U.S. patent application number 14/891241 was filed with the patent office on 2016-11-17 for capsid-modified, raav3 vector compositions and uses in gene therapy of human liver cancer.
This patent application is currently assigned to University of Florida Research Foundation, Inc.. The applicant listed for this patent is UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC.. Invention is credited to Mavis Agbandje-McKenna, George Vladimirovich Aslanidi, Arun Srivastava, Kim M. Van Vliet, Li Zhong, Sergei Zolotukhin.
Application Number | 20160333372 14/891241 |
Document ID | / |
Family ID | 39684174 |
Filed Date | 2016-11-17 |
United States Patent
Application |
20160333372 |
Kind Code |
A1 |
Srivastava; Arun ; et
al. |
November 17, 2016 |
CAPSID-MODIFIED, RAAV3 VECTOR COMPOSITIONS AND USES IN GENE THERAPY
OF HUMAN LIVER CANCER
Abstract
Disclosed are next-generation multi-mutated capsid
protein-modified rAAV expression vectors, as well as infectious
virions, compositions, and pharmaceutical formulations that include
them. Also disclosed are methods of preparing and using these high
transduction efficiency vector constructs in a variety of
therapeutic applications including, inter alia, as delivery agents
for the treatment or amelioration of one or more diseases or
abnormal conditions in an affected mammal using in vivo and/or ex
situ viral vector-based gene therapy protocols. Also disclosed are
large-scale production methods for the multi-mutated,
capsid-modified rAAV expression vectors, viral particles, and
infectious virions, as well as use of the disclosed compositions in
the manufacture of medicaments for use in a variety of in vitro
and/or in vivo therapeutic methodologies.
Inventors: |
Srivastava; Arun;
(Gainesville, FL) ; Zhong; Li; (Gainesville,
FL) ; Zolotukhin; Sergei; (Gainesville, FL) ;
Aslanidi; George Vladimirovich; (Gainesville, FL) ;
Agbandje-McKenna; Mavis; (Gainesville, FL) ; Van
Vliet; Kim M.; (Gainesville, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. |
Gainesville |
FL |
US |
|
|
Assignee: |
University of Florida Research
Foundation, Inc.
Gainesville
FL
|
Family ID: |
39684174 |
Appl. No.: |
14/891241 |
Filed: |
May 21, 2014 |
PCT Filed: |
May 21, 2014 |
PCT NO: |
PCT/US2014/039015 |
371 Date: |
November 13, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13899481 |
May 21, 2013 |
|
|
|
14891241 |
|
|
|
|
12595196 |
Dec 31, 2009 |
8445267 |
|
|
PCT/US08/59647 |
Apr 8, 2008 |
|
|
|
13899481 |
|
|
|
|
60910798 |
Apr 9, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 35/76 20130101;
A61K 48/0008 20130101; A61K 2039/5158 20130101; C12N 7/00 20130101;
C12N 2750/14142 20130101; C12N 2750/14122 20130101; C12N 15/86
20130101; A61K 48/0091 20130101; C12N 15/8645 20130101; A61K 48/005
20130101; C07K 14/005 20130101; C12N 2750/14143 20130101; C12N
2810/6027 20130101; C12N 2750/14145 20130101; A61K 39/0011
20130101; C12N 2750/14132 20130101; C12N 2750/14171 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant
Nos. R01-HL-097088 and R21-EB-015684 awarded by the National
Institutes of Health. The government has certain rights in the
invention.
Claims
1. An rAAV3 vector comprising a modified capsid protein that
comprises: (a) a non-tyrosine amino acid residue at one or more
positions corresponding to Y252, Y272, Y444, Y701, Y705, and Y731
of the wild-type AAV3 capsid protein as set forth in SEQ ID NO:3;
(b) a non-serine amino acid residue at each of one or more
positions corresponding to S459 or S663, of the wild-type AAV3
capsid protein as set forth in SEQ ID NO:3; (c) a non-threonine
amino acid residue at each of one or more positions corresponding
to T251 or T492 of the wild-type AAV3 capsid protein as set forth
in SEQ ID NO:3; (d) a non-lysine amino acid residue at each of one
or more positions corresponding to K528, K533, or K545 of the
wild-type AAV3 capsid protein as set forth in SEQ ID NO:3; (e) (i)
a non-tyrosine amino acid residue at position Y701, or Y705; and
(ii) a non-tyrosine amino acid residue at position Y705 or Y731, or
a non-serine amino acid residue at position S663 of the wild-type
AAV3 capsid protein as set forth in SEQ ID NO:3; (f) a combination
of three or more amino acid substitutions listed in (a), (b), (c),
and (d); each with a non-native amino acid; (g) a combination of
four or more amino acid substitutions listed in (a), (b), (c), and
(d); each with a non-native amino acid; or (h) a combination of
five or more amino acid substitutions listed in (a), (b), (c), and
(d); each with a non-native amino acid; or alternatively, wherein
each of the amino acid substitutions is at an equivalent amino acid
position corresponding thereto in any one of the other wild-type
vector serotypes selected from the group consisting of AAV1, AAV2,
AAV4, AAV5, AAV7, AAV8, AAV9, and AAV10, as set forth in SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID
NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively.
2. The rAAV3 vector in accordance with claim 1, wherein the
non-serine amino acid residue is selected from the group consisting
of phenylalanine (F), valine (V), histidine (H), isoleucine (I),
alanine (A), leucine (L) aspartic acid (D), asparagine (N).
glutamic acid (E), arginine (R), and isoleucine (I); or the
non-tyrosine, non-lysine, or non-threonine amino acid residue is
selected from the group consisting of serine (S), phenylalanine
(F), valine (V), histidine (H), isoleucine (I), alanine (A),
leucine (L) aspartic acid (D), asparagine (N). glutamic acid (E),
arginine (R), and isoleucine (I).
3. The rAAV3 vector in accordance with claim 1, wherein the
combination of three or more amino acid substitutions include a
non-native amino acid substitution at one or more of the following
combination of acid residues: (a) Y701F, Y705F, and Y731F; (b)
Y705F, Y731F, and S663V; (c) Y705F, Y731F, and T492V; (d) Y705F,
Y731F, K533R; (e) S663V, T492V, and K533R; (f) Y705F, Y731F, S663V,
and T492V; or (g) Y705F, Y731F, S663V, T492V, and K533R, of the
wild-type AAV3 capsid protein as set forth in SEQ ID NO:3, or at
the equivalent surface-exposed amino acid residues in any one of
the corresponding wild-type AAV1, AAV2, AAV4, AAV5, AAV6, AAV7,
AAV8, AAV9, or AAV10 capsid proteins, as set forth in SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7,
SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, respectively, or in any
combination thereof.
4. The rAAV3 vector in accordance with claim 1, wherein the
transduction efficiency of a virion comprising the vector is about
2- to about 50-fold higher in a selected mammalian host cell than
that of a virion that comprises a corresponding, unmodified, rAAV3
vector.
5. The rAAV3 vector in accordance claim 1, wherein the transduction
efficiency of a virion comprising the vector is about 6- to about
40-fold higher in a selected mammalian host cell than that of a
virion that comprises a corresponding, unmodified, rAAV3
vector.
6. The rAAV3 vector in accordance with claim 1, wherein the
transduction efficiency of a virion comprising the vector is about
8- to about 30-fold higher in a selected mammalian host cell than
that of a virion that comprises a corresponding, unmodified, rAAV3
vector.
7. The rAAV3 vector in accordance with claim 1, wherein the virion
comprising the vector is less susceptible to ubiquitination when
introduced into a mammalian cell than that of a virion that
comprises a corresponding, unmodified, rAAV3 vector.
8. The rAAV3 vector in accordance with claim 1, wherein the vector
further comprises a nucleic acid segment that encodes a diagnostic,
therapeutic, or chemotherapeutic agent operably linked to a
promoter capable of expressing the nucleic acid segment in a
suitable host cell comprising the vector.
9. The rAAV3 vector in accordance with claim 8, wherein the nucleic
acid segment further comprises an enhancer, a post-transcriptional
regulatory sequence, a polyadenylation signal, or any combination
thereof, operably linked to the nucleic acid segment.
10. The rAAV3 vector in accordance with claim 8, further comprising
at least a first mammalian intron sequence operably linked to the
nucleic segment.
11. The rAAV3 vector in accordance with claim 8, wherein the
promoter is a heterologous promoter, a tissue-specific promoter, a
cell-specific promoter, a constitutive promoter, an inducible
promoter, or any combination thereof.
12. The rAAV3 vector in accordance with claim 10, wherein the
promoter is a liver-specific promoter, a tumor cell-specific
promoter, or a combination thereof.
13. The rAAV3 vector in accordance with claim 8, wherein the
nucleic acid segment expresses or encodes a polypeptide, a peptide,
a ribozyme, a peptide nucleic acid, an siRNA, an RNAi, an antisense
oligonucleotide, an antisense polynucleotide, an antibody, an
antigen binding fragment, or any combination thereof.
14. The rAAV3 vector in accordance with claim 8, wherein the at
least a first nucleic acid segment encodes a chemotherapeutic
agent.
15. The rAAV3 vector in accordance with claim 8, wherein the
diagnostic, therapeutic or chemotherapeutic agent is an agonist, an
antagonist, an anti-apoptosis factor, an inhibitor, a receptor, a
cytokine, a cytotoxin, an erythropoietic agent, a glycoprotein, a
growth factor, a growth factor receptor, a hormone, a hormone
receptor, an interferon, an interleukin, an interleukin receptor, a
nerve growth factor, a neuroactive peptide, a neuroactive peptide
receptor, a protease, a protease inhibitor, a protein
decarboxylase, a protein kinase, a protein kinase inhibitor, an
enzyme, a receptor binding protein, a transport protein or an
inhibitor thereof, a serotonin receptor, or an uptake inhibitor
thereof, a serpin, a serpin receptor, a tumor suppressor, a
cytotoxic agent, a cytostatic agent, an anti-inflammatory agent, or
any combination thereof.
16. The rAAV3 vector in accordance with claim 1, comprised within
an adeno-associated viral particle or infectious rAAV3 virion.
17-29. (canceled)
30. A method for providing a mammal in need thereof with a
diagnostically- or therapeutically-effective amount of a selected
biological molecule, the method comprising providing to a cell,
tissue or organ of a mammal in need thereof, an amount of the rAAV3
vector in accordance with claim 1; and for a time effective to
provide the mammal with a diagnostically- or a
therapeutically-effective amount of the selected biological
molecule.
31. A method for diagnosing, preventing, treating, or ameliorating
at least one or more symptoms of liver cancer, including HCC, in a
mammal, the method comprising, administering to a mammal in need
thereof the rAAV3 vector in accordance with claim 1, in an amount
and for a time sufficient to diagnose, prevent, treat or ameliorate
the one or more symptoms of the liver cancer in the mammal.
32. The method in accordance with claim 31, wherein the mammal is
human.
33. A method of transducing a population of liver cells or liver
tumor cells in a human diagnosed with, having, or suspected of
having HCC; the method comprising administering to the human, a
composition that comprises an effective amount of the rAAV3 vector
in accordance with claim 1, for a time effective to transduce the
population of liver cells or liver tumor cells.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present international patent application claims priority
to U.S. patent application Ser. No. 13/899,481, filed May 21, 2013
(pending; Atty. Dkt. No. 36689.331), which was a
continuation-in-part of U.S. patent application Ser. No.
12/595,196, filed Dec. 31, 2009 (now U.S. Pat. No. 8,445,267; Atty.
Docket No. 36689.305), which was the U.S. national-stage filing of
PCT Intl. Patent Appl. No. PCT/US2008/059647 filed Apr. 8, 2008
(nationalized; Atty. Docket No. 36689.272), which claimed priority
to U.S. Provisional Patent Appl. No. 60/910,798, filed Apr. 9, 2007
(expired; Atty. Docket No. 36689.266). The content of each of the
aforementioned applications is hereby incorporated in its entirety
by express reference thereto.
NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT
[0003] Not Applicable.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present invention relates generally to the fields of
molecular biology and virology, and in particular, to the
development of gene delivery vehicles. Also disclosed are improved
rAAV vector compositions useful in delivering a variety of nucleic
acid segments, including those encoding therapeutic proteins
polypeptides, peptides, antisense oligonucleotides, and ribozyme
constructs to selected host cells for use in various diagnostic
and/or therapeutic regimens. Methods are also provided for
preparing and using these modified rAAV-based vector constructs in
a variety of viral-based gene therapies, and in particular, for the
diagnosis, prevention, treatment and/or amelioration of symptoms of
human diseases, disorders, dysfunctions, trauma, or injury. The
invention also provides mutated rAAV-based viral vector delivery
systems with increased transduction efficiency and/or improved
viral infectivity of selected mammalian host cells. In particular,
the invention provides improved rAAV vectors and virions having
particles having amino acid substitutions in one or more
surface-exposed residues of a viral capsid protein.
[0006] 2. Description of Related Art
[0007] Major advances in the field of gene therapy have been
achieved by using viruses to deliver therapeutic genetic material.
The adeno-associated virus (AAV) has attracted considerable
attention as a highly effective viral vector for gene therapy due
to its low immunogenicity and ability to effectively transduce
non-dividing cells. AAV has been shown to infect a variety of cell
and tissue types, and significant progress has been made over the
last decade to adapt this viral system for use in human gene
therapy.
[0008] In its normal "wild type" form, recombinant AAV (rAAV) DNA
is packaged into the viral capsid as a single stranded molecule
about 4600 nucleotides (nt) in length. Following infection of the
cell by the virus, the molecular machinery of the cell converts the
single DNA strand into a double-stranded form. Only the
double-stranded DNA form is useful to the polypeptides of the cell
that transcribe the contained gene or genes into RNA.
[0009] AAV has many properties that favor its use as a gene
delivery vehicle: 1) the wild type virus is not associated with any
pathologic human condition; 2) the recombinant form does not
contain native viral coding sequences; and 3) persistent transgenic
expression has been observed in many applications.
[0010] The transduction efficiency of recombinant adeno-associated
virus 2 (AAV) vectors varies greatly in different cells and tissues
in vitro and in vivo, which has limited the usefulness of many of
them in potential gene therapy regimens. Systematic studies have
been performed to elucidate the fundamental steps in the life cycle
of AAV. For example, it has been documented that a cellular
protein, FKBP52, phosphorylated at tyrosine residues by epidermal
growth factor receptor protein tyrosine kinase (EGFR-PTK), inhibits
AAV second-strand DNA synthesis and consequently, transgene
expression in vitro as well as in vivo. It has also been
demonstrated that EGFR-PTK signaling modulates the
ubiquitin/proteasome pathway-mediated intracellular trafficking as
well as FKBP52-mediated second-strand DNA synthesis of AAV vectors.
In those studies, inhibition of EGFR-PTK signaling led to decreased
ubiquitination of AAV capsid proteins, which in turn, facilitated
nuclear transport by limiting proteasome-mediated degradation of
AAV vectors, implicating EGFR-PTK-mediated phosphorylation of
tyrosine residues on AAV capsids. What is lacking in the prior art
are improved rAAV viral vectors that have enhanced transduction
efficiency for infecting selected mammalian cells, and for targeted
gene delivery to human cells in particular.
BRIEF SUMMARY OF THE INVENTION
[0011] The present invention overcomes limitations and deficiencies
inherent in the prior art by providing novel improved rAAV-based
genetic constructs that encode one or more therapeutic agents
useful in the preparation of medicaments for the prevention,
treatment, and/or amelioration of one or more diseases, disorders
or dysfunctions resulting from a deficiency in one or more of such
polypeptides. In particular, the invention provides VP3
capsid-protein-modified rAAV-based genetic constructs encoding one
or more selected molecules, such as, for example, one or more
diagnostic or therapeutic agents (including, e.g., proteins,
polypeptides, peptides, antibodies, antigen binding fragments,
siRNAs, RNAis, antisense oligo- and poly-nucleotides, ribozymes,
and variants and/or active fragments thereof), for use in the
diagnosis, prevention, treatment, and/or amelioration of symptoms
of a variety of mammalian diseases, disorders, dysfunctions,
trauma, injury, and such like.
[0012] The present invention provides mutated AAV VP3 capsid
proteins that include modification of one or more surface-exposed
amino acid resides (including, e.g., without limitation, lysine,
serine, threonine, and/or tyrosine residues) as compared to
wildtype. Also provided are infectious rAAV virions that comprise
the mutated AAV capsid proteins of the present invention, as well
as nucleic acid molecules and rAAV vectors encoding the mutant AAV
capsid proteins of the present invention, and nucleic acids
encoding one or more selected diagnostic and/or therapeutic agents
for delivery to a selected population of mammalian cells.
[0013] Advantageously, the novel rAAV vectors, express constructs,
and infectious virions and viral particles comprising them as
disclosed herein preferably have an improved efficiency in
transducing one or more of a variety of cells, tissues and organs
of interest, when compared to wild-type, unmodified, expression
constructs, and to the corresponding rAAV vectors and virions
comprising them.
[0014] The improved rAAV vectors provided herein transduce one or
more selected host cells at higher-efficiencies (and often much
higher efficiencies) than conventional, wild type (i.e.,
"unmodified") rAAV vectors. By performing extensive analysis and
detailed experiments involving the site-directed mutagenesis of
various individual and/or combinations of two, three, four, five,
or even six or more surface-exposed amino acid residues on various
AAV capsid proteins from a variety of AAV serotypes, the inventors
have developed a large collection of single- or multi-mutated rAAV
vectors that possess improved transduction efficiencies. The
inventors have demonstrated in a number of different AAV serotypes
that the substitution of one or more virion surface-presenting
amino acid residues results in improved viral vectors, which are
capable of higher-efficiency transduction than that of the
corresponding, non-substituted vectors from which the mutants were
prepared.
[0015] The development of these new capsid-mutant rAAV viral
vectors dramatically reduces the number of viral particles needed
for conventional gene therapy regimens. In addition to having
improved transduction efficiencies for various mammalian cells, the
surface-exposed amino acid-modified rAAV vectors described herein
are more stable, less immunogenic, and can be produced at much
lower cost than the traditional viral vectors currently employed in
mammalian gene therapy regimens.
[0016] In a particular embodiment the invention provides a modified
rAAV VP3 capsid protein, that includes: (a) a non-tyrosine amino
acid residue at one or more positions corresponding to Y252, Y272,
Y444, Y701, Y705, and Y731 of the wild-type AAV3 capsid protein as
set forth in SEQ ID NO:3; (b) a non-serine amino acid residue at
each of one or more positions corresponding to S459 or 5663, of the
wild-type AAV3 capsid protein as set forth in SEQ ID NO:3; (c) a
non-threonine amino acid residue at each of one or more positions
corresponding to T251 or T492 of the wild-type AAV3 capsid protein
as set forth in SEQ ID NO:3; (d) a non-lysine amino acid residue at
each of one or more positions corresponding to K528, K533, or K545
of the wild-type AAV3 capsid protein as set forth in SEQ ID NO:3;
(e) (i) a non-tyrosine amino acid residue at position Y701, or
Y705; and (ii) a non-tyrosine amino acid residue at position Y705
or Y731, or a non-serine amino acid residue at position S663 of the
wild-type AAV3 capsid protein as set forth in SEQ ID NO:3; (f) a
combination of three or more amino acid substitutions listed in
(a), (b), (c), and (d); each with a non-native amino acid; (g) a
combination of four or more amino acid substitutions listed in (a),
(b), (c), and (d); each with a non-native amino acid; or (h) a
combination of five or more amino acid substitutions listed in (a),
(b), (c), and (d); each with a non-native amino acid; or
alternatively, wherein each of the amino acid substitutions is at
an equivalent amino acid position corresponding thereto in any one
of the other wild-type vector serotypes selected from the group
consisting of AAV1, AAV2, AAV4, AAV5, AAV7, AAV8, AAV9, and AAV10,
as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5,
SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10,
respectively.
[0017] Exemplary multi-mutated proteins of the present invention
include, but are not limited to, combinations of non-native amino
acid substitutions at each of three or more distinct
surface-exposed amino acid residues on the AAV3 capsid. These
multi-mutant vectors include, without limitation:
(a) Y701F, Y705F, and Y731F;
(b) Y705F, Y731F, and S663V;
(c) Y705F, Y731F, and T492V;
(d) Y705F, Y731F, K533R;
(e) S663V, T492V, and K533R;
(f) Y705F, Y731F, S663V, and T492V; and
[0018] (g) Y705F, Y731F, S663V, T492V, and K533R substitutions at
the denoted amino acid residues of the wild-type AAV3 capsid
protein as set forth in SEQ ID NO:3, or at the equivalent
surface-exposed amino acid residues in any one of the corresponding
wild-type AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10
capsid proteins, as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, or SEQ ID NO:10, respectively, or in any combination
thereof.
[0019] In the practice of the invention, the substituted non-native
amino acids may include a substitution of one or more amino acids
not normally present at a particular residue in the corresponding
wild-type protein, and preferably include one or more non-native
amino acid substitutions selected from the group consisting of
phenylalanine (F), valine (V), histidine (H), isoleucine (I),
alanine (A), leucine (L) aspartic acid (D), asparagine (N).
glutamic acid (E), arginine (R), serine (S), and isoleucine
(I).
[0020] The invention also provides isolated and purified
polynucleotides that encode one or more of the disclosed capsid
protein-mutated variants as described herein, as well as
recombinant adeno-associated viral (rAAV) vectors that comprise one
or more such polynucleotides. Preferably, the vector constructs of
the present invention further include at least one nucleic acid
segment that encodes a diagnostic or therapeutic molecule operably
linked to a promoter capable of expressing the nucleic acid segment
in a suitable host cell comprising the vector. In the practice of
the invention, the transduction efficiency of a virion comprising
the modified AAV VP3 capsid protein will be higher than that of the
corresponding, unmodified, wild-type protein, and as such, will
preferably possess a transduction efficiency in a mammalian cell
that is at least 2-fold, at least about 4-fold, at least about
6-fold, at least about 8-fold, at least about 10-fold, or at least
about 12-fold or higher in a selected mammalian host cell than that
of a virion that comprises a corresponding, unmodified, capsid
protein. In certain embodiments, the transduction efficiency of the
rAAV vectors provided herein will be at least about 15-fold higher,
at least about 20-fold higher, at least about 25-fold higher, at
least about 30-fold higher, or at least about 40, 45, or 50-fold or
more greater than that of a virion that comprises a corresponding,
unmodified, capsid protein. Moreover, the infectious virions of the
present invention that include one or more modified AAV VP3 capsid
proteins are preferably less susceptible to ubiquitination when
introduced into a mammalian cell than that of a virion that
comprises a corresponding, unmodified, capsid protein.
[0021] The present invention also concerns rAAV vectors, wherein
the nucleic acid segment further comprises a promoter, an enhancer,
a post-transcriptional regulatory sequence, a polyadenylation
signal, or any combination thereof, operably linked to the nucleic
acid segment that encodes the selected polynucleotide of
interest.
[0022] Preferably, the promoter is a heterologous promoter, a
tissue-specific promoter, a cell-specific promoter, a constitutive
promoter, an inducible promoter, or any combination thereof.
[0023] In certain embodiments, the nucleic acid segments cloned
into the novel rAAV expression vectors described herein will
express or encode one or more polypeptides, peptides, ribozymes,
peptide nucleic acids, siRNAs, RNAis, antisense oligonucleotides,
antisense polynucleotides, antibodies, antigen binding fragments,
or any combination thereof.
[0024] As noted herein, the therapeutic agents useful in the
invention may include one or more agonists, antagonists,
anti-apoptosis factors, inhibitors, receptors, cytokines,
cytotoxins, erythropoietic agents, glycoproteins, growth factors,
growth factor receptors, hormones, hormone receptors, interferons,
interleukins, interleukin receptors, nerve growth factors,
neuroactive peptides, neuroactive peptide receptors, proteases,
protease inhibitors, protein decarboxylases, protein kinases,
protein kinase inhibitors, enzymes, receptor binding proteins,
transport proteins or one or more inhibitors thereof, serotonin
receptors, or one or more uptake inhibitors thereof, serpins,
serpin receptors, tumor suppressors, diagnostic molecules,
chemotherapeutic agents, cytotoxins, or any combination
thereof.
[0025] While the inventors particularly contemplate the use of the
rAAV3 vectors denoted in FIG. 41 in methods for the gene therapy of
one or more mammalian liver cancers, capsid-mutated vectors may be
prepared and packaged within virions of any known AAV serotype,
including, for examples, AAV serotype 1 (AAV1), AAV serotype 2
(AAV2), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype
6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV
serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11
(AAV11), or AAV serotype 12 (AAV12).
[0026] The invention further provides populations and pluralities
of such capsid-mutated rAAV vectors, as well as virions, infectious
viral particles, and mammalian host cells that include one or more
nucleic acid segments encoding them.
[0027] Preferably, the mammalian host cells will be human host
cells, including, for example blood cells, stem cells,
hematopoietic cells, CD34.sup.+ cells, liver cells, cancer cells,
vascular cells, pancreatic cells, neural cells, ocular or retinal
cells, epithelial or endothelial cells, dendritic cells,
fibroblasts, or any other cell of mammalian origin, including,
without limitation, hepatic (i.e., liver) cells, lung cells,
cardiac cells, pancreatic cells, intestinal cells, diaphragmatic
cells, renal (i.e., kidney) cells, neural cells, blood cells, bone
marrow cells, or any one or more selected tissues of a mammal for
which viral-based gene therapy is contemplated.
[0028] The invention further provides composition and formulations
that include one or more of the proteins nucleic acid segments
viral vectors, host cells, or viral particles of the present
invention together with one or more pharmaceutically-acceptable
buffers, diluents, or excipients. Such compositions may be included
in one or more diagnostic or therapeutic kits, for diagnosing,
preventing, treating or ameliorating one or more symptoms of a
mammalian disease, injury, disorder, trauma or dysfunction.
[0029] The invention further includes a method for providing a
mammal in need thereof with a diagnostically- or
therapeutically-effective amount of a selected biological molecule,
the method comprising providing to a cell, tissue or organ of a
mammal in need thereof, an amount of an rAAV vector; and for a time
effective to provide the mammal with a diagnostically- or a
therapeutically-effective amount of the selected biological
molecule.
[0030] The invention further provides a method for diagnosing,
preventing, treating, or ameliorating at least one or more symptoms
of a disease, a disorder, a dysfunction, an injury, an abnormal
condition, or trauma in a mammal. In an overall and general sense,
the method includes at least the step of administering to a mammal
in need thereof one or more of the disclosed rAAV vectors, in an
amount and for a time sufficient to diagnose, prevent, treat or
ameliorate the one or more symptoms of the disease, disorder,
dysfunction, injury, abnormal condition, or trauma in the mammal.
In the case of rAAV3-based vectors, such abnormal conditions
preferably include one or more diseases or dysfunctions of the
mammalian liver, including, for example, HCC; in the case of
rAAV8-based vectors, such abnormal conditions preferably include
one or more diseases or dysfunctions of the mammalian eye; or, in
the case of rAAV6 vectors, one or more diseases of stem cells,
blood cells, hematopoietic cells, or CD35.sup.+ cells, including
for example, sickle cell disease, .beta.-thalassemia, and such
like.
[0031] The invention also provides a method of transducing a
population of mammalian cells. In an overall and general sense, the
method includes at least the step of introducing into one or more
cells of the population, a composition that comprises an effective
amount of one or more of the rAAV vectors disclosed herein.
[0032] In a further embodiment, the invention also provides
isolated nucleic acid segments that encode one or more of the VP3
mutant capsid proteins as described herein, and provides
recombinant vectors, virus particles, infectious virions, and
isolated host cells that comprise one or more of the improved
vector sequences described and tested herein.
[0033] Additionally, the present invention provides compositions,
as well as therapeutic and/or diagnostic kits that include one or
more of the disclosed vectors or AAv compositions, formulated with
one or more additional ingredients, or prepared with one or more
instructions for their use.
[0034] The invention also demonstrates methods for making, as well
as methods of using the disclosed improved rAAV capsid-mutated
vectors in a variety of ways, including, for example, ex situ, in
vitro and in vivo applications, methodologies, diagnostic
procedures, and/or gene therapy regimens. Because many of the
improved vectors described herein are also resistant to proteasomal
degradation, they possess significantly increased transduction
efficiencies in vivo making them particularly well suited for viral
vector-based human gene therapy regimens, and in particular, for
delivering one or more genetic constructs to selected mammalian
cells in vivo and/or in vitro.
[0035] In one aspect, the invention provides compositions
comprising recombinant adeno-associated viral (AAV) vectors,
virions, viral particles, and pharmaceutical formulations thereof,
useful in methods for delivering genetic material encoding one or
more beneficial or therapeutic product(s) to mammalian cells and
tissues. In particular, the compositions and methods of the
invention provide a significant advancement in the art through
their use in the treatment, prevention, and/or amelioration of
symptoms of one or more mammalian diseases. It is contemplated that
human gene therapy will particularly benefit from the present
teachings by providing new and improved viral vector constructs for
use in the treatment of a number of diverse diseases, disorders,
and dysfunctions.
[0036] In another aspect, the invention concerns modified rAAV
vector that encode one or more mammalian therapeutic agents for the
prevention, treatment, and/or amelioration of one or more disorders
in the mammal into which the vector construct is delivered.
[0037] In particular, the invention provides rAAV-based expression
constructs that encode one or more mammalian therapeutic agent(s)
(including, but not limited to, for example, protein(s),
polypeptide(s), peptide(s), enzyme(s), antibodies, antigen binding
fragments, as well as variants, and/or active fragments thereof,
for use in the treatment, prophylaxis, and/or amelioration of one
or more symptoms of a mammalian disease, dysfunction, injury,
and/or disorder.
[0038] In one embodiment, the invention provides an rAAV vector
that comprises at least a first capsid protein comprising at least
a first amino acid substitution to a non-native amino acid at one
or more surface exposed amino acid residues in an rAAV capsid
protein, and wherein the vector further additionally includes at
least a first nucleic acid segment that encodes at least a first
diagnostic or therapeutic agent operably linked to a promoter
capable of expressing the segment in a host cell that contains the
expression vector construct.
[0039] The surface-exposed amino acid-modified rAAV vectors of the
present invention may optionally further include one or more
enhancer sequences that are each operably linked to the nucleic
acid segment. Exemplary enhancer sequences include, but are not
limited to, one or more selected from the group consisting of a CMV
enhancer, a synthetic enhancer, a liver-specific enhancer, an
vascular-specific enhancer, a brain-specific enhancer, a neural
cell-specific enhancer, a lung-specific enhancer, a muscle-specific
enhancer, a kidney-specific enhancer, a pancreas-specific enhancer,
and an islet cell-specific enhancer.
[0040] Exemplary promoters useful in the practice of the invention
include, without limitation, one or more heterologous,
tissue-specific, constitutive or inducible promoters, including,
for example, but not limited to, a promoter selected from the group
consisting of a CMV promoter, a .beta.-actin promoter, an insulin
promoter, an enolase promoter, a BDNF promoter, an NGF promoter, an
EGF promoter, a growth factor promoter, an axon-specific promoter,
a dendrite-specific promoter, a brain-specific promoter, a
hippocampal-specific promoter, a kidney-specific promoter, an
elafin promoter, a cytokine promoter, an interferon promoter, a
growth factor promoter, an .alpha..sub.1-antitrypsin promoter, a
brain cell-specific promoter, a neural cell-specific promoter, a
central nervous system cell-specific promoter, a peripheral nervous
system cell-specific promoter, an interleukin promoter, a serpin
promoter, a hybrid CMV promoter, a hybrid .beta.-actin promoter, an
EF1 promoter, a U1a promoter, a U1b promoter, a Tet-inducible
promoter, a VP16-LexA promoter, or any combination thereof. In
exemplary embodiments, the promoter may include a mammalian or
avian .beta.-actin promoter.
[0041] The first nucleic acid segment may also further include one
or more post-transcriptional regulatory sequences or one or more
polyadenylation signals, including, for example, but not limited
to, a woodchuck hepatitis virus post-transcription regulatory
element, a polyadenylation signal sequence, or any combination
thereof.
[0042] Exemplary diagnostic or therapeutic agents deliverable to
host cells by the present vector constructs include, but are not
limited to, an agent selected from the group consisting of a
polypeptide, a peptide, an antibody, an antigen binding fragment, a
ribozyme, a peptide nucleic acid, a siRNA, an RNAi, an antisense
oligonucleotide, an antisense polynucleotide, and any combination
thereof.
[0043] In exemplary embodiments, the improved rAAV vectors of the
invention will preferably encode at least one diagnostic or
therapeutic protein or polypeptide selected from the group
consisting of a molecular marker, an adrenergic agonist, an
anti-apoptosis factor, an apoptosis inhibitor, a cytokine receptor,
a cytokine, a cytotoxin, an erythropoietic agent, a glutamic acid
decarboxylase, a glycoprotein, a growth factor, a growth factor
receptor, a hormone, a hormone receptor, an interferon, an
interleukin, an interleukin receptor, a kinase, a kinase inhibitor,
a nerve growth factor, a netrin, a neuroactive peptide, a
neuroactive peptide receptor, a neurogenic factor, a neurogenic
factor receptor, a neuropilin, a neurotrophic factor, a
neurotrophin, a neurotrophin receptor, an N-methyl-D-aspartate
antagonist, a plexin, a protease, a protease inhibitor, a protein
decarboxylase, a protein kinase, a protein kinase inhibitor, a
proteolytic protein, a proteolytic protein inhibitor, a semaphorin,
a semaphorin receptor, a serotonin transport protein, a serotonin
uptake inhibitor, a serotonin receptor, a serpin, a serpin
receptor, a tumor suppressor, and any combination thereof.
[0044] In certain applications, the capsid-modified rAAV vectors of
the present invention may include one or more nucleic acid segments
that encode a polypeptide selected from the group consisting of
BDNF, CNTF, CSF, EGF, FGF, G-SCF, GM-CSF, gonadotropin, IFN, IFG-1,
M-CSF, NGF, PDGF, PEDF, TGF, TGF-B2, TNF, VEGF, prolactin,
somatotropin, XIAP1, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-8, IL-9, IL-10, IL-10(I87A), viral IL-10, IL-11, IL-12, IL-13,
IL-14, IL-15, IL-16, IL-17, IL-18, and any combination thereof.
[0045] In another embodiment, the invention concerns
genetically-modified improved transduction-efficiency rAAV vectors
that include at least a first nucleic acid segment that encodes one
or more therapeutic agents that alter, inhibit, reduce, prevent,
eliminate, or impair the activity of one or more endogenous
biological processes in the cell. In particular embodiments, such
therapeutic agents may be those that selectively inhibit or reduce
the effects of one or more metabolic processes, dysfunctions,
disorders, or diseases. In certain embodiments, the defect may be
caused by injury or trauma to the mammal for which treatment is
desired. In other embodiments, the defect may be caused the
over-expression of an endogenous biological compound, while in
other embodiments still; the defect may be caused by the
under-expression or even lack of one or more endogenous biological
compounds.
[0046] When the use of such vectors is contemplated for
introduction of one or more exogenous proteins, polypeptides,
peptides, ribozymes, siRNAs, and/or antisense oligonucleotides, to
a particular cell transfected with the vector, one may employ the
modified AAV vectors disclosed herein by incorporating into the
vector at least a first exogenous polynucleotide operably
positioned downstream and under the control of at least a first
heterologous promoter that expresses the polynucleotide in a cell
comprising the vector to produce the encoded therapeutic agent,
including for example, peptides, proteins, polypeptides,
antibodies, ribozymes, siRNAs, and antisense oligo- or
polynucleotides.
[0047] The genetically-modified rAAV vectors and expression systems
of the present invention may also further optionally include a
second distinct nucleic acid segment that comprises, consists
essentially of, or consists of, one or more enhancers, one or more
regulatory elements, one or more transcriptional elements, or any
combination thereof, that alter, improve, regulate, and/or affect
the transcription of the nucleotide sequence of interest expressed
by the modified rAAV vectors.
[0048] For example, the rAAV vectors of the present invention may
further include a second nucleic acid segment that comprises,
consists essentially of, or consists of, a CMV enhancer, a
synthetic enhancer, a cell-specific enhancer, a tissue-specific
enhancer, or any combination thereof. The second nucleic acid
segment may also further comprise, consist essentially of, or
consist of, one or more intron sequences, one or more
post-transcriptional regulatory elements, or any combination
thereof.
[0049] The improved vectors and expression systems of the present
invention may also optionally further include a polynucleotide that
comprises, consists essentially of, or consists of, one or more
polylinkers, restriction sites, and/or multiple cloning region(s)
to facilitate insertion (cloning) of one or more selected genetic
elements, genes of interest, or therapeutic or diagnostic
constructs into the rAAV vector at a selected site within the
vector.
[0050] In further aspects of the present invention, the exogenous
polynucleotide(s) that may be delivered into suitable host cells by
the improved, capsid-modified, rAAV vectors disclosed herein are
preferably of mammalian origin, with polynucleotides encoding one
or more polypeptides or peptides of human, non-human primate,
porcine, bovine, ovine, feline, canine, equine, epine, caprine, or
lupine origin being particularly preferred.
[0051] The exogenous polynucleotide(s) that may be delivered into
host cells by the disclosed capsid-modified viral vectors may, in
certain embodiments, encode one or more proteins, one or more
polypeptides, one or more peptides, one or more enzymes, or one or
more antibodies (or antigen-binding fragments thereof), or
alternatively, may express one or more siRNAs, ribozymes, antisense
oligonucleotides, PNA molecules, or any combination thereof. When
combinational gene therapies are desired, two or more different
molecules may be produced from a single rAAV expression system, or
alternatively, a selected host cell may be transfected with two or
more unique rAAV expression systems, each of which may comprise one
or more distinct polynucleotides that encode a therapeutic
agent.
[0052] In other embodiments, the invention also provides
capsid-modified rAAV vectors that are comprised within an
infectious adeno-associated viral particle or a virion, as well as
pluralities of such virions or infectious particles. Such vectors
and virions may be comprised within one or more diluents, buffers,
physiological solutions or pharmaceutical vehicles, or formulated
for administration to a mammal in one or more diagnostic,
therapeutic, and/or prophylactic regimens. The vectors, virus
particles, virions, and pluralities thereof of the present
invention may also be provided in excipient formulations that are
acceptable for veterinary administration to selected livestock,
exotics, domesticated animals, and companion animals (including
pets and such like), as well as to non-human primates, zoological
or otherwise captive specimens, and such like.
[0053] The invention also concerns host cells that comprise at
least one of the disclosed capsid protein-modified rAAV expression
vectors, or one or more virus particles or virions that comprise
such an expression vector. Such host cells are particularly
mammalian host cells, with human host cells being particularly
highly preferred, and may be either isolated, in cell or tissue
culture. In the case of genetically modified animal models, the
transformed host cells may even be comprised within the body of a
non-human animal itself.
[0054] In certain embodiments, the creation of recombinant
non-human host cells, and/or isolated recombinant human host cells
that comprise one or more of the disclosed rAAV vectors is also
contemplated to be useful for a variety of diagnostic, and
laboratory protocols, including, for example, means for the
production of large-scale quantities of the rAAV vectors described
herein. Such virus production methods are particularly contemplated
to be an improvement over existing methodologies including in
particular, those that require very high titers of the viral stocks
in order to be useful as a gene therapy tool. The inventors
contemplate that one very significant advantage of the present
methods will be the ability to utilize lower titers of viral
particles in mammalian transduction protocols, yet still retain
transfection rates at a suitable level.
[0055] Compositions comprising one or more of the disclosed
capsid-modified, improved transduction-efficiency rAAV vectors,
expression systems, infectious AAV particles, or host cells also
form part of the present invention, and particularly those
compositions that further comprise at least a first
pharmaceutically-acceptable excipient for use in therapy, and for
use in the manufacture of medicaments for the treatment of one or
more mammalian diseases, disorders, dysfunctions, or trauma. Such
pharmaceutical compositions may optionally further comprise one or
more diluents, buffers, liposomes, a lipid, a lipid complex; or the
tyrosine-modified rAAV vectors may be comprised within a
microsphere or a nanoparticle.
[0056] Pharmaceutical formulations suitable for intramuscular,
intravenous, or direct injection into an organ or tissue or a
plurality of cells or tissues of a human or other mammal are
particularly preferred, however, the compositions disclosed herein
may also find utility in administration to discreet areas of the
mammalian body, including for example, formulations that are
suitable for direct injection into one or more organs, tissues, or
cell types in the body. Such injection sites include, but are not
limited to, the brain, a joint or joint capsule, a synovium or
subsynovium tissue, tendons, ligaments, cartilages, bone,
peri-articular muscle or an articular space of a mammalian joint,
as well as direct administration to an organ such as the heart,
liver, lung, pancreas, intestine, brain, bladder, kidney, or other
site within the patient's body, including, for example,
introduction of the viral vectors via intraabdominal,
intrathorascic, intravascular, or intracerebroventricular
delivery.
[0057] Other aspects of the invention concern recombinant
adeno-associated virus virion particles, compositions, and host
cells that comprise, consist essentially of, or consist of, one or
more of the capsid-modified, improved transduction efficiency, rAAV
vectors disclosed herein, such as for example pharmaceutical
formulations of the vectors intended for administration to a mammal
through suitable means, such as, by intramuscular, intravenous,
intra-articular, or direct injection to one or more cells, tissues,
or organs of a selected mammal. Typically, such compositions may be
formulated with pharmaceutically-acceptable excipients as described
hereinbelow, and may comprise one or more liposomes, lipids, lipid
complexes, microspheres or nanoparticle formulations to facilitate
administration to the selected organs, tissues, and cells for which
therapy is desired.
[0058] Kits comprising one or more of the disclosed capsid-modified
rAAV vectors (as well as one or more virions, viral particles,
transformed host cells or pharmaceutical compositions comprising
such vectors); and instructions for using such kits in one or more
therapeutic, diagnostic, and/or prophylactic clinical embodiments
are also provided by the present invention. Such kits may further
comprise one or more reagents, restriction enzymes, peptides,
therapeutics, pharmaceutical compounds, or means for delivery of
the composition(s) to host cells, or to an animal (e.g., syringes,
injectables, and the like). Exemplary kits include those for
treating, preventing, or ameliorating the symptoms of a disease,
deficiency, dysfunction, and/or injury, or may include components
for the large-scale production of the viral vectors themselves,
such as for commercial sale, or for use by others, including e.g.,
virologists, medical professionals, and the like.
[0059] Another important aspect of the present invention concerns
methods of use of the disclosed rAAV vectors, virions, expression
systems, compositions, and host cells described herein in the
preparation of medicaments for diagnosing, preventing, treating or
ameliorating at least one or more symptoms of a disease, a
dysfunction, a disorder, an abnormal condition, a deficiency,
injury, or trauma in an animal, and in particular, in a vertebrate
mammal. Such methods generally involve administration to a mammal
in need thereof, one or more of the disclosed vectors, virions,
viral particles, host cells, compositions, or pluralities thereof,
in an amount and for a time sufficient to diagnose, prevent, treat,
or lessen one or more symptoms of such a disease, dysfunction,
disorder, abnormal condition, deficiency, injury, or trauma in the
affected animal. The methods may also encompass prophylactic
treatment of animals suspected of having such conditions, or
administration of such compositions to those animals at risk for
developing such conditions either following diagnosis, or prior to
the onset of symptoms.
[0060] As described above, the exogenous polynucleotide will
preferably encode one or more proteins, polypeptides, peptides,
ribozymes, or antisense oligonucleotides, or a combination of
these. In fact, the exogenous polynucleotide may encode two or more
such molecules, or a plurality of such molecules as may be desired.
When combinational gene therapies are desired, two or more
different molecules may be produced from a single rAAV expression
system, or alternatively, a selected host cell may be transfected
with two or more unique rAAV expression systems, each of which will
provide unique heterologous polynucleotides encoding at least two
different such molecules.
[0061] Compositions comprising one or more of the disclosed rAAV
vectors, expression systems, infectious AAV particles, host cells
also form part of the present invention, and particularly those
compositions that further comprise at least a first
pharmaceutically-acceptable excipient for use in the manufacture of
medicaments and methods involving therapeutic administration of
such rAAV vectors. Such pharmaceutical compositions may optionally
further comprise liposomes, a lipid, a lipid complex; or the rAAV
vectors may be comprised within a microsphere or a nanoparticle.
Pharmaceutical formulations suitable for intramuscular,
intravenous, or direct injection into an organ or tissue of a human
are particularly preferred.
[0062] Another important aspect of the present invention concerns
methods of use of the disclosed vectors, virions, expression
systems, compositions, and host cells described herein in the
preparation of medicaments for treating or ameliorating the
symptoms of various polypeptide deficiencies in a mammal. Such
methods generally involve administration to a mammal, or human in
need thereof, one or more of the disclosed vectors, virions, host
cells, or compositions, in an amount and for a time sufficient to
treat or ameliorate the symptoms of such a deficiency in the
affected mammal. The methods may also encompass prophylactic
treatment of animals suspected of having such conditions, or
administration of such compositions to those animals at risk for
developing such conditions either following diagnosis, or prior to
the onset of symptoms.
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] For promoting an understanding of the principles of the
invention, reference will now be made to the embodiments, or
examples, illustrated in the drawings and specific language will be
used to describe the same. It will, nevertheless be understood that
no limitation of the scope of the invention is thereby intended.
Any alterations and further modifications in the described
embodiments, and any further applications of the principles of the
invention as described herein are contemplated as would normally
occur to one of ordinary skill in the art to which the invention
relates.
[0064] The following drawings form part of the present
specification and are included to demonstrate certain aspects of
the present invention. The invention may be better understood by
reference to the following description taken in conjunction with
the accompanying drawings, in which like reference numerals
identify like elements, and in which:
[0065] FIG. 1A, FIG. 1B, and FIG. 1C show the effect of NF-.kappa.B
pathway inhibitors and activator on AAV vector-mediated EGFP
expression in HeLa cells in vitro. Cells were pre-treated with
various concentrations of inhibitors and activators for 12 hrs and
transduced with 2.times.10.sup.3 AAV-EGFP vgs per cell. FIG. 1A
shows the transgene expression was detected by fluorescence
microscopy 48 hrs post-infection. Representative images are shown.
FIG. 1B shows the quantitative analyses of the data from FIG. 1A.
Images from five visual fields were analyzed as described.
*P<0.001. FIG. 1C is a Western blot analysis of HeLa cell
extracts transduced with scAAV vectors and in the presence of
NF-.kappa.B modulators. The samples were analyzed by using anti-p65
and anti-I.kappa.B antibodies [classical pathway], anti-p100/p52
antibody [non-canonical pathway] for detection NF-.kappa.B
signaling in response to AAV exposure. These results are
representative of two independent experiments;
[0066] FIG. 2A and FIG. 2B show AAV-EGFP vector-mediated
transduction of primary human monocytes-derived dendritic cells in
the presence of NF-.kappa.B modulators. FIG. 2A shows the transgene
expression was detected by flow cytometry 48 hrs post-transduction.
FIG. 2B is a Western blot analysis for components of classical and
non-canonical pathway of NF-.kappa.B activation in nuclear extracts
from dendritic cells, mock-transduced or transduced with 2,000
vgs/cell of scAAV vectors and in the presence of NF-.kappa.B
modulators;
[0067] FIG. 3A and FIG. 3B show AAV vector-induced innate immune
and NF-.kappa.B response in mice in vivo. Gene expression profiling
of innate immune mediators (FIG. 3A) or NF-.kappa.B activation
(FIG. 3B) was performed as described. The data for fold changes in
gene expression at the 2-hr time-point comparing AAV vectors with
Bay11 (hatched or open bars) with AAV vectors without Bay11 (black
or grey bars) are shown. The minimal threshold fold-increase
(horizontal black line) was 2.5 (FIG. 3A) or 3.0 (FIG. 3B) by
measuring the variability of duplicate .DELTA.CT (compared to
GAPDH, 2 .sup.-.DELTA.CT(variability));
[0068] FIG. 4A and FIG. 4B illustrate transgene expression in
murine hepatocytes 10 days post-injection of 1.times.10.sup.11 vgs
each of WT-scAAV-EGFP or TM-scAAV-EFGP vectors/animal via the
tail-vein. FIG. 4A shows representative images are shown. Original
magnification: .times.400. FIG. 4B shows the quantitative analyses
of the data from FIG. 4A. Images from five visual fields were
analyzed quantitatively as described in the legend to FIG. 1A;
[0069] FIG. 5 demonstrates that AAV genome contains putative
binding sites for NF-.kappa.B-responsive transcription factors
within the inverted terminal repeats (ITRs). The putative
NF-.kappa.B-responsive transcription factor-binding sites in the
AAV-ITRs were identified by in silico analysis using the web-based
TRANSFAC database. The binding sites for p300, TFIIB, and SpII
transcriptions factors are denoted by green, red, and blue
underlined fonts, respectively. The boxed sequence represents the
20-nucleotide, single-stranded D-sequence within the ITR;
[0070] FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D, and FIG. 6E show the
effect of NF-.kappa.B activators and inhibitors on transgene
expression from an AAV2-EGFP vector in HeLa cells in vitro. Cells
were either mock-treated or pretreated with various combinations of
inhibitors and activators for 12 hr. Washed cells were infected
with 2.times.10.sup.3 vg/cell of scAAV2-EGFP (FIG. 6A), ssAAV2-EGFP
(FIG. 6B), or TM-scAAV2-EGFP (FIG. 6C). Transgene expression was
detected by fluorescence microscopy 48-hrs' postinfection.
Representative images are shown; Western blot analysis of
cytoplasmic (FIG. 6D) and nuclear (FIG. 6E) extracts from HeLa
cells transduced with scAAV vectors and in the presence of
NF-.kappa.B modulators. The samples were analyzed by using
anti-p100/p52 antibody for detection of NF-.kappa.B signaling.
Anti-GAPDH and lamin B antibodies were used as appropriate
controls. These results are representative of two independent
experiments;
[0071] FIG. 7 shows a Western blot analysis of liver homogenates
from mice following mock-injections (n=2), or injections with scAAV
vectors, with and without prior administration of Bay11 (n=3 each).
The samples were analyzed by using anti-p52 antibody for detection
NF-.kappa.B signaling in response to AAV exposure.
Anti-.beta.-actin antibody was used as a loading control;
[0072] FIG. 8A, FIG. 8B, FIG. 8C, FIG. 8D, FIG. 8E, and FIG. 8F
show fold changes in gene expression of various
cytokines/chemokines from total mRNA collected from liver samples
from animals injected with the WT-AAV or the TM-AAV vectors,
following PBS- or Bay11-pre-treatment. FIG. 8A: IL-1.alpha.; FIG.
8B: IL-6; FIG. 8C: TNF-.alpha.; FIG. 8D: IL-12.alpha., FIG. 8E: KC;
and FIG. 8F: RANTES. Values are significant above 2.6 and below
0.38; calculated by determining the variability in the 96-well
plates used to measure specific gene expression;
[0073] FIG. 9 demonstrates humoral response to AAV vectors in the
absence or presence of NF-kB inhibitor. Anti-AAV2 IgG2a levels were
determined in peripheral blood from mice at day 10 following
injections with scAAV vectors, with and without prior
administration of Bay11 (n=4 each);
[0074] FIG. 10 illustrate electrophoretic mobility-shift assays
carried out with whole-cell extracts prepared from HeLa cells and
.sup.32P-labeled single-stranded D[+]-sequence probe (lane 1),
which interacted with a host cell protein (lane 3, arrowhead).
Single-stranded D[-]-sequence (lane 2) probe was used as an
appropriate control, which also interacted with a cellular protein,
FKBP52 (lane 4, arrow). Binding assays were also carried out using
biotin-labeled ssD[+]-sequence probe followed by selection with
streptavidin-beads, and fractionation by SDS-polyacrylamide gel
electrophoresis. The relevant protein band was visualized by silver
staining, excised from the gel, and subjected to mass spectrometry,
and one of the unique peptides was found to share homology with the
NF-.kappa.B-repressing factor (NRF);
[0075] FIG. 11A and FIG. 11B show the analysis of AAV3-mediated
transgene expression in T47D and T47D+hHGFR cells. FIG. 11A shows
equivalent numbers of T47D and T47D+hHGFR cells were infected with
various indicated multiplicity-of-infection (MOI) of
scAAV3-CBAp-EGFP vectors under identical conditions. Transgene
expression was determined by fluorescence microscopy 72 hrs
post-infection. FIG. 11B shows T47D+hHGFR cells were transduced
with 2,000 vgs/cell of scAAV3 vectors in the absence or the
presence of 5 .mu.g/mL of hHGF. Transgene expression was determined
by fluorescence microscopy 72-hrs' post-infection;
[0076] FIG. 12A, FIG. 12B and FIG. 12C show the effect of
BMS-777607 on AAV3-mediated transgene expression. FIG. 12A shows
T47D+hHGFR cells, either mock-treated or treated with various
concentration of BMS-777607, that were infected with 2,000 vgs/cell
of scAAV3-CBAp-EGFP vectors. Transgene expression was determined by
fluorescence microscopy 72 hrs' post-infection. FIG. 12B
illustrates T47D and T47D+hHGFR cells were infected with 10,000
vgs/cell of scAAV3-CBAp-EGFP vectors in the absence or the presence
of 1 .mu.M of BMS-777607. FIG. 12C shows T47D and T47D+hHGFR cells
were mock-treated or pretreated with BMS-777607 for two hrs.
Whole-cell lysates were prepared and analyzed on Western blots
using various indicated primary antibodies. .beta.-actin was used
as a loading control;
[0077] FIG. 13A and FIG. 13B show the effect of BMS-777607 on
various AAV serotype-mediated transgene expression. In FIG. 13A,
T47D+hHGFR cells, either mock-treated or treated with 1 .mu.M of
BMS-777607, were infected with 2,000 vgs/cell of either scAAV2-,
scAAV3- or scAAV4-CBAp-EGFP vectors. In FIG. 13B, T47D+hHGFR cells,
either mock-treated or treated with 1 .mu.M of BMS-777607, were
infected with 2,000 vgs/cell of either scAAV5-, scAAV7-, scAAV8- or
scAAV9-CBAp-EGFP vectors. Transgene expression was determined by
fluorescence microscopy 72 hrs post-infection;
[0078] FIG. 14A, FIG. 14B, FIG. 14C and FIG. 14D show the
comparative analyses of AAV3-mediated transduction efficiency in
Huh7 and Hep293TT cells with or without treatment with MG132. In
FIG. 14A, HeLa cells, either mock-treated or treated with 5 .mu.M
of MG132, were infected with scAAV2-CBAp-EGFP vectors. In FIG. 14B,
Huh7 and Hep293TT cells, either mock-treated or treated with
various concentration of MG132, were infected with
scAAV3-WT-CBAp-EGFP vectors. In FIG. 14C, HeLa cells, either
mock-treated or treated with 200 .mu.M of Tyr23, were infected by
scAAV2-CBAp-EGFP vectors. In FIG. 14D, Hep293TT cells, either
mock-treated or treated with Tyr23, were infected by
scAAV3-CBAp-EGFP vectors. Transgene expression was determined 72
hrs' post-transduction;
[0079] FIG. 15A, FIG. 15B and FIG. 15C show the site-directed
mutational analyses of surface-exposed tyrosine residues on AAV3
capsids. Huh7 cells were transduced with WT or F501Y
scAAV3-CBAp-EGFP vectors under identical conditions, and transgene
expression was determined 72 hrs' post-transduction. Transduction
efficiency of WT (FIG. 15A) and various Y-F scAAV3-mediated
transgene expression in Huh7 (FIG. 15B) and Hep293TT (FIG. 15C)
cells are shown. Transgene expression was determined 72 hrs
post-transduction;
[0080] FIG. 16A, FIG. 16B, and FIG. 16C illustrate the transduction
efficiency of WT and single, double, and triple tyrosine-mutant
AAV3 vectors. In FIG. 16A, Huh7 cells were transduced with WT or
various indicated Y-F mutant scAAV3-CBAp-EGFP vectors under
identical conditions. Transgene expression was determined 72-hrs'
post-transduction. In FIG. 16B, Huh7 cells were transduced with
5,000 vgs/cell of WT or Y.fwdarw.F mutated scAAV3 vectors in the
absence or the presence of 5 .mu.g/mL of hHGF. FIG. 16C shows
transgene expression was determined by fluorescence microscopy 72
hrs post-infection;
[0081] FIG. 17A, FIG. 17B, FIG. 17C and FIG. 17D show the
transduction efficiency of AAV3 vectors in vivo following direct
intra-tumor injections. Transduction efficiency of WT-AAV3 vectors
in Huh7- (FIG. 17A) and Hep293TT- (FIG. 17B) derived tumors in NSG
mice is shown. The transduction efficiency of WT- (FIG. 17C) and
Y705+731F-AAV3 (FIG. 17D) vectors in Hep293TT-derived tumors are
also shown in NSG mice. EGFP fluorescence (green) and DAPI staining
(blue) of two representative tumor sections from each set of mice
is shown;
[0082] FIG. 18A, FIG. 18B and FIG. 18C illustrate the transduction
efficiency of WT- and Y705+731F-AAV3 vectors in Hep293TT-derived
tumors in NSG mice following tail-vein injections. EGFP
fluorescence (green) and DAPI staining (blue) of tumor in three
representative tumor sections from each set of mice injected with
PBS (FIG. 18A), WT-AAV3 (FIG. 18B), or Y705+731F-AAV3 (FIG. 18C)
vectors is shown;
[0083] FIG. 19A and FIG. 19B show the effect of various kinase
inhibitors on ssAAV and scAAV mediated EGFP expression in HEK293
cells. Cells were pretreated with inhibitors for 1 hr before
infection then transduced with 1.times.10.sup.3 vgs/cell. In FIG.
19A, transgene expression was detected by fluorescence microscopy
48 hrs post infection. In FIG. 19B, images from three visual fields
were analyzed as described. *P<0.005, **P<0.001 vs. WT
AAV2;
[0084] FIG. 20A and FIG. 20B show the analysis of EGFP expression
after transduction of HEK293 cells with individual site-directed
scAAV2 capsid mutants. Each of the 15 surface-exposed serines (S)
in the AAV2 capsid was substituted with valine (V), and then
evaluated for its efficiency to mediate transgene expression. FIG.
20A shows the EGFP expression analysis at 48 hrs post-infection at
an MOI of 1.times.10.sup.3 vgs/cell. FIG. 20B shows the
quantitation of transduction efficiency of each of the
serine-mutant AAV2 vectors. *P<0.005, **P<0.001 vs. WT
AAV2;
[0085] FIG. 21 and FIG. 21B illustrate the structure of AAV2. In
FIG. 21A, a trimer of the AAV2 VP3 shown in ribbon representation
and viewed down the icosahedral threefold axis (left) and rotated
90.degree. (right) with VP monomers colored in blue, purple and
light blue showing the location of serine residues 458, 492, and
662 in the yellow, green, and red spheres, respectively. The
approximate positions of the icosahedral two-, three-, and
five-fold axes are depicted by the filled oval, triangle, and
pentagon, respectively. In FIG. 21B, the capsid surface of AAV2
shown in blue with serine residues 458, 492, and 662 highlighted in
the same colors as shown previously in similar figures. The S458
and S492 residues are located adjacent to each other on the outer
surface of the protrusions facing the depression surrounding the
two-fold axes. S662 is located on the HI loop (colored white)
(between the .beta.-H and .beta.-I strands of the core
eight-stranded beta-barrel) which lie on the floor of the
depression surrounding the icosahedral five-fold axes. The
five-fold symmetry related DE loops (between the .beta.-D and
.beta.-E strands), which form the channel at the icosahedral 5-fold
axes, are shown in brown. The approximate positions of an
icosahedral two-fold (2F), three-fold (3F), and five-fold (5F) axes
are indicated by the open arrows;
[0086] FIG. 22A and FIG. 22B summarize the evaluation of the effect
of serine substitution at position 662 in the scAAV2 capsid with
different amino acids in mediating transgene expression. The
following eight serine mutants were generated with different amino
acids: S662.fwdarw.Valine (V), S662.fwdarw.Alanine (A),
S662.fwdarw.Asparagine (N), S662.fwdarw.Aspartic acid (D),
S662.fwdarw.Histidine (H), S662.fwdarw.Isoleucine (I),
S662.fwdarw.Leucine (L), and S662.fwdarw.Phenylalanine (F), and
their transduction efficiency in 293 cells was analyzed. FIG. 22A
shows the EGFP expression analysis at 48 h after infection of 293
cells at an MOI of 1.times.10.sup.3 vgs/cell. FIG. 22B shows the
quantitation of the transduction efficiency of each of the
serine-mutant AAV2 vectors. *P<0.005, **P<0.001 vs. WT
AAV2;
[0087] FIG. 23A and FIG. 23B show the analysis of correlation of
transduction efficiency of scAAV2-S662V vectors with p38 MAPK
activity in various cell types. FIG. 23A illustrates the
quantitation of the transduction efficiency of WT- and S662V-AAV2
vectors in HEK293, HeLa, NIH3T3, H2.35 and moDCs. FIG. 23B is a
Western blot analysis of lysates from different cell lines for
p-p38 MAPK expression levels. Total p38 MAPK and GAPDH levels were
measured and used as loading controls. *P<0.005, **P<0.001
vs. WT AAV2;
[0088] FIG. 24A, FIG. 24B, and FIG. 24C illustrate scAAV
vector-mediated transgene expression in monocyte-derived dendritic
cells (moDCs). FIG. 24A illustrates the effect of JNK and p38 MAPK
inhibitors, and site-directed substitution of the serine residue at
position 662 on EGFP expression. FIG. 24B summarizes the
quantitation of data from FIG. 24A at 48 hrs after infection and
initiation of maturation. FIG. 24C is an analysis of expression of
co-stimulatory markers such as CD80, CD83, CD86 in moDCs infected
with scAAV2-S662V vectors at an MOI of 5.times.10.sup.4 vgs/cell.
iDCs--immature dendritic cells, and mDCs--mature dendritic cells,
stimulated with cytokines, generated as described herein, were used
as negative and positive controls, respectively. A representative
example is shown. *P<0.005, **P<0.001 vs. WT AAV2;
[0089] FIG. 25 illustrates analysis of hTERT-specific cytotoxic
T-lymphocytes (CTLs) killing activity on K562 cells. CTLs were
generated after transduction of moDCs by scAAV2-S662V vectors
encoding the truncated human telomerase (hTERT). scAAV2-S662V-EGFP
vector-traduced moDCs were used to generate non-specific CTLs.
Pre-stained with 3,3-dioctadecyloxacarbocyanine (DiOC18(3)), a
green fluorescent membrane stain, 1.times.10.sup.5 target K562
cells were co-cultured overnight with different ratios of CTLs
(80:1, 50:1, 20:1, 10:1, 5:1). Membrane-permeable nucleic acid
counter-stain, propidium iodide, was added to label the cells with
compromised plasma membranes. Percentages of killed, double
stain-positive cells were analyzed by flow cytometry;
[0090] FIG. 26A and FIG. 26B show the analysis of EGFP expression
after transduction of HEK293 cells with individual site-directed
AAV2 capsid mutants. Each of the 17 surface-exposed threonine (T)
residues in AAV2 capsid was substituted with valine (V) and
evaluated for its efficiency to mediate transgene expression. In
FIG. 26A, EGFP expression analysis at 48-hrs' post-infection is
shown (MOI of 1.times.10.sup.3 vg/cell). FIG. 26B shows the
quantification of transduction efficiency of each of the
threonine-mutant scAAV2 vectors. *P<0.005, **P<0.001 vs. WT
AAV2;
[0091] FIG. 27A and FIG. 27B show the analysis of EGFP expression
in HEK293 cells infected with multiple site-directed AAV2 capsid
mutants. Several most efficient threonine mutations were combined
on single AAV2 capsid to produce double- and triple-mutant and
efficiency of each vector was evaluated. FIG. 27A illustrates EGFP
expression analysis at 48 hrs' post-infection at MOI of
1.times.10.sup.3 vg/cell. FIG. 27B shows the quantification of
transduction efficiency of each of the threonine-mutant AAV2
vectors. *P<0.005, **P<0.001 vs. WT AAV2;
[0092] FIG. 28A and FIG. 28B demonstrate the evaluation of EGFP
expression in H2.35 cell transduced with capsid optimized AAV2
vectors. The most efficient tyrosine, serine and threonine
mutations were combined on single AAV2 capsid to produce several
optimized AAV mutants. Efficiency of each vector was estimated on
immortalized murine hepatocytes. FIG. 28A shows EGFP expression
analysis at 48 hrs' post-infection at MOI of 1.times.10.sup.3
vg/cell. FIG. 28B summarizes the quantification of transduction
efficiency of each of the optimized scAAV2 vectors. *P<0.005,
**P<0.001 vs. WT AAV2;
[0093] FIG. 29A and FIG. 29B illustrate the kinetics of EGFP
expression in H2.35 cell mediated by capsid optimized AAV vectors.
FIG. 29A shows EGFP expression analysis at 16, 24 and 48 hrs'
post-infection at MOI of 1.times.10.sup.3 vg/cell. FIG. 29B
illustrates results from quantification of transduction efficiency
of each of the optimized scAAV2 vectors. *P<0.005, **P<0.001
vs. WT AAV2;
[0094] FIG. 30A and FIG. 30B show the analysis of intracellular
trafficking of AAV multiple mutant vectors to the nucleus. Nuclear
and cytoplasmic fractions of H2.35 cell infected with AAV2-WT,
AAV2-Y444F+Y500F+Y730F or the AAV2-Y444F+Y500F+Y730F+T491V
multi-mutant were separated and qPCR analysis was performed to
evaluate vector genome distribution within cells at 16 hrr (FIG.
30A) and 48 hrr (FIG. 30B) post infection. **P<0.001 vs. WT in
nucleus was considered as significant;
[0095] FIG. 31A and FIG. 31B show the in vivo imaging of luciferase
gene expression following tail vein injection of multiple
site-directed AAV2 capsid mutants. C57BL/6 mice were injected with
1.times.10.sup.10 vg/animal of several most efficient mutant scAAV
vectors carrying luciferase gene. Live images were taken to
analyses difference in luciferase activity. The visual output
represents the number of photons emitted/second/cm.sup.2 as a false
color image where the maximum is red and the minimum is blue (FIG.
31A) and relative signal intensity (FIG. 31B) *P<0.005 was
considered as significant;
[0096] FIG. 32A and FIG. 32B illustrate the AAV2 capsid surface.
FIG. 32A shows the capsid surface of AAV2 (grey) with the 17
surface threonine residues mutated in blue (251, 329, 330, 454,
503, 581, 592, 597, 660, 671, 701, 713, 716), green (455), yellow
(491), brown (550), and pink (659). The surface location of T329,
T330, T713 and T716 are indicated by arrows. The five-fold symmetry
related DE loops (between the .beta.D and .beta.E strands) are
colored in orange. The HI loops (between the .beta.H and .beta.I
strands) are colored white and S662 located in this loop is in red.
The white dashed triangle in FIG. 32A depicts a viral asymmetric
unit bounded by a five-fold axis and two three-fold axes with a
two-fold axis between the three-folds. Dashed ovals delineate the
approximate footprints (2/60) of threonine residues that affect
transduction when mutated. FIG. 32B shows a "roadmap" projection of
the AAV2 capsid surface residues within a viral asymmetric unit.
The areas covered by AAV2 surface threonines and S662 are colored
as in FIG. 32A. The residues in the tyrosine triple mutant
residues, 444, 500, and 730 are shown in shades of purple. Dashed
ovals are as described in FIG. 23A. Dashed rectangle (blue) shows
residues previously determined to be important in heparin sulfate
receptor binding for AAV2 and AAV6 (Wu et al., 2006; Opie et al.,
2003);
[0097] FIG. 33A, FIG. 33B, and FIG. 33C illustrate the amino acid
alignment of the wild-type capsids from serotypes AAV1 through
AAV10. FIG. 33A shows amino acid alignment of the wild-type AAV1-10
serotype capsids (SEQ ID NO:1 through SEQ ID NO:10). FIG. 33B shows
amino acid alignment of the wild-type AAV1-AAV10 serotype capsids,
as well as surface-exposed serine and threonine residues that are
conserved in among AAV1-AAV10 capsids (conserved, surface-exposed
residues are shown in bold); and FIG. 33C shows conserved,
surface-exposed tyrosine residues in the wild-type AAV1-AAV12
capsids, as well as embodiments of amino acid modifications. The
tyrosine residues conserved among AAV1-AAV12 are shown in bold;
[0098] FIG. 34 show packaging and transduction efficiencies of
various serine.fwdarw.valine mutated AAV2 vectors relative to that
of WT AAV2 vectors and the amino acid alignment of wild-type
AAV1-AAV10 capsids;
[0099] FIG. 35 depicts packaging and transduction efficiencies of
serine-mutant vectors replaced with various samino acids relative
to WT AAV2 vectors;
[0100] FIG. 36A, FIG. 36B, FIG. 36C, FIG. 36D, and FIG. 36E show
transduction efficiency of rAAV3 and rAAV8 vectors in human HCC
tumors in a murine xenograft model in vivo. Female and male Huh7
tumor-bearing NSG mice were used for tail-vein injection with
either rAAV3-CBAp-FLuc or rAAV8-CBAp-FLuc vectors at
1.times.10.sup.11 vgs/mouse. n=4 per group. FIG. 36A shows
representative images of mouse whole body bioluminescent images at
3 days post-vector administration are shown. FIG. 36B illustrates
the quantitative analysis of transgene expression data from whole
body bioluminescent images of mice at 3-days' post-vector
administration. FIG. 36C shows Huh7 tumor-bearing male NSG mice
were used for direct intra-tumor injections with either
rAAV3-CBAp-FLuc or rAAV8-CBAp-FLuc vectors at a lower dose of
1.times.10.sup.11 vgs/mouse (L) or at a higher dose of
1.times.10.sup.12 vgs/mouse (H). n=4 per group. Representative
images of lower dose at 7 days post-vector administration are
shown. FIG. 36D presents the quantitative data for transgene
expression in tumors and liver from mice injected with rAAV3 or
rAAV8 vectors at 3 days or 7 days post-vector administration. FIG.
36E shows vector genome copy numbers persisting in the liver tissue
samples from mice injected with higher dose of rAAV3 or rAAV8
vectors 7 days post-vector administration;
[0101] FIG. 37A, FIG. 37B, FIG. 37C, FIG. 37D, FIG. 37E, and FIG.
37F show transduction efficiency of WT and capsid-modified rAAV3
vectors in human liver cancer cells in vitro. FIG. 37A shows Huh7
cells were transduced with the indicated viral vectors carrying the
CBAp-FLuc expression cassette at 5,000 vgs/cell. FIG. 37B shows
HepG2 cells and FIG. 37C shows Hep293TT cells were transduced with
the indicated viral vectors carrying the CBAp-EGFP expression
cassette at 5,000 vgs/cell. FIG. 37D shows Huh7 cells were
transduced with the indicated viral vectors carrying the CBAp-EGFP
expression cassette at 5,000 vgs/cell either in the absence or
presence of low (100 ng/mL) or high (100 .mu.g/mL) doses of soluble
heparin. FIG. 37E shows Huh7 cells were transduced with the
indicated viral vectors carrying the CBAp-EGFP expression cassette
at 5,000 vgs/cell in either the absence or presence of 5 .mu.g/mL
hHGF. FIG. 37F shows human T47D cells or T47D+hHGFR cells were
transduced with indicated viral vectors carrying the CBAp-EGFP
expression cassette at 5,000 vgs/cell. All transgene expression
levels were determined 48 hrs post-transduction;
[0102] FIG. 38A, FIG. 38B, FIG. 38C, and FIG. 38D show transduction
efficiency of exemplary rAAV3 capsid-mutated vectors in vivo. FIG.
38A shows human Huh7- or Hep293TT liver tumor-bearing NSG mice were
used for tail-vein injections with the indicated mutant viral
vectors carrying the CBAp-FLuc expression cassette at
5.times.10.sup.10 vgs/mouse. n=4 per each group. On Day 3, mouse
whole-body bioluminescent images were obtained, followed by
dissection of both growing tumor and normal liver. Representative
images are shown. FIG. 38B shows quantitative data showing FLuc
expression in Huh7- and Hep293TT-derived tumors. Vector genome copy
numbers are shown in Huh7 tumors (FIG. 38C), and in normal livers
(FIG. 38D);
[0103] FIG. 39A, FIG. 39B and FIG. 39C show exemplary embodiments
of the present invention. FIG. 39A shows suppression of human liver
tumorigenesis in a murine xenograft model by optimized rAAV3
vectors expressing the TCS gene; FIG. 39B and FIG. 39C show results
of Huh7-FLuc tumor-bearing mice were used for tail-vein injections
with the indicated viral vectors at 5.times.10.sup.10 vgs/mouse at
Day 0, and tumor growth was monitored over time until Day 11. FIG.
39B depicts representative whole-body bioluminescence images of
mice from both groups at Day 8. FIG. 39C summarizes serum
activities of AST and ALT that were measured in rAAV3-TCS
vector-injected and rAAV3-EGFP vector-injected mice at Day 11 by
spectrophotometric methods. Data are presented as mean.+-.SD.
(n=5/group);
[0104] FIG. 40A, FIG. 40B and FIG. 40C show exemplary vector
constructs and polynucleotide sequences useful in accordance with
one aspect of the present invention. FIG. 40A shows the schematic
structures of the rAAV vectors used in these studies. HP: hairpin;
D: D-sequence in the AAV inverted terminal repeat (ITR); CBAp: CMV
enhancer/chicken .beta.-actin promoter; FLuc: firefly luciferase;
hGH (A)n: human growth hormone polyA sequence; HP-: hairpin
structure without the terminal resolution site (trs); EGFP:
enhanced green fluorescence protein; AFPp: human
.alpha.-fetoprotein promoter; TCS: Tricosanthin; FIG. 40B shows the
nucleotide sequence of the original TCS gene. The start codon (ATG)
and the stop codon (TAG) are shown in green and red fonts,
respectively. FIG. 40C shows the nucleotide sequence of the
FLAG-tagged TCS gene. The EcoRI and XhoI restriction enzyme sites
used for cloning the chemically synthesized TCS gene are shown in
bold italic font, respectively, and the FLAG-tag sequence
containing the stop codon (TAA) is underlined; and
[0105] FIG. 41 shows the transduction efficiency of various
single-, double-, and multiple-mutant scAAV3-CBAp-EGFP vectors in
human HCC cell line, Huh7.
BRIEF DESCRIPTION OF THE SEQUENCES
[0106] SEQ ID NO:1 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 1 (AAV1);
[0107] SEQ ID NO:2 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 2 (AAV2);
[0108] SEQ ID NO:3 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 3 (AAV3);
[0109] SEQ ID NO:4 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 4 (AAV4);
[0110] SEQ ID NO:5 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 5 (AAV5);
[0111] SEQ ID NO:6 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 6 (AAV6);
[0112] SEQ ID NO:7 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 7 (AAV7);
[0113] SEQ ID NO:8 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 8 (AAV8);
[0114] SEQ ID NO:9 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 9 (AAV9);
[0115] SEQ ID NO:10 is an amino acid sequence of the capsid protein
of the wild-type adeno-associated virus serotype 10 (AAV10);
[0116] SEQ ID NO:11 is an oligonucleotide primer sequence useful
according to the present invention;
[0117] SEQ ID NO:12 is an oligonucleotide primer sequence useful
according to the present invention;
[0118] SEQ ID NO:13 is an oligonucleotide primer sequence useful
according to the present invention;
[0119] SEQ ID NO:14 is an oligonucleotide primer sequence useful
according to the present invention;
[0120] SEQ ID NO:15 is an oligonucleotide primer sequence useful
according to the present invention;
[0121] SEQ ID NO:16 is an oligonucleotide primer sequence useful
according to the present invention;
[0122] SEQ ID NO:17 is an oligonucleotide primer sequence useful
according to the present invention;
[0123] SEQ ID NO:18 is an oligonucleotide primer sequence useful
according to the present invention;
[0124] SEQ ID NO:19 is an oligonucleotide primer sequence useful
according to the present invention;
[0125] SEQ ID NO:20 is an oligonucleotide primer sequence useful
according to the present invention;
[0126] SEQ ID NO:21 is an oligonucleotide primer sequence useful
according to the present invention;
[0127] SEQ ID NO:22 is a nucleic acid sequence containing the
putatitve binding site for NF-kB-responsive transcription factors
(See FIG. 5);
[0128] SEQ ID NO:23 is a single-stranded nucleic acid sequence
probe (see FIG. 10);
[0129] SEQ ID NO:24 is a double-stranded nucleic acid sequence
probe (see FIG. 10);
[0130] SEQ ID NO:25 is a single-stranded nucleic acid sequence
probe (see FIG. 10);
[0131] SEQ ID NO:26 is the nucleic acid sequence of the TCS gene
(see FIG. 40B); and
[0132] SEQ ID NO:27 is the nucleic acid sequence of the FLAG-tagged
TCS gene (see FIG. 40C).
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0133] Illustrative embodiments of the invention are described
below. In the interest of clarity, not all features of an actual
implementation are described in this specification. It will of
course be appreciated that in the development of any such actual
embodiment, numerous implementation-specific decisions must be made
to achieve the developers' specific goals, such as compliance with
system-related and business-related constraints, which will vary
from one implementation to another. Moreover, it will be
appreciated that such a development effort might be complex and
time-consuming, but would be a routine undertaking for those of
ordinary skill in the art having the benefit of this
disclosure.
[0134] Recombinant adeno-associated virus (AAV) vectors have been
used successfully for in vivo gene transfer in numerous
pre-clinical animal models of human disease, and have been used
successfully for long-term expression of a wide variety of
therapeutic genes (Daya and Berns, 2008; Niemeyer et al., 2009;
Owen et al., 2002; Keen-Rhinehart et al., 2005; Scallan et al.,
2003; Song et al., 2004). AAV vectors have also generated long-term
clinical benefit in humans when targeted to immune-privileged
sites, i.e., ocular delivery for Leber's congenital amaurosis
(Bainbridge et al., 2008; Maguire et al., 2008; Cideciyan et al.,
2008). A major advantage of this vector is its comparatively low
immune profile, eliciting only limited inflammatory responses and,
in some cases, even directing immune tolerance to transgene
products (LoDuca et al., 2009). Nonetheless, the therapeutic
efficiency, when targeted to non-immune privileged organs, has been
limited in humans due to antibody and CD8.sup.+ T cell responses
against the viral capsid, while in animal models, adaptive
responses to the transgene product have also been reported (Manno
et al., 2006; Mingozzi et al., 2007; Muruve et al., 2008;
Vandenberghe and Wilson, 2007; Mingozzi and High, 2007). These
results suggested that immune responses remain a concern for AAV
vector-mediated gene transfer.
[0135] Based on pre-clinical data from murine models (Snyder et
al., 1999), AAV was considered as minimally immunogenic for years,
due to absence of prior exposure of these antigens in these models
and the presence of variety of tolerance-inducing mechanisms
against the vector (Dobrzynski et al., 2004; Cao et al., 2007).
This was best illustrated in gene transfer studies in murine and
canine models of hemophilia B, which showed remarkable therapeutic
efficiency (5-25% of F.IX levels) and long-term (2-8 years) and
stable F.IX expression (Snyder et al., 1999). In the first clinical
trial using AAV to deliver the human F.IX gene to the liver in
subjects with hemophilia B, therapeutic levels (.about.11.8%) of
F.IX expression were observed at a high dose of vector
(2.times.10.sup.12 vgs/kg body weight) (Manno et al., 2006).
[0136] However, 4-6 weeks after gene transfer, an AAV
capsid-specific T cell response was observed that coincided with a
rise in liver transaminases and a drop in F.IX transgene expression
to baseline levels. This CD8.sup.+ T cell-mediated immune response
was unexpected (Mingozzi et al., 2007), as this had not been
observed in any pre-clinical animal models. This study and several
others have implicated the host inflammatory and innate immune
responses for cytotoxic T-lymphocyte mediated elimination of
transduced hepatocytes (Zhu et al., 2009; Li et al., 2009; Madsen
et al., 2009). Subsequently, a great deal of effort has been
devoted to circumvent the host immune response to AAV vectors.
These include the use of alternate naturally occurring AAV
serotypes such as AAV1 (Brantly et al., 2009; Cohn et al., 2007) or
AAV8 (Nathwani et al., 2006), the use of shuffled capsids (Gray et
al., 2010), or surface-exposed tyrosine-mutant AAV2 (Markusic et
al., 2010) vectors. In addition, strategies to counter the risks
associated with the immune response have included the use of
transgene constructs which have targeted expression in the host
tissue (Wang et al., 2010), or the development of transient
immune-suppression protocols (Jiang et al., 2006).
[0137] Although such strategies have incrementally improved the
safety of AAV gene transfer, their efficacy in humans remains to be
seen. For example, immune suppression with cyclosporine and MMF was
effective at lower AAV1 vector dose (3.times.10.sup.11 vg/kg) but
failed to prevent IFN-.alpha. CD8+ T cell responses against capsid
at high doses (1.times.10.sup.12 vg/kg) during muscle-directed gene
transfer in patients with lipoprotein lipase deficiency (Ross et
al., 2006). These data underscore the importance of pursuing
further studies on the biology of the virus-host cell interactions
to identify the first "danger signal" in response to AAV infection.
It was reasoned that understanding how the potential activity and
the selectivity of proteins associated with inflammatory and innate
immune response are regulated in host cells upon transduction with
AAV might offer clues to address obstacles of the host immune
response against the capsid and/or the transgene product. Although
compared with other viral vectors, AAV vectors are inefficient in
transducing professional APCs such as DCs, additional signals that
activate NF-.kappa.B would lead to increased transgene expression
in these cells, thereby increasing the risk of adaptive responses
to the transgene product.
[0138] Recombinant vectors based on AAV serotype 2 are currently in
use in a number of gene therapy clinical trials (Daya and Berns,
2008), and have recently shown remarkable efficacy in the treatment
of Leber's congenital amaurosis (Bainbridge et al., 2008; Cideciyan
et al., 2008; Maguire et al., 2008). However, concerns have been
raised with reference to the humoral response to AAV2 vectors based
on the high prevalence of sero-positivity in the general population
(.about.80 to 90%) (Boutin et al., 2008; Mendell et al., 2010;
Manno et al., 2006). The discovery of many novel AAV serotypes has
prompted the development of AAV vectors to circumvent this
potential problem (Muramatsu et al., 1996; Chiorini et al., 1997;
Chiorini et al., 199; Rutledge et al., 1998; Gao et al., 2002; Gao
et al., 2004).
[0139] For example, recombinant AAV8 vectors were recently reported
to be therapeutic in a mouse model of liver cancer (Kato et al.,
2006). However, several groups have described various strategies to
target human liver cancer cells in murine models using AAV2 vectors
(Su et al., 1996; Peng et al., 2000; Su et al., 2000; Ma et al.,
2005; Wang et al., 2005; Tse et al., 2008; Zhang et al., 2008;
Malecki et al., 2009; Wang et al., 2010). To identify the most
efficient AAV serotype to target human liver cancer cells, three
different human liver cancer cell lines were shown to be transduced
extremely efficiently by AAV3 vectors (Glushakova et al., 2009).
Human hepatocyte growth factor receptor (hHGFR) was subsequently
identified as a cellular co-receptor for AAV3 infection (Ling et
al., 2010). The precise role of hHGFR, especially the role of
tyrosine kinase activity associated with the intracellular domain
of hHGFR, in AAV3-mediated transduction initially remained unclear.
Data in Example 5 (see below) provided a more-detailed explanation
of AAV3-hHGFR interactions, and illustrated the development of
optimized capsid-mutated AAV3 vectors for use in targeting human
liver cancer cells.
[0140] rAAV Capsid Proteins
[0141] Supramolecular assembly of 60 individual capsid protein
subunits into a non-enveloped, T-1 icosahedral lattice capable of
protecting a 4.7-kb single-stranded DNA genome is a critical step
in the life-cycle of the helper-dependent human parvovirus,
adeno-associated virus2 (AAV2). The mature 20-nm diameter AAV2
particle is composed of three structural proteins designated VP1,
VP2, and VP3 (molecular masses of 87, 73, and 62 kDa respectively)
in a ratio of 1:1:18. Based on its symmetry and these molecular
weight estimates, of the 60 capsid proteins comprising the
particle, three are VP1 proteins, three are VP2 proteins, and
fifty-four are VP3 proteins. The employment of three structural
proteins makes AAV serotypes unique among parvoviruses, as all
others known package their genomes within icosahedral particles
composed of only two capsid proteins. The anti-parallel
.beta.-strand barreloid arrangement of these 60 capsid proteins
results in a particle with a defined tropism that is highly
resistant to degradation. Modification of one or more tyrosine
residues in one or more of the capsid proteins has been shown by
the inventors to achieve superior transfection at lower dose and
lower cost than conventional protocols. By site-specifically
modifying one or more tyrosine residues on the surface of the
capsid, the inventors have achieved significant improvement in
transduction efficiency.
[0142] Uses for Improved, Capsid-Modified rAAV Vectors
[0143] The present invention provides compositions including one or
more of the disclosed tyrosine-modified rAAV vectors comprised
within a kit for diagnosing, preventing, treating or ameliorating
one or more symptoms of a mammalian disease, injury, disorder,
trauma or dysfunction. Such kits may be useful in diagnosis,
prophylaxis, and/or therapy, and particularly useful in the
treatment, prevention, and/or amelioration of one or more symptoms
of cancer, diabetes, autoimmune disease, kidney disease,
cardiovascular disease, pancreatic disease, intestinal disease,
liver disease, neurological disease, neuromuscular disorder,
neuromotor deficit, neuroskeletal impairment, neurological
disability, neurosensory dysfunction, stroke, ischemia, eating
disorder, .alpha..sub.1-antitrypsin (AAT) deficiency, Batten's
disease, Alzheimer's disease, sickle cell disease,
.beta.-thalassamia, Huntington's disease, Parkinson's disease,
skeletal disease, trauma, pulmonary disease, or any combination
thereof.
[0144] The invention also provides for the use of a composition
disclosed herein in the manufacture of a medicament for treating,
preventing or ameliorating the symptoms of a disease, disorder,
dysfunction, injury or trauma, including, but not limited to, the
treatment, prevention, and/or prophylaxis of a disease, disorder or
dysfunction, and/or the amelioration of one or more symptoms of
such a disease, disorder or dysfunction. Exemplary conditions for
which rAAV viral based gene therapy may find particular utility
include, but are not limited to, cancer, diabetes, sickle cell
disease, .beta.-thalassamia, autoimmune disease, kidney disease,
cardiovascular disease, pancreatic disease, diseases of the eye,
intestinal disease, liver disease, neurological disease,
neuromuscular disorder, neuromotor deficit, neuroskeletal
impairment, neurological disability, neurosensory dysfunction,
stroke, .alpha..sub.1-antitrypsin (AAT) deficiency, Batten's
disease, ischemia, an eating disorder, Alzheimer's disease,
Huntington's disease, Parkinson's disease, skeletal disease,
pulmonary disease, and any combinations thereof.
[0145] The invention also provides a method for treating or
ameliorating the symptoms of such a disease, injury, disorder, or
dysfunction in a mammal. Such methods generally involve at least
the step of administering to a mammal in need thereof, one or more
of the tyrosine-modified rAAV vectors as disclosed herein, in an
amount and for a time sufficient to treat or ameliorate the
symptoms of such a disease, injury, disorder, or dysfunction in the
mammal.
[0146] Such treatment regimens are particularly contemplated in
human therapy, via administration of one or more compositions
either intramuscularly, intravenously, subcutaneously,
intrathecally, intraperitoneally, or by direct injection into an
organ or a tissue of the mammal under care.
[0147] The invention also provides a method for providing to a
mammal in need thereof, a therapeutically-effective amount of the
rAAV compositions of the present invention, in an amount, and for a
time effective to provide the patient with a
therapeutically-effective amount of the desired therapeutic
agent(s) encoded by one or more nucleic acid segments comprised
within the rAAV vector. Preferably, the therapeutic agent is
selected from the group consisting of a polypeptide, a peptide, an
antibody, an antigen-binding fragment, a ribozyme, a peptide
nucleic acid, an siRNA, an RNAi, an antisense oligonucleotide, an
antisense polynucleotide, a diagnostic marker, a diagnostic
molecule, a reporter molecule, and any combination thereof.
[0148] AAV Vector Compositions
[0149] One important aspect of the present methodology is the fact
that the improved rAAV vectors described herein permit the delivery
of smaller titers of viral particles in order to achieve the same
transduction efficiency as that obtained using higher levels of
conventional, non-surface capsid modified rAAV vectors. To that
end, the amount of AAV compositions and time of administration of
such compositions will be within the purview of the skilled artisan
having benefit of the present teachings. In fact, the inventors
contemplate that the administration of therapeutically-effective
amounts of the disclosed compositions may be achieved by a single
administration, such as for example, a single injection of
sufficient numbers of infectious particles to provide therapeutic
benefit to the patient undergoing such treatment. Alternatively, in
some circumstances, it may be desirable to provide multiple, or
successive administrations of the AAV vector compositions, either
over a relatively short, or over a relatively prolonged period, as
may be determined by the medical practitioner overseeing the
administration of such compositions. For example, the number of
infectious particles administered to a mammal may be approximately
10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12,
10.sup.13, or even higher, infectious particles/mL, given either as
a single dose (or divided into two or more administrations, etc.)
as may be required to achieve therapy of the particular disease or
disorder being treated. In fact, in certain embodiments, it may be
desirable to administer two or more different rAAV vector-based
compositions, either alone, or in combination with one or more
other diagnostic agents, drugs, bioactives, or such like, to
achieve the desired effects of a particular regimen or therapy. In
most rAAV-vectored, gene therapy-based regimens, the inventors
contemplate that lower titers of infectious particles will be
required when using the modified-capsid rAAV vectors described
herein, as compared to the use of equivalent wild-type, or
corresponding "un-modified" rAAV vectors.
[0150] As used herein, the terms "engineered" and "recombinant"
cells are intended to refer to a cell into which an exogenous
polynucleotide segment (such as DNA segment that leads to the
transcription of a biologically active molecule) has been
introduced. Therefore, engineered cells are distinguishable from
naturally occurring cells, which do not contain a recombinantly
introduced exogenous DNA segment. Engineered cells are, therefore,
cells that comprise at least one or more heterologous
polynucleotide segments introduced through the hand of man.
[0151] To express a therapeutic agent in accordance with the
present invention one may prepare a tyrosine-modified rAAV
expression vector that comprises a therapeutic agent-encoding
nucleic acid segment under the control of one or more promoters. To
bring a sequence "under the control of" a promoter, one positions
the 5' end of the transcription initiation site of the
transcriptional reading frame generally between about 1 and about
50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter.
The "upstream" promoter stimulates transcription of the DNA and
promotes expression of the encoded polypeptide. This is the meaning
of "recombinant expression" in this context. Particularly preferred
recombinant vector constructs are those that comprise an rAAV
vector. Such vectors are described in detail herein.
[0152] When the use of such vectors is contemplated for
introduction of one or more exogenous proteins, polypeptides,
peptides, ribozymes, and/or antisense oligonucleotides, to a
particular cell transfected with the vector, one may employ the
capsid-modified rAAV vectors disclosed herein to deliver one or
more exogenous polynucleotides to a selected host cell.
[0153] Pharmaceutical Compositions
[0154] The genetic constructs of the present invention may be
prepared in a variety of compositions, and may also be formulated
in appropriate pharmaceutical vehicles for administration to human
or animal subjects. The rAAV molecules of the present invention and
compositions comprising them provide new and useful therapeutics
for the treatment, control, and amelioration of symptoms of a
variety of disorders, and in particular, articular diseases,
disorders, and dysfunctions, including for example osteoarthritis,
rheumatoid arthritis, and related disorders.
[0155] The invention also provides compositions comprising one or
more of the disclosed capsid-modified rAAV vectors, expression
systems, virions, viral particles, mammalian cells, or combinations
thereof. In certain embodiments, the present invention provides
pharmaceutical formulations of one or more capsid-modified rAAV
vectors disclosed herein for administration to a cell or an animal,
either alone or in combination with one or more other modalities of
therapy, and in particular, for therapy of human cells, tissues,
and diseases affecting man. Formulation of
pharmaceutically-acceptable excipients and carrier solutions is
well-known to those of skill in the art, as is the development of
suitable dosing and treatment regimens for using the particular
compositions described herein in a variety of treatment regimens,
including e.g., oral, parenteral, intravenous, intranasal,
intra-articular, intramuscular administration and formulation.
EXEMPLARY DEFINITIONS
[0156] In accordance with the present invention, polynucleotides,
nucleic acid segments, nucleic acid sequences, and the like,
include, but are not limited to, DNAs (including and not limited to
genomic or extragenomic DNAs), genes, peptide nucleic acids (PNAs)
RNAs (including, but not limited to, rRNAs, mRNAs and tRNAs),
nucleosides, and suitable nucleic acid segments either obtained
from natural sources, chemically synthesized, modified, or
otherwise prepared or synthesized in whole or in part by the hand
of man.
[0157] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and compositions similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, the preferred methods and compositions are
described herein. For purposes of the present invention, the
following terms are defined below:
[0158] In accordance with long standing patent law convention, the
words "a" and "an" when used in this application, including the
claims, denote "one or more."
[0159] The terms "about" and "approximately" as used herein, are
interchangeable, and should generally be understood to refer to a
range of numbers around a given number, as well as to all numbers
in a recited range of numbers (e.g., "about 5 to 15" means "about 5
to about 15" unless otherwise stated). Moreover, all numerical
ranges herein should be understood to include each whole integer
within the range.
[0160] As used herein, the term "carrier" is intended to include
any solvent(s), dispersion medium, coating(s), diluent(s),
buffer(s), isotonic agent(s), solution(s), suspension(s),
colloid(s), inert(s) or such like, or a combination thereof, that
is pharmaceutically acceptable for administration to the relevant
animal. The use of one or more delivery vehicles for chemical
compounds in general, and chemotherapeutics in particular, is well
known to those of ordinary skill in the pharmaceutical arts. Except
insofar as any conventional media or agent is incompatible with the
active ingredient, its use in the diagnostic, prophylactic, and
therapeutic compositions is contemplated. One or more supplementary
active ingredient(s) may also be incorporated into, or administered
in association with, one or more of the disclosed chemotherapeutic
compositions.
[0161] As used herein, the term "DNA segment" refers to a DNA
molecule that has been isolated free of total genomic DNA of a
particular species. Therefore, a DNA segment obtained from a
biological sample using one of the compositions disclosed herein
refers to one or more DNA segments that have been isolated away
from, or purified free from, total genomic DNA of the particular
species from which they are obtained. Included within the term "DNA
segment," are DNA segments and smaller fragments of such segments,
as well as recombinant vectors, including, for example, plasmids,
cosmids, phage, viruses, and the like.
[0162] The term "effective amount," as used herein, refers to an
amount that is capable of treating or ameliorating a disease or
condition or otherwise capable of producing an intended therapeutic
effect. The term "for example" or "e.g.," as used herein, is used
merely by way of example, without limitation intended, and should
not be construed as referring only those items explicitly
enumerated in the specification.
[0163] As used herein, a "heterologous" is defined in relation to a
predetermined referenced gene sequence. For example, with respect
to a structural gene sequence, a heterologous promoter is defined
as a promoter which does not naturally occur adjacent to the
referenced structural gene, but which is positioned by laboratory
manipulation. Likewise, a heterologous gene or nucleic acid segment
is defined as a gene or segment that does not naturally occur
adjacent to the referenced promoter and/or enhancer elements.
[0164] As used herein, the term "homology" refers to a degree of
complementarity between two or more polynucleotide or polypeptide
sequences. The word "identity" may substitute for the word
"homology" when a first nucleic acid or amino acid sequence has the
exact same primary sequence as a second nucleic acid or amino acid
sequence. Sequence homology and sequence identity can be determined
by analyzing two or more sequences using algorithms and computer
programs known in the art. Such methods may be used to assess
whether a given sequence is identical or homologous to another
selected sequence.
[0165] As used herein, "homologous" means, when referring to
polynucleotides, sequences that have the same essential nucleotide
sequence, despite arising from different origins. Typically,
homologous nucleic acid sequences are derived from closely related
genes or organisms possessing one or more substantially similar
genomic sequences. By contrast, an "analogous" polynucleotide is
one that shares the same function with a polynucleotide from a
different species or organism, but may have a significantly
different primary nucleotide sequence that encodes one or more
proteins or polypeptides that accomplish similar functions or
possess similar biological activity. Analogous polynucleotides may
often be derived from two or more organisms that are not closely
related (e.g., either genetically or phylogenetically).
[0166] The terms "identical" or percent "identity," in the context
of two or more nucleic acid or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same, when compared and aligned for maximum correspondence, as
measured using one of the sequence comparison algorithms described
below (or other algorithms available to persons of ordinary skill)
or by visual inspection.
[0167] As used herein, the phrase "in need of treatment" refers to
a judgment made by a caregiver such as a physician or veterinarian
that a patient requires (or will benefit in one or more ways) from
treatment. Such judgment may made based on a variety of factors
that are in the realm of a caregiver's expertise, and may include
the knowledge that the patient is ill as the result of a disease
state that is treatable by one or more compound or pharmaceutical
compositions such as those set forth herein.
[0168] As used herein, the term "nucleic acid" includes one or more
types of: polydeoxyribonucleotides (containing 2-deoxy-D-ribose),
polyribonucleotides (containing D-ribose), and any other type of
polynucleotide that is an N-glycoside of a purine or pyrimidine
base, or modified purine or pyrimidine bases (including abasic
sites). The term "nucleic acid," as used herein, also includes
polymers of ribonucleosides or deoxyribonucleosides that are
covalently bonded, typically by phosphodiester linkages between
subunits, but in some cases by phosphorothioates,
methylphosphonates, and the like. "Nucleic acids" include single-
and double-stranded DNA, as well as single- and double-stranded
RNA. Exemplary nucleic acids include, without limitation, gDNA;
hnRNA; mRNA; rRNA, tRNA, micro RNA (miRNA), small interfering RNA
(siRNA), small nucleolar RNA (snORNA), small nuclear RNA (snRNA),
and small temporal RNA (stRNA), and the like, and any combination
thereof.
[0169] The term "naturally occurring" as used herein as applied to
an object refers to the fact that an object can be found in nature.
For example, a polypeptide or polynucleotide sequence that is
present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by the hand of man in a laboratory is naturally-occurring.
As used herein, laboratory strains of rodents that may have been
selectively bred according to classical genetics are considered
naturally occurring animals.
[0170] The term "operably linked," as used herein, refers to that
the nucleic acid sequences being linked are typically contiguous,
or substantially contiguous, and, where necessary to join two
protein coding regions, contiguous and in reading frame. However,
since enhancers generally function when separated from the promoter
by several kilobases and intronic sequences may be of variable
lengths, some polynucleotide elements may be operably linked but
not contiguous.
[0171] As used herein, the term "patient" (also interchangeably
referred to as "host" or "subject") refers to any host that can
receive one or more of the pharmaceutical compositions disclosed
herein. Preferably, the subject is a vertebrate animal, which is
intended to denote any animal species (and preferably, a mammalian
species such as a human being). In certain embodiments, a "patient"
refers to any animal host including without limitation any
mammalian host. Preferably, the term refers to any mammalian host,
the latter including but not limited to, human and non-human
primates, bovines, canines, caprines, cavines, corvines, epines,
equines, felines, hircines, lapines, leporines, lupines, murines,
ovines, porcines, ranines, racines, vulpines, and the like,
including livestock, zoological specimens, exotics, as well as
companion animals, pets, and any animal under the care of a
veterinary practitioner. A patient can be of any age at which the
patient is able to respond to inoculation with the present vaccine
by generating an immune response. In particular embodiments, the
mammalian patient is preferably human.
[0172] The phrase "pharmaceutically-acceptable" refers to molecular
entities and compositions that preferably do not produce an
allergic or similar untoward reaction when administered to a
mammal, and in particular, when administered to a human. As used
herein, "pharmaceutically acceptable salt" refers to a salt that
preferably retains the desired biological activity of the parent
compound and does not impart any undesired toxicological effects.
Examples of such salts include, without limitation, acid addition
salts formed with inorganic acids (e.g., hydrochloric acid,
hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and
the like); and salts formed with organic acids including, without
limitation, acetic acid, oxalic acid, tartaric acid, succinic acid,
maleic acid, fumaric acid, gluconic acid, citric acid, malic acid,
ascorbic acid, benzoic acid, tannic acid, pamoic (embonic) acid,
alginic acid, naphthoic acid, polyglutamic acid,
naphthalenesulfonic acids, naphthalenedisulfonic acids,
polygalacturonic acid; salts with polyvalent metal cations such as
zinc, calcium, bismuth, barium, magnesium, aluminum, copper,
cobalt, nickel, cadmium, and the like; salts formed with an organic
cation formed from N,N'-dibenzylethylenediamine or ethylenediamine;
and combinations thereof.
[0173] The term "pharmaceutically acceptable salt" as used herein
refers to a compound of the present disclosure derived from
pharmaceutically acceptable bases, inorganic or organic acids.
Examples of suitable acids include, but are not limited to,
hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric,
maleic, phosphoric, glycollic, lactic, salicyclic, succinic,
toluene-p-sulfonic, tartaric, acetic, citric, methanesulfonic,
formic, benzoic, malonic, naphthalene-2-sulfonic, trifluoroacetic
and benzenesulfonic acids. Salts derived from appropriate bases
include, but are not limited to, alkali such as sodium and
ammonia.
[0174] As used herein, the terms "prevent," "preventing,"
"prevention," "suppress," "suppressing," and "suppression" as used
herein refer to administering a compound either alone or as
contained in a pharmaceutical composition prior to the onset of
clinical symptoms of a disease state so as to prevent any symptom,
aspect or characteristic of the disease state. Such preventing and
suppressing need not be absolute to be deemed medically useful.
[0175] The term "promoter," as used herein refers to a region or
regions of a nucleic acid sequence that regulates
transcription.
[0176] As used herein, the term "polypeptide" is intended to
encompass a singular "polypeptide" as well as plural
"polypeptides," and includes any chain or chains of two or more
amino acids. Thus, as used herein, terms including, but not limited
to "peptide," "dipeptide," "tripeptide," "protein," "enzyme,"
"amino acid chain," and "contiguous amino acid sequence" are all
encompassed within the definition of a "polypeptide," and the term
"polypeptide" can be used instead of, or interchangeably with, any
of these terms. The term further includes polypeptides that have
undergone one or more post-translational modification(s), including
for example, but not limited to, glycosylation, acetylation,
phosphorylation, amidation, derivatization, proteolytic cleavage,
post-translation processing, or modification by inclusion of one or
more non-naturally occurring amino acids. Conventional nomenclature
exists in the art for polynucleotide and polypeptide structures.
For example, one-letter and three-letter abbreviations are widely
employed to describe amino acids: Alanine (A; Ala), Arginine (R;
Arg), Asparagine (N; Asn), Aspartic Acid (D; Asp), Cysteine (C;
Cys), Glutamine (Q; Gln), Glutamic Acid (E; Glu), Glycine (G; Gly),
Histidine (H; His), Isoleucine (I; Ile), Leucine (L; Leu),
Methionine (M; Met), Phenylalanine (F; Phe), Proline (P; Pro),
Serine (S; Ser), Threonine (T; Thr), Tryptophan (W; Trp), Tyrosine
(Y; Tyr), Valine (V; Val), and Lysine (K; Lys). Amino acid residues
described herein are preferred to be in the "l" isomeric form.
However, residues in the "d" isomeric form may be substituted for
any l-amino acid residue provided the desired properties of the
polypeptide are retained.
[0177] "Protein" is used herein interchangeably with "peptide" and
"polypeptide," and includes both peptides and polypeptides produced
synthetically, recombinantly, or in vitro and peptides and
polypeptides expressed in vivo after nucleic acid sequences are
administered into a host animal or human subject. The term
"polypeptide" is preferably intended to refer to any amino acid
chain length, including those of short peptides from about 2 to
about 20 amino acid residues in length, oligopeptides from about 10
to about 100 amino acid residues in length, and longer polypeptides
including from about 100 amino acid residues or more in length.
Furthermore, the term is also intended to include enzymes, i.e.,
functional biomolecules including at least one amino acid polymer.
Polypeptides and proteins of the present invention also include
polypeptides and proteins that are or have been
post-translationally modified, and include any sugar or other
derivative(s) or conjugate(s) added to the backbone amino acid
chain.
[0178] The term "recombinant" indicates that the material (e.g., a
polynucleotide or a polypeptide) has been artificially or
synthetically (non-naturally) altered by human intervention. The
alteration can be performed on the material within or removed from,
its natural environment or state. Specifically, e.g., a promoter
sequence is "recombinant" when it is produced by the expression of
a nucleic acid segment engineered by the hand of man. For example,
a "recombinant nucleic acid" is one that is made by recombining
nucleic acids, e.g., during cloning, DNA shuffling or other
procedures, or by chemical or other mutagenesis; a "recombinant
polypeptide" or "recombinant protein" is a polypeptide or protein
which is produced by expression of a recombinant nucleic acid; and
a "recombinant virus," e.g., a recombinant AAV virus, is produced
by the expression of a recombinant nucleic acid.
[0179] The term "regulatory element," as used herein, refers to a
region or regions of a nucleic acid sequence that regulates
transcription. Exemplary regulatory elements include, but are not
limited to, enhancers, post-transcriptional elements,
transcriptional control sequences, and such like.
[0180] The term "RNA segment" refers to an RNA molecule that has
been isolated free of total cellular RNA of a particular species.
Therefore, RNA segments can refer to one or more RNA segments
(either of native or synthetic origin) that have been isolated away
from, or purified free from, other RNAs. Included within the term
"RNA segment," are RNA segments and smaller fragments of such
segments.
[0181] The term "substantially corresponds to," "substantially
homologous," or "substantial identity," as used herein, denote a
characteristic of a nucleic acid or an amino acid sequence, wherein
a selected nucleic acid or amino acid sequence has at least about
70 or about 75 percent sequence identity as compared to a selected
reference nucleic acid or amino acid sequence. More typically, the
selected sequence and the reference sequence will have at least
about 76, 77, 78, 79, 80, 81, 82, 83, 84 or even 85 percent
sequence identity, and more preferably, at least about 86, 87, 88,
89, 90, 91, 92, 93, 94, or 95 percent sequence identity. More
preferably still, highly homologous sequences often share greater
than at least about 96, 97, 98, or 99 percent sequence identity
between the selected sequence and the reference sequence to which
it was compared.
[0182] The percentage of sequence identity may be calculated over
the entire length of the sequences to be compared, or may be
calculated by excluding small deletions or additions which total
less than about 25 percent or so of the chosen reference sequence.
The reference sequence may be a subset of a larger sequence, such
as a portion of a gene or flanking sequence, or a repetitive
portion of a chromosome. However, in the case of sequence homology
of two or more polynucleotide sequences, the reference sequence
will typically comprise at least about 18-25 nucleotides, more
typically at least about 26 to 35 nucleotides, and even more
typically at least about 40, 50, 60, 70, 80, 90, or even 100 or so
nucleotides.
[0183] When highly-homologous fragments are desired, the extent of
percent identity between the two sequences will be at least about
80%, preferably at least about 85%, and more preferably about 90%
or 95% or higher, as readily determined by one or more of the
sequence comparison algorithms well-known to those of skill in the
art, such as e.g., the FASTA program analysis described by Pearson
and Lipman (1988). The term "subject," as used herein, describes an
organism, including mammals such as primates, to which treatment
with the compositions according to the present invention can be
provided. Mammalian species that can benefit from the disclosed
methods of treatment include, but are not limited to, apes;
chimpanzees; orangutans; humans; monkeys; domesticated animals such
as dogs and cats; livestock such as horses, cattle, pigs, sheep,
goats, and chickens; and other animals such as mice, rats, guinea
pigs, and hamsters.
[0184] As used herein, the term "structural gene" is intended to
generally describe a polynucleotide, such as a gene, that is
expressed to produce an encoded peptide, polypeptide, protein,
ribozyme, catalytic RNA molecule, or antisense molecule.
[0185] The term "subject," as used herein, describes an organism,
including mammals such as primates, to which treatment with the
compositions according to the present invention can be provided.
Mammalian species that can benefit from the disclosed methods of
treatment include, but are not limited to, humans, non-human
primates such as apes; chimpanzees; monkeys, and orangutans,
domesticated animals, including dogs and cats, as well as livestock
such as horses, cattle, pigs, sheep, and goats, or other mammalian
species including, without limitation, mice, rats, guinea pigs,
rabbits, hamsters, and the like.
[0186] "Transcriptional regulatory element" refers to a
polynucleotide sequence that activates transcription alone or in
combination with one or more other nucleic acid sequences. A
transcriptional regulatory element can, for example, comprise one
or more promoters, one or more response elements, one or more
negative regulatory elements, and/or one or more enhancers.
[0187] As used herein, a "transcription factor recognition site"
and a "transcription factor binding site" refer to a polynucleotide
sequence(s) or sequence motif(s) which are identified as being
sites for the sequence-specific interaction of one or more
transcription factors, frequently taking the form of direct
protein-DNA binding. Typically, transcription factor binding sites
can be identified by DNA footprinting, gel mobility shift assays,
and the like, and/or can be predicted on the basis of known
consensus sequence motifs, or by other methods known to those of
skill in the art.
[0188] "Transcriptional unit" refers to a polynucleotide sequence
that comprises at least a first structural gene operably linked to
at least a first cis-acting promoter sequence and optionally linked
operably to one or more other cis-acting nucleic acid sequences
necessary for efficient transcription of the structural gene
sequences, and at least a first distal regulatory element as may be
required for the appropriate tissue-specific and developmental
transcription of the structural gene sequence operably positioned
under the control of the promoter and/or enhancer elements, as well
as any additional cis sequences that are necessary for efficient
transcription and translation (e.g., polyadenylation site(s), mRNA
stability controlling sequence(s), etc.
[0189] As used herein, the term "transformed cell" is intended to
mean a host cell whose nucleic acid complement has been altered by
the introduction of one or more exogenous polynucleotides into that
cell.
[0190] As used herein, the term "transformation" is intended to
generally describe a process of introducing an exogenous
polynucleotide sequence (e.g., a viral vector, a plasmid, or a
recombinant DNA or RNA molecule) into a host cell or protoplast in
which the exogenous polynucleotide is incorporated into at least a
first chromosome or is capable of autonomous replication within the
transformed host cell. Transfection, electroporation, and "naked"
nucleic acid uptake all represent examples of techniques used to
transform a host cell with one or more polynucleotides.
[0191] As used herein, the terms "treat," "treating," and
"treatment" refer to the administration of one or more compounds
(either alone or as contained in one or more pharmaceutical
compositions) after the onset of clinical symptoms of a disease
state so as to reduce, or eliminate any symptom, aspect or
characteristic of the disease state. Such treating need not be
absolute to be deemed medically useful. As such, the terms
"treatment," "treat," "treated," or "treating" may refer to
therapy, or to the amelioration or the reduction, in the extent or
severity of disease, of one or more symptom thereof, whether before
or after its development afflicts a patient.
[0192] The phrases "isolated" or "biologically pure" refer to
material that is substantially, or essentially, free from
components that normally accompany the material as it is found in
its native state. Thus, isolated polynucleotides in accordance with
the invention preferably do not contain materials normally
associated with those polynucleotides in their natural, or in situ,
environment.
[0193] "Link" or "join" refers to any method known in the art for
functionally connecting one or more proteins, peptides, nucleic
acids, or polynucleotides, including, without limitation,
recombinant fusion, covalent bonding, disulfide bonding, ionic
bonding, hydrogen bonding, electrostatic bonding, and the like.
[0194] As used herein, the term "plasmid" or "vector" refers to a
genetic construct that is composed of genetic material (i.e.,
nucleic acids). Typically, a plasmid or a vector contains an origin
of replication that is functional in bacterial host cells, e.g.,
Escherichia coli, and selectable markers for detecting bacterial
host cells including the plasmid. Plasmids and vectors of the
present invention may include one or more genetic elements as
described herein arranged such that an inserted coding sequence can
be transcribed and translated in a suitable expression cells. In
addition, the plasmid or vector may include one or more nucleic
acid segments, genes, promoters, enhancers, activators, multiple
cloning regions, or any combination thereof, including segments
that are obtained from or derived from one or more natural and/or
artificial sources.
[0195] The term "a sequence essentially as set forth in SEQ ID
NO:X" means that the sequence substantially corresponds to a
portion of SEQ ID NO:X and has relatively few nucleotides (or amino
acids in the case of polypeptide sequences) that are not identical
to, or a biologically functional equivalent of, the nucleotides (or
amino acids) of SEQ ID NO:X. The term "biologically functional
equivalent" is well understood in the art, and is further defined
in detail herein. Accordingly, sequences that have about 85% to
about 90%; or more preferably, about 91% to about 95%; or even more
preferably, about 96% to about 99%; of nucleotides that are
identical or functionally equivalent to one or more of the
nucleotide sequences provided herein are particularly contemplated
to be useful in the practice of the invention.
[0196] Suitable standard hybridization conditions for the present
invention include, for example, hybridization in 50% formamide,
5.times.Denhardt's solution, 5.times.SSC, 25 mM sodium phosphate,
0.1% SDS and 100 .mu.g/ml of denatured salmon sperm DNA at
42.degree. C. for 16 h followed by 1 hr sequential washes with
0.1.times.SSC, 0.1% SDS solution at 60.degree. C. to remove the
desired amount of background signal. Lower stringency hybridization
conditions for the present invention include, for example,
hybridization in 35% formamide, 5.times.Denhardt's solution,
5.times.SSC, 25 mM sodium phosphate, 0.1% SDS and 100 .mu.g/ml
denatured salmon sperm DNA or E. coli DNA at 42.degree. C. for 16 h
followed by sequential washes with 0.8.times.SSC, 0.1% SDS at
55.degree. C. Those of skill in the art will recognize that
conditions can be readily adjusted to obtain the desired level of
stringency.
[0197] Naturally, the present invention also encompasses nucleic
acid segments that are complementary, essentially complementary,
and/or substantially complementary to at least one or more of the
specific nucleotide sequences specifically set forth herein.
Nucleic acid sequences that are "complementary" are those that are
capable of base-pairing according to the standard Watson-Crick
complementarity rules. As used herein, the term "complementary
sequences" means nucleic acid sequences that are substantially
complementary, as may be assessed by the same nucleotide comparison
set forth above, or as defined as being capable of hybridizing to
one or more of the specific nucleic acid segments disclosed herein
under relatively stringent conditions such as those described
immediately above.
[0198] As described above, the probes and primers of the present
invention may be of any length. By assigning numeric values to a
sequence, for example, the first residue is 1, the second residue
is 2, etc., an algorithm defining all probes or primers contained
within a given sequence can be proposed:
[0199] n to n+y, where n is an integer from 1 to the last number of
the sequence and y is the length of the probe or primer minus one,
where n+y does not exceed the last number of the sequence. Thus,
for a 25-basepair probe or primer (i.e., a "25-mer"), the
collection of probes or primers correspond to bases 1 to 25, bases
2 to 26, bases 3 to 27, bases 4 to 28, and so on over the entire
length of the sequence. Similarly, for a 35-basepair probe or
primer (i.e., a "35-mer), exemplary primer or probe sequence
include, without limitation, sequences corresponding to bases 1 to
35, bases 2 to 36, bases 3 to 37, bases 4 to 38, and so on over the
entire length of the sequence. Likewise, for 40-mers, such probes
or primers may correspond to the nucleotides from the first
basepair to bp 40, from the second by of the sequence to bp 41,
from the third bp to bp 42, and so forth, while for 50-mers, such
probes or primers may correspond to a nucleotide sequence extending
from bp 1 to bp 50, from bp 2 to bp 51, from bp 3 to bp 52, from bp
4 to bp 53, and so forth.
[0200] In certain embodiments, it will be advantageous to employ
one or more nucleic acid segments of the present invention in
combination with an appropriate detectable marker (i.e., a
"label,"), such as in the case of employing labeled polynucleotide
probes in determining the presence of a given target sequence in a
hybridization assay. A wide variety of appropriate indicator
compounds and compositions are known in the art for labeling
oligonucleotide probes, including, without limitation, fluorescent,
radioactive, enzymatic or other ligands, such as avidin/biotin,
etc., which are capable of being detected in a suitable assay. In
particular embodiments, one may also employ one or more fluorescent
labels or an enzyme tag such as urease, alkaline phosphatase or
peroxidase, instead of radioactive or other environmentally
less-desirable reagents. In the case of enzyme tags, colorimetric,
chromogenic, or fluorigenic indicator substrates are known that can
be employed to provide a method for detecting the sample that is
visible to the human eye, or by analytical methods such as
scintigraphy, fluorimetry, spectrophotometry, and the like, to
identify specific hybridization with samples containing one or more
complementary or substantially complementary nucleic acid
sequences. In the case of so-called "multiplexing" assays, where
two or more labeled probes are detected either simultaneously or
sequentially, it may be desirable to label a first oligonucleotide
probe with a first label having a first detection property or
parameter (for example, an emission and/or excitation spectral
maximum), which also labeled a second oligonucleotide probe with a
second label having a second detection property or parameter that
is different (i.e., discreet or discernable from the first label.
The use of multiplexing assays, particularly in the context of
genetic amplification/detection protocols are well-known to those
of ordinary skill in the molecular genetic arts.
[0201] The term "vector," as used herein, refers to a nucleic acid
molecule (typically comprised of DNA) capable of replication in a
host cell and/or to which another nucleic acid segment can be
operatively linked so as to bring about replication of the attached
segment. A plasmid, cosmid, or a virus is an exemplary vector.
EXAMPLES
[0202] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples that
follow represent techniques discovered by the inventor to function
well in the practice of the invention, and thus can be considered
to constitute preferred modes for its practice. However, those of
skill in the art should, in light of the present disclosure,
appreciate that many changes can be made in the specific
embodiments which are disclosed and still obtain a like or similar
result without departing from the spirit and scope of the
invention.
Example 1
Next Generation rAAV2 Vectors: Point Mutations in Tyrosines Lead to
High-Efficiency Transduction at Lower Doses
[0203] The present example demonstrates that mutations of
surface-exposed tyrosine residues on AAV2 capsids circumvents the
ubiquitination step, thereby avoiding proteasome-mediated
degradation, and resulting in high-efficiency transduction by these
vectors in human cells in vitro and murine hepatocytes in vivo,
leading to the production of therapeutic levels of human
coagulation factor at reduced vector doses. The increased
transduction efficiency observed for tyrosine-mutant vectors is due
to lack of ubiquitination, and improved intracellular trafficking
to the nucleus. In addition to yielding insights into the role of
tyrosine phosphorylation of AAV2 capsid in various steps in the
life cycle of AAV2, these studies have resulted in the development
of novel AAV2 vectors that are capable of high-efficiency
transduction at lower doses.
[0204] Materials and Methods
[0205] Recombinant AAV2 Vectors.
[0206] Highly purified stocks of scAAV2 vectors containing the
enhanced green fluorescence protein (EGFP) gene driven by the
chicken .beta.-actin (CBA) promoter (scAAV2-EGFP), and ssAAV2
vectors containing the factor IX (F.IX) gene under the control of
the apolipoprotein enhancer/human .alpha.-1 antitrypsin (ApoE/hAAT)
promoter (ssAAV2-F.IX) were generated using published methods.
[0207] Localization of Surface-Tyrosines on the AAV2 Capsid.
[0208] The crystal structure of AAV2 (PDB accession number 1lp3)
was used to localize the tyrosine residues on the AAV2 capsid
surface. The icosahedral two-, three- and five-fold related VP3
monomers were generated by applying icosahedral symmetry operators
to a reference monomer using Program O on a Silicon graphics Octane
workstation. The position of the tyrosine residues were then
visualized and analyzed in the context of a viral asymmetric unit
using the program COOT, and graphically presented using the program
PyMOL Molecular Graphics System (DeLano Scientific, San Carlos,
Calif., USA).
[0209] Construction of Surface-Exposed Tyrosine Residue Mutant AAV2
Capsid Plasmids.
[0210] A two-stage procedure, based on QuikChange II.RTM.
site-directed mutagenesis (Stratagene, La Jolla, Calif., USA) was
performed using plasmid pACG-2. Briefly, in stage one, two PCR
extension reactions were performed in separate tubes for each
mutant. One tube contained the forward PCR primer and the other
contained the reverse primer. In stage two, the two reactions were
mixed and a standard PCR mutagenesis assay was carried out as per
the manufacturer's instructions. PCR primers were designed to
introduce changes from tyrosine to phenylalanine residues as well
as a silent change to create a new restriction endonuclease site
for screening purposes. All mutants were screened with the
appropriate restriction enzyme and were sequenced prior to use.
[0211] Preparation of Whole Cell Lysates (WCL) and
Co-Immunoprecipitations.
[0212] Approximately 2.times.10.sup.6 HeLa cells, mock-treated or
treated with MG132, were also subjected to mock-infection or
infection with the WT scAAV2-EGFP or Y730F mutant vectors at
5.times.10.sup.3 particles/cell for 2 hr at 37.degree. C. For
immunoprecipitations, cells were treated with 0.01% trypsin and
washed extensively with PBS. WCL were cleared of non-specific
binding by incubation with 0.25 mg of normal mouse IgG together
with 20 .mu.l of protein G-agarose beads. After preclearing, 2
.mu.g of capsid antibody against intact AAV2 particles (mouse
monoclonal IgG.sub.3, clone A20; Research Diagnostics, Inc.
(Flanders, N.J., USA), or 2 .mu.g of normal mouse IgG (as a
negative control) were added and incubated at 4.degree. C. for 1
hr, followed by precipitation with protein G-agarose beads. For
immunoprecipitations, resuspended pellet solutions were used for
SDS-PAGE. Membranes were treated with monoclonal HRP-conjugated
anti-Ub antibody (1:2,000 dilution) specific for ubiquitin (Ub)
(mouse monoclonal immunoglobulin G.sub.1 .gamma.IgG.sub.1], clone
P4D1; Santa Cruz, Calif., USA). Immuno-reactive bands were
visualized using chemiluminescence (ECL-plus, Amersham Pharmacia
Biotech, Piscataway, N.J., USA).
[0213] Isolation of Nuclear and Cytoplasmic Fractions from HeLa
Cells.
[0214] Nuclear and cytoplasmic fractions from HeLa cells were
isolated and mock-infected or recombinant wt scAAV2-EGFP or Y700F
vector-infected cells were used to isolate the cytoplasmic and
nuclear fractions. The purity of each fraction was determined to be
>95%.
[0215] Southern Blot Analysis for AAV2 Trafficking.
[0216] Low-M.sub.r DNA samples from nuclear and cytoplasmic
fractions were isolated and electrophoresed on 1% agarose gels or
1% alkaline-agarose gels followed by Southern blot hybridization
using a .sup.32P-labeled EGFP-specific DNA probe.
[0217] Recombinant AAV2 Vector Transduction Assays In Vitro.
[0218] Approximately 1.times.10.sup.5 HeLa cells were used for
transductions with recombinant AAV2 vectors. The transduction
efficiency was measured 48-hr post-transduction by EGFP imaging
using fluorescence microscopy. Images from three to five visual
fields were analyzed quantitatively by ImageJ analysis software
(NIH, Bethesda, Md., USA). Transgene expression was assessed as
total area of green fluorescence (pixel.sup.2) per visual field
(mean.+-.SD). Analysis of variance (ANOVA) was used to compare
between test results and the control and they were determined to be
statistically significant.
[0219] Recombinant AAV2 Vector Transduction Studies In Vivo.
[0220] scAAV2-EGFP vectors were injected intravenously via the tail
vein into C57BL/6 mice at 1.times.10.sup.10 virus particles per
animal. Liver sections from three hepatic lobes of the
mock-injected and injected mice 2 weeks after injection were
mounted on slides. The transduction efficiency was measured by EGFP
imaging as described. ssAAV2-FI.X vectors were injected
intravenously (via the tail vein) or into the portal vein of
C57BL/6, BALB/c, and C3H/HeJ mice at 1.times.10.sup.10 or
1.times.10.sup.11 virus particles per animal. Plasma samples were
obtained by retro-orbital bleed and analyzed for hF.IX expression
by ELISA.
[0221] Results
[0222] Mutations in Surface-Exposed Tyrosine Residues Significantly
Improve Transduction Efficiency of AAV2 Vectors.
[0223] To demonstrate that tyrosine-phosphorylation of AAV2 capsids
leads to increased ubiquitination and results in impaired
intracellular trafficking, and is therefore unfavorable to viral
transduction, surface-exposed tyrosine residues were modified on
AAV2 capsids. Inspection of the capsid surface of the AAV2
structure revealed seven surface-exposed tyrosine residues (Y252,
Y272, Y444, Y500, Y700, Y704, and Y730). Site-directed mutagenesis
was performed for each of the seven tyrosine residues, which were
conservatively substituted with phenylalanine residues
(tyrosine-phenylalanine, Y-F) (Table 1). scAAV2-EGFP genomes
encapsidated in each of the tyrosine-mutant capsids were
successfully packaged, and mutations of the surface-exposed
tyrosine residues did not lead to reduced vector stability.
TABLE-US-00001 TABLE 1 TITERS OF WILDTYPE (WT) AND TYROSINE-
MODIFIED Y.fwdarw.F MUTANT AAV2 VECTORS 1.sup.st packaging 2.sup.nd
packaging 3.sup.rd packaging 4.sup.th packaging AAV Vectors titers
(vgs/mL) titers (vgs/mL) titers (vgs/mL) titers (vgs/mL) WT
scAAV2-EGFP 3.4 .times. 10.sup.11 1.0 .times. 10.sup.12 3.2 .times.
10.sup.11 3.0 .times. 10.sup.11 Y252F scAAV2-EGFP 3.8 .times.
10.sup.11 4.0 .times. 10.sup.11 ND ND Y272 scAAV2-EGFP 7.7 .times.
10.sup.11 1.0 .times. 10.sup.11 ND ND Y444F scAAV2-EGFP 9.7 .times.
10.sup.10 4.0 .times. 10.sup.10 6.0 .times. 10.sup.9 5.0 .times.
10.sup.10 Y500F scAAV2-EGFP 8.8 .times. 10.sup.10 2.0 .times.
10.sup.9 4.0 .times. 10.sup.10 6.0 .times. 10.sup.10 Y700F
scAAV2-EGFP 1.0 .times. 10.sup.11 4.0 .times. 10.sup.11 ND ND Y704F
scAAV2-EGFP 6.0 .times. 10.sup.11 2.0 .times. 10.sup.11 ND ND Y730F
scAAV2-EGFP 1.2 .times. 10.sup.11 5.0 .times. 10.sup.11 1.2 .times.
10.sup.11 4.0 .times. 10.sup.11 ND = Not done.
[0224] The transduction efficiency of each of the tyrosine-mutant
vectors was analyzed and compared with the WT scAAV2-EGFP vector in
HeLa cells in vitro under identical conditions. From the results,
it was evident that whereas mock-infected cells showed no green
fluorescence, the transduction efficiency of each of the
tyrosine-mutant vectors was significantly higher compared with the
WT scAAV2-EGFP vector at 2,000 viral particles/cell. Specifically,
the transduction efficiency of Y444F, Y500F, Y730F vectors was
.about.8- to 11-fold higher than the WT vector.
[0225] Mutations in Surface-Exposed Tyrosine Residues Dramatically
Improve Transduction
[0226] Efficiency of AAV2 Vectors in Murine Hepatocytes in
Vivo.
[0227] The efficacy of WT and tyrosine-mutant scAAV2-EGFP vectors
was also evaluated in a mouse model in vivo. The transduction
efficiency of tyrosine-mutant vectors was significantly higher, and
ranged between 4-29-fold, compared with the WT vector. When other
tissues, such as heart, lung, kidney, spleen, pancreas, GI tract
(jejunum, colon), testis, skeletal muscle, and brain were harvested
from mice injected with 1.times.10.sup.10 particles of the
tyrosine-mutant vectors and analyzed, no evidence of EGFP gene
expression was seen. Thus, mutations in the surface-exposed
tyrosine residues did not appear to alter the liver-tropism
following tail vein injection of these vectors in vivo.
[0228] Increased Transduction Efficiency of Tyrosine-Mutant Vectors
is Due to Lack of Uubiquitination, and Improved Intracellular
Trafficking to the Nucleus.
[0229] To further confirm the hypothesis that EGFR-PTK-mediated
phosphorylation of capsid proteins at tyrosine residues is a
pre-requisite for ubiquitination of AAV2 capsids, and that
ubiquitinated virions are recognized and degraded by cytoplasmic
proteasome on their way to the nucleus, leading to inefficient
nuclear transport, a series of experiments were performed as
follows.
[0230] In the first study, HeLa C12 cells, carrying
adenovirus-inducible AAV2 rep and cap genes, were mock infected, or
infected with WT, Y444F or Y730F scAAV2-EGFP vectors. Whereas
mock-infected cells showed no green fluorescence, and .about.15% of
cells were transduced with the WT scAAV2-EGFP vectors in the
absence of co-infection with adenovirus, the transduction
efficiency of Y444F and Y730F scAAV2-EGFP vectors was increased by
.about.9 and .about.18-fold, respectively, compared with the WT
vector. Interestingly, whereas co-infection with adenovirus led to
.about.11-fold increase, the transduction efficiency of Y444F and
Y730F scAAV2-EGFP vectors was not further enhanced by co-infection
with adenovirus. Since adenovirus can improve AAV2 vector nuclear
transport in HeLa cells, these data suggested that the
surface-exposed tyrosine residues play a role in intracellular
trafficking of AAV2, and that their removal leads to efficient
nuclear transport of AAV2 vectors.
[0231] In a second study, HeLa cells, either mock-treated or
treated with Tyr23, a specific inhibitor of EGFR-PTK, or MG132, a
proteasome inhibitor, both known to increase the transduction
efficiency of AAV vectors, were mock-infected or infected with the
WT or Y730F scAAV2-EGFP vectors. Whereas mock-infected cells showed
no green fluorescence, and .about.5% of cells were transduced with
the WT scAAV2-EGFP vectors in mock-treated cells, pretreatment with
Tyr23 or MG132 led to an .about.9-fold and .about.6-fold increase
in the transduction efficiency, respectively. Although the
transduction efficiency of Y730F scAAV2-EGFP vectors was increased
by .about.14-fold compared with the WT vectors, it was not further
enhanced by pretreatment with either Tyr23 or MG132. These data
strongly suggest that the absence of surface-exposed tyrosine
residues, which prevented phosphorylation of the mutant vectors,
likely prevented ubiquitination of the capsid proteins, and these
vectors could not be recognized on their way to the nucleus and
degraded by the proteasome, which led to their efficient nuclear
translocation.
[0232] In a third study, HeLa cells, either mock-treated or treated
with MG132, were mock-infected or infected with the WT, Y730F, or
Y444F scAAV2-EGFP vectors. WCL were prepared 4 hrs post-infection
and equivalent amounts of proteins were immunoprecipitated first
with anti-AAV2 capsid antibody (A20) followed by Western blot
analyses with anti-Ub monoclonal antibody. Whereas ubiquitinated
AAV2 capsid proteins (Ub-AAV2 Cap) were undetectable in
mock-infected cells, the signal of ubiquitinated AAV2 capsid
proteins was weaker in untreated cells, and a significant
accumulation of ubiquitinated AAV2 capsid proteins occurred
following treatment with MG132. Interestingly, infections with
Y730F or Y444F vectors dramatically decreased the extent of
accumulation of MG132-induced ubiquitinated AAV2 capsid proteins.
These results substantiate that mutation in tyrosine residues
circumvents proteasome-mediated degradation of the vectors.
[0233] In a fourth study, the fate of the input WT, Y444F, and
Y730F vector viral DNA was determined in HeLa cells. Southern blot
analysis of low-M.sub.r DNA samples isolated from cytoplasmic [C]
and nuclear [N] fractions and densitometric scanning of
autoradiographs, revealed that .about.36% of the input scAAV2 DNA
was present in the nuclear fraction in cells infected with the WT
vector. Interestingly, however, the amount of input Y730F and Y444F
scAAV2 vector DNA in the nuclear fraction was increased to
.about.72% and .about.70%, respectively. These results further
documented that mutations in the surface-exposed tyrosine residues
prevent ubiquitination of AAV2 capsids, resulting in a decrease of
proteasome-mediated degradation, and in turn, facilitate nuclear
transport of AAV2 vectors.
[0234] Tyrosine-Mutant Vectors Express Therapeutic Levels of Human
Factor IX Protein at .about.10-Fold Reduced Vector Dose in
Mice.
[0235] It was important to examine whether tyrosine-mutant AAV2
vectors were capable of delivering a therapeutic gene efficiently
at a reduced vector dose in vivo. To this end, a single-stranded,
hepatocyte-specific human Factor IX (h.FIX) expression cassette was
encapsidated in the Y730F vector, and the efficacy of this vector
was tested in three different strains of mice (BALB/c, C3H/HeJ, and
C57BL/6). Consistently in all three strains, Y730F vector achieved
.about.10-fold higher circulating hF.IX levels compared with the WT
vector following tail vein or portal vein administration, with the
latter being the more effective route. These results clearly
indicated that the Y730F vectors expressed therapeutic levels of
human F.IX protein (.about.50 ng/mL) at .about.10-fold reduced
vector dose (10.sup.10 particles/mouse) in C57BL/6 mice by port
vein injection. It should be noted that hepatic viral gene transfer
in C57BL/6 mice is generally more efficient than in the other two
strains.
[0236] These results demonstrated here are consistent with the
interpretation that EGFR-PTK-induced tyrosine phosphorylation of
AAV2 capsid proteins promotes ubiquitination and degradation of
AAV2, thus leading to impairment of viral nuclear transport and
decrease in transduction efficiency. Mutational analyses of each of
the seven surface-exposed tyrosine residues yield AAV2 vectors with
significantly increased transduction efficiency in vitro as well as
in vivo. Specifically, Y444F and Y730F mutant vectors bypass the
ubiquitination step, which results in a significantly improved
intracellular trafficking and delivery of the viral genome to the
nucleus.
[0237] Despite long-term therapeutic expression achieved in
preclinical animal models by AAV2 vectors composed of the WT capsid
proteins, in a recent gene therapy trial, two patients with severe
hemophilia B developed vector dose-dependent transaminitis that
limited duration of hepatocyte-derived hF.IX expression to <8
weeks. Subsequent analyses demonstrated presence of memory
CD8.sup.+ T cells to AAV capsids in humans and an MHC I-restricted,
capsid-specific cytotoxic T lymphocyte (CTL) response in one of the
hemophilia B patients, which mirrored the time course of the
transaminitis. It was concluded that this CD8.sup.+ T cell response
to input capsid eliminated AAV2-transduced hepatocytes. These data
demonstrated that a lower capsid antigen dose is sufficient for
efficient gene transfer with the Y730F vector, and show
much-reduced ubiquitination of AAV-Y730F compared to WT capsid, a
prerequisite for MHC I presentation. Thus, the T-cell response to
AAV2 capsid (a serious hurdle for therapeutic gene transfer in the
liver), may be avoided by using the surface-exposed tyrosine-mutant
AAV2 vectors.
[0238] Dramatically increased transduction efficiency of
tyrosine-mutant vectors have also been observed in primary human
neuronal and hematopoietic stem cells in vitro and in various
tissues and organs in mice in vivo. Double, triple, and quadruple
tyrosine-mutants have also been constructed to examine whether such
multiple mutants are viable, and whether the transduction
efficiency of these vectors can be augmented further. It is
noteworthy that with a few exceptions (Y444 positioned equivalent
to a glycine in AAV4 and arginine in AAV5; Y700 positioned
equivalent to phenylalanine in AAV4 and AAV5; and Y704 positioned
equivalent to a phenylalanine in AAV7), these tyrosine residues are
highly conserved in AAV serotypes 1 through 10.
Example 2
Activation of the NF-.kappa.B Pathway by rAAV Vectors
[0239] Since the in silico analysis with human transcription factor
database demonstrated the presence of several binding sites for
NF-.kappa.B, a central regulator of cellular immune and
inflammatory responses, in the adeno-associated virus (AAV) genome,
the present example investigates whether AAV utilizes NF-.kappa.B
during its life cycle. Small molecule modulators of NF-.kappa.B
were used in HeLa cells transduced with recombinant AAV vectors.
VP16, an NF-.kappa.B activator, augmented AAV vector-mediated
transgene expression up to 25-fold. Of the two NF-.kappa.B
inhibitors (Bay11), which blocks both the canonical and the
non-canonical NF-.kappa.B pathways, totally ablated the transgene
expression, whereas pyrrolidone dithiocarbamate (PDTC), which
interferes with the classical NF-.kappa.B pathway, had no effect.
Western blot analyses confirmed the abundance of the nuclear p52
protein component of the non-canonical NF-.kappa.B pathway in the
presence of VP16, which was ablated by Bay11, suggesting that the
non-canonical NF-.kappa.B pathway is triggered during AAV
infection. Similar results were obtained with primary human
dendritic cells (DCs) in vitro, in which cytokines-induced
expression of DC maturation markers, CD83 and CD86, was also
inhibited by Bay11. Administration of Bay11 prior to gene transfer
in normal C57BL/6 mice in vivo resulted in up to 7-fold decrease in
AAV vector-induced production of pro-inflammatory cytokines and
chemokines such as, IL-1.beta., IL-6, TNF.alpha., IL-12.beta., KC,
and RANTES. These studies suggested that transient
immuno-suppression with NF-.kappa.B inhibitors prior to
transduction with AAV vectors leads to a dampened immune response,
which has significant implications in the optimal use of AAV
vectors in human gene therapy.
[0240] Recent studies have begun to define the initial activation
signals that result from AAV gene transfer. One study found
AAV-induced signaling through the Toll-like receptor 9
(TLR9)-myeloid differentiation factor 88 (MyD88) pathway to induce
a type I interferon response in plasmacytoid dendritic cells
(pDCs), thereby driving subsequent adaptive immune responses to the
vector and transgene product upon gene transfer to murine skeletal
muscle (Zhu et al., 2009). These data indicate sensing of the DNA
genome by the endosomal TLR9 receptor in pDCs. No evidence for
induction of pro-inflammatory cytokines following in vitro pulsing
of DCs or macrophages with AAV was found. Still, earlier reports
demonstrated a rapid, albeit highly transient, Kupffer
cell-dependent innate response to AAV vectors in the liver, which
included expression of several inflammatory cytokines (Zaiss and
Muruve, 2008; Zaiss et al., 2008; Zaiss and Muruve, 2005; Zaiss et
al., 2002).
[0241] Interestingly, the role of NF-.kappa.B, a key cellular
responder to many stress- and pathogen-derived signals and
regulator of pro-inflammatory cytokine expression (Hayden and
Ghosh, 2004; Hiscott et al., 2006; Li and Verma, 2002), has not
been previously studied in the AAV life cycle. In this example, it
is shown that infection of human cells with AAV can lead to
activation of the non-canonical NF-.kappa.B pathway. In addition,
activation of NF-.kappa.B substantially increases transgene
expression (including in DCs), while inhibition of NF-.kappa.B
blunts expression. Prevention of inflammatory cytokine induction by
transient inhibition of NF-.kappa.B reveals a role for NF-.kappa.B
in the innate response to AAV in vivo, and importantly, does not
interfere with long-term transgene expression.
[0242] Results
[0243] AAV-ITRs Contain Binding Sites for NF-.kappa.B-Responsive
Transcription Factors.
[0244] The existence of a cellular protein which interacts
specifically with the single-stranded D[-]-sequence in the left
inverted terminal repeat (ITR) of the AAV2 genome has been
previously described (Qing et al., 1997). Since the ssD[+]-sequence
in the right ITR is complementary to the ssD[-]-sequence in the
left ITR, it was reasoned that a putative cellular protein might
also exist, and interact with the ssD[+]-sequence in the right ITR.
In electrophoretic mobility-shift assays, using the ssD[+]-sequence
probe, a distinct cellular protein was indeed detected, which was
designated as ssD[+]-sequence binding protein (ssD[+]-BP) (Qing et
al., 1997). Following purification and mass spectrometry, ssD[+]-BP
was found to have partial amino acid homology to a cellular
NF-.kappa.B repressing factor, a negative regulator of
transcription. Additional in silico analysis with human
transcription factor database [TRANSFAC] demonstrated the presence
of several binding sites for NF-.kappa.B binding co-factors, such
as p300, TFIIB, and SplI. One of these is the p300/CREB
transcription factor that has been recently shown to be associated
with the AAV genome (Dean et al., 2009). Although it is not known
whether the NF-.kappa.B signaling is activated by AAV binding to
the cell surface receptors/co-receptors, recent studies have
demonstrated that the innate immune response could be triggered
either a) through the Toll like receptor 9 (TLR9)-myeloid
differentiation factor 88 (MYD88) pathway, or b) through the
activation of the CD40 ligand on the cell surface in mouse models
in vivo (Zhu et al., 2009; Mays et al., 2009). Both of these
ligands are known to interact down-stream with NF-.kappa.B
transcription factors during their biological activation (Mineva et
al., 2007; Loiarro et al., 2005). The following data demonstrated
that the NF-.kappa.B is involved in the AAV life cycle.
[0245] AAV Infection Activates Non-Canonical NF-.kappa.B Pathway in
Human Cells.
[0246] Small molecule activators and inhibitors of NF-.kappa.B
signaling were used in HeLa cells transduced with a
self-complementary serotype 2 vector expressing EGFP (scAAV-EGFP).
VP16, an NF-.kappa.B activator (Wu and Miyamoto, 2008), augmented
EGFP expression by .about.25-fold (FIG. 1A and FIG. 1B). Between
the two inhibitors tested, Bay11, that blocks the activity of both
IKK.kappa. and IKK.kappa., totally ablated EGFP expression, whereas
PDTC, which inhibits IKB degradation by blocking IKB ubiquitin
ligase in the classical pathway (Cuzzocrea et al., 2002), had no
noticeable effect on EGFP expression (FIG. 1A and FIG. 1B).
Furthermore, VP16-mediated augmented transgene expression was
completely ablated by Bay11, but not by PDTC (FIG. 6A). Similar
results were obtained with both ssAAV vectors (FIG. 6B) and with
the tyrosine triple-mutant scAAV vector (Y730+500+444F; TM-AAV),
which were described in the previous examples (Markusic et al.,
2010) (FIG. 6C). It was concluded, therefore, that transgene
expression from the AAV vector was regulated by the alternative
(non-canonical) pathway of NF-.kappa.B. This conclusion was
confirmed by Western blot analysis (FIG. 6D, and FIG. 6E), which
revealed an increase in the cytosolic p100 and the nuclear p52
protein components of the non-canonical NF-.kappa.B pathway by
.about.3- to 6-fold in the presence of VP16. Moreover, transduction
with AAV vector by itself (i.e., in the absence of activator)
increased p100 and p52 (FIG. 1C), indicating that infection of the
cell activated the alternative NF-.kappa.B pathway. This increase
was ablated by Bay11 treatment, while p65, the marker used for the
classical NF-.kappa.B pathway, was unaffected (FIG. 1C).
[0247] NF-.kappa.B Pathway is Operational in Primary Human
Antigen-Presenting Cells.
[0248] Following AAV Infection.
[0249] In primary human dendritic cells (DCs), on the other hand,
while transgene expression was again substantially increased with
the NF-.kappa.B activator (FIG. 2A), AAV infection by itself did
not activate NF-.kappa.B (FIG. 2B). In the presence of VP16,
.about.20-fold increase in EGFP expression was observed compared
with scAAV vector-transduced DCs. Treatment with cytokines
(TNF-.alpha., IL-6, IL-1.beta., PGE2), known to activate the
NF-.kappa.B pathway, led to a further increase in transgene
expression to .about.26%, which was reduced to .about.12% following
treatment with Bay11 (FIG. 2A). Western blot analyses of nuclear
fractions further corroborated that the alternative pathway of
NF-.kappa.B activation (accumulation of p52 proteins) was
operational (FIG. 2B). Similar results were obtained following
scAAV vector-mediated gene delivery to murine livers in vivo (FIG.
7). The inventors also tested the capability of NF-.kappa.B
modulators to induce phenotypic changes in DCs. Flow cytometric
analyses of two DC maturation markers, CD83 and CD86 indicated that
VP16 alone was not able to induce maturation or enhance the
expression of co-stimulatory molecules when used together with the
cytokines cocktail. However, treatment with Bay11 led to inhibition
of cytokine-mediated maturation of APCs, further implicating the
involvement of NF-.kappa.B (Table 2). This reduction of maturation
markers expression diminishes the main function of DCs to process
antigenic material and reduces T-cell activation and proliferation.
Thus, it was hypothesized that suppression of NF-.kappa.B
activation prior to vector administration might lead to a dampened
innate immune response against AAV.
TABLE-US-00002 TABLE 2 FACS ANALYSES OF MARKERS OF MATURATION OF
PRIMARY HUMAN DENDRITIC CELLS Geometric means of levels of
expression in cells expressing Group CD83 CD86 Immature DCs 10.38
7.04 DCs - No maturation supplement 18.08 13.63 Mature DCs +
Cytokines 20.60 26.80 DCs + AAV 18.29 12.65 DCs + VP16 16.48 13.70
Mature DCs + AAV + Cytokines 24.25 23.75 Mature DCs + AAV +
Cytokines + 19.92 21.92 VP16 Mature DCs + AAV + Cytokines + 16.88
10.11 Bay11 Data from a representative experiment are shown (n =
3).
[0250] Inhibition of NF-.kappa.B Activation Leads to Suppression of
Pro-Inflammatory Cytokine Production Prior to AAV Vector-Mediated
Gene Transfer in Mice in Vivo. In in vivo studies, a single dose of
Bay11 at 20 mg/kg body weight was administered intra-peritoneally
(i.p.) 12 hrs prior to vector administration in C57BL/6 mice.
Transcript levels from liver homogenates of innate immune mediators
(FIG. 3A) or for activation of NF-.kappa.B (FIG. 3B) genes were
measured from Bay11- and vector-injected groups and compared with
sham-injected mice. These data revealed that 2 hrs post-vector
administration, mice injected with Bay11+AAV vector had
significantly reduced levels of pro-inflammatory cytokines or
chemokines including IL-1.alpha., IL-6, TNF.alpha., IL-12.alpha.,
KC, and RANTES, compared with sham- and AAV vector-injected animals
(FIG. 3A), and additionally, the up-regulation of the NF-.kappa.B
gene expression profile was prevented (FIG. 3B). A similar
down-regulation trend of these innate immune response markers was
seen in mice injected with the more efficacious tyrosine
triple-mutant AAV vector (Y730+500+444F; TM-AAV). The up-regulation
of type I interferon expression by both wild-type (WT-AAV) and
TM-AAV vectors was unaffected by Bay11 (FIG. 8A, FIG. 8B, FIG. 8C,
FIG. 8D, FIG. 8E, and FIG. 8F). Administration of Bay11 also
significantly reduced the anti-AAV2 antibody response in these mice
(FIG. 9). The sum of these results implies that the transient
inflammatory cytokine response, typically seen during in vivo
hepatic AAV gene transfer, is mediated by NF-.kappa.B
activation.
[0251] AAV Vector-Mediated Transgene Expression in Murine
Hepatocytes. In view of the observation that Bay11 strongly
inhibits AAV-mediated transgene expression in HeLa cells in vitro
48 hrs post-transduction (FIG. 1A and FIG. 1B), which would be
counter-productive to achieve long-term transgene expression in
vivo, it was important to examine the effect of Bay11 in mice. As
can be seen in FIG. 4A, animals injected with or without Bay11 had
similar levels of EGFP expression from either vector when analyzed
2 weeks after gene transfer. Transduction efficiency of the TM-AAV
vector was .about.12-fold higher than that of the WT-AAV vector
(FIG. 4B), consistent with recently published studies (Markusic et
al., 2010). These data suggested that Bay11 administration could
safely and effectively down-regulate mediators of innate immune
response without compromising long-term transgene expression.
[0252] Materials and Methods
[0253] Recombinant AAV Vectors.
[0254] Highly purified stocks of self-complementary (sc) AAV2
vectors were generated containing either the wild-type (WT) plasmid
or the triple tyrosine-mutant (TM; Y730+500+444F) plasmid and the
enhanced green fluorescence protein (EGFP) gene driven by the
chicken .beta.-actin (CBA) promoter (WT-scAAV2-EGFP,
TM-scAAV2-EGFP) by triple transfection of HEK-293 cells. The
vectors were then purified by CsCl gradient centrifugation, filter
sterilized, and quantified by slot-blot hybridization as described
(Liu et al., 2003; Kube and Srivastava, 1997). The tyrosine-mutant
pACG2-Y730+500+444F-Rep/Cap plasmid has been described recently
(Markusic et al., 2010).
[0255] Recombinant AAV Vector Transduction Assays in Vitro.
[0256] Optimal concentration of NF-.kappa.B-modulating compounds
was determined by a cell viability assay with tenfold-dilutions
from the IC.sub.50 or were used as described previously (Wu and
Miyamoto, 2008; Kumar et al., 2008). VP16 or Bay11 (10 or 5 .mu.M,
final concentration), and PDTC (50 or 25 .mu.M final concentration)
were used either alone or in activator/inhibitor combinations. For
transduction experiments, approximately 1.times.10.sup.5 HeLa cells
were either pre-treated with these compounds 24 hrs prior to vector
infection. Cells were transduced with 500 or 2,000 vector genomes
(vgs) per cell of recombinant WT-AAV or TM-AAV vectors encoding the
EGFP transgene as described previously (Markusic et al., 2010).
After 7 days of culture, primary human dendritic cells were
transduced with AAV vectors at 2000 vgs/cell and incubated for 48
hrs. Transgene expression was assessed as total area of green
fluorescence (pixel) per visual field (mean.+-.SD), or by flow
cytometry. Analysis of variance (ANOVA) was used to compare between
test results and the control and they were determined to be
statistically significant.
[0257] Recombinant AAV Vector Transduction Studies In Vivo.
[0258] Groups of 6-weeks old normal C57BL/6J mice (Jackson
Laboratories, Bar Harbor, Me., USA) were administered
intra-peritoneally, with a single dose (20 mg/kg) of NF-.kappa.B
inhibitor Bay11, in a 200-.mu.L volume diluted in DMSO (day 0).
Animals injected with only the DMSO carrier solvent were considered
as baseline (mock) group (n=75) and animals injected with Bay11
were the test group (n=75). At this point, the animals from mock
and Bay11 groups were randomized to receive either phosphate
buffered saline (PBS, pH 7.4) or WT-AAV or TM-AAV vectors (n=25
mice each group). On day 1, .about.1.times.10.sup.11 viral genome
(vg) particles of WT-AAV2-EGFP or TM-AAV2-EGFP vectors or PBS were
administered intravenously via the tail vein. To measure the
modulation of immune response to AAV, 5 animals each from PBS-,
WT-AAV-, or TM-AAV vector-injected groups were sacrificed by
carbon-dioxide inhalation at different time points post-vector
administration (2, 6, 10, 24 hrs and day 10). Hepatic lobes were
collected, cross-sectioned and mounted on slides to study the
effect of Bay11 on AAV-mediated EGFP expression (from day 10 mice).
All animal studies were conducted in accordance with institutional
animal care and use committee guidelines.
[0259] Gene-Expression Analysis of Innate Immune Response by RT-PCR
Assay.
[0260] Groups of 6-weeks old normal C57BL/6J mice were administered
intra-peritoneally, with a single dose (20 mg/kg) of NF-.kappa.B
inhibitor, Bay11, in a 200-.mu.L volume diluted in DMSO (day 0). On
day 1, mice were injected with either phosphate-buffered saline
(PBS, pH 7.4), or with .about.1.times.10.sup.11 vgs of the
wild-type (WT) AAV-EGFP vectors, or the tyrosine triple-mutant (TM)
AAV-EGFP vectors intravenously via the tail-vein (n=5 mice each
group). At 2 hr post-vector administration, gene expression
profiling of the innate immune response was performed that included
Toll-like receptors 1-9, MyD88, MIP-1, IL-1.alpha., IL-1.beta.,
IL-12.alpha., IL6, KC, TNF.alpha., RANTES, MCP-1, IFN.alpha.,
IFN.beta., and IP-10. Data were captured and analyzed using an ABI
Prism 7500 Sequence Detection System with v 1.1 Software (Applied
Biosystems). The baseline was determined automatically for the 18S
rRNA and for other genes. Thresholds were determined manually for
all genes. Gene expression was measured by the comparative
threshold cycle (Ct) method. The parameter threshold cycle (Ct) was
defined as the cycle number at which the reporter fluorescence
generated by the cleavage of the probe passed a fixed threshold
above baseline. Cytokine gene expression was normalized using the
endogenous reference 18S rRNA gene and mock-infected murine mRNA
were used as reference sample. Relative gene expression was
determined for each group of treated and untreated animals and
values >2.6 and <0.38 were considered as significant
up-regulations and down-regulations between the groups and was
calculated by assessing the variability in the 96-well plates used
to measure specific gene expression.
[0261] Cells, Antibodies and Chemicals.
[0262] HeLa cells were obtained from the American Type Culture
Collection (Rockville, Md., USA) and maintained as monolayer
cultures in Iscove's-modified Dulbecco's medium (IMDM, Invitrogen
Carlsbad, Calif., USA) supplemented with 10% newborn calf serum
(NCS) (Lonza, Inc., Basel, Switzerland) and antibiotics.
Leukapheresis-derived PBMCs were resuspended in serum-free AIM-V
medium (Lonza) and semi-adherent cell fractions were incubated in
serum-free AIM-V medium supplemented with recombinant human IL-4
(500 U/mL) and GM-CSF (800 U/mL) (R&D Systems, MN, USA). Cells
were treated with NF-.kappa.B modulators (10 mM VP16 or 10 mM
Bay11), and cytokines cocktail including 10 ng/mL TNF-.alpha., 10
ng/mL IL-1, 10 ng/mL IL-6, 1 mg/mL PGE2 (R&D Systems) for 20
hr. Cells were harvested, characterized to ensure they met the
typical phenotype of mature DCs (CD83, RPE, murine IgG1, CD86,
FITC, murine IgG1; Invitrogen). All primary and secondary
antibodies were purchased from Cell Signaling Technology, Inc.
(Danvers, Mass., USA) or Santa Cruz Biotechnology, Inc (Santa Cruz,
Calif., USA). NF-kB activators [Etoposide (VP16), Aphidicolin,
Hydroxyurea (HU)] and NF-kB inhibitors [Bay11-7082 (Bay11),
Pyrrolidine dithiocarbamate (PDTC)] were purchased from
Sigma-Aldrich Co. (St. Louis, Mo., USA). These compounds were
re-suspended in either DMSO (Sigma-Aldrich) or in sterile, DNAase-,
RNAase-free water (Invitrogen) as per the manufacturer's
instructions.
[0263] Western Blot Analyses.
[0264] Homogenized lysates of the cell pellets from
.about.2.times.10.sup.6 HeLa cells or DCs, mock or pre-treated with
the optimal concentration of NF-.kappa.B activators or inhibitors
were used for sample preparation. Whole cell proteins were isolated
using the RIPA lysis buffer (Sigma-Aldrich) and cytoplasmic and
nuclear proteins were extracted using a commercial kit (NE-PER
Extraction Reagent Kit, Pierce Biotech, Rockford, Ill., USA) as per
the manufacturer's protocol in the presence of a protease inhibitor
cocktail (Halt.TM. Protease Inhibitor Cocktail Kit, Pierce
Biotech). The protein extracts were boiled for 5 min under reducing
conditions [SDS-sample buffer containing 62.5 mM Tris-HCl (pH 6.8
at 25.degree. C.), 2% wt./vol. SDS, 10% glycerol, 50 mM DTT, 0.01%
(wt./vol.) bromo-phenol blue (Cell Signaling Technology, Inc.)] and
stored at -86.degree. C. until further analysis. Equal volumes of
samples were run on 4-15% SDS-PAGE (Bio-Rad, Hercules, Calif.,
USA). Gels were transferred onto a 0.2-.mu.m nitrocellulose
membrane (Bio-Rad) and typically incubated overnight with 1:1000
dilution of primary antibodies [p100/52, p65, inhibitory
kinase-I.kappa.B.kappa., glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), Lamin B (Cell Signaling Technology, Inc.), .beta.-actin
(Santa Cruz Biotechnology)]. The next day, blots were incubated
with 1:2,000-1:5,000 of the appropriate anti-idiotypic HRP labeled
IgG secondary antibody (Santa Cruz Biotechnology) Immunoblot
detection was performed using the ECL plus Western blotting
detection kit (Amersham Biosciences, Piscataway, N.J., USA). The
intensity of the protein bands was measured with Adobe Photoshop
CS3 Software.RTM. and normalized to proteins levels from the
housekeeping gene products used as loading controls.
[0265] The basis for the present study was the finding that the
host cellular NF-.kappa.B can bind to the 20-bp D-sequence present
in the AAV inverted terminal repeats (ITRs) (Qing et al., 1997),
which was identified by electrophoretic mobility-shift assays
followed by mass-spectrometry (FIG. 10A and FIG. 10B). The data
presented in this example provide the first evidence of the
involvement of NF-.kappa.B in AAV infection. Using a variety of
pharmacological modulators, which have been extensively used by
other investigators (Wu and Miyamoto, 2008; Kumar et al., 2008) to
study the NF-.kappa.B signaling pathway, it was shown that the
non-canonical NF-.kappa.B pathway is up-regulated following AAV
infection. This is significant considering that activation of the
NF-.kappa.B transcriptional program is a fundamental immediate
early step of inflammatory and immune activation (Li and Verma,
2002), and NF-.kappa.B signaling represents a prime candidate for
viral susceptibility or interference (Hiscott et al., 2006).
Viruses which activate NF-.kappa.B have been shown to be
susceptible to innate immune response through an interferon
response (Vesicular stomatitis virus, Measles virus) (Hiscott et
al., 2003), toll-like receptor (TLR) dependent (Ebola virus,
Respiratory syncytial virus) (Okumura et al., 2010; Lizundia et
al., 2008), and TLR-independent signaling pathway (Cytomegalovirus,
Hepatitis C virus) (Castanier et al., 2010; Gourzi et al., 2007).
On the other hand, many viruses disrupt the innate immune responses
and NF-.kappa.B using multifunctional viral decoy proteins that
target specific aspects of the NF-.kappa.B pathway. Viruses,
including human immunodeficiency virus type I (HIV-I), human T-cell
leukemia virus type 1 (HTLV-1), Human herpesvirus 8 (HHV8) and
Epstein-Barr virus (EBV), have incorporated aspects of NF-.kappa.B
signaling into their life cycle and pathogenicity, and thus utilize
NF-.kappa.B activation to promote their survival (Hiscott et al.,
2006).
[0266] In contrast, it stands to reason that the non-canonical
pathway of NF-.kappa.B is activated following AAV infection both
because the non-canonical NF-.kappa.B activation is known to be
important for innate and adaptive immune response (Gilmore, 2006),
and AAV vectors lack complex structural gene elements necessary to
develop any NF-.kappa.B-like decoy proteins. The exacerbated
activation of the non-canonical pathway has been associated to a
wide range of inflammatory disorders like rheumatoid arthritis,
ulcerative colitis or B cell lymphomas (Dejardin, 2006). Monarch-1,
a pyrin-containing protein expressed exclusively in cells of
myeloid lineage suppresses pro-inflammatory cytokines and
chemokines through inhibition of NF-.kappa.B inducing kinase (NIK)
necessary to activate non-canonical NF-.kappa.B pathway (Lich et
al., 2007). The activation of non-canonical pathway of NF-.kappa.B
activation has been shown to result in maturation and T-cell
priming activity of DCs over-expressing a mutated I.kappa.B.kappa.
which blocks activation of the classical pathway (Lind et al.,
2008). In alymphoplasia (Aly) mouse deficient in NIK, the
cross-priming of CD8+ T cells to exogenous antigens in DCs is
affected suggesting the importance of this pathway in adaptive
immunity (Lind et al., 2008). Mice deficient in non-canonical
pathway components are also deficient in secondary lymphoid organ
development and homeostasis (Guo et al., 2008). It is not known
whether AAV-binding activates the NF-.kappa.B signaling to a cell
surface receptor. Recent studies have demonstrated that the innate
immune response to AAV could be triggered through the TLR9-MYD88
pathway or through activation of the CD40 ligand on cell surface in
murine models in vivo (Zhu et al., 2009; Mays et al., 2009). It is
interesting to note that while both rely on NF-.kappa.B signaling
down-stream for mounting an innate immune response (Mineva et al.,
2007; Loiarro et al., 2005), activation of TNF super family
receptors such as CD40L can activate the non-canonical NF-.kappa.B
pathway (Qing et al., 2005).
[0267] Based on the evidence that the first "danger-signal" or
"trigger" to immune surveillance directed against AAV vectors may
be the activation of alternative NF-.kappa.B signaling pathway, it
was reasoned that transient blocking of NF-.kappa.B during AAV
vector administration could dampen the host immune response. One
possible strategy to negate the NF-.kappa.B-priming by AAV is to
generate targeted mutations against the NF-.kappa.B responsive
transcription factor binding sites in the AAV-ITRs. However, given
the pleiotropic functions of NF-.kappa.B proteins in cellular
physiology (Hayden and Ghosh, 2004), it is possible that different
NF-.kappa.B-responsive cytokine promoter-binding transcription
factors might be operational in different cell types.
Alternatively, a protocol for transient immuno-suppression by
targeting the NF-.kappa.B pathway might be universally applicable.
The selective NF-.kappa.B inhibitor, Bay11, can markedly reduce
markers of inflammation and innate immune response to AAV vectors
yet does not affect its transgene expression in vivo. Bay11 was
able to down-regulate the activity of several key regulators
namely, IL-1.alpha., IL-6, TNF.alpha., IL-12.alpha., KC and RANTES,
suggesting the benefit of using this pharmacologic modulator to
selectively down-regulate the inflammatory and innate immune
response against AAV vectors. Interestingly, NIK that is critical
for activation of the non-canonical NF-.kappa.B pathway, is also
known induce activation of IL-1.alpha., IL-6, IL-12.alpha.,
TNF.alpha. and RANTES in response to a variety of viral infections
(DiPaolo et al., 2009; Yanagawa and Onoe, 2006; Andreakos et al.,
2006; Habib et al., 2001). In addition, it is well recognized that
NIK is pivotal to the activation and function of the quiescent
professional antigen presenting cells, the DCs, whose activity is
critical for priming of the antigen specific CD4+ helper T cells,
leading to immune responses to relevant targets such as the
delivery vector (Andreakos et al., 2006; Habib et al., 2001; Martin
et al., 2003; Brown and Lillicrap, 2002). In vitro, NIK increases
DC antigen presentation by potently activating NF-.kappa.B and
consequently up-regulating the expression of cytokines (TNF.alpha.,
IL-6, IL-12, IL-15, and IL-18), chemokines {IL-8, RANTES,
macrophage inflammatory protein-1.alpha., monocyte chemo-attractant
protein-1, and monocyte chemo-attractant protein-3}, MHC
antigen-presenting molecules (class I and II), and co-stimulatory
molecules (CD80 and CD86) (Andreakos et al., 2006). In vivo, NIK
enhances immune responses against a vector-encoded antigen and
shifts them toward a T helper 1 immune response with increased
IgG2a levels, T-cell proliferation, IFN-.gamma. production, and
cytotoxic T lymphocyte responses more potently than complete
Freund's adjuvant (Andreakos et al., 2006). Bay11, used in this
study, prevents the activity of IKK.alpha. and .beta., which are
the substrates for NIK in the non-canonical pathway (Pierce et al.,
1997). These data indicate the high specificity of Bay11 in
targeting the non-canonical NF-.kappa.B pathway as well as its
ability to prevent the activation of major modulators of immune
response.
[0268] A protocol for transient immuno-suppression by targeting the
NF-.kappa.B pathway might be universally applicable to limit
immuno-toxicities. Indeed, a recent report showed decreased AAV
capsid antigen presentation by the use of a proteasomal inhibitor,
Bortezomib [Velcade.RTM.] (Finn et al., 2010). Bortezomib has a
considerable anti-myeloma efficacy (Kube and Srivastava, 1997),
which is likely in large part due to repression of NF-.kappa.B
signaling. It may therefore be possible to simultaneously block MHC
I presentation of capsid and inflammatory signals or use more
selective NF-.kappa.B-targeted therapies, such as Bay11 in this
study, or the newer IKK inhibitors in order to further enhance the
safety and therapeutic efficacy of AAV vectors.
Example 3
Development of Optimized AAV3 Serotype Vectors
[0269] Adeno-associated virus 2 (AAV2), a non-pathogenic human
parvovirus, contains a single-stranded DNA genome, and possesses a
wide tissue-tropism that transcends the species barrier (Muzyczka,
1992). Recombinant AAV2 vectors have gained attention as a
promising vector system for the potential gene therapy of a variety
of human diseases, and are currently in use in a number of gene
therapy clinical trials (Daya and Berns, 2008). More recently,
several additional AAV serotypes have been isolated, and have been
shown to transduce specific cell types efficiently (Muramatsu et
al., 1996; Chiorini et al., 1997; Chiorini et al., 1999; Rutledge
et al., 1998; Gao G P et al., 2002; Vandenberghe et al., 2004).
Whereas various steps in the life cycle of AAV2 are reasonably well
understood (Summerford and Samulski 1998; Qing et al., 1999;
Summerford et al. 1999; Hansen et al., 2000; Hansen et al., 2001;
Sanlioglu et al., 2000; Douar et al., 2001; Zhao et al., 2006;
Thomas et al. 2004; Zhong et al. 2004; Ferrari et al., 1996; Fisher
et al. 1996; Qing et al., 2004; Zhong et al., 2004; Zhong et al.,
2004; Zhong et al., 2008; McCarty et al., 2004; Bainbridge et al.,
2008), less is known about the other serotypes.
[0270] Of the 10 commonly used AAV serotypes, AAV3 has been
reported to transduce cells and tissues poorly (Zincarelli et al.;
Zincarelli et al., 2008). However, recent studies revealed that
AAV3 vectors transduce established human hepatoblastoma (HB) and
human hepatocellular carcinoma (HCC) cell lines as well as primary
human hepatocytes extremely efficiently (Glushakova et al., 2009).
Subsequently, it was documented that AAV3 infection was strongly
inhibited by hepatocyte growth factor (HGF), HGF receptor (HGFR)
specific siRNA, and anti-HGFR antibody, which suggested that AAV3
utilizes HGFR as a cellular receptor/co-receptor for viral entry
(Ling et al., 2010).
[0271] The ubiquitin-proteasome pathway plays a crucial role in
intracellular trafficking of AAV vectors (Douar et al., 2001; Zhong
et al., 2007; Duan et al., 2000). Intact AAV2 capsids can be
phosphorylated at tyrosine residues by epidermal growth factor
receptor protein tyrosine kinase (EGFR-PTK), and that
tyrosine-phosphorylation of AAV capsids negatively affects viral
intracellular trafficking and transgene expression. These
observations led to the suggestion that tyrosine-phosphorylation is
a signal for ubiquitination of AAV capsids followed by
proteasome-mediated degradation (Duan et al., 2000; Zhong et al.,
2008). This led to the hypothesis that mutations of the
surface-exposed tyrosine residues (Y) to phenylalanine (F) might
allow the vectors to evade phosphorylation, ubiquitination and
proteasome-mediated degradation. Indeed, mutations of the
surface-exposed tyrosine residues in AAV2 vectors led to
high-efficiency transduction at lower doses both in HeLa cells in
vitro and murine hepatocytes in vivo (Zhong et al., 2008).
Therapeutic levels of expression of human factor IX have been
obtained in several different strains of mice using the single and
multiple tyrosine-mutant AAV2 vectors (Zhong et al., 2008; Markusic
et al., 2010). Additional studies have corroborated that similar
Y-to-F mutations in AAV serotypes 6, 8 and 9 also lead to augmented
transgene expression (Petrs-Silva et al., 2009; Qiao et al., 2010;
Taylor and Ussher, 2010). Six of seven surface-exposed tyrosine
residues in AAV2 are also conserved in AAV3, but their involvement
in AAV3-mediated transduction has not been evaluated.
[0272] This example demonstrates that: (i) AAV3 vector-mediated
transduction is dramatically increased in T47D cells, a human
breast cancer cell line that expresses undetectable levels of the
endogenous hHGFR (Abella et al., 2005), following stable
transfection and over-expression of hHGFR; (ii) the tyrosine kinase
activity associated with hHGFR negatively affects the transduction
efficiency of AAV3 vectors; (iii) the use of proteasome inhibitors
significantly improves AAV3 vector-mediated transduction; (iv)
site-directed mutagenesis of three surface-exposed tyrosine
residues on the AAV3 capsid leads to improved transduction
efficiency; (v) a specific combination of two tyrosine-mutations
further improves the extent of transgene expression; and (vi) AAV3
vectors efficiently transduce human HB and HCC tumors in a murine
xenograft model in vivo, following both intratumoral or systemic
administration. These optimized AAV3 vectors provide improved tools
for gene therapy, and particularly for the therapy of liver cancer
in humans.
[0273] Materials and Methods
[0274] Cell Lines and Cultures.
[0275] Human cervical cancer (HeLa) and hepatocellular carcinoma
(Huh7) cell lines were purchased from American Type Culture
Collection (Manassas, Va., USA), and maintained in complete DMEM
medium (Mediatech, Inc., Manassas, Va., USA) supplemented with 10%
heat-inactivated fetal bovine serum (FBS, Sigma-Aldrich, St. Louis,
Mo., USA), 1% penicillin and streptomycin (P/S, Lonza,
Walkersville, Md., USA). A newly established human hepatoblastoma
(Hep293TT) cell line (Chen et al., 2009) was maintained in complete
RPMI medium 1640 (Invitrogen, Camarillo, Calif., USA) supplemented
with 15% heat-inactivated FBS (Sigma-Aldrich), 1% penicillin and
streptomycin (P/S, Lonza, Walkersville, Md.). Cells were grown as
adherent cultures in a humidified atmosphere at 37.degree. C. in 5%
CO.sub.2 and were sub-cultured after treatment with trypsin-versene
mixture (Lonza) for 2-5 min at room temperature, washed and
re-suspended in complete medium. A human breast cancer cell line,
T47D, and T47D cells stably transfected with a hHGFR expression
plasmid (T47D+hHGFR), were maintained in complete DMEM medium
(Mediatech, Inc.) with or without 600 .mu.g/mL of G418,
supplemented with 10% heat-inactivated fetal bovine serum (FBS,
Sigma-Aldrich, St. Louis, Mo., USA), 1% penicillin and streptomycin
(Lonza).
[0276] Recombinant AAV Plasmids and Vectors.
[0277] Recombinant AAV3 packaging plasmid and recombinant
AAV2-CBAp-EGFP vector plasmid were generously provided respectively
by Drs. R. Jude Samulski and Xiao Xiao, University of North
Carolina at Chapel Hill, Chapel Hill, N.C. Highly purified stocks
of scAAV2 and scAAV3 vectors containing the enhanced green
fluorescence protein (EGFP) gene driven by the chicken .beta.-actin
promoter (CBAp) were packaged by the calcium phosphate
triple-plasmid transfection protocol described previously (Wu et
al., 2007; Kube and Srivastava, 1997). The physical particle titers
of recombinant vector stocks were determined by quantitative DNA
slot-blot analyses (Kube and Srivastava, 1997).
[0278] Construction of Surface-Exposed Tyrosine Residue Mutant AAV3
Capsid Plasmids.
[0279] A two-stage procedure, based on QuikChange II.RTM.
site-directed mutagenesis (Stratagene) was performed by using
plasmid pAAV3 as described previously (Glushakova et al., 2009;
Ling et al., 2010). Briefly, in stage one, two PCR extension
reactions were performed in separate tubes for each mutant. One
tube contained the forward PCR primer and the other contained the
reverse primer (Table 3).
[0280] In stage two, the two reactions were mixed and a standard
PCR mutagenesis assay was carried out as the manufacturer's
instructions. PCR primers were designed to introduce changes from
tyrosine to phenylalanine residues and a silent change to create a
new restriction endonuclease site for screening purposes (Table 3).
All mutants were screened with the appropriate restriction enzyme
and were sequenced before use.
TABLE-US-00003 TABLE 3 NUCLEOTIDE SEQUENCES OF PRIMERS USED FOR
SITE-DIRECTED MUTAGENESIS Mutants Primer Sequences (5' to 3') Y252F
ACCAGAACCTGGGCTCTGCCCACTTTCAACAACCAT ApaI Tyr.fwdarw.Phe CTCTACAAG
(SEQ ID NO: 11) Y272F CAATCAGGAGCTTCGAACGACAACCACTTCTTTGGC +BstBI
Tyr.fwdarw.Phe TACAGCACC (SEQ ID NO: 12) Y444F
CTTATCGATCAGTATCTGTACTTCCTGAACAGAACG +ClaI Tyr.fwdarw.Phe CAAGGAACA
(SEQ ID NO: 13) F501Y GCTAACGACAACAACAACAGTAACTATCCATGGACA
Phe.fwdarw.Tyr +NcoI GCGGCCAGCAAA (SEQ ID NO: 14) Y701F
TGGAATCCAGAGATTCAGTTCACGTCCAACTACAAC Tyr.fwdarw.Phe +BmgBI
AAGTCTGTT (SEQ ID NO: 15) Y705F
GAGATTCAGTACACGTCCAACTTCAACAAGTCTGTT +AflIII Tyr.fwdarw.Phe
AATGTGGAC (SEQ ID NO: 16) Y731F
GTGAACCTCGCCCTATTGGAACCCGGTTTCTCACAC Tyr.fwdarw.Phe GAAACTTG (SEQ
ID NO: 17) The codon triplets are shown in bold; red fonts denote
the mutations from tyrosine to phenylalanine residues, and green
fonts indicate the silent mutations to eliminate/create the
restriction enzyme sites (underlined), which were used to identify
the desired clones.
[0281] AAV Vector Transduction Assays.
[0282] Huh7 or HeLa cells were seeded in 96-well plates at a
concentration of 5,000 cells per well in complete DMEM medium. AAV
infections were performed in serum- and antibiotic-free DMEM
medium. Hep293TT cells were seeded in 96-well plates at a
concentration of 10,000 cells per well in complete RPMI medium. The
infections were performed in serum- and antibiotic-free RPMI
medium. The expression of EGFP was analyzed by direct fluorescence
imaging 72-hrs' post-transduction.
[0283] Western Blot Analyses.
[0284] Cells were harvested and disrupted in a
radio-immunoprecipitation assay (RIPA) lysis buffer (50 mM
Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% NP-40, 0.25% sodium
deoxycholate and 1 mM EDTA with protease inhibitor cocktail, 1 mM
NaF and 1 mM Na.sub.3VO.sub.4). Total protein concentration was
measured using a Bradford reagent (Bio-Rad) and equal amounts (50
.mu.g) of whole cell lysates were resolved by SDS-PAGE. After
electrophoresis, samples were electro-transferred to a
nitrocellulose membrane (Bio-Rad), probed with relevant primary
antibodies at 4.degree. C. overnight, incubated with horseradish
peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch,
West Grove, Pa., USA), and detected with an enhanced
chemiluminescence substrate (Amersham). Antibodies against
phospho-c-Met (Y1234/1235), total c-Met, phospho-Akt (S473) and
phospho-ERK (T202/Y204) were purchased from Cell Signaling, and
anti-.beta.-actin (AC-74) antibody was obtained from
Sigma-Aldrich.
[0285] Recombinant AAV3 Vector Transduction Studies in Mouse
Xenograft Models.
[0286] Groups of 6-weeks old NSG mice (Jackson Laboratories) were
injected subcutaneously with 5.times.10.sup.6 Hep293TT or Huh7
cells. Four-week post-injection, indicated numbers of AAV3 vector
genomes (vgs) were administered either intratumorally or through
tail-vein. Four days post-vector administration, tumors were
resected, cross-sectioned and evaluated for EGFP expression using a
fluorescent microscope. Sections were also stained with DAPI to
visualize the cell nucleus. All animal studies were conducted in
accordance with approved institutional guidelines.
[0287] Statistical Analysis.
[0288] Results are presented as mean.+-.standard deviation (SD).
Differences between groups were identified using a grouped-unpaired
two-tailed distribution of Student's T test. P values <0.05 were
considered statistically significant.
[0289] Results
[0290] Human HGFR is Required for AAV3 Infectivity.
[0291] AAV3 utilizes human hepatocyte growth factor receptor (HGFR)
as a cellular co-receptor (Ling et al., 2010). To unequivocally
corroborate this finding, a human breast cancer cell line, T47D,
was used that expresses undetectable levels of hHGFR (Abella et
al., 2005), as well as T47D cells stably transfected with hHGFR
expression plasmids (T47D+hHGFR) (Abella et al., 2005). The
expression of hHGFR protein in the established cell line T47D+hHGFR
was confirmed by Western blot analysis (see FIG. 12C). Equivalent
numbers of T47D and T47D+hHGFR cells were transduced with various
multiplicities-of-infection (MOI) of self-complementary (sc)
AAV3-CBAp-EGFP vectors under identical conditions and transgene
expression was determined 72 hr post-transduction. These results,
shown in FIG. 11A, document that the transduction efficiency of
AAV3 vectors is .about.8-13-fold higher in cells that express hHGFR
than those that do not. AAV3 vector-mediated transduction of
T47D+hHGFR cells could be completely blocked in the presence of 5
.mu.g/mL of hHGF (FIG. 11B). Taken together, these data provide
conclusive evidence that cell surface expression of hHGFR is
required for successful transduction by AAV3 vectors.
[0292] Inhibition of HGFR Protein Tyrosine Kinase Activity Enhances
Transduction Efficiency of AAV3 Vectors.
[0293] To examine whether in addition to the extracellular domain,
the intracellular domain of HGFR, which contains protein tyrosine
kinase activity, is also involved in AAV3 infection, a further
study was performed. Binding of its ligand, HGF, results in
dimerization of the receptor and intermolecular
trans-phosphorylation of multiple tyrosine residues in the
intracellular domain (Nguyen et al., 1997). T47D+hHGFR cells were
treated for two hrs with increasing concentrations of a specific
HGFR kinase inhibitor, BMS-77760707 (BMS) (Schroeder et al., 2009;
Dai and Siemann, 2010). Cells were subsequently infected with
scAAV3 vectors at 2,000 vgs/cell. These results are shown in FIG.
12A. It is evident that BMS-777607-treatment led to .about.2-fold
increase in AAV3 transduction efficiency. Although the p-value is
higher when BMS-777607 was used at the highest concentration of 10
.mu.M, compared with the lower concentration of 1 .mu.M, this
change is most likely due to drug toxicity. In previous studies, it
was reported that BMS-777607 treatment had no significant effect on
cell growth at doses .ltoreq.1 .mu.M. However, doses of 10 .mu.M
did result in significant reduction in cell proliferation, which
suggests that this concentration is toxic to cells (Dai and
Siemann, 2010). In the next experiment, to rule out any possible
non-specific nature of this drug, the parental T47D cells were
included as a control. Both cell types were treated with 1 .mu.M
BMS-777607 for 2 hr and then infected with scAAV3 vectors at 10,000
vg/cell. The results, shown in FIG. 12B, indicated that whereas
BMS-777607-treatment significantly enhanced AAV3 infectivity in
T47D+hHGFR cells, it had no effect in T47D cells that lack
expression of hHGFR.
[0294] To examine whether inhibition of the HGFR kinase led to
alterations in the phosphorylation status of specific cellular
proteins involved in the downstream signaling pathway total and
phosphorylation levels of the HGFR protein in both T47D and
T47D+hHGFR lysates were determined following a 2-hr drug-incubation
period. Activation of signaling pathways downstream from HGFR
kinase, ERK1/2 and Akt, were analyzed using
phosphorylation-specific antibodies. These results, shown in FIG.
12C, confirmed that whereas little expression of hHGFR occurs in
T47D cells, the level of expression is significantly higher in
T47D+hHGFR cells for both total HGFR and phosphorylated HGFR, which
is consistent with previously published reports (Abella et al.,
2005). Treatment of T47D+hHGFR cells with BMS-777607 completely
blocked the phosphorylation of HGFR, but not total HGFR. In
addition, BMS-777607-treatment had no effect on the expression of
phosphorylated AKT and ERK1/2. These results suggest that the
enhancement of AAV3 vector infectivity by the BMS-777607-treatment
is due to inhibition of HGFR kinase.
[0295] To date, only AAV2 has been reported to use hHGFR as a
co-receptor (Yan et al., 2002). The roles of hHGFR and hHGFR kinase
inhibitor on other AAV serotypes are not known. To rule out any
non-specific enhancement of transduction by BMS-777607, other
serotypes of AAV, which are not dependent on HGFR, as well as AAV2
vectors, were compared for transduction efficiency following
treatment of cells with BMS-777607. These results, shown in FIG.
13, indicate that whereas AAV2 and AAV3 vectors can efficiently
transduce T47D+hHGFR cells, other serotypes (AAV4-AAV9) can only
transduce these cells at a very low efficiency. This result
suggests that hHGFR is not involved in the life cycle of these AAV
serotypes. Treatment of cells with BMS-777607 significantly
increased the transduction efficiency of both AAV2 and AAV3
vectors, but not the other AAV serotypes, which suggested that the
effect of the BMS-777607-treatment is AAV serotype-specific.
[0296] Proteasome Inhibitors Increase the Transduction Efficiency
of AAV3 Vectors.
[0297] Previous studies have shown that proteasome inhibitors, such
as MG132, can significantly enhance the transduction efficiency of
AAV2 vectors by facilitating intracellular trafficking (Zhong et
al., 2007; Yan et al., 2002). To evaluate whether MG132 can also
improve AAV3 trafficking in target cells, Huh7, a well-established
human hepatocellular carcinoma cell line (Nakabayashi et al.,
1982), and Hep293TT, a recently established human hepatoblastoma
cell line (Chen et al., 2009), were either mock-treated or treated
with increasing concentrations of MG132. Following a two-hour
treatment, cells were infected with scAAV3-EGFP vectors. HeLa
cells, treated with 5 .mu.M MG132 and transduced with scAAV2
vectors, were included as a positive control. Transgene expression
was determined by fluorescence microscopy 72 hrs post-transduction.
These data are shown in FIG. 14A and FIG. 14B. As can be seen,
pretreatment with MG132 significantly increased the transduction
efficiency of scAAV2 vectors in HeLa cells, which is consistent
with previously results (Zhong et al., 2008). Interestingly, a
dose-dependent increase in the transduction efficiency of scAAV3
vectors in both Huh7 and Hep293TT cells occurred following
MG132-treatment, suggesting that AAV3 vectors also undergo
ubiquitination followed by proteasome-mediated degradation.
[0298] Previous studies have also shown that inhibition of EGFR-PTK
signaling by Tyrphostin 23 (Tyr23), a specific inhibitor of
EGFR-PTK (May et al., 1998), modulates the Ub/proteasome pathway,
which in turn, facilitates intracellular trafficking and transgene
expression mediated by AAV2 vectors (Zhong et al., 2007). Hep293TT
cells were mock-treated or treated with Tyr23 for 2 hr and
transduced with scAAV3 vectors. HeLa cells, pretreated with Tyr23
and transduced with scAAV2 vectors, were included as appropriate
controls. Transgene expression was determined 72 hr
post-transduction. These results, shown in FIG. 14C and FIG. 14D,
indicate that Tyr23-treatment led to a significant increase in the
transduction efficiency of both scAAV2 and scAAV3 vectors. The
increased transgene expression was independent of vector entry,
since there was no significant difference in the amounts of
internalized viral DNA in the presence or absence of either MG132
or Tyr23. These results further corroborate the involvement of the
host cell Ub/proteasome machinery in the life cycle of AAV3 vectors
as well.
[0299] Site-Directed Mutagenesis of Surface-Exposed Tyr Residues
Significantly Improves Transduction Efficiency of scAAV3
Vectors.
[0300] In the preceding examples, the inventors have demonstrated
that there are seven surface-exposed tyrosine residues (Y252, Y272,
Y444, Y500, Y700, Y704 and Y730) on AAV2 capsids that are
phosphorylated by EGFR-PTK and negatively affect the transduction
efficiency of AAV2 vectors (Zhong et al., 2008). Alignment of amino
acid sequences from AAV2 and AAV3 capsids indicated that six of
seven tyrosine residues (Y252, Y272, Y444, Y701, Y705 and Y731) are
conserved in AAV3 capsid (Table 4).
TABLE-US-00004 TABLE 4 SURFACE-EXPOSED TYR RESIDUES ON AAV CAPSIDS,
AND SITE-DIRECTED MUTAGENESIS TO CONVERT THEM TO PHENYLALANINE
RESIDUES AAV2 AAV3 Y252 Y252.fwdarw.F Y272 Y272.fwdarw.F Y444
Y444.fwdarw.F Y500 F501 Y700 Y701.fwdarw.F Y704 Y705.fwdarw.F Y730
Y731.fwdarw.F The surface-exposed tyrosine (Y) residues on AAV2 and
AAV3 capsids are shown; arrows denote the site-directed mutations
from Y to phenylalanine (F) residues on AAV3 capsids.
[0301] One tyrosine residue, Y500 in AAV2, is present as F501 in
AAV3. Since it has been shown that Y to F mutations in several AAV
serotypes enhance transgene expression by circumventing
ubiquitination and proteasome-mediated degradation (Zhong et al.,
2008; Petrs-Silva et al., 2009; Qiao et al., 2010; Taylor and
Ussher et al., 2010), it was reasoned that mutation of F501 back to
a tyrosine residue would reduce the transduction efficiency of AAV3
vectors. This hypothesis was tested by generating a mutant AAV3
vector in which the phenylalanine residue was substituted with a
tyrosine residue (F501Y). The transduction efficiency of the mutant
vector was compared with its wild-type (WT) AAV3 counterpart using
Huh7 cells under identical conditions. As can be seen in FIG. 15A,
the extent of the transgene expression mediated by the F501Y mutant
vector was reduced by .about.50% compared with the WT AAV3
vector.
[0302] To further test the hypothesis that tyrosine-mutations on
AAV3 capsids would lead to decreased EGFR-PTK-mediated
phosphorylation followed by reduced ubiquitination and impaired
proteasome-mediated degradation resulting in increased transgene
expression, all six surface-exposed tyrosine residues on AAV3
capsids were modified and substituted with phenylalanine residues
(tyrosine-phenylalanine, Y-F). Each of the single tyrosine-mutant
vectors encapsidating scAAV2-CBAp-EGFP genomes could be
successfully packaged. Vector titers for each of the mutants were
determined by both quantitative DNA slot blots and qPCR, and no
significant differences in the packaging efficiency were observed.
The transduction efficiency of each of the tyrosine-mutant vectors
was analyzed and compared with the WT scAAV3-CBAp-EGFP vector in
both Huh7 (FIG. 15B) and Hep293TT (FIG. 15C) cells under identical
conditions. From these results, it is evident that, the
transduction efficiency of three of the tyrosine-mutant vectors
(Y701F, Y705F and Y731F) is significantly higher compared with the
WT scAAV3 vector. Specifically, the transduction efficiency of
Y731F vector was .about.8-fold higher than the WT vector, followed
by Y705F (.about.3-fold) and Y701F (.about.2-fold) vectors.
[0303] Multiple Mutations in Surface-Exposed Tyrosine Residues
Further Improve the Transduction Efficiency of AAV3 Vectors.
[0304] In the prior examples involving Y-F mutant AAV2 vectors, it
was observed that specific combinations of the most efficient
single-mutations of surface-exposed tyrosine residues further
augmented the transduction efficiency of AAV2 vectors (Markusic et
al., 2010). To examine whether a similar enhancement could be
achieved with AAV3 vectors, the following double- and triple-mutant
AAV3 vectors were constructed: Y701+731F, Y705+731F, and
Y701+705+731F. Each of these mutant vectors was packaged to similar
titers, as determined by both quantitative DNA slot blots and qPCR.
The transduction efficiency of these multiple-mutants was compared
with the WT and the Y731F single-mutant AAV3 vectors in Huh7 cells
under identical conditions. These results are shown in FIG. 16A. As
can be seen, whereas the Y731F mutation significantly increased the
transduction efficiency of AAV3 vectors, as observed before, only
one of the double-mutations (Y705+731F) led to an additional
significant increase in transgene expression. Interestingly, the
transduction efficiency of both the double mutant (Y701+731F) and
the triple mutant (Y701+705+731F) vectors was reduced to levels
similar to the WT AAV3 vector. The best-performing single and
multiple tyrosine-mutants on human liver cancer cells were then
evaluated for transduction of T47D and T74D+hHGFR cells (FIG. 16B).
Similar to human liver cancer cells, the tyrosine-mutant rAAV3
vectors led to high-efficiency transduction of both cell types,
with or without hHGFR expression.
[0305] To examine the possibility whether the observed enhanced
transduction efficiency of the Y-F mutant vectors was due to the
involvement of one or more additional putative cellular
receptor/co-receptor functions, the WT, Y731F, and Y705+731F mutant
scAAV3-CBAp-EGFP vectors were used to transduce Huh7 cells in the
absence or the presence of 5 .mu.g/ml hHGF under identical
conditions. These results are shown in FIG. 16C. As is evident, the
presence of hHGF dramatically inhibited the transduction efficiency
and transgene expression of all three AAV3 vectors, which is
consistent with the interpretation that the tyrosine-mutant vectors
also utilize hHGFR as a cellular receptor/co-receptor for viral
entry.
[0306] AAV3 Vectors Transduce Human Liver Tumors in Murine
Xenograft Models.
[0307] To demonstrate AAV3 vectors could also transduce human HB
and HCC tumors in a xenograft mouse model in vivo,
.about.5.times.10.sup.6 HCC (Huh7) or HB (Hep293TT) cells were
injected sub-cutaneously in NOD/Scid gamma (NSG) mice. Four-weeks
later, when tumors were clearly visible and palpable in both groups
of animals, .about.2.times.10.sup.10 vgs of scAAV3-CBAp-EGFP
vectors were injected directly into tumors. Four-days post-vector
injections, tumors were excised and thin sections were examined
under a fluorescence microscope. These results indicated that AAV3
vectors were effective to transduce both human HCC (FIG. 17A) and
HB (FIG. 17B) tumors in vivo. Consistent with the in vitro data,
the transduction efficiency of AAV3 vectors was higher in Hep293TT
cell-derived tumors than that in Huh7 cell-derived tumors.
[0308] Optimized Tyrosine-Mutant AAV3 Vectors are Highly Efficient
in Transducing Human Liver Tumors in Murine Xenografts.
[0309] Next, the best performing double tyrosine-mutant AAV3
vectors were further evaluated in vivo for xenograft human liver
tumors gene transfer. In the first set of studies,
.about.5.times.10.sup.10 vgs of either the wild-type (WT) scAAV3-
or Y705+731F-AAV3-CBAp-EGFP vectors were intratumorally injected in
NSG mice bearing human HB (Hep293TT) tumors. Four-days post-vector
injections, tumors were excised, and thin sections were examined
under a fluorescence microscope (FIG. 17C). As can be seen, tumors
injected with the WT-AAV3 vectors exhibited detectable levels
expression of EGFP. The transduction efficiency of the double
tyrosine-mutant AAV3 vectors was significantly higher compared with
the WT AAV3 vectors, which is consistent with the in vitro
data.
[0310] In the second set of studies, .about.5.times.10.sup.11 vgs
of either the WT-scAAV3-CBAp-EGFP vector or the
Y705+731F-scAAV3-CBAp-EGFP vector were injected via the tail-vein
in NSG mice bearing human HB (Hep293TT) tumors. Phosphate-buffered
saline (PBS) injections were used as an appropriate control.
Whereas little transgene expression occurred in tumors from mice
injected with pBS (FIG. 18A), direct tumor-targeting could be
achieved following systemic administration of AAV3 vectors. The
transduction efficiency of the optimized tyrosine-mutant AAV3
vectors (FIG. 18C), once again, was significantly higher than that
of the WT AAV3 vectors (FIG. 18B). These data suggest that the
observed increased transduction efficiency of tyrosine-mutant AAV3
vectors was independent of viral administration route.
[0311] HGFR is a trans-membrane receptor tyrosine kinase, and
binding of its ligand, HGF, results in dimerization of the receptor
and intermolecular trans-phosphorylation of multiple tyrosine
residues in the intracellular domain. (Liu et al., 2008) Whereas it
is clear that AAV3 capsid interacts with the extracellular domain
of hHGFR, it is less clear, whether AAV3-binding to hHGFR also
triggers its activation and phosphorylation of the downstream
target proteins. The data does indeed demonstrate that suppression
of the hHGFR-PTK activity leads to a modest increase in AAV3
vector-mediated transgene expression. In this context, it is of
interest to note that the transduction efficiency of AAV3 vectors
is significantly higher in a more recently established human
hepatoblastoma (HB) cell line, Hep293TT, compared with that in a HB
cell line, Huh6, which was established nearly three decades ago.
Although subtle differences might exist between the two cell lines,
specific mutations have been identified in the tyrosine kinase
domain of hHGFR in Hep293TT cells, which render it inactive, and
that the hHGFR-specific kinase inhibitor, BMS-777607, which
augments the transduction efficiency in Huh6 cells, has little
effect on AAV3 transduction efficiency in Hep293TT cells.
[0312] Despite the utilization of two distinct cellular growth
factor receptors as co-receptors by AAV2 (hFGFR1) and AAV3 (hHGFR),
the two serotypes appear to share certain post-receptor entry and
intracellular trafficking pathways. For example, both capsids
become phosphorylated at tyrosine residues by EGFR-PTK, presumably
in the late endosomes, followed by ubiquitination, which leads to
proteasome-mediated degradation. (Zhong et al., 2008) However,
although 6 of 7 surface-exposed tyrosines in AAV2 are conserved in
AAV3, the patterns of behavior of the corresponding Y-F mutants are
somewhat divergent. For example, Y730F (for AAV2) and Y731F (for
AAV3) are the most efficient single-mutants, followed by Y444F (for
AAV2), and Y705F (for AAV3), the transduction efficiency of Y444F
(for AAV3) remains unaltered. Similarly, whereas the transduction
efficiency of the Y730+444F double-mutant (for AAV2) is not
significantly different from that of Y730F, the transduction
efficiency of the Y705+731F double-mutant (for AAV3) is
significantly higher than Y731F. Furthermore, the Y730+500+444F
triple-mutant (for AAV2) is the most efficient, the Y731+501+705F
triple-mutant (for AAV3) is the most efficient, the Y501 residue
having already been mutated in the WT AAV3 capsid. Interestingly,
even the WT AAV3 vectors were able to transduce human liver tumors
reasonably well in a mouse xenograft model in vivo following
intratumor injection. However, evidence that the tyrosine-mutant
vector resulted in higher gene transfer efficiency in vivo has been
demonstrated.
[0313] Human liver cancer, especially hepatocellular carcinoma
(HCC), is one of the most aggressive malignant tumors. The major
obstacle to survival with HCC is recurrence after HCC resection
(Tang, 2005). Thus, transduction of 100% of target cells is
desirable in order to completely eliminate the tumor. In previous
studies, it was observed that melittin, a toxic peptide derived
from bee venom, inhibits the viability and motility of HCC cells
both in vitro and in vivo via the suppression of Rac1-dependent
pathway (Liu et al., 2008) and up-regulation of mitochondria
membrane protein 7A6 (Zhang et al., 2007). Melittin has been shown
to induce apoptosis of HCC cells potentially by activating
CaMKII/TAK1/JNK/p38 signaling pathway (Wang et al., 2009).
[0314] Based on previous studies with recombinant adenovirus
vectors containing the melittin gene driven by a liver cancer
cell-specific promoter to achieve specific killing of liver cancer
cells both in vitro and in vivo (Ling et al., 2005), this example
provides optimized tyrosine-mutant AAV3-melittin vectors under the
control of a liver cancer cell-specific promoter that can be used
to selectively target both primary and metastatic liver cancer.
Example 4
High-Efficiency Transduction of Human Monocyte-Derived Dendritic
Cells by Capsid-Modified Recombinant AAV2 Vectors
[0315] Dendritic cells (DCs) are antigen-presenting cells (APCs),
which play a critical role in the regulation of the adaptive immune
response. DCs are unique APCs and have been referred to as
"professional" APCs, since the principal function of DCs is to
present antigens, and because only DCs have the ability to induce a
primary immune response in resting naive T lymphocytes. (Banchereau
and Steinman, 1998) Although a naturally occurring anti-tumor
immune response is detectable in patients, this response fails to
control tumor growth. On the other hand, monocyte-derived DCs
(moDCs) generated ex vivo in the presence of granulocyte-macrophage
colony-stimulating factor (GM-CSF) and interleukin 4 (IL-4) possess
the capacity to stimulate antigen-specific T-cells after endogenous
expression of antigens. (Chapuis et al., 1997; den Brok et al.,
2005) For this reason, genetically-modified DCs have been
extensively studied and numerous Phase I and II clinical trials
evaluating the efficacy of DCs in patients with cancer have been
initiated. (Figdor et al., 2004; Palucka et al., 2011) However,
current methods for DC loading are inadequate in terms of cell
viability, uncertainty regarding the longevity of antigen
presentation, and the restriction by the patient's haplotype.
(Palucka et al., 2011)
[0316] The possibility of manipulating viral genomes by
biotechnological techniques, together with the recent
identification of many tumor-associated antigens (TAAs), has
sparked an interest in using recombinant viruses to express TAAs in
the hope of inducing a protective antitumor immune response in
patients. (Liu, 2010; Robert-Guroff, 2007) Among different methods
for gene delivery, vectors based on a human parvovirus, the
adeno-associated virus serotype 2 (AAV2), have attracted much
attention mainly because of the non-pathogenic nature of this
virus, and its ability to mediate long-term, sustained therapeutic
gene expression. (Daya and Berns, 2008; Mueller and Flotte, 2008;
Srivastava, 2008) Successful transduction of different subsets of
DCs by different commonly used serotypes of AAV vectors has been
demonstrated and the potential advantage of an AAV-based antitumor
vaccine discussed. (Pannazhagan et al., 2001; Veron et al., 2007;
Mahadevan et al., 2007; Shin et al., 2008; Taylor and Ussher, 2010)
However, further improvements in gene transfer by recombinant AAV
vectors to DCs in terms of specificity and transduction efficiency
are warranted to achieve a significant impact when used as an
anti-tumor vaccine.
[0317] Cellular epidermal growth factor receptor protein tyrosine
kinase (EGFR-PTK) negatively impacts nuclear transport and
subsequent transgene expression by recombinant AAV2 vectors
primarily due to phosphorylation of capsids at surface tyrosine
residues. (Zhong et al., 2007) These studies resulted in the
development of next generation recombinant AAV2 vectors containing
point mutations in surface exposed tyrosine residues that transduce
various cells and tissues with high-efficiency at lower doses
compared to the wild-type (WT) vector. (Zhong et al., 2008)
However, such single or multiple tyrosine-mutant AAV vectors failed
to increase the transduction efficiency of monocyte-derived DCs
(moDCs) more than 2-fold, most likely due to lower levels of
expression and/or activity of EGFR-PTK compared with that in HeLa
cells or hepatocytes. (Taylor and Ussher, 2010)
[0318] Serine/threonine protein kinases are involved in a wide
variety of cellular processes such as differentiation,
transcription regulation, and development of many cell types
including immune cells. Such kinases can also negatively regulate
the efficiency of recombinant AAV vector-mediated gene transfer by
phosphorylating the surface-exposed serine and/or threonine
residues on the viral capsid and target the vectors for
proteasome-mediated degradation. In the present example, the
following were documented: (i) Site-directed mutagenesis of the 15
surface-exposed serine (S) residues on the AAV2 capsid to valine
(V) residues leads to improved transduction efficiency of S458V,
S492V, and S662V mutant vectors compared with the WT AAV2 vector;
(ii) The S662V mutant vector efficiently transduces human
monocyte-derived dendritic cells (moDCs), a cell type not readily
amenable to transduction by the conventional AAV vectors; (iii)
High-efficiency transduction of moDCs by S662V mutant does not
induce any phenotypic changes in these cells; and (iv) Recombinant
S662V-vectors encoding a truncated human telomerase (hTERT) gene,
used to transduced DCs result in rapid, specific T-cell clone
proliferation and generation of robust CTLs, which leads to
specific cell lysis of K562 cells.
[0319] Materials and Methods
[0320] Cells and Antibodies.
[0321] HEK293, HeLa and NIH3T3 cells were obtained from the
American Type Culture Collection and maintained as monolayer
cultures in DMEM (Invitrogen) supplemented with 10% FBS (Sigma) and
antibiotics (Lonza). Leukapheresis-derived peripheral blood
mononuclear cells (PBMCs) (AllCells) were purified on Ficoll-Paque
(GEHeathCare), resuspended in serum-free AIM-V medium (Lonza), and
semi-adherent cell fractions were incubated for 7 days with
recombinant human IL-4 (500 U/mL) and GM-CSF (800 U/mL) (R&D
Systems). Cell maturation was initiated with a cytokine mixture
including 10 ng/mL TNF-.alpha., 10 ng/mL IL-1, 10 ng/mL IL-6, and 1
mg/mL PGE2 (R&D Systems) for 48 hrs. Prior to EGFP expression
cells were characterized for co-stimulatory molecules expression to
ensure that they met the typical phenotype of mature dendritic
cells (mDC) (CD80, RPE, murine IgG1; CD83, RPE, murine IgG1; CD86,
FITC, murine IgG1; Invitrogen). (Jayandharan et al., 2011)
[0322] Site-Directed Mutagenesis.
[0323] A two-stage PCR was performed with plasmid pACG2 as
described previously (Wang and Malcolm, 1999) using Turbo Pfu
Polymerase (Stratagene). Briefly, in stage one, two PCR extension
reactions were performed in separate tubes for the forward and
reverse PCR primer for 3 cycles. In stage two, the two reactions
were mixed and a PCR reaction was performed for an additional 15
cycles, followed by DpnI digestion for 1 hr. Primers were designed
to introduce changes from serine (TCA or AGC) to valine (GTA or
GTC) for each of the residues mutated.
[0324] Production of Recombinant AAV Vectors.
[0325] Recombinant AAV2 vectors containing the EGFP gene driven by
the chicken .beta.-actin promoter were generated as described
previously (Zologukhin et al., 2002). Briefly, HEK293 cells were
transfected using polyethelenimine (PEI, linear, MW 25,000,
Polyscinces, Inc.). Seventy-two hrs post transfection, cells were
harvested and vectors were purified by iodixanol (Sigma) gradient
centrifugation and ion exchange column chromatography (HiTrap Sp Hp
5 mL, GE Healthcare). Virus was then concentrated and the buffer
exchanged in three cycles to lactated Ringer's using centrifugal
spin concentrators (Apollo, 150-kDa cut-off, 20-mL capacity, CLP)
(Cheng et al., 2011). Ten .mu.L of purified virus was treated with
DNAse I (Invitrogen) for 2 hr at 37.degree. C., then an additional
2 hr with proteinase K (Invitrogen) at 56.degree. C. The reaction
mixture was purified by phenol/chloroform, followed by chloroform
treatment. Packaged DNA was precipitated with ethanol in the
presence of 20 .mu.g glycogen (Invitrogen). DNAse I-resistant AAV
particle titers were determined by RT-PCR with the following
primer-pair, specific for the CBA promoter:
TABLE-US-00005 Forward (SEQ ID NO: 18) 5'-TCCCATAGTAACGCCAATAGG-3',
Reverse (SEQ ID NO: 19) 5'-CTTGGCATATGATACACTTGATG-3'
[0326] and SYBR Green PCR Master Mix (Invitrogen) (Aslanidi et al.,
2009).
[0327] Recombinant AAV Vector Transduction Assays In Vitro.
[0328] HEK293 or monocyte-derived dendritic cells (moDCs), were
transduced with AAV2 vectors with 1,000 vgs/cell or 2,000 vgs/cell
respectively, and incubated for 48 hrs. Alternatively, cells were
pretreated with 50 .mu.M of selective serine/threonine kinase
inhibitors 2-(2-hydroxyethylamino)-6-aminohexylcarbamic acid
tert-butyl ester-9-isopropylpurine (for CaMK-II),
anthra[1,9-cd]pyrazol-6(2H)-one, 1,9-pyrazoloanthrone (for JNK),
and
4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole
(for MAPK) (CK59, JNK inhibitor 2, PD 98059, Calbiochem), 1 hr
before transduction. Transgene expression was assessed as the total
area of green fluorescence (pixel2) per visual field (mean.+-.SD)
as described previously (Markusic et al., 2011; Jayandharan et al.,
2011). Analysis of variance was used to compare test results and
the control, which were determined to be statistically
significant.
[0329] Western Blot Analysis.
[0330] Western blot analysis was performed as described previously.
(Akache et al., 2006) Cells were harvested by centrifugation,
washed with PBS, and resuspended in lysis buffer containing 50 mM
TrisHCl, pH 7.5, 120 mM NaCl, 1% Nonidet P-40, 10% glycerol, 10 mM
Na4P2O7, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM EDTA, and
1 mM EGTA supplemented with protease and phosphotase inhibitors
mixture (Set 2 and 3, Calbiochem). The suspension was incubated on
ice for 1 hr and clarified by centrifugation for 30 min at 14,000
rpm at 4.degree. C. Following normalization for protein
concentration, samples were separated using 12% polyacrylamide/SDS
electrophoresis, transferred to a nitrocellulose membrane, and
probed with primary antibodies, anti p-p38 MAPK (Thr180/Tyr182)
rabbit mAb, total p38 MAPK rabbit mAb and GAPDH rabbit mAb (1:1000,
CellSignaling), followed by secondary horseradish peroxidase-linked
linked antibodies (1:1000, CellSignaling).
[0331] Specific Cytotoxic T-Lymphocytes Generation and Cytotoxicity
Assay.
[0332] Monocyte-derived dendritic cells (moDCs) were generated as
described above. Immature DCs were infected with AAV2-S662V vectors
encoding human telomerase cDNA, separated into two overlapping
ORF--hTERT838-2229 and hTERT2042-3454 at MOI 2,000 vgs/cell of
each. Cells were then allowed to undergo stimulation with
supplements to induce maturation. After 48 hr, the mature DCs
expressing hTERT were harvested and mixed with the PBMCs at a ratio
of 20:1. CTLs were cultured in AIM-V medium containing recombinant
human IL-15 (20 IU/mL) and IL-7 (20 ng/mL) at 20.times.10.sup.6
cells in 25 cm.sup.2 flasks. Fresh cytokines were added every 2
days. After 7 days post-priming, the cells were harvested and used
for killing assays (Heiser et al., 2002). A killing curve was
generated and specific cell lysis was determined by FACS analysis
of live/dead cell ratios as described previously (Mattis et al.,
1997). Human immortalized myelogenous leukemia cell line, K562, was
used as a target.
[0333] Statistical Analysis.
[0334] Results are presented as mean.+-.S.D. Differences between
groups were identified using a grouped-unpaired two-tailed
distribution of Student's T-test. P-values <0.05 were considered
statistically significant.
[0335] Results
[0336] Inhibition of Specific Cellular Serine/Threonine Kinase
Increases Transduction Efficiency of rAAV2 Vectors.
[0337] In previous studies, inhibition of cellular epidermal growth
factor receptor protein tyrosine kinase (EGFR-PTK) activity and
site-directed mutagenesis of the 7 surface-exposed tyrosine
residues was shown to significantly increase to the transduction
efficiency of AAV2 vectors by preventing phosphorylation of these
residues, thereby circumventing ubiquitination and subsequent
proteasome-mediated degradation of the vectors (Zhong et al.,
2008). However, AAV2 capsids also contain 15 surface-exposed serine
residues, which can potentially be phosphorylated by cellular
serine/threonine kinases widely expressed in various cell types and
tissues. To test the hypothesis that inhibition of such kinase
activity can prevent phosphorylation of surface-exposed serine
residues and thus improve intracellular trafficking and nuclear
transport of AAV2 vectors, several commercially available specific
inhibitors of cellular serine/threonine kinases were used,
including calmodulin-dependent protein kinase II (CamK-II), c-Jun
N-terminal kinase (JNK); and mitogen-activated protein kinase (p38
MAPK). HEK293 cells were pre-treated with specific inhibitors, such
as 2-(2-hydroxyethylamino)-6-aminohexylcarbamic acid tert-butyl
ester-9-isopropylpurine (for CaMK-II),
anthra[1,9-cd]pyrazol-6(2H)-one, 1,9-pyrazoloanthrone (for JNK),
and
4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole
(for p38 MAPK) for 1 hr at various concentrations. Cells were
subsequently transduced with either single-stranded (ss) or
self-complementary (sc) AAV2 vectors at 1,000 vector genomes (vgs)
per cell. These results indicated that all inhibitors at an optimal
concentration of 50 .mu.M significantly increased the transduction
efficiency of ssAAV2 and scAAV2 vectors, the p38 MAPK inhibitor
being the most effective (FIG. 19A and FIG. 19B). This observation
suggests, albeit does not prove, that the increase in the
transduction efficiency was most likely due to prevention of
phosphorylation of vector capsids rather than improved viral
second-strand DNA synthesis.
[0338] Site-Directed Mutagenesis of Surface-Exposed Serine Residues
on AAV2 Capsid Improves AAV2 Vector-Mediated Transgene Expression.
The AAV2 capsid contains 50 serine (S) residues in the viral
protein 3 (VP3) common region of the three capsid VPs, of which 15
(S261, S264, S267, S276, S384, S458, S468, S492, S498, S578, S658,
S662, S668, S707, S721) are surface-exposed. (Xie et al., 2002)
Each of the 15 S residues was substituted with valine (V) by
site-directed mutagenesis as described (Zhong et al., 2008). Most
mutants could be generated at titers similar to the WT AAV2
vectors, with the exception of S261V, S276V, and S658V, which were
produced at .about.10 times lower titers, and S267V and S668V,
which produced no detectable levels of DNAse I-resistant vector
particles. The titers of S468V and S384V mutants were .about.3-5
times higher than the WT AAV2 vectors. Each of the S-V mutant
vectors was evaluated for transduction efficiency in HEK293 cells.
These results, shown in FIG. 20, indicate that of the 15 mutants,
the S662V mutant transduced HEK293 cells .about.20-fold more
efficiently than its WT counterpart did. The transduction
efficiency of the S458V and the S492V mutant vectors was increased
by .about.4- and 2-fold, respectively. The positions of these three
critical surface exposed serine residues on the AAV2 capsid are
shown in FIG. 21A and FIG. 21B. No further increase in transduction
efficiency was observed with the double-mutants (S458+662V and
S492+662V), or the triple-mutant (S458+492+662V), indicating that
unlike some of the tyrosine-mutants, combining multiple mutations
in the serine residues was neither additive nor synergistic.
Interestingly, the transduction efficiency of the S468V and the
S384V mutants, which were produced at titers higher than the WT
AAV2 vectors, remained unchanged (S468V) or were reduced
.about.10-fold (S384V) at the same multiplicity of infection (MOI).
These data are summarized in FIG. 34.
[0339] Substitution of S662 with Different Amino Acids has Diverse
Effects on AAV2 Capsid Assembly and AAV2 Vector-Mediated Transgene
Expression. In addition to S-to-V substitution at position 662, the
following 7 mutants with different amino acids were also generated:
S662.fwdarw.Alanine (A), S662.fwdarw.Asparagine (N),
S662.fwdarw.Aspartic acid (D), S662.fwdarw.Histidine (H),
S662.fwdarw.Isoleucine (I), S662.fwdarw.Leucine (L), and
S662.fwdarw.Phenylalanine (F), and evaluated their transduction
efficiency in 293 cells. These results, shown in FIG. 22 and
summarized in FIG. 35, demonstrate that the substitution of S with
V led to the production of the most efficient mutant without any
change in vector titers. Replacement of S with N, I, L, or F
decreased the packaging efficiency .about.10-fold with no
significant effect on the transduction efficiency, whereas
substitution with D or H increased the transduction efficiency
.about.8-fold and .about.4-fold, respectively, with no effect on
vector titers. Interestingly, substitution of S to A increased the
viral titer up to .about.5-fold, and enhanced the transgene
expression .about.3-fold compared with the WT AAV2 vector. The
observed variability in titers and infectivity of the
serine-mutants at position 662 suggests the critical role each of
the amino acids plays in modulating both AAV2 packaging efficiency
and biological activity.
[0340] Transduction Efficiency of S662V Vectors Correlate with p38
MAPK Activity.
[0341] Since all of the S662V vector-mediated transgene expression
data thus far were derived using 293 cells, these studies were
extended to include the following cells types: (i) NIH3T3 (mouse
embryonic fibroblasts), (ii) H2.35 (mouse fetal hepatocytes), (iii)
HeLa (human cervical cancer cells), and (iv) primary human
monocyte-derived dendritic cells (moDCs). These cell types were
transduced with WT scAAV2-EGFP or S662V scAAV2-EGFP vectors at an
MOI of 2,000 vgs per cell under identical conditions. EGFP gene
expression was evaluated 48 hrs post-infection (p.i.) for HeLa, 293
and moDCs, and 5 days p.i. for H2.35 and NIH3T3 cells. These
results are shown in FIG. 23A. As can be seen, although the
absolute differences in the transduction efficiency between WT and
S662V mutant vectors ranged from .about.3-fold (in H2.35 cells) to
.about.20-fold (in 293 cells) the mutant vector was consistently
more efficient in each cell type tested. Since pre-treatment of
cells with an inhibitor of cellular p38 MAPK was the most effective
in increasing the transduction efficiency (FIG. 19A and FIG. 19B),
the inventors examined whether or not the observed differences in
the transduction efficiency of the WT and the mutant vectors was
due to variations in the levels of expression and/or activity of
the cellular p38 MAPK. Cell lysates prepared from each cell type
were analyzed on Western blots probed with specific antibodies to
detect both total p38 MAPK and phospho-p38 MAPK levels. GAPDH was
used as a loading control. These results, shown in FIG. 23B,
indicate that whereas the p38 MAPK protein levels were similar, the
kinase activity, as determined by the level of phosphorylation,
varied significantly among different cell types, and the
transduction efficiency of the S662V mutant vector correlated
roughly with the p38 MAPK activity. These approximate correlations
between p38 MAPK activity and the efficiency of the S662V mutant
vector can probably be explained by different cell susceptibilities
for AAV infection, the overall number of viral particles entered
cell after primary infection. It remains unclear as to which
precise steps in the life cycle of AAV are modulated by p38
MAPK-mediated phosphorylation. It is also possible that other
serine/threonine kinases contributing to the difference in
efficiency of transduction by S662V and WT vectors. Interestingly,
however, transduction by the WT-AAV2 vectors did not lead to up
regulation of phosphorylation of p38 MAPK in 293 cells or in moDC,
further supporting a previous report that AAV does not induce
robust phenotypic changes in moDCs (Markusic et al., 2011).
[0342] S662V Vector-Mediated Transduction of Primary Human moDCs
does not Lead to Phenotypic Alterations.
[0343] MAPK family members play important roles in the development
and maturation of APCs. moDCs, isolated from healthy donor
leukapheresis, were treated with 50 .mu.M selective kinase
inhibitors as described above and then transduced with WT
scAAV2-EGFP vectors. Two hrs p.i., cells were treated with
supplements (TNF-.alpha., IL-1.beta., Il-6, PGE2) to induce
maturation. EGFP transgene expression was evaluated 48 hrs p.i. by
fluorescence microscopy. Pre-treatment of moDCs with specific
inhibitors of JNK and p38 MAPK increased EGFP expression levels
.about.2-fold and .about.3-fold, respectively, and the transduction
efficiency was enhanced by .about.5-fold with the S662V mutant
vectors (FIG. 24). Since inhibition of these kinases has previously
been reported to prevent maturation of dendritic cells (Beisleve et
al., 2005; Nakahara et al., 2006; Nakahara et al., 2004; Harley,
2008), the capability of S662V mutant to induce phenotypic changes
in DCs also was evaluated. moDC were infected with an increasingly
higher MOI up to 50,000 vgs per cell, harvested at 48 hrs p.i., and
analyzed by fluorescence-activated cell sorting (FACS) for up
regulation of surface co-stimulatory molecules. Flow cytometric
analyses of DC maturation markers such as CD80, CD83 and CD86
indicated that, similar to WT AAV2 vectors, the S662V mutant
vectors also did not induce the maturation of moDCs (FIG. 24C).
This observation supports the previously described low
immunogenicity of AAV vectors. (Shin et al., 2008; Jayandharan et
al., 2011)
[0344] hTERT-Specific CTL Generation by moDC Transduced with
AAV2-S662V Vectors.
[0345] Since the serine-mutant AAV2 vector-mediated transgene
expression in moDC was significantly improved compared with the
WT-AAV2 vectors, the ability of S662V-loaded moDCs to stimulate the
generation of cytotoxic T-lymphocytes and effect specific killing
of the target cell was examined. Given that human telomerase is
recognized as a unique anti-cancer target (Harley, 2008; Beatty and
Vonderheide, 2008) commonly expressed in most cancer cells, a
truncated human telomerase (hTERT) gene was cloned under the
control of the chicken .beta.-actin promoter and packaged the DNA
into the AAV2 S662V mutant. Non-adherent peripheral blood
mononuclear cells (PBMC) containing up to 25% of CD8 positive cells
were stimulated once with moDC/hTERT delivered by the S662V vector.
An immortalized myelogenous leukemia cell line, K562, was used for
a two-color fluorescence assay of cell-mediated cytotoxicity to
generate a killing curve with subsequently reduced effector to
target cell ratio. Result of these experiments, shown in FIG. 25,
suggest that moDC loaded with hTERT can effectively stimulate
specific T cell clone proliferation and killing activity compared
with moDC expressing GFP. Thus, since immunization strategies that
generate rapid and potent effector responses are essential for
effective immunotherapy, these results support the efficacy of
AAV-based delivery methods for vaccination studies.
[0346] Discussion
[0347] Although the possibility of genetically-modified dendritic
cells stimulating a specific anti-tumor cytotoxic T cell response
has been proven in a number of clinical trials, a reliable method
for therapeutic antigen loading, control of expression, and antigen
presentation has not yet been previously developed (O'Neill and
Bhardwaj, 2007; Tacken et al., 2007). Since the first attempts to
transduce dendritic cells with conventional ssAAV vectors nearly a
decade ago (Pannazhagan et al., 2001), significant progress has
been made in increasing the transduction efficiency of these
vectors. For example, the development of self-complementary AAV
(ssAAV) vectors has circumvented a major rate-limiting step of
viral second-strand DNA synthesis, which dramatically increases
transgene expression levels in different subsets of dendritic
cells. (Shin et al., 2008; Aldrich et al., 2006; Wang et al., 2003)
AAV vector-based antigen delivery to dendritic cells has
successfully been utilized for several cancer models. (Mahadevan et
al., 2007; Eisold et al., 2007; Yu et al., 2008)
[0348] The natural flexibility of AAV structural and regulatory
viral components promotes rapid molecular evolution and formation
of numerous serologically distinct serotypes (Gao et al., 2003;
Vandenberghe et al., 2009; Wu et al., 2006). Several studies have
shown that one can take advantage of such plasticity of AAV to
generate new vectors with different cell and tissue tropism (Wu et
al., 2000; Girod et al., 1999). Other studies revealed that
substitution of a single amino acid on the viral capsid can
strongly affect viral titer, interaction with cellular receptor,
tissue-tropism and trafficking from endosome to the nucleolus
(Zhong et al., 2008; Wu et al., 2006). Wu et al. (2006) have
reported that replacement of lysine to glutamine at position 531
(K531E) on AAV6 capsid reduces gene transfer to mouse hepatocytes
in vivo and affinity for heparin. The reverse mutation (E531K) on
AAV1 capsid increased liver transduction and imparted heparin
binding.
[0349] Data with AAV2 serotype vectors indicate that a single
substitution of tyrosine to phenylalanine (Y.fwdarw.F) dramatically
improves viral trafficking from endosome to the nucleolus by
preventing capsid phosphorylation, subsequent ubiquitination and
degradation via proteasome (Zhong et al., 2008). These studies have
led to the generation of a number of vectors with increased
transduction efficiency in different cell types and tissues. Such
vectors were used to improve F.IX gene transfer to murine
hepatocytes for the phenotypic correction of hemophilia B (Markusic
et al., 2011). These tyrosine-mutant AAV vectors also led to high
efficiency transduction of mouse retina for the potential treatment
of ocular diseases (Petrs-Zilva et al., 2009). Although AAV6
serotype has shown higher transduction efficiency than AAV2 in
dendritic cells (Veron et al., 2007; Taylor and Ussher, 2010),
these studies have focused on AAV2 because these vectors have been
studied more extensively in both basic research and clinical
settings, however AAV6 vectors may be developed with a similar
strategy as described herein.
[0350] It has become abundantly clear that phosphorylation of
surface-exposed tyrosine-residues on AAV2 capsids negatively
impacts the transduction efficiency of these vectors, which can be
dramatically augmented by the use of specific inhibitors of
cellular EGFR-PTK, known to phosphorylate these residues (Zhong et
al., 2008). In the present example, the role of phosphorylation of
serine residues in the life cycle of AAV2 vectors was more fully
delineated.
[0351] Indeed, the transduction efficiency of both ssAAV and scAAV
vectors could be augmented by pre-treatment of cells with specific
inhibitors of JNK and p38 MAPK, implying that one or more
surface-exposed serine and/threonine residues on the AAV2 capsid
becomes phosphorylated inside the host cell and that this
modification is detrimental to capsid trafficking to the
nucleus.
[0352] Next, each of 15 surface-exposed serine residues was mutated
individually, but only three of these mutations led to an increase
in transduction efficiency in different cell types, which ranged
from .about.2-fold to .about.20-fold. However, unlike the
tyrosine-mutants (Markusic et al., 2011), combining multiple
mutations did not augment the transduction efficiency of either the
double-mutants (S458+662V and S492+662V), or the triple-mutant
(S458+492+662V) AAV2 vectors in vitro. In this context, it is
noteworthy that in a report by DiPrimio et al., (DiPrimio et al.,
2008), in which the HI loop located between the H and I strands of
the conserved core .beta.-barrel and contains residue S662 was
characterized, both site-directed mutagenesis and peptide
substitutions showed that this capsid region plays a crucial role
in AAV capsid assembly and viral genome packaging (FIG. 22A and
FIG. 22B) (Xie et al., 2002). Although the S662 residue was not
specifically targeted in those studies, the transduction efficiency
of most of these mutants was either unchanged, or was reduced by up
to 27-fold. The HI loop, which forms interactions between
icosahedral five-fold symmetry related VPs and lies on the floor of
the depression surrounding this axis, was also proposed to undergo
a conformational re-arrangement that opens up the channel located
at the icosahedral fivefold axis following heparin binding by AAV2
(Levy et al., 2009). Residues S458 and 492 are located adjacent to
each other (contributed from symmetry related VPs) on the outer
surface of the protrusions (surrounding the icosahedral three-fold
axes) facing the depression at the two-fold axes. Previous mutation
of residues adjacent to S458A, S492A and S492T had no effect on
capsid assembly and resulted in no effect on transduction
efficiency (Lochrie et al., 2006), which confirms the critical role
that particular amino acids plays in packaging efficiency and
biological activity of AAV. Additional structural analyses of these
data revealed the following: For the three mutants with low yields,
the side-chain of the residues interact with main-chain atoms from
the same VP monomer, and S267V with a low titer, interacts with
D269 from the same monomer. For another capsid mutant, S668V, which
is located in the HI loop and shown to play a role in capsid
assembly (DiPrimio et al., 2008), no obvious disruption of
interaction was observed with the substitution. Interestingly, all
of these residues, regardless of assembly phenotype, are at
interface positions but only 458 and 492 involved in inter-VP
interactions. The other residues are only involved in intra-VP
interactions, if any. Thus, it is possible that the changes in the
no capsid or low capsid yield mutants result in misfolding for
their VPs or the abrogation of formation of multimers formation
required for assembly when changed to alanine.
[0353] In the setting of tumor immunotherapy, the time of T cell
activation and the potency and longevity of CD8 T cell responses
are crucial factors in determining therapeutic outcome. Thus, the
investors further evaluated whether increased transduction
efficiency of moDC by the serine-mutant AAV2 vectors correlated
with superior priming of T cells. Human telomerase was used as a
specific target since it has been shown in numerous studies and
clinical trials to be an attractive candidate for a broadly
expressed rejection antigen for many cancer patients (Harley, 2008;
Beatty and Vonderheide, 2008). These results suggest that
modification of the AAV2 capsid might be beneficial in terms of
producing more specific and effective vectors for gene
delivery.
[0354] It is also important that one of the main obstacles, the
induction of immuno-competition in cellular immune responses
against vector-derived and transgene-derived epitopes, can probably
be overcome not only by the replication-deficiency and lack of
viral proteins expressed by recombinant AAV2, but also the fact
that less capsid of modified viral particles will be degraded by
host proteosomes and thus, provide less material for
presentation.
Example 5
Optimization of the Capsid of rAAV2 Vectors
[0355] Adeno-associated virus (AAV) vectors are currently in use in
a number of Phase I/II clinical trials as delivery vehicles to
target a variety of tissues to achieve sustained expression of
therapeutic genes (Daya and Berns 2008; Mueller and Flotte 2008;
Srivastava 2008; Asokan et al., 2012; Flotte et al., 2012).
However, large vector doses are needed to achieve therapeutic
benefits. The requirements for sufficient amounts of the vector
pose a production challenge, as well as the risk of initiating the
host immune response to the vector (High and Aubourg, 2011; Mendell
et al., 2012, Mingozzi and High, 2011). More specifically,
recombinant vectors based on AAV2 serotype were initially used in a
clinical trial for the potential gene therapy of hemophilia B, but
in this trial, therapeutic level of expression of human Factor IX
(hF.IX) was not achieved at lower vector doses, and at higher
vector doses, the therapeutic level of expression of hF.IX was
short-lived due to a cytotoxic T cell (CTL) response against AAV2
capsids (Manno et al., 2006; Mingozzi and High, 2007; Mingozzi et
al., 2007).
[0356] In a more recent trial with recombinant vectors based on
AAV8 serotype, therapeutic levels of expression of hF.IX were been
achieved, but an immune response to AAV8 capsid proteins was
observed (Aslanidi et al., 2012). Thus, it is critical to develop
novel AAV vectors with high transduction efficiency that can be
used at lower doses. Cellular epidermal growth factor receptor
protein tyrosine kinase (EGFR-PTK) negatively affects transgene
expression from recombinant AAV2 vectors primarily due to
phosphorylation of AAV2 capsids at tyrosine residues, and
tyrosine-phosphorylated capsids are subsequently degraded by the
host proteasome machinery (Zhong et al., 2008; Markusic et al.,
2010). Selective inhibitors of JNK and p38 MAPK serine/threonine
kinases also improved the transduction efficiency of AAV2 vectors,
suggesting that phosphorylation of certain surface-exposed serine
and/or threonine residues might also decrease the transduction
efficiency of these vectors. These studies led to the development
of tyrosine- and serine-mutant AAV2 vectors, which has been shown
to transduce various cell types with significantly higher
efficiency than the WT vectors. (Aslanidi et al., 2012; Zhong et
al., 2008; Markusic et al., 2010; Petrs-Silva et al., 2009) In
addition to the tyrosine and serine residues, the elimination of
surface-exposed threonine residues by site-directed mutagenesis
also led to an increase in the transduction efficiency at lower
vector doses. In this example, each of the 17 surface-exposed
threonine residues was substituted with valine (V) residues by
site-directed mutagenesis, and four of these mutants, T455V, T491V,
T550V, T659V, were shown to increase the transduction efficiency
between fold in human HEK293 cells. Because the tyrosine
triple-mutant (Y730F+500+444F) vector transduced murine hepatocytes
most efficiently than WT (Aslanidi et al., 2012; Zhong et al.,
2008; Markusic et al., 2010; Petrs-Silva et al., 2009), these
mutations were subsequently combined with the best-performing
single serine-mutant (S662V) and single threonine-mutant (T491V) to
generate the following vectors: two quadruple (Y444+500+730F+S662V;
Y730+500+44F+T491V) and one quintuple (Y444+500+730F+S662V+T491V).
The quadruple-mutant (Y444+500+730F+T491V) vector efficiently
transduced a murine hepatocyte cell line in vitro as well as
primary murine hepatocytes in vivo at reduced doses, which
implicated the use of these vectors in human gene therapy in
general, and hemophilia in particular.
[0357] Materials and Methods
[0358] Cells.
[0359] Human embryonic kidney cell line, HEK293, and murine
hepatocyte cell line, H2.35, cells were obtained from the American
Type Culture Collection (Manassas, Va., USA), and maintained as
monolayer cultures in DMEM (Invitrogen) supplemented with 10% fetal
bovine serum (FBS; Sigma) and antibiotics (Lonza).
[0360] Production of Recombinant Vectors.
[0361] Recombinant AAV2 vectors containing either EGFP (scAAV2-GFP)
or firefly luciferase gene (Flue) (ssAAV2-Fluc) driven by the
chicken .beta.-actin promoter (CBA) were generated as described
previously (Aslanidi et al., 2012; Aslanidi et al., 2009;
Zolotukhin et al., 2002; Kohlbrenner et al., 2005). Briefly, HEK293
cells were transfected using polyethylenimine (PEI, linear, MW
25,000, Polysciences, Inc.). Seventy-two hrs' post-transfection,
cells were harvested and vectors were purified by iodixanol (Sigma)
gradient centrifugation and ion exchange column chromatography
(HiTrap Sp Hp 5 mL, GE Healthcare). Virus was then concentrated and
buffer exchanged into Lactated Ringer's solution in three cycles
using centrifugal spin concentrators (Apollo, 150-kDa cut-off,
20-mL capacity, CLP). To determine genome titers, ten IA of
purified virus were incubated with DNase I (Invitrogen) at
37.degree. C. for 2 hr, then with Proteinase K (Invitrogen) at
55.degree. C. for an additional 2 hr. The reaction mixture was
purified by phenol/chloroform, followed by chloroform extraction.
Packaged DNA was precipitated O/N with ethanol in the presence of
20 .mu.g glycogen (Invitrogen). DNase I-resistant AAV2 particle
titers were determined by qPCR with the following primer-pairs
specific for the CBA promoter:
TABLE-US-00006 Forward: (SEQ ID NO: 20)
5'-TCCCATAGTAACGCCAATAGG-3', Reverse: (SEQ ID NO: 21)
5'-CTTGGCATATGATACACTTGATG-3',
[0362] and SYBR GreenER PCR Master Mix (Invitrogen) (Aslanidi et
al., 2012; Aslanidi et al., 2009).
[0363] Site-Directed Mutagenesis.
[0364] A two-stage PCR was performed with plasmid pACG2 as
described previously (Aslanidi et al., 2012; Wang and Malcolm,
1999) using Turbo Pfu Polymerase (Stratagene). Briefly, in stage
one, two PCR extension reactions were performed in separate tubes
for the forward and reverse PCR primers for 3 cycles. In stage two,
the two reactions were mixed and a PCR reaction was performed for
an additional 15 cycles, followed by DpnI digestion for 1 hr.
Primers were designed to introduce changes from threonine (ACA) to
valine (GTA) for each of the residues mutated.
[0365] Recombinant AAV Vector Transduction Assays In Vitro.
[0366] Human HEK293 were transduced with 1.times.10.sup.3 vgs/cell,
and murine hepatocytes H2.35 cells were transduced with
2.times.10.sup.3 vgs/cell with WT and mutant scAAV2-GFP vectors,
respectively, and incubated for 48 hr. Transgene expression was
assessed as the total area of green fluorescence (pixel2) per
visual field (mean.+-.SD) as described previously (Aslanidi et al.,
2012; Zhong et al., 2008; Markusic et al., 2010). Analysis of
variance was used to compare test results and the control, which
were determined to be statistically significant.
[0367] Analysis of Vector Genome Distribution in Cytoplasm and
Nuclear Fractions.
[0368] Approximately 1.times.10.sup.6 H2.35 cells were infected by
either WT or mutant scAAV2-GFP vectors with MOI 1.times.10.sup.4
vgs/cell. Cells were collected at various time points by trypsin
treatment to remove any adsorbed and un-adsorbed viral particles
and then washed extensively with PBS. Nuclear and cytoplasmic
fractions were separated with Nuclear and Cytoplasmic Extraction
Reagents kit (Thermo Scientific) according to manufacturer
instruction. Viral genome was extracted and detected by qPCR
analysis with the CBA specific primers described above. The
difference in amount of viral genome between cytoplasmic and
nuclear fractions was determined by the following rule: C.sub.T
values for each sample from cells treated with virus were
normalized to corresponding C.sub.T from mock treated cells
(.DELTA.C.sub.T). For each pairwise set of samples, fold change in
packaged genome presence was calculated as fold
change=2.sup.-(.DELTA.CT-cytoplasm-.DELTA.CT-nucleus). Data from
three independent experiments were presented as a percentage of the
total amount of packaged genome in the nuclear and cytoplasmic
fractions.
[0369] In Vivo Bioluminescence Imaging.
[0370] All animal experiments were performed per institutional
policies, and all procedures were done in accordance with the
principles of the National Research Council's Guide for the Care
and Use of Laboratory Animals. All efforts were made to minimize
suffering. Ten-week-old C57BL/6 male mice (Jackson Laboratory, Bar
Harbor, Me.) were injected intravenously with 1.times.10.sup.10
vgs/animal of WT and mutant ssAAV2-Fluc vectors (n=3). Luciferase
activity was analyzed two weeks post injection using a Xenogen IVIS
Lumina System (Caliper Life Sciences). Briefly, mice were
anesthetized with 2% isofluorane and injected intraperitoneally
with luciferin substrate (Beetle luciferin, Caliper Life Sciences)
at a dose of 150 .mu.g/g of body weight. Mice were placed in a
light-tight chamber and images were collected at 5 min after the
substrate injection. Images were analyzed by the Living Image 3.2
software (Caliper Life Sciences) to determine relative signal
intensity.
[0371] Visualization of the Position of the Mutant Residues on the
AAV2 Capsid.
[0372] The atomic coordinates for the AAV2 VP3 crystal structure
(residues 217 to 735, VP1 numbering) (Protein Data Bank (PDB)
accession no. 1lp3; [Xie et al., 2002]) was downloaded and used to
generate a complete capsid model using the Oligomer generator
application in VIPERdb (Carrillo-Trip et al., 2009). This generates
60 VP3 copies for creating the T=1 icosahedral capsid via matrix
multiplication. The structure was viewed with the program COOT (Xie
et al., 2002) and figures were generated using either of the
computer programs, PyMOL (Schrodinger, LLC) and RIVEM (Xiao and
Rossman, 2007).
[0373] Statistical Analysis.
[0374] Results are presented as mean.+-.S.D. Differences between
groups were identified using a grouped-unpaired two-tailed
distribution of Student's t-test. P-values <0.05 were considered
statistically significant.
[0375] Results
[0376] Site-Directed Mutagenesis of Surface-Exposed Threonine
Residues on AAV2 Capsid.
[0377] The AAV2 capsid contains 45 threonine (T) residues in the
capsid viral protein 3 (VP3) common region of the three capsid VPs,
VP1, VP2, and VP3. Seventeen of these (251, 329, 330, 454, 455,
503, 550, 592, 581, 597, 491, 671, 659, 660, 701, 713, 716) are
surface-exposed. (Xie et al., 2002) Each of the 17 T residues was
substituted with valine (V) by site-directed mutagenesis as
described previously (Aslanidi et al., 2012; Zhong et al., 2008).
Most mutants could be generated at titers similar to the WT AAV2
vectors, with the exception of T329V and T330V that were produced
at .about.10-fold lower titers, and T713V and T716V, which produced
no detectable levels of DNase I-resistant vector particles. Each of
the T-V mutant vectors was evaluated for transduction efficiency in
HEK293 cells. These results, shown in FIG. 26A and FIG. 26B,
indicate that of the 17 mutants, the T491V mutant transduced HEK293
cells .about.4-fold more efficiently than its WT counterpart did.
The transduction efficiency of the T455V, T550V, T659V mutant
vectors were increased by .about.2-fold. These data indicated that
phosphorylation of specific tyrosine, serine, and threonine
residues on AAV2 capsid by cellular kinases is a critical
determinant of the transduction efficiency of these vectors.
[0378] Multiple Mutations of Surface-Exposed Threonine Residues
Further Improve Transduction Efficiency of AAV2 Vectors.
[0379] To evaluate whether the transduction efficiency of the
threonine-mutant AAV2 vectors could be enhanced further, the
following multiple-mutant vectors were generated: three
double-mutants (T455+491V; T550+491V; T659+491V), two
triple-mutants (T455+491+550V; T491+550+659V), and one
quadruple-mutant (T455+491+550+659V). Each of the multiple-mutant
vectors packaged genome titers similar to the WT AAV2 vectors. In
side-by-side comparisons, each of the multiple-mutant vectors was
shown to transduce HEK293 more efficiently than the WT and the
single-threonine mutant AAV2 vectors (FIG. 27A and FIG. 27B). The
best performing vector was identified to be the triple-mutant
(T491+550+659V), with the transduction efficiency .about.10-fold
higher than the WT vector, and .about.3-fold higher than the best
single-mutant (T491V) vector. These data confirmed that combining
several threonine-mutations on a single viral capsid led to a
synergetic effect in augmenting the transduction efficiency.
[0380] Optimized Threonine-Mutant AAV2 Vectors Efficiently
Transduce Murine Hepatocytes In Vitro.
[0381] The tyrosine triple-mutant (Y444+550+730F) vector described
in previous examples has been shown to be efficient in transducing
murine hepatocytes in a comparison of vectors containing up to 7
surface tyrosine to phenylalanine changes (Markusic et al. 2010;
Jayandharan et al., 2011). Thus, it was of interest to evaluate
whether combining the best performing single-serine (S662V) and
single-threonine (T491V) mutations with the triple-tyrosine mutant
could further increase the transduction efficiency of these vectors
to produce even further improved expression vectors in accordance
with the methods described herein.
[0382] To that end, several multiple-mutants were generated as
follows: two quadruple (Y444+500+730F+T491V; Y444+500+730F+S662V),
and one quintuple (Y444+500+730F+T491V+S662V) mutant vectors.
Comparison of the transduction efficiency of these mutants with the
WT and the tyrosine triple-mutant AAV2 vectors in H2.35 cells
showed that the expression level from the Y444+500+730F+T491V
mutant was .about.2-3-fold higher than for the tyrosine
triple-mutant AAV2 vector, and .about.24-fold higher than the WT
AAV2 vector (FIG. 28A and FIG. 28B). Interestingly, combining the
S662V mutation with the tyrosine triple-mutant vector, or with the
tyrosine-threonine quadruple-mutant vector, negatively affected
their transduction efficiency. Addition of several other threonine
mutations, such as T550V and T659V, also did not augment the
transduction efficiency of the Y444+500+730F+T491V quadruple-mutant
AAV2 vector. Additional studies are warranted to gain a better
understanding of the complex interactions among these
surface-exposed Y, S, and T residues as well as their
phosphorylation status.
[0383] Multiple Mutations Enhance Intracellular Trafficking and
Nuclear Translocation of AAV2 Vectors.
[0384] Prevention of phosphorylation of surface-exposed tyrosine
residues on the AAV2 capsid improved intracellular trafficking of
tyrosine-mutant vectors and increases the number of the viral
genomes translocated to the nucleus (Zhong et al., 2008; Zhong et
al., 2008). In this example, the addition of the T491V mutant to
the tyrosine triple-mutant vector was assigned for its ability to
augment this transduction efficiency by further increasing nuclear
transport of these vectors. To this end, the kinetics of transgene
expression in H2.35 cells mediated by the Y444+500+730F+T491V
quadruple-mutant were evaluated and compared to the Y444+500+730F
triple-mutant and the WT AAV2 vectors. These results are shown in
FIG. 29A and FIG. 29B. As can be seen, EGFP expression from the
tyrosine-threonine quadruple-mutant vector was .about.2-3fold
higher at each tested time point, and could be detected as early as
16 hr post-infection. These results suggested that the early-onset
of transgene expression from the quadruple-mutant vectors could be
due to more efficient nuclear transport of these vectors. To test
this possibility experimentally, qPCR analysis was used to
quantitate the vector genomes in cytoplasmic and nuclear fractions
of H2.35 cells infected with the WT and the two mutant AAV2 vectors
at different time points. The vector genome ratios in the two
cellular fractions are shown in FIG. 30A and FIG. 30B. Whereas
.about.20% of the genomes from the WT AAV2 vectors, and .about.45%
of the genomes from the triple-mutant vectors were detected in the
nuclear fraction 16 hr post-infection, more than 70% of the vector
genomes from the quadruple-mutant were detected at the same
time-point. Similarly, only .about.45% of the genomes from the WT
AAV2 vectors were detected in the nuclear fraction 48 hr
post-infection, .about.80% of the genomes from the triple-mutant
vectors, and .about.90% of the vector genomes from the
quadruple-mutant were detected in the nuclear fraction at the same
time-point. Thus, these data corroborated the hypothesis that
combining the threonine (T491V) mutation with the tyrosine
triple-mutant (Y444+500+730F) vector leads to a modest improvement
in the nuclear translocation of these vectors, which correlated
with a faster onset of gene expression and the observed improvement
in the transduction efficiency.
[0385] Optimized AAV2 Vectors are Highly Efficient in Transducing
Murine Hepatocytes In Vivo.
[0386] The transduction efficiency of the optimized AAV2 vectors
was evaluated in a murine model in vivo. Each of multiple-mutant
vectors was packaged with a single-stranded firefly luciferase
(Flue) AAV2 genome, and .about.1.times.10.sup.10 vgs of each
vectors were injected intravenously into C57BL/6 mice (n=3 for each
group). Levels of expression of Fluc gene, assessed two weeks
post-injection by bioluminescence imaging, showed that expression
from the Y444+500+730F+T491V quadruple-mutant vector was
.about.3-fold higher than that from the tyrosine triple-mutant
vector. One representative animal from each group and the
quantification of these data are presented in FIG. 31A and FIG.
31B. Consistent with the data obtained in vitro, the addition of
S662V mutation had a negative effect on the transduction efficiency
of both the tyrosine-triple-mutant and the tyrosine-threonine
quadruple-mutant vectors. Exemplary single and multiple-mutation
capsid proteins of the present invention include, but are not
limited to, those illustrated in Table 5:
TABLE-US-00007 TABLE 5 SUMMARY OF EXEMPLARY MUTATIONS OF SURFACE-
EXPOSED TYROSINE (Y), SERINE (S), AND THREONINE (T) RESIDUES ON THE
AAV2 CAPSID Single Mutations Double Mutations Triple Mutations
Multiple Mutations Y252F Y252F + Y730F Y444 + 500 + 730F Y272 + 444
+ 500 + 730F Y272F Y272F + Y730F Y730F + S662V + T491V Y272 + 444 +
500 + 730F Y444F Y444F + Y730F S458 + 492 + 662V Y272 + 444 + 500 +
730F Y500F Y500F + Y730F T455 + 550 + 491V Y272 + 444 + 500 + 700 +
730F Y700F Y700F + Y730F T550 + 659 + 491V Y272 + 444 + 500 + 704 +
730F Y704F Y704F + Y730F Y252 + 272 + 444 + 500 + 704 + 730F Y730F
Y444F + T550F Y272 + 444 + 500 + 700 + 704 + 730F S261V S458V +
S492V Y252 + 272 + 444 + 500 + 700 + 704 + 730F S264V S458V + S662V
Y444 + 500 + 730F + T491V S267V S492V + S662V Y444 + 500 + 730F +
S458V S276V T455 + T491V Y444 + 500 + 730F + S662V + T491V S384V
T550 + T491V Y444 + 500 + 730F + T550 + T491V S458V T659 + T491V
Y444 + 500 + 730F + T659 + T491V S468V T671 + T491V S492V Y730F +
T491V S498V S662V + T491V S578V Y730F + S662V S658V S662V S662A
S662D S662F S662H S662N S662L S662I S668V S707V S721V T251V T329V
T330V T454V T455V T491V T503V T550V T592V T597V T581V T671V T659V
T660V T701V T713V T716V The first letter corresponds to the amino
acid in the wild-type AAV2 capsid, the number is the VP3 amino acid
position that was mutated, and the last letter is the mutant amino
acid.
[0387] Discussion
[0388] Recombinant AAV-based vectors are attractive delivery
vehicles for gene replacement therapy as a potential treatment for
a variety of genetic disorders. Although AAV vectors have been used
successfully in many animal models, and recently shown efficacy in
several clinical trials, a number of steps in the life cycle of AAV
continue to appear to limit the effectiveness of these vectors in
gene therapy. Some of these steps include intracellular
trafficking, nuclear transport, uncoating, and viral second-strand
DNA synthesis (Ding et al., 2005; Harbison et al., 2005;
Nonnenmacher and Weber, 2012).
[0389] The simple organization and natural plasticity of AAV
structural and regulatory components provide a unique opportunity
to manipulate the viral capsid and the genome to develop customized
recombinant vectors with distinctive features. Significant progress
has been made in the past decade to improve the specificity and the
transduction efficiency of recombinant AAV vectors. For example,
specific mutations in the viral inverted terminal repeat (ITR)
sequences have led to development of self-complementary AAV (scAAV)
vectors, which overcome the rate-limiting step of viral
second-strand DNA synthesis, and dramatically increase transgene
expression levels in various types of the cells and tissues
(McCarty et al., 2003; Wang et al., 2003). Additional studies on
capsid structure analyses, combined with a wealth of information
emanating from mutagenesis studies on the capsid genes, have led to
the identification of specific regions which play a critical role
in vector encapsidation, tissue-tropism, and intracellular
trafficking of these vectors (Lochire et al., 2006; Muzyczka and
Warrington, 2005; Wu et al., 2006; Gao et al., 2003; Vandenberghe
et al., 2009; Wu et al., 2006).
[0390] In the previous examples, it was shown that substitution of
surface-exposed specific tyrosine (Y) and serine (S) residues on
AAV2 capsids significantly increased the transduction efficiency of
these vectors, both in vitro and in vivo, presumably by preventing
phosphorylation, subsequent ubiquitination, and proteasome-mediated
degradation. Since surface-exposed specific threonine (T) residues
on AAV2 capsids would likewise be expected to undergo
phosphorylation, in this example each of the 17 surface-exposed T
residues were systematically mutagenized, and several single-mutant
vectors were identified that could increase the transduction
efficiency up to 4-fold. Combinations of multiple T mutations on a
single capsid identified modifications that further augmented the
transduction efficiency up to .about.10-fold, compared with that of
the WT AAV2 vector in HEK293 cells.
[0391] Two independent groups have previously reported mutations of
specific T residues on AAV2 capsids. For example, Lochrie et al.,
2006, targeted the T residues at positions 330, 454, 455, 491, 503,
and 550 in a tour de force effort to identify surface regions that
bind antibodies, and DiPrimio et al. (2008), targeted the T residue
at position 659 in an effort to identify regions critical for
capsid assembly and genome packaging. In both studies, the T
residues were substituted with either alanine (A), serine (S), or
lysine (K) residues, or by peptide substitution. However, no
increase in the transduction efficiency of any of the mutant
vectors was observed. In contrast, in the example, the
surface-exposed T residues were substituted with valine residues.
This further corroborates the recent observation for the critical
role played by specific amino acid type in modulating the
biological activity of AAV vectors (Aslanidi et al., 2012; Li et
al., 2012).
[0392] When the most efficient threonine-mutation (T491 V) was
combined with a previously reported tyrosine triple-mutation
(Y444+500+730F) (Markusic et al. 2010) to generate a Y-T
quadruple-mutant (Y444+500+730F+T491V) vector, the transduction
efficiency of this vector was .about.2-3-fold higher than the
tyrosine triple-mutant vector in murine hepatocytes, both in vitro
and in vivo. However, combining the most efficient S-mutation
(S662V) (Aslanidi et al., 2012) with the tyrosine triple-mutation
negatively affected the transduction efficiency of the Y-S
quadruple mutant (Y444+500+730F+S662V) vector aswell as the Y-S-T
pentuple mutant (Y444+500+730F+S662V+T491V) vector. Although
several other combinations showed greater transduction efficiency
compared with the WT AAV2 vector, neither combination of similar
(quadruple, pentuple or sextuple-tyrosine; and triple and
quadruple-threonine mutants), nor combination of the best
performing YST mutations reached the level of expression from the
triple-tyrosine mutant vector. In view of the large number of
combinations of mutations tested, only the mutations that
significantly increased the transduction efficiency over the
triple-tyrosine mutant vector were characterized in detail
here.
[0393] The 17 AAV2 surface-exposed threonine residues are scattered
throughout the capsid. Four of the mutations (T329V, T330V, T713V,
and T716V) resulted in significant defects in assembly and vector
production, and they could not be further characterized. Residues
329 and 330 are located in the .alpha.-surface loop (DE loop)
located between the .beta.D and .beta.E strands of the core
.beta.-barrel of the AAV2 VP3 structure (Xie et al., 2002). Five of
these loops, from icosahedral five-fold symmetry related VP3s
assembly a channel at this axis which connects the interior and
exterior surfaces of the capsid (FIG. 32A). As was observed in a
previous study (Bleker et al., 2006), titers for these mutants were
significantly reduced consistent with a role for the channel in
genome packaging. Residues 713 and 716 are located on the
wall/raised capsid region between the depressions at and
surrounding the icosahedral two- and five-fold axes, respectively
(FIG. 32A and FIG. 32B). Their side-chains participate in polar
interactions with symmetry related VP3 monomers and it is likely
that mutation results in a defect in capsid assembly. A role in
capsid assembly for residues located at the icosahedral two-fold
axis is consistent with a recent report in which they observe that
the AAV2 residues that mediated the interaction with the
assembly-activating protein (AAP) were located at this capsid
region (Naumer et al., 2012).
[0394] Residues T455, T491, T550, and T659, showing an increased
transduction phenotype when mutated to valine or alanine, are
located on the protrusions which surround the icosahedral
three-fold axis (T455, T491, and T550) or on the HI loop (between
.beta.H and .beta.I of the core .beta.-barrel) (T659) which is lies
on the depression surrounding the channel at the icosahedral
five-fold axis of the AAV2 capsid. The residues on the protrusion,
a prominent feature on the capsid assembled from two VP3 monomers,
are located close to the top (455), side facing the two-fold
depression (491), and side facing the depression surrounding the
five-fold (550), respectively, of the protrusions. This AAV region
contains the most variability in sequence and structure, and with
the exception of residue 659, the other three threonine residues
are located to define VP3 variable regions (VRs) (Govindasamy et
al., 2006). Along with T659, these residues form a footprint on the
capsid surface that extends over the top of the protrusion towards
the depression surrounding the icosahedral five-fold axis (FIG. 32A
and FIG. 32B). Their surface exposure is consistent with the
potential to interact with host molecules, which could include
kinases. Interestingly, this footprint is flanked by the residues
in the triple-tyrosine mutant, Y444, Y500, and Y730, with T491
located proximal to tyrosine residue Y730 in a depiction of the
capsid surface amino acids (FIG. 32B). This residue, which sits in
the depression at the icosahedral axis of the capsid, showed the
highest increase in transduction compared to WT AAV2 when of the
seven surface-exposed tyrosines where mutated to phenylanine
residues (Zhong et al. 2008). Significantly, the two-fold capsid
region is observed to undergo pH-mediated structural transitions
when the homologous AAV8 was examined at the conditions encountered
during trafficking in the endocytic pathway (Nam et al., 2011). It
is possible that the mutations of the AAV2 improve transduction
efficiency through altered receptor binding mechanisms. Residues
mediating AAV2 and AAV6 interaction with heparan sulfate receptors,
R585 and R588, and K531 (structurally equivalent to E530 in AAV2),
respectively, are close to this foot (FIG. 26B), and residues 491
and 500, in VRV, are located in one of two large regions on the
surface of the AAV2 capsid that has been implicated in binding to
the LamR receptor in AAV8 (Akache et al., 2006). Amino acids in VRV
also play a role in the AAV9 capsid binding to its glycan receptor,
galactose.
[0395] The decreased transduction efficiency phenotype of the
mutants containing the S662V mutations is difficult to explain
given the location of this residue within the footprint delineated
by the residues which enhance transduction when mutated to
eliminate potential phosphorylation (FIG. 32A and FIG. 32B). In
addition, it has been shown that a mutation of this residue to
valine improved transduction relative to WT AAV2 (Aslanidi et al.,
2012). Residue S662, like T659, is located in the HI loop that
extends over adjacent five-fold symmetry related VP3 monomers and
likely plays a role in stabilizing the pentameric subunits.
However, the serine side-chain is not engaged in any inter- or
intra-subunit interactions, and while the HI loop has been reported
to be a determinant of capsid assembly and genome packaging
(DiPrimio et al., 2008), it tolerated single amino acid
substitution (Aslanidi et al., 2012). Thus, its effect is likely
due to the abrogation of a capsid interaction utilizing the
footprint containing the triple-tyrosine mutant residues and T491.
Significantly, the phenotypes for mutations in nearby amino acids
that make up the HI loop, for example, amino acid residue 664,
substituting either serine (mut45subSer14) or a FLAG epitope
(mut45SubFLAG10), were non-infectious or not assembled into viral
capsid (Wu et al., 2000). However, an HA insertion at the same
position produced capsids that were partially defective, yet still
bound heparin (Wu et al., 2000).
[0396] Whereas only .about.45% of the vector genomes delivered by
the WT AAV2 vectors were present in the nucleus at 48 h post
infection, >90% of the vector genomes delivered by the Y-T
quadruple-mutant vector were present at the same time point. This
indicates improved trafficking kinetics for the mutant that would
be consistent with reduced re-direction to the proteasome. The
modest (.about.2-3-fold) increase in the transduction efficiency of
these vectors compared to the tyrosine triple-mutant vectors is
also consistent with the .about.10% increase in nuclear vector
genome delivery, i.e. .about.90% compared to .about.80%.
[0397] The various combinations of surface tyrosine, serine, and
threonine modifications clearly showed that there is an optimal
combination to achieve maximal augmentation. These studies also
highlighted the requirement for specific residue types in AAV
interactions during infection and for enhancing transduction. It is
possible that the individual mutations, which did not show a
significant increase in the transduction efficiency as single
changes, can form superior vectors when combined in a single
capsid.
TABLE-US-00008 TABLE 6 COMPARISON OF TYROSINE RESIDUES IN AAV
SEROTYPES (Surface exposed residues are shown with an "*" following
their amino acid position) AAV1 AAV* AAV* AAV4 AAV* AAV* AAV* AAV*
AAV9 AAV* AAV* AAV Y6 Y6 Y6 Y5 NA Y6 Y6 Y6 Y6 Y6 Y6 Y6 Y50 Y50 Y50
Y49 Y49 Y50 Y50 Y50 Y50 Y50 Y50 Y50 Y52 Y52 Y52 Y51 Y51 Y52 Y52 Y52
Y52 Y52 Y52 Y52 Y79 Y79 Y79 Y78 Y78 Y79 Y79 Y79 Y79 Y79 Y79 Y79 Y90
Y90 Y90 Y89 Y89 Y90 Y90 Y90 Y90 Y90 Y90 Y90 Y93 Y93 Y93 Y92 Y92 Y93
Y93 Y93 Y93 Y93 Y93 Y93 Y252 Y252* Y252* Y246* Y242* Y252* Y253*
Y253* Y252* Y253* Y246* Y255* Y257 Y257 Y257 Y251 Y247 Y257 Y258
Y258 Y257 Y258 Y251 Y260 Y273* Y272* Y272* Y263* Y263* Y273* Y274*
Y275* Y274* Y275* Y263* Y272* Y276 Y275 Y275 NA Y266 Y276 Y277 Y278
Y277 Y278 NA NA Y282 Y281 Y281 Y272 Y272 Y282 Y283 Y284 Y283 Y284
Y272 Y281 NA NA NA NA Y294 NA NA NA NA NA NA NA Y349 Y348 Y348 Y339
Y339 Y349 Y350 Y351 Y350 Y351 Y339 Y348 Y353 Y352 Y352 Y343 Y343
Y353 Y354 Y355 Y354 Y355 Y343 Y352 Y376 Y375 Y375 Y366 Y366 Y376
Y377 Y378 Y377 Y378 Y366 Y375 Y378 Y377 Y377 Y368 Y368 Y378 Y379
Y380 Y379 Y380 Y368 Y377 Y394 Y393 Y393 Y387 NA Y394 Y395 Y396 Y395
Y396 Y386 Y395 Y398 Y397 Y397 Y391 Y390 Y398 Y399 Y400 Y399 Y400
Y390 Y399 Y414 Y413 Y413 Y407 Y406 Y414 Y415 Y416 Y415 Y416 Y406
Y415 Y425 Y424 Y424 Y418 NA Y425 Y426 Y427 Y426 Y427 Y417 Y426
Y442* Y441* Y441* Y435* Y434* Y442* Y443* Y444* Y443* Y444* Y434*
Y443* NA NA NA NA Y436 NA NA NA NA NA NA NA Y444* Y443* Y443* NA NA
Y444* Y445* Y446* Y445* Y446* NA NA Y445* Y444* Y444* NA NA Y445*
Y446* Y447* Y446* Y447* NA NA NA NA NA NA NA NA NA NA NA NA NA Y465
NA NA NA NA NA NA Y466 NA NA NA NA NA NA NA NA NA Y457 NA NA NA NA
NA NA NA NA NA NA NA NA NA NA NA NA NA NA Y475 NA NA NA NA NA NA NA
NA NA NA Y467 Y476 NA NA NA NA Y461 NA NA NA NA NA NA NA NA NA NA
NA NA NA NA NA Y478 NA NA NA Y484 Y483 Y484 NA NA Y484 NA Y486 Y484
Y486 NA NA NA NA NA Y491* NA NA NA NA NA NA Y490* Y499* NA Y500* NA
NA NA NA NA NA NA NA NA NA NA NA NA Y504* NA NA NA NA NA NA Y503*
Y512* Y509 Y508 Y509 NA NA Y509 Y511 Y511 NA Y511 Y507 NA NA NA NA
NA Y502 NA NA NA NA NA NA NA NA NA NA NA Y521* NA NA NA NA NA NA NA
NA NA NA NA Y542* NA NA Y557* NA Y557* NA NA NA NA NA NA Y563* NA
NA NA NA NA NA NA NA Y576 Y577 NA NA NA Y578 Y579 Y577 Y579 NA NA
NA NA NA NA Y585* NA NA NA NA NA NA NA Y613* Y612* Y613* Y611*
Y602* Y613* Y614* Y615* Y613* Y615* Y610* Y619* NA NA NA Y612 NA NA
NA NA NA NA Y611 Y620 Y674* Y673* Y674* Y672* Y662* Y674* Y675*
Y676* Y674* Y676* Y671* Y680* Y701 Y700* Y701 NA Y689* Y701* Y702*
Y703* Y701* Y703* NA NA Y705* Y704* Y705* Y703* Y693* Y705* NA
Y707* Y705* Y707* Y702* Y711* NA NA NA NA NA NA NA Y708 Y706 Y708
NA NA Y721 Y720 Y721 Y719 Y709 Y721 Y722 Y723 Y721 Y723 Y717 Y727
Y731* Y730* Y731* Y729* Y719* Y731* Y732* Y733* Y731* Y733* Y728*
NA indicates data missing or illegible when filed
TABLE-US-00009 TABLE 7 COMPARISON OF LYSINE RESIDUES IN AAV
SEROTYPES (Surface exposed residues are shown with an "*" following
their amino acid position) AAV1 AAV2 AAV3 AAV4 AAV5 AAV6 AAV7 AAV8
AAV9 AAV10 AAV11 AAV12 NA K24 NA NA NA NA NA NA NA NA NA NA K26 K26
K26 NA NA K26 K26 K26 K26 K26 K26 K26 K31 NA NA K30 K30 K31 K31 K31
NA K31 K31 NA K33 K33 K33 K32 K32 K33 K33 K33 K33 K33 K33 K33 K38
NA NA NA NA K38 K38 K38 NA K38 K38 NA NA K39 NA NA NA NA NA NA NA
NA NA NA K51 K51 K51 K50 NA K51 K51 K51 K51 K51 K51 K51 K61 K61 K61
K60 NA K61 K61 K61 K61 K61 K61 K61 K77 K77 K77 K76 NA K77 K77 K77
K77 K77 K77 K77 NA NA NA NA NA NA NA NA NA NA NA K81 K84 NA K84 K83
NA K84 K84 NA K84 K84 K84 NA NA K92 K92 K91 K91 NA NA NA K92 NA NA
K92 NA NA NA NA K102 NA NA NA NA NA NA NA NA K105 NA NA NA NA NA NA
K105 NA NA NA NA NA NA NA K115 NA NA NA NA NA NA NA K122 K122 K122
K121 K121 K122 K122 K122 K122 K122 K122 K122 K123 K123 K123 K122
K122 K123 K123 K123 K123 K123 K123 K123 K137 K137 K137 NA K136 K137
K137 K137 K137 K137 K137 K137 K142 K142 K142 K141 NA K142 K142 K142
K142 K142 K142 K142 K143 K143 K143 K142 K142 K143 K143 K143 K143
K143 K143 K142 NA NA NA NA NA NA NA NA NA NA NA K148 NA NA NA NA
K150 NA NA NA NA NA NA NA NA NA NA NA K152 NA NA NA NA NA NA NA NA
NA NA NA K153 NA NA NA NA NA NA K160 K161 K161 K161 K160 NA K161
K162 K162 K161 K162 K160 K164 NA NA NA K161 NA NA K163 K163 NA K163
K161 K165 NA NA NA NA NA NA NA NA NA NA NA K166 NA NA K164 K163 NA
NA NA NA NA NA K163 NA NA NA NA NA K161 NA NA NA NA NA NA K168 K168
NA NA K167 NA K168 NA NA K168 K169 NA NA K169 K169 K169 K168 NA
K169 K170 K170 K169 K170 K168 NA NA NA NA K169 NA NA NA NA NA NA NA
NA NA NA NA NA K232I NA NA NA NA NA NA NA K258* K258 K258* K252* NA
K258* K259* K259* K258* K259* NA NA NA NA NA NA K251* NA NA NA NA
NA NA NA K310I K309 K309I K300I NA K310I K311I K312I K311I K312I
K300I K309I NA NA K310I NA NA NA K312I NA NA NA NA NA K315I K314
K314I K305I K305I K315I K316I K317I K316I K317I K305I K314I K322I
K321 K321I K312I K312I K322I K323I K324I K323I K324I K312I K321I NA
NA NA NA NA NA NA K333* K332* K333* NA NA NA NA NA NA NA NA NA NA
NA NA NA K384I NA NA NA NA K394I NA NA NA NA NA NA NA NA NA NA
K411I NA NA NA NA NA NA K410I K419I NA NA NA NA K425I NA NA NA NA
NA NA NA NA NA NA NA NA NA NA NA K449* NA NA NA K459I NA NA NA NA
K459I NA NA NA NA NA NA NA NA NA NA NA NA NA NA K462* NA NA NA NA
NA NA K459I K451I NA NA NA NA NA K458I K467I NA NA NA K469I NA NA
NA NA NA NA NA NA K476I NA NA K470I K462I K476I K478I K478I NA
K478I K469I K478I NA NA NA K479I NA NA NA NA NA NA K478I K487I NA
NA NA NA NA NA NA NA NA NA NA K490I K491* K490 K491* K485* NA K491*
K493* NA NA NA K484* K490 K493* NA NA NA NA K493* NA NA NA NA NA NA
NA NA NA K492* NA NA NA NA NA NA K491* K493 NA NA NA K503* NA NA NA
NA NA NA K502* K511 K508* K507 K508* NA NA K508* K510* K510* NA
K510* NA NA K528* K527 K528* NA NA K528* K530* K530* K528* K530* NA
NA NA NA NA NA NA K531* NA NA NA NA NA NA K533* K532 K533* NA NA
K533* NA NA NA NA NA NA NA NA NA K532* NA NA NA NA NA NA NA NA
K545* K544 K545* NA NA K545* K547* K547* K545* K547* NA NA NA NA NA
K544* NA NA NA NA NA NA NA NA NA K549 NA NA NA NA NA NA NA NA NA NA
NA NA NA NA NA NA K553* NA NA NA NA NA NA K556 NA NA NA NA NA NA
K557* NA NA NA K567*- NA NA NA NA K567* NA K569* K567* K569* NA NA
K621I K620 K621I K619I K610I K621I K622I K623I K621I K623I K618I
K627I K641I K640 K641I K639I K630I K641I K642I K643I K641I K643I
K638I K647I K650I K649 K650I K648I K639I K650I K651I K652I K650I
K652I K647I K656I NA NA NA NA NA NA NA NA K664I NA NA NA K666* K665
K666* NA NA K666* K667* K668* K666* K668* NA NA NA NA NA NA K676I
NA NA NA NA NA NA NA K689I K688 K689I K687I K677I K689I K690I K691I
K689I K691I K686I K695I K693I K692 K693I K691I K681I K693I K694I
K695I K693I K695I K690I K699I K707* K706 K707* NA NA K707* K708*
K709* K707* K709* NA NA NA NA NA K718I NA NA NA NA NA NA K717I NA
Residues in bold are surface-associated lysines = * Resides that
are located on the interior of the capsid = I No homologous lysine
at that position for that serotype = NA
[0398] Residues not visible in the crystal structure of AAVs are
shaded in grey; however, biochemical data suggests that these amino
acids are located inside the AAV capsid until some point in the
virus life cycle when they are then externalized.
Example 6
Suppression of Human Liver Tumorigenesis by AAV3 Vectors
[0399] Hepatocellular carcinoma (HCC) ranks fifth among solid
cancers with .about.695,900 deaths worldwide each year (Thomas and
Zhu, 2005; Jemal et al., 2011). During the past two decades, the
incidence of HCC in the USA has tripled, while the 5-year survival
rate has remained below 12% (El-Serag, 2011). It is even worse in
Asia and Africa, with an annual incidence of 1 per 3,000 in China
(Chen, et al., 2013). Currently, staging of HCC is considered
crucial for planning of optimal therapy (Bruix et al., 2005).
Patients with early HCC may benefit from radical (curative)
therapies and those with intermediate stage may benefit from
palliative treatments. However, relapse is a frequent complication
and treatment failure rates are high. For those with advanced HCC,
unfortunately, best supportive care is the only option (Verslype et
al., 2009). Although there is one medicine, Sorafenib, approved by
the U.S. Food and Drug Administration for advanced HCC, in a large
Phase III clinical trial the median survival rate increased only
from 7.9 to 10.7 months (Llovet et al., 2008).
[0400] AAV vectors have shown remarkable efficacy in the treatment
of Leber's congenital amaurosis (Bainbridge et al., 2008; Maguire
et al., 2008; Cideciyan et al., 2008; Cideciyan, 2010) hemophilia B
(Nathwani et al., 2011) and aromatic L-amino acid carboxylase
deficiency (Hwu et al., 2012). Glybera, a rAAV1 vector to treat
lipoprotein lipase deficiency, is the first gene therapy product in
the Western world (Melchiorri et al., 2013). In the early 2000s,
conventional, single-stranded (ss) rAAV2 vectors were used by
investigators to target HCC in vivo (Su et al., 2000).
Unfortunately, since the transduction efficiency of ssAAV2 vectors
is low, no transduction was observed in tumors larger than 2-mm via
systemic administration (Peng et al., 2000). More recently,
delivery of specific miRNAs in a mouse endogenous HCC model using
rAAV8 vectors was shown to result in inhibition of cancer cell
proliferation (Kota et al., 2009; Hsu et al., 2012). However, rAAV8
vectors have a broad tropism to normal tissues other than the liver
in murine models (Zincarelli et al., 2008; Gao et al., 2002; Wang
et al., 2005) and in non-human primates (Nathwani, et al., 2006;
Nathwani et al., 2007).
[0401] Interestingly, the inventors have demonstrated that rAAV3
vectors, which fail to efficiently transduce any normal murine
tissue in vivo, (Zincarelli et al., 2008; Palomeque et al., 2007;
Markakis et al., 2010; Ling et al., 2010) were shown to transduce
human HCC cells highly efficiently both in vitro (Ling et al.,
2010; Glushakova et al., 2009) and in vivo (Cheng et al., 2012).
Although rAAV3 vectors also transduce primary human hepatocytes,
the transgene expression could be restricted to malignant cells by
using a HCC-specific promoter, .alpha.-fetoprotein promoter (AFPp).
In subsequent studies, the inventors observed that rAAV3 vectors
utilize the human hepatocyte growth factor receptor (hHGFR, also
named c-Met) as a cellular co-receptor, (Ling et al., 2010) which
indicates an opportunity to exploit rAAV3-based vectors in
targeting human liver cancers, since hHGFR is over-expressed in
most HCC cells (You et al., 2011). Furthermore, since AAV3 has
lower incidence of pre-existing neutralizing antibodies in humans
compared with other commonly used AAV serotypes (van der Marel et
al., 2011), it has the potential to be developed as a selective
viral vector for gene therapy of human liver cancers. The present
example demonstrates that further augmentation of rAAV3-mediated
transduction efficiency in human liver cancer cells can be achieved
through the elimination of specific surface-exposed tyrosine (Y),
serine (S), and threonine (T) residues on the viral capsids. No
observed significant alteration in cellular receptor interaction in
vitro and viral-tropism in vivo was associated with these
modifications. Furthermore, significant inhibition of tumorigenesis
in a human liver cancer xenograft model was achieved through
systemic administration of optimized rAAV3 vectors carrying a novel
therapeutic gene from traditional Chinese medicine,
Trichosanthin.
[0402] Materials and Methods
[0403] Chemicals, Plasmids and Primers.
[0404] Grade I-A heparin sodium salt were purchased from
Sigma-Aldrich. Recombinant hHGF was purchased from Life
Technologies. Plasmid pHelper was purchased from Agilent
Technologies. Plasmids pdsAAV-CBAp-EGFP and pAAV-CBAp-FLuc were
obtained from Dr. Xiao Xiao, University of North Carolina at Chapel
Hill. Plasmid pdsAAV-AFPp-EGFP has been previously described
(Glushakova et al., 2009). The TCS gene (Shaw et al., 1994) was
synthesized by Life Technologies, based on the published sequence
(T. kirilowii trichosanthin (TCS) mRNA, complete cds; GenBank:
M34858.1), and sub-cloned into plasmid pdsAAV-AFPp-EGFP using AgeI
and HindIII restriction sites. All plasmids were sequenced prior to
use.
[0405] Construction of Optimized rAAV3 Capsid Plasmids.
[0406] A two-stage PCR procedure, using Turbo Pfu Polymerase
(Stratagene) was performed to introduce site-specific mutations in
the rAAV3 capsid, as describe previously (Zhong et al., 2008;
Markusic et al., 2010; Aslanidi et al., 2013). Briefly, in stage
one, two PCR extension reactions were performed in separate tubes
for each mutant. One tube contained the forward PCR primer and the
other contained the reverse primer. In stage two, the two reactions
were mixed and a standard PCR mutagenesis assay was carried out
according to the manufacturer's instructions. All mutant plasmids
were sequenced before use.
[0407] Cell Lines and Cultures.
[0408] Human hepatocellular carcinoma (Huh7) cells have been
described previously, (Ling et al., 2010; Cheng et al., 2012) and
were maintained in complete Dulbecco's modified Eagle medium
(C-DMEM, Mediatech, Inc.) supplemented with 10% heat-inactivated
fetal bovine serum (FBS, Sigma-Aldrich), 1% penicillin and
streptomycin (Lonza). A newly established human hepatoblastoma
(Hep293TT) cell line, was obtained from Dr. Gail E. Tomlinson
(University of Texas Health Science Center at San Antonio) and was
maintained in complete RPMI medium 1640 (Life Technologies)
supplemented with 15% heat-inactivated FBS (Sigma-Aldrich) and 1%
P/S (Lonza). Cells were grown as adherent culture in a humidified
atmosphere at 37.degree. C. in 5% CO.sub.2 and were sub-cultured
after treatment with trypsin-versene mixture (Lonza) for 2-5 min at
room temperature, washed and re-suspended in complete medium.
[0409] rAAV Vectors Production.
[0410] Highly purified stocks of rAAV vectors were generated by the
triple-plasmid transfection protocol. Briefly, HEK293 cells were
co-transfected with three plasmids using Polyethelenimine (linear,
MW 25000, Polysciences, Inc.), and medium was replaced six hrs
post-transfection. Cells were harvested 72-hrs' post-transfection,
subjected to three rounds of freeze-thaw and then digested with
Benzonase (Life Technology). Viral vectors were purified by
iodixanol (Sigma-Aldrich) gradient ultra-centrifugation followed by
ion exchange chromatography using HiTrap SP/Q HP (GE Healthcare),
washed with phosphate-buffered saline (PBS, Mediatech, Inc.) and
concentrated by centrifugal spin concentrators with a 150 Kda
molecular-weight cutoff (MWCO). The physical genomic titers of
recombinant vector stocks were determined by quantitative DNA
slot-blot and Southern blot analyses.
[0411] rAAV Vectors Transduction In Vitro.
[0412] Cells were seeded in 96-well plates at 5,000 or 10,000 cells
per well in C-DMEM. Twenty-four hours later, cells were
mock-treated or treated with indicated chemicals for 2 hrs. rAAV
infections (MOI: 5.times.10.sup.3) were then performed in serum-
and antibiotic-free DMEM medium for 2 hrs, with or without
indicated chemicals, followed by extensive washes with PBS to
remove the vector inoculum. Transgene expression was analyzed by
either fluorescence microscopy or flow cytometry 72-hrs'
post-transduction.
[0413] hHGF Competition Assay.
[0414] Huh7 cells were transduced with scAAV3-CBAp-EGFP vectors at
an MOI of 5.times.10.sup.3 vgs/cell. Vectors were premixed with
increasing concentrations of recombinant hHGF. Cells were analyzed
for EGFP expression levels 72 hrs post-transduction.
[0415] Animal Handling.
[0416] All animal experiments were approved by the appropriate
regulatory authorities, and were performed according to specified
guidelines for animal care. Six- to ten-week old non-obese
diabetic/severe combined immuno-deficient, IL2-gamma-deficient
(NSG) male mice were purchased from Jackson Laboratory.
[0417] Human Liver Cancer Xenograft Model.
[0418] Six- to ten-week old male NSG mice received subcutaneous
injection of 5.times.10.sup.6 Huh7 or Hep293TT cells on the ventral
side of the neck between shoulder blades. Animals were kept in
sterile cages until the end of the experiment.
[0419] In Vivo FLuc Assays.
[0420] rAAV vectors were injected intravenously via tail-vein, or
injected directly into tumors in NSG mice. For in vivo FLuc
imaging, mice were weighed to calculate the volume of substrate,
D-luciferin-K.sup.+ salt (Caliper Life Sciences), according to the
dose of 4 mg/kg of body weight and anesthetized. The calculated
volume of the 5 mg/mL of stock substrate solution was mixed with
100 .mu.L of PBS and injected intra-peritoneally. In vivo
bioluminescence images were acquired immediately over a period of 5
min using a Xenogen machine equipped with a cooled couple-charged
device camera (Xenogen). Signal intensity was quantified using the
camera control program, Living Image software and presented as
photons/second/cm.sup.2/steridian (p/s/cm.sup.2/sr).
[0421] Statistical Analysis.
[0422] Results are presented as mean.+-.standard deviation (SD).
Differences between groups were identified using one-way ANOVA with
Sidak's multiple comparison test in GraphPad Prism 6 software.
[0423] Results
[0424] rAAV3 Vectors Selectively Transduce Human Liver Tumors In
Vivo.
[0425] In the first set of studies, the transduction efficiency of
rAAV3 and rAAV8 vectors in human HCC tumors was compared in a
murine xenograft model in vivo. Non-obese, diabetic (NOD),
severe-combined immune-deficient (scid), interleukin 2-deficient
(IL2.sup.-) (NSG) mice, both male and female (n=4), were injected
subcutaneously on the ventral side between shoulder blades with
5.times.10.sup.6 human Huh7 cells, which formed tumors. Four-weeks
later, mice were either mock injected, or injected via the tail
vein with 1.times.10.sup.11 viral genomes (vgs)/mouse of rAAV3 or
rAAV8 vectors carrying the firefly luciferase gene (FLuc) under the
control of cytomegalovirus (CMV) enhancer/chicken .beta.-actin
hybrid promoter (CBAp) (FIG. 40A). Whole body bioluminescent
imaging was performed 3 days post-vector administration. These
results are shown in FIG. 36A. As can be seen, in both male and
female mice injected with rAAV3 vectors, FLuc expression was
restricted to the tumor, whereas in mice injected with rAAV8
vectors, FLuc expression was relatively more widespread, but
predominantly localized to liver, and the transduction efficiency
of rAAV8 vectors was significantly higher in male mice, an
observation, consistent with previously published studies (Davidoff
et al., 2003). Quantitative data further demonstrated that rAAV3
vector-mediated transgene expression was restricted to tumors, and
little transgene expression was detected in livers. In contrast, in
rAAV8 vector-injected mice, only low-level transgene expression
occurred in the tumors, whereas expression in the liver was
significantly higher. To further corroborate these results, in the
second set of experiments, rAAV3 and rAAV8 vectors were used in
direct intra-tumor injections in male NSG mice bearing human Huh7
tumors (n=4) at 1.times.10.sup.11 vgs/mouse, and whole body
bioluminescence images were obtained 3 days post-vector injections.
As can be seen in FIG. 36C, high-level transgene expression was
localized to the tumor in mice injected with rAAV3 vectors, whereas
in addition to the tumor, significant transgene expression in the
liver was also detected in mice injected with rAAV8 vectors. Thus,
in contrast to rAAV8 vectors, rAAV3 vectors possess human liver
tumor-tropism in this experimental model in vivo.
[0426] In preliminary experiments, a diminution in transgene
expression was also noted in tumors 5-days' post-vector
administration, which was due to the rapid growth of HCC tumors.
Thus, to further corroborate these results, in the next set of
experiments, direct intra-tumor injections was performed of rAAV3
and rAAV8 vectors at low (L=1.times.10.sup.11 vgs/mouse) and high
(H=1.times.10.sup.12 vgs/mouse) doses. Whole-body bioluminescence
imaging data obtained at both day 3 and day 7 are shown in FIG.
36D. It was evident that, even at a high dose, ectopic expression
in the liver in rAAV3 vector-injected mice was minimal, whereas
intra-tumor injection of rAAV8 vectors resulted in strong transgene
expression in the liver in a dose- and time-dependent manner. At
Day 7, post-vector injections, mice were sacrificed and the viral
genome copy numbers persisting in the liver tissue samples were
compared. These results, shown in FIG. 36E, indicated that a large
amount of rAAV8 vector genomes were present in the liver, whereas
the numbers of rAAV3 vector genomes were minimal, corroborating
earlier results. These studies, together with earlier results (Ling
et al., 2010; Glushakova et al., 2009; Cheng et al., 2012; Ling et
al., 2011) provide a clear rationale for employing rAAV3
vector-mediated gene therapy for HCC.
[0427] Further augmentation of rAAV3 vector-mediated transgene
expression in human liver cancer cells in vitro can be achieved
through modifications of viral capsids. To further enhance the
transduction efficiency of rAAV3 vectors, site-directed mutagenesis
of rAAV3 capsids was performed. In addition to mutagenesis of
surface-exposed tyrosine (Y) to phenylalanine (F) residues (Cheng
et al., 2012), surface-exposed serine (S), threonine (T), and
lysine (K) residues were also mutagenized to valine (V) and
glutamic acid (E) or arginine (R) residues, respectively. Priority
was given to the positions that are conserved among various AAV
serotypes, and have previously been shown to augment the
transduction efficiency of rAAV2 vectors (Zhong et al., 2008;
Markusic et al., 2010; Aslanidi et al., 2013; Aslanidi et al.,
2012). The wild type (WT) and all mutant rAAV3 vectors carrying the
CBAp-driven enhanced green fluorescence protein (EGFP) reporter
gene (FIG. 40A) were used to evaluate their transduction
efficiencies in a human HCC cell line, Huh7, under identical
conditions. A summary of these data is provided in FIG. 41. The
transduction efficiency of two K-mutants (K528E; K533E) was reduced
>10-fold, and that of several Y- and T-mutants (Y272F; Y444F;
T251V; Y705+731F+T492V) was reduced >2-fold. The transduction
efficiency of the rest of the mutants was increased, which ranged
between <2-fold to >10-fold. The seven best mutants as well
as the WT rAAV3 vectors carrying the CBAp-driven FLuc reporter gene
were then used to transduce Huh7 cells under identical conditions.
These results (shown in FIG. 37A) indicated that the transduction
efficiency of Y705+731F and S663V+T492V+K533R mutants was increased
by .about.10-fold, and that of S663V+T492V mutants was increased by
.about.15-fold, compared with the WT rAAV3 vectors. To further
validate the observed increased transduction efficiency of these
mutants, the three best mutant rAAV3 vectors carrying the CBAp
promoter-driven EGFP reporter gene were used to transduce a
different human HCC cell line, HepG2, under identical conditions.
The results (shown in FIG. 37B), demonstrated that the transduction
efficiency of S663V+T492V+K533R and Y705+731F mutants was increased
by .about.2- and .about.3-fold, respectively, and that of
S663V+T492V mutants was increased by .about.5-fold, compared with
the WT rAAV3 vectors. The transduction efficiency of the best
mutant (S633V+T492V) was also evaluated in a more
recently-established, human hepatoblastoma (HB) cell line, Hep293TT
(Cheng et al., 2012) (FIG. 37C). Thus, the optimized rAAV3 vector
may prove useful in the potential gene therapy of human liver
cancer.
[0428] Modifications of Specific Amino Acids on rAAV3 Capsids do
not Alter the Virus-Cellular Receptor Interaction.
[0429] Owing to the uncertainty of viral capsid amino acid(s)
responsible for virus-receptor(s) interaction, the inventors also
examined whether cellular heparan sulfate proteoglycan (HSPG) and
human hepatocyte growth factor receptor (hHGFR), previously
identified as receptor (Rabinowitz et al., 2004) and co-receptor
(Ling et al., 2010) of WT rAAV3 vectors, were involved in
transduction by our optimized rAAV3 vectors. The following three
sets of studies were performed. First, transduction of Huh7 cells
with rAAV3-CBAp-EGFP vectors or the two best mutant vectors were
performed in the presence of either low (100 ng/mL) or high (100
.mu.g/mL) doses of soluble heparin. These results (shown in FIG.
37D, indicated that both Y705+731F and S663V+T492V mutants
performed in a similar manner as the WT rAAV3 vectors, in which the
low-dose of heparin enhanced viral vector-mediated transduction
efficiency, whereas the high-dose dramatically reduced it. Second,
transduction assays were performed in the presence of 5 .mu.g/mL
human hepatocyte growth factor (hHGF), which was previously shown
to significantly inhibit the transduction efficiency of WT rAAV3
vectors (Ling et al., 2010). These results, shown in FIG. 37E,
demonstrated that the transduction efficiency of both the WT and
the mutant viral vectors was significantly affected. And third, the
WT and the two mutant rAAV3 vectors were used to transduce a human
breast cancer cell line, T47D, that expresses undetectable levels
of endogenous hHGFR, as well as T47D cells stably transfected with
a hHGFR expression plasmids (T47D+hHGFR). These results, shown in
FIG. 37F, indicated that both the WT and the mutant rAAV3 vectors
transduce T47D+hHGFR cells more efficiently (>5-fold) than the
parental T47D cells. Taken together, these data confirmed that the
optimized rAAV3 vectors also utilize cellular HSPG and hHGFR as
receptor/co-receptor for their transduction.
[0430] Modifications of Specific Amino Acids on rAAV3 Capsids
Further Enhance Viral Transduction Efficiency In Vivo Following
Systemic Administration.
[0431] The inventors next evaluated the transduction efficiency of
the two optimized rAAV3 vectors in a murine xenograft model in
vivo. To this end, human Huh7 or Hep293TT tumor-bearing NSG mice
were used (n=4), and a relatively low dose (5.times.10.sup.10
vgs/mouse) of rAAV3-Y705+731F-CBAp-FLuc or
rAAV3-S663V+T492V-CBAp-FLuc vectors were delivered via the
tail-vein. Whole-body bioluminescent imaging was performed 3-days'
post-vector injections. From the results shown in FIG. 38A, it was
clear that both Huh7 and Hep293TT tumors were efficiently targeted
by the optimized rAAV3 vectors, and that transgene expression in
both types of tumors was significantly enhanced by
rAAV3-S663V+T492V vectors (FIG. 38B), compared with rAAV3-Y705+731F
vectors, which have previously been shown to be significantly more
efficient than the WT rAAV3 vectors in vivo (Cheng et al., 2012).
Three days' post-vector injections, mice were sacrificed, and liver
and tumor tissues were harvested. Total DNA samples were isolated
from both liver and tumor tissues, and subjected to qPCR analyses
to determine the vector-genome copy numbers. From the data shown in
FIG. 38C and FIG. 38D, it was apparent that the persisting vector
genomes of rAAV3-S663V+T492V mutant in the tumor was significantly
higher than those of rAAV3-Y705+731F mutant (FIG. 38C), presumably
due to more efficient intracellular trafficking and nuclear entry
(Aslanidi et al., 2013), which also correlates well with the FLuc
transgene expression (FIG. 38A and FIG. 38B). No significant
difference in the persisting vector genomes of the two vectors in
the liver was observed, which is also comparable to that reported
previously (Zincarelli et al., 2008). It is noteworthy, however,
that despite the presence of a roughly 5-fold higher vector genome
copy numbers in the liver, compared with the tumor, little
transgene expression in the liver was detected with either of the
two optimized rAAV3 vectors.
[0432] Suppression of tumorigenesis in the human liver cancer
xenograft model in vivo following systemic administration of
optimized rAAV3 vectors expressing a novel therapeutic gene. All of
the studies described thus far were carried out with reporter
genes, which lack therapeutic value. Thus, although the use of a
number of well-established pro-apoptotic and "suicide" genes was
contemplated, efforts were focused on a newly-identified
therapeutic gene, which encodes trichosanthin (TCS), a
ribosome-inactivating protein, isolated from a traditional Chinese
medicinal herb, Trichosanthes kirilowii (Sha et al., 2013).
Although the nucleotide sequence of the TCS gene was determined
more than 20 years ago (Shaw et al., 1994), the delivery of a gene
encoding TCS into cells has never been pursued. TCS gene-expressing
cassettes under the control of the AFPp were synthesized (detailed
FIG. 40A), whose intracellular expression significantly inhibited
the growth of human HCC cell lines in vitro.
TABLE-US-00010 (SEQ ID NO: 26)
ATGATCAGATTCTTAGTCCTCTCTTTGCTAATTCTCACCCTCTTCC
TAACAACTCCTGCTGTGGAGGGCGATGTTAGCTTCCGTTTATCAGG
TGCAACAAGCAGTTCCTATGGAGTTTTCATTTCAAATCTGAGAAAA
GCTCTTCCAAATGAAAGGAAACTGTACGATATCCCTCTGTTACGTT
CCTCTCTTCCAGGTTCTCAACGCTACGCATTGATCCATCTCACAAA
TTACGCCGATGAAACCATTTCAGTGGCCATAGACGTAACGAACGTC
TATATTATGGGATATCGCGCTGGCGATACATCCTATTTTTTCAACG
AGGCTTCTGCAACAGAAGCTGCAAAATATGTATTCAAAGACGCTAT
GCGAAAAGTTACGCTTCCATATTCTGGCAATTACGAAAGGCTTCAA
ACTGCTGCAGGCAAAATAAGGGAAAATATTCCGCTTGGACTCCCTG
CTTTGGACAGTGCCATTACCACTTTGTTTTACTACAACGCCAATTC
TGCTGCGTCGGCACTTATGGTACTCATTCAGTCGACGTCTGAGGCT
GCGAGGTATAAATTTATTGAGCAACAAATTGGGAAGCGTGTTGACA
AAACCTTCCTACCAAGTTTAGCAATTATAAGTTTGGAAAATAGTTG
GTCTGCTCTCTCCAAGCAAATTCAGATAGCGAGTACTAATAATGGA
CAGTTTGAAAGTCCTGTTGTGCTTATAAATGCTCAAAACCAACGAG
TCACGATAACCAATGTTGATGCTGGAGTTGTAACCTCCAACATCGC
GTTGCTGCTGAATAGAAACAATATGGCAGCCATGGATGACGATGTT
CCTATGACACAGAGCTTTGGATGTGGAAGTTATGCTATTTAG (SEQ ID NO: 27)
GAATTCATGATCAGATTCTTAGTCCTCTCTTTGCTAATTCTCACCC
TCTTCCTAACAACTCCTGCTGTGGAGGGCGATGTTAGCTTCCGTTT
ATCAGGTGCAACAAGCAGTTCCTATGGAGTTTTCATTTCAAATCTG
AGAAAAGCTCTTCCAAATGAAAGGAAACTGTACGATATCCCTCTGT
TACGTTCCTCTCTTCCAGGTTCTCAACGCTACGCATTGATCCATCT
CACAAATTACGCCGATGAAACCATTTCAGTGGCCATAGACGTAACG
AACGTCTATATTATGGGATATCGCGCTGGCGATACATCCTATTTTT
TCAACGAGGCTTCTGCAACAGAAGCTGCAAAATATGTATTCAAAGA
CGCTATGCGAAAAGTTACGCTTCCATATTCTGGCAATTACGAAAGG
CTTCAAACTGCTGCAGGCAAAATAAGGGAAAATATTCCGCTTGGAC
TCCCTGCTTTGGACAGTGCCATTACCACTTTGTTTTACTACAACGC
CAATTCTGCTGCGTCGGCACTTATGGTACTCATTCAGTCGACGTCT
GAGGCTGCGAGGTATAAATTTATTGAGCAACAAATTGGGAAGCGTG
TTGACAAAACCTTCCTACCAAGTTTAGCAATTATAAGTTTGGAAAA
TAGTTGGTCTGCTCTCTCCAAGCAAATTCAGATAGCGAGTACTAAT
AATGGACAGTTTGAAAGTCCTGTTGTGCTTATAAATGCTCAAAACC
AACGAGTCACGATAACCAATGTTGATGCTGGAGTTGTAACCTCCAA
CATCGCGTTGCTGCTGAATAGAAACAATATGGCAGCCATGGATGAC
GATGTTCCTATGACACAGAGCTTTGGATGTGGAAGTTATGCTATTC
TCGAGGACTACAAGGATGACGATGACAAGGATTACAAAGACGACGA
TGATAAGGACTATAAGGATGATGACGACAAATAA
[0433] Then, rAAV3-S663V+T492 mutant vectors were generated
carrying this novel therapeutic gene. In addition, to allow
initiating the treatment at an early time-point, before the tumors
are palpable, a genetically-modified human HCC cell line,
Huh7-FLuc, was also generated in which the FLuc gene under the
control of the CBAp promoter is stably transfected, which also
allowed for monitoring the tumor growth by whole body
bioluminescent imaging. NSG mice (n=10) were subcutaneously
injected on the ventral side between shoulder blades with
5.times.10.sup.6 Huh7-FLuc cells. Four weeks post-xenografts, mice
were divided into 2 groups, and 5.times.10.sup.10 vgs of
rAAV3-S663V+T492V-AFPp-TCS vectors were injected via the tail-vein
in the first group (Day 0). The second group of mice was injected
with 5.times.10.sup.10 vgs of rAAV3-S663V+T492V-AFPp-EGFP vectors
to serve as appropriate controls. Whole-body bioluminescent imaging
of mice was performed at Day 0, Day 3, Day 8, and Day 11 post
vector-administrations. These results, shown in FIG. 39A, document
that whereas Huh7-FLuc tumors grew progressively in mice injected
with rAAV3-S663V+T492V-AFPp-EGFP vectors, tumor growth in mice
injected with rAAV3-S663V+T492V-AFPp-TCS vectors was significantly
inhibited up until Day 11 (p<0.05), with maximal growth
inhibition at Day 8 (p<0.01). Whole body bioluminescent images
of mice performed at Day 8 post vector-administrations are shown in
FIG. 39B. Moreover, on Day 11, all mice were sacrificed, and serum
levels of aspartate transaminase (AST) and alanine transaminase
(ALT) were determined. No significant differences were observed
between TCS-treated and control groups, suggesting little liver
injury in mice (FIG. 39C).
[0434] Discussion
[0435] As stated above, HCC, which ranks fifth among solid tumors
in humans, leads to .about.695,900 deaths worldwide each year.
Although patients with early diagnosis of HCC may benefit from
surgical and/or chemotherapeutic interventions, relapse of the
disease is a frequent occurrence, and the rate of treatment failure
is high. For patients diagnosed with advanced HCC, the options are
limited largely to supportive care. Although the US Food and Drug
Administration (FDA) has approved the use of Sorafenib in patients
with advanced HCC, the median survival is increased by only
.about.3 months. Thus, it is readily clear that the development of
novel therapeutic options for HCC is sorely needed, and the
combination of gene therapy with tradition Chinese medicine (TCM)
is a promising option. TCM medicine, as a main complementary and
alternative medicinal therapy, has already become a commonly-used
treatment for HCC in China (Zhai et al., 2013). Recently, it has
been reported that bioactive monomeric compounds extracted from TCM
herbs have the ability to significantly enhance the therapeutic
efficiency mediated by rAAV vectors (Zhang et al., 2010; Mitchell
et al., 2013; Wang et al., 2014; Ling et al., 2014). Here, a novel
strategy has been developed that combines gene therapy with TCM
administration, in which a therapeutic suicide gene isolated from
herbs is systemically delivered into malignant cells in vivo
through rAAV vectors.
[0436] Recombinant AAV vector-mediated gene therapy of HCC has been
attempted in the past. For example, the use of conventional,
single-stranded (ss) rAAV2 vectors to target HCC in vivo has been
reported (Su et al., 2000), but the transduction efficiency of
these vectors was low. In subsequent studies (Peng et al., 2000),
no transduction was observed in tumors larger than 2 mm following
systemic administration. In more recent studies, the use of rAAV8
vectors to mediate delivery of specific miRNA-26A and miRNA-122 in
mouse endogenous HCC tumor models was shown to result in inhibition
of tumor growth (Kota et al., 2009; Hsu et al., 2012). However,
rAAV8 vectors have a broad tropism to normal tissues other than the
liver in murine models (Zincarelli et al., 2008; Gao et al., 2002;
Wang et al., 2005) and in non-human primates (Nathwani, et al.,
2006; Nathwani et al., 2007). This example demonstrates that the
remarkable tropism of rAAV3 vectors for human liver cancer cells in
vitro can also be exploited to achieve targeted delivery of these
vectors to human liver tumors in a xenograft mouse model in vivo.
In addition, site-directed mutagenesis of specific amino acid
residues on the rAAV3 capsid can further augment the transduction
efficiency of rAAV3 vectors. Furthermore, the optimized rAAV3
vectors expressing a novel therapeutic gene can also be used to
suppress human liver tumorigenesis in a murine xenograft model. It
should be emphasized that these studies were carried out with
well-established tumors, and the deliberate use of low vector doses
to establish tumor-targeting. Thus, it is highly likely that the
use of high vector doses and/or earlier intervention, before the
tumor is well-established, it would be possible to achieve a more
desirable therapeutic endpoint. It is also tempting to speculate
that pending successful completion of additional studies with
primary human liver tumor xenografts, especially in liver
microenvironment, and safety and efficacy in large animal models,
rAAV3-S663V+T492V vectors might prove useful in the potential gene
therapy of human liver cancers.
REFERENCES
[0437] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference:
[0438] Abella, J V et al., "Met/hepatocyte growth factor receptor
ubiquitination suppresses transformation and is required for Hrs
phosphorylation," Molec. Cell. Biol., 25:9632-9645 (2005). [0439]
Akache, B et al., "The 37/67-kilodalton laminin receptor is a
receptor for adeno-associated virus serotypes 8, 2, 3, and 9," J.
Virol., 80:9831-9836 (2006). [0440] Aldrich, W A et al., "Enhanced
transduction of mouse bone marrow-derived dendritic cells by
repetitive infection with self-complementary adeno-associated virus
6 combined with immunostimulatory ligands," Gene Ther., 13(1):29-39
(2006). [0441] Andreakos, E et al., "Activation of NF-.kappa.B by
the intracellular expression of NF-.kappa.B-inducing kinase acts as
a powerful vaccine adjuvant," Proc. Nat'l. Acad. Sci. USA,
103(39):14459-14464 (2006). [0442] Aslanidi, G et al., "An
inducible system for highly efficient production of recombinant
adeno-associated virus (rAAV) vectors in insect Sf9 cells," Proc.
Nat'l. Acad. Sci. USA, 106(13):5059-5064 (2009). [0443] Aslanidi, G
et al., "Ectopic expression of wnt10b decreases adiposity and
improves glucose homeostasis in obese rats," Am. J. Physiol.
Endocrinol. Metab., 293(3):E726-E736 (2007). [0444] Aslanidi, G V
et al., "Optimization of the capsid of recombinant adeno-associated
virus 2 (AAV2) vectors: the final threshold?" PLoS One, 8:e59142
(2013). [0445] Aslanidi, G V et al., "High-efficiency transduction
of human monocyte-derived dendritic cells by capsid-modified
recombinant AAV2 Vectors," Vaccine, 30:3908-3917 (2012). [0446]
Asokan, A et al., "The AAV vector toolkit: poised at the clinical
crossroads," Mol. Ther., 20:699-708 (2012). [0447] Bainbridge, J W
et al., "Effect of gene therapy on visual function in Leber's
congenital amaurosis," N. Engl. J. Med., 358(21):2231-2239 (2008).
[0448] Banchereau, J and Steinman, R M, "Dendritic cells and the
control of immunity," Nature, 392(6673):245-252 (1998). [0449]
Beatty, G L and Vonderheide, R H, "Telomerase as a universal tumor
antigen for cancer vaccines," Exp. Rev. Vaccines, 7(7):881-887
(2008). [0450] Bleker, S et al., "Impact of capsid conformation and
Rep-capsid interactions on adeno-associated virus type 2 genome
packaging," J. Virol., 80:810-820 (2006). [0451] Boisleve, F et
al., "Implication of the MAPK pathways in the maturation of human
dendritic cells induced by nickel and TNF-.alpha.," Toxicology,
206(2):233-244 (2005). [0452] Boutin, S et al., "Prevalence of
serum IgG and neutralizing factors against adeno-associated virus
(AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population:
implications for gene therapy using AAV vectors," Hum. Gene Ther.,
21:704-712 (2010). [0453] Brantly, M L et al., "Sustained transgene
expression despite T lymphocyte responses in a clinical trial of
rAAV1-AAT gene therapy," Proc. Nat'l. Acad. Sci. USA,
106(38):16363-16368 (2009). [0454] Brown, B D and Lillicrap, D,
"Dangerous liaisons: the role of `danger` signals in the immune
response to gene therapy," Blood, 100(4):1133-1140 (2002). [0455]
Bruix, J et al., "Management of hepatocellular carcinoma,"
Hepatology, 42:1208-1236 (2005). [0456] Cao, O et al., "Induction
and role of regulatory CD4+CD25+ T cells in tolerance to the
transgene product following hepatic in vivo gene transfer," Blood,
110(4):1132-1140 (2007). [0457] Carrillo-Tripp, M et al.,
"VIPERdb2: An enhanced and web API enabled relational database for
structural virology," Nucl. Acids Res., 37:D436-D442 (2009). [0458]
Castanier, C et al., "Mitochondrial dynamics regulate the
RIG-I-like receptor antiviral pathway," EMBO Rep., 11(2):133-138
(2010). [0459] Chapuis, F et al., "Differentiation of human
dendritic cells from monocytes in vitro," Eur. J. Immunol.,
27(2):431-441 (1997). [0460] Chen, T T et al., "Establishment and
characterization of a cancer cell line derived from an aggressive
childhood liver tumor," Ped. Blood Cancer, 53:1040-1047 (2009).
[0461] Chen, W Q et al., "Liver cancer incidence and mortality in
China, 2009," Chin. J. Cancer; 32:162-169 (2013). [0462] Cheng, B
et al., "Development of optimized AAV3 serotype vectors: mechanism
of high-efficiency transduction of human liver cancer cells," Gene
Ther., 19(4):375-384 (2011). [0463] Chiorini, J A et al., "Cloning
and characterization of adeno-associated virus type 5," J. Virol.,
73:1309-1319 (1999). [0464] Chiorini, J A et al., "Cloning of
adeno-associated virus type 4 (AAV4) and generation of recombinant
AAV4 particles," J. Virol., 71:6823-6833 (1997). [0465] Cideciyan,
A V "Leber congenital amaurosis due to RPE65 mutations and its
treatment with gene therapy," Prog. Retin. Eye Res., 29:398-427
(2010). [0466] Cideciyan, A V et al., "Human gene therapy for RPE65
isomerase deficiency activates the retinoid cycle of vision but
with slow rod kinetics," Proc. Nat'l. Acad. Sci. USA,
105(39):15112-15117 (2008). [0467] Cohn, E F et al., "Efficient
induction of immune tolerance to coagulation factor IX following
direct intramuscular gene transfer," J. Thromb. Haemost.,
5(6):1227-1236 (2007). [0468] Cuzzocrea, S et al., "Pyrrolidine
dithiocarbamate attenuates the development of acute and chronic
inflammation," Br. J. Pharmacol., 135(2):496-510 (2002). [0469]
Dai, Y and Siemann, D W, "BMS-777607, a small-molecule Met kinase
inhibitor, suppresses hepatocyte growth factor-stimulated prostate
cancer metastatic phenotype in vitro," Molec. Cancer Therapeutics,
9:1554-1561 (2010). [0470] Davidoff, A M et al., "Sex significantly
influences transduction of murine liver by recombinant
adeno-associated viral vectors through an androgen-dependent
pathway," Blood, 102:480-488 (2003). [0471] Daya, S and Berns, K I,
"Gene therapy using adeno-associated virus vectors," Clin.
Microbiol. Rev., 21(4):583-593 (2008). [0472] Dean, J et al., "Role
of cyclic AMP-dependent kinase response element-binding protein in
recombinant adeno-associated virus-mediated transduction of heart
muscle cells," Hum. Gene Ther., 20(9):1005-1012 (2009). [0473]
Dejardin, E, "The alternative NF-.kappa.B pathway from biochemistry
to biology: pitfalls and promises for future drug development,"
Biochem. Pharmacol., 72(9):1161-1179 (2006). [0474] den Brok, M H
et al., "Dendritic cells: tools and targets for antitumor
vaccination," Exp. Rev. Vaccines, 4(5):699-710 (2005). [0475] Ding,
W et al., "Intracellular trafficking of adeno-associated viral
vectors," Gene Ther., 12:873-880 (2005). [0476] DiPaolo, N C et
al., "Virus binding to a plasma membrane receptor triggers
interleukin-1 alpha-mediated proinflammatory macrophage response in
vivo," Immunity, 31(1):110-121 (2009). [0477] DiPrimio, N et al.,
"Surface loop dynamics in adeno-associated virus capsid assembly,"
J. Virol., 82(11):5178-5189 (2008). [0478] Dobrzynski, E et al.,
"Induction of antigen-specific CD4.sup.+ T-cell anergy and deletion
by in vivo viral gene transfer," Blood, 104(4):969-977 (2004).
[0479] Douar, A M et al., "Intracellular trafficking of
adeno-associated virus vectors: routing to the late endosomal
compartment and proteasome degradation," J. Virol., 75:1824-1833
(2001). [0480] Duan, D et al., "Endosomal processing limits gene
transfer to polarized airway epithelia by adeno-associated virus,"
J. Clin. Invest., 105:1573-1587 (2000). [0481] Eisold, S et al.,
"Induction of an antitumoral immune response by wild-type
adeno-associated virus type 2 in an in vivo model of pancreatic
carcinoma," Pancreas, 35(1):63-72 (2007). [0482] El-Serag, H B,
"Hepatocellular carcinoma," N. Engl. J. Med., 365:1118-1127 (2011).
[0483] Emsley, P and Cowtan, K, "Coot: model-building tools for
molecular graphics," Acta Crystallogr. D. Biol. Crystallogr.,
60:2126-2132 (2004). [0484] Ferrari, F K et al., "Second-strand
synthesis is a rate-limiting step for efficient transduction by
recombinant adeno-associated virus vectors," J. Virol.,
70:3227-3234 (1996). [0485] Figdor, C G et al., "Dendritic cell
immunotherapy: mapping the way," Nat. Med., 10(5):475-480 (2004).
[0486] Finn, J D et al., "Proteasome inhibitors decrease AAV2
capsid derived peptide epitope presentation on MHC class I
following transduction," Mol. Ther., 18(1):135-142 (2010). [0487]
Fisher, K J et al., "Transduction with recombinant adeno-associated
virus for gene therapy is Limited by leading-strand synthesis," J.
Virol., 70:520-532 (1996). [0488] Flotte, T R et al., "Phase 2
clinical trial of a recombinant adeno-associated viral vector
expressing .alpha.1-antitrypsin: interim results," Hum. Gene Ther.,
22:1239-1247 (2012). [0489] Gao, G P et al., "Novel
adeno-associated viruses from Rhesus monkeys as vectors for human
gene therapy," Proc. Nat'l. Acad. Sci. USA, 99:11854-11859 (2002).
[0490] Gao, G P et al., "Adeno-associated viruses undergo
substantial evolution in primates during natural infections," Proc.
Nat'l. Acad. Sci. USA, 100(10):6081-6086 (2003). [0491] Gao, G P et
al., "Clades of adeno-associated viruses are widely disseminated in
human tissues," J. Virol., 78:6381-6388 (2004). [0492] Gilmore, T
D, "Introduction to NF-.kappa.B: players, pathways, perspectives,"
Oncogene, 25(51):6680-6684 (2006). [0493] Girod, A et al., "Genetic
capsid modifications allow efficient re-targeting of
adeno-associated virus type 2," Nature Med., 5(12):1438 (1999).
[0494] Glushakova, L G et al., "AAV3-mediated transfer and
expression of the pyruvate dehydrogenase E1 .alpha. subunit gene
causes metabolic remodeling and apoptosis of human liver cancer
cells," Molec. Genet. Metabol., 98:289-299 (2009). [0495] Gotoh, A
and Ohyashiki, K, "Role of bortezomib in the treatment of multiple
myeloma," Nippon Rinsho, 65(12):2309-2314 (2007). [0496] Gourzi, P
et al., "Viral induction of AID is independent of the interferon
and the Toll-like receptor signaling pathways but requires
NF-.kappa.B," J. Exp. Med., 204(2):259-265 (2007). [0497]
Govindasamy, L et al., "Structurally mapping the diverse phenotype
of adeno-associated virus serotype 4," J. Virol., 80:11556-11570
(2006). [0498] Gray, S J et al., "Directed evolution of a novel
adeno-associated virus (AAV) vector that crosses the
seizure-compromised blood-brain barrier (BBB)," Mol. Ther.,
18(3):570-578 (2010). [0499] Guo, F et al., "Lack of nuclear
factor-.kappa.B2/p100 causes a RelB-dependent block in early B
lymphopoiesis," Blood, 112(3):551-559 (2008). [0500] Habib, A A et
al., "The epidermal growth factor receptor engages receptor
interacting protein and nuclear factor-kappa B
(NF-.kappa.B)-inducing kinase to activate NF-.kappa.B.
Identification of a novel receptor-tyrosine kinase signalosome," J.
Biol. Chem., 276(12):8865-8874 (2001). [0501] Hansen, J et al.,
"Adeno-associated virus type 2-mediated gene transfer: altered
endocytic processing enhances transduction efficiency in murine
fibroblasts," J. Virol., 75:4080-4090 (2001). [0502] Hansen, J et
al., "Impaired intracellular trafficking of adeno-associated virus
type 2 vectors limits efficient transduction of murine
fibroblasts," J. Virol., 74:992-996 (2000). [0503] Harbison, C E et
al., "The parvovirus capsid odyssey: from the cell surface to the
nucleus," Trends Microbiol., 16:208-214(2008). [0504] Harley, C B,
"Telomerase and cancer therapeutics," Nat. Rev. Cancer,
8(3):167-179 (2008). [0505] Hayden, M S and Ghosh, S, "Signaling to
NF-kB," Genes Develop., 18(18):2195-2224 (2004). [0506] Heiser, A
et al., "Autologous dendritic cells transfected with
prostate-specific antigen RNA stimulate CTL responses against
metastatic prostate tumors," J. Clin. Invest., 109(3):409-417
(2002). [0507] High, K A and Aubourg, P, "rAAV human trial
experience," Methods Mol. Biol., 807:429-457 (2011). [0508]
Hiscott, J et al., "Convergence of the NF-.kappa.B and interferon
signaling pathways in the regulation of antiviral defense and
apoptosis," Ann. N.Y. Acad. Sci., 1010:237-248 (2003). [0509]
Hiscott, J et al., "Manipulation of the nuclear factor-.kappa.B
pathway and the innate immune response by viruses," Oncogene,
25(51):6844-6867 (2006). [0510] Hsu, S H et al., "Essential
metabolic, anti-inflammatory, and anti-tumorigenic functions of
miR-122 in liver," J. Clin. Invest., 122:2871-2883 (2012). [0511]
Hwu, W L et al., "Gene therapy for aromatic L-amino acid
decarboxylase deficiency," Sci. Transl. Med., 4:134ra161 (2012).
[0512] Jayandharan, G R et al., "Activation of the NF-kB pathway by
adeno-associated virus (AAV) vectors and its implications in immune
response and gene therapy," Proc. Nat'l. Acad. Sci. USA,
108(9):3743-3748 (2011). [0513] Jemal, A et al., "Global cancer
statistics," CA Cancer J. Clin., 61:69-90 (2011). [0514] Jiang, H
et al., "Effects of transient immunosuppression on adenoassociated,
virus-mediated, liver-directed gene transfer in rhesus macaques and
implications for human gene therapy," Blood, 108(10):3321-3328
(2006). [0515] Kashiwakura, Y et al., "Hepatocyte growth factor
receptor is a coreceptor for adeno-associated virus type 2
infection," J. Virol., 79:609-614 (2005). [0516] Keen-Rhinehart, E
et al., "AAV-mediated leptin receptor installation improves energy
balance and the reproductive status of obese female Koletsky rats,"
Peptides, 26(12):2567-2578 (2005). [0517] Kohlbrenner, E et al.,
"Successful production of pseudotyped rAAV vectors using a modified
baculovirus expression system," Mol. Ther., 12:1217-1225 (2005).
[0518] Kota, J et al., "Therapeutic microRNA delivery suppresses
tumorigenesis in a murine liver cancer model," Cell, 137:1005-1017
(2009). [0519] Kube, D M and Srivastava, A, "Quantitative DNA slot
blot analysis: inhibition of DNA binding to membranes by magnesium
ions," Nucl. Acids Res., 25(16):3375-3376 (1997). [0520] Kumar, N
et al., "NF-.kappa.B signaling differentially regulates influenza
virus RNA synthesis," J. Virol., 82(20):9880-9889(2008). [0521]
Levy, H C et al., "Heparin binding induces conformational changes
in adeno-associated virus serotype 2," J. Struct. Biol.,
165(3):146-156 (2009). [0522] Li, C et al., "Cellular immune
response to cryptic epitopes during therapeutic gene transfer,"
Proc. Natl. Acad. Sci. USA, 106(26):10770-10774 (2009). [0523] Li,
C et al., "Single amino acid modification of adeno-associated virus
capsid changes transduction and humoral immune profiles," J.
Virol., 86:7752-7759 (2012). [0524] Li, Q and Verma, I M,
"NF-.kappa.B regulation in the immune system," Nat. Rev. Immunol.,
2(10):725-734 (2002). [0525] Lich, J D et al., "Monarch-1
suppresses non-canonical NF-kappaB activation and p52-dependent
chemokine expression in monocytes," J. Immunol., 178(3):1256-1260
(2007). [0526] Lind, E F et al., "Dendritic cells require the
NF-.kappa.B2 pathway for cross-presentation of soluble antigens,"
J. Immunol., 181(1):354-363 (2008). [0527] Ling, C et al.,
"High-efficiency transduction of liver cancer cells by recombinant
adeno-associated virus serotype 3 vectors," J. Vis. Exp.,
49:Pii:2538, doi: 10.3791/2538 (2011). [0528] Ling, C et al.,
"Human hepatocyte growth factor receptor is a cellular co-receptor
for AAV3," Hum. Gene Ther., 21:1741-1747 (2010). [0529] Ling, C Q
et al., "The roles of traditional Chinese medicine in gene
therapy," J. Integr. Med., 12:67-75 (2014). [0530] Ling, C Q et
al., "Inhibitory effect of recombinant adenovirus carrying melittin
gene on hepatocellular carcinoma," Ann. Oncol., 16:109-115 (2005).
[0531] Lisowski, L et al., "Selection and evaluation of clinically
relevant AAV variants in a xenograft liver model," Nature,
506:382-386 (2014). [0532] Liu, M A, "Immunologic basis of vaccine
vectors," Immunity, 33(4):504-515 (2010). [0533] Liu, S et al.,
"Melittin prevents liver cancer cell metastasis through inhibition
of the Rac1-dependent pathway," Hepatology (Baltimore, Md.),
47:1964-1973 (2008). [0534] Liu, X et al., "Targeting the c-MET
signaling pathway for cancer therapy," Exp. Opin. Invest. Drugs,
17:997-1011 (2008). [0535] Liu, Y L et al., "Optimized production
of high-titer recombinant adeno-associated virus in roller
bottles," Biotechniques, 34(1):184-189 (2003). [0536] Lizundia, R
et al., "Host species-specific usage of the TLR4-LPS receptor
complex," Innate Immun., 14(4):223-231 (2008). [0537] Llovet, J M
et al., "Sorafenib in advanced hepatocellular carcinoma," N. Engl.
J. Med., 359:378-390 (2008). [0538] Lochrie, M A et al., "Mutations
on the external surfaces of adeno-associated virus type 2 capsids
that affect transduction and neutralization," J. Virol.,
80(2):821-834 (2006). [0539] LoDuca, P A et al., "Hepatic gene
transfer as a means of tolerance induction to transgene products,"
Curr. Gene Ther., 9(2):104-114 (2009). [0540] Loiarro, M et al.,
"Peptide-mediated interference of TIR domain dimerization in MyD88
inhibits interleukin-1-dependent activation of NF-.kappa.B," J.
Biol. Chem., 280(16):15809-15814 (2005). [0541] Ma, H et al., "Oral
adeno-associated virus-sTRAIL gene therapy suppresses human
hepatocellular carcinoma growth in mice," Hepatology (Baltimore,
Md.), 42:1355-1363 (2005). [0542] Madsen, D et al., "AAV-2 induces
cell mediated immune responses directed against multiple epitopes
of the capsid protein VP1," J. Gen. Virol., 90(11):2622-2633
(2009). [0543] Maguire, A M et al., "Safety and efficacy of gene
transfer for Leber's congenital amaurosis," N. Engl. J. Med.,
358(21):2240-2248 (2008). [0544] Mah, C et al., "Adeno-associated
virus type 2-mediated gene transfer: role of epidermal growth
factor receptor protein tyrosine kinase in transgene expression,"
J. Virol., 72:9835-9843 (1998). [0545] Mahadevan, M et al.,
"Generation of robust cytotoxic T lymphocytes against prostate
specific antigen by transduction of dendritic cells using protein
and recombinant adeno-associated virus," Cancer Immunol.
Immunother., 56(10):1615-1624 (2007). [0546] Malecki, M et al.,
"Recombinant adeno-associated virus derived vectors (rAAV2)
efficiently transduce ovarian and hepatocellular carcinoma
cells--implications for cancer gene therapy," Acta Poloniae
Pharmaceutica, 66:93-99 (2009). [0547] Manno, C S et al.,
"Successful transduction of liver in hemophilia by AAV-Factor IX
and limitations imposed by the host immune response," Nat. Med.,
12(3):342-347 (2006). [0548] Markakis, E A et al., "Comparative
transduction efficiency of AAV vector serotypes 1-6 in the
substantia nigra and striatum of the primate brain," Mol. Ther.,
18:588-593 (2010). [0549] Markusic, D M et al., "High-efficiency
transduction and correction of murine hemophilia B using AAV2
vectors devoid of multiple surface-exposed tyrosines," Mol. Ther.,
18(12):2048-2056 (2010). [0550] Marshall, E "Gene therapy. Viral
vectors still pack surprises," Science, 294:1640 (2001). [0551]
Martin, E et al., "Antigen-specific suppression of a primed immune
response by dendritic cells mediated by regulatory T cells
secreting interleukin-10," Immunity, 18(1):155-167 (2003). [0552]
Mattis, A E et al., "Analyzing cytotoxic T lymphocyte activity: a
simple and reliable flow cytometry-based assay," J. Immunol.
Methods, 204(2):135-142 (1997). [0553] Mays, L E et al.,
"Adeno-associated virus capsid structure drives CD4-dependent CD8+
T cell response to vector encoded proteins," J. Immunol.,
182(10):6051-6060 (2009). [0554] McCarty, D M et al., "Integration
of adeno-associated virus (AAV) and recombinant AAV vectors," Annu.
Rev. Genet., 38:819-845 (2004). [0555] McCarty, D M et al.,
"Adeno-associated virus terminal repeat (TR) mutant generates
self-complementary vectors to overcome the rate-limiting step to
transduction in vivo," Gene Ther., 10:2112-2118 (2003). [0556]
Melchiorri, D et al., "Regulatory evaluation of Glybera in
Europe--two committees, one mission," Nat. Rev. Drug Discov.,
12:719 (2013). [0557] Mendell, J R et al., "Dystrophin immunity in
Duchenne's muscular dystrophy," N. Engl. J. Med., 363:1429-1437
(2010). [0558] Mendell, J R et al., "Gene therapy for muscular
dystrophy: lessons learned and path forward," Neurosci. Lett.,
12:341-355 (2012). [0559] Mineva, N D et al., "CD40 ligand-mediated
activation of the de novo RelB NF-.kappa.B synthesis pathway in
transformed B cells promotes rescue from apoptosis," J. Biol.
Chem., 282(24):17475-17485 (2007). [0560] Mingozzi, F and High, K
A, "Immune responses to AAV in clinical trials," Curr. Gene Ther.,
7(5):316-324 (2007). [0561] Mingozzi, F and High, K A, "Therapeutic
in vivo gene transfer for genetic disease using AAV: progress and
challenges," Nat. Rev. Genet., 12:341-355 (2011). [0562] Mingozzi,
F et al., "CD8(+) T-cell responses to adeno-associated virus capsid
in humans," Nat. Med., 13(4):419-422 (2007). [0563] Mitchell, A M
et al., "Arsenic trioxide stabilizes accumulations of
adeno-associated virus virions at the perinuclear region,
increasing transduction in vitro and in vivo," J. Virol.,
87:4571-4583 (2013). [0564] Mueller, C and Flotte, T R, "Clinical
gene therapy using recombinant adeno-associated virus vectors,"
Gene Ther., 15(11):858-863 (2008). [0565] Muramatsu, S et al.,
"Nucleotide sequencing and generation of an infectious clone of
adeno-associated virus 3," Virology, 221:208-217 (1996). [0566]
Muruve, D A et al., "The inflammasome recognizes cytosolic
microbial and host DNA and triggers an innate immune response,"
Nature, 452(7183):103-107 (2008). [0567] Muzyczka, N and
Warrington, K H, "Custom adeno-associated virus capsids: the next
generation of recombinant vectors with novel tropism," Hum. Gene
Ther., 16:408-416 (2005). [0568] Muzyczka, N, "Use of
adeno-associated virus as a general transduction vector for
mammalian cells," Curr. Top. Microbiol. Immunol., 158:97-129
(1992). [0569] Nakabayashi, H et al., "Growth of human hepatoma
cells lines with differentiated functions in chemically defined
medium," Cancer Res., 42:3858-3863 (1982). [0570] Nakahara, T et
al., "Differential role of MAPK signaling in human dendritic cell
maturation and Th1/Th2 engagement," J. Dermatol. Sci., 42(1):1-11
(2006). [0571] Nakahara, T et al., "Role of c-Jun N-terminal kinase
on lipopolysaccharide induced maturation of human monocyte-derived
dendritic cells," Int. Immunol., 16(12):1701-1709 (2004). [0572]
Nam, H J et al., "Structural studies of adeno-associated virus
serotype 8 capsid transitions associated with endosomal
trafficking," J. Virol., 85:11791-11799 (2011). [0573] Nathwani, A
C et al., "Adenovirus-associated virus vector-mediated gene
transfer in hemophilia B," N. Engl. J. Med., 365:2357-2365 (2011).
[0574] Nathwani, A C et al., "Safe and efficient transduction of
the liver after peripheral vein infusion of self-complementary AAV
vector results in stable therapeutic expression of human FIX in
nonhuman primates," Blood, 109:1414-1421 (2007). [0575] Nathwani, A
C et al., "Self-complementary adeno-associated virus vectors
containing a novel liver-specific human factor IX expression
cassette enable highly efficient transduction of murine and
nonhuman primate liver," Blood, 107(7):2653-2661 (2006). [0576]
Naumer, M et al., "Properties of the adeno-associated virus
assembly-activating protein," J. Virol., 86:13038-13048 (2012).
[0577] Nguyen, L et al., "Association of the multisubstrate docking
protein gab1 with the hepatocyte growth factor receptor requires a
functional Grb2 binding site involving tyrosine 1356," J. Biol.
Chem., 272:20811-20819 (1997). [0578] Niemeyer, G P et al.,
"Long-term correction of inhibitor-prone hemophilia B dogs treated
with liver-directed AAV2-mediated factor IX gene therapy," Blood,
113(4):797-806 (2009). [0579] Nonnenmacher, M and Weber, T,
"Intracellular transport of recombinant adeno-associated virus
vectors," Gene Ther., 19:649-658 (2012). [0580] Okumura, A et al.,
"Interaction between Ebola virus glycoprotein and host toll-like
receptor 4 leads to induction of proinflammatory cytokines and
SOCS1," J. Virol., 84(1):27-33 (2010). [0581] O'Neill, D W and
Bhardwaj, N, "Exploiting dendritic cells for active immunotherapy
of cancer and chronic infections," Mol. Biotechnol., 36(2):131-141
(2007). [0582] Opie, S R et al., "Identification of amino acid
residues in the capsid proteins of adeno-associated virus type 2
that contribute to heparan sulfate proteoglycan binding," J.
Virol., 77:6995-7006 (2003). [0583] Owen, R T et al., "Gene therapy
for pyruvate dehydrogenase E1alpha deficiency using recombinant
adeno-associated virus 2 (rAAV2) vectors," Mol. Ther., 6(3):394-399
(2002). [0584] Palomeque, J et al., "Efficiency of eight different
AAV serotypes in transducing rat myocardium in vivo," Gene Ther.,
14:989-997 (2007). [0585] Palucka, K et al., "Recent developments
in cancer vaccines," J. Immunol., 186(3):1325-1331 (2011). [0586]
Pearson, W R and Lipman, D J, "Improved tools for biological
sequence comparison," Proc. Nat'l. Acad. Sci. USA, 85(8):2444-2448
(1988). [0587] Peng, D et al., "Transduction of hepatocellular
carcinoma (HCC) using recombinant adeno-associated virus (rAAV): in
vitro and in vivo effects of genotoxic agents," J. Hepatol.,
32:975-985 (2000). [0588] Petrs-Silva, H et al., "High-efficiency
transduction of the mouse retina by tyrosine-mutant AAV serotype
vectors," Mol. Ther., 17:463-471 (2009). [0589] Pierce, J W et al.,
"Novel inhibitors of cytokine-induced I.kappa.B.alpha.
phosphorylation and endothelial cell adhesion molecule expression
show anti-inflammatory effects in vivo," J. Biol. Chem.,
272(34):21096-21103 (1997). [0590] Ponnazhagan, S et al.,
"Adeno-associated virus type 2-mediated transduction of human
monocyte-derived dendritic cells: implications for ex vivo
immunotherapy," J. Virol., 75(19):9493-9501 (2001). [0591] Qiao, C
et al., "AAV6 capsid tyrosine-to-phenylalanine mutations improve
gene transfer to skeletal muscle," Hum. Gene Ther., 21:1343-1348
(2010). [0592] Qing, G et al., "Stabilization of basally translated
NF-kappaB-inducing kinase (NIK) protein functions as a molecular
switch of processing of NF-.kappa.B2 p100," J. Biol. Chem.,
280(49):40578-40582 (2005). [0593] Qing, K et al.,
"Adeno-associated virus type 2-mediated gene transfer: role of
cellular FKBP52 protein in transgene expression," J. Virol.,
75:8968-8976 (2001). [0594] Qing, K et al., "Human fibroblast
growth factor receptor 1 is a co-receptor for infection by
adeno-associated virus 2," Nature Med., 5:71-77 (1999). [0595]
Qing, K et al., "Role of tyrosine phosphorylation of a cellular
protein in adeno-associated virus 2-mediated transgene expression,"
Proc. Nat'l. Acad. Sci. USA, 94(20):10879-10884 (1997). [0596]
Rabinowitz, J E et al., "Cross-dressing the virion: the
transcapsidation of adeno-associated virus serotypes functionally
defines subgroups," J. Virol., 78:4421-4432 (2004). [0597]
Robert-Guroff, M, "Replicating and non-replicating viral vectors
for vaccine development," Curr. Opin. Biotechnol., 18(6):546-556
(2007). [0598] Ross, C J et al., "Correction of feline lipoprotein
lipase deficiency with adeno-associated virus serotype 1-mediated
gene transfer of the lipoprotein lipase S447X beneficial mutation,"
Hum. Gene Ther., 17(5):487-499 (2006). [0599] Rutledge, E A et al.,
"Infectious clones and vectors derived from adeno-associated virus
(AAV) serotypes other than AAV type 2," J. Virol., 72:309-319
(1998). [0600] Sanlioglu, S et al., "Endocytosis and nuclear
trafficking of adeno-associated virus type 2 are controlled by Rac1
and phosphatidylinositol-3 kinase activation," J. Virol.,
74:9184-9196 (2000). [0601] Scallan, C D et al., "Sustained
phenotypic correction of canine hemophilia A using an
adeno-associated viral vector," Blood, 102(6):2031-2037 (2003).
[0602] Schroeder, G M et al., "Discovery of
N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluo-
rophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (BMS-777607), a
selective and orally efficacious inhibitor of the Met kinase
superfamily," J. Med. Chem., 52:1251-1254 (2009). [0603] Sha, O et
al., "Anti-tumor action of trichosanthin, a type 1
ribosome-inactivating protein, employed in traditional Chinese
medicine: a mini review," Cancer Chemother. Pharmacol.,
71:1387-1393 (2013). [0604] Shaw, P C et al., "Minireview:
trichosanthin--a protein with multiple pharmacological properties,"
Life Sci., 55:253-262 (1994). [0605] Shin, O et al., "Effective
transduction by self-complementary adeno-associated viruses of
human dendritic cells with no alteration of their natural
characteristics," J. Gene Med., 10(7):762-769 (2008). [0606]
Snyder, R O et al., "Correction of hemophilia B in canine and
murine models using recombinant adeno-associated viral vectors,"
Nature Med., 5(1):64-70 (1999). [0607] Song, S et al., "Recombinant
adeno-associated virus-mediated alpha-1 antitrypsin gene therapy
prevents type I diabetes in NOD mice," Gene Ther., 11(2):181-186
(2004). [0608] Srivastava, A, "Adeno-associated virus-mediated gene
transfer," J. Cell. Biochem., 105(1):17-24 (2008). [0609] Su, H et
al., "Adeno-associated viral-mediated gene transfer to hepatoma:
thymidine kinase/interleukin 2 is more effective in tumor killing
in non-ganciclovir (GCV)-treated than in GCV-treated animals," Mol.
Ther., 1:509-515 (2000). [0610] Su, H et al., "Selective killing of
AFP-positive hepatocellular carcinoma cells by adeno-associated
virus transfer of the Herpes simplex virus thymidine kinase gene,"
Hum. Gene Ther., 7:463-470 (1996). [0611] Summerford, C and
Samulski, R J, "Membrane-associated heparan sulfate proteoglycan is
a receptor for adeno-associated virus type 2 virions," J. Virol.,
72:1438-1445 (1998). [0612] Summerford, C et al., "AlphaVbeta5
integrin: a co-receptor for adeno-associated virus type 2
infection," Nature Med., 5:78-82 (1999). [0613] Tacken, P J et al.,
"Dendritic-cell immunotherapy: from ex vivo loading to in vivo
targeting," Nat. Rev. Immunol., 7(10):790-802 (2007). [0614] Tang,
Z Y, "Hepatocellular carcinoma surgery--review of the past and
prospects for the 21st century," J. Surg. Oncol., 91:95-96 (2005).
[0615] Taylor, J and Ussher, J E, "Optimized transduction of human
monocyte-derived dendritic cells by recombinant adeno-associated
virus serotype 6 (rAAV6),
" Hum. Gene Ther., 21:1675-1686 (2010). [0616] Thomas, C E et al.,
"Rapid uncoating of vector genomes is the key to efficient liver
transduction with pseudotyped adeno-associated virus vectors," J.
Virol., 78:3110-3122 (2004). [0617] Thomas, M B, and Zhu, A X,
"Hepatocellular carcinoma: the need for progress," J. Clin. Oncol.
23:2892-2899 (2005). [0618] Tse, L Y et al., "Adeno-associated
virus-mediated expression of Kallistatin suppresses local and
remote hepatocellular carcinomas," J. Gene Med., 10:508-517 (2008).
[0619] van der Marel, S et al., "Neutralizing antibodies against
adeno-associated viruses in inflammatory bowel disease patients:
implications for gene therapy," Inflamm. Bowel Dis., 17:2436-2442
(2011). [0620] Vandenberghe, L H and Wilson, J M "AAV as an
immunogen," Curr. Gene Ther., 7(5):325-333 (2007). [0621]
Vandenberghe, L H et al., "Tailoring the AAV vector capsid for gene
therapy," Gene Ther., 16(3):311-319 (2009). [0622] Veron, P et al.,
"Major subsets of human dendritic cells are efficiently transduced
by self-complementary adeno-associated virus vectors 1 and 2,"J.
Virol., 81(10):5385-5394 (2007). [0623] Verslype, C et al., "The
management of hepatocellular carcinoma. Current expert opinion and
recommendations derived from the 10th World Congress on
Gastrointestinal Cancer, Barcelona, 2008," Ann. Oncol., 20(Suppl
7):vii1-vii6 (2009). [0624] Wang, C et al., "Melittin, a major
component of bee venom, sensitizes human hepatocellular carcinoma
cells to tumor necrosis factor-related apoptosis-inducing ligand
(TRAIL)-induced apoptosis by activating CaMKII-TAK1-JNK/p38 and
inhibiting I.kappa.B.alpha. kinase-NF.kappa.B," J. Biol. Chem.,
284:3804-3813 (2009). [0625] Wang, L et al., "The pleiotropic
effects of natural AAV infections on liver-directed gene transfer
in macaques," Mol. Ther., 18(1):126-134 (2010). [0626] Wang, L N et
al., "Pristimerin enhances recombinant adeno-associated virus
vector-mediated transgene expression in human cell lines in vitro
and murine hepastocytes in vivo," J. Integr. Med., 12:20-34 (2014).
[0627] Wang, W and Malcolm, B A, "Two-stage PCR protocol allowing
introduction of multiple mutations, deletions and insertions using
QuikChange site-directed mutagenesis," Biotechniques, 26(4):680-682
(1999). [0628] Wang, Y et al., "Potent antitumor effect of TRAIL
mediated by a novel adeno-associated viral vector targeting to
telomerase activity for human hepatocellular carcinoma," J. Gene
Med., 10:518-526 (2008). [0629] Wang, Y et al., "The efficacy of
combination therapy using adeno-associated virus-TRAIL targeting to
telomerase activity and cisplatin in a mice model of hepatocellular
carcinoma," J. Cancer Res. Clin. Oncol., 136:1827-1837 (2010).
[0630] Wang, Z et al., "Adeno-associated virus serotype 8
efficiently delivers genes to muscle and heart," Nat. Biotechnol.,
23:321-328 (2005). [0631] Wang, Z et al., "Rapid and highly
efficient transduction by double-stranded adeno-associated virus
vectors in vitro and in vivo," Gene Ther., 10(26):2105-2111 (2003).
[0632] Wu, J et al., "Self-complementary recombinant
adeno-associated viral vectors: packaging capacity and the role of
Rep proteins in vector purity," Hum. Gene Ther., 18:171-182 (2007).
[0633] Wu, P et al., "Mutational analysis of the adeno-associated
virus type 2 (AAV2) capsid gene and construction of AAV2 vectors
with altered tropism," J. Virol., 74(18): 8635-8647 (2000). [0634]
Wu, Z et al., "Adeno-associated virus serotypes: vector toolkit for
human gene therapy," Mol. Ther., 14(3):316-327 (2006). [0635] Wu, Z
et al., "Single amino acid changes can influence titer, heparin
binding, and tissue tropism in different adeno-associated virus
serotypes," J. Virol., 80(22):11393-11397 (2006). [0636] Wu, Z H
and Miyamoto, S, "Induction of a pro-apoptotic ATM-NF-.kappa.B
pathway and its repression by ATR in response to replication
stress," EMBO J., 27:1963-1973 (2008). [0637] Xiao, C and Rossmann,
M G, "Interpretation of electron density with stereographic roadmap
projections," J. Struct. Biol., 158:182-187 (2007). [0638] Xiao, W
et al., "Adenovirus-facilitated nuclear translocation of
adeno-associated virus type 2," J. Virol., 76:11505-11517 (2002).
[0639] Xie, Q et al., "The atomic structure of adeno-associated
virus (AAV-2), a vector for human gene therapy," Proc. Nat'l. Acad.
Sci. USA, 99(16):10405-10410 (2002). [0640] Yan, Z et al.,
"Ubiquitination of both adeno-associated virus type 2 and 5 capsid
Proteins affects the transduction efficiency of recombinant
vectors," J. Virol., 76:2043-2053 (2002). [0641] Yanagawa, Y and
Onoe, K, "Distinct regulation of CD40-mediated interleukin-6 and
interleukin-12 productions via mitogen-activated protein kinase and
nuclear factor kappaB-inducing kinase in mature dendritic cells,"
Immunology, 117(4):526-535 (2006). [0642] Yu, Y et al.,
"rAAV/Her-2/neu loading of dendritic cells for a potent
cellular-mediated MHC class I restricted immune response against
ovarian cancer," Viral Immunol., 21(4):435-442 (2008). [0643]
Zaiss, A K and Muruve, D A, "Immune responses to adeno-associated
virus vectors," Curr. Gene Ther., 5(3):323-331 (2005). [0644]
Zaiss, A K and Muruve, D A, "Immunity to adeno-associated virus
vectors in animals and humans: a continued challenge," Gene Ther.,
15(11):808-816 (2008). [0645] Zaiss, A K et al., "Complement is an
essential component of the immune response to adeno-associated
virus vectors," J. Virol., 82(6):2727-2740 (2008). [0646] Zaiss, A
K et al., "Differential activation of innate immune responses by
adenovirus and adeno-associated virus vectors," J. Virol.,
76(9):4580-4590 (2002). [0647] Zhai, X F et al., "Traditional
herbal medicine in preventing recurrence after resection of small
hepatocellular carcinoma: a multicenter randomized controlled
trial," J. Integr. Med., 11:90-100 (2013). [0648] Zhang, C et al.,
"Effects of melittin on expressions of mitochondria membrane
protein 7A6c cell apoptosis-related gene products Fas and Fas
ligand in hepatocarcinoma cells," J. Chinese Integrat. Med.,
5:559-563 (2007). [0649] Zhang, F L et al., "Celastrol enhances
AAV1-mediated gene expression in mice adipose tissues," Gene Ther.,
18:128-134 (2010). [0650] Zhang, Y et al., "AAV-mediated TRAIL gene
expression driven by hTERT promoter suppressed human hepatocellular
carcinoma growth in mice," Life Sci., 82:1154-1161 (2008). [0651]
Zhao, W et al., "Role of cellular FKBP52 protein in intracellular
trafficking of recombinant adeno-associated virus 2 vectors,"
Virology, 353:283-293 (2006). [0652] Zhong, L et al., "A dual role
of EGFR protein tyrosine kinase signaling in ubiquitination of AAV2
capsids and viral second-strand DNA synthesis," Mol. Ther.,
15(7):1323-1330 (2007). [0653] Zhong, L et al., "Heat-shock
treatment-mediated increase in transduction by recombinant
adeno-associated virus 2 vectors is independent of the cellular
heat-shock protein 90," J. Biol. Chem., 279:12714-12723 (2004).
[0654] Zhong, L et al., "Impaired nuclear transport and uncoating
limit recombinant adeno-associated virus 2 vector-mediated
transduction of primary murine hematopoietic cells," Hum. Gene
Ther., 15:1207-1218 (2004). [0655] Zhong, L et al., "Improved
transduction of primary murine hepatocytes by recombinant
adeno-associated virus 2 vectors in vivo," Gene Ther., 11:1165-1169
(2004). [0656] Zhong, L et al., "Next generation of
adeno-associated virus 2 vectors: point mutations in tyrosines lead
to high-efficiency transduction at lower doses," Proc. Nat'l. Acad.
Sci. USA, 105(22):7827-7832 (2008). [0657] Zhong, L et al.,
"Single-polarity recombinant adeno-associated virus 2
vector-mediated transgene expression in vitro and in vivo:
mechanism of transduction," Mol. Ther., 16:290-295 (2008). [0658]
Zhong, L et al., "Tyrosine-phosphorylation of AAV2 vectors and its
consequences on viral intracellular trafficking and transgene
expression," Virology, 381:194-202 (2008). [0659] Zhu, J et al.,
"The TLR9-MyD88 pathway is critical for adaptive immune responses
to adeno-associated virus gene therapy vectors in mice," J. Clin.
Invest., 119(8):2388-2398 (2009). [0660] Zincarelli, C et al.,
"Analysis of AAV serotypes 1-9 mediated gene expression and tropism
in mice after systemic injection," Mol. Ther., 16:1073-1080 (2008).
[0661] Zincarelli, C et al., "Comparative cardiac gene delivery of
adeno-associated virus serotypes 1-9 reveals that AAV6 mediates the
most efficient transduction in mouse heart," Clin. Translat. Sci.,
3:81-89 (2008). [0662] Zolotukhin, S et al., "Production and
purification of serotype 1, 2, and 5 recombinant adeno-associated
viral vectors," Methods, 28(2):158-167 (2002).
[0663] It should be understood that the examples and embodiments
described herein are for illustrative purposes only and that
various modifications or changes in light thereof will be suggested
to persons skilled in the art and are to be included within the
spirit and purview of this application and the scope of the
appended claims.
[0664] All references, including publications, patent applications
and patents cited herein are specifically incorporated herein by
reference in their entirety to the same extent as if each reference
was individually and specifically indicated to be incorporated by
reference and was set forth in its entirety herein.
[0665] Recitation of ranges of values herein are merely intended to
serve as a shorthand method of referring individually to each
separate value falling within the range, unless otherwise indicated
herein, and each separate value is incorporated into the
specification as if it were individually recited herein.
[0666] All methods described herein can be performed in any
suitable order, unless otherwise indicated herein, or otherwise
clearly contradicted by context.
[0667] The use of any and all examples, or exemplary language
(e.g., "such as") provided herein, is intended merely to better
illustrate the invention and does not pose a limitation on the
scope of the invention unless otherwise indicated. No language in
the specification should be construed as indicating any element is
essential to the practice of the invention unless as much is
explicitly stated.
[0668] The description herein of any aspect or embodiment of the
invention using terms such as "comprising," "having," "including"
or "containing" with reference to an element or elements is
intended to provide support for a similar aspect or embodiment of
the invention that "consists of," "consists essentially of," or
"substantially comprises" that particular element or elements,
unless otherwise stated or clearly contradicted by context (e.g., a
composition described herein as comprising a particular element
should be understood as also describing a composition consisting of
that element, unless otherwise stated or clearly contradicted by
context).
[0669] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents that are chemically and/or physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
Sequence CWU 1
1
251736PRTAdeno-associated virus serotype 1 1Met Ala Ala Asp Gly Tyr
Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg
Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala
Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr
Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr
Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala
Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser
Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr
Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175
Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly
Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val
Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu
Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala
Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser
Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260 265 270 Tyr Phe Gly Tyr
Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280 285 His Cys
His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290 295 300
Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln 305
310 315 320 Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala
Asn Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu
Tyr Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His Gln Gly Cys
Leu Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Ile Pro Gln Tyr
Gly Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala Val Gly Arg
Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400 Ser Gln Met
Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405 410 415 Glu
Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp 420 425
430 Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg
435 440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu
Phe Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys
Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val
Ser Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn Phe Thr Trp
Thr Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg Glu Ser Ile
Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu
Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530 535 540 Lys
Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile 545 550
555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu
Arg 565 570 575 Phe Gly Thr Val Ala Val Asn Phe Gln Ser Ser Ser Thr
Asp Pro Ala 580 585 590 Thr Gly Asp Val His Ala Met Gly Ala Leu Pro
Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro
Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro
Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys Asn Pro Pro
Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro
Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr 660 665 670
Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675
680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser
Asn 690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn
Asn Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg
Tyr Leu Thr Arg Pro Leu 725 730 735 2735PRTAdeno-associated virus
serotype 2 2Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr
Leu Ser 1 5 10 15 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly
Pro Pro Pro Pro 20 25 30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser
Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe
Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Glu Ala Asp Ala
Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Arg Gln Leu Asp
Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala
Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115
120 125 Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys
Arg 130 135 140 Pro Val Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser
Gly Thr Gly 145 150 155 160 Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg
Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ala Asp Ser Val Pro Asp
Pro Gln Pro Leu Gly Gln Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu
Gly Thr Asn Thr Met Ala Thr Gly Ser Gly 195 200 205 Ala Pro Met Ala
Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly
Asn Trp His Cys Asp Ser Thr Trp Met Gly Asp Arg Val Ile 225 230 235
240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255 Tyr Lys Gln Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn
His Tyr 260 265 270 Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe
Asn Arg Phe His 275 280 285 Cys His Phe Ser Pro Arg Asp Trp Gln Arg
Leu Ile Asn Asn Asn Trp 290 295 300 Gly Phe Arg Pro Lys Arg Leu Asn
Phe Lys Leu Phe Asn Ile Gln Val 305 310 315 320 Lys Glu Val Thr Gln
Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu 325 330 335 Thr Ser Thr
Val Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr 340 345 350 Val
Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala Asp 355 360
365 Val Phe Met Val Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser
370 375 380 Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
Pro Ser 385 390 395 400 Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe
Ser Tyr Thr Phe Glu 405 410 415 Asp Val Pro Phe His Ser Ser Tyr Ala
His Ser Gln Ser Leu Asp Arg 420 425 430 Leu Met Asn Pro Leu Ile Asp
Gln Tyr Leu Tyr Tyr Leu Ser Arg Thr 435 440 445 Asn Thr Pro Ser Gly
Thr Thr Thr Gln Ser Arg Leu Gln Phe Ser Gln 450 455 460 Ala Gly Ala
Ser Asp Ile Arg Asp Gln Ser Arg Asn Trp Leu Pro Gly 465 470 475 480
Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Ser Ala Asp Asn Asn 485
490 495 Asn Ser Glu Tyr Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn
Gly 500 505 510 Arg Asp Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser
His Lys Asp 515 520 525 Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val
Leu Ile Phe Gly Lys 530 535 540 Gln Gly Ser Glu Lys Thr Asn Val Asp
Ile Glu Lys Val Met Ile Thr 545 550 555 560 Asp Glu Glu Glu Ile Arg
Thr Thr Asn Pro Val Ala Thr Glu Gln Tyr 565 570 575 Gly Ser Val Ser
Thr Asn Leu Gln Arg Gly Asn Arg Gln Ala Ala Thr 580 585 590 Ala Asp
Val Asn Thr Gln Gly Val Leu Pro Gly Met Val Trp Gln Asp 595 600 605
Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr 610
615 620 Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu
Lys 625 630 635 640 His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro
Val Pro Ala Asn 645 650 655 Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe
Ala Ser Phe Ile Thr Gln 660 665 670 Tyr Ser Thr Gly Gln Val Ser Val
Glu Ile Glu Trp Glu Leu Gln Lys 675 680 685 Glu Asn Ser Lys Arg Trp
Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr 690 695 700 Asn Lys Ser Val
Asn Val Asp Phe Thr Val Asp Thr Asn Gly Val Tyr 705 710 715 720 Ser
Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735
3736PRTAdeno-associated virus serotype 3 3Met Ala Ala Asp Gly Tyr
Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg
Glu Trp Trp Ala Leu Lys Pro Gly Val Pro Gln Pro 20 25 30 Lys Ala
Asn Gln Gln His Gln Asp Asn Arg Arg Gly Leu Val Leu Pro 35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr
Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr
Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala
Lys Lys Arg Ile Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala
Ala Lys Thr Ala Pro Gly Lys Lys Gly 130 135 140 Ala Val Asp Gln Ser
Pro Gln Glu Pro Asp Ser Ser Ser Gly Val Gly 145 150 155 160 Lys Ser
Gly Lys Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175
Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190 Ala Ala Pro Thr Ser Leu Gly Ser Asn Thr Met Ala Ser Gly Gly
Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val
Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu
Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala
Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser
Gln Ser Gly Ala Ser Asn Asp Asn His Tyr 260 265 270 Phe Gly Tyr Ser
Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His 275 280 285 Cys His
Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp 290 295 300
Gly Phe Arg Pro Lys Lys Leu Ser Phe Lys Leu Phe Asn Ile Gln Val 305
310 315 320 Arg Gly Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn
Asn Leu 325 330 335 Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr
Gln Leu Pro Tyr 340 345 350 Val Leu Gly Ser Ala His Gln Gly Cys Leu
Pro Pro Phe Pro Ala Asp 355 360 365 Val Phe Met Val Pro Gln Tyr Gly
Tyr Leu Thr Leu Asn Asn Gly Ser 370 375 380 Gln Ala Val Gly Arg Ser
Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser 385 390 395 400 Gln Met Leu
Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr Phe Glu 405 410 415 Asp
Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg 420 425
430 Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr
435 440 445 Gln Gly Thr Thr Ser Gly Thr Thr Asn Gln Ser Arg Leu Leu
Phe Ser 450 455 460 Gln Ala Gly Pro Gln Ser Met Ser Leu Gln Ala Arg
Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Leu
Ser Lys Thr Ala Asn Asp Asn 485 490 495 Asn Asn Ser Asn Phe Pro Trp
Thr Ala Ala Ser Lys Tyr His Leu Asn 500 505 510 Gly Arg Asp Ser Leu
Val Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu
Glu Lys Phe Phe Pro Met His Gly Asn Leu Ile Phe Gly 530 535 540 Lys
Glu Gly Thr Thr Ala Ser Asn Ala Glu Leu Asp Asn Val Met Ile 545 550
555 560 Thr Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu
Gln 565 570 575 Tyr Gly Thr Val Ala Asn Asn Leu Gln Ser Ser Asn Thr
Ala Pro Thr 580 585 590 Thr Gly Thr Val Asn His Gln Gly Ala Leu Pro
Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro
Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro
Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro
Pro Gln Ile Met Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro
Pro Thr Thr Phe Ser Pro Ala Lys Phe Ala Ser Phe Ile Thr 660 665 670
Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675
680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser
Asn 690 695 700 Tyr Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr
Asn Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg
Tyr Leu Thr Arg Asn Leu 725 730 735 4734PRTAdeno-associated virus
serotype 4 4Met Thr Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu
Ser Glu 1 5 10 15 Gly Val Arg Glu Trp Trp Ala Leu Gln Pro Gly Ala
Pro Lys Pro Lys 20 25 30 Ala Asn Gln Gln His Gln Asp Asn Ala Arg
Gly Leu Val Leu Pro Gly 35 40 45 Tyr Lys Tyr Leu Gly Pro Gly Asn
Gly Leu Asp Lys Gly Glu Pro Val 50 55 60 Asn Ala Ala Asp Ala Ala
Ala Leu Glu His Asp Lys Ala Tyr Asp Gln 65 70
75 80 Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala
Asp 85 90 95 Ala Glu Phe Gln Gln Arg Leu Gln Gly Asp Thr Ser Phe
Gly Gly Asn 100 105 110 Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg
Val Leu Glu Pro Leu 115 120 125 Gly Leu Val Glu Gln Ala Gly Glu Thr
Ala Pro Gly Lys Lys Arg Pro 130 135 140 Leu Ile Glu Ser Pro Gln Gln
Pro Asp Ser Ser Thr Gly Ile Gly Lys 145 150 155 160 Lys Gly Lys Gln
Pro Ala Lys Lys Lys Leu Val Phe Glu Asp Glu Thr 165 170 175 Gly Ala
Gly Asp Gly Pro Pro Glu Gly Ser Thr Ser Gly Ala Met Ser 180 185 190
Asp Asp Ser Glu Met Arg Ala Ala Ala Gly Gly Ala Ala Val Glu Gly 195
200 205 Gly Gln Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His
Cys 210 215 220 Asp Ser Thr Trp Ser Glu Gly His Val Thr Thr Thr Ser
Thr Arg Thr 225 230 235 240 Trp Val Leu Pro Thr Tyr Asn Asn His Leu
Tyr Lys Arg Leu Gly Glu 245 250 255 Ser Leu Gln Ser Asn Thr Tyr Asn
Gly Phe Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg Phe
His Cys His Phe Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile Asn
Asn Asn Trp Gly Met Arg Pro Lys Ala Met Arg Val 290 295 300 Lys Ile
Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn Gly Glu 305 310 315
320 Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val Gln Ile Phe Ala Asp
325 330 335 Ser Ser Tyr Glu Leu Pro Tyr Val Met Asp Ala Gly Gln Glu
Gly Ser 340 345 350 Leu Pro Pro Phe Pro Asn Asp Val Phe Met Val Pro
Gln Tyr Gly Tyr 355 360 365 Cys Gly Leu Val Thr Gly Asn Thr Ser Gln
Gln Gln Thr Asp Arg Asn 370 375 380 Ala Phe Tyr Cys Leu Glu Tyr Phe
Pro Ser Gln Met Leu Arg Thr Gly 385 390 395 400 Asn Asn Phe Glu Ile
Thr Tyr Ser Phe Glu Lys Val Pro Phe His Ser 405 410 415 Met Tyr Ala
His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro Leu Ile 420 425 430 Asp
Gln Tyr Leu Trp Gly Leu Gln Ser Thr Thr Thr Gly Thr Thr Leu 435 440
445 Asn Ala Gly Thr Ala Thr Thr Asn Phe Thr Lys Leu Arg Pro Thr Asn
450 455 460 Phe Ser Asn Phe Lys Lys Asn Trp Leu Pro Gly Pro Ser Ile
Lys Gln 465 470 475 480 Gln Gly Phe Ser Lys Thr Ala Asn Gln Asn Tyr
Lys Ile Pro Ala Thr 485 490 495 Gly Ser Asp Ser Leu Ile Lys Tyr Glu
Thr His Ser Thr Leu Asp Gly 500 505 510 Arg Trp Ser Ala Leu Thr Pro
Gly Pro Pro Met Ala Thr Ala Gly Pro 515 520 525 Ala Asp Ser Lys Phe
Ser Asn Ser Gln Leu Ile Phe Ala Gly Pro Lys 530 535 540 Gln Asn Gly
Asn Thr Ala Thr Val Pro Gly Thr Leu Ile Phe Thr Ser 545 550 555 560
Glu Glu Glu Leu Ala Ala Thr Asn Ala Thr Asp Thr Asp Met Trp Gly 565
570 575 Asn Leu Pro Gly Gly Asp Gln Ser Asn Ser Asn Leu Pro Thr Val
Asp 580 585 590 Arg Leu Thr Ala Leu Gly Ala Val Pro Gly Met Val Trp
Gln Asn Arg 595 600 605 Asp Ile Tyr Tyr Gln Gly Pro Ile Trp Ala Lys
Ile Pro His Thr Asp 610 615 620 Gly His Phe His Pro Ser Pro Leu Ile
Gly Gly Phe Gly Leu Lys His 625 630 635 640 Pro Pro Pro Gln Ile Phe
Ile Lys Asn Thr Pro Val Pro Ala Asn Pro 645 650 655 Ala Thr Thr Phe
Ser Ser Thr Pro Val Asn Ser Phe Ile Thr Gln Tyr 660 665 670 Ser Thr
Gly Gln Val Ser Val Gln Ile Asp Trp Glu Ile Gln Lys Glu 675 680 685
Arg Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn Tyr Gly 690
695 700 Gln Gln Asn Ser Leu Leu Trp Ala Pro Asp Ala Ala Gly Lys Tyr
Thr 705 710 715 720 Glu Pro Arg Ala Ile Gly Thr Arg Tyr Leu Thr His
His Leu 725 730 5724PRTAdeno-associated virus serotype 5 5Met Ser
Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15
Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20
25 30 Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro
Gly 35 40 45 Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly
Glu Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp
Ile Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr
Leu Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu
Ala Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val
Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val
Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp
Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150
155 160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser
Gln 165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly
Ala Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp
Asn Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp
Trp His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr
Lys Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn
His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser
Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270
Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275
280 285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg
Val 290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln
Asp Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr
Val Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val
Val Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro
Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn
Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe
Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395
400 Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser
405 410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu
Val Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr
Gly Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala
Asn Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr
Gln Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser
Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly
Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn
Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520
525 Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu
530 535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val
Asn Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr
Asn Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr
Asn Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg
Asp Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu
Thr Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe
Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640
Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645
650 655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met
Glu 660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro
Glu Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val
Asp Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg
Pro Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu
6736PRTAdeno-associated virus serotype 6 6Met Ala Ala Asp Gly Tyr
Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg
Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala
Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr
Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr
Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala
Lys Lys Arg Val Leu Glu Pro 115 120 125 Phe Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser
Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr
Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175
Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180
185 190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly
Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val
Gly Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu
Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala
Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser
Ala Ser Thr Gly Ala Ser Asn Asp Asn His 260 265 270 Tyr Phe Gly Tyr
Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280 285 His Cys
His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290 295 300
Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln 305
310 315 320 Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala
Asn Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu
Tyr Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His Gln Gly Cys
Leu Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Ile Pro Gln Tyr
Gly Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala Val Gly Arg
Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400 Ser Gln Met
Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405 410 415 Glu
Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp 420 425
430 Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg
435 440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu
Phe Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys
Asn Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val
Ser Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn Phe Thr Trp
Thr Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg Glu Ser Ile
Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525 Asp Asp Lys
Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530 535 540 Lys
Glu Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile 545 550
555 560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu
Arg 565 570 575 Phe Gly Thr Val Ala Val Asn Leu Gln Ser Ser Ser Thr
Asp Pro Ala 580 585 590 Thr Gly Asp Val His Val Met Gly Ala Leu Pro
Gly Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro
Ile Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro
Ser Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro
Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro
Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr 660 665 670
Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675
680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser
Asn 690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn
Asn Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg
Tyr Leu Thr Arg Pro Leu 725 730 735 7737PRTAdeno-associated virus
serotype 7 7Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn
Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly
Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asn Gly
Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe
Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala
Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys
Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala
Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115
120 125 Leu Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Ala Lys Lys
Arg 130 135 140 Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser
Thr Gly Ile 145 150 155 160 Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys
Arg Leu Asn Phe Gly Gln 165
170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu
Pro 180 185 190 Pro Ala Ala Pro Ser Ser Val Gly Ser Gly Thr Val Ala
Ala Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala
Asp Gly Val Gly Asn 210 215 220 Ala Ser Gly Asn Trp His Cys Asp Ser
Thr Trp Leu Gly Asp Arg Val 225 230 235 240 Ile Thr Thr Ser Thr Arg
Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245 250 255 Leu Tyr Lys Gln
Ile Ser Ser Glu Thr Ala Gly Ser Thr Asn Asp Asn 260 265 270 Thr Tyr
Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290
295 300 Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn
Ile 305 310 315 320 Gln Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr
Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Ile Gln Val Phe Ser
Asp Ser Glu Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His
Gln Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile
Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn 370 375 380 Gly Ser Gln Ser
Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro
Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Glu Phe Ser Tyr Ser 405 410
415 Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr
Leu Ala 435 440 445 Arg Thr Gln Ser Asn Pro Gly Gly Thr Ala Gly Asn
Arg Glu Leu Gln 450 455 460 Phe Tyr Gln Gly Gly Pro Ser Thr Met Ala
Glu Gln Ala Lys Asn Trp 465 470 475 480 Leu Pro Gly Pro Cys Phe Arg
Gln Gln Arg Val Ser Lys Thr Leu Asp 485 490 495 Gln Asn Asn Asn Ser
Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His 500 505 510 Leu Asn Gly
Arg Asn Ser Leu Val Asn Pro Gly Val Ala Met Ala Thr 515 520 525 His
Lys Asp Asp Glu Asp Arg Phe Phe Pro Ser Ser Gly Val Leu Ile 530 535
540 Phe Gly Lys Thr Gly Ala Thr Asn Lys Thr Thr Leu Glu Asn Val Leu
545 550 555 560 Met Thr Asn Glu Glu Glu Ile Arg Pro Thr Asn Pro Val
Ala Thr Glu 565 570 575 Glu Tyr Gly Ile Val Ser Ser Asn Leu Gln Ala
Ala Asn Thr Ala Ala 580 585 590 Gln Thr Gln Val Val Asn Asn Gln Gly
Ala Leu Pro Gly Met Val Trp 595 600 605 Gln Asn Arg Asp Val Tyr Leu
Gln Gly Pro Ile Trp Ala Lys Ile Pro 610 615 620 His Thr Asp Gly Asn
Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly 625 630 635 640 Leu Lys
His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro 645 650 655
Ala Asn Pro Pro Glu Val Phe Thr Pro Ala Lys Phe Ala Ser Phe Ile 660
665 670 Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu
Leu 675 680 685 Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln
Tyr Thr Ser 690 695 700 Asn Phe Glu Lys Gln Thr Gly Val Asp Phe Ala
Val Asp Ser Gln Gly 705 710 715 720 Val Tyr Ser Glu Pro Arg Pro Ile
Gly Thr Arg Tyr Leu Thr Arg Asn 725 730 735 Leu
8738PRTAdeno-associated virus serotype 8 8Met Ala Ala Asp Gly Tyr
Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg
Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala
Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50
55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr
Asp 65 70 75 80 Gln Gln Leu Gln Ala Gly Asp Asn Pro Tyr Leu Arg Tyr
Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp
Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala
Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly
Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Pro Ser
Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile 145 150 155 160 Gly Lys
Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln 165 170 175
Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro 180
185 190 Pro Ala Ala Pro Ser Gly Val Gly Pro Asn Thr Met Ala Ala Gly
Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly
Val Gly Ser 210 215 220 Ser Ser Gly Asn Trp His Cys Asp Ser Thr Trp
Leu Gly Asp Arg Val 225 230 235 240 Ile Thr Thr Ser Thr Arg Thr Trp
Ala Leu Pro Thr Tyr Asn Asn His 245 250 255 Leu Tyr Lys Gln Ile Ser
Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp 260 265 270 Asn Thr Tyr Phe
Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn 275 280 285 Arg Phe
His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn 290 295 300
Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser Phe Lys Leu Phe Asn 305
310 315 320 Ile Gln Val Lys Glu Val Thr Gln Asn Glu Gly Thr Lys Thr
Ile Ala 325 330 335 Asn Asn Leu Thr Ser Thr Ile Gln Val Phe Thr Asp
Ser Glu Tyr Gln 340 345 350 Leu Pro Tyr Val Leu Gly Ser Ala His Gln
Gly Cys Leu Pro Pro Phe 355 360 365 Pro Ala Asp Val Phe Met Ile Pro
Gln Tyr Gly Tyr Leu Thr Leu Asn 370 375 380 Asn Gly Ser Gln Ala Val
Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr 385 390 395 400 Phe Pro Ser
Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Thr Tyr 405 410 415 Thr
Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser 420 425
430 Leu Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu
435 440 445 Ser Arg Thr Gln Thr Thr Gly Gly Thr Ala Asn Thr Gln Thr
Leu Gly 450 455 460 Phe Ser Gln Gly Gly Pro Asn Thr Met Ala Asn Gln
Ala Lys Asn Trp 465 470 475 480 Leu Pro Gly Pro Cys Tyr Arg Gln Gln
Arg Val Ser Thr Thr Thr Gly 485 490 495 Gln Asn Asn Asn Ser Asn Phe
Ala Trp Thr Ala Gly Thr Lys Tyr His 500 505 510 Leu Asn Gly Arg Asn
Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr 515 520 525 His Lys Asp
Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile Leu Ile 530 535 540 Phe
Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp Tyr Ser Asp Val 545 550
555 560 Met Leu Thr Ser Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala
Thr 565 570 575 Glu Glu Tyr Gly Ile Val Ala Asp Asn Leu Gln Gln Gln
Asn Thr Ala 580 585 590 Pro Gln Ile Gly Thr Val Asn Ser Gln Gly Ala
Leu Pro Gly Met Val 595 600 605 Trp Gln Asn Arg Asp Val Tyr Leu Gln
Gly Pro Ile Trp Ala Lys Ile 610 615 620 Pro His Thr Asp Gly Asn Phe
His Pro Ser Pro Leu Met Gly Gly Phe 625 630 635 640 Gly Leu Lys His
Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val 645 650 655 Pro Ala
Asp Pro Pro Thr Thr Phe Asn Gln Ser Lys Leu Asn Ser Phe 660 665 670
Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu 675
680 685 Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr
Thr 690 695 700 Ser Asn Tyr Tyr Lys Ser Thr Ser Val Asp Phe Ala Val
Asn Thr Glu 705 710 715 720 Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly
Thr Arg Tyr Leu Thr Arg 725 730 735 Asn Leu 9736PRTAdeno-associated
virus serotype 9 9Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu
Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys
Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp
Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly
Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala
Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln
Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100
105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu
Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly
Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser
Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys
Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val
Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser
Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro
Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225
230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn
His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser
Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly
Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg
Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro
Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys
Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn
Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345
350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu
Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys
Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn
Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His
Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn
Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Lys Thr Ile
Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460 Val
Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470
475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln
Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp
Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala
Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu
Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp
Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu
Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly
Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln 580 585 590
Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln 595
600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro
His 610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly
Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys
Asn Thr Pro Val Pro Ala 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys
Asp Lys Leu Asn Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln
Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser
Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn 690 695 700 Tyr Tyr
Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715
720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu
725 730 735 10738PRTAdeno-associated virus serotype 10 10Met Ala
Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15
Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20
25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu
Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys
Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His
Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro
Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg
Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala
Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu
Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro
Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile 145 150
155 160 Gly Lys Lys Gly Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly
Gln 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Ile
Gly Glu Pro 180 185 190 Pro Ala Gly Pro Ser Gly Leu Gly Ser Gly Thr
Met Ala Ala Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn Asn Glu
Gly Ala Asp Gly Val Gly Ser 210 215 220 Ser Ser Gly Asn Trp His Cys
Asp Ser Thr Trp Leu Gly Asp Arg Val 225 230 235 240 Ile Thr Thr Ser
Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245
250 255 Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ser Thr Asn
Asp 260 265 270 Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe
Asp Phe Asn 275 280 285 Arg Phe His Cys His Phe Ser Pro Arg Asp Trp
Gln Arg Leu Ile Asn 290 295 300 Asn Asn Trp Gly Phe Arg Pro Lys Arg
Leu Asn Phe Lys Leu Phe Asn 305 310 315 320 Ile Gln Val Lys Glu Val
Thr Gln Asn Glu Gly Thr Lys Thr Ile Ala 325 330 335 Asn Asn Leu Thr
Ser Thr Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln 340 345 350 Leu Pro
Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe 355 360 365
Pro Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn 370
375 380 Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu
Tyr 385 390 395 400 Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe
Glu Phe Ser Tyr 405 410 415 Gln Phe Glu Asp Val Pro Phe His Ser Ser
Tyr Ala His Ser Gln Ser 420 425 430 Leu Asp Arg Leu Met Asn Pro Leu
Ile Asp Gln Tyr Leu Tyr Tyr Leu 435 440 445 Ser Arg Thr Gln Ser Thr
Gly Gly Thr Ala Gly Thr Gln Gln Leu Leu 450 455 460 Phe Ser Gln Ala
Gly Pro Asn Asn Met Ser Ala Gln Ala Lys Asn Trp 465 470 475 480 Leu
Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Leu Ser 485 490
495 Gln Asn Asn Asn Ser Asn Phe Ala Trp Thr Gly Ala Thr Lys Tyr His
500 505 510 Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Val Ala Met
Ala Thr 515 520 525 His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Ser
Gly Val Leu Met 530 535 540 Phe Gly Lys Gln Gly Ala Gly Lys Asp Asn
Val Asp Tyr Ser Ser Val 545 550 555 560 Met Leu Thr Ser Glu Glu Glu
Ile Lys Thr Thr Asn Pro Val Ala Thr 565 570 575 Glu Gln Tyr Gly Val
Val Ala Asp Asn Leu Gln Gln Gln Asn Ala Ala 580 585 590 Pro Ile Val
Gly Ala Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val 595 600 605 Trp
Gln Asn Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile 610 615
620 Pro His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe
625 630 635 640 Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn
Thr Pro Val 645 650 655 Pro Ala Asp Pro Pro Thr Thr Phe Ser Gln Ala
Lys Leu Ala Ser Phe 660 665 670 Ile Thr Gln Tyr Ser Thr Gly Gln Val
Ser Val Glu Ile Glu Trp Glu 675 680 685 Leu Gln Lys Glu Asn Ser Lys
Arg Trp Asn Pro Glu Ile Gln Tyr Thr 690 695 700 Ser Asn Tyr Tyr Lys
Ser Thr Asn Val Asp Phe Ala Val Asn Thr Asp 705 710 715 720 Gly Thr
Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg 725 730 735
Asn Leu 1145DNAArtificial SequenceForward Oligonucleotide Primer
11accagaacct gggctctgcc cactttcaac aaccatctct acaag
451245DNAArtificial SequenceReverse Oligonucleotide Primer
12caatcaggag cttcgaacga caaccacttc tttggctaca gcacc
451345DNAArtificial SequenceOligonucleotide Primer 13cttatcgatc
agtatctgta cttcctgaac agaacgcaag gaaca 451448DNAArtificial
SequenceOligonucleotide Primer 14gctaacgaca acaacaacag taactatcca
tggacagcgg ccagcaaa 481545DNAArtificial SequenceOligonucleotide
Primer 15tggaatccag agattcagtt cacgtccaac tacaacaagt ctgtt
451645DNAArtificial SequenceOligonucleotide Primer 16gagattcagt
acacgtccaa cttcaacaag tctgttaatg tggac 451744DNAArtificial
SequenceOligonucleotide Primer 17gtgaacctcg ccctattgga acccggtttc
tcacacgaaa cttg 441821DNAArtificial SequenceOligonucleotide Primer
18tcccatagta acgccaatag g 211923DNAArtificial
SequenceOligonucleotide Primer 19cttggcatat gatacacttg atg
232021DNAArtificial SequenceOligonucleotide Primer 20tcccatagta
acgccaatag g 212123DNAArtificial SequenceOligonucleotide Primer
21cttggcatat gatacacttg atg 2322145DNAArtificial SequenceSynthetic
Sequence 22aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg
ctcactgagg 60ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca
gtgagcgagc 120gagcgcgcag agagggagtg gccaa 1452320DNAArtificial
SequenceOligonucleotide Primer 23ctccatcact aggggttcct
202420DNAArtificial SequenceOligonucleotide Primer 24ctccatcact
aggggttcct 202520DNAArtificial SequenceOligonucleotide Primer
25gaggtagtga tccccaagga 20
* * * * *