivation.
Alanine becomes a very sensitive intermediary to balance the
utilization of BCAAs in the muscle for protein production and
generation of available energy through gluconeogenesis in the
liver. Furthermore, the alanine induction of gluconeogenesis is
integral to support the function of many tissues, not limited to
muscle, liver, and inmmunocytes. Beyond acting as simply an
intermediate, however, it also directly regulates activity of a key
enzyme in this energy balance, pyruvate kinase. Alanine has the
ability to inhibit pyruvate kinase by facilitating its
phosphorylation, slowing glycolysis and driving the reverse
reaction of pyruvate to phosphoenolpyruvate (PEP) for initiation of
gluconeogenesis.
[0247] High Alanine
[0248] A lack of ATP-producing substrates, as occurs in a fasted
state, can lead to autophagy and the turnover of intracellular
protein in the lysosome to provide an energy source. Low levels of
the glucogenic amino acids, including alanine can stimulate hepatic
autophagy, leading to degradation of liver function.
[0249] Beta-cells show increased autophagy when under high fat diet
feeding as a response to increased demand for insulin production
and protein turnover as the body reacts to rising plasma glucose
concentrations. This progression towards increased insulin
production in obesity is an early marker for pre-diabetes, an
indicator of insulin resistance, and a risk factor for the
deterioration of islet beta cell functionality which eventually
leads to the onset of diabetes in overweight individuals. The
ability to regulate alanine levels via nutrition may provide a
powerful lever for shifting hepatic and beta cell autophagy to
perturb impaired insulin metabolism in overweight individuals.
[0250] Alanine directly produces beta-alanine, important to the
biosynthesis of panthothenic acid (vitamin b5), coenzyme A, and
carnosine (or which it is the rate-limiting precursor). Carnosine,
as well as other beta-alanine derived di-peptides (which don't
incorporate into proteins) carcinine, anserine, and balenine act as
antioxidant buffers in the muscle tissue, constituting up to 20% of
the buffer capacity in type I and II muscle fibres. This buffering
is important for maintaining tissue pH in muscle during the
breakdown of glycogen to lactic acid. In weight loss/gain trials in
college athletes, supplementation with beta-alanine was shown to
prevent loss of lean mass in weight loss and larger increases in
lean mass during weight gain compared to placebo. Beta-alanine is
also implicated in decreasing fatigue and increasing muscular work
done.
[0251] Carnosine is an antioxidant and transition metal
ion-sequestering agent. It acts as an anti-glycating agent by
inhibiting the formation of advanced glycation end products (AGEs).
AGEs are prevalent in diabetic vasculature and contribute to the
development of atherosclerosis. The presence of AGEs in various
cells types affect both the extracellular and intracellular
structure and function. (Golden, A. et. al. Advanced Glycosylation
End Products. Circulation 2006). Also, the accumulation of AGEs in
the brain is a characteristic of aging and degeneration,
particularly in Alzheimer's disease. AGE accumulation explains many
neuropathological and biochemical features of Alzheimer's disease
such as protein crosslinking, oxidative stress, and neuronal cell
death. Because of its combination of antioxidant and antiglycating
properties, carnosine is able to diminish cellular oxidative stress
and inhibit the intracellular formation of reactive oxygen species
and reactive nitrogen species.
[0252] Low Alanine
[0253] In states of obesity and diabetes, animals have been shown
to exhibit reduced hepatic autophagy, leading to increased insulin
resistance. Autophagy is important for maintenance of the ER and
cellular homeostasis, which when stressed can lead to impaired
insulin sensitivity. High fat diet feeding in animal models
stresses the ER, while leading to depressed hepatic autophagy
through over-stimulation of mTORC1, which reinforces the
progression towards insulin sensitivity impaired beta cell function
in diabetes. Reducing the level of systemic Alanine provides an
opportunity to lower mTORC1 activity and restore healthy levels of
autophagy.
[0254] Arginine:
[0255] Arginine is a glucogenic non-essential amino acid, which can
be synthesized via glutamate, aspartate, glutamine, and proline. It
is produced by the mammalian small intestine via oxidation of
glutamate, glutamine, and aspartate, which generates ornithine,
citrulline, arginine, and alanine. It can also be produced (along
with ornithine and citrulline) via the proline oxidase pathway from
active degradation of proline in enterocytes. Arginine is converted
from citrulline released into circulation by the enterocytes in the
kidneys and some endothelial cells (leukocytes and smooth muscle).
Newborns utilize most of the free citrulline locally in the small
intestine for arginine synthesis rather than systemic release.
Arginine and proline oxidation is constrained to the mucosa due to
reduced activity of pyrroline-5-carboxylate dehydrogenase across
the other tissues.
[0256] High Arginine
[0257] Citrulline is produced from arginine as a by-product of a
reaction catalyzed by the NOS family. Dietary supplement of either
arginine or citrulline is known to reduce plasma levels of glucose,
homocysteine, and asymmetric dimethylarginine, which are risk
factors for metabolic syndrome. L-citrulline accelerates the
removal of lactic acid from muscles, likely due to the affects on
vascular tone and endothelial function. Recent studies have also
shown that L-citrulline from watermelon juice provides greater
recovery from exercise, and less soreness the next day. It also
appears that delivery of L-citrulline as a free form results in
less uptake into cells in vitro than in the context of watermelon
juice (which contains high levels of L-citrulline). This suggests
an opportunity to deliver peptide doses, which can traffic arginine
into muscle tissue for conversion into citrulline by eNOS at the
endothelial membrane for improved efficacy.
[0258] Arginine is a highly functional amino acid implicated in
many signaling pathways and as a direct precursor of nitric oxide
(NO), which facilitates systemic signaling between tissues and
regulation of nutrient metabolism and immune function. NO is
important for normal endothelial function and cardiovascular health
(including vascular tone, hemodynamics, and angiogenesis). Arginine
stimulates insulin secretion by directly depolarizing the plasma
membrane of the .beta. cell leading to the influx of Ca.sup.2+ and
subsequent insulin exocytosis.
[0259] Arginine supplementation was shown to improve
endothelium-dependent relaxation, an indicator of cardiovascular
function in type I and type II models of diabetes mellitus.
Notably, arginine supplementation reduced white adipose tissue but
increased brown fat mass in Zucker diabetic rats and diet-induced
obese rats. Arginine and/or its metabolites may enhance the
proliferation, differentiation, and function of brown adipocytes.
In addition, both skeletal muscle mass and whole body insulin
sensitivity were enhanced in response to arginine supplementation
via mechanisms involving increases in muscle mTOR and NO signaling.
Surprisingly, long-term oral administration of arginine decreased
fat mass in adult obese humans with type II diabetes (Lucotti et al
2006). Moreover, supplementation with arginine to a conventional
corn- and soybean-based diet reduced fat accretion and promoted
protein deposition in the whole body of growing-finishing pigs. In
a small pilot trial in humans data indicated that defective
insulin-mediated vasodilatation in obesity and non-insulin
dependent diabetics (NIDDM) can be normalized by intravenous
L-arginine; L-arginine also improved insulin sensitivity in healthy
subjects, obese patients and NIDDM patients, indicating a possible
mechanism that is different from the restoration of
insulin-mediated vasodilatation. In addition, a chronic
administration of L-arginine improved glucose levels, insulin
induced-hepatic glucose production, and insulin sensitivity in type
II diabetic patients (Piatti et al 2001). Arginine rich peptides
have not been isolated and tested.
[0260] Amino acid administration at high doses (10-20.times. that
available in diet, or 0.3 g/kg body weight dosed over 20 minutes,
via intravenous or oral routes, can stimulate hormone secretion
from the gut via endocrine cells. Arginine is a well-studied
secretagogue that can stimulate the systemic release of insulin,
growth hormone, prolactin, glucagon, progesterone, and placental
lactogen. This biology has direct implications on both digestive
biology and the absorption of nutrients present in the intestine,
as well as affecting energy balance by triggering satiety signals
mediated by endocrine hormones. The ability to modulate these
hormones provides a therapeutic opportunity for decreasing caloric
intake in metabolic disorders such as obesity or alternatively
triggering appetite in muscle wasting, sarcopenia, and cachexia, as
well as by shifting insulin sensitivity in the onset of
diabetes.
[0261] Arginine is an important signaling molecule for stimulating
mTOR1 phosphorylation in a cell-specific manner. This regulates
cellular protein turnover (autophagy) and integrates insulin-like
growth signals to protein synthesis initiation across tissues. This
biology has been directly linked to biogenesis of lean tissue mass
in skeletal muscle, metabolic shifts in disease states of obesity
and insulin resistance, and aging. It is also a central signaling
pathway which can be hijacked for the proliferation of fast-growing
cancer cells.
[0262] There is evidence for Arginine increasing levels of protein
synthesis in the small intestine under catabolic states such as
viral infection and malnutrition, where amino acid levels are
dramatically shifted from their normal post-absorptive states.
Additionally, demonstrated mTOR activation in the intestinal
epithelial cells by Arginine provides a mechanism to repair
intestinal epithelium by stimulating protein synthesis and cell
proliferation. Similar anabolic signaling has been observed in
myocytes in response to rising plasma levels of Arginine, leading
to increased whole body and skeletal muscle protein synthesis.
Arginine is an amino acid maintained at sufficient levels to
support the anabolic effects of EAAs. Lysine, Methionine.
Threonine. Tryptophan. Leucine, Isoleucine, and Valine have been
shown unable to support increased protein synthesis and whole-body
growth when added to a 12.7% crude protein diet, indicating a
deficiency in the anabolic mediating non-essential amino acids,
including Arginine.
[0263] Arginine also up-regulates proteins and enzymes related to
mitochondrial biogenesis and substrate oxidation, stimulating
metabolism of fatty acid stores and reducing fat tissue mass.
Supplementation of dietary Arginine provides a therapeutic benefit
in obese and pre-diabetic populations who suffer from insulin
resistance due to their increased caloric intake. Likewise, the
ability to stimulate mitochondrial biogenesis has direct
implications in aging and the ability to regenerate functional
proteins and healthy cells subject to oxidative stress.
[0264] It is established that dietary deficiency of protein reduces
the availability of most amino acids, including Arginine despite it
not being considered essential. Arginine deficiency is known to
cause decreases in sperm counts by 90% after 9 days, increasing the
proportion of non-motile sperm by a factor of 10. Arginine
supplementation has been demonstrated in animals to increase levels
of Arginine, Proline, Ornithine, and other Arginine metabolites
such as Polyamines in seminal fluid, corresponding with increased
sperm counts and sperm motility. Changes in NO synthesis and
polyamines (via), likewise are seen during gestation when placental
growth rate peaks, indicating a role for Arginine in fetal
development during pregnancy. In uterine fluids during early
gestation Arginine levels also decrease in response to expression
of specific amino acid transporters at the embryo. Arginine
supplementation to the diet of animals during early gestation has
shown embryonic survival and increase in litter size, indicating a
significant potential for delivering high levels of arginine during
pregnancy.
[0265] Arginine has an extensively studied effect on enhancing
immune function, based on direct effects on NO production (which
can potentiate a phagocyte's killing ability), hormonal
secretagogue activity, and stimulation of mTOR. Proline catabolism
by proline oxidase is known to have high levels of activity in the
placentae and small intestine of mammals. This activity points to a
crucial role for Arginine in gut and placentae immunity, both
through generation of H.sub.2O.sub.2, which is cytotoxic to
pathogenic bacteria, and synthesis of arginine. In critically
injured patients leukocyte count normalizes more quickly after 6
days of Arginine enriched diet, with recovery to normal TNF
response after 10 days (100% improvement). A clinical study in 296
surgery, trauma, or sepsis patients examining Arginine enriched
(12.5 g/L Arginine) formulation vs enteral formula indicates highly
reduced hospital stay (8-10 days) and major reduction in frequency
of acquired infections. A separate clinical study of 181 septic
patients fed Arginine enriched (12.5 g/L Arginine) vs. enteral
formula show significantly reduced bacteremia (8% vs 22%),
nosocomial infection (6% vs 20%).
[0266] Arginine is also a key substrate for the synthesis of
collagen. Oral supplementation of arginine enhances wound healing
and lymphocyte immune response in healthy subjects. A 2.4.times.
increase in collagen deposition was observe at wound sites (24
nmol/cm vs. 10.1 nmol/cm), along with increased lymphocyte
proliferation vs. control.
[0267] Arginine is an allosteric activator of N-acetylglutamate
synthase, an enzyme which converts glutamate and acetyl-CoA into
N-acetylglutamate in the mitochondria. This pushes the hepatic urea
cycle towards the active state, useful for ammonia detoxification.
This means that dietary delivery of nutrients with low doses of
arginine may be useful in the context of kidney disease, where
patients struggle to clear urea from their circulation. Elimination
of arginine to limit uremia from the available nitrogen sources,
while being able to maintain a limited protein intake to prevent
tissue catabolism, is a novel strategy against a disruptive
nutritional consequence of kidney disease.
[0268] Arginine up-regulates the activity of GTP cyclohydrolase-I,
freeing tetrahydrobiopterin (THB) for NO synthesis and the
hydroxylation of aromatic amino acids (ArAAs) by aromatic amino
acid hydroxylase (AAAH). For this reason, delivery of high levels
of Arginine to raise cellular levels of THB directly stimulates the
biosynthesis of many neurotransmitters in the CNS capillary
endothelial cells. ArAAs serve as precursors for biosynthesis of
monoamine neurotransmitters, including melatonin, dopamine,
norepinephrine (noradrenaline), and epinephrine (adrenaline).
[0269] Low Arginine
[0270] Excessive arginine intake, stimulating production of high
levels of NO in the blood can lead to oxidative injury and
apoptosis of cells.
[0271] Arginine excess or depletion affects global gene expression
in mammalian hepatocytes. Depletion leads to 1419 genes with
significantly (p<0.05) altered expression using in-vitro models,
of which 56 showed at least 2-fold variation using a 9-way
bioinformatics analysis. The majority rise in expression, including
multiple growth, survival, and stress-related genes such as GADD45.
TA1/LAT1, and caspases 11 and 12. Many are relevant in luminal ER
stress response. LDLr, a regulator of cholesterol and steroid
biosynthesis, was also modulated in response to arginine depletion.
Consistent with Arginine affecting gene expression, dietary
arginine supplementation up-regulates anti-oxidative genes and
lowers expression of proinflammatory genes in the adipose and small
intestinal tissues.
[0272] Lower arginine levels inhibit neurotransmitter biosynthesis,
which has shown clinical efficacy in indications such as mania,
parkinsons, and dyskenisia.
[0273] Asparagine:
[0274] Asparagine is a glucogenic nonessential amino acid, whose
precursor is oxaloacetate (OAA) and which is synthesized via
glutamine and aspartate by a transaminase enzyme. It is used for
the function of some neoplastic cells such as lymphoblasts.
[0275] Asparagine is typically located at the ends of alpha helices
of proteins and provides important sites for N-linked glycosylation
to add carbohydrate chains, which affects immune response to amino
acid ingestion.
[0276] Acyrlamide is formed by heat-induced reactions between
Asparagine and carbonxyl groups of glucose and fructose in many
plant-derived foods. Acrylamide is an oxidant that can be
cytotoxic, cause gene mutations, and generally affect food quality.
Compositions with low levels of asparagine are useful in making
safer food products that may be subject to cooking or
non-refrigerated storage conditions.
[0277] Aspartate:
[0278] Aspartate is a glucogenic nonessential amino acid
synthesized via the oxaloacetate (OAA) precursor by a transaminase
enzyme. As part of the urea cycle, it can also be produced from
ornithine and citrulline (or arginine) as the released fumarate is
converted to malate and subsequently recycled to OAA. Aspartate
provides a nitrogen atom in the synthesis of inosine, which is the
precursor in purine biosynthesis. It is also involved in the
synthesis of beta-alanine. Aspartate oxidizes in enterocytes of the
small intestine, leading to nitrogeneous products ornithine,
citrulline, arginine, and alanine.
[0279] Aspartate is an agonist of NMDA receptors (Glutamate
receptors), releasing Ca2+ as a second messenger in many cellular
signaling pathways. There are dopaminergic and glutaminergic
abnormalities implicated in schitzophrenia, with NMDA antagonists
mimicking some positive and negative symptoms of schitzophrenia,
while carrying less risk of brain harm than do dopamine agonists.
Ketamine and PCP, for example, produce similar phenotypes observed
in schitzophrenia, with PCP showing less representative
symptomology yet similar brain structure changes. Glutamate
receptors have increased function, contributing to the onset of
schizophrenia. An increased proportion of post-synaptic glutamate
receptors to pre-synaptic glutamate receptors result in increased
glutamate signaling. Both agonizing and antagonizing NMDA receptors
has shown some benefit in treating Alzheimer's dementia, depending
on the MOA and receptor specificity. Thus delivering proteins with
either high or low levels of Aspartate, which also as NMDA agonist
activity, could be therapeutic for this patient population.
Proteins with low levels of Aspartate would likely provide a
synergistic benefit along side NMDA antagonists, such as Memantine.
Likewise, clinical trials on LY2140023 have demonstrated
glutamate-based treatments as having potential for treating
schizophrenia without the side effects seen with xenochemical
anti-psychotics. Similar studies combining co-agonist glycine with
anti-psychotics, showed improved symptomology, suggesting that
delivering high doses of Aspartate, also a NMDA agonist, will yield
similar therapeutic benefits in this patient population.
[0280] Aspartate is an acidic amino acid, with a low Pka of 3.9.
Aspartate in the dipeptide form with phenylalanine via a methyl
ester yields aspartame, which is used as a commercial artificial
sweetener.
[0281] Cysteine:
[0282] Cysteine is a nonessential amino acid, and is synthesized
from homocysteine, which is itself synthesized from the metabolism
of methionine. Serine is involved in cysteine's synthesis by
condensing with homocysteine to form cystathionine. Cystathionine
is then deaminated and hydrolyzed to form cysteine and alpha
ketobutyrate. Cysteine's sulfur comes from homocysteine, but the
rest of the molecule comes from the initial serine residue. The
biosynthesis of cysteine occurs via a different mechanism in plants
and prokaryotes. Cysteine is a vital amino acid because it plays an
important role in protein folding. The disulfide linkages formed
between cysteine residues helps to stabilize the tertiary and
quaternary structure of proteins, and these disulfide linkages are
most common among the secreted proteins, where proteins are exposed
to more oxidizing conditions that are found in the cellular
interior. Despite the benefits of homocysteine, having high
systemic levels is a risk factor for developing cardiovascular
disease. Elevated homocysteine may be caused by a genetic
deficiency of cystathionine beta-synthase and excess methionine
intake may be another explanation. Control of methionine intake and
supplementation with folic acid and vitamin B12 in the diet has
been used to lower homocysteine levels. Furthermore, because the
availability of cysteine is a key component that limits the
synthesis of glutathionine, dietary supplementation with
N-acetyl-cysteine, a precursor for cysteine, is highly effective in
enhancing immunity under a wide range of disease states.
[0283] Cysteine undergoes rapid oxidation to Cystine. It
facilitates the biosynthesis of glutathionine, a powerful
antioxidant which can donate a reducing equivalent to unstable
molecules such as reactive oxygen species (ROS) free radicals.
After reducing an oxidative species, it can form a glutathionine
sulfide with another reactive glutathionine, providing a mechanism
of depleting oxidative stress inducing molecules from cells (The
liver can maintain concentrations of up to 5 mM). Glutathionine is
a powerful neutralizer of toxins in the liver, and helps to protect
the liver from the damaging effects of toxins. Additionally, this
detoxifying ability helps to diminish muscle weakness, prevents
brittle hair, and protects against radiation associated with these
toxins. As a result, it is beneficial for those suffering from
chemical allergies or exposed to high levels of air pollution.
Glutathionine also is a cofactor for iNOS, allow maximal synthesis
of NO in the arg-NO pathway. NO is important for normal endothelial
function and cardiovascular health (including vascular tone,
hemodynamics, angiogenesis).
[0284] In addition to being a precursor to glutatithionine,
cysteine is a precursor for the H2S, which can induce
endothelial-dependent relaxation, and can be further converted to
cysteine sulfinate. Cysteine sulfunate can be converted to taurine,
which has the ability to decrease methionine uptake. An excess of
methionine increases the risks of the development of
atherosclerosis by inducing hyperhomocysteinemia because
homocysteine is an intermediate between methionine and cysteine.
However, it is not known whether cysteine decreases homocysteine
directly or through the reduction of methionine (Sebastiaan
Wesseling, et al., Hypertension. 2009 53: 909-911).
[0285] Furthermore. Cysteine is a precursor for Taurine, which
modulates the arginine-NO pathway. Taurine has several potentially
protective effects. First, taurine has the ability to reduce
oxidative stress by binding to hypochlorite. It has been
hypothesized that taurine conjugates to mitochondrial transfer RNA,
and in so doing, prevents the formation of mitochondrial
superoxide. Additionally, taurine inhibits homocysteine-induced
stress of the endoplasmic reticulum of vascular smooth muscle cells
and thus restores the expression and secretion of extracellular
superoxide dismutase.
[0286] Glutamate:
[0287] Glutamate oxidizes in enterocytes of the small intestine,
leading to nitrogeneous products ornithine, citrulline, arginine,
and alanine. Glutamate also modulates the arginine-NO pathway. NO
is important for normal endothelial function and cardiovascular
health (including vascular tone, hemodynamics, angiogenesis).
[0288] High Glutamate
[0289] A lack of ATP-producing substrates, as occurs in a fasted
state, can lead to autophagy and the turnover of intracellular
protein in the lysosome to provide an energy source. Low levels of
the glucogenic amino acids, including glutamate can stimulate
hepatic autophagy, leading to degradation of liver function.
[0290] Citrulline is produced from Glutamate as a by-product of a
reaction catalyzed by the NOS family. Dietary supplement of
citrulline is known to reduce plasma levels of glucose,
homocysteine., and asymmetric dimethylarginine, which are risk
factors for metabolic syndrome. L-citrulline accelerates the
removal of lactic acid from muscles, likely due to the effects on
vascular tone and endothelial function. Recent studies have also
shown that L-citrulline from watermelon juice provides greater
recovery from exercise, and less soreness the next day. It also
appears that delivery of L-citrulline as a free form results in
less uptake into cells in vitro than in the context of watermelon
juice (which contains high levels of L-citrulline). This suggests
an opportunity to deliver peptide doses, which can traffic arginine
into muscle tissue for conversion into citrulline by eNOS at the
endothelial membrane for improved efficacy.
[0291] Glutamate facilitates the biosynthesis of glutathione, which
can donate a reducing equivalent to unstable molecules such as
reactive oxygen species (ROS) and free radicals. After reducing an
oxidative species, it can form a glutathione disulfide with another
reactive glutathione, providing a mechanism of depleting oxidative
stress inducing molecules from cells (maintains high concentrations
of up to 5 mM in the liver). Glutathione also is a cofactor for
iNOS, allow maximal synthesis of NO in the arg-NO pathway.
[0292] Glutamate with co-agonists glycine or serine is an agonist
of NMDA receptors, releasing Ca2+ as a second messenger in many
cellular signaling pathways. There are dopaminergic and
glutaminergic abnormalities implicated in schitzophrenia, with NMDA
antagonists mimicking some positive and negative symptoms of
schitzophrenia, while carrying less risk of brain harm than do
dopamine agonists. Ketamine and PCP, for example, produce similar
phenotypes observed in schitzophrenia, with PCP showing less
representative symptomology yet similar brain structure changes.
Glutamate receptors have increased function, contributing to the
onset of schizophrenia. An increased proportion of post-synaptic
glutamate receptors to pre-synaptic glutamate receptors result in
increased glutamate signaling. Both agonizing and antagonizing NMDA
receptors has shown some benefit in treating Alzheimer's dementia,
depending on the MOA and receptor specificity. Thus delivering
proteins with either high or low levels of Glutamate, which also as
NMDA agonist activity, could be therapeutic for this patient
population. Proteins with low levels of Glutamate would likely
provide a synergistic benefit alongside NMDA antagonists, such as
Memantine. Likewise, clinical trials on LY2140023 have demonstrated
Glutamate-based treatments as having potential for treating
schizophrenia without the side effects seen with xenochemical
anti-psychotics. Similar studies combining co-agonist Glycine with
anti-psychotics, showed improved symptomology, suggesting that
delivering high doses of Aspartate, also a NMDA agonist, will yield
similar therapeutic benefits in this patient population.
[0293] Low Glutamate
[0294] Glutamate and acetyl-CoA are converted into
N-acetylglutamate in the mitochondria. This pushes the hepatic urea
cycle towards the active state, useful for ammonia detoxification.
This means that dietary delivery of nutrients with low doses of
Glutamate may be useful in the context of kidney disease, where
patients struggle to clear urea from their circulation. Elimination
of Glutamate to limit uremia from the available nitrogen sources,
while being able to maintain a limited protein intake to prevent
tissue catabolism, is a novel strategy against a disruptive
nutritional consequence of kidney disease.
[0295] Glutamine:
[0296] Glutamine oxidizes in enterocytes of the small intestine,
leading to nitrogeneous products ornithine, citrulline, arginine,
and alanine.
[0297] Citrulline is produced from Glutamine as a by-product of a
reaction catalyzed by the NOS family. Dietary supplement of
citrulline is known to reduce plasma levels of glucose,
homocysteine, and asymmetric dimethylarginine, which are risk
factors for metabolic syndrome. L-citrulline accelerates the
removal of lactic acid from muscles, likely due to the affects on
vascular tone and endothelial function. Recent studies have also
shown that L-citrulline from watermelon juice provides greater
recovery from exercise, and less soreness the next day. It also
appears that delivery of L-citrulline as a free from results in
less uptake into cells in vitro than in the context of watermelon
juice (which contains high levels of L-citrulline). This suggests
an opportunity to deliver peptide doses, which can traffic arginine
into muscle tissue for conversion into citrulline by eNOS at the
endothelial membrane for improved efficacy.
[0298] High Glutamine
[0299] Glutamine is a well studied secretagogue that can stimulate
the systemic release of insulin from beta-cells, growth hormone,
prolactin, glucagon, progesterone, and placental lactogen. It has
also been shown to reduce circulating glucocorticoids and stress
hormones. This biology has direct implications on both digestive
biology and the absorption of nutrients present in the intestine,
as well as affecting energy balance by triggering satiety signals
mediated by endocrine hormones. The ability to modulate these
hormones provides a therapeutic opportunity for decreasing caloric
intake in metabolic disorders such as obesity or alternatively
triggering appetite in muscle wasting, sarcopenia, and cachexia, as
well as by shifting insulin sensitivity in the onset of
diabetes.
[0300] Dietary Glutamine supplementation up-regulates
anti-oxidative genes and lowers expression of proinflammatory genes
in the adipose and small intestinal tissues.
[0301] Glutamine is an important signaling molecule for stimulating
mTOR1 phosphorylation in a cell-specific manner. This regulates
cellular protein turnover (autophagy) and integrates insulin-like
growth signals to protein synthesis initiation across tissues. This
biology has been directly linked to biogenesis of lean tissue mass
in skeletal muscle, metabolic shifts in disease states of obesity
and insulin resistance, and aging.
[0302] Glutamine is an amino acid that is maintained at sufficient
levels to support the anabolic effects of EAAs. Lysine, Methionine,
Threonine. Tryptophan, Leucine, Isoleucine, and Valine have been
shown unable to support increased protein synthesis and whole-body
growth when added to a 12.7% crude protein diet, indicating a
deficiency in the anabolic mediating non-essential amino acids,
including Glutamine.
[0303] Glutamine is slowly cyclized to pyroglutamate. Glutamine is
the preferred source of fuel for rapidly dividing cells, including
enterocytes, lymphocytes, macrophages, and tumors. Supplementation
with glutamine in the diet has significant demonstrated benefits in
gut integrity and immune function in surgery, critical illness,
burn and infection. A 12-day burn injury study of Glutamine
supplementation (0.35 g/kg) showed decreased intestinal
permeability, lower endotoxin levels, and shorter length of
hospital stay. It provided 8.8.times.decrease vs 5.5.times.
decrease in Lactulose/mannitol ratio after 3 days and a 6-day
reduction in hospital stay. 2 week Glutamine total parenteral
nutrition (TPN) (0.23 g/kg) vs Glutamine-Free TPN study of
malnourished patients waiting for surgery showed increased gut
permeability in Glutamine-Free group. It provided a 3.6.times. vs
0.81.times. increase in Lactulose/Mannitol ratio after 2 weeks.
These improvements point to an opportunity to deliver high levels
of Glutamine in the clinic to improve intestinal immunity and
reduced bacteremia.
[0304] This also improves lymphocyte counts systemically and
reduces infectious complications during a hospital stay. A study of
glutamine supplementation (26 g/day until discharge) in patients
with serious burn injury shows 3.times. more frequent positive
blood culture in standard total enteral nutrition (TEN) vs
Glutamine-enriched, significantly reducing mortality rate.
Additionally, Glutamine supplementation shows increased lymphocyte
count and function, increased HGH, reduced infectious
complications, reduced hospital stay, reduced morbidity, reduced
mortality, and reduced gut permeability.
[0305] Intramuscular levels of Glutamine decrease under catabolic
states such as stress, burn, injury, and sepsis. This decrease
causes an net negative protein in lean tissue. Administration of
Glutamine to the skeletal muscle has been shown to increase protein
synthesis while inhibiting breakdown in-vitro. Furthermore, dose
dependence from physiological concentrations (1 mM Glutamine) up to
15-fold higher concentrations has been observed in skeletal muscle.
The effect was further demonstrated in mucosal cells taken from the
small intestine.
[0306] Branched chain amino acids are all metabolic substrates for
glutamine synthesis, providing a source of Glutamine in the fetus,
enhancing placental and fetal growth, suggesting a role for
Glutamine in mediating their effects on anabolism in mammals.
Moreover, it has been shown that Glutamine levels and timing of
availability from the plasma affect the cellular uptake of Leucine,
and the subsequent profile of mTOR activation. A buildup of
intracellular Glutamine is used for uptake of Leucine via the
Glutamine/Leucine antiporter, SLC7A5. Administration of glutamine
at equal proportions to Leucine in-vitro causes a more sustained
stimulation of protein synthesis via mTOR, whereas priming the
cells with Glutamine prior to Leucine administration leads to a
more rapid, yet transient mTOR activation (Nicklin, P. et. al. Cell
2009).
[0307] A lack of ATP-producing substrates, as occurs in a fasted
state, can lead to autophagy and the turnover of intracellular
protein in the lysosome to provide an energy source. Low levels of
the glucogenic amino acids, including glutamine can stimulate
hepatic autophagy, leading to degradation of liver function.
[0308] Low Glutamine
[0309] mTOR is a central signaling pathway which can be hijacked
for the proliferation of fast-growing cancer cells, as is evidence
by oncogenic cells' preferential uptake of Glutamine.
[0310] Glycine:
[0311] A lack of ATP-producing substrates, as occurs in a fasted
state, can lead to autophagy and the turnover of intracellular
protein in the lysosome to provide an energy source. Low levels of
the glucogenic amino acids, including glycine can stimulate hepatic
autophagy, leading to degradation of liver function.
[0312] Glycine facilitates the biosynthesis of glutathione, which
can donate a reducing equivalent to unstable molecules such as
reactive oxygen species (ROS) and free radicals. After reducing an
oxidative species, it can form a glutathione disulfide with another
reactive glutathione, providing a mechanism of depleting oxidative
stress inducing molecules from cells (maintains high concentrations
of up to 5 mM in the liver). Glutathione also is a cofactor for
iNOS, allow maximal synthesis of NO in the arg-NO pathway.
[0313] Histidine:
[0314] Histidine is an essential amino acid, and is a precursor for
carnosine. Carnosine is an antioxidant and transition metal
ion-sequestering agent. It acts as an anti-glycating agent by
inhibiting the formation of advanced glycation end products (AGEs).
AGEs are prevalent in diabetic vasculature and contribute to the
development of atherosclerosis. The presence of AGEs in various
cells types affect both the extracellular and intracellular
structure and function. (Golden, A. et. al. Advanced Glycosylation
End Products. Circulation 2006). Also, the accumulation of AGEs in
the brain is a characteristic of aging and degeneration,
particularly in Alzheimer's disease. AGE accumulation explains many
neuropathological and biochemical features of Alzheimer's disease
such as protein crosslinking, oxidative stress, and neuronal cell
death. Because of its combination of antioxidant and antiglycating
properties, carnosine is able to diminish cellular oxidative stress
and inhibit the intracellular formation of reactive oxygen species
and reactive nitrogen species.
[0315] Histidine has antioxidant, anti-inflammatory, and
anti-secretory properties. Histidine's imidazole rings have the
ability to scavenge reactive oxygen species (ROS), which are made
by cells during acute inflammatory response. Histidine
administration inhibits cytokine and growth factors involved in
cell and tissue damage. Histidine administration is instrumental in
rheumatoid arthritis treatment, and administering 4.5 g daily has
been used to effectively treat patients with severe rheumatoid
arthritis. Rheumatoid arthritis patients have been found to have
low serum histidine levels due to its very rapid removal from the
blood. Low plasma Histidine levels have also been found in patients
with chronic renal failure, obese women (where it also had negative
impact on oxidative stress and inflammation), pediatric patients
with pneumonia, and asthma patients. Histidine supplementation has
been shown to diminish insulin resistance, reduce BMI and fat mass.
Histidine suppresses inflammation and oxidative stress in obese
subjects with a metabolic syndrome. Lastly, as a precursor to
histamine, histidine increases levels of histamine in the blood and
in the brain. Low blood histamine is found in some manic,
schizophrenic, high copper and hyperactive groups of psychiatric
patients.
[0316] Posttranslational modification of proteins involved in
transcriptional regulation is a mechanisms used to regulate genes.
This modification can alter protein functions in specific ways. One
form of modification is protein methylation, which is one of the
most abundant protein modifications. Protein methylation carries
important biological functions, including gene regulation and
signal transduction. Histidine plays a role in protein
modification, and ultimately gene regulation, in that it accepts
methyl group transferred from S-adenosylmethionine by protein
methyltransferases (Young-Ho Lee and Michael R. Stallcup, Mol
Endocrinol. 2009 April; 23(4): 425-433).
[0317] Histidine supplementation can be instrumental in the
treatment of multiple diseases including: Alzheimer's disease,
diabetes, atherosclerosis, metabolic syndrome in women, rheumatoid
arthritis, and various psychiatric conditions (manic,
schizophrenic, high copper, and hyperactive groups). Additionally,
due to its role in protein modifications, Histidine provides an
avenue to combat diseases resulting from gene deregulation,
including cancer.
[0318] Low Histidine
[0319] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, elF2a, and GCN4p discussed below). Diets
devoid of an essential amino acid remarkably trigger this signaling
within minutes after diet introduction (Hao et. Al., science 2005).
Signaling through SREBP-1c has been shown in vivo to have dramatic
effects on mobilizing lipid stores by repressing genes related to
lipogenesis. SREBP-1c has been shown to specifically act on hepatic
lipid synthesis, and an ability to cause a hepatic steatosis
phenotype as well as increase in visceral fat mass (Knebel B, et.
Al. Liver-Specific Expression of Transcriptionally Active SREBP-c
Is Associated with Fatty Liver and Increased Visceral Fat Mass.
PLoS, 2012). An unbalanced diet lacking Histidine has been shown to
signal GCN2 for rats on a basal casein diet with 1-5.4% of an amino
acid mixture supplemented lacking Histidine. Histidine deprivation,
through its action on GCN2, has an effect on SREBP-1c and decreased
physiologic measures of liver weight (and fatty liver phenotype),
adipose tissue weight, cholesterol/triglyceride content, and food
intake. Driving decreased fat mass, while maintaining lean mass,
provides a therapeutic opportunity in areas such as obesity,
diabetes, and cardiovascular health.
[0320] Isoleucine:
[0321] Isoleucine is an EAA, and is also a BCAA. Isoleucine is used
in combination with other BCAAs to improve the nutritional status
of patients suffering from hepatic disease. BCAAs, including
isoleucine, serve as fuel sources for skeletal muscle during
periods of metabolic stress; promote protein synthesis, suppress
protein catabolism, and serve as substrates for gluconeogenesis.
BCAAs, and specifically isoleucine, are catabolized in the skeletal
muscle, and stimulate the production of L-alanine and
L-glutamine.
[0322] BCAAs have been shown to have anabolic effects on protein
metabolism by increasing the rate of protein synthesis and
decreasing the rate of protein degradation in resting human muscle.
Additionally. BCAAs are shown to have anabolic effects in human
muscle during post endurance exercise recovery. These effects are
mediated through the phosphorylation of mTOR and sequential
activation of 70-kD S6 protein kinase (p70-kD S6), and eukaryotic
initiation factor 4E-binding protein 1. P70-kD S6 is known for its
role in modulating cell-cycle progression, cell size, and cell
survival. P70-kD S6 activation in response to mitogen stimulation
up-regulates ribosomal biosynthesis and enhances the translational
capacity of the cell (W-L An, et al., Am J Pathol. 2003 August;
163(2): 591-607; E. Blomstrand, et al., J. Nutr. January 2006 136:
269S-273S). Eukaryotic initiation factor 4E-binding protein 1 is a
limiting component of the multi-subunit complex that recruits 40S
ribosomal subunits to the 5' end of mRNAs. Activation of p70 S6
kinase, and subsequent phosphorylation of the ribosomal protein S6,
is associated with enhanced translation of specific mRNAs.
[0323] BCAAs given to subjects during and after one session of
quadriceps muscle resistance exercise show an increase in mTOR, p70
S6 kinase, and S6 phosphorylation was found in the recovery period
after the exercise. However, there was no such effect of BCAAs on
Akt or glycogen synthase kinase 3 (GSK-3). Exercise without BCAA
intake leads to a partial phosphorylation of p70 S6 kinase without
activating the enzyme, a decrease in Akt phosphorylation, and no
change in GSK-3. BCAA infusion also increases p70 S6 kinase
phosphorylation in an Akt-independent manner in resting subjects.
This mTOR activity regulates cellular protein turnover (autophagy)
and integrates insulin-like growth signals to protein synthesis
initiation across tissues. This biology has been directly linked to
biogenesis of lean tissue mass in skeletal muscle, metabolic shifts
in disease states of obesity and insulin resistance, and aging.
[0324] Isoleucine supplementation can be used to improve athletic
performance and muscle formation, prevent muscle loss that
accompanies aging, aid those suffering from hepatic disease,
support the growing bodies of children, and improve the nutritive
quality of foods given to the starving populations. Additionally,
as a precursor for L-alanine and L-glutamine, isoleucine mediates
their significant metabolic signaling activities.
[0325] Low Isoleucine
[0326] In states of obesity and diabetes, animals have been shown
to exhibit reduced hepatic autophagy, leading to increased insulin
resistance. Autophagy is important for maintenance of the ER and
cellular homeostasis, which when stressed can lead to impaired
insulin sensitivity. High fat diet feeding in animal models
stresses the ER, while leading to depressed hepatic autophagy
through over-stimulation of mTORC1, which reinforces the
progression towards insulin sensitivity impaired beta-cell function
in diabetes. Reducing the level of systemic Isoleucine provides an
opportunity to lower mTORC1 activity and restore healthy levels of
autophagy.
[0327] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, elF2a, and GCN4p discussed below). Diets
devoid of any EAAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B, et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Isoleucine deprivation, through its action on GCN2, has an
effect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol, triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0328] Leucine:
[0329] Leucine is an essential amino acid and a branched chain
amino acid. The branched chain amino acids, including Leucine,
serve as fuel sources for skeletal muscle during periods of
metabolic stress; promote protein synthesis, suppress protein
catabolism, and serve as substrates for gluconeogenesis. BCAAs, and
including Leucine, are catabolized in the skeletal muscle, and
stimulate the production of L-alanine and L-glutamine. Leucine
plays a direct role in the regulation of protein turnover through
cellular mTOR signaling and gene expression as well as serving to
activate glumatate dehydrogenase.
[0330] BCAAs have been shown to have anabolic effects on protein
metabolism by increasing the rate of protein synthesis and
decreasing the rate of protein degradation in resting human muscle.
Additionally, BCAAs are shown to have anabolic affects in human
muscle during post endurance exercise recovery. These affects are
mediated through the phosphorylation of mTOR and sequential
activation of 70-kD S6 protein kinase (p70-kD S6), and eukaryotic
initiation factor 4E-binding protein 1. P70-kD S6 is known for its
role in modulating cell-cycle progression, cell size, and cell
survival. P70-kD S6 activation in response to mitogen stimulation
up-regulates ribosomal biosynthesis and enhances the translational
capacity of the cell (W-L An, et al., Am J Pathol. 2003 August;
163(2): 591-607; E. Blomstrand, et al., J. Nutr. January 2006 136:
269S-273S). Eukaryotic initiation factor 4E-binding protein 1 is a
limiting component of the multi-subunit complex that recruits 40S
ribosomal subunits to the 5' end of mRNAs. Activation of p70 S6
kinase, and subsequent phosphorylation of the ribosomal protein S6,
is associated with enhanced translation of specific mRNAs.
[0331] BCAAs given to subjects during and after one session of
quadriceps muscle resistance exercise show an increase in mTOR, p70
S6 kinase, and S6 phosphorylation was found in the recovery period
after the exercise. However, there was no such effect of BCAAs on
Akt or glycogen synthase kinase 3 (GSK-3). Exercise without BCAA
intake leads to a partial phosphorylation of p70 S6 kinase without
activating the enzyme, a decrease in Akt phosphorylation, and no
change in GSK-3. BCAA infusion also increases p70 S6 kinase
phosphorylation in an Akt-independent manner in resting subjects.
Leucine is furthermore known to be the primary signaling molecule
for stimulating mTOR1 phosphorylation in a cell-specific manner.
This regulates cellular protein turnover (autophagy) and integrates
insulin-like growth signals to protein synthesis initiation across
tissues. This biology has been directly linked to biogenesis of
lean tissue mass in skeletal muscle, metabolic shifts in disease
states of obesity and insulin resistance, and aging.
[0332] Leucine is a well-studied secretagogue that can stimulate
the systemic release of insulin from beta-cells, growth hormone,
prolactin, glucagon, progesterone, and placental lactogen. This
biology has direct implications on both digestive biology and the
absorption of nutrients present in the intestine, as well as
affecting energy balance by triggering satiety signals mediated by
endocrine hormones. The ability to modulate these hormones provides
a therapeutic opportunity for decreasing caloric intake in
metabolic disorders such as obesity or alternatively triggering
appetite in muscle wasting, sarcopenia, and cachexia, as well as by
shifting insulin sensitivity in the onset of diabetes.
[0333] Leucine activates glutamate dehydrogenase, which is an
enzyme that catalyzes the reversible interconversion between
glutamate, a-ketoglutarate, and ammonia. In mammals, glutamate
dehydrogenase has high levels of activity in the liver, kidney,
brain, and pancreas. In the liver, glutamate dehydrogenase provides
the appropriate ratio of ammonia and amino acids for urea synthesis
in periportal hepatocytes, and the glutamate dehydrogenase
reactions seem to be in a close-to-equilibrium state. Additionally,
glutamate dehydrogenase has been shown to produce glutamate for
glutamine synthesis in a small rim of pericentral hepatocytes,
enabling it to serve as either a source for ammonia or an ammonia
scavenger. In the kidney, glutamate dehydrogenase functions to
produce ammonia from glutamate to control acidosis (C. Spanaki and
A. Plaitakis, Neurotox Res. 2012 January; 21(1):117-27).
[0334] Leucine supplementation can be used to improve athletic
performance and muscle formation, prevent muscle loss that
accompanies aging, aid those suffering from hepatic disease,
support the growing bodies of children, and improve the nutritive
quality of foods given to the starving populations. Additionally,
leucine plays an important role in urea synthesis in hepatocytes,
and may be given to treat those who suffer from conditions that
cause them to be hyperammonemic. Lastly, leucine may be used to
treat acidosis.
[0335] Low Leucine
[0336] In states of obesity and diabetes, animals have been shown
to exhibit reduced hepatic autophagy, leading to increased insulin
resistance. Autophagy is important for maintenance of the ER and
cellular homeostasis, which when stressed can lead to impaired
insulin sensitivity. High fat diet feeding in animal models
stresses the ER, while leading to depressed hepatic autophagy
through over-stimulation of mTORC1, which reinforces the
progression towards insulin sensitivity impaired beta cell function
in diabetes. Reducing the level of systemic Leucine provides an
opportunity to lower mTORC1 activity and restore healthy levels of
autophagy.
[0337] mTOR is a central signaling pathway which can be hijacked
for the proliferation of fast-growing cancer cells. Depletion of
Leucine may reduce a fast-growing cell's ability to sustain
constitutive mTOR activation.
[0338] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of an EAA remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B, et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Leucine deprivation, through its action on GCN2, has an
affect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol/triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0339] Leucine deprivation, furthermore, has directly shown
up-regulation of UCP1 in brown adipose tissue (BAT), a direct
measure of thermogenesis, an increase in energy expenditure
(presumably due to an increase in thermogenesis in BAT), and a
corresponding decrease in fat mass by stimulation of lipolysis in
the white adipose tissue (WAT). UCP1 up-regulation results in
decreased food intake, body weight, abdominal fat mass, fat mass,
and maintenance of lean mass (Guo, F. The GCN2 elF2alpha kinase
regulates fatty-acid homeostasis in the liver during deprivation of
an essential amino acid. Cell Metab., 2007).
[0340] Lysine:
[0341] Lysine is an EAA that is important for proper growth, and
plays a vital role in the production of carnitine. Camitine is a
quaternary amine that plays an important role in the production of
energy in the myocardium. Carnitine transports free fatty acids
into the mitochondria, and in so doing, increases the preferred
substrate for oxidative metabolism in the heart. Additionally,
carnitine prevents the fatty acid accumulation that occurs during
ischemic events, which may lead to ventricular arrhythmias. As the
myocardial carnitine levels are quickly diminished during an
ischemic event, exogenous supplementation with carnitine
replenishes the depleted myocardial carnitine levels and improve
cardiac metabolic and left ventricular function. Additionally, an
analysis of 4 studies demonstrated that supplementation with
L-carnitine after an acute myocardial infarction (AMI), in
comparison to a placebo, significantly reduces left ventricular
dilation in the first year after the AMI. This is significant
because the prevention of left ventricular dilation and the
preservation of cardiac function after an AMI is a powerful
predictor of the progression to heart failure and death.
Additionally, carnitine aids in lowering cholesterol, which further
supports heart health, and aids in the prevention of acute
myocardial infarctions (James J. DiNicolantonio, et al., Mayo
Clinic Proceedings. 2013: 88, 544-551).
[0342] Lysine supplementation is useful to support heart health and
during ischemic events to prevent ventricular arrhythmia. In
addition, Lysine supplementation may help heart attack patients
recover effectively, and aid in the prevention of heart attacks in
those with the left ventricular dilation. Also, Lysine can be used
for to decrease cholesterol levels in patients with high
cholesterol.
[0343] Lysine is instrumental in helping the body to absorb calcium
and decreases the amount of calcium that is lost in urine. Due to
calcium's role in bone health, Lysine supplementation is helpful in
preventing the bone loss that is associated with osteoporosis.
Furthermore, a combination of L-arginine and Lysine makes the bone
building cells more active and enhances production of collagen,
which is substance that is important for bones and connective
tissues including: skin, tendon, and cartilage.
[0344] Lysine supplementation is useful for patients suffering from
osteoporosis, and those at risk for developing osteoporosis; the
elderly, menopausal women, growing children, in cosmetics due to
its role in collagen production, and athletes for improved ligament
integrity.
[0345] A lysine deficiency causes fatigue, nausea, dizziness, loss
of appetite, agitation, bloodshot eyes, slow growth, anemia, and
reproductive disorders.
[0346] Lysine helps to prevent and suppress outbreaks of cold sores
and genital herpes when taken on a regular basis. When 45 patients
with frequently recurring herpes infection were given 312-1200 mg
of lysine daily in single or multiple doses, recovery from the
infection and suppression of recurrence was evidenced (Griffith R.
S., et al., Dermatologica 1978:156:257-267). This is because lysine
has antiviral effects, which act by blocking the activity of
arginine, which promotes herpes simplex virus (HSV) replication. In
tissue culture studies, herpes viral replication is enhanced when
the arginine/lysine ratio favors arginine. However, when the
arginine/lysine ratio favors lysine, viral replication is
suppressed, ad cyto-pathogenicity of HSV is inhibited. (Griffith R.
S. et al., Dermatologica 1978; 156:257-267). It has been shown that
oral lysine is more effective for preventing an outbreak than it is
at reducing the severity and duration of the outbreak.
[0347] Supplementing the diet with Lysine for those infected with
the HSV suppresses outbreak of cold sores and genital warts, and
when actively taken on a regular basis is very beneficial in the
prevention of outbreaks.
[0348] Lysine modulates the arginine-NO pathway. NO is important
for normal endothelial function and cardiovascular health
(including vascular tone, hemodynamics, angiogenesis). Lysine is a
natural inhibitor of L-arginine transport, and competes with
L-arginine for uptake through the system y+, which is the major
transport system of cationic amino acids in mammalian cells. Excess
nitric oxide contributes to refractory hypotension associated with
sepsis, and can be combatted with administration of L-lysine
because it inhibits Arginine, which is an important component of NO
synthesis (K. G. Allman, et al., British Journal of Anaesthesia
(1998) 81: 188-192). Moreover, an excess of NO may lead to
diseases, due to its release from cerebral vasculature, brain
tissue, and nerve endings, which are prime regions for
neurodegeneration. Excess NO may lead to migraines, brain cell
damage that can lead to neurodegenerative diseases like Parkinson
disease, Alzheimer's disease, Huntington disease, and amyotrophic
lateral sclerosis. Furthermore, NO that is produced by the pancreas
may damage the beta-cells as occurs in type 1 diabetes.
[0349] Lysine supplementation is useful for the prevention of
hypotension associated with sepsis by preventing vasodilation.
Additionally, lysine may be used to prevent/treat migraines, and
prevent/slow down the progression of neurodegenerative diseases
like AD, Parkinson's disease, Huntington, and amyotrophic lateral
sceloris.
[0350] Low Lysine
[0351] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of an EAA remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, with an ability to cause a hepatic steatosis phenotype
as well as increase in visceral fat mass (Knebel, B, et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Lysine deprivation, through its action on GCN2, has an
affect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol/triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0352] Methionine:
[0353] Methionine is an essential amino acid, and is the initiating
amino acid in the synthesis of virtually all eukaryotic proteins.
Methionine is one of the most hydrophobic AAs. Most of the
methionine residues in globular proteins can be found in the
interior of the hydrophobic core. Methionine is often found to
interact with the lipid bilayer in membrane-spanning protein
domains. Due to its location and powerful antioxidative properties,
methionine has been regarded as endogenous antioxidants in proteins
(John T. Brosnan and Margaret E. Brosnan, J. Nutr. June 2006 vol.
136 no. 6 1636S-1640S). Methionine residues have a high
susceptibility to oxidation by oxidases, ozone, hydrogen peroxide,
superoxide, .gamma.-irradiation, metal-catalyzed oxidation,
"leakage" from the electron transport chain, and auto-oxidation of
flavins or xenobiotics. Once oxidized, the Methionine residue is
converted to methionine sulfoxide, which can be converted back to
Methionine though methionine sulfoxide reductases (Rodney L.
Levine, et al., Proc Natl Acad Sci USA, 1996 Dec. 24; 93(26):
15036-15040). As an antioxidant, methionine supplementation can aid
in the prevention of cancer, degenerative diseases, heart disease,
liver and kidney pathologies. It can also be used in cosmetics to
fight the damage of UV rays to the skin.
[0354] Methionine is a lipotropic AA, and helps the liver process
lipids, and thereby helps prevent the build-up of fat in the liver
and arteries that may ultimately lead to an obstruction of blood
flow to the brain, heart, and kidneys. Additionally, the build-up
of fat in the liver drives a pathology known as hepatic steatosis,
which may ultimately lead to cirrhosis of the liver. Methionine
supplementation for individuals undergoing drug detoxification may
improve the process, as well as for those taking medications which
have toxic side effects.
[0355] In addition, to being a lipotropic AA, Methionine promotes
heart health by increasing of the liver's production of lectithin,
which is known to help reduce cholesterol levels. Methionine
supplementation can prevent cirrhosis of the liver from fat
deposition therein. Additionally, it can promote cardiovascular
health by preventing the deposition of fat into the arteries,
thereby preventing possible myocardial infarctions and strokes.
Further, Methionine may help those with high cholesterol levels
lower their cholesterol improving the risk of cardiovascular
disease
[0356] Methionine aids in the proper functioning of the immune
system in that elevated levels of methionine increases the levels
of taurine, and homocysteine and glutathione which help improve
immune function. The underlying mechanism for the immune functions
may involve mTOR activation, NO and glutathionine synthesis, H2S
signaling, and cellular redox state. Methionine is a precursor for
Taurine, which modulates the arginine-NO pathway. NO is important
for normal endothelial function and cardiovascular health
(including vascular tone, hemodynamics, angiogenesis).
[0357] Methionine is also converted into cysteine, which is a
precursor for Glutathionine. Glutathionine is a powerful
neutralizer of toxins in the liver, and helps to protect the liver
from the damaging effects of toxins. Additionally, this detoxifying
ability helps to diminish muscle weakness, prevents brittle hair,
and protects against radiation associated with these toxins. As a
result, it is beneficial for those suffering from chemical
allergies or exposure to high levels of air pollution. Methionine
can be helpful to patients with compromised immune systems, such as
AIDS patients and cancer patients. Likewise, it can be a useful
supplement during flu seasons, particularly to groups who are most
susceptible, including: the elderly, children, and pregnant women.
Furthermore, it can be used for those travelling to countries where
they will likely be susceptible to regional infections. Methionine
levels are observed to be lower in patients with AIDS. This
decreased level of methionine has been linked to deterioration in
the nervous system that leads to symptoms like dementia, and
diminished memory recall. Supplementing with 6 grams of methionine
per day can lead to improvements in the memory recall in these
patients. Likewise, Methionine can be beneficial to those who have
diseases that involve nervous system degeneration including
Alzheimer's Disease, ALS, MS, and Huntington's.
[0358] Methionine participates in one-carbon metabolism, and
thereby also participates in the methylation of proteins and DNA,
which in turn helps regulate gene expression and the biological
activity of proteins. Methionine supplementation for those at risk
for related genetic disorders can be used to promote proper gene
regulation in all individuals.
[0359] Low Methionine
[0360] Methionine is a precursor for the toxic homocysteine, which
mediates ADMA by down-regulating DDAH in body to metabolize ADMA,
interfering with the arginine-NO pathway. NO is important for
normal endothelial function and cardiovascular health (including
vascular tone, hemodynamics, angiogenesis).
[0361] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis,
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of any EEAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B. et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Methionine deprivation, through its action on GCN2, has an
affect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol/triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0362] Phenylalanine:
[0363] Phenylalanine is an EEA, AuAA, and precursor for synthesis
of norepinephrine in the brain, as well as a metabolic precursor
for tyrosine, which is another aromatic amino acid and precursor
for the synthesis of dopamine.
[0364] Norepinephrine (NE) is synthesized in the adrenal medulla
and postganglionic neurons in the sympathetic nervous system by the
.beta.-oxidation of dopamine by .beta.-hydroxylase along with the
cofactor ascorbate. It works by being secreted into the synaptic
cleft where it stimulates adrenergic receptors and is then either
degraded or up-taken by surrounding cells. As a cathecolamine, it
does not cross the blood-brain barrier.
[0365] NE can be used to combat attention-deficit/hyperactivity
disorders (ADHD), depression, and hypotension. In terms of
attention disorders, like ADHD, medications prescribed tend to help
increase levels of NE and dopamine. Furthermore, depression is
typically treated with medications that inhibit the reuptake of
serotonin and NE thereby increasing the amount of serotonin and NE
that is available in the postsynaptic cells in the brain. Recent
evidence has suggested that serotonin-norepinephrine reuptake
inhibitors (SNRIs) may also increase dopamine transmission because
if the norepinephrine transporter ordinarily recycled dopamine as
well then SNRIs will also enhance the dopaminergic transmission. As
a result, the effects antidepressants may also be associated with
the increased NE levels may partly be due to the simultaneous
increase in dopamine (in particular in the prefrontal cortex of the
brain).
[0366] NE is used to treat patients with critical hypotension. NE
is a vasopressor and acts on both .alpha.1 and .alpha.2 adrenergic
receptors to cause vasoconstriction, thereby increasing the blood
pressure.
[0367] As a precursor for NE, Phenylalanine can be used to treat
attention disorders like ADHD and ADD. Additionally, it can be used
to treat those suffering from depression or post-traumatic stress
syndrome. Phenylalaline can also be used to treat depression or
alter the function of neurotransmitter modulating drugs such as
SSRIs. Additionally, due to its ability to increase blood pressure
through the increase of vascular tone, it may be used to treat
those with a hypotensive tendency. Furthermore, phenylalanine may
be used as an upstream regulator of tyrosine levels, and thereby
Tyrosine function.
[0368] Tyrosine supplementation can help in the treatment of
Parkinson's disease due to its role as a precursor to L-DOPA and
dopamine. Additionally, it can be used in the treatment of those
with emotional/psychiatric disorder like depression and in the
treatment of addiction. Furthermore, it can promote learning by
increasing the reward/pleasure response during learning difficult
or complex concepts or movements.
[0369] Dopamine, which is a monoamine catecholamine
neurotransmitter, plays a regulatory role in the immune system.
Neurotransmitters and neuropeptides that interact with specific
receptors present in particular immune effector cells are released
by the immune system to influence the functions of these cells in
the host against disease and other environmental stress. The
immunoregulatory actions of dopamine have been shown to be
regulated via five different G protein-coupled receptors that are
present in target cells. There are two broad classes of these
receptors: G1 and G2, which encompass the varying subtypes. The D1
class of receptors includes D2 and D5 subtypes, and increase
intracellular cAMP upon activation. The D2 class of receptors
consists of the D2, D3, and D4 subtypes, and has been reported to
inhibit intracellular cAMP upon stimulation. Dopamine receptors
have been found on normal human leukocytes. Likewise, the lymphoid
tissues have dopaminergic innervations through sympathetic nerves,
which suggests that dopamine may be able to regulate the immune
system effector cells (Basu, Sujit & Sarkar, Chandrani.
Dopamine and immune system. SciTopics 2010).
[0370] Dopamine affects T cells by activating the resting T cells
and inhibiting the activation of stimulated T cells. In normal
resting peripheral human T lymphocytes, dopamine activates the D2
and D3 subclass of receptors, which in turn activates integrins
(.alpha.4.beta.1 and .alpha.5.beta.1). These integrins are
hetrodimeric transmembrane glycoproteins that attach cells to the
extracellular matrix component, fibronectin. Fibronectin is used
for the trafficking and extravasation of T cells across the tissue
barriers and blood vessels. Furthermore, dopamine acts through the
D3 receptors to selectively induce the migration and homing of CD8+
T cells. Moreover, dopamine affects T cells by influencing the
secretions of cytokines by the T cells. When dopamine stimulates
the D3 and D1/D5 receptors, the secretion of TNF-.alpha. (a
pleiotropic inflammatory cytokine) is increased. When the D2
receptors are stimulated, IL-10 (an anti-inflammatory cytokine) is
induced to secrete. Dopamine, however, can inhibit the activated T
cell receptor induced cell proliferation and secretion of a number
of cytokines like 11-2, IFN-.gamma. and IL-4 through the
down-regulation of the expression of non-receptor tyrosine kinases
Ick and fyn, which are important tyrosine kinases in the initiation
of TCR activation (Basu. Sujit & Sarkar. Chandrani Dopamine and
immune system. SciTopics 2010).
[0371] The B cells have a very high expression of dopamine D2, D3,
and D5 receptors. Dopamine has the ability to inhibit the
proliferation of the resting and the malignant B lymphocytes.
Dopamine acts by promoting apoptosis in cycling B cells through
oxidative stress. However, this dopaminergic action has not been
observed in resting lymphocytes, therefore suggesting a role in the
prevention of cancer (Basu. Sujit & Sarkar, Chandrani, Dopamine
and immune system. SciTopics 2010).
[0372] Tyrosine, as a precursor for Dopamine, can be used to
improve immune responses and improve the overall immune system
functionality. It can provide a benefit to the elderly, women who
are pregnant, children, and those with compromised immune functions
like AIDS patients, and cancer patients. It also can be given to
teachers, those travelling, and anyone frequently exposed to
germs.
[0373] Epinephrine, which is popularly known as adrenaline, is a
hormone that is secreted by the medulla of the adrenal glands.
Epinephrine is released in response to strong emotions such as fear
or anger, which causes an increase in heart rate, muscle strength,
blood pressure, and sugar metabolism. It is responsible for the
flight or fight response that prepares the body for difficult or
strenuous activity. Epinephrine is used as a stimulant during
cardiac arrest, as a vasoconstrictor during shock to increase blood
pressure, and as a bronchodilator and antispasmodic in bronchial
asthma. Epinephrine is not found in large quantities in the body,
but is nevertheless very important in the maintenance of
cardiovascular homeostasis because it has the ability to divert
blood to tissues under stress. Epinephrine has this effect by
influencing muscle contraction. Contraction of the muscles occurs
through the binding calmodulin to calcium ions when the
concentration is 10.times.larger than normal in the cell. The
calcium-calmodulin complex then goes on to activate the myosin
light chain kinase, which then phosphorylates the LC2 causing the
contraction. Epinephrine binds to the epinephrine receptors, which
activates adenylyl cyclase, and produces cyclic AMP from ATP, cAMP
activates a protein kinase which thus phosphorylates the myosin
light chain kinase. This phosphorylated myosin light chain kinase
has a lower affinity for the calcium-calmodulin complex, and is
thus inactive. As such, the smooth muscle tissue is relaxed. It is
this action of epinephrine that makes it very useful in treating
asthma, cardiac arrest, and anaphylactic shock. Tyrosine, as a
precursor for Epinephrine, can be used for patients who are at risk
for cardiac arrest, those suffering from asthma, and those who are
at risk for anaphylactic shock.
[0374] Epinephrine is one of two main hormones that breakdown
glycogen by binding to a receptor on exterior of a liver cell. This
binding causes a conformational change to take place thereby
allowing G protein to bind and become active. The activation of the
G-protein coupled receptor causes a conformational change on the
molecule to occur which causes adenylate cyclase to bind.
Onceadenylate cyclase binds the complex, adenylate cyclase breaks
down ATP into cAMP, which then becomes the second messenger protein
in this process and activates protein kinase. The activated protein
kinase activates phosphorylase, which is an enzyme that catalyzes
breaks down the glycogen to glucose. Tyrosine, as a precursor for
Epinephrine, can be used to improve athletic performance by making
glucose readily available to fuel exercise.
[0375] Melanin is a metabolite of Tyrosine, and is a powerful
antioxidant. Additionally, it is influential in the inhibition of
the production of inflammatory cytokines and superoxide. When
pro-inflammatory cytokines are overproduced, it mediates the
damaging effects of inflammation in pathologic conditions like
rheumatoid arthritis, graft vs. host reactions, cachexia, and
sepsis syndrome. It has been found that melanin inhibits ongoing
cytokine synthesis, which strongly suggests that melanin may be
useful as a superimposed therapy for conditions that involve
proinflammatory cytokines (Mohagheghpour N., et al., Cell Immunol.
2000 Jan. 10; 199(1):25-36).
[0376] Tyrosine can be used in the treatment of rheumatoid
arthritis, cachexia, sepsis syndrome, those with inflammation
related to autoimmune disorder, and other inflammatory sequela of
pathologic conditions.
[0377] Phenylalanine up-regulates the activity of GTP
cyclohydrolase-I, freeing tetrahydrobiopterin (THB) for NO
synthesis and the hydroxylation of ArAAs by aromatic amino acid
hydroxylase (AAAH). For this reason, delivery of high levels of
Phenylalanine to raise cellular levels of THB directly stimulates
the biosynthesis of many neurotransmitters in the CNS capillary
endothelial cells. ArAAs serve as precursors for biosynthesis of
monoamine neurotransmitters, including melatonin, dopamine,
norepinephrine (noradrenaline), and epinephrine (adrenaline). In
promoting NO synthesis, phenylalanine can be used to treat
hypertension, to decrease blood pressure, and may be used in the
context of diving, or those travelling to high altitudes to
increase vasodilation.
[0378] Low Phenylalanine
[0379] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of any EAAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B. et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Phenylalanine deprivation, through its action on GCN2, has
an effect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol, triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0380] Proline:
[0381] Citrulline is produced from Glutamine as a by-product of a
reaction catalyzed by the NOS family. Dietary supplement of
citrulline is known to reduce plasma levels of glucose,
homocysteine, and asymmetric dimethylarginine, which are risk
factors for metabolic syndrome. L-citrulline accelerates the
removal of lactic acid from muscles, likely due to the effects on
vascular tone and endothelial function. Recent studies have also
shown that L-citrulline from watermelon juice provides greater
recovery from exercise and less soreness the next day. It also
appears that delivery of L-citrulline as a free form results in
less uptake into cells in vitro than in the context of watermelon
juice (which contains high levels of L-citrulline). This suggests
an opportunity to deliver peptide doses, which can traffic arginine
into muscle tissue for conversion into citrulline by eNOS at the
endothelial membrane for improved efficacy.
[0382] Changes in NO synthesis and polyamines (via Proline), are
seen during gestation when placental growth rate peaks, indicating
a role for arginine in fetal development during pregnancy.
[0383] Serine:
[0384] Serine is a nonessential amino acid, and is biosynthesized
from glycolysis via 3-phosphoglycerate. Serine plays a vital role
in intermediary metabolism in that it contributes to phospholipid,
sphingolipid, and cysteine biosynthesisas well as tryptophan
synthesis in bacteria and is a primary source of glycine. The body
has a need for glycine, which probably exceeds dietary intake by
10-50 fold. This demand is not only for the synthesis of protein,
particularly collagen, but also for glycine being a precursor for 5
major metabolic biosynthetic pathways: creatine, porphyrins,
purines, bile acids, and glutathione. Additionally, due to its role
in glycine production, serine is also a major donor of
folate-linked one-carbon units that are used in the biosynthesis of
purines and 2' deoxythymidine 5'-monophosphate and the
remethylation of homocystein to methionine. It is important to note
that for every glycine molecule that is derived from serine, there
is one-carbon unit formed. (Cook, R. Defining the steps of the
folate one-carbon shuffle and homocysteine metabolism 1'2; Am. J
Clin Nutr; 2000)
[0385] In one-carbon metabolism, one-carbon units for biosynthesis
are carried and chemically activated by a family of cofactors
called tetrahydrofolate (THF) polyglutamates. THF-mediated
one-carbon metabolism is a metabolic system of interdependent
biosynthetic pathways compartmentalized in the cytoplasm, the
mitochondria, and the nucleus. In the cytoplasm, one-carbon
metabolism is used for the synthesis of purines and thymidylates
and the remethylation of homocysteine to methionine (an
overabundance of homocysteine may be harmful to the body). In the
mitochondria, one-carbon metabolism is used for the synthesis of
formylated methionyl-tRNA; the catabolism of choline, purines, and
histidine; and the interconversion of serine and glycine.
Additionally, the mitochondria is the primary source for one-carbon
units for cytoplasmic metabolism. Disruption of the folate-mediated
one-carbon metabolism has been linked with many pathologies and
developmental anomalies. (J. T. Fox and P. J. Stover, Chapter i,
Folate-Mediated One-Carbon Metabolism, In: Gerald Litwack,
Editor(s), Vitamins & Hormones, Academic Press, 2008, Volume
79, Pages 1-44).
[0386] Serine hydroxymethyltransferase (SHMT) catalyzes the freely
reversible interconversion of serine and glycine in a reaction that
is both folate- and pyridoxal 5-phosphate dependent. The conversion
of serine to glycine involves the removal of the C-3 serine and the
formation of 5,10-methylenetetrahydrofolate, which can be utilized
in the folate-dependent one-carbon metabolism or oxidized to carbon
dioxide via 10-foryltetrahydrofolate (Robert J Cook, Am J Clin Nutr
December 2000 vol. 72 no. 6 1419-1420).
[0387] Serine is a precursor for cysteine. Cysteine is synthesized
from homocysteine, which is itself synthesized from the metabolism
of methionine. Serine is involved in cysteine's synthesis by
condensing with homocysteine to form cystathionine. Cystathionine
is then deaminated and hydrolyzed to form cysteine and alpha
ketobutyrate. Cysteine's sulfur comes from homocysteine, but the
rest of the molecule comes from the initial serine residue. The
biosynthesis of cysteine occurs via a different mechanism in plants
and prokaryotes. Cysteine is a vital amino acid because it plays an
important role in protein folding. The disulfide linkages formed
between cysteine residues helps to stabilize the tertiary and
quaternary structure of proteins, and these disulfide linkages are
most common among the secreted proteins, where proteins are exposed
to more oxidizing conditions that are found in the cellular
interior. Despite the benefits of homocysteine, high levels can be
a risk factor for developing cardiovascular disease. Elevated
homocysteine may be caused by a genetic deficiency of cystathionine
beta-synthase and excess methionine intake may be another
explanation. Control of methionine intake and supplementing with
folic acid and vitamin B12 in the diet have been used to lower
homocysteine levels. Likewise, increased Serine levels to support
homocysteine to cysteine conversion can be beneficial.
[0388] N-methyl-D-aspartate (NMDA) is one of the most fundamental
neurotransmitters in the brain. It is a glutamate receptor and is a
vital molecular device for the control of synaptic plasticity and
memory function. This receptor is an ionotropic receptor for
glutamate and is characterized by high affinity for glutamate, a
high unitary conductance, high calcium permeability, and a
voltage-dependent block by magnesium ions. In order for the NMDA
receptor to open, it is bound by glutamate and glycine or D-serine.
D-serine is a neurotransmitter and a gliotransmitter that is
biosynthesized in the brain by serine racemase from L-serine. It is
a powerful or potent agonist to glycine for the NMDA receptor
binding site. (Jean-Pierre Mothet, et al., Proc Natl Acad Sci USA,
2000, 97 (9) 4926-4931; Zito K and Scheuss V. (2009) NMDA Receptor
Function and Physiological Modulation. In: Encyclopedia of
Neuroscience (Squire L R, ed), volume 6, pp. 1157-1164. Oxford:
Academic Press).
[0389] Serine plays an important role in learning and synaptic
plasticity, as a result, serine supplementation can be useful to
the elderly, growing children, school age children, and those
experiencing learning difficulties. Additionally, it can be given
to anyone trying to learn a new task, be it an instrument, or
athletes/dancers trying to improve or learn new exercises and
movements. Furthermore, due to its role as a precursor for
cysteine, may be given as an upstream regulator for the effects of
cysteine. As a precursor for the synthesis of glycine, serine may
be used in cosmetic products, to combat aging, and promote proper
growth because of its role in collagen synthesis. Furthermore, it
can be used to improve athletic abilities because of its role in
the creatine biosynthetic pathway. Moreover, it may be very useful
in the detoxification and immune health because of its role in the
glutathionine metabolic pathway.
[0390] Threonine:
[0391] Threonine is an EAA, and is one of the few AAs that is not
converted into its L-isomer via transaminases and d-AA oxidases.
Threonine is used for the synthesis of mucin protein, which is used
for maintaining the integrity and function of the intestines.
Mucus, which is composed of mucin and inorganic salts suspended in
water, serve as a diffusion barrier against contact with noxious
substances such as gastric acid and smoke. Mucus also acts as a
lubricant to minimize shear stresses (G. K. Law, et al., Am J
Physiol Gastrointest Liver Physiol 292:G1293-G1301, 2007).
[0392] 90% of dietary threonine is used in the gut for mucus
synthesis. Mucin is continuously synthesized and is very resistant
to intestinal proteolysis, and is therefore not very easily
recycled. As such, a substantial and consistent supply of threonine
is used in order to effectively maintain gut function and
structure. As a result, it is very important that the diet is rich
with threonine in order to prevent mucus production from
decreasing, which can lead to cancers in the gut, ulcers, etc. (G.
K. Law, et al., Am J Physiol Gastrointest Liver Physiol
292:G1293-G1301, 2007: A. Hamard, et al., Journal of Nutritional
Biochemistry, October 2010, Volume 21, Issue 10, Pages 914-921).
Due to the importance of mucus to the integrity and structure of
the gut, threonine supplementation can be useful in the prevention
of gut disorder including cancers, ulcers, infections, and
erosions.
[0393] Threonine plays a key role in humoral immunity because
threonine is a major component of immunoglobulins, which are
secreted by B lymphocytes in the blood. Once released, they reach
the site of infection, recognize, bind, and inactivate their
antigens. Because of the high threonine content of immunoglobulins,
a threonine deficiency may have negatively affect immunoglobulin
production, and thereby decrease immune response. Threonine
supplementation is essential for its role in the immune response
and can support leukemia patients, AIDS patients, and individuals
who have immunodeficiency. Additionally, it can support those
susceptible to infection during the flu season, such as the elderly
and small children, as well as throughout the year to strengthen
immune response.
[0394] Low Threonine
[0395] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis,
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of any EAAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B. et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). An unbalanced diet lacking Threonine has been shown to
signal GCN2 for rats on a basal casein diet with 1-5.4% of an amino
acid mixture supplemented lacking Threonine. Threonine deprivation,
through its action on GCN2, has an effect on SREBP-1c and decreased
physiologic measures of liver weight (and fatty liver phenotype),
adipose tissue weight, cholesterol/triglyceride content, and food
intake. Driving decreased fat mass, while maintaining lean mass,
provides a therapeutic opportunity in areas such as obesity,
diabetes, and cardiovascular health.
[0396] Tryptophan:
[0397] Tryptophan is both an EAA that plays an important role in
immune functions. For example, concentrations of tryptophan
progressively decline due to chronic lung inflammation. This
suggests that catabolism of tryptophan via the indoleamine
2,3-dioxygenase (IDO) appears to be very important for function of
macrophages and lymphocytes. Thus, antranilic acid (ANS) inhibits
the production of proinflammatory T-helper 1 cytokines and prevents
autoimmune neuroinflammation. Tryptophan can be used to treat the
inflammatory effects of certain diseases include arthritis and
asthma or other autoimmune diseases.
[0398] It is also a precursor for serotonin (5-HT) synthesis, a
neurotransmitter that affects appetite, sleep and is widely
implicated in onset of depression. Abnormality in 5-HT activity in
recovered depression patients (on SSRIs or other neurotransmitter
re-uptake inhibitors) leads to an acute sensitivity to low levels
of Tryptophan in the bloodstream. 5-HT production can be increased
2-fold by oral intake of free Tryptophan, indicating a role for
Tryptophan administration in depression. Furthermore, Tryptophan
can potentiate the effects of SSRIs due to the apparent dependence
on 5-HT availability for improvement in patient outcome.
[0399] Tryptophan can furthermore be used to help in weight
loss/maintenance, benefit those suffering from sleep disorders,
recovery from travel and jet lag: in addition to those suffering
from mood disorders like depression or the effects of PMS.
[0400] Low Tryptophan
[0401] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis,
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, elF2a, and GCN4p discussed below). Diets
devoid of any EAAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-1c has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel. B. et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Tryptophan deprivation, through its action on GCN2, has an
effect on SREBP-1c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol/triglyceride content, and food intake. Driving
decreased fat mass, while maintaining lean mass, provides a
therapeutic opportunity in areas such as obesity, diabetes, and
cardiovascular health.
[0402] Tyrosine:
[0403] Tyrosine is a nonessential amino acid that is synthesized
from phenylalanine. It is used as a precursor for many important
neurotransmitters including, epinephrine, norepinephrine, and
dopamine. Tyrosine helps produce melanin, and helps the organs that
make and regulate hormones, like the adrenal gland, thyroid gland,
and pituitary gland. Additionally, tyrosine is involved in the
structure of almost every protein in the body.
[0404] Tyrosine hydroxylase converts L-tyrosine into Levodopa using
tetrahydropteridine as a cofactor or by tyrosinase. The conversion
that is mediated by tyrosinase specifically oxidizes Levodopa to
Dopaquinone, and levodopa is further decarboxylated to Dopamine by
Dopa decarboxylase. Dopamine is a very important hormone and
neurotransmitter, and plays a vital role in both mental and
physical health. Dopamine helps to control the brain's reward and
pleasure centers, helps to regulate movement and emotional
responses, and enables one to see rewards and take action to move
towards those rewards. The neurons that contain dopamine are
clustered in the midbrain, in an area called the susbtantia nigra.
In those afflicted with Parkinson's disease, the neurons that
transmit dopamine in this area die resulting in an inability to
control bodily movement. In order to relieve the symptoms of
Parkinson's disease, L-Dopa, which can be converted to dopamine is
given to the patients.
[0405] Tyrosine supplementation can help in the treatment of
Parkinson's disease due to its role as a precursor to L-DOPA and
dopamine. Additionally, it can be used in the treatment of those
with emotional/psychiatric disorder like depression and in the
treatment of addiction. Furthermore, it can promote learning by
increasing the reward/pleasure response during learning difficult
or complex concepts or movements.
[0406] Dopamine, which is a monoamine catecholamine
neurotransmitter, plays a regulatory role in the immune system.
Neurotransmitters and neuropeptides that interact with specific
receptors present in particular immune effector cells are released
by the immune system to influence the functions of these cells in
the host against disease and other environmental stress. The
immunoregulatory actions of dopamine have been shown to be
regulated via five different G protein-coupled receptors that are
present in target cells. There are two broad classes of these
receptors: G1 and G2, which encompass the varying subtypes. The DI
class of receptors includes D2 and D5 subtypes, and increase
intracellular cAMP upon activation. The D2 class of receptors
consists of the D2, D3, and D4 subtypes, and has been reported to
inhibit intracellular cAMP upon stimulation. Dopamine receptors
have been found on normal human leukocytes. Likewise, the lymphoid
tissues have dopaminergic innervations through sympathetic nerves,
which suggests that dopamine may be able to regulate the immune
system effector cells (Basu, Sujit & Sarkar, Chandrani,
Dopamine and immune system. SciTopics 2010).
[0407] Dopamine affects T cells by activating the resting T cells
and inhibiting the activation of stimulated T cells. In normal
resting peripheral human T lymphocytes, dopamine activates the D2
and D3 subclass of receptors, which in turn activates integrins
(.alpha.4.beta.1 and .alpha.5.beta.1). These integrins are
hetrodimeric transmembrane glycoproteins that attach cells to the
extracellular matrix component, fibronectin. Fibronectin is used
for the trafficking and extravasation of T cells across the tissue
barriers and blood vessels. Furthermore, dopamine acts through the
D3 receptors to selectively induce the migration and homing of CD8+
T cells. Moreover, dopamine affects T cells by influencing the
secretions of cytokines by the T cells. When dopamine stimulates
the D3 and D1/D5 receptors, the secretion of TNF-.alpha. (a
pleiotropic inflammatory cytokine) is increased. When the D2
receptors are stimulated, IL-10 (an anti-inflammatory cytokine) is
induced to secrete. Dopamine, however, can inhibit the activated T
cell receptor induced cell proliferation and secretion of a number
of cytokines like 11-2, IFN-.gamma. and IL-4 through the
down-regulation of the expression of non-receptor tyrosine kinases
Ick and fyn, which are important tyrosine kinases in the initiation
of TCR activation (Basu, Sujit & Sarkar, Chandrani Dopamine and
immune system. SciTopics 2010).
[0408] The B cells have a very high expression of dopamine D2, D3,
and D5 receptors. Dopamine has the ability to inhibit the
proliferation of the resting and the malignant B lymphocytes.
Dopamine acts by promoting apoptosis in cycling B cells through
oxidative stress. However, this dopaminergic action has not been
observed in resting lymphocytes, therefore suggesting a role in the
prevention of cancer (Basu, Sujit & Sarkar, Chandrani, Dopamine
and immune system. SciTopics 2010).
[0409] Tyrosine, as a precursor for Dopamine, can be used to
improve immune responses and improve the overall immune system
functionality. It can provide a benefit to the elderly, women who
are pregnant, children, and those with compromised immune functions
like AIDS patients and cancer patients. It also can be given to
teachers, those travelling, and anyone frequently exposed to
germs.
[0410] NE is synthesized in the adrenal medulla and postganglionic
neurons in the sympathetic nervous system by the .beta.-oxidation
of dopamine by .beta.-hydroxylase along with the cofactor
ascorbate. It works by being secreted into the synaptic cleft where
it stimulates adrenergic receptors, and is then either degraded or
up-taken by surrounding cells. As a cathecolamine, it does not
cross the blood-brain barrier.
[0411] NE can be used to combat ADHD, depression, and hypotension.
In terms of attention disorders, like ADHD, medications prescribed
tend to help increase levels of NE and dopamine. Furthermore,
depression is typically treated with medications that inhibit the
reuptake of serotonin and NE thereby increasing the amount of
serotonin and NE that is available in the postsynaptic cells in the
brain. Recent evidence has suggested that SNRIs may also increase
dopamine transmission because if the norepinephrine transporter
ordinarily recycled dopamine as well, then SNRIs will also enhance
the dopaminergic transmission. As a result, the effects
antidepressants may also be associated with the increased NE levels
may partly be due to the simultaneous increase in dopamine (in
particular in the prefrontal cortex of the brain).
[0412] NE is used to treat patients with critical hypotension. NE
is a vasopressor and acts on both .alpha.1 and .alpha.2 adrenergic
receptors to cause vasoconstriction, thereby increasing the blood
pressure.
[0413] As a precursor for NE, Tyrosine can be used to treat
attention disorders like ADHD and ADD. Additionally, it can be used
to treat those suffering from depression, post-traumatic stress
syndrome, and those with acute hypotension.
[0414] Epinephrine, which is popularly known as adrenaline, is a
hormone that is secreted by the medulla of the adrenal glands.
Epinephrine is released in response to strong emotions such as fear
or anger, which causes an increase in heart rate, muscle strength,
blood pressure, and sugar metabolism. It is responsible for the
flight or fight response that prepares the body for difficult or
strenuous activity. Epinephrine is used as a stimulant during
cardiac arrest, as a vasoconstrictor during shock to increase blood
pressure, and as a bronchodilator and antispasmodic in bronchial
asthma. Epinephrine is not found in large quantities in the body,
but is nevertheless very important in the maintenance of
cardiovascular homeostasis because it has the ability to divert
blood to tissues under stress. Epinephrine has this effect by
influencing muscle contraction. Contraction of the muscles occurs
through the binding calmodulin to calcium ions when the
concentration is 10.times. larger than normal in the cell. The
calcium-calmodulin complex then goes on to activate the myosin
light chain kinase, which then phosphorylates the LC2 causing the
contraction. Epinephrine binds to the epinephrine receptors, which
activates adenylyl cyclase, and produces cyclic AMP from ATP, cAMP
activates a protein kinase which thus phosphorylates the myosin
light chain kinase. This phosphorylated myosin light chain kinase
has a lower affinity for the calcium-calmodulin complex, and is
thus inactive. As such, the smooth muscle tissue is relaxed. It is
this action of epinephrine that makes it very useful in treating
asthma, cardiac arrest, and anaphylactic shock. Tyrosine, as a
precursor for Epinephrine, can be used for patients who are at risk
for cardiac arrest, those suffering from asthma, and those who are
at risk for anaphylactic shock.
[0415] Epinephrine is one of two main hormones that breakdown
glycogen by binding to a receptor on exterior of a liver cell. This
binding causes a conformational change to take place thereby
allowing G protein to bind and become active. The activation of the
G-protein coupled receptor causes a conformational change on the
molecule to occur which causes adenylate cyclase to bind. Once
adenylate cyclase binds the complex, adenylate cyclase breaks down
ATP into cAMP, which then becomes the second messenger protein in
this process and activates protein kinase. The activated protein
kinase activates phosphorylase, which is an enzyme that catalyzes
breaks down the glycogen to glucose. Tyrosine, as a precursor for
Epinephrine, can be used to improve athletic performance by making
glucose readily available to fuel exercise.
[0416] Melanin is a metabolite of Tyrosine, and is a powerful
antioxidant. Additionally, it is influential in the inhibition of
the production of inflammatory cytokines and superoxide. When
pro-inflammatory cytokines are overproduced, it mediates the
damaging effects of inflammation in pathologic conditions like
rheumatoid arthritis, graft vs. host reactions, cachexia, and
sepsis syndrome. It has been found that melanin inhibits ongoing
cytokine synthesis, which strongly suggests that melanin may be
useful as a superimposed therapy for conditions that involve
proinflammatory cytokines (Mohagheghpour N., et al., Cell Immunol.
2000 Jan. 10; 199(1):25-36).
[0417] Tyrosine can be used in the treatment of rheumatoid
arthritis, cachexia, sepsis syndrome, those with inflammation
related to autoimmune disorder, and other inflammatory sequela of
pathologic conditions.
[0418] Valine:
[0419] Valine is an EAA, and is also a BCAA. The BCAAs, including
valine, serve as fuel sources for skeletal muscle during periods of
metabolic stress by promoting protein synthesis, suppressing
protein catabolism, and serving as substrates for gluconeogenesis.
The BCAAs, including valine, are substrates for glutamine synthesis
in animal tissues, and it has been shown that glutamine may play a
role in mediating the anabolic effect of BCAAs in animals. Such an
effect is likely to be important for the lactating mammary gland
because it produces more glutamine than it takes up from arterial
blood. Catabolism of BCAAs in the placenta results in glutamine
synthesis and its release into the fetal circulation, which is a
major source of the glutamine that circulates in the fetus. This
suggests that supplementing a diet with Valine as well as the other
BCAAs, or a combination thereof, may increase fetal growth in
mammals. Additionally, Valine plays a direct role in the synthesis
of alanine, and therefore has a regulatory function with regards to
alanine.
[0420] BCAAs have been shown to have anabolic effects on protein
metabolism by increasing the rate of protein synthesis and
decreasing the rate of protein degradation in resting human muscle.
Additionally, BCAAs are shown to have anabolic effects in human
muscle during post endurance exercise recovery. These effects are
mediated through the phosphorylation of mTOR and sequential
activation of 70-kD S6 protein kinase (p70-kD S6), and eukaryotic
initiation factor 4E-binding protein 1. P70-kD S6 is known for its
role in modulating cell-cycle progression, cell size, and cell
survival. P70-kD S6 activation in response to mitogen stimulation
up-regulates ribosomal biosynthesis and enhances the translational
capacity of the cell (W-L An, et al., Am J Pathol. 2003 August;
163(2): 591-607; E. Blomstrand, et al., J. Nutr. January 2006 136:
269S-273S). Eukaryotic initiation factor 4E-binding protein 1 is a
limiting component of the multi-subunit complex that recruits 40S
ribosomal subunits to the 5' end of mRNAs. Activation of p70 S6
kinase, and subsequent phosphorylation of the ribosomal protein S6,
is associated with enhanced translation of specific mRNAs.
[0421] BCAAs given to subjects during and after one session of
quadriceps muscle resistance exercise show an increase in mTOR, p70
S6 kinase, and S6 phosphorylation was found in the recovery period
after the exercise. However, there was no such effect of BCAAs on
Akt or glycogen synthase kinase 3 (GSK-3). Exercise without BCAA
intake leads to a partial phosphorylation of p70 S6 kinase without
activating the enzyme, a decrease in Akt phosphorylation, and no
change in GSK-3. BCAA infusion also increases p70 S6 kinase
phosphorylation in an Akt-independent manner in resting subjects.
This mTOR activity regulates cellular protein turnover (autophagy)
and integrates insulin-like growth signals to protein synthesis
initiation across tissues. This biology has been directly linked to
biogenesis of lean tissue mass in skeletal muscle, metabolic shifts
in disease states of obesity and insulin resistance, and aging.
[0422] Valine plays a key role in muscle metabolism, tissue repair,
and the maintenance of proper nitrogen balance in the body. As one
of the three BCAAs, it can be utilized as an energy source by
muscle tissue. Valine is a glucogenic AA, and therefore provides
glucose. Valine may be useful in the treatment of liver and
gallbladder disease. Additionally, valine may be useful in
correcting the type of severe AA deficiencies caused by drug
addiction. Furthermore, Valine has been found to promote mental
vigor, muscle coordination, and calm emotions. It may also be used
to prevent muscle loss at high altitudes.
[0423] Valine supplementation can be used to improve athletic
performance and muscle formation, aid in drug addiction
rehabilitation, to enhance mental vigor in elderly and growing
children, prevent muscle loss that accompanies aging, aid those
suffering from hepatic disease, support the growing bodies of
children, serve as a therapy for gallbladder and liver disease, to
increase lactation in mammals, to increase fetal growth in mammals,
and improve the nutritive quality of foods given to the starving
populations.
[0424] Low Valine
[0425] In states of obesity and diabetes, animals have been shown
to exhibit reduced hepatic autophagy, leading to increased insulin
resistance. Autophagy is important for maintenance of the ER and
cellular homeostasis, which when stressed can lead to impaired
insulin sensitivity. High fat diet feeding in animal models
stresses the ER, while leading to depressed hepatic autophagy
through over-stimulation of mTORC1, which reinforces the
progression towards insulin sensitivity impaired beta cell function
in diabetes. Reducing the level of systemic Valine provides an
opportunity to lower mTORC1 activity and restore healthy levels of
autophagy.
[0426] There exists a mechanistic understanding of how uncharged
tRNA allosterically activates GCN2, leading to downstream
phosphorylation of transcription factors related to lipogenesis and
protein synthesis, along with many biosynthetic pathways in
eukaryotes (SREBP-1c, eIF2a, and GCN4p discussed below). Diets
devoid of any EAAs remarkably trigger this signaling within minutes
after diet introduction (Hao et. Al., science 2005). Signaling
through SREBP-1c has been shown in vivo to have dramatic effects on
mobilizing lipid stores by repressing genes related to lipogenesis.
SREBP-le has been shown to specifically act on hepatic lipid
synthesis, and an ability to cause a hepatic steatosis phenotype as
well as increase in visceral fat mass (Knebel, B. et. Al.
Liver-Specific Expression of Transcriptionally Active SREBP-1c Is
Associated with Fatty Liver and Increased Visceral Fat Mass. PLoS,
2012). Valine deprivation, through its action on GCN2, has an
effect on SREBP-c and decreased physiologic measures of liver
weight (and fatty liver phenotype), adipose tissue weight,
cholesterol/triglyceride content and food intake. Driving decreased
fat mass, while maintaining lean mass, provides a therapeutic
opportunity in areas such as obesity, diabetes, and cardiovascular
health.
[0427] In vitro analyses of amino acid pharmacology. As provided
herein, amino acids behave both as necessary substrates for the
synthesis of new proteins and also serve as signaling molecules.
Analysis of the pharmacological properties of a given amino acid is
dependent on the cell line and model system utilized. For example,
the amino acid leucine has been shown to increase phosphorylation
of the mammalian target of rapamycin complex I and downstream
targets involved in anabolism in skeletal muscle cells (Gran P
& D Cameron-Smith. 2011. The actions of exogenous leucine on
mTOR signaling and amino acid transporters in human myotubes. BMC
Physiol. 11:10). In vitro assays of amino acid pharmacology can
also reveal auxotrophies in certain types of cancer. Auxotrophies
to methionine have been reported in multiple immortalized cancer
cell lines (Cavuoto P & MF Fenech. 2012. A review of methionine
dependency and the role of methionine restriction in cancer growth
control and life-span extension. Cancer Treat Rev. 38:
726-736).
[0428] An in vitro assay may be designed utilizing amino acids,
protein digests, or di- and tri-peptides as the independent or
manipulated variable after identifying a relevant cell line. An
appropriate cell line is selected based on its relevance as a model
of cellular processes. For example, C2C12 (ATCC. CRL-1772) is a
murine myoblast cell line that differentiates into myofibers and is
used as a model of skeletal muscle fiber differentiation and
development. Cells are maintained in a complete medium supplemented
with fetal bovine serum up to 10% which supplies necessary growth
factors, and penicillin and streptomycin. Adherent cell lines are
grown in T75 flasks with phenolic caps for filtered gas exchange
and incubated at 37.degree. C. at 5% CO2 in a humidified
environment. Table AA lists cell lines that are used to assay amino
acid pharmacology. For an in vitro assay, cells are seeded in T75
flasks, 6-, 12-, 24-, 48- or 96-well plates at an appropriate cell
density, determined empirically. Following an incubation period the
complete growth medium is replaced with medium deficient in the
test article. Following a period of medium depletion the test
article is added in the appropriate medium. Following the treatment
period, the relevant dependent variable is measured.
TABLE-US-00003 TABLE AA List of exemplary cell lines utilized in
vitro assays of amino acid pharmacology. Tissue Cell Line Species
or Cell Type Systems Modeled C2C12 Mus Skeletal muscle Skeletal
muscle growth musculus and differentiation RSkMC Rattus Skeletal
muscle Skeletal muscle growth norvegicus and differentiation 3T3-L1
Mus Embryo White adipose tissue musculus development CHO-K1
Cricetulus Ovary Heterologous protein griseus expression FHs 74 Int
Homo Small intestine Gastrointestinal and sapiens enteroendocrine
systems 293T Homo Embryonic Heterologous protein sapiens kidney
expression IEC-6 Rattus Small intestine/ Gastrointestinal and
norvegicus epithelium enteroendocrine systems NCI-H716 Homo Cecum
Gastrointestinal and sapiens enteroendocrine systems STC-1 Mus
Intestine Gastrointestinal and musculus enteroendocrine systems
MCF-7 Homo Lung Breast cancer sapiens adenocarcinoma LNCaP Homo
Prostate Prostate cancer clone FGC sapiens carcinoma Homo Prostate
Prostate cancer PC-3 sapiens adenocarcinoma
[0429] See, e.g., Wu, G. Amino acids: Metabolism, functions, and
nutrition. Amino Acids 37(1):1-17 (2009); Wu, G. Functional amino
acids in nutrition and health. Amino Acids 45(3):407-11 (2013);
Schworer, C. Glucagon-induced autophagy and proteolysis in rat
liver: Mediation by selective deprivation of intracellular amino
acids. PNAS 76(7):3169-73 (1979); Codongo, P. Autophagy: A
Potential Link between Obesity and Insulin Resistance. Cell
Metabolism 11(6):449-51 (2010); Leong, H et. al. Short-term
arginine deprivation results in large-scale modulation of hepatic
gene expression in both normal and tumor cells: microarray
bioinformatic analysis. Nutrition and metabolism 3:37 (2006);
Harbrecht, B. G. Glutathione regulates nitric oxide synthase in
cultured hepatocytes. Annals of Surgery 225(1): 76-87 (1997);
Watermelon juice: a potential functional drunk for sore muscle
relief in athletes. J. Agric. Food Chem. 61(31):7522-8 (2013).
[0430] Secreted Nutritive Polypeptides.
[0431] In another aspect, provided are nutritive polypeptides that
contain the amino acid sequences of edible species polypeptides,
which are engineered to be secreted from unicellular organisms and
purified therefrom. Such nutritive polypeptides can be endogenous
to the host cell or exogenous, and can be naturally secreted in
either the polypeptide or the host cell, or both, and are
engineered for secretion of the nutritive polypeptide.
[0432] Advantageous properties of a nutritive polypeptide include
the ability to be expressed and secreted in a host cell, solubility
in a wide variety of solvents, and when consumed by an intended
subject, nutritional benefit, reduced allergenicity or
non-allergenicity, lack of toxicity, and digestibility. Such
properties can be weighted based, at least in part, on the intended
consumer and the reason(s) for consumption of the nutritive
polypeptide (e.g., for general health, muscle anabolism, immune
health, or treatment or prevention of a disease, disorder or
condition). One or multiple nutritional criteria are satisfied for
example, by computing the mass fractions of all relevant amino
acid(s) based on primary sequence.
[0433] By way of non-limiting examples, polypeptides of the present
invention are provided in Table 1. The Predicted leader column
shows the sequence indices of predicted leaders (if a leader
exists). The Fragment Indices column shows the sequence indices of
fragment sequences. The DBID column lists either the UniProt or
GenBank Accession numbers for each sequence as available as of Sep.
24, 2014, each of which is herein incorporated by reference. DBIDs
with only numerical characters are from a GenBank database, and
those with mixed alphabetical/numerical characters are from a
UniProt database.
[0434] Nucleic Acids
[0435] Also provided herein are nucleic acids encoding polypeptides
or proteins. In some embodiments the nucleic acid is isolated. In
some embodiments the nucleic acid is purified.
[0436] In some embodiments of the nucleic acid, the nucleic acid
comprises a nucleic acid sequence that encodes a first polypeptide
sequence disclosed herein. In some embodiments of the nucleic acid,
the nucleic acid consists of a nucleic acid sequence that encodes a
first polypeptide sequence disclosed herein. In some embodiments of
the nucleic acid, the nucleic acid comprises a nucleic acid
sequence that encodes a protein disclosed herein. In some
embodiments of the nucleic acid, the nucleic acid consists of a
nucleic acid sequence that encodes a protein disclosed herein. In
some embodiments of the nucleic acid the nucleic acid sequence that
encodes the first polypeptide sequence is operatively linked to at
least one expression control sequence. For example, in some
embodiments of the nucleic acid the nucleic acid sequence that
encodes the first polypeptide sequence is operatively linked to a
promoter such as a promoter described herein.
[0437] Accordingly, in some embodiments the nucleic acid molecule
of this disclosure encodes a polypeptide or protein that itself is
a polypeptide or protein. Such a nucleic acid molecule can be
referred to as a "nucleic acid." In some embodiments the nucleic
acid encodes a polypeptide or protein that itself comprises at
least one of: a) a ratio of branched chain amino acid residues to
total amino acid residues of at least 24%; b) a ratio of Leu
residues to total amino acid residues of at least 11%; and c) a
ratio of essential amino acid residues to total amino acid residues
of at least 49%. In some embodiments the nucleic acid comprises at
least 10 nucleotides, at least 20 nucleotides, at least 30
nucleotides, at least 40 nucleotides, at least 50 nucleotides, at
least 60 nucleotides, at least 70 nucleotides, at least 80
nucleotides, at least 90 nucleotides, at least 100 nucleotides, at
least 200 nucleotides, at least 300 nucleotides, at least 400
nucleotides, at least 500 nucleotides, at least 600 nucleotides, at
least 700 nucleotides, at least 800 nucleotides, at least 900
nucleotides, at least 1,000 nucleotides. In some embodiments the
nutritive nucleic acid comprises from 10 to 100 nucleotides, from
20 to 100 nucleotides, from 10 to 50 nucleotides, or from 20 to 40
nucleotides. In some embodiments the nucleic acid comprises all or
part of an open reading frame that encodes an edible species
polypeptide or protein. In some embodiments the nucleic acid
consists of an open reading frame that encodes a fragment of an
edible species protein, wherein the open reading frame does not
encode the complete edible species protein.
[0438] In some embodiments the nucleic acid is a cDNA.
[0439] In some embodiments nucleic acid molecules are provided that
comprise a sequence that is at least 50%, 60%, 70%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99%, or 99.9% identical to an edible species
nucleic acid. In some embodiments nucleic acids are provided that
hybridize under stringent hybridization conditions with at least
one reference nucleic acid.
[0440] The nucleic acids and fragments thereof provided in this
disclosure display utility in a variety of systems and methods. For
example, the fragments can be used as probes in various
hybridization techniques. Depending on the method, the target
nucleic acid sequences can be either DNA or RNA. The target nucleic
acid sequences can be fractionated (e.g., by gel electrophoresis)
prior to the hybridization, or the hybridization can be performed
on samples in situ. One of skill in the art will appreciate that
nucleic acid probes of known sequence find utility in determining
chromosomal structure (e.g., by Southern blotting) and in measuring
gene expression (e.g., by Northern blotting). In such experiments,
the sequence fragments are preferably detectably labeled, so that
their specific hydridization to target sequences can be detected
and optionally quantified. One of skill in the art will appreciate
that the nucleic acid fragments of this disclosure can be used in a
wide variety of blotting techniques not specifically described
herein.
[0441] It should also be appreciated that the nucleic acid sequence
fragments disclosed herein also find utility as probes when
immobilized on microarrays. Methods for creating microarrays by
deposition and fixation of nucleic acids onto support substrates
are well known in the art. Reviewed in DNA Microarrays: A Practical
Approach (Practical Approach Series), Schena (ed.), Oxford
University Press (1999) (ISBN: 0199637768); Nature Genet.
21(1)(suppl): 1-60 (1999); Microarray Biochip: Tools and
Technology, Schena (ed.), Eaton Publishing Company/BioTechniques
Books Division (2000) (ISBN: 1881299376), the disclosures of which
are incorporated herein by reference in their entireties. Analysis
of, for example, gene expression using microarrays comprising
nucleic acid sequence fragments, such as the nucleic acid sequence
fragments disclosed herein, is a well-established utility for
sequence fragments in the field of cell and molecular biology.
Other uses for sequence fragments immobilized on microarrays are
described in Gerhold et al., Trends Biochem. Sci. 24:168-173 (1999)
and Zweiger. Trends Biotechnol. 17:429-436 (1999); DNA Microarrays:
A Practical Approach (Practical Approach Series), Schena (ed.),
Oxford University Press (1999) (ISBN: 0199637768); Nature Genet.
21(1)(suppl):1-60 (1999); Microarray Biochip: Tools and Technology,
Schena (ed.), Eaton Publishing Company/BioTechniques Books Division
(2000) (ISBN: 1881299376).
[0442] Expression
[0443] Vectors
[0444] Also provided are one or more vectors, including expression
vectors, which comprise at least one of the nucleic acid molecules
disclosed herein, as described further herein. In some embodiments,
the vectors comprise at least one isolated nucleic acid molecule
encoding a protein as disclosed herein. In alternative embodiments,
the vectors comprise such a nucleic acid molecule operably linked
to one or more expression control sequence. The vectors can thus be
used to express at least one recombinant protein in a recombinant
microbial host cell. In some aspects, a vector or set of vectors
can include a nucleic acid sequence coding for a signal peptide,
e.g., to cause secretion of a protein disclosed herein. See below
for further discussion of signal peptides and secretion.
[0445] Suitable vectors for expression of nucleic acids in
microorganisms are well known to those of skill in the art.
Suitable vectors for use in cyanobacteria are described, for
example, in Heidorn et al., "Synthetic Biology in Cyanobacteria:
Engineering and Analyzing Novel Functions," Methods in Enzymology,
Vol. 497, Ch. 24 (2011). Exemplary replicative vectors that can be
used for engineering cyanobacteria as disclosed herein include
pPMQAK1, pSL1211, pFC1, pSB2A, pSCR119/202, pSUN119/202, pRL2697,
pRL25C, pRL1050, pSG111M, and pPBH201.
[0446] Other vectors such as pJB161 which are capable of receiving
nucleic acid sequences disclosed herein may also be used. Vectors
such as pJB161 comprise sequences which are homologous with
sequences present in plasmids endogenous to certain photosynthetic
microorganisms (e.g., plasmids pAQ1, pAQ3, and pAQ4 of certain
Synechococcus species). Examples of such vectors and how to use
them is known in the art and provided, for example, in Xu et al.,
"Expression of Genes in Cyanobacteria: Adaptation of Endogenous
Plasmids as Platforms for High-Level Gene Expression in
Synechococcus sp. PCC 7002," Chapter 21 in Robert Carpentier (ed.),
"Photosynthesis Research Protocols," Methods in Molecular Biology,
Vol. 684, 2011, which is hereby incorporated herein by reference.
Recombination between pJB161 and the endogenous plasmids in vivo
yield engineered microbes expressing the genes of interest from
their endogenous plasmids. Alternatively, vectors can be engineered
to recombine with the host cell chromosome, or the vector can be
engineered to replicate and express genes of interest independent
of the host cell chromosome or any of the host cell's endogenous
plasmids.
[0447] A further example of a vector suitable for recombinant
protein production is the pET system (Novagen.RTM.). This system
has been extensively characterized for use in E. coli and other
microorganisms. In this system, target genes are cloned in pET
plasmids under control of strong bacteriophage T7 transcription and
(optionally) translation signals; expression is induced by
providing a source of T7 RNA polymerase in the host cell. T7 RNA
polymerase is so selective and active that, when fully induced,
almost all of the microorganism's resources are converted to target
gene expression: the desired product can comprise more than 50% of
the total cell protein a few hours after induction. It is also
possible to attenuate the expression level simply by lowering the
concentration of inducer. Decreasing the expression level may
enhance the soluble yield of some target proteins. In some
embodiments this system also allows for maintenance of target genes
in a transcriptionally silent un-induced state.
[0448] In some embodiments of using this system, target genes are
cloned using hosts that do not contain the T7 RNA polymerase gene,
thus alleviating potential problems related to plasmid instability
due to the production of proteins potentially toxic to the host
cell. Once established in a non-expression host, target protein
expression can be initiated either by infecting the host with
.lamda.CE6, a phage that carries the T7 RNA polymerase gene under
the control of the .lamda..mu.L and pI promoters, or by
transferring the plasmid into an expression host containing a
chromosomal copy of the T7 RNA polymerase gene under lacUV5
control. In the second case, expression is induced by the addition
of IPTG or lactose to the bacterial culture or using an
autoinduction medium. Other plasmids systems that are controlled by
the lac operator, but do not require the T7 RNA polymerase gene and
rely upon E. coli's native RNA polymerase include the pTrc plasmid
suite (Invitrogen) or pQE plamid suite (QIAGEN).
[0449] In other embodiments it is possible to clone directly into
expression hosts. Two types of T7 promoters and several hosts that
differ in their stringency of suppressing basal expression levels
are available, providing great flexibility and the ability to
optimize the expression of a wide variety of target genes.
[0450] Suitable vectors for expression of nucleic acids in
mammalian cells typically comprise control functions provided by
viral regulatory elements. For example, commonly used promoters are
derived from polyoma virus, Adenovirus 2, cytomegalovirus, or
Simian Virus 40.
[0451] Promoters
[0452] Promoters useful for expressing the recombinant genes
described herein include both constitutive and
inducible/repressible promoters. Examples of inducible/repressible
promoters include nickel-inducible promoters (e.g., PnrsA, PnrsB;
see, e.g., Lopez-Mauy et al., Cell (2002) v. 43: 247-256) and urea
repressible promoters such as PnirA (described in, e.g., Qi et al.,
Applied and Environmental Microbiology (2005) v. 71: 5678-5684).
Additional examples of inducible/repressible promoters include
PnirA (promoter that drives expression of the nirA gene, induced by
nitrate and repressed by urea) and Psuf (promoter that drives
expression of the suiB gene, induced by iron stress). Examples of
constitutive promoters include Pcpc (promoter that drives
expression of the cpc operon), Prbc (promoter that drives
expression of rubisco), PpsbAII (promoter that drives expression of
PpsbAII), Pcro (lambda phage promoter that drives expression of
cro). In other embodiments, a PaphII and/or a laclq-Ptrc promoter
can used to control expression. Where multiple recombinant genes
are expressed in an engineered microorganism, the different genes
can be controlled by different promoters or by identical promoters
in separate operons, or the expression of two or more genes can be
controlled by a single promoter as part of an operon.
[0453] Further non-limiting examples of inducible promoters may
include, but are not limited to, those induced by expression of an
exogenous protein (e.g., T7 RNA polymerase, SP6 RNA polymerase), by
the presence of a small molecule (e.g., IPTG, galactose,
tetracycline, steroid hormone, abscisic acid), by absence of small
molecules (e.g., CO2, iron, nitrogen), by metals or metal ions
(e.g., copper, zinc, cadmium, nickel), and by environmental factors
(e.g., heat, cold, stress, light darkness), and by growth phase. In
some embodiments, the inducible promoter is tightly regulated such
that in the absence of induction, substantially no transcription is
initiated through the promoter. In some embodiments, induction of
the promoter does not substantially alter transcription through
other promoters. Also, generally speaking, the compound or
condition that induces an inducible promoter is not naturally
present in the organism or environment where expression is
sought.
[0454] In some embodiments, the inducible promoter is induced by
limitation of CO.sub.2 supply to a cyanobacteria culture. By way of
non-limiting example, the inducible promoter can be the promoter
sequence of Synechocystis PCC 6803 that are up-regulated under the
CO.sub.2-limitation conditions, such as the cmp genes, ntp genes,
ndh genes, sbt genes, chp genes, and rbc genes, or a variant or
fragment thereof.
[0455] In some embodiments, the inducible promoter is induced by
iron starvation or by entering the stationary growth phase. In some
embodiments, the inducible promoter can be variant sequences of the
promoter sequence of cyanobacterial genes that are up-regulated
under Fe-starvation conditions such as isiA, or when the culture
enters the stationary growth phase, such as isiA, phrA, sigC, sigB,
and sigHgenes, or a variant or fragment thereof.
[0456] In some embodiments, the inducible promoter is induced by a
metal or metal ion. By way of non-limiting example, the inducible
promoter can be induced by copper, zinc, cadmium, mercury, nickel,
gold, silver, cobalt, and bismuth or ions thereof. In some
embodiments, the inducible promoter is induced by nickel or a
nickel ion. In some embodiments, the inducible promoter is induced
by a nickel ion, such as Ni.sup.2+. In another exemplary
embodiment, the inducible promoter is the nickel inducible promoter
from Synechocystis PCC 6803. In another embodiment, the inducible
promoter can be induced by copper or a copper ion. In yet another
embodiment, the inducible promoter can be induced by zinc or a zinc
ion. In still another embodiment the inducible promoter can be
induced by cadmium or a cadmium ion. In yet still another
embodiment, the inducible promoter can be induced by mercury or a
mercury ion. In an alternative embodiment, the inducible promoter
can be induced by gold or a gold ion. In another alternative
embodiment, the inducible promoter can be induced by silver or a
silver ion. In yet another alternative embodiment, the inducible
promoter can be induced by cobalt or a cobalt ion. In still another
alternative embodiment, the inducible promoter can be induced by
bismuth or a bismuth ion.
[0457] In some embodiments, the promoter is induced by exposing a
cell comprising the inducible promoter to a metal or metal ion. The
cell can be exposed to the metal or metal ion by adding the metal
to the microbial growth media. In certain embodiments, the metal or
metal ion added to the microbial growth media can be efficiently
recovered from the media. In other embodiments, the metal or metal
ion remaining in the media after recovery does not substantially
impede downstream processing of the media or of the bacterial gene
products.
[0458] Further non-limiting examples of constitutive promoters
include constitutive promoters from Gram-negative bacteria or a
bacteriophage propagating in a Gram-negative bacterium. For
instance, promoters for genes encoding highly expressed
Gram-negative gene products can be used, such as the promoter for
Lpp. OmpA, rRNA, and ribosomal proteins. Alternatively, regulatable
promoters can be used in a strain that lacks the regulatory protein
for that promoter. For instance P.sub.lac, P.sub.tac, and
P.sub.trc, can be used as constitutive promoters in strains that
lack Lac1. Similarly, P22 P.sub.R and P.sub.L can be used in
strains that lack the lambda C2 repressor protein, and lambda
P.sub.R and P.sub.L can be used in strains that lack the lambda C1
repressor protein. In one embodiment, the constitutive promoter is
from a bacteriophage. In another embodiment the constitutive
promoter is from a Salmonella bacteriophage. In yet another
embodiment, the constitutive promoter is from a cyanophage. In some
embodiments, the constitutive promoter is a Synechocystis promoter.
For instance, the constitutive promoter can be the PpsbAll promoter
or its variant sequences, the Prbc promoter or its variant
sequences, the P.sub.cpc promoter or its variant sequences, and the
PrnpB promoter or its variant sequences.
[0459] Hosts
[0460] Also provided are host cells transformed with the nucleic
acid molecules or vectors disclosed herein, and descendants
thereof. In some embodiments the host cells are microbial cells. In
some embodiments, the host cells carry the nucleic acid sequences
on vectors, which may but need not be freely replicating vectors.
In other embodiments, the nucleic acids have been integrated into
the genome of the host cells and/or into an endogenous plasmid of
the host cells. The transformed host cells find use, e.g., in the
production of recombinant proteins disclosed herein.
[0461] A variety of host microorganisms can be transformed with a
nucleic acid sequence disclosed herein and can in some embodiments
be used to produce a recombinant protein disclosed herein. Suitable
host microorganisms include both autotrophic and heterotrophic
microbes. In some applications the autotrophic microorganisms
allows for a reduction in the fossil fuel and/or electricity inputs
required to make a protein encoded by a recombinant nucleic acid
sequence introduced into the host microorganism. This, in turn, in
some applications reduces the cost and/or the environmental impact
of producing the protein and/or reduces the cost and/or the
environmental impact in comparison to the cost and/or environmental
impact of manufacturing alternative proteins, such as whey, egg,
and soy. For example, the cost and/or environmental impact of
making a protein disclosed herein using a host microorganism as
disclosed herein is in some embodiments lower that the cost and/or
environmental impact of making whey protein in a form suitable for
human consumption by processing of cow's milk.
[0462] Non-limiting examples of heterotrophs include Escherichia
coli, Salmonella typhimurium, Bacillus subtilis, Bacillus
megaterium, Corynebacterium glutamicum, Streptomyces coelicolor,
Streptomyces lividans, Streptomyces vanezuelae, Streptomyces
roseosporus, Streptomyces fradiae, Streptomyces griseus,
Streptomyces calvuligerus, Streptomyces hygroscopicus, Streptomyces
platensis, Saccharopolyspora erythraea, Corynebacterium glutamicum,
Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae,
Aspergillus terreus, Aspergillus sojae, Penicillium chrysogenum,
Trichoderma reesei, Clostridium acetobutylicum, Clostridium
beijerinckii, Clostridium thermocellum, Fusibacter paucivorans,
Saccharomyces cerevisiae. Saccharomyces boulardii. Pichia pastoris,
and Pichia stipitis.
[0463] Photoautotrophic microrganisms include eukaryotic algae, as
well as prokaryotic cyanobacteria, green-sulfur bacteria, green
non-sulfur bacteria, purple sulfur bacteria, and purple non-sulfur
bacteria. Extremophiles are also contemplated as suitable
organisms. Such organisms are provided, e.g., in Mixotrophic
organisms are also suitable organisms. Algae and cyanobacteria are
contemplated as suitable organisms. See the organisms disclosed in,
e.g., PCT/US2013/032232, filed Mar. 15, 2013, PCT:/US2013/032180,
filed Mar. 15, 2013. PCT/US2013/032225, filed Mar. 15, 2013,
PCT/US2013/032218, filed Mar. 15, 2013. PCT/US2013/032212, filed
Mar. 15, 2013, PCT/US2013/032206, filed Mar. 15, 2013, and
PCT/US2013/038682, filed Apr. 29, 2013
[0464] Yet other suitable organisms include synthetic cells or
cells produced by synthetic genomes as described in Venter et al.
US Pat. Pub. No. 2007/0264688, and cell-like systems or synthetic
cells as described in Glass et al. US Pat. Pub. No.
2007/0269862.
[0465] Still other suitable organisms include Escherichia coli,
Acetobacter aceti, Bacillus subtilis, yeast and fungi such as
Clostridium ljungdahlii, Clostridium thermocellum, Penicillium
chrysogenum, Pichia pastoris, Saccharomyces cerevisiae,
Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas
mobilis. In some embodiments those organisms are engineered to fix
carbon dioxide while in other embodiments they are not.
[0466] In some embodiments eukaryotic cells, such as insect cells
or mammalian cells, such as human cells are used as host cells.
Vectors and expression control sequences including promoters and
enhancers are well known for such cells. Examples of useful
mammalian host cell lines for this purpose are monkey kidney CV1
line transformed by SV40 (COS-7, ATCC CRL 1651): human embryonic
kidney line (293 or 293 cells subcloned for growth in suspension
culture, Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster
kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR
(CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980));
mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980));
monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney
cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells
(HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34);
buffalo rat liver cells (BRL 3A, ATCC CRL 1442): human lung cells
(W138. ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse
mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al.,
Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells;
and a human hepatoma line (Hep G2).
[0467] Transfection
[0468] Proteins can be produced in a host cell using, for example,
a combination of recombinant DNA techniques and gene transfection
methods as is well known in the art (e.g., Morrison, S. (1985)
Science 229:1202). For expression of the protein, the expression
vector(s) encoding the protein is transfected into a host cell by
standard techniques. The various forms of the term transfection are
intended to encompass a wide variety of techniques commonly used
for the introduction of exogenous DNA into a prokaryotic or
eukaryotic host cell, e.g., electroporation, calcium-phosphate
precipitation, DEAE-dextran transfection and the like.
[0469] Production
[0470] Skilled artisans are aware of many suitable methods
available for culturing recombinant cells to produce (and
optionally secrete) a protein as disclosed herein, as well as for
purification and/or isolation of expressed proteins. The methods
chosen for protein purification depend on many variables, including
the properties of the protein of interest, its location and form
within the cell, the vector, host strain background, and the
intended application for the expressed protein. Culture conditions
can also have an effect on solubility and localization of a given
target protein. Many approaches can be used to purify target
proteins expressed in recombinant microbial cells as disclosed
herein, including without limitation ion exchange and gel
filtration.
[0471] In some embodiments a peptide fusion tag is added to the
recombinant protein making possible a variety of affinity
purification methods that take advantage of the peptide fusion tag.
In some embodiments, the use of an affinity method enables the
purification of the target protein to near homogeneity in one step.
Purification may include cleavage of part or all of the fusion tag
with enterokinase, factor Xa, thrombin, or HRV 3 C proteases, for
example. In some embodiments, before purification or activity
measurements of an expressed target protein, preliminary analysis
of expression levels, cellular localization, and solubility of the
target protein is performed. The target protein can be found in any
or all of the following fractions: soluble or insoluble cytoplasmic
fractions, periplasm, or medium. Depending on the intended
application, preferential localization to inclusion bodies, medium,
or the periplasmic space can be advantageous, in some embodiments,
for rapid purification by relatively simple procedures.
[0472] While Escherichia coli is widely regarded as a robust host
for heterologous protein expression, it is also widely known that
over-expression of many proteins in this host is prone to
aggregation in the form of insoluble inclusion bodies. One of the
most commonly used methods for either rescuing inclusion body
formation, or to improve the titer of the protein itself, is to
include an amino-terminal maltose-binding protein (MBP) (Austin B
P, Nallamsetty S, Waugh D S. Hexahistidine-tagged maltose-binding
protein as a fusion partner for the production of soluble
recombinant proteins in Escherichia coli. Methods Mol Biol.
2009:498:157-72), or small ubiquitin-related modifier (SUMO)
(Saitoh H, Uwada J, Azusa K. Strategies for the expression of
SUMO-modified target proteins in Escherichia coli. Methods Mol
Biol. 2009; 497:211-21; Malakhov M P, Mattern M R, Malakhova O A,
Drinker M, Weeks S D, Butt T R. SUMO fusions and SUMO-specific
protease for efficient expression and purification of proteins. J
Struct Funct Genomics. 2004:5(1-2):75-86; Panavas T, Sanders C,
Butt T R. SUMO fusion technology for enhanced protein production in
prokaryotic and eukaryotic expression systems. Methods Mol Biol.
2009; 497:303-17) fusion to the protein of interest. These two
proteins are expressed extremely well, and in the soluble form, in
Escherichia coli such that the protein of interest is also
effectively produced in the soluble form. The protein of interest
can be cleaved by designing a site specific protease recognition
sequence (such as the tobacco etch virus (TEV) protease) in-between
the protein of interest and the fusion protein. In some
embodiments, a protein of interest can be present in an inclusion
body; in some aspects the inclusion body can be formulated for
delivery to a subject. Formulation is discussed in further detail
below.
[0473] In some embodiments the protein is initially not folded
correctly or is insoluble. A variety of methods are well known for
refolding of insoluble proteins. Most protocols comprise the
isolation of insoluble inclusion bodies by centrifugation followed
by solubilization under denaturing conditions. The protein is then
dialyzed or diluted into a non-denaturing buffer where refolding
occurs. Because every protein possesses unique folding properties,
the optimal refolding protocol for any given protein can be
empirically determined by a skilled artisan. Optimal refolding
conditions can, for example, be rapidly determined on a small scale
by a matrix approach, in which variables such as protein
concentration, reducing agent, redox treatment, divalent cations,
etc., are tested. Once the optimal concentrations are found, they
can be applied to a larger scale solubilization and refolding of
the target protein.
[0474] In some embodiments the protein does not comprise a tertiary
structure. In some embodiments less than half of the amino acids in
the protein participate in a tertiary structure. In some
embodiments the protein does not comprise a secondary structure. In
some embodiments less than half of the amino acids in the protein
participate in a secondary structure. Recombinant proteins can be
isolated from a culture of cells expressing them in a state that
comprises one or more of these structural features. In some
embodiments the tertiary structure of a recombinant protein is
reduced or eliminated after the protein is isolated from a culture
producing it. In some embodiments the secondary structure of a
recombinant protein is reduced or eliminated after the protein is
isolated from a culture producing it.
[0475] In some embodiments a CAPS buffer at alkaline pH in
combination with N-lauroylsarcosine is used to achieve solubility
of the inclusion bodies, followed by dialysis in the presence of
DTT to promote refolding. Depending on the target protein,
expression conditions, and intended application, proteins
solubilized from washed inclusion bodies can be >90% homogeneous
and may not require further purification. Purification under fully
denaturing conditions (before refolding) is possible using
His.Tag.RTM. fusion proteins and His.Bind.RTM. immobilized metal
affinity chromatography (Novogen.RTM.). In addition, S.Tag.TM.,
T7.Tag.RTM., and Strep.Tag.RTM. II fusion proteins solubilized from
inclusion bodies using 6 M urea can be purified under partially
denaturing conditions by dilution to 2 M urea (S*Tag and T7.Tag) or
1 M urea (Strep.Tag II) prior to chromatography on the appropriate
resin. Refolded fusion proteins can be affinity purified under
native conditions using His.Tag, S.Tag, Strep.Tag II, and other
appropriate affinity tags (e.g., GST.Tag.TM., and T7-Tag)
(Novogent).
[0476] In some embodiments the protein is an endogenous protein of
the host cell used to express it. That is, the cellular genome of
the host cell comprises an open reading frame that encodes the
recombinant protein. In some embodiments regulatory sequences
sufficient to increase expression of the protein are inserted into
the host cell genome and operatively linked to the endogenous open
reading frame such that the regulatory sequences drive
overexpression of the recombinant protein from a recombinant
nucleic acid. In some embodiments heterologous nucleic acid
sequences are fused to the endogenous open reading frame of the
protein and cause the protein to be synthesized comprising a
hetgerologous amino acid sequence that changes the cellular
trafficking of the recombinant protein, such as directing it to an
organelle or to a secretion pathway. In some embodiments an open
reading frame that encodes the endogeneous host cell protein is
introduced into the host cell on a plasmid that further comprises
regulatory sequences operatively linked to the open reading frame.
In some embodiments the recombinant host cell expresses at least 2
times, at least 3 times, at least 4 times, at least 5 times, at
least 10 times, or at least 20 times, at least 30 times, at least
40 times, at least 50 times, or at least 100 times more of the
recombinant protein than the amount of the protein produced by a
similar host cell grown under similar conditions.
[0477] Production of Recombinant Proteins in Plants
[0478] Nutritive polypeptides can be produced recombinantly from
plants, including but not limited to those organisms and methods of
production disclosed in PCT/US2013/032232, filed Mar. 15, 2013,
PCT/US2013/032180, filed Mar. 15, 2013, PCT/US2013/032225, filed
Mar. 15, 2013, PCT/US2013/032218, filed Mar. 15, 2013,
PCT/US2013/032212, filed Mar. 15, 2013, PCT/US2013/032206, filed
Mar. 15, 2013, and PCT/US2013/038682, filed Apr. 29, 2013 and any
phylogenetically related organisms, and other methods of production
known in the art.
[0479] Purification
[0480] Secreted
[0481] It is generally recognized that nearly all secreted
bacterial proteins, and those proteins from other unicellular
hosts, are synthesized as pre-proteins that contain N-terminal
sequences known as signal peptides. These signal peptides influence
the final destination of the protein and the mechanisms by which
they are transported. Most signal peptides can be placed into one
of four groups based on their translocation mechanism (e.g., Sec-
or Tat-mediated) and the type of signal peptidase used to cleave
the signal peptide from the preprotein. Also provided are
N-terminal signal peptides containing a lipoprotein signal peptide.
Although proteins carrying this type of signal are transported via
the Sec translocase, their peptide signals tend to be shorter than
normal Sec-signals and they contain a distinct sequence motif in
the C-domain known as the lipo box (L(AS)(GA)C) at the -3 to +1
position. The cysteine at the +1 position is lipid modified
following translocation whereupon the signal sequence is cleaved by
a type 11 signal peptidase. Also provided are type IV or prepilin
signal peptides, wherein type IV peptidase cleavage domains are
localized between the N- and H-domain rather than in the C-domain
common in other signal peptides.
[0482] As provided herein, the signal peptides can be attached to a
heterologous polypeptide sequence (i.e., different than the protein
the signal peptide is derived or obtained from) containing a
nutritive polypeptide, in order to generate a recombinant nutritive
polypeptide sequence. Alternatively, if a nutritive polypeptide is
naturally secreted in the host organism, it can be sufficient to
use the native signal sequence or a variety of signal sequences
that directs secretion. In some embodiments of the nutritive
polypeptides, the heterologous nutritive polypeptide sequence
attached to the carboxyl terminus of the signal peptide is an
edible species eukaryotic protein, a mutein or derivative thereof,
or a polypeptide nutritional domain. In other embodiments of the
polypeptide, the heterologous nutritive polypeptide sequence
attached to the carboxyl terminus of the signal peptide is an
edible species intracellular protein, a mutein or derivative
thereof, or a polypeptide nutritional domain.
[0483] Purification of Nutritive Polypeptides.
[0484] Also provided are methods for recovering the secreted
nutritive polypeptide from the culture medium. In some embodiments
the secreted nutritive polypeptide is recovered from the culture
medium during the exponential growth phase or after the exponential
growth phase (e.g., in pre-stationary phase or stationary phase).
In some embodiments the secreted nutritive polypeptide is recovered
from the culture medium during the stationary phase. In some
embodiments the secreted nutritive polypeptide is recovered from
the culture medium at a first time point, the culture is continued
under conditions sufficient for production and secretion of the
recombinant nutritive polypeptide by the microorganism, and the
recombinant nutritive polypeptide is recovered from the culture
medium at a second time point. In some embodiments the secreted
nutritive polypeptide is recovered from the culture medium by a
continuous process. In some embodiments the secreted nutritive
polypeptide is recovered from the culture medium by a batch
process. In some embodiments the secreted nutritive polypeptide is
recovered from the culture medium by a semi-continuous process. In
some embodiments the secreted nutritive polypeptide is recovered
from the culture medium by a fed-batch process. Those skilled in
the art are aware of many suitable methods available for culturing
recombinant cells to produce (and optionally secrete) a recombinant
nutritive polypeptide as disclosed herein, as well as for
purification and/or isolation of expressed recombinant
polypeptides. The methods chosen for polypeptide purification
depend on many variables, including the properties of the
polypeptide of interest. Various methods of purification are known
in the art including diafilitration, precipitation, and
chromatography.
[0485] Non-Secreted
[0486] In some aspects, proteins can be isolated in the absence of
secretion. For example, a cell having the protein (e.g., on the
cell surface or intracellularly) can be lysed and the protein can
be purified using standard methods such as chromatography or
antibody-based isolation of the protein from the lysate. In some
aspects, a cell surface expressed protein can be enzymatically
cleaved from the surface.
[0487] Isolation of Nutritive Polypeptides from Biological
Materials from Edible Species
[0488] In some embodiments a nutritive polypeptide having a desired
amino acid or plurality of amino acids, which are optionally
present in a desired amino acid sequence, is isolated or purified
from a food source, or from a biological material from an edible
species. For example, a biological material of a plant includes
nuts, seeds, leaves, and roots: a biological material of a mammal
includes milk, muscle, sera, and liver. Isolation methods include
solubilization, chromatography, and precipitation.
[0489] Nutritive polypeptides are isolated from biological
materials by specific solubilization of the targeted nutritive
polypeptide. The biological material is suspended and homogenized
in a solubilization solution. The solubilization solution is
selected based on the nutritive polypeptides physiochemical
properties. Composition of the solubilization solution is a mixture
of water, detergent, salt, pH, chaotrope, cosmotrope, and/or
organic solvent. As an example, proteins high in proline are known
to be soluble in ethanol solutions (Dickey, L. C., et al.
Industrial Crops and Products 10.2 (1999): 137-143.). A nutritive
polypeptide with high proline content is selected and isolated by
suspending the biological material in ethanol at a ratio (w/w) of
liquid to biological material of 1:1, 2:1, 3:1, 4:1 or other ratio
recognized in the art. The suspension is blended and insoluble
material is removed by centrifugation. The ethanol soluble
nutritive polypeptide is purified solubly in the ethanol
fraction.
[0490] Nutritive polypeptides are isolated from biological
materials by precipitation of the targeted nutritive polypeptide or
precipitation of other proteins. Precipitating agents include salt,
pH, heat, flocculants, chaotropes, cosmotropes, and organic
solvents. The mode of precipitation is selected for a given
nutritive polypeptide based on the proteins physiochemical
properties. As an example, a nutritive polypeptide is selected to
be thermal stable at pH 7 by low solvation score and low
aggregation score as described herein. To purify this protein the
biological material is suspended in a neutral pH aqueous solution
and homogenized. Insoluble material is removed from solution by
centrifugation. To purify the nutritive polypeptide from other
proteins, the supernatant is heated to 90 degrees C. for 10
minutes. Insoluble material is removed by centrifugation. Small
molecules are removed from the supernatant by dialyzing using a 3
kDa membrane, resulting in pure nutritive polypeptide.
[0491] Nutritive polypeptides are isolated from biological
materials by various chromatographic methods. The mode of
chromatography selected for use depends on the physicochemical
properties of the target nutritive polypeptide. Charged nutritive
polypeptides bind to ion exchange chromatography resin through
electrostatic interactions. Hydrophobic nutritive polypeptides bind
to hydrophobic interaction chromatography resin through hydrophobic
association. Mixed-mode chromatography can be used for a variety of
nutritive polypeptides, and can act through a variety of
interactions. Metal affinity chromatography can be used for
nutritive polypeptides that bind to metal ions. As an example, a
nutritive polypeptide is selected to have a high charge per amino
acid at pH 4 so that it binds tightly to a cation-exchange resin.
The biological material is added to a low ionic strength pH 4
aqueous solution and homogenized. Insoluble material is removed by
centrifugation. The soluble material is added to a cation exchange
resin, such as POROS.RTM. XS Strong Cation Exchange Resin from Life
Technologies, and washed with a low ionic strength pH4 solution.
The nutritive polypeptide is eluted from the resin by adding high
ionic strength (eg. 500 mM NaCl) pH 4 solution, resulting in
purified nutritive polypeptide.
[0492] Synthetic Nutritive Polypeptide Amino Acid Compositions
[0493] In some embodiments compositions of this disclosure contain
a plurality of free amino acids that represents the molar ratio of
the plurality of amino acids present in a selected nutritive
polypeptide., herein termed a "nutritive polypeptide blend". The
compositions in certain embodiments include both free amino acids
and nutritive polypeptides. As used herein in these embodiments,
disclosure of a nutritive polypeptide and compositions and
formulations containing the nutritive polypeptide includes
disclosure of a nutritive polypeptide blend and compositions and
formulations containing the nutritive polypeptide blend, as well as
a composition in which a first amount of amino acids are present in
the form of a nutritive polypeptide and a second amount of amino
acids are present in free amino acid form.
[0494] Synthetic Methods of Production
[0495] In some embodiments proteins of this disclosure are
synthesized chemically without the use of a recombinant production
system. Protein synthesis can be carried out in a liquid-phase
system or in a solid-phase system using techniques known in the art
(see, e.g., Atherton, E., Sheppard. R. C. (1989). Solid Phase
peptide synthesis: a practical approach. Oxford. England: IRL
Press; Stewart, J. M., Young. J. D. (1984). Solid phase peptide
synthesis (2nd ed.). Rockford: Pierce Chemical Company.
[0496] Peptide chemistry and synthetic methods are well known in
the art and a protein of this disclosure can be made using any
method known in the art. A non-limiting example of such a method is
the synthesis of a resin-bound peptide (including methods for
deprotection of amino acids, methods for cleaving the peptide from
the resin, and for its purification).
[0497] For example, Fmoc-protected amino acid derivatives that can
be used to synthesize the peptides are the standard recommended:
Fmoc-Ala-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Asn(Trt)-OH, Fmoc-Asp(OtBu)-OH,
Fmoc-Cys(Trt)-OH, Fmoc-Gln(Trt)-OH. Fmoc-Glu(OtBu)-OH, Fmoc-Gly-OH,
Fmoc-His(Trt)-OH, Fmoc-Ile-OH, Fmoc-Leu-OH, Fmoc-Lys(BOC)-OH,
Fmoc-Met-OH, Fmoc-Phe-OH, Fmoc-Pro-OH, Fmoc-Ser(tBu)-OH,
Fmoc-Thr(tBu)-OH, Fmoc-Trp(BOC)-OH, Fmoc-Tyr(tBu)-OH and
Fmoc-Val-OH (supplied from, e.g., Anaspec, Bachem. Iris Biotech, or
NovabioChem). Resin bound peptide synthesis is performed, for
example, using Fmoc based chemistry on a Prelude Solid Phase
Peptide Synthesizer from Protein Technologies (Tucson, Ariz. 85714
U.S.A.). A suitable resin for the preparation of C-terminal
carboxylic acids is a pre-loaded, low-load Wang resin available
from NovabioChem (e.g. low load fmoc-Thr(tBu)-Wang resin, LL, 0.27
mmol/g). A suitable resin for the synthesis of peptides with a
C-terminal amide is PAL-ChemMatrix resin available from
Matrix-Innovation. The N-terminal alpha amino group is protected
with Boc.
[0498] Fmoc-deprotection can be achieved with 20% piperidine in NMP
for 2.times.3 min. The coupling chemistry is DIC/HOAt/collidine in
NMP. Amino acid/HOAt solutions (0.3 M/0.3 M in NMP at a molar
excess of 3-10 fold) are added to the resin followed by the same
molar equivalent of DIC (3 M in NMP) followed by collidine (3 M in
NMP). For example, the following amounts of 0.3 M amino acid/HOAt
solution are used per coupling for the following scale reactions:
Scale/ml, 0.05 mmol/1.5 mL, 0.10 mmol/3.0 mL, 0.25 mmol/7.5 mL.
Coupling time is either 2.times.30 min or 1.times.240 min. After
synthesis the resin is washed with DCM, and the peptide is cleaved
from the resin by a 2-3 hour treatment with TFA/TIS/water
(95/2.5/2.5) followed by precipitation with diethylether. The
precipitate is washed with diethylether. The crude peptide is
dissolved in a suitable mixture of water and MeCN such as
water/MeCN (4:1) and purified by reversed-phase preparative HPLC
(Waters Deltaprep 4000 or Gilson) on a column containing C18-silica
gel. Elution is performed with an increasing gradient of MeCN in
water containing 0.1% TFA. Relevant fractions are checked by
analytical HPLC or UPLC. Fractions containing the pure target
peptide are mixed and concentrated under reduced pressure. The
resulting solution is analyzed (HPLC, LCMS) and the product is
quantified using a chemiluminescent nitrogen specific HPLC detector
(Antek 8060 HPLC-CLND) or by measuring UV-absorption at 280 nm. The
product is dispensed into glass vials. The vials are capped with
Millipore glassfibre prefilters. Freeze-drying affords the peptide
trifluoroacetate as a white solid. The resulting peptides can be
detected and characterized using LCMS and/or UPLC, for example,
using standard methods known in the art. LCMS can be performed on a
setup consisting of Waters Acquity UPLC system and LCT Premier XE
mass spectrometer from Micromass. The UPLC pump is connected to two
eluent reservoirs containing: A) 0.1% Formic acid in water; and B)
0.1% Formic acid in acetonitrile. The analysis is performed at RT
by injecting an appropriate volume of the sample (preferably 2-10
.mu.l) onto the column which is eluted with a gradient of A and B.
The UPLC conditions, detector settings and mass spectrometer
settings are: Column: Waters Acquity UPLC BEH, C-18, 1.7 .mu.m, 2.1
mm.times.50 mm. Gradient: Linear 5%-95% acetonitrile during 4.0 min
(alternatively 8.0 min) at 0.4 ml/min. Detection: 214 nm (analogue
output from TUV (Tunable UV detector)). MS ionisation mode: API-ES
Scan: 100-2000 amu (alternatively 500-2000 amu), step 0.1 amu. UPLC
methods are well known. Non-limiting examples of methods that can
be used are described at pages 16-17 of US 2013/0053310 A1,
published Feb. 28, 2013, for example.
[0499] Inactivating Enzyme Activity
[0500] In some aspects, a protein is an enzyme or has enzymatic
activity. In some aspects, it can be desirable to inactivate or
reduce the enzymatic activity of the enzyme. Various methods are
known in the art for enzyme inactivation including application of
heat, application of one or more detergents, application of one or
more metal chelators, reduction, oxidation, application of one or
more chaotropes, covalent modification, alternating post
translational modifications, e.g., via enzymatic or chemical
alteration, altering pH (acidic and basic), or altering the salt
concentration. For example, heat inactivation is typically
performed at a certain temperature for a certain amount of time,
e.g., most endonucleases are inactivated by incubation at
65.degree. C. for 20 minutes. In some aspects, enzymes can be
mutated to eliminate or reduce enzymatic activity. e.g., by causing
the enzyme to misfold. In addition, high pressure carbon dioxide
(HPCD) has been demonstrated to an effective non-thermal processing
technique for inactivating enzymes. See Hu et al., Enzyme
Inactivation in Food Processing using High Pressure Carbon Dioxide
Technology; Critical Review in Food Science and Nutrition; Volume
52, Issue 2, 2013. Various other forms of enzyme inactivation are
known in the art, the parameters of which can be adjusted as needed
to alter enzyme activity accordingly. Various methods for enzyme
inactivation and excipients such as oxidation. e.g., bleach,
H.sub.2O.sub.2, and ethylene oxide; to reduce disulphides, e.g.,
DTT, BME, and TCEP: high pH using Na.sub.2CO.sub.3, Tris Base, or
Na.sub.2HPO.sub.4; low pH using Citric Acid. Boric Acid, Acetic
Acid, or Tris HCl; Heat using temperatures 30.degree.
C.-100.degree. C. over a period of time; protein unfolding with
chaotropes such as Thiocyanate, Urea, Guanidine HCl, or CaCl.sub.2;
protein unfold with surfactants (e.g., detergents) such as MPD,
Triton (non-ionic), CHAPS (zwitterionic), or Tween (non-ionic), or
to chelate metals with EDTA or Citrate.
[0501] Cell Proliferation Assays
[0502] Cell proliferation assays can be used to measure the
relative importance of a protein or portion thereof to the
proliferative process. In some aspects, cell proliferation can be
measured under starvation conditions in the presence or absence of
a protein or interest. For example, cells can be starved over a
period of time (e.g., 48 hours) with a medium having or lacking
each, respective protein of interest in a tissue culture incubator.
After the incubation, a detection agent such as AlamarBlue can be
added and fluorescence measured as an output for proliferation. In
some aspects, cell proliferation can be measured as part of a dose
response to a protein of interest. For example, cells can be
starved in medium having or lacking each, respective protein of
interest in a tissue culture incubator. After starvation, the cells
can then be treated with varying concentrations of the protein
(e.g., 0, 20, 100, or 1000 .mu.M) that was lacking in the initial
culture in the same, source medium lacking the respective protein.
The cells can then be incubated again in a for tissue culture
incubator. After the incubation a detection agent such as
AlamarBlue can be added and fluorescence read.
[0503] Allergenicity Assays
[0504] For some embodiments it is preferred that the protein not
exhibit inappropriately high allergenicity. Accordingly, in some
embodiments the potential allergenicy of the protein is assessed.
This can be done by any suitable method known in the art. In some
embodiments an allergenicity score is calculated. The allergenicity
score is a primary sequence based metric based on WHO
recommendations (fao.org/ag/agn/food/pd/allergygm.pdf) for
assessing how similar a protein is to any known allergen, the
primary prediction being that high percent identity between a
target and a known allergen is likely indicative of cross
reactivity. For a given protein, the likelihood of eliciting an
allergic response can be assessed via one or both of a
complimentary pair of sequence homology based tests. The first test
determines the protein's percent identity across the entire
sequence via a global-global sequence alignment to a database of
known allergens using the FASTA algorithm with the BLOSUM50
substitution matrix, a gap open penalty of 10, and a gap extension
penalty of 2. It has been suggested that proteins with less than
50% global homology are unlikely to be allergenic (Goodman R. E. et
al. Allergenicity assessment of genetically modified crops-what
makes sense? Nat. Biotech. 26, 73-81 (2008); Aalberse R. C.
Structural biology of allergens. J. Allergy Clin. Immunol. 106,
228-238 (2000)).
[0505] In some embodiments of a protein, the protein has less than
50% global homology to any known allergen in the database used for
the analysis. In some embodiments a cutoff of less than 40%
homology is used. In some embodiments a cutoff of less than 30%
homology is used. In some embodiments a cutoff of less than 20%
homology is used. In some embodiments a cutoff of less than 10%
homology is used. In some embodiments a cutoff of from 40% to 50%
is used. In some embodiments a cutoff of from 30% to 50% is used.
In some embodiments a cutoff of from 20% to 50% is used. In some
embodiments a cutoff of from 10% to 50% is used. In some
embodiments a cutoff of from 5% to 50% is used. In some embodiments
a cutoff of from 0% to 50% is used. In some embodiments a cutoff of
greater than 50% global homology to any known allergen in the
database used for the analysis is used. In some embodiments a
cutoff of from 50% to 60% is used. In some embodiments a cutoff of
from 50% to 70% is used. In some embodiments a cutoff of from 50%
to 80% is used. In some embodiments a cutoff of from 50% to 90% is
used. In some embodiments a cutoff of from 55% to 60% is used. In
some embodiments a cutoff of from 65% to 70% is used. In some
embodiments a cutoff of from 70% to 75% is used. In some
embodiments a cutoff of from 75% to 80% is used.
[0506] The second test assesses the local allergenicity along the
protein sequence by determining the local allergenicity of all
possible contiguous 80 amino acid fragments via a global-local
sequence alignment of each fragment to a database of known
allergens using the FASTA algorithm with the BLOSUM50 substitution
matrix, a gap open penalty of 10, and a gap extension penalty of 2.
The highest percent identity of any 80 amino acid window with any
allergen is taken as the final score for the protein of interest.
The WHO guidelines suggest using a 35% identity cutoff with this
fragment test. In some embodiments of a protein, all possible
fragments of the protein have less than 35% local homology to any
known allergen in the database used for the analysis using this
test. In some embodiments a cutoff of less than 30% homology is
used. In some embodiments a cutoff of from 30% to 35% homology is
used. In some embodiments a cutoff of from 25% to 30% homology is
used. In some embodiments a cutoff of from 20% to 25% homology is
used. In some embodiments a cutoff of from 15% to 20% homology is
used. In some embodiments a cutoff of from 10% to 15% homology is
used. In some embodiments a cutoff of from 5% to 10% homology is
used. In some embodiments a cutoff of from 0% to 5% homology is
used. In some embodiments a cutoff of greater than 35% homology is
used. In some embodiments a cutoff of from 35% to 40% homology is
used. In some embodiments a cutoff of from 40% to 45% homology is
used. In some embodiments a cutoff of from 45% to 50% homology is
used. In some embodiments a cutoff of from 50% to 55% homology is
used. In some embodiments a cutoff of from 55% to 60% homology is
used. In some embodiments a cutoff of from 65% to 70% homology is
used. In some embodiments a cutoff of from 70% to 75% homology is
used. In some embodiments a cutoff of from 75% to 80% homology is
used.
[0507] Skilled artisans are able to identify and use a suitable
database of known allergens for this purpose. In some embodiments
the database is custom made by selecting proteins from more than
one database source. In some embodiments the custom database
comprises pooled allergen lists collected by the Food Allergy
Research and Resource Program (allergenonline.org/), UNIPROT
annotations (uniprot.org/docs/allergen), and the Structural
Database of Allergenic Proteins (SDAP,
fermi.utmb.edu/SDAP/sdap_lnk.html). This database includes all
currently recognized allergens by the International Union of
Immunological Societies (IUIS, allergen.org/) as well as a large
number of additional allergens not yet officially named. In some
embodiments the database comprises a subset of known allergen
proteins available in known databases; that is, the database is a
custom selected subset of known allergen proteins. In some
embodiments the database of known allergens comprises at least 10
proteins, at least 20 proteins, at least 30 proteins, at least 40
proteins, at least 50 proteins, at least 100, proteins, at least
200 proteins, at least 300 proteins, at least 400 proteins, at
least 500 proteins, at least 600 proteins, at least 700 proteins,
at least 800 proteins, at least 900 proteins, at least 1,000
proteins, at least 1,100 proteins, at least 1,200 proteins, at
least 1,300 proteins, at least 1,400 proteins, at least 1,500
proteins, at least 1,600 proteins, at least 1,700 proteins, at
least 1,800 proteins, at least 1,900 proteins, or at least 2.000
proteins. In some embodiments the database of known allergens
comprises from 100 to 500 proteins, from 200 to 1,000 proteins,
from 500 to 1,000 proteins, from 500 to 1,000 proteins, or from
1,000 to 2,000 proteins.
[0508] In some embodiments all (or a selected subset) of contiguous
amino acid windows of different lengths (e.g., 70, 60, 50, 40, 30,
20, 10, 8 or 6 amino acid windows) of a protein are tested against
the allergen database and peptide sequences that have 100%
identity, 95% or higher identity, 90% or higher identity, 85% or
higher identity, 80% or higher identity, 75% or higher identity,
70% or higher identity, 65% or higher identity, 60% or higher
identity, 55% or higher identity, or 50% or higher identity matches
are identified for further examination of potential
allergenicity.
[0509] Another method of predicting the allergenicity of a protein
is to assess the homology of the protein to a protein of human
origin. The human immune system is exposed to a multitude of
possible allergenic proteins on a regular basis and has the
intrinsic ability to differentiate between the host body's proteins
and exogenous proteins. The exact nature of this ability is not
always clear, and there are many diseases that arise as a result of
the failure of the body to differentiate self from non-self (e.g.,
arthritis). Nonetheless, the fundamental analysis is that proteins
that share a degree of sequence homology to human proteins are less
likely to elicit an immune response. In particular, it has been
shown that for some protein families with known allergenic members
(tropomyosins, parvalbumins, caseins), those proteins that bear
more sequence homology to their human counterparts relative to
known allergenic proteins, are not thought to be allergenic
(Jenkins J. A. et al. Evolutionary distance from human homologs
reflects allergenicity of animal food proteins. J. Allergy Clin
Immunol. 120 (2007): 1399-1405). For a given protein, a human
homology score is measured by determining the maximum percent
identity of the protein to a database of human proteins (e.g., the
UNIPROT database) from a global-local alignment using the FASTA
algorithm with the BLOSUM50 substitution matrix, a gap open penalty
of 10, and a gap extension penalty of 2. According to Jenkins et
al. (Jenkins J. A. et al. Evolutionary distance from human homologs
reflects allergenicity of animal food proteins J. Allergy Clin
Immunol. 120 (2007): 1399-1405) proteins with a sequence identity
to a human protein above about 62% are less likely to be
allergenic. Skilled artisans are able to identify and use a
suitable database of known human proteins for this purpose, for
example, by searching the UNIPROT database (uniprot.org). In some
embodiments the database is custom made by selecting proteins from
more than one database source. Of course the database may but need
not be comprehensive. In some embodiments the database comprises a
subset of human proteins: that is, the database is a custom
selected subset of human proteins. In some embodiments the database
of human proteins comprises at least 10 proteins, at least 20
proteins, at least 30 proteins, at least 40 proteins, at least 50
proteins, at least 100, proteins, at least 200 proteins, at least
300 proteins, at least 400 proteins, at least 500 proteins, at
least 600 proteins, at least 700 proteins, at least 800 proteins,
at least 900 proteins, at least 1,000 proteins, at least 2,000
proteins, at least 3,000 proteins, at least 4.000 proteins, at
least 5,000 proteins, at least 6,000 proteins, at least 7,000
proteins, at least 8,000 proteins, at least 9,000 proteins, or at
least 10,000 proteins. In some embodiments the database comprises
from 100 to 500 proteins, from 200 to 1,000 proteins, from 500 to
1,000 proteins, from 500 to 1,000 proteins, from 1,000 to 2.000
proteins, from 1,000 to 5,000 proteins, or from 5.000 to 10.000
proteins. In some embodiments the database comprises at least 90%,
at least 95%, or at least 99% of all known human proteins.
[0510] In some embodiments of a protein, the protein is at least
20% homologous to a human protein. In some embodiments a cutoff of
at least 30% homology is used. In some embodiments a cutoff of at
least 40% homology is used. In some embodiments a cutoff of at
least 50% homology is used. In some embodiments a cutoff of at
least 60% homology is used. In some embodiments a cutoff of at
least 70% homology is used. In some embodiments a cutoff of at
least 80% homology is used. In some embodiments a cutoff of at
least 62% homology is used. In some embodiments a cutoff of from at
least 20% homology to at least 30% homology is used. In some
embodiments a cutoff of from at least 30% homology to at least 40%
homology is used. In some embodiments a cutoff of from at least 50%
homology to at least 60% homology is used. In some embodiments a
cutoff of from at least 60% homology to at least 70% homology is
used. In some embodiments a cutoff of from at least 70% homology to
at least 80% homology is used.
[0511] Thermostability Assays
[0512] As used herein, a "stable" protein is one that resists
changes (e.g., unfolding, oxidation, aggregation, hydrolysis, etc.)
that alter the biophysical (e.g., solubility), biological (e.g.,
digestibility), or compositional (e.g. proportion of Leucine amino
acids) traits of the protein of interest.
[0513] Protein stability can be measured using various assays known
in the art and proteins disclosed herein and having stability above
a threshold can be selected. In some embodiments a protein is
selected that displays thermal stability that is comparable to or
better than that of whey protein. Thermal stability is a property
that can help predict the shelf life of a protein. In some
embodiments of the assay stability of protein samples is determined
by monitoring aggregation formation using size exclusion
chromatography (SEC) after exposure to extreme temperatures.
Aqueous samples of the protein to be tested are placed in a heating
block at 90.degree. C. and samples are taken after 0, 1, 5, 10, 30
and 60 min for SEC analysis. Protein is detected by monitoring
absorbance at 214 nm, and aggregates are characterized as peaks
eluting faster than the protein of interest. No overall change in
peak area indicates no precipitation of protein during the heat
treatment. Whey protein has been shown to rapidly form .about.80%
aggregates when exposed to 90.degree. C. in such an assay.
[0514] In some embodiments the thermal stability of a protein is
determined by heating a sample slowly from 25.degree. C. to
95.degree. C. in presence of a hydrophobic dye (e.g.,
ProteoStat.RTM. Thermal shift stability assay kit, Enzo Life
Sciences) that binds to aggregated proteins that are formed as the
protein denatures with increasing temperature (Niesen, F. H.,
Berglund, H. & Vadadi, M., 2007. The use of differential
scanning fluorimetry to detect ligand interactions that promote
protein stability. Nature Protocols, Volume 2, pp. 2212-2221). Upon
binding, the dye's fluorescence increases significantly, which is
recorded by an rtPCR instrument and represented as the protein's
melting curve (Lavinder. J. J., Hari, S. B., Suillivan, B. J. &
Magilery, T. J., 2009. High-Throughput Thermal Scanning: A General,
Rapid Dye-Binding Thermal Shift Screen for Protein Engineering.
Journal of the American Chemical Society, pp. 3794-3795). After the
thermal shift is complete, samples are examined for insoluble
precipitates and further analyzed by analytical size exclusion
chromatography (SEC).
[0515] Solubility Assays
[0516] In some embodiments of the proteins disclosed herein the
protein is soluble. Solubility can be measured by any method known
in the art. In some embodiments solubility is examined by
centrifuge concentration followed by protein concentration assays.
Samples of proteins in 20 mM HEPES pH 7.5 are tested for protein
concentration according to protocols using two methods, Coomassie
Plus (Bradford) Protein Assay (Thermo Scientific) and Bicinchoninic
Acid (BCA) Protein Assay (SigmadAldrich). Based on these
measurements 10 mg of protein is added to an Amicon Ultra 3 kDa
centrifugal filter (Millipore). Samples are concentrated by
centrifugation at 10,000.times.g for 30 minutes. The final, now
concentrated, samples are examined for precipitated protein and
then tested for protein concentration as above using two methods,
Bradford and BCA.
[0517] In some embodiments the proteins have a final solubility
limit of at least 5 g/L, 10 g/L, 20 g/L, 30 g/L, 40 g/L, 50 g/L, or
100 g/L at physiological pH. In some embodiments the proteins are
greater than 50%, greater than 60%, greater than 70%, greater than
80%, greater than 90%, greater than 95%, greater than 96%, greater
than 97%, greater than 98%, greater than 99%, or greater than 99.5%
soluble with no precipitated protein observed at a concentration of
greater than 5 g/L, or 10 g/L, or 20 g/L, or 30 g/L, or 40 g/L, or
50 g/L, or 100 g/L at physiological pH. In some embodiments, the
solubility of the protein is higher than those typically reported
in studies examining the solubility limits of whey (12.5 g/L;
Pelegrine et al., Lebensm.-Wiss. U.-Technol. 38 (2005) 77-80) and
soy (10 g/L; Lee et al., JAOCS 80(1) (2003) 85-90).
[0518] Eukaryotic proteins are often glycosylated, and the
carbohydrate chains that are attached to proteins serve various
functions. N-linked and O-linked glycosylation are the two most
common forms of glycosylation occurring in proteins. N-linked
glycosylation is the attachment of a sugar molecule to a nitrogen
atom in an amino acid residue in a protein. N-linked glycosylation
occurs at Asparagine and Arginine residues. O-linked glycosylation
is the attachment of a sugar molecule to an oxygen atom in an amino
acid residue in a protein. O-linked glycosylation occurs at
Threonine and Serine residues.
[0519] Glycosylated proteins are often more soluble than their
un-glycosylated forms. In terms of protein drugs, proper
glycosylation usually confers high activity, proper antigen
binding, better stability in the blood, etc. However, glycosylation
necessarily means that a protein "carries with it" sugar moieties.
Such sugar moieties may reduce the usefulness of the proteins of
this disclosure including recombinant proteins. For example, as
demonstrated in the examples, a comparison of digestion of
glycosylated and non-glycosylated forms of the same proteins shows
that the non-glycosylated forms are digested more quickly than the
glycosylated forms. For these reasons, in some embodiments the
nutritive proteins according to the disclosure comprise low or no
glycosylation. For example, in some embodiments the proteins
comprise a ratio of non-glycosidated to total amino acid residues
of at least 80%, at least 85%, at least 90%, at least 95%, at least
96%, at least 97%, at least 98%, or at least 99%. In some
embodiments the proteins to not comprise any glycosylation.
[0520] In some embodiments, the protein according to the disclosure
is deglycosylated after it is produced or after it is isolated.
Proteins of low or no glycosylation can be made by any method known
in the art. For example, enzymatic and/or chemical methods can be
used (Biochem. J. (2003) 376, p339-350.). Enzymes are produced
commercially at research scales for the removal of N-linked and
O-linked oligosaccharides. Chemical methods include use of
trifluoromethanesulfonic acid to selectively break N-linked and
O-linked peptide-saccharide bonds. This method often results in a
more complete deglycosylation than does the use of enzymatic
methods.
[0521] In other embodiments, the protein according to the
disclosure is produced with low or no glycosylation by a host
organism. Most bacteria and other prokaryotes have very limited
capabilities to glycosylate proteins, especially heterologous
proteins. Accordingly, in some embodiments of this disclosure a
protein is made recombinantly in a microorganism such that the
level of glycosylation of the recombinant protein is low or no
glycosylation. In some embodiments the level of glycosylation of
the recombinant protein is lower than the level of glycosylation of
the protein as it occurs in the organism from which it is derived.
Glycosylation of a protein can vary based on the host organism, in
other words some hosts will produce more glycosylation relative to
one or more other hosts; while other hosts will produce less g
glycosylation relative to one or more other hosts. Differences in
the amount of glycosylation can be measured based upon, e.g., the
mass of glycosylation present and/or the total number of
glycosylation sites present.
[0522] Toxicity and Anti-Nutricity Assays
[0523] For most embodiments it is preferred that the protein not
exhibit inappropriately high toxicity. Accordingly, in some
embodiments the potential toxicity of the protein is assessed. This
can be done by any suitable method known in the art. In some
embodiments a toxicity score is calculated by determining the
protein's percent identity to databases of known toxic proteins
(e.g., toxic proteins identified from the UNIPROT database). A
global-global alignment of the protein of interest against the
database of known toxins is performed using the FASTA algorithm
with the BLOSUM50 substitution matrix, a gap open penalty of 10,
and a gap extension penalty of 2. In some embodiments of a protein,
the protein is less than 35% homologous to a known toxin. In some
embodiments a cutoff of less than 35% homology is used. In some
embodiments a cutoff of from 30% to 35% homology is used. In some
embodiments a cutoff of from 25% to 35% homology is used. In some
embodiments a cutoff of from 20% to 35% homology is used. In some
embodiments a cutoff of from 15% to 35% homology is used. In some
embodiments a cutoff of from 10% to 35% homology is used. In some
embodiments a cutoff of from 5% to 35% homology is used. In some
embodiments a cutoff of from 0% to 35% homology is used. In some
embodiments a cutoff of grater than 35% homology is used. In some
embodiments a cutoff of from 35% to 40% homology is used. In some
embodiments a cutoff of from 35% to 45% homology is used. In some
embodiments a cutoff of from 35% to 50% homology is used. In some
embodiments a cutoff of from 35% to 55% homology is used. In some
embodiments a cutoff of from 35% to 60% homology is used. In some
embodiments a cutoff of from 35% to 70% homology is used. In some
embodiments a cutoff of from 35% to 75% homology is used. In some
embodiments a cutoff of from 35% to 80% homology is used. Skilled
artisans are able to identify and use a suitable database of known
toxins for this purpose, for example, by searching the UNIPROT
database (uniprot.org). In some embodiments the database is custom
made by selecting proteins identified as toxins from more than one
database source. In some embodiments the database comprises a
subset of known toxic proteins; that is, the database is a custom
selected subset of known toxic proteins. In some embodiments the
database of toxic proteins comprises at least 10 proteins, at least
20 proteins, at least 30 proteins, at least 40 proteins, at least
50 proteins, at least 100, proteins, at least 200 proteins, at
least 300 proteins, at least 400 proteins, at least 500 proteins,
at least 600 proteins, at least 700 proteins, at least 800
proteins, at least 900 proteins, at least 1,000 proteins, at least
2.000 proteins, at least 3,000 proteins, at least 4,000 proteins,
at least 5,000 proteins, at least 6,000 proteins, at least 7,000
proteins, at least 8,000 proteins, at least 9,000 proteins, or at
least 10,000 proteins. In some embodiments the database comprises
from 100 to 500 proteins, from 200 to 1,000 proteins, from 500 to
1,000 proteins, from 500 to 1,000 proteins, from 1,000 to 2,000
proteins, from 1,000 to 5,000 proteins, or from 5,000 to 10,000
proteins.
[0524] Anti-Nutricity and Anti-Nutrients
[0525] For some embodiments it is preferred that the protein not
exhibit anti-nutritional activity ("anti-nutricity"), i.e.,
proteins that have the potential to prevent the absorption of
nutrients from food. Examples of anti-nutritive sequences causing
such anti-nutricity include protease inhibitors, which inhibit the
actions of trypsin, pepsin and other proteases in the gut,
preventing the digestion and subsequent absorption of protein.
[0526] Disclosed herein are formulations containing isolated
nutritive polypeptides that are substantially free of
anti-nutritive sequences. In some embodiments the nutritive
polypeptide has an anti-nutritive similarity score below about 1,
below about 0.5, or below about 0.1. The nutritive polypeptide is
present in the formulation in an amount greater than about 10 g,
and the formulation is substantially free of anti-nutritive
factors. The formulation is present as a liquid, semi-liquid or gel
in a volume not greater than about 500 ml or as a solid or
semi-solid in a mass not greater than about 200 g. The nutritive
polypeptide may have low homology with a protease inhibitor, such
as a member of the serpin family of polypeptides, e.g., it is less
than 90%, identical, or is less than 85%, 80%, 75%, 70%, 65%, 60%,
55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or less than
5% identical.
[0527] Accordingly, in some embodiments the potential
anti-nutricity of the protein is assessed. This can be done by any
suitable method known in the art. In some embodiments an
anti-nutricity score is calculated by determining the protein's
percent identity to databases of known protease inhibitors (e.g.,
protease inhibitors identified from the UNIPROT database). A
global-global alignment of the protein of interest against the
database of known protease inhibitors is performed using the FASTA
algorithm with the BLOSUM50 substitution matrix, a gap open penalty
of 10, and a gap extension penalty of 2, to identify whether the
protein is homologous to a known anti-protein. In some embodiments
of a protein, the protein has less than 35% global homology to any
known anti-protein (e.g., any known protease inhibitor) in the
database used for the analysis. In some embodiments a cutoff of
less than 35% identify is used. In some embodiments a cutoff of
from 30% to 35% is used. In some embodiments a cutoff of from 25%
to 35% is used. In some embodiments a cutoff of from 20% to 35% is
used. In some embodiments a cutoff of from 15% to 35% is used. In
some embodiments a cutoff of from 10% to 35% is used. In some
embodiments a cutoff of from 5% to 35% is used. In some embodiments
a cutoff of from 0% to 35% is used. In some embodiments a cutoff of
greater than 35% identify is used. In some embodiments a cutoff of
from 35% to 40% is used. In some embodiments a cutoff of from 35%
to 45% is used. In some embodiments a cutoff of from 35% to 50% is
used. In some embodiments a cutoff of from 35% to 55% is used. In
some embodiments a cutoff of from 35% to 60% is used. In some
embodiments a cutoff of from 35% to 70% is used. In some
embodiments a cutoff of from 35% to 75% is used. In some
embodiments a cutoff of from 35% to 80% is used. Skilled artisans
are able to identify and use a suitable database of known protease
inhibitors for this purpose, for example, by searching the UNIPROT
database (uniprot.org). In some embodiments the database is custom
made by selecting proteins identified protease-inhibitors as from
more than one database source. In some embodiments the database
comprises a subset of known protease inhibitors available in
databases; that is, the database is a custom selected subset of
known protease inhibitor proteins. In some embodiments the database
of known protease inhibitor proteins comprises at least 10
proteins, at least 20 proteins, at least 30 proteins, at least 40
proteins, at least 50 proteins, at least 100, proteins, at least
200 proteins, at least 300 proteins, at least 400 proteins, at
least 500 proteins, at least 600 proteins, at least 700 proteins,
at least 800 proteins, at least 900 proteins, at least 1,000
proteins, at least 1,100 proteins, at least 1,200 proteins, at
least 1,300 proteins, at least 1,400 proteins, at least 1,500
proteins, at least 1.600 proteins, at least 1,700 proteins, at
least 1,800 proteins, at least 1,900 proteins, or at least 2,000
proteins. In some embodiments the database of known protease
inhibitor proteins comprises from 100 to 500 proteins, from 200 to
1,000 proteins, from 500 to 1,000 proteins, from 500 to 1,000
proteins, or from 1,000 to 2,000 proteins, or from 2,000 to 3,000
proteins.
[0528] In other embodiments a protein that does exhibit some degree
of protease inhibitor activity is used. For example, in some
embodiments such a protein can be useful because it delays protease
digestion when the nutritive protein is consumed such that the
protein traverse a greater distance within the GI tract before it
is digested, thus delaying absorption. For example, in some
embodiments the protein inhibits gastric digestion but not
intestinal digestion. Delaney B. et al. (Evaluation of protein
safety in the context of agricultural biotechnology. Food. Chem.
Toxicol. 46 (2008: S71-S97)) suggests that one should avoid both
known toxic and anti-proteins when assessing the safety of a
possible food protein. In some embodiments of a protein, the
protein has a favorably low level of global homology to a database
of known toxic proteins and/or a favorably low level of global
homology to a database of known anti-nutricity proteins (e.g.,
protease inhibitors), as defined herein.
[0529] Antinutrients.
[0530] Provided are nutritional compositions that lack
anti-nutrients (or antinutrients). Antinutrients are compounds,
usually other than proteins, which are typically found in plant
foods and have been found to have both adverse effects and, in some
situations, certain health benefits. For instance, phytic acid,
lectins, phenolic compounds, saponins, and enzyme inhibitors have
been shown to reduce the availability of nutrients and to cause the
inhibition of growth, and phytoestrogens and lignans have been
linked with infertility problems. On the other hand, phytic acid,
lectins, phenolic compounds, amylase inhibitors, and saponins have
been shown to reduce the blood glucose and insulin response to
starch foods and/or the plasma cholesterol and triglycerides.
Furthermore, phytic acid, phenolics, saponins, protease inhibitors,
phytoestrogens, and lignans have been linked to reduced cancer
risks.
[0531] Provided are methods for reducing the amount
anti-nutritional factors in a food product, by treating the food
product with a thermal treatment comprising steam or hot air having
a temperature greater than about 90 degrees C. for at least 1
minute, combining with the treated food product with a composition
containing an isolated nutritive polypeptide. Optionally, the step
of thermal treatment degrades at least one anti-nutritional factor
such as a saponin, a lectin, and a prolamin, a protease inhibitor,
or phytic acid.
[0532] Anti-nutritional factors are detected in a protein
composition as follows. Phytic acid: The procedure of Wheeler and
Ferrel (Wheeler, E. L., Ferrel, R. E., Cereal Chem. 1971, 48, 312)
is used for the determination of phytic acid extracted in 3%
trichloroacetic acid. Raffinose family oligosaccharides: Protein
samples are extracted with 70% ethanol using Soxhlet apparatus for
6-8 h and thin-layer chromatography is used for the quantitative
determination of raffinose and stachyose in the extract according
to the procedure of Tanaka et al. (Tanaka, M., Thananunkul, D.,
Lee. T. C., Chichester, C. O., J. Food Sci. 1975, 40, 1087-1088).
Trypsin inhibitor. The method of Kakade et al. (Kakade, M. L.,
Rackis, J. J., McGhee, J. E., Puski, G., Cereal Chem. 1974, 51,
376-82) is used for determining the trypsin inhibitor activity in
raw and treated samples. One trypsin inhibitor unit (TIU) is
defined as a decrease in absorbance at 410 nm by 0.01 in 10 min and
data were expressed as TIU*mg-1. Amylase inhibitor. The inhibitor
is extracted in 0.15 m NaCl according to the procedure of Baker et
al. (Baker. J. E., Woo, S. M., Throne, J. E., Finny, P. L.,
Environm. Entomol. 1991, 20, 53.+-.60) and assayed by the method of
Huesing et al. (Huesing, J. E., Shade, R. E., Chrispeels, M. J.,
Murdok, L. L., Plant Physiol. 1991, 96, 993.+-.996). One amylase
inhibitor unit (AIU) is defined as the amount that gives 50%
inhibition of a portion of the amylase that produced one mg maltose
monohydrate per min. Lectins: The procedure of Paredes-Lopez et al.
(Paredes-Lopez, O., Schevenin, M. L., Guevara-Lara, F., Food Chem.
1989, 31, 129-137) is applied to the extraction of lectins using
phosphate-buffered saline (PBS). The hemagglutinin activity (HA) of
lectins in the sample extract is determined according to Kortt
(Kortt, A. A. (Ed.), Eur. J. Biochem. 1984, 138, 519). Trypsinized
human red blood cell (A, B and O) suspensions are prepared
according to Lis and Sharon (Lis, H., Sharon, N., Methods Enzymol.
1972, 28, 360.+-.368). HA is expressed as the reciprocal of the
highest dilution giving positive agglutination. Tannins: The tannin
contents are determined as tannic acid by Folin-Denis reagent
according to the procedure of the AOAC (Helrich, K. (Ed.), AOAC,
Official Methods of Analysis, Association of Official Analytical
Chemists, Arlington, Va. 1990)
[0533] Charge Assays and Solvation Scoring
[0534] One feature that can enhance the utility of a protein is its
charge (or per amino acid charge). Proteins with higher charge can
in some embodiments exhibit desirable characteristics such as
increased solubility, increased stability, resistance to
aggregation, and desirable taste profiles. For example, a charged
protein that exhibits enhanced solubility can be formulated into a
beverage or liquid formulation that includes a high concentration
of protein in a relatively low volume of solution, thus delivering
a large dose of protein nutrition per unit volume. A charged
protein that exhibits enhanced solubility can be useful, for
example, in sports drinks or recovery drinks wherein a user (e.g.,
an athlete) wants to ingest protein before, during or after
physical activity. A charged protein that exhibits enhanced
solubility can also be particularly useful in a clinical setting
wherein a subject (e.g., a patient or an elderly person) is in need
of protein nutrition but is unable to ingest solid foods or large
volumes of liquids.
[0535] For example, the net charge (ChargeP) of a polypeptide at pH
7 can be calculated using the following formula:
ChargeP=-0.002-(CX(0.045)-(D)(0.999)-(EX0.998)+(H)(0.091)+(K)(1.0)+(R)(1-
.0)-(Y)(-0.001)
[0536] where C is the number of cysteine residues, D is the number
of aspartic acid residues, E is the number of glutamic acid
residues. H is the number of histidine residues, K is the number of
lysine residues. R is the number of arginine residues and Y is the
number of tyrosine residues in the polypeptide. The per amino acid
charge (ChargeA) of the polypeptide can be calculated by dividing
the net charge (ChargeP) by the number of amino acid residues (N),
i.e., ChargeA=ChargePN. (See Bassi S (2007), "A Primer on Python
for Life Science Researchers." PLoS Comput Biol 3(11): e199, doi:
10.1371/journal.pcbi.0030199).
[0537] One metric for assessing the hydrophilicity and potential
solubility of a given protein is the solvation score. Solvation
score is defined as the total free energy of solvation (i.e. the
free energy change associated with transfer from gas phase to a
dilute solution) for all amino acid side chains if each residue
were solvated independently, normalized by the total number of
residues in the sequence. The side chain solvation free energies
are found computationally by calculating the electrostatic energy
difference between a vacuum dielectric of 1 and a water dielectric
of 80 (by solving the Poisson-Boltzmann equation) as well as the
non-polar, Van der Waals energy using a linear solvent accessible
surface area model (D. Sitkoff, K. A. Sharp, B. Honig. "Accurate
Calculation of Hydration Free Energies Using Macroscopic Solvent
Models". J. Phys. Chem. 98, 1994). For amino acids with ionizable
sidechains (Arg, Asp, Cys, Glu, His, Lys and Tyr), an average
solvation free energy is used based on the relative probabilities
for each ionization state at the specified pH. Solvation scores
start at 0 and continue into negative values, and the more negative
the solvation score, the more hydrophilic and potentially soluble
the protein is predicted to be. In some embodiments of a protein,
the protein has a solvation score of -10 or less at pH 7. In some
embodiments of a protein, the protein has a solvation score of -15
or less at pH 7. In some embodiments of a protein, the protein has
a solvation score of -20 or less at pH 7. In some embodiments of a
protein, the protein has a solvation score of -25 or less at pH 7.
In some embodiments of a protein, the protein has a solvation score
of -30 or less at pH 7. In some embodiments of a protein, the
protein has a solvation score of -35 or less at pH 7. In some
embodiments of a protein, the protein has a solvation score of -40
or less at pH 7.
[0538] The solvation score is a function of pH by virtue of the pH
dependence of the molar ratio of undissociated weak acid ([HA]) to
conjugate base ([A-]) as defined by the Henderson-Hasselbalch
equation:
pH = pKa + log ( [ A - ] [ HA ] ) ##EQU00001##
[0539] All weak acids have different solvation free energies
compared to their conjugate bases, and the solvation free energy
used for a given residue when calculating the solvation score at a
given pH is the weighted average of those two values.
[0540] Accordingly, in some embodiments of a protein, the protein
has a solvation score of -10 or less at an acidic pH. In some
embodiments of a protein, the protein has a solvation score of -15
or less at an acidic pH. In some embodiments of a protein, the
protein has a solvation score of -20 or less at an acidic pH. In
some embodiments of a protein, the protein has a solvation score of
-25 or less at an acidic pH. In some embodiments of a protein, the
protein has a solvation score of -30 or less at an acidic pH. In
some embodiments of a protein, the protein has a solvation score of
-35 or less at an acidic pH. In some embodiments of a protein, the
protein has a solvation score of -40 or less at acidic pH.
[0541] Accordingly, in some embodiments of a protein, the protein
has a solvation score of -10 or less at a basic pH. In some
embodiments of a protein, the protein has a solvation score of -15
or less at a basic pH. In some embodiments of a protein, the
protein has a solvation score of -20 or less at a basic pH. In some
embodiments of a protein, the protein has a solvation score of -25
or less at a basic pH. In some embodiments of a protein, the
protein has a solvation score of -30 or less at a basic pH. In some
embodiments of a protein, the protein has a solvation score of -35
or less at a basic pH. In some embodiments of a protein, the
protein has a solvation score of -40 or less at basic pH.
[0542] Accordingly, in some embodiments of a protein, the protein
has a solvation score of -10 or less at a pH range selected from
2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, and 11-12. In some
embodiments of a protein, the protein has a solvation score of -15
or less at a pH range selected from 2-3, 3-4, 4-5, 5-6, 6-7, 7-8,
8-9, 9-10, 10-11, and 11-12. In some embodiments of a protein, the
protein has a solvation score of -20 or less at a pH range selected
from 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, and 11-12. In
some embodiments of a protein, the protein has a solvation score of
-25 or less at a pH range selected from 2-3, 3-4, 4-5, 5-6, 6-7,
7-8, 8-9, 9-10, 10-11, and 11-12. In some embodiments of a protein,
the protein has a solvation score of -30 or less at a pH range
selected from 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, and
11-12. In some embodiments of a protein, the protein has a
solvation score of -35 or less at a pH range selected from 2-3,
3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, and 11-12. In some
embodiments of a protein, the protein has a solvation score of -40
or less at a pH range selected from 2-3, 3-4, 4-5, 5-6, 6-7, 7-8,
8-9, 9-10, 10-11, and 11-12.
[0543] Aggregation Assays and Aggregation Scoring
[0544] In some embodiments a protein of this disclosure shows
resistance to aggregation, exhibiting, for example, less than 80%
aggregation, 10% aggregation, or no detectable aggregation at
elevated temperatures (e.g., 50.degree. C., 60.degree. C.,
70.degree. C., 80.degree. C., 85.degree. C. 90.degree. C. or
95.degree. C.).
[0545] One benefit of stable proteins as disclosed herein is that
they can be able to be stored for an extended period of time before
use, in some instances without the need for refrigeration or
cooling. In some embodiments, proteins are processed into a dry
form (e.g., by lyophilization). In some embodiments, proteins are
stable upon lyophilization. In some embodiments, such lyophilized
proteins maintain their stability upon reconstitution (e.g., liquid
formulation).
[0546] The aggregation score is a primary sequence based metric for
assessing the hydrophobicity and likelihood of aggregation of a
given protein. Using the Kyte and Doolittle hydrophobity scale
(Kyte J. Doolittle RF (May 1982) "A simple method for displaying
the hydropathic character of a protein". J. Mol. Biol. 157 (1):
105-32), which gives hydrophobic residues positive values and
hydrophilic residues negative values, the average hydrophobicity of
a protein sequence is calculated using a moving average of five
residues. The aggregation score is drawn from the resulting plot by
determining the area under the curve for values greater than zero
and normalizing by the total length of the protein. The underlying
view is that aggregation is the result of two or more hydrophobic
patches coming together to exclude water and reduce surface
exposure, and the likelihood that a protein will aggregate is a
function of how densely packed its hydrophobic (i.e., aggregation
prone) residues are. Aggregation scores start at 0 and continue
into positive values, and the smaller the aggregation score, the
less hydrophobic and potentially less prone to aggregation the
protein is predicted to be. In some embodiments of a protein, the
protein has an aggregation score of 2 or less. In some embodiments
of a protein, the protein has an aggregation score of 1.5 or less.
In some embodiments of a protein, the protein has an aggregation
score of 1 or less. In some embodiments of a protein, the protein
has an aggregation score of 0.9 or less. In some embodiments of a
protein, the protein has an aggregation score of 0.8 or less. In
some embodiments of a protein, the protein has an aggregation score
of 0.7 or less. In some embodiments of a protein, the protein has
an aggregation score of 0.6 or less. In some embodiments of a
protein, the protein has an aggregation score of 0.5 or less. In
some embodiments of a protein, the protein has an aggregation score
of 0.4 or less. In some embodiments of a protein, the protein has
an aggregation score of 0.3 or less. In some embodiments of a
protein, the protein has an aggregation score of 0.2 or less. In
some embodiments of a protein, the protein has an aggregation score
of 0.1 or less.
[0547] In some cases, soluble expression is desirable because it
can increase the amount and/or yield of the protein and facilitate
one or more of the isolation and purification of the protein. In
some embodiments, the proteins of this disclosure are solubly
expressed in the host organism. Solvation score and aggregation
score can be used to predict soluble expression of recombinant
proteins in a host organism. As shown in Example 8, this disclosure
provides evidence suggesting that proteins with solvation scores of
.ltoreq.-20 and aggregation scores of .ltoreq.0.75 are more likely
to be recombinantly expressed in a particular E. coli expression
system. Moreover, the data also suggests that proteins with
solvation scores of .ltoreq.-20 and aggregation scores of
.ltoreq.0.5 are more likely to be solubly expressed in this system.
Therefore, in some embodiments the protein of this disclosure has a
solvation score of -20 or less. In some embodiments the nutritive
protein has an aggregation score of 0.75 or less. In some
embodiments the nutritive protein has an aggregation score of 0.5
or less. In some embodiments the protein has a solvation score of
-20 or less and an aggregation score of 0.75 or less. In some
embodiments the protein has a solvation score of -20 or less and an
aggregation score of 0.5 or less.
[0548] Taste and Mouth Characteristics
[0549] Certain free amino acids and mixtures of free amino acids
are known to have a bitter or otherwise unpleasant taste. In
addition, hydrolysates of common proteins (e.g., whey and soy)
often have a bitter or unpleasant taste. In some embodiments,
proteins disclosed and described herein do not have a bitter or
otherwise unpleasant taste. In some embodiments, proteins disclosed
and described herein have a more acceptable taste as compared to at
least one of free amino acids, mixtures of free amino acids, and/or
protein hydrolysates. In some embodiments, proteins disclosed and
described herein have a taste that is equal to or exceeds at least
one of whey protein.
[0550] Proteins are known to have tastes covering the five
established taste modalities: sweet, sour, bitter, salty, and
umami. Fat can be considered a sixth taste. The taste of a
particular protein (or its lack thereof) can be attributed to
several factors, including the primary structure, the presence of
charged side chains, and the electronic and conformational features
of the protein. In some embodiments, proteins disclosed and
described herein are designed to have a desired taste (e.g., sweet,
salty, umami) and/or not to have an undesired taste (e.g., bitter,
sour). In this context "design" includes, for example, selecting
edible species proteins embodying features that achieve the desired
taste property, as well as creating muteins of edible species
polypeptides that have desired taste properties. For example,
proteins can be designed to interact with specific taste receptors,
such as sweet receptors (TIR2-TIR3 heterodimer) or umami receptors
(TIR1-TIR3 heterodimer, mGluR4, and/or mGluR1). Further, proteins
can be designed not to interact, or to have diminished interaction,
with other taste receptors, such as bitter receptors (T2R
receptors).
[0551] Proteins disclosed and described herein can also elicit
different physical sensations in the mouth when ingested, sometimes
referred to as "mouth feel." The mouth feel of the proteins can be
due to one or more factors including primary structure, the
presence of charged side chains, and the electronic and
conformational features of the protein. In some embodiments,
proteins elicit a buttery or fat-like mouth feel when ingested.
[0552] Nutritive Compositions and Formulations
[0553] At least one protein disclosed herein can be combined with
at least one second component to form a composition. In some
embodiments the only source of amino acid in the composition is the
at least one protein disclosed herein. In such embodiments the
amino acid composition of the composition will be the same as the
amino acid composition of the at least one protein disclosed
herein. In some embodiments the composition comprises at least one
protein disclosed herein and at least one second protein. In some
embodiments the at least one second protein is a second protein
disclosed herein, while in other embodiments the at least one
second protein is not a protein disclosed herein. In some
embodiments the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more proteins
disclosed herein. In some embodiments the composition comprises 0,
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20 or more proteins that are not proteins disclosed herein. In some
embodiments the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more proteins and the
composition comprises 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20 or more proteins that are not proteins
disclosed herein.
[0554] Also provided are formulations containing the nutritive
polypeptides described herein. In one aspect, provided is a
formulation containing a unicellular organism secreted polypeptide
nutritional domain. For example, the polypeptide nutritional domain
contains an amino acid sequence having an N-terminal amino acid
that does not correspond to the N-terminal amino acid of an amino
acid sequence comprising a unicellular organism secreted
polypeptide that contains the polypeptide nutritional domain. In
some embodiments the amino acid sequence comprising the unicellular
organism secreted polypeptide is an edible species polypeptide
sequence, and the N-terminal amino acid is a common edible species
amino acid. In addition or in the alternative, the polypeptide
nutritional domain contains an amino acid sequence having a
C-terminal amino acid that does not correspond to the C-terminal
amino acid of an amino acid sequence comprising a unicellular
organism secreted polypeptide that contains the polypeptide
nutritional domain. In some embodiments the amino acid sequence
comprising the unicellular organism secreted polypeptide is an
edible species polypeptide sequence, and the C-terminal amino acid
is a common edible species amino acid. Thus, in some embodiments
the secreted polypeptide nutritional domain is at least one amino
acid shorter than a homologous edible species polypeptide. The
nutritional domain can be about 99%, 98%, 97%, 96%, 95%, 90%, 85%,
80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%,
15%, 10%, 5% or less than 5% the length of a homologous edible
species peptide. In other embodiments, the polypeptide nutritional
domain consists of from about 1% to about 99% of the unicellular
organism secreted polypeptide that contains the polypeptide
nutritional domain. As described herein, the polypeptide
nutritional domain is generally preferred to the larger polypeptide
containing the polypeptide nutritional domain. A polypeptide
nutritional domain may contain, on a mass basis, more nutrition
than the larger including polypeptide. In some embodiments, a
polypeptide nutritional domain may provide desirable features when
compared to the larger including polypeptide, such as increased
solubility and better shelf-life stability.
[0555] In some embodiments the composition as described in the
preceding paragraph, further comprises at least one of at least one
polypeptide, at least one peptide, and at least one free amino
acid. In some embodiments the composition comprises at least one
polypeptide and at least one peptide. In some embodiments the
composition comprises at least one polypeptide and at least one
free amino acid. In some embodiments the composition comprises at
least one peptide and at least one free amino acid. In some
embodiments the at least one polypeptide, at least one peptide,
and/or at least one free amino acid comprises amino acids selected
from 1) branched chain amino acids, 2) leucine, and 3) essential
amino acids. In some embodiments the at least one polypeptide, at
least one peptide, and/or at least one free amino acid consists of
amino acids selected from 1) branched chain amino acids, 2)
leucine, and 3) essential amino acids. In some embodiments, the
composition comprises at least one modified amino acid or a
non-standard amino acid. Modified amino acids include amino acids
that have modifications to one or more of the carboxy terminus,
amino terminus, and/or side chain. Non-standard amino acids can be
selected from those that are formed by post-translational
modification of proteins, for example, carboxylated glutamate,
hydroxyproline, or hypusine. Other non-standard amino acids are not
found in proteins. Examples include lanthionine, 2-aminoisobutyric
acid, dehydroalanine, gamma-aminobutyric acid, omithine and
citrulline. In some embodiments, the composition comprises one or
more D-amino acids. In some embodiments, the composition comprises
one or more L-amino acids. In some embodiments, the composition
comprises a mixture of one or more D-amino acids and one or more
L-amino acids.
[0556] By adding at least one of a polypeptide, a peptide, and a
free amino acid to a composition the proportion of at least one of
branched chain amino acids, leucine, and essential amino acids, to
total amino acid, present in the composition can be increased.
[0557] In some embodiments the composition comprises at least one
carbohydrate. A "carbohydrate" refers to a sugar or polymer of
sugars. The terms "saccharide," "polysaccharide," "carbohydrate,"
and "oligosaccharide" can be used interchangeably. Most
carbohydrates are aldehydes or ketones with many hydroxyl groups,
usually one on each carbon atom of the molecule. Carbohydrates
generally have the molecular formula CnH2nOn. A carbohydrate can be
a monosaccharide, a disaccharide, trisaccharide, oligosaccharide,
or polysaccharide. The most basic carbohydrate is a monosaccharide,
such as glucose, sucrose, galactose, mannose, ribose, arabinose,
xylose, and fructose. Disaccharides are two joined monosaccharides.
Exemplary disaccharides include sucrose, maltose, cellobiose, and
lactose. Typically, an oligosaccharide includes between three and
six monosaccharide units (e.g., raffinose, stachyose), and
polysaccharides include six or more monosaccharide units. Exemplary
polysaccharides include starch, glycogen, and cellulose.
Carbohydrates may contain modified saccharide units such as
2'-deoxyribose wherein a hydroxyl group is removed, 2'-fluororibose
wherein a hydroxyl group is replace with a fluorine, or
N-acetylglucosamine, a nitrogen-containing form of glucose (e.g.,
2'-fluororibose, deoxyribose, and hexose). Carbohydrates may exist
in many different forms, for example, conformers, cyclic forms,
acyclic forms, stereoisomers, tautomers, anomers, and isomers.
[0558] In some embodiments the composition comprises at least one
lipid. As used herein a "lipid" includes fats, oils, triglycerides,
cholesterol, phospholipids, fatty acids in any form including free
fatty acids. Fats, oils and fatty acids can be saturated,
unsaturated (cis or trans) or partially unsaturated (cis or trans).
In some embodiments the lipid comprises at least one fatty acid
selected from lauric acid (12:0), myristic acid (14:0), palmitic
acid (16:0), palmitoleic acid (16:1), margaric acid (17:0),
heptadecenoic acid (17:1), stearic acid (18:0), oleic acid (18:1),
linoleic acid (18:2), linolenic acid (18:3), octadecatetraenoic
acid (18:4), arachidic acid (20:0), eicosenoic acid (20:1),
eicosadienoic acid (20:2), eicosatetraenoic acid (20:4),
eicosapentaenoic acid (20:5) (EPA), docosanoic acid (22:0),
docosenoic acid (22:1), docosapentaenoic acid (22:5),
docosahexaenoic acid (22:6) (DHA), and tetracosanoic acid (24:0).
In some embodiments the composition comprises at least one modified
lipid, for example a lipid that has been modified by cooking.
[0559] In some embodiments the composition comprises at least one
supplemental mineral or mineral source. Examples of minerals
include, without limitation: chloride, sodium, calcium, iron,
chromium, copper, iodine, zinc, magnesium, manganese, molybdenum,
phosphorus, potassium, and selenium. Suitable forms of any of the
foregoing minerals include soluble mineral salts, slightly soluble
mineral salts, insoluble mineral salts, chelated minerals, mineral
complexes, non-reactive minerals such as carbonyl minerals, and
reduced minerals, and combinations thereof
[0560] In some embodiments the composition comprises at least one
supplemental vitamin. The at least one vitamin can be fat-soluble
or water soluble vitamins. Suitable vitamins include but are not
limited to vitamin C, vitamin A, vitamin E, vitamin B12, vitamin K,
riboflavin, niacin, vitamin D, vitamin B6, folic acid, pyridoxine,
thiamine, pantothenic acid, and biotin. Suitable forms of any of
the foregoing are salts of the vitamin, derivatives of the vitamin,
compounds having the same or similar activity of the vitamin, and
metabolites of the vitamin.
[0561] In some embodiments the composition comprises at least one
organism. Suitable examples are well known in the art and include
probiotics (e.g., species of Lactobacillus or Bifidobacterium),
spirulina, chlorella, and porphyra.
[0562] In some embodiments the composition comprises at least one
dietary supplement. Suitable examples are well known in the art and
include herbs, botanicals, and certain hormones. Non limiting
examples include ginko, gensing, and melatonin.
[0563] In some embodiments the composition comprises an excipient.
Non-limiting examples of suitable excipients include a tastant, a
flavorant, a buffering agent, a preservative, a stabilizer, a
binder, a compaction agent, a lubricant, a dispersion enhancer, a
disintegration agent, a flavoring agent, a sweetener, a coloring
agent.
[0564] In some embodiments the excipient is a buffering agent.
Non-limiting examples of suitable buffering agents include sodium
citrate, magnesium carbonate, magnesium bicarbonate, calcium
carbonate, and calcium bicarbonate.
[0565] In some embodiments the excipient comprises a preservative.
Non-limiting examples of suitable preservatives include
antioxidants, such as alpha-tocopherol and ascorbate, and
antimicrobials, such as parabens, chlorobutanol, and phenol.
[0566] In some embodiments the composition comprises a binder as an
excipient. Non-limiting examples of suitable binders include
starches, pregelatinized starches, gelatin, polyvinylpyrolidone,
cellulose, methylcellulose, sodium carboxymethylcellulose,
ethylcellulose, polyacrylamides, polyvinyloxoazolidone,
polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol,
polyols, saccharides, oligosaccharides, and combinations
thereof.
[0567] In some embodiments the composition comprises a lubricant as
an excipient. Non-limiting examples of suitable lubricants include
magnesium stearate, calcium stearate, zinc stearate, hydrogenated
vegetable oils, sterotex, polyoxyethylene monostearate, talc,
polyethyleneglycol, sodium benzoate, sodium lauryl sulfate,
magnesium lauryl sulfate, and light mineral oil.
[0568] In some embodiments the composition comprises a dispersion
enhancer as an excipient. Non-limiting examples of suitable
dispersants include starch, alginic acid, polyvinylpyrrolidones,
guar gum, kaolin, bentonite, purified wood cellulose, sodium starch
glycolate, isoamorphous silicate, and microcrystalline cellulose as
high HLB emulsifier surfactants.
[0569] In some embodiments the composition comprises a disintegrant
as an excipient. In some embodiments the disintegrant is a
non-effervescent disintegrant. Non-limiting examples of suitable
non-effervescent disintegrants include starches such as corn
starch, potato starch, pregelatinized and modified starches
thereof, sweeteners, clays, such as bentonite, micro-crystalline
cellulose, alginates, sodium starch glycolate, gums such as agar,
guar, locust bean, karaya, pecitin, and tragacanth. In some
embodiments the disintegrant is an effervescent disintegrant.
Non-limiting examples of suitable effervescent disintegrants
include sodium bicarbonate in combination with citric acid, and
sodium bicarbonate in combination with tartaric acid.
[0570] In some embodiments the excipient comprises a flavoring
agent. Flavoring agents incorporated into the outer layer can be
chosen from synthetic flavor oils and flavoring aromatics; natural
oils; extracts from plants, leaves, flowers, and fruits; and
combinations thereof. In some embodiments the flavoring agent is
selected from cinnamon oils; oil of wintergreen; peppermint oils:
clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil
such as lemon oil, orange oil grape and grapefruit oil; and fruit
essences including apple, peach, pear, strawberry, raspberry,
cherry, plum, pineapple, and apricot.
[0571] In some embodiments the excipient comprises a sweetener.
Non-limiting examples of suitable sweeteners include glucose (corn
syrup), dextrose, invert sugar, fructose, and mixtures thereof
(when not used as a carrier); saccharin and its various salts such
as the sodium salt; dipeptide sweeteners such as aspartame;
dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana
(Stevioside); chloro derivatives of sucrose such as sucralose; and
sugar alcohols such as sorbitol, mannitol, sylitol, and the like.
Also contemplated are hydrogenated starch hydrolysates and the
synthetic sweetener
3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide,
particularly the potassium salt (acesulfame-K), and sodium and
calcium salts thereof.
[0572] In some embodiments the composition comprises a coloring
agent. Non-limiting examples of suitable color agents include food,
drug and cosmetic colors (FD&C), drug and cosmetic colors
(D&C), and external drug and cosmetic colors (Ext. D&C).
The coloring agents can be used as dyes or their corresponding
lakes.
[0573] The weight fraction of the excipient or combination of
excipients in the formulation is usually about 50% or less, about
45% or less, about 40% or less, about 35% or less, about 30% or
less, about 25% or less, about 20% or less, about 15% or less,
about 10% or less, about 5% or less, about 2% or less, or about 1%
or less of the total weight of the amino acids in the
composition.
[0574] The proteins and compositions disclosed herein can be
formulated into a variety of forms and administered by a number of
different means. The compositions can be administered orally,
rectally, or parenterally, in formulations containing
conventionally acceptable carriers, adjuvants, and vehicles as
desired. The term "parenteral" as used herein includes
subcutaneous, intravenous, intramuscular, or intrasternal injection
and infusion techniques. In an exemplary embodiment, the protein or
composition is administered orally.
[0575] Solid dosage forms for oral administration include capsules,
tablets, caplets, pills, troches, lozenges, powders, and granules.
A capsule typically comprises a core material comprising a protein
or composition and a shell wall that encapsulates the core
material. In some embodiments the core material comprises at least
one of a solid, a liquid, and an emulsion. In some embodiments the
shell wall material comprises at least one of a soft gelatin, a
hard gelatin, and a polymer. Suitable polymers include, but are not
limited to: cellulosic polymers such as hydroxypropyl cellulose,
hydroxyethyl cellulose, hydroxypropyl methyl cellulose (HPMC),
methyl cellulose, ethyl cellulose, cellulose acetate, cellulose
acetate phthalate, cellulose acetate trimellitate,
hydroxypropylmethyl cellulose phthalate, hydroxypropylmethyl
cellulose succinate and carboxymethylcellulose sodium; acrylic acid
polymers and copolymers, such as those formed from acrylic acid,
methacrylic acid, methyl acrylate, ammonio methylacrylate, ethyl
acrylate, methyl methacrylate and/or ethyl methacrylate (e.g.,
those copolymers sold under the trade name "Eudragit"); vinyl
polymers and copolymers such as polyvinyl pyrrolidone, polyvinyl
acetate, polyvinylacetate phthalate, vinylacetate crotonic acid
copolymer, and ethylene-vinyl acetate copolymers; and shellac
(purified lac). In some embodiments at least one polymer functions
as taste-masking agents.
[0576] Tablets, pills, and the like can be compressed, multiply
compressed, multiply layered, and/or coated. The coating can be
single or multiple. In one embodiment, the coating material
comprises at least one of a saccharide, a polysaccharide, and
glycoproteins extracted from at least one of a plant, a fungus, and
a microbe. Non-limiting examples include corn starch, wheat starch,
potato starch, tapioca starch, cellulose, hemicellulose, dextrans,
maltodextrin, cyclodextrins, inulins, pectin, mannans, gum arabic,
locust bean gum, mesquite gum, guar gum, gum karaya, gum ghatti,
tragacanth gum, funori, carrageenans, agar, alginates, chitosans,
or gellan gum. In some embodiments the coating material comprises a
protein. In some embodiments the coating material comprises at
least one of a fat and oil. In some embodiments the at least one of
a fat and an oil is high temperature melting. In some embodiments
the at least one of a fat and an oil is hydrogenated or partially
hydrogenated. In some embodiments the at least one of a fat and an
oil is derived from a plant. In some embodiments the at least one
of a fat and an oil comprises at least one of glycerides, free
fatty acids, and fatty acid esters. In some embodiments the coating
material comprises at least one edible wax. The edible wax can be
derived from animals, insects, or plants. Non-limiting examples
include beeswax, lanolin, bayberry wax, carnauba wax, and rice bran
wax. Tablets and pills can additionally be prepared with enteric
coatings.
[0577] Alternatively, powders or granules embodying the proteins
and compositions disclosed herein can be incorporated into a food
product. In some embodiments the food product is be a drink for
oral administration. Non-limiting examples of a suitable drink
include fruit juice, a fruit drink, an artificially flavored drink,
an artificially sweetened drink, a carbonated beverage, a sports
drink, a liquid diary product, a shake, an alcoholic beverage, a
caffeinated beverage, infant formula and so forth. Other suitable
means for oral administration include aqueous and nonaqueous
solutions, creams, pastes, emulsions, suspensions and slurries,
each of which may optionally also containing at least one of
suitable solvents, preservatives, emulsifying agents, suspending
agents, diluents, sweeteners, coloring agents, a tastant, a
flavorant, and flavoring agents.
[0578] In some embodiments the food product is a solid foodstuff.
Suitable examples of a solid foodstuff include without limitation a
food bar, a snack bar, a cookie, a brownie, a muffin, a cracker, a
biscuit, a cream or paste, an ice cream bar, a frozen yogurt bar,
and the like.
[0579] In some embodiments, the proteins and compositions disclosed
herein are incorporated into a therapeutic food. In some
embodiments, the therapeutic food is a ready-to-use food that
optionally contains some or all essential macronutrients and
micronutrients. In some embodiments, the proteins and compositions
disclosed herein are incorporated into a supplementary food that is
designed to be blended into an existing meal. In some embodiments,
the supplemental food contains some or all essential macronutrients
and micronutrients. In some embodiments, the proteins and
compositions disclosed herein are blended with or added to an
existing food to fortify the food's protein nutrition. Examples
include food staples (grain, salt, sugar, cooking oil, margarine),
beverages (coffee, tea, soda, beer, liquor, sports drinks), snacks,
sweets and other foods.
[0580] The compositions disclosed herein can be utilized in methods
to increase at least one of muscle mass, strength and physical
function, thermogenesis, metabolic expenditure, satiety,
mitochondrial biogenesis, weight or fat loss, and lean body
composition for example.
[0581] A formulation can contain a nutritive polypeptide up to
about 25 g per 100 kilocalories (25 g/100 kcal) in the formulation,
meaning that all or essentially all of the energy present in the
formulation is in the form of the nutritive polypeptide. More
typically, about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%,
65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or
less than 5% of the energy present in the formulation is in the
form of the nutritive polypeptide. In other formulations, the
nutritive polypeptide is present in an amount sufficient to provide
a nutritional benefit equivalent to or greater than at least about
0.1% of a reference daily intake value of polypeptide. Suitable
reference daily intake values for protein are well known in the
art. See, e.g., Dietary Reference Intakes for Energy, Carbohydrate,
Fiber, Fat, Fatty Acids, Cholesterol, Protein and Amino Acids,
Institute of Medicine of the National Academies, 2005, National
Academies Press, Washington DC. A reference daily intake value for
protein is a range wherein 10-35% of daily calories are provided by
protein and isolated amino acids. Another reference daily intake
value based on age is provided as grams of protein per day:
children ages 1-3: 13 g children ages 4-8: 19 g, children ages
9-13: 34 g, girls ages 14-18: 46, boys ages 14-18: 52, women ages
19-70+: 46, and men ages 19-70+: 56. In other formulations, the
nutritive polypeptide is present in an amount sufficient to provide
a nutritional benefit to a human subject suffering from protein
malnutrition or a disease, disorder or condition characterized by
protein malnutrition. Protein malnutrition is commonly a prenatal
or childhood condition. Protein malnutrition with adequate energy
intake is termed kwashiorkor or hypoalbuminemic malnutrition, while
inadequate energy intake in all forms, including inadequate protein
intake, is termed marasmus. Adequately nourished individuals can
develop sarcopenia from consumption of too little protein or
consumption of proteins deficient in nutritive amino acids.
Prenatal protein malnutrition can be prevented, treated or reduced
by administration of the nutritive polypeptides described herein to
pregnant mothers, and neonatal protein malnutrition can be
prevented, treated or reduced by administration of the nutritive
polypeptides described herein to the lactation mother. In adults,
protein malnutrition is commonly a secondary occurrence to cancer,
chronic renal disease, and in the elderly. Additionally, protein
malnutrition can be chronic or acute. Examples of acute protein
malnutrition occur during an acute illness or disease such as
sepsis, or during recovery from a traumatic injury, such as
surgery, thermal injury such as a burn, or similar events resulting
in substantial tissue remodeling. Other acute illnesses treatable
by the methods and compositions described herein include
sarcopenia, cachexia, diabetes, insulin resistance, and
obesity.
[0582] A formulation can contain a nutritive polypeptide in an
amount sufficient to provide a feeling of satiety when consumed by
a human subject, meaning the subject feels a reduced sense or
absence of hunger, or desire to eat. Such a formulation generally
has a higher satiety index than carbohydrate-rich foods on an
equivalent calorie basis.
[0583] A formulation can contain a nutritive polypeptide in an
amount based on the concentration of the nutritive polypeptide
(e.g., on a weight-to-weight basis), such that the nutritive
polypeptide accounts for up to 100% of the weight of the
formulation, meaning that all or essentially all of the matter
present in the formulation is in the form of the nutritive
polypeptide. More typically, about 99%, 98%, 97%, 96%, 95%, 90%,
85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%,
20%, 15%, 10%, 5% or less than 5% of the weight present in the
formulation is in the form of the nutritive polypeptide. In some
embodiments, the formulation contains 10 mg, 100 mg, 500 mg, 750
mg, 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9, 10 g, 15 g, 20 g, 25
g, 30 g, 35 g, 40 g, 45 g, 50 g, 60 g, 70 g, 80 g, 90 g, 100 g or
over 100 g of nutritive polypeptide.
[0584] Preferably, the formulations provided herein are
substantially free of non-comestible products. Non-comestible
products are often found in preparations of recombinant proteins of
the prior art, produced from yeast, bacteria, algae, insect,
mammalian or other expression systems. Exemplary non-comestible
products include surfactant, a polyvinyl alcohol, a propylene
glycol, a polyvinyl acetate, a polyvinylpyrrolidone, a
non-comestible polyacid or polyol a fatty alcohol, an alkylbenzyl
sulfonate, an alkyl glucoside, or a methyl paraben.
[0585] In aspects, the provided formulations contain other
materials, such as a tastant, a nutritional carbohydrate and/or a
nutritional lipid. In addition, formulations may include bulking
agents, texturizers, and fillers.
[0586] In preferred embodiments, the nutritive polypeptides
provided herein are isolated and/or substantially purified. The
nutritive polypeptides and the compositions and formulations
provided herein, are substantially free of non-protein components.
Such non-protein components are generally present in protein
preparations such as whey, casein, egg and soy preparations, which
contain substantial amounts of carbohydrates and lipids that
complex with the polypeptides and result in delayed and incomplete
protein digestion in the gastrointestinal tract. Such non-protein
components can also include DNA. Thus, the nutritive polypeptides,
compositions and formulations are characterized by improved
digestibility and decreased allergenicity as compared to
food-derived polypeptides and polypeptide mixtures. Furthermore,
these formulations and compositions are characterized by more
reproducible digestibility from a time and/or a digestion product
at a given unit time basis. In certain embodiments, a nutritive
polypeptide is at least 10% reduced in lipids and/or carbohydrates,
and optionally one or more other materials that decreases
digestibility and/or increases allergenicity, relative to a
reference polypeptide or reference polypeptide mixture, e.g., is
reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or
greater than 99%. In certain embodiments, the nutritive
formulations contain a nutritional carbohydrate and/or nutritional
lipid, which may be selected for digestibility and/or reduced
allergenicity.
[0587] Methods of Use
[0588] In some embodiments the proteins and compositions disclosed
herein are administered to a patient or a user (sometimes
collectively referred to as a "subject"). As used herein
"administer" and "administration" encompasses embodiments in which
one person directs another to consume a protein or composition in a
certain manner and/or for a certain purpose, and also situations in
which a user uses a protein or composition in a certain manner
and/or for a certain purpose independently of or in variance to any
instructions received from a second person. Non-limiting examples
of embodiments in which one person directs another to consume a
protein or composition in a certain manner and/or for a certain
purpose include when a physician prescribes a course of conduct
and/or treatment to a patient, when a trainer advises a user (such
as an athlete) to follow a particular course of conduct and/or
treatment, and when a manufacturer, distributor, or marketer
recommends conditions of use to an end user, for example through
advertisements or labeling on packaging or on other materials
provided in association with the sale or marketing of a
product.
[0589] In some embodiments the proteins or compositions are
provided in a dosage form. In some embodiments the dosage form is
designed for administration of at least one protein disclosed
herein, wherein the total amount of protein administered is
selected from 0.1 g to 1 g, 1 g to 5 g. from 2 g to 10 g, from 5 g
to 15 g, from 10 g to 20 g. from 15 g to 25 g, from 20 g to 40 g,
from 25-50 g, and from 30-60 g. In some embodiments the dosage form
is designed for administration of at least one protein disclosed
herein, wherein the total amount of protein administered is
selected from about 0.1 g, 0.1 g-1 g, 1 g, 2 g, 3 g, 4 g, 5 g, 6 g,
7 g, 8 g, 9 g, 10 g, 15 g, 20 g, 25 g, 30 g, 35 g, 40 g, 45 g, 50
g, 55 g, 60 g, 65 g, 70 g, 75 g, 80 g, 85 g, 90 g, 95 g. and 100
g.
[0590] In some embodiments the dosage form is designed for
administration of at least one protein disclosed herein, wherein
the total amount of essential amino acids administered is selected
from 0.1 g to 1 g, from 1 g to 5 g, from 2 g to 10 g, from 5 g to
15 g. from 10 g to 20 g, and from 1-30 g. In some embodiments the
dosage form is designed for administration of at least one protein
disclosed herein, wherein the total amount of protein administered
is selected from about 0.1 g, 0.1-1 g, 1 g, 2 g, 3 g, 4 g, 5 g, 6
g, 7 g, 8 g, 9 g, 10 g, 15 g, 20 g, 25 g, 30 g, 35 g, 40 g, 45 g,
50 g, 55 g, 60 g, 65 g, 70 g, 75 g., 80 g, 85 g, 90 g, 95 g. and
100 g.
[0591] In some embodiments the protein or composition is consumed
at a rate of from 0.1 g to 1 g a day, 1 g to 5 g a day, from 2 g to
10 g a day, from 5 g to 15 g a day, from 10 g to 20 g a day, from
15 g to 30 g a day, from 20 g to 40 g a day, from 25 g to 50 g a
day, from 40 g to 80 g a day, from 50 g to 100 g a day, or
more.
[0592] In some embodiments, of the total protein intake by the
subject, at least 5%, at least 10%, at least 15%, at least 20%, at
least 25%, at least 30%, at least 35%, at least 40%, at least 45%,
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, or about 100% of the total protein intake by the subject
over a dietary period is made up of at least one protein according
to this disclosure. In some embodiments, of the total protein
intake by the subject, from 5% to 100% of the total protein intake
by the subject, from 5% to 90% of the total protein intake by the
subject, from 5% to 80% of the total protein intake by the subject,
from 5% to 70% of the total protein intake by the subject, from 5%
to 60% of the total protein intake by the subject, from 5% to 50%
of the total protein intake by the subject, from 5% to 40% of the
total protein intake by the subject, from 5% to 30% of the total
protein intake by the subject, from 5% to 20% of the total protein
intake by the subject, from 5% to 10% of the total protein intake
by the subject, from 10% to 100% of the total protein intake by the
subject, from 10% to 100% of the total protein intake by the
subject, from 20% to 100% of the total protein intake by the
subject, from 30% to 100% of the total protein intake by the
subject, from 40% to 100% of the total protein intake by the
subject, from 50% to 100% of the total protein intake by the
subject, from 60% to 100% of the total protein intake by the
subject, from 70% to 100% of the total protein intake by the
subject, from 80% to 100% of the total protein intake by the
subject, or from 90% to 100% of the total protein intake by the
subject, over a dietary period, is made up of at least one protein
according to this disclosure. In some embodiments the at least one
protein of this disclosure accounts for at least 5%, at least 10%,
at least 15%, at least 20%, at least 25%, at least 30%, at least
35%, at least 40%, at least 45%, or at least 50% of the subject's
calorie intake over a dietary period.
[0593] In some embodiments the at least one protein according to
this disclosure comprises at least 2 proteins of this disclosure,
at least 3 proteins of this disclosure, at least 4 proteins of this
disclosure, at least 5 proteins of this disclosure, at least 6
proteins of this disclosure, at least 7 proteins of this
disclosure, at least 8 proteins of this disclosure, at least 9
proteins of this disclosure, at least 10 proteins of this
disclosure, or more.
[0594] In some embodiments the dietary period is I meal 2 meals, 3
meals, at least 1 day, at least 2 days, at least 3 days, at least 4
days, at least 5 days, at least 6 days, at least 1 week, at least 2
weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at
least 2 months, at least 3 months, at least 4 months, at least 5
months, at least 6 months, or at least 1 year. In some embodiments
the dietary period is from 1 day to 1 week, from 1 week to 4 weeks,
from 1 month, to 3 months, from 3 months to 6 months, or from 6
months to 1 year.
[0595] Clinical studies provide evidence that protein prevents
muscle loss due to aging or disuse, such as from immobility or
prolonged bed rest. In particular, studies have shown that protein
supplementation increases muscle fractional synthetic rate (FSR)
during prolonged bed rest, maintains leg mass and strength during
prolonged bed rest, increases lean body mass, improves functional
measures of gait and balance, and may serve as a viable
intervention for individuals at risk of sarcopenia due to
immobility or prolonged bed rest. See. e.g., Paddon-Jones D, et al.
J Clin Endocrinol Metab 2004, 89:4351-4358; Ferrando, A et al.
Clinical Nutrition 2009 1-6; Katsanos C et al. Am J Physiol
Endocrinol Metab. 2006, 291: 381-387.
[0596] Studies on increasing muscle protein anabolism in athletes
have shown that protein provided following exercise promotes muscle
hypertrophy to a greater extent than that achieved by exercise
alone. It has also been shown that protein provided following
exercise supports protein synthesis without any increase in protein
breakdown, resulting in a net positive protein balance and muscle
mass accretion. While muscle protein synthesis appears to respond
in a dose-response fashion to essential amino acid supplementation,
not all proteins are equal in building muscle. For example, the
amino acid leucine is an important factor in stimulating muscle
protein synthesis. See, e.g., & Borscheim E et al. Am J Physiol
Endocrinol Metab 2002, 283: E648-E657; Borsheim E et al. Clin Nutr.
2008, 27: 189-95; Esmarck B et al J Physiol 2001, 535: 301-311;
Moore D et al. Am J Clin Nutr 2009, 89: 161-8).
[0597] In another aspect this disclosure provides methods of
maintaining or increasing at least one of muscle mass, muscle
strength, and functional performance in a subject. In some
embodiments the methods comprise providing to the subject a
sufficient amount of a protein of this disclosure, a composition of
this disclosure, or a composition made by a method of this
disclosure. In some embodiments the subject is at least one of
elderly, critically-medically ill, and suffering from
protein-energy malnutrition. In some embodiments the sufficient
amount of a protein of this disclosure, a composition of this
disclosure, or a composition made by a method of this disclosure is
consumed by the subject in coordination with performance of
exercise. In some embodiments the protein of this disclosure,
composition of this disclosure, or composition made by a method of
this disclosure is consumed by the subject by an oral, enteral, or
parenteral route. In some embodiments the protein of this
disclosure, composition of this disclosure, or composition made by
a method of this disclosure is consumed by the subject by an oral
route. In some embodiments the protein of this disclosure,
composition of this disclosure, or composition made by a method of
this disclosure is consumed by the subject by an enteral route.
[0598] In another aspect this disclosure provides methods of
maintaining or achieving a desirable body mass index in a subject.
In some embodiments the methods comprise providing to the subject a
sufficient amount of a protein of this disclosure, a composition of
this disclosure, or a composition made by a method of this
disclosure. In some embodiments the subject is at least one of
elderly, critically-medically ill, and suffering from
protein-energy malnutrition. In some embodiments the sufficient
amount of a protein of this disclosure, a composition of this
disclosure, or a composition made by a method of this disclosure is
consumed by the subject in coordination with performance of
exercise. In some embodiments the protein of this disclosure,
composition of this disclosure, or composition made by a method of
this disclosure is consumed by the subject by an oral, enteral, or
parenteral route.
[0599] In another aspect this disclosure provides methods of
providing protein to a subject with protein-energy malnutrition. In
some embodiments the methods comprise providing to the subject a
sufficient amount of a protein of this disclosure, a composition of
this disclosure, or a composition made by a method of this
disclosure. In some embodiments the protein of this disclosure,
composition of this disclosure, or composition made by a method of
this disclosure is consumed by the subject by an oral, enteral, or
parenteral route.
[0600] The need for essential amino acid supplementation has been
suggested in cancer patients and other patients suffering from
muscle wasting and cachexia. Dietary studies in mice have shown
survival and functional benefits to cachectic cancer-bearing mice
through dietary intervention with essential amino acids. Beyond
cancer, essential amino acid supplementation has also shown
benefits, such as improved muscle function and muscle gain, in
patients suffering from other diseases that have difficulty
exercising and therefore suffer from muscular deterioration, such
as chronic obstructive pulmonary disease, chronic heart failure,
HIV, and other disease states.
[0601] Studies have shown that specific amino acids have advantages
in managing cachexia. A relatively high content of BCAAs and Leu in
diets are thought to have a positive effect in cachexia by
promoting total protein synthesis by signaling an increase in
translation, enhancing insulin release, and inhibiting protein
degradation. Thus, consuming increased dietary BCAAs in general
and/or Leu in particular will contribute positively to reduce or
reverse the effects of cachexia. Because nitrogen balance is
important in countering the underlying cause of cachexia it is
thought that consuming increased dietary glutamine and/or arginine
will contribute positively to reduce or reverse the effects of
cachexia. See, e.g., Op den Kamp C, Langen R, Haegens A, Schols A.
"Muscle atrophy in cachexia: can dietary protein tip the balance?"
Current Opinion in Clinical Nutrition and Metabolic Care 2009,
12:611-616; Poon RT-P, Yu W-C, Fan S-T, et al. "Long-term oral
branched chain amino acids in patients undergoing chemoembolization
for hepatocellular carcinoma: a randomized trial." Aliment
Pharmacol Ther 2004; 19:779 788; Tayek J A, Bistrian B R, Hehir D
J, Martin R, Mokldawer L L, Blackburn G L. "Improved protein
kinetics and albumin synthesis by branched chain amino
acid-enriched total parenteral nutrition in cancer cachexia."
Cancer. 1986; 58:147-57; Xi P, Jiang Z, Zheng C, Lin Y, Wu G
"Regulation of protein metabolism by glutamine: implications for
nutrition and health." Front Biosci. 2011 Jan. 1; 16:578-97.
[0602] Accordingly, also provided herein are methods of treating
cachexia in a subject. In some embodiments a sufficient amount of a
protein of this disclosure, a composition of this disclosure, or a
composition made by a method of this disclosure for a subject with
cachexia is an amount such that the amount of protein of this
disclosure ingested by the person meets or exceeds the metabolic
needs (which are often elevated). A protein intake of 1.5 g/kg of
body weight per day or 15-20% of total caloric intake appears to be
an appropriate target for persons with cachexia. In some
embodiments all of the protein consumed by the subject is a protein
according to this disclosure. In some embodiments protein according
to this disclosure is combined with other sources of protein and/or
free amino acids to provide the total protein intake of the
subject. In some embodiments the subject is at least one of
elderly, critically-medically ill, and suffering from
protein-energy malnutrition. In some embodiments the subject
suffers from a disease that makes exercise difficult and therefore
causes muscular deterioration, such as chronic obstructive
pulmonary disease, chronic heart failure, HIV, cancer, and other
disease states. In some embodiments, the protein according to
disclosure, the composition according to disclosure, or the
composition made by a method according to disclosure is consumed by
the subject in coordination with performance of exercise. In some
embodiments, the protein according to this disclosure, the
composition according to disclosure, or the composition made by a
method according to disclosure is consumed by the subject by an
oral, enteral, or parenteral route.
[0603] Sarcopenia is the degenerative loss of skeletal muscle mass
(typically 0.5-1% loss per year after the age of 25), quality, and
strength associated with aging. Sarcopenia is a component of the
frailty syndrome. The European Working Group on Sarcopenia in Older
People (EWGSOP) has developed a practical clinical definition and
consensus diagnostic criteria for age-related sarcopenia. For the
diagnosis of sarcopenia, the working group has proposed using the
presence of both low muscle mass and low muscle function (strength
or performance). Sarcopenia is characterized first by a muscle
atrophy (a decrease in the size of the muscle), along with a
reduction in muscle tissue "quality," caused by such factors as
replacement of muscle fibres with fat, an increase in fibrosis,
changes in muscle metabolism, oxidative stress, and degeneration of
the neuromuscular junction. Combined, these changes lead to
progressive loss of muscle function and eventually to frailty.
Frailty is a common geriatric syndrome that embodies an elevated
risk of catastrophic declines in health and function among older
adults. Contributors to frailty can include sarcopenia,
osteoporosis, and muscle weakness. Muscle weakness, also known as
muscle fatigue, (or "lack of strength") refers to the inability to
exert force with one's skeletal muscles. Weakness often follows
muscle atrophy and a decrease in activity, such as after a long
bout of bedrest as a result of an illness. There is also a gradual
onset of muscle weakness as a result of sarcopenia.
[0604] The proteins of this disclosure are useful for treating
sarcopenia or frailty once it develops in a subject or for
preventing the onset of sarcopenia or frailty in a subject who is a
member of an at risk groups. In some embodiments all of the protein
consumed by the subject is a protein according to this disclosure.
In some embodiments protein according to this disclosure is
combined with other sources of protein and/or free amino acids to
provide the total protein intake of the subject. In some
embodiments the subject is at least one of elderly,
critically-medically ill, and suffering from protein-energy
malnutrition. In some embodiments, the protein according to
disclosure, the composition according to disclosure, or the
composition made by a method according to disclosure is consumed by
the subject in coordination with performance of exercise. In some
embodiments, the protein according to this disclosure, the
composition according to disclosure, or the composition made by a
method according to disclosure is consumed by the subject by an
oral, enteral, or parenteral route.
[0605] Obesity is a multifactoral disorder associated with a host
of comorbidities including hypertension, type 2 diabetes,
dyslipidemia, coronary heart disease, stroke, cancer (eg,
endometrial, breast, and colon), osteoarthritis, sleep apnea, and
respiratory problems. The incidence of obesity, defined as a body
mass index >30 kg/m2, has increased dramatically in the United
States, from 15% (1976-1980) to 33% (2003-2004), and it continues
to grow. Although the mechanisms contributing to obesity are
complex and involve the interplay of behavioral components with
hormonal, genetic, and metabolic processes, obesity is largely
viewed as a lifestyle-dependent condition with 2 primary causes:
excessive energy intake and insufficient physical activity. With
respect to energy intake, there is evidence that modestly
increasing the proportion of protein in the diet, while controlling
total energy intake, may improve body composition, facilitate fat
loss, and improve body weight maintenance after weight loss.
Positive outcomes associated with increased dietary protein are
thought to be due primarily to lower energy intake associated with
increased satiety, reduced energy efficiency and/or increased
thermogenesis, positive effects on body composition (specifically
lean muscle mass), and enhanced glycemic control.
[0606] Dietary proteins are more effective in increasing
post-prandial energy expenditure than isocaloric intakes of
carbohydrates or fat (see, e.g., Dauncey M, Bingham S. "Dependence
of 24 h energy expenditure in man on composition of the nutrient
intake." Br J Nutr 1983, 50: 1-13; Karst H et al. "Diet-induced
thermogenesis in man: thermic effects of single proteins,
carbohydrates and fats depending on their energy amount." Ann Nutr
Metab. 1984, 28: 245-52; Tappy L et al "Thermic effect of infused
amino acids in healthy humans and in subjects with insulin
resistance." Am J Clin Nutr 1993, 57 (6): 912-6). This property
along with other properties (satiety induction: preservation of
lean body mass) make protein an attractive component of diets
directed at weight management. The increase in energy expenditure
caused by such diets may in part be due to the fact that the energy
cost of digesting and metabolizing protein is higher than for other
calorie sources. Protein turnover, including protein synthesis, is
an energy consuming process. In addition, high protein diets may
also up-regulate uncoupling protein in liver and brown adipose,
which is positively correlated with increases in energy
expenditure. It has been theorized that different proteins may have
unique effects on energy expenditure.
[0607] Studies suggest that ingestion of protein, particularly
proteins with high EAA and/or BCAA content, leads to distinct
effects on thermogenesis and energy expenditure (see, e.g.,
Mikkelsen P. et al. "Effect of fat-reduced diets on 24 h energy
expenditure: comparisons between animal protein, vegetable protein
and carbohydrate." Am J Clin Nutr 2000, 72:1135-41; Acheson K. et
al. "Protein choices targeting thermogenesis and metabolism." Am J
Clin Nutr 2011, 93:525-34; Alfenas R. et al. "Effects of protein
quality on appetite and energy metabolism in normal weight
subjects" Arg Bras Endocrinol Metabol 2010, 54 (1): 45-51; Lorenzen
J. et al. "The effect of milk proteins on appetite regulation and
diet-induced thermogenesis." J Clin Nutr 2012 66 (5): 622-7).
Additionally, L-tyrosine has been identified as an amino acid that
plays a role in thermogenesis (see, e.g., Belza A. et al. "The
beta-adrenergic antagonist propranolol partly abolishes thermogenic
response to bioactive food ingredients." Metabolism 2009, 58
(8):1137-44). Further studies suggest that Leucine and Arginine
supplementation appear to alter energy metabolism by directing
substrate to lean body mass rather than adipose tissue (Dulloo A.
"The search for compounds that stimulate thermogenesis in obesity
management: from pharmaceuticals to functional food ingredients."
Obes Rev 2011 12: 866-83).
[0608] Collectively the literature suggests that different protein
types leads to distinct effects on thermogenesis. Because proteins
or peptides rich in EAAs, BCAA, and/or at least one of Tyr, Arg,
and Leu are believed to have a stimulatory effect on thermogenesis,
and because stimulation of thermogenesis is believed to lead to
positive effects on weight management, this disclosure also
provides products and methods useful to stimulation thermogenesis
and/or to bring about positive effects on weight management in
general.
[0609] More particularly, this disclosure provides methods of
increasing thermogenesis in a subject. In some embodiments the
methods comprise providing to the subject a sufficient amount of a
protein of this disclosure, a composition of this disclosure, or a
composition made by a method of this disclosure. In some
embodiments the subject is obese. In some embodiments, the protein
according to disclosure, the composition according to disclosure,
or the composition made by a method according to disclosure is
consumed by the subject in coordination with performance of
exercise. In some embodiments, the protein according to disclosure,
the composition according to disclosure, or the composition made by
a method according to disclosure is consumed by the subject by an
oral, enteral, or parenteral route.
[0610] At the basic level, the reason for the development of an
overweight condition is due to an imbalance between energy intake
and energy expenditure. Attempts to reduce food at any particular
occasion (satiation) and across eating occasions (satiety) have
been a major focus of recent research. Reduced caloric intake as a
consequence of feeling satisfied during a meal and feeling full
after a meal results from a complex interaction of internal and
external signals. Various nutritional studies have demonstrated
that variation in food properties such as energy density, content,
texture and taste influence both satiation and satiety.
[0611] There are three macronutrients that deliver energy: fat,
carbohydrates and proteins. A gram of protein or carbohydrate
provides 4 calories while a gram of fat 9 calories. Protein
generally increases satiety to a greater extent than carbohydrates
or fat and therefore may facilitate a reduction in calorie intake.
However, there is considerable evidence that indicates the type of
protein matters in inducing satiety (see, e.g., W. L. Hall, et al.
"Casein and whey exert different effects on plasma amino acid
profiles, gastrointestinal hormone secretion and appetite." Br J
Nutr. 2003 February, 89(2):239-48; R. Abou-Samra, et al. "Effect of
different protein sources on satiation and short-term satiety when
consumed as a starter." Nutr J. 2011 Dec. 23, 10:139; T. Akhavan,
et al. "Effect of premeal consumption of whey protein and its
hydrolysate on food intake and postmeal glycemia and insulin
responses in young adults." Am J Clin Nutr. 2010 April
91(4):966-75. Epub 2010 Feb. 17; MA Veldhorst "Dose-dependent
satiating effect of whey relative to casein or soy" Physiol Behav.
2009 Mar. 23, 96(4-5):675-82). Evidence indicates that protein rich
in Leucine is particularly effective at inducing satiety (see,
e.g., Fromentin G et al "Peripheral and central mechanisms involved
in the control of food intake by dietary amino acids and proteins."
Nutr Res Rev 2012 25: 29-39).
[0612] In some embodiments a protein of this disclosure is consumed
by a subject concurrently with at least one pharmaceutical or
biologic drug product. In some embodiments the beneficial effects
of the protein and the at least one pharmaceutical or biologic drug
product have an additive effect while in some embodiments the
beneficial effects of the protein and the at least one
pharmaceutical or biologic drug product have a synergistic effect.
Examples of pharmaceutical or biologic drug products that can be
administered with the proteins of this disclosure are well known in
the art. For example, when a protein of this disclosure is used to
maintain or increase at least one of muscle mass, muscle strength,
and functional performance in a subject, the protein can be
consumed by a subject concurrently with a therapeutic dosage regime
of at least one pharmaceutical or biologic drug product indicated
to maintain or increase at least one of muscle mass, muscle
strength, and functional performance in a subject, such as an
anabolic steroid. When a protein of this disclosure is used to
maintain or achieve a desirable body mass index in a subject, the
protein can be consumed by a subject concurrently with a
therapeutic dosage regime of at least one pharmaceutical or
biologic drug product indicated to maintain or achieve a desirable
body mass index in a subject, such as orlistat, lorcaserin,
sibutramine, rimonabant, metformin, exenatide, or pramlintide. When
a protein of this disclosure is used to induce at least one of a
satiation response and a satiety response in a subject, the protein
can be consumed by a subject concurrently with a therapeutic dosage
regime of at least one pharmaceutical or biologic drug product
indicated to induce at least one of a satiation response and a
satiety response in a subject, such as rimonabant, exenatide, or
pramlintide. When a protein of this disclosure is used to treat at
least one of cachexia, sarcopenia and frailty in a subject, the
protein can be consumed by a subject concurrently with a
therapeutic dosage regime of at least one pharmaceutical or
biologic drug product indicated to treat at least one of cachexia,
sarcopenia and frailty, such as omega-3 fatty acids or anabolic
steroids. Because of the role of dietary protein in inducing
satiation and satiety, the proteins and compositions disclosed
herein can be used to induce at least one of a satiation response
and a satiety response in a subject. In some embodiments the
methods comprise providing to the subject a sufficient amount of a
protein of this disclosure, a composition of this disclosure, or a
composition made by a method of this disclosure. In some
embodiments the subject is obese. In some embodiments, the protein
according to disclosure, the composition according to disclosure,
or the composition made by a method according to disclosure is
consumed by the subject in coordination with performance of
exercise. In some embodiments, the protein according to disclosure,
the composition according to disclosure, or the composition made by
a method according to disclosure is consumed by the subject by an
oral, enteral, or parenteral route.
[0613] In some embodiments incorporating a least one protein or
composition of this disclosure into the diet of a subject has at
least one effect selected from inducing postprandial satiety
(including by suppressing hunger), inducing thermogenesis, reducing
glycemic response, positively affecting energy expenditure
positively affecting lean body mass, reducing the weight gain
caused by overeating, and decreasing energy intake. In some
embodiments incorporating a least one protein or composition of
this disclosure into the diet of a subject has at least one effect
selected from increasing loss of body fat, reducing lean tissue
loss, improving lipid profile, and improving glucose tolerance and
insulin sensitivity in the subject.
[0614] Examples of the techniques and protocols described herein
can be found in Remington's Pharmaceutical Sciences, 16th edition.
Osol, A. (ed). 1980.
EXAMPLES
[0615] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way. Efforts have been made to ensure
accuracy with respect to numbers used (e.g., amounts, temperatures,
etc.), but some experimental error and deviation should, of course,
be allowed for.
[0616] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of protein chemistry,
biochemistry, recombinant DNA techniques and pharmacology, within
the skill of the art. Such techniques are explained fully in the
literature. See, e.g., T. E. Creighton, Proteins: Structures and
Molecular Properties (W.H. Freeman and Company, 1993); A. L.
Lehninger, Biochemistry (Worth Publishers, Inc., current addition);
Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd
Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan
eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Carey
and Sundberg Advanced Organic Chemistry 3.sup.rd Ed. (Plenum Press)
Vols A and B(1992).
Example 1
Identification and Selection of Amino Acid Sequences of Nutritive
Polypeptides of Edible Species Using Mass Spectrometric
Analyses
[0617] Provided is a process for identifying one or a plurality of
nutritive polypeptide amino acid sequences, such as from a
polypeptide or nucleic acid library, or from a relevant database of
protein sequences. Here, nutritive polypeptide amino acid sequences
were identified by mass spectroscopy analysis of proteins extracted
and purified from edible species.
[0618] Protein Isolation for Mass Spectroscopy.
[0619] Proteins were extracted from solid edible sources. Samples
from the following species were included in the analysis: Actinidia
deliciosa, Agaricus bisporus var. bisporus, Arthrospira platensis,
Bos taurus, Brassica oleracea, Cannabis, Chenopodium quinoa,
Chlorella regularis, Chlorella variabilis, Cicer arietinum,
Cucurbita maxima, Fusarium graminearum, Gadus morhua, Gallus
gallus, Glycine Max, Lactobacillus acidophilus, Laminariales, Linum
usitatissimum, Meleagris gallopavo, Odocoileus virginianus,
Oreochromis niloticus, Oryza sativa, Ovis aries, Palmaria palmnata,
Persea americana, Prunus mume, Saccharomyces cerevisiae, Salmo
salar, Solanum lycopesicum, Solanum tuberosum, Sus scrofa, Thunnus
thymus, Vaccinium corymbosum, Vitis vinifera, and Zea mays. Each
sample was first frozen at -80 C and then ground using a mortar and
pestle before weighing 50 mg of material into a microcentrifuge
tube. The 50 mg sample was then resuspended in 1 mL of extraction
buffer (8.3 M urea, 2 M thiourea, 2% w/v CHAPS, 1% w/v DTT) and
agitated for 30 minutes. Addition of 500 .mu.L of 100-.mu.m
zirconium beads (Ops Diagnostics) was followed by continued
agitation for an additional 30 minutes. Samples were run on a
TissueLyser II (Qiagen) at 30 Hz for 3 minutes and then centrifuged
for 10 minutes at 21.130 g in a benchtop microcentrifuge
(Eppendorf). Supernatants were transferred to clean microcentrifuge
tubes, aliquoted into 50 .mu.L aliquots, and stored at -80.degree.
C. The amount of soluble protein extracted was measured by
Coomassie Plus (Bradford) Protein Assay (Thermo Scientific). 20 ug
of protein was run on 10% 10-lane BisTris SDS-PAGE gel (Invitrogen)
and then excised for analysis by LC/MS/MS.
[0620] Proteins were also isolated from liquid cultures of the
following edible organisms: Aspergillus niger, Bacillus subtilis,
Bacillus licheniformis, and Bacillus amyloliquefaciens. Aspergillus
and bacillus organisms were cultured as described herein. Clarified
supernatants were isolated by centrifuging (10,000.times.g)
cultures for 10 minutes, followed by filtering the supernatant
using a 0.2 .mu.M filter. The amount of soluble protein in the
clarified supernatant was measured by Coomassie Plus (Bradford)
Protein Assay (Thermo Scientific). Protein samples (20 .mu.g) were
run on a 10% Precast BisTris SDS-PAGE gel (Invitrogen) according to
the manufacturer's protocol.
[0621] Mass Spectroscopy.
[0622] For LC/MS/MS analysis each gel was excised into five equally
sized pieces. Trypsin digestion was performed using a robot
(ProGest, DigiLab) with the following protocol: washed with 25 mM
ammonium bicarbonate followed by acetonitrile, reduced with 10 mM
dithiothreitol at 60.degree. C. followed by alkylation with 50 mM
iodoacetamide at RT, digested with trypsin (Promega) at 37.degree.
C. for 4 h, quenched with formic acid and the supernatant was
analyzed directly without further processing. The gel digests for
each sample were pooled and analyzed by nano LC/MS/MS with a Waters
NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive.
Peptides were loaded on a trapping column and eluted over a 75
.mu.m analytical column at 350 nL/min; both columns were packed
with Jupiter Proteco resin (Phenomenex). The mass spectrometer was
operated in data-dependent mode, with MS and MS/MS performed in the
Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively.
The fifteen most abundant ions were selected for MS/MS. Resulting
data were searched against a Uniprot and/or NCBI protein database
from the corresponding organism using Mascot with the following
parameters: Enzyme--Trypsin/P, Fixed modification--Carbamidomethyl
(C) Variable modifications--Oxidation (M), Acetyl (Protein N-term).
Pyro-Glu (N-term Q). Deamidation (NQ). Mass values--Monoisotopic,
Peptide Mass Tolerance--10 ppm, Fragment Mass Tolerance--0.015 Da,
Max Missed Cleavages--2. Mascot DAT files were parsed into the
Scaflold software for validation, filtering and to create a
non-redundant list per sample. Data were filtered using a minimum
protein value of 90%, a minimum peptide value of 50% (Prophet
scores) and requiring at least two unique peptides per protein.
Relative abundance of detected proteins was determined by spectral
counts, which is the number of spectra acquired for each protein.
Spectral counting is a label-free quantification method commonly
used by the protein mass spec field (Liu, Hongbin et al. Analytical
chemistry 76.14 (2004): 4193-4201). To calculate the relative
abundance of each protein in the protein isolate the number of
protein spectral counts is divided by the total protein spectral
counts. SEQID 894-3415 were identified using this method.
[0623] Homolog Discovery.
[0624] For the nutritive polypeptide sequences identified, as
described, similar sequences are identified from other species,
SEQID-00093, which was identified by this method, was used to
search for homologs using the computer program BLAST as described
herein. Example nutritive polypeptide homologs from the edible
database identified in this way are shown in table E1A. Example
nutritive polypeptide homologous from the expressed sequence
database identified in this way are shown in table EIB.
TABLE-US-00004 TABLE E1A Edible Sequences identified as homologs to
SEQID-00093. SEQID EAA Percent ID to SEQID-00093 SEQID-00094 0.45
98.8 SEQID-00092 0.42 89.9 SEQID-00075 0.46 67.9 SEQID-00072 0.46
67.3 SEQID-03712 0.46 66.0 SEQID-03763 0.44 50.3 SEQID-03708 0.45
51.6 SEQID-03798 0.46 51.6 SEQID-03860 0.45 50.9 SEQID-03651 0.46
50.9
TABLE-US-00005 TABLE E1B Expressed Sequences identified as homologs
to SEQID-00093 SEQID EAA Percent ID to SEQID-00093 SEQID-00074 0.42
91.2 SEQID-00092 0.42 89.9 SEQID-00075 0.46 66.9 SEQID-00078 0.46
65 SEQID-00106 0.46 50.3 SEQID-00104 0.45 50.3 SEQID-00864 0.45
50.3 SEQID-00870 0.45 43.8 SEQID-00867 0.47 44.5 SEQID-00105 0.44
41.1 SEQID-00103 0.45 40.5 SEQID-00866 0.40 39.8
Example 2
Identification and Selection of Amino Acid Sequences of Nutritive
Polypeptides of Edible Species Using cDNA Libraries
[0625] Here, nutritive polypeptide amino acid sequences were
identified by analysis of proteins produced from nucleic acid
sequences extracted and purified from edible species.
[0626] Construction of cDNA Library.
[0627] A library of cDNA from twelve edible species was
constructed. The twelve edible species were divided into five
categories for RNA extraction. Animal tissues including ground
beef, pork, lamb, chicken, turkey, and a portion of tilapia was
combined with 50 mg from each edible species. Fruit tissues from
grape and tomato including both the skin and the fruit were
grounded and combined with 2.5 g from each species. Seeds of rice
and soybean were combined with 1 g from each species and grounded
into powder. 12 ml of Saccharomyces cerevisiae were grown overnight
and spun down to obtain 110 mg of wet cell weight of yeast. 1 g of
mushroom mycelium was grounded and processed using fungi RNA
extraction protocols. All five categories of samples were snap
frozen with liquid nitrogen, thawed and lysed using
category-specific RNA extract protocols. The RNA from different
food categories was extracted and combined as one pooled sample.
The combined pool of RNA was reverse transcribed into cDNA using
oligo-dT as primers resulting in cDNA of length between 500 bp to 4
kb. Adaptors were ligated to each end of the cDNA and used as PCR
primers for amplification of the cDNA library and also included Sfi
I restriction digestion sites for cloning the library into an
expression vector. The cDNA library was denatured and re-annealed
and the single-stranded DNA was selected using gel electrophoresis.
This process removed extra cDNA from highly abundant RNA species to
obtain a normalized cDNA library. The normalized cDNA library was
precipitated using ethanol precipitation before PCR amplification
and cloning into the expression vectors.
TABLE-US-00006 TABLE E2A Primer and adapter sequences flanking the
cDNA. SEQ Sequence Adapter ID (underlined: Sfi I site) 5' adapter
3910 CAGTGGTATCAACGCAGAGTGGCCAT TACGGCCAAGTTACGGG 3' adapter 3911
CAGTGGTATCAACGCAGAGTGGCCGA GGCGGCCTTTTTTTTTTTTTTT
[0628] Cloning of cDNA Library into E. coli for Protein
Expression.
[0629] The cDNA library was cloned into the pET15b backbone vector,
which was amplified with primers with overhangs that contain the
corresponding SfiI restriction sites (forward primer overhang:
TACGTGTATGKGCCGCCTCGGCC; reverse primer overhang:
TACGTGTATGGCCGTAATGG(CC), pET15b contains a pBR322 origin of
replication, lac-controlled T7 promoter, and a bla gene conferring
resistance to carbenicillin. Both the cDNA library and PCR
amplified backbone were cut with SfiI. PCR purified, and ligated.
The ligation reaction was transformed into 10-Beta High Efficiency
Competent Cells (New England Biolabs), and transformed cells were
plated onto four LB agar plates containing 100 mg/L carbenicillin.
Plates were incubated at 37.degree. C. overnight. After colonies
had grown, 2 mL of liquid LB medium was added to each plate. Cells
were scraped into the liquid and mixed together, and the suspension
was prepared for plasmid extraction to form the multiplex cDNA
plasmid library.
[0630] E. coli cDNA Multiplex Expression Methods.
[0631] Four strains were used to express the cDNA libraries: T7
Express from New England Biolabs: and Rosetta 2(DE3), Rosetta-gami
B(DE3), and Rosetta-gami 2(DE3) from EMD Millipore. T7 Express is
an enhanced BL21 derivative which contains the T7 RNA polymerase in
the lac operon, while lacking the Lon and OmpT proteases. The
genotype of T7 Express is: fhuA2 lacZ::T7 gene1 [Ion] ompT gal
sulA11 R(mcr-73::miniTn10-Tet.sup.S)2 [dcm]
R(zgb-210::Tn10-Tet.sup.S) endA1 .DELTA.(mcrC-mrr)114::IS10.
Rosetta 2(DE3) is a BL21 derivative that supplies tRNAs for 7 rare
codons (AGA. AGG, AUA. CUA. GGA, CCC, CGG). The strain is a lysogen
of .lamda.DE3, and carries the T7 RN4 polymerase gene under the
lacUV5 promoter. The genotype of Rosetta 2(DE3) is: F.sup.- ompT
hsdS.sub.B(r.sub.B.sup.-m.sub.B.sup.-) gal dcm (DE3) pRA4RE2
(Cam.sup.R). Rosetta-gami B(DE3) has the same properties as Rosetta
2(DE3) but includes characteristics that enhance the formation of
protein disulfide bonds in the cytoplasm. The genotype of
Rosetta-gami B(DE3) is F.sup.- ompT
hsdS.sub.B(r.sub.B.sup.-m.sub.B.sup.-) gal dcm lacY1 ahpC (DE3)
gor522:: Tn10 trxBpRARE (Cam.sup.R, Kan.sup.R. Tet.sup.R).
Rosetta-gami 2(DE3), similarly to Rosetta-gami B(DE3), alleviates
codon bias, enhances disulfide bond formation, and have the T7 RNA
polymerase gene under the lacUV5 promoter in the chromosome. The
genotype of Rosetta-gami 2(DE3) is .DELTA.(ara-leu)7697
.DELTA.lacX74 .DELTA.phoA PvuII phoR araD139 ahpC galE galK
rpsL(DE3) F'[lac.sup.+ lac.sup.q pro] gor522::Tn10 tirB pRARE2
(Cam.sup.R, Str.sup.R. Tet.sup.R)
[0632] Roughly 200 ng of prepared cDNA libraries were transformed
into the four background strains: T7 Express. Rosetta 2(DE3),
Rosetta-gami B(DE3), and Rosetta-gami 2(DE3) competent cells. After
transforming, 100 .mu.L of each strain was plated onto four LB (10
g/l NaCl, 10 g/l tryptone, and 5 g/l yeast extract) 1.5% agar
plates containing 100 mg/L carbenicillin and incubated at
37.degree. C. for 16 hrs. After incubation, 2 mL of LB media with
100 mg/L carbenicillin was added to the surface of each plate
containing several thousand transformants, and the cells were
suspended in the surface medium by scraping with a cell spreader
and mixing. Suspended cells from the four replicate plates from
each background were combined to form the pre-inoculum cultures for
the expression experiments.
[0633] The OD.sub.600 of the pre-inoculum cultures made from
re-suspended cells were measured using a plate reader to be between
35 and 40 (T7, Rosetta 2(DE3) or 15 and 20 (Rosetta-gami B(DE3) and
2(DE3)). For the four background strains, 125 mL baffled shake
flasks containing 10 mL of LB medium with 100 mg/L carbenicillin
were inoculated to OD.sub.600 0.2 to form the inoculum cultures,
and incubated at 37.degree. C. shaking at 250 rpm for roughly 6
hours. OD.sub.600 was measured and the inoculum cultures were used
to inoculate expression cultures in 2 L baffled shake flasks
containing 250 mL of BioSilta Enbase medium with 100 mg/L
carbenicillin, 600 mU/L of glucoamylase and 0.01% Antifoam 204 to
an OD.sub.600 of 0.1. Cultures were shaken at 30.degree. C. and 250
rpm for 18 hours, and were induced with 1 mM IPTG and supplemented
with additional EnBase media components and another 600 mU/L of
glucoamylase. Heterologous expression was carried out for 24 hours
at 30.degree. C. and 250 rpm, at which point the cultures were
terminated. The terminal cell density was measured and the cells
were harvested by centrifugation (5000.times.g, 10 min, RT). Cells
were stored at -80.degree. C. before being lysed with B-PER
(Pierce) according to the manufacturer's protocol. After cell
lysis, the whole cell lysate is sampled for analysis. In the
Rosetta (DE3) strain, the whole cell lysate is centrifuged
(3000.times.g, 10 min RT) and the supernatant is collect as the
soluble fraction of the lysate. Cell lysates were run on SDS-PAGE
gels, separated into ten fractions, and then analyzed using
MS-MS.
[0634] Cloning of cDNA Library into Bacillus for Protein
Secretion.
[0635] The cDNA library was cloned into the pHT43 vector for
protein secretion assay in Bacillus subtilis. The unmodified pHT43
vector from MoBiTec contains the Pgrac promoter, the SamyQ signal
peptide, Amp and Cm resistance genes, a lad region, a repA region,
and the ColE1 origin of replication. The SamyQ signal peptide was
removed. The pHT43 backbone vector with no signal peptide as well
as a modified version with the aprE promoter substituted for the
grac promoter and with the lacI region removed were amplified with
primers with overhangs that contain the corresponding SfiI
restriction sites (forward primer overhang: TACGTGTATGGCCGCCTCGGCC;
reverse primer overhang: TACGTGTATGGCCGTAATGGCC). Both the cDNA
library and the two PCR amplified backbones were cut with SfiI and
PCR purified. The cDNA library inserts were ligated into each
background. The ligation reactions were transformed into 10-Beta
High Efficiency Competent Cells (New England Biolabs), and cells
from each ligation were plated onto four LB agar plates containing
100 mg/L carbenicillin. Plates were incubated at 37.degree. C.
overnight. After colonies had grown, 2 mL of liquid LB medium was
added to each plate. For each ligation, cells were scraped into the
liquid and mixed together, and the suspensions were prepped for
plasmid extraction to form the multiplex cDNA plasmid libraries
(henceforth referred to as the multiplex (Grac-cDNA and AprE-cDNA
libraries).
[0636] The expression strains used in this expression experiment
are based off of the WB800N strain (MoBiTec). The WB800N strain has
the following genotype: nprE aprE epr bpr mpr::ble nprB::bsr vpr
wprA::hyg cm::neo; NeoR. Strain cDNA-1 contains a mutation that
synergizes with the paprE promoter and has these alterations in
addition to the WB800N genotype: pXy1A-comK::Erm, degU32(Hy),
sigF::Str. Strain cDNA-2 has these alterations to WB800N:
pXy1A-conK::Erm.
[0637] Roughly 1 .mu.g of the multiplex Grac-cDNA library was
transformed into both Strain cDNA-1 and Strain cDNA-2, and 1 .mu.g
of the multiplex AprE-cDNA library was transformed into Strain
cDNA-1. After transforming, 100 .mu.L of each strain was plated
onto four LB (10 g/l NaCl, 10 g/l tryptone, and 5 g/l yeast
extract) 1.5% agar plates containing 5 mg/L chloramphenicol and
incubated at 37.degree. C. for 16 hrs. After incubation, 2 mL of LB
media with 5 mg/L chloramphenicol was added to the surface of each
plate containing several thousand transformants, and the cells were
suspended in the surface medium by scraping with a cell spreader
and mixing. Suspended cells from the four replicate plates from
each transformation were combined to form the preinoculum cultures
for the expression experiments.
[0638] The OD.sub.600 of the preinoculum cultures made from
resuspended cells were measured using a plate reader to be roughly
20-25. For the three strains (strain cDNA-1+ multiplex Grac-cDNA,
strain cDNA-1+ multiplex AprE-cDNA, strain cDNA-2+ Grac-cDNA), 500
nL baffled shake flasks containing 50 mL of 2.times. Mal medium (20
g/L NaCl, 20 g/L Tryptone, 10 g/L yeast extract, 75 .mu.L
D-Maltose) with 5 mg/L chloramphenicol were inoculated to
OD.sub.600.apprxeq.0.2 to form the inoculum cultures, and incubated
at 30.degree. C. shaking at 250 rpm for roughly 6 hours. OD.sub.600
was measured and the inoculum cultures were used to inoculate
expression cultures in 2 L baffled shake flasks containing 2.times.
Mal medium with 5 mg/L chloramphenicol, 1.times. Teknova Trace
Metals, and 0.01% Antifoam 204 to an OD.sub.600 of 0.1. The strain
cDNA-1+ multiplex AprE cDNA culture was shaken for 30.degree. C.
and 250 rpm for 18 hours, at which point the culture was harvested.
The terminal cell density was measured and the cells were harvested
by centrifugation (5000.times.g, 30 min, RT). The strain cDNA-1+
multiplex Grac-cDNA and strain cDNA-2+ multiplex Grac-cDNA cultures
were shaken at 37.degree. C. and 250 rpm for 4 hours, and were
induced with 1 mM IPTG. Heterologous expression was carried out for
4 hours at 37.degree. C. and 250 rpm, at which point the cultures
were harvested. Again, the terminal cell density was measured and
the cells were harvested by centrifugation (5000.times.g, 30 min,
RT). The supernatant was collected and run on SDS-PAGE gels,
separated into ten fractions, and then analyzed using LC-MS/MS to
identify secreted proteins.
[0639] Mass Spectrometry Analysis.
[0640] Whole cell lysate and soluble lysate samples were analyzed
for protein expression using LC-MS/MS. To analyze samples, 10 .mu.g
of sample was loaded onto a 10% SDS-PAGE gel (Invitrogen) and
separated approximately 5 cm. The gel was excised into ten segments
and the gel slices were processed by washing with 25 mM ammonium
bicarbonate, followed by acetonitrile. Gel slices were then reduced
with 10 mM dithiothreitol at 60.degree. C., followed by alkylation
with 50 mM iodoacetamide at room temperature. Finally, the samples
were digested with trypsin (Promega) at 37.degree. C. for 4 h and
the digestions were quenched with the addition of formic acid. The
supernatant samples were then analyzed by nano LC/MS/MS with a
Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q
Exactive. Peptides were loaded on a trapping column and eluted over
a 75 .mu.m analytical column at 350 nL/min; both columns were
packed with Jupiter Proteo resin (Phenomenex). A 1 h gradient was
employed. The mass spectrometer was operated in data-dependent
mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM
resolution and 17,500 FWHM resolution, respectively. The fifteen
most abundant ions were selected for MS/MS. Data were searched
against a database using Mascot to identify peptides. The database
was constructed by combining the complete proteome sequences from
all twelve species including Bos taurus, Gallus gallus, Vitis
vinifera, Ovis aries, Sus scrofa, Oryza sativa, Glycine max,
Oreochromis niloticus, Solanum lycopesicum, Agaricus bisporus var
bisporus. Saccharomyces cerevisiae, and Meleagris gallopavo. Mascot
DAT files were parsed into the Scaffold software for validation,
filtering and to create a nonredundant list per sample. Data were
filtered at 1% protein and peptide false discovery rate (FDR) and
requiring at least two unique peptides per protein.
[0641] Expressed proteins identified. Mass spectrometry analysis
identified a total of 125 proteins across expression strains.
Spectrum counts, which are related to the protein abundance, are
reported to confirm protein expression or secretion. Fifty three
proteins were identified in whole cell lysate of the Rosetta (DE3)
strain, 46 in the soluble fraction of the Rosetta (DE3) strain, 36
in Rosetta-Gami B (DE3), 10 in Rosetta-Gami 2 (DE3), and 15 in the
secreted supernatant of Bacillus subtilis.
[0642] The nutritive polypeptides detected in the secreted
supernatant of Bacillus subtilis are SEQID-00718, SEQID-00762,
SEQID-00763, SEQID-00764, SEQID-00765, SEQID-00766, SEQID-00767,
SEQID-00768, SEQID-00769, SEQID-00770, SEQID-00771, SEQID-00772,
SEQID-00773, SEQID-00774, SEQID-00775.
[0643] The nutritive polypeptides detected in the whole cell lysate
of the E. coli Rosetta (DE3) strain are SEQID-00716, SEQID-00718,
SEQID-00720, SEQID-00723, SEQID-00724, SEQID-00725, SEQID-00729,
SEQID-00732, SEQID-00737, SEQID-00751, SEQID-00776, SEQID-00790,
SEQID-00797, SEQID-00798, SEQID-00799, SEQID-00800. SEQID-0080 I,
SEQID-00802, SEQID-00803, SEQID-00804, SEQID-00805, SEQID-00806,
SEQID-00807, SEQID-00808, SEQID-00809, SEQID-00810, SEQID-00811,
SEQID-00812, SEQID-00813, SEQID-00814, SEQID-00815, SEQID-00816,
SEQID-00817, SEQID-00818, SEQID-00819, SEQID-00820, SEQID-0082 I,
SEQID-00822, SEQID-00823, SEQID-00824, SEQID-00825, SEQID-00826,
SEQID-00827, SEQID-00828, SEQID-00829, SEQID-00830, SEQID-00831,
SEQID-00832, SEQID-00833, SEQID-00834, SEQID-00835, SEQID-00836.
SEQID-00837.
[0644] The nutritive polypeptides detected in the soluble lysate of
the E. coli Rosetta (DE3) strain are SEQID-00716, SEQID-00717,
SEQID-00718, SEQID-00719, SEQID-00720, SEQID-00721, SEQID-00722,
SEQID-00724, SEQID-00725. SEQID-00726, SEQID-00727, SEQID-00728,
SEQID-00729, SEQID-00730, SEQID-00731, SEQID-00732, SEQID-00733,
SEQID-00734, SEQID-00735, SEQID-00736, SEQID-00737, SEQID-00738,
SEQID-00739. SEQID-00740, SEQID-00741, SEQID-00742, SEQID-00743,
SEQID-00744, SEQID-00745. SEQID-00746, SEQID-00747, SEQID-00748,
SEQID-00749, SEQID-00750, SEQID-00751, SEQID-00752, SEQID-00753,
SEQID-00754, SEQID-00755, SEQID-00756, SEQID-00757, SEQID-00758,
SEQID-00759, SEQID-00760, SEQID-00761.
[0645] The nutritive polypeptides detected in the E. coli
Rosetta-Gami B (DE3) strain are SEQID-00003, SEQID-00004,
SEQID-00005, SEQID-00716, SEQID-00718, SEQID-00719. SEQID-00720,
SEQID-00729, SEQID-00730, SEQID-00731, SEQID-00732, SEQID-00734.
SEQID-00736, SEQID-00740, SEQID-00743, SEQID-00752, SEQID-00760,
SEQID-00763, SEQID-00764, SEQID-00776, SEQID-00777, SEQID-00778,
SEQID-00779, SEQID-00780, SEQID-00781, SEQID-00782, SEQID-00783,
SEQID-00784, SEQID-00785, SEQID-00786, SEQID-00787, SEQID-00788,
SEQID-00789, SEQID-00790, SEQID-00791, SEQID-00792.
[0646] The nutritive polypeptides detected in the E. coli
Rosetta-Gami 2 (DE3) strain are SEQID-00716, SEQID-00737,
SEQID-00747, SEQID-00763, SEQID-00789, SEQID-00790. SEQID-00793,
SEQID-00794, SEQID-00795, SEQID-00796.
Example 3
Identification and Selection of Amino Acid Sequences of Nutritive
Polypeptides of Edible Species Using Annotated Protein Sequence
Databases
[0647] Construction of Protein Databases. The UniProtKB/Swiss-Prot
(a collaboration between the European Bioinformatics Institute and
the Swiss Institute of Bioinformatics) is a manually curated and
reviewed protein database, and was used as the starting point for
constructing a protein database. To construct a protein database of
edible species, a search was performed on the UniProt database for
proteins from edible species as disclosed in. e.g.,
PCT/US2013/032232, filed Mar. 15, 2013, PCT/US2013/032180, filed
Mar. 15, 2013. PCT/US2013/032225, filed Mar. 15, 2013,
PCT/US2013/032218, filed Mar. 15, 2013, PCT/US2013/032212, filed
Mar. 15, 2013, and PCT/US2013/032206, filed Mar. 15, 2013. To
identify proteins that are secreted from microorganisms, the
UniProt database was searched for species from microorganisms as
disclosed herein and proteins that are annotated with keywords or
annotations that includes secreted, extracellular, cell wall, and
outer membrane. To identify proteins that are abundant in the human
diet, the reference proteomes of edible species were assembled from
genome databases. As provided herein, mass spectrometry was
performed on proteins extracted from each edible species. The
peptides identified by mass spectrometry were mapped to the
reference proteomes and the spectrum counts of the peptides
associated with the reference protein sequences were converted to a
measure for the abundance of the corresponding protein in food. All
proteins that were detected above a cutoff spectrum count with high
confidence were assembled into a database. These databases are used
for identifying proteins that are derived from edible species,
which are secreted, and/or are abundant in the human diet.
[0648] Processes for Selection of Amino Acid Sequences.
[0649] A process for picking a protein or group of proteins can
include identifying a set of constraints that define the class of
protein one is interested in finding, the database of proteins from
which to search, and performing the actual search.
[0650] The protein class criteria can be defined by nutritional
literature (i.e., what has been previously identified as
efficacious), desired physiochemical traits (e.g., expressible,
soluble, nonallergenic, nontoxic, digestible, etc), and other
characteristics. A relevant database of proteins that can be used
for searching purposes can be derived from the sequences disclosed
herein.
[0651] One example of proteins that can be searched is a highly
soluble class of proteins for muscle anabolism/immune
health/diabetes treatment. These proteins are generally solubly
expressible, highly soluble upon purification/isolation,
non-allergenic, non-toxic, fast digesting, and meet some basic
nutritional criteria (e.g., [EAA]>0.3, [BCAA]>0.15, [Leucine
or Glutamine or Arginine]>0.08, eaa complete).
[0652] A search is conducted for expressible, soluble proteins
using a binary classification model based on two parameters related
to the hydrophilicity and hydrophobicity of the protein sequence:
solvation score and aggregation score (see examples below for
various descriptions of these two metrics and measures of efficacy
of the model). Alternatively, a search can be conducted for highly
charged proteins with high (or low) net charge per amino acid,
which is indicative of a net excess of negative or positive charges
per amino acid (see example below for additional description).
[0653] The nutritional criteria are satisfied by computing the mass
fractions of all relevant amino acids based on primary sequence.
For cases in which it is desired to match a known, clinically
efficacious amino acid blend a weighted Euclidean distance method
can be used (see example below).
[0654] As provided herein,
allergenicity/toxicity/nonallergenicity/antinutrticity criteria are
searched for using sequence based homology assessments in which
each candidate sequence is compared to libraries of known
allergens, toxins, nonallergens, or antinutritive (e.g., protease
inhibitory) proteins (see examples herein). In general, cutoffs of
<50% global or <35% local (over any given 80aa window)
homology (percent ID) can be used for the allergenicity screens,
and <35% global for the toxicity and antinutricity screens. In
all cases, smaller implies less allergenic/toxic/antinutritive. The
nonallergenicity screen is less typically used as a cutoff, but
>62% as a cutoff can be used (greater implies is more
nonallergenic). These screens reduce the list to a smaller subset
of proteins enriched in the criteria of interest. This list is then
ranked using a variety of aggregate objective functions and
selections are made from this rank ordered list.
Example 4
Selection of Amino Acid Sequences to Demonstrate Amino Acid
Pharmacology of Nutritive Polypeptides
[0655] Identification of Proteins Enriched in Leucine and Essential
Amino Acids for the Treatment of Sarcopenia.
[0656] As described herein, sarcopenia is the degenerative loss of
skeletal muscle mass (typically 0.5-1% loss per year after the age
of 25), quality, and strength associated with aging. Sarcopenia is
characterized first by a muscle atrophy (a decrease in the size of
the muscle), along with a reduction in muscle tissue "quality,"
caused by such factors as replacement of muscle fibres with fat, an
increase in fibrosis, changes in muscle metabolism, oxidative
stress, and degeneration of the neuromuscular junction. Combined,
these changes lead to progressive loss of muscle function and
eventually to frailty. It has been shown that essential amino acid
supplementation in elderly, sarcopenia individuals can have an
anabolic and/or sparing effect on muscle mass. Furthermore, this
supplementation can also translate to improvements in patient
strength and muscle quality. See, e.g., Paddon-Jones D, et al. J
Clin Endocrinol Metab 2004, 89:4351-4358; Ferrando, A et al.
Clinical Nutrition 2009 1-6; Katsanos C et al. Am J Physiol
Endocrinol Metab. 2006, 291: 381-387. It has also been shown that
the essential amino acid leucine is a particularly important factor
in stimulating muscle protein synthesis. See, e.g., Borscheim E et
al. Am J Physiol Endocrinol Metab 2002, 283: E648-E657; Borsheim E
et al. Clin Nutr. 2008, 27: 189-95; Esmarck B et al J Physiol 2001,
535: 301-311; Moore D et al. Am J Clin Nutr 2009, 89: 161-8). One
can identify beneficial nutritive polypeptides for individuals that
suffer from sarcopenia by selecting proteins that are enriched by
mass in leucine and the other essential amino acids.
[0657] Using a database of all protein sequences derived from
edible species as described herein, candidate sequences that are
enriched in leucine (.gtoreq.15% by mass) and essential amino acids
(.gtoreq.40% by mass) were identified and rank ordered by their
total leucine plus essential amino acid mass relative to total
amino acid mass. In order to increase the probability that these
proteins are solubly expressed, as well as highly soluble at pH 7
with reduced aggregation propensity, solvation score and
aggregation score upper bounds of -20 kcal/mol/AA and 0.5 were
applied. In order to reduce the likelihood that these proteins
would elicit an allergenic response, upper bounds of 50% and 35%
were set for the global allergen homology and allergenicity scores,
respectively. In order to reduce the likelihood that these proteins
would have toxic effects upon ingestion, an upper bound of 35% was
set for the toxicity score. In order to reduce the likelihood that
these proteins would act as inhibitors of digestive proteases, an
upper bound of 35% was set for the anti-nutricity score.
[0658] An exemplary list of the top 10 nutritive polypeptide
sequences that are enriched in leucine (>15% by mass) and
essential amino acids (?40% by mass), and meet the afore mentioned
cutoffs in solvation score, aggregation score, global allergen
homology, allergenicity score, toxicity score, and anti-nutricity
score is shown in Table E4A.
TABLE-US-00007 TABLE E4A SEQID EAA L SEQID-03552 0.56 0.21
SEQID-03581 0.60 0.15 SEQID-03532 0.58 0.16 SEQID-03475 0.56 0.17
SEQID-03499 0.58 0.15 SEQID-03494 0.54 0.18 SEQID-03460 0.54 0.17
SEQID-03485 0.54 0.16 SEQID-03513 0.54 0.15 SEQID-03491 0.52
0.17
[0659] An exemplary list of the top 10 nutritive polypeptide
sequences from the expressed protein database that are enriched in
leucine (.gtoreq.15% by mass) and essential amino acids
(.gtoreq.40% by mass) is shown in Table E4B.
TABLE-US-00008 TABLE E4B SEQID EAA L SEQID-00162 0.64 0.34
SEQID-00132 0.60 0.32 SEQID-00166 0.65 0.26 SEQID-00169 0.60 0.25
SEQID-00137 0.64 0.20 SEQID-00134 0.58 0.24 SEQID-00175 0.63 0.19
SEQID-00194 0.54 0.26 SEQID-00193 0.53 0.26 SEQID-00195 0.52
0.26
Example 5
Selection of Amino Acid Sequences of Nutritive Polypeptides
Enriched in Essential Amino Acids and Enriched or Reduced in
Various Individual Amino Acids of Interest
[0660] Using a database of all protein sequences derived from
edible species as described herein, candidate sequences enriched in
essential amino acids with elevated or reduced amounts of each
amino acid were identified. In order to increase the probability
that these proteins would be solubly expressed, as well as highly
soluble at pH 7 with reduced aggregation propensity, solvation
score and aggregation score upper bounds of -20 kcal/mol/AA and 0.5
were applied. In order to reduce the likelihood that these proteins
would elicit an allergenic response, upper bounds of 50% and 35%
were set for the global allergen homology and allergenicity scores,
respectively. In order to reduce the likelihood that these proteins
would have toxic effects upon ingestion, an upper bound of 35% was
set for the toxicity score. In order to reduce the likelihood that
these proteins would act as inhibitors of digestive proteases, an
upper bound of 35% was set for the anti-nutricity score. When
searching for proteins enriched or reduced in a given amino acid,
the cutoffs described above were applied, and proteins were rank
ordered by their calculated amino acid mass fraction of the desired
amino acid and then by their essential amino acid content.
[0661] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in alanine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in Table E5A. The top 10 nutritive polypeptide sequences
reduced in alanine are shown in Table E5B.
TABLE-US-00009 TABLE E5A SEQID EAA A SEQID-03678 0.46 0.18
SEQID-03682 0.44 0.18 SEQID-03646 0.46 0.18 SEQID-03653 0.39 0.16
SEQID-03717 0.38 0.16 SEQID-03686 0.41 0.15 SEQID-03807 0.46 0.15
SEQID-03864 0.44 0.15 SEQID-03663 0.35 0.15 SEQID-03777 0.46
0.14
TABLE-US-00010 TABLE E5B SEQID EAA A SEQID-03874 0.62 0.00
SEQID-03552 0.56 0.00 SEQID-03880 0.52 0.00 SEQID-03673 0.52 0.00
SEQID-03667 0.50 0.00 SEQID-03657 0.50 0.00 SEQID-03842 0.49 0.00
SEQID-03623 0.49 0.00 SEQID-03817 0.48 0.00 SEQID-03875 0.48
0.00
[0662] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in arginine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table ESC. The top 10 nutritive polypeptide sequences
reduced in arginine are shown in Table E5D.
TABLE-US-00011 TABLE E5C SEQID EAA R SEQID-03473 0.06 0.72
SEQID-03855 0.09 0.65 SEQID-03727 0.10 0.63 SEQID-03767 0.17 0.62
SEQID-03704 0.17 0.60 SEQID-03459 0.10 0.60 SEQID-03731 0.16 0.48
SEQID-03698 0.47 0.40 SEQID-03687 0.37 0.38 SEQID-03732 0.19
0.38
TABLE-US-00012 TABLE E5D SEQID EAA R SEQID-03744 0.60 0.00
SEQID-03770 0.56 0.00 SEQID-03880 0.52 0.00 SEQID-03736 0.49 0.00
SEQID-03706 0.49 0.00 SEQID-03881 0.49 0.00 SEQID-03668 0.49 0.00
SEQID-03733 0.46 0.00 SEQID-03764 0.46 0.00 SEQID-03832 0.44
0.00
[0663] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in asparagine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5E. The top 10 nutritive polypeptide sequences
reduced in asparagine are shown in table E5F.
TABLE-US-00013 TABLE E5E SEQID EAA N SEQID-03723 0.39 0.15
SEQID-03721 0.39 0.15 SEQID-03803 0.42 0.15 SEQID-03801 0.38 0.15
SEQID-03714 0.40 0.14 SEQID-03742 0.41 0.14 SEQID-03724 0.38 0.14
SEQID-03884 0.42 0.14 SEQID-03778 0.39 0.13 SEQID-03746 0.41
0.13
TABLE-US-00014 TABLE E5F SEQID EAA N SEQID-03874 0.62 0.00
SEQID-03793 0.59 0.00 SEQID-03789 0.57 0.00 SEQID-03869 0.57 0.00
SEQID-03809 0.57 0.00 SEQID-03662 0.56 0.00 SEQID-03850 0.55 0.00
SEQID-03783 0.55 0.00 SEQID-03753 0.54 0.00 SEQID-03677 0.53
0.00
[0664] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in aspartic acid that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5G. The top 10 nutritive polypeptide sequences
reduced in aspartic acid are shown in table E5H.
TABLE-US-00015 TABLE E5G SEQID EAA D SEQID-03630 0.33 0.28
SEQID-03425 0.34 0.26 SEQID-03564 0.33 0.25 SEQID-03543 0.34 0.25
SEQID-03607 0.32 0.24 SEQID-03621 0.35 0.23 SEQID-03604 0.37 0.21
SEQID-03827 0.42 0.20 SEQID-03540 0.37 0.20 SEQID-03624 0.39
0.19
TABLE-US-00016 TABLE E5H SEQID EAA D SEQID-03795 0.62 0.00
SEQID-03468 0.62 0.00 SEQID-03672 0.62 0.00 SEQID-03656 0.61 0.00
SEQID-03517 0.60 0.00 SEQID-03493 0.60 0.00 SEQID-03816 0.60 0.00
SEQID-03796 0.59 0.00 SEQID-03868 0.59 0.00 SEQID-03740 0.59
0.00
[0665] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in cysteine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5I. The top 10 nutritive polypeptide sequences
reduced in cysteine are shown in table E5J.
TABLE-US-00017 TABLE E5I SEQID EAA C SEQID-03495 0.24 0.30
SEQID-03514 0.24 0.30 SEQID-03571 0.24 0.28 SEQID-03430 0.36 0.27
SEQID-03419 0.37 0.16 SEQID-03478 0.29 0.16 SEQID-03523 0.33 0.16
SEQID-03504 0.35 0.16 SEQID-03477 0.28 0.16 SEQID-03459 0.10
0.16
TABLE-US-00018 TABLE E5J SEQID EAA C SEQID-03636 0.65 0.00
SEQID-03492 0.63 0.00 SEQID-03484 0.62 0.00 SEQID-03442 0.61 0.00
SEQID-03417 0.61 0.00 SEQID-03563 0.61 0.00 SEQID-03512 0.61 0.00
SEQID-03517 0.60 0.00 SEQID-03606 0.60 0.00 SEQID-03493 0.60
0.00
[0666] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in glutamine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5K. The top 10 nutritive polypeptide sequences
reduced in glutamine are shown in table ESL.
TABLE-US-00019 TABLE E5K SEQID EAA Q SEQID-03676 0.29 0.19
SEQID-03720 0.29 0.19 SEQID-03683 0.33 0.19 SEQID-03782 0.46 0.18
SEQID-03681 0.46 0.18 SEQID-03852 0.46 0.18 SEQID-03671 0.43 0.17
SEQID-00515 0.25 0.17 SEQID-03866 0.40 0.17 SEQID-03824 0.36
0.16
TABLE-US-00020 TABLE E5L SEQID EAA Q SEQID-03636 0.65 0.00
SEQID-03795 0.62 0.00 SEQID-03468 0.62 0.00 SEQID-03484 0.62 0.00
SEQID-03570 0.59 0.00 SEQID-03422 0.58 0.00 SEQID-03432 0.58 0.00
SEQID-03590 0.58 0.00 SEQID-03515 0.58 0.00 SEQID-03499 0.58
0.00
[0667] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in histidine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5M. The top 10 nutritive polypeptide sequences
reduced in histidine are shown in table E5N.
TABLE-US-00021 TABLE E5M SEQID EAA H SEQID-03744 0.60 0.25
SEQID-03551 0.48 0.24 SEQID-03745 0.56 0.19 SEQID-03793 0.59 0.19
SEQID-03468 0.62 0.15 SEQID-03743 0.38 0.13 SEQID-03711 0.56 0.12
SEQID-03847 0.58 0.12 SEQID-03637 0.43 0.12 SEQID-03739 0.52
0.12
TABLE-US-00022 TABLE E5N SEQID EAA H SEQID-03795 0.62 0.00
SEQID-03874 0.62 0.00 SEQID-03656 0.61 0.00 SEQID-03517 0.60 0.00
SEQID-03493 0.60 0.00 SEQID-03816 0.60 0.00 SEQID-03796 0.59 0.00
SEQID-03740 0.59 0,00 SEQID-03814 0.58 0.00 SEQID-03837 0.57
0.00
[0668] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in isoleucine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E50. The top 10 nutritive polypeptide sequences
reduced in isoleucine are shown in table E5P.
TABLE-US-00023 TABLE E5O SEQID EAA I SEQID-03722 0.40 0.15
SEQID-03805 0.38 0.15 SEQID-03435 0.40 0.15 SEQID-03838 0.42 0.15
5E0ID-03655 0.54 0.15 SEQID-03828 0.49 0.15 SEQID-03593 0.39 0.15
SEQID-03818 0.51 0.15 SEQID-03841 0.49 0.15 SEQID-03843 0.48
0.14
TABLE-US-00024 TABLE E5P SEQID EAA I SEQID-03581 0.60 0.00
SEQID-03685 0.57 0.00 SEQID-03705 0.56 0.00 SEQID-03660 0.55 0.00
SEQID-03779 0.53 0.00 SEQID-03781 0.52 0.00 SEQID-03647 0.51 0.00
SEQID-03785 0.50 0.00 SEQID-03865 0.50 0.00 SEQID-03802 0.49
0.00
[0669] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in leucine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5Q. The top 10 nutritive polypeptide sequences
reduced in leucine are shown in table E5R.
TABLE-US-00025 TABLE E5Q SEQID EAA L SEQID-03552 0.56 0.21
SEQID-03428 0.49 0.18 SEQID-03623 0.49 0.18 SEQID-03702 0.47 0.18
SEQID-03701 0.49 0.18 SEQID-03703 0.49 0.18 SEQID-03599 0.51 0.18
SEQID-03494 0.54 0.18 SEQID-03632 0.45 0.18 SEQID-03423 0.44
0.18
TABLE-US-00026 TABLE E5R SEQID EAA L SEQID-03661 0.53 0.00
SEQID-03849 0.52 0.00 SEQID-03644 0.42 0.00 SEQID-03878 0.39 0.00
SEQID-03652 0.38 0.00 SEQID-03419 0.37 0.00 SEQID-03654 0.36 0.00
SEQID-03804 0.36 0.00 SEQID-03504 0.35 0.00 SEQID-03477 0.28
0.00
[0670] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in lysine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5S. The top 10 nutritive polypeptide sequences
reduced in lysine are shown in table E5T.
TABLE-US-00027 TABLE E5S SEQID EAA K SEQID-03648 0.52 0.36
SEQID-03797 0.56 0.34 SEQID-03830 0.52 0.31 SEQID-03829 0.54 0.30
SEQID-03581 0.60 0.30 SEQID-03520 0.36 0.30 SEQID-03457 0.37 0.30
SEQID-03471 0.36 0.29 SEQID-03859 0.53 0.29 SEQID-03456 0.34
0.29
TABLE-US-00028 TABLE E5T SEQID EAA K SEQID-03583 0.42 0.00
SEQID-03684 0.40 0.00 SEQID-03813 0.36 0.00 SEQID-03771 0.28 0.00
SEQID-03873 0.26 0.00 SEQID-03585 0.25 0.00 SEQID-03704 0.17 0.00
SEQID-03767 0.17 0.00 SEQID-03731 0.16 0.00 SEQID-03459 0.10
0.00
[0671] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in methionine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5U. The top 10 nutritive polypeptide sequences
reduced in arginine are shown in table E5V.
TABLE-US-00029 TABLE E5U SEQID EAA M SEQID-00552 0.45 0.16
SEQID-03870 0.52 0.15 SEQID-03680 0.49 0.15 SEQID-03888 0.39 0.13
SEQID-03738 0.37 0.13 SEQID-03698 0.47 0.13 SEQID-03584 0.53 0.12
SEQID-03487 0.53 0.11 SEQID-03858 0,49 0.11 SEQID-03787 0.46
0.11
TABLE-US-00030 TABLE E5V SEQID EAA M SEQID-03701 0.49 0.00
SEQID-03861 0.49 0.00 SEQID-03703 0.49 0.00 SEQID-03702 0.47 0.00
SEQID-03773 0.46 0.00 SEQID-03707 0.45 0.00 SEQID-03726 0.41 0.00
SEQID-03725 0.39 0.00 SEQID-03734 0.39 0.00 SEQID-03700 0.37
0.00
[0672] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in phenylalanine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5W. The top 10 nutritive polypeptide sequences
reduced in phenylalanine are shown in table E5X.
TABLE-US-00031 TABLE E5W SEQID EAA F SEQID-03761 0.48 0.14
SEQID-03831 0.56 0.14 SEQID-03836 0.55 0.13 SEQID-03437 0.41 0.13
SEQID-03749 0.41 0.13 SEQID-03558 0.44 0.13 SEQID-03791 0.49 0.13
SEQID-03729 0.50 0.12 SEQID-03846 0.40 0.12 SEQID-03862 0.50
0.12
TABLE-US-00032 TABLE E5X SEQID EAA F SEQID-03581 0.60 0.00
SEQID-03441 0.57 0.00 SEQID-03685 0.57 0.00 SEQID-03573 0.55 0.00
SEQID-03661 0.53 0.00 SEQID-03859 0.53 0.00 SEQID-03688 0.53 0.00
SEQID-03675 0.53 0.00 SEQID-03609 0.53 0.00 SEQID-03584 0.53
0.00
[0673] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in proline that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5Y. The top 10 nutritive polypeptide sequences
reduced in proline are shown in table E5Z.
TABLE-US-00033 TABLE E5Y SEQID EAA P SEQID-03800 0.33 0.16
SEQID-03756 0.32 0.14 SEQID-03839 0.35 0.14 SEQID-03810 0.33 0.13
SEQID-03888 0.39 0.13 SEQID-03845 0.41 0.13 SEQID-03834 0.39 0.13
SEQID-03658 0.35 0.13 SEQID-03856 0.44 0.12 SEQID-03799 0.37
0.12
TABLE-US-00034 TABLE E5Z SEQID EAA P SEQID-03636 0.65 0.00
SEQID-03468 0.62 0.00 SEQID-03790 0.57 0.00 SEQID-03486 0.57 0.00
SEQID-03665 0.56 0.00 SEQID-03833 0.56 0.00 SEQID-03588 0.56 0.00
SEQID-03808 0.56 0.00 SEQID-03719 0.56 0.00 SEQID-03815 0.55
0.00
[0674] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in serine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5AA. The top 10 nutritive polypeptide sequences
reduced in serine are shown in table E5AB.
TABLE-US-00035 TABLE E5AA SEQID EAA S SEQID-03747 0.45 0.16
SEQID-03863 0.27 0.15 SEQID-03737 0.32 0.15 SEQID-03759 0.40 0.15
SEQID-03882 0.39 0.15 SEQID-03748 0.41 0.14 SEQID-03792 0.41 0.14
SEQID-03844 0.37 0.14 SEQID-03751 0.47 0.14 SEQID-03822 0.45
0.14
TABLE-US-00036 TABLE E5AB SEQID EAA S SEQID-03441 0.57 0.00
SEQID-03867 0.55 0.00 SEQID-03645 0.43 0.00 SEQID-03455 0.35 0.00
SEQID-03775 0.30 0.00 SEQID-03771 0.28 0.00 SEQID-03772 0.28 0.00
SEQID-03716 0.26 0.00 SEQID-03873 0.26 0.00 SEQID-03508 0.41
0.01
[0675] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in threonine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5AC. The top 10 nutritive polypeptide sequences
reduced in threonine are shown in table E5AD.
TABLE-US-00037 TABLE E5AC SEQID EAA T SEQID-03718 0.42 0.16
SEQID-03777 0.46 0.14 SEQID-03713 0.42 0.12 SEQID-03871 0.44 0.12
SEQID-03867 0.55 0.12 SEQID-03819 0.48 0.12 SEQID-03820 0.41 0.11
SEQID-03653 0.39 0.11 SEQID-03717 0.38 0.11 SEQID-03877 0.45
0.11
TABLE-US-00038 TABLE E5AD SEQID EAA T SEQID-03744 0.60 0.00
SEQID-03745 0.56 0.00 SEQID-03661 0.53 0.00 SEQID-03830 0.52 0.00
SEQID-03849 0.52 0.00 SEQID-03887 0.51 0.00 SEQID-03886 0.50 0.00
SEQID-03670 0.48 0.00 SEQID-03551 0.48 0.00 SEQID-03780 0.47
0.00
[0676] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in tryptophan that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5AE. The top 10 nutritive polypeptide sequences
reduced in tryptophan are shown in table E5AF.
TABLE-US-00039 TABLE E5AE SEQID EAA W SEQID-03583 0.42 0.15
SEQID-03635 0.40 0.13 SEQID-03555 0.50 0.11 SEQID-03679 0.48 0.09
SEQID-03440 0.44 0.09 SEQID-03439 0.45 0.09 SEQID-03468 0.62 0.08
SEQID-01546 0.51 0.08 SEQID-03576 0.42 0.08 SEQID-03821 0.44
0.08
TABLE-US-00040 TABLE E5AF SEQID EAA W SEQID-03672 0.62 0.00
SEQID-03512 0.61 0.00 SEQID-03606 0.60 0.00 SEQID-03744 0.60 0.00
SEQID-03581 0.60 0.00 SEQID-03868 0.59 0.00 SEQID-03762 0.59 0.00
SEQID-03857 0.59 0.00 SEQID-03793 0.59 0.00 SEQID-03769 0.59
0.00
[0677] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in tyrosine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5AG. The top 10 nutritive polypeptide sequences
reduced in tyrosine are shown in table E5AH.
TABLE-US-00041 TABLE E5AG SEQID EAA Y SEQID-03848 0.32 0.16
SEQID-03831 0.56 0.15 SEQID-03876 0.26 0.15 SEQID-00325 0.42 0.14
SEQID-03794 0.43 0.14 SEQID-03826 0.38 0.14 SEQID-03659 0.46 0.14
SEQID-03786 0.35 0.14 SEQID-03784 0.38 0.14 SEQID-03823 0.39
0.14
TABLE-US-00042 TABLE ESAH SEQID EAA Y SEQID-03468 0.62 0.00
SEQID-03442 0.61 0.00 SEQID-03417 0.61 0.00 SEQID-03563 0.61 0.00
SEQID-03606 0.60 0.00 SEQID-03469 0.60 0.00 SEQID-03443 0.60 0.00
SEQID-03581 0.60 0.00 SEQID-03796 0.59 0.00 SEQID-03762 0.59
0.00
[0678] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in valine that met the above cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E5AI. The top 10 nutritive polypeptide sequences
reduced in valine are shown in table E5AJ.
TABLE-US-00043 TABLE E5AI SEQID EAA V SEQID-03881 0.49 0.17
SEQID-03790 0.57 0.17 SEQID-03808 0.56 0.17 SEQID-03606 0.60 0.17
SEQID-03688 0.53 0.16 SEQID-03806 0.55 0.16 SEQID-03643 0.51 0.15
SEQID-03788 0.58 0.14 SEQID-03762 0.59 0.14 SEQID-03674 0.51
0.14
TABLE-US-00044 TABLE E5AJ SEQID EAA V SEQID-03879 0.56 0.00
SEQID-03552 0.56 0.00 SEQID-03835 0.54 0.00 SEQID-03851 0.53 0.00
SEQID-03757 0.53 0.00 SEQID-03648 0.52 0.00 SEQID-03766 0.50 0.00
SEQID-03710 0.46 0.00 SEQID-03764 0.46 0.00 SEQID-00552 0.45
0.00
[0679] Selection of Expressed Proteins Enriched Essential Amino
Acids and Enriched or Reduced in Various Individual Amino
Acids.
[0680] Using the database of all expressed protein sequences
described herein, candidate sequences enriched in essential amino
acids with elevated or reduced amounts of each amino acid were
identified. When searching for proteins enriched or reduced in a
given amino acid, proteins were rank ordered by their calculated
amino acid mass fraction of the desired amino acid and then by
their essential amino acid content.
[0681] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in alanine is shown in table E5AK. The top 10
nutritive polypeptide sequences reduced in alanine are shown in
table E5AL.
TABLE-US-00045 TABLE E5AK SEQID EAA A SEQID-00499 0.34 0.18
SEQID-00512 0.44 0.17 SEQID-00651 0.39 0.17 SEQID-00519 0.38 0.16
SEQID-02704 0.42 0.16 SEQID-02703 0.42 0.13 SEQID-00530 0.37 0.13
SEQID-00544 0.45 0.12 SEQID-00549 0.40 0.12 SEQID-02675 0.50
0.11
TABLE-US-00046 TABLE E5AL SEQID EAA A SEQID-00140 0.70 0.00
SEQID-00057 0.41 0.00 SEQID-00652 0.28 0.00 SEQID-00199 0.52 0.00
SEQID-00198 0.53 0.00 SEQID-00197 0.52 0.00 SEQID-00196 0.53 0.00
SEQID-00722 0.53 0.01 SEQID-00204 0.51 0.01 SEQID-00203 0.51
0.01
[0682] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in arginine is shown in table E5AM. The top 10
nutritive polypeptide sequences reduced in arginine are shown in
table E5AN.
TABLE-US-00047 TABLE E5AM SEQID EAA R SEQID-00540 0.41 0.23
SEQID-00567 0.42 0.22 SEQID-00636 0.47 0.22 SEQID-00556 0.33 0.22
SEQID-00637 0.42 0.22 SEQID-00575 0.33 0.22 SEQID-00492 0.42 0.21
SEQID-00631 0.38 0.21 SEQID-00551 0.41 0.21 SEQID-00328 0.45
0.20
TABLE-US-00048 TABLE E5AN SEQID EAA R SEQID-00140 0.70 0.00
SEQID-00146 0.67 0.00 SEQID-00150 0.67 0.00 SEQID-00143 0.65 0.00
SEQID-00525 0.64 0.00 SEQID-00162 0.64 0.00 SEQID-00175 0.63 0.00
SEQID-00169 0.60 0.00 SEQID-00548 0.59 0.00 SEQID-00536 0.58
0.00
[0683] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in asparagine is shown in table E5AO. The top 10
nutritive polypeptide sequences reduced in asparagine are shown in
table E5AP.
TABLE-US-00049 TABLE E5AO SEQID EAA N SEQID-00195 0.52 0.14
SEQID-00194 0.54 0.14 SEQID-00193 0.53 0.12 SEQID-03872 0.47 0.12
SEQID-01388 0.36 0.12 SEQID-00552 0.45 0.12 SEQID-00169 0.60 0.11
SEQID-00196 0.53 0.10 SEQID-00197 0.52 0.10 SEQID-03693 0.34
0.10
TABLE-US-00050 TABLE E5AP SEQID EAA N SEQID-00536 0.58 0.00
SEQID-00284 0.54 0.00 SEQID-00212 0.51 0.00 SEQID-00101 0.51 0.00
SEQID-00219 0.50 0.00 SEQID-00634 0.50 0.00 SEQID-00624 0.49 0.00
SEQID-00639 0.46 0.00 SEQID-00597 0.45 0.00 SEQID-00527 0.40
0.00
[0684] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in aspartic acid is shown in table E5AQ. The top
10 nutritive polypeptide sequences reduced in aspartic acid are
shown in table E5AR.
TABLE-US-00051 TABLE E5AQ SEQID EAA D SEQID-00562 0.40 0.19
SEQID-03853 0.34 0.17 SEQID-00116 0.32 0.16 SEQID-00102 0.45 0.16
SEQID-00115 0.32 0.16 SEQID-00484 0.38 0.16 SEQID-00100 0.46 0.15
SEQID-00220 0.52 0.15 SEQID-00098 0.50 0.15 SEQID-00078 0.46
0.14
TABLE-US-00052 TABLE E5AR SEQID EAA D SEQID-00166 0.65 0.00
SEQID-00051 0.59 0.00 SEQID-00052 0.59 0.00 SEQID-00053 0.57 0.00
SEQID-00054 0.55 0.00 SEQID-00055 0.55 0.00 SEQID-00523 0.51 0.00
SEQID-00635 0.46 0.00 SEQID-00230 0.45 0.00 SEQID-00637 0.42
0.00
[0685] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in cysteine is shown in table E5AS. The top 10
nutritive polypeptide sequences reduced in cysteine are shown in
table E5AT.
TABLE-US-00053 TABLE E5AS SEQID EAA C SEQID-00737 0.28 0.18
SEQID-00652 0.28 0.16 SEQID-00007 0.28 0.13 SEQID-00007 0.28 0.13
SEQID-00558 0.36 0.13 SEQID-00013 0.28 0.12 SEQID-00014 0.30 0.12
SEQID-00989 0.34 0.12 SEQID-00566 0.38 0.11 SEQID-00596 0.44
0.11
TABLE-US-00054 TABLE E5AT SEQID EAA C SEQID-00166 0.65 0.00
SEQID-00137 0.64 0.00 SEQID-00525 0.64 0.00 SEQID-00162 0.64 0.00
SEQID-03297 0.62 0.00 SEQID-00169 0.60 0.00 SEQID-00132 0.60 0.00
SEQID-00298 0.59 0.00 SEQID-00536 0.58 0.00 SEQID-00297 0.58
0.00
[0686] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in glutamine is shown in table ESAU. The top 10
nutritive polypeptide sequences reduced in glutamine are shown in
table E5AV.
TABLE-US-00055 TABLE E5AU SEQID EAA Q SEQID-00743 0.29 0.22
SEQID-00513 0.33 0.17 SEQID-03695 0.38 0.17 SEQID-00522 0.40 0.17
SEQID-00515 0.25 0.17 SEQID-03692 0.44 0.14 SEQID-03666 0.35 0.13
SEQID-00613 0.36 0.13 SEQID-00585 0.44 0.13 SEQID-00223 0.50
0.13
TABLE-US-00056 TABLE E5AV SEQID EAA Q SEQID-00143 0.65 0.00
SEQID-00137 0.64 0.00 SEQID-00525 0.64 0.00 SEQID-00134 0.58 0.00
SEQID-00194 0.54 0.00 SEQID-00193 0.53 0.00 SEQID-00195 0.52 0.00
SEQID-00650 0.50 0.00 SEQID-00563 0.50 0.00 SEQID-00598 0.49
0.00
[0687] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in histidine is shown in table E5AW. The top 10
nutritive polypeptide sequences reduced in histidine are shown in
table E5AX.
TABLE-US-00057 TABLE E5AW SEQID EAA H SEQID-00536 0.58 0.23
SEQID-00560 0.55 0.18 SEQID-01162 0.48 0.12 SEQID-00585 0.44 0.10
SEQID-00298 0.59 0.10 SEQID-00615 0.40 0.10 SEQID-00525 0.64 0.10
SEQID-00297 0.58 0.10 SEQID-00764 0.56 0.09 SEQID-00128 0.53
0.08
TABLE-US-00058 TABLE E5AX SEQID EAA H SEQID-00043 0.57 0.00
SEQID-00531 0.55 0.00 SEQID-00592 0.53 0.00 SEQID-00224 0.53 0.00
SEQID-00024 0.52 0.00 SEQID-00625 0.52 0.00 SEQID-00233 0.52 0.00
SEQID-00587 0.51 0.00 SEQID-00213 0.51 0.00 SEQID-00214 0.51
0.00
[0688] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in isoleucine is shown in table E5AY. The top 10
nutritive polypeptide sequences reduced in isoleucine are shown in
table E5AZ.
TABLE-US-00059 TABLE E5AY SEQID EAA I SEQID-00561 0.68 0.18
SEQID-00134 0.58 0.14 SEQID-00175 0.63 0.14 SEQID-00162 0.64 0.14
SEQID-00234 0.51 0.13 SEQID-00233 0.52 0.13 SEQID-00169 0.60 0.13
SEQID-00025 0.48 0.13 SEQID-00043 0.57 0.12 SEQID-00584 0.50
0.12
TABLE-US-00060 TABLE E5AZ SEQID EAA I SEQID-00762 0.56 0.00
SEQID-00764 0.56 0.00 SEQID-00571 0.54 0.00 SEQID-00212 0.51 0.00
SEQID-00237 0.48 0.00 SEQID-00236 0.45 0.00 SEQID-00551 0.41 0.00
SEQID-00515 0.25 0.01 SEQID-00128 0.53 0.01 SEQID-00651 0.39
0.01
[0689] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in leucine is shown in table E5BA. The top 10
nutritive polypeptide sequences reduced in leucine are shown in
table E5BB.
TABLE-US-00061 TABLE E5BA SEQID EAA L SEQID-00162 0.64 0.34
SEQID-00132 0.60 0.32 SEQID-00195 0.52 0.26 SEQID-00194 0.54 0.76
SEQID-00193 0.53 0.26 SEQID-00166 0.65 0.26 SEQID-00169 0.60 0.25
SEQID-00134 0.58 0.24 SEQID-00212 0.51 0.23 SEQID-00139 0.49
0.23
TABLE-US-00062 TABLE E5BB SEQID EAA L SEQID-00553 0.39 0.00
SEQID-00743 0.29 0.00 SEQID-00522 0.40 0.01 SEQID-00554 0.38 0.01
SEQID-00585 0.44 0.01 SEQID-00560 0.55 0.01 SEQID-00529 0.38 0.01
SEQID-00552 0.45 0.01 SEQID-00547 0.49 0.01 SEQID-00575 0.33
0.01
[0690] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in lysine is shown in table E5BC. The top 10
nutritive polypeptide sequences reduced in lysine are shown in
table E5BD.
TABLE-US-00063 TABLE E5BC SEQID EAA K SEQID-00560 0.55 0.25
SEQID-00573 0.54 0.23 SEQID-00619 0.51 0.23 SEQID-00553 0.39 0.23
SEQID-00572 0.54 0.23 SEQID-00623 0.54 0.23 SEQID-03691 0.52 0.23
SEQID-00503 0.49 0.22 SEQID-00564 0.51 0.22 SEQID-00517 0.49
0.22
TABLE-US-00064 TABLE E5BD SEQID EAA K SEQID-00166 0.65 0.00
SEQID-00175 0.63 0.00 SEQID-00169 0.60 0.00 SEQID-00134 0.58 0.00
SEQID-00535 0.30 0.00 SEQID-00513 0.33 0.01 SEQID-02675 0.50 0.01
SEQID-00490 0.58 0.01 SEQID-00512 0.44 0.01 SEQID-00500 0.40
0.01
[0691] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in methionine is shown in table E5BE. The top 10
nutritive polypeptide sequences reduced in arginine are shown in
table E5BF.
TABLE-US-00065 TABLE E5BE SEQID EAA M SEQID-00552 0.45 0.16
SEQID-00513 0.33 0.13 SEQID-00529 0.38 0.09 SEQID-00526 0.41 0.09
SEQID-00868 0.48 0.09 SEQID-00595 0.44 0.09 SEQID-00584 0.50 0.09
SEQID-00486 0.56 0.09 SEQID-00092 0.42 0.08 SEQID-00074 0.42
0.08
TABLE-US-00066 TABLE E5BF SEQID EAA M SEQID-00132 0.60 0.00
SEQID-00051 0.59 0.00 SEQID-00052 0.59 0.00 SEQID-00043 0.57 0.00
SEQID-00053 0.57 0.00 SEQID-00055 0.55 0.00 SEQID-00054 0.55 0.00
SEQID-00224 0.53 0.00 SEQID-00024 0.52 0.00 SEQID-00220 0.52
0.00
[0692] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in phenylalanine is shown in table E5BG. The top
10 nutritive polypeptide sequences reduced in phenylalanine are
shown in table E5BH.
TABLE-US-00067 TABLE E5BG SEQID EAA F SEQID-00150 0.67 0.13
SEQID-00595 0.44 0.13 SEQID-00561 0.68 0.13 SEQID-00118 0.51 0.12
SEQID-00597 0.45 0.12 SEQID-00507 0.51 0.12 SEQID-00594 0.44 0.12
SEQID-00501 0.50 0.12 SEQID-00175 0.63 0.11 SEQID-00485 0.46
0.11
TABLE-US-00068 TABLE E5BH SEQID EAA F SEQID-00162 0.64 0.00
SEQID-00560 0.55 0.00 SEQID-00224 0.53 0.00 SEQID-00220 0.52 0.00
SEQID-00195 0.52 0.00 SEQID-00241 0.52 0.00 SEQID-00215 0.51 0.00
SEQID-00213 0.51 0.00 SEQID-00214 0.51 0.00 SEQID-00212 0.51
0.00
[0693] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in proline is shown in table E5BT. The top 10
nutritive polypeptide sequences reduced in proline are shown in
table E5BJ.
TABLE-US-00069 TABLE E5BI SEQID EAA P SEQID-00743 0.29 0.28
SEQID-00553 0.39 0.24 SEQID-03641 0.24 0.20 SEQID-03444 0.23 0.16
SEQID-00169 0.60 0.14 SEQID-00005 0.48 0.14 SEQID-00805 0.50 0.13
SEQID-00737 0.28 0.13 SEQID-03451 0.40 0.11 SEQID-03447 0.30
0.10
TABLE-US-00070 TABLE E5BJ SEQID EAA P SEQID-00150 0.67 0.00
SEQID-00137 0.64 0.00 SEQID-00287 0.59 0.00 SEQID-00548 0.59 0.00
SEQID-00142 0.56 0.00 SEQID-00560 0.55 0.00 SEQID-00224 0.53 0.00
SEQID-00220 0.52 0.00 SEQID-00241 0.52 0.00 SEQID-00216 0.52
0.00
[0694] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in serine is shown in table E5BK. The top 10
nutritive polypeptide sequences reduced in serine are shown in
table E5BL.
TABLE-US-00071 TABLE E5BK SEQID EAA S SEQID-03447 0.30 0.27
SEQID-00483 0.42 0.16 SEQID-00535 0.30 0.16 SEQID-00630 0.35 0.14
SEQID-00134 0.58 0.14 SEQID-00557 0.47 0.13 SEQID-03760 0.39 0.12
SEQID-03642 0.37 0.12 SEQID-00652 0.28 0.12 SEQID-00577 0.47
0.12
TABLE-US-00072 TABLE E5BL SEQID EAA S SEQID-00175 0.63 0.00
SEQID-00051 0.59 0.00 SEQID-00052 0.59 0.00 SEQID-00536 0.58 0.00
SEQID-00043 0.57 0.00 SEQID-00053 0.57 0.00 SEQID-00643 0.57 0.00
SEQID-00055 0.55 0.00 SEQID-00054 0.55 0.00 SEQID-00112 0.50
0.00
[0695] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in threonine is shown in table E5BM. The top 10
nutritive polypeptide sequences reduced in threonine are shown in
table E5BN.
TABLE-US-00073 TABLE E5BM SEQID EAA T SEQID-00404 0.49 0.14
SEQID-00547 0.49 0.13 SEQID-00522 0.40 0.13 SEQID-00569 0.56 0.13
SEQID-00528 0.53 0.11 SEQID-00504 0.47 0.11 SEQID-03768 0.42 0.11
SEQID-00523 0.51 0.11 SEQID-03649 0.49 0.11 SEQID-00116 0.32
0.11
TABLE-US-00074 TABLE E5BN SEQID EAA T SEQID-00560 0.55 0.00
SEQID-00057 0.41 0.00 SEQID-00542 0.41 0.00 SEQID-00059 0.41 0.00
SEQID-00015 0.30 0.00 SEQID-00014 0.30 0.00 SEQID-00013 0.28 0.00
SEQID-00007 0.28 0.00 SEQID-00007 0.28 0.00 SEQID-00621 0.39
0.01
[0696] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in tryptophan is shown in table E5BM. The top 10
nutritive polypeptide sequences reduced in tryptophan are shown in
table E5BN.
TABLE-US-00075 TABLE E5BM SEQID EAA W SEQID-01546 0.51 0.08
SEQID-00642 0.45 0.08 SEQID-03690 0.43 0.08 SEQID-03776 0.43 0.08
SEQID-03297 0.62 0.07 SEQID-03244 0.46 0.07 SEQID-00512 0.44 0.07
SEQID-00814 0.42 0.07 SEQID-00110 0.49 0.06 SEQID-03137 0.50
0.06
TABLE-US-00076 TABLE E5BN SEQID EAA W SEQID-00166 0.65 0.00
SEQID-00137 0.64 0.00 SEQID-00525 0.64 0.00 SEQID-00162 0.64 0.00
SEQID-00169 0.60 0.00 SEQID-00051 0.59 0.00 SEQID-00052 0.59 0.00
SEQID-00134 0.58 0.00 SEQID-00536 0.58 0.00 SEQID-00043 0.57
0.00
[0697] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in tyrosine is shown in table E5BO. The top 10
nutritive polypeptide sequences reduced in tyrosine are shown in
table E5BP.
TABLE-US-00077 TABLE E5BO SEQID EAA Y SEQID-00013 0.28 0.16
SEQID-00007 0.28 0.15 SEQID-00007 0.28 0.15 SEQID-00015 0.30 0.14
SEQID-00325 0.42 0.14 SEQID-00014 0.30 0.13 SEQID-00513 0.33 0.12
SEQID-03689 0.41 0.11 SEQID-00521 0.41 0.11 SEQID-00640 0.47
0.11
TABLE-US-00078 TABLE E5BP SEQID EAA V SEQID-00140 0.70 0.00
SEQID-00146 0.67 0.00 SEQID-00051 0.59 0.00 SEQID-00052 0.59 0.00
SEQID-00548 0.59 0.00 SEQID-00134 0.58 0.00 SEQID-00043 0.57 0.00
SEQID-00053 0.57 0.00 SEQID-00054 0.55 0.00 SEQID-00055 0.55
0.00
[0698] An exemplary list of the top 10 nutritive polypeptide
sequences enriched in valine is shown in table E5BQ. The top 10
nutritive polypeptide sequences reduced in valine are shown in
table E5BR.
TABLE-US-00079 TABLE E5BQ SEQID EAA V SEQID-00550 0.49 0.18
SEQID-00592 0.53 0.16 SEQID-00532 0.44 0.15 SEQID-00620 0.50 0.15
SEQID-00644 0.42 0.14 SEQID-00514 0.46 0.13 SEQID-00518 0.52 0.13
SEQID-00598 0.49 0.13 SEQID-00581 0.51 0.13 SEQID-00145 0.51
0.13
TABLE-US-00080 TABLE E5BR SEQID EAA V SEQID-00239 0.48 0.00
SEQID-00552 0.45 0.00 SEQID-00240 0.45 0.00 SEQID-00615 0.40 0.00
SEQID-00652 0.28 0.00 SEQID-00515 0.25 0.01 SEQID-00522 0.40 0.01
SEQID-00560 0.55 0.01 SEQID-00645 0.56 0.01 SEQID-00647 0.42
0.01
Example 6
Selection of Amino Acid Sequences of Nutritive Polypeptides
Enriched in Essential Amino Acids to Provide Protein Nutrition and
for the Treatment of Protein Malnutrition
[0699] It has been shown that humans cannot endogenously synthesize
nine of the twenty naturally occurring amino acids: histidine,
leucine, isoleucine, valine, phenylalanine, methionine, threonine,
lysine, and tryptophan (Young, V. R. and Tharakan, J. F.
Nutritional essentiality of amino acids and amino acid requirements
in healthy adults. In Metabolic and Therapeutic Aspects of Amino
Acids in Clinical Nutrition. Second Edition. Cynober, L. A. Ed.;
CRC Press: New York, 2004; pp 439-470). As such, there is a need to
ingest sufficient quantities of these nine essential amino acids to
avoid protein malnutrition and the deleterious health effects that
result from this state. Nutritive polypeptides are identified that
are useful for the fulfillment of these essential amino acid
requirements either in healthy or malnourished individuals by
selecting those that are enriched in essential amino acids by mass
and contain a non-zero amount of each essential amino acid (i.e.,
the nutritive polypeptide sequence is essential amino acid
complete).
[0700] Using a database of all protein sequences derived from
edible species as described herein, candidate sequences that are
essential amino acid complete and enriched in essential amino acids
were identified. In order to increase the probability of these
proteins being solubly expressed and highly soluble at pH 7 with
reduced aggregation propensity, solvation score and aggregation
score upper bounds of -20 kcal/mol/AA and 0.5 were applied. In
order to reduce the likelihood that these proteins would elicit an
allergenic response, upper bounds of 50% and 35% were set for the
global allergen homology and allergenicity scores, respectively. In
order to reduce the likelihood that these proteins would have toxic
effects upon ingestion, an upper bound of 35% was set for the
toxicity score. In order to reduce the likelihood that these
proteins would act as inhibitors of digestive proteases, an upper
bound of 35% was set for the anti-nutricity score.
[0701] An exemplary list of the top 10 nutritive polypeptide
sequences that are essential amino acid complete, enriched in
essential amino acids, and meet the aforementioned cutoffs in
solvation score, aggregation score, global allergen homology,
allergenicity score, toxicity score, and anti-nutricity score is
shown in table E6A.
TABLE-US-00081 TABLE E6A SEQID EAAc EAA SEQID-03636 1 0.65
SEQID-03492 1 0.63 SEQID-03468 1 0.62 SEQID-03544 1 0.62
SEQID-03484 1 0.62 SEQID-03442 1 0.61 SEQID-03417 1 0.61
SEQID-03563 1 0.61 SEQID-03469 1 0.60 SEQID-03443 1 0.60
[0702] An exemplary list of the top 10 nutritive polypeptide
sequences from the expressed protein database that are essential
amino acid complete and enriched in essential amino acids is shown
in table E6B.
TABLE-US-00082 TABLE E6B SEQID EAAc EAA SEQID-00140 1 0.70
5EQID-00561 1 0.68 SEQID-00146 1 0.67 SEQID-00150 1 0.67
SEQID-00143 I 0.65 SEQID-03297 1 0.62 SEQID-00487 I 0.61
SEQID-00287 1 0.59 SEQID-00298 1 0.59 SEQID-00548 1 0.59
Example 7
Selection of Amino Acid Sequences of Nutritive Polypeptides
Enriched in Branched Chain Amino Acids for Muscle Health, and
Selection of Amino Acid Sequences of Nutritive Polypeptides Reduced
in Branched Chain Amino Acids for Treatment of Diabetes,
Cardiovascular Disease, Chronic Kidney Disease and Stroke
[0703] Identification of Proteins Enriched in Branched Chain Amino
Acids for the Treatment of Hepatic and/or Renal Disease.
[0704] Using a database of all protein sequences derived from
edible species as described herein, candidate sequences that are
enriched or reduced in branched chain amino acids were identified.
In order to increase the probability that these proteins are
solubly expressed, as well as highly soluble at pH 7 with reduced
aggregation propensity, solvation score and aggregation score upper
bounds of -20 kcal/mol/AA and 0.5 were applied. In order to reduce
the likelihood that these proteins would elicit an allergenic
response, upper bounds of 50% and 35% were set for the global
allergen homology and allergenicity scores, respectively. In order
to reduce the likelihood that these proteins would have toxic
effects upon ingestion, an upper bound of 35% was set for the
toxicity score. In order to reduce the likelihood that these
proteins would act as inhibitors of digestive proteases, an upper
bound of 35% was set for the anti-nutricity score.
[0705] An exemplary list of the top 10 nutritive polypeptide
sequences that are enriched in branched chain amino acids, and meet
the afore mentioned cutoffs in solvation score, aggregation score,
global allergen homology, allergenicity score, toxicity score, and
anti-nutricity score is shown in table E7A.
TABLE-US-00083 TABLE E7A SEQID EAA BCAA SEQID-03532 0.58 0.31
SEQID-03616 0.53 0.31 SEQID-03629 0.56 0.31 SEQID-03619 0.52 0.29
SEQID-03542 0.49 0.29 SEQID-03519 0.49 0.29 SEQID-03603 0.53 0.29
SEQID-03536 0.52 0.29 SEQID-03597 0.48 0.29 SEQID-03623 0.49
0.29
[0706] An exemplary list of the top 10 nutritive polypeptide
sequences from the expressed protein database that are enriched in
branched chain amino acids is shown in table E7B.
TABLE-US-00084 TABLE E7B SEQID EAA BCAA SEQID-00162 0.64 0.53
SEQID-00166 0.65 0.46 SEQID-00134 0.58 0.46 SEQID-00169 0.60 0.43
SEQID-00043 0.57 0.41 SEQID-00132 0.60 0.41 SEQID-00137 0.64 0.39
SEQID-00175 0.63 0.38 SEQID-00550 0.49 0.38 SEQID-00234 0.51
0.37
[0707] An exemplary list of the top 10 nutritive polypeptide
sequences that are reduced in branched chain amino acids, and meet
the afore mentioned cutoffs in solvation score, aggregation score,
global allergen homology, allergenicity score, toxicity score, and
anti-nutricity score is shown in table E7C.
TABLE-US-00085 TABLE E7C SEQID EAA BCAA SEQID-03471 0.36 0.01
SEQID-03473 0.06 0.01 SEQID-03571 0.24 0.01 SEQID-03495 0.24 0.01
SEQID-03514 0.24 0.01 SEQID-00552 0.45 0.03 5EQID-03611 0.37 0.03
SEQID-03457 0.37 0.03 SEQID-03456 0.34 0.03 SEQID-03520 0.36
0.03
[0708] An exemplary list of the top 10 nutritive polypeptide
sequences from the expressed protein database that are reduced in
branched chain amino acids is shown in table E7D.
TABLE-US-00086 TABLE E7D SEQID EAA BCAA SEQID-00552 0.45 0.03
SEQID-00522 0.40 0.03 SEQID-00515 0.25 0.05 SEQID-00553 0.39 0.05
SEQID-00585 0.44 0.06 SEQID-00637 0.42 0.07 SEQID-00652 0.28 0.08
SEQID-00615 0.40 0.08 SEQID-00743 0.29 0.08 SEQID-00547 0.49
0.09
Example 8
Selection of Amino Acid Sequences of Nutritive Polypeptides Having
Low or No Phenylalanine and Enriched in Tyrosine and all Other
Essential Amino Acids for Treatment or Prevention of
Phenylketonuria
[0709] Individuals who suffer from phenylketonuria (PKU) are unable
to process the amino acid phenylalanine and catalyze its conversion
to tyrosine often due to a malfunctioning hepatic enzyme
phenylalnine hydroxylase (MacLeod E. L. and Ney D. M. Nutritional
Management of Phenylketonuria. Annales Nestle. (2010) 68:58-69). In
these individuals, when protein containing the amino acid
phenylalanine is ingested, phenylalanine accumulates in the blood.
Untreated PKU has serious untoward health effects, including
impaired school performance, impaired executive functioning, and
long term intellectual disability (Matalon, R., Michals-Matalon.
K., Bhatia, G., Grechanina, E., Novikov, P., McDonald, J. D.,
Grady, J., Tyring, S. K., Guttler, F. Large neutral amino acids in
the treatment of phenylketonuria. J. Inherit. Metab. Dis. (2006)
29: 732-738). One way phenylalanine blood levels can be kept low to
avoid neurological effects is to avoid the ingestion of
phenylalanine containing proteins and/or only consume protein
sources that are low in phenylalanine. As basic protein nutritional
requirements of all other amino acids must also be met, sufficient
intake of the other essential amino acids (histidine, leucine,
isoleucine, valine, methionine, threonine, lysine, and tryptophan)
and tyrosine, which becomes conditionally essential in these
individuals, is required. One can identify beneficial nutritive
polypeptides for individuals that suffer from phenylketonuria by
selecting proteins that contain low or no phenylalanine and are
enriched by mass in tyrosine and the other essential amino
acids.
[0710] Using a database of all protein sequences derived from
edible species as described herein, candidate sequences that
contain low or no phenylalanine by mass, are essential amino acid
and tyrosine complete (aside from phenylalanine), and enriched in
tyrosine and essential amino acids were identified and rank ordered
first by their phenylalanine mass fraction and then by their total
tyrosine plus essential amino acid mass fraction. In order to
increase the probability that these proteins are solubly expressed,
as well as highly soluble at pH 7 with reduced aggregation
propensity, solvation score and aggregation score upper bounds of
-20 kcal/mol/AA and 0.5 were applied. In order to reduce the
likelihood that these proteins would elicit an allergenic response,
upper bounds of 50% and 35% were set for the global allergen
homology and allergenicity scores, respectively. In order to reduce
the likelihood that these proteins would have toxic effects upon
ingestion, an upper bound of 35% was set for the toxicity score. In
order to reduce the likelihood that these proteins would act as
inhibitors of digestive proteases, an upper bound of 35% was set
for the anti-nutricity score.
[0711] An exemplary list of the top 10 nutritive polypeptide
sequences that contain low or no phenylalanine by mass, are
essential amino acid and tyrosine complete (aside from
phenylalanine), enriched in tyrosine and essential amino acids, and
meet the afore mentioned cutoffs in solvation score, aggregation
score, global allergen homology, allergenicity score, toxicity
score, and anti-nutricity score is shown in table E8A.
TABLE-US-00087 TABLE E8A SEQID EAA F Y SEQID-03584 0.53 0.00 0.09
SEOID-03479 0.52 0.00 0.04 SEQID-03573 0.55 0.00 0.01 SEQID-00634
0.50 0.00 0.05 SEQID-03466 0.49 0.00 0.05 SEOID-03609 0.53 0.00
0.01 SEQID-03498 0.45 0.00 0.06 SEQID-03465 0.40 0.00 0.08
SEQID-03587 0.46 0.00 0.01 SEQID-03463 0.41 0.00 0.05
An exemplary list of the top 10 nutritive polypeptide sequences
from the expressed protein database that contain low or no
phenylalanine by mass, are essential amino acid and tyrosine
complete (aside from phenylalanine), and enriched in tyrosine and
essential amino acids is shown in table E8B.
TABLE-US-00088 TABLE E8B SEQID EAA F Y SEQID-00634 0.50 0.00 0.05
SEQID-00514 0.46 0.01 0.01 SEQID-00329 0.47 0.01 0.03 SEQID-00628
0.51 0.01 0.02 SEQID-00636 0.47 0.01 0.04 SEQID-03634 0.45 0.01
0.04 SEQID-00335 0.38 0.01 0.07 SEQID-00639 0.46 0.01 0.06
SEQID-03448 0.40 0.01 0.03 SEQID-03889 0.42 0.02 0.01
Example 9
Selection of Amino Acid Sequences of Nutritive Polypeptides
Containing Fragments or Regions of Naturally-Occurring Protein
Sequences: Nutritive Polypeptide Fragments Enriched in Leucine and
all Essential Amino Acids
[0712] In some cases, full length proteins identified from the
databases described herein are not particularly advantageous in
view of one or more selection requirements defined by one or more
important parameters, or otherwise do not provide enough of one or
more specific amino acid(s) by mass relative to the total mass of
the nutritive polypeptide. In these cases, one or more fragments
(also termed "regions" herein) of nutritive polypeptides identified
in the database are able meet the desired search criteria.
Databases containing possible fragments of nutritive polypeptides
are generated and searched by taking each full length sequences in
the database and examining all possible subsequences at least 25
amino acids in length contained therein. For example, it was
desired to find a nutritive polypeptide sequence that had leucine
mass fractions greater than about 0.2 and highly charged to
increase the likelihood of soluble expression. The protein edible
species database described herein was searched using a solvation
score cutoff of less than -30, and in order to reduce the
likelihood that these proteins would elicit an allergenic response,
upper bounds of 50% were set for the global allergen homology and
allergenicity scores. In order to reduce the likelihood that these
proteins would have toxic effects upon ingestion, an upper bound of
35% was set for the toxicity score. In order to reduce the
likelihood that these proteins would act as inhibitors of digestive
proteases, an upper bound of 35% was set for the anti-nutricity
score.
[0713] An exemplary list of the top 10 nutritive polypeptide
fragments that are enriched in leucine (.ltoreq.20% by mass) and
meet the afore mentioned cutoffs in solvation score, global
allergen homology, allergenicity score, toxicity score, and
anti-nutricity score is shown in table E9A.
TABLE-US-00089 TABLE E9A DBID EAA L P58797 0.47 0.26 A7A1V1 0.49
0.24 P04467 0.56 0.23 Q9AWA5 0.45 0.22 Q2NL14 0.52 0.22 Q60CZ8 0.42
0.22 Q10MN8 0.32 0.22 P50275 0.47 0.22 Q2YDE5 0.45 0.22 Q0P5B4 0.51
0.22
[0714] An exemplary list of the top 10 nutritive polypeptide
fragments from the expressed protein database that are enriched in
leucine (120% by mass) is shown in Table E9B.
TABLE-US-00090 TABLE E9B SEQID EAA L SEQID-00132 0.60 0.32
SEQID-00195 0.52 0.26 SEQID-00194 0.54 0.26 SEQID-00193 0.53 0.26
SEQID-00166 0.65 0.26 SEQID-00134 0.58 0.24 SEQID-00212 0.51 0.23
SEQID-00139 0.49 0.23 SEQID-00213 0.51 0.21 SEQID-00148 0.47
0.21
Example 10
Purification of Nutritive Polypeptides
[0715] Various methods of purification have been used to isolate
nutritive polypeptides from or away other materials such as raw
foods, cells, salts, small molecules, host cell proteins, and
lipids. These methods include diafiltration, precipitation,
flocculation, aqueous two phase extraction, and chromatography.
[0716] Purification by Anti-FLAG Affinity Chromatography.
[0717] Anti-FLAG purification provides a method to purify nutritive
polypeptides from low-titer expression systems or from similarly
charged host cell proteins. Nutritive polypeptides were engineered
to contain either a single FLAG tag (DYKDDDDK) or a triple tandem
FLAG tag (DYKDDDDKDYKDDDDKDYKDDDDK) appended to the C-terminus of
the protein. Anti-FLAG affinity purification offers a single-step
purification process that offers non-denaturing process conditions
and elution purities of >95% (Einhauer et al., 2001 Journal of
Biochemical and Biophysical Methods).
[0718] Nutritive polypeptides were purified using Anti-FLAG M2
Affinity Agarose Gel (Sigma Aldrich, St. Louis, Mo.). The M2
affinity resin is designed specifically for use with C-terminal
FLAG epitopes. For purification of N-terminally appended FLAG
epitopes, the M1 Affinity Agarose Gel was used. The M2 Affinity
Agarose Gel (resin) has an advertised static binding capacity (SBC)
of approximately 0.5 mg nutritive polypeptide per mL of resin.
[0719] Purification of nutritive polypeptides from Aspergillus
niger secretion media and Bacillus subtilis secretion media were
performed using 20-40 mL of anti-FLAG resin. Prior to purification,
secretion media was adjusted to 150 mM NaCl and pH 7.4. Resin was
equilibrated by rinsing the media with an excess of 1.times.
tris-buffered saline (TBS) pH 7.4 t 0.1 and collecting it through a
0.2 um polyethersulfone (PES) vacuum filter. Equilibrated resin was
then mixed with secretion media in batch mode and allowed to mix at
room temperature for one hour. Unbound material was removed from
the resin by passing the entire mixture through a 0.2 um PES vacuum
filter. The resin was physically collected on the surface of the
filter and was subsequently washed with 20 resin volumes of TBS pH
7.4.+-.0.1 to further remove unbound material through the 0.2 um
PES vacuum filter. Washed resin was transferred to drip columns (10
mL each) and the bound polypeptides were eluted with two column
volumes (CV) of 0.1M glycine pH 3.0. The eluted polypeptides were
flowed directly from the drip columns into conical tubes that
contained 1M Tris pH 8.0; this strategy was used to neutralize the
pH of the eluted polypeptide solution as quickly as possible. Resin
was regenerated using an additional 3 CV of 0.1M glycine pH 3.0.
For short term storage, resin was stored in 1.times.TBS pH 7.4 at
4.degree. C.: for long term storage, resin was stored in
0.5.times.TBS pH 7.4, 50% glycerol at -20.degree. C.
[0720] Exemplary anti-FLAG purification of SEQID-00105 from B.
subtilis yielded 4.0 mg of protein in a 4.3 ml elution. The sample
was loaded onto a polyacrylamide gel at three different dilutions
for increased sensitivity and SEQID-00105 was found to be 95% pure.
Exemplary anti-FLAG purification of SEQID-00298 from A. niger was
performed according to the same procedure. The elution fraction was
neutralized, as described, and analyzed by SDS-PAGE and Bradford
assay as described herein. The main band in the elution was found
to be 95% pure. The main band in the elution is compared to the MW
ladder on the same gel, and matched the expected molecular weight
of SEQID-00298. Forty mL of anti-FLAG resin captured 4.0 mg of
material, resulting in an estimated resin capacity of 0, 10
mg/mL.
[0721] Purification by 5 ml Immobilized Metal Affinity
Chromatography (IMAC).
[0722] E. coli was grown in shake flask fermentation with targeted
expression of individual nutritive polypeptides with HIS8 tags, as
described herein. Cells were harvested from each shake-flask by
bucket centrifugation. The supernatant was discarded, and the cells
were suspended in 30 mM imidazole, 50 mM sodium phosphate, 0.5 M
NaCl, pH 7.5 at a wet cell weight (WCW) concentration of 20% w/v.
The suspended cells were then lysed with two passes through a
M110-P microfluidizer (Microfluidics, Westwood, Mass.) at 20,000
psi through an 87 um interaction chamber. The lysed cells were
centrifuged at 15,000 relative centrifugal force (RCF) for 120
minutes, and then decanted. Cellular debris was discarded, and the
supernatants were 0.2 um filtered. These filtered protein solutions
were then purified by immobilized metal affinity chromatography
(IMAC) on an AKTA Explorer 100 FPLC (GE Healthcare, Piscataway,
N.J.). Nutritive polypeptides were purified over 5 mL (1.6 cm
diameter.times.2.5 cm height) IMAC Sepharose 6 Fast Flow columns
(GE Healthcare, Piscataway, N.J.).
[0723] IMAC resin (GE Healthcare, IMAC Sepharose 6 Fast Flow) was
charged with nickel using 0.2 NiSO4 and washed with 500 mM NaCl,
200 mM imidazole, pH 7.5 followed by equilibration in 30 mM
imidazole, 50 mM sodium phosphate, 0.5 M NaCl, pH 7.5, 50 mL of
each protein load solution was applied onto a 5 mL IMAC column, and
washed with additional equilibration solution to remove unbound
impurities. The protein of interest was then eluted with 15 mL of
IMAC Elution Solution, 0.25 M imidazole, 0.5 M NaCl, pH 7.5. All
column blocks were performed at a linear flow rate of 150 cm/hr.
Each IMAC elution fraction was buffer exchanged by dialysis into a
neutral pH formulation solution. The purified proteins were
analyzed for concentration and purity by capillary electrophoresis
and/or SDS-PAGE. Concentration was also tested by Bradford and A280
measurement, as described herein. Table E9A demonstrates a list of
nutritive polypeptides that were purified by IMAC at 5 mL
scale.
TABLE-US-00091 TABLE E9A Nutritive polypeptides that were purified
by IMAC at 5 mL SEQID Mass (mg) Purity 00533 3 22% 00522 25.5 36%
00085 34 51% 00103 4.5 56% 00359 40.5 56% 00346 30.7 56% 00510 112
61% 00622 70 70% 00522 47 72% 00546 235.6 75% 00353 5.6 76% 00601
83.8 77% 00418 14 80% 00502 93.2 84% 00100 68 87% 00606 77.8 87%
00104 93 89% 00076 92 91% 00341 176.6 91% 00598 60.3 91% 00647 73.7
93% 00105 3.8 93% 00343 35.3 95% 00103 112 95% 00511 179 95% 00354
85.8 96% 00587 93 96% 00610 90.5 97% 00485 269 98% 00356 76.9 98%
00352 134.9 99% 00345 196.2 100% 00338 123.2 100% 00298 0.6 100%
00357 104.8 100% 00605 202 100% 00559 241.8 100% 00338 268 100%
[0724] Purification by IL Immobilized Metal Affinity Chromatography
(IMAC).
[0725] E. coli was grown in 20 L fermentation with targeted
expression of individual nutritive polypeptides with HIS8 tags, as
described herein. Cells were harvested from the fermenter and
centrifuged using a Sharples AS-16P centrifuge to collect wet cell
mass. Cells were subsequently resuspended in 30 mM imidazole, 50 mM
sodium phosphate, 0.5 M NaCl, pH 7.5 at a wet cell weight (WCW)
concentration of 20% w/v. The cell suspension was then lysed using
four passes through a Niro Soavi Homogenizer (Niro Soavi, Parma,
Italy) at an operational pressure of 12,500-15,000 psi and a flow
rate of 1 L/min. The lysate was clarified using a Beckman J2-HC
bucket centrifuge (Beckman-Coulter, Brea, Calif.) at 13,700.times.g
for 1 hour. Cellular debris was discarded, and the supernatant was
filtered through a Sartopore 11 XLG 0.8/0.2 um filter (Sartorius
Stedim, Bohemia. N.Y.) at 30 L/m2/hr. Filtered lysate was purified
by IMAC using IMAC Sepharose 6 Fast Flow resin packed in a 0.9 L
column (9 cm diameter.times.13.8 cm height).
[0726] IMAC resin was equilibrated, as described herein, at a
linear flow rate of 300 cm/hr. Once equilibrated, the entirety of
the filtered lysate was passed over the column at a linear flow
rate of 150 cm/hr. Load volumes ranged from six to ten column
volumes. After the load, unbound material was washed off of the
column, and the target protein was eluted. Elution pools were
shipped at room temperature, 4.degree. C. or frozen. This decision
was dependent on the stability of the nutritive polypeptide in
Elution Solution. Table E9B summarizes a number of nutritive
polypeptides that have been purified by IMAC at the 1 L column
scale.
TABLE-US-00092 TABLE E9B Nutritive polypeptides that have been
purified by IMAC at 1 L scale SEQID IMAC Elution Mass IMAC Elution
Purity 00240 9.00 grams 98% 00338 43.5 grams 100% 00341 54.3 grams
100% 00352 19.8 grams 100% 00559 19.5 grams 89% 00587 8.6 grams
69%
[0727] Nutritive polypeptides were filtered through a Sartopore II
XLG 0.8/0.2 .quadrature..quadrature. m filter and loaded directly
into an ultrafiltration/diafiltration (UF/DF) unit operation.
Membrane area and nominal molecular weight cutoff were chosen as
appropriate for each nutritive polypeptide. Nutritive polypeptides
were ultrafiltered at a cross flow of 12 L/m2/min and a TMP target
of 25 psi. Nutritive polypeptides were concentrated approximately
ten-fold on Hydrosart ultrafiltration cassettes (Sartorius Stedim,
Bohemia, N.Y.), and diafiltered seven diavolumes into a formulation
buffer that is specific to the nutritive polypeptide.
Ultrafiltration permeate was discarded. The diafiltered,
concentrated retentate was collected, filtered through a 0.22 um
membrane filter and frozen at -80.degree. C.
[0728] In some cases, frozen protein concentrates were lyophilized
using a Labconco lyophilizer (Labconco, Kansas City, Mo.). Residual
water content of the cake is analyzed using the Karl Fisher
method.
[0729] Purification by 10 L Immobilized Metal Affinity
Chromatography (IMAC).
[0730] E. coli was grown in 250 L fermentation with targeted
expression of individual nutritive polypeptides with HIS8 tags, as
described herein. Cells were harvested from the 250 L fermenter and
centrifuged using a Sharples AS-16P centrifuge to collect wet cell
mass. Cells were subsequently resuspended in 30 mM imidazole, 50 mM
sodium phosphate, 0.5 M NaCl, pH 7.5 at a WCW concentration of 20%
w/v. The cells suspension was then lysed using four passes through
a Niro Soavi Homogenizer (Niro Soavi, Parma, Italy) at an
operational pressure of 12,500-15,000 psi and a flow rate of 1
L/min. Clarified lysate was generated using four passes through a
Sharples AS-16P centrifuge at 15,000 rpm operated at 0.5 L/min.
Cellular debris was discarded, and the supernatant was filtered
through a series of filters. Clarified lysate was passed
sequentially through a SartoPure GF+0.65 um, a SartoGuard PES
1.2/0.2 um and a Sartopore II XLG 0.8/0.2 um filter (Sartorius
Stedim, Bohemia, N.Y.). Filtered lysate was purified by IMAC using
IMAC Sepharose 6 Fast Flow resin packed in an 8.5 column (20 cm
diameter.times.27.1 cm height).
[0731] IMAC resin was equilibrated as described at a linear flow
rate of 150 cm/hr. Once equilibrated, the filtered lysate was
passed over the column at a linear flow rate of 150 cm/hr. Load
volumes ranged from 3.8 to 5.0 CV. After the load, unbound material
was washed off of the column with additional equilibration.
Nutritive polypeptides manufactured at the 10 L IMAC scale were
subject to an additional set of washes with 2 CV of 10 mM sodium
phosphate dibasic, 300 mM NaCl 3 CV of 0.5% w/v sodium
deoxycholate, 50 mM sodium phosphate dibasic, 300 mM NaCl: and 5CV
of 10 mM sodium phosphate dibasic, 300 mM NaCl. Following the
washes, the target polypeptide was eluted as described. Elution
pools were stored at room temperature.
[0732] Multiple nutritive polypeptides were purified by IMAC
chromatography at the 10 L column scale. Table E9C summarizes the
purification of SEQID-00105 and SEQID-00338. FIG. 1 provides an
exemplary SDS-PAGE analysis of the purification of SEQID-00105.
TABLE-US-00093 TABLE E9C Nutritive polypeptides were purified by
IMAC chromatography at the 10 L column scale SEQID Mass Purity
00105 179 g 98% 00105 265 g 98% 00105 131 g 91% 00105 147 g 92%
00105 164 g 94% 00105 148 g 95% 00105 229 g 100% 00105 228 g 100%
00338 137 g 92% 00338 196 g 100% 00338 169 g 100%
[0733] After IMAC purification at the 10 L column scale, nutritive
polypeptides were filtered through a Sartopore II XLG 0.8/0.2 um
filter and loaded directly into an ultrafiltration/diafiltration
(UF/DF) unit operation. Membrane area and nominal molecular weight
cutoff were chosen as appropriate for each nutritive polypeptide.
Nutritive polypeptides were ultrafiltered at a cross flow of 12
L/m2/min and a TMP target of 25 psi. Nutritive polypeptides were
concentrated approximately ten-fold on Hydrosart ultrafiltration
cassettes (Sartorius Stedim, Bohemia, N.Y.), and diafiltered
sequentially into four diavolumes of 10% phosphate buffered saline
(PBS), pH 8.7; followed by two diavolumes of 25 mM tetrasodium
ethylenediaminetetraacetic acid (Na4EDTA); followed by seven
diavolumes of 10% PBS, pH 8.7. Intermediate diafiltration into
Na4EDTA was performed in order to chelate any leached nickel(II)
from the IMAC resin. Ultrafiltration permeate was discarded; the
diafiltered, concentrated retentate was filtered through a 0.2 um
membrane filter, and frozen at -80.degree. C.
[0734] The ultrafiltration pool was filtered with a
sterilizing-grade filter with the goal of bioburden reduction. The
nutritive polypeptide was filtered into glass trays that were
rinsed with ethanol. Filled glass trays were subsequently frozen at
-80.degree. C. The frozen material was then lyophilized to a dry
cake using a Labconco lyophilization unit (Labconco, Kansas City,
Mo.). The mass of the protein in the tray was monitored with time,
until it plateaued, which was considered to be complete drying. The
dried protein cake was sealed by the lid of the tray, and
over-packaged by vacuum sealing in a plastic bag. The entire
package was stored at -80.degree. C.
[0735] Ion Exchange Chromatography.
[0736] Selecting an appropriate method of purifying a nutritive
polypeptide has implications for the speed of process development,
cost of manufacture, final purity, and robustness of the
purification. Nutritive polypeptides have been isolated by various
chromatographic methods. The mode of chromatography selected for
use depends on the physicochemical properties of the target
nutritive polypeptide.
[0737] Charged nutritive polypeptides bind to ion exchange
chromatography resin through electrostatic interactions.
[0738] In the present application, we have defined two methods of
screening a library of polypeptides to rank-order them for their
ability to bind to ion exchange resins. One method is an in silico
prediction based on calculation of protein net charge across a
range of pH using the primary sequence of the polypeptides, as
described herein. The second method is a multiplexed purification
screen in vitro, as described herein. The two methods have
successfully been used independently of each other, and they have
been used together on the same set of 168 nutritive polypeptides
with supportive data, as described herein.
[0739] The in silico method of predictive ranking for ion exchange
purification is based on calculating net charge of a nutritive
polypeptide at a range of pH based on the primary sequence. The
primary sequence of a nutritive polypeptide is used to predict the
mode of chromatography that is most likely to successfully isolate
that nutritive polypeptide from host cell proteins and other
impurities. Highly charged nutritive polypeptides are likely to
bind tightly to ion exchange chromatography resin. The tightest
binding is achieved for nutritive polypeptides which have one
predominant charge, either positive or negative. It is possible for
a nutritive polypeptide with a mixture of positive and negative
charges to have tight binding to ion exchange resin, but it is also
possible that those charges may work against each other. Similarly,
a nutritive polypeptide with alternating positive and negative
patches on its surface may not bind as tightly as one with a
dominant portion of its surface that is one single charge.
Similarly, a nutritive polypeptide that has a strongly positive or
negative terminus, tail, tag, or linker sequence may effectively
display that highly charged group allowing for extremely tight
binding.
[0740] A prevalence of one or more certain amino acids, e.g.,
histidine, arginine, and lysine in a polypeptide imparts in that
polypeptide, or a portion thereof, a positive charge when the pH of
the protein solvent is below the pKa of the one or more amino
acids. Polypeptide charge includes total protein charge, net
charge, or the charge of a portion of the polypeptide. In
embodiments wherein a polypeptide or portion thereof is positively
charged, a cation exchange resin is used.
[0741] A prevalence of one or more certain amino acids, e.g.,
glutamic acid and aspartic acid in a polypeptide imparts in that
polypeptide, or a portion thereof, a negative charge when the pH of
the protein solvent is above the pKa of the one or more amino
acids. Polypeptide charge includes total protein charge, net
charge, or the charge of a portion of the polypeptide. In
embodiments wherein a polypeptide or portion thereof is negatively
charged, an anion exchange resin is used.
[0742] The net charge of a polypeptide changes as a function of the
pH of the protein solvent. The number of positive charges and
negative charges can be calculated at any pH based on the primary
sequence of the polypeptide. The sum of the positive charges and
negative charges at any one pH results in the calculated net
charge. The isoelectric point (pI) of the polypeptide is the pH at
which its calculated net charge is 0. To make comparisons, the net
charge of a sequence is normalized by the number of amino acids in
the sequence and the parameter "net charge per amino acid" results
as the novel comparator between sequences, which is used to predict
chromatographic performance.
[0743] Nutritive polypeptide sequences have been evaluated by
calculating the net charge per amino acid of each polypeptide at
every pH (1-14). Additionally, the pI of each polypeptide was
calculated. Nutritive polypeptides were ranked by pI and by net
charge per amino acid. Polypeptides with a low pI and very negative
net charge per amino acid across a wide range of pH are predicted
to bind to anion exchange chromatography resin with high affinity.
Polypeptides with a high pI and very positive net charge per amino
acid across a wide range of pH are predicted to bind to cation
exchange chromatography resin with high affinity. In some
embodiments herein, only a portion of the polypeptide is charged
(as in a terminus, tail, tag, or linker), it is recognized that the
pI and net polypeptide charge may be variable, and other factors or
empirical measurements may be useful to predict the binding
affinity of such a polypeptide to chromatography resins.
[0744] FIG. 2 demonstrates example nutritive polypeptides, which,
based on primary sequence, are predicted to bind to either anion or
cation exchange resin. Nutritive polypeptides with a pI of <4.0,
and a net charge per amino acid that is negative across a broad
range of pH are predicted to bind anion exchange resin with high
affinity ((1) SEQID-00105, (2) SEQID-00008, (3) SEQID-00009, (4)
SEQID-00475). Nutritive polypeptides with a pI of >10.0, and a
net charge per amino acid that is positive across a broad range of
pH are predicted to bind cation exchange resin with high affinity
((5) SEQID-00472, (6) SEQID-00640, (7) SEQID-0019).
[0745] The primary sequence analyses presented herein indicate that
SEQID-00105 and SEQID-00009 are likely to bind to anion exchange
chromatography resin with high affinity, and that SEQID-00640 is
likely to bind to cation exchange chromatography resin with high
affinity. These predictions were tested and demonstrated to be
true, as demonstrated in the following four examples of polypeptide
purification after microbial cell culture. In the first example,
SEQID-00(09 was purified directly from lysed E. coli cells to 99%
purity using anion exchange chromatography. In the second example,
SEQID-00105 was isolated from bacillus subtilis supernatant by
anion exchange chromatography. In the third example, SEQID-00105
expressed intracellularly in E. coli was refined to 100% purity
using anion exchange chromatography after it had been initially
purified by IMAC chromatography. In the fourth example, SEQID-00640
was isolated from bacillus subtilis supernatant by cation exchange
chromatography.
[0746] SEQID-00009 was expressed intracellularly in E. coli, as
described herein. The cells were suspended in solution and
ruptured. Three solutions were tested (0.1 M Na2CO3 pH 11.4, 0.1 M
tris HCl pH 4.1, and 0.1 M potassium phosphate pH 7.0). These lysed
solutions were clarified by centrifugation and mixed with anion
exchange resin for binding. Two resins were tested (Fractogel.RTM.
EMD TMAE Hicap (M) from EMD and POROS.RTM. D 50 .mu.m from Life
Technologies). These six binding conditions were performed in batch
mode and the resins were washed with the appropriate lysis buffer
to remove any unbound protein. The maximally-bound damp resin was
then transferred to smaller drip columns. Each drip column was then
eluted with up to six sequential washes of increasing NaCl
concentration (each NaCl wash solution was buffered with the
appropriate lysis buffer). SEQID-00009 was eluted in these
fractions, collected, and analyzed by chip electrophoresis, as
described herein. SEQID-00009 was identified as an eluting band at
the expected molecular weight. In every case, SEQID-00009 eluted
from the drip column at a purity higher than the load purity. This
observation indicates that SEQID-00009 did bind to the anion
exchange resins, as predicted, and that purification was achieved.
The maximum purity achieved was 99%. In every case, SEQID-00009 was
among the last proteins to elute from the resin indicating that the
binding affinity of SEQID-00009 to two resins at a range of pH is
generally higher than the binding affinity of any host cell protein
from E. coli.
[0747] Microbial cell culture of Bacillus subtilis was performed as
described herein expressing and secreting SEQID-00105 into the
fermentation media. The cells were removed by centrifugation, and
the supernatant was further clarified by membrane filtration. The
clarified supernatant was concentrated by ultrafiltration to
decrease load time on the anion exchange column and the solution
was exchanged into a low salt solution buffered at pH 6.0. This
solution was passed over a chromatography column (1 cm diameter, 20
cm height) containing POROS.RTM. XQ Strong Anion Exchange Resin
from Life Technologies. The unbound proteins were rinsed from the
resin with 20 mM Bistris, pH 6.3. The bound proteins were then
eluted using a 30 column volume gradient to 400 mM NaCl, 20 mM
Bistris, pH 6.3. The column effluent was collected in sequential
fractions and analyzed by chip electrophoresis, as described
herein. SEQID-00105 was identified as an eluting band at the
expected molecular weight. The maximum purity achieved in one
fraction was 100%.
[0748] SEQID-00105 was expressed intracellularly in E. coli, as
described herein. The cells were ruptured, and the SEQID-00105 was
purified by IMAC chromatography, according to the procedure
described herein. The IMAC elution pool was further refined to 100%
purity using anion exchange chromatography. The IMAC elution pool
was concentrated and then diluted into 50 mM tris pH 8.0. This
solution was then passed through a column (1.6 cm diameter, 20 cm
height) packed with anion exchange resin: Fractogel.RTM. EMD TMAE
Hicap (M) from EMD. The bound protein was rinsed with equilibration
solution, and then eluted with 350 mM NaCl 50 mM tris pH 8.0. This
procedure was repeated multiple times, and all samples were
analyzed by chip electrophoresis, as described herein. The elution
samples ranged from 79% to 99% pure.
[0749] Microbial cell culture of Bacillus subtilis was performed as
described herein expressing and secreting SEQID-00640 into the
fermentation media. The cells were removed by centrifugation, and
the supernatant was further clarified by membrane filtration. The
clarified supernatant was diluted 1:2 with deionized water and
titrated to pH 5 with 1 M acetic acid. The resulting solution was
membrane filtered prior to loading onto a cation exchange column
(1.2 cm diameter 10 cm height) packed with POROS.RTM. XS Strong
Cation Exchange Resin from Life Technologies. The bound resin was
flushed with a 50 mM Acetate, 50 mM NaCL pH 5.0 solution. The
protein was then eluted with a 20 CV gradient to 1.05 M NaCl pH
5.0. Elution fractions were collected and analyzed by SDS-PAGE.
Coomassie Blue Stain. The peak sample demonstrated 100% purity and
no impurities eluted later in the gradient, indicating that the
SEQID-00640 polypeptide bound to the cation exchange resin with
more affinity than any host cell proteins.
[0750] Purification by Precipitation.
[0751] Protein Precipitation is a Well-Known Method for
purification of polypeptides (Scopes R. 1987. Protein Purification:
Principles and Practice, New York: Springer). Many polypeptides
precipitate as salt concentrations increase, a phenomenon known as
salting out. Salt types have been ranked and organized on the
Hofmeister series for their different abilities to salt out
proteins (F. Hofmeister Arch. Exp. Pathol. Pharmacol. 24, (1888)
247-260.). Proteins also have different propensity to precipitate
due to high salt concentration based on their physicochemical
properties, however, a universal metric to rank proteins for this
characteristic has not been established. The use of such a ranking
metric to select nutritive polypeptides for their ability to be
purified has implications for the speed of process development,
cost of manufacture, final purity, and robustness of the
purification.
[0752] In most industrial applications of purification by
polypeptides precipitation, the polypeptide of interest is
selectively precipitated, and the impurities are then rinsed away
from the solid precipitate. In certain embodiments, polypeptides do
not precipitate with high levels of salt, and purification is
achieved by precipitating the impurities. In the present
application, we have defined two methods of screening a library of
polypeptides to rank-order them for their ability to remain soluble
through harsh precipitation conditions. One method is an in silico
prediction based on calculation of protein total charge across a
range of pH using the primary sequence of the polypeptides, as
described herein. The second method is a multiplexed purification
screen in vitro, as described herein. The two methods have
successfully been used independently of each other, and they have
been used together on the same set of 168 nutritive polypeptides
with supportive data, as described herein.
[0753] The solubility of a polypeptide correlates directly with the
abundance of surface charges (Jim Kling, Highly Concentrated
Protein Formulations: Finding Solutions for the Next Generation of
Parenteral Biologics, BioProcess International, 2014.). It has been
established that surface charges can impart physical
characteristics to a polypeptide (Lawrence. M. S., Phillips, K. J.,
& Liu, D. R. (2007). Supercharging proteins can impart unusual
resilience. Journal of the American Chemical Society, 129(33),
10110-2, doi:10.1021/ja071641y).
[0754] The in silico method of predictive solubility ranking is
based on calculating total number of charges of a nutritive
polypeptide at a range of pH based on the primary sequence.
[0755] A prevalence of one or more certain amino acids, e.g.,
histidine, arginine, and lysine in a polypeptide imparts in that
polypeptide, or a portion thereof, a positive charge when the pH of
the protein solvent is below the pKa of the one or more amino
acids. A prevalence of one or more certain amino acids, e.g.,
glutamic acid and aspartic acid in a polypeptide imparts in that
polypeptide, or a portion thereof, a negative charge when the pH of
the protein solvent is above the pKa of the one or more amino
acids.
[0756] The total number of charges of a polypeptide changes as a
function of the pH of the protein solvent. The number of positive
charges and negative charges can be calculated at any pH based on
the primary sequence of the polypeptide, as described herein. The
sum of the positive charges and negative charges at any one pH
results in the calculated net charge. The isoelectric point (pI) of
the polypeptide is the pH at which its calculated net charge is 0.
To make comparisons across nutritive polypeptides, the total number
of positive charges is added to the total number of negative
charges (the absolute value), and that total charge is normalized
by the number of amino acids in the sequence, and the parameter
"total charge per amino acid" results as the novel comparator
between sequences, which is used to predict the polypeptide's
resistance to precipitation. The more resistant a polypeptide is,
the higher the likelihood that it can be purified to a high degree
by precipitating out the impurities. Unlike predicting
chromatographic performance, solubility is not affected by the
polarity of the charges. While it is often true that a polypeptide
experiences its lowest solubility at the pI of the sequence, some
polypeptides have a high total charge and are still extremely
soluble at their pI, as shown herein.
[0757] Nutritive polypeptide sequences have been evaluated by
calculating the total charge per amino acid of each polypeptide at
a range of pH (1-14). Nutritive polypeptides were ranked by total
charge per amino acid. Polypeptides with a low pI and very negative
net charge per amino acid across a wide range of pH and
polypeptides with a high pI and very positive net charge per amino
acid across a wide range of pH are all expected to score equally
well by this ranking. Polypeptides with a large number of both
charges score the best.
[0758] FIG. 3 demonstrates example nutritive polypeptides, which,
based on primary sequence, are predicted to have extremely high
solubility. This set includes polypeptides with a low pI (<4)
and very negative net charge per amino acid across a wide range
((1) SEQID-00475. (2) SEQID-00009). This set includes polypeptides
with a high pI (>10) and very positive net charge per amino acid
across a wide range of pH ((4) SEQID-00433, (5) SEQID-00472). This
set includes polypeptides with more neutral pI ((3) SEQID-00478).
Many of the polypeptides displayed here show high charge even at
extreme pH values, such as <4 and >12. The entire set is
expected to be extremely soluble and resist precipitation across a
wide range of pH.
[0759] In this demonstration, the E. coli cells were harvested from
shake flask fermentation by centrifugation, and the whole cells
were distributed into tubes (1 gram of cells per tube). To each
tube, 4 mL of lysis solution was added, and cells were lysed by
sonication at 75 Amps for 30 seconds. Lysis solutions included:
Water, 8 M Urea 0.1 M Tris 0.1M NaCl, 0.1 M Acetate 10% gly 0.1%
Tween-80 0.3 M Arg 0.3M NaCl 10 mM EDTA, 10 mM Imidazole pH 5.0,
0.1 M Acetate 10% gly 0.1% Tween-80 0.3 M Arg 0.3M NaC 10 mM EDTA,
10 mM Imidazole pH 7.0, 100 NaCl 100 Hepes 10 Imidazole pH 7.5, 500
NaCl 100 Hepes 10 Imidazole pH 7.5, 100 mM Phos, 150 mM NaCl, 10 mM
Imidazole pH 7.5, 0.1 M NaCl 0.1 M Hepes 10 mM Imidazole 50 mM
CaCl2 PH 7.5, 0.1 M Hepes 3.5 M Am Sulfate pH 7.5, 0.1 M Hepes 2 M
Am. Sulfate pH 7.5, 0.1 M Tris, 0.1 M Tris 0.5 M NaC, 150 mM NaCl
10 mM Acetate 15 mM Imidazole pH 6.04, and 500 mM NaCl 100 mM
Acetate 15 mM Imidazole pH 6.04. The lysate was clarified by
centrifugation and 0.2 um filtration. The clarified supernatant was
analyzed by SDS-PAGE (blue stain), as described herein. SEQID-00009
demonstrated solubility in each of these conditions. E. coli host
cell proteins generally demonstrated solubility in these conditions
as well, with one exception. In the presence of 3.5 M ammonium
sulfate effectively precipitated the majority of the host cell
proteins resulting in 85% purified SEQID-00009 after the cell
harvest stage of the process. This result indicates that
SEQID-00009 is more soluble than most E. coli host cell proteins
and that precipitation can be used as part of a low cost method for
isolation. This correlates with the high total charge of
SEQID-00009 and supports that the prediction is accurate.
Furthermore, it is predicted that polypeptides with more charge
than SEQID-00009 would be even more soluble which could have the
benefit over SEQID-00009 of higher polypeptide yield.
[0760] In subsequent experiments, SEQID-00009 was purified to 99%
purity with a single stage of ammonium sulfate precipitation. In
this demonstration, the E. coli cells were harvested from shake
flask fermentation by centrifugation, and the whole cells were
suspended in 0.1 M sodium carbonate, pH 10 (1 gram of cells in 4 mL
of solution). The cells were lysed by sonication (80 Amp for 2
minutes). The lysate was clarified by centrifugation and 0.2 Um
membrane filtration. The clarified supernatant was divided into a
series of 3 mL fractions, to which a stock solution of 4 M ammonium
sulfate, pH 9.8 was added. Variable amounts of stock solution were
added to achieve a range of ammonium sulfate concentrations. The
samples were mixed for 10 minutes at room temperature, and
clarified by centrifugation and 0.2 um membrane filtration. The
clarified supernatants were analyzed by SDS-PAGE (blue stain), as
described herein. FIG. 4 shows the purity of SEQID-00009 is as a
function of ammonium sulfate concentration.
[0761] Multiplexed Purification: Ion Exchange Chromatography. In
some cases, an entire library of proteins is tested in a
multiplexed screening experimental platform, 168 nutritive
polypeptides were transfected and expressed in a multiplexed
expression system in which a single growth condition was used to
produce each polypeptide in a single container. This multiplexed
expression system allows any set of polypeptide sequences to be
tested in parallel for a wide range of manufacturability
parameters, each of which can be used to rank order the set of
polypeptides being examined. A set of manufacturability parameters
includes expression level, polypeptide solubility, ability of
polypeptide to be purified by chromatography, ability to resist
thermal denaturation, ability of polypeptide to digest, ability of
polypeptide to be purified by resisting harsh treatments.
[0762] The set of 168 nutritive polypeptides was tested for
intracellular expression in E. coli. The solubly expressed
polypeptides were pre-treated as a group and then subjected to a
series of purification conditions so that the set could be rank
ordered in terms of their ease of purification by multiple
methodologies. As described herein, it is expected that the same
subset of proteins will be identified from each expression system
to bind a particular mode of chromatography based on the primary
sequence analysis, specifically net charge per amino acid.
[0763] For E. coli multiplexed purification, the set of nutritive
polypeptide sequences was HIS8 tagged. The cells were cultured, as
described herein, ruptured, and the solution was clarified, as
described herein. This production resulted in a solution containing
all of the polypeptides from the set which were both expressed and
soluble. That set of soluble polypeptides was passed over an 5 ml
IMAC column, and eluted, as described herein. This IMAC
purification effectively isolated the solubly expressed nutritive
polypeptides as a set by removing the majority of E. coli host cell
proteins. The elution fraction was concentrated and buffer
exchanged into a low salt solution buffered near neutral pH before
testing various purification methods. The methods tested include
anion exchange chromatography, cation exchange chromatography, and
negative precipitation, in which the impurities precipitate and the
polypeptides that remain soluble rank the highest. In this case,
impurities have been removed, so the polypeptides are rank ordered
amongst themselves. Additionally, the set of proteins was tested
for thermal stability, by heating, wherein the polypeptides which
remain soluble after heating are more thermal stable than those
which precipitate.
[0764] This mixture of polypeptides was rank ordered for their
ability to bind anion exchange and cation exchange chromatography
resins. Four chromatography resins were tested. Two anion exchange
resins: Capto DEAE, from GE Lifesciences and Eshmuno.RTM., Q Resin
from EMD. Two cation exchange resins: POROS.RTM., XS Strong Cation
Exchange Resin from Life Technologies and Eshmuno.RTM. S Resin from
EMD. Each resin was tested with eight different buffering
conditions, as follows. Buffers used for anion exchange: Water (no
buffer), pH 7; 15 mM Na2HPO4, pH 8.7; 30 mM Na2HPO4, pH 9.0; 15 mM
Tris Base, pH 9.6; 30 mM Tris Base, pH 10.0; 30 mM Na2CO3, pH 11.2;
25 mM Arginine, pH 10.1. Buffers used for cation exchange:Water (no
buffer), pH 7; 15 mM KH2PO4, pH 4.2; 30 mM KH2PO4, pH 4.5; 15 mM
Tris Acid, pH 4.9; 30 mM Tris Acid, pH 4.7; 15 mM MES Acid, pH 3.9;
25 mM MES Acid, pH 4.1.
[0765] The resins were distributed to a 96 well filterplate (20 uL
of resin per well) and each was equilibrated three times. The
protein set was mixed with the equilibration buffers and allowed to
bind to the resins. The unbound proteins in solution were separated
from the resin by centrifuging the liquid through the filterplate
for collection in a 96 well plate below. The remaining unbound
proteins were further rinsed off the resin with a wash of
equilibration buffer. The bound proteins were then sequentially
eluted with three stages of increasing salt concentration (50, 250,
1500 mM NaCl buffered in the appropriate set of buffers above). The
loosely bound proteins were removed first, and the proteins that
were removed in the final elution condition were very tightly bound
to the resin. Thus, a library of 168 proteins was expressed in E.
coli and rank ordered for their binding affinity to anion exchange
and cation exchange chromatography resin.
[0766] The experiment described herein produced 160 samples (four
resins, eight buffers, five collections). The five collection
stages include: the flow through fraction, the wash fraction, the
50 mM NaCl elution, the 250 mM NaCl elution, and the 1500 mM NaCl
elution. All 160 samples were analyzed by UV-vis absorbance at 280
nm, by Bradford total protein assay, by Chip electrophoresis, and
select samples were analyzed by LC/MS/MS. All analytical assays are
described herein.
[0767] The assays demonstrated that some protein flowed through the
resin and was not bound. In most cases, the wash fraction did not
elute a significant amount of protein, indicating that any further
protein to elute was in fact bound to the resin. As the NaCl
concentration increased, the total protein being removed also
increased demonstrating successful binding and elution in nearly
every condition. The proteins detected by electrophoresis in 1500
mM NaCl elution conditions remained bound through the 250 mM NaCl
wash condition, indicating strong binding. Select conditions were
selected for LC/MS/MS analysis. The LC/MS/MS analysis was performed
with the 1500 mM NaCl elution sample from anion exchange
chromatography resin (Capto DEAE) in the 30 mM Tris Base buffering
condition. The LC/MS/MS results were searched against the sequences
of all 168 nutritive polypeptides originally expressed in the
library. Eight unique polypeptides were identified as having high
binding affinity to this anion exchange resin in this condition are
SEQID-00341, SEQID-00346, SEQID-00497, SEQID-00525, SEQID-00555,
SEQID-00605, SEQID-00606, SEQID-00610. For each polypeptide
sequence in this set, the net charge per amino acid was calculated
based on primary sequence across the range of pH tested. As
described herein, it is expected that polypeptides which bind
tightly to anion exchange resins have a net charge per amino acid
below 0 across the pH range, and this is demonstrated to be true,
with a single exception. Any exception is expected to be due to the
fact that there is charge heterogeneity across the length of the
sequence, and as described, net charge per amino acid does not
always capture that. This multiplexed screen identified a set of
polypeptides from a larger library based on their affinity to bind
anion exchange resin, and this result can be predicted based on the
primary sequence analysis, as described herein.
[0768] The LC/MS/MS analysis was performed with the 1500 mM NaCl
elution sample from cation exchange chromatography resin (Poros XS)
in the 15 mM Tris Acid buffering condition. The LC/MS/MS results
were searched against the sequences of all 168 nutritive
polypeptides originally expressed in the library. Eight unique
polypeptides were identified as having high binding affinity to
this cation exchange resin in this condition are SEQID-00302,
SEQID-495, SEQID-00522, SEQID-00537, SEQID-00546, SEQID-00547,
SEQID-00560, SEQID-00598. For each polypeptide sequence in this
set, the net charge per amino acid was calculated based on primary
sequence across the range of pH tested. As described herein, it is
expected that polypeptides which bind tightly to cation exchange
resins have a net charge per amino acid above 0 across the pH
range, and this is demonstrated to be true, with minor exception.
Any exception is expected to be due to the fact that there is
charge heterogeneity across the length of the sequence, and as
described, net charge per amino acid does not always capture that.
This multiplexed screen identified a set of polypeptides from a
larger library based on their affinity to bind cation exchange
resin, and this result can be predicted based on the primary
sequence analysis, as described herein.
[0769] In the Bacillus subtilis example of multiplexed
purification, the set of polypeptide sequences was expressed
without any type of purification tag. The cells were cultured in
flasks, as described herein and expressed and secreted the
polypeptides into the growth media. The cells were removed by
centrifugation and the solution was further clarified by membrane
filtration, as described herein. This production process resulted
in a solution containing all of the polypeptides from the set which
were both expressed and solubly secreted. That set of soluble
polypeptides was concentrated and buffer exchanged into a solution
of phosphate, pH 7.0 before testing various purification methods.
The methods tested include anion exchange chromatography, cation
exchange chromatography, and negative precipitation, in which the
impurities precipitate and the polypeptides that remain soluble
rank the highest. In these multiplexed purification studies, the
polypeptides are purified away from each other and from the host
cell proteins in order to be rank ordered amongst themselves.
[0770] This mixture of polypeptides was rank ordered for their
ability to bind to anion exchange and cation exchange
chromatography resins. Four chromatography resins were tested. Two
anion exchange resins: Capto DEAE, from GE Lifesciences and
Eshmuno.RTM. Q Resin from EMD. Two cation exchange resins:
POROS.RTM. XS Strong Cation Exchange Resin from Life Technologies
and Eshmuno.RTM. S Resin from EMD. Each resin was tested with eight
different buffering conditions. Buffers used for Anion Exchange: 18
mM BIS-TRIS, pH 6.5; 13 mM HEPES, pH 7.0; 18 mM HEPES, pH 7.5; 16
mM TRIS, pH 8.0; 32 mM TRIS, pH 8.5; 88 mM TRIS, pH 9.0; 13 mM
Na2CO3, pH 9.5; 20 mM Na2CO3, pH 10.0. Buffers used for Cation
Exchange: 19 mM Citrate, pH 3.0; 13 mM Citrate, pH 3.5; 49 mM
Acetate, pH 4.0; 22 mM Acetate, pH 4.5; 14 mM Acetate, pH 5.0; 10
mM Acetate, pH 5.5; 24 mM MES, pH 6.0; 15 mM MES, pH 6.5.
[0771] The resins were distributed to a 96 well filterplate (50
.mu.L of resin per well) and each was equilibrated three times. The
protein set was mixed with the equilibration buffers and allowed to
bind to the resins. The unbound proteins in solution were separated
from the resin by centrifuging the liquid through the filterplate
for collection in a 96 well plate below. The remaining unbound
proteins were further rinsed off the resin with two wash cycles of
equilibration buffer. The bound proteins were then sequentially
eluted with increasing salt concentration (250, 500, 1000 mM, 2000
mM NaCl). Each salt solution was buffered in the appropriate
equilibration buffer except for the 2000 mM NaCl solution which was
buffered with MES at pH 6.0 for anion exchange resins and with TRIS
at pH 8.0 for cation exchange resins. The loosely bound proteins
were removed first, and the proteins that were removed in the final
elution condition were very tightly bound to the resin. Thus, the
library of proteins was expressed in Bacillus subtilis and rank
ordered for their binding affinity to anion exchange and cation
exchange chromatography resin.
[0772] The experiment described herein produced 192 samples (four
resins, eight buffers, six collections). The six collection stages
include: the flow through fraction, the wash fraction, the 250 mM
NaC elution, the 500 mM NaCl elution, the 1000 mM NaCl elution, and
the 2000 mM NaCl elution. All 192 samples were analyzed by Chip
electrophoresis. Select samples were analyzed by SDS-PAGE. Select
samples were analyzed by LC/MS/MS. All analytical assays are
described herein. Identification of strongly bound proteins is
performed by a combination of Chip electrophoresis, SDS-PAGE, and
LC/MS/MS.
[0773] SDS-PAGE results demonstrate that the majority of
polypeptides do not bind to these resins, in fact they are found in
the flow through fraction. Therefore, the polypeptides that bind to
the resins are unique in their ability to be purified from the
majority of other polypeptides. The set of polypeptides in the
various elution fractions have been isolated from a larger set
based on their properties in a purification process, which has
implications for the manufacture, cost, development time, and
eventual purity of these polypeptides. Furthermore, of the
polypeptides that bind to resins, these can be rank ordered by
their ability to remain bound to the resin through stringent wash
conditions with increasing concentrations of NaCl. Those
polypeptides found in the 2000 mM NaCl samples have been able to
remain bound through 1000 mM NaCl wash conditions. It is widely
accepted that any polypeptide which can remain bound to an ion
exchange resin above 500 mM NaCl is considered to have very high
affinity for that resin. The banding pattern is similar between the
two cation exchange resins supporting that the proposed mechanism.
Likewise, the banding pattern is similar between the two anion
exchange resins, and represents a different sample set than those
identified by cation exchange. To rank order the individual
polypeptides identified in any subset, LC/MS/MS is utilized.
[0774] As an exemplary dataset, the LC/MS/MS results identified the
following polypeptides as binding to the Capto DEAE anion exchange
resin at pH 7.5: P39645, P37869, P80698, P80868, P21880, P80239,
P50849, P12425, 034669, P39138, P37871, P19669, P29727, P80643,
034981. P80879, P54716, P37477. As an exemplary dataset, the
LC/MS/MS results identified the following polypeptides as binding
to the Poros XS cation exchange resin at pH 4.0: 034669, P19405,
031803, 005411, 031973, 031643, P80239, P26901. P08821, P80240,
P49814, 034310, P0C178, 031925, P71014, P42111.
[0775] These polypeptides identified as having high binding
affinity were analyzed for physicochemical properties based on
their primary sequence. The net charge per amino acid was
calculated based on primary sequence across the range of pH tested.
As described herein, it is expected that polypeptides which bind
tightly to anion exchange resins have a net charge per amino acid
below 0 across the pH range, and this was generally demonstrated to
be true. As described herein, it is expected that polypeptides
which bind tightly to cation exchange resins have a net charge per
amino acid above 0 across the pH range, and this was generally
demonstrated to be true. Any exception is expected to be due to the
fact that there is charge heterogeneity across the length of the
sequence, and as described, net charge per amino acid does not
always capture that. This multiplexed screen identified a set of
polypeptides from a larger library based on their affinity to bind
anion exchange resin, and this result can be predicted based on the
primary sequence analysis, as described herein.
[0776] In the Bacillus subtilis example of multiplexed
purification, the set of 168 nutritive polypeptide sequences was
expressed without any type of purification tag. The cells were
cultured in flasks, as described herein and expressed and secreted
the polypeptides into the growth media. The methods tested included
negative flocculation/precipitation, in which the impurities
precipitate and the polypeptides that remain soluble rank the
highest. In these multiplexed purification studies, impurities are
present in the form of soluble impurities (e.g. host cell proteins,
DNA, phospholipids, and product-related impurities, such as
isoforms or aggregated species), insoluble impurities, cells, or
cellular debris (e.g. membrane fragments). Negative precipitation
was performed prior to and following removal of insoluble
impurities, cells, and cellular debris centrifugation and further
clarification by membrane filtration.
[0777] The set of solubly expressed and secreted polypeptides in
the cell suspension (prior to centrifugation and membrane
filtration) and clarified supernatant (following centrifugation and
membrane filtration) were rank ordered for their ability to
associate with the flocculating agents. Furthermore, the
flocculating agents were rank ordered for their ability to
associate with the impurities, 48 flocculating agents were tested
at two different concentrations, as follows: Ammonium Bicarbonate
(100 mM, 200 mM); Manganese Chloride (100 mM, 2(0 mM); Nickel
Sulfate (100 mM, 200 mM); Sodium Citrate(100 mM, 200 mM); Lithium
Acetate (100 mM, 200 mM): Propylene Glycol (10% v/v, 20% v/v):
Ammonium Nitrate (100 mM, 200 mM); Potassium Chloride (I00 mM, 200
mM); Sodium Sulfate (100 mM, 200 mM); Sodium Molybdate (100 mM, 200
mM); Acetic Acid (100 mM, 200 mM); Chitosan MMW (0.1% w/v, 0.2%
w/v); Ammonium Sulfate (100 mM, 200 mM); Sodium Chloride (0.5M, 1.0
M); Zinc Sulfate (100 mM, 200 mM); Sodium Nitrate (100 mM, 200 mM);
Citric Acid (100 mM, 200 mM); Guanidine HCl (0.6M, 1.2M); Ammonium
Chloride (100 mM, 200 mM); Zinc Chloride (100 mM, 200 mM);
Potassium Carbonate (100 mM, 200 mM); Sodium Phosphate (100 mM, 200
mM); Hydrochloric Acid (100 mM, 200 mM); PEG 1000 (5% w/v, 10%
w/v); Calcium Chloride (100 mM, 200 mM); Iron Citrate (100 mM, 200
mM); Potassium Nitrate (100 mM, 200 mM); Sodium Propionate (100 mM,
200 mM); Potassium Hydroxide (100 mM, 200 mM); PEG 4000 (5% w/v,
10% w/v); Choline Chloride (100 mM, 200 mM); Copper Sulfate (100
mM, 200 mM); Potassium Phosphate (100 mM, 200 mM); Sodium Succinate
(100 mM, 200 mM); Sodium Hydroxide (100 mM, 200 M); Triton X-100
(0.5% w/v, 1.0% w/v); Iron Chloride (100 mM, 200 mM); Iron Sulfate
(100 mM, 200 mM); Deoxycholic Acid (0.5% w/v, 1.0% w/v); Sodium
Thiocyanate (100 mM, 200 mM); Ethanol (10% v/v, 20% v/v); Tween 80
(0.5% w/v, 1.0% w/v); Magnesium Chloride (100 mM, 200(M); Magnesium
Sulfate (100 mM, 200 (mM); Sodium Carbonate (100 mM, 200 mM);
Sodium Thiosulfate (100 mM, 200 mM); Isopropanol (10% v/v, 20%
v/v): Urea (0.8M, 1.6M).
[0778] The cell suspension (prior to centrifugation and membrane
filtration) and clarified supernatant (following centrifugation and
membrane filtration) were distributed into a 96-well filter plate
(300 .mu.L per well for the low flocculating agent concentration
and 267 .mu.L for the high flocculating agent concentration). These
loads were diluted 0.1.times. or 0.2.times. by adding 33 .mu.L or
67 .mu.L, respectively, of concentrated flocculating agent
solutions. The resulting solution was mixed for 1 hour at room
temperature. Following mixing, the remaining soluble material was
separated from the insoluble material by centrifuging the liquid
through the filterplate for collection in a 96 well plate below.
All 192 samples were analyzed by Chip electrophoresis. Select
samples were analyzed by SDS-PAGE. Select samples were analyzed by
LC/MS/MS. All analytical assays are described herein.
[0779] SDS-PAGE results demonstrated that some conditions
effectively precipitated many polypeptides, indicating that the
soluble polypeptides in those conditions were rather soluble, and
can be isolated in these conditions. The polypeptides that were
soluble in the various precipitation conditions were isolated from
a larger set based on their properties in a purification process,
which has implications for the manufacture, cost, development time,
and eventual purity of these polypeptides. Some polypeptides are
widely soluble across a range of conditions due to their high
charge, according the mechanism described herein. To rank order the
individual polypeptides identified in any subset, LC/MS/MS is
utilized.
[0780] As an exemplary dataset, the LC/MS/MS results demonstrated
that the following polypeptides were isolated due to their
sustained solubility in 100 mM Acetic Acid, pH 5.18: O34669,
P54423, P21879, P10475, P28598, O31803, P40767, P17889, O34918,
Q08352, P24327, P37871, O31973, P81101, P50849, P26901, P80700,
O34385, P70960, P42111, P21880, P27876, P80868, P54716, O34313,
O07603, O05411, P54531, O05497, P12425, O07921, P19405, Q06797,
P02394, P24141, P09339, P37965, P07343, P37809, P0C178, P39824,
P49814. P39632, P39773, P51777, P21883, O06989, P25152, P70961,
O07593, O34310, P80860, P37437, P80698, P13243, P38494, P39645,
P39148, O31398, P08821. P08877, O05268, P04957, P28366, P31103,
P94421, P14949, P80864, P37869, P80240, P80859, O06993, O34666,
O34714, P37546, Q9KWU4, 031605, P16616, P80239, O34788, P71014,
P37571, P09124, P42971, O31925, P39793, P17865, P16263, P18429,
P05653, P26908, P33166, O34499, P08750, P54602, Q45071. P12047,
P42919, O34334, O34358, P39120, P39126, P00691, P14192, P22250,
P37870, P39116, P54484, P54488, P54547, P56849, O31579, O34629,
P30949, P54422, P54530, P54542, P96739.
[0781] As an exemplary dataset, the LC/MS/MS results demonstrated
that the following polypeptides were isolated due to their
sustained solubility in 100 mM Potassium Carbonate, pH 9.66:
O34669, P54423, P21879, P24327, P40767, P17889, O31973, P10475,
P28598, P80700, P37871, P80868, O31803, P81101, P70960, P27876,
P19405, P28366, P71014, P26901, O34385, P21880, Q06797, P24141,
P07343, P80698, P13243, P42971, P39793, O31643, P39071, O32210,
P21468, P42199, P54531, P37965, P37809, P21883, P38494, P39148,
P08877, P09124, P17865, P16263, P54602, P46906, O34918, Q08352,
P42111, O05411, O05497, O07921, P02394, P09339, P49814, P39632,
P37437, P39645, P08821, P04957, P31103, Q9KWU4, P80239, O34788,
P18429, P05653, P26908, O34499, P08750, P12047, P37870, P54547,
Q06796, Q45477, P25144, P46898, P40871, O31501, P21464, P21465,
P40409.
[0782] As an exemplary dataset, the LC/MS/MS results demonstrated
that the following polypeptides were isolated due to their
sustained solubility in 100 mM Calcium Chloride, pH 7.50: O34669,
P54423, P21879, O34918, O31803, P10475, P28598, P24327, P40767,
P80700, P27876, P37871, O34385, P13243, Q08352, O07921, P17889,
031973, P80868, P26901, P24141, P80698, P02394, Q06797, P39148,
P19405, P54531, P37965, P09339, P39645, O34788, P37571, O07909,
P70960, P21880, P42971, P37809, P80239, Q45477, P94421, P81101,
P07343, P39793, P39071, P38494, P17865, P42111, P12425, P39773,
O06989, P80864, O05411, 005497, P25144, P0CI78, P39824, P25152,
P70961, O31398, O05268, P37869, P80859, O32150, P39138, O31643,
P21468, P42199, P21883, P09124, P49814, P05653, Q06796, O34313,
P51777, O34310, O06993, O34666, O31925, P33166, P39634, P37808,
P39779, P28366, P08877, P16263, P39632, P08821, P04957, 034499,
P08750, P46898. P50849, P54716, P80860, P14949, P80240, Q45071,
O34334, O34358, P39120, P39126. P20278, P53001, P54375, O06006,
O06988, O34667, O34981, P08164. P19669, P30950, P37487, P45694,
P81102, P71014, P54602, P46906, P31103, P18429, P26908. P12047,
P40871, O07603, O34714, P37546, P42919. P00691, P22250, P39116,
P54488, P40924, C0SP93, O31760, O32023, O32106, O32167, O34962,
P12048, P25995, P28015, P28599, P34957, P35137, P37253, P37477,
P37812, P37940, P46354, P49778, P54169, P54418. P54550, P54941,
P80885, P94576, Q04796, Q06004. Q07868, Q9R911.
[0783] As an exemplary dataset, the LC/MS/MS results demonstrated
that the following polypeptides were isolated due to their
sustained solubility in 100 mM Iron Chloride, pH 4.54: P26901,
O34669, O34918, P54423, O31803, P96657, O31973. P37871, O07921,
O31643, Q06796. P17889, P80698, P80239, O05411, O07909, O31925,
P20278, P71014, P21879, P10475, P80700, P27876, Q08352, P81101,
P42111, P0C178, P39824, 032210, P28598, P24327, O34385, Q06797,
P19405, P37571, P38494, O31398, P09124, P51777. P08821, P18429,
O07593, P80868, P09339, P39645, O34788, O05268, P49814, P08877,
P39632, P04957, P14949, P31103, O06746, O07555, P40767, P02394,
P54531, P37965, P70960, P37809, P07343, P39773, P33166, P39634,
P16263, P46898, P50849, P54716, P80240, Q45071, P53001, P54375,
P26908, P42919, P40924, P14192, P54484, P56849, O06748, P12878,
P21477. P32081, P46899, P50620, P54464.
[0784] These polypeptides identified as having high solubility were
analyzed for physicochemical properties based on their primary
sequence. The total charge per amino acid was calculated based on
primary sequence across the range of pH tested. As described
herein, it is expected that the most soluble polypeptides have a
high total charge per amino acid, and this was generally
demonstrated to be true. This multiplexed screen identified a set
of polypeptides from a larger library based on their affinity to
bind anion exchange resin, and this result can be predicted based
on the primary sequence analysis, as described herein.
[0785] Multiplexed Purification: Precipitation &
Flocculation.
[0786] Conventional biopharmaceutical protein purification methods
used to remove cells and cellular debris include centrifugation,
microfiltration, and depth filters. Filter aids, such as
diatomaceous earth, can be used to enhance performance of these
steps, but they are not always effective and sometimes
significantly bind the product of interest. Their use may also
require the addition of a solid or a homogeneous suspension that
can be challenging as part of large-scale biopharmaceutical
operations.
[0787] Polymeric flocculants can be used to aid in the
clarification of mammalian cell culture process streams, but they
can have limitations. For example, protamine sulfate preparations
typically used as processing aids are limited in application due to
concerns about inactivation of the protein of interest or product
loss due to precipitation (Scopes. Protein Purification Principles
and Practice 3rd edition. Cantor eds, 22-43; 171 (1994)).
[0788] High quality reagents, such as that sold for medical use,
can be expensive. In certain instances, removal to very low levels
be required to ensure there are no adverse effects in patients. For
example, chitosan is not a well-defined reagent and there are
concerns about its consistent performance in routine use in
clarification applications. Multiple charged polymers, such as DEAE
dextran, acrylamide-based polymers often used in waste-water
treatment (NALCO Water Handbook. Section 2.1: Applications-Impurity
Removal, 3rd ed., McGraw-Hill, 2009) and polyethylene amine (PEI)
have been considered for use in clarification applications. With
respect to the latter two types of polymers, the acrylamide
reagents have the potential for contamination with toxic reagents
and polyethylene amine, while a highly effective clarification
reagent, is often contaminated with varying amounts of ethylenimine
monomer, a suspected cancer agent (Scawen et al., Handbook of
Enzyme Biotechnology 2nd edition. Wiseman eds.:15-53 (1985)).
Moreover, many of these polymers, including PEI, tend to bind
almost irreversibly to many chromatography resins, thereby limiting
downstream processing options. The regulatory and raw material
reuse concerns associated with these polymers have limited their
application primarily to academic studies.
[0789] Non-polymer based flocculants, such as alum and iron salts,
have been utilized in the wastewater treatment industry (NALCO
Water Handbook, Section 2.1: Applications-Impurity Removal, 3rd
ed., McGraw-Hill, 2009). These substances may appear to be
non-useful in processing protein products, because they may bind to
the protein product or may catalyze chemical reactions resulting in
modifications of the protein that could affect safety or
efficacy.
[0790] In some cases, an entire library of proteins is tested in a
multiplexed screening experimental platform. The 168 nutritive
polypeptide library was transfected and expressed in a multiplexed
expression system in which a single growth condition was used to
produce each polypeptide in a single container. This multiplexed
expression system allows any set of polypeptide sequences to be
tested in parallel for a wide range of manufacturability
parameters, each of which can be used to rank order the set of
polypeptides being examined. A set of manufacturability parameters
includes expression level, polypeptide solubility, ability of
polypeptide to be purified by chromatography, ability to resist
thermal denaturation, ability of polypeptide to digest, ability of
polypeptide to be purified by resisting harsh treatments.
[0791] For E. coli multiplexed purification by precipitation, the
set of 168 nutritive polypeptide sequences was HIS8 tagged. The
cells were cultured, as described herein, ruptured, and the
solution was clarified, as described herein. This production
resulted in a solution containing all of the polypeptides from the
set which were both expressed and soluble. That set of soluble
polypeptides was passed over an IMAC column, and eluted, as
described herein. This IMAC purification effectively isolated the
solubly expressed nutritive polypeptides as a set by removing the
majority of E. coli host cell proteins. The elution fraction was
concentrated and buffer exchanged into a low salt solution buffered
near neutral pH before testing various purification methods. The
methods tested include anion exchange chromatography, cation
exchange chromatography, and negative precipitation, in which the
impurities precipitate and the polypeptides that remain soluble
rank the highest. In this case, impurities have been removed, so
the polypeptides are rank ordered amongst themselves. Additionally,
the set of proteins was tested for thermal stability, by heating,
wherein the polypeptides which remain soluble after heating are
more thermal stable than those which precipitate.
[0792] The pre-treated group of polypeptides expressed by E. coli
was distributed to 32 wells of a 96 well plate (4.7 .mu.L of
protein stock per well at a total protein concentration of 43 g/L).
Stock solutions were added to each well to create the following
conditions: Control(No Additives): 42 mM Citrate/Phosphate, pH 7.1;
42 mM Citrate/Phosphate, pH 6.5; 42 mM Citrate/Phosphate, pH 6.0;
42 mM Citrate/Phosphate, pH 5.6; 42 mM Citrate/Phosphate, pH 5.0;
42 mM Citrate/Phosphate, pH 4.6; 42 mM Citrate/Phosphate, pH 4.3;
42 mM Citrate/Phosphate, pH 3.9; 42 mM Citrate/Phosphate, pH 3.7;
42 mM Citrate/Phosphate, pH 2.8; 75 mM Tris Base; 50 mM Na2CO3; 50
mM Piperazine Base; 100 mM sodium phosphate dibasic; 50 mM
ethanolamine; 100 mM sodium phosphate monobasic; 100 mM MES Acid;
100 mM Sodium Acetate, pH 4.1; 100 mM MOPS Acid; 100 mM Tris HCl;
25 mM Acetic Acid; 25 mM Boric Acid; 25 mM Citric Acid; 50 mM PIPES
Acid; 50 mM Succinic Acid; 1.2 M sodium sulfite; 1.5 M sodium
sulfite; 2.5 M Ammonium Sulfate; 3.5 M Ammonium Sulfate; 200 mM
CaCl2; 60% methanol. Water was added such that each well contained
a total of 40 uL of solution at 5 g/L. The plates were mixed for 30
minutes at room temperature, then centrifuged at 3,000 RCF for 10
minutes to pellet any precipitated protein. A sample was taken from
each well for analysis. The 96 well plate sas then heated at
95.degree. C. for 2 minutes. The plate was again centrifuged at
3,000 RCF for 10 minutes to pellet any precipitated protein, and a
sample was taken from each well for analysis. All 64 samples were
analyzed by Bradford assay, and select samples were analyzed by
chip electrophoresis, followed by LC/MS/MS. All analytical assays
are described herein. The measurements of total protein remaining
in solution demonstrate that many conditions caused polypeptide
precipitation, indicating that a portion of the conditions tested
were rigorous harsh conditions.
[0793] LC/MS/MS analysis was performed with four select samples,
described in the Table E9D. The detection of nutritive polypeptide
in the soluble fraction is noted with an X.
TABLE-US-00094 TABLE E9D Nutritive polypeptides detected in the
soluble fraction of select conditions. Detection is noted with an
X. 42 mM citrate/ 100 mM 50 mM phosphate, sodium PIPES 2.5M pH 5.6,
phosphate acid, Ammonium SEQID heated monobasic heated sulfate
SEQID-00105 X SEQID-00115 X SEQID-00302 X X X X SEQID-00304 X
SEQID-00305 X X X X SEQID-00316 X X SEQID-00323 X X SEQID-00338 X X
X X SEQID-00341 X X X X SEQID-00343 X X X X SEQID-00345 X X X X
SEQID-00346 X X X SEQID-00352 X X X X SEQID-00354 X X X X
SEQID-00356 X SEQID-00357 X X X SEQID-00485 X X SEQID-00495 X X X
SEQID-00497 X X SEQID-00502 X X X X SEQID-00507 X SEQID-00509 X
SEQID-00510 X X X X SEQID-00511 X X X SEQID-00515 X SEQID-00518 X
SEQID-00521 X X SEQID-00522 X X X X SEQID-00525 X X X X SEQID-00528
X X SEQID-00529 X X SEQID-00533 X X SEQID-00537 X X SEQID-00540 X X
X SEQID-00546 X X SEQID-00547 X X X SEQID-00553 X X X X SEQID-00555
X X SEQID-00559 X SEQID-00560 X X X SEQID-00564 X X X X SEQID-00570
X X X SEQID-00585 X X X X SEQID-00587 X X X SEQID-00592 X X X
SEQID-00598 X X X SEQID-00601 X X X SEQID-00603 X SEQID-00605 X X X
SEQID-00606 X X SEQID-00610 X SEQID-00613 X X X SEQID-00619 X
SEQID-00622 X X SEQID-00623 X X X X SEQID-00631 X X X SEQID-00632 X
X X X SEQID-00633 X X X SEQID-00641 X SEQID-00647 X X X SEQID-00648
X
[0794] LC/MS/MS data identified a number of soluble polypeptides in
each condition. The different conditions tested across the screen
represent a number of different mechanisms of precipitation, and
these different conditions were able to identify different sets of
polypeptides based on their different physicochemical properties.
Based on the number of polypeptides which remained soluble, of the
conditions examined by LC/MS/MS, the harshest condition is the 2.5
M ammonium sulfate condition at room temperature. The polypeptides
that were soluble in that condition were generally soluble in all
three other conditions tested, with few exceptions. A large number
of polypeptides were identified as being soluble after being heated
to 95.degree. C. for two minutes. In this experiment, a library of
nutritive polypeptides was physically screened for solubility
across a wide variety of conditions, and subsets of soluble
peptides were identified within each condition.
Example 11
Selection of Amino Acid Sequences of Nutritive Polypeptides from
Amino Acid Sequence Libraries Based on Solvation Scores and
Aggregation Scores, and Other Sequence-Based Analyses
[0795] Solvation Score. The solvation score is a primary
sequence-based metric for assessing the hydrophilicity and
potential solubility of a given protein. It is defined as the total
free energy of solvation (i.e. the free energy change associated
with transfer from gas phase to a dilute solution) for all amino
acid side chains, assuming each residue were solvated
independently, normalized by the total number of residues in the
sequence. The side chain solvation free energies were found
computationally by calculating the electrostatic energy difference
between a vacuum dielectric of 1 and a water dielectric of 80 (by
solving the Poisson-Boltzmann equation) as well as the non-polar,
Van der Waals energy using a linear solvent accessible surface area
model (D. Sitkoff. K. A. Sharp, B. Honig. "Accurate Calculation of
Hydration Free Energies Using Macroscopic Solvent Models". J. Phys.
Chem. 98, 1994). These solvation free energies correlate well with
experimental measurements. For amino acids with ionizable
sidechains (Arg, Asp, Cys. Glu, His, Lys and Tyr), an average
solvation free energy is based on the relative probabilities for
each ionization state at the specified pH. The solvation score is
effectively a measure of the solvation free energy assuming all
polar residues are solvent exposed and non-polar residues are
solvent excluded upon folding.
[0796] Aggregation Score. The aggregation score is a primary
sequence based metric for assessing the hydrophobicity and
likelihood of aggregation of a given protein. Using the Kyte and
Doolittle hydrophobity scale (Kyte J, Doolitile R F (May 1982). "A
simple method for displaying the hydropathic character of a
protein". J. Mol. Biol. 157 (1): 105-32), which gives hydrophobic
residues positive values and hydrophilic residues negative values,
the effective hydrophobicity as a function of sequence position is
calculated using a moving average of 5 residues centered around
each residue. The aggregation score is found by summing all those
average hydrophobicity values greater than 0 and normalizing by the
total length of the protein. The underlying understanding is that
aggregation is the result of two or more hydrophobic patches coming
together to exclude water and reduce surface exposure, and the
likelihood that a protein will aggregate is a function of how
densely packed its hydrophobic (i.e., aggregation prone) residues
are.
[0797] Charge Content.
[0798] The absolute or net charge per amino acid is calculated as a
function of pH and independently of the location of the residue
within the protein. Given a pH value and the pKa of a titratable
residue, the Henderson-Hasselbalch equation is solved to determine
the relative concentrations of each titration state (e.g. -1 or 0
for the acidic residue glutamate).
pH = pE a | log 10 ( [ A * ] [ HA ] ) ##EQU00002##
The Henderson-Hasselbalch Equation
[0799] The average charge for that titratable residue is found by
converting these relative concentrations into effective
probabilities of being charged and multiplying by the charge and
number of instances of that amino acid. The net or absolute charge
found from this procedure is then divided by the number of amino
acids to get the per amino acid value.
[0800] The residue types shown below in Table E11A are used with
the corresponding pKa values and relevant titration states. These
pKa values come from the pKa table provided in the European
Molecular Biology Open Software Suite (Rice, P. Longden, I. and
Bleasby. A. EMBOSS: The European Molecular Biology Open Software
Suite. Trends in Genetics, 16, 2000).
TABLE-US-00095 TABLE E11A Residue pKa Titration States Glutamate
-4.1 -1, 0 Aspartate -3.9 -1, 0 Arginine -12.5 0, +1 Lysine -10.8
0, +1 Histidine -6.5 0, +1 Cysteine -8.5 -1, 0 Tyrosine -10.1 -1, 0
C-terminus -3.6 -1, 0 N-terminus -8.6 0, +1
[0801] Weighted Euclidean Distance.
[0802] To identity candidate proteins with a similar amino acid
breakdown to a known, clinically efficacious blend, a weighted
Euclidean distance based search strategy is used. In principle,
this means computing the weighted percent differences for each
amino acid relative to the target amino acid distribution, as
defined by the following equation:
Distance = ? ##EQU00003## ? indicates text missing or illegible
when filed ##EQU00003.2##
[0803] where AA is the set of all amino acids in the target
distribution, x.sub.i is the fraction by weight of amino acid i in
the candidate protein sequence, x.sub.i.sup.T is the fraction by
weight of amino acid i in the target amino acid distribution, and
.alpha..sub.i is the relative weight associated with amino acid i.
The relative weights were applied to ensure that large deviations
from the most important amino acid targets were appropriately
penalized.
[0804] As an example, for treatment of sarcopenia, support of
exercise, and stimulation of thermogenesis amino acid blends (given
the relative importance of Leucine and the other two branched chain
amino acids, Isoleucine and Valine) relative weights of 3:2:2 for
Leucine, Valine, and Isoleucine were used. All other amino acids
were given a relative weight of 1.
[0805] Allergenicity.
[0806] The allergenicity score is a primary sequence based metric
based on WHO recommendations
(fao.org/ag/agn/food/pdf/allergygm.pdf) for assessing how similar a
protein is to any known allergen, the primary understanding being
that high percent identity between a target and a known allergen is
likely indicative of cross reactivity. For a given protein, the
likelihood of eliciting an allergic response is assessed via a
complimentary pair of sequence homology based tests. The first test
determines the protein's percent identity across the entire
sequence via a global-local sequence alignment to a database of
known allergens using the FASTA algorithm with the BLOSUM50
substitution matrix, a gap open penalty of 10, and a gap extension
penalty of 2. It is suggested that proteins with less than 50%
global homology across both sequences are unlikely to be allergenic
(Goodman R. E. et al. Allergenicity assessment of genetically
modified crops--what makes sense? Nat. Biotech. 26, 73-81 (2008);
Aalberse R. C. Structural biology of allergens. J. Allergy Clin.
Immunol. 106, 228-238 (2000).). The second test assesses the local
allergenicity along the protein sequence by determining the local
allergenicity of all possible contiguous 80 amino acid fragments
via a global-local sequence alignment of each fragment to a
database of known allergens using the FASTA algorithm with the
BLOSUM50 substitution matrix, a gap open penalty of 10, and a gap
extension penalty of 2. The highest percent identity of any 80
amino acid window with any allergen is taken as the final score for
the protein of interest. The WHO guidelines suggest using a 35%
identity cutoff. The custom database comprises pooled allergen
lists collected by the Food Allergy Research and Resource Program
(allergenonline.org/), UNIPROT annotations
(uniprot.org/docs/allergen), and the Structural Database of
Allergenic Proteins (SDAP, fermi.utmb.edu/SDAPisdap_lnk.html). This
database includes all currently recognized allergens by the
International Union of Immunological Societies (IUIS,
allergen.org/) as well as a large number of additional allergens
not yet officially named.
[0807] Toxicity/Nonalergenicity/Antinutricity.
[0808] The toxicity, nonallergenicity, and anti-nutricity of a
protein are all assessed similarly, by determining the protein's
percent identity to databases of known toxic, nonallergenic, and
protease inhibitory proteins, respectively. The toxicity and
anti-nutritive qualities are assumed to be a function of the whole
protein (i.e., a fragment of a known toxic protein will not be
toxic), as their toxic and inhibitory mechanisms of action are
often structural in nature (Huntington J., Read R, Carrell R.
"Structure of a serpin-protease complex shows inhibition by
deformation". Nature 407 (2000): 923-6; Van den Born H. K. et al.
Theoretical analysis of the structure of the peptide fasciculin and
its docking to acetylcholinesterase. Protein Sci. 4 (1995):
703-715.: and Harel M. Crystal structure of an
acetylcholinesterase-fasciculin complex: interaction of a
three-fingered toxin from snake venom with its target. Structure. 3
(1995): 1355-1366.). Given that protein structure is a function of
the entire protein sequence, a global-global alignment is performed
of the protein of interest against the two respective databases
using the FASTA algorithm with the BLOSUM50 substitution matrix, a
gap open penalty of 10, and a gap extension penalty of 2. A cut off
of 35% can be used. While it does not provide specific instructions
of how to avoid toxic/antinutritive polypeptides, reference Delaney
B. et al. Evaluation of protein safety in the context of
agricultural biotechnology. Food. Chem. Toxicol. 46 (2008: S71-S97
suggests that one should avoid both known toxic and antinutritive
polypeptides when assessing the safety of a possible food
protein.
[0809] The nonallergenicity of a protein is related to its
likelihood of eliciting an allergenic response upon exposure
(similar to but opposite of allergenicity). Specifically, the human
immune system is exposed to a multitude of possible allergenic
proteins on a regular basis, and has the intrinsic ability to
determine self from non-self. The exact nature of this ability is
not always clear, and there are many diseases that arise as a
result of the failure of the body to differentiate self from
non-self (e.g. arthritis). Nonetheless, the understanding is that
proteins that look (i.e. share a large degree of sequence homology
to) a lot like nonallergenic (i.e., human) proteins are less likely
to elicit an immune response. In particular, it has been shown that
for some protein families with known allergenic members
(tropomyosins, parvalbumins, caseins), those proteins that bear
more sequence homology to their human counterparts relative to
known allergenic proteins, are not thought to be allergenic
(Jenkins J. A. et al. Evolutionary distance from human homologs
reflects allergenicity of animal food proteins. J. Allergy Clin
Immunol. 120 (2007): 1399-1405.) For a given protein, the
nonallergenicity score is measured by determining the maximum
percent identity of the protein to a database of human proteins
from a global-local alignment using the FASTA algorithm with the
BLOSUM50 substitution matrix, a gap open penalty of 10, and a gap
extension penalty of 2. Cutoffs can vary. For example, Jenkins J.
A. et al. (Evolutionary distance from human homologs reflects
allergenicity of animal food proteins. J. Allergy Clin Immunol. 120
(2007): 1399-1405) claim that proteins with a sequence identity to
a human protein above .about.62% are less likely to be
allergenic.
Example 12
Expression of Nutritive Polypeptides
[0810] The lists below include all the nutritive protein sequences
that were expressed in Escherichia coli, Bacillus, Aspergillus
niger, and mammalian cells. In E. coli, the proteins were detected
in either whole cell lysates or in the soluble fraction of the cell
lysate. In Bacillus, expression was detected in either cell lysates
or secreted supernatants of Bacillus subtilis or Bacillus
megaterium. In Aspergillus niger, proteins were secreted from the
fungus and detected in the supernatant. For proteins expressed in
mammalian cells, they were expressed in either in Chinese Hamster
Ovarian-S strain (CHO-S) or Human Embryonic Kidney 293F strain
(HEK293F). Expression was measured by the following metrics: mass
spectrometry spectrum counts for protein expression data acquired
from LC-MS/MS in pooled library. SDS-PAGE, Chip Electrophoresis,
dot blot, Western blot and ELISA for individual protein expression
as described above.
[0811] The following nutritive polypeptides were detected in either
whole cell lysates or in the soluble fraction of the cell lysates
of Escherichia coli: SEQID-00001, SEQID-00002, SEQID-00003,
SEQID-00004, SEQID-00005, SEQID-00007, SEQID-00008, SEQID-00009,
SEQID-00011, SEQID-00012, SEQID-00013, SEQID-00014, SEQID-00015,
SEQID-00016, SEQID-00020, SEQID-00021, SEQID-00024, SEQID-00025,
SEQID-00027, SEQID-00028, SEQID-00029, SEQID-00030, SEQID-00031.,
SEQID-00033, SEQID-00043, SEQID-00049, SEQID-00051, SEQID-00052,
SEQID-00053, SEQID-00054, SEQID-00055, SEQID-00057, SEQID-00059,
SEQID-00060, SEQID-00061, SEQID-00068, SEQID-00070, SEQID-00071,
SEQID-00073 SEQID-00074, SEQID-00075, SEQID-00076, SEQID-00077,
SEQID-00078. SEQID-00083, SEQID-00084, SEQID-00085, SEQID-00086,
SEQID-00087, SEQID-00088, SEQID-00090, SEQID-00091, SEQID-00092,
SEQID-00093, SEQID-00098, SEQID-00099, SEQID-00100, SEQID-00101,
SEQID-00102, SEQID-00103, SEQID-00104, SEQID-00105, SEQID-00106,
SEQID-00107, SEQID-00108, SEQID-00110, SEQID-00112, SEQID-00113,
SEQID-001115, SEQID-00116, SEQID-00117, SEQID-00118, SEQID-00123,
SEQID-00124, SEQID-00128, SEQID-00130, SEQID-00131, SEQID-00132,
SEQID-00134, SEQID-00137, SEQID-00139, SEQID-00140, SEQID-00141,
SEQID-00142, SEQID-00143, SEQID-00145. SEQID-00146, SEQID-00148,
SEQID-00150, SEQID-00151, SEQID-00152, SEQID-00153, SEQID-00154,
SEQID-00155, SEQID-00157, SEQID-00158, SEQID-00159, SEQID-00162,
SEQID-00166, SEQID-00169, SEQID-00175, SEQID-00193, SEQID-00194,
SEQID-00195, SEQID-00196, SEQID-00197, SEQID-00198, SEQID-00199,
SEQID-00200, SEQID-00201, SEQID-00202, SEQID-00203, SEQID-00204,
SEQID-00205, SEQID-00211, SEQID-00212, SEQID-00213, SEQID-00214,
SEQID-00215, SEQID-00216, SEQID-00218, SEQID-00219, SEQID-00220,
SEQID-00221, SEQID-00223, SEQID-00224, SEQID-00225, SEQID-00226.
SEQID-00227, SEQID-00228, SEQID-00230, SEQID-00232, SEQID-00233,
SEQID-00234, SEQID-00235, SEQID-00236, SEQID-00237, SEQID-00239,
SEQID-00240, SEQID-00241, SEQID-00264, SEQID-00265, SEQID-00266,
SEQID-00267, SEQID-00268, SEQID-00269, SEQID-00270, SEQID-00271,
SEQID-00273, SEQID-00274, SEQID-00275, SEQID-00276, SEQID-00284,
SEQID-00287, SEQID-00297, SEQID-00298, SEQID-00299, SEQID-00302,
SEQID-00303, SEQID-00304, SEQID-00305, SEQID-00306, SEQID-00307,
SEQID-00309, SEQID-00318, SEQID-00322, SEQID-00325, SEQID-00326,
SEQID-00327, SEQID-00328. SEQID-00329, SEQID-00332, SEQID-00335,
SEQID-00336, SEQID-00337, SEQID-00338, SEQID-00341, SEQID-00343,
SEQID-00344, SEQID-00345, SEQID-00346, SEQID-00349, SEQID-00350,
SEQID-00352, SEQID-00353, SEQID-00354, SEQID-00355, SEQID-00356,
SEQID-00357, SEQID-00358, SEQID-00359, SEQID-00360, SEQID-00362,
SEQID-00363, SEQID-00408, SEQID-00409, SEQID-00415, SEQID-00416,
SEQID-00418, SEQID-00424, SEQID-00481, SEQID-00482, SEQID-00483,
SEQID-00484, SEQID-00485, SEQID-00486, SEQID-00487, SEQID-00488,
SEQID-00489, SEQID-00490, SEQID-00491, SEQID-00492. SEQID-00493,
SEQID-00494, SEQID-00495, SEQID-00496, SEQID-00497, SEQID-00498,
SEQID-00499, SEQID-00500, SEQID-00501, SEQID-00502, SEQID-00503,
SEQID-00504, SEQID-00505, SEQID-00506, SEQID-00507, SEQID-00508,
SEQID-00509, SEQID-00510, SEQID-00511, SEQID-00512, SEQID-00513,
SEQID-00514, SEQID-00515, SEQID-00516, SEQID-00517, SEQID-00518,
SEQID-00519, SEQID-00520, SEQID-00521, SEQID-00522, SEQID-00523,
SEQID-00524, SEQID-00525, SEQID-00526, SEQID-00527, SEQID-00528,
SEQID-00529, SEQID-00530, SEQID-00531, SEQID-00532, SEQID-00533,
SEQID-00534, SEQID-00535, SEQID-00536, SEQID-00537, SEQID-00538,
SEQID-00539, SEQID-00540, SEQID-00541, SEQID-00542, SEQID-00543,
SEQID-00544, SEQID-00545, SEQID-00546, SEQID-00547, SEQID-00548,
SEQID-00549, SEQID-00550, SEQID-00551, SEQID-00552, SEQID-00553,
SEQID-00554, SEQID-00555, SEQID-00556, SEQID-00557, SEQID-00558,
SEQID-00559, SEQID-00560, SEQID-00561, SEQID-00562, SEQID-00563,
SEQID-00564, SEQID-00565, SEQID-00566, SEQID-00567, SEQID-00568,
SEQID-00569, SEQID-00570, SEQID-00571, SEQID-00572, SEQID-00573,
SEQID-00574, SEQID-00575, SEQID-00576, SEQID-00577, SEQID-00578,
SEQID-00579, SEQID-00580, SEQID-00581, SEQID-00582, SEQID-00583,
SEQID-00584, SEQID-00585, SEQID-00586, SEQID-00587, SEQID-00588,
SEQID-00589, SEQID-00590, SEQID-0059 I. SEQID-00592, SEQID-00593,
SEQID-00594, SEQID-00595, SEQID-00596, SEQID-00597, SEQID-00598,
SEQID-00599, SEQID-00600, SEQID-00601, SEQID-00602, SEQID-00603,
SEQID-00604, SEQID-00605, SEQID-00606. SEQID-00607, SEQID-00608,
SEQID-00609, SEQID-00610, SEQID-006 ii, SEQID-00612, SEQID-00613,
SEQID-00614, SEQID-00615, SEQID-00616, SEQID-00617, SEQID-00618,
SEQID-00619, SEQID-00620, SEQID-00621, SEQID-00622, SEQID-00623,
SEQID-00624, SEQID-00625, SEQID-00626, SEQID-00627, SEQID-00628,
SEQID-00629, SEQID-00630, SEQID-00631, SEQID-00632, SEQID-00633,
SEQID-00634, SEQID-00635, SEQID-00636, SEQID-00637, SEQID-00638,
SEQID-00639, SEQID-00640, SEQID-00641, SEQID-00642, SEQID-00643,
SEQID-00644, SEQID-00645, SEQID-00646, SEQID-00647, SEQID-00648.
SEQID-00669, SEQID-00670, SEQID-00671, SEQID-00672, SEQID-00673,
SEQID-00674, SEQID-00675, SEQID-00676, SEQID-00677, SEQID-00678,
SEQID-00679, SEQID-00680, SEQID-00681, SEQID-00682, SEQID-00716,
SEQID-00717, SEQID-00718, SEQID-00719, SEQID-00720, SEQID-00723,
SEQID-00724, SEQID-00725, SEQID-00)726, SEQID-00727, SEQID-00728,
SEQID-00729, SEQID-00730, SEQID-00731, SEQID-00732, SEQID-00734,
SEQID-00735, SEQID-00736, SEQID-00737, SEQID-00738, SEQID-00739,
SEQID-00740, SEQID-00741, SEQID-00742, SEQID-00743, SEQID-00744,
SEQID-00745, SEQID-00746. SEQID-00747, SEQID-00748, SEQID-00749,
SEQID-00750, SEQID-00751, SEQID-00752, SEQID-00753, SEQID-00754,
SEQID-00755, SEQID-00756, SEQID-00757, SEQID-00758, SEQID-00759,
SEQID-00760, SEQID-00761, SEQID-00763, SEQID-00765, SEQID-00766,
SEQID-00767, SEQID-00768, SEQID-00769, SEQID-00770, SEQID-00771,
SEQID-00772, SEQID-00773, SEQID-00774, SEQID-00775, SEQID-00777,
SEQID-00778, SEQID-00780, SEQID-00781, SEQID-00782, SEQID-00783,
SEQID-00784, SEQID-00785, SEQID-00786, SEQID-00787, SEQID-00788,
SEQID-00789, SEQID-00790, SEQID-00791, SEQID-00792, SEQID-00793,
SEQID-00794, SEQID-00795, SEQID-00796, SEQID-00797, SEQID-00798,
SEQID-00799, SEQID-00801, SEQID-00802, SEQID-00803, SEQID-00804,
SEQID-00805, SEQID-00806, SEQID-00807, SEQID-00808, SEQID-00809,
SEQID-00810, SEQID-00811, SEQID-00812, SEQID-00813, SEQID-00814,
SEQID-00815, SEQID-00816, SEQID-00817. SEQID-00818, SEQID-00819,
SEQID-00820, SEQID-00821, SEQID-00822, SEQID-00823. SEQID-00824,
SEQID-00825, SEQID-00826, SEQID-00827, SEQID-00828, SEQID-00829,
SEQID-00830, SEQID-00831, SEQID-00832, SEQID-00833, SEQID-00834,
SEQID-00835, SEQID-00836, SEQID-00837.
[0812] The following nutritive polypeptides were detected in either
cell lysates or secreted supernatants of Bacillus subtilis or
Bacillus megaterium: SEQID.-00003, SEQID-00004, SEQID-00005,
SEQID-00087, SEQID-00099, SEQID-00102, SEQID-00103, SEQID-00105.
SEQID-00115, SEQID-00218, SEQID-00220, SEQID-00223, SEQID-00226,
SEQID-00236. SEQID-00240, SEQID-00267, SEQID-00271, SEQID-00276,
SEQID-00297, SEQID-00298, SEQID-00299, SEQID-00302, SEQID-00303,
SEQID-00304, SEQID-00305, SEQID-00306, SEQID-00307, SEQID-00309,
SEQID-00318, SEQID-00322, SEQID-00325, SEQID-00326, SEQID-00327,
SEQID-00328, SEQID-00329, SEQID-00330, SEQID-00332, SEQID-00335,
SEQID-00336, SEQID-00337, SEQID-00338, SEQID-00340, SEQID-00341,
SEQID-00343, SEQID-00344, SEQID-00345, SEQID-00346, SEQID-00349,
SEQID-00350, SEQID-00352. SEQID-00353, SEQID-00354, SEQID-00355,
SEQID-00356, SEQID-00357, SEQID-00358, SEQID-00359, SEQID-00360,
SEQID-00361, SEQID-00362, SEQID-00363, SEQID-00374, SEQID-00389,
SEQID-00398, SEQID-00403, SEQID-00404, SEQID-00405, SEQID-00407,
SEQID-00409, SEQID-00415, SEQID-00416, SEQID-00417, SEQID-00418,
SEQID-00419, SEQID-00420, SEQID-00421, SEQID-00424, SEQID-00481I,
SEQID-00482, SEQID-00483, SEQID-00484, SEQID-00485, SEQID-00486,
SEQID-00487, SEQID-00488, SEQID-00489. SEQID-00490, SEQID-00491,
SEQID-00492, SEQID-00493, SEQID-00494, SEQID-00495. SEQID-00496,
SEQID-00497, SEQID-00498, SEQID-00499, SEQID-00500, SEQID-00501,
SEQID-00502, SEQID-00503, SEQID-00504, SEQID-00505, SEQID-00506,
SEQID-00507, SEQID-00508, SEQID-00509, SEQID-00510, SEQID-00511,
SEQID-00512, SEQID-00513, SEQID-00514, SEQID-00515, SEQID-00516,
SEQID-00517, SEQID-00518, SEQID-00519, SEQID-00520, SEQID-00521,
SEQID-00522, SEQID-00523, SEQID-00524, SEQID-00525, SEQID-00526,
SEQID-00527, SEQID-00528, SEQID-00529, SEQID-00530, SEQID-00531.
SEQID-00532, SEQID-00533, SEQID-00534, SEQID-00535, SEQID-00536,
SEQID-00537, SEQID-00538, SEQID-00539, SEQID-00540, SEQID-00541,
SEQID-00542, SEQID-00543, SEQID-00544, SEQID-00545, SEQID-00546,
SEQID-00547, SEQID-00548, SEQID-00549, SEQID-00550, SEQID-00551,
SEQID-00552, SEQID-00553, SEQID-00554, SEQID-00555, SEQID-00556,
SEQID-00557, SEQID-00558, SEQID-00559, SEQID-00560, SEQID-00561,
SEQID-00562, SEQID-00563, SEQID-00564, SEQID-00565, SEQID-00566,
SEQID-00567, SEQID-00568, SEQID-00569, SEQID-00570, SEQID-00571,
SEQID-00572, SEQID-00573, SEQID-00574, SEQID-00575, SEQID-00576,
SEQID-00577, SEQID-00578, SEQID-00579, SEQID-00580, SEQID-00581,
SEQID-00582, SEQID-00583, SEQID-00584, SEQID-00585, SEQID-00586,
SEQID-00587, SEQID-00588, SEQID-00589, SEQID-00590, SEQID-00591,
SEQID-00592, SEQID-00593, SEQID-00594, SEQID-00595, SEQID-00596,
SEQID-00597, SEQID-00598, SEQID-00599, SEQID-00600, SEQID-00601,
SEQID-00602, SEQID-00603, SEQID-00604, SEQID-00605, SEQID-00606,
SEQID-00607, SEQID-00608, SEQID-00609, SEQID-00610, SEQID-00611,
SEQID-00612, SEQID-00613, SEQID-00614, SEQID-00615. SEQID-00616,
SEQID-00617, SEQID-00618, SEQID-00619, SEQID-00620, SEQID-00621,
SEQID-00622, SEQID-00623, SEQID-00624, SEQID-00625, SEQID-00626,
SEQID-00627, SEQID-00628, SEQID-00629, SEQID-00630, SEQID-00631,
SEQID-00632, SEQID-00633, SEQID-00634, SEQID-00635, SEQID-00636,
SEQID-00637, SEQID-00638, SEQID-00639, SEQID-00640, SEQID-00641,
SEQID-00642, SEQID-00643, SEQID-00644, SEQID-00645, SEQID-00646,
SEQID-00647, SEQID-00648, SEQID-00653, SEQID-00654, SEQID-00655,
SEQID-00656, SEQID-00657, SEQID-00659, SEQID-00660, SEQID-00664,
SEQID-00668. SEQID-00670, SEQID-00671, SEQID-00672, SEQID-00673,
SEQID-00674, SEQID-00675, SEQID-00676, SEQID-00678, SEQID-00679,
SEQID-00680, SEQID-00681, SEQID-00682, SEQID-00690, SEQID-00710,
SEQID-00711, SEQID-00712, SEQID-00713, SEQID-00714, SEQID-00715,
SEQID-00716, SEQID-00717, SEQID-00718, SEQID-00719, SEQID-00720,
SEQID-00723, SEQID-00724, SEQID-00725, SEQID-00726, SEQID-00727,
SEQID-00728, SEQID-00729, SEQID-00730, SEQID-00731, SEQID-00734,
SEQID-00735, SEQID-00736, SEQID-00737, SEQID-00738, SEQID-00739,
SEQID-00740, SEQID-00741, SEQID-00742. SEQID-00743, SEQID-00744,
SEQID-00745, SEQID-00746, SEQID-00747, SEQID-00748, SEQID-00749,
SEQID-00750, SEQID-00751, SEQID-00752, SEQID-00753, SEQID-00754,
SEQID-00755, SEQID-00756, SEQID-00757, SEQID-00758, SEQID-00759,
SEQID-00760, SEQID-00761, SEQID-00763, SEQID-00765, SEQID-00766,
SEQID-00767, SEQID-00768, SEQID-00769, SEQID-00770, SEQID-00771,
SEQID-00772, SEQID-00773, SEQID-00774, SEQID-00775, SEQID-00777,
SEQID-00778, SEQID-00780, SEQID-00781, SEQID-00782, SEQID-00783,
SEQID-00784, SEQID-00785, SEQID-00786, SEQID-00787, SEQID-00788,
SEQID-00789, SEQID-00790, SEQID-00791, SEQID-00792, SEQID-00793,
SEQID-00794, SEQID-00795, SEQID-00796, SEQID-00797, SEQID-00798,
SEQID-00799, SEQID-00800, SEQID-00801, SEQID-00802, SEQID-00803,
SEQID-00804, SEQID-00805 SEQID-00806, SEQID-00807, SEQID-00808,
SEQID-00809, SEQID-00810, SEQID-00811, SEQID-00812, SEQID-00813
SEQID-00814, SEQID-00815, SEQID-00816, SEQID-00817 SEQID-00818.
SEQID-00819, SEQID-00820, SEQID-00821, SEQID-00822, SEQID-00823,
SEQID-00824, SEQID-00825, SEQID-00826, SEQID-00827, SEQID-00828,
SEQID-00829, SEQID-00830, SEQID-00831, SEQID-00832, SEQID-00833,
SEQID-00834, SEQID-00835, SEQID-00836, SEQID-00837.
[0813] The following nutritive polypeptides were detected from the
secreted supernatant of Aspergillus niger SEQID-00087, SEQID-00103,
SEQID-00105, SEQID-00112, SEQID-00115, SEQID-00218, SEQID-00298,
SEQID-00341, SEQID-00352, SEQID-00354, SEQID-00363, SEQID-00406,
SEQID-00409, SEQID-00415, SEQID-00416, SEQID-00417, SEQID-00418,
SEQID-00419, SEQID-00420, SEQID-00421, SEQID-00424, SEQID-00552,
SEQID-00554.
[0814] The following nutritive polypeptides were expressed in the
mammalian cell lines Chinese Hamster Ovarian-S strain (CHO-S) or
Human Embryonic Kidney 293F strain (HEK293F): SEQID-00001,
SEQID-00103, SEQID-00105, SEQID-00298.
Example 13
Expression of Nutritive Polypeptides in E. coli Bacteria
[0815] A nutritive polypeptide sequence library was generated from
edible species and screened to demonstrate nutritive polypeptide
expression in E. coli.
[0816] Gene Synthesis & Plasmid Construction.
[0817] All genes were made synthetically by either Life
Technologies/GeneArt or DNA2.0, and optimized for expression in
Escherichia coli. The genes were cloned into pET15b (EMD
MilliporetNovagen) using the NdeI-BamHI restriction sites within
the multiple cloning site (therefore containing an amino-terminal
MGSSHHHHHHSSGLVPRGSH tag), or cloned into the NcoI-BamHI sites
(therefore removing the amino terminal tag on the plasmid) using
primers to include an amino terminal tag containing MGSHHHHHHHH or
MGSHHHHHHHHSENLYFQG, pET15b contains a pBR322 origin of
replication, a lac-controlled T7 promoter, and a bla gene
conferring resistance to carbenicillin. For manually cloned
fragments, inserts were verified by Sanger sequencing using both
the T7 promoter primer and the T7 terminator primer. For the
secreted constructs, the genes were cloned into pJ444 vector (DNA
2.0, USA) upstream of T5 terminator with C-terminal HHHHHHHH tag
and DsbA signal peptide
(ATGAAAAAGATTTGGCTGCCTGGGCTGGTTTAGTITAGCGTTTAGCGCATCGG CG) in
N-terminal.
[0818] Strain Construction. T7 Express Competent E. coli was
purchased from New England Biolabs and was used as the parent
strain. T7 Express is an enhanced BL21 derivative which contains
the T7 RNA polymerase in the lac operon, while still lacking the
Lon and OmpT proteases. The genoptype of T7 Express is: fhuA2
lacZ::T7 gene1 [Ion] ompT gal sulA11 R(mcr-73::miniTn10-TetS)2
[dcm] R(zgb-210::Tn10-TetS) endA1 .DELTA.(mcrC-mrr) 114::IS10. For
secreted constructs, CGSC 5610 (Yale E. coli genetic stock center,
USA) was used for the study. The genotype of CGSC 5610 is F-, lacY1
or .DELTA.(cod-lacI)6, glnV44(AS), galK2(Oc), galT22, .lamda.-, e
14-, mcrA0, rfbC1, metB1, mcrB1, hsdR2. Roughly 1 ng of purified
plasmid DNA described above was used to transform chemically
competent T7 Express and single colonies were selected on LB agar
plates containing 100 mg/l carbenicillin after roughly 16 hr of
incubation at 37.degree. C. Single colonies were inoculated into
liquid LB containing 100 mg/l carbenicillin and grown to a
cell-density of OD600 nm=0.6, at which point, glycerol was
supplemented to the medium at 10% (v/v) and an aliquot was taken
for storage in a cryovial at -80.degree. C.
[0819] Expression Testing.
[0820] Expression cultures were grown in LB medium (10 g/l NaCl, 10
g/l tryptone, and 5 g/l yeast extract) or in BioSilta EnBase medium
and induced with isopropyl A-D-1-thiogalactopyranoside (IPTG). For
expression testing in LB media, a colony or stab from a glycerol
stock was inoculated into 3 ml LB supplemented with 100 mg/l
carbenicillin and grown overnight (roughly 16 hr) at 37.degree. C.
and 250 rpm. The next morning, the cell-density
(spectrophotometrically at OD600 nm) was measured and diluted back
to OD6(H)nm=0.05 into 3 ml LB medium supplemented with
carbenicillin and grown at 37.degree. C. and 250 rpm. At OD600
nm=0.8.+-.0.2 the cultures were induced with 1 mM IPTG.
Heterologous expression was allowed to proceed for 2 hr at
37.degree. C. and 250 rpm, at which point the cultures were
terminated. The terminal cell-density was measured. For expression
with Enbase media, a colony or stab from a glycerol stock was
inoculated into 3 ml LB with 100 mg/l carbenicillin and transferred
to Enbase media with 100 mg/l carbenicillin and 600 mU/l of
glucoamylase at OD600=0.1 and grown overnight at 37.degree. C. and
250 rpm and induced with 1 mM IPTG next day. Heterologous
expression was allowed for 24 hours at 37.degree. C. and 250 rpm,
at which point the cultures were terminated. The terminal
cell-density was measured and the cells were harvested by
centrifugation (3000 rpm, 10 min, RT). To determine intracellular
production the cells were lyzed with B-PER (Pierce) according to
manufacturer's protocol and then assayed to measure protein of
interest (POI). To determine the levels of secreted protein, 0.5-ml
aliquots of the culture supernatants were filtered by a 0.22 .mu.m
filter. The filtrates were then assayed to determine the levels of
secreted protein of interest (POI).
[0821] Fermentation. The intracellular soluble proteins
SEQID-00105, SEQID-00240, SEQID-00338, SEQID-00341, SEQID-00352,
SEQID-00363, SEQID-00423, SEQID-00424, SEQID-00425, SEQID-00426,
SEQID-00429, SEQID-00559, and SEQID-00587 were expressed in E. coli
host cells NEB T7 Express (New England BioLabs) in 20 and/or 250 L
fermentations. The fermentation occurred in a carbon and nitrogen
rich media containing: Yeast Extract, Soy Hydrolysate, Glycerol,
Glucose, and Lactose. The fermentation occurred at 30.degree. C.
and induction occurred when the Glucose present in the media was
exhausted and Lactose became the primary carbon source sugar. The
fermentation process time generally lasted 24-26 hrs. Fermentation
run parameters were controlled at a pH of 6.9, temperature of
30.degree. C., and a percent dissolved oxygen of 35%. The culture
was supplemented with a Glycerol based feed in the later stages of
the culture duration. Harvest occurred when the cells entered
stationary phase and no longer required oxygen supplementation to
maintain the 35% set point.
[0822] Nutritive Polypeptide Library Gene Synthesis & Plasmid
Construction.
[0823] Genes encoding for 168 different edible species polypeptide
sequences were generated as linear fragments and codon-selected for
expression in Escherichia coli. In some cases, a single linear
fragment contained two or more nucleic acid sequences encoding two
or more distinct polypeptide sequences that had a flanking 5' NdeI
restriction site and 3' BamHI restriction site. All linear
fragments were combined at equal molar concentrations. The linear
fragments were digested with NdeI and BamHI and the digested
mixture was cloned into pET1Sb (EMD Millipore/Novagen) using
primers to include an amino terminal tag containing MGSHHHHHHHH and
NdeI-BamHI restriction sites, pET15b contains a pBR322 origin of
replication, a lac-controlled T7 promoter, and a bla gene
conferring resistance to carbenicillin. For cloned fragments,
inserts were verified by Sanger sequencing using both the T7
promoter primer and the T7 terminator primer.
[0824] 168 Nutritive Polypeptide Library Strain Construction.
[0825] T7 Express Competent E. coli (New England Biolabs) was used
as the parent strain. T7 Express is an enhanced BL21 derivative
which contains the T7 RNA polymerase in the lac operon, while
lacking the Lon and OmpT proteases. The genotype of T7 Express is:
fhuA2 lacZ::T7 gene1 [Ion] ompT gal sulA11
R(mcr-73::miniTn10-TetS)2 [dcm] R(zgb-210::Tn10-TetS) endA1
.DELTA.(mcrC-mrr) 114::IS10. For secreted constructs, CGSC 5610
(Yale E. coli genetic stock center, USA) was used. The genotype of
CGSC 5610 is F-, lacYI or A(cod-lacI) 6, glnV44(AS), galK2(Oc),
galT22, .lamda.-, e14-, mcrA0, rfbC1, metB1, mcrB1, hsdR2.
Approximately 10 ng of ligated DNA mixture were transformed into
chemically competent T7 Express and single colonies were selected
on LB agar plates containing 100 mg/l carbenicillin after roughly
16 hr of incubation at 37.degree. C. Multiple transformations were
done and approximately 1000 colonies were pooled together and
suspended into LB medium. The DNA from 50-100 colonies was
sequenced to determine the diversity of the generated library.
[0826] 168 Nutritive Polypeptide Library Expression Testing.
[0827] The colony mixtures resuspended in LB medium were initially
grown in 3 ml of LB medium (10 g/l NaCl, 10 g/l tryptone, and 5 g/l
yeast extract) with 100 mg/l carbenicillin, then transferred to
BioSilta Enbase media with 100 mg/l carbenicillin and 600 mU/1 of
glucoamylase at OD600=0.1, grown overnight at 37.degree. C. and 250
rpm and induced with 1 mM IPTG next day. Heterologous expression
was allowed for 24 hours at 37.degree. C. and 250 rpm, at which
point the cultures were terminated. The terminal cell-density was
measured and the cells were harvested by centrifugation (3000 rpm,
10 min, RT). To determine intracellular production the cells were
lysed using a microfluidizer and the soluble fraction was purified
in 5 ml Nickel Affinity column according to manufacturer's protocol
and then assayed using LC-MS/MS to identify the proteins that were
expressed as described below. 114/168 different proteins were
successfully solubly expressed in E. coli based on MS spectral
count. Based on this result, certain genes were individually cloned
and tested for intracellular soluble expression in E. coli.
[0828] Fungal Nutritive Polypeptides Expressed in E. coli Strain
Backgrounds.
[0829] Four strains were used to express fungal nutritive
polypeptides: T7 Express, Shuffle T7, and Shuffle T7 Express from
New England Biolabs; and Origami B(DE3) from EMD Millipore.
[0830] T7 Express is an enhanced BL21 derivative which contains the
T7 RNA polymerase in the lac operon, while lacking the Lon and OmpT
proteases. The genotype of T7 Express is: fhuA2 lacZ::T7 gene1
[Ion] ompT gal sulA11 R(mcr-73::miniTn10-TetS)2 [dcm]
R(zgb-210::Tn10-TetS) endA1 .DELTA.(mcrC-mrr)114::IS10.
[0831] Shuffle T7 is a K12 derivative strain that promotes
cytoplasmic disulfide bond formation and expresses a chromosomal
copy of T7 RNAP. The genotype of Shuffle T7 is F' lac, pro,
lacIQ/.DELTA.(ara-leu)7697 araD139 fhuA2 lacZ::T7 gene1
.DELTA.(phoA)Pvul phoR ahpC* galE (or U) galK
.lamda.att::pNEB3-r1-cDsbC (SpecR lacIq) .DELTA.trxB rpsL150(StrR)
.DELTA.gor .DELTA.(malF)3.
[0832] Shuffle T7 Express is a BL21 derivative strain that promotes
cytoplasmic disulfide bond formation and expresses a chromosomal
copy of T7 RNAP. The genotype of Shuffle T7 Express is thuA2
lacZ::T7 gene1 [Ion] ompT ahpC gal .lamda.att::pNEB3-r1-cDsbC
(SpecR, lacIq) .DELTA.trxB sulA11 R(mcr-73::miniTn10-TetS)2 [dcm]
R(zgb-210::Tn10-TetS) endA1 .DELTA.gor
.DELTA.(mcrC-mrnr)114::IS10.
[0833] Origami B(DE3) is a BL21 derivative that contains mutations
in trxB and gor that promote disulfide bond formation in the
cytoplasm. The genotype of Origami B(DE3) is F-ompT hsdSB(rB-mB-)
gal dcm lacYI ahpC (DE3) gor522:: Tn10 trxB (KanR, TetR)
[0834] Expression screening of these strains was completed as
described for E. coli.
Example 14
Expression of Nutritive Polypeptides in B. subtills Bacteria
[0835] Gene Synthesis & Plasmid Construction. All of the genes
encoding proteins of interest (POI) were cloned by PCR. The
templates for PCR amplification of these genes were either
synthetic genes, generated for expression in E. coli (see above),
or genomic DNA from a source organism (e.g. B. subtilis). Synthetic
genes were codon optimized for expression in E. coli. All of the
genes were cloned with a sequence encoding a 1.times.FLAG tag
(a.a.=DYKDDDK) fused, in frame, to their 3'-terminus immediately
preceding the stop codon. For expression in B. subtilis, genes were
cloned in the MoBiTec (Gottingen, Germany) expression vector,
pHT43, using the Gibson Assembly Master Mix (New England Biolabs,
Beverly, Mass.) and the cloning host E. coli Turbo (New England
Biolabs) according to manufacturer's instructions. The genes were
cloned into pHT43 either as secretion expression constructs (gene
fused in-frame with DNA encoding the a-amylase signal peptide
(SamyQ) from Bacillus amyloliquefaciens) or as an intracellular
expression constructs (gene inserted immediately downstream of the
ribosomal binding site (RBS), removing the SamyQ sequence).
Following transformation into E. coli, cells containing recombinant
plasmids were selected on LB agar plates containing 100 .mu.g/ml
carbenicillin (Cb100). Recombinant plasmids were isolated from E.
coli and their DNA sequences were verified by Sanger sequencing
prior to transformation into the B. subtilis expression host.
[0836] Strain Construction.
[0837] B. subtilis strain WB800N was purchased from MoBiTec
(Gottingen, Germany) and used as the expression host. WB800N is a
derivative of a well-studied strain (B. subtilis 168) and it has
been engineered to reduce proteolytic degradation of secreted
proteins by deletion of genes encoding 8 extracellular proteases
(nprE, aprE, epr, bpr, mpr, nprB, vpr and wprA). B. subtilis
transformations were performed according to the manufacturer's
instructions. Approximately 1 .mu.g of each expression construct
was transformed into WB800N and single colonies were selected at
37.degree. C. by plating on LB agar containing 5.0 .mu.g/ml
chloramphenicol (Cm5). Individual transformants were grown in LB
broth containing Cm5 until they reached log phase. Aliquots of
these cultures were mixed with glycerol (20% final concentration)
and frozen at -80.degree. C.
[0838] Expression Testing.
[0839] Frozen glycerol stocks of B. subtilis expression strains
were used to inoculate 1-ml of 2.times.-MAL medium (20 g/l NaC, 20
g/l tryptone, and 10 g/l yeast extract, 75 g/l maltose) with Cm5,
in deep well blocks (96-square wells). Culture blocks were covered
with porous adhesive plate seals and incubated overnight in a
micro-expression chamber (Glas-Col. Terre Haute, Ind.) at
37.degree. C. and 880 rpm. Overnight cultures were used to
inoculate fresh, 2.times.-MAL, Cm5 cultures, in deep well blocks,
to a starting OD600=0.1. These expression cultures were incubated
at 37.degree. C., 880 rpm until the OD600=1.0 (approx. 4 hrs) at
which time they were induced by adding
isopropyl-D-1-thiogalactopyranoside (IPTG) at a final concentration
of 0.1 M and continuing incubation for 4 hrs. After 4 hrs, the cell
densities of each culture was measured (OD600) and cells were
harvested by centrifugation (3000 rpm, 10 min, RT). After
centrifugation, culture supernatant was carefully removed and
transferred to a new block and cell pellets were frozen at
-80.degree. C. To determine the levels of secreted protein, 0.5-ml
aliquots of the culture supernatants were filtered first through a
0.45-.mu.m filter followed by a 0.22 .mu.m filter. The filtrates
were then assayed to determine the levels of secreted protein of
interest (POI).
[0840] To determine levels of intracellularly produced POI, frozen
cell pellets were thawed and 0.5 g of 0.1 mm zirconium beads were
added to each sample followed by 0.5 ml of PBS. The cells were
lysed in the cold room (4.degree. C.) by bead-beating for 5 min in
a Qiagen TissuelyserII (Qiagen, Hilden, Germany) equipped with a
96-well plate adapter. Cell lysates were centrifuged at 3000 rpm
for 10 min and the supernatant was removed and analyzed for POI
concentration as described below. To determine the levels of
secreted protein, 0.5-ml aliquots of the culture supernatants were
filtered by a 0.22 .mu.m filter. The filtrates were then assayed to
determine the levels of secreted protein of interest (POI).
[0841] Shake Flask Expression.
[0842] A single colony was picked from an agar plate for each SEQID
and inoculated into 5 mL of 2.times.Mal media. These shake flasks
inocula were grown in a 30.degree. C. shaker incubator overnight.
5mLs of this overnight culture was used to inoculate 250 mL
2.times.Mal. Cultures were grown for 4 hours at 30.degree. C. then
induced for 4 hours at 30.degree. C. Cultures were harvested by
centrifugation. Centrifuged supernatants for each SEQID were
sterile filtered and frozen at -80.degree. C.
[0843] Fermentation Expression.
[0844] Soluble protein for SEQID-00105 has been secreted from
engineered Bacillus subtilis strains containing episomal or
integrated plasmids. The fermentation occurred at a volume of 4 L
in a carbon and nitrogen rich media containing Phytone Peptone,
Yeast Extract, and Glucose. Fermentation cultures were grown at
30.degree. C., at a pH of 7.0 and a percent dissolved oxygen of
40%. Induction, via the addition of IPTG, occurred at an OD600 nm
of 5.0 (+/-1.0). The cultures were supplemented with a Glucose
based feed post induction. The cultures were harvested 5-8 hours
post induction. The biomass was then removed via centrifugation and
the supernatant was clarified via filtration and stored at
4.degree. C. until processing.
[0845] 168 Nutritive Polypeptide Library Gene Synthesis &
Plasmid Construction.
[0846] For expression in B. subtilis, the vector that was used was
derived from pHT43 backbone vector (MoBiTec Gottingen, Germany)
with no signal peptide and grac promoter substituted with aprE
promoter and lacI expression cassette removed. 168 genes encoding
for 168 different protein sequences that were identified above were
made synthetically by Life Technologies/GeneArt as linear fragments
(GeneStrings) and selected for expression in Escherichia coli. In
most cases two genes were synthesized together in a single linear
fragment that had a flanking 5' NdeI restriction site and 3' BamHI
restriction site. All the linear fragments were mixed together at
equal molar concentrations. Then the linear fragments mixture was
digested with NdeI and BamHI. The digested mixtures were cloned
into the vector either as secretion expression constructs (gene
fused in-frame with DNA encoding the lipase signal peptide (LipAsp)
from Bacillus subtilis) or as an intracellular expression
constructs (gene inserted immediately downstream of the ribosomal
binding site (RBS), with and without N-terminal tag containing
MGSHHHHHHH). The library of genes was ligated to the vector PCR
product using T4 DNA ligase (New England Biolabs, Beverly, Mass.).
The ligation products were transformed into the cloning host, E.
coli Turbo (New England Biolabs) according to manufacturer's
instructions. 50-100 colonies were sequenced to determine the
diversity of the leader peptide library. The colonies on the agar
plate were then suspended in LB media and harvested for plasmid
purification.
[0847] 168 Nutritive Polypeptide Library Strain Construction.
[0848] WB800N is a derivative of a well-studied strain (B. subtilis
168) and it has been engineered to reduce proteolytic degradation
of secreted proteins by deletion of genes encoding 8 extracellular
proteases (nprE, aprE, epr, bpr, mpr, nprB, vpr and wprA). B.
subtilis strain WB800N was purchased from MoBiTec (Gottingen,
Germany) and was modified to have the following mutations WB800N:
pXylA-comnK::Erm, degU32(Hy), .DELTA.sigF. This new strain was used
as the expression host. Roughly 1 .mu.g of the plasmid mixture
purified from E. coli cells was transformed into the expression
strain. After transformation, 100 .mu.L of the culture were plated
onto four LB 1.5% agar plates containing 5 mg/L chloramphenicol and
incubated at 37.degree. C. for 16 hrs. After incubation, 2 mL of LB
media with 5 mg/L chloramphenicol were added to the surface of each
plate containing several thousand transformants, and the cells were
suspended in the surface medium by scraping with a cell spreader
and mixing. Suspended cells from the four replicates were pooled
together to form the preinoculum culture for the expression
experiment.
[0849] 168 Nutritive Polypeptide Expression Testing.
[0850] The OD600 of the preinoculum culture made from resuspended
cells was measured using a plate reader to be roughly 20-25. A 500
mL baffled shake flask containing 50 mL of 2.times.Mal medium (20
g/L NaCl, 20 g/L Tryptone, 10 g/L yeast extract, 75 g/L D-Maltose)
with 5 mg/L chloramphenicol was inoculated to OD600.apprxeq.0.2 to
form the inoculum culture, and incubated at 30.degree. C. shaking
at 250 rpm for roughly 6 hours. OD600 was measured and the inoculum
culture was used to inoculate the expression culture in a 2 L
baffled shake flask containing 250 ml 2.times.Mal medium with 5
mg/L chloramphenicol, 1.times. Teknova Trace Metals, and 0.01%
Antifoam 204 to an OD600 of 0.1. The culture was shaken for
30.degree. C. and 250 rpm for 18 hours, at which point the culture
was harvested. For the secreted protein library constructs, the
terminal cell density was measured and the supernatant was
harvested by centrifugation (5000.times.g, 30 min, RT) and filtered
using 0.22 um filter. For the intracellular protein library
constructs, the terminal cell density was measured and the cells
were harvested by centrifugation (5000.times.g, 30 min, RT). Cells
were then lysed using microfluidizer and the soluble fraction was
purified using nickel affinity column if the construct library had
N-terminal His tag. Otherwise the soluble fraction was used for
further analysis. All the samples were run on SDS-PAGE gels,
separated into ten fractions, and then analyzed using LC-MS/MS as
described below. 40/168 proteins were successfully secreted, 10/168
proteins were successfully produced intracellularly without His tag
and 28/168 proteins were successfully produced intracellularly with
5' 8.times.His tag in Bacillus subtilis. Based on the results,
certain genes were individually cloned and tested for individual
secretion in Bacillus subtilis.
[0851] Secreted Nutritive Polypeptide Plasmid Construction.
[0852] For this study, the pHT43 backbone vector with no signal
peptide was modified by removing the SamyQ signal peptide to allow
for the native signal peptide to guide secretion, substituting the
grac promoter with the aprE promoter, removing the lacI region, and
adding a 1.times.FLAG tag (DYKDDDDK) before the terminator region.
The unmodified pHT43 vector from MoBiTec contains the Pgrac
promoter, the SamyQ signal peptide, Amp and Cm resistance genes, a
lacI region, a repA region, and the ColE1 origin of replication. To
amplify the genes of interest, genomic DNA preps were made from
wild-type Bacillus strains. Secreted nutritive polypeptide genes
including their native signal peptide coding regions were PCR
amplified using PCR primers with tails containing 25 bp homology
regions to the pHT43 backbone and were run on a 1% Agarose TAE gel
to check for correct insert size. 10 .mu.L from each PCR were
pooled together into a single library of inserts, and the mix was
Gibson ligated to a pHT43 backbone vector. The ligation was
transformed into 10-Beta electrocompetent cells (New England
Biolabs), and transformed cells were plated at a 10-1 dilution onto
four LB agar plates with 100 mg/L carbenicillin. One plate was
sequenced using a forward primer that binds in the promoter region
and a reverse primer that binds in the terminator region. 2 mL of
LB medium with 100 mg/L carbenicillin was added to the remaining
three plates. Cells were scraped and suspended into the LB medium,
and the plasmids were extracted from the cell suspensions to form
the multiplex plasmid mix to be transformed into the expression
strain. The secreted polypeptide library strain construction and
expression were done similar to 168 nutritive polypeptide library
strain construction and expression testing.
[0853] Secretion Leader Peptide Library Construction.
[0854] Secretion signal peptide libraries facilitate the secretion
of any given protein of interest. One approach to enhancing
secretion is to fuse a library of signal peptide sequences to the
protein of interest and screen for those that result in the highest
level of secretion. The signal peptide library described here
consists of 173 signal peptides that were identified as being
associated to naturally Sec mediated secreted proteins in Bacillus
subtilis (Brockmeier et al Molecular Biology, 2006). A signal
peptide library was generated for SEQID-43136, starting with
plasmid pES1207 which has SEQID-43136 fused to the signal peptide
from the B. amyloliquefaciens .alpha.-amylase (SamyQ), pES1207 was
used as template for a PCR reaction with primers, Pfwd and Prev,
which amplified the entire plasmid except for the SamyQ sequence.
Pfwd and Prev possessed tails that had AarI restriction sites and
the PCR products were purified and cut with Aar I. The fragment was
then dephosphorylated using Antarctic phosphatase (New England
Biolabs, Beverly, Mass.). DNA encoding the individual signal
peptides was constructed by duplexing single stranded
oligonucleotides comprising the forward- and reverse-strands of
each signal peptide sequence. The oligonucleotides were designed
such that single strand tails were formed at the 5'-ends of the
duplexed molecule. These were complementary of the overhangs
generated by the AarI digestion of the vector PCR fragment. To
duplex the oligonucleotides, the direct strand and the reverse
strand oligonucleotides were mixed together, phosphorylated using
T4 polynucleotide kinase (New England Biolabs, Beverly, Mass.) and
annealed. Post annealing, signal peptide DNA sequences were mixed
in equal proportion in a single tube. The library of signal
peptides was ligated to the vector PCR product using T4 DNA ligase
(New England Biolabs, Beverly, Mass.). The ligation products were
transformed into the cloning host, E. coli Turbo (New England
Biolabs) according to manufacturer's instructions. 50-100 colonies
were sequenced to determine the diversity of the leader peptide
library for SEQID-00298 and SEQID-00338. The colonies on the agar
plate were then suspended in LB media and harvested for plasmid
purification.
[0855] Secretion Leader Peptide Library Strain Construction.
[0856] B. subtilis strain WB800N (MoBiTec, (Gottingen, Germany) was
used as the expression host. Approximately 10 .mu.g of signal
peptide library of a particular protein construct was transformed
into WB800N and single colonies were selected at 37.degree. C. by
plating on LB agar containing 5.0 .mu.g/ml chloramphenicol (Cm5).
The leader peptide library screening for SEQID-00105, SEQID-00352,
SEQID-00341, SEQID-00103 were carried out in B. subtilis WB800N
that has been modified to have mutations in the sigF sporulation
factor and also the intracellular serine protease (ispA) was
disrupted with an antibiotic marker. The strain also had an
inducible comK (the competence initiation transcription factor)
integrated into chromosome for higher transformation
efficiency.
[0857] Secretion Leader Peptide Library Expression Screening.
[0858] 400-500 individual transformants of the B. subtilis signal
peptide library were used to inoculate individual, 1-ml cultures of
2.times.-MAL medium (20 g/l NaCl, 20 g/l tryptone, and 10 g/l yeast
extract, 75 g/l maltose) with Cm5, in deep well blocks (96-square
wells). In addition to the signal peptide library strains, a strain
containing plasmid with the protein of interest and the SamyQ
leader peptide was inoculated as a control. Culture blocks were
covered with porous adhesive plate seals and incubated overnight in
a micro-expression chamber (Glas-Col, Terre Haute, Ind.) at
37.degree. C. and 800 rpm. Overnight cultures were used to
inoculate fresh, 2.times.-MAL, Cm5 cultures, in deep well blocks,
to a starting OD600=0.15,
[0859] Expression cultures were incubated at 37.degree. C., 880 rpm
until the OD600=1.0 (approx. 4 hrs) at which time they were induced
by adding isopropyl .beta.-1-thiogalactopyranoside (IPTG) at a
final concentration of 1 mM and continuing incubation for 4 hrs.
After 4 hrs, the cell densities of each culture was measured
(OD600) and cells were harvested by centrifugation (3000 rpm, 10
min, RT). After centrifugation, the culture supernatant was
carefully removed and transferred to a new block and cell pellets
were frozen at -80.degree. C. To determine the levels of secreted
protein, 0.5-ml aliquots of the culture supernatants were filtered
first through a 0.45-.mu.m filter followed by a 0.22 .mu.m filter.
The filtrates were then assayed by Chip electrophoresis, as
described herein, to determine the levels of secreted protein of
interest (POI) and compared with the level of secretion of base
construct.
[0860] Diluted overnight cultures were used as inoculum for LB
broth cultures containing Cm5. These cultures were grown at 37 C
until they reached log phase. Aliquots of these cultures were mixed
with glycerol (20% final concentration) and frozen at -80.degree.
C. The top 10-15 hits were then purified using Instagene matrix
(Biorad, USA) and amplified around the signal peptide and sent for
sequencing to identify the signal peptide sequence.
TABLE-US-00096 TABLE E14A Exemplary results of B. subtilis leader
peptide library screening. SEQID- SEQID- SEQID- SEQID- SEQID-
SEQID- Other Gene 298 00338 00105 00352 00341 00103 SEQ IDs SEQID
Name Protein Sequence mg/l/OD mg/l/OD mg/l/OD mg/l/OD mg/l/OD
mg/l/OD mg/l/OD 3921 abnA MKKKKTWKRFLHFSSA 4.4 9.4 135.7 ~ 148.14
12.1 3.1 ALAAGLIFTSAAPAEA SEQID- 00405 3922 bglC MKRSISIFITCLLITL
7.8 ~ 73.6 2.7 33.9 12.1 ~ LTMGGMIASPASA 3923 bpr MRKKKTKNRLISSVLS
~ ~ ~ ~ 40.4 ~ ~ TVVISSLLFPGAAGA 3924 glpQ MRKNRILALFVLSLGL ~ 5.7 ~
~ 41.9 ~ 5.5 LSFMVTPVSA SEQID- 00398 3925 lipA MKFVKRRIIALVTILM
14.1 ~ ~ 10.9 ~ 16.1 ~ LSVTSLFALQPSAKAA 3926 lytB MKSCKQLIVCSLAAIL
~ 3.4 ~ ~ ~ ~ ~ LLIPSVSFA 3927 lytF MKKKLAAGLTASAIVG ~ ~ ~ ~ ~ 14.8
~ TTLVVTPAEA 3928 mpr MKLVPRFRKQWFAYLT 10.8 ~ ~ ~ ~ ~ ~
VLCLALAAAVSFGVPA KA 3929 nprB MRNLTKTSLLLAGLCT ~ ~ ~ ~ 37.5 ~ ~
AAQMVFVTHASA 3930 pelB MKRLCLWFTVFSLFLV ~ ~ ~ ~ 64.4 ~ ~ LLPGKALG
3931 penP MKLKTKASIKFGICVG ~ ~ ~ 2.8 ~ ~ ~ LLCLSITGFTPFFNST HAEA
3932 phoB MKKFPKKLLPIAVLSS 7.9 ~ ~ ~ ~ ~ ~ IAFSSLASGSVPEASA 3933
wapA MKKRKRRNFKRFIAAF ~ 7 ~ 2.14 ~ ~ ~ LVLALMISLVPADVLA 3934 xynA
MFKPKKNFLVGLSAAL 4.3 8.8 114.4 ~ 83.3 13.4 ~ MSISLFSATASA 3935 ybfO
MKRMIVRMTLPLLIVC ~ ~ ~ 0.69 ~ ~ ~ LAFSSFSASARA 3936 yekD
MKRITINIITMFIAAA ~ ~ ~ ~ 61.7 ~ ~ VISLTGTAEA 3937 yddT
MRKKRVITCVMAASLT ~ ~ 135.6 ~ ~ ~ ~ LGSLLPAGYASA 3938 yfhK
MKKKQVMLALTAAAGL ~ ~ ~ ~ ~ 20.8 ~ GLTALHSAPAAKA 3939 yfjS
MKWMCSICCAAVLLAG ~ ~ ~ ~ ~ 9.4 ~ GAAQA 3940 yjeM MKKELLASLVLCLSLS ~
~ 83.4 ~ 80.2 ~ ~ PLVSTNEVFA 3941 yjdB MNFKKTVVSALSISAL ~ ~ 152.7 ~
~ 14.3 ~ ALSVSGVASA 3942 yjfA MKRLFMKASLVLFAVV ~ ~ ~ ~ ~ 20 ~
FVFAVKGAPAKA 3943 ykoJ MLKKKWMVGLLAGCLA ~ ~ ~ 2.23 132.5 ~ ~
AGGFSYNAFA 3944 ylqB MKKIGLLFMLCLAALF ~ ~ ~ ~ ~ 13.3 ~ TIGFPAQQADA
3945 yndA MRFTKVVGFLSVLGLA ~ ~ 124.3 ~ ~ ~ ~ AVFPLTAQA 3946 yqgA
MKQGKFSVFLILLLML 3.9 ~ ~ ~ ~ ~ ~ TLVVAPKGKAEA 3947 yraI
MTLTKLKMLSMLTVMI ~ 6.3 ~ ~ ~ ~ ~ ASLFIFSSQALA 3948 yuaB
MKRKLLSSLAISALSL ~ ~ ~ ~ ~ ~ 2.5 GLLVSAPTASFAAE SEQID- 00404 3949
yurI MTKKAWFLPLVCVLLI ~ ~ ~ 2.26 ~ ~ ~ SGWLAPAASASA 3950 yveE
MRKSLITLGLASVIGT ~ ~ 124.4 ~ ~ 14.6 ~ SSFLIPFTSKTASA 3951 yvgO
MKRIRIPMTLALGAAL ~ ~ ~ ~ ~ 17.7 ~ TLAPLSFASA 3952 yvnB
MRKYTVIASILLSFLS ~ ~ ~ ~ ~ 26.2 ~ VLSGG 3953 ywaD MKKLLTVMTMAVLTAG
~ ~ ~ ~ ~ ~ 3.4 TLLLPAQSVTPAAHA SEQID- 403 3954 ywaB
MMNKPTKLFSTLALAA ~ ~ 13.1 ~ ~ ~ ~ GMTAAAAGGAGTIHA 3955 yxaK
MVKSFRMKALIAGAAV ~ ~ ~ 3.7 ~ ~ ~ AAAVSAGAVSDVPAAK VLQPTAAYA 3956
yxiT MKWNNMLKAAGIAVLL ~ 7.9 ~ 0.95 41.5 ~ ~ FSVFAYAAPSLKAVQA
Example 15
Expression of Nutritive Polypeptides in Aspergillus niger Fungi
[0861] Gene Synthesis & Plasmid Construction.
[0862] Genes encoding natively secreted proteins were PCR amplified
from the Aspergillus niger ATCC 64974 using primers designed from
the genome sequence of Aspergillus niger CBS 513.88. In one
example, genes included native 5' secretion sequences and were
cloned into the expression vector pAN56-1 (Genbank: Z32700.1)
directly under the control of the gpdA promoter from Aspergillus
nidulans with the addition of a C-terminal 3.times.FLAG tag
(DYKDHDGDYKDHDIDYKDDDDK). In another example genes included only
the mature peptide with the addition of a heterologous 5' secretion
signal. Plasmids were constructed using the Gibson Assembly Kit
(New England Biolabs, Beverly, Mass.). Recombinant plasmids were
sequence verified before transformation into Aspergillus hosts.
[0863] pFGLAHIL6T was obtained from the BCCM/LMBP (Ghent,
Netherlands). Plasmids were constructed using the Gibson Assembly
Kit (New England Biolabs, Beverly, Mass.). Recombinant plasmids
were sequence verified before transformation into Aspergillus
hosts.
[0864] The pyrA nutritional marker was PCR amplified from
Aspergillus niger ATCC 64974 using primers designed from genome
sequence of Aspergillus niger ATCC 1015. The pyrA PCR fragment was
digested with XbaI and ligated into an XbaI fragment of pCSN44
(Staben et al., 1989) to construct pES1947, pCSN44 was obtained
from the BCCM/LMBP (Ghent, Netherlands). The recombinant plasmid
was sequence verified before transformation into Aspergillus
hosts.
[0865] Strain Construction. A protease deficient derivate of
Aspergillus niger ATCC 62590 was used as the expression host.
Expression vectors were co-transformed with pES1947 using the
protoplast method as described in Punt et al., 1992, Methods in
Enzymology, 216, 447-457. Approximately 5 ug of each plasmid was
transformed into Aspergillus niger protoplasts. Transformants were
selected on minimal media supplemented with 1.2 M sorbitol and 1.5%
bacto agar (10 g/f glucose, 4 g/l sodium nitrate, 20 mg/l salts
solution (containing 26.2 g/l potassium chloride and 74.8 g/l
Potassium phosphate monobasic at pH 5.5), 1 ml/l vitamin solution
(containing 100 mg/l Pyridoxine hydrochloride, 150 mg/l Thiamine
hydrochloride, 750 mg/l 4-Aminobenzoic acid, 2.5 g/l Nicotinic
acid, 2.5 g/l riboflavin, 20 g/l choline chloride, and 30 mg/l
biotin), and 1 ml/1 of metals solution (containing 20 g/l Zinc
sulfate heptahydrate (ZnSO4-7H2O), 11 g/l Boric acid (H3BO3), 5 g/l
Manganese (II) chloride tetrahydrate (MnCl2-4H2O), 5 g/l Iron (II)
sulfate heptahydrate (FeSO4-7H2O). 1.7 g/l Cobalt(II) chloride
hexahydrate (CoCl2-6H2O), 1.6 g/l Copper(II) sulfate pentahydrate
(CuSO4-5H2O), 1.5 g/l Sodium molybdate dihydrate (NaMoO4-2H2O), and
5.0 g/l EDTA disodium salt dihydrate (Na2EDTA-2H2O) at pH 6.5).
Individual transformants were isolated on minimal media plates and
allowed to grow at 30 C until they sporulated. Spores were
harvested in water and stored at 4 C.
[0866] Expression Testing.
[0867] Spore stocks of Aspergillus niger strains were inoculated at
10.sup.6 spores/ml into 2 mL of CM (MM plus 5.0 g/l yeast extract,
2.0 g/l casamino acids) adjusted to pH 7 with 40 mM MES and
SigmaFast Protease Inhibitor Cocktail (1 tab/100 mL, Sigma Aldrich)
in 24 well square bottom deep well blocks. Culture blocks were
covered with porous adhesive plate seals and incubated for 48 hrs
in a micro-expression chamber (Glas-Col, Terre Haute, Ind.) at
30.degree. C. at 600 rpm. After the growth period, 0.5-ml aliquots
of the culture supernatants were filtered first through a 25
.mu.m/0.45-.mu.m dual stage filter followed by a 0.22 .mu.m filter.
The filtrates were then assayed to determine the levels of secreted
protein of interest (POI).
TABLE-US-00097 TABLE E15A Exemplary results of Aspergillus leader
peptide library screening. signal peptide name (gene name_species
SEQID name) signal sequence Genotype 3957 native signal
MRWLLTSSALLVPAAA PgpdA-native signal peptide-SEQID-00409-3XFlag
peptide 3958 AXHA_ASPNG MKFLKAKGSLLSSGIYLIALAPFVNA
PgpdA-AXHA_ASPNG-SEQID-00409-3XFlag 3959 PPIB_ASPNG
MNFKNIFLSFFFVLAVGLALVHA PgpdA-PPIB_ASPNG-SEQID-00409-3XFlag 3960
FAEA_ASPNG MKQFSAKYALILLATAGQALA
PgpdA-FAEA_ASPNG-SEQID-00409-3XFlag 3961 BGAL_ASPNG
MKLSSACAIALLAAQAAGA PgpdA-BGAL_ASPNG-SEQID-00409-3XFlag 3962
PLYA_ASPNG MKYSTIFSAAAAVFAGSAAA PgpdA-PLYA_ASPNG-SEQID-00409-3XFlag
3963 PRTA_ASPNG MKFSTILTGSLFATAALA
PgpdA-PRTA_ASPNG-SEQID-00409-3XFlag 3964 AGALC_ASPNG
MIGSSHAVVALGLFTLYGHSAA PgpdA-AGALC_ASPNG-SEQID-00409-3XFlag 3965
PHYB_ASPNG MPRTSLLTLACALATGASA PgpdA-PHYB_ASPNG-SEQID-00409-3XFlag
3966 AORSN_ASPOR MRPLSHLSFFNGLLLGLSALSA
PgpdA-AORSN_ASPOR-SEQID-00409-3XFlag 3967 DPP5_ASPOR
MGALRWLSIAATASTALA PgpdA-DPP5_ASPOR-SEQID-00409-3XFlag 3968
PHYA_ASPNG MGVSAVLLPLYLLSGVTSGLAVP
PgpdA-PHYA_ASPNG-SEQID-00409-3XFlag 3969 EXG_ASPOR MLPLLLCIVPYCWS
PgpdA-EXG_ASPOR-SEQID-00409-3XFlag 3970 native signal
MHFLQNAVVAATMGAALA PgpdA-native signal peptide-SEQID-00420-3XFlag
peptide 3971 PPA1_ASPNG MKGTAASALLIALSATAAQA
PgpdA-PPA1_ASPNG-SEQID-00420-3XFlag 3972 PEPC_ASPNG
MKGILGLSLLPLLTAA PgpdA-PEPC_ASPNG-SEQID-00420-3XFlag 3973
PRTA_ASPNG MKFSTILTGSLFATAALA PgpdA-PRTA_ASPNG-SEQID-00420-3XFlag
3974 AGALC_ASPNG MIGSSHAVVALGLFTLYGHSAA
PgpdA-AGALC_ASPNG-SEQID-00420-3XFlag 3975 RNT1_ASPOR
MMYSKLLTLTTLLLPTALALPSLVER PgpdA-RNT1_ASPOR-SEQID-00420-3XFlag 3976
PGLR1_ASPNG MHSYQLLGLAAVGSLVSA PgpdA-PGLR1_ASPNG-SEQID-00420-3XFlag
3977 ORYZ_ASPOR MQSIKRTLLLLGAILPAVLGA
PgpdA-ORYZ_ASPOR-SEQID-00420-3XFlag 3978 PLYB_ASPNG
MHYKLLFAAAAASLASAVSA PgpdA-PLYB_ASPNG-SEQID-00420-3XFlag 3979
NUS1_ASPOR MPRLLPISAATLALAQLTYG PgpdA-NUS1_ASPOR-SEQID-00420-3XFlag
3980 PHYB_ASPNG MPRTSLLTLACALATGASA
PgpdA-PHYB_ASPNG-SEQID-00420-3XFlag 3981 TAN_ASPOR
MRQHSRMAVAALAAGANA PgpdA-TAN_ASPOR-SEQID-00420-3XFlag 3982
PDI_ASPNG MRSFAPWLVSLLGASAVVAA PgpdA-PDI_ASPNG-SEQID-00420-3XFlag
3983 XYN2_ASPNG MLTKNLLLCFAAAKAALA
PgpdA-XYN2_ASPNG-SEQID-00420-3XFlag 3984 PHYA_ASPOR
MAVLSVLLPITFLLSSVTG PgpdA-PHYA_ASPOR-SEQID-00420-3XFlag 3985
DPP5_ASPOR MGALRWLSIAATASTALA PgpdA-DPP5_ASPOR-SEQID-00420-3XFlag
3986 PHYA_ASPNG MGVSAVLLPLYLLSGVTSGLAVP
PgpdA-PHYA_ASPNG-SEQID-00420-3XFlag 3987 PEPA_ASPNG
MVVFSKTAALVLGLSTAVSA PgpdA-PEPA_ASPNG-SEQID-00420-3XFlag 3988
AGLU_ASPNG MVKLTHLLARAWLVPLAYGASQSLL
PgpdA-AGLU_ASPNG-SEQID-00420-3XFlag 3989 ABFA_ASPNG
MVAFSALSGVSAVSLLLSLVQNAHG PgpdA-ABFA_ASPNG-SEQID-00420-3XFlag 3990
AMYG_ASPNG MSFRSLLALSGLVCTGLA PgpdA-AMYG_ASPNG-SEQID-00420-3XFlag
3991 PHOA_ASPNG MFTKQSLVTLLGGLSLAVA
PgpdA-PHOA_ASPNG-SEQID-00420-3XFlag 3992 ABFB_ASPNG
MFSRRNLVALGLAATVSA PgpdA-ABFB_ASPNG-SEQID-00420-3XFlag
[0868] Aspergillus niger Signal Peptide Library Construction.
[0869] It is difficult to predict which secretion signal peptide
will facilitate the secretion of any given protein of interest
best. Therefore, one approach to optimizing secretion is to fuse a
library of signal peptide sequences to the protein and screen for
those that result in the highest level of secretion. We constructed
a signal peptide library for SEQID-00409 and SEQID-00420. Table
E15A shows the signal peptides that were used with SEQID-00409 and
SEQID-00420. DNA encoding the individual signal peptides was
constructed by duplexing single stranded oligonucleotides
comprising the forward- and reverse-strands of each signal peptide
sequence. The oligonucleotides were designed such that single
strand tails were formed at the 5'-ends of the duplexed molecule.
Genes encoding natively secreted proteins SEQID-00409 and
SEQID-00420 were PCR amplified from the Aspergillus niger ATCC
64974 using primers designed from the genome sequence of
Aspergillus niger CBS 513.88. Genes included native 5' secretion
sequences and were cloned into the expression vector pAN56-1
(Genbank: Z32700.1) directly under the control of the gpdA promoter
from Aspergillus nidulans with the addition of a C-terminal
3.times.FLAG tag (DYKDHDGDYKDHDIDYKDDDDK). Then the vectors were
amplified without the native signal peptide and plasmids with
different signal peptides were reconstructed with the duplex signal
peptide sequences using the Gibson Assembly Kit (New England
Biolabs, Beverly, Mass.). Recombinant plasmids were sequence
verified before transformation into Aspergillus hosts.
[0870] The pyrA nutritional marker was PCR amplified from
Aspergillus niger ATCC 64974 using primers designed from genome
sequence of Aspergillus niger ATCC 1015. The pyrA PCR fragment was
digested with XbaI and ligated into an XbaI fragment of pCSN44
(Staben et al., 1989) to construct pES1947, pCSN44 was obtained
from the BCCM/LMBP (Ghent, Netherlands). The recombinant plasmid
was sequence verified before transformation into Aspergillus
hosts.
[0871] Aspergillus niger Signal Peptide Library Strain
Construction.
[0872] A protease deficient derivate of Aspergillus niger ATCC
62590 was used as the expression host. Each signal peptide-gene
combination vector was individually co-transformed with plasmid
containing the nutritional marker pyrG using the protoplast method
as described in Punt et al., 1992. Approximately 5 ug of each
plasmid were transformed into Aspergillus niger protoplasts.
Transformants were selected on minimal media supplemented with 1.2
M sorbitol and 1.5% bacto agar (10 g/l glucose, 4 g/l sodium
nitrate, 20 ml/l salts solution (containing 26.2 g/l potassium
chloride and 74.8 g/l Potassium phosphate monobasic at pH 5.5), 1
ml/l vitamin solution (containing 100 mg/l Pyridoxine
hydrochloride, 150 mg/l Thiamine hydrochloride, 750 mg/l
4-Aminobenzoic acid, 2.5 g/l Nicotinic acid, 2.5 g/l riboflavin, 20
g/l choline chloride, and 30 mg/l biotin), and 1 ml/l of metals
solution (containing 20 g/l Zinc sulfate heptahydrate (ZnSO4-7H2O),
11 g/l Boric acid (H3B03), 5 g/l Manganese (II) chloride
tetrahydrate (MnCl2-4H2O), 5 g/l Iron (II) sulfate heptahydrate
(FeSO4-7H2O), 1.7 g/l Cobalt(II) chloride hexahydrate (CoCl2-6H2O),
1.6 g/l Copper(II) sulfate pentahydrate (CuSO4-5H2O), 1.5 g/l
Sodium molybdate dihydrate (NaMo 4-2H2O), and 5.0 g/l EDTA disodium
salt dihydrate (Na2EDTA-2H2O) at pH 6.5). Individual transformants
were isolated on minimal media plates and allowed to grow at 30 C
until they sporulated.
[0873] Aspergillus niger Signal Peptide Library Expression
Testing.
[0874] Six different primary transformants from each construct were
inoculated into 1 ml of minimal media as defined above supplemented
with 5.0 g/l yeast extract 2.0 g/l casamino acids) adjusted to pH 7
with 160 mM MES in 96 deep well culture blocks. Culture blocks were
covered with porous adhesive plate seals and incubated for 48 hrs
in a micro-expression chamber (Glas-Col, Terre Haute, Ind.) at
33.degree. C. at 800 rpm. After the growth period, 0.5-ml aliquots
of the culture supernatants were filtered first through a 25
.mu.m/0.45-.mu.m dual stage filter followed by a 0.22 .mu.min
filter. The filtered supernatants were then analyzed using Chip
Electrophoresis as described below or anti-FLAG DOT-BLOT and
SDS-PAGE as described below. Based on these results the primary
transformants, which demonstrated higher secretion than the native
signal peptide, were isolated on minimal media plate and allowed to
grow at 30.degree. C. until they sporulated.
[0875] Spore stocks of the above Aspergillus niger strains along
with the control Aspergillus niger strain that contain expression
construct of pgpdA promoter and native signal peptide of
SEQID-00409 and SEQID-00424 were inoculated at 10.sup.6 spores/mL
into 10 mL of minimal media as defined above supplemented with 5.0
g/l yeast extract, 2.0 g/l casamino acids) adjusted to pH 7 with
160 mM MES in 125 ml plastic flask. Aspergillus spores were then
grown at 30.degree. C. with 150 RPM for two days. After the growth
period, aliquots of the culture supernatants were filtered first
through a 25 m/0.45-.mu.m dual stage filter followed by a 0.22
.mu.m filter. The filtrates were then analyzed using SDS-PAGE as
described herein.
[0876] FIG. 5, demonstrates the secretion of SEQID-00409 (left) and
SEQID-00420 (right) with new signal peptide compared to native
signal peptide.
[0877] Aspergillus niger Heterologous Nutritive Polypeptide Gene
Synthesis & Plasmid Construction.
[0878] Genes encoding nutritive polypeptides were synthesized
(Geneart, Life Technologies). Genes were codon optimized for
expression in Aspergillus niger. Synthesized genes were PCR
amplified and cloned into the expression vector pAN56-1 (Genbank:
Z32700.1) fused to glucoamylase with its native leader sequence
under the control of the gpdA promoter from Aspergillus nidulans
with the addition of a C-terminal 3.times.FLAG tag
(DYKDHDGDYKDHDIDYKDDDDK) and Kexin protease site (NVISKR) between
glucoamylase gene and gene of interest. Plasmids were constructed
using the Gibson Assembly Kit (New England Biolabs, Beverly,
Mass.). Recombinant plasmids were sequence verified before
transformation into Aspergillus hosts.
[0879] SEQID-00087, SEQID-00103, SEQID-00105, SEQID-00115,
SEQID-00218, SEQID-00298, SEQID-00302, SEQID-00341, SEQID-00352,
SEQID-00354 genes were utilized.
[0880] Aspergillus niger Heterologous Nutritive Polypeptide Strain
Construction.
[0881] A protease deficient derivate of Aspergillus niger D15#26
(E. Karnaukhova et al, Microbial Cell Factories, 6:34) was used as
the expression host. 10 ug of Expression vectors were
co-transformed with lug plasmid containing pyrG selection marker
using the protoplast method described in Punt et al., 1992, Methods
in Enzymology, 216, 447-457. Transformants were selected on minimal
media containing 10 g/l glucose, 6 g/l sodium nitrate, 20 ml/l
salts solution (containing 26 g/l potassium chloride and 76 g/l
Potassium phosphate monobasic at pH 5.5), 2 mM magnesium sulphate,
1 ml/l vitamin solution (containing 100 mg/l Pyridoxine
hydrochloride, 150 mg/l Thiamine hydrochloride, 750 mg/l
4-Aminobenzoic acid, 2.5 g/l Nicotinic acid, 2.5 g/l riboflavin, 20
g/l choline chloride, and 30 mg/I biotin), and 1 ml/l of metals
solution (containing 20 g/l Zinc sulfate heptahydrate (ZnSO4-7H2O),
11 g/l Boric acid (H3B03), 5 g/l Manganese (II) chloride
tetrahydrate (MnCl2-4H2O), 5 g/l Iron (II) sulfate heptahydrate
(FeSO4-7H2O), 1.7 g/l Cobalt(II) chloride hexahydrate (CoCl2-6H2O),
1.6 g/l Copper(II) sulfate pentahydrate (CuSO4-5H2O), 1.5 g/l
Sodium molybdate dihydrate (NaMoO4-2H2O), and 5.0 g/l EDTA disodium
salt dihydrate (Na2EDTA-2H2O) at pH 6.5) and supplemented with 1.2
M sorbitol and 1.5% bacto agar. Individual transformants were
isolated on minimal media plates and allowed to grow at 30 C until
they sporulated. Spores were harvested in water at stored at 4
C.
[0882] Aspergillus niger Heterologous Nutritive Polypeptide
Expression Testing.
[0883] 90 different primary transformants from each construct were
inoculated into 1 ml of minimal media as defined above supplemented
with 1 g/L casamino acids in 96 deep well culture blocks (1.sup.st
MTP). Culture blocks were covered with porous adhesive plate seals
and incubated for 72 hrs in a micro-expression chamber (Glas-Col,
Terre Haute, Ind.) at 33.degree. C. at 800 rpm. After the growth
period, 0.5-ml aliquots of the culture supernatants were filtered
first through a 25 .mu.m/0.45-.mu.m dual stage filter followed by a
0.22 .mu.m filter. The filtrates were then assayed using an
anti-FLAG ELISA method, as described herein, to determine the
levels of secreted protein of interest (POI). At least five
colonies from nine expression constructs excluding SEQID-00302
yielded positive signals in an anti-flag ELISA as reported in Table
E 15B. At least 5 primary transformants that showed positive
signals in anti-FLAG ELISA assay from each of the nine expression
strains were also streaked onto a fresh minimal media agar plate
for single spore purification and retested for confirmation
(2.sup.nd MTP).
[0884] Spores were harvested from the plate and inoculation was
done with fresh spore crops with a density of approximately 1E9
spores/ml. 10 ul of these spore crops were added to 10 ml of
minimal medium giving a start density of 1E6 spores/ml. Aspergillus
spores were then grown at 33 C with 150 RPM for three days. After
the growth period, aliquots of the culture supernatants were
filtered first through a 25 .mu.m/0.45-.mu.m dual stage filter
followed by a 0.22 .mu.m filter. The filtrates were then analyzed
using anti-FLAG ELISA, anti-flag western blot and SDS-PAGE
described below.
[0885] Certain clones from different expression construct were
grown using fresh spore crops with a final density of
approximately, 1E6 spores/ml in one litre minimal media.
Aspergillus spores were then grown at 33 C with 150 RPM for three
days. After the growth period, aliquots of the culture supernatants
were filtered first through a 25 .mu.m/0.45-.mu.m dual stage filter
followed by a 0.22 .mu.m filter. The filtrates were then analyzed
using anti-FLAG ELISA, anti-flag western blot and SDS-PAGE
described below. Any secreted protein above 39 mg/l in an anti-flag
ELISA from a one liter shake flask were detected by an anti-FLAG
western blot and SDS-PAGE.
TABLE-US-00098 TABLE E15B demonstrates the anti-flag ELISA results
and anti-FLAG western blot results of different protein secretion
in Aspergillus niger ELISA ELISA ELISA ELISA 10 ml Western 1 litre
1st MTP 2nd MTP shake flask 10 ml shake flask SEQ ID # (mg/l)
(mg/l) (mg/l) shake flask (mg/l) SEQID-00103 14.7-42.2 3.0-29.1
1.6-4.0 ++ 1.2-5.6 SEQID-00105 1.4-20.2 0-2.1 0-2.4 + 0.2-1.6
SEQID-00298 66.0-215.4 5.2-119.5 1.3-79.4 +++ 93.9-224.3
SEQID-00897 11.9-21.4 3.6-17.5 0.6-2.2 + - SEQID-00115 16.3-96.2
0-4.9 0.7-3.7 - - SEQID-00218 28.2-69.3 0.4-191.7 2.1-13.3 + -
SEQID-00341 10.4-25.3 1.9-20.5 3.0-8.3 +++ 1.0-3.6 SEQID-00352
27.1-207.6 0-16.2 0.7-245.70 +++ 39.0-124.3 SEQID-00354 9.1-120.4
0-47.2 0.9-7.8 +++ 0-1.2
Example 16
Expression of Nutritive Polypeptides in Cultured Mammalian
Cells
[0886] Gene Synthesis and Plasmid Construction.
[0887] All genes were made synthetically (GeneArt, Life
Technologies) and optimized for expression in Homo Sapiens. Genes
encoding SEQID-0001, SEQID-00103, SEQID-00105, SEQID-00298 and
SEQID-00363 were chosen for secretion in mammalian cells. All the
genes were fused with 5' signal peptide sequence from 1 g-kappa
protein (METDTLLLWVLLLWVPGSTGD) and HHHHHHHH tag in the 3' end. All
the gene constructs were cloned to pcDNA 3.1 (+) vector (Life
Technologies) downstream of pCMV promoter in the multiple cloning
site of NheI and BamHI. All gene sequences contained the GCC
sequence upstream of start codon to generate GCCATGG Kozak
sequence. All plasmids were transformed in E. coli, sequence
verified and 10 mg of each plasmid were purified for transfection
into mammalian cells.
[0888] Strain Construction.
[0889] The cell lines selected for experimentation are 2 transient
lines from Invitrogen, FreeStyle.TM. CHO-S Cells (PN 51-4448) and
FreeStyle.TM. 293F Cells (PN 51-0029). Cell lines were received
from Invitrogen and stored in liquid nitrogen until sub-culturing
was initiated. For sub-culturing prior to transfection, cells were
thawed into specific media: CHO-S cells were thawed into 30 mL of
FreeStyle.TM. CHO Expression Media (Invitrogen PN 12651-014)
supplemented with 8 mM Glutamax (Invitrogen PN 35050-061) and
1.times. HT (Invitrogen PN 11067-030). 293F cells were thawed into
30 mL FreeStyle.TM. 293 Expression Medium (Invitrogen PN
12338-018). Cells were allowed to recover in suspension for 72 hrs
under 80% humidity, 8% Carbon Dioxide, 36.5.degree. C., shaking at
110 rotations per minute. Cells were passed from viable cell
densities (VCD) not exceeding 2.0.times.10 6 cells/mL to
0.2.times.10 6 cells/mL. Sub-culturing continued for 5 passages
prior to transfection.
[0890] At 26 hrs prior to transfection the cultures were passed
back to 0.6.times.10 6 viable cells/mL in a volume of 60 mL. Each
nutritive polypeptide was transfected in duplicate with 2 mock
transfections performed as control for each cell line. On the day
of transfection cells were counted and determined to be at
1.1.times.10 6 cells/mL with greater than 98% viability.
[0891] Transfection Procedure.
[0892] Preparation of DNA-lipid complexes for 120 mL total volume
(60 mL/250 mL shake flask) transfections.
[0893] The following procedure was performed in a Laminar Flow
Hood. 150 .mu.g of plasmid DNA were diluted into OptiPRO.TM. SFM
Reduced Serum Medium (Invitrogen PN: 12307-050 to a total volume of
2.4 mL. This solution was mixed gently and 0.2 .mu.m filter
sterilized. Diluted 150 uL of FreeStyle.TM. MAX Reagent (Invitrogen
PN 16447-100) in OptiPRO.TM. SFM Reduced Serum Medium to a total
volume of 2.4 mL, mixed gently and incubated for 5 minutes at room
temperature. After 5-minute incubation, the 2.4 mL of diluted DNA
was added to the 2.4 mL of the diluted reagent, gently mixed and
incubated for 20 min at room temperature to form the DNA-lipid
complex. After 20-minute incubation, 2.4 mL of complex was added to
each duplicate flask. Control Flask received 2.4 mL of OptiPRO.TM.
SFM reduced serum medium. Transfected flasks were placed back in
incubated shaker under 80% humidity, 8% Carbon Dioxide 36.5.degree.
C., shaking at 110 rotations per minute. Cultures were monitored
for % Viability and VCD. All flasks were supplemented on Day 3 with
a 20% Phytone Peptone Feed made in the media specific to each cell
line. The final concentration of Phytone Peptone in the flask
equaled 2%. Cultures were harvested on Day 4 via centrifugation and
0.2 um filtration of the supernatant. Supernatants were run on a
non-reducing SDS-PAGE 12% Bis-Tris Gel to confirm expression of
nutritive polypeptides at molecular weights. SEQID-00001,
SEQID-00103, SEQID-00105, and SEQID-00298 were confirmed as being
expressed from 293F cells but no visible bands could be detected in
any of the CHO-S cultures. SEQID-00363 could not be visualized on
the gel from either 293F or CHO-S cultures. Supernatants from 293F
cultures for SEQID-00001, SEQID-00103, SEQID-00105, SEQID-00298,
and SEQID-00363 as well as CHO-S supernatants for SEQID-00103 and
SEQID-00105 were purified via IMAC. SEQID-00103, SEQID-00105, and
SEQID-00298 were scaled up to 190 mL transfection volume in a 1 L
shake flask using 293F cells. Transfection procedure was also
scaled accordingly. 4.times.190 mL cultures for both SEQID-00103
and SEQID-00105 and 2.times.190 mL cultures for SEQID-00298 were
run. On Day 2 these cultures were fed with the 20% Phytone Peptone
feed to a final concentration of 2% in culture and were harvested
on Day 5.
Example 17
Nutritive Polypeptide Expression Analysis
[0894] Nutritive polypeptides intracellularly expressed and/or
secreted were detected using a variety of methods. These methods
include electrophoresis, western blot, dot-blot, ELISA, and
quantitative LC/MS/MS.
[0895] Electrophoresis Analysis. Extracellular and/or intracellular
expressed proteins were analyzed by chip electrophoresis (Labchip
GXII) or SDS-PAGE analysis to evaluate expression level.
[0896] For SDS-PAGE, 10 .mu.l sample in Invitrogen LDS Sample
Buffer mixed with 5% 1-mercaptoethanol was boiled and loaded onto
either: 1) a Novex.RTM. NuPAGE.RTM. 12% Bis-Tris gel (Life
Technologies), or 2) a Novex.RTM. 16% Tricine gel (Life
Technologies), and run using standard manufacturer's protocols.
Gels were stained using SimplyBlue.TM. SafeStain (Life
Technologies) using the standard manufacturer's protocol and imaged
using the Molecular Imager.RTM. Gel Doc.TM. XR+ System (Bio-Rad).
Over-expressed heterologous proteins were identified by comparison
against a molecular weight marker and control cultures.
[0897] For chip electrophoresis (Labchip GX II) samples were
analyzed using a HT Low MW Protein Express LabChip.RTM., Kit
(following the manufacturer's protocol) by adding 2 .mu.l of sample
to 7 .mu.l sample buffer. A protein ladder was loaded every 12
samples for molecular weight determination and quantification
(molecular weight in kDa).
[0898] LC-MS/MS Analysis.
[0899] Whole cell, cell lysate and secreted samples can be analyzed
for protein expression using LC-MSMS. To analyze samples, 10 g of
sample were loaded onto a 10% SDS-PAGE gel (Invitrogen) and
separated approximately 2 cm. The gel was excised into ten segments
and the gel slices were processed by washing with 25 mM ammonium
bicarbonate, followed by acetonitrile. Gel slices were then reduced
with 10 mM dithiothreitol at 60.degree. C., followed by alkylation
with 50 mM iodoacetamide at room temperature. Finally, the samples
were digested with trypsin (Promega) at 37.degree. C. for 4 h and
the digestions were quenched with the addition of formic acid. The
supernatant samples were then analyzed by nano LC:`MS`MS with a
Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q
Exactive. Peptides were loaded on a trapping column and eluted over
a 75 .mu.m analytical column at 350 nL/min; both columns were
packed with Jupiter Proteo resin (Phenomenex). A 1 h gradient was
employed. The mass spectrometer was operated in data-dependent
mode, with MS and MS/MS performed in the Orbitrap at 70.000 FWHM
resolution and 17,500 FWHM resolution, respectively. The fifteen
most abundant ions were selected for MS/MS. Data were searched
against an appropriate database using Mascot to identify peptides.
Mascot DAT files were parsed into the Scaffold software for
validation, filtering and to create a nonredundant list per sample.
Data were filtered at 1% protein and peptide false discovery rate
(FDR) and requiring at least two unique peptides per protein.
[0900] Anti-FLAG Western Blot.
[0901] Extracellular and/or intracellular protein was analyzed
using western blot to evaluate expression level.
[0902] For SDS-PAGE, 10 .mu.l sample in Invitrogen LDS Sample
Buffer mixed with 5% 1-mercaptoethanol was boiled and loaded onto a
Novex.RTM. NuPAGE.RTM. 12% His-Tris gel (Life Technologies). For
standards, 0.5 .mu.g to 2 .mu.g Amino-terminal FLAG-BAP.TM. Fusion
Protein (Sigma) were loaded as a positive control. Gel
electrophoresis was performed according to manufacturer's protocol.
Once run, the gel was transferred onto an iBlot.RTM. Mini Transfer
Stack nitrocellulose 0.2 .mu.m pore size membrane (Life
Technologies) according to manufacturer protocol. Next, the
nitrocellulose membrane was removed from the stack and assembled
into a Millipore SNAP I.d..RTM. 2.0 Protein Detection Apparatus. 30
ml of Millipore Blok CH Noise Cancelling reagent was placed into an
assembled reservoir tray and vacuumed through. 3 ml of antibody
solution was prepared by diluting 2 .mu.l of Sigma Monoclonal
ANTI-FLAG.RTM. M2-Peroxidase (HRP) antibody into 3 ml of Millipore
Blok CH Noise Cancelling Reagent. Antibody solution was added to
reservoir tray and allowed to incubate for 10 minutes without
vacuum. After incubation, the reservoir tray was filled with 90 ml
of 1.times.PBS+0.1% Tween 20 and vacuumed through as the final wash
step. After wash, the nitrocellulose membrane was removed and
placed into a reagent tray. 20 ml of Millipore Luminata Classico
Western HRP substrate was added and allowed to incubate for 1
minute. After incubation, the membrane was placed into imaging tray
of Gel Doc.TM. XR+ System (Bio-rad) and imaged using a
chemiluminescent protocol.
[0903] Anti-FLAG Dot Blot.
[0904] Extracellular and/or intracellular proteins were analyzed
using dot blot to evaluate expression level.
[0905] 110 .mu.l of 0.2 .mu.m filtered sample was mixed with 110
.mu.l 8.0 M Guanidine Hydrochloride, 0.1 M Sodium Phosphate
(Denaturing Buffer) to allow for even protein binding. A standard
curve of Amino-terminal FLAG-BAP.TM. Fusion Protein (Sigma) was
prepared in the same matrix as the samples, starting at 2 .mu.g,
diluting 2.times. serially to 0.0313 .mu.g. Invitrogen 0.45 .mu.m
nitrocellulose membrane was pre-wet in 1.times.PBS buffer for 5
minutes and then loaded onto Bio-Rad Dot Blot Apparatus, 300 .mu.l
of PBS was vacuumed through to further wet the membrane. Next, 200
.mu.l the 1:1 Sample:Denaturing Buffer mixture was loaded into each
well and allowed to drain through the dot blot apparatus by gravity
for 30 minutes. Next, a 300 .mu.l PBS is wash was performed on all
wells by vacuum followed by loading 300 .mu.l of Millipore Blok CH
Noise Cancelling reagent and incubating for 60 minutes. After
blocking, membrane was washed with 300 .mu.l of 1.times.PBS+0.1%
Tween 20. Next, antibody solution was prepared by adding 2.4 .mu.l
of Sigma Monoclonal ANTI-FLAG.RTM. M2-Peroxidase (HRP) antibody to
12 ml of Millipore Blok CH Noise Cancelling reagent (1:5000
dilution). 100 .mu.l of the resulting antibody solution was added
to each well and allowed to incubate for 30 minutes by gravity.
After antibody incubation, three final washes were performed with
300 .mu.l 1.times.PBS+0.1% Tween 20 by vacuum. After washes,
nitrocellulose membrane was removed and placed into a reagent tray,
20 ml of Millipore Luminata Classico Western HRP substrate was
added and allowed to incubate for 1 minute. After incubation,
membrane was placed into imaging tray of Gel Doc.TM. XR+ System
(Bio-rad) and imaged using a chemiluminescent protocol.
[0906] Anti-FLAG ELISA.
[0907] Protein expression was detected by direct ELISA using an
anti-FLAG antibody. Briefly, a dilution series (0.005-10 .mu.g/mL)
of FLAG fusion protein (Sigma) was prepared in 0.1 M NaHCO3 (pH
9.5). A dilution series (0.01-20 .mu.g/mL) of FLAG fusion protein
was also prepared in spent medium from an empty fungus culture
diluted 10-fold in 0.1 M NaHCO3 (pH 9.5). Experimental cultured
medium samples were diluted 10-fold in 0.1 M NaHCO3 (pH 9.5). The
FLAG fusion protein dilution series and the experimental samples
were then transferred (0.2 mL) to the wells of a Nunc-immuno.TM.
Maxisorp.TM. (Thermo) 96-well plate and incubated overnight at
2-8.degree. C. to facilitate protein adsorption. The following
morning, plates were rinsed three times with Tris-buffered saline
(TBS) containing 0.05% TWEEN 80 (TBST). The wells were blocked from
non-specific protein binding by incubation with 0.2 mL of 1%
non-fat dried milk dissolved in TBST for 1 h at room temperature.
The plates were rinsed three more times with TBST and then
incubated at room temperature for 1 h with 0.2 mL of the monoclonal
antibody anti-FLAG M2-HRP (Sigma) diluted 1:2000 in blocking
buffer. The plates were again rinsed three more times with TBST
before incubation with 0.2 mL % well of SIGMAFAST.TM.
o-phenylenediamine dihydrocholride (OPD) (Sigma) for 30 min at room
temperature. The reaction was terminated with the addition of 0.05
mL/well of 1 M HCl and the absorbance of samples was measured at
492 nm on a spectrophotometer equipped with a plate reader.
Example 18
Therapeutic Liquid Formulations of Nutritive Polypeptides
[0908] Nutritive polypeptide sequences were administered for
therapeutic purposes in a variety of liquid formulations. For
example, the formulations utilized differ by protein concentration,
solution pH, presence or absence of particulates, minerals,
tastants, and/or excipient additives. In therapeutic liquid
formulations, the concentration of protein ranges from 0.1% to 60%
w/w in solution. In certain instances, a lower concentration is
preferable. For example, SEQID-00105 has been dosed as low as 10%.
In some cases a higher concentration is preferable. For example,
SEQID-00105 and SEQID-00363 were dosed as 35% solutions. In some
cases a nutritive polypeptide sequence is dosed at its maximum
solubility, which varies by protein and is generally in the range
of 0.1% to 60% w/w. Both SEQID-00105 and SEQID-00363 were shown to
be a soluble liquid at 50% w/w in solution. In therapeutic liquid
formulations, the solution pH generally ranges from 2 to 11.
Protein solubility is known to be a strong function of solution pH
(C. Tanford. Physical Chemistry of Macromolecules, p. 242, Wiley,
New York, 1961.) In most cases, nutritive polypeptide sequences are
least soluble at their isoelectric point (pI), and thus solution pH
is often adjusted to be above or below the pI of the nutritive
polypeptide sequence. This modulation of pH allows control over
protein solubility. For example, SEQID-00105 and SEQID-00363 have
isoelectric points near 4. These nutritive polypeptide sequences
were purposely formulated at pH 8-9, so they would be above their
pI. For example, SEQID-00587 has a pI of 9.7 and was purposely
formulated at pH 7, so that it would be below its pI. Nutritive
polypeptides that are soluble at their pI, can be formulated at
their pI so that the liquid formulation does not require an
additional buffering species to maintain the solution pH. In this
case, the protein itself acts to buffer the solution pH, as its own
amino acids are protonated and deprotonated. A protein solution
formulated at the pI of the protein shows resistance to changes in
pH when acid or base are added, indicating that the solution is, in
fact, buffered by the protein itself. In some therapeutic liquid
formulations, a nutritive polypeptide includes particulate matter.
Particulate matter is visible to the eye, and/or it contains
subvisible particulates (example soluble aggregates). Particulate
matter is product-related, and/or it is foreign. Particulate matter
occurs in suspension, as a slurry, and/or settles at the bottom of
the solution. In some embodiments, particulate matter is desirable
because wherein it is indigestible or slowly digestible in the
stomach, it acts as a carrier delivering the nutritive polypeptide
to the intestine. In some embodiments, particulate matter is
desirable in a liquid formulation because it allows dosing the
nutritive polypeptide above its limit of solubility. In the case of
SEQID-00105, there is no visible particulate matter. SEQID-00424
was dosed with suspended particulate matter.
[0909] In therapeutic liquid formulations, a nutritive polypeptide
sequence is typically formulated with one or more excipients
dissolved in the formulation. Each excipient is included for a
specific purpose. Buffers (examples: Tris, phosphate, ammonium
bicarbonate, sodium carbonate, acetate, citrate, arginine) are
added to control the solution pH. Sugars are added to control
aggregation and solubility (examples: trehalose, glucose, sucrose,
and mannitol). Detergents are added to control solubility and
aggregation (examples tween, triton, CHAPS, and deoxycholate).
Polyalcohols are added to control solubility and aggregation
(glycerol, PEG). Chaotropes are added to increase protein
solubility (example thiocyanate and urea). Antioxidants are added
to prevent protein oxidation (examples ascorbic acid and
methionine). Salts are added to increase protein solubility and/or
are added to achieve a desired osmolality (example sodium
chloride). SEQID-00105, SEQID-00363, SEQID-00426 were formulated in
sodium phosphate and sodium chloride and dosed orally. SEQID-00587
and SEQID-00559 were formulated in ammonium bicarbonate and dosed
orally. SEQID-00240 was formulated in sodium carbonate and dosed
orally. Tastants were added to nutritive polypeptides to enhance
the gustatory experience of the user, with successful result.
Vanilla extract was added in combination with sucralose according
to Tang et al. (Tang J E, Moore D R. Kujbida G W, Tarnopolsky M A,
Phillips S M. J Appl Physiol (1985). 2009 September;
107(3):987-92). The qualitative benefit of enhanced flavor was
documented by users as being "quite pleasant."
[0910] The two tables Table E18A and Table E18B summarize a number
of administrations of nutritive polypeptides to humans and to
rats.
TABLE-US-00099 TABLE E18A Therapeutic liquid formulations of
nutritive polypeptides used for human administration. Human
Administration Protein Conc dosed SEQID (g/L) (g) pH Buffer NaCl
Tastants SEQID-00105 350 35 8.7 2 mM 6 mM Each formulation
phosphate contained 8 mL of SEQID-00363 350 35 7 3 mM 14 mM vanilla
extract per phosphate liter and 4 grams SEQID-00105 117 20 8.7 2 mM
6 mM of sucralose per phosphate liter, according to SEQID-00105 117
20 8.7 2 mM 6 mM Tang, et al. phosphate SEQID-00363 117 20 7 3 mM
14 mM phosphate SEQID-00426 117 20 7 none none
TABLE-US-00100 TABLE E18B Therapeutic liquid formulations of
nutritive polypeptides used for human administration. Rat
Administration dosage (mg protein per Conc kg body SEQID (g/L)
weight) pH Buffer NaCl SEQID-00105 250 2,850 8.7 2 mM phosphate 6
mM SEQID-00105 250 2,850 8.7 2 mM phosphate 6 mM SEQID-00338 250
2,850 8.7 2 mM phosphate 6 mM SEQID-00338 250 2,850 8.7 2 mM
phosphate 6 mM SEQID-00105 98 1,113 8.7 2 mM phosphate 6 mM
SEQID-00240 135 1,539 10.8 25 mM Na2CO3 0 mM SEQID-00105 156 1,781
8.7 2 mM phosphate 6 mM SEQID-00363 229 2,850 7 3 mM phosphate 14
mM (a-mannosidase treated) SEQID-00363 250 2,850 7 3 mM phosphate
14 mM (hydrolyzed) SEQID-00105 250 2,850 8.7 2 mM phosphate 6 mM
SEQID-00105 250 2,850 8.7 2 mM phosphate 6 mM SEQID-00105 250 2,850
8.7 2 mM phosphate 6 mM SEQID-00105 250 2,850 8.7 2 mM phosphate 6
mM SEQID-00105 250 2,850 8.7 2 mM phosphate 6 mM SEQID-00338 250
2,850 8.7 2 mM phosphate 6 mM SEQID-00352 250 2,850 7 3 mM
phosphate 14 mM SEQID-00363 250 2,850 7 3 mM phosphate 14 mM
SEQID-00363 250 2,850 7 3 mM phosphate 14 mM SEQID-00423 250 2,850
7 3 mM phosphate 14 mM SEQID-00424 250 2,850 7 3 mM phosphate 14 mM
SEQID-00425 250 2,850 7 3 mM phosphate 14 mM SEQID-00426 250 2,850
7 none 0 mM SEQID-00426 250 2,850 7 none 0 mM SEQID-00429 250 2,850
7 3 mM phosphate 14 mM SEQID-00559 250 2,850 7.7 25 mM NH4HCO3 0 mM
SEQID-00587 250 2,850 7.7 25 mM NH4HCO3 0 mM
Example 19
Therapeutic Formulations of Nutritive Polypeptides
[0911] Alternative to soluble, homogenous, liquid formulations,
nutritive polypeptides can be prepared alternatively. This example
describes alternative nutritive polypeptide formulations such as
slurries, gels, tablets and food ingredients.
[0912] Slurry Formulations.
[0913] Slurries are semiliquid mixtures that contain both soluble
and insoluble material which generally appear as fine granules in
solution. Nutritive polypeptide slurries are prepared when a
nutritive polypeptide is either concentrated above its maximum
solubility, or, when a lyophilized or freeze dried preparation of a
nutritive polypeptide is resuspended above its maximum solubility.
Optionally, addition of an emulsifier such as soy lecithin is added
at a concentration between 0.1-1% to stabilize the homogeneity of a
slurry (van Nieuwenhuyzen et al., 1999 Eur. Journal of Lipid Sci,
and Tech.).
[0914] Gel Formulations.
[0915] Alternatively, nutritive polypeptides are formulated as
gels. Gels are solid, jelly-like formulations that are generally
formed through molecular cross linking. Nutritive polypeptides are
formulated as gels through treatment with transglutaminase (EC
Number 2.3.2.13). Transglutaminase can catalyze the cross linking
of nutritive polypeptides between g-carboxamide groups of peptide
bound glutamine residues and the e-amino groups of nutritive
polypeptide bound lysine residues. This formation of a
g-glutamyl-e-lysine cross links proteins in solution; thus,
promoting gel formation.
[0916] Human transglutaminase is a calcium (Ca2+) dependent enzyme
with a Kd for calcium in the range of 0.3-3 uM (Ahvazi et al., 2003
Journal of Biological Chemistry). Due to the precipitave effects of
calcium in preparations of nutritive polypeptides, a microbial
(Streptomyces mobaraensis) orthologue of transglutaminase has been
identified that acts in a calcium-independent manner (Ando et al,
1989 Agric Biol Chem). To prepare a gelatinous preparation of
nutritive polypeptides, nutritive polypeptides are solubly
formulated at 250 g/L at neutral pH. Transglutaminase is spiked
into the preparation at 10 EU per g nutritive polypeptide and
allowed to react at 35.degree. C. until adequate gel formation has
occurred (Chen et al., 2003 Biomaterials).
[0917] Tablet Formulations.
[0918] Preparation of solid tablets of nutritive polypeptides is
accomplished according to Sakarkar et al. 2009 (International
Journal of Applied Pharmaceutics). Tablets are formulated as a
mixture of nutritive polypeptides, excipients and binding agents.
Tablets are composed of 50% w/w nutritive polypeptide, 26% w/w
microcrystalline cellulose, 7.5w, sodium bicarbonate-citric acid
mixture (70:30), 6.5% w/w lactose, 5.5% w/w, magnesium stearate and
bound by 4.5% w/w polyvinyl pyrrolidone solution in isopropanol.
Tablets are dehumidified and granulated prior to compression into
100 mg tablets. Tablets are coated with 12.5% w/w ethyl cellulose
solution in dichloromethane and diethyl phthalate as a
plasticizer.
[0919] Inhalable Dry Powder.
[0920] Nutritive polypeptides are formulated to be administered as
an inhalable dry powder as described in Lucas et al., 1998 Pharm
Res. Nutritive proteins are co-processed with malto-dextrin by
spray-drying to produce model protein particles. Aerosol
formulations are then prepared by tumble mixing protein powders
with a-lactose monohydrate (63-90 .mu.m) or modified lactoses
containing between 2.5 and 10% w/w fine particle lactose (FPL) or
micronised polyethylene glycol 6000. Powder blends are then
characterized in terms of particle size distribution, morphology
and powder flow.
[0921] Conventional Food Formulations.
[0922] Nutritive polypeptides are formulated as a food ingredients
as dry, solid formulations. For example, nutritive polypeptides are
incorporated into pasta dough by mixing dry nutritive polypeptide
formulations into water, durum semolina. Arabica gum, mono- and
diglycerides, fiber, yeast and citric acid. Dough is cut to shape,
dried and packaged.
Example 20
In Vitro Screening of Amino Acids and Nutritive Polypeptides for
GLP-1 Production
[0923] Glucagon-like peptide-1 (GLP-1) is a peptide hormone
produced by L-cells of the intestine in response to multiple
nutrient stimuli. GLP-1 is an incretin that decreases blood glucose
levels by increasing insulin release from the pancreas. GLP-1 acts
on other peripheral tissues increasing glucose uptake and storage
in skeletal muscle and adipose tissue, decreasing the rate of
gastric emptying, and decreasing hepatic glucose production (Baggio
LL & DJ Drucker. 2007. Biology of incretins: GLP-1 and GIP.
Gastroenterology. 132:2131-2157). GLP-1 is a product of the
post-translational cleavage of proglucagon to generate active GLP-1
(7-36) this is rapidly degraded after secretion by dipeptidyl
peptidase IV (DPPIV) to GLP-1 (9-36).
[0924] Several mammalian gastrointestinal cell lines are used as
models for L-cell secretion of GLP-1 (IEC-6 from rats, NCI-H716 and
FHs74Int from Humans, and STC-1 and GLUTag from mice). The purpose
of these experiments is to determine which amino acid combinations,
nutritive protein digests, and/or full length nutritive proteins
induce GLP-1 secretion in vitro.
[0925] The NCI-H716 cell line is obtained from the American Type
Culture Collection (Catalog number ATCC. CCL-251.TM., Manassas,
Va.). RPMI-1640, Dulbecco's Modified Eagle Medium (DMEM) and
Dulbecco's Phosphate Buffered Saline (DPBS) are obtained from Life
Technologies (Catalog numbers 11875, 11965 and 14190, respectively;
Carlsbad, Calif.). Penicillin-Streptomycin Solution is obtained
from ATCC (Catalog number 30-2300, Manassas, Va.).
Antibiotic-Antimycotic Solution (100.times.) is obtained from
Sigma-Aldrich (Catalog number A5955, St. Louis, Mo.). Fetal bovine
serum is obtained from GE Healthcare (Catalog number SH3007103HI,
Wilmington, Mass.). Bovine serum albumin is obtained from Fisher
Scientific (Catalog number BPI600-100, Pittsburgh, Pa.). Fatty-acid
free bovine serum albumin is obtained from Sigma-Aldrich (Catalog
number A7030, St. Louis, Mo.). Phenylmethyl sulfonyl fluoride
(PMSF), a protease inhibitor, is obtained from Thermo Scientific
(Catalog number 36978, Waltham, Mass.). Diprotin A, a DPPIV
inhibitor, is obtained from Sigma-Aldrich (Catalog number 19759,
St. Louis, Mo.). Tissue Protein Extraction Reagent (T-PER) is
obtained from Thermo Scientific (Catalog number 78510, Waltham,
Mass.). Active GLP-1 concentration is determined using the
AlphaLisa GLP-1 (7-36 amide) Immunoassay Research Kit (Catalog
number AL215, PerkinElmer, Waltham, Mass.) and read on an EnSpire
Alpha plate reader (PerkinElmer, Waltham, Mass.). Data are analyzed
using Microsoft Excel version 14.0.7128.5000 (Microsoft
Corporation, Redmond. Wash.) and GraphPad Prism version 6.03 for
Windows (GraphPad Software, La Jolla, Calif.). Krebs Ringer Buffer
(KRB) is prepared and the AlphaLISA GLP-1 (7-36 amide) Immunoassay
Research Kit is obtained from PerkinElmer (Catalog number AL215.
Waltham, Mass.).
[0926] Ninety-six well plates are pre-coated with MatriGel. 80
.mu.L of MatriGel is added to 5 mL Dulbecco's Modified Eagle Medium
(DMEM) without glucose. 50 .mu.L are added per well and the plate
incubated at 37.degree. C. 5% CO2 for 30 minutes. MatriGel solution
is aspirated prior to addition of cells.
[0927] NCI-H716 cells are maintained in RPMI-1640 medium
supplemented with 10% fetal bovine serum (FBS) and 1%
Antibiotic-Antimycotic Solution and incubated in T-75 tissue
culture flasks at 37.degree. C., 5% CO2. Cells are passaged 1:3 or
1:6 every 2 to 3 days.
[0928] Cells are detached with 0.25% trypsin-EDTA incubated at
37.degree. C., 5% C02 and centrifuged at 750 rpm for 10 minutes to
pellet cells. Cell pellet is washed twice with 1.times. Dulbecco's
Phosphate Buffered Saline (DPBS) supplemented with 1% FBS and
centrifuged at 750 rpm for 10 minutes to pellet cells. The cells
are resuspended in Dulbecco's Modified Eagle Medium (DMEM)
supplemented with 10% FBS and 1% penicillin/streptomycin and
counted on a hemocytometer. Cells are diluted to 1.8>106
cells/mL and 200 .mu.L added to each well of a 96 well plate
pre-coated with Matri-Gel. Cells are incubated for 2 days at
37.degree. C., 5% CO2.
[0929] Screening of GLP-1 Secretion to Amino Acid Treatments in
NCI-H716 Cells
[0930] Following two day incubation, medium is aspirated and
replaced with 200 .mu.L Starvation Buffer [i.e. Krebs-Ringer Buffer
(KRB) containing 50 .mu.g/mL PMSF, 34 .mu.g/mL Diprotin A, and 0.2%
fatty-acid free bovine serum albumin (BSA)] and incubated for 30
minutes at 37.degree. C., 5% CO.sub.2. Starvation buffer is then
aspirated and replaced with 100 .mu.L/well of treatment article in
Starvation Buffer. Cells are stimulated with treatment article for
2 hours then medium is removed and frozen at -80.degree. C.
Treatment articles include individual amino acids, amino acid
blends, nutritive protein digests, and/or full length nutritive
proteins.
[0931] Determination of Active GLP-1 Concentration from
Supernatant.
[0932] Supernatant is assayed for the active form of GLP-1
(7-36)NH2 using the AlphaLISA GLP-1 (7-36 amide) Immunoassay
Research Kit (PerkinElmer, AL215) in accordance with the
manufacturer's instructions. The standard is assayed in Assay
Buffer supplemented to an equivalent concentration of Starvation
Buffer. Alternatively, the active form of GLP-1 is measured using
an enzyme-linked immunosorbant assay (ELISA) as described herein.
Luminescence data from the AlphaLISA GLP-1 (7-36 amide) Immunoassay
or GLP-1 ELISA is analyzed on Microsoft Excel and GraphPad
Prism.
[0933] Duplicate sample concentrations are determined by non-linear
regression using a 4 parameter logistic model of the standard
following an x=log(x) transformation of the active GLP-1
concentration in GraphPad Prism 6. ANOVA and multiple comparison
tests are conducted on GraphPad Prism 6.
[0934] Comparisons of the GLP-1 content from samples collected
after test article treatment to those collected after vehicle
control treatment describe the degree of GLP-1 secretion due to a
test article over time. Comparison of this difference across
treatments describes the differential effects of each amino acid.,
amino acid blend, nutritive protein digest, and nutritive protein
treatment relative to the other, and provides a means of ranking
their efficacy.
[0935] GLP-1 secretion by amino acids
[0936] Cells were starved of amino acids as described herein and
stimulated with stimulation buffer alone, 19 amino acids, 17 amino
acids (without leucine, isoleucine or valine). 20 amino acids or
leucine alone at their concentration in DME/F12 medium (see Table
E20C) for two hours. Supernatant was harvested and frozen at
-80.degree. C. GLP-1 (7-36) amide concentration was assayed
subsequently. FIG. 6 shows supernatant concentration of GLP-1
(7-36) detected in the supernatant following stimulation, error
bars are the standard deviation of the technical replicates.
Fourteen compositions increased the concentration of GLP-1 above
10% greater than that observed in the larger buffer only
stimulation (those lacking either Asn, Met, Gln, Tyr, His, Gly,
Cys, Phe, Trp, Ala, Glu, Leu, Ile and Val). Two compositions, amino
acids lacking Arg & Leu only treatment, showed decreased
concentration of GLP-1 (7-36) below 10% below the lower buffer only
stimulation.
TABLE-US-00101 TABLE E20A Amino Acids .mu.M Amino Acids .mu.M
Glycine 250 L-Leucine 451 L-Alanine 50 L-Lysine 500 L-Arginine 700
L-Methionine 116 L-Asparagine 57 L-Phenylalanine 215 L-Aspartic
Acid 50 L-Proline 150 L-Cysteine 100 L-Serine 250 L-Glutamic Acid
100 L-Threonine 449 L-Glutamine 2500 L-Tryptophan 44 L-Histidine
150 L-Tyrosine 214 L-Isoleucine 416 L-Valine 452
Example 21
Use of Nutritive Polypeptides to Improve Glycemic Control in
Healthy, Fasted Rats
[0937] Glucose tolerance tests are a common method of measuring
glycemic control in both clinical and preclinical settings. During
the test, a large dose of glucose is given and blood samples are
taken at subsequent time points to determine how quickly blood
glucose levels renormalize. In an oral glucose tolerance test
(OGTT), a dose of glucose is ingested by mouth. Such tests are
clinically used to identify individuals with poor glucose control
(Cobelli et al., 2014), and pre-clinically to assess the
therapeutic efficacy of anti-diabetes medications (Wagman &
Nuss, 2001)(Moller, 2001). Glucose levels are modulated by a number
of different gastrointestinal hormones, including insulin,
glucagon, somatostatin, glucose-dependent insulinotropic peptide
(GIP), and glucagon-like peptide 1 (GLP-1), which both directly and
indirectly modulate glucose levels. Combined measurements of
glucose and gastrointestinal hormones are used to assess glucose
intolerance, insulin resistance, and the severity of metabolic
disease (Ferrannini & Mari, 2014).
[0938] An OGTT was performed on twenty five healthy, fasted, male
Sprague-Dawley rats with indwelling jugular vein catheters (JVC) to
assess the acute effects of nutritive polypeptide dosing on
glycemic control as well as insulin and GLP-I levels.
[0939] Oral Glucose Tolerance Test.
[0940] All rodents were approximately 10-12 weeks old, weighed
average of approximately 350 g and acclimated for 4 days prior to
testing. Animals were housed singly with bedding and fed a regular
rodent chow diet (Lab Diet 5001) prior to the study. Housing
temperature was at kept at 222.degree. C., humidity at 50.+-.20%,
and a 12 hour light/2 hour dark cycle was implemented. Air
circulation was ten or more air changes per hour with 100% fresh
air. Prior to treatment, all rats were fasted overnight for
fourteen hours. Fasted animals were treated with formulations of
nutritive polypeptides dissolved in water by oral gavage (see Table
E21A), and fifteen minutes after treatment gavage were then
challenged with an oral gavage of glucose (2 g/kg). Blood glucose
was measured and blood was collected at seven time points (-15, 0,
15, 30, 60, 90, 120 minutes relative to the glucose challenge).
Blood was collected in an EDTA collection tube containing plasma
stablizers (a DPP4 inhibitor and a protease cocktail inhibitor).
One additional rat was sacrificed at and bled out to provide naive
blood for analytical standards. Glucose was measured using small
drops of blood collected via the JVC using a glucometer (AlphaTrak
2, Abbott).
TABLE-US-00102 TABLE E21A Dose Average Total Glucose Glucose
Glucose Dose Conc. Volume BW Protein Volume Dose Conc. Group
(mg/kg) (mg/mL) (mL/kg) (kg) (mg) (mL/kg) (g/kg) (mg/mL) Vehicle NA
NA 11.4 0.35 NA 4 2 500 SEQID- 2850 250 11.4 0.35 5,985 4 2 500
00105 Arginine 1000 87.7 11.4 0.35 2,100 4 2 500 HCl SEQID- 2850
250 11.4 0.35 5,985* 4 2 500 00338
[0941] Approximately 300 .mu.L of blood was collected from the V of
all rats in Group 1-4 at six time points (-15, 0, 15, 30, 60, and
120 minutes). Glucose gavages and blood collections were timed to
take the same amount of time per animal so that sample times were
accurate for each animal. All time points were collected within 5%
of the target time. Blood was collected into pre-chilled
(0-4.degree. C.) K2EDTA blood collection tubes containing Protease
Inhibitor Cocktail (Catalog number D8340, Sigma-Aldrich, St. Louis,
Mo.) and DPPIV inhibitor (Millipore, Billerica, Mass.) added to the
tubes at 1:100 prior to collection. After blood collection, blood
samples were maintained chilled (2-6.degree. C.) and centrifuged
within 30 minutes. The collected plasma was placed in sample tubes
and immediately stored at -80.degree. C.
[0942] Prior to immunoassay analysis samples were thawed on ice for
1 hour, mixed thoroughly by pipette, rearrayed to 96 well
microplates. Separate aliquots were prepared for insulin
immunoassay and GLP-1 immunoassay. Master plate and aliquots were
stored frozen at -80.degree. C.
[0943] FIG. 7 shows the average blood glucose values during the
OGTT described herein. The error bars shown are the standard errors
of the mean. All groups showed significant differences in blood
glucose from fasting at times t=15, and t=30 min after the glucose
challenge (p<0.05, Dunnett multiple comparison test). The groups
that received SEQID-00105 and SEQID-00338 showed a significant
difference in blood glucose relative to vehicle at times t=15, and
t=30 after the glucose challenge (p<0.05. Tukey-Kramer multiple
comparison test, comparing treatment group to each other at each
time point). These data indicated that acute ingestion of
SEQID-00105 and SEQID-00338 can significantly improve glycemic
control after a glucose challenge in outbred male Sprague-Dawley
rats.
[0944] The area under curve for blood glucose was calculated using
the Linear-Log Traperoidal Method in Microsoft Excel, and
statistical analysis was conducted on GraphPad Prism 6.
[0945] The area under curve for blood glucose integreated from
0-120 minutes and from 0-60 minutes (FIG. 8) show that acute dosing
of SEQID-00105 and SEQID-00338 improves blood glucose control by
reducing blood glucose excursion in the context of an oral glucose
tolerance test. Between 0 and 60 minutes both SEQID-00105 and
SEQID-00338 have significantly smaller change in blood glucose in
comparison to vehicle (P<0.05, Dunnett's multiple comparisons
test).
[0946] Rat Insulin Enzyme Linked Immunosorbent Assay (ELISA).
[0947] An Ultra-Sensitive Rat Insulin ELISA Kit was obtained from
Crystal Chem, Inc. (Catalog number 90060, Downers Grove, Ill.).
Plates were washed using a BioTek ELx50 microplate strip washer
(BioTek, Winooski, Vt.). Absorbance was read on a Synergy Mx
monochromator-based microplate reader (BioTek, Winooski, Vt.). Data
was analyzed using Microsoft Excel version 14.0.7128.5000
(Microsoft Corporation, Redmond, Wash.) and GraphPad Prism version
6.03 for Windows (GraphPad Software, La Jolla, Calif.).
[0948] The ELISA kit was prewarmed to room temperature for 30
minutes prior to beginning the assay set up. The standard curve
dilutions were prepared in accordance with the manufacturer's
instructions for running the assay in Wide Range format.
[0949] Plasma matrix from the naive group and sample plasma were
thawed on ice and then centrifuged at approximately 1000.times.rcf
for 10 minutes at 4.degree. C. to pellet any insoluble
material.
[0950] Matrix Assay Buffer for running the insulin standard was
prepared using plasma matrix from the naive group to a
concentration of 5.26% in 95 .mu.L. 95 .mu.L of Assay Buffer was
added to all sample wells, and 95 .mu.L of Matrix Assay Buffer was
added to all standard wells. 5 .mu.L of each sample and standard
were added in duplicate. The plates were incubated at 4.degree. C.
for 2 hours. The plates were then washed five times with 300
.mu.L/well 1.times. Wash Buffer. The plates were tapped sharply
several times on paper towels to remove any residual wash
buffer.
[0951] Anti-insulin Enzyme Conjugate Working Solution was prepared
by combining 2 volumes Anti-Insulin Enzyme Conjugate Stock with 1
volume Enyme Conjugate Diluent, and mixing by pipetting up and down
and gently vortexing. 100 .mu.L/well of Anti-Insulin Enzyme
Conjugate Working Solution was added to all wells. The plates were
sealed and incubated at room temperature for 30 minutes and then
washed seven times with 300 .mu.L/well 1.times. Wash Buffer. The
plates were tapped sharply several times on paper towels to remove
any residual wash buffer. 100 .mu.L/well Enzyme Substrate Solution
was then added to each well and incubated in the dark at room
temperature for 40 minutes. 100 .mu.L/well Stop Solution was added
to all wells.
[0952] The absorbance was read on the Synergy Mx plate reader at
450 nm and 630 nm. Final values obtained were the A450 nm-A630 nm
values.
[0953] The insulin standard curve was corrected for matrix
concentration of insulin by subtracting the mean of the 0 ng/mL
insulin standard from each of the standard well A450 nm-A630 nm
values in Excel. Duplicate sample concentrations were determined by
non-linear regression using a 4 parameter logistic model of the
background corrected standard following an x=log(x) transformation
of insulin concentration in GraphPad Prism 6. ANOVA and multiple
comparison tests were conducted on GraphPad Prism 6. The area under
curve was integrated using the Linear-Log Trapezoidal Method on
Microsoft Excel, with post hoc testing conducted in GraphPad.
[0954] FIG. 9 shows the average plasma insulin concentration for
n=6 rats per treatment group over the course of the experiment. The
error bars show the standard error of the mean. All treatment
groups had statistically significant increases in plasma insulin
relative to their treatment or vehicle gavage at 15, 30 and 60
minutes following the glucose challenge (Dunnett's multiple
comparisons test). Only SEQID-00105 had a statistically significant
increase in plasma insulin concentration at the time of the glucose
challenge (0) relative to the plasma insulin at the time of the
treatment gavage (P<0.0001, Dunnett's multiple comparisons
test). Both SEQID-00105 and SEQID-00338 had statistically
significant greater insulin concentrations at 120 minutes following
the glucose challenge (P<0.05 and P<0.01, respectively;
Dunnett's multiple comparisons test).
[0955] In comparison to the vehicle, only SEQID-00105 showed a
statistically significantly greater increase in plasma insulin
concentration at the time of the glucose challenge (P<0.001,
Dunnett's multiple comparisons test).
[0956] These data indicated that an acute ingestion of SEQID-00105
can stimulate insulin release within 15 minutes of ingestion in
outbred male Sprague-Dawley rats.
[0957] FIG. 10 shows the area under curve integrated between 0-240
and 0-60 minutes for all treatment groups. No treatment group was
statistically significantly greater than vehicle.
[0958] Total GLP-1 Enzyme Linked Immunosorbent Assay (ELISA).
[0959] A rat GLP-1 ELISA Kit was obtained from Crystal Chem, Inc.
(Catalog number 81507, Downers Grove, Ill.). Plates were washed
using a BioTek ELx50 microplate strip washer (BioTek. Winooski,
Vt.). Absorbance was read on a Synergy Mx monochromator-based
microplate reader (BioTek. Winooski Vt.). Data was analyzed using
Microsoft Excel version 14.0.7128.5000 (Microsoft Corporation.
Redmond, Wash.) and GraphPad Prism version 6.03 for Windows
(GraphPad Software, La Jolla, Calif.).
[0960] The ELISA kit was prewarmed to room temperature for 30
minutes prior to beginning the assay set up. The standard curve
dilutions were prepared in accordance with the manufacturer's
instructions.
[0961] Plasma matrix from Group 5 and sample plasma were thawed on
ice and then centrifuged at approximately 1000.times. rcf for 10
minutes at 4.degree. C. to pellet any insoluble material.
[0962] Matrix Assay Buffer for running the GLP-1 standard was
prepared using plasma matrix from the naive group to a
concentration of 25% in 100 .mu.L. The ELISA microplates were
washed three times with 350 .mu.L/well 1.times. Wash Buffer and
tapped sharply on paper towels to remove residual wash buffer. 100
.mu.L of Assay Buffer was added to all sample wells, and 100 .mu.L
of Matrix Assay Buffer was added to all standard wells. 25 .mu.L of
each sample and standard were added in duplicate. Wells were mixed
by pipetting. The plates were covered with adhesive foil and
incubated for 18 hours at room temperature on a horizontal plate
shaker at 100 rpm. The plates were then washed three times with 350
.mu.L/well 1.times. Wash Buffer then tapped sharply several times
on paper towels to remove any residual wash buffer. 100 .mu.L/well
of Biotin Labeled Antibody Solution was added to all wells. The
plates were then sealed and incubated at room temperature for 1
hour on a horizontal plate shaker at 100 rpm. The plates were then
washed three times with 350 .mu.L/well 1.times. Wash Buffer then
tapped sharply several times on paper towels to remove any residual
wash buffer. 100 .mu.L/well SA-HRP Solution was added to all wells.
The plates were then sealed and incubated at room temperature for
30 minutes on a horizontal plate shaker at 100 rpm. The plates were
then washed three times with 350 .mu.L/well 1.times. Wash Buffer
then tapped sharply several times on paper towels to remove any
residual wash buffer. 100 .mu.L/well Enzyme Substrate Solution was
added to all wells. The plates were then sealed and incubated in
the dark, without shaking, for 30 minutes at room temperature.
Following substrate incubation, 100 .mu.L Stop Solution was added
to all wells.
[0963] The absorbance values were read on the Synergy Mx plate
reader at 450 nm and 630 nm. Final values obtained were the A450
nm-A630 nm values.
[0964] The standard curve was corrected for matrix concentration of
total GLP-1 by subtracting the mean of the 0 .mu.M GLP-1 standard
from each of the standard well A450 nm-A630 nm values in Excel.
Duplicate sample concentrations were determined by non-linear
regression using a 4 parameter logistic model of the background
corrected standard following an x=log(x) transformation of GLP-1
concentration. ANOVA and multiple comparison tests were conducted
using GraphPad Prism 6. The area under curve was integrated using
the Linear-Log Trapezoidal Method on Microsoft Excel, with post hoc
testing conducted in GraphPad.
[0965] FIG. 11 shows average plasma GLP-concentration for n=6 rats
per treatment group over the course of the experiment. The error
bars shown here correspond to the standard error of the mean. The
SEQID-00338 treatment group shows a statistically significant
greater concentration of GLP-1 at the time of the glucose challenge
than vehicle (p<0.0005, Dunnett's multiple comparisons
test).
Example 22
Use of Nutritive Polypeptides to Improve Glycemic Control in Zucker
Fatty (fa/fa) Rats
[0966] An OGTT was performed in 18, fasted, male Zucker fatty rats
with indwelling jugular vein catheters (JVC) to assess the acute
effects of nutritive polypeptide dosing on glycemic control as well
as insulin and GLP-1 levels.
[0967] Oral Glucose Tolerance Test.
[0968] All rodents were approximately 10-11 weeks old, weighed
average of approximately 450 g and acclimated for 4 days prior to
testing. Animals were housed singly with bedding and fed a regular
rodent chow diet (Lab Diet 5001) prior to the study. Housing
temperature was at kept at 222.degree. C., humidity at 50.+-.20%,
and a 12 hour light/2 hour dark cycle was implemented. Air
circulation was ten or more air changes per hour with 100% fresh
air. Prior to treatment, all rats were fasted overnight for
fourteen hours. Fasted animals were treated with formulations of
nutritive polypeptides dissolved in water by oral gavage (see Table
E22A), and fifteen minutes after treatment gavage were then
challenged with an oral gavage of glucose (5 g/kg). Blood glucose
was measured and blood was collected at seven time points (-15, 0,
15, 30, 60, 90, 120 minutes relative to the glucose challenge).
Blood was collected in an EDTA collection tube containing plasma
stablizers (a DPP4 inhibitor and a protease cocktail inhibitor).
One additional rat was sacrificed at and bled out to provide naive
blood for analytical standards. Glucose was measured using small
drops of blood collected via the JVC using a glucometer (AlphaTrak
2, Abbott).
TABLE-US-00103 TABLE E22A Body Polypeptides weight Dose Volume
Glucose Group (average, g) SEQID (mg/kg) (ml/kg) Dose (g/kg) 1 450
Vehicle 0 11.4 5 2 450 00105 2850 11.4 5 3 450 00338 2850 11.4
5
[0969] Approximately 300 .mu.L of blood was collected from the JVC
of all rats in Group 1-3 at six time points (-15, 0, 15, 30, 60,
90, and 120 minutes). Glucose gavages and blood collections were
timed to take the same amount of time per animal so that sample
times were accurate for each animal. All time points were collected
within 5% of the target time. Blood was collected into pre-chilled
(0-4.degree. C.) K2EDTA blood collection tubes containing Protease
Inhibitor Cocktail (Catalog number D8340. Sigma-Aldrich, St. Louis.
Mo.) and DPPIV inhibitor (Millipore, Billerica, Mass.) added to the
tubes at 1:100 prior to collection. After blood collection, blood
samples were maintained chilled (2-6.degree. C.) and centrifuged
within 30 minutes. The collected plasma was placed in sample tubes
and immediately stored at -80.degree. C.
[0970] Prior to immunoassay analysis samples were thawed on ice for
1 hour, mixed thoroughly by pipette, rearrayed to 96 well
microplates. Separate aliquots were prepared for insulin
immunoassay and GLP-1 immunoassay. Master plate and aliquots were
stored frozen at -80.degree. C.
[0971] FIG. 12 shows the average blood glucose values during the
OGTT described herein. The error bars shown are the standard errors
of the mean.
[0972] The integrated area under curve (AUC) was calculated on
Microsoft Excel using the Linear-Log Trapezoidal Method and
statistical testing was conducted on GraphPad Prism 6.03.
[0973] FIG. 13 shows the integrated AUC for each treatment group
between the time of glucose challenge (0 min.) and 60 minutes, and
between time 0 and 120 minutes. No treatment showed statistically
significant difference from vehicle between time 0 and 60 minutes.
Between time 0 and 120 minutes SEQID-00105 but not SEQID-00338
shows a statistically significant decrease in integrated area under
curve compared to vehicle (P<0.005, Dunnett's multiple
comparisons test). These data show that acute dosing of SEQID-00105
can reduce glucose excursion due to an oral glucose challenge in a
Zucker Fatty (fa/fa) model rodent model.
[0974] Rat Insulin Enzyme Linked Immunosorbent Assay (ELISA).
[0975] An Ultra-Sensitive Rat Insulin ELISA Kit was obtained from
Crystal Chem, Inc. (Catalog number 90060, Downers Grove, Ill.).
Plates were washed using a BioTek ELx50 microplate strip washer
(BioTek. Winooski. Vt.). Absorbance was read on a Synergy Mx
monochromator-based microplate reader (BioTek, Winooski. Vt.). Data
was analyzed using Microsoft Excel version 14.0.7128.5000
(Microsoft Corporation, Redmond, Wash.) and GraphPad Prism version
6.03 for Windows (GraphPad Software, La Jolla, Calif.).
[0976] The ELISA kit was prewarmed to room temperature for 30
minutes prior to beginning the assay set up. The standard curve
dilutions were prepared in accordance with the manufacturer's
instructions for running the assay in Wide Range format.
[0977] Plasma matrix from the naive group and sample plasma were
thawed on ice and then centrifuged at approximately 1000.times. rcf
for 10 minutes at 4.degree. C. to pellet any insoluble
material.
[0978] Matrix Assay Buffer for running the insulin standard was
prepared using plasma matrix from the naive group to a
concentration of 5.26% in 95 .mu.L. 95 .mu.L of Assay Buffer was
added to all sample wells, and 95 .mu.L of Matrix Assay Buffer was
added to all standard wells. 5 .mu.L of each sample and standard
were added in duplicate. The plates were incubated at 4.degree. C.
for 2 hours. The plates were then washed five times with 300
.mu.L/well 1.times. Wash Buffer. The plates were tapped sharply
several times on paper towels to remove any residual wash
buffer.
[0979] Anti-insulin Enzyme Conjugate Working Solution was prepared
by combining 2 volumes Anti-Insulin Enzyme Conjugate Stock with 1
volume Enyme Conjugate Diluent, and mixing by pipetting up and down
and gently vortexing. 100 .mu.L/well of Anti-Insulin Enzyme
Conjugate Working Solution was added to all wells. The plates were
sealed and incubated at room temperature for 30 minutes and then
washed seven times with 300 .mu.L/well 1.times. Wash Buffer. The
plates were tapped sharply several times on paper towels to remove
any residual wash buffer. 100 .mu.L/well Enzyme Substrate Solution
was then added to each well and incubated in the dark at room
temperature for 40 minutes. 100 .mu.L/well Stop Solution was added
to all wells.
[0980] The absorbance was read on the Synergy Mx plate reader at
450 nm and 630 nm. Final values obtained were the A450 nm-A630 nm
values. Samples in which the value exceeded the standard curve were
rerun at 1:1 dilution against a 2.5% matrix standard
[0981] The insulin standard curve was corrected for matrix
concentration of insulin by subtracting the mean of the 0 ng/mL
insulin standard from each of the standard well A450 nm-A630 nm
values in Excel. Duplicate sample concentrations were determined by
non-linear regression using a 4 parameter logistic model of the
background corrected standard following an x=log(x) transformation
of insulin concentration in GraphPad Prism 6. ANOVA and multiple
comparison tests were conducted on GraphPad Prism 6. The area under
curve was integrated using the Linear-Log Trapezoidal Method on
Microsoft Excel, with post hoc testing conducted in GraphPad.
[0982] FIG. 14 shows the average plasma insulin concentration for
n=6 rats per treatment group in Vehicle & SEQID-00105 and n=5
rats per treatment group in the case of SEQID-00338 over the course
of the experiment. One-way ANOVA with Dunnett's multiple
comparisons tests were used to compare within each treatment to
time 0 and between treatments at the same time point to vehicle.
Vehicle had no statistically significant change in plasma insulin
compared to the time of vehicle gavage. SEQID-00105 had
statistically significantly greater plasma insulin compared to the
time of treatment gavage (time -15) at the time of the glucose
challenge (time 0) and at 15 minutes and 90 minutes following
glucose challenge (P=0.0002, P<0.05 and P<0.05,
respectively). SEQID-00338 had statistically significantly greater
plasma insulin concentration compared to the time of treatment
gavage at all subsequent sampled time points (P<0.0001,
P<0.05, P<0.005, P<0.005, and P=0.0005, respectively).
[0983] In comparisons between treatments, neither SEQID-00105 nor
SEQID-00338 was significantly different from Vehicle at the time of
treatment or vehicle gavage. At the time of the glucose challenges
and all subsequent time points sampled (0, 15, 30, 60 and 90
minutes) both SEQID-00105 and SEQID-00338 had a significantly
greater plasma insulin concentration than vehicle. This shows that
both treatments stimulate insulin secretion in the Zucker Fatty
(fa/fa) model.
[0984] FIG. 15 shows the integrated area under the curve for each
group. Only SEQID-00338 treatment integrated between 0 and 90
minutes was statistically significantly greater than vehicle
(P<0.005).
[0985] Active GLP-1 Enzyme Linked Immunosorbent Assay (ELISA). A
rat active GLP-1 ELISA Kit was obtained from Eagle Biosciences
(Catalog number GP121-K01, Nashua, N.H.). Plates were washed using
a BioTek ELx50 microplate strip washer (BioTek, Winooski, Vt.).
Absorbance was read on a Synergy Mx monochromator-based microplate
reader (BioTek, Winooski, Vt.). Data was analyzed using Microsoft
Excel version 14.0.7128.5000 (Microsoft Corporation. Redmond,
Wash.) and GraphPad Prism version 6.03 for Windows (GraphPad
Software, La Jolla, Calif.).
[0986] The ELISA kit was prewarmed to room temperature for at least
30 minutes prior to beginning the assay set up. The standard curve
dilutions were prepared in accordance with the manufacturer's
instructions.
[0987] Plasma matrix from Group 5 and sample plasma were thawed on
ice and then centrifuged at approximately 1000.times. rcf for 10
minutes at 4.degree. C. to pellet any insoluble material.
[0988] Matrix Assay Buffer for running the active GLP-1 standard
was prepared using plasma matrix from the naive group to a
concentration of 10% in 100 .mu.L for samples tested at 1:1
dilution or 20% in 100 .mu.L for samples tested undiluted. 20 .mu.L
of standards and samples were added to the pre-coated microplate
and 100 .mu.L appropriate assay buffer added to the standard and
sample wells. The plates were covered with adhesive foil and
incubated for 24 hours at 4.degree. C. protected from light. The
plates were then washed five times with 350 .mu.L/well 1.times.
Wash Buffer then tapped sharply several times on paper towels to
remove any residual wash but er. 100 .mu.L/well of ELISA HRP
Substrate was added to all wells. The plates were then sealed and
incubated at room temperature for 20 minutes protected from light.
100 .mu.L/well ELISA Stop Solution was added to all wells and
gently mixed.
[0989] The absorbance values were read on the Synergy Mx plate
reader at 450 nm and 620 nm. Final values obtained were the A450
nm-A620 nm values.
[0990] The standard curve was corrected for matrix concentration of
active GLP-1 by subtracting the mean of the 0 .mu.M GLP-1 standard
from each of the standard well A450 nm-A620 nm values in Excel.
Duplicate sample concentrations were determined by non-linear
regression using a 4 parameter logistic model of the background
corrected standard following an x=log(x) transformation of GLP-1
concentration. ANOVA and multiple comparison tests were conducted
using GraphPad Prism 6. The area under curve was integrated using
the Linear-Log Trapezoidal Method on Microsoft Excel, with post hoc
testing conducted in GraphPad.
[0991] FIG. 16 shows average plasma GLP-1 concentration for n=6
rats per vehicle and SEQID-00105, and n=5 rats per SEQID-00338
treatment group, over the course of the experiment. One-way ANOVA
with Dunnett's multiple comparisons tests were used to compare
within each treatment to time 0 and between treatments at the same
time point to vehicle. Vehicle showed no significant difference in
GLP-1 (7-36) concentration at any time point after vehicle gavage.
SEQID-00105 showed significantly greater GLP-1 (7-36) concentration
at 15 minutes and 30 minutes after glucose challenge (P<0.0001
and P<0.05, respectively). SEQID-00338 had a significantly
greater GLP-1 concentration at 15 minutes following glucose
challenge (P<0.005).
[0992] When compared to vehicle at each time point only SEQID-00105
had a significantly greater GLP-1 (7-36) concentration than vehicle
at 15 minutes following glucose challenge (P<0.005).
[0993] FIG. 17 shows the area under curve for GLP-1 (7-36) for each
treatment group integrated to 0-90 and 0-60 minutes. No treatment
had a significantly different GLP-1 (7-36) integrated AUC compared
to vehicle at either 0-90 or 0-60 minutes.
[0994] In another experiment, an OGTT was performed in 24, fasted,
male Zucker fatty rats with indwelling jugular vein catheters (JVC)
to assess the acute effects of nutritive protein dosing on glycemic
control as well as insulin and GLP-1 levels. The capacity of
SEQID-00105 to improve glucose control was tested by comparing the
blood glucose excursion of SEQID-00105 to alogliptin to
SEQID-00105+ alogliptin to vehicle in the context of an oral
glucose tolerance test. All rodents were approximately 10-11 weeks
old, weighed average of approximately 430 g and acclimated for 4-5
days prior to testing. Prior to treatment, all rats were fasted
overnight for fourteen hours. Fasted animals were treated with
formulations of nutritive proteins dissolved in water by oral
gavage (see table E22B), and fifteen minutes after treatment gavage
were then challenged with an oral gavage of glucose (2 g/kg). Blood
glucose was measured and blood was collected at nine time points
(-15, 0, 15, 30, 60, 90, 120, 180 and 240 minutes relative to the
glucose challenge).
TABLE-US-00104 TABLE E22B Body DPP TV weight Polypeptides Inhibitor
Glucose (average, Treatment Dose Volume Dose Dose Group g) ID
(mg/kg) (ml/kg) (mg/kg) (g/kg) 1 430.5 Vehicle 0 11.4 0 2 2 432.3
SEQID-00105 2850 11.4 0 2 3 431.7 Alogliptin 0 11.4 0.3 2 4 435.5
SEQID-00105 + 2850 11.4 0.3 2 Alogliptin
[0995] FIG. 18 shows the average blood glucose values during the
OGTT described herein. N=6 rats per treatment group. The error bars
shown are the standard errors of the mean. Each group was compared
post hoc on GraphPad Prism 6, two-way ANOVA, Dunnett's multiple
comparisons test first comparing within each group to the fasting
glucose concentration, followed by a comparison of each time point
to vehicle. No treatment group blood glucose was significantly
different from fasting at the time of the glucose challenge.
[0996] Fasting glucose and blood glucose at the time of the glucose
challenge was not significantly different between each group and
vehicle. At 15 minutes following glucose challenge, SEQID-00105
only and SEQID-00105+ Alogliptin had significantly lower blood
glucose compare to vehicle (P=0.0003 & P<0.0001,
respectively). At 30 minutes following the glucose challenge
Alogliptin alone and SEQID-00105+ Alogliptin had significantly
lower blood glucose than vehicle (P=0.0424 & P=0.0021,
respectively). At 60 minutes following the glucose challenge, only
Alogliptin alone was significantly lower than vehicle
(P<0.0001). No group after 60 minutes had significantly
different blood glucose than vehicle.
[0997] The integrated area under curve (AUC) was calculated on
Microsoft Excel using the Linear-Log Trapezoidal Method and two-way
ANOVA and Dunnett's multiple comparisons tests was conducted on
GraphPad Prism 6.03. No treatment showed statistically significant
difference in glucose AUC from vehicle between time 0 and 60
minutes. Between time 0 and 120 minutes and between time 0 and 240
minutes only the alogliptin alone treatment was significantly less
than vehicle (P=0.0051 & P=0.0054, respectively).
Example 23
Use of Nutritive Polypeptides to Improve Glycemic Control and
Fasting Glucose in Diet Induced Obese Mice
[0998] The effects of chronic dosing of therapeutic nutritive
polypeptides described herein are evaluated by oral glucose
tolerance tests in diet induced obese (DIO) mice. In particular,
chronic dosing in this animal model of metabolic disease can affect
glycemic control, insulin resistance, fasting glucose and insulin
levels, and comparison of fasting levels as well as glucose area
under the curve (AUC) during an OGTT before and after a period of
daily dosing provides a measure of compound efficacy.
[0999] Four groups of 10 male C57BL/6 mice are fed a high fat diet
ad libitum for 14 weeks to ensure that they develop elevated
fasting glucose levels (hyperglycemia), elevated fasting insulin
levels (hyperinsulinemia), and impaired glucose control (Xu. H. et
al. Chronic inflammation in fat plays a crucial role in the
development of obesity-related insulin resistance. J. Clin. Invest.
(2003) 112: 1821-1830). A single group of 10 male C57BL/6 mice
(group I) is fed a normal diet for comparison of treatment arms on
HFD to normal diet at the same age, handling, and housing
conditions. All mice are housed and acclimated for three days prior
to the start of the study.
[1000] All Mice are fasted overnight for fourteen hours before OGTT
treatment, and a blood sample is collected the morning of the study
prior to dosing for analysis of fasting glucose and hormone levels.
Fasted animals are treated with formulation of provided nutritive
polypeptides by oral gavage fifteen minutes before glucose
challenge. Glucose (2 g/kg) is orally administered at time zero.
Blood glucose is measured at seven time points (-15, 0, 15, 30, 60,
90, 120 minutes). Age-matched normal mice under regular diet are
used as an internal standard for the analytics. In groups 2-5, mice
receive daily dose of provided therapeutic nutritive polypeptides
(2.85 g/kg) (groups 4 and 5) or vehicle control (groups 2 and 3)
for 15-30 days via daily gavage or formulation into chow. All blood
is collected in an EDTA collection tube containing plasma
stabilizers (a DPP4 inhibitor and a protease cocktail inhibitor),
processed for plasma, and stored frozen at -80C.
[1001] An OGTT as described above is performed again on the final
day of the study with either vehicle (groups 2 and 4) or test
article (groups 1, 3, and 5). Prior to the final test article or
vehicle dose, a blood sample is collected for analysis of fasting
glucose and hormone levels. At the completion of the final OGTT,
all mice are sacrificed and entire blood volume is collected via
cardiac puncture. Analysis of insulin levels are performed using an
ELISA method described herein.
[1002] Comparisons of end of study OGTT glucose AUC across groups 2
and 4 describe the effect of chronic test article administration
without the acute effects of test article administration on the
OGTT. Comparisons of end of study OGTT glucose AUC across groups 3
and 5 describe the effect of chronic test article administration
and include the acute effects of test article administration on the
OGTT. Comparisons of fasting glucose and insulin levels at the
beginning and end of the study within group 4 or within group 5
describe the effect of chronic dosing on fasting glucose and
insulin levels.
Example 24
Use of Nutritive Polypeptides to Induce Insulin Secretion in
Rodents
[1003] Ingested amino acids have been shown to have the capacity to
induce insulin secretion (Gannon M. C, and F. Q. 2010. Nuttall.
Amino Acid Ingestion and Glucose Metabolism--A Review. IUBMB Life,
62(9): 660-668). Protein ingestion increases plasma insulin
significantly in comparison to ingestion of glucose alone (Nuttall,
et al. 1984. Effect of protein ingestion on the glucose and insulin
response to a standardized oral glucose load. Diabetes Care.
7(5):465-470). Ingested protein increases insulin secretion in part
via the action of incretin hormones, i.e., glucagon-like peptide-1
(GLP-1) and glucose-dependent insulinotropic peptide (GIP), which
are secreted by endocrine cells upon luminal exposure to nutrients
(Baggio LL & DJ Drucker. 2007. Biology of incretins: GLP-1 and
GIP. Gastroenterology. 132:2131-2157). Amino acids such as leucine
and arginine have also been shown to directly stimulate insulin
release (Newsholme P. et al. New insights into amino acid
metabolism, B-cell function and diabetes. Clin. Sci. (2005) 108:
185-194). In these studies, the insulin response after acute dosing
of various nutritive proteins was measured in rodents.
[1004] Animals were treated and acutely dosed with various test
articles as part of pharmacokinetic rodent experiments according to
methods described herein. Unless otherwise stated all dosing was at
2.85 g/kg body weight. All treatment groups except for SEQID-00240
which had n=5 rats, and SEQID-00587 which had n=3, contained n=4
rats.
[1005] Quantification of Plasma Insulin Using AlphaLISA.RTM.
Insulin Immunoassay
[1006] Plasma Samples were Thawed on Ice and Centrifuged for 10
Minutes at 1109.times.g to pellet insoluble material.
AlphaLISA.RTM. Insulin Immunoassay Kit (PerkinElmer, AL204C) was
removed from 4.degree. C. cold room and kept on ice during assay
set up. 1.times. Assay Buffer was prepared by diluting 10.times.
Assay Buffer with milliQ water.
[1007] Standard buffer for dilution of insulin was prepared at
25.9% fasted rat plasma in 1.times. Assay Buffer and used to
prepare a 16 point standard curve. Plasma samples were prepared by
diluting 7:20 in 1.times. Assay Buffer in a 96-well PCR
microplate.
[1008] Acceptor head mix was prepared by diluting Acceptor Beads
and Biotinylated Anti-Insulin Antibody 1/400 in 1.times. Assay
Buffer. Acceptor bead mix was pipetted, 20 .mu.L/well, into a white
opaque 384 well microplate (PerkinElmer, OptiPlate-384), to this
mixture was added 10 .mu.L/well of insulin standard in fasted rat
plasma or sample rat plasma in duplicate. The plate was sealed with
a foil plate seal and incubated on a horizontal shaker at
.about.600 rpm for 60 minutes at room temperature.
[1009] It was necessary to protect the Streptavidin Coated Donor
Beads from light; as such, in a darkened room, donor bead mix was
prepared by diluting the streptavidin coated donor beads 1/125 in
1.times. Assay Buffer. After the first incubation step, 20
.mu.L/well donor head mix was added to the standard and samples.
The assay plate was sealed and returned to the horizontal shaker at
.about.600 rpm, for 30 minutes at room temperature. Following the
donor bead incubation, luminescence was read on the EnSpire Alpha
plate reader.
[1010] Data were analyzed with Microsoft Excel version
14.0.7128.5000 (32-bit) and GraphPad Prism version 6.03. A standard
curve was generated to log(Insulin (IU)). Rat plasma insulin
concentrations were interpolated using a sigmoidal, four parameter
logistic equation. The mean of duplicate concentration of insulin
in the technical replicates for each rat were plotted against time.
Area under curve was integrated for 0-240 minutes and 0-60 minutes
using the Linear-Log Linear Method in Microsoft Excel.
[1011] Quantification of Plasma Insulin Using a Rat Insulin Enzyme
Linked Immunosorbent Assay (ELISA).
[1012] An Ultra-Sensitive Rat Insulin ELISA Kit was obtained from
Crystal Chem, Inc. (Catalog number 90060, Downers Grove, Ill.).
Plates were washed using a BioTek ELx50 microplate strip washer
(BioTek, Winooski, Vt.). Absorbance was read on a Synergy Mx
monochromator-based microplate reader (BioTek, Winooski, Vt.). Data
was analyzed using Microsoft Excel version 14.0.7128.5000
(Microsoft Corporation, Redmond, Wash.) and GraphPad Prism version
6.03 for Windows (GraphPad Software, La Jolla, Calif.).
[1013] The ELISA kit was pre-warmed to room temperature for 30
minutes prior to beginning the assay set up. The standard curve
dilutions were prepared in accordance with the manufacturer's
instructions for running the assay in Wide Range format.
[1014] Plasma matrix from the naive group and sample plasma were
thawed on ice and then centrifuged at approximately 1000.times.rcf
for 10 minutes at 4.degree. C. to pellet any insoluble
material.
[1015] Matrix Assay Buffer for running the insulin standard was
prepared using plasma matrix from the naive group to a
concentration of 5.26% in 95 .mu.L. 95 .mu.L of Assay Buffer was
added to all sample wells, and 95 .mu.L of Matrix Assay Buffer was
added to all standard wells. 5 .mu.L of each sample and standard
were added in duplicate. The plates were incubated at 4.degree. C.
for 2 hours. The plates were then washed five times with 300
.mu.L/well 1.times. Wash Buffer. The plates were tapped sharply
several times on paper towels to remove any residual wash
buffer.
[1016] Anti-Insulin Enzyme Conjugate Working Solution was prepared
by combining 2 volumes Anti-Insulin Enzyme Conjugate Stock with 1
volume Enyme Conjugate Diluent, and mixing by pipetting up and down
and gently vortexing. 100 .mu.L/well of Anti-Insulin Enzyme
Conjugate Working Solution was added to all wells. The plates were
sealed and incubated at room temperature for 30 minutes and then
washed seven times with 300 .mu.L/well 1.times. Wash Buffer. The
plates were tapped sharply several times on paper towels to remove
any residual wash buffer. 100 .mu.L/well Enzyme Substrate Solution
was then added to each well and incubated in the dark at room
temperature for 40 minutes. 100 .mu.L/well Stop Solution was added
to all wells. The absorbance was read on the Synergy Mx plate
reader at 450 nm and 630 nm. Final values obtained were the A450
nm-A630 nm values.
[1017] The insulin standard curve was corrected for matrix
concentration of insulin by subtracting the mean of the 0 ng/mL
insulin standard from each of the standard well
A.sub.450nm-A.sub.630nm values in Excel. Duplicate sample
concentrations were determined by non-linear regression using a 4
parameter logistic model of the background corrected standard
following an x=log(x) transformation of insulin concentration in
GraphPad Prism 6. ANOVA and multiple comparison tests were
conducted on GraphPad Prism 6. Area under curve was integrated for
0-240 minutes and 0-60 minutes using the Linear-Log Linear Method
in Microsoft Excel.
[1018] In Vivo Plasma Insulin Concentrations
[1019] FIGS. 19 and 20 show the combined biological replicate data
for a study of vehicle and SEQID-00105 administered at three
different doses and SEQID-00426, SEQID-00338, SEQID-00341
administered at one dose, where plasma insulin was measured using
the AlphaLISA Insulin kit. All error bars represent the standard
error of the mean. A one-way ANOVA with Dunnett's multiple
comparisons tests were used to compare within each treatment to
time 0 and between treatments at the same time point to
vehicle.
[1020] In FIG. 19, SEQID-00105 at 2.85 g/kg had a statistically
significant increase in plasma insulin concentration at 15, 30 and
60 minutes following gavage (P<0.0001, P<0.0001, and
P<0.05, respectively); SEQID-00105 at 1.78 g/kg had a
statistically significant increase in plasma insulin concentration
at 15 and 30 minutes following gavage (P=0.0005 and P<0.05,
respectively); at the lowest SEQID-00105 dose plasma insulin
concentration over the time course was not significantly different
from time 0. When compared to the plasma insulin concentration of
the vehicle control at each time point. SEQID-00105 at 2.85 g/kg
showed statistically significant greater plasma insulin than
vehicle at 15 minutes and 30 minutes following oral gavage
(P<0.000 and P<0.001, respectively), SEQID-00105 at 1.78 g/kg
showed a statistically significant increase in plasma insulin
concentration at 15 minutes following oral gavage (P=0.0005). In
FIG. 20, only SEQID-00338 had a statistically significant increase
in plasma insulin concentration from 0 at 15 and 30 minutes
following oral gavage (P=0.005 and P<0.05, respectively). When
compared to vehicle plasma insulin concentration at each
concentration SEQID-00338 was significantly greater than vehicle at
15 minutes following oral gavage (P<0.01).
[1021] FIGS. 21 and 22 show the integrated area under curves for
plasma insulin concentrations measured for vehicle of SEQID-00105,
SEQID-00426, SEQID-00338, SEQID-00341, error bars are the standard
error of the mean. One-way ANOVA with Dunnett's multiple
comparisons tests were used to compare the AUCs to vehicle.
SEQID-00105 at 2.85 g/kg had a statistically significantly greater
plasma insulin AUC than vehicle when integrated from 0-240 minutes
and 0-60 minutes (P=0.0005 and P<0.05, respectively).
[1022] FIGS. 23 and 24 show the combined biological replicate data
for a study of vehicle and SEQID-00423, SEQID-00587, SEQID-00105,
SEQID-00424, SEQID-00425, and SEQID-00429, where plasma insulin was
measured using the AlphaLISA Insulin kit. All error bars represent
the standard error of the mean. One-way ANOVA with Dunnett's
multiple comparisons tests were used to compare within each
treatment to time 0 and between treatments at the same time point
to vehicle.
[1023] FIGS. 25 and 26 shows the integrated area under curves for
plasma insulin concentrations shown in FIGS. 23 and 24. One-way
ANOVA with Dunnett's multiple comparisons tests were used to
compare the AUCs to vehicle. SEQID-00587 had a significantly
greater plasma insulin AUC when integrated at 0-240 minutes
(P<0.005).
[1024] FIG. 27 shows the combined biological replicate data for a
study of vehicle and SEQID-00105, SEQID-00240, and SEQID-00559,
where plasma insulin was measured using the Rat Insulin ELISA kit.
All error bars represent the standard error of the mean. One-way
ANOVA with Dunnett's multiple comparisons tests were used to
compare within each treatment to time 0, SEQID-00105, and
SEQID-00559 both had a statistically significant increase in plasma
insulin concentration at 15 minutes post gavage compared to time 0
(P<0.05, both). SEQID-00240 had statistically significant
increase in plasma insulin at 15 and 30 minutes post gavage
compared to time 0 (P<0.05 & P<0.01, respectively). The
vehicle had no statistically significant change in plasma insulin
concentration compared to time 0.
[1025] FIG. 28 shows the integrated area under curve from 0-240 and
0-60 minutes post gavage for each treatment, error bars are the
standard error of the mean. No treatment showed a significantly
greater AUC compared to vehicle at 0-60 or 0-240 minutes by a
Dunnett's multiple comparisons test.
Example 25
Nutritive Polypeptide Stimulation of Glucagon Like Peptide 2
Secretion in Healthy, Fasted Rats
[1026] Glucagon-like peptide-2 (GLP-2) is a thirty three amino acid
peptide produced by the post-translational cleavage of proglucagon.
GLP-2 is secreted by the intestinal enteroendocrine L-cells of
humans and rodents along with GLP-1 in response to exposure to
nutrients in the gut lumen. GLP-2 has been shown previously to
improve outcomes in the treatment of short bowel syndrome (Brinkman
A S, Murali S G, Hitt S, Solverson P M, Hoist J J, Ney DM. 2012.
Enteral nutrients potentiate glucagon-like peptide-2 action and
reduce dependence on parenteral nutrition in a rat model of human
intestinal failure. Am. J. Physiol. Gastrointest. Liver Physiol.
303(5):G610-G622) by supporting intestinal growth (Liu X, Murali S
G, Hoist J J, Ney DM. 2008. Enteral nutrients potentiate the
intestinotrophic action of glucagon-like peptide-2 in association
with increased insulin-like growth factor-I responses in rats. Am.
J. Physiol. Gastrointest. Liver Physiol. 295(6):R1794-R1802).
[1027] Animals were treated and acutely dosed with test articles as
part of pharmacokinetic rodent experiments according to methods
described herein. In this experiment, two test articles were
analyzed, vehicle and a nutritive formulation of SEQID-240, dosed
at 1.54 g/kg.
[1028] Total GLP-2 Enzyme-Linked Immunosorbent Assay (ELISA)
[1029] Total GLP-2 was measured with Millipore Total GLP-2 ELISA
Kit (Millipore, EZGLP2-37K). The ELISA kit was equilibrated to room
temperature for a minimum of 30 minutes prior to running the assay.
The kit GLP-2 Standard, Quality Control 1 and Quality Control 2
were reconstituted with 500 .mu.L MilliQ water, inverted 5 times
and incubated at room temperature for 5 minutes, then gently
vortexed to mix. The standard curve was prepared by diluting the
GLP-2 Standard serially 1:1 in kit Assay Buffer to generate an
eight point standard curve including 0 ng/mL GLP-2. Plasma samples
were thawed on ice and centrifuged for 10 minutes at approximately
1109.times.rcf to pellet insoluble material. Fasted plasma matrix
from untreated, fasted rat was prepared for running the standard
and quality controls in duplicate at 20% (2.times.).
[1030] 1.times. Wash Buffer was prepared in a clean 500 mL glass
bottle by combining 50 mL 10.times. Wash Buffer with 450 mL MilliQ
water. Strips were prepared by washing 3 times with 300 .mu.L
1.times. Wash Buffer applied with a 30-300 .mu.L 8-channel pipette.
Between washes the wash buffer was decanted into a waste receptacle
and the plate tapped sharply on a stack of paper towels to remove
remaining wash buffer.
[1031] Following the first wash. 90 .mu.L of Assay Buffer was added
to sample wells, and 50 .mu.L of 20% matrix in Assay Buffer was
added to all standard and quality control wells. 10 .mu.L of sample
was added to each sample well and 50 .mu.L of standard and quality
control were added to matrix containing wells. Samples, standards
and quality control wells were run in duplicate, except for 0 ng/mL
GLP-2 standard which was run in quadruplicate.
[1032] The plate was sealed with a plastic plate seal and incubated
at room temperature on a horizontal plate shaker at 450 rpm for 2
hours. Following the first incubation, the plate was washed three
times with 1.times. Wash Buffer, decanting into a waste receptacle
and tapping the inverted plate sharply on a stack of paper towels
to remove excess wash buffer after each wash.
[1033] 100 .mu.L of Detection Antibody was added to each well and
the plate was sealed with a plastic plate seal and incubated at
room temperature on a horizontal plate shaker at 450 rpm for 1
hour. Following the second incubation, the plate was washed three
times with 1.times. Wash Buffer, decanting into a waste receptacle
and tapping the inverted plate sharply on a stack of paper towels
to remove excess wash buffer after each wash.
[1034] 100 .mu.L Enzyme Solution was added to each well and the
plate was sealed with a plastic plate seal and incubated at room
temperature on a horizontal plate shaker at 450 rpm for 30 minutes.
Following the third incubation, the plate was washed three times
with 1.times. Wash Buffer, decanting into a waste receptacle and
tapping the inverted plate sharply on a stack of paper towels to
remove excess wash buffer after each wash.
[1035] 100 .mu.L Substrate was added to each well and the plate was
sealed with a plastic plate seal and an opaque foil seal and
incubated at room temperature on a horizontal plate shaker at 450
rpm for 20 minutes. Following substrate reaction, 100 .mu.L of Stop
Solution was added to each well and the plate gently shaken to
mix.
[1036] Absorbance was measured on a SynergyMX Plate Reader at 450
nm and 590 nm. Measured values were the difference between 450 nm
and 590 nm absorbance values.
[1037] Data were analyzed with GraphPad Prism 6.03. A standard
curve was generated to log(Total GLP-2 (ng/mL)) after subtracting
the 0 ng/mL background value. Rat plasma GLP-2 concentrations were
interpolated using a sigmoidal, four parameter logistic equation.
The mean of duplicate concentration of GLP-2 in the technical
replicates for each rat were plotted against time. The integrated
area under curve was calculated on Microsoft Excel where the area
between each time point was calculated for each biological
replicate as the sum of the areas using the Linear-Log Trapezoidal
Method.
[1038] FIG. 29 shows the calculated total GLP-2 concentration over
a 4 hour time course for SEQID-00240 and vehicle control. Vehicle
GLP-2 concentration did not change significantly at any of the time
points sampled compared to time 0, whereas SEQID-00240 showed a
statistically significant increase in GLP-2 concentration relative
to time 0 at 15 (P<0.00), 30 (P<0.0001) and 60 minutes
(P<0.01) following SEQID-00240 gavage (Dunnett's multiple
comparison test). SEQID-00240 was compared to vehicle at each time
point by ordinary One-Way ANOVA with a Dunnett's multiple
comparisons test post hoc analysis. GLP-2 concentration was not
significantly different between treatments at time 0. GLP-2
concentrations were statistically significantly greater than
vehicle at 15 (P<0.001), 30 (P<0.0001), 60 (P<0.0001) and
120 minutes (P<0.05) following treatment. These data show that
an acute dose of SEQID-00240 but not vehicle induces secretion of
GLP-2 in healthy fasted rodents.
[1039] FIG. 30 shows the integrated GLP-2 area under the curve over
the first hour and the full 4 hours. The area under curve for GLP-2
was significantly greater in the SEQID-00240 treatment compared to
vehicle when integrated over 0-60 minutes and over 0-240 minutes
(P<0.005 & P<0.01, respectively, unpaired 2-tailed
Student's t-test). This data indicated that acute dosing of
SEQID-00240 significantly stimulated GLP-2 secretion in comparison
to vehicle within the first hour of acute dosing in healthy fasted
rodents.
Example 26
Effect of Orally Delivered Nutritive Polypeptides on Plasma Insulin
and Incretin Levels in Humans
[1040] The insulin and incretin response to protein ingestion is
predicated on the delivery of amino acids. The purpose of this
study was to examine the changes in plasma insulin concentrations
in response to SEQID-00426 and SEQID-00105 over a period of 240
minutes. Two groups of four apparently healthy subjects between the
ages of 18 and 50 received 20 grams of the nutritive polypeptide
formulations orally. All subjects were fasted overnight (>8 hrs)
before starting the study. Venous blood samples were collected at
specified time points (i.e. 0, 15, 30, 60, 90, 120, 150, 180, 210
and 240 minutes) following the oral ingestion of nutritive
polypeptide to assess changes in plasma insulin and incretin
concentrations. FIG. 31 shows the average insulin response of all
subjects to SEQID-00105, and FIG. 32 shows the average fold
response over baseline (time 0 min), measured as described herein.
The error bars on all figures correspond to the standard error of
the mean. The first phase insulin response occurs between time 0
min and 90 min. The second phase insulin response occurs between 90
min and 210 min. A 1-way ANOVA comparison across time indicates
that there is a significant change in plasma insulin over time
(p=0.003). A Dunnett multicomparison test indicates that the
insulin values at 15 and 30 min time points are significantly
different from that at time 0 min (p<0.05).
[1041] FIG. 33 shows the average insulin response of all patients
to SEQID-00426, and FIG. 34 shows the average fold response over
baseline (time 0 min), measured as described herein. The error bars
on all figures correspond to the standard error of the mean.
[1042] FIG. 35 shows the average total Gastric Inhibitory
Polypeptide (GIP) response of all patients to SEQID-00426, and FIG.
36 shows the average fold response over baseline (time 0 min),
measured as described herein. The error bars on all figures
correspond to the standard error of the mean.
Example 27
In Vitro Demonstration of Skeletal Muscle Cell Growth and Signaling
Using Nutritive Polypeptide Amino Acid Compositions Containing
Tyrosine, Arginine, and/or Leucine
[1043] The mammalian target of rapamycin (mTOR) is a protein kinase
an a key regulator of cell growth, notably via protein synthesis,
mTOR acts as a master regulator of cellular metabolism that
nucleates two complexes, mTORC1 and mTORC2 that have different
kinase specificity and distinct protein partners (citations from
ESS-020).
[1044] mTOR drives protein synthesis across tissues, mTORC1
mediated response to growth signaling is gated by amino acids. The
localization of the response to lysosomes couples mTOR activation
to muscle protein catabolism, mTORC1 can be gated by essential
amino acids (EAAs), leucine, and glutamine. Amino acids must be
present for any upstream signal, including growth factors, to
activate mTORC1 (citations from ESS-020).
[1045] These experiments demonstrated the capacity of arginine,
tyrosine as well as leucine to modulate mTORC1 activation by
measuring downstream phosphorylation of the ribosomal protein S6
(rps6) in response to stimulation by single amino acids in
vitro.
[1046] Primary Rat Skeletal Muscle Cell (RSKMC) culture medium was
purchased from Cell Applications (Catalog number: R150-500, San
Diego, Calif.). Starvation medium DMEM/F12 was bought from Sigma
(Catalog number: D9785. St. Louis, Mo.). Customized starvation
medium Mod.4 was purchased from Life Technologies (Catalog number
12500062. Grand Island, N.Y.), which does not contain any amino
acids, phenol red, or glucose. Fetal bovine serum (FBS) and other
growth factors were obtained from Cell Applications (Catalog
number: R151-GS, San Diego, Calif.). Tissue culture flasks and
clear bottom 96-well tissue culture plates were purchased from
Corning Incorporated (Catalog number: 430641 and 353072,
respectively, Corning, N.Y.). Trypsin/EDTA was obtained from Life
Technology (Catalog number: 25200, Grand Island, N.Y.). DPBS and
HBSS were also purchased from Life Technologies (Catalog number:
14190, 14175, respectively). AlphaScreen.RTM. SureFire.RTM.
Ribosomal Protein S6 Assay Kits was obtained from Perkin Elmer
(Catalog number: TGRS6P2S10K).
[1047] Primary Rat Skeletal Muscle Cell (RSKMC) culture. RSKMC were
isolated using protocol described herein and cryopreserved in
liquid nitrogen. The cells were also maintained in RSKMC medium
(Cell Applications) in T75 tissue flask in a 37.degree. C., 5% CO2
tissue culture incubator (Model 3110, Thermo Fisher Scientific).
The cells were split every three day when they reached .about.90%
confluency. RSKMC cells were cultured in RSKMC medium in T75 tissue
flask to 100% confluency. The culture medium was aspirated from the
culture flask and rinsed once with 10 ml of DPBS, and then 1.5 ml
of 0.25% trypsin/EDTA was added to the cells. After the cells were
detached from the flask, 10 ml of culture medium were added. The
medium was pipetted up and down with a 10 ml pipet to detach the
cells from the flask. The cells were then seeded into clear bottom
96-well tissue culture plates at a density of 50,000 cells per
well. Following overnight culture in a 37.degree. C., 5% CO2
incubator, the cells were starved over a period of 4 hours with
starvation DME/F12 medium without FBS and leucine in a 37.degree.
C., 5% CO2 tissue culture incubator, then starved for another hour
incubation with Hank's Buffered Salt Solution (HBSS). The cells
were stimulated with different concentrations of leucine in
starvation medium for 15 and 30 minutes. The cells were also
treated with 5 nM of Rapamycin (R0395, Sigma) or 100 nM of Insulin
(19278, Sigma) for 15 and 30 minutes. The cells were lysed in 20
.mu.L of Lysis Buffer (Perkin Elmer) for 10 minutes at room
temperature with shaking at 725 rpm. The cell lysates were stored
at -80.degree. C. and AlphaScreen.RTM. assay was performed the next
day. AlphaScreen.RTM. SureFire.RTM. Ribosomal Protein S6 Assay was
performed according to manufacturer's manual.
[1048] FIG. 37 shows the relative alphascreen signal (y-axis)
measured at different Leucine concentrations, demonstrating that
leucine stimulates phorphorylation of rps6 in primary RSkMC in a
dose-dependent manner. This stimulation was inhibited in a dose
dependent manner by the mTOR inhibitor, rapamycin.
[1049] FIG. 38 shows that leucine stimulates phosphorylation of
rps6 in primary RSkMC in a dose-dependent manner in both a complete
amino acid medium (Arg, His, Lys, Asp, Glu, Ser, Thr, Asn, Gin,
Cys, Gly, Pro, Ala Val, Ile, Met, Phe, Tyr, Trp), as well as a
minimal 12 amino acid mixture containing only (Arg, His, Lys, Thr.
Gin, Cys, Val, Ile, Met, Phe, Tyr, and Trp) at their DME/F12
concentrations (see table E27B).
[1050] Primary skeletal muscle cells obtained from the Soleus
(Sol), gastroenemius (GS) and extensor digitorum longus (EDL) of
two Sprague-Dawley rats. FIGS. 39, 40, and 41 shows that leucine
stimulates mTOR RPS6 pathway using isolated primary cells in a dose
dependent manner.
[1051] Arginine, tyrosine and leucine are required to fully
stimulate the mTOR pathway. Cells were starved as described above
in Mod.4 medium without fetal bovine serum and then stimulated in
Mod.4 medium lacking each of the respective single amino acids (see
table E27A and E27B for composition of Mod.4 medium and DME/F12
amino acid levels, respectively).
TABLE-US-00105 TABLE E27A Vitamins .mu.M Other mM Inorganic Salts
mM Choline chloride 64.1 D-Glucose 17.5 Calcium chloride, 1.05
(Dextrose) anhydrous D-Calcium 4.7 Sodium Pyruvate 0.5 Copper (II)
Sulfate 5.21E-06 pantothenate Pentahydrate Folic Acid 6.01 HEPES 15
Magnesium Sulfate 0.407 (anhyd.) Niacinamide 16.56 Hypoxanthine
0.018 Magnesium Chloride 0.301 Pyrodoxine 9.88 Linoleic Acid
1.50E-04 Potassium Chloride 4.157 hydrochloride Riboflavin 0.58
Putrescine 5.03E-04 Sodium Bicarbonate 0.014 Hydrochloride Thiamine
6.44 Thioctic Acid 5.10E-04 Sodium Chloride 120.6 hydrochloride
i-inositol 70 Thymidine 1.51E-03 Sodium Phosphate 0.521 Monobasic
D-biotin 1.43E-02 Phenol Red 5.00 .times. 10{circumflex over (
)}.sup.-4 Sodium Phosphate 0.5 (%) Dibasic Vitamin B-12 0.5 Iron
(III) Nitrate 1.24E-04 Nonahydrate Iron (II) Sulfate 1.50E-03
Heptahydrate Zinc Sulfate 1.50E-03 heptahydrate
TABLE-US-00106 TABLE E27B Amino Acids .mu.M Amino Acids .mu.M
Glycine 250 L-Leucine 451 L-Alanine 50 L-Lysine 500 L-Arginine 700
L-Methionine 116 L-Asparagine 57 L-Phenylalanine 215 L-Aspartic
Acid 50 L-Proline 150 L-Cysteine 100 L-Serine 250 L-Glutamic Acid
100 L-Threonine 449 L-Glutamine 2500 L-Tryptophan 44 L-Histidine
150 L-Tyrosine 214 L-Isoleucine 416 L-Valine 452
[1052] Primary muscle cells were starved for 2 hours, and then
stimulated with 0 .mu.M or 500 .mu.M single amino acid in 37 C, 5%
CO2 tissue culture incubator for 30 minutes. The treatment was
performed in triplicate. FIG. 42 demonstrates that the combination
of leucine, arginine, and tyrosine are necessary and sufficient to
activate the mTOR pathway in RMSKC to the same degree as a full
complement of all 20 amino acids at their DME/F12 concentrations,
and that none of the individual or paired treatments of Leu, Arg,
or Tyr were capable of a similar response.
[1053] FIGS. 43, 44, and 45 show the effect of a dose response of
each amino acid (Leu, Arg, Tyr) in the background of all other 19
amino acids vs the other 2 amino acids (e.g. dose response of Arg
in a background of Tyr and Leu) on rps6 phosphorylation. These data
indicate the synergy between Leu, Arg, and Tyr is dose dependent.
Comparing the 20 amino acids response at low doses of Arg to that
in a comparable high Leu and Tyr background, there is a reduction
in the degree of stimulation caused by the other 17 amino acids. At
high doses of Arg, the response in both backgrounds equalizes.
Comparing the 20 amino acids response at low doses of Leu to that
in a comparable high Arg and Tyr background, there is no difference
in rps6 phosphorylation response. Comparing the 20 amino acid
response at low doses of Tyr to that in a comparable high Leu and
Arg background, the other 17 amino acids can further potentiate the
mTOR response.
Example 28
Determination of Safety and Lack of Toxicity of Leucine-Enriched
Nutritive Polypeptides Following Oral Consumption by Rodents
[1054] An acute toxicology study was completed to confirm the
expected safety of nutritive polypeptides SEQID-00105, SEQID-00363,
and SEQID-00426 in rodents.
[1055] Each study group contained 5 male rats and 5 female rats (10
Wistar, 6-7 weeks old, Males 220-250 g, Females 180-200 g). Test
formulations were 350 g/L nutritive polypeptide and aqueous buffer
as a control. Animals were acclimated for 1 week upon arrival and
given a diet of regular chow always available. Before dosing,
animals were weighed and pre-bleeds were taken. Single dosage of 10
ml/kg was completed via oral gavage. On days 2, 6 and 7, body and
food weights were taken. On day 6 animals were bled in EDTA and
Sodium Heparin tubes. On day 7 weights were taken and animals were
euthanized followed by immediate necropsies. Eight organs (heart,
liver, lung, spleen, kidney, brain, bladder, and small intestine)
were removed, weighed and stored in 10% formaldehyde. During the
study clinical observations for signs of stress, pain, and abnormal
activity were performed daily.
[1056] For all three tested nutritive polypeptides the protein and
buffer were well tolerated as no abnormalities were seen in the
animals. All activity from the animals was normal and no other
signs of pain or distress were observed.
Example 29
Analytical Demonstration of Nutritive Polypeptide Digestibility
[1057] The digestion of nutritive polypeptides was analyzed via in
vitro simulated digestion assays. In vitro digestion systems are
used to simulate the breakdown of polypeptides into bioaccessible
peptides and amino acids, as occurs in vivo while passing through
the stomach and intestine (Kopf-Bolanz, K. A. et al., The Journal
of nutrition 2012; 142: 245-250, Hur, S. J. et al., Food Chemistry
2011; 125: 1-12). Simulated gastrointestinal digestion is also
predictive of potential protein allergenicity, since
digestion-resistant polypeptides may be absorbed and cause
sensitization (Astwood et al., Nature Biotechnology 1996; 14:
1269-1273).
[1058] Nutritive Polypeptide Half-Life During Simulated
Digestion.
[1059] One metric for quantifying the breakdown of polypeptides
from an intact form to smaller peptides is the intact half-life. In
this experiment the nutritive polypeptide was exposed to a series
of proteases that are active in the stomach (pepsin) and intestine
(trypsin and chymotrypsin), and the presence of intact protein was
measured over time. Specifically, the nutritive polypeptide was
first treated at a concentration of 2 g/L with simulated gastric
fluid (SGF) (0.03 M NaCl, titrated with HCl to pH 1.5 with a final
pepsin:polypeptide ratio of 1:20 w/w) at 37.degree.. Time points
were sampled from the reaction and quenched by addition of 0.2 M
Na2CO3. After 120 min in SGF, the remaining reaction was mixed
50:50 with simulated intestinal fluid (SIF) (18.4 mM CaCl2, 50 mM
MES pH 6.5 with a final trypsin:chymotrypsin:substrate ratio of
1:4:400 w/w) and neutralized with NaOH to pH 6.5. Time points were
sampled from the reaction and quenched by addition of
Trypsin/Chymotrypsin Inhibitor (Sigma) solution until 240 min.
[1060] Time point samples were analyzed for intact protein by chip
electrophoresis, polyacrylamide gel electrophoresis, or western
blot. For chip electrophoresis (Labchip (GX II), samples were
analyzed using a HT Low MW Protein Express LabChip.RTM. Kit
(following the manufacturer's protocol). A protein ladder was
loaded every 12 samples for molecular weight determination (kDa)
and quantification. For polyacrylamide gel electrophoresis, samples
(1 .mu.g) were separated on a NuPAGE.RTM. Novex.RTM. Bis-Tris
Precast gel (Life Technologies) according to the manufacturer's
protocol. The gel was stained using SimplyBlue.TM. SafeStain
(Invitrogen) and imaged using a Chemidoc XRS+(BioRad) or
transferred onto nitrocellulose membranes using the iBlot.RTM. Dry
Blotting System (Life Technologies) and iBlot.RTM. Western
Detection Kit (Life Technologies) according to the manufacturer's
protocol. Proteins were detected by blotting with Anti-His
[C-term]-HRP antibody diluted 3:5000 in Blok.TM.-PO Blocking Buffer
using the SNAP I.d..RTM. Protein Detection System (Millipore)
according to the manufacturer's protocol. Blots were treated with
Luminata Classico Western HRP Substrate (Millipore) according to
the manufacturer's protocol and imaged using chemiluminescent
detection on the Molecular Imager.RTM. Gel Doc.TM. XR+ System
(Bio-Rad). Quantification of intact protein was determined by
densitometry using ImageLab (BioRad). For all analysis methods the
relative concentration of the polypeptide at each time point (if
detected) was plotted overtime and fit to an exponential curve to
calculate the intact half-life.
[1061] Alternatively, samples were analyzed by determining the
percentage of intact protein remaining at a single time point (eg,
half-life less than 2 min). Specifically, the t=0 (enzyme-free
control) and t=2 min samples from the SGF digest were analyzed for
intact protein as described by chip electrophoresis, SDS-PAGE,
western blot, and/or LC-MS/MS. Relative quantities of polypeptides
at each time point were determined and the percentage of intact
protein remaining at t=2 was determined. Intact half-life values
determined using this method are reported as greater or less than 2
min to indicate more or less than 50% of the protein remained
intact at t=2 min, respectively. Results for intact SGF half-life
determined by either method are reported in Table E29A.
TABLE-US-00107 TABLE E29A Intact half-lives calculated from in
vitro intact protein detection during SGF treatment. SGF Half-life
(t1/2) in min SEQID-00001 5 SEQID-00001 (HEK293) 8.6 SEQID-00008
0.9 SEQID-00009 3 SEQID-00076 0.3 SEQID-00085 0.9 SEQID-00087 0.3
SEQID-00098 0.4 SEQID-00099 1 SEQID-00100 2 SEQID-00102 0.6
SEQID-00103 0.3 SEQID-00103 (HEK293) <2 SEQID-00104 0.3
SEQID-00105 0.2 SEQID-00105 (BS) 0.5 SEQID-00105 (HEK293) <2
SEQID-00143 0.3 SEQID-00212 0.3 SEQID-00215 2 SEQID-00218 6
SEQID-00220 0.5 SEQID-00226 0.7 SEQID-00236 10 SEQID-00237 0.6
SEQID-00240 0.7 SEQID-00241 0.3 SEQID-00265 29 SEQID-00269 41
SEQID-00284 1 SEQID-00287 3 SEQID-00298 (AN) 0.3 SEQID-00298 (BS)
0.1 SEQID-00302 0.2 SEQID-00305 0.2 SEQID-00338 0.2 SEQID-00338
(BS) 0.2 SEQID-00341 0.2 SEQID-00343 0.3 SEQID-00345 0.8
SEQID-00346 0.2 SEQID-00352 0.2 SEQID-00354 0.2 SEQID-00356 0.2
SEQID-00357 0.2 SEQID-00359 0.2 SEQID-00363 20 SEQID-00363 (E.
coli) <10 SEQID-00407 (BS) 0.2 SEQID-00417 0.2 SEQID-00418 0.2
SEQID-00418 (E. coli) 0.5 SEQID-00420 1.2 SEQID-00423 (BA) 0.3
SEQID-00423 (BA) 3 SEQID-00424 (AO) 0.2 SEQID-00424 (AO) 0.6
SEQID-00425 (KL) 0.3 SEQID-00426 (TL) 0.3 SEQID-00429 (BL) 5
SEQID-00485 0.5 SEQID-00502 0.6 SEQID-00510 0.3 SEQID-00511 0.3
SEQID-00546 <10 SEQID-00559 0.5 SEQID-00587 2.4 SEQID-00598 0.5
SEQID-00601 0.2 SEQID-00605 0.2 SEQID-00606 0.3 SEQID-00610 0.4
SEQID-00622 6.6 SEQID-00647 0.2 SEQID-00672 (BS) 0.3 SEQID-00678
(BS) 0.2 SEQID-00690 (BS) 4.4 All proteins were produced in E.
coli, unless otherwise noted. AN = Aspergillus niger, AO =
Aspergillus oryzae, BS = Bacillus subtilis, BA = Bacillus
amyloliquefaciens, KL = Kluyveromyces lactis, TL = Thermomyces
lanuginosus, BL = Bacillus lichenifomis. Alpha-mannosidase- treated
SEQID-00363 and protein proteins originating from AO, BA, KL, TL,
and BL were produced as described herein.
[1062] Nutritive Polypeptide Release of Amino Acids During
Simulated Digestion.
[1063] An additional method of quantifying polypeptide digestion is
to measure the amount of free amino acids present after exposure to
a simulated digestive system. In this method, pancreatin, a mixture
of enzymes, is used to simulate intestinal proteases. Specifically,
the digestion of polypeptides into amino acids was analyzed by an
in vitro Pancreatin-based digestion assay followed by free amino
acid analysis using reversed phase HPLC (RP-HPLC). The nutritive
polypeptide was added to SGF (0.92 g/L Pepsin (Sigma), 0.03 M NaCl
titrated with HCl to pH 1.5) at a final concentration of 4 g/L and
incubated at 37.degree. C. for 120 min. After 120 min. Na2CO3 was
added to a final concentration of 16 mM to quench the pepsin
reaction. The resulting reaction was mixed 50:50 with 2.times.
concentrated SIF (0.78 mg/ml Porcine Pancreatin (Sigma), 18.4 mM
CaCl2, 50 mM MES pH 6.5) and incubated for 240 min. Time points
were sampled from the reaction and quenched by heating to
95.degree. C. for 5 min. Control samples were protease-free.
[1064] Time points were analyzed for free amino acids using RP-HPLC
amino acid analysis as described in Henderson, J. W., et al.
Agilent Technologies (2010). Analyses were performed using an
Agilent 1100 series system. Primary amino acids were derivatized
pre-column at room temperature, online, using o-phthalaldehyde
(OPA). The OPA-derivatives were separated using the Zorbax
Eclipse-AAA 4.6.times.150 mm, 3.5 .mu.m column at 40.degree. C. The
separation gradient transitioned from 100% 40 mM Na2HPO4 pH 7.8 to
65% acetonitrile/methanol/water mixture (45/45/10) over 23 minutes.
Analytes were detected by fluorescence at 340 nm Ex/450 nm Em. FIG.
46 demonstrates a representative time-course of free Leu
concentration during a Pancreatin digest of SEQID-00105. Free Leu
concentrations for samples at the 120 min time point of the
Pancreatin digest are summarized in Table E29B.
TABLE-US-00108 TABLE E29B Free Leu detected at 120 min time point
of Pancreatin digest of nutritive polypeptides. Free Leu (.mu.M) at
120 min time point of Pancreatin digest SEQID-00076 824.3
SEQID-00103 793.8 SEQID-00105 1357.6 SEQID-00298 (BS) 1030.8
SEQID-00338 1181.7 SEQID-00341 1143.5 SEQID-00352 906.1 SEQID-00363
511 SEQID-00363 561.5 SEQID-00423 587.1 SEQID-00424 758.7
SEQID-00425 713.1 SEQID-00426 952.3 SEQID-00426 955.2 SEQID-00429
580.7 SEQID-00485 764.9 SEQID-00605 937.1
[1065] Nutritive polypeptide release of peptides during simulated
digestion. Samples from the simulated Pancreatin-based in vitro
digestion described herein were analyzed for peptides by LC-MSIMS.
To prepare the samples for LC-MS/MS analysis, the sample pH was
adjusted to pH 3 with trifluoroacetic acid (TFA) and peptides were
extracted using Hydrophilic-lipophilic Balance (HLB) solid phase
extraction cartridges (Waters). Cartridges were activated with 2 mL
of acetonitrile and equilibrated with 2 mL of 0.1% TFA. Samples
were loaded and cartridges washed with 2 mL 0.1% TFA and eluted
with 1 mL of 70% acetonitrile/0.1% TFA. The eluted peptides were
dried to completion and reconstituted in 50 .mu.L 0.1% TFA. The
eluted peptides (4 .mu.L) were loaded on-column and analyzed by
nano LC-MS/MS with a Waters NanoAcquity HPLC system interfaced to a
ThermoFisher Orbitrap Velos Pro. Peptides were loaded on a trapping
column and eluted over a 75 .mu.m analytical column at 350 nL/min;
both columns were packed with Jupiter Proteo resin (Phenomenex). A
1 h gradient was employed. The mass spectrometer was operated in
data-dependent mode, with MS performed in the Orbitrap mass
analyzer at 60,000 FWHM resolution and MS/MS performed in the LTQ
linear ion trap mass spectrometer. The fifteen most abundant ions
were selected for MS/MS. Data were searched against an appropriate
database using Mascot to identify peptides. Mascot DAT files were
parsed into the Scaffold software for validation, filtering and to
create a nonredundant list per sample. Data were filtered using a
minimum protein value of 95% and a minimum peptide value of
50%.
[1066] Unique peptides were detected at the 240 min time point of
the Pancreatin digest by LC-MS/MS after in vitro digestion of a
given SEQID. Unique peptides detected for the SEQID-00105 sample
were: LFDKDNNGSIS, FDKDNNGS, FDKDNNGSIS/FDKDNnGSIS, FDKDNNGSISS,
FDKDNNGSISSSEL, DKDNNGSI, DKDNNGSIS, SLGLSPSE, NEIDVDCIN, IDVDGNH,
IDVDCiNHQ, IDVDGNHQIE/IDVDGNHQIE, KVFDKNGDG, VFDKNGDGLIS, DKNGDGL,
KLTDAEV, LREVSDGSGEINIQQF, REVSDGSG, REVSDGSGE, REVSDGSGEI,
REVSDGSGiEIN/REVSDCISGEIN, REVSDIXSGEINIQ, REVSDGSGEINIQQF,
EVSDGSGEI, EVSDGSGEIN. Unique peptides detected for the SEQID-00426
sample were: YSFEDSGVGDVT, YSFEDSGVGDVTG, SFEDSGVGDVTG, FEDSGVGDV,
EDSGVGDVT, EDSGVGDVTG, EDSGVGDVTGF, DSGVGDVT, LRGnGYD, LRGnGYDIDV,
ITHTNDIVPR, HTNDIVPR, TNDIVPR, NDIVPR, YSHSSPE,
DIVKIEGIDATGGNNQPNIPDIPAHL, KIEGID, KIEGIDATGGNNQPNIPDIPA,
IEGIDATGGNNQPNIPDIPA, EGIDATGGNNQPNIPDIPA, GIDATGGNNQPNIPDIPA,
IDATGGNNQPNIPD, IDATGGNNQPNIPDIP, IDATGGNNQPNIPDIPA,
IDATGGNNQPnIPDIPA, IDATGGNNQPNIPDIPAH,
DATGGNNQPNIPDIPA/DATGGNNPAqPNIPDIPA, ATGGNNQPNIPD, ATGGNNQPNIPDIP,
ATGGNNQPNIPDIPA/ATGGNNqPNIPDIPA, ATGGNNQPNIPDIPAH, TGGNNQPNIPDIPA,
CGNNQPNIPDIP/GGNnQPNIPDIP,
GGNNQPNIPDIPA/GGnNQPNIPDIPA/GGnnQPNIPDIPA,
GNNQPNIPDIPA/GNNqPNIPDIPA, NNQPNIPDIPA, NQPNIPDIPA, PNIPDIPA.
[1067] Nutritive Polypeptide Intact Half-Life Determination in a
Complex Mixture.
[1068] The in vitro intact half-life of multiple polypeptides in a
complex mixture was determined using the simulated gastric in vitro
digestion described above. Briefly, the 168 nutritive polypeptide
library was generated as described herein by cloning, transforming,
and expressing a gene library encoding 168 proteins as a single
mixture. The recombinantly expressed proteins were purified from
host cell proteins by IMAC purification as described herein.
[1069] The 168 Protein Library was treated with SGF as described
above and the t=0 and t=10 min samples were analyzed for intact
protein by LC-MS/MS. To begin, 10 .mu.g of sample was loaded onto a
10% SDS-PAGE gel (Invitrogen) and run approximately 5 cm into the
gel. The gel was excised into ten fractions from 100 kD to the dye
front and the gel slices were processed by washing with 25 mM
ammonium bicarbonate, followed by acetonitrile. Gel fractions were
then reduced with 10 mM dithiothreitol at 60.degree. C., followed
by alkylation with 50 mM iodoacetamide at room temperature.
Finally, the samples were digested with trypsin (Promega) at
37.degree. C. for 4 h and the digestions were quenched with the
addition of formic acid. The samples were then analyzed by nano
LC/MS/MS using an EasynLC 1000 HPLC system interfaced to a
ThermoFisher Q Exactive. Peptides were loaded on a trapping column
and eluted over a 75 .mu.m analytical column at 350 nL/min; both
columns were packed with PepMap C18 3 .mu.m resin (ThemoFisher). A
1 hour gradient was employed. The mass spectrometer was operated in
data-dependent mode, with MS and MS/MS performed in the Orbitrap at
70,000 FWHM resolution and 17,500 FWHM resolution, respectively.
The fifteen most abundant ions were selected for MS/MS. Data were
searched against an appropriate database using Mascot to identify
peptides. Mascot DAT files were parsed into the Scaffold software
for validation, filtering and to create a nonredundant list per
sample. Data were filtered at 1% protein and peptide false
discovery rate (FDR) and requiring at least two unique peptides per
protein. A full list of detected proteins and their spectral counts
(SpC) was generated and reported as a function of each collected
gel fraction. SpC are a count of the number of spectra identified
for a given protein and are used as a measure of relative protein
abundance (Liu, H. et al., Analytical Chemistry 2004, 76:
4193-4201). To calculate the percentage of intact protein remaining
at the 10 min time point of the SGF digest the number of SpC
representative of intact peptide in the t=10 min sample were
divided by the number of SpC representative of intact peptide in
the t=0 min sample. The number of SpC representative of intact
peptide was defined as the sum of the SpC in the fraction with the
highest number of SpC assigned to that protein in the t=0 min
sample and the two flanking fractions. Results for % Intact Protein
at 10 min are shown in Table E20C. Intact half-life values for
purified proteins, determined by chip electrophoresis, and
percentage of intact peptide remaining at 10 min for proteins
detected in the 168 SEQID Library, determined by LC-MS/MS analysis,
are compared for fourteen polypeptides in Table E20D. The linear
relationship between percentage protein remaining intact at t=10
min and half-life value was analyzed and the R2 value determined to
be 0.72.
TABLE-US-00109 TABLE E20C Percent intact protein remaining at 10
min time point of 168 nutritive polypeptide library SGF digest. %
intact Protein at Protein 10 min SEQID-00338 3.9 SEQID-00484 0
SEQID-00485 0 SEQID-00489 0 SEQID-00495 0 SEQID-00496 0 SEQID-00497
20.3 SEQID-00502 9.7 SEQID-00507 0 SEQID-00509 36.4 SEQID-00510
13.4 SEQID-00511 4.3 SEQID-00515 17 SEQID-00518 0 SEQID-00520 0
SEQID-00521 11.5 SEQID-00524 0 SEQID-00525 13.7 SEQID-00528 11.8
SEQID-00529 0 SEQID-00532 0 SEQID-00533 19 SEQID-00534 0
SEQID-00536 11.8 SEQID-00540 0 SEQID-00541 0 SEQID-00544 0
SEQID-00545 0 SEQID-00546 0 SEQID-00552 79 SEQID-00555 6.8
SEQID-00559 3.1 SEQID-00562 0 SEQID-00564 89.6 SEQID-00570 91.4
SEQID-00573 66.7 SEQID-00574 0 SEQID-00577 30.8 SEQID-00581 33.3
SEQID-00582 15.2 SEQID-00583 0 SEQID-00587 21.7 SEQID-00590 0
SEQID-00591 20 SEQID-00592 24.3 SEQID-00598 24.3 SEQID-00599 0
SEQID-00601 1.1 SEQID-00602 0 SEQID-00603 0 SEQID-00605 0
SEQID-00606 0 SEQID-00607 0 SEQID-00609 0 SEQID-00610 3.3
SEQID-00612 0 SEQID-00613 0 SEQID-00615 85.7 SEQID-00617 43.9
SEQID-00618 0 SEQID-00619 68.5 SEQID-00620 0 SEQID-00622 43.6
SEQID-00623 63.6 SEQID-00624 0 SEQID-00625 0 SEQID-00626 0
SEQID-00628 0 SEQID-00629 40 SEQID-00631 17.1 SEQID-00632 1.2
SEQID-00633 92.1 SEQID-00634 36.8 SEQID-00636 60 SEQID-00638 0
SEQID-00639 0 SEQID-00640 50 SEQID-00641 21.2 SEQID-00642 75
SEQID-00643 13.6 SEQID-00644 0 SEQID-00645 0 SEQID-00647 12
SEQID-00648 39.5
TABLE-US-00110 TABLE E20D Comparison of intact half-life values for
purified proteins, determined by chip electrophoresis, and
percentage of intact peptide remaining at 10 min for proteins
detected in the 168 nutritive polypeptide library, determined by
LC-MS/MS analysis. Half-life Protein (min) % Remaining at 10 min
SEQID-00338 0.2 3.9 SEQID-00601 0.2 1.1 SEQID-00605 0.2 0
SEQID-00647 0.2 12 SEQID-00510 0.3 13.4 SEQID-00511 0.3 4.3
SEQID-00606 0.3 0 SEQID-00610 0.4 3.3 SEQID-00559 0.5 3.1
SEQID-00485 0.5 0 SEQID-00598 0.5 24.3 SEQID-00502 0.6 9.7
SEQID-00587 2.4 21.7 SEQID-00622 6.6 43.6
Example 30
Viscosity of Nutritive Polypeptides
[1070] It has been demonstrated that the presence of strong
attractive self-associating interactions results in higher
viscosity solutions (Yadav, Sandeep, et al. Journal of
pharmaceutical sciences 99.12 (2010): 4812-4829.). Specifically,
electrostatic interactions of oppositely charged residues results
in high viscosity solutions (Liu, Jun, et al. Journal of
pharmaceutical sciences 94.9 (2005): 1928-1940.). A nutritive
polypeptide with low viscosity can be selected using net charge or
charge per amino acid calculations described herein, and selecting
proteins with highly positive or highly negative charges. Proteins
selected in this way would lack complementary electrostatic
interactions and would instead have an overall repulsive force that
limits the ability to self-associate thus reducing viscosity of the
solutions.
[1071] Solutions of a nutritive polypeptide (SEQID-00105) and whey
were measured for relative viscosity. Both proteins were
resuspended with water to the desired concentration for analysis.
Viscosity was measured using a Brookfield LVDV-II+ PRO Cone/Plate
with a CPE-40 spindle. All tests were performed at 4 C and 25 C.
Sample volume was 0.5 ml. Temperature was maintained with a
Brookfield TC-550AP-115 Programmable Temperature Bath. All samples
were equilibrated for a minimum of two minutes at 4 C and one
minute at 25 C. All readings were taken between 10% and 100%
torque. FIG. 47 shows viscosity measured in centipoise for
SEQID-00105 at 4 C (closed circles) and 25 C (open circles) and
whey at 4 C (closed squares) and 25 C (open squares).
[1072] SEQID-00105 has been shown herein to have a negative net
charge across a range of pH, and SEQID-00105 is presently shown at
multiple temperatures and polypeptide concentrations to be less
viscous than whey, which is a disperse mixture of proteins without
a dominant single charge.
[1073] To generate a solution with increased viscosity
transglutaminase can be used to create a network consisting of
enzyme-induced permanent covalent cross-links between nutritive
polypeptides thereby generating additionally viscous solutions.
This enzyme treatment can also be followed by thermal processing to
make a viscous solution containing a nutritive polypeptide. To
generate nutritive polypeptide samples containing crosslinks that
increase viscosity, a sample is mixed with a transglutaminase
solution at pH 7.0 to give an enzyme to protein weight ratio of
1:25. The enzyme-catalyzed cross-linking reaction is conducted at
40.degree. C. in most of the experiments.
Example 31
Analytical Demonstration of Nutritive Polypeptide Solubility and
Thermostability
[1074] Solubility. The solubility of proteins was evaluated by
determining the protein concentration of reconstituted lyophilized
powder, centrifugal filtered, and/or ultrafiltered solutions
(Carpenter et al. (2002) Rational Design of Stable Lyopholized
Protein Formulations: Theorty and Practice, Kluwer Academic/Plenum
publishers, New York, pp. 109-133; Millipore publication, Amicon
Ultra: Centrifugal Filter Devices for the Concentration and
Purification of Biological Samples (2001); Oss et al. (1969) A
membrane for the rapid concentration of dilute protein samples in
an ultrafilter. Clinical Chemistry, 15(8): 699-707). Protein
samples were dried by lyophilization on a FreeZone Freeze Dry
System (Labconco) using the manufacturer's standard protocol and
then resuspended in buffer to the desired concentration.
Centrifugal and tangential ultrafiltration were used to selectively
remove buffer from the protein sample until the desired
concentration was reached. Centrifugal ultrafiltration of protein
solutions was performed by centrifugation (10,000.times.g) of 10 mg
of protein in an Amicon centrifugal filter (Millipore) with a
molecular weight cutoff of 3 kDa, 10 kDa, or 30 kDa, depending on
the protein size, until the desired concentration was reached.
Ultrafiltration of protein solutions was performed on Hydrosart
ultrafiltration cassettes (Sartorius Stedim, Bohemia, N.Y.) with a
molecular weight cutoff of 3 kDa, 10 kDa, or 30 kDa, depending on
the protein size, at a cross flow rate of 12 L/m2/min. For most
processes, transmembrane pressure was maintained at 20 psi and
performed until the desired concentration was reached.
[1075] The protein concentration of the above samples was measured
by one or a combination of the following methods: Coomassie Plus
Protein Assay, absorbance at 280 nm (A280), and total amino acid
analysis. Coomassie Plus Protein Assays (Pierce) were performed
according to the manufacturer's protocol. Absorbance at 280 nm was
measured on a Nanodrop 2000 UV-Vis spectrophotometer. Protein
concentration was determined using the A280 value and molar
extinction coefficient, which was calculated by primary amino acid
sequence using ProtParam (Gasteiger, Elisabeth, et al. The
proteomics protocols handbook. Humana Press, 2005, 571-607.). Total
amino acids were analyzed by HPLC after acid hydrolysis as
described in Henderson, J. W., et al. Agilent Technologies
(2010).
TABLE-US-00111 TABLE E31A Solubility of proteins. Protein
Solubility (g/L) SEQID-00008 265 SEQID-00009 53 SEQID-00076 150
SEQID-00085 50 SEQID-00087 176 SEQID-00099 91 SEQID-00100 107
SEQID-00102 120 SEQID-00103 133 SEQID-00104 192 SEQID-00105 500
SEQID-00115 70 SEQID-00220 166 SEQID-00226 107 SEQID-00236 60
SEQID-00240 163 SEQID-00241 207 SEQID-00265 95 SEQID-00269 159
SEQID-00287 192 SEQID-00298 (BS) 209 SEQID-00302 158 SEQID-00305
231 SEQID-00338 254 SEQID-00341 166 SEQID-00345 196 SEQID-00346 161
SEQID-00352 223 SEQID-00354 235 SEQID-00357 211 SEQID-00363 (AN)
336 SEQID-00363 229 a-mannosidase treated SEQID-00423 (BA) 193
SEQID-00424 (AO) 205 SEQID-00425 (KL) 190 SEQID-00426 (TL) 138
SEQID-00429 (BL) 214 SEQID-00485 99 SEQID-00510 135 SEQID-00511 135
SEQID-00546 149 SEQID-00559 156 SEQID-00587 223 SEQID-00598 150
SEQID-00605 128 All proteins were produced in E. coli, unless
otherwise noted. AN = Aspergillus niger, AO = Aspergillus oryzae,
BS = Bacillus subtilis, BA = Bacillus amyloliquefaciens, KL =
Kluyveromyces lactis, TL = Thermomyces lanuginosus, BL = Bacillus
licheniformis. Alpha-mannosidase-treated SEQID-00363 and protein
and originating from AO, BA, KL, TL, and BL were produced as
described herein.
[1076] pH Solubility. The pH solubility of proteins was determined
in a buffer cocktail of Citric Acid and Dibasic Sodium Phosphate
over a pH range of 2.8 to 7.1, pH solutions were prepared as
outlined in Table E31B. Protein was either lyophilized and then
resuspended in buffer cocktail mixtures, or concentrated and then
spiked into buffer cocktail mixtures at a final protein
concentration of 5 to 30 mg/ml. As a control, protein was also
dissolved in a solution of 8 M urea. Protein solutions were shaken
for 10 min at room temperature. Turbidity of proteins was
determined by measuring the absorbance of protein solutions at 650
nm. The protein solution was then centrifuged for 10 min at
1100.times.g to pellet undissolved or precipitated protein. The
soluble protein fraction (supernatant) was sampled and protein
concentration was measured by one or more of the following methods:
Coomassie Plus Protein Assay (Pierce). Chip electrophoresis, gel
electrophoresis, and/or absorbance at 280 nm. The pH range over
which select proteins remained greater than 80% soluble as
determined by Bradford and the A650 value are listed in Table
E31C.
TABLE-US-00112 TABLE E31B Buffer composition for pH solubility
screen. Sodium mL of 42 mM Phosphate Citric Sodium mL of 42 mM
Buffer Dibasic Acid Phosphate Citric Add # pH (mM) (mM) (10 mL
total) (10 mL total) 1 7.1 38 4 9 1 2 6.5 34 8 8.1 1.9 3 6 32 10
7.6 2.4 4 5.6 30 12 7.1 2.9 5 5 28 14 6.7 3.3 6 4.6 26 16 6.2 3.8 7
4.3 24 18 5.7 4.3 8 3.9 22 20 5.2 4.8 9 3.7 20 22 4.8 5.2 10 2.8 10
32 2.4 7.6
TABLE-US-00113 TABLE E31C Solubility of proteins over a range of
pHs. pH Range where Protein is >80% detected as Soluble and A650
<1 OD Protein High Low Other SEQID-00009 9.1 3.7 SEQID-00076 7.1
4.6 SEQID-00085 7.1 7.1 SEQID-00100 7.1 4.3 SEQID-00103 7.1 5.6
SEQID-00104 7.1 5 SEQID-00105 9.1 4.3 SEQID-00226 9.1 2.6
SEQID-00240 9.1 6.6 3.0-2.6 SEQID-00241 9.1 4.3 SEQID-00265 9.1 5.1
3 SEQID-00269 9.1 7.2 3.0-2.6 SEQID-00287 9.1 6.2 2.6 SEQID-00338
7.1 2.8 SEQID-00485 7.1 4.6 2.8 SEQID-00502 7.1 2.8 SEQID-00510 7.1
6.5 2.8 SEQID-00511 7.1 5.6 SEQID-00587 7.1 2.8 SEQID-00605 7.1 5.6
SEQID-00622 7.1 2.8 N/A: not applicable.
[1077] Thermostability.
[1078] The thermostability of proteins in a buffer cocktail of
Citric Acid and Dibasic Sodium Phosphate over a pH range of 2.8 to
7.1 (preparation described above in Table E31B) was determined
using the ProteoStat.RTM. k Thermal Shift Stability Kit (Enzo Life
Sciences) according to the manufacturer's standard protocol.
Briefly, protein solutions (.about.10 mg/ml) containing 1.times.
ProteoStat.RTM. TS Detection Reagent were heated from 25.degree. C.
to 95.degree. C. at a rate of 0.5.degree. C. per 30 sec using a
real-time PCR (rtPCR) thermocycler (BioRad) equipped with a plate
reader (SynergyMx, Biotek) while monitoring the fluorescence with a
Texas Red filter. The temperature of aggregation (Tagg) was
identified as the temperature at which the steepest slope was
observed in the trace of fluorescence intensity as a function of
temperature. The temperature of aggregation at pH 7.1 for a subset
of proteins is listed in Table E31D. The temperature of aggregation
over a range of pHs for a subset of proteins is listed in Table
E31E.
TABLE-US-00114 TABLE E31D Temperature of aggregation (Tagg) at pH
7.1 Protein Tagg (pH 7.1) SEQID-00008 >95 SEQID-00009 56
SEQID-00087 >95 SEQID-00099 64 SEQID-00102 >95 SEQID-00220
>95 SEQID-00226 >95 SEQID-00237 45 SEQID-00240 >95
SEQID-00241 >95 SEQID-00265 >95 SEQID-00269 >95
SEQID-00302 46 SEQID-00305 48 SEQID-00510 57.5 SEQID-00606 95
SEQID-00610 54.5
TABLE-US-00115 TABLE E31E Temperature of aggregation (Tagg) as a
function of pH. T.sub.agg pH pH pH pH pH pH pH pH pH pH Protein 7.1
6.5 6.0 5.6 5.0 4.6 4.3 3.9 3.7 2.8 SEQID-00076 >95 95 95 .sup.
73.5 75 34.5 NS NS NS NS SEQID-00098 >95 NS NS NS NS NS NS NS NS
NS SEQID-00100 >95 95 95 95 95 84.sup. 83.sup. 95 95 95
SEQID-00103 >95 95 67.5 62 61 59.5 37.5 .sup. 41.5 .sup. 45.5 NS
SEQID-00104 >95 95 95 80 66 59.5 60.sup. .sup. 74.5 NS NS
SEQID-00105 >95 95 95 .sup. 70.5 75.5 61.5 36.5 NS NS NS
SEQID-00338 51.5 51 51.5 51 50.5 84.5 40.5 38 37 95 SEQID-00485 36
36.5 36 .sup. 34.5 31.5 NS NS NS NS NS SEQID-00502 95 78.5 76.5 77
77 95.sup. 95.sup. NT 95 95 SEQID-00511 42 45.5 39.5 NS NS NS NS NS
NS NS SEQID-00559 64.5 64 62 59 57 57.5 NS NS NS NS SEQID-00587 95
95 95 .sup. 69.5 67 63.sup. 58.5 54 .sup. 50.5 50 SEQID-00601 48.5
45.5 NS NS NS NS 95.sup. NT 95 95 SEQID-00605 39 38.5 44.5 37 33.5
40.5 NS NS NS NS SEQID-00622 95 47 46 .sup. 45.5 42.5 43.5 43.5 42
42 .sup. 58.5 NS = condition where protein was not soluble for
thermal stability assay.
[1079] Thermal Unfolding.
[1080] Thermal unfolding of proteins was monitored by circular
dichroism on an Applied Photophysics CS/2 Chirascan
spectrophotometer. Far-UV measurements (200-260 nm) of protein
solutions (0.5 to 1.0 mg/mL) in buffer (20 mM potassium phosphate,
pH 7.5) were recorded every 5.degree. C. from 20 to 90.degree. C.
using a 0.1 cm optical path length cell. After collection of the
spectrum at 90.degree. C. the protein sample was immediately cooled
to 20.degree. C. and a final spectrum was recorded. The melting
temperature (Tmelt) was calculated as the temperature with the
strongest slope, and the final spectrum was compared to the initial
20.degree. C. spectrum to determine if protein unfolding was
reversible or if a permanent change in structure had occurred. FIG.
48 displays a representative CD spectra of SEQID-00105,
demonstrating the nutritive polypeptide does not completely unfold
at even 90 C and returns to it's original fold when cooled to 20
C.
Example 32
Nutritive Polypeptide Glycosylation
[1081] The glycans present on proteins often affect properties such
as solubility, activity, and stability. Changing the pattern on
glycosylation of nutritive peptides can also affect their
bioavailability, nutritional quality, and product formulation
attributes. Furthermore, specific sugar patterns on nutritive food
peptides augment metabolic response to the ingestion of isolated
nutritive food peptides based both the kinetics of amino acid
absorption and the incorporation of exogenous glycans during human
protein production.
[1082] Host Selection for Glycosylation State.
[1083] As described herein nutritive polypeptides were produced in
a variety of hosts. Choice of host has an impact on the
glycosylation state of the nutritive polypeptide which has
biophysical, digestion, and immunogenic implications. For example,
hosts for expression include. E. coli, B. subtilis. B.
licheniformis, Aspergillus niger. Aspergillus nidulans, human
embryonic kidney (HEK), and chinese hamster ovary cells (CHO). E.
coli, B. subtilis and Bacillus licheniformis are used as an
expression host due to their ability to produce polypeptides with
unglycated (or minimally glycated) backbones compared to eukaryotic
hosts such as aspergillus, s, cerevisiae, and pichia. Aspergillus
niger is selected as a protein secretion host due to its unique
glycosylation machinery that drives the addition of mannose-rich
glycans to the polypeptide backbone. Aspergillus nidulans is
selected as a protein secretion host, due to the previously
demonstrated ability (Kainz et. al. N-Glycan modification in
aspergillus species. Appl. Environ. Microbiol., 2008) to engineer
the host glycosylation machinery towards reduced glycan structure
complexity in to place of extensive oligomannose polysaccharides.
Chinese hamster ovarian (CHO) cells are selected as an expression
host for their ability to glycosylate proteins in patterns similar
to human cells. Differences include the Gal .alpha.1-3 Gal epitope
and the N-glycolylneuraminic acid (Neu5gc) have both been found on
glycoproteins produced by CHO cells but are not found in normal
human glycans (Gahll, Un, et al Journal of Biological Chemistry
263.33 (1988): 17755-17762). Also, certain proteins produced in CHO
cells have more acidic isoforms suggesting higher content of sialic
acid. Human Embryonic Kidney 293 (HEK293) cells are selected as an
expression host for their ability to have human glycosylation of
proteins.
[1084] Gel Electrophoresis and Protein Transfer.
[1085] To analyze glycosylation, western blot analysis was
performed with antibodies or lectins that recognize specific glycan
antigens to evaluate and compare the glycosylation profile of
proteins produced in eukaryotes and prokaryotes. First, protein
separation was performed by gel electrophoresis using Novex.RTM.
NuPAGE.RTM. Bis-Tris Pre-cast gels (Life Technologies) according to
the manufacturer's protocol. Proteins were transferred from the gel
to a nitrocellulose membrane using the iBlot.RTM. Dry Blotting
System (Life Technologies) and iBlot.RTM. Western Detection Kit
(Life Technologies) according to the manufacturer's protocol.
Protein brands were visualized by staining polyacrylamide gels with
Coomassie.RTM. G-250 stain SimplyBlue.TM. SafeStain (Life
Technologies) according to the manufacturer's protocol and imaged
using the Molecular Imager.RTM. Gel Doc.TM. XR+ System
(Bio-Rad).
[1086] Glycosylation Profile of SEQID-00363 Expressed in E. coli
and A. niger.
[1087] The mannose content of proteins was examined using a
glycoprotein detection kit (DIG Glycan Differentiation Kit. Roche)
according to the manufacturer's standard protocol. To begin, whole
cell extract (5 .mu.g) and soluble cell lysate (5 .mu.g) from E.
coli transformed with an expression vector encoding the gene for
SEQID-00363 (as described herein), SEQID-00363 expressed in A.
niger (5 g), and the DIG Glycan Differentiation Kit positive
control carboxypeptidase Y (5 .mu.g) were loaded onto a Novex.RTM.
NuPAGE.RTM. 10% Bis-Tris gel (Life Technologies). Protein
separation and transfer were performed as described herein.
Briefly, nitrocellulose membranes were incubated with digoxifenin
(DIG)-labeled Galanthus nivalis agglutinin (GNA), a lectin that
binds terminal mannose. Membranes were then incubated with
anti-Digoxidenin-alkaline phosphatase (AP), followed by incubation
with an AP substrate solution (NBT/BCIP). The intensity of AP
staining was qualitatively visualized by the naked eye and
membranes were photographed. FIG. 49 displays a representative
Coomassie-stained gel (panel A) and a GNA probed western blot
membrane (panel B) of SEQID-00363 isolated from A. niger and
SEQID-00363 expressed recombinantly in E. coli. In lane 2, a
prominent band around 120 kD is representative of glycosylated
SEQID-00363. In lane 3, a band around 80 kD is representative of
non-glycosylated SEQID-00363. These results demonstrate that
SEQID-00363 expressed in A. niger (FIG. 49B, Lane 2) is a
terminally mannosylated protein (FIG. 49B. Lane 3), while
SEQID-00363 expressed in E. coli contains no terminal mannose
residues on its glycans.
[1088] Protein Extraction from Food for Glycan Analysis.
[1089] Flaxseed (Organic Brown Flaxseed, Farmers Direct Coop),
chickpea (Garbanzo Beans, 365 Everyday Value Organic), corn
(frozen, Super Sweet Bicolor Corn, 365 Everyday Value Organic),
potato (conventional yellow potato), mushroom (organic white
mushroom), broccoli (frozen, Broccoli Flortes, 365 Everyday Value),
tomato (conventional Roma tomato), blueberry (Organic Blueberries,
Little Buck Organics), grape (Organic Red Seedless Grapes,
Anthony's Organic), beef (85% Lean Ground Beef), chicken (Ground
Chicken Thighs, Boneless, Skinless, Airchilled), lamb (Ground New
Zealand Lamb), turkey (Ground Turkey Thighs), cod (Wild Cod
Fillet), and pork (Ground Pork) were purchased from Whole Foods.
Venison was provided. Aliquots of each food source (50-2,500 mg)
were frozen at -80. Proteins were extracted from the food source by
grinding the sample with a mortar and pestle before adding 1.0 mL
of extraction buffer (8.3 M urea, 2 M thiourea, 2% w/v CHAPS, 1%
w/v DTT) and additional grinding with the pestle. The samples were
transferred to microcentrifuge tubes and agitated for 30 min at
room temperature, followed by addition of 500 AL of 100-.mu.m
zirconium beads (Ops Diagnostics) and further agitation for an
additional 30 min. Samples were then lysed on a TissueLyser II
(Qiagen) at 30 Hz for 3 min. centrifuged for 10 min at
21,130.times.g, and supernatants were collected. Yeast (Nutritional
Yeast, Whole Foods), soy protein isolate (Soy Protein Powder. Whole
Foods), and rice protein isolate (Organic Rice Protein, Growing
Naturals) were prepared by solubilization in extraction buffer. The
total protein concentration of samples was determined by Coomassie
Plus Protein Assays (Pierce) according to the manufacturer's
standard protocol.
[1090] N-Glycolylneuramink Acid (Neu5Gc) Detection by Western Blot
Analysis.
[1091] N-glycolylneuraminic acid (Neu5Gc) is a sialic acid found on
most mammalian glycans, but is not present on human protein
glycoproteins. Human biochemical pathways don't recognize the
Neu5Gc sialic acid as foreign, leading to trace amounts found in
human glycoproteins following uptake into golgi and incorporation
onto newly synthesized proteins. Despite integrating biochemically,
however, the immune system recognizes as foreign the adjusted
surface conformation containing an externally-derived sialic acid,
increasing the risk of many diseases. Anti-Neu5Gc antibodies, which
have been detected in human plasma, cause chronic inflammation in
response to the ingestion of Neu5Gc containing protein sources
(Varki et. al. "Uniquely human evolution of sialic acid genetics
and biology", PNAS 2011). The main sources of Neu5Gc include lamb,
beef, pork, and even dairy products, with trace amounts also found
in fish (Tangvoranuntakul et al., 2003, PNAS, 100(21):
12045-12050).
[1092] Western blot analysis was performed with an anti-Neu5Gc
antibody to characterize the Neu5Gc content of proteins extracted
from food as well as proteins expressed recombinantly by bacterial
hosts. Proteins were extracted from meat sources as described
herein. Also, proteins were recombinantly expressed in E. coli
and/or B. subtilis by transformation with individual expression
vectors, as described herein, or by transformation with a library
of expression vectors, as described in herein. Proteins originating
from individual expression vectors, and in some cases protein
originating from a library of expression vectors, were purified by
IMAC purification, as described herein. A mixture (Protein Mixture
1) of purified proteins recombinantly expressed in E. coli was
prepared to contain each protein at a final concentration of
approximately 1 mg/mL. The proteins included in this mixture, as
well as the species in which they are naturally produced,
SEQID-00076 Cow, SEQID-00240 Cow, SEQID-00298 Cow, SEQID-00359
Sheep, and SEQID-00510 Turkey.
[1093] A sample of each meat extract (beef, pork, deer, lamb,
turkey, chicken, and cod), Protein Mixture 1., the 168 nutritive
polypeptide library expressed in E. coli (IMAC-purified lysate) and
B. subtilis (IMAC-purified lysate and unpurified supernatant and
lysate), and the cDNA Library expressed in E. coli (Rosetta, GamiB,
and Gami2 soluble lysate and Rosetta whole cell) and B. subtilis
(PH951 Grac lysate) were loaded onto a Novex.RTM. NuPAGE.RTM. 10%
Bis-Tris gel (Life Technologies). Protein separation and transfer
were performed as described herein. Neu5Gc was detected using the
SNAP I.d..RTM., Protein Detection System (Millipore) according to
the standard manufacturer's protocol with chicken anti-Neu5Gc (IgY)
primary antibody (BioLegend) and goat anti-chicken IgY-horseradish
peroxidase (HRP) secondary antibody, both diluted 3:5,000 in
Blok.TM.-PO Blocking Buffer. Blots were treated with Luminata
Classico Western HRP Substrate (Millipore) according to the
manufacturer's protocol and imaged using chemiluminescent detection
on the Molecular Imager.RTM., Gel Doc.TM. XR+ System (Bio-Rad).
FIG. 50 displays representative Coomassie-stained gels (panel A)
and anti-Neu5Gc probed western blot membranes (panel B). These
results demonstrate that while Neu5Gc is present in proteins
extracted from cow, pig, sheep, turkey, and chicken meat, it is not
present in proteins from these animals that have been recombinantly
expressed in E. coli or B. subtilis.
[1094] Xylose and Fucose Detection by Western Blot Analysis.
[1095] Xylose and fucose are sugars that are often present on plant
glycoproteins and can be immunogenic to humans (Bardor et al.,
2003, Glycobiology, 13(6): 427-434). The xylose and fucose content
of proteins extracted from food sources and proteins recombinantly
expressed by bacterial hosts was examined by western blot analysis
using anti-Xylose and anti-Fucose antibodies. As described herein,
protein samples were prepared either by extraction from food
sources or by reconstitution of purchased protein isolates.
Proteins were recombinantly expressed in E. coli and purified by
IMAC purification, as described in herein. A mixture (Protein
Mixture 2) of purified proteins recombinantly expressed in E. coli
was prepared to contain each protein at a final concentration of
approximately 1 mg/mL. The proteins included in this mixture, as
well as the species in which they are naturally produced, are
SEQID-00103 Rice. SEQID-00104 Corn, SEQID-00352 Corn, SEQID-00485
Chickpea, SEQID-00559 Rice, SEQID-00598 Flaxseed, and SEQID-00605
Mushroom.
[1096] A sample of each plant and fungi extract (yeast, flaxseed,
chickpea, corn, potato, mushroom, soy, rice, broccoli, tomato,
blueberry, and grape), Protein Mixture 2, horseradish peroxidase
(positive control), and fetuin (negative control) were loaded onto
a Novex.RTM. NuPAGE.RTM. 10% Bis-Tris gel (Life Technologies).
Protein separation and transfer were performed as described herein.
Western blot analysis was performed using the SNAP I.d..RTM.
Protein Detection System (Millipore) according to the standard
manufacturer's protocol. Xylose was detected by blotting with
rabbit anti-xylose primary antibody (Agrisera) and donkey
anti-rabbit IgG-HRP secondary antibody (abeam) diluted 3:5,000 and
3:2, 500 in Blok.TM.-PO Blocking Buffer, respectively. Fucose was
detected by blotting with rabbit anti-fucose primary antibody
(Agrisera) and donkey anti-rabbit IgG-HRP secondary antibody
(abcam) diluted 3:10,000 and 3:3,000 in Blok.TM.-PO Blocking
Buffer, respectively. Blots were treated with Luminata Classico
Western HRP Substrate (Millipore) according to the manufacturer's
protocol and imaged using chemiluminescent detection on the
Molecular Imager.RTM. Gel Doc.TM. XR+ System (Bio-Rad). FIG. 51
demonstrates a representative Coomassie-stained gel, anti-xylose
probed western blot membrane, and anti-fucose probed western blot
membrane. These results demonstrate that while xylose and fucose
are both present in plant proteins extracted from flaxseed,
chickpea, corn, potato, soy, rice, broccoli, tomato, blueberry, and
grape, they are not present in proteins from plant and fungi
sources that have been recombinantly expressed in E. coli.
[1097] Selection of Proteins with High Asparagine, Serine, and/or
Threonine Mass Compositions to Decrease Nutritive Polypeptide
Glycosylation.
[1098] The glycosylation state of a nutritive polypeptide can be
decreased by selecting sequences low in glycosylation sites. These
sites include Asparagine, for N-linked glycosylation, and serine
and threonine, for O-linked glycosylation. These isolated
polypeptides contain a higher amino acid percentage by mass due to
the reduced level of bound polysaccharide composition along the
polypeptide, allowing a higher digestible amino acid dose per gram
of nutritive polypeptide, and have reduced immune activity upon
consumption. The N-linked glycosylation of available glycan
acceptor sites along a nutritive polypeptide backbone occurs
predominantly at Asparagine amino acid residues. Expression of
heterologous polypeptides selected for their low levels of
Asparagine allows for polypeptides to be isolated with decreased
glycan structures. The O-linked glycosylation of available glycan
acceptor sites along a nutritive polypeptide backbone occurs
predominantly at Serine and Threonine amino acid residues.
Expression of heterologous polypeptides selected for their low
levels of either Serine or Threonine allows for polypeptides to be
isolated with decreased glycan structures
[1099] Selection of proteins with high Asparagine, Serine, and/or
Threonine mass compositions to increase nutritive polypeptide
glycosylation. The glycosylation state of a nutritive polypeptide
can be increased by selecting sequences rich in glycosylation
sites. These sites include Asparagine, for N-linked glycosylation,
and serine and threonine, for O-linked glycosylation. Increase in
glycosylation can enable increased solubility and thermostability
of the nutritive polypeptide. The N-linked glycosylation of
available glycan acceptor sites along a nutritive polypeptide
backbone occurs predominantly at Asparagine amino acid residues.
Expression of heterologous polypeptides selected for their high
levels of Asparagine allows for polypeptides to be isolated with
increased glycan structures. The O-linked glycosylation of
available glycan acceptor sites along a nutritive polypeptide
backbone occurs predominantly at Serine and Threonine amino acid
residues. Expression of heterologous polypeptides selected for
their high levels of either Serine or Threonine allows for
polypeptides to be isolated with increased glycan structures
[1100] Removal of Glycans from Isolated Nutritive Polypeptides.
[1101] The glycosylation state of nutritive polypeptides can have
an effect on structure and physical properties. As described
herein, nutritive polypeptides expressed in recombinant hosts can
have a different glycosylation than occurs naturally. If a
nutritive polypeptide is produced with glycosylation, the glycans
can be released to alter structural and physical properties using
chemical or enzymatic methods. Common chemical methods of glycan
release are hydrazinolysis and alkali/reducing conditions
(.beta.-elimination) (Takasaki. Seiichi, et al. Methods in
enzymology 83 (1981): 263-268.). Glycans can be released from
proteins using an Endoglycosidases such as PNGaseF, Endo-H, Endo
F2, PNGaseA, or O-Glycanase or using an Exoglycosidases such as
Sialidase, Alpha Galactosidase, Beta Galactosidase, Hexosaminidase,
Galactosaminidase, Alpha Mannosidase, Beta Mannosidase, Alpha
Fucosidase, exact enzymes are selected based on oligosaccharide
composition and linkage (Merry. Tony, et al. Capillary
Electrophoresis of Carbohydrates. Humana Press, 2003, 27-40.).
[1102] PNGCase F is a very effective enzymatic method for removing
almost all N-linked oligosaccharides from glycoproteins. PNGase F
digestion deaminates the aspargine residue to aspartic acid, and
leaves the oligosaccharide intact. To deglycosylate a protein using
an Endoglycosidase, 500 ug of glycoprotein is resuspended in 50 ul
of 50 mM sodium phosphate pH 7.5. PNGase F is added at 0.1 U/ml and
the solution is incubated at 37 C for 24 hours. The reaction is
monitored for completion by SDS-PAGE.
[1103] Screening for IgE-Mediated Allergic Response Due to
Glycan.
[1104] A change in glycan modifications to a nutritive polypeptide
affects the IgE binding interactions. About 20% or more of allergic
patients generate specific anti-glycan IgE, which is often
accompanied by IgG (Altmann, F. The role of protein glycosylation
in allergy. Int Arch Allergy Immunol. 2007). For polypeptides which
induce an IgE-mediated immune response, as is the case with
allergens, a glycan modification as described herein may reduce the
isolated polypeptide's allergenicity compared to in its native
composition. In this example, polypeptides are screened for IgE
binding in an in-vitro serum assay as well as for reactivity by
skin prick test (as described in Mari. A et. al. IgE to
Cross-Reactive Carbohydrate Determinants: Analysis of the
Distribution and Appraisal of the in vivo and in vitro Reactivity,
2002).
[1105] Allergenic response due to the glycan (termed cross-reactive
carbohydrate determinants), can be determined by comparing results
of a skin prick test with an IgE serum binding assay. Unselected
consecutive subjects presenting respiratory symptoms that suggest
an allergic disease, and referred to an allergy unit, are enrolled.
Demographical and clinical data are recorded for each patient.
Patients with a clinical history of anaphylaxis are excluded from
the study. Those patients who haven't previously received a
specific immunotherapy (SIT) course are not excluded. All the
treated patients receive alum-adsorbed extract of the nutritive
polypeptide in both the isolated form and in the native
composition. For statistical purposes, only pollen treated patients
are evaluated. Patients undergo skin prick testing (SPT), with a
standardized procedure and recording (Mari. A, et. al Specific IgE
to cross-reactive carbohydrate determinants strongly affect the in
vitro diagnosis of allergic diseases. J Allergy Clin Immunol 1999),
using the allergenic extracts described above. Following the SPT,
sera are obtained from patients who consent to blood sampling for
an in vitro diagnostic procedure. Sera are stored at -20.degree. C.
until required. Informed consent for skin testing and blood
sampling is obtained by patients or caregivers during the allergy
consultation.
[1106] Total IgE is determined in all the sera (Radim, Pomezia,
Italy). Allergen-specific IgE is detected by the CAP system
following the manufacturer's instructions (Pharmacia, Uppsala,
Sweden). Values 60.4 kUA/l is considered positive. As there is not
a single test to detect CCD-IgE, discrepancy of the results between
a positive in vitro test to the nutritive polypeptide bearing
carbohydrate moieties recognized by IgE and a negative SPT to the
same glycoprotein is assumed to be indicative of the presence of
CCD-IgE. IgE detection is performed on the largest random samples
of sera recorded negative in the SPT to the same allergenic
extract. Modification in the glycan structure that mediates binding
to IgE is observed by a shift in the distribution in patients for
which a CCD-IgE is detected upon isolation of the nutritive
polypeptide and confirmation of altered glycan structure.
Example 33
In Animal Demonstration of Nutritive Polypeptide Amino Acid
Pharmacokinetics
[1107] Pharmacokinetic (PK) studies may be performed to evaluate
the plasma concentration of amino acids following oral
administration of a nutritive polypeptide formulation. Such
analyses provide information on the rate and extent of digestion of
the protein in the gastrointestinal intact and the bioavailability
of the free amino acids and/or peptides released during digestion.
Growing rats, which have a similar small intestinal transit rat to
adult humans (3-4 h), are accepted as a suitable model for
pharmacokinetic studies with oral administration (DeSesso and
Jacobson (2001) Anatomical and physiological parameters affecting
gastrointestinal absorption in humans and rats, Food and Chemical
Toxicology 39: 209-228).
[1108] Rat Pharmacokinetic Studies.
[1109] Male Sprague Dawley rats with indwelling jugular vein
cannula (JVC) were purchased from Harlan Laboratories and
acclimated to the Test Facility (Agilux Laboratories) for at least
two days prior to study initiation. Prior to dose administration
animals were fasted overnight (11-13 h) and remained fasted until
completion of the study. Test articles were orally administered via
a bulb-tipped 18 gauge stainless steel gavage needle attached to a
syringe. The weight of all dose syringes were recorded prior to and
following dosing to more accurately determine the amount of
solution dosed. Serial blood samples (.about.300 .mu.L) were
collected from the JVC at time 0 (pre-dose) and 0.25, 0.5, 1, 2,
and 4 h post-dose. Blood samples were collected into tubes
containing the anti-coagulant K2EDTA, a general protease inhibitor
cocktail (Sigma P8340, diluted 1:100 in whole blood), and a DPP IV
inhibitor (Millipore DPP4, diluted 1:100 in whole blood).
Immediately following blood collection tubes were vortexed and
stored on wet ice until processing to plasma by centrifugation
(3,500 rpm at 5.degree. C.) within 1 h of collection. Plasma
samples were then transferred into new tubes and stored at
-80.degree. C. In some cases, following the terminal blood
collection animals were euthanized and the terminal ileum and its
contents were collected and analyzed as described herein.
[1110] The concentration of Glu, Ser, His, Gly, Thr, Arg, Ala, Tyr,
Val, Met, Phe, Ile, Leu, and Lys in the plasma samples was
determined by HPLC amino acid analysis, as described herein. Prior
to HPLC amino acid analysis, insoluble particles were removed from
plasma samples by centrifugation (1100.times.g at 4.degree. C.) for
10 min. A 25 .mu.L sample of the soluble fraction was then
transferred to a 96-well plate, for some samples an internal
standard (Norvaline, Agilent) was added to each plasma sample at
final concentration of 0.5 mM. Amino acids not measured in the
current HPLC amino acid analysis, including Gln, Asn, Trp,
Hydroxyproline (Hyp), and Sarcosine (Sar), are analyzed by using a
standard mixture that includes the individual standard stocks
provided in the supplemental amino acid kit (Agilent) and comparing
the chromatographic profiles of the samples against that of the
combined standards. Because solutions containing the supplemental
standards are unstable at room temperature the supplemental amino
acid standards are prepared immediately prior to use and used for
no longer than 24 h.
[1111] FIG. 52 displays the change in average area under the curve
(AUC) (.+-.SD) of plasma amino acid concentrations (.mu.M.h)
measured in blood samples collected from rats over 4 h following
oral administration of the indicated nutritive polypeptides at the
doses listed in Table E33A. FIG. 53 shows SEQID-00105 as an example
of oral administration of nutritive polypeptides altering the
concentration of amino acids in rat plasma. The profile of amino
acids detected in the rat plasma after oral administration was
dependent on the amino acid sequence of the nutritive polypeptide.
For example, oral administration of the polypeptides SEQID-00240,
SEQID-00338, and SEQID-00352 increased the change in AUC0-4 h for
plasma Lys, whereas administration of the polypeptides SEQID-00363,
SEQID-00424, and SEQID-00426 did not alter the change in AUC0-4 h
for plasma Lys (FIG. 52). Additionally, the nutritive polypeptide
SEQID-00240 serves as an example of a polypeptide that is capable
of delivering essential amino acids (EAAs) while causing no flux in
plasma Phe concentration. FIG. 54 demonstrates representative
plasma amino acid concentration time curves for oral administration
of SEQID-00105 (2.85 g/kg) to rats. FIG. 54 demonstrates a
dose-response effect on plasma Leu concentrations following oral
administration of SEQID-00105 at the doses indicated in Table E33A.
Taken together, these results demonstrate that oral administration
of nutritive polypeptides can be used to deliver specific amino
acid profiles to the systemic circulation in rats.
TABLE-US-00116 TABLE E33A List of the nutritive polypeptides and
doses used in rat pharmacokinetic studies. FIG. 52 and 53 Symbol
SEQID Dose (g/kg) 1 Vehicle NA 2 105 2.85 3 240 1.54 4 338 2.85 5
352 2.85 6 363 2.85 7 423 2.85 8 424 2.85 9 425 2.85 10 426 2.85 11
429 2.85 12 559 2.85 13 587 2.85 14 105 1.78 15 105 1.78 16 105
1.11 NA: not applicable.
Example 34
Modulation of Nutritive Polypeptide Digestibility
[1112] Multiple methods of protein modification were used to alter
the structure of a model nutritive polypeptide, SEQID-00363. These
methods were performed to assess the relevance of specific
structural features in regards to protein digestibility and
bioavailability. These modifications include reduction of glycans,
hydrolysis of the protein, reductionialkylation of disulfide bonds,
and thermal denaturing of protein structure. Resulting materials
from these modifications were evaluated for improved digestion
using in vitro digestion assays and, in some cases, in vivo assays.
These methods or other means of producing similar structural
changes end can be applied to other nutritive polypeptides.
[1113] Enzymatic Deglycosylation.
[1114] It is predicted that SEQID-00363 contains high-mannose
O-linked glycosylation (Goto et al., 2007 Biosci. Biotechnol.
Biochem.). To assess the effect of glycosylation on the digestion
of SEQID-00363 the mannose glycans were significantly reduced
enzymatically. A non-specific alpha mannosidase (M7257, Lot
SLBC4303V, Sigma Aldrich. St. Louis, Mo.) was used to cleave all
1-3, 1-4 and 1-6 glycosidic linkages within the O-glycans. This
alpha mannosidase does not cleave any non-mannose glycosidic
linkages; it is predicted that this enzyme is ineffective against
N-linked glycan release.
[1115] The deglycosylation reaction was adapted from Jafari-Aghdam
et al., 2005 Biochimica et Biophysica Acta. The protein stock of
SEQID-00363 was resuspended from lyophilized powder to an enzyme
concentration of 100 g/L into deglycosylation reaction buffer: 20
mM sodium acetate, 2 mM zinc chloride, 0.01% 2-mercaptoethanol, pH
4.3. Reagent stocks were diluted into the deglycosylation reaction
to a final volume of 0.5 L. The reaction was performed at a
SEQID-00363 concentration of 10 g/L and an alpha mannosidase
concentration of 0.5 EU per mg of SEQID-00363. The reaction was
sterile filtered through a 0.2 um filter directly into 7.times.70
mL 3.5 kD dialysis cassettes in 20 L of deglycosylation reaction
buffer. The reaction was performed in dialysis in order to decrease
proposed feedback inhibition of the alpha mannosidase by released
(mono/poly)saccharides. The reaction was then stored at 37.degree.
C. for six days. Throughout the course of the reaction,
approximately 10% of SEQID-00363 was lost due to insoluble
aggregate formation. At the terminal (6 day) time point, the
reaction was collected from dialysis, sterile filtered,
concentrated, and diafiltered into 10% (phosphate buffered saline,
pH 7.4. Successfully reduction of mannose glycans was monitored by
a decrease in size by SDS-PAGE and anti-GNA western blot as
described herein. In order to create a high protein concentration
formulation of deglycosylated SEQID-00363, the remaining pool was
concentrated in an Amicon spin concentrator (EMD Millipore,
Billerica, Mass.) until the final concentration approached 250 g/L.
The high-concentration formulation remained soluble at 4.degree.
C., and was held at that temperature for long-term storage.
[1116] Protein Hydrolysis.
[1117] Another approach to increasing bioavailability relative to a
preparation of native protein was hydrolysis into short peptides.
Protein hydrolysates of commodity proteins, such as whey (Perea et
al., 1993 Enzyme Microb. Technol.) and soy (Kong et al., 2008
Bioresource Technology) are generated enzymatically through
subtilisin-mediated proteolysis.
[1118] Subtilisin is most active at pH 8.5 and 55.degree. C.
(Alder-Nissen, 1986). For the intent of this experiment, a
lyophilized preparation of a model protein enzyme was resuspended
to 275 g/L in 100 mM sodium carbonate in order to bring the pH of
the resulting protein solution to approximately pH 8. Subtilisin
(Alcalase 2.4 L, Sigma Aldrich, St. Louis, Mo.) was added to the
protein solution at a concentration of 5.93.times.10-4 U per mg of
model protein enzyme. The reaction was then diluted to 250 g/L
model protein enzyme and transferred to 55.degree. C. for 24 hours.
Once completed, the hydrolyzed material was stored at 4.degree.
C.
[1119] Reaction progress was monitored by size exclusion
chromatography (SEC) using a Superdex 75 (5.times.150 mm) column
(GE Healthcare, Uppsala, Sweden) and also by SDS-PAGE analysis.
[1120] Protein Reduction and Alkylation.
[1121] Disulfide containing proteins can be reduced and alkylated
in order to break disulfide bonds and stabilize free thiols. This
modification disrupts all disulfide bridge structure and
furthermore prevents disulfide bridges from reforming both
intramolecularly or extramolecularly. SEQID-00363 contains 10
cysteines, and four disulfide bonds as predicted by SCRATCH Protein
Predictor (Cheng et al., 2005 Nucleic Acids Res.).
[1122] SEQID-00363 was reduced and alkylated at a final
concentration of 6 g/L using Bio-Rad ready Prep
Reduction/Alkylation Kit (Bio-Rad, Hercules, Calif.). The
reduction/alkylation reaction was performed as recommended by the
manufacturer's instructions. SEQID-00363 was reduced and alkylated
in 50 mM phosphate, pH 8.0. Samples were analyzed by non-reducing
SDS-PAGE analysis.
[1123] Heat-Induced Protein Destabilization.
[1124] Denaturation of protein involves the disruption of ordered
structure of the molecule; i.e., reduction of all quaternary,
tertiary and secondary structure to primary structure. Denaturation
disrupts all non-covalent intramolecular interactions; i.e.,
hydrogen bonding, ionic interaction, Vander Waals interaction and
hydrophobic interaction. Heat can be used to disrupt these
interactions, and reduce a native protein to its primary structure
(with the exception of disulfide linkages).
[1125] SEQID-00363 was diluted to 30 g/L in 10% PBS, pH 7.4 and
rapidly heated to 95.degree. C. Upon boiling, the protein was
removed from heat treatment and immediately transferred to in vitro
digestion analysis as described in herein.
[1126] In Vitro Digestibility of Modified Forms of SEQID-00363.
[1127] The digestibility of native SEQID-00363 and modified forms
(ie, deglycosylated, reduced and alkylated, and heat-denatured) of
SEQID-00363 was evaluated using the methods described herein.
Briefly, native and modified forms of SEQID-00363 were treated with
simulated gastric fluid (SGF) and the presence of intact protein
remaining at various time points was analyzed by gel
electrophoresis as described herein. Additionally, the amount of
free amino acids present after exposure to a Pancreatin-based
simulated digestive system was analyzed by reverse phase HPLC amino
acid analysis as described herein. Results from the SGF digest of
native and modified forms of SEQID-00363 demonstrate that
modification of SEQID-00363 via deglycosylation, reduction and
alkylation, and heat-denaturation enhances the digestibility of the
protein to varying degrees. Results from the Pancreatin digest of
native and modified forms of SEQID-00363 demonstrate that
modification of SEQID-00363 via deglycosylation and
heat-denaturation, but not reduction and alkylation, enhanced the
release of free Leu during digestion. Table E34A lists half-life
values calculated from the exponential decay curves and free Leu
(SIM) at 120 min time point.
TABLE-US-00117 TABLE E34A SGF Half-life (t1/2) in min and Free Leu
(.mu.M) at 120 min time point of Pancreatin digest of modified
nutritive polypeptide Free Leu (.mu.M) at 120 min time point of SGF
Half-life (t1/2) in min Pancreatin digest SEQID-00363 36 574.2
Heat-denatured 20.4 763.5 SEQID-00363 Reduced and alkylated 20.4
598.1 SEQID-00363 Deglycosylated 4.3 799.2 SEQID-00363
[1128] Bioavailability of Modified Forms of SEQID-00363.
[1129] The bioavailability of native and modified forms (ie.
deglycosylated and hydrolyzed) of SEQID-00363 was evaluated using
the methods described in herein. Briefly, native and modified forms
of SEQID-00363 were orally administered to intrajugular-cannulated
rats and concentration of free amino acids in plasma samples
collected over a 4 h period was determined by HPLC amino acid
analysis. Amino acid analysis of plasma samples collected in the
rat pharmacokinetic study of native and modified forms of
SEQID-00363 are displayed in FIG. 55. These results demonstrate
that hydrolysis of SEQID-00363 increased the bioavailability of
Leucine, Serine, Threonine, and in general essential amino acids
(EAAs). While deglycosylation of SEQID-00363 did not increase the
bioavailability of Leucine or EAAs, it did increase the
bioavailability of Serine and Threonine.
[1130] Ileal Digestibility of Modified Forms of SEQID-00363.
[1131] Protein quality is a function of amino acid composition,
digestibility, and bioavailability. Ileal digestibility assays may
be used to measure the difference between the contents (ie. amino
acid, nitrogen, dry matter weight) of a protein and the contents of
the digesta in the terminal ileum following ingestion of the
protein. Results from ileal digestibility assays can be used to
calculate amino acid, nitrogen, and dry matter ileal digestibility
coefficients and provide knowledge about the protein's
digestibility and amino acid bioavailability (Darragh and
Hodgkinson, 2000, Journal of Nutrition, 130(7): 1850S-1856S). Fecal
digestibility coefficients, determined over the entire digestive
tract, tend to overestimate amino acid digestibility and
bioavailability due to microbial metabolism in the large intestine.
Since protein digestion and amino acid absorption occurs mainly in
the upper small intestine and is effTectively complete by the end
of the ileum, ileal digestibility assays are now accepted as the
method of choice for determining protein and amino acid
digestibility in monogastric mammals. Growing rats, which have a
similar small intestinal transit rate to adult humans (3-4 h), are
accepted as a suitable model for ileal digestibility assays (Amidon
et al., 1986, The Journal of Pharmacy and Pharmacology, 38(5):
363-368).
[1132] A rat pharmacokinetic study with oral administration of
native and modified forms of SEQID-00363 was performed as described
herein. The indigestible marker Cobalt-EDTA was formulated at 50
mg/L in the dosed protein solutions to monitor differences in
intestinal transit rate between treatment groups and individual
rats. Following the final blood collection (at t=4 h) rats were
euthanized and the terminal ileum (20 cm of small intestine prior
to the cecum) and its contents (the digesta) were collected into a
pre-weighed tube. The ileum was flushed with saline and pooled with
the digesta. The pH of the digesta was adjusted to .about.3.0 with
HCl in order to inactivate all enzymes. The ileum samples were
placed into separate pre-weighed 15 mL conical tubes. All samples
were flash frozen in liquid nitrogen, and stored at -80.degree. C.
until further analysis. Individual ileum and ileum content weights
were calculated and recorded for each sample.
[1133] A sample of the digesta, which exists as a heterogenous
solution containing insoluble particles, was used in the Coomassie
Plus Protein Assay, as described herein, to determine protein
concentration. The average total protein concentration in digesta
samples harvested from rats administered vehicle, native
SEQID-00363, deglycosylated SEQID-00363, and hydrolyzed SEQID-00363
was 0.1, 0.9, 0.9, and 0.3 mg/mL, respectively. Based on the
volumes of collected digesta the total protein mass in digesta
samples harvested from rats administered vehicle, native
SEQID-00363, deglycosylated SEQID-00363, and hydrolyzed SEQID-00363
was 1.2, 6.9, 7.7, and 2.2 mg, respectively. These results
demonstrate that the concentration and total mass of protein is
higher in the digesta of rats administered native and
deglycosylated SEQID-00363 than in rats administered either vehicle
or hydrolyzed SEQID-00363. Together these results suggest that
hydrolyzed SEQID-00363 is more completely digested in the rat
gastrointestinal system than either native or deglycosylated
SEQID-00363.
[1134] To determine ileal digestibility coefficients an aliquot of
the dosing sample and the ileal digesta sample are analyzed for
total amino acid content by reverse phase HPLC amino acid analysis
(Lookhart and Jones, 1985, Cereal Chemistry, 62(2):97-102), total
nitrogen content by Kjeldhal analysis (Lynch and Barbano, 1999,
JOURNAL OF AOAC INTERNATIONAL, 82(6): 1389-1398), and Cobalt
content by Inductively Coupled Plasma Mass Spectrometry (ICP-MS)
(Taylor, H. E., Inductively Coupled Plasma-mass Spectrometry:
Practices and Techniques. Academic Press, 2001) to determine ileal
amino acid and nitrogen digestibility coefficients.
Example 35
Treatment of Nutritive Polypeptides for Reduced Activity
[1135] Modification of enzymatically active nutritive polypeptides
can alter both the enzymatic activity, and the structural stability
of the protein. It can be advantageous for an orally administered
nutritive polypeptides to lack activity that is not required for
delivery of amino acid nutrients. Furthermore, deactivation is
indicative of destabilization that can be more digestible and
bioavailable than its native counterpart. Enzyme modification was
achieved through either chemical or heat treatment(s). Enzymatic
activity was measured through an in vitro assay.
[1136] Activity Assay.
[1137] Inactivation of SEQID-00363 was tested by a glucoamylase
activity assay. Glucoamylase acts to hydrolyze
p-nitrophenyl-a-D-glucopyranoside to p-nitrophenol (PNP) and
glucose. The activity of the enzyme in units (U) per mL was
determined by measuring the absorbance of release PNP at 400 nm
(method adapted from Glucoamylase Activity Assay (U.S.
Pharmacopeia. Food Chemicals Codex, 8th edition; 2012:1314-1315.))
PNP standards at 0.12, 0.06, 0.03, 0.015 and 0.0075 .mu.mol/mL in
0.3 M sodium carbonate were used to determine the millimolar
extinction coefficient (e) using the follow equation: e=A400 nm/C
where the average value considered where A400 nm is the absorbance
at 400 nm measured using a spectrophotometer with a 10 mm light
path and C is the standard concentration in .mu.mol/mL. The samples
were made at dilutions in 0.1 M sodium acetate pH 4.5 that fall in
the absorbance range of the standards. 100 .mu.L of sample was
incubated at 50.degree. C. for 5 minutes prior to addition of 100
.mu.L of PNPG solution (100 mg PNPG, dilute to 100 mL in 0.1 M
sodium acetate pH 4.5) that had been equilibrated at 50.degree. C.
for at least 15 minutes. The sample was then incubated at
50.degree. C. and 100 .mu.L of 0.3 M sodium carbonate added 10
minutes after PNPG addition to stop the reaction. The absorbance at
400 nm was then measured and the activity in U/mL calculated as
follows: Activity=[(Asample-Ablank).times.0.3 mL.times. Dilution
Factor]/.di-elect cons..times.10 min.times.0.10
.mu.mol/min/unit.times.0.1 mL where Asample is the sample
absorbance and Ablank is the blank absorbance at 400 nm, 0.3 mL is
the volume of the reaction, 10 min is the reaction time, 0.10
mol/min is the amount of PNP cleaved per unit of enzyme and 0.1 mL
is the sample aliquot. 1:1:1: 0.1 M sodium acetate pH 4.5:0.3 M
sodium carbonate: PNPG solution is used as a blank. Activity is
reported as specific activity (U/mL or U/mg) or as a relative
activity (i.e. compared to a control protein).
[1138] Protein Modification for Deactivation.
[1139] Protein enzymes can be deactivated through chemical-induced
destabilization of the enzymatic active site of the molecule. An
experiment was performed that screened a subset of reagents that
represented different chemical classes and mechanisms of action
including: Oxidation (Bleach. H2O2, ethylene oxide); Reduction
(DTT, bME, TCEP); Chaotrope (CaCl2, Urea, Gnd HCl, NaSCN); High pH
(Na2CO3, Tris Base. Na2HPO4); Low pH (Na3Citrate, Tris HCl, Acetic
acid, Boric acid); Neutral pH (Na-Citrate. MOPS Acid, MES Acid,
Na-Acetate); Detergents (Tween 80, Triton-X-100, CHAPS, SDS, MPD);
Chelation (EDTA, citrate).
[1140] SEQID-00363 was formulated in water to 300 g/L and diluted
10.times. into an array of chemical deactivation conditions (final
concentration=30 g/L). SEQID-00363 was subsequently assayed for
enzymatic activity after 10 minutes of deactivation and 4 days of
deactivation Table E35A.
TABLE-US-00118 TABLE E35A Chemical deactivation of SEQID-00363.
Results of enzyme activity assay at 4 day time point. All enzyme
activities are normalized to the negative control (water). Activity
After Activity After 4 Days 4 Days Condition (% of Water) Condition
(% of Water) Water Control 100% 1M Gnd HCl 58% 1% Triton-X-100 93%
250 mM Tris Base 56% 200 mM CaCl2 92% 100 mM Tris Base 54% 1% CHAPS
85% 2M Gnd HCl 46% 50 mM CaCl2 84% 500 mM Tris Base 41% 400 mM
CaCl2 79% 5M Urea 41% 100 mM CaCl2 78% 0.1% Bleach 21% 5% BME 77%
50 mM Na2CO3 19% 250 mM EDTA 76% 10M Urea 15% 0.1% H2O2 76% 4M Gnd
HCl 10% 0.01% Bleach 73% 0.615% Bleach 9% 50 mM DTT 73% 100 mM
Na2CO3 6% 0.3% H2O2 72% 200 mM Na2CO3 4% 1% Tween 80 66% 500 mM
Na2CO3 0% 1% SDS 65% 6M Gnd HCl 0% 0.5M Gnd HCl 60%
[1141] Relative to a water deactivation negative control,
SEQID-00363 displayed greatest deactivation in strong chaotropes
such as 6M Gnd.HCl and 4M urea; high pH formulations of sodium
carbonate; and the strong oxidizer, sodium hypochlorite (household
bleach). At t=4 days, these conditions all displayed less than 20%
of relative enzymatic activity after four days of treatment. Due to
the health risks associated with consumption of vigorous oxidizers
and strong chaotropes, treatment of SEQID-00363 with high pH was
identified as the best condition for deactivation of the enzyme.
Relative to the 10 minute time point, samples taken at the four day
time point suggest that chemical deactivation at room temperature
is not a fast-acting process. The kinetics of deactivation are
likely not very fast in many of the assayed conditions.
[1142] An experiment measured deactivation of SEQID-00363 by heat
at multiple buffer conditions was tested. SEQID-00363 was diluted
to 3 g/L in 20 mM sodium phosphate pH 7, 20 mM sodium phosphate pH
9, 20 mM sodium carbonate pH 11 and water. 100 .mu.L of sample was
then treated at ambient temperature, 60.degree. C., 70.degree. C.,
80.degree. C. and 90.degree. C. for each buffer for 5 minutes in a
PCR thermocycler. The activity of each enzyme was tested by the
glucoamylase activity assay and each activity normalized to the
activity in water at ambient temperature (control). The results are
shown below in Table E35B.
TABLE-US-00119 TABLE E35B Chemical deactivation of SEQID-00363.
Results of enzyme activity assay at 4 day time point. All enzyme
activities are nomalized to the negative control (water). Activity
(% of Water, Condition Ambient) Water, Ambient 100% Water,
60.degree. C. 84% Water, 70.degree. C. 14% Water, 80.degree. C. 3%
Water, 90.degree. C. 3% 20 mM Sodium Phosphate pH 7, Ambient 101%
20 mM Sodium Phosphate pH 7, 60.degree. C. 53% 20 mM Sodium
Phosphate pH 7, 70.degree. C. 2% 20 mM Sodium Phosphate pH 7,
80.degree. C. 1% 20 mM Sodium Phosphate pH 7, 90.degree. C. 1% 20
mM Sodium Phosphate pH 9, Ambient 99% 20 mM Sodium Phosphate pH 9,
60.degree. C. 27% 20 mM Sodium Phosphate pH 9, 70.degree. C. 2% 20
mM Sodium Phosphate pH 9, 80.degree. C. 1% 20 mM Sodium Phosphate
pH 9, 90.degree. C. 1% 20 mM Sodium Carbonate pH 11, Ambient 93% 20
mM Sodium Carbonate pH 11, 60.degree. C. 0% 20 mM Sodium Carbonate
pH 11, 70.degree. C. 0% 20 mM Sodium Carbonate pH 11, 80.degree. C.
0% 20 mM Sodium Carbonate pH 11, 90.degree. C. 1%
[1143] An additional multifactoral experiment was performed that
assayed the effect of temperature and pH for varying exposure time
on the enzymatic activity of SEQID-00363. SEQID-00363 was
formulated to 100 g/L, and the effect of either a high pH spike, or
a diafiltration into high pH buffers was tested against a gradient
of temperatures across 25 C to 70.degree. C. over a time course of
0 hours to 24 hours. Upon analysis, samples were neutralized to
.about.pH 7 using a spike of 1 M sodium acetate buffer.
[1144] SEQID-00363 experimental overview and design was as follows.
SEQID-00363 was resuspended to 100 g/L and either spiked with 0.25M
sodium carbonate pH 10, diafiltered into 50 mM sodium carbonate pH
10, or diafiltered into 10% phosphate buffered saline pH 9.0.
Samples were incubated at either 40, 50, 60 or 70.degree. C. across
a time course that included sampling points at t=0, 1, 2, 4 and 24
h.
[1145] Inactivation of SEQID-00363 was assayed using an activity
assay as described herein. Samples were analyzed by specific
activity (U/mg) and visual solubility, as either a gel, viscous or
fluid. This study found SEQID-00363 is enzymatically deactivated by
both temperature and pH. Some treatments caused irreversible
aggregation, and gel formation of the nutritive polypeptide; these
samples were not analyzed for enzymatic activity. The results of
this experiment suggest that SEQID-00363 can be solubly deactivated
at pH 10 at 25.degree. C. As the temperature of the reaction
increases, the protein remains deactivated, but becomes
insoluble.
[1146] pH was therefore defined as a critical process variable in
regard to SEQID-00363 deactivation. A subsequent study was
performed to explored SEQID-00363 deactivation as a function of pH
at room temperature. A process which can be performed at room
temperature is less costly and easier to scale up than a heated
process. SEQID-00363 was formulated to 100 g/L at pH 3.6 and using
an ultrafiltration membrane, the buffer was exchanged into a series
of sodium carbonate buffers. The SEQID-00363 solution pH increased
from 3.6 to 11.0 during the course of buffer exchange. Samples of
the protein were taken from the ultrafiltration system
systematically during the course of buffer exchange, resulting in a
set of samples across the pH range. These samples were held at room
temperature and each sample was split in half. Half of each sample
was neutralized into sodium acetate buffer after 2-5 hours.
Neutralized samples were then assayed for enzyme activity as
described and results are in the Table E35C.
TABLE-US-00120 TABLE E35C Effect of 2-5 hour incubation over pH
range on activity. Relative activity pH (%) 3.6 100 4 91 5 83 6 82
7 89 8 86 9 56 9.7 54 10 37 10.9 13
[1147] Deactivation by hydrolysis of SEQID-00363 was also tested by
glucoamylase activity assay. The procedure of protein hydrolysis is
described herein. Hydrolysis was found to reduce activity to 7%
relative to control.
[1148] Other amylase nutritive polypeptide deactivation was also
tested. Deactivation of SEQID-00424 was tested by the glucoamylase
activity assay as described herein, but instead utilizing a pH 5.0
acetate buffer (recommended for Aspergillus oryzae derived
enzymes). Samples were deactivated by hydrolysis or by boiling, as
described herein. Boiling reduced activity to 0% and hydrolysis
reduced activity to 51% relative to control.
Example 36
Disruption of Nutritive Polypeptide Enzymatic Activity
[1149] Construction of Mutant Proteins. Multiple mutations were
tested to determine the degree of enzymatic inactivation that could
be achieved for a model protein known to have enzymatic activity
(SEQID-00338, UniProt ID: P07170). In this protein, the substrate
binding sites includes positions 42, 134, 167, and 178. In
addition, there is a magnesium ion binding site at position 91.
Single amino acid mutations were made at several substrate-binding
positions. The mutants were expressed and tested for enzymatic
activity.
[1150] The single amino acid mutant proteins were constructed by
PCR amplification of two pieces. The first piece is amplified using
a forward primer that binds to the 5'-end of the gene
(ATCACCACCATCACCATCATAGCAGCAGCGAAACATTCGTATG) with an overhang that
is compatible with a His-tag and a reverse primer (Table E36A)
containing the most common codon for the target amino acid in
Escherichia coli and the 20-bp flanking region upstream and
downstream of the mutation. The second piece amplifies the 3'-end
of the protein immediately following the mutation site using a
forward primer specific to the position of the mutation (Table
E36A) and a reverse primer that binds to the 3'-end of the gene
(TGTTAGCAGCCGGATCCTTAATCTTTGCCCAGCTTTATTCAGAATATC). Standard PCR
reaction conditions were used for all pieces, which contains 0.5 uM
forward primer, 0.5 uM reverse primer, 1.times. Phusion Polymerase
Master Mix (New England Biolabs), and 1-100 ng template DNA in 50
ul final volume. The thermocycle conditions are initial denaturing
at 98.degree. C. for 30 sec. cycle 30 times with denaturing
temperature at 98.degree. C. for 10 sec. annealing temperature at
55-60.degree. C. 15 sec, extension temperature at 72.degree. C. for
15 sec/kb product. The template DNA are removed from the final
products by adding 1 ul Dpn I (New England Biolabs) and 5 ul
10.times. CutSmart buffer and incubating at 37.degree. C. for 1
hour. Each PCR product is cleaned and concentrated following a Gel
Recovery kit (Zymo Research) and eluted in 20 ul sterile water
before proceeding to the next assembly step.
TABLE-US-00121 TABLE E36A List of reverse primers used to amplify
PCR piece 1 for the mutants. Mutation Reverse Primer 1 D91F
GGAATGGTACGCGGAAAACCAAACAGAATAAAGCCATTT TTGCATGCC D91I
GGAATGGTACGCGGAAAACCAATCAGAATAAAGCCATTT TTGCATGCC R134M
CCGCTTGCCGGATGAATCAGCATACCGGTAATACGTGCA ACCAG R134Y
CCGCTTGCCGGATGAATCAGATAACCGGTAATACGTGCA ACCAG R42A
GTACCTTTTGCAATCTGGCTTGCCAGCATATCACCGGTT GCCAG R42C
GTACCTTTTGCAATCTGGCTACACAGCATATCACCGGTT GCCAG R42G
GTACCTTTTGCAATCTGGCTACCCAGCATATCACCGGTT GCCAG R42I
GTACCTTTTGCAATCTGGCTAATCAGCATATCACCGGTT GCCAG R42K
GTACCTTTTGCAATCTGGCTTTTCAGCATATCACCGGTT GCCAG R42L
GTACCTTTTGCAATCTGGCTCAGCAGCATATCACCGGTT GCCAG R42Q
GTACCTTTTGCAATCTGGCTCTGCAGCATATCACCGGTT GCCAG R42T
GTACCTTTTGCAATCTGGCTGGTCAGCATATCACCGGTT GCCAG R42V
GTACCTTTTGCAATCTGGCTAACCAGCATATCACCGGTT GCCAG Position Forward
Primer 2 91 GGTTTTCCGCGTACCATTCC 134 CTGATTCATCCGGCAAGCG 42
AGCCAGATTGCAAAAGGTACAC
[1151] Mutations are specified by original amino acid in its single
letter abbreviation followed by the position and the final amino
acid in its single letter abbreviation.
[1152] The PCR amplified pieces were inserted into the expression
plasmid by Gibson assembly and transformed into T7 Express (New
England Biolabs) cells for expression. The expression plasmid
pET15b containing a T7 promoter, an 8.times.His-tag, and a stop
codon was amplified by PCR using primers GGATCCGGGCTCTAACAAAGCC and
ATGATGGTGATCGTGGTGATGATGATGAC so that there will be 20 bp overlap
between each PCR piece, so that they will be properly assembled by
Gibson assembly. In Gibson assembly, 1 ul of each PCR piece is
combined into 10 ul final volume with 1.times. Gibson Assembly
Master Mix (New England Biolabs) and incubated at 50.degree. C. for
1 hour. The assembly reaction mixture was diluted 3.times. by
adding 20 ul water. 3 ul of the diluted mixture was transformed
into 30 ul T7 Express (New England Biolabs) cells. Single colonies
were picked and plasmids extracted and sequence confirmed before
moving on to expression studies.
[1153] Expression and Purification of Mutant Proteins.
[1154] Single colonies were used to inoculate a 2 mL deep well
block with 1 mL of LB medium with 100 mg/L carbenicillin in each
well. Cultures were shaken at 37.degree. C. and 900 rpm overnight
in a deep well block shaker. The deep well block was used to
inoculate another deep well block with 1 mL of BioSilta Enbase
medium with 600 mU/L glucoamylase to an OD600 of 0.1. Cultures were
shaken for 16 hours at 37 C and 900 rpm, at which point 1 mM IPTG
was added to induce the cultures, and additional Enbase
supplemental media and another 600 mU/L of glucoamylase was added
to supplement the cultures. Expression was carried out for another
6 hours at 37.degree. C. and 900 rpm. Cultures were harvested by
spinning the deep well block at 3.000.times.g for 10 minutes at RT.
After centrifugation, the supernatant was carefully removed the
cell pellets were frozen at -20.degree. C. Frozen cell pellets were
thawed and 0.3 g of 0.1 mm zirconium beads were added to each
sample followed by 0.5 ml of PBS. The cells were lysed in the cold
room (4.degree. C.) by head-beating for 5 min in a Qiagen
TissuelyserII (Qiagen. Hilden, Germany) equipped with a 96-well
plate adapter. Cell lysates were centrifuged at 3000 rpm for 10 min
and the supernatant was removed, sampled, and analyzed for protein
concentration by chip electrophoresis. Samples were prepared by
adding 2 .mu.l of sample to 7 .mu.l sample buffer, heating at 95 C
for 5 minutes, and then adding 35 .mu.l of water. Analysis was
completed using HT Low MW Protein Express LabChip.RTM. Kit or HT
Protein Express LabChip.RTM. Kit (following the manufacturer's
protocol). A protein ladder ran every 12 samples for molecular
weight determination (kDa) and quantification (ng/.mu.l).
[1155] The mutant proteins were purified using the His Multitrap HP
(GE Healthcare) system according to manufacturer's protocol. The
concentrations of the proteins were measured by SDS-PAGE stained by
Coomasie Blue and absorbance at 280 nm. The proteins were diluted
in 40 mM Tris buffer for kinase activity assay.
[1156] Determination of the Kinase Activity of SEQID-00338.
[1157] The ADP-Glo.TM. Max Assay was obtained from Promega (Catalog
number V7001, Madison, Wis.). Adenosine Monophosphate was obtained
from Sigma-Aldrich (Catalog number A1752, St. Louis, Mo.). 5.times.
Kinase Buffer was prepared w/ 1.211 g Tris Base (Catalog number
BP152-2, Fisher Bioreagents, Pittsburgh, Pa.), 692 .mu.L 12%
hydrochloric acid solution (Catalog number BDH3026-500MLP, VWR,
Radnor, Pa.), 10.0 mL 500 mM magnesium chloride (Catalog number
BP214-500. Fisher Bioreagents. Pittsburgh, Pa.) and the volume
brought to 50 mL with MilliQ water and filtered through 0.22 .mu.m
PES filter (Catalog number SCGP00525, Millipore, Billerica, Mass.)
into a sterile 50 mL tube.
[1158] Twelve his-tag purified mutant proteins and the wild-type
protein at 35 .mu.g/mL in Tris buffer were serially diluted to 7.0
and 1.4 .mu.g/mL. Prepared kinase reaction mix at 0.5 mM AMP/0.5 mM
ATP to test for activity and at 0 mM AMP/0 mM ATP to assay
background activity by diluting 5.times. Kinase Buffer with
appropriate volumes of 10 mM AMP and 10 mM ATP in MilliQ water.
Duplicate reactions were prepared by mixing 9 .mu.L of the reaction
mixture with 6 .mu.L of diluted SEQID-00338, mixing by pipetting up
and down and dispensing 5 .mu.L into a 384-well white OptiPlate
(PerkinElmer, Waltham, Mass.). An ADP standard curve was prepared
by serially diluting 4 mM ADP in MilliQ water and adding kinase
buffer to 1.times. for a standard at 0.0005, 0.001, 0.005, 0.01,
0.05, 0.1, 0.5, 1, 2, 3, and 4 mM ADP. The plate was covered with a
foil plate seal and incubated at 30.degree. C. for 30 min.
Following the kinase reaction, 5 .mu.L of ADP-Glo.TM. Reagent was
added to each well. The plate was sealed with a foil plate seal and
placed on a horizontal plate shaker at 450 rpm for 2 minutes at mom
temperature. The plate was removed from the plate shaker and
incubated at room temperature for 40 minutes. The plate was then
centrifuged for 15 seconds at 1109.times.rcf and 10 .mu.L of
ADP-Go.TM. Max Detection Reagent was added. The plate was sealed
with a foil plate seal and shaken on a horizontal plate shaker at
450 rpm at room temperature for 2 minutes. The plate was then
removed from the plate shaker and incubated at room temperature for
60 minutes. The plate was centrifuged for 15 seconds at
1109.times.ref and the luminescence read on an EnspireAlpha plate
reader (PerkinElmer, Waltham, Mass.).
[1159] The ADP standard curve was used to determine the
concentration of ADP in sample wells in the presence or absence of
substrate. Concentrations were determined by performing a
non-linear 4 parameter logistic on the X=log(X) transformed ADP
standard luminescence values. Background ADP was found to be below
the limit of detection in most samples. Where the background
concentration of ADP in the absence of substrate was calculable the
average of those values were subtracted from the calculated ADP
concentration in the substrate incubated wells. Activity knock out
was calculated by percentage activity relative to purified
wild-type protein at the same concentration.
TABLE-US-00122 TABLE E36B The proportion activity was calculated as
the percentage AMP + ATP.fwdarw.2ADP converted by SEQID-00338 at 7
.mu.g/mL during a 30 minute reaction at 30.degree. C. KINASE AVG SD
N Wild-type 100.0% 11.2% 2 D91F 0.9% 0.60% 2 D91I 0.4% 0.20% 2
R134M 0.3% 0.09% 2 R134Y 0.2% 0.08% 2 R42A 0.9% 0.08% 2 R42C 1.8%
0.14% 2 R42G 1.2% 0.06% 2 R42I 1.5% 0.07% 2 R42K 2.2% 0.14% 2 R42L
1.7% 0.08% 2 R42Q 1.2% 0.05% 2 R42T 1.9% 0.06% 2
Example 37
Engineering of Secreted Polypeptide for Reduced Enzymatic
Activity
[1160] A mutant protein was constructed to reduce the enzymatic
activity of a nutritive polypeptide. The active sites of
SEQID-00407 are predicted to be residues D217 and E249, which are
acidic residues lying in the center of the catalytic domain. To
produce a polypeptide free of enzymatic activity and enriched in
amino acids important to nutrition and health, we mutated those two
sites to disrupt the catalytic activity of SEQID-00407. D217 and
E249 in SEQID-00407 may act as nucleophiles and proton donors or
acceptors to form hydrogen bonds with their ligands.
[1161] To remove enzymatic activity from SEQID-00407, we engineered
a protein with a single amino acid mutation at E249, changing it
from glutamic acid to phenylalanine. The mutant was constructed by
assembling two PCR fragments. The first contains the 5'-end of the
enzyme up to 20 bp downstream of the mutation site. The second
contains the 3'-end of the enzyme starting immediately after the
mutation site. In the first PCR fragment, specific PCR primers were
designed to bind the targeted mutation site and incorporate the
desired mutant amino acid codon. The TTT codon was selected because
it is the most highly used codon for phenylalanine in Bacillus
subtilis. The two PCR fragments were assembled and inserted into
the plasmid vector using Gibson Assembly method (NEB Gibson
Assembly Master Mix) at 50.degree. C. for 1 hour. The constructs
were built in E. coli and confirmed by DNA sequencing before
transforming into Bacillus subtilis for secretion and enzymatic
activity assays.
[1162] Secretion of nutritive polypeptides from Bacillus subtilis.
Three separate colonies of B. subtilis expression strains were used
to inoculate 1-ml of 2.times.L-Mal medium (20 g/l NaCl, 20 g/l
tryptone, and 10 g/l yeast extract, 75 g/l maltose) with Cm5, in
deep well blocks (96-square wells). Culture blocks were covered
with porous adhesive plate seals and incubated overnight in a
micro-expression chamber (Glas-Col. Terre Haute, Ind.) at
37.degree. C. and 880 rpm. Overnight cultures were used to
inoculate fresh, 2.times.L-Mal, Cm5 cultures, in deep well blocks,
to a starting OD600=0.1. These expression cultures were incubated
at 37.degree. C., 880 rpm until the OD600=1.0 (approx. 4 hrs) at
which time they were induced by adding isopropyl
p-D-1-thiogalactopyranoside (IPTG) at a final concentration of 0.1
M and continuing incubation for 4 hrs. After 4 hrs, the cell
densities of each culture was measured (OD600) and cells were
harvested by centrifugation (3000 rpm, 10 min, RT). After
centrifugation, culture supernatant was carefully removed and
transferred to a new block and cell pellets were frozen at
-80.degree. C. To determine the levels of secreted protein, the
supernatants were assayed to determine the levels of secreted
protein of interest (POI) by chip electrophoresis. Briefly, samples
were prepared by adding 2 .mu.l of sample to 7 .mu.l sample buffer,
heating at 95 C for 5 minutes, and then adding 35 .mu.l of water.
Analysis was completed using HT Low MW Protein Express LabChip.RTM.
Kit or HT Protein Express LabChip.RTM. Kit (following the
manufacturer's protocol). A protein ladder ran every 12 samples for
molecular weight determination (kDa) and quantification
(ng/.mu.l).
[1163] Amylase Activity Assay.
[1164] SEQID-00407 is an a-amylase in Bacillus subtilis that has
the activity of breaking down polysaccharides, such as starch, into
monosaccharides or disaccharides. To demonstrate that the specific
mutants have removed enzymatic activity, Bacillus subtilis
secreting the enzyme were plated onto agar plates containing
starch. If there is enzymatic activity, the secreted enzyme will
breakdown the starch and upon staining by iodine, there will be a
halo surrounding the Bacillus subtilis colonies. 1% starch plates
were made by combining 25 g Luria Broth-Miller, 10 g starch, 15 g
bacteriological agar, and 1 L water. 10 mM IPTG was added to the
starch plates after the agar has solidified. Single colonies of
Bacillus subtilis strains expressing the mutant polypeptides were
inoculated in 5 ml LB at 37.degree. C. for 4 hours and 50 .mu.l of
the liquid culture were spotted at the center for the starch
plates. After 20 hours of growth and induced secretion, 10% iodine
was added to the starch plates to stain for starch. When the
wild-type enzyme is secreted, it creates a large halo around the
cells. However, when the engineered enzymes are secreted, the halo
reduces in area, similar to the negative control strain, which
expresses the empty vector without the enzyme. Table E37A
quantifies the area of the halos relative to the area of the cells.
It is shown that the difference in area between the halo and the
cells is larger for the wild-type than engineered mutants. From the
data shown, we demonstrated the engineering of secreted nutritive
polypeptide with reduced enzymatic activity.
TABLE-US-00123 TABLE E37A Quantified area of cells, halos, and
their differences measured in in2. Protein Cell Area (in.sup.2)
Halo Area (in.sup.2) Halo/Cell No protein control 0.413 0.6 1.45
Wild-type 1.27 2.246 1.77 E249F sample 1 0.331 0.496 1.50 E249F
sample 2 1.335 1.936 1.45
Example 38
Engineering of Nutritive Polypeptide Amino Acid Content to Modulate
Polypeptide Activity and to Enrich Essential Amino Acid Content
[1165] To demonstrate the engineering of secreted polypeptides for
enriched amino acid content, we chose a microorganism known to
secrete protein at high levels Bacillus subtilis. SEQID-00407 was
identified a major secreted protein in Bacillus subtilis. Using
sequence conservation and crystal structure data for SEQID-00407,
we identified contiguous regions within each protein that were
predicted to be tolerant to mutations without negatively affecting
the structural stability of the protein and/or the ability of the
host organism to secrete the protein.
[1166] We analyzed the secondary structure of SEQID-00407 reported
in the structural protein databank entry 1UA7. We identified 19
loop regions within the sequence of the protein that are not part
of an a-helix or a a-sheet. These loop regions are defined by the
following amino acid residues: 73-76, 130-133, 147-152, 157-161,
189-192, 222-227, 239-244, 283-286, 291-298, 305-308, 318-323,
336-340, 356-360, 365-368, 387-392, 417-421, 428-432, 437-442, and
464-466. Loop regions less than 4 amino acids in length were not
considered for mutation.
[1167] Conservation of sequence over evolutionary space was also
considered for identifying positions amenable for engineering while
maintaining structural stability and secretion competency.
Positions that are less conserved within a family of homologous
sequences are inherently variable and likely more amenable to
mutation without affecting activity, which is intrinsically tied to
structure. To find positions that are less conserved, we downloaded
the alignment of the pfam00128 from the NCBI Conserved Domain
Database, which contains 31 protein sequences including the
SEQID-00407 catalytic domain (Marchler-Bauer A., Zheng C., Chitsaz
F., Derbyshire M. K., Geer L. Y., Geer R. C., Gonzales N. R., Gwadz
M., Hurwitz D. 1., Lanczycki C. J., Lu F., Lu S., Marchler G. H.,
Song J. S., Thanki N., Yamashita R. A., Zhang D., and S. H. Bryant.
Nucleic Acids Res. (2013) 41:D348-52). We also performed a
PSI-BLAST search of the NCBI protein reference sequence database
(Pruitt K. D., Tatusova T., and D. R. Maglott. Nucleic Acids Res.
(2005) 33:D501-504) using SEQID-00407 and obtained 500 sequences
homologous to SEQID-00407. In both cases, a single iteration was
performed using the BLOSUM62 position specific scoring matrix, a
gap penalty of -11, a gap extension penalty of -1, and an alignment
inclusion e-value cutoff of 0.005 (Altschul S. F., Nucleic Acids
Res. (1997) 25:3389-3402). All protein sequence alignments were
used to generate position-specific scoring matrices (PSSM) specific
to each query sequence as part of the PSI-BLAST search. From the
PSSMs, we identified regions predicted to be tolerant to mutation
by counting the number of different amino acids associated with a
positive PSSM score at each position within each loop as well as
the sum and average of the PSSM scores for essential amino acid
substitutions at each position. Furthermore, from the multiple
sequence alignments obtained from each PSI-BLAST search, we
calculated the amino acid entropy at each position, as defined
by
? = ? ##EQU00004## ? indicates text missing or illegible when filed
##EQU00004.2##
where Sj is the entropy at position j and pi is the probability of
observing amino acid i at position j.
[1168] Using these measures of mutation tolerance, we identified
four loop regions expected to be tolerant to mutations into
essential amino acids. To enrich the identified regions in
essential amino acids we used a combinatorial codon library where
any selected position could be either a F, I, L, V, or M (denoted
Z) or a R, K, T, I, or M (denoted X). In each of the loop regions
selected for mutation into an essential amino acid, each variable
position was assigned as a Z or X depending upon its relative
tolerance of hydrophobic residues (based upon their respective PSSM
values). Positions that were tolerant of hydrophobic residues were
assigned as Z and genetically encoded using the codon NTN.
Positions more tolerant of hydrophilic residues were assigned as an
X and genetically encoded using the codon ANR. We note that in one
of the identified variable regions of SEQID-00407 (147-153), a
glycine residue was inserted into the center of the loop in an
attempt to enhance the conformational flexibility of this region.
For SEQID-00407 the sequences of the identified regions are
summarized in Table E38A.
TABLE-US-00124 TABLE E38A Start residue # original degenerate 148
YAAI XXGXX 240 NTSA ZXXZ 291 SHYASD XZYXXZ 389 QPEE XPZZ X = NTN,
codes for F, L, I, M, V Z = ANR, codes for I, M, T, K, R
[1169] Library Design and Construction.
[1170] Based on identification of variable regions, we designed
primers that can amplify each variable region as explained herein.
For example if there are four variable regions, we need four pair
of primers to generate four variable fragments. In step 1 we used
pES1205 as the template which contains SEQID-00407 fused with
N-terminal AmyQ signal peptide and downstream of pirac promoter,
pES1205 is a derivative of the vector, pHT43 (MoBiTec), containing
a 1905-bp DNA fragment encoding the amyE gene from B. subtilis
(minus the initial 93-bp encoding the AmyE signal peptide) plus a
C-terminal 1.times.FLAG tag. The amyE::1XFL:AG sequence is cloned,
in-frame with the SamyQ sequence encoded on pHT43. For fragment 1,
2, 3, 4, the forward PRIMERID-45053, PRIMERID-45054,
PRIMERID-45055, and PRIMERID-45056 contain 25 bases of constant
sequence before the variable region followed by degenerate
sequences to represent the variable region and 25 bases of constant
sequence downstream of the variable region. For fragment 1, 2, 3,
the reverse primers PRIMERID-45061, PRIMERID-45062, and
PRIMERID-45063 contain 25 bases of reverse complementary sequence
upstream of next variable region respectively. For fragment 4, the
reverse primer PRIMERID-45064 contains 25 bases of reverse
complementary sequence at an arbitrary distance from variable
region 4. Four separate PCR amplifications were run using Phusion
DNA polymerase (New England Biolabs, Beverly, Mass.) and reaction
parameters recommended by the manufacturer. As separate reactions,
four wild type fragments, WT-frag-1, WT-frag-2. WT-frag-3 and
WT-frag-4 were generated using PES 1205 as template and primer
pairs PRIMERID-45057 & PRIMERID-45061, PRIMERID-45058 &
PRIMERID-45062, PRIMERID-45059 & PRIMERID-45063, and
PRIMERID-45060 & PRIMERID-45064, respectively. All PCR
fragments were gel purified. In step 2, two separate PCR reactions
were set. The first PCR reaction contain fragment 1 and 2 in
equimolar ratio as template and PRIMERID-45057 and PRIMERID-45062
as primers. The second PCR reaction contain fragment 3 and 4 in
equimolar ratio and PRIMERID-45059 and PRIMERID-45064 as primers.
In both the reactions, respective wild type fragments were added in
a molar ratio of library members present in each variable
fragments. Fragment 5 and 6 are gel purified and used as templates
in equimolar ratio in step 3. The primers used in the PCR reaction
include PRIMERID-45057 and PRIMERID-45064. The vector PCR product
was generated using pES1205 and primer pairs, PRIMERID-45065 and
PRIMERID-45066. Both fragment 7 and vector PCR product were gel
purified and cloned together using the Gibson Assembly Master Mix
(New England Biolabs, Beverly, Mass.) and transformed into the
cloning host E. coli Turbo (New England Biolabs) according to
manufacturer's instructions. 50 colonies were sequenced to
determine the diversity of the library. The colonies on the agar
plate were then suspended in LB media and harvested for plasmid
purification. In a similar fashion, we generated 9 specific
variants of SEQID-00407 which were altered with 9 specific amino
acids, F, L, I, M, V, T, K, R, % at every variable position
identified in the mutant design. Specific variant primers are
denoted by the single letter amino acid abbreviation in the name.
All primers are listed in Table E38B.
TABLE-US-00125 TABLE E38B Primer sequence
GGTCATCAATCATACCACCAGTGATNTNNTNGGCNTNNTNTCCAATGAG
GTTAAGAGTATTCCAAACTGG
CAGTCAATTTTGGCCGAATATCACAANRNTNNTNANRGAGTTCCAATAC GGAGAAATCCTGC
TCGTAATCTGGGCGTGTCGAATATCNTNANRTATNTNNTNANRGTGTCT GCGGACAAGCTAGTGAC
GATTTCACAATGTGATGGCTGGANTNCCTANRANRCTCTCGAACCCGAA TGGAAAC
GGTCATCAATCATACCACCAGTG CAGTCAATTTTGGCCGAATATCAC
TCGTAATCTGGGCGTGTCG GATTTCACAATGTGATGGCTGG
TGTGATATTCGGCCAAAATTGACTG GATATTCGACACGCCAGATTACG
TCCAGCCATCACATTGTGAAATC ATCTGCACGCAAGGTAATCGTCAG
CTGACGATTACCTTGCGTGCAG CACTGGTGGTATGATTGATGACC
GGTCATCAATCATACCACCAGTGATCTTCTGGGCCTTCTGTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATATTATCGGCATTATCTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATGTTGTGGGCGTTGTGTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATTTTTTCGGCTTTTTCTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATTGGTGGGGATGGTGGTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATATGATGGGCATGATGTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATACAACGGGCACAACGTCCAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATTATAAGAAAGGCAAGAAAAATGAG
GTTAAGAGTATTCCAAACTGG
GGTCATCAATCATACCACCAGTGATTATCATCATGGCCATCACAATGAG
GTTAAGAGTATTCCAAACTGG
CAGTCAATTTTGGCCGAATATCACAAAGCTTCTGGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGATTATCGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGGTTGTGGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGTTCTTTGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGTGGTGGGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGATGATGGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGACGACAGGCGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACAAAGAAAGGAGCAGAGTTCCAATAC GGAGAAATCCTGC
CAGTCAATTTTGGCCGAATATCACACATCATGGAGCAGAGTTCCAATAC GGAGAAATCCTGC
TCGTAATCTGGGCGTGTCGAATATCCTTCACTATCTTCTGGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCATTCACTATATCATTGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCGTTCACTATGTTGTGGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCTTCCACTATTTCTTTGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCTGGCACTATTGGTGGGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCATGCACTATATGATGGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCACACACTATACAACGGATGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCTCCAAGTATAAAGCAAAGGTGTCT GCGGACAAGCTAGTGAC
TCGTAATCTGGGCGTGTCGAATATCTCCCATTATCACGCACATGTGTCT GCGGACAAGCTAGTGAC
GATTTCACAATGTGATGGCTGGACTTCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGAATTCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGAGTTCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGATTCCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGATGGCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGAATGCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGAACACCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGAAAGCCTGAGGAACTCTCGAACCCGAA TGGAAAC
GATTTCACAATGTGATGGCTGGACATCCTGAGGAACTCTCGAACCCGAA TGGAAAC
[1171] Bacillus subtilis Strain Construction.
[1172] B. subtilis strain WB800N (MoBiTec, Gottingen, Germany) and
used as the expression host. WB800N is a derivative of a
well-studied strain (B. subtilis 168) and it has been engineered to
reduce protease degradation of secreted proteins by deletion of
genes encoding 8 extracellular proteases (nprE, aprE, epr, hpr,
mpr, nprB. vpr and wprA). B. subtilis transformations were
performed according to the manufacturer's instructions.
Approximately 5 .mu.g of library for SEQID-00407 variant constructs
was transformed into WB800N and single colonies were selected at
37.degree. C. by plating on LB agar containing 5.0 .mu.g/ml
chloramphenicol (Cm5). For 9 specific variants. 1 .mu.g of specific
SEQID-00407 variant was transformed into WB800N and single colonies
were selected at 37.degree. C. by plating on LB agar containing 5.0
.mu.g/ml chloramphenicol (Cm5).
[1173] Bacillus subtilis Library Screening.
[1174] .about.800 individual transformants of the B. subtilis
SEQID-00407 library were used to inoculate individual, 1-ml
cultures of 2.times.-MAL medium (20 .mu.l NaCL 20 g/l tryptone, and
10 g/l yeast extract, 75 g/l maltose) with Cm5, in deep well blocks
(96-square wells). In addition to the library strains, a strain
containing plasmid with AmyE and the SamyQ leader peptide was
inoculated as a positive control and a strain containing plasmid
with no gene of interest was inoculated as negative control.
Culture blocks were covered with porous adhesive plate seals and
incubated overnight in a micro-expression chamber (Glas-Col, Terre
Haute, Ind.) at 37.degree. C. and 880 rpm. Overnight cultures were
used to inoculate fresh, 2.times.-MAL, Cm5 cultures, in deep well
blocks, to a starting OD600=0.1.
[1175] Expression cultures were incubated at 37.degree. C., 880 rpm
until the OD1600=1.0 (approx. 4 hrs) at which time they were
induced by adding isopropyl .beta.-D-1-thiogalactopyranoside (IPTG)
at a final concentration of 1 mM and continuing incubation for 4
hrs. After 4 hrs. the cell densities of each culture was measured
(OD600) and cells were harvested by centrifugation (3000 rpm, 10
min, RT). After centrifugation, culture supernatant was carefully
removed and transferred to a new block and cell pellets were frozen
at -80.degree. C. To determine the levels of secreted protein,
0.5-ml aliquots of the culture supernatants were filtered first
through a 0.45-.mu.m filter followed by a 0.22 .mu.m filter. The
filtrates were then assayed to determine the levels of secreted
protein of interest (POI) by chip electrophoresis system and
compared with the level of secretion of base construct. Briefly,
samples were prepared by adding 2 .mu.l of sample to 7 .mu.l sample
buffer, heating at 95 C for 5 minutes, and then adding 35 .mu.l of
water. Analysis was completed using HT Low MW Protein Express
LabChip.RTM. Kit or HT Protein Express LabChip.RTM. Kit (following
the manufacturer's protocol). A protein ladder ran every 12 samples
for molecular weight determination (kDa) and quantification
(ng/l).
[1176] SEQID-00690 and SEQID-00702 were confirmed by LC/MS/MS of
the gel band of interest. Selected hits were mixed with Invitrogen
LDS Sample Buffer containing 5% (l-mercaptoethanol, boiled and
loaded on a Novex.RTM. NuPAGE.RTM. 10% Bis-Tris gel (Life
Technologies). After running, the gels were stained using
SimplyBlue.TM. SafeStain (Life Technologies) and desired bands were
excised and submitted for analysis. Gel bands were washed, reduced
and alkylated, and then digested with Trypsin for 4 hours followed
by quenching with formic acid. Digests were then analyzed by nano
LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a
ThermoFisher Q Exactive. Peptides were loaded on a trapping column
and eluted over a 75 .mu.m analytical column at 350 nL/min; both
columns were packed with Jupiter Proteo resin (Phenomenex). The
mass spectrometer was operated in data-dependent mode, with MS and
MS/MS performed in the Orbitrap at 70,000 FWHM resolution and
17,500 FWHM resolution, respectively. The fifteen most abundant
ions were selected for MS/MS. The resulting peptide data were
searched using Mascot against the relevant host database with
relevant variant protein sequence appended.
[1177] Diluted overnight cultures were used as inoculum for LB
broth cultures containing Cm5. These cultures were grown at 37 C
until they reached log phase. Aliquots of these cultures were mixed
with glycerol (20% final concentration) and frozen at -80.degree.
C. The top 30 hits are then purified using Instagene matrix
(Biorad, USA) and amplified using CTTGAAATTGGGAACGGGATTC and
GTATAAACTTTTCAGTTGCAGAC, and sequenced using the same primers to
identify the SEQID-00407 variant sequence.
[1178] Bacillus subtilis Secretion Library Analysis.
[1179] All the secreted variants of SEQID-00407 (SEQIDs
45002-45028) were analyzed to determine if there were any position
specific biases in the amino acids present in the secreted
variants, relative to the expected position specific biases present
in the initial genetic library. To this end, an exact binomial test
was performed for each amino acid at each position to determine the
likelihood that the observed number of each amino acid was
significantly (p<0.05) more or less than expected by chance.
Table E38 C shows the p-values of this single tailed test, where
those highlighted elements have p values <0.05. Note that aside
from wild type values, which were all significantly higher than
expected, all other significant different amino acid frequencies
were less than expected. The expected position specific amino acid
biases are shown in Table E38D, and were found by sequencing 47
randomly selected variants after the library had been constructed
and transformed into E. coli. It was assumed that all positions
designed to be an X effectively sampled from the same distribution
of L, 1, V, F, and M codons (i.e., for all X positions, there were
no position specific amino acid biases). As such, the observed
counts of each amino acid were aggregated across positions to
determine the expected amino acid likelihoods for all X positions.
A similar assumption was made for all positions designed to be a Z.
As can be seen in Table E38 C, in addition to the strong bias
toward the wild type sequence at each position, there are a number
of different amino acids that were observed significantly less than
expected, indicating a bias away from those amino acids at that
position in the secreted library. This data provides additional
information for the design of specific, rationally designed
variants with specific mutations at each position. As an example,
to enrich a secreted variant in leucine, positions 241 and 291 may
be less desired choices. Alternatively, to enrich a secreted
variant in valine, positions 149, 241, 242, 291, 294, 295, and 389
may be less desired choices.
TABLE-US-00126 TABLE E38C Single tailed binomial test p-values
assessing position specific amino acid biases in secreted variants
of SEQID-450001 ##STR00001##
TABLE-US-00127 TABLE E38D Position specific, expected amino acid
likelihoods in the constructed SEQID-450001 library X Z L 30.2% --
I 12.3% 9.7% V 36.4% -- F 6.7% -- M 10.7% 12.2% T -- 18.3% K --
17.9% R -- 36.2% Wt 3.7% 5.7%
[1180] Bacillus subtilis Expression Testing of Specific
Variants.
[1181] Three separate colonies of B. subtilis expression strains
were used to inoculate 1-ml of 2.times.-MAL medium (20 g/l NaCl, 20
g/l tryptone, and 10 g/l yeast extract, 75 g/l maltose) with Cm5,
in deep well blocks (96-square wells). Culture blocks were covered
with porous adhesive plate seals and incubated overnight in a
micro-expression chamber (Glas-Col, Terre Haute, Ind.) at
37.degree. C. and 880 rpm. Overnight cultures were used to
inoculate fresh, 2.times.-MAL, Cm5 cultures, in deep well blocks,
to a starting OD600=0.1. These expression cultures were incubated
at 37.degree. C., 880 rpm until the OD600=1.0 (approx. 4 hrs) at
which time they were induced by adding isopropyl
.beta.-D-1-thiogalactopyranoside (IPTG) at a final concentration of
0.1 M and continuing incubation for 4 hrs. After 4 hrs, the cell
densities of each culture was measured (OD600) and cells were
harvested by centrifugation (3000 rpm, 10 min, RT). After
centrifugation, culture supernatant was carefully removed and
transferred to a new block and cell pellets were frozen at
-80.degree. C. To determine the levels of secreted protein. 0.5-ml
aliquots of the culture supernatants were filtered first through a
0.45-.mu.m filter followed by a 0.22 .mu.m filter. The filtrates
were then assayed to determine the levels of secreted protein of
interest (POI) by chip electrophoresis. Briefly, samples were
prepared by adding 2 .mu.l of sample to 7 .mu.l sample buffer,
heating at 95 C for 5 minutes, and then adding 35 .mu.l of water.
Analysis was completed using HT Low MW Protein Express LabChip.RTM.
Kit or HT Protein Express LabChip.RTM. Kit (following the
manufacturer's protocol). A protein ladder ran every 12 samples for
molecular weight determination (kDa) and quantification
(ng/.mu.l).
[1182] SEQID-45025, SEQID-45026, SEQID-45027, and SEQID-45028 were
confirmed by LC/MS/MS of the gel band of interest. Selected hits
were mixed with Invitrogen LDS Sample Buffer containing 5%
0-mercaptoethanol, boiled and loaded on a Novex.RTM.% NuPAGE.RTM.
10% Bis-Tris gel (Life Technologies). After running, the gels were
stained using SimplyBlue.TM. SafeStain (Life Technologies) and
desired bands were excised and submitted for analysis. Gel bands
were washed, reduced and alkylated, and then digested with Trypsin
for 4 hours followed by quenching with formic acid. Digests were
then analyzed by nano LC/MS/MS with a Waters NanoAcquity HPLC
system interfaced to a ThermoFisher Q Exactive. Peptides were
loaded on a trapping column and eluted over a 75 .mu.m analytical
column at 350 nL/min; both columns were packed with Jupiter Proteo
resin (Phenomenex). The mass spectrometer was operated in
data-dependent mode, with MS and MS/MS performed in the Orbitrap at
70,000 FWHM resolution and 17,500 FWHM resolution, respectively.
The fifteen most abundant ions were selected for MS/MS. The
resulting peptide data were searched using Mascot against the
relevant host database with relevant variant protein sequence
appended.
[1183] Amylase Activity Assay for Engineered Polypeptides.
[1184] One of the engineered polypeptides were tested to
demonstrate enzymatic activity. SEQID-00407 is an a-amylase in
Bacillus subtilis that has the activity of breaking down
polysaccharides, such as starch, into monosaccharides or
disaccharides. To demonstrate that the SEQID-00690 has retained
enzymatic activity, Bacillus subtilis secreting the enzyme were
plated onto agar plates containing starch. If there is enzymatic
activity, the secreted enzyme will breakdown the starch and upon
staining by iodine, there will be a halo surrounding the Bacillus
subtilis colonies. 1% starch plates were made by combining 25 g
Luria Broth-Miller, 10 g starch, 15 g bacteriological agar, and 1 L
water. 10 mM IPTG was added to the starch plates after the agar has
solidified. Single colonies of Bacillus subtilis strains expressing
the mutant polypeptides were inoculated in 5 ml LB at 370(for 4
hours and 50 .mu.l of the liquid culture were spotted at the center
for the starch plates. After 20 hours of growth and induced
secretion, 10% iodine was added to the starch plates to stain for
starch. When SEQID-00690 was plated on the starch plates, the
enzyme is secreted abd creates a large halo around the cells,
similar to wild-type strain, and much larger than the negative
control strain, which expresses the empty vector without the
enzyme. Table E38E quantifies the area of the halos relative to the
area of the cells. From the data shown, we demonstrated the
engineering of secreted nutritive polypeptide enriched in essential
amino acids which retains enzymatic activity.
TABLE-US-00128 TABLE E38E Quantified area of cells, halos, and
their differences measured in in2. Protein Cell Area (in.sup.2)
Halo Area (in.sup.2) Halo/Cell No protein control 0.413 0.600 1.45
Wild-type 1.270 2.246 1.77 SEQID-00690 0.469 1.234 2.63
Example 39
Determination of Muscle Protein Fractional Synthesis Rate in Human
Subjects Following Oral Consumption of Leucine-Enriched Nutritive
Polypeptides
[1185] Oral ingestion of leucine or leucine-containing proteins
stimulates muscle protein synthesis (Layman & Walker, 2006, The
Journal of nutrition: 136: 319-323). Many of the leucine-enriched
nutritive polypeptides described herein are highly water soluble
and readily digested and absorbed in human subjects. The
pharmacokinetics of amino acids as delivered via nutritive
polypeptides and their effect on muscle protein synthesis are
described here.
[1186] Effects of the leucine-enriched nutritive polypeptides on
muscle protein synthesis were measured in apparently healthy
subjects. Twelve (12) apparently healthy subjects (average height:
1.7 m, weight: 78.5 kg, age: 56.2, and BMI: 26.8) between the ages
of 50 and 70 were randomly assigned in a single-blinded manner to a
sequence of treatments. One group of six received formulations of
SEQID-105 and 90% whey protein isolate (WPI) control, and the other
group received SEQID-363 and 90% whey protein isolate control. The
treatments were staggered such that each individual received 35
grams of each nutritive polypeptide formulation on separate days
(2-3 days apart) to allow for washout of the initial formulation.
Each subject served as their own control in the within-subject
cross-over comparison.
[1187] Subjects were excluded from the study if they met any of the
following exclusion criteria: History of diabetes. History of
malignancy in the previous 6 months. Prior gastrointestinal bypass
surgery (Lapband, etc.). Chronic inflammatory condition or disease
(Lupus, HIV/AIDS, etc.). Known sensitivity or allergy to whey
protein, mold spores or fungi. Do not refrain from eating animal
proteins during their participation in this study. Cannot refrain
from consuming protein or amino acid supplements during their
participation in this study. Cannot refrain from resistance
training during the study period. Currently participating in
another research study with an investigational product. Hemoglobin
less than 9.5 mg/dl at the screening visit. Concomitant use of
corticosteroids or testosterone replacement therapy (ingestion,
injection, or transdermal). Any other diseases or conditions that
would place the subject at increased risk of harm if they were to
participate, at the discretion of the medical staff.
[1188] All subjects were asked to maintain their current dietary
habits, maintain their activities of daily living, and to not
participate in any resistance exercise during the study.
[1189] The anabolic effect of each nutritive formulation was
measured using the fractional rate of muscle protein synthesis
(FSR) (Smith, Villareal, & Mittendorfer, 2007, American journal
of physiology--Endocrinology and metabolism: 293: E666-E671).
Research procedures included venous blood draws and vastus
lateralis muscle biopsies during a primed, constant infusion of
L-[ring-d5]-phenylalanine (Cambridge Isotope Laboratories,
Tewksbury, Mass.). The fractional rate of muscle protein synthesis
(FSR) was measured by muscle biopsies during a primed, constant
infusion of L-[ring-d5]-phenylalanine. Specifically, the fractional
rate of muscle protein synthesis (FSR) was measured in fasted human
subjects after an overnight fast (>8 hrs) using the stable
isotope tracer incorporation technique from vastus lateralis muscle
biopsies performed 2, 4, and 7 hrs after initiating stable isotope
tracer infusion. Blood samples were also collected at specified
time points after the beginning of stable isotope tracer infusion
(i.e. 2, 3, 4, 4+30, 5, 5+30, 6, 6+30, and 7 hrs) to assess changes
in amino acid concentrations.
[1190] For each subject, on the morning of the study and after an
overnight fast (8 hrs), an 18-22 gauge polyethylene catheter was
inserted into each arm. One catheter was inserted into a distal
vein for heated blood sampling to obtain a background blood sample
(5 ml), and another into the forearm for infusion of the stable
isotope tracers. After insertion of peripheral catheters, a primed
(5.04 .mu.mol/kg), constant (0.084 .mu.mol/kg/min) infusion of the
stable isotope (GRAS substance) ring-d5-phenylalanine was started.
Stable isotopes were obtained from Cambridge Isotope Laboratories
(Tewksbury, Mass.) and were tested for sterility and pyrogenicity
(by CIL and the preparing pharmacy--PharmaCare). Prior to infusion,
the tracer was reconstituted with sterile saline. The stable
isotope was filtered during infusion through a sterile 0.22 micron
(Millipore) filter placed in the infusion line.
[1191] Blood samples (5 ml) were collected in serum separator tubes
at specified time points after the beginning of isotope infusion
(2, 3, 4, 4+30, 5, 5+30, 6, 6+30, and 7 hrs). About 60 ml of blood
was drawn during the entire study, and this volume was replaced
with saline infused with a stable isotope tracer.
[1192] Muscle biopsies from the vastus lateralis were performed at
2, 4, and 7 hrs of tracer infusion. After the biopsy at 4 hr, the
nutritive protein formulation was administered orally. All muscle
biopsies were performed under local anesthesia (using sterile 1%
lidocaine, without epinephrine) for normal pain management and
strict sterile procedures. Prior to each muscle biopsy, skin was
cleaned using a sterile skin preparation kit Betadine), and the
skin and tissue below was injected with local anesthetic
(Lidocaine) to minimize pain.
[1193] Through a small incision (about 1 cm), a 5 mm Bergstrom
needle "0" was advanced into the muscle and suction applied. A
piece of the muscle was then removed with the needle (approximately
50-100 mg). The skin was then cleansed, edges approximated with 1/4
inch.times.1.5 inch adhesive Steri-strips, and a transparent,
breathable film dressing (Tegaderm) was applied to the site. Firm
pressure was maintained until bleeding at the site ceased. To
minimize the risk of infection and bruising, an antibiotic ointment
and pressure dressing (with self-adhesive elastic bandage) was
applied, respectively, by the medical staff before the subject was
released.
[1194] FSR, measured in (%/hr), was calculated as follows:
FSR = [ E P 1 - E P 2 E m ] * 1 t * 60 * 100 , ##EQU00005##
[1195] where enrichments (EP1, EP2, and Em) are expressed as mole
percent excess (MPE) and calculated as the ratio of labeled
phenylalanine tracer to unlabeled phenylalanine tracee (TTR), once
the tracer concentration has plateaued. EP1 and EP2 are the
enrichments of bound ring-2H5-phenylalanine in the first and second
biopsies (or second and third), respectively, and Em is the mean
value of the enrichments of ring-2H5-phenylalanine in the
intracellular pool. "t" is the time in minutes elapsed between 1st
and 2nd muscle biopsy in min (or between the second and third).
Constant conversion factors of 60 min/hr and 100 were used to
express FSR in percent per hour. Outcome variables (muscle protein
synthesis and blood amino acid concentrations) were analyzed via
paired t-tests. Statistical significance was established a priori
at P<0.05 and trends were accepted as 0.051<P<0.10.
[1196] Tables E39A-C show the calculated FSR data for each subject
before and after an acute, oral dose of each nutritive protein
formulation, and FIG. 56 shows the change in average FSR. The data
shown is the mean+/-standard error of the mean. Note that the
fasted FSR value from subject 3 in the WPI group had a very
elevated FSR, inconsistent with normal fasted values, with a
z-value of 2.85. A two-tailed grubbs' outlier test indicated that
it was a significant (p<0.05) outlier and it was removed when
calculating the mean and standard error as shown in FIG. 56.
TABLE-US-00129 TABLE E39A Subject WPI FSR (hr.sup.-1) ID Fasted Fed
1 0.00023651 0.00072108 2 0.00041336 0.00037967 3 0.00168551
0.00022099 4 0.00032137 0.00112458 5 0.00064807 0.0005574 6
0.00078224 0.00133908 7 0.00029799 0.00058582 8 0.00063563
0.0007537 9 0.00043453 0.000653 10 0.0006604 0.00088189 11
0.00056282 0.00067366 12 0.00040945 0.00070602
TABLE-US-00130 TABLE E39B Subject SEQID-363 FSR (hr.sup.-1) ID
Fasted Fed 1 0.00040882 0.00106664 2 0.00090652 0.00040036 3
0.00040061 0.00094592 4 0.00078852 0.00082819 5 0.00057147
0.00038021 6 0.00054359 0.00047435
TABLE-US-00131 TABLE E39C Subject SEQID-105 FSR (hr.sup.-1) ID
Fasted Fed 7 0.00037724 0.00090154 8 0.00041119 0.00047965 9
0.00043875 0.00075389 10 0.00039112 0.00032007 11 0.00049953
0.00088001 12 0.00022427 0.00085157
[1197] Paired t-tests comparing the fasted and fed response of each
group indicate that the fed response in the WPI treated subjects is
significantly different from the fasted response when subject 3 is
removed. (p=0.007), consistent with previous studies examining the
FSR response to WPI (Paddon-Jones, D., Sheffield-Moore, M.,
Katsanos C. S., Xiao-Jun Z., Wolfe. R. R. Differential stimulation
of muscle protein synthesis in elderly humans following isocaloric
ingestion in amino acids or whey protein. Exp. Gerontol. (2006) 41:
215-219). If subject three is included, the difference loses
significance (p=0.45). The fasted and fed FSR response in the
SEQID-105 fed group are significantly different (p=0.04), but the
fasted and fed FSR response in the SEQID-363 fed group are not
significantly different (p=0.68).
Example 40
Oral Pharmacokinetics of Formulations Containing Nutritive
Polypeptides
[1198] The anabolic response to protein ingestion is predicated on
the delivery of essential amino acids. The purpose of this study
was to examine the changes in plasma amino acid concentrations in
response to various proteins over a period of 240 minutes. Four
apparently healthy subjects between the ages of 18 and 50 were
randomly assigned in a double-blinded manner to a sequence of
treatments, receiving 20 grams of either whey protein isolate or
SEQID-105 orally, in a volume of 170 ml. Subjects were fasted
overnight (>8 hrs) before oral pharmacokinetic study. Venous
blood samples were collected at specified time points (i.e. 0, 15,
30, 60, 90, 120, 150, 180, 210 and 240 minutes) following the oral
ingestion of nutritive polypeptide to assess changes in plasma
amino acid concentrations. Plasma amino acid concentrations were
quantified by Quest Diagnostics or Laboratory Corporation of
America.
[1199] FIGS. 57-60 show the plasma time course of each measured
amino acid and the aggregate groups, essential amino acids (EAA),
branched chain amino acids (BCAA), and total amino acids (TAA), for
WPI and SEQID-105.
[1200] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for
WPI, these data indicate that there are significant differences
across time for Asn, lie, Leu, Lys. Met, Phe, Pro, Trp, Tyr, EAA.
BCAA, and TAA (p<0.05).
[1201] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for a
nutritive formulation of SEQID-105, these data indicate that there
are significant differences across time for Arg, Asn, Asp, Glu,
Gly, His, Ile, Leu, Lys, Met, Phe, Ser, Tyr, Val, EAA, BCAA, and
TAA (p<0.05).
[1202] FIGS. 61-63 show the integrated area under the curve (AUC)
of each measured amino acid as well as the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA), for WPI and SEQID-105.
[1203] Using a t-test to compare the AUCs of each amino acid or
amino acid group between WPI and SEQID-105, there are significant
differences in the Asp (p=0.01), His (p=0.04), Leu (0.023). Met
(0.002), Phe (0.04). Pro (p<0.01), Ser (p=0.03), and Trp
(p=0.002) responses.
[1204] In another study, a 35 gram dose of SEQID-105 and WPI was
given orally in 100 ml and 1151 ml, respectively, to six,
apparently healthy subjects between the ages of 18 and 50. FIGS.
64-67 show the plasma time course of each measured amino acid and
the aggregate groups, essential amino acids (EAA), branched chain
amino acids (BCAA), and total amino acids (TAA), for WPI and
SEQID-105.
[1205] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for
WPI, these data indicate that there are significant differences
across time for Arg, Asn, Asp, Gln, Ile, Leu, Lys, Met, Phe, Pro,
Ser, Thr, Trp, Tyr, Val, EAA, BCAA, and TAA (p<0.05).
[1206] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for a
nutritive formulation of SEQID-105, these data indicate that them
are significant differences across time for
[1207] Arg, Asn, Asp, Glu, His, Ile, Ley, Lys, Met, Phe, Ser, Thr,
Trp, Val EAA, BCAA, and TAA (p<0.05).
[1208] FIGS. 68-70 show the integrated area under the curve (AUC)
of each measured amino acid as well as the aggregate groups,
essential amino acids (EAA), branched chain amino acids (BCAA), and
total amino acids (TAA), for WPI and SEQID-105 dosed at 35 g.
[1209] Using a two-tailed, unequal variance t-test to compare the
AUCs of each amino acid or amino acid group between WPI and
SEQID-105, there are significant differences in the Asn (p=0.006),
His (p=0.01), Ile (p=0.03), Lys (p=0.02), Met (p<0.001), Phe
(p<0.001), Pro (p=0.002), Ser (p=0.005), Thr (p=0.004), Trp
(p<0.001), Tyr (p=0.003), and Val (p=0.012) responses.
[1210] In another study examining the pharmacokinetics of amino
acid delivery via nutritive polypeptides, three apparently healthy
subjects between the ages of 18 and 50 were randomly assigned in a
double-blinded manner to a sequence of treatments, receiving 20
grams of either whey protein isolate or SEQID-363 orally. Subjects
were fasted overnight (>8 hrs) before oral pharmacokinetic
study. Venous blood samples were collected at specified time points
(i.e. 0, 15, 30, 60, 90, 120, 150, 180, 210 and 240 minutes)
following the oral ingestion of nutritive polypeptide to assess
changes in plasma amino acid concentrations. Plasma amino acid
concentrations were quantified by Quest Diagnostics or Laboratory
Corporation of America.
[1211] FIGS. 71-74 show the plasma time course of each measured
amino acid and the aggregate groups, essential amino acids (EAA),
branched chain amino acids (BCAA), and total amino acids (TAA), for
WPI and SEQID-363.
[1212] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for
WPI, these data indicate that there are significant differences
across time for Gin, Ile. Leu, Lys, Phe, Ser, Tyr, Val, EAA, BCAA,
and TAA (pr<0.05).
[1213] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for
SEQID-363, these data indicate that there are no significant
differences across time (p<0.05).
Example 41
Chronic Treatment of Sarcopenia and Loss of Physical Function in
Elderly Frail Subjects Using Nutritive Polypeptides
[1214] Supplementation of leucine or leucine-containing proteins
improve muscle mass build-up after exercise and maintain skeletal
muscle mass during long-term disuse (Layman & Walker, 2006, The
Journal of nutrition: 136: 319-323). Nutritive polypeptides
enriched in leucine and essential amino acids are described herein.
Elderly, frail subjects are randomly assigned in a double blind
manner to a specific treatment group: a control group receiving an
isocaloric control or one of 3 dose ranging treatment arm receiving
3 times daily a dose of 15, 30, or 40 grams of a nutritive
polypeptide formulation for 30 days. Enrolled subjects are provided
with a control diet based upon individual's body mass index (BMI)
and physical activities throughout the trial period. Food and
calorie intakes are recorded. Enrolled subjects maintain their
regular daily activities. Daily physical activities and calorie
consumption are measured by a physical activity tracker (FitBit
Flex wrist band). Lean body mass is measured by MRI (Miller. M. J.,
et al. "Assessment and definition of lean body mass deficiency in
the elderly." European journal of clinical nutrition (2014)) or
dual-energy X-ray absorptiometry (DEXA; Nielsen, Palle Kjrerulff,
Jorgen Ladefoged, and Klaus Olgaard. "Lean body mass by Dual Energy
X-ray Absorptiometry (DEXA) and by urine and dialysate creatinine
recovery in CAPD and pre-dialysis patients compared to normal
subjects." Adv Perit Dial 10 (1994): 99-103.) on day 1 (prior to
nutritive polypeptide dosing) and day 31 after treatment has
concluded to assess the change of skeletal muscle mass. Physical
function is also assessed at the start and end of the treatment
period using the short physical performance battery score (Volpato,
Stefano, et al. "Predictive value of the Short Physical Performance
Battery following hospitalization in older patients." The Journals
of Gerontology Series A: Biological Sciences and Medical Sciences
66.1 (2011): 89-96.), measures of gait speed. 6 minute walk test
(6MWT), and the timed up and go test (TUGS; Podsiadlo, D;
Richardson, S. "The timed `Up & Go`: A test of basic functional
mobility for frail elderly persons". Journal of the American
Geriatrics Society (1991) 39: 142-8). The absolute and percent
change in lean body mass as well as SPPB score, gait speed, 6MWT,
and TUGS, from baseline is compared across treatment arms and
relative to control to assess treatment efficacy.
Example 42
Oral Pharmacokinetics of Formulations Containing Nutritive
Polypeptides Deficient in Methionine
[1215] The purpose of this study was to examine the changes in
plasma amino acid concentrations in response to a methionine
deficient nutritive protein over a period of 240 minutes. Four
apparently healthy subjects between the ages of 18 and 50 were
randomly assigned in a double-blinded manner to a sequence of
treatments, receiving 20 grams of SEQID-426 orally, in a volume of
170 ml. Subjects were fasted overnight (>8 hrs), and the
following morning venous blood samples were collected at specified
time points (i.e. 0, 15, 30, 60, 90, 120, 150, 180, 210 and 240
minutes) after the oral ingestion of nutritive polypeptide to
assess changes in plasma amino acid concentrations. Plasma amino
acid concentrations were quantified by Quest Diagnostics or
Laboratory Corporation of America.
[1216] FIGS. 75-78 show the plasma time course of each measured
amino acid and the aggregate groups, essential amino acids (EAA),
branched chain amino acids (BCAA), and total amino acids (TAA), for
SEQID-426.
[1217] Using a 1-way ANOVA test to assess significant differences
in plasma amino acid levels across the time points measured, for
SEQID-426, these data indicate that there are significant
differences across time for Glu and EAA (p<0.05). A Dunnett
multiple comparison test examining the plasma EAA time course
further indicates that the plasma EAA levels at the 30 and 60 min.
time points are significantly different from the basal levels at
time 0 min. Methionine shows no significant change over time.
Example 43
Selection of Nutritive Polypeptides for Increasing Renal Function
and Treatment and Prevention of Renal Diseases
[1218] Nutritive polypeptides are selected from a database of
edible proteins as described herein. As a result of inadequate
metabolic and nutritional status high mortality and morbidity rates
remain prevalent in patients suffering from chronic kidney disease
(CKD, particularly in those with end-stage renal disease (ESRD)
receiving dialysis. This altered status, deemed protein energy
wasting (PEW), can be caused by inadequate dietary protein intake
and utilization and has a significant effect on patient mortality
rate. Dialysis depletes the body of amino acids and the compromised
kidneys alter amino acid homeostasis in the human body. PEW can
result in loss of muscle and protein stores compounding the effects
of renal disease. Nutritive polypeptide compositions are useful for
treatment of renal diseases. Also, CKD patients are known to have
abnormal amino acid profiles in serum, in particular, essential
amino acids (EAAs) and branched chain amino acids (BCAAs). Kim et.
al. report lower serum BCAAs levels in ESRD dialysis patients
compared to a control group. More specifically, lower levels of
serine, tyrosine and lysine as well as the BCAAs-valine, leucine
and isoleucine have been reported (Kim. D. H. Kor. Journ. Int. Med.
1998, 13(1): 33-40). Therefore. BCAA-enriched nutritive
polypeptides and/or EAA-enriched nutritive polypeptides are of
particular utility for patients with CKD.
[1219] Supplementation of BCAAs in the diet can improve the
nutritional status and appetite of dialysis patients. (Hiroshige,
K. Nephr. Dial. Transplant. 2001, 16:1856-62). Levels of BCAAs were
normalized by 12 g/day oral supplements. Nutritive polypeptides
high in BCAAs are an effective treatment for patients compromised
by renal disease. PEW can be remedied by restoring the specific
amino acids lost by dialysis and diminished metabolic function by
nutritive polypeptide administration while diminishing stress on an
already compromised patient. A nutritive polypeptide selected for
improving the status of ESRD patients, particularly those with PEW,
delivers optimal combinations of amino acids at a beneficial
quantity. Specifically, a nutritive polypeptide high in BCAAs
satisfies these requirements. The nutritive polypeptide optionally
is low in glutamine and glutamic acid content, since patients with
renal disease do not efficiently excrete ammonia, a by-product of
glutamic acid and glutamine metabolism. Accumulation of ammonia in
the blood, also known as hyperammonemia, is a dangerous condition
that may lead to death (Sacks, G. S. Ann. Pharmacol. 1999,
33:348-354).
[1220] Uremic toxicity, where excess nitrogenous waste products
exist in circulation often occurs in CKD and, must be monitored.
CKD patients are sometimes placed on a low protein diet to prevent
uremic toxicity. Urea, the main nitrogenous metabolite from
ingestion of protein, may or may not be toxic alone, and can serve
as an indicator of accumulation of other toxins as a consequence of
altered renal function. Thus, a nutritive polypeptide is able to
deliver amino acids optimally to meet a subject's nutritional needs
while diminishing risks of these side effects. A high BCAA protein
satisfies these requirements. Where some ESRD patients are placed
on a low protein diet, dialysis patients are placed on a high
protein diet due to loss of amino acids that occur during the
dialysis process. Hyperphosphatemia is a complication of a poorly
optimized high protein diet, where high phosphorous levels from
food can become toxic in individuals with CKD (Mandayam, S.
Nephrology. 2006, 11:53-57). Even mild increases in serum
phosphorous levels increased mortality rates in CKD patients
(Kestenbaum, B. J Am. Soc. Nephrol. 2005, 16: 520-28). A nutritive
polypeptide is advantageous in CKD, as it counteracts the loss of
amino acids, while sparing the kidneys of extraneous dietary
phosphorous.
[1221] An exemplary list of nutritive polypeptides from the edible
database described herein useful for treatment of renal disease are
summarized in Table E43A. These are high in BCAA content and
optionally low in glutamine and glutamic acid content.
TABLE-US-00132 TABLE E43A SEQID EAA BCAA Q E SEQID-03580 0.55 0.24
0.00 0.00 SEQID-03636 0.65 0.24 0.00 0.00 SEQID-03629 0.56 0.31
0.06 0.04 SEQID-03441 0.57 0.29 0.02 0.06 SEQID-03620 0.54 0.28
0.04 0.03 SEQID-03468 0.62 0.25 0.00 0.04 SEQID-03553 0.47 0.27
0.00 0.06 SEQID-03535 0.54 0.28 0.04 0.03 SEQID-03476 0.50 0.25
0.04 0.00 SEQID-03582 0.54 0.23 0.02 0.00
TABLE-US-00133 TABLE E43B SEQID EAA BCAA Q E SEQID-00162 0.64 0.53
0.02 0.02 SEQID-00134 0.58 0.46 0.00 0.02 SEQID-00169 0.60 0.43
0.02 0.02 SEQID-00166 0.65 0.46 0.03 0.03 SEQID-00561 0.68 0.36
0.02 0.03 SEQID-00175 0.63 0.38 0.02 0.04 SEQID-00137 0.64 0.39
0.00 0.07 SEQID-00132 0.60 0.41 0.02 0.07 SEQID-00195 0.52 0.36
0.00 0.07 SEQID-00194 0.54 0.36 0.00 0.07
Example 44
Effect of Amino Acids and Nutritive Polypeptides on Renal Fibrosis
In Vitro
[1222] Efficacy of high-BCAA nutritive polypeptides is demonstrated
by using an in vitro assay modeling kidney disease, which utilizes
the pericyte to myofibroblast transition that occurs during kidney
fibrosis. Fibrosis reflects pathology observed in end-stage renal
failure. Myofibroblast formation is studied by quantitative
polymerase chain reaction (qPCR) and Western Blot (WB) in cultured
kidney cells (Wu, C. F. Am. Journ. Path. 2013, 182(1): 118-31).
Normal kidney pericytes are incubated with TGF-.beta.1 to induce
the transition to myofibroblasts and a-smooth muscle actin
(.alpha.-SMA) is used as a marker of myofibroblast differentiation.
Incorporation of nutritive polypeptides into the assay as digests
or free amino acid blends is the sole amino acid source in amino
acid-free serum in cell culture as opposed to 20% fetal bovine
serum. (Kuncio, G. S. Kidn. Int. 1991, 39:550-556).
Example 45
Treatment of Chronic Kidney Disease with Nutritive Polypeptides in
Rodents
[1223] Efficacy of high-BCAA nutritive polypeptides is demonstrated
using a rat model of renal disease by 5/6 nephrectomy (Gao, X.
Kidney Int. 2011, 79(9): 978-996. Nutritive polypeptides high in
BCAAs and optionally low in glutamine and glutamic acid are orally
administered to supplement a low-protein diet or a protein-free
diet using low-protein and high-protein diet controls. Body weight,
blood urea levels and renal lesions are measured to demonstrate
improved parameters compared to the controls.
Example 46
Treatment of Chronic Kidney Disease with Nutritive Polypeptides in
Humans
[1224] A nutritive polypeptide high in BCAAs and low in glutamate
and glutamine is selected and orally dosed to humans for
improvement of symptoms resulting from ESRD. By administering a
nutritive polypeptide for 2, 3, 4, 5 or 6 months or control and
measuring parameters such as dry body weight, body mass index, body
fat percentage, lean body mass, dietary protein intake, dietary
caloric intake and plasma levels of urea, ammonia, phosphorous,
albumin and BCAAs, nutritive polypeptides efficacy are assessed. A
nutritive polypeptide for nutritional support is beneficial as
concern exists for stress on the kidney by supply of excess
protein.
Example 47
Selection of Nutritive Polypeptides for the Treatment of Urea Cycle
Disorders
[1225] Urea cycle disorder (UCD) patients are treated or symptoms
prevented by administration of nutritive polypeptides. The urea
cycle is the main nitrogenous waste disposal pathway in humans. UCD
is a hereditary disorder caused by deficiency of one or more
enzymes in the cycle, ultimately resulting in hyperammonemia. UCD
patients present low BCAA serum levels. (Boneh. A. Mol. Genet.
Metab. 2014. S1096-7192). Disruption of the normal urea cycle
causes diminished synthesis of arginine, normally a nonessential
amino acid (Leonard, J. V. Journ. Pediatrics. 2001, 138(1):S40-45).
Arginine plays a major role in the urea cycle. The synthetic
pathway of arginine interacts closely with urea cycle enzymes in
the liver and kidneys and is made from ornithine via citrulline
(Barbul A. J Parenter Enteral Nutr. 1986, 10: 227-238). Citrulline
and ornithine have been supplemented in UCD patients; however, they
are not found in natural proteins and are not present in nutritive
polypeptides. A nutritive polypeptide indicated for urea cycle
disorders contains high levels of BCAAs and arginine.
Supplementation of glutamine and glutamic acid produces the
nitrogenous waste product ammonia, so a nutritive polypeptide
useful for UCD is generally low in these amino acids. A nutritive
polypeptide provides an optimized therapy for UCD patients, as it
can deliver essential amino acids such as the BCAAs, as well as
arginine, without delivering excess amino acids.
[1226] An exemplary list of nutritive polypeptides from the edible
database useful for the treatment of urea cycle disorders are
summarized in Table E47A. These are high in BCAA and arginine
content and low in glutamine and glutamic acid content.
TABLE-US-00134 TABLE E47A SEQID EAA BCAA Q R E SEQID-03551 0.48
0.16 0.02 0.36 0.00 SEQID-03554 0.43 0.24 0.04 0.25 0.01
SEQID-03568 0.44 0.23 0.04 0.26 0.01 SEQID-03434 0.43 0.21 0.04
0.27 0.01 SEQID-03468 0.62 0.25 0.00 0.21 0.04 SEQID-03560 0.43
0.23 0.04 0.24 0.01 SEQID-03578 0.37 0.19 0.06 0.35 0.03
SEQID-03593 0.39 0.19 0.06 0.34 0.03 SEQID-03435 0.40 0.22 0.06
0.32 0.03 SEQID-03582 0.54 0.23 0.02 0.18 0.00
[1227] An exemplary list of nutritive polypeptides from the
expressed database described herein useful for the treatment of
renal disease are summarized in table E47B.
TABLE-US-00135 TABLE E47B SEQID EAA BCAA Q R E SEQID-00134 0.58
0.46 0.00 0.06 0.02 SEQID-00162 0.64 0.53 0.02 0.00 0.02
SEQID-00166 0.65 0.46 0.03 0.04 0.03 SEQID-00169 0.60 0.43 0.02
0.00 0.02 SEQID-00636 0.47 0.23 0.02 0.22 0.04 SEQID-00195 0.52
0.36 0.00 0.08 0.07 SEQID-00194 0.54 0.36 0.00 0.08 0.07
SEQID-00540 0.41 0.21 0.03 0.23 0.05 SEQID-00132 0.60 0.41 0.02
0.05 0.07 SEQID-00043 0.57 0.41 0.02 0.08 0.09
Example 48
Effect of Amino Acids and Nutritive Polypeptides on Urea Cycle
Disorders In Vitro
[1228] Efficacy of high-BCAA nutritive polypeptides for UCD is
demonstrated by using an in vitro liver model of UCD assessing
viability of murine-derived embryonic stem cells. Ornithine has
been shown to increase cell viability (Tamai, M. Amino Acids.
2013.45:1343-1351). Briefly, hepatocytes derived from mice are
cultured. Nutritive polypeptides as digests or blends of free amino
acids in the cell culture medium protected the cells against
NH.sub.4+ induced hepatocyte death. This is due to enhanced
enzymatic conversion of ammonium to urea in the urea cycle. Urea
was quantified in the media by a QuantiChrom.TM. Urea Assay Kit
(BioAssay Systems, CA) and ammonia quantified by Ammonia Test Wako
(Wako, Osaka, Japan). Cell viability was measured by a Cell
Counting Kit (Dijindo Laboratories Kumamoto, Japan). A nutritive
polypeptide intended for UCD therapy is supplemented against an
L-ornithine control and cell viability and urea and ammonia
concentrations quantified.
Example 49
Treatment of Urea Cycle Disorders with Nutritive Polypeptides in
Rodents
[1229] Efficacy of high-BCAA nutritive polypeptides for UCD is
demonstrated by using a mouse gene knockout study. DeMars et. al.
describe a mutation that reduces activity of the urea cycle enzyme
ornithine transcarbamylase--a common deficiency in UCD patients
(DeMars, R. Proc. Natl. Acad. Sci. 1976, 73: 1693-1697). Oral
supplementation of high BCAA and arginine nutritive polypeptides in
a mouse diet shows normalization of serum BCAA and arginine
profiles in mice compared to the control diet.
Example 50
Treatment of Urea Cycle Disorders with Nutritive Polypeptides in
Humans
[1230] Human oral administration of nutritive polypeptides high in
BCAAs and arginine and low in glutamine and glutamic acid is
performed and measurements are made as described herein.
Specifically, by administering a nutritive polypeptide for 2, 3, 4,
5 or 6 months or control and measuring parameters such as dry body
weight, body mass index, body fat percentage, lean body mass,
dietary protein intake, dietary caloric intake and plasma levels of
urea, ammonia, phosphorous, albumin and BCAAs, nutritive
polypeptides efficacy are assessed.
[1231] While the invention has been particularly shown and
described with reference to a preferred embodiment and various
alternate embodiments, it will be understood by persons skilled in
the relevant art that various changes in form and details can be
made therein without departing from the spirit and scope of the
invention.
[1232] All references, issued patents and patent applications cited
within the body of the instant specification are hereby
incorporated by reference in their entirety, for all purposes.
TABLE-US-00136 TABLE 1 Predicted Fragment EAAcom- SEQID DBID Leader
Indices plete EAA BCAA A R N D C Q E G H I L K SEQID-00001 P01012
-- -- 1 0.47 0.22 0.06 0.05 0.05 0.04 0.01 0.04 0.10 0.03 0.02 0.07
0.08 0.06 SEQID-00002 P04405 -- -- 1 0.36 0.18 0.04 0.08 0.08 0.04
0.02 0.12 0.09 0.04 0.01 0.05 0.08 0.04 SEQID-00003 P02754 -- -- 1
0.50 0.16 0.07 0.02 0.03 0.06 0.04 0.06 0.10 0.01 0.01 0.06 0.15
0.10 SEQID-00004 P02662 -- -- 1 0.44 0.21 0.03 0.04 0.04 0.03 0.00
0.07 0.13 0.02 0.03 0.06 0.10 0.08 SEQID-00005 P02666 -- -- 1 0.48
0.25 0.03 0.02 0.02 0.02 0.00 0.10 0.10 0.01 0.03 0.05 0.12 0.06
SEQID-00006 P00711 -- -- 1 0.53 0.23 0.02 0.01 0.06 0.09 0.05 0.06
0.06 0.02 0.03 0.06 0.12 0.09 SEQID-00007 P56552 -- -- 0 0.28 0.10
0.02 0.05 0.07 0.09 0.13 0.08 0.08 0.01 0.02 0.02 0.05 0.14
SEQID-00008 P29290 -- -- 0 0.45 0.21 0.03 0.05 0.03 0.11 0.00 0.02
0.21 0.04 0.00 0.07 0.10 0.06 SEQID-00009 Q5ZMN0 -- -- 0 0.34 0.20
0.01 0.05 0.06 0.17 0.01 0.01 0.23 0.03 0.01 0.03 0.14 0.06
SEQID-00010 P04698 -- -- 0 0.41 0.29 0.10 0.02 0.05 0.00 0.00 0.22
0.01 0.00 0.01 0.05 0.19 0.00 SEQID-00011 P42212 -- -- 1 0.50 0.20
0.02 0.03 0.05 0.08 0.01 0.04 0.08 0.05 0.05 0.05 0.09 0.09
SEQID-00012 P56552 -- -- 0 0.28 0.10 0.02 0.05 0.07 0.09 0.13 0.08
0.08 0.01 0.02 0.02 0.05 0.14 SEQID-00013 P56552 -- 5:54 0 0.28
0.11 0.02 0.05 0.08 0.08 0.12 0.06 0.09 0.01 0.02 0.02 0.06 0.13
SEQID-00014 P56552 -- 1:51 0 0.30 0.11 0.02 0.05 0.07 0.09 0.12
0.08 0.06 0.01 0.02 0.02 0.06 0.15 SEQID-00015 P56552 -- 5:51 0
0.30 0.12 0.03 0.06 0.08 0.08 0.11 0.07 0.07 0.01 0.02 0.02 0.06
0.14 SEQID-00016 -- -- -- 0 0.45 0.25 0.08 0.00 0.03 0.07 0.04 0.06
0.14 0.02 0.00 0.05 0.18 0.07 SEQID-00017 -- -- -- 1 0.45 0.20 0.06
0.01 0.05 0.07 0.02 0.03 0.12 0.03 0.02 0.08 0.08 0.04 SEQID-00018
P10568 -- 693:792 1 0.52 0.19 0.04 0.17 0.03 0.00 0.01 0.08 0.00
0.02 0.02 0.06 0.11 0.13 SEQID-00019 -- -- -- 0 0.48 0.21 0.07 0.31
0.00 0.00 0.00 0.13 0.00 0.02 0.04 0.04 0.11 0.13 SEQID-00020 -- --
-- 0 0.52 0.20 0.07 0.09 0.03 0.03 0.03 0.06 0.03 0.02 0.02 0.07
0.08 0.13 SEQID-00021 -- -- -- 0 0.39 0.23 0.05 0.12 0.08 0.03 0.02
0.05 0.02 0.02 0.01 0.06 0.10 0.10 SEQID-00022 P04700 -- -- 0 0.42
0.29 0.10 0.01 0.05 0.00 0.00 0.22 0.00 0.01 0.01 0.04 0.20 0.00
SEQID-00023 P04705 -- 40:139 0 0.41 0.36 0.08 0.04 0.05 0.00 0.01
0.23 0.01 0.01 0.02 0.06 0.26 0.00 SEQID-00024 P15989 -- 388:487 0
0.52 0.36 0.07 0.07 0.04 0.06 0.00 0.07 0.06 0.03 0.00 0.12 0.15
0.04 SEQID-00025 P15989 -- 341:442 0 0.48 0.36 0.08 0.06 0.04 0.05
0.00 0.06 0.11 0.03 0.00 0.13 0.16 0.02 SEQID-00026 -- -- -- 0 0.74
0.59 0.06 0.05 0.00 0.00 0.00 0.00 0.09 0.06 0.00 0.04 0.52 0.00
SEQID-00027 -- -- -- 0 0.51 0.36 0.01 0.03 0.04 0.02 0.01 0.05 0.11
0.02 0.01 0.07 0.20 0.05 SEQID-00028 -- -- -- 0 0.50 0.41 0.03 0.00
0.01 0.09 0.01 0.02 0.20 0.02 0.02 0.09 0.16 0.00 SEQID-00029 -- --
-- 0 0.37 0.27 0.02 0.08 0.03 0.07 0.00 0.07 0.15 0.02 0.00 0.05
0.16 0.03 SEQID-00030 P10587 -- 1287:1386 0 0.49 0.26 0.02 0.04
0.06 0.06 0.00 0.12 0.15 0.00 0.02 0.04 0.17 0.13 SEQID-00031
Q27991 -- 1353:1452 0 0.46 0.23 0.04 0.07 0.02 0.10 0.00 0.11 0.16
0.00 0.01 0.02 0.17 0.17 SEQID-00032 P29616 -- 51:151 0 0.48 0.23
0.04 0.04 0.04 0.09 0.02 0.04 0.22 0.00 0.01 0.04 0.15 0.15
SEQID-00033 -- -- -- 0 0.64 0.33 0.04 0.03 0.01 0.05 0.00 0.03 0.13
0.01 0.02 0.06 0.21 0.18 SEQID-00034 -- -- -- 0 0.53 0.27 0.08 0.01
0.01 0.05 0.03 0.07 0.09 0.03 0.00 0.07 0.16 0.14 SEQID-00035
P47807 -- 887:986 0 0.57 0.33 0.07 0.06 0.02 0.05 0.01 0.05 0.05
0.03 0.04 0.02 0.21 0.11 SEQID-00036 -- -- -- 1 0.64 0.28 0.02 0.01
0.03 0.05 0.03 0.04 0.04 0.03 0.04 0.06 0.17 0.11 SEQID-00037 -- --
-- 1 1.00 0.49 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.04 0.12
0.28 0.19 SEQID-00038 Q90584 -- 424:529 1 0.55 0.28 0.02 0.05 0.06
0.03 0.03 0.01 0.10 0.03 0.02 0.03 0.19 0.03 SEQID-00039 Q02440 --
1443:1545 1 0.54 0.25 0.02 0.05 0.05 0.07 0.03 0.04 0.06 0.02 0.02
0.05 0.14 0.14 SEQID-00040 P15989 -- 399:498 0 0.51 0.34 0.06 0.08
0.04 0.06 0.00 0.05 0.07 0.03 0.00 0.10 0.13 0.03 SEQID-00041
P10568 -- 680:779 1 0.48 0.18 0.04 0.18 0.03 0.00 0.01 0.08 0.02
0.02 0.02 0.06 0.10 0.10 SEQID-00042 P79114 -- 982:1083 0 0.25 0.09
0.05 0.03 0.03 0.13 0.01 0.04 0.15 0.03 0.04 0.01 0.04 0.01
SEQID-00043 P15989 -- 398:447 0 0.57 0.41 0.03 0.08 0.06 0.04 0.00
0.02 0.09 0.01 0.00 0.12 0.18 0.05 SEQID-00044 P15989 -- 399:448 0
0.59 0.43 0.06 0.08 0.06 0.04 0.00 0.02 0.09 0.01 0.00 0.12 0.20
0.05 SEQID-00045 P15989 -- 402:454 0 0.56 0.43 0.06 0.08 0.06 0.06
0.00 0.02 0.09 0.02 0.00 0.14 0.20 0.04 SEQID-00046 P15989 --
403:454 0 0.55 0.42 0.06 0.08 0.06 0.06 0.00 0.02 0.09 0.02 0.00
0.14 0.18 0.05 SEQID-00047 P15989 -- 406:455 0 0.58 0.44 0.07 0.06
0.06 0.04 0.00 0.02 0.10 0.02 0.00 0.13 0.21 0.05 SEQID-00048
P69012 -- -- 0 0.08 0.03 0.03 0.76 0.00 0.00 0.00 0.00 0.00 0.01
0.00 0.03 0.00 0.00 SEQID-00049 -- -- -- 1 0.52 0.19 0.03 0.04 0.05
0.07 0.01 0.04 0.07 0.05 0.08 0.04 0.08 0.09 SEQID-00050 P02662 --
1:50 0 0.59 0.31 0.05 0.06 0.04 0.00 0.02 0.05 0.09 0.02 0.05 0.04
0.18 0.09 SEQID-00051 P02662 -- 2:51 0 0.59 0.31 0.05 0.06 0.04
0.00 0.02 0.05 0.09 0.02 0.05 0.04 0.18 0.11 SEQID-00052 P02662 --
3:52 0 0.59 0.33 0.05 0.06 0.04 0.00 0.02 0.05 0.09 0.02 0.05 0.04
0.18 0.09 SEQID-00053 P02662 -- 4:53 0 0.57 0.31 0.05 0.06 0.06
0.00 0.02 0.05 0.09 0.02 0.05 0.04 0.16 0.09 SEQID-00054 P02662 --
5:54 0 0.55 0.29 0.05 0.06 0.06 0.00 0.02 0.05 0.11 0.02 0.05 0.04
0.14 0.09 SEQID-00055 P02662 -- 6:55 0 0.55 0.29 0.05 0.06 0.06
0.00 0.02 0.05 0.11 0.02 0.05 0.02 0.16 0.09 SEQID-00056 P02662 --
78:127 0 0.41 0.28 0.00 0.05 0.02 0.02 0.00 0.09 0.18 0.01 0.02
0.08 0.12 0.11 SEQID-00057 P02662 -- 79:128 0 0.41 0.28 0.00 0.05
0.02 0.02 0.00 0.09 0.15 0.01 0.02 0.08 0.12 0.11 SEQID-00058
P02662 -- 80:129 0 0.41 0.28 0.00 0.05 0.04 0.02 0.00 0.09 0.15
0.01 0.02 0.08 0.12 0.11 SEQID-00059 P02662 -- 86:135 0 0.41 0.27
0.01 0.08 0.04 0.02 0.00 0.09 0.15 0.01 0.02 0.06 0.13 0.11
SEQID-00060 -- -- -- 1 0.48 0.19 0.03 0.03 0.04 0.10 0.01 0.03 0.11
0.05 0.08 0.04 0.08 0.06 SEQID-00061 -- -- -- 1 0.55 0.17 0.02 0.11
0.04 0.04 0.01 0.02 0.04 0.05 0.08 0.04 0.08 0.16 SEQID-00062
P33465 -- -- 0 0.67 0.49 0.03 0.07 0.04 0.03 0.03 0.02 0.02 0.02
0.04 0.05 0.32 0.02 SEQID-00063 Q9 8D7 -- -- 0 0.63 0.48 0.05 0.01
0.02 0.01 0.00 0.01 0.04 0.04 0.01 0.20 0.19 0.01 SEQID-00064
P48923 -- -- 1 0.62 0.46 0.04 0.00 0.04 0.02 0.01 0.01 0.04 0.03
0.01 0.19 0.20 0.02 SEQID-00065 P44110 -- -- 1 0.68 0.49 0.05 0.00
0.02 0.01 0.00 0.04 0.02 0.07 0.01 0.16 0.24 0.05 SEQID-00066
O67248 -- -- 0 0.70 0.43 0.02 0.01 0.06 0.02 0.00 0.01 0.03 0.02
0.00 0.10 0.23 0.08 SEQID-00067 P81327 -- -- 0 0.68 0.48 0.04 0.00
0.03 0.02 0.01 0.03 0.02 0.03 0.00 0.21 0.18 0.07 SEQID-00068 -- --
-- 0 0.57 0.43 0.00 0.04 0.04 0.03 0.00 0.07 0.13 0.00 0.03 0.12
0.21 0.03 SEQID-00069 -- -- -- 0 0.56 0.47 0.06 0.04 0.04 0.05 0.00
0.04 0.09 0.03 0.00 0.12 0.23 0.02 SEQID-00070 -- -- -- 0 0.50 0.40
0.06 0.06 0.04 0.05 0.00 0.06 0.11 0.03 0.00 0.12 0.19 0.02
SEQID-00071 -- -- -- 0 0.62 0.46 0.05 0.08 0.06 0.04 0.00 0.02 0.09
0.01 0.00 0.12 0.20 0.05 SEQID-00072 P09860 -- -- 0 0.46 0.18 0.03
0.03 0.03 0.14 0.01 0.03 0.17 0.04 0.00 0.06 0.08 0.09 SEQID-00073
P35622 -- -- 0 0.49 0.20 0.04 0.05 0.02 0.12 0.02 0.02 0.16 0.03
0.00 0.05 0.10 0.13 SEQID-00074 P02586 -- -- 0 0.42 0.16 0.05 0.06
0.02 0.12 0.01 0.04 0.19 0.04 0.01 0.06 0.06 0.06 SEQID-00075
P63317 -- -- 0 0.46 0.18 0.03 0.03 0.03 0.14 0.01 0.03 0.17 0.04
0.00 0.06 0.08 0.09 SEQID-00076 P63315 -- -- 0 0.46 0.18 0.0 0.0
0.03 0.14 0.01 0.03 0.17 0.04 0.00 0.06 0.08 0.09 SEQID-00077
D7F1Q2 -- -- 0 0.47 0.21 0.04 0.03 0.02 0.14 0.00 0.03 0.18 0.03
0.00 0.08 0.09 0.07 SEQID-00078 Q7ZZ89 -- -- 0 0.46 0.17 0.0 0.02
0.04 0.14 0.02 0.04 0.16 0.03 0.00 0.06 0.07 0.10 SEQID-00079
Q9FF58 -- -- 0 0.58 0.38 0.01 0.13 0.00 0.02 0.0 0.02 0.02 0.03
0.00 0.07 0.24 0.04 SEQID-00080 P93280 -- -- 1 0.62 0.33 0.01 0.03
0.02 0.02 0.03 0.04 0.04 0.03 0.02 0.08 0.21 0.02 SEQID-00081
Q67E55 -- -- 1 0.55 0.30 0.04 0.0 0.02 0.03 0.0 0.05 0.02 0.01 0.04
0.06 0.19 0.02 SEQID-00082 Q35Z72 -- -- 1 0.48 0.30 0.07 0.11 0.03
0.04 0.03 0.03 0.04 0.04 0.03 0.03 0.20 0.02 SEQID-00083 P14622 --
-- 1 0.51 0.26 0.09 0.12 0.01 0.01 0.09 0.03 0.05 0.04 0.04 0.04
0.18 0.05 SEQID-00084 P33626 -- 1:61 1 0.32 0.15 0.04 0.02 0.02
0.12 0.05 0.0 0.16 0.10 0.04 0.10 0.03 0.02 SEQID-00085 P60660 --
-- 0 0.47 0.20 0.03 0.05 0.05 0.07 0.02 0.05 0.13 0.05 0.03 0.03
0.09 0.07 SEQID-00086 P02607 -- -- 0 0.46 0.18 0.09 0.05 0.05 0.06
0.02 0.06 0.14 0.05 0.02 0.03 0.09 0.08 SEQID-00087 P02605 -- -- 0
0.48 0.19 0.05 0.04 0.08 0.06 0.01 0.04 0.15 0.04 0.02 0.05 0.08
0.08 SEQID-00088 Q9FRT9 -- 1:90 1 0.32 0.11 0.05 0.02 0.06 0.09
0.11 0.03 0.04 0.05 0.01 0.02 0.07 0.04 SEQID-00089 Q95M18 -- -- 1
0.46 0.19 0.04 0.06 0.03 0.08 0.01 0.03 0.15 0.02 0.01 0.05 0.08
0.11 SEQID-00090 Q41784 -- -- 1 0.43 0.17 0.04 0.07 0.05 0.06 0.02
0.05 0.10 0.04 0.03 0.04 0.08 0.04 SEQID-00091 P09643 -- 1: 22 1
0.44 0.20 0.06 0.06 0.04 0.06 0.03 0.04 0.09 0.03 0.03 0.06 0.08
0.04 SEQID-00092 P02587 -- -- 0 0.42 0.16 0.05 0.06 0.02 0.12 0.01
0.04 0.19 0.04 0.01 0.07 0.05 0.06 SEQID-00093 P10246 -- -- 0 0.45
0.16 0.05 0.05 0.03 0.12 0.01 0.04 0.18 0.04 0.01 0.07 0.06 0.07
SEQID-00094 P02588 -- -- 0 0.45 0.16 0.05 0.05 0.03 0.13 0.01 0.03
0.18 0.04 0.01 0.07 0.06 0.07 SEQID-00095 P04119 -- -- 1 0.50 0.28
0.05 0.05 0.02 0.08 0.09 0.06 0.10 0.01 0.02 0.03 0.18 0.07
SEQID-00096 Q9T5R4 -- -- 1 0.53 0.23 0.02 0.01 0.05 0.10 0.05 0.06
0.06 0.02 0.03 0.06 0.12 0.09 SEQID-00097 Q5KR47 -- -- 0 0.39 0.18
0.08 0.07 0.02 0.07 0.00 0.06 0.24 0.01 0.01 0.04 0.12 0.15
SEQID-00098 Q030J7 -- -- 0 0.50 0.25 0.09 0.00 0.04 0.15 0.00 0.03
0.20 0.01 0.00 0.07 0.08 0.09 SEQID-00099 Q8DH53 -- -- 0 0.45 0.28
0.07 0.00 0.05 0.10 0.00 0.04 0.19 0.01 0.00 0.06 0.10 0.09
SEQID-00100 Q5FJ18 -- -- 0 0.46 0.32 0.0 0.00 0.06 0.15 0.00 0.03
0.16 0.02 0.02 0.11 0.06 0.08 SEQID-00101 Q9WZD0 -- -- 0 0.51 0.29
0.03 0.02 0.00 0.14 0.00 0.01 0.15 0.03 0.00 0.09 0.10 0.12
SEQID-00102 Q74IP1 -- -- 0 0.45 0.20 0.04 0.03 0.05 0.16 0.00 0.04
0.14 0.01 0.01 0.10 0.06 0.07 SEQID-00103 Q84MN0 -- -- 0 0.45 0.19
0.09 0.05 0.05 0.11 0.01 0.05 0.16 0.04 0.00 0.05 0.09 0.06
SEQID-00104 P41040 -- -- 0 0.45 0.18 0.05 0.05 0.05 0.12 0.01 0.05
0.15 0.03 0.01 0.05 0.08 0.08 SEQID-00105 P06787 -- -- 0 0.44 0.23
0.05 0.03 0.06 0.09 0.00 0.05 0.14 0.03 0.02 0.06 0.13 0.06
SEQID-00106 P93087 -- -- 0 0.46 0.17 0.04 0.05 0.05 0.14 0.01 0.05
0.14 0.03 0.01 0.05 0.07 0.08 SEQID-00107 P52193 -- -- 1 0.42 0.14
0.03 0.03 0.04 0.13 0.01 0.04 0.15 0.03 0.02 0.05 0.06 0.11
SEQID-00108 Q95P22 -- -- 1 0.44 0.14 0.05 0.02 0.03 0.14 0.00 0.03
0.12 0.03 0.03 0.06 0.05 0.14 SEQID-00109 P32018 -- 656:709 0 0.42
0.33 0.05 0.00 0.02 0.10 0.00 0.00 0.20 0.04 0.00 0.04 0.16 0.0
SEQID-00110 Q9HD67 -- 472:521 0 0.49 0.29 0.02 0.03 0.04 0.10 0.02
0.02 0.16 0.03 0.02 0.08 0.20 0.04 SEQID-00111 Q03472 -- 140:189 0
0.48 0.26 0.01 0.00 0.02 0.02 0.05 0.06 0.22 0.01 0.02 0.02 0.21
0.13 SEQID-00112 Q02440 -- 461:511 1 0.50 0.23 0.01 0.00 0.06 0.07
0.02 0.12 0.12 0.01 0.02 0.07 0.13 0.06 SEQID-00113 Q13402 --
452:509 1 0.52 0.24 0.039 0.02 0.08 0.06 0.01 0.07 0.11 0.00 0.06
0.10 0.11 0.04 SEQID-00114 Q90688 -- 446:495 1 0.51 0.24 0.01 0.05
0.00 0.04 0.02 0.02 0.25 0.03 0.02 0.04 0.08 0.07 SEQID-00115
Q29092 -- 703:803 0 0.32 0.13 0.04 0.05 0.01 0.16 0.00 0.02 0.27
0.01 0.00 0.02 0.08 0.04 SEQID-00116 Q29092 -- 704:803 0 0.32 0.14
0.04 0.06 0.01 0.16 0.00 0.02 0.26 0.02 0.00 0.02 0.08 0.05
SEQID-00117 Q02440 -- 413:512 1 0.52 0.22 0.02 0.00 0.08 0.06 0.02
0.09 0.12 0.01 0.05 0.09 0.09 0.06 SEQID-00118 Q28970 -- 427:527 1
0.51 0.21 0.02 0.04 0.08 0.06 0.01 0.05 0.12 0.01 0.09 0.09 0.10
0.05 SEQID-00119 Q90688 -- 382:481 1 0.46 0.24 0.05 0.03 0.04 0.05
0.03 0.03 0.17 0.03 0.02 0.07 0.07 0.07 SEQID-00120 Q90688 --
398:498 1 0.46 0.22 0.04 0.04 0.03 0.04 0.03 0.03 0.20 0.03 0.02
0.07 0.06 0.07 SEQID-00121 Q28063 -- 23:225 0 0.29 0.12 0.09 0.02
0.04 0.08 0.00 0.03 0.21 0.05 0.01 0.04 0.04 0.04 SEQID-00122
Q28063 -- 2:202 0 0.26 0.10 0.04 0.02 0.04 0.09 0.01 0.05 0.21 0.04
0.01 0.03 0.09 0.04 SEQID-00123 Q95M18 -- 118:318 1 0.46 0.20 0.04
0.02 0.06 0.07 0.00 0.03
0.18 0.03 0.02 0.06 0.08 0.09 SEQID-00124 P08110 -- 120:321 1 0.48
0.19 0.09 0.02 0.06 0.07 0.00 0.03 0.18 0.03 0.02 0.05 0.07 0.11
SEQID-00125 P22418 -- 75:275 1 0.40 0.27 0.05 0.03 0.04 0.06 0.09
0.05 0.10 0.05 0.01 0.09 0.08 0.03 SEQID-00126 P79114 -- 913:1115 1
0.26 0.11 0.04 0.06 0.039 0.11 0.02 0.06 0.15 0.03 0.02 0.02 0.06
0.02 SEQID-00127 P04119 -- -- 1 0.50 0.28 0.05 0.05 0.02 0.0 0.09
0.06 0.10 0.01 0.02 0.03 0.18 0.07 SEQID-00128 P06714 -- -- 1 0.53
0.24 0.09 0.10 0.01 0.05 0.01 0.02 0.04 0.03 0.08 0.01 0.17 0.04
SEQID-00129 A1AAQ3 -- -- 1 0.51 0.26 0.06 0.08 0.01 0.05 0.01 0.09
0.06 0.03 0.06 0.02 0.13 0.02 SEQID-00130 P02114 -- -- 1 0.56 0.24
0.07 0.06 0.05 0.05 0.02 0.04 0.05 0.03 0.06 0.05 0.12 0.08
SEQID-00131 P67975 -- -- 1 0.50 0.25 0.06 0.03 0.04 0.05 0.0 0.06
0.11 0.02 0.02 0.06 0.13 0.11 SEQID-00132 Q90584 -- 436:486 0 0.60
0.41 0.04 0.05 0.08 0.02 0.00 0.02 0.07 0.04 0.02 0.04 0.32 0.07
SEQID-00133 A6QP B3 -- 473:523 0 0.61 0.35 0.04 0.10 0.02 0.00 0.00
0.00 0.15 0.04 0.00 0.02 0.30 0.11 SEQID-00134 P22281 -- 82:134 0
0.58 0.46 0.04 0.06 0.02 0.06 0.02 0.00 0.02 0.02 0.02 0.14 0.24
0.0 SEQID-00135 P01958 -- 63:114 0 0.61 0.38 0.06 0.03 0.04 0.10
0.02 0.00 0.00 0.03 0.12 0.00 0.29 0.05 SEQID-00136 Q9T5N7 --
63:114 0 0.62 0.36 0.09 0.03 0.02 0.06 0.00 0.00 0.02 0.02 0.12
0.00 0.27 0.07 SEQID-00137 Q17R14 -- 270:321 0 0.64 0.39 0.06 0.03
0.02 0.03 0.00 0.00 0.07 0.03 0.02 0.10 0.20 0.09 SEQID-00138
P47807 -- 952:1003 0 0.59 0.35 0.08 0.03 0.00 0.06 0.00 0.05 0.05
0.04 0.08 0.04 0.27 0.05 SEQID-00139 Q27991 -- 1396:1446 0 0.49
0.31 0.02 0.08 0.02 0.11 0.00 0.11 0.11 0.00 0.02 0.02 0.23 0.13
SEQID-00140 P12106 -- 170:120 1 0.70 0.32 0.00 0.00 0.02 0.06 0.02
0.02 0.04 0.02 0.05 0.10 0.14 0.11 SEQID-00141 P32191 -- 112:163 1
0.58 0.31 0.05 0.05 0.04 0.02 0.02 0.02 0.09 0.02 0.07 0.11 0.15
0.06 SEQID-00142 P19524 -- 1398:1449 1 0.56 0.25 0.01 0.10 0.06
0.02 0.03 0.08 0.06 0.03 0.04 0.04 0.18 0.08 SEQID-00143 Q03262 --
225:277 1 0.65 0.30 0.01 0.00 0.04 0.02 0.02 0.00 0.11 0.03 0.02
0.06 0.13 0.15 SEQID-00144 P32492 -- 1275:1325 1 0.67 0.25 0.02
0.00 0.09 0.08 0.03 0.02 0.02 0.00 0.02 0.04 0.15 0.11 SEQID-00145
P12863 -- 82:132 1 0.51 0.33 0.05 0.06 0.04 0.02 0.02 0.02 0.12
0.06 0.03 0.04 0.17 0.05 SEQID-00146 P12106 -- 159:209 1 0.67 0.29
0.01 0.00 0.02 0.06 0.02 0.04 0.04 0.02 0.05 0.08 0.14 0.09
SEQID-00147 P32492 -- 1092:1193 1 0.57 0.36 0.00 0.04 0.08 0.04
0.01 0.01 0.08 0.04 0.01 0.07 0.17 0.06 SEQID-00148 A6QR56 --
589:691 0 0.47 0.34 0.10 0.14 0.02 0.01 0.02 0.05 0.09 0.03 0.02
0.01 0.21 0.03 SEQID-00149 P47807 -- 888:988 0 0.56 0.32 0.07 0.06
0.02 0.05 0.01 0.06 0.05 0.03 0.05 0.02 0.21 0.09 SEQID-00150
P32492 -- 1218:1319 1 0.67 0.25 0.02 0.00 0.08 0.08 0.01 0.01 0.06
0.00 0.03 0.06 0.14 0.13 SEQID-00151 P79114 -- 688:788 1 0.48 0.26
0.05 0.14 0.03 0.03 0.02 0.06 0.09 0.01 0.02 0.04 0.15 0.10
SEQID-00152 Q5MIB5 -- 492:592 1 0.53 0.27 0.01 0.05 0.07 0.05 0.02
0.05 0.09 0.01 0.02 0.07 0.14 0.13 SEQID-00153 P04119 -- 28:129 1
0.51 0.26 0.06 0.01 0.04 0.10 0.02 0.05 0.08 0.02 0.02 0.06 0.17
0.10 SEQID-00154 P06642 -- 14:115 1 0.55 0.27 0.03 0.05 0.07 0.06
0.02 0.01 0.06 0.04 0.04 0.05 0.14 0.08 SEQID-00155 Q2XQV4 --
108:213 1 0.49 0.26 0.05 0.06 0.04 0.08 0.02 0.02 0.03 0.04 0.02
0.05 0.15 0.06 SEQID-00156 Q02440 -- 1448:1548 1 0.52 0.25 0.02
0.07 0.05 0.06 0.03 0.04 0.07 0.03 0.02 0.05 0.15 0.12 SEQID-00157
Q49068 -- -- 1 0.45 0.23 0.04 0.03 0.06 0.06 0.01 0.06 0.07 0.03
0.03 0.06 0.10 0.05 SEQID-00158 P32492 -- 1086:1287 1 0.58 0.29
0.02 0.03 0.07 0.06 0.00 0.02 0.08 0.02 0.02 0.05 0.15 0.10
SEQID-00159 Q76F 2 -- 59:260 1 0.46 0.23 0.03 0.0 0.06 0.07 0.03
0.03 0.06 0.05 0.03 0.04 0.12 0.03 SEQID-00160 P32492 -- 1115:1316
1 0.61 0.28 0.02 0.01 0.07 0.06 0.00 0.02 0.07 0.02 0.02 0.05 0.14
0.11 SEQID-00161 Q41874 -- 113:313 1 0.49 0.27 0.04 0.09 0.07 0.04
0.01 0.06 0.04 0.01 0.02 0.05 0.12 0.05 SEQID-00162 P52768 -- -- 0
0.64 0.53 0.01 0.00 0.08 0.02 0.00 0.02 0.02 0.01 0.02 0.14 0.34
0.02 SEQID-00163 P8 479 -- -- 1 0.72 0.43 0.02 0.01 0.02 0.02 0.00
0.02 0.03 0.01 0.05 0.13 0.26 0.07 SEQID-00164 Q31K24 -- -- 0 0.67
0.51 0.04 0.05 0.05 0.02 0.00 0.04 0.00 0.04 0.00 0.05 0.24 0.00
SEQID-00165 P51316 -- -- 0 0.69 0.52 0.03 0.00 0.02 0.00 0.00 0.06
0.02 0.05 0.00 0.12 0.23 0.02 SEQID-00166 Q36967 -- 1:105 0 0.65
0.46 0.08 0.04 0.02 0.00 0.00 0.03 0.03 0.02 0.02 0.12 0.26 0.00
SEQID-00167 O21402 -- -- 1 0.65 0.39 0.05 0.03 0.05 0.00 0.00 0.05
0.02 0.02 0.02 0.06 0.29 0.02 SEQID-00168 Q47872 -- -- 1 0.68 0.41
0.04 0.02 0.05 0.00 0.00 0.05 0.02 0.02 0.03 0.10 0.27 0.02
SEQID-00169 Q85X26 -- -- 0 0.60 0.43 0.01 0.00 0.11 0.02 0.00 0.02
0.02 0.01 0.02 0.13 0.25 0.00 SEQID-00170 P14092 -- -- 1 0.63 0.39
0.05 0.03 0.05 0.00 0.00 0.04 0.02 0.02 0.02 0.09 0.28 0.02
SEQID-00171 Q36964 -- 1:219 1 0.65 0.40 0.06 0.04 0.04 0.00 0.00
0.04 0.02 0.03 0.02 0.09 0.25 0.01 SEQID-00172 Q70RQ2 -- -- 0 0.64
0.39 0.07 0.01 0.06 0.01 0.03 0.02 0.02 0.02 0.04 0.07 0.24 0.00
SEQID-00173 P48178 -- -- 1 0.64 0.37 0.05 0.04 0.04 0.00 0.00 0.05
0.02 0.03 0.02 0.09 0.23 0.01 SEQID-00174 Q36090 -- 1:133 1 0.65
0.34 0.02 0.05 0.05 0.00 0.00 0.03 0.03 0.03 0.03 0.07 0.23 0.01
SEQID-00175 Q31721 -- 1:58 0 0.63 0.38 0.07 0.00 0.05 0.02 0.03
0.02 0.04 0.04 0.02 0.14 0.19 0.00 SEQID-00176 Q38LTZ5 -- -- 1 0.67
0.35 0.05 0.03 0.05 0.00 0.00 0.05 0.02 0.03 0.03 0.10 0.20 0.02
SEQID-00177 A4GYW9 -- 13:120 1 0.66 0.41 0.04 0.00 0.07 0.01 0.02
0.01 0.01 0.05 0.01 0.11 0.21 0.01 SEQID-00178 Q31720 -- 150:252 1
0.64 0.37 0.06 0.03 0.02 0.00 0.03 0.01 0.03 0.04 0.02 0.10 0.22
0.01 SEQID-00179 P27572 -- 6:106 1 0.61 0.40 0.01 0.04 0.02 0.03
0.04 0.02 0.03 0.02 0.01 0.15 0.21 0.01 SEQID-00180 P11631 --
360:460 1 0.67 0.35 0.03 0.03 0.03 0.00 0.01 0.01 0.04 0.02 0.05
0.11 0.23 0.01 SEQID-00181 Q00506 -- 30:130 1 0.68 0.36 0.03 0.01
0.02 0.02 0.01 0.03 0.03 0.00 0.01 0.07 0.28 0.03 SEQID-00182
P92487 -- 272:373 1 0.63 0.38 0.04 0.04 0.01 0.01 0.01 0.04 0.02
0.02 0.02 0.13 0.21 0.02 SEQID-00183 B2XWJ4 -- 62:163 1 0.63 0.38
0.01 0.01 0.07 0.04 0.01 0.06 0.03 0.04 0.01 0.18 0.17 0.02
SEQID-00184 P27572 -- 50:150 1 0.65 0.33 0.02 0.03 0.01 0.03 0.03
0.02 0.05 0.02 0.01 0.10 0.17 0.02 SEQID-00185 P27572 -- 22:122 1
0.62 0.37 0.01 0.05 0.02 0.02 0.02 0.02 0.03 0.03 0.01 0.16 0.17
0.02 SEQID-00186 P27572 -- 130:236 1 0.68 0.35 0.04 0.05 0.00 0.02
0.01 0.05 0.03 0.02 0.01 0.11 0.17 0.03 SEQID-00187 Q31720 --
43:144 1 0.69 0.35 0.01 0.00 0.05 0.01 0.02 0.04 0.02 0.04 0.02
0.10 0.18 0.04 SEQID-00188 O47872 -- 105:206 0 0.70 0.48 0.04 0.04
0.02 0.00 0.00 0.02 0.03 0.02 0.02 0.12 0.32 0.00 SEQID-00189
P50681 -- 14:114 1 0.69 0.37 0.02 0.04 0.05 0.00 0.00 0.03 0.00
0.02 0.01 0.06 0.30 0.03 SEQID-00190 P14092 -- 69:170 0 0.63 0.39
0.06 0.04 0.04 0.00 0.00 0.02 0.02 0.03 0.03 0.06 0.32 0.00
SEQID-00191 O47872 -- 54:154 1 0.68 0.43 0.03 0.03 0.03 0.00 0.00
0.03 0.02 0.02 0.04 0.14 0.27 0.02 SEQID-00192 P50681 -- 111:212 0
0.64 0.45 0.08 0.04 0.02 0.00 0.00 0.04 0.04 0.02 0.03 0.14 0.29
0.00 SEQID-00193 Q5ZMN0 -- 44:93 0 0.53 0.36 0.01 0.08 0.12 0.02
0.00 0.00 0.09 0.02 0.02 0.06 0.26 0.07 SEQID-00194 Q5ZMN0 -- 46:95
0 0.54 0.36 0.01 0.0 0.14 0.02 0.00 0.00 0.07 0.02 0.02 0.06 0.26
0.07 SEQID-00195 Q5ZMN0 -- 47:96 0 0.52 0.36 0.01 0.08 0.14 0.02
0.00 0.00 0.07 0.02 0.02 0.06 0.26 0.07 SEQID-00196 Q5ZMN0 -- 1:146
0 0.53 0.30 0.00 0.07 0.10 0.06 0.01 0.01 0.09 0.02 0.02 0.05 0.21
0.10 SEQID-00197 Q5ZMN0 -- 1:147 0 0.52 0.30 0.00 0.07 0.10 0.06
0.01 0.01 0.09 0.02 0.02 0.05 0.21 0.10 SEQID-00198 Q5ZMN0 -- 1:148
0 0.53 0.30 0.00 0.06 0.10 0.05 0.01 0.01 0.09 0.02 0.02 0.05 0.21
0.10 SEQID-00199 Q5ZMN0 -- 1:149 0 0.52 0.29 0.00 0.06 0.10 0.06
0.01 0.01 0.09 0.02 0.02 0.05 0.21 0.10 SEQID-00200 Q5ZMN0 -- 1:150
0 0.52 0.29 0.01 0.06 0.10 0.06 0.01 0.01 0.09 0.02 0.02 0.05 0.21
0.10 SEQID-00201 Q5ZMN0 -- 1:151 0 0.52 0.29 0.01 0.06 0.10 0.07
0.01 0.01 0.09 0.02 0.02 0.05 0.20 0.10 SEQID-00202 Q5ZMN0 -- 1:152
0 0.51 0.29 0.01 0.06 0.10 0.07 0.01 0.01 0.10 0.02 0.02 0.05 0.20
0.10 SEQID-00203 Q5ZMN0 -- 1:153 0 0.51 0.29 0.01 0.06 0.10 0.07
0.01 0.01 0.10 0.02 0.02 0.05 0.20 0.10 SEQID-00204 Q5ZMN0 -- 1:154
0 0.51 0.28 0.01 0.06 0.10 0.07 0.01 0.01 0.10 0.02 0.02 0.05 0.20
0.09 SEQID-00205 Q5ZMN0 -- 1:161 0 0.49 0.27 0.01 0.06 0.09 0.08
0.01 0.01 0.11 0.02 0.02 0.04 0.19 0.09 SEQID-00206 P35580 --
117:166 0 0.56 0.24 0.03 0.10 0.02 0.02 0.02 0.10 0.10 0.00 0.02
0.00 0.16 0.14 SEQID-00207 Q9JLT0 -- 127:193 1 0.54 0.22 0.01 0.07
0.01 0.01 0.00 0.11 0.20 0.01 0.03 0.01 0.15 0.15 SEQID-00208
Q61879 -- 152:206 0 0.43 0.20 0.04 0.02 0.02 0.02 0.00 0.12 0.33
0.01 0.02 0.02 0.16 0.14 SEQID-00209 Q27991 -- 102:206 1 0.49 0.21
0.06 0.07 0.02 0.01 0.01 0.13 0.17 0.00 0.02 0.01 0.15 0.14
SEQID-00210 Q9JLT0 -- 127:226 1 0.49 0.21 0.05 0.03 0.01 0.01 0.00
0.11 0.23 0.00 0.03 0.02 0.15 0.13 SEQID-00211 Q9JLT0 -- 127:231 1
0.48 0.21 0.04 0.09 0.01 0.02 0.00 0.10 0.23 0.00 0.03 0.02 0.15
0.12 SEQID-00212 Q27991 -- 141:190 0 0.51 0.28 0.04 0.05 0.00 0.12
0.00 0.09 0.15 0.00 0.02 0.00 0.23 0.17 SEQID-00213 Q27991 --
136:185 0 0.51 0.28 0.04 0.05 0.02 0.0 0.00 0.07 0.18 0.01 0.00
0.02 0.21 0.18 SEQID-00214 Q27991 -- 116:185 0 0.51 0.27 0.04 0.04
0.01 0.11 0.00 0.11 0.13 0.01 0.00 0.01 0.21 0.17 SEQID-00215
Q27991 -- 146:200 0 0.51 0.29 0.02 0.07 0.02 0.11 0.00 0.10 0.12
0.00 0.02 0.02 0.21 0.18 SEQID-00216 Q27991 -- 146:210 0 0.52 0.27
0.03 0.06 0.01 0.10 0.00 0.12 0.12 0.00 0.02 0.01 0.20 0.18
SEQID-00217 Q27991 -- 131:185 0 0.50 0.29 0.03 0.05 0.02 0.13 0.00
0.06 0.16 0.01 0.00 0.02 0.21 0.16 SEQID-00218 Q27991 -- 136:190 0
0.50 0.27 0.03 0.05 0.02 0.11 0.00 0.0 0.16 0.01 0.02 0.02 0.21
0.16 SEQID-00219 Q27991 -- 146:195 0 0.50 0.30 0.02 0.0 0.00 0.12
0.00 0.11 0.11 0.00 0.02 0.02 0.21 0.15 SEQID-00220 Q27991 --
126:190 0 0.52 0.26 0.03 0.04 0.02 0.15 0.00 0.07 0.14 0.01 0.02
0.01 0.19 0.19 SEQID-00221 Q27991 -- 141:200 0 0.51 0.28 0.0 0.07
0.02 0.10 0.00 0.09 0.15 0.00 0.02 0.02 0.21 0.18 SEQID-00222
Q27991 -- 31:80 0 0.41 0.20 0.06 0.03 0.06 0.06 0.00 0.11 0.21 0.02
0.00 0.02 0.16 0.14 SEQID-00223 Q27991 -- 161:210 0 0.50 0.24 0.04
0.05 0.02 0.12 0.00 0.13 0.11 0.00 0.02 0.02 0.19 0.17 SEQID-00224
Q27991 -- 126:185 0 0.53 0.27 0.0 0.04 0.02 0.13 0.00 0.06 0.15
0.01 0.00 0.02 0.19 0.20 SEQID-00225 Q27991 -- 111:210 0 0.50 0.26
0.04 0.05 0.02 0.11 0.00 0.12 0.12 0.00 0.01 0.02 0.19 0.18
SEQID-00226 Q27991 -- 116:215 0 0.50 0.26 0.04 0.04 0.0 0.11 0.00
0.12 0.12 0.00 0.01 0.03 0.18 0.18 SEQID-00227 Q27991 -- 126:225 0
0.46 0.22 0.04 0.03 0.0 0.12 0.00 0.03 0.14 0.00 0.01 0.03 0.15
0.17 SEQID-00228 Q27991 -- 126:237 0 0.45 0.21 0.0 0.03 0.0 0.11
0.00 0.07 0.17 0.00 0.01 0.03 0.15 0.18 SEQID-00229 Q9JLT0 --
124:174 0 0.40 0.22 0.04 0.13 0.06 0.05 0.00 0.05 0.21 0.01 0.00
0.02 0.19 0.06 SEQID-00230 Q9JLT0 -- 194:244 0 0.45 0.20 0.11 0.03
0.04 0.00 0.00 0.11 0.21 0.02 0.00 0.04 0.14 0.20 SEQID-00231
Q27991 -- 139:227 0 0.41 0.20 0.08 0.0 0.06 0.03 0.00 0.11 0.18
0.01 0.00 0.03 0.15 0.11 SEQID-00232 Q61879 -- 154:252 0 0.41 0.19
0.09 0.11 0.05 0.03 0.00 0.10 0.16 0.01 0.00 0.02 0.14 0.15
SEQID-00233 P15989 -- 99:308 0 0.52 0.37 0.07 0.05 0.04 0.07 0.00
0.04 0.08 0.04 0.00 0.13 0.17 0.03 SEQID-00234 P15989 -- 99:203 0
0.51 0.37 0.07 0.06 0.04 0.07 0.00 0.05 0.08 0.04 0.00 0.13 0.16
0.03 SEQID-00235 P15989 -- 49:166 0 0.44 0.28 0.10 0.06 0.04 0.06
0.00 0.05 0.09 0.05 0.00 0.07 0.15 0.04 SEQID-00236 Q90339 --
201:265 0 0.45 0.21 0.06 0.06 0.02 0.11 0.00 0.12 0.16 0.02 0.02
0.00 0.18 0.15 SEQID-00237 Q E41 -- 216:265 0 0.48 0.21 0.04 0.08
0.02 0.10 0.00 0.07 0.18 0.02 0.00 0.00 0.18 0.20 SEQID-00238
Q8MJV0 -- 146:200 0 0.56 0.21 0.05 0.00 0.04 0.09 0.02 0.00 0.23
0.01 0.02 0.04 0.14 0.22 SEQID-00239 Q9 V62 -- 241:290 0 0.48 0.17
0.02 0.08 0.02 0.09 0.00 0.08 0.19 0.01 0.00 0.02 0.15 0.21
SEQID-00240 Q5 X39 -- 236:285 0 0.45 0.19 0.02 0.08 0.02 0.12 0.00
0.09 0.17 0.02 0.00 0.02 0.17 0.20 SEQID-00241 Q9 V61 -- 151:265 0
0.52 0.21 0.0 0.04 0.0 0.10 0.00 0.07 0.18 0.01 0.02 0.02 0.16 0.19
SEQID-00242 Q79102 -- 55:104 0 0.75 0.53 0.0 0.03 0.00 0.02 0.00
0.04 0.02 0.01 0.00 0.0 0.42 0.00 SEQID-00243 Q ZBI9 -- 192:241 0
0.66 0.47 0.04 0.03 0.00 0.00 0.02 0.05 0.02 0.04 0.00 0.02 0.43
0.00 SEQID-00244 P18937 -- 119:170 0 0.71 0.46 0.0 0.00 0.02 0.00
0.00 0.05 0.00 0.04 0.00 0.08 0.37 0.02 SEQID-00245 P18937 --
106:157 1 0.73 0.43 0.01 0.00 0.02 0.00 0.00 0.04 0.02 0.02 0.02
0.04 0.36 0.02 SEQID-00246 Q90592 -- 200:250 0 0.69 0.51 0.04 0.00
0.02 0.04 0.00 0.07 0.02 0.0 0.03 0.0 0.39 0.00 SEQID-00247 Q90592
-- 152:250 1 0.61 0.43 0.06 0.03 0.01 0.02 0.01 0.04 0.03 0.07 0.03
0.0 0.30 0.01 SEQID-00248 O478 -- 56:109 0 0.69 0.43 0.09 0.00 0.02
0.02 0.00 0.00 0.02 0.01 0.00 0.04 0.39 0.04
SEQID-00249 O478 -- 11:109 1 0.65 0.40 0.07 0.03 0.02 0.02 0.00
0.02 0.02 0.03 0.01 0.07 0.31 0.05 SEQID-00250 A1L504 -- 57:107 0
0.65 0.44 0.05 0.03 0.00 0.02 0.00 0.05 0.07 0.04 0.05 0.00 0.40
0.00 SEQID-00251 A1L504 -- 260:327 1 0.63 0.37 0.06 0.06 0.05 0.03
0.00 0.02 0.02 0.02 0.02 0.03 0.30 0.05 SEQID-00252 Q 2LM8 --
203:253 0 0.63 0.44 0.04 0.11 0.00 0.06 0.00 0.07 0.00 0.03 0.07
0.00 0.39 0.02 SEQID-00253 Q767L9 -- 139:230 1 0.66 0.44 0.0 0.06
0.00 0.02 0.02 0.01 0.04 0.0 0.05 0.03 0.31 0.02 SEQID-00254 Q32LM8
-- 150:230 1 0.63 0.43 0.03 0.07 0.00 0.0 0.01 0.01 0.04 0.03 0.04
0.02 0.32 0.03 SEQID-00255 Q6F4F5 -- :55 0 0.70 0.45 0.0 0.0 0.02
0.00 0.00 0.00 0.02 0.0 0.0 0.02 0.38 0.05 SEQID-00256 Q6F4F5 --
1:52 1 0.70 0.46 0.05 0.03 0.02 0.00 0.00 0.00 0.05 0.05 0.02 0.02
0.37 0.05 SEQID-00257 Q35920 -- 58:111 1 0.73 0.41 0.02 0.00 0.06
0.00 0.00 0.02 0.00 0.04 0.02 0.02 0.36 0.02 SEQID-00258 P49208 --
1:50 1 0.69 0.39 0.00 0.18 0.02 0.00 0.00 0.02 0.00 0.01 0.05 0.02
0.34 0.08 SEQID-00259 P00729 -- 2:52 0 0.60 0.35 0.07 0.03 0.00
0.11 0.02 0.05 0.02 0.04 0.03 0.02 0.31 0.12 SEQID-00260 Q58 T4 --
337:386 0 0.69 0.43 0.03 0.0 0.02 0.04 0.04 0.00 0.02 0.05 0.03
0.02 0.34 0.05 SEQID-00261 Q066 9 -- 422:473 0 0.64 0.43 0.00 0.0
0.10 0.04 0.02 0.02 0.04 0.01 0.02 0.06 0.34 0.02 SEQID-00262
Q9UKT8 -- 15:69 0 0.61 0.37 0.01 0.05 0.05 0.05 0.00 0.04 0.06 0.01
0.04 0.02 0.32 0.06 SEQID-00263 A1 P6 -- 17:68 0 0.64 0.41 0.02
0.00 0.00 0.02 0.03 0.04 0.00 0.02 0.02 0.02 0.34 0.02 SEQID-00264
Q9 V61 -- 102:344 0 0.44 0.19 0.06 0.06 0.02 0.0 0.01 0.0 0.21 0.01
0.01 0.04 0.12 0.17 SEQID-00265 Q27991 -- 20:289 0 0.38 0.20 0.06
0.10 0.03 0.07 0.00 0.09 0.20 0.01 0.01 0.02 0.15 0.13 SEQID-00266
-- -- -- 0 0.52 0.26 0.03 0.04 0.01 0.15 0.00 0.07 0.14 0.01 0.02
0.01 0.22 0.18 SEQID-00267 -- -- -- 0 0.52 0.26 0.03 0.04 0.01 0.15
0.00 0.07 0.14 0.01 0.02 0.00 0.25 0.18 SEQID-00268 -- -- -- 0 0.52
0.28 0.03 0.04 0.01 0.15 0.00 0.07 0.14 0.01 0.02 0.00 0.28 0.17
SEQID-00269 -- -- -- 0 0.53 0.31 0.02 0.04 0.01 0.15 0.00 0.07 0.13
0.01 0.02 0.00 0.31 0.17 SEQID-00270 -- -- -- 0 0.56 0.33 0.00 0.04
0.01 0.15 0.00 0.07 0.13 0.01 0.02 0.00 0.33 0.16 SEQID-00271 -- --
-- 0 0.57 0.36 0.00 0.04 0.00 0.15 0.00 0.07 0.13 0.01 0.02 0.00
0.36 0.16 SEQID-00272 -- -- -- 0 0.53 0.28 0.02 0.04 0.01 0.15 0.00
0.07 0.13 0.01 0.02 0.00 0.28 0.18 SEQID-00273 -- -- -- 0 0.56 0.31
0.01 0.04 0.00 0.15 0.00 0.07 0.13 0.01 0.02 0.00 0.31 0.18
SEQID-00274 -- -- -- 0 0.57 0.33 0.01 0.04 0.00 0.15 0.00 0.07 0.13
0.00 0.02 0.00 0.33 0.18 SEQID-00275 -- -- -- 0 0.58 0.36 0.00 0.04
0.00 0.15 0.00 0.07 0.13 0.00 0.02 0.00 0.36 0.1 SEQID-00276 -- --
-- 0 0.60 0.36 0.01 0.04 0.00 0.15 0.00 0.07 0.13 0.00 0.02 0.00
0.36 0.18 SEQID-00277 Q1WLP9 -- 170:263 1 0.67 0.33 0.06 0.02 0.01
0.00 0.04 0.01 0.05 0.01 0.04 0.08 0.14 0.11 SEQID-00278 A3DBX3 --
-- 1 0.43 0.15 0.02 0.06 0.07 0.07 0.00 0.02 0.05 0.05 0.01 0.04
0.05 0.07 SEQID-00279 -- -- -- 0 0.57 0.35 0.00 0.04 0.00 0.15 0.00
0.07 0.13 0.01 0.02 0.00 0.35 0.16 SEQID-00280 -- -- -- 0 0.57 0.35
0.01 0.04 0.00 0.15 0.00 0.07 0.13 0.00 0.02 0.00 0.35 0.18
SEQID-00281 P05804 -- -- 1 0.46 0.19 0.05 0.07 0.05 0.07 0.01 0.06
0.08 0.04 0.04 0.05 0.07 0.05 SEQID-00282 O60167 -- 51:75 1 0.75
0.32 0.00 0.05 0.00 0.00 0.03 0.04 0.08 0.00 0.04 0.07 0.15 0.13
SEQID-00283 Q0WvK7 -- 53:105 1 0.57 0.27 0.01 0.14 0.02 0.05 0.03
0.02 0.06 0.00 0.04 0.07 0.12 0.12 SEQID-00284 Q94A52 -- 149:261 1
0.54 0.26 0.02 0.10 0.00 0.06 0.02 0.03 0.11 0.02 0.03 0.06 0.12
0.10 SEQID-00285 Q5F479 -- 556:615 1 0.64 0.28 0.03 0.13 0.00 0.02
0.01 0.02 0.11 0.00 0.06 0.06 0.14 0.11 SEQID-00286 Q08213 --
177:230 1 0.65 0.31 0.00 0.05 0.04 0.04 0.03 0.04 0.06 0.02 0.04
0.07 0.14 0.12 SEQID-00287 P38111 -- 1093:1165 1 0.59 0. 0 0.02
0.04 0.05 0.10 0.04 0.02 0.06 0.01 0.03 0.08 0.13 0.11 SEQID-00288
O93262 -- -- 1 0.55 0.27 0.02 0.06 0.02 0.06 0.03 0.06 0.07 0.01
0.03 0.06 0.13 0.09 SEQID-00289 O64837 -- -- 1 0.61 0.26 0.02 0.06
0.02 0.03 0.01 0.01 0.10 0.0 0.03 0.06 0.12 0.09 SEQID-00290 Q54K39
-- -- 1 0.53 0.28 0.03 0.05 0.03 0.04 0.01 0.02 0.09 0.05 0.03 0.09
0.11 0.09 SEQID-00291 P38111 -- 1093:1182 1 0.57 0.27 0.03 0.03
0.06 0.08 0.03 0.04 0.06 0.01 0.03 0.07 0.13 0.10 SEQID-00292
P38111 -- 1093:1162 1 0.57 0.27 0.02 0.04 0.06 0.10 0.04 0.02 0.06
0.01 0.03 0.07 0.13 0.11 SEQID-00293 P38111 -- 1092:1166 1 0.59
0.29 0.02 0.04 0.05 0.09 0.04 0.01 0.06 0.01 0.03 0.0 0.13 0.10
SEQID-00294 P33111 -- 1093:1168 1 0.58 0.29 0.02 0.04 0.05 0.09
0.04 0.01 0.06 0.01 0.03 0.08 0.13 0.10 SEQID-00295 P38111 --
1091:1164 1 0.59 0.30 0.02 0.04 0.05 0.09 0.04 0.02 0.06 0.01 0.03
0.09 0.13 0.11 SEQID-00296 P38111 -- 1089:1164 1 0.58 0.29 0.02
0.04 0.05 0.11 0.04 0.01 0.06 0.01 0.03 0.09 0.13 0.10 SEQID-00297
P02190 -- -- 1 0.58 0.20 0.07 0.02 0.03 0.05 0.00 0.04 0.10 0.05
0.10 0.04 0.11 0.14 SEQID-00298 P02192 -- -- 1 0.59 0.20 0.07 0.02
0.03 0.05 0.00 0.0 0.10 0.04 0.10 0.04 0.11 0.14 SEQID-00299 P02189
-- -- 1 0.56 0.21 0.06 0.02 0.02 0.05 0.00 0.05 0.11 0.05 0.07 0.04
0.12 0.14 SEQID-00300 F1RJW7 -- -- 1 0.45 0.21 0.04 0.03 0.03 0.14
0.00 0.02 0.15 0.02 0.02 0.05 0.10 0.07 SEQID-00301 Q05JF3 -- -- 1
0.44 0.21 0.05 0.03 0.04 0.12 0.00 0.02 0.16 0.02 0.02 0.04 0.10
0.07 SEQID-00302 406710553 -- -- 1 0.49 0.26 0.08 0.04 0.02 0.07
0.01 0.04 0.09 0.05 0.02 0.05 0.12 0.09 SEQID-00303 406715845 -- --
1 0.46 0.23 0.05 0.07 0.03 0.07 0.01 0.05 0.08 0.04 0.02 0.09 0.08
0.06 SEQID-00304 406711970 -- -- 1 0.44 0.23 0.02 0.09 0.03 0.09
0.01 0.04 0.08 0.04 0.04 0.07 0.09 0.06 SEQID-00305 A6QLL8 -- -- 1
0.44 0.21 0.08 0.06 0.04 0.04 0.02 0.05 0.08 0.04 0.03 0.06 0.10
0.09 SEQID-00306 B7TJ13 -- -- 1 0.52 0.23 0.06 0.04 0.05 0.06 0.02
0.02 0.07 0.05 0.02 0.05 0.10 0.12 SEQID-00307 P39824 -- -- 1 0.51
0.22 0.07 0.06 0.06 0.07 0.01 0.02 0.05 0.03 0.02 0.08 0.09 0.11
SEQID-00308 P25152 -- -- 1 0.48 0.21 0.07 0.04 0.04 0.05 0.00 0.04
0.09 0.04 0.03 0.06 0.09 0.11 SEQID-00309 O32150 -- -- 1 0.40 0.16
0.05 0.07 0.07 0.09 0.00 0.02 0.07 0.04 0.04 0.03 0.08 0.06
SEQID-00310 Q9K6A3 -- -- 1 0.39 0.14 0.05 0.14 0.04 0.05 0.03 0.05
0.09 0.05 0.02 0.03 0.06 0.02 SEQID-00311 P42249 -- -- 1 0.38 0.14
0.07 0.15 0.05 0.06 0.06 0.06 0.06 0.06 0.02 0.06 0.06 0.06
SEQID-00312 -- -- 1 0.47 0.23 0.03 0.05 0.04 0.04 0.00 0.06 0.13
0.04 0.04 0.06 0.10 0.05 SEQID-00313 P39844 -- -- 1 0.49 0.23 0.05
0.04 0.04 0.07 0.00 0.06 0.07 0.05 0.02 0.05 0.11 0.10 SEQID-00314
P38422 -- -- 1 0.55 0.18 0.06 0.04 0.04 0.04 0.00 0.02 0.10 0.04
0.01 0.05 0.09 0.16 SEQID-00315 P96600 -- -- 1 0.49 0.20 0.04 0.03
0.06 0.06 0.00 0.06 0.10 0.03 0.02 0.07 0.10 0.10 SEQID-00316
P39597 -- -- 1 0.47 0.16 0.05 0.05 0.04 0.07 0.01 0.07 0.06 0.05
0.02 0.04 0.09 0.11 SEQID-00317 Q9K6W0 -- -- 1 0.41 0.20 0.05 0.09
0.07 0.06 0.00 0.07 0.08 0.03 0.01 0.07 0.08 0.04 SEQID-00318
O05512 -- -- 1 0.47 0.19 0.05 0.04 0.07 0.06 0.01 0.04 0.05 0.03
0.03 0.06 0.09 0.07 SEQID-00319 E6TXL6 -- -- 1 0.48 0.21 0.04 0.05
0.06 0.06 0.01 0.05 0.07 0.03 0.04 0.06 0.08 0.06 SEQID-00320
Q9K742 -- -- 1 0.42 0.18 0.03 0.14 0.04 0.06 0.00 0.02 0.13 0.03
0.03 0.06 0.08 0.07 SEQID-00321 P37548 -- -- 1 0.49 0.22 0.04 0.08
0.03 0.06 0.01 0.05 0.07 0.03 0.05 0.07 0.08 0.10 SEQID-00322
O31526 -- -- 1 0.43 0.18 0.06 0.07 0.06 0.09 0.00 0.04 0.04 0.06
0.02 0.04 0.08 0.07 SEQID-00323 O07544 -- -- 1 0.48 0.20 0.03 0.07
0.02 0.05 0.02 0.06 0.06 0.03 0.03 0.07 0.09 0.10 SEQID-00324
O32123 -- -- 1 0.44 0.16 0.03 0.07 0.02 0.04 0.01 0.08 0.10 0.02
0.04 0.04 0.09 0.06 SEQID-00325 P46784 -- -- 1 0.42 0.18 0.02 0.07
0.04 0.02 0.00 0.10 0.10 0.02 0.03 0.04 0.08 0.09 SEQID-00326
406713168 -- -- 1 0.44 0.19 0.03 0.08 0.02 0.03 0.02 0.09 0.10 0.02
0.02 0.04 0.10 0.05 SEQID-00327 GAU 3 -- -- 1 0.53 0.25 0.04 0.04
0.05 0.07 0.00 0.02 0.08 0.03 0.02 0.09 0.10 0.12 SEQID-00328
291571454 -- -- 1 0.45 0.17 0.08 0.20 0.06 0.04 0.00 0.06 0.09 0.02
0.01 0.06 0.07 0.14 SEQID-00329 O82579 -- -- 1 0.47 0.22 0.02 0.20
0.03 0.04 0.01 0.03 0.05 0.02 0.04 0.05 0.06 0.12 SEQID-00330
P0CX55 -- -- 1 0.49 0.22 0.03 0.15 0.06 0.05 0.01 0.06 0.05 0.03
0.06 0.07 0.10 0.08 SEQID-00331 P00648 -- -- 1 0.51 0.19 0.06 0.06
0.04 0.06 0.01 0.06 0.04 0.04 0.03 0.06 0.08 0.10 SEQID-00332
291572097 -- -- 1 0.45 0.22 0.06 0.09 0.03 0.09 0.00 0.05 0.07 0.03
0.03 0.05 0.13 0.04 SEQID-00333 C3B4Y1 -- -- 1 0.52 0.23 0.02 0.05
0.06 0.04 0.01 0.04 0.05 0.02 0.03 0.07 0.11 0.10 SEQID-00334
C6TFG0 -- -- 1 0.42 0.21 0.04 0.18 0.04 0.05 0.00 0.04 0.08 0.03
0.03 0.03 0.11 0.03 SEQID-00335 291571495 -- -- 1 0.38 0.22 0.05
0.19 0.05 0.02 0.00 0.05 0.07 0.04 0.02 0.06 0.11 0.05 SEQID-00336
94FL64 -- -- 1 0.46 0.15 0.06 0.19 0.02 0.02 0.00 0.03 0.07 0.02
0.03 0.04 0.07 0.18 SEQID-00337 IK8X7 -- -- 1 0.46 0.19 0.05 0.06
0.05 0.07 0.02 0.07 0.07 0.03 0.04 0.04 0.08 0.09 SEQID-00338
P07170 -- -- 1 0.47 0.21 0.06 0.06 0.04 0.09 0.00 0.06 0.06 0.04
0.03 0.07 0.10 0.10 SEQID-00339 F0 I61 -- -- 1 0.47 0.21 0.04 0.06
0.06 0.09 0.00 0.03 0.09 0.03 0.05 0.06 0.11 0.09 SEQID-00340
406715507 -- -- 1 0.41 0.23 0.06 0.15 0.03 0.06 0.00 0.03 0.07 0.04
0.02 0.10 0.07 0.06 SEQID-00341 P29311 -- -- 1 0.39 0.18 0.06 0.06
0.03 0.05 0.01 0.03 0.13 0.02 0.03 0.05 0.09 0.07 SEQID-00342
P33673 -- -- 1 0.47 0.15 0.06 0.06 0.07 0.07 0.01 0.04 0.05 0.04
0.01 0.04 0.08 0.10 SEQID-00343 I1LLC0 -- -- 1 0.46 0.22 0.05 0.10
0.04 0.07 0.01 0.03 0.10 0.02 0.05 0.06 0.09 0.10 SEQID-00344
291571381 -- -- 1 0.39 0.22 0.07 0.11 0.05 0.04 0.00 0.08 0.06 0.04
0.03 0.06 0.09 0.04 SEQID-00345 291567248 -- -- 1 0.42 0.21 0.05
0.07 0.06 0.06 0.02 0.08 0.07 0.04 0.02 0.05 0.10 0.06 SEQID-00346
291569666 -- -- 1 0.45 0.21 0.07 0.07 0.03 0.05 0.01 0.05 0.10 0.05
0.03 0.05 0.09 0.07 SEQID-00347 H8XE54 -- -- 1 0.48 0.18 0.09 0.06
0.03 0.08 0.00 0.04 0.07 0.06 0.02 0.06 0.09 0.16 SEQID-00348
B5DG39 -- -- 1 0.59 0.29 0.03 0.03 0.03 0.05 0.01 0.02 0.07 0.05
0.06 0.05 0.11 0.10 SEQID-00349 291567247 -- -- 1 0.45 0.21 0.03
0.09 0.04 0.07 0.01 0.04 0.08 0.06 0.05 0.05 0.10 0.05 SEQID-00350
P28675 -- -- 1 0.49 0.27 0.03 0.05 0.09 0.04 0.02 0.04 0.07 0.06
0.03 0.07 0.14 0.08 SEQID-00351 I1MJC7 -- -- 1 0.52 0.27 0.06 0.04
0.03 0.07 0.00 0.02 0.08 0.06 0.01 0.05 0.13 0.11 SEQID-00352
B4G0K4 -- -- 1 0.54 0.26 0.08 0.06 0.02 0.07 0.00 0.01 0.09 0.05
0.01 0.05 0.12 0.12 SEQID-00353 P45741 -- -- 1 0.43 0.23 0.06 0.05
0.03 0.08 0.00 0.07 0.05 0.03 0.02 0.05 0.12 0.06 SEQID-00354
B7TJ13 -- -- 1 0.52 0.23 0.06 0.04 0.05 0.06 0.02 0.02 0.07 0.05
0.02 0.05 0.10 0.12 SEQID-00355 P504 48 -- -- 1 0.51 0.24 0.04 0.06
0.03 0.06 0.01 0.05 0.06 0.036 0.03 0.05 0.14 0.06 SEQID-00356
I1MBR7 -- -- 1 0.50 0.27 0.04 0.06 0.07 0.06 0.00 0.06 0.09 0.04
0.02 0.07 0.12 0.09 SEQID-00357 291570796 -- -- 1 0.48 0.28 0.05
0.05 0.05 0.05 0.01 0.06 0.09 0.04 0.02 0.10 0.11 0.07 SEQID-00358
291569660 -- -- 1 0.47 0.18 0.05 0.09 0.03 0.06 0.02 0.03 0.08 0.05
0.04 0.05 0.08 0.06 SEQID-00359 291566695 -- -- 1 0.42 0.23 0.06
0.14 0.03 0.07 0.00 0.07 0.07 0.03 0.03 0.07 0.11 0.04 SEQID-00360
Q42795 -- -- 1 0.45 0.21 0.04 0.05 0.06 0.07 0.01 0.05 0.07 0.04
0.03 0.05 0.09 0.07 SEQID-00361 C5 V2 -- -- 1 0.44 0.20 0.04 0.10
0.04 0.05 0.01 0.07 0.09 0.06 0.03 0.05 0.08 0.07 SEQID-00362
P11412 -- -- 1 0.47 0.21 0.04 0.07 0.04 0.07 0.00 0.06 0.09 0.06
0.02 0.05 0.09 0.10 SEQID-00363 P69328 -- 25:640 1 0.42 0.17 0.07
0.04 0.04 0.08 0.01 0.06 0.05 0.04 0.01 0.04 0.07 0.02 SEQID-00364
F1NXK1 -- 1220:1292 0 0.33 0.07 0.02 0.05 0.00 0.06 0.00 0.00 0.35
0.02 0.03 0.04 0.00 0.12 SEQID-00365 P02702 -- 81:162 1 0.44 0.10
0.01 0.11 0.06 0.05 0.08 0.04 0.08 0.02 0.04 0.02 0.05 0.08
SEQID-00366 P38158 -- 118:186 0 0.48 0.07 0.03 0.09 0.07 0.06 0.00
0.02 0.06 0.03 0.00 0.01 0.04 0.09 SEQID-00367 Q12329 -- 69:138 0
0.11 0.01 0.02 0.09 0.07 0.12 0.01 0.09 0.12 0.05 0.02 0.00 0.00
0.00 SEQID-00368 I LP30 -- 84:159 1 0.51 0.29 0.01 0.12 0.06 0.04
0.01 0.01 0.17 0.00 0.01 0.10 0.17 0.07 SEQID-00369 F1MZX6 --
1269:1337 0 0.48 0.23 0.06 0.04 0.03 0.06 0.00 0.20 0.12 0.01 0.05
0.06 0.17 0.11 SEQID-00370 I KZL6 -- 1621:1693 0 0.37 0.23 0.08
0.07 0.08 0.07 0.00 0.17 0.14 0.01 0.02 0.04 0.16 0.06 SEQID-00371
K7TNK3 -- 1070:1154 1 0.36 0.18 0.05 0.08 0.01 0.04 0.00 0.16 0.24
0.01 0.05 0.03 0.12 0.05 SEQID-00372 291570621 -- 821:890 1 0.40
0.21 0.03 0.13 0.03 0.05 0.00 0.12 0.11 0.03 0.02 0.07 0.11 0.05
SEQID-00373 291572019 -- 775:851 1 0.37 0.21 0.02 0.12 0.01 0.06
0.01 0.11 0.10 0.01 0.02 0.09 0.09 0.04 SEQID-00374 P38427 --
534:617 1 0.44 0.21 0.02 0.17 0.02 0.06 0.01 0.10
0.06 0.02 0.03 0.04 0.09 0.05 SEQID-00375 A6QP89 -- 288:356 0 0.45
0.21 0.04 0.19 0.01 0.06 0.00 0.03 0.06 0.03 0.00 0.06 0.08 0.13
SEQID-00376 I1JDH6 -- 29:142 1 0.48 0.25 0.03 0.17 0.02 0.03 0.01
0.05 0.09 0.05 0.03 0.08 0.08 0.10 SEQID-00377 406710335 -- 6:235 0
0.37 0.17 0.04 0.03 0.02 0.03 0.01 0.25 0.19 0.01 0.02 0.02 0.11
0.06 SEQID-00378 I3JTN2 -- 3518:3698 1 0.38 0.17 0.05 0.02 0.07
0.06 0.01 0.16 0.14 0.02 0.02 0.04 0.09 0.10 SEQID-00379 F1NPH8 --
520:646 1 0.39 0.20 0.05 0.06 0.02 0.02 0.02 0.25 0.15 0.00 0.04
0.01 0.14 0.08 SEQID-00380 F1NPH8 -- 673:746 1 0.43 0.25 0.04 0.11
0.04 0.03 0.02 0.06 0.20 0.01 0.02 0.03 0.20 0.07 SEQID-00381
G3MYN5 -- 12:124 1 0.46 0.25 0.06 0.15 0.01 0.06 0.02 0.06 0.13
0.01 0.09 0.06 0.18 0.12 SEQID-00382 G3MYN5 -- 88:158 1 0.50 0.23
0.03 0.19 0.01 0.03 0.00 0.00 0.08 0.02 0.02 0.01 0.14 0.17
SEQID-00383 C6TFG0 -- 19:88 0 0.36 0.22 0.09 0.24 0.05 0.03 0.01
0.01 0.12 0.03 0.00 0.03 0.17 0.06 SEQID-00384 C6TFG0 -- 42:140 1
0.46 0.25 0.04 0.21 0.06 0.03 0.00 0.04 0.08 0.02 0.09 0.05 0.15
0.05 SEQID-00385 P C0X0 -- -- 0 0.47 0.27 0.02 0.21 0.03 0.05 0.00
0.02 0.10 0.04 0.00 0.04 0.09 0.07 SEQID-00386 291568762 -- -- 0
0.39 0.26 0.03 0.08 0.03 0.06 0.00 0.10 0.08 0.02 0.00 0.07 0.12
0.05 SEQID-00387 4FKR5 -- -- 1 0.49 0.25 0.05 0.07 0.02 0.08 0.02
0.04 0.08 0.05 0.01 0.06 0.08 0.13 SEQID-00388 4FKR5 -- 1:169 1
0.49 0.25 0.05 0.07 0.02 0.08 0.02 0.04 0.08 0.05 0.01 0.06 0.08
0.13 SEQID-00389 291567798 -- -- 0 0.44 0.26 0.04 0.13 0.05 0.02
0.01 0.05 0.08 0.06 0.01 0.06 0.08 0.11 SEQID-00390 P39824 --
37:306 1 0.48 0.22 0.07 0.06 0.07 0.08 0.00 0.02 0.06 0.03 0.01
0.08 0.09 0.11 SEQID-00391 P39844 -- 30:491 1 0.48 0.22 0.05 0.04
0.04 0.08 0.00 0.03 0.08 0.05 0.02 0.05 0.11 0.10 SEQID-00392
P96600 -- 19:350 1 0.48 0.20 0.03 0.03 0.06 0.07 0.00 0.07 0.10
0.03 0.03 0.06 0.09 0.10 SEQID-00393 P39597 -- 29:416 1 0.47 0.17
0.05 0.05 0.05 0.07 0.01 0.07 0.06 0.05 0.02 0.04 0.09 0.11
SEQID-00394 O05512 -- 27:362 1 0.45 0.17 0.05 0.04 0.07 0.07 0.01
0.05 0.05 0.04 0.03 0.06 0.08 0.06 SEQID-00395 P45741 -- 31:409 1
0.41 0.22 0.06 0.06 0.03 0.08 0.00 0.07 0.06 0.03 0.02 0.05 0.11
0.05 SEQID-00396 P25959 -- 29:124 1 0.45 0.21 0.01 0.10 0.03 0.03
0.01 0.10 0.12 0.03 0.02 0.07 0.10 0.09 SEQID-00397 P54450 --
45:250 1 0.50 0.16 0.03 0.04 0.08 0.05 0.01 0.03 0.05 0.04 0.04
0.06 0.08 0.13 SEQID-00398 P37965 -- 27:299 1 0.52 0.21 0.04 0.04
0.04 0.06 0.00 0.05 0.07 0.03 0.05 0.04 0.11 0.11 SEQID-00399
O34966 -- 31:319 1 0.49 0.19 0.06 0.00 0.03 0.08 0.00 0.05 0.12
0.02 0.05 0.05 0.08 0.13 SEQID-00400 P54427 -- 24:267 1 0.52 0.19
0.03 0.07 0.04 0.08 0.00 0.05 0.08 0.03 0.03 0.05 0.08 0.10
SEQID-00401 P39632 -- 31:154 1 0.51 0.25 0.04 0.07 0.04 0.07 0.00
0.04 0.07 0.04 0.01 0.06 0.11 0.07 SEQID-00402 O34348 -- 29:315 1
0.50 0.22 0.04 0.05 0.06 0.09 0.00 0.02 0.09 0.03 0.03 0.07 0.08
0.14 SEQID-00403 P25152 -- 25:455 1 0.46 0.20 0.07 0.04 0.04 0.05
0.00 0.04 0.10 0.04 0.03 0.07 0.08 0.11 SEQID-00404 P71014 --
29:181 1 0.49 0.18 0.06 0.06 0.08 0.03 0.01 0.02 0.06 0.03 0.01
0.03 0.12 0.03 SEQID-00405 P94522 -- 33:323 1 0.43 0.17 0.04 0.03
0.08 0.06 0.01 0.03 0.03 0.06 0.01 0.06 0.09 0.07 SEQID-00406
P54507 -- 28:261 1 0.48 0.17 0.05 0.00 0.09 0.10 0.00 0.05 0.07
0.04 0.01 0.04 0.08 0.15 SEQID-00407 P00691 -- 34:659 1 0.42 0.16
0.05 0.05 0.09 0.083 0.00 0.05 0.04 0.04 0.03 0.06 0.06 0.06
SEQID-00408 A2QLC7 -- 19:265 1 0.41 0.19 0.06 0.08 0.07 0.07 0.00
0.04 0.08 0.03 0.04 0.06 0.09 0.02 SEQID-00409 A2QEJ9 -- 17:443 1
0.44 0.18 0.05 0.05 0.07 0.08 0.02 0.02 0.05 0.04 0.02 0.05 0.08
0.06 SEQID-00410 A2QXG2 -- 21:338 1 0.49 0.25 0.05 0.04 0.06 0.06
0.00 0.05 0.06 0.03 0.02 0.08 0.12 0.04 SEQID-00411 A2QUK3 --
20:392 1 0.42 0.19 0.04 0.11 0.05 0.09 0.01 0.03 0.06 0.05 0.03
0.05 0.06 0.04 SEQID-00412 A2QAC1 -- 15:865 1 0.43 0.19 0.04 0.06
0.05 0.08 0.01 0.04 0.05 0.04 0.03 0.04 0.08 0.04 SEQID-00413
A2QJI1 -- 18:375 1 0.44 0.18 0.05 0.04 0.08 0.08 0.02 0.04 0.04
0.03 0.02 0.03 0.10 0.04 SEQID-00414 A2QAN3 -- 19:1007 1 0.44 0.20
0.04 0.04 0.06 0.06 0.00 0.03 0.06 0.05 0.02 0.05 0.10 0.05
SEQID-00415 A2QWU9 -- 22:931 1 0.45 0.20 0.04 0.06 0.05 0.07 0.00
0.05 0.05 0.04 0.03 0.05 0.09 0.04 SEQID-00416 A2QE24 -- 24:403 1
0.45 0.22 0.04 0.04 0.07 0.06 0.01 0.07 0.05 0.05 0.02 0.08 0.07
0.04 SEQID-00417 A2QFV7 -- 20:327 1 0.47 0.20 0.07 0.03 0.06 0.07
0.01 0.03 0.05 0.04 0.03 0.08 0.07 0.06 SEQID-00418 A2RAR6 --
23:416 1 0.43 0.16 0.06 0.05 0.04 0.03 0.01 0.07 0.04 0.05 0.03
0.03 0.07 0.04 SEQID-00419 B0YIR9 -- 20:860 1 0.39 0.18 0.06 0.06
0.07 0.07 0.01 0.04 0.07 0.06 0.01 0.04 0.08 0.04 SEQID-00420
A2QCV8 -- 19:362 1 0.49 0.19 0.04 0.02 0.06 0.08 0.03 0.03 0.04
0.07 0.02 0.08 0.05 0.10 SEQID-00421 P56526 -- 20:985 1 0.43 0.19
0.06 0.05 0.06 0.06 0.01 0.05 0.05 0.04 0.03 0.04 0.08 0.03
SEQID-00422 A2QUZ1 -- 20:458 1 0.38 0.15 0.06 0.05 0.06 0.09 0.01
0.02 0.05 0.05 0.00 0.03 0.06 0.07 SEQID-00423 P00692 -- 32:514 1
0.43 0.15 0.04 0.06 0.05 0.03 0.00 0.05 0.07 0.05 0.04 0.04 0.06
0.07 SEQID-00424 P0C1B3 -- 22:499 1 0.43 0.19 0.06 0.03 0.06 0.09
0.02 0.05 0.03 0.05 0.02 0.06 0.07 0.05 SEQID-00425 P00723 -- -- 1
0.47 0.19 0.03 0.05 0.06 0.07 0.01 0.03 0.09 0.03 0.04 0.05 0.07
0.09 SEQID-00426 O59952 -- 23:291 0 0.42 0.20 0.05 0.07 0.07 0.07
0.02 0.03 0.05 0.05 0.03 0.06 0.08 0.03 SEQID-00427 D4PHA8 -- -- 1
0.44 0.21 0.09 0.03 0.05 0.05 0.01 0.05 0.05 0.04 0.02 0.07 0.09
0.05 SEQID-00428 P19515 -- 95:363 0 0.55 0.00 0.02 0.04 0.01 0.14
0.00 0.06 0.13 0.01 0.02 0.00 0.00 0.16 SEQID-00429 P06278 -- -- 0
0.56 0.00 0.02 0.04 0.01 0.14 0.00 0.06 0.13 0.01 0.37 0.00 0.00
0.16 SEQID-00430 NA -- 0 0.55 0.00 0.02 0.04 0.01 0.14 0.00 0.06
0.13 0.01 0.02 0.00 0.00 0.16 SEQID-00431 NA -- 0 0.56 0.00 0.02
0.04 0.01 0.14 0.00 0.06 0.13 0.01 0.37 0.00 0.00 0.16 SEQID-00432
NA -- 0 0.55 0.00 0.02 0.04 0.01 0.14 0.00 0.06 0.13 0.01 0.02 0.00
0.00 0.50 SEQID-00433 NA -- 0 0.20 0.00 0.02 0.42 0.01 0.13 0.00
0.06 0.12 0.01 0.02 0.00 0.00 0.15 SEQID-00434 NA -- 0 0.22 0.00
0.02 0.04 0.01 0.14 0.00 0.40 0.13 0.01 0.02 0.00 0.00 0.16
SEQID-00435 NA -- 0 0.30 0.28 0.02 0.34 0.01 0.13 0.00 0.03 0.13
0.01 0.00 0.00 0.28 0.00 SEQID-00436 NA -- 1 0.72 0.22 0.00 0.00
0.00 0.14 0.00 0.00 0.13 0.00 0.07 0.04 0.13 0.21 SEQID-00437 NA --
1 1.00 0.26 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.12 0.04 0.17
0.35 SEQID-00438 NA -- 0 0.53 0.31 0.02 0.04 0.01 0.15 0.00 0.07
0.13 0.01 0.02 0.12 0.19 0.17 SEQID-00439 NA -- 0 0.53 0.30 0.02
0.04 0.02 0.15 0.00 0.07 0.14 0.01 0.02 0.00 0.19 0.17 SEQID-00440
NA -- 0 0.55 0.18 0.02 0.04 0.01 0.14 0.00 0.06 0.13 0.01 0.02 0.00
0.18 0.16 SEQID-00441 NA -- 0 0.57 0.18 0.02 0.04 0.01 0.14 0.00
0.06 0.12 0.01 0.02 0.00 0.18 0.15 SEQID-00442 NA -- 0 0.53 0.19
0.02 0.04 0.02 0.15 0.00 0.07 0.14 0.01 0.02 0.00 0.19 0.17
SEQID-00443 NA -- 0 0.54 0.19 0.02 0.04 0.01 0.15 0.00 0.07 0.13
0.01 0.02 0.00 0.19 0.16 SEQID-00444 NA -- 0 0.54 0.20 0.02 0.04
0.01 0.15 0.00 0.07 0.13 0.01 0.14 0.00 0.19 0.16 SEQID-00445 NA --
0 0.41 0.19 0.02 0.04 0.01 0.15 0.00 0.20 0.13 0.01 0.02 0.00 0.19
0.16 SEQID-00446 NA -- 0 0.32 0.28 0.02 0.27 0.01 0.14 0.00 0.06
0.13 0.01 0.00 0.00 0.28 0.00 SEQID-00447 NA -- 0 0.58 0.19 0.02
0.00 0.01 0.15 0.00 0.07 0.13 0.01 0.00 0.00 0.19 0.35 SEQID-00448
NA -- 0 0.21 0.18 0.02 0.39 0.01 0.14 0.00 0.06 0.12 0.01 0.00 0.00
0.18 0.00 SEQID-00449 NA -- 0 0.53 0.31 0.02 0.04 0.01 0.15 0.00
0.07 0.13 0.01 0.02 0.31 0.00 0.17 SEQID-00450 NA -- 0 0.51 0.28
0.02 0.04 0.02 0.16 0.00 0.07 0.14 0.01 0.02 0.00 0.00 0.17
SEQID-00451 NA -- 0 0.57 0.00 0.02 0.04 0.01 0.14 0.00 0.06 0.12
0.01 0.02 0.00 0.00 0.15 SEQID-00452 NA -- 0 0.61 0.00 0.02 0.03
0.01 0.12 0.00 0.06 0.11 0.01 0.01 0.00 0.00 0.14 SEQID-00453 NA --
0 0.52 0.00 0.02 0.04 0.02 0.15 0.00 0.07 0.14 0.01 0.02 0.00 0.00
0.17 SEQID-00454 NA -- 0 0.59 0.28 0.00 0.41 0.00 0.00 0.00 0.00
0.00 0.00 0.00 0.00 0.28 0.30 SEQID-00455 NA -- 0 0.69 0.40 0.00
0.30 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.40 0.30 SEQID-00456
NA -- 0 0.71 0.51 0.00 0.29 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
0.51 0.20 SEQID-00457 NA -- 0 0.32 0.32 0.00 0.00 0.00 0.30 0.00
0.00 0.38 0.00 0.00 0.00 0.32 0.00 SEQID-00458 NA -- 0 0.43 0.43
0.00 0.00 0.00 0.29 0.00 0.00 0.27 0.00 0.00 0.00 0.43 0.00
SEQID-00459 NA -- 0 0.55 0.55 0.00 0.00 0.00 0.20 0.00 0.00 0.26
0.00 0.00 0.00 0.55 0.00 SEQID-00460 NA -- 0 0.41 0.30 0.00 0.25
0.00 0.15 0.00 0.00 0.19 0.00 0.00 0.00 0.30 0.12 SEQID-00461 NA --
0 0.49 0.40 0.00 0.27 0.00 0.12 0.00 0.00 0.12 0.00 0.00 0.00 0.40
0.08 SEQID-00462 NA -- 0 0.62 0.53 0.00 0.15 0.00 0.13 0.00 0.00
0.11 0.00 0.00 0.00 0.53 0.09 SEQID-00463 NA -- 0 0.59 0.28 0.00
0.41 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.28 0.30 SEQID-00464
NA -- 0 0.62 0.36 0.00 0.35 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
0.36 0.26 SEQID-00465 NA -- 0 0.71 0.46 0.00 0.29 0.00 0.00 0.00
0.00 0.00 0.00 0.00 0.00 0.46 0.25 SEQID-00466 NA -- 0 0.32 0.32
0.00 0.00 0.00 0.30 0.00 0.00 0.38 0.00 0.00 0.00 0.32 0.00
SEQID-00467 NA -- 0 0.40 0.40 0.00 0.00 0.00 0.26 0.00 0.00 0.34
0.00 0.00 0.00 0.40 0.00 SEQID-00468 NA -- 0 0.50 0.50 0.00 0.00
0.00 0.24 0.00 0.00 0.26 0.00 0.00 0.00 0.50 0.00 SEQID-00469 NA --
0 0.42 0.30 0.00 0.25 0.00 0.20 0.00 0.00 0.14 0.00 0.00 0.00 0.30
0.12 SEQID-00470 NA -- 0 0.50 0.38 0.00 0.19 0.00 0.19 0.00 0.00
0.12 0.00 0.00 0.00 0.38 0.12 SEQID-00471 NA -- 0 0.58 0.48 0.00
0.19 0.00 0.17 0.00 0.00 0.05 0.00 0.00 0.00 0.48 0.10 SEQID-00472
NA -- 0 0.57 0.25 0.00 0.43 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
0.25 0.32 SEQID-00473 NA -- 0 0.75 0.37 0.00 0.24 0.00 0.00 0.00
0.00 0.00 0.00 0.00 0.00 0.37 0.38 SEQID-00474 NA -- 0 0.67 0.46
0.00 0.32 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.46 0.22
SEQID-00475 NA -- 0 0.28 0.28 0.00 0.00 0.00 0.32 0.00 0.00 0.39
0.00 0.00 0.00 0.28 0.00 SEQID-00476 NA -- 0 0.40 0.40 0.00 0.00
0.00 0.38 0.00 0.00 0.22 0.00 0.00 0.00 0.40 0.00 SEQID-00477 NA --
0 0.49 0.49 0.00 0.00 0.00 0.21 0.00 0.00 0.29 0.00 0.00 0.00 0.49
0.00 SEQID-00478 NA -- 0 0.40 0.27 0.00 0.24 0.00 0.15 0.00 0.00
0.20 0.00 0.00 0.00 0.27 0.13 SEQID-00479 NA -- 0 0.52 0.37 0.00
0.29 0.00 0.08 0.00 0.00 0.12 0.00 0.00 0.00 0.37 0.15 SEQID-00480
NA -- 0 0.62 0.48 0.00 0.11 0.00 0.16 0.00 0.00 0.11 0.00 0.00 0.00
0.48 0.14 SEQID-00481 K9HYS1 -- 1 0.54 0.22 0.07 0.07 0.03 0.02
0.00 0.05 0.01 0.02 0.02 0.06 0.11 0.05 SEQID-00482 P39929 -- 1
0.44 0.20 0.04 0.05 0.08 0.06 0.00 0.06 0.17 0.02 0.02 0.06 0.09
0.10 SEQID-00483 F1MLW7 -- 1 0.42 0.19 0.04 0.04 0.03 0.03 0.03
0.04 0.04 0.05 0.01 0.03 0.08 0.05 SEQID-00484 P17891 -- 1 0.38
0.14 0.05 0.06 0.05 0.16 0.00 0.06 0.14 0.02 0.01 0.05 0.06 0.11
SEQID-00485 G1K3R9 -- 1 0.46 0.16 0.05 0.06 0.06 0.08 0.01 0.00
0.05 0.04 0.01 0.06 0.06 0.09 SEQID-00486 O78750 -- 1 0.56 0.27
0.02 0.04 0.02 0.04 0.01 0.03 0.07 0.02 0.03 0.08 0.14 0.03
SEQID-00487 D5A2W2 -- 1 0.61 0.27 0.03 0.05 0.00 0.02 0.01 0.03
0.04 0.04 0.03 0.09 0.09 0.05 SEQID-00488 K9HRR8 -- 1 0.52 0.21
0.04 0.05 0.06 0.05 0.02 0.04 0.09 0.04 0.03 0.06 0.08 0.10
SEQID-00489 P07260 -- 1 0.52 0.20 0.03 0.05 0.04 0.08 0.00 0.03
0.10 0.03 0.04 0.05 0.09 0.10 SEQID-00490 K1WPG5 -- 1 0.58 0.34
0.06 0.04 0.04 0.03 0.00 0.03 0.05 0.04 0.01 0.06 0.17 0.01
SEQID-00491 D7SYA1 -- 1 0.46 0.15 0.06 0.19 0.03 0.02 0.00 0.03
0.07 0.02 0.03 0.03 0.07 0.18 SEQID-00492 D7SLS3 -- 1 0.42 0.16
0.03 0.21 0.04 0.02 0.01 0.04 0.04 0.03 0.04 0.04 0.06 0.10
SEQID-00493 A5PJM2 -- 1 0.42 0.14 0.04 0.15 0.02 0.06 0.02 0.05
0.14 0.02 0.04 0.02 0.09 0.12 SEQID-00494 B9VGZ5 -- 1 0.57 0.32
0.06 0.05 0.03 0.05 0.00 0.04 0.06 0.03 0.02 0.08 0.15 0.10
SEQID-00495 D7UC61 -- 1 0.46 0.15 0.09 0.04 0.04 0.04 0.01 0.02
0.17 0.02 0.01 0.02 0.06 0.19 SEQID-00496 P52286 -- 1 0.38 0.18
0.03 0.09 0.09 0.13 0.00 0.02 0.13 0.01 0.02 0.05 0.07 0.06
SEQID-00497 P49435 -- 0 0.50 0.26 0.07 0.03 0.04 0.04 0.01 0.04
0.11 0.04 0.01 0.07 0.14 0.09 SEQID-00498 K1VXA7 -- 0 0.49 0.30
0.05 0.09 0.05 0.05 0.00 0.06 0.08 0.04 0.01 0.07 0.15 0.06
SEQID-00499 B6UI23 -- 1 0.34 0.17 0.18 0.12 0.01 0.09 0.03 0.03
0.06 0.03 0.02 0.03 0.08 0.04
SEQID-00500 Q67VZ0 -- 1 0.40 0.16 0.08 0.10 0.03 0.06 0.09 0.03
0.06 0.09 0.04 0.02 0.06 0.01 SEQID-00501 K9HZV3 -- 1 0.50 0.16
0.03 0.04 0.04 0.05 0.00 0.03 0.07 0.05 0.02 0.04 0.07 0.05
SEQID-00502 C6SZX7 -- 1 0.48 0.20 0.06 0.03 0.09 0.07 0.02 0.03
0.06 0.04 0.01 0.04 0.09 0.12 SEQID-00503 B4FFR7 -- 1 0.49 0.14
0.07 0.14 0.01 0.03 0.01 0.05 0.07 0.04 0.02 0.05 0.05 0.22
SEQID-00504 K9HEB9 -- 1 0.47 0.21 0.06 0.07 0.08 0.02 0.01 0.09
0.03 0.05 0.02 0.07 0.06 0.02 SEQID-00505 Q3SYR8 -- 1 0.42 0.21
0.03 0.09 0.06 0.08 0.06 0.04 0.07 0.01 0.01 0.06 0.06 0.06
SEQID-00506 K9I599 -- 1 0.62 0.29 0.07 0.03 0.02 0.02 0.00 0.02
0.04 0.03 0.05 0.11 0.12 0.05 SEQID-00507 K9HG54 -- 1 0.51 0.14
0.06 0.03 0.04 0.06 0.00 0.02 0.07 0.02 0.00 0.03 0.06 0.10
SEQID-00508 D7U394 -- 1 0.54 0.25 0.05 0.04 0.03 0.05 0.03 0.03
0.07 0.06 0.03 0.05 0.07 0.08 SEQID-00509 Q3IJ07 -- 1 0.43 0.13
0.03 0.13 0.03 0.08 0.00 0.05 0.17 0.02 0.03 0.04 0.07 0.19
SEQID-00510 G1NCP5 -- 1 0.44 0.15 0.04 0.06 0.05 0.03 0.02 0.05
0.16 0.02 0.01 0.05 0.06 0.10 SEQID-00511 K1WAW9 -- 1 0.40 0.15
0.05 0.06 0.03 0.03 0.02 0.07 0.08 0.06 0.02 0.02 0.07 0.05
SEQID-00512 Q8H920 -- 1 0.44 0.21 0.17 0.09 0.02 0.02 0.02 0.03
0.03 0.07 0.04 0.01 0.16 0.01 SEQID-00513 P06673 -- 0 0.33 0.16
0.10 0.04 0.02 0.01 0.04 0.17 0.02 0.04 0.00 0.01 0.11 0.01
SEQID-00514 D4ZPH7 -- 1 0.46 0.26 0.07 0.11 0.06 0.02 0.00 0.06
0.07 0.07 0.01 0.06 0.07 0.12 SEQID-00515 Q08969 -- 1 0.25 0.05
0.01 0.10 0.09 0.13 0.00 0.17 0.06 0.07 0.03 0.01 0.04 0.03
SEQID-00516 P04037 -- 1 0.46 0.22 0.03 0.07 0.03 0.07 0.02 0.04
0.07 0.04 0.03 0.05 0.11 0.07 SEQID-00517 P04449 -- 1 0.49 0.13
0.07 0.14 0.03 0.02 0.00 0.05 0.07 0.03 0.02 0.04 0.04 0.22
SEQID-00518 FOTIG9 -- 1 0.52 0.23 0.03 0.08 0.04 0.04 0.00 0.03
0.07 0.06 0.03 0.06 0.04 0.14 SEQID-00519 B6UD91 -- 1 0.38 0.20
0.16 0.08 0.02 0.09 0.03 0.02 0.07 0.05 0.01 0.04 0.11 0.05
SEQID-00520 P63246 -- 1 0.45 0.17 0.05 0.11 0.03 0.07 0.01 0.05
0.14 0.02 0.03 0.02 0.11 0.16 SEQID-00521 P72505 -- 0 0.41 0.23
0.09 0.07 0.04 0.07 0.01 0.04 0.04 0.04 0.00 0.08 0.09 0.06
SEQID-00522 O49817 -- 0 0.40 0.03 0.10 0.04 0.03 0.08 0.00 0.17
0.08 0.04 0.02 0.01 0.01 0.16 SEQID-00523 K1X7Q4 -- 0 0.51 0.19
0.04 0.05 0.05 0.00 0.00 0.06 0.08 0.04 0.00 0.05 0.12 0.04
SEQID-00524 P79395 -- 1 0.48 0.19 0.03 0.06 0.07 0.01 0.00 0.02
0.08 0.02 0.04 0.04 0.06 0.10 SEQID-00525 P01095 -- 0 0.64 0.25
0.02 0.00 0.07 0.08 0.00 0.00 0.11 0.02 0.10 0.08 0.07 0.17
SEQID-00526 B1N67 -- 0 0.41 0.13 0.06 0.17 0.03 0.01 0.10 0.02 0.08
0.04 0.02 0.01 0.07 0.03 SEQID-00527 D4ZQ -- 1 0.40 0.18 0.05 0.09
0.00 0.07 0.11 0.03 0.06 0.04 0.02 0.05 0.06 0.04 SEQID-00528
P38711 -- 0 0.53 0.21 0.05 0.07 0.01 0.06 0.06 0.04 0.04 0.03 0.05
0.01 0.11 0.10 SEQID-00529 B2BN60 -- 0 0.38 0.14 0.02 0.11 0.06
0.04 0.00 0.05 0.11 0.05 0.00 0.07 0.01 0.05 SEQID-00530 Q10ST8 --
0 0.37 0.20 0.13 0.10 0.04 0.01 0.10 0.05 0.00 0.08 0.01 0.02 0.07
0.04 SEQID-00531 P14903 -- 0 0.55 0.25 0.09 0.03 0.05 0.04 0.06
0.05 0.05 0.02 0.00 0.06 0.15 0.08 SEQID-00532 D4ZX53 -- 0 0.44
0.28 0.06 0.10 0.02 0.03 0.00 0.02 0.11 0.05 0.02 0.09 0.03 0.03
SEQID-00533 D4ZPG3 -- 0 0.47 0.23 0.04 0.15 0.03 0.06 0.00 0.05
0.08 0.01 0.00 0.05 0.08 0.08 SEQID-00534 D4ZUU2 -- 0 0.33 0.13
0.04 0.15 0.03 0.07 0.01 0.01 0.12 0.09 0.00 0.02 0.05 0.05
SEQID-00535 G5E604 -- 0 0.30 0.16 0.06 0.10 0.06 0.04 0.02 0.08
0.02 0.06 0.00 0.04 0.06 0.00 SEQID-00536 O82575 -- 0 0.58 0.10
0.09 0.00 0.00 0.04 0.00 0.01 0.20 0.04 0.23 0.04 0.05 0.18
SEQID-00537 Q08245 -- 0 0.42 0.14 0.08 0.01 0.07 0.03 0.00 0.11
0.21 0.02 0.00 0.04 0.04 0.20 SEQID-00538 F1P2P7 -- 0 0.49 0.18
0.06 0.04 0.04 0.05 0.02 0.04 0.14 0.03 0.08 0.04 0.09 0.08
SEQID-00539 Q9N109 -- 0 0.53 0.30 0.05 0.06 0.06 0.06 0.01 0.07
0.07 0.03 0.02 0.09 0.12 0.09 SEQID-00540 K1W1H1 -- 0 0.41 0.21
0.05 0.23 0.02 0.06 0.00 0.03 0.05 0.05 0.01 0.06 0.08 0.08
SEQID-00541 K9I1Y2 -- 1 0.48 0.29 0.01 0.14 0.06 0.03 0.01 0.04
0.04 0.05 0.04 0.12 0.08 0.07 SEQID-00542 K9HG97 -- 0 0.41 0.23
0.08 0.09 0.04 0.03 0.00 0.05 0.08 0.08 0.03 0.04 0.12 0.13
SEQID-00543 K9HDT0 -- 1 0.42 0.16 0.03 0.11 0.06 0.06 0.02 0.04
0.06 0.04 0.01 0.05 0.05 0.04 SEQID-00544 Q5XQ56 -- 0 0.45 0.20
0.12 0.06 0.01 0.07 0.00 0.07 0.06 0.03 0.05 0.04 0.11 0.06
SEQID-00545 P00427 -- 0 0.39 0.19 0.06 0.13 0.05 0.06 0.01 0.03
0.12 0.01 0.02 0.03 0.10 0.07 SEQID-00546 Q12513 -- 0 0.39 0.20
0.04 0.07 0.09 0.11 0.01 0.03 0.12 0.03 0.02 0.08 0.07 0.08
SEQID-00547 E78SD7 -- 0 0.49 0.09 0.08 0.04 0.04 0.03 0.00 0.04
0.10 0.08 0.08 0.01 0.01 0.12 SEQID-00548 Q7YS10 -- 1 0.59 0.27
0.03 0.00 0.03 0.05 0.02 0.09 0.12 0.04 0.03 0.08 0.13 0.11
SEQID-00549 P21306 -- 0 0.40 0.15 0.12 0.07 0.05 0.02 0.00 0.08
0.04 0.02 0.00 0.05 0.07 0.08 SEQID-00550 D4ZT65 -- 0 0.49 0.38
0.09 0.06 0.01 0.05 0.00 0.02 0.10 0.02 0.00 0.09 0.10 0.05
SEQID-00551 B6S 9 -- 0 0.41 0.18 0.05 0.21 0.03 0.00 0.09 0.03 0.06
0.04 0.05 0.00 0.11 0.01 SEQID-00552 P50263 -- 0 0.45 0.03 0.03
0.04 0.12 0.10 0.00 0.06 0.06 0.06 0.05 0.01 0.01 0.16 SEQID-00553
K6EQ38 -- 0 0.39 0.05 0.08 0.00 0.00 0.07 0.00 0.01 0.15 0.00 0.01
0.01 0.00 0.23 SEQID-00554 K9H8H5 -- 1 0.38 0.16 0.09 0.17 0.06
0.03 0.04 0.00 0.05 0.04 0.03 0.06 0.01 0.12 SEQID-00555 D4ZXX9 --
0 0.45 0.26 0.03 0.17 0.02 0.02 0.00 0.07 0.09 0.04 0.01 0.12 0.04
0.08 SEQID-00556 4FEE7 -- 0 0.33 0.13 0.08 0.22 0.05 0.04 0.05 0.03
0.03 0.04 0.06 0.04 0.02 0.03 SEQID-00557 G3MXD9 -- 0 0.47 0.27
0.03 0.06 0.03 0.03 0.02 0.06 0.03 0.04 0.00 0.02 0.14 0.04
SEQID-00558 P53849 -- 0 0.36 0.09 0.02 0.07 0.06 0.05 0.13 0.05
0.07 0.04 0.06 0.03 0.03 0.10 SEQID-00559 P0C030 -- 0 0.50 0.26
0.03 0.07 0.02 0.08 0.00 0.07 0.10 0.04 0.02 0.11 0.11 0.11
SEQID-00560 Q6PY61 -- 0 0.55 0.10 0.02 0.00 0.02 0.13 0.00 0.01
0.12 0.07 0.18 0.08 0.01 0.26 SEQID-00561 D5A2Z0 -- 1 0.68 0.36
0.03 0.02 0.03 0.02 0.01 0.02 0.03 0.06 0.03 0.18 0.14 0.04
SEQID-00562 F0TIX0 -- 0 0.40 0.18 0.07 0.00 0.08 0.19 0.01 0.04
0.11 0.03 0.01 0.03 0.08 0.13 SEQID-00563 Q65XV6 -- 1 0.50 0.21
0.07 0.07 0.04 0.07 0.02 0.00 0.05 0.07 0.04 0.08 0.06 0.09
SEQID-00564 B6T878 -- 0 0.51 0.17 0.09 0.05 0.02 0.03 0.00 0.02
0.09 0.03 0.02 0.07 0.06 0.22 SEQID-00565 D7UCH9 -- 1 0.56 0.28
0.06 0.04 0.02 0.05 0.01 0.01 0.06 0.03 0.04 0.09 0.13 0.10
SEQID-00566 M1B8F8 -- 0 0.38 0.15 0.04 0.02 0.04 0.03 0.11 0.02
0.07 0.06 0.03 0.05 0.07 0.08 SEQID-00567 B4FUW2 -- 1 0.42 0.17
0.03 0.22 0.04 0.02 0.01 0.05 0.04 0.04 0.04 0.03 0.07 0.10
SEQID-00568 B4FUS2 -- 1 0.51 0.20 0.02 0.16 0.05 0.07 0.01 0.04
0.04 0.04 0.03 0.04 0.09 0.12 SEQID-00569 P02701 -- 1 0.56 0.22
0.03 0.07 0.07 0.03 0.01 0.03 0.05 0.04 0.02 0.05 0.11 0.07
SEQID-00570 P40185 -- 0 0.48 0.23 0.07 0.05 0.09 0.03 0.01 0.04
0.06 0.01 0.03 0.04 0.08 0.08 SEQID-00571 P02074 -- 0 0.54 0.25
0.08 0.06 0.05 0.05 0.01 0.02 0.07 0.05 0.06 0.00 0.13 0.07
SEQID-00572 M0ZHX8 -- 0 0.54 0.17 0.06 0.05 0.02 0.02 0.00 0.02
0.10 0.03 0.02 0.07 0.05 0.23 SEQID-00573 Q9M3H6 -- 0 0.54 0.17
0.08 0.05 0.02 0.02 0.00 0.02 0.10 0.02 0.02 0.07 0.04 0.23
SEQID-00574 F0TIG5 -- 0 0.44 0.19 0.04 0.14 0.05 0.03 0.00 0.03
0.03 0.05 0.04 0.04 0.07 0.12 SEQID-00575 B6SIA2 -- 0 0.33 0.13
0.08 0.22 0.03 0.04 0.05 0.03 0.04 0.04 0.05 0.04 0.01 0.09
SEQID-00576 K9HNE7 -- 1 0.42 0.21 0.09 0.04 0.06 0.07 0.06 0.05
0.00 0.04 0.03 0.03 0.05 0.04 SEQID-00577 P02294 -- 0 0.47 0.16
0.08 0.07 0.02 0.02 0.00 0.04 0.07 0.02 0.02 0.06 0.05 0.17
SEQID-00578 B6T2K5 -- 0 0.54 0.22 0.05 0.15 0.01 0.02 0.00 0.04
0.06 0.01 0.02 0.05 0.13 0.21 SEQID-00579 B4FGQ6 -- 0 0.47 0.19
0.03 0.17 0.02 0.01 0.01 0.06 0.04 0.03 0.02 0.04 0.07 0.18
SEQID-00580 F0TGC -- 1 0.49 0.15 0.08 0.16 0.04 0.04 0.00 0.04 0.02
0.03 0.02 0.04 0.07 0.16 SEQID-00581 D4ZPH2 -- 0 0.51 0.21 0.02
0.12 0.03 0.04 0.00 0.04 0.07 0.04 0.03 0.04 0.04 0.15 SEQID-00582
K9I7W3 -- 1 0.54 0.18 0.05 0.07 0.04 0.08 0.00 0.03 0.02 0.03 0.03
0.06 0.06 0.17 SEQID-00583 B6SGX0 -- 0 0.56 0.18 0.05 0.16 0.01
0.02 0.00 0.01 0.06 0.05 0.04 0.03 0.09 0.21 SEQID-00584 G3UV10 --
1 0.50 0.18 0.05 0.05 0.03 0.05 0.02 0.04 0.06 0.04 0.02 0.12 0.04
0.08 SEQID-00585 Q5BYT2 -- 0 0.44 0.06 0.02 0.00 0.04 0.10 0.00
0.13 0.09 0.10 0.10 0.03 0.01 0.21 SEQID-00586 K1VX49 -- 0 0.44
0.09 0.05 0.10 0.01 0.07 0.00 0.02 0.08 0.03 0.00 0.02 0.06 0.15
SEQID-00587 P38910 -- 0 0.51 0.29 0.06 0.04 0.05 0.07 0.00 0.07
0.06 0.04 0.00 0.07 0.11 0.12 SEQID-00588 K9HK97 -- 1 0.44 0.20
0.04 0.17 0.04 0.01 0.00 0.03 0.09 0.05 0.02 0.07 0.06 0.11
SEQID-00589 Q12497 -- 0 0.42 0.12 0.03 0.13 0.05 0.10 0.00 0.06
0.07 0.03 0.03 0.02 0.08 0.13 SEQID-00590 F0TEQ9 -- 0 0.49 0.20
0.10 0.06 0.04 0.04 0.00 0.04 0.12 0.04 0.01 0.06 0.06 0.16
SEQID-00591 P01098 -- 0 0.37 0.18 0.04 0.14 0.09 0.03 0.01 0.06
0.10 0.03 0.03 0.06 0.10 0.11 SEQID-00592 B6SPL7 -- 0 0.53 0.21
0.07 0.02 0.01 0.04 0.02 0.04 0.10 0.05 0.00 0.01 0.04 0.12
SEQID-00593 D5A0N7 -- 1 0.49 0.20 0.05 0.08 0.01 0.04 0.00 0.08
0.07 0.04 0.01 0.11 0.06 0.03 SEQID-00594 K4CBP6 -- 0 0.44 0.14
0.05 0.16 0.03 0.01 0.09 0.01 0.07 0.03 0.03 0.03 0.06 0.04
SEQID-00595 K7WJX3 -- 0 0.44 0.10 0.06 0.16 0.04 0.01 0.09 0.00
0.07 0.03 0.03 0.01 0.06 0.03 SEQID-00596 Q2I2W0 -- 1 0.44 0.16
0.05 0.09 0.04 0.05 0.11 0.02 0.06 0.03 0.03 0.01 0.09 0.08
SEQID-00597 I1K554 -- 0 0.45 0.18 0.03 0.19 0.00 0.05 0.10 0.05
0.03 0.05 0.03 0.01 0.12 0.06 SEQID-00598 P82381 -- 1 0.49 0.20
0.06 0.12 0.07 0.04 0.03 0.00 0.07 0.04 0.05 0.04 0.03 0.07
SEQID-00599 K9HN29 -- 1 0.50 0.22 0.04 0.06 0.04 0.08 0.01 0.02
0.05 0.04 0.04 0.05 0.08 0.06 SEQID-00600 G1NGA7 -- 1 0.50 0.21
0.06 0.06 0.02 0.02 0.02 0.04 0.06 0.04 0.01 0.05 0.09 0.08
SEQID-00601 K9HJD1 -- 1 0.40 0.14 0.06 0.05 0.03 0.05 0.02 0.09
0.09 0.05 0.06 0.04 0.07 0.09 SEQID-00602 F0TGH0 -- 1 0.51 0.17
0.07 0.01 0.04 0.06 0.00 0.09 0.03 0.02 0.02 0.05 0.06 0.19
SEQID-00603 Q04491 -- 1 0.51 0.22 0.05 0.04 0.04 0.06 0.01 0.03
0.09 0.04 0.05 0.05 0.08 0.08 SEQID-00604 K9HHN3 -- 1 0.48 0.20
0.08 0.05 0.05 0.07 0.00 0.04 0.04 0.04 0.04 0.03 0.09 0.09
SEQID-00605 K9I605 -- 1 0.51 0.26 0.04 0.05 0.04 0.04 0.00 0.04
0.10 0.04 0.03 0.10 0.11 0.09 SEQID-00606 C6T9B1 -- 1 0.48 0.20
0.06 0.07 0.05 0.03 0.01 0.02 0.08 0.05 0.12 0.06 0.09 0.05
SEQID-00607 K1WSX8 -- 1 0.38 0.14 0.07 0.10 0.02 0.04 0.00 0.17
0.10 0.01 0.02 0.02 0.07 0.07 SEQID-00608 Q3Z I6 -- 1 0.34 0.10
0.03 0.08 0.01 0.06 0.12 0.07 0.07 0.05 0.04 0.01 0.06 0.04
SEQID-00609 P39015 -- 1 0.36 0.12 0.08 0.10 0.12 0.03 0.00 0.04
0.08 0.02 0.00 0.02 0.05 0.14 SEQID-00610 P38886 -- 0 0.41 0.20
0.05 0.07 0.06 0.06 0.00 0.10 0.11 0.03 0.03 0.06 0.09 0.04
SEQID-00611 Q9FWV6 -- 1 0.50 0.26 0.11 0.07 0.02 0.03 0.00 0.01
0.03 0.07 0.04 0.04 0.14 0.01 SEQID-00612 Q6YTX5 -- 1 0.42 0.25
0.16 0.06 0.02 0.04 0.00 0.02 0.06 0.03 0.04 0.03 0.12 0.05
SEQID-00613 K1WS36 -- 0 0.36 0.19 0.08 0.08 0.07 0.04 0.00 0.13
0.13 0.02 0.00 0.04 0.11 0.08 SEQID-00614 K9H9H7 -- 1 0.57 0.26
0.08 0.06 0.03 0.04 0.02 0.05 0.02 0.03 0.05 0.09 0.12 0.06
SEQID-00615 F6HMP1 -- 0 0.40 0.06 0.01 0.06 0.00 0.00 0.00 0.07
0.22 0.18 0.10 0.06 0.02 0.14 SEQID-00616 P05745 -- 0 0.49 0.20
0.07 0.17 0.05 0.01 0.00 0.00 0.06 0.04 0.01 0.08 0.06 0.16
SEQID-00617 D4ZMN8 -- 0 0.44 0.16 0.10 0.07 0.05 0.03 0.02 0.05
0.11 0.04 0.01 0.06 0.02 0.10 SEQID-00618 C6SWA6 -- 0 0.46 0.23
0.08 0.11 0.04 0.02 0.00 0.02 0.06 0.07 0.02 0.04 0.11 0.17
SEQID-00619 -- 0 0.51 0.16 0.09 0.06 0.04 0.02 0.00 0.02 0.11 0.02
0.02 0.06 0.05 0.23 SEQID-00620 P48589 -- 1 0.50 0.30 0.06 0.06
0.04 0.05 0.00 0.04 0.15 0.04 0.02 0.04 0.11 0.07 SEQID-00621
M1B1K7 -- 0 0.39 0.22 0.08 0.11 0.06 0.02 0.00 0.04 0.06 0.03 0.02
0.05 0.11 0.10 SEQID-00622 Q0DT04 -- 1 0.40 0.18 0.09 0.09 0.00
0.08 0.01 0.04 0.06 0.04 0.03 0.04 0.04 0.04 SEQID-00623 O65819 --
0 0.54 0.17 0.08 0.05 0.02 0.03 0.00 0.03 0.09 0.02 0.02 0.07 0.05
0.23 SEQID-00624 D4ZXXG -- 0 0.49 0.21 0.11 0.01 0.00 0.05 0.00
0.04 0.18 0.04 0.00 0.06 0.10 0.14 SEQID-00625 C66Y27 -- 0 0.52
0.24 0.05 0.14 0.03 0.08 0.00 0.03 0.04 0.01
0.00 0.07 0.07 0.17 SEQID-00626 F0TII3 -- 1 0.46 0.26 0.05 0.09
0.06 0.06 0.00 0.02 0.07 0.04 0.01 0.12 0.06 0.11 SEQID-00627
Q62GV5 -- 1 0.48 0.20 0.05 0.14 0.04 0.05 0.01 0.01 0.12 0.03 0.02
0.07 0.06 0.15 SEQID-00628 P38701 -- 1 0.51 0.25 0.02 0.07 0.05
0.02 0.00 0.10 0.11 0.02 0.02 0.10 0.05 0.13 SEQID-00629 P39939 --
0 0.37 0.16 0.08 0.19 0.07 0.03 0.03 0.01 0.04 0.01 0.03 0.05 0.03
0.14 SEQID-00630 G3N028 -- 1 0.35 0.16 0.03 0.06 0.04 0.03 0.03
0.07 0.04 0.06 0.01 0.05 0.06 0.03 SEQID-00631 F0 3 -- 0 0.38 0.20
0.04 0.21 0.04 0.09 0.01 0.02 0.06 0.04 0.01 0.07 0.06 0.10
SEQID-00632 P38804 -- 0 0.47 0.20 0.05 0.03 0.07 0.04 0.00 0.02
0.14 0.06 0.00 0.05 0.08 0.13 SEQID-00633 P22943 -- 0 0.35 0.10
0.08 0.04 0.03 0.11 0.00 0.07 0.12 0.06 0.02 0.01 0.03 0.16
SEQID-00634 Q3E792 -- 0 0.50 0.21 0.08 0.09 0.00 0.04 0.00 0.05
0.05 0.02 0.03 0.08 0.08 0.19 SEQID-00635 P41056 -- 1 0.46 0.20
0.05 0.14 0.07 0.00 0.00 0.03 0.04 0.04 0.03 0.06 0.06 0.09
SEQID-00636 -- 1 0.47 0.23 0.04 0.22 0.02 0.03 0.00 0.02 0.04 0.07
0.02 0.07 0.08 0.11 SEQID-00637 BGSGI4 -- 1 0.42 0.07 0.06 0.22
0.04 0.00 0.04 0.01 0.02 0.05 0.04 0.03 0.02 0.12 SEQID-00638
D4ZUU9 -- 0 0.48 0.21 0.06 0.11 0.03 0.03 0.00 0.04 0.14 0.02 0.00
0.04 0.07 0.14 SEQID-00639 P0CX26 -- 1 0.46 0.16 0.08 0.15 0.00
0.01 0.05 0.04 0.04 0.05 0.01 0.04 0.03 0.14 SEQID-00640 F0TIH8 --
0 0.47 0.19 0.01 0.13 0.06 0.05 0.00 0.02 0.06 0.01 0.03 0.04 0.02
0.16 SEQID-00641 P01097 -- 0 0.39 0.14 0.04 0.17 0.01 0.05 0.00
0.03 0.12 0.03 0.01 0.02 0.09 0.10 SEQID-00642 Q01519 -- 1 0.45
0.11 0.04 0.03 0.06 0.11 0.04 0.08 0.05 0.02 0.04 0.03 0.03 0.09
SEQID-00643 D4P880 -- 0 0.57 0.24 0.02 0.07 0.02 0.07 0.03 0.03
0.08 0.04 0.01 0.05 0.13 0.15 SEQID-00644 D5A1R0 -- 0 0.42 0.22
0.06 0.09 0.07 0.04 0.01 0.04 0.09 0.04 0.00 0.05 0.03 0.09
SEQID-00645 P37299 -- 1 0.56 0.20 0.03 0.04 0.03 0.04 0.00 0.01
0.05 0.05 0.05 0.01 0.17 0.07 SEQID-00646 B6UDM4 -- 1 0.54 0.23
0.06 0.09 0.01 0.04 0.01 0.03 0.03 0.05 0.03 0.03 0.15 0.09
SEQID-00647 K1XDJ4 -- 0 0.42 0.24 0.04 0.15 0.04 0.04 0.00 0.09
0.12 0.01 0.05 0.05 0.18 0.08 SEQID-00648 K1WP04 -- 1 0.39 0.12
0.03 0.19 0.03 0.06 0.00 0.00 0.17 0.04 0.03 0.04 0.04 0.08
SEQID-00649 Q6H6I1 -- 1 0.42 0.19 0.13 0.08 0.02 0.04 0.03 0.01
0.06 0.05 0.03 0.05 0.06 0.05 SEQID-00650 F1NXK2 -- 0 0.50 0.23
0.04 0.11 0.02 0.08 0.00 0.00 0.09 0.04 0.00 0.08 0.03 0.07
SEQID-00651 B6UHQ3 -- 1 0.39 0.19 0.17 0.03 0.01 0.06 0.02 0.07
0.04 0.04 0.05 0.01 0.13 0.02 SEQID-00652 P01064 -- 0 0.28 0.08
0.00 0.03 0.02 0.13 0.16 0.05 0.03 0.01 0.01 0.02 0.06 0.07
SEQID-00653 E1UJV6 -- 0 0.47 0.22 0.10 0.07 0.05 0.05 0.01 0.03
0.09 0.04 0.00 0.08 0.05 0.11 SEQID-00654 E1USS1 -- 1 0.54 0.28
0.07 0.05 0.04 0.06 0.00 0.03 0.09 0.03 0.05 0.11 0.11 0.07
SEQID-00655 E1UU33 -- 0 0.47 0.21 0.07 0.06 0.05 0.06 0.01 0.05
0.13 0.04 0.02 0.06 0.08 0.12 SEQID-00656 E1UV85 -- 0 0.44 0.20
0.07 0.01 0.06 0.05 0.00 0.14 0.07 0.04 0.00 0.05 0.06 0.13
SEQID-00657 E1UR 2 -- 1 0.49 0.17 0.05 0.02 0.09 0.07 0.00 0.04
0.07 0.04 0.01 0.05 0.07 0.13 SEQID-00658 E1URC8 -- 1 0.42 0.17
0.06 0.04 0.06 0.09 0.00 0.07 0.09 0.04 0.01 0.05 0.07 0.16
SEQID-00659 E1UV03 -- 1 0.44 0.17 0.05 0.06 0.10 0.05 0.00 0.05
0.05 0.03 0.04 0.05 0.05 0.05 SEQID-00660 E1UKZ8 -- 1 0.48 0.17
0.06 0.02 0.083 0.09 0.00 0.04 0.08 0.04 0.02 0.04 0.08 0.14
SEQID-00661 P00780 -- 1 0.44 0.22 0.10 0.02 0.07 0.05 0.00 0.03
0.04 0.06 0.03 0.05 0.06 0.08 SEQID-00662 E1UMM6 -- 1 0.43 0.17
0.04 0.04 0.08 0.06 0.01 0.02 0.04 0.06 0.01 0.06 0.08 0.07
SEQID-00663 QBGCB2 -- 1 0.47 0.20 0.03 0.05 0.12 0.06 0.00 0.01
0.04 0.05 0.03 0.09 0.05 0.08 SEQID-00664 Q65EF5 -- 1 0.50 0.19
0.05 0.05 0.07 0.06 0.00 0.04 0.07 0.05 0.03 0.07 0.04 0.10
SEQID-00665 D5DEH5 -- 1 0.41 0.17 0.06 0.03 0.07 0.07 0.00 0.04
0.04 0.05 0.02 0.04 0.06 0.09 SEQID-00666 G2RXU3 -- 1 0.46 0.24
0.07 0.05 0.05 0.07 0.00 0.03 0.10 0.06 0.01 0.07 0.09 0.07
SEQID-00667 E1UPU6 -- 1 0.40 0.15 0.05 0.09 0.05 0.11 0.00 0.04
0.07 0.04 0.01 0.03 0.07 0.10 SEQID-00668 E1UQB7 -- 1 0.52 0.16
0.05 0.01 0.03 0.10 0.00 0.05 0.09 0.03 0.01 0.03 0.08 0.23
SEQID-00669 P07170 -- 1 0.48 0.21 0.06 0.06 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00670 P07170 -- 1 0.48 0.21
0.06 0.06 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00671 P07170 -- 1 0.48 0.21 0.06 0.05 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00672 P07170 -- 1 0.47 0.21
0.06 0.06 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00673 P07170 -- 1 0.47 0.21 0.06 0.05 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00674 P07170 -- 1 0.47 0.21
0.07 0.05 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00675 P07170 -- 1 0.47 0.21 0.06 0.05 0.04 0.09 0.01 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00676 P07170 -- 1 0.47 0.21
0.06 0.05 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00677 P07170 -- 1 0.48 0.21 0.06 0.05 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00678 P07170 -- 1 0.48 0.21
0.06 0.05 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.11
SEQID-00679 P07170 -- 1 0.48 0.21 0.06 0.05 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00680 P07170 -- 1 0.47 0.21
0.06 0.05 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00681 P07170 -- 1 0.48 0.21 0.06 0.05 0.04 0.09 0.00 0.06
0.06 0.04 0.03 0.07 0.10 0.10 SEQID-00682 P07170 -- 1 0.48 0.21
0.06 0.05 0.04 0.09 0.00 0.06 0.06 0.04 0.03 0.07 0.10 0.10
SEQID-00683 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.03 0.00 0.05
0.04 0.04 0.03 0.06 0.06 0.06 SEQID-00684 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00685 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.08 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00686 P00691 34:659 1 0.43 0.16
0.05 0.05 0.09 0.08 0.00 0.05 0.04 0.05 0.03 0.05 0.06 0.06
SEQID-00687 P00691 34:659 1 0.42 0.16 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.04 0.03 0.06 0.06 0.06 SEQID-00688 P00691 34:659 1 0.43 0.16
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.05 0.06 0.06
SEQID-00689 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.08 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00690 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00691 P00691 34:659 1 0.44 0.17 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.06 0.06 0.06 SEQID-00692 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.07 0.06
SEQID-00693 P00691 34:659 1 0.44 0.16 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00694 P00691 34:659 1 0.43 0.16
0.05 0.05 0.09 0.08 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00695 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.08 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00696 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00697 P00691 34:659 1 0.43 0.17 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.06 0.06 0.06 SEQID-00698 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00699 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00700 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00701 P00691 34:659 1 0.44 0.17 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.06 0.06 0.06 SEQID-00702 P00691 34:659 1 0.44 0.17
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00703 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.06 0.06 0.06 SEQID-00704 P00691 34:659 1 0.43 0.17
0.05 0.06 0.09 0.07 0.00 0.05 0.04 0.05 0.03 0.06 0.06 0.06
SEQID-00705 P00691 34:659 1 0.44 0.17 0.05 0.05 0.09 0.07 0.00 0.05
0.04 0.05 0.03 0.05 0.06 0.06 SEQID-00706 P00691 34:659 1 0.42 0.16
0.05 0.05 0.09 0.08 0.00 0.06 0.04 0.05 0.03 0.05 0.05 0.06
SEQID-00707 P00691 34:659 1 0.42 0.16 0.05 0.05 0.09 0.08 0.00 0.06
0.04 0.05 0.03 0.05 0.05 0.06 SEQID-00708 P00691 34:659 1 0.42 0.16
0.05 0.05 0.09 0.08 0.00 0.06 0.04 0.05 0.03 0.05 0.05 0.06
SEQID-00709 P00691 34:659 1 0.42 0.16 0.05 0.05 0.09 0.08 0.00 0.06
0.04 0.05 0.03 0.05 0.05 0.06 SEQID-00710 P00691 34:659 1 0.42 0.16
0.05 0.05 0.09 0.07 0.00 0.05 0.04 0.04 0.03 0.06 0.06 0.06
SEQID-00711 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.06 0.00 0.05
0.04 0.04 0.03 0.06 0.06 0.06 SEQID-00712 P00691 34:659 1 0.42 0.16
0.05 0.05 0.09 0.08 0.00 0.05 0.04 0.04 0.03 0.06 0.06 0.06
SEQID-00713 P00691 34:659 1 0.42 0.16 0.05 0.05 0.09 0.08 0.00 0.05
0.04 0.04 0.03 0.06 0.06 0.06 SEQID-00714 P00691 34:659 1 0.43 0.16
0.05 0.05 0.09 0.08 0.00 0.05 0.04 0.04 0.03 0.06 0.06 0.06
SEQID-00715 P00691 34:659 1 0.43 0.16 0.05 0.05 0.09 0.08 0.00 0.05
0.04 0.04 0.03 0.06 0.06 0.06 SEQID-00716 E7Q265 -- 1 0.46 0.20
0.06 0.07 0.04 0.09 0.01 0.06 0.07 0.04 0.03 0.07 0.10 0.10
SEQID-00717 E1BKT9 -- 1 0.41 0.20 0.03 0.10 0.04 0.06 0.01 0.09
0.12 0.03 0.02 0.06 0.10 0.09 SEQID-00718 W5Q7Z7 -- 1 0.42 0.20
0.03 0.10 0.04 0.06 0.01 0.09 0.12 0.02 0.02 0.06 0.11 0.10
SEQID-00719 F1RW75 -- 1 0.41 0.20 0.04 0.10 0.04 0.06 0.01 0.09
0.12 0.02 0.02 0.06 0.10 0.10 SEQID-00720 Q8SPI1 -- 1 0.45 0.24
0.06 0.07 0.05 0.05 0.02 0.06 0.07 0.03 0.03 0.05 0.13 0.05
SEQID-00721 Q6PVZ5 -- 1 0.38 0.19 0.05 0.10 0.04 0.04 0.00 0.05
0.09 0.10 0.01 0.04 0.10 0.06 SEQID-00722 E7Q6N3 -- 0 0.53 0.26
0.01 0.07 0.02 0.07 0.00 0.08 0.08 0.04 0.01 0.09 0.12 0.11
SEQID-00723 E7Q6P3 -- 0 0.43 0.23 0.05 0.03 0.04 0.08 0.01 0.07
0.10 0.03 0.02 0.08 0.11 0.09 SEQID-00724 E7Q142 -- 1 0.53 0.20
0.06 0.03 0.07 0.05 0.00 0.04 0.07 0.04 0.04 0.06 0.09 0.03
SEQID-00725 Q28161 -- 1 0.38 0.16 0.05 0.10 0.06 0.05 0.03 0.06
0.05 0.04 0.02 0.03 0.10 0.06 SEQID-00726 P53478 -- 1 0.47 0.20
0.05 0.07 0.02 0.06 0.01 0.04 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-00727 A25W69 -- 1 0.45 0.21 0.04 0.03 0.03 0.09 0.01 0.04
0.08 0.03 0.01 0.06 0.10 0.11 SEQID-00728 F1S3U9 -- 1 0.51 0.21
0.04 0.05 0.03 0.08 0.01 0.05 0.05 0.04 0.02 0.09 0.06 0.11
SEQID-00729 E7Q765 -- 1 0.40 0.18 0.04 0.03 0.07 0.06 0.01 0.04
0.17 0.02 0.03 0.05 0.06 0.09 SEQID-00730 E7Q9J9 -- 1 0.51 0.23
0.04 0.04 0.05 0.06 0.02 0.04 0.07 0.04 0.03 0.07 0.09 0.10
SEQID-00731 F1SGG1 -- 1 0.40 0.23 0.05 0.11 0.04 0.06 0.00 0.07
0.12 0.03 0.02 0.05 0.13 0.06 SEQID-00732 Q03763 -- 1 0.43 0.22
0.03 0.07 0.07 0.05 0.02 0.03 0.07 0.06 0.02 0.07 0.07 0.04
SEQID-00733 F1STM4 -- 1 0.52 0.21 0.06 0.06 0.04 0.05 0.01 0.03
0.07 0.04 0.03 0.07 0.06 0.11 SEQID-00734 E7Q5T7 -- 1 0.42 0.19
0.03 0.05 0.07 0.06 0.00 0.06 0.16 0.01 0.02 0.05 0.11 0.11
SEQID-00735 E7Q880 -- 1 0.44 0.21 0.06 0.06 0.04 0.06 0.01 0.10
0.09 0.01 0.03 0.06 0.11 0.07 SEQID-00736 K4BLT8 -- 1 0.48 0.25
0.05 0.05 0.04 0.07 0.02 0.04 0.07 0.03 0.02 0.08 0.09 0.08
SEQID-00737 F1SFT0 -- 0 0.28 0.09 0.02 0.04 0.02 0.03 0.18 0.11
0.00 0.04 0.00 0.01 0.02 0.06 SEQID-00738 I3LK01 -- 1 0.38 0.20
0.06 0.11 0.04 0.03 0.03 0.06 0.13 0.03 0.02 0.05 0.09 0.07
SEQID-00739 ASD984 -- 1 0.48 0.23 0.07 0.08 0.04 0.06 0.02 0.03
0.08 0.04 0.03 0.08 0.08 0.08 SEQID-00740 E7Q1Q3 -- 0 0.48 0.23
0.03 0.06 0.03 0.07 0.01 0.04 0.11 0.04 0.02 0.07 0.11 0.12
SEQID-00741 E7Q1V1 -- 1 0.39 0.21 0.02 0.10 0.07 0.06 0.01 0.08
0.09 0.02 0.03 0.06 0.12 0.05 SEQID-00742 I1N6A2 -- 1 0.43 0.22
0.05 0.11 0.04 0.06 0.00 0.06 0.10 0.03 0.02 0.07 0.10 0.07
SEQID-00743 P35323 -- 0 0.29 0.08 0.01 0.00 0.00 0.00 0.09 0.22
0.08 0.00 0.03 0.01 0.00 0.14 SEQID-00744 F1SAM0 -- 1 0.46 0.20
0.03 0.05 0.04 0.07 0.03 0.05 0.08 0.04 0.03 0.05 0.09 0.08
SEQID-00745 F1SGS9 -- 1 0.43 0.16 0.05 0.08 0.06 0.07 0.01 0.05
0.06 0.03 0.05 0.04 0.06 0.06 SEQID-00746 I3LR13 -- 1 0.40 0.19
0.04 0.11 0.02 0.04 0.01 0.07 0.09 0.03 0.04 0.02 0.12 0.02
SEQID-00747 P0C522 -- 0 0.42 0.25 0.07 0.09 0.04 0.05 0.01 0.06
0.08 0.04 0.01 0.07 0.10 0.06 SEQID-00748 Q6K838 -- 1 0.46 0.23
0.05 0.09 0.03 0.04 0.01 0.07 0.06 0.03 0.02 0.05 0.12 0.07
SEQID-00749 Q2KJ64 -- 1 0.51 0.24 0.03 0.05 0.02 0.07 0.01 0.02
0.08 0.05 0.03 0.06 0.10 0.10 SEQID-00750 F1MUE4 -- 1 0.49 0.24
0.04 0.07 0.03 0.05 0.01 0.05 0.12 0.03 0.02 0.02 0.16 0.08
SEQID-00751 E1BLN6 -- 1 0.23 0.12 0.02 0.11 0.01 0.02 0.10 0.10
0.06 0.03 0.01 0.02 0.04 0.03 SEQID-00752 E7Q207 -- 1 0.48 0.20
0.06 0.07 0.04 0.04 0.00 0.03 0.11 0.03 0.01 0.05 0.08 0.11
SEQID-00753 E7QAF4 -- 1 0.51 0.28 0.03 0.04 0.07 0.08 0.01 0.04
0.07 0.02 0.02 0.09 0.15 0.09 SEQID-00754 D7TRY0 -- 1 0.37 0.13
0.04 0.06 0.05 0.05 0.00 0.03 0.19 0.03 0.01 0.03 0.05 0.14
SEQID-00755 Q9SWB6 -- 1 0.50 0.20 0.05 0.04 0.04 0.04 0.02 0.04
0.12 0.03 0.02 0.06 0.09 0.09 SEQID-00756 W5P481 -- 1 0.24 0.10
0.07 0.08 0.02 0.05 0.01 0.05 0.06 0.15 0.01 0.02 0.04 0.05
SEQID-00757 W5PVF9 -- 1 0.37 0.15 0.04 0.09 0.05 0.06 0.02 0.05
0.08 0.03 0.04 0.03 0.07 0.06 SEQID-00758 F15GP9 -- 1 0.41 0.19
0.03 0.10 0.05 0.06 0.02 0.04 0.07 0.05 0.03 0.04 0.07 0.04
SEQID-00759 F15II1 -- 1 0.45 0.17 0.03 0.02 0.06 0.04 0.01 0.05
0.13 0.05 0.02 0.06 0.05 0.13 SEQID-00760 Q3SYU2 -- 1 0.48 0.22
0.05 0.07 0.03 0.06 0.02 0.04 0.08 0.04 0.02 0.06 0.09 0.09
SEQID-00761 F1MW 0 -- 1 0.30 0.18 0.02 0.03 0.02 0.02 0.03 0.05
0.01 0.12 0.02 0.05 0.07 0.04 SEQID-00762 P02075 -- 0 0.56 0.23
0.07 0.04 0.06 0.06 0.01 0.03 0.06 0.04 0.08 0.00 0.12 0.10
SEQID-00763 P60706 -- 1 0.47 0.20 0.05 0.07 0.02 0.06 0.01 0.04
0.03 0.04 0.03 0.08 0.07 0.06 SEQID-00764 P01966 -- 0 0.56 0.23
0.09 0.03 0.02 0.06 0.00 0.01 0.04 0.03 0.09 0.00 0.15 0.09
SEQID-00765 F1MKE9 -- 1 0.43 0.19 0.05 0.09 0.03 0.07 0.01 0.08
0.12 0.02 0.03 0.04 0.11 0.07 SEQID-00766 H7U1 -- 1 0.43 0.17 0.04
0.07 0.05 0.07 0.02 0.05 0.09 0.04 0.03 0.03 0.08 0.04 SEQID-00767
O64937 -- 1 0.52 0.21 0.04 0.06 0.04 0.06 0.01 0.02 0.08 0.04 0.03
0.07 0.06 0.13 SEQID-00768 K7LZH1 -- 1 0.45 0.21 0.06 0.07 0.05
0.08 0.01 0.04 0.10 0.04 0.01 0.08 0.07 0.09 SEQID-00769 O77642 --
1 0.39 0.18 0.07 0.07 0.03 0.06 0.01 0.04 0.16 0.03 0.01 0.04 0.10
0.08 SEQID-00770 P28752 -- 1 0.44 0.21 0.05 0.07 0.04 0.07 0.02
0.03 0.09 0.04 0.04 0.06 0.08 0.05 SEQID-00771 F6H7U7 -- 1 0.43
0.21 0.06 0.08 0.05 0.06 0.01 0.05 0.11 0.02 0.02 0.05 0.11 0.09
SEQID-00772 F6HN28 -- 1 0.44 0.21 0.05 0.09 0.03 0.06 0.01 0.04
0.12 0.02 0.03 0.06 0.11 0.06 SEQID-00773 W5PC91 -- 1 0.42 0.19
0.05 0.09 0.04 0.08 0.01 0.08 0.14 0.02 0.03 0.04 0.12 0.08
SEQID-00774 C7IZV3 -- 1 0.44 0.20 0.04 0.15 0.02 0.05 0.03 0.03
0.05 0.04 0.05 0.06 0.08 0.06 SEQID-00775 E1C4S8 -- 1 0.42 0.19
0.06 0.08 0.04 0.05 0.02 0.10 0.08 0.03 0.05 0.02 0.11 0.10
SEQID-00776 G3MXL3 -- 1 0.37 0.18 0.05 0.08 0.04 0.04 0.01 0.06
0.08 0.12 0.01 0.04 0.09 0.06 SEQID-00777 F1SKJ1 -- 1 0.42 0.19
0.06 0.09 0.04 0.05 0.01 0.08 0.15 0.02 0.02 0.04 0.11 0.11
SEQID-00778 F1SSA6 -- 1 0.42 0.19 0.06 0.09 0.04 0.05 0.01 0.09
0.16 0.02 0.02 0.04 0.11 0.11 SEQID-00779 F1SSS0 -- 1 0.49 0.23
0.05 0.05 0.05 0.05 0.01 0.04 0.08 0.04 0.02 0.07 0.09 0.08
SEQID-00780 P02663 -- 1 0.47 0.18 0.03 0.04 0.06 0.02 0.01 0.08
0.12 0.00 0.02 0.05 0.07 0.12 SEQID-00781 G1NEY4 -- 1 0.38 0.19
0.05 0.10 0.04 0.04 0.00 0.05 0.09 0.10 0.01 0.04 0.10 0.06
SEQID-00782 P02543 -- 1 0.37 0.19 0.04 0.13 0.05 0.06 0.00 0.08
0.13 0.01 0.02 0.03 0.12 0.05 SEQID-00783 K4CAJ3 -- 1 0.45 0.20
0.04 0.10 0.04 0.06 0.02 0.03 0.10 0.03 0.03 0.06 0.08 0.06
SEQID-00784 E7Q2C6 -- 1 0.47 0.25 0.05 0.10 0.04 0.08 0.01 0.04
0.09 0.03 0.02 0.07 0.11 0.10 SEQID-00785 P68103 -- 1 0.51 0.21
0.06 0.05 0.04 0.06 0.01 0.03 0.07 0.05 0.03 0.07 0.06 0.12
SEQID-00786 Q04619 -- 1 0.47 0.20 0.03 0.06 0.04 0.07 0.01 0.03
0.15 0.02 0.02 0.06 0.08 0.12 SEQID-00787 P31691 -- 1 0.45 0.18
0.07 0.08 0.05 0.05 0.01 0.04 0.03 0.07 0.00 0.05 0.08 0.08
SEQID-00788 P00829 -- 0 0.45 0.26 0.08 0.07 0.02 0.06 0.00 0.06
0.08 0.05 0.02 0.07 0.10 0.05 SEQID-00789 Q0IWN2 -- 1 0.47 0.21
0.09 0.09 0.04 0.04 0.01 0.03 0.11 0.02 0.03 0.04 0.12 0.11
SEQID-00790 P0C276 -- 0 0.49 0.22 0.02 0.11 0.05 0.05 0.04 0.07
0.06 0.03 0.03 0.03 0.10 0.15 SEQID-00791 E1B9D0 -- 1 0.389 0.21
0.07 0.14 0.02 0.05 0.01 0.05 0.08 0.04 0.03 0.02 0.14 0.02
SEQID-00792 E1BXJ2 -- 1 0.47 0.21 0.03 0.03 0.05 0.05 0.01 0.07
0.10 0.02 0.03 0.06 0.11 0.09 SEQID-00793 I1JFH4 -- 1 0.50 0.20
0.05 0.03 0.03 0.05 0.01 0.03 0.11 0.02 0.03 0.04 0.09 0.09
SEQID-00794 I1NGL1 -- 1 0.42 0.20 0.04 0.08 0.05 0.06 0.03 0.03
0.09 0.02 0.03 0.05 0.11 0.08 SEQID-00795 I3JQE4 -- 1 0.48 0.24
0.06 0.05 0.03 0.05 0.02 0.06 0.08 0.03 0.03 0.05 0.13 0.08
SEQID-00796 W5NX33 -- 1 0.47 0.23 0.04 0.07 0.05 0.05 0.02 0.04
0.08 0.02 0.05 0.06 0.10 0.05 SEQID-00797 E7Q6A3 -- 1 0.46 0.22
0.02 0.05 0.10 0.05 0.02 0.05 0.11 0.02 0.01 0.05 0.13 0.12
SEQID-00798 E7Q9U4 -- 1 0.45 0.21 0.04 0.04 0.05 0.06 0.01 0.05
0.10 0.03 0.01 0.05 0.08 0.07 SEQID-00799 E7Q306 -- 1 0.48 0.22
0.04 0.05 0.07 0.07 0.01 0.03 0.06 0.04 0.03 0.06 0.10 0.09
SEQID-00800 E7BQS1 -- 1 0.46 0.16 0.03 0.04 0.06 0.02 0.01 0.03
0.12 0.00 0.03 0.05 0.06 0.12 SEQID-00801 I1LP26 -- 1 0.49 0.17
0.03 0.05 0.05 0.083 0.01 0.04 0.07 0.02 0.03 0.05 0.07 0.17
SEQID-00802 Q148H5 -- 1 0.38 0.20 0.05 0.09 0.05 0.05 0.02 0.05
0.10 0.04 0.01 0.05 0.10 0.08 SEQID-00803 P04653 -- 1 0.42 0.21
0.04 0.04 0.05 0.03 0.00 0.03 0.11 0.02 0.02 0.06 0.11 0.08
SEQID-00804 E7QAF7 -- 1 0.48 0.21 0.06 0.05 0.03 0.07 0.01 0.04
0.09 0.04 0.01 0.07 0.08 0.12 SEQID-00805 P11839 -- 1 0.50 0.26
0.02 0.02 0.02 0.02 0.00 0.11 0.10 0.01 0.03 0.05 0.12 0.07
SEQID-00806 E7Q3D2 -- 1 0.47 0.21 0.04 0.07 0.02 0.05 0.01 0.04
0.08 0.04 0.03 0.08 0.07 0.06 SEQID-00807 E7Q6T4 -- 1 0.50 0.24
0.03 0.06 0.06 0.07 0.01 0.03 0.07 0.02 0.02 0.08 0.10 0.11
SEQID-00808 E7QA23 -- 1 0.42 0.19 0.03 0.06 0.08 0.06 0.00 0.05
0.14 0.02 0.02 0.06 0.09 0.07 SEQID-00809 P02669 -- 1 0.41 0.19
0.07 0.04 0.05 0.04 0.01 0.09 0.07 0.01 0.03 0.06 0.06 0.05
SEQID-00810 E7Q742 -- 1 0.49 0.24 0.03 0.06 0.06 0.07 0.01 0.04
0.09 0.03 0.04 0.07 0.10 0.06 SEQID-00811 E7Q4K4 -- 1 0.49 0.22
0.04 0.03 0.03 0.08 0.01 0.04 0.08 0.04 0.03 0.05 0.12 0.07
SEQID-00812 E7Q3Y5 -- 1 0.47 0.22 0.02 0.05 0.06 0.09 0.00 0.04
0.09 0.01 0.02 0.06 0.13 0.07 SEQID-00813 O22493 -- 1 0.48 0.20
0.04 0.08 0.03 0.06 0.01 0.03 0.08 0.05 0.02 0.05 0.09 0.07
SEQID-00814 P00698 -- 1 0.42 0.20 0.06 0.12 0.10 0.05 0.06 0.02
0.02 0.05 0.01 0.05 0.10 0.05 SEQID-00815 E7Q1A8 -- 1 0.49 0.20
0.03 0.03 0.07 0.08 0.00 0.04 0.07 0.02 0.03 0.06 0.10 0.10
SEQID-00816 E7Q2C3 -- 1 0.50 0.17 0.05 0.06 0.06 0.07 0.01 0.04
0.09 0.02 0.03 0.08 0.12 0.08 SEQID-00817 E7Q315 -- 1 0.51 0.25
0.02 0.01 0.08 0.08 0.03 0.05 0.04 0.03 0.03 0.09 0.11 0.09
SEQID-00818 E7Q0X9 -- 1 0.44 0.21 0.03 0.068 0.09 0.07 0.01 0.06
0.07 0.01 0.02 0.06 0.11 0.09 SEQID-00819 P62796 -- 0 0.48 0.22
0.04 0.19 0.02 0.03 0.00 0.02 0.05 0.09 0.02 0.06 0.08 0.12
SEQID-00820 E7Q903 -- 1 0.34 0.09 0.03 0.07 0.10 0.08 0.00 0.10
0.06 0.05 0.01 0.03 0.04 0.08 SEQID-00821 E7QA30 -- 1 0.48 0.21
0.04 0.05 0.04 0.07 0.00 0.03 0.15 0.02 0.01 0.07 0.09 0.12
SEQID-00822 Q69IM0 -- 1 0.48 0.24 0.07 0.09 0.02 0.07 0.01 0.04
0.09 0.05 0.03 0.07 0.08 0.08 SEQID-00823 F6HQQ4 -- 1 0.50 0.24
0.04 0.08 0.04 0.05 0.02 0.05 0.06 0.02 0.04 0.08 0.09 0.07
SEQID-00824 F6HHW7 -- 1 0.47 0.19 0.04 0.05 0.05 0.05 0.01 0.04
0.07 0.04 0.04 0.05 0.08 0.08 SEQID-00825 E7Q876 -- 1 0.48 0.22
0.02 0.06 0.07 0.07 0.01 0.07 0.11 0.01 0.02 0.07 0.11 0.13
SEQID-00826 E7Q4C4 -- 1 0.42 0.16 0.03 0.04 0.08 0.08 0.00 0.07
0.10 0.03 0.03 0.04 0.06 0.08 SEQID-00827 E7Q7F8 -- 1 0.45 0.21
0.04 0.06 0.06 0.06 0.01 0.06 0.06 0.02 0.03 0.07 0.09 0.07
SEQID-00828 K9HAR9 -- 1 0.45 0.22 0.05 0.09 0.03 0.07 0.01 0.03
0.08 0.05 0.02 0.06 0.10 0.07 SEQID-00829 F1MPS8 -- 1 0.44 0.19
0.03 0.08 0.04 0.05 0.01 0.10 0.14 0.02 0.03 0.04 0.11 0.12
SEQID-00830 K7K247 -- 1 0.43 0.12 0.04 0.04 0.05 0.04 0.01 0.07
0.15 0.01 0.03 0.03 0.07 0.19 SEQID-00831 K9HJK7 -- 1 0.47 0.22
0.05 0.09 0.03 0.06 0.01 0.04 0.08 0.03 0.03 0.06 0.10 0.05
SEQID-00832 K9HV52 -- 1 0.42 0.19 0.05 0.11 0.04 0.04 0.03 0.03
0.10 0.05 0.03 0.05 0.10 0.04 SEQID-00833 E1C4H7 -- 1 0.44 0.22
0.05 0.07 0.03 0.05 0.02 0.06 0.08 0.04 0.04 0.04 0.12 0.05
SEQID-00834 E1BTL7 -- 1 0.42 0.19 0.03 0.09 0.05 0.05 0.02 0.08
0.06 0.02 0.02 0.05 0.06 0.07 SEQID-00835 I1N1P3 -- 1 0.48 0.21
0.05 0.08 0.04 0.05 0.02 0.05 0.08 0.03 0.04 0.05 0.09 0.11
SEQID-00836 W5PEW5 -- 1 0.42 0.20 0.03 0.06 0.04 0.04 0.01 0.10
0.18 0.01 0.02 0.03 0.13 0.11 SEQID-00837 B0JEU3 -- 1 0.35 0.16
0.03 0.12 0.06 0.04 0.02 0.13 0.11 0.04 0.02 0.04 0.07 0.06
SEQID-00838 P00724 -- 1 0.45 0.16 0.04 0.03 0.08 0.06 0.00 0.04
0.06 0.03 0.01 0.04 0.07 0.05 SEQID-00839 P00724 -- 1 0.45 0.16
0.04 0.03 0.08 0.06 0.00 0.04 0.06 0.03 0.01 0.04 0.07 0.05
SEQID-00840 K9HWU9 -- 1 0.43 0.20 0.07 0.07 0.05 0.07 0.01 0.03
0.06 0.05 0.02 0.06 0.07 0.04 SEQID-00841 Q653V7 -- 1 0.45 0.21
0.06 0.10 0.04 0.06 0.00 0.02 0.03 0.06 0.03 0.03 0.10 0.03
SEQID-00842 K9HXA6 -- 1 0.46 0.17 0.05 0.06 0.05 0.05 0.01 0.07
0.05 0.05 0.03 0.05 0.07 0.04 SEQID-00843 P23776 -- 1 0.43 0.19
0.04 0.05 0.06 0.09 0.02 0.05 0.07 0.03 0.03 0.06 0.09 0.04
SEQID-00844 F1MM32 -- 1 0.46 0.20 0.06 0.10 0.03 0.06 0.02 0.04
0.06 0.04 0.03 0.06 0.10 0.05 SEQID-00845 P80025 -- 1 0.46 0.20
0.04 0.09 0.06 0.05 0.02 0.05 0.06 0.06 0.03 0.04 0.11 0.06
SEQID-00846 Q67UF5 -- 1 0.46 0.21 0.08 0.03 0.04 0.05 0.02 0.04
0.10 0.04 0.01 0.03 0.10 0.11 SEQID-00847 Q95114 -- 1 0.45 0.18
0.04 0.07 0.06 0.05 0.04 0.06 0.05 0.05 0.03 0.05 0.09 0.04
SEQID-00848 F1MGU7 -- 1 0.44 0.17 0.03 0.04 0.06 0.07 0.02 0.06
0.06 0.04 0.03 0.06 0.07 0.08 SEQID-00849 P15703 -- 1 0.46 0.17
0.06 0.02 0.05 0.08 0.01 0.05 0.06 0.04 0.01 0.04 0.06 0.06
SEQID-00850 P53334 -- 1 0.39 0.18 0.10 0.02 0.06 0.06 0.01 0.05
0.05 0.03 0.01 0.05 0.05 0.06 SEQID-00851 B4FBD6 -- 1 0.38 0.17
0.07 0.07 0.04 0.08 0.04 0.05 0.04 0.05 0.02 0.02 0.10 0.04
SEQID-00852 E0CQY0 -- 1 0.45 0.16 0.06 0.05 0.07 0.04 0.09 0.06
0.01 0.06 0.02 0.04 0.05 0.05 SEQID-00853 P01888 -- 1 0.45 0.22
0.02 0.07 0.03 0.07 0.02 0.06 0.06 0.02 0.04 0.05 0.12 0.08
SEQID-00854 F1SU23 -- 1 0.39 0.16 0.05 0.11 0.03 0.09 0.01 0.06
0.05 0.03 0.03 0.01 0.11 0.06 SEQID-00855 Q3SZR3 -- 1 0.47 0.19
0.06 0.05 0.04 0.05 0.02 0.04 0.11 0.02 0.03 0.06 0.09 0.09
SEQID-00856 Q9MZ06 -- 1 0.47 0.18 0.03 0.08 0.05 0.04 0.04 0.05
0.09 0.03 0.02 0.03 0.10 0.11 SEQID-00857 Q3ZCH5 -- 1 0.38 0.15
0.06 0.09 0.02 0.05 0.01 0.06 0.10 0.04 0.03 0.02 0.09 0.04
SEQID-00858 G1MZ49 -- 0 0.48 0.25 0.04 0.07 0.07 0.06 0.02 0.03
0.07 0.02 0.02 0.07 0.14 0.07 SEQID-00859 P80195 -- 0 0.50 0.23
0.04 0.05 0.05 0.03 0.01 0.05 0.12 0.01 0.04 0.07 0.14 0.10
SEQID-00860 P04272 -- 1 0.45 0.21 0.04 0.08 0.03 0.09 0.01 0.04
0.08 0.03 0.01 0.06 0.10 0.11 SEQID-00861 P60712 -- 1 0.47 0.20
0.05 0.07 0.02 0.06 0.01 0.04 0.08 0.04 0.03 0.08 0.07 0.06
SEQID-00862 P63258 -- 1 0.47 0.20 0.05 0.07 0.02 0.06 0.01 0.04
0.09 0.04 0.03 0.08 0.07 0.06 SEQID-00863 I1M076 -- 0 0.52 0.26
0.02 0.07 0.03 0.08 0.00 0.09 0.08 0.04 0.02 0.09 0.12 0.11
SEQID-00864 P27161 -- 0 0.45 0.17 0.05 0.05 0.04 0.11 0.01 0.05
0.17 0.03 0.01 0.05 0.08 0.08 SEQID-00865 Q84MN0 -- 0 0.45 0.19
0.03 0.05 0.05 0.11 0.01 0.05 0.16 0.04 0.00 0.05 0.09 0.06
SEQID-00866 Q948R0 -- 0 0.40 0.19 0.05 0.10 0.02 0.12 0.01 0.05
0.16 0.05 0.01 0.04 0.08 0.03 SEQID-00867 O23320 -- 0 0.47 0.21
0.04 0.01 0.05 0.11 0.01 0.05 0.17 0.02 0.02 0.08 0.09 0.08
SEQID-00868 Q95744 -- 0 0.48 0.16 0.05 0.03 0.02 0.11 0.01 0.06
0.11 0.04 0.02 0.07 0.07 0.08 SEQID-00869 Q41420 -- 0 0.46 0.19
0.04 0.06 0.06 0.11 0.01 0.03 0.15 0.03 0.01 0.06 0.07 0.07
SEQID-00870 Q2R1Z5 -- 1 0.45 0.16 0.03 0.06 0.06 0.12 0.01 0.03
0.13 0.02 0.01 0.06 0.06 0.07 SEQID-00871 Q 6A5 -- 0 0.48 0.22 0.03
0.06 0.05 0.08 0.02 0.02 0.11 0.04 0.02 0.07 0.09 0.11 SEQID-00872
P00571 -- 0 0.49 0.22 0.03 0.08 0.01 0.06 0.01 0.04 0.11 0.05 0.01
0.05 0.09 0.12 SEQID-00873 P05081 -- 0 0.50 0.22 0.03 0.07 0.01
0.06 0.01 0.04 0.11 0.05 0.03 0.05 0.10 0.13 SEQID-00874 A5PJA1 --
1 0.46 0.24 0.01 0.05 0.06 0.08 0.02 0.04 0.12 0.03 0.04 0.07 0.11
0.08 SEQID-00875 Q9TTU2 -- 1 0.45 0.22 0.01 0.07 0.05 0.07 0.02
0.04 0.14 0.03 0.03 0.07 0.10 0.06 SEQID-00876 Q9UU88 -- 1 0.49
0.23 0.01 0.05 0.05 0.06 0.03 0.03 0.17 0.03
0.03 0.08 0.10 0.08 SEQID-00877 Q12055 -- 1 0.40 0.20 0.02 0.07
0.06 0.12 0.02 0.03 0.11 0.03 0.04 0.05 0.07 0.07 SEQID-00878
Q2KIW9 -- 1 0.44 0.20 0.03 0.03 0.05 0.08 0.02 0.05 0.10 0.04 0.01
0.07 0.07 0.11 SEQID-00879 Q5ZKE7 -- 1 0.43 0.20 0.03 0.11 0.04
0.08 0.02 0.04 0.09 0.05 0.01 0.07 0.07 0.09 SEQID-00880 P54877 --
0 0.28 0.09 0.10 0.10 0.02 0.12 0.04 0.02 0.03 0.14 0.02 0.06 0.03
0.10 SEQID-00881 Q10980 -- 0 0.21 0.01 0.07 0.13 0.03 0.07 0.21
0.02 0.03 0.10 0.03 0.00 0.00 0.02 SEQID-00882 Q08000 -- 0 0.28
0.09 0.04 0.16 0.02 0.05 0.00 0.06 0.18 0.10 0.01 0.02 0.05 0.08
SEQID-00883 Q6H595 -- 1 0.31 0.09 0.11 0.16 0.02 0.09 0.08 0.05
0.05 0.07 0.03 0.01 0.04 0.08 SEQID-00884 Q6Z461 -- 0 0.26 0.10
0.12 0.17 0.03 0.05 0.03 0.05 0.05 0.07 0.04 0.01 0.05 0.05
SEQID-00885 Q3T0I4 -- 1 0.31 0.13 0.07 0.19 0.04 0.08 0.00 0.07
0.03 0.11 0.02 0.03 0.07 0.05 SEQID-00886 P46202 96:211 1 0.60 0.23
0.03 0.07 0.06 0.10 0.01 0.06 0.06 0.00 0.05 0.07 0.11 0.17
SEQID-00887 Q03336 281:356 1 0.48 0.16 0.02 0.12 0.09 0.06 0.01
0.06 0.11 0.00 0.04 0.04 0.05 0.15 SEQID-00888 P40568 331:406 1
0.37 0.17 0.02 0.03 0.04 0.26 0.00 0.03 0.18 0.00 0.01 0.06 0.06
0.08 SEQID-00889 Q32LH1 21:116 1 0.38 0.17 0.04 0.12 0.01 0.01 0.00
0.14 0.26 0.00 0.01 0.03 0.12 0.06 SEQID-00890 Q29RL0 676:821 1
0.33 0.17 0.04 0.21 0.01 0.07 0.00 0.13 0.17 0.00 0.02 0.04 0.09
0.05 SEQID-00891 Q2TBK0 56:181 1 0.40 0.14 0.07 0.11 0.02 0.03 0.01
0.13 0.21 0.00 0.04 0.04 0.07 0.10 SEQID-00892 Q06698 146:226 1
0.47 0.16 0.04 0.11 0.08 0.08 0.00 0.08 0.07 0.00 0.03 0.03 0.09
0.13 SEQID-00893 P53061 251:321 1 0.56 0.18 0.01 0.06 0.06 0.08
0.02 0.04 0.10 0.00 0.02 0.05 0.10 0.22 SEQID-00894 Q9BE40 -- -- 1
0.45 0.19 0.05 0.07 0.04 0.05 0.01 0.07 0.15 0.02 0.02 0.05 0.10
0.12 SEQID-00895 F1MRC2 -- -- 1 0.45 0.19 0.05 0.07 0.04 0.05 0.01
0.07 0.15 0.02 0.02 0.05 0.10 0.12 SEQID-00896 F1N757 -- -- 1 0.47
0.21 0.04 0.06 0.03 0.05 0.02 0.05 0.11 0.03 0.02 0.06 0.07 0.09
SEQID-00897 Q9BE39 -- -- 1 0.45 0.19 0.05 0.08 0.05 0.05 0.01 0.07
0.15 0.02 0.02 0.05 0.11 0.12 SEQID-00898 P68138 -- -- 1 0.47 0.20
0.05 0.07 0.03 0.06 0.01 0.03 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-00899 P63258 -- -- 1 0.47 0.20 0.05 0.07 0.02 0.06 0.01 0.04
0.09 0.04 0.03 0.08 0.07 0.06 SEQID-00900 F1MZX6 -- -- 1 0.44 0.19
0.05 0.07 0.05 0.05 0.01 0.08 0.14 0.02 0.02 0.04 0.11 0.11
SEQID-00901 Q9XSC6 -- -- 1 0.50 0.20 0.03 0.07 0.05 0.07 0.01 0.04
0.03 0.04 0.05 0.04 0.10 0.10 SEQID-00902 F1MJ28 -- -- 1 0.46 0.21
0.05 0.10 0.05 0.06 0.01 0.04 0.09 0.03 0.03 0.06 0.09 0.07
SEQID-00903 Q3ZCS5 -- -- 1 0.44 0.20 0.05 0.09 0.05 0.06 0.01 0.07
0.11 0.02 0.03 0.07 0.09 0.07 SEQID-00904 Q0III9 -- -- 1 0.43 0.20
0.06 0.10 0.04 0.06 0.01 0.07 0.11 0.03 0.03 0.05 0.10 0.06
SEQID-00905 Q5KR49 -- -- 0 0.40 0.18 0.08 0.07 0.02 0.08 0.00 0.05
0.22 0.00 0.01 0.04 0.11 0.15 SEQID-00906 Q3ZC09 -- -- 1 0.47 0.22
0.07 0.06 0.05 0.06 0.01 0.03 0.08 0.05 0.02 0.06 0.09 0.10
SEQID-00907 A6QP89 -- -- 1 0.46 0.19 0.05 0.06 0.04 0.07 0.01 0.03
0.11 0.03 0.02 0.07 0.06 0.11 SEQID-00908 Q5KR48 -- -- 0 0.39 0.17
0.07 0.07 0.02 0.08 0.01 0.06 0.23 0.01 0.00 0.04 0.10 0.15
SEQID-00909 P10096 -- -- 1 0.52 0.22 0.06 0.04 0.06 0.06 0.01 0.02
0.05 0.05 0.04 0.07 0.06 0.09 SEQID-00910 P19858 -- -- 1 0.53 0.28
0.04 0.05 0.05 0.05 0.02 0.04 0.06 0.04 0.03 0.08 0.11 0.09
SEQID-00911 E1BF23 -- -- 1 0.45 0.20 0.04 0.08 0.03 0.06 0.02 0.04
0.09 0.03 0.04 0.04 0.08 0.08 SEQID-00912 A0JNJ5 -- -- 0 0.44 0.17
0.08 0.03 0.06 0.05 0.01 0.05 0.14 0.03 0.01 0.04 0.08 0.12
SEQID-00913 P02769 -- -- 1 0.46 0.19 0.05 0.06 0.02 0.07 0.05 0.04
0.11 0.01 0.03 0.03 0.11 0.11 SEQID-00914 Q0VCY0 -- -- 1 0.49 0.25
0.06 0.07 0.04 0.05 0.02 0.03 0.09 0.04 0.02 0.07 0.10 0.06
SEQID-00915 A5D984 -- -- 1 0.48 0.23 0.07 0.08 0.04 0.06 0.02 0.03
0.08 0.04 0.03 0.08 0.08 0.08 SEQID-00916 Q0BDP0 -- -- 1 0.48 0.23
0.05 0.06 0.04 0.06 0.01 0.04 0.06 0.05 0.02 0.09 0.08 0.08
SEQID-00917 F1MR86 -- -- 1 0.46 0.12 0.04 0.04 0.04 0.05 0.10 0.05
0.04 0.03 0.06 0.02 0.03 0.14 SEQID-00918 Q3SZX4 -- -- 1 0.47 0.17
0.05 0.06 0.05 0.05 0.02 0.02 0.07 0.03 0.06 0.04 0.09 0.09
SEQID-00919 Q0IIG5 -- -- 1 0.48 0.22 0.05 0.10 0.04 0.05 0.02 0.03
0.07 0.05 0.03 0.06 0.08 0.06 SEQID-00920 F1MQI3 -- -- 1 0.47 0.17
0.04 0.06 0.04 0.08 0.01 0.05 0.07 0.02 0.04 0.05 0.07 0.13
SEQID-00921 Q3ZBD7 -- -- 1 0.51 0.20 0.04 0.06 0.05 0.04 0.01 0.05
0.07 0.04 0.04 0.06 0.09 0.07 SEQID-00922 G3MYN5 -- -- 1 0.47 0.20
0.05 0.14 0.02 0.06 0.01 0.03 0.12 0.02 0.03 0.02 0.12 0.15
SEQID-00923 E1BNV1 -- -- 1 0.47 0.20 0.04 0.07 0.03 0.06 0.01 0.04
0.10 0.03 0.02 0.05 0.07 0.11 SEQID-00924 E1BE25 -- -- 1 0.44 0.20
0.05 0.06 0.03 0.06 0.02 0.03 0.08 0.06 0.03 0.05 0.05 0.07
SEQID-00925 F1MV90 -- -- 1 0.40 0.19 0.07 0.10 0.02 0.05 0.02 0.08
0.21 0.01 0.01 0.05 0.11 0.12 SEQID-00926 Q3TDP6 -- -- 1 0.52 0.23
0.06 0.04 0.05 0.06 0.02 0.02 0.07 0.05 0.02 0.05 0.10 0.12
SEQID-00927 Q0P571 -- -- 1 0.48 0.16 0.06 0.05 0.05 0.09 0.01 0.05
0.10 0.04 0.01 0.06 0.05 0.11 SEQID-00928 A5PJM2 -- -- 1 0.41 0.15
0.04 0.15 0.02 0.06 0.02 0.05 0.14 0.02 0.04 0.02 0.09 0.12
SEQID-00929 Q5E956 -- -- 1 0.48 0.22 0.08 0.05 0.05 0.05 0.02 0.05
0.08 0.05 0.02 0.06 0.07 0.10 SEQID-00930 P02510 -- -- 1 0.48 0.19
0.03 0.11 0.01 0.06 0.00 0.02 0.09 0.02 0.06 0.06 0.08 0.06
SEQID-00931 Q8MKI3 -- -- 1 0.37 0.13 0.05 0.13 0.02 0.06 0.00 0.06
0.21 0.01 0.03 0.03 0.07 0.15 SEQID-00932 Q3ZBP1 -- -- 1 0.45 0.21
0.04 0.11 0.04 0.07 0.02 0.04 0.07 0.04 0.03 0.05 0.10 0.07
SEQID-00933 O62654 -- -- 1 0.37 0.19 0.06 0.13 0.04 0.05 0.00 0.08
0.14 0.02 0.02 0.04 0.10 0.05 SEQID-00934 F1MPR3 -- -- 1 0.50 0.24
0.05 0.06 0.04 0.05 0.03 0.03 0.09 0.03 0.01 0.07 0.09 0.07
SEQID-00935 P00929 -- -- 0 0.45 0.26 0.08 0.07 0.02 0.06 0.00 0.06
0.08 0.05 0.02 0.07 0.10 0.05 SEQID-00936 Q32KV0 -- -- 1 0.48 0.18
0.06 0.09 0.03 0.05 0.01 0.04 0.10 0.03 0.03 0.06 0.08 0.10
SEQID-00937 F1MHT1 -- -- 1 0.45 0.21 0.04 0.08 0.05 0.05 0.02 0.04
0.07 0.03 0.04 0.05 0.10 0.06 SEQID-00938 Q04467 -- -- 1 0.50 0.19
0.05 0.07 0.04 0.07 0.02 0.05 0.06 0.04 0.04 0.06 0.07 0.09
SEQID-00939 P19483 -- -- 0 0.44 0.25 0.07 0.10 0.03 0.06 0.00 0.05
0.07 0.05 0.01 0.08 0.10 0.07 SEQID-00940 E18B91 -- -- 1 0.42 0.23
0.05 0.09 0.04 0.06 0.01 0.06 0.07 0.05 0.01 0.05 0.10 0.06
SEQID-00941 P85100 -- -- 0 0.46 0.15 0.06 0.04 0.03 0.06 0.01 0.04
0.14 0.04 0.02 0.04 0.07 0.12 SEQID-00942 Q14BH2 -- -- 0 0.44 0.22
0.04 0.07 0.02 0.06 0.01 0.04 0.12 0.03 0.02 0.04 0.10 0.10
SEQID-00943 F1MME6 -- -- 1 0.44 0.19 0.05 0.07 0.03 0.05 0.01 0.04
0.10 0.03 0.03 0.05 0.06 0.09 SEQID-00944 Q3SZE5 -- -- 0 0.50 0.16
0.05 0.04 0.06 0.08 0.00 0.05 0.12 0.03 0.01 0.06 0.06 0.11
SEQID-00945 P00570 -- -- 0 0.48 0.22 0.03 0.09 0.02 0.05 0.01 0.04
0.11 0.05 0.01 0.05 0.09 0.11 SEQID-00946 Q3T149 -- -- 1 0.40 0.17
0.05 0.10 0.02 0.04 0.00 0.06 0.10 0.04 0.03 0.03 0.09 0.04
SEQID-00947 Q5EA88 -- -- 1 0.52 0.25 0.05 0.04 0.05 0.04 0.03 0.05
0.08 0.05 0.04 0.08 0.09 0.09 SEQID-00948 Q32LG3 -- -- 0 0.50 0.25
0.08 0.05 0.04 0.04 0.02 0.03 0.07 0.04 0.02 0.07 0.10 0.09
SEQID-00949 Q27965 -- -- 1 0.45 0.21 0.06 0.08 0.05 0.07 0.01 0.05
0.09 0.04 0.02 0.07 0.08 0.09 SEQID-00950 P02070 -- -- 0 0.57 0.23
0.07 0.04 0.05 0.06 0.01 0.02 0.06 0.04 0.05 0.00 0.12 0.10
SEQID-00951 P12344 -- -- 1 0.47 0.19 0.07 0.07 0.04 0.05 0.02 0.05
0.06 0.04 0.03 0.06 0.08 0.08 SEQID-00952 A4FV78 -- -- 1 0.47 0.24
0.04 0.05 0.04 0.08 0.02 0.04 0.09 0.03 0.01 0.06 0.11 0.10
SEQID-00953 F1MJW7 -- -- 1 0.35 0.17 0.06 0.07 0.03 0.06 0.01 0.04
0.16 0.05 0.03 0.04 0.09 0.05 SEQID-00954 E1BF59 -- -- 1 0.37 0.20
0.07 0.13 0.01 0.04 0.01 0.09 0.14 0.03 0.02 0.03 0.12 0.06
SEQID-00955 P01966 -- -- 0 0.56 0.23 0.09 0.03 0.02 0.06 0.00 0.01
0.04 0.03 0.09 0.00 0.15 0.09 SEQID-00956 Q8SQ24 -- -- 1 0.41 0.16
0.03 0.06 0.04 0.04 0.00 0.06 0.07 0.08 0.03 0.04 0.09 0.08
SEQID-00957 Q5E9B1 -- -- 1 0.53 0.29 0.04 0.04 0.05 0.05 0.01 0.04
0.08 0.04 0.03 0.03 0.11 0.09 SEQID-00958 P33097 -- -- 1 0.46 0.20
0.05 0.03 0.05 0.05 0.01 0.04 0.07 0.03 0.02 0.05 0.09 0.06
SEQID-00959 P19120 -- -- 1 0.46 0.20 0.05 0.06 0.05 0.07 0.01 0.05
0.09 0.04 0.01 0.07 0.07 0.10 SEQID-00960 Q148F8 -- -- 1 0.37 0.22
0.11 0.10 0.00 0.04 0.01 0.04 0.09 0.03 0.05 0.03 0.11 0.02
SEQID-00961 Q8MKH6-2 -- -- 1 0.38 0.14 0.04 0.14 0.02 0.04 0.00
0.06 0.22 0.02 0.03 0.04 0.07 0.14 SEQID-00962 F1MPU4 -- -- 1 0.33
0.16 0.05 0.08 0.06 0.04 0.01 0.09 0.06 0.02 0.02 0.04 0.07 0.07
SEQID-00963 F1MLX6 -- -- 1 0.48 0.18 0.03 0.06 0.06 0.05 0.01 0.04
0.07 0.02 0.04 0.04 0.09 0.09 SEQID-00964 G3N3C9 -- -- 1 0.37 0.14
0.07 0.06 0.03 0.04 0.03 0.06 0.05 0.03 0.03 0.04 0.06 0.06
SEQID-00965 Q9N0V4 -- -- 1 0.50 0.22 0.09 0.08 0.04 0.07 0.01 0.02
0.08 0.03 0.02 0.06 0.12 0.09 SEQID-00966 P02722 -- -- 1 0.51 0.21
0.07 0.08 0.03 0.05 0.01 0.05 0.02 0.05 0.01 0.07 0.08 0.09
SEQID-00967 Q3T145 -- -- 1 0.51 0.25 0.06 0.04 0.04 0.08 0.01 0.03
0.06 0.04 0.02 0.07 0.10 0.11 SEQID-00968 P68252 -- -- 1 0.39 0.19
0.06 0.07 0.06 0.07 0.01 0.05 0.13 0.02 0.02 0.04 0.10 0.08
SEQID-00969 P45879 -- -- 1 0.50 0.19 0.05 0.04 0.07 0.05 0.01 0.03
0.06 0.06 0.01 0.04 0.10 0.10 SEQID-00970 P81948 -- -- 1 0.44 0.20
0.05 0.07 0.04 0.07 0.03 0.04 0.09 0.04 0.04 0.06 0.07 0.05
SEQID-00971 E1BI98 -- -- 1 0.37 0.18 0.05 0.09 0.03 0.08 0.02 0.05
0.08 0.08 0.02 0.04 0.07 0.07 SEQID-00972 PG8432 -- -- 0 0.43 0.18
0.08 0.18 0.01 0.03 0.01 0.07 0.06 0.03 0.02 0.05 0.09 0.11
SEQID-00973 Q5E946 -- -- 0 0.49 0.26 0.07 0.05 0.02 0.06 0.02 0.03
0.10 0.05 0.02 0.06 0.10 0.12 SEQID-00974 Q77834 -- -- 1 0.50 0.22
0.05 0.07 0.04 0.07 0.00 0.02 0.08 0.03 0.02 0.07 0.10 0.10
SEQID-00975 P62261 -- -- 1 0.41 0.20 0.06 0.07 0.04 0.09 0.01 0.04
0.13 0.02 0.01 0.05 0.10 0.08 SEQID-00976 Q2KHU5 -- -- 1 0.44 0.20
0.08 0.11 0.02 0.04 0.03 0.03 0.07 0.04 0.03 0.04 0.11 0.08
SEQID-00977 P31800 -- -- 1 0.41 0.20 0.07 0.09 0.04 0.05 0.03 0.05
0.07 0.04 0.04 0.04 0.11 0.03 SEQID-00978 E1BE77 -- -- 1 0.41 0.20
0.06 0.11 0.02 0.04 0.03 0.05 0.10 0.04 0.04 0.02 0.13 0.05
SEQID-00979 P62803 -- -- 0 0.48 0.22 0.04 0.19 0.02 0.03 0.00 0.02
0.05 0.09 0.02 0.06 0.08 0.12 SEQID-00980 G3MZK7 -- -- 0 0.45 0.15
0.05 0.07 0.00 0.11 0.01 0.04 0.18 0.04 0.00 0.06 0.06 0.06
SEQID-00981 A1A4R1 -- -- 0 0.44 0.23 0.09 0.13 0.05 0.02 0.00 0.05
0.06 0.05 0.03 0.05 0.12 0.13 SEQID-00982 P62808 -- -- 0 0.48 0.16
0.07 0.09 0.02 0.02 0.00 0.03 0.06 0.03 0.03 0.05 0.05 0.18
SEQID-00983 Q5E947 -- -- 1 0.51 0.20 0.04 0.05 0.03 0.08 0.02 0.06
0.04 0.04 0.02 0.08 0.06 0.11 SEQID-00984 P13621 -- -- 0 0.52 0.26
0.06 0.07 0.03 0.02 0.01 0.04 0.07 0.02 0.01 0.05 0.12 0.11
SEQID-00985 P28801 -- -- 1 0.43 0.23 0.05 0.06 0.04 0.06 0.02 0.09
0.05 0.04 0.02 0.03 0.14 0.07 SEQID-00986 Q3SYR3 -- -- 1 0.42 0.17
0.06 0.07 0.04 0.03 0.02 0.05 0.16 0.02 0.02 0.04 0.09 0.07
SEQID-00987 Q3ZBU0 -- -- 1 0.46 0.17 0.04 0.09 0.04 0.05 0.01 0.06
0.06 0.04 0.05 0.05 0.07 0.10 SEQID-00988 P13272 -- -- 1 0.43 0.22
0.07 0.10 0.02 0.05 0.02 0.03 0.06 0.03 0.03 0.04 0.08 0.07
SEQID-00989 Q3Z8I6 -- -- 1 0.34 0.10 0.03 0.08 0.01 0.06 0.12 0.07
0.07 0.05 0.04 0.01 0.06 0.04 SEQID-00990 Q3SYZ8 -- -- 1 0.38 0.17
0.07 0.10 0.05 0.06 0.02 0.06 0.06 0.04 0.04 0.05 0.07 0.06
SEQID-00991 P04272 -- -- 1 0.45 0.21 0.04 0.08 0.03 0.09 0.01 0.04
0.08 0.03 0.01 0.06 0.10 0.11 SEQID-00992 P23004 -- -- 1 0.43 0.22
0.09 0.06 0.05 0.04 0.00 0.05 0.06 0.04 0.04 0.04 0.11 0.06
SEQID-00993 P11179 -- -- 1 0.44 0.22 0.08 0.10 0.03 0.05 0.01 0.03
0.07 0.03 0.01 0.06 0.07 0.07 SEQID-00994 Q32PH8 -- -- 1 0.50 0.22
0.05 0.06 0.04 0.05 0.01 0.03 0.08 0.05 0.03 0.08 0.06 0.12
SEQID-00995 Q29RK1 -- -- 1 0.48 0.22 0.06 0.06 0.04 0.05 0.01 0.05
0.06 0.04 0.03 0.04 0.13 0.06 SEQID-00996 F1N690 -- -- 1 0.44 0.21
0.08 0.07 0.03 0.04 0.01 0.04 0.07 0.04 0.01 0.07 0.07 0.07
SEQID-00997 P79134 -- -- 1 0.45 0.20 0.06 0.09 0.02 0.08 0.01 0.04
0.10 0.03 0.02 0.07 0.10 0.09 SEQID-00998 P20004 -- -- 1 0.47 0.22
0.05 0.07 0.05 0.06 0.02 0.04 0.06 0.05 0.04 0.08 0.09 0.08
SEQID-00999 Q76LV2 -- -- 1 0.47 0.19 0.03 0.06 0.04 0.07 0.01 0.04
0.15 0.02 0.02 0.07 0.08 0.12 SEQID-01000 E1BCU2 -- -- 1 0.42 0.19
0.04 0.10 0.03 0.06 0.01 0.05 0.10 0.03 0.02 0.04 0.08 0.07
SEQID-01001 P02789 -- -- 1 0.45 0.18 0.05 0.06 0.04 0.07 0.04 0.04
0.07 0.04 0.02 0.04 0.08 0.10
SEQID-01002 E1BQC2 -- -- 1 0.46 0.19 0.05 0.06 0.04 0.07 0.04 0.03
0.07 0.04 0.02 0.04 0.08 0.09 SEQID-01003 F1NZY2 -- -- 1 0.42 0.17
0.03 0.04 0.05 0.06 0.09 0.04 0.07 0.03 0.03 0.05 0.05 0.07
SEQID-01004 P01014 -- -- 1 0.52 0.21 0.04 0.04 0.06 0.04 0.01 0.01
0.10 0.03 0.02 0.06 0.09 0.07 SEQID-01005 P00698 -- -- 1 0.42 0.20
0.06 0.12 0.10 0.05 0.06 0.02 0.02 0.05 0.01 0.05 0.10 0.05
SEQID-01006 P01005 -- -- 0 0.41 0.16 0.05 0.04 0.07 0.09 0.09 0.01
0.07 0.05 0.02 0.02 0.07 0.07 SEQID-01007 F1NFY4 -- -- 1 0.39 0.17
0.04 0.08 0.05 0.06 0.09 0.03 0.07 0.04 0.04 0.05 0.06 0.06
SEQID-01008 E1C546 -- -- 1 0.49 0.23 0.04 0.05 0.05 0.05 0.02 0.06
0.07 0.02 0.02 0.07 0.09 0.07 SEQID-01009 F1NIV0 -- -- 1 0.49 0.22
0.05 0.05 0.03 0.03 0.02 0.06 0.06 0.03 0.03 0.04 0.10 0.06
SEQID-01010 P01013 -- -- 1 0.54 0.22 0.04 0.04 0.05 0.05 0.00 0.03
0.10 0.02 0.03 0.06 0.10 0.03 SEQID-01011 E1BTF4 -- -- 1 0.53 0.24
0.05 0.05 0.05 0.05 0.01 0.03 0.08 0.02 0.02 0.05 0.13 0.10
SEQID-01012 F1N8Q8 -- -- 1 0.43 0.18 0.03 0.12 0.03 0.06 0.02 0.07
0.11 0.03 0.03 0.03 0.11 0.04 SEQID-01013 E1C1X2 -- -- 1 0.49 0.28
0.06 0.06 0.02 0.04 0.03 0.05 0.05 0.03 0.04 0.02 0.16 0.04
SEQID-01014 F1P2P7 -- -- 0 0.49 0.18 0.06 0.04 0.04 0.05 0.02 0.04
0.14 0.03 0.08 0.04 0.09 0.08 SEQID-01015 O42273 -- -- 1 0.50 0.29
0.07 0.06 0.01 0.05 0.02 0.05 0.06 0.02 0.03 0.04 0.16 0.04
SEQID-01016 F1NTK2 -- -- 1 0.52 0.22 0.03 0.05 0.03 0.04 0.02 0.06
0.06 0.03 0.03 0.06 0.09 0.07 SEQID-01017 F1NBL0 -- -- 1 0.42 0.17
0.03 0.05 0.06 0.05 0.08 0.04 0.07 0.03 0.02 0.06 0.06 0.07
SEQID-01018 P02701 -- -- 1 0.56 0.22 0.03 0.07 0.07 0.03 0.01 0.03
0.05 0.04 0.02 0.05 0.11 0.07 SEQID-01019 P02752 -- -- 1 0.39 0.12
0.04 0.05 0.04 0.05 0.07 0.05 0.11 0.01 0.04 0.04 0.06 0.07
SEQID-01020 P21760 -- -- 1 0.46 0.19 0.07 0.10 0.01 0.06 0.02 0.01
0.12 0.02 0.01 0.02 0.10 0.08 SEQID-01021 F1NVN3 -- -- 1 0.42 0.18
0.06 0.06 0.06 0.05 0.04 0.06 0.06 0.04 0.02 0.04 0.08 0.06
SEQID-01022 F1N9M9 -- -- 1 0.57 0.21 0.03 0.02 0.02 0.00 0.09 0.02
0.00 0.03 0.02 0.05 0.13 0.11 SEQID-01023 F1NPJ8 -- -- 1 0.43 0.21
0.04 0.06 0.06 0.04 0.02 0.06 0.06 0.05 0.01 0.04 0.10 0.07
SEQID-01024 P01038 -- -- 1 0.42 0.24 0.06 0.09 0.03 0.05 0.09 0.06
0.08 0.03 0.01 0.04 0.11 0.06 SEQID-01025 P41366 -- -- 1 0.43 0.20
0.04 0.09 0.04 0.06 0.04 0.04 0.04 0.06 0.01 0.04 0.10 0.06
SEQID-01026 P02668 -- -- 1 0.44 0.20 0.05 0.04 0.04 0.02 0.01 0.09
0.07 0.01 0.02 0.07 0.07 0.06 SEQID-01027 P02663 -- -- 1 0.47 0.18
0.03 0.04 0.06 0.02 0.01 0.08 0.12 0.00 0.02 0.05 0.07 0.12
SEQID-01028 G5E5H7 -- -- 1 0.50 0.26 0.06 0.02 0.03 0.06 0.04 0.06
0.10 0.01 0.01 0.06 0.15 0.10 SEQID-01029 P24627 -- -- 1 0.44 0.19
0.06 0.07 0.04 0.05 0.05 0.05 0.07 0.04 0.02 0.02 0.11 0.09
SEQID-01030 F1MUT3 -- -- 1 0.48 0.20 0.05 0.06 0.04 0.04 0.09 0.04
0.08 0.04 0.03 0.05 0.09 0.08 SEQID-01031 Q2UVX4 -- -- 1 0.47 0.23
0.04 0.07 0.04 0.06 0.01 0.06 0.08 0.03 0.02 0.06 0.09 0.08
SEQID-01032 Q95114 -- -- 1 0.45 0.18 0.04 0.07 0.06 0.05 0.04 0.06
0.05 0.05 0.03 0.05 0.09 0.04 SEQID-01033 P18892 -- -- 1 0.45 0.21
0.04 0.09 0.02 0.05 0.02 0.03 0.11 0.03 0.02 0.05 0.09 0.05
SEQID-01034 P81265 -- -- 1 0.42 0.19 0.05 0.07 0.04 0.06 0.03 0.05
0.07 0.04 0.02 0.04 0.07 0.07 SEQID-01035 P80025 -- -- 1 0.46 0.20
0.04 0.09 0.06 0.05 0.02 0.05 0.06 0.03 0.03 0.04 0.11 0.06
SEQID-01036 P80195 -- -- 0 0.50 0.23 0.04 0.05 0.05 0.03 0.01 0.05
0.12 0.01 0.04 0.07 0.14 0.10 SEQID-01037 Q9TUM6-2 -- -- 1 0.45
0.23 0.06 0.05 0.05 0.06 0.01 0.07 0.08 0.03 0.02 0.05 0.11 0.08
SEQID-01038 P11151 -- -- 1 0.48 0.20 0.04 0.06 0.05 0.05 0.02 0.03
0.07 0.04 0.04 0.05 0.09 0.08 SEQID-01039 F1N726 -- -- 1 0.41 0.21
0.03 0.07 0.05 0.06 0.05 0.05 0.07 0.04 0.02 0.04 0.11 0.03
SEQID-01040 Q29443 -- -- 1 0.44 0.17 0.05 0.05 0.06 0.07 0.05 0.03
0.07 0.04 0.03 0.03 0.08 0.11 SEQID-01041 F1MLW7 -- -- 1 0.42 0.19
0.04 0.04 0.03 0.03 0.03 0.04 0.04 0.05 0.01 0.03 0.08 0.05
SEQID-01042 G5EST5 -- -- 1 0.48 0.22 0.03 0.04 0.03 0.05 0.02 0.04
0.07 0.03 0.02 0.04 0.08 0.05 SEQID-01043 G5E513 -- -- 1 0.46 0.19
0.04 0.05 0.03 0.05 0.02 0.04 0.07 0.03 0.02 0.03 0.07 0.06
SEQID-01044 Q3ZCH5 -- -- 1 0.38 0.15 0.06 0.09 0.02 0.05 0.01 0.06
0.10 0.04 0.03 0.02 0.09 0.04 SEQID-01045 P26201 -- -- 1 0.52 0.24
0.03 0.04 0.06 0.04 0.02 0.03 0.06 0.03 0.02 0.08 0.09 0.08
SEQID-01046 Q0P569 -- -- 1 0.39 0.18 0.05 0.10 0.03 0.06 0.00 0.09
0.15 0.02 0.04 0.01 0.12 0.07 SEQID-01047 E1BGX8 -- -- 1 0.41 0.17
0.04 0.12 0.04 0.06 0.03 0.04 0.05 0.05 0.03 0.04 0.09 0.07
SEQID-01048 F1MLW8 -- -- 1 0.44 0.20 0.06 0.03 0.02 0.07 0.03 0.06
0.04 0.03 0.02 0.03 0.11 0.07 SEQID-01049 G3N0V0 -- -- 1 0.46 0.18
0.03 0.06 0.03 0.05 0.03 0.05 0.06 0.03 0.03 0.02 0.05 0.07
SEQID-01050 F1MGU7 -- -- 1 0.44 0.17 0.03 0.04 0.06 0.07 0.02 0.06
0.06 0.04 0.03 0.06 0.07 0.08 SEQID-01051 G5E604 -- -- 0 0.30 0.17
0.06 0.10 0.06 0.04 0.02 0.08 0.02 0.06 0.00 0.04 0.06 0.00
SEQID-01052 F6R3I5 -- -- 1 0.44 0.15 0.05 0.04 0.08 0.04 0.06 0.05
0.04 0.03 0.03 0.03 0.06 0.07 SEQID-01053 Q4GZT4 -- -- 1 0.55 0.26
0.04 0.05 0.05 0.04 0.02 0.03 0.06 0.04 0.02 0.07 0.13 0.07
SEQID-01054 F1N647 -- -- 1 0.45 0.23 0.05 0.07 0.04 0.04 0.02 0.07
0.07 0.04 0.03 0.04 0.13 0.04 SEQID-01055 G3MXB5 -- -- 1 0.42 0.22
0.04 0.02 0.05 0.03 0.05 0.07 0.04 0.04 0.02 0.02 0.12 0.04
SEQID-01056 Q27960 -- -- 1 0.56 0.28 0.04 0.04 0.04 0.03 0.04 0.03
0.06 0.03 0.01 0.09 0.12 0.07 SEQID-01057 G3N028 -- -- 1 0.34 0.16
0.03 0.06 0.04 0.03 0.03 0.07 0.04 0.07 0.01 0.05 0.06 0.03
SEQID-01058 P10790 -- -- 1 0.60 0.22 0.02 0.04 0.04 0.08 0.01 0.04
0.06 0.04 0.02 0.05 0.07 0.11 SEQID-01059 Q3SZR3 -- -- 1 0.47 0.19
0.06 0.05 0.04 0.05 0.02 0.04 0.11 0.02 0.03 0.06 0.09 0.09
SEQID-01060 Q9MZ06 -- -- 1 0.47 0.18 0.03 0.08 0.05 0.04 0.04 0.05
0.09 0.03 0.02 0.03 0.10 0.11 SEQID-01061 P02702 -- -- 1 0.41 0.12
0.05 0.08 0.06 0.04 0.06 0.05 0.06 0.02 0.04 0.03 0.06 0.06
SEQID-01062 A2I7M9 -- -- 1 0.50 0.36 0.04 0.07 0.05 0.05 0.00 0.05
0.09 0.02 0.03 0.06 0.14 0.06 SEQID-01063 Q9XSG3 -- -- 1 0.48 0.19
0.05 0.05 0.04 0.06 0.01 0.05 0.08 0.04 0.02 0.07 0.07 0.10
SEQID-01064 A6OL27 -- -- 1 0.42 0.17 0.04 0.08 0.04 0.05 0.05 0.04
0.06 0.04 0.03 0.03 0.06 0.08 SEQID-01065 F1MM32 -- -- 1 0.46 0.20
0.06 0.10 0.03 0.03 0.02 0.04 0.06 0.04 0.03 0.03 0.10 0.05
SEQID-01066 A0JNP2 -- -- 0 0.51 0.28 0.08 0.06 0.06 0.04 0.04 0.01
0.05 0.01 0.00 0.05 0.15 0.07 SEQID-01067 P01888 -- -- 1 0.45 0.22
0.02 0.07 0.03 0.07 0.02 0.06 0.06 0.02 0.04 0.05 0.12 0.08
SEQID-01068 G3MXD9 -- -- 0 0.47 0.27 0.03 0.06 0.03 0.03 0.02 0.06
0.03 0.04 0.00 0.02 0.14 0.04 SEQID-01069 P10152 -- -- 0 0.44 0.19
0.02 0.12 0.05 0.07 0.04 0.03 0.05 0.04 0.05 0.07 0.07 0.07
SEQID-01070 Q3SYR8 -- -- 1 0.42 0.21 0.03 0.09 0.06 0.08 0.05 0.04
0.07 0.01 0.01 0.06 0.06 0.06 SEQID-01071 Q8SPP7 -- -- 1 0.38 0.20
0.06 0.12 0.04 0.03 0.03 0.07 0.03 0.05 0.04 0.04 0.09 0.02
SEQID-01072 P30932 -- -- 1 0.55 0.26 0.04 0.04 0.03 0.04 0.04 0.04
0.07 0.04 0.02 0.10 0.10 0.07 SEQID-01073 P08037-2 -- -- 1 0.42
0.21 0.04 0.09 0.05 0.05 0.02 0.05 0.04 0.04 0.03 0.05 0.11 0.05
SEQID-01074 P02676 -- -- 1 0.41 0.15 0.02 0.08 0.06 0.07 0.02 0.06
0.07 0.04 0.02 0.04 0.06 0.09 SEQID-01075 Q2TBI0 -- -- 1 0.51 0.27
0.04 0.07 0.05 0.05 0.01 0.04 0.06 0.03 0.03 0.06 0.14 0.05
SEQID-01076 Q8WML4 -- -- 1 0.37 0.14 0.08 0.04 0.03 0.03 0.01 0.04
0.03 0.04 0.04 0.03 0.07 0.02 SEQID-01077 P04776 -- -- 1 0.38 0.17
0.04 0.08 0.08 0.04 0.02 0.11 0.10 0.04 0.02 0.05 0.08 0.06
SEQID-01078 Q94LX2 -- -- 1 0.35 0.17 0.03 0.11 0.07 0.05 0.01 0.09
0.15 0.02 0.02 0.05 0.09 0.07 SEQID-01079 Q4LER6 -- -- 1 0.37 0.16
0.03 0.09 0.06 0.04 0.01 0.09 0.14 0.02 0.04 0.04 0.08 0.08
SEQID-01080 Q9SB11 -- -- 1 0.35 0.17 0.03 0.09 0.06 0.06 0.01 0.10
0.11 0.03 0.03 0.04 0.08 0.05 SEQID-01081 K7LZA4 -- -- 1 0.37 0.17
0.03 0.08 0.06 0.05 0.01 0.10 0.10 0.04 0.04 0.04 0.08 0.04
SEQID-01082 P11828 -- -- 1 0.37 0.17 0.04 0.08 0.08 0.03 0.02 0.12
0.09 0.03 0.02 0.05 0.08 0.04 SEQID-01083 P04347 -- -- 1 0.36 0.17
0.02 0.09 0.06 0.05 0.01 0.10 0.09 0.04 0.04 0.03 0.08 0.04
SEQID-01084 I1LB60 -- -- 1 0.46 0.17 0.03 0.09 0.04 0.05 0.01 0.05
0.12 0.03 0.04 0.05 0.08 0.08 SEQID-01085 B3TDK6 -- -- 1 0.47 0.22
0.04 0.07 0.05 0.06 0.01 0.03 0.07 0.04 0.04 0.06 0.11 0.07
SEQID-01086 Q04672 -- -- 1 0.46 0.18 0.03 0.09 0.04 0.04 0.01 0.05
0.12 0.03 0.04 0.05 0.08 0.08 SEQID-01087 I1JF86 -- -- 1 0.48 0.19
0.03 0.08 0.04 0.04 0.01 0.04 0.12 0.03 0.04 0.05 0.10 0.08
SEQID-01088 P09439 -- -- 1 0.47 0.23 0.04 0.07 0.05 0.06 0.01 0.04
0.07 0.04 0.03 0.06 0.10 0.07 SEQID-01089 I1LXD1 -- -- 1 0.51 0.21
0.05 0.06 0.04 0.04 0.03 0.03 0.07 0.05 0.03 0.06 0.06 0.09
SEQID-01090 P01070 -- -- 1 0.47 0.22 0.04 0.07 0.05 0.08 0.02 0.03
0.08 0.04 0.02 0.08 0.09 0.07 SEQID-01091 P08170 -- -- 1 0.47 0.22
0.04 0.06 0.05 0.06 0.00 0.04 0.08 0.06 0.04 0.06 0.10 0.07
SEQID-01092 Q2I0H4 -- -- 1 0.53 0.24 0.05 0.05 0.04 0.08 0.01 0.01
0.06 0.05 0.03 0.07 0.07 0.10 SEQID-01093 C6T9Z5 -- -- 1 0.48 0.22
0.06 0.06 0.05 0.06 0.01 0.04 0.08 0.04 0.05 0.06 0.09 0.08
SEQID-01094 C6TN36 -- -- 1 0.52 0.24 0.05 0.05 0.05 0.08 0.01 0.01
0.06 0.04 0.02 0.07 0.06 0.10 SEQID-01095 K7Kl44 -- -- 1 0.55 0.23
0.05 0.04 0.04 0.07 0.00 0.01 0.05 0.04 0.04 0.06 0.08 0.09
SEQID-01096 I1KC70 -- -- 1 0.53 0.24 0.06 0.05 0.04 0.08 0.01 0.01
0.06 0.05 0.03 0.07 0.06 0.10 SEQID-01097 I1NGF4 -- -- 0 0.41 0.22
0.03 0.10 0.07 0.05 0.00 0.08 0.09 0.02 0.02 0.06 0.11 0.05
SEQID-01098 I1N5S0 -- -- 1 0.48 0.22 0.06 0.06 0.05 0.06 0.01 0.04
0.08 0.04 0.05 0.06 0.09 0.03 SEQID-01099 I1N747 -- -- 1 0.46 0.22
0.12 0.09 0.01 0.03 0.00 0.05 0.08 0.04 0.03 0.03 0.10 0.05
SEQID-01100 P29531 -- -- 1 0.47 0.23 0.12 0.09 0.01 0.03 0.00 0.04
0.07 0.04 0.04 0.05 0.09 0.05 SEQID-01101 I1LE33 -- -- 1 0.38 0.17
0.03 0.12 0.05 0.04 0.01 0.07 0.15 0.03 0.04 0.04 0.09 0.07
SEQID-01102 I1JH86 -- -- 1 0.44 0.23 0.08 0.05 0.05 0.02 0.01 0.05
0.09 0.05 0.03 0.04 0.11 0.08 SEQID-01103 P13917 -- -- 1 0.47 0.22
0.04 0.05 0.06 0.03 0.03 0.10 0.02 0.04 0.04 0.04 0.11 0.03
SEQID-01104 I1MAE6 -- -- 1 0.49 0.22 0.06 0.05 0.03 0.05 0.03 0.03
0.08 0.05 0.04 0.06 0.06 0.08 SEQID-01105 I1KUG6 -- -- 1 0.47 0.22
0.05 0.06 0.02 0.06 0.01 0.03 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-01106 I1MA91 -- -- 1 0.49 0.21 0.05 0.06 0.05 0.05 0.03 0.02
0.09 0.05 0.03 0.06 0.07 0.08 SEQID-01107 Q8RVH5 -- -- 1 0.48 0.21
0.04 0.04 0.06 0.03 0.03 0.10 0.02 0.04 0.06 0.04 0.11 0.04
SEQID-01108 I1KAJ4 -- -- 1 0.49 0.22 0.06 0.05 0.04 0.05 0.03 0.02
0.08 0.06 0.04 0.06 0.06 0.07 SEQID-01109 Q71EW8 -- -- 1 0.49 0.23
0.06 0.06 0.04 0.06 0.00 0.03 0.08 0.03 0.02 0.06 0.10 0.08
SEQID-01110 P05046 -- -- 1 0.52 0.25 0.05 0.03 0.07 0.06 0.00 0.03
0.04 0.02 0.03 0.05 0.12 0.06 SEQID-01111 P19594 -- -- 1 0.43 0.15
0.02 0.08 0.04 0.09 0.06 0.08 0.12 0.02 0.04 0.07 0.08 0.10
SEQID-01112 K7MJY8 -- -- 1 0.49 0.23 0.04 0.08 0.04 0.05 0.01 0.04
0.10 0.03 0.04 0.06 0.11 0.06 SEQID-01113 P25698 -- -- 1 0.52 0.21
0.04 0.06 0.03 0.06 0.01 0.02 0.07 0.04 0.03 0.07 0.06 0.13
SEQID-01114 I7FST9 -- -- 1 0.46 0.18 0.05 0.03 0.04 0.07 0.01 0.05
0.10 0.03 0.03 0.05 0.06 0.10 SEQID-01115 C6T7Y1 -- -- 1 0.47 0.21
0.05 0.07 0.02 0.06 0.01 0.03 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-01116 I1JPW5 -- -- 1 0.47 0.23 0.07 0.04 0.06 0.07 0.01 0.04
0.08 0.05 0.01 0.06 0.08 0.10 SEQID-01117 I1LN49 -- -- 1 0.48 0.18
0.03 0.03 0.03 0.04 0.02 0.05 0.09 0.03 0.08 0.05 0.10 0.06
SEQID-01118 C6TNT2 -- -- 1 0.48 0.19 0.05 0.04 0.05 0.06 0.01 0.04
0.09 0.02 0.01 0.05 0.09 0.11 SEQID-01119 O64458 -- -- 1 0.45 0.18
0.04 0.05 0.04 0.06 0.02 0.05 0.08 0.04 0.04 0.06 0.08 0.08
SEQID-01120 P01064 -- -- 0 0.28 0.08 0.00 0.03 0.02 0.13 0.16 0.05
0.03 0.01 0.01 0.02 0.06 0.07 SEQID-01121 C65WV3 -- -- 1 0.44 0.18
0.05 0.06 0.02 0.06 0.01 0.06 0.08 0.02 0.04 0.05 0.07 0.07
SEQID-01122 C6TKH0 -- -- 1 0.45 0.20 0.07 0.04 0.07 0.05 0.03 0.07
0.07 0.04 0.03 0.05 0.08 0.08 SEQID-01123 I1JGP8 -- -- 1 0.50 0.24
0.08 0.04 0.04 0.05 0.01 0.02 0.07 0.05 0.02 0.06 0.11 0.08
SEQID-01124 I1K668 -- -- 1 0.47 0.22 0.05 0.07 0.04 0.07 0.01 0.04
0.11 0.04 0.01 0.07 0.08 0.11 SEQID-01125 I1KAB7 -- -- 1 0.47 0.20
0.05 0.03 0.05 0.07 0.01 0.05 0.11 0.03 0.03 0.05 0.07 0.10
SEQID-01126 I1NFS4 -- -- 1 0.44 0.24 0.07 0.08 0.03 0.05 0.00 0.05
0.08 0.05 0.02 0.07 0.09 0.05 SEQID-01127 P25272 -- -- 1 0.48 0.24
0.04 0.06 0.03 0.07 0.02 0.05 0.06
0.04 0.01 0.07 0.10 0.06 SEQID-01128 H2D553 -- -- 1 0.47 0.25 0.08
0.05 0.06 0.05 0.02 0.04 0.07 0.04 0.02 0.07 0.09 0.07 SEQID-01129
I1JB84 -- -- 1 0.48 0.25 0.03 0.05 0.05 0.05 0.02 0.04 0.05 0.04
0.03 0.07 0.08 0.06 SEQID-01130 I1KTX8 -- -- 1 0.49 0.27 0.08 0.05
0.02 0.06 0.00 0.02 0.06 0.05 0.02 0.05 0.13 0.09 SEQID-01131
I1KU21 -- -- 1 0.08 0.21 0.05 0.07 0.03 0.06 0.02 0.04 0.09 0.04
0.02 0.05 0.08 0.08 SEQID-01132 I1L3K7 -- -- 1 0.45 0.22 0.07 0.04
0.05 0.06 0.01 0.05 0.08 0.05 0.02 0.06 0.08 0.10 SEQID-01133
I1K3X9 -- -- 1 0.44 0.21 0.05 0.07 0.04 0.06 0.02 0.03 0.09 0.04
0.04 0.06 0.08 0.05 SEQID-01134 I1LDR2 -- -- 1 0.42 0.17 0.04 0.07
0.05 0.06 0.02 0.06 0.09 0.04 0.02 0.04 0.07 0.04 SEQID-01135
O48548 -- -- 1 0.46 0.24 0.06 0.08 0.04 0.06 0.01 0.04 0.04 0.04
0.03 0.06 0.11 0.05 SEQID-01136 O22518 -- -- 1 0.42 0.19 0.08 0.07
0.04 0.07 0.01 0.08 0.06 0.04 0.02 0.08 0.06 0.04 SEQID-01137
Q01915 -- -- 0 0.43 0.26 0.07 0.09 0.03 0.05 0.01 0.06 0.08 0.04
0.01 0.08 0.11 0.06 SEQID-01138 Q42806 -- -- 1 0.50 0.25 0.06 0.06
0.04 0.06 0.02 0.02 0.07 0.04 0.02 0.07 0.10 0.09 SEQID-01139
D6C4Z9 -- -- 1 0.49 0.21 0.04 0.04 0.04 0.07 0.01 0.03 0.14 0.02
0.02 0.06 0.10 0.13 SEQID-01140 I1K3K3 -- -- 1 0.48 0.23 0.06 0.06
0.05 0.07 0.01 0.03 0.06 0.05 0.03 0.08 0.08 0.07 SEQID-01141
K7LEQ5 -- -- 0 0.40 0.07 0.03 0.05 0.05 0.09 0.00 0.06 0.03 0.11
0.09 0.03 0.01 0.06 SEQID-01142 P26413 -- -- 1 0.45 0.20 0.06 0.07
0.06 0.07 0.01 0.04 0.10 0.04 0.01 0.07 0.07 0.10 SEQID-01143
C6TG91 -- -- 1 0.46 0.23 0.05 0.12 0.03 0.04 0.01 0.04 0.09 0.04
0.01 0.05 0.09 0.10 SEQID-01144 I1NJ85 -- -- 1 0.48 0.24 0.07 0.05
0.04 0.06 0.02 0.03 0.05 0.05 0.03 0.07 0.09 0.07 SEQID-01145 K7M
E5 -- -- 1 0.51 0.25 0.07 0.05 0.06 0.03 0.01 0.04 0.09 0.04 0.02
0.06 0.06 0.08 SEQID-01146 Q9ZNZ1 -- -- 0 0.43 0.18 0.02 0.08 0.03
0.05 0.06 0.09 0.14 0.03 0.04 0.09 0.10 0.10 SEQID-01147 P27066 --
-- 1 0.46 0.19 0.06 0.09 0.03 0.06 0.02 0.03 0.09 0.05 0.04 0.04
0.09 0.06 SEQID-01148 C6SVX5 -- -- 1 0.45 0.16 0.06 0.14 0.04 0.04
0.03 0.03 0.04 0.04 0.04 0.04 0.06 0.11 SEQID-01149 I1JUP4 -- -- 1
0.46 0.24 0.08 0.05 0.03 0.04 0.01 0.03 0.02 0.06 0.01 0.08 0.10
0.05 SEQID-01150 I1K354 -- -- 1 0.50 0.23 0.06 0.06 0.04 0.06 0.02
0.04 0.08 0.04 0.02 0.06 0.10 0.08 SEQID-01151 I1K5E6 -- -- 1 0.49
0.23 0.05 0.08 0.04 0.08 0.02 0.02 0.03 0.04 0.03 0.06 0.10 0.06
SEQID-01152 I1KYW3 -- -- 1 0.46 0.21 0.04 0.05 0.04 0.06 0.03 0.05
0.05 0.04 0.02 0.08 0.09 0.07 SEQID-01153 I1LKD3 -- -- 1 0.49 0.20
0.05 0.06 0.03 0.06 0.01 0.03 0.09 0.04 0.03 0.05 0.10 0.08
SEQID-01154 I1LQR8 -- -- 1 0.46 0.19 0.06 0.06 0.05 0.03 0.07 0.03
0.02 0.05 0.07 0.03 0.09 0.02 SEQID-01155 I1LUL9 -- -- 1 0.45 0.22
0.07 0.08 0.04 0.06 0.01 0.03 0.07 0.04 0.02 0.06 0.09 0.06
SEQID-01156 I1M1V8 -- -- 1 0.46 0.23 0.07 0.05 0.05 0.05 0.02 0.04
0.06 0.04 0.03 0.07 0.08 0.05 SEQID-01157 K7KTR9 -- -- 1 0.46 0.23
0.06 0.06 0.03 0.04 0.01 0.04 0.02 0.05 0.02 0.08 0.11 0.03
SEQID-01158 Q8LJW0 -- -- 1 0.52 0.22 0.04 0.12 0.04 0.05 0.01 0.03
0.05 0.04 0.04 0.07 0.09 0.12 SEQID-01159 Q9XEY1 -- -- 1 0.42 0.18
0.03 0.12 0.05 0.10 0.02 0.05 0.09 0.03 0.03 0.04 0.06 0.09
SEQID-01160 P28759 -- -- 1 0.49 0.20 0.05 0.03 0.06 0.05 0.00 0.04
0.08 0.04 0.02 0.04 0.10 0.09 SEQID-01161 C6SVT0 -- -- 1 0.46 0.23
0.04 0.06 0.05 0.05 0.03 0.06 0.08 0.03 0.02 0.04 0.10 0.09
SEQID-01162 C6T9B1 -- -- 1 0.48 0.20 0.06 0.07 0.05 0.08 0.01 0.02
0.08 0.05 0.12 0.06 0.09 0.05 SEQID-01163 C6TGW2 -- -- 1 0.39 0.19
0.08 0.08 0.03 0.07 0.01 0.03 0.14 0.02 0.01 0.05 0.10 0.07
SEQID-01164 I1JXA0 -- -- 1 0.43 0.21 0.04 0.10 0.04 0.08 0.01 0.03
0.11 0.03 0.02 0.06 0.08 0.07 SEQID-01165 I1K4Q5 -- -- 1 0.52 0.21
0.05 0.07 0.03 0.04 0.00 0.03 0.06 0.04 0.02 0.04 0.03 0.18
SEQID-01166 I1K5M9 -- -- 1 0.46 0.21 0.05 0.06 0.04 0.07 0.01 0.02
0.08 0.05 0.03 0.06 0.08 0.07 SEQID-01167 I1MAE7 -- -- 1 0.47 0.19
0.05 0.09 0.03 0.06 0.01 0.03 0.10 0.03 0.04 0.03 0.10 0.07
SEQID-01168 K7K4G2 -- -- 1 0.40 0.15 0.03 0.13 0.04 0.04 0.01 0.05
0.20 0.03 0.02 0.04 0.07 0.10 SEQID-01169 K7MX62 -- -- 0 0.53 0.18
0.06 0.05 0.04 0.05 0.00 0.02 0.10 0.03 0.02 0.03 0.05 0.15
SEQID-01170 P05478 -- -- 1 0.48 0.17 0.03 0.08 0.06 0.07 0.00 0.02
0.12 0.02 0.01 0.04 0.04 0.11 SEQID-01171 C6SY27 -- -- 0 0.52 0.24
0.05 0.14 0.03 0.08 0.00 0.03 0.04 0.01 0.00 0.07 0.07 0.17
SEQID-01172 C6T9D7 -- -- 1 0.46 0.20 0.05 0.07 0.05 0.05 0.01 0.04
0.08 0.04 0.02 0.05 0.08 0.08 SEQID-01173 I1JFX0 -- -- 1 0.49 0.22
0.06 0.05 0.03 0.04 0.01 0.04 0.07 0.04 0.05 0.05 0.08 0.07
SEQID-01174 I1KGP0 -- -- 1 0.49 0.22 0.04 0.11 0.06 0.03 0.00 0.03
0.10 0.03 0.02 0.07 0.10 0.14 SEQID-01175 I1KJI7 -- -- 1 0.49 0.22
0.05 0.07 0.03 0.05 0.00 0.04 0.08 0.05 0.02 0.10 0.05 0.07
SEQID-01176 I1L8R1 -- -- 1 0.46 0.19 0.07 0.12 0.04 0.04 0.00 0.03
0.05 0.03 0.02 0.05 0.07 0.13 SEQID-01177 I1LID6 -- -- 1 0.45 0.18
0.07 0.14 0.04 0.04 0.01 0.03 0.03 0.07 0.07 0.05 0.05 0.09
SEQID-01178 I1LWR4 -- -- 1 0.45 0.20 0.06 0.07 0.05 0.05 0.01 0.03
0.11 0.03 0.02 0.06 0.08 0.08 SEQID-01179 I1M561 -- -- 1 0.49 0.25
0.08 0.06 0.04 0.06 0.01 0.01 0.09 0.05 0.02 0.05 0.13 0.08
SEQID-01180 I1 E4 -- -- 1 0.45 0.24 0.06 0.06 0.04 0.07 0.01 0.04
0.06 0.03 0.02 0.06 0.11 0.07 SEQID-01181 K7KN32 -- -- 1 0.49 0.27
0.05 0.07 0.05 0.05 0.01 0.04 0.04 0.03 0.03 0.09 0.12 0.04
SEQID-01182 Q42807 -- -- 1 0.44 0.18 0.04 0.10 0.03 0.06 0.01 0.05
0.10 0.03 0.03 0.06 0.08 0.07 SEQID-01183 A0A762 -- -- 1 0.43 0.14
0.04 0.03 0.04 0.12 0.01 0.02 0.13 0.03 0.02 0.04 0.06 0.12
SEQID-01184 C6SZ13 -- -- 1 0.50 0.28 0.09 0.05 0.01 0.04 0.00 0.10
0.02 0.03 0.04 0.08 0.11 0.04 SEQID-01185 C6T1V2 -- -- 1 0.47 0.17
0.03 0.10 0.04 0.06 0.00 0.04 0.11 0.04 0.02 0.04 0.04 0.09
SEQID-01186 I1JDH6 -- -- 1 0.48 0.20 0.03 0.14 0.02 0.04 0.01 0.03
0.07 0.07 0.02 0.05 0.07 0.10 SEQID-01187 I1KUR0 -- -- 1 0.46 0.23
0.03 0.10 0.03 0.08 0.01 0.08 0.07 0.04 0.01 0.06 0.10 0.05
SEQID-01188 I1KZP9 -- -- 1 0.54 0.18 0.04 0.10 0.02 0.03 0.01 0.04
0.07 0.04 0.06 0.05 0.06 0.15 SEQID-01189 I1LLR5 -- -- 1 0.48 0.20
0.04 0.02 0.04 0.04 0.04 0.04 0.09 0.01 0.05 0.04 0.11 0.07
SEQID-01190 I1M3C1 -- -- 0 0.42 0.18 0.07 0.11 0.03 0.07 0.00 0.02
0.10 0.03 0.03 0.05 0.08 0.12 SEQID-01191 I1MUH0 -- -- 1 0.51 0.28
0.08 0.07 0.01 0.05 0.01 0.02 0.01 0.04 0.03 0.04 0.16 0.03
SEQID-01192 P04670 -- -- 1 0.50 0.21 0.04 0.06 0.03 0.05 0.01 0.05
0.08 0.03 0.03 0.05 0.08 0.08 SEQID-01193 P17093 -- -- 1 0.52 0.17
0.04 0.11 0.04 0.01 0.02 0.03 0.04 0.05 0.04 0.08 0.04 0.15
SEQID-01194 Q9SWB6 -- -- 1 0.50 0.20 0.05 0.04 0.04 0.04 0.02 0.04
0.12 0.03 0.02 0.06 0.09 0.09 SEQID-01195 C6F117 -- -- 1 0.51 0.25
0.03 0.12 0.04 0.04 0.01 0.03 0.07 0.05 0.03 0.07 0.08 0.10
SEQID-01196 C6K8D0 -- -- 1 0.48 0.25 0.04 0.06 0.04 0.04 0.02 0.04
0.05 0.05 0.02 0.06 0.10 0.06 SEQID-01197 C6SWG9 -- -- 1 0.43 0.17
0.06 0.14 0.04 0.03 0.02 0.05 0.07 0.02 0.04 0.04 0.08 0.12
SEQID-01198 C6SXS0 -- -- 1 0.46 0.22 0.03 0.14 0.03 0.04 0.01 0.05
0.07 0.04 0.01 0.06 0.08 0.10 SEQID-01199 C6SZX7 -- -- 1 0.48 0.20
0.05 0.03 0.09 0.07 0.02 0.03 0.06 0.04 0.01 0.04 0.09 0.12
SEQID-01200 C6T034 -- -- 1 0.47 0.20 0.08 0.03 0.01 0.10 0.01 0.03
0.11 0.03 0.01 0.05 0.08 0.12 SEQID-01201 C6T048 -- -- 1 0.50 0.19
0.04 0.14 0.06 0.07 0.01 0.04 0.03 0.04 0.03 0.05 0.08 0.13
SEQID-01202 C6T871 -- -- 1 0.50 0.23 0.05 0.09 0.05 0.03 0.01 0.02
0.08 0.04 0.03 0.06 0.10 0.03 SEQID-01203 C6T9G0 -- -- 1 0.44 0.20
0.05 0.06 0.07 0.07 0.02 0.06 0.06 0.03 0.01 0.07 0.07 0.07
SEQID-01204 C5TFI8 -- -- 1 0.47 0.19 0.03 0.18 0.03 0.06 0.00 0.02
0.05 0.02 0.02 0.03 0.04 0.14 SEQID-01205 C6THM2 -- -- 1 0.48 0.20
0.06 0.07 0.03 0.05 0.01 0.04 0.07 0.03 0.06 0.06 0.10 0.09
SEQID-01206 C6TJH2 -- -- 1 0.53 0.25 0.02 0.09 0.05 0.06 0.01 0.01
0.08 0.04 0.04 0.09 0.08 0.12 SEQID-01207 I1JW44 -- -- 1 0.46 0.23
0.06 0.06 0.05 0.04 0.03 0.05 0.02 0.03 0.01 0.04 0.11 0.04
SEQID-01208 I1JX58 -- -- 1 0.41 0.20 0.06 0.10 0.04 0.06 0.01 0.05
0.09 0.04 0.01 0.04 0.08 0.07 SEQID-01209 I1K3R6 -- -- 1 0.47 0.21
0.03 0.05 0.03 0.07 0.02 0.03 0.06 0.05 0.05 0.05 0.10 0.05
SEQID-01210 I1K467 -- -- 0 0.49 0.26 0.08 0.07 0.03 0.07 0.01 0.04
0.09 0.03 0.02 0.07 0.10 0.09 SEQID-01211 I1K554 -- -- 0 0.45 0.18
0.03 0.19 0.00 0.05 0.10 0.05 0.03 0.05 0.03 0.01 0.12 0.06
SEQID-01212 I1KDM8 -- -- 0 0.48 0.25 0.08 0.05 0.04 0.05 0.01 0.03
0.06 0.06 0.02 0.05 0.11 0.09 SEQID-01213 I1KRJ7 -- -- 1 0.51 0.21
0.03 0.04 0.04 0.07 0.01 0.05 0.07 0.03 0.02 0.06 0.09 0.11
SEQID-01214 I1KZT2 -- -- 1 0.48 0.21 0.04 0.07 0.03 0.06 0.01 0.03
0.10 0.04 0.02 0.05 0.08 0.09 SEQID-01215 I1LCQ1 -- -- 1 0.52 0.26
0.05 0.06 0.03 0.06 0.01 0.03 0.08 0.03 0.03 0.08 0.11 0.09
SEQID-01216 I1M322 -- -- 1 0.50 0.27 0.08 0.06 0.04 0.05 0.01 0.02
0.08 0.03 0.02 0.05 0.12 0.08 SEQID-01217 I1MC31 -- -- 1 0.47 0.20
0.03 0.06 0.04 0.09 0.00 0.03 0.12 0.02 0.01 0.05 0.10 0.12
SEQID-01218 K7LSN8 -- -- 1 0.50 0.19 0.05 0.05 0.05 0.03 0.02 0.03
0.05 0.06 0.03 0.06 0.05 0.07 SEQID-01219 K7M Y6 -- -- 1 0.52 0.26
0.04 0.07 0.02 0.08 0.02 0.04 0.06 0.03 0.05 0.06 0.11 0.06
SEQID-01220 A1VZE0 -- -- 1 0.49 0.23 0.05 0.06 0.04 0.06 0.01 0.04
0.06 0.05 0.02 0.06 0.08 0.08 SEQID-01221 B2BF98 -- -- 1 0.45 0.18
0.05 0.17 0.02 0.05 0.01 0.04 0.06 0.04 0.00 0.04 0.09 0.16
SEQID-01222 C6SV94 -- -- 0 0.43 0.19 0.07 0.18 0.02 0.06 0.01 0.02
0.06 0.05 0.03 0.06 0.07 0.08 SEQID-01223 C63VR -- -- 1 0.44 0.18
0.06 0.14 0.01 0.05 0.01 0.04 0.04 0.05 0.03 0.06 0.06 0.09
SEQID-01224 C6SVS3 -- -- 1 0.56 0.23 0.04 0.04 0.05 0.03 0.02 0.06
0.07 0.03 0.02 0.05 0.12 0.17 SEQID-01225 C6SWA6 -- -- 0 0.46 0.23
0.08 0.11 0.04 0.02 0.00 0.02 0.06 0.07 0.02 0.04 0.11 0.17
SEQID-01226 C6SWE0 -- -- 1 0.54 0.27 0.07 0.03 0.04 0.06 0.01 0.01
0.10 0.05 0.02 0.08 0.10 0.11 SEQID-01227 C6SWG3 -- -- 0 0.50 0.19
0.06 0.13 0.02 0.04 0.00 0.02 0.07 0.04 0.03 0.07 0.07 0.12
SEQID-01228 C6T065 -- -- 0 0.47 0.22 0.05 0.03 0.05 0.07 0.02 0.05
0.06 0.05 0.04 0.06 0.08 0.08 SEQID-01229 C6T0U3 -- -- 1 0.52 0.23
0.03 0.10 0.02 0.05 0.01 0.03 0.08 0.03 0.04 0.07 0.07 0.12
SEQID-01230 C6T530 -- -- 0 0.47 0.22 0.04 0.13 0.03 0.06 0.00 0.02
0.09 0.02 0.02 0.05 0.08 0.12 SEQID-01231 C6T5U0 -- -- 0 0.43 0.22
0.07 0.15 0.01 0.03 0.02 0.05 0.06 0.05 0.02 0.09 0.06 0.10
SEQID-01232 C6THA9 -- -- 1 0.47 0.22 0.02 0.09 0.06 0.05 0.01 0.03
0.08 0.04 0.03 0.07 0.09 0.07 SEQID-01233 C6TI64 -- -- 1 0.52 0.20
0.05 0.09 0.03 0.07 0.01 0.05 0.07 0.03 0.02 0.06 0.06 0.15
SEQID-01234 C6TMB5 -- -- 1 0.50 0.26 0.05 0.07 0.03 0.09 0.01 0.04
0.07 0.04 0.01 0.08 0.08 0.14 SEQID-01235 I1JA95 -- -- 1 0.37 0.12
0.03 0.13 0.03 0.06 0.01 0.03 0.06 0.09 0.01 0.05 0.05 0.08
SEQID-01236 I1JSJ3 -- -- 1 0.44 0.23 0.08 0.06 0.05 0.04 0.01 0.05
0.08 0.04 0.01 0.04 0.12 0.07 SEQID-01237 I1JXS7 -- -- 1 0.45 0.18
0.04 0.04 0.04 0.09 0.01 0.02 0.12 0.03 0.02 0.07 0.07 0.11
SEQID-01238 I1K099 -- -- 1 0.46 0.21 0.06 0.08 0.02 0.05 0.01 0.03
0.09 0.04 0.02 0.05 0.10 0.08 SEQID-01239 I1K1K4 -- -- 1 0.55 0.27
0.08 0.05 0.01 0.01 0.01 0.09 0.04 0.05 0.06 0.04 0.15 0.02
SEQID-01240 I1K964 -- -- 1 0.45 0.23 0.05 0.05 0.05 0.06 0.00 0.06
0.05 0.06 0.03 0.06 0.08 0.05 SEQID-01241 I1K9I0 -- -- 1 0.45 0.22
0.04 0.07 0.05 0.07 0.02 0.04 0.06 0.04 0.03 0.08 0.07 0.07
SEQID-01242 I1K9M9 -- -- 1 0.45 0.23 0.04 0.05 0.05 0.04 0.03 0.04
0.03 0.04 0.01 0.06 0.10 0.04 SEQID-01243 I1KG34 -- -- 1 0.45 0.21
0.06 0.07 0.03 0.06 0.01 0.04 0.08 0.04 0.02 0.05 0.10 0.06
SEQID-01244 I1KZY9 -- -- 1 0.47 0.23 0.04 0.05 0.05 0.05 0.01 0.04
0.06 0.04 0.04 0.05 0.12 0.05 SEQID-01245 I1L0S5 -- -- 1 0.49 0.23
0.09 0.04 0.07 0.03 0.01 0.03 0.08 0.06 0.03 0.05 0.14 0.07
SEQID-01246 I1L5Q0 -- -- 1 0.46 0.20 0.05 0.12 0.04 0.05 0.01 0.05
0.11 0.02 0.02 0.05 0.10 0.12 SEQID-01247 I1L957 -- -- 0 0.38 0.09
0.11 0.06 0.03 0.08 0.00 0.05 0.15 0.04 0.01 0.01 0.02 0.18
SEQID-01248 I1LFD6 -- -- 1 0.55 0.26 0.05 0.01 0.03 0.04 0.00 0.01
0.09 0.03 0.04 0.04 0.12 0.11 SEQID-01249 I1LIT1 -- -- 1 0.46 0.23
0.03 0.06 0.04 0.06 0.00 0.02 0.05 0.05 0.01 0.08 0.09 0.08
SEQID-01250 I1MIA3 -- -- 0 0.44 0.22 0.06 0.10 0.03 0.14 0.00 0.03
0.08 0.03 0.01 0.05 0.10 0.05 SEQID-01251 I1N1F9 -- -- 1 0.48 0.21
0.07 0.06 0.03 0.05 0.01 0.04 0.07 0.05 0.03 0.05 0.09 0.07
SEQID-01252 I1N4U1 -- -- 1 0.45 0.22 0.06 0.07 0.04 0.06 0.01 0.04
0.09 0.05 0.01 0.08 0.09 0.09
SEQID-01253 I1NH02 -- -- 1 0.45 0.20 0.04 0.02 0.06 0.07 0.02 0.06
0.03 0.04 0.03 0.05 0.10 0.05 SEQID-01254 O23957 -- -- 0 0.40 0.13
0.06 0.09 0.05 0.05 0.00 0.05 0.07 0.08 0.06 0.03 0.06 0.08
SEQID-01255 O49857 -- -- 1 0.47 0.22 0.03 0.06 0.06 0.04 0.02 0.04
0.08 0.04 0.03 0.06 0.09 0.05 SEQID-01256 P00560 -- -- 1 0.51 0.25
0.07 0.05 0.04 0.07 0.00 0.02 0.08 0.05 0.02 0.06 0.10 0.12
SEQID-01257 P00359 -- -- 1 0.50 0.23 0.06 0.05 0.04 0.08 0.01 0.02
0.05 0.04 0.03 0.06 0.07 0.09 SEQID-01258 P00549 -- -- 1 0.43 0.24
0.06 0.07 0.05 0.07 0.01 0.02 0.07 0.04 0.02 0.08 0.07 0.09
SEQID-01259 P00358 -- -- 1 0.51 0.23 0.07 0.05 0.04 0.08 0.01 0.02
0.05 0.04 0.03 0.06 0.07 0.09 SEQID-01260 P10591 -- -- 1 0.45 0.20
0.06 0.06 0.05 0.08 0.00 0.04 0.09 0.04 0.01 0.06 0.08 0.10
SEQID-01261 P00360 -- -- 1 0.51 0.23 0.07 0.05 0.03 0.08 0.01 0.03
0.04 0.04 0.03 0.07 0.06 0.10 SEQID-01262 P10592 -- -- 1 0.45 0.20
0.06 0.06 0.05 0.08 0.00 0.04 0.10 0.04 0.01 0.06 0.08 0.10
SEQID-01263 P00942 -- -- 1 0.49 0.24 0.07 0.05 0.05 0.06 0.01 0.03
0.08 0.05 0.02 0.06 0.08 0.10 SEQID-01264 P02994 -- -- 1 0.52 0.21
0.05 0.06 0.04 0.06 0.01 0.03 0.08 0.05 0.03 0.07 0.05 0.13
SEQID-01265 P06169 -- -- 1 0.51 0.23 0.06 0.04 0.05 0.05 0.01 0.05
0.06 0.04 0.03 0.07 0.10 0.07 SEQID-01266 P22943 -- -- 0 0.35 0.10
0.08 0.04 0.03 0.11 0.00 0.07 0.12 0.06 0.02 0.01 0.03 0.16
SEQID-01267 P14540 -- -- 1 0.47 0.19 0.06 0.04 0.05 0.05 0.01 0.03
0.10 0.04 0.04 0.07 0.07 0.09 SEQID-01268 P05694 -- -- 1 0.48 0.22
0.05 0.06 0.05 0.06 0.00 0.04 0.08 0.03 0.02 0.06 0.09 0.09
SEQID-01269 P31539 -- -- 0 0.44 0.23 0.05 0.08 0.04 0.08 0.01 0.07
0.10 0.03 0.02 0.08 0.11 0.09 SEQID-01270 P15108 -- -- 1 0.48 0.21
0.04 0.05 0.04 0.07 0.00 0.03 0.15 0.02 0.01 0.07 0.10 0.12
SEQID-01271 P32324 -- -- 1 0.49 0.23 0.05 0.07 0.03 0.07 0.01 0.04
0.08 0.04 0.02 0.06 0.08 0.08 SEQID-01272 Q07653 -- -- 1 0.38 0.09
0.04 0.05 0.08 0.08 0.00 0.05 0.07 0.04 0.06 0.03 0.02 0.09
SEQID-01273 P34730 -- -- 1 0.37 0.17 0.05 0.06 0.03 0.05 0.00 0.12
0.13 0.01 0.02 0.05 0.09 0.07 SEQID-01274 P02829 -- -- 1 0.48 0.21
0.04 0.05 0.04 0.07 0.00 0.03 0.15 0.02 0.01 0.07 0.09 0.12
SEQID-01275 Q08969 -- -- 1 0.25 0.05 0.01 0.10 0.09 0.13 0.00 0.17
0.06 0.07 0.03 0.01 0.04 0.03 SEQID-01276 P46367 -- -- 1 0.48 0.23
0.05 0.05 0.05 0.05 0.01 0.04 0.08 0.05 0.02 0.09 0.07 0.09
SEQID-01277 P00950 -- -- 1 0.45 0.22 0.06 0.07 0.05 0.07 0.00 0.04
0.08 0.03 0.02 0.05 0.11 0.11 SEQID-01278 P14126 -- -- 1 0.52 0.18
0.05 0.12 0.02 0.04 0.00 0.02 0.06 0.04 0.05 0.05 0.05 0.13
SEQID-01279 P06106 -- -- 1 0.47 0.20 0.06 0.04 0.05 0.05 0.00 0.05
0.07 0.05 0.05 0.06 0.08 0.07 SEQID-01280 P17709 -- -- 1 0.50 0.23
0.04 0.06 0.03 0.07 0.01 0.04 0.08 0.04 0.04 0.06 0.12 0.07
SEQID-01281 P38158 -- -- 1 0.48 0.15 0.09 0.06 0.05 0.08 0.01 0.03
0.08 0.03 0.03 0.06 0.06 0.09 SEQID-01282 Q12230 -- -- 1 0.39 0.19
0.06 0.07 0.03 0.08 0.00 0.05 0.14 0.02 0.03 0.04 0.09 0.07
SEQID-01283 P07251 -- -- 1 0.43 0.26 0.07 0.09 0.04 0.04 0.00 0.06
0.08 0.05 0.01 0.06 0.13 0.06 SEQID-01284 P11484 -- -- 1 0.47 0.22
0.07 0.07 0.04 0.07 0.00 0.05 0.10 0.04 0.01 0.06 0.09 0.09
SEQID-01285 P17536 -- -- 1 0.40 0.18 0.03 0.04 0.07 0.06 0.00 0.08
0.25 0.00 0.02 0.03 0.12 0.15 SEQID-01286 P60010 -- -- 1 0.47 0.21
0.04 0.07 0.02 0.06 0.01 0.04 0.08 0.04 0.03 0.06 0.07 0.06
SEQID-01287 P12709 -- -- 1 0.53 0.20 0.06 0.03 0.07 0.05 0.00 0.04
0.07 0.04 0.04 0.06 0.09 0.08 SEQID-01288 P09435 -- -- 1 0.44 0.19
0.06 0.08 0.05 0.08 0.00 0.04 0.09 0.04 0.01 0.06 0.07 0.08
SEQID-01289 P19414 -- -- 1 0.48 0.20 0.06 0.06 0.06 0.08 0.01 0.03
0.06 0.05 0.03 0.07 0.08 0.10 SEQID-01290 P17255 -- -- 1 0.46 0.21
0.05 0.07 0.04 0.06 0.01 0.03 0.09 0.04 0.02 0.06 0.08 0.08
SEQID-01291 P19882 -- -- 0 0.46 0.25 0.07 0.07 0.03 0.06 0.01 0.03
0.11 0.05 0.00 0.08 0.09 0.09 SEQID-01292 P16467 -- -- 1 0.51 0.24
0.06 0.05 0.05 0.05 0.01 0.04 0.07 0.04 0.03 0.07 0.10 0.07
SEQID-01293 P06115 -- -- 1 0.43 0.16 0.03 0.06 0.06 0.06 0.01 0.07
0.07 0.03 0.03 0.04 0.06 0.08 SEQID-01294 Q00055 -- -- 1 0.48 0.24
0.05 0.05 0.05 0.05 0.02 0.04 0.10 0.05 0.04 0.07 0.08 0.07
SEQID-01295 P04806 -- -- 1 0.48 0.22 0.04 0.05 0.04 0.08 0.01 0.04
0.08 0.04 0.02 0.07 0.10 0.09 SEQID-01296 P16862 -- -- 1 0.44 0.21
0.07 0.08 0.05 0.06 0.01 0.03 0.07 0.04 0.02 0.06 0.08 0.06
SEQID-01297 P0CX36 -- -- 1 0.51 0.24 0.04 0.12 0.04 0.07 0.00 0.02
0.04 0.05 0.05 0.06 0.10 0.12 SEQID-01298 P53252 -- -- 1 0.35 0.18
0.05 0.08 0.02 0.08 0.00 0.08 0.15 0.03 0.01 0.06 0.09 0.07
SEQID-01299 P00830 -- -- 1 0.48 0.25 0.07 0.07 0.02 0.05 0.00 0.05
0.09 0.05 0.02 0.07 0.10 0.07 SEQID-01300 P16861 -- -- 1 0.48 0.22
0.06 0.07 0.05 0.06 0.01 0.03 0.08 0.04 0.03 0.06 0.09 0.07
SEQID-01301 P16521 -- -- 1 0.49 0.22 0.06 0.06 0.05 0.06 0.01 0.03
0.10 0.03 0.03 0.08 0.08 0.09 SEQID-01302 P11154 -- -- 1 0.46 0.23
0.06 0.08 0.04 0.07 0.01 0.05 0.07 0.04 0.03 0.06 0.09 0.06
SEQID-01303 P23301 -- -- 0 0.50 0.18 0.05 0.04 0.03 0.11 0.01 0.02
0.09 0.04 0.04 0.05 0.07 0.10 SEQID-01304 P41805 -- -- 1 0.43 0.18
0.06 0.14 0.04 0.05 0.02 0.04 0.06 0.03 0.03 0.04 0.08 0.11
SEQID-01305 P00331 -- -- 1 0.47 0.23 0.07 0.03 0.04 0.05 0.02 0.02
0.07 0.07 0.04 0.07 0.08 0.08 SEQID-01306 P10081 -- -- 0 0.47 0.24
0.04 0.06 0.04 0.07 0.01 0.06 0.09 0.03 0.01 0.08 0.09 0.06
SEQID-01307 P18899 -- -- 0 0.13 0.02 0.00 0.02 0.25 0.14 0.00 0.02
0.01 0.06 0.00 0.01 0.00 0.03 SEQID-01308 Q12363 -- -- 1 0.47 0.19
0.03 0.05 0.05 0.08 0.00 0.03 0.07 0.03 0.03 0.07 0.06 0.07
SEQID-01309 Q12122 -- -- 1 0.48 0.23 0.05 0.06 0.06 0.09 0.02 0.02
0.06 0.03 0.03 0.09 0.07 0.09 SEQID-01310 P07262 -- -- 1 0.43 0.20
0.05 0.06 0.05 0.04 0.01 0.05 0.09 0.06 0.01 0.07 0.06 0.07
SEQID-01311 P37291 -- -- 1 0.46 0.21 0.05 0.07 0.04 0.06 0.01 0.04
0.07 0.04 0.04 0.07 0.08 0.08 SEQID-01312 P00890 -- -- 1 0.48 0.22
0.05 0.06 0.03 0.04 0.00 0.04 0.09 0.04 0.03 0.05 0.12 0.09
SEQID-01313 P38720 -- -- 1 0.47 0.22 0.06 0.06 0.04 0.07 0.01 0.03
0.07 0.05 0.02 0.08 0.09 0.08 SEQID-01314 P26263 -- -- 1 0.52 0.26
0.05 0.03 0.05 0.05 0.00 0.05 0.07 0.04 0.03 0.07 0.12 0.08
SEQID-01315 P33315 -- -- 1 0.45 0.20 0.05 0.06 0.04 0.06 0.00 0.05
0.07 0.05 0.03 0.05 0.09 0.07 SEQID-01316 P07149 -- -- 1 0.50 0.23
0.04 0.05 0.05 0.06 0.01 0.04 0.08 0.03 0.02 0.07 0.09 0.08
SEQID-01317 P0CX48 -- -- 1 0.54 0.19 0.04 0.11 0.05 0.01 0.01 0.04
0.03 0.03 0.04 0.06 0.03 0.14 SEQID-01318 P15992 -- -- 1 0.44 0.19
0.03 0.05 0.09 0.10 0.00 0.03 0.06 0.04 0.02 0.04 0.08 0.11
SEQID-01319 P26783 -- -- 1 0.45 0.23 0.07 0.11 0.06 0.05 0.00 0.06
0.10 0.02 0.01 0.08 0.06 0.08 SEQID-01320 P35719 -- -- 1 0.48 0.23
0.03 0.06 0.04 0.11 0.00 0.05 0.13 0.02 0.01 0.06 0.12 0.12
SEQID-01321 P33442 -- -- 1 0.55 0.22 0.04 0.03 0.04 0.05 0.00 0.05
0.07 0.03 0.03 0.06 0.09 0.15 SEQID-01322 P23248 -- -- 1 0.55 0.23
0.04 0.09 0.05 0.05 0.00 0.04 0.07 0.03 0.03 0.05 0.09 0.15
SEQID-01323 P33011 -- -- 1 0.51 0.21 0.07 0.04 0.05 0.08 0.01 0.04
0.03 0.04 0.03 0.05 0.09 0.07 SEQID-01324 P15019 -- -- 1 0.50 0.23
0.06 0.04 0.03 0.07 0.01 0.04 0.09 0.03 0.01 0.07 0.08 0.12
SEQID-01325 P0C590 -- -- 1 0.46 0.23 0.06 0.07 0.06 0.06 0.00 0.05
0.10 0.04 0.01 0.07 0.08 0.09 SEQID-01326 P31688 -- -- 1 0.48 0.21
0.03 0.07 0.06 0.07 0.01 0.06 0.07 0.02 0.02 0.05 0.10 0.09
SEQID-01327 Q02326 -- -- 1 0.52 0.23 0.06 0.03 0.05 0.03 0.00 0.04
0.08 0.02 0.01 0.03 0.11 0.17 SEQID-01328 P25443 -- -- 1 0.48 0.23
0.05 0.10 0.04 0.03 0.00 0.06 0.06 0.06 0.01 0.07 0.09 0.09
SEQID-01329 P05750 -- -- 0 0.45 0.23 0.08 0.12 0.02 0.04 0.00 0.03
0.11 0.04 0.01 0.06 0.08 0.09 SEQID-01330 P05317 -- -- 1 0.45 0.24
0.08 0.06 0.05 0.06 0.00 0.02 0.10 0.04 0.02 0.06 0.08 0.06
SEQID-01331 P38009 -- -- 1 0.44 0.23 0.07 0.07 0.04 0.06 0.01 0.04
0.08 0.03 0.03 0.07 0.08 0.08 SEQID-01332 Q3E754 -- -- 0 0.34 0.21
0.05 0.11 0.07 0.08 0.01 0.04 0.08 0.04 0.01 0.06 0.08 0.07
SEQID-01333 P0C2H7 -- -- 1 0.57 0.18 0.06 0.08 0.02 0.01 0.00 0.03
0.07 0.03 0.05 0.03 0.04 0.19 SEQID-01334 P35691 -- -- 1 0.49 0.19
0.05 0.02 0.05 0.10 0.01 0.03 0.10 0.04 0.01 0.07 0.04 0.10
SEQID-01335 Q12690 -- -- 1 0.41 0.17 0.10 0.18 0.05 0.03 0.00 0.05
0.08 0.02 0.02 0.05 0.06 0.11 SEQID-01336 P10664 -- -- 1 0.49 0.21
0.08 0.10 0.05 0.02 0.00 0.04 0.05 0.04 0.04 0.04 0.08 0.10
SEQID-01337 P41939 -- -- 1 0.51 0.22 0.04 0.06 0.02 0.07 0.00 0.04
0.09 0.03 0.03 0.08 0.07 0.09 SEQID-01338 P16140 -- -- 1 0.43 0.22
0.04 0.09 0.05 0.07 0.00 0.04 0.10 0.04 0.02 0.08 0.08 0.06
SEQID-01339 P10963 -- -- 1 0.47 0.19 0.05 0.05 0.05 0.05 0.02 0.03
0.08 0.03 0.04 0.07 0.07 0.07 SEQID-01340 P37012 -- -- 1 0.48 0.20
0.04 0.04 0.05 0.07 0.01 0.03 0.07 0.05 0.04 0.08 0.07 0.10
SEQID-01341 P23254 -- -- 1 0.46 0.21 0.07 0.05 0.05 0.05 0.00 0.04
0.06 0.04 0.03 0.06 0.10 0.07 SEQID-01342 P0CX52 -- -- 0 0.49 0.22
0.05 0.10 0.02 0.04 0.00 0.05 0.05 0.04 0.03 0.06 0.08 0.14
SEQID-01343 P05759 -- -- 0 0.54 0.21 0.02 0.07 0.03 0.05 0.02 0.04
0.05 0.04 0.04 0.05 0.09 0.19 SEQID-01344 P0CX23 -- -- 1 0.50 0.18
0.04 0.12 0.03 0.03 0.00 0.04 0.06 0.01 0.05 0.06 0.05 0.12
SEQID-01345 P34760 -- -- 1 0.50 0.24 0.06 0.04 0.04 0.06 0.01 0.04
0.09 0.03 0.01 0.07 0.09 0.08 SEQID-01346 P0CX45 -- -- 1 0.43 0.21
0.06 0.15 0.05 0.04 0.00 0.04 0.04 0.07 0.05 0.07 0.07 0.09
SEQID-01347 P46654 -- -- 1 0.42 0.22 0.08 0.08 0.05 0.05 0.00 0.04
0.12 0.02 0.02 0.06 0.08 0.03 SEQID-01348 P31116 -- -- 1 0.52 0.26
0.06 0.03 0.04 0.07 0.00 0.02 0.06 0.04 0.01 0.07 0.09 0.11
SEQID-01349 P53912 -- -- 1 0.50 0.25 0.06 0.03 0.04 0.07 0.01 0.04
0.07 0.04 0.03 0.09 0.09 0.11 SEQID-01350 P19358 -- -- 1 0.46 0.21
0.06 0.06 0.02 0.09 0.01 0.05 0.07 0.04 0.02 0.07 0.08 0.09
SEQID-01351 P06168 -- -- 1 0.45 0.19 0.05 0.09 0.05 0.05 0.01 0.03
0.08 0.04 0.02 0.05 0.09 0.08 SEQID-01352 Q03558 -- -- 1 0.42 0.18
0.06 0.08 0.06 0.05 0.00 0.04 0.09 0.04 0.02 0.06 0.07 0.07
SEQID-01353 P39954 -- -- 1 0.50 0.24 0.07 0.05 0.04 0.05 0.02 0.04
0.08 0.04 0.04 0.07 0.09 0.08 SEQID-01354 Q00764 -- -- 1 0.50 0.23
0.03 0.04 0.06 0.05 0.01 0.04 0.08 0.03 0.04 0.06 0.09 0.07
SEQID-01355 P17967 -- -- 1 0.44 0.21 0.07 0.02 0.05 0.09 0.01 0.04
0.11 0.02 0.03 0.05 0.09 0.08 SEQID-01356 P04802 -- -- 1 0.45 0.20
0.05 0.09 0.03 0.06 0.00 0.05 0.12 0.03 0.03 0.05 0.10 0.10
SEQID-01357 P48589 -- -- 1 0.50 0.30 0.06 0.06 0.04 0.05 0.00 0.04
0.15 0.04 0.02 0.04 0.11 0.07 SEQID-01358 P14832 -- -- 1 0.48 0.18
0.04 0.04 0.05 0.07 0.01 0.03 0.05 0.08 0.03 0.05 0.05 0.09
SEQID-01359 P0CX83 -- -- 1 0.42 0.18 0.09 0.20 0.04 0.04 0.00 0.04
0.07 0.02 0.04 0.04 0.08 0.14 SEQID-01360 P0CX39 -- -- 1 0.42 0.14
0.07 0.15 0.04 0.02 0.01 0.04 0.08 0.04 0.02 0.06 0.05 0.13
SEQID-01361 P26786 -- -- 0 0.50 0.25 0.04 0.09 0.02 0.04 0.00 0.08
0.09 0.02 0.03 0.06 0.11 0.11 SEQID-01362 P05737 -- -- 1 0.48 0.22
0.06 0.08 0.06 0.02 0.00 0.06 0.07 0.03 0.02 0.09 0.08 0.13
SEQID-01363 P17076 -- -- 1 0.49 0.19 0.09 0.07 0.05 0.04 0.00 0.04
0.06 0.03 0.01 0.04 0.08 0.16 SEQID-01364 P07283 -- -- 1 0.48 0.20
0.03 0.07 0.04 0.06 0.01 0.03 0.11 0.04 0.02 0.05 0.10 0.08
SEQID-01365 P00917 -- -- 1 0.49 0.20 0.05 0.03 0.06 0.09 0.00 0.03
0.08 0.03 0.03 0.09 0.06 0.12 SEQID-01366 P18239 -- -- 0 0.50 0.21
0.07 0.07 0.03 0.05 0.01 0.04 0.03 0.06 0.00 0.04 0.11 0.10
SEQID-01367 P26321 -- -- 1 0.41 0.16 0.07 0.10 0.01 0.06 0.00 0.05
0.10 0.03 0.02 0.05 0.08 0.08 SEQID-01368 P17505 -- -- 0 0.51 0.25
0.06 0.05 0.06 0.05 0.00 0.02 0.07 0.04 0.03 0.07 0.10 0.10
SEQID-01369 P07257 -- -- 0 0.47 0.25 0.06 0.06 0.05 0.07 0.00 0.03
0.07 0.03 0.01 0.03 0.13 0.10 SEQID-01370 P31373 -- -- 1 0.48 0.24
0.07 0.05 0.06 0.06 0.00 0.05 0.06 0.04 0.05 0.06 0.11 0.07
SEQID-01371 P38999 -- -- 1 0.48 0.23 0.06 0.05 0.03 0.08 0.01 0.02
0.07 0.04 0.01 0.06 0.10 0.09 SEQID-01372 P07256 -- -- 1 0.49 0.23
0.05 0.05 0.08 0.05 0.00 0.05 0.06 0.03 0.02 0.05 0.12 0.08
SEQID-01373 P53319 -- -- 1 0.48 0.12 0.07 0.07 0.04 0.07 0.01 0.03
0.06 0.05 0.03 0.08 0.09 0.08 SEQID-01374 P54115 -- -- 1 0.48 0.22
0.06 0.05 0.06 0.06 0.01 0.03 0.09 0.05 0.01 0.07 0.08 0.09
SEQID-01375 P32861 -- -- 1 0.50 0.25 0.03 0.07 0.07 0.06 0.01 0.03
0.07 0.03 0.04 0.07 0.12 0.08 SEQID-01376 P32191 -- -- 1 0.49 0.21
0.05 0.06 0.05 0.06 0.01 0.04 0.06 0.03 0.02 0.05 0.09 0.07
SEQID-01377 P19097 -- -- 1 0.46 0.21 0.06 0.05 0.04 0.05 0.00 0.05
0.10 0.04 0.02 0.06 0.09 0.09 SEQID-01378 P38711 -- -- 0 0.53 0.21
0.05 0.07 0.01 0.03 0.06 0.04 0.04
0.03 0.05 0.01 0.11 0.10 SEQID-01379 P0CX31 -- -- 0 0.46 0.19 0.06
0.14 0.04 0.05 0.00 0.04 0.07 0.03 0.01 0.02 0.07 0.16 SEQID-01380
P0C0W1 -- -- 1 0.51 0.25 0.04 0.10 0.05 0.04 0.01 0.04 0.05 0.04
0.04 0.10 0.08 0.10 SEQID-01381 P39516 -- -- 0 0.42 0.19 0.09 0.16
0.02 0.07 0.01 0.03 0.04 0.06 0.02 0.05 0.05 0.08 SEQID-01382
P36010 -- -- 1 0.50 0.21 0.04 0.07 0.03 0.06 0.01 0.04 0.08 0.05
0.02 0.06 0.08 0.10 SEQID-01383 Q02753 -- -- 0 0.46 0.19 0.04 0.12
0.04 0.02 0.01 0.06 0.06 0.04 0.05 0.05 0.05 0.12 SEQID-01384
P40159 -- -- 1 0.24 0.05 0.04 0.05 0.14 0.02 0.00 0.14 0.06 0.16
0.03 0.02 0.02 0.03 SEQID-01385 P05755 -- -- 0 0.41 0.20 0.06 0.17
0.02 0.05 0.00 0.03 0.10 0.03 0.02 0.05 0.10 0.10 SEQID-01386
P08067 -- -- 1 0.49 0.21 0.05 0.06 0.03 0.07 0.02 0.03 0.04 0.04
0.03 0.06 0.08 0.08 SEQID-01387 Q04432 -- -- 1 0.51 0.20 0.07 0.02
0.04 0.10 0.00 0.01 0.06 0.05 0.03 0.05 0.07 0.11 SEQID-01388
P39015 -- -- 1 0.36 0.12 0.08 0.10 0.12 0.08 0.00 0.04 0.08 0.02
0.00 0.02 0.05 0.14 SEQID-01389 P36060 -- -- 1 0.52 0.19 0.03 0.03
0.05 0.07 0.00 0.05 0.06 0.03 0.04 0.05 0.09 0.12 SEQID-01390
P53228 -- -- 1 0.49 0.21 0.06 0.05 0.03 0.06 0.01 0.03 0.11 0.02
0.03 0.06 0.09 0.12 SEQID-01391 P43567 -- -- 1 0.51 0.24 0.06 0.05
0.04 0.06 0.01 0.03 0.05 0.04 0.03 0.06 0.10 0.08 SEQID-01392
P41338 -- -- 1 0.46 0.24 0.09 0.04 0.05 0.05 0.01 0.05 0.07 0.05
0.02 0.07 0.08 0.09 SEQID-01393 P54839 -- -- 1 0.47 0.21 0.04 0.05
0.06 0.07 0.01 0.05 0.05 0.04 0.02 0.06 0.09 0.10 SEQID-01394
Q04792 -- -- 1 0.49 0.20 0.04 0.05 0.05 0.05 0.01 0.04 0.09 0.03
0.05 0.05 0.10 0.08 SEQID-01395 Q01574 -- -- 1 0.48 0.21 0.05 0.06
0.03 0.07 0.01 0.04 0.06 0.04 0.03 0.06 0.08 0.08 SEQID-01396
P25694 -- -- 1 0.43 0.22 0.06 0.09 0.05 0.09 0.00 0.03 0.10 0.04
0.02 0.06 0.08 0.07 SEQID-01397 Q05050 -- -- 1 0.44 0.17 0.06 0.05
0.06 0.06 0.00 0.05 0.13 0.02 0.02 0.05 0.07 0.14 SEQID-01398
P38427 -- -- 1 0.45 0.21 0.04 0.06 0.06 0.06 0.01 0.06 0.06 0.02
0.03 0.07 0.09 0.07 SEQID-01399 P07259 -- -- 1 0.47 0.24 0.05 0.07
0.05 0.06 0.01 0.03 0.08 0.03 0.02 0.07 0.09 0.07 SEQID-01400
P01097 -- -- 0 0.39 0.14 0.04 0.17 0.01 0.05 0.00 0.08 0.12 0.03
0.01 0.02 0.09 0.10 SEQID-01401 Q01519 -- -- 1 0.45 0.11 0.04 0.03
0.06 0.11 0.04 0.08 0.05 0.02 0.04 0.03 0.03 0.09 SEQID-01402
P38804 -- -- 0 0.47 0.20 0.05 0.03 0.07 0.04 0.00 0.02 0.14 0.06
0.00 0.05 0.08 0.13 SEQID-01403 P53221 -- -- 0 0.48 0.24 0.05 0.13
0.02 0.06 0.00 0.05 0.05 0.03 0.02 0.05 0.11 0.16 SEQID-01404
P14127 -- -- 0 0.43 0.22 0.03 0.17 0.05 0.05 0.01 0.06 0.06 0.02
0.01 0.05 0.11 0.11 SEQID-01405 P04037 -- -- 1 0.46 0.22 0.03 0.07
0.03 0.07 0.02 0.04 0.07 0.04 0.03 0.05 0.11 0.07 SEQID-01406
P00427 -- -- 0 0.39 0.19 0.06 0.13 0.05 0.06 0.01 0.03 0.12 0.01
0.02 0.03 0.10 0.07 SEQID-01407 P53849 -- -- 0 0.36 0.09 0.02 0.07
0.06 0.05 0.13 0.05 0.07 0.04 0.06 0.03 0.03 0.10 SEQID-01408
P04449 -- -- 1 0.49 0.13 0.07 0.14 0.03 0.02 0.00 0.05 0.07 0.03
0.02 0.04 0.04 0.22 SEQID-01409 P38013 -- -- 1 0.51 0.22 0.06 0.01
0.04 0.07 0.02 0.03 0.07 0.03 0.02 0.07 0.05 0.09 SEQID-01410
P05740 -- -- 1 0.40 0.16 0.10 0.14 0.04 0.01 0.00 0.07 0.07 0.03
0.03 0.04 0.06 0.11 SEQID-01411 P0CX50 -- -- 0 0.50 0.20 0.07 0.17
0.03 0.03 0.01 0.02 0.03 0.04 0.03 0.04 0.08 0.12 SEQID-01412
P05738 -- -- 0 0.54 0.27 0.02 0.08 0.07 0.06 0.00 0.04 0.05 0.03
0.03 0.09 0.05 0.12 SEQID-01413 P00447 -- -- 1 0.50 0.20 0.07 0.03
0.07 0.05 0.00 0.06 0.06 0.04 0.03 0.05 0.10 0.09 SEQID-01414
P0CX38 -- -- 0 0.44 0.20 0.05 0.16 0.03 0.05 0.00 0.06 0.08 0.04
0.01 0.05 0.08 0.13 SEQID-01415 Q06146 -- -- 0 0.33 0.15 0.03 0.09
0.07 0.08 0.00 0.05 0.14 0.02 0.02 0.05 0.08 0.09 SEQID-01416
P38715 -- -- 1 0.52 0.24 0.03 0.04 0.04 0.06 0.02 0.04 0.08 0.03
0.04 0.07 0.11 0.10 SEQID-01417 P40531 -- -- 0 0.42 0.18 0.06 0.05
0.05 0.05 0.01 0.07 0.13 0.01 0.01 0.04 0.10 0.09 SEQID-01418
P28834 -- -- 1 0.51 0.24 0.05 0.07 0.06 0.05 0.00 0.03 0.07 0.05
0.03 0.09 0.08 0.08 SEQID-01419 P41940 -- -- 1 0.54 0.28 0.03 0.04
0.05 0.06 0.01 0.02 0.08 0.04 0.02 0.09 0.10 0.10 SEQID-01420
P28241 -- -- 1 0.48 0.25 0.05 0.07 0.06 0.04 0.01 0.02 0.06 0.04
0.02 0.08 0.10 0.06 SEQID-01421 P39714 -- -- 1 0.53 0.24 0.04 0.03
0.03 0.06 0.03 0.03 0.08 0.05 0.06 0.08 0.07 0.10 SEQID-01422
Q12443 -- -- 1 0.47 0.20 0.03 0.07 0.08 0.05 0.00 0.04 0.07 0.02
0.04 0.06 0.08 0.09 SEQID-01423 P07267 -- -- 1 0.47 0.21 0.05 0.02
0.05 0.07 0.01 0.03 0.08 0.05 0.03 0.06 0.10 0.07 SEQID-01424
P36008 -- -- 1 0.48 0.19 0.07 0.05 0.05 0.07 0.00 0.02 0.08 0.02
0.01 0.04 0.09 0.12 SEQID-01425 Q04409 -- -- 1 0.47 0.24 0.03 0.08
0.04 0.05 0.02 0.03 0.09 0.04 0.03 0.06 0.12 0.06 SEQID-01426
P50095 -- -- 1 0.48 0.23 0.05 0.06 0.06 0.05 0.01 0.05 0.06 0.05
0.02 0.06 0.10 0.07 SEQID-01427 P32316 -- -- 1 0.48 0.21 0.05 0.07
0.06 0.07 0.01 0.03 0.07 0.03 0.05 0.06 0.08 0.07 SEQID-01428
P37302 -- -- 1 0.45 0.19 0.05 0.03 0.08 0.07 0.01 0.04 0.08 0.03
0.04 0.06 0.08 0.09 SEQID-01429 Q03104 -- -- 1 0.50 0.17 0.03 0.03
0.06 0.10 0.00 0.06 0.04 0.02 0.02 0.03 0.09 0.13 SEQID-01430
P15705 -- -- 1 0.39 0.14 0.08 0.06 0.06 0.07 0.00 0.06 0.11 0.02
0.02 0.05 0.07 0.12 SEQID-01431 Q00711 -- -- 1 0.46 0.19 0.06 0.09
0.04 0.06 0.02 0.03 0.07 0.05 0.05 0.05 0.08 0.06 SEQID-01432
P07244 -- -- 1 0.48 0.25 0.06 0.05 0.04 0.07 0.01 0.05 0.06 0.05
0.03 0.07 0.09 0.06 SEQID-01433 P41058 -- -- 1 0.42 0.11 0.02 0.19
0.05 0.03 0.06 0.04 0.04 0.03 0.08 0.03 0.03 0.08 SEQID-01434
P02309 -- -- 0 0.47 0.23 0.04 0.19 0.01 0.03 0.00 0.02 0.05 0.08
0.02 0.07 0.09 0.12 SEQID-01435 P22803 -- -- 0 0.48 0.21 0.10 0.01
0.02 0.07 0.02 0.05 0.07 0.03 0.00 0.05 0.05 0.10 SEQID-01436
P20081 -- -- 1 0.48 0.25 0.02 0.05 0.05 0.07 0.01 0.03 0.05 0.08
0.01 0.08 0.07 0.07 SEQID-01437 Q04438 -- -- 1 0.36 0.13 0.02 0.11
0.07 0.08 0.00 0.07 0.09 0.03 0.03 0.03 0.04 0.08 SEQID-01438
P02294 -- -- 0 0.47 0.16 0.08 0.07 0.02 0.02 0.00 0.04 0.07 0.02
0.02 0.06 0.05 0.17 SEQID-01439 P38701 -- -- 1 0.51 0.25 0.02 0.07
0.05 0.02 0.00 0.10 0.11 0.02 0.02 0.10 0.05 0.13 SEQID-01440
P38061 -- -- 1 0.55 0.19 0.06 0.12 0.05 0.02 0.00 0.02 0.03 0.03
0.07 0.06 0.07 0.16 SEQID-01441 P32445 -- -- 1 0.44 0.16 0.05 0.08
0.08 0.05 0.00 0.05 0.08 0.03 0.02 0.04 0.07 0.08 SEQID-01442
P38754 -- -- 0 0.53 0.24 0.10 0.11 0.02 0.03 0.01 0.06 0.04 0.03
0.00 0.06 0.08 0.14 SEQID-01443 Q03048 -- -- 1 0.44 0.19 0.05 0.07
0.04 0.09 0.01 0.01 0.08 0.03 0.01 0.04 0.08 0.09 SEQID-01444
Q01855 -- -- 0 0.49 0.18 0.06 0.14 0.04 0.01 0.00 0.02 0.07 0.04
0.03 0.05 0.06 0.10 SEQID-01445 P0CX54 -- -- 0 0.46 0.24 0.06 0.07
0.04 0.05 0.01 0.04 0.09 0.04 0.02 0.10 0.07 0.13 SEQID-01446
P40414 -- -- 0 0.36 0.16 0.03 0.04 0.08 0.05 0.01 0.08 0.25 0.00
0.00 0.02 0.12 0.14 SEQID-01447 Q3E757 -- -- 1 0.48 0.20 0.03 0.13
0.04 0.06 0.01 0.04 0.07 0.04 0.02 0.06 0.06 0.11 SEQID-01448
Q12402 -- -- 1 0.54 0.27 0.05 0.04 0.03 0.03 0.00 0.04 0.04 0.03
0.01 0.08 0.13 0.07 SEQID-01449 Q96VH4 -- -- 1 0.49 0.19 0.09 0.04
0.04 0.04 0.00 0.05 0.07 0.03 0.03 0.08 0.06 0.09 SEQID-01450
P52286 -- -- 1 0.38 0.18 0.03 0.09 0.09 0.13 0.00 0.02 0.13 0.01
0.02 0.05 0.07 0.06 SEQID-01451 P26785 -- -- 1 0.50 0.11 0.07 0.12
0.02 0.04 0.00 0.03 0.05 0.03 0.02 0.04 0.09 0.15 SEQID-01452
P32471 -- -- 1 0.44 0.17 0.10 0.01 0.03 0.11 0.00 0.05 0.13 0.02
0.02 0.06 0.06 0.10 SEQID-01453 P53184 -- -- 1 0.53 0.22 0.03 0.04
0.04 0.10 0.01 0.03 0.06 0.02 0.07 0.07 0.06 0.09 SEQID-01454
P32835 -- -- 1 0.48 0.20 0.05 0.05 0.05 0.06 0.01 0.06 0.08 0.03
0.02 0.05 0.08 0.09 SEQID-01455 P17891 -- -- 1 0.38 0.14 0.05 0.06
0.05 0.16 0.00 0.06 0.14 0.02 0.01 0.05 0.06 0.11 SEQID-01456
P05626 -- -- 1 0.48 0.25 0.06 0.06 0.04 0.04 0.00 0.06 0.09 0.02
0.01 0.05 0.11 0.10 SEQID-01457 P40106 -- -- 1 0.49 0.20 0.07 0.04
0.04 0.08 0.01 0.02 0.08 0.04 0.02 0.08 0.07 0.12 SEQID-01458
P27616 -- -- 1 0.50 0.23 0.04 0.05 0.03 0.07 0.00 0.03 0.10 0.03
0.02 0.07 0.09 0.11 SEQID-01459 P47143 -- -- 1 0.49 0.23 0.08 0.02
0.04 0.07 0.01 0.04 0.07 0.04 0.03 0.05 0.10 0.08 SEQID-01460
P32449 -- -- 1 0.45 0.22 0.07 0.07 0.07 0.06 0.01 0.05 0.07 0.05
0.03 0.07 0.09 0.07 SEQID-01461 P13663 -- -- 1 0.48 0.26 0.06 0.06
0.03 0.06 0.02 0.04 0.08 0.04 0.03 0.09 0.10 0.09 SEQID-01462
P32771 -- -- 1 0.50 0.21 0.07 0.04 0.03 0.07 0.04 0.03 0.07 0.06
0.03 0.07 0.06 0.10 SEQID-01463 P32288 -- -- 1 0.41 0.15 0.05 0.08
0.04 0.06 0.02 0.04 0.08 0.05 0.04 0.07 0.05 0.06 SEQID-01464
P09624 -- -- 1 0.51 0.24 0.06 0.05 0.05 0.05 0.01 0.03 0.09 0.05
0.04 0.08 0.08 0.11 SEQID-01465 Q05911 -- -- 1 0.49 0.23 0.06 0.09
0.04 0.06 0.01 0.04 0.09 0.02 0.03 0.06 0.10 0.06 SEQID-01466
P54114 -- -- 1 0.50 0.21 0.06 0.03 0.05 0.07 0.01 0.04 0.07 0.04
0.01 0.07 0.08 0.11 SEQID-01467 P32582 -- -- 1 0.50 0.24 0.04 0.04
0.06 0.08 0.00 0.03 0.07 0.04 0.02 0.03 0.10 0.12 SEQID-01468
P15891 -- -- 1 0.36 0.14 0.06 0.04 0.05 0.08 0.00 0.04 0.15 0.02
0.01 0.05 0.05 0.12 SEQID-01469 P53051 -- -- 1 0.46 0.15 0.03 0.06
0.06 0.07 0.01 0.02 0.09 0.03 0.03 0.05 0.06 0.09 SEQID-01470
P09232 -- -- 1 0.47 0.18 0.05 0.04 0.06 0.09 0.01 0.04 0.08 0.05
0.05 0.06 0.07 0.11 SEQID-01471 P52910 -- -- 1 0.47 0.22 0.05 0.06
0.04 0.06 0.01 0.03 0.07 0.04 0.04 0.06 0.07 0.07 SEQID-01472
P07264 -- -- 1 0.47 0.20 0.05 0.06 0.04 0.07 0.01 0.04 0.03 0.04
0.03 0.07 0.08 0.09 SEQID-01473 P33416 -- -- 1 0.47 0.25 0.05 0.10
0.04 0.08 0.01 0.04 0.09 0.03 0.02 0.07 0.11 0.10 SEQID-01474
P21306 -- -- 0 0.40 0.15 0.12 0.07 0.05 0.02 0.00 0.08 0.04 0.02
0.00 0.05 0.07 0.08 SEQID-01475 P01095 -- -- 0 0.63 0.25 0.02 0.00
0.08 0.08 0.00 0.00 0.11 0.02 0.10 0.03 0.07 0.16 SEQID-01476
P0CX26 -- -- 1 0.46 0.16 0.08 0.15 0.00 0.01 0.05 0.04 0.04 0.05
0.01 0.04 0.03 0.14 SEQID-01477 P14120 -- -- 0 0.52 0.28 0.05 0.04
0.04 0.02 0.00 0.04 0.06 0.04 0.00 0.07 0.13 0.13 SEQID-01478
P25373 -- -- 0 0.47 0.27 0.05 0.04 0.07 0.05 0.02 0.05 0.13 0.03
0.03 0.08 0.13 0.08 SEQID-01479 Q3E792 -- -- 0 0.50 0.21 0.08 0.09
0.00 0.04 0.00 0.05 0.05 0.02 0.03 0.08 0.08 0.19 SEQID-01480
P40037 -- -- 0 0.47 0.25 0.10 0.03 0.08 0.05 0.01 0.03 0.07 0.01
0.03 0.07 0.07 0.06 SEQID-01481 P32463 -- -- 0 0.41 0.23 0.05 0.09
0.06 0.10 0.01 0.05 0.06 0.01 0.01 0.09 0.06 0.06 SEQID-01482
P00128 -- -- 1 0.44 0.24 0.06 0.03 0.04 0.06 0.01 0.04 0.11 0.01
0.03 0.09 0.12 0.08 SEQID-01483 P07281 -- -- 1 0.39 0.20 0.06 0.12
0.04 0.06 0.00 0.06 0.07 0.05 0.02 0.07 0.06 0.09 SEQID-01484
P04456 -- -- 0 0.51 0.22 0.09 0.07 0.05 0.04 0.00 0.02 0.04 0.02
0.01 0.05 0.08 0.18 SEQID-01485 Q12513 -- -- 0 0.39 0.20 0.04 0.07
0.09 0.11 0.01 0.03 0.12 0.03 0.02 0.08 0.07 0.08 SEQID-01486
P05756 -- -- 1 0.46 0.24 0.06 0.13 0.04 0.03 0.00 0.02 0.05 0.03
0.03 0.09 0.09 0.10 SEQID-01487 P39726 -- -- 1 0.46 0.21 0.04 0.04
0.05 0.05 0.00 0.05 0.12 0.04 0.02 0.04 0.10 0.06 SEQID-01488
Q12408 -- -- 0 0.45 0.28 0.04 0.04 0.06 0.05 0.02 0.02 0.12 0.04
0.01 0.09 0.11 0.05 SEQID-01489 P40043 -- -- 1 0.56 0.16 0.02 0.02
0.02 0.08 0.01 0.03 0.13 0.02 0.10 0.04 0.05 0.13 SEQID-01490
P38886 -- -- 0 0.41 0.20 0.05 0.07 0.06 0.06 0.00 0.10 0.11 0.03
0.03 0.06 0.09 0.04 SEQID-01491 Q07651 -- -- 1 0.49 0.19 0.06 0.06
0.06 0.03 0.02 0.03 0.02 0.04 0.01 0.03 0.11 0.05 SEQID-01492
Q07551 -- -- 1 0.48 0.22 0.04 0.04 0.04 0.05 0.00 0.06 0.09 0.02
0.02 0.07 0.10 0.10 SEQID-01493 P50107 -- -- 1 0.47 0.17 0.02 0.05
0.06 0.06 0.02 0.03 0.09 0.04 0.05 0.05 0.08 0.10 SEQID-01494
P04173 -- -- 1 0.50 0.26 0.07 0.04 0.04 0.07 0.01 0.03 0.08 0.04
0.02 0.07 0.12 0.09 SEQID-01495 P49723 -- -- 1 0.49 0.17 0.05 0.04
0.06 0.06 0.01 0.03 0.11 0.02 0.02 0.07 0.07 0.11 SEQID-01496
P40495 -- -- 0 0.45 0.25 0.06 0.08 0.04 0.06 0.01 0.05 0.07 0.05
0.01 0.08 0.09 0.08 SEQID-01497 P08524 -- -- 1 0.48 0.22 0.05 0.04
0.04 0.07 0.02 0.04 0.10 0.02 0.02 0.06 0.10 0.11 SEQID-01498
Q12123 -- -- 1 0.50 0.23 0.02 0.07 0.05 0.07 0.00 0.03 0.07 0.03
0.05 0.08 0.09 0.08 SEQID-01499 Q12329 -- -- 0 0.34 0.14 0.03 0.07
0.06 0.06 0.00 0.06 0.13 0.03 0.04 0.04 0.06 0.07 SEQID-01500
P38219 -- -- 1 0.49 0.24 0.05 0.07 0.04 0.06 0.01 0.04 0.10 0.03
0.02 0.09 0.09 0.11 SEQID-01501 P38891 -- -- 1 0.49 0.21 0.05 0.06
0.05 0.04 0.01 0.04 0.07 0.04 0.02 0.05 0.10 0.08 SEQID-01502
P09938 -- -- 1 0.50 0.19 0.05 0.05 0.06 0.06 0.00 0.02 0.13 0.02
0.03 0.06 0.09 0.10 SEQID-01503 P07991 -- -- 1 0.51 0.24 0.07 0.04
0.03 0.05 0.02 0.04 0.07 0.04 0.06 0.07 0.11 0.08
SEQID-01504 P29952 -- -- 1 0.46 0.19 0.05 0.05 0.05 0.07 0.01 0.05
0.08 0.03 0.03 0.06 0.08 0.10 SEQID-01505 P40054 -- -- 1 0.47 0.26
0.05 0.04 0.07 0.04 0.01 0.06 0.07 0.03 0.03 0.09 0.10 0.06
SEQID-01506 P32481 -- -- 1 0.48 0.25 0.05 0.07 0.04 0.06 0.02 0.05
0.10 0.04 0.02 0.10 0.08 0.09 SEQID-01507 P03536 -- -- 1 0.45 0.24
0.04 0.09 0.04 0.07 0.00 0.05 0.07 0.03 0.03 0.08 0.10 0.05
SEQID-01508 P06208 -- -- 1 0.42 0.20 0.06 0.08 0.06 0.06 0.01 0.04
0.08 0.03 0.02 0.06 0.07 0.07 SEQID-01509 P46655 -- -- 1 0.50 0.21
0.05 0.07 0.05 0.09 0.01 0.03 0.07 0.03 0.02 0.07 0.08 0.11
SEQID-01510 P04801 -- -- 1 0.48 0.18 0.03 0.07 0.04 0.06 0.01 0.04
0.10 0.03 0.03 0.05 0.08 0.10 SEQID-01511 P00915 -- -- 1 0.47 0.24
0.05 0.04 0.04 0.06 0.01 0.05 0.10 0.03 0.02 0.06 0.11 0.09
SEQID-01512 P39730 -- -- 1 0.45 0.20 0.05 0.06 0.03 0.06 0.01 0.06
0.14 0.03 0.01 0.05 0.09 0.14 SEQID-01513 P22515 -- -- 1 0.48 0.22
0.04 0.05 0.06 0.08 0.01 0.04 0.08 0.03 0.02 0.06 0.10 0.09
SEQID-01514 Q00955 -- -- 1 0.47 0.22 0.04 0.08 0.05 0.06 0.00 0.04
0.09 0.03 0.03 0.07 0.09 0.07 SEQID-01515 P37299 -- -- 1 0.56 0.20
0.03 0.04 0.03 0.04 0.00 0.01 0.05 0.05 0.05 0.01 0.17 0.07
SEQID-01516 P50263 -- -- 0 0.45 0.03 0.03 0.04 0.12 0.10 0.00 0.06
0.06 0.06 0.05 0.01 0.01 0.16 SEQID-01517 P01098 -- -- 0 0.37 0.18
0.04 0.14 0.09 0.03 0.01 0.06 0.10 0.03 0.03 0.06 0.10 0.11
SEQID-01518 Q12497 -- -- 0 0.42 0.12 0.03 0.13 0.05 0.10 0.00 0.06
0.07 0.03 0.03 0.02 0.08 0.13 SEQID-01519 P05745 -- -- 0 0.49 0.20
0.07 0.17 0.05 0.01 0.00 0.00 0.06 0.04 0.01 0.08 0.06 0.16
SEQID-01520 Q3E841 -- -- 0 0.47 0.24 0.05 0.06 0.06 0.03 0.00 0.01
0.08 0.04 0.03 0.09 0.06 0.10 SEQID-01521 P38910 -- -- 0 0.51 0.29
0.06 0.04 0.05 0.07 0.00 0.07 0.06 0.04 0.00 0.07 0.11 0.12
SEQID-01522 P41056 -- -- 1 0.46 0.20 0.05 0.14 0.07 0.00 0.00 0.03
0.04 0.04 0.03 0.06 0.06 0.09 SEQID-01523 P39939 -- -- 0 0.37 0.16
0.08 0.19 0.07 0.03 0.03 0.01 0.04 0.01 0.03 0.05 0.03 0.14
SEQID-01524 Q08245 -- -- 0 0.42 0.14 0.08 0.01 0.07 0.03 0.00 0.11
0.21 0.02 0.00 0.04 0.04 0.20 SEQID-01525 P04912 -- -- 0 0.42 0.24
0.10 0.11 0.07 0.02 0.00 0.05 0.05 0.06 0.03 0.06 0.14 0.10
SEQID-01526 P0CX41 -- -- 0 0.45 0.22 0.07 0.11 0.06 0.04 0.01 0.02
0.04 0.07 0.00 0.05 0.07 0.10 SEQID-01527 P07274 -- -- 1 0.43 0.24
0.06 0.06 0.03 0.07 0.01 0.09 0.05 0.06 0.03 0.08 0.07 0.05
SEQID-01528 Q12305 -- -- 1 0.43 0.18 0.04 0.04 0.06 0.07 0.01 0.03
0.07 0.04 0.04 0.06 0.05 0.08 SEQID-01529 P40185 -- -- 0 0.48 0.23
0.07 0.05 0.09 0.03 0.01 0.04 0.06 0.01 0.03 0.04 0.08 0.08
SEQID-01530 P38879 -- -- 0 0.41 0.21 0.09 0.03 0.09 0.07 0.00 0.08
0.10 0.03 0.01 0.07 0.06 0.11 SEQID-01531 P11076 -- -- 1 0.49 0.22
0.04 0.09 0.07 0.04 0.01 0.03 0.09 0.04 0.01 0.06 0.10 0.06
SEQID-01532 P49435 -- -- 0 0.50 0.26 0.07 0.03 0.04 0.04 0.01 0.04
0.11 0.04 0.01 0.07 0.14 0.09 SEQID-01533 P22141 -- -- 0 0.45 0.23
0.03 0.08 0.02 0.09 0.00 0.07 0.06 0.03 0.02 0.07 0.10 0.08
SEQID-01534 P07260 -- -- 1 0.52 0.20 0.03 0.05 0.04 0.08 0.00 0.03
0.10 0.03 0.04 0.05 0.09 0.10 SEQID-01535 Q04304 -- -- 1 0.46 0.25
0.06 0.06 0.06 0.06 0.01 0.03 0.08 0.03 0.01 0.07 0.09 0.09
SEQID-01536 Q01976 -- -- 1 0.48 0.23 0.03 0.07 0.04 0.07 0.02 0.05
0.09 0.03 0.02 0.08 0.08 0.10 SEQID-01537 Q12522 -- -- 0 0.43 0.27
0.04 0.08 0.06 0.05 0.02 0.06 0.09 0.04 0.02 0.07 0.11 0.01
SEQID-01538 P40582 -- -- 1 0.48 0.22 0.05 0.05 0.03 0.06 0.00 0.04
0.08 0.02 0.04 0.07 0.11 0.09 SEQID-01539 P39929 -- -- 1 0.44 0.20
0.04 0.05 0.08 0.06 0.00 0.06 0.17 0.02 0.02 0.06 0.09 0.10
SEQID-01540 P39931 -- -- 1 0.51 0.20 0.03 0.05 0.04 0.03 0.00 0.02
0.15 0.03 0.08 0.07 0.08 0.09 SEQID-01541 P00410 -- -- 1 0.53 0.28
0.04 0.03 0.03 0.06 0.01 0.04 0.07 0.02 0.02 0.10 0.11 0.04
SEQID-01542 P15873 -- -- 0 0.51 0.26 0.03 0.04 0.02 0.11 0.01 0.04
0.08 0.02 0.01 0.09 0.13 0.08 SEQID-01543 P32379 -- -- 1 0.43 0.22
0.06 0.06 0.03 0.06 0.01 0.03 0.15 0.04 0.03 0.06 0.11 0.07
SEQID-01544 P21801 -- -- 1 0.46 0.19 0.04 0.03 0.05 0.05 0.05 0.06
0.04 0.02 0.02 0.05 0.11 0.09 SEQID-01545 P30656 -- -- 1 0.45 0.20
0.06 0.06 0.04 0.06 0.02 0.05 0.06 0.05 0.03 0.06 0.08 0.06
SEQID-01546 Q04491 -- -- 1 0.51 0.23 0.05 0.04 0.04 0.06 0.01 0.03
0.09 0.04 0.05 0.05 0.08 0.08 SEQID-01547 P07143 -- -- 1 0.43 0.16
0.08 0.07 0.04 0.05 0.01 0.03 0.07 0.04 0.03 0.03 0.08 0.07
SEQID-01548 P24280 -- -- 1 0.44 0.18 0.04 0.06 0.03 0.06 0.01 0.04
0.10 0.03 0.02 0.05 0.09 0.09 SEQID-01549 P01120 -- -- 0 0.37 0.17
0.05 0.06 0.11 0.06 0.01 0.08 0.07 0.05 0.01 0.05 0.06 0.08
SEQID-01550 P14065 -- -- 1 0.51 0.24 0.04 0.04 0.06 0.06 0.01 0.05
0.07 0.03 0.04 0.07 0.10 0.10 SEQID-01551 P53598 -- -- 0 0.51 0.22
0.06 0.04 0.02 0.04 0.01 0.07 0.07 0.06 0.02 0.10 0.07 0.10
SEQID-01552 P47120 -- -- 1 0.43 0.22 0.03 0.06 0.05 0.07 0.01 0.04
0.12 0.02 0.03 0.04 0.11 0.07 SEQID-01553 Q12068 -- -- 1 0.51 0.22
0.05 0.04 0.05 0.08 0.01 0.03 0.08 0.03 0.03 0.06 0.09 0.11
SEQID-01554 P38115 -- -- 1 0.49 0.24 0.04 0.05 0.05 0.06 0.01 0.02
0.10 0.03 0.04 0.07 0.12 0.09 SEQID-01555 P53839 -- -- 1 0.49 0.24
0.04 0.07 0.05 0.05 0.01 0.04 0.11 0.04 0.04 0.06 0.10 0.08
SEQID-01556 P32366 -- -- 1 0.43 0.21 0.04 0.06 0.06 0.07 0.02 0.05
0.09 0.02 0.02 0.07 0.11 0.04 SEQID-01557 Q03102 -- -- 1 0.53 0.25
0.05 0.02 0.05 0.06 0.01 0.04 0.06 0.05 0.01 0.06 0.11 0.12
SEQID-01558 Q06151 -- -- 1 0.47 0.23 0.02 0.06 0.07 0.06 0.01 0.04
0.08 0.03 0.03 0.10 0.09 0.08 SEQID-01559 P32628 -- -- 0 0.37 0.17
0.03 0.05 0.04 0.06 0.01 0.08 0.14 0.04 0.01 0.04 0.08 0.05
SEQID-01560 P23644 -- -- 1 0.45 0.21 0.05 0.04 0.06 0.05 0.01 0.09
0.05 0.04 0.01 0.04 0.11 0.06 SEQID-01561 P32377 -- -- 1 0.48 0.19
0.06 0.06 0.04 0.06 0.01 0.05 0.08 0.02 0.02 0.05 0.09 0.07
SEQID-01562 P27476 -- -- 1 0.31 0.08 0.04 0.08 0.04 0.07 0.00 0.02
0.17 0.05 0.01 0.03 0.03 0.11 SEQID-01563 P36046 -- -- 1 0.32 0.10
0.04 0.05 0.08 0.09 0.02 0.06 0.17 0.03 0.02 0.02 0.04 0.11
SEQID-01564 P23542 -- -- 1 0.50 0.21 0.06 0.04 0.05 0.05 0.01 0.05
0.05 0.03 0.04 0.06 0.09 0.08 SEQID-01565 Q08412 -- -- 1 0.35 0.14
0.03 0.09 0.06 0.10 0.00 0.06 0.15 0.02 0.03 0.03 0.06 0.08
SEQID-01566 P53549 -- -- 0 0.44 0.21 0.04 0.10 0.03 0.07 0.00 0.05
0.12 0.04 0.02 0.08 0.09 0.08 SEQID-01567 P19262 -- -- 1 0.48 0.20
0.06 0.07 0.04 0.04 0.00 0.03 0.11 0.03 0.01 0.05 0.08 0.11
SEQID-01568 P02557 -- -- 1 0.43 0.18 0.04 0.06 0.06 0.07 0.01 0.06
0.09 0.04 0.03 0.05 0.07 0.04 SEQID-01569 P04076 -- -- 1 0.49 0.22
0.04 0.08 0.03 0.08 0.01 0.04 0.08 0.04 0.03 0.05 0.12 0.07
SEQID-01570 P07284 -- -- 1 0.45 0.19 0.03 0.05 0.05 0.05 0.02 0.05
0.12 0.03 0.02 0.06 0.09 0.12 SEQID-01571 P17649 -- -- 1 0.45 0.19
0.06 0.05 0.04 0.07 0.02 0.05 0.08 0.03 0.03 0.06 0.09 0.10
SEQID-01572 P08417 -- -- 1 0.49 0.22 0.06 0.04 0.07 0.03 0.02 0.06
0.08 0.04 0.04 0.06 0.10 0.08 SEQID-01573 P16130 -- -- 1 0.49 0.21
0.05 0.04 0.06 0.06 0.00 0.04 0.08 0.03 0.01 0.07 0.09 0.10
SEQID-01574 P14904 -- -- 1 0.49 0.22 0.04 0.05 0.06 0.06 0.01 0.03
0.09 0.04 0.03 0.06 0.10 0.09 SEQID-01575 P38625 -- -- 1 0.52 0.24
0.04 0.05 0.04 0.06 0.01 0.04 0.08 0.04 0.04 0.08 0.09 0.08
SEQID-01576 P30952 -- -- 1 0.49 0.22 0.04 0.06 0.07 0.06 0.01 0.04
0.07 0.03 0.03 0.07 0.10 0.07 SEQID-01577 P32891 -- -- 1 0.49 0.21
0.04 0.06 0.05 0.08 0.02 0.02 0.07 0.03 0.03 0.06 0.09 0.10
SEQID-01578 P38695 -- -- 1 0.50 0.21 0.03 0.06 0.04 0.03 0.02 0.03
0.06 0.05 0.00 0.07 0.08 0.05 SEQID-01579 P15624 -- -- 1 0.48 0.22
0.04 0.06 0.05 0.07 0.01 0.03 0.09 0.02 0.03 0.07 0.09 0.09
SEQID-01580 P32590 -- -- 1 0.47 0.20 0.05 0.07 0.05 0.03 0.01 0.03
0.09 0.02 0.02 0.06 0.08 0.10 SEQID-01581 P32775 -- -- 1 0.47 0.18
0.04 0.07 0.05 0.07 0.00 0.02 0.07 0.03 0.05 0.04 0.09 0.06
SEQID-01582 P53278 -- -- 1 0.40 0.15 0.04 0.05 0.07 0.06 0.00 0.09
0.15 0.01 0.02 0.04 0.07 0.12 SEQID-01583 P13188 -- -- 1 0.47 0.19
0.02 0.08 0.05 0.06 0.01 0.03 0.10 0.03 0.02 0.05 0.07 0.11
SEQID-01584 P07245 -- -- 1 0.48 0.24 0.06 0.06 0.05 0.06 0.01 0.04
0.07 0.04 0.03 0.08 0.09 0.07 SEQID-01585 P40825 -- -- 1 0.48 0.20
0.04 0.05 0.05 0.08 0.01 0.03 0.09 0.04 0.02 0.06 0.09 0.11
SEQID-01586 P20967 -- -- 1 0.47 0.19 0.04 0.07 0.04 0.05 0.01 0.05
0.08 0.03 0.04 0.05 0.10 0.08 SEQID-01587 P22855 -- -- 1 0.48 0.19
0.03 0.06 0.05 0.06 0.01 0.05 0.07 0.03 0.03 0.06 0.08 0.09
SEQID-01588 F0TEP7 -- -- 1 0.50 0.25 0.06 0.05 0.04 0.08 0.00 0.03
0.08 0.05 0.02 0.08 0.08 0.10 SEQID-01589 F0TIG2 -- -- 1 0.46 0.22
0.04 0.09 0.04 0.08 0.01 0.04 0.08 0.04 0.02 0.08 0.08 0.09
SEQID-01590 F0TIH2 -- -- 1 0.47 0.20 0.05 0.11 0.05 0.05 0.00 0.04
0.05 0.06 0.05 0.09 0.07 0.13 SEQID-01591 F0TE83 -- -- 1 0.50 0.21
0.07 0.04 0.06 0.07 0.01 0.03 0.06 0.04 0.03 0.06 0.07 0.08
SEQID-01592 F0TEJ0 -- -- 0 0.45 0.21 0.05 0.05 0.06 0.08 0.01 0.02
0.11 0.05 0.03 0.07 0.08 0.08 SEQID-01593 F0TDZ2 -- -- 0 0.49 0.23
0.05 0.06 0.02 0.08 0.00 0.04 0.10 0.05 0.04 0.07 0.08 0.07
SEQID-01594 F0TEQ7 -- -- 0 0.45 0.24 0.03 0.08 0.06 0.10 0.00 0.03
0.09 0.04 0.02 0.06 0.08 0.10 SEQID-01595 F0TFN9 -- -- 1 0.48 0.22
0.05 0.06 0.04 0.10 0.00 0.06 0.08 0.03 0.01 0.07 0.07 0.08
SEQID-01596 F0TGC0 -- -- 1 0.49 0.15 0.08 0.16 0.04 0.04 0.00 0.04
0.02 0.03 0.02 0.04 0.07 0.16 SEQID-01597 F0TIP0 -- -- 1 0.48 0.22
0.07 0.05 0.04 0.09 0.00 0.06 0.04 0.04 0.01 0.05 0.08 0.11
SEQID-01598 F0THG83 -- -- 1 0.48 0.21 0.03 0.09 0.03 0.07 0.01 0.03
0.11 0.03 0.04 0.07 0.10 0.09 SEQID-01599 F0THR9 -- -- 1 0.45 0.20
0.05 0.07 0.05 0.08 0.01 0.04 0.06 0.04 0.03 0.07 0.07 0.08
SEQID-01600 F0TID9 -- -- 1 0.50 0.24 0.06 0.04 0.03 0.09 0.00 0.04
0.08 0.05 0.04 0.08 0.07 0.09 SEQID-01601 F0TII4 -- -- 0 0.46 0.20
0.04 0.08 0.03 0.05 0.00 0.03 0.09 0.06 0.01 0.06 0.05 0.13
SEQID-01602 F0TEP6 -- -- 0 0.48 0.22 0.07 0.07 0.04 0.09 0.01 0.02
0.06 0.06 0.05 0.08 0.07 0.07 SEQID-01603 F0TFM5 -- -- 1 0.46 0.20
0.05 0.08 0.07 0.07 0.00 0.06 0.08 0.03 0.03 0.06 0.06 0.14
SEQID-01604 F0TI54 -- -- 1 0.50 0.19 0.09 0.02 0.08 0.06 0.00 0.02
0.03 0.04 0.01 0.02 0.06 0.12 SEQID-01605 F0TIG5 -- -- 0 0.44 0.19
0.04 0.14 0.05 0.03 0.00 0.03 0.09 0.05 0.04 0.04 0.07 0.12
SEQID-01606 F0TIG7 -- -- 1 0.47 0.20 0.06 0.07 0.03 0.08 0.00 0.03
0.10 0.04 0.02 0.07 0.06 0.08 SEQID-01607 F0TII6 -- -- 0 0.46 0.23
0.06 0.13 0.06 0.06 0.00 0.02 0.07 0.06 0.02 0.07 0.05 0.11
SEQID-01608 F0TIG9 -- -- 1 0.52 0.23 0.03 0.08 0.04 0.04 0.00 0.03
0.07 0.06 0.03 0.06 0.04 0.14 SEQID-01609 F0TIH5 -- -- 1 0.44 0.20
0.07 0.14 0.05 0.05 0.00 0.05 0.08 0.05 0.02 0.08 0.06 0.10
SEQID-01610 F0TDX9 -- -- 1 0.45 0.22 0.04 0.09 0.05 0.08 0.00 0.04
0.09 0.04 0.02 0.07 0.09 0.07 SEQID-01611 F0TE85 -- -- 1 0.44 0.20
0.06 0.04 0.05 0.07 0.02 0.03 0.12 0.04 0.02 0.07 0.07 0.10
SEQID-01612 F0TFK9 -- -- 0 0.50 0.25 0.05 0.03 0.06 0.04 0.01 0.01
0.10 0.05 0.01 0.09 0.09 0.10 SEQID-01613 F0TGI4 -- -- 1 0.46 0.20
0.07 0.05 0.05 0.08 0.01 0.03 0.11 0.05 0.02 0.07 0.08 0.10
SEQID-01614 F0TI74 -- -- 1 0.48 0.16 0.05 0.04 0.07 0.06 0.00 0.04
0.05 0.04 0.00 0.03 0.08 0.13 SEQID-01615 F0TI56 -- -- 1 0.56 0.25
0.07 0.02 0.04 0.06 0.00 0.04 0.04 0.05 0.03 0.03 0.09 0.03
SEQID-01616 F0TJ46 -- -- 1 0.43 0.17 0.05 0.03 0.11 0.04 0.00 0.05
0.03 0.04 0.01 0.06 0.04 0.09 SEQID-01617 F0TDQ0 -- -- 0 0.42 0.20
0.02 0.12 0.05 0.07 0.00 0.03 0.14 0.01 0.02 0.04 0.08 0.03
SEQID-01618 F0TDS8 -- -- 1 0.41 0.20 0.03 0.15 0.04 0.04 0.00 0.06
0.09 0.04 0.03 0.04 0.10 0.07 SEQID-01619 F0TE84 -- -- 1 0.52 0.24
0.06 0.03 0.05 0.09 0.00 0.01 0.07 0.05 0.03 0.08 0.09 0.12
SEQID-01620 F0TED5 -- -- 1 0.43 0.20 0.05 0.05 0.06 0.03 0.01 0.03
0.08 0.05 0.02 0.06 0.09 0.08 SEQID-01621 F0TEQ9 -- -- 0 0.49 0.20
0.10 0.06 0.04 0.04 0.00 0.04 0.12 0.04 0.01 0.06 0.06 0.16
SEQID-01622 F0TEU3 -- -- 1 0.44 0.21 0.05 0.07 0.05 0.06 0.01 0.08
0.07 0.03 0.02 0.08 0.08 0.08 SEQID-01623 F0TFQ7 -- -- 0 0.46 0.23
0.05 0.19 0.01 0.04 0.00 0.03 0.09 0.04 0.04 0.07 0.04 0.09
SEQID-01624 F0TFS5 -- -- 1 0.49 0.17 0.05 0.03 0.07 0.05 0.00 0.04
0.04 0.04 0.01 0.05 0.06 0.14 SEQID-01625 F0TGH0 -- -- 1 0.51 0.17
0.07 0.01 0.04 0.06 0.00 0.09 0.03 0.02 0.02 0.05 0.06 0.19
SEQID-01626 F0TH33 -- -- 1 0.52 0.23 0.08 0.03 0.05 0.06 0.00 0.01
0.06 0.06 0.03 0.10 0.08 0.09 SEQID-01627 F0THG4 -- -- 1 0.48 0.20
0.05 0.09 0.03 0.05 0.00 0.04 0.11 0.03 0.05 0.06 0.08 0.07
SEQID-01628 F0TIG8 -- -- 0 0.52 0.24 0.04 0.11 0.02 0.06 0.00 0.02
0.08 0.02 0.04 0.09 0.11 0.09 SEQID-01629 F0TIH8 -- -- 0 0.47 0.19
0.01 0.13 0.06 0.05 0.00 0.02 0.06
0.01 0.03 0.04 0.02 0.16 SEQID-01630 F0TIH9 -- -- 0 0.48 0.27 0.05
0.13 0.04 0.06 0.01 0.02 0.07 0.06 0.01 0.09 0.06 0.11 SEQID-01631
F0TII3 -- -- 1 0.46 0.26 0.05 0.09 0.06 0.06 0.00 0.02 0.07 0.04
0.01 0.12 0.06 0.11 SEQID-01632 F0TIJ3 -- -- 0 0.38 0.20 0.04 0.21
0.04 0.09 0.01 0.02 0.06 0.04 0.01 0.07 0.06 0.10 SEQID-01633
F0TIJ6 -- -- 0 0.48 0.21 0.07 0.16 0.02 0.06 0.00 0.02 0.08 0.02
0.02 0.05 0.09 0.12 SEQID-01634 F0TIR8 -- -- 1 0.50 0.23 0.08 0.05
0.03 0.08 0.01 0.04 0.06 0.04 0.05 0.10 0.07 0.09 SEQID-01635
F0TIS2 -- -- 1 0.44 0.22 0.08 0.05 0.06 0.09 0.01 0.03 0.06 0.05
0.02 0.06 0.09 0.07 SEQID-01636 F0TIU2 -- -- 1 0.45 0.24 0.08 0.06
0.05 0.09 0.00 0.05 0.09 0.05 0.01 0.08 0.08 0.09 SEQID-01637
F0TIX0 -- -- 0 0.40 0.18 0.07 0.00 0.08 0.19 0.01 0.04 0.11 0.03
0.01 0.03 0.08 0.13 SEQID-01638 P13538 -- -- 1 0.45 0.19 0.05 0.07
0.04 0.05 0.01 0.07 0.15 0.02 0.03 0.05 0.10 0.12 SEQID-01639
F1P3W7 -- -- 1 0.45 0.19 0.05 0.07 0.04 0.05 0.01 0.07 0.15 0.02
0.02 0.05 0.10 0.12 SEQID-01640 F1P3X4 -- -- 1 0.45 0.19 0.05 0.07
0.04 0.05 0.01 0.07 0.15 0.02 0.03 0.05 0.10 0.12 SEQID-01641
F1ND26 -- -- 1 0.45 0.19 0.06 0.07 0.04 0.05 0.01 0.07 0.15 0.02
0.02 0.05 0.10 0.12 SEQID-01642 F1NDL1 -- -- 1 0.47 0.17 0.05 0.06
0.04 0.08 0.01 0.05 0.07 0.02 0.04 0.05 0.07 0.13 SEQID-01643
F1NGF6 -- -- 1 0.47 0.20 0.04 0.07 0.03 0.05 0.01 0.04 0.11 0.03
0.03 0.06 0.06 0.09 SEQID-01644 P68139 -- -- 1 0.47 0.20 0.05 0.07
0.03 0.06 0.01 0.03 0.09 0.04 0.03 0.06 0.07 0.06 SEQID-01645
P00565 -- -- 1 0.50 0.19 0.02 0.08 0.04 0.07 0.01 0.04 0.09 0.04
0.05 0.04 0.09 0.09 SEQID-01646 P00548 -- -- 1 0.49 0.22 0.07 0.09
0.04 0.06 0.01 0.03 0.08 0.04 0.04 0.07 0.07 0.08 SEQID-01647
P16419 -- -- 1 0.45 0.20 0.04 0.09 0.03 0.06 0.01 0.03 0.11 0.03
0.02 0.04 0.07 0.09 SEQID-01648 Q5ZMQ2 -- -- 1 0.47 0.20 0.05 0.07
0.02 0.06 0.01 0.04 0.09 0.04 0.03 0.08 0.07 0.06 SEQID-01649
F1NU17 -- -- 1 0.54 0.24 0.06 0.03 0.04 0.07 0.02 0.02 0.07 0.05
0.03 0.05 0.09 0.13 SEQID-01650 P07322 -- -- 1 0.49 0.22 0.07 0.06
0.04 0.06 0.02 0.04 0.08 0.05 0.05 0.07 0.07 0.10 SEQID-01651
P20111 -- -- 1 0.44 0.19 0.05 0.09 0.05 0.06 0.01 0.07 0.12 0.02
0.03 0.07 0.09 0.07 SEQID-01652 P13585 -- -- 1 0.50 0.25 0.06 0.07
0.04 0.05 0.02 0.02 0.09 0.03 0.02 0.07 0.10 0.06 SEQID-01653 P00
56 -- -- 1 0.52 0.22 0.07 0.05 0.05 0.07 0.01 0.02 0.04 0.05 0.04
0.06 0.06 0.09 SEQID-01654 Q07734 -- -- 1 0.47 0.21 0.03 0.07 0.03
0.07 0.01 0.02 0.09 0.03 0.02 0.05 0.06 0.10 SEQID-01655 F1NN63 --
-- 1 0.47 0.20 0.06 0.08 0.05 0.07 0.01 0.03 0.05 0.05 0.03 0.08
0.07 0.08 SEQID-01656 F2Z4L6 -- -- 1 0.43 0.18 0.04 0.06 0.03 0.07
0.05 0.06 0.09 0.02 0.03 0.06 0.07 0.09 SEQID-01657 F1NX83 -- -- 1
0.46 0.20 0.04 0.08 0.05 0.05 0.03 0.04 0.07 0.03 0.05 0.06 0.09
0.06 SEQID-01658 P00940 -- -- 1 0.51 0.23 0.07 0.04 0.03 0.06 0.02
0.04 0.083 0.06 0.04 0.07 0.07 0.11 SEQID-01659 F1NXK1 -- -- 1 0.46
0.20 0.03 0.05 0.03 0.05 0.02 0.05 0.13 0.03 0.02 0.07 0.07 0.11
SEQID-01660 E1B5N7 -- -- 1 0.45 0.21 0.04 0.09 0.05 0.06 0.01 0.04
0.09 0.03 0.03 0.06 0.09 0.06 SEQID-01661 Q02173 -- -- 1 0.46 0.20
0.04 0.07 0.04 0.06 0.02 0.03 0.10 0.03 0.04 0.05 0.07 0.08
SEQID-01662 F1NW35 -- -- 1 0.57 0.27 0.04 0.04 0.03 0.07 0.01 0.02
0.06 0.04 0.07 0.07 0.10 0.11 SEQID-01663 E19T53 -- -- 1 0.47 0.20
0.04 0.06 0.03 0.05 0.02 0.05 0.12 0.03 0.02 0.05 0.08 0.11
SEQID-01664 P02609 -- -- 1 0.48 0.17 0.05 0.05 0.05 0.09 0.01 0.03
0.11 0.04 0.01 0.07 0.05 0.11 SEQID-01665 F1NIJ6 -- -- 1 0.55 0.21
0.05 0.05 0.05 0.05 0.01 0.03 0.07 0.04 0.06 0.06 0.10 0.09
SEQID-01666 P05031 -- -- 0 0.50 0.22 0.03 0.07 0.01 0.06 0.01 0.04
0.11 0.05 0.03 0.05 0.10 0.13 SEQID-01667 P68246 -- -- 1 0.45 0.17
0.05 0.11 0.03 0.07 0.01 0.05 0.14 0.02 0.03 0.02 0.11 0.16
SEQID-01668 P11009 -- -- 1 0.45 0.21 0.04 0.11 0.04 0.07 0.02 0.03
0.07 0.04 0.03 0.04 0.10 0.07 SEQID-01669 P08106 -- -- 1 0.46 0.20
0.05 0.07 0.05 0.08 0.01 0.05 0.09 0.04 0.01 0.07 0.07 0.10
SEQID-01670 P02457 -- -- 1 0.24 0.09 0.08 0.08 0.03 0.05 0.01 0.04
0.07 0.16 0.01 0.02 0.04 0.05 SEQID-01671 P02604 -- -- 0 0.46 0.17
0.09 0.03 0.05 0.06 0.00 0.04 0.13 0.03 0.01 0.05 0.07 0.12
SEQID-01672 Q52LN1 -- -- 1 0.45 0.20 0.06 0.10 0.04 0.06 0.01 0.04
0.09 0.03 0.03 0.06 0.09 0.07 SEQID-01673 Q05623 -- -- 1 0.42 0.16
0.07 0.06 0.03 0.05 0.01 0.04 0.10 0.02 0.03 0.05 0.05 0.10
SEQID-01674 E1C3E2 -- -- 1 0.45 0.19 0.05 0.06 0.04 0.06 0.01 0.03
0.10 0.03 0.03 0.05 0.06 0.09 SEQID-01675 P51913 -- -- 1 0.46 0.23
0.06 0.06 0.06 0.07 0.01 0.03 0.08 0.04 0.02 0.06 0.09 0.10
SEQID-01676 O73885 -- -- 1 0.46 0.21 0.05 0.06 0.06 0.07 0.01 0.05
0.09 0.04 0.02 0.07 0.08 0.10 SEQID-01677 P15989 -- -- 1 0.44 0.23
0.05 0.09 0.04 0.06 0.01 0.06 0.07 0.05 0.02 0.06 0.09 0.06
SEQID-01678 F1NCR0 -- -- 1 0.26 0.11 0.07 0.08 0.04 0.04 0.01 0.03
0.06 0.17 0.02 0.03 0.05 0.05 SEQID-01679 F1NKY4 -- -- 1 0.42 0.13
0.08 0.11 0.01 0.05 0.00 0.05 0.19 0.01 0.08 0.03 0.08 0.15
SEQID-01680 P53449 -- -- 1 0.37 0.18 0.10 0.08 0.06 0.02 0.01 0.04
0.08 0.05 0.02 0.02 0.09 0.04 SEQID-01681 QS2MJ6 -- -- 1 0.51 0.22
0.07 0.08 0.02 0.06 0.01 0.05 0.03 0.05 0.01 0.08 0.07 0.10
SEQID-01682 P19204 -- -- 1 0.47 0.20 0.03 0.03 0.02 0.18 0.01 0.02
0.13 0.02 0.02 0.05 0.10 0.08 SEQID-01683 F1N9H4 -- -- 1 0.50 0.21
0.05 0.06 0.04 0.05 0.01 0.03 0.08 0.05 0.03 0.08 0.06 0.12
SEQID-01684 E1BR47 -- -- 1 0.46 0.22 0.03 0.08 0.04 0.05 0.02 0.05
0.08 0.03 0.02 0.05 0.12 0.08 SEQID-01685 F1NY12 -- -- 0 0.49 0.22
0.05 0.05 0.03 0.06 0.01 0.03 0.07 0.05 0.02 0.06 0.10 0.11
SEQID-01686 P02542 -- -- 1 0.38 0.18 0.06 0.13 0.04 0.05 0.00 0.09
0.13 0.02 0.02 0.04 0.09 0.05 SEQID-01687 F1NCJ4 -- -- 1 0.48 0.22
0.04 0.06 0.04 0.06 0.02 0.05 0.10 0.03 0.03 0.06 0.11 0.07
SEQID-01688 E1BVT3 -- -- 0 0.49 0.25 0.07 0.06 0.05 0.04 0.02 0.03
0.07 0.05 0.02 0.07 0.10 0.09 SEQID-01689 E16XW3 -- -- 1 0.46 0.23
0.06 0.10 0.04 0.05 0.02 0.04 0.07 0.05 0.03 0.06 0.10 0.05
SEQID-01690 P79757 -- -- 1 0.43 0.17 0.04 0.09 0.03 0.04 0.01 0.04
0.11 0.02 0.03 0.06 0.06 0.09 SEQID-01691 P04268 -- -- 0 0.40 0.18
0.08 0.07 0.02 0.08 0.00 0.05 0.23 0.01 0.01 0.04 0.11 0.15
SEQID-01692 P00508 -- -- 1 0.45 0.20 0.06 0.09 0.04 0.05 0.01 0.04
0.06 0.04 0.03 0.06 0.09 0.08 SEQID-01693 P09203 -- -- 1 0.43 0.17
0.04 0.07 0.05 0.06 0.02 0.06 0.09 0.04 0.03 0.04 0.07 0.04
SEQID-01694 F1NGA2 -- -- 0 0.45 0.25 0.07 0.10 0.03 0.05 0.00 0.06
0.07 0.05 0.01 0.07 0.10 0.06 SEQID-01695 P15988 -- -- 1 0.38 0.17
0.04 0.09 0.03 0.07 0.02 0.05 0.08 0.08 0.01 0.06 0.07 0.07
SEQID-01696 F1NXK2 -- -- 0 0.49 0.23 0.04 0.11 0.02 0.08 0.00 0.00
0.09 0.04 0.00 0.08 0.08 0.07 SEQID-01697 F1P0E4 -- -- 1 0.50 0.18
0.05 0.03 0.06 0.06 0.01 0.02 0.05 0.06 0.01 0.04 0.09 0.11
SEQID-01698 E1BU93 -- -- 1 0.46 0.15 0.03 0.06 0.04 0.04 0.00 0.03
0.08 0.06 0.05 0.04 0.08 0.10 SEQID-01699 P07341 -- -- 1 0.44 0.20
0.08 0.06 0.04 0.04 0.02 0.07 0.07 0.04 0.02 0.05 0.10 0.08
SEQID-01700 P17785 -- -- 1 0.45 0.21 0.05 0.083 0.04 0.08 0.01 0.04
0.09 0.03 0.01 0.07 0.10 0.11 SEQID-01701 E1BR89 -- -- 1 0.48 0.19
0.06 0.08 0.02 0.02 0.02 0.04 0.06 0.04 0.01 0.05 0.09 0.07
SEQID-01702 F1NXR6 -- -- 1 0.44 0.20 0.05 0.07 0.04 0.06 0.02 0.04
0.09 0.04 0.04 0.06 0.07 0.05 SEQID-01703 F1P0N2 -- -- 1 0.46 0.18
0.04 0.08 0.04 0.05 0.01 0.05 0.08 0.02 0.04 0.05 0.09 0.07
SEQID-01704 F1NPH8 -- -- 1 0.37 0.19 0.06 0.10 0.03 0.05 0.03 0.10
0.13 0.02 0.03 0.03 0.13 0.07 SEQID-01705 P04713 -- -- 1 0.44 0.21
0.07 0.09 0.04 0.05 0.02 0.03 0.07 0.05 0.02 0.04 0.08 0.06
SEQID-01706 K7UZT6 -- -- 1 0.45 0.22 0.06 0.08 0.04 0.05 0.01 0.05
0.09 0.05 0.02 0.04 0.10 0.06 SEQID-01707 B4F832 -- -- 1 0.44 0.21
0.08 0.10 0.02 0.04 0.02 0.04 0.07 0.05 0.01 0.05 0.08 0.08
SEQID-01708 P11155 -- -- 1 0.45 0.21 0.07 0.8 0.04 0.05 0.02 0.05
0.09 0.05 0.02 0.04 0.09 0.06 SEQID-01709 Q43247 -- -- 1 0.52 0.23
0.06 0.05 0.04 0.07 0.01 0.02 0.07 0.05 0.02 0.06 0.06 0.10
SEQID-01710 P04712 -- -- 1 0.43 0.22 0.04 0.07 0.04 0.06 0.01 0.04
0.08 0.03 0.03 0.06 0.11 0.07 SEQID-01711 6TEC1 -- -- 1 0.46 0.23
0.08 0.10 0.02 0.07 0.03 0.01 0.08 0.06 0.04 0.03 0.08 0.05
SEQID-01712 Q0QWI2 -- -- 1 0.46 0.23 0.07 0.10 0.02 0.06 0.03 0.01
0.08 0.06 0.04 0.03 0.08 0.05 SEQID-01713 B4F8M9 -- -- 1 0.54 0.18
0.04 0.10 0.02 0.04 0.01 0.04 0.07 0.04 0.05 0.05 0.06 0.15
SEQID-01714 Q5K3Q7 -- -- 1 0.53 0.28 0.09 0.03 0.03 0.04 0.01 0.02
0.05 0.06 0.01 0.09 0.10 0.05 SEQID-01715 B4FJZ7 -- -- 1 0.46 0.14
0.07 0.18 0.02 0.02 0.00 0.03 0.07 0.02 0.03 0.04 0.06 0.18
SEQID-01716 6T1F1 -- -- 1 0.47 0.14 0.06 0.18 0.02 0.03 0.00 0.03
0.06 0.02 0.04 0.04 0.07 0.18 SEQID-01717 K7URL6 -- -- 1 0.53 0.28
0.09 0.03 0.03 0.04 0.01 0.02 0.05 0.06 0.01 0.09 0.10 0.05
SEQID-01718 B4FUW2 -- -- 1 0.42 0.17 0.03 0.22 0.04 0.02 0.01 0.05
0.04 0.04 0.04 0.03 0.07 0.10 SEQID-01719 B6UEE8 -- -- 1 0.47 0.26
0.11 0.06 0.03 0.05 0.01 0.01 0.05 0.06 0.02 0.06 0.11 0.03
SEQID-01720 B4FUK7 -- -- 1 0.47 0.15 0.05 0.07 0.06 0.07 0.02 0.03
0.06 0.05 0.07 0.02 0.06 0.07 SEQID-01721 4FY16 -- -- 1 0.53 0.21
0.05 0.06 0.03 0.06 0.01 0.03 0.07 0.04 0.03 0.07 0.06 0.13
SEQID-01722 Q946V2 -- -- 1 0.41 0.20 0.06 0.08 0.04 0.05 0.01 0.08
0.06 0.05 0.05 0.04 0.09 0.03 SEQID-01723 B6T1H0 -- -- 0 0.44 0.17
0.04 0.17 0.04 0.06 0.01 0.05 0.05 0.04 0.00 0.04 0.08 0.15
SEQID-01724 4F989 -- -- 1 0.46 0.21 0.05 0.07 0.02 0.06 0.01 0.03
0.09 0.04 0.03 0.08 0.07 0.06 SEQID-01725 B4G1E1 -- -- 1 0.46 0.20
0.05 0.07 0.03 0.06 0.02 0.03 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-01726 B6TQ68 -- -- 1 0.46 0.14 0.06 0.19 0.03 0.02 0.00 0.02
0.07 0.02 0.04 0.04 0.06 0.18 SEQID-01727 B6SP93 -- -- 0 0.48 0.11
0.19 0.04 0.01 0.00 0.00 0.02 0.06 0.02 0.01 0.01 0.03 0.30
SEQID-01728 P 84 40 -- -- 1 0.45 0.22 0.07 0.06 0.04 0.05 0.02 0.03
0.09 0.04 0.02 0.05 0.11 0.10 SEQID-01729 B6TQ06 -- -- 1 0.47 0.21
0.05 0.07 0.02 0.06 0.01 0.03 0.08 0.04 0.03 0.08 0.07 0.06
SEQID-01730 B4FUH2 -- -- 1 0.44 0.21 0.07 0.09 0.04 0.04 0.01 0.05
0.06 0.04 0.03 0.05 0.10 0.04 SEQID-01731 P21569 -- -- 1 0.49 0.17
0.05 0.06 0.05 0.04 0.02 0.03 0.07 0.07 0.02 0.03 0.04 0.09
SEQID-01732 P27923 -- -- 0 0.54 0.19 0.04 0.07 0.03 0.06 0.02 0.06
0.05 0.04 0.04 0.05 0.08 0.18 SEQID-01733 C0P455 -- -- 1 0.46 0.20
0.07 0.13 0.05 0.04 0.00 0.03 0.05 0.04 0.02 0.04 0.08 0.11
SEQID-01734 C0PHE3 -- -- 1 0.47 0.23 0.03 0.10 0.03 0.08 0.01 0.07
0.07 0.04 0.02 0.06 0.10 0.05 SEQID-01735 B6SP74 -- -- 1 0.27 0.10
0.04 0.13 0.07 0.05 0.01 0.02 0.08 0.21 0.02 0.03 0.04 0.02
SEQID-01736 K7T5X3 -- -- 1 0.33 0.08 0.07 0.07 0.02 0.11 0.00 0.03
0.14 0.05 0.01 0.02 0.02 0.16 SEQID-01737 K7V1U2 -- -- 1 0.44 0.18
0.06 0.06 0.03 0.09 0.01 0.04 0.14 0.03 0.01 0.05 0.06 0.15
SEQID-01738 B6T879 -- -- 0 0.50 0.16 0.09 0.05 0.02 0.02 0.00 0.02
0.09 0.03 0.02 0.06 0.05 0.22 SEQID-01738 Q946V3 -- -- 0 0.27 0.13
0.06 0.15 0.00 0.03 0.06 0.11 0.07 0.09 0.00 0.02 0.07 0.02
SEQID-01740 P12863 -- -- 1 0.49 0.24 0.08 0.04 0.04 0.04 0.02 0.05
0.09 0.05 0.02 0.05 0.07 0.08 SEQID-01741 B6TC95 -- -- 0 0.47 0.08
0.19 0.04 0.02 0.01 0.00 0.01 0.05 0.01 0.01 0.01 0.04 0.31
SEQID-01742 P49106 -- -- 1 0.41 0.20 0.06 0.08 0.03 0.06 0.01 0.03
0.15 0.02 0.01 0.06 0.10 0.08 SEQID-01743 B6U607 -- -- 1 0.04 0.23
0.09 0.09 0.05 0.04 0.01 0.04 0.09 0.05 0.02 0.02 0.12 0.06
SEQID-01744 C0P381 -- -- 0 0.30 0.11 0.02 0.02 0.03 0.01 0.05 0.37
0.05 0.02 0.11 0.03 0.05 0.02 SEQID-01745 B4G0K5 -- -- 1 0.45 0.15
0.04 0.07 0.06 0.07 0.02 0.04 0.06 0.06 0.06 0.03 0.05 0.06
SEQID-01746 K7TNK3 -- -- 1 0.43 0.20 0.05 0.04 0.03 0.05 0.01 0.09
0.20 0.01 0.03 0.03 0.13 0.11 SEQID-01747 B6SGI4 -- -- 1 0.42 0.07
0.06 0.22 0.04 0.00 0.04 0.01 0.02 0.05 0.04 0.03 0.02 0.12
SEQID-01748 P04706 -- -- 0 0.37 0.21 0.05 0.04 0.00 0.00 0.07 0.16
0.01 0.03 0.09 0.02 0.12 0.00 SEQID-01749 B6T5F2 -- -- 1 0.49 0.16
0.06 0.12 0.04 0.02 0.00 0.06 0.06 0.03 0.03 0.04 0.06 0.17
SEQID-01750 B6T440 -- -- 1 0.49 0.22 0.06 0.06 0.03 0.06 0.02 0.03
0.09 0.04 0.03 0.06 0.09 0.09 SEQID-01751 B6TN50 -- -- 1 0.47 0.19
0.06 0.06 0.05 0.07 0.01 0.03 0.09 0.03 0.02 0.05 0.09 0.14
SEQID-01752 K7UDH4 -- -- 1 0.49 0.20 0.03 0.08 0.05 0.05 0.01 0.05
0.07 0.02 0.04 0.06 0.10 0.07 SEQID-01753 P62787 -- -- 0 0.47 0.22
0.04 0.21 0.02 0.03 0.00 0.02 0.05 0.09 0.02 0.07 0.08 0.11
SEQID-01754 B6SIA2 -- -- 0 0.33 0.13 0.08 0.22 0.03 0.04 0.05 0.03
0.04 0.04 0.05 0.04 0.01 0.09
SEQID-01755 P01088 -- -- 1 0.38 0.22 0.09 0.11 0.01 0.03 0.06 0.02
0.06 0.05 0.02 0.06 0.12 0.02 SEQID-01756 4FK49 -- -- 1 0.50 0.22
0.05 0.06 0.03 0.05 0.00 0.03 0.09 0.05 0.02 0.10 0.05 0.09
SEQID-01757 B4G1P4 -- -- 1 0.48 0.19 0.05 0.06 0.05 0.07 0.02 0.05
0.07 0.03 0.04 0.05 0.08 0.09 SEQID-01758 B4F093 -- -- 0 0.50 0.09
0.17 0.03 0.02 0.03 0.00 0.00 0.03 0.01 0.01 0.01 0.04 0.31
SEQID-01759 O22424 -- -- 1 0.51 0.22 0.04 0.11 0.05 0.06 0.01 0.03
0.04 0.04 0.04 0.08 0.08 0.12 SEQID-01760 B8QXG4 -- -- 1 0.50 0.18
0.08 0.06 0.04 0.07 0.01 0.05 0.08 0.03 0.02 0.04 0.07 0.10
SEQID-01761 B6TFX9 -- -- 1 0.45 0.23 0.08 0.07 0.02 0.05 0.01 0.03
0.05 0.05 0.02 0.04 0.10 0.05 SEQID-01762 B6TDF8 -- -- 1 0.46 0.21
0.08 0.06 0.04 0.06 0.01 0.01 0.05 0.04 0.02 0.06 0.06 0.08
SEQID-01763 K7VLV6 -- -- 1 0.49 0.21 0.06 0.06 0.03 0.06 0.01 0.03
0.12 0.03 0.02 0.04 0.12 0.16 SEQID-01764 B65J49 -- -- 0 0.41 0.18
0.05 0.21 0.03 0.00 0.09 0.03 0.06 0.04 0.05 0.00 0.11 0.01
SEQID-01765 P69246 -- -- 0 0.45 0.18 0.09 0.17 0.01 0.03 0.01 0.07
0.06 0.03 0.02 0.05 0.09 0.12 SEQID-01766 P80639 -- -- 0 0.49 0.20
0.04 0.04 0.04 0.09 0.02 0.04 0.09 0.04 0.05 0.06 0.06 0.11
SEQID-01767 C0HHC4 -- -- 1 0.50 0.21 0.04 0.07 0.03 0.05 0.00 0.04
0.08 0.05 0.02 0.09 0.05 0.08 SEQID-01768 B4FFR7 -- -- 1 0.49 0.14
0.07 0.14 0.01 0.03 0.01 0.05 0.07 0.04 0.02 0.05 0.05 0.22
SEQID-01769 B4G031 -- -- 1 0.44 0.19 0.07 0.06 0.03 0.08 0.01 0.04
0.08 0.05 0.04 0.03 0.12 0.08 SEQID-01770 B4F9R4 -- -- 1 0.43 0.17
0.07 0.15 0.04 0.03 0.01 0.03 0.03 0.07 0.07 0.04 0.04 0.08
SEQID-01771 Q08062 -- -- 1 0.47 0.24 0.07 0.05 0.04 0.05 0.02 0.04
0.08 0.04 0.02 0.05 0.08 0.07 SEQID-01772 B6T7G7 -- -- 1 0.50 0.20
0.05 0.04 0.04 0.06 0.01 0.02 0.10 0.03 0.02 0.03 0.09 0.11
SEQID-01773 P26301 -- -- 1 0.46 0.22 0.06 0.04 0.06 0.06 0.01 0.04
0.09 0.05 0.01 0.07 0.08 0.10 SEQID-01774 B6TBZ8 -- -- 1 0.43 0.23
0.06 0.06 0.04 0.05 0.02 0.06 0.03 0.04 0.02 0.07 0.10 0.07
SEQID-01775 B6U051 -- -- 1 0.48 0.21 0.05 0.07 0.03 0.06 0.02 0.05
0.09 0.04 0.02 0.05 0.08 0.08 SEQID-01776 B6SGX0 -- -- 0 0.56 0.18
0.05 0.16 0.01 0.02 0.00 0.01 0.06 0.05 0.04 0.03 0.09 0.21
SEQID-01777 Q4W1F6 -- -- 1 0.56 0.21 0.13 0.01 0.01 0.04 0.02 0.03
0.10 0.02 0.05 0.04 0.05 0.12 SEQID-01778 B6SNY0 -- -- 1 0.40 0.24
0.10 0.13 0.02 0.04 0.01 0.06 0.03 0.05 0.04 0.02 0.12 0.02
SEQID-01779 Q41764 -- -- 1 0.44 0.18 0.05 0.08 0.04 0.10 0.01 0.05
0.06 0.02 0.01 0.06 0.06 0.10 SEQID-01780 B6T4H7 -- -- 1 0.56 0.18
0.06 0.10 0.03 0.03 0.01 0.02 0.02 0.06 0.08 0.05 0.06 0.17
SEQID-01781 P25460 -- -- 1 0.52 0.17 0.05 0.11 0.03 0.01 0.02 0.03
0.04 0.05 0.04 0.08 0.03 0.16 SEQID-01782 B4FUS2 -- -- 1 0.51 0.20
0.02 0.16 0.05 0.07 0.01 0.04 0.04 0.04 0.03 0.04 0.09 0.12
SEQID-01783 P06673 -- -- 0 0.33 0.16 0.10 0.04 0.02 0.01 0.04 0.17
0.02 0.04 0.00 0.01 0.11 0.01 SEQID-01784 B4F9R6 -- -- 1 0.50 0.16
0.03 0.12 0.06 0.02 0.01 0.04 0.05 0.02 0.04 0.05 0.06 0.11
SEQID-01785 B T7B2 -- -- 1 0.43 0.20 0.05 0.17 0.05 0.04 0.00 0.03
0.09 0.04 0.04 0.04 0.11 0.09 SEQID-01786 4FB55 -- -- 1 0.44 0.20
0.07 0.09 0.05 0.08 0.01 0.04 0.06 0.03 0.01 0.09 0.07 0.09
SEQID-01787 P45633 -- -- 1 0.42 0.17 0.07 0.16 0.04 0.05 0.03 0.03
0.05 0.04 0.03 0.04 0.06 0.11 SEQID-01788 K7UJH1 -- -- 1 0.45 0.19
0.07 0.08 0.04 0.05 0.01 0.04 0.05 0.06 0.02 0.06 0.06 0.07
SEQID-01789 B6SI09 -- -- 1 0.45 0.24 0.16 0.11 0.03 0.02 0.02 0.01
0.05 0.07 0.05 0.02 0.13 0.01 SEQID-01790 B4FAV3 -- -- 1 0.51 0.21
0.04 0.10 0.03 0.06 0.01 0.05 0.07 0.03 0.01 0.06 0.07 0.14
SEQID-01791 P00333 -- -- 1 0.50 0.21 0.06 0.05 0.05 0.04 0.03 0.02
0.09 0.05 0.04 0.06 0.06 0.08 SEQID-01792 P05494 -- -- 0 0.42 0.25
0.07 0.09 0.04 0.05 0.01 0.06 0.08 0.04 0.01 0.07 0.11 0.06
SEQID-01793 P19023 -- -- 0 0.44 0.24 0.07 0.09 0.03 0.06 0.00 0.05
0.07 0.05 0.02 0.07 0.09 0.05 SEQID-01794 A4GUI1 -- -- 1 0.45 0.17
0.04 0.09 0.04 0.07 0.01 0.03 0.06 0.05 0.05 0.04 0.07 0.04
SEQID-01795 B4FGQ6 -- -- 0 0.47 0.19 0.03 0.17 0.02 0.01 0.01 0.06
0.04 0.03 0.02 0.04 0.07 0.18 SEQID-01796 B T2K5 -- -- 0 0.54 0.22
0.05 0.15 0.01 0.02 0.00 0.04 0.06 0.01 0.02 0.05 0.13 0.21
SEQID-01797 B4FJ41 -- -- 1 0.49 0.22 0.13 0.05 0.00 0.05 0.00 0.08
0.01 0.08 0.05 0.04 0.11 0.06 SEQID-01798 Q08275 -- -- 0 0.44 0.20
0.08 0.15 0.01 0.09 0.01 0.01 0.09 0.04 0.02 0.03 0.07 0.08
SEQID-01799 B 6SK03 -- -- 1 0.46 0.17 0.02 0.09 0.05 0.06 0.01 0.04
0.08 0.05 0.03 0.05 0.07 0.06 SEQID-01800 B6TR92 -- -- 1 0.49 0.20
0.05 0.03 0.05 0.07 0.02 0.04 0.06 0.04 0.01 0.06 0.08 0.12
SEQID-01801 B6SP06 -- -- 1 0.22 0.07 0.02 0.13 0.03 0.10 0.03 0.02
0.04 0.22 0.02 0.02 0.03 0.04 SEQID-01802 B6SJ08 -- -- 0 0.48 0.20
0.05 0.18 0.04 0.04 0.01 0.02 0.04 0.04 0.02 0.04 0.09 0.11
SEQID-01803 B6UHQ3 -- -- 1 0.39 0.19 0.17 0.08 0.01 0.06 0.02 0.07
0.04 0.04 0.05 0.01 0.13 0.02 SEQID-01804 B4F8D6 -- -- 1 0.38 0.17
0.07 0.07 0.04 0.08 0.04 0.05 0.04 0.05 0.02 0.02 0.10 0.04
SEQID-01805 B4FHH2 -- -- 1 0.48 0.24 0.05 0.12 0.03 0.04 0.01 0.03
0.09 0.04 0.02 0.06 0.10 0.08 SEQID-01806 C0PM74 -- -- 1 0.47 0.22
0.06 0.07 0.02 0.08 0.02 0.04 0.06 0.03 0.03 0.06 0.10 0.11
SEQID-01807 B4F7Y1 -- -- 1 0.54 0.22 0.06 0.10 0.04 0.03 0.01 0.04
0.07 0.03 0.02 0.05 0.10 0.18 SEQID-01808 Q84RL7 -- -- 1 0.49 0.26
0.10 0.05 0.02 0.05 0.01 0.02 0.02 0.07 0.03 0.08 0.09 0.04
SEQID-01809 C0PCQ6 -- -- 1 0.49 0.20 0.04 0.13 0.01 0.03 0.02 0.04
0.08 0.07 0.02 0.05 0.06 0.10 SEQID-01810 B4FBF6 -- -- 1 0.47 0.20
0.09 0.06 0.03 0.03 0.02 0.08 0.03 0.05 0.01 0.05 0.08 0.08
SEQID-01811 B6THG9 -- -- 0 0.42 0.16 0.06 0.11 0.04 0.08 0.00 0.03
0.08 0.04 0.03 0.05 0.08 0.11 SEQID-01812 O24573 -- -- 0 0.48 0.25
0.06 0.04 0.03 0.07 0.01 0.02 0.10 0.04 0.01 0.06 0.10 0.11
SEQID-01813 B4FRC6 -- -- 1 0.45 0.23 0.10 0.03 0.04 0.05 0.02 0.05
0.01 0.06 0.01 0.02 0.12 0.04 SEQID-01814 P04709 -- -- 1 0.46 0.19
0.06 0.08 0.05 0.05 0.01 0.04 0.03 0.06 0.01 0.06 0.09 0.08
SEQID-01815 Q41745 -- -- 1 0.57 0.26 0.06 0.09 0.01 0.04 0.01 0.03
0.05 0.03 0.02 0.06 0.12 0.07 SEQID-01816 B4FTU3 -- -- 1 0.53 0.29
0.08 0.06 0.04 0.01 0.02 0.04 0.03 0.04 0.02 0.06 0.14 0.06
SEQID-01817 C0PMH6 -- -- 1 0.53 0.25 0.07 0.05 0.03 0.02 0.01 0.03
0.04 0.03 0.02 0.07 0.10 0.06 SEQID-01818 4F987 -- -- 1 0.43 0.19
0.07 0.10 0.01 0.07 0.01 0.02 0.06 0.07 0.03 0.04 0.07 0.03
SEQID-01819 4FUE0 -- -- 1 0.51 0.21 0.05 0.06 0.03 0.07 0.02 0.03
0.10 0.03 0.03 0.08 0.07 0.12 SEQID-01820 B4FQ44 -- -- 1 0.44 0.19
0.06 0.09 0.05 0.06 0.02 0.02 0.05 0.05 0.02 0.06 0.07 0.05
SEQID-01821 B4FAD9 -- -- 1 0.51 0.27 0.03 0.04 0.07 0.06 0.01 0.03
0.09 0.03 0.01 0.08 0.11 0.10 SEQID-01822 A1R6 -- -- 1 0.53 0.29
0.05 0.06 0.04 0.02 0.01 0.04 0.05 0.05 0.02 0.09 0.13 0.04
SEQID-01823 D3YKV1 -- -- 1 0.44 0.22 0.07 0.06 0.05 0.07 0.01 0.03
0.07 0.04 0.02 0.09 0.08 0.07 SEQID-01824 C0PHH5 -- -- 1 0.48 0.25
0.08 0.07 0.04 0.05 0.01 0.02 0.07 0.05 0.05 0.08 0.09 0.07
SEQID-01825 B6UDM4 -- -- 1 0.54 0.23 0.06 0.09 0.01 0.04 0.01 0.03
0.03 0.05 0.03 0.03 0.15 0.09 SEQID-01826 6SPL7 -- -- 0 0.53 0.21
0.07 0.02 0.01 0.04 0.02 0.04 0.10 0.05 0.00 0.01 0.04 0.12
SEQID-01827 4FC92 -- -- 0 0.46 0.17 0.06 0.05 0.03 0.04 0.02 0.09
0.06 0.05 0.04 0.03 0.08 0.04 SEQID-01828 B4FIA6 -- -- 0 0.42 0.23
0.13 0.11 0.04 0.03 0.00 0.02 0.07 0.07 0.02 0.05 0.11 0.10
SEQID-01829 B4FEE7 -- -- 0 0.33 0.13 0.08 0.22 0.05 0.04 0.05 0.03
0.03 0.04 0.06 0.04 0.02 0.08 SEQID-01830 B6SHT0 -- -- 1 0.46 0.22
0.09 0.09 0.04 0.07 0.01 0.02 0.07 0.04 0.01 0.04 0.08 0.08
SEQID-01831 P19950 -- -- 0 0.44 0.18 0.06 0.17 0.02 0.05 0.01 0.02
0.07 0.06 0.03 0.05 0.07 0.08 SEQID-01832 B4FD90 -- -- 1 0.41 0.20
0.06 0.13 0.03 0.06 0.01 0.06 0.05 0.05 0.03 0.08 0.06 0.08
SEQID-01833 B4FH4 -- -- 1 0.43 0.21 0.11 0.09 0.04 0.07 0.04 0.01
0.06 0.03 0.06 0.03 0.06 0.05 SEQID-01834 B6SNQ7 -- -- 0 0.43 0.20
0.06 0.18 0.01 0.04 0.01 0.05 0.05 0.04 0.00 0.06 0.07 0.11
SEQID-01835 B4G250 -- -- 1 0.46 0.16 0.04 0.10 0.04 0.05 0.00 0.03
0.13 0.03 0.02 0.04 0.06 0.09 SEQID-01836 B6UD91 -- -- 1 0.38 0.20
0.16 0.08 0.02 0.09 0.03 0.02 0.07 0.05 0.01 0.04 0.11 0.05
SEQID-01837 B6UI23 -- -- 1 0.34 0.17 0.18 0.12 0.01 0.09 0.03 0.03
0.05 0.03 0.02 0.03 0.08 0.04 SEQID-01838 B6T1F2 -- -- 1 0.50 0.22
0.03 0.13 0.03 0.04 0.01 0.03 0.04 0.05 0.05 0.06 0.07 0.11
SEQID-01839 P49076 -- -- 1 0.52 0.24 0.04 0.08 0.06 0.07 0.00 0.04
0.07 0.03 0.02 0.06 0.12 0.07 SEQID-01840 P12653 -- -- 1 0.48 0.23
0.08 0.05 0.04 0.04 0.02 0.03 0.09 0.02 0.02 0.03 0.13 0.08
SEQID-01841 B4F9G6 -- -- 1 0.52 0.20 0.06 0.09 0.01 0.06 0.00 0.02
0.05 0.03 0.02 0.05 0.08 0.16 SEQID-01842 B4FAM6 -- -- 1 0.51 0.23
0.05 0.13 0.01 0.02 0.02 0.03 0.09 0.03 0.04 0.06 0.11 0.15
SEQID-01843 4FE06 -- -- 1 0.45 0.21 0.06 0.10 0.03 0.08 0.01 0.02
0.08 0.03 0.02 0.05 0.07 0.07 SEQID-01844 6TB84 -- -- 1 0.42 0.21
0.06 0.08 0.03 0.08 0.01 0.05 0.09 0.02 0.03 0.06 0.08 0.08
SEQID-01845 A2SZW8 -- -- 1 0.47 0.18 0.07 0.07 0.02 0.08 0.01 0.04
0.06 0.04 0.03 0.04 0.07 0.09 SEQID-01846 P41980 -- -- 1 0.47 0.21
0.09 0.04 0.06 0.05 0.00 0.04 0.07 0.05 0.04 0.04 0.11 0.08
SEQID-01847 C4J9Y2 -- -- 1 0.46 0.23 0.08 0.05 0.03 0.05 0.02 0.04
0.07 0.05 0.03 0.02 0.13 0.06 SEQID-01848 D4F848 -- -- 0 0.49 0.27
0.07 0.06 0.01 0.06 0.00 0.02 0.08 0.05 0.01 0.06 0.10 0.10
SEQID-01849 6TKC5 -- -- 1 0.47 0.21 0.08 0.07 0.02 0.04 0.00 0.03
0.08 0.04 0.04 0.07 0.09 0.03 SEQID-01850 P29023 -- -- 1 0.34 0.13
0.08 0.08 0.06 0.03 0.06 0.07 0.03 0.09 0.02 0.02 0.05 0.04
SEQID-01851 B4F8K1 -- -- 1 0.47 0.22 0.04 0.12 0.07 0.01 0.00 0.04
0.11 0.03 0.02 0.07 0.10 0.13 SEQID-01852 4FXR6 -- -- 1 0.26 0.08
0.05 0.11 0.02 0.06 0.05 0.02 0.05 0.19 0.04 0.02 0.02 0.03
SEQID-01853 Q41814 -- -- 0 0.40 0.03 0.03 0.00 0.00 0.01 0.00 0.00
0.02 0.02 0.02 0.00 0.02 0.15 SEQID-01854 D4F9T3 -- -- 1 0.41 0.22
0.09 0.09 0.02 0.06 0.02 0.03 0.09 0.05 0.02 0.07 0.07 0.06
SEQID-01855 Q6XZ78 -- -- 1 0.48 0.22 0.09 0.06 0.05 0.08 0.02 0.01
0.06 0.05 0.02 0.04 0.11 0.08 SEQID-01856 4FRJ1 -- -- 0 0.48 0.25
0.07 0.05 0.05 0.05 0.01 0.03 0.07 0.05 0.01 0.05 0.11 0.09
SEQID-01857 P93629 -- -- 1 0.51 0.23 0.05 0.03 0.04 0.06 0.04 0.04
0.06 0.06 0.03 0.06 0.06 0.08 SEQID-01858 B4FRI -- -- 1 0.43 0.19
0.11 0.07 0.03 0.06 0.02 0.03 0.05 0.04 0.03 0.04 0.08 0.07
SEQID-01859 B6TGG7 -- -- 1 0.44 0.21 0.07 0.08 0.05 0.06 0.02 0.02
0.05 0.06 0.03 0.08 0.06 0.06 SEQID-01860 P30792 -- -- 1 0.46 0.23
0.06 0.06 0.05 0.09 0.01 0.04 0.06 0.05 0.03 0.05 0.09 0.07
SEQID-01861 6TZ53 -- -- 1 0.51 0.25 0.08 0.07 0.02 0.02 0.01 0.03
0.04 0.06 0.03 0.08 0.11 0.04 SEQID-01862 B6SH97 -- -- 1 0.44 0.22
0.08 0.10 0.03 0.06 0.01 0.03 0.07 0.04 0.04 0.07 0.08 0.06
SEQID-01863 B7ZZ42 -- -- 1 0.45 0.21 0.06 0.07 0.05 0.08 0.01 0.04
0.10 0.04 0.01 0.07 0.07 0.09 SEQID-01864 K7UD35 -- -- 1 0.47 0.21
0.06 0.11 0.03 0.06 0.01 0.03 0.05 0.04 0.03 0.04 0.10 0.05
SEQID-01865 Q9 V61 -- -- 1 0.45 0.19 0.05 0.07 0.04 0.05 0.01 0.08
0.15 0.02 0.02 0.05 0.10 0.12 SEQID-01866 F1SS64 -- -- 1 0.45 0.19
0.05 0.07 0.04 0.05 0.01 0.08 0.15 0.02 0.02 0.05 0.10 0.12
SEQID-01867 Q9TV62 -- -- 1 0.45 0.18 0.05 0.07 0.04 0.05 0.01 0.08
0.15 0.02 0.02 0.05 0.10 0.12 SEQID-01868 P79293 -- -- 1 0.44 0.19
0.05 0.08 0.05 0.05 0.01 0.07 0.15 0.02 0.02 0.04 0.11 0.12
SEQID-01869 P68137 -- -- 1 0.47 0.20 0.05 0.07 0.03 0.06 0.01 0.03
0.09 0.04 0.03 0.08 0.07 0.06 SEQID-01870 I3L8Q0 -- -- 1 0.45 0.19
0.06 0.09 0.02 0.03 0.01 0.05 0.12 0.03 0.03 0.06 0.05 0.09
SEQID-01871 F1RQQ8 -- -- 1 0.45 0.21 0.05 0.10 0.06 0.06 0.01 0.04
0.09 0.03 0.03 0.06 0.09 0.06 SEQID-01872 F1RHL9 -- -- 1 0.44 0.20
0.05 0.09 0.05 0.06 0.01 0.07 0.11 0.02 0.03 0.07 0.09 0.07
SEQID-01873 Q5XLD3 -- -- 1 0.50 0.20 0.02 0.07 0.05 0.07 0.01 0.04
0.08 0.04 0.05 0.04 0.10 0.10 SEQID-01874 F1RUN2 -- -- 1 0.46 0.19
0.05 0.07 0.02 0.06 0.05 0.04 0.11 0.01 0.04 0.04 0.11 0.11
SEQID-01875 Q1KYT0 -- -- 1 0.48 0.23 0.06 0.06 0.05 0.06 0.01 0.03
0.08 0.05 0.02 0.06 0.09 0.10 SEQID-01876 F1RFH9 -- -- 1 0.49 0.25
0.06 0.07 0.04 0.05 0.02 0.03 0.09 0.04 0.02 0.07 0.10 0.06
SEQID-01877 F15HL9 -- -- 1 0.48 0.23 0.07 0.08 0.03 0.06 0.02 0.03
0.08 0.04 0.03 0.07 0.08 0.03 SEQID-01878 F1RU49 -- -- 1 0.43 0.20
0.06 0.10 0.04 0.06 0.01 0.07 0.11 0.03 0.03 0.05 0.10 0.06
SEQID-01879 P00355 -- -- 1 0.52 0.22 0.06 0.04 0.05 0.07 0.01 0.02
0.04 0.05 0.04 0.07 0.06 0.09 SEQID-01880 P11607 -- -- 1 0.50 0.25
0.05 0.06 0.04 0.05 0.03 0.03 0.09
0.03 0.01 0.07 0.09 0.07 SEQID-01881 F1SRI8 -- -- 1 0.46 0.20 0.04
0.06 0.04 0.07 0.01 0.03 0.09 0.03 0.02 0.07 0.06 0.11 SEQID-01882
F1SFA7 -- -- 1 0.25 0.12 0.07 0.09 0.04 0.04 0.01 0.03 0.06 0.17
0.01 0.03 0.05 0.05 SEQID-01883 F SHW9 -- -- 1 0.47 0.15 0.05 0.03
0.06 0.08 0.01 0.05 0.06 0.01 0.04 0.05 0.07 0.16 SEQID-01884
Q9GIV4 -- -- 1 0.47 0.11 0.04 0.04 0.04 0.05 0.10 0.04 0.05 0.03
0.06 0.02 0.03 0.14 SEQID-01885 A1XQT6 -- -- 0 0.44 0.18 0.08 0.03
0.05 0.05 0.01 0.04 0.14 0.03 0.01 0.05 0.08 0.12 SEQID-01886
D0G7F6 -- -- 1 0.49 0.23 0.08 0.05 0.05 0.05 0.02 0.04 0.09 0.05
0.03 0.06 0.07 0.10 SEQID-01887 P16960 -- -- 1 0.44 0.21 0.05 0.08
0.03 0.05 0.02 0.04 0.11 0.04 0.03 0.04 0.11 0.05 SEQID-01888
F1RZQ6 -- -- 1 0.50 0.21 0.07 0.08 0.03 0.05 0.01 0.05 0.02 0.05
0.01 0.06 0.09 0.09 SEQID-01889 Q5XLD2 -- -- 1 0.49 0.16 0.06 0.05
0.05 0.09 0.01 0.05 0.10 0.04 0.01 0.06 0.05 0.11 SEQID-01890
Q7SIB7 -- -- 1 0.52 0.23 0.06 0.04 0.05 0.06 0.02 0.02 0.08 0.05
0.02 0.05 0.09 0.12 SEQID-01891 F1RVL5 -- -- 1 0.46 0.20 0.04 0.05
0.04 0.07 0.02 0.03 0.10 0.03 0.03 0.05 0.07 0.09 SEQID-01892
P00339 -- -- 1 0.54 0.28 0.04 0.05 0.05 0.05 0.01 0.03 0.07 0.04
0.04 0.07 0.11 0.09 SEQID-01893 F1RH20 -- -- 1 0.46 0.20 0.04 0.07
0.03 0.06 0.01 0.04 0.11 0.04 0.02 0.05 0.07 0.10 SEQID-01894
Q55154 -- -- 1 0.49 0.18 0.04 0.06 0.04 0.07 0.02 0.02 0.06 0.03
0.06 0.04 0.09 0.09 SEQID-01895 B5KJG2 -- -- 1 0.47 0.18 0.06 0.10
0.03 0.05 0.01 0.03 0.10 0.04 0.04 0.06 0.08 0.09 SEQID-01896
F1SHX0 -- -- 1 0.47 0.17 0.04 0.07 0.04 0.07 0.01 0.05 0.07 0.02
0.05 0.05 0.07 0.13 SEQID-01897 P02540 -- -- 1 0.37 0.19 0.06 0.13
0.04 0.05 0.00 0.08 0.14 0.02 0.02 0.04 0.10 0.05 SEQID-01898
F15E14 -- -- 1 0.48 0.22 0.06 0.07 0.04 0.06 0.01 0.04 0.06 0.05
0.02 0.09 0.08 0.08 SEQID-01899 Q2HYU2 -- -- 1 0.48 0.22 0.05 0.09
0.04 0.05 0.02 0.04 0.07 0.05 0.03 0.06 0.08 0.06 SEQID-01900
F1SM75 -- -- 1 0.44 0.18 0.05 0.07 0.04 0.05 0.01 0.04 0.10 0.03
0.03 0.05 0.07 0.09 SEQID-01901 Q4PS85 -- -- 1 0.43 0.16 0.03 0.05
0.04 0.04 0.00 0.06 0.07 0.09 0.03 0.03 0.09 0.08 SEQID-01902
Q75NG9 -- -- 1 0.38 0.14 0.05 0.12 0.02 0.06 0.00 0.06 0.21 0.01
0.03 0.04 0.07 0.16 SEQID-01903 F1SQT3 -- -- 1 0.46 0.21 0.07 0.07
0.02 0.03 0.02 0.04 0.06 0.04 0.01 0.04 0.10 0.07 SEQID-01904
P33198 -- -- 1 0.50 0.19 0.05 0.07 0.04 0.07 0.02 0.05 0.05 0.04
0.04 0.07 0.07 0.09 SEQID-01905 F1SMN5 -- -- 1 0.44 0.20 0.05 0.06
0.03 0.06 0.02 0.03 0.08 0.06 0.03 0.05 0.05 0.07 SEQID-01906
Q2HYU1 -- -- 1 0.44 0.21 0.04 0.12 0.04 0.07 0.02 0.04 0.07 0.04
0.03 0.05 0.10 0.06 SEQID-01907 P08059 -- -- 1 0.52 0.20 0.04 0.06
0.05 0.05 0.00 0.05 0.07 0.04 0.05 0.06 0.10 0.08 SEQID-01908
F1SG00 -- -- 0 0.38 0.17 0.07 0.08 0.02 0.07 0.00 0.07 0.25 0.01
0.01 0.03 0.11 0.13 SEQID-01909 F1RPS8 -- -- 0 0.45 0.25 0.07 0.09
0.03 0.06 0.00 0.05 0.07 0.05 0.01 0.08 0.10 0.07 SEQID-01910
P16276 -- -- 1 0.47 0.22 0.05 0.07 0.05 0.06 0.02 0.04 0.06 0.05
0.04 0.06 0.09 0.08 SEQID-01911 13L953 -- -- 1 0.44 0.22 0.06 0.10
0.01 0.05 0.02 0.06 0.10 0.04 0.03 0.03 0.09 0.05 SEQID-01912
P01965 -- -- 0 0.55 0.22 0.09 0.03 0.04 0.03 0.01 0.03 0.02 0.04
0.10 0.00 0.14 0.09 SEQID-01913 P02067 -- -- 1 0.54 0.26 0.06 0.05
0.06 0.06 0.01 0.04 0.06 0.05 0.07 0.01 0.13 0.09 SEQID-01914
Q7M2W6 -- -- 1 0.48 0.18 0.03 0.12 0.01 0.06 0.00 0.02 0.09 0.02
0.06 0.06 0.08 0.06 SEQID-01915 F1RT61 -- -- 0 0.18 0.06 0.09 0.09
0.03 0.03 0.00 0.04 0.06 0.21 0.01 0.01 0.03 0.05 SEQID-01916
I3LB76 -- -- 1 0.46 0.19 0.05 0.14 0.02 0.05 0.01 0.03 0.13 0.02
0.03 0.02 0.12 0.14 SEQID-01917 F1RM62 -- -- 1 0.38 0.22 0.10 0.10
0.00 0.03 0.01 0.04 0.10 0.03 0.06 0.03 0.11 0.02 SEQID-01918
F6PSL2 -- -- 0 0.49 0.16 0.05 0.05 0.06 0.08 0.00 0.04 0.12 0.03
0.01 0.06 0.05 0.11 SEQID-01919 P00346 -- -- 0 0.49 0.25 0.07 0.05
0.04 0.04 0.02 0.03 0.06 0.05 0.02 0.07 0.10 0.09 SEQID-01920
P11708 -- -- 1 0.51 0.25 0.06 0.04 0.04 0.08 0.01 0.03 0.06 0.03
0.02 0.07 0.10 0.11 SEQID-01921 F1RJ25 -- -- 1 0.41 0.22 0.08 0.08
0.04 0.05 0.02 0.05 0.08 0.05 0.02 0.06 0.09 0.07 SEQID-01922
F1SLA0 -- -- 0 0.45 0.25 0.08 0.07 0.02 0.06 0.00 0.06 0.08 0.05
0.02 0.07 0.10 0.05 SEQID-01923 F1RK48 -- -- 1 0.35 0.16 0.06 0.07
0.03 0.06 0.01 0.05 0.15 0.06 0.03 0.04 0.09 0.05 SEQID-01924
F1SU23 -- -- 1 0.39 0.16 0.05 0.11 0.03 0.09 0.01 0.06 0.05 0.03
0.03 0.01 0.11 0.06 SEQID-01925 I3LJX2 -- -- 0 0.23 0.09 0.10 0.07
0.02 0.05 0.01 0.03 0.07 0.17 0.00 0.01 0.04 0.06 SEQID-01926
F1SHA2 -- -- 0 0.49 0.24 0.05 0.04 0.04 0.04 0.04 0.06 0.10 0.05
0.03 0.07 0.10 0.07 SEQID-01927 F1STM4 -- -- 1 0.52 0.21 0.06 0.06
0.04 0.05 0.01 0.03 0.07 0.04 0.03 0.07 0.06 0.11 SEQID-01928
F1RIS3 -- -- 1 0.41 0.22 0.07 0.11 0.00 0.04 0.03 0.03 0.10 0.04
0.04 0.02 0.14 0.05 SEQID-01929 I3LP30 -- -- 1 0.49 0.22 0.03 0.06
0.05 0.04 0.01 0.07 0.15 0.01 0.02 0.05 0.13 0.13 SEQID-01930
F1S557 -- -- 1 0.45 0.21 0.04 0.08 0.05 0.05 0.02 0.05 0.08 0.03
0.04 0.06 0.10 0.06 SEQID-01931 B5DGM7 -- -- 1 0.47 0.19 0.07 0.06
0.04 0.05 0.02 0.05 0.07 0.04 0.04 0.05 0.09 0.08 SEQID-01932
B5DGR2 -- -- 1 0.53 0.22 0.07 0.05 0.05 0.07 0.01 0.01 0.05 0.05
0.05 0.07 0.05 0.09 SEQID-01933 B5DGM8 -- -- 1 0.47 0.19 0.07 0.06
0.04 0.05 0.02 0.05 0.06 0.04 0.04 0.05 0.09 0.08 SEQID-01934
B5DGQ6 -- -- 1 0.48 0.22 0.07 0.05 0.05 0.08 0.02 0.03 0.07 0.05
0.03 0.07 0.08 0.11 SEQID-01935 B5DGQ7 -- -- 1 0.48 0.21 0.07 0.05
0.05 0.08 0.02 0.03 0.07 0.05 0.03 0.07 0.08 0.11 SEQID-01936
B5DG40 -- -- 1 0.46 0.20 0.05 0.07 0.03 0.06 0.01 0.03 0.08 0.04
0.03 0.0 0.07 0.06 SEQID-01937 B5DGP0 -- -- 1 0.50 0.20 0.02 0.07
0.05 0.08 0.01 0.02 0.08 0.05 0.05 0.04 0.09 0.10 SEQID-01938
B5DGL3 -- -- 1 0.51 0.23 0.07 0.04 0.05 0.06 0.02 0.03 0.08 0.06
0.03 0.07 0.07 0.11 SEQID-01939 B5DGG5 -- -- 1 0.50 0.19 0.03 0.07
0.04 0.08 0.01 0.03 0.08 0.05 0.05 0.04 0.09 0.10 SEQID-01940
Q91472 -- -- 0 0.41 0.18 0.07 0.06 0.02 0.09 0.00 0.04 0.22 0.01
0.00 0.04 0.11 0.15 SEQID-01941 B5DGU1 -- -- 1 0.49 0.21 0.06 0.09
0.03 0.06 0.02 0.03 0.08 0.04 0.04 0.08 0.07 0.09 SEQID-01942
B5DH12 -- -- 0 0.43 0.18 0.08 0.04 0.05 0.09 0.00 0.04 0.11 0.04
0.01 0.04 0.07 0.10 SEQID-01943 B5DG55 -- -- 1 0.48 0.21 0.05 0.08
0.05 0.06 0.01 0.04 0.09 0.03 0.04 0.06 0.09 0.09 SEQID-01944 B5DFX
-- -- 1 0.53 0.22 0.07 0.03 0.05 0.07 0.02 0.02 0.06 0.05 0.03 0.05
0.09 0.12 SEQID-01945 B5DGT1 -- -- 0 0.43 0.18 0.08 0.04 0.05 0.09
0.00 0.04 0.12 0.04 0.01 0.04 0.07 0.10 SEQID-01946 Q7ZZN0 -- -- 1
0.46 0.18 0.06 0.04 0.04 0.07 0.01 0.05 0.13 0.03 0.01 0.06 0.07
0.10 SEQID-01947 B5DGT9 -- -- 1 0.52 0.19 0.06 0.07 0.04 0.05 0.01
0.02 0.09 0.04 0.05 0.06 0.08 0.12 SEQID-01948 O13093 -- -- 1 0.54
0.18 0.05 0.06 0.03 0.06 0.00 0.04 0.14 0.02 0.03 0.04 0.09 0.20
SEQID-01949 B5DGM5 -- -- 0 0.49 0.23 0.05 0.07 0.01 0.09 0.01 0.02
0.09 0.05 0.01 0.07 0.09 0.14 SEQID-01950 B5DG45 -- -- 1 0.43 0.18
0.07 0.07 0.04 0.06 0.02 0.02 0.10 0.03 0.00 0.06 0.05 0.11
SEQID-01951 BS0H15 -- -- 0 0.55 0.17 0.10 0.01 0.02 0.11 0.03 0.03
0.09 0.03 0.02 0.06 0.08 0.14 SEQID-01952 B5X1G7 -- -- 1 0.49 0.26
0.07 0.06 0.04 0.07 0.01 0.03 0.09 0.05 0.01 0.07 0.09 0.10
SEQID-01953 B5DGZ4 -- -- 1 0.39 0.14 0.05 0.11 0.02 0.05 0.00 0.04
0.25 0.01 0.03 0.04 0.06 0.17 SEQID-01954 Q98SJ9 -- -- 1 0.57 0.26
0.05 0.03 0.06 0.04 0.03 0.02 0.09 0.05 0.03 0.09 0.09 0.10
SEQID-01955 B5DG10 -- -- 1 0.52 0.22 0.06 0.05 0.04 0.05 0.01 0.03
0.07 0.05 0.03 0.08 0.06 0.12 SEQID-01956 B5RI24 -- -- 1 0.43 0.20
0.05 0.07 0.05 0.08 0.01 0.08 0.10 0.02 0.03 0.08 0.08 0.04
SEQID-01957 B5DGZ1 -- -- 1 0.51 0.20 0.07 0.07 0.03 0.05 0.01 0.05
0.03 0.05 0.01 0.09 0.06 0.10 SEQID-01958 B5DG5S2 -- -- 1 0.49 0.20
0.04 0.05 0.04 0.07 0.02 0.05 0.06 0.04 0.03 0.06 0.09 0.10
SEQID-01959 B5DFT9 -- -- 1 0.46 0.19 0.03 0.11 0.05 0.08 0.02 0.04
0.06 0.04 0.03 0.04 0.10 0.06 SEQID-01960 B5DG78 -- -- 0 0.45 0.24
0.07 0.09 0.03 0.06 0.01 0.05 0.06 0.05 0.03 0.07 0.10 0.07
SEQID-01961 B5DG72 -- -- 1 0.50 0.21 0.05 0.05 0.04 0.07 0.01 0.03
0.05 0.06 0.03 0.08 0.07 0.09 SEQID-01962 406714392 -- -- 1 0.41
0.20 0.05 0.09 0.05 0.04 0.00 0.06 0.08 0.04 0.01 0.06 0.08 0.06
SEQID-01963 409935420 -- -- 1 0.42 0.20 0.05 0.09 0.05 0.04 0.00
0.06 0.08 0.04 0.01 0.06 0.08 0.06 SEQID-01964 291565678 -- -- 1
0.45 0.23 0.09 0.08 0.05 0.06 0.00 0.03 0.12 0.05 0.01 0.07 0.09
0.08 SEQID-01965 291568131 -- -- 1 0.40 0.21 0.07 0.09 0.04 0.07
0.00 0.05 0.10 0.03 0.02 0.06 0.08 0.08 SEQID-01966 406715237 -- --
1 0.42 0.22 0.07 0.09 0.03 0.08 0.00 0.04 0.10 0.04 0.02 0.06 0.09
0.08 SEQID-01967 406714893 -- -- 1 0.45 0.22 0.05 0.08 0.04 0.07
0.02 0.03 0.10 0.04 0.01 0.06 0.08 0.07 SEQID-01968 291571801 -- --
1 0.45 0.22 0.05 0.08 0.04 0.07 0.02 0.03 0.10 0.04 0.01 0.06 0.08
0.07 SEQID-01969 406715272 -- -- 1 0.44 0.23 0.07 0.08 0.05 0.05
0.02 0.04 0.11 0.05 0.03 0.09 0.07 0.05 SEQID-01970 406712836 -- --
0 0.43 0.21 0.08 0.07 0.04 0.06 0.01 0.05 0.08 0.04 0.05 0.07 0.07
0.05 SEQID-01971 406716509 -- -- 1 0.38 0.14 0.07 0.10 0.02 0.04
0.00 0.17 0.10 0.01 0.02 0.02 0.07 0.07 SEQID-01972 406712937 -- --
1 0.39 0.20 0.07 0.06 0.05 0.06 0.01 0.08 0.09 0.03 0.02 0.05 0.10
0.06 SEQID-01973 304281792 -- -- 1 0.38 0.19 0.06 0.10 0.04 0.05
0.01 0.06 0.06 0.05 0.03 0.08 0.06 0.05 SEQID-01974 406711415 -- --
1 0.48 0.25 0.06 0.06 0.03 0.07 0.01 0.02 0.05 0.04 0.03 0.07 0.09
0.06 SEQID-01975 291566625 -- -- 1 0.49 0.25 0.06 0.06 0.08 0.07
0.01 0.02 0.05 0.04 0.03 0.06 0.09 0.06 SEQID-01976 406712246 -- --
1 0.40 0.17 0.04 0.11 0.06 0.04 0.00 0.03 0.07 0.03 0.01 0.05 0.07
0.04 SEQID-01977 406715559 -- -- 1 0.57 0.23 0.06 0.04 0.04 0.04
0.01 0.04 0.03 0.05 0.07 0.07 0.10 0.04 SEQID-01978 4067161 2 -- --
1 0.44 0.25 0.05 0.12 0.03 0.06 0.00 0.04 0.13 0.04 0.02 0.08 0.10
0.07 SEQID-01979 406711547 -- -- 1 0.40 0.20 0.06 0.08 0.10 0.04
0.01 0.05 0.05 0.06 0.01 0.07 0.06 0.02 SEQID-01980 406715412 -- --
1 0.42 0.22 0.04 0.11 0.04 0.07 0.00 0.05 0.09 0.04 0.02 0.06 0.09
0.05 SEQID-01981 406712949 -- -- 1 0.49 0.22 0.06 0.08 0.03 0.08
0.00 0.03 0.09 0.05 0.03 0.08 0.06 0.07 SEQID-01982 291570166 -- --
1 0.44 0.17 0.04 0.07 0.04 0.05 0.01 0.07 0.09 0.05 0.03 0.07 0.07
0.07 SEQID-01983 291569320 -- -- 1 0.49 0.22 0.06 0.08 0.03 0.07
0.00 0.03 0.09 0.05 0.03 0.08 0.06 0.07 SEQID-01984 406715542 -- --
1 0.47 0.21 0.07 0.06 0.04 0.06 0.01 0.03 0.07 0.05 0.04 0.05 0.09
0.06 SEQID-01985 406714412 -- -- 0 0.42 0.15 0.05 0.09 0.04 0.06
0.01 0.04 0.10 0.05 0.04 0.04 0.08 0.11 SEQID-01986 406711071 -- --
0 0.47 0.27 0.08 0.07 0.04 0.06 0.00 0.05 0.11 0.06 0.00 0.09 0.09
0.08 SEQID-01987 406712053 -- -- 1 0.45 0.19 0.05 0.06 0.06 0.06
0.01 0.05 0.08 0.04 0.03 0.05 0.09 0.06 SEQID-01988 P13550 -- -- 1
0.45 0.24 0.05 0.08 0.02 0.06 0.01 0.04 0.11 0.04 0.02 0.08 0.07
0.06 SEQID-01989 406715415 -- -- 1 0.44 0.25 0.04 0.08 0.04 0.08
0.01 0.05 0.10 0.04 0.02 0.07 0.09 0.05 SEQID-01990 291570822 -- --
1 0.49 0.19 0.02 0.07 0.03 0.09 0.02 0.04 0.07 0.05 0.01 0.04 0.05
0.07 SEQID-01991 157042617 -- -- 1 0.36 0.18 0.05 0.14 0.05 0.02
0.00 0.07 0.10 0.04 0.01 0.03 0.08 0.02 SEQID-01992 406711121 -- --
0 0.46 0.22 0.05 0.07 0.06 0.05 0.01 0.08 0.07 0.03 0.00 0.07 0.10
0.05 SEQID-01993 406715081 -- -- 1 0.50 0.19 0.06 0.07 0.02 0.05
0.00 0.05 0.05 0.06 0.03 0.05 0.07 0.03 SEQID-01994 406713986 -- --
0 0.42 0.25 0.07 0.07 0.03 0.06 0.00 0.08 0.08 0.05 0.00 0.08 0.10
0.06 SEQID-01995 291570872 -- -- 0 0.48 0.27 0.07 0.07 0.04 0.05
0.00 0.04 0.11 0.06 0.00 0.09 0.09 0.08 SEQID-01996 406715991 -- --
1 0.46 0.21 0.05 0.06 0.05 0.07 0.01 0.04 0.06 0.06 0.03 0.06 0.09
0.06 SEQID-01997 409938508 -- -- 1 0.45 0.19 0.05 0.06 0.06 0.07
0.00 0.05 0.08 0.04 0.02 0.05 0.09 0.07 SEQID-01998 291571972 -- --
1 0.51 0.20 0.06 0.07 0.02 0.05 0.00 0.04 0.06 0.06 0.03 0.05 0.09
0.03 SEQID-01999 291565665 -- -- 0 0.41 0.15 0.05 0.09 0.03 0.06
0.01 0.05 0.10 0.05 0.03 0.04 0.08 0.11 SEQID-02000 291568537 -- --
1 0.49 0.16 0.04 0.05 0.05 0.03 0.01 0.03 0.12 0.05 0.01 0.05 0.07
0.13 SEQID-02001 1524355 -- -- 0 0.40 0.23 0.07 0.11 0.02 0.05 0.01
0.01 0.11 0.05 0.00 0.08 0.07 0.04 SEQID-02002 157042618 -- -- 1
0.35 0.19 0.04 0.13 0.03 0.05 0.01 0.07 0.08 0.04 0.01 0.05 0.08
0.03 SEQID-02003 291568724 -- -- 0 0.45 0.25 0.05 0.07 0.03 0.06
0.00 0.05 0.09 0.05 0.01 0.07 0.09 0.06 SEQID-02004 406716541 -- --
0 0.44 0.22 0.06 0.07 0.04 0.09 0.01 0.05 0.09 0.05 0.01 0.06 0.08
0.09 SEQID-02005 291568008 -- -- 1 0.45 0.21 0.06 0.06 0.04 0.07
0.01 0.04 0.06 0.06 0.03 0.06 0.09 0.05
SEQID-02006 291567743 -- -- 1 0.56 0.21 0.06 0.04 0.04 0.04 0.00
0.04 0.03 0.05 0.07 0.06 0.10 0.03 SEQID-02007 2915693 9 -- -- 0
0.38 0.17 0.02 0.04 0.04 0.05 0.00 0.22 0.12 0.01 0.02 0.04 0.11
0.10 SEQID-02008 2114199 -- -- 0 0.41 0.23 0.09 0.07 0.04 0.07 0.01
0.04 0.04 0.04 0.00 0.08 0.09 0.06 SEQID-02009 406716545 -- -- 1
0.52 0.24 0.06 0.05 0.05 0.03 0.00 0.03 0.05 0.07 0.04 0.07 0.11
0.03 SEQID-02010 406710610 -- -- 1 0.46 0.20 0.04 0.07 0.06 0.07
0.01 0.05 0.07 0.03 0.04 0.06 0.10 0.06 SEQID-02011 406712941 -- --
1 0.43 0.22 0.05 0.07 0.04 0.06 0.02 0.05 0.08 0.06 0.03 0.06 0.10
0.05 SEQID-02012 406712920 -- -- 0 0.42 0.19 0.03 0.04 0.05 0.05
0.00 0.16 0.09 0.01 0.02 0.05 0.12 0.09 SEQID-02013 406716507 -- --
1 0.44 0.25 0.04 0.10 0.05 0.06 0.01 0.06 0.08 0.02 0.02 0.07 0.12
0.04 SEQID-02014 406714835 -- -- 1 0.38 0.17 0.06 0.03 0.02 0.02
0.01 0.24 0.18 0.01 0.03 0.02 0.12 0.07 SEQID-02015 291566055 -- --
1 0.49 0.16 0.03 0.05 0.05 0.07 0.01 0.03 0.08 0.04 0.06 0.04 0.06
0.05 SEQID-02016 409939478 -- -- 0 0.39 0.05 0.08 0.00 0.00 0.07
0.00 0.01 0.15 0.00 0.01 0.01 0.00 0.23 SEQID-02017 P72508 -- -- 0
0.38 0.22 0.11 0.09 0.04 0.06 0.02 0.04 0.06 0.03 0.00 0.06 0.09
0.03 SEQID-02018 291568270 -- -- 1 0.42 0.22 0.03 0.10 0.03 0.06
0.02 0.05 0.13 0.02 0.01 0.08 0.05 0.07 SEQID-02019 406714163 -- --
1 0.49 0.23 0.06 0.05 0.06 0.02 0.01 0.03 0.06 0.05 0.03 0.07 0.09
0.00 SEQID-02020 406713173 -- -- 1 0.44 0.24 0.07 0.11 0.03 0.07
0.00 0.05 0.08 0.05 0.01 0.07 0.10 0.04 SEQID-02021 406711712 -- --
1 0.45 0.21 0.07 0.09 0.04 0.07 0.01 0.04 0.12 0.04 0.01 0.07 0.07
0.12 SEQID-02022 291566390 -- -- 1 0.43 0.25 0.07 0.10 0.04 0.06
0.01 0.07 0.08 0.02 0.00 0.05 0.13 0.07 SEQID-02023 291565971 -- --
1 0.49 0.23 0.07 0.07 0.04 0.07 0.01 0.04 0.08 0.04 0.03 0.08 0.08
0.07 SEQID-02024 291570193 -- -- 1 0.46 0.19 0.04 0.07 0.06 0.06
0.01 0.04 0.08 0.04 0.05 0.06 0.09 0.05 SEQID-02025 406711224 -- --
1 0.45 0.21 0.05 0.05 0.05 0.06 0.01 0.06 0.08 0.03 0.03 0.06 0.09
0.08 SEQID-02026 409938720 -- -- 1 0.45 0.22 0.06 0.09 0.04 0.08
0.01 0.05 0.12 0.04 0.01 0.08 0.06 0.12 SEQID-02027 406715510 -- --
1 0.42 0.19 0.05 0.16 0.05 0.03 0.01 0.02 0.05 0.06 0.04 0.07 0.05
0.09 SEQID-02028 406716632 -- -- 0 0.42 0.15 0.05 0.03 0.02 0.03
0.00 0.02 0.16 0.01 0.00 0.03 0.05 0.15 SEQID-02029 291567489 -- --
1 0.48 0.22 0.06 0.06 0.04 0.08 0.01 0.03 0.05 0.05 0.03 0.07 0.07
0.07 SEQID-02030 406715202 -- -- 1 0.42 0.21 0.04 0.10 0.04 0.07
0.01 0.05 0.05 0.04 0.03 0.08 0.09 0.04 SEQID-02031 291572127 -- --
1 0.40 0.21 0.04 0.11 0.04 0.04 0.01 0.03 0.11 0.05 0.01 0.07 0.07
0.02 SEQID-02032 406710632 -- -- 1 0.45 0.27 0.08 0.07 0.03 0.05
0.00 0.10 0.08 0.03 0.00 0.08 0.10 0.08 SEQID-02033 291569653 -- --
1 0.45 0.22 0.06 0.08 0.03 0.06 0.01 0.08 0.07 0.04 0.01 0.04 0.10
0.06 SEQID-02034 291568318 -- -- 1 0.44 0.25 0.04 0.12 0.05 0.05
0.01 0.04 0.09 0.03 0.02 0.07 0.11 0.06 SEQID-02035 10303060 -- --
0 0.39 0.16 0.10 0.09 0.02 0.05 0.02 0.08 0.04 0.04 0.00 0.05 0.07
0.09 SEQID-02036 406714441 -- -- 0 0.42 0.09 0.12 0.06 0.03 0.05
0.00 0.02 0.08 0.03 0.00 0.01 0.04 0.16 SEQID-02037 406713502 -- --
0 0.49 0.24 0.07 0.06 0.03 0.06 0.01 0.06 0.08 0.03 0.00 0.08 0.08
0.11 SEQID-02038 406715512 -- -- 1 0.43 0.22 0.07 0.15 0.03 0.04
0.01 0.05 0.08 0.04 0.01 0.04 0.08 0.08 SEQID-02039 406716252 -- --
0 0.36 0.19 0.08 0.08 0.07 0.04 0.00 0.13 0.13 0.02 0.00 0.04 0.11
0.08 SEQID-02040 291571590 -- -- 0 0.43 0.21 0.06 0.06 0.04 0.07
0.01 0.04 0.08 0.04 0.00 0.05 0.11 0.07 SEQID-02041 291571517 -- --
1 0.39 0.20 0.06 0.10 0.03 0.14 0.01 0.04 0.07 0.04 0.02 0.07 0.08
0.06 SEQID-02042 155676168 -- -- 1 0.50 0.24 0.06 0.07 0.03 0.07
0.01 0.05 0.09 0.05 0.03 0.08 0.09 0.07 SEQID-02043 291565929 -- --
0 0.49 0.21 0.11 0.01 0.00 0.05 0.00 0.04 0.18 0.04 0.00 0.06 0.10
0.14 SEQID-02044 291565691 -- -- 0 0.42 0.08 0.14 0.06 0.04 0.03
0.00 0.01 0.10 0.03 0.00 0.01 0.04 0.17 SEQID-02045 406713937 -- --
0 0.49 0.30 0.05 0.09 0.05 0.05 0.00 0.06 0.08 0.04 0.01 0.07 0.15
0.06 SEQID-02046 291572098 -- -- 1 0.41 0.21 0.05 0.09 0.03 0.06
0.00 0.04 0.17 0.03 0.02 0.07 0.07 0.04 SEQID-02047 291571140 -- --
1 0.47 0.25 0.04 0.05 0.04 0.08 0.01 0.05 0.06 0.05 0.02 0.06 0.10
0.07 SEQID-02048 406713289 -- -- 1 0.42 0.21 0.05 0.05 0.03 0.05
0.00 0.08 0.19 0.02 0.01 0.06 0.09 0.08 SEQID-02049 406714641 -- --
1 0.40 0.20 0.04 0.11 0.04 0.05 0.01 0.04 0.10 0.04 0.01 0.07 0.07
0.02 SEQID-02050 406712535 -- -- 1 0.40 0.24 0.05 0.04 0.05 0.11
0.00 0.07 0.14 0.02 0.01 0.07 0.09 0.01 SEQID-02051 291567799 -- --
0 0.43 0.21 0.06 0.18 0.01 0.07 0.01 0.06 0.05 0.03 0.05 0.05 0.08
0.07 SEQID-02052 291569929 -- -- 0 0.45 0.24 0.05 0.09 0.03 0.08
0.01 0.04 0.09 0.04 0.00 0.08 0.11 0.08 SEQID-02053 406716396 -- --
0 0.37 0.13 0.06 0.08 0.06 0.06 0.01 0.07 0.09 0.05 0.00 0.03 0.05
0.12 SEQID-02054 226536926 -- -- 1 0.52 0.17 0.08 0.00 0.08 0.05
0.01 0.04 0.06 0.04 0.04 0.04 0.10 0.08 SEQID-02055 291566672 -- --
1 0.45 0.20 0.05 0.10 0.03 0.04 0.01 0.04 0.09 0.04 0.03 0.04 0.10
0.07 SEQID-02056 291567524 -- -- 1 0.54 0.22 0.06 0.05 0.04 0.03
0.02 0.04 0.06 0.05 0.03 0.05 0.11 0.01 SEQID-02057 291571685 -- --
1 0.46 0.22 0.04 0.10 0.05 0.07 0.01 0.02 0.08 0.04 0.03 0.08 0.07
0.04 SEQID-02058 406711744 -- -- 1 0.46 0.23 0.06 0.04 0.06 0.05
0.00 0.06 0.07 0.05 0.03 0.06 0.08 0.05 SEQID-02059 291567802 -- --
0 0.52 0.32 0.06 0.08 0.03 0.01 0.00 0.06 0.04 0.05 0.00 0.12 0.12
0.03 SEQID-02060 406712317 -- -- 1 0.44 0.20 0.04 0.04 0.02 0.04
0.00 0.20 0.11 0.01 0.03 0.03 0.12 0.09 SEQID-02061 406715474 -- --
1 0.44 0.26 0.06 0.09 0.04 0.06 0.01 0.05 0.09 0.04 0.01 0.07 0.13
0.06 SEQID-02062 291569833 -- -- 1 0.43 0.24 0.07 0.11 0.04 0.07
0.00 0.06 0.09 0.04 0.01 0.06 0.10 0.05 SEQID-02063 406715203 -- --
1 0.43 0.22 0.04 0.11 0.05 0.07 0.01 0.05 0.06 0.04 0.02 0.08 0.10
0.03 SEQID-02064 406715533 -- -- 1 0.45 0.23 0.05 0.06 0.04 0.05
0.01 0.06 0.10 0.04 0.02 0.05 0.11 0.05 SEQID-02065 291570764 -- --
1 0.48 0.23 0.07 0.06 0.05 0.06 0.01 0.03 0.08 0.04 0.03 0.08 0.09
0.06 SEQID-02066 291570294 -- -- 1 0.45 0.20 0.06 0.06 0.05 0.06
0.02 0.04 0.07 0.04 0.02 0.05 0.08 0.07 SEQID-02067 291565677 -- --
0 0.46 0.26 0.07 0.06 0.02 0.07 0.01 0.01 0.11 0.06 0.00 0.05 0.09
0.12 SEQID-02068 406713927 -- -- 0 0.44 0.09 0.05 0.10 0.01 0.07
0.00 0.02 0.08 0.03 0.00 0.02 0.06 0.15 SEQID-02069 291565882 -- --
1 0.44 0.24 0.12 0.10 0.02 0.05 0.00 0.02 0.08 0.06 0.01 0.07 0.07
0.04 SEQID-02070 291570798 -- -- 0 0.44 0.23 0.06 0.13 0.02 0.03
0.00 0.07 0.13 0.03 0.02 0.07 0.08 0.08 SEQID-02071 406711359 -- --
1 0.46 0.22 0.08 0.07 0.02 0.05 0.01 0.06 0.07 0.04 0.02 0.06 0.13
0.06 SEQID-02072 291566660 -- -- 1 0.46 0.22 0.08 0.07 0.02 0.05
0.01 0.05 0.07 0.05 0.02 0.06 0.13 0.06 SEQID-02073 406715124 -- --
0 0.41 0.24 0.04 0.14 0.06 0.05 0.02 0.03 0.05 0.03 0.00 0.09 0.08
0.03 SEQID-02074 406711662 -- -- 1 0.48 0.28 0.06 0.06 0.03 0.06
0.02 0.03 0.05 0.06 0.02 0.09 0.12 0.03 SEQID-02075 406715358 -- --
1 0.42 0.19 0.03 0.09 0.03 0.06 0.04 0.04 0.10 0.02 0.03 0.05 0.08
0.09 SEQID-02076 291568477 -- -- 1 0.46 0.21 0.03 0.05 0.06 0.10
0.01 0.04 0.05 0.02 0.02 0.06 0.09 0.08 SEQID-02077 291567784 -- --
0 0.49 0.21 0.03 0.09 0.06 0.03 0.00 0.05 0.06 0.07 0.03 0.05 0.09
0.11 SEQID-02078 406711814 -- -- 1 0.49 0.27 0.06 0.07 0.04 0.07
0.01 0.04 0.06 0.04 0.03 0.09 0.09 0.05 SEQID-02079 406714225 -- --
1 0.38 0.18 0.0 0.03 0.09 0.06 0.02 0.06 0.03 0.05 0.01 0.04 0.11
0.04 SEQID-02080 291566562 -- -- 1 0.49 0.19 0.04 0.09 0.05 0.05
0.01 0.02 0.10 0.02 0.04 0.05 0.10 0.07 SEQID-02081 291566243 -- --
1 0.44 0.19 0.05 0.10 0.03 0.05 0.01 0.04 0.09 0.03 0.06 0.05 0.08
0.05 SEQID-02082 291568601 -- -- 1 0.49 0.22 0.07 0.04 0.03 0.04
0.01 0.03 0.08 0.07 0.03 0.06 0.09 0.06 SEQID-02083 291568927 -- --
1 0.44 0.21 0.06 0.07 0.05 0.05 0.01 0.05 0.08 0.05 0.02 0.06 0.09
0.06 SEQID-02084 291570378 -- -- 1 0.46 0.17 0.04 0.08 0.03 0.05
0.01 0.05 0.07 0.04 0.03 0.06 0.06 0.04 SEQID-02085 406712979 -- --
1 0.39 0.20 0.08 0.04 0.04 0.04 0.01 0.10 0.10 0.03 0.04 0.05 0.12
0.05 SEQID-02086 291571158 -- -- 1 0.47 0.20 0.07 0.06 0.04 0.05
0.01 0.05 0.07 0.05 0.03 0.06 0.09 0.04 SEQID-02087 291570621 -- --
1 0.44 0.22 0.05 0.09 0.03 0.06 0.00 0.06 0.11 0.03 0.02 0.05 0.09
0.06 SEQID-02088 291566536 -- -- 1 0.42 0.24 0.05 0.04 0.05 0.09
0.00 0.08 0.14 0.02 0.01 0.07 0.09 0.01 SEQID-02089 291568759 -- --
0 0.49 0.38 0.0 0.06 0.01 0.05 0.00 0.02 0.10 0.02 0.00 0.09 0.10
0.05 SEQID-02090 291566375 -- -- 1 0.49 0.20 0.05 0.08 0.01 0.04
0.00 0.08 0.07 0.04 0.01 0.11 0.06 0.03 SEQID-02091 406715888 -- --
0 0.36 0.19 0.04 0.18 0.03 0.03 0.00 0.06 0.10 0.03 0.00 0.06 0.08
0.07 SEQID-02092 291567786 -- -- 0 0.47 0.23 0.04 0.16 0.03 0.06
0.00 0.05 0.08 0.01 0.00 0.05 0.08 0.08 SEQID-02093 406715491 -- --
0 0.41 0.21 0.05 0.23 0.02 0.06 0.00 0.03 0.05 0.05 0.01 0.06 0.08
0.08 SEQID-02094 291568112 -- -- 0 0.46 0.18 0.06 0.03 0.05 0.12
0.01 0.03 0.04 0.04 0.03 0.04 0.07 0.09 SEQID-02095 291565897 -- --
1 0.52 0.24 0.05 0.08 0.03 0.04 0.00 0.03 0.11 0.05 0.02 0.08 0.10
0.08 SEQID-02096 291568829 -- -- 0 0.41 0.25 0.08 0.09 0.02 0.09
0.01 0.04 0.06 0.04 0.01 0.06 0.12 0.03 SEQID-02097 291567800 -- --
1 0.46 0.26 0.07 0.11 0.06 0.02 0.00 0.06 0.07 0.07 0.01 0.06 0.07
0.12 SEQID-02098 291567422 -- -- 0 0.38 0.12 0.07 0.07 0.07 0.05
0.01 0.07 0.08 0.04 0.00 0.03 0.05 0.11 SEQID-02099 406715501 -- --
0 0.48 0.23 0.04 0.10 0.03 0.05 0.00 0.07 0.08 0.04 0.01 0.10 0.08
0.07 SEQID-02100 406716242 -- -- 1 0.42 0.19 0.08 0.06 0.03 0.09
0.00 0.07 0.09 0.01 0.01 0.04 0.11 0.09 SEQID-02101 291567386 -- --
0 0.43 0.22 0.05 0.08 0.05 0.05 0.00 0.09 0.09 0.02 0.03 0.08 0.07
0.07 SEQID-02102 406716309 -- -- 1 0.43 0.16 0.05 0.09 0.04 0.07
0.00 0.05 0.09 0.04 0.07 0.06 0.04 0.05 SEQID-02103 291565931 -- --
1 0.48 0.24 0.06 0.08 0.01 0.07 0.01 0.05 0.07 0.04 0.01 0.05 0.12
0.09 SEQID-02104 291566379 -- -- 1 0.45 0.21 0.03 0.09 0.03 0.04
0.02 0.05 0.08 0.03 0.01 0.07 0.09 0.05 SEQID-02105 291571503 -- --
0 0.48 0.23 0.06 0.10 0.02 0.04 0.01 0.05 0.08 0.03 0.00 0.07 0.10
0.09 SEQID-02106 406715051 -- -- 1 0.49 0.24 0.04 0.04 0.05 0.06
0.00 0.08 0.05 0.04 0.01 0.07 0.10 0.09 SEQID-02107 291566214 -- --
1 0.47 0.23 0.03 0.08 0.07 0.06 0.01 0.04 0.06 0.04 0.04 0.07 0.10
0.05 SEQID-02108 291567878 -- -- 1 0.46 0.23 0.07 0.05 0.06 0.07
0.02 0.03 0.09 0.05 0.02 0.08 0.09 0.07 SEQID-02109 291572086 -- --
1 0.45 0.25 0.05 0.09 0.02 0.08 0.02 0.05 0.07 0.05 0.03 0.08 0.10
0.05 SEQID-02110 291568830 -- -- 1 0.46 0.18 0.05 0.05 0.04 0.07
0.01 0.04 0.07 0.04 0.03 0.05 0.08 0.06 SEQID-02111 291565792 -- --
1 0.58 0.36 0.07 0.04 0.04 0.04 0.00 0.05 0.04 0.04 0.01 0.12 0.16
0.03 SEQID-02112 291566578 -- -- 0 0.43 0.24 0.03 0.10 0.04 0.06
0.01 0.04 0.11 0.05 0.02 0.06 0.09 0.05 SEQID-02113 291569922 -- --
1 0.46 0.27 0.05 0.09 0.02 0.08 0.00 0.04 0.08 0.05 0.02 0.09 0.10
0.06 SEQID-02114 406713771 -- -- 1 0.42 0.22 0.05 0.08 0.07 0.05
0.01 0.06 0.06 0.05 0.02 0.06 0.08 0.04 SEQID-02115 291566950 -- --
1 0.45 0.22 0.07 0.07 0.04 0.06 0.02 0.04 0.08 0.05 0.01 0.07 0.09
0.05 SEQID-02116 406712549 -- -- 1 0.46 0.24 0.05 0.08 0.04 0.06
0.01 0.04 0.09 0.03 0.03 0.06 0.11 0.06 SEQID-02117 17974193 -- --
0 0.53 0.19 0.02 0.12 0.04 0.01 0.01 0.08 0.05 0.04 0.00 0.04 0.07
0.10 SEQID-02118 291569292 -- -- 0 0.48 0.21 0.06 0.11 0.03 0.03
0.00 0.04 0.14 0.02 0.00 0.04 0.07 0.14 SEQID-02119 291569856 -- --
0 0.44 0.28 0.06 0.10 0.02 0.03 0.00 0.02 0.11 0.05 0.02 0.09 0.03
0.03 SEQID-02120 291569285 -- -- 0 0.33 0.13 0.04 0.15 0.03 0.07
0.01 0.01 0.12 0.09 0.00 0.02 0.05 0.05 SEQID-02121 406714138 -- --
0 0.47 0.23 0.03 0.12 0.02 0.05 0.00 0.06 0.11 0.04 0.04 0.08 0.06
0.09 SEQID-02122 291570835 -- -- 1 0.68 0.36 0.03 0.02 0.03 0.02
0.01 0.02 0.08 0.06 0.03 0.18 0.14 0.04 SEQID-02123 291568903 -- --
0 0.39 0.20 0.09 0.11 0.05 0.04 0.01 0.04 0.05 0.02 0.01 0.02 0.10
0.05 SEQID-02124 291567801 -- -- 0 0.37 0.19 0.07 0.15 0.04 0.03
0.01 0.06 0.05 0.08 0.00 0.05 0.10 0.09 SEQID-02125 406713989 -- --
0 0.41 0.24 0.10 0.07 0.03 0.04 0.00 0.11 0.12 0.02 0.01 0.10 0.13
0.08 SEQID-02126 291570409 -- -- 0 0.52 0.23 0.07 0.03 0.03 0.08
0.00 0.05 0.09 0.05 0.00 0.04 0.12 0.09 SEQID-02127 P13577 -- -- 1
0.40 0.17 0.07 0.21 0.03 0.03 0.00 0.01 0.09 0.02 0.04 0.03 0.06
0.05 SEQID-02128 406714844 -- -- 1 0.45 0.23 0.06 0.07 0.05 0.05
0.02 0.07 0.07 0.02 0.02 0.06 0.10 0.05 SEQID-02129 406713988 -- --
0 0.36 0.25 0.10 0.12 0.05 0.03 0.00 0.10 0.15 0.03 0.01 0.07 0.14
0.05 SEQID-02130 406713332 -- -- 1 0.49 0.25 0.08 0.05 0.05 0.06
0.00 0.03 0.07 0.06 0.01 0.10 0.06 0.098 SEQID-02131 406713096 --
-- 1 0.44 0.23 0.04 0.05 0.05 0.08 0.00 0.07 0.09
0.04 0.01 0.07 0.09 0.09 SEQID-02132 291571396 -- -- 1 0.44 0.24
0.04 0.08 0.05 0.04 0.01 0.05 0.12 0.05 0.03 0.08 0.08 0.04
SEQID-02133 406714445 -- -- 1 0.46 0.22 0.03 0.08 0.05 0.06 0.00
0.07 0.11 0.02 0.00 0.05 0.11 0.07 SEQID-02134 291566643 -- -- 0
0.37 0.21 0.05 0.03 0.09 0.13 0.00 0.05 0.04 0.12 0.00 0.07 0.09
0.01 SEQID-02135 291568361 -- -- 0 0.44 0.27 0.06 0.08 0.04 0.07
0.02 0.06 0.06 0.04 0.01 0.06 0.12 0.07 SEQID-02136 291568800 -- --
1 0.46 0.24 0.07 0.08 0.03 0.08 0.01 0.05 0.07 0.03 0.03 0.06 0.12
0.04 SEQID-02137 406712435 -- -- 1 0.44 0.25 0.07 0.04 0.04 0.05
0.01 0.07 0.08 0.05 0.01 0.06 0.09 0.05 SEQID-02138 291571840 -- --
0 0.47 0.25 0.05 0.07 0.05 0.06 0.01 0.05 0.08 0.04 0.03 0.06 0.12
0.05 SEQID-02139 291571996 -- -- 1 0.45 0.26 0.09 0.05 0.04 0.05
0.01 0.06 0.10 0.05 0.01 0.06 0.10 0.07 SEQID-02140 406716058 -- --
0 0.40 0.19 0.04 0.12 0.04 0.05 0.02 0.03 0.10 0.07 0.01 0.06 0.08
0.06 SEQID-02141 291568019 -- -- 1 0.43 0.21 0.07 0.10 0.04 0.07
0.01 0.02 0.07 0.04 0.02 0.06 0.07 0.07 SEQID-02142 291570518 -- --
1 0.48 0.23 0.06 0.06 0.04 0.06 0.02 0.05 0.06 0.04 0.05 0.07 0.11
0.06 SEQID-02143 291566657 -- -- 1 0.57 0.38 0.08 0.04 0.03 0.04
0.00 0.02 0.07 0.05 0.00 0.12 0.14 0.02 SEQID-02144 406711605 -- --
1 0.49 0.27 0.07 0.06 0.04 0.06 0.02 0.04 0.07 0.05 0.04 0.07 0.10
0.06 SEQID-02145 406713196 -- -- 1 0.46 0.30 0.06 0.08 0.04 0.06
0.01 0.05 0.07 0.04 0.02 0.09 0.12 0.05 SEQID-02146 291570777 -- --
1 0.47 0.21 0.06 0.09 0.04 0.05 0.01 0.04 0.09 0.02 0.04 0.05 0.08
0.06 SEQID-02147 406712981 -- -- 1 0.43 0.19 0.03 0.06 0.05 0.04
0.00 0.12 0.12 0.02 0.02 0.04 0.12 0.06 SEQID-02148 291569312 -- --
1 0.40 0.24 0.04 0.12 0.05 0.07 0.00 0.04 0.10 0.03 0.02 0.07 0.09
0.03 SEQID-02149 406713557 -- -- 1 0.43 0.20 0.05 0.09 0.05 0.07
0.01 0.05 0.08 0.04 0.02 0.06 0.08 0.06 SEQID-02150 291570203 -- --
1 0.41 0.20 0.04 0.05 0.01 0.03 0.00 0.03 0.07 0.11 0.01 0.05 0.07
0.02 SEQID-02151 291565708 -- -- 1 0.45 0.22 0.03 0.07 0.05 0.07
0.00 0.06 0.09 0.03 0.02 0.07 0.10 0.06 SEQID-02152 291570064 -- --
1 0.46 0.24 0.06 0.07 0.03 0.06 0.01 0.04 0.10 0.04 0.01 0.08 0.09
0.06 SEQID-02153 291572019 -- -- 1 0.44 0.24 0.04 0.10 0.04 0.05
0.01 0.08 0.09 0.02 0.03 0.06 0.12 0.05 SEQID-02154 291568067 -- --
1 0.37 0.21 0.07 0.05 0.05 0.12 0.00 0.06 0.14 0.03 0.01 0.05 0.11
0.03 SEQID-02155 291568693 -- -- 1 0.44 0.22 0.05 0.07 0.05 0.05
0.01 0.07 0.08 0.03 0.03 0.07 0.10 0.05 SEQID-02156 406713711 -- --
0 0.51 0.19 0.04 0.05 0.05 0.00 0.00 0.06 0.08 0.04 0.00 0.05 0.12
0.04 SEQID-02157 406715505 -- -- 0 0.42 0.24 0.04 0.15 0.04 0.04
0.00 0.09 0.12 0.01 0.05 0.05 0.18 0.08 SEQID-02158 406715222 -- --
1 0.39 0.12 0.03 0.19 0.03 0.06 0.00 0.00 0.17 0.04 0.03 0.04 0.04
0.098 SEQID-02159 291571965 -- -- 1 0.40 0.18 0.05 0.09 0.00 0.07
0.11 0.03 0.06 0.04 0.02 0.05 0.06 0.04 SEQID-02160 291570671 -- --
0 0.42 0.22 0.06 0.09 0.07 0.04 0.01 0.04 0.09 0.04 0.00 0.05 0.03
0.09 SEQID-02161 291567416 -- -- 0 0.44 0.16 0.10 0.07 0.05 0.03
0.02 0.05 0.11 0.04 0.01 0.05 0.02 0.10 SEQID-02162 157042619 -- --
0 0.38 0.14 0.02 0.11 0.06 0.04 0.00 0.05 0.11 0.05 0.00 0.07 0.01
0.05 SEQID-02163 291566338 -- -- 0 0.41 0.10 0.06 0.10 0.02 0.05
0.00 0.04 0.08 0.04 0.00 0.02 0.06 0.13 SEQID-02164 291571410 -- --
1 0.48 0.24 0.12 0.04 0.06 0.07 0.02 0.03 0.02 0.05 0.01 0.03 0.11
0.10 SEQID-02165 291568589 -- -- 0 0.48 0.25 0.05 0.04 0.03 0.06
0.02 0.08 0.08 0.03 0.00 0.05 0.08 0.05 SEQID-02166 P48852 -- -- 0
0.48 0.24 0.04 0.16 0.01 0.09 0.02 0.04 0.04 0.01 0.03 0.10 0.09
0.089 SEQID-02167 291567795 -- -- 0 0.51 0.21 0.02 0.12 0.03 0.04
0.00 0.04 0.07 0.04 0.03 0.04 0.04 0.15 SEQID-02168 291566622 -- --
0 0.41 0.22 0.04 0.07 0.04 0.06 0.00 0.08 0.12 0.07 0.00 0.02 0.14
0.07 SEQID-02169 406713351 -- -- 0 0.53 0.26 0.05 0.03 0.04 0.02
0.00 0.05 0.09 0.03 0.00 0.05 0.09 0.09 SEQID-02170 291567797 -- --
1 0.50 0.23 0.04 0.15 0.04 0.03 0.01 0.03 0.06 0.04 0.02 0.08 0.08
0.08 SEQID-02171 291565935 -- -- 0 0.45 0.26 0.03 0.17 0.02 0.02
0.00 0.07 0.09 0.04 0.01 0.12 0.04 0.08 SEQID-02172 406712927 -- --
1 0.48 0.23 0.07 0.05 0.06 0.05 0.01 0.05 0.06 0.03 0.02 0.05 0.12
0.07 SEQID-02173 291569027 -- -- 1 0.51 0.26 0.07 0.03 0.04 0.03
0.01 0.03 0.13 0.05 0.01 0.08 0.10 0.09 SEQID-02174 291566287 -- --
1 0.47 0.26 0.05 0.06 0.02 0.06 0.01 0.08 0.07 0.04 0.01 0.06 0.13
0.04 SEQID-02175 406715357 -- -- 1 0.58 0.34 0.06 0.04 0.04 0.03
0.00 0.03 0.05 0.04 0.01 0.06 0.17 0.01 SEQID-02176 406715137 -- --
1 0.46 0.26 0.06 0.04 0.04 0.04 0.01 0.05 0.13 0.05 0.03 0.07 0.11
0.06 SEQID-02177 406710703 -- -- 1 0.40 0.15 0.05 0.06 0.03 0.03
0.02 0.07 0.08 0.06 0.02 0.02 0.07 0.05 SEQID-02178 291570807 -- --
1 0.61 0.27 0.03 0.05 0.00 0.02 0.01 0.03 0.04 0.04 0.03 0.09 0.09
0.05 SEQID-02179 291569898 -- -- 1 0.49 0.26 0.06 0.04 0.03 0.04
0.01 0.07 0.08 0.04 0.02 0.07 0.11 0.06 SEQID-02180 291570674 -- --
1 0.45 0.27 0.08 0.09 0.06 0.05 0.01 0.03 0.06 0.05 0.02 0.08 0.10
0.02 SEQID-02181 291565912 -- -- 1 0.44 0.23 0.07 0.08 0.04 0.05
0.01 0.08 0.09 0.02 0.01 0.06 0.10 0.06 SEQID-02182 406714269 -- --
1 0.47 0.22 0.03 0.08 0.02 0.05 0.01 0.06 0.10 0.03 0.02 0.07 0.08
0.06 SEQID-02183 291571644 -- -- 1 0.48 0.26 0.05 0.05 0.03 0.07
0.01 0.07 0.05 0.04 0.02 0.10 0.10 0.07 SEQID-02184 291567808 -- --
1 0.44 0.25 0.06 0.09 0.04 0.08 0.01 0.06 0.10 0.03 0.02 0.08 0.11
0.06 SEQID-02185 291571141 -- -- 1 0.45 0.23 0.03 0.08 0.06 0.07
0.01 0.05 0.06 0.04 0.03 0.08 0.09 0.06 SEQID-02186 406714429 -- --
1 0.57 0.26 0.08 0.03 0.02 0.04 0.01 0.04 0.04 0.05 0.05 0.05 0.14
0.03 SEQID-02187 291566376 -- -- 1 0.46 0.19 0.04 0.05 0.04 0.07
0.01 0.04 0.07 0.05 0.01 0.05 0.09 0.05 SEQID-02188 291570198 -- --
1 0.43 0.17 0.06 0.09 0.03 0.07 0.02 0.02 0.10 0.04 0.03 0.03 0.06
0.06 SEQID-02189 406715783 -- -- 1 0.50 0.24 0.06 0.06 0.04 0.06
0.01 0.04 0.07 0.04 0.04 0.07 0.11 0.07 SEQID-02190 291568588 -- --
1 0.46 0.26 0.08 0.06 0.03 0.05 0.02 0.05 0.06 0.06 0.01 0.08 0.09
0.06 SEQID-02191 291569924 -- -- 1 0.47 0.23 0.09 0.06 0.03 0.06
0.01 0.04 0.07 0.07 0.02 0.05 0.12 0.06 SEQID-02192 406712516 -- --
1 0.46 0.24 0.08 0.05 0.04 0.05 0.00 0.06 0.05 0.04 0.01 0.07 0.08
0.05 SEQID-02193 291568241 -- -- 0 0.53 0.34 0.07 0.04 0.03 0.03
0.01 0.04 0.05 0.05 0.00 0.10 0.17 0.03 SEQID-02194 291571841 -- --
0 0.47 0.30 0.06 0.09 0.04 0.04 0.00 0.06 0.08 0.05 0.00 0.08 0.14
0.02 SEQID-02195 406712605 -- -- 1 0.43 0.19 0.06 0.09 0.03 0.05
0.01 0.06 0.09 0.03 0.01 0.08 0.07 0.05 SEQID-02196 291567555 -- --
1 0.54 0.27 0.07 0.04 0.03 0.03 0.01 0.03 0.05 0.07 0.02 0.10 0.10
0.02 SEQID-02197 291569604 -- -- 1 0.38 0.15 0.07 0.03 0.01 0.08
0.00 0.02 0.20 0.02 0.01 0.02 0.05 0.08 SEQID-02198 406713974 -- --
1 0.41 0.23 0.05 0.04 0.06 0.08 0.00 0.05 0.05 0.07 0.00 0.05 0.09
0.01 SEQID-02199 291571795 -- -- 1 0.44 0.24 0.06 0.07 0.04 0.07
0.00 0.08 0.07 0.04 0.03 0.08 0.11 0.06 SEQID-02200 291570843 -- --
1 0.43 0.19 0.06 0.07 0.06 0.07 0.01 0.04 0.06 0.05 0.02 0.08 0.07
0.05 SEQID-02201 291569589 -- -- 1 0.43 0.22 0.07 0.08 0.04 0.05
0.01 0.05 0.08 0.05 0.03 0.08 0.07 0.04 SEQID-02202 291569371 -- --
1 0.46 0.19 0.05 0.08 0.03 0.06 0.01 0.04 0.09 0.05 0.03 0.05 0.07
0.06 SEQID-02203 291566291 -- -- 1 0.42 0.19 0.04 0.09 0.04 0.06
0.01 0.05 0.09 0.04 0.03 0.06 0.09 0.07 SEQID-02204 291568479 -- --
1 0.48 0.21 0.03 0.07 0.04 0.07 0.01 0.05 0.11 0.02 0.03 0.07 0.09
0.07 SEQID-02205 291566322 -- -- 1 0.45 0.22 0.04 0.09 0.03 0.06
0.00 0.08 0.09 0.03 0.02 0.06 0.10 0.05 SEQID-02206 291567103 -- --
1 0.50 0.29 0.06 0.06 0.04 0.06 0.01 0.06 0.06 0.04 0.01 0.10 0.11
0.04 SEQID-02207 I3JEK7 -- -- 1 0.46 0.20 0.04 0.07 0.03 0.07 0.02
0.03 0.10 0.03 0.02 0.06 0.06 0.09 SEQID-02208 I3KK23 -- -- 1 0.47
0.18 0.05 0.05 0.05 0.07 0.01 0.05 0.06 0.02 0.04 0.05 0.08 0.13
SEQID-02209 I3JYT9 -- -- 1 0.45 0.19 0.05 0.07 0.04 0.05 0.01 0.07
0.15 0.02 0.02 0.04 0.10 0.12 SEQID-02210 I3IZY8 -- -- 1 0.44 0.18
0.06 0.07 0.04 0.05 0.01 0.07 0.13 0.02 0.03 0.04 0.09 0.11
SEQID-02211 I3KLJ9 -- -- 1 0.47 0.20 0.04 0.06 0.03 0.05 0.02 0.04
0.12 0.03 0.02 0.06 0.07 0.11 SEQID-02212 I3IZU1 -- -- 1 0.46 0.19
0.06 0.07 0.04 0.05 0.01 0.07 0.14 0.02 0.02 0.05 0.09 0.11
SEQID-02213 I3K022 -- -- 1 0.49 0.24 0.06 0.06 0.04 0.06 0.03 0.02
0.09 0.03 0.01 0.07 0.09 0.07 SEQID-02214 I3IZY3 -- -- 1 0.40 0.18
0.06 0.10 0.04 0.06 0.00 0.10 0.18 0.02 0.02 0.03 0.10 0.12
SEQID-02215 I3K5K1 -- -- 1 0.46 0.20 0.05 0.08 0.05 0.06 0.01 0.06
0.11 0.02 0.03 0.07 0.09 0.07 SEQID-02216 I3IUB3 -- -- 1 0.47 0.19
0.05 0.06 0.03 0.05 0.01 0.03 0.08 0.03 0.04 0.04 0.06 0.09
SEQID-02217 I3KK81 -- -- 1 0.46 0.20 0.05 0.07 0.03 0.06 0.01 0.03
0.08 0.04 0.03 0.08 0.07 0.06 SEQID-02218 I3IZX8 -- -- 1 0.51 0.19
0.05 0.04 0.05 0.05 0.01 0.05 0.09 0.03 0.03 0.07 0.07 0.10
SEQID-02219 I3KU01 -- -- 1 0.45 0.19 0.05 0.07 0.04 0.05 0.01 0.07
0.15 0.02 0.03 0.05 0.11 0.12 SEQID-02220 I3JT59 -- -- 1 0.45 0.18
0.05 0.07 0.04 0.05 0.01 0.07 0.14 0.02 0.02 0.05 0.10 0.12
SEQID-02221 I3IZY5 -- -- 1 0.49 0.20 0.05 0.05 0.05 0.05 0.01 0.04
0.08 0.03 0.02 0.07 0.08 0.08 SEQID-02222 I3KZL6 -- -- 1 0.45 0.18
0.05 0.07 0.05 0.05 0.01 0.07 0.15 0.02 0.02 0.04 0.11 0.12
SEQID-02223 I3KXM4 -- -- 1 0.48 0.23 0.04 0.06 0.05 0.05 0.01 0.03
0.09 0.04 0.01 0.06 0.07 0.09 SEQID-02224 I3JDJ0 -- -- 1 0.47 0.19
0.05 0.06 0.03 0.05 0.02 0.03 0.08 0.04 0.03 0.06 0.06 0.09
SEQID-02225 I3JDJ1 -- -- 1 0.47 0.19 0.05 0.06 0.04 0.05 0.01 0.03
0.08 0.04 0.03 0.06 0.06 0.08 SEQID-02226 I3KFP0 -- -- 1 0.50 0.20
0.02 0.07 0.05 0.07 0.01 0.03 0.09 0.05 0.05 0.04 0.09 0.09
SEQID-02227 I3JE80 -- -- 1 0.48 0.22 0.04 0.06 0.04 0.06 0.02 0.04
0.10 0.03 0.03 0.05 0.11 0.07 SEQID-02228 I3KW15 -- -- 1 0.45 0.21
0.07 0.06 0.05 0.04 0.02 0.05 0.07 0.04 0.03 0.05 0.09 0.08
SEQID-02229 I3KvU7 -- -- 1 0.48 0.20 0.04 0.06 0.04 0.07 0.02 0.02
0.10 0.03 0.02 0.06 0.06 0.11 SEQID-02230 I3JBN0 -- -- 1 0.46 0.20
0.05 0.09 0.06 0.06 0.01 0.04 0.09 0.03 0.04 0.06 0.08 0.07
SEQID-02231 I3K556 -- -- 1 0.52 0.22 0.06 0.05 0.05 0.06 0.01 0.01
0.06 0.05 0.04 0.07 0.05 0.10 SEQID-02232 I3J7R3 -- -- 1 0.47 0.21
0.04 0.07 0.04 0.06 0.02 0.04 0.11 0.03 0.03 0.05 0.10 0.07
SEQID-02233 I3JS50 -- -- 1 0.47 0.18 0.04 0.07 0.05 0.06 0.01 0.04
0.08 0.02 0.04 0.05 0.09 0.08 SEQID-02234 I3JKR2 -- -- 1 0.49 0.22
0.06 0.05 0.05 0.07 0.01 0.03 0.08 0.04 0.03 0.07 0.08 0.11
SEQID-02235 I3JL13 -- -- 1 0.49 0.21 0.02 0.08 0.04 0.07 0.01 0.04
0.09 0.05 0.04 0.04 0.10 0.09 SEQID-02236 I3JRU6 -- -- 1 0.48 0.20
0.04 0.06 0.04 0.05 0.01 0.03 0.10 0.04 0.03 0.04 0.06 0.09
SEQID-02237 I3JS33 -- -- 1 0.47 0.18 0.04 0.12 0.03 0.05 0.02 0.05
0.07 0.04 0.04 0.06 0.07 0.08 SEQID-02238 I3JXH7 -- -- 1 0.42 0.13
0.05 0.15 0.01 0.06 0.00 0.05 0.19 0.01 0.03 0.04 0.07 0.19
SEQID-02239 I3JU24 -- -- 1 0.47 0.18 0.06 0.04 0.05 0.07 0.01 0.05
0.12 0.03 0.01 0.07 0.07 0.11 SEQID-02240 I3JFQ4 -- -- 1 0.46 0.20
0.04 0.07 0.04 0.06 0.02 0.03 0.09 0.04 0.02 0.05 0.07 0.08
SEQID-02241 I3K6V3 -- -- 0 0.46 0.21 0.05 0.04 0.06 0.09 0.01 0.05
0.09 0.04 0.03 0.04 0.11 0.07 SEQID-02242 I3IXG2 -- -- 1 0.45 0.16
0.03 0.05 0.04 0.04 0.01 0.04 0.10 0.07 0.03 0.04 0.07 0.11
SEQID-02243 I3J8Q1 -- -- 1 0.38 0.17 0.05 0.11 0.04 0.06 0.00 0.08
0.13 0.02 0.02 0.05 0.09 0.06 SEQID-02244 I3JXH4 -- -- 1 0.26 0.10
0.08 0.09 0.04 0.04 0.01 0.03 0.06 0.16 0.02 0.02 0.05 0.05
SEQID-02245 I3J8X4 -- -- 0 0.40 0.18 0.11 0.05 0.07 0.07 0.00 0.03
0.11 0.04 0.01 0.05 0.07 0.09 SEQID-02246 I3KFU1 -- -- 1 0.45 0.18
0.07 0.05 0.04 0.05 0.00 0.07 0.06 0.05 0.04 0.07 0.06 0.08
SEQID-02247 I3KSF9 -- -- 1 0.50 0.22 0.06 0.08 0.04 0.05 0.02 0.04
0.06 0.05 0.03 0.06 0.09 0.06 SEQID-02248 I3JGN1 -- -- 1 0.26 0.09
0.08 0.08 0.02 0.06 0.02 0.04 0.07 0.15 0.01 0.02 0.04 0.05
SEQID-02249 I3JMB4 -- -- 1 0.25 0.09 0.07 0.08 0.02 0.06 0.01 0.04
0.06 0.16 0.01 0.03 0.04 0.05 SEQID-02250 I3KBQ8 -- -- 1 0.45 0.17
0.07 0.06 0.03 0.06 0.01 0.02 0.11 0.07 0.02 0.06 0.05 0.11
SEQID-02251 I3KB11 -- -- 1 0.57 0.28 0.09 0.03 0.04 0.05 0.01 0.03
0.07 0.05 0.05 0.06 0.10 0.10 SEQID-02252 I3KBN9 -- -- 1 0.44 0.18
0.07 0.05 0.04 0.05 0.02 0.03 0.10 0.03 0.01 0.06 0.05 0.12
SEQID-02253 I3JNZ0 -- -- 1 0.48 0.23 0.06 0.08 0.03 0.06 0.02 0.03
0.08 0.04 0.03 0.08 0.07 0.09 SEQID-02254 I3JXF9 -- -- 1 0.53 0.21
0.06 0.06 0.03 0.08 0.01 0.04 0.10 0.01 0.03 0.05 0.10 0.19
SEQID-02255 I3KMQ5 -- -- 1 0.41 0.14 0.04 0.13 0.03 0.07 0.00 0.07
0.07 0.04 0.03 0.04 0.06 0.06 SEQID-02256 I3JQE5 -- -- 1 0.49 0.21
0.05 0.05 0.04 0.08 0.01 0.04 0.06 0.05 0.03 0.08 0.07 0.08
SEQID-02257 I3K5C3 -- -- 1 0.51 0.23 0.06 0.04 0.05 0.06 0.02 0.04
0.08 0.06 0.02 0.07 0.06 0.11 SEQID-02258 I3KL70 -- -- 0 0.42 0.18
0.05 0.11 0.03 0.05 0.00 0.05 0.14 0.04 0.01 0.03 0.07 0.11
SEQID-02259 I3KER1 -- -- 1 0.42 0.20 0.03 0.02 0.02 0.25 0.00 0.02
0.11 0.02 0.04 0.05 0.08 0.05 SEQID-02260 I3KOM4 -- -- 0 0.48 0.25
0.04 0.07 0.01 0.09 0.01 0.04 0.09 0.05 0.01 0.07 0.10 0.14
SEQID-02261 I3J820 -- -- 1 0.50 0.20 0.06 0.08 0.04 0.04 0.01 0.03
0.10 0.04 0.04 0.07 0.08 0.10 SEQID-02262 I3KM40 -- -- 1 0.52 0.20
0.07 0.07 0.03 0.05 0.02 0.04 0.03 0.05 0.01 0.09 0.06 0.10
SEQID-02263 I3K3X8 -- -- 1 0.46 0.19 0.06 0.08 0.04 0.05 0.04 0.06
0.08 0.03 0.06 0.04 0.09 0.08 SEQID-02264 I3IZI3 -- -- 0 0.42 0.17
0.03 0.06 0.03 0.13 0.01 0.03 0.17 0.04 0.00 0.06 0.08 0.06
SEQID-02265 I3IU19 -- -- 1 0.48 0.20 0.05 0.07 0.04 0.08 0.03 0.04
0.09 0.03 0.02 0.07 0.08 0.10 SEQID-02266 I3IY11 -- -- 1 0.50 0.21
0.05 0.06 0.05 0.05 0.01 0.03 0.089 0.05 0.03 0.08 0.06 0.12
SEQID-02267 I3KXA2 -- -- 1 0.45 0.20 0.04 0.06 0.04 0.05 0.02 0.02
0.09 0.03 0.02 0.06 0.06 0.08 SEQID-02268 I3K8C6 -- -- 1 0.51 0.22
0.05 0.07 0.04 0.04 0.01 0.03 0.05 0.04 0.04 0.06 0.10 0.05
SEQID-02269 I3IZN6 -- -- 1 0.46 0.20 0.04 0.08 0.04 0.06 0.02 0.04
0.07 0.04 0.04 0.04 0.10 0.05 SEQID-02270 I3JPF4 -- -- 1 0.46 0.20
0.04 0.05 0.04 0.07 0.01 0.03 0.07 0.06 0.03 0.06 0.05 0.09
SEQID-02271 I3JTN2 -- -- 1 0.44 0.20 0.04 0.05 0.04 0.07 0.01 0.08
0.11 0.02 0.03 0.05 0.11 0.08 SEQID-02272 P60713 -- -- 1 0.47 0.20
0.05 0.07 0.02 0.06 0.01 0.04 0.08 0.04 0.03 0.08 0.07 0.06
SEQID-02273 O138751 -- -- 1 0.46 0.21 0.05 0.10 0.05 0.06 0.01 0.04
0.09 0.03 0.03 0.06 0.09 0.06 SEQID-02274 P14639 -- -- 1 0.46 0.18
0.05 0.06 0.02 0.07 0.06 0.04 0.10 0.01 0.04 0.02 0.11 0.11
SEQID-02275 B2MVW8 -- -- 1 0.50 0.21 0.07 0.08 0.03 0.05 0.01 0.05
0.02 0.05 0.01 0.07 0.08 0.09 SEQID-02276 D7R7V6 -- -- 1 0.53 0.22
0.06 0.04 0.06 0.06 0.01 0.02 0.05 0.05 0.04 0.07 0.06 0.09
SEQID-02277 C8BKC8 -- -- 1 0.47 0.12 0.04 0.04 0.05 0.05 0.10 0.05
0.04 0.03 0.06 0.02 0.03 0.14 SEQID-02278 B7U168 -- -- 1 0.47 0.20
0.07 0.07 0.02 0.03 0.02 0.04 0.06 0.04 0.02 0.03 0.09 0.08
SEQID-02279 B9VGZ8 -- -- 1 0.47 0.16 0.06 0.06 0.05 0.08 0.01 0.05
0.10 0.04 0.01 0.06 0.05 0.10 SEQID-02280 Q9N116 -- -- 1 0.43 0.23
0.05 0.08 0.05 0.06 0.03 0.06 0.08 0.05 0.02 0.07 0.08 0.08
SEQID-02281 Q9BE42 -- -- 0 0.50 0.168 0.06 0.05 0.01 0.08 0.00 0.04
0.15 0.02 0.02 0.02 0.08 0.12 SEQID-02282 B2LU28 -- -- 0 0.40 0.18
0.08 0.07 0.02 0.08 0.00 0.05 0.22 0.00 0.01 0.04 0.11 0.15
SEQID-02283 Q9N109 -- -- 0 0.53 0.30 0.05 0.06 0.06 0.06 0.01 0.07
0.07 0.03 0.02 0.09 0.12 0.09 SEQID-02284 Q9BE43 -- -- 0 0.49 0.14
0.07 0.04 0.02 0.06 0.00 0.04 0.12 0.03 0.02 0.03 0.03 0.12
SEQID-02285 Q9BE44 -- -- 0 0.50 0.15 0.06 0.04 0.02 0.05 0.00 0.04
0.14 0.03 0.02 0.03 0.04 0.12 SEQID-02286 Q9N113 -- -- 0 0.44 0.19
0.08 0.04 0.06 0.08 0.00 0.02 0.09 0.05 0.03 0.06 0.08 0.10
SEQID-02287 P68240 -- -- 0 0.56 0.23 0.08 0.03 0.04 0.07 0.01 0.01
0.03 0.04 0.08 0.00 0.15 0.09 SEQID-02288 Q1A2D1 -- -- 0 0.55 0.23
0.07 0.06 0.06 0.06 0.01 0.03 0.06 0.04 0.08 0.00 0.12 0.08
SEQID-02289 Q9N104 -- -- 0 0.52 0.27 0.09 0.03 0.06 0.04 0.03 0.05
0.05 0.04 0.03 0.10 0.07 0.07 SEQID-02290 B6VCA9 -- -- 0 0.50 0.16
0.05 0.04 0.06 0.08 0.00 0.05 0.12 0.03 0.01 0.05 0.06 0.12
SEQID-02291 B9VGZ5 -- -- 1 0.57 0.32 0.05 0.05 0.03 0.05 0.00 0.04
0.05 0.03 0.02 0.098 0.15 0.10 SEQID-02292 Q7YS10 -- -- 0 0.57 0.28
0.03 0.00 0.03 0.05 0.02 0.09 0.12 0.04 0.03 0.08 0.13 0.12
SEQID-02293 P79395 -- -- 0 0.45 0.19 0.02 0.06 0.07 0.02 0.00 0.02
0.08 0.02 0.04 0.04 0.06 0.10 SEQID-02294 B0FZM4 -- -- 0 0.47 0.21
0.03 0.05 0.06 0.06 0.01 0.04 0.14 0.05 0.03 0.02 0.10 0.07
SEQID-02295 C5IJA8 -- -- 0 0.48 0.22 0.03 0.09 0.02 0.05 0.01 0.04
0.11 0.05 0.01 0.05 0.09 0.11 SEQID-02296 B2MVX2 -- -- 1 0.51 0.22
0.06 0.09 0.03 0.03 0.01 0.04 0.04 0.06 0.01 0.04 0.11 0.06
SEQID-02297 H2DGR2 -- -- 1 0.45 0.21 0.06 0.08 0.05 0.07 0.01 0.05
0.09 0.04 0.02 0.07 0.08 0.09 SEQID-02298 B0LRN3 -- -- 0 0.41 0.19
0.08 0.18 0.01 0.03 0.01 0.07 0.06 0.03 0.02 0.06 0.09 0.10
SEQID-02299 Q35331 -- -- 1 0.44 0.25 0.08 0.11 0.02 0.05 0.02 0.05
0.09 0.05 0.02 0.07 0.08 0.06 SEQID-02300 B2LSM3 -- -- 1 0.38 0.16
0.06 0.12 0.04 0.05 0.01 0.07 0.07 0.04 0.04 0.05 0.07 0.04
SEQID-02301 B6E3I6 -- -- 1 0.54 0.19 0.03 0.05 0.06 0.06 0.01 0.05
0.07 0.03 0.04 0.05 0.11 0.07 SEQID-02302 Q9N102 -- -- 1 0.47 0.16
0.06 0.06 0.05 0.06 0.03 0.05 0.04 0.04 0.03 0.05 0.05 0.08
SEQID-02303 Q5ENY9 -- -- 1 0.48 0.19 0.03 0.11 0.01 0.06 0.00 0.02
0.09 0.02 0.06 0.06 0.08 0.06 SEQID-02304 O78750 -- -- 1 0.56 0.27
0.02 0.04 0.02 0.04 0.01 0.03 0.07 0.02 0.03 0.08 0.14 0.03
SEQID-02305 P29361 -- -- 1 0.39 0.18 0.06 0.07 0.04 0.06 0.01 0.06
0.14 0.02 0.00 0.04 0.10 0.09 SEQID-02306 Q00555 -- -- 1 0.53 0.26
0.03 0.08 0.04 0.04 0.01 0.05 0.06 0.03 0.02 0.08 0.13 0.07
SEQID-02307 B7U9A4 -- -- 1 0.45 0.25 0.06 0.08 0.02 0.05 0.02 0.06
0.07 0.02 0.03 0.04 0.14 0.04 SEQID-02308 Q9M4M9 -- -- 1 0.44 0.22
0.07 0.06 0.05 0.04 0.02 0.05 0.09 0.05 0.01 0.05 0.11 0.09
SEQID-02309 Q02096 -- -- 1 0.47 0.21 0.03 0.05 0.06 0.07 0.03 0.03
0.05 0.05 0.03 0.08 0.07 0.07 SEQID-02310 P19464 -- -- 1 0.50 0.21
0.05 0.05 0.05 0.06 0.01 0.03 0.12 0.03 0.03 0.03 0.10 0.09
SEQID-02311 P24465 -- -- 1 0.52 0.26 0.04 0.08 0.04 0.05 0.01 0.02
0.09 0.03 0.04 0.06 0.14 0.07 SEQID-02312 Q7M224 -- -- 1 0.47 0.20
0.06 0.06 0.04 0.04 0.00 0.05 0.14 0.03 0.02 0.02 0.07 0.11
SEQID-02313 Q9SEK6 -- -- 1 0.47 0.19 0.04 0.08 0.02 0.06 0.01 0.04
0.10 0.02 0.03 0.05 0.09 0.08 SEQID-02314 Q9M4M7 -- -- 1 0.48 0.22
0.04 0.05 0.05 0.06 0.02 0.04 0.06 0.05 0.04 0.05 0.08 0.06
SEQID-02315 P93680 -- -- 1 0.37 0.16 0.07 0.05 0.06 0.04 0.05 0.05
0.02 0.07 0.01 0.05 0.07 0.04 SEQID-02316 Q9M7I8 -- -- 1 0.54 0.21
0.06 0.02 0.02 0.07 0.02 0.03 0.08 0.03 0.06 0.04 0.11 0.10
SEQID-02317 B0FGG5 -- -- 1 0.47 0.22 0.06 0.05 0.03 0.05 0.01 0.02
0.09 0.05 0.03 0.07 0.07 0.09 SEQID-02318 Q68YT2 -- -- 0 0.44 0.06
0.02 0.00 0.04 0.10 0.00 0.13 0.09 0.10 0.10 0.03 0.01 0.21
SEQID-02319 P48686 -- -- 1 0.46 0.19 0.06 0.08 0.03 0.06 0.02 0.03
0.08 0.05 0.04 0.04 0.09 0.06 SEQID-02320 A7XB47 -- -- 1 0.52 0.22
0.06 0.05 0.03 0.06 0.02 0.04 0.08 0.04 0.03 0.07 0.09 0.09
SEQID-02321 Q6DV58 -- -- 1 0.45 0.17 0.06 0.05 0.02 0.05 0.01 0.05
0.08 0.05 0.01 0.03 0.07 0.10 SEQID-02322 Q8GTA0 -- -- 1 0.48 0.17
0.05 0.07 0.03 0.04 0.06 0.02 0.03 0.05 0.10 0.02 0.10 0.03
SEQID-02323 H6TDM4 -- -- 1 0.45 0.18 0.06 0.07 0.02 0.07 0.02 0.04
0.09 0.04 0.05 0.04 0.11 0.07 SEQID-02324 Q9SE87 -- -- 1 0.48 0.25
0.03 0.11 0.03 0.07 0.01 0.08 0.06 0.03 0.02 0.06 0.10 0.06
SEQID-02325 F8U7Z9 -- -- 1 0.42 0.17 0.04 0.07 0.05 0.05 0.02 0.06
0.10 0.04 0.02 0.04 0.07 0.04 SEQID-02326 A7YX85 -- -- 1 0.47 0.21
0.04 0.08 0.03 0.07 0.01 0.03 0.09 0.03 0.03 0.05 0.11 0.07
SEQID-02327 O82795 -- -- 1 0.52 0.23 0.06 0.04 0.04 0.04 0.01 0.03
0.05 0.04 0.01 0.07 0.09 0.08 SEQID-02328 Q50DJU7 -- -- 1 0.49 0.23
0.04 0.07 0.02 0.07 0.02 0.05 0.08 0.03 0.03 0.07 0.11 0.06
SEQID-02329 Q3HYA1 -- -- 1 0.50 0.21 0.04 0.04 0.04 0.04 0.01 0.03
0.08 0.04 0.02 0.05 0.10 0.07 SEQID-02330 Q39366 -- -- 1 0.46 0.21
0.03 0.08 0.04 0.06 0.01 0.03 0.10 0.05 0.01 0.05 0.08 0.08
SEQID-02331 Q6PY61 -- -- 0 0.55 0.10 0.02 0.00 0.02 0.13 0.00 0.01
0.12 0.07 0.18 0.08 0.01 0.26 SEQID-02332 P09678 -- -- 0 0.49 0.21
0.06 0.04 0.07 0.068 0.01 0.02 0.03 0.11 0.08 0.07 0.07 0.03
SEQID-02333 Q944W6 -- -- 1 0.52 0.21 0.03 0.01 0.02 0.07 0.01 0.03
0.13 0.04 0.01 0.05 0.09 0.12 SEQID-02334 Q6ZZ92 -- -- 1 0.47 0.20
0.06 0.07 0.04 0.06 0.01 0.03 0.03 0.06 0.00 0.05 0.11 0.10
SEQID-02335 D9I762 -- -- 1 0.44 0.22 0.06 0.09 0.04 0.05 0.02 0.03
0.09 0.04 0.03 0.07 0.07 0.06 SEQID-02336 I3Y171 -- -- 1 0.47 0.21
0.06 0.09 0.05 0.07 0.01 0.02 0.10 0.02 0.03 0.03 0.12 0.09
SEQID-02337 Q4TU02 -- -- 1 0.46 0.16 0.04 0.05 0.04 0.07 0.00 0.04
0.07 0.07 0.03 0.03 0.05 0.08 SEQID-02338 Q75UU6 -- -- 1 0.47 0.21
0.07 0.04 0.02 0.06 0.01 0.02 0.08 0.06 0.01 0.06 0.08 0.10
SEQID-02339 O82549 -- -- 1 0.46 0.20 0.04 0.08 0.03 0.08 0.01 0.05
0.07 0.04 0.05 0.08 0.07 0.06 SEQID-02340 P56294 -- -- 0 0.42 0.25
0.07 0.08 0.03 0.05 0.00 0.08 0.08 0.04 0.01 0.08 0.10 0.06
SEQID-02341 P56307 -- -- 1 0.51 0.21 0.06 0.08 0.03 0.05 0.01 0.03
0.05 0.06 0.03 0.05 0.09 0.03 SEQID-02342 P56308 -- -- 1 0.52 0.22
0.05 0.06 0.04 0.03 0.01 0.02 0.05 0.07 0.04 0.06 0.10 0.03
SEQID-02343 P56319 -- -- 1 0.55 0.21 0.06 0.06 0.04 0.03 0.01 0.04
0.05 0.05 0.03 0.05 0.11 0.02 SEQID-02344 P56341 -- -- 1 0.56 0.23
0.06 0.04 0.04 0.04 0.00 0.05 0.03 0.05 0.07 0.07 0.11 0.03
SEQID-02345 P56342 -- -- 1 0.55 0.22 0.06 0.04 0.03 0.04 0.01 0.05
0.03 0.05 0.07 0.06 0.12 0.02 SEQID-02346 Q8JIV4 -- -- 0 0.39 0.17
0.06 0.11 0.03 0.06 0.01 0.08 0.18 0.02 0.02 0.02 0.10 0.13
SEQID-02347 Q8JJ07 -- -- 1 0.43 0.13 0.03 0.13 0.03 0.08 0.00 0.05
0.17 0.02 0.03 0.04 0.07 0.19 SEQID-02348 Q98557 -- -- 1 0.51 0.21
0.03 0.09 0.04 0.06 0.01 0.04 0.08 0.05 0.04 0.04 0.10 0.09
SEQID-02349 Q8AWX8 -- -- 1 0.51 0.23 0.06 0.05 0.05 0.07 0.01 0.02
0.06 0.05 0.04 0.08 0.05 0.09 SEQID-02350 A7XA06 -- -- 1 0.50 0.19
0.02 0.08 0.05 0.07 0.02 0.02 0.08 0.04 0.06 0.04 0.11 0.08
SEQID-02351 Q98954 -- -- 1 0.53 0.21 0.04 0.02 0.06 0.06 0.01 0.07
0.08 0.03 0.04 0.09 0.08 0.08 SEQID-02352 Q98559 -- -- 0 0.39 0.16
0.06 0.09 0.05 0.06 0.01 0.10 0.15 0.01 0.03 0.03 0.10 0.13
SEQID-02353 A7XA16 -- -- 1 0.48 0.24 0.04 0.08 0.04 0.06 0.02 0.03
0.07 0.04 0.01 0.06 0.07 0.08 SEQID-02354 Q8QG69 -- -- 1 0.49 0.17
0.10 0.07 0.02 0.09 0.01 0.03 0.10 0.02 0.04 0.04 0.10 0.16
SEQID-02355 A5I873 -- -- 0 0.49 0.18 0.14 0.01 0.00 0.11 0.03 0.02
0.09 0.04 0.00 0.05 0.08 0.13 SEQID-02356 A7XA17 -- -- 1 0.43 0.17
0.04 0.089 0.06 0.05 0.02 0.03 0.07 0.04 0.02 0.08 0.03 0.06
SEQID-02357 A8CZC9 -- -- 1 0.51 0.22 0.05 0.05 0.04 0.06 0.01 0.03
0.07 0.05 0.03 0.08 0.06 0.12 SEQID-02358 Q5XQ56 -- -- 0 0.44 0.21
0.12 0.06 0.01 0.07 0.00 0.07 0.06 0.03 0.05 0.04 0.11 0.06
SEQID-02359 Q92079 -- -- 1 0.44 0.19 0.07 0.04 0.03 0.06 0.04 0.04
0.05 0.06 0.02 0.05 0.07 0.08 SEQID-02360 O98734 -- -- 1 0.41 0.17
0.04 0.08 0.04 0.07 0.01 0.03 0.07 0.04 0.03 0.07 0.07 0.05
SEQID-02361 F22AL7 -- -- 0 0.38 0.23 0.10 0.08 0.05 0.08 0.04 0.01
0.04 0.04 0.00 0.06 0.09 0.05 SEQID-02362 F22AL8 -- -- 1 0.36 0.18
0.10 0.09 0.05 0.07 0.02 0.03 0.07 0.04 0.02 0.03 0.08 0.05
SEQID-02363 I2FJT9 -- -- 0 0.40 0.23 0.10 0.09 0.07 0.07 0.02 0.05
0.05 0.03 0.00 0.03 0.11 0.04 SEQID-02364 Q9IHF8 -- -- 1 0.46 0.21
0.06 0.07 0.04 0.06 0.01 0.05 0.07 0.05 0.03 0.06 0.08 0.05
SEQID-02365 I2FJU0 -- -- 1 0.38 0.18 0.09 0.06 0.05 0.03 0.01 0.05
0.07 0.04 0.01 0.06 0.08 0.04 SEQID-02366 O98733 -- -- 1 0.49 0.24
0.06 0.06 0.06 0.02 0.01 0.03 0.06 0.05 0.03 0.08 0.10 0.00
SEQID-02367 Q6TNX3 -- -- 1 0.56 0.23 0.06 0.03 0.04 0.04 0.00 0.04
0.03 0.06 0.08 0.06 0.13 0.04 SEQID-02368 B3RG69 -- -- 1 0.58 0.24
0.05 0.03 0.05 0.03 0.01 0.04 0.03 0.05 0.08 0.08 0.11 0.03
SEQID-02369 P84527 -- -- 1 0.36 0.15 0.03 0.06 0.08 0.09 0.07 0.03
0.04 0.07 0.04 0.05 0.04 0.06 SEQID-02370 P81370 -- -- 0 0.41 0.14
0.05 0.06 0.09 0.06 0.07 0.05 0.02 0.06 0.00 0.04 0.07 0.05
SEQID-02371 A5HII1 -- -- 1 0.42 0.18 0.04 0.05 0.07 0.05 0.02 0.04
0.07 0.05 0.01 0.06 0.06 0.05 SEQID-02372 Q6TPK4 -- -- 1 0.48 0.27
0.08 0.07 0.05 0.04 0.00 0.06 0.05 0.04 0.02 0.02 0.12 0.06
SEQID-02373 P85524 -- -- 1 0.58 0.26 0.01 0.02 0.03 0.07 0.01 0.02
0.13 0.03 0.02 0.10 0.07 0.10 SEQID-02374 P85076 -- -- 1 0.47 0.20
0.06 0.05 0.06 0.06 0.01 0.04 0.04 0.04 0.01 0.06 0.06 0.06
SEQID-02375 A5HII4 -- -- 1 0.44 0.20 0.03 0.05 0.08 0.06 0.02 0.03
0.06 0.05 0.01 0.06 0.07 0.08 SEQID-02376 P43394 -- -- 1 0.44 0.25
0.04 0.10 0.03 0.05 0.00 0.04 0.06 0.03 0.04 0.07 0.10 0.03
SEQID-02377 Q06AW1 -- -- 1 0.39 0.19 0.04 0.11 0.05 0.04 0.01 0.08
0.09 0.04 0.04 0.06 0.08 0.03 SEQID-02378 Q06AW2 -- -- 1 0.38 0.19
0.04 0.12 0.05 0.03 0.01 0.08 0.09 0.05 0.03 0.06 0.09 0.03
SEQID-02379 Q9IB39 -- -- 0 0.41 0.17 0.10 0.04 0.05 0.07 0.00 0.04
0.12 0.03 0.01 0.04 0.06 0.10 SEQID-02380 Q9IB37 -- -- 1 0.47 0.18
0.06 0.04 0.05 0.07 0.01 0.04 0.13 0.03 0.01 0.07 0.07 0.10
SEQID-02381 Q78CT4 -- -- 0 0.41 0.18 0.07 0.07 0.02 0.08 0.00 0.05
0.23 0.01 0.01 0.04 0.12 0.15 SEQID-02382 B9WPP3 -- -- 1 0.50 0.21
0.05 0.05 0.05 0.05 0.00 0.03 0.08
0.05 0.03 0.06 0.07 0.09 SEQID-02383 P02074 -- -- 0 0.54 0.25 0.08
0.06 0.05 0.05 0.01 0.02 0.07 0.05 0.06 0.00 0.13 0.07 SEQID-02384
G3URG5 -- -- 1 0.45 0.19 0.05 0.08 0.04 0.04 0.01 0.07 0.14 0.02
0.03 0.06 0.10 0.11 SEQID-02385 G3UV20 -- -- 1 0.47 0.19 0.05 0.08
0.04 0.05 0.01 0.08 0.13 0.02 0.03 0.05 0.10 0.12 SEQID-02386
G1MUC5 -- -- 1 0.48 0.19 0.05 0.06 0.05 0.04 0.01 0.05 0.09 0.03
0.03 0.06 0.08 0.10 SEQID-02387 G3US01 -- -- 0 0.40 0.20 0.06 0.10
0.04 0.05 0.00 0.09 0.19 0.01 0.03 0.05 0.11 0.12 SEQID-02388
G1MSQ0 -- -- 1 0.44 0.19 0.05 0.07 0.05 0.06 0.01 0.08 0.14 0.02
0.03 0.04 0.11 0.12 SEQID-02389 G1NIB8 -- -- 1 0.46 0.20 0.05 0.07
0.03 0.06 0.01 0.03 0.09 0.04 0.03 0.09 0.07 0.06 SEQID-02390
G1NNJ7 -- -- 1 0.45 0.19 0.05 0.08 0.04 0.06 0.01 0.07 0.15 0.02
0.02 0.04 0.11 0.12 SEQID-02391 G1MS62 -- -- 1 0.44 0.19 0.06 0.08
0.05 0.05 0.01 0.07 0.15 0.02 0.02 0.04 0.11 0.12 SEQID-02392
G1MUV8 -- -- 1 0.45 0.19 0.05 0.08 0.04 0.06 0.01 0.07 0.14 0.02
0.02 0.05 0.11 0.12 SEQID-02393 G1MT49 -- -- 1 0.52 0.21 0.04 0.06
0.08 0.03 0.01 0.05 0.07 0.03 0.03 0.06 0.10 0.10 SEQID-02394
G1NMR6 -- -- 1 0.52 0.22 0.07 0.05 0.05 0.07 0.01 0.02 0.04 0.05
0.04 0.06 0.06 0.09 SEQID-02395 G3URH1 -- -- 0 0.39 0.20 0.06 0.12
0.04 0.06 0.00 0.09 0.17 0.01 0.02 0.05 0.11 0.11 SEQID-02396
G1MSA4 -- -- 1 0.49 0.22 0.07 0.09 0.03 0.07 0.01 0.03 0.08 0.04
0.04 0.07 0.07 0.08 SEQID-02397 G1NGT5 -- -- 1 0.44 0.19 0.05 0.09
0.05 0.06 0.01 0.07 0.11 0.02 0.03 0.07 0.09 0.07 SEQID-02398
G1NAX6 -- -- 1 0.48 0.21 0.04 0.06 0.03 0.06 0.01 0.03 0.13 0.03
0.02 0.07 0.07 0.12 SEQID-02399 G1N679 -- -- 1 0.57 0.28 0.04 0.04
0.03 0.06 0.01 0.02 0.06 0.04 0.07 0.08 0.10 0.10 SEQID-02400
G1NAN1 -- -- 1 0.47 0.21 0.04 0.06 0.03 0.05 0.02 0.04 0.11 0.03
0.03 0.06 0.07 0.10 SEQID-02401 G1NS52 -- -- 1 0.47 0.20 0.05 0.07
0.02 0.06 0.01 0.04 0.09 0.04 0.03 0.089 0.07 0.06 SEQID-02402
G1NAX9 -- -- 1 0.47 0.20 0.04 0.04 0.03 0.04 0.02 0.04 0.12 0.03
0.02 0.05 0.06 0.11 SEQID-02403 G1NJG2 -- -- 1 0.47 0.18 0.04 0.06
0.04 0.07 0.01 0.05 0.07 0.02 0.04 0.05 0.08 0.12 SEQID-02404
G3UPH8 -- -- 1 0.46 0.20 0.04 0.07 0.04 0.06 0.02 0.03 0.10 0.03
0.04 0.05 0.07 0.08 SEQID-02405 G3UV10 -- -- 1 0.49 0.18 0.05 0.05
0.03 0.05 0.02 0.04 0.06 0.04 0.02 0.12 0.04 0.08 SEQID-02406
G1N3D3 -- -- 1 0.54 0.23 0.06 0.03 0.05 0.06 0.02 0.02 0.08 0.05
0.03 0.06 0.09 0.12 SEQID-02407 G1NJH3 -- -- 1 0.46 0.17 0.06 0.07
0.04 0.09 0.01 0.05 0.06 0.01 0.05 0.06 0.08 0.12 SEQID-02408
G1NJH4 -- -- 1 0.46 0.16 0.05 0.05 0.04 0.08 0.00 0.06 0.06 0.01
0.04 0.05 0.07 0.14 SEQID-02409 H9H166 -- -- 1 0.50 0.22 0.05 0.09
0.04 0.05 0.02 0.02 0.08 0.05 0.04 0.07 0.09 0.07 SEQID-02410
G1NGV6 -- -- 1 0.48 0.21 0.06 0.07 0.05 0.07 0.01 0.03 0.06 0.05
0.03 0.08 0.07 0.08 SEQID-02411 G1MYI4 -- -- 0 0.40 0.18 0.08 0.07
0.02 0.08 0.00 0.05 0.23 0.01 0.01 0.04 0.11 0.15 SEQID-02412
G1NCR2 -- -- 1 0.43 0.18 0.04 0.06 0.03 0.07 0.05 0.05 0.09 0.01
0.02 0.06 0.07 0.10 SEQID-02413 G1NBA6 -- -- 1 0.48 0.20 0.04 0.07
0.04 0.06 0.01 0.04 0.09 0.03 0.03 0.06 0.07 0.09 SEQID-02414
G1N314 -- -- 1 0.54 0.21 0.05 0.04 0.05 0.05 0.01 0.04 0.06 0.04
0.06 0.07 0.09 0.08 SEQID-02415 G1NBW3 -- -- 1 0.49 0.21 0.06 0.09
0.03 0.06 0.01 0.05 0.09 0.03 0.03 0.07 0.09 0.09 SEQID-02416
G1N823 -- -- 1 0.42 0.14 0.06 0.14 0.02 0.07 0.00 0.06 0.14 0.02
0.02 0.05 0.08 0.20 SEQID-02417 G3URJ0 -- -- 1 0.42 0.15 0.06 0.14
0.01 0.06 0.00 0.06 0.15 0.02 0.01 0.04 0.09 0.20 SEQID-02418
G1NAZ1 -- -- 1 0.47 0.21 0.03 0.07 0.03 0.07 0.01 0.02 0.09 0.03
0.02 0.05 0.06 0.10 SEQID-02419 G1NMV8 -- -- 1 0.49 0.24 0.08 0.04
0.02 0.06 0.02 0.05 0.09 0.06 0.04 0.08 0.06 0.10 SEQID-02420
G1NNB7 -- -- 1 0.46 0.20 0.03 0.04 0.02 0.18 0.01 0.02 0.12 0.02
0.02 0.06 0.10 0.08 SEQID-02421 G1MX98 -- -- 1 0.45 0.22 0.06 0.06
0.06 0.07 0.01 0.03 0.08 0.04 0.01 0.06 0.09 0.10 SEQID-02422
G1MWY3 -- -- 1 0.45 0.22 0.04 0.09 0.05 0.06 0.01 0.04 0.09 0.03
0.02 0.07 0.09 0.06 SEQID-02423 G1MXU8 -- -- 1 0.51 0.26 0.05 0.06
0.04 0.05 0.03 0.03 0.09 0.03 0.02 0.08 0.10 0.07 SEQID-02424
G1N5J6 -- -- 1 0.46 0.20 0.04 0.08 0.05 0.05 0.03 0.04 0.07 0.04
0.04 0.06 0.09 0.06 SEQID-02425 G1NGS2 -- -- 1 0.46 0.17 0.04 0.08
0.04 0.07 0.01 0.03 0.07 0.04 0.06 0.05 0.07 0.08 SEQID-02426
G1NK94 -- -- 1 0.45 0.19 0.04 0.07 0.05 0.07 0.01 0.03 0.10 0.03
0.02 0.06 0.06 0.10 SEQID-02427 G1MVK8 -- -- 1 0.44 0.23 0.05 0.09
0.05 0.06 0.01 0.06 0.07 0.05 0.02 0.06 0.09 0.06 SEQID-02428
G1NLT9 -- -- 1 0.45 0.18 0.04 0.08 0.04 0.06 0.01 0.05 0.08 0.02
0.04 0.04 0.09 0.08 SEQID-02429 G1N2A4 -- -- 1 0.43 0.21 0.08 0.07
0.04 0.06 0.02 0.05 0.08 0.04 0.02 0.05 0.09 0.07 SEQID-02430
G1MXB6 -- -- 0 0.49 0.24 0.07 0.06 0.05 0.04 0.02 0.03 0.07 0.05
0.02 0.07 0.10 0.09 SEQID-02431 G1NAR9 -- -- 1 0.39 0.17 0.03 0.07
0.03 0.06 0.01 0.05 0.15 0.04 0.02 0.05 0.09 0.07 SEQID-02432
G1MVB6 -- -- 1 0.49 0.24 0.05 0.07 0.04 0.04 0.02 0.04 0.09 0.03
0.02 0.07 0.09 0.06 SEQID-02433 G1MT65 -- -- 1 0.48 0.21 0.04 0.07
0.03 0.07 0.01 0.04 0.07 0.03 0.02 0.07 0.07 0.11 SEQID-02434
G1N3V6 -- -- 1 0.49 0.21 0.05 0.06 0.04 0.05 0.01 0.03 0.08 0.05
0.02 0.08 0.06 0.11 SEQID-02435 G1NMW0 -- -- 1 0.43 0.22 0.06 0.07
0.05 0.09 0.01 0.03 0.09 0.04 0.02 0.06 0.09 0.07 SEQID-02436
G1NLY5 -- -- 1 0.48 0.23 0.05 0.08 0.04 0.07 0.01 0.03 0.09 0.03
0.04 0.07 0.08 0.08 SEQID-02437 G1N9H8 -- -- 0 0.58 0.25 0.08 0.03
0.03 0.05 0.01 0.02 0.05 0.03 0.09 0.06 0.11 0.10 SEQID-02438
G1N8B8 -- -- 1 0.45 0.17 0.06 0.11 0.03 0.06 0.01 0.05 0.13 0.02
0.03 0.02 0.12 0.16 SEQID-02439 G1MWQ38 -- -- 1 0.42 0.11 0.03 0.06
0.04 0.04 0.11 0.03 0.07 0.03 0.04 0.03 0.03 0.12 SEQID-02440
G1NR17 -- -- 1 0.46 0.20 0.05 0.07 0.05 0.08 0.01 0.05 0.09 0.04
0.01 0.07 0.07 0.10 SEQID-02441 G1NB19 -- -- 1 0.44 0.17 0.03 0.09
0.02 0.04 0.01 0.04 0.11 0.02 0.03 0.05 0.06 0.09 SEQID-02442
PB2013 -- -- 1 0.50 0.19 0.05 0.03 0.06 0.06 0.01 0.02 0.05 0.06
0.01 0.05 0.09 0.11 SEQID-02443 G1N478 -- -- 1 0.44 0.15 0.03 0.07
0.04 0.04 0.00 0.03 0.08 0.06 0.05 0.04 0.07 0.10 SEQID-02444
G1MSQ3 -- -- 1 0.46 0.19 0.06 0.09 0.04 0.05 0.01 0.04 0.06 0.04
0.03 0.06 0.08 0.08 SEQID-02445 G1N0V4 -- -- 1 0.43 0.17 0.07 0.06
0.03 0.04 0.01 0.04 0.11 0.03 0.03 0.05 0.06 0.10 SEQID-02446
G1MSW3 -- -- 1 0.46 0.21 0.05 0.06 0.05 0.07 0.01 0.05 0.09 0.04
0.01 0.07 0.07 0.10 SEQID-02447 H9H1S2 -- -- 0 0.51 0.22 0.05 0.03
0.05 0.03 0.04 0.06 0.08 0.05 0.02 0.06 0.09 0.10 SEQID-02448
Q6W5H1 -- -- 0 0.46 0.17 0.08 0.02 0.05 0.06 0.00 0.04 0.13 0.03
0.01 0.05 0.07 0.13 SEQID-02449 G1MRV9 -- -- 0 0.45 0.23 0.07 0.03
0.02 0.05 0.01 0.07 0.06 0.04 0.02 0.07 0.10 0.07 SEQID-02450
G1N0M3 -- -- 1 0.42 0.21 0.03 0.12 0.05 0.05 0.02 0.04 0.09 0.05
0.03 0.05 0.10 0.06 SEQID-02451 H9H062 -- -- 0 0.47 0.25 0.07 0.07
0.02 0.06 0.00 0.05 0.10 0.05 0.02 0.08 0.09 0.06 SEQID-02452
G3URQ7 -- -- 1 0.45 0.19 0.07 0.03 0.01 0.03 0.00 0.06 0.12 0.02
0.03 0.06 0.04 0.09 SEQID-02453 G1NPZ8 -- -- 1 0.56 0.25 0.07 0.05
0.04 0.05 0.01 0.04 0.04 0.03 0.07 0.05 0.12 0.09 SEQID-02454
G1N3B7 -- -- 1 0.50 0.22 0.06 0.03 0.03 0.05 0.01 0.05 0.03 0.05
0.01 0.08 0.07 0.10 SEQID-02455 G1N8F8 -- -- 1 0.44 0.17 0.05 0.06
0.05 0.05 0.02 0.05 0.10 0.04 0.03 0.03 0.08 0.04 SEQID-02456
G1MV26 -- -- 1 0.47 0.23 0.05 0.09 0.04 0.05 0.02 0.04 0.07 0.05
0.03 0.06 0.10 0.06 SEQID-02457 G1NFA2 -- -- 1 0.49 0.22 0.05 0.07
0.03 0.07 0.02 0.04 0.08 0.04 0.02 0.06 0.09 0.09 SEQID-02458
G1N0S1 -- -- 1 0.47 0.23 0.03 0.07 0.04 0.06 0.02 0.06 0.07 0.03
0.03 0.07 0.11 0.07 SEQID-02459 G1NHY3 -- -- 1 0.48 0.22 0.03 0.06
0.04 0.05 0.02 0.04 0.10 0.03 0.03 0.06 0.11 0.08 SEQID-02460
G1MUC1 -- -- 1 0.47 0.20 0.04 0.06 0.03 0.05 0.02 0.04 0.11 0.03
0.02 0.05 0.08 0.11 SEQID-02461 G1NC68 -- -- 0 0.43 0.26 0.05 0.10
0.03 0.07 0.01 0.04 0.07 0.05 0.01 0.08 0.09 0.06 SEQID-02462
G1NL16 -- -- 1 0.49 0.21 0.03 0.08 0.05 0.09 0.01 0.04 0.07 0.05
0.04 0.04 0.11 0.08 SEQID-02463 G1NFQ5 -- -- 1 0.44 0.20 0.05 0.06
0.04 0.06 0.02 0.04 0.09 0.04 0.04 0.06 0.07 0.05 SEQID-02464
G1N3X9 -- -- 1 0.45 0.21 0.06 0.09 0.03 0.09 0.01 0.04 0.09 0.03
0.02 0.06 0.11 0.09 SEQID-02465 G1MUF1 -- -- 1 0.43 0.21 0.06 0.10
0.04 0.07 0.01 0.04 0.09 0.04 0.02 0.07 0.09 0.06 SEQID-02466
G1MVN4 -- -- 1 0.46 0.20 0.05 0.06 0.04 0.06 0.04 0.05 0.07 0.04
0.02 0.04 0.10 0.09 SEQID-02467 G1NBN7 -- -- 1 0.47 0.23 0.04 0.07
0.03 0.05 0.02 0.06 0.08 0.04 0.04 0.05 0.12 0.06 SEQID-02468
G1N481 -- -- 0 0.46 0.19 0.06 0.03 0.01 0.09 0.01 0.02 0.09 0.05
0.00 0.04 0.10 0.15 SEQID-02469 G1MX59 -- -- 1 0.45 0.17 0.04 0.08
0.01 0.04 0.00 0.03 0.10 0.03 0.03 0.05 0.07 0.07 SEQID-02470
G1NLB3 -- -- 1 0.46 0.22 0.03 0.08 0.05 0.05 0.01 0.05 0.10 0.03
0.03 0.05 0.12 0.08 SEQID-02471 G1N1G2 -- -- 1 0.44 0.21 0.03 0.07
0.04 0.10 0.01 0.06 0.06 0.03 0.02 0.04 0.11 0.10 SEQID-02472
G1N071 -- -- 1 0.51 0.26 0.06 0.05 0.04 0.07 0.01 0.03 0.07 0.03
0.02 0.07 0.10 0.11 SEQID-02473 G1NB81 -- -- 1 0.48 0.19 0.04 0.08
0.05 0.05 0.01 0.05 0.05 0.04 0.02 0.04 0.09 0.06 SEQID-02474
G1MZD9 -- -- 1 0.45 0.21 0.05 0.08 0.04 0.08 0.01 0.04 0.09 0.03
0.01 0.07 0.10 0.11 SEQID-02475 G1NL53 -- -- 1 0.50 0.23 0.04 0.06
0.04 0.06 0.01 0.05 0.08 0.06 0.03 0.07 0.08 0.09 SEQID-02476
G1NAW6 -- -- 1 0.50 0.25 0.03 0.09 0.04 0.06 0.01 0.05 0.09 0.03
0.01 0.08 0.10 0.06 SEQID-02477 G1NB27 -- -- 1 0.40 0.16 0.05 0.07
0.06 0.05 0.01 0.09 0.07 0.03 0.03 0.04 0.08 0.08 SEQID-02478
G1NCE0 -- -- 1 0.48 0.23 0.06 0.07 0.04 0.04 0.01 0.05 0.07 0.04
0.02 0.06 0.11 0.06 SEQID-02479 G1NGS1 -- -- 1 0.45 0.18 0.05 0.04
0.04 0.06 0.02 0.05 0.10 0.03 0.02 0.04 0.09 0.10 SEQID-02480
G1NKX1 -- -- 1 0.47 0.20 0.03 0.06 0.04 0.07 0.01 0.04 0.15 0.02
0.02 0.06 0.09 0.12 SEQID-02481 G1NRH0 -- -- 0 0.51 0.16 0.06 0.038
0.02 0.02 0.00 0.03 0.06 0.03 0.04 0.06 0.05 0.18 SEQID-02482
G1NQ36 -- -- 0 0.48 0.20 0.04 0.06 0.04 0.06 0.02 0.03 0.13 0.04
0.03 0.08 0.06 0.09 SEQID-02483 G1MK52 -- -- 1 0.40 0.20 0.05 0.06
0.06 0.06 0.01 0.05 0.13 0.02 0.02 0.04 0.10 0.08 SEQID-02484
G1NCP5 -- -- 1 0.43 0.15 0.04 0.06 0.05 0.03 0.02 0.05 0.16 0.02
0.01 0.05 0.06 0.10 SEQID-02485 G1MZ49 -- -- 0 0.48 0.25 0.04 0.07
0.07 0.06 0.02 0.03 0.07 0.02 0.02 0.07 0.14 0.07 SEQID-02486
G1NGA7 -- -- 1 0.50 0.21 0.06 0.06 0.02 0.02 0.02 0.04 0.06 0.04
0.01 0.05 0.09 0.08 SEQID-02487 G1NLA9 -- -- 1 0.48 0.21 0.06 0.04
0.05 0.05 0.02 0.05 0.08 0.03 0.03 0.06 0.09 0.10 SEQID-02488
G1NAL4 -- -- 1 0.44 0.18 0.06 0.06 0.02 0.04 0.04 0.05 0.11 0.04
0.03 0.05 0.07 0.08 SEQID-02489 G1NCM2 -- -- 1 0.50 0.21 0.06 0.06
0.04 0.05 0.01 0.05 0.11 0.02 0.02 0.04 0.12 0.11 SEQID-02490
G1NP43 -- -- 1 0.39 0.16 0.04 0.12 0.04 0.07 0.01 0.04 0.07 0.06
0.02 0.05 0.08 0.05 SEQID-02491 G1NMS8 -- -- 1 0.48 0.23 0.07 0.06
0.03 0.05 0.01 0.06 0.06 0.05 0.02 0.06 0.09 0.10 SEQID-02492
G1MSI1 -- -- 1 0.38 0.18 0.04 0.09 0.03 0.07 0.02 0.05 0.08 0.08
0.01 0.06 0.07 0.07 SEQID-02493 G1NP96 -- -- 1 0.46 0.22 0.04 0.07
0.04 0.07 0.02 0.06 0.08 0.02 0.03 0.06 0.11 0.07 SEQID-02494
P07728 -- -- 1 0.35 0.19 0.04 0.11 0.07 0.03 0.02 0.12 0.06 0.04
0.02 0.05 0.08 0.03 SEQID-02495 P07730 -- -- 1 0.37 0.19 0.04 0.11
0.07 0.03 0.02 0.12 0.06 0.04 0.02 0.05 0.08 0.03 SEQID-02496
P14323 -- -- 1 0.38 0.19 0.04 0.09 0.07 0.02 0.01 0.12 0.06 0.03
0.03 0.05 0.07 0.04 SEQID-02497 Q02897 -- -- 1 0.38 0.18 0.04 0.09
0.07 0.02 0.01 0.12 0.06 0.03 0.02 0.05 0.07 0.04 SEQID-02498
P14614 -- -- 1 0.38 0.19 0.05 0.10 0.08 0.02 0.01 0.12 0.07 0.04
0.03 0.05 0.09 0.03 SEQID-02499 Q09151 -- -- 1 0.39 0.20 0.04 0.10
0.06 0.05 0.02 0.12 0.05 0.04 0.03 0.05 0.08 0.03 SEQID-02500
Q01401 -- -- 1 0.46 0.17 0.04 0.08 0.05 0.07 0.01 0.02 0.07 0.04
0.05 0.04 0.07 0.07 SEQID-02501 Q6K508 -- -- 1 0.40 0.21 0.05 0.11
0.06 0.04 0.01 0.11 0.06 0.04 0.03 0.06 0.08 0.04 SEQID-02502
Q6K7K6 -- -- 1 0.42 0.20 0.05 0.10 0.05 0.04 0.01 0.11 0.06 0.03
0.04 0.05 0.09 0.03 SEQID-02503 Q0E2G5 -- -- 1 0.41 0.20 0.04 0.10
0.09 0.02 0.01 0.10 0.06 0.04 0.03 0.07 0.08 0.05 SEQID-02504
Q6H6P8 -- -- 1 0.43 0.17 0.05 0.08 0.04 0.07 0.01 0.02 0.07 0.05
0.04 0.04 0.07 0.05 SEQID-02505 Q7X834 -- -- 1 0.44 0.21 0.05 0.08
0.05 0.08 0.01 0.04 0.05 0.04 0.04 0.05 0.08 0.04 SEQID-02506
Q0DEV5 -- -- 1 0.45 0.21 0.07 0.08 0.04 0.06 0.02 0.03 0.07 0.05
0.02 0.05 0.08 0.08 SEQID-02507 Q6AVA8 -- -- 1 0.45 0.21 0.07 0.09
0.03 0.05 0.02 0.04 0.09 0.05 0.03 0.04 0.09 0.06
SEQID-02508 Q43009 -- -- 1 0.49 0.22 0.04 0.08 0.04 0.04 0.01 0.04
0.09 0.03 0.05 0.06 0.11 0.06 SEQID-02509 Q5VNT5 -- -- 1 0.46 0.21
0.04 0.07 0.04 0.07 0.02 0.04 0.07 0.04 0.03 0.09 0.07 0.06
SEQID-02510 P15280 -- -- 1 0.43 0.22 0.06 0.08 0.05 0.07 0.01 0.03
0.06 0.04 0.02 0.08 0.08 0.06 SEQID-02511 P30298 -- -- 1 0.48 0.22
0.04 0.07 0.04 0.06 0.01 0.04 0.08 0.03 0.04 0.06 0.11 0.06
SEQID-02512 Q10LP5 -- -- 1 0.47 0.23 0.04 0.08 0.04 0.05 0.01 0.04
0.08 0.03 0.04 0.07 0.10 0.06 SEQID-02513 Q0DI45 -- -- 1 0.38 0.25
0.08 0.06 0.04 0.03 0.01 0.20 0.01 0.02 0.01 0.06 0.13 0.01
SEQID-02514 Q9AUv8 -- -- 1 0.47 0.21 0.05 0.07 0.05 0.06 0.01 0.03
0.10 0.04 0.03 0.06 0.08 0.08 SEQID-02515 Q6Z7B0 -- -- 1 0.46 0.22
0.05 0.07 0.05 0.07 0.01 0.04 0.12 0.05 0.01 0.07 0.08 0.11
SEQID-02516 P37833 -- -- 1 0.46 0.22 0.06 0.08 0.03 0.05 0.01 0.05
0.05 0.04 0.03 0.06 0.10 0.05 SEQID-02517 Q6K5G8 -- -- 1 0.52 0.22
0.06 0.05 0.04 0.07 0.01 0.02 0.07 0.04 0.03 0.06 0.06 0.10
SEQID-02518 Q6Z7B2 -- -- 1 0.44 0.22 0.09 0.11 0.02 0.02 0.02 0.01
0.09 0.05 0.02 0.04 0.09 0.06 SEQID-02519 Q75GX9 -- -- 1 0.33 0.16
0.06 0.18 0.03 0.05 0.01 0.06 0.13 0.04 0.03 0.04 0.07 0.04
SEQID-02520 Q2QV45 -- -- 1 0.46 0.22 0.07 0.06 0.04 0.09 0.01 0.05
0.08 0.05 0.01 0.05 0.08 0.09 SEQID-02521 Q84Q83 -- -- 1 0.44 0.19
0.04 0.08 0.05 0.05 0.01 0.05 0.07 0.07 0.03 0.04 0.08 0.06
SEQID-02522 O64937 -- -- 1 0.52 0.21 0.04 0.06 0.04 0.06 0.01 0.02
0.08 0.04 0.03 0.07 0.06 0.13 SEQID-02523 Q6T725 -- -- 1 0.40 0.20
0.03 0.09 0.07 0.03 0.01 0.11 0.07 0.03 0.03 0.06 0.08 0.03
SEQID-02524 P29835 -- -- 0 0.26 0.12 0.06 0.16 0.00 0.03 0.04 0.13
0.10 0.04 0.00 0.02 0.06 0.01 SEQID-02525 Q5N725 -- -- 1 0.46 0.22
0.07 0.05 0.04 0.04 0.02 0.04 0.10 0.05 0.02 0.05 0.10 0.10
SEQID-02526 Q6ZBH2 -- -- 1 0.47 0.24 0.08 0.10 0.02 0.05 0.03 0.01
0.10 0.06 0.04 0.05 0.07 0.05 SEQID-02527 Q338N8 -- -- 1 0.42 0.23
0.07 0.06 0.05 0.05 0.02 0.06 0.07 0.04 0.02 0.08 0.10 0.07
SEQID-02528 Q53LQ0 -- -- 1 0.48 0.20 0.07 0.03 0.03 0.08 0.01 0.03
0.11 0.03 0.02 0.05 0.08 0.12 SEQID-02529 Q01B82 -- -- 1 0.39 0.20
0.07 0.11 0.03 0.06 0.06 0.04 0.04 0.06 0.05 0.03 0.08 0.02
SEQID-02530 Q7FAH2 -- -- 1 0.51 0.22 0.06 0.05 0.04 0.08 0.01 0.02
0.07 0.04 0.02 0.06 0.06 0.10 SEQID-02531 Q852L2 -- -- 1 0.38 0.17
0.05 0.14 0.02 0.03 0.01 0.03 0.13 0.05 0.04 0.03 0.07 0.04
SEQID-02532 Q6H4L2 -- -- 1 0.48 0.21 0.05 0.07 0.03 0.06 0.02 0.04
0.09 0.04 0.02 0.05 0.08 0.08 SEQID-02533 P35683 -- -- 1 0.46 0.23
0.093 0.10 0.03 0.08 0.01 0.07 0.08 0.04 0.02 0.06 0.09 0.05
SEQID-02534 Q6Z2Z4 -- -- 1 0.46 0.23 0.03 0.10 0.03 0.08 0.01 0.07
0.07 0.04 0.02 0.06 0.10 0.05 SEQID-02535 Q6H6C7 -- -- 1 0.53 0.26
0.09 0.03 0.02 0.07 0.00 0.01 0.08 0.05 0.01 0.05 0.12 0.12
SEQID-02536 Q7XTK1 -- -- 1 0.48 0.22 0.05 0.07 0.03 0.06 0.02 0.04
0.09 0.04 0.02 0.05 0.08 0.08 SEQID-02537 P20698 -- -- 1 0.40 0.20
0.07 0.04 0.02 0.01 0.05 0.22 0.01 0.01 0.02 0.06 0.08 0.01
SEQID-02538 Q2QXY9 -- -- 1 0.43 0.21 0.08 0.09 0.03 0.06 0.01 0.03
0.08 0.04 0.04 0.07 0.07 0.05 SEQID-02539 Q93X08 -- -- 1 0.51 0.26
0.04 0.04 0.07 0.06 0.01 0.03 0.08 0.04 0.02 0.07 0.11 0.10
SEQID-02540 Q8H4L8 -- -- 1 0.38 0.21 0.08 0.12 0.03 0.05 0.06 0.05
0.04 0.05 0.03 0.05 0.07 0.02 SEQID-02541 Q655T1 -- -- 1 0.53 0.26
0.07 0.03 0.02 0.07 0.00 0.01 0.07 0.05 0.01 0.06 0.12 0.12
SEQID-02542 Q0J8A4 -- -- 1 0.52 0.23 0.06 0.05 0.04 0.08 0.01 0.01
0.05 0.04 0.02 0.08 0.06 0.10 SEQID-02543 Q69T99 -- -- 1 0.43 0.22
0.07 0.09 0.05 0.06 0.01 0.03 0.07 0.04 0.02 0.09 0.07 0.06
SEQID-02544 Q653V7 -- -- 1 0.45 0.21 0.06 0.10 0.04 0.06 0.00 0.02
0.09 0.06 0.03 0.03 0.10 0.03 SEQID-02545 Q01881 -- -- 1 0.36 0.20
0.09 0.13 0.02 0.05 0.06 0.04 0.04 0.05 0.03 0.02 0.09 0.01
SEQID-02546 Q8H4M4 -- -- 1 0.42 0.20 0.07 0.10 0.01 0.05 0.06 0.05
0.02 0.05 0.02 0.03 0.08 0.04 SEQID-02547 Q6ZIX4 -- -- 1 0.41 0.26
0.06 0.04 0.03 0.01 0.03 0.22 0.01 0.01 0.02 0.07 0.11 0.01
SEQID-02548 Q10P83 -- -- 1 0.48 0.25 0.04 0.09 0.05 0.06 0.01 0.04
0.06 0.04 0.02 0.07 0.10 0.07 SEQID-02549 Q10DV7 -- -- 1 0.47 0.21
0.05 0.07 0.02 0.06 0.01 0.03 0.08 0.04 0.03 0.08 0.07 0.06
SEQID-02550 Q7X8H9 -- -- 1 0.37 0.20 0.10 0.10 0.02 0.06 0.06 0.04
0.04 0.07 0.02 0.03 0.08 0.02 SEQID-02551 Q0J4C6 -- -- 1 0.45 0.17
0.04 0.06 0.05 0.06 0.02 0.02 0.07 0.05 0.04 0.04 0.08 0.04
SEQID-02552 A1YQF0 -- -- 1 0.37 0.25 0.08 0.06 0.05 0.03 0.00 0.19
0.01 0.02 0.02 0.06 0.15 0.01 SEQID-02553 Q5Z9M9 -- -- 1 0.37 0.16
0.06 0.06 0.02 0.01 0.08 0.20 0.02 0.02 0.02 0.03 0.07 0.02
SEQID-02554 P17048 -- -- 1 0.41 0.24 0.06 0.04 0.03 0.01 0.03 0.22
0.01 0.01 0.02 0.07 0.10 0.01 SEQID-02555 Q5Z627 -- -- 1 0.50 0.19
0.04 0.04 0.05 0.05 0.01 0.02 0.10 0.03 0.01 0.04 0.09 0.11
SEQID-02556 Q65XV6 -- -- 1 0.50 0.21 0.07 0.07 0.04 0.07 0.02 0.00
0.05 0.07 0.04 0.08 0.06 0.09 SEQID-02557 Q7X7E6 -- -- 1 0.35 0.19
0.11 0.11 0.02 0.06 0.06 0.03 0.05 0.06 0.02 0.03 0.08 0.02
SEQID-02558 Q8GVK7 -- -- 0 0.40 0.28 0.07 0.06 0.05 0.03 0.01 0.19
0.01 0.02 0.02 0.07 0.15 0.01 SEQID-02559 Q0DJ38 -- -- 1 0.39 0.25
0.06 0.05 0.04 0.03 0.01 0.18 0.01 0.02 0.01 0.06 0.16 0.01
SEQID-02560 Q75HX0 -- -- 1 0.46 0.21 0.04 0.07 0.02 0.06 0.01 0.03
0.08 0.04 0.03 0.07 0.07 0.06 SEQID-02561 Q0JKM8 -- -- 1 0.46 0.22
0.07 0.06 0.04 0.05 0.02 0.06 0.05 0.06 0.03 0.06 0.098 0.06
SEQID-02562 Q7XDC8 -- -- 1 0.47 0.24 0.07 0.05 0.05 0.05 0.02 0.04
0.07 0.04 0.02 0.06 0.09 0.07 SEQID-02563 Q5W6C5 -- -- 1 0.42 0.19
0.06 0.08 0.04 0.06 0.01 0.04 0.04 0.04 0.03 0.03 0.10 0.04
SEQID-02564 Q10M12 -- -- 1 0.45 0.15 0.04 0.07 0.06 0.07 0.02 0.04
0.07 0.06 0.07 0.04 0.05 0.06 SEQID-02565 Q6YW46 -- -- 1 0.49 0.18
0.05 0.04 0.05 0.05 0.01 0.02 0.10 0.03 0.01 0.04 0.08 0.12
SEQID-02566 Q9AUQ4 -- -- 1 0.48 0.21 0.06 0.05 0.04 0.08 0.01 0.03
0.06 0.05 0.02 0.05 0.07 0.08 SEQID-02567 Q01883 -- -- 1 0.36 0.19
0.08 0.12 0.02 0.05 0.06 0.05 0.04 0.05 0.04 0.02 0.09 0.01
SEQID-02568 Q0JDG9 -- -- 1 0.41 0.24 0.07 0.08 0.04 0.05 0.01 0.04
0.07 0.07 0.01 0.05 0.12 0.03 SEQID-02569 P49027 -- -- 1 0.47 0.23
0.04 0.06 0.05 0.07 0.02 0.03 0.04 0.06 0.03 0.05 0.10 0.05
SEQID-02570 Q0ISV7 -- -- 1 0.486 0.22 0.05 0.07 0.03 0.06 0.02 0.03
0.08 0.04 0.02 0.06 0.09 0.08 SEQID-02571 Q0DUA3 -- -- 1 0.38 0.15
0.04 0.13 0.03 0.05 0.01 0.04 0.16 0.05 0.04 0.04 0.05 0.07
SEQID-02572 Q53NM9 -- -- 1 0.45 0.21 0.06 0.07 0.05 0.08 0.01 0.05
0.09 0.04 0.01 0.08 0.07 0.09 SEQID-02573 Q07078 -- -- 1 0.49 0.20
0.03 0.05 0.04 0.07 0.01 0.03 0.14 0.02 0.02 0.06 0.09 0.13
SEQID-02574 Q42465 -- -- 1 0.41 0.26 0.08 0.05 0.05 0.03 0.01 0.18
0.01 0.02 0.02 0.07 0.14 0.01 SEQID-02575 P48494 -- -- 1 0.49 0.25
0.07 0.05 0.04 0.05 0.02 0.05 0.09 0.05 0.01 0.06 0.07 0.08
SEQID-02576 Q2QNF3 -- -- 1 0.43 0.17 0.07 0.15 0.04 0.03 0.01 0.03
0.03 0.07 0.07 0.05 0.04 0.08 SEQID-02577 Q948T6 -- -- 1 0.47 0.21
0.05 0.05 0.02 0.07 0.02 0.02 0.09 0.04 0.01 0.05 0.10 0.11
SEQID-02578 Q9ZRI7 -- -- 1 0.49 0.17 0.06 0.04 0.05 0.05 0.01 0.02
0.10 0.03 0.01 0.04 0.08 0.12 SEQID-02579 Q42971 -- -- 1 0.45 0.22
0.07 0.04 0.06 0.06 0.01 0.05 0.08 0.05 0.01 0.06 0.08 0.10
SEQID-02580 Q0DEC8 -- -- 1 0.44 0.20 0.05 0.08 0.03 0.06 0.01 0.04
0.07 0.05 0.03 0.04 0.09 0.05 SEQID-02581 Q0DDE3 -- -- 1 0.39 0.19
0.07 0.10 0.03 0.09 0.01 0.03 0.07 0.05 0.03 0.03 0.07 0.05
SEQID-02582 Q07661 -- -- 1 0.47 0.20 0.05 0.09 0.03 0.05 0.00 0.03
0.089 0.05 0.02 0.09 0.05 0.06 SEQID-02583 Q0D868 -- -- 1 0.46 0.19
0.09 0.13 0.04 0.03 0.00 0.02 0.06 0.04 0.03 0.04 0.08 0.11
SEQID-02584 Q7XC37 -- -- 1 0.51 0.23 0.05 0.07 0.03 0.03 0.00 0.03
0.10 0.05 0.02 0.03 0.06 0.08 SEQID-02585 Q6ZKC0 -- -- 1 0.43 0.20
0.07 0.07 0.03 0.06 0.01 0.03 0.15 0.03 0.02 0.05 0.11 0.09
SEQID-02586 Q7XTE8 -- -- 1 0.41 0.20 0.06 0.08 0.03 0.06 0.01 0.03
0.15 0.02 0.01 0.06 0.10 0.08 SEQID-02587 Q65XA1 -- -- 1 0.49 0.23
0.06 0.05 0.04 0.05 0.01 0.03 0.06 0.06 0.02 0.06 0.10 0.07
SEQID-02588 Q0DJB9 -- -- 1 0.47 0.23 0.06 0.04 0.03 0.10 0.00 0.05
0.09 0.05 0.01 0.05 0.10 0.10 SEQID-02589 Q0DBN4 -- -- 1 0.45 0.18
0.07 0.09 0.03 0.05 0.02 0.04 0.06 0.04 0.04 0.06 0.08 0.06
SEQID-02590 Q2QVC1 -- -- 1 0.44 0.22 0.07 0.07 0.03 0.05 0.01 0.02
0.09 0.05 0.03 0.06 0.09 0.08 SEQID-02591 P0C522 -- -- 0 0.42 0.25
0.07 0.09 0.04 0.05 0.01 0.06 0.08 0.04 0.01 0.07 0.10 0.06
SEQID-02592 Q01859 -- -- 0 0.44 0.24 0.07 0.09 0.03 0.05 0.00 0.05
0.08 0.05 0.03 0.06 0.10 0.05 SEQID-02593 Q0J1E1 -- -- 1 0.47 0.23
0.07 0.07 0.03 0.06 0.02 0.03 0.05 0.05 0.04 0.07 0.09 0.07
SEQID-02594 Q2QLY4 -- -- 1 0.48 0.22 0.07 0.06 0.04 0.06 0.01 0.03
0.08 0.03 0.02 0.06 0.09 0.08 SEQID-02595 Q6YZX6 -- -- 1 0.48 0.22
0.05 0.05 0.05 0.06 0.01 0.03 0.07 0.05 0.03 0.05 0.09 0.07
SEQID-02596 Q0DKN6 -- -- 1 0.37 0.20 0.07 0.06 0.04 0.08 0.00 0.04
0.14 0.04 0.01 0.04 0.09 0.07 SEQID-02597 P0C030 -- -- 0 0.50 0.26
0.03 0.07 0.02 0.08 0.00 0.07 0.10 0.04 0.02 0.11 0.11 0.11
SEQID-02598 P35681 -- -- 1 0.49 0.21 0.03 0.02 0.02 0.12 0.01 0.05
0.09 0.05 0.01 0.04 0.10 0.11 SEQID-02599 Q8H920 -- -- 1 0.44 0.21
0.17 0.09 0.02 0.02 0.02 0.03 0.03 0.07 0.04 0.01 0.16 0.01
SEQID-02600 P29421 -- -- 1 0.39 0.21 0.06 0.12 0.01 0.05 0.02 0.02
0.06 0.05 0.03 0.03 0.10 0.03 SEQID-02601 Q6YTY2 -- -- 1 0.47 0.23
0.05 0.11 0.03 0.04 0.01 0.03 0.08 0.04 0.02 0.06 0.09 0.09
SEQID-02602 Q10QU9 -- -- 1 0.41 0.18 0.11 0.07 0.03 0.07 0.01 0.03
0.06 0.04 0.02 0.06 0.06 0.03 SEQID-02603 Q0DS36 -- -- 1 0.45 0.18
0.06 0.07 0.03 0.04 0.01 0.03 0.10 0.06 0.02 0.03 0.07 0.09
SEQID-02604 Q9SXP2 -- -- 1 0.47 0.22 0.07 0.07 0.04 0.06 0.01 0.03
0.07 0.05 0.04 0.06 0.09 0.08 SEQID-02605 Q5W6H1 -- -- 1 0.50 0.23
0.06 0.04 0.04 0.07 0.02 0.03 0.10 0.03 0.03 0.06 0.08 0.13
SEQID-02606 P35684 -- -- 1 0.54 0.18 0.03 0.10 0.01 0.04 0.02 0.04
0.06 0.04 0.05 0.05 0.06 0.15 SEQID-02607 Q6ZK46 -- -- 1 0.33 0.18
0.07 0.18 0.04 0.06 0.01 0.05 0.09 0.05 0.02 0.04 0.07 0.02
SEQID-02608 Q6ZHC3 -- -- 1 0.42 0.20 0.07 0.08 0.03 0.04 0.02 0.06
0.10 0.03 0.02 0.07 0.08 0.07 SEQID-02609 Q6SXK0 -- -- 1 0.45 0.21
0.08 0.07 0.03 0.05 0.01 0.03 0.08 0.04 0.03 0.06 0.08 0.06
SEQID-02610 Q67IX6 -- -- 1 0.47 0.21 0.07 0.04 0.04 0.10 0.01 0.03
0.09 0.02 0.03 0.05 0.10 0.09 SEQID-02611 Q6H547 -- -- 1 0.41 0.20
0.06 0.10 0.03 0.06 0.01 0.05 0.09 0.04 0.01 0.05 0.08 0.07
SEQID-02612 P0C5C9 -- -- 1 0.48 0.20 0.05 0.06 0.03 0.10 0.01 0.02
0.05 0.05 0.04 0.05 0.07 0.10 SEQID-02613 Q0DKF0 -- -- 1 0.44 0.17
0.06 0.15 0.03 0.04 0.C3 0.03 0.05 0.04 0.04 0.04 0.06 0.11
SEQID-02614 P35685 -- -- 1 0.54 0.22 0.06 0.10 0.03 0.03 0.01 0.04
0.07 0.03 0.02 0.04 0.10 0.18 SEQID-02615 Q8L4L4 -- -- 0 0.42 0.16
0.06 0.11 0.03 0.08 0.00 0.04 0.08 0.04 0.03 0.04 0.08 0.10
SEQID-02616 Q6Z4N6 -- -- 1 0.49 0.17 0.04 0.06 0.06 0.07 0.02 0.03
0.06 0.04 0.06 0.04 0.06 0.08 SEQID-02617 Q7XHN4 -- -- 1 0.43 0.20
0.06 0.07 0.05 0.06 0.02 0.05 0.03 0.05 0.02 0.05 0.07 0.05
SEQID-02618 Q6F2Y7 -- -- 1 0.43 0.25 0.07 0.12 0.02 0.07 0.00 0.05
0.11 0.04 0.03 0.05 0.12 0.07 SEQID-02619 Q8GVI3 -- -- 1 0.35 0.20
0.11 0.12 0.01 0.04 0.07 0.02 0.07 0.04 0.02 0.02 0.15 0.02
SEQID-02620 P27777 -- -- 1 0.47 0.20 0.04 0.09 0.05 0.07 0.00 0.02
0.11 0.02 0.02 0.03 0.05 0.11 SEQID-02621 Q53NL5 -- -- 1 0.41 0.18
0.09 0.09 0.03 0.08 0.01 0.03 0.04 0.06 0.04 0.04 0.10 0.04
SEQID-02622 P41095 -- -- 0 0.49 0.25 0.06 0.04 0.04 0.06 0.01 0.02
0.09 0.04 0.01 0.06 0.10 0.11 SEQID-02623 Q8H916 -- -- 1 0.44 0.19
0.05 0.09 0.05 0.07 0.00 0.03 0.07 0.03 0.03 0.06 0.09 0.06
SEQID-02624 Q4W8D0 -- -- 1 0.42 0.18 0.05 0.08 0.05 0.07 0.01 0.03
0.06 0.06 0.04 0.07 0.05 0.06 SEQID-02625 Q9LD54 -- -- 1 0.47 0.23
0.07 0.08 0.03 0.03 0.01 0.04 0.06 0.06 0.02 0.04 0.12 0.07
SEQID-02626 P46265 -- -- 1 0.43 0.17 0.04 0.07 0.05 0.07 0.02 0.05
0.09 0.04 0.03 0.04 0.08 0.04 SEQID-02627 Q53M52 -- -- 1 0.43 0.21
0.04 0.07 0.04 0.07 0.02 0.04 0.09 0.04 0.03 0.05 0.09 0.05
SEQID-02628 Q10R45 -- -- 1 0.45 0.22 0.06 0.07 0.04 0.04 0.01 0.04
0.07 0.06 0.03 0.05 0.10 0.07 SEQID-02629 Q69P84 -- -- 1 0.46 0.24
0.06 0.07 0.05 0.03 0.02 0.05 0.07 0.06 0.02 0.09 0.09 0.04
SEQID-02630 Q33AE4 -- -- 1 0.45 0.21 0.06 0.08 0.04 0.08 0.00 0.03
0.05 0.05 0.02 0.06 0.09 0.07 SEQID-02631 Q0JCZ5 -- -- 1 0.47 0.19
0.04 0.10 0.03 0.05 0.01 0.03 0.11 0.03 0.01 0.05 0.08 0.10
SEQID-02632 Q9FWV2 -- -- 1 0.44 0.24 0.08 0.07 0.03 0.06 0.01 0.05
0.10 0.03 0.01 0.06 0.12 0.09 SEQID-02633 P31674 -- -- 0 0.48 0.20
0.05 0.13 0.02 0.05 0.00 0.03 0.07
0.04 0.03 0.06 0.07 0.12 SEQID-02634 Q84Q77 -- -- 1 0.44 0.16 0.04
0.09 0.03 0.07 0.00 0.04 0.11 0.04 0.02 0.05 0.05 0.10 SEQID-02635
Q0JBY8 -- -- 1 0.53 0.17 0.04 0.11 0.04 0.01 0.03 0.03 0.04 0.05
0.04 0.08 0.04 0.16 SEQID-02636 Q8H590 -- -- 1 0.51 0.20 0.03 0.16
0.05 0.07 0.01 0.04 0.04 0.04 0.03 0.04 0.10 0.12 SEQID-02637
Q6K1W6 -- -- 1 0.41 0.16 0.07 0.14 0.05 0.03 0.01 0.05 0.07 0.03
0.04 0.05 0.06 0.11 SEQID-02638 P49199 -- -- 1 0.43 0.16 0.06 0.14
0.04 0.04 0.01 0.06 0.07 0.05 0.02 0.03 0.07 0.14 SEQID-02639
Q40680 -- -- 1 0.44 0.21 0.07 0.03 0.03 0.11 0.00 0.02 0.05 0.03
0.01 0.04 0.09 0.09 SEQID-02640 Q7GD79 -- -- 1 0.48 0.20 0.05 0.06
0.05 0.07 0.02 0.05 0.07 0.03 0.04 0.05 0.08 0.09 SEQID-02641
Q0JDZ7 -- -- 1 0.43 0.16 0.06 0.14 0.04 0.04 0.01 0.06 0.07 0.05
0.02 0.03 0.07 0.14 SEQID-02642 Q8LH97 -- -- 0 0.45 0.17 0.05 0.16
0.03 0.06 0.01 0.05 0.08 0.04 0.00 0.04 0.08 0.16 SEQID-02643
Q6K8B8 -- -- 1 0.51 0.20 0.04 0.10 0.03 0.06 0.01 0.05 0.07 0.03
0.01 0.06 0.07 0.14 SEQID-02644 Q84M35 -- -- 1 0.49 0.20 0.04 0.13
0.02 0.03 0.01 0.03 0.07 0.07 0.02 0.04 0.06 0.10 SEQID-02645
Q75KH3 -- -- 1 0.40 0.19 0.08 0.09 0.04 0.06 0.01 0.05 0.07 0.05
0.01 0.07 0.06 0.06 SEQID-02646 Q6F361 -- -- 0 0.47 0.25 0.09 0.05
0.05 0.04 0.01 0.03 0.09 0.05 0.02 0.05 0.11 0.09 SEQID-02647
Q6Z9P5 -- -- 1 0.53 0.124 0.05 0.05 0.03 0.07 0.01 0.02 0.07 0.04
0.04 0.09 0.09 0.06 SEQID-02648 Q75H81 -- -- 1 0.51 0.123 0.09 0.03
0.02 0.05 0.00 0.05 0.07 0.04 0.04 0.03 0.13 0.08 SEQID-02649
Q6Z1J6 -- -- 1 0.50 0.21 0.05 0.06 0.03 0.07 0.02 0.03 0.09 0.03
0.03 0.08 0.07 0.11 SEQID-02650 Q62744 -- -- 1 0.45 0.20 0.06 0.09
0.04 0.05 0.02 0.03 0.09 0.05 0.02 0.06 0.07 0.07 SEQID-02651
Q3S0E1 -- -- 1 0.53 0.23 0.05 0.05 0.05 0.07 0.02 0.02 0.05 0.04
0.04 0.08 0.11 0.09 SEQID-02652 Q10Q18 -- -- 1 0.53 0.29 0.05 0.08
0.04 0.02 0.01 0.04 0.05 0.05 0.02 0.09 0.13 0.04 SEQID-02653
Q62702 -- -- 1 0.43 0.18 0.07 0.09 0.03 0.06 0.02 0.03 0.07 0.04
0.02 0.05 0.06 0.07 SEQID-02654 Q2Q511 -- -- 1 0.49 0.18 0.04 0.06
0.04 0.06 0.02 0.03 0.10 0.04 0.01 0.05 0.07 0.11 SEQID-02655
Q9SLX0 -- -- 1 0.42 0.23 0.07 0.07 0.06 0.06 0.02 0.07 0.09 0.03
0.02 0.06 0.11 0.06 SEQID-02656 Q0IMT5 -- -- 1 0.37 0.16 0.09 0.14
0.02 0.05 0.02 0.03 0.07 0.06 0.02 0.04 0.06 0.04 SEQID-02657
Q5QMK7 -- -- 1 0.47 0.22 0.06 0.07 0.04 0.08 0.01 0.03 0.07 0.05
0.03 0.05 0.09 0.07 SEQID-02658 Q9LGA3 -- -- 1 0.46 0.22 0.09 0.07
0.03 0.06 0.01 0.05 0.06 0.03 0.02 0.04 0.10 0.09 SEQID-02659
Q10MW3 -- -- 1 0.44 0.22 0.07 0.05 0.05 0.05 0.03 0.03 0.07 0.05
0.03 0.06 0.09 0.06 SEQID-02660 Q6K4K9 -- -- 1 0.46 0.28 0.06 0.07
0.03 0.06 0.02 0.06 0.09 0.02 0.02 0.07 0.13 0.05 SEQID-02661
Q75GT3 -- -- 1 0.42 0.22 0.06 0.11 0.03 0.07 0.00 0.06 0.10 0.04
0.01 0.06 0.09 0.07 SEQID-02662 Q6ZHP6 -- -- 0 0.35 0.14 0.12 0.10
0.03 0.06 0.00 0.01 0.17 0.09 0.00 0.00 0.08 0.05 SEQID-02663
Q0IQK9 -- -- 0 0.36 0.24 0.18 0.10 0.05 0.02 0.07 0.02 0.00 0.05
0.01 0.05 0.10 0.05 SEQID-02664 Q6ZGV5 -- -- 1 0.48 0.20 0.05 0.14
0.04 0.05 0.01 0.01 0.12 0.03 0.02 0.07 0.06 0.15 SEQID-02665
Q762A6 -- -- 1 0.47 0.19 0.06 0.09 0.05 0.06 0.01 0.01 0.09 0.05
0.01 0.05 0.06 0.16 SEQID-02666 Q42980 -- -- 1 0.50 0.24 0.12 0.06
0.00 0.05 0.00 0.08 0.09 0.07 0.04 0.05 0.11 0.06 SEQID-02667
C7IYQ9 -- -- 1 0.46 0.22 0.06 0.11 0.04 0.04 0.00 0.09 0.05 0.03
0.04 0.05 0.09 0.05 SEQID-02668 Q6H7T1 -- -- 0 0.44 0.18 0.06 0.16
0.02 0.05 0.01 0.02 0.07 0.06 0.03 0.05 0.07 0.09 SEQID-02669
Q67VZ0 -- -- 1 0.40 0.16 0.08 0.10 0.03 0.06 0.03 0.03 0.05 0.09
0.04 0.02 0.06 0.01 SEQID-02670 Q6ZH98 -- -- 1 0.49 0.17 0.04 0.07
0.04 0.05 0.03 0.02 0.06 0.08 0.03 0.04 0.04 0.08 SEQID-02671
P49210 -- -- 1 0.53 0.25 0.04 0.10 0.05 0.05 0.00 0.03 0.07 0.03
0.03 0.08 0.08 0.10 SEQID-02672 Q2R4A1 -- -- 1 0.44 0.23 0.08 0.12
0.06 0.05 0.01 0.04 0.07 0.02 0.03 0.09 0.07 0.08 SEQID-02673
Q6L502 -- -- 1 0.46 0.20 0.06 0.08 0.05 0.09 0.01 0.04 0.05 0.04
0.01 0.09 0.07 0.09 SEQID-02674 Q10P60 -- -- 1 0.39 0.19 0.06 0.16
0.03 0.09 0.00 0.04 0.08 0.04 0.01 0.02 0.07 0.05 SEQID-02675
Q9FWV6 -- -- 1 0.50 0.26 0.11 0.07 0.02 0.03 0.00 0.01 0.03 0.07
0.04 0.04 0.14 0.01 SEQID-02676 Q10MT8 -- -- 1 0.41 0.22 0.07 0.06
0.04 0.03 0.04 0.03 0.08 0.04 0.04 0.03 0.09 0.0 SEQID-02677 P49398
-- -- 1 0.51 0.22 0.04 0.10 0.05 0.06 0.01 0.03 0.04 0.04 0.03 0.08
0.08 0.13 SEQID-02678 C7J0T2 -- -- 1 0.42 0.17 0.05 0.14 0.03 0.05
0.01 0.03 0.08 0.03 0.05 0.04 0.08 0.03 SEQID-02679 Q69020 -- -- 1
0.42 0.21 0.05 0.11 0.04 0.06 0.02 0.04 0.11 0.04 0.03 0.05 0.10
0.04 SEQID-02680 Q10R17 -- -- 1 0.43 0.23 0.06 0.09 0.03 0.06 0.02
0.03 0.07 0.06 0.03 0.05 0.10 0.05 SEQID-02681 Q6Z4E4 -- -- 1 0.46
0.21 0.07 0.07 0.05 0.06 0.01 0.04 0.06 0.04 0.01 0.06 0.08 0.06
SEQID-02682 Q10RW9 -- -- 0 0.48 0.25 0.08 0.06 0.04 0.06 0.01 0.04
0.10 0.05 0.01 0.07 0.09 0.10 SEQID-02683 Q7X9A7 -- -- 1 0.45 0.26
0.09 0.08 0.03 0.05 0.00 0.04 0.11 0.04 0.01 0.08 0.09 0.08
SEQID-02684 Q7XV86 -- -- 1 0.45 0.18 0.05 0.04 0.03 0.10 0.01 0.02
0.13 0.03 0.02 0.07 0.07 0.13 SEQID-02685 Q7XMP6 -- -- 1 0.48 0.27
0.10 0.08 0.03 0.05 0.01 0.02 0.08 0.05 0.04 0.06 0.10 0.06
SEQID-02686 Q0DCI1 -- -- 1 0.47 0.23 0.07 0.05 0.03 0.05 0.02 0.05
0.06 0.04 0.04 0.06 0.10 0.07 SEQID-02687 Q0D9G9 -- -- 1 0.47 0.20
0.03 0.05 0.03 0.08 0.00 0.03 0.14 0.02 0.01 0.05 0.10 0.13
SEQID-02688 Q0J716 -- -- 1 0.46 0.18 0.04 0.06 0.03 0.07 0.01 0.05
0.09 0.03 0.02 0.05 0.08 0.09 SEQID-02689 Q6Z1D6 -- -- 1 0.44 0.20
0.04 0.07 0.05 0.08 0.01 0.04 0.10 0.03 0.04 0.05 0.07 0.06
SEQID-02690 Q10ST8 -- -- 0 0.37 0.20 0.13 0.10 0.04 0.01 0.10 0.05
0.00 0.08 0.01 0.02 0.07 0.04 SEQID-02691 Q0DT04 -- -- 1 0.40 0.18
0.09 0.09 0.00 0.08 0.01 0.04 0.06 0.04 0.03 0.04 0.04 0.04
SEQID-02692 Q384ZP1 -- -- 1 0.52 0.25 0.02 0.12 0.04 0.04 0.01 0.03
0.07 0.05 0.03 0.08 0.08 0.10 SEQID-02693 Q10EK7 -- -- 0 0.43 0.24
0.14 0.08 0.01 0.03 0.00 0.09 0.09 0.08 0.02 0.03 0.14 0.03
SEQID-02694 Q2QXN5 -- -- 1 0.45 0.20 0.06 0.18 0.03 0.05 0.01 0.02
0.05 0.03 0.03 0.05 0.05 0.13 SEQID-02695 Q0JAI2 -- -- 1 0.50 0.26
0.06 0.07 0.03 0.07 0.01 0.04 0.08 0.04 0.01 0.08 0.07 0.14
SEQID-02696 Q2QQ48 -- -- 0 0.49 0.20 0.04 0.04 0.05 0.09 0.02 0.04
0.08 0.04 0.05 0.07 0.06 0.11 SEQID-02697 Q7XXS55 -- -- 1 0.46
0.325 0.07 0.10 0.02 0.08 0.02 0.04 0.06 0.05 0.05 0.04 0.13 0.06
SEQID-02698 Q0DK10 -- -- 1 0.44 0.20 0.03 0.13 0.03 0.03 0.01 0.06
0.09 0.04 0.01 0.05 0.07 0.10 SEQID-02699 Q943F3 -- -- 1 0.53 0.15
0.03 0.12 0.05 0.02 0.01 0.04 0.04 0.02 0.04 0.05 0.06 0.13
SEQID-02700 Q1DMS5 -- -- 0 0.47 0.22 0.05 0.13 0.04 0.05 0.00 0.03
0.09 0.02 0.02 0.06 0.07 0.12 SEQID-02701 Q2R1J8 -- -- 1 0.43 0.20
0.03 0.17 0.05 0.04 0.00 0.03 0.09 0.04 0.04 0.04 0.10 0.08
SEQID-02702 Q6YY64 -- -- 1 0.51 0.18 0.07 0.09 0.02 0.07 0.00 0.02
0.05 0.04 0.02 0.05 0.08 0.16 SEQID-02703 Q6H6I1 -- -- 1 0.42 0.19
0.13 0.08 0.02 0.04 0.03 0.01 0.06 0.05 0.03 0.05 0.06 0.05
SEQID-02704 Q6YTX5 -- -- 1 0.42 0.25 0.16 0.06 0.02 0.04 0.00 0.02
0.06 0.03 0.04 0.03 0.12 0.05 SEQID-02705 Q6ER94 -- -- 1 0.44 0.22
0.07 0.06 0.02 0.08 0.01 0.03 0.05 0.03 0.01 0.07 0.09 0.07
SEQID-02706 P52428 -- -- 1 0.39 0.18 0.09 0.09 0.03 0.06 0.02 0.05
0.09 0.03 0.02 0.04 0.08 0.05 SEQID-02707 Q8H5N9 -- -- 1 0.51 0.25
0.11 0.05 0.03 0.03 0.01 0.02 0.03 0.07 0.03 0.09 0.08 0.04
SEQID-02708 Q0E3 7 -- -- 1 0.53 0.27 0.10 0.03 0.02 0.04 0.01 0.01
0.04 0.06 0.01 0.10 0.10 0.05 SEQID-02709 Q2R8Z5 -- -- 1 0.51 0.22
0.06 0.05 0.05 0.04 0.03 0.02 0.09 0.05 0.04 0.07 0.06 0.08
SEQID-02710 Q8H8T0 -- -- 1 0.48 0.19 0.04 0.06 0.04 0.08 0.02 0.03
0.05 0.03 0.02 0.06 0.08 0.08 SEQID-02711 Q85059 -- -- 1 0.46 0.19
0.06 0.10 0.03 0.08 0.01 0.04 0.07 0.03 0.03 0.05 0.09 0.07
SEQID-02712 Q5JK10 -- -- 1 0.45 0.24 0.08 0.06 0.03 0.07 0.01 0.04
0.06 0.03 0.01 0.06 0.10 0.098 SEQID-02713 Q67UF5 -- -- 1 0.46 0.21
0.08 0.03 0.04 0.05 0.02 0.04 0.10 0.04 0.01 0.03 0.10 0.11
SEQID-02714 Q0DJG7 -- -- 1 0.47 0.21 0.04 0.05 0.04 0.08 0.02 0.03
0.06 0.04 0.03 0.04 0.10 0.08 SEQID-02715 Q8R2W7 -- -- 1 0.46 0.21
0.04 0.05 0.03 0.07 0.02 0.04 0.06 0.06 0.05 0.04 0.10 0.06
SEQID-02716 Q6AVT2 -- -- 1 0.44 0.22 0.07 0.10 0.05 0.08 0.01 0.03
0.05 0.05 0.01 0.08 0.08 0.06 SEQID-02717 Q0JK67 -- -- 1 0.42 0.21
0.07 0.10 0.04 0.07 0.02 0.03 0.05 0.04 0.03 0.05 0.10 0.03
SEQID-02718 Q0JP92 -- -- 1 0.48 0.28 0.06 0.06 0.06 0.05 0.01 0.06
0.06 0.02 0.01 0.07 0.12 0.04 SEQID-02719 Q654U8 -- -- 1 0.45 0.21
0.06 0.05 0.04 0.05 0.02 0.04 0.08 0.05 0.03 0.05 0.10 0.08
SEQID-02720 Q93VT8 -- -- 1 0.47 0.23 0.05 0.06 0.03 0.05 0.01 0.05
0.06 0.05 0.02 0.09 0.08 0.08 SEQID-02721 Q6K2E8 -- -- 1 0.45 0.23
0.08 0.08 0.03 0.05 0.01 0.05 0.06 0.04 0.03 0.06 0.09 0.05
SEQID-02722 Q8W1L6 -- -- 1 0.51 0.26 0.06 0.07 0.03 0.05 0.01 0.04
0.06 0.05 0.02 0.07 0.11 0.08 SEQID-02723 Q9AQZ5 -- -- 1 0.44 0.18
0.06 0.06 0.04 0.06 0.02 0.05 0.11 0.03 0.01 0.04 0.07 0.10
SEQID-02724 Q9ZWR4 -- -- 1 0.45 0.24 0.07 0.05 0.04 0.06 0.02 0.07
0.09 0.03 0.02 0.06 0.12 0.05 SEQID-02725 P05117 -- -- 1 0.46 0.23
0.04 0.03 0.10 0.05 0.03 0.06 0.05 0.04 0.02 0.10 0.05 0.08
SEQID-02726 K48249 -- -- 1 0.46 0.21 0.05 0.07 0.02 0.06 0.01 0.03
0.08 0.04 0.03 0.07 0.08 0.06 SEQID-02727 P14280 -- -- 1 0.48 0.22
0.06 0.05 0.05 0.07 0.01 0.06 0.04 0.03 0.02 0.06 0.08 0.06
SEQID-02728 K4BHR9 -- -- 1 0.47 0.21 0.05 0.07 0.02 0.06 0.01 0.03
0.09 0.04 0.03 0.08 0.07 0.06 SEQID-02729 P17786 -- -- 1 0.521 0.21
0.05 0.06 0.03 0.06 0.01 0.03 0.07 0.05 0.03 0.07 0.06 0.13
SEQID-02730 P09607 -- -- 1 0.49 0.23 0.06 0.06 0.04 0.07 0.02 0.05
0.04 0.03 0.02 0.06 0.09 0.08 SEQID-02731 K48JW4 -- -- 1 0.52 0.23
0.06 0.05 0.04 0.07 0.01 0.02 0.07 0.04 0.02 0.06 0.06 0.10
SEQID-02732 K4CWR4 -- -- 1 0.50 0.22 0.06 0.05 0.03 0.06 0.02 0.04
0.08 0.04 0.03 0.06 0.09 0.08 SEQID-02733 K49N62 -- -- 1 0.48 0.20
0.06 0.07 0.05 0.06 0.02 0.04 0.05 0.03 0.03 0.05 0.07 0.09
SEQID-02734 K46WA9 -- -- 1 0.52 0.22 0.06 0.05 0.05 0.08 0.01 0.02
0.05 0.05 0.02 0.07 0.06 0.11 SEQID-02735 O82575 -- -- 0 0.58 0.10
0.09 0.00 0.00 0.04 0.00 0.01 0.20 0.04 0.23 0.04 0.05 0.18
SEQID-02736 O65819 -- -- 0 0.53 0.17 0.09 0.05 0.02 0.03 0.00 0.03
0.09 0.02 0.02 0.07 0.05 0.23 SEQID-02737 K4CX83 -- -- 1 0.48 0.23
0.06 0.06 0.04 0.07 0.01 0.03 0.04 0.05 0.03 0.06 0.07 0.08
SEQID-02738 P29000 -- -- 1 0.47 0.21 0.04 0.04 0.04 0.08 0.01 0.05
0.04 0.04 0.03 0.05 0.09 0.06 SEQID-02739 K4D8N5 -- -- 1 0.33 0.17
0.02 0.03 0.07 0.02 0.02 0.02 0.04 0.02 0.02 0.04 0.08 0.03
SEQID-02740 K4CQV5 -- -- 1 0.44 0.22 0.07 0.05 0.05 0.03 0.02 0.05
0.10 0.05 0.01 0.04 0.11 0.09 SEQID-02741 P10967 -- -- 1 0.48 0.21
0.02 0.05 0.03 0.08 0.02 0.05 0.06 0.03 0.03 0.05 0.10 0.08
SEQID-02742 Q42382 -- -- 1 0.43 0.23 0.06 0.08 0.05 0.07 0.01 0.03
0.06 0.04 0.02 0.09 0.09 0.07 SEQID-02743 K4CPX6 -- -- 1 0.51 0.23
0.05 0.05 0.04 0.06 0.02 0.03 0.07 0.04 0.03 0.06 0.10 0.08
SEQID-02744 K4D4C8 -- -- 1 0.38 0.14 0.02 0.03 0.05 0.03 0.02 0.02
0.04 0.02 0.04 0.03 0.07 0.07 SEQID-02745 K4CL75 -- -- 1 0.48 0.20
0.05 0.07 0.04 0.06 0.02 0.04 0.09 0.04 0.02 0.05 0.08 0.08
SEQID-02746 K4ASM0 -- -- 1 0.48 0.22 0.03 0.06 0.06 0.05 0.01 0.03
0.08 0.03 0.04 0.06 0.10 0.07 SEQID-02747 K4CBP6 -- -- 0 0.44 0.14
0.05 0.16 0.03 0.01 0.09 0.01 0.07 0.03 0.03 0.03 0.06 0.04
SEQID-02748 P14903 -- -- 0 0.55 0.25 0.03 0.03 0.05 0.04 0.06 0.05
0.05 0.02 0.00 0.06 0.15 0.08 SEQID-02749 P62980 -- -- 0 0.53 0.18
0.04 0.07 0.03 0.07 0.02 0.06 0.05 0.04 0.03 0.05 0.08 0.19
SEQID-02750 K4CUC1 -- -- 1 0.48 0.23 0.06 0.04 0.04 0.06 0.04 0.03
0.08 0.0 0.02 0.05 0.10 0.07 SEQID-02751 K4CW40 -- -- 1 0.46 0.25
0.08 0.05 0.05 0.06 0.02 0.03 0.07 0.04 0.02 0.06 0.09 0.07
SEQID-02752 K4B6D8 -- -- 1 0.49 0.21 0.02 0.03 0.07 0.04 0.01 0.04
0.09 0.03 0.03 0.07 0.10 0.07 SEQID-02753 K4D422 -- -- 1 0.49 0.20
0.03 0.07 0.04 0.04 0.02 0.04 0.15 0.04 0.02 0.05 0.10 0.09
SEQID-02754 K4BX34 -- -- 1 0.42 0.21 0.07 0.08 0.05 0.03 0.01 0.05
0.08 0.04 0.01 0.05 0.10 0.07 SEQID-02755 P24629 -- -- 1 0.46 0.21
0.05 0.06 0.05 0.07 0.01 0.04 0.10 0.04 0.01 0.07 0.07 0.10
SEQID-02756 K4AQY8 -- -- 0 0.42 0.24 0.09 0.10 0.03 0.08 0.00 0.05
0.06 0.04 0.01 0.06 0.10 0.05 SEQID-02757 K4D338 -- -- 1 0.49 0.22
0.06 0.06 0.04 0.06 0.01 0.04 0.08 0.03 0.02 0.06 0.09 0.08
SEQID-02758 K4D8C4 -- -- 1 0.47 0.22 0.05 0.06 0.05 0.06 0.01 0.03
0.06 0.04 0.03 0.05 0.09 0.07
SEQID-02759 Q6LB28 -- -- 0 0.46 0.19 0.08 0.17 0.01 0.03 0.01 0.07
0.06 0.03 0.03 0.05 0.10 0.12 SEQID-02760 K4B1G1 -- -- 1 0.50 0.26
0.05 0.07 0.05 0.04 0.01 0.04 0.05 0.06 0.03 0.08 0.12 0.06
SEQID-02761 K4CI69 -- -- 1 0.44 0.17 0.06 0.07 0.06 0.05 0.04 0.05
0.03 0.03 0.02 0.05 0.07 0.08 SEQID-02762 K4D1H0 -- -- 1 0.34 0.13
0.05 0.09 0.07 0.05 0.05 0.05 0.02 0.07 0.02 0.05 0.06 0.03
SEQID-02763 P15003 -- -- 0 0.43 0.22 0.08 0.06 0.08 0.08 0.03 0.05
0.03 0.04 0.01 0.05 0.10 0.04 SEQID-02764 K4BAW0 -- -- 1 0.43 0.22
0.07 0.07 0.05 0.04 0.01 0.06 0.08 0.04 0.01 0.04 0.10 0.07
SEQID-02765 K4CHY3 -- -- 1 0.52 0.27 0.07 0.03 0.03 0.07 0.00 0.02
0.08 0.06 0.01 0.05 0.12 0.12 SEQID-02766 Q6SKP4 -- -- 1 0.54 0.19
0.04 0.09 0.02 0.03 0.02 0.05 0.06 0.04 0.05 0.05 0.07 0.16
SEQID-02767 K4C711 -- -- 1 0.46 0.23 0.04 0.10 0.03 0.08 0.01 0.07
0.06 0.03 0.01 0.06 0.10 0.05 SEQID-02768 P26300 -- -- 1 0.46 0.22
0.07 0.04 0.05 0.06 0.01 0.04 0.09 0.05 0.02 0.06 0.089 0.10
SEQID-02769 P49118 -- -- 1 0.46 0.22 0.05 0.06 0.05 0.03 0.01 0.04
0.11 0.04 0.01 0.07 0.08 0.11 SEQID-02770 K4BEL1 -- -- 1 0.48 0.20
0.03 0.05 0.04 0.08 0.01 0.03 0.14 0.02 0.01 0.06 0.09 0.13
SEQID-02771 K4BVW7 -- -- 1 0.44 0.17 0.04 0.08 0.06 0.07 0.01 0.02
0.08 0.04 0.04 0.05 0.06 0.06 SEQID-02772 B1N678 -- -- 0 0.41 0.13
0.05 0.17 0.03 0.01 0.10 0.02 0.08 0.04 0.02 0.01 0.07 0.03
SEQID-02773 K4B3H9 -- -- 0 0.22 0.098 0.03 0.16 0.05 0.07 0.01 0.04
0.08 0.22 0.00 0.03 0.02 0.01 SEQID-02774 K4BNT4 -- -- 1 0.59 0.27
0.02 0.01 0.03 0.05 0.02 0.02 0.11 0.03 0.07 0.12 0.10 0.12
SEQID-02775 K4CWC4 -- -- 0 0.55 0.25 0.04 0.01 0.03 0.08 0.01 0.01
0.09 0.05 0.06 0.07 0.09 0.12 SEQID-02776 K4BIL3 -- -- 1 0.49 0.19
0.04 0.06 0.02 0.06 0.03 0.02 0.05 0.06 0.04 0.06 0.07 0.06
SEQID-02777 K4ATQ2 -- -- 1 0.43 0.20 0.04 0.18 0.03 0.05 0.00 0.04
0.08 0.03 0.03 0.03 0.10 0.09 SEQID-02778 K4BP02 -- -- 1 0.41 0.17
0.03 0.22 0.03 0.02 0.01 0.05 0.04 0.04 0.03 0.03 0.07 0.10
SEQID-02779 K4C3V1 -- -- 1 0.45 0.14 0.06 0.19 0.04 0.02 0.00 0.04
0.07 0.03 0.03 0.03 0.07 0.18 SEQID-02780 P12670 -- -- 1 0.41 0.13
0.05 0.06 0.07 0.04 0.07 0.04 0.03 0.06 0.01 0.03 0.06 0.04
SEQID-02781 P93210 -- -- 1 0.40 0.20 0.06 0.07 0.06 0.06 0.01 0.03
0.14 0.02 0.01 0.06 0.10 0.08 SEQID-02782 O65820 -- -- 0 0.52 0.14
0.13 0.04 0.02 0.01 0.00 0.02 0.07 0.00 0.00 0.03 0.04 0.29
SEQID-02783 P37213 -- -- 0 0.52 0.11 0.17 0.04 0.02 0.01 0.00 0.02
0.06 0.01 0.01 0.02 0.03 0.30 SEQID-02784 Q08451 -- -- 1 0.52 0.24
0.08 0.06 0.03 0.03 0.01 0.03 0.04 0.06 0.03 0.08 0.09 0.04
SEQID-02785 K4DA99 -- -- 1 0.54 0.26 0.09 0.05 0.02 0.03 0.01 0.02
0.04 0.06 0.04 0.10 0.08 0.05 SEQID-02786 Q3C2L6 -- -- 1 0.49 0.25
0.06 0.07 0.04 0.06 0.04 0.02 0.07 0.06 0.03 0.07 0.09 0.06
SEQID-02787 P28032 -- -- 1 0.51 0.23 0.06 0.05 0.04 0.05 0.03 0.02
0.08 0.05 0.04 0.06 0.08 0.08 SEQID-02788 K4CL59 -- -- 1 0.47 0.24
0.05 0.06 0.04 0.05 0.01 0.03 0.07 0.04 0.02 0.06 0.10 0.06
SEQID-02789 K4ASC2 -- -- 1 0.50 0.20 0.06 0.06 0.04 0.06 0.01 0.02
0.09 0.04 0.03 0.07 0.08 0.10 SEQID-02790 K4C285 -- -- 1 0.50 0.26
0.04 0.04 0.07 0.07 0.01 0.03 0.06 0.03 0.02 0.07 0.12 0.10
SEQID-02791 K4B8V1 -- -- 1 0.47 0.23 0.06 0.04 0.06 0.04 0.03 0.03
0.07 0.05 0.03 0.07 0.09 0.06 SEQID-02792 K4D8S6 -- -- 1 0.45 0.18
0.06 0.04 0.03 0.05 0.00 0.03 0.17 0.02 0.01 0.03 0.06 0.11
SEQID-02793 K4C764 -- -- 1 0.46 0.21 0.06 0.08 0.03 0.07 0.01 0.03
0.08 0.04 0.02 0.05 0.10 0.07 SEQID-02794 K4BL25 -- -- 1 0.43 0.24
0.06 0.11 0.03 0.07 0.00 0.05 0.11 0.04 0.02 0.05 0.11 0.08
SEQID-02795 F6I0I5 -- -- 1 0.50 0.23 0.04 0.07 0.02 0.05 0.01 0.02
0.08 0.04 0.04 0.07 0.10 0.06 SEQID-02796 A5B0L2 -- -- 1 0.47 0.21
0.05 0.07 0.02 0.06 0.01 0.03 0.09 0.04 0.03 0.08 0.07 0.06
SEQID-02797 A5BXV1 -- -- 1 0.47 0.21 0.05 0.07 0.02 0.06 0.01 0.03
0.09 0.04 0.03 0.07 0.07 0.06 SEQID-02798 D7T227 -- -- 1 0.48 0.22
0.07 0.04 0.06 0.06 0.01 0.04 0.08 0.05 0.02 0.07 0.08 0.11
SEQID-02799 C5DBS0 -- -- 1 0.47 0.22 0.05 0.06 0.04 0.08 0.01 0.03
0.08 0.06 0.04 0.06 0.08 0.08 SEQID-02800 F6H4T7 -- -- 1 0.47 0.21
0.05 0.098 0.03 0.06 0.02 0.04 0.09 0.04 0.02 0.05 0.08 0.08
SEQID-02801 F6HKH3 -- -- 1 0.47 0.23 0.06 0.03 0.06 0.06 0.01 0.04
0.09 0.05 0.02 0.07 0.08 0.10 SEQID-02802 F6HXK4 -- -- 1 0.51 0.27
0.06 0.07 0.04 0.05 0.01 0.03 0.08 0.04 0.02 0.10 0.10 0.06
SEQID-02803 A5C5K3 -- -- 1 0.50 0.22 0.05 0.05 0.03 0.06 0.02 0.04
0.08 0.05 0.03 0.07 0.09 0.09 SEQID-02804 F6HNX5 -- -- 1 0.45 0.20
0.06 0.06 0.05 0.08 0.01 0.04 0.09 0.04 0.01 0.07 0.07 0.09
SEQID-02805 A5B118 -- -- 1 0.46 0.22 0.07 0.06 0.04 0.03 0.02 0.03
0.10 0.05 0.02 0.04 0.11 0.10 SEQID-02806 A5CAF6 -- -- 1 0.53 0.28
0.07 0.04 0.02 0.07 0.00 0.01 0.08 0.06 0.02 0.05 0.13 0.12
SEQID-02807 A5AFS1 -- -- 1 0.52 0.21 0.04 0.06 0.04 0.06 0.01 0.02
0.08 0.04 0.03 0.07 0.06 0.12 SEQID-02808 A5C0I8 -- -- 1 0.49 0.23
0.05 0.06 0.05 0.05 0.09 0.02 0.09 0.05 0.03 0.06 0.07 0.08
SEQID-02809 F6HLD8 -- -- 1 0.45 0.20 0.06 0.06 0.05 0.08 0.01 0.04
0.09 0.04 0.01 0.07 0.07 0.10 SEQID-02810 F6HG44 -- -- 1 0.52 0.23
0.06 0.05 0.04 0.08 0.01 0.01 0.06 0.04 0.03 0.07 0.06 0.10
SEQID-02811 F6HCG2 -- -- 1 0.45 0.22 0.04 0.10 0.04 0.07 0.01 0.03
0.08 0.04 0.03 0.06 0.09 0.06 SEQID-02812 A5C6H7 -- -- 1 0.47 0.22
0.04 0.08 0.04 0.06 0.01 0.04 0.08 0.03 0.04 0.06 0.10 0.05
SEQID-02813 F6H0C4 -- -- 0 0.46 0.12 0.02 0.01 0.00 0.04 0.02 0.02
0.27 0.03 0.05 0.03 0.04 0.22 SEQID-02814 F6GSG7 -- -- 1 0.53 0.23
0.06 0.05 0.04 0.07 0.01 0.01 0.07 0.05 0.03 0.07 0.06 0.10
SEQID-02815 F6HFF7 -- -- 1 0.46 0.20 0.06 0.06 0.04 0.06 0.01 0.03
0.07 0.05 0.02 0.06 0.07 0.08 SEQID-02816 F6HXC8 -- -- 1 0.46 0.20
0.03 0.08 0.03 0.07 0.01 0.04 0.09 0.04 0.05 0.08 0.07 0.06
SEQID-02817 D7TCM7 -- -- 1 0.46 0.23 0.03 0.10 0.03 0.08 0.01 0.07
0.07 0.04 0.01 0.06 0.10 0.05 SEQID-02818 D7TBH4 -- -- 1 0.47 0.24
0.05 0.06 0.04 0.05 0.01 0.05 0.09 0.04 0.02 0.06 0.12 0.08
SEQID-02819 F6I407 -- -- 1 0.45 0.20 0.05 0.04 0.03 0.04 0.01 0.03
0.18 0.02 0.01 0.04 0.06 0.11 SEQID-02820 D7TQP5 -- -- 1 0.42 0.21
0.06 0.10 0.03 0.08 0.02 0.03 0.11 0.04 0.02 0.07 0.08 0.07
SEQID-02821 A5BT28 -- -- 1 0.48 0.22 0.06 0.09 0.05 0.06 0.01 0.03
0.10 0.02 0.04 0.06 0.11 0.09 SEQID-02822 F6I2F8 -- -- 0 0.42 0.25
0.07 0.10 0.03 0.05 0.01 0.05 0.07 0.04 0.01 0.07 0.11 0.06
SEQID-02823 F6HHU9 -- -- 1 0.48 0.20 0.04 0.05 0.02 0.07 0.02 0.02
0.12 0.03 0.03 0.05 0.09 0.10 SEQID-02824 D7T7Y3 -- -- 1 0.46 0.21
0.05 0.07 0.05 0.06 0.01 0.03 0.06 0.04 0.03 0.06 0.08 0.06
SEQID-02825 D7SJV3 -- -- 1 0.47 0.23 0.05 0.06 0.05 0.06 0.01 0.06
0.09 0.02 0.02 0.06 0.11 0.07 SEQID-02826 F6HMP1 -- -- 0 0.40 0.08
0.01 0.06 0.00 0.00 0.00 0.07 0.22 0.18 0.10 0.06 0.02 0.14
SEQID-02827 ASAML5 -- -- 1 0.56 0.23 0.05 0.02 0.02 0.04 0.02 0.04
0.15 0.03 0.03 0.03 0.07 0.12 SEQID-02828 D75KR5 -- -- 1 0.46 0.19
0.06 0.06 0.02 0.06 0.01 0.02 0.11 0.05 0.03 0.04 0.10 0.10
SEQID-02829 F6H3T7 -- -- 1 0.46 0.22 0.06 0.07 0.03 0.05 0.02 0.03
0.07 0.04 0.02 0.06 0.09 0.06 SEQID-02830 D7TJ46 -- -- 1 0.49 0.23
0.07 0.05 0.03 0.05 0.01 0.02 0.10 0.05 0.01 0.07 0.08 0.11
SEQID-02831 F6I0H8 -- -- 1 0.52 0.27 0.04 0.03 0.08 0.05 0.01 0.03
0.8 0.04 0.02 0.07 0.11 0.11 SEQID-02832 F6HAM6 -- -- 1 0.46 0.20
0.07 0.07 0.04 0.05 0.01 0.02 0.08 0.05 0.04 0.06 0.09 0.07
SEQID-02833 F6HMN8 -- -- 1 0.49 0.22 0.06 0.06 0.03 0.06 0.01 0.03
0.08 0.03 0.02 0.06 0.09 0.09 SEQID-02834 D7T1R6 -- -- 1 0.47 0.22
0.05 0.06 0.05 0.06 0.01 0.03 0.07 0.05 0.03 0.06 0.08 0.07
SEQID-02835 D7TLU7 -- -- 1 0.50 0.25 0.07 0.04 0.05 0.03 0.02 0.03
0.10 0.05 0.02 0.06 0.07 0.09 SEQID-02836 F6H5V8 -- -- 0 0.14 0.03
0.01 0.10 0.01 0.06 0.01 0.04 0.17 0.09 0.03 0.01 0.01 0.06
SEQID-02837 D7T0U8 -- -- 1 0.48 0.21 0.07 0.05 0.04 0.06 0.02 0.02
0.05 0.04 0.02 0.06 0.06 0.09 SEQID-02838 A5AEI5 -- -- 0 0.52 0.26
0.02 0.07 0.03 0.08 0.00 0.09 0.08 0.04 0.02 0.09 0.12 0.11
SEQID-02839 F6HGH4 -- -- 1 0.47 0.22 0.05 0.07 0.04 0.06 0.01 0.04
0.08 0.05 0.01 0.07 0.09 0.09 SEQID-02840 F6GV71 -- -- 1 0.45 0.23
0.06 0.05 0.06 0.04 0.04 0.04 0.07 0.04 0.03 0.07 0.08 0.06
SEQID-02841 F6HL03 -- -- 1 0.48 0.20 0.05 0.06 0.05 0.06 0.02 0.04
0.07 0.05 0.04 0.05 0.08 0.06 SEQID-02842 D75QC6 -- -- 1 0.45 0.17
0.04 0.07 0.03 0.05 0.01 0.05 0.10 0.03 0.02 0.05 0.07 0.09
SEQID-02843 A5B878 -- -- 1 0.51 0.23 0.09 0.07 0.04 0.04 0.00 0.02
0.09 0.06 0.03 0.10 0.06 0.08 SEQID-02844 A5AKD3 -- -- 1 0.52 0.17
0.05 0.04 0.04 0.04 0.02 0.02 0.05 0.09 0.04 0.05 0.04 0.09
SEQID-02845 A5BQN6 -- -- 1 0.50 0.17 0.04 0.07 0.03 0.06 0.02 0.03
0.07 0.08 0.03 0.06 0.04 0.08 SEQID-02846 Q9M4H7 -- -- 0 0.31 0.12
0.12 0.00 0.01 0.04 0.00 0.03 0.36 0.00 0.00 0.00 0.01 0.10
SEQID-02847 F6HUD1 -- -- 1 0.47 0.20 0.04 0.02 0.05 0.07 0.02 0.05
0.06 0.04 0.01 0.06 0.09 0.12 SEQID-02848 C5DB51 -- -- 1 0.51 0.26
0.06 0.07 0.04 0.06 0.02 0.02 0.08 0.04 0.01 0.08 0.10 0.09
SEQID-02849 D7TA34 -- -- 1 0.49 0.22 0.05 0.06 0.06 0.05 0.01 0.03
0.10 0.03 0.03 0.06 0.08 0.08 SEQID-02850 F6H0X3 -- -- 1 0.38 0.19
0.08 0.09 0.03 0.07 0.01 0.03 0.14 0.02 0.01 0.06 0.10 0.07
SEQID-02851 D75UQ2 -- -- 1 0.49 0.20 0.04 0.07 0.05 0.05 0.02 0.05
0.06 0.02 0.04 0.06 0.10 0.09 SEQID-02852 D7FBC0 -- -- 1 0.47 0.25
0.08 0.05 0.05 0.05 0.02 0.04 0.07 0.04 0.03 0.06 0.09 0.07
SEQID-02853 F6HFL6 -- -- 1 0.42 0.20 0.07 0.07 0.04 0.03 0.01 0.06
0.08 0.04 0.01 0.04 0.09 0.07 SEQID-02854 D7TBL7 -- -- 1 0.46 0.23
0.06 0.08 0.04 0.06 0.01 0.04 0.05 0.04 0.03 0.07 0.10 0.05
SEQID-02855 F6H1L2 -- -- 1 0.42 0.17 0.04 0.07 0.05 0.06 0.02 0.05
0.09 0.04 0.02 0.04 0.07 0.04 SEQID-02856 F6HLZ6 -- -- 1 0.43 0.18
0.04 0.07 0.05 0.06 0.02 0.05 0.10 0.04 0.02 0.04 0.038 0.04
SEQID-02857 D7TVX5 -- -- 1 0.47 0.21 0.06 0.06 0.05 0.07 0.01 0.05
0.07 0.02 0.02 0.03 0.11 0.07 SEQID-02858 F6H710 -- -- 1 0.47 0.23
0.06 0.05 0.03 0.06 0.02 0.04 0.09 0.04 0.03 0.06 0.09 0.08
SEQID-02859 F6HAU0 -- -- 1 0.48 0.22 0.04 0.05 0.04 0.09 0.01 0.03
0.05 0.04 0.03 0.06 0.09 0.03 SEQID-02860 D7TJI9 -- -- 1 0.46 0.23
0.06 0.06 0.05 0.05 0.02 0.03 0.07 0.05 0.03 0.07 0.08 0.05
SEQID-02861 F6H7B3 -- -- 1 0.47 0.22 0.05 0.06 0.04 0.08 0.01 0.04
0.11 0.04 0.01 0.08 0.08 0.11 SEQID-02862 D7TVF4 -- -- 1 0.49 0.23
0.03 0.05 0.04 0.05 0.02 0.03 0.09 0.04 0.01 0.07 0.09 0.10
SEQID-02863 D7TZ79 -- -- 1 0.53 0.27 0.08 0.03 0.03 0.04 0.01 0.02
0.05 0.06 0.01 0.09 0.10 0.05 SEQID-02864 F6H2N7 -- -- 1 0.45 0.22
0.05 0.10 0.03 0.07 0.01 0.05 0.09 0.03 0.03 0.06 0.12 0.06
SEQID-02865 F6HQM5 -- -- 0 0.22 0.09 0.03 0.16 0.05 0.06 0.01 0.04
0.08 0.19 0.00 0.04 0.03 0.01 SEQID-02866 Q9FS43 -- -- 0 0.52 0.20
0.06 0.02 0.01 0.07 0.02 0.02 0.09 0.05 0.06 0.07 0.04 0.12
SEQID-02867 F6GX20 -- -- 1 0.44 0.25 0.04 0.09 0.06 0.06 0.02 0.04
0.08 0.06 0.01 0.08 0.08 0.06 SEQID-02868 F6HDT7 -- -- 1 0.42 0.16
0.04 0.09 0.04 0.10 0.01 0.03 0.10 0.03 0.04 0.03 0.08 0.07
SEQID-02869 F6GU22 -- -- 1 0.40 0.19 0.04 0.03 0.10 0.07 0.07 0.03
0.04 0.07 0.02 0.05 0.07 0.05 SEQID-02870 A5AX75 -- -- 1 0.45 0.21
0.06 0.05 0.03 0.05 0.01 0.04 0.14 0.01 0.02 0.04 0.12 0.08
SEQID-02871 Q0MX16 -- -- 1 0.53 0.25 0.08 0.05 0.03 0.03 0.01 0.03
0.05 0.06 0.02 0.09 0.09 0.05 SEQID-02872 A5AP38 -- -- 1 0.42 0.18
0.05 0.07 0.05 0.06 0.01 0.03 0.08 0.06 0.02 0.08 0.06 0.06
SEQID-02873 D7SZX9 -- -- 1 0.49 0.24 0.06 0.03 0.04 0.03 0.01 0.04
0.08 0.05 0.01 0.05 0.11 0.08 SEQID-02874 D7TMY3 -- -- 1 0.48 0.24
0.06 0.08 0.03 0.06 0.03 0.03 0.08 0.05 0.03 0.06 0.08 0.06
SEQID-02875 D7TCC4 -- -- 1 0.47 0.23 0.04 0.08 0.02 0.06 0.01 0.03
0.10 0.04 0.02 0.07 0.08 0.06 SEQID-02876 F6GUN5 -- -- 1 0.46 0.20
0.08 0.12 0.05 0.04 0.00 0.03 0.05 0.04 0.02 0.06 0.06 0.12
SEQID-02877 D7TVX4 -- -- 1 0.47 0.21 0.03 0.08 0.04 0.06 0.02 0.03
0.07 0.03 0.03 0.04 0.10 0.07 SEQID-02878 D7UD99 -- -- 1 0.44 0.17
0.03 0.10 0.06 0.06 0.01 0.03 0.06 0.03 0.05 0.05 0.07 0.05
SEQID-02879 F6I0 4 -- -- 1 0.45 0.17 0.03 0.09 0.06 0.07 0.01 0.03
0.07 0.03 0.05 0.04 0.06 0.06 SEQID-02880 F6GTT4 -- -- 1 0.51 0.23
0.03 0.06 0.04 0.06 0.01 0.03 0.09 0.04 0.02 0.07 0.08 0.10
SEQID-02881 F6GTT2 -- -- 0 0.44 0.25 0.07 0.09 0.03 0.05 0.00 0.05
0.08 0.05 0.02 0.07 0.10 0.05 SEQID-02882 F6HEU9 -- -- 1 0.34 0.16
0.05 0.05 0.04 0.06 0.01 0.13 0.03 0.03 0.04 0.04 0.07 0.03
SEQID-02883 Q4U339 -- -- 1 0.51 0.28 0.05 0.05 0.01 0.04 0.01 0.04
0.07 0.05 0.01 0.08 0.13 0.03 SEQID-02884 F6HYG1 -- -- 1 0.44 0.19
0.06 0.06 0.04 0.07 0.02 0.05 0.11
0.03 0.02 0.05 0.07 0.09 SEQID-02885 F6HFK7 -- -- 1 0.39 0.18 0.07
0.08 0.04 0.05 0.01 0.09 0.08 0.02 0.02 0.05 0.10 0.06 SEQID-02886
A58M68 -- -- 1 0.51 0.21 0.03 0.02 0.02 0.09 0.01 0.05 0.11 0.04
0.01 0.04 0.11 0.11 SEQID-02887 F6H8W9 -- -- 1 0.52 0.25 0.07 0.03
0.04 0.04 0.01 0.05 0.05 0.04 0.02 0.06 0.09 0.08 SEQID-02888
A5B3K2 -- -- 0 0.49 0.18 0.06 0.01 0.02 0.03 0.01 0.01 0.22 0.02
0.00 0.05 0.05 0.17 SEQID-02889 D7SYA1 -- -- 1 0.46 0.15 0.05 0.19
0.03 0.02 0.00 0.03 0.07 0.02 0.03 0.03 0.07 0.18 SEQID-02890
D7U394 -- -- 1 0.54 0.25 0.05 0.04 0.03 0.05 0.03 0.03 0.07 0.06
0.03 0.05 0.07 0.08 SEQID-02891 D7T745 -- -- 1 0.46 0.21 0.06 0.06
0.04 0.07 0.02 0.03 0.07 0.04 0.04 0.03 0.10 0.06 SEQID-02892
A5BIQ8 -- -- 1 0.48 0.20 0.04 0.14 0.01 0.04 0.01 0.03 0.07 0.07
0.02 0.05 0.06 0.10 SEQID-02893 Q5PXH0 -- -- 1 0.53 0.25 0.08 0.05
0.02 0.04 0.01 0.02 0.03 0.06 0.03 0.09 0.09 0.04 SEQID-02894
F6I0K9 -- -- 1 0.47 0.24 0.05 0.05 0.04 0.05 0.00 0.04 0.08 0.04
0.02 0.10 0.06 0.09 SEQID-02895 D7U9L9 -- -- 1 0.46 0.23 0.05 0.08
0.03 0.06 0.01 0.02 0.10 0.04 0.03 0.08 0.09 0.08 SEQID-02896
A5BIN1 -- -- 1 0.46 0.22 0.03 0.09 0.07 0.05 0.01 0.03 0.08 0.04
0.03 0.07 0.08 0.06 SEQID-02897 F6GSQ2 -- -- 1 0.44 0.21 0.05 0.07
0.04 0.05 0.02 0.03 0.08 0.06 0.04 0.08 0.08 0.06 SEQID-02898
F6GY49 -- -- 1 0.53 0.17 0.04 0.11 0.01 0.03 0.01 0.05 0.07 0.04
0.05 0.05 0.05 0.15 SEQID-02899 F6H2P8 -- -- 1 0.49 0.26 0.07 0.06
0.03 0.05 0.02 0.03 0.07 0.04 0.02 0.06 0.12 0.08 SEQID-02900
F6H7I5 -- -- 1 0.47 0.24 0.05 0.038 0.03 0.07 0.00 0.03 0.06 0.04
0.02 0.08 0.07 0.09 SEQID-02901 D7TIZ5 -- -- 1 0.52 0.26 0.06 0.05
0.03 0.06 0.01 0.03 0.07 0.03 0.03 0.06 0.10 0.09 SEQID-02902
F6I1W0 -- -- 1 0.49 0.22 0.04 0.07 0.05 0.05 0.01 0.02 0.10 0.03
0.02 0.06 0.08 0.07 SEQID-02903 F6HXL0 -- -- 1 0.43 0.22 0.05 0.07
0.03 0.05 0.02 0.05 0.08 0.04 0.02 0.06 0.09 0.06 SEQID-02904
F6HUX3 -- -- 1 0.34 0.16 0.03 0.05 0.05 0.05 0.00 0.12 0.05 0.05
0.03 0.03 0.09 0.04 SEQID-02905 F6HSN5 -- -- 1 0.46 0.23 0.08 0.06
0.03 0.06 0.02 0.03 0.06 0.05 0.02 0.05 0.10 0.06 SEQID-02906
F6I6W5 -- -- 1 0.47 0.23 0.05 0.05 0.04 0.05 0.02 0.06 0.06 0.04
0.03 0.05 0.12 0.08 SEQID-02907 E0CR04 -- -- 1 0.47 0.23 0.04 0.06
0.05 0.05 0.01 0.04 0.07 0.04 0.02 0.06 0.10 0.08 SEQID-02908
F6HCU9 -- -- 1 0.49 0.21 0.03 0.05 0.04 0.07 0.01 0.03 0.14 0.03
0.02 0.06 0.09 0.13 SEQID-02909 F6HH37 -- -- 1 0.34 0.18 0.02 0.04
0.05 0.03 0.02 0.02 0.04 0.02 0.04 0.04 0.09 0.03 SEQID-02910 F
HES2 -- -- 0 0.41 0.23 0.05 0.02 0.04 0.09 0.01 0.02 0.20 0.02 0.02
0.04 0.06 0.10 SEQID-02911 F6GUN0 -- -- 1 0.44 0.24 0.07 0.06 0.03
0.06 0.02 0.07 0.09 0.02 0.02 0.05 0.13 0.05 SEQID-02912 A5BAX1 --
-- 1 0.52 0.20 0.03 0.02 0.04 0.06 0.02 0.03 0.14 0.03 0.06 0.09
0.07 0.11 SEQID-02913 A5C3I9 -- -- 0 0.50 0.20 0.04 0.04 0.03 0.11
0.02 0.04 0.07 0.05 0.06 0.07 0.06 0.11 SEQID-02914 A5C718 -- -- 1
0.46 0.16 0.05 0.08 0.04 0.04 0.03 0.04 0.05 0.03 0.02 0.05 0.07
0.06 SEQID-02915 D7SJX8 -- -- 1 0.57 0.22 0.03 0.04 0.03 0.05 0.00
0.02 0.07 0.07 0.03 0.05 0.10 0.11 SEQID-02916 D7UC61 -- -- 1 0.46
0.15 0.09 0.04 0.04 0.04 0.01 0.02 0.17 0.02 0.01 0.02 0.06 0.19
SEQID-02917 F6HUH1 -- -- 1 0.42 0.15 0.03 0.05 0.07 0.07 0.07 0.03
0.03 0.05 0.01 0.04 0.08 0.04 SEQID-02918 D7T5I6 -- -- 1 0.44 0.22
0.06 0.04 0.05 0.06 0.02 0.04 0.11 0.03 0.02 0.06 0.11 0.06
SEQID-02919 D7SGX1 -- -- 1 0.47 0.25 0.06 0.04 0.02 0.09 0.01 0.02
0.11 0.03 0.02 0.07 0.10 0.10 SEQID-02920 F6GSZ1 -- -- 0 0.25 0.11
0.05 0.09 0.04 0.07 0.00 0.03 0.05 0.17 0.01 0.03 0.03 0.02
SEQID-02921 A5B427 -- -- 1 0.50 0.24 0.04 0.06 0.04 0.07 0.01 0.00
0.08 0.04 0.05 0.06 0.11 0.05 SEQID-02922 F6H6J3 -- -- 1 0.33 0.18
0.06 0.08 0.02 0.11 0.00 0.04 0.05 0.06 0.02 0.03 0.07 0.05
SEQID-02923 D7TD80 -- -- 1 0.49 0.20 0.04 0.05 0.05 0.03 0.01 0.05
0.10 0.03 0.02 0.06 0.07 0.10 SEQID-02924 F6I229 -- -- 1 0.46 0.18
0.06 0.04 0.02 0.06 0.01 0.05 0.08 0.05 0.00 0.04 0.09 0.11
SEQID-02925 A5BV59 -- -- 1 0.50 0.22 0.05 0.08 0.03 0.09 0.02 0.02
0.04 0.04 0.03 0.06 0.09 0.07 SEQID-02926 D7SJS6 -- -- 1 0.49 0.26
0.05 0.05 0.03 0.06 0.02 0.03 0.08 0.04 0.03 0.06 0.11 0.08
SEQID-02927 D7TWQ4 -- -- 1 0.48 0.22 0.07 0.05 0.04 0.05 0.01 0.04
0.06 0.04 0.05 0.07 0.09 0.08 SEQID-02928 F6GU55 -- -- 1 0.45 0.20
0.07 0.08 0.04 0.05 0.01 0.05 0.02 0.05 0.02 0.05 0.09 0.08
SEQID-02929 F6HUT2 -- -- 1 0.42 0.19 0.06 0.06 0.05 0.06 0.02 0.06
0.03 0.05 0.03 0.07 0.08 0.04 SEQID-02930 F6HDW4 -- -- 1 0.49 0.18
0.04 0.07 0.05 0.05 0.02 0.02 0.10 0.05 0.03 0.07 0.07 0.08
SEQID-02931 A5BF93 -- -- 1 0.49 0.26 0.07 0.05 0.05 0.07 0.02 0.05
0.08 0.05 0.01 0.08 0.09 0.10 SEQID-02932 F6GZN9 -- -- 1 0.49 0.19
0.05 0.05 0.04 0.07 0.02 0.02 0.09 0.03 0.03 0.06 0.08 0.07
SEQID-02933 D7SYS5 -- -- 1 0.44 0.18 0.04 0.08 0.04 0.06 0.02 0.03
0.07 0.04 0.02 0.05 0.08 0.06 SEQID-02934 F6H955 -- -- 0 0.41 0.20
0.04 0.07 0.04 0.09 0.02 0.07 0.08 0.06 0.04 0.06 0.08 0.07
SEQID-02935 F6HKX8 -- -- 1 0.41 0.19 0.04 0.09 0.02 0.05 0.05 0.03
0.09 0.04 0.04 0.06 0.06 0.06 SEQID-02936 A5BZF5 -- -- 1 0.43 0.21
0.05 0.07 0.04 0.07 0.02 0.04 0.09 0.04 0.03 0.05 0.08 0.05
SEQID-02937 D7T5P6 -- -- 1 0.39 0.17 0.05 0.07 0.04 0.07 0.01 0.03
0.06 0.03 0.02 0.05 0.07 0.07 SEQID-02938 D7TW33 -- -- 1 0.45 0.19
0.05 0.04 0.04 0.06 0.03 0.04 0.07 0.04 0.03 0.03 0.09 0.08
SEQID-02939 P56643 -- -- 1 0.46 0.19 0.06 0.09 0.03 0.05 0.02 0.03
0.08 0.05 0.04 0.05 0.09 0.06 SEQID-02940 D75TJ8 -- -- 1 0.45 0.22
0.05 0.08 0.06 0.06 0.02 0.04 0.06 0.05 0.04 0.08 0.07 0.06
SEQID-02941 D7TK33 -- -- 1 0.49 0.22 0.04 0.08 0.03 0.07 0.02 0.03
0.08 0.05 0.06 0.07 0.09 0.05 SEQID-02942 D7SYK8 -- -- 1 0.47 0.23
0.06 0.07 0.03 0.05 0.01 0.04 0.07 0.05 0.03 0.08 0.08 0.07
SEQID-02943 D7SS06 -- -- 1 0.46 0.22 0.06 0.07 0.03 0.06 0.01 0.04
0.08 0.04 0.02 0.05 0.10 0.06 SEQID-02944 D7SH83 -- -- 1 0.46 0.21
0.06 0.07 0.03 0.06 0.01 0.04 0.10 0.03 0.03 0.05 0.09 0.09
SEQID-02945 F6HHX2 -- -- 1 0.43 0.20 0.05 0.05 0.05 0.05 0.01 0.06
0.08 0.04 0.02 0.04 0.09 0.06 SEQID-02946 F6HTM3 -- -- 1 0.43 0.23
0.06 0.05 0.03 0.04 0.00 0.09 0.21 0.01 0.03 0.04 0.14 0.10
SEQID-02947 D7SZW5 -- -- 1 0.48 0.22 0.03 0.03 0.02 0.02 0.02 0.04
0.10 0.08 0.01 0.03 0.09 0.11 SEQID-02948 A5AQ89 -- -- 1 0.48 0.23
0.06 0.02 0.02 0.06 0.02 0.07 0.07 0.07 0.02 0.10 0.09 0.05
SEQID-02949 D7TBK8 -- -- 1 0.52 0.26 0.07 0.03 0.02 0.09 0.01 0.03
0.06 0.05 0.02 0.06 0.10 0.10 SEQID-02950 A5B7Q8 -- -- 1 0.44 0.19
0.02 0.07 0.04 0.06 0.02 0.07 0.10 0.05 0.02 0.06 0.08 0.06
SEQID-02951 D7SIH0 -- -- 0 0.52 0.22 0.06 0.06 0.05 0.05 0.01 0.03
0.04 0.03 0.01 0.05 0.09 0.09 SEQID-02952 A5BYC0 -- -- 1 0.47 0.23
0.07 0.06 0.04 0.07 0.01 0.02 0.06 0.04 0.04 0.07 0.09 0.07
SEQID-02953 D7SPB2 -- -- 1 0.44 0.22 0.04 0.08 0.04 0.08 0.01 0.02
0.08 0.03 0.05 0.09 0.07 0.07 SEQID-02954 D7SLS3 -- -- 1 0.42 0.16
0.03 0.21 0.04 0.02 0.01 0.04 0.04 0.03 0.04 0.04 0.06 0.10
SEQID-02955 D7T475 -- -- 1 0.52 0.24 0.06 0.02 0.03 0.04 0.01 0.02
0.11 0.04 0.01 0.05 0.09 0.11 SEQID-02956 D7U7S6 -- -- 1 0.42 0.20
0.06 0.06 0.05 0.07 0.03 0.05 0.04 0.03 0.02 0.05 0.10 0.07
SEQID-02957 D7T6Q0 -- -- 1 0.48 0.22 0.08 0.02 0.02 0.06 0.02 0.03
0.07 0.05 0.04 0.05 0.08 0.10 SEQID-02958 D7TPB9 -- -- 1 0.50 0.22
0.07 0.03 0.02 0.06 0.02 0.03 0.09 0.04 0.03 0.05 0.06 0.09
SEQID-02959 F6H4V0 -- -- 1 0.50 0.19 0.03 0.05 0.03 0.05 0.02 0.02
0.12 0.03 0.04 0.04 0.09 0.10 SEQID-02960 D7TRL3 -- -- 0 0.45 0.18
0.04 0.16 0.02 0.04 0.02 0.05 0.07 0.04 0.00 0.04 0.09 0.15
SEQID-02961 D7TU16 -- -- 1 0.48 0.23 0.07 0.06 0.03 0.09 0.01 0.02
0.08 0.03 0.02 0.05 0.13 0.09 SEQID-02962 D7UCH9 -- -- 1 0.56 0.28
0.06 0.04 0.02 0.05 0.01 0.01 0.06 0.03 0.04 0.09 0.13 0.10
SEQID-02963 E0CQY0 -- -- 1 0.45 0.16 0.06 0.05 0.07 0.04 0.03 0.05
0.01 0.06 0.02 0.04 0.05 0.05 SEQID-02964 E0CSN8 -- -- 1 0.45 0.17
0.06 0.07 0.04 0.07 0.02 0.01 0.06 0.05 0.03 0.03 0.08 0.06
SEQID-02965 D7T4T3 -- -- 1 0.46 0.22 0.04 0.05 0.03 0.06 0.03 0.07
0.09 0.04 0.05 0.04 0.09 0.05 SEQID-02966 F6GU78 -- -- 1 0.43 0.18
0.03 0.10 0.05 0.08 0.02 0.03 0.11 0.04 0.01 0.03 0.08 0.11
SEQID-02967 D75R32 -- -- 1 0.44 0.19 0.08 0.04 0.05 0.06 0.02 0.06
0.13 0.02 0.02 0.04 0.11 0.11 SEQID-02968 D7THS4 -- -- 1 0.49 0.17
0.05 0.02 0.05 0.06 0.02 0.04 0.06 0.04 0.05 0.05 0.09 0.08
SEQID-02969 F6HQD3 -- -- 1 0.47 0.21 0.04 0.07 0.03 0.07 0.02 0.01
0.08 0.04 0.05 0.05 0.08 0.05 SEQID-02970 F6GUL7 -- -- 1 0.50 0.22
0.04 0.11 0.04 0.05 0.01 0.03 0.05 0.05 0.03 0.07 0.09 0.11
SEQID-02971 F6GX19 -- -- 1 0.48 0.21 0.04 0.09 0.04 0.07 0.02 0.02
0.08 0.02 0.04 0.03 0.13 0.07 SEQID-02972 F6HQD6 -- -- 1 0.49 0.21
0.05 0.05 0.05 0.06 0.01 0.02 0.07 0.04 0.07 0.04 0.09 0.07
SEQID-02973 D7TM77 -- -- 1 0.47 0.20 0.06 0.03 0.05 0.05 0.03 0.04
0.10 0.04 0.03 0.06 0.07 0.09 SEQID-02974 F6HKS7 -- -- 1 0.49 0.20
0.07 0.05 0.03 0.05 0.00 0.04 0.06 0.05 0.04 0.05 0.10 0.06
SEQID-02975 A5ARE0 -- -- 1 0.51 0.24 0.04 0.04 0.04 0.06 0.01 0.02
0.08 0.06 0.02 0.05 0.10 0.08 SEQID-02976 D7TVP9 -- -- 1 0.46 0.19
0.05 0.09 0.04 0.09 0.01 0.04 0.07 0.04 0.05 0.04 0.09 0.06
SEQID-02977 F6HL98 -- -- 1 0.50 0.25 0.02 0.05 0.07 0.05 0.03 0.03
0.03 0.03 0.03 0.05 0.17 0.08 SEQID-02978 F6HBC6 -- -- 1 0.50 0.22
0.06 0.04 0.04 0.05 0.01 0.03 0.06 0.05 0.02 0.05 0.11 0.08
SEQID-02979 D7TA50 -- -- 1 0.48 0.23 0.07 0.03 0.02 0.05 0.03 0.04
0.07 0.05 0.04 0.06 0.09 0.06 SEQID-02980 D7T3J3 -- -- 1 0.47 0.19
0.05 0.06 0.06 0.07 0.01 0.03 0.07 0.04 0.04 0.06 0.10 0.06
SEQID-02981 D7TKK5 -- -- 1 0.49 0.22 0.05 0.06 0.04 0.07 0.02 0.04
0.10 0.03 0.03 0.08 0.08 0.11 SEQID-02982 D7U0Q3 -- -- 1 0.48 0.24
0.05 0.06 0.04 0.05 0.01 0.04 0.07 0.04 0.02 0.04 0.11 0.07
SEQID-02983 F6I4H0 -- -- 1 0.50 0.21 0.05 0.06 0.03 0.08 0.02 0.03
0.07 0.05 0.04 0.07 0.07 0.08 SEQID-02984 A5ALT5 -- -- 0 0.41 0.16
0.03 0.07 0.03 0.07 0.03 0.08 0.11 0.05 0.02 0.04 0.07 0.11
SEQID-02985 D7T6C5 -- -- 0 0.44 0.23 0.05 0.08 0.04 0.09 0.01 0.05
0.10 0.03 0.01 0.07 0.11 0.09 SEQID-02986 F6H0K6 -- -- 1 0.43 0.19
0.07 0.06 0.03 0.06 0.01 0.03 0.08 0.04 0.02 0.04 0.11 0.09
SEQID-02987 F6GY09 -- -- 1 0.47 0.21 0.04 0.07 0.06 0.07 0.01 0.04
0.09 0.04 0.02 0.06 0.10 0.08 SEQID-02988 F6HK38 -- -- 1 0.50 0.18
0.05 0.05 0.05 0.04 0.01 0.03 0.10 0.03 0.02 0.05 0.08 0.12
SEQID-02989 F6HE13 -- -- 1 0.34 0.14 0.05 0.06 0.05 0.04 0.02 0.14
0.05 0.05 0.01 0.03 0.06 0.03 SEQID-02990 D7TCZ8 -- -- 1 0.47 0.19
0.04 0.07 0.04 0.07 0.01 0.03 0.08 0.04 0.04 0.05 0.09 0.07
SEQID-02991 F6GST3 -- -- 1 0.44 0.22 0.05 0.08 0.04 0.05 0.01 0.04
0.09 0.04 0.02 0.06 0.10 0.07 SEQID-02992 F6HKF1 -- -- 1 0.48 0.23
0.04 0.07 0.03 0.07 0.02 0.05 0.07 0.03 0.02 0.07 0.10 0.09
SEQID-02993 D7U4U5 -- -- 1 0.44 0.22 0.04 0.09 0.06 0.05 0.01 0.05
0.03 0.05 0.02 0.07 0.08 0.04 SEQID-02994 F6HYJ1 -- -- 1 0.49 0.24
0.08 0.04 0.03 0.05 0.02 0.02 0.07 0.05 0.02 0.05 0.11 0.09
SEQID-02995 D7SIX7 -- -- 1 0.47 0.28 0.06 0.08 0.03 0.07 0.02 0.05
0.08 0.02 0.02 0.07 0.14 0.05 SEQID-02996 F6H392 -- -- 1 0.24 0.09
0.07 0.04 0.04 0.04 0.00 0.15 0.04 0.07 0.01 0.04 0.02 0.03
SEQID-02997 E0CSK6 -- -- 0 0.47 0.24 0.05 0.08 0.05 0.06 0.01 0.05
0.08 0.04 0.03 0.08 0.10 0.07 SEQID-02998 Q07J21 -- -- 1 0.55 0.22
0.06 0.05 0.04 0.04 0.00 0.05 0.03 0.05 0.07 0.06 0.12 0.02
SEQID-02999 E0CQR2 -- -- 1 0.43 0.16 0.04 0.07 0.05 0.07 0.01 0.02
0.08 0.04 0.04 0.04 0.07 0.05 SEQID-03000 D7SRR6 -- -- 0 0.34 0.18
0.05 0.08 0.07 0.05 0.01 0.10 0.06 0.06 0.03 0.04 0.08 0.02
SEQID-03001 D7STT1 -- -- 1 0.47 0.22 0.06 0.06 0.04 0.06 0.02 0.04
0.09 0.03 0.02 0.05 0.10 0.06 SEQID-03002 F6HH36 -- -- 1 0.45 0.21
0.04 0.07 0.05 0.05 0.02 0.03 0.09 0.03 0.03 0.06 0.09 0.05
SEQID-03003 A5AHP0 -- -- 1 0.49 0.28 0.04 0.07 0.05 0.06 0.02 0.05
0.08 0.02 0.02 0.08 0.13 0.07 SEQID-03004 F6GUM1 -- -- 1 0.46 0.21
0.05 0.06 0.06 0.07 0.02 0.04 0.08 0.03 0.03 0.05 0.10 0.06
SEQID-03005 D7T3A6 -- -- 1 0.46 0.20 0.03 0.07 0.04 0.07 0.01 0.06
0.10 0.02 0.04 0.05 0.09 0.08 SEQID-03006 273402 -- -- 1 0.41 0.17
0.04 0.09 0.06 0.05 0.01 0.08 0.09 0.03 0.03 0.04 0.09 0.06
SEQID-03007 83173888 -- -- 0 0.44 0.26 0.02 0.09 0.06 0.04 0.00
0.07 0.12 0.02 0.02 0.08 0.11 0.07 SEQID-03008 219522337 -- -- 1
0.48 0.22 0.06 0.05 0.04 0.06 0.01 0.03 0.08 0.03 0.02 0.06 0.09
0.08 SEQID-03009 367460278 -- -- 1 0.46 0.16 0.05 0.06 0.06 0.08
0.01 0.00 0.05 0.04 0.01 0.08 0.06 0.09
SEQID-03010 2108286 -- -- 1 0.39 0.16 0.04 0.08 0.06 0.02 0.03 0.09
0.11 0.04 0.02 0.03 0.11 0.04 SEQID-03011 3319882 -- -- 1 0.52 0.22
0.04 0.05 0.04 0.06 0.01 0.03 0.08 0.04 0.02 0.06 0.07 0.13
SEQID-03012 301131212 -- -- 1 0.47 0.21 0.05 0.07 0.02 0.06 0.01
0.03 0.09 0.04 0.03 0.08 0.07 0.06 SEQID-03013 21068668 -- -- 1
0.47 0.22 0.03 0.10 0.06 0.08 0.00 0.01 0.12 0.01 0.03 0.06 0.09
0.05 SEQID-03014 3021333 -- -- 1 0.46 0.24 0.08 0.05 0.05 0.04 0.01
0.04 0.09 0.05 0.02 0.05 0.11 0.08 SEQID-03015 13487787 -- -- 1
0.43 0.22 0.06 0.08 0.05 0.06 0.01 0.03 0.06 0.04 0.02 0.09 0.08
0.07 SEQID-03016 3413165 -- -- 1 0.52 0.25 0.06 0.05 0.04 0.08 0.01
0.01 0.06 0.04 0.01 0.08 0.08 0.09 SEQID-03017 3175990 -- -- 1 0.48
0.22 0.04 0.05 0.04 0.08 0.01 0.02 0.07 0.04 0.03 0.05 0.10 0.09
SEQID-03018 197089784 -- -- 1 0.46 0.20 0.06 0.09 0.03 0.06 0.02
0.03 0.08 0.05 0.04 0.05 0.09 0.06 SEQID-03019 38566732 -- -- 1
0.52 0.17 0.03 0.02 0.04 0.04 0.02 0.04 0.06 0.09 0.04 0.05 0.04
0.12 SEQID-03020 10334493 -- -- 1 0.47 0.25 0.07 0.05 0.05 0.05
0.02 0.04 0.07 0.04 0.03 0.06 0.09 0.07 SEQID-03021 4586588 -- -- 1
0.53 0.18 0.06 0.07 0.02 0.06 0.03 0.02 0.07 0.04 0.03 0.09 0.06
0.12 SEQID-03022 148612111 -- -- 1 0.39 0.19 0.07 0.08 0.04 0.07
0.01 0.03 0.14 0.02 0.01 0.06 0.10 0.07 SEQID-03023 10334503 -- --
1 0.46 0.19 0.05 0.06 0.05 0.07 0.02 0.07 0.07 0.03 0.04 0.05 0.07
0.09 SEQID-03024 4586594 -- -- 0 0.55 0.26 0.02 0.05 0.03 0.09 0.00
0.08 0.07 0.03 0.01 0.10 0.10 0.12 SEQID-03025 20975622 -- -- 1
0.53 0.20 0.02 0.02 0.05 0.08 0.02 0.04 0.09 0.03 0.07 0.05 0.08
0.12 SEQID-03026 228552592 -- -- 1 0.40 0.19 0.06 0.07 0.05 0.07
0.01 0.03 0.14 0.02 0.02 0.05 0.09 0.08 SEQID-03027 7208773 -- -- 1
0.48 0.24 0.04 0.06 0.04 0.06 0.01 0.05 0.08 0.03 0.03 0.08 0.11
0.07 SEQID-03028 3043428 -- -- 1 0.44 0.24 0.06 0.13 0.06 0.06 0.01
0.04 0.05 0.02 0.03 0.09 0.07 0.08 SEQID-03029 60219077 -- -- 1
0.49 0.23 0.05 0.06 0.04 0.06 0.02 0.04 0.08 0.04 0.02 0.07 0.09
0.07 SEQID-03030 84569909 -- -- 1 0.44 0.16 0.05 0.09 0.04 0.08
0.11 0.02 0.06 0.03 0.03 0.01 0.09 0.08 SEQID-03031 7208784 -- -- 1
0.53 0.19 0.04 0.07 0.03 0.06 0.00 0.03 0.05 0.04 0.03 0.03 0.08
0.18 SEQID-03032 207008822 -- -- 0 0.54 0.17 0.08 0.05 0.02 0.02
0.00 0.02 0.10 0.02 0.02 0.07 0.04 0.23 SEQID-03033 499171 -- -- 0
0.47 0.21 0.06 0.01 0.05 0.04 0.01 0.03 0.11 0.06 0.02 0.06 0.06
0.13 SEQID-03034 219725672 -- -- 1 0.43 0.19 0.09 0.07 0.05 0.07
0.01 0.07 0.06 0.03 0.02 0.09 0.06 0.04 SEQID-03035 315440443 -- --
0 0.49 0.09 0.08 0.04 0.04 0.03 0.00 0.04 0.10 0.08 0.08 0.01 0.01
0.12 SEQID-03036 45720184 -- -- 1 0.49 0.25 0.08 0.09 0.02 0.06
0.02 0.03 0.10 0.03 0.06 0.05 0.07 0.06 SEQID-03037 4586580 -- -- 1
0.43 0.19 0.06 0.06 0.07 0.07 0.02 0.06 0.06 0.03 0.01 0.07 0.07
0.07 SEQID-03038 6469141 -- -- 1 0.47 0.22 0.03 0.09 0.07 0.06 0.01
0.03 0.07 0.04 0.03 0.05 0.09 0.07 SEQID-03039 6850936 -- -- 0 0.52
0.28 0.08 0.07 0.04 0.08 0.01 0.05 0.05 0.03 0.02 0.08 0.12 0.11
SEQID-03040 4586578 -- -- 1 0.53 0.26 0.06 0.07 0.05 0.04 0.03 0.01
0.07 0.06 0.01 0.12 0.08 0.08 SEQID-03041 O65759 -- -- 0 0.44 0.23
0.08 0.10 0.05 0.02 0.00 0.04 0.07 0.06 0.02 0.05 0.11 0.11
SEQID-03042 O49817 -- -- 0 0.40 0.03 0.10 0.04 0.03 0.08 0.00 0.17
0.08 0.04 0.02 0.01 0.01 0.16 SEQID-03043 3928152 -- -- 1 0.50 0.21
0.04 0.06 0.04 0.02 0.02 0.04 0.08 0.03 0.02 0.04 0.08 0.08
SEQID-03044 21684781 -- -- 1 0.43 0.18 0.03 0.08 0.07 0.06 0.01
0.04 0.05 0.04 0.04 0.05 0.09 0.06 SEQID-03045 K9I869 -- -- 1 0.50
0.20 0.05 0.06 0.05 0.09 0.00 0.03 0.05 0.04 0.04 0.06 0.08 0.07
SEQID-03046 K9I432 -- -- 1 0.54 0.18 0.04 0.11 0.02 0.04 0.00 0.02
0.06 0.04 0.06 0.05 0.06 0.13 SEQID-03047 K9HSF5 -- -- 1 0.53 0.26
0.06 0.02 0.05 0.05 0.01 0.07 0.06 0.05 0.04 0.07 0.10 0.09
SEQID-03048 K9HCC6 -- -- 1 0.49 0.23 0.07 0.04 0.06 0.05 0.01 0.06
0.04 0.04 0.02 0.08 0.06 0.07 SEQID-03049 K9HXR0 -- -- 1 0.46 0.21
0.06 0.08 0.04 0.07 0.00 0.05 0.09 0.03 0.01 0.05 0.08 0.09
SEQID-03050 K9HXN3 -- -- 1 0.49 0.23 0.04 0.07 0.04 0.07 0.01 0.04
0.08 0.04 0.02 0.06 0.083 0.09 SEQID-03051 K9HHN3 -- -- 1 0.48 0.20
0.03 0.05 0.05 0.07 0.00 0.04 0.04 0.04 0.04 0.03 0.09 0.09
SEQID-03052 K9I0P5 -- -- 1 0.46 0.19 0.05 0.07 0.06 0.06 0.01 0.01
0.07 0.03 0.04 0.07 0.06 0.07 SEQID-03053 K9I1X4 -- -- 1 0.44 0.24
0.07 0.10 0.03 0.05 0.01 0.05 0.07 0.05 0.01 0.07 0.10 0.06
SEQID-03054 K9HML4 -- -- 1 0.45 0.23 0.07 0.07 0.04 0.06 0.01 0.04
0.08 0.03 0.02 0.06 0.09 0.06 SEQID-03055 KSHHZ0 -- -- 1 0.46 0.22
0.06 0.08 0.03 0.06 0.01 0.05 0.07 0.05 0.03 0.07 0.07 0.06
SEQID-03056 K9HIT2 -- -- 1 0.48 0.24 0.06 0.07 0.05 0.06 0.01 0.04
0.07 0.04 0.03 0.06 0.10 0.08 SEQID-03057 K9HU82 -- -- 1 0.46 0.21
0.07 0.07 0.02 0.05 0.00 0.05 0.08 0.04 0.03 0.07 0.07 0.07
SEQID-03058 K9I9C0 -- -- 1 0.42 0.20 0.06 0.07 0.05 0.07 0.00 0.04
0.10 0.05 0.01 0.07 0.07 0.08 SEQID-03059 K9HD94 -- -- 1 0.47 0.24
0.05 0.09 0.03 0.05 0.02 0.05 0.09 0.03 0.03 0.08 0.09 0.06
SEQID-03060 K9ICT4 -- -- 0 0.42 0.21 0.06 0.11 0.01 0.03 0.01 0.07
0.11 0.04 0.02 0.04 0.08 0.08 SEQID-03061 K9HUL5 -- -- 1 0.47 0.23
0.07 0.03 0.05 0.06 0.00 0.04 0.08 0.05 0.02 0.08 0.09 0.10
SEQID-03062 K9H805 -- -- 1 0.53 0.21 0.05 0.03 0.05 0.04 0.01 0.05
0.07 0.05 0.03 0.07 0.07 0.08 SEQID-03063 K9HNG2 -- -- 1 0.45 0.20
0.07 0.15 0.04 0.03 0.01 0.02 0.04 0.06 0.06 0.07 0.06 0.09
SEQID-03064 K9HUK9 -- -- 1 0.47 0.22 0.07 0.07 0.04 0.06 0.01 0.04
0.06 0.04 0.03 0.06 0.10 0.06 SEQID-03065 K9IBU7 -- -- 1 0.53 0.21
0.05 0.05 0.04 0.06 0.01 0.02 0.08 0.05 0.03 0.08 0.05 0.13
SEQID-03066 K9HFT9 -- -- 1 0.51 0.20 0.06 0.05 0.05 0.06 0.00 0.05
0.06 0.04 0.04 0.06 0.09 0.08 SEQID-03067 K9I586 -- -- 1 0.47 0.21
0.07 0.07 0.02 0.07 0.01 0.04 0.06 0.06 0.04 0.04 0.09 0.09
SEQID-03068 K9HV44 -- -- 1 0.48 0.21 0.05 0.06 0.04 0.07 0.00 0.03
0.07 0.03 0.01 0.05 0.10 0.08 SEQID-03069 K9I985 -- -- 1 0.45 0.22
0.06 0.08 0.05 0.05 0.00 0.04 0.08 0.03 0.03 0.05 0.11 0.06
SEQID-03070 K9HT30 -- -- 0 0.47 0.24 0.08 0.06 0.05 0.05 0.00 0.02
0.09 0.04 0.01 0.06 0.08 0.07 SEQID-03071 K9I6L1 -- -- 1 0.41 0.16
0.07 0.11 0.02 0.07 0.00 0.03 0.12 0.03 0.02 0.04 0.07 0.12
SEQID-03072 K9H8Q7 -- -- 1 0.48 0.23 0.06 0.06 0.05 0.07 0.01 0.02
0.05 0.05 0.02 0.07 0.06 0.09 SEQID-03073 K9HRA9 -- -- 1 0.46 0.21
0.05 0.07 0.03 0.05 0.02 0.04 0.09 0.04 0.03 0.07 0.09 0.06
SEQID-03074 K9HDW7 -- -- 1 0.45 0.20 0.06 0.06 0.03 0.03 0.01 0.05
0.10 0.05 0.02 0.05 0.09 0.07 SEQID-03075 K9H7U6 -- -- 1 0.47 0.17
0.05 0.07 0.05 0.08 0.01 0.05 0.06 0.04 0.05 0.06 0.07 0.07
SEQID-03076 K9HES3 -- -- 1 0.46 0.21 0.04 0.08 0.05 0.05 0.01 0.04
0.08 0.03 0.03 0.06 0.10 0.07 SEQID-03077 K9HVW3 -- -- 1 0.51 0.22
0.05 0.13 0.02 0.03 0.01 0.04 0.05 0.03 0.05 0.05 0.10 0.13
SEQID-03078 K9HRT5 -- -- 1 0.45 0.21 0.06 0.12 0.05 0.02 0.00 0.05
0.09 0.03 0.01 0.08 0.08 0.12 SEQID-03079 K9HST7 -- -- 1 0.46 0.21
0.07 0.14 0.05 0.03 0.00 0.05 0.04 0.03 0.03 0.04 0.09 0.10
SEQID-03080 K9H972 -- -- 1 0.48 0.22 0.07 0.09 0.03 0.06 0.01 0.04
0.07 0.03 0.04 0.05 0.11 0.06 SEQID-03081 K9I188 -- -- 1 0.45 0.19
0.06 0.05 0.05 0.05 0.00 0.04 0.10 0.03 0.01 0.04 0.09 0.10
SEQID-03082 K9I379 -- -- 1 0.50 0.24 0.04 0.07 0.05 0.08 0.01 0.04
0.06 0.03 0.03 0.08 0.10 0.08 SEQID-03083 K9H9R8 -- -- 1 0.44 0.20
0.07 0.06 0.05 0.03 0.01 0.05 0.07 0.05 0.02 0.06 0.07 0.06
SEQID-03084 K9I8C2 -- -- 1 0.47 0.25 0.05 0.08 0.05 0.07 0.01 0.04
0.06 0.04 0.03 0.09 0.09 0.06 SEQID-03085 K9I5N9 -- -- 1 0.45 0.18
0.04 0.07 0.05 0.06 0.01 0.04 0.08 0.03 0.04 0.05 0.07 0.06
SEQID-03086 K9HMI3 -- -- 1 0.48 0.23 0.06 0.07 0.03 0.06 0.00 0.04
0.08 0.03 0.02 0.05 0.10 0.08 SEQID-03087 K9I6J8 -- -- 1 0.50 0.22
0.06 0.07 0.03 0.05 0.01 0.01 0.08 0.05 0.03 0.08 0.07 0.08
SEQID-03088 K9HM52 -- -- 1 0.50 0.23 0.02 0.15 0.06 0.07 0.01 0.06
0.09 0.04 0.04 0.06 0.09 0.11 SEQID-03089 K9I6I9 -- -- 1 0.51 0.26
0.02 0.12 0.06 0.07 0.01 0.04 0.06 0.04 0.03 0.10 0.08 0.09
SEQID-03090 K9HF90 -- -- 1 0.41 0.18 0.04 0.16 0.05 0.04 0.03 0.04
0.06 0.03 0.02 0.05 0.06 0.10 SEQID-03091 K9H895 -- -- 1 0.41 0.18
0.07 0.07 0.03 0.08 0.01 0.04 0.13 0.01 0.02 0.05 0.09 0.07
SEQID-03092 K9HYF2 -- -- 1 0.50 0.19 0.09 0.08 0.03 0.03 0.00 0.06
0.06 0.03 0.02 0.04 0.08 0.15 SEQID-03093 K9H8Q4 -- -- 1 0.50 0.28
0.07 0.05 0.05 0.05 0.00 0.02 0.07 0.05 0.02 0.06 0.12 0.08
SEQID-03094 K9HEE4 -- -- 1 0.48 0.22 0.06 0.06 0.05 0.06 0.02 0.03
0.07 0.04 0.04 0.05 0.09 0.07 SEQID-03095 K9HUG1 -- -- 1 0.48 0.19
0.04 0.05 0.04 0.07 0.01 0.05 0.08 0.03 0.05 0.06 0.08 0.05
SEQID-03096 K9HV61 -- -- 1 0.45 0.21 0.07 0.06 0.04 0.05 0.00 0.05
0.06 0.05 0.04 0.06 0.09 0.05 SEQID-03097 K9I1Z8 -- -- 0 0.51 0.18
0.03 0.09 0.01 0.06 0.02 0.06 0.04 0.04 0.02 0.07 0.08 0.1
SEQID-03098 K9I4C3 -- -- 1 0.48 0.20 0.04 0.15 0.03 0.05 0.01 0.06
0.07 0.05 0.03 0.09 0.06 0.10 SEQID-03099 K9HY15 -- -- 1 0.42 0.22
0.06 0.19 0.02 0.05 0.00 0.06 0.08 0.06 0.03 0.06 0.11 0.09
SEQID-03100 K9I3C6 -- -- 1 0.52 0.25 0.05 0.04 0.04 0.05 0.00 0.05
0.08 0.06 0.02 0.07 0.14 0.10 SEQID-03101 K9HE77 -- -- 1 0.48 0.21
0.04 0.15 0.02 0.06 0.01 0.05 0.06 0.03 0.02 0.07 0.08 0.13
SEQID-03102 K9HMK1 -- -- 1 0.48 0.19 0.06 0.09 0.02 0.04 0.00 0.04
0.07 0.04 0.02 0.06 0.08 0.15 SEQID-03103 K9HVM2 -- -- 0 0.48 0.21
0.07 0.07 0.03 0.04 0.00 0.06 0.03 0.07 0.00 0.04 0.09 0.09
SEQID-03104 K9I7D4 -- -- 1 0.49 0.22 0.07 0.05 0.03 0.05 0.01 0.04
0.10 0.04 0.02 0.06 0.06 0.123 SEQID-03105 K9HVE8 -- -- 1 0.48 0.22
0.05 0.06 0.04 0.06 0.01 0.04 0.08 0.06 0.03 0.07 0.07 0.0
SEQID-03106 K9HYK9 -- -- 1 0.45 0.21 0.06 0.07 0.04 0.08 0.00 0.05
0.08 0.06 0.02 0.07 0.08 0.03 SEQID-03107 K9H M1 -- -- 1 0.51 0.25
0.06 0.07 0.05 0.04 0.01 0.02 0.07 0.03 0.03 0.03 0.11 0.06
SEQID-03108 K9HE69 -- -- 1 0.47 0.21 0.06 0.07 0.08 0.02 0.01 0.09
0.03 0.05 0.02 0.07 0.06 0.02 SEQID-03109 K9HJ57 -- -- 1 0.37 0.17
0.06 0.11 0.02 0.09 0.01 0.04 0.13 0.04 0.03 0.06 0.06 0.09
SEQID-03110 K9I7S9 -- -- 1 0.40 0.17 0.02 0.21 0.06 0.02 0.01 0.04
0.03 0.04 0.06 0.04 0.05 0.10 SEQID-03111 K9I5Q6 -- -- 1 0.49 0.22
0.04 0.06 0.06 0.05 0.01 0.05 0.08 0.03 0.05 0.06 0.08 0.07
SEQID-03112 K9HMM0 -- -- 1 0.47 0.23 0.06 0.03 0.04 0.03 0.01 0.04
0.06 0.03 0.05 0.06 0.10 0.07 SEQID-03113 K9I794 -- -- 1 0.46 0.17
0.05 0.06 0.05 0.05 0.02 0.04 0.07 0.04 0.05 0.04 0.09 0.06
SEQID-03114 K9I1B2 -- -- 1 0.47 0.19 0.04 0.07 0.03 0.06 0.01 0.06
0.08 0.06 0.02 0.04 0.09 0.09 SEQID-03115 K9I6M4 -- -- 1 0.47 0.22
0.04 0.05 0.04 0.07 0.01 0.06 0.13 0.02 0.01 0.07 0.10 0.11
SEQID-03116 K9HWR2 -- -- 1 0.46 0.24 0.06 0.08 0.04 0.07 0.01 0.04
0.06 0.06 0.03 0.06 0.11 0.06 SEQID-03117 K9HA66 -- -- 1 0.45 0.20
0.07 0.06 0.05 0.07 0.01 0.04 0.06 0.05 0.03 0.07 0.08 0.07
SEQID-03118 K9HQF1 -- -- 1 0.48 0.20 0.04 0.03 0.04 0.07 0.01 0.04
0.07 0.04 0.03 0.05 0.08 0.06 SEQID-03119 K9HZD5 -- -- 1 0.55 0.18
0.04 0.04 0.05 0.07 0.01 0.04 0.04 0.07 0.03 0.04 0.05 0.10
SEQID-03120 K9HRRB -- -- 1 0.52 0.21 0.04 0.05 0.06 0.05 0.02 0.04
0.09 0.04 0.03 0.06 0.08 0.10 SEQID-03121 K9HM68 -- -- 1 0.49 0.21
0.07 0.12 0.00 0.05 0.01 0.04 0.05 0.06 0.01 0.05 0.09 0.10
SEQID-03122 K9I509 -- -- 1 0.45 0.20 0.10 0.07 0.05 0.06 0.01 0.04
0.07 0.06 0.03 0.08 0.06 0.05 SEQID-03123 K9HMX1 -- -- 0 0.46 0.27
0.08 0.03 0.03 0.06 0.01 0.04 0.05 0.05 0.02 0.06 0.11 0.07
SEQID-03124 K9HI03 -- -- 1 0.43 0.21 0.06 0.08 0.04 0.05 0.01 0.04
0.10 0.04 0.01 0.07 0.08 0.07 SEQID-03125 K9HPE6 -- -- 1 0.48 0.21
0.05 0.08 0.06 0.05 0.01 0.04 0.07 0.06 0.04 0.07 0.07 0.06
SEQID-03126 K9HE 5 -- -- 1 0.44 0.21 0.07 0.07 0.05 0.06 0.01 0.05
0.06 0.04 0.02 0.05 0.11 0.07 SEQID-03127 K9H4L4 -- -- 1 0.52 0.22
0.06 0.06 0.05 0.06 0.01 0.04 0.06 0.05 0.03 0.08 0.07 0.09
SEQID-03128 K9H4N1 -- -- 1 0.51 0.22 0.06 0.04 0.04 0.04 0.01 0.03
0.07 0.06 0.03 0.07 0.07 0.09 SEQID-03129 K9HK61 -- -- 1 0.50 0.20
0.06 0.05 0.04 0.05 0.01 0.03 0.07 0.05 0.05 0.06 0.09 0.06
SEQID-03130 K9HQA9 -- -- 1 0.53 0.26 0.05 0.07 0.02 0.02 0.02 0.04
0.06 0.06 0.03 0.08 0.11 0.05 SEQID-03131 K9HAR9 -- -- 1 0.45 0.22
0.05 0.09 0.03 0.07 0.01 0.03 0.08 0.05 0.02 0.06 0.10 0.07
SEQID-03132 K9I219 -- -- 1 0.46 0.20 0.05 0.03 0.04 0.07 0.01 0.06
0.06 0.04 0.03 0.06 0.09 0.06 SEQID-03133 K9HC31 -- -- 1 0.47 0.20
0.04 0.06 0.05 0.05 0.01 0.04 0.08 0.04 0.04 0.04 0.10 0.06
SEQID-03134 K9HCT6 -- -- 1 0.42 0.17 0.04 0.10 0.08 0.04 0.01 0.04
0.08 0.05 0.01 0.05 0.05 0.04 SEQID-03135 K9HHW4 -- -- 1 0.50 0.21
0.06 0.08 0.06 0.02 0.01 0.08 0.09
0.04 0.03 0.05 0.07 0.02 SEQID-03136 K9HP63 -- -- 1 0.48 0.21 0.03
0.13 0.04 0.05 0.01 0.04 0.08 0.02 0.01 0.06 0.08 0.13 SEQID-03137
K9HN29 -- -- 1 0.50 0.22 0.04 0.06 0.04 0.08 0.01 0.02 0.06 0.04
0.04 0.05 0.08 0.06 SEQID-03138 K9HQ79 -- -- 1 0.48 0.20 0.05 0.07
0.03 0.08 0.01 0.03 0.07 0.06 0.05 0.06 0.08 0.08 SEQID-03139
K9HPY6 -- -- 1 0.47 0.22 0.05 0.03 0.03 0.06 0.01 0.07 0.07 0.06
0.02 0.06 0.10 0.06 SEQID-03140 K9HJ92 -- -- 1 0.42 0.19 0.06 0.03
0.04 0.06 0.01 0.04 0.06 0.04 0.03 0.06 0.08 0.05 SEQID-03141
K9I7R9 -- -- 1 0.50 0.24 0.05 0.06 0.03 0.07 0.01 0.06 0.07 0.05
0.03 0.08 0.08 0.10 SEQID-03142 K9HJT2 -- -- 1 0.47 0.22 0.05 0.05
0.06 0.06 0.00 0.03 0.07 0.05 0.02 0.08 0.08 0.08 SEQID-03143
K9I574 -- -- 1 0.44 0.20 0.08 0.05 0.07 0.05 0.01 0.04 0.03 0.04
0.02 0.06 0.08 0.06 SEQID-03144 K9HQA4 -- -- 1 0.43 0.20 0.07 0.08
0.04 0.07 0.02 0.06 0.06 0.05 0.04 0.06 0.07 0.06 SEQID-03145
K9HZ97 -- -- 1 0.47 0.21 0.05 0.07 0.05 0.07 0.01 0.04 0.07 0.04
0.04 0.04 0.11 0.07 SEQID-03146 K9I361 -- -- 1 0.47 0.24 0.07 0.08
0.04 0.06 0.01 0.04 0.07 0.04 0.02 0.09 0.09 0.05 SEQID-03147
K9HBR0 -- -- 0 0.41 0.24 0.09 0.05 0.02 0.06 0.02 0.10 0.08 0.03
0.02 0.11 0.05 0.08 SEQID-03148 K9I7W3 -- -- 0 0.54 0.18 0.06 0.07
0.04 0.08 0.00 0.06 0.02 0.06 0.03 0.06 0.06 0.17 SEQID-03149
K9I1Y2 -- -- 1 0.48 0.29 0.01 0.14 0.06 0.06 0.01 0.04 0.04 0.05
0.04 0.12 0.08 0.07 SEQID-03150 K9HDT0 -- -- 1 0.42 0.16 0.03 0.11
0.06 0.06 0.02 0.04 0.06 0.04 0.01 0.05 0.05 0.04 SEQID-03151
K9HT24 -- -- 1 0.48 0.23 0.07 0.06 0.01 0.08 0.01 0.04 0.06 0.06
0.02 0.07 0.09 0.09 SEQID-03152 K9I2D5 -- -- 1 0.47 0.21 0.04 0.17
0.03 0.03 0.00 0.03 0.06 0.02 0.03 0.07 0.07 0.09 SEQID-03153
K9HI94 -- -- 1 0.45 0.17 0.08 0.14 0.04 0.06 0.00 0.04 0.07 0.06
0.04 0.05 0.06 0.11 SEQID-03154 K9I5L3 -- -- 1 0.48 0.25 0.06 0.10
0.05 0.07 0.00 0.06 0.05 0.03 0.02 0.09 0.09 0.10 SEQID-03155
K9HP79 -- -- 1 0.46 0.19 0.04 0.03 0.04 0.06 0.00 0.04 0.07 0.03
0.04 0.07 0.08 0.06 SEQID-03156 K9H767 -- -- 0 0.46 0.15 0.05 0.05
0.05 0.05 0.00 0.03 0.07 0.03 0.00 0.03 0.09 0.09 SEQID-03157
K9HEU3 -- -- 1 0.51 0.16 0.07 0.03 0.02 0.03 0.00 0.04 0.07 0.05
0.03 0.06 0.05 0.0 SEQID-03158 K9HGS4 -- -- 1 0.51 0.14 0.05 0.06
0.04 0.06 0.00 0.02 0.07 0.02 0.00 0.06 0.06 0.10 SEQID-03159
K9HNK9 -- -- 1 0.44 0.19 0.08 0.10 0.01 0.06 0.01 0.05 0.09 0.04
0.03 0.07 0.06 0.06 SEQID-03160 K9HG05 -- -- 1 0.43 0.23 0.07 0.07
0.04 0.07 0.02 0.05 0.06 0.04 0.01 0.07 0.10 0.05 SEQID-03161
K9HVR1 -- -- 1 0.51 0.20 0.04 0.07 0.03 0.06 0.01 0.04 0.07 0.04
0.07 0.05 0.07 0.07 SEQID-03162 K9HJD1 -- -- 1 0.40 0.14 0.06 0.05
0.03 0.05 0.02 0.09 0.09 0.05 0.06 0.04 0.07 0.09 SEQID-03163
K9HWF5 -- -- 1 0.49 0.22 0.07 0.05 0.03 0.07 0.01 0.04 0.08 0.04
0.01 0.05 0.10 0.12 SEQID-03164 K9HFM8 -- -- 1 0.47 0.24 0.06 0.05
0.05 0.07 0.03 0.03 0.07 0.05 0.01 0.0 0.09 0.09 SEQID-03165 K9HCU6
-- -- 1 0.47 0.18 0.05 0.06 0.03 0.05 0.00 0.04 0.09 0.05 0.03 0.05
0.08 0.09 SEQID-03166 K9I5M1 -- -- 1 0.46 0.23 0.05 0.07 0.06 0.07
0.00 0.03 0.07 0.04 0.04 0.07 0.11 0.06 SEQID-03167 K9HP80 -- -- 1
0.47 0.21 0.08 0.04 0.05 0.06 0.01 0.02 0.05 0.04 0.05 0.05 0.08
0.05 SEQID-03168 K9I3Y1 -- -- 1 0.48 0.23 0.07 0.05 0.05 0.05 0.01
0.04 0.07 0.05 0.02 0.0 0.07 0.0 SEQID-03169 K9HRV8 -- -- 0 0.46
0.24 0.07 0.08 0.03 0.06 0.00 0.05 0.08 0.05 0.02 0.07 0.09 0.06
SEQID-03170 K9HB49 -- -- 1 0.43 0.16 0.05 0.09 0.05 0.06 0.01 0.07
0.06 0.03 0.05 0.04 0.06 0.04 SEQID-03171 K9IB94 -- -- 1 0.47 0.22
0.04 0.07 0.02 0.05 0.02 0.04 0.08 0.04 0.05 0.06 0.09 0.05
SEQID-03172 K9I3N1 -- -- 1 0.49 0.24 0.05 0.06 0.03 0.05 0.01 0.04
0.08 0.04 0.03 0.06 0.10 0.07 SEQID-03173 K9HP17 -- -- 1 0.45 0.22
0.06 0.07 0.04 0.06 0.01 0.04 0.07 0.04 0.02 0.06 0.09 0.06
SEQID-03174 K9HRI9 -- -- 1 0.54 0.24 0.04 0.07 0.02 0.04 0.01 0.02
0.08 0.0 0.04 0.0 0.08 0.15 SEQID-03175 K9HXT8 -- -- 1 0.52 0.24
0.06 0.13 0.02 0.05 0.00 0.06 0.06 0.03 0.02 0.07 0.08 0.14
SEQID-03176 K9HZL6 -- -- 0 0.42 0.22 0.09 0.13 0.01 0.04 0.01 0.06
0.05 0.05 0.01 0.06 0.08 0.11 SEQID-03177 K9HHS6 -- -- 1 0.51 0.23
0.04 0.12 0.01 0.03 0.00 0.05 0.05 0.03 0.04 0.09 0.09 0.11
SEQID-03178 K9HJC3 -- -- 1 0.47 0.25 0.08 0.07 0.03 0.06 0.01 0.04
0.08 0.04 0.02 0.0 0.08 0.12 SEQID-03179 K9HXR3 -- -- 1 0.50 0.18
0.04 0.14 0.03 0.05 0.01 0.04 0.02 0.04 0.02 0.06 0.06 0.13
SEQID-03180 K9I3A2 -- -- 0 0.50 0.17 0.09 0.11 0.05 0.07 0.00 0.02
0.04 0.01 0.04 0.05 0.06 0.18 SEQID-03181 K9I737 -- -- 0 0.45 0.17
0.05 0.14 0.05 0.03 0.01 0.04 0.06 0.03 0.06 0.06 0.02 0.09
SEQID-03182 K9I4D4 -- -- 0 0.52 0.23 0.05 0.15 0.02 0.04 0.00 0.02
0.04 0.04 0.05 0.07 0.11 0.13 SEQID-03183 K9HA62 -- -- 1 0.55 0.26
0.03 0.06 0.05 0.06 0.01 0.04 0.05 0.03 0.02 0.06 0.13 0.16
SEQID-03184 K9H9H7 -- -- 1 0.57 0.26 0.08 0.06 0.03 0.04 0.02 0.05
0.02 0.03 0.05 0.09 0.12 0.06 SEQID-03185 K9HVR7 -- -- 1 0.46 0.21
0.04 0.08 0.04 0.06 0.01 0.04 0.08 0.04 0.03 0.04 0.07 0.06
SEQID-03186 K9HU08 -- -- 1 0.49 0.26 0.05 0.06 0.04 0.0 0.01 0.03
0.07 0.05 0.05 0.06 0.12 0.06 SEQID-03187 K9I3W7 -- -- 1 0.50 0.22
0.04 0.0 0.04 0.05 0.00 0.06 0.08 0.03 0.05 0.05 0.09 0.06
SEQID-03188 K9I5W6 -- -- 1 0.42 0.16 0.07 0.07 0.03 0.09 0.02 0.03
0.05 0.06 0.03 0.05 0.06 0.05 SEQID-03189 K9I0 0 -- -- 1 0.51 0.24
0.05 0.04 0.05 0.06 0.00 0.03 0.07 0.03 0.04 0.05 0.12 0.09
SEQID-03190 K9HPF6 -- -- 1 0.48 0.22 0.07 0.04 0.04 0.05 0.01 0.07
0.12 0.03 0.01 0.09 0.09 0.09 SEQID-03191 K9HZH4 -- -- 1 0.43 0.25
0.06 0.08 0.03 0.05 0.01 0.08 0.07 0.04 0.02 0.08 0.07 0.04
SEQID-03192 K9H560 -- -- 1 0.45 0.23 0.04 0.06 0.04 0.04 0.01 0.04
0.09 0.04 0.03 0.08 0.08 0.07 SEQID-03193 K9HMV4 -- -- 1 0.45 0.22
0.06 0.05 0.06 0.06 0.01 0.04 0.09 0.04 0.04 0.06 0.07 0.0
SEQID-03194 K9HNW8 -- -- 1 0.47 0.17 0.05 0.06 0.05 0.07 0.02 0.03
0.03 0.04 0.03 0.04 0.07 0.06 SEQID-03195 K9HPX5 -- -- 1 0.48 0.23
0.06 0.07 0.04 0.05 0.01 0.03 0.06 0.05 0.02 0.08 0.09 0.07
SEQID-03196 K9HUE6 -- -- 1 0.44 0.24 0.07 0.08 0.04 0.05 0.02 0.05
0.06 0.03 0.04 0.09 0.07 0.04 SEQID-03197 K9HUI8 -- -- 1 0.48 0.20
0.05 0.08 0.02 0.05 0.01 0.03 0.10 0.04 0.03 0.07 0.08 0.08
SEQID-03198 K9HCR7 -- -- 1 0.47 0.21 0.07 0.06 0.03 0.06 0.02 0.03
0.09 0.04 0.07 0.06 0.10 0.06 SEQID-03199 K9HE21 -- -- 1 0.48 0.23
0.04 0.07 0.04 0.06 0.00 0.04 0.08 0.04 0.02 0.06 0.13 0.05
SEQID-03200 K9HEI4 -- -- 1 0.47 0.24 0.06 0.09 0.04 0.06 0.00 0.04
0.07 0.03 0.04 0.05 0.11 0.05 SEQID-03201 K9HY34 -- -- 1 0.49 0.21
0.07 0.06 0.04 0.06 0.01 0.05 0.06 0.06 0.02 0.08 0.08 0.09
SEQID-03202 K9HS49 -- -- 1 0.48 0.20 0.05 0.03 0.03 0.06 0.01 0.06
0.07 0.05 0.03 0.07 0.07 0.07 SEQID-03203 K9H5L7 -- -- 1 0.45 0.22
0.06 0.07 0.06 0.04 0.01 0.05 0.09 0.03 0.04 0.06 0.10 0.05
SEQID-03204 K9I6Y5 -- -- 1 0.50 0.20 0.06 0.06 0.04 0.09 0.01 0.03
0.09 0.05 0.04 0.05 0.07 0.10 SEQID-03205 K9HUY3 -- -- 1 0.46 0.22
0.05 0.07 0.03 0.06 0.01 0.05 0.09 0.04 0.02 0.06 0.08 0.07
SEQID-03206 K9ICM5 -- -- 1 0.49 0.21 0.05 0.05 0.03 0.06 0.00 0.05
0.07 0.03 0.04 0.06 0.09 0.07 SEQID-03207 K9HFN2 -- -- 1 0.50 0.17
0.04 0.05 0.04 0.07 0.01 0.03 0.07 0.04 0.04 0.04 0.07 0.07
SEQID-03208 K9I3M2 -- -- 1 0.46 0.17 0.04 0.07 0.04 0.09 0.01 0.04
0.05 0.03 0.04 0.05 0.07 0.07 SEQID-03209 K9HV87 -- -- 1 0.42 0.17
0.05 0.07 0.06 0.08 0.01 0.04 0.06 0.05 0.04 0.04 0.07 0.04
SEQID-03210 K9I6W6 -- -- 1 0.45 0.21 0.05 0.09 0.05 0.05 0.02 0.06
0.05 0.04 0.03 0.06 0.08 0.06 SEQID-03211 K9HXM7 -- -- 1 0.47 0.22
0.05 0.08 0.04 0.07 0.01 0.03 0.08 0.05 0.02 0.05 0.10 0.07
SEQID-03212 K9HBK9 -- -- 1 0.46 0.24 0.06 0.09 0.03 0.05 0.00 0.03
0.08 0.04 0.03 0.05 0.10 0.08 SEQID-03213 K9HH69 -- -- 1 0.43 0.21
0.07 0.08 0.04 0.06 0.01 0.04 0.08 0.03 0.03 0.05 0.10 0.05
SEQID-03214 K9HKG7 -- -- 0 0.43 0.23 0.04 0.19 0.02 0.03 0.00 0.01
0.05 0.03 0.02 0.03 0.09 0.12 SEQID-03215 K9I3L2 -- -- 1 0.59 0.23
0.08 0.07 0.02 0.04 0.00 0.02 0.03 0.02 0.05 0.09 0.09 0.21
SEQID-03216 K9HK97 -- -- 1 0.44 0.20 0.04 0.17 0.04 0.01 0.00 0.03
0.03 0.05 0.02 0.07 0.06 0.11 SEQID-03217 K9HLM3 -- -- 0 0.43 0.18
0.11 0.18 0.01 0.03 0.00 0.07 0.06 0.02 0.02 0.04 0.10 0.11
SEQID-03218 K9HB34 -- -- 0 0.43 0.21 0.04 0.17 0.04 0.06 0.00 0.04
0.08 0.02 0.02 0.06 0.098 0.09 SEQID-03219 K9HHM4 -- -- 1 0.53 0.19
0.03 0.11 0.04 0.02 0.00 0.02 0.06 0.07 0.08 0.05 0.07 0.12
SEQID-03220 K9I2C7 -- -- 1 0.41 0.14 0.04 0.10 0.03 0.03 0.01 0.03
0.06 0.03 0.01 0.02 0.07 0.07 SEQID-03221 K I0P4 -- -- 0 0.46 0.23
0.07 0.14 0.01 0.05 0.01 0.04 0.06 0.05 0.03 0.05 0.08 0.07
SEQID-03222 K9HQL8 -- -- 0 0.48 0.25 0.04 0.13 0.05 0.05 0.00 0.05
0.09 0.02 0.02 0.05 0.10 0.10 SEQID-03223 K9HQV1 -- -- 1 0.43 0.20
0.05 0.06 0.05 0.07 0.00 0.03 0.09 0.05 0.01 0.07 0.06 0.08
SEQID-03224 K9I5G0 -- -- 1 0.45 0.24 0.04 0.09 0.02 0.06 0.00 0.01
0.09 0.03 0.02 0.07 0.11 0.07 SEQID-03225 K9ICR1 -- -- 1 0.47 0.18
0.07 0.19 0.04 0.03 0.00 0.05 0.06 0.03 0.04 0.05 0.07 0.15
SEQID-03226 K9HNM9 -- -- 1 0.40 0.15 0.07 0.16 0.04 0.03 0.00 0.06
0.06 0.04 0.04 0.05 0.07 0.11 SEQID-03227 K9HSQ2 -- -- 1 0.48 0.24
0.04 0.10 0.02 0.06 0.01 0.05 0.07 0.04 0.03 0.06 0.08 0.03
SEQID-03228 K9HPQ3 -- -- 1 0.43 0.22 0.07 0.03 0.03 0.05 0.00 0.03
0.11 0.04 0.03 0.06 0.10 0.08 SEQID-03229 K9H7S5 -- -- 1 0.50 0.26
0.06 0.06 0.04 0.06 0.01 0.03 0.07 0.05 0.02 0.06 0.08 0.07
SEQID-03230 K9HUD2 -- -- 1 0.48 0.27 0.07 0.03 0.04 0.06 0.00 0.04
0.06 0.05 0.01 0.07 0.09 0.07 SEQID-03231 K9HP00 -- -- 0 0.40 0.18
0.07 0.03 0.04 0.05 0.00 0.06 0.09 0.04 0.04 0.04 0.09 0.06
SEQID-03232 K9I605 -- -- 1 0.51 0.26 0.04 0.05 0.04 0.04 0.00 0.04
0.10 0.04 0.03 0.10 0.11 0.09 SEQID-03233 K9HHI3 -- -- 1 0.48 0.21
0.05 0.11 0.03 0.06 0.01 0.05 0.08 0.02 0.04 0.06 0.08 0.06
SEQID-03234 K9I 5 -- -- 1 0.47 0.21 0.03 0.03 0.03 0.06 0.01 0.04
0.09 0.04 0.05 0.06 0.08 0.04 SEQID-03235 K9HTL8 -- -- 1 0.46 0.24
0.03 0.10 0.05 0.06 0.01 0.07 0.09 0.03 0.04 0.08 0.08 0.06
SEQID-03236 K9HZX9 -- -- 1 0.41 0.18 0.06 0.03 0.04 0.06 0.09 0.04
0.04 0.06 0.01 0.04 0.08 0.03 SEQID-03237 K9HV97 -- -- 1 0.42 0.18
0.07 0.11 0.05 0.0 0.09 0.02 0.04 0.04 0.03 0.06 0.07 0.03
SEQID-03238 K9HKZ1 -- -- 1 0.48 0.25 0.07 0.04 0.04 0.05 0.01 0.07
0.08 0.02 0.00 0.09 0.09 0.06 SEQID-03239 K9HNA4 -- -- 1 0.46 0.20
0.08 0.04 0.04 0.07 0.01 0.07 0.10 0.03 0.01 0.08 0.09 0.08
SEQID-03240 K9HR04 -- -- 1 0.46 0.22 0.07 0.09 0.03 0.05 0.01 0.02
0.08 0.04 0.02 0.05 0.08 0.06 SEQID-03241 K9I209 -- -- 1 0.45 0.16
0.04 0.09 0.03 0.05 0.01 0.03 0.09 0.04 0.05 0.05 0.07 0.05
SEQID-03242 K9I4P0 -- -- 1 0.46 0.23 0.07 0.07 0.04 0.05 0.01 0.02
0.09 0.04 0.03 0.05 0.10 0.08 SEQID-03243 K9I7A5 -- -- 1 0.47 0.22
0.06 0.03 0.03 0.05 0.01 0.05 0.08 0.04 0.03 0.07 0.10 0.06
SEQID-03244 K9HKA6 -- -- 1 0.46 0.17 0.05 0.06 0.05 0.05 0.01 0.07
0.05 0.05 0.03 0.05 0.07 0.04 SEQID-03245 K9I1J7 -- -- 1 0.48 0.20
0.07 0.05 0.04 0.05 0.02 0.03 0.09 0.05 0.07 0.08 0.08 0.05
SEQID-03246 K9I4A6 -- -- 1 0.47 0.27 0.05 0.07 0.04 0.06 0.01 0.05
0.06 0.04 0.03 0.07 0.09 0.06 SEQID-03247 K9HJ05 -- -- 1 0.43 0.20
0.05 0.10 0.04 0.06 0.02 0.04 0.07 0.03 0.04 0.07 0.09 0.05
SEQID-03248 K9HP50 -- -- 1 0.50 0.22 0.05 0.07 0.04 0.07 0.00 0.03
0.06 0.04 0.03 0.08 0.07 0.07 SEQID-03249 K9HY17 -- -- 1 0.53 0.30
0.05 0.07 0.03 0.03 0.01 0.04 0.05 0.04 0.01 0.09 0.14 0.04
SEQID-03250 K9HXU7 -- -- 1 0.47 0.18 0.09 0.05 0.05 0.06 0.00 0.03
0.07 0.04 0.03 0.04 0.08 0.08 SEQID-03251 K9I7E8 -- -- 1 0.43 0.21
0.06 0.09 0.06 0.06 0.01 0.04 0.09 0.04 0.02 0.05 0.09 0.07
SEQID-03252 K9I783 -- -- 1 0.49 0.22 0.06 0.07 0.03 0.05 0.00 0.05
0.10 0.02 0.03 0.05 0.12 0.10 SEQID-03253 K9HBS2 -- -- 1 0.48 0.21
0.05 0.07 0.05 0.06 0.01 0.04 0.08 0.03 0.06 0.06 0.09 0.07
SEQID-03254 K9HB75 -- -- 1 0.45 0.21 0.06 0.03 0.05 0.06 0.01 0.03
0.07 0.06 0.04 0.03 0.08 0.06 SEQID-03255 K9HWN9 -- -- 1 0.52 0.25
0.07 0.07 0.04 0.04 0.01 0.02 0.05 0.04 0.02 0.03 0.10 0.04
SEQID-03256 K9HS66 -- -- 1 0.44 0.19 0.07 0.09 0.03 0.06 0.01 0.04
0.08 0.05 0.05 0.06 0.08 0.05 SEQID-03257 K9H5W9 -- -- 1 0.45 0.20
0.03 0.09 0.03 0.05 0.01 0.05 0.10 0.03 0.05 0.05 0.10 0.07
SEQID-03258 K9HDE7 -- -- 1 0.50 0.21 0.06 0.07 0.02 0.06 0.01 0.02
0.07 0.05 0.05 0.07 0.07 0.07 SEQID-03259 K9HXH0 -- -- 1 0.47 0.21
0.05 0.06 0.05 0.07 0.00 0.04 0.10 0.05 0.02 0.06 0.08 0.09
SEQID-03260 K9HJZ1 -- -- 1 0.53 0.23 0.04 0.06 0.04 0.05 0.00 0.04
0.04 0.03 0.04 0.07 0.10 0.05
SEQID-03261 K9I493 -- -- 1 0.42 0.21 0.06 0.10 0.04 0.09 0.01 0.04
0.09 0.04 0.01 0.07 0.09 0.06 SEQID-03262 K9HTI2 -- -- 1 0.45 0.22
0.06 0.10 0.04 0.06 0.01 0.04 0.07 0.05 0.04 0.07 0.09 0.05
SEQID-03263 K9ISB7 -- -- 1 0.46 0.27 0.05 0.09 0.03 0.06 0.00 0.04
0.06 0.03 0.02 0.07 0.12 0.05 SEQID-03264 K9HZD7 -- -- 1 0.48 0.23
0.06 0.07 0.03 0.06 0.01 0.03 0.07 0.05 0.03 0.03 0.09 0.07
SEQID-03265 K9HS81 -- -- 1 0.49 0.20 0.03 0.06 0.04 0.07 0.01 0.04
0.09 0.03 0.04 0.06 0.09 0.09 SEQID-03266 K9I1P6 -- -- 1 0.49 0.22
0.04 0.09 0.04 0.04 0.01 0.04 0.05 0.04 0.03 0.07 0.10 0.05
SEQID-03267 K9IB16 -- -- 1 0.45 0.17 0.06 0.12 0.03 0.08 0.00 0.05
0.09 0.01 0.05 0.04 0.07 0.07 SEQID-03268 K9HBH5 -- -- 1 0.38 0.16
0.09 0.17 0.06 0.03 0.04 0.00 0.05 0.04 0.03 0.06 0.01 0.12
SEQID-03269 K9HG97 -- -- 0 0.41 0.23 0.09 0.09 0.04 0.03 0.00 0.05
0.08 0.08 0.03 0.04 0.12 0.13 SEQID-03270 K9HJ84 -- -- 1 0.48 0.18
0.05 0.09 0.04 0.03 0.02 0.02 0.10 0.04 0.02 0.03 0.09 0.11
SEQID-03271 K9HNE7 -- -- 1 0.42 0.21 0.09 0.04 0.06 0.07 0.06 0.05
0.00 0.04 0.03 0.03 0.05 0.04 SEQID-03272 K9HE11 -- -- 0 0.48 0.15
0.10 0.06 0.02 0.02 0.00 0.02 0.07 0.03 0.02 0.07 0.04 0.19
SEQID-03273 K9HHP1 -- -- 1 0.44 0.18 0.04 0.09 0.04 0.08 0.02 0.02
0.03 0.03 0.02 0.07 0.08 0.05 SEQID-03274 K9HIA6 -- -- 1 0.55 0.27
0.04 0.02 0.04 0.04 0.01 0.02 0.10 0.03 0.06 0.10 0.12 0.11
SEQID-03275 K9HNG3 -- -- 1 0.48 0.21 0.04 0.12 0.06 0.04 0.01 0.02
0.06 0.06 0.01 0.04 0.08 0.17 SEQID-03276 K9H7R8 -- -- 1 0.46 0.13
0.07 0.17 0.01 0.02 0.00 0.08 0.05 0.04 0.02 0.05 0.04 0.17
SEQID-03277 K9HK80 -- -- 0 0.41 0.20 0.08 0.0 0.03 0.04 0.02 0.02
0.09 0.05 0.00 0.07 0.09 0.06 SEQID-03278 K9HT12 -- -- 1 0.40 0.17
0.05 0.12 0.03 0.04 0.00 0.05 0.09 0.05 0.02 0.04 0.08 0.09
SEQID-03279 K9HZV3 -- -- 1 0.50 0.16 0.03 0.04 0.04 0.05 0.00 0.03
0.07 0.05 0.02 0.04 0.07 0.05 SEQID-03280 K9IGL3 -- -- 0 0.48 0.19
0.05 0.02 0.04 0.09 0.01 0.03 0.10 0.03 0.00 0.04 0.08 0.12
SEQID-03281 K9H6B7 -- -- 1 0.41 0.19 0.07 0.12 0.05 0.06 0.01 0.04
0.04 0.03 0.01 0.06 0.12 0.04 SEQID-03282 K9HB61 -- -- 0 0.48 0.23
0.05 0.09 0.03 0.04 0.01 0.06 0.07 0.02 0.01 0.05 0.12 0.09
SEQID-03283 K9I5V8 -- -- 1 0.44 0.23 0.05 0.11 0.04 0.09 0.01 0.05
0.04 0.03 0.04 0.07 0.07 0.05 SEQID-03284 K9I6Q8 -- -- 1 0.46 0.22
0.06 0.07 0.05 0.06 0.01 0.04 0.07 0.03 0.02 0.07 0.08 0.08
SEQID-03285 K9HEZ0 -- -- 1 0.47 0.23 0.08 0.05 0.03 0.05 0.01 0.04
0.07 0.04 0.03 0.09 0.08 0.06 SEQID-03286 K9HAI6 -- -- 1 0.50 0.21
0.098 0.04 0.07 0.04 0.00 0.04 0.07 0.03 0.06 0.08 0.10 0.0
SEQID-03287 K9HQU8 -- -- 1 0.44 0.20 0.06 0.07 0.04 0.06 0.02 0.04
0.06 0.06 0.03 0.06 0.06 0.04 SEQID-03288 K9HRI1 -- -- 1 0.53 0.20
0.03 0.02 0.04 0.07 0.00 0.04 0.08 0.02 0.06 0.05 0.09 0.10
SEQID-03289 K9HWB2 -- -- 1 0.46 0.25 0.08 0.06 0.05 0.04 0.01 0.05
0.08 0.04 0.01 0.08 0.07 0.07 SEQID-03290 K9I4L8 -- -- 1 0.41 0.15
0.04 0.06 0.03 0.09 0.00 0.07 0.03 0.09 0.02 0.04 0.06 0.04
SEQID-03291 K9IAZ9 -- -- 1 0.48 0.22 0.06 0.07 0.02 0.06 0.01 0.07
0.12 0.03 0.04 0.06 0.09 0.06 SEQID-03292 K9HC09 -- -- 1 0.49 0.20
0.05 0.0 0.05 0.06 0.02 0.03 0.06 0.05 0.02 0.05 0.07 0.06
SEQID-03293 K9KG89 -- -- 0 0.50 0.23 0.06 0.06 0.02 0.04 0.00 0.04
0.07 0.04 0.00 0.07 0.09 0.10 SEQID-03294 K9HYS1 -- -- 1 0.54 0.22
0.07 0.07 0.03 0.02 0.00 0.05 0.01 0.02 0.02 0.06 0.11 0.05
SEQID-03295 K9H7W0 -- -- 1 0.45 0.19 0.05 0.07 0.03 0.06 0.01 0.06
0.07 0.04 0.03 0.05 0.09 0.06 SEQID-03296 K9HZB7 -- -- 1 0.44 0.25
0.08 0.09 0.03 0.05 0.00 0.07 0.08 0.03 0.01 0.08 0.09 0.06
SEQID-03297 K9I599 -- -- 1 0.62 0.29 0.07 0.03 0.02 0.02 0.00 0.02
0.04 0.03 0.05 0.11 0.12 0.05 SEQID-03298 K9HF28 -- -- 1 0.44 0.25
0.06 0.11 0.04 0.05 0.00 0.06 0.07 0.04 0.03 0.06 0.12 0.06
SEQID-03299 K9HS24 -- -- 0 0.47 0.25 0.05 0.06 0.06 0.06 0.01 0.02
0.06 0.05 0.01 0.09 0.10 0.07 SEQID-03300 K9HVI9 -- -- 1 0.54 0.25
0.07 0.04 0.03 0.04 0.00 0.03 0.07 0.05 0.01 0.07 0.09 0.10
SEQID-03301 K9I0Z6 -- -- 1 0.45 0.22 0.07 0.08 0.04 0.04 0.01 0.04
0.09 0.05 0.01 0.08 0.08 0.06 SEQID-03302 K9HG59 -- -- 1 0.47 0.23
0.07 0.05 0.02 0.05 0.03 0.04 0.07 0.05 0.05 0.08 0.07 0.07
SEQID-03303 K9HA97 -- -- 1 0.52 0.30 0.07 0.06 0.04 0.05 0.01 0.02
0.07 0.04 0.03 0.08 0.16 0.07 SEQID-03304 K9HJX8 -- -- 1 0.47 0.25
0.06 0.07 0.02 0.05 0.02 0.04 0.07 0.05 0.05 0.06 0.10 0.06
SEQID-03305 K9HL00 -- -- 1 0.50 0.23 0.05 0.08 0.03 0.07 0.01 0.02
0.07 0.04 0.05 0.07 0.08 0.07 SEQID-03306 K9I4Y2 -- -- 0 0.46 0.24
0.08 0.05 0.04 0.06 0.01 0.05 0.06 0.05 0.02 0.08 0.06 0.08
SEQID-03307 K9I6P1 -- -- 1 0.47 0.19 0.07 0.05 0.08 0.06 0.01 0.04
0.04 0.03 0.02 0.04 0.11 0.04 SEQID-03308 K9HYS9 -- -- 1 0.46 0.21
0.05 0.07 0.04 0.05 0.01 0.03 0.07 0.05 0.03 0.05 0.09 0.07
SEQID-03309 K9HZC3 -- -- 1 0.47 0.20 0.03 0.10 0.05 0.07 0.00 0.06
0.11 0.02 0.04 0.06 0.09 0.09 SEQID-03310 K9I376 -- -- 1 0.46 0.21
0.05 0.07 0.05 0.04 0.01 0.05 0.05 0.05 0.04 0.06 0.07 0.04
SEQID-03311 K9IA06 -- -- 1 0.43 0.20 0.03 0.10 0.03 0.05 0.01 0.04
0.05 0.03 0.04 0.04 0.10 0.02 SEQID-03312 K9HZ98 -- -- 0 0.46 0.25
0.05 0.10 0.03 0.04 0.01 0.05 0.10 0.04 0.02 0.07 0.10 0.09
SEQID-03313 K9I4C4 -- -- 1 0.48 0.25 0.04 0.10 0.03 0.08 0.01 0.06
0.07 0.03 0.01 0.08 0.09 0.05 SEQID-03314 K9I7S4 -- -- 1 0.44 0.20
0.06 0.08 0.04 0.05 0.00 0.05 0.08 0.05 0.01 0.05 0.08 0.08
SEQID-03315 K9I9Q1 -- -- 1 0.52 0.25 0.06 0.04 0.05 0.06 0.00 0.02
0.08 0.05 0.02 0.06 0.11 0.12 SEQID-03316 K9I3E2 -- -- 1 0.50 0.18
0.04 0.05 0.03 0.04 0.00 0.03 0.08 0.05 0.05 0.04 0.09 0.08
SEQID-03317 K9IBU9 -- -- 1 0.45 0.21 0.07 0.08 0.05 0.05 0.01 0.04
0.06 0.04 0.03 0.06 0.10 0.07 SEQID-03318 K9I7V8 -- -- 1 0.45 0.20
0.09 0.06 0.03 0.06 0.00 0.03 0.08 0.03 0.01 0.07 0.07 0.09
SEQID-03319 K9HS31 -- -- 1 0.42 0.19 0.04 0.09 0.03 0.06 0.01 0.04
0.07 0.04 0.03 0.07 0.07 0.05 SEQID-03320 K9HBKS -- -- 1 0.49 0.24
0.05 0.06 0.04 0.05 0.01 0.03 0.07 0.04 0.06 0.07 0.11 0.06
SEQID-03321 K9HS -- -- 1 0.47 0.22 0.04 0.10 0.02 0.07 0.00 0.05
0.08 0.04 0.03 0.05 0.11 0.06 SEQID-03322 K9HY69 -- -- 1 0.48 0.24
0.06 0.08 0.04 0.06 0.02 0.03 0.07 0.03 0.01 0.08 0.09 0.07
SEQID-03323 K9I3V1 -- -- 1 0.47 0.25 0.06 0.05 0.06 0.05 0.01 0.02
0.08 0.05 0.03 0.08 0.09 0.06 SEQID-03324 K9I3X6 -- -- 1 0.48 0.22
0.05 0.06 0.06 0.05 0.01 0.04 0.07 0.03 0.05 0.06 0.10 0.06
SEQID-03325 K9H2Q3 -- -- 1 0.44 0.21 0.07 0.07 0.03 0.05 0.00 0.04
0.08 0.03 0.04 0.07 0.09 0.06 SEQID-03326 K9HTU2 -- -- 1 0.47 0.23
0.08 0.07 0.04 0.04 0.01 0.03 0.08 0.05 0.02 0.05 0.09 0.07
SEQID-03327 K9HX91 -- -- 1 0.46 0.18 0.05 0.08 0.03 0.07 0.01 0.03
0.09 0.03 0.03 0.04 0.10 0.07 SEQID-03328 K9HZK9 -- -- 1 0.46 0.21
0.07 0.07 0.05 0.05 0.01 0.06 0.05 0.05 0.02 0.07 0.08 0.06
SEQID-03329 K9I853 -- -- 1 0.34 0.17 0.07 0.04 0.07 0.07 0.03 0.04
0.04 0.05 0.00 0.04 0.08 0.02 SEQID-03330 K9I6R8 -- -- 1 0.48 0.17
0.04 0.04 0.04 0.06 0.01 0.04 0.08 0.04 0.04 0.04 0.09 0.06
SEQID-03331 K3HIF4 -- -- 1 0.46 0.19 0.05 0.07 0.04 0.08 0.01 0.04
0.06 0.03 0.04 0.05 0.09 0.05 SEQID-03332 K9H9TB -- -- 1 0.49 0.20
0.06 0.07 0.03 0.05 0.01 0.05 0.06 0.03 0.05 0.05 0.09 0.05
SEQID-03333 K9HBVY6 -- -- 1 0.50 0.22 0.06 0.09 0.03 0.03 0.01 0.04
0.07 0.04 0.01 0.05 0.12 0.04 SEQID-03334 K9HKC5 -- -- 1 0.46 0.21
0.07 0.07 0.05 0.07 0.00 0.04 0.09 0.04 0.02 0.07 0.07 0.09
SEQID-03335 K9HT37 -- -- 1 0.50 0.27 0.06 0.08 0.04 0.04 0.01 0.02
0.05 0.04 0.03 0.10 0.09 0.05 SEQID-03336 K9HPY2 -- -- 1 0.48 0.21
0.09 0.05 0.04 0.05 0.01 0.04 0.06 0.05 0.02 0.06 0.07 0.08
SEQID-03337 K9HWU9 -- -- 1 0.43 0.20 0.07 0.07 0.05 0.07 0.01 0.03
0.06 0.05 0.02 0.06 0.07 0.04 SEQID-03338 K9HX18 -- -- 1 0.52 0.24
0.04 0.07 0.04 0.05 0.01 0.04 0.08 0.03 0.04 0.07 0.11 0.04
SEQID-03339 K9HZ01 -- -- 1 0.46 0.22 0.06 0.08 0.05 0.07 0.01 0.04
0.06 0.03 0.04 0.05 0.10 0.05 SEQID-03340 K9HPA6 -- -- 1 0.49 0.21
0.05 0.06 0.05 0.05 0.01 0.04 0.06 0.03 0.02 0.06 0.09 0.07
SEQID-03341 K9HCQ7 -- -- 1 0.46 0.20 0.05 0.09 0.04 0.05 0.01 0.03
0.06 0.05 0.03 0.06 0.08 0.03 SEQID-03342 K9IDW4 -- -- 1 0.45 0.19
0.05 0.09 0.04 0.06 0.01 0.05 0.07 0.04 0.05 0.05 0.08 0.06
SEQID-03343 K9HZG6 -- -- 1 0.49 0.20 0.05 0.07 0.05 0.07 0.01 0.03
0.08 0.03 0.03 0.05 0.09 0.09 SEQID-03344 K9IB19 -- -- 1 0.47 0.20
0.05 0.06 0.03 0.09 0.01 0.03 0.10 0.03 0.03 0.06 0.08 0.08
SEQID-03345 K9HB63 -- -- 1 0.48 0.25 0.07 0.06 0.04 0.05 0.01 0.04
0.07 0.04 0.02 0.07 0.10 0.07 SEQID-03346 77737588 -- -- 1 0.49
0.22 0.08 0.05 0.00 0.04 0.01 0.10 0.02 0.08 0.04 0.05 0.10 0.05
SEQID-03347 77737572 -- -- 1 0.48 0.21 0.08 0.05 0.00 0.03 0.01
0.10 0.03 0.08 0.04 0.05 0.10 0.06 SEQID-03348 218319228 -- -- 1
0.51 0.24 0.05 0.07 0.03 0.05 0.02 0.02 0.06 0.04 0.01 0.07 0.09
0.05 SEQID-03349 P48417 -- -- 1 0.47 0.21 0.05 0.06 0.04 0.05 0.01
0.03 0.07 0.03 0.01 0.05 0.10 0.08 SEQID-03350 57118119 -- -- 1
0.47 0.21 0.05 0.07 0.02 0.06 0.01 0.03 0.09 0.04 0.03 0.07 0.07
0.06 SEQID-03351 76056895 -- -- 1 0.39 0.15 0.07 0.11 0.06 0.04
0.03 0.04 0.06 0.04 0.02 0.05 0.05 0.03 SEQID-03352 41411212 -- --
1 0.50 0.23 0.08 0.04 0.05 0.07 0.02 0.01 0.07 0.05 0.01 0.06 0.06
0.13 SEQID-03353 296511511 -- -- 1 0.47 0.18 0.04 0.10 0.05 0.06
0.00 0.01 0.14 0.03 0.02 0.05 0.06 0.10 SEQID-03354 20502190 -- --
1 0.33 0.14 0.04 0.09 0.01 0.04 0.04 0.26 0.05 0.06 0.01 0.05 0.05
0.03 SEQID-03355 20502192 -- -- 1 0.32 0.15 0.04 0.10 0.01 0.05
0.04 0.24 0.05 0.05 0.01 0.04 0.07 0.04 SEQID-03356 237637012 -- --
1 0.45 0.19 0.06 0.09 0.03 0.05 0.02 0.03 0.09 0.05 0.04 0.04 0.09
0.06 SEQID-03357 P82381 -- -- 1 0.48 0.20 0.06 0.12 0.07 0.05 0.03
0.00 0.07 0.04 0.05 0.04 0.03 0.07 SEQID-03358 295416082 -- -- 1
0.47 0.23 0.04 0.22 0.02 0.03 0.00 0.02 0.04 0.07 0.02 0.07 0.08
0.11 SEQID-03359 257712682 -- -- 1 0.46 0.23 0.04 0.09 0.03 0.03
0.01 0.07 0.07 0.04 0.02 0.06 0.10 0.05 SEQID-03360 206981241 -- --
1 0.51 0.16 0.09 0.06 0.04 0.02 0.00 0.02 0.11 0.02 0.02 0.06 0.05
0.23 SEQID-03361 77737574 -- -- 1 0.47 0.25 0.08 0.05 0.01 0.03
0.00 0.10 0.02 0.07 0.03 0.06 0.11 0.03 SEQID-03362 257712524 -- --
1 0.44 0.16 0.06 0.14 0.04 0.04 0.03 0.05 0.04 0.04 0.03 0.05 0.06
0.11 SEQID-03363 395146536 -- -- 1 0.47 0.21 0.05 0.06 0.03 0.08
0.01 0.03 0.09 0.04 0.02 0.06 0.10 0.09 SEQID-03364 227304504 -- --
1 0.54 0.22 0.04 0.11 0.05 0.05 0.01 0.02 0.04 0.04 0.04 0.07 0.10
0.13 SEQID-03365 77737580 -- -- 1 0.51 0.26 0.08 0.06 0.01 0.03
0.00 0.10 0.01 0.06 0.03 0.07 0.11 0.03 SEQID-03366 219922540 -- --
1 0.45 0.18 0.06 0.09 0.07 0.03 0.03 0.04 0.02 0.06 0.01 0.05 0.07
0.03 SEQID-03367 395146556 -- -- 1 0.45 0.24 0.09 0.06 0.06 0.04
0.00 0.01 0.06 0.05 0.01 0.08 0.10 0.06 SEQID-03368 395146543 -- --
1 0.48 0.26 0.07 0.04 0.07 0.05 0.01 0.03 0.07 0.06 0.01 0.06 0.10
0.09 SEQID-03369 219725692 -- -- 1 0.42 0.17 0.09 0.07 0.04 0.07
0.01 0.07 0.06 0.04 0.02 0.07 0.06 0.04 SEQID-03370 290760343 -- --
1 0.56 0.24 0.02 0.07 0.03 0.08 0.03 0.03 0.09 0.04 0.02 0.05 0.14
0.15 SEQID-03371 257672199 -- -- 1 0.43 0.23 0.09 0.10 0.03 0.03
0.01 0.04 0.06 0.06 0.02 0.05 0.11 0.13 SEQID-03372 77737576 -- --
1 0.48 0.26 0.08 0.06 0.01 0.02 0.00 0.10 0.02 0.07 0.03 0.06 0.11
0.02 SEQID-03373 218339750 -- -- 1 0.46 0.28 0.06 0.08 0.05 0.07
0.02 0.04 0.07 0.07 0.02 0.08 0.12 0.04 SEQID-03374 218401648 -- --
1 0.55 0.21 0.04 0.04 0.03 0.05 0.00 0.02 0.06 0.07 0.04 0.05 0.10
0.13 SEQID-03375 168304 -- -- 1 0.52 0.26 0.02 0.07 0.03 0.08 0.00
0.09 0.08 0.04 0.02 0.10 0.12 0.11 SEQID-03376 296520445 -- -- 1
0.47 0.23 0.09 0.07 0.04 0.04 0.01 0.04 0.07 0.06 0.01 0.07 0.06
0.08 SEQID-03377 219789721 -- -- 1 0.48 0.25 0.08 0.05 0.05 0.05
0.02 0.04 0.06 0.04 0.02 0.06 0.09 0.07 SEQID-03378 295416104 -- --
0 0.46 0.24 0.06 0.06 0.02 0.07 0.00 0.06 0.09 0.05 0.03 0.07 0.09
0.06 SEQID-03379 218573202 -- -- 0 0.48 0.23 0.03 0.07 0.03 0.07
0.02 0.04 0.10 0.03 0.04 0.07 0.10 0.08 SEQID-03380 291048676 -- --
1 0.49 0.25 0.05 0.05 0.05 0.03 0.02 0.05 0.09 0.06 0.01 0.08 0.09
0.07 SEQID-03381 395146546 -- -- 1 0.47 0.21 0.05 0.08 0.04 0.07
0.01 0.04 0.08 0.04 0.04 0.06 0.08 0.07 SEQID-03382 M0ZKT2 -- -- 0
0.45 0.18 0.09 0.17 0.01 0.03 0.01 0.07 0.06 0.03 0.02 0.05 0.08
0.12 SEQID-03383 M1AMZ0 -- -- 1 0.54 0.27 0.02 0.04 0.08 0.07 0.02
0.03 0.04 0.03 0.02 0.07 0.11 0.09 SEQID-03384 M1AMY4 -- -- 1 0.52
0.27 0.02 0.04 0.06 0.08 0.02 0.04 0.03 0.03 0.02 0.07 0.10 0.08
SEQID-03385 M0ZXL4 -- -- 0 0.51 0.26 0.02 0.07 0.03 0.08 0.00 0.09
0.08 0.04 0.02 0.09 0.12 0.10 SEQID-03386 M1AMY9 -- -- 0 0.57 0.22
0.01 0.05 0.05 0.07 0.02 0.04 0.04
0.05 0.03 0.07 0.07 0.12 SEQID-03387 M1AKE5 -- -- 0 0.47 0.27 0.02
0.05 0.08 0.05 0.04 0.04 0.04 0.04 0.00 0.08 0.12 0.06 SEQID-03388
M1AGXS -- -- 1 0.47 0.20 0.06 0.04 0.06 0.06 0.00 0.05 0.07 0.04
0.02 0.05 0.10 0.07 SEQID-03389 M1C5FS -- -- 1 0.48 0.21 0.05 0.07
0.02 0.06 0.01 0.03 0.09 0.04 0.03 0.07 0.08 0.06 SEQID-03390
M18BVW6 -- -- 1 0.48 0.22 0.04 0.06 0.05 0.06 0.00 0.04 0.08 0.03
0.03 0.06 0.11 0.07 SEQID-03391 M02HX8 -- -- 0 0.54 0.17 0.06 0.05
0.02 0.02 0.00 0.02 0.10 0.03 0.02 0.07 0.05 0.23 SEQID-03392
M02HU8 -- -- 0 0.47 0.22 0.04 0.21 0.02 0.03 0.00 0.02 0.05 0.09
0.02 0.07 0.08 0.11 SEQID-03393 J7EQ13 -- -- 0 0.39 0.16 0.05 0.03
0.06 0.03 0.10 0.01 0.08 0.05 0.02 0.04 0.07 0.09 SEQID-03394
M1B3W0 -- -- 1 0.48 0.20 0.06 0.02 0.05 0.06 0.00 0.05 0.07 0.02
0.02 0.04 0.11 0.07 SEQID-03395 09M6H3 -- -- 1 0.44 0.23 0.06 0.10
0.03 0.07 0.01 0.03 0.13 0.02 0.03 0.05 0.12 0.08 SEQID-03396
Q8LK04 -- -- 1 0.51 0.22 0.06 0.05 0.04 0.08 0.01 0.01 0.07 0.05
0.02 0.06 0.06 0.10 SEQID-03397 M1ACZ6 -- -- 1 0.53 0.24 0.04 0.06
0.05 0.06 0.01 0.02 0.11 0.02 0.03 0.07 0.08 0.11 SEQID-03398
MQZI18 -- -- 1 0.45 0.20 0.05 0.06 0.05 0.08 0.01 0.04 0.10 0.04
0.01 0.07 0.07 0.10 SEQID-03399 M19FJ0 -- -- 0 0.45 0.19 0.07 0.07
0.04 0.09 0.00 0.02 0.10 0.01 0.00 0.00 0.14 0.16 SEQID-03400
M1B1W6 -- -- 1 0.52 0.24 0.04 0.08 0.06 0.07 0.00 0.04 0.07 0.03
0.03 0.06 0.12 0.07 SEQID-03401 M1 QM9 -- -- 1 0.52 0.21 0.04 0.06
0.03 0.06 0.01 0.03 0.07 0.05 0.03 0.07 0.06 0.12 SEQID-03402
K7WJX9 -- -- 0 0.44 0.10 0.06 0.16 0.04 0.01 0.09 0.00 0.07 0.03
0.03 0.01 0.06 0.03 SEQID-03403 M1CQ57 -- -- 0 0.45 0.17 0.06 0.15
0.02 0.05 0.01 0.02 0.07 0.06 0.03 0.06 0.07 0.09 SEQID-03404
M0ZVD2 -- -- 1 0.42 0.20 0.07 0.06 0.05 0.05 0.01 0.04 0.08 0.05
0.01 0.05 0.11 0.07 SEQID-03405 M161K7 -- -- 0 0.39 0.22 0.08 0.11
0.06 0.02 0.00 0.04 0.06 0.08 0.02 0.05 0.11 0.10 SEQID-03406
M1B8F8 -- -- 0 0.38 0.15 0.04 0.02 0.04 0.03 0.11 0.02 0.07 0.06
0.03 0.05 0.07 0.08 SEQID-03407 M1AVV0 -- -- 1 0.50 0.24 0.05 0.04
0.03 0.06 0.02 0.03 0.08 0.04 0.02 0.06 0.09 0.09 SEQID-03408
M1CVH4 -- -- 1 0.44 0.17 0.04 0.09 0.05 0.07 0.02 0.03 0.07 0.03
0.05 0.05 0.06 0.06 SEQID-03409 M1CQ02 -- -- 1 0.49 0.22 0.06 0.06
0.04 0.06 0.01 0.03 0.08 0.03 0.02 0.06 0.09 0.08 SEQID-03410
M16FR3 -- -- 0 0.48 0.21 0.07 0.11 0.06 0.04 0.02 0.01 0.03 0.06
0.00 0.07 0.05 0.13 SEQID-03411 M1AMY3 -- -- 1 0.51 0.26 0.03 0.02
0.10 0.08 0.02 0.01 0.06 0.03 0.03 0.06 0.11 0.07 SEQID-03412
M0ZI9B -- -- 1 0.47 0.22 0.07 0.07 0.05 0.06 0.01 0.03 0.08 0.04
0.04 0.06 0.09 0.08 SEQID-03413 M0ZSD6 -- -- 1 0.47 0.22 0.07 0.04
0.05 0.06 0.01 0.04 0.09 0.05 0.02 0.06 0.08 0.10 SEQID-03414
M1D7J7 -- -- 1 0.46 0.23 0.06 0.06 0.04 0.04 0.02 0.04 0.09 0.04
0.02 0.06 0.11 0.07 SEQID-03415 M0ZSL2 -- -- 1 0.52 0.26 0.08 0.03
0.03 0.05 0.01 0.01 0.06 0.06 0.01 0.09 0.11 0.06 SEQID-03416
A0Z2Z75 -- -- 1 0.58 0.21 0.05 0.10 0.08 0.02 0.00 0.00 0.06 0.03
0.08 0.13 0.06 0.12 SEQID-03417 A1A073 -- -- 1 0.61 0.15 0.03 0.09
0.02 0.07 0.00 0.02 0.05 0.04 0.09 0.04 0.02 0.16 SEQID-03418
A1A091 -- -- 0 0.45 0.26 0.03 0.13 0.05 0.04 0.00 0.03 0.09 0.03
0.02 0.08 0.08 0.08 SEQID-03419 A2WLS0 -- -- 0 0.37 0.09 0.04 0.00
0.04 0.07 0.16 0.02 0.12 0.07 0.02 0.02 0.00 0.16 SEQID-03420
A2YN17 -- -- 1 0.36 0.17 0.05 0.14 0.01 0.06 0.02 0.05 0.11 0.08
0.04 0.01 0.10 0.06 SEQID-03421 A4GGC8 -- -- 1 0.51 0.24 0.04 0.20
0.06 0.02 0.01 0.04 0.01 0.02 0.03 0.12 0.09 0.10 SEQID-03422
A4GYV1 -- -- 1 0.58 0.21 0.04 0.10 0.10 0.02 0.00 0.00 0.04 0.03
0.08 0.10 0.09 0.12 SEQID-03423 A5A779 -- -- 1 0.44 0.24 0.04 0.10
0.04 0.05 0.03 0.06 0.10 0.01 0.04 0.01 0.18 0.04 SEQID-03424
ASLHG2 -- -- 1 0.36 0.20 0.05 0.26 0.00 0.04 0.02 0.05 0.03 0.04
0.03 0.04 0.15 0.04 SEQID-03425 ASVI25 -- -- 1 0.34 0.15 0.04 0.04
0.03 0.26 0.00 0.03 0.14 0.02 0.03 0.04 0.07 0.05 SEQID-03426
A5VLV3 -- -- 1 0.51 0.22 0.04 0.06 0.03 0.07 0.02 0.01 0.10 0.04
0.05 0.06 0.10 0.09 SEQID-03427 A5YT9S -- -- 1 0.37 0.15 0.04 0.07
0.05 0.05 0.10 0.04 0.10 0.04 0.01 0.03 0.08 0.09 SEQID-03428
A6QLV3 -- -- 1 0.49 0.27 0.03 0.06 0.08 0.04 0.01 0.03 0.09 0.02
0.03 0.05 0.18 0.10 SEQID-03429 A6QPY8 -- -- 1 0.50 0.15 0.06 0.04
0.02 0.03 0.01 0.04 0.08 0.08 0.03 0.04 0.05 0.18 SEQID-03430
A6ZNN4 -- -- 0 0.36 0.04 0.00 0.00 0.02 0.05 0.27 0.02 0.12 0.05
0.04 0.02 0.02 0.18 SEQID-03431 A62UT6 -- -- 1 0.53 0.13 0.03 0.08
0.05 0.10 0.00 0.02 0.08 0.03 0.04 0.04 0.06 0.23 SEQID-03432
A7Y3J1 -- -- 1 0.58 0.19 0.03 0.12 0.06 0.03 0.00 0.00 0.05 0.03
0.09 0.11 0.06 0.13 SEQID-03433 A7YWC8 -- -- 0 0.31 0.22 0.12 0.15
0.01 0.05 0.01 0.09 0.12 0.03 0.02 0.02 0.17 0.01 SEQID-03434
B1A958 -- -- 1 0.43 0.21 0.04 0.27 0.05 0.02 0.01 0.04 0.01 0.02
0.03 0.11 0.08 0.07 SEQID-03435 B1A969 -- -- 0 0.40 0.22 0.02 0.32
0.03 0.00 0.07 0.06 0.03 0.03 0.03 0.15 0.03 0.11 SEQID-03436
B2G634 -- -- 1 0.57 0.24 0.04 0.01 0.05 0.06 0.00 0.03 0.09 0.03
0.03 0.08 0.09 0.12 SEQID-03437 B2G729 -- -- 1 0.41 0.09 0.05 0.05
0.08 0.09 0.00 0.07 0.09 0.00 0.03 0.04 0.04 0.01 SEQID-03438
B3WC71 -- -- 1 0.37 0.17 0.04 0.00 0.06 0.16 0.00 0.05 0.15 0.02
0.01 0.04 0.09 0.03 SEQID-03439 BSY212 -- -- 1 0.45 0.17 0.05 0.05
0.04 0.08 0.06 0.04 0.08 0.04 0.04 0.02 0.07 0.06 SEQID-03440
B5X9P2 -- -- 1 0.44 0.17 0.05 0.05 0.04 0.09 0.06 0.04 0.08 0.03
0.04 0.02 0.06 0.06 SEQID-03441 B7GNC2 -- -- 0 0.57 0.29 0.05 0.12
0.09 0.03 0.00 0.02 0.06 0.03 0.06 0.05 0.10 0.10 SEQID-03442
B7GND6 -- -- 1 0.61 0.15 0.03 0.09 0.02 0.07 0.00 0.02 0.05 0.04
0.08 0.04 0.02 0.17 SEQID-03443 B8DW17 -- -- 1 0.60 0.15 0.03 0.10
0.02 0.07 0.00 0.02 0.04 0.04 0.09 0.04 0.02 0.15 SEQID-03444
E1BLN6 -- -- 1 0.23 0.12 0.02 0.11 0.01 0.02 0.10 0.10 0.06 0.03
0.01 0.02 0.04 0.03 SEQID-03445 E7Q5T7 -- -- 1 0.42 0.19 0.03 0.05
0.07 0.06 0.00 0.06 0.16 0.01 0.02 0.05 0.11 0.11 SEQID-03446
F1MUE4 -- -- 1 0.49 0.24 0.04 0.07 0.03 0.05 0.01 0.05 0.12 0.03
0.02 0.02 0.16 0.08 SEQID-03447 F1MWJ0 -- -- 1 0.30 0.18 0.02 0.03
0.02 0.02 0.03 0.05 0.01 0.12 0.02 0.05 0.07 0.04 SEQID-03448
F1SGG1 -- -- 1 0.40 0.23 0.05 0.11 0.04 0.06 0.00 0.07 0.12 0.03
0.02 0.05 0.13 0.06 SEQID-03449 G1NEY4 -- -- 1 0.38 0.19 0.05 0.10
0.04 0.04 0.00 0.05 0.09 0.10 0.01 0.04 0.10 0.06 SEQID-03450
G3MXL3 -- -- 1 0.37 0.18 0.05 0.08 0.04 0.04 0.01 0.06 0.08 0.12
0.01 0.04 0.09 0.06 SEQID-03451 I3LR13 -- -- 1 0.40 0.19 0.04 0.11
0.02 0.04 0.01 0.07 0.09 0.03 0.04 0.02 0.12 0.02 SEQID-03452
O04433 -- -- 1 0.51 0.14 0.08 0.07 0.01 0.02 0.02 0.03 0.09 0.02
0.02 0.02 0.07 0.22 SEQID-03453 O42395 -- -- 1 0.32 0.08 0.04 0.12
0.03 0.05 0.12 0.03 0.09 0.06 0.06 0.04 0.03 0.08 SEQID-03454
O62650 -- -- 1 0.37 0.15 0.03 0.07 0.05 0.06 0.10 0.04 0.10 0.04
0.01 0.03 0.08 0.09 SEQID-03455 P00127 -- -- 1 0.35 0.14 0.04 0.03
0.02 0.15 0.01 0.06 0.27 0.02 0.06 0.01 0.07 0.07 SEQID-03456
P02313 -- -- 0 0.34 0.03 0.12 0.07 0.04 0.10 0.00 0.04 0.10 0.06
0.00 0.00 0.01 0.29 SEQID-03457 P02314 -- -- 0 0.37 0.03 0.11 0.07
0.04 0.09 0.00 0.04 0.10 0.05 0.00 0.00 0.01 0.30 SEQID-03458
P02687 -- -- 1 0.39 0.10 0.05 0.15 0.01 0.06 0.00 0.06 0.01 0.08
0.07 0.02 0.06 0.09 SEQID-03459 P04101 -- -- 0 0.10 0.05 0.02 0.60
0.00 0.00 0.16 0.00 0.00 0.00 0.02 0.02 0.00 0.00 SEQID-03460
P05016 -- -- 1 0.54 0.27 0.03 0.04 0.07 0.04 0.02 0.03 0.10 0.01
0.02 0.04 0.17 0.10 SEQID-03461 P05739 -- -- 1 0.53 0.23 0.05 0.08
0.04 0.03 0.00 0.04 0.09 0.02 0.01 0.01 0.11 0.17 SEQID-03462
P07107 -- -- 1 0.52 0.13 0.06 0.02 0.02 0.08 0.00 0.03 0.13 0.03
0.03 0.05 0.06 0.19 SEQID-03463 P07924 -- -- 0 0.41 0.20 0.04 0.17
0.03 0.05 0.00 0.09 0.06 0.04 0.04 0.12 0.06 0.09 SEQID-03464
P03771 -- -- 1 0.52 0.17 0.02 0.15 0.09 0.02 0.00 0.06 0.03 0.02
0.11 0.07 0.07 0.06 SEQID-03465 P0C074 -- -- 0 0.40 0.19 0.02 0.14
0.03 0.05 0.00 0.09 0.083 0.03 0.03 0.05 0.12 0.09 SEQID-03466
P0C0T4 -- -- 0 0.49 0.21 0.09 0.09 0.00 0.04 0.00 0.05 0.05 0.02
0.03 0.08 0.08 0.19 SEQID-03467 P0C453 -- -- 1 0.52 0.11 0.02 0.11
0.03 0.00 0.00 0.06 0.02 0.02 0.02 0.03 0.03 0.22 SEQID-03468
P0C5N1 -- -- 1 0.62 0.25 0.02 0.21 0.03 0.00 0.02 0.00 0.04 0.03
0.15 0.10 0.12 0.04 SEQID-03469 P0C5N3 -- -- 1 0.60 0.23 0.02 0.03
0.05 0.04 0.00 0.04 0.13 0.02 0.01 0.06 0.14 0.16 SEQID-03470
P10669 -- -- 1 0.37 0.15 0.03 0.06 0.05 0.05 0.10 0.04 0.11 0.04
0.01 0.03 0.08 0.09 SEQID-03471 P12902 -- -- 0 0.36 0.01 0.12 0.06
0.04 0.07 0.00 0.01 0.18 0.03 0.01 0.00 0.01 0.29 SEQID-03472
P13204 -- -- 1 0.35 0.23 0.04 0.17 0.01 0.05 0.02 0.07 0.08 0.07
0.04 0.02 0.16 0.01 SEQID-03473 P14402 -- -- 0 0.06 0.01 0.01 0.72
0.00 0.00 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.00 SEQID-03474
P15720 -- -- 1 0.41 0.10 0.04 0.16 0.01 0.04 0.00 0.03 0.02 0.09
0.10 0.02 0.04 0.08 SEQID-03475 P19114 -- -- 1 0.56 0.26 0.03 0.04
0.06 0.04 0.02 0.03 0.09 0.01 0.02 0.04 0.17 0.11 SEQID-03476
P19948 -- -- 1 0.50 0.25 0.04 0.18 0.05 0.03 0.01 0.04 0.00 0.02
0.02 0.12 0.10 0.11 SEQID-03477 P20158 -- -- 0 0.28 0.06 0.03 0.18
0.07 0.02 0.16 0.10 0.02 0.08 0.00 0.04 0.00 0.10 SEQID-03478
P20159 -- -- 0 0.29 0.10 0.03 0.15 0.04 0.04 0.16 0.10 0.03 0.08
0.00 0.02 0.02 0.10 SEQID-03479 P23935 -- -- 0 0.52 0.25 0.04 0.05
0.03 0.02 0.01 0.06 0.14 0.03 0.02 0.07 0.13 0.13 SEQID-03480
P24052 -- -- 1 0.49 0.14 0.07 0.04 0.02 0.04 0.07 0.02 0.08 0.05
0.01 0.02 0.09 0.23 SEQID-03481 P25362 -- -- 1 0.52 0.19 0.04 0.05
0.03 0.07 0.02 0.03 0.10 0.01 0.03 0.04 0.11 0.09 SEQID-03482
P27007 -- -- 1 0.45 0.30 0.07 0.10 0.02 0.05 0.00 0.05 0.11 0.00
0.01 0.03 0.10 0.10 SEQID-03483 P30562 -- -- 1 0.60 0.21 0.06 0.04
0.02 0.05 0.00 0.02 0.10 0.04 0.10 0.06 0.12 0.14 SEQID-03484
P31162 -- -- 1 0.62 0.20 0.03 0.09 0.08 0.02 0.00 0.00 0.04 0.04
0.07 0.11 0.06 0.17 SEQID-03485 P31853 -- -- 0 0.54 0.26 0.06 0.03
0.02 0.05 0.00 0.05 0.10 0.01 0.01 0.06 0.16 0.12 SEQID-03486
P32046 -- -- 1 0.57 0.16 0.06 0.09 0.01 0.01 0.04 0.03 0.09 0.05
0.03 0.06 0.03 0.20 SEQID-03487 P32344 -- -- 1 0.53 0.15 0.03 0.17
0.04 0.01 0.01 0.04 0.04 0.04 0.01 0.04 0.07 0.13 SEQID-03488
P32570 -- -- 1 0.52 0.24 0.04 0.05 0.07 0.06 0.01 0.07 0.12 0.00
0.01 0.07 0.11 0.07 SEQID-03489 P32760 -- -- 1 0.50 0.09 0.03 0.04
0.04 0.03 0.07 0.08 0.08 0.04 0.01 0.01 0.05 0.24 SEQID-03490
P33309 -- -- 1 0.54 0.23 0.03 0.01 0.04 0.09 0.01 0.03 0.09 0.02
0.02 0.07 0.11 0.16 SEQID-03491 P36047 -- -- 1 0.52 0.28 0.01 0.03
0.10 0.07 0.00 0.03 0.10 0.01 0.03 0.08 0.17 0.11 SEQID-03492
P36071 -- -- 1 0.63 0.23 0.01 0.09 0.05 0.02 0.00 0.02 0.07 0.00
0.03 0.10 0.10 0.10 SEQID-03493 P36493 -- -- 0 0.60 0.15 0.04 0.12
0.05 0.00 0.00 0.02 0.00 0.02 0.00 0.05 0.05 0.24 SEQID-03494
P36835 -- -- 1 0.54 0.25 0.03 0.04 0.06 0.05 0.02 0.04 0.09 0.01
0.02 0.03 0.18 0.10 SEQID-03495 P37360 -- -- 0 0.24 0.01 0.05 0.00
0.00 0.03 0.30 0.02 0.17 0.06 0.00 0.00 0.00 0.15 SEQID-03496
P38202 -- -- 1 0.51 0.13 0.04 0.11 0.02 0.07 0.00 0.05 0.08 0.02
0.03 0.03 0.07 0.23 SEQID-03497 P38828 -- -- 1 0.54 0.25 0.01 0.05
0.05 0.05 0.00 0.08 0.08 0.03 0.01 0.09 0.07 0.14 SEQID-03498
P40060 -- -- 0 0.45 0.24 0.02 0.05 0.03 0.10 0.00 0.03 0.14 0.01
0.01 0.08 0.11 0.09 SEQID-03499 P40062 -- -- 0 0.58 0.24 0.02 0.10
0.04 0.03 0.02 0.00 0.04 0.01 0.04 0.05 0.15 0.13 SEQID-03500
P40509 -- -- 1 0.48 0.24 0.04 0.01 0.08 0.07 0.01 0.07 0.10 0.02
0.02 0.05 0.15 0.08 SEQID-03501 P40619 -- -- 1 0.41 0.07 0.08 0.04
0.05 0.11 0.00 0.05 0.11 0.03 0.01 0.01 0.02 0.23 SEQID-03502
P40620 -- -- 1 0.40 0.08 0.06 0.03 0.04 0.10 0.01 0.02 0.18 0.04
0.01 0.01 0.03 0.23 SEQID-03503 P41648 -- -- 1 0.47 0.28 0.00 0.15
0.03 0.06 0.00 0.09 0.01 0.03 0.03 0.07 0.18 0.09 SEQID-03504
P43389 -- -- 0 0.35 0.14 0.09 0.00 0.05 0.12 0.16 0.02 0.06 0.05
0.00 0.05 0.00 0.12 SEQID-03505 P46963 -- -- 1 0.50 0.19 0.02 0.06
0.05 0.09 0.01 0.05 0.06 0.00 0.04 0.05 0.11 0.089 SEQID-03506
P46988 -- -- 1 0.51 0.22 0.03 0.06 0.05 0.06 0.01 0.03 0.08 0.00
0.01 0.04 0.13 0.14 SEQID-03507 P47005 -- -- 1 0.50 0.24 0.02 0.05
0.09 0.07 0.01 0.04 0.06 0.00 0.09 0.09 0.12 0.08 SEQID-03508
P47815 -- -- 1 0.41 0.19 0.03 0.10 0.04 0.13 0.02 0.03 0.10 0.06
0.02 0.06 0.07 0.13 SEQID-03509 P50291 -- -- 1 0.37 0.15 0.04 0.07
0.05 0.05 0.10 0.04 0.10 0.04 0.01 0.03 0.08 0.09 SEQID-03510
P53079 -- -- 1 0.51 0.25 0.01 0.04 0.08 0.08 0.01 0.07 0.05 0.00
0.03 0.06 0.15 0.07 SEQID-03511 P53335 -- -- 1 0.53 0.13 0.09 0.08
0.05 0.10 0.00 0.02 0.08 0.03 0.04 0.04 0.07 0.23
SEQID-03512 P53910 -- -- 0 0.61 0.26 0.03 0.10 0.03 0.02 0.00 0.04
0.05 0.02 0.06 0.10 0.08 0.14 SEQID-03513 P53970 -- -- 1 0.54 0.26
0.03 0.05 0.03 0.06 0.02 0.03 0.10 0.04 0.03 0.05 0.15 0.11
SEQID-03514 P55944 -- -- 0 0.24 0.01 0.05 0.00 0.00 0.03 0.30 0.02
0.17 0.06 0.00 0.00 0.00 0.15 SEQID-03515 P60577 -- -- 1 0.58 0.18
0.03 0.10 0.05 0.01 0.00 0.00 0.08 0.02 0.08 0.03 0.04 0.12
SEQID-03516 P60750 -- -- 1 0.53 0.17 0.06 0.01 0.03 0.07 0.00 0.08
0.05 0.03 0.02 0.05 0.07 0.18 SEQID-03517 P61848 -- -- 0 0.60 0.14
0.02 0.10 0.04 0.00 0.00 0.04 0.00 0.03 0.00 0.06 0.06 0.25
SEQID-03518 P68080 -- -- 1 0.58 0.21 0.06 0.04 0.02 0.05 0.00 0.02
0.10 0.04 0.10 0.05 0.12 0.14 SEQID-03519 P71479 -- -- 0 0.49 0.29
0.06 0.11 0.03 0.10 0.00 0.04 0.07 0.04 0.05 0.09 0.11 0.05
SEQID-03520 P80272 -- -- 0 0.36 0.03 0.12 0.07 0.04 0.10 0.00 0.04
0.08 0.06 0.00 0.00 0.01 0.30 SEQID-03521 P80680 -- -- 1 0.46 0.21
0.08 0.10 0.01 0.06 0.01 0.04 0.12 0.03 0.03 0.02 0.05 0.08
SEQID-03522 P81558 -- -- 1 0.38 0.09 0.06 0.15 0.01 0.06 0.00 0.06
0.01 0.03 0.07 0.02 0.06 0.09 SEQID-03523 P82010 -- -- 0 0.33 0.04
0.04 0.09 0.07 0.04 0.16 0.05 0.05 0.03 0.00 0.00 0.02 0.10
SEQID-03524 P82920 -- -- 1 0.39 0.14 0.03 0.22 0.05 0.03 0.09 0.04
0.08 0.02 0.01 0.06 0.05 0.07 SEQID-03525 P83487 -- -- 1 0.39 0.11
0.04 0.17 0.01 0.06 0.00 0.05 0.01 0.08 0.07 0.02 0.06 0.08
SEQID-03526 PB49 7 -- -- 1 0.59 0.20 0.07 0.02 0.03 0.05 0.00 0.03
0.11 0.04 0.10 0.04 0.11 0.13 SEQID-03527 Q02368 -- -- 1 0.37 0.13
0.05 0.16 0.01 0.07 0.03 0.05 0.11 0.02 0.04 0.01 0.09 0.07
SEQID-03528 Q034H8 -- -- 1 0.53 0.28 0.05 0.06 0.03 0.07 0.00 0.05
0.09 0.05 0.05 0.08 0.13 0.09 SEQID-03529 Q034Z7 -- -- 1 0.49 0.28
0.04 0.11 0.05 0.07 0.00 0.01 0.07 0.04 0.01 0.11 0.08 0.11
SEQID-03530 Q03525 -- -- 1 0.50 0.11 0.03 0.03 0.04 0.07 0.00 0.01
0.09 0.04 0.03 0.02 0.05 0.27 SEQID-03531 Q038I0 -- -- 1 0.56 0.20
0.05 0.18 0.05 0.03 0.00 0.02 0.00 0.03 0.06 0.05 0.08 0.15
SEQID-03532 Q03919 -- -- 0 0.58 0.31 0.01 0.04 0.01 0.05 0.00 0.07
0.12 0.04 0.05 0.08 0.16 0.12 SEQID-03533 Q03AJ7 -- -- 1 0.46 0.20
0.05 0.14 0.07 0.05 0.00 0.04 0.07 0.03 0.04 0.04 0.11 0.13
SEQID-03534 Q03AZ68 -- -- 1 0.37 0.17 0.04 0.00 0.06 0.17 0.00 0.05
0.14 0.02 0.01 0.04 0.09 0.03 SEQID-03535 Q042Y3 -- -- 1 0.54 0.28
0.03 0.06 0.04 0.08 0.01 0.04 0.03 0.03 0.02 0.08 0.14 0.12
SEQID-03536 Q043Y6 -- -- 0 0.52 0.29 0.04 0.04 0.07 0.06 0.00 0.07
0.07 0.03 0.02 0.07 0.14 0.11 SEQID-03537 Q045P3 -- -- 1 0.37 0.19
0.03 0.03 0.06 0.19 0.00 0.05 0.11 0.02 0.01 0.04 0.09 0.02
SEQID-03538 Q046A4 -- -- 0 0.54 0.27 0.03 0.09 0.03 0.06 0.00 0.00
0.09 0.03 0.03 0.10 0.08 0.09 SEQID-03539 Q04869 -- -- 1 0.51 0.23
0.06 0.03 0.05 0.07 0.01 0.04 0.07 0.04 0.03 0.06 0.08 0.11
SEQID-03540 Q048Z6 -- -- 1 0.37 0.19 0.05 0.03 0.03 0.20 0.00 0.04
0.15 0.02 0.02 0.04 0.09 0.01 SEQID-03541 Q04935 -- -- 1 0.47 0.14
0.04 0.05 0.04 0.05 0.01 0.11 0.06 0.02 0.02 0.04 0.08 0.11
SEQID-03542 Q049N0 -- -- 1 0.49 0.29 0.06 0.06 0.03 0.08 0.01 0.03
0.08 0.04 0.03 0.08 0.11 0.10 SEQID-03543 Q04C52 -- -- 1 0.34 0.14
0.03 0.06 0.05 0.25 0.00 0.03 0.14 0.02 0.03 0.04 0.06 0.04
SEQID-03544 Q05462 -- -- 1 0.62 0.21 0.04 0.07 0.02 0.06 0.01 0.02
0.09 0.02 0.02 0.03 0.09 0.23 SEQID-03545 Q05566 -- -- 1 0.50 0.09
0.03 0.11 0.05 0.00 0.00 0.06 0.02 0.02 0.02 0.03 0.03 0.22
SEQID-03546 Q06071 -- -- 1 0.49 0.23 0.01 0.03 0.08 0.05 0.01 0.04
0.10 0.00 0.03 0.07 0.12 0.10 SEQID-03547 Q06162 -- -- 1 0.43 0.26
0.03 0.07 0.04 0.05 0.00 0.12 0.11 0.01 0.02 0.07 0.18 0.03
SEQID-03548 Q06835 -- -- 1 0.44 0.19 0.01 0.10 0.07 0.07 0.11 0.04
0.04 0.04 0.02 0.05 0.08 0.14 SEQID-03549 Q06891 -- -- 1 0.44 0.26
0.02 0.12 0.03 0.08 0.03 0.06 0.06 0.00 0.01 0.07 0.15 0.04
SEQID-03550 Q08273 -- -- 1 0.44 0.14 0.06 0.07 0.07 0.08 0.07 0.06
0.07 0.01 0.04 0.06 0.02 0.07 SEQID-03551 Q08423 -- -- 0 0.48 0.16
0.01 0.36 0.01 0.01 0.00 0.02 0.00 0.00 0.24 0.01 0.13 0.03
SEQID-03552 Q09MB5 -- -- 0 0.56 0.25 0.00 0.06 0.06 0.02 0.00 0.05
0.12 0.01 0.05 0.04 0.21 0.07 SEQID-03553 Q09ME2 -- -- 1 0.47 0.27
0.03 0.20 0.07 0.04 0.01 0.00 0.06 0.04 0.01 0.14 0.09 0.07
SEQID-03554 Q09MF5 -- -- 1 0.43 0.24 0.04 0.25 0.06 0.02 0.01 0.04
0.01 0.01 0.02 0.11 0.09 0.06 SEQID-03555 Q0II65 -- -- 1 0.50 0.13
0.04 0.12 0.02 0.03 0.00 0.02 0.20 0.02 0.02 0.02 0.07 0.11
SEQID-03556 Q0P5B3 -- -- 1 0.44 0.18 0.04 0.08 0.05 0.08 0.09 0.06
0.04 0.04 0.02 0.03 0.11 0.09 SEQID-03557 Q0VCD4 -- -- 1 0.50 0.23
0.04 0.10 0.04 0.06 0.01 0.03 0.08 0.03 0.05 0.04 0.12 0.04
SEQID-03558 Q0VD26 -- -- 1 0.44 0.14 0.03 0.11 0.06 0.04 0.01 0.03
0.10 0.08 0.03 0.01 0.08 0.06 SEQID-03559 Q12028 -- -- 1 0.51 0.28
0.03 0.04 0.07 0.03 0.01 0.04 0.07 0.02 0.02 0.09 0.15 0.09
SEQID-03560 Q14FD4 -- -- 1 0.43 0.23 0.05 0.24 0.07 0.02 0.01 0.04
0.01 0.01 0.02 0.10 0.11 0.05 SEQID-03561 Q17Q91 -- -- 1 0.37 0.12
0.03 0.13 0.07 0.06 0.04 0.03 0.07 0.02 0.01 0.02 0.06 0.08
SEQID-03562 Q1G940 -- -- 0 0.46 0.24 0.06 0.04 0.04 0.05 0.00 0.04
0.10 0.05 0.00 0.06 0.10 0.11 SEQID-03563 Q1G9J5 -- -- 1 0.61 0.18
0.02 0.11 0.07 0.02 0.00 0.02 0.00 0.03 0.02 0.02 0.07 0.19
SEQID-03564 Q1GBQ3 -- -- 1 0.33 0.14 0.04 0.06 0.05 0.25 0.00 0.03
0.14 0.02 0.03 0.04 0.06 0.04 SEQID-03565 Q2KI95 -- -- 1 0.40 0.12
0.03 0.03 0.01 0.06 0.11 0.05 0.08 0.03 0.04 0.04 0.06 0.09
SEQID-03566 Q2KIA3 -- -- 1 0.44 0.19 0.04 0.08 0.05 0.07 0.09 0.04
0.05 0.03 0.02 0.03 0.12 0.10 SEQID-03567 Q2K1T5 -- -- 1 0.34 0.13
0.04 0.06 0.03 0.07 0.10 0.05 0.13 0.05 0.01 0.01 0.08 0.05
SEQID-03568 Q2L927 -- -- 1 0.44 0.23 0.04 0.26 0.05 0.02 0.01 0.04
0.01 0.02 0.03 0.11 0.09 0.08 SEQID-03569 Q2M2S7 -- -- 1 0.38 0.11
0.05 0.10 0.06 0.05 0.08 0.04 0.08 0.03 0.04 0.01 0.05 0.06
SEQID-03570 Q2MI60 -- -- 1 0.59 0.21 0.04 0.09 0.07 0.03 0.00 0.00
0.05 0.03 0.08 0.11 0.08 0.12 SEQID-03571 Q2MJS5 -- -- 0 0.24 0.01
0.05 0.00 0.00 0.05 0.28 0.02 0.15 0.05 0.00 0.00 0.00 0.15
SEQID-03572 Q2T9Q2 -- -- 1 0.44 0.25 0.09 0.11 0.01 0.04 0.01 0.08
0.13 0.02 0.04 0.02 0.17 0.07 SEQID-03573 Q2TBR9 -- -- 0 0.55 0.15
0.04 0.11 0.02 0.06 0.01 0.06 0.07 0.02 0.02 0.04 0.07 0.24
SEQID-03574 Q2YDK0 -- -- 1 0.44 0.12 0.02 0.05 0.03 0.04 0.11 0.02
0.09 0.03 0.05 0.04 0.05 0.11 SEQID-03575 Q32L75 -- -- 1 0.50 0.17
0.04 0.10 0.04 0.01 0.01 0.12 0.10 0.01 0.07 0.02 0.12 0.08
SEQID-03576 Q32PJ6 -- -- 1 0.42 0.18 0.05 0.07 0.03 0.03 0.05 0.04
0.09 0.03 0.04 0.02 0.08 0.04 SEQID-03577 Q332T6 -- -- 1 0.57 0.22
0.04 0.10 0.09 0.02 0.00 0.00 0.05 0.03 0.07 0.12 0.08 0.12
SEQID-03578 Q332U3 -- -- 0 0.37 0.19 0.02 0.35 0.03 0.00 0.07 0.06
0.03 0.03 0.03 0.13 0.03 0.11 SEQID-03579 Q3E731 -- -- 1 0.37 0.13
0.03 0.07 0.07 0.09 0.04 0.05 0.07 0.04 0.04 0.01 0.11 0.07
SEQID-03580 Q3E732 -- -- 0 0.55 0.24 0.03 0.10 0.05 0.05 0.00 0.00
0.00 0.00 0.00 0.08 0.10 0.14 SEQID-03581 Q3E747 -- -- 0 0.60 0.19
0.03 0.10 0.02 0.01 0.00 0.05 0.07 0.02 0.03 0.00 0.15 0.30
SEQID-03582 Q3E794 -- -- 0 0.54 0.23 0.02 0.18 0.04 0.06 0.00 0.02
0.00 0.00 0.09 0.11 0.09 0.06 SEQID-03583 Q3E813 -- -- 0 0.42 0.15
0.02 0.23 0.04 0.02 0.05 0.02 0.06 0.04 0.02 0.02 0.13 0.00
SEQID-03584 Q3E843 -- -- 0 0.53 0.19 0.01 0.03 0.02 0.09 0.02 0.02
0.07 0.01 0.03 0.04 0.13 0.07 SEQID-03585 Q3SZ70 -- -- 0 0.25 0.08
0.07 0.20 0.02 0.03 0.04 0.03 0.14 0.06 0.05 0.01 0.05 0.00
SEQID-03586 Q3T0Q6 -- -- 1 0.30 0.08 0.04 0.13 0.03 0.06 0.12 0.03
0.10 0.07 0.06 0.03 0.03 0.06 SEQID-03587 Q3T0V7 -- -- 0 0.46 0.19
0.07 0.10 0.03 0.06 0.00 0.09 0.09 0.04 0.03 0.07 0.07 0.16
SEQID-03588 Q3T0Z3 -- -- 1 0.56 0.24 0.02 0.05 0.05 0.09 0.02 0.03
0.05 0.03 0.03 0.08 0.08 0.13 SEQID-03589 Q3T0ZB -- -- 1 0.45 0.23
0.01 0.05 0.07 0.04 0.01 0.01 0.15 0.06 0.01 0.03 0.13 0.07
SEQID-03590 Q3V4Z3 -- -- 1 0.58 0.21 0.03 0.10 0.06 0.02 0.00 0.00
0.09 0.03 0.08 0.11 0.07 0.11 SEQID-03591 Q3ZBK6 -- -- 1 0.42 0.18
0.02 0.13 0.04 0.04 0.02 0.08 0.07 0.09 0.02 0.06 0.07 0.09
SEQID-03592 Q48585 -- -- 1 0.52 0.19 0.04 0.07 0.05 0.02 0.00 0.04
0.08 0.02 0.03 0.04 0.09 0.19 SEQID-03593 Q4VZK1 -- -- 0 0.39 0.19
0.02 0.34 0.02 0.00 0.07 0.06 0.03 0.01 0.03 0.15 0.02 0.11
SEQID-03594 Q58CS7 -- -- 1 0.46 0.20 0.07 0.03 0.01 0.05 0.00 0.05
0.17 0.02 0.01 0.05 0.09 0.12 SEQID-03595 Q58DW3 -- -- 1 0.47 0.11
0.11 0.13 0.05 0.01 0.01 0.04 0.03 0.03 0.04 0.03 0.06 0.22
SEQID-03596 Q56IS3 -- -- 1 0.46 0.13 0.02 0.14 0.04 0.04 0.02 0.04
0.07 0.06 0.05 0.04 0.05 0.09 SEQID-03597 Q5E9Z8 -- -- 0 0.48 0.29
0.02 0.09 0.02 0.07 0.00 0.07 0.13 0.03 0.03 0.08 0.13 0.08
SEQID-03598 Q5EA80 -- -- 1 0.44 0.24 0.04 0.09 0.04 0.05 0.03 0.07
0.10 0.02 0.03 0.02 0.18 0.04 SEQID-03599 Q5F4C4 -- -- 1 0.51 0.27
0.02 0.06 0.09 0.04 0.01 0.03 0.09 0.03 0.02 0.05 0.18 0.10
SEQID-03600 Q5FHT1 -- -- 1 0.52 0.20 0.04 0.01 0.06 0.08 0.01 0.04
0.08 0.03 0.03 0.10 0.06 0.13 SEQID-03601 Q5FJI3 -- -- 1 0.58 0.18
0.09 0.13 0.05 0.03 0.00 0.02 0.00 0.03 0.02 0.02 0.06 0.20
SEQID-03602 Q5FK48 -- -- 1 0.51 0.23 0.03 0.08 0.03 0.08 0.02 0.01
0.10 0.04 0.05 0.08 0.10 0.07 SEQID-03603 Q5FKL2 -- -- 0 0.53 0.29
0.03 0.03 0.06 0.06 0.00 0.07 0.09 0.03 0.02 0.08 0.14 0.12
SEQID-03604 Q5FLW3 -- -- 1 0.37 0.19 0.04 0.03 0.05 0.21 0.00 0.06
0.09 0.03 0.02 0.04 0.09 0.02 SEQID-03605 Q5FM69 -- -- 0 0.54 0.27
0.03 0.09 0.03 0.07 0.00 0.00 0.08 0.03 0.03 0.10 0.08 0.09
SEQID-03606 Q5FM79 -- -- 0 0.60 0.24 0.03 0.02 0.08 0.04 0.00 0.03
0.06 0.06 0.03 0.05 0.01 0.25 SEQID-03607 Q5FME7 -- -- 1 0.32 0.14
0.04 0.05 0.06 0.24 0.00 0.02 0.12 0.02 0.02 0.04 0.06 0.05
SEQID-03608 Q5QHW1 -- -- 1 0.51 0.22 0.04 0.06 0.03 0.07 0.02 0.01
0.10 0.04 0.05 0.06 0.10 0.09 SEQID-03609 Q5ZHK9 -- -- 0 0.53 0.16
0.05 0.12 0.03 0.05 0.01 0.05 0.08 0.02 0.01 0.02 0.10 0.24
SEQID-03610 Q5ZI72 -- -- 1 0.35 0.11 0.03 0.06 0.05 0.06 0.01 0.08
0.08 0.09 0.01 0.03 0.04 0.10 SEQID-03611 Q5ZIR5 -- -- 0 0.37 0.03
0.08 0.07 0.04 0.03 0.00 0.04 0.17 0.04 0.00 0.00 0.01 0.26
SEQID-03612 Q5Z 6 -- -- 1 0.45 0.23 0.05 0.10 0.02 0.05 0.02 0.07
0.08 0.03 0.08 0.04 0.12 0.07 SEQID-03613 Q5ZK61 -- -- 1 0.45 0.15
0.02 0.16 0.01 0.04 0.02 0.04 0.07 0.06 0.05 0.04 0.05 0.07
SEQID-03614 Q6PVZ5 -- -- 1 0.38 0.19 0.05 0.10 0.04 0.04 0.00 0.05
0.09 0.10 0.01 0.04 0.10 0.06 SEQID-03615 Q6Q311 -- -- 1 0.51 0.19
0.07 0.07 0.04 0.08 0.01 0.02 0.04 0.04 0.01 0.03 0.10 0.25
SEQID-03616 Q6Q546 -- -- 0 0.53 0.31 0.01 0.04 0.04 0.08 0.01 0.06
0.08 0.03 0.03 0.05 0.14 0.12 SEQID-03617 Q6XXM1 -- -- 1 0.31 0.19
0.07 0.27 0.00 0.02 0.01 0.06 0.05 0.02 0.02 0.01 0.14 0.02
SEQID-03618 Q74IM0 -- -- 1 0.52 0.28 0.05 0.05 0.05 0.07 0.00 0.03
0.08 0.04 0.02 0.10 0.10 0.11 SEQID-03619 Q74IV9 -- -- 0 0.52 0.29
0.05 0.04 0.07 0.06 0.00 0.07 0.07 0.03 0.02 0.07 0.14 0.11
SEQID-03620 Q74I20 -- -- 1 0.54 0.28 0.04 0.06 0.04 0.08 0.01 0.04
0.03 0.03 0.02 0.08 0.14 0.12 SEQID-03621 Q74LG3 -- -- 1 0.35 0.16
0.03 0.05 0.05 0.23 0.00 0.04 0.13 0.02 0.03 0.05 0.07 0.04
SEQID-03622 Q7Y1H8 -- -- 1 0.35 0.14 0.10 0.11 0.01 0.09 0.02 0.02
0.05 0.08 0.01 0.02 0.07 0.08 SEQID-03623 Q85WU8 -- -- 1 0.49 0.29
0.00 0.16 0.02 0.06 0.00 0.09 0.01 0.02 0.03 0.07 0.18 0.09
SEQID-03624 Q88V14 -- -- 1 0.39 0.20 0.04 0.01 0.07 0.19 0.00 0.07
0.10 0.03 0.01 0.06 0.09 0.01 SEQID-03625 Q88V75 -- -- 1 0.47 0.18
0.08 0.10 0.01 0.07 0.02 0.06 0.10 0.03 0.02 0.06 0.09 0.05
SEQID-03626 Q88WJ7 -- -- 0 0.41 0.21 0.04 0.05 0.06 0.07 0.00 0.07
0.12 0.01 0.04 0.08 0.09 0.07 SEQID-03627 Q88WK6 -- -- 1 0.57 0.18
0.04 0.16 0.05 0.03 0.00 0.02 0.00 0.03 0.06 0.02 0.06 0.16
SEQID-03628 Q28X0S -- -- 1 0.54 0.19 0.04 0.01 0.06 0.06 0.00 0.05
0.03 0.03 0.01 0.04 0.10 0.18 SEQID-03629 Q88XW8 -- -- 0 0.56 0.31
0.06 0.13 0.02 0.05 0.00 0.06 0.04 0.03 0.06 0.12 0.10 0.12
SEQID-03630 Q88Z77 -- -- 1 0.33 0.16 0.04 0.03 0.03 0.28 0.00 0.04
0.10 0.03 0.02 0.05 0.08 0.05 SEQID-03631 Q8H7U1 -- -- 1 0.43 0.17
0.04 0.07 0.05 0.07 0.02 0.05 0.09 0.04 0.03 0.03 0.08 0.04
SEQID-03632 Q83HZ03 -- -- 1 0.45 0.26 0.05 0.10 0.03 0.05 0.05 0.06
0.08 0.04 0.02 0.06 0.18 0.07 SEQID-03633 Q8LJS2 -- -- 1 0.42 0.14
0.05 0.01 0.03 0.12 0.01 0.04 0.11 0.04 0.03 0.03 0.06 0.15
SEQID-03634 Q8SPJ1 -- -- 1 0.45 0.24 0.06 0.07 0.05 0.05 0.02 0.06
0.07 0.03 0.03 0.05 0.13 0.05 SEQID-03635 Q8TGQ6 -- -- 0 0.40 0.08
0.06 0.17 0.06 0.06 0.09 0.00 0.02 0.02 0.02 0.00 0.04 0.09
SEQID-03636 Q3TGU5 -- -- 1 0.65 0.24 0.02 0.07 0.05 0.05 0.00 0.00
0.00 0.03 0.09 0.05 0.10 0.14 SEQID-03637 Q90370 -- -- 1 0.43 0.13
0.03 0.08 0.03 0.04 0.01 0.09 0.08
0.02 0.12 0.02 0.08 0.05 SEQID-03638 Q90886 -- -- 1 0.42 0.13 0.03
0.08 0.03 0.04 0.01 0.09 0.08 0.02 0.12 0.02 0.08 0.05 SEQID-03639
Q9SKV7 -- -- 1 0.47 0.19 0.04 0.12 0.02 0.03 0.00 0.03 0.09 0.04
0.01 0.03 0.10 0.05 SEQID-03640 Q9M4U5 -- -- 1 0.42 0.12 0.05 0.00
0.03 0.13 0.01 0.03 0.13 0.04 0.03 0.02 0.06 0.16 SEQID-03641
WSP481 -- -- 1 0.24 0.10 0.07 0.08 0.02 0.05 0.01 0.05 0.06 0.15
0.01 0.02 0.04 0.05 SEQID-03642 WSPVF9 -- -- 1 0.37 0.15 0.04 0.09
0.05 0.06 0.02 0.05 0.08 0.03 0.04 0.03 0.07 0.06 SEQID-03643
A1A080 -- -- 0 0.51 0.26 0.05 0.13 0.01 0.06 0.00 0.07 0.08 0.04
0.02 0.07 0.04 0.17 SEQID-03644 A1A092 -- -- 0 0.42 0.21 0.00 0.25
0.05 0.00 0.07 0.06 0.08 0.03 0.06 0.08 0.00 0.09 SEQID-03645
A1A093 -- -- 0 0.43 0.20 0.05 0.19 0.04 0.06 0.01 0.04 0.06 0.04
0.01 0.10 0.07 0.12 SEQID-03646 A1A1E3 -- -- 0 0.46 0.19 0.18 0.09
0.08 0.03 0.00 0.04 0.04 0.03 0.03 0.05 0.06 0.19 SEQID-03647
A1A2C3 -- -- 0 0.51 0.14 0.07 0.15 0.05 0.02 0.00 0.02 0.04 0.04
0.06 0.00 0.10 0.18 SEQID-03648 A1A4Q4 -- -- 0 0.52 0.08 0.06 0.02
0.00 0.03 0.00 0.09 0.15 0.06 0.00 0.02 0.06 0.36 SEQID-03649
A2QCV8 -- -- 1 0.49 0.19 0.04 0.02 0.06 0.08 0.03 0.03 0.04 0.07
0.02 0.08 0.05 0.10 SEQID-03650 A2QEJ9 -- -- 1 0.44 0.18 0.05 0.05
0.07 0.08 0.02 0.02 0.05 0.04 0.02 0.05 0.08 0.06 SEQID-03651
A2WNH1 -- -- 0 0.46 0.17 0.03 0.05 0.02 0.01 0.14 0.05 0.05 0.07
0.08 0.07 0.05 0.08 SEQID-03652 A2Y1D7 -- -- 0 0.38 0.09 0.04 0.00
0.03 0.08 0.15 0.02 0.11 0.07 0.04 0.02 0.00 0.15 SEQID-03653
A2Y720 -- -- 0 0.39 0.05 0.16 0.04 0.01 0.08 0.00 0.09 0.11 0.05
0.03 0.01 0.02 0.16 SEQID-03654 A3B0Y1 -- -- 0 0.36 0.09 0.04 0.00
0.05 0.08 0.15 0.02 0.11 0.07 0.02 0.02 0.00 0.15 SEQID-03655
A4GG84 -- -- 1 0.54 0.25 0.03 0.08 0.05 0.02 0.01 0.07 0.07 0.04
0.02 0.15 0.05 0.13 SEQID-03656 A4GGE4 -- -- 0 0.61 0.14 0.05 0.08
0.06 0.00 0.02 0.02 0.00 0.02 0.00 0.06 0.07 0.23 SEQID-03657
A4GGF3 -- -- 0 0.50 0.22 0.00 0.12 0.04 0.03 0.00 0.11 0.04 0.03
0.03 0.08 0.11 0.13 SEQID-03658 A5D962 -- -- 1 0.35 0.12 0.05 0.10
0.01 0.07 0.02 0.03 0.11 0.04 0.01 0.03 0.07 0.09 SEQID-03659
A5VJC3 -- -- 0 0.46 0.14 0.03 0.11 0.04 0.04 0.02 0.04 0.07 0.01
0.07 0.02 0.09 0.12 SEQID-03660 A5VKX3 -- -- 0 0.55 0.07 0.04 0.16
0.06 0.02 0.00 0.03 0.00 0.04 0.04 0.00 0.06 0.22 SEQID-03661
A5VLI2 -- -- 0 0.53 0.16 0.02 0.14 0.05 0.00 0.07 0.06 0.03 0.03
0.06 0.05 0.00 0.23 SEQID-03662 A5VLK1 -- -- 1 0.56 0.15 0.03 0.08
0.00 0.06 0.00 0.02 0.06 0.05 0.05 0.03 0.04 0.16 SEQID-03663
A6QQ14 -- -- 0 0.35 0.18 0.15 0.10 0.01 0.08 0.02 0.05 0.10 0.04
0.00 0.04 0.10 0.05 SEQID-03664 A6QQ66 -- -- 0 0.34 0.12 0.03 0.01
0.06 0.13 0.02 0.02 0.25 0.01 0.03 0.03 0.08 0.07 SEQID-03665
A7Y3K4 -- -- 0 0.56 0.24 0.01 0.10 0.05 0.02 0.00 0.06 0.08 0.02
0.04 0.07 0.13 0.18 SEQID-03666 B0JEU3 -- -- 1 0.35 0.16 0.03 0.12
0.06 0.04 0.02 0.13 0.11 0.04 0.02 0.04 0.07 0.06 SEQID-03667
B1A991 -- -- 0 0.50 0.22 0.00 0.14 0.06 0.02 0.00 0.06 0.07 0.02
0.02 0.07 0.12 0.15 SEQID-03668 B2G5T7 -- -- 0 0.49 0.24 0.14 0.00
0.02 0.13 0.00 0.00 0.11 0.04 0.00 0.07 0.08 0.16 SEQID-03669
B2G6N9 -- -- 0 0.44 0.16 0.05 0.04 0.07 0.06 0.00 0.06 0.14 0.00
0.02 0.03 0.08 0.09 SEQID-03670 B2G7V3 -- -- 0 0.48 0.15 0.06 0.15
0.02 0.03 0.00 0.02 0.05 0.03 0.07 0.04 0.089 0.18 SEQID-03671
B2G8D6 -- -- 0 0.43 0.16 0.04 0.03 0.05 0.08 0.00 0.17 0.08 0.02
0.01 0.04 0.07 0.10 SEQID-03672 B3Y1Y0 -- -- 0 0.62 0.14 0.02 0.08
0.03 0.00 0.05 0.03 0.05 0.02 0.07 0.03 0.06 0.21 SEQID-03673
B3Y208 -- -- 0 0.51 0.20 0.00 0.13 0.07 0.04 0.01 0.09 0.00 0.02
0.03 0.05 0.12 0.15 SEQID-03674 B3DQC5 -- -- 0 0.51 0.25 0.05 0.12
0.02 0.05 0.00 0.07 0.07 0.05 0.02 0.07 0.04 0.16 SEQID-03675
B3DQT3 -- -- 0 0.53 0.15 0.07 0.13 0.03 0.03 0.00 0.05 0.04 0.04
0.08 0.02 0.10 0.20 SEQID-03676 B3DRN7 -- -- 0 0.29 0.13 0.11 0.00
0.03 0.13 0.00 0.19 0.14 0.02 0.00 0.03 0.06 0.02 SEQID-03677
B30S06 -- -- 1 0.53 0.19 0.05 0.03 0.00 0.05 0.00 0.04 0.17 0.03
0.06 0.05 0.10 0.09 SEQID-03678 B3DSB0 -- -- 0 0.46 0.21 0.18 0.09
0.08 0.03 0.00 0.04 0.04 0.03 0.03 0.06 0.08 0.17 SEQID-03679
B3LMP9 -- -- 1 0.48 0.20 0.02 0.09 0.06 0.089 0.00 0.04 0.04 0.04
0.02 0.05 0.06 0.07 SEQID-03680 B3W9Z1 -- -- 0 0.49 0.14 0.04 0.03
0.02 0.09 0.00 0.11 0.09 0.04 0.00 0.07 0.04 0.13 SEQID-03681
B3WF72 -- -- 0 0.46 0.18 0.04 0.01 0.03 0.10 0.00 0.18 0.06 0.02
0.00 0.06 0.09 0.11 SEQID-03682 B7GRY8 -- -- 0 0.44 0.21 0.18 0.10
0.08 0.03 0.00 0.04 0.04 0.03 0.03 0.06 0.08 0.16 SEQID-03683
B7GUP0 -- -- 0 0.33 0.15 0.08 0.00 0.03 0.13 0.00 0.19 0.14 0.02
0.00 0.03 0.06 0.02 SEQID-03684 B8DSI4 -- -- 0 0.40 0.25 0.09 0.07
0.02 0.08 0.00 0.04 0.15 0.02 0.01 0.06 0.10 0.00 SEQID-03685
B8DSQ1 -- -- 0 0.57 0.14 0.09 0.16 0.02 0.03 0.00 0.04 0.02 0.04
0.06 0.00 0.10 0.20 SEQID-03686 B8DUL7 -- -- 0 0.41 0.17 0.15 0.14
0.07 0.02 0.00 0.07 0.04 0.02 0.01 0.07 0.05 0.15 SEQID-03687
B8DV05 -- -- 0 0.37 0.08 0.05 0.38 0.06 0.00 0.00 0.02 0.00 0.03
0.03 0.02 0.04 0.10 SEQID-03688 B8DW24 -- -- 0 0.53 0.27 0.04 0.13
0.01 0.06 0.00 0.06 0.07 0.05 0.02 0.07 0.04 0.17 SEQID-03689
D5DEH5 -- -- 1 0.41 0.17 0.06 0.03 0.07 0.07 0.00 0.04 0.04 0.05
0.02 0.04 0.06 0.09 SEQID-03690 E1UMM6 -- -- 1 0.43 0.17 0.04 0.04
0.08 0.06 0.01 0.02 0.04 0.06 0.01 0.06 0.08 0.07 SEQID-03691
E1UQB7 -- -- 1 0.52 0.16 0.05 0.01 0.03 0.10 0.00 0.05 0.09 0.03
0.01 0.03 0.08 0.23 SEQID-03692 E1UV85 -- -- 0 0.44 0.20 0.07 0.01
0.06 0.05 0.00 0.14 0.07 0.04 0.00 0.05 0.06 0.13 SEQID-03693
E7Q903 -- -- 1 0.34 0.09 0.03 0.07 0.10 0.08 0.00 0.10 0.06 0.05
0.01 0.03 0.04 0.098 SEQID-03694 I1LP26 -- -- 1 0.49 0.17 0.03 0.05
0.05 0.08 0.01 0.04 0.07 0.02 0.03 0.05 0.07 0.17 SEQID-03695
K1WSX8 -- -- 1 0.38 0.14 0.07 0.10 0.02 0.04 0.00 0.17 0.10 0.01
0.02 0.02 0.07 0.07 SEQID-03696 K7K247 -- -- 1 0.48 0.12 0.04 0.04
0.05 0.04 0.01 0.07 0.15 0.01 0.03 0.03 0.07 0.19 SEQID-03697
O13555 -- -- 0 0.42 0.23 0.09 0.05 0.04 0.16 0.02 0.00 0.25 0.00
0.01 0.03 0.13 0.07 SEQID-03693 O49224 -- -- 0 0.47 0.07 0.00 0.40
0.00 0.00 0.00 0.04 0.00 0.05 0.00 0.00 0.04 0.25 SEQID-03699
P00126 -- -- 0 0.37 0.17 0.02 0.10 0.01 0.08 0.05 0.05 0.24 0.02
0.04 0.00 0.13 0.06 SEQID-03700 P00227 -- -- 0 0.37 0.19 0.06 0.02
0.00 0.12 0.05 0.04 0.15 0.03 0.01 0.04 0.05 0.05 SEQID-03701
P01249 -- -- 0 0.49 0.27 0.04 0.06 0.04 0.04 0.00 0.07 0.12 0.02
0.02 0.00 0.18 0.11 SEQID-03702 P01250 -- -- 0 0.47 0.27 0.04 0.06
0.04 0.04 0.00 0.05 0.14 0.01 0.00 0.00 0.18 0.11 SEQID-03703
P01251 -- -- 0 0.49 0.27 0.04 0.06 0.04 0.02 0.00 0.05 0.16 0.01
0.02 0.00 0.18 0.11 SEQID-03704 P02318 -- -- 0 0.17 0.06 0.01 0.60
0.00 0.00 0.11 0.02 0.00 0.02 0.02 0.02 0.02 0.00 SEQID-03705
P02405 -- -- 0 0.56 0.12 0.09 0.10 0.01 0.01 0.04 0.09 0.03 0.04
0.04 0.00 0.06 0.24 SEQID-03706 P02633 -- -- 0 0.49 0.21 0.02 0.00
0.03 0.05 0.00 0.06 0.19 0.03 0.00 0.03 0.15 0.16 SEQID-03707
P02777 -- -- 0 0.45 0.22 0.03 0.05 0.01 0.07 0.04 0.05 0.08 0.04
0.03 0.06 0.13 0.11 SEQID-03708 P04464 -- -- 0 0.45 0.17 0.09 0.04
0.02 0.01 0.13 0.05 0.05 0.07 0.08 0.07 0.05 0.08 SEQID-03709
P04568 -- -- 0 0.27 0.09 0.04 0.16 0.02 0.06 0.00 0.09 0.16 0.10
0.00 0.02 0.05 0.08 SEQID-03710 P04650 -- -- 0 0.46 0.11 0.06 0.22
0.11 0.00 0.00 0.08 0.00 0.00 0.00 0.07 0.04 0.16 SEQID-03711
P05747 -- -- 0 0.56 0.08 0.10 0.09 0.07 0.02 0.00 0.02 0.00 0.03
0.12 0.02 0.05 0.25 SEQID-03712 P05936 -- -- 0 0.46 0.18 0.04 0.04
0.02 0.00 0.13 0.03 0.06 0.08 0.09 0.08 0.03 0.07 SEQID-03713
P07249 -- -- 0 0.42 0.16 0.03 0.09 0.04 0.09 0.01 0.03 0.09 0.02
0.01 0.06 0.06 0.08 SEQID-03714 P07269 -- -- 1 0.40 0.16 0.03 0.06
0.14 0.10 0.00 0.07 0.05 0.01 0.04 0.06 0.08 0.05 SEQID-03715
P09441 -- -- 0 0.29 0.04 0.07 0.11 0.06 0.09 0.00 0.06 0.08 0.10
0.03 0.01 0.01 0.07 SEQID-03716 P0C225 -- -- 0 0.26 0.16 0.06 0.08
0.02 0.10 0.04 0.02 0.12 0.04 0.02 0.04 0.10 0.02 SEQID-03717
P0C5A4 -- -- 0 0.38 0.05 0.16 0.04 0.01 0.08 0.00 0.09 0.11 0.04
0.03 0.01 0.02 0.16 SEQID-03718 P0C5Q9 -- -- 0 0.42 0.09 0.07 0.12
0.06 0.00 0.00 0.07 0.07 0.03 0.00 0.03 0.06 0.10 SEQID-03719
P0CSR4 -- -- 1 0.56 0.25 0.01 0.11 0.04 0.06 0.02 0.05 0.02 0.01
0.05 0.10 0.08 0.07 SEQID-03720 P0CG92 -- -- 0 0.29 0.13 0.11 0.00
0.03 0.13 0.00 0.19 0.14 0.02 0.00 0.03 0.06 0.02 SEQID-03721
P10961 -- -- 1 0.39 0.15 0.03 0.07 0.15 0.08 0.00 0.04 0.06 0.02
0.03 0.05 0.07 0.06 SEQID-03722 P12230 -- -- 0 0.40 0.23 0.02 0.28
0.03 0.00 0.07 0.06 0.03 0.03 0.03 0.15 0.03 0.12 SEQID-03723
P14164 -- -- 1 0.39 0.16 0.03 0.04 0.15 0.12 0.00 0.04 0.07 0.02
0.07 0.05 0.06 0.08 SEQID-03724 P14724 -- -- 0 0.38 0.15 0.03 0.04
0.14 0.14 0.00 0.06 0.06 0.01 0.06 0.05 0.08 0.05 SEQID-03725
P14936 -- -- 0 0.39 0.19 0.05 0.01 0.01 0.11 0.04 0.06 0.12 0.04
0.05 0.04 0.07 0.07 SEQID-03726 P14937 -- -- 0 0.41 0.19 0.05 0.01
0.01 0.09 0.05 0.07 0.14 0.04 0.04 0.04 0.06 0.06 SEQID-03727
P15341 -- -- 0 0.10 0.06 0.01 0.63 0.00 0.00 0.11 0.06 0.00 0.00
0.00 0.00 0.02 0.00 SEQID-03728 P17639 -- -- 0 0.34 0.10 0.04 0.11
0.02 0.05 0.00 0.10 0.16 0.10 0.03 0.02 0.06 0.12 SEQID-03729
P17803 -- -- 0 0.50 0.19 0.02 0.06 0.05 0.05 0.02 0.09 0.05 0.02
0.00 0.08 0.08 0.11 SEQID-03730 P19515 -- -- 1 0.45 0.22 0.04 0.05
0.04 0.06 0.02 0.03 0.06 0.04 0.03 0.07 0.08 0.03 SEQID-03731
P19757 -- -- 0 0.16 0.06 0.01 0.48 0.01 0.03 0.04 0.08 0.05 0.02
0.07 0.01 0.02 0.00 SEQID-03732 P19782 -- -- 0 0.19 0.05 0.03 0.38
0.00 0.02 0.04 0.08 0.05 0.05 0.07 0.02 0.02 0.01 SEQID-03733
P20422 -- -- 0 0.46 0.18 0.06 0.00 0.03 0.08 0.01 0.01 0.11 0.07
0.03 0.03 0.04 0.09 SEQID-03734 P22613 -- -- 0 0.39 0.07 0.01 0.27
0.05 0.04 0.03 0.02 0.00 0.04 0.04 0.00 0.05 0.20 SEQID-03735
P22701 -- -- 0 0.30 0.09 0.04 0.13 0.01 0.05 0.00 0.06 0.18 0.10
0.00 0.02 0.05 0.10 SEQID-03736 P26351 -- -- 0 0.49 0.11 0.03 0.00
0.05 0.05 0.00 0.08 0.19 0.00 0.00 0.02 0.07 0.21 SEQID-03737
P26377 -- -- 0 0.32 0.06 0.01 0.22 0.04 0.01 0.05 0.09 0.01 0.02
0.12 0.01 0.02 0.09 SEQID-03738 P27013 -- -- 0 0.37 0.10 0.03 0.14
0.05 0.06 0.03 0.06 0.06 0.02 0.03 0.02 0.06 0.02 SEQID-03739
P28318 -- -- 0 0.52 0.22 0.02 0.04 0.04 0.07 0.01 0.14 0.07 0.02
0.12 0.06 0.10 0.09 SEQID-03740 P28804 -- -- 0 0.59 0.17 0.05 0.09
0.05 0.00 0.00 0.02 0.02 0.02 0.00 0.07 0.07 0.23 SEQID-03741
P31395 -- -- 0 0.42 0.14 0.07 0.08 0.05 0.03 0.00 0.05 0.23 0.01
0.03 0.03 0.09 0.17 SEQID-03742 P32389 -- -- 1 0.41 0.16 0.03 0.05
0.14 0.08 0.00 0.04 0.07 0.02 0.05 0.05 0.07 0.08 SEQID-03743
P32450 -- -- 0 0.38 0.14 0.01 0.21 0.02 0.04 0.04 0.11 0.01 0.01
0.13 0.06 0.06 0.03 SEQID-03744 P37219 -- -- 0 0.60 0.12 0.08 0.00
0.01 0.04 0.00 0.02 0.17 0.04 0.25 0.03 0.04 0.18 SEQID-03745
P37220 -- -- 0 0.56 0.11 0.10 0.04 0.02 0.02 0.00 0.04 0.14 0.04
0.19 0.03 0.04 0.22 SEQID-03746 P38236 -- -- 1 0.41 0.15 0.05 0.04
0.13 0.03 0.00 0.06 0.11 0.01 0.04 0.03 0.09 0.08 SEQID-03747
P38243 -- -- 0 0.45 0.14 0.03 0.07 0.05 0.08 0.00 0.04 0.07 0.01
0.04 0.04 0.10 0.10 SEQID-03748 P38284 -- -- 0 0.41 0.13 0.02 0.09
0.06 0.04 0.01 0.04 0.08 0.03 0.04 0.05 0.06 0.10 SEQID-03749
P39549 -- -- 1 0.41 0.11 0.02 0.07 0.06 0.04 0.03 0.04 0.14 0.02
0.03 0.04 0.06 0.04 SEQID-03750 P39973 -- -- 0 0.56 0.16 0.02 0.05
0.05 0.04 0.02 0.01 0.04 0.00 0.06 0.04 0.09 0.14 SEQID-03751
P41651 -- -- 0 0.47 0.16 0.06 0.10 0.03 0.07 0.01 0.00 0.02 0.02
0.02 0.07 0.04 0.20 SEQID-03752 P42755 -- -- 0 0.31 0.10 0.04 0.16
0.00 0.03 0.00 0.05 0.22 0.10 0.01 0.02 0.06 0.08 SEQID-03753
P46298 -- -- 1 0.54 0.24 0.04 0.11 0.00 0.04 0.01 0.02 0.05 0.03
0.05 0.09 0.11 0.15 SEQID-03754 P46517 -- -- 0 0.32 0.10 0.04 0.15
0.00 0.04 0.00 0.08 0.17 0.10 0.01 0.01 0.05 0.09 SEQID-03755
P46520 -- -- 0 0.26 0.09 0.04 0.15 0.01 0.05 0.00 0.10 0.17 0.11
0.00 0.02 0.04 0.08 SEQID-03756 P50415 -- -- 0 0.32 0.21 0.03 0.19
0.03 0.04 0.02 0.07 0.07 0.02 0.00 0.02 0.14 0.04 SEQID-03757
P51426 -- -- 0 0.53 0.10 0.02 0.24 0.05 0.02 0.00 0.02 0.00 0.01
0.04 0.07 0.03 0.16 SEQID-03758 P52193 -- -- 1 0.42 0.14 0.03 0.03
0.04 0.13 0.01 0.04 0.15 0.03 0.02 0.05 0.06 0.11 SEQID-03759
P53222 -- -- 0 0.40 0.14 0.04 0.13 0.09 0.04 0.01 0.03 0.06 0.00
0.02 0.06 0.05 0.09 SEQID-03760 P53334 -- -- 1 0.39 0.18 0.10 0.02
0.06 0.06 0.01 0.05 0.05 0.03 0.01 0.05 0.05 0.06 SEQID-03761
P53869 -- -- 1 0.48 0.12 0.01 0.16 0.01 0.05 0.00 0.04 0.05 0.02
0.01 0.02 0.07 0.11 SEQID-03762 P60741 -- -- 0 0.59 0.22 0.04 0.02
0.11 0.04 0.00 0.02 0.08 0.05 0.03 0.07 0.01 0.26
SEQID-03763 P62144 -- -- 0 0.44 0.16 0.04 0.04 0.02 0.01 0.12 0.06
0.05 0.06 0.06 0.08 0.05 0.07 SEQID-03764 P62326 -- -- 0 0.46 0.09
0.03 0.00 0.02 0.07 0.00 0.08 0.20 0.01 0.00 0.04 0.04 0.23
SEQID-03765 P63212 -- -- 0 0.45 0.18 0.12 0.06 0.06 0.04 0.03 0.03
0.10 0.00 0.02 0.06 0.09 0.11 SEQID-03766 P63314 -- -- 0 0.50 0.11
0.04 0.03 0.02 0.07 0.00 0.05 0.18 0.01 0.00 0.07 0.05 0.20
SEQID-03767 P67833 -- -- 0 0.17 0.06 0.01 0.62 0.00 0.00 0.11 0.02
0.11 0.01 0.02 0.00 0.02 0.00 SEQID-03768 P69328 -- -- 1 0.42 0.17
0.07 0.04 0.04 0.08 0.01 0.03 0.05 0.04 0.01 0.04 0.07 0.02
SEQID-03769 P79105 -- -- 0 0.59 0.26 0.02 0.04 0.03 0.10 0.00 0.06
0.08 0.02 0.06 0.08 0.11 0.12 SEQID-03770 P81451 -- -- 0 0.56 0.20
0.06 0.00 0.05 0.06 0.00 0.03 0.07 0.04 0.05 0.06 0.11 0.17
SEQID-03771 P83005 -- -- 0 0.28 0.15 0.05 0.11 0.02 0.10 0.04 0.02
0.11 0.03 0.05 0.02 0.10 0.00 SEQID-03772 P83489 -- -- 0 0.28 0.16
0.05 0.08 0.02 0.10 0.04 0.02 0.12 0.04 0.05 0.02 0.10 0.02
SEQID-03773 P83704 -- -- 0 0.46 0.21 0.07 0.02 0.04 0.04 0.01 0.12
0.10 0.01 0.02 0.03 0.14 0.10 SEQID-03774 P84088 -- -- 0 0.38 0.11
0.06 0.08 0.00 0.06 0.01 0.07 0.23 0.04 0.01 0.02 0.07 0.17
SEQID-03775 P86315 -- -- 0 0.30 0.14 0.05 0.08 0.02 0.10 0.04 0.05
0.12 0.04 0.02 0.00 0.10 0.02 SEQID-03776 P94522 -- -- 1 0.43 0.17
0.04 0.03 0.08 0.06 0.01 0.03 0.03 0.06 0.01 0.06 0.09 0.07
SEQID-03777 Q00747 -- -- 0 0.46 0.03 0.14 0.07 0.02 0.05 0.00 0.06
0.11 0.06 0.03 0.00 0.01 0.17 SEQID-03778 Q03323 -- -- 0 0.39 0.18
0.03 0.03 0.13 0.06 0.01 0.06 0.12 0.02 0.03 0.05 0.07 0.08
SEQID-03779 Q033K5 -- -- 0 0.53 0.09 0.04 0.28 0.02 0.00 0.00 0.02
0.02 0.03 0.05 0.00 0.04 0.19 SEQID-03780 Q035G1 -- -- 0 0.47 0.17
0.07 0.15 0.01 0.05 0.00 0.05 0.03 0.03 0.05 0.03 0.09 0.16
SEQID-03781 Q035T6 -- -- 0 0.52 0.15 0.04 0.11 0.04 0.00 0.07 0.05
0.07 0.02 0.05 0.00 0.06 0.16 SEQID-03782 Q037X5 -- -- 0 0.46 0.18
0.04 0.01 0.03 0.10 0.00 0.18 0.06 0.03 0.00 0.06 0.09 0.11
SEQID-03783 Q038A1 -- -- 0 0.55 0.09 0.05 0.18 0.00 0.01 0.00 0.07
0.00 0.02 0.09 0.01 0.06 0.20 SEQID-03784 Q038J5 -- -- 0 0.38 0.17
0.06 0.07 0.05 0.07 0.00 0.05 0.11 0.01 0.03 0.03 0.11 0.06
SEQID-03785 Q038L1 -- -- 0 0.50 0.13 0.07 0.09 0.01 0.07 0.01 0.05
0.05 0.03 0.09 0.00 0.08 0.09 SEQID-03786 Q039F0 -- -- 0 0.35 0.11
0.05 0.07 0.06 0.07 0.00 0.04 0.11 0.02 0.04 0.01 0.08 0.04
SEQID-03787 Q045U8 -- -- 0 0.46 0.16 0.07 0.04 0.04 0.13 0.00 0.11
0.04 0.05 0.00 0.05 0.07 0.12 SEQID-03788 Q04664 -- -- 0 0.58 0.22
0.05 0.02 0.11 0.04 0.00 0.02 0.08 0.05 0.03 0.07 0.01 0.26
SEQID-03789 Q046C1 -- -- 1 0.57 0.18 0.04 0.09 0.00 0.04 0.00 0.02
0.06 0.04 0.04 0.06 0.03 0.14 SEQID-03790 Q04C04 -- -- 0 0.57 0.24
0.07 0.02 0.10 0.03 0.00 0.00 0.03 0.06 0.02 0.06 0.01 0.22
SEQID-03791 Q04C49 -- -- 0 0.49 0.11 0.05 0.05 0.05 0.05 0.01 0.03
0.08 0.04 0.03 0.05 0.02 0.14 SEQID-03792 Q06648 -- -- 1 0.41 0.15
0.03 0.07 0.09 0.05 0.00 0.05 0.06 0.01 0.04 0.04 0.08 0.09
SEQID-03793 Q08655 -- -- 0 0.59 0.13 0.08 0.01 0.00 0.04 0.00 0.01
0.18 0.03 0.19 0.04 0.06 0.20 SEQID-03794 Q08745 -- -- 1 0.43 0.18
0.02 0.07 0.04 0.03 0.00 0.09 0.10 0.02 0.03 0.04 0.08 0.09
SEQID-03795 Q09MC8 -- -- 0 0.62 0.15 0.07 0.08 0.06 0.00 0.02 0.00
0.00 0.03 0.00 0.04 0.10 0.24 SEQID-03796 Q0G9R4 -- -- 0 0.59 0.16
0.05 0.10 0.06 0.00 0.00 0.02 0.00 0.04 0.00 0.06 0.07 0.27
SEQID-03797 Q0 J2 -- -- 0 0.56 0.11 0.09 0.05 0.02 0.02 0.00 0.03
0.03 0.02 0.01 0.03 0.02 0.34 SEQID-03798 Q NL7 -- -- 0 0.46 0.17
0.03 0.05 0.02 0.01 0.13 0.05 0.05 0.07 0.08 0.04 0.05 0.08
SEQID-03799 Q0MUU2 -- -- 0 0.37 0.17 0.06 0.07 0.06 0.01 0.01 0.07
0.12 0.03 0.00 0.07 0.05 0.12 SEQID-03800 Q0VBZ8 -- -- 1 0.33 0.15
0.05 0.16 0.02 0.04 0.01 0.05 0.07 0.02 0.02 0.02 0.09 0.04
SEQID-03801 Q12034 -- -- 1 0.38 0.13 0.03 0.05 0.15 0.05 0.00 0.06
0.07 0.02 0.01 0.06 0.06 0.10 SEQID-03802 Q12087 -- -- 0 0.49 0.16
0.04 0.15 0.05 0.00 0.00 0.04 0.04 0.04 0.02 0.00 0.06 0.20
SEQID-03803 Q12515 -- -- 0 0.42 0.15 0.04 0.06 0.15 0.07 0.00 0.03
0.06 0.05 0.03 0.07 0.04 0.12 SEQID-03804 Q148C4 -- -- 0 0.36 0.06
0.06 0.07 0.03 0.08 0.00 0.13 0.11 0.05 0.00 0.03 0.00 0.15
SEQID-03805 Q14FC3 -- -- 0 0.38 0.20 0.03 0.32 0.03 0.00 0.07 0.06
0.03 0.03 0.03 0.15 0.05 0.12 SEQID-03806 Q1G9G5 -- -- 0 0.55 0.23
0.04 0.01 0.01 0.05 0.00 0.06 0.09 0.05 0.04 0.04 0.03 0.19
SEQID-03807 Q1GAQ4 -- -- 0 0.46 0.17 0.15 0.10 0.05 0.04 0.00 0.06
0.04 0.01 0.02 0.05 0.08 0.19 SEQID-03808 Q1GBK7 -- -- 0 0.56 0.24
0.07 0.02 0.10 0.03 0.00 0.00 0.09 0.06 0.02 0.06 0.01 0.20
SEQID-03809 Q1GBL4 -- -- 1 0.57 0.17 0.05 0.09 0.00 0.07 0.00 0.04
0.05 0.03 0.05 0.04 0.04 0.15 SEQID-03810 Q1JQB5 -- -- 1 0.33 0.16
0.06 0.10 0.02 0.06 0.06 0.04 0.09 0.03 0.03 0.03 0.08 0.05
SEQID-03811 Q29S17 -- -- 0 0.36 0.20 0.04 0.10 0.03 0.04 0.00 0.07
0.25 0.01 0.05 0.02 0.15 0.03 SEQID-03812 Q2KU9 -- -- 0 0.33 0.12
0.02 0.13 0.02 0.02 0.01 0.04 0.23 0.02 0.02 0.02 0.07 0.08
SEQID-03813 Q2KJD8 -- -- 0 0.36 0.22 0.11 0.19 0.03 0.10 0.01 0.03
0.06 0.06 0.04 0.01 0.14 0.00 SEQID-03814 Q2L961 -- -- 0 0.58 0.16
0.06 0.10 0.06 0.00 0.00 0.02 0.02 0.02 0.00 0.04 0.07 0.23
SEQID-03815 Q2MID0 -- -- 0 0.55 0.24 0.01 0.12 0.05 0.02 0.00 0.06
0.07 0.02 0.04 0.07 0.12 0.16 SEQID-03816 Q2PMN0 -- -- 0 0.60 0.12
0.03 0.10 0.05 0.00 0.02 0.02 0.00 0.02 0.00 0.05 0.05 0.23
SEQID-03817 Q2PMN9 -- -- 0 0.48 0.22 0.00 0.17 0.03 0.04 0.00 0.07
0.06 0.02 0.02 0.10 0.09 0.14 SEQID-03818 Q2PMP7 -- -- 1 0.51 0.25
0.03 0.08 0.06 0.03 0.02 0.08 0.06 0.04 0.01 0.15 0.05 0.12
SEQID-03819 Q2TBJ3 -- -- 1 0.48 0.20 0.03 0.02 0.06 0.10 0.00 0.00
0.14 0.01 0.02 0.07 0.08 0.07 SEQID-03820 Q2V2P1 -- -- 0 0.41 0.13
0.05 0.07 0.08 0.07 0.01 0.11 0.13 0.00 0.02 0.05 0.06 0.07
SEQID-03821 Q32KM6 -- -- 1 0.44 0.11 0.02 0.06 0.05 0.07 0.01 0.06
0.08 0.07 0.02 0.03 0.04 0.12 SEQID-03822 Q32KN2 -- -- 1 0.45 0.17
0.02 0.07 0.04 0.05 0.00 0.04 0.09 0.03 0.04 0.04 0.10 0.08
SEQID-03823 Q32LI5 -- -- 1 0.39 0.13 0.03 0.10 0.04 0.06 0.01 0.07
0.10 0.01 0.01 0.04 0.02 0.14 SEQID-03824 Q32IJ0 -- -- 0 0.36 0.11
0.05 0.10 0.01 0.03 0.01 0.16 0.15 0.01 0.00 0.03 0.04 0.15
SEQID-03825 Q32PA2 -- -- 0 0.28 0.12 0.04 0.05 0.01 0.03 0.02 0.09
0.31 0.06 0.03 0.00 0.08 0.06 SEQID-03826 Q32PA4 -- -- 1 0.38 0.17
0.06 0.06 0.00 0.10 0.01 0.05 0.06 0.05 0.04 0.07 0.02 0.09
SEQID-03827 Q32PD7 -- -- 0 0.42 0.16 0.08 0.00 0.04 0.20 0.00 0.02
0.10 0.05 0.02 0.02 0.09 0.04 SEQID-03828 Q332T8 -- -- 1 0.49 0.24
0.03 0.10 0.05 0.03 0.01 0.08 0.08 0.04 0.02 0.15 0.06 0.10
SEQID-03829 Q3E742 -- -- 0 0.54 0.12 0.04 0.06 0.07 0.00 0.03 0.05
0.08 0.03 0.05 0.01 0.06 0.30 SEQID-03830 Q3E764 -- -- 0 0.52 0.11
0.07 0.02 0.02 0.07 0.00 0.11 0.04 0.06 0.00 0.03 0.07 0.31
SEQID-03831 Q3E807 -- -- 1 0.56 0.17 0.01 0.05 0.04 0.03 0.02 0.03
0.04 0.01 0.05 0.05 0.08 0.12 SEQID-03832 Q3I5G7 -- -- 0 0.44 0.17
0.09 0.00 0.02 0.05 0.00 0.05 0.17 0.07 0.01 0.02 0.03 0.13
SEQID-03833 Q3MIC0 -- -- 1 0.56 0.16 0.06 0.11 0.01 0.01 0.04 0.02
0.09 0.05 0.03 0.06 0.03 0.19 SEQID-03834 Q35WY1 -- -- 1 0.39 0.16
0.06 0.09 0.01 0.03 0.02 0.04 0.09 0.05 0.04 0.01 0.11 0.09
SEQID-03835 Q3T051 -- -- 0 0.54 0.12 0.01 0.22 0.05 0.00 0.00 0.06
0.00 0.02 0.04 0.07 0.05 0.18 SEQID-03836 Q3T0F2 -- -- 1 0.55 0.18
0.04 0.05 0.06 0.08 0.00 0.02 0.06 0.02 0.07 0.04 0.08 0.07
SEQID-03837 Q3V4Y6 -- -- 0 0.57 0.13 0.05 0.10 0.04 0.00 0.00 0.04
0.02 0.02 0.00 0.03 0.03 0.24 SEQID-03838 Q3V500 -- -- 0 0.42 0.22
0.02 0.28 0.03 0.00 0.07 0.06 0.03 0.03 0.03 0.15 0.03 0.14
SEQID-03839 Q3ZBD4 -- -- 0 0.35 0.16 0.06 0.07 0.06 0.01 0.01 0.07
0.12 0.04 0.00 0.09 0.04 0.12 SEQID-03840 Q41784 -- -- 1 0.43 0.17
0.04 0.07 0.05 0.06 0.02 0.05 0.10 0.04 0.03 0.04 0.08 0.04
SEQID-03841 Q4VZK0 -- -- 1 0.49 0.26 0.02 0.17 0.07 0.03 0.01 0.02
0.05 0.04 0.02 0.15 0.08 0.07 SEQID-03842 Q4VZL1 -- -- 0 0.49 0.22
0.00 0.12 0.05 0.02 0.00 0.07 0.08 0.02 0.03 0.02 0.12 0.16
SEQID-03843 Q4VZN0 -- -- 1 0.48 0.25 0.03 0.10 0.05 0.01 0.04 0.08
0.07 0.05 0.02 0.14 0.06 0.09 SEQID-03844 Q5E9A0 -- -- 1 0.37 0.15
0.05 0.09 0.02 0.06 0.03 0.05 0.08 0.03 0.03 0.02 0.07 0.08
SEQID-03845 Q5EAE6 -- -- 1 0.41 0.10 0.06 0.08 0.00 0.07 0.00 0.08
0.07 0.04 0.09 0.05 0.01 0.11 SEQID-03846 Q5F3Z5 -- -- 1 0.40 0.10
0.04 0.10 0.04 0.05 0.00 0.04 0.11 0.06 0.03 0.02 0.05 0.09
SEQID-03847 Q5 W8 -- -- 0 0.58 0.07 0.05 0.20 0.01 0.01 0.00 0.05
0.00 0.03 0.12 0.01 0.03 0.18 SEQID-03848 Q5FKE7 -- -- 0 0.32 0.10
0.05 0.07 0.04 0.09 0.00 0.07 0.11 0.00 0.01 0.00 0.07 0.04
SEQID-03849 Q5FM68 -- -- 0 0.52 0.16 0.02 0.14 0.03 0.00 0.07 0.06
0.03 0.03 0.09 0.05 0.00 0.17 SEQID-03850 Q5FM86 -- -- 1 0.55 0.17
0.05 0.07 0.00 0.09 0.00 0.04 0.02 0.03 0.05 0.05 0.04 0.13
SEQID-03851 Q5SMI4 -- -- 0 0.53 0.10 0.02 0.22 0.05 0.02 0.00 0.04
0.00 0.01 0.04 0.07 0.03 0.16 SEQID-03852 Q5ZMM5 -- -- 0 0.46 0.09
0.08 0.04 0.01 0.04 0.02 0.18 0.05 0.01 0.05 0.03 0.04 0.19
SEQID-03853 Q5ZMN0 -- -- 0 0.34 0.20 0.01 0.05 0.06 0.17 0.01 0.01
0.23 0.03 0.01 0.03 0.14 0.06 SEQID-03854 Q6SMX0 -- -- 1 0.46 0.16
0.05 0.06 0.05 0.08 0.00 0.05 0.06 0.05 0.06 0.04 0.06 0.07
SEQID-03855 Q66QC7 -- -- 0 0.09 0.06 0.01 0.65 0.00 0.00 0.12 0.04
0.00 0.00 0.00 0.00 0.02 0.00 SEQID-03856 Q6RFL5 -- -- 1 0.44 0.18
0.05 0.09 0.02 0.04 0.00 0.04 0.10 0.02 0.09 0.03 0.12 0.06
SEQID-03857 Q74IL4 -- -- 0 0.59 0.21 0.03 0.01 0.01 0.04 0.00 0.03
0.10 0.04 0.04 0.05 0.02 0.22 SEQID-03858 Q74L00 -- -- 0 0.49 0.16
0.07 0.03 0.05 0.12 0.00 0.10 0.04 0.05 0.00 0.05 0.07 0.14
SEQID-03859 Q74LZ9 -- -- 0 0.53 0.16 0.06 0.03 0.00 0.08 0.00 0.04
0.18 0.06 0.02 0.04 0.04 0.29 SEQID-03860 Q7DMN9 -- -- 0 0.45 0.17
0.03 0.05 0.03 0.01 0.13 0.05 0.05 0.07 0.08 0.07 0.04 0.08
SEQID-03861 Q7M2P1 -- -- 0 0.49 0.10 0.02 0.21 0.01 0.00 0.01 0.06
0.03 0.01 0.02 0.04 0.01 0.22 SEQID-03862 Q7XC27 -- -- 1 0.50 0.21
0.03 0.08 0.05 0.09 0.00 0.02 0.10 0.02 0.01 0.07 0.09 0.07
SEQID-03863 Q7YQJ3 -- -- 0 0.27 0.13 0.06 0.08 0.01 0.10 0.01 0.05
0.15 0.06 0.00 0.03 0.04 0.03 SEQID-03864 Q88VD4 -- -- 0 0.44 0.14
0.15 0.12 0.08 0.06 0.00 0.01 0.03 0.01 0.00 0.05 0.04 0.17
SEQID-03865 Q88WD3 -- -- 0 0.50 0.12 0.06 0.04 0.01 0.14 0.00 0.05
0.10 0.04 0.00 0.00 0.04 0.27 SEQID-03866 Q88WM6 -- -- 0 0.40 0.18
0.06 0.00 0.07 0.05 0.00 0.17 0.17 0.03 0.00 0.01 0.12 0.06
SEQID-03867 Q88WN5 -- -- 0 0.55 0.19 0.06 0.04 0.01 0.07 0.00 0.07
0.05 0.06 0.02 0.05 0.01 0.16 SEQID-03868 Q88WU7 -- -- 0 0.59 0.12
0.07 0.13 0.03 0.00 0.00 0.07 0.02 0.02 0.06 0.05 0.05 0.24
SEQID-03869 Q88XY2 -- -- 1 0.57 0.17 0.09 0.08 0.00 0.10 0.00 0.02
0.01 0.04 0.07 0.07 0.04 0.15 SEQID-03870 Q88YP9 -- -- 0 0.52 0.14
0.06 0.01 0.04 0.12 0.00 0.11 0.03 0.03 0.00 0.02 0.05 0.11
SEQID-03871 Q8G435 -- -- 0 0.44 0.12 0.03 0.19 0.05 0.03 0.06 0.02
0.08 0.02 0.02 0.05 0.05 0.12 SEQID-03872 Q8GC82 -- -- 1 0.47 0.20
0.03 0.05 0.12 0.06 0.00 0.01 0.04 0.05 0.03 0.09 0.05 0.08
SEQID-03873 Q8HYY9 -- -- 0 0.26 0.16 0.06 0.11 0.02 0.10 0.04 0.02
0.12 0.04 0.05 0.04 0.10 0.00 SEQID-03874 Q8TGT3 -- -- 0 0.62 0.22
0.00 0.12 0.00 0.03 0.03 0.03 0.06 0.00 0.00 0.06 0.11 0.16
SEQID-03875 Q8TGU1 -- -- 0 0.48 0.17 0.00 0.06 0.09 0.04 0.04 0.02
0.15 0.03 0.05 0.04 0.11 0.14 SEQID-03876 Q8TGV0 -- -- 0 0.26 0.14
0.00 0.28 0.03 0.00 0.03 0.08 0.00 0.00 0.00 0.03 0.10 0.04
SEQID-03877 Q90953 -- -- 1 0.45 0.18 0.04 0.04 0.03 0.06 0.01 0.04
0.12 0.03 0.03 0.05 0.06 0.06 SEQID-03878 Q96386 -- -- 0 0.39 0.09
0.05 0.00 0.05 0.10 0.15 0.02 0.06 0.04 0.02 0.05 0.00 0.11
SEQID-03879 Q98TFS -- -- 0 0.56 0.12 0.01 0.20 0.05 0.00 0.00 0.06
0.00 0.02 0.04 0.07 0.05 0.20 SEQID-03880 Q9DET5 -- -- 0 0.52 0.12
0.00 0.00 0.04 0.07 0.04 0.02 0.20 0.00 0.00 0.02 0.06 0.27
SEQID-03881 Q9N250 -- -- 0 0.49 0.20 0.09 0.00 0.03 0.03 0.00 0.06
0.19 0.04 0.01 0.02 0.01 0.15 SEQID-03882 Q9P305 -- -- 0 0.39 0.18
0.04 0.10 0.06 0.08 0.00 0.04 0.04 0.04 0.02 0.05 0.09 0.11
SEQID-03883 Q9SP22 -- -- 1 0.44 0.14 0.05 0.02 0.03 0.14 0.00 0.03
0.12 0.03 0.03 0.06 0.05 0.14 SEQID-03884 Q9URQ5 -- -- 0 0.42 0.19
0.02 0.10 0.14 0.01 0.01 0.06 0.13 0.00 0.01 0.05 0.12 0.08
SEQID-03885 Q9XSK7 -- -- 1 0.34 0.09 0.05 0.06 0.03 0.05 0.01 0.02
0.23 0.05 0.02 0.01 0.06 0.13 SEQID-03886 Q92T46 -- -- 0 0.50 0.20
0.03 0.04 0.04 0.08 0.00 0.05 0.07 0.06 0.04 0.07 0.07 0.10
SEQID-03887 Q9ZT47 -- -- 0 0.51 0.18 0.03 0.03 0.04 0.08 0.01 0.02
0.08 0.07 0.06 0.06 0.07 0.12 SEQID-03888 Q9ZZV8 -- -- 0 0.39 0.07
0.02 0.16 0.08 0.04 0.00 0.00 0.02
0.04 0.00 0.02 0.02 0.13 SEQID-03889 W5PEW5 -- -- 1 0.42 0.20 0.03
0.06 0.04 0.04 0.01 0.10 0.18 0.01 0.02 0.03 0.13 0.11 SEQID-03890
Q2YDE5 -- 6:66 0 0.45 0.23 0.00 0.09 0.08 0.00 0.06 0.04 0.02 0.22
0.16 0.02 0.00 0.02 SEQID-03891 Q06698 -- 151:201 0 0.57 0.16 0.00
0.07 0.00 0.04 0.13 0.10 0.02 0.13 0.14 0.06 0.01 0.07 SEQID-03892
P53061 -- 251:301 0 0.57 0.14 0.00 0.07 0.00 0.02 0.05 0.05 0.05
0.07 0.24 0.02 0.01 0.11 SEQID-03893 P53061 -- 251:306 0 0.56 0.14
0.00 0.06 0.00 0.02 0.05 0.04 0.05 0.08 0.24 0.02 0.01 0.10
SEQID-03894 P53061 -- 251:311 0 0.56 0.16 0.00 0.06 0.00 0.02 0.08
0.04 0.04 0.10 0.23 0.02 0.01 0.10 SEQID-03895 P53061 -- 251:316 0
0.57 0.17 0.00 0.06 0.00 0.02 0.08 0.04 0.04 0.11 0.22 0.02 0.01
0.09 SEQID-03896 Q90980 -- 381:431 0 0.58 0.26 0.00 0.04 0.00 0.02
0.07 0.10 0.07 0.11 0.16 0.02 0.03 0.02 SEQID-03897 Q00194 --
426:476 0 0.60 0.24 0.00 0.04 0.00 0.02 0.09 0.10 0.05 0.11 0.18
0.02 0.02 0.02 SEQID-03898 Q00194 -- 426:481 0 0.59 0.24 0.00 0.03
0.00 0.02 0.10 0.09 0.07 0.10 0.17 0.02 0.03 0.04 SEQID-03899
Q90805 -- 466:521 0 0.67 0.24 0.00 0.05 0.00 0.04 0.09 0.05 0.05
0.12 0.21 0.02 0.03 0.04 SEQID-03900 Q35Z12 -- 86:136 0 0.57 0.21
0.00 0.07 0.00 0.02 0.04 0.10 0.09 0.05 0.23 0.04 0.03 0.02
SEQID-03901 P04467 -- 121:171 0 0.56 0.25 0.01 0.08 0.01 0.00 0.12
0.03 0.00 0.23 0.15 0.04 0.04 0.05 SEQID-03902 Q0P584 -- 166:216 0
0.51 0.23 0.00 0.02 0.03 0.02 0.06 0.20 0.00 0.22 0.14 0.04 0.02
0.02 SEQID-03903 Q2NL14 -- 211:261 0 0.52 0.24 0.03 0.04 0.03 0.07
0.00 0.15 0.00 0.22 0.17 0.00 0.02 0.02 SEQID-03904 Q10MN8 --
211:276 0 0.32 0.25 0.01 0.01 0.05 0.04 0.06 0.20 0.01 0.22 0.00
0.02 0.09 0.02 SEQID-03905 P58797 -- 266:316 0 0.47 0.31 0.02 0.06
0.08 0.00 0.08 0.08 0.02 0.26 0.16 0.00 0.05 0.00 SEQID-03906
A7A1V1 -- 41:91 0 0.49 0.33 0.02 0.06 0.03 0.02 0.09 0.13 0.07 0.24
0.08 0.00 0.00 0.00 SEQID-03907 P50275 -- 491:546 0 0.47 0.27 0.00
0.03 0.04 0.00 0.05 0.05 0.03 0.22 0.08 0.00 0.01 0.07 SEQID-03908
Q60CZ8 -- 591:646 0 0.42 0.29 0.01 0.03 0.04 0.00 0.16 0.14 0.03
0.22 0.04 0.02 0.03 0.00 SEQID-03909 Q9AWA5 -- 821:876 0 0.45 0.30
0.01 0.05 0.01 0.02 0.09 0.14 0.02 0.22 0.06 0.00 0.03 0.02 Aller-
SolveScore NetChg genHo- Aller- Tox- Anti- SEQID M F P S T W Y V
(pH 7) AggScore (pH 7) pI mology genicity icity nutricity
SEQID-00001 0.05 0.07 0.03 0.03 0.04 0.01 0.04 0.07 -18.29 0.50
-0.03 4.96 1.00 1.00 0.20 0.42 SEQID-00002 0.02 0.06 0.05 0.05 0.03
0.01 0.03 0.05 -18.75 0.40 -0.01 5.25 1.00 1.00 0.19 0.21
SEQID-00003 0.03 0.03 0.04 0.03 0.05 0.02 0.03 0.04 -20.98 0.56
-0.04 4.66 1.00 1.00 0.00 0.24 SEQID-00004 0.03 0.05 0.07 0.06 0.02
0.02 0.07 0.05 -21.19 0.32 -0.05 4.70 1.00 1.00 0.23 0.23
SEQID-00005 0.04 0.05 0.14 0.06 0.04 0.01 0.03 0.08 -15.50 0.50
-0.03 5.06 1.00 1.00 0.24 0.12 SEQID-00006 0.02 0.05 0.01 0.05 0.05
0.05 0.04 0.05 -20.52 0.44 -0.04 4.73 1.00 1.00 0.26 0.25
SEQID-00007 0.00 0.02 0.01 0.03 0.00 0.00 0.15 0.03 -28.17 0.11
0.00 6.98 0.29 0.19 0.37 0.33 SEQID-00008 0.05 0.08 0.01 0.04 0.05
0.00 0.02 0.05 -30.62 0.31 -0.21 3.67 0.95 0.98 0.23 0.00
SEQID-00009 0.02 0.02 0.03 0.03 0.02 0.00 0.02 0.03 -38.14 0.22
-0.28 3.59 0.23 0.41 0.23 0.25 SEQID-00010 0.03 0.05 0.07 0.06 0.03
0.00 0.04 0.06 -5.26 0.69 0.01 9.42 0.28 0.39 0.25 0.00 SEQID-00011
0.03 0.07 0.04 0.03 0.05 0.01 0.07 0.06 -21.57 0.36 -0.02 5.81 0.25
0.32 0.24 0.00 SEQID-00012 0.00 0.02 0.01 0.03 0.00 0.00 0.15 0.03
-28.17 0.11 0.00 6.98 0.29 0.19 0.37 0.33 SEQID-00013 0.00 0.02
0.02 0.03 0.00 0.00 0.16 0.03 -27.17 0.12 0.00 7.00 0.30 0.19 0.38
0.34 SEQID-00014 0.00 0.02 0.02 0.03 0.00 0.00 0.13 0.03 -28.08
0.11 0.02 7.69 0.31 0.20 0.38 0.31 SEQID-00015 0.00 0.03 0.02 0.03
0.00 0.00 0.14 0.04 -27.01 0.12 0.02 7.75 0.31 0.13 0.38 0.28
SEQID-00016 0.05 0.03 0.04 0.04 0.04 0.02 0.03 0.02 -20.72 0.65
-0.13 3.73 0.40 0.44 0.26 0.25 SEQID-00017 0.05 0.10 0.04 0.05 0.02
0.02 0.06 0.04 -19.76 0.63 -0.12 3.86 0.48 0.51 0.00 0.30
SEQID-00018 0.04 0.06 0.00 0.05 0.02 0.05 0.08 0.02 -20.08 0.50
0.25 12.35 0.22 0.24 0.00 0.24 SEQID-00019 0.00 0.10 0.00 0.00 0.00
0.00 0.00 0.06 -27.12 0.34 0.37 13.87 0.26 0.28 0.00 0.25
SEQID-00020 0.03 0.10 0.03 0.05 0.03 0.00 0.04 0.05 -19.74 0.39
0.13 10.85 0.42 0.47 0.25 0.26 SEQID-00021 0.02 0.00 0.05 0.06 0.03
0.00 0.12 0.07 -17.96 0.43 0.12 10.56 0.26 0.30 0.25 0.00
SEQID-00022 0.03 0.05 0.08 0.05 0.04 0.00 0.05 0.06 -4.43 0.72 0.01
8.97 0.29 0.39 0.25 0.00 SEQID-00023 0.01 0.01 0.06 0.06 0.00 0.00
0.03 0.05 -6.27 0.79 0.02 9.33 0.36 0.39 0.00 0.00 SEQID-00024 0.00
0.07 0.04 0.02 0.06 0.00 0.00 0.10 -15.79 0.80 -0.03 4.45 0.28 0.31
0.00 1.00 SEQID-00025 0.00 0.05 0.03 0.06 0.04 0.00 0.00 0.03
-16.50 0.84 0.08 3.94 0.25 0.29 0.00 1.00 SEQID-00026 0.00 0.05
0.00 0.00 0.03 0.07 0.00 0.03 -9.16 2.04 -0.04 4.15 0.28 0.32 0.24
0.26 SEQID-00027 0.02 0.02 0.03 0.04 0.03 0.00 0.12 0.09 -16.31
0.80 -0.05 4.39 0.23 0.32 0.00 0.00 SEQID-00028 0.00 0.03 0.01 0.03
0.05 0.00 0.03 0.15 -21.97 1.00 -0.25 3.10 0.28 0.30 0.00 0.25
SEQID-00029 0.03 0.01 0.02 0.04 0.02 0.00 0.13 0.06 -24.09 0.41
-0.12 3.93 0.00 0.31 0.00 0.00 SEQID-00030 0.00 0.00 0.00 0.05 0.08
0.00 0.00 0.05 -28.44 0.16 -0.04 4.97 0.33 0.36 0.00 0.00
SEQID-00031 0.00 0.00 0.00 0.02 0.04 0.00 0.01 0.04 -36.33 0.16
-0.04 4.90 0.32 0.33 0.00 0.00 SEQID-00032 0.02 0.00 0.00 0.03 0.06
0.00 0.00 0.03 -36.17 0.22 -0.12 4.27 0.32 0.35 0.25 0.27
SEQID-00033 0.02 0.00 0.01 0.04 0.06 0.02 0.01 0.07 -27.36 0.49
0.01 8.97 0.30 0.34 0.00 0.30 SEQID-00034 0.04 0.00 0.03 0.03 0.05
0.03 0.03 0.04 -20.74 0.58 0.00 6.54 0.84 0.34 0.29 0.28
SEQID-00035 0.02 0.01 0.04 0.05 0.06 0.00 0.00 0.09 -18.18 0.64
0.05 10.26 0.26 0.30 0.00 0.00 SEQID-00036 0.02 0.08 0.01 0.03 0.04
0.06 0.06 0.06 -17.32 0.73 0.03 8.48 0.51 0.60 0.26 0.24
SEQID-00037 0.06 0.07 0.00 0.00 0.10 0.05 0.00 0.09 -14.15 1.56
0.19 11.98 0.14 0.26 0.23 0.24 SEQID-00038 0.01 0.06 0.03 0.06 0.02
0.08 0.01 0.07 -19.01 0.72 0.00 7.29 0.26 0.33 0.25 0.27
SEQID-00039 0.02 0.06 0.02 0.03 0.03 0.02 0.05 0.06 -24.37 0.51
0.05 9.49 0.27 0.30 0.24 0.26 SEQID-00040 0.00 0.08 0.04 0.02 0.05
0.00 0.03 0.11 -17.17 0.77 -0.03 4.50 0.27 0.31 0.00 1.00
SEQID-00041 0.03 0.06 0.01 0.05 0.03 0.05 0.08 0.02 -21.00 0.47
0.22 12.17 0.19 0.25 0.00 0.00 SEQID-00042 0.01 0.04 0.12 0.11 0.06
0.00 0.06 0.04 -24.24 0.16 -0.21 3.55 0.29 0.32 0.26 0.30
SEQID-00043 0.00 0.05 0.04 0.00 0.05 0.00 0.00 0.11 -17.59 0.99
-0.02 4.77 0.32 0.20 0.00 1.00 SEQID-00044 0.00 0.05 0.03 0.00 0.05
0.00 0.00 0.11 -17.59 1.04 -0.02 4.77 0.32 0.20 0.00 1.00
SEQID-00045 0.00 0.03 0.03 0.02 0.05 0.00 0.00 0.10 -18.20 0.93
-0.04 4.46 0.32 0.21 0.00 1.00 SEQID-00046 0.00 0.03 0.03 0.02 0.05
0.00 0.00 0.10 -18.55 0.92 -0.04 4.46 0.33 0.21 0.33 1.00
SEQID-00047 0.00 0.03 0.04 0.02 0.06 0.00 0.00 0.11 -16.30 1.04
-0.04 4.39 0.35 0.22 0.00 1.00 SEQID-00048 0.00 0.00 0.05 0.06 0.05
0.00 0.00 0.00 -4.65 0.00 0.64 13.78 0.38 0.15 0.44 0.39
SEQID-00049 0.02 0.06 0.03 0.03 0.07 0.01 0.05 0.06 -21.74 0.30
-0.01 6.61 0.23 0.31 0.23 0.00 SEQID-00050 0.02 0.10 0.09 0.00 0.02
0.00 0.00 0.09 -16.62 0.92 0.05 9.51 1.00 0.63 0.00 0.34
SEQID-00051 0.00 0.10 0.09 0.00 0.02 0.00 0.00 0.09 -17.98 0.90
0.07 10.22 1.00 0.63 0.00 0.00 SEQID-00052 0.00 0.10 0.09 0.00 0.02
0.00 0.00 0.11 -16.59 0.95 0.05 9.51 1.00 0.63 0.00 0.32
SEQID-00053 0.00 0.10 0.09 0.00 0.02 0.00 0.00 0.11 -16.79 0.87
0.05 9.51 1.00 0.63 0.00 0.33 SEQID-00054 0.00 0.10 0.09 0.00 0.02
0.00 0.00 0.11 -18.37 0.77 0.03 8.55 1.00 0.63 0.00 0.30
SEQID-00055 0.00 0.10 0.09 0.00 0.02 0.00 0.00 0.11 -18.37 0.71
0.03 8.55 1.00 0.63 0.00 0.32 SEQID-00056 0.00 0.00 0.05 0.09 0.00
0.00 0.08 0.08 -26.42 0.21 -0.04 4.99 1.00 0.63 0.26 0.00
SEQID-00057 0.00 0.00 0.07 0.09 0.00 0.00 0.08 0.08 -24.84 0.25
-0.03 5.78 1.00 0.63 0.26 0.00 SEQID-00058 0.00 0.00 0.07 0.07 0.00
0.00 0.08 0.08 -24.93 0.20 -0.02 5.78 1.00 0.63 0.26 0.00
SEQID-00059 0.00 0.00 0.07 0.04 0.00 0.00 0.08 0.08 -26.10 0.22
0.00 7.53 1.00 0.63 0.26 0.00 SEQID-00060 0.02 0.06 0.03 0.03 0.06
0.01 0.05 0.06 -24.08 0.29 -0.11 4.40 0.22 0.31 0.23 0.30
SEQID-00061 0.02 0.06 0.03 0.03 0.05 0.01 0.05 0.06 -25.02 0.25
0.16 11.10 0.22 0.30 0.23 0.00 SEQID-00062 0.01 0.07 0.02 0.04 0.04
0.00 0.01 0.11 -10.77 1.44 0.03 8.52 0.25 0.29 0.27 0.28
SEQID-00063 0.04 0.05 0.04 0.07 0.05 0.00 0.08 0.09 -5.74 1.81
-0.03 4.13 0.37 0.30 0.24 0.23 SEQID-00064 0.02 0.06 0.03 0.07 0.04
0.01 0.10 0.06 -6.82 1.66 -0.04 3.88 0.23 0.28 0.22 0.25
SEQID-00065 0.03 0.03 0.04 0.06 0.05 0.02 0.01 0.08 -5.87 1.50 0.02
10.29 0.22 0.31 0.24 0.24 SEQID-00066 0.01 0.16 0.03 0.03 0.02 0.00
0.07 0.10 -10.37 1.56 0.03 9.86 0.25 0.31 0.22 0.22 SEQID-00067
0.02 0.05 0.03 0.05 0.05 0.01 0.07 0.09 -7.86 1.69 0.03 9.42 0.23
0.29 0.22 0.24 SEQID-00068 0.01 0.00 0.00 0.06 0.02 0.01 0.06 0.10
-21.10 0.87 -0.05 4.70 0.76 0.88 0.00 0.20 SEQID-00069 0.01 0.01
0.03 0.06 0.04 0.00 0.00 0.12 -14.66 1.17 -0.08 3.87 0.26 0.29 0.00
0.88 SEQID-00070 0.01 0.03 0.03 0.06 0.04 0.00 0.00 0.09 -16.34
0.91 -0.08 3.94 0.23 0.28 0.00 0.95 SEQID-00071 0.00 0.05 0.02 0.00
0.05 0.00 0.00 0.14 -17.59 1.19 -0.02 4.77 0.32 0.20 0.00 0.94
SEQID-00072 0.08 0.07 0.01 0.02 0.04 0.00 0.03 0.04 -31.39 0.32
-0.18 3.79 0.37 0.43 0.21 0.22 SEQID-00073 0.03 0.05 0.00 0.02 0.04
0.03 0.01 0.05 -32.67 0.32 -0.10 4.22 0.39 0.54 0.26 0.25
SEQID-00074 0.08 0.08 0.01 0.03 0.03 0.00 0.02 0.04 -30.64 0.26
-0.18 3.81 0.38 0.45 0.25 0.22 SEQID-00075 0.08 0.07 0.01 0.02 0.04
0.00 0.03 0.04 -31.40 0.32 -0.18 3.79 0.37 0.43 0.21 0.22
SEQID-00076 0.08 0.07 0.01 0.02 0.04 0.00 0.03 0.04 -31.40 0.32
-0.18 3.79 0.37 0.43 0.21 0.22 SEQID-00077 0.05 0.09 0.01 0.04 0.06
0.00 0.01 0.04 -29.63 0.32 -0.21 3.61 1.00 1.00 0.25 0.00
SEQID-00078 0.03 0.07 0.01 0.01 0.04 0.00 0.03 0.04 -31.05 0.32
-0.19 3.74 0.37 0.41 0.21 0.20 SEQID-00079 0.04 0.07 0.08 0.03 0.02
0.03 0.03 0.06 -13.19 1.21 0.09 10.26 0.32 0.21 0.27 0.28
SEQID-00080 0.02 0.14 0.04 0.07 0.05 0.03 0.06 0.04 -9.71 1.15
-0.02 5.52 0.21 0.31 0.23 0.24 SEQID-00081 0.05 0.09 0.01 0.09 0.01
0.05 0.06 0.04 -12.67 1.02 0.04 8.87 0.26 0.27 0.29 0.00
SEQID-00082 0.02 0.03 0.04 0.05 0.04 0.03 0.02 0.08 -14.94 0.85
0.03 8.78 0.00 0.33 0.23 0.23 SEQID-00083 0.05 0.04 0.09 0.06 0.05
0.02 0.02 0.04 -15.80 0.76 0.08 10.61 0.28 0.24 0.30 0.30
SEQID-00084 0.04 0.02 0.01 0.01 0.02 0.03 0.05 0.02 -24.13 0.24
-0.21 3.63 0.68 0.52 0.32 0.31 SEQID-00085 0.05 0.07 0.02 0.02 0.05
0.00 0.04 0.08 -23.50 0.38 -0.09 4.29 0.37 0.46 0.00 0.18
SEQID-00086 0.07 0.07 0.02 0.03 0.05 0.00 0.03 0.07 -23.76 0.32
-0.08 4.24 0.36 0.45 0.22 0.23 SEQID-00087 0.05 0.09 0.02 0.03 0.05
0.00 0.01 0.05 -23.80 0.35 -0.08 4.24 0.37 0.49 0.23 0.27
SEQID-00088 0.05 0.06 0.07 0.08 0.02 0.02 0.08 0.02 -15.45 0.39
-0.08 3.93 0.29 0.32 1.00 0.34 SEQID-00089 0.03 0.05 0.02 0.05 0.05
0.02 0.04 0.06 -28.87 0.28 -0.07 4.48 0.43 0.63 0.00 0.21
SEQID-00090 0.05 0.07 0.03 0.05 0.05 0.02 0.05 0.06 -19.97 0.34
-0.06 4.45 0.40 0.54 0.00 0.21 SEQID-00091 0.03 0.06 0.04 0.05 0.06
0.02 0.06 0.07 -19.21 0.44 -0.05 4.51 0.92 0.99 0.00 0.00
SEQID-00092 0.08 0.08 0.01 0.03 0.03 0.00 0.02 0.04 -30.84 0.27
-0.18 3.81 0.37 0.45 0.25 0.23 SEQID-00093 0.08 0.09 0.01 0.03 0.04
0.00 0.00 0.03 -30.31 0.28 -0.18 3.81 0.38 0.47 0.25 0.24
SEQID-00094 0.09 0.09 0.01 0.03 0.04 0.00 0.00 0.03 -30.14 0.30
-0.18 3.81 0.37 0.47 0.25 0.23 SEQID-00095 0.03 0.02 0.04 0.04 0.06
0.01 0.02 0.07 -21.15 0.62 -0.06 4.42 0.65 0.74 0.00 0.23
SEQID-00096 0.02 0.05 0.01 0.05 0.05 0.05 0.04 0.05 -21.02 0.44
-0.05 4.61 0.99 1.00 0.26 0.26 SEQID-00097 0.03 0.00 0.00 0.03 0.02
0.00 0.03 0.02 -36.52 0.12 -0.10 4.38 0.58 0.70 0.25 0.21
SEQID-00098 0.03 0.07 0.00 0.02 0.05 0.00 0.02 0.11 -33.16 0.40
-0.25 3.57 0.27 0.24 0.34 0.00 SEQID-00099 0.03 0.05 0.03 0.05 0.01
0.00 0.00 0.11 -27.07 0.41 -0.19 3.67 0.31 0.30 0.41 0.24
SEQID-00100 0.03 0.08 0.01 0.05 0.03 0.00 0.02 0.04 -29.97 0.29
-0.21 3.67 0.35 0.35 0.42 0.30 SEQID-00101 0.03 0.05 0.00 0.09 0.02
0.00 0.02 0.10 -29.38 0.37 -0.15 3.90 0.23 0.29 0.38 0.23
SEQID-00102 0.04 0.08 0.01 0.04 0.04 0.00 0.02 0.04 -30.86 0.24
-0.20 3.75 0.30 0.30 0.38 0.00 SEQID-00103 0.08 0.07 0.01 0.03 0.06
0.00 0.01 0.05 -27.55 0.34 -0.16 3.79 0.39 0.46 0.22 0.24
SEQID-00104 0.07 0.07 0.01 0.02 0.05 0.00 0.01 0.05 -28.96 0.24
-0.15 3.88 0.43 0.49 0.22 0.21 SEQID-00105 0.04 0.07 0.01 0.10 0.03
0.00 0.00 0.04 -23.64 0.35 -0.13 3.92 0.39 0.46 0.25 0.26
SEQID-00106 0.07 0.08 0.01 0.03 0.05 0.00 0.01 0.05 -29.02 0.23
-0.15 3.87 0.44 0.51 0.23 0.21 SEQID-00107 0.01 0.06 0.05 0.03 0.03
0.04 0.05 0.04 -30.63 0.26 -0.13 4.06 0.32 0.49 0.00 0.22
SEQID-00108 0.01 0.04 0.05 0.04 0.04 0.05 0.06 0.03 -31.29 0.25
-0.10 4.28 0.34 0.55 0.00 0.22 SEQID-00109 0.00 0.03 0.03 0.03 0.03
0.03 0.06 0.14 -21.85 0.87 -0.26 2.83 0.31 0.21 0.27 0.35
SEQID-00110 0.00 0.03 0.02 0.05 0.04 0.06 0.03 0.02 -25.30 0.46
-0.18 3.78 0.36 0.22 0.33 0.34 SEQID-00111 0.02 0.00 0.05 0.01 0.02
0.03 0.05 0.03 -27.81 0.25 -0.10 4.35 0.33 0.21 0.34 0.29
SEQID-00112 0.06 0.07 0.03 0.00 0.02 0.03 0.05 0.03 -22.49 0.43
-0.13 3.90 0.33 0.21 0.31 0.35 SEQID-00113 0.04 0.11 0.01 0.02 0.01
0.03 0.02 0.03 -22.06 0.51 -0.13 4.12 0.29 0.21 0.28 0.27
SEQID-00114 0.05 0.05 0.05 0.02 0.05 0.03 0.00 0.12 -28.91 0.42
-0.16 4.04 0.37 0.20 0.28 0.37 SEQID-00115 0.02 0.01 0.03 0.04 0.11
0.00 0.03 0.03 -38.34 0.23 -0.32 3.45 0.31 0.35 0.26 0.33
SEQID-00116 0.02 0.01 0.03 0.04 0.11 0.00 0.03 0.04 -37.93 0.23
-0.31 3.46 0.31 0.35 0.26 0.33 SEQID-00117 0.03 0.10 0.02 0.02 0.03
0.03 0.05 0.05 -21.01 0.41 -0.10 4.21 0.24 0.31 0.00 0.28
SEQID-00118 0.03 0.12 0.02 0.04 0.03 0.02 0.01 0.03 -23.16 0.43
-0.10 4.17 0.23 0.28 0.00 0.00 SEQID-00119 0.04 0.05 0.03 0.04 0.03
0.02 0.03 0.10 -23.37 0.44 -0.12 4.07 0.28 0.29 0.25 0.24
SEQID-00120 0.02 0.06 0.03 0.04 0.05 0.02 0.03 0.09 -25.42 0.36
-0.12 4.08 0.28 0.30 0.00 0.26 SEQID-00121 0.02 0.03 0.08 0.04 0.07
0.00 0.12 0.05 -25.73 0.12 -0.21 3.49 0.25 0.39 0.00 0.27
SEQID-00122 0.01 0.03 0.06 0.05 0.07 0.00 0.13 0.05 -27.56 0.08
-0.22 3.50 0.00 0.31 0.24 0.24 SEQID-00123 0.01 0.05 0.01 0.06 0.08
0.02 0.03 0.06 -26.58 0.34 -0.13 4.03 0.48 0.59 0.00 0.22
SEQID-00124 0.02 0.05 0.02 0.05 0.08 0.02 0.03 0.06 -27.93 0.29
-0.12 4.12 0.50 0.61 0.00 0.25 SEQID-00125 0.02 0.03 0.02 0.10 0.04
0.01 0.06 0.09 -17.21 0.63 -0.10 3.73 0.24 0.32 0.00 0.22
SEQID-00126 0.01 0.05 0.07 0.11 0.05 0.01 0.05 0.03 -25.09 0.15
-0.18 3.64 0.23 0.33 0.00 0.26 SEQID-00127 0.03 0.02 0.04 0.04 0.06
0.01 0.02 0.07 -21.15 0.62 -0.06 4.42 0.65 0.74 0.00 0.23
SEQID-00128 0.03 0.07 0.04 0.06 0.06 0.01 0.02 0.07 -16.81 0.57
0.04 9.31 0.25 0.30 0.23 0.25 SEQID-00129 0.03 0.06 0.04 0.03 0.04
0.02 0.04 0.11 -16.17 0.61 -0.01 6.63 0.24 0.30 0.00 0.28
SEQID-00130 0.02 0.07 0.03 0.03 0.05 0.05 0.02 0.07 -17.34 0.56
0.03 8.89 0.23 0.34 0.00 0.23 SEQID-00131 0.03 0.03 0.04 0.03 0.04
0.02 0.03 0.05 -21.19 0.47 -0.03 5.04 0.96 0.99 0.22 0.24
SEQID-00132 0.00 0.05 0.02 0.03 0.02 0.03 0.03 0.05 -15.02 1.17
0.02 9.22 0.35 0.22 0.34 0.35 SEQID-00133 0.04 0.02 0.00 0.01 0.02
0.06 0.03 0.03 -23.93 1.02 0.04 9.95 0.33 0.21 0.00 0.35
SEQID-00134 0.02 0.03 0.03 0.14 0.05 0.00 0.00 0.07 -10.60 1.38
-0.03 4.49 0.33 0.22 0.00 0.34 SEQID-00135 0.00 0.03 0.04 0.06 0.04
0.00 0.00 0.09 -15.04 0.70 -0.02 6.67 0.32 0.21 0.00 0.31
SEQID-00136 0.00 0.03 0.04 0.08 0.04 0.00 0.00 0.09 -16.20 0.65
0.00 7.09 0.31 0.20 0.00 0.29 SEQID-00137 0.02 0.03 0.00 0.03 0.09
0.00 0.03 0.09 -18.91 0.89 -0.03 4.79 0.31 0.20 0.00 0.32
SEQID-00138 0.02 0.00 0.04 0.06 0.09 0.00 0.00 0.04 -14.32 0.74
-0.02 6.22 0.33 0.22 0.00 0.28 SEQID-00139 0.00 0.00 0.00 0.03 0.03
0.00 0.03 0.07 -31.57 0.29 -0.03 5.00 0.33 0.21 0.00 0.31
SEQID-00140 0.02 0.10 0.03 0.08 0.07 0.03 0.00 0.09 -17.13 0.77
-0.01 7.52 0.31 0.20 0.31 0.28 SEQID-00141 0.02 0.05 0.05 0.01 0.03
0.03 0.05 0.05 -16.98 0.76 0.01 7.61 0.30 0.19 0.25 0.17
SEQID-00142 0.02 0.02 0.00 0.01 0.08 0.06 0.03 0.03 -20.09 0.24
0.08 10.05 0.32 0.21 0.29 0.30 SEQID-00143 0.02 0.07 0.05 0.03 0.05
0.03 0.05 0.11 -19.93 0.52 0.02 8.49 0.33 0.22 0.32 0.32
SEQID-00144 0.04 0.15 0.02 0.01 0.07 0.03 0.03 0.07 -17.29 0.58
0.00 7.25 0.31 0.20 0.39 0.32 SEQID-00145 0.02 0.03 0.02 0.05 0.02
0.03 0.03 0.13 -16.57 0.79 -0.04 4.79 0.90 0.58 0.33 0.24
SEQID-00146 0.02 0.10 0.03 0.08 0.09 0.03 0.00 0.07 -16.05 0.65
-0.01 6.50 0.32 0.20 0.28 0.31 SEQID-00147 0.03 0.03 0.03 0.07 0.06
0.02 0.03 0.12 -16.21 0.73 -0.03 4.70 0.24 0.23 0.00 0.23
SEQID-00148 0.00 0.01 0.05 0.02 0.01 0.05 0.00 0.11 -17.15 0.83
0.04 10.46 0.31 0.30 0.30 0.00 SEQID-00149 0.02 0.01 0.04 0.05 0.06
0.00 0.00 0.09 -17.64 0.65 0.04 9.98 0.27 0.30 0.00 0.00
SEQID-00150 0.04 0.13 0.00 0.03 0.06 0.02 0.04 0.06 -21.64 0.55
-0.01 6.24 0.25 0.26 0.26 0.26 SEQID-00151 0.02 0.04 0.01 0.02 0.03
0.02 0.05 0.07 -24.45 0.54 0.09 10.51 0.29 0.32 0.24 0.25
SEQID-00152 0.02 0.06 0.02 0.04 0.02 0.02 0.05 0.06 -23.71 0.37
0.03 9.12 0.26 0.30 0.27 0.29 SEQID-00153 0.02 0.03 0.03 0.05 0.05
0.02 0.03 0.06 -22.23 0.52 -0.06 4.38 0.72 0.74 0.00 0.19
SEQID-00154 0.03 0.08 0.03 0.05 0.02 0.03 0.03 0.09 -18.41 0.58
0.01 7.51 0.26 0.29 0.29 0.25 SEQID-00155 0.03 0.02 0.05 0.01 0.04
0.05 0.11 0.07 -17.59 0.58 0.00 7.40 0.58 0.60 0.00 0.23
SEQID-00156 0.02 0.05 0.02 0.04 0.03 0.02 0.06 0.06 -22.73 0.51
0.04 9.19 0.23 0.29 0.26 0.26 SEQID-00157 0.04 0.04 0.03 0.05 0.05
0.01 0.06 0.07 -19.38 0.39 -0.02 5.62 0.31 0.44 0.00 0.21
SEQID-00158 0.03 0.07 0.02 0.05 0.05 0.02 0.04 0.08 -19.98 0.57
-0.02 5.35 0.00 0.31 0.00 0.24 SEQID-00159 0.04 0.07 0.05 0.06 0.05
0.01 0.03 0.07 -17.02 0.48 -0.04 4.70 0.47 0.53 0.00 0.22
SEQID-00160 0.03 0.09 0.01 0.05 0.06 0.02 0.04 0.08 -19.43 0.57
-0.02 5.68 0.18 0.31 0.22 0.26 SEQID-00161 0.03 0.03 0.04 0.06 0.09
0.01 0.06 0.10 -15.61 0.48 0.04 9.92 0.29 0.38 0.00 0.22
SEQID-00162 0.05 0.00 0.10 0.06 0.02 0.00 0.03 0.05 -6.47 1.39
-0.02 5.45 0.34 0.22 0.28 0.36 SEQID-00163 0.01 0.13 0.03 0.04 0.02
0.02 0.07 0.04 -11.56 1.34 0.03 9.43 0.22 0.27 0.00 0.23
SEQID-00164 0.04 0.07 0.01 0.03 0.03 0.03 0.05 0.22 -5.03 1.99 0.02
9.17 0.29 0.22 0.00 0.34 SEQID-00165 0.02 0.00 0.03 0.07 0.08 0.06
0.03 0.17 -4.16 1.81 0.00 6.41 0.30 0.23 0.27 0.00 SEQID-00166 0.03
0.05 0.07 0.02 0.08 0.00 0.03 0.08 -5.92 1.63 0.00 7.70 0.25 0.30
0.00 0.27 SEQID-00167 0.04 0.05 0.07 0.05 0.10 0.03 0.02 0.02 -6.50
1.19 0.02 10.10 0.21 0.33 0.00 0.24 SEQID-00168 0.05 0.04 0.06 0.05
0.10 0.03 0.02 0.03 -6.42 1.26 0.01 9.66 0.21 0.33 0.00 0.00
SEQID-00169 0.04 0.09 0.14 0.04 0.02 0.00 0.03 0.05 -5.08 1.18
-0.03 4.18 0.29 0.20 0.32 0.33 SEQID-00170 0.05 0.04 0.07 0.06 0.09
0.03 0.02 0.02 -6.50 1.19 0.02 9.72 0.21 0.33 0.00 0.00 SEQID-00171
0.04 0.06 0.07 0.03 0.09 0.04 0.03 0.05 -5.71 1.32 0.02 10.04 0.23
0.31 0.00 0.22 SEQID-00172 0.09 0.06 0.01 0.05 0.07 0.00 0.05 0.07
-5.77 1.52 -0.01 6.20 0.26 0.28 0.00 0.24 SEQID-00173 0.05 0.07
0.07 0.03 0.09 0.04 0.03 0.05 -6.03 1.24 0.01 9.63 0.21 0.33 0.00
0.20 SEQID-00174 0.04 0.08 0.08 0.03 0.10 0.06 0.01 0.04 -7.89 1.02
0.02 10.42 0.23 0.32 0.00 0.26 SEQID-00175 0.04 0.11 0.02 0.00 0.05
0.03 0.08 0.05 -6.10 1.53 -0.05 3.93 0.29 0.21 0.00 0.26
SEQID-00176 0.06 0.08 0.05 0.06 0.10 0.02 0.01 0.05 -6.48 1.21 0.02
10.57 0.00 0.32 0.00 0.00 SEQID-00177 0.02 0.11 0.01 0.07 0.06 0.03
0.06 0.09 -4.33 1.65 -0.01 5.45 0.00 0.30 0.22 0.27 SEQID-00178
0.05 0.14 0.04 0.04 0.03 0.02 0.06 0.05 -6.01 1.52 0.00 7.34 0.22
0.28 0.27 0.20 SEQID-00179 0.01 0.11 0.04 0.07 0.03 0.03 0.06 0.04
-9.40 1.40 -0.02 4.73 0.23 0.33 0.00 0.27 SEQID-00180 0.06 0.05
0.07 0.05 0.07 0.08 0.04 0.02 -7.83 1.16 0.00 6.95 0.20 0.30 0.00
0.27 SEQID-00181 0.07 0.10 0.03 0.03 0.09 0.02 0.04 0.01 -8.86 1.29
-0.01 5.65 0.29 0.32 0.00 0.23 SEQID-00182 0.05 0.08 0.05 0.06 0.04
0.05 0.06 0.04 -7.84 1.36 0.02 9.13 0.25 0.28 0.00 0.25 SEQID-00183
0.02 0.10 0.02 0.03 0.08 0.02 0.04 0.03 -9.90 1.21 -0.04 4.17 0.18
0.28 0.23 0.27 SEQID-00184 0.04 0.16 0.02 0.05 0.03 0.05 0.07 0.06
-10.84 1.38 -0.04 4.29 0.27 0.28 0.27 0.23 SEQID-00185 0.02 0.11
0.03 0.08 0.03 0.05 0.06 0.04 -10.00 1.28 0.01 8.21 0.26 0.31 0.24
0.26 SEQID-00186 0.05 0.14 0.02 0.03 0.05 0.04 0.04 0.07 -9.98 1.54
0.02 9.17 0.25 0.28 0.00 0.22 SEQID-00187 0.02 0.18 0.03 0.05 0.05
0.02 0.03 0.07 -7.42 1.30 0.01 8.23 0.23 0.28 0.20 0.27 SEQID-00188
0.04 0.03 0.07 0.04 0.10 0.03 0.00 0.04 -6.18 1.52 0.00 7.72 0.25
0.33 0.00 0.26 SEQID-00189 0.07 0.04 0.08 0.05 0.11 0.07 0.01 0.01
-6.44 1.10 0.06 12.27 0.23 0.29 0.00 0.30 SEQID-00190 0.05 0.01
0.08 0.05 0.12 0.03 0.01 0.01 -5.82 1.11 0.01 9.35 0.27 0.30 0.24
0.27 SEQID-00191 0.05 0.01 0.09 0.05 0.12 0.02 0.01 0.02 -6.73
1.262 0.03 10.24 0.27 0.30 0.00 0.29 SEQID-00192 0.04 0.00 0.07
0.05 0.12 0.00 0.00 0.03 -6.30 1.37 0.00 7.72 0.23 0.27 0.00 0.29
SEQID-00193 0.02 0.03 0.03 0.08 0.04 0.00 0.00 0.04 -18.69 0.54
0.02 9.44 0.29 0.18 0.24 0.35 SEQID-00194 0.02 0.03 0.03 0.08 0.04
0.00 0.00 0.04 -17.31 0.54 0.04 10.49 0.31 0.20 0.24 0.33
SEQID-00195 0.02 0.00 0.03 0.09 0.04 0.00 0.00 0.04 -17.40 0.47
0.04 10.49 0.31 0.20 0.22 0.34 SEQID-00196 0.03 0.04 0.03 0.06 0.04
0.00 0.02 0.04 -22.65 0.39 0.00 7.42 0.24 0.32 0.25 0.25
SEQID-00197 0.03 0.04 0.03 0.06 0.04 0.00 0.02 0.04 -22.50 0.39
0.00 7.42 0.20 0.32 0.25 0.25 SEQID-00198 0.03 0.04 0.03 0.06 0.04
0.00 0.02 0.04 -22.35 0.39 0.00 7.42 0.00 0.32 0.25 0.26
SEQID-00199 0.03 0.04 0.03 0.06 0.04 0.00 0.02 0.04 -22.74 0.39
0.00 6.53 0.23 0.32 0.00 0.25 SEQID-00200 0.03 0.04 0.03 0.06 0.04
0.00 0.02 0.04 -22.59 0.39 0.00 6.53 0.23 0.32 0.00 0.25
SEQID-00201 0.03 0.04 0.03 0.06 0.04 0.00 0.02 0.04 -22.97 0.38
-0.01 5.82 0.22 0.32 0.24 0.25 SEQID-00202 0.03 0.04 0.03 0.06 0.04
0.00 0.02 0.04 -23.34 0.38 -0.02 5.32 0.22 0.32 0.24 0.25
SEQID-00203 0.03 0.04 0.03 0.05 0.04 0.00 0.02 0.04 -23.25 0.38
-0.02 5.32 0.22 0.32 0.24 0.25 SEQID-00204 0.03 0.04 0.03 0.05 0.04
0.00 0.02 0.04 -23.61 0.37 -0.02 5.06 0.25 0.32 0.00 0.25
SEQID-00205 0.03 0.04 0.04 0.06 0.04 0.00 0.02 0.04 -24.11 0.36
-0.04 4.67 0.25 0.32 0.23 0.26 SEQID-00206 0.00 0.02 0.02 0.00 0.03
0.09 0.03 0.08 -27.16 0.30 0.10 10.48 0.32 0.10 0.29 0.25
SEQID-00207 0.02 0.02 0.01 0.00 0.04 0.07 0.02 0.06 -33.49 0.15
0.01 7.70 0.31 0.26 0.26 0.00 SEQID-00208 0.02 0.02 0.00 0.00 0.03
0.00 0.00 0.03 -37.87 0.12 0.18 4.11 0.34 0.23 0.29 0.27
SEQID-00209 0.01 0.04 0.01 0.01 0.03 0.04 0.01 0.05 -29.13 0.21
0.02 9.15 0.30 0.31 0.00 0.00 SEQID-00210 0.02 0.02 0.01 0.00 0.03
0.05 0.01 0.04 -32.93 0.17 -0.04 5.09 0.30 0.34 0.25 0.23
SEQID-00211 0.02 0.02 0.01 0.01 0.03 0.04 0.01 0.04 -33.59 0.15
-0.05 4.95 0.30 0.34 0.25 0.00 SEQID-00212 0.00 0.00 0.00 0.01 0.03
0.00 0.03 0.05 -36.26 0.21 -0.06 4.77 0.34 0.21 0.29 0.33
SEQID-00213 0.00 0.00 0.00 0.01 0.05 0.00 0.03 0.05 -34.27 0.27
-0.04 4.76 0.35 0.22 0.25 0.00 SEQID-00214 0.00 0.00 0.00 0.01 0.06
0.00 0.02 0.05 -32.73 0.22 -0.04 4.66 0.29 0.25 0.31 0.00
SEQID-00215 0.00 0.00 0.00 0.03 0.03 0.00 0.02 0.06 -34.50 0.23
0.00 7.54 0.31 0.21 0.00 0.00 SEQID-00216 0.00 0.02 0.00 0.02 0.03
0.00 0.02 0.05 -34.08 0.25 0.00 7.54 0.32 0.26 0.00 0.00
SEQID-00217 0.00 0.00 0.00 0.01 0.05 0.00 0.03 0.06 -35.54 0.25
-0.09 4.33 0.34 0.23 0.00 0.00 SEQID-00218 0.00 0.00 0.00 0.01 0.05
0.00 0.03 0.05 -34.67 0.22 -0.07 4.60 0.34 0.23 0.25 0.00
SEQID-00219 0.00 0.00 0.00 0.03 0.03 0.00 0.03 0.07 -33.39 0.29
-0.02 5.81 0.32 0.20 0.00 0.31 SEQID-00220 0.00 0.00 0.00 0.01 0.05
0.00 0.02 0.05 -37.57 0.19 -0.07 4.55 0.31 0.25 0.31 0.00
SEQID-00221 0.00 0.00 0.00 0.02 0.03 0.00 0.02 0.06 -35.42 0.21
-0.01 5.88 0.32 0.24 0.21 0.00 SEQID-00222 0.00 0.03 0.00 0.03 0.05
0.00 0.00 0.02 -30.85 0.13 -0.10 4.23 0.36 0.23 0.00 0.33
SEQID-00223 0.00 0.02 0.00 0.01 0.03 0.00 0.03 0.03 -33.68 0.26
-0.02 5.81 0.36 0.23 0.00 0.00 SEQID-00224 0.00 0.00 0.00 0.01 0.06
0.00 0.02 0.06 -37.47 0.23 -0.05 4.66 0.33 0.25 0.00 0.00
SEQID-00225 0.00 0.01 0.00 0.02 0.04 0.00 0.01 0.04 -33.38 0.20
-0.02 5.31 0.30 0.31 0.00 0.00 SEQID-00226 0.00 0.01 0.00 0.02 0.04
0.00 0.01 0.04 -32.78 0.18 -0.03 5.01 0.30 0.33 0.27 0.29
SEQID-00227 0.00 0.01 0.00 0.02 0.03 0.00 0.03 0.04 -36.89 0.16
-0.03
5.07 0.33 0.35 0.00 0.00 SEQID-00228 0.00 0.01 0.00 0.02 0.04 0.00
0.02 0.04 -37.66 0.15 -0.03 4.97 0.33 0.39 0.00 0.00 SEQID-00229
0.02 0.02 0.00 0.03 0.07 0.00 0.00 0.02 -32.91 0.12 -0.10 4.28 0.38
0.25 0.00 0.00 SEQID-00230 0.00 0.03 0.00 0.03 0.02 0.00 0.00 0.02
-29.21 0.16 0.02 9.18 0.39 0.25 0.00 0.27 SEQID-00231 0.01 0.03
0.00 0.04 0.05 0.00 0.00 0.02 -28.20 0.17 -0.03 4.75 0.30 0.31 0.00
0.00 SEQID-00232 0.00 0.03 0.00 0.03 0.05 0.00 0.00 0.03 -30.24
0.12 0.04 10.27 0.31 0.33 0.00 0.00 SEQID-00233 0.00 0.06 0.02 0.07
0.05 0.00 0.00 0.08 -16.02 0.94 -0.06 4.03 0.26 0.32 0.00 1.00
SEQID-00234 0.00 0.07 0.02 0.07 0.04 0.00 0.00 0.08 -16.69 0.94
-0.07 4.03 0.23 0.30 0.00 1.00 SEQID-00235 0.00 0.07 0.01 0.08 0.04
0.00 0.03 0.06 -17.69 0.65 -0.06 4.15 0.26 0.31 0.00 1.00
SEQID-00236 0.02 0.00 0.00 0.01 0.05 0.00 0.00 0.03 -34.37 0.07
-0.06 4.67 0.36 0.29 0.00 0.00 SEQID-00237 0.02 0.00 0.00 0.01 0.05
0.00 0.00 0.03 -38.56 0.08 -0.02 5.12 0.38 0.24 0.00 0.00
SEQID-00238 0.02 0.00 0.00 0.01 0.03 0.00 0.00 0.03 -38.44 0.16
-0.09 4.53 0.35 0.24 0.27 0.32 SEQID-00239 0.06 0.02 0.00 0.01 0.02
0.00 0.00 0.00 -41.59 0.04 -0.02 5.16 0.42 0.26 0.00 0.00
SEQID-00240 0.04 0.00 0.00 0.03 0.02 0.00 0.00 0.00 -40.29 0.04
-0.04 4.82 0.37 0.23 0.28 0.00 SEQID-00241 0.02 0.00 0.00 0.01 0.07
0.00 0.00 0.03 -35.70 0.11 -0.05 4.83 0.31 0.36 0.26 0.22
SEQID-00242 0.00 0.10 0.05 0.03 0.05 0.07 0.00 0.03 -5.77 1.91
-0.02 4.18 0.33 0.20 0.29 0.00 SEQID-00243 0.00 0.11 0.05 0.03 0.05
0.03 0.06 0.02 -4.36 1.69 0.00 6.23 0.31 0.19 0.00 0.33 SEQID-00244
0.05 0.00 0.04 0.11 0.15 0.03 0.00 0.00 -3.56 1.26 0.02 9.70 0.37
0.24 0.27 0.29 SEQID-00245 0.02 0.08 0.07 0.08 0.12 0.03 0.00 0.03
-5.24 1.22 0.00 7.55 0.30 0.19 0.00 0.36 SEQID-00246 0.00 0.08 0.02
0.03 0.04 0.03 0.00 0.05 -6.47 1.61 -0.05 3.87 0.29 0.19 0.00 0.29
SEQID-00247 0.04 0.04 0.04 0.06 0.04 0.02 0.03 0.06 -7.06 1.30
-0.01 6.50 0.26 0.31 0.00 0.26 SEQID-00248 0.07 0.03 0.12 0.03 0.09
0.03 0.00 0.00 -6.58 1.34 0.00 6.49 0.33 0.22 0.00 0.29 SEQID-00249
0.07 0.04 0.09 0.02 0.06 0.02 0.00 0.02 -8.69 1.28 0.02 10.33 0.24
0.29 0.00 0.26 SEQID-00250 0.00 0.00 0.05 0.02 0.09 0.07 0.03 0.04
-9.82 1.06 -0.05 4.57 0.33 0.21 0.00 0.37 SEQID-00251 0.03 0.04
0.03 0.06 0.09 0.02 0.04 0.04 -11.82 1.17 0.05 10.32 0.28 0.23 0.29
0.27 SEQID-00252 0.00 0.00 0.02 0.00 0.07 0.03 0.06 0.05 -14.21
1.06 0.05 10.00 0.31 0.20 0.36 0.30 SEQID-00253 0.01 0.06 0.04 0.03
0.04 0.04 0.06 0.09 -10.95 1.37 0.02 8.24 0.25 0.27 0.27 0.28
SEQID-00254 0.01 0.05 0.04 0.03 0.04 0.02 0.07 0.09 -11.95 1.26
0.02 8.49 0.28 0.29 0.00 0.31 SEQID-00255 0.00 0.08 0.09 0.05 0.04
0.03 0.00 0.05 -7.56 1.49 0.05 10.79 0.36 0.23 0.35 0.31
SEQID-00256 0.02 0.08 0.07 0.03 0.04 0.03 0.00 0.07 -8.27 1.48 0.02
9.54 0.33 0.22 0.36 0.33 SEQID-00257 0.07 0.05 0.06 0.03 0.10 0.06
0.03 0.03 -3.63 1.30 0.02 9.30 0.35 0.24 0.00 0.00 SEQID-00258 0.09
0.02 0.03 0.04 0.03 0.03 0.00 0.03 -17.37 0.94 0.23 13.28 0.30 0.19
0.00 0.27 SEQID-00259 0.00 0.05 0.02 0.05 0.06 0.00 0.00 0.02
-19.14 0.66 0.00 7.36 0.33 0.21 0.00 0.39 SEQID-00260 0.02 0.08
0.04 0.03 0.08 0.00 0.00 0.07 -10.46 1.44 0.00 7.25 0.30 0.19 0.23
0.34 SEQID-00261 0.00 0.10 0.03 0.04 0.07 0.00 0.03 0.03 -11.32
1.17 -0.03 4.54 0.31 0.20 0.00 0.29 SEQID-00262 0.00 0.07 0.02 0.07
0.06 0.00 0.03 0.03 -17.75 0.73 -0.01 6.51 0.31 0.21 0.27 0.22
SEQID-00263 0.04 0.07 0.03 0.04 0.07 0.00 0.14 0.05 -5.22 1.51 0.00
7.24 0.37 0.24 0.00 0.29 SEQID-00264 0.02 0.01 0.00 0.02 0.05 0.00
0.00 0.02 -37.24 0.08 -0.07 4.58 0.29 0.37 0.22 0.00 SEQID-00265
0.01 0.01 0.00 0.04 0.03 0.00 0.01 0.03 -34.97 0.13 -0.06 4.60 0.29
0.40 0.23 0.22 SEQID-00266 0.00 0.00 0.00 0.01 0.05 0.00 0.02 0.03
-37.57 0.18 -0.07 4.55 0.31 0.25 0.32 0.00 SEQID-00267 0.00 0.00
0.00 0.01 0.05 0.00 0.02 0.01 -37.57 0.17 -0.07 4.55 0.33 0.27 0.32
0.00 SEQID-00268 0.00 0.00 0.00 0.01 0.05 0.00 0.02 0.00 -36.50
0.23 -0.09 4.42 0.35 0.28 0.33 0.00 SEQID-00269 0.00 0.00 0.00 0.01
0.04 0.00 0.02 0.00 -36.42 0.23 -0.09 4.42 0.34 0.27 0.00 0.00
SEQID-00270 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -36.42 0.28
-0.09 4.42 0.38 0.31 0.00 0.26 SEQID-00271 0.00 0.00 0.00 0.01 0.03
0.00 0.02 0.00 -36.19 0.40 -0.09 4.42 0.35 0.29 0.00 0.00
SEQID-00272 0.00 0.00 0.00 0.01 0.05 0.00 0.02 0.00 -37.57 0.19
-0.07 4.55 0.33 0.27 0.33 0.00 SEQID-00273 0.00 0.00 0.00 0.01 0.05
0.00 0.02 0.00 -37.42 0.26 -0.07 4.55 0.35 0.28 0.00 0.00
SEQID-00274 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -37.34 0.37
-0.07 4.55 0.35 0.28 0.00 0.00 SEQID-00275 0.00 0.00 0.00 0.01 0.03
0.00 0.02 0.00 -37.26 0.37 -0.07 4.55 0.34 0.28 0.36 0.00
SEQID-00276 0.00 0.00 0.00 0.00 0.04 0.00 0.00 0.00 -37.16 0.47
-0.07 4.55 0.35 0.29 0.00 0.00 SEQID-00277 0.03 0.06 0.02 0.06 0.09
0.02 0.05 0.11 -13.06 1.31 0.07 9.64 0.23 0.29 0.22 0.25
SEQID-00278 0.02 0.08 0.06 0.05 0.06 0.05 0.11 0.07 -18.57 0.24
-0.01 5.38 0.25 0.38 0.20 0.21 SEQID-00279 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -36.27 0.40 -0.09 4.42 0.35 0.29 0.00 0.00
SEQID-00280 0.00 0.00 0.00 0.01 0.03 0.00 0.02 0.00 -37.26 0.37
-0.07 4.55 0.35 0.28 0.00 0.00 SEQID-00281 0.02 0.05 0.03 0.03 0.05
0.05 0.06 0.08 -19.78 0.35 -0.03 5.12 0.21 0.33 0.00 0.20
SEQID-00282 0.04 0.10 0.00 0.03 0.07 0.06 0.00 0.10 -19.86 1.03
0.09 9.58 0.44 0.14 0.42 0.38 SEQID-00283 0.02 0.05 0.03 0.01 0.05
0.03 0.05 0.08 -26.91 0.45 0.12 10.39 0.28 0.18 0.30 0.22
SEQID-00284 0.04 0.04 0.04 0.04 0.05 0.01 0.04 0.08 -25.52 0.46
0.01 7.51 0.23 0.29 0.00 0.25 SEQID-00285 0.04 0.06 0.01 0.01 0.07
0.03 0.02 0.08 -25.31 0.52 0.09 10.56 0.31 0.23 0.00 0.00
SEQID-00286 0.04 0.05 0.00 0.03 0.06 0.03 0.05 0.09 -20.36 0.77
0.06 9.29 0.34 0.23 0.31 0.22 SEQID-00287 0.02 0.05 0.00 0.04 0.06
0.02 0.04 0.08 -23.00 0.80 -0.02 5.64 0.29 0.27 0.00 0.24
SEQID-00288 0.03 0.03 0.03 0.06 0.05 0.04 0.04 0.07 -21.14 0.53
0.01 7.38 0.20 0.33 0.19 0.17 SEQID-00289 0.04 0.07 0.02 0.06 0.06
0.06 0.03 0.08 -20.21 0.69 0.01 7.63 0.23 0.33 0.00 0.22
SEQID-00290 0.04 0.04 0.05 0.05 0.04 0.01 0.04 0.08 -19.04 0.52
0.00 6.72 0.21 0.32 0.00 0.19 SEQID-00291 0.01 0.07 0.02 0.05 0.05
0.04 0.03 0.08 -20.82 0.80 -0.02 5.66 0.23 0.27 0.00 0.25
SEQID-00292 0.02 0.05 0.00 0.04 0.06 0.02 0.04 0.07 -23.98 0.70
-0.02 5.64 0.29 0.25 0.27 0.25 SEQID-00293 0.02 0.05 0.01 0.04 0.07
0.02 0.04 0.08 -22.45 0.79 -0.02 5.64 0.28 0.27 0.27 0.25
SEQID-00294 0.02 0.07 0.01 0.04 0.06 0.02 0.04 0.08 -22.10 0.80
-0.02 5.64 0.28 0.27 0.28 0.24 SEQID-00295 0.02 0.05 0.00 0.04 0.07
0.02 0.04 0.07 -22.75 0.77 -0.02 5.64 0.30 0.28 0.31 0.25
SEQID-00296 0.02 0.05 0.00 0.05 0.07 0.02 0.04 0.07 -23.28 0.71
-0.03 5.00 0.29 0.28 0.28 0.25 SEQID-00297 0.03 0.06 0.02 0.03 0.03
0.02 0.02 0.05 -22.84 0.36 0.01 7.50 0.24 0.30 0.23 0.24
SEQID-00298 0.03 0.06 0.02 0.03 0.03 0.02 0.02 0.05 -22.93 0.37
0.01 7.54 0.29 0.30 0.23 0.22 SEQID-00299 0.03 0.06 0.02 0.04 0.03
0.02 0.02 0.05 -23.45 0.34 0.01 7.38 0.24 0.31 0.21 0.23
SEQID-00300 0.02 0.07 0.04 0.03 0.03 0.02 0.05 0.06 -29.09 0.40
-0.18 3.78 0.22 0.31 0.00 0.23 SEQID-00301 0.03 0.07 0.04 0.03 0.03
0.02 0.05 0.07 -28.15 0.40 -0.17 3.78 0.22 0.31 0.00 0.21
SEQID-00302 0.02 0.05 0.03 0.06 0.05 0.01 0.02 0.08 -19.36 0.48
-0.03 4.71 0.23 0.33 0.21 0.22 SEQID-00303 0.03 0.06 0.04 0.05 0.05
0.02 0.06 0.05 -19.91 0.43 -0.03 5.01 0.20 0.31 0.00 0.23
SEQID-00304 0.03 0.04 0.04 0.03 0.04 0.01 0.08 0.07 -23.25 0.38
-0.03 5.16 0.21 0.32 0.00 0.18 SEQID-00305 0.01 0.03 0.05 0.04 0.05
0.01 0.05 0.05 -18.71 0.40 0.02 8.31 0.20 0.33 0.00 0.21
SEQID-00306 0.04 0.05 0.04 0.05 0.04 0.02 0.02 0.09 -20.25 0.45
0.01 8.46 0.23 0.33 0.21 0.23 SEQID-00307 0.02 0.05 0.03 0.05 0.08
0.02 0.04 0.04 -20.51 0.44 0.02 9.38 0.00 0.31 0.00 0.21
SEQID-00308 0.02 0.04 0.04 0.07 0.06 0.02 0.04 0.05 -20.65 0.37
0.00 7.10 0.22 0.33 0.22 0.22 SEQID-00309 0.02 0.02 0.05 0.06 0.05
0.05 0.07 0.04 -21.70 0.29 -0.04 4.85 0.23 0.33 0.20 0.20
SEQID-00310 0.05 0.09 0.04 0.03 0.04 0.03 0.05 0.06 -20.85 0.36
0.00 7.29 0.23 0.32 0.24 0.25 SEQID-00311 0.03 0.08 0.04 0.03 0.04
0.03 0.07 0.05 -19.63 0.26 0.05 9.70 0.21 0.30 0.25 0.23
SEQID-00312 0.04 0.03 0.03 0.07 0.06 0.01 0.05 0.07 -20.18 0.48
-0.06 4.54 0.00 0.30 0.00 0.00 SEQID-00313 0.03 0.03 0.04 0.08 0.06
0.02 0.04 0.07 -20.16 0.44 -0.02 5.53 0.21 0.34 0.22 0.22
SEQID-00314 0.06 0.05 0.02 0.05 0.07 0.01 0.04 0.04 -23.28 0.41
0.05 10.12 0.21 0.33 0.16 0.19 SEQID-00315 0.03 0.06 0.03 0.04 0.05
0.02 0.06 0.04 -21.95 0.32 -0.04 4.83 0.18 0.31 0.00 0.13
SEQID-00316 0.03 0.07 0.04 0.05 0.06 0.02 0.04 0.03 -20.35 0.36
0.02 8.34 0.21 0.33 0.19 0.20 SEQID-00317 0.03 0.05 0.02 0.08 0.08
0.01 0.04 0.05 -20.14 0.25 -0.02 4.83 0.21 0.34 0.00 0.21
SEQID-00318 0.02 0.06 0.04 0.06 0.05 0.05 0.08 0.04 -17.30 0.36
-0.01 6.18 0.00 0.33 0.00 0.20 SEQID-00319 0.03 0.05 0.03 0.04 0.05
0.04 0.07 0.06 -19.59 0.36 -0.02 6.07 0.20 0.34 0.00 0.20
SEQID-00320 0.03 0.06 0.02 0.03 0.03 0.02 0.07 0.04 -28.07 0.20
-0.01 6.59 0.23 0.34 0.22 0.21 SEQID-00321 0.04 0.04 0.02 0.05 0.03
0.01 0.07 0.06 -22.70 0.40 0.03 9.29 0.23 0.33 0.00 0.00
SEQID-00322 0.03 0.03 0.03 0.05 0.06 0.04 0.07 0.06 -19.27 0.31
-0.01 6.37 0.22 0.34 0.22 0.21 SEQID-00323 0.01 0.06 0.04 0.06 0.04
0.03 0.07 0.04 -21.48 0.31 0.04 9.36 0.00 0.33 0.00 0.00
SEQID-00324 0.03 0.09 0.04 0.06 0.04 0.03 0.09 0.03 -20.93 0.27
-0.01 6.45 0.16 0.33 0.00 0.19 SEQID-00325 0.02 0.03 0.04 0.03 0.05
0.01 0.14 0.05 -22.26 0.22 0.04 9.39 0.23 0.30 0.21 0.00
SEQID-00326 0.03 0.07 0.05 0.05 0.05 0.03 0.07 0.05 -19.44 0.37
-0.01 6.51 0.26 0.30 0.24 0.23 SEQID-00327 0.03 0.06 0.02 0.08 0.03
0.01 0.04 0.06 -22.60 0.39 0.00 6.53 0.26 0.29 0.30 0.00
SEQID-00328 0.05 0.04 0.01 0.03 0.02 0.01 0.02 0.05 -26.69 0.22
0.21 12.35 0.25 0.29 0.24 0.23 SEQID-00329 0.02 0.01 0.03 0.06 0.05
0.01 0.03 0.12 -26.66 0.27 0.18 11.94 0.24 0.28 0.20 0.25
SEQID-00330 0.02 0.03 0.01 0.02 0.06 0.02 0.04 0.06 -24.07 0.28
0.09 10.90 0.23 0.29 0.00 0.21 SEQID-00331 0.03 0.04 0.02 0.07 0.08
0.04 0.07 0.04 -19.13 0.41 0.04 9.73 0.23 0.30 0.24 0.27
SEQID-00332 0.03 0.03 0.02 0.05 0.08 0.02 0.06 0.04 -21.07 0.28
-0.04 4.72 0.22 0.34 0.00 0.20 SEQID-00333 0.02 0.07 0.01 0.03 0.03
0.04 0.08 0.05 -19.36 0.44 0.05 9.83 0.18 0.31 0.28 0.22
SEQID-00334 0.02 0.05 0.03 0.03 0.03 0.01 0.05 0.06 -26.57 0.28
0.10 10.98 0.00 0.33 0.00 0.20 SEQID-00335 0.03 0.01 0.04 0.04 0.03
0.01 0.07 0.07 -21.68 0.28 0.10 11.31 0.22 0.30 0.00 0.26
SEQID-00336 0.05 0.02 0.04 0.05 0.02 0.02 0.03 0.05 -29.65 0.18
0.22 12.00 0.24 0.32 0.18 0.23 SEQID-00337 0.01 0.08 0.05 0.02 0.05
0.01 0.06 0.06 -20.90 0.36 0.00 6.86 0.19 0.34 0.00 0.00
SEQID-00338 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.97 0.28
-0.01 6.37 0.00 0.35 0.25 0.00 SEQID-00339 0.02 0.02 0.03 0.03 0.04
0.04 0.06 0.05 -25.07 0.25 -0.03 5.57 0.19 0.30 0.21 0.00
SEQID-00340 0.00 0.02 0.03 0.04 0.05 0.02 0.04 0.07 -22.52 0.30
0.05 10.51 0.21 0.31 0.00 0.00 SEQID-00341 0.03 0.02 0.03 0.09 0.05
0.01 0.07 0.04 -23.40 0.28 -0.06 4.54 0.21 0.33 0.00 0.20
SEQID-00342 0.04 0.07 0.03 0.05 0.06 0.03 0.04 0.03 -20.62 0.33
0.02 9.39 0.21 0.32 0.00 0.21 SEQID-00343 0.01 0.03 0.01 0.04 0.04
0.01 0.06 0.06 -26.83 0.38 0.02 8.41 0.24 0.31 0.00 0.00
SEQID-00344 0.01 0.02 0.06 0.07 0.05 0.02 0.04 0.07 -16.90 0.50
0.03 10.12 0.22 0.31 0.00 0.00 SEQID-00345 0.02 0.05 0.05 0.02 0.04
0.02 0.06 0.06 -18.75 0.39 -0.02 5.68 0.20 0.34 0.19 0.00
SEQID-00346 0.03 0.05 0.03 0.03 0.05 0.01 0.06 0.07 -19.87 0.46
-0.02 5.27 0.21 0.31 0.00 0.00 SEQID-00347 0.03 0.04 0.03 0.08 0.08
0.01 0.05 0.05 -21.72 0.35 -0.01 6.27 0.23 0.33 0.00 0.23
SEQID-00348 0.04 0.02 0.03 0.06 0.05 0.03 0.02 0.12 -18.43 0.59
0.01 7.75 0.24 0.33 0.21 0.22 SEQID-00349 0.02 0.05 0.03 0.04 0.05
0.02 0.08 0.06 -21.95 0.32 -0.02 6.35 0.20 0.31 0.00 0.21
SEQID-00350 0.02 0.05 0.05 0.06 0.03 0.00 0.03 0.05 -18.20 0.43
0.02 8.65 0.00 0.32 0.00 0.23 SEQID-00351 0.02 0.05 0.04 0.06 0.06
0.01 0.03 0.09 -19.26 0.50 -0.01 6.19 0.23 0.34 0.00 0.22
SEQID-00352 0.02 0.05 0.04 0.04 0.06 0.01 0.03 0.09 -30.47 0.53
-0.01 5.58 0.23 0.33 0.00 0.21
SEQID-00353 0.03 0.05 0.06 0.06 0.03 0.02 0.08 0.07 -17.60 0.45
-0.03 4.69 0.21 0.32 0.00 0.20 SEQID-00354 0.04 0.05 0.04 0.05 0.04
0.02 0.02 0.09 -20.25 0.45 0.01 8.46 0.23 0.33 0.21 0.23
SEQID-00355 0.02 0.07 0.05 0.08 0.07 0.01 0.02 0.06 -17.37 0.50
0.00 6.65 0.21 0.35 0.00 1.00 SEQID-00356 0.01 0.05 0.05 0.05 0.04
0.01 0.03 0.09 -19.88 0.46 -0.02 4.98 0.21 0.33 0.00 0.22
SEQID-00357 0.03 0.02 0.05 0.05 0.04 0.01 0.03 0.06 -18.65 0.48
-0.02 5.37 0.21 0.34 0.21 0.21 SEQID-00358 0.04 0.07 0.04 0.03 0.06
0.03 0.04 0.05 -20.25 0.37 -0.01 6.46 0.20 0.35 0.20 0.21
SEQID-00359 0.03 0.02 0.04 0.05 0.04 0.01 0.03 0.06 -22.70 0.38
0.01 9.34 0.21 0.34 0.21 0.21 SEQID-00360 0.03 0.06 0.05 0.04 0.03
0.04 0.07 0.06 -19.19 0.37 -0.02 5.22 0.21 0.33 0.21 0.22
SEQID-00361 0.03 0.06 0.04 0.04 0.04 0.00 0.04 0.07 -22.15 0.34
0.00 6.94 0.21 0.31 0.00 0.21 SEQID-00362 0.03 0.07 0.05 0.05 0.04
0.02 0.06 0.06 -23.27 0.34 -0.01 6.22 0.21 0.33 0.19 0.22
SEQID-00363 0.00 0.05 0.03 0.11 0.11 0.05 0.07 0.06 -15.13 0.40
-0.06 3.96 0.21 0.38 0.00 0.21 SEQID-00364 0.03 0.02 0.07 0.01 0.02
0.04 0.14 0.03 -45.75 0.03 -0.24 4.02 0.30 0.28 0.28 0.29
SEQID-00365 0.01 0.03 0.04 0.03 0.03 0.15 0.05 0.03 -24.44 0.13
0.04 8.21 0.26 0.27 0.28 0.27 SEQID-00366 0.00 0.14 0.07 0.06 0.05
0.13 0.04 0.01 -22.70 0.11 0.04 10.10 0.27 0.24 0.00 0.27
SEQID-00367 0.02 0.02 0.04 0.05 0.05 0.00 0.22 0.01 -27.90 0.00
-0.17 3.77 0.30 0.27 0.28 0.26 SEQID-00368 0.03 0.05 0.01 0.04 0.04
0.02 0.02 0.02 -26.53 0.31 -0.04 4.88 0.23 0.26 0.00 0.21
SEQID-00369 0.02 0.00 0.00 0.03 0.06 0.00 0.00 0.03 -22.97 0.22
0.01 7.80 0.35 0.30 0.00 0.00 SEQID-00370 0.02 0.02 0.00 0.01 0.04
0.00 0.00 0.02 -25.72 0.17 -0.08 4.31 0.34 0.31 0.00 0.32
SEQID-00371 0.01 0.01 0.00 0.02 0.03 0.02 0.03 0.03 -32.01 0.12
-0.15 4.19 0.34 0.34 0.00 0.25 SEQID-00372 0.03 0.05 0.01 0.02 0.02
0.02 0.06 0.04 -24.83 0.16 -0.01 5.83 0.27 0.23 0.00 0.00
SEQID-00373 0.01 0.05 0.04 0.09 0.02 0.02 0.04 0.03 -23.94 0.21
-0.02 5.07 0.27 0.26 0.00 0.29 SEQID-00374 0.03 0.06 0.01 0.03 0.03
0.04 0.03 0.08 -25.39 0.30 0.05 10.23 0.25 0.27 0.00 0.24
SEQID-00375 0.03 0.04 0.04 0.03 0.02 0.02 0.06 0.07 -28.50 0.25
0.14 11.20 0.31 0.26 0.00 0.21 SEQID-00376 0.01 0.02 0.04 0.02 0.05
0.01 0.01 0.09 -24.79 0.46 0.11 11.40 0.26 0.31 0.27 0.23
SEQID-00377 0.00 0.02 0.00 0.05 0.09 0.01 0.00 0.04 -24.99 0.04
-0.13 3.98 0.27 0.35 0.22 0.00 SEQID-00378 0.02 0.01 0.02 0.06 0.05
0.01 0.02 0.03 -25.00 0.15 -0.07 4.35 0.24 0.33 0.00 0.25
SEQID-00379 0.01 0.01 0.00 0.02 0.03 0.02 0.00 0.05 -25.41 0.18
-0.02 6.12 0.29 0.35 0.24 0.27 SEQID-00380 0.02 0.02 0.00 0.06 0.04
0.02 0.00 0.02 -28.46 0.17 -0.05 4.69 0.35 0.33 0.00 0.23
SEQID-00381 0.02 0.01 0.02 0.03 0.02 0.01 0.02 0.04 -30.97 0.39
0.05 9.63 0.29 0.34 0.24 0.25 SEQID-00382 0.03 0.02 0.04 0.04 0.01
0.02 0.00 0.08 -33.88 0.23 0.14 11.31 0.33 0.29 0.30 0.21
SEQID-00383 0.02 0.03 0.02 0.01 0.01 0.02 0.08 0.02 -29.58 0.21
0.10 10.66 0.25 0.22 0.24 0.00 SEQID-00384 0.02 0.05 0.01 0.02 0.09
0.02 0.04 0.05 -25.11 0.31 0.12 11.78 0.23 0.30 0.00 0.00
SEQID-00385 0.03 0.02 0.03 0.05 0.08 0.00 0.00 0.13 -26.46 0.42
0.07 11.42 0.29 0.24 0.00 0.00 SEQID-00386 0.02 0.00 0.04 0.14 0.04
0.03 0.01 0.06 -19.07 0.39 -0.03 4.51 0.24 0.30 0.00 0.24
SEQID-00387 0.03 0.01 0.05 0.06 0.04 0.02 0.01 0.11 -23.24 0.49
0.02 9.25 0.00 0.30 0.00 0.23 SEQID-00388 0.03 0.01 0.05 0.06 0.04
0.02 0.00 0.11 -23.34 0.50 0.02 9.30 0.25 0.30 0.00 0.24
SEQID-00389 0.03 0.01 0.05 0.04 0.03 0.00 0.03 0.11 -21.13 0.37
0.09 10.92 0.21 0.33 0.00 0.25 SEQID-00390 0.02 0.03 0.03 0.05 0.07
0.02 0.05 0.04 -21.63 0.38 0.01 9.14 0.00 0.30 0.00 0.00
SEQID-00391 0.03 0.02 0.04 0.08 0.06 0.02 0.04 0.06 -20.87 0.38
-0.02 5.05 0.22 0.34 0.22 0.22 SEQID-00392 0.02 0.06 0.03 0.04 0.05
0.02 0.06 0.04 -22.88 0.23 -0.04 4.76 0.18 0.31 0.00 0.00
SEQID-00393 0.03 0.07 0.04 0.06 0.06 0.02 0.04 0.03 -19.96 0.35
0.01 8.65 0.21 0.33 0.00 0.21 SEQID-00394 0.02 0.05 0.04 0.06 0.06
0.05 0.09 0.04 -17.65 0.27 -0.02 5.57 0.19 0.33 0.00 0.00
SEQID-00395 0.02 0.05 0.06 0.06 0.03 0.02 0.08 0.06 -18.60 0.38
-0.04 4.52 0.21 0.32 0.00 0.21 SEQID-00396 0.01 0.04 0.00 0.05 0.06
0.02 0.07 0.04 -25.26 0.21 0.01 8.44 0.17 0.30 0.00 0.00
SEQID-00397 0.01 0.04 0.06 0.06 0.05 0.04 0.04 0.04 -20.27 0.20
0.06 10.19 0.21 0.31 0.00 0.21 SEQID-00398 0.04 0.03 0.04 0.04 0.05
0.02 0.07 0.06 -21.47 0.27 0.01 8.63 0.22 0.32 0.00 0.00
SEQID-00399 0.02 0.03 0.04 0.05 0.04 0.02 0.07 0.06 -25.17 0.29
-0.05 4.89 0.20 0.34 0.00 0.20 SEQID-00400 0.03 0.06 0.01 0.05 0.07
0.04 0.05 0.06 -23.79 0.29 -0.01 6.64 0.23 0.30 0.00 0.00
SEQID-00401 0.01 0.05 0.04 0.05 0.10 0.01 0.04 0.08 -18.97 0.39
-0.01 5.14 0.27 0.31 0.00 0.28 SEQID-00402 0.01 0.03 0.02 0.07 0.06
0.02 0.04 0.06 -25.96 0.30 0.00 7.19 0.21 0.32 0.00 0.00
SEQID-00403 0.02 0.04 0.04 0.07 0.05 0.02 0.05 0.05 -21.38 0.33
0.00 6.70 0.22 0.33 0.00 0.22 SEQID-00404 0.02 0.06 0.04 0.07 0.14
0.01 0.03 0.02 -16.05 0.35 0.03 9.57 0.21 0.30 0.18 0.25
SEQID-00405 0.02 0.03 0.04 0.10 0.06 0.03 0.10 0.03 -15.43 0.25
0.00 6.53 0.19 0.33 0.00 0.21 SEQID-00406 0.02 0.07 0.03 0.05 0.06
0.01 0.04 0.04 -24.16 0.24 -0.02 4.90 0.20 0.31 0.00 0.00
SEQID-00407 0.02 0.05 0.03 0.07 0.07 0.04 0.07 0.05 -17.75 0.22
-0.02 5.71 0.21 0.38 0.00 0.21 SEQID-00408 0.02 0.05 0.06 0.05 0.07
0.02 0.07 0.03 -18.90 0.25 -0.05 4.66 0.22 0.31 0.00 0.00
SEQID-00409 0.02 0.03 0.05 0.05 0.07 0.06 0.07 0.06 -18.43 0.31
-0.03 4.61 0.22 0.33 0.21 0.21 SEQID-00410 0.02 0.05 0.04 0.06 0.10
0.02 0.06 0.05 -15.30 0.48 -0.04 4.32 0.00 0.31 0.23 0.00
SEQID-00411 0.03 0.04 0.04 0.06 0.06 0.03 0.06 0.08 -20.87 0.35
-0.02 5.28 0.19 0.33 0.00 0.22 SEQID-00412 0.02 0.06 0.06 0.06 0.06
0.03 0.09 0.06 -18.00 0.33 -0.03 4.78 0.20 0.33 0.18 0.20
SEQID-00413 0.01 0.05 0.04 0.10 0.10 0.04 0.06 0.06 -15.67 0.31
-0.04 4.36 0.21 0.34 0.00 0.22 SEQID-00414 0.01 0.05 0.05 0.07 0.07
0.03 0.09 0.06 -16.00 0.35 -0.03 4.79 0.19 0.34 0.20 0.21
SEQID-00415 0.02 0.05 0.05 0.07 0.06 0.05 0.08 0.06 -16.54 0.34
-0.03 4.83 0.19 0.33 0.00 0.21 SEQID-00416 0.01 0.04 0.05 0.04 0.09
0.03 0.07 0.07 -16.52 0.36 -0.05 4.28 0.21 0.34 0.00 0.20
SEQID-00417 0.02 0.04 0.04 0.07 0.06 0.04 0.06 0.06 -17.25 0.33
-0.01 6.40 0.21 0.33 0.22 0.00 SEQID-00418 0.03 0.04 0.04 0.06 0.07
0.06 0.06 0.06 -16.75 0.27 -0.04 4.69 0.23 0.33 0.00 0.20
SEQID-00419 0.02 0.04 0.05 0.06 0.06 0.04 0.08 0.06 -16.77 0.32
-0.04 4.34 0.26 0.36 0.00 0.21 SEQID-00420 0.00 0.04 0.02 0.09 0.11
0.03 0.04 0.06 -17.45 0.28 0.00 6.65 0.27 0.41 0.23 0.21
SEQID-00421 0.01 0.06 0.05 0.07 0.06 0.05 0.08 0.06 -15.20 0.37
-0.03 4.87 0.20 0.37 0.20 0.20 SEQID-00422 0.02 0.06 0.04 0.10 0.06
0.01 0.09 0.06 -18.05 0.33 -0.03 4.46 0.23 0.39 0.22 0.21
SEQID-00423 0.01 0.05 0.03 0.05 0.05 0.06 0.09 0.05 -21.13 0.21
-0.03 5.23 0.23 0.36 0.00 0.21 SEQID-00424 0.02 0.04 0.04 0.06 0.08
0.04 0.11 0.05 -16.16 0.36 -0.05 4.29 1.00 1.00 0.19 0.21
SEQID-00425 0.01 0.07 0.04 0.05 0.04 0.03 0.07 0.06 -22.68 0.27
-0.03 5.42 0.19 0.32 0.20 0.20 SEQID-00426 0.00 0.08 0.04 0.05 0.07
0.03 0.06 0.06 -17.18 0.38 -0.03 4.81 0.00 0.31 0.00 0.24
SEQID-00427 0.01 0.07 0.07 0.06 0.07 0.02 0.06 0.06 -13.64 0.49
-0.01 5.68 0.22 0.34 0.21 0.23 SEQID-00428 0.34 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -36.89 0.05 -0.09 4.42 0.22 0.22 0.00 0.18
SEQID-00429 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -43.92 0.00
-0.01 6.93 0.23 0.23 0.25 0.34 SEQID-00430 0.34 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -36.89 0.05 -0.09 4.42 0.27 0.22 0.00 0.18
SEQID-00431 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -43.92 0.00
-0.01 6.93 0.28 0.23 0.25 0.34 SEQID-00432 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -58.85 0.00 0.23 10.67 0.31 0.25 0.29 0.29
SEQID-00433 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -58.85 0.00
0.23 11.81 0.36 0.30 0.23 0.31 SEQID-00434 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -39.46 0.00 -0.09 4.42 0.35 0.29 0.22 0.26
SEQID-00435 0.00 0.00 0.00 0.01 0.02 0.00 0.02 0.00 -40.87 0.16
0.02 9.33 0.38 0.31 0.29 0.00 SEQID-00436 0.03 0.07 0.00 0.00 0.08
0.05 0.00 0.05 -38.16 0.28 -0.06 5.16 0.28 0.22 0.00 0.00
SEQID-00437 0.03 0.07 0.00 0.00 0.11 0.05 0.00 0.05 -26.97 0.35
0.36 12.12 0.28 0.23 0.00 0.00 SEQID-00438 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -36.42 0.27 -0.09 4.42 0.32 0.26 0.27 0.00
SEQID-00439 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.10 -36.42 0.25
-0.09 4.42 0.33 0.27 0.00 0.00 SEQID-00440 0.00 0.15 0.00 0.01 0.04
0.00 0.02 0.00 -36.51 0.19 -0.09 4.42 0.33 0.27 0.00 0.29
SEQID-00441 0.00 0.00 0.00 0.01 0.04 0.18 0.02 0.00 -37.14 0.07
-0.09 4.42 0.30 0.25 0.30 0.00 SEQID-00442 0.00 0.00 0.00 0.01 0.15
0.00 0.02 0.00 -37.04 0.07 -0.09 4.42 0.35 0.23 0.00 0.25
SEQID-00443 0.13 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -36.60 0.15
-0.09 4.42 0.30 0.25 0.00 0.00 SEQID-00444 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.01 -38.92 0.05 -0.06 6.07 0.33 0.27 0.00 0.32
SEQID-00445 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -37.58 0.04
-0.09 4.42 0.33 0.27 0.00 0.00 SEQID-00446 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -38.20 0.17 -0.06 4.55 0.37 0.30 0.00 0.00
SEQID-00447 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -45.68 0.04
0.05 9.76 0.35 0.28 0.26 0.31 SEQID-00448 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.00 -45.68 0.04 0.05 11.23 0.38 0.31 0.00 0.00
SEQID-00449 0.00 0.00 0.00 0.01 0.04 0.00 0.02 0.00 -36.42 0.32
-0.09 4.42 0.27 0.22 0.00 0.00 SEQID-00450 0.00 0.00 0.00 0.01 0.04
0.00 0.02 0.28 -36.42 0.28 -0.09 4.42 0.29 0.23 0.00 0.00
SEQID-00451 0.00 0.37 0.00 0.01 0.04 0.00 0.02 0.00 -36.67 0.12
-0.09 4.42 0.24 0.20 0.23 0.29 SEQID-00452 0.00 0.00 0.00 0.01 0.03
0.42 0.02 0.00 -38.31 0.00 -0.09 4.42 0.74 0.20 0.26 0.22
SEQID-00453 0.00 0.00 0.00 0.01 0.33 0.00 0.02 0.00 -38.04 0.00
-0.09 4.42 0.30 0.24 0.20 0.31 SEQID-00454 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -46.29 0.00 0.67 13.81 0.37 0.28 0.00 0.27
SEQID-00455 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -38.19 0.38
0.55 13.66 0.32 0.24 0.30 0.00 SEQID-00456 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -30.09 0.62 0.43 13.62 0.33 0.25 0.00 0.00
SEQID-00457 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -53.15 0.00
-0.67 2.38 0.36 0.27 0.31 0.39 SEQID-00458 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -43.89 0.46 -0.55 2.44 0.32 0.24 0.37 0.34
SEQID-00459 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -34.54 0.80
-0.43 2.56 0.37 0.27 0.00 0.39 SEQID-00460 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -49.89 0.00 -0.03 5.00 0.39 0.29 0.00 0.33
SEQID-00461 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -40.78 0.40
0.05 10.57 0.36 0.27 0.00 0.00 SEQID-00462 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -32.52 0.72 -0.03 4.79 0.34 0.26 0.00 0.00
SEQID-00463 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -46.29 0.10
0.67 13.81 0.33 0.25 0.30 0.00 SEQID-00464 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -40.50 0.37 0.58 13.76 0.28 0.21 0.00 0.00
SEQID-00465 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -33.56 0.58
0.48 13.62 0.33 0.25 0.00 0.30 SEQID-00466 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -53.15 0.15 -0.67 2.38 0.35 0.27 0.34 0.43
SEQID-00467 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -46.49 0.45
-0.58 2.44 0.34 0.25 0.38 0.34 SEQID-00468 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -38.56 0.69 -0.48 2.50 0.32 0.24 0.00 0.35
SEQID-00469 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -49.95 0.13
-0.03 4.97 0.33 0.25 0.00 0.33 SEQID-00470 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -43.82 0.43 -0.05 4.72 0.31 0.23 0.00 0.00
SEQID-00471 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -36.05 0.60
0.02 9.27 0.33 0.25 0.00 0.30 SEQID-00472 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -48.60 0.28 0.70 13.83 0.29 0.22 0.00 0.31
SEQID-00473 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -40.50 0.43
0.58 13.56 0.32 0.24 0.00 0.00 SEQID-00474 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -33.56 0.90 0.48 13.68 0.31 0.23 0.00 0.00
SEQID-00475 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -55.80 0.32
-0.70 2.36 0.32 0.24 0.37 0.39 SEQID-00476 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -46.64 0.53 -0.58 2.40 0.28 0.21 0.30 0.32
SEQID-00477 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -38.51 1.01
-0.48 2.52 0.35 0.26 0.29 0.00 SEQID-00478 0.00 0.00 0.00 0.00 0.00
0.00 0.00 0.00 -52.37 0.31 -0.03
5.03 0.32 0.24 0.00 0.30 SEQID-00479 0.00 0.00 0.00 0.00 0.00 0.00
0.00 0.00 -42.55 0.44 0.18 11.72 0.35 0.26 0.00 0.30 SEQID-00480
0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -36.35 0.97 -0.05 4.63 0.32
0.24 0.00 0.00 SEQID-00481 0.02 0.10 0.06 0.04 0.08 0.05 0.09 0.05
-11.08 0.66 0.07 10.46 0.22 0.30 0.00 0.00 SEQID-00482 0.05 0.02
0.02 0.07 0.04 0.01 0.00 0.04 -27.29 0.18 -0.08 4.37 0.24 0.35 0.00
0.00 SEQID-00483 0.01 0.03 0.05 0.16 0.10 0.04 0.06 0.07 -12.63
0.44 0.00 7.74 0.18 0.31 0.22 0.23 SEQID-00484 0.00 0.07 0.02 0.05
0.03 0.01 0.01 0.02 -33.66 0.11 -0.13 4.08 0.23 0.32 0.00 0.21
SEQID-00485 0.02 0.11 0.03 0.05 0.05 0.01 0.11 0.03 -20.39 0.29
0.01 8.37 0.21 0.30 0.00 0.00 SEQID-00486 0.09 0.04 0.05 0.07 0.07
0.04 0.06 0.05 -14.98 0.69 -0.05 4.44 0.21 0.31 0.00 0.19
SEQID-00487 0.06 0.09 0.04 0.06 0.07 0.05 0.06 0.09 -12.20 0.88
0.02 9.25 0.21 0.29 0.00 0.19 SEQID-00488 0.02 0.08 0.04 0.01 0.06
0.02 0.05 0.07 -20.86 0.42 0.00 7.03 0.22 0.31 0.19 0.00
SEQID-00489 0.01 0.06 0.05 0.06 0.06 0.06 0.01 0.06 -24.06 0.27
-0.03 5.17 0.24 0.31 0.00 0.22 SEQID-00490 0.06 0.09 0.03 0.07 0.06
0.01 0.02 0.12 -9.86 1.25 -0.03 4.30 0.20 0.31 0.00 0.22
SEQID-00491 0.05 0.02 0.03 0.05 0.02 0.02 0.03 0.05 -30.76 0.15
0.22 11.99 0.21 0.31 0.21 0.23 SEQID-00492 0.02 0.02 0.04 0.04 0.03
0.05 0.09 0.06 -25.46 0.19 0.21 11.95 0.21 0.31 0.00 0.20
SEQID-00493 0.06 0.02 0.03 0.04 0.03 0.01 0.01 0.03 -32.41 0.15
0.04 9.50 0.25 0.34 0.23 0.21 SEQID-00494 0.01 0.07 0.01 0.05 0.03
0.02 0.06 0.09 -17.65 0.90 0.03 9.78 0.18 0.31 0.19 0.22
SEQID-00495 0.02 0.04 0.05 0.05 0.03 0.02 0.01 0.06 -29.07 0.23
0.01 8.19 0.24 0.35 0.00 0.24 SEQID-00496 0.03 0.03 0.03 0.07 0.02
0.03 0.02 0.07 -30.33 0.30 -0.12 4.11 0.00 0.31 0.00 0.22
SEQID-00497 0.01 0.11 0.05 0.03 0.02 0.00 0.05 0.05 -18.49 0.58
-0.03 4.75 0.00 0.31 0.00 0.26 SEQID-00498 0.05 0.04 0.02 0.05 0.04
0.00 0.02 0.08 -19.54 0.57 0.00 6.55 0.23 0.52 0.00 0.24
SEQID-00499 0.01 0.02 0.05 0.03 0.05 0.02 0.04 0.06 -19.08 0.62
-0.01 6.25 0.27 0.32 0.26 0.25 SEQID-00500 0.02 0.06 0.04 0.02 0.06
0.05 0.06 0.07 -15.40 0.43 -0.01 6.65 0.26 0.30 0.26 0.26
SEQID-00501 0.04 0.12 0.05 0.06 0.05 0.06 0.07 0.05 -16.94 0.34
-0.03 4.74 0.21 0.29 0.22 0.24 SEQID-00502 0.01 0.09 0.03 0.05 0.04
0.01 0.05 0.06 -20.99 0.33 0.00 7.18 0.23 0.32 0.25 0.25
SEQID-00503 0.01 0.04 0.03 0.04 0.04 0.01 0.04 0.04 -29.34 0.19
0.22 11.43 0.23 0.31 0.23 0.24 SEQID-00504 0.03 0.03 0.03 0.06 0.11
0.04 0.02 0.09 -11.10 0.46 0.02 9.37 0.22 0.30 0.28 0.24
SEQID-00505 0.03 0.02 0.04 0.06 0.07 0.01 0.05 0.08 -22.47 0.46
-0.03 4.82 0.22 0.29 0.00 0.26 SEQID-00506 0.00 0.11 0.03 0.04 0.04
0.07 0.08 0.07 -11.44 1.03 0.02 9.04 0.20 0.30 0.00 0.22
SEQID-00507 0.05 0.12 0.06 0.07 0.05 0.04 0.06 0.05 -19.34 0.32
-0.01 5.15 0.25 0.33 0.00 0.24 SEQID-00508 0.03 0.06 0.03 0.05 0.06
0.03 0.03 0.13 -17.01 0.60 -0.01 6.50 0.27 0.32 0.22 0.00
SEQID-00509 0.02 0.03 0.01 0.04 0.02 0.01 0.01 0.02 -39.60 0.07
0.05 10.23 0.25 0.35 0.22 0.00 SEQID-00510 0.03 0.07 0.04 0.04 0.04
0.03 0.05 0.04 -25.37 0.32 -0.03 4.91 0.21 0.32 0.24 0.23
SEQID-00511 0.03 0.06 0.06 0.04 0.06 0.02 0.10 0.06 -16.64 0.38
-0.01 6.12 0.22 0.30 0.22 0.00 SEQID-00512 0.02 0.05 0.02 0.05 0.03
0.07 0.04 0.05 -10.38 0.87 0.03 9.59 0.24 0.35 0.28 0.24
SEQID-00513 0.13 0.00 0.07 0.05 0.03 0.01 0.12 0.04 -6.89 0.52 0.01
8.00 0.26 0.34 0.00 0.23 SEQID-00514 0.01 0.01 0.04 0.04 0.04 0.01
0.01 0.13 -19.37 0.48 0.10 11.46 0.00 0.34 0.00 0.23 SEQID-00515
0.01 0.05 0.02 0.05 0.07 0.01 0.06 0.01 -25.21 0.03 -0.07 4.34 0.27
0.33 0.23 0.22 SEQID-00516 0.02 0.03 0.06 0.05 0.07 0.02 0.05 0.06
-20.21 0.76 0.00 6.92 0.22 0.32 0.00 0.00 SEQID-00517 0.01 0.07
0.02 0.07 0.04 0.01 0.01 0.04 -29.09 0.17 0.22 11.90 0.17 0.33 0.21
0.26 SEQID-00518 0.03 0.02 0.04 0.04 0.06 0.01 0.04 0.13 -22.45
0.33 0.08 10.62 0.24 0.33 0.00 0.25 SEQID-00519 0.05 0.03 0.04 0.02
0.04 0.03 0.04 0.05 -18.59 0.62 -0.04 4.41 0.27 0.35 0.21 0.25
SEQID-00520 0.05 0.02 0.02 0.04 0.02 0.01 0.02 0.04 -32.61 0.15
0.04 9.81 0.25 0.33 0.26 0.24 SEQID-00521 0.04 0.02 0.02 0.06 0.06
0.00 0.11 0.06 -16.77 0.44 0.00 6.60 0.23 0.30 0.21 0.25
SEQID-00522 0.04 0.03 0.01 0.04 0.13 0.00 0.01 0.01 -25.65 0.04
0.02 9.76 0.23 0.32 0.22 0.25 SEQID-00523 0.04 0.09 0.06 0.04 0.11
0.03 0.05 0.02 -12.76 0.65 0.00 6.65 0.27 0.19 0.32 0.26
SEQID-00524 0.03 0.06 0.06 0.11 0.04 0.02 0.04 0.09 -18.82 0.26
0.05 10.11 0.27 0.23 0.25 0.23 SEQID-00525 0.02 0.05 0.02 0.02 0.06
0.00 0.02 0.11 -27.49 0.79 -0.01 6.80 0.32 0.30 0.00 1.00
SEQID-00526 0.09 0.09 0.03 0.06 0.06 0.00 0.00 0.05 -18.31 0.55
0.07 8.61 0.31 0.29 0.34 0.30 SEQID-00527 0.04 0.02 0.04 0.06 0.08
0.02 0.06 0.07 -17.85 0.43 -0.01 5.74 0.29 0.29 0.27 0.28
SEQID-00528 0.01 0.05 0.04 0.07 0.11 0.00 0.02 0.08 -16.90 0.49
0.03 9.51 0.29 0.29 0.23 0.29 SEQID-00529 0.09 0.05 0.03 0.08 0.05
0.00 0.07 0.06 -21.10 0.31 0.00 6.83 0.00 0.28 0.00 0.00
SEQID-00530 0.04 0.03 0.04 0.05 0.04 0.00 0.03 0.10 -9.31 0.92 0.08
9.06 0.32 0.32 0.29 0.30 SEQID-00531 0.07 0.06 0.05 0.05 0.09 0.00
0.03 0.04 -15.35 0.71 0.01 7.73 0.26 0.28 0.25 0.26 SEQID-00532
0.04 0.03 0.03 0.08 0.05 0.00 0.06 0.15 -17.89 0.60 -0.01 5.70 0.21
0.30 0.00 0.00 SEQID-00533 0.02 0.07 0.07 0.01 0.07 0.00 0.03 0.11
-24.25 0.43 0.06 10.72 0.29 0.32 0.00 0.25 SEQID-00534 0.04 0.05
0.02 0.06 0.05 0.02 0.06 0.06 -24.70 0.24 -0.02 4.91 0.26 0.30 0.29
0.27 SEQID-00535 0.01 0.04 0.03 0.16 0.07 0.02 0.06 0.06 -11.86
0.30 0.01 8.20 0.22 0.28 0.27 0.28 SEQID-00536 0.01 0.05 0.02 0.00
0.01 0.00 0.03 0.02 -32.67 0.27 0.00 7.00 0.21 0.31 0.24 0.27
SEQID-00537 0.01 0.02 0.01 0.04 0.05 0.00 0.00 0.05 -31.23 0.13
-0.02 5.11 0.29 0.33 0.27 0.22 SEQID-00538 0.02 0.07 0.02 0.06 0.06
0.00 0.00 0.05 -22.79 0.30 -0.06 5.19 0.27 0.30 0.00 0.24
SEQID-00539 0.06 0.03 0.02 0.03 0.04 0.00 0.01 0.09 -19.20 0.71
0.00 7.52 0.27 0.32 0.00 0.23 SEQID-00540 0.04 0.00 0.02 0.03 0.07
0.00 0.05 0.07 -26.07 0.29 0.14 11.85 0.22 0.29 0.28 0.00
SEQID-00541 0.02 0.03 0.02 0.06 0.02 0.01 0.04 0.09 -19.28 0.56
0.10 11.02 0.23 0.30 0.24 0.22 SEQID-00542 0.01 0.01 0.03 0.07 0.00
0.00 0.03 0.07 -20.95 0.42 0.08 10.68 0.25 0.31 0.26 0.00
SEQID-00543 0.02 0.05 0.01 0.04 0.10 0.05 0.10 0.07 -19.52 0.31
0.00 7.18 0.00 0.30 0.24 0.25 SEQID-00544 0.05 0.01 0.03 0.06 0.07
0.00 0.04 0.05 -17.82 0.44 -0.01 6.35 0.25 0.33 0.29 0.25
SEQID-00545 0.01 0.08 0.04 0.04 0.04 0.00 0.08 0.06 -26.17 0.22
-0.01 5.86 0.25 0.31 0.19 0.25 SEQID-00546 0.03 0.02 0.02 0.06 0.04
0.00 0.04 0.05 -27.22 0.22 -0.08 4.33 0.21 0.31 0.22 0.27
SEQID-00547 0.07 0.00 0.04 0.04 0.13 0.00 0.02 0.06 -20.21 0.09
0.03 9.81 0.25 0.34 0.27 0.24 SEQID-00548 0.03 0.03 0.00 0.04 0.07
0.04 0.00 0.07 -21.35 0.47 -0.05 4.76 0.30 0.15 0.33 0.33
SEQID-00549 0.02 0.02 0.03 0.09 0.10 0.03 0.10 0.03 -14.48 0.26
0.06 10.19 0.30 0.23 0.00 0.34 SEQID-00550 0.02 0.00 0.01 0.09 0.03
0.02 0.04 0.18 -17.01 0.91 -0.04 4.37 0.33 0.29 0.00 0.27
SEQID-00551 0.03 0.08 0.03 0.05 0.06 0.00 0.00 0.07 -17.92 0.64
0.12 10.11 0.32 0.32 0.30 0.31 SEQID-00552 0.16 0.02 0.00 0.06 0.02
0.02 0.02 0.00 -26.95 0.02 0.02 9.05 0.25 0.24 0.25 0.26
SEQID-00553 0.01 0.00 0.24 0.06 0.07 0.00 0.00 0.04 -29.60 0.05
0.00 7.54 0.33 0.35 0.33 0.34 SEQID-00554 0.03 0.02 0.04 0.04 0.01
0.01 0.05 0.09 -23.36 0.31 0.16 11.12 0.27 0.34 0.24 0.29
SEQID-00555 0.03 0.03 0.03 0.02 0.05 0.00 0.04 0.10 -23.32 0.33
0.10 11.21 0.20 0.29 0.24 0.00 SEQID-00556 0.01 0.03 0.07 0.02 0.01
0.00 0.03 0.07 -23.75 0.29 0.17 11.60 0.23 0.30 0.23 0.26
SEQID-00557 0.02 0.03 0.06 0.13 0.07 0.05 0.02 0.10 -12.39 0.59
0.02 8.90 0.29 0.33 0.24 0.26 SEQID-00558 0.04 0.03 0.03 0.05 0.05
0.00 0.06 0.03 -21.91 0.09 0.03 7.88 0.25 0.31 0.28 0.26
SEQID-00559 0.02 0.02 0.03 0.02 0.08 0.00 0.04 0.05 -25.27 0.34
-0.01 5.85 0.00 0.33 0.00 0.00 SEQID-00560 0.01 0.00 0.00 0.07 0.00
0.00 0.00 0.01 -38.09 0.15 0.02 7.57 0.29 0.30 0.27 0.28
SEQID-00561 0.04 0.13 0.04 0.04 0.04 0.04 0.01 0.04 -8.41 1.32 0.01
8.53 0.19 0.28 0.21 0.00 SEQID-00562 0.01 0.05 0.01 0.04 0.01 0.00
0.01 0.07 -31.55 0.39 -0.16 3.88 0.24 0.30 0.24 0.25 SEQID-00563
0.05 0.05 0.02 0.04 0.04 0.02 0.04 0.07 -18.88 0.52 0.03 8.84 0.24
0.31 0.00 0.23 SEQID-00564 0.02 0.04 0.07 0.06 0.04 0.00 0.03 0.05
-24.85 0.23 0.11 10.77 0.28 0.33 0.26 0.23 SEQID-00565 0.01 0.07
0.04 0.06 0.04 0.03 0.03 0.06 -18.34 0.73 0.02 8.87 0.23 0.31 0.23
0.00 SEQID-00566 0.02 0.03 0.05 0.06 0.06 0.00 0.10 0.04 -15.35
0.46 0.00 6.76 0.24 0.32 0.25 0.81 SEQID-00567 0.01 0.03 0.04 0.03
0.04 0.04 0.07 0.07 -25.61 0.22 0.21 12.15 0.23 0.31 0.00 0.22
SEQID-00568 0.04 0.05 0.02 0.03 0.05 0.02 0.02 0.06 -26.59 0.30
0.13 11.42 0.25 0.33 0.20 0.20 SEQID-00569 0.02 0.06 0.02 0.06 0.13
0.04 0.01 0.05 -16.16 0.52 0.04 10.35 0.23 0.32 0.00 0.24
SEQID-00570 0.03 0.06 0.05 0.07 0.04 0.00 0.04 0.11 -15.90 0.43
0.03 9.76 0.23 0.30 0.24 0.00 SEQID-00571 0.02 0.09 0.02 0.02 0.03
0.02 0.02 0.12 -18.31 0.58 0.00 7.24 0.28 0.31 0.21 0.25
SEQID-00572 0.03 0.04 0.05 0.08 0.06 0.00 0.02 0.04 -26.28 0.23
0.13 10.87 0.28 0.32 0.25 0.26 SEQID-00573 0.03 0.04 0.05 0.06 0.05
0.00 0.03 0.05 -26.70 0.25 0.13 10.82 0.25 0.32 0.19 0.21
SEQID-00574 0.04 0.01 0.05 0.06 0.05 0.00 0.07 0.09 -21.11 0.22
0.15 11.42 0.23 0.31 0.00 0.00 SEQID-00575 0.01 0.03 0.08 0.02 0.01
0.00 0.04 0.07 -24.56 0.26 0.17 11.38 0.24 0.28 0.25 0.25
SEQID-00576 0.01 0.07 0.05 0.06 0.06 0.01 0.05 0.13 -11.59 0.55
0.00 7.24 0.27 0.31 0.23 0.27 SEQID-00577 0.02 0.02 0.03 0.12 0.08
0.00 0.06 0.05 -22.27 0.21 0.11 10.74 0.24 0.29 0.00 0.25
SEQID-00578 0.02 0.02 0.03 0.05 0.04 0.00 0.03 0.05 -28.89 0.26
0.24 11.90 0.24 0.31 0.27 0.25 SEQID-00579 0.01 0.01 0.04 0.05 0.07
0.00 0.07 0.08 -25.22 0.20 0.25 11.95 0.25 0.30 0.26 0.25
SEQID-00580 0.06 0.05 0.01 0.04 0.03 0.01 0.06 0.04 -24.98 0.25
0.21 11.84 0.00 0.27 0.00 0.22 SEQID-00581 0.04 0.02 0.04 0.05 0.05
0.00 0.04 0.13 -25.40 0.28 0.12 11.02 0.23 0.29 0.22 0.00
SEQID-00582 0.01 0.08 0.03 0.04 0.05 0.01 0.06 0.06 -24.01 0.19
0.11 10.65 0.00 0.32 0.25 0.00 SEQID-00583 0.05 0.02 0.05 0.03 0.05
0.00 0.01 0.06 -28.61 0.28 0.24 12.14 0.26 0.31 0.21 0.20
SEQID-00584 0.09 0.02 0.04 0.06 0.07 0.03 0.07 0.02 -18.12 0.37
0.01 8.20 0.24 0.28 0.00 0.21 SEQID-00585 0.04 0.01 0.02 0.04 0.01
0.00 0.03 0.03 -29.34 0.13 0.03 8.91 0.28 0.30 0.27 0.30
SEQID-00586 0.08 0.07 0.07 0.09 0.05 0.00 0.03 0.02 -26.12 0.09
0.07 10.60 0.24 0.31 0.17 0.00 SEQID-00587 0.02 0.04 0.04 0.04 0.04
0.00 0.01 0.11 -19.76 0.50 0.02 9.69 0.27 0.31 0.00 0.26
SEQID-00588 0.02 0.04 0.04 0.08 0.03 0.02 0.07 0.07 -20.29 0.26
0.18 12.08 0.26 0.29 0.25 0.19 SEQID-00589 0.04 0.05 0.05 0.03 0.05
0.00 0.03 0.02 -30.06 0.12 0.06 10.32 0.22 0.31 0.25 0.25
SEQID-00590 0.01 0.06 0.04 0.04 0.04 0.00 0.00 0.08 -24.08 0.36
0.05 10.32 0.30 0.31 0.00 0.00 SEQID-00591 0.01 0.03 0.04 0.03 0.01
0.00 0.05 0.02 -27.30 0.13 0.09 10.47 0.30 0.32 0.00 0.27
SEQID-00592 0.06 0.02 0.02 0.06 0.10 0.02 0.02 0.16 -18.59 0.39
-0.01 5.02 0.30 0.30 0.26 0.24 SEQID-00593 0.01 0.09 0.05 0.04 0.10
0.04 0.05 0.03 -16.04 0.63 -0.01 5.76 0.26 0.27 0.00 0.23
SEQID-00594 0.06 0.12 0.03 0.06 0.06 0.00 0.00 0.05 -19.01 0.53
0.08 8.81 0.30 0.29 0.30 0.28 SEQID-00595 0.09 0.13 0.03 0.06 0.06
0.00 0.00 0.02 -18.17 0.56 0.07 8.61 0.29 0.28 0.30 0.28
SEQID-00596 0.02 0.09 0.01 0.04 0.05 0.02 0.02 0.05 -22.57 0.60
0.00 7.12 0.34 0.32 0.33 0.29 SEQID-00597 0.02 0.12 0.02 0.03 0.04
0.00 0.00 0.05 -21.54 0.57 0.11 9.35 0.28 0.26 0.32 0.29
SEQID-00598 0.05 0.02 0.04 0.04 0.05 0.05 0.00 0.13 -20.52 0.43
0.05 9.60 0.30 0.26 0.00 0.99 SEQID-00599 0.01 0.04 0.02 0.09 0.08
0.06 0.04 0.09 -19.09 0.44 -0.02 5.99 0.22 0.31 0.00 0.20
SEQID-00600 0.04 0.03 0.05 0.04 0.04 0.03 0.08 0.07 -15.69 0.57
0.04 9.53 0.21 0.30 0.00 0.00 SEQID-00601 0.01 0.03 0.04 0.03 0.03
0.05 0.08 0.04 -21.74 0.27 -0.01 6.72 0.20 0.33 0.00 0.20
SEQID-00602 0.03 0.03 0.01 0.10 0.06 0.01 0.07 0.06 -20.45 0.28
0.09 10.47 0.22 0.31 0.00 0.22 SEQID-00603 0.00 0.02 0.03 0.07 0.06
0.08 0.03 0.08 -20.14 0.42 -0.03 5.54 0.21 0.32 0.00 0.20
SEQID-00604 0.00 0.05 0.03 0.07 0.08 0.02 0.06 0.08 -17.58 0.35
0.02 9.31 0.21 0.32 0.00 0.21 SEQID-00605 0.01 0.04 0.04 0.05 0.07
0.01 0.03 0.05 -20.32 0.40 0.00 6.81 0.21 0.31 0.00 0.00
SEQID-00606 0.02 0.04 0.04 0.03 0.04 0.01 0.03 0.04 -21.52 0.39
-0.03 6.47 0.21 0.34 0.00 0.21 SEQID-00607 0.02 0.04 0.05 0.04 0.06
0.03 0.01 0.05 -22.65 0.19 0.02 9.92 0.21 0.33 0.17 0.00
SEQID-00608 0.01 0.08 0.05 0.07 0.05 0.02 0.06 0.03 -18.71 0.25
-0.02 5.97 0.22 0.31 0.23 0.24 SEQID-00609 0.00 0.03 0.04 0.06 0.06
0.01 0.02 0.05 -27.26 0.10 0.04 10.39 0.21 0.33 0.00 0.21
SEQID-00610 0.03 0.06 0.04 0.06 0.05 0.00 0.01 0.05 -20.53 0.46
-0.06 4.45 0.21 0.32 0.21 0.21 SEQID-00611 0.03 0.06 0.06 0.03 0.05
0.04 0.05 0.08 -10.14 0.90 0.01 8.79 0.22 0.33 0.00 0.25
SEQID-00612 0.02 0.03 0.07 0.07 0.02 0.01 0.02 0.10 -14.35 0.60
0.01 7.83 0.24 0.34 0.21 0.23 SEQID-00613 0.03 0.02 0.02 0.06 0.04
0.01 0.01 0.04 -23.29 0.20 -0.03 4.72 0.25 0.33 0.00 0.00
SEQID-00614 0.01 0.08 0.03 0.04 0.07 0.04 0.02 0.05 -13.56 0.91
0.04 9.96 0.21 0.32 0.22 0.19 SEQID-00615 0.05 0.00 0.00 0.00 0.02
0.00 0.06 0.00 -27.63 0.18 0.00 6.97 0.43 0.28 0.33 0.36
SEQID-00616 0.04 0.03 0.03 0.06 0.05 0.00 0.09 0.05 -24.45 0.32
0.20 12.14 0.25 0.27 0.00 0.25 SEQID-00617 0.04 0.06 0.04 0.05 0.07
0.00 0.00 0.08 -20.90 0.46 0.01 8.23 0.27 0.30 0.00 0.23
SEQID-00618 0.01 0.01 0.07 0.03 0.03 0.00 0.04 0.08 -21.61 0.44
0.15 11.36 0.26 0.30 0.00 0.27 SEQID-00619 0.02 0.04 0.05 0.05 0.04
0.00 0.03 0.04 -27.42 0.25 0.13 10.79 0.26 0.33 0.25 0.25
SEQID-00620 0.03 0.01 0.01 0.04 0.05 0.02 0.00 0.15 -22.84 0.58
-0.07 4.39 0.23 0.31 0.00 0.24 SEQID-00621 0.01 0.03 0.04 0.08 0.01
0.00 0.03 0.07 -18.26 0.35 0.09 11.09 0.25 0.31 0.27 0.22
SEQID-00622 0.02 0.05 0.05 0.06 0.05 0.02 0.08 0.11 -18.79 0.43
-0.02 5.65 0.26 0.33 0.20 0.00 SEQID-00623 0.03 0.04 0.06 0.05 0.05
0.00 0.03 0.06 -25.75 0.25 0.13 10.85 0.28 0.31 0.22 0.00
SEQID-00624 0.06 0.03 0.03 0.06 0.04 0.00 0.00 0.06 -25.21 0.43
-0.07 4.34 0.25 0.34 0.23 0.00 SEQID-00625 0.03 0.04 0.02 0.03 0.01
0.02 0.03 0.10 -28.78 0.34 0.14 11.14 0.26 0.34 0.23 0.23
SEQID-00626 0.03 0.02 0.03 0.05 0.03 0.01 0.06 0.08 -21.94 0.44
0.03 9.85 0.24 0.30 0.20 0.18 SEQID-00627 0.02 0.02 0.02 0.02 0.06
0.01 0.02 0.07 -30.26 0.19 0.08 10.61 0.23 0.30 0.00 0.23
SEQID-00628 0.02 0.01 0.03 0.04 0.07 0.01 0.02 0.10 -23.95 0.29
0.05 10.21 0.25 0.29 0.22 0.00 SEQID-00629 0.02 0.01 0.06 0.05 0.01
0.00 0.05 0.07 -25.54 0.24 0.20 11.52 0.18 0.30 0.21 0.22
SEQID-00630 0.02 0.02 0.05 0.14 0.09 0.02 0.09 0.05 -12.56 0.23
0.01 8.03 0.25 0.34 0.29 0.25 SEQID-00631 0.02 0.00 0.02 0.03 0.05
0.00 0.05 0.08 -29.33 0.29 0.11 10.97 0.24 0.33 0.29 0.24
SEQID-00632 0.01 0.06 0.02 0.06 0.07 0.00 0.05 0.07 -22.73 0.35
-0.03 4.74 0.26 0.33 0.25 0.27 SEQID-00633 0.02 0.03 0.02 0.06 0.02
0.00 0.06 0.06 -29.53 0.07 -0.03 5.00 0.29 0.33 0.00 0.26
SEQID-00634 0.02 0.00 0.03 0.07 0.03 0.02 0.05 0.05 -24.75 0.38
0.15 11.02 0.22 0.26 0.00 0.24 SEQID-00635 0.02 0.05 0.03 0.06 0.04
0.02 0.083 0.09 -18.64 0.27 0.16 11.63 0.24 0.30 0.00 0.21
SEQID-00636 0.02 0.01 0.02 0.02 0.06 0.02 0.04 0.08 -24.50 0.28
0.19 12.27 0.20 0.29 0.00 0.26 SEQID-00637 0.04 0.05 0.03 0.07 0.08
0.02 0.05 0.02 -22.79 0.13 0.25 12.25 0.25 0.28 0.25 0.25
SEQID-00638 0.01 0.04 0.06 0.04 0.08 0.00 0.00 0.10 -26.77 0.32
0.04 10.37 0.25 0.29 0.00 0.28 SEQID-00639 0.03 0.01 0.00 0.05 0.09
0.02 0.06 0.08 -21.28 0.30 0.19 11.06 0.26 0.29 0.28 0.23
SEQID-00640 0.04 0.01 0.02 0.04 0.05 0.00 0.11 0.12 -28.97 0.26
0.14 10.65 0.19 0.27 0.00 0.00 SEQID-00641 0.03 0.06 0.02 0.03 0.04
0.00 0.02 0.03 -29.69 0.09 0.07 10.79 0.27 0.28 0.00 0.31
SEQID-00642 0.03 0.08 0.04 0.03 0.03 0.08 0.05 0.04 -23.31 0.20
-0.04 5.02 0.26 0.26 0.00 0.25 SEQID-00643 0.07 0.05 0.04 0.00 0.04
0.00 0.02 0.05 -26.01 0.39 0.04 8.90 0.25 0.25 0.27 0.00
SEQID-00644 0.02 0.05 0.02 0.04 0.02 0.02 0.08 0.14 -21.12 0.33
0.03 9.08 0.27 0.26 0.00 0.27 SEQID-00645 0.05 0.07 0.08 0.06 0.08
0.04 0.06 0.01 -15.18 0.44 0.02 9.00 0.26 0.25 0.00 0.26
SEQID-00646 0.03 0.07 0.01 0.03 0.04 0.05 0.08 0.05 -18.27 0.71
0.09 10.32 0.31 0.28 0.00 0.00 SEQID-00647 0.02 0.00 0.04 0.04 0.04
0.00 0.00 0.01 -27.75 0.24 0.04 10.19 0.34 0.30 0.27 0.30
SEQID-00648 0.05 0.05 0.05 0.01 0.04 0.02 0.02 0.04 -33.89 0.16
0.01 7.70 0.27 0.23 0.00 0.00 SEQID-00649 0.01 0.06 0.07 0.05 0.08
0.01 0.04 0.08 -14.83 0.68 0.01 7.78 0.25 0.33 0.22 0.22
SEQID-00650 0.02 0.05 0.03 0.06 0.10 0.03 0.03 0.07 -23.09 0.36
-0.02 4.88 0.27 0.17 0.30 0.35 SEQID-00651 0.04 0.04 0.03 0.03 0.03
0.03 0.04 0.05 -14.04 0.78 -0.01 6.41 0.25 0.34 0.25 0.24
SEQID-00652 0.06 0.03 0.05 0.12 0.03 0.00 0.05 0.00 -23.90 0.31
-0.04 4.69 0.26 0.27 0.31 1.00 SEQID-00653 0.05 0.04 0.07 0.03 0.05
0.00 0.01 0.10 -20.09 0.49 0.03 9.96 0.25 0.31 0.22 0.24
SEQID-00654 0.02 0.04 0.03 0.04 0.06 0.01 0.01 0.06 -19.75 0.51
-0.03 5.30 0.19 0.32 0.22 0.28 SEQID-00655 0.04 0.04 0.01 0.03 0.05
0.00 0.03 0.07 -25.19 0.32 -0.03 4.99 0.20 0.35 0.20 0.00
SEQID-00656 0.00 0.01 0.04 0.05 0.07 0.03 0.03 0.08 -19.20 0.26
0.00 8.72 0.00 0.36 0.00 0.20 SEQID-00657 0.02 0.05 0.04 0.04 0.06
0.04 0.06 0.05 -22.10 0.20 0.00 7.80 0.20 0.32 0.00 0.21
SEQID-00658 0.01 0.03 0.01 0.09 0.04 0.01 0.02 0.05 -26.41 0.23
0.00 6.84 0.22 0.37 0.20 0.22 SEQID-00659 0.03 0.06 0.04 0.05 0.05
0.05 0.07 0.07 -17.32 0.26 0.01 8.00 0.22 0.30 0.00 0.21
SEQID-00660 0.02 0.07 0.02 0.06 0.06 0.01 0.03 0.05 -23.14 0.27
-0.01 5.82 0.24 0.33 0.00 0.22 SEQID-00661 0.02 0.02 0.03 0.09 0.06
0.01 0.07 0.11 -14.17 0.48 0.01 8.58 1.00 1.00 0.23 0.22
SEQID-00662 0.02 0.03 0.04 0.09 0.05 0.08 0.10 0.03 -15.75 0.26
0.00 6.53 0.00 0.33 0.00 0.22 SEQID-00663 0.02 0.05 0.03 0.08 0.06
0.04 0.07 0.06 -17.59 0.23 0.02 9.22 0.37 0.49 0.24 0.21
SEQID-00664 0.01 0.06 0.01 0.05 0.09 0.02 0.02 0.09 -20.23 0.27
0.02 9.02 0.00 0.33 0.00 0.23 SEQID-00665 0.01 0.03 0.03 0.07 0.08
0.01 0.11 0.07 -17.78 0.25 0.00 6.87 0.22 0.32 0.21 0.21
SEQID-00666 0.03 0.05 0.02 0.04 0.05 0.00 0.05 0.08 -20.08 0.44
-0.05 4.40 0.55 0.71 0.19 0.23 SEQID-00667 0.02 0.04 0.02 0.04 0.05
0.02 0.07 0.05 -26.85 0.17 -0.01 5.26 0.21 0.33 0.00 0.00
SEQID-00668 0.02 0.03 0.00 0.05 0.08 0.01 0.07 0.06 -30.38 0.14
0.03 9.69 0.23 0.35 0.00 0.20 SEQID-00669 0.04 0.04 0.05 0.04 0.05
0.02 0.02 0.04 -21.61 0.30 0.00 6.69 0.00 0.35 0.25 0.00
SEQID-00670 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.61 0.31
0.00 6.69 0.00 0.35 0.25 0.00 SEQID-00671 0.05 0.03 0.05 0.04 0.05
0.02 0.02 0.04 -21.67 0.30 -0.01 6.03 0.00 0.35 0.25 0.00
SEQID-00672 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.97 0.28
-0.01 6.37 0.00 0.35 0.25 0.00 SEQID-00673 0.04 0.03 0.05 0.04 0.05
0.02 0.03 0.04 -21.69 0.29 -0.01 6.03 0.00 0.35 0.25 0.00
SEQID-00674 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.66 0.30
-0.01 6.03 0.00 0.32 0.25 0.00 SEQID-00675 0.04 0.03 0.05 0.04 0.05
0.02 0.02 0.04 -21.68 0.30 -0.01 6.03 0.00 0.32 0.25 0.00
SEQID-00676 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.66 0.29
-0.01 6.03 0.00 0.33 0.25 0.00 SEQID-00677 0.04 0.03 0.05 0.04 0.05
0.02 0.02 0.04 -21.66 0.31 -0.01 6.03 0.00 0.32 0.25 0.23
SEQID-00678 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.97 0.28
-0.01 6.37 0.00 0.34 0.25 0.00 SEQID-00679 0.04 0.03 0.05 0.04 0.05
0.02 0.02 0.04 -21.66 0.31 -0.01 6.03 0.00 0.32 0.25 0.23
SEQID-00680 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.04 -21.70 0.28
-0.01 6.03 0.00 0.32 0.25 0.00 SEQID-00681 0.04 0.03 0.05 0.04 0.05
0.02 0.02 0.04 -21.68 0.29 -0.01 6.03 0.00 0.32 0.25 0.00
SEQID-00682 0.04 0.03 0.05 0.04 0.05 0.02 0.02 0.05 -21.66 0.31
-0.01 6.03 0.00 0.32 0.25 0.23 SEQID-00683 0.02 0.05 0.03 0.07 0.07
0.04 0.07 0.05 -17.73 0.22 -0.02 5.71 0.21 0.38 0.00 0.21
SEQID-00684 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.50 0.25
-0.01 6.00 0.21 0.39 0.00 0.22 SEQID-00685 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.72 0.22 -0.02 5.71 0.21 0.39 0.00 0.21
SEQID-00686 0.02 0.05 0.03 0.07 0.07 0.04 0.06 0.05 -17.59 0.22
-0.02 5.84 0.22 0.40 0.00 0.22 SEQID-00687 0.02 0.05 0.03 0.07 0.07
0.04 0.07 0.05 -17.70 0.22 -0.02 5.59 0.21 0.38 0.00 0.21
SEQID-00688 0.02 0.05 0.03 0.07 0.07 0.04 0.06 0.05 -17.70 0.23
-0.02 5.73 0.21 0.40 0.00 0.21 SEQID-00689 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.72 0.22 -0.02 5.71 0.21 0.40 0.00 0.22
SEQID-00690 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.68 0.26
-0.01 6.46 0.22 0.40 0.00 0.20 SEQID-00691 0.02 0.05 0.03 0.06 0.07
0.04 0.06 0.05 -17.79 0.24 -0.01 6.57 0.21 0.39 0.00 0.21
SEQID-00692 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.59 0.25
-0.01 6.35 0.21 0.40 0.00 0.21 SEQID-00693 0.02 0.05 0.03 0.06 0.07
0.04 0.06 0.05 -17.85 0.23 -0.01 6.35 0.21 0.39 0.21 0.21
SEQID-00694 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.74 0.24
-0.01 6.24 0.21 0.00 0.00 0.21 SEQID-00695 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.72 0.22 -0.02 5.71 0.21 0.40 0.00 0.22
SEQID-00696 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.57 0.26
-0.01 6.85 0.21 0.39 0.00 0.22 SEQID-00697 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.50 0.25 -0.01 6.00 0.22 0.39 0.00 0.21
SEQID-00698 0.03 0.05 0.03 0.07 0.07 0.04 0.06 0.05 -17.44 0.25
-0.01 6.20 0.21 0.39 0.00 0.21 SEQID-00699 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.62 0.23 -0.02 5.85 0.21 0.40 0.00 0.21
SEQID-00700 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.48 0.27
-0.01 6.46 0.22 0.39 0.00 0.21 SEQID-00701 0.02 0.05 0.03 0.06 0.07
0.04 0.06 0.05 -17.57 0.26 -0.01 6.35 0.21 0.39 0.00 0.22
SEQID-00702 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.59 0.25
-0.01 6.35 0.21 0.39 0.00 0.22 SEQID-00703 0.02 0.05 0.03 0.07 0.07
0.04 0.06 0.05 -17.80 0.23 -0.02 5.85 0.21 0.40 0.00 0.21
SEQID-00704 0.02 0.05 0.03 0.06 0.07 0.04 0.06 0.05 -17.90 0.24
0.00 6.69 0.21 0.39 0.00 0.21 SEQID-00705 0.02 0.05 0.03 0.06 0.07
0.04 0.06 0.06 -17.58 0.25 -0.01 6.35 0.22 0.40 0.21 0.21
SEQID-00706 0.02 0.05 0.03 0.07 0.07 0.03 0.07 0.05 -17.53 0.23
-0.02 5.44 0.22 0.40 0.00 0.21 SEQID-00707 0.02 0.05 0.03 0.07 0.07
0.03 0.07 0.05 -17.53 0.23 -0.02 5.44 0.22 0.40 0.00 0.21
SEQID-00708 0.02 0.05 0.03 0.07 0.07 0.03 0.07 0.05 -17.53 0.23
-0.02 5.44 0.22 0.40 0.00 0.21 SEQID-00709 0.02 0.05 0.03 0.07 0.07
0.03 0.07 0.05 -17.53 0.23 -0.02 5.44 0.22 0.40 0.00 0.21
SEQID-00710 0.02 0.05 0.03 0.07 0.07 0.04 0.07 0.05 -17.62 0.22
-0.02 5.845 0.21 0.375 0 0.2083 SEQID-00711 0.02 0.05 0.03 0.07
0.07 0.04 0.07 0.05 -17.66 0.22 -0.02 5.946 0.21 0.375 0 0.2083
SEQID-00712 0.02 0.05 0.03 0.07 0.07 0.04 0.07 0.05 -17.64 0.22
-0.02 5.844 0.21 0.375 0 0.2083 SEQID-00713 0.02 0.05 0.04 0.07
0.07 0.04 0.07 0.05 -17.62 0.22 -0.02 5.844 0.21 0.375 0 0.2083
SEQID-00714 0.02 0.05 0.03 0.07 0.07 0.04 0.07 0.05 -17.63 0.22
-0.02 5.844 0.21 0.375 0 0.2083 SEQID-00715 0.02 0.05 0.03 0.07
0.07 0.04 0.07 0.05 -17.74 0.22 -0.01 5.973 0.21 0.375 0 0.2098
SEQID-00716 0.05 0.03 0.05 0.04 0.04 0.01 0.03 0.04 -22.86 0.27
0.00 6.68 0.00 0.35 0.25 0.22 SEQID-00717 0.02 0.02 0.02 0.06 0.05
0.01 0.04 0.03 -26.21 0.21 0.00 6.81 0.00 0.37 0.17 0.18
SEQID-00718 0.02 0.02 0.02 0.05 0.04 0.01 0.04 0.03 -26.84 0.21
0.00 6.67 0.00 0.38 0.17 0.19 SEQID-00719 0.02 0.03 0.02 0.06 0.04
0.01 0.04 0.04 -26.53 0.21 0.00 6.85 0.00 0.38 0.18 0.18
SEQID-00720 0.04 0.01 0.05 0.05 0.06 0.01 0.04 0.06 -17.51 0.47
-0.01 6.05 0.20 0.33 0.00 0.20 SEQID-00721 0.04 0.04 0.01 0.09 0.03
0.01 0.05 0.05 -18.44 0.28 0.01 8.63 0.68 0.89 0.21 0.21
SEQID-00722 0.02 0.04 0.02 0.05 0.09 0.00 0.02 0.05 -23.26 0.35
0.00 7.76 0.22 0.32 0.00 0.00 SEQID-00723 0.02 0.04 0.03 0.04 0.04
0.00 0.04 0.05 -24.71 0.36 -0.02 5.10 0.20 0.35 0.35 0.20
SEQID-00724 0.02 0.08 0.03 0.05 0.07 0.03 0.04 0.06 -17.74 0.39
-0.01 6.43 0.20 0.34 0.00 0.20 SEQID-00725 0.03 0.03 0.03 0.10 0.06
0.01 0.05 0.04 -18.15 0.28 0.04 9.15 0.20 0.32 0.00 0.21
SEQID-00726 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05 -19.47 0.43
-0.03 5.16 0.21 0.31 0.00 0.22 SEQID-00727 0.03 0.03 0.02 0.06 0.05
0.00 0.08 0.05 -25.41 0.34 0.00 7.39 0.21 0.32 0.00 0.00
SEQID-00728 0.02 0.09 0.05 0.05 0.05 0.02 0.04 0.06 -20.49 0.42
0.02 8.79 0.27 0.35 0.00 0.23 SEQID-00729 0.01 0.02 0.05 0.07 0.06
0.01 0.01 0.07 -25.53 0.22 -0.10
4.24 0.17 0.34 0.20 0.22 SEQID-00730 0.02 0.05 0.03 0.05 0.06 0.02
0.06 0.07 -19.93 0.43 0.00 7.52 0.20 0.33 0.00 0.20 SEQID-00731
0.02 0.01 0.02 0.07 0.05 0.01 0.03 0.05 -23.80 0.25 -0.02 5.21 0.25
0.36 0.20 0.22 SEQID-00732 0.03 0.05 0.05 0.07 0.07 0.01 0.05 0.07
-16.46 0.43 -0.03 4.71 0.18 0.41 0.19 0.21 SEQID-00733 0.04 0.05
0.04 0.05 0.06 0.02 0.03 0.09 -20.09 0.45 0.04 9.88 0.21 0.33 0.00
0.21 SEQID-00734 0.02 0.02 0.02 0.09 0.04 0.01 0.04 0.03 -28.10
0.11 -0.05 4.66 0.23 0.38 0.00 0.21 SEQID-00735 0.03 0.04 0.03 0.06
0.06 0.01 0.03 0.05 -20.57 0.37 -0.03 5.11 0.19 0.39 0.17 0.19
SEQID-00736 0.03 0.06 0.05 0.05 0.04 0.00 0.04 0.08 -18.67 0.55
-0.02 5.26 0.20 0.34 0.19 0.23 SEQID-00737 0.01 0.01 0.13 0.07 0.10
0.01 0.08 0.06 -10.66 0.25 0.03 7.94 0.25 0.34 0.23 0.25
SEQID-00738 0.01 0.04 0.02 0.08 0.04 0.00 0.04 0.06 -22.90 0.30
0.00 7.02 0.49 0.70 0.00 0.22 SEQID-00739 0.04 0.04 0.04 0.04 0.05
0.01 0.03 0.08 -20.80 0.45 0.01 7.95 0.21 0.31 0.00 0.21
SEQID-00740 0.04 0.03 0.05 0.05 0.05 0.00 0.03 0.05 -24.77 0.34
-0.01 5.84 0.22 0.34 0.00 0.22 SEQID-00741 0.02 0.05 0.03 0.07 0.03
0.01 0.06 0.04 -22.26 0.32 -0.01 6.31 0.21 0.33 0.00 0.21
SEQID-00742 0.03 0.04 0.03 0.05 0.04 0.01 0.03 0.06 -23.79 0.32
0.00 6.55 0.19 0.37 0.37 0.20 SEQID-00743 0.01 0.00 0.28 0.02 0.03
0.00 0.00 0.07 -17.20 0.07 0.05 8.50 0.40 0.43 0.31 0.27
SEQID-00744 0.02 0.05 0.05 0.05 0.06 0.01 0.04 0.06 -21.41 0.40
-0.03 4.98 0.18 0.33 0.00 0.20 SEQID-00745 0.02 0.08 0.06 0.04 0.04
0.02 0.05 0.06 -20.48 0.24 0.00 7.10 0.37 0.56 0.00 0.22
SEQID-00746 0.02 0.03 0.11 0.03 0.05 0.05 0.03 0.05 -19.27 0.23
-0.01 6.42 0.22 0.32 0.23 0.25 SEQID-00747 0.03 0.04 0.04 0.05 0.05
0.00 0.05 0.07 -18.93 0.47 -0.01 5.90 0.21 0.33 0.00 0.22
SEQID-00748 0.03 0.06 0.06 0.05 0.04 0.02 0.04 0.06 -18.69 0.48
0.04 10.26 0.19 0.40 0.19 0.21 SEQID-00749 0.02 0.04 0.06 0.05 0.06
0.01 0.05 0.08 -20.08 0.43 -0.01 6.51 0.00 0.33 0.00 0.20
SEQID-00750 0.03 0.06 0.04 0.05 0.05 0.01 0.02 0.06 -22.29 0.42
-0.03 5.11 0.22 0.33 0.00 0.23 SEQID-00751 0.01 0.02 0.16 0.09 0.04
0.01 0.06 0.05 -15.46 0.16 0.03 8.07 0.22 0.36 0.20 0.24
SEQID-00752 0.03 0.04 0.05 0.07 0.08 0.00 0.03 0.07 -21.91 0.33
0.01 9.44 0.21 0.34 0.22 0.21 SEQID-00753 0.01 0.05 0.02 0.07 0.05
0.01 0.04 0.04 -20.98 0.47 -0.02 5.20 0.19 0.35 0.00 0.21
SEQID-00754 0.03 0.02 0.07 0.09 0.03 0.01 0.02 0.05 -30.38 0.15
-0.04 4.71 0.22 0.35 0.20 0.23 SEQID-00755 0.04 0.05 0.02 0.06 0.05
0.06 0.04 0.05 -21.04 0.43 -0.03 5.03 0.00 0.32 0.00 0.21
SEQID-00756 0.01 0.02 0.20 0.04 0.03 0.01 0.02 0.03 -14.62 0.15
0.00 7.76 0.59 0.30 0.20 0.39 SEQID-00757 0.02 0.03 0.08 0.12 0.06
0.01 0.02 0.04 -20.93 0.21 0.00 7.12 0.18 0.38 0.19 0.19
SEQID-00758 0.02 0.04 0.05 0.06 0.06 0.03 0.05 0.08 -19.05 0.40
-0.01 6.39 0.19 0.33 0.00 0.21 SEQID-00759 0.02 0.03 0.04 0.07 0.04
0.03 0.06 0.06 -23.41 0.23 -0.03 5.04 0.00 0.31 0.21 0.25
SEQID-00760 0.04 0.05 0.05 0.04 0.05 0.01 0.04 0.07 -21.34 0.43
0.00 6.82 0.20 0.33 0.19 0.21 SEQID-00761 0.00 0.02 0.10 0.27 0.03
0.00 0.04 0.06 -8.13 0.28 0.02 8.77 0.25 0.52 0.22 0.27 SEQID-00762
0.02 0.08 0.02 0.02 0.03 0.02 0.02 0.11 -19.85 0.47 0.01 7.35 0.26
0.30 0.25 0.25 SEQID-00763 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05
-19.53 0.43 -0.03 5.15 0.21 0.31 0.00 0.22 SEQID-00764 0.02 0.07
0.04 0.07 0.05 0.01 0.03 0.08 -17.08 0.44 0.02 8.94 0.25 0.34 0.26
0.27 SEQID-00765 0.02 0.04 0.02 0.04 0.04 0.03 0.03 0.04 -25.78
0.23 -0.04 4.94 0.16 0.36 0.18 0.19 SEQID-00766 0.05 0.07 0.03 0.05
0.05 0.02 0.05 0.06 -19.72 0.34 -0.06 4.46 0.40 0.54 0.00 0.22
SEQID-00767 0.03 0.04 0.05 0.04 0.06 0.01 0.04 0.08 -22.21 0.39
0.03 9.56 0.22 0.35 0.21 0.22 SEQID-00768 0.03 0.04 0.04 0.04 0.06
0.01 0.04 0.06 -23.12 0.37 -0.03 4.87 0.68 0.90 0.00 0.21
SEQID-00769 0.04 0.03 0.02 0.06 0.04 0.01 0.06 0.04 -26.06 0.29
-0.07 4.36 0.22 0.33 0.23 0.00 SEQID-00770 0.03 0.06 0.04 0.05 0.05
0.01 0.06 0.08 -19.57 0.40 -0.05 4.68 0.80 0.90 0.22 0.22
SEQID-00771 0.03 0.04 0.04 0.05 0.03 0.01 0.04 0.05 -23.12 0.39
-0.01 5.89 0.21 0.36 0.00 0.22 SEQID-00772 0.02 0.05 0.03 0.04 0.03
0.02 0.08 0.05 -24.11 0.37 -0.05 4.75 0.20 0.33 0.00 0.20
SEQID-00773 0.02 0.04 0.01 0.04 0.03 0.03 0.03 0.03 -27.93 0.22
-0.06 4.57 0.17 0.36 0.18 0.18 SEQID-00774 0.01 0.04 0.09 0.07 0.05
0.04 0.01 0.06 -19.68 0.37 0.08 10.85 0.23 0.32 0.00 0.25
SEQID-00775 0.01 0.02 0.04 0.07 0.05 0.01 0.02 0.06 -21.83 0.29
0.04 9.61 0.19 0.37 0.22 0.21 SEQID-00776 0.02 0.08 0.01 0.10 0.04
0.00 0.03 0.05 -16.79 0.24 -0.01 5.68 0.82 0.91 0.21 0.22
SEQID-00777 0.03 0.03 0.02 0.03 0.03 0.01 0.03 0.04 -28.02 0.23
-0.02 5.49 0.18 0.42 0.17 0.18 SEQID-00778 0.02 0.04 0.01 0.03 0.03
0.01 0.02 0.03 -29.55 0.22 -0.02 5.34 0.19 0.42 0.18 0.18
SEQID-00779 0.03 0.05 0.04 0.05 0.05 0.02 0.04 0.07 -18.79 0.42
-0.01 6.24 0.19 0.34 0.19 0.19 SEQID-00780 0.03 0.05 0.04 0.06 0.06
0.01 0.08 0.06 -22.58 0.29 0.02 8.69 1.00 1.00 0.18 0.00
SEQID-00781 0.04 0.04 0.01 0.09 0.03 0.01 0.05 0.05 -18.68 0.26
0.01 8.78 0.89 0.89 0.21 0.21 SEQID-00782 0.02 0.03 0.02 0.07 0.05
0.00 0.04 0.05 -26.50 0.17 -0.04 4.77 0.30 0.44 0.00 0.21
SEQID-00783 0.03 0.04 0.02 0.06 0.07 0.03 0.04 0.06 -22.76 0.29
-0.01 6.25 0.00 0.31 0.00 0.22 SEQID-00784 0.02 0.03 0.03 0.04 0.05
0.00 0.03 0.06 -25.48 0.36 0.01 8.05 0.20 0.34 0.43 0.22
SEQID-00785 0.03 0.04 0.05 0.04 0.06 0.02 0.04 0.09 -20.73 0.43
0.03 9.50 0.23 0.32 0.00 0.22 SEQID-00786 0.03 0.05 0.03 0.05 0.05
0.01 0.05 0.05 -28.05 0.31 -0.05 4.66 0.65 0.88 0.00 0.21
SEQID-00787 0.04 0.10 0.02 0.07 0.03 0.02 0.07 0.05 -16.15 0.45
0.05 10.26 0.22 0.33 0.00 0.19 SEQID-00788 0.03 0.04 0.05 0.04 0.06
0.00 0.04 0.08 -17.76 0.53 -0.03 4.92 0.22 0.36 0.23 0.22
SEQID-00789 0.02 0.03 0.03 0.04 0.03 0.05 0.02 0.05 -23.69 0.42
0.03 9.29 0.24 0.35 0.00 0.00 SEQID-00790 0.02 0.02 0.04 0.02 0.05
0.00 0.03 0.04 -25.14 0.25 0.11 10.51 0.22 0.30 0.27 0.00
SEQID-00791 0.02 0.06 0.06 0.04 0.04 0.02 0.04 0.05 -18.94 0.44
0.01 7.91 0.18 0.34 0.21 0.22 SEQID-00792 0.03 0.05 0.02 0.05 0.05
0.01 0.05 0.05 -23.78 0.31 0.00 7.09 0.18 0.34 0.18 0.18
SEQID-00793 0.03 0.07 0.05 0.05 0.06 0.02 0.07 0.08 -21.12 0.40
-0.03 5.00 0.25 0.39 0.00 0.00 SEQID-00794 0.02 0.04 0.04 0.09 0.04
0.01 0.04 0.04 -22.19 0.35 -0.01 6.31 0.20 0.34 0.20 0.20
SEQID-00795 0.04 0.03 0.04 0.06 0.05 0.02 0.03 0.07 -18.67 0.51
0.00 6.89 0.17 0.34 0.18 0.19 SEQID-00796 0.02 0.06 0.04 0.05 0.05
0.01 0.06 0.07 -19.06 0.46 -0.01 6.44 0.19 0.37 0.19 0.20
SEQID-00797 0.01 0.03 0.02 0.07 0.04 0.01 0.02 0.04 -24.56 0.24
0.00 6.34 0.22 0.34 0.00 0.22 SEQID-00798 0.03 0.07 0.04 0.06 0.05
0.02 0.06 0.07 -19.87 0.41 -0.05 4.37 0.20 0.33 0.00 0.21
SEQID-00799 0.03 0.06 0.04 0.05 0.04 0.01 0.06 0.06 -20.28 0.40
0.00 6.88 0.21 0.33 0.20 0.21 SEQID-00800 0.02 0.05 0.04 0.05 0.06
0.02 0.07 0.05 -23.63 0.24 0.01 8.40 0.90 0.95 0.00 0.00
SEQID-00801 0.03 0.03 0.05 0.08 0.05 0.02 0.04 0.05 -26.41 0.21
0.05 10.06 0.20 0.33 0.00 0.21 SEQID-00802 0.03 0.04 0.02 0.09 0.03
0.00 0.04 0.05 -22.03 0.28 0.00 6.55 0.56 0.76 0.00 0.22
SEQID-00803 0.03 0.04 0.07 0.07 0.02 0.02 0.07 0.04 -19.42 0.33
-0.02 5.12 0.88 0.89 0.00 0.21 SEQID-00804 0.03 0.05 0.03 0.06 0.05
0.01 0.05 0.06 -22.56 0.39 0.00 6.80 0.22 0.33 0.00 0.21
SEQID-00805 0.04 0.05 0.13 0.05 0.04 0.01 0.02 0.09 -15.61 0.52
-0.03 5.06 0.92 0.94 0.23 0.22 SEQID-00806 0.05 0.05 0.05 0.06 0.05
0.02 0.06 0.06 -19.07 0.45 -0.02 6.01 0.20 0.30 0.00 0.21
SEQID-00807 0.02 0.04 0.04 0.07 0.06 0.02 0.04 0.06 -22.08 0.41
0.01 7.91 0.20 0.34 0.00 0.20 SEQID-00808 0.03 0.04 0.04 0.06 0.05
0.01 0.04 0.05 -24.86 0.25 -0.07 4.43 0.19 0.35 0.00 0.20
SEQID-00809 0.02 0.05 0.09 0.05 0.07 0.01 0.07 0.06 -15.74 0.43
-0.01 6.10 0.84 0.95 0.00 0.24 SEQID-00810 0.03 0.06 0.03 0.06 0.04
0.01 0.03 0.07 -21.00 0.44 -0.04 4.78 0.19 0.32 0.00 0.22
SEQID-00811 0.03 0.06 0.02 0.05 0.06 0.02 0.05 0.04 -21.49 0.37
-0.02 5.48 0.22 0.32 0.00 0.22 SEQID-00812 0.02 0.05 0.01 0.09 0.08
0.01 0.05 0.04 -23.69 0.30 -0.07 4.28 0.22 0.31 0.22 0.00
SEQID-00813 0.04 0.07 0.04 0.04 0.04 0.03 0.05 0.05 -20.90 0.36
0.00 6.68 0.20 0.33 0.00 0.21 SEQID-00814 0.02 0.04 0.02 0.06 0.04
0.07 0.03 0.04 -15.97 0.54 0.06 9.25 1.00 1.00 0.00 0.25
SEQID-00815 0.02 0.07 0.03 0.06 0.04 0.03 0.06 0.04 -21.94 0.26
-0.02 5.45 0.20 0.33 0.00 0.20 SEQID-00816 0.02 0.04 0.03 0.06 0.05
0.01 0.03 0.07 -21.25 0.54 -0.02 5.30 0.19 0.34 0.00 0.20
SEQID-00817 0.03 0.06 0.03 0.08 0.05 0.02 0.03 0.05 -17.92 0.47
-0.03 4.98 0.22 0.31 0.00 0.22 SEQID-00818 0.03 0.05 0.03 0.08 0.04
0.01 0.02 0.04 -22.52 0.26 0.01 8.12 0.19 0.33 0.00 0.20
SEQID-00819 0.02 0.03 0.01 0.02 0.06 0.00 0.06 0.08 -23.82 0.30
0.18 11.91 0.19 0.28 0.00 0.28 SEQID-00820 0.05 0.05 0.05 0.07 0.05
0.01 0.05 0.02 -22.32 0.13 0.00 6.55 0.19 0.33 0.19 0.20
SEQID-00821 0.02 0.06 0.03 0.05 0.05 0.01 0.04 0.05 -27.82 0.30
-0.05 4.54 0.75 0.89 0.00 0.21 SEQID-00822 0.03 0.03 0.04 0.04 0.05
0.01 0.01 0.09 -21.46 0.48 0.00 6.76 0.21 0.33 0.18 0.21
SEQID-00823 0.03 0.05 0.05 0.06 0.04 0.02 0.04 0.07 -19.60 0.45
0.03 9.21 0.21 0.38 0.00 0.23 SEQID-00824 0.02 0.07 0.05 0.06 0.05
0.03 0.07 0.06 -18.82 0.38 0.01 7.62 0.43 0.70 0.21 0.21
SEQID-00825 0.02 0.04 0.01 0.06 0.05 0.01 0.03 0.03 -27.73 0.20
-0.01 5.87 0.20 0.34 0.21 0.18 SEQID-00826 0.02 0.05 0.04 0.07 0.05
0.03 0.04 0.06 -23.22 0.17 -0.06 4.46 0.22 0.32 0.00 0.22
SEQID-00827 0.02 0.05 0.05 0.09 0.05 0.02 0.04 0.05 -18.66 0.36
-0.01 6.55 0.18 0.33 0.19 0.19 SEQID-00828 0.02 0.05 0.04 0.06 0.05
0.00 0.05 0.06 -21.15 0.40 -0.01 5.88 0.19 0.33 0.00 0.22
SEQID-00829 0.04 0.02 0.03 0.06 0.03 0.01 0.02 0.04 -27.07 0.18
0.00 6.97 0.19 0.36 0.19 0.17 SEQID-00830 0.05 0.05 0.04 0.04 0.03
0.02 0.05 0.02 -31.03 0.20 0.03 9.50 0.21 0.31 0.18 0.23
SEQID-00831 0.02 0.06 0.03 0.07 0.05 0.03 0.04 0.06 -20.27 0.49
-0.01 6.52 0.19 0.32 0.00 0.20 SEQID-00832 0.03 0.07 0.07 0.04 0.03
0.03 0.03 0.05 -19.84 0.49 -0.01 6.35 0.23 0.33 0.24 0.23
SEQID-00833 0.03 0.03 0.04 0.08 0.05 0.03 0.03 0.06 -18.70 0.04
-0.02 5.99 0.00 0.36 0.00 0.18 SEQID-00834 0.03 0.04 0.07 0.06 0.05
0.03 0.04 0.05 -19.80 0.30 0.03 9.51 0.21 0.33 0.00 0.20
SEQID-00835 0.02 0.06 0.03 0.04 0.05 0.00 0.04 0.06 -212.75 0.42
0.04 9.78 0.20 0.33 0.00 0.20 SEQID-00836 0.02 0.02 0.01 0.07 0.05
0.01 0.01 0.04 -28.27 0.15 -0.06 4.67 0.00 0.36 0.16 0.19
SEQID-00837 0.01 0.07 0.03 0.04 0.02 0.01 0.04 0.04 -23.16 0.37
0.01 8.05 0.44 0.59 0.00 0.21 SEQID-00838 0.02 0.09 0.04 0.07 0.07
0.05 0.08 0.05 -17.20 0.33 -0.04 4.36 0.23 0.43 0.00 0.21
SEQID-00839 0.02 0.09 0.04 0.07 0.07 0.05 0.08 0.05 -17.20 0.33
-0.04 4.36 0.23 0.43 0.00 0.21 SEQID-00840 0.02 0.05 0.06 0.08 0.06
0.03 0.04 0.07 -16.79 0.41 -0.03 4.92 0.23 0.41 0.00 0.22
SEQID-00841 0.02 0.07 0.06 0.05 0.06 0.03 0.06 0.08 -15.70 0.45
0.01 8.78 0.21 0.33 0.00 0.21 SEQID-00842 0.02 0.08 0.05 0.06 0.06
0.07 0.05 0.05 -15.37 0.40 -0.01 6.24 0.21 0.33 0.00 0.20
SEQID-00843 0.02 0.05 0.03 0.05 0.04 0.05 0.09 0.04 -19.75 0.35
-0.06 4.34 0.21 0.33 0.00 0.21 SEQID-00844 0.02 0.08 0.05 0.07 0.04
0.04 0.03 0.06 -17.13 0.43 0.03 9.49 0.20 0.33 0.00 0.21
SEQID-00845 0.02 0.06 0.05 0.05 0.06 0.04 0.03 0.05 -19.30 0.37
0.02 8.68 0.20 0.33 0.00 0.21 SEQID-00846 0.01 0.07 0.06 0.06 0.03
0.03 0.03 0.08 -19.54 0.47 -0.01 5.25 0.21 0.37 0.21 0.22
SEQID-00847 0.02 0.07 0.04 0.05 0.06 0.04 0.05 0.04 -15.64 0.382
0.00 7.17 0.21 0.31 0.35 0.21 SEQID-00848 0.02 0.05 0.02 0.06 0.06
0.04 0.08 0.04 -20.06 0.27 -0.02 5.45 0.21 0.31 0.29 0.21
SEQID-00849 0.02 0.08 0.02 0.09 0.08 0.05 0.08 0.07 -17.01 0.41
-0.06 4.10 0.25 0.35 0.00 0.22 SEQID-00850 0.01 0.03 0.03 0.12 0.08
0.03 0.08 0.09 -14.72 0.43 -0.03 4.43 0.22 0.41 0.00 0.23
SEQID-00851 0.01 0.07 0.06 0.05 0.03 0.04 0.07 0.05 -16.72 0.46
-0.01 5.64 0.25 0.31 0.00 0.00 SEQID-00852 0.03 0.08 0.03 0.08 0.06
0.05 0.08 0.06 -11.63 0.39 0.03 8.62 0.29 0.37 0.00 0.19
SEQID-00853 0.01 0.05 0.06 0.07 0.01 0.03 0.07 0.05 -21.01 0.41
0.02 8.22 0.28 0.30 0.25 0.26 SEQID-00854 0.02 0.04 0.05 0.05 0.04
0.03 0.09 0.03 -22.92 0.44 0.01 7.66 0.20 0.28 0.21 0.22
SEQID-00855 0.02 0.06 0.03 0.05 0.05 0.02 0.06 0.04 -22.85 0.50
-0.02 5.69 0.28 0.32 0.23 0.22 SEQID-00856 0.03 0.04 0.05 0.07 0.07
0.02 0.02 0.05 -21.90 0.38 0.04 9.19 0.21 0.29 0.00 0.00
SEQID-00857 0.02 0.05 0.06 0.06 0.04 0.04 0.08 0.05 -20.43 0.34
-0.04 4.89 0.21 0.33 0.20 0.21 SEQID-00858 0.02 0.05 0.04 0.05 0.07
0.00 0.05 0.04 -19.78 0.44 0.00 6.90 0.20 0.30 0.00 0.00
SEQID-00859 0.02 0.03 0.04 0.09 0.07 0.00 0.01 0.03 -22.27 0.41
-0.01 6.68 0.20 0.33 0.23 0.22 SEQID-00860 0.03 0.03 0.02 0.06 0.05
0.00 0.08 0.05 -25.41 0.34 0.00 7.39 0.21 0.32 0.00 0.00
SEQID-00861 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05 -19.53 0.43
-0.03 5.15 0.21 0.31 0.00 0.22 SEQID-00862 0.05 0.05 0.04 0.05 0.06
0.02 0.06 0.05 -19.52 0.43 -0.03 5.16 0.21 0.31 0.00 0.22
SEQID-00863 0.02 0.04 0.02 0.03 0.08 0.00 0.02 0.05 -23.67 0.33
0.00 7.90 0.22 0.31 0.23 0.21 SEQID-00864 0.07 0.08 0.01 0.03 0.05
0.00 0.01 0.04 -28.98 0.24 -0.15 3.89 0.44 0.48 0.24 0.19
SEQID-00865 0.08 0.07 0.01 0.03 0.06 0.00 0.01 0.05 -27.55 0.34
-0.18 3.79 0.39 0.46 0.22 0.24 SEQID-00866 0.06 0.08 0.01 0.03 0.04
0.00 0.00 0.07 -29.02 0.33 -0.18 3.88 0.39 0.44 0.23 0.24
SEQID-00867 0.05 0.07 0.01 0.04 0.05 0.00 0.02 0.04 -28.60 0.33
-0.18 3.76 0.44 0.49 0.24 0.23 SEQID-00868 0.09 0.10 0.01 0.05 0.04
0.00 0.03 0.03 -24.77 0.34 -0.12 3.96 0.34 0.45 0.00 0.00
SEQID-00869 0.06 0.07 0.02 0.01 0.06 0.00 0.01 0.06 -28.16 0.29
-0.14 3.97 0.44 0.47 0.23 0.25 SEQID-00870 0.07 0.07 0.01 0.04 0.04
0.02 0.02 0.0a -28.99 0.30 -0.13 4.03 0.35 0.45 0.00 0.00
SEQID-00871 0.02 0.04 0.04 0.03 0.06 0.00 0.03 0.06 -25.67 0.29
-0.03 4.94 0.23 0.34 0.00 0.00 SEQID-00872 0.04 0.03 0.03 0.04 0.07
0.00 0.05 0.08 -25.39 0.32 0.01 8.62 0.00 0.33 0.00 0.2J
SEQID-00873 0.03 0.03 0.03 0.04 0.06 0.00 0.06 0.07 -25.16 0.32
0.02 8.95 0.22 0.33 0.00 0.22 SEQID-00874 0.01 0.04 0.03 0.03 0.03
0.03 0.07 0.05 -25.15 0.33 -0.08 4.45 0.25 0.31 0.21 0.25
SEQID-00875 0.02 0.04 0.03 0.03 0.04 0.03 0.07 0.05 -25.71 0.29
-0.08 4.36 0.21 0.34 0.21 0.25 SEQID-00876 0.02 0.03 0.02 0.04 0.05
0.05 0.02 0.05 -26.34 0.38 -0.10 4.27 0.23 0.31 0.22 0.22
SEQID-00877 0.03 0.03 0.02 0.05 0.02 0.02 0.06 0.07 -27.67 0.29
-0.10 4.27 0.23 0.31 0.00 0.22 SEQID-00878 0.03 0.05 0.03 0.04 0.03
0.01 0.04 0.06 -26.25 0.35 -0.01 5.48 0.21 0.33 0.00 0.23
SEQID-00879 0.03 0.05 0.03 0.05 0.03 0.01 0.04 0.07 -25.44 0.39
0.00 7.29 0.20 0.31 0.00 0.22 SEQID-00880 0.03 0.02 0.09 0.06 0.01
0.00 0.00 0.00 -21.21 0.14 0.01 8.06 0.35 0.34 0.34 0.36
SEQID-00881 0.02 0.00 0.06 0.09 0.13 0.00 0.00 0.01 -15.62 0.24
0.01 7.37 0.27 0.31 0.30 0.31 SEQID-00882 0.04 0.01 0.01 0.08 0.05
0.00 0.02 0.02 -29.20 0.07 -0.02 5.28 0.29 0.30 0.00 0.30
SEQID-00883 0.01 0.05 0.04 0.03 0.04 0.01 0.01 0.03 -23.50 0.25
0.05 8.55 0.23 0.35 0.25 0.25 SEQID-00884 0.02 0.03 0.04 0.12 0.02
0.00 0.01 0.04 -19.99 0.33 0.07 10.84 0.23 0.35 0.24 0.23
SEQID-00885 0.03 0.04 0.03 0.05 0.04 0.01 0.02 0.03 -20.99 0.15
0.08 11.70 0.24 0.37 0.25 0.25 SEQID-00886 0.04 0.06 0.01 0.00 0.04
0.01 0.02 0.05 -30.02 0.32 0.07 10.21 0.21 0.28 0.21 1.00
SEQID-00887 0.01 0.06 0.03 0.00 0.03 0.02 0.02 0.07 -32.84 0.06
0.07 10.25 0.29 0.28 0.28 0.27 SEQID-00888 0.01 0.03 0.01 0.00 0.03
0.02 0.05 0.04 -44.55 0.23 -0.34 3.56 0.30 0.29 0.19 0.30
SEQID-00889 0.07 0.04 0.02 0.00 0.01 0.02 0.04 0.02 -33.51 0.19
-0.10 4.35 0.28 0.32 0.00 0.26 SEQID-00890 0.04 0.02 0.01 0.00 0.02
0.01 0.04 0.04 -35.96 0.10 -0.02 5.48 0.27 0.35 0.20 0.25
SEQID-00891 0.07 0.02 0.00 0.00 0.01 0.01 0.01 0.03 -33.58 0.07
-0.04 5.39 0.28 0.33 0.25 0.25 SEQID-00892 0.04 0.05 0.03 0.00 0.05
0.02 0.03 0.03 -29.13 0.16 0.07 10.36 0.29 0.28 0.00 0.26
SEQID-00893 0.01 0.08 0.03 0.00 0.01 0.04 0.04 0.02 -34.20 0.12
0.07 9.83 0.30 0.26 0.28 0.28 SEQID-00894 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -28.24 0.23 -0.02 5.45 0.18 0.56 0.18 0.18
SEQID-00895 0.03 0.04 0.01 0.03 0.05 0.01 0.03 0.04 -28.12 0.24
-0.02 5.53 0.18 0.56 0.18 0.17 SEQID-00896 0.02 0.05 0.04 0.06 0.07
0.02 0.04 0.08 -21.96 0.34 -0.02 5.52 0.00 0.34 0.00 0.00
SEQID-00897 0.03 0.04 0.01 0.04 0.04 0.01 0.03 0.04 -28.40 0.22
-0.02 5.45 0.19 0.53 0.18 0.18 SEQID-00898 0.05 0.04 0.04 0.05 0.06
0.02 0.06 0.05 -19.69 0.41 -0.03 5.05 0.19 0.30 0.00 0.20
SEQID-00899 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05 -19.52 0.43
-0.03 5.16 0.21 0.31 0.00 0.22 SEQID-00900 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -27.76 0.23 -0.02 5.43 0.19 0.54 0.18 0.18
SEQID-00901 0.03 0.06 0.04 0.04 0.04 0.02 0.03 0.06 -23.59 0.31
0.00 7.14 0.42 0.64 0.00 0.19 SEQID-00902 0.03 0.06 0.03 0.03 0.04
0.02 0.06 0.06 -22.21 0.34 0.00 7.11 0.19 0.33 0.00 0.20
SEQID-00903 0.03 0.04 0.03 0.03 0.04 0.03 0.04 0.03 -24.33 0.29
-0.03 5.13 0.20 0.36 0.00 0.20 SEQID-00904 0.03 0.04 0.03 0.03 0.04
0.03 0.03 0.04 -23.52 0.31 -0.03 5.12 0.21 0.35 0.00 0.20
SEQID-00905 0.02 0.00 0.00 0.04 0.02 0.00 0.03 0.03 -36.76 0.12
-0.09 4.39 0.58 0.69 0.22 0.22 SEQID-00906 0.03 0.05 0.04 0.04 0.03
0.01 0.04 0.07 -20.67 0.42 0.01 7.85 0.85 0.99 0.20 0.22
SEQID-00907 0.02 0.04 0.06 0.04 0.06 0.03 0.05 0.07 -23.89 0.29
-0.01 5.48 0.19 0.35 0.19 0.20 SEQID-00908 0.03 0.00 0.00 0.03 0.02
0.00 0.093 0.03 -37.05 0.12 -0.10 4.35 0.56 0.68 0.21 0.19
SEQID-00909 0.04 0.06 0.03 0.04 0.06 0.02 0.04 0.09 -17.81 0.47
0.02 8.58 0.89 0.85 0.00 0.22 SEQID-00910 0.03 0.03 0.03 0.05 0.03
0.03 0.03 0.09 -18.50 0.56 0.01 8.14 0.23 0.32 0.00 0.21
SEQID-00911 0.02 0.05 0.04 0.06 0.05 0.03 0.05 0.08 -22.55 0.33
-0.01 6.39 0.18 0.34 0.19 0.20 SEQID-00912 0.04 0.06 0.06 0.03 0.03
0.00 0.02 0.05 -22.92 0.34 -0.04 4.67 0.32 0.46 0.00 0.24
SEQID-00913 0.01 0.06 0.04 0.04 0.05 0.01 0.05 0.05 -25.08 0.34
-0.02 6.09 1.00 1.00 0.20 0.21 SEQID-00914 0.04 0.05 0.04 0.04 0.06
0.02 0.09 0.08 -19.09 0.62 -0.02 4.93 0.18 0.35 0.19 0.20
SEQID-00915 0.04 0.04 0.04 0.04 0.05 0.01 0.09 0.08 -20.80 0.45
0.01 7.95 0.21 0.31 0.00 0.21 SEQID-00916 0.02 0.07 0.04 0.05 0.05
0.01 0.05 0.06 -18.96 0.48 0.00 6.80 0.21 0.31 0.00 0.22
SEQID-00917 0.01 0.07 0.03 0.04 0.05 0.02 0.07 0.06 -21.16 0.25
0.07 8.51 0.21 0.31 0.23 0.23 SEQID-00918 0.01 0.05 0.07 0.06 0.04
0.05 0.06 0.04 -20.38 0.30 0.01 7.96 0.22 0.31 0.00 0.22
SEQID-00919 0.04 0.05 0.03 0.05 0.06 0.02 0.03 0.07 -19.53 0.46
0.01 8.37 0.20 0.34 0.00 0.20 SEQID-00920 0.03 0.02 0.03 0.05 0.05
0.02 0.09 0.05 -25.14 0.21 0.04 9.57 0.00 0.34 0.00 0.00
SEQID-00921 0.03 0.07 0.04 0.05 0.06 0.04 0.03 0.05 -18.81 0.42
0.01 7.80 0.20 0.35 0.00 0.21 SEQID-00922 0.04 0.01 0.03 0.04 0.03
0.02 0.02 0.05 -31.38 0.24 0.08 10.51 0.25 0.34 0.00 0.20
SEQID-00923 0.02 0.05 0.06 0.04 0.06 0.02 0.04 0.09 -23.98 0.32
0.00 6.83 0.19 0.36 0.19 0.20 SEQID-00924 0.02 0.05 0.07 0.05 0.07
0.01 0.04 0.09 -18.81 0.32 -0.02 5.87 0.00 0.39 0.16 0.22
SEQID-00925 0.04 0.01 0.00 0.02 0.03 0.01 0.02 0.04 -33.82 0.22
-0.05 4.71 0.49 0.68 0.23 0.00 SEQID-00926 0.04 0.05 0.04 0.05 0.04
0.02 0.02 0.09 -20.25 0.45 0.01 8.46 0.23 0.33 0.21 0.23
SEQID-00927 0.05 0.09 0.03 0.03 0.05 0.01 0.02 0.05 -25.17 0.31
-0.04 4.62 0.39 0.58 0.23 0.00 SEQID-00928 0.06 0.02 0.03 0.04 0.03
0.01 0.01 0.03 -32.56 0.15 0.04 9.50 0.25 0.34 0.23 0.21
SEQID-00929 0.01 0.04 0.04 0.04 0.05 0.03 0.02 0.09 -19.07 0.45
0.00 6.93 0.84 0.83 0.20 0.23 SEQID-00930 0.01 0.10 0.08 0.07 0.04
0.02 0.02 0.05 -23.31 0.29 0.01 7.38 0.25 0.35 0.23 0.23
SEQID-00931 0.02 0.01 0.04 0.02 0.02 0.01 0.09 0.03 -38.39 0.06
-0.01 6.23 0.23 0.36 0.23 0.25 SEQID-00932 0.02 0.05 0.05 0.04 0.05
0.02 0.04 0.06 -22.04 0.35 0.01 8.31 0.38 0.56 0.21 0.21
SEQID-00933 0.02 0.04 0.02 0.06 0.05 0.00 0.04 0.05 -25.40 0.19
-0.03 4.94 0.30 0.45 0.20 0.22 SEQID-00934 0.04 0.06 0.04 0.05 0.06
0.03 0.09 0.08 -18.24 0.65 -0.02 4.99 0.19 0.35 0.19 0.19
SEQID-00935 0.03 0.04 0.05 0.04 0.06 0.00 0.04 0.08 -17.76 0.53
-0.03 4.92 0.22 0.36 0.23 0.22 SEQID-00936 0.04 0.03 0.04 0.03 0.05
0.05 0.03 0.04 -23.52 0.27 0.03 9.32 0.22 0.28 0.21 0.00
SEQID-00937 0.02 0.05 0.05 0.05 0.04 0.03 0.06 0.06 -19.26 0.38
0.00 6.76 0.18 0.35 0.18 0.19 SEQID-00938 0.03 0.06 0.04 0.04 0.06
0.03 0.05 0.06 -20.58 0.35 0.02 8.95 0.21 0.31 0.00 0.21
SEQID-00939 0.02 0.04 0.03 0.06 0.04 0.00 0.04 0.07 -19.40 0.45
0.02 9.64 0.21 0.33 0.00 0.22 SEQID-00940 0.01 0.06 0.06 0.06 0.05
0.00 0.03 0.08 -18.74 0.44 0.00 6.43 0.00 0.55 0.17 0.86
SEQID-00941 0.05 0.07 0.08 0.02 0.05 0.00 0.02 0.04 -24.70 0.26
-0.04 4.72 0.30 0.48 0.19 0.23 SEQID-00942 0.03 0.05 0.09 0.04 0.02
0.00 0.09 0.08 -23.23 0.35 -0.02 5.20 0.28 0.42 0.00 0.24
SEQID-00943 0.02 0.05 0.04 0.07 0.05 0.03 0.06 0.07 -21.97 0.31
-0.01 6.50 0.18 0.34 0.19 0.19 SEQID-00944 0.05 0.11 0.04 0.01 0.05
0.00 0.09 0.04 -25.95 0.30 -0.05 4.56 0.40 0.58 0.00 0.00
SEQID-00945 0.04 0.03 0.03 0.04 0.07 0.00 0.05 0.08 -24.69 0.33
0.01 8.63 0.00 0.33 0.00 0.23 SEQID-00946 0.01 0.05 0.08 0.07 0.05
0.05 0.04 0.05 -19.88 0.23 -0.01 6.36 0.21 0.32 0.22 0.25
SEQID-00947 0.03 0.06 0.03 0.03 0.05 0.01 0.02 0.09 -17.51 0.57
0.00 6.89 0.20 0.31 0.00 0.20 SEQID-00948 0.03 0.05 0.06 0.05 0.07
0.00 0.02 0.08 -16.36 0.55 0.02 8.73 0.51 0.69 0.22 0.21
SEQID-00949 0.02 0.05 0.03 0.04 0.06 0.01 0.03 0.06 -22.43 0.35
-0.01 5.66 0.71 0.90 0.00 0.21 SEQID-00950 0.02 0.09 0.02 0.03 0.04
0.02 0.02 0.11 -19.79 0.52 0.01 7.77 0.28 0.30 0.24 0.25
SEQID-00951 0.03 0.06 0.04 0.05 0.04 0.03 0.05 0.06 -18.10 0.43
0.03 9.45 0.22 0.31 0.00 0.21 SEQID-00952 0.02 0.05 0.04 0.05 0.03
0.03 0.05 0.07 -22.51 0.46 -0.03 4.87 0.20 0.33 0.19 0.20
SEQID-00953 0.01 0.04 0.07 0.07 0.03 0.02 0.03 0.04 -23.78 0.26
-0.09 4.20 0.22 0.42 0.20 0.23 SEQID-00954 0.02 0.03 0.03 0.04 0.04
0.01 0.03 0.05 -25.81 0.25 -0.01 5.77 0.00 0.41 0.00 0.18
SEQID-00955 0.02 0.07 0.04 0.07 0.05 0.01 0.03 0.08 -17.08 0.44
0.02 8.94 0.25 0.34 0.26 0.27 SEQID-00956 0.04 0.05 0.06 0.09 0.04
0.01 0.05 0.03 -17.66 0.20 0.02 9.66 0.24 0.41 0.26 0.25
SEQID-00957 0.04 0.02 0.03 0.06 0.04 0.03 0.03 0.10 -18.85 0.58
-0.01 6.40 0.24 0.32 0.00 0.00 SEQID-00958 0.02 0.07 0.05 0.05 0.05
0.04 0.04 0.06 -18.60 0.41 0.00 7.56 0.23 0.34 0.19 0.20
SEQID-00959 0.03 0.05 0.04 0.04 0.07 0.01 0.03 0.06 -22.45 0.34
-0.02 5.16 0.73 0.93 0.00 0.22 SEQID-00960 0.01 0.04 0.12 0.06 0.02
0.01 0.04 0.08 -16.72 0.46 -0.01 6.39 0.25 0.32 0.25 0.26
SEQID-00961 0.03 0.03 0.03 0.02 0.01 0.01 0.02 0.03 -37.46 0.14
-0.01 6.56 0.25 0.35 0.22 0.21 SEQID-00962 0.02 0.05 0.06 0.09 0.04
0.01 0.04 0.06 -19.01 0.20 0.02 9.32 0.21 0.35 0.19 0.24
SEQID-00963 0.05 0.08 0.05 0.04 0.04 0.02 0.08 0.05 -20.90 0.32
0.01 7.78 0.20 0.30 0.20 0.21 SEQID-00964 0.02 0.05 0.11 0.09 0.06
0.01 0.06 0.04 -15.14 0.27 0.01 7.95 0.20 0.45 0.20 0.21
SEQID-00965 0.04 0.08 0.05 0.03 0.02 0.03 0.07 0.03 -23.11 0.36
0.00 7.49 0.52 0.68 0.21 0.23 SEQID-00966 0.03 0.09 0.02 0.04 0.04
0.03 0.06 0.07 -16.84 0.56 0.07 10.36 0.21 0.34 0.00 0.00
SEQID-00967 0.03 0.04 0.03 0.05 0.04 0.02 0.03 0.08 -20.61 0.55
0.00 6.53 0.25 0.34 0.17 0.00 SEQID-00968 0.03 0.02 0.01 0.06 0.04
0.01 0.08 0.05 -25.41 0.27 -0.06 4.52 0.25 0.34 0.00 0.00
SEQID-00969 0.01 0.07 0.02 0.05 0.10 0.02 0.06 0.04 -18.46 0.31
0.01 8.89 0.21 0.31 0.00 0.00 SEQID-00970 0.03 0.06 0.04 0.04 0.05
0.01 0.06 0.06 -20.02 0.37 -0.05 4.69 0.94 1.00 0.20 0.22
SEQID-00971 0.02 0.05 0.08 0.04 0.04 0.01 0.04 0.06 -20.64 0.33
-0.02 5.02 0.27 0.56 0.21 0.30 SEQID-00972 0.03 0.04 0.04 0.03 0.07
0.00 0.03 0.04 -24.05 0.30 0.15 11.71 0.24 0.30 0.22 0.00
SEQID-00973 0.03 0.02 0.04 0.05 0.04 0.00 0.02 0.10 -21.20 0.60
0.00 7.44 0.20 0.33 0.00 0.23 SEQID-00974 0.03 0.06 0.07 0.03 0.08
0.02 0.03 0.05 -22.31 0.45 -0.01 6.30 0.50 0.56 0.00 0.00
SEQID-00975 0.04 0.03 0.02 0.04 0.03 0.01 0.07 0.04 -26.62 0.33
-0.07 4.36 0.24 0.32 0.00 0.00 SEQID-00976 0.01 0.04 0.05 0.05 0.05
0.03 0.04 0.06 -20.20 0.42 0.05 9.78 0.20 0.34 0.00 0.21
SEQID-00977 0.02 0.04 0.03 0.06 0.05 0.02 0.05 0.06 -18.41 0.38
-0.01 6.34 0.21 0.31 0.18 0.22 SEQID-00978 0.01 0.05 0.07 0.04 0.03
0.03 0.02 0.06 -20.46 0.43 0.00 7.02 0.21 0.33 0.21 0.24
SEQID-00979 0.02 0.03 0.01 0.02 0.06 0.00 0.06 0.08 -23.82 0.30
0.18 11.91 0.19 0.28 0.00 0.28 SEQID-00980 0.09 0.09 0.01 0.03 0.06
0.00 0.01 0.04 -29.38 0.32 -0.16
3.85 0.39 0.45 0.00 0.25 SEQID-00981 0.02 0.01 0.03 0.04 0.03 0.00
0.03 0.06 -21.47 0.40 0.14 11.55 0.24 0.33 0.00 0.24 SEQID-00982
0.03 0.02 0.04 0.09 0.06 0.00 0.06 0.06 -23.96 0.22 0.15 11.00 0.25
0.30 0.22 0.22 SEQID-00983 0.02 0.10 0.05 0.05 0.04 0.02 0.04 0.05
-20.43 0.40 0.02 8.61 0.28 0.36 0.23 0.24 SEQID-00984 0.05 0.03
0.04 0.08 0.06 0.00 0.03 0.09 -18.31 0.47 0.07 10.55 0.00 0.31 0.00
0.24 SEQID-00985 0.03 0.04 0.05 0.04 0.02 0.02 0.08 0.05 -17.45
0.42 0.00 7.44 0.30 0.39 0.00 0.23 SEQID-00986 0.03 0.07 0.04 0.03
0.03 0.03 0.06 0.04 -23.98 0.30 -0.06 4.53 0.22 0.32 0.00 0.22
SEQID-00987 0.03 0.03 0.06 0.07 0.07 0.02 0.02 0.05 -21.44 0.23
0.06 10.42 0.23 0.32 0.00 0.24 SEQID-00988 0.02 0.04 0.06 0.09 0.04
0.01 0.04 0.10 -18.81 0.50 0.03 9.15 0.21 0.31 0.00 0.00
SEQID-00989 0.01 0.08 0.05 0.07 0.05 0.02 0.06 0.03 -18.71 0.25
-0.02 5.97 0.22 0.31 0.23 0.24 SEQID-00990 0.02 0.05 0.08 0.05 0.04
0.01 0.04 0.06 -18.94 0.32 0.01 8.02 0.21 0.35 0.00 0.21
SEQID-00991 0.03 0.03 0.02 0.06 0.05 0.00 0.08 0.05 -25.41 0.34
0.00 7.39 0.21 0.32 0.00 0.00 SEQID-00992 0.02 0.05 0.04 0.07 0.04
0.00 0.05 0.07 -15.67 0.41 0.02 9.07 0.21 0.34 0.00 0.23
SEQID-00993 0.03 0.05 0.08 0.05 0.06 0.00 0.02 0.09 -18.97 0.44
0.02 9.36 0.20 0.36 0.20 0.21 SEQID-00994 0.03 0.04 0.05 0.05 0.05
0.02 0.04 0.08 -20.80 0.41 0.03 9.50 0.22 0.34 0.00 0.22
SEQID-00995 0.04 0.04 0.04 0.06 0.05 0.03 0.06 0.06 -17.23 0.44
0.01 8.29 0.21 0.33 0.22 0.22 SEQID-00996 0.03 0.04 0.10 0.05 0.06
0.02 0.02 0.07 -17.11 0.45 0.01 8.25 0.21 0.36 0.22 0.22
SEQID-00997 0.04 0.05 0.02 0.05 0.05 0.00 0.05 0.03 -25.20 0.37
-0.02 5.65 0.19 0.34 0.00 0.20 SEQID-00998 0.02 0.04 0.05 0.04 0.05
0.02 0.04 0.05 -19.46 0.39 0.01 7.90 0.20 0.32 0.00 0.21
SEQID-00999 0.03 0.04 0.02 0.04 0.05 0.01 0.05 0.04 -28.98 0.30
-0.05 4.64 0.85 0.86 0.00 0.20 SEQID-01000 0.02 0.05 0.05 0.05 0.05
0.03 0.04 0.06 -23.33 0.29 -0.01 5.62 0.19 0.33 0.20 0.20
SEQID-01001 0.02 0.05 0.03 0.05 0.05 0.02 0.04 0.07 -21.41 0.40
0.00 7.13 1.00 1.00 0.00 0.21 SEQID-01002 0.02 0.05 0.03 0.06 0.05
0.03 0.04 0.07 -21.00 0.42 0.00 7.04 0.93 1.00 0.00 0.21
SEQID-01003 0.02 0.05 0.05 0.06 0.06 0.02 0.05 0.06 -18.58 0.39
-0.02 5.31 0.16 0.35 0.18 0.19 SEQID-01004 0.06 0.08 0.03 0.07 0.07
0.02 0.05 0.05 -19.09 0.45 -0.03 4.97 0.57 0.74 0.00 0.45
SEQID-01005 0.02 0.04 0.02 0.06 0.04 0.07 0.03 0.04 -15.97 0.54
0.06 9.25 1.00 1.00 0.00 0.25 SEQID-01006 0.02 0.07 0.03 0.05 0.06
0.00 0.04 0.08 -20.07 0.51 -0.05 4.51 1.00 1.00 0.24 1.00
SEQID-01007 0.01 0.03 0.04 0.05 0.07 0.00 0.06 0.06 -20.24 0.39
-0.01 6.57 0.22 0.59 0.21 1.00 SEQID-01008 0.03 0.06 0.04 0.06 0.06
0.02 0.06 0.07 -17.92 0.49 -0.01 5.89 0.18 0.34 0.18 0.99
SEQID-01009 0.03 0.07 0.05 0.07 0.08 0.02 0.06 0.08 -15.59 0.51
0.01 7.60 0.19 0.32 0.00 0.48 SEQID-01010 0.06 0.07 0.04 0.06 0.07
0.02 0.03 0.05 -19.62 0.48 -0.03 4.66 0.64 0.78 0.21 0.46
SEQID-01011 0.05 0.05 0.03 0.07 0.06 0.02 0.04 0.05 -19.80 0.44
0.01 8.46 0.59 0.71 0.00 0.44 SEQID-01012 0.03 0.07 0.04 0.05 0.05
0.02 0.01 0.05 -23.91 0.24 -0.03 5.29 0.22 0.33 0.00 0.21
SEQID-01013 0.02 0.03 0.08 0.06 0.05 0.03 0.02 0.10 -14.17 0.62
-0.01 6.50 0.22 0.33 0.00 0.23 SEQID-01014 0.01 0.07 0.02 0.06 0.08
0.00 0.00 0.06 -22.97 0.30 -0.08 5.19 0.27 0.30 0.25 0.25
SEQID-01015 0.04 0.04 0.07 0.07 0.06 0.01 0.02 0.09 -14.50 0.66
-0.02 5.76 0.22 0.33 0.00 0.24 SEQID-01016 0.03 0.08 0.04 0.06 0.08
0.02 0.06 0.07 -16.56 0.51 0.01 8.22 0.20 0.34 0.00 0.41
SEQID-01017 0.03 0.04 0.04 0.07 0.07 0.02 0.08 0.05 -17.85 0.37
-0.01 6.00 0.19 0.33 0.19 0.20 SEQID-01018 0.02 0.06 0.02 0.06 0.13
0.04 0.01 0.05 -16.16 0.52 0.04 10.35 0.23 0.32 0.00 0.24
SEQID-01019 0.04 0.04 0.03 0.10 0.04 0.04 0.05 0.02 -21.68 0.27
-0.04 4.91 0.21 0.31 0.22 0.21 SEQID-01020 0.05 0.04 0.02 0.06 0.07
0.02 0.06 0.07 -23.98 0.52 -0.01 5.41 0.28 0.31 0.00 0.28
SEQID-01021 0.03 0.05 0.03 0.06 0.05 0.03 0.08 0.06 -16.96 0.39
-0.01 6.29 0.38 0.59 0.00 0.20 SEQID-01022 0.04 0.06 0.04 0.07 0.06
0.08 0.11 0.04 -10.42 0.83 0.11 9.33 0.31 0.25 0.36 0.29
SEQID-01023 0.02 0.07 0.06 0.02 0.02 0.02 0.07 0.08 -17.26 0.50
0.02 8.56 0.21 0.31 0.00 0.24 SEQID-01024 0.03 0.03 0.03 0.07 0.03
0.01 0.05 0.08 -18.61 0.64 0.01 7.82 0.24 0.30 0.24 1.00
SEQID-01025 0.01 0.09 0.03 0.06 0.06 0.06 0.03 0.06 -17.18 0.51
0.03 8.58 0.26 0.30 0.00 0.23 SEQID-01026 0.02 0.05 0.10 0.06 0.08
0.01 0.07 0.06 -14.96 0.42 0.00 6.78 0.98 1.00 0.00 0.24
SEQID-01027 0.03 0.05 0.04 0.06 0.08 0.01 0.08 0.06 -22.58 0.29
0.02 8.69 1.00 1.00 0.18 0.00 SEQID-01028 0.03 0.03 0.04 0.03 0.05
0.02 0.03 0.05 -20.98 0.57 -0.04 4.66 0.99 1.00 0.00 0.24
SEQID-01029 0.01 0.05 0.04 0.05 0.05 0.03 0.04 0.06 -19.81 0.44
0.02 8.38 1.00 1.00 0.00 0.21 SEQID-01030 0.03 0.07 0.05 0.05 0.06
0.01 0.04 0.06 -18.85 0.43 0.01 7.72 0.19 0.33 0.19 0.20
SEQID-01031 0.02 0.04 0.04 0.05 0.06 0.02 0.05 0.08 -21.17 0.42
0.00 6.82 0.18 0.32 0.19 0.24 SEQID-01032 0.02 0.07 0.04 0.05 0.08
0.04 0.05 0.04 -15.64 0.38 0.00 7.17 0.21 0.31 0.35 0.21
SEQID-01033 0.03 0.06 0.06 0.06 0.03 0.04 0.03 0.07 -21.14 0.51
-0.03 4.85 0.20 0.35 0.20 0.22 SEQID-01034 0.01 0.05 0.05 0.07 0.06
0.03 0.05 0.09 -19.28 0.39 0.00 7.29 0.20 0.37 0.00 0.21
SEQID-01035 0.02 0.06 0.05 0.05 0.08 0.04 0.03 0.05 -19.30 0.37
0.02 8.68 0.20 0.33 0.00 0.21 SEQID-01036 0.02 0.03 0.04 0.09 0.07
0.00 0.01 0.03 -22.27 0.41 -0.01 6.68 0.20 0.33 0.23 0.22
SEQID-01037 0.03 0.02 0.03 0.07 0.06 0.01 0.04 0.07 -19.70 0.36
-0.01 6.13 0.20 0.38 0.00 0.22 SEQID-01038 0.02 0.06 0.04 0.07 0.05
0.03 0.06 0.07 -19.11 0.39 0.02 8.68 0.21 0.45 0.00 0.22
SEQID-01039 0.02 0.05 0.04 0.06 0.06 0.03 0.05 0.06 -17.74 0.44
-0.05 4.44 0.21 0.32 0.20 0.22 SEQID-01040 0.02 0.05 0.04 0.05 0.05
0.02 0.05 0.05 -21.57 0.37 0.00 7.08 0.59 0.71 0.21 0.21
SEQID-01041 0.01 0.03 0.05 0.16 0.10 0.04 0.06 0.07 -12.63 0.44
0.00 7.74 0.18 0.31 0.22 0.23 SEQID-01042 0.01 0.07 0.06 0.11 0.07
0.04 0.03 0.10 -16.09 0.53 -0.03 4.64 0.22 0.34 0.00 0.21
SEQID-01043 0.01 0.06 0.07 0.11 0.07 0.03 0.04 0.09 -16.92 0.42
-0.02 5.16 0.22 0.35 0.19 0.23 SEQID-01044 0.02 0.05 0.08 0.06 0.04
0.04 0.08 0.05 -20.43 0.34 -0.04 4.39 0.21 0.33 0.20 0.21
SEQID-01045 0.02 0.08 0.05 0.05 0.06 0.02 0.06 0.07 -17.05 0.58
0.01 8.22 0.22 0.33 0.00 0.21 SEQID-01046 0.03 0.04 0.05 0.03 0.03
0.01 0.02 0.04 -28.00 0.22 -0.05 4.87 0.23 0.35 0.00 0.23
SEQID-01047 0.02 0.06 0.06 0.06 0.02 0.02 0.06 0.04 -20.51 0.34
0.05 9.68 0.21 0.36 0.21 0.22 SEQID-01048 0.01 0.02 0.06 0.11 0.10
0.03 0.05 0.06 -15.19 0.47 -0.01 5.69 0.21 0.32 0.00 0.22
SEQID-01049 0.02 0.04 0.06 0.09 0.09 0.03 0.05 0.10 -17.98 0.41
0.01 7.92 0.20 0.31 0.00 0.23 SEQID-01050 0.02 0.05 0.02 0.06 0.06
0.04 0.08 0.04 -20.06 0.27 -0.02 5.45 0.21 0.31 0.29 0.21
SEQID-01051 0.00 0.04 0.04 0.16 0.07 0.02 0.06 0.06 -11.96 0.30
0.01 8.20 0.22 0.31 0.27 0.28 SEQID-01052 0.02 0.07 0.05 0.06 0.05
0.05 0.07 0.06 -15.49 0.41 0.02 8.00 0.25 0.39 0.52 0.32
SEQID-01053 0.03 0.08 0.03 0.07 0.06 0.01 0.05 0.06 -15.78 0.68
0.02 8.87 0.19 0.31 0.20 0.20 SEQID-01054 0.03 0.05 0.05 0.06 0.05
0.02 0.03 0.06 -16.22 0.48 -0.01 6.42 0.17 0.35 0.17 0.19
SEQID-01055 0.01 0.05 0.09 0.13 0.07 0.03 0.01 0.08 -10.74 0.51
-0.01 6.21 0.22 0.31 0.20 0.24 SEQID-01056 0.02 0.07 0.04 0.07 0.07
0.03 0.02 0.08 -14.33 0.87 0.00 7.51 0.20 0.33 0.00 0.20
SEQID-01057 0.01 0.02 0.05 0.14 0.09 0.02 0.09 0.05 -12.66 0.22
0.01 8.03 0.24 0.34 0.29 0.23 SEQID-01058 0.04 0.06 0.01 0.04 0.12
0.03 0.02 0.10 -21.36 0.43 0.00 7.51 0.43 0.53 0.20 0.20
SEQID-01059 0.02 0.06 0.03 0.05 0.05 0.02 0.06 0.04 -22.85 0.50
-0.02 5.69 0.28 0.32 0.23 0.22 SEQID-01060 0.03 0.04 0.05 0.07 0.07
0.02 0.02 0.05 -21.90 0.38 0.04 9.19 0.21 0.29 0.00 0.00
SEQID-01061 0.02 0.04 0.06 0.05 0.04 0.09 0.05 0.03 -19.03 0.26
0.02 7.89 0.21 0.31 0.20 0.24 SEQID-01062 0.01 0.07 0.03 0.05 0.06
0.01 0.04 0.06 -19.76 0.52 -0.02 5.84 0.27 0.39 0.00 1.00
SEQID-01063 0.04 0.05 0.03 0.04 0.05 0.03 0.06 0.05 -21.17 0.34
-0.01 6.52 0.21 0.32 0.00 0.20 SEQID-01064 0.02 0.03 0.06 0.05 0.05
0.04 0.07 0.08 -19.14 0.35 0.03 8.38 0.22 0.43 0.21 0.26
SEQID-01065 0.02 0.08 0.05 0.07 0.04 0.04 0.03 0.06 -17.13 0.43
0.03 9.49 0.20 0.33 0.00 0.21 SEQID-01066 0.02 0.07 0.04 0.04 0.07
0.00 0.07 0.08 -14.90 0.75 0.02 8.31 0.35 0.39 0.26 0.26
SEQID-01067 0.01 0.05 0.06 0.07 0.01 0.03 0.07 0.05 -21.01 0.41
0.02 8.22 0.28 0.30 0.25 0.26 SEQID-01068 0.02 0.03 0.06 0.13 0.07
0.05 0.02 0.10 -12.39 0.59 0.02 8.90 0.29 0.33 0.24 0.26
SEQID-01069 0.03 0.06 0.06 0.04 0.04 0.00 0.06 0.05 -21.65 0.52
0.05 9.04 0.24 0.31 0.23 0.25 SEQID-01070 0.03 0.02 0.04 0.06 0.07
0.01 0.05 0.08 -22.47 0.46 -0.03 4.82 0.22 0.29 0.00 0.26
SEQID-01071 0.02 0.01 0.05 0.05 0.03 0.05 0.09 0.07 -14.44 0.45
0.06 9.70 0.00 0.29 0.00 0.24 SEQID-01072 0.04 0.10 0.03 0.04 0.04
0.02 0.04 0.06 -16.09 1.02 0.00 6.72 0.22 0.30 0.00 0.20
SEQID-01073 0.03 0.05 0.08 0.06 0.03 0.01 0.07 0.06 -16.32 0.42
0.04 9.51 0.21 0.32 0.00 0.21 SEQID-01074 0.03 0.02 0.05 0.05 0.06
0.05 0.07 0.05 -22.62 0.18 0.01 8.31 0.21 0.33 0.19 0.22
SEQID-01075 0.02 0.08 0.05 0.06 0.05 0.01 0.04 0.07 -16.97 0.49
0.00 7.11 0.21 0.33 0.00 0.22 SEQID-01076 0.01 0.03 0.13 0.17 0.11
0.01 0.04 0.04 -9.51 0.35 0.00 7.31 0.22 0.38 0.23 0.22 SEQID-01077
0.02 0.06 0.05 0.05 0.04 0.01 0.03 0.04 -19.53 0.40 -0.01 6.14 1.00
1.00 0.20 0.22 SEQID-01078 0.01 0.06 0.08 0.06 0.02 0.01 0.03 0.04
-26.15 0.38 -0.03 4.84 1.00 1.00 0.19 0.20 SEQID-01079 0.01 0.06
0.05 0.06 0.02 0.01 0.03 0.04 -26.21 0.36 -0.03 5.48 0.96 1.00 0.00
0.20 SEQID-01080 0.01 0.04 0.08 0.06 0.03 0.02 0.04 0.05 -23.03
0.33 -0.04 4.95 1.00 1.00 0.00 0.20 SEQID-01081 0.01 0.05 0.08 0.06
0.04 0.01 0.04 0.06 -20.74 0.36 -0.03 5.47 1.00 1.00 0.00 0.21
SEQID-01082 0.01 0.08 0.05 0.05 0.03 0.01 0.03 0.05 -18.72 0.42
-0.01 5.78 1.00 1.00 0.19 0.22 SEQID-01083 0.01 0.05 0.06 0.06 0.04
0.01 0.04 0.06 -20.28 0.34 -0.02 5.75 1.00 1.00 0.00 0.22
SEQID-01084 0.02 0.09 0.04 0.06 0.04 0.01 0.02 0.05 -24.13 0.42
-0.01 6.47 0.45 0.63 0.00 0.21 SEQID-01085 0.02 0.06 0.05 0.05 0.05
0.03 0.05 0.05 -20.29 0.39 -0.01 6.55 0.20 0.33 0.00 0.21
SEQID-01086 0.02 0.09 0.04 0.06 0.04 0.01 0.02 0.05 -24.06 0.41
0.00 6.87 0.44 0.63 0.00 0.21 SEQID-01087 0.02 0.08 0.04 0.06 0.05
0.01 0.02 0.05 -23.27 0.45 -0.01 6.57 0.46 0.66 0.18 0.21
SEQID-01088 0.02 0.05 0.05 0.05 0.05 0.03 0.06 0.06 -19.35 0.40
0.00 6.73 0.20 0.34 0.00 0.21 SEQID-01089 0.02 0.07 0.05 0.04 0.07
0.02 0.03 0.08 -18.23 0.50 0.01 8.02 0.25 0.34 0.00 0.21
SEQID-01090 0.02 0.09 0.04 0.06 0.04 0.02 0.03 0.06 -20.83 0.56
-0.03 4.72 1.00 1.00 0.25 1.00 SEQID-01091 0.02 0.05 0.05 0.06 0.05
0.03 0.06 0.05 -19.29 0.37 -0.01 6.35 0.20 0.35 0.00 0.21
SEQID-01092 0.02 0.06 0.03 0.05 0.06 0.03 0.04 0.09 -20.78 0.50
0.00 7.27 0.84 0.94 0.00 0.21 SEQID-01093 0.02 0.04 0.05 0.03 0.05
0.02 0.05 0.07 -20.34 0.38 -0.01 6.76 0.22 0.31 0.00 0.21
SEQID-01094 0.02 0.06 0.03 0.05 0.06 0.03 0.04 0.11 -20.35 0.49
0.00 7.61 0.86 0.96 0.20 0.20 SEQID-01095 0.02 0.08 0.03 0.07 0.06
0.02 0.05 0.09 -18.22 0.57 0.01 7.386 0.67 0.94 0.19 0.21
SEQID-01096 0.02 0.06 0.03 0.05 0.06 0.03 0.04 0.10 -20.79 0.50
0.00 7.27 0.84 0.94 0.00 0.21 SEQID-01097 0.01 0.08 0.04 0.06 0.02
0.00 0.04 0.05 -21.37 0.48 -0.01 6.14 1.00 1.00 0.21 0.22
SEQID-01098 0.02 0.04 0.04 0.03 0.05 0.02 0.05 0.07 -19.99 0.38
-0.01 6.76 0.21 0.31 0.00 0.20 SEQID-01099 0.01 0.04 0.05 0.04 0.10
0.01 0.03 0.09 -15.86 0.67 0.02 9.38 0.23 0.76 0.00 0.24
SEQID-01100 0.01 0.04 0.05 0.04 0.10 0.01 0.03 0.09 -16.06 0.72
0.02 9.38 0.47 0.71 0.00 0.21 SEQID-01101 0.01 0.07 0.05 0.05 0.02
0.00 0.03 0.04 -27.12 0.37 -0.01 6.26 0.60 0.86 0.19 0.20
SEQID-01102 0.01 0.03 0.04 0.06 0.05 0.01 0.05 0.08 -17.38 0.42
0.01 7.63 0.21 0.32 0.00 0.22 SEQID-01103 0.03 0.07 0.06 0.07 0.07
0.01 0.02 0.07 -11.30 0.50 0.02 8.38 0.22 0.34 0.20 0.22
SEQID-01104 0.03 0.07 0.05 0.05 0.05 0.01 0.02 0.09 -18.02 0.50
-0.01 6.50 0.27 0.36 0.22 0.21 SEQID-01105 0.05 0.04 0.05 0.06 0.05
0.02 0.06 0.07 -19.68 0.46 -0.03 5.17 0.21 0.33 0.00 0.21
SEQID-01106 0.02 0.07 0.05 0.04 0.06 0.02 0.03 0.08 -19.23 0.47
0.00 6.76 0.24 0.33 0.00 0.21 SEQID-01107 0.03 0.07 0.06 0.07 0.06
0.01 0.02 0.06 -11.25 0.48 0.02 8.32 0.22 0.33 0.00 0.21
SEQID-01108 0.02 0.06 0.05 0.05 0.05 0.01 0.03 0.10 -17.31 0.52
-0.01 6.43 0.27 0.36 0.00 0.20 SEQID-01109 0.02 0.05 0.04 0.06 0.06
0.03 0.05 0.07 -19.81 0.42 -0.01 6.26 0.88 0.98 0.00 0.21
SEQID-01110 0.01 0.07 0.05 0.10 0.08 0.04 0.03 0.07 -15.10 0.55
-0.01 5.94 1.00 1.00 0.53 0.23 SEQID-01111 0.06 0.02 0.02 0.04 0.04
0.01 0.01 0.01 -29.45 0.31 -0.04 4.98 0.36 0.39 0.23 0.36
SEQID-01112 0.02 0.06 0.04 0.03 0.05 0.02 0.05 0.06 -21.45 0.41
-0.01 6.32 0.20 0.32 0.00 0.21 SEQID-01113 0.03 0.05 0.05 0.04 0.07
0.01 0.04 0.08 -22.27 0.40 0.03 9.56 0.22 0.35 0.20 0.22
SEQID-01114 0.01 0.11 0.05 0.06 0.03 0.01 0.04 0.07 -22.15 0.41
-0.04 4.82 0.21 0.58 0.20 0.22 SEQID-01115 0.05 0.04 0.05 0.05 0.06
0.02 0.06 0.06 -19.69 0.44 -0.03 5.16 0.20 0.33 0.00 0.21
SEQID-01116 0.02 0.04 0.03 0.04 0.05 0.02 0.05 0.09 -19.41 0.46
-0.01 5.37 0.91 0.98 0.20 0.22 SEQID-01117 0.04 0.05 0.05 0.04 0.04
0.01 0.07 0.03 -20.78 0.29 0.00 7.07 0.22 0.29 0.00 0.00
SEQID-01118 0.03 0.08 0.07 0.05 0.04 0.03 0.05 0.05 -21.32 0.34
-0.01 6.11 0.22 0.37 0.00 0.21 SEQID-01119 0.02 0.04 0.02 0.07 0.04
0.04 0.07 0.04 -20.86 0.36 -0.02 5.88 1.00 1.00 0.00 0.35
SEQID-01120 0.06 0.03 0.05 0.12 0.03 0.00 0.05 0.00 -23.90 0.31
-0.04 4.69 0.26 0.27 0.31 1.00 SEQID-01121 0.06 0.04 0.08 0.07 0.03
0.03 0.05 0.06 -20.07 0.32 -0.02 6.03 0.21 0.32 0.21 0.00
SEQID-01122 0.03 0.05 0.05 0.04 0.05 0.01 0.03 0.08 -16.87 0.43
0.00 6.85 0.25 0.34 0.24 0.00 SEQID-01123 0.02 0.05 0.04 0.08 0.06
0.02 0.02 0.07 -16.39 0.59 0.00 7.14 0.21 0.35 0.20 0.21
SEQID-01124 0.02 0.04 0.03 0.04 0.05 0.01 0.03 0.07 -25.16 0.41
-0.02 5.27 0.87 1.00 0.00 0.21 SEQID-01125 0.00 0.10 0.05 0.06 0.03
0.01 0.04 0.07 -21.91 0.46 -0.05 4.62 0.22 0.55 0.20 0.22
SEQID-01126 0.02 0.04 0.05 0.06 0.06 0.00 0.04 0.08 -18.33 0.49
-0.01 6.05 0.21 0.33 0.20 0.22 SEQID-01127 0.02 0.08 0.04 0.05 0.05
0.02 0.04 0.07 -18.52 0.64 -0.02 4.72 1.00 1.00 0.00 1.00
SEQID-01128 0.03 0.03 0.05 0.05 0.05 0.03 0.03 0.09 -16.77 0.56
-0.01 6.25 0.27 0.34 0.20 0.20 SEQID-01129 0.04 0.03 0.05 0.05 0.05
0.03 0.09 0.11 -15.32 0.61 0.00 7.46 0.27 0.34 0.00 0.23
SEQID-01130 0.02 0.04 0.05 0.08 0.04 0.01 0.02 0.09 -17.73 0.58
0.01 8.68 0.23 0.33 0.21 0.22 SEQID-01131 0.05 0.05 0.04 0.05 0.05
0.02 0.04 0.08 -21.19 0.38 -0.01 5.97 0.19 0.33 0.00 0.21
SEQID-01132 0.02 0.04 0.03 0.05 0.04 0.02 0.05 0.08 -19.78 0.43
-0.01 6.20 0.90 0.98 0.20 0.23 SEQID-01133 0.03 0.06 0.04 0.05 0.05
0.01 0.06 0.08 -19.26 0.41 -0.04 4.77 0.81 0.90 0.19 0.22
SEQID-01134 0.05 0.07 0.04 0.05 0.05 0.02 0.05 0.06 -19.53 0.34
-0.05 4.46 0.39 0.55 0.00 0.21 SEQID-01135 0.02 0.05 0.05 0.08 0.05
0.01 0.04 0.07 -16.45 0.48 0.01 8.66 0.21 0.34 0.22 0.22
SEQID-01136 0.03 0.04 0.08 0.03 0.05 0.04 0.03 0.05 -17.04 0.43
-0.03 4.88 0.21 0.31 0.20 0.22 SEQID-01137 0.02 0.04 0.04 0.05 0.05
0.00 0.05 0.07 -18.87 0.48 0.00 6.55 0.21 0.33 0.00 0.22
SEQID-01138 0.05 0.02 0.05 0.05 0.07 0.01 0.03 0.08 -19.52 0.52
0.01 7.63 0.22 0.34 0.00 0.22 SEQID-01139 0.03 0.06 0.02 0.05 0.04
0.01 0.04 0.05 -28.20 0.33 -0.05 4.66 0.67 0.83 0.00 0.20
SEQID-01140 0.03 0.05 0.05 0.04 0.06 0.01 0.03 0.06 -18.65 0.44
-0.02 5.97 0.19 0.32 0.00 0.21 SEQID-01141 0.01 0.01 0.02 0.04 0.16
0.00 0.11 0.03 -18.99 0.11 -0.01 6.80 0.26 0.37 0.23 0.24
SEQID-01142 0.03 0.05 0.03 0.04 0.05 0.01 0.09 0.07 -23.21 0.36
-0.02 5.12 0.71 0.91 0.00 0.20 SEQID-01143 0.03 0.04 0.04 0.04 0.04
0.01 0.04 0.10 -22.76 0.46 0.05 10.21 0.23 0.30 0.00 0.19
SEQID-01144 0.03 0.05 0.05 0.05 0.06 0.00 0.04 0.08 -16.78 0.51
0.00 6.97 0.20 0.33 0.20 0.21 SEQID-01145 0.01 0.05 0.03 0.04 0.05
0.05 0.03 0.13 -17.92 0.55 0.00 6.52 0.69 0.85 0.00 0.23
SEQID-01146 0.07 0.01 0.02 0.04 0.02 0.01 0.01 0.00 -26.27 0.38
-0.01 6.35 0.37 0.39 0.26 0.37 SEQID-01147 0.02 0.06 0.04 0.03 0.06
0.03 0.05 0.06 -20.17 0.37 -0.01 6.40 0.22 0.33 0.00 0.22
SEQID-01148 0.03 0.08 0.05 0.05 0.02 0.01 0.03 0.06 -22.38 0.28
0.13 11.03 0.24 0.29 0.19 0.21 SEQID-01149 0.01 0.06 0.04 0.07 0.09
0.01 0.11 0.06 -11.77 0.89 0.02 9.20 0.45 0.66 0.00 0.26
SEQID-01150 0.04 0.03 0.04 0.03 0.06 0.03 0.04 0.07 -19.34 0.53
-0.01 6.04 0.20 0.33 0.21 0.21 SEQID-01151 0.01 0.03 0.02 0.08 0.07
0.06 0.04 0.08 -18.83 0.44 0.01 7.81 0.21 0.30 0.00 0.00
SEQID-01152 0.01 0.07 0.05 0.07 0.04 0.03 0.07 0.05 -17.08 0.48
0.00 7.30 0.51 0.65 0.20 0.51 SEQID-01153 0.04 0.08 0.04 0.07 0.04
0.01 0.04 0.05 -20.47 0.46 -0.02 5.96 0.99 1.00 0.00 0.22
SEQID-01154 0.01 0.07 0.06 0.07 0.07 0.02 0.03 0.07 -11.40 0.52
0.02 7.89 0.40 0.52 0.00 0.32 SEQID-01155 0.03 0.06 0.04 0.08 0.04
0.01 0.04 0.06 -18.29 0.46 0.00 7.32 0.21 0.33 0.00 0.22
SEQID-01156 0.01 0.06 0.05 0.05 0.05 0.02 0.05 0.08 -16.00 0.53
-0.01 6.03 0.20 0.32 0.18 0.21 SEQID-01157 0.02 0.04 0.04 0.10 0.12
0.01 0.10 0.04 -11.42 0.75 0.02 8.90 0.28 0.66 0.21 0.24
SEQID-01158 0.03 0.05 0.04 0.03 0.05 0.01 0.04 0.06 -23.09 0.36
0.11 10.94 0.20 0.32 0.00 0.00 SEQID-01159 0.01 0.03 0.04 0.04 0.03
0.05 0.01 0.08 -28.74 0.19 -0.01 6.52 0.51 0.68 0.00 0.22
SEQID-01160 0.02 0.07 0.06 0.05 0.03 0.05 0.05 0.06 -18.96 0.36
-0.02 5.68 0.34 0.48 0.00 0.20 SEQID-01161 0.04 0.03 0.03 0.05 0.05
0.01 0.05 0.09 -19.80 0.48 0.00 7.21 0.21 0.29 0.00 0.23
SEQID-01162 0.02 0.04 0.04 0.03 0.04 0.01 0.03 0.04 -21.52 0.39
-0.03 6.47 0.21 0.34 0.00 0.21 SEQID-01163 0.03 0.04 0.03 0.07 0.04
0.01 0.06 0.04 -25.01 0.32 -0.07 4.39 0.23 0.32 0.00 0.00
SEQID-01164 0.02 0.06 0.05 0.05 0.04 0.00 0.03 0.06 -24.61 0.35
-0.03 4.86 0.19 0.33 0.00 0.20 SEQID-01165 0.01 0.06 0.08 0.04 0.03
0.01 0.04 0.08 -23.84 0.38 0.12 10.90 0.00 0.31 0.00 0.23
SEQID-01166 0.02 0.07 0.04 0.06 0.05 0.01 0.05 0.07 -19.45 0.42
-0.02 5.20 0.20 0.34 0.00 0.22 SEQID-01167 0.04 0.05 0.05 0.03 0.04
0.04 0.05 0.06 -23.34 0.35 -0.02 5.84 0.21 0.31 0.19 0.22
SEQID-01168 0.02 0.05 0.03 0.04 0.03 0.02 0.02 0.04 -32.07 0.35
-0.03 5.18 0.22 0.50 0.00 0.21 SEQID-01169 0.04 0.08 0.05 0.04 0.07
0.00 0.02 0.11 -24.06 0.34 0.04 10.06 0.23 0.31 0.00 0.20
SEQID-01170 0.02 0.10 0.06 0.06 0.03 0.03 0.00 0.09 -26.89 0.25
-0.01 5.88 0.71 0.83 0.00 0.22 SEQID-01171 0.03 0.04 0.02 0.03 0.01
0.02 0.03 0.10 -28.78 0.34 0.14 11.14 0.26 0.34 0.23 0.23
SEQID-01172 0.03 0.06 0.04 0.04 0.05 0.02 0.06 0.07 -19.93 0.37
0.01 7.90 0.21 0.33 0.00 0.22 SEQID-01173 0.06 0.04 0.04 0.07 0.04
0.01 0.04 0.09 -17.74 0.54 0.00 7.20 0.19 0.32 0.00 0.23
SEQID-01174 0.02 0.04 0.03 0.02 0.02 0.01 0.07 0.05 -26.31 0.28
0.10 10.61 0.24 0.32 0.00 0.00 SEQID-01175 0.02 0.07 0.05 0.06 0.04
0.05 0.04 0.07 -18.65 0.43 0.00 6.981 0.27 0.35 0.25 0.25
SEQID-01176 0.03 0.03 0.05 0.07 0.03 0.03 0.03 0.08 -22.07 0.32
0.11 11.15 0.22 0.33 0.00 0.19 SEQID-01177 0.02 0.05 0.05 0.03 0.04
0.01 0.03 0.08 -19.41 0.37 0.12 11.44 0.00 0.33 0.20 0.25
SEQID-01178 0.02 0.06 0.04 0.05 0.04 0.03 0.05 0.06 -22.03 0.34
-0.02 5.45 0.19 0.34 0.00 0.20 SEQID-01179 0.02 0.06 0.04 0.06 0.04
0.02 0.02 0.06 -19.17 0.54 -0.02 5.11 0.20 0.35 0.00 0.23
SEQID-01180 0.01 0.04 0.04 0.09 0.05 0.02 0.05 0.07 -19.10 0.38
0.00 6.53 0.22 0.34 0.21 0.21 SEQID-01181 0.01 0.05 0.04 0.10 0.05
0.02 0.04 0.07 -15.33 0.56 0.01 7.73 0.21 0.33 0.00 0.23
SEQID-01182 0.04 0.05 0.05 0.05 0.06 0.03 0.05 0.04 -23.47 0.27
-0.01 6.04 0.21 0.31 0.00 0.20 SEQID-01183 0.01 0.05 0.06 0.04 0.04
0.05 0.06 0.04 -29.60 0.23 -0.11 4.19 0.37 0.55 0.00 0.22
SEQID-01184 0.02 0.04 0.06 0.06 0.06 0.01 0.06 0.09 -11.24 1.01
0.03 9.70 0.72 0.88 0.00 0.26 SEQID-01185 0.03 0.07 0.05 0.06 0.04
0.03 0.00 0.09 -25.30 0.28 0.00 6.382 0.73 0.84 0.00 0.21
SEQID-01186 0.02 0.06 0.04 0.03 0.07 0.02 0.02 0.08 -22.51 0.39
0.09 11.06 0.20 0.33 0.00 0.25 SEQID-01187 0.04 0.06 0.03 0.04 0.06
0.01 0.04 0.08 -20.50 0.45 -0.02 5.09 0.21 0.33 0.00 0.00
SEQID-01188 0.02 0.05 0.03 0.03 0.06 0.02 0.05 0.08 -24.54 0.31
0.12 10.75 0.68 0.79 0.00 0.00 SEQID-01189 0.01 0.07 0.06 0.07 0.03
0.04 0.08 0.06 -18.06 0.47 -0.03 5.52 0.43 0.61 0.21 0.21
SEQID-01190 0.02 0.04 0.03 0.03 0.04 0.00 0.09 0.06 -27.23 0.36
0.04 9.73 0.19 0.31 0.00 0.00 SEQID-01191 0.02 0.07 0.06 0.06 0.06
0.02 0.07 0.08 -11.49 1.06 0.03 9.41 0.37 0.50 0.23 0.27
SEQID-01192 0.01 0.07 0.04 0.06 0.06 0.03 0.06 0.08 -20.15 0.37
0.01 8.19 0.17 0.32 0.00 0.00 SEQID-01193 0.02 0.07 0.04 0.05 0.06
0.01 0.04 0.04 -21.17 0.30 0.17 11.45 0.23 0.31 0.20 0.22
SEQID-01194 0.04 0.05 0.02 0.06 0.05 0.06 0.04 0.05 -21.04 0.43
-0.03 5.03 0.00 0.32 0.00 0.21 SEQID-01195 0.04 0.06 0.02 0.04 0.02
0.01 0.06 0.10 -21.65 0.54 0.07 10.46 0.00 0.31 0.24 0.24
SEQID-01196 0.01 0.07 0.06 0.07 0.04 0.03 0.04 0.09 -15.53 0.59
0.01 8.47 0.47 0.64 0.18 0.47 SEQID-01197 0.01 0.04 0.04 0.06 0.04
0.01 0.04 0.05 -24.61 0.22 0.12 10.98 0.21 0.30 0.00 0.21
SEQID-01198 0.03 0.06 0.02 0.05 0.03 0.01 0.06 0.08 -23.27 0.36
0.08 10.54 0.21 0.32 0.00 0.25 SEQID-01199 0.01 0.09 0.03 0.05 0.04
0.01 0.05 0.06 -20.99 0.33 0.00 7.18 0.23 0.32 0.25 0.25
SEQID-01200 0.03 0.04 0.04 0.05 0.05 0.02 0.03 0.07 -25.01 0.35
-0.07 4.28 0.37 0.58 0.00 0.00 SEQID-01201 0.04 0.04 0.01 0.03 0.04
0.02 0.03 0.07 -25.72 0.31 0.13 11.26 0.25 0.31 0.22 0.21
SEQID-01202 0.05 0.07 0.03 0.04 0.05 0.04 0.05 0.08 -17.45 0.56
0.00 6.68 0.00 0.33 0.00 0.20 SEQID-01203 0.03 0.05 0.03 0.05 0.06
0.02 0.07 0.07 -19.45 0.37 -0.01 5.34 0.22 0.33 0.00 0.21
SEQID-01204 0.03 0.03 0.03 0.07 0.05 0.01 0.09 0.12 -27.72 0.21
0.16 11.65 0.24 0.29 0.00 0.23 SEQID-01205 0.03 0.03 0.03 0.06 0.07
0.01 0.07 0.04 -20.53 0.39 0.03 9.09 0.22 0.32 0.00 0.00
SEQID-01206 0.02 0.05 0.01 0.06 0.04 0.01 0.03 0.08 -24.54 0.33
0.05 10.05 0.00 0.31 0.00 0.24 SEQID-01207 0.02 0.07 0.07 0.08 0.09
0.01 0.04 0.07 -12.03 0.56 0.02 8.63 0.39 0.57 0.19 0.22
SEQID-01208 0.02 0.05 0.05 0.06 0.04 0.02 0.04 0.08 -21.37 0.38
0.00 6.41 0.19 0.33 0.00 0.21 SEQID-01209 0.02 0.06 0.08 0.07 0.04
0.04 0.05 0.06 -18.32 0.37 -0.03 5.77 0.21 0.34 0.00 0.22
SEQID-01210 0.04 0.02 0.02 0.04 0.05 0.00 0.02 0.09 -21.67 0.55
-0.01 6.45 0.21 0.34 0.00 0.21 SEQID-01211 0.02 0.12 0.02 0.03 0.04
0.00 0.00 0.05 -21.54 0.57 0.11 9.35 0.28 0.26 0.32 0.29
SEQID-01212 0.03 0.04 0.05 0.06 0.05 0.00 0.04 0.10 -16.48 0.54
0.01 8.30 0.53 0.74 0.00 0.23 SEQID-01213 0.03 0.05 0.07 0.04 0.06
0.02 0.04 0.06 -21.02 0.30 0.00 6.94 0.71 0.81 0.00 0.22
SEQID-01214 0.02 0.06 0.04 0.02 0.07 0.01 0.09 0.08 -22.28 0.35
-0.01 5.81 0.78 0.88 0.00 0.21 SEQID-01215 0.02 0.05 0.04 0.06 0.08
0.01 0.03 0.08 -20.11 0.52 0.00 7.40 0.21 0.31 0.00 0.21
SEQID-01216 0.03 0.04 0.04 0.06 0.05 0.01 0.02 0.09 -18.22 0.67
0.00 6.95 0.21 0.36 0.20 0.22 SEQID-01217 0.02 0.06 0.02 0.07 0.04
0.02 0.04 0.05 -28.13 0.27 -0.05 4.64 0.43 0.69 0.00 0.20
SEQID-01218 0.04 0.08 0.05 0.11 0.09 0.01 0.02 0.07 -13.96 0.43
0.03 9.02 0.20 0.96 0.00 0.21 SEQID-01219 0.05 0.02 0.03 0.07 0.08
0.02 0.02 0.09 -19.87 0.53 -0.01 6.56 0.20 0.37 0.17 0.00
SEQID-01220 0.03 0.06 0.05 0.04 0.05 0.03 0.04 0.08 -18.51 0.48
0.00 7.07 0.21 0.34 0.00 0.20 SEQID-01221 0.01 0.04 0.03 0.05 0.04
0.01 0.03 0.05 -27.59 0.24 0.16 11.39 0.21 0.34 0.22 0.00
SEQID-01222 0.03 0.04 0.04 0.05 0.07 0.00 0.01 0.06 -23.57 0.34
0.09 11.50 0.22 0.29 0.18 0.22 SEQID-01223 0.03 0.04 0.04 0.07 0.04
0.02 0.06 0.06 -21.05 0.28 0.10 10.83 0.22 0.28 0.00 0.20
SEQID-01224 0.05 0.05 0.03 0.05 0.02 0.02 0.03 0.07 -22.77 0.40
0.09 10.51 0.22 0.30 0.00 0.21 SEQID-01225 0.01 0.01 0.07 0.03 0.03
0.00 0.04 0.08 -21.61 0.44 0.15 11.36 0.26 0.30 0.00 0.27
SEQID-01226 0.02 0.07 0.04 0.05 0.04 0.01 0.02 0.09 -20.11 0.58
-0.02 5.28 0.40 0.48 0.24 0.00 SEQID-01227 0.05 0.07 0.08 0.04 0.03
0.00 0.09 0.06 -22.82 0.40 0.10 11.11 0.00 0.29 0.00 0.23
SEQID-01228 0.07 0.04 0.03 0.05 0.02 0.00 0.06 0.08 -18.17 0.45
-0.02 6.08 0.26 0.30 0.24 0.24 SEQID-01229 0.03 0.01 0.05 0.04 0.07
0.01 0.02 0.09 -24.32 0.28 0.06 10.25 0.21 0.33 0.00 0.24
SEQID-01230 0.02 0.05 0.04 0.04 0.04 0.00 0.05 0.09 -27.23 0.33
0.07 10.42 0.20 0.32 0.00 0.22 SEQID-01231 0.01 0.06 0.04 0.03 0.02
0.00 0.06 0.06 -21.84 0.51 0.12
10.79 0.23 0.32 0.00 0.00 SEQID-01232 0.03 0.05 0.06 0.04 0.06 0.01
0.04 0.06 -20.35 0.32 0.01 8.31 0.20 0.32 0.00 0.22 SEQID-01233
0.03 0.05 0.02 0.04 0.05 0.02 0.03 0.07 -25.82 0.25 0.08 10.50 0.20
0.30 0.00 0.00 SEQID-01234 0.02 0.02 0.06 0.05 0.05 0.01 0.00 0.11
-23.74 0.48 0.03 9.63 0.20 0.32 0.00 0.25 SEQID-01235 0.02 0.10
0.10 0.03 0.03 0.02 0.07 0.02 -20.74 0.19 0.05 10.10 0.29 0.45 0.00
0.29 SEQID-01236 0.02 0.03 0.05 0.07 0.05 0.03 0.05 0.07 -16.99
0.43 0.00 6.77 0.22 0.34 0.00 0.21 SEQID-01237 0.01 0.06 0.06 0.05
0.02 0.04 0.05 0.04 -26.99 0.40 -0.06 4.51 0.41 0.71 0.00 0.22
SEQID-01238 0.03 0.04 0.04 0.06 0.05 0.02 0.05 0.07 -20.81 0.36
0.00 7.00 0.22 0.31 0.22 0.22 SEQID-01239 0.06 0.04 0.05 0.04 0.08
0.01 0.02 0.08 -9.86 0.97 0.02 8.55 0.42 0.55 0.00 0.23 SEQID-01240
0.03 0.04 0.03 0.06 0.06 0.02 0.07 0.09 -15.50 0.47 -0.02 5.23 0.22
0.35 0.00 0.23 SEQID-01241 0.03 0.05 0.04 0.05 0.05 0.01 0.06 0.07
-19.27 0.43 0.00 6.91 0.20 0.31 0.19 0.20 SEQID-01242 0.02 0.07
0.07 0.09 0.07 0.01 0.06 0.08 -12.30 0.51 0.01 8.06 0.37 0.55 0.00
0.22 SEQID-01243 0.04 0.05 0.05 0.05 0.06 0.02 0.06 0.07 -19.43
0.38 -0.02 5.16 0.21 0.33 0.00 0.21 SEQID-01244 0.01 0.06 0.08 0.06
0.05 0.03 0.04 0.06 -16.02 0.43 -0.01 6.23 0.22 0.34 0.22 0.23
SEQID-01245 0.01 0.04 0.02 0.06 0.09 0.02 0.03 0.04 -16.05 0.52
0.00 6.94 0.23 0.32 0.00 0.24 SEQID-01246 0.00 0.08 0.02 0.05 0.02
0.02 0.09 0.05 -27.51 0.35 0.05 10.27 0.21 0.34 0.00 0.19
SEQID-01247 0.02 0.01 0.01 0.04 0.07 0.00 0.06 0.05 -31.20 0.10
0.00 6.28 0.22 0.36 0.23 0.22 SEQID-01248 0.01 0.06 0.07 0.06 0.04
0.03 0.04 0.10 -19.05 0.58 -0.01 6.40 0.29 0.39 0.00 0.22
SEQID-01249 0.03 0.05 0.04 0.11 0.04 0.02 0.04 0.06 -16.73 0.49
0.01 9.15 0.23 0.32 0.00 0.21 SEQID-01250 0.04 0.09 0.03 0.06 0.03
0.00 0.01 0.07 -25.26 0.42 -0.08 4.21 0.27 0.36 0.24 0.26
SEQID-01251 0.02 0.07 0.04 0.05 0.05 0.02 0.04 0.07 -18.30 0.43
0.00 7.16 0.51 0.78 0.20 0.23 SEQID-01252 0.03 0.04 0.03 0.04 0.04
0.02 0.06 0.06 -20.96 0.44 -0.01 5.63 0.21 0.33 0.21 0.22
SEQID-01253 0.02 0.07 0.06 0.06 0.05 0.04 0.09 0.05 -14.18 0.42
-0.03 4.68 0.36 0.59 0.00 0.18 SEQID-01254 0.02 0.01 0.05 0.07 0.11
0.00 0.03 0.04 -20.46 0.18 0.03 9.81 0.35 0.57 0.22 0.25
SEQID-01255 0.03 0.06 0.05 0.03 0.04 0.04 0.08 0.07 -18.03 0.39
-0.02 5.40 0.20 0.32 0.00 0.19 SEQID-01256 0.01 0.06 0.04 0.05 0.04
0.01 0.03 0.08 -21.42 0.48 0.00 7.81 0.22 0.34 0.20 0.20
SEQID-01257 0.03 0.04 0.03 0.06 0.07 0.02 0.05 0.10 -19.33 0.45
0.00 6.96 0.87 0.90 0.00 0.22 SEQID-01258 0.03 0.04 0.04 0.04 0.07
0.00 0.04 0.09 -20.05 0.47 0.00 7.78 0.21 0.31 0.19 0.21
SEQID-01259 0.03 0.05 0.03 0.06 0.06 0.02 0.05 0.10 -19.34 0.46
0.00 6.96 0.67 0.90 0.23 0.00 SEQID-01260 0.02 0.06 0.04 0.05 0.07
0.00 0.02 0.06 -22.84 0.34 -0.03 4.73 0.76 0.93 0.19 0.21
SEQID-01261 0.03 0.04 0.04 0.06 0.07 0.02 0.05 0.10 -19.20 0.47
0.01 8.57 0.67 0.90 0.00 0.00 SEQID-01262 0.02 0.06 0.04 0.05 0.07
0.00 0.02 0.06 -22.96 0.34 -0.03 4.68 0.77 0.93 0.19 0.21
SEQID-01263 0.00 0.06 0.03 0.05 0.05 0.02 0.04 0.10 -20.31 0.47
-0.01 5.81 0.50 0.60 0.00 0.23 SEQID-01264 0.02 0.05 0.04 0.04 0.06
0.02 0.03 0.09 -21.72 0.43 0.03 9.58 0.22 0.34 0.00 0.21
SEQID-01265 0.03 0.06 0.04 0.04 0.07 0.02 0.05 0.06 -16.92 0.48
-0.01 6.11 0.21 0.33 0.00 0.22 SEQID-01266 0.02 0.03 0.02 0.06 0.02
0.00 0.06 0.06 -29.53 0.07 -0.03 5.00 0.29 0.33 0.00 0.26
SEQID-01267 0.03 0.06 0.04 0.04 0.05 0.01 0.06 0.06 -20.53 0.36
-0.03 5.59 0.21 0.31 0.00 0.21 SEQID-01268 0.01 0.07 0.04 0.05 0.05
0.02 0.05 0.07 -21.13 0.39 -0.01 6.41 0.47 0.79 0.00 0.20
SEQID-01269 0.02 0.04 0.03 0.04 0.04 0.00 0.04 0.05 -24.71 0.37
-0.02 5.10 0.19 0.35 0.35 0.20 SEQID-01270 0.02 0.06 0.03 0.05 0.05
0.01 0.04 0.05 -27.58 0.30 -0.06 4.48 0.76 0.89 0.00 0.20
SEQID-01271 0.03 0.06 0.04 0.04 0.05 0.02 0.03 0.09 -21.10 0.46
-0.01 6.23 0.19 0.32 0.00 0.20 SEQID-01272 0.02 0.02 0.05 0.11 0.09
0.00 0.05 0.04 -22.42 0.06 -0.02 6.36 0.18 0.34 0.19 0.20
SEQID-01273 0.02 0.02 0.02 0.09 0.05 0.01 0.06 0.04 -23.40 0.25
-0.05 4.54 0.21 0.37 0.00 0.00 SEQID-01274 0.02 0.06 0.03 0.05 0.05
0.01 0.04 0.05 -27.83 0.30 -0.05 4.54 0.75 0.89 0.00 0.21
SEQID-01275 0.01 0.05 0.02 0.05 0.07 0.01 0.06 0.01 -25.21 0.03
-0.07 4.34 0.27 0.33 0.23 0.22 SEQID-01276 0.02 0.06 0.04 0.06 0.05
0.02 0.05 0.07 -18.75 0.39 0.00 6.72 0.54 0.69 0.18 0.22
SEQID-01277 0.01 0.03 0.06 0.05 0.03 0.03 0.05 0.06 -22.75 0.33
0.02 9.34 0.20 0.38 0.00 0.00 SEQID-01278 0.02 0.05 0.03 0.04 0.06
0.03 0.04 0.08 -23.46 0.33 0.11 10.96 0.76 0.36 0.00 0.16
SEQID-01279 0.01 0.08 0.04 0.05 0.05 0.02 0.07 0.07 -17.43 0.40
-0.01 6.41 0.22 0.33 0.22 0.22 SEQID-01280 0.03 0.05 0.04 0.05 0.07
0.01 0.04 0.06 -20.24 0.42 -0.02 6.13 0.22 0.33 0.00 0.21
SEQID-01281 0.02 0.09 0.04 0.06 0.05 0.05 0.06 0.03 -23.17 0.27
-0.02 5.44 0.21 0.33 0.00 0.20 SEQID-01282 0.02 0.03 0.04 0.06 0.04
0.01 0.05 0.06 -25.53 0.22 -0.08 4.34 0.21 0.35 0.00 0.21
SEQID-01283 0.01 0.04 0.03 0.06 0.05 0.01 0.04 0.07 -18.54 0.48
0.01 9.50 0.22 0.36 0.21 0.22 SEQID-01284 0.02 0.06 0.03 0.06 0.07
0.00 0.02 0.08 -21.88 0.41 -0.02 5.08 0.59 0.81 0.00 0.21
SEQID-01285 0.01 0.01 0.00 0.05 0.03 0.02 0.01 0.03 -37.09 0.07
-0.12 4.28 0.28 0.40 0.27 0.25 SEQID-01286 0.05 0.05 0.04 0.06 0.05
0.02 0.05 0.06 -19.01 0.47 -0.02 5.43 0.20 0.30 0.00 0.20
SEQID-01287 0.02 0.08 0.03 0.05 0.07 0.03 0.04 0.06 -17.74 0.39
-0.01 6.43 0.20 0.34 0.00 0.20 SEQID-01288 0.02 0.06 0.03 0.05 0.08
0.00 0.03 0.05 -22.82 0.33 -0.03 4.79 0.74 0.93 0.21 0.21
SEQID-01289 0.02 0.05 0.05 0.04 0.06 0.02 0.04 0.05 -20.52 0.37
0.01 8.25 0.19 0.33 0.00 0.21 SEQID-01290 0.03 0.05 0.04 0.06 0.05
0.02 0.06 0.07 -20.89 0.37 -0.01 6.05 0.20 0.33 0.20 0.19
SEQID-01291 0.02 0.03 0.04 0.05 0.06 0.00 0.02 0.08 -21.70 0.46
-0.02 4.95 0.21 0.32 0.20 0.22 SEQID-01292 0.03 0.05 0.04 0.04 0.07
0.02 0.05 0.07 -17.32 0.48 -0.01 6.40 0.20 0.32 0.00 0.21
SEQID-01293 0.01 0.08 0.05 0.05 0.05 0.02 0.08 0.06 -20.30 0.23
-0.01 6.51 0.30 0.50 0.00 0.21 SEQID-01294 0.02 0.05 0.03 0.05 0.04
0.03 0.04 0.08 -18.83 0.47 -0.03 5.16 0.21 0.31 0.00 0.21
SEQID-01295 0.03 0.05 0.05 0.04 0.05 0.01 0.05 0.05 -21.84 0.41
-0.02 5.10 0.21 0.33 0.00 0.22 SEQID-01296 0.03 0.04 0.04 0.06 0.06
0.02 0.05 0.06 -18.84 0.41 0.00 6.65 0.20 0.32 0.00 0.20
SEQID-01297 0.01 0.05 0.04 0.02 0.05 0.01 0.05 0.08 -23.48 0.33
0.09 10.73 0.19 0.33 0.00 0.00 SEQID-01298 0.01 0.03 0.04 0.07 0.04
0.01 0.05 0.03 -26.76 0.21 -0.09 4.26 0.22 0.33 0.00 0.24
SEQID-01299 0.02 0.05 0.04 0.04 0.07 0.00 0.03 0.08 -18.91 0.51
-0.01 5.41 0.22 0.35 0.20 0.22 SEQID-01300 0.02 0.05 0.03 0.06 0.06
0.02 0.03 0.07 -20.35 0.44 -0.01 6.35 0.19 0.34 0.19 0.20
SEQID-01301 0.03 0.05 0.04 0.05 0.05 0.02 0.03 0.06 -22.18 0.42
-0.01 5.91 0.20 0.34 0.19 0.19 SEQID-01302 0.03 0.05 0.04 0.04 0.05
0.01 0.04 0.08 -20.21 0.40 -0.01 6.15 0.19 0.33 0.20 0.20
SEQID-01303 0.06 0.05 0.03 0.07 0.06 0.00 0.02 0.06 -23.96 0.40
-0.06 4.56 0.26 0.29 0.00 0.00 SEQID-01304 0.02 0.06 0.04 0.04 0.02
0.01 0.06 0.06 -24.23 0.28 0.10 10.63 0.23 0.32 0.00 0.00
SEQID-01305 0.02 0.03 0.04 0.06 0.04 0.03 0.06 0.09 -16.90 0.51
0.00 6.73 0.73 0.30 0.00 0.21 SEQID-01306 0.04 0.06 0.03 0.04 0.06
0.00 0.04 0.07 -21.66 0.45 -0.03 4.75 0.22 0.31 0.00 0.19
SEQID-01307 0.01 0.02 0.00 0.21 0.00 0.00 0.15 0.01 -21.89 0.01
-0.06 4.06 0.23 0.43 0.23 0.26 SEQID-01308 0.01 0.06 0.04 0.09 0.08
0.03 0.05 0.06 -20.01 0.29 -0.03 5.00 0.21 0.33 0.00 0.22
SEQID-01309 0.02 0.05 0.03 0.05 0.05 0.00 0.04 0.07 -21.77 0.36
-0.01 6.25 0.22 0.34 0.20 0.21 SEQID-01310 0.02 0.05 0.03 0.07 0.04
0.02 0.06 0.07 -18.68 0.38 -0.01 5.39 0.22 0.33 0.22 0.22
SEQID-01311 0.03 0.04 0.04 0.05 0.05 0.01 0.07 0.06 -195.91 0.35
0.01 7.47 0.21 0.33 0.00 0.21 SEQID-01312 0.01 0.05 0.04 0.06 0.05
0.02 0.06 0.05 -20.58 0.42 0.01 8.65 0.22 0.34 0.00 0.22
SEQID-01313 0.03 0.06 0.04 0.05 0.04 0.03 0.05 0.05 -19.18 0.46
0.00 6.60 0.21 0.33 0.00 0.22 SEQID-01314 0.01 0.06 0.04 0.05 0.07
0.02 0.05 0.07 -17.18 0.47 -0.01 6.11 0.21 0.33 0.00 0.22
SEQID-01315 0.02 0.06 0.04 0.07 0.05 0.02 0.06 0.06 -19.03 0.36
-0.01 6.05 0.19 0.34 0.00 0.20 SEQID-01316 0.02 0.07 0.05 0.06 0.08
0.02 0.04 0.07 -19.19 0.43 -0.01 5.73 0.18 0.35 0.18 0.19
SEQID-01317 0.01 0.07 0.04 0.04 0.07 0.01 0.06 0.09 -19.96 0.34
0.17 11.44 0.23 0.30 0.00 0.22 SEQID-01318 0.01 0.07 0.06 0.06 0.03
0.02 0.05 0.07 -23.65 0.27 -0.02 5.15 0.00 0.45 0.00 0.00
SEQID-01319 0.02 0.04 0.03 0.03 0.06 0.01 0.02 0.09 -22.45 0.39
0.01 9.04 0.22 0.31 0.00 0.00 SEQID-01320 0.01 0.08 0.03 0.06 0.04
0.01 0.01 0.05 -29.34 0.21 -0.07 4.40 0.22 0.32 0.00 0.00
SEQID-01321 0.02 0.06 0.02 0.05 0.06 0.01 0.01 0.08 -24.62 0.30
0.08 10.75 0.24 0.32 0.00 0.00 SEQID-01322 0.02 0.06 0.02 0.05 0.06
0.01 0.01 0.09 -24.64 0.30 0.08 10.78 0.00 0.30 0.00 0.00
SEQID-01323 0.03 0.04 0.02 0.07 0.07 0.06 0.03 0.07 -17.42 0.43
-0.01 6.16 0.22 0.36 0.21 0.00 SEQID-01324 0.01 0.06 0.03 0.06 0.06
0.01 0.05 0.07 -22.79 0.46 0.00 6.33 0.20 0.30 0.21 0.20
SEQID-01325 0.02 0.05 0.03 0.06 0.07 0.00 0.02 0.08 -21.39 0.39
-0.01 5.24 0.49 0.78 0.00 0.22 SEQID-01326 0.02 0.05 0.03 0.06 0.05
0.04 0.05 0.06 -21.70 0.31 0.01 8.29 0.19 0.33 0.00 0.20
SEQID-01327 0.01 0.05 0.04 0.04 0.04 0.01 0.04 0.08 -24.49 0.38
0.11 10.81 0.22 0.33 0.00 0.27 SEQID-01328 0.01 0.04 0.06 0.04 0.07
0.02 0.02 0.08 -18.01 0.47 0.08 11.13 0.22 0.33 0.19 0.20
SEQID-01329 0.03 0.04 0.04 0.03 0.05 0.00 0.04 0.09 -22.67 0.45
0.03 9.94 0.23 0.34 0.00 0.00 SEQID-01330 0.02 0.07 0.04 0.06 0.04
0.01 0.04 0.10 -19.25 0.55 -0.05 4.46 0.00 0.45 0.00 0.21
SEQID-01331 0.01 0.05 0.05 0.06 0.04 0.02 0.06 0.07 -19.89 0.43
-0.01 6.52 0.20 0.34 0.00 0.21 SEQID-01332 0.01 0.00 0.02 0.07 0.02
0.02 0.08 0.07 -23.86 0.20 -0.01 5.85 0.27 0.29 0.00 0.26
SEQID-01333 0.01 0.09 0.04 0.04 0.04 0.01 0.04 0.11 -24.55 0.35
0.16 11.08 0.22 0.31 0.25 0.00 SEQID-01334 0.05 0.07 0.03 0.03 0.04
0.02 0.06 0.08 -24.22 0.34 -0.09 4.17 0.56 0.61 0.00 0.00
SEQID-01335 0.01 0.05 0.04 0.02 0.04 0.01 0.02 0.06 -25.90 0.30
0.14 11.76 0.23 0.31 0.00 0.26 SEQID-01336 0.01 0.03 0.04 0.06 0.07
0.03 0.09 0.09 -18.37 0.41 0.10 11.33 0.20 0.33 0.00 0.21
SEQID-01337 0.03 0.05 0.03 0.04 0.07 0.02 0.06 0.06 -22.66 0.39
-0.01 6.08 0.22 0.32 0.00 0.21 SEQID-01338 0.03 0.05 0.05 0.05 0.05
0.00 0.05 0.05 -22.25 0.33 -0.04 4.69 0.21 0.32 0.18 0.21
SEQID-01339 0.03 0.05 0.05 0.06 0.06 0.02 0.06 0.05 -18.50 0.38
-0.01 6.31 0.20 0.31 0.20 0.21 SEQID-01340 0.02 0.07 0.04 0.05 0.05
0.02 0.07 0.05 -20.27 0.36 0.00 6.59 0.23 0.35 0.19 0.22
SEQID-01341 0.02 0.06 0.05 0.07 0.05 0.02 0.06 0.06 -17.18 0.38
0.00 7.01 0.20 0.33 0.19 0.21 SEQID-01342 0.01 0.06 0.04 0.06 0.04
0.00 0.06 0.09 -21.26 0.41 0.12 10.91 0.21 0.29 0.19 0.00
SEQID-01343 0.01 0.03 0.02 0.04 0.06 0.00 0.06 0.07 -25.42 0.31
0.13 10.52 0.23 0.35 0.23 0.27 SEQID-01344 0.03 0.07 0.03 0.05 0.04
0.02 0.07 0.07 -23.79 0.20 0.13 10.92 0.00 0.31 0.00 0.22
SEQID-01345 0.01 0.07 0.05 0.03 0.06 0.03 0.04 0.08 -19.47 0.58
-0.03 4.77 0.29 0.37 0.00 0.24 SEQID-01346 0.01 0.03 0.04 0.05 0.04
0.01 0.04 0.07 -20.01 0.36 0.12 11.68 0.23 0.34 0.22 0.00
SEQID-01347 0.01 0.04 0.06 0.03 0.05 0.03 0.04 0.08 -20.44 0.47
-0.06 4.40 0.00 0.33 0.00 0.00 SEQID-01348 0.01 0.06 0.04 0.08 0.07
0.01 0.04 0.09 -18.50 0.53 0.00 7.71 0.22 0.32 0.00 0.00
SEQID-01349 0.02 0.05 0.05 0.04 0.04 0.01 0.05 0.07 -20.33 0.50
-0.01 6.12 0.23 0.36 0.00 0.22 SEQID-01350 0.02 0.05 0.04 0.05 0.06
0.02 0.06 0.06 -21.78 0.39 -0.03 4.98 0.23 0.31 0.00 0.21
SEQID-01351 0.02 0.05 0.04 0.04 0.08 0.03 0.07 0.05 -20.92 0.30
0.02 9.42 0.22 0.31 0.00 0.22 SEQID-01352 0.01 0.06 0.05 0.03 0.04
0.03 0.07 0.05 -20.99 0.27 -0.01 6.53 0.22 0.31 0.00 0.21
SEQID-01353 0.03 0.05 0.03 0.04 0.04 0.02 0.04 0.07 -18.95 0.51
-0.02 6.20 0.22 0.36 0.00 0.21 SEQID-01354 0.02 0.06 0.03 0.06 0.05
0.03 0.06 0.08 -18.88 0.42 -0.02 6.00 0.20 0.32 0.00 0.21
SEQID-01355 0.02 0.08 0.04 0.05 0.03 0.01 0.06 0.07 -22.02 0.40
-0.09 4.13 0.26 0.51 0.00 0.22 SEQID-01356 0.02 0.06 0.04 0.04 0.04
0.00 0.05 0.05 -25.30 0.31 -0.01 6.53 0.22 0.35 0.20 0.23
SEQID-01357 0.03 0.01 0.01 0.04 0.05 0.02 0.00 0.15 -22.84 0.58
-0.07 4.39 0.23 0.31 0.00 0.24 SEQID-01358 0.02 0.10 0.06 0.05 0.05
0.01 0.05 0.09 -17.80 0.34 0.01 7.57 0.73 0.90 0.00 0.26
SEQID-01359 0.01 0.01 0.01 0.04 0.03 0.02 0.03 0.06 -28.98 0.20
0.18 11.91 0.25 0.31 0.00 0.22 SEQID-01360 0.01 0.05 0.02 0.07 0.05
0.02 0.04 0.04 -24.31 0.18 0.14 11.33 0.18 0.29 0.00 0.21
SEQID-01361 0.01 0.06 0.05 0.05 0.04 0.00 0.02 0.08 -22.96 0.37
0.06 10.53 0.19 0.30 0.00 0.24 SEQID-01362 0.01 0.05 0.04 0.04 0.03
0.01 0.06 0.05 -21.23 0.30 0.10 10.79 0.21 0.33 0.20 0.20
SEQID-01363 0.01 0.04 0.05 0.03 0.05 0.01 0.05 0.07 -22.07 0.39
0.10 10.72 0.23 0.33 0.18 0.00 SEQID-01364 0.01 0.10 0.03 0.04 0.05
0.01 0.05 0.05 -23.63 0.37 -0.03 4.88 0.00 0.32 0.00 0.00
SEQID-01365 0.01 0.05 0.06 0.04 0.08 0.03 0.06 0.04 -22.68 0.28
-0.02 5.25 0.18 0.32 0.00 0.00 SEQID-01366 0.04 0.09 0.03 0.06 0.04
0.02 0.06 0.06 -16.35 0.58 0.06 10.33 0.21 0.32 0.00 0.00
SEQID-01367 0.01 0.06 0.03 0.04 0.06 0.01 0.08 0.04 -24.70 0.29
0.00 6.81 0.22 0.33 0.00 0.23 SEQID-01368 0.02 0.05 0.05 0.06 0.05
0.00 0.01 0.08 -19.00 0.47 0.01 8.96 0.58 0.76 0.00 0.18
SEQID-01369 0.00 0.07 0.03 0.07 0.05 0.00 0.06 0.08 -20.78 0.37
0.00 8.30 0.00 0.35 0.00 0.25 SEQID-01370 0.01 0.05 0.04 0.06 0.07
0.01 0.04 0.07 -17.38 0.42 -0.01 6.51 0.23 0.32 0.00 0.00
SEQID-01371 0.02 0.04 0.04 0.06 0.06 0.02 0.07 0.06 -20.40 0.42
-0.02 4.87 0.21 0.34 0.20 0.22 SEQID-01372 0.02 0.06 0.03 0.08 0.05
0.03 0.03 0.07 -17.92 0.37 0.00 7.35 0.21 0.34 0.00 0.23
SEQID-01373 0.03 0.06 0.04 0.05 0.04 0.03 0.05 0.05 -19.21 0.48
0.00 7.32 0.20 0.33 0.21 0.22 SEQID-01374 0.03 0.06 0.04 0.04 0.07
0.01 0.05 0.07 -19.45 0.41 -0.02 5.08 0.49 0.60 0.00 0.22
SEQID-01375 0.02 0.06 0.04 0.06 0.05 0.01 0.03 0.06 -20.98 0.35
0.01 7.50 0.21 0.31 0.20 0.23 SEQID-01376 0.03 0.06 0.04 0.05 0.06
0.02 0.05 0.07 -18.69 0.42 0.01 8.01 0.20 0.32 0.00 0.21
SEQID-01377 0.03 0.05 0.04 0.06 0.05 0.02 0.04 0.06 -20.70 0.39
-0.02 5.11 0.18 0.37 0.18 0.19 SEQID-01378 0.01 0.05 0.04 0.07 0.11
0.00 0.02 0.08 -16.90 0.49 0.08 9.51 0.29 0.29 0.28 0.29
SEQID-01379 0.01 0.07 0.02 0.04 0.03 0.00 0.04 0.10 -26.89 0.28
0.14 11.20 0.24 0.32 0.00 0.21 SEQID-01380 0.03 0.05 0.02 0.05 0.03
0.01 0.04 0.07 -19.88 0.52 0.08 10.55 0.23 0.33 0.20 0.23
SEQID-01381 0.03 0.03 0.03 0.05 0.08 0.00 0.02 0.09 -21.31 0.33
0.08 11.20 0.27 0.33 0.18 0.26 SEQID-01382 0.02 0.06 0.03 0.06 0.04
0.04 0.03 0.08 -22.43 0.32 0.02 9.05 0.23 0.30 0.00 0.00
SEQID-01383 0.03 0.04 0.03 0.04 0.04 0.00 0.07 0.09 -21.66 0.27
0.13 11.00 0.20 0.30 0.00 0.24 SEQID-01384 0.01 0.09 0.07 0.05 0.01
0.01 0.04 0.01 -12.40 0.17 0.01 7.89 0.32 0.46 0.25 0.33
SEQID-01385 0.01 0.05 0.04 0.05 0.03 0.00 0.04 0.05 -27.28 0.27
0.08 10.72 0.23 0.33 0.00 0.00 SEQID-01386 0.04 0.05 0.05 0.07 0.05
0.02 0.03 0.07 -18.11 0.53 0.01 8.21 0.23 0.31 0.20 0.22
SEQID-01387 0.01 0.09 0.03 0.04 0.07 0.01 0.05 0.07 -21.39 0.38
-0.02 5.14 0.62 0.74 0.22 0.00 SEQID-01388 0.00 0.03 0.04 0.06 0.06
0.01 0.02 0.05 -27.26 0.10 0.04 10.39 0.21 0.33 0.00 0.21
SEQID-01389 0.02 0.10 0.05 0.06 0.04 0.02 0.04 0.05 -20.63 0.41
0.02 9.11 0.22 0.31 0.00 0.00 SEQID-01390 0.03 0.05 0.03 0.06 0.05
0.00 0.06 0.06 -23.89 0.37 -0.01 6.33 0.23 0.32 0.00 0.00
SEQID-01391 0.02 0.07 0.04 0.03 0.05 0.02 0.04 0.08 -16.70 0.53
0.01 8.14 0.22 0.33 0.00 0.21 SEQID-01392 0.02 0.04 0.03 0.06 0.04
0.01 0.03 0.09 -17.38 0.54 0.00 7.46 0.22 0.34 0.20 0.21
SEQID-01393 0.02 0.05 0.03 0.06 0.06 0.01 0.08 0.06 -20.13 0.33
0.01 8.32 0.20 0.33 0.22 0.22 SEQID-01394 0.03 0.06 0.04 0.06 0.04
0.03 0.04 0.05 -20.20 0.39 -0.01 6.61 0.20 0.33 0.00 0.20
SEQID-01395 0.01 0.05 0.05 0.06 0.06 0.03 0.06 0.07 -19.55 0.44
-0.01 6.60 0.19 0.34 0.20 0.21 SEQID-01396 0.03 0.04 0.04 0.04 0.04
0.01 0.03 0.07 -23.63 0.38 -0.05 4.56 0.20 0.33 0.00 0.21
SEQID-01397 0.03 0.02 0.02 0.08 0.06 0.01 0.03 0.04 -26.82 0.19
-0.01 6.26 0.19 0.35 0.00 0.20 SEQID-01398 0.02 0.05 0.05 0.09 0.05
0.02 0.04 0.05 -18.87 0.35 -0.01 6.61 0.18 0.35 0.19 0.20
SEQID-01399 0.03 0.05 0.04 0.06 0.05 0.01 0.05 0.08 -19.41 0.45
-0.02 5.60 0.19 0.36 0.18 0.19 SEQID-01400 0.03 0.06 0.02 0.08 0.04
0.00 0.02 0.03 -29.69 0.09 0.07 10.79 0.27 0.28 0.00 0.31
SEQID-01401 0.03 0.08 0.04 0.03 0.03 0.08 0.05 0.04 -23.31 0.20
-0.04 5.02 0.26 0.26 0.00 0.25 SEQID-01402 0.01 0.06 0.02 0.06 0.07
0.00 0.05 0.07 -22.73 0.35 -0.03 4.74 0.26 0.33 0.25 0.27
SEQID-01403 0.01 0.02 0.03 0.07 0.02 0.00 0.03 0.08 -26.26 0.33
0.14 11.18 0.25 0.31 0.24 0.00 SEQID-01404 0.02 0.02 0.02 0.06 0.05
0.00 0.05 0.06 -26.18 0.28 0.13 11.15 0.24 0.31 0.26 0.00
SEQID-01405 0.02 0.03 0.06 0.05 0.07 0.02 0.05 0.06 -20.21 0.26
0.00 6.92 0.22 0.32 0.00 0.00 SEQID-01406 0.01 0.08 0.04 0.04 0.04
0.00 0.08 0.06 -26.17 0.22 -0.01 5.86 0.25 0.31 0.19 0.25
SEQID-01407 0.04 0.03 0.03 0.05 0.05 0.00 0.06 0.03 -21.91 0.09
0.03 7.88 0.25 0.31 0.28 0.26 SEQID-01408 0.01 0.07 0.02 0.07 0.04
0.01 0.01 0.04 -29.09 0.17 0.22 11.90 0.17 0.33 0.21 0.26
SEQID-01409 0.02 0.05 0.04 0.07 0.06 0.04 0.05 0.10 -17.79 0.45
-0.03 4.78 0.37 0.44 0.00 0.20 SEQID-01410 0.01 0.04 0.02 0.06 0.05
0.02 0.05 0.06 -21.71 0.18 0.13 11.53 0.20 0.32 0.00 0.23
SEQID-01411 0.01 0.06 0.04 0.04 0.06 0.00 0.02 0.08 -21.92 0.43
0.17 12.23 0.21 0.31 0.00 0.25 SEQID-01412 0.02 0.05 0.02 0.03 0.06
0.00 0.05 0.12 -22.05 0.33 0.06 10.34 0.23 0.30 0.00 0.22
SEQID-01413 0.01 0.06 0.03 0.03 0.06 0.04 0.05 0.05 -17.44 0.33
0.01 8.87 0.48 0.35 0.00 0.20 SEQID-01414 0.01 0.05 0.03 0.03 0.04
0.00 0.03 0.07 -27.84 0.28 0.12 11.14 0.20 0.31 0.21 0.00
SEQID-01415 0.02 0.02 0.03 0.11 0.04 0.00 0.04 0.03 -28.18 0.14
-0.06 4.54 0.23 0.33 0.00 0.22 SEQID-01416 0.01 0.06 0.04 0.04 0.04
0.03 0.05 0.05 -20.77 0.35 0.00 7.09 0.21 0.31 0.00 0.18
SEQID-01417 0.03 0.05 0.03 0.07 0.06 0.00 0.04 0.05 -23.05 0.23
-0.04 4.62 0.23 0.33 0.00 0.00 SEQID-01418 0.03 0.04 0.03 0.04 0.08
0.01 0.03 0.06 -19.66 0.40 0.02 9.54 0.00 0.33 0.00 0.22
SEQID-01419 0.02 0.04 0.05 0.04 0.06 0.01 0.04 0.10 -19.31 0.49
-0.01 6.27 0.22 0.32 0.00 0.20 SEQID-01420 0.01 0.05 0.05 0.07 0.08
0.00 0.04 0.07 -16.80 0.45 0.02 9.01 0.00 0.31 0.00 0.21
SEQID-01421 0.03 0.05 0.04 0.05 0.04 0.02 0.02 0.09 -19.36 0.50
-0.01 6.55 0.21 0.33 0.00 0.21 SEQID-01422 0.02 0.05 0.04 0.07 0.07
0.00 0.05 0.05 -20.93 0.40 0.03 9.71 0.22 0.33 0.00 0.19
SEQID-01423 0.01 0.08 0.04 0.05 0.06 0.02 0.08 0.04 -17.98 0.41
-0.05 4.45 0.37 0.54 0.00 0.23 SEQID-01424 0.02 0.07 0.05 0.04 0.03
0.04 0.06 0.06 -22.06 0.41 0.01 8.13 0.21 0.35 0.00 0.21
SEQID-01425 0.02 0.05 0.03 0.06 0.06 0.01 0.05 0.05 -20.51 0.40
-0.01 6.21 0.21 0.33 0.00 0.21 SEQID-01426 0.05 0.05 0.03 0.06 0.06
0.00 0.04 0.06 -17.68 0.46 0.00 7.46 0.21 0.34 0.21 0.21
SEQID-01427 0.03 0.06 0.06 0.04 0.05 0.02 0.04 0.06 -20.62 0.32
0.00 6.77 0.20 0.32 0.20 0.22 SEQID-01428 0.02 0.07 0.04 0.04 0.04
0.01 0.08 0.05 -20.04 0.36 -0.04 4.95 0.21 0.34 0.00 0.21
SEQID-01429 0.02 0.05 0.02 0.09 0.05 0.07 0.06 0.05 -24.14 0.19
0.00 7.83 0.20 0.34 0.00 0.21 SEQID-01430 0.03 0.03 0.04 0.05 0.05
0.01 0.06 0.03 -25.39 0.21 -0.02 5.26 0.20 0.34 0.00 0.21
SEQID-01431 0.03 0.04 0.03 0.05 0.07 0.02 0.05 0.06 -19.82 0.35
0.01 7.53 0.21 0.35 0.00 0.21 SEQID-01432 0.03 0.05 0.05 0.05 0.06
0.01 0.03 0.09 -17.16 0.51 -0.03 4.89 0.19 0.31 0.00 0.20
SEQID-01433 0.02 0.09 0.01 0.05 0.02 0.03 0.05 0.0J -24.24 0.10
0.16 10.56 0.28 0.20 0.34 0.32 SEQID-01434 0.01 0.03 0.01 0.05 0.05
0.00 0.06 0.07 -23.87 0.28 0.18 11.91 0.28 0.32 0.00 0.27
SEQID-01435 0.05 0.07 0.03 0.07 0.04 0.02 0.06 0.11 -18.32 0.50
-0.03 4.54 0.42 0.50 0.00 0.21 SEQID-01436 0.01 0.06 0.08 0.05 0.06
0.02 0.04 0.09 -16.92 0.35 -0.01 5.83 0.26 0.32 0.22 0.33
SEQID-01437 0.04 0.04 0.04 0.09 0.02 0.01 0.05 0.06 -25.69 0.12
0.00 6.81 0.25 0.29 0.00 0.20 SEQID-01438 0.02 0.02 0.03 0.12 0.08
0.00 0.06 0.05 -22.27 0.21 0.11 10.74 0.24 0.29 0.00 0.25
SEQID-01439 0.02 0.01 0.03 0.04 0.07 0.01 0.02 0.10 -23.95 0.29
0.05 10.21 0.25 0.29 0.22 0.00 SEQID-01440 0.02 0.04 0.03 0.05 0.05
0.01 0.03 0.06 -23.29 0.31 0.19 11.79 0.21 0.31 0.00 0.00
SEQID-01441 0.03 0.08 0.01 0.06 0.07 0.01 0.06 0.05 -22.02 0.27
0.01 8.81 0.24 0.29 0.00 0.23 SEQID-01442 0.02 0.03 0.03 0.04 0.05
0.05 0.01 0.10 -20.71 0.50 0.14 11.62 0.23 0.32 0.24 0.23
SEQID-01443 0.02 0.07 0.02 0.09 0.05 0.01 0.07 0.07 -22.98 0.32
-0.03 4.81 0.23 0.30 0.24 0.00 SEQID-01444 0.07 0.06 0.05 0.04 0.05
0.00 0.04 0.07 -20.84 0.29 0.11 11.34 0.00 0.28 0.00 0.20
SEQID-01445 0.01 0.03 0.06 0.05 0.03 0.00 0.02 0.07 -22.28 0.39
0.04 10.10 0.22 0.34 0.24 0.25 SEQID-01446 0.02 0.01 0.00 0.07 0.02
0.02 0.03 0.01 -36.22 0.05 -0.12 4.18 0.32 0.38 0.22 0.27
SEQID-01447 0.03 0.05 0.02 0.04 0.06 0.01 0.04 0.08 -24.87 0.26
0.07 10.55 0.22 0.31 0.00 0.24 SEQID-01448 0.02 0.08 0.03 0.07 0.06
0.03 0.09 0.06 -14.24 0.78 0.02 9.38 0.22 0.30 0.00 0.00
SEQID-01449 0.01 0.06 0.06 0.05 0.08 0.03 0.05 0.06 -17.40 0.41
0.00 6.97 0.20 0.35 0.00 0.20 SEQID-01450 0.03 0.03 0.03 0.07 0.02
0.03 0.02 0.07 -30.33 0.30 -0.12 4.11 0.00 0.31 0.00 0.22
SEQID-01451 0.01 0.06 0.03 0.05 0.04 0.01 0.06 0.08 -22.94 0.32
0.15 11.21 0.00 0.32 0.00 0.00 SEQID-01452 0.02 0.07 0.03 0.06 0.04
0.02 0.02 0.05 -25.66 0.28 -0.11 4.05 0.54 0.78 0.22 0.23
SEQID-01453 0.03 0.03 0.04 0.04 0.08 0.04 0.07 0.08 -23.36 0.37
-0.02 6.23 0.23 0.31 0.20 0.00 SEQID-01454 0.02 0.07 0.05 0.02 0.05
0.02 0.06 0.07 -20.72 0.37 -0.01 6.52 0.21 0.30 0.00 0.00
SEQID-01455 0.00 0.07 0.02 0.05 0.03 0.01 0.01 0.02 -33.66 0.11
-0.13 4.08 0.23 0.32 0.00 0.21 SEQID-01456 0.03 0.04 0.02 0.03 0.04
0.01 0.04 0.08 -20.05 0.44 0.02 9.68 0.21 0.33 0.00 0.00
SEQID-01457 0.01 0.07 0.05 0.03 0.04 0.03 0.05 0.06 -22.23 0.41
-0.01 6.05 0.22 0.33 0.20 0.00 SEQID-01458 0.01 0.05 0.04 0.05 0.08
0.03 0.06 0.06 -23.62 0.34 -0.01 5.74 0.21 0.34 0.00 0.21
SEQID-01459 0.02 0.07 0.04 0.05 0.05 0.01 0.04 0.08 -17.88 0.50
-0.03 4.77 0.21 0.32 0.00 0.21 SEQID-01460 0.03 0.03 0.04 0.05 0.08
0.01 0.03 0.06 -18.90 0.42 0.00 6.94 0.00 0.33 0.00 0.21
SEQID-01461 0.01 0.04 0.05 0.05 0.04 0.01 0.03 0.07 -19.76 0.57
0.00 6.71 0.22 0.34 0.00 0.21 SEQID-01462 0.02 0.06 0.03 0.04 0.07
0.01 0.03 0.08 -19.62 0.49 0.00 6.76 0.29 0.40 0.22 0.23
SEQID-01463 0.04 0.05 0.04 0.04 0.04 0.03 0.08 0.04 -21.36 0.25
-0.01 6.29 0.20 0.30 0.00 0.20 SEQID-01464 0.02 0.05 0.03 0.04 0.05
0.00 0.03 0.08 -20.94 0.43 0.01 8.22 0.22 0.38 0.00 0.21
SEQID-01465 0.03 0.06 0.03 0.05 0.05 0.02 0.03 0.06 -21.35 0.43
-0.01 6.39 0.21 0.31 0.00 0.21 SEQID-01466 0.02 0.08 0.04 0.05 0.06
0.02 0.05 0.07 -19.43 0.41 -0.01 5.42 0.50 0.70 0.18 0.21
SEQID-01467 0.01 0.04 0.03 0.06 0.05 0.01 0.05 0.06 -22.02 0.39
0.00 6.65 0.21 0.35 0.00 0.22 SEQID-01468 0.01 0.04 0.10 0.07 0.03
0.02 0.03 0.06 -27.18 0.16 -0.08 4.31 0.21 0.36 0.19 0.23
SEQID-01469 0.02 0.08 0.04 0.06 0.04 0.05 0.07 0.03 -23.56 0.24
-0.03 5.13 0.21 0.36 0.00 0.20 SEQID-01470 0.01 0.06 0.03 0.07 0.05
0.01 0.03 0.05 -23.15 0.32 -0.02 6.36 0.42 0.89 0.20 0.21
SEQID-01471 0.02 0.04 0.05 0.05 0.06 0.03 0.07 0.08 -19.05 0.43
-0.01 6.67 0.20 0.32 0.00 0.21 SEQID-01472 0.02 0.06 0.05 0.05 0.06
0.02 0.03 0.06 -21.68 0.36 -0.02 5.69 0.20 0.34 0.00 0.21
SEQID-01473 0.02 0.03 0.03 0.04 0.05 0.00 0.03 0.06 -25.57 0.35
0.01 8.24 0.20 0.34 0.43 0.22 SEQID-01474 0.02 0.02 0.03 0.09 0.10
0.03 0.10 0.03 -14.48 0.26 0.06 10.19 0.30 0.23 0.00 0.34
SEQID-01475 0.02 0.05 0.02 0.02 0.06 0.00 0.02 0.10 -27.25 0.28
-0.01 6.80 0.32 0.30 0.00 1.00 SEQID-01476 0.03 0.01 0.00 0.05 0.09
0.02 0.06 0.08 -21.28 0.30 0.19 11.06 0.26 0.29 0.23 0.23
SEQID-01477 0.02 0.03 0.02 0.08 0.08 0.00 0.09 0.08 -17.20 0.58
0.08 10.35 0.25 0.30 0.00 0.23 SEQID-01478 0.02 0.02 0.03 0.02 0.04
0.00 0.05 0.06 -21.71 0.38 -0.05 4.72 0.22 0.30 0.00 0.25
SEQID-01479 0.02 0.00 0.03 0.07 0.03 0.02 0.05 0.05 -24.75 0.38
0.15 11.02 0.22 0.26 0.00 0.24 SEQID-01480 0.04 0.05 0.04 0.06 0.04
0.00 0.04 0.10 -16.44 0.61 -0.03 5.10 0.24 0.36 0.20 0.00
SEQID-01481 0.03 0.05 0.03 0.09 0.04 0.00 0.04 0.08 -22.13 0.30
-0.04 4.57 0.24 0.29 0.24 0.25 SEQID-01482 0.02 0.03 0.05 0.04 0.03
0.01 0.07 0.03 -22.78 0.33 -0.02
5.70 0.24 0.32 0.00 0.00 SEQID-01483 0.02 0.03 0.03 0.05 0.01 0.01
0.06 0.07 -22.48 0.28 0.04 10.12 0.23 0.31 0.27 0.24 SEQID-01484
0.02 0.02 0.04 0.03 0.06 0.00 0.08 0.09 -22.18 0.26 0.13 10.75 0.00
0.31 0.22 0.00 SEQID-01485 0.03 0.02 0.02 0.06 0.04 0.00 0.04 0.05
-27.22 0.22 -0.08 4.33 0.21 0.31 0.22 0.27 SEQID-01486 0.02 0.02
0.04 0.07 0.03 0.02 0.07 0.06 -20.48 0.39 0.11 11.04 0.24 0.29 0.26
0.00 SEQID-01487 0.03 0.02 0.04 0.06 0.08 0.03 0.05 0.08 -19.96
0.23 -0.06 4.38 0.00 0.30 0.00 0.24 SEQID-01488 0.01 0.05 0.08 0.02
0.05 0.00 0.06 0.07 -19.31 0.54 -0.08 4.08 0.00 0.33 0.22 0.24
SEQID-01489 0.01 0.08 0.03 0.02 0.06 0.01 0.04 0.07 -29.68 0.20
-0.04 6.14 0.00 0.31 0.00 0.18 SEQID-01490 0.03 0.06 0.04 0.06 0.05
0.00 0.01 0.05 -20.53 0.46 -0.06 4.45 0.21 0.32 0.21 0.21
SEQID-01491 0.02 0.11 0.05 0.06 0.07 0.04 0.07 0.05 -12.60 0.73
0.04 9.74 0.00 0.31 0.00 0.22 SEQID-01492 0.01 0.06 0.04 0.05 0.05
0.02 0.07 0.05 -20.65 0.33 -0.01 6.07 0.19 0.30 0.00 0.00
SEQID-01493 0.02 0.08 0.04 0.05 0.05 0.02 0.06 0.04 -22.18 0.31
0.00 6.84 0.32 0.43 0.00 0.00 SEQID-01494 0.02 0.04 0.06 0.06 0.04
0.02 0.02 0.07 -19.30 0.51 -0.02 5.48 0.00 0.33 0.00 0.20
SEQID-01495 0.05 0.10 0.03 0.05 0.04 0.02 0.07 0.03 -23.42 0.33
-0.03 4.86 0.19 0.32 0.00 0.21 SEQID-01496 0.02 0.04 0.04 0.05 0.06
0.00 0.04 0.07 -19.57 0.43 0.01 8.18 0.19 0.33 0.00 0.20
SEQID-01497 0.02 0.06 0.02 0.04 0.04 0.02 0.08 0.05 -23.62 0.41
-0.02 5.11 0.22 0.33 0.00 0.19 SEQID-01498 0.02 0.05 0.04 0.04 0.04
0.03 0.07 0.06 -22.22 0.37 -0.01 6.62 0.21 0.31 0.00 0.22
SEQID-01499 0.01 0.03 0.08 0.05 0.04 0.00 0.09 0.04 -24.80 0.18
-0.05 4.73 0.21 0.36 0.00 0.22 SEQID-01500 0.02 0.05 0.04 0.04 0.04
0.01 0.04 0.06 -23.45 0.41 0.00 7.50 0.21 0.36 0.00 0.23
SEQID-01501 0.02 0.05 0.06 0.03 0.07 0.03 0.06 0.05 -17.92 0.36
0.02 9.27 0.22 0.34 0.00 0.20 SEQID-01502 0.03 0.10 0.03 0.05 0.03
0.02 0.04 0.04 -24.51 0.40 -0.04 4.90 0.21 0.33 0.00 0.00
SEQID-01503 0.02 0.05 0.05 0.05 0.04 0.02 0.04 0.06 -17.28 0.56
0.00 6.95 0.21 0.31 0.00 0.21 SEQID-01504 0.03 0.08 0.06 0.05 0.03
0.01 0.04 0.04 -22.29 0.34 -0.02 5.83 0.21 0.31 0.00 0.22
SEQID-01505 0.03 0.04 0.03 0.07 0.06 0.01 0.04 0.07 -16.42 0.49
-0.02 5.28 0.21 0.33 0.20 0.22 SEQID-01506 0.02 0.04 0.05 0.04 0.05
0.01 0.02 0.07 -21.58 0.44 0.00 6.78 0.21 0.33 0.20 0.21
SEQID-01507 0.01 0.06 0.05 0.05 0.04 0.02 0.05 0.06 -20.35 0.44
-0.02 5.62 0.20 0.34 0.00 0.21 SEQID-01508 0.02 0.05 0.04 0.07 0.04
0.02 0.05 0.07 -20.70 0.35 -0.01 5.85 0.21 0.31 0.00 0.21
SEQID-01509 0.03 0.05 0.04 0.03 0.05 0.03 0.05 0.06 -24.81 0.31
0.00 7.62 0.21 0.33 0.00 0.20 SEQID-01510 0.03 0.07 0.03 0.05 0.04
0.03 0.05 0.05 -23.93 0.29 0.00 7.03 0.20 0.35 0.00 0.20
SEQID-01511 0.02 0.05 0.04 0.06 0.04 0.01 0.04 0.08 -20.83 0.44
-0.03 4.94 0.20 0.32 0.00 0.21 SEQID-01512 0.02 0.03 0.03 0.05 0.04
0.01 0.03 0.06 -27.97 0.35 -0.02 5.45 0.20 0.37 0.19 0.19
SEQID-01513 0.02 0.08 0.04 0.06 0.05 0.01 0.04 0.07 -21.63 0.39
-0.04 4.72 0.20 0.34 0.20 0.20 SEQID-01514 0.03 0.05 0.04 0.05 0.05
0.02 0.04 0.06 -20.91 0.39 -0.01 6.21 0.17 0.33 0.18 0.19
SEQID-01515 0.05 0.07 0.08 0.06 0.08 0.04 0.06 0.01 -15.18 0.44
0.02 9.00 0.26 0.25 0.00 0.26 SEQID-01516 0.16 0.02 0.00 0.06 0.02
0.02 0.02 0.00 -26.95 0.02 0.02 9.05 0.25 0.24 0.25 0.26
SEQID-01517 0.01 0.03 0.04 0.03 0.01 0.00 0.05 0.02 -27.30 0.13
0.09 10.47 0.30 0.32 0.00 0.27 SEQID-01518 0.04 0.05 0.05 0.03 0.05
0.00 0.03 0.02 -30.06 0.12 0.06 10.32 0.22 0.31 0.25 0.25
SEQID-01519 0.04 0.03 0.03 0.06 0.05 0.00 0.03 0.05 -24.45 0.32
0.20 12.14 0.25 0.27 0.00 0.25 SEQID-01520 0.01 0.05 0.05 0.06 0.05
0.00 0.08 0.08 -18.79 0.42 0.03 9.40 0.23 0.28 0.00 0.29
SEQID-01521 0.02 0.04 0.04 0.04 0.04 0.00 0.01 0.11 -19.76 0.50
0.02 9.69 0.27 0.31 0.00 0.26 SEQID-01522 0.02 0.05 0.03 0.06 0.04
0.02 0.08 0.09 -18.64 0.27 0.16 11.63 0.24 0.30 0.00 0.21
SEQID-01523 0.02 0.01 0.06 0.05 0.01 0.00 0.05 0.07 -25.54 0.24
0.20 11.52 0.18 0.30 0.21 0.22 SEQID-01524 0.01 0.02 0.01 0.04 0.05
0.00 0.00 0.05 -31.23 0.13 -0.02 5.11 0.29 0.33 0.27 0.22
SEQID-01525 0.01 0.01 0.03 0.05 0.04 0.00 0.03 0.04 -18.10 0.37
0.10 11.34 0.26 0.30 0.28 0.25 SEQID-01526 0.05 0.03 0.05 0.06 0.02
0.03 0.02 0.10 -17.41 0.58 0.09 11.03 0.25 0.29 0.27 0.00
SEQID-01527 0.02 0.02 0.03 0.04 0.05 0.03 0.07 0.08 -16.35 0.41
-0.02 5.59 0.37 0.37 0.23 0.19 SEQID-01528 0.03 0.04 0.06 0.10 0.01
0.04 0.06 0.07 -19.64 0.29 -0.01 6.35 0.21 0.30 0.22 0.00
SEQID-01529 0.03 0.06 0.05 0.07 0.04 0.00 0.04 0.11 -15.90 0.43
0.03 9.76 0.23 0.30 0.24 0.00 SEQID-01530 0.03 0.03 0.03 0.04 0.03
0.00 0.02 0.07 -22.46 0.32 -0.04 4.57 0.38 0.44 0.21 0.21
SEQID-01531 0.04 0.06 0.01 0.05 0.06 0.05 0.04 0.06 -19.58 0.45
0.00 7.51 0.00 0.32 0.00 0.22 SEQID-01532 0.01 0.11 0.05 0.03 0.02
0.00 0.05 0.05 -18.49 0.58 -0.03 4.75 0.00 0.31 0.00 0.26
SEQID-01533 0.03 0.05 0.03 0.06 0.04 0.00 0.08 0.07 -22.34 0.40
-0.01 6.13 0.24 0.31 0.00 0.22 SEQID-01534 0.01 0.06 0.05 0.06 0.06
0.06 0.01 0.06 -24.06 0.27 -0.03 5.17 0.24 0.31 0.00 0.22
SEQID-01535 0.02 0.05 0.02 0.06 0.04 0.01 0.05 0.09 -20.98 0.45
-0.01 5.45 0.22 0.34 0.24 0.00 SEQID-01536 0.03 0.05 0.04 0.04 0.05
0.01 0.03 0.06 -23.96 0.38 -0.01 6.30 0.22 0.33 0.00 0.21
SEQID-01537 0.01 0.03 0.03 0.07 0.08 0.00 0.04 0.09 -16.54 0.54
-0.06 4.27 0.23 0.31 0.21 0.00 SEQID-01538 0.03 0.08 0.05 0.07 0.01
0.02 0.07 0.04 -21.18 0.36 -0.01 6.64 0.23 0.34 0.00 0.00
SEQID-01539 0.05 0.02 0.02 0.07 0.04 0.01 0.00 0.04 -27.29 0.18
-0.08 4.37 0.24 0.35 0.00 0.00 SEQID-01540 0.02 0.07 0.02 0.03 0.03
0.02 0.03 0.05 -28.85 0.29 -0.09 4.76 0.23 0.30 0.00 0.22
SEQID-01541 0.04 0.06 0.04 0.04 0.06 0.03 0.08 0.07 -15.44 0.75
-0.06 4.20 0.21 0.32 0.00 0.20 SEQID-01542 0.03 0.09 0.03 0.07 0.04
0.00 0.02 0.04 -22.95 0.51 -0.08 4.18 0.23 0.32 0.00 0.22
SEQID-01543 0.03 0.04 0.02 0.07 0.05 0.01 0.05 0.05 -23.39 0.40
-0.08 4.38 0.00 0.33 0.22 0.00 SEQID-01544 0.04 0.03 0.04 0.05 0.06
0.02 0.06 0.03 -18.90 0.44 0.05 8.97 0.22 0.31 0.00 0.20
SEQID-01545 0.02 0.06 0.02 0.06 0.05 0.04 0.06 0.06 -18.02 0.41
-0.01 6.16 0.20 0.32 0.00 0.00 SEQID-01546 0.00 0.02 0.03 0.07 0.06
0.08 0.09 0.08 -20.14 0.42 -0.03 5.54 0.21 0.32 0.00 0.20
SEQID-01547 0.02 0.05 0.06 0.06 0.06 0.03 0.07 0.05 -18.75 0.39
0.01 8.29 0.21 0.35 0.20 0.22 SEQID-01548 0.03 0.07 0.05 0.05 0.03
0.02 0.08 0.04 -22.52 0.29 -0.02 5.16 0.21 0.32 0.00 0.25
SEQID-01549 0.03 0.02 0.02 0.08 0.07 0.00 0.06 0.07 -19.16 0.29
0.00 7.40 0.22 0.31 0.22 0.18 SEQID-01550 0.01 0.03 0.05 0.04 0.05
0.04 0.04 0.07 -20.54 0.32 0.01 8.22 0.23 0.31 0.00 0.20
SEQID-01551 0.03 0.06 0.05 0.05 0.07 0.00 0.03 0.06 -17.15 0.48
0.01 8.76 0.21 0.31 0.00 0.20 SEQID-01552 0.02 0.04 0.04 0.04 0.04
0.01 0.04 0.06 -23.14 0.35 -0.06 4.51 0.22 0.31 0.00 0.00
SEQID-01553 0.02 0.08 0.03 0.06 0.04 0.01 0.03 0.07 -22.22 0.40
-0.01 6.06 0.22 0.32 0.00 0.00 SEQID-01554 0.02 0.05 0.05 0.04 0.05
0.02 0.06 0.05 -21.32 0.33 -0.02 5.83 0.23 0.32 0.00 0.22
SEQID-01555 0.02 0.05 0.05 0.04 0.05 0.01 0.02 0.08 -21.34 0.43
-0.01 6.30 0.21 0.32 0.23 0.22 SEQID-01556 0.03 0.06 0.02 0.05 0.06
0.02 0.09 0.03 -20.12 0.32 -0.07 4.22 0.19 0.35 0.00 0.18
SEQID-01557 0.01 0.07 0.03 0.05 0.04 0.03 0.05 0.08 -18.69 0.55
0.01 8.39 0.20 0.35 0.00 0.20 SEQID-01558 0.03 0.04 0.04 0.04 0.04
0.03 0.08 0.04 -21.38 0.36 -0.01 6.19 0.20 0.32 0.00 0.20
SEQID-01559 0.03 0.04 0.06 0.06 0.07 0.00 0.02 0.06 -20.66 0.33
-0.10 3.97 0.21 0.35 0.00 0.22 SEQID-01560 0.02 0.07 0.05 0.08 0.06
0.01 0.04 0.05 -15.08 0.37 -0.01 5.18 0.22 0.33 0.21 0.21
SEQID-01561 0.03 0.07 0.03 0.03 0.07 0.03 0.04 0.05 -19.53 0.40
-0.02 5.49 0.20 0.33 0.00 0.20 SEQID-01562 0.01 0.05 0.03 0.17 0.03
0.01 0.02 0.03 -28.73 0.13 -0.05 4.58 0.26 0.57 0.21 0.22
SEQID-01563 0.02 0.03 0.04 0.09 0.04 0.00 0.02 0.04 -29.57 0.18
-0.11 4.19 0.22 0.32 0.23 0.22 SEQID-01564 0.02 0.06 0.04 0.05 0.06
0.02 0.05 0.06 -17.13 0.41 0.01 8.55 0.22 0.35 0.00 0.20
SEQID-01565 0.01 0.03 0.06 0.07 0.05 0.02 0.01 0.04 -30.23 0.14
-0.08 4.43 0.21 0.34 0.00 0.22 SEQID-01566 0.03 0.05 0.04 0.03 0.05
0.00 0.03 0.04 -25.47 0.32 -0.02 5.45 0.22 0.32 0.20 0.22
SEQID-01567 0.03 0.04 0.05 0.07 0.08 0.00 0.03 0.07 -21.91 0.33
0.01 9.44 0.21 0.34 0.22 0.21 SEQID-01568 0.04 0.07 0.03 0.06 0.05
0.02 0.04 0.06 -19.23 0.32 -0.06 4.37 0.40 0.54 0.00 0.21
SEQID-01569 0.03 0.06 0.02 0.05 0.06 0.02 0.05 0.04 -21.49 0.37
-0.02 5.48 0.22 0.32 0.00 0.22 SEQID-01570 0.01 0.06 0.03 0.05 0.02
0.02 0.06 0.05 -25.30 0.30 -0.01 5.94 0.21 0.34 0.19 0.21
SEQID-01571 0.01 0.06 0.05 0.05 0.03 0.02 0.07 0.04 -21.09 0.35
0.00 6.79 0.21 0.37 0.00 0.21 SEQID-01572 0.03 0.06 0.04 0.06 0.05
0.01 0.02 0.06 -17.35 0.38 0.02 8.40 0.21 0.31 0.00 0.21
SEQID-01573 0.02 0.08 0.03 0.06 0.05 0.01 0.05 0.05 -20.75 0.36
-0.01 5.30 0.22 0.14 0.00 0.21 SEQID-01574 0.01 0.07 0.04 0.05 0.05
0.02 0.04 0.06 -20.80 0.41 -0.02 5.63 0.20 0.33 0.00 0.21
SEQID-01575 0.03 0.05 0.04 0.04 0.06 0.02 0.04 0.07 -20.18 0.41
-0.01 6.47 0.21 0.33 0.00 0.21 SEQID-01576 0.03 0.05 0.05 0.03 0.08
0.02 0.05 0.06 -19.53 0.33 0.00 7.20 0.20 0.32 0.00 0.21
SEQID-01577 0.03 0.04 0.04 0.05 0.08 0.02 0.04 0.06 -21.89 0.35
0.00 6.82 0.21 0.32 0.20 0.21 SEQID-01578 0.04 0.09 0.03 0.06 0.08
0.03 0.07 0.07 -14.76 0.73 0.00 7.66 0.20 0.33 0.00 0.22
SEQID-01579 0.03 0.06 0.04 0.05 0.05 0.01 0.04 0.06 -22.28 0.41
-0.02 5.55 0.21 0.34 0.00 0.21 SEQID-01580 0.02 0.05 0.04 0.05 0.06
0.01 0.04 0.07 -24.31 0.31 -0.02 5.29 0.46 0.61 0.00 0.21
SEQID-01581 0.03 0.08 0.04 0.05 0.04 0.03 0.08 0.05 -20.71 0.35
-0.02 6.10 0.21 0.31 0.00 0.21 SEQID-01582 0.01 0.02 0.03 0.07 0.08
0.01 0.03 0.04 -28.38 0.10 -0.05 4.68 0.21 0.40 0.00 0.20
SEQID-01583 0.02 0.06 0.04 0.05 0.05 0.02 0.06 0.07 -24.33 0.25
0.01 8.67 0.20 0.33 0.00 0.20 SEQID-01584 0.02 0.05 0.05 0.04 0.06
0.00 0.03 0.07 -18.52 0.45 0.00 6.83 0.19 0.34 0.00 0.20
SEQID-01585 0.01 0.07 0.03 0.04 0.05 0.01 0.05 0.05 -23.50 0.29
-0.02 5.39 0.20 0.35 0.19 0.20 SEQID-01586 0.01 0.06 0.04 0.06 0.05
0.03 0.05 0.05 -20.61 0.30 0.00 7.23 0.19 0.33 0.20 0.20
SEQID-01587 0.02 0.07 0.04 0.06 0.05 0.04 0.06 0.05 -21.13 0.26
0.00 7.26 0.19 0.32 0.19 0.20 SEQID-01588 0.04 0.04 0.03 0.04 0.07
0.00 0.02 0.08 -21.16 0.46 -0.02 5.25 0.21 0.32 0.21 0.21
SEQID-01589 0.03 0.04 0.04 0.04 0.05 0.01 0.04 0.07 -22.97 0.34
0.00 7.14 0.19 0.35 0.19 0.19 SEQID-01590 0.02 0.01 0.04 0.05 0.05
0.01 0.04 0.05 -22.07 0.27 0.11 11.06 0.21 0.34 0.17 0.23
SEQID-01591 0.04 0.04 0.03 0.05 0.09 0.01 0.05 0.07 -18.50 0.40
-0.01 6.10 0.42 0.59 0.00 0.20 SEQID-01592 0.04 0.04 0.03 0.04 0.05
0.00 0.05 0.06 -22.72 0.32 -0.06 4.52 0.49 0.68 0.00 0.20
SEQID-01593 0.03 0.04 0.04 0.01 0.08 0.00 0.04 0.09 -22.55 0.42
-0.06 4.66 0.22 0.35 0.00 0.21 SEQID-01594 0.01 0.05 0.02 0.07 0.03
0.00 0.02 0.10 -25.27 0.36 -0.02 5.08 0.21 0.31 0.21 0.23
SEQID-01595 0.05 0.05 0.04 0.02 0.05 0.02 0.03 0.08 -23.32 0.48
-0.05 4.51 0.21 0.33 0.23 0.00 SEQID-01596 0.06 0.05 0.01 0.04 0.03
0.01 0.06 0.04 -24.98 0.25 0.21 11.84 0.00 0.27 0.00 0.22
SEQID-01597 0.04 0.04 0.05 0.04 0.05 0.01 0.04 0.10 -19.93 0.37
0.02 9.66 0.21 0.32 0.00 0.00 SEQID-01598 0.04 0.04 0.03 0.03 0.04
0.03 0.04 0.04 -25.91 0.31 -0.01 6.52 0.21 0.32 0.00 0.20
SEQID-01599 0.02 0.05 0.04 0.05 0.05 0.03 0.05 0.06 -21.91 0.32
-0.01 6.39 0.20 0.33 0.00 0.20 SEQID-01600 0.04 0.03 0.04 0.04 0.04
0.02 0.04 0.08 -20.96 0.45 -0.03 5.00 0.24 0.33 0.20 0.00
SEQID-01601 0.01 0.03 0.04 0.05 0.07 0.00 0.06 0.10 -23.64 0.26
0.04 9.92 0.24 0.30 0.00 0.24 SEQID-01602 0.04 0.05 0.02 0.03 0.05
0.00 0.05 0.07 -20.74 0.48 -0.03 5.74 0.21 0.32 0.22 0.22
SEQID-01603 0.03 0.03 0.04 0.04 0.04 0.00 0.02 0.08 -25.70 0.29
0.04 10.27 0.19 0.33 0.00 0.20 SEQID-01604 0.01 0.04 0.03 0.07 0.13
0.00 0.08 0.10 -16.36 0.36 0.03 9.90 0.23 0.36 0.23 0.23
SEQID-01605 0.04 0.01 0.05 0.06 0.05 0.00 0.07 0.09 -21.11 0.22
0.15 11.42 0.23 0.31 0.00 0.00 SEQID-01606 0.04 0.05 0.04 0.04 0.06
0.01 0.04 0.07 -22.99 0.36 -0.04 4.73 0.19 0.35 0.00 0.21
SEQID-01607 0.04 0.02 0.03 0.04 0.04 0.00 0.01 0.11 -23.44 0.40
0.07 10.98 0.00 0.30 0.00 0.24
SEQID-01608 0.03 0.02 0.04 0.04 0.06 0.01 0.04 0.13 -22.45 0.33
0.08 10.62 0.24 0.33 0.00 0.25 SEQID-01609 0.03 0.02 0.03 0.03 0.04
0.04 0.03 0.06 -23.54 0.22 0.07 10.93 0.00 0.33 0.00 0.00
SEQID-01610 0.03 0.04 0.04 0.04 0.06 0.01 0.04 0.07 -22.98 0.34
-0.02 5.30 0.21 0.37 0.00 0.22 SEQID-01611 0.03 0.02 0.04 0.05 0.05
0.02 0.05 0.06 -23.03 0.35 -0.05 4.54 0.42 0.59 0.00 0.00
SEQID-01612 0.05 0.03 0.05 0.05 0.06 0.00 0.05 0.06 -18.79 0.54
-0.02 5.06 0.21 0.32 0.00 0.23 SEQID-01613 0.03 0.04 0.02 0.03 0.04
0.02 0.04 0.05 -23.26 0.34 -0.05 4.63 0.21 0.34 0.24 0.00
SEQID-01614 0.02 0.05 0.03 0.07 0.083 0.04 0.07 0.06 -19.94 0.27
0.05 10.11 0.21 0.33 0.00 0.21 SEQID-01615 0.03 0.08 0.04 0.04 0.06
0.01 0.04 0.09 -15.06 0.74 0.00 6.63 0.21 0.35 0.00 0.20
SEQID-01616 0.02 0.03 0.03 0.08 0.11 0.01 0.09 0.07 -15.18 0.29
0.04 9.91 0.21 0.33 0.22 0.21 SEQID-01617 0.03 0.05 0.03 0.03 0.04
0.00 0.07 0.08 -29.91 0.24 -0.02 5.24 0.23 0.32 0.00 0.17
SEQID-01618 0.03 0.03 0.03 0.05 0.03 0.02 0.06 0.06 -23.87 0.26
0.05 10.31 0.00 0.30 0.00 0.23 SEQID-01619 0.03 0.05 0.04 0.04 0.04
0.01 0.02 0.08 -21.83 0.44 -0.02 5.34 0.23 0.35 0.24 0.21
SEQID-01620 0.03 0.06 0.03 0.05 0.04 0.01 0.08 0.05 -21.00 0.36
-0.04 4.69 0.21 0.33 0.00 0.22 SEQID-01621 0.01 0.06 0.04 0.04 0.04
0.00 0.00 0.08 -24.08 0.36 0.05 10.32 0.30 0.31 0.00 0.00
SEQID-01622 0.04 0.05 0.03 0.04 0.04 0.01 0.07 0.06 -20.44 0.39
0.01 7.92 0.20 0.31 0.00 0.21 SEQID-01623 0.01 0.03 0.03 0.01 0.06
0.00 0.04 0.11 -26.56 0.28 0.10 11.20 0.23 0.33 0.00 0.00
SEQID-01624 0.03 0.05 0.04 0.06 0.06 0.03 0.09 0.06 -19.40 0.27
0.06 10.13 0.20 0.34 0.20 0.20 SEQID-01625 0.03 0.03 0.01 0.10 0.06
0.01 0.07 0.06 -20.45 0.28 0.09 10.47 0.22 0.31 0.00 0.22
SEQID-01626 0.05 0.07 0.05 0.05 0.04 0.02 0.09 0.06 -16.88 0.71
-0.01 6.08 0.19 0.35 0.20 0.20 SEQID-01627 0.03 0.04 0.03 0.04 0.06
0.03 0.05 0.06 -23.61 0.26 -0.02 6.28 0.21 0.34 0.00 0.22
SEQID-01628 0.05 0.03 0.06 0.06 0.08 0.00 0.01 0.04 -23.11 0.37
0.04 10.15 0.25 0.27 0.00 0.00 SEQID-01629 0.04 0.01 0.02 0.04 0.05
0.00 0.11 0.12 -28.97 0.26 0.14 10.65 0.19 0.27 0.00 0.00
SEQID-01630 0.02 0.03 0.03 0.05 0.04 0.00 0.01 0.12 -23.06 0.57
0.07 10.72 0.27 0.33 0.25 0.23 SEQID-01631 0.03 0.02 0.03 0.05 0.03
0.01 0.06 0.08 -21.94 0.44 0.03 9.85 0.24 0.30 0.20 0.18
SEQID-01632 0.02 0.00 0.02 0.03 0.05 0.00 0.05 0.08 -29.33 0.29
0.11 10.97 0.24 0.33 0.29 0.24 SEQID-01633 0.05 0.02 0.02 0.02 0.06
0.00 0.09 0.08 -27.40 0.39 0.09 10.88 0.27 0.32 0.23 0.24
SEQID-01634 0.03 0.05 0.03 0.04 0.04 0.02 0.04 0.05 -19.86 0.54
-0.01 6.70 0.20 0.34 0.00 0.21 SEQID-01635 0.03 0.04 0.05 0.05 0.04
0.01 0.05 0.07 -18.51 0.45 -0.03 4.81 0.21 0.33 0.20 0.12
SEQID-01636 0.02 0.01 0.02 0.03 0.07 0.00 0.02 0.08 -22.43 0.41
-0.03 4.70 0.21 0.35 0.23 0.12 SEQID-01637 0.01 0.05 0.01 0.04 0.01
0.00 0.01 0.07 -31.55 0.39 -0.18 3.88 0.24 0.30 0.24 0.25
SEQID-01638 0.03 0.04 0.01 0.04 0.04 0.01 0.03 0.04 -28.30 0.24
-0.02 5.58 0.19 0.55 0.18 0.00 SEQID-01639 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -28.28 0.23 -0.02 5.65 0.19 0.55 0.18 0.17
SEQID-01640 0.03 0.04 0.01 0.04 0.04 0.01 0.03 0.04 -28.28 0.23
-0.02 5.64 0.18 0.54 0.18 0.00 SEQID-01641 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -28.15 0.23 -0.02 5.68 0.18 0.55 0.18 0.00
SEQID-01642 0.03 0.02 0.03 0.05 0.04 0.02 0.08 0.05 -25.06 0.21
0.09 9.44 0.00 0.34 0.00 0.00 SEQID-01643 0.02 0.04 0.05 0.06 0.07
0.02 0.05 0.08 -22.60 0.30 -0.01 6.25 0.00 0.34 0.00 0.18
SEQID-01644 0.05 0.04 0.04 0.05 0.06 0.02 0.06 0.05 -19.69 0.41
-0.03 5.05 0.19 0.30 0.00 0.20 SEQID-01645 0.04 0.06 0.05 0.04 0.04
0.02 0.03 0.05 -24.11 0.30 0.00 7.00 0.43 0.66 0.00 0.20
SEQID-01646 0.05 0.04 0.03 0.04 0.04 0.01 0.02 0.08 -21.25 0.45
0.01 7.66 0.21 0.35 0.00 0.21 SEQID-01647 0.02 0.04 0.06 0.04 0.05
0.03 0.03 0.09 -24.19 0.30 0.00 6.53 0.18 0.34 0.20 0.21
SEQID-01648 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05 -19.52 0.43
-0.03 5.16 0.21 0.31 0.00 0.22 SEQID-01649 0.04 0.06 0.03 0.05 0.04
0.02 0.01 0.10 -20.59 0.46 0.01 8.29 0.23 0.36 0.00 0.22
SEQID-01650 0.03 0.05 0.03 0.04 0.04 0.01 0.03 0.07 -21.15 0.42
0.01 7.67 0.81 0.98 0.21 0.21 SEQID-01651 0.04 0.04 0.03 0.04 0.04
0.03 0.04 0.03 -24.31 0.28 -0.03 5.06 0.20 0.36 0.00 0.19
SEQID-01652 0.03 0.05 0.04 0.04 0.06 0.02 0.03 0.08 -18.95 0.64
-0.02 5.08 0.19 0.35 0.15 0.20 SEQID-01653 0.04 0.05 0.03 0.05 0.06
0.02 0.04 0.10 -17.92 0.49 0.02 8.82 0.70 0.86 0.00 0.20
SEQID-01654 0.02 0.03 0.07 0.05 0.07 0.03 0.05 0.09 -23.26 0.28
-0.01 6.41 0.21 0.34 0.00 0.23 SEQID-01655 0.03 0.07 0.04 0.04 0.05
0.01 0.05 0.06 -19.82 0.43 0.02 9.13 0.20 0.36 0.19 0.21
SEQID-01656 0.04 0.07 0.04 0.05 0.03 0.00 0.05 0.05 -22.74 0.38
-0.02 5.47 1.00 1.00 0.00 0.20 SEQID-01657 0.03 0.05 0.05 0.04 0.04
0.03 0.06 0.05 -19.55 0.37 0.00 6.93 0.18 0.34 0.19 0.00
SEQID-01658 0.01 0.04 0.03 0.04 0.04 0.03 0.02 0.08 -19.93 0.45
0.00 7.24 0.67 0.80 0.23 0.22 SEQID-01659 0.01 0.04 0.05 0.05 0.07
0.02 0.04 0.07 -23.94 0.29 -0.02 5.25 0.19 0.37 0.19 0.19
SEQID-01660 0.03 0.06 0.04 0.03 0.04 0.02 0.06 0.06 -22.25 0.32
-0.01 6.28 0.19 0.32 0.00 0.21 SEQID-01661 0.01 0.05 0.04 0.06 0.05
0.03 0.06 0.08 -22.31 0.32 -0.01 6.28 0.19 0.34 0.19 0.20
SEQID-01662 0.03 0.03 0.03 0.06 0.04 0.03 0.02 0.10 -19.92 0.55
0.02 8.02 0.23 0.32 0.20 0.19 SEQID-01663 0.01 0.04 0.03 0.06 0.07
0.02 0.04 0.07 -24.15 0.31 -0.02 5.47 0.00 0.38 0.00 0.00
SEQID-01664 0.05 0.09 0.04 0.03 0.05 0.01 0.02 0.05 -25.42 0.34
-0.05 4.48 0.41 0.59 0.23 0.23 SEQID-01665 0.03 0.07 0.04 0.04 0.06
0.04 0.04 0.05 -19.34 0.41 0.01 8.10 0.21 0.32 0.00 0.20
SEQID-01666 0.03 0.03 0.03 0.04 0.06 0.00 0.06 0.07 -25.16 0.32
0.02 8.95 0.22 0.33 0.00 0.22 SEQID-01667 0.05 0.02 0.02 0.04 0.02
0.01 0.02 0.04 -32.61 0.15 0.04 9.81 0.25 0.33 0.26 0.24
SEQID-01668 0.03 0.05 0.05 0.04 0.05 0.02 0.04 0.07 -22.22 0.37
0.02 8.84 0.38 0.60 0.00 0.22 SEQID-01669 0.03 0.05 0.03 0.04 0.07
0.00 0.04 0.06 -23.34 0.33 -0.01 5.34 0.71 0.89 0.00 0.21
SEQID-01670 0.02 0.03 0.19 0.03 0.03 0.01 0.02 0.03 -14.79 0.16
-0.01 5.27 0.61 0.78 0.21 0.39 SEQID-01671 0.04 0.07 0.07 0.02 0.04
0.00 0.01 0.05 -23.56 0.32 -0.04 4.68 0.31 0.49 0.00 0.22
SEQID-01672 0.03 0.04 0.05 0.03 0.04 0.05 0.03 0.05 -22.65 0.31
0.01 7.60 0.23 0.30 0.20 0.20 SEQID-01673 0.02 0.03 0.11 0.04 0.06
0.02 0.03 0.06 -21.53 0.26 0.01 7.60 0.21 0.41 0.21 0.22
SEQID-01674 0.02 0.05 0.04 0.06 0.05 0.03 0.05 0.08 -22.52 0.31
-0.02 5.83 0.19 0.33 0.19 0.19 SEQID-01675 0.02 0.05 0.03 0.04 0.04
0.01 0.04 0.08 -21.06 0.43 0.00 6.53 0.85 0.96 0.21 0.22
SEQID-01676 0.02 0.05 0.04 0.04 0.07 0.01 0.03 0.06 -22.28 0.54
-0.02 5.31 0.73 0.91 0.20 0.22 SEQID-01677 0.02 0.05 0.05 0.05 0.05
0.00 0.03 0.08 -18.73 0.43 0.00 6.68 0.00 0.52 0.18 1.00
SEQID-01678 0.01 0.03 0.19 0.03 0.03 0.01 0.02 0.0 -13.57 0.17 0.01
9.57 0.84 0.96 0.22 0.39 SEQID-01679 0.00 0.02 0.02 0.02 0.02 0.02
0.03 0.02 -36.28 0.11 0.01 7.24 0.24 0.37 0.23 0.23 SEQID-01680
0.02 0.03 0.06 0.07 0.06 0.03 0.06 0.05 -14.89 0.38 0.00 6.51 0.23
0.33 0.24 0.24 SEQID-01681 0.03 0.08 0.02 0.04 0.03 0.03 0.06 0.07
-17.57 0.56 0.06 10.24 0.20 0.31 0.22 0.00 SEQID-01682 0.03 0.08
0.03 0.02 0.03 0.02 0.03 0.05 -31.94 0.40 -0.19 3.81 0.21 0.33 0.00
0.23 SEQID-01683 0.03 0.04 0.05 0.05 0.06 0.02 0.04 0.08 -20.68
0.41 0.03 9.50 0.21 0.34 0.00 0.22 SEQID-01684 0.02 0.07 0.06 0.05
0.05 0.01 0.05 0.04 -20.28 0.38 0.01 8.43 0.22 0.32 0.19 0.23
SEQID-01685 0.04 0.04 0.04 0.05 0.06 0.00 0.07 0.07 -19.87 0.53
0.01 8.17 0.22 0.34 0.00 0.21 SEQID-01686 0.03 0.04 0.01 0.05 0.05
0.00 0.04 0.05 -25.43 0.18 -0.02 5.27 0.29 0.46 0.00 0.21
SEQID-01687 0.03 0.06 0.03 0.05 0.04 0.02 0.04 0.05 -21.38 0.46
-0.02 5.37 0.00 0.34 0.00 0.18 SEQID-01688 0.03 0.05 0.06 0.05 0.06
0.00 0.02 0.08 -16.80 0.55 0.02 8.74 0.51 0.70 0.00 0.00
SEQID-01689 0.04 0.04 0.03 0.05 0.05 0.02 0.04 0.07 -18.64 0.49
0.01 7.89 0.19 0.34 0.00 0.21 SEQID-01690 0.02 0.04 0.05 0.10 0.07
0.01 0.04 0.06 -22.89 0.22 0.01 8.52 0.19 0.40 0.20 0.20
SEQID-01691 0.02 0.00 0.00 0.04 0.03 0.00 0.03 0.03 -36.78 0.12
-0.09 4.39 0.59 0.70 0.26 0.22 SEQID-01692 0.04 0.05 0.03 0.06 0.04
0.03 0.05 0.05 -19.60 0.40 0.04 9.78 0.21 0.32 0.00 0.20
SEQID-01693 0.05 0.07 0.04 0.05 0.06 0.01 0.05 0.06 -19.49 0.31
-0.05 4.52 0.40 0.54 0.00 0.22 SEQID-01694 0.03 0.04 0.03 0.05 0.05
0.00 0.04 0.08 -18.98 0.46 0.02 9.56 0.21 0.34 0.00 0.22
SEQID-01695 0.02 0.04 0.08 0.04 0.05 0.01 0.04 0.05 -20.77 0.34
-0.01 5.62 0.26 0.54 0.20 0.30 SEQID-01696 0.00 0.05 0.03 0.06 0.11
0.03 0.03 0.07 -23.51 0.35 -0.02 4.88 0.30 0.19 0.00 0.36
SEQID-01697 0.01 0.07 0.02 0.08 0.09 0.02 0.06 0.05 -17.82 0.30
0.01 8.88 0.20 0.32 0.00 0.00 SEQID-01698 0.04 0.05 0.08 0.06 0.05
0.01 0.06 0.04 -20.82 0.18 0.03 9.60 0.18 0.33 0.00 0.23
SEQID-01699 0.02 0.04 0.04 0.06 0.07 0.01 0.05 0.05 -17.51 0.40
0.02 8.79 0.10 0.33 0.00 0.21 SEQID-01700 0.03 0.03 0.02 0.05 0.04
0.00 0.07 0.04 -25.38 0.35 0.00 7.40 0.21 0.33 0.00 0.00
SEQID-01701 0.04 0.09 0.05 0.05 0.04 0.03 0.07 0.05 -16.01 0.54
0.04 9.63 0.19 0.30 0.00 0.21 SEQID-01702 0.02 0.06 0.04 0.04 0.06
0.01 0.06 0.06 -20.11 0.37 -0.05 4.74 0.95 1.00 0.20 0.22
SEQID-01703 0.04 0.06 0.04 0.05 0.04 0.01 0.07 0.05 -21.59 0.32
0.00 7.30 0.20 0.31 0.00 0.21 SEQID-01704 0.02 0.02 0.03 0.06 0.03
0.02 0.02 0.03 -24.91 0.22 -0.03 5.14 0.20 0.37 0.00 0.21
SEQID-01705 0.04 0.05 0.05 0.04 0.04 0.02 0.05 0.08 -18.71 0.48
0.00 7.01 0.20 0.32 0.19 0.21 SEQID-01706 0.04 0.05 0.04 0.04 0.04
0.02 0.03 0.08 -19.28 0.44 -0.01 5.54 0.20 0.36 0.00 0.23
SEQID-01707 0.03 0.04 0.06 0.04 0.05 0.02 0.04 0.08 -19.01 0.52
0.04 9.77 0.21 0.34 0.22 0.23 SEQID-01708 0.04 0.05 0.04 0.04 0.05
0.02 0.02 0.07 -19.00 0.45 -0.01 5.91 0.20 0.33 0.00 0.21
SEQID-01709 0.03 0.05 0.03 0.06 0.06 0.03 0.04 0.11 -19.75 0.48
0.00 7.59 0.88 0.98 0.20 0.00 SEQID-01710 0.03 0.06 0.04 0.05 0.04
0.02 0.07 0.05 -20.59 0.40 -0.01 6.34 0.20 0.34 0.00 0.21
SEQID-01711 0.04 0.05 0.05 0.04 0.03 0.01 0.02 0.12 -19.29 0.53
0.00 6.72 0.27 0.34 0.00 0.21 SEQID-01712 0.05 0.05 0.05 0.04 0.03
0.01 0.02 0.12 -19.24 0.54 0.00 6.72 0.27 0.33 0.00 0.20
SEQID-01713 0.03 0.05 0.03 0.03 0.06 0.02 0.05 0.06 -24.64 0.80
0.13 10.78 0.67 0.76 0.00 0.18 SEQID-01714 0.03 0.08 0.03 0.06 0.06
0.02 0.04 0.08 -12.35 0.97 -0.01 5.13 0.20 0.34 0.19 0.20
SEQID-01715 0.05 0.02 0.04 0.04 0.02 0.02 0.03 0.04 -29.46 0.20
0.22 11.90 0.25 0.32 0.00 0.22 SEQID-01716 0.04 0.02 0.03 0.05 0.03
0.02 0.03 0.04 -29.79 0.14 0.22 11.90 0.26 0.31 0.18 0.20
SEQID-01717 0.03 0.08 0.03 0.06 0.06 0.02 0.05 0.08 -12.15 0.97
-0.01 5.37 0.20 0.34 0.20 0.21 SEQID-01718 0.01 0.03 0.04 0.03 0.04
0.04 0.07 0.07 -25.61 0.22 0.21 12.15 0.23 0.31 0.00 0.22
SEQID-01719 0.03 0.07 0.03 0.06 0.05 0.01 0.05 0.09 -12.62 0.98
-0.02 5.14 0.20 0.34 0.21 0.21 SEQID-01720 0.02 0.05 0.05 0.04 0.03
0.06 0.03 0.08 -20.31 0.88 0.00 7.19 0.22 0.33 0.22 0.22
SEQID-01721 0.03 0.05 0.04 0.04 0.07 0.01 0.04 0.08 -22.00 0.41
0.04 9.79 0.22 0.35 0.21 0.22 SEQID-01722 0.03 0.06 0.04 0.07 0.02
0.01 0.05 0.08 -16.23 0.49 0.00 6.79 0.37 0.58 0.00 0.22
SEQID-01723 0.02 0.04 0.03 0.05 0.05 0.00 0.03 0.05 -27.65 0.24
0.16 11.39 0.20 0.34 0.19 0.00 SEQID-01724 0.05 0.04 0.05 0.06 0.05
0.02 0.06 0.06 -19.93 0.44 -0.08 5.06 0.21 0.34 0.00 0.19
SEQID-01725 0.05 0.04 0.04 0.05 0.06 0.02 0.06 0.05 -19.69 0.41
-0.08 5.05 0.20 0.31 0.00 0.21 SEQID-01726 0.04 0.02 0.04 0.05 0.03
0.02 0.03 0.05 -29.76 0.17 0.22 12.00 0.26 0.32 0.20 0.23
SEQID-01727 0.01 0.01 0.13 0.04 0.04 0.00 0.01 0.07 -23.43 0.24
0.21 11.50 0.29 0.39 0.24 0.26 SEQID-01728 0.01 0.03 0.04 0.04 0.06
0.01 0.06 0.06 -20.62 0.42 0.01 7.71 0.22 0.33 0.22 0.21
SEQID-01729 0.05 0.04 0.05 0.05 0.06 0.02 0.06 0.06 -19.71 0.44
-0.03 5.16 0.20 0.33 0.00 0.21 SEQID-01730 0.04 0.05 0.05 0.07 0.05
0.01 0.05 0.06 -16.27 0.44 0.01 8.56 0.21 0.34 0.00 0.22
SEQID-01731 0.04 0.09 0.05 0.04 0.06 0.01 0.03 0.10 -17.51 0.37
0.03 8.95 0.80 0.84 0.00 0.24 SEQID-01732 0.01 0.04 0.02 0.01 0.07
0.00 0.06 0.06 -25.48 0.31 0.12 10.46 0.25 0.31 0.22 0.00
SEQID-01733 0.03 0.03 0.05 0.05 0.04 0.03 0.03 0.08 -20.98 0.34
0.11
11.32 0.22 0.37 0.00 0.19 SEQID-01734 0.04 0.07 0.03 0.04 0.05 0.01
0.04 0.07 -21.67 0.43 -0.02 5.11 0.21 0.33 0.00 0.21 SEQID-01735
0.03 0.05 0.00 0.04 0.04 0.02 0.09 0.03 -16.81 0.18 0.00 6.53 0.33
0.50 0.28 0.35 SEQID-01736 0.01 0.04 0.05 0.12 0.03 0.00 0.01 0.04
-31.20 0.13 -0.04 4.73 0.18 0.43 0.20 0.23 SEQID-01737 0.02 0.03
0.06 0.03 0.04 0.01 0.02 0.06 -29.86 0.33 -0.04 4.86 0.19 0.36 0.19
0.18 SEQID-01738 0.02 0.04 0.07 0.06 0.04 0.00 0.03 0.05 -24.32
0.23 0.12 10.82 0.28 0.32 0.26 0.27 SEQID-01739 0.04 0.02 0.07 0.03
0.02 0.04 0.07 0.04 -16.56 0.35 0.03 8.54 0.36 0.53 0.24 0.25
SEQID-01740 0.01 0.04 0.04 0.05 0.05 0.04 0.02 0.13 -17.37 0.51
-0.01 5.39 0.88 0.94 0.00 0.00 SEQID-01741 0.01 0.01 0.14 0.04 0.05
0.00 0.02 0.03 -23.90 0.14 0.23 11.53 0.26 0.40 0.27 0.28
SEQID-01742 0.03 0.03 0.02 0.06 0.05 0.01 0.07 0.04 -26.09 0.32
-0.06 4.46 0.23 0.31 0.00 0.00 SEQID-01743 0.02 0.05 0.03 0.05 0.05
0.02 0.03 0.09 -18.35 0.48 0.00 6.53 0.22 0.35 0.23 0.23
SEQID-01744 0.02 0.02 0.04 0.06 0.02 0.00 0.05 0.04 -12.99 0.30
0.00 7.03 0.37 0.54 0.21 0.22 SEQID-01745 0.02 0.06 0.05 0.03 0.03
0.06 0.04 0.07 -20.06 0.31 -0.01 6.79 0.21 0.32 0.23 0.22
SEQID-01746 0.02 0.02 0.01 0.07 0.05 0.00 0.02 0.04 -29.01 0.19
-0.09 4.37 0.22 0.39 0.18 0.18 SEQID-01747 0.04 0.06 0.03 0.07 0.08
0.02 0.05 0.02 -22.79 0.13 0.25 12.25 0.25 0.28 0.25 0.25
SEQID-01748 0.01 0.01 0.21 0.04 0.04 0.00 0.03 0.07 -6.36 0.48 0.03
8.08 0.33 0.41 0.29 0.24 SEQID-01749 0.03 0.04 0.04 0.02 0.05 0.02
0.03 0.06 -25.48 0.20 0.17 11.40 0.21 0.32 0.23 0.20 SEQID-01750
0.04 0.04 0.03 0.04 0.06 0.02 0.04 0.07 -20.83 0.49 -0.02 5.70 0.22
0.35 0.23 0.21 SEQID-01751 0.03 0.05 0.03 0.06 0.04 0.01 0.04 0.05
-25.28 0.31 0.02 9.52 0.21 0.33 0.20 0.21 SEQID-01752 0.03 0.05
0.05 0.03 0.05 0.04 0.06 0.04 -20.99 0.33 0.02 9.01 0.16 0.35 0.17
0.18 SEQID-01753 0.02 0.03 0.01 0.02 0.06 0.00 0.06 0.07 -23.82
0.31 0.18 12.01 0.00 0.28 0.00 0.29 SEQID-01754 0.01 0.03 0.08 0.02
0.01 0.00 0.04 0.07 -24.56 0.26 0.17 11.38 0.24 0.28 0.25 0.25
SEQID-01755 0.02 0.01 0.09 0.08 0.05 0.05 0.02 0.04 -14.26 0.60
0.01 7.87 0.49 0.59 0.25 1.00 SEQID-01756 0.02 0.07 0.05 0.06 0.03
0.05 0.04 0.07 -19.52 0.43 0.00 6.81 0.23 0.33 0.24 0.21
SEQID-01757 0.02 0.05 0.05 0.01 0.06 0.01 0.07 0.07 -21.11 0.37
0.00 7.15 0.20 0.34 0.00 0.00 SEQID-01758 0.01 0.01 0.14 0.04 0.06
0.00 0.02 0.04 -23.91 0.15 0.22 11.47 0.27 0.38 0.28 0.27
SEQID-01759 0.03 0.05 0.04 0.03 0.05 0.01 0.04 0.06 -22.82 0.35
0.10 10.82 0.21 0.31 0.00 0.00 SEQID-01760 0.04 0.05 0.04 0.03 0.07
0.03 0.02 0.07 -21.26 0.39 0.00 6.69 0.22 0.34 1.00 0.00
SEQID-01761 0.02 0.06 0.07 0.08 0.05 0.03 0.03 0.09 -15.03 0.55
0.00 6.67 0.27 0.46 0.21 0.22 SEQID-01762 0.03 0.05 0.04 0.08 0.06
0.02 0.04 0.09 -17.42 0.45 0.02 8.86 0.61 0.88 0.00 0.21
SEQID-01763 0.02 0.03 0.03 0.05 0.05 0.01 0.03 0.04 -26.38 0.34
0.02 9.46 0.21 0.36 0.22 0.22 SEQID-01764 0.03 0.08 0.03 0.05 0.06
0.00 0.00 0.07 -17.92 0.64 0.12 10.11 0.32 0.32 0.30 0.31
SEQID-01765 0.02 0.05 0.04 0.03 0.07 0.00 0.02 0.04 -23.97 0.30
0.15 11.86 0.23 0.31 0.26 0.00 SEQID-01766 0.01 0.05 0.03 0.06 0.06
0.00 0.02 0.08 -23.42 0.37 -0.03 5.87 0.25 0.30 0.00 0.21
SEQID-01767 0.04 0.07 0.05 0.04 0.02 0.06 0.05 0.08 -19.94 0.40
0.00 7.76 0.27 0.32 0.00 0.24 SEQID-01768 0.01 0.04 0.03 0.04 0.04
0.01 0.04 0.04 -29.34 0.19 0.22 11.43 0.23 0.31 0.23 0.24
SEQID-01769 0.02 0.07 0.06 0.04 0.04 0.01 0.04 0.04 -20.43 0.34
-0.03 5.16 0.26 0.33 0.22 0.21 SEQID-01770 0.02 0.04 0.05 0.04 0.04
0.01 0.04 0.08 -19.28 0.34 0.13 11.66 0.00 0.35 0.22 0.24
SEQID-01771 0.04 0.03 0.05 0.06 0.05 0.02 0.03 0.10 -17.25 0.53
-0.01 5.98 0.25 0.34 0.19 0.22 SEQID-01772 0.03 0.07 0.06 0.04 0.04
0.03 0.06 0.08 -22.03 0.34 -0.01 6.42 0.22 0.36 0.00 0.20
SEQID-01773 0.03 0.04 0.03 0.05 0.04 0.02 0.05 0.07 -19.84 0.40
-0.02 4.95 0.89 0.98 0.22 0.22 SEQID-01774 0.02 0.05 0.05 0.05 0.03
0.01 0.06 0.05 -18.41 0.45 0.00 6.62 0.21 0.33 0.00 0.22
SEQID-01775 0.05 0.05 0.04 0.04 0.05 0.02 0.04 0.07 -20.94 0.40
-0.01 6.28 0.19 0.33 0.00 0.21 SEQID-01776 0.05 0.02 0.05 0.03 0.05
0.00 0.01 0.06 -28.61 0.28 0.24 12.14 0.26 0.31 0.21 0.20
SEQID-01777 0.03 0.08 0.04 0.03 0.05 0.01 0.01 0.11 -19.18 0.65
-0.01 6.67 0.60 0.69 0.25 0.20 SEQID-01778 0.02 0.02 0.07 0.02 0.03
0.04 0.05 0.10 -14.55 0.53 0.05 10.62 0.37 0.41 0.28 1.00
SEQID-01779 0.03 0.08 0.01 0.08 0.03 0.01 0.05 0.06 -24.77 0.26
-0.01 5.29 0.22 0.29 0.21 0.23 SEQID-01780 0.03 0.06 0.05 0.02 0.03
0.01 0.05 0.07 -21.15 0.33 0.18 11.37 0.23 0.30 0.00 0.19
SEQID-01781 0.01 0.07 0.04 0.05 0.05 0.01 0.04 0.06 -21.09 0.35
0.17 11.28 0.25 0.30 0.21 0.22 SEQID-01782 0.04 0.05 0.02 0.03 0.05
0.02 0.02 0.06 -26.59 0.30 0.13 11.42 0.25 0.33 0.20 0.20
SEQID-01783 0.13 0.00 0.07 0.05 0.03 0.01 0.12 0.04 -6.89 0.52 0.01
8.00 0.26 0.34 0.00 0.23 SEQID-01784 0.04 0.07 0.04 0.03 0.06 0.03
0.08 0.05 -21.92 0.25 0.15 11.07 0.23 0.28 0.00 0.00 SEQID-01785
0.02 0.05 0.03 0.03 0.02 0.01 0.05 0.06 -25.46 0.28 0.10 10.94 0.21
0.33 0.00 0.00 SEQID-01786 0.02 0.06 0.02 0.05 0.06 0.02 0.04 0.03
-22.05 0.39 0.01 8.44 0.00 0.30 0.20 0.24 SEQID-01787 0.03 0.05
0.04 0.04 0.02 0.01 0.05 0.06 -23.74 0.25 0.13 10.91 0.21 0.31 0.00
0.25 SEQID-01788 0.02 0.08 0.04 0.08 0.05 0.01 0.02 0.08 -17.07
0.47 0.03 9.88 0.24 0.81 0.00 0.24 SEQID-01789 0.04 0.04 0.04 0.02
0.03 0.03 0.04 0.10 -11.71 0.93 0.04 10.01 0.23 0.35 0.26 0.24
SEQID-01790 0.03 0.05 0.02 0.04 0.05 0.02 0.03 0.08 -25.32 0.30
0.08 10.48 0.21 0.31 0.00 0.00 SEQID-01791 0.04 0.07 0.05 0.04 0.05
0.01 0.02 0.09 -18.66 0.49 0.00 6.72 0.24 0.32 0.00 0.22
SEQID-01792 0.03 0.03 0.04 0.05 0.04 0.00 0.05 0.07 -18.93 0.46
-0.01 5.90 0.21 0.37 0.00 0.23 SEQID-01793 0.02 0.04 0.05 0.05 0.06
0.00 0.04 0.08 -18.17 0.47 -0.01 6.37 0.22 0.33 0.00 0.22
SEQID-01794 0.04 0.08 0.04 0.05 0.04 0.03 0.07 0.06 -19.95 0.32
-0.02 6.31 0.19 0.32 0.00 0.21 SEQID-01795 0.01 0.01 0.04 0.05 0.07
0.00 0.07 0.08 -25.22 0.20 0.25 11.95 0.25 0.30 0.26 0.25
SEQID-01796 0.02 0.02 0.03 0.05 0.04 0.00 0.03 0.05 -28.89 0.26
0.24 11.90 0.24 0.31 0.27 0.25 SEQID-01797 0.06 0.04 0.03 0.04 0.06
0.01 0.03 0.06 -11.76 0.85 0.03 10.18 0.58 0.79 0.30 0.23
SEQID-01798 0.05 0.03 0.06 0.01 0.05 0.00 0.03 0.10 -26.63 0.40
0.01 8.46 0.39 0.52 0.23 0.25 SEQID-01799 0.05 0.05 0.05 0.05 0.06
0.02 0.05 0.05 -21.19 0.26 0.00 6.94 0.22 0.32 0.22 0.22
SEQID-01800 0.01 0.09 0.03 0.08 0.05 0.01 0.06 0.06 -19.85 0.36
0.01 8.43 0.22 0.33 0.22 0.25 SEQID-01801 0.01 0.04 0.02 0.04 0.02
0.01 0.10 0.03 -18.98 0.10 -0.01 6.26 0.29 0.49 0.28 0.32
SEQID-01802 0.03 0.06 0.05 0.03 0.05 0.00 0.02 0.08 -22.83 0.42
0.16 12.03 0.00 0.30 0.00 0.24 SEQID-01803 0.04 0.04 0.03 0.03 0.03
0.03 0.04 0.05 -14.04 0.78 -0.01 6.41 0.25 0.34 0.25 0.24
SEQID-01804 0.01 0.07 0.06 0.05 0.03 0.04 0.07 0.05 -16.72 0.46
-0.01 5.64 0.25 0.31 0.00 0.00 SEQID-01805 0.04 0.05 0.03 0.04 0.04
0.01 0.04 0.09 -21.68 0.44 0.05 10.22 0.23 0.30 0.00 0.00
SEQID-01806 0.03 0.03 0.06 0.05 0.04 0.01 0.02 0.06 -23.13 0.34
0.01 7.97 0.00 0.31 0.23 0.00 SEQID-01807 0.02 0.04 0.05 0.02 0.04
0.02 0.02 0.07 -24.75 0.37 0.14 11.12 0.00 0.31 0.24 0.21
SEQID-01808 0.01 0.08 0.04 0.05 0.05 0.03 0.07 0.08 -11.36 0.94
0.01 7.97 0.23 0.33 0.00 0.21 SEQID-01809 0.02 0.06 0.05 0.03 0.07
0.02 0.02 0.09 -20.81 0.41 0.08 10.85 0.23 0.33 0.20 0.26
SEQID-01810 0.04 0.08 0.04 0.04 0.05 0.02 0.05 0.07 -14.40 0.53
0.05 10.22 0.22 0.31 0.00 0.15 SEQID-01811 0.02 0.05 0.03 0.04 0.04
0.00 0.08 0.04 -26.68 0.27 0.04 9.78 0.19 0.37 0.00 0.23
SEQID-01812 0.02 0.05 0.05 0.06 0.04 0.00 0.05 0.09 -21.32 0.56
-0.02 4.93 0.23 0.49 0.00 0.00 SEQID-01813 0.02 0.07 0.07 0.09 0.07
0.01 0.03 0.09 -9.80 0.68 0.00 7.68 0.22 0.32 0.22 0.21 SEQID-01814
0.03 0.09 0.03 0.06 0.03 0.02 0.07 0.05 -16.57 0.45 0.06 10.35 0.21
0.33 0.00 0.21 SEQID-01815 0.04 0.08 0.04 0.06 0.04 0.07 0.02 0.07
-17.44 0.77 0.05 10.58 0.21 0.32 0.18 0.19 SEQID-01816 0.03 0.07
0.05 0.07 0.05 0.02 0.04 0.09 -11.10 0.84 0.06 10.53 0.21 0.31 0.00
0.22 SEQID-01817 0.05 0.08 0.05 0.09 0.04 0.04 0.05 0.08 -11.63
0.77 0.04 10.12 0.21 0.30 0.00 0.20 SEQID-01818 0.04 0.04 0.06 0.06
0.06 0.03 0.04 0.08 -17.52 0.45 -0.01 6.14 0.25 0.32 0.00 0.24
SEQID-01819 0.02 0.08 0.04 0.03 0.03 0.02 0.03 0.06 -23.99 0.39
0.00 6.74 0.23 0.32 0.00 0.22 SEQID-01820 0.03 0.06 0.05 0.06 0.06
0.04 0.07 0.06 -17.01 0.43 0.01 8.42 0.22 0.31 0.00 0.22
SEQID-01821 0.01 0.05 0.05 0.05 0.04 0.01 0.03 0.08 -20.56 0.44
-0.02 4.99 0.21 0.34 0.00 0.22 SEQID-01822 0.03 0.09 0.03 0.06 0.05
0.01 0.06 0.07 -12.55 0.92 0.02 9.11 0.20 0.33 0.00 0.22
SEQID-01823 0.03 0.05 0.05 0.04 0.04 0.01 0.06 0.05 -19.29 0.44
-0.02 5.12 0.21 0.30 0.00 0.21 SEQID-01824 0.02 0.04 0.04 0.05 0.05
0.00 0.02 0.09 -17.75 0.51 0.00 7.07 0.21 0.35 0.20 0.22
SEQID-01825 0.03 0.07 0.01 0.03 0.04 0.05 0.08 0.05 -18.27 0.71
0.09 10.32 0.31 0.28 0.00 0.00 SEQID-01826 0.06 0.02 0.02 0.06 0.10
0.02 0.02 0.16 -18.59 0.39 -0.01 5.02 0.30 0.30 0.26 0.24
SEQID-01827 0.05 0.12 0.06 0.05 0.04 0.00 0.05 0.06 -14.20 0.51
-0.02 6.07 0.53 0.60 0.00 0.22 SEQID-01828 0.02 0.02 0.03 0.04 0.03
0.00 0.04 0.06 -18.73 0.48 0.08 10.91 0.24 0.30 0.31 0.22
SEQID-01829 0.01 0.03 0.07 0.02 0.01 0.00 0.03 0.07 -23.75 0.29
0.17 11.60 0.23 0.30 0.23 0.26 SEQID-01830 0.03 0.04 0.06 0.04 0.07
0.01 0.01 0.10 -19.88 0.43 0.02 9.21 0.26 0.34 0.16 0.26
SEQID-01831 0.03 0.05 0.04 0.04 0.03 0.00 0.01 0.06 -23.32 0.35
0.09 11.36 0.24 0.32 0.00 0.23 SEQID-01832 0.02 0.04 0.05 0.04 0.02
0.02 0.06 0.07 -21.28 0.28 0.07 10.53 0.22 0.30 0.20 0.21
SEQID-01833 0.05 0.02 0.04 0.06 0.03 0.01 0.03 0.12 -18.22 0.58
0.00 7.15 0.19 0.31 0.24 0.25 SEQID-01334 0.02 0.05 0.05 0.02 0.05
0.00 0.07 0.07 -23.53 0.36 0.15 11.29 0.24 0.31 0.00 0.21
SEQID-01835 0.01 0.09 0.05 0.07 0.05 0.03 0.00 0.07 -25.23 0.26
-0.01 5.78 0.74 0.88 0.00 0.28 SEQID-01836 0.03 0.03 0.04 0.02 0.04
0.03 0.04 0.05 -18.59 0.62 -0.04 4.41 0.27 0.35 0.21 0.25
SEQID-01837 0.01 0.02 0.05 0.03 0.05 0.02 0.04 0.06 -19.08 0.62
-0.01 6.25 0.27 0.32 0.26 0.25 SEQID-01838 0.02 0.03 0.06 0.03 0.06
0.01 0.05 0.10 -21.38 0.32 0.12 11.06 0.22 0.28 0.00 0.25
SEQID-01839 0.03 0.06 0.01 0.03 0.07 0.04 0.04 0.06 -20.86 0.45
0.00 6.80 0.22 0.31 0.00 0.25 SEQID-01840 0.04 0.04 0.05 0.04 0.04
0.03 0.06 0.07 -18.59 0.47 -0.02 5.34 0.25 0.33 0.21 0.23
SEQID-01841 0.02 0.07 0.06 0.05 0.05 0.01 0.03 0.07 -24.15 0.39
0.10 10.85 0.23 0.31 0.00 0.00 SEQID-01842 0.04 0.01 0.04 0.03 0.03
0.02 0.05 0.06 -25.12 0.36 0.13 10.87 0.20 0.31 0.20 0.00
SEQID-01843 0.03 0.06 0.01 0.06 0.05 0.02 0.05 0.10 -23.04 0.39
-0.01 5.80 0.20 0.29 0.00 0.00 SEQID-01844 0.03 0.04 0.06 0.05 0.02
0.01 0.07 0.07 -23.20 0.42 -0.02 5.39 0.22 0.33 0.20 0.22
SEQID-01845 0.04 0.05 0.06 0.03 0.07 0.01 0.04 0.07 -21.00 0.36
0.00 6.79 0.81 0.91 0.23 0.20 SEQID-01846 0.02 0.03 0.04 0.04 0.03
0.05 0.06 0.07 -16.96 0.39 0.00 7.32 0.75 0.94 0.21 0.00
SEQID-01847 0.02 0.08 0.05 0.07 0.04 0.01 0.04 0.08 -16.06 0.59
-0.01 6.23 0.23 0.33 0.24 0.00 SEQID-01848 0.02 0.02 0.04 0.07 0.07
0.00 0.04 0.12 -19.65 0.63 0.01 8.90 0.17 0.34 0.23 0.00
SEQID-01849 0.03 0.05 0.04 0.06 0.04 0.03 0.05 0.05 -18.97 0.54
0.02 9.46 0.24 0.31 0.20 0.23 SEQID-01850 0.01 0.07 0.05 0.05 0.04
0.03 0.08 0.06 -12.44 0.40 0.04 8.62 0.51 0.65 0.19 0.24
SEQID-01851 0.02 0.04 0.03 0.02 0.01 0.01 0.06 0.06 -25.38 0.30
0.10 10.72 0.23 0.33 0.22 0.00 SEQID-01852 0.02 0.06 0.06 0.08 0.02
0.01 0.05 0.04 -15.19 0.11 0.01 7.81 0.29 0.49 0.23 0.29
SEQID-01853 0.00 0.00 0.38 0.04 0.20 0.00 0.09 0.01 -12.64 0.12
0.10 10.61 0.26 0.54 0.29 0.25 SEQID-01854 0.04 0.05 0.05 0.05 0.02
0.01 0.04 0.08 -19.12 0.53 -0.01 5.47 0.21 0.33 0.00 0.00
SEQID-01855 0.03 0.08 0.04 0.05 0.04 0.02 0.02 0.07 -18.77 0.58
-0.02 5.23 0.00 0.33 0.00 0.19 SEQID-01856 0.03 0.05 0.05 0.07 0.05
0.00 0.03 0.09 -17.27 0.52 0.00 8.03 0.53 0.71 0.00 0.22
SEQID-01857 0.03 0.05 0.04 0.04 0.05 0.02 0.03 0.11 -17.00 0.54
0.00 6.82 0.28 0.35 0.20 0.21 SEQID-01858 0.03 0.07 0.06 0.06 0.03
0.01 0.04 0.08 -16.63 0.53 0.01 8.46 0.22 0.35 0.00 0.22
SEQID-01859 0.03 0.06 0.05 0.05 0.05 0.01 0.04 0.07 -17.33 0.54
0.01 7.73 0.22 0.33 0.20 0.22 SEQID-01860 0.03 0.05 0.04 0.04 0.04
0.02 0.04 0.09 -20.27 0.38 -0.02 5.18 0.22 0.34 0.22 0.23
SEQID-01861 0.04 0.09 0.04 0.06 0.04 0.03 0.05 0.06 -12.27 0.91
0.03 9.53 0.20 0.33 0.00 0.21 SEQID-01862 0.02 0.03 0.05 0.05 0.07
0.01 0.03 0.07 -19.54 0.41 0.00 7.45 0.21 0.34 0.18 0.21
SEQID-01863 0.03 0.04 0.03 0.04 0.06 0.01 0.03 0.06 -23.07 0.38
-0.03 4.84 0.71 0.91 0.00 0.20 SEQID-01864 0.03 0.07 0.04 0.05 0.05
0.03 0.04 0.07 -18.51 0.52 0.02 9.23 0.19 0.33 0.20 0.20
SEQID-01865 0.03 0.04 0.01 0.04 0.05 0.01 0.03 0.04 -28.16 0.23
-0.02 5.50 0.18 0.58 0.18 0.18 SEQID-01866 0.03 0.04 0.01 0.04 0.05
0.01 0.03 0.04 -28.15 0.23 -0.02 5.56 0.18 0.55 0.18 0.17
SEQID-01867 0.03 0.04 0.01 0.04 0.04 0.01 0.03 0.04 -28.30 0.23
-0.02 5.50 0.19 0.55 0.18 0.17 SEQID-01868 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -28.42 0.22 -0.02 5.48 0.18 0.53 0.18 0.19
SEQID-01869 0.05 0.04 0.04 0.05 0.06 0.02 0.06 0.05 -19.69 0.41
-0.03 5.05 0.19 0.30 0.00 0.20 SEQID-01870 0.02 0.04 0.06 0.05 0.08
0.01 0.04 0.08 -22.75 0.31 0.01 8.67 0.18 0.35 0.18 0.19
SEQID-01871 0.03 0.06 0.03 0.03 0.04 0.02 0.06 0.06 -22.38 0.34
0.00 7.11 0.19 0.31 0.00 0.20 SEQID-01872 0.03 0.04 0.03 0.03 0.04
0.03 0.04 0.03 -24.32 0.29 -0.03 5.13 0.20 0.36 0.00 0.20
SEQID-01873 0.03 0.05 0.04 0.04 0.04 0.02 0.04 0.07 -23.56 0.32
0.00 7.11 0.42 0.64 0.00 0.00 SEQID-01874 0.00 0.07 0.04 0.03 0.04
0.01 0.05 0.05 -24.99 0.33 -0.01 6.33 0.80 0.90 0.00 0.22
SEQID-01875 0.03 0.05 0.03 0.04 0.04 0.01 0.04 0.07 -20.83 0.43
0.01 8.12 0.85 0.99 0.21 0.22 SEQID-01876 0.04 0.05 0.04 0.04 0.06
0.02 0.09 0.08 -19.08 0.62 -0.02 4.92 0.19 0.35 0.18 0.20
SEQID-01877 0.04 0.04 0.04 0.04 0.05 0.01 0.09 0.08 -20.69 0.45
0.01 7.94 0.22 0.31 0.00 0.22 SEQID-01878 0.04 0.04 0.03 0.03 0.04
0.03 0.09 0.04 -23.47 0.31 -0.03 5.12 0.21 0.34 0.00 0.20
SEQID-01879 0.04 0.06 0.03 0.05 0.06 0.02 0.04 0.09 -17.84 0.47
0.02 8.58 0.69 0.85 0.00 0.21 SEQID-01880 0.04 0.06 0.04 0.05 0.06
0.03 0.03 0.08 -18.26 0.64 -0.02 4.99 0.18 0.35 0.19 0.20
SEQID-01881 0.02 0.04 0.06 0.05 0.05 0.03 0.05 0.07 -23.52 0.30
-0.01 6.23 0.19 0.33 0.19 0.20 SEQID-01882 0.01 0.02 0.18 0.03 0.03
0.01 0.02 0.04 -13.80 0.20 0.01 9.54 0.95 1.00 0.21 0.39
SEQID-01883 0.04 0.03 0.03 0.05 0.04 0.01 0.09 0.04 -24.90 0.20
0.04 9.62 0.18 0.33 0.19 0.18 SEQID-01884 0.01 0.08 0.03 0.04 0.05
0.02 0.07 0.06 -21.41 0.25 0.07 8.46 0.22 0.30 0.21 0.23
SEQID-01885 0.04 0.06 0.06 0.03 0.03 0.00 0.02 0.05 -23.23 0.36
-0.04 4.61 0.33 0.46 0.00 0.25 SEQID-01886 0.01 0.04 0.04 0.03 0.05
0.03 0.02 0.09 -19.17 0.44 0.00 7.03 0.65 0.384 0.00 0.22
SEQID-01887 0.03 0.05 0.05 0.04 0.04 0.02 0.04 0.06 -21.09 0.44
-0.04 4.95 0.00 0.41 0.00 0.18 SEQID-01888 0.03 0.09 0.02 0.04 0.03
0.03 0.06 0.07 -16.87 0.54 0.07 10.33 0.21 0.34 0.00 0.00
SEQID-01889 0.05 0.09 0.03 0.02 0.05 0.01 0.02 0.05 -25.05 0.32
-0.04 4.61 0.41 0.59 0.25 0.23 SEQID-01890 0.04 0.05 0.04 0.05 0.03
0.02 0.01 0.08 -20.27 0.44 0.01 8.04 0.22 0.35 0.21 0.22
SEQID-01891 0.02 0.05 0.05 0.06 0.05 0.03 0.05 0.098 -22.19 0.34
-0.03 5.09 0.19 0.34 0.19 0.18 SEQID-01892 0.03 0.03 0.03 0.05 0.03
0.03 0.03 0.10 -18.61 0.56 0.01 8.23 0.23 0.31 0.00 0.21
SEQID-01893 0.02 0.05 0.06 0.04 0.05 0.02 0.04 0.09 -23.86 0.90
0.00 6.49 0.19 0.35 0.19 0.20 SEQID-01894 0.01 0.05 0.07 0.05 0.05
0.05 0.06 0.05 -20.39 0.32 0.02 7.97 0.22 0.31 0.00 0.22
SEQID-01895 0.04 0.03 0.05 0.03 0.05 0.05 0.03 0.04 -23.30 0.27
0.02 9.08 0.21 0.30 0.21 0.20 SEQID-01896 0.02 0.02 0.03 0.05 0.05
0.02 0.09 0.06 -25.22 0.18 0.04 9.62 0.00 0.34 0.18 0.18
SEQID-01897 0.02 0.04 0.02 0.06 0.05 0.00 0.09 0.05 -25.35 0.18
-0.03 4.94 0.30 0.45 0.20 0.22 SEQID-01898 0.03 0.07 0.04 0.05 0.05
0.01 0.05 0.06 -19.06 0.48 0.00 7.01 0.21 0.32 0.00 0.22
SEQID-01899 0.04 0.04 0.02 0.04 0.07 0.02 0.03 0.07 -19.21 0.46
0.01 8.28 0.20 0.34 0.00 0.20 SEQID-01900 0.02 0.04 0.04 0.06 0.05
0.03 0.06 0.07 -22.22 0.31 -0.01 6.46 0.18 0.35 0.19 0.19
SEQID-01901 0.04 0.05 0.06 0.09 0.05 0.01 0.05 0.04 -17.28 0.20
0.01 8.67 0.24 0.40 0.25 0.25 SEQID-01902 0.02 0.01 0.03 0.02 0.01
0.01 0.03 0.03 -38.43 0.07 -0.01 6.36 0.23 0.36 0.23 0.23
SEQID-01903 0.03 0.08 0.06 0.05 0.04 0.02 0.07 0.07 -15.95 0.55
0.04 9.68 0.20 0.34 0.00 0.21 SEQID-01904 0.02 0.06 0.03 0.04 0.06
0.03 0.05 0.06 -21.24 0.34 0.02 8.76 0.21 0.31 0.00 0.21
SEQID-01905 0.02 0.05 0.07 0.05 0.07 0.01 0.04 0.09 -18.84 0.32
-0.02 5.81 0.00 0.39 0.17 0.22 SEQID-01906 0.03 0.05 0.04 0.04 0.05
0.02 0.04 0.06 -22.41 0.34 0.01 8.31 0.37 0.56 0.00 0.20
SEQID-01907 0.03 0.07 0.04 0.05 0.06 0.04 0.03 0.05 -19.24 0.41
0.01 8.17 0.20 0.33 0.00 0.21 SEQID-01908 0.04 0.00 0.00 0.03 0.03
0.00 0.02 0.03 -36.92 0.12 -0.11 4.32 0.55 0.68 0.23 0.25
SEQID-01909 0.02 0.04 0.03 0.05 0.05 0.00 0.05 0.07 -19.57 0.43
0.01 9.19 0.21 0.32 0.00 0.21 SEQID-01910 0.02 0.04 0.05 0.04 0.05
0.02 0.04 0.05 -19.81 0.39 0.01 8.14 0.20 0.33 0.00 0.21
SEQID-01911 0.02 0.03 0.04 0.06 0.07 0.02 0.02 0.10 -20.99 0.34
-0.01 6.28 0.21 0.32 0.19 0.21 SEQID-01912 0.01 0.07 0.04 0.06 0.05
0.01 0.02 0.08 -16.91 0.42 0.03 9.14 0.24 0.31 0.00 0.26
SEQID-01913 0.02 0.07 0.02 0.03 0.01 0.02 0.02 0.12 -18.96 0.49
0.01 7.84 0.25 0.31 0.24 0.26 SEQID-01914 0.01 0.10 0.089 0.07 0.04
0.02 0.02 0.05 -23.35 0.27 0.01 7.38 0.24 0.35 0.23 0.24
SEQID-01915 0.03 0.02 0.24 0.03 0.01 0.00 0.00 0.02 -12.61 0.11
0.02 10.55 0.70 0.80 0.31 0.48 SEQID-01916 0.04 0.01 0.03 0.04 0.03
0.02 0.02 0.05 -30.81 0.23 0.07 10.38 0.26 0.33 0.00 0.21
SEQID-01917 0.01 0.04 0.13 0.05 0.02 0.01 0.04 0.08 -16.73 0.44
-0.01 6.39 0.27 0.33 0.29 0.27 SEQID-01918 0.04 0.11 0.04 0.02 0.05
0.00 0.02 0.05 -26.07 0.31 -0.05 4.56 0.41 0.60 0.00 0.00
SEQID-01919 0.03 0.05 0.06 0.05 0.06 0.00 0.02 0.08 -16.12 0.56
0.02 8.90 0.51 0.69 0.22 0.21 SEQID-01920 0.03 0.04 0.03 0.06 0.04
0.02 0.03 0.08 -20.62 0.54 0.00 6.53 0.25 0.33 0.17 0.00
SEQID-01921 0.01 0.03 0.05 0.04 0.04 0.01 0.05 0.07 -19.18 0.43
0.00 6.63 0.20 0.33 0.00 0.21 SEQID-01922 0.03 0.04 0.05 0.04 0.06
0.00 0.04 0.08 -17.78 0.51 -0.03 4.92 0.22 0.33 0.23 0.22
SEQID-01923 0.02 0.05 0.08 0.06 0.03 0.01 0.03 0.03 -23.01 0.25
-0.09 4.22 0.23 0.40 0.20 0.23 SEQID-01924 0.02 0.04 0.05 0.05 0.04
0.03 0.09 0.03 -22.92 0.44 0.01 7.66 0.20 0.28 0.21 0.22
SEQID-01925 0.01 0.03 0.21 0.04 0.03 0.01 0.01 0.03 -13.36 0.14
0.00 5.29 0.50 0.73 0.29 0.46 SEQID-01926 0.04 0.06 0.03 0.03 0.04
0.00 0.02 0.07 -17.97 0.56 -0.03 5.11 0.22 0.30 0.00 0.23
SEQID-01927 0.04 0.05 0.04 0.05 0.06 0.02 0.03 0.09 -20.09 0.45
0.04 9.88 0.21 0.33 0.00 0.21 SEQID-01928 0.02 0.04 0.06 0.04 0.02
0.03 0.02 0.07 -20.39 0.43 -0.01 6.51 0.22 0.34 0.22 0.23
SEQID-01929 0.02 0.04 0.01 0.04 0.05 0.01 0.04 0.04 -28.64 0.25
-0.01 6.48 0.22 0.40 0.00 0.20 SEQID-01930 0.03 0.05 0.05 0.05 0.04
0.03 0.06 0.05 -19.50 0.38 0.00 6.80 0.19 0.35 0.18 0.19
SEQID-01931 0.02 0.04 0.04 0.04 0.06 0.02 0.05 0.06 -18.28 0.41
0.02 8.47 0.24 0.31 0.00 0.20 SEQID-01932 0.03 0.05 0.03 0.05 0.06
0.03 0.05 0.10 -18.27 0.46 0.02 8.91 0.69 0.84 0.00 0.22
SEQID-01933 0.02 0.04 0.04 0.05 0.06 0.02 0.05 0.05 -18.20 0.40
0.02 8.61 0.24 0.31 0.00 0.20 SEQID-01934 0.02 0.05 0.03 0.04 0.03
0.01 0.04 0.06 -21.81 0.39 0.00 7.27 0.98 1.00 0.21 0.21
SEQID-01935 0.02 0.05 0.03 0.04 0.04 0.01 0.04 0.06 -21.72 0.38
0.00 7.09 1.00 1.00 0.20 0.22 SEQID-01936 0.05 0.04 0.04 0.05 0.06
0.02 0.06 0.05 -19.65 0.42 -0.03 5.05 0.19 0.30 0.00 0.19
SEQID-01937 0.04 0.06 0.04 0.04 0.05 0.02 0.03 0.06 -23.67 0.30
0.00 6.93 0.43 0.61 0.00 0.21 SEQID-01938 0.02 0.04 0.03 0.04 0.04
0.04 0.02 0.09 -19.79 0.43 0.01 7.89 0.68 0.76 0.22 0.00
SEQID-01939 0.05 0.06 0.04 0.04 0.04 0.02 0.03 0.06 -23.33 0.31
0.00 6.92 0.43 0.64 0.00 0.20 SEQID-01940 0.02 0.00 0.00 0.04 0.04
0.00 0.03 0.03 -36.46 0.13 -0.10 4.34 0.58 0.68 0.25 0.22
SEQID-01941 0.04 0.04 0.03 0.04 0.05 0.01 0.03 0.06 -21.67 0.42
0.01 8.12 0.20 0.35 0.00 0.22 SEQID-01942 0.05 0.06 0.07 0.02 0.03
0.00 0.02 0.07 -23.48 0.34 -0.06 4.40 0.28 0.37 0.00 0.24
SEQID-01943 0.04 0.06 0.03 0.03 0.03 0.02 0.06 0.06 -22.73 0.34
0.00 7.18 0.20 0.33 0.00 0.20 SEQID-01944 0.04 0.06 0.03 0.04 0.04
0.01 0.01 0.08 -20.06 0.45 0.01 8.29 0.22 0.35 0.00 0.21
SEQID-01945 0.05 0.06 0.07 0.02 0.03 0.00 0.02 0.07 -23.48 0.34
-0.06 4.40 0.28 0.37 0.00 0.24 SEQID-01946 0.04 0.09 0.03 0.04 0.04
0.01 0.03 0.06 -23.98 0.39 -0.06 4.41 0.41 0.54 0.00 0.23
SEQID-01947 0.04 0.03 0.04 0.03 0.05 0.05 0.03 0.04 -22.93 0.30
0.03 9.29 0.21 0.30 0.20 0.00 SEQID-01948 0.09 0.01 0.01 0.04 0.02
0.01 0.01 0.05 -31.88 0.29 0.04 10.04 0.28 0.36 0.22 0.25
SEQID-01949 0.04 0.03 0.03 0.04 0.04 0.00 0.05 0.07 -25.50 0.40
0.01 8.17 0.00 0.33 0.00 0.21 SEQID-01950 0.02 0.03 0.09 0.03 0.07
0.02 0.04 0.07 -22.65 0.29 -0.01 5.76 0.21 0.44 0.00 0.23
SEQID-01951 0.02 0.14 0.01 0.02 0.05 0.00 0.00 0.04 -24.37 0.45
-0.04 4.73 1.00 1.00 0.24 0.22 SEQID-01952 0.04 0.02 0.03 0.03 0.06
0.00 0.02 0.10 -20.88 0.50 -0.01 5.38 0.20 0.35 0.19 0.22
SEQID-01953 0.01 0.02 0.04 0.03 0.02 0.01 0.01 0.04 -39.35 0.11
-0.03 5.20 0.24 0.40 0.23 0.25 SEQID-01954 0.04 0.06 0.03 0.02 0.06
0.01 0.01 0.09 -19.05 0.60 0.00 6.97 0.22 0.32 0.00 0.22
SEQID-01955 0.03 0.04 0.04 0.04 0.06 0.02 0.04 0.08 -20.42 0.45
0.03 9.75 0.21 0.31 0.00 0.21 SEQID-01956 0.04 0.05 0.02 0.04 0.05
0.02 0.04 0.04 -22.36 0.29 -0.07 4.39 0.20 0.34 0.00 0.21
SEQID-01957 0.04 0.09 0.02 0.05 0.04 0.03 0.06 0.05 -16.87 0.53
0.06 10.30 0.20 0.31 0.00 0.20 SEQID-01958 0.03 0.06 0.04 0.04 0.06
0.03 0.06 0.06 -20.42 0.37 0.01 7.71 0.21 0.34 0.00 0.20
SEQID-01959 0.04 0.05 0.04 0.04 0.06 0.02 0.03 0.05 -21.88 0.34
0.01 7.73 0.37 0.59 0.00 0.21 SEQID-01960 0.03 0.03 0.04 0.05 0.05
0.00 0.04 0.08 -18.98 0.44 0.02 9.29 0.21 0.33 0.19 0.22
SEQID-01961 0.03 0.07 0.04 0.05 0.05 0.01 0.05 0.07 -18.96 0.44
0.00 7.19 0.21 0.33 0.00 0.21 SEQID-01962 0.02 0.07 0.04 0.06 0.05
0.01 0.07 0.06 -19.47 0.32 0.01 9.19 0.20 0.33 0.00 0.20
SEQID-01963 0.02 0.07 0.04 0.06 0.05 0.01 0.07 0.06 -19.50 0.32
0.01 9.03 0.20 0.33 0.00 0.20 SEQID-01964 0.04 0.02 0.03 0.03 0.06
0.00 0.02 0.07 -22.39 0.45 -0.03 4.71 0.21 0.34 0.22 0.22
SEQID-01965 0.02 0.02 0.06 0.07 0.05 0.00 0.02 0.08 -22.73 0.33
-0.02 5.25 0.19 0.34 0.20 0.20 SEQID-01966 0.02 0.02 0.05 0.05 0.05
0.00 0.01 0.08 -23.32 0.37 -0.02 5.11 0.20 0.36 0.00 0.21
SEQID-01967 0.03 0.06 0.04 0.04 0.04 0.01 0.05 0.08 -21.62 0.44
-0.03 4.79 0.19 0.32 0.00 0.22 SEQID-01968 0.03 0.06 0.04 0.04 0.04
0.01 0.05 0.08 -21.87 0.43 -0.03 4.88 0.20 0.33 0.00 0.22
SEQID-01969 0.05 0.04 0.03 0.04 0.0J 0.01 0.02 0.07 -19.58 0.53
-0.03 5.04 0.18 0.32 0.20 0.22 SEQID-01970 0.04 0.03 0.04 0.05 0.05
0.00 0.05 0.07 -18.79 0.41 -0.02 6.01 0.20 0.31 0.00 0.20
SEQID-01971 0.02 0.04 0.05 0.04 0.06 0.03 0.01 0.05 -22.65 0.19
0.02 9.92 0.21 0.33 0.17 0.00 SEQID-01972 0.01 0.04 0.04 0.04 0.03
0.03 0.07 0.05 -20.52 0.33 -0.03 4.96 0.18 0.36 0.19 0.19
SEQID-01973 0.01 0.03 0.05 0.09 0.05 0.02 0.04 0.06 -17.93 0.33
0.01 8.38 0.20 0.35 0.20 0.21 SEQID-01974 0.03 0.02 0.03 0.05 0.07
0.03 0.04 0.10 -17.52 0.53 -0.01 6.51 0.46 0.62 0.00 0.20
SEQID-01975 0.03 0.02 0.03 0.05 0.07 0.03 0.04 0.10 -17.78 0.52
0.00 6.72 0.46 0.62 0.00 0.19 SEQID-01976 0.03 0.07 0.06 0.04 0.06
0.03 0.07 0.05 -18.64 0.28 0.02 9.52 0.22 0.31 0.00 0.20
SEQID-01977 0.03 0.09 0.04 0.05 0.05 0.06 0.04 0.05 -12.42 0.65
0.01 7.91 0.20 0.34 0.00 0.21 SEQID-01978 0.02 0.04 0.03 0.03 0.04
0.00 0.03 0.06 -24.74 0.39 -0.02 5.17 0.20 0.33 0.52 0.21
SEQID-01979 0.01 0.05 0.06 0.08 0.09 0.01 0.03 0.07 -13.51 0.41
0.00 6.95 0.20 0.37 0.20 0.20 SEQID-01980 0.02 0.04 0.05 0.04 0.04
0.01 0.05 0.07 -22.92 0.34 -0.02 5.09 0.20 0.34 0.20 0.20
SEQID-01981 0.04 0.04 0.04 0.02 0.08 0.00 0.03 0.08 -22.02 0.46
-0.03 5.12 0.22 0.31 0.20 0.22 SEQID-01982 0.04 0.04 0.05 0.03 0.06
0.02 0.07 0.04 -19.89 0.33 0.00 6.79 0.21 0.34 0.00 0.00
SEQID-01983 0.04 0.04 0.04 0.02 0.03 0.00 0.03 0.08 -21.44 0.46
-0.03 5.22 0.21 0.31 0.20 0.22 SEQID-01984 0.02 0.05 0.04 0.05 0.05
0.03 0.05 0.07 -18.58 0.45 -0.02
5.96 0.21 0.33 0.00 0.22 SEQID-01985 0.04 0.02 0.04 0.03 0.07 0.00
0.06 0.03 -24.96 0.23 0.02 8.66 0.00 0.30 0.21 0.25 SEQID-01986
0.04 0.02 0.02 0.04 0.06 0.00 0.01 0.09 -20.21 0.51 -0.03 4.60 0.21
0.35 0.22 0.21 SEQID-01987 0.02 0.05 0.03 0.05 0.07 0.03 0.05 0.05
-20.16 0.29 -0.03 5.06 0.16 0.35 0.18 0.19 SEQID-01988 0.03 0.04
0.04 0.05 0.05 0.01 0.04 0.09 -21.92 0.44 -0.04 4.75 0.20 0.32 0.00
0.20 SEQID-01989 0.02 0.03 0.04 0.04 0.06 0.01 0.03 0.08 -22.26
0.39 -0.06 4.33 0.19 0.34 0.20 0.20 SEQID-01990 0.05 0.10 0.05 0.04
0.05 0.03 0.03 0.10 -21.67 0.43 -0.03 4.62 0.35 0.46 0.00 0.23
SEQID-01991 0.03 0.05 0.03 0.05 0.04 0.02 0.0a 0.07 -19.43 0.27
0.01 9.01 0.23 0.32 0.00 0.23 SEQID-01992 0.04 0.07 0.06 0.03 0.06
0.03 0.03 0.06 -16.92 0.43 -0.02 4.62 0.21 0.33 0.00 0.00
SEQID-01993 0.03 0.13 0.05 0.04 0.05 0.06 0.03 0.07 -14.71 0.55
-0.01 6.13 0.22 0.36 0.22 0.23 SEQID-01994 0.03 0.03 0.04 0.05 0.05
0.00 0.05 0.07 -18.50 0.48 -0.03 4.53 0.21 0.32 0.21 0.21
SEQID-01995 0.04 0.01 0.02 0.04 0.06 0.00 0.01 0.09 -20.53 0.52
-0.03 4.70 0.22 0.34 0.22 0.21 SEQID-01996 0.03 0.07 0.04 0.05 0.04
0.01 0.05 0.06 -18.00 0.45 -0.02 5.27 0.19 0.33 0.00 0.22
SEQID-01997 0.02 0.05 0.03 0.05 0.06 0.03 0.05 0.05 -20.64 0.28
-0.03 4.99 0.16 0.35 0.18 0.19 SEQID-01998 0.03 0.11 0.05 0.04 0.05
0.06 0.04 0.07 -14.37 0.56 -0.01 6.40 0.22 0.36 0.00 0.23
SEQID-01999 0.04 0.02 0.04 0.04 0.07 0.00 0.06 0.03 -24.83 0.23
0.02 8.66 0.24 0.31 0.00 0.00 SEQID-02000 0.03 0.07 0.05 0.03 0.07
0.01 0.05 0.04 -22.75 0.22 0.02 8.96 0.22 0.28 0.19 0.21
SEQID-02001 0.05 0.03 0.03 0.06 0.06 0.00 0.08 0.08 -20.51 0.45
-0.03 4.60 0.00 0.31 0.26 0.24 SEQID-02002 0.02 0.05 0.03 0.08 0.05
0.01 0.09 0.06 -19.91 0.29 0.01 8.38 0.21 0.34 0.00 0.00
SEQID-02003 0.04 0.05 0.05 0.05 0.05 0.00 0.04 0.09 -18.47 0.49
-0.03 4.64 0.21 0.33 0.21 0.22 SEQID-02004 0.02 0.03 0.04 0.04 0.07
0.00 0.02 0.08 -22.68 0.36 -0.04 4.52 0.49 0.78 0.00 0.21
SEQID-02005 0.03 0.07 0.04 0.05 0.04 0.01 0.05 0.06 -17.91 0.46
-0.03 5.03 0.21 0.33 0.00 0.22 SEQID-02006 0.03 0.09 0.04 0.04 0.05
0.07 0.06 0.05 -12.46 0.63 0.00 7.04 0.20 0.31 0.00 0.20
SEQID-02007 0.01 0.03 0.02 0.07 0.05 0.00 0.03 0.02 -24.40 0.16
-0.03 4.85 0.22 0.39 0.00 0.19 SEQID-02008 0.04 0.02 0.02 0.06 0.06
0.00 0.11 0.06 -16.77 0.44 0.00 6.60 0.23 0.30 0.21 0.25
SEQID-02009 0.03 0.09 0.04 0.04 0.03 0.06 0.05 0.06 -12.75 0.69
-0.01 6.58 0.21 0.34 0.00 0.22 SEQID-02010 0.03 0.05 0.04 0.03 0.04
0.03 0.07 0.05 -20.82 0.31 -0.02 6.11 0.20 0.34 0.00 0.20
SEQID-02011 0.03 0.04 0.05 0.05 0.04 0.02 0.04 0.06 -18.19 0.42
-0.02 5.59 0.20 0.34 0.20 0.21 SEQID-02012 0.01 0.04 0.03 0.07 0.06
0.00 0.04 0.03 -22.36 0.24 -0.01 5.90 0.22 0.35 0.19 0.21
SEQID-02013 0.02 0.04 0.04 0.05 0.06 0.00 0.04 0.06 -20.36 0.41
-0.02 5.32 0.22 0.31 0.00 0.00 SEQID-02014 0.01 0.02 0.01 0.05 0.07
0.01 0.00 0.04 -24.24 0.09 -0.09 4.24 0.23 0.36 0.20 0.21
SEQID-02015 0.03 0.09 0.05 0.03 0.04 0.06 0.07 0.05 -20.47 0.34
-0.04 5.55 0.19 0.36 0.00 0.20 SEQID-02016 0.01 0.00 0.24 0.06 0.07
0.00 0.00 0.04 -29.60 0.05 0.00 7.54 0.33 0.35 0.33 0.34
SEQID-02017 0.04 0.04 0.03 0.08 0.06 0.00 0.05 0.07 -16.22 0.56
-0.02 4.71 0.00 0.32 0.23 0.23 SEQID-02018 0.03 0.02 0.03 0.03 0.06
0.01 0.05 0.08 -23.78 0.41 -0.03 4.90 0.24 0.31 0.00 0.24
SEQID-02019 0.04 0.10 0.04 0.06 0.04 0.05 0.06 0.07 -10.97 0.74
-0.02 5.24 0.21 0.31 0.00 0.20 SEQID-02020 0.02 0.06 0.04 0.03 0.05
0.01 0.02 0.07 -20.48 0.50 -0.02 5.04 0.21 0.33 0.21 0.23
SEQID-02021 0.04 0.03 0.02 0.03 0.04 0.01 0.02 0.07 -26.59 0.33
-0.01 5.56 0.22 0.34 0.19 0.00 SEQID-02022 0.02 0.04 0.03 0.05 0.05
0.01 0.03 0.07 -21.00 0.39 0.00 8.02 0.21 0.33 0.00 0.00
SEQID-02023 0.04 0.04 0.03 0.03 0.07 0.01 0.03 0.08 -19.81 0.47
-0.02 5.81 0.22 0.32 0.00 0.21 SEQID-02024 0.03 0.05 0.05 0.04 0.04
0.04 0.06 0.05 -19.74 0.33 -0.02 6.18 0.19 0.33 0.00 0.20
SEQID-02025 0.02 0.05 0.03 0.04 0.05 0.02 0.06 0.06 -21.52 0.37
-0.02 5.59 0.19 0.33 0.19 0.20 SEQID-02026 0.03 0.03 0.02 0.03 0.04
0.01 0.02 0.07 -27.34 0.28 -0.01 5.56 0.23 0.33 0.00 0.00
SEQID-02027 0.02 0.01 0.06 0.05 0.05 0.01 0.04 0.07 -21.18 0.31
0.13 11.71 0.25 0.35 0.21 0.24 SEQID-02028 0.01 0.04 0.21 0.03 0.06
0.01 0.02 0.06 -24.60 0.34 -0.01 5.18 0.23 0.44 0.26 0.24
SEQID-02029 0.03 0.05 0.04 0.06 0.07 0.02 0.04 0.08 -18.14 0.47
-0.02 5.39 0.58 0.79 0.00 0.22 SEQID-02030 0.02 0.07 0.04 0.06 0.05
0.02 0.08 0.05 -18.45 0.35 0.00 7.05 0.23 0.32 0.00 0.22
SEQID-02031 0.03 0.06 0.06 0.05 0.04 0.03 0.04 0.06 -19.68 0.41
-0.04 4.61 0.22 0.35 0.00 0.23 SEQID-02032 0.01 0.05 0.03 0.05 0.03
0.01 0.02 0.08 -19.30 0.61 0.00 7.53 0.23 0.33 0.00 0.00
SEQID-02033 0.02 0.08 0.05 0.05 0.05 0.02 0.03 0.08 -18.53 0.45
0.00 6.31 0.22 0.33 0.00 0.22 SEQID-02034 0.03 0.03 0.04 0.03 0.03
0.02 0.04 0.07 -22.24 0.40 0.01 8.52 0.20 0.34 0.00 0.21
SEQID-02035 0.04 0.05 0.03 0.06 0.06 0.00 0.09 0.04 -17.35 0.41
0.05 9.69 0.26 0.30 0.00 0.23 SEQID-02036 0.06 0.05 0.11 0.05 0.07
0.00 0.02 0.04 -22.02 0.20 0.06 10.52 0.28 0.37 0.27 0.26
SEQID-02037 0.03 0.04 0.03 0.06 0.06 0.01 0.02 0.08 -20.95 0.45
0.02 9.48 0.21 0.33 0.00 0.24 SEQID-02038 0.01 0.02 0.03 0.04 0.05
0.03 0.09 0.09 -23.12 0.36 0.06 10.69 0.00 0.30 0.23 0.21
SEQID-02039 0.03 0.02 0.02 0.06 0.04 0.01 0.01 0.04 -23.29 0.20
-0.03 4.72 0.25 0.33 0.00 0.00 SEQID-02040 0.00 0.08 0.06 0.06 0.07
0.00 0.05 0.06 -18.92 0.43 -0.03 4.56 0.21 0.31 0.21 0.21
SEQID-02041 0.04 0.02 0.03 0.03 0.03 0.02 0.07 0.05 -25.62 0.42
-0.06 4.47 0.21 0.32 0.22 0.18 SEQID-02042 0.02 0.06 0.02 0.04 0.07
0.01 0.02 0.07 -20.68 0.45 -0.03 4.97 0.00 0.33 0.00 0.19
SEQID-02043 0.06 0.03 0.03 0.06 0.04 0.00 0.00 0.06 -25.21 0.43
-0.07 4.34 0.25 0.34 0.23 0.00 SEQID-02044 0.06 0.05 0.10 0.07 0.06
0.00 0.02 0.03 -22.27 0.22 0.07 10.62 0.25 0.37 0.26 0.27
SEQID-02045 0.05 0.04 0.02 0.05 0.04 0.00 0.02 0.08 -19.54 0.57
0.00 6.55 0.23 0.32 0.00 0.24 SEQID-02046 0.03 0.04 0.04 0.06 0.06
0.00 0.02 0.07 -24.59 0.32 -0.11 4.15 0.22 0.35 0.00 0.00
SEQID-02047 0.03 0.04 0.04 0.05 0.04 0.01 0.04 0.09 -18.87 0.49
-0.02 4.99 0.21 0.34 0.20 0.22 SEQID-02048 0.03 0.04 0.05 0.03 0.05
0.00 0.03 0.06 -25.99 0.25 -0.11 4.09 0.22 0.36 0.00 0.22
SEQID-02049 0.03 0.06 0.07 0.06 0.05 0.03 0.04 0.06 -19.40 0.39
-0.04 4.55 0.21 0.33 0.00 0.23 SEQID-02050 0.00 0.10 0.02 0.06 0.05
0.01 0.04 0.07 -22.40 0.42 -0.19 3.30 0.16 0.41 0.18 0.19
SEQID-02051 0.01 0.03 0.01 0.05 0.05 0.00 0.04 0.08 -24.36 0.33
0.09 11.10 0.23 0.29 0.26 0.00 SEQID-02052 0.04 0.03 0.04 0.04 0.04
0.02 0.05 0.05 -22.91 0.49 -0.03 4.73 0.21 0.32 0.00 0.23
SEQID-02053 0.02 0.04 0.05 0.09 0.05 0.01 0.02 0.05 -22.60 0.23
0.02 9.77 0.25 0.32 0.00 0.25 SEQID-02054 0.03 0.08 0.05 0.06 0.05
0.05 0.03 0.04 -16.03 0.28 -0.03 5.51 0.40 0.48 0.00 0.24
SEQID-02055 0.04 0.05 0.04 0.04 0.04 0.02 0.05 0.06 -21.40 0.40
0.01 8.44 0.20 0.33 0.00 0.00 SEQID-02056 0.03 0.14 0.04 0.04 0.05
0.07 0.03 0.06 -11.96 0.78 -0.01 5.83 0.20 0.32 0.00 0.23
SEQID-02057 0.05 0.05 0.04 0.02 0.02 0.04 0.07 0.07 -21.18 0.39
-0.03 5.20 0.21 0.31 0.00 0.20 SEQID-02058 0.03 0.04 0.07 0.05 0.06
0.02 0.03 0.09 -15.02 0.54 -0.02 5.10 0.29 0.45 0.00 0.23
SEQID-02059 0.04 0.07 0.05 0.05 0.04 0.02 0.04 0.08 -10.95 1.04
0.03 10.49 0.21 0.34 0.00 0.21 SEQID-02060 0.02 0.01 0.01 0.06 0.07
0.01 0.02 0.06 -22.39 0.18 -0.02 5.77 0.23 0.36 0.18 0.21
SEQID-02061 0.01 0.04 0.05 0.04 0.05 0.01 0.02 0.06 -20.56 0.42
-0.02 4.99 0.20 0.33 0.21 0.21 SEQID-02062 0.04 0.05 0.05 0.04 0.04
0.01 0.02 0.08 -20.85 0.52 -0.02 4.76 0.21 0.36 0.20 0.22
SEQID-02063 0.02 0.07 0.05 0.04 0.05 0.01 0.06 0.04 -19.08 0.36
0.00 6.75 0.20 0.35 0.00 0.21 SEQID-02064 0.03 0.05 0.05 0.04 0.06
0.02 0.04 0.07 -18.79 0.44 -0.04 4.64 0.19 0.34 0.00 0.21
SEQID-02065 0.04 0.06 0.05 0.04 0.05 0.01 0.05 0.06 -18.55 0.48
-0.02 5.32 0.19 0.35 0.00 0.20 SEQID-02066 0.03 0.05 0.04 0.05 0.05
0.03 0.05 0.06 -18.95 0.40 -0.01 6.14 0.18 0.35 0.20 0.19
SEQID-02067 0.02 0.01 0.04 0.06 0.04 0.00 0.05 0.12 -22.91 0.61
-0.02 4.88 0.25 0.32 0.25 0.00 SEQID-02068 0.08 0.07 0.07 0.09 0.05
0.00 0.03 0.02 -26.12 0.09 0.07 10.60 0.24 0.31 0.17 0.00
SEQID-02069 0.04 0.04 0.04 0.03 0.05 0.02 0.04 0.11 -17.36 0.62
-0.01 5.87 0.25 0.30 0.00 0.26 SEQID-02070 0.01 0.03 0.03 0.03 0.08
0.00 0.04 0.08 -23.78 0.34 0.02 9.75 0.25 0.34 0.27 0.23
SEQID-02071 0.03 0.06 0.04 0.05 0.04 0.04 0.05 0.03 -17.18 0.59
0.00 6.52 0.21 0.34 0.24 0.00 SEQID-02072 0.03 0.06 0.04 0.05 0.03
0.04 0.05 0.04 -17.10 0.62 0.00 6.52 0.21 0.34 0.24 0.00
SEQID-02073 0.01 0.05 0.10 0.03 0.06 0.01 0.05 0.07 -18.26 0.47
0.03 9.73 0.25 0.31 0.00 0.24 SEQID-02074 0.04 0.04 0.03 0.08 0.06
0.01 0.05 0.08 -14.10 0.64 -0.02 4.89 0.28 0.34 0.00 0.00
SEQID-02075 0.03 0.05 0.06 0.03 0.03 0.01 0.07 0.06 -24.22 0.34
0.00 6.97 0.22 0.31 0.00 0.23 SEQID-02076 0.02 0.04 0.06 0.06 0.07
0.03 0.05 0.07 -20.99 0.36 -0.03 4.68 0.42 0.53 0.00 0.24
SEQID-02077 0.03 0.03 0.05 0.04 0.09 0.00 0.0 4 0.07 -19.18 0.30
0.08 10.75 0.22 0.32 0.18 0.26 SEQID-02078 0.03 0.04 0.06 0.05 0.03
0.03 0.02 0.09 -17.54 0.60 -0.02 5.90 0.17 0.34 0.00 0.19
SEQID-02079 0.01 0.05 0.05 0.06 0.06 0.02 0.10 0.03 -13.17 0.30
-0.02 4.59 0.22 0.32 0.00 0.23 SEQID-02080 0.02 0.11 0.03 0.04 0.04
0.03 0.06 0.04 -23.47 0.37 0.00 6.91 0.20 0.32 0.00 0.20
SEQID-02081 0.04 0.05 0.06 0.04 0.05 0.01 0.06 0.05 -20.97 0.33
0.00 6.80 0.21 0.33 0.00 0.00 SEQID-02082 0.04 0.07 0.05 0.04 0.06
0.01 0.0 0.07 -16.07 0.50 -0.02 5.43 0.22 0.33 0.00 0. 2
SEQID-02083 0.03 0.05 0.04 0.04 0.05 0.02 0.06 0.06 -18.69 0.44
-0.02 4.94 0.21 0.34 0.21 0.21 SEQID-02084 0.06 0.07 0.05 0.04 0.06
0.05 0.08 0.05 -17.64 0.40 -0.02 5.65 0.20 0.31 0.00 0.21
SEQID-02085 0.00 0.03 0.03 0.05 0.04 0.02 0.08 0.03 -18.57 0.29
-0.04 4.95 0.21 0.33 0.22 0.22 SEQID-02086 0.04 0.06 0.05 0.04 0.07
0.02 0.05 0.05 -16.31 0.46 -0.02 5.48 0.20 0.33 0.00 0.21
SEQID-02087 0.03 0.04 0.03 0.03 0.04 0.01 0.05 0.07 -23.59 0.37
-0.03 4.89 0.19 0.33 0.00 0.20 SEQID-02088 0.00 0.10 0.03 0.06 0.05
0.01 0.04 0.08 -20.74 0.42 -0.17 3.39 0.15 0.41 0.19 0.19
SEQID-02089 0.02 0.00 0.01 0.09 0.03 0.02 0.04 0.18 -17.01 0.91
-0.04 4.37 0.33 0.29 0.00 0.27 SEQID-02090 0.01 0.09 0.05 0.04 0.10
0.04 0.05 0.03 -16.04 0.63 -0.01 5.76 0.26 0.27 0.00 0.23
SEQID-02091 0.02 0.03 0.06 0.06 0.05 0.00 0.05 0.05 -24.85 0.21
0.08 10.85 0.25 0.30 0.00 0.00 SEQID-02092 0.02 0.07 0.07 0.01 0.07
0.00 0.03 0.11 -24.25 0.43 0.06 10.72 0.29 0.32 0.00 0.25
SEQID-02093 0.04 0.00 0.02 0.03 0.07 0.00 0.05 0.07 -26.07 0.29
0.14 11.85 0.2 0.29 0.28 0.00 SEQID-02094 0.02 0.06 0.02 0.04 0.09
0.00 0.08 0.08 -20.86 0.38 -0.04 4.59 0.25 0.34 0.25 0.22
SEQID-02095 0.03 0.07 0.04 0.05 0.03 0.04 0.01 0.06 -20.82 0.50
-0.01 6.27 0.25 0.30 0.23 0.22 SEQID-02096 0.01 0.02 0.03 0.03 0.08
0.00 0.10 0.07 -19.24 0.42 -0.04 4.45 0.00 0.31 0.00 0.24
SEQID-02097 0.01 0.01 0.04 0.04 0.04 0.01 0.01 0.13 -19.37 0.48
0.10 11.46 0.00 0.34 0.00 0.23 SEQID-02098 0.02 0.04 0.05 0.09 0.07
0.01 0.02 0.04 -21.54 0.21 0.03 9.97 0.25 0.33 0.00 0.23
SEQID-02099 0.06 0.05 0.04 0.04 0.05 0.00 0.04 0.06 -20.26 0.40
0.03 9.94 0.00 0.30 0.00 0.22 SEQID-02100 0.04 0.04 0.03 0.07 0.05
0.01 0.05 0.05 -23.47 0.38 -0.04 4.61 0.23 0.33 0.00 0.00
SEQID-02101 0.03 0.02 0.04 0.04 0.05 0.00 0.06 0.07 -21.34 0.25
0.01 8.71 0.21 0.31 0.00 0.25 SEQID-02102 0.02 0.04 0.02 0.04 0.07
0.02 0.08 0.06 -23.24 0.21 -0.03 6.18 0.22 0.29 0.21 0.22
SEQID-02103 0.04 0.03 0.04 0.04 0.06 0.01 0.03 0.07 -21.63 0.38
0.01 8.67 0.20 0.31 0.19 0.00 SEQID-02104 0.05 0.04 0.08 0.05 0.08
0.01 0.05 0.05 -17.60 0.49 0.00 7.29 0.21 0.30 0.23 0.19
SEQID-02105 0.02 0.06 0.04 0.04 0.06 0.03 0.04 0.06 -21.56 0.46
0.04 9.87 0.25 0.36 0.00 0.00 SEQID-02106 0.03 0.08 0.05 0.04 0.03
0.01 0.04 0.06 -17.76 0.58 0.01 8.77 0.22 0.35 0.00 0.20
SEQID-02107 0.03 0.06 0.04 0.04 0.05 0.02 0.06 0.0 -19.10 0.39
-0.01 6.27 0.21 0.33 0.00 0.19 SEQID-02108 0.03 0.04 0.03 0.05 0.06
0.02 0.03 0.05 -19.58 0.47 -0.04 4.60 0.51 0.68 0.21 0.21
SEQID-02109 0.02 0.02 0.04 0.03 0.06 0.02 0.05 0.08 -20.33 0.44
-0.02 5.35 0.21 0.35 0.00 0.22
SEQID-02110 0.04 0.07 0.06 0.04 0.06 0.02 0.06 0.05 -19.17 0.36
-0.04 4.63 0.21 0.33 0.20 0.22 SEQID-02111 0.03 0.07 0.02 0.06 0.05
0.02 0.02 0.08 -11.09 1.13 -0.01 4.93 0.20 0.32 0.00 0.22
SEQID-02112 0.04 0.05 0.05 0.04 0.04 0.00 0.04 0.08 -22.16 0.40
-0.04 4.71 0.21 0.32 0.00 0.22 SEQID-02113 0.03 0.03 0.06 0.04 0.05
0.30 0.0 0.08 -20.86 0.51 -0.03 4.69 0.19 0.34 0.00 0.22
SEQID-02114 0.02 0.03 0.06 0.05 0.06 0.03 0.04 0.08 -16.41 0.40
-0.01 5.65 0.20 0.39 0.00 0.21 SEQID-02115 0.04 0.05 0.06 0.04 0.06
0.01 0.03 0.06 -18.27 0.45 -0.03 4.75 0.18 0.33 0.00 0.22
SEQID-02116 0.01 0.04 0.04 0.04 0.03 0.04 0.04 0.08 -20.93 0.45
-0.02 5.70 0.18 0.37 0.19 0.20 SEQID-02117 0.05 0.06 0.04 0.01 0.10
0.02 0.04 0.08 -19.43 0.36 0.13 11.09 0.26 0.22 0.19 0.25
SEQID-02118 0.01 0.04 0.06 0.04 0.08 0.00 0.00 0.10 -26.77 0.32
0.04 10.37 0.25 0.29 0.00 0.28 SEQID-02119 0.04 0.03 0.03 0.08 0.05
0.00 0.06 0.15 -17.89 0.60 -0.01 5.70 0.21 0.30 0.00 0.00
SEQID-02120 0.04 0.05 0.02 0.06 0.05 0.02 0.06 0.05 -24.70 0.24
-0.02 4.91 0.26 0.30 0.29 0.27 SEQID-02121 0.03 0.02 0.04 0.03 0.06
0.00 0.03 0.09 -24.80 0.40 0.03 9.83 0.23 0.29 0.23 0.00
SEQID-02122 0.04 0.13 0.04 0.04 0.04 0.04 0.01 0.04 -8.41 1.32 0.01
8.53 0.19 0.28 0.21 0.00 SEQID-02123 0.03 0.04 0.05 0.08 0.06 0.00
0.06 0.08 -17.19 0.53 0.04 10.00 0.26 0.31 0.24 0.25 SEQID-02124
0.02 0.03 0.04 0.08 0.05 0.00 0.02 0.04 -18.96 0.32 0.11 11.71 0.25
0.31 0.26 0.26 SEQID-02125 0.03 0.03 0.01 0.05 0.02 0.00 0.04 0.02
-21.54 0.50 -0.02 4.88 0.24 0.36 0.25 0.25 SEQID-02126 0.01 0.09
0.02 0.03 0.06 0.03 0.03 0.0 -20.43 0.65 -0.04 4.40 0.00 0.32 0.22
0.23 SEQID-02127 0.06 0.02 0.03 0.06 0.05 0.01 0.05 0.08 -24.19
0.25 0.10 11.65 0.22 0.31 0.00 0.22 SEQID-02128 0.03 0.07 0.03 0.06
0.03 0.01 0.05 0.07 -18.79 0.54 0.00 6.77 0.24 0.30 0.00 0.23
SEQID-02129 0.01 0.03 0.00 0.04 0.02 0.00 0.02 0.04 -22.65 0.43
-0.03 4.83 0.27 0.35 0.00 0.21 SEQID-02130 0.03 0.05 0.03 0.04 0.06
0.01 0.03 0.09 -17.91 0.60 -0.01 5.86 0.30 0.35 0.22 0.20
SEQID-02131 0.03 0.03 0.02 0.07 0.04 0.01 0.03 0.07 -22.77 0.31
-0.03 4.71 0.22 0.34 0.00 0.21 SEQID-02132 0.03 0.04 0.03 0.05 0.05
0.02 0.04 0.08 -20.20 0.48 -0.05 4.58 0.38 0.50 0.17 0.25
SEQID-02133 0.03 0.07 0.02 0.06 0.05 0.02 0.03 0.05 -23.22 0.29
-0.03 4.63 0.22 0.33 0.22 0.00 SEQID-02134 0.02 0.06 0.02 0.04 0.06
0.00 0.04 0.05 -16.13 0.39 -0.12 3.40 0.26 0.39 0.33 0.26
SEQID-02135 0.04 0.01 0.04 0.05 0.04 0.00 0.04 0.09 -18.90 0.49
-0.01 6.38 0.22 0.31 0.21 0.22 SEQID-02136 0.05 0.04 0.03 0.05 0.05
0.01 0.03 0.06 -19.17 0.55 -0.03 5.05 0.22 0.33 0.00 0.00
SEQID-02137 0.02 0.05 0.06 0.03 0.06 0.01 0.05 0.11 -15.26 0.59
-0.04 4.43 0.21 0.32 0.20 0.23 SEQID-02138 0.05 0.04 0.05 0.04 0.04
0.00 0.05 0.07 -18.34 0.47 -0.02 5.32 0.19 0.31 0.20 0.19
SEQID-02139 0.04 0.03 0.04 0.04 0.04 0.00 0.023 0.10 -17.78 0.55
-0.03 4.78 0.22 0.39 0.22 0.21 SEQID-02140 0.01 0.05 0.04 0.04 0.07
0.00 0.04 0.05 -21.80 0.90 0.00 6.75 0.22 0.34 0.00 0.23
SEQID-02141 0.04 0.03 0.04 0.04 0.04 0.01 0.07 0.08 -20.82 0.37
0.01 8.41 0.22 0.33 0.00 0.18 SEQID-02142 0.03 0.05 0.05 0.04 0.07
0.00 0.0 0.05 -17.71 0.43 -0.01 6.55 0.21 0.34 0.00 0.20
SEQID-02143 0.02 0.09 0.04 0.06 0.05 0.00 0.01 0.12 -11.90 1.31
-0.05 4.02 0.21 0.34 0.00 0.22 SEQID-02144 0.032 0.04 0.03 0.04
0.06 0.01 0.03 0.09 -17.41 0.56 -0.02 5.83 0.21 0.34 0.00 0.22
SEQID-02145 0.03 0.02 0.04 0.04 0.04 0.00 0.03 0.09 -18.17 0.53
-0.03 5.38 0.22 0.33 0.00 0.22 SEQID-02146 0.02 0.06 0.04 0.03 0.04
0.03 0.05 0.08 -21.40 0.41 -0.01 6.68 0.20 0.31 0.00 0.21
SEQID-02147 0.03 0.04 0.02 0.06 0.05 0.04 0.05 0.03 -22.57 0.18
-0.04 4.69 0.20 0.34 0.00 0.20 SEQID-02148 0.02 0.02 0.05 0.06 0.06
0.01 0.03 0.07 -22.27 0.37 -0.04 4.57 0.19 0.35 0.00 0.21
SEQID-02149 0.03 0.04 0.03 0.04 0.05 0.02 0.07 0.05 -21.30 0.34
-0.02 5.61 0.20 0.32 0.00 0.20 SEQID-02150 0.10 0.03 0.02 0.14 0.04
0.02 0.08 0.08 -11.67 0.51 -0.03 4.42 0.21 0.43 0.19 0. 2
SEQID-02151 0.02 0.07 0.04 0.04 0.03 0.03 0.07 0.05 -21.86 0.34
-0.04 4.62 0.19 0.33 0.00 0.20 SEQID-02152 0.03 0.04 0.05 0.04 0.06
0.01 0.05 0.07 -19.74 0.46 -0.03 4.67 0.19 0.37 0.18 0.20
SEQID-02153 0.02 0.04 0.04 0.05 0.04 0.02 0.05 0.05 -20.57 0.34
-0.01 6.46 0.19 0.33 0.19 0.20 SEQID-02154 0.02 0.05 0.03 0.06 0.05
0.00 0.03 0.06 -24.92 0.30 -0.17 3.61 0.20 0.35 0.20 0.21
SEQID-02155 0.01 0.06 0.05 0.04 0.05 0.03 0.06 0.05 -18.77 0.38
-0.02 5.27 0.18 0.37 0.19 0.19 SEQID-02156 0.04 0.09 0.06 0.04 0.11
0.03 0.05 0.02 -12.76 0.65 0.00 6.65 0.27 0.19 0.312 0.26
SEQID-02157 0.02 0.00 0.04 0.04 0.04 0.00 0.00 0.01 -27.75 0.24
0.04 10.19 0.34 0.30 0.27 0.30 SEQID-02158 0.05 0.05 0.05 0.01 0.04
0.02 0.02 0.04 -33.89 0.16 0.01 7.70 0.27 0.23 0.00 0.00
SEQID-02159 0.04 0.02 0.04 0.06 0.08 0.02 0.06 0.07 -17.85 0.43
-0.01 5.74 0.29 0.29 0.27 0.28 SEQID-02160 0.02 0.05 0.02 0.04 0.02
0.02 0.08 0.14 -21.12 0.33 0.03 9.08 0.27 0.26 0.00 0.27
SEQID-02161 0.04 0.06 0.04 0.05 0.07 0.00 0.00 0.08 -20.90 0.46
0.01 8.23 0.27 0.30 0.00 0.23 SEQID-02162 0.09 0.05 0.03 0.08 0.05
0.00 0.07 0.06 -21.10 0.31 0.00 6.83 0.00 0.28 0.00 0.00
SEQID-02163 0.07 0.08 0.09 0.10 0.04 0.00 0.01 0.02 -23.49 0.11
0.07 10.67 0.27 0.39 0.22 0.27 SEQID-02164 0.03 0.05 0.03 0.04 0.03
0.02 0.04 0.10 -15.36 0.73 0.03 9.19 0.26 0.31 0.29 0.00
SEQID-02165 0.04 0.04 0.06 0.04 0.06 0.03 0.04 0.13 -16.83 0.54
-0.05 4.24 0.40 0.46 0.00 0.24 SEQID-02166 0.02 0.02 0.05 0.04 0.08
0.00 0.03 0.04 -25.16 0.37 0.07 10.46 0.27 0.28 0.00 0.00
SEQID-02167 0.04 0.02 0.04 0.05 0.05 0.00 0.04 0.13 -25.40 0.28
0.12 11.02 0.23 0.29 0.22 0.00 SEQID-02168 0.05 0.03 0.03 0.03 0.03
0.00 0.03 0.06 -22.21 0.32 -0.05 4.38 0.24 0.32 0.28 0.24
SEQID-02169 0.03 0.08 0.06 0.03 0.07 0.01 0.05 0.12 -16.54 0.74
-0.01 5.19 0.23 0.32 0.00 0.21 SEQID-02170 0.04 0.02 0.03 0.04 0.10
0.01 0.03 0.07 -20.64 0.43 0.09 11.06 0.24 0.30 0.00 0.23
SEQID-02171 0.03 0.03 0.03 0.02 0.05 0.00 0.04 0.10 -23.32 0.33
0.10 11.21 0.20 0.29 0.24 0.00 SEQID-02172 0.02 0.05 0.05 0.02 0.06
0.03 0.06 0.06 -17.37 0.50 0.00 6.52 0.31 0.31 0.21 0.22
SEQID-02173 0.03 0.04 0.03 0.04 0.08 0.01 0.02 0.08 -18.83 0.69
-0.04 4.48 0.00 0.33 0.00 0.21 SEQID-02174 0.01 0.07 0.05 0.04 0.06
0.01 0.06 0.07 -16.84 0.65 -0.03 4.65 0.33 0.31 0.00 0. 4
SEQID-02175 0.06 0.09 0.03 0.07 0.06 0.01 0.02 0.12 -9.86 1.25
-0.03 4.30 0.20 0.31 0.00 0.22 SEQID-02176 0.02 0.03 0.05 0.05 0.04
0.02 0.02 0.08 -19.08 0.45 -0.06 4.48 0.00 0.33 0.00 0.23
SEQID-02177 0.03 0.06 0.06 0.04 0.06 0.02 0.10 0.06 -16.64 0.38
-0.01 6.12 0.22 0.30 0.22 0.00 SEQID-02178 0.06 0.09 0.04 0.06 0.07
0.05 0.06 0.09 -12.20 0.88 0.02 9.25 0.21 0.29 0.00 0.19
SEQID-02179 0.02 0.04 0.05 0.05 0.06 0.02 0.03 0.08 -15.62 0.57
-0.02 5.15 0.20 0.32 0.00 0.24 SEQID-02180 0.04 0.03 0.05 0.05 0.06
0.01 0.03 0.10 -15.23 0.64 -0.02 4.99 0.27 0.38 0.00 0.00
SEQID-02181 0.05 0.03 0.03 0.05 0.05 0.01 0.03 0.07 -20.34 0.42
-0.01 5.12 0.24 0.34 0.00 0.19 SEQID-02182 0.02 0.07 0.04 0.03 0.05
0.02 0.06 0.07 -21.19 0.43 -0.02 5.47 0.22 0.31 0.00 0.00
SEQID-02183 0.03 0.03 0.06 0.04 0.05 0.03 0.05 0.06 -16.88 0.56
-0.01 6.36 0.20 0.31 0.00 0.00 SEQID-02184 0.02 0.03 0.03 0.05 0.06
0.01 0.03 0.06 -22.05 0.41 -0.04 4.61 0.24 0.31 0.00 0.00
SEQID-02185 0.03 0.05 0.05 0.03 0.05 0.01 0.07 0.06 -20.27 0.37
-0.01 6.51 0.21 0.34 0.00 0.00 SEQID-02186 0.02 0.11 0.04 0.02 0.05
0.04 0.06 0.07 -11.45 0.82 -0.01 6.51 0.22 0.31 0.00 0.21
SEQID-02187 0.02 0.06 0.05 0.08 0.06 0.07 0.04 0.05 -18.36 0.40
-0.04 4.52 0.19 0.34 0.00 0.21 SEQID-02188 0.05 0.08 0.03 0.04 0.04
0.01 0.06 0.07 -22.44 0.39 -0.04 4.83 0.20 0.32 0.17 0.20
SEQID-02189 0.04 0.05 0.05 0.03 0.05 0.02 0.03 0.06 -18.28 0.54
-0.01 6.44 0.17 0.31 0.23 0.21 SEQID-02190 0.04 0.03 0.05 0.04 0.06
0.01 0.03 0.08 -15.62 0.60 0.00 5.94 0.22 0.38 0.00 0.24
SEQID-02191 0.03 0.06 0.03 0.06 0.06 0.01 0.03 0.05 -16.55 0.51
-0.02 5.25 0.23 0.32 0.23 0.21 SEQID-02192 0.04 0.03 0.07 0.05 0.09
0.01 0.04 0.09 -14.81 0.52 -0.01 5.23 0.21 0.38 0.18 0.21
SEQID-02193 0.03 0.06 0.06 0.05 0.03 0.04 0.05 0.07 -10.43 1.03
-0.01 4.79 0.22 0.34 0.00 0.23 SEQID-02194 0.01 0.07 0.03 0.04 0.06
0.01 0.02 0.08 -15.31 0.79 -0.03 4.51 0.23 0.33 0.23 0.22
SEQID-02195 0.02 0.05 0.08 0.03 0.06 0.05 0.04 0.05 -19.05 0.33
-0.02 4.95 0.22 0.38 0.21 0.22 SEQID-02196 0.03 0.09 0.05 0.05 0.05
0.05 0.03 0.03 -10.73 0.96 -0.02 5.16 0.21 0.32 0.00 0.22
SEQID-02197 0.00 0.02 0.10 0.07 0.10 0.02 0.00 0.08 -26.49 0.28
-0.14 3.92 0.21 0.43 0.21 0.23 SEQID-02198 0.01 0.09 0.10 0.06 0.06
0.01 0.02 0.10 -13.64 0.45 -0.08 3.66 0.26 0.35 0.21 0.24
SEQID-02199 0.02 0.04 0.04 0.04 0.04 0.02 0.05 0.05 -18.85 0.42
-0.02 5.50 0.20 0.31 0.00 0.21 SEQID-02200 0.03 0.04 0.05 0.06 0.07
0.02 0.05 0.05 -18.13 0.35 -0.03 4.90 0.22 0.33 0.00 0.21
SEQID-02201 0.04 0.04 0.05 0.04 0.04 0.02 0.05 0.07 -17.57 0.46
-0.02 5.62 0.21 0.32 0.20 0.21 SEQID-02202 0.03 0.04 0.05 0.04 0.06
0.05 0.05 0.06 -20.49 0.35 -0.02 5.54 0.00 0.32 0.00 0.22
SEQID-02203 0.02 0.05 0.05 0.04 0.05 0.01 0.06 0.05 -21.67 0.31
-0.01 6.52 0.18 0.32 0.00 0.21 SEQID-02204 0.02 0.06 0.03 0.05 0.07
0.01 0.05 0.05 -23.34 0.33 -0.04 4.74 0.25 0.40 0.00 0.20
SEQID-02205 0.03 0.05 0.05 0.04 0.05 0.03 0.04 0.06 -20.67 0.33
-0.03 4.77 0.42 0.71 0.00 0.21 SEQID-02206 0.02 0.05 0.04 0.05 0.05
0.03 0.03 0.07 -15.97 0.76 -0.02 4.80 0.19 0.34 0.18 0.20
SEQID-02207 0.02 0.03 0.06 0.04 0.07 0.03 0.04 0.08 -23.26 0.31
-0.01 5.64 0.00 0.35 0.00 0.00 SEQID-02208 0.03 0.03 0.03 0.05 0.05
0.02 0.09 0.05 -23.56 0.26 0.04 9.73 0.00 0.35 0.00 0.17
SEQID-02209 0.03 0.03 0.01 0.04 0.04 0.01 0.03 0.04 -28.21 0.23
-0.02 5.45 0.19 0.56 0.19 0.00 SEQID-02210 0.03 0.04 0.02 0.04 0.04
0.01 0.03 0.04 -26.63 0.25 -0.01 5.91 0.20 0.53 0.19 0.18
SEQID-02211 0.02 0.04 0.04 0.06 0.06 0.02 0.03 0.08 -24.06 0.30
-0.01 6.23 0.00 0.38 0.00 0.00 SEQID-02212 0.04 0.04 0.02 0.03 0.05
0.01 0.03 0.05 -26.31 0.29 -0.02 5.33 0.26 0.54 0.18 0.18
SEQID-02213 0.03 0.05 0.04 0.05 0.06 0.02 0.04 0.08 -19.00 0.62
-0.03 4.86 0.19 0.35 0.00 0.20 SEQID-02214 0.04 0.00 0.00 0.03 0.03
0.00 0.01 0.05 -32.13 0.13 -0.03 5.10 0.38 0.55 0.21 0.21
SEQID-02215 0.04 0.04 0.02 0.03 0.05 0.03 0.04 0.04 -23.77 0.30
-0.03 4.98 0.21 0.24 0.00 0.19 SEQID-02216 0.02 0.04 0.06 0.07 0.07
0.02 0.05 0.09 -19.87 0.35 0.01 8.15 0.18 0.38 0.19 0.21
SEQID-02217 0.05 0.04 0.04 0.05 0.06 0.02 0.06 0.05 -19.66 0.42
-0.03 5.05 0.00 0.30 0.00 0.20 SEQID-02218 0.04 0.07 0.04 0.03 0.06
0.01 0.06 0.05 -20.75 0.42 -0.01 6.25 0.21 0.33 0.00 0.21
SEQID-02219 0.03 0.04 0.01 0.04 0.04 0.01 0.03 0.04 -27.49 0.25
-0.02 5.63 0.18 0.53 0.18 0.18 SEQID-02220 0.04 0.04 0.01 0.04 0.04
0.01 0.03 0.04 -27.72 0.23 -0.02 5.64 0.19 0.51 0.18 0.18
SEQID-02221 0.05 0.06 0.04 0.04 0.07 0.01 0.06 0.06 -19.58 0.45
-0.01 6.33 0.21 0.34 0.21 0.19 SEQID-02222 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.03 -28.29 0.22 -0.02 5.42 0.19 0.49 0.18 0.18
SEQID-02223 0.01 0.03 0.06 0.05 0.08 0.03 0.05 0.10 -20.80 0.34
0.00 7.29 0.19 0.32 0.18 0.21 SEQID-02224 0.02 0.05 0.06 0.06 0.06
0.03 0.06 0.07 -19.95 0.34 0.00 6.73 0.19 0.37 0.20 0.19
SEQID-02225 0.03 0.05 0.05 0.06 0.06 0.03 0.07 0.07 -20.00 0.32
-0.01 6.59 0.18 0.33 0.19 0.19 SEQID-02226 0.03 0.05 0.04 0.04 0.04
0.02 0.03 0.06 -23.59 0.30 0.00 6.84 0.42 0.64 0.00 0.20
SEQID-02227 0.04 0.06 0.03 0.06 0.04 0.02 0.04 0.06 -21.10 0.46
-0.02 5.40 0.00 0.35 0.00 0.19 SEQID-02228 0.02 0.03 0.05 0.04 0.06
0.01 0.06 0.06 -18.44 0.42 0.02 8.30 0.20 0.30 0.00 0.21
SEQID-02229 0.03 0.04 0.05 0.04 0.05 0.03 0.05 0.08 -24.61 0.31
-0.01 5.58 0.20 0.33 0.19 0.19 SEQID-02230 0.04 0.05 0.03 0.02 0.04
0.02 0.06 0.06 -22.56 0.34 0.00 7.09 0.20 0.33 0.00 0.20
SEQID-02231 0.04 0.05 0.03 0.05 0.05 0.02 0.05 0.09 -19.29 0.45
0.01 8.31 0.72 0.89 0.00 0.00 SEQID-02232 0.04 0.06 0.04 0.05 0.04
0.02 0.04 0.06 -22.05 0.44 -0.04 4.80 0.00 0.41 0.00 0.18
SEQID-02233 0.04 0.07 0.04 0.04 0.04 0.01 0.07 0.05 -22.35 0.33
0.00 6.87 0.20 0.33 0.00 0.21 SEQID-02234 0.02 0.05 0.03 0.04 0.04
0.02 0.03 0.06 -22.15 0.37 0.00 6.79 0.94 0.99 0.21 0.22
SEQID-02235 0.03 0.05 0.04 0.04 0.04 0.02 0.03 0.07 -22.81 0.33
0.00 6.74
0.44 0.65 0.00 0.00 SEQID-02236 0.02 0.05 0.04 0.05 0.06 0.03 0.05
0.10 -21.98 0.35 0.00 6.84 0.19 0.33 0.19 0.19 SEQID-02237 0.05
0.05 0.03 0.04 0.04 0.03 0.04 0.04 -22.90 0.32 0.05 9.86 0.00 0.29
0.00 0.24 SEQID-02238 0.02 0.03 0.02 0.03 0.02 0.01 0.01 0.02
-40.08 0.09 0.07 10.40 0.26 0.39 0.24 0.00 SEQID-02239 0.04 0.08
0.03 0.05 0.04 0.01 0.03 0.05 -24.45 0.38 -0.05 4.47 0.39 0.54 0.00
0.19 SEQID-02240 0.01 0.05 0.04 0.05 0.06 0.03 0.06 0.09 -21.66
0.35 -0.01 5.77 0.20 0.33 0.19 0.21 SEQID-02241 0.05 0.06 0.03 0.04
0.04 0.00 0.04 0.06 -21.24 0.38 -0.07 4.39 0.27 0.38 0.00 0.24
SEQID-02242 0.04 0.06 0.08 0.06 0.05 0.01 0.03 0.05 -20.78 0.20
0.01 7.73 0.24 0.39 0.22 0.26 SEQID-02243 0.04 0.03 0.01 0.08 0.05
0.00 0.04 0.03 -25.45 0.16 -0.03 5.11 0.31 0.49 0.00 0.21
SEQID-02244 0.02 0.02 0.16 0.04 0.04 0.01 0.02 0.03 -14.16 0.16
0.02 9.58 0.57 0.83 0.21 0.38 SEQID-02245 0.05 0.06 0.08 0.03 0.02
0.00 0.03 0.06 -21.06 0.37 -0.05 4.40 0.26 0.35 0.00 0.24
SEQID-02246 0.04 0.03 0.07 0.07 0.07 0.02 0.03 0.05 -17.43 0.28
0.02 9.52 0.22 0.32 0.22 0.21 SEQID-02247 0.05 0.05 0.03 0.04 0.07
0.02 0.03 0.07 -18.04 0.51 0.01 8.27 0.20 0.34 0.00 0.21
SEQID-02248 0.03 0.03 0.18 0.03 0.04 0.01 0.01 0.03 -15.17 0.17
-0.01 5.18 0.54 0.80 0.21 0.38 SEQID-02249 0.02 0.03 0.18 0.05 0.04
0.01 0.02 0.03 -14.55 0.17 -0.01 6.05 0.59 0.80 0.21 0.38
SEQID-02250 0.02 0.04 0.04 0.05 0.05 0.02 0.04 0.06 -22.44 0.34
-0.01 5.99 0.21 0.50 0.19 0.21 SEQID-02251 0.05 0.02 0.03 0.06 0.04
0.03 0.02 0.12 -18.26 0.58 0.01 7.70 0.24 0.34 0.00 0.20
SEQID-02252 0.01 0.04 0.09 0.04 0.06 0.02 0.03 0.07 -23.00 0.39
0.00 5.90 0.21 0.41 0.21 0.22 SEQID-02253 0.04 0.04 0.03 0.04 0.06
0.01 0.03 0.08 -21.44 0.45 0.01 7.94 0.21 0.33 0.00 0.21
SEQID-02254 0.05 0.01 0.03 0.04 0.03 0.02 0.02 0.06 -29.51 0.27
0.05 10.02 0.28 0.36 0.23 0.18 SEQID-02255 0.03 0.05 0.04 0.06 0.07
0.03 0.04 0.04 -23.64 0.19 0.02 9.54 0.22 0.31 0.00 0.22
SEQID-02256 0.03 0.07 0.04 0.05 0.05 0.01 0.05 0.06 -19.33 0.42
-0.01 6.21 0.22 0.34 0.00 0.22 SEQID-02257 0.02 0.05 0.03 0.04 0.04
0.03 0.02 0.10 -20.08 0.43 0.00 7.41 0.67 0.84 0.00 0.00
SEQID-02258 0.03 0.02 0.04 0.06 0.0 0.00 0.01 0.08 -27.31 0.16 0.01
8.77 0.23 0.32 0.00 0.19 SEQID-02259 0.02 0.07 0.04 0.03 0.01 0.03
0.04 0.06 -34.51 0.37 -0.27 3.56 0.21 0.32 0.21 0.22 SEQID-02260
0.02 0.03 0.03 0.05 0.03 0.00 0.06 0.08 -25.52 0.42 0.01 8.15 0.24
0.30 0.00 0.22 SEQID-02261 0.04 0.03 0.05 0.03 0.04 0.05 0.03 0.05
-22.63 0.32 0.03 9.34 0.20 0.30 0.19 0.00 SEQID-02262 0.04 0.10
0.03 0.03 0.05 0.03 0.06 0.05 -17.15 0.58 0.06 10.27 0.23 0.34 0.22
0.00 SEQID-02263 0.03 0.05 0.01 0.05 0.04 0.02 0.04 0.05 -21.13
0.35 0.02 8.10 0.21 0.33 0.00 0.21 SEQID-02264 0.08 0.08 0.01 0.04
0.04 0.00 0.02 0.03 -30.26 0.28 -0.19 3.71 0.36 0.48 0.22 0.23
SEQID-02265 0.03 0.07 0.01 0.04 0.06 0.01 0.05 0.05 -23.75 0.45
-0.01 5.76 0.20 0.31 0.21 0.20 SEQID-02266 0.03 0.04 0.05 0.04 0.06
0.02 0.04 0.089 -20.89 0.41 0.03 9.59 0.21 0.31 0.00 0.22
SEQID-02267 0.01 0.04 0.06 0.07 0.08 0.03 0.05 0.09 -19.83 0.34
-0.01 5.53 0.20 0.34 0.19 0.21 SEQID-02268 0.03 0.08 0.03 0.06 0.05
0.04 0.07 0.07 -16.17 0.70 0.02 9.14 0.20 0.33 0.00 0.20
SEQID-02269 0.03 0.05 0.05 0.05 0.05 0.03 0.06 0.07 -19.20 0.36
0.00 6.73 0.19 0.32 0.19 0.19 SEQID-02270 0.02 0.05 0.07 0.05 0.07
0.01 0.05 0.09 -19.23 0.30 -0.01 6.31 0.00 0.37 0.17 0.21
SEQID-02271 0.03 0.03 0.03 0.07 0.05 0.02 0.02 0.05 -23.98 0.25
-0.05 4.70 0.00 0.36 0.00 0.00 SEQID-02272 0.05 0.05 0.04 0.05 0.06
0.02 0.06 0.05 -19.53 0.43 -0.03 5.15 0.21 0.31 0.00 0.22
SEQID-02273 0.03 0.06 0.03 0.03 0.04 0.02 0.06 0.06 -22.21 0.34
0.00 7.11 0.19 0.33 0.00 0.20 SEQID-02274 0.01 0.07 0.04 0.04 0.05
0.01 0.05 0.05 -25.20 0.34 -0.02 6.06 0.92 0.98 0.21 0.21
SEQID-02275 0.03 0.09 0.02 0.04 0.04 0.03 0.06 0.07 -16.86 0.55
0.07 10.36 0.20 0.34 0.00 0.00 SEQID-02276 0.04 0.06 0.03 0.04 0.06
0.02 0.04 0.09 -17.85 0.47 0.02 8.58 0.69 0.85 0.00 0.22
SEQID-02277 0.01 0.07 0.03 0.04 0.05 0.02 0.07 0.06 -21.18 0.25
0.07 8.51 0.21 0.32 0.21 0.23 SEQID-02278 0.04 0.08 0.06 0.05 0.03
0.02 0.08 0.07 -16.15 0.52 0.05 9.72 0.20 0.34 0.00 0.21
SEQID-02279 0.05 0.09 0.03 0.02 0.05 0.01 0.03 0.05 -24.33 0.31
-0.04 4.60 0.40 0.60 0.00 0.19 SEQID-02280 0.01 0.04 0.04 0.02 0.05
0.01 0.04 0.09 -20.24 0.49 0.00 7.29 0.19 0.33 0.24 0.23
SEQID-02281 0.05 0.08 0.05 0.02 0.06 0.00 0.01 0.03 -28.13 0.33
-0.05 4.67 0.22 0.26 0.00 0.21 SEQID-02282 0.02 0.00 0.00 0.04 0.02
0.00 0.03 0.03 -36.76 0.12 -0.09 4.39 0.58 0.69 0.22 0.22
SEQID-02283 0.05 0.03 0.02 0.03 0.04 0.00 0.01 0.09 -19.35 0.71
0.00 7.52 0.24 0.32 0.00 0.25 SEQID-02284 0.07 0.08 0.06 0.05 0.06
0.00 0.01 0.03 -24.42 0.31 -0.02 5.21 0.19 0.28 0.00 0.00
SEQID-02285 0.07 0.08 0.06 0.05 0.06 0.00 0.01 0.08 -24.41 0.32
-0.02 5.22 0.25 0.30 0.00 0.00 SEQID-02286 0.04 0.06 0.04 0.03 0.02
0.00 0.07 0.06 -21.17 0.39 -0.03 5.14 0.90 0.91 0.00 0.23
SEQID-02287 0.02 0.07 0.04 0.07 0.06 0.01 0.03 0.08 -16.53 0.44
0.03 9.09 0.25 0.33 0.22 0.26 SEQID-02288 0.02 0.08 0.02 0.02 0.03
0.02 0.02 0.11 -19.85 0.47 0.01 7.35 0.27 0.30 0.25 0.25
SEQID-02289 0.01 0.04 0.06 0.02 0.10 0.00 0.01 0.09 -14.29 0.62
0.00 7.39 0.59 0.65 0.24 0.25 SEQID-02290 0.05 0.11 0.04 0.02 0.05
0.00 0.02 0.05 -25.98 0.30 -0.05 4.56 0.41 0.59 0.23 0.00
SEQID-02291 0.01 0.07 0.01 0.05 0.03 0.02 0.06 0.09 -17.65 0.90
0.05 9.78 0.18 0.31 0.19 0.22 SEQID-02292 0.00 0.03 0.00 0.04 0.07
0.04 0.00 0.07 -21.86 0.40 -0.05 4.76 0.33 0.16 0.33 0.33
SEQID-02293 0.00 0.06 0.06 0.11 0.04 0.02 0.04 0.09 -19.05 0.25
0.05 10.11 0.27 0.23 0.25 0.24 SEQID-02294 0.06 0.06 0.02 0.02 0.05
0.00 0.04 0.09 -23.42 0.39 -0.08 4.32 0.38 0.46 0.25 0.00
SEQID-02295 0.04 0.03 0.03 0.04 0.07 0.00 0.05 0.08 -24.69 0.33
0.01 8.63 0.00 0.33 0.00 0.23 SEQID-02296 0.05 0.08 0.04 0.05 0.08
0.01 0.06 0.07 -14.96 0.61 0.05 10.35 0.21 0.33 0.00 0.24
SEQID-02297 0.02 0.05 0.03 0.04 0.06 0.01 0.03 0.06 -22.33 0.36
-0.01 5.96 0.71 0.89 0.00 0.21 SEQID-02298 0.01 0.04 0.04 0.04 0.05
0.00 0.03 0.03 -23.86 0.30 0.14 11.71 0.24 0.30 0.00 0.21
SEQID-02299 0.03 0.04 0.04 0.04 0.04 0.01 0.01 0.10 -20.10 0.57
0.00 6.92 0.21 0.34 0.21 0.22 SEQID-02300 0.03 0.06 0.04 0.05 0.03
0.02 0.07 0.04 -20.39 0.35 0.02 8.61 0.19 0.32 0.22 0.21
SEQID-02301 0.05 0.08 0.03 0.03 0.04 0.06 0.04 0.03 -20.36 0.39
-0.02 6.09 0.51 0.63 0.25 0.25 SEQID-02302 0.03 0.10 0.05 0.03 0.04
0.03 0.06 0.06 -17.77 0.42 0.02 8.21 0.00 0.31 0.00 0.24
SEQID-02303 0.01 0.10 0.08 0.07 0.04 0.02 0.02 0.05 -23.34 0.27
0.01 7.38 0.25 0.35 0.23 0.23 SEQID-02304 0.09 0.04 0.05 0.07 0.07
0.04 0.06 0.05 -14.98 0.69 -0.05 4.44 0.21 0.31 0.00 0.19
SEQID-02305 0.03 0.03 0.02 0.06 0.04 0.01 0.06 0.04 -25.77 0.30
-0.05 4.48 0.24 0.33 0.00 0.23 SEQID-02306 0.03 0.07 0.02 0.07 0.05
0.02 0.04 0.05 -18.34 0.62 0.02 9.36 0.18 0.35 0.19 0.20
SEQID-02307 0.02 0.04 0.06 0.08 0.05 0.02 0.03 0.07 -17.22 0.57
-0.01 6.46 0.00 0.39 0.16 0.19 SEQID-02308 0.01 0.03 0.04 0.05 0.06
0.01 0.05 0.06 -18.98 0.41 0.00 6.89 0.22 0.33 0.00 0.20
SEQID-02309 0.03 0.05 0.04 0.09 0.06 0.03 0.03 0.05 -18.07 0.40
-0.01 6.18 0.38 0.61 0.18 0.21 SEQID-02310 0.05 0.07 0.05 0.03 0.04
0.02 0.04 0.07 -22.73 0.36 -0.04 4.83 0.21 0.35 0.00 0.22
SEQID-02311 0.02 0.06 0.04 0.05 0.04 0.02 0.03 0.06 -20.55 0.57
0.00 6.88 0.21 0.33 0.00 0.22 SEQID-02312 0.01 0.05 0.03 0.05 0.04
0.03 0.04 0.11 -24.64 0.30 -0.02 5.77 0.38 0.44 0.00 1.00
SEQID-02313 0.03 0.06 0.05 0.05 0.05 0.03 0.05 0.05 -23.03 0.33
-0.01 6.04 0.23 0.30 0.00 0.20 SEQID-02314 0.03 0.06 0.05 0.05 0.05
0.03 0.04 0.08 -17.36 0.45 -0.02 5.73 0.18 0.33 0.00 0.21
SEQID-02315 0.01 0.06 0.06 0.06 0.06 0.04 0.08 0.04 -12.07 0.45
0.01 7.96 1.00 1.00 0.22 0.22 SEQID-02316 0.03 0.06 0.04 0.04 0.04
0.04 0.06 0.06 -20.46 0.37 -0.02 6.41 0.27 0.35 0.00 0.23
SEQID-02317 0.02 0.07 0.04 0.05 0.03 0.02 0.08 0.08 -19.61 0.47
-0.01 6.03 0.22 0.32 0.21 0.22 SEQID-02318 0.04 0.01 0.02 0.04 0.01
0.00 0.03 0.03 -29.34 0.13 0.03 8.91 0.28 0.30 0.27 0.30
SEQID-02319 0.02 0.06 0.04 0.03 0.06 0.03 0.05 0.06 -19.82 0.38
-0.01 6.24 0.20 0.32 0.00 0.22 SEQID-02320 0.05 0.04 0.03 0.03 0.07
0.03 0.03 0.07 -19.93 0.49 -0.02 5.51 0.20 0.34 0.21 0.21
SEQID-02321 0.01 0.08 0.05 0.09 0.07 0.01 0.04 0.06 -19.55 0.31
0.00 7.25 0.19 0.34 0.00 0.23 SEQID-02322 0.02 0.08 0.06 0.08 0.06
0.02 0.02 0.06 -13.94 0.45 0.03 7.94 0.41 0.56 0.21 0.32
SEQID-02323 0.02 0.08 0.06 0.03 0.04 0.01 0.03 0.04 -21.81 0.30
-0.03 5.79 0.23 0.33 0.00 0.00 SEQID-02324 0.04 0.06 0.03 0.04 0.06
0.01 0.03 0.09 -21.10 0.45 0.00 7.46 0.00 0.35 0.21 0.22
SEQID-02325 0.05 0.07 0.03 0.06 0.05 0.02 0.06 0.06 -19.60 0.34
-0.05 4.53 0.39 0.56 0.19 0.21 SEQID-02326 0.02 0.05 0.06 0.04 0.05
0.03 0.05 0.05 -22.14 0.36 -0.02 5.59 0.20 0.33 0.19 0.20
SEQID-02327 0.01 0.07 0.07 0.05 0.09 0.02 0.05 0.07 -14.97 0.56
0.01 8.44 0.24 0.33 0.00 0.29 SEQID-02328 0.02 0.04 0.03 0.03 0.08
0.02 0.06 0.05 -21.37 0.41 -0.03 5.10 0.21 0.32 0.00 0.21
SEQID-02329 0.03 0.06 0.07 0.07 0.08 0.03 0.05 0.06 -16.53 0.52
-0.01 6.12 0.27 0.35 0.21 0.26 SEQID-02330 0.03 0.06 0.04 0.03 0.05
0.01 0.08 0.09 -22.17 0.37 -0.02 4.90 0.74 0.83 0.00 0.00
SEQID-02331 0.01 0.00 0.00 0.07 0.00 0.00 0.00 0.01 -38.09 0.15
0.02 7.57 0.29 0.30 0.27 0.28 SEQID-02332 0.02 0.05 0.04 0.05 0.09
0.00 0.00 0.07 -13.98 0.45 -0.03 6.21 0.80 0.83 0.26 0.28
SEQID-02333 0.01 0.09 0.04 0.02 0.06 0.02 0.07 0.06 -24.33 0.38
-0.07 4.36 0.39 0.46 0.00 0.25 SEQID-02334 0.02 0.09 0.02 0.07 0.03
0.02 0.07 0.04 -17.50 0.49 0.05 10.21 0.20 0.34 0.00 0.00
SEQID-02335 0.04 0.05 0.05 0.05 0.04 0.00 0.04 0.07 -19.22 0.43
0.00 6.65 0.21 0.33 0.20 0.22 SEQID-02336 0.03 0.03 0.02 0.05 0.05
0.02 0.05 0.06 -24.82 0.37 -0.01 6.33 0.21 0.33 0.20 0.00
SEQID-02337 0.01 0.07 0.05 0.05 0.07 0.04 0.07 0.07 -19.39 0.29
-0.01 5.93 0.19 0.34 0.00 0.22 SEQID-02338 0.02 0.07 0.04 0.05 0.04
0.01 0.06 0.08 -19.98 0.45 -0.01 5.60 0.22 0.35 0.22 0.22
SEQID-02339 0.03 0.06 0.04 0.05 0.04 0.03 0.05 0.06 -21.72 0.36
-0.03 5.69 0.21 0.33 0.00 0.21 SEQID-02340 0.02 0.03 0.03 0.05 0.05
0.00 0.06 0.07 -18.32 0.47 0.00 5.95 0.22 0.34 0.21 0.22
SEQID-02341 0.02 0.11 0.04 0.05 0.05 0.06 0.04 0.07 -14.51 0.60
-0.01 6.51 0.21 0.33 0.20 0.23 SEQID-02342 0.03 0.09 0.05 0.05 0.04
0.07 0.06 0.06 -13.27 0.60 0.00 7.04 0.22 0.33 0.00 0.22
SEQID-02343 0.03 0.14 0.03 0.04 0.06 0.06 0.03 0.06 -12.54 0.77
-0.01 6.51 0.19 0.32 0.00 0.22 SEQID-02344 0.03 0.09 0.04 0.05 0.05
0.06 0.04 0.05 -12.00 0.61 0.01 7.52 0.19 0.33 0.00 0.20
SEQID-02345 0.02 0.10 0.04 0.05 0.06 0.07 0.05 0.05 -11.60 0.64
0.00 7.08 0.19 0.35 0.00 0.21 SEQID-02346 0.03 0.00 0.00 0.04 0.04
0.00 0.02 0.06 -33.43 0.12 -0.02 5.63 0.41 0.55 0.23 0.22
SEQID-02347 0.02 0.03 0.01 0.04 0.02 0.01 0.01 0.02 -39.60 0.07
0.05 10.23 0.25 0.35 0.22 0.00 SEQID-02348 0.04 0.06 0.03 0.05 0.05
0.03 0.02 0.07 -22.00 0.36 0.03 9.13 0.45 0.64 0.00 0.00
SEQID-02349 0.04 0.06 0.03 0.05 0.05 0.02 0.04 0.09 -19.04 0.46
0.01 8.10 0.72 0.86 0.00 0.21 SEQID-02350 0.02 0.06 0.04 0.04 0.05
0.03 0.04 0.04 -23.29 0.32 0.00 7.11 0.48 0.64 0.00 0.00
SEQID-02351 0.06 0.08 0.02 0.03 0.05 0.01 0.06 0.04 -18.81 0.53
-0.03 5.29 0.20 0.29 0.21 0.00 SEQID-02352 0.03 0.02 0.00 0.06 0.02
0.00 0.01 0.03 -30.87 0.09 -0.01 6.28 0.30 0.38 0.24 0.21
SEQID-02353 0.02 0.03 0.05 0.05 0.07 0.03 0.04 0.11 -20.20 0.39
0.00 7.27 0.21 0.31 0.22 0.23 SEQID-02354 0.06 0.01 0.03 0.05 0.03
0.02 0.01 0.04 -28.42 0.26 0.02 9.14 0.29 0.35 0.18 0.26
SEQID-02355 0.01 0.13 0.00 0.05 0.02 0.02 0.01 0.05 -23.06 0.63
-0.06 4.34 1.00 1.00 0.27 0.26 SEQID-02356 0.02 0.02 0.06 0.07 0.09
0.04 0.05 0.06 -19.29 0.23 0.00 6.90 0.24 0.31 0.21 0.24
SEQID-02357 0.03 0.04 0.04 0.05 0.05 0.02 0.04 0.08 -20.45 0.42
0.03 9.69 0.22 0.33 0.20 0.22 SEQID-02358 0.04 0.01 0.03 0.06 0.07
0.00 0.04 0.05 -17.94 0.44 -0.01 6.35 0.25 0.34 0.29 0.23
SEQID-02359 0.02 0.06 0.04 0.09 0.06 0.02 0.05 0.06 -16.62 0.42
-0.01 6.49 0.48 0.62 0.21 0.21 SEQID-02360 0.03 0.06 0.06 0.07 0.05
0.04 0.08 0.04 -19.45 0.29 -0.02 5.66 0.24 0.30 0.25 0.24
SEQID-02361 0.04 0.03 0.03 0.10 0.03 0.00 0.05 0.08 -15.55 0.61
-0.01 5.20 0.24 0.32 0.24 0.24 SEQID-02362 0.03 0.03 0.03 0.06 0.04
0.01 0.08 0.08 -18.99 0.37 -0.02 5.25 0.24 0.32 0.24 0.00
SEQID-02363 0.04 0.03 0.02 0.06 0.04 0.00 0.04 0.09 -16.78 0.53
-0.01 4.90 0.22 0.32 0.26 0.26 SEQID-02364 0.04 0.05 0.03 0.04 0.06
0.02 0.06 0.06 -18.19 0.40 -0.02 5.63 0.20 0.33 0.00 0.22
SEQID-02365 0.03 0.03 0.03 0.09 0.08 0.01 0.10 0.03 -14.55 0.33
-0.01 5.16 0.22 0.30 0.23 0.24 SEQID-02366 0.04 0.09 0.04 0.07 0.04
0.05 0.05 0.07 -11.27 0.75 -0.02 5.25 0.00 0.31 0.00 0.22
SEQID-02367 0.03 0.09 0.04 0.06 0.06 0.05 0.04 0.04 -11.91 0.63
0.00 7.04 0.22 0.35 0.00 0.20 SEQID-02368 0.05 0.09 0.04 0.05 0.05
0.05 0.05 0.05 -10.93 0.65 0.01 7.57 0.20 0.31 0.00 0.21
SEQID-02369 0.01 0.01 0.05 0.09 0.06 0.03 0.09 0.05 -19.00 0.25
-0.02 6.21 1.00 1.00 0.23 0.26 SEQID-02370 0.01 0.12 0.06 0.04 0.08
0.02 0.03 0.03 -13.69 0.41 0.02 7.95 1.00 1.00 0.21 0.58
SEQID-02371 0.02 0.06 0.03 0.06 0.07 0.04 0.09 0.06 -17.33 0.41
-0.03 4.66 1.00 1.00 0.22 0.32 SEQID-02372 0.02 0.05 0.03 0.05 0.02
0.04 0.05 0.13 -15.63 0.68 0.03 9.85 1.00 1.00 0.00 1.00
SEQID-02373 0.04 0.07 0.01 0.04 0.07 0.02 0.07 0.08 -23.85 0.48
-0.07 4.41 1.00 1.00 0.25 0.23 SEQID-02374 0.01 0.08 0.03 0.06 0.08
0.04 0.08 0.09 -15.49 0.50 0.00 7.28 1.00 1.00 0.54 0.20
SEQID-02375 0.03 0.04 0.03 0.07 0.05 0.03 0.08 0.06 -17.98 0.34
0.01 8.01 0.71 0.80 0.20 0.34 SEQID-02376 0.01 0.04 0.08 0.07 0.05
0.02 0.06 0.08 -17.15 0.45 0.01 8.40 0.21 0.31 0.00 0.21
SEQID-02377 0.03 0.05 0.04 0.06 0.04 0.01 0.03 0.05 -19.83 0.38
0.00 7.06 0.52 0.73 0.20 0.22 SEQID-02378 0.03 0.05 0.04 0.06 0.04
0.01 0.03 0.04 -19.64 0.38 0.00 7.34 0.52 0.73 0.21 0.22
SEQID-02379 0.06 0.05 0.07 0.03 0.03 0.00 0.04 0.07 -22.04 0.36
-0.05 4.44 0.26 0.38 0.00 0.24 SEQID-02380 0.04 0.08 0.04 0.04 0.05
0.01 0.03 0.05 -24.42 0.37 -0.06 4.36 0.38 0.54 0.22 0.19
SEQID-02381 0.03 0.00 0.00 0.03 0.03 0.00 0.03 0.03 -36.74 0.12
-0.09 4.39 0.59 0.70 0.25 0.21 SEQID-02382 0.03 0.05 0.06 0.05 0.06
0.03 0.04 0.08 -18.72 0.43 0.01 7.75 0.00 0.32 0.00 0.18
SEQID-02383 0.02 0.09 0.02 0.02 0.03 0.02 0.02 0.12 -18.31 0.58
0.00 7.24 0.28 0.31 0.21 0.25 SEQID-02384 0.03 0.05 0.01 0.05 0.04
0.01 0.04 0.04 -26.24 0.28 -0.01 6.55 0.19 0.55 0.19 0.17
SEQID-02385 0.03 0.05 0.02 0.04 0.05 0.01 0.03 0.04 -26.69 0.24
0.01 8.53 0.20 0.55 0.18 0.17 SEQID-02386 0.04 0.08 0.03 0.04 0.05
0.01 0.06 0.05 -21.50 0.39 0.01 8.45 0.19 0.34 0.00 0.20
SEQID-02387 0.02 0.01 0.00 0.04 0.03 0.00 0.01 0.04 -32.95 0.10
-0.04 5.11 0.39 0.55 0.21 0.21 SEQID-02388 0.03 0.03 0.01 0.04 0.04
0.01 0.03 0.03 -27.94 0.21 -0.02 5.55 0.19 0.53 0.18 0.18
SEQID-02389 0.05 0.04 0.04 0.05 0.06 0.02 0.06 0.05 -19.68 0.41
-0.03 5.05 0.19 0.31 0.00 0.20 SEQID-02390 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.03 -28.44 0.23 -0.02 5.55 0.19 0.51 0.18 0.19
SEQID-02391 0.03 0.04 0.01 0.04 0.03 0.01 0.03 0.04 -28.04 0.22
-0.02 5.44 0.18 0.54 0.18 0.19 SEQID-02392 0.03 0.04 0.01 0.04 0.04
0.01 0.03 0.03 -28.31 0.24 -0.02 5.66 0.18 0.50 0.17 0.17
SEQID-02393 0.03 0.10 0.02 0.06 0.04 0.01 0.05 0.05 -19.60 0.46
0.04 9.84 0.21 0.32 0.00 0.20 SEQID-02394 0.04 0.05 0.03 0.05 0.06
0.02 0.04 0.10 -17.92 0.49 0.02 8.82 0.70 0.86 0.00 0.20
SEQID-02395 0.02 0.01 0.00 0.05 0.02 0.00 0.01 0.04 -32.33 0.12
-0.02 5.54 0.38 0.54 0.21 0.19 SEQID-02396 0.05 0.04 0.03 0.04 0.04
0.01 0.02 0.08 -21.27 0.45 0.01 7.68 0.21 0.33 0.00 0.22
SEQID-02397 0.04 0.04 0.03 0.04 0.04 0.03 0.04 0.03 -24.38 0.28
-0.03 5.17 0.20 0.36 0.00 0.19 SEQID-02398 0.01 0.04 0.06 0.04 0.06
0.02 0.04 0.07 -26.13 0.30 -0.02 5.29 0.00 0.41 0.17 0.18
SEQID-02399 0.03 0.03 0.03 0.06 0.03 0.03 0.02 0.10 -19.78 0.56
0.02 8.27 0.23 0.32 0.21 0.19 SEQID-02400 0.02 0.04 0.04 0.06 0.06
0.02 0.05 0.08 -22.74 0.31 -0.01 6.33 0.00 0.34 0.17 0.19
SEQID-02401 0.05 0.05 0.04 0.05 0.06 0.02 0.06 0.05 -19.47 0.43
-0.03 5.16 0.21 0.31 0.00 0.22 SEQID-02402 0.01 0.04 0.07 0.06 0.07
0.02 0.04 0.09 -22.48 0.31 -0.01 5.81 0.00 0.40 0.00 0.18
SEQID-02403 0.02 0.02 0.03 0.05 0.05 0.02 0.09 0.06 -24.84 0.20
0.03 9.41 0.00 0.34 0.17 0.18 SEQID-02404 0.01 0.05 0.04 0.06 0.05
0.03 0.06 0.07 -22.26 0.33 -0.01 6.27 0.18 0.34 0.19 0.19
SEQID-02405 0.08 0.02 0.04 0.06 0.07 0.03 0.07 0.02 -18.28 0.36
0.01 8.20 0.25 0.28 0.00 0.00 SEQID-02406 0.04 0.06 0.04 0.04 0.04
0.02 0.01 0.09 -20.16 0.47 0.01 7.53 0.23 0.35 0.00 0.321
SEQID-02407 0.03 0.01 0.03 0.05 0.03 0.03 0.08 0.04 -24.99 0.22
0.02 8.88 0.20 0.32 0.00 0.19 SEQID-02408 0.04 0.03 0.04 0.05 0.04
0.02 0.08 0.04 -24.99 0.20 0.03 9.54 0.19 0.33 0.18 0.18
SEQID-02409 0.03 0.04 0.03 0.04 0.07 0.02 0.03 0.06 -19.75 0.46
0.02 8.25 0.21 0.32 0.00 0.21 SEQID-02410 0.02 0.07 0.04 0.04 0.05
0.01 0.05 0.05 -19.79 0.43 0.02 8.78 0.20 0.36 0.00 0.21
SEQID-02411 0.02 0.00 0.00 0.04 0.03 0.00 0.03 0.03 -36.78 0.12
-0.09 4.39 0.59 0.70 0.26 0.22 SEQID-02412 0.04 0.05 0.03 0.06 0.03
0.00 0.05 0.05 -23.93 0.35 -0.01 6.37 0.88 1.00 0.18 0.21
SEQID-02413 0.02 0.04 0.04 0.05 0.06 0.03 0.04 0.08 -22.25 0.35
-0.01 6.34 0.18 0.32 0.19 0.20 SEQID-02414 0.03 0.06 0.04 0.04 0.06
0.04 0.04 0.06 -17.89 0.44 0.01 8.09 0.20 0.32 0.20 0.21
SEQID-02415 0.03 0.05 0.05 0.03 0.05 0.04 0.02 0.05 -22.74 0.32
0.02 9.12 0.21 0.30 0.21 0.20 SEQID-02416 0.01 0.02 0.01 0.02 0.02
0.02 0.03 0.02 -37.68 0.11 0.09 10.58 0.26 0.36 0.24 0.00
SEQID-02417 0.01 0.02 0.01 0.03 0.02 0.02 0.04 0.02 -37.55 0.11
0.09 10.51 0.26 0.36 0.20 0.00 SEQID-02418 0.02 0.03 0.07 0.04 0.07
0.03 0.05 0.09 -23.17 0.28 0.00 6.53 0.20 0.34 0.19 0.23
SEQID-02419 0.01 0.04 0.02 0.05 0.04 0.03 0.03 0.09 -19.87 0.48
-0.01 6.39 0.70 0.80 0.26 0.22 SEQID-02420 0.03 0.08 0.03 0.02 0.03
0.02 0.03 0.05 -31.95 0.40 -0.19 3.81 0.21 0.33 0.00 0.23
SEQID-02421 0.02 0.05 0.03 0.04 0.04 0.01 0.04 0.07 -21.29 0.41
0.00 6.39 0.85 0.96 0.00 0.22 SEQID-02422 0.04 0.06 0.04 0.04 0.04
0.02 0.06 0.06 -21.28 0.35 -0.02 5.14 0.19 0.34 0.00 0.20
SEQID-02423 0.04 0.05 0.03 0.06 0.06 0.02 0.03 0.08 -18.90 0.66
-0.02 5.14 0.19 0.33 0.00 0.20 SEQID-02424 0.03 0.05 0.05 0.04 0.04
0.03 0.06 0.05 -19.61 0.37 0.00 7.02 0.17 0.34 0.19 0.00
SEQID-02425 0.02 0.04 0.07 0.06 0.03 0.05 0.04 0.06 -21.89 0.25
0.02 8.05 0.22 0.31 0.24 0.21 SEQID-02426 0.02 0.04 0.05 0.05 0.06
0.03 0.05 0.07 -23.80 0.29 -0.02 5.46 0.19 0.32 0.19 0.19
SEQID-02427 0.02 0.06 0.05 0.05 0.05 0.00 0.03 0.08 -18.62 0.43
0.00 6.55 0.00 0.52 0.17 0.97 SEQID-02428 0.03 0.07 0.05 0.05 0.04
0.02 0.07 0.05 -21.75 0.30 0.01 7.98 0.19 0.31 0.00 0.20
SEQID-02429 0.02 0.03 0.04 0.05 0.06 0.01 0.05 0.07 -18.78 0.43
0.00 6.62 0.19 0.33 0.00 0.23 SEQID-02430 0.03 0.06 0.06 0.05 0.06
0.00 0.02 0.07 -16.81 0.55 0.02 8.74 0.51 0.69 0.00 0.00
SEQID-02431 0.02 0.05 0.06 0.07 0.05 0.01 0.04 0.04 -24.73 0.28
-0.07 4.42 0.20 0.40 0.00 0.22 SEQID-02432 0.04 0.05 0.04 0.05 0.07
0.03 0.03 0.08 -18.45 0.60 -0.01 5.73 0.19 0.32 0.00 0.20
SEQID-02433 0.01 0.04 0.05 0.06 0.06 0.02 0.04 0.07 -22.41 0.32
0.01 8.58 0.19 0.35 0.19 0.20 SEQID-02434 0.03 0.04 0.05 0.05 0.05
0.02 0.04 0.08 -21.07 0.40 0.03 9.43 0.22 0.34 0.00 0.22
SEQID-02435 0.03 0.05 0.03 0.05 0.03 0.01 0.04 0.07 -21.68 0.43
-0.05 4.55 0.82 0.96 0.21 0.22 SEQID-02436 0.04 0.05 0.04 0.04 0.03
0.02 0.05 0.07 -22.82 0.38 0.00 6.73 0.21 0.32 0.00 0.21
SEQID-02437 0.02 0.07 0.04 0.03 0.06 0.00 0.04 0.08 -17.52 0.62
0.03 8.71 0.23 0.31 0.00 0.22 SEQID-02438 0.04 0.02 0.02 0.04 0.02
0.01 0.02 0.03 -32.14 0.15 0.06 10.17 0.26 0.31 0.26 0.00
SEQID-02439 0.01 0.07 0.04 0.05 0.04 0.03 0.07 0.05 -21.60 0.24
0.06 8.37 0.21 0.32 0.23 0.23 SEQID-02440 0.03 0.05 0.03 0.04 0.07
0.01 0.04 0.06 -23.37 0.33 -0.01 5.71 0.72 0.89 0.19 0.21
SEQID-02441 0.03 0.04 0.05 0.10 0.07 0.01 0.04 0.06 -23.33 0.22
0.01 8.53 0.19 0.40 0.19 0.19 SEQID-02442 0.00 0.07 0.02 0.08 0.09
0.02 0.06 0.05 -17.94 0.30 0.01 8.88 0.20 0.32 0.00 0.00
SEQID-02443 0.04 0.05 0.089 0.07 0.05 0.01 0.06 0.03 -20.79 0.18
0.04 9.80 0.18 0.34 0.00 0.23 SEQID-02444 0.04 0.05 0.04 0.06 0.04
0.03 0.05 0.05 -19.86 0.39 0.03 9.43 0.22 0.31 0.00 0.21
SEQID-02445 0.01 0.03 0.10 0.05 0.07 0.02 0.03 0.06 -21.39 0.27
0.00 6.99 0.20 0.43 0.20 0.22 SEQID-02446 0.02 0.05 0.03 0.05 0.07
0.01 0.03 0.06 -22.59 0.34 -0.02 5.16 0.74 0.93 0.21 0.22
SEQID-02447 0.04 0.07 0.03 0.03 0.06 0.00 0.03 0.07 -17.51 0.50
0.01 7.98 0.23 0.31 0.00 0.00 SEQID-02448 0.05 0.06 0.07 0.02 0.04
0.00 0.02 0.05 -23.59 0.32 -0.04 4.68 0.31 0.48 0.00 0.22
SEQID-02449 0.02 0.05 0.03 0.05 0.06 0.00 0.06 0.06 -18.88 0.43
0.02 9.26 0.19 0.31 0.00 0.22 SEQID-02450 0.02 0.04 0.04 0.04 0.05
0.02 0.04 0.05 -22.04 0.28 0.01 8.21 0.37 0.54 0.00 0.20
SEQID-02451 0.03 0.04 0.05 0.03 0.06 0.00 0.04 0.08 -19.05 0.48
-0.04 4.75 0.22 0.33 0.20 0.20 SEQID-02452 0.02 0.02 0.07 0.06 0.09
0.01 0.03 0.10 -21.92 0.31 0.01 9.07 0.19 0.34 0.19 0.19
SEQID-02453 0.02 0.06 0.03 0.05 0.03 0.05 0.02 0.08 -16.92 0.54
0.04 9.64 0.23 0.33 0.20 0.21 SEQID-02454 0.03 0.08 0.02 0.04 0.03
0.03 0.07 0.07 -17.65 0.55 0.07 10.22 0.23 0.31 0.00 0.00
SEQID-02455 0.05 0.07 0.05 0.05 0.07 0.01 0.05 0.06 -18.76 0.33
-0.04 4.68 0.39 0.53 0.00 0.21 SEQID-02456 0.03 0.04 0.02 0.05 0.06
0.02 0.04 0.07 -18.79 0.48 0.01 7.64 0.19 0.33 0.00 0.22
SEQID-02457 0.04 0.05 0.05 0.04 0.05 0.01 0.04 0.07 -21.29 0.44
0.00 6.93 0.20 0.33 0.19 0.20 SEQID-02458 0.02 0.06 0.04 0.05 0.03
0.02 0.05 0.06 -20.31 0.48 0.00 7.09 0.18 0.32 0.20 0.19
SEQID-02459 0.03 0.06 0.03 0.06 0.04 0.02 0.05 0.05 -21.32 0.46
-0.02 5.69 0.00 0.33 0.00 0.19 SEQID-02460 0.01 0.04 0.03 0.06 0.07
0.02 0.04 0.07 -23.81 0.32 -0.01 6.06 0.00 0.36 0.00 0.00
SEQID-02461 0.03 0.03 0.04 0.06 0.05 0.00 0.05 0.08 -19.82 0.44
0.00 7.49 0.21 0.33 0.00 0.23 SEQID-02462 0.04 0.06 0.04 0.04 0.04
0.02 0.03 0.06 -22.56 0.35 -0.01 6.40 0.42 0.65 0.00 0.19
SEQID-02463 0.02 0.06 0.04 0.04 0.06 0.01 0.06 0.07 -19.71 0.37
-0.05 4.70 0.93 1.00 0.19 0.32 SEQID-02464 0.03 0.04 0.01 0.05 0.04
0.00 0.05 0.05 -24.76 0.39 -0.01 5.89 0.22 0.33 0.00 0.20
SEQID-02465 0.03 0.06 0.05 0.04 0.04 0.01 0.03 0.05 -21.99 0.39
-0.03 4.94 0.20 0.33 0.00 0.22 SEQID-02466 0.02 0.06 0.04 0.06 0.06
0.02 0.04 0.07 -20.05 0.45 0.00 7.09 0.18 0.99 0.18 0.20
SEQID-02467 0.03 0.04 0.04 0.05 0.05 0.02 0.05 0.06 -19.09 0.42
-0.01 6.58 0.19 0.33 0.19 0.20 SEQID-02468 0.03 0.06 0.05 0.03 0.04
0.00 0.10 0.05 -24.58 0.42 -0.01 5.16 0.26 0.29 0.00 0.00
SEQID-02469 0.02 0.06 0.09 0.09 0.05 0.05 0.04 0.05 -20.66 0.25
0.00 6.69 0.22 0.31 0.00 0.22 SEQID-02470 0.02 0.03 0.04 0.05 0.03
0.04 0.04 0.05 -22.96 0.32 -0.01 6.64 0.21 0.31 0.00 0.20
SEQID-02471 0.03 0.02 0.03 0.07 0.04 0.02 0.05 0.06 -23.84 0.29
-0.01 5.78 0.19 0.33 0.00 0.00 SEQID-02472 0.03 0.04 0.04 0.05 0.04
0.02 0.03 0.09 -20.58 0.56 0.00 7.45 0.25 0.33 0.00 0.00
SEQID-02473 0.04 0.07 0.03 0.05 0.06 0.05 0.04 0.05 -18.23 0.38
0.02 8.89 0.19 0.32 0.00 0.00 SEQID-02474 0.03 0.03 0.02 0.05 0.04
0.00 0.07 0.04 -25.38 0.35 0.00 7.40 0.21 0.33 0.00 0.00
SEQID-02475 0.02 0.06 0.04 0.03 0.05 0.03 0.05 0.07 -20.38 0.41
0.01 8.20 0.21 0.32 0.00 0.22 SEQID-02476 0.04 0.05 0.02 0.03 0.06
0.02 0.03 0.07 -21.76 0.49 -0.01 5.82 0.21 0.33 0.21 0.20
SEQID-02477 0.02 0.04 0.08 0.05 0.05 0.02 0.04 0.04 -20.44 0.24
0.01 8.55 0.20 0.36 0.20 0.21 SEQID-02478 0.02 0.09 0.04 0.05 0.06
0.01 0.05 0.06 -17.07 0.48 0.01 8.48 0.20 0.36 0.00 0.21
SEQID-02479 0.02 0.05 0.07 0.07 0.05 0.02 0.02 0.05 -21.00 0.33
-0.02 5.10 0.18 0.33 0.20 0.21 SEQID-02480 0.03 0.04 0.02 0.04 0.05
0.01 0.05 0.05 -28.79 0.90 -0.05 4.73 0.65 0.86 0.00 0.21
SEQID-02481 0.03 0.02 0.03 0.09 0.07 0.00 0.06 0.06 -23.72 0.21
0.14 10.93 0.26 0.30 0.00 0.21 SEQID-02482 0.05 0.07 0.03 0.02 0.05
0.00 0.05 0.06 -24.45 0.38 -0.05 4.74 0.42 0.52 0.00 0.22
SEQID-02483 0.02 0.02 0.02 0.06 0.04 0.01 0.08 0.05 -24.51 0.30
-0.06 4.50 0.25 0.32 0.22 0.00 SEQID-02484 0.03 0.07 0.04 0.04 0.04
0.03 0.05 0.04 -25.47 0.32 -0.03 4.91 0.22 0.32 0.00 0.23
SEQID-02485 0.02 0.05 0.04 0.05 0.07 0.00 0.05 0.04 -19.78 0.44
0.00 6.90 0.20 0.30 0.00 0.00 SEQID-02486 0.04 0.08 0.05 0.05 0.04
0.03 0.08 0.07 -15.73 0.57 0.04 9.53
0.21 0.30 0.00 0.00 SEQID-02487 0.03 0.05 0.05 0.04 0.04 0.03 0.05
0.06 -19.73 0.41 0.00 7.19 0.21 0.33 0.00 0.00 SEQID-02488 0.02
0.05 0.05 0.04 0.04 0.03 0.05 0.06 -20.63 0.35 -0.01 6.50 0.21 0.33
0.00 0.19 SEQID-02489 0.03 0.07 0.02 0.03 0.04 0.02 0.04 0.05
-24.46 0.45 0.00 6.80 0.21 0.32 0.00 0.20 SEQID-02490 0.03 0.07
0.03 0.08 0.04 0.02 0.05 0.04 -21.89 0.31 0.00 7.33 0.22 0.36 0.20
0.21 SEQID-02491 0.03 0.05 0.04 0.04 0.05 0.00 0.04 0.08 -18.41
0.48 0.03 9.56 0.19 0.35 0.00 0.21 SEQID-02492 0.02 0.04 0.07 0.05
0.04 0.01 0.04 0.05 -20.66 0.34 -0.01 5.44 0.26 0.55 0.21 0.30
SEQID-02493 0.03 0.05 0.03 0.06 0.04 0.02 0.05 0.05 -21.97 0.38
-0.02 5.70 0.19 0.34 0.00 0.20 SEQID-02494 0.01 0.06 0.04 0.06 0.04
0.01 0.06 0.07 -17.07 0.38 0.02 9.01 0.47 0.64 0.21 0.21
SEQID-02495 0.01 0.06 0.04 0.06 0.04 0.01 0.06 0.07 -16.80 0.38
0.02 8.77 0.46 0.63 0.20 0.21 SEQID-02496 0.01 0.07 0.04 0.05 0.03
0.01 0.05 0.06 -16.41 0.40 0.03 9.41 0.45 0.61 0.21 0.21
SEQID-02497 0.01 0.08 0.04 0.07 0.04 0.01 0.06 0.06 -16.25 0.37
0.02 9.18 0.45 0.62 0.00 0.21 SEQID-02498 0.02 0.07 0.04 0.04 0.03
0.01 0.05 0.06 -16.80 0.40 0.02 8.96 0.45 0.61 0.00 0.21
SEQID-02499 0.01 0.06 0.03 0.06 0.04 0.01 0.06 0.07 -17.37 0.42
0.02 8.64 0.45 0.60 0.00 0.22 SEQID-02500 0.04 0.07 0.04 0.05 0.04
0.03 0.07 0.06 -21.43 0.31 0.00 6.82 0.19 0.33 0.00 0.20
SEQID-02501 0.01 0.07 0.04 0.04 0.03 0.01 0.05 0.06 -17.67 0.44
0.03 9.55 0.42 0.56 0.00 0.22 SEQID-02502 0.02 0.07 0.04 0.06 0.04
0.02 0.03 0.07 -16.73 0.44 0.02 8.95 0.41 0.60 0.21 0.22
SEQID-02503 0.01 0.07 0.04 0.04 0.04 0.01 0.04 0.05 -17.57 0.40
0.04 9.98 0.41 0.59 0.00 0.21 SEQID-02504 0.04 0.07 0.05 0.06 0.03
0.03 0.07 0.06 -20.04 0.31 -0.02 5.99 0.19 0.36 0.00 0.21
SEQID-02505 0.02 0.06 0.04 0.07 0.04 0.03 0.06 0.07 -18.61 0.37
-0.01 6.20 0.19 0.34 0.00 0.20 SEQID-02506 0.03 0.05 0.05 0.04 0.04
0.02 0.05 0.07 -19.04 0.45 0.01 8.22 0.21 0.33 0.20 0.21
SEQID-02507 0.04 0.05 0.04 0.04 0.05 0.01 0.03 0.08 -19.62 0.43
-0.01 6.31 0.20 0.35 0.00 0.21 SEQID-02508 0.03 0.06 0.04 0.04 0.05
0.02 0.06 0.05 -20.08 0.42 -0.01 6.59 0.19 0.31 0.00 0.21
SEQID-02509 0.04 0.06 0.04 0.05 0.06 0.01 0.05 0.05 -19.78 0.42
-0.02 5.49 0.20 0.30 0.00 0.21 SEQID-02510 0.03 0.04 0.04 0.06 0.04
0.01 0.06 0.06 -19.00 0.46 0.00 7.04 0.21 0.32 0.00 0.21
SEQID-02511 0.03 0.06 0.04 0.04 0.04 0.02 0.06 0.05 -20.23 0.42
-0.01 6.35 0.20 0.31 0.00 0.20 SEQID-02512 0.02 0.06 0.04 0.04 0.04
0.02 0.07 0.06 -20.16 0.41 -0.01 6.52 0.20 0.34 0.00 0.22
SEQID-02513 0.01 0.08 0.03 0.05 0.02 0.01 0.10 0.06 -9.08 0.66 0.01
8.91 0.31 0.41 0.21 0.20 SEQID-02514 0.02 0.05 0.04 0.05 0.04 0.03
0.05 0.07 -21.93 0.35 -0.02 5.75 0.19 0.36 0.00 0.20 SEQID-02515
0.02 0.05 0.03 0.03 0.05 0.01 0.04 0.07 -25.25 0.39 -0.03 4.82 0.89
0.99 0.00 0.21 SEQID-02516 0.04 0.05 0.05 0.06 0.05 0.02 0.05 0.06
-16.46 0.49 0.01 8.09 0.23 0.33 0.00 0.20 SEQID-02517 0.03 0.05
0.03 0.05 0.06 0.03 0.04 0.10 -19.93 0.49 0.01 8.07 0.88 0.95 0.00
0.21 SEQID-02518 0.04 0.04 0.05 0.04 0.05 0.02 0.05 0.09 -17.47
0.55 0.04 9.88 0.22 0.34 0.22 0.22 SEQID-02519 0.01 0.05 0.04 0.05
0.03 0.01 0.03 0.06 -25.87 0.41 0.01 8.23 0.37 0.51 0.18 0.21
SEQID-02520 0.02 0.04 0.04 0.05 0.07 0.00 0.01 0.09 -21.36 0.39
-0.02 4.86 0.46 0.77 0.00 0.22 SEQID-02521 0.02 0.07 0.04 0.07 0.05
0.01 0.03 0.07 -17.87 0.36 0.01 8.44 0.22 0.44 0.20 0.22
SEQID-02522 0.03 0.04 0.05 0.04 0.06 0.01 0.04 0.08 -22.21 0.39
0.03 9.56 0.22 0.35 0.21 0.22 SEQID-02523 0.01 0.07 0.04 0.05 0.05
0.01 0.05 0.06 -17.00 0.39 0.01 8.01 0.43 0.60 0.20 0.21
SEQID-02524 0.07 0.04 0.04 0.08 0.01 0.01 0.07 0.04 -19.56 0.33
0.00 7.60 0.36 0.49 0.25 0.24 SEQID-02525 0.01 0.03 0.04 0.05 0.06
0.01 0.05 0.07 -19.79 0.39 0.01 8.33 0.21 0.33 0.00 0.00
SEQID-02526 0.04 0.05 0.04 0.03 0.03 0.01 0.02 0.11 -19.49 0.55
-0.01 6.43 0.26 0.35 0.20 0.20 SEQID-02527 0.02 0.05 0.05 0.05 0.03
0.01 0.06 0.05 -17.50 0.46 0.00 6.62 0.21 0.32 0.00 0.22
SEQID-02528 0.01 0.08 0.05 0.04 0.03 0.01 0.05 0.07 -23.43 0.40
-0.04 4.76 0.24 0.63 0.19 0.21 SEQID-02529 0.04 0.02 0.05 0.04 0.03
0.02 0.05 0.09 -15.87 0.52 0.02 7.90 1.00 1.00 0.27 0.32
SEQID-02530 0.02 0.06 0.03 0.05 0.06 0.03 0.04 0.10 -20.63 0.47
0.00 6.80 0.89 0.96 0.23 0.00 SEQID-02531 0.02 0.06 0.04 0.07 0.03
0.01 0.03 0.07 -23.43 0.45 0.00 7.26 0.39 0.54 0.22 0.23
SEQID-02532 0.05 0.05 0.04 0.04 0.05 0.02 0.04 0.08 -21.12 0.40
-0.01 6.03 0.20 0.33 0.00 0.21 SEQID-02533 0.04 0.06 0.03 0.04 0.05
0.01 0.05 0.08 -21.73 0.43 -0.02 5.23 0.22 0.33 0.00 0.21
SEQID-02534 0.04 0.07 0.03 0.04 0.05 0.01 0.04 0.07 -21.79 0.40
-0.02 5.35 0.22 0.33 0.00 0.20 SEQID-02535 0.02 0.05 0.04 0.04 0.06
0.01 0.02 0.09 -20.07 0.56 -0.01 5.57 0.24 0.36 0.00 0.22
SEQID-02536 0.05 0.05 0.04 0.05 0.04 0.02 0.04 0.08 -21.12 0.40
-0.01 6.03 0.19 0.33 0.00 0.21 SEQID-02537 0.05 0.08 0.04 0.06 0.03
0.01 0.06 0.06 -7.72 0.63 0.02 8.14 0.33 0.48 0.27 0.26 SEQID-02538
0.02 0.04 0.04 0.07 0.06 0.01 0.04 0.07 -19.34 0.40 0.00 6.93 0.20
0.33 0.00 0.20 SEQID-02539 0.01 0.05 0.05 0.05 0.05 0.01 0.03 0.08
-20.15 0.43 -0.02 5.26 0.24 0.32 0.00 0.22 SEQID-02540 0.03 0.03
0.06 0.04 0.04 0.02 0.06 0.10 -15.06 0.53 0.02 8.09 1.00 1.00 0.28
0.33 SEQID-02541 0.02 0.05 0.04 0.05 0.06 0.01 0.03 0.08 -19.70
0.53 0.00 6.55 0.23 0.33 0.22 0.21 SEQID-02542 0.03 0.05 0.03 0.06
0.06 0.03 0.04 0.09 -19.94 0.46 0.00 7.13 0.93 0.99 0.00 0.21
SEQID-02543 0.03 0.05 0.04 0.05 0.05 0.01 0.06 0.05 -18.88 0.46
0.00 6.64 0.21 0.31 0.00 0.21 SEQID-02544 0.02 0.07 0.06 0.05 0.06
0.03 0.06 0.08 -15.70 0.45 0.01 8.78 0.21 0.33 0.00 0.21
SEQID-02545 0.05 0.03 0.06 0.04 0.02 0.02 0.07 0.09 -15.58 0.53
0.02 8.09 1.00 1.00 0.29 0.33 SEQID-02546 0.07 0.04 0.07 0.03 0.03
0.01 0.06 0.09 -14.38 0.66 0.03 8.41 1.00 1.00 0.27 0.30
SEQID-02547 0.01 0.06 0.04 0.06 0.02 0.02 0.07 0.08 -7.89 0.67 0.02
8.47 0.32 0.46 0.25 0.23 SEQID-02548 0.03 0.04 0.04 0.05 0.05 0.03
0.03 0.07 -20.17 0.43 0.02 9.64 0.00 0.30 0.00 0.00 SEQID-02549
0.05 0.04 0.05 0.05 0.06 0.02 0.06 0.06 -19.73 0.44 -0.03 5.16 0.20
0.34 0.00 0.21 SEQID-02550 0.05 0.04 0.05 0.04 0.03 0.01 0.05 0.09
-14.39 0.68 0.01 7.57 0.34 0.40 0.27 0.37 SEQID-02551 0.04 0.08
0.05 0.05 0.04 0.04 0.07 0.06 -18.24 0.37 -0.03 5.44 0.20 0.34 0.00
0.22 SEQID-02552 0.01 0.06 0.03 0.06 0.01 0.01 0.10 0.05 -9.62 0.60
0.02 9.47 0.29 0.40 0.26 0.23 SEQID-02553 0.08 0.05 0.05 0.07 0.02
0.02 0.04 0.05 -9.85 0.49 0.02 7.95 0.35 0.49 0.30 0.29 SEQID-02554
0.01 0.07 0.04 0.06 0.03 0.02 0.098 0.07 -7.89 0.65 0.02 8.46 0.31
0.48 0.26 0.24 SEQID-02555 0.04 0.07 0.06 0.04 0.04 0.03 0.06 0.06
-21.89 0.35 0.00 6.39 0.21 0.35 0.00 0.20 SEQID-02556 0.05 0.05
0.02 0.04 0.04 0.02 0.04 0.07 -18.88 0.52 0.03 8.84 0.24 0.31 0.00
0.23 SEQID-02557 0.06 0.03 0.04 0.06 0.02 0.01 0.04 0.09 -15.43
0.71 0.01 7.57 0.33 0.39 0.26 0.38 SEQID-02558 0.01 0.07 0.03 0.05
0.02 0.00 0.10 0.06 -9.17 0.67 0.02 8.91 0.31 0.41 0.26 0.23
SEQID-02559 0.01 0.07 0.04 0.06 0.02 0.02 0.10 0.04 -10.06 0.62
0.00 7.33 0.28 0.36 0.22 0.23 SEQID-02560 0.05 0.04 0.05 0.06 0.05
0.02 0.06 0.07 -19.68 0.43 -0.03 5.15 0.21 0.32 0.00 0.19
SEQID-02561 0.03 0.06 0.04 0.06 0.05 0.02 0.05 0.08 -15.24 0.55
0.00 7.05 0.24 0.55 0.19 0.22 SEQID-02562 0.04 0.03 0.05 0.06 0.06
0.02 0.03 0.09 -16.87 0.54 -0.01 5.97 0.25 0.35 0.21 0.21
SEQID-02563 0.02 0.04 0.08 0.06 0.05 0.05 0.10 0.06 -16.23 0.41
0.00 7.12 0.70 0.91 0.00 0.21 SEQID-02564 0.02 0.06 0.05 0.03 0.03
0.06 0.04 0.06 -20.60 0.31 -0.01 6.79 0.22 0.32 0.22 0.23
SEQID-02565 0.04 0.07 0.07 0.04 0.03 0.03 0.06 0.06 -21.89 0.34
0.00 6.69 0.21 0.38 0.21 0.21 SEQID-02566 0.03 0.07 0.04 0.07 0.06
0.01 0.05 0.08 -18.93 0.44 -0.02 5.28 0.21 0.33 0.00 0.21
SEQID-02567 0.04 0.03 0.06 0.04 0.03 0.03 0.08 0.08 -15.22 0.52
0.01 7.31 1.00 1.00 0.26 0.32 SEQID-02568 0.01 0.07 0.06 0.03 0.04
0.01 0.06 0.07 -15.31 0.51 -0.03 4.64 0.26 0.35 0.00 0.24
SEQID-02569 0.01 0.04 0.03 0.09 0.06 0.06 0.05 0.08 -16.43 0.41
-0.01 6.41 0.21 0.32 0.00 0.22 SEQID-02570 0.03 0.04 0.05 0.05 0.06
0.03 0.04 0.07 -19.99 0.46 0.00 7.01 0.21 0.34 0.22 0.21
SEQID-02571 0.02 0.04 0.03 0.05 0.04 0.02 0.02 0.06 -28.49 0.36
-0.03 5.45 0.22 0.43 0.00 0.20 SEQID-02572 0.03 0.04 0.03 0.04 0.06
0.01 0.09 0.06 -22.92 0.37 -0.03 4.84 0.71 0.91 0.00 0.21
SEQID-02573 0.03 0.05 0.02 0.05 0.04 0.02 0.04 0.05 -28.14 0.31
-0.05 4.69 0.66 0.83 0.00 0.20 SEQID-02574 0.01 0.07 0.03 0.06 0.03
0.01 0.09 0.06 -8.93 0.63 0.01 8.42 0.31 0.42 0.23 0.25 SEQID-02575
0.01 0.04 0.03 0.06 0.05 0.04 0.02 0.12 -17.90 0.51 -0.01 5.15 0.87
0.93 0.00 0.00 SEQID-02576 0.02 0.04 0.05 0.04 0.04 0.01 0.04 0.09
-19.24 0.34 0.13 11.57 0.00 0.35 0.00 0.24 SEQID-02577 0.02 0.05
0.04 0.02 0.06 0.01 0.09 0.06 -23.20 0.38 -0.01 5.31 1.00 1.00 0.20
0.22 SEQID-02578 0.04 0.07 0.06 0.04 0.04 0.03 0.06 0.06 -22.11
0.34 0.00 6.40 0.21 0.33 0.00 0.21 SEQID-02579 0.03 0.04 0.03 0.05
0.04 0.02 0.05 0.08 -19.55 0.44 -0.02 5.23 0.88 0.98 0.20 0.21
SEQID-02580 0.03 0.06 0.06 0.05 0.04 0.04 0.06 0.07 -17.64 0.45
-0.01 6.24 0.20 0.34 0.00 0.22 SEQID-02581 0.03 0.04 0.07 0.04 0.03
0.03 0.05 0.08 -21.18 0.39 -0.02 5.14 0.20 0.34 0.00 0.22
SEQID-02582 0.04 0.07 0.05 0.05 0.02 0.06 0.05 0.07 -20.45 0.39
0.00 6.81 0.23 0.33 0.19 0.23 SEQID-02583 0.02 0.04 0.05 0.05 0.04
0.02 0.03 0.07 -21.54 0.36 0.11 11.32 0.21 0.39 0.00 0.19
SEQID-02584 0.03 0.07 0.04 0.04 0.02 0.04 0.04 0.09 -19.60 0.45
0.00 7.77 0.00 0.32 0.26 0.22 SEQID-02585 0.03 0.03 0.01 0.05 0.04
0.01 0.07 0.05 -25.84 0.30 -0.06 4.49 0.22 0.32 0.00 0.00
SEQID-02586 0.03 0.03 0.02 0.06 0.05 0.01 0.07 0.04 -26.08 0.30
-0.06 4.46 0.24 0.32 0.00 0.00 SEQID-02587 0.02 0.07 0.05 0.07 0.05
0.03 0.03 0.08 -16.51 0.51 -0.01 6.05 0.26 0.48 0.00 0.23
SEQID-02588 0.02 0.04 0.04 0.05 0.07 0.00 0.01 0.08 -22.86 0.38
-0.06 4.32 0.47 0.66 0.22 0.23 SEQID-02589 0.05 0.05 0.05 0.05 0.04
0.02 0.04 0.04 -18.82 0.37 0.02 8.39 0.22 0.35 0.20 0.23
SEQID-02590 0.04 0.03 0.04 0.06 0.04 0.02 0.06 0.07 -20.00 0.41
0.00 7.05 0.22 0.34 0.20 0.22 SEQID-02591 0.03 0.04 0.04 0.05 0.05
0.00 0.05 0.07 -18.93 0.47 -0.01 5.90 0.21 0.33 0.00 0.22
SEQID-02592 0.02 0.04 0.05 0.04 0.06 0.00 0.04 0.08 -18.09 0.47
-0.01 6.31 0.21 0.35 0.21 0.22 SEQID-02593 0.04 0.04 0.06 0.05 0.05
0.00 0.04 0.08 -17.29 0.50 0.01 8.18 0.20 0.33 0.19 0.21
SEQID-02594 0.03 0.05 0.04 0.06 0.06 0.03 0.05 0.07 -19.28 0.43
-0.01 6.23 0.87 0.96 0.00 0.20 SEQID-02595 0.03 0.06 0.05 0.05 0.05
0.02 0.05 0.08 -18.26 0.43 -0.02 5.89 0.20 0.34 0.00 0.21
SEQID-02596 0.02 0.03 0.05 0.07 0.04 0.01 0.03 0.07 -24.35 0.36
-0.10 4.09 0.19 0.40 0.20 0.19 SEQID-02597 0.02 0.02 0.03 0.02 0.08
0.00 0.04 0.05 -25.27 0.34 -0.01 5.85 0.00 0.33 0.00 0.00
SEQID-02598 0.02 0.09 0.03 0.03 0.03 0.02 0.06 0.07 -24.82 0.35
-0.07 4.28 0.38 0.44 0.24 0.24 SEQID-02599 0.02 0.05 0.02 0.05 0.03
0.07 0.04 0.05 -10.38 0.87 0.03 9.59 0.24 0.35 0.28 0.24
SEQID-02600 0.01 0.04 0.10 0.07 0.05 0.03 0.04 0.08 -17.05 0.50
0.02 8.49 0.30 0.39 0.00 1.00 SEQID-02601 0.04 0.05 0.04 0.04 0.04
0.01 0.04 0.08 -21.61 0.44 0.05 10.15 0.21 0.31 0.00 0.21
SEQID-02602 0.03 0.04 0.07 0.03 0.05 0.05 0.04 0.06 -17.05 0.50
-0.04 4.61 0.20 0.35 0.20 0.00 SEQID-02603 0.02 0.06 0.05 0.05 0.03
0.04 0.04 0.08 -20.46 0.47 0.01 8.42 0.42 0.69 0.22 0.20
SEQID-02604 0.03 0.03 0.04 0.03 0.04 0.02 0.06 0.06 -19.79 0.39
0.00 7.19 0.21 0.31 0.00 0.19 SEQID-02605 0.02 0.03 0.03 0.05 0.05
0.00 0.03 0.09 -24.17 0.42 0.00 7.09 0.21 0.33 0.00 0.21
SEQID-02606 0.03 0.05 0.03 0.04 0.05 0.02 0.05 0.07 -24.29 0.30
0.13 10.75 0.67 0.75 0.00 0.20 SEQID-02607 0.03 0.03 0.04 0.07 0.03
0.01 0.02 0.07 -22.97 0.41 0.01 8.58 0.41 0.60 0.21 0.23
SEQID-02608 0.02 0.06 0.05 0.05 0.04 0.00 0.05 0.06 -20.67 0.39
-0.01 6.22 0.20 0.34 0.00 0.21 SEQID-02609 0.03 0.06 0.05 0.07 0.04
0.01 0.04 0.07 -17.99 0.49 -0.01 6.39 0.21 0.38 0.00 0.21
SEQID-02610 0.01 0.08 0.05 0.05 0.05 0.01 0.04 0.05 -22.39 0.44
-0.06 4.53 0.21 0.51 0.00 0.21 SEQID-02611 0.02 0.05 0.04 0.07 0.05
0.02 0.04 0.07 -21.82 0.36 0.00 6.87 0.19 0.32 0.00 0.21
SEQID-02612 0.03 0.05 0.07 0.04 0.05 0.02 0.04 0.08 -21.82 0.35
-0.01 6.40 0.86 0.93 0.00 0.00 SEQID-02613 0.03 0.05 0.04 0.05 0.02
0.02 0.04 0.06 -22.91 0.24 0.14 11.03 0.22 0.31 0.24 0.26
SEQID-02614 0.02 0.04 0.05 0.02 0.04 0.02 0.02 0.07 -25.19 0.35
0.14 11.09 0.22 0.31 0.20 0.22 SEQID-02615 0.02 0.05 0.02 0.03 0.06
0.00 0.09 0.04 -26.16 0.26 0.03 9.40 0.22 0.31 0.00 0.00
SEQID-02616 0.02 0.06 0.05 0.04 0.04 0.06 0.03 0.07 -20.47 0.36
0.01 7.28 0.19 0.33 0.22 0.21 SEQID-02617 0.02 0.09 0.05 0.06 0.05
0.02 0.07 0.08 -14.92 0.47 0.00 7.33 0.52 0.70 0.00 0.21
SEQID-02618 0.02 0.03 0.03 0.03 0.03 0.00 0.02 0.08 -24.23 0.41
-0.01 6.17 0.22 0.38 0.39 0.21 SEQID-02619 0.04 0.01 0.06 0.04 0.05
0.01 0.06 0.03 -16.32 0.61 0.01 7.57 0.51 0.55 0.26 0.56
SEQID-02620 0.02 0.07 0.05 0.06 0.03 0.03 0.00 0.12 -27.11 0.32
0.00 6.56 0.75 0.85 0.19 0.24 SEQID-02621 0.02 0.06 0.04 0.04 0.04
0.03 0.10 0.05 -17.30 0.52 -0.01 6.60 0.36 0.50 0.00 0.20
SEQID-02622 0.03 0.04 0.05 0.06 0.04 0.00 0.05 0.10 -20.38 0.59
-0.02 5.14 0.20 0.53 0.21 0.23 SEQID-02623 0.01 0.09 0.05 0.07 0.06
0.02 0.06 0.04 -20.14 0.28 -0.02 5.66 0.23 0.31 0.00 0.00
SEQID-02624 0.03 0.03 0.05 0.05 0.04 0.05 0.06 0.06 -19.35 0.33
-0.01 6.65 0.21 0.32 0.00 0.23 SEQID-02625 0.04 0.05 0.06 0.05 0.05
0.01 0.04 0.07 -16.45 0.59 0.04 10.08 0.21 0.34 0.00 0.22
SEQID-02626 0.05 0.07 0.03 0.05 0.05 0.02 0.05 0.06 -19.72 0.35
-0.06 4.46 0.40 0.54 0.00 0.21 SEQID-02627 0.03 0.06 0.04 0.06 0.04
0.01 0.06 0.08 -19.97 0.39 -0.05 4.57 0.81 0.90 0.23 0.22
SEQID-02628 0.03 0.04 0.05 0.04 0.05 0.01 0.06 0.08 -17.24 0.44
0.01 8.43 0.22 0.34 0.21 0.22 SEQID-02629 0.03 0.05 0.05 0.05 0.05
0.02 0.09 0.07 -15.14 0.55 0.00 7.08 0.28 0.38 0.21 0.22
SEQID-02630 0.02 0.03 0.05 0.06 0.04 0.02 0.04 0.06 -18.89 0.43
0.00 6.66 0.21 0.32 0.00 0.21 SEQID-02631 0.03 0.07 0.03 0.06 0.05
0.02 0.05 0.06 -24.34 0.34 0.02 9.28 0.38 0.61 0.00 0.21
SEQID-02632 0.02 0.04 0.04 0.05 0.04 0.01 0.04 0.06 -21.94 0.46
-0.02 5.13 0.20 0.35 0.18 0.20 SEQID-02633 0.05 0.05 0.06 0.03 0.03
0.00 0.05 0.06 -23.57 0.36 0.10 10.85 0.23 0.29 0.20 0.25
SEQID-02634 0.01 0.09 0.06 0.08 0.03 0.03 0.00 0.06 -25.01 0.26
-0.01 5.86 0.72 0.85 0.18 0.22 SEQID-02635 0.01 0.07 0.05 0.03 0.06
0.01 0.04 0.06 -21.44 0.34 0.18 11.28 0.21 0.31 0.26 0.22
SEQID-02636 0.04 0.05 0.02 0.03 0.05 0.02 0.02 0.06 -26.57 0.30
0.13 11.42 0.24 0.32 0.20 0.23 SEQID-02637 0.02 0.03 0.04 0.05 0.03
0.01 0.05 0.05 -24.26 0.31 0.12 10.98 0.31 0.30 0.20 0.23
SEQID-02638 0.02 0.02 0.02 0.05 0.05 0.03 0.05 0.06 -25.95 0.18
0.13 11.09 0.23 0.34 0.00 0.19 SEQID-02639 0.03 0.04 0.03 0.08 0.05
0.02 0.06 0.08 -23.36 0.38 -0.08 4.12 0.39 0.54 0.00 0.00
SEQID-02640 0.02 0.06 0.05 0.01 0.05 0.01 0.07 0.07 -21.08 0.37
0.00 7.15 0.20 0.30 0.00 0.20 SEQID-02641 0.02 0.02 0.02 0.05 0.05
0.03 0.05 0.05 -25.83 0.18 0.13 11.09 0.23 0.33 0.00 0.20
SEQID-02642 0.02 0.05 0.03 0.04 0.05 0.00 0.03 0.05 -27.95 0.23
0.16 11.35 0.20 0.33 0.17 0.18 SEQID-02643 0.03 0.05 0.02 0.04 0.05
0.02 0.03 0.08 -25.27 0.31 0.08 10.53 0.20 0.30 0.00 0.00
SEQID-02644 0.02 0.06 0.05 0.03 0.06 0.02 0.02 0.10 -21.54 0.40
0.09 10.94 0.22 0.33 0.20 0.25 SEQID-02645 0.03 0.05 0.05 0.04 0.05
0.01 0.05 0.06 -19.10 0.45 -0.01 5.83 0.26 0.36 0.00 0.00
SEQID-02646 0.02 0.05 0.05 0.06 0.05 0.00 0.03 0.10 -16.61 0.56
0.01 8.30 0.53 0.71 0.00 0.23 SEQID-02647 0.05 0.06 0.04 0.06 0.05
0.02 0.09 0.06 -17.98 0.57 -0.03 5.23 0.00 0.31 0.00 0.22
SEQID-02648 0.02 0.09 0.04 0.07 0.04 0.01 0.02 0.08 -16.79 0.55
-0.02 6.09 0.71 0.81 0.00 1.00 SEQID-02649 0.01 0.08 0.04 0.04 0.03
0.02 0.03 0.06 -23.65 0.39 0.00 6.74 0.24 0.31 0.00 0.21
SEQID-02650 0.05 0.04 0.05 0.05 0.05 0.02 0.03 0.07 -19.93 0.36
0.00 6.72 0.21 0.35 0.19 0.21 SEQID-02651 0.04 0.07 0.05 0.04 0.05
0.01 0.03 0.03 -18.84 0.50 0.01 8.22 0.45 0.68 0.00 0.21
SEQID-02652 0.03 0.09 0.03 0.05 0.05 0.01 0.06 0.07 -12.69 0.92
0.02 9.25 0.21 0.33 0.00 0.22 SEQID-02653 0.04 0.06 0.05 0.05 0.06
0.01 0.04 0.08 -18.81 0.43 0.00 7.37 0.21 0.33 0.21 0.21
SEQID-02654 0.03 0.06 0.04 0.04 0.05 0.05 0.05 0.07 -23.42 0.31
0.00 7.06 0.20 0.33 0.20 0.21 SEQID-02655 0.02 0.03 0.04 0.06 0.04
0.02 0.02 0.06 -19.52 0.47 -0.03 4.96 0.21 0.33 0.00 0.22
SEQID-02656 0.03 0.04 0.06 0.06 0.05 0.03 0.09 0.06 -19.16 0.38
0.03 9.42 0.22 0.37 0.21 0.22 SEQID-02657 0.03 0.05 0.04 0.04 0.04
0.02 0.04 0.09 -20.62 0.40 -0.02 5.39 0.21 0.33 0.21 0.22
SEQID-02658 0.03 0.04 0.05 0.06 0.04 0.03 0.02 0.07 -18.73 0.55
0.02 9.11 0.20 0.33 0.00 0.22 SEQID-02659 0.02 0.05 0.05 0.05 0.04
0.02 0.05 0.08 -16.18 0.54 -0.02 5.61 0.21 0.31 0.19 0.22
SEQID-02660 0.03 0.04 0.04 0.05 0.02 0.02 0.09 0.08 -19.63 0.60
-0.04 4.66 0.20 0.34 0.00 0.22 SEQID-02661 0.03 0.04 0.03 0.05 0.04
0.01 0.09 0.06 -23.81 0.34 0.00 6.56 0.20 0.36 0.38 0.21
SEQID-02662 0.04 0.04 0.06 0.02 0.06 0.02 0.00 0.07 -23.42 0.38
-0.08 4.21 0.28 0.36 0.28 0.31 SEQID-02663 0.01 0.00 0.04 0.09 0.05
0.00 0.03 0.09 -9.95 0.75 0.08 9.58 0.71 0.80 0.28 0.28 SEQID-02664
0.02 0.02 0.02 0.02 0.06 0.01 0.02 0.07 -30.26 0.19 0.08 10.61 0.23
0.30 0.00 0.23 SEQID-02665 0.02 0.04 0.01 0.04 0.04 0.01 0.06 0.08
-26.30 0.32 0.06 10.16 0.30 0.34 0.24 0.00 SEQID-02666 0.05 0.04
0.03 0.05 0.06 0.01 0.03 0.08 -13.01 0.91 0.03 10.18 0.59 0.80 0.29
0.23 SEQID-02667 0.02 0.06 0.03 0.06 0.03 0.04 0.03 0.08 -18.21
0.45 0.05 10.66 0.52 0.63 0.26 0.00 SEQID-02668 0.03 0.04 0.04 0.05
0.09 0.00 0.02 0.06 -23.27 0.33 0.08 11.13 0.23 0.30 0.18 0.23
SEQID-02669 0.02 0.06 0.04 0.02 0.06 0.05 0.06 0.07 -15.40 0.43
-0.01 6.65 0.26 0.30 0.26 0.26 SEQID-02670 0.04 0.10 0.04 0.05 0.06
0.01 0.03 0.09 -17.99 0.40 0.02 8.49 0.82 0.85 0.00 0.24
SEQID-02671 0.03 0.05 0.01 0.03 0.07 0.01 0.03 0.08 -22.31 0.39
0.05 10.24 0.22 0.31 0.00 0.21 SEQID-02672 0.03 0.03 0.03 0.05 0.04
0.01 0.04 0.06 -21.21 0.39 0.05 10.27 0.00 0.30 0.00 0.18
SEQID-02673 0.02 0.06 0.02 0.05 0.07 0.02 0.04 0.03 -22.00 0.39
0.01 8.44 0.23 0.30 0.16 0.23 SEQID-02674 0.06 0.03 0.0 0.05 0.03
0.03 0.01 0.10 -24.56 0.35 0.00 7.53 0.00 0.45 0.22 0.24
SEQID-02675 0.03 0.06 0.06 0.03 0.05 0.04 0.05 0.08 -10.14 0.90
0.01 8.79 0.32 0.33 0.00 0.25 SEQID-02676 0.00 0.04 0.06 0.02 0.02
0.02 0.08 0.10 -19.85 0.53 -0.03 5.34 0.50 0.79 0.20 0.24
SEQID-02677 0.02 0.05 0.04 0.03 0.05 0.01 0.04 0.06 -22.73 0.36
0.10 10.80 0.20 0.31 0.00 0.00 SEQID-02678 0.03 0.06 0.06 0.05 0.05
0.03 0.06 0.05 -20.62 0.36 0.02 8.92 0.20 0.31 0.00 0.20
SEQID-02679 0.02 0.06 0.02 0.06 0.04 0.01 0.02 0.07 -22.98 0.35
-0.05 4.65 0.20 0.33 0.00 0.23 SEQID-02680 0.01 0.06 0.04 0.06 0.04
0.01 0.04 0.08 -18.07 0.45 0.00 6.84 0.21 0.35 0.18 0.22
SEQID-02681 0.04 0.06 0.05 0.06 0.05 0.02 0.02 0.07 -17.09 0.51
-0.01 6.28 0.30 0.43 0.00 0.21 SEQID-02682 0.04 0.02 0.02 0.05 0.06
0.00 0.02 0.08 -20.90 0.49 -0.01 5.39 0.21 0.33 0.22 0.22
SEQID-02683 0.02 0.03 0.03 0.07 0.05 0.00 0.01 0.09 -20.47 0.54
-0.02 5.11 0.21 0.33 0.20 0.22 SEQID-02684 0.01 0.04 0.07 0.03 0.03
0.04 0.04 0.05 -28.42 0.38 -0.07 4.45 0.43 0.73 0.19 0.21
SEQID-02685 0.02 0.03 0.05 0.05 0.05 0.00 0.02 0.10 -17.41 0.58
0.00 7.33 0.21 0.35 0.22 0.21 SEQID-02686 0.03 0.04 0.04 0.06 0.05
0.01 0.05 0.07 -17.37 0.46 0.00 7.27 0.20 0.35 0.00 0.22
SEQID-02687 0.02 0.04 0.03 0.07 0.04 0.02 0.05 0.05 -28.42 0.24
-0.05 4.61 0.44 0.69 0.00 0.20 SEQID-02688 0.02 0.07 0.04 0.07 0.05
0.02 0.04 0.05 -22.43 0.31 -0.01 5.79 0.19 0.55 0.00 0.20
SEQID-02689 0.03 0.05 0.03 0.07 0.04 0.02 0.04 0.07 -22.87 0.32
-0.05 4.72 0.18 0.33 0.19 0.19 SEQID-02690 0.04 0.03 0.04 0.05 0.04
0.00 0.03 0.10 -9.31 0.92 0.08 9.06 0.32 0.32 0.29 0.30 SEQID-02691
0.02 0.05 0.05 0.06 0.05 0.02 0.08 0.11 -18.79 0.43 -0.02 5.65 0.26
0.33 0.20 0.00 SEQID-02692 0.04 0.07 0.02 0.05 0.03 0.01 0.04 0.10
-21.68 0.56 0.07 10.55 0.00 0.30 0.23 0.26 SEQID-02693 0.02 0.05
0.04 0.05 0.07 0.00 0.03 0.07 -10.89 0.88 0.03 10.62 0.47 0.64 0.26
0.22 SEQID-02694 0.02 0.02 0.02 0.06 0.04 0.01 0.03 0.11 -27.06
0.27 0.15 11.62 0.22 0.30 0.17 0.22 SEQID-02695 0.03 0.01 0.05 0.05
0.05 0.01 0.00 0.11 -23.24 0.48 0.03 9.90 0.21 0.31 0.00 0.21
SEQID-02696 0.03 0.04 0.03 0.06 0.06 0.00 0.03 0.07 -23.44 0.37
-0.03 5.87 0.00 0.30 0.00 0.25 SEQID-02697 0.04 0.01 0.02 0.05 0.03
0.03 0.04 0.08 -20.38 0.49 0.00 6.79 0.00 0.31 0.23 0.25
SEQID-02698 0.03 0.05 0.01 0.06 0.03 0.01 0.06 0.08 -23.35 0.29
0.08 10.48 0.00 0.33 0.00 0.23 SEQID-02699 0.04 0.08 0.04 0.02 0.07
0.03 0.08 0.04 -22.58 0.23 0.16 11.08 0.22 0.28 0.00 0.00
SEQID-02700 0.02 0.05 0.04 0.02 0.04 0.00 0.06 0.08 -26.58 0.31
0.07 10.37 0.22 0.30 0.00 0.26 SEQID-02701 0.02 0.05 0.03 0.03 0.02
0.01 0.05 0.06 -25.76 0.30 0.09 10.90 0.00 0.33 0.00 0.00
SEQID-02702 0.02 0.06 0.06 0.04 0.06 0.01 0.04 0.05 -24.24 0.34
0.10 10.81 0.23 0.32 0.00 0.00 SEQID-02703 0.01 0.06 0.07 0.05 0.06
0.01 0.04 0.08 -14.83 0.68 0.01 7.78 0.25 0.33 0.22 0.22
SEQID-02704 0.02 0.03 0.07 0.07 0.02 0.01 0.02 0.10 -14.35 0.60
0.01 7.83 0.24 0.34 0.21 0.23 SEQID-02705 0.01 0.07 0.06 0.09 0.04
0.01 0.04 0.06 -18.24 0.49 -0.01 5.77 0.24 0.41 0.00 0.23
SEQID-02706 0.03 0.05 0.03 0.06 0.04 0.01 0.06 0.06 -20.80 0.37
-0.02 5.22 0.00 0.34 0.00 0.17 SEQID-02707 0.02 0.09 0.04 0.04 0.05
0.03 0.06 0.08 -10.43 0.97 0.02 8.57 0.19 0.33 0.22 0.22
SEQID-02708 0.04 0.07 0.04 0.07 0.07 0.02 0.04 0.07 -11.61 0.98
0.00 6.52 0.00 0.34 0.20 0.22 SEQID-02709 0.04 0.07 0.05 0.03 0.05
0.01 0.02 0.09 -18.52 0.51 -0.01 6.63 0.24 0.32 0.00 0.20
SEQID-02710 0.04 0.07 0.06 0.04 0.04 0.04 0.06 0.06 -19.76 0.38
-0.01 6.06 0.21 0.33 0.00 0.22 SEQID-02711 0.03 0.05 0.04 0.04 0.06
0.03 0.05 0.05 -22.74 0.35 0.00 6.86 0.22 0.31 0.00 0.20
SEQID-02712 0.01 0.04 0.05 0.07 0.05 0.02 0.05 0.07 -18.77 0.43
0.00 6.33 0.21 0.32 0.20 0.23 SEQID-02713 0.01 0.07 0.06 0.06 0.03
0.03 0.03 0.08 -19.54 0.47 -0.01 5.25 0.21 0.37 0.21 0.22
SEQID-02714 0.04 0.05 0.04 0.05 0.06 0.00 0.08 0.07 -20.73 0.39
-0.02 5.64 0.21 0.32 0.00 0.22 SEQID-02715 0.02 0.04 0.05 0.05 0.04
0.04 0.06 0.06 -18.43 0.36 -0.02 6.00 0.22 0.33 0.00 0.23
SEQID-02716 0.03 0.06 0.04 0.06 0.04 0.02 0.04 0.06 -19.43 0.47
0.00 7.43 0.21 0.33 0.00 0.22 SEQID-02717 0.02 0.05 0.06 0.06 0.05
0.03 0.04 0.06 -17.83 0.44 0.00 6.87 0.21 0.34 0.00 0.22
SEQID-02718 0.03 0.07 0.0G 0.06 0.04 0.02 0.04 0.09 -15.17 0.68
-0.01 5.53 0.20 0.33 0.00 0.22 SEQID-02719 0.03 0.05 0.05 0.05 0.05
0.01 0.06 0.06 -18.34 0.42 -0.01 6.38 0.21 0.33 0.00 0.22
SEQID-02720 0.03 0.06 0.04 0.06 0.05 0.01 0.05 0.07 -17.71 0.48
0.01 7.76 0.21 0.35 0.21 0.22 SEQID-02721 0.03 0.04 0.07 0.04 0.05
0.02 0.04 0.08 -16.52 0.52 0.00 6.96 0.20 0.34 0.19 0.22
SEQID-02722 0.04 0.05 0.05 0.05 0.04 0.01 0.03 0.08 -17.69 0.56
0.02 9.42 0.20 0.33 0.00 0.21 SEQID-02723 0.03 0.05 0.05 0.04 0.05
0.01 0.04 0.07 -23.11 0.36 -0.03 4.91 0.41 0.59 0.00 0.20
SEQID-02724 0.04 0.05 0.03 0.06 0.04 0.01 0.05 0.06 -18.16 0.55
-0.05 4.33 0.19 0.33 0.00 0.20 SEQID-02725 0.01 0.05 0.03 0.08 0.04
0.02 0.04 0.07 -16.41 0.39 0.00 6.82 0.38 0.65 0.00 0.21
SEQID-02726 0.05 0.04 0.05 0.05 0.06 0.02 0.06 0.07 -19.70 0.45
-0.03 5.16 0.19 0.35 0.00 0.21 SEQID-02727 0.04 0.05 0.03 0.06 0.06
0.02 0.06 0.07 -16.67 0.51 0.00 6.78 0.20 0.69 0.51 0.21
SEQID-02728 0.06 0.04 0.05 0.05 0.05 0.02 0.06 0.06 -19.71 0.44
-0.03 5.16 0.19 0.33 0.00 0.20 SEQID-02729 0.03 0.04 0.05 0.03 0.06
0.01 0.04 0.08 -21.97 0.41 0.03 9.64 0.21 0.35 0.20 0.22
SEQID-02730 0.03 0.05 0.03 0.06 0.06 0.02 0.06 0.08 -17.45 0.53
0.02 8.69 0.21 0.68 0.51 0.20 SEQID-02731 0.03 0.06 0.03 0.05 0.06
0.03 0.04 0.10 -20.31 0.50 0.01 8.19 0.284 0.94 0.22 0.00
SEQID-02732 0.04 0.04 0.04 0.04 0.07 0.02 0.04 0.07 -19.63 0.47
-0.02 5.66 0.20 0.31 0.00 0.22 SEQID-02733 0.02 0.05 0.03 0.07 0.06
0.02 0.04 0.08 -19.85 0.43 0.02 3.30 0.21 0.68 0.46 0.20
SEQID-02734 0.04 0.05 0.03 0.05 0.06 0.03 0.04 0.10 -19.88 0.45
0.01 3.72 0.84 0.91 0.00 0.21 SEQID-02735 0.01 0.05 0.02 0.00 0.01
0.00 0.03 0.02 -32.67 0.27 0.00 7.00 0.21 0.31 0.24 0.27
SEQID-02736 0.02 0.04 0.06 0.05 0.05 0.00 0.03 0.05 -25.93 0.25
0.13 10.85 0.28 0.31 0.00 0.00 SEQID-02737 0.03 0.04 0.04 0.09 0.06
0.02 0.04 0.09 -17.54 0.44 0.01 8.66
0.59 0.88 0.22 0.21 SEQID-02738 0.01 0.05 0.05 0.07 0.05 0.05 0.06
0.07 -16.83 0.38 -0.02 5.73 0.99 1.00 0.00 0.21 SEQID-02739 0.01
0.07 0.28 0.07 0.02 0.00 0.07 0.05 -10.31 0.32 0.00 6.61 0.20 0.41
0.21 0.22 SEQID-02740 0.02 0.03 0.04 0.05 0.06 0.01 0.05 0.07
-18.93 0.38 0.00 7.69 0.22 0.34 0.00 0.22 SEQID-02741 0.02 0.06
0.06 0.06 0.06 0.01 0.06 0.06 -20.59 0.35 -0.02 5.81 0.21 0.33 0.00
0.20 SEQID-02742 0.03 0.04 0.04 0.07 0.03 0.01 0.06 0.05 -19.66
0.44 0.00 6.93 0.20 0.32 0.00 0.22 SEQID-02743 0.03 0.06 0.04 0.05
0.05 0.02 0.05 0.08 -18.64 0.49 0.00 6.93 0.21 0.33 0.00 0.21
SEQID-02744 0.01 0.05 0.22 0.09 0.06 0.01 0.07 0.04 -13.87 0.30
0.02 8.68 0.21 0.45 0.24 0.22 SEQID-02745 0.05 0.05 0.04 0.04 0.05
0.02 0.04 0.08 -21.23 0.37 -0.01 6.06 0.19 0.35 0.00 0.21
SEQID-02746 0.01 0.05 0.05 0.05 0.04 0.04 0.06 0.06 -20.01 0.36
-0.01 6.46 0.19 0.35 0.00 0.20 SEQID-02747 0.06 0.12 0.03 0.06 0.06
0.00 0.00 0.05 -19.01 0.53 0.08 8.81 0.30 0.29 0.30 0.28
SEQID-02748 0.07 0.06 0.05 0.05 0.09 0.00 0.03 0.04 -15.35 0.71
0.01 7.73 0.26 0.28 0.25 0.26 SEQID-02749 0.01 0.04 0.02 0.01 0.07
0.00 0.06 0.05 -26.09 0.28 0.11 10.44 0.24 0.31 0.24 0.28
SEQID-02750 0.01 0.08 0.05 0.05 0.04 0.02 0.04 0.08 -18.50 0.55
-0.03 4.81 0.20 0.31 0.00 0.22 SEQID-02751 0.03 0.03 0.05 0.06 0.04
0.02 0.03 0.10 -16.97 0.56 -0.01 6.25 0.26 0.34 0.20 0.22
SEQID-02752 0.03 0.09 0.05 0.06 0.04 0.02 0.05 0.04 -18.54 0.32
-0.03 4.97 0.00 0.34 0.00 0.00 SEQID-02753 0.05 0.05 0.02 0.05 0.03
0.05 0.01 0.06 -24.99 0.39 -0.03 4.92 0.22 0.33 0.00 0.21
SEQID-02754 0.02 0.03 0.05 0.07 0.05 0.03 0.05 0.06 -18.14 0.38
0.01 9.15 0.23 0.35 0.00 0.22 SEQID-02755 0.03 0.05 0.04 0.04 0.06
0.01 0.03 0.07 -23.11 0.38 -0.03 4.88 0.70 0.93 0.20 0.21
SEQID-02756 0.03 0.04 0.03 0.06 0.05 0.00 0.03 0.09 -18.71 0.49
-0.01 5.32 0.19 0.35 0.00 0.22 SEQID-02757 0.02 0.05 0.04 0.06 0.05
0.03 0.05 0.07 -19.94 0.41 -0.01 5.35 0.88 1.00 0.00 0.20
SEQID-02758 0.03 0.06 0.05 0.07 0.05 0.02 0.05 0.08 -17.81 0.43
0.00 6.97 0.19 0.33 0.20 0.21 SEQID-02759 0.02 0.04 0.04 0.02 0.07
0.00 0.03 0.04 -24.18 0.30 0.15 11.74 0.24 0.30 0.00 0.26
SEQID-02760 0.03 0.04 0.05 0.04 0.05 0.03 0.04 0.06 -16.13 0.48
0.02 9.09 0.20 0.33 0.20 0.19 SEQID-02761 0.02 0.08 0.04 0.07 0.05
0.03 0.05 0.04 -16.70 0.36 0.05 9.16 0.22 0.32 0.00 0.21
SEQID-02762 0.02 0.07 0.07 0.07 0.04 0.04 0.06 0.03 -14.12 0.35
0.02 8.29 0.70 0.35 0.21 0.23 SEQID-02763 0.03 0.06 0.01 0.07 0.06
0.00 0.03 0.07 -15.16 0.53 -0.02 4.73 0.00 0.32 0.00 0.21
SEQID-02764 0.03 0.04 0.05 0.07 0.05 0.03 0.05 0.09 -16.89 0.42
0.01 8.17 0.21 0.34 0.00 0.20 SEQID-02765 0.03 0.05 0.04 0.05 0.04
0.01 0.03 0.09 -19.66 0.54 -0.01 5.85 0.23 0.33 0.23 0.21
SEQID-02766 0.02 0.06 0.03 0.03 0.06 0.02 0.05 0.07 -24.03 0.34
0.13 10.76 0.67 0.75 0.21 0.22 SEQID-02767 0.04 0.07 0.03 0.04 0.05
0.01 0.04 0.07 -21.28 0.43 -0.01 5.55 0.22 0.33 0.00 0.20
SEQID-02768 0.02 0.04 0.03 0.05 0.04 0.02 0.05 0.09 -20.12 0.41
-0.01 5.75 0.39 0.95 0.22 0.23 SEQID-02769 0.02 0.04 0.03 0.03 0.06
0.01 0.03 0.07 -24.92 0.41 -0.03 4.83 0.91 0.99 0.00 0.21
SEQID-02770 0.03 0.05 0.02 0.05 0.04 0.01 0.05 0.05 -28.29 0.30
-0.04 4.75 0.68 0.33 0.00 0.20 SEQID-02771 0.03 0.07 0.04 0.06 0.03
0.03 0.07 0.06 -21.30 0.29 -0.02 6.00 0.19 0.32 0.00 0.20
SEQID-02772 0.09 0.09 0.03 0.06 0.06 0.00 0.00 0.05 -18.31 0.55
0.07 8.61 0.31 0.29 0.34 0.30 SEQID-02773 0.02 0.04 0.00 0.04 0.03
0.02 0.09 0.03 -19.07 0.13 -0.01 5.32 0.31 0.54 0.28 0.32
SEQID-02774 0.01 0.04 0.03 0.05 0.05 0.03 0.03 0.05 -21.86 0.45
-0.02 6.41 0.36 0.44 0.23 0.20 SEQID-02775 0.02 0.05 0.02 0.05 0.06
0.00 0.06 0.09 -21.70 0.35 -0.03 5.54 0.74 0.89 0.24 0.22
SEQID-02776 0.02 0.07 0.03 0.08 0.07 0.04 0.07 0.06 -16.91 0.43
0.00 5.77 0.26 0.32 0.00 0.22 SEQID-02777 0.03 0.05 0.02 0.03 0.03
0.01 0.05 0.06 -26.92 0.30 0.09 10.85 0.22 0.32 0.00 0.21
SEQID-02778 0.01 0.02 0.03 0.04 0.04 0.04 0.08 0.07 -24.90 0.20
0.20 12.00 0.22 0.31 0.20 0.22 SEQID-02779 0.04 0.02 0.04 0.04 0.02
0.02 0.03 0.04 -29.48 0.17 0.22 12.05 0.00 0.30 0.22 0.24
SEQID-02780 0.02 0.08 0.08 0.04 0.09 0.03 0.06 0.04 -13.34 0.33
0.02 7.96 1.00 1.00 0.22 0.50 SEQID-02781 0.03 0.03 0.02 0.06 0.04
0.01 0.07 0.04 -24.89 0.32 -0.06 4.37 0.21 0.34 0.21 0.00
SEQID-02782 0.02 0.02 0.11 0.05 0.05 0.00 0.02 0.08 -25.13 0.22
0.20 11.32 0.24 0.38 0.24 0.25 SEQID-02783 0.01 0.02 0.12 0.04 0.06
0.00 0.01 0.06 -24.43 0.15 0.22 11.47 0.29 0.43 0.25 0.29
SEQID-02784 0.04 0.09 0.05 0.04 0.05 0.03 0.05 0.06 -12.46 0.86
0.01 8.31 0.21 0.34 0.24 0.20 SEQID-02785 0.02 0.09 0.04 0.03 0.05
0.03 0.07 0.09 -11.82 0.99 0.01 8.30 0.22 0.34 0.00 0.00
SEQID-02786 0.04 0.05 0.05 0.03 0.04 0.01 0.02 0.09 -18.30 0.52
-0.01 6.24 0.25 0.33 0.00 0.23 SEQID-02787 0.03 0.06 0.04 0.04 0.05
0.01 0.03 0.10 -18.28 0.54 -0.01 6.43 0.26 0.35 0.00 0.22
SEQID-02788 0.03 0.05 0.05 0.07 0.04 0.02 0.06 0.08 -17.31 0.52
0.00 6.63 0.21 0.33 0.00 0.21 SEQID-02789 0.03 0.06 0.02 0.04 0.06
0.03 0.05 0.05 -22.14 0.37 0.00 6.79 0.22 0.34 0.17 0.21
SEQID-02790 0.02 0.05 0.05 0.06 0.05 0.01 0.09 0.08 -19.53 0.41
-0.01 6.03 0.21 0.33 0.00 0.21 SEQID-02791 0.01 0.06 0.04 0.06 0.05
0.02 0.04 0.08 -16.02 0.52 -0.01 6.30 0.20 0.32 0.19 0.21
SEQID-02792 0.01 0.05 0.07 0.04 0.07 0.02 0.04 0.09 -25.79 0.30
-0.07 4.36 0.20 0.41 0.18 0.22 SEQID-02793 0.04 0.06 0.05 0.05 0.05
0.02 0.06 0.07 -19.92 0.39 -0.02 5.10 0.20 0.36 0.00 0.22
SEQID-02794 0.02 0.02 0.03 0.04 0.04 0.01 0.03 0.07 -24.57 0.38
-0.01 6.02 0.23 0.38 0.38 0.21 SEQID-02795 0.05 0.06 0.05 0.06 0.05
0.02 0.05 0.06 -18.56 0.53 -0.01 6.68 0.21 0.33 0.00 0.23
SEQID-02796 0.05 0.04 0.05 0.05 0.06 0.02 0.06 0.06 -19.72 0.44
-0.03 5.17 0.20 0.34 0.00 0.20 SEQID-02797 0.05 0.04 0.05 0.05 0.06
0.02 0.06 0.06 -19.74 0.43 -0.03 5.16 0.21 0.31 0.00 0.21
SEQID-02798 0.03 0.04 0.03 0.05 0.04 0.02 0.04 0.0 -20.29 0.44 0.00
6.53 0.91 1.00 0.22 0.22 SEQID-02799 0.03 0.05 0.04 0.04 0.04 0.02
0.05 0.0 -21.22 0.38 -0.02 5.73 0.21 0.33 0.20 0.22 SEQID-02800
0.05 0.05 0.04 0.04 0.05 0.02 0.04 0.0 -21.15 0.39 -0.01 5.97 0.19
0.33 0.00 0.21 SEQID-02801 0.02 0.04 0.03 0.04 0.04 0.02 0.05 0.08
-19.95 0.44 -0.01 5.53 0.89 0.99 0.20 0.22 SEQID-02802 0.03 0.05
0.04 0.05 0.05 0.03 0.09 0.07 -18.37 0.70 -0.02 5.50 0.19 0.33 0.00
0.20 SEQID-02803 0.04 0.04 0.04 0.04 0.06 0.02 0.04 0.07 -19.89
0.48 -0.01 6.30 0.21 0.33 0.21 0.21 SEQID-02804 0.03 0.04 0.03 0.04
0.06 0.01 0.0 0.06 -22.76 0.37 -0.03 4.91 0.71 0.91 0.21 0.20
SEQID-02805 0.02 0.03 0.04 0.03 0.06 0.01 0.06 0.07 -19.40 0.41
0.01 8.03 0.23 0.34 0.00 0.22 SEQID-02806 0.02 0.05 0.04 0.06 0.04
0.01 0.03 0.09 -20.35 0.54 0.00 6.70 0.24 0.33 0.20 0.21
SEQID-02807 0.03 0.05 0.05 0.04 0.06 0.01 0.04 0.0 -22.17 0.41 0.03
9.53 0.22 0.33 0.21 0.21 SEQID-02808 0.03 0.07 0.04 0.05 0.05 0.01
0.02 0.09 -19.02 0.51 -0.01 6.35 0.25 0.34 0.00 0.20 SEQID-02809
0.03 0.05 0.04 0.04 0.06 0.01 0.03 0.07 -22.81 0.37 -0.02 4.91 0.71
0.91 0.00 0.21 SEQID-02810 0.03 0.05 0.03 0.07 0.06 0.03 0.04 0.10
-20.69 0.47 0.00 7.21 0.86 0.93 0.00 0.19 SEQID-02811 0.03 0.04
0.04 0.06 0.04 0.03 0.04 0.06 -21.89 0.38 -0.01 6.31 0.19 0.33 0.20
0.19 SEQID-02812 0.03 0.06 0.04 0.05 0.04 0.02 0.06 0.06 -20.34
0.41 -0.02 6.02 0.19 0.35 0.00 0.21 SEQID-02813 0.01 0.03 0.07 0.05
0.04 0.00 0.01 0.05 -38.34 0.12 -0.07 4.92 0.28 0.45 0.13 0.26
SEQID-02814 0.03 0.06 0.03 0.05 0.06 0.03 0.04 0.10 -20.33 0.49
0.01 8.08 0.84 0.94 0.19 0.22 SEQID-02815 0.03 0.07 0.04 0.07 0.04
0.02 0.05 0.06 -19.57 0.42 0.00 6.53 0.20 0.34 0.00 0.21
SEQID-02816 0.03 0.06 0.05 0.04 0.04 0.03 0.05 0.05 -22.17 0.35
-0.03 5.57 0.12 0.32 0.00 0.20 SEQID-02817 0.04 0.07 0.03 0.04 0.05
0.01 0.05 0.08 -21.34 0.43 -0.02 5.22 0.21 0.33 0.00 0.20
SEQID-02818 0.02 0.05 0.04 0.05 0.04 0.01 0.06 0.06 -19.05 0.50
0.00 6.68 0.20 0.32 0.20 0.21 SEQID-02819 0.01 0.05 0.09 0.03 0.05
0.02 0.03 0.09 -25.75 0.35 -0.07 4.40 0.20 0.48 0.19 0.21
SEQID-02820 0.02 0.05 0.04 0.05 0.04 0.00 0.03 0.06 -24.83 0.35
-0.03 4.89 0.20 0.34 0.00 0.21 SEQID-02821 0.01 0.03 0.01 0.03 0.07
0.02 0.05 0.04 -24.60 0.40 0.01 7.68 0.23 0.31 0.00 0.00
SEQID-02822 0.03 0.04 0.04 0.06 0.03 0.00 0.05 0.07 -18.84 0.46
0.00 7.93 0.22 0.32 0.00 0.22 SEQID-02823 0.02 0.08 0.04 0.06 0.03
0.03 0.05 0.06 -24.66 0.39 -0.05 4.72 0.20 0.32 0.00 0.23
SEQID-02824 0.03 0.06 0.05 0.07 0.05 0.02 0.05 0.07 -17.72 0.41
0.00 7.12 0.18 0.38 0.20 0.21 SEQID-02825 0.03 0.06 0.04 0.04 0.04
0.01 0.05 0.07 -19.88 0.46 -0.02 5.18 0.19 0.36 0.18 0.19
SEQID-02826 0.05 0.00 0.00 0.00 0.02 0.00 0.06 0.00 -27.63 0.13
0.00 6.97 0.43 0.28 0.33 0.36 SEQID-02827 0.03 0.07 0.03 0.03 0.04
0.04 0.00 0.13 -23.66 0.49 -0.04 4.98 0.56 0.68 0.00 0.00
SEQID-02828 0.02 0.07 0.07 0.04 0.04 0.01 0.04 0.04 -22.83 0.33
-0.02 5.93 0.24 0.35 0.20 0.23 SEQID-02829 0.03 0.06 0.06 0.06 0.04
0.03 0.05 0.07 -17.67 0.51 -0.01 5.99 0.22 0.33 0.00 0.23
SEQID-02830 0.01 0.06 0.03 0.03 0.04 0.02 0.07 0.08 -20.80 0.48
0.00 6.69 0.22 0.33 0.00 0.22 SEQID-02831 0.01 0.05 0.05 0.05 0.04
0.01 0.03 0.09 -19.87 0.44 0.00 8.05 0.21 0.33 0.00 0.22
SEQID-02832 0.02 0.04 0.04 0.06 0.05 0.03 0.05 0.06 -18.85 0.43
0.00 7.06 0.20 0.35 0.00 0.21 SEQID-02833 0.03 0.05 0.04 0.06 0.05
0.02 0.05 0.07 -20.31 0.41 -0.01 6.47 0.87 0.98 0.00 0.20
SEQID-02834 0.04 0.05 0.05 0.06 0.05 0.02 0.05 0.03 -18.23 0.43
0.00 6.85 0.20 0.34 0.00 0.21 SEQID-02835 0.01 0.05 0.04 0.05 0.04
0.04 0.02 0.12 -17.44 0.54 0.00 6.77 0.79 0.86 0.23 0.23
SEQID-02836 0.00 0.02 0.10 0.09 0.01 0.00 0.19 0.01 -27.00 0.03
-0.08 4.40 0.25 0.38 0.21 0.26 SEQID-02837 0.03 0.05 0.04 0.09 0.07
0.02 0.04 0.09 -17.36 0.45 0.02 8.78 0.57 0.89 0.21 0.22
SEQID-02838 0.02 0.04 0.02 0.03 0.09 0.00 0.02 0.05 -23.65 0.34
0.00 7.88 0.22 0.31 0.23 0.21 SEQID-02839 0.03 0.05 0.02 0.06 0.03
0.03 0.05 0.06 -20.86 0.43 0.00 7.03 0.22 0.35 0.22 0.21
SEQID-02840 0.02 0.05 0.05 0.06 0.05 0.02 0.05 0.08 -15.77 0.52
-0.01 6.24 0.22 0.33 0.00 0.21 SEQID-02841 0.03 0.06 0.04 0.04 0.05
0.03 0.04 0.07 -18.06 0.42 -0.02 5.81 0.19 0.32 0.00 0.20
SEQID-02842 0.02 0.07 0.05 0.07 0.05 0.02 0.04 0.06 -22.46 0.30
-0.01 6.38 0.20 0.58 0.00 0.21 SEQID-02843 0.02 0.07 0.04 0.07 0.03
0.05 0.03 0.07 -19.11 0.43 0.00 7.78 0.25 0.33 0.00 0.21
SEQID-02844 0.04 0.10 0.04 0.07 0.07 0.01 0.02 0.08 -16.02 0.43
0.03 8.97 0.91 0.96 0.00 0.27 SEQID-02845 0.04 0.10 0.04 0.05 0.07
0.01 0.02 0.08 -18.91 0.35 0.01 7.97 0.88 0.94 0.00 0.27
SEQID-02846 0.01 0.00 0.12 0.02 0.08 0.00 0.00 0.11 -32.61 0.13
-0.25 3.61 0.42 0.48 0.26 0.28 SEQID-02847 0.01 0.08 0.04 0.07 0.03
0.01 0.06 0.05 -20.86 0.34 0.00 7.29 0.22 0.31 0.00 0.23
SEQID-02848 0.05 0.02 0.04 0.05 0.06 0.01 0.02 0.08 -19.41 0.56
0.00 7.59 0.21 0.33 0.00 0.21 SEQID-02849 0.03 0.05 0.04 0.04 0.05
0.03 0.05 0.07 -21.14 0.40 -0.01 6.25 0.20 0.31 0.00 0.22
SEQID-02850 0.04 0.03 0.02 0.07 0.03 0.01 0.06 0.03 -25.82 0.32
-0.07 4.40 0.22 0.33 0.19 0.00 SEQID-02851 0.01 0.07 0.05 0.02 0.05
0.02 0.07 0.05 -20.48 0.38 0.04 9.21 0.21 0.34 0.00 0.00
SEQID-02852 0.03 0.02 0.04 0.05 0.04 0.03 0.03 0.10 -16.82 0.56
0.00 6.62 0.25 0.33 0.00 0.21 SEQID-02853 0.02 0.04 0.05 0.07 0.05
0.03 0.05 0.06 -17.53 0.38 0.01 8.99 0.22 0.35 0.00 0.23
SEQID-02854 0.03 0.05 0.05 0.05 0.05 0.02 0.06 0.06 -17.07 0.49
0.00 7.38 0.22 0.35 0.00 0.22 SEQID-02855 0.06 0.06 0.04 0.06 0.05
0.02 0.06 0.06 -19.18 0.33 -0.05 4.51 0.40 0.53 0.22 0.23
SEQID-02856 0.06 0.07 0.03 0.05 0.05 0.02 0.05 0.06 -19.74 0.35
-0.05 4.49 0.40 0.54 0.00 0.21 SEQID-02857 0.03 0.07 0.04 0.06 0.04
0.02 0.05 0.06 -19.73 0.45 -0.02 5.50 0.21 0.32 0.00 0.22
SEQID-02858 0.02 0.07 0.04 0.07 0.03 0.01 0.05 0.07 -19.33 0.50
-0.02 5.62 0.21 0.34 0.19 0.22 SEQID-02859 0.03 0.05 0.05 0.05 0.06
0.05 0.07 0.07 -17.75 0.42 -0.07 4.19 0. 8 0.88 0.00 0.21
SEQID-02860 0.01 0.05 0.05 0.05 0.05 0.02 0.05 0.08 -16.60 0.51
-0.02 5.87 0.21 0.32 0.17 0.21 SEQID-02861 0.02 0.04 0.03 0.04 0.06
0.01 0.03 0.07 -24.91 0.41 -0.03 4.78 0.90 1.00 0.00 0.21
SEQID-02862 0.02 0.06 0.04 0.05 0.04 0.03 0.07 0.07 -20.75 0.43
0.00 7.12 0.20 0.34 0.00 0.21
SEQID-02863 0.04 0.09 0.03 0.07 0.06 0.02 0.04 0.09 -12.26 0.95
-0.01 5.12 0.20 0.34 0.18 0.30 SEQID-02864 0.03 0.04 0.04 0.04 0.04
0.02 0.05 0.05 -22.85 0.36 -0.01 6.07 0.20 0.32 0.00 0.21
SEQID-02865 0.02 0.05 0.00 0.09 0.02 0.02 0.0 0.02 -18.40 0.16 0.00
6.75 0.31 0.49 0.29 0.32 SEQID-02866 0.02 0.06 0.05 0.04 0.06 0.00
0.06 0.09 -21.29 0.39 -0.02 6.39 0.62 0.68 0.00 0.25 SEQID-02867
0.02 0.03 0.04 0.05 0.04 0.03 0.02 0.09 -19.69 0.49 0.00 6.52 0.26
0.33 0.00 0.25 SEQID-02868 0.03 0.06 0.04 0.03 0.02 0.04 0.07 0.05
-26.81 0.28 -0.06 4.66 0.21 0.31 0.00 0.24 SEQID-02869 0.02 0.02
0.06 0.09 0.06 0.03 0.02 0.07 -14.19 0.47 -0.03 4.73 0.66 0.89 0.24
0.24 SEQID-02870 0.04 0.03 0.02 0.07 0.05 0.02 0.07 0.05 -23.48
0.40 -0.06 4.51 0.23 0.34 0.21 0.00 SEQID-02871 0.03 0.09 0.04 0.04
0.06 0.03 0.05 0.06 -12.89 0.89 0.01 8.58 0.20 0.33 0.23 0.23
SEQID-02872 0.02 0.04 0.06 0.04 0.05 0.05 0.07 0.05 -19.05 0.32
-0.02 5.27 0.22 0.34 0.00 0.34 SEQID-02873 0.02 0.07 0.05 0.06 0.05
0.02 0.06 0.03 -16.01 0.52 -0.01 5.46 0.28 0.41 0.00 0.23
SEQID-02874 0.05 0.05 0.05 0.04 0.03 0.01 0.02 0.11 -18.46 0.52
-0.01 6.41 0.25 0.33 0.00 0.25 SEQID-02875 0.05 0.05 0.04 0.05 0.05
0.02 0.05 0.0 -21.45 0.46 -0.0 5.01 0.00 0.30 0.00 0.19 SEQID-02876
0.04 0.03 0.05 0.05 0.03 0.03 0.04 0.07 -21.33 0.34 0.10 11.11 0.22
0.36 0.00 0.22 SEQID-02877 0.03 0.07 0.05 0.07 0.05 0.02 0.06 0.06
-20.45 0.39 0.01 7.72 0.22 0.33 0.23 0.22 SEQID-02878 0.02 0.08
0.07 0.05 0.04 0.0 0.06 0.05 -20.84 0.28 0.01 7.39 0.39 0.59 0.00
0.21 SEQID-02879 0.02 0.09 0.06 0.04 0.04 0.02 0.06 0.06 -21.17
0.28 0.00 7.21 0.39 0.61 0.00 0.21 SEQID-02880 0.03 0.07 0.04 0.06
0.04 0.02 0.03 0.09 -21.19 0.53 0.00 7.50 0.20 0.34 0.00 0.22
SEQID-02881 0.02 0.04 0.05 0.06 0.06 0.00 0.03 0.09 -18.04 0.48
-0.01 6.31 0.21 0.33 0.00 0.22 SEQID-02882 0.03 0.04 0.10 0.10 0.04
0.00 0.05 0.05 -14.55 0.27 -0.02 5.91 0.22 0.49 0.19 0.21
SEQID-02883 0.05 0.05 0.05 0.07 0.05 0.03 0.04 0.08 -13.95 0.84
-0.03 4.60 0.19 0.36 0.00 0.21 SEQID-02884 0.03 0.05 0.05 0.05 0.05
0.01 0.03 0.08 -22.71 0.37 -0.03 4.87 0.39 0.60 0.00 0.20
SEQID-02885 0.04 0.04 0.06 0.06 0.04 0.01 0.06 0.03 -19.93 0.30
-0.01 6.37 0.19 0.40 0.00 0.21 SEQID-02886 0.02 0.09 0.03 0.03 0.04
0.02 0.06 0.07 -24.09 0.38 -0.08 4.23 0.38 0.43 0.21 0.25
SEQID-02887 0.03 0.07 0.06 0.06 0.06 0.01 0.03 0.10 -14.57 0.56
0.01 8.69 0.31 0.40 0.00 0.26 SEQID-02888 0.01 0.06 0.05 0.05 0.06
0.01 0.02 0.07 -28.50 0.34 -0.06 4.50 0.00 0.38 0.00 0.27
SEQID-02889 0.05 0.02 0.03 0.05 0.02 0.02 0.03 0.05 -30.76 0.15
0.22 11.99 0.21 0.31 0.21 0.23 SEQID-02890 0.03 0.06 0.03 0.05 0.06
0.03 0.03 0.13 -17.01 0.60 -0.01 6.50 0.27 0.32 0.22 0.00
SEQID-02891 0.01 0.10 0.05 0.07 0.04 0.01 0.04 0.08 -18.28 0.49
-0.02 5.59 0.23 0.34 0.00 0.24 SEQID-02892 0.02 0.05 0.04 0.03 0.06
0.02 0.09 0.09 -22.47 0.39 0.09 10.89 0.22 0.33 0.21 0.23
SEQID-02893 0.02 0.09 0.04 0.05 0.06 0.03 0.07 0.08 -11.49 0.93
0.01 8.30 0.20 0.33 0.00 0.21 SEQID-02894 0.01 0.06 0.05 0.06 0.05
0.01 0.05 0.03 -19.70 0.42 -0.01 6.07 0.75 0.85 0.00 0.00
SEQID-02895 0.01 0.03 0.05 0.05 0.05 0.03 0.05 0.05 -21.54 0.35
-0.01 6.12 0.22 0.33 0.00 0.00 SEQID-02896 0.04 0.05 0.06 0.04 0.05
0.01 0.04 0.07 -20.51 0.34 0.00 6.96 0.19 0.33 0.00 0. SEQID-02897
0.02 0.03 0.06 0.05 0.04 0.04 0.06 0.06 -18.54 0.42 0.00 6.73 0.00
0.36 0.00 0.23 SEQID-02898 0.03 0.05 0.03 0.03 0.06 0.02 0.05 0.07
-24.52 0.30 0.13 10.89 0.66 0.75 0.22 0.21 SEQID-02899 0.04 0.05
0.05 0.07 0.04 0.01 0.02 0.09 -17.42 0.63 0.00 7.36 0.22 0.34 0.00
0.22 SEQID-02900 0.03 0.04 0.08 0.07 0.05 0.00 0.03 0.09 -20.10
0.43 0.02 9.93 0.21 0.36 0.00 0.23 SEQID-02901 0.02 0.05 0.03 0.07
0.05 0.01 0.03 0.09 -19.38 0.56 0.00 7.33 0.23 0.33 0.00 0.22
SEQID-02902 0.04 0.05 0.03 0.05 0.06 0.03 0.05 0.089 -21.33 0.44
-0.02 5.43 0.21 0.33 0.00 0.21 SEQID-02903 0.02 0.06 0.05 0.07 0.04
0.01 0.05 0.06 -18.75 0.41 -0.02 5.54 0.21 0.35 0.00 0.21
SEQID-02904 0.03 0.03 0.14 0.09 0.04 0.01 0.04 0.05 -14.76 0.16
-0.01 6.40 0.22 0.46 0.20 0.23 SEQID-02905 0.03 0.06 0.06 0.06 0.04
0.02 0.0 0.09 -16.86 0.58 -0.01 6.30 0.21 0.33 0.00 0.22
SEQID-02906 0.02 0.05 0.04 0.05 0.06 0.01 0.05 0.06 -17.48 0.43
0.01 7.80 0.21 0.33 0.00 0.22 SEQID-02907 0.02 0.05 0.05 0.06 0.05
0.02 0.05 0.07 -19.25 0.37 0.00 7.77 0.20 0.33 0.00 0.21
SEQID-02908 0.03 0.06 0.02 0.05 0.04 0.01 0.04 0.05 -27.98 0.32
-0.04 4.71 0.686 0.31 0.00 0.21 SEQID-02909 0.01 0.06 0.28 0.09
0.02 0.00 0.06 0.05 -10.68 0.33 -0.01 6.22 0.22 0.40 0.22 0.23
SEQID-02910 0.01 0.01 0.06 0.07 0.05 0.00 0.00 0.13 -28.57 0.28
-0.15 3.96 0.20 0.36 0.00 0.22 SEQID-02911 0.04 0.04 0.04 0.06 0.04
0.02 0.03 0.05 -19.16 0.55 -0.05 4.51 0.19 0.33 0.20 0.20
SEQID-02912 0.01 0.05 0.03 0.06 0.07 0.03 0.03 0.05 -24.87 0.26
-0.06 4.92 0.34 0.41 0.22 0.22 SEQID-02913 0.02 0.04 0.03 0.05 0.06
0.00 0.03 0.07 -23.29 0.37 -0.03 5.87 0.22 0.28 0.00 0.20
SEQID-02914 0.05 0.05 0.06 0.05 0.07 0.04 0.07 0.05 -17.27 0.37
0.04 9.15 0.25 0.29 0.00 0.23 SEQID-02915 0.04 0.09 0.04 0.06 0.07
0.02 0.02 0.07 -18.33 0.49 0.03 9.69 0.58 0.81 0.00 0.25
SEQID-02916 0.02 0.04 0.05 0.05 0.03 0.02 0.01 0.06 -29.07 0.23
0.01 8.19 0.24 0.35 0.00 0.24 SEQID-02917 0.01 0.098 0.07 0.06 0.11
0.02 0.05 0.02 -14.45 0.36 -0.01 4.89 0.76 0.38 0.21 0.54
SEQID-02918 0.03 0.0 0.04 0.07 0.05 0.01 0.04 0.06 -19.39 0.45
-0.07 4.26 0.00 0.31 0.00 0.20 SEQID-02919 0.02 0.02 0.03 0.07 0.05
0.02 0.05 0.09 -23.16 0.51 -0.07 4.38 0.37 0.57 0.00 0.00
SEQID-02920 0.01 0.07 0.02 0.12 0.03 0.00 0.11 0.05 -14.97 0.20
-0.03 4.47 0.26 0.49 0.26 0.27 SEQID-02921 0.04 0.06 0.05 0.05 0.06
0.01 0.05 0.09 -18.77 0.48 -0.04 5.01 0.19 0.31 0.00 0.22
SEQID-02922 0.01 0.02 0.10 0.04 0.03 0.02 0.10 0.08 -20.10 0.34
-0.05 4.42 0.24 0.38 0.23 0.26 SEQID-02923 0.03 0.07 0.03 0.05 0.05
0.0 0.04 0.07 -20.52 0.39 0.00 7.13 0.22 0.31 0.00 0.31 SEQID-02924
0.01 0.07 0.05 0.07 0.08 0.01 0.04 0.06 -19.54 0.35 0.00 6.12 0.22
0.33 0.20 0.23 SEQID-02925 0.01 0.03 0.02 0.08 0.08 0.06 0.04 0.07
-19.59 0.44 0.01 7.81 0.21 0.33 0.00 0.00 SEQID-02926 0.03 0.03
0.04 0.06 0.04 0.03 0.05 0.09 -19.09 0.55 -0.01 6.17 0.21 0.31 0.00
0.19 SEQID-02927 0.04 0.03 0.04 0.03 0.04 0.02 0.05 0.07 -18.99
0.43 0.01 7.43 0.21 0.32 0.00 0.19 SEQID-02928 0.03 0.089 0.02 0.07
0.03 0.02 0.07 0.06 -16.20 0.47 0.06 10.25 0.22 0.31 0.00 0.21
SEQID-02929 0.02 0.07 0.05 0.06 0.03 0.03 0.08 0.04 -15.04 0.41
0.00 7.03 0.46 0.69 0.21 0.20 SEQID-02930 0.04 0.07 0.03 0.05 0.05
0.03 0.05 0.05 -20.89 0.33 -0.01 6.44 0.21 0.32 0.00 0.20
SEQID-02931 0.03 0.04 0.02 0.04 0.04 0.00 0.02 0.09 -20.45 0.50
-0.01 5.86 0.24 0.33 0.00 0.71 SEQID-02932 0.03 0.06 0.05 0.04 0.03
0.07 0.04 0.05 -21.27 0.39 -0.04 4.86 0.21 0.32 0.00 0.19
SEQID-02933 0.03 0.06 0.04 0.06 0.06 0.03 0.07 0.05 -19.56 0.32
-0.01 5.95 0.22 0.33 0.00 0.20 SEQID-02934 0.02 0.05 0.03 0.06 0.05
0.00 0.04 0.05 -22.41 0.31 -0.04 4.85 0.21 0.30 0.00 0.20
SEQID-02935 0.01 0.05 0.05 0.07 0.04 0.02 0.04 0.06 -20.31 0.35
-0.01 6.72 0.20 0.31 0.19 0.22 SEQID-02936 0.03 0.06 0.04 0.06 0.05
0.01 0.06 0.08 -19.63 0.38 -0.05 4.64 0.82 0.90 0.20 0.21
SEQID-02937 0.02 0.05 0.06 0.06 0.05 0.01 0.05 0.05 -19.29 0.30
-0.01 5.88 0.19 0.31 0.18 0.20 SEQID-02938 0.04 0.06 0.04 0.08 0.04
0.01 0.07 0.07 -18.49 0.41 -0.01 6.29 0.21 0.33 0.21 0.22
SEQID-02939 0.02 0.06 0.04 0.03 0.06 0.03 0.05 0.06 -19.69 0.38
0.00 6.79 0.20 0.33 0.18 0.22 SEQID-02940 0.03 0.04 0.04 0.05 0.05
0.01 0.05 0.07 -18.93 0.42 0.00 7.40 0.21 0.34 0.19 0.21
SEQID-02941 0.03 0.05 0.03 0.04 0.05 0.03 0.04 0.06 -20.20 0.55
-0.02 6.29 0.20 0.34 0.19 0.21 SEQID-02942 0.02 0.06 0.04 0.06 0.05
0.01 0.05 0.07 -17.95 0.49 0.00 7.37 0.21 0.35 0.00 0.21
SEQID-02943 0.04 0.05 0.05 0.05 0.06 0.02 0.06 0.07 -19.44 0.39
-0.02 5.02 0.20 0.35 0.00 0.22 SEQID-02944 0.02 0.06 0.04 0.05 0.05
0.01 0.05 0.07 -21.66 0.38 -0.01 6.19 0.21 0.33 0.00 0.20
SEQID-02945 0.02 0.05 0.06 0.08 0.06 0.03 0.04 0.07 -17.48 0.38
-0.03 4.85 0.18 0.40 0.19 0.19 SEQID-02946 0.01 0.01 0.00 0.07 0.04
0.00 0.01 0.05 -28.23 0.22 -0.09 4.43 0.21 0.40 0.19 0.18
SEQID-02947 0.02 0.07 0.06 0.07 0.03 0.02 0.06 0.10 -17.49 0.42
0.01 8.20 0.29 0.36 0.21 0.25 SEQID-02948 0.05 0.03 0.05 0.02 0.07
0.03 0.06 0.04 -15.48 0.46 -0.05 4.33 0.90 0.94 0.25 0.26
SEQID-02949 0.01 0.07 0.04 0.05 0.05 0.01 0.03 0.09 -19.80 0.54
-0.03 4.97 0.40 0.50 0.20 0.24 SEQID-02950 0.06 0.03 0.06 0.03 0.06
0.02 0.04 0.06 -20.78 0.34 -0.04 4.59 0.19 0.30 0.21 0.21
SEQID-02951 0.06 0.08 0.02 0.03 0.05 0.00 0.04 0.08 -17.44 0.49
0.04 9.84 0.20 0.28 0.00 0.21 SEQID-02952 0.04 0.05 0.03 0.05 0.04
0.01 0.08 0.07 -19.06 0.55 -0.01 6.24 0.25 0.32 0.00 0.24
SEQID-02953 0.04 0.05 0.06 0.06 0.01 0.01 0.06 0.07 -22.91 0.40
-0.02 5.85 0.23 0.32 0.21 0.21 SEQID-02954 0.02 0.02 0.04 0.04 0.03
0.05 0.09 0.06 -25.46 0.19 0.21 11.95 0.21 0.31 0.00 0.20
SEQID-02955 0.01 0.08 0.06 0.07 0.06 0.01 0.02 0.10 -19.22 0.48
-0.02 5.00 0.23 0.34 0.00 0.00 SEQID-02956 0.04 0.04 0.04 0.07 0.05
0.01 0.09 0.05 -17.31 0.47 0.00 7.36 0.19 0.30 0.21 0.00
SEQID-02957 0.02 0.06 0.06 0.05 0.02 0.03 0.06 0.09 -17.40 0.53
-0.01 6.15 0.00 0.35 0.00 0.25 SEQID-02958 0.03 0.07 0.06 0.05 0.03
0.04 0.04 0.11 -19.49 0.49 -0.03 4.99 0.20 0.33 0.00 0.24
SEQID-02959 0.04 0.07 0.04 0.04 0.01 0.05 0.06 0.05 -23.42 0.35
-0.02 5.65 0.54 0.65 0.20 0.22 SEQID-02960 0.02 0.05 0.03 0.05 0.04
0.00 0.03 0.05 -27.13 0.26 0.15 11.29 0.22 0.33 0.21 0.19
SEQID-02961 0.02 0.07 0.05 0.05 0.03 0.02 0.04 0.06 -21.97 0.48
-0.03 4.82 0.21 0.31 0.00 0.23 SEQID-02962 0.01 0.07 0.04 0.06 0.04
0.03 0.03 0.06 -18.34 0.73 0.02 8.87 0.23 0.31 0.23 0.00
SEQID-02963 0.03 0.08 0.03 0.09 0.06 0.05 0.06 0.06 -11.63 0.39
0.03 8.62 0.29 0.37 0.00 0.19 SEQID-02964 0.05 0.09 0.05 0.07 0.03
0.02 0.05 0.06 -17.63 0.47 -0.01 6.39 0.22 0.33 0.00 0.24
SEQID-02965 0.02 0.03 0.05 0.04 0.06 0.02 0.06 0.09 -19.23 0.41
-0.03 5.74 0.22 0.34 0.00 0.18 SEQID-02966 0.03 0.05 0.04 0.03 0.04
0.01 0.03 0.07 -27.55 0.31 0.00 6.78 0.21 0.31 0.00 0.20
SEQID-02967 0.01 0.05 0.01 0.04 0.04 0.02 0.06 0.04 -24.79 0.29
-0.04 4.81 0.23 0.32 0.00 0.00 SEQID-02968 0.03 0.08 0.05 0.06 0.04
0.03 0.06 0.04 -17.45 0.36 0.00 6.84 0.21 0.34 0.00 0.00
SEQID-02969 0.02 0.07 0.06 0.06 0.03 0.03 0.05 0.09 -20.02 0.45
-0.04 5.20 0.22 0.33 0.00 0.00 SEQID-02970 0.02 0.06 0.04 0.04 0.05
0.01 0.04 0.06 -21.16 0.42 0.10 10.87 0.19 0.31 0.00 0.19
SEQID-02971 0.03 0.07 0.05 0.05 0.04 0.03 0.03 0.05 -22.23 0.31
-0.01 6.60 0.23 0.31 0.00 0.21 SEQID-02972 0.03 0.07 0.06 0.05 0.02
0.03 0.05 0.07 -18.72 0.44 -0.01 6.56 0.22 0.30 0.20 0.00
SEQID-02973 0.03 0.06 0.04 0.04 0.04 0.02 0.06 0.07 -19.70 0.48
-0.02 5.27 0.19 0.31 0.00 0.21 SEQID-02974 0.02 0.07 0.06 0.05 0.07
0.03 0.05 0.05 -16.20 0.43 0.00 6.87 0.32 0.56 0.00 0.21
SEQID-02975 0.02 0.08 0.05 0.07 0.04 0.03 0.03 0.09 -17.95 0.53
-0.02 5.26 0.27 0.43 0.00 0.23 SEQID-02976 0.04 0.07 0.04 0.05 0.02
0.02 0.04 0.06 -22.45 0.37 -0.01 6.32 0.22 0.31 0.00 0.00
SEQID-02977 0.02 0.09 0.06 0.08 0.04 0.01 0.03 0.03 -16.20 0.41
0.03 8.98 0.19 0.39 0.00 0.21 SEQID-02978 0.02 0.10 0.07 0.06 0.05
0.01 0.03 0.06 -16.32 0.50 0.01 7.98 0.22 0.31 0.00 0.18
SEQID-02979 0.03 0.06 0.05 0.04 0.05 0.01 0.06 0.08 -15.90 0.61
-0.02 5.54 0.21 0.33 0.00 0.22 SEQID-02980 0.02 0.08 0.06 0.06 0.03
0.04 0.04 0.03 -19.54 0.34 -0.02 6.05 0.22 0.36 0.00 0.20
SEQID-02981 0.01 0.08 0.04 0.04 0.03 0.02 0.03 0.06 -23.94 0.40
-0.01 6.61 0.21 0.32 0.00 0.21 SEQID-02982 0.04 0.04 0.05 0.05 0.03
0.03 0.06 0.09 -17.80 0.47 0.00 6.52 0.22 0.32 0.00 0.22
SEQID-02983 0.02 0.06 0.04 0.03 0.06 0.02 0.03 0.07 -21.58 0.39
-0.02 5.91 0.22 0.33 0.00 0.20 SEQID-02984 0.03 0.05 0.04 0.04 0.04
0.00 0.04 0.05 -24.33 0.21 -0.01 5.95 0.22 0.33 0.00 0.22
SEQID-02985 0.03 0.04 0.04 0.04 0.04 0.00 0.02 0.06 -25.10 0.40
-0.04 4.72 0.22 0.33 0.00 0.22 SEQID-02986 0.02 0.06 0.06 0.09 0.03
0.02 0.05 0.04 -19.85 0.35 0.00 7.65 0.22 0.35 0.21 0.23
SEQID-02987 0.03 0.07 0.02 0.05 0.05 0.01 0.04 0.05 -22.33 0.36
-0.02 5.27 0.21 0.33 0.00 0.21 SEQID-02988 0.03 0.07 0.06 0.04 0.03
0.03 0.05 0.06 -22.46 0.33 0.02 8.89
0.22 0.35 0.19 0.22 SEQID-02989 0.04 0.04 0.09 0.04 0.05 0.03 0.07
0.05 -14.73 0.27 -0.01 5.49 0.24 0.45 0.21 0.21 SEQID-02990 0.03
0.07 0.06 0.06 0.04 0.03 0.02 0.06 -21.06 0.34 -0.02 6.17 0.21 0.32
0.20 0.21 SEQID-02991 0.03 0.04 0.04 0.06 0.04 0.02 0.06 0.07
-20.54 0.38 0.00 7.00 0.22 0.33 0.20 0.21 SEQID-02992 0.04 0.05
0.05 0.06 0.04 0.01 0.04 0.06 -20.34 0.41 0.01 7.74 0.21 0.32 0.00
0.21 SEQID-02993 0.02 0.06 0.05 0.06 0.06 0.03 0.03 0.06 -14.67
0.41 0.03 9.69 0.21 0.31 0.00 0.22 SEQID-02994 0.03 0.04 0.04 0.09
0.05 0.02 0.02 0.09 -16.75 0.58 0.00 7.11 0.22 0.33 0.20 0.22
SEQID-02995 0.03 0.05 0.05 0.05 0.03 0.01 0.0 0.07 -19.38 0.60
-0.03 4.83 0.20 0.33 0.19 0.22 SEQID-02996 0.02 0.01 0.12 0.09 0.06
0.01 0.10 0.03 -11.88 0.11 -0.01 6.00 0.28 0.41 0.20 0.24
SEQID-02997 0.03 0.06 0.03 0.07 0.04 0.00 0.03 0.06 -20.23 0.45
-0.01 6.09 0.19 0.32 0.00 0.21 SEQID-02998 0.02 0.09 0.04 0.05 0.05
0.07 0.05 0.04 -12.06 0.63 0.00 7.24 0.20 0.35 0.00 0.20
SEQID-02999 0.03 0.07 0.04 0.06 0.04 0.03 0.07 0.06 -21.11 0.31
-0.04 5.06 0.19 0.32 0.00 0.21 SEQID-03000 0.04 0.03 0.07 0.10 0.04
0.00 0.01 0.06 -15.56 0.26 -0.02 5.67 0.22 0.37 0.19 0.22
SEQID-03001 0.02 0.07 0.03 0.06 0.04 0.03 0.05 0.07 -19.76 0.47
-0.03 5.03 0.19 0.32 0.00 0.20 SEQID-03002 0.03 0.05 0.03 0.06 0.05
0.03 0.06 0.06 -20.82 0.39 -0.04 4.80 0.19 0.33 0.00 0.20
SEQID-03003 0.03 0.03 0.03 0.06 0.05 0.01 0.04 0.07 -19.78 0.57
-0.01 5.64 0.19 0.32 0.19 0.20 SEQID-03004 0.02 0.0 0.04 0.06 0.04
0.02 0.09 0.06 -20.40 0.42 -0.03 4.91 0.19 0.34 0.19 0.20
SEQID-03005 0.02 0.07 0.04 0.04 0.04 0.02 0.07 0.06 -24.11 0.26
-0.02 5.83 0.19 0.34 0.13 0.19 SEQID-03006 0.01 0.08 0.04 0.06 0.03
0.01 0.09 0.04 -21.51 0.41 -0.01 6.63 0.56 0.74 0.19 0.22
SEQID-03007 0.01 0.07 0.03 0.09 0.02 0.00 0.01 0.07 -323.03 0.55
-0.01 6.35 0.50 0.91 0.00 0.22 SEQID-03008 0.02 0.06 0.04 0.06 0.05
0.03 0.05 0.07 -20.05 0.43 -0.01 6.37 0.86 0.98 0.00 0.20
SEQID-03009 0.02 0.11 0.03 0.05 0.06 0.01 0.11 0.03 -20.47 0.29
0.01 8.37 0.21 0.30 0.00 0.00 SEQID-03010 0.02 0.11 0.05 0.06 0.03
0.01 0.02 0.03 -19.04 0.49 -0.02 5.21 0.68 0.78 0.24 0.28
SEQID-03011 0.03 0.05 0.06 0.04 0.06 0.01 0.04 0.09 -21.63 0.39
0.03 9.63 0.22 0.35 0.00 0.22 SEQID-03012 0.05 0.04 0.05 0.06 0.05
0.02 0.06 0.06 -19.72 0.44 -0.03 5.16 0.20 0.33 0.00 0.19
SEQID-03013 0.02 0.06 0.03 0.05 0.05 0.04 0.04 0.07 -25.34 0.45
-0.06 4.56 0.22 0.30 0.23 0.22 SEQID-03014 0.01 0.03 0.04 0.05 0.06
0.01 0.05 0.07 -18.24 0.43 0.00 6.64 0.31 0.32 0.00 0.21
SEQID-03015 0.03 0.04 0.04 0.07 0.04 0.01 0.06 0.06 -18.93 0.43
0.00 6.94 0.21 0.32 0.00 0.21 SEQID-03016 0.01 0.06 0.03 0.06 0.0
0.02 0.03 0.10 -19.58 0.53 -0.02 5.04 0.83 0.93 0.00 0.20
SEQID-03017 0.04 0.06 0.04 0.05 0.04 0.00 0.07 0.07 -21.13 0.44
-0.02 5.82 0.21 0.32 0.19 0.21 SEQID-03018 0.02 0.06 0.04 0.03 0.06
0.03 0.05 0.06 -20.23 0.36 -0.01 6.46 0.20 0.31 0.00 0.22
SEQID-03019 0.02 0.10 0.04 0.0 0.05 0.01 0.01 0.08 -17.15 0.29 0.03
8.90 0.92 0.96 0.25 0.29 SEQID-03020 0.03 0.03 0.05 0.06 0.04 0.02
0.03 0.09 -16.97 0.56 -0.01 6.25 0.25 0.33 0.00 0.22 SEQID-03021
0.03 0.05 0.01 0.03 0.09 0.02 0.05 0.03 -22.71 0.45 0.04 8.97 0.23
0.35 0.20 0.24 SEQID-03022 0.03 0.04 0.03 0.06 0.04 0.01 0.06 0.04
-24.82 0.32 -0.06 4.42 0.23 0.32 0.00 0.00 SEQID-03023 0.01 0.08
0.05 0.01 0.05 0.01 0.06 0.07 -20.92 0.34 0.00 6.86 0.20 0.34 0.00
0.00 SEQID-03024 0.02 0.04 0.02 0.04 0.10 0.00 0.01 0.06 -23.57
0.35 -0.01 5.90 0.23 0.30 0.24 0.00 SEQID-03025 0.03 0.04 0.02 0.04
0.04 0.04 0.06 0.07 -24.54 0.25 -0.02 6.43 0.34 0.45 0.26 0.22
SEQID-03026 0.03 0.03 0.02 0.06 0.04 0.01 0.07 0.05 -25.35 0.27
-0.06 4.51 0.20 0.31 0.00 0.00 SEQID-03027 0.01 0.04 0.05 0.06 0.05
0.04 0.06 0.05 -19.12 0.36 -0.02 5.88 0.21 0.33 0.19 0.21
SEQID-03028 0.02 0.03 0.03 0.06 0.04 0.01 0.04 0.08 -21.36 0.43
0.06 10.49 0.00 0.31 0.00 0.00 SEQID-03029 0.03 0.04 0.03 0.04 0.06
0.02 0.04 0.07 -19.49 0.49 -0.02 5.52 0.21 0.33 0.21 0.23
SEQID-03030 0.02 0.09 0.01 0.04 0.05 0.02 0.02 0.05 -22.57 0.60
0.00 7.12 0.34 0.32 0.33 0.29 SEQID-03031 0.01 0.06 0.07 0.05 0.05
0.01 0.03 0.07 -24.45 0.29 0.12 10.85 0.00 0.34 0.18 0.23
SEQID-03032 0.03 0.04 0.05 0.06 0.05 0.00 0.03 0.05 -35.70 0.25
0.13 10.82 0.25 0.32 0.19 0.21 SEQID-03033 0.02 0.04 0.04 0.03 0.06
0.00 0.08 0.09 -20.37 0.36 -0.03 5.31 0.69 0.73 0.00 0.00
SEQID-03034 0.03 0.04 0.08 0.03 0.05 0.04 0.03 0.05 -17.12 0.45
-0.03 4.86 0.21 0.13 0.19 0.00 SEQID-03035 0.07 0.00 0.04 0.04 0.13
0.00 0.02 0.06 -20.21 0.09 0.03 9.81 0.25 0.34 0.27 0.24
SEQID-03036 0.04 0.03 0.03 0.03 0.04 0.01 0.03 0.12 -21.66 0.60
-0.02 6.08 0.21 0.29 0.00 0.22 SEQID-03037 0.04 0.05 0.03 0.06 0.05
0.02 0.06 0.06 -19.45 0.37 -0.01 5.34 0.22 0.33 0.00 0.20
SEQID-03038 0.03 0.05 0.05 0.04 0.06 0.01 0.04 0.06 -20.55 0.32
0.01 7.69 0.21 0.32 0.00 0.20 SEQID-03039 0.02 0.07 0.01 0.04 0.04
0.00 0.02 0.03 -20.98 0.57 0.03 9.26 0.37 0.26 0.00 0.00
SEQID-03040 0.01 0.08 0.02 0.05 0.06 0.03 0.03 0.07 -16.75 0.76
0.02 3.49 0.91 0.95 0.21 0.24 SEQID-03041 0.01 0.03 0.04 0.07 0.03
0.00 0.03 0.07 -18.61 0.39 0.09 11.01 0.26 0.30 0.25 0.00
SEQID-03042 0.04 0.03 0.01 0.04 0.13 0.00 0.01 0.01 -25.65 0.04
0.02 9.76 0.23 0.32 0.22 0.25 SEQID-03043 0.03 0.07 0.06 0.06 0.04
0.04 0.06 0.09 -17.32 0.45 0.03 9.14 0.21 0.32 0.00 0.23
SEQID-03044 0.01 0.06 0.04 0.05 0.05 0.04 0.10 0.03 -19.15 0.23
0.00 7.43 0.21 0.33 0.00 0.21 SEQID-03045 0.01 0.08 0.05 0.04 0.07
0.03 0.05 0.06 -20.02 0.37 -0.01 6.24 0.21 0.32 0.00 0.21
SEQID-03046 0.03 0.06 0.04 0.04 0.06 0.02 0.04 0.07 -23.48 0.33
0.12 10.99 0.79 0.90 0.00 0.23 SEQID-03047 0.02 0.06 0.06 0.03 0.05
0.01 0.0 0.09 -16.16 0.52 0.00 6.97 0.26 0.35 0.00 0.00 SEQID-03048
0.02 0.06 0.02 0.06 0.07 0.02 0.04 0.09 -15.02 0.50 0.01 8.45 0.35
0.45 0.00 0.20 SEQID-03049 0.02 0.05 0.03 0.05 0.07 0.01 0.03 0.09
-22.62 0.39 -0.01 5.23 0.57 0.81 0.00 0.21 SEQID-03050 0.03 0.06
0.04 0.04 0.06 0.01 0.04 0.08 -21.59 0.42 0.00 6.52 0.19 0.34 0.00
0.21 SEQID-03051 0.00 0.05 0.03 0.07 0.09 0.02 0.06 0.09 -17.58
0.35 0.02 9.31 0.21 0.32 0.00 0.21 SEQID-03052 0.03 0.05 0.05 0.05
0.04 0.04 0.08 0.06 -20.46 0.29 0.00 7.34 0.20 0.31 0.00 0.00
SEQID-03053 0.03 0.04 0.04 0.06 0.05 0.01 0.04 0.07 -18.67 0.44
0.02 9.52 0.22 0.33 0.00 0.22 SEQID-03054 0.02 0.04 0.04 0.06 0.05
0.02 0.05 0.08 -19.24 0.43 -0.01 5.92 0.19 0.34 0.19 0.20
SEQID-03055 0.03 0.05 0.04 0.05 0.06 0.01 0.04 0.08 -19.08 0.41
0.00 6.72 0.19 0.34 0.20 0.20 SEQID-03056 0.01 0.04 0.03 0.04 0.05
0.03 0.05 0.08 -19.53 0.43 0.01 7.61 0.00 0.34 0.00 0.21
SEQID-03057 0.01 0.05 0.06 0.05 0.05 0.04 0.04 0.06 -19.12 0.42
0.00 6.92 0.22 0.34 0.00 0.21 SEQID-03058 0.02 0.05 0.04 0.06 0.06
0.01 0.04 0.06 -22.49 0.34 -0.03 4.80 0.77 0.94 0.00 0.22
SEQID-03059 0.02 0.05 0.03 0.05 0.06 0.00 0.04 0.07 -20.31 0.50
0.00 6.69 0.19 0.32 0.00 0.21 SEQID-03060 0.02 0.06 0.05 0.04 0.03
0.00 0.05 0.09 -22.21 0.35 0.02 9.07 0.00 0.31 0.00 0.20
SEQID-03061 0.01 0.04 0.04 0.06 0.05 0.02 0.04 0.06 -19.15 0.39
-0.01 5.92 0.89 0.81 0.21 0.22 SEQID-03062 0.04 0.07 0.04 0.04 0.08
0.02 0.04 0.07 -16.48 0.42 0.01 7.99 0.52 0.66 0.21 0.21
SEQID-03063 0.01 0.03 0.04 0.03 0.06 0.01 0.05 0.08 -20.11 0.35
0.13 11.50 0.00 0.33 0.23 0.00 SEQID-03064 0.02 0.06 0.04 0.05 0.05
0.02 0.05 0.06 -18.36 0.44 0.00 6.68 0.22 0.33 0.20 0.20
SEQID-03065 0.03 0.05 0.04 0.04 0.06 0.02 0.0 0.08 -21.98 0.43 0.03
9.72 0.21 0.35 0.20 0.21 SEQID-03066 0.02 0.09 0.03 0.06 0.05 0.03
0.04 0.05 -18.92 0.42 0.00 6.98 0.20 0.33 0.20 0.21 SEQID-03067
0.02 0.05 0.04 0.05 0.05 0.02 0.04 0.08 -19.81 0.42 0.01 7.82 0.21
0.34 0.23 0.23 SEQID-03068 0.02 0.06 0.04 0.06 0.07 0.03 0.06 0.06
-19.97 0.37 -0.02 5.11 0.20 0.33 0.00 0.20 SEQID-03069 0.01 0.05
0.04 0.06 0.04 0.03 0.05 0.06 -19.66 0.39 0.00 6.90 0.19 0.35 0.19
0.20 SEQID-03070 0.03 0.07 0.05 0.04 0.05 0.00 0.04 0.09 -18.54
0.56 -0.02 5.09 0.00 0.47 0.00 0.00 SEQID-03071 0.01 0.07 0.03 0.04
0.04 0.01 0.07 0.04 -28.05 0.24 0.01 8.70 0.23 0.33 0.00 0.00
SEQID-03072 0.03 0.04 0.03 0.05 0.05 0.02 0.05 0.11 -18.60 0.46
0.01 7.87 0.67 0.85 0.00 0.21 SEQID-03073 0.03 0.06 0.05 0.05 0.06
0.02 0.05 0.06 -19.47 0.46 -0.03 5.16 0.21 0.31 0.00 0.22
SEQID-03074 0.02 0.05 0.04 0.05 0.05 0.03 0.05 0.05 -18.35 0.42
-0.01 5.93 0.21 0.34 0.22 0.22 SEQID-03075 0.02 0.08 0.02 0.04 0.04
0.05 0.06 0.04 -21.86 0.28 -0.01 6.47 0.20 0.32 0.00 0.21
SEQID-03076 0.02 0.07 0.04 0.06 0.06 0.01 0.06 0.05 -19.88 0.35
0.00 5.88 0.18 0.32 0.20 0.20 SEQID-03077 0.02 0.05 0.05 0.05 0.02
0.01 0.04 0.07 -22.48 0.31 0.15 11.36 0.21 0.33 0.24 0.00
SEQID-03078 0.01 0.05 0.04 0.03 0.04 0.01 0.05 0.05 -23.11 0.29
0.10 10.88 0.19 0.34 0.23 0.18 SEQID-03079 0.01 0.04 0.05 0.05 0.04
0.02 0.02 0.08 -20.31 0.40 0.12 11.80 0.00 0.34 0.00 0.22
SEQID-03080 0.02 0.04 0.06 0.05 0.06 0.03 0.03 0.06 -19.58 0.48
0.01 8.06 0.22 0.31 0.00 0.22 SEQID-03081 0.01 0.07 0.05 0.05 0.04
0.03 0.06 0.06 -21.85 0.36 -0.02 5.16 0.21 0.37 0.00 0.21
SEQID-03082 0.03 0.05 0.03 0.05 0.05 0.01 0.04 0.05 -21.22 0.37
0.01 8.03 0.20 0.34 0.00 0.21 SEQID-03083 0.02 0.07 0.05 0.05 0.05
0.03 0.06 0.06 -16.47 0.45 0.00 7.52 0.27 0.41 0.00 0.21
SEQID-03084 0.03 0.02 0.05 0.04 0.07 0.01 0.04 0.07 -18.74 0.50
-0.01 6.52 0.20 0.32 0.00 0.21 SEQID-03085 0.02 0.06 0.05 0.04 0.06
0.04 0.07 0.05 -20.38 0.31 -0.03 5.48 0.20 0.31 0.00 0.21
SEQID-03086 0.02 0.06 0.05 0.06 0.05 0.03 0.04 0.07 -20.38 0.42
0.00 7.06 0.47 0.79 0.00 0.21 SEQID-03087 0.04 0.06 0.05 0.05 0.04
0.03 0.05 0.06 -19.20 0.47 0.01 8.45 0.21 0.29 0.26 0.00
SEQID-03088 0.01 0.03 0.02 0.03 0.05 0.02 0.02 0.07 -24.99 0.26
0.12 11.41 0.22 0.31 0.22 0.23 SEQID-03089 0.03 0.03 0.01 0.04 0.06
0.01 0.02 0.09 -23.22 0.37 0.05 10.11 0.22 0.30 0.00 0.21
SEQID-03090 0.02 0.05 0.04 0.04 0.03 0.01 0.07 0.06 -23.97 0.27
0.13 10.81 0.23 0.33 0.21 0.24 SEQID-03091 0.04 0.02 0.02 0.06 0.06
0.01 0.06 0.05 -26.20 0.23 -0.08 4.33 0.24 0.33 0.18 0.20
SEQID-03092 0.02 0.05 0.06 0.02 0.05 0.01 0.0 0.07 -21.77 0.43 0.12
11.07 0.24 0.32 0.00 0.21 SEQID-03093 0.01 0.04 0.05 0.07 0.05 0.01
0.04 0.11 -16.57 0.61 0.01 8.40 0.50 0.78 0.22 0.22 SEQID-03094
0.03 0.03 0.03 0.04 0.06 0.02 0.06 0.07 -18.75 0.45 -0.01 6.56 0.22
0.33 0.00 0.22 SEQID-03095 0.02 0.06 0.05 0.03 0.05 0.05 0.07 0.05
-19.90 0.35 -0.04 4.93 0.21 0.31 0.00 0.21 SEQID-03096 0.01 0.05
0.04 0.06 0.06 0.02 0.06 0.06 -16.33 0.42 0.00 6.83 0.20 0.33 0.00
0.21 SEQID-03097 0.02 0.04 0.04 0.04 0.07 0.00 0.05 0.04 -24.94
0.30 0.13 10.64 0.19 0.31 0.00 0.26 SEQID-03098 0.03 0.06 0.04 0.03
0.06 0.01 0.03 0.05 -23.63 0.37 0.09 10.91 0.19 0.33 0.00 0.23
SEQID-03099 0.01 0.03 0.04 0.03 0.02 0.01 0.04 0.05 -26.92 0.31
0.10 11.08 0.23 0.31 0.00 0.22 SEQID-03100 0.03 0.05 0.05 0.04 0.06
0.02 0.05 0.05 -19.28 0.44 -0.01 6.29 0.27 0.39 0.24 0.21
SEQID-03101 0.01 0.04 0.04 0.03 0.04 0.01 0.04 0.06 -27.30 0.32
0.14 11.16 0.00 0.30 0.21 0.00 SEQID-03102 0.01 0.05 0.06 0.05 0.06
0.01 0.05 0.07 -22.87 0.31 0.09 10.73 0.20 0.31 0.24 0.00
SEQID-03103 0.04 0.09 0.02 0.07 0.04 0.02 0.08 0.07 -15.74 0.53
0.06 10.38 0.00 0.35 0.00 0.21 SEQID-03104 0.02 0.04 0.04 0.05 0.07
0.02 0.03 0.09 -21.48 0.38 0.01 8.42 0.22 0.31 0.00 0.00
SEQID-03105 0.02 0.04 0.05 0.04 0.06 0.02 0.05 0.09 -19.87 0.41
0.00 7.00 0.21 0.32 0.22 0.21 SEQID-03106 0.01 0.05 0.05 0.05 0.07
0.01 0.04 0.07 -22.28 0.37 -0.02 5.36 0.54 0.74 0.00 0.20
SEQID-03107 0.02 0.07 0.05 0.05 0.05 0.03 0.05 0.07 -16.48 0.71
0.01 8.20 0.19 0.32 0.00 0.20 SEQID-03108 0.03 0.03 0.03 0.06 0.11
0.04 0.02 0.09 -11.10 0.46 0.02 9.37 0.22 0.30 0.28 0.24
SEQID-03109 0.01 0.02 0.03 0.05 0.03 0.02 0.07 0.06 -28.09 0.25
-0.03 5.14 0.21 0.30 0.25 0.23 SEQID-03110 0.01 0.01 0.04 0.03 0.02
0.03 0.10 0.08 -25.01 0.16 0.21 11.85 0.23 0.33 0.00 0.23
SEQID-03111 0.02 0.05 0.06 0.04 0.04 0.04 0.04 0.07 -20.07 0.33
-0.01 6.71 0.22 0.30 0.00 0.20 SEQID-03112 0.01 0.05 0.04 0.04 0.05
0.02 0.05 0.07 -20.65 0.42 0.00 6.93 0.21 0.35 0.20 0.22
SEQID-03113 0.04 0.07 0.06 0.05 0.04 0.03 0.05 0.05 -17.86 0.33
-0.01 6.64 0.21 0.32 0.21 0.22
SEQID-03114 0.02 0.07 0.04 0.05 0.05 0.02 0.07 0.06 -23.81 0.31
-0.02 5.72 0.19 0.34 0.00 0.21 SEQID-03115 0.02 0.06 0.03 0.06 0.05
0.01 0.05 0.05 -26.40 0.31 -0.05 4.56 0.70 0.90 0.00 0.21
SEQID-03116 0.02 0.04 0.06 0.05 0.05 0.03 0.05 0.07 -19.40 0.39
-0.01 6.30 0.19 0.33 0.00 0.20 SEQID-03117 0.02 0.05 0.05 0.05 0.06
0.02 0.04 0.06 -18.78 0.43 -0.01 6.39 0.19 0.34 0.00 0.21
SEQID-03118 0.01 0.07 0.04 0.05 0.05 0.06 0.05 0.07 -20.64 0.35
-0.02 5.83 0.20 0.33 0.00 0.20 SEQID-03119 0.03 0.11 0.02 0.05 0.08
0.01 0.03 0.09 -18.42 0.35 0.02 9.48 0.74 0.39 0.00 0.23
SEQID-03120 0.02 0.08 0.04 0.01 0.06 0.02 0.05 0.07 -20.86 0.42
0.00 7.03 0.22 0.31 0.19 0.00 SEQID-03121 0.03 0.07 0.05 0.03 0.05
0.02 0.03 0.07 -20.22 0.50 0.09 10.96 0.22 0.35 0.21 0.23
SEQID-03122 0.02 0.04 0.06 0.03 0.06 0.06 0.03 0.06 -18.08 0.50
-0.02 5.17 0.21 0.35 0.00 0.20 SEQID-03123 0.01 0.05 0.06 0.07 0.05
0.00 0.03 0.09 -16.57 0.58 0.01 9.02 0.64 0.76 0.25 0.21
SEQID-03124 0.02 0.05 0.04 0.05 0.05 0.02 0.07 0.06 -20.22 0.36
-0.02 5.13 0.21 0.31 0.00 0.20 SEQID-03125 0.02 0.08 0.04 0.05 0.06
0.01 0.06 0.07 -18.92 0.41 0.00 7.29 0.20 0.31 0.22 0.21
SEQID-03126 0.02 0.04 0.05 0.04 0.06 0.02 0.06 0.05 -18.56 0.40
0.00 7.20 0.21 0.31 0.19 0.22 SEQID-03127 0.02 0.06 0.03 0.04 0.06
0.03 0.04 0.07 -17.56 0.40 -0.01 6.33 0.56 0.71 0.00 0.20
SEQID-03128 0.02 0.06 0.04 0.04 0.09 0.02 0.05 0.08 -16.71 0.43
0.00 7.69 0.54 0.70 0.20 0.23 SEQID-03129 0.03 0.07 0.04 0.05 0.07
0.02 0.05 0.05 -17.23 0.44 -0.02 6.08 0.21 0.33 0.23 0.21
SEQID-03130 0.03 0.09 0.04 0.06 0.05 0.03 0.05 0.03 -13.47 0.77
0.03 9.36 0.20 0.33 0.20 0.21 SEQID-03131 0.02 0.05 0.04 0.06 0.05
0.00 0.05 0.06 -21.15 0.40 -0.01 5.88 0.19 0.33 0.00 0.22
SEQID-03132 0.02 0.07 0.05 0.06 0.06 0.02 0.06 0.05 -20.38 0.37
-0.01 6.55 0.20 0.33 0.20 0.20 SEQID-03133 0.02 0.07 0.04 0.07 0.05
0.03 0.05 0.06 -18.93 0.32 -0.01 6.24 0.18 0.35 0.19 0.20
SEQID-03134 0.02 0.05 0.02 0.04 0.10 0.03 0.09 0.07 -13.89 0.33
-0.01 5.92 0.24 0.31 0.00 0.26 SEQID-03135 0.04 0.07 0.03 0.08 0.09
0.04 0.02 0.08 -11.66 0.50 0.03 9.90 0.00 0.30 0.28 0.25
SEQID-03136 0.02 0.05 0.03 0.07 0.05 0.01 0.03 0.07 -25.76 0.21
0.09 10.74 0.22 0.31 0.20 0.00 SEQID-03137 0.01 0.04 0.02 0.09 0.06
0.06 0.04 0.09 -19.09 0.44 -0.02 5.99 0.22 0.31 0.00 0.20
SEQID-03138 0.01 0.06 0.04 0.05 0.05 0.04 0.06 0.05 -21.71 0.32
-0.02 6.32 0.21 0.33 0.00 0.00 SEQID-03139 0.02 0.07 0.04 0.06 0.05
0.03 0.05 0.06 -16.14 0.42 -0.03 4.74 0.36 0.50 0.00 0.22
SEQID-03140 0.02 0.05 0.07 0.09 0.05 0.03 0.02 0.05 -17.71 0.32
0.00 6.92 0.21 0.34 0.21 0.23 SEQID-03141 0.02 0.05 0.04 0.05 0.06
0.01 0.03 0.03 -20.24 0.46 0.00 7.17 0.21 0.33 0.21 0.22
SEQID-03142 0.01 0.07 0.04 0.07 0.05 0.01 0.06 0.06 -17.74 0.41
-0.01 6.16 0.20 0.33 0.00 0.22 SEQID-03143 0.01 0.06 0.04 0.10 0.08
0.05 0.06 0.06 -12.84 0.45 -0.01 5.65 0.21 0.34 0.00 0.21
SEQID-03144 0.02 0.03 0.05 0.04 0.05 0.03 0.07 0.07 -19.25 0.38
0.00 6.95 0.26 0.40 0.18 0.20 SEQID-03145 0.02 0.05 0.03 0.04 0.05
0.03 0.05 0.07 -21.13 0.34 -0.01 6.35 0.21 0.33 0.00 0.21
SEQID-03146 0.03 0.06 0.04 0.04 0.05 0.02 0.03 0.06 -18.57 0.66
-0.02 5.13 0.19 0.34 0.00 0.30 SEQID-03147 0.01 0.01 0.03 0.04 0.04
0.00 0.07 0.08 -18.97 0.52 -0.01 5.70 0.31 0.36 0.24 0.25
SEQID-03148 0.00 0.08 0.03 0.04 0.05 0.01 0.06 0.06 -24.21 0.19
0.11 10.65 0.26 0.32 0.00 0.00 SEQID-03149 0.02 0.03 0.02 0.06 0.02
0.01 0.04 0.09 -19.28 0.56 0.10 11.02 0.23 0.30 0.24 0.22
SEQID-03150 0.02 0.05 0.01 0.04 0.10 0.05 0.10 0.07 -19.52 0.31
0.00 7.18 0.00 0.30 0.24 0.25 SEQID-03151 0.02 0.04 0.07 0.04 0.03
0.04 0.05 0.07 -20.14 0.43 0.00 7.41 0.24 0.31 0.25 0.00
SEQID-03152 0.03 0.07 0.05 0.05 0.03 0.02 0.05 0.06 -23.90 0.27
0.13 11.56 0.21 0.29 0.00 0.23 SEQID-03153 0.01 0.05 0.03 0.02 0.06
0.01 0.05 0.06 -23.46 0.29 0.11 11.09 0.20 0.31 0.00 0.25
SEQID-03154 0.02 0.03 0.03 0.05 0.05 0.01 0.03 0.0 -22.13 0.44 0.06
10.50 0.20 0.33 0.00 0.23 SEQID-03155 0.02 0.07 0.06 0.04 0.05 0.04
0.08 0.04 -20.56 0.29 0.00 7.23 0.24 0.33 0.22 0.00 SEQID-03156
0.02 0.10 0.07 0.05 0.06 0.04 0.08 0.03 -18.82 0.29 0.00 8.30 0.24
0.31 0.00 0.21 SEQID-03157 0.03 0.07 0.07 0.06 0.10 0.03 0.05 0.06
-15.40 0.39 0.01 7.78 0.43 0.64 0.19 0.00 SEQID-03158 0.05 0.12
0.06 0.07 0.05 0.04 0.06 0.05 -19.34 0.32 -0.01 5.15 0.25 0.33 0.00
0.24 SEQID-03159 0.04 0.05 0.03 0.04 0.06 0.01 0.06 0.05 -20.81
0.42 0.00 6.80 0.21 0.34 0.00 0.00 SEQID-03160 0.03 0.02 0.04 0.05
0.04 0.04 0.05 0.06 -17.94 0.47 -0.02 5.16 0.34 0.50 0.00 0.00
SEQID-03161 0.04 0.06 0.04 0.05 0.04 0.03 0.04 0.09 -20.27 0.40
0.01 7.31 0.21 0.31 0.22 0.20 SEQID-03162 0.01 0.03 0.04 0.03 0.03
0.05 0.09 0.04 -21.74 0.27 -0.01 6.72 0.20 0.33 0.00 0.20
SEQID-03163 0.02 0.05 0.03 0.05 0.05 0.02 0.04 0.07 -21.91 0.44
0.00 6.81 0.21 0.33 0.00 0.00 SEQID-03164 0.03 0.05 0.04 0.03 0.03
0.01 0.06 0.07 -19. 2 0.48 -0.01 6.16 0.25 0.39 0.00 0.20
SEQID-03165 0.01 0.06 0.05 0.06 0.06 0.04 0.05 0.05 -20.50 0.34
0.00 6.93 0.21 0.31 0.00 0.21 SEQID-03166 0.02 0.05 0.06 0.05 0.05
0.01 0.04 0.05 -19.02 0.38 -0.02 5.74 0.22 0.35 0.00 0.22
SEQID-03167 0.02 0.06 0.05 0.07 0.07 0.01 0.04 0.08 -15.61 0.47
-0.01 6.34 0.49 0.84 0.21 0.21 SEQID-03168 0.02 0.05 0.05 0.05 0.06
0.03 0.04 0.07 -18.10 0.42 -0.01 6.13 0.51 0.71 0.20 0.21
SEQID-03169 0.03 0.05 0.05 0.05 0.06 0.00 0.09 0.08 -18.31 0.47
-0.01 5.40 0.22 0.34 0.22 0.23 SEQID-03170 0.02 0.09 0.06 0.05 0.04
0.03 0.05 0.06 -18.69 0.25 0.00 6.94 0.35 0.55 0.00 0.21
SEQID-03171 0.01 0.04 0.05 0.06 0.05 0.04 0.04 0.09 -19.15 0.39
-0.02 6.05 0.20 0.33 0.00 0.21 SEQID-03172 0.02 0.04 0.04 0.05 0.06
0.02 0.05 0.09 -18.65 0.46 -0.01 6.13 0.21 0.35 0.00 0.21
SEQID-03173 0.02 0.05 0.04 0.06 0.05 0.02 0.05 0.07 -19.08 0.43
-0.01 5.87 0.00 0.36 0.00 0.19 SEQID-03174 0.01 0.01 0.04 0.06 0.07
0.01 0.04 0.08 -23.53 0.27 0.07 10.34 0.26 0.30 0.00 0.25
SEQID-03175 0.03 0.05 0.04 0.04 0.03 0.02 0.01 0.09 -24.39 0.38
0.13 11.46 0.22 0.30 0.21 0.24 SEQID-03176 0.02 0.04 0.03 0.04 0.03
0.00 0.09 0.07 -20.30 0.46 0.11 10.74 0.22 0.29 0.24 0.00
SEQID-03177 0.02 0.03 0.06 0.07 0.07 0.02 0.04 0.05 -21.07 0.32
0.12 11.31 0.00 0.30 0.18 0.21 SEQID-03178 0.02 0.02 0.06 0.06 0.05
0.01 0.01 0.09 -21.32 0.43 0.03 9.87 0.26 0.33 0.23 0.24
SEQID-03179 0.01 0.07 0.02 0.04 0.07 0.01 0.06 0.07 -22.64 0.21
0.16 11.37 0.21 0.29 0.19 0.23 SEQID-03180 0.02 0.03 0.03 0.05 0.07
0.00 0.04 0.06 -25.68 0.26 0.14 11.09 0.24 0.30 0.00 0.00
SEQID-03181 0.04 0.05 0.04 0.03 0.06 0.00 0.06 0.0 -21.97 0.25 0.11
10.99 0.22 0.28 0.00 0.19 SEQID-03182 0.01 0.05 0.04 0.05 0.06 0.00
0.02 0.04 -23.82 0.39 0.15 11.77 0.00 0.32 0.00 0.24 SEQID-03183
0.03 0.04 0.04 0.06 0.03 0.01 0.03 0.07 -22.66 0.40 0.09 10.61 0.23
0.32 0.20 0.20 SEQID-03184 0.01 0.08 0.03 0.04 0.07 0.04 0.02 0.05
-13.56 0.91 0.04 9.96 0.21 0.32 0.22 0.19 SEQID-03185 0.01 0.05
0.05 0.06 0.05 0.0 0.05 0.10 -20.75 0.33 -0.01 6.52 0.20 0.31 0.00
0.00 SEQID-03186 0.04 0.04 0.05 0.04 0.04 0.02 0.02 0.09 -17.89
0.52 -0.04 5.16 0.24 0.32 0.00 0.20 SEQID-03187 0.06 0.03 0.03 0.06
0.05 0.02 0.03 0.09 -19.76 0.43 0.00 7.02 0.19 0.29 0.00 0.00
SEQID-03188 0.04 0.05 0.04 0.06 0.05 0.03 0.09 0.05 -17.81 0.34
-0.01 6.51 0.18 0.31 0.00 0.21 SEQID-03189 0.02 0.03 0.06 0.05 0.04
0.05 0.04 0.07 -19.54 0.34 0.00 6.92 0.22 0.33 0.00 0.00
SEQID-03190 0.03 0.06 0.03 0.03 0.05 0.02 0.09 0.05 -21.71 0.44
-0.05 4.46 0.21 0.33 0.18 0.17 SEQID-03191 0.03 0.03 0.04 0.07 0.04
0.00 0.039 0.10 -17.00 0.45 0.00 6.52 0.21 0.34 0.00 0.20
SEQID-03192 0.03 0.03 0.04 0.06 0.04 0.02 0.08 0.07 -19.23 0.37
-0.01 6.52 0.20 0.30 0.00 0.00 SEQID-03193 0.03 0.04 0.04 0.05 0.03
0.01 0.06 0.08 -19.80 0.43 -0.01 6.29 0.21 0.33 0.00 0.21
SEQID-03194 0.02 0.10 0.05 0.08 0.03 0.05 0.05 0.06 -17.54 0.41
0.01 7.55 0.00 0.32 0.00 0.20 SEQID-03195 0.03 0.04 0.04 0.06 0.07
0.01 0.05 0.07 -17.53 0.44 0.01 8.79 0.19 0.33 0.00 0.00
SEQID-03196 0.01 0.05 0.07 0.06 0.05 0.01 0.03 0.08 -16.08 0.54
0.00 6.79 0.23 0.32 0.00 0.20 SEQID-03197 0.03 0.04 0.05 0.04 0.06
0.04 0.05 0.05 -21.77 0.37 -0.01 6.53 0.10 0.31 0.00 0.21
SEQID-03198 0.02 0.05 0.05 0.04 0.04 0.03 0.04 0.05 -19.67 0.43
-0.02 6.25 0.21 0.31 0.00 0.21 SEQID-03199 0.02 0.04 0.06 0.05 0.07
0.04 0.03 0.05 -18.77 0.41 -0.03 4.85 0.21 0.33 0.00 0.22
SEQID-03200 0.03 0.03 0.02 0.08 0.06 0.02 0.04 0.08 -19.56 0.40
-0.01 6.64 0.21 0.36 0.13 0.22 SEQID-03201 0.03 0.06 0.03 0.04 0.04
0.03 0.04 0.05 -19.13 0.47 0.00 7.63 0.20 0.34 0.21 0.24
SEQID-03202 0.03 0.06 0.03 0.04 0.06 0.03 0.04 0.06 -19.73 0.37
0.01 7.59 0.21 0.34 0.00 0.21 SEQID-03203 0.02 0.05 0.06 0.04 0.05
0.02 0.04 0.06 -18.35 0.41 -0.01 6.24 0.21 0.33 0.00 0.23
SEQID-03204 0.04 0.06 0.03 0.03 0.05 0.01 0.04 0.07 -23.29 0.40
-0.02 5.84 0.21 0.32 0.19 0.21 SEQID-03205 0.04 0.05 0.04 0.05 0.06
0.01 0.05 0.07 -20.04 0.39 -0.02 5.26 0.22 0.32 0.00 0.21
SEQID-03206 0.01 0.07 0.05 0.05 0.05 0.03 0.07 0.05 -19.44 0.36
-0.01 6.21 0.21 0.31 0.00 0.20 SEQID-03207 0.01 0.08 0.05 0.05 0.06
0.05 0.05 0.06 -19.96 0.34 -0.02 5.78 0.34 0.59 0.00 0.21
SEQID-03208 0.01 0.08 0.05 0.06 0.05 0.03 0.06 0.06 -20.97 0.33
-0.02 6.23 0.21 0.32 0.00 0.21 SEQID-03209 0.03 0.06 0.06 0.05 0.05
0.04 0.05 0.06 -18.60 0.29 -0.04 5.00 0.38 0.78 0.00 0.21
SEQID-03210 0.04 0.06 0.06 0.05 0.04 0.01 0.05 0.07 -17.85 0.39
0.04 9.85 0.20 0.33 0.00 0.21 SEQID-03211 0.02 0.05 0.04 0.05 0.05
0.03 0.04 0.07 -20.85 0.38 -0.01 5.93 0.23 0.36 0.00 0.21
SEQID-03212 0.02 0.04 0.04 0.05 0.05 0.01 0.05 0.09 -20.43 0.43
0.01 9.10 0.20 0.33 0.19 0.20 SEQID-03213 0.01 0.05 0.04 0.06 0.05
0.02 0.05 0.06 -19.53 0.38 -0.02 5.97 0.19 0.34 0.20 0.20
SEQID-03214 0.01 0.03 0.01 0.03 0.06 0.00 0.06 0.06 -23.82 0.32
0.18 11.91 0.25 0.32 0.00 0.27 SEQID-03215 0.01 0.03 0.03 0.06 0.05
0.02 0.0 0.06 -23.53 0.31 0.17 11.20 0.00 0.27 0.00 0.22
SEQID-03216 0.02 0.04 0.04 0.08 0.03 0.02 0.07 0.07 -20.29 0.26
0.18 12.08 0.26 0.29 0.25 0.19 SEQID-03217 0.02 0.05 0.03 0.04 0.06
0.00 0.02 0.04 -23.81 0.32 0.15 12.05 0.27 0.33 0.00 0.23
SEQID-03218 0.02 0.04 0.05 0.04 0.07 0.00 0.03 0.07 -25.82 0.26
0.08 11.01 0.21 0.30 0.00 0.24 SEQID-03219 0.02 0.05 0.05 0.03 0.04
0.02 0.05 0.07 -22.01 0.33 0.13 11.13 0.00 0.33 0.00 0.23
SEQID-03220 0.09 0.06 0.20 0.01 0.03 0.01 0.00 0.05 -15.94 0.30
0.05 10.92 0.29 0.39 0.26 0.32 SEQID-03221 0.03 0.04 0.04 0.05 0.07
0.00 0.02 0.10 -20.37 0.49 0.06 10.80 0.22 0.30 0.00 0.26
SEQID-03222 0.01 0.05 0.04 0.05 0.05 0.00 0.01 0.10 -24.53 0.39
0.07 10.84 0.21 0.32 0.00 0.22 SEQID-03223 0.03 0.03 0.07 0.06 0.05
0.03 0.04 0.07 -20.93 0.28 -0.03 4.70 0.23 0.30 0.00 0.22
SEQID-03224 0.02 0.03 0.04 0.07 0.05 0.02 0.10 0.06 -21.73 0.39
0.00 6.96 0.21 0.32 0.00 0.19 SEQID-03225 0.03 0.01 0.02 0.03 0.04
0.02 0.02 0.06 -28.52 0.22 0.20 12.12 0.22 0.32 0.21 0.22
SEQID-03226 0.01 0.03 0.03 0.05 0.05 0.02 0.05 0.04 -23.70 0.14
0.13 11.45 0.23 0.30 0.22 0.19 SEQID-03227 0.02 0.04 0.03 0.05 0.06
0.01 0.05 0.10 -21.72 0.46 0.02 9.07 0.22 0.31 0.22 0.21
SEQID-03228 0.00 0.03 0.03 0.05 0.06 0.01 0.08 0.06 -21.24 0.35
-0.02 5.72 0.22 0.32 0.00 0.00 SEQID-03229 0.03 0.04 0.04 0.04 0.06
0.01 0.04 0.11 -18.46 0.55 -0.01 6.36 0.20 0.34 0.22 0.00
SEQID-03230 0.02 0.06 0.03 0.05 0.06 0.01 0.03 0.10 -17.47 0.56
0.01 8.42 0.25 0.33 0.00 0.20 SEQID-03231 0.03 0.05 0.04 0.03 0.03
0.00 0.06 0.05 -19.05 0.35 0.00 6.73 0.00 0.32 0.00 0.00
SEQID-03232 0.01 0.04 0.04 0.05 0.07 0.01 0.03 0.05 -20.32 0.40
0.00 6.81 0.21 0.31 0.00 0.00 SEQID-03233 0.04 0.07 0.03 0.04 0.06
0.01 0.05 0.06 -22.57 0.41 0.00 7.08 0.21 0.32 0.00 0.00
SEQID-03234 0.03 0.05 0.04 0.04 0.06 0.03 0.06 0.06 -20.07 0.38
-0.03 5.55 0.20 0.31 0.00 0.19 SEQID-03235 0.01 0.04 0.03 0.04 0.05
0.01 0.04 0.09 -22.51 0.37 -0.01 6.59 0.19 0.31 0.00 0.00
SEQID-03236 0.02 0.06 0.07 0.08 0.10 0.01 0.07 0.06 -12.65 0.42
-0.04 4.25 0.20 0.35 0.00 0.22 SEQID-03237 0.03 0.04 0.02 0.09 0.06
0.04 0.03 0.05 -18.70 0.42 0.00 6.76 0.21 0.35 0.00 0.21
SEQID-03238 0.02 0.06 0.03 0.06 0.06 0.02 0.05 0.06 -17.19 0.55
-0.03 4.58 0.20 0.31 0.25 0.00 SEQID-03239 0.03 0.07 0.02 0.03 0.05
0.02 0.03 0.04 -21.62 0.41 -0.06
4.29 0.21 0.35 0.00 0.00 SEQID-03240 0.06 0.05 0.06 0.05 0.04 0.01
0.04 0.09 -18.85 0.46 -0.01 6.38 0.00 0.33 0.00 0.21 SEQID-03241
0.03 0.06 0.06 0.06 0.07 0.03 0.05 0.04 -20.80 0.30 0.00 6.80 0.20
0.31 0.00 0.18 SEQID-03242 0.02 0.04 0.05 0.07 0.05 0.02 0.05 0.08
-19.28 0.45 0.00 7.65 0.22 0.32 0.00 0.22 SEQID-03243 0.01 0.04
0.06 0.04 0.06 0.05 0.03 0.05 -18.94 0.41 0.00 7.11 0.22 0.32 0.00
0.22 SEQID-03244 0.02 0.08 0.05 0.06 0.06 0.07 0.05 0.05 -15.37
0.40 -0.01 6.24 0.21 0.33 0.00 0.20 SEQID-03245 0.02 0.04 0.05 0.04
0.06 0.04 0.04 0.04 -18.05 0.44 -0.02 6.25 0.23 0.35 0.20 0.22
SEQID-03246 0.00 0.04 0.04 0.07 0.04 0.02 0.06 0.11 -17.67 0.48
0.00 7.36 0.23 0.34 0.00 0.21 SEQID-03247 0.03 0.05 0.05 0.05 0.05
0.01 0.06 0.04 -19.69 0.31 0.00 7.20 0.20 0.38 0.00 0.22
SEQID-03248 0.02 0.05 0.05 0.04 0.03 0.03 0.04 0.07 -20.12 0.41
-0.01 6.60 0.20 0.56 0.00 0.23 SEQID-03249 0.05 0.06 0.04 0.06 0.04
0.03 0.04 0.07 -13.17 0.92 0.01 8.54 0.22 0.34 0.00 0.22
SEQID-03250 0.03 0.04 0.06 0.05 0.07 0.03 0.04 0.06 -18.89 0.38
-0.01 6.37 0.21 0.31 0.00 0.21 SEQID-03251 0.02 0.06 0.05 0.06 0.04
0.01 0.04 0.07 -21.06 0.40 -0.01 6.27 0.21 0.34 0.18 0.22
SEQID-03252 0.03 0.03 0.02 0.05 0.04 0.03 0.05 0.06 -24.02 0.32
0.01 8.68 0.23 0.33 0.19 0.22 SEQID-03253 0.03 0.06 0.05 0.06 0.03
0.02 0.04 0.06 -20.06 0.38 -0.01 6.73 0.21 0.33 0.00 0.21
SEQID-03254 0.04 0.05 0.04 0.06 0.05 0.02 0.03 0.06 -18.37 0.41
-0.01 6.41 0.21 0.32 0.00 0.22 SEQID-03255 0.03 0.08 0.04 0.04 0.06
0.04 0.06 0.07 -14.89 0.76 0.01 7.81 0.21 0.32 0.00 0.21
SEQID-03256 0.03 0.05 0.04 0.04 0.06 0.02 0.05 0.05 -20.06 0.33
-0.01 6.69 0.20 0.34 0.00 0.21 SEQID-03257 0.03 0.05 0.06 0.05 0.04
0.01 0.05 0.05 -22.75 0.32 0.00 7.14 0.21 0.31 0.19 0.21
SEQID-03258 0.01 0.04 0.05 0.04 0.07 0.04 0.05 0.08 -18.56 0.43
0.00 7.05 0.20 0.33 0.00 0.21 SEQID-03259 0.02 0.05 0.03 0.05 0.06
0.01 0.03 0.07 -22.67 0.39 -0.04 4.80 0.64 0.83 0.00 0.21
SEQID-03260 0.03 0.08 0.04 0.06 0.07 0.04 0.06 0.06 -15.35 0.63
0.00 7.32 0.20 0.32 0.00 0.21 SEQID-03261 0.04 0.05 0.05 0.04 0.04
0.00 0.03 0.06 -22.98 0.36 -0.04 4.68 0.18 0.34 0.00 0.21
SEQID-03262 0.03 0.04 0.03 0.05 0.05 0.02 0.03 0.06 -18.67 0.40
0.00 7.04 0.19 0.33 0.00 0.21 SEQID-03263 0.01 0.05 0.05 0.08 0.05
0.02 0.04 0.07 -18.10 0.66 0.00 6.69 0.18 0.32 0.18 0.20
SEQID-03264 0.02 0.05 0.05 0.05 0.05 0.02 0.05 0.07 -18.67 0.47
0.00 7.29 0.20 0.33 0.19 0.20 SEQID-03265 0.02 0.03 0.05 0.04 0.05
0.02 0.04 0.06 -23.47 0.32 -0.02 6.17 0.19 0.34 0.19 0.19
SEQID-03266 0.03 0.09 0.04 0.05 0.04 0.03 0.07 0.05 -17.08 0.61
0.02 9.11 0.18 0.33 0.19 0.13 SEQID-03267 0.01 0.03 0.02 0.04 0.06
0.05 0.05 0.07 -26.35 0.30 0.01 7.85 0.26 0.28 0.27 0.23
SEQID-03268 0.02 0.02 0.04 0.05 0.01 0.01 0.05 0.10 -23.54 0.31
0.16 11.12 0.27 0.33 0.24 0.29 SEQID-03269 0.01 0.01 0.03 0.07 0.00
0.00 0.03 0.07 -20.95 0.42 0.03 10.68 0.25 0.31 0.26 0.00
SEQID-03270 0.03 0.06 0.04 0.03 0.04 0.04 0.04 0.05 -23.36 0.23
0.04 9.56 0.23 0.33 0.25 0.27 SEQID-03271 0.01 0.07 0.05 0.06 0.06
0.01 0.05 0.13 -11.59 0.55 0.00 7.24 0.27 0.31 0.23 0.27
SEQID-03272 0.02 0.03 0.04 0.12 0.07 0.00 0.04 0.04 -21.64 0.22
0.13 10.94 0.27 0.32 0.00 0.26 SEQID-03273 0.04 0.05 0.09 0.06 0.07
0.03 0.06 0.02 -17.54 0.44 0.00 7.34 0.22 0.28 0.23 0.29
SEQID-03274 0.01 0.06 0.06 0.04 0.04 0.01 0.04 0.05 -19.71 0.44
0.00 6.88 0.00 0.30 0.25 0.21 SEQID-03275 0.01 0.05 0.04 0.06 0.02
0.02 0.01 0.09 -24.57 0.37 0.14 11.24 0.00 0.31 0.00 0.23
SEQID-03276 0.02 0.04 0.03 0.05 0.05 0.01 0.03 0.05 -25.87 0.20
0.22 12.19 0.00 0.29 0.23 0.22 SEQID-03277 0.04 0.05 0.06 0.08 0.05
0.01 0.05 0.05 -17.99 0.52 -0.01 5.28 0.23 0.31 0.25 0.24
SEQID-03278 0.02 0.04 0.06 0.03 0.03 0.03 0.09 0.05 -23.44 0.24
0.05 10.04 0.23 0.33 0.23 0.24 SEQID-03279 0.04 0.12 0.05 0.06 0.05
0.06 0.07 0.05 -16.94 0.34 -0.03 4.74 0.21 0.29 0.22 0.24
SEQID-03280 0.04 0.08 0.03 0.06 0.04 0.01 0.08 0.08 -23.77 0.34
-0.05 4.37 0.56 0.61 0.00 0.19 SEQID-03281 0.02 0.07 0.06 0.06 0.05
0.02 0.06 0.02 -18.20 0.32 0.03 9.82 0.24 0.31 0.23 0.00
SEQID-03282 0.02 0.07 0.01 0.06 0.06 0.00 0.07 0.05 -20.98 0.65
0.05 9.94 0.21 0.32 0.00 0.24 SEQID-03283 0.02 0.04 0.04 0.08 0.05
0.02 0.01 0.08 -20.15 0.42 0.01 8.11 0.18 0.33 0.20 0.24
SEQID-03284 0.01 0.04 0.01 0.08 0.08 0.02 0.06 0.07 -19.83 0.40
0.00 6.79 0.00 0.31 0.22 0.00 SEQID-03285 0.02 0.04 0.08 0.06 0.05
0.04 0.03 0.06 -16.16 0.48 -0.01 6.51 0.19 0.31 0.00 0.23
SEQID-03286 0.01 0.04 0.04 0.04 0.05 0.05 0.05 0.02 -17.98 0.31
0.01 7.90 0.51 0.66 0.00 0.00 SEQID-03287 0.04 0.04 0.03 0.04 0.06
0.03 0.06 0.09 -16.83 0.43 -0.02 5.59 0.20 0.32 0.23 0.00
SEQID-03288 0.03 0.07 0.06 0.04 0.02 0.04 0.06 0.06 -22.43 0.32
-0.02 6.37 0.00 0.33 0.00 0.00 SEQID-03289 0.01 0.04 0.05 0.05 0.06
0.02 0.02 0.10 -17.38 0.54 -0.01 5.87 0.57 0.68 0.00 0.18
SEQID-03290 0.02 0.09 0.08 0.05 0.05 0.04 0.05 0.04 -15.00 0.25
-0.02 4.98 0.27 0.41 0.22 0.25 SEQID-03291 0.04 0.05 0.02 0.05 0.06
0.01 0.02 0.07 -22.01 0.41 -0.05 4.84 0.23 0.30 0.00 0.21
SEQID-03292 0.05 0.06 0.03 0.05 0.09 0.01 0.02 0.07 -18.19 0.51
-0.01 6.36 0.20 0.31 0.21 0.00 SEQID-03293 0.03 0.08 0.05 0.06 0.03
0.04 0.05 0.08 -17.68 0.69 0.04 10.16 0.22 0.31 0.20 0.22
SEQID-03294 0.02 0.10 0.06 0.04 0.09 0.05 0.09 0.05 -11.08 0.66
0.07 10.46 0.22 0.30 0.00 0.00 SEQID-03295 0.03 0.05 0.03 0.06 0.07
0.02 0.09 0.05 -18.78 0.34 -0.01 6.16 0.19 0.32 0.00 0.00
SEQID-03296 0.02 0.04 0.03 0.06 0.05 0.01 0.03 0.08 -19.15 0.47
0.01 8.42 0.21 0.33 0.00 0.00 SEQID-03297 0.00 0.11 0.03 0.04 0.04
0.07 0.08 0.07 -11.44 1.03 0.02 9.04 0.20 0.30 0.00 0.22
SEQID-03298 0.02 0.05 0.03 0.05 0.04 0.01 0.09 0.07 -19.38 0.42
0.03 10.12 0.21 0.32 0.21 0.00 SEQID-03299 0.03 0.05 0.04 0.06 0.07
0.00 0.08 0.06 -16.95 0.52 -0.01 5.76 0.00 0.32 0.00 0.00
SEQID-03300 0.01 0.07 0.04 0.03 0.09 0.01 0.04 0.09 -17.72 0.54
0.02 9.70 0.23 0.35 0.00 0.21 SEQID-03301 0.03 0.04 0.04 0.04 0.07
0.02 0.04 0.06 -19.05 0.48 -0.01 5.81 0.00 0.36 0.00 0.20
SEQID-03302 0.02 0.02 0.04 0.05 0.06 0.02 0.06 0.08 -17.63 0.45
0.00 6.86 0.45 0.56 0.00 0.20 SEQID-03303 0.03 0.04 0.05 0.05 0.04
0.01 0.03 0.07 -16.74 0.83 0.00 7.03 0.23 0.33 0.21 0.23
SEQID-03304 0.01 0.05 0.06 0.04 0.04 0.02 0.03 0.08 -17.49 0.49
0.00 7.20 0.24 0.37 0.00 0.22 SEQID-03305 0.02 0.06 0.04 0.05 0.05
0.02 0.04 0.08 -20.38 0.46 -0.01 6.68 0.21 0.33 0.00 0.22
SEQID-03306 0.03 0.04 0.04 0.07 0.05 0.00 0.03 0.10 -17.13 0.50
0.01 7.88 0.21 0.33 0.00 0.17 SEQID-03307 0.02 0.07 0.05 0.05 0.09
0.04 0.05 0.04 -14.77 0.44 -0.01 5.62 0.23 0.35 0.00 0.22
SEQID-03308 0.02 0.05 0.04 0.08 0.05 0.02 0.04 0.06 -18.98 0.43
0.01 7.64 0.21 0.35 0.00 0.22 SEQID-03309 0.02 0.04 0.04 0.03 0.06
0.01 0.03 0.05 -26.26 0.31 0.00 6.97 0.22 0.32 0.00 0.23
SEQID-03310 0.02 0.06 0.05 0.07 0.07 0.02 0.05 0.07 -15.17 0.43
0.01 7.62 0.24 0.31 0.20 0.22 SEQID-03311 0.02 0.07 0.08 0.08 0.05
0.03 0.06 0.05 -16.81 0.49 0.01 7.97 0.21 0.32 0.00 0.20
SEQID-03312 0.04 0.03 0.04 0.05 0.03 0.00 0.03 0.08 -21.81 0.41
0.02 9.64 0.24 0.34 0.00 0.22 SEQID-03313 0.03 0.05 0.02 0.04 0.07
0.01 0.04 0.08 -20.78 0.47 -0.02 5.19 0.21 0.32 0.00 0.20
SEQID-03314 0.02 0.04 0.04 0.05 0.06 0.03 0.07 0.06 -19.61 0.37
0.02 9.42 0.21 0.36 0.20 0.22 SEQID-03315 0.02 0.06 0.04 0.04 0.04
0.01 0.02 0.09 -20.60 0.46 0.01 8.22 0.22 0.32 0.00 0.22
SEQID-03316 0.03 0.07 0.06 0.06 0.04 0.04 0.07 0.05 -18.95 0.34
0.00 7.31 0.21 0.34 0.00 0.23 SEQID-03317 0.02 0.05 0.05 0.06 0.05
0.02 0.05 0.05 -17.55 0.38 0.02 9.43 0.21 0.33 0.00 0.21
SEQID-03318 0.02 0.04 0.06 0.08 0.07 0.01 0.03 0.05 -19.66 0.40
0.00 8.17 0.21 0.35 0.19 0.24 SEQID-03319 0.02 0.07 0.05 0.06 0.05
0.02 0.07 0.06 -19.89 0.37 -0.01 6.07 0.21 0.35 0.00 0.22
SEQID-03320 0.03 0.03 0.05 0.04 0.05 0.03 0.05 0.06 -18.30 0.45
0.00 6.89 0.21 0.33 0.00 0.22 SEQID-03321 0.04 0.06 0.03 0.05 0.04
0.02 0.03 0.06 -22.56 0.37 -0.01 6.34 0.21 0.33 0.20 0.23
SEQID-03322 0.02 0.06 0.04 0.05 0.06 0.03 0.03 0.08 -19.07 0.49
0.00 6.74 0.20 0.34 0.21 0.21 SEQID-03323 0.01 0.05 0.04 0.05 0.05
0.02 0.06 0.08 -17.29 0.57 -0.02 5.65 0.22 0.40 0.00 0.21
SEQID-03324 0.03 0.06 0.05 0.07 0.05 0.01 0.09 0.06 -18.12 0.43
0.00 6.80 0.21 0.32 0.20 0.23 SEQID-03325 0.01 0.03 0.05 0.08 0.08
0.02 0.05 0.06 -18.57 0.39 -0.01 6.46 0.20 0.34 0.00 0.23
SEQID-03326 0.02 0.07 0.04 0.07 0.05 0.02 0.04 0.08 -17.44 0.49
0.01 8.19 0.31 0.48 0.19 0.21 SEQID-03327 0.03 0.06 0.04 0.05 0.04
0.05 0.05 0.04 -22.15 0.32 -0.02 5.53 0.21 0.36 0.00 0.21
SEQID-03328 0.03 0.05 0.05 0.06 0.06 0.02 0.02 0.06 -16.03 0.48
0.01 8.92 0.28 0.43 0.00 0.22 SEQID-03329 0.02 0.06 0.05 0.12 0.06
0.01 0.07 0.05 -13.60 0.41 -0.05 3.95 0.20 0.36 0.20 0.21
SEQID-03330 0.02 0.06 0.06 0.05 0.08 0.05 0.06 0.05 -17.92 0.32
-0.03 5.13 0.22 0.34 0.00 0.21 SEQID-03331 0.02 0.07 0.06 0.05 0.05
0.05 0.04 0.05 -19.69 0.36 -0.04 4.95 0.20 0.35 0.00 0.21
SEQID-03332 0.02 0.08 0.06 0.07 0.06 0.03 0.03 0.05 -16.58 0.47
0.01 7.78 0.20 0.35 0.21 0.21 SEQID-03333 0.03 0.11 0.05 0.04 0.05
0.05 0.05 0.05 -15.34 0.71 0.01 8.35 0.20 0.32 0.00 0.21
SEQID-03334 0.03 0.04 0.03 0.05 0.06 0.00 0.02 0.07 -21.94 0.41
-0.01 5.83 0.45 0.73 0.00 0.22 SEQID-03335 0.02 0.06 0.05 0.07 0.04
0.04 0.05 0.08 -15.52 0.75 0.02 9.45 0.19 0.35 0.00 0.20
SEQID-03336 0.02 0.06 0.05 0.05 0.07 0.02 0.04 0.08 -16.52 0.52
0.00 7.91 0.19 0.42 0.19 0.21 SEQID-03337 0.02 0.05 0.06 0.08 0.06
0.03 0.04 0.07 -16.79 0.41 -0.03 4.92 0.23 0.41 0.00 0.22
SEQID-03338 0.03 0.08 0.04 0.04 0.06 0.03 0.04 0.05 -18.38 0.57
-0.03 5.16 0.18 0.34 0.00 0.20 SEQID-03339 0.02 0.05 0.04 0.05 0.06
0.01 0.05 0.07 -18.47 0.44 0.00 6.70 0.20 0.33 0.00 0.20
SEQID-03340 0.03 0.08 0.04 0.06 0.06 0.03 0.06 0.06 -17.65 0.54
0.01 8.36 0.18 0.35 0.00 0.21 SEQID-03341 0.03 0.05 0.06 0.05 0.05
0.01 0.06 0.06 -19.20 0.38 0.04 9.98 0.19 0.36 0.00 0.21
SEQID-03342 0.02 0.05 0.06 0.04 0.06 0.03 0.05 0.05 -20.08 0.29
0.00 7.25 0.20 0.32 0.20 0.20 SEQID-03343 0.03 0.06 0.05 0.04 0.05
0.04 0.03 0.05 -21.66 0.35 0.00 6.85 0.19 0.35 0.19 0.18
SEQID-03344 0.03 0.05 0.06 0.04 0.05 0.02 0.04 0.06 -23.33 0.36
-0.05 4.64 0.19 0.73 0.19 0.20 SEQID-03345 0.02 0.04 0.04 0.06 0.07
0.02 0.04 0.08 -17.42 0.52 -0.01 6.42 0.18 0.33 0.19 0.20
SEQID-03346 0.04 0.05 0.05 0.05 0.08 0.01 0.04 0.07 -11.85 0.77
0.03 9.95 0.51 0.70 0.00 0.00 SEQID-03347 0.04 0.05 0.05 0.06 0.07
0.01 0.04 0.07 -11.94 0.76 0.04 10.04 0.52 0.70 0.00 0.21
SEQID-03348 0.03 0.09 0.05 0.05 0.06 0.02 0.05 0.08 -15.96 0.61
-0.01 6.14 0.21 0.33 0.00 0.23 SEQID-03349 0.03 0.09 0.07 0.07 0.05
0.01 0.05 0.06 -18.41 0.41 0.00 7.53 0.21 0.34 0.20 0.21
SEQID-03350 0.05 0.05 0.05 0.06 0.05 0.02 0.06 0.06 -19.76 0.45
-0.02 5.86 0.20 0.33 0.00 0.20 SEQID-03351 0.02 0.04 0.04 0.02 0.05
0.07 0.10 0.05 -17.47 0.27 0.02 8.46 0.57 0.59 0.00 0.24
SEQID-03352 0.02 0.05 0.04 0.06 0.06 0.01 0.02 0.10 -20.36 0.52
0.02 8.82 0.85 0.94 0.00 0.25 SEQID-03353 0.04 0.08 0.05 0.07 0.03
0.03 0.00 0.07 -26.77 0.30 -0.02 5.42 0.69 0.81 0.19 0.21
SEQID-03354 0.03 0.05 0.01 0.05 0.04 0.03 0.03 0.04 -17.00 0.34
0.01 7.63 0.35 0.39 0.25 0.29 SEQID-03355 0.02 0.04 0.01 0.04 0.03
0.03 0.03 0.05 -18.73 0.33 0.01 7.63 0.38 0.43 0.25 0.34
SEQID-03356 0.02 0.06 0.04 0.03 0.06 0.03 0.06 0.06 -19.94 0.35
-0.01 6.51 0.20 0.33 0.00 0.22 SEQID-03357 0.03 0.02 0.04 0.05 0.05
0.05 0.00 0.13 -20.80 0.43 0.05 9.60 0.30 0.26 0.00 1.00
SEQID-03358 0.02 0.01 0.02 0.02 0.06 0.02 0.04 0.08 -24.50 0.28
0.19 12.27 0.20 0.29 0.00 0.26 SEQID-03359 0.02 0.06 0.03 0.04 0.05
0.01 0.04 0.07 -20.90 0.43 -0.02 5.34 0.21 0.33 0.00 0.22
SEQID-03360 0.02 0.04 0.05 0.05 0.04 0.00 0.03 0.04 -27.42 0.25
0.13 10.79 0.26 0.33 0.25 0.25 SEQID-03361 0.02 0.04 0.04 0.07 0.10
0.01 0.06 0.08 -9.68 0.87 0.02 9.72 0.66 0.34 0.26 0.25 SEQID-03362
0.03 0.06 0.05 0.03 0.02 0.01 0.03 0.06 -21.73 0.28 0.14 11.17 0.21
0.29 0.19 0.23 SEQID-03363 0.02 0.05 0.04 0.06 0.06 0.02 0.05 0.06
-22.51 0.37 -0.03 5.01 0.19 0.32 0.00 0.20 SEQID-03364 0.03 0.05
0.04 0.04 0.05 0.01 0.03 0.06 -22.74 0.37 0.11 10.93 0.19 0.32 0.00
0.20
SEQID-03365 0.04 0.04 0.03 0.05 0.10 0.01 0.05 0.08 -10.26 0.95
0.04 10.29 0.74 0.36 0.00 0.25 SEQID-03366 0.03 0.09 0.05 0.06 0.06
0.05 0.04 0.06 -12.29 0.53 0.04 9.54 0.31 0.42 0.00 0.22
SEQID-03367 0.03 0.04 0.05 0.09 0.05 0.02 0.05 0.06 -14.63 0.57
0.00 7.65 0.24 0.32 0.00 0.24 SEQID-03368 0.02 0.05 0.05 0.05 0.05
0.00 0.03 0.10 -16.64 0.55 0.00 6.28 0.54 0.73 0.00 0.00
SEQID-03369 0.04 0.05 0.08 0.03 0.05 0.04 0.04 0.04 -17.25 0.45
-0.03 4.77 0.21 0.36 0.00 0.00 SEQID-03370 0.06 0.05 0.04 0.00 0.04
0.00 0.02 0.05 -26.32 0.37 0.04 8.90 0.25 0.25 0.25 0.00
SEQID-03371 0.02 0.03 0.03 0.08 0.01 0.00 0.03 0.07 -20.23 0.45
0.10 10.98 0.26 0.32 0.25 0.24 SEQID-03372 0.02 0.04 0.04 0.07 0.09
0.01 0.05 0.09 -9.77 0.87 0.03 9.83 0.68 0.85 0.20 0.25 SEQID-03373
0.04 0.03 0.02 0.06 0.03 0.02 0.02 0.08 -17.25 0.59 -0.02 4.93 0.26
0.31 0.24 0.00 SEQID-03374 0.03 0.07 0.03 0.06 0.06 0.02 0.04 0.07
-19.34 0.47 0.04 9.86 0.57 0.84 0.24 0.24 SEQID-03375 0.02 0.03
0.02 0.03 0.08 0.00 0.02 0.04 -23.63 0.33 0.00 7.82 0.22 0.31 0.00
0.00 SEQID-03376 0.04 0.04 0.02 0.08 0.04 0.01 0.02 0.10 -16.89
0.58 0.03 9.87 0.27 0.37 0.19 0.00 SEQID-03377 0.03 0.02 0.04 0.06
0.05 0.03 0.03 0.10 -17.05 0.55 0.00 6.78 0.26 0.33 0.20 0.22
SEQID-03378 0.02 0.05 0.04 0.05 0.06 0.00 0.04 0.07 -19.37 0.46
-0.03 4.82 0.23 0.33 0.00 0.21 SEQID-03379 0.04 0.05 0.03 0.04 0.04
0.00 0.04 0.07 -23.44 0.42 -0.03 5.37 0.21 0.31 0.19 0.00
SEQID-03380 0.03 0.05 0.04 0.05 0.06 0.02 0.02 0.07 -16.45 0.54
-0.01 6.09 0.29 0.38 0.20 0.23 SEQID-03381 0.04 0.06 0.04 0.05 0.04
0.01 0.05 0.07 -21.01 0.38 -0.01 6.34 0.19 0.31 0.00 0.20
SEQID-03382 0.02 0.05 0.04 0.03 0.07 0.00 0.02 0.05 -23.97 0.30
0.15 11.86 0.23 0.31 0.26 0.00 SEQID-03383 0.03 0.07 0.04 0.04 0.05
0.01 0.04 0.09 -17.64 0.57 0.02 8.47 0.91 0.98 0.22 0.94
SEQID-03384 0.02 0.07 0.05 0.05 0.05 0.01 0.05 0.09 -17.85 0.54
0.00 7.45 0.94 0.96 0.00 0.94 SEQID-03385 0.02 0.04 0.02 0.03 0.08
0.00 0.02 0.05 -23.64 0.33 0.00 7.90 0.22 0.31 0.23 0.21
SEQID-03386 0.04 0.10 0.04 0.03 0.06 0.00 0.05 0.09 -19.69 0.44
0.05 9.49 0.85 0.83 0.00 0.85 SEQID-03387 0.01 0.07 0.06 0.07 0.05
0.01 0.05 0.07 -14.46 0.61 0.01 7.89 0.78 0.98 0.23 0.92
SEQID-03388 0.03 0.06 0.04 0.05 0.08 0.01 0.06 0.05 -17.52 0.43
-0.03 4.85 0.87 0.98 0.00 0.20 SEQID-03389 0.05 0.04 0.05 0.05 0.06
0.02 0.05 0.06 -19.76 0.44 -0.03 5.29 0.21 0.31 0.00 0.21
SEQID-03390 0.01 0.06 0.06 0.05 0.06 0.03 0.05 0.05 -20.16 0.37
-0.02 5.65 0.19 0.35 0.00 0.20 SEQID-03391 0.03 0.04 0.05 0.08 0.06
0.00 0.02 0.04 -26.28 0.23 0.13 10.87 0.28 0.32 0.25 0.26
SEQID-03392 0.02 0.03 0.01 0.02 0.06 0.00 0.06 0.07 -23.82 0.31
0.18 12.01 0.00 0.28 0.00 0.29 SEQID-03393 0.03 0.04 0.06 0.05 0.04
0.00 0.10 0.05 -16.95 0.53 0.00 7.08 0.25 0.32 0.26 0.98
SEQID-03394 0.04 0.05 0.04 0.06 0.09 0.01 0.07 0.05 -17.36 0.37
-0.03 4.65 0.95 1.00 0.00 0.00 SEQID-03395 0.01 0.02 0.02 0.04 0.05
0.02 0.06 0.06 -26.96 0.40 -0.03 5.23 0.24 0.34 0.00 0.00
SEQID-03396 0.03 0.06 0.03 0.05 0.05 0.03 0.04 0.09 -20.88 0.47
0.00 6.80 0.86 0.93 0.23 0.21 SEQID-03397 0.02 0.05 0.04 0.03 0.06
0.03 0.03 0.08 -24.40 0.39 -0.02 5.55 0.21 0.34 0.00 0.20
SEQID-03398 0.03 0.04 0.04 0.04 0.06 0.01 0.03 0.06 -22.95 0.36
-0.02 4.88 0.72 0.91 0.19 0.20 SEQID-03399 0.04 0.02 0.03 0.07 0.03
0.00 0.05 0.05 -29.35 0.21 0.02 9.01 0.98 0.69 0.00 0.34
SEQID-03400 0.03 0.06 0.01 0.03 0.06 0.04 0.04 0.06 -20.96 0.45
0.00 6.96 0.22 0.31 0.00 0.25 SEQID-03401 0.03 0.05 0.05 0.04 0.06
0.01 0.04 0.08 -22.02 0.41 0.03 9.66 0.21 0.35 0.21 0.22
SEQID-03402 0.09 0.13 0.03 0.06 0.06 0.00 0.00 0.02 -18.17 0.56
0.07 8.61 0.29 0.29 0.30 0.28 SEQID-03403 0.04 0.04 0.04 0.05 0.09
0.00 0.01 0.05 -23.24 0.34 0.08 11.26 0.23 0.30 0.22 0.23
SEQID-03404 0.01 0.05 0.03 0.05 0.04 0.04 0.09 0.04 -18.45 0.29
-0.02 5.06 0.24 0.33 0.00 0.24 SEQID-03405 0.01 0.03 0.04 0.08 0.01
0.00 0.03 0.07 -18.26 0.35 0.09 11.09 0.25 0.31 0.27 0.22
SEQID-03406 0.02 0.03 0.05 0.06 0.06 0.00 0.10 0.04 -15.35 0.46
0.00 6.76 0.24 0.32 0.25 0.81 SEQID-03407 0.03 0.06 0.04 0.04 0.04
0.02 0.06 0.08 -19.27 0.53 -0.02 5.37 0.21 0.33 0.20 0.22
SEQID-03408 0.02 0.08 0.06 0.04 0.05 0.02 0.06 0.06 -21.28 0.28
0.00 7.03 0.39 0.56 0.00 0.21 SEQID-03409 0.02 0.05 0.04 0.06 0.06
0.03 0.05 0.07 -19.93 0.41 0.00 6.59 0.88 1.00 0.00 0.20
SEQID-03410 0.06 0.03 0.05 0.04 0.03 0.02 0.02 0.09 -19.41 0.55
0.12 11.19 0.25 0.30 0.25 0.24 SEQID-03411 0.02 0.07 0.05 0.05 0.05
0.01 0.05 0.09 -18.21 0.52 -0.04 4.58 0.82 0.91 0.21 0.82
SEQID-03412 0.03 0.03 0.05 0.03 0.05 0.02 0.05 0.06 -19.98 0.38
0.00 7.14 0.22 0.32 0.23 0.22 SEQID-03413 0.02 0.04 0.03 0.05 0.04
0.02 0.05 0.08 -20.30 0.40 -0.01 5.55 0.89 0.96 0.21 0.22
SEQID-03414 0.03 0.05 0.04 0.04 0.05 0.01 0.07 0.06 -18.95 0.51
-0.01 5.86 0.20 0.33 0.00 0.20 SEQID-03415 0.04 0.09 0.03 0.08 0.05
0.01 0.05 0.07 -13.29 0.89 -0.02 4.72 0.20 0.34 0.21 0.20
SEQID-03416 0.04 0.04 0.04 0.03 0.07 0.02 0.02 0.02 -21.96 0.35
0.12 11.31 0.24 0.31 0.00 0.28 SEQID-03417 0.04 0.08 0.04 0.03 0.08
0.02 0.00 0.08 -26.04 0.20 0.12 10.98 0.28 0.29 0.00 0.18
SEQID-03418 0.06 0.02 0.03 0.02 0.02 0.00 0.08 0.09 -23.37 0.42
0.04 9.88 0.30 0.27 0.26 0.19 SEQID-03419 0.02 0.02 0.00 0.08 0.05
0.00 0.03 0.08 -24.14 0.27 -0.03 4.99 0.31 0.24 0.33 0.31
SEQID-03420 0.02 0.04 0.03 0.07 0.02 0.01 0.04 0.06 -23.80 0.29
0.00 7.24 0.23 0.33 0.22 0.21 SEQID-03421 0.03 0.04 0.01 0.05 0.05
0.01 0.05 0.04 -22.10 0.45 0.22 12.43 0.23 0.29 0.00 0.25
SEQID-03422 0.04 0.04 0.04 0.03 0.08 0.02 0.02 0.03 -20.50 0.33
0.15 11.74 0.26 0.29 0.00 0.25 SEQID-03423 0.01 0.04 0.05 0.05 0.04
0.04 0.03 0.05 -20.61 0.42 -0.02 5.73 0.21 0.33 0.20 0.22
SEQID-03424 0.01 0.01 0.04 0.08 0.04 0.03 0.04 0.01 -23.48 0.39
0.17 12.30 0.27 0.30 0.30 0.25 SEQID-03425 0.02 0.05 0.01 0.04 0.03
0.02 0.04 0.04 -37.76 0.22 -0.30 3.51 0.21 0.30 0.13 0.23
SEQID-03426 0.01 0.04 0.03 0.05 0.07 0.03 0.04 0.06 -23.41 0.28
-0.02 6.39 0.00 0.33 0.00 0.23 SEQID-03427 0.02 0.02 0.04 0.06 0.05
0.03 0.04 0.04 -21.76 0.33 -0.01 5.87 0.21 0.33 0.22 0.25
SEQID-03428 0.02 0.02 0.05 0.08 0.05 0.00 0.03 0.03 -20.38 0.35
0.01 8.68 0.22 0.33 0.00 0.23 SEQID-03429 0.06 0.05 0.06 0.06 0.02
0.01 0.02 0.06 -21.84 0.28 0.08 10.52 0.25 0.33 0.00 0.27
SEQID-03430 0.02 0.00 0.03 0.10 0.08 0.00 0.00 0.01 -24.63 0.17
0.00 6.95 0.29 0.25 0.32 0.32 SEQID-03431 0.02 0.04 0.02 0.05 0.04
0.03 0.01 0.02 -34.55 0.18 0.11 10.64 0.22 0.32 0.00 0.22
SEQID-03432 0.04 0.05 0.03 0.05 0.07 0.02 0.02 0.02 -23.50 0.27
0.15 11.53 0.25 0.28 0.00 0.00 SEQID-03433 0.01 0.01 0.07 0.04 0.03
0.00 0.00 0.03 -21.17 0.34 -0.03 5.07 0.27 0.35 0.27 0.26
SEQID-03434 0.01 0.04 0.00 0.06 0.05 0.01 0.06 0.02 -24.25 0.30
0.24 12.58 0.25 0.28 0.00 0.23 SEQID-03435 0.03 0.00 0.02 0.04 0.00
0.00 0.00 0.04 -28.57 0.45 0.33 12.42 0.34 0.16 0.32 0.30
SEQID-03436 0.07 0.05 0.05 0.05 0.05 0.01 0.02 0.07 -20.41 0.43
-0.01 6.26 0.22 0.30 0.26 0.23 SEQID-03437 0.07 0.13 0.03 0.05 0.05
0.02 0.07 0.01 -21.35 0.15 -0.12 3.96 0.22 0.20 0.21 0.27
SEQID-03438 0.02 0.07 0.03 0.06 0.04 0.02 0.05 0.05 -27.53 0.31
-0.26 3.23 0.24 0.28 0.00 0.24 SEQID-03439 0.00 0.03 0.03 0.05 0.06
0.09 0.03 0.07 -20.71 0.39 -0.06 4.55 0.18 0.32 0.00 0.23
SEQID-03440 0.00 0.03 0.03 0.06 0.05 0.09 0.0 3 0.08 -21.25 0.38
-0.05 4.65 0.21 0.32 0.22 0.22 SEQID-03441 0.02 0.00 0.03 0.00 0.11
0.00 0.00 0.13 -20.61 0.26 0.09 11.27 0.30 0.23 0.00 0.29
SEQID-03442 0.04 0.08 0.04 0.02 0.08 0.02 0.00 0.08 -26.48 0.23
0.12 11.03 0.26 0.27 0.00 0.00 SEQID-03443 0.04 0.08 0.04 0.04 0.08
0.02 0.00 0.08 -25.24 0.20 0.13 11.21 0.26 0.27 0.00 0.00
SEQID-03444 0.01 0.02 0.16 0.09 0.04 0.01 0.06 0.05 -15.46 0.16
0.03 8.07 0.22 0.36 0.20 0.24 SEQID-03445 0.02 0.02 0.02 0.09 0.04
0.01 0.04 0.03 -28.10 0.11 -0.05 4.66 0.23 0.38 0.00 0.21
SEQID-03446 0.03 0.06 0.04 0.05 0.05 0.01 0.02 0.06 -22.29 0.42
-0.03 5.11 0.22 0.33 0.00 0.23 SEQID-03447 0.00 0.02 0.10 0.27 0.03
0.00 0.04 0.06 -8.13 0.28 0.02 8.77 0.25 0.52 0.22 0.27 SEQID-03448
0.02 0.01 0.02 0.07 0.05 0.01 0.03 0.05 -23.80 0.25 -0.02 5.21 0.25
0.36 0.20 0.22 SEQID-03449 0.04 0.04 0.01 0.09 0.03 0.01 0.05 0.05
-18.68 0.26 0.01 8.78 0.689 0.89 0.21 0.21 SEQID-03450 0.02 0.08
0.01 0.10 0.04 0.00 0.03 0.05 -16.79 0.24 -0.01 5.68 0.62 0.91 0.21
0.22 SEQID-03451 0.02 0.03 0.11 0.03 0.05 0.05 0.03 0.05 -19.27
0.23 -0.01 6.42 0.22 0.32 0.23 0.25 SEQID-03452 0.05 0.02 0.03 0.0
0.04 0.01 0.04 0.05 -27.05 0.26 0.15 10.77 0.23 0.30 0.23 0.25
SEQID-03453 0.02 0.03 0.02 0.05 0.04 0.01 0.05 0.02 -24.50 0.11
0.09 7.86 0.24 0.31 0.26 0.26 SEQID-03454 0.02 0.02 0.04 0.06 0.05
0.03 0.04 0.04 -22.24 0.31 -0.02 5.35 0.23 0.34 0.22 0.25
SEQID-03455 0.02 0.03 0.02 0.00 0.03 0.01 0.04 0.05 -39.36 0.23
-0.30 3.72 0.27 0.35 0.22 0.29 SEQID-03456 0.01 0.00 0.11 0.02 0.01
0.00 0.00 0.02 -33.42 0.00 0.11 10.67 0.32 0.31 0.30 0.31
SEQID-03457 0.01 0.00 0.11 0.03 0.02 0.00 0.00 0.02 -33.41 0.00
0.13 10.79 0.30 0.31 0.30 0.30 SEQID-03458 0.01 0.06 0.06 0.09 0.04
0.01 0.04 0.02 -20.91 0.13 0.13 11.83 0.26 0.31 0.00 0.27
SEQID-03459 0.02 0.00 0.03 0.04 0.02 0.00 0.05 0.03 -36.62 0.10
0.50 12.47 0.29 0.18 0.34 0.31 SEQID-03460 0.04 0.04 0.03 0.05 0.07
0.01 0.04 0.05 -20.18 0.49 0.00 6.51 0.22 0.32 0.23 0.24
SEQID-03461 0.01 0.05 0.05 0.03 0.06 0.01 0.04 0.09 -24.13 0.37
0.10 10.78 0.23 0.33 0.00 0.26 SEQID-03462 0.05 0.04 0.02 0.03 0.04
0.04 0.06 0.03 -30.24 0.13 -0.01 6.54 0.27 0.31 0.00 0.00
SEQID-03463 0.04 0.00 0.02 0.05 0.04 0.01 0.05 0.02 -24.71 0.14
0.10 11.18 0.00 0.31 0.25 0.00 SEQID-03464 0.07 0.05 0.02 0.04 0.02
0.03 0.03 0.02 -20.78 0.43 0.15 12.24 0.25 0.28 0.21 0.22
SEQID-03465 0.03 0.00 0.01 0.07 0.05 0.02 0.08 0.02 -25.38 0.12
0.08 10.34 0.24 0.27 0.00 0.00 SEQID-03466 0.02 0.00 0.03 0.07 0.02
0.02 0.05 0.05 -24.70 0.38 0.15 11.02 0.22 0.26 0.00 0.00
SEQID-03467 0.04 0.06 0.04 0.13 0.04 0.03 0.05 0.04 -24.12 0.22
0.27 12.15 0.28 0.21 0.28 0.26 SEQID-03468 0.04 0.04 0.00 0.03 0.02
0.03 0.00 0.03 -21.62 0.41 0.20 12.60 0.30 0.20 0.28 0.30
SEQID-03469 0.10 0.03 0.03 0.03 0.03 0.04 0.00 0.03 -26.22 0.36
0.01 9.11 0.26 0.26 0.00 0.00 SEQID-03470 0.02 0.02 0.04 0.06 0.05
0.03 0.04 0.04 -22.20 0.32 -0.02 5.35 0.23 0.33 0.22 0.25
SEQID-03471 0.01 0.00 0.09 0.04 0.04 0.00 0.00 0.00 -38.40 0.01
0.07 10.28 0.32 0.32 0.27 0.29 SEQID-03472 0.02 0.03 0.08 0.05 0.01
0.02 0.01 0.04 -20.01 0.23 0.02 8.25 0.31 0.30 0.34 0.30
SEQID-03473 0.02 0.00 0.00 0.09 0.03 0.00 0.10 0.01 -45.36 0.00
0.63 13.20 0.30 0.21 0.34 0.27 SEQID-03474 0.02 0.07 0.06 0.11 0.03
0.01 0.03 0.03 -20.32 0.14 0.14 12.12 0.25 0.31 0.00 0.28
SEQID-03475 0.04 0.04 0.02 0.05 0.07 0.01 0.04 0.04 -20.61 0.48
0.00 7.29 0.23 0.31 0.24 0.24 SEQID-03476 0.02 0.04 0.01 0.05 0.05
0.01 0.07 0.04 -21.37 0.41 0.21 12.16 0.21 0.29 0.18 0.00
SEQID-03477 0.03 0.06 0.04 0.03 0.00 0.04 0.00 0.02 -20.63 0.09
0.16 9.35 0.35 0.20 0.34 0.32 SEQID-03478 0.00 0.06 0.04 0.03 0.00
0.04 0.00 0.06 -20.63 0.16 0.12 8.80 0.36 0.21 0.33 0.32
SEQID-03479 0.03 0.00 0.06 0.02 0.05 0.06 0.04 0.05 -23.08 0.39
0.01 8.46 0.30 0.35 0.23 0.00 SEQID-03480 0.03 0.02 0.03 0.04 0.02
0.05 0.04 0.03 -25.60 0.37 0.12 10.07 0.25 0.30 0.25 0.28
SEQID-03481 0.01 0.09 0.03 0.05 0.06 0.05 0.05 0.04 -23.17 0.35
-0.04 5.01 0.20 0.32 0.21 0.00 SEQID-03482 0.04 0.03 0.06 0.05 0.05
0.02 0.03 0.06 -24.86 0.31 0.01 8.90 0.25 0.33 0.00 0.00
SEQID-03483 0.02 0.07 0.02 0.03 0.03 0.03 0.01 0.03 -24.64 0.35
0.04 9.80 0.25 0.32 0.00 0.19 SEQID-03484 0.04 0.06 0.04 0.04 0.07
0.02 0.02 0.03 -22.32 0.36 0.18 11.65 0.24 0.28 0.00 0.27
SEQID-03485 0.04 0.05 0.06 0.07 0.07 0.00 0.02 0.04 -20.22 0.48
0.00 6.06 0.19 0.35 0.00 0.00 SEQID-03486 0.05 0.01 0.00 0.05 0.09
0.04 0.06 0.07 -21.49 0.30 0.21 11.05 0.19 0.28 0.28 0.24
SEQID-03487 0.11 0.032 0.04 0.05 0.09 0.01 0.01 0.04 -22.55 0.26
0.10 12.41 0.23 0.37 0.22 0.00 SEQID-03488 0.05 0.03 0.01 0.04 0.09
0.01 0.01 0.06 -22.64 0.42 -0.06 4.32 0.22 0.29 0.22 0.22
SEQID-03489 0.01 0.02 0.04 0.02 0.09 0.05 0.01 0.02 -27.29 0.11
0.14 10.34 0.22 0.30 0.26 0.25 SEQID-03490 0.03 0.06 0.02 0.05 0.05
0.00 0.07 0.05 -25.31 0.43 -0.02
5.41 0.22 0.34 0.00 0.00 SEQID-03491 0.01 0.03 0.02 0.07 0.05 0.01
0.03 0.03 -24.17 0.20 -0.03 5.20 0.23 0.32 0.00 0.25 SEQID-03492
0.07 0.03 0.03 0.02 0.11 0.01 0.05 0.03 -20.36 0.49 0.09 10.76 0.23
0.30 0.18 0.26 SEQID-03493 0.02 0.07 0.02 0.10 0.06 0.06 0.03 0.05
-23.62 0.33 0.31 12.73 0.35 0.34 0.29 0.24 SEQID-03494 0.04 0.04
0.02 0.05 0.08 0.01 0.05 0.04 -20.69 0.48 0.00 7.29 0.21 0.31 0.22
0.24 SEQID-03495 0.02 0.00 0.06 0.08 0.06 0.00 0.00 0.01 -23.02
0.18 -0.05 4.51 0.28 0.24 0.33 0.30 SEQID-03496 0.03 0.04 0.01 0.07
0.03 0.02 0.01 0.03 -34.51 0.02 0.15 10.95 0.27 0.31 0.00 0.28
SEQID-03497 0.01 0.06 0.02 0.06 0.05 0.02 0.02 0.03 -23.27 0.32
0.04 10.07 0.21 0.33 0.00 0.00 SEQID-03498 0.02 0.00 0.05 0.05 0.08
0.01 0.06 0.05 -28.10 0.22 -0.10 4.15 0.27 0.32 0.27 0.00
SEQID-03499 0.03 0.10 0.05 0.08 0.03 0.00 0.04 0.03 -20.87 0.44
0.14 11.02 0.25 0.31 0.25 0.23 SEQID-03500 0.01 0.05 0.01 0.04 0.07
0.01 0.08 0.04 -20.42 0.41 -0.08 4.18 0.00 0.33 0.00 0.00
SEQID-03501 0.02 0.05 0.04 0.05 0.03 0.01 0.09 0.04 -34.30 0.20
0.02 9.53 0.25 0.32 0.21 0.26 SEQID-03502 0.02 0.04 0.05 0.05 0.02
0.01 0.04 0.04 -37.06 0.18 -0.03 4.96 0.24 0.31 0.21 0.26
SEQID-03503 0.01 0.01 0.01 0.08 0.03 0.02 0.06 0.04 -21.65 0.32
0.13 11.37 0.28 0.30 0.00 0.26 SEQID-03504 0.04 0.00 0.03 0.09 0.05
0.00 0.03 0.09 -21.49 0.33 -0.07 4.18 0.28 0.22 0.33 0.28
SEQID-03505 0.02 0.05 0.03 0.06 0.09 0.02 0.06 0.03 -23.32 0.27
-0.02 6.29 0.22 0.32 0.00 0.00 SEQID-03506 0.04 0.01 0.01 0.05 0.07
0.01 0.05 0.05 -25.65 0.19 0.04 9.69 0.27 0.30 0.00 0.26
SEQID-03507 0.03 0.06 0.04 0.06 0.04 0.01 0.05 0.03 -20.67 0.37
0.00 6.69 0.18 0.33 0.00 0.20 SEQID-03508 0.03 0.02 0.02 0.01 0.02
0.01 0.05 0.06 -31.80 0.29 -0.04 4.84 0.21 0.30 0.20 0.00
SEQID-03509 0.02 0.02 0.04 0.06 0.05 0.03 0.04 0.04 -21.76 0.32
-0.01 5.87 0.21 0.33 0.22 0.25 SEQID-03510 0.01 0.06 0.03 0.06 0.08
0.01 0.04 0.04 -20.40 0.31 -0.03 4.96 0.20 0.31 0.00 0.20
SEQID-03511 0.02 0.04 0.02 0.06 0.04 0.03 0.01 0.02 -34.54 0.18
0.11 10.66 0.23 0.32 0.00 0.22 SEQID-03512 0.06 0.03 0.03 0.03 0.07
0.00 0.03 0.08 -21.60 0.44 0.14 11.38 0.22 0.30 0.00 0.21
SEQID-03513 0.01 0.07 0.03 0.03 0.04 0.02 0.04 0.06 -22.41 0.48
-0.01 6.17 0.24 0.34 0.24 0.00 SEQID-03514 0.02 0.00 0.06 0.08 0.06
0.00 0.00 0.01 -23.02 0.22 -0.05 4.51 0.29 0.25 0.33 0.31
SEQID-03515 0.05 0.04 0.05 0.04 0.09 0.02 0.09 0.06 -22.65 0.33
0.11 10.98 0.23 0.28 0.00 0.00 SEQID-03516 0.03 0.04 0.01 0.07 0.03
0.01 0.06 0.06 -22.44 0.28 0.06 10.10 0.00 0.33 0.00 0.00
SEQID-03517 0.02 0.07 0.02 0.11 0.05 0.06 0.03 0.03 -23.64 0.23
0.31 12.59 0.31 0.20 0.26 0.29 SEQID-03518 0.02 0.06 0.032 0.03
0.03 0.02 0.02 0.03 -25.15 0.34 0.03 9.43 0.25 0.31 0.23 0.21
SEQID-03519 0.03 0.03 0.03 0.02 0.04 0.00 0.02 0.09 -22.86 0.50
-0.02 5.88 0.19 0.31 0.00 0.22 SEQID-03520 0.01 0.00 0.11 0.023
0.01 0.00 0.00 0.02 -33.31 0.00 0.13 10.79 0.31 0.32 0.29 0.31
SEQID-03521 0.01 0.09 0.05 0.01 0.02 0.02 0.03 0.14 -24.48 0.31
-0.02 5.75 0.27 0.30 0.00 0.26 SEQID-03522 0.01 0.06 0.07 0.03 0.04
0.01 0.04 0.02 -20.66 0.12 0.13 11.83 0.25 0.33 0.00 0.28
SEQID-03523 0.03 0.09 0.06 0.05 0.04 0.04 0.03 0.02 -20.10 0.31
0.06 8.20 0.33 0.19 0.33 0.31 SEQID-03524 0.07 0.03 0.02 0.01 0.04
0.02 0.08 0.03 -28.01 0.20 0.13 10.72 0.25 0.27 0.00 0.25
SEQID-03525 0.01 0.06 0.06 0.09 0.04 0.01 0.03 0.03 -21.42 0.14
0.13 11.89 0.28 0.33 0.00 0.27 SEQID-03526 0.03 0.06 0.02 0.03 0.04
0.02 0.02 0.05 -23.48 0.35 0.01 7.23 0.25 0.31 0.22 0.22
SEQID-03527 0.05 0.05 0.05 0.01 0.01 0.01 0.06 0.04 -29.27 0.21
0.02 8.32 0.22 0.30 0.24 0.24 SEQID-03528 0.02 0.03 0.03 0.03 0.05
0.01 0.02 0.07 -21.60 0.44 -0.02 6.04 0.20 0.32 0.24 0.00
SEQID-03529 0.03 0.02 0.03 0.05 0.03 0.01 0.06 0.09 -23.91 0.47
0.05 10.14 0.24 0.31 0.00 0.00 SEQID-03530 0.01 0.03 0.01 0.10 0.03
0.03 0.02 0.03 -34.65 0.13 0.16 10.91 0.23 0.33 0.24 0.25
SEQID-03531 0.02 0.02 0.01 0.06 0.06 0.05 0.00 0.07 -23.63 0.20
0.24 12.74 0.30 0.23 0.00 0.30 SEQID-03532 0.03 0.02 0.02 0.03 0.06
0.00 0.02 0.08 -23.72 0.40 -0.02 6.25 0.30 0.29 0.00 0.29
SEQID-03533 0.03 0.02 0.02 0.01 0.03 0.01 0.06 0.04 -26.72 0.24
0.11 10.79 0.23 0.29 0.24 0.25 SEQID-03534 0.02 0.07 0.03 0.06 0.04
0.02 0.05 0.05 -27.54 0.31 -0.26 3.23 0.25 0.30 0.00 0.24
SEQID-03535 0.03 0.05 0.01 0.04 0.04 0.01 0.07 0.06 -21.01 0.48
0.04 9.70 0.00 0.30 0.20 0.00 SEQID-03536 0.01 0.04 0.02 0.04 0.05
0.00 0.03 0.08 -20.34 0.46 0.00 6.82 0.22 0.32 0.00 0.00
SEQID-03537 0.02 0.06 0.01 0.07 0.04 0.02 0.06 0.07 -27.33 0.33
-0.24 3.35 0.27 0.31 0.24 0.26 SEQID-03538 0.05 0.04 0.04 0.02 0.06
0.00 0.06 0.10 -23.10 0.36 0.02 8.98 0.27 0.24 0.00 0.27
SEQID-03539 0.00 0.089 0.04 0.04 0.04 0.01 0.04 0.09 -20.60 0.47
-0.01 6.61 0.21 0.31 0.00 0.22 SEQID-03540 0.02 0.07 0.01 0.06 0.04
0.02 0.04 0.06 -30.13 0.36 -0.29 3.26 0.29 0.32 0.23 0.24
SEQID-03541 0.03 0.06 0.04 0.09 0.03 0.03 0.02 0.02 -20.94 0.29
0.04 10.11 0.22 0.33 0.00 0.22 SEQID-03542 0.03 0.01 0.05 0.04 0.02
0.01 0.02 0.10 -22.09 0.50 -0.02 5.44 0.22 0.31 0.20 0.22
SEQID-03543 0.04 0.05 0.01 0.04 0.03 0.02 0.03 0.04 -37.89 0.20
-0.30 3.53 0.23 0.31 0.00 0.22 SEQID-03544 0.02 0.09 0.03 0.03 0.06
0.01 0.04 0.09 -26.74 0.38 0.17 11.00 0.24 0.30 0.23 0.29
SEQID-03545 0.04 0.06 0.04 0.11 0.03 0.03 0.05 0.03 -24.11 0.18
0.27 12.15 0.31 0.23 0.00 0.27 SEQID-03546 0.05 0.03 0.03 0.05 0.04
0.01 0.06 0.03 -24.14 0.36 0.01 8.21 0.18 0.29 0.25 0.25
SEQID-03547 0.01 0.05 0.01 0.09 0.04 0.01 0.05 0.02 -20.44 0.34
-0.07 4.32 0.24 0.33 0.25 0.21 SEQID-03548 0.02 0.05 0.03 0.03 0.01
0.02 0.03 0.06 -24.19 0.35 0.09 8.87 0.20 0.30 0.28 0.29
SEQID-03549 0.01 0.06 0.05 0.04 0.05 0.01 0.05 0.04 -21.47 0.39
-0.01 5.98 0.23 0.34 0.00 0.25 SEQID-03550 0.04 0.03 0.03 0.04 0.04
0.08 0.00 0.05 -22.98 0.25 -0.03 5.60 0.24 0.26 0.23 0.22
SEQID-03551 0.01 0.04 0.03 0.02 0.00 0.00 0.07 0.02 -30.43 0.46
0.38 12.96 0.25 0.28 0.24 0.21 SEQID-03552 0.05 0.05 0.04 0.03 0.06
0.03 0.06 0.00 -21.47 0.39 -0.01 6.51 0.22 0.12 0.26 0.31
SEQID-03553 0.03 0.03 0.02 0.03 0.05 0.01 0.04 0.04 -23.53 0.48
0.13 11.75 0.22 0.30 0.00 0.24 SEQID-03554 0.03 0.03 0.00 0.06 0.04
0.01 0.07 0.04 -22.98 0.39 0.23 12.48 0.21 0.29 0.00 0.23
SEQID-03555 0.03 0.09 0.01 0.03 0.01 0.11 0.01 0.04 -33.41 0.19
-0.02 5.58 0.21 0.34 0.19 0.00 SEQID-03556 0.05 0.06 0.02 0.02 0.03
0.01 0.05 0.04 -21.03 0.45 0.02 7.83 0.19 0.29 0.25 0.26
SEQID-03557 0.08 0.06 0.05 0.04 0.03 0.01 0.03 0.07 -20.34 0.44
-0.01 6.51 0.21 0.33 0.00 0.23 SEQID-03558 0.02 0.13 0.01 0.06 0.05
0.01 0.04 0.04 -20.27 0.31 0.01 8.43 0.21 0.31 0.26 0.25
SEQID-03559 0.01 0.05 0.02 0.07 0.05 0.01 0.04 0.04 -21.00 0.47
-0.02 5.09 0.19 0.35 0.00 0.20 SEQID-03560 0.02 0.04 0.00 0.05 0.05
0.01 0.07 0.01 -21.98 0.35 0.21 12.36 0.25 0.27 0.25 0.23
SEQID-03561 0.08 0.03 0.07 0.06 0.03 0.02 0.05 0.04 -23.21 0.17
0.05 8.98 0.24 0.25 0.26 0.27 SEQID-03562 0.03 0.05 0.04 0.04 0.04
0.00 0.09 0.07 -20.11 0.48 -0.01 5.42 0.24 0.32 0.00 0.24
SEQID-03563 0.02 0.04 0.03 0.09 0.10 0.05 0.00 0.10 -21.01 0.16
0.23 12.72 0.28 0.21 0.00 0.31 SEQID-03564 0.04 0.05 0.01 0.04 0.03
0.02 0.03 0.04 -37.86 0.21 -0.30 3.53 0.22 0.31 0.00 0.22
SEQID-03565 0.01 0.07 0.03 0.05 0.04 0.02 0.06 0.02 -23.04 0.33
0.01 7.44 0.24 0.30 0.23 0.21 SEQID-03566 0.04 0.05 0.02 0.02 0.03
0.01 0.07 0.04 -21.55 0.44 0.04 8.27 0.25 0.30 0.24 0.25
SEQID-03567 0.01 0.04 0.06 0.04 0.06 0.02 0.03 0.04 -22.19 0.29
-0.09 4.12 0.21 0.31 0.26 0.24 SEQID-03568 0.02 0.03 0.00 0.06 0.04
0.01 0.06 0.03 -24.22 0.38 0.24 12.55 0.23 0.29 0.00 0.22
SEQID-03569 0.03 0.05 0.05 0.01 0.06 0.03 0.07 0.05 -21.51 0.27
0.02 7.62 0.26 0.28 0.26 0.27 SEQID-03570 0.04 0.04 0.04 0.05 0.08
0.02 0.02 0.03 -21.28 0.35 0.11 11.14 0.24 0.28 0.00 0.27
SEQID-03571 0.02 0.00 0.07 0.09 0.06 0.00 0.00 0.01 -23.06 0.21
-0.05 4.50 0.30 0.25 0.33 0.33 SEQID-03572 0.02 0.02 0.06 0.04 0.03
0.01 0.02 0.06 -24.00 0.34 0.00 6.80 0.22 0.30 0.00 0.21
SEQID-03573 0.06 0.00 0.02 0.03 0.04 0.04 0.01 0.05 -33.26 0.16
0.18 11.10 0.30 0.32 0.25 0.23 SEQID-03574 0.02 0.09 0.03 0.06 0.04
0.02 0.07 0.03 -22.16 0.27 0.02 7.57 0.21 0.33 0.23 0.24
SEQID-03575 0.09 0.04 0.01 0.02 0.02 0.03 0.04 0.03 -23.30 0.22
0.06 10.14 0.22 0.29 0.28 0.24 SEQID-03576 0.00 0.03 0.03 0.09 0.05
0.08 0.03 0.07 -20.50 0.40 -0.06 4.47 0.21 0.32 0.00 0.22
SEQID-03577 0.04 0.04 0.04 0.04 0.07 0.03 0.02 0.03 -21.01 0.39
0.13 11.51 0.28 0.31 0.00 0.28 SEQID-03578 0.03 0.00 0.02 0.04 0.00
0.00 0.00 0.04 -30.44 0.26 0.35 12.51 0.34 0.16 0.29 0.30
SEQID-03579 0.07 0.01 0.06 0.05 0.04 0.02 0.06 0.01 -22.91 0.12
-0.03 5.10 0.25 0.29 0.23 0.25 SEQID-03580 0.06 0.07 0.04 0.06 0.04
0.00 0.11 0.07 -20.66 0.47 0.16 10.79 0.31 0.15 0.29 0.32
SEQID-03581 0.01 0.00 0.04 0.06 0.06 0.00 0.00 0.04 -31.33 0.10
0.28 11.81 0.24 0.29 0.00 0.25 SEQID-03582 0.02 0.05 0.02 0.13 0.08
0.00 0.00 0.03 -21.40 0.48 0.15 12.39 0.26 0.17 0.00 0.28
SEQID-03583 0.04 0.05 0.05 0.04 0.00 0.15 0.00 0.00 -21.55 0.34
0.10 11.60 0.28 0.17 0.31 0.31 SEQID-03584 0.12 0.00 0.00 0.10 0.08
0.04 0.09 0.02 -21.49 0.40 -0.06 4.43 0.30 0.17 0.29 0.00
SEQID-03585 0.01 0.01 0.08 0.03 0.03 0.06 0.04 0.03 -24.54 0.11
0.00 6.92 0.28 0.30 0.25 0.30 SEQID-03586 0.01 0.03 0.02 0.06 0.03
0.01 0.05 0.02 -24.37 0.12 0.02 7.74 0.24 0.30 0.27 0.26
SEQID-03587 0.01 0.00 0.03 0.03 0.06 0.02 0.01 0.05 -26.49 0.18
0.08 10.72 0.23 0.32 0.27 0.00 SEQID-03588 0.03 0.02 0.00 0.01 0.06
0.04 0.08 0.07 -24.87 0.30 0.03 8.70 0.24 0.22 0.00 0.00
SEQID-03589 0.08 0.02 0.04 0.03 0.02 0.02 0.08 0.07 -21.33 0.38
-0.07 4.34 0.25 0.28 0.00 0.00 SEQID-03590 0.05 0.04 0.04 0.08 0.08
0.02 0.02 0.03 -22.89 0.36 0.09 10.89 0.24 0.28 0.00 0.26
SEQID-03591 0.05 0.02 0.04 0.02 0.03 0.02 0.03 0.05 -21.51 0.26
0.08 10.64 0.26 0.33 0.20 0.28 SEQID-03592 0.01 0.02 0.02 0.05 0.05
0.03 0.09 0.06 -25.97 0.21 0.14 10.63 0.22 0.32 0.00 0.19
SEQID-03593 0.06 0.00 0.02 0.04 0.00 0.00 0.00 0.02 -30.48 0.37
0.35 12.51 0.29 0.14 0.29 0.29 SEQID-03594 0.09 0.02 0.03 0.05 0.03
0.01 0.01 0.06 -28.02 0.34 -0.03 4.85 0.23 0.32 0.00 0.00
SEQID-03595 0.04 0.02 0.07 0.05 0.03 0.01 0.02 0.02 -24.47 0.12
0.26 12.35 0.23 0.34 0.23 0.26 SEQID-03596 0.09 0.03 0.04 0.05 0.03
0.04 0.00 0.04 -22.88 0.26 0.08 10.76 0.27 0.27 0.27 0.24
SEQID-03597 0.02 0.03 0.03 0.03 0.04 0.00 0.03 0.07 -25.68 0.39
-0.04 4.87 0.26 0.30 0.24 0.25 SEQID-03598 0.01 0.04 0.05 0.05 0.04
0.04 0.03 0.05 -20.75 0.41 -0.03 5.31 0.21 0.33 0.20 0.21
SEQID-03599 0.02 0.04 0.04 0.07 0.06 0.00 0.02 0.04 -20.97 0.39
0.02 9.10 0.21 0.33 0.00 0.21 SEQID-03600 0.03 0.06 0.04 0.03 0.06
0.01 0.05 0.05 -22.46 0.32 -0.03 5.03 0.20 0.30 0.24 0.00
SEQID-03601 0.02 0.02 0.04 0.05 0.09 0.05 0.02 0.10 -24.18 0.14
0.25 12.31 0.27 0.21 0.30 0.30 SEQID-03602 0.01 0.04 0.04 0.04 0.08
0.03 0.03 0.06 -23.47 0.28 -0.03 5.59 0.22 0.31 0.22 0.20
SEQID-03603 0.02 0.04 0.02 0.05 0.04 0.00 0.03 0.08 -22.08 0.46
0.00 6.71 0.20 0.31 0.00 0.00 SEQID-03604 0.02 0.05 0.01 0.05 0.04
0.02 0.07 0.07 -27.64 0.33 -0.24 3.42 0.00 0.29 0.29 0.00
SEQID-03605 0.05 0.04 0.04 0.02 0.06 0.00 0.06 0.10 -23.12 0.36
0.02 8.98 0.25 0.23 0.00 0.30 SEQID-03606 0.02 0.02 0.01 0.06 0.04
0.00 0.00 0.17 -25.73 0.39 0.15 10.95 0.29 0.28 0.22 0.28
SEQID-03607 0.03 0.04 0.02 0.05 0.02 0.02 0.05 0.04 -36.23 0.21
-0.26 3.59 0.22 0.31 0.23 0.22 SEQID-03608 0.01 0.04 0.03 0.05 0.07
0.03 0.04 0.06 -23.92 0.27 -0.02 6.15 0.00 0.32 0.00 0.24
SEQID-03609 0.05 0.00 0.03 0.03 0.02 0.04 0.01 0.04 -32.73 0.18
0.19 11.18 0.25 0.32 0.23 0.00 SEQID-03610 0.02 0.05 0.03 0.06 0.04
0.01 0.11 0.03 -22.40 0.17 0.00 7.41 0.21 0.34 0.21 0.23
SEQID-03611 0.01 0.00 0.10 0.04 0.08 0.00 0.00 0.02 -33.57 0.01
0.09 10.58 0.29 0.33 0.26 0.32 SEQID-03612 0.01 0.02 0.05 0.01 0.02
0.01 0.08 0.07 -22.57 0.29 0.032 8.10 0.28 0.30 0.00 0.00
SEQID-03613 0.09 0.03 0.04 0.07 0.02 0.04 0.00 0.06 -23.00 0.27
0.09 10.90 0.28 0.28 0.23 0.24 SEQID-03614 0.04 0.04 0.01 0.09 0.03
0.01 0.05 0.05 -18.44 0.28 0.01 8.63 0.68 0.38 0.21 0.21
SEQID-03615 0.01 0.01 0.04 0.04 0.03 0.01 0.04 0.06 -28.73 0.25
0.15 10.85 0.23 0.34 0.24 0.00
SEQID-03616 0.02 0.02 0.01 0.04 0.02 0.00 0.06 0.12 -23.86 0.38
-0.01 6.51 0.00 0.00 0.26 0.27 SEQID-03617 0.02 0.04 0.10 0.02 0.02
0.01 0.05 0.03 -21.83 0.41 0.15 12.23 0.28 0.31 0.28 0.28
SEQID-03618 0.03 0.02 0.05 0.03 0.05 0.01 0.02 0.08 -20.99 0.50
0.00 6.97 0.21 0.34 0.00 0.24 SEQID-03619 0.01 0.04 0.02 0.04 0.04
0.00 0.03 0.08 -20.098 0.47 0.00 7.10 0.22 0.35 0.23 0.00
SEQID-03620 0.02 0.05 0.01 0.04 0.01 0.01 0.07 0.06 -21.54 0.48
0.04 9.69 0.00 0.31 0.00 0.00 SEQID-03621 0.03 0.05 0.02 0.04 0.01
0.02 0.03 0.04 -35.16 0.19 -0.27 3.58 0.25 0.31 0.00 0.22
SEQID-03622 0.04 0.04 0.03 0.10 0.03 0.02 0.05 0.06 -20.52 0.33
0.02 8.89 0.00 0.33 0.24 0.24 SEQID-03623 0.01 0.03 0.01 0.09 0.03
0.02 0.05 0.04 -22.33 0.41 0.14 11.77 0.32 0.32 0.00 0.24
SEQID-03624 0.04 0.08 0.02 0.03 0.04 0.02 0.04 0.04 -25.73 0.39
-0.25 3.16 0.24 0.29 0.00 0.25 SEQID-03625 0.02 0.12 0.02 0.01 0.04
0.03 0.03 0.04 -22.01 0.50 -0.04 1.68 0.25 0.32 0.24 0.25
SEQID-03626 0.02 0.04 0.01 0.04 0.02 0.00 0.13 0.04 -24.81 0.22
-0.07 4.54 0.22 0.30 0.00 0.24 SEQID-03627 0.032 0.02 0.01 0.06
0.07 0.05 0.02 0.10 -23.81 0.15 0.24 12.43 0.31 0.24 0.00 0.26
SEQID-03628 0.02 0.03 0.01 0.11 0.09 0.02 0.06 0.06 -20.14 0.29
0.08 10.41 0.24 0.33 0.00 0.00 SEQID-03629 0.02 0.02 0.03 0.04 0.03
0.00 0.00 0.09 -21.66 0.47 0.11 11.35 0.31 0.23 0.26 0.00
SEQID-03630 0.02 0.04 0.02 0.05 0.03 0.02 0.05 0.04 -35.69 0.23
-0.29 3.45 0.20 0.30 0.24 0.21 SEQID-03631 0.05 0.07 0.03 0.05 0.05
0.02 0.05 0.06 -19.72 0.34 -0.06 4.46 0.40 0.54 0.00 0.22
SEQID-03632 0.02 0.02 0.02 0.04 0.05 0.01 0.01 0.02 -20.44 0.47
0.02 7.98 0.22 0.33 0.23 0.28 SEQID-03633 0.01 0.02 0.06 0.09 0.05
0.01 0.02 0.06 -27.34 0.22 -0.06 4.54 0.22 0.33 0.24 0.25
SEQID-03634 0.04 0.01 0.05 0.05 0.06 0.01 0.04 0.06 -17.51 0.47
-0.01 6.05 0.20 0.33 0.00 0.20 SEQID-03635 0.02 0.00 0.03 0.08 0.05
0.13 0.00 0.04 -23.52 0.09 0.12 9.75 0.27 0.18 0.33 0.33
SEQID-03636 0.03 0.07 0.00 0.10 0.04 0.04 0.04 0.09 -20.21 0.35
0.15 11.00 0.33 0.18 0.30 0.31 SEQID-03637 0.03 0.04 0.05 0.09 0.05
0.01 0.03 0.04 -21.12 0.13 0.02 7.73 0.20 0.33 0.00 0.00
SEQID-03638 0.03 0.04 0.05 0.09 0.05 0.01 0.03 0.04 -21.08 0.13
0.02 7.72 0.21 0.33 0.00 0.20 SEQID-03639 0.08 0.04 0.04 0.04 0.04
0.06 0.07 0.06 -20.76 0.41 0.02 9.59 0.23 0.31 0.21 0.00
SEQID-03640 0.02 0.04 0.05 0.09 0.05 0.01 0.02 0.04 -29.86 0.19
-0.08 4.39 0.22 0.34 0.00 0.23 SEQID-03641 0.01 0.02 0.20 0.04 0.03
0.01 0.02 0.03 -14.62 0.15 0.00 7.76 0.59 0.30 0.20 0.39
SEQID-03642 0.02 0.03 0.08 0.12 0.06 0.01 0.02 0.04 -20.93 0.21
0.00 7.12 0.18 0.38 0.19 0.19 SEQID-03643 0.02 0.00 0.02 0.02 0.04
0.00 0.00 0.15 -27.81 0.37 0.11 11.10 0.00 0.32 0.00 0.20
SEQID-03644 0.06 0.00 0.04 0.04 0.00 0.00 0.00 0.14 -23.87 0.48
0.25 12.14 0.29 0.13 0.32 0.33 SEQID-03645 0.01 0.01 0.03 0.00
0.089 0.00 0.05 0.03 -27.88 0.26 0.12 11.11 0.23 0.30 0.26 0.23
SEQID-03646 0.01 0.00 0.00 0.04 0.03 0.00 0.02 0.09 -21.23 0.40
0.16 11.45 0.29 0.30 0.00 0.30 SEQID-03647 0.09 0.00 0.01 0.09 0.04
0.00 0.00 0.04 -24.81 0.15 0.23 12.43 0.30 0.24 0.00 0.26
SEQID-03648 0.04 0.02 0.04 0.02 0.01 0.00 0.00 0.00 -36.23 0.05
0.17 10.80 0.31 0.25 0.29 0.31 SEQID-03649 0.00 0.04 0.02 0.09 0.11
0.03 0.04 0.06 -17.45 0.28 0.00 6.65 0.27 0.41 0.23 0.21
SEQID-03650 0.02 0.03 0.05 0.05 0.07 0.06 0.07 0.06 -18.43 0.31
-0.03 4.61 0.22 0.33 0.21 0.21 SEQID-03651 0.01 0.01 0.05 0.00 0.01
0.05 0.14 0.05 -28.98 0.24 -0.15 3.67 0.44 0.51 0.23 0.21
SEQID-03652 0.04 0.02 0.00 0.06 0.04 0.00 0.05 0.07 -24.65 0.29
-0.04 5.01 0.27 0.22 0.32 0.31 SEQID-03653 0.03 0.01 0.00 0.06 0.11
0.00 0.02 0.03 -25.79 0.15 0.00 6.98 0.23 0.34 0.27 0.25
SEQID-03654 0.04 0.02 0.00 0.06 0.04 0.00 0.05 0.07 -24.44 0.29
-0.05 4.69 0.29 0.23 0.32 0.29 SEQID-03655 0.02 0.04 0.02 0.02 0.04
0.03 0.05 0.04 -21.52 0.40 0.09 10.57 0.21 0.32 0.00 0.23
SEQID-03656 0.02 0.12 0.02 0.08 0.07 0.03 0.05 0.02 -20.58 0.35
0.26 11.66 0.27 0.18 0.30 0.22 SEQID-03657 0.01 0.08 0.03 0.07 0.03
0.00 0.05 0.03 -22.79 0.22 0.15 11.36 0.27 0.30 0.27 0.00
SEQID-03658 0.03 0.03 0.13 0.08 0.05 0.02 0.02 0.03 -24.82 0.20
-0.01 5.98 0.23 0.33 0.22 0.25 SEQID-03659 0.01 0.098 0.01 0.04
0.04 0.00 0.14 0.03 -25.61 0.25 0.11 10.02 0.22 0.28 0.20 0.24
SEQID-03660 0.07 0.10 0.03 0.06 0.05 0.00 0.02 0.01 -26.25 0.07
0.31 12.76 0.26 0.21 0.00 0.28 SEQID-03661 0.09 0.00 0.04 0.04 0.00
0.00 0.00 0.11 -26.24 0.39 0.29 11.49 0.32 0.15 0.33 0.32
SEQID-03662 0.03 0.08 0.04 0.06 0.07 0.02 0.05 0.08 -24.61 0.25
0.10 10.56 0.26 0.32 0.30 0.00 SEQID-03663 0.01 0.05 0.06 0.02 0.06
0.00 0.01 0.04 -20.55 0.45 -0.04 4.54 0.30 0.32 0.26 0.26
SEQID-03664 0.05 0.03 0.04 0.07 0.03 0.00 0.02 0.01 -35.30 0.23
-0.28 3.63 0.28 0.31 0.25 0.24 SEQID-03665 0.01 0.05 0.00 0.05 0.05
0.00 0.05 0.04 -27.65 0.27 0.15 10.99 0.27 0.30 0.00 0.24
SEQID-03666 0.01 0.07 0.03 0.04 0.02 0.01 0.04 0.04 -23.16 0.37
0.01 8.05 0.44 0.59 0.00 0.21 SEQID-03667 0.01 0.08 0.00 0.09 0.02
0.00 0.04 0.03 -26.95 0.21 0.17 11.40 0.28 0.28 0.00 0.26
SEQID-03668 0.01 0.04 0.02 0.05 0.04 0.00 0.00 0.09 -25.82 0.49
-0.08 4.18 0.28 0.33 0.26 0.27 SEQID-03669 0.03 0.07 0.02 0.02 0.07
0.00 0.10 0.05 -25.38 0.28 -0.07 4.41 0.27 0.23 0.00 0.18
SEQID-03670 0.04 0.03 0.03 0.05 0.00 0.02 0.06 0.03 -28.28 0.10
0.22 11.46 0.27 0.28 0.00 0.28 SEQID-03671 0.06 0.04 0.03 0.03 0.06
0.00 0.09 0.05 -23.14 0.15 -0.04 4.59 0.26 0.30 0.19 0.00
SEQID-03672 0.02 0.11 0.06 0.01 0.06 0.00 0.02 0.05 -24.34 0.38
0.22 11.00 0.30 0.25 0.29 0.00 SEQID-03673 0.03 0.03 0.00 0.07 0.07
0.00 0.06 0.03 -22.85 0.16 0.20 11.53 0.25 0.23 0.28 0.28
SEQID-03674 0.02 0.00 0.02 0.04 0.06 0.00 0.00 0.14 -25.40 0.34
0.11 11.18 0.00 0.31 0.00 0.20 SEQID-03675 0.06 0.00 0.01 0.06 0.04
0.00 0.00 0.04 -26.36 0.07 0.22 12.05 0.25 0.20 0.00 0.30
SEQID-03676 0.02 0.04 0.03 0.04 0.08 0.00 0.02 0.04 -22.75 0.14
-0.22 3.08 0.33 0.28 0.00 0.00 SEQID-03677 0.07 0.04 0.01 0.04 0.07
0.02 0.05 0.04 -25.14 0.25 -0.08 4.58 0.28 0.30 0.00 0.00
SEQID-03678 0.01 0.00 0.00 0.03 0.03 0.00 0.02 0.07 -20.36 0.41
0.14 11.42 0.28 0.30 0.00 0.26 SEQID-03679 0.02 0.02 0.02 0.06 0.05
0.09 0.08 0.09 -21.80 0.30 0.01 8.83 0.25 0.28 0.20 0.24
SEQID-03680 0.15 0.03 0.03 0.02 0.05 0.00 0.03 0.03 -24.71 0.20
-0.04 4.53 0.22 0.29 0.22 0.23 SEQID-03681 0.08 0.06 0.01 0.03 0.04
0.00 0.05 0.03 -22.61 0.19 -0.05 4.29 0.23 0.31 0.00 0.00
SEQID-03682 0.01 0.00 0.00 0.03 0.03 0.00 0.02 0.07 -20.36 0.41
0.14 11.57 0.28 0.30 0.00 0.24 SEQID-03683 0.02 0.04 0.03 0.04 0.11
0.00 0.02 0.05 -22.90 0.13 -0.22 3.08 0.32 0.27 0.00 0.00
SEQID-03684 0.04 0.03 0.08 0.02 0.08 0.00 0.02 0.08 -20.40 0.40
-0.14 3.73 0.28 0.31 0.00 0.22 SEQID-03685 0.09 0.00 0.01 0.02 0.07
0.00 0.00 0.04 -25.89 0.17 0.25 12.44 0.30 0.24 0.29 0.00
SEQID-03686 0.03 0.02 0.00 0.05 0.03 0.00 0.02 0.04 -22.07 0.36
0.17 11.95 0.26 0.29 0.00 0.23 SEQID-03687 0.07 0.06 0.02 0.05 0.04
0.00 0.00 0.02 -28.97 0.12 0.39 13.58 0.27 0.15 0.30 0.29
SEQID-03688 0.02 0.00 0.02 0.03 0.04 0.00 0.00 0.16 -27.06 0.42
0.12 11.21 0.24 0.31 0.00 0.00 SEQID-03689 0.01 0.03 0.03 0.07 0.08
0.01 0.11 0.07 -17.78 0.25 0.00 6.87 0.22 0.32 0.21 0.21
SEQID-03690 0.02 0.03 0.04 0.09 0.05 0.08 0.10 0.03 -15.75 0.26
0.00 6.53 0.00 0.33 0.00 0.22 SEQID-03691 0.02 0.03 0.00 0.05 0.06
0.01 0.07 0.06 -30.38 0.14 0.03 9.69 0.23 0.35 0.00 0.20
SEQID-03692 0.00 0.01 0.04 0.05 0.07 0.03 0.03 0.03 -19.20 0.26
0.00 8.72 0.00 0.36 0.00 0.20 SEQID-03693 0.05 0.05 0.05 0.07 0.05
0.01 0.05 0.02 -22.32 0.13 0.00 6.55 0.19 0.33 0.19 0.20
SEQID-03694 0.03 0.03 0.05 0.08 0.05 0.02 0.04 0.05 -26.41 0.21
0.05 10.06 0.20 0.33 0.00 0.21 SEQID-03695 0.02 0.04 0.05 0.04 0.06
0.03 0.01 0.05 -22.65 0.19 0.02 9.92 0.21 0.33 0.17 0.00
SEQID-03696 0.05 0.05 0.04 0.04 0.03 0.02 0.05 0.02 -31.03 0.20
0.03 9.50 0.21 0.31 0.18 0.23 SEQID-03697 0.05 0.02 0.00 0.03 0.04
0.00 0.00 0.07 -39.00 0.31 -0.28 3.65 0.26 0.34 0.23 0.28
SEQID-03698 0.13 0.00 0.00 0.03 0.03 0.00 0.00 0.03 -39.85 0.11
0.56 13.35 0.32 0.10 0.32 0.32 SEQID-03699 0.02 0.03 0.02 0.04 0.05
0.00 0.00 0.05 -34.84 0.17 -0.18 4.16 0.30 0.33 0.24 0.26
SEQID-03700 0.00 0.06 0.03 0.07 0.06 0.00 0.06 0.10 -24.50 0.40
-0.19 3.59 0.25 0.28 0.00 0.00 SEQID-03701 0.00 0.03 0.03 0.03 0.05
0.00 0.06 0.09 -23.52 0.27 0.00 7.53 0.35 0.22 0.00 0.00
SEQID-03702 0.00 0.03 0.05 0.05 0.05 0.00 0.06 0.09 -24.58 0.31
-0.02 4.92 0.33 0.20 0.00 0.31 SEQID-03703 0.00 0.03 0.05 0.03 0.05
0.00 0.06 0.09 -24.92 0.27 -0.02 5.78 0.36 0.22 0.00 0.27
SEQID-03704 0.02 0.02 0.00 0.03 0.04 0.00 0.05 0.03 -37.34 0.12
0.51 12.70 0.33 0.21 0.33 0.30 SEQID-03705 0.01 0.06 0.02 0.01 0.08
0.00 0.04 0.06 -26.05 0.18 0.26 11.32 0.22 0.31 0.25 0.21
SEQID-03706 0.01 0.08 0.04 0.07 0.02 0.00 0.02 0.03 -28.24 0.23
-0.08 4.34 0.34 0.34 0.27 0.28 SEQID-03707 0.00 0.03 0.07 0.07 0.06
0.00 0.02 0.03 -21.71 0.38 -0.01 6.49 0.27 0.30 0.26 0.28
SEQID-03708 0.01 0.01 0.05 0.00 0.01 0.05 0.15 0.05 -29.44 0.24
-0.16 3.86 0.43 0.49 0.22 0.22 SEQID-03709 0.04 0.01 0.01 0.03 0.05
0.00 0.02 0.02 -28.31 0.07 -0.01 5.26 0.28 0.31 0.00 0.30
SEQID-03710 0.06 0.02 0.03 0.01 0.05 0.06 0.03 0.00 -25.89 0.07
0.13 13.06 0.31 0.20 0.00 0.00 SEQID-03711 0.02 0.02 0.04 0.03 0.06
0.00 0.05 0.01 -25.32 0.12 0.30 11.95 0.30 0.22 0.25 0.28
SEQID-03712 0.01 0.01 0.04 0.00 0.03 0.05 0.15 0.04 -30.09 0.32
-0.18 3.83 0.35 0.42 0.20 0.22 SEQID-03713 0.01 0.03 0.07 0.09 0.12
0.00 0.09 0.05 -24.01 0.27 -0.03 4.92 0.20 0.31 0.00 0.25
SEQID-03714 0.02 0.06 0.04 0.08 0.06 0.01 0.02 0.02 -21.00 0.23
-0.04 4.70 0.20 0.33 0.20 0.20 SEQID-03715 0.05 0.02 0.02 0.04 0.09
0.00 0.08 0.01 -23.13 0.06 -0.01 6.12 0.25 0.34 0.24 0.27
SEQID-03716 0.00 0.05 0.12 0.00 0.00 0.00 0.12 0.02 -23.49 0.20
-0.12 4.05 0.33 0.20 0.29 0.30 SEQID-03717 0.03 0.01 0.00 0.07 0.11
0.00 0.02 0.03 -25.89 0.15 -0.01 6.15 0.24 0.34 0.27 0.26
SEQID-03718 0.03 0.04 0.00 0.02 0.16 0.00 0.13 0.00 -20.29 0.17
0.12 10.45 0.30 0.12 0.29 0.00 SEQID-03719 0.02 0.08 0.00 0.03 0.05
0.03 0.09 0.07 -20.63 0.48 0.07 9.72 0.30 0.17 0.00 0.27
SEQID-03720 0.02 0.04 0.03 0.04 0.08 0.00 0.02 0.04 -22.75 0.15
-0.22 3.08 0.28 0.23 0.00 0.28 SEQID-03721 0.02 0.05 0.05 0.09 0.07
0.01 0.03 0.03 -20.94 0.13 -0.03 5.06 0.19 0.34 0.17 0.19
SEQID-03722 0.03 0.00 0.04 0.04 0.00 0.00 0.00 0.05 -26.69 0.47
0.30 12.31 0.32 0.15 0.32 0.32 SEQID-03723 0.02 0.03 0.03 0.08 0.04
0.00 0.04 0.05 -24.41 0.18 -0.07 4.67 0.18 0.33 0.18 0.21
SEQID-03724 0.02 0.03 0.01 0.07 0.07 0.00 0.03 0.02 -25.20 0.11
-0.10 4.27 0.20 0.28 0.24 0.20 SEQID-03725 0.00 0.05 0.04 0.05 0.03
0.00 0.089 0.07 -23.75 0.36 -0.12 4.11 0.28 0.30 0.28 0.26
SEQID-03726 0.00 0.08 0.03 0.05 0.04 0.00 0.05 0.08 -22.85 0.43
-0.14 3.96 0.23 0.34 0.26 0.27 SEQID-03727 0.02 0.00 0.00 0.05 0.02
0.00 0.05 0.04 -39.39 0.04 0.54 12.73 0.38 0.24 0.32 0.28
SEQID-03728 0.04 0.01 0.01 0.05 0.04 0.00 0.02 0.02 -28.12 0.06
0.01 7.70 0.27 0.31 0.00 0.29 SEQID-03729 0.03 0.12 0.03 0.07 0.03
0.01 0.04 0.03 -20.53 0.38 0.05 10.07 0.22 0.28 0.00 0.22
SEQID-03730 0.00 0.05 0.04 0.07 0.09 0.03 0.08 0.07 -15.74 0.44
-0.04 4.58 0.22 0.33 0.00 0.00 SEQID-03731 0.01 0.00 0.03 0.04 0.02
0.00 0.04 0.03 -37.31 0.04 0.32 12.55 0.31 0.32 0.30 0.26
SEQID-03732 0.02 0.00 0.09 0.04 0.04 0.00 0.05 0.02 -28.34 0.06
0.25 12.48 0.27 0.31 0.31 0.27 SEQID-03733 0.01 0.10 0.04 0.07 0.06
0.00 0.05 0.10 -20.09 0.34 -0.09 4.15 0.27 0.32 0.25 0.26
SEQID-03734 0.00 0.02 0.02 0.11 0.05 0.00 0.03 0.02 -32.91 0.00
0.36 12.46 0.26 0.18 0.31 0.27 SEQID-03735 0.04 0.01 0.01 0.09 0.05
0.00 0.03 0.02 -28.66 0.08 -0.02 4.97 0.28 0.32 0.26 0.29
SEQID-03736 0.03 0.03 0.08 0.05 0.10 0.00 0.00 0.02 -32.42 0.06
-0.02 4.98 0.35 0.18 0.35 0.27 SEQID-03737 0.02 0.00 0.07 0.15 0.04
0.00 0.02 0.03 -23.09 0.01 0.25 12.40 0.26 0.34 0.28 0.25
SEQID-03738 0.13 0.06 0.03 0.07 0.03 0.00 0.08 0.02 -20.71 0.22
0.02 8.20 0.24 0.28 0.00 0.00 SEQID-03739 0.02 0.04 0.01 0.03 0.04
0.00 0.02 0.05 -24.16 0.40 0.00 6.97 0.27 0.32 0.25 0.24
SEQID-03740 0.02 0.07 0.01 0.09 0.05 0.06 0.05 0.03 -22.98 0.30
0.26 11.93 0.32 0.23 0.33 0.00 SEQID-03741 0.03 0.03 0.03 0.04 0.02
0.00 0.00 0.02 -35.11 0.12 -0.01
6.55 0.27 0.34 0.24 0.25 SEQID-03742 0.01 0.05 0.04 0.10 0.06 0.00
0.02 0.03 -21.70 0.23 -0.03 5.63 0.20 0.33 0.00 0.19 SEQID-03743
0.03 0.03 0.02 0.06 0.02 0.00 0.08 0.03 -23.45 0.22 0.18 11.09 0.23
0.26 0.21 0.22 SEQID-03744 0.02 0.03 0.01 0.01 0.00 0.00 0.093 0.05
-30.92 0.34 0.02 7.34 0.23 0.30 0.22 0.25 SEQID-03745 0.01 0.04
0.02 0.01 0.00 0.00 0.01 0.04 -30.77 0.31 0.12 10.52 0.20 0.27 0.00
0.26 SEQID-03746 0.08 0.03 0.03 0.08 0.05 0.00 0.05 0.02 -20.04
0.16 -0.02 5.80 0.21 0.34 0.00 0.00 SEQID-03747 0.04 0.05 0.02 0.16
0.08 0.00 0.02 0.00 -23.42 0.21 0.01 8.483 0.24 0.31 0.00 0.25
SEQID-03748 0.01 0.08 0.04 0.14 0.05 0.00 0.05 0.02 -22.65 0.13
0.04 9.95 0.23 0.33 0.00 0.22 SEQID-03749 0.01 0.113 0.04 0.04 0.06
0.02 0.07 0.01 -23.48 0.16 -0.08 4.43 0.26 0.24 0.31 0.28
SEQID-03750 0.02 0.08 0.07 0.07 0.10 0.00 0.07 0.03 -20.25 0.24
0.10 10.30 0.28 0.29 0.22 0.28 SEQID-03751 0.02 0.04 0.03 0.14 0.04
0.00 0.04 0.04 -25.76 0.34 0.16 10.96 0.32 0.28 0.00 0.25
SEQID-03752 0.05 0.01 0.01 0.07 0.05 0.00 0.02 0.02 -30.53 0.08
-0.04 4.83 0.29 0.31 0.00 0.30 SEQID-03753 0.01 0.03 0.04 0.08 0.05
0.02 0.05 0.05 -23.34 0.34 0.14 11.07 0.00 0.30 0.25 0.20
SEQID-03754 0.03 0.02 0.01 0.07 0.07 0.00 0.02 0.04 -28.01 0.09
0.00 7.55 0.29 0.30 0.27 0.32 SEQID-03755 0.05 0.00 0.01 0.07 0.05
0.00 0.03 0.02 -27.72 0.07 -0.01 5.27 0.29 0.31 0.24 0.30
SEQID-03756 0.02 0.02 0.14 0.06 0.02 0.03 0.01 0.05 -21.30 0.29
0.08 11.45 0.25 0.34 0.24 0.24 SEQID-03757 0.06 0.05 0.04 0.01 0.06
0.06 0.05 0.00 -28.84 0.08 0.34 12.70 0.27 0.17 0.24 0.29
SEQID-03758 0.01 0.06 0.05 0.03 0.03 0.04 0.05 0.04 -30.63 0.26
-0.13 4.06 0.32 0.49 0.00 0.22 SEQID-03759 0.03 0.02 0.02 0.15 0.09
0.00 0.01 0.03 -22.70 0.32 0.08 11.04 0.25 0.30 0.00 0.22
SEQID-03760 0.01 0.03 0.03 0.12 0.08 0.03 0.06 0.09 -14.72 0.43
-0.03 4.43 0.22 0.41 0.00 0.23 SEQID-03761 0.02 0.14 0.05 0.04 0.04
0.03 0.08 0.03 -26.38 0.13 0.13 10.96 0.25 0.27 0.28 0.25
SEQID-03762 0.02 0.02 0.01 0.04 0.05 0.00 0.00 0.14 -26.13 0.39
0.13 10.85 0.27 0.26 0.32 0.29 SEQID-03763 0.01 0.00 0.07 0.00 0.02
0.05 0.16 0.04 -28.55 0.19 -0.16 3.84 0.47 0.53 0.21 0.24
SEQID-03764 0.05 0.03 0.06 0.07 0.06 0.00 0.00 0.00 -35.85 0.01
-0.05 4.72 0.33 0.18 0.30 0.28 SEQID-03765 0.05 0.06 0.05 0.04 0.03
0.00 0.02 0.04 -21.74 0.44 0.02 8.22 0.33 0.29 0.24 0.00
SEQID-03766 0.05 0.03 0.04 0.05 0.10 0.00 0.00 0.00 -33.95 0.07
-0.02 5.02 0.27 0.15 0.33 0.33 SEQID-03767 0.02 0.02 0.00 0.03 0.04
0.00 0.05 0.04 -38.70 0.11 0.53 12.73 0.33 0.21 0.33 0.29
SEQID-03768 0.00 0.05 0.03 0.11 0.11 0.05 0.07 0.06 -15.13 0.40
-0.06 3.96 0.21 0.38 0.00 0.21 SEQID-03769 0.01 0.07 0.02 0.02 0.07
0.00 0.02 0.06 -26.47 0.34 -0.02 6.35 0.31 0.32 0.25 0.32
SEQID-03770 0.03 0.06 0.06 0.02 0.04 0.00 0.04 0.04 -21.97 0.50
0.04 9.61 0.27 0.23 0.32 0.00 SEQID-03771 0.00 0.05 0.12 0.00 0.00
0.03 0.11 0.03 -24.09 0.12 -0.11 4.21 0.33 0.20 0.29 0.33
SEQID-03772 0.00 0.05 0.12 0.00 0.00 0.00 0.12 0.04 -23.97 0.13
-0.11 4.21 0.33 0.20 0.35 0.35 SEQID-03773 0.00 0.07 0.03 0.03 0.07
0.00 0.06 0.03 -20.39 0.22 -0.02 5.00 0.28 0.26 0.00 0.24
SEQID-03774 0.05 0.02 0.04 0.01 0.02 0.00 0.02 0.02 -36.47 0.14
-0.05 4.75 0.26 0.33 0.25 0.00 SEQID-03775 0.02 0.05 0.09 0.00 0.04
0.00 0.12 0.04 -23.92 0.09 -0.12 4.05 0.33 0.20 0.29 0.33
SEQID-03776 0.02 0.03 0.04 0.10 0.06 0.08 0.10 0.03 -15.43 0.25
0.00 6.53 0.19 0.33 0.00 0.21 SEQID-03777 0.07 0.02 0.01 0.01 0.14
0.00 0.02 0.02 -25.61 0.08 0.05 10.21 0.31 0.34 0.00 0.29
SEQID-03778 0.03 0.02 0.04 0.09 0.05 0.00 0.09 0.06 -22.47 0.20
-0.06 4.44 0.00 0.31 0.00 0.22 SEQID-03779 0.07 0.05 0.02 0.03 0.07
0.00 0.00 0.05 -31.12 0.15 0.38 13.11 0.30 0.17 0.30 0.33
SEQID-03780 0.04 0.03 0.04 0.05 0.00 0.02 0.05 0.05 -25.62 0.07
0.20 11.73 0.25 0.28 0.00 0.24 SEQID-03781 0.02 0.05 0.03 0.02 0.09
0.00 0.03 0.09 -23.27 0.32 0.17 10.49 0.30 0.18 0.29 0.30
SEQID-03782 0.08 0.06 0.01 0.03 0.04 0.00 0.05 0.03 -21.91 0.20
-0.04 4.37 0.23 0.31 0.00 0.00 SEQID-03783 0.07 0.06 0.01 0.08 0.05
0.00 0.02 0.01 -26.74 0.11 0.32 12.83 0.24 0.20 0.00 0.27
SEQID-03784 0.02 0.04 0.01 0.04 0.05 0.00 0.14 0.04 -23.57 0.27
-0.08 4.60 0.28 0.33 0.00 0.25 SEQID-03785 0.01 0.08 0.01 0.02 0.06
0.04 0.09 0.06 -22.59 0.26 0.05 9.40 0.17 0.25 0.00 0.22
SEQID-03786 0.04 0.08 0.03 0.06 0.04 0.00 0.14 0.01 -23.30 0.15
-0.08 4.43 0.28 0.28 0.00 0.26 SEQID-03787 0.11 0.04 0.02 0.03 0.03
0.00 0.01 0.05 -23.23 0.25 -0.03 4.64 0.22 0.29 0.00 0.24
SEQID-03788 0.02 0.02 0.01 0.04 0.04 0.00 0.00 0.14 -26.07 0.39
0.13 10.85 0.27 0.26 0.31 0.29 SEQID-03789 0.02 0.08 0.04 0.06 0.09
0.02 0.03 0.08 -22.78 0.32 0.10 10.83 0.28 0.32 0.00 0.27
SEQID-03790 0.03 0.02 0.00 0.07 0.05 0.00 0.00 0.17 -22.17 0.45
0.10 10.80 0.25 0.24 0.00 0.19 SEQID-03791 0.03 0.13 0.03 0.06 0.05
0.00 0.07 0.04 -22.87 0.25 0.04 9.47 0.27 0.30 0.24 0.26
SEQID-03792 0.02 0.06 0.05 0.14 0.05 0.00 0.03 0.02 -20.96 0.15
0.04 10.05 0.23 0.33 0.00 0.20 SEQID-03793 0.01 0.04 0.01 0.01 0.02
0.00 0.02 0.02 -32.65 0.32 0.02 7.39 0.18 0.31 0.23 0.27
SEQID-03794 0.02 0.03 0.04 0.02 0.06 0.01 0.14 0.05 -22.93 0.22
0.03 9.12 0.23 0.30 0.21 0.00 SEQID-03795 0.02 0.08 0.02 0.07 0.07
0.06 0.03 0.02 -20.65 0.38 0.27 11.98 0.33 0.21 0.27 0.28
SEQID-03796 0.02 0.05 0.02 0.13 0.03 0.06 0.00 0.03 -23.50 0.29
0.31 13.02 0.26 0.18 0.28 0.32 SEQID-03797 0.01 0.01 0.07 0.08 0.07
0.00 0.02 0.06 -27.59 0.13 0.28 11.65 0.23 0.32 0.00 0.26
SEQID-03798 0.01 0.01 0.05 0.00 0.01 0.05 0.15 0.05 -28.97 0.24
-0.15 3.88 0.43 0.49 0.22 0.21 SEQID-03799 0.03 0.02 0.12 0.05 0.03
0.00 0.02 0.05 -21.47 0.18 0.03 9.78 0.26 0.30 0.27 0.29
SEQID-03800 0.02 0.03 0.16 0.09 0.05 0.01 0.01 0.04 -20.32 0.21
0.05 11.22 0.23 0.34 0.21 0.24 SEQID-03801 0.02 0.05 0.04 0.09 0.04
0.01 0.07 0.01 -20.88 0.15 0.03 9.74 0.21 0.33 0.00 0.21
SEQID-03802 0.04 0.02 0.07 0.04 0.06 0.00 0.05 0.10 -24.31 0.18
0.26 12.22 0.31 0.24 0.22 0.00 SEQID-03803 0.02 0.05 0.04 0.08 0.05
0.00 0.02 0.04 -21.78 0.20 0.04 10.22 0.21 0.31 0.00 0.20
SEQID-03804 0.04 0.06 0.03 0.06 0.04 0.00 0.00 0.03 -28.60 0.12
0.00 6.83 0.27 0.21 0.22 0.31 SEQID-03805 0.03 0.00 0.02 0.04 0.00
0.00 0.00 0.00 -28.57 0.42 0.33 12.42 0.34 0.16 0.34 0.30
SEQID-03806 0.01 0.04 0.03 0.04 0.04 0.00 0.07 0.16 -24.25 0.46
0.06 9.93 0.00 0.26 0.21 0.00 SEQID-03807 0.03 0.02 0.01 0.05 0.05
0.00 0.02 0.04 -23.55 0.21 0.16 11.44 0.27 0.28 0.00 0.31
SEQID-03808 0.03 0.02 0.00 0.07 0.05 0.00 0.00 0.17 -22.29 0.45
0.08 10.60 0.26 0.26 0.00 0.00 SEQID-03809 0.03 0.09 0.04 0.05 0.06
0.02 0.02 0.09 -24.75 0.35 0.10 10.81 0.23 0.28 0.00 0.28
SEQID-03810 0.02 0.05 0.13 0.05 0.02 0.01 0.03 0.05 -20.20 0.30
-0.02 5.86 0.20 0.34 0.22 0.23 SEQID-03811 0.05 0.00 0.03 0.08 0.03
0.00 0.00 0.03 -30.72 0.19 -0.15 4.15 0.31 0.33 0.25 0.28
SEQID-03812 0.06 0.04 0.10 0.07 0.00 0.01 0.01 0.03 -31.97 0.09
-0.06 4.71 0.26 0.32 0.23 0.23 SEQID-03813 0.04 0.02 0.04 0.01 0.03
0.01 0.01 0.07 -21.63 0.35 0.00 6.96 0.26 0.31 0.32 0.30
SEQID-03814 0.02 0.07 0.02 0.10 0.05 0.06 0.03 0.05 -22.85 0.32
0.26 12.23 0.35 0.24 0.26 0.00 SEQID-03815 0.01 0.06 0.00 0.04 0.04
0.00 0.05 0.06 -26.78 0.29 0.16 11.14 0.26 0.28 0.25 0.27
SEQID-03816 0.02 0.12 0.02 0.08 0.08 0.03 0.05 0.02 -21.98 0.31
0.28 11.91 0.25 0.17 0.30 0.22 SEQID-03817 0.01 0.07 0.02 0.06 0.02
0.00 0.04 0.03 -28.81 0.21 0.17 11.50 0.27 0.28 0.25 0.23
SEQID-03818 0.02 0.04 0.02 0.03 0.04 0.02 0.05 0.05 -20.79 0.41
0.09 10.56 0.20 0.31 0.00 0.22 SEQID-03819 0.03 0.05 0.05 0.07 0.12
0.00 0.02 0.05 -25.03 0.29 -0.14 3.85 0.21 0.33 0.00 0.22
SEQID-03820 0.04 0.04 0.00 0.07 0.11 0.00 0.00 0.01 -25.34 0.08
-0.06 4.48 0.32 0.25 0.26 0.27 SEQID-03821 0.02 0.06 0.04 0.02 0.02
0.08 0.07 0.04 -25.02 0.16 0.01 7.95 0.21 0.33 0.00 0.23
SEQID-03822 0.03 0.05 0.05 0.14 0.05 0.03 0.02 0.03 -21.29 0.32
0.00 6.89 0.23 0.31 0.18 0.22 SEQID-03823 0.02 0.03 0.02 0.04 0.02
0.03 0.14 0.06 -30.29 0.05 0.06 9.65 0.24 0.26 0.00 0.21
SEQID-03824 0.05 0.04 0.07 0.02 0.01 0.00 0.02 0.04 -30.01 0.08
0.04 9.78 0.28 0.23 0.22 0.29 SEQID-03825 0.04 0.01 0.03 0.09 0.02
0.00 0.00 0.04 -31.12 0.21 -0.20 3.87 0.25 0.31 0.28 0.33
SEQID-03826 0.02 0.01 0.03 0.05 0.02 0.03 0.14 0.07 -22.84 0.23
-0.02 5.60 0.27 0.32 0.00 0.26 SEQID-03827 0.06 0.12 0.05 0.01 0.02
0.00 0.03 0.05 -26.24 0.22 -0.24 3.42 0.32 0.23 0.30 0.28
SEQID-03828 0.03 0.04 0.03 0.02 0.04 0.02 0.05 0.04 -21.39 0.39
0.06 10.34 0.22 0.30 0.00 0.00 SEQID-03829 0.02 0.04 0.02 0.02 0.01
0.00 0.06 0.05 -31.10 0.27 0.26 10.97 0.31 0.26 0.28 0.26
SEQID-03830 0.08 0.02 0.04 0.05 0.00 0.00 0.00 0.01 -28.50 0.16
0.19 11.06 0.27 0.22 0.28 0.31 SEQID-03831 0.02 0.14 0.01 0.04 0.04
0.04 0.15 0.03 -20.48 0.33 0.10 9.76 0.24 0.20 0.26 0.26
SEQID-03832 0.04 0.02 0.03 0.02 0.08 0.00 0.04 0.12 -23.18 0.40
-0.07 4.32 0.26 0.34 0.25 0.26 SEQID-03833 0.05 0.01 0.00 0.05 0.09
0.04 0.06 0.07 -21.49 0.30 0.21 11.11 0.18 0.25 0.28 0.24
SEQID-03834 0.02 0.04 0.13 0.06 0.04 0.02 0.03 0.04 -20.06 0.25
0.04 9.69 0.23 0.35 0.21 0.25 SEQID-03835 0.04 0.05 0.03 0.04 0.05
0.06 0.03 0.00 -27.60 0.10 0.36 13.06 0.24 0.15 0.00 0.00
SEQID-03836 0.06 0.13 0.03 0.05 0.02 0.02 0.05 0.06 -20.29 0.42
-0.01 6.51 0.24 0.29 0.23 0.00 SEQID-03837 0.02 0.11 0.01 0.12 0.05
0.03 0.03 0.06 -22.98 0.34 0.26 12.24 0.31 0.22 0.00 0.00
SEQID-03838 0.03 0.00 0.02 0.02 0.00 0.00 0.04 0.04 -28.59 0.44
0.33 12.09 0.34 0.18 0.32 0.27 SEQID-03839 0.03 0.02 0.14 0.05 0.02
0.00 0.02 0.04 -21.42 0.13 0.03 9.78 0.26 0.30 0.32 0.31
SEQID-03840 0.05 0.07 0.03 0.05 0.05 0.02 0.05 0.06 -19.97 0.34
-0.06 4.45 0.40 0.54 0.00 0.21 SEQID-03841 0.04 0.02 0.03 0.03 0.05
0.02 0.04 0.03 -21.54 0.49 0.12 11.67 0.21 0.31 0.00 0.21
SEQID-03842 0.02 0.04 0.00 0.09 0.03 0.00 0.05 0.05 -26.92 0.20
0.14 11.01 0.26 0.27 0.26 0.29 SEQID-03843 0.02 0.05 0.03 0.02 0.02
0.02 0.04 0.04 -21.07 0.42 0.06 10.30 0.20 0.31 0.00 0.00
SEQID-03844 0.03 0.02 0.05 0.14 0.04 0.01 0.04 0.05 -21.65 0.19
0.01 8.01 0.23 0.33 0.00 0.00 SEQID-03845 0.02 0.03 0.13 0.06 0.04
0.02 0.00 0.04 -24.03 0.22 0.05 10.20 0.26 0.30 0.27 0.27
SEQID-03846 0.01 0.12 0.04 0.07 0.04 0.01 0.05 0.04 -24.67 0.15
0.02 9.29 0.21 0.34 0.00 0.21 SEQID-03847 0.10 0.06 0.02 0.03 0.05
0.00 0.00 0.03 -27.07 0.07 0.33 13.12 0.25 0.20 0.00 0.00
SEQID-03848 0.09 0.06 0.02 0.07 0.02 0.00 0.16 0.02 -24.96 0.12
-0.10 4.09 0.30 0.28 0.00 0.28 SEQID-03849 0.09 0.00 0.09 0.02 0.00
0.00 0.00 0.11 -23.49 0.40 0.25 11.37 0.33 0.16 0.33 0.33
SEQID-03850 0.03 0.07 0.04 0.07 0.08 0.02 0.03 0.08 -22.85 0.33
0.07 10.48 0.25 0.29 0.00 0.26 SEQID-03851 0.06 0.05 0.04 0.01 0.06
0.06 0.05 0.00 -27.66 0.08 0.32 12.62 0.29 0.18 0.00 0.29
SEQID-03852 0.03 0.03 0.07 0.02 0.06 0.00 0.02 0.02 -23.24 0.21
0.13 10.63 0.28 0.26 0.26 0.27 SEQID-03853 0.02 0.02 0.03 0.03 0.02
0.00 0.02 0.03 -38.14 0.22 -0.28 3.59 0.23 0.41 0.23 0.25
SEQID-03854 0.02 0.05 0.03 0.04 0.05 0.06 0.09 0.06 -20.82 0.21
-0.01 6.58 0.23 0.35 0.00 0.22 SEQID-03855 0.02 0.00 0.00 0.04 0.01
0.00 0.05 0.04 -40.55 0.04 0.55 12.69 0.38 0.24 0.32 0.30
SEQID-03856 0.01 0.06 0.12 0.05 0.03 0.01 0.02 0.04 -21.58 0.29
0.01 7.37 0.21 0.31 0.21 0.00 SEQID-03857 0.01 0.04 0.03 0.03 0.07
0.00 0.07 0.14 -26.17 0.37 0.08 10.22 0.31 0.31 0.00 0.00
SEQID-03858 0.11 0.04 0.02 0.01 0.03 0.00 0.01 0.05 -23.03 0.26
-0.01 5.15 0.26 0.30 0.00 0.25 SEQID-03859 0.02 0.00 0.00 0.02 0.03
0.00 0.00 0.09 -37.46 0.02 0.04 9.75 0.31 0.21 0.28 0.32
SEQID-03860 0.01 0.01 0.05 0.00 0.01 0.05 0.15 0.05 -29.01 0.23
-0.15 3.88 0.43 0.51 0.23 0.21 SEQID-03861 0.00 0.02 0.06 0.07 0.09
0.04 0.04 0.05 -30.00 0.10 0.34 12.54 0.24 0.23 0.00 0.23
SEQID-03862 0.03 0.12 0.03 0.05 0.05 0.01 0.02 0.05 -24.40 0.41
-0.06 4.40 0.24 0.35 0.21 0.24 SEQID-03863 0.05 0.02 0.02 0.15 0.04
0.00 0.02 0.06 -24.15 0.17 -0.13 3.83 0.28 0.27 0.00 0.28
SEQID-03864 0.06 0.02 0.01 0.05 0.06 0.00 0.04 0.05 -24.03 0.22
0.14 11.24 0.30 0.31 0.00 0.24 SEQID-03865 0.05 0.02 0.00 0.05 0.04
0.00 0.00 0.07 -36.76 0.07 0.04 9.93 0.30 0.27 0.23 0.26
SEQID-03866 0.05 0.05 0.03 0.02 0.06 0.00 0.00 0.05 -21.90 0.14
-0.14 3.67 0.28 0.27 0.31 0.00
SEQID-03867 0.01 0.04 0.02 0.00 0.12 0.00 0.07 0.13 -22.28 0.38
0.06 10.13 0.25 0.33 0.25 0.00 SEQID-03868 0.04 0.06 0.03 0.02 0.08
0.00 0.02 0.03 -25.74 0.09 0.31 12.57 0.30 0.24 0.00 0.25
SEQID-03869 0.03 0.07 0.04 0.06 0.07 0.02 0.05 0.06 -24.42 0.26
0.09 10.48 0.24 0.33 0.00 0.26 SEQID-03870 0.15 0.03 0.03 0.02 0.09
0.00 0.01 0.07 -21.44 0.24 -0.04 4.40 0.24 0.27 0.00 0.22
SEQID-03871 0.04 0.02 0.04 0.01 0.12 0.00 0.02 0.01 -27.74 0.20
0.14 10.57 0.32 0.23 0.30 0.33 SEQID-03872 0.02 0.05 0.03 0.08 0.06
0.04 0.07 0.06 -17.59 0.23 0.02 9.22 0.37 0.49 0.24 0.21
SEQID-03873 0.00 0.05 0.10 0.00 0.00 0.00 0.12 0.02 -23.97 0.19
-0.11 4.21 0.34 0.21 0.29 0.32 SEQID-03874 0.03 0.11 0.05 0.02 0.05
0.05 0.04 0.05 -26.20 0.42 0.15 10.69 0.31 0.13 0.29 0.31
SEQID-03875 0.02 0.06 0.02 0.07 0.04 0.00 0.00 0.02 -28.87 0.20
0.01 7.42 0.33 0.19 0.28 0.35 SEQID-03876 0.04 0.04 0.06 0.10 0.00
0.00 0.15 0.00 -21.57 0.23 0.27 11.87 0.35 0.11 0.27 0.35
SEQID-03877 0.03 0.04 0.05 0.10 0.11 0.01 0.04 0.07 -20.80 0.29
-0.08 4.25 0.00 0.33 0.16 0.18 SEQID-03878 0.06 0.00 0.03 0.08 0.10
0.00 0.02 0.04 -20.20 0.24 -0.05 4.54 0.28 0.23 0.29 0.30
SEQID-03879 0.04 0.05 0.03 0.04 0.05 0.06 0.03 0.00 -27.60 0.10
0.36 13.00 0.26 0.17 0.27 0.00 SEQID-03880 0.03 0.03 0.04 0.07 0.08
0.00 0.00 0.04 -38.18 0.01 0.00 6.58 0.33 0.18 0.30 0.24
SEQID-03881 0.02 0.02 0.01 0.06 0.08 0.00 0.01 0.17 -24.25 0.36
-0.05 4.62 0.26 0.31 0.26 0.25 SEQID-03882 0.04 0.02 0.07 0.15 0.02
0.00 0.05 0.04 -22.20 0.08 0.06 10.38 0.24 0.29 0.26 0.26
SEQID-03883 0.01 0.04 0.05 0.04 0.04 0.05 0.06 0.03 -31.29 0.25
-0.10 4.28 0.34 0.55 0.00 0.22 SEQID-03884 0.07 0.02 0.02 0.07 0.04
0.00 0.02 0.02 -23.97 0.24 0.03 9.28 0.27 0.26 0.00 0.27
SEQID-03885 0.01 0.04 0.07 0.05 0.03 0.01 0.03 0.03 -31.94 0.12
-0.09 4.39 0.23 0.34 0.21 0.24 SEQID-03886 0.06 0.08 0.05 0.02 0.00
0.02 0.05 0.06 -21.81 0.31 -0.02 6.00 0.23 0.32 0.22 0.00
SEQID-03887 0.06 0.06 0.05 0.03 0.00 0.02 0.05 0.05 -21.79 0.27
-0.01 6.63 0.25 0.31 0.00 0.00 SEQID-03888 0.13 0.02 0.13 0.03 0.03
0.00 0.08 0.03 -22.77 0.03 0.18 11.37 0.29 0.18 0.25 0.30
SEQID-03889 0.02 0.02 0.01 0.07 0.05 0.01 0.01 0.04 -28.27 0.15
-0.06 4.67 0.00 0.36 0.16 0.19 SEQID-03890 0.03 0.00 0.01 0.00 0.04
0.05 0.14 0.00 -30.54 0.16 -0.02 5.10 0.28 0.21 0.00 0.00
SEQID-03891 0.05 0.00 0.06 0.03 0.03 0.00 0.04 0.02 -31.55 0.14
0.05 9.84 0.28 0.18 0.29 0.28 SEQID-03892 0.03 0.00 0.02 0.03 0.05
0.06 0.10 0.02 -33.88 0.05 0.12 10.44 0.31 0.20 0.29 0.31
SEQID-03893 0.03 0.01 0.01 0.03 0.05 0.05 0.13 0.01 -34.98 0.09
0.09 10.08 0.31 0.21 0.27 0.32 SEQID-03894 0.03 0.01 0.01 0.02 0.04
0.05 0.12 0.01 -35.89 0.09 0.07 9.84 0.30 0.23 0.28 0.30
SEQID-03895 0.04 0.01 0.01 0.05 0.04 0.05 0.11 0.02 -34.48 0.10
0.05 9.55 0.30 0.25 0.28 0.29 SEQID-03896 0.02 0.00 0.03 0.06 0.05
0.00 0.10 0.08 -31.95 0.24 0.06 10.01 0.33 0.21 0.00 0.32
SEQID-03897 0.02 0.00 0.05 0.06 0.05 0.00 0.08 0.08 -33.43 0.21
0.08 10.22 0.27 0.17 0.00 0.34 SEQID-03898 0.01 0.02 0.04 0.05 0.05
0.00 0.08 0.07 -31.96 0.29 0.06 9.66 0.29 0.20 0.15 0.32
SEQID-03899 0.01 0.00 0.06 0.06 0.02 0.00 0.08 0.07 -31.03 0.21
0.08 10.25 0.27 0.19 0.27 0.27 SEQID-03900 0.00 0.00 0.02 0.03 0.00
0.10 0.08 0.06 -32.21 0.17 0.18 11.19 0.30 0.19 0.00 0.00
SEQID-03901 0.00 0.00 0.07 0.00 0.03 0.00 0.13 0.02 -31.13 0.24
-0.08 4.33 0.41 0.26 0.00 0.32 SEQID-03902 0.03 0.02 0.05 0.00 0.03
0.04 0.04 0.02 -30.04 0.23 0.20 11.63 0.29 0.19 0.33 0.23
SEQID-03903 0.02 0.02 0.02 0.00 0.03 0.02 0.13 0.02 -30.82 0.25
0.17 11.01 0.33 0.21 0.35 0.33 SEQID-03904 0.01 0.01 0.00 0.00 0.02
0.00 0.20 0.01 -31.14 0.38 -0.08 4.54 0.32 0.26 0.00 0.25
SEQID-03905 0.00 0.00 0.00 0.00 0.03 0.00 0.13 0.03 -30.46 0.34
0.00 6.81 0.34 0.22 0.00 0.00 SEQID-03906 0.00 0.03 0.02 0.03 0.00
0.04 0.11 0.02 -29.86 0.39 -0.02 5.79 0.29 0.19 0.20 0.31
SEQID-03907 0.01 0.02 0.06 0.00 0.02 0.06 0.23 0.01 -30.42 0.29
-0.16 3.92 0.32 0.22 0.23 0.32 SEQID-03908 0.03 0.02 0.02 0.06 0.02
0.00 0.10 0.03 -31.04 0.39 -0.11 4.13 0.28 0.20 0.31 0.23
SEQID-03909 0.03 0.00 0.05 0.00 0.02 0.00 0.16 0.06 -31.07 0.42
-0.07 4.57 0.29 0.20 0.00 0.30 indicates data missing or illegible
when filed
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160354436A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160354436A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References