U.S. patent application number 15/221791 was filed with the patent office on 2016-11-10 for stabilization of whole blood at room temperature.
The applicant listed for this patent is Roche Diagnostics Operations, Inc.. Invention is credited to Waltraud Ankenbauer, Ulrike Dietrich-Veenstra, Renate Kolb, Yvonne Maerz, Stephanie Wessner.
Application Number | 20160324144 15/221791 |
Document ID | / |
Family ID | 50033350 |
Filed Date | 2016-11-10 |
United States Patent
Application |
20160324144 |
Kind Code |
A1 |
Ankenbauer; Waltraud ; et
al. |
November 10, 2016 |
STABILIZATION OF WHOLE BLOOD AT ROOM TEMPERATURE
Abstract
The present disclosure is directed to the stabilization of
nucleated cells in a whole blood sample ex-vivo, effected by an
additive being a liquid composition for stabilizing an analyte in
intact nucleated cells of a whole-blood sample ex-vivo, the
composition being an aqueous solution, the solution comprising an
anticoagulant, a phosphate salt, a cell-metabolizable sugar,
adenine, and an antioxidant, wherein the antioxidant comprises a
mitochondria-targeted antioxidant, preferably a
mitochondria-targeted antioxidant selected from the group
consisting of SkQ1, MitoQ, SS-31, and a mixture thereof. In a
specific embodiment, the liquid composition further comprises a
protease inhibitor. Further provided is advantageous use of the
composition for stabilizing an analyte selected from DNA, RNA and
protein in intact nucleated cells of the whole-blood sample
ex-vivo, as well as kits including the composition for practicing
said use. Additionally, specific methods are provided for
stabilizing intact nucleated cells of a whole-blood sample
ex-vivo.
Inventors: |
Ankenbauer; Waltraud;
(Mannheim, DE) ; Dietrich-Veenstra; Ulrike;
(Iffeldorf, DE) ; Kolb; Renate; (Iffeldorf,
DE) ; Maerz; Yvonne; (Murnau, DE) ; Wessner;
Stephanie; (Farchant, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Roche Diagnostics Operations, Inc. |
Indianapolis |
IN |
US |
|
|
Family ID: |
50033350 |
Appl. No.: |
15/221791 |
Filed: |
July 28, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/EP2015/051658 |
Jan 28, 2015 |
|
|
|
15221791 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01N 1/0226
20130101 |
International
Class: |
A01N 1/02 20060101
A01N001/02 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 30, 2014 |
EP |
14153199.6 |
Claims
1. A liquid composition for stabilizing an analyte in intact
nucleated cells of a whole-blood sample ex-vivo, the composition
being an aqueous solution, the solution comprising an
anticoagulant, a phosphate salt, a cell-metabolizable sugar,
adenine, and an antioxidant, wherein the antioxidant comprises a
mitochondria-targeted antioxidant.
2. The composition of claim 1 wherein the mitochondria-targeted
antioxidant is selected from the group consisting of SkQ1, MitoQ,
SS-31, or a mixture thereof.
3. The composition according to claim 1, wherein the composition
further comprises a protease inhibitor.
4. The composition of claim 1, wherein the antioxidant is a mixture
of a first and a second antioxidant, wherein the first antioxidant
is a mitochondria-targeted antioxidant, and the second antioxidant
is an antioxidant other than a mitochondria-targeted
antioxidant.
5. The composition of claim 4, wherein the second antioxidant is
selected from the group consisting of glutathione, acetylsalicylic
acid, N-acetyl-5-aminosalicylic acid, N-acetylcysteine,
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox) and
a mixture thereof.
6. The composition according to claim 4, wherein the first
mitochondria-targeted antioxidant is selected from the group
consisting of SkQ1, MitoQ, SS-31, and a mixture thereof.
7. The composition according to claim 1, wherein the
cell-metabolizable sugar is selected from the group consisting of
glucose and fructose.
8. The composition according to claim 1, the composition being
enclosed in a blood drawing container.
9. The composition according to claim 1, further comprising an
amount of whole blood.
10. The composition according to claim 9, wherein the composition
comprises one or more mitochondria-targeted antioxidant(s) with an
aggregate concentration of 10 nM to 200 .mu.M.
11. The composition according to claim 10, wherein the composition
comprises a concentration of a mitochondria-targeted antioxidant
selected from the group consisting of 50 nM-250 nM.
12. The composition according to claim 11, wherein the composition
comprises 11.1 mM-12.3 mM trisodium citrate, 2 mM-2.2 mM citric
acid, 2 mM-2.2 mM NaH.sub.2PO.sub.4, 19.1 mM-21.1 mM glucose, 0.23
mM-0.25 mM adenine, 0.24 mM-0.26 mM AEBSF, 990 nM-1.1 .mu.M SS-31
and acetylsalicylic acid 990 .mu.M-1.1 mM.
13. A kit of parts comprising a composition according to claim 8,
the kit further comprising packaging material, a label, and a user
instruction sheet.
14. A method for stabilizing intact nucleated cells of a
whole-blood sample ex-vivo, the method comprising the steps of (a)
providing the whole blood sample ex-vivo; (b) contacting and mixing
the sample of step (a) with a composition according to claim 1; (c)
incubating the mixture obtained in step (b), thereby stabilizing
intact nucleated cells of the ex-vivo whole-blood sample.
15. The method according to claim 14, wherein the mixture obtained
in step (b) is a composition according to claim 10.
16. The method according to claim 14, wherein step (c) is performed
at room temperature for a time interval selected from the group
consisting of 0 h-12 h, 0 h-24 h, 0 h-36 h, 0 h-48 h, 0 h-60 h, and
0 h-72 h.
17. The method of claim 14, the method further comprising the steps
of (d) separating intact nucleated cells from the incubated mixture
obtained in step (c); and (e) lysing the separated nucleated cells
and detecting an analyte of nucleated cells in the lysate, wherein
the analyte is selected from the group consisting of DNA, RNA, and
protein.
18. The method according to claim 17, wherein in the mixture of
step (b) the mitochondria-targeted antioxidant is SS-31 at a
concentration of 500 nM-10 .mu.M.
19. The method according to claim 18, wherein the mixture of step
(b) further comprises acetylsalicylic acid at a concentration of
200 nM-10 mM, and AEBSF at a concentration of 50 nM-1 mM.
20. The method according to claim 14, the method further comprising
the steps of (d) separating intact nucleated cells from the
incubated mixture obtained in step (c); (e) contacting the
separated nucleated cells of step (d) with a culture medium, and
culturing viable cells.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of International Patent
Application No. PCT/EP2015/051658 filed Jan. 28, 2015, and claims
priority to European Patent Application No. 14153199.6 filed Jan.
30, 2014, the disclosures of which are hereby incorporated by
reference in their entirety.
BACKGROUND OF THE DISCLOSURE
[0002] The present disclosure pertains to compositions, uses, kits
and methods useful in the stabilization of intact viable cells,
particularly nucleated cells present in whole blood samples. The
present disclosure is directed to the stabilization of nucleated
cells in a whole blood sample ex-vivo, effected by an additive
being a liquid composition for stabilizing an analyte in intact
nucleated cells of a whole-blood sample ex-vivo, the composition
being an aqueous solution, the solution comprising an
anticoagulant, a phosphate salt, a cell-metabolizable sugar,
adenine, and an antioxidant, wherein the antioxidant comprises a
mitochondria-targeted antioxidant, preferably a
mitochondria-targeted antioxidant selected from the group
consisting of SkQ1, MitoQ, SS-31, and a mixture thereof. In a
specific embodiment, the liquid composition further comprises a
protease inhibitor. Further provided is advantageous use of the
composition for stabilizing an analyte selected from DNA, RNA and
protein in intact nucleated cells of the whole-blood sample
ex-vivo, as well as kits including the composition for practicing
said use. Additionally, specific methods are provided for
stabilizing intact nucleated cells of a whole-blood sample
ex-vivo.
[0003] Whole blood is one of the most frequently collected sample
material for diagnostic analysis in medicine. However, sampling and
analysis of whole blood are usually separate events. Following the
sampling step, a major technical challenge exists concerning
stabilization of intact cells, particularly intact nucleated cells,
over a period of time. There is a specific desire in the art to
preserve the biological status of nucleated cells in a whole blood
sample, in order to bridge the time interval between sampling and
analysis, see Olson W C et al. (Journal of Translational Medicine 9
(2011) 26), Tanner et al. (Clin. Lab. Haem. 24 (2002) 337-341),
Baechler et al. (Genes and Immunity 5 (2004) 347-353), and Elliott
et al. (International Journal of Epidemiology 37 (2008) 234-244).
"Preservation of biological status" or "stabilization" is
understood as providing conditions under which changes concerning
the composition and levels of biomolecules present in a living cell
at the time of sampling are minimized while keeping the cell intact
and viable. Particular biomolecules of interest in this regard are
DNA, RNA and protein.
[0004] Although some cell-preserving additives are known to the
art, it still remains a technical challenge to stabilize a whole
blood sample with nucleated cells over a period of 2 to 3 days at
room temperature. There is a particular need for means enabling
isolation of intact nucleated cells after that time interval,
wherein the cells are preferably viable. More specifically, it is
desired that any change of composition and level of biomolecules in
the cells is minimized such that analysis of the cells after the
time interval closely reflects the biological status of the cells
at the time point when the whole blood was sampled.
BRIEF SUMMARY OF THE DISCLOSURE
[0005] A first aspect reported herein is a liquid composition for
stabilizing an analyte in intact nucleated cells of a whole-blood
sample ex-vivo, the composition being an aqueous solution, the
solution comprising an anticoagulant, a phosphate salt, a
cell-metabolizable sugar, adenine, and an antioxidant, wherein the
antioxidant comprises a mitochondria-targeted antioxidant,
preferably a mitochondria-targeted antioxidant selected from the
group consisting of SkQ1, MitoQ, SS-31, and a mixture thereof.
[0006] A second aspect reported herein is the use of a composition
as disclosed herein for stabilizing an analyte selected from DNA,
RNA and protein in intact nucleated cells of a whole-blood sample
ex-vivo.
[0007] A third aspect reported herein is a kit of parts comprising
a blood drawing container enclosing a liquid composition according
to the disclosure herein, the kit further comprising packaging
material, a label, and a user instruction sheet.
[0008] A fourth aspect reported herein is method for stabilizing
intact nucleated cells of a whole-blood sample ex-vivo, the method
comprising the steps of (a) providing the whole blood sample
ex-vivo; (b) contacting and mixing the sample of step (a) with a
composition according to the disclosure herein; (c) incubating the
mixture obtained in step (b), thereby stabilizing intact nucleated
cells of the ex-vivo whole-blood sample.
DESCRIPTION OF THE FIGURES
[0009] FIG. 1 Detection of MDA-MB-468 cells spiked into blood
samples after storage for 48 hours at room temperature. Depicted is
the percentage of MDA-MB-468 cells detected by immunostaining with
Anti-CK5/8 antigens. "Box-and-whisker plot" indicating mean
percentage of target cell retrieval by way of assay as described in
Example 1. 1st diagrammed box--EDTA: MDA-MB-468 cells detected in
blood sample stored in EDTA as anticoagulant. 2nd
box--EDTA+Sivelestat: MDA-MB-468 cells detected in blood sample
stored in EDTA as anticoagulant and sivelestat as stabilizer. 3rd
box--EDTA+Pefabloc.RTM. SC: MDA-MB-468 cells detected in blood
sample stored in EDTA as anticoagulant and Pefabloc.RTM. SC as
stabilizer. 4th box-EDTA+SKQ1: MDA-MB-468 cells detected in blood
sample stored in EDTA as anticoagulant and SKQ1 as stabilizer. 5th
box--EDTA+MitoQ: MDA-MB-468 cells detected in blood sample stored
in EDTA as anticoagulant and MitoQ as stabilizer. 6th
box--EDTA+glutathione: MDA-MB-468 cells detected in blood sample
stored in EDTA as anticoagulant and glutathione as stabilizer.
[0010] FIG. 2 Detection of MDA-MB-468 cells spiked into blood
samples after storage for 48 hours at room temperature. Depicted is
the percentage of MDA-MB-468 cells detected by immunodetection with
fluorescent anti-CK 5/8 antibodies. "Box plot" indicating mean
percentage of target cell retrieval by way of the assay described
in Example 2. 1st diagrammed box--EDTA: MDA-MB-468 cells detected
in blood sample stored in EDTA as anticoagulant. 2nd box--CPDA:
MDA-MB-468 cells detected in blood sample stored in citrate/citric
acid, phosphate, dextrose and adenine. 3rd box--CPDA+SS-31:
MDA-MB-468 cells detected in blood sample stored in citrate,
phosphate, dextrose, adenine and SS+31. 4th box--CPDA+glutathione:
MDA-MB-468 cells detected in blood sample stored in citrate,
phosphate, dextrose, adenine and glutathione.
[0011] FIG. 3 Influence of storage on DNA yield. Samples were
stored in EDTA or EDTA supplemented with glutathione, SkQ1 and
Pefabloc.RTM. SC ("Stabilizer 3"), as indicated in Example 3.
[0012] FIG. 4 Blood from two blood donors was collected either in
EDTA or in stabilizer as described in Example 5. Samples were
spiked with MDA-MB-468 cells. Immediately and following a 72 hours
long incubation at room temperature, the MDA-MB-468 cells were
isolated and the nucleic acids were extracted. The set of nucleic
acid parameters depicted in the figure was amplified by RT-PCR or
PCR (depending on the template); changes of the respective nucleic
acid levels were calculated using GCK DNA as endogenous reference.
"Stabilizer 72 h" refers to the samples incubated for 72 hours with
Stabilizer 5 as described in Example 5.
[0013] FIG. 5 Blood from 2 different donors was either stabilized
with EDTA or with stabilizer. MDA-MB-468 cells were spiked to the
blood samples. The samples were stored for 48 hours at room
temperature. MDA-MB-468 cells were enriched by erythrocyte lysis
and immunomagnetic isolation using CD326 (EpCAM) Microparticles
(see Example 7). The cells were cultured for more than 100 hrs.
[0014] Open diamond: specimen 1, EDTA-stabilized, closed diamond:
specimen 1 with Stabilizer 5.
[0015] Open square: specimen 2, EDTA-stabilized, closed square:
specimen 2 with Stabilizer 5.
[0016] Open circle: specimen 1, EDTA-stabilized, closed circle:
specimen 1 with Stabilizer 5.
[0017] Open triangle: specimen 2, EDTA-stabilized, closed triangle:
specimen 2 with Stabilizer 5.
DETAILED DESCRIPTION
[0018] For the purpose of the present disclosure, certain terms are
defined as follows herein. In the event of a conflict in a
definition in the present disclosure and that of a cited reference,
the present disclosure controls.
[0019] As used herein, the term "comprising" means that other steps
and other components that do not affect the end result may be
utilized. The term "comprising" encompasses the expressions
"consisting of," and "consisting, essentially of". The use of
singular identifiers such as "the," "a," or "an" is not intended to
be limiting solely to the use of a single component, but may
include multiple components. For example, unless stated otherwise
the expression "a compound" has the meaning of "one or more
compound(s)". As used herein, "plurality" is understood to mean
more than one. For example, a plurality refers to at least two,
three, four, five, or more. Unless specifically stated or obvious
from context, as used herein, the term "or" is understood to be
inclusive. The term "and/or" means one or all of the listed
elements or a combination of any two or more of the listed
elements. Ranges are used herein as a shorthand for describing each
and every value that is within the range (e.g., 1 to 5 includes 1,
1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Any value within the range can
be selected as the terminus of the range. Unless specifically
stated or obvious from context, as used herein, the term "about" is
understood as within a range of normal tolerance in the art, for
example within 2 standard deviations of the mean. If not indicated
differently, "about" can be understood as within 10%, 9%, 8%, 7%,
6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated
value. Unless otherwise clear from context, all numerical values
provided herein can be modified by the term "about".
[0020] As used herein the term "room temperature", unless specified
otherwise, means the ambient temperature of a typical laboratory,
which is usually about 18.degree. C. to 25.degree. C. In a specific
embodiment, room temperature is a temperature selected from the
group consisting of 18.degree. C., 19.degree. C., 20.degree. C.,
21.degree. C., 22.degree. C., 23.degree. C., 24.degree. C., and
25.degree. C. As used herein, a "purified" or "isolated" compound
means the compound has been separated from the mixture in which it
was formed. With respect to cells, a "purified" or "isolated" cell
denotes one or more cells or a group of cells that were enriched or
separated from a mixture of cells. By way of non-limiting example,
nucleated cells can be isolated from the mixture of cells in an ex
vivo sample of whole blood by lysing the erythrocytes present in
the sample and separating by centrifugation intact nucleated cells,
discarding the supernatant and re-suspending the pelleted cells in
a physiological buffer or in a cell culture medium.
[0021] Disclosed herein is a "composition", the term being
understood as signifying the product of combining and mixing a
plurality of ingredients. A "liquid" composition is a composition
which is present in the liquid state of aggregation. Specifically,
the liquid composition as disclosed herein is an aqueous
composition, a solution with water as solvent and a plurality of
water-soluble compounds dissolved therein. An "analyte" in general
is a substance, specifically a cellular component, which is the
target of an analytical process such as, but not limited to, a
process for qualitative or quantitative detection of the substance.
A specific analyte for the purpose of the present disclosure is
selected from DNA, RNA and protein, the latter comprising
oligopeptides, polypeptides, and posttranslational modified
derivatives thereof.
[0022] A large number of processes are known for purifying and
analyzing nucleic acids. In the analytical field, specific focus is
on qualitative and/or quantitative detection of specific DNA or RNA
sequences. Using the polymerase chain reaction (PCR) and specific
primers hybridizing to the flanks of a DNA sequence of interest,
said sequence can be amplified, and the amplified sequence can be
detected. Such detection usually is performed as a hybridization
reaction with a labeled probe. So-called real-time PCR allows this
detection step to take place while the target sequence is being
amplified. For the specific detection of a RNA sequence, RNA needs
to be reverse-translated to form cDNA; the cDNA reflecting the
target RNA sequence can then be amplified and detected using a
PCR-based DNA amplification technique.
[0023] Specific detection of a target protein is typically achieved
making use of specific binders capable of binding to the target.
Thus, immunoassay detection methods are a non limiting example of
this approach.
[0024] The present disclosure is specifically directed to
stabilizing an analyte selected from DNA, RNA and protein in intact
nucleated cells of a whole-blood sample ex-vivo for a period of up
to 72 hours (0 to 72 h), specifically 48 to 72 hours, the period
counted from the time point of sampling the whole blood and
contacting the whole blood with the stabilizing composition as
disclosed herein. Advantageously, the time between blood sampling
and contacting the blood with the stabilizing composition is less
than 30 seconds.
[0025] The term "stabilizing" includes the specific meaning of
keeping intact the cell membranes of nucleated cells of the blood
sample, and preserving and maintaining in the nucleated cells the
cellular proteins and the cellular DNA as well as the cellular RNA
and particularly the composition of cellular mRNA reflecting the
gene expression status at the time of sampling; in addition,
"stabilizing" encompasses providing an environment in which
nucleated cells have a substantially reduced tendency to undergo
necrosis or apoptosis, and in which the pattern of expressed
proteins remains largely unchanged. The term "stabilizing" further
includes supporting of vital cell functions, avoiding intoxication
of cells and cell death, maintaining the nucleated cells in a
resting but viable state.
[0026] Unless explicitly mentioned otherwise, the expression
"citrate/citric acid" refers to a mixture of trisodium citrate and
citric acid. Reference to Blood with EDTA as the sole anticoagulant
means whole blood having an EDTA concentration of about 1.8 mg per
ml of blood.
[0027] A first aspect as disclosed herein is a liquid composition
for stabilizing an analyte in intact nucleated cells of a
whole-blood sample ex-vivo, the composition being an aqueous
solution, the solution comprising an anticoagulant, a phosphate
salt, a cell-metabolizable sugar, adenine, and an antioxidant,
wherein the antioxidant comprises a mitochondria-targeted
antioxidant, preferably a mitochondria-targeted antioxidant
selected from the group consisting of SkQ1, MitoQ, SS-31, and a
mixture thereof. Specifically, the analyte is selected from DNA,
RNA and protein of intact nucleated cells of the whole-blood
sample.
[0028] The term "whole blood" in all aspects and embodiments
disclosed herein denotes blood that was directly collected from a
vertebrate, specifically from a mammal, more specifically from a
primate, even more specifically from a human, without any further
treatment other than the blood drawing process. It is understood
that the blood drawing process itself is not part of any of the
procedures, uses and/or methods according to the present
disclosure. Rather, the present disclosure relates to procedures,
uses and methods based on the provision of a sample of whole blood
"ex-vivo", that is to say whole blood outside of and separate from
the organism from which it was drawn. The whole blood ex vivo is
provided as a "sample", being understood as a measured amount of
whole blood.
[0029] Additives that inhibit blood and/or plasma from clotting are
important for ensuring that the cells to be analyzed are not
negatively affected by blood coagulation prior to the analytical
process. Anticoagulation occurs by binding calcium ions (EDTA,
citrate) or by inhibiting thrombin activity (heparin, hirudin).
Therefore, in order to prevent blood clotting of the ex-vivo whole
blood sample, the composition as disclosed in all aspects and
embodiments herein comprises an anticoagulant, specifically an
anticoagulant selected from the group consisting of EDTA, citrate,
heparin, hirudin, warfarin, and a mixture thereof. Anticoagulant
additives which at the same time permit integrity, that is to say
the absence of lysis and the viability of nucleated cells are known
to the art. In a specific embodiment in all aspects as disclosed
herein, sodium citrate/citric acid is added to the whole blood
sample to a final concentration of 11.7 mM and 2.1 mM,
respectively.
[0030] The phosphate salt in the composition as disclosed in here,
either alone or in combination with EDTA and/or citrate, if
present, effects the buffering of the whole blood sample at a
physiological pH. In a specific embodiment of all aspects as
disclosed herein, the phosphate salt is NaH.sub.2PO.sub.4, added to
the whole blood sample to a final concentration of 2.1 mM in an
even more specific embodiment. Further additives are adenine and a
cell-metabolizable sugar, in order to support cell integrity and
viability. In a further specific embodiment of all aspects as
disclosed herein, adenine is added to the whole blood sample to a
final concentration of 0.24 mM.
[0031] Notably, is was found by the authors of to present
disclosure that the presence of an effective amount of an
antioxidant is essential, in order to stabilize nucleated cells of
a whole blood sample ex-vivo. The observed beneficial effects of
antioxidants point to reactive oxygen species as a possible cause
for cell instability in the sample. Reactive oxygen species are
typically generated by NADPH oxidase, xanthine oxidase, the
mitochondrial electron-transport chain, and dysfunctional
endothelial nitric oxide synthase. When the capacity of cellular
antioxidant defense systems, e.g., superoxide dismutase, catalase,
glutathione peroxidase, heme oxygenase, paraoxonase, is exceeded,
this results in oxidative stress, which can promote cell death.
Therefore, means to prevent oxidative stress are of major
interest.
[0032] Particularly, mitochondria produce substantial amounts of
O.sub.2.sup.- at the mitochondrial electron-transport chain
complexes I and III. Complex I releases O.sub.2.sup.- into the
mitochondrial matrix and is considered the main producer of
O.sub.2.sup.- due to reverse electron flow from complex II under
low-ADP conditions. The matrix-localized mitochondrial superoxide
dismutase 2 (SOD2) dismutates O.sub.2.sup.- to H.sub.2O.sub.2,
which in turn is reduced to water by glutathione peroxidase or
catalase. The importance of SOD2 thus lies in the detoxification of
O.sub.2.sup.- to prevent generation of ONOO.sup.- (peroxynitrite)
and/or oxidative damage of mitochondrial electron-transport chain
proteins and mitochondrial DNA, which may otherwise compromise
mitochondrial function. Complex III also releases O.sub.2.sup.- to
the mitochondrial intermembrane space, where it is dismutated by
SOD1, another isozyme of superoxide dismutase. Mitochondria
themselves are known to be sensitive to reactive oxygen species.
Oxidative damage lowers their activity and may even increase their
production of reactive oxygen species. Enhanced levels thereof are
known to damage the mitochondrial DNA and to stimulate the release
of mitochondrial apoptotic factors.
[0033] Importantly, the composition in all aspects and embodiments
as disclosed in here comprises a mitochondria-targeted antioxidant.
An "antioxidant" in a generic sense is a molecule that is capable
of inhibiting oxidation or reactions promoted by oxygen, reactive
oxygen species, and peroxides. This includes the property of being
capable of inhibiting and/or terminating a reaction of a free
radical. An antioxidant is typically a reducing agent which is
capable of taking part in oxidation reactions as an electron donor,
thus becoming oxidized itself. An antioxidant according to the
understanding as disclosed in here acts as a substitute oxidation
target competing with cellular components which in the absence of
the antioxidant would be oxidized and thereby compromised by
oxidative damage.
[0034] A "mitochondria-targeted" antioxidant is an antioxidant
which is typically applied extracellularly, which is capable of
crossing the cellular membrane and capable of interacting with the
mitochondrial membrane, in order to inhibit certain oxidation
processes taking place in the mitochondrial compartment of the
cell. Specific examples for such cell-permeable antioxidants are
SkQ1, MitoQ, SS-31, among others. SkQ1, also known as a salt
comprising 10-(6'-plastoquinonyl) decyltriphenylphosphonium, is
known for its neuroprotective properties, among others. When
applied to target cells extracellularly, SkQ1 has been shown to
inhibit oxidative stress caused by reactive oxygen species in
mitochondria. MitoQ is a mixture of mitoquinol (reduced form) and
mitoquinone (oxidized form), also known as
(10-(2,5-dihydroxy-3,4-dimethoxy-6-methylphenyl)decyl)
triphenylphosphonium and
(10-(4,5-dimethoxy-2-methyl-3,6-dioxocyclohexa-1,4-dienyl)decyl)
triphenylphosphonium. MitoQ comprises a ubiquinol moiety which is
covalently attached through an aliphatic carbon chain to a
lipophilic triphenylphosphonium cation. The antioxidant reactions
of extracellularly applied MitoQ predominantly occur within
phospholipid bilayers. SS-31 (d-Arg-Dmt-Lys-Phe-NH2;
Dmt=2',6'-dimethyltyrosine) is a member of a family of several
cell-permeable antioxidant peptides that reduce intracellular free
radicals Like other members in the family, SS-31 peptides are known
to target mitochondria and protect mitochondria against
mitochondrial permeability transition, swelling, and cytochrome c
release, and prevent t-butylhydroperoxide-induced apoptosis.
[0035] A number of other mitochondria targeted antioxidants are
known to the art, particularly from clinical applications in the
fields of cardiovascular and neurodegenerative diseases. In
principle, these also qualify as compounds which can be
advantageously used as alternative stabilizing compounds, in order
to practice the teachings of the present disclosure.
[0036] In a specific embodiment of all aspects as disclosed herein,
the mitochondria targeted antioxidant is SkQ1. In an even more
specific embodiment, SkQ1 is added to the whole blood sample to a
final concentration of 5-500 nM, advantageously to a final
concentration of 50-250 nM, particularly about 100 nM. In yet a
further specific embodiment of all aspects as disclosed herein, the
mitochondria targeted antioxidant is SS-31. In an even more
specific embodiment, SS-31 is added to the whole blood sample to a
final concentration of 0.1-50 .mu.M, advantageously to a final
concentration of 0.5-10 .mu.M, particularly about 1 .mu.M.
[0037] As the antioxidants disclosed in here are applied in an
aqueous solution, the antioxidants selected to practice all aspects
and embodiments of the present disclosure are advantageously water
soluble or solubilized in water, e.g. using a helper substance
including, but not limited to a surfactant, a detergent and an
emulsifier.
[0038] In a specific embodiment of all aspects as disclosed herein,
the antioxidant is a mixture of a first and a second antioxidant,
wherein the first antioxidant is a mitochondria-targeted
antioxidant, and the second antioxidant is an antioxidant other
than a mitochondria-targeted antioxidant. This group encompasses
water-soluble molecules with a reducing activity, wherein the
molecules are capable of undergoing oxidation outside of the
mitochondrial compartment. The second antioxidant, in a further
specific embodiment, is an antioxidant other than SkQ1, MitoQ, and
SS-31. Advantageously, in an even more specific embodiment of all
aspects as disclosed herein, the second antioxidant is selected
from the group consisting of glutathione, acetylsalicylic acid,
N-acetyl-5-aminosalicylic acid, N-acetylcysteine,
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox) and
a mixture thereof.
[0039] Further stabilization of nucleated cells of the whole blood
sample is provided by the presence of a protease inhibitor in the
liquid composition in all aspects and embodiments as disclosed
herein. A specific embodiment in this regard includes an inhibitor
of a serine protease. A more specific embodiment in this regard
includes an inhibitor of human neutrophil elastase. Particular
advantage is provided by specific embodiments of a liquid
composition for stabilizing an analyte in intact nucleated cells of
a whole-blood sample ex-vivo, the liquid composition including a
protease inhibitor selected from Sivelestat, AEBSF, and a mixture
thereof. The compound commercialized as "Sivelestat" or "ONO-5046",
also known as
N-{2-[({4-[(2,2-dimethylpropanoyl)oxy]phenyl}sulfonyl)amino]benzoyl}glyci-
ne is a selective neutrophil elastase inhibitor. AEBSF is an
abbreviation of 4-(2-Aminoethyl)benzenesulfonyl fluoride which a
water soluble, and which is an irreversible serine protease
inhibitor. The hydrochloride is commercially available as
Pefabloc.RTM. SC. In a specific embodiment of all aspects as
disclosed herein, and with particular advantage, Pefabloc.RTM. SC
is added to the whole blood sample to result in a final
concentration of 0.05-1 mM, more specifically 0.1-0.5 mM, and even
more specifically 0.2-0.3 mM, particularly about 0.25 mM.
[0040] Pefabloc.RTM. SC is a water-soluble serine protease
inhibitor with a molecular weight of 239.5 Daltons, also known to
the art as 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride
(AEBSF). The compound is capable of inhibiting proteases like
chymotrypsin, kallikrein, plasmin, thrombin, and trypsin.
[0041] In order to stabilize the nucleated cells of the whole blood
sample, it was also found to be of advantage to supplement the
sample with a cell-metabolizable sugar. In a specific embodiment of
all aspects as disclosed herein, the sugar is selected from glucose
and fructose. In an even more specific embodiment, the glucose is
added to the whole blood sample to a final concentration of 15-25
mM, advantageously to a final concentration of 19-21 mM,
particularly about 20 mM.
[0042] A further aspect as disclosed in here is a kit of parts
comprising a liquid composition for stabilizing an analyte in
intact nucleated cells of a whole-blood sample ex-vivo as disclosed
in here, the composition being an aqueous solution, the solution
comprising an anticoagulant, a phosphate salt, a cell-metabolizable
sugar, adenine, and an antioxidant, wherein the antioxidant
comprises a mitochondria-targeted antioxidant, the liquid
composition being enclosed in a blood drawing container, the kit
further comprising packaging material, a label, and a user
instruction sheet.
[0043] The liquid composition for stabilizing an analyte in intact
nucleated cells of a whole-blood sample ex-vivo in all aspects and
embodiments as disclosed in here is advantageously contained in a
blood drawing container. An example therefor is known to the art as
a "vacutainer". A vacutainer is a blood collection tube provided as
a sterile glass or plastic tube with a closure and a vacuum inside
the tube facilitating the draw of a predetermined volume of liquid
such as a whole blood sample from the vein of a subject. A
vacutainer tube according to the present disclosure contains a
liquid composition for stabilizing an analyte in intact nucleated
cells of a whole-blood sample ex-vivo, in order to stabilize and
preserve the whole blood sample prior to analytical testing. Tubes
are available with or without a safety-engineered closure, with a
variety of labeling options and closure colors as well as a range
of draw volumes.
[0044] In the blood collection process, the vein is first punctured
with a hypodermic needle which is carried in a translucent plastic
holder. The needle is double ended, the second shorter needle being
shrouded for safety by the holder. When a Vacutainer test tube is
pushed down into the holder, its rubber cap is pierced by the
second needle and the pressure difference between the blood volume
and the vacuum in the tube forces blood through the needle and into
the tube. The filled tube is then removed and another can be
inserted and filled the same way. It is important to remove the
tube before withdrawing the needle, as there may still be some
suction left, causing pain upon withdrawal. Once the collection
tube is removed from the needle, the whole blood sample inside the
tube is detached from the body of the subject, hence being an
ex-vivo whole blood sample. Thus, another specific embodiment of
all aspects as disclosed herein is enclosing a mixture of (a) a
liquid composition for stabilizing an analyte in intact nucleated
cells of a whole-blood sample ex-vivo as disclosed herein, and (b)
an amount of whole blood, i.e. the sample being a measured and/or
predetermined amount of whole blood ex-vivo.
[0045] Another aspect disclosed in here is the use of a liquid
composition for stabilizing an analyte in intact nucleated cells of
a whole-blood sample ex-vivo as disclosed in here, the composition
being an aqueous solution, the solution comprising an
anticoagulant, a phosphate salt, a cell-metabolizable sugar,
adenine, and an antioxidant, wherein the antioxidant comprises a
mitochondria-targeted antioxidant, the use being for the purpose of
stabilizing an analyte selected from DNA, RNA and protein in intact
nucleated cells of a whole-blood sample ex-vivo.
[0046] Thus, another aspect disclosed in here is a method for
stabilizing intact nucleated cells of a whole-blood sample ex-vivo,
the method comprising the steps of (a) providing the whole blood
sample ex-vivo; (b) contacting and mixing the sample of step (a)
with a liquid composition for stabilizing an analyte in intact
nucleated cells of a whole-blood sample ex-vivo as disclosed in
here, the composition being an aqueous solution, the solution
comprising an anticoagulant, a phosphate salt, a cell-metabolizable
sugar, adenine, and an antioxidant, wherein the antioxidant
comprises a mitochondria-targeted antioxidant; (c) incubating the
mixture obtained in step (b), thereby stabilizing intact nucleated
cells of the ex-vivo whole-blood sample. In a specific embodiment
of all aspects as disclosed in here, the whole blood sample
contacted and mixed with the liquid composition as disclosed in
here can be incubated at room temperature for a prolonged time
interval, whereby the nucleated cells present in the whole blood
sample are stabilized, as well as analytes in the cells,
particularly DNA, RNA, and protein. In a specific embodiment, the
step of incubating the mixture obtained in step (b) can be
performed at room temperature for a time interval selected from the
group consisting of 0 h-12 h, 0 h-24 h, 0 h-36 h, 0 h-48 h, 0 h-60
h, and 0 h-72 h, or even for longer, depending on the analyte to be
detected thereafter.
[0047] In the embodiments of all aspects as disclosed herein, the
target cell for stabilization is a nucleated cell present in the
ex-vivo sample of whole blood. Specifically, the nucleated cell is
a nucleated cell of hematopoetic lineage or a nucleated cell of
non-hematopoetic lineage. Specifically, a nucleated cell of
hematopoetic lineage is selected from the group of cell types
consisting of a megakaryocyte, a thrombocyte, a nucleated red blood
cell, a mast cell, a myeloblast, a basophil, a neutrophil, an
eosinophil, a monocyte, a macrophage, a large granular lymphocyte,
a small lymphocyte, a T lymphocyte, a B lymphocyte, a plasma cell,
and a dendritic cell, or a precursor of any of the said cell types.
In another specific embodiment, the nucleated cell is a nucleated
cancer cell of hematopoetic lineage.
[0048] In a further embodiment of all aspects as disclosed herein,
the target cell for stabilization is a nucleated cell present in
the ex-vivo sample of whole blood, the nucleated cell being capable
of undergoing two or more cell divisions thereby forming daughter
cells. In a specific embodiment, the nucleated cell is capable of
undergoing cell divisions not only in vivo but also ex-vivo in a
culture medium. Thus, the present disclosure, its aspects and
embodiments provide liquid compositions for supporting and/or
maintaining the viability of an intact nucleated target cell of a
whole-blood sample ex-vivo, the composition being an aqueous
solution, the solution comprising an anticoagulant, a phosphate
salt, a cell-metabolizable sugar, adenine, and an antioxidant,
wherein the antioxidant comprises a mitochondria-targeted
antioxidant, preferably a mitochondria-targeted antioxidant
selected from the group consisting of SkQ1, MitoQ, SS-31, and a
mixture thereof, wherein the intact nucleated target cell is
capable of undergoing one or more cell divisions. More
specifically, the nucleated target cell is capable of undergoing
one or more cell divisions in a culture medium.
[0049] In this regard, the skilled person is well aware of
different culture media which support viability and cell division
of mammalian cells, specifically of human cells, more specifically
of cancer cells of human origin. In a specific embodiment the
culture media support cell viability and cell division in the
absence of a composition for supporting and/or maintaining the
viability of an intact nucleated target cell in an ex-vivo of
whole-blood as disclosed in the present document.
[0050] On the one hand, despite being in a resting state the
viability of the nucleated target cell is maintained in the ex-vivo
whole-blood sample that is mixed with the stabilizing liquid
composition as disclosed. On the other hand and remarkably, the
nucleated target cell which is in a resting state can be isolated
from the stabilized blood sample and be put into culture, whereby
once removed from the stabilizers the nucleated cell becomes
physiologically active again. In other words, upon removing the
nucleated target cell from the whole-blood sample with the
stabilizing composition the resting state is reversed, even
including the biological functions necessary for cell division.
Thus, the skilled person is now equipped with improved means to
isolate a nucleated target cell from a sample of whole blood,
wherein in a specific embodiment the target cell is capable of
undergoing cell divisions ex vivo, and more specifically wherein
the target cell is a cancer cell, e.g. but not limited to, a
circulating tumor cell.
[0051] Yet, in a further embodiment of all aspects as disclosed
herein there is provided a method to isolate and culture a
nucleated target cell present in an ex-vivo sample of whole blood,
comprising the steps of (a) providing the ex-vivo whole blood
sample; (b) contacting and mixing the sample of step (a) with a
liquid composition, the composition being an aqueous solution, the
solution comprising an anticoagulant, a phosphate salt, a
cell-metabolizable sugar, adenine, and an antioxidant, wherein the
antioxidant comprises a mitochondria-targeted antioxidant,
preferably a mitochondria-targeted antioxidant selected from the
group consisting of SkQ1, MitoQ, SS-31, and a mixture thereof; (c)
incubating the mixture obtained in step (b), thereby stabilizing
intact nucleated cells of the ex-vivo whole-blood sample;
separating nucleated cells from the incubated mixture of step (c)
and contacting the separated nucleated cells with a culture medium;
and (d) incubating the nucleated cells in the culture medium. In
specific embodiments the liquid composition is selected from a
liquid composition for stabilizing an analyte in intact nucleated
cells of a whole-blood sample ex-vivo as disclosed herein in any
aspects and embodiments.
[0052] A cancer with metastatic tumors spread over the human body
is more difficult to remove or treat than a cancer with a primary
tumor. In a patient with metastatic disease, circulating tumor
cells (CTCs) can be found in venous blood. These circulating tumor
cells are potential seeds for metastatic cancer growth. To detect
these cells is a particular desire in cancer care. Thus, the
teaching, aspects and embodiments disclosed herein provide
additional means for this purpose.
[0053] Accordingly, in yet further embodiments of all aspects as
disclosed herein, the target cell for stabilization is a nucleated
cancer cell present in the ex-vivo sample of whole blood.
Specifically, the target cell for stabilization is a nucleated cell
present in the ex-vivo sample of whole blood, wherein the
individual from whom the sample of whole blood is obtained prior to
stabilization (and detection) suffers from a cancer. In a specific
embodiment, the target cell is a nucleated cell of non-hematopoetic
lineage, particularly a cancer cell of non-hematopoetic lineage.
Particularly, the cancer cell is a circulating tumor cell,
specifically a cell shedded from a solid tumor into the
circulation, the circulation including lymph and blood.
[0054] In a specific embodiment of all aspects as disclosed herein,
the circulating tumor cell is selected from a solid tumor of cells
selected from the group consisting of epithelial, connective
tissue, bone, cartilage, muscle, and nerve cells. Circulating tumor
cells are specific nucleated cells the present disclosure as
presented here aims to make detectable in whole blood, by
stabilizing the cancer cells in the whole blood over a period of
time, preferably at room temperature.
[0055] The following examples, figures, and the sequence listing
are provided to aid the understanding of the present invention, the
true scope of which is set forth in the appended claims. It is
understood that modifications can be made in the procedures set
forth without departing from the spirit of the disclosures and
teachings as provided herein.
Example 1
Preservation of Cellular Proteins
[0056] Suspended cells of MDA-MB-468, a human breast cancer cell
line were spiked into blood samples obtained from healthy
individuals to result in 100,000 spiked cells per ml blood. The
samples were processed either immediately or after storage at room
temperature for 48 hours. Sample 1 contained EDTA as anticoagulant
only and no additive, sample 2 to 6 were supplemented with
Sivelestat (10 .mu.g/ml), Pefabloc.RTM. SC (1 mM), SkQ1 (100 nM),
Mito Q (100 nM) and glutathione (3 mM), respectively.
[0057] Nucleated cells were enriched by erythrocytes lysis. A 50
.mu.l aliquot of peach sample was mixed with 200 .mu.l of lysis
buffer (100 mM NH.sub.4Cl, 5 mM Hepes, 0.5 mM KHCO.sub.3, 0.1 mM
EDTA) and incubated for 10 min at room temperature. After
centrifugation at 200.times.g for 15 min, the supernatant was
removed and the pellet was resuspended in 250 .mu.l of lysis
buffer. After centrifugation at 200.times.g for 15 min, the
supernatant was removed and the pellet was resuspended in 1,000
.mu.l of PBS, 0.3 mM EDTA. The cells were sedimented by
centrifugation at 200.times.g for 15 min. The pellet was
resuspended in PBS, 0.3 mM EDTA and the volume of the samples
adjusted to 500 .mu.l.
[0058] For each sample a volume of 50 .mu.l of the cell suspension
was spotted on a glass slide and air-dried. The slides were fixed
in ice cold acetone for 10 min, washed with PBS twice and immersed
in labeling mixture containing anti-cytokeratine K5/K8--FITC
labeled antibody diluted 1:50 in PBS (cytokeratine=CK). After an
incubation for 30 min in the dark the supernatant was removed.
DAPI-containing mounting medium was added, the spots covered with
cover slips and after a further incubation for 20 min analyzed on a
Zeiss Axio Observer Microscope. The total number of nucleated cells
and the CK 5/8 positive cells were analyzed with the Assay Builder
Software from Zeiss. The result is shown in FIG. 1. The samples
containing protease inhibitors like Sivelestat (inhibitor of
neutrophilic elastase) and Pefabloc SC (serine protease inhibitor)
showed higher signals than the control sample without additive.
Particular positive effects were observed with SkQ1 and MitoQ,
antioxidants targeted to mitochondria. A further positive effect
was observed with the antioxidant glutathione.
[0059] FIG. 1 illustrates the detection of MDA-MB-468 cells spiked
into blood samples after storage for 48 hours at room temperature.
Depicted is the percentage of MDA-MB-468 cells detected by
immunostaining with Anti-CK 5/8 antigens.
Example 2
Preservation of Cellular Proteins
[0060] MDA-MB-468 cells were spiked into blood samples obtained
from healthy individuals to result in a concentration of 100,000
spiked cells/ml blood. The samples were processed either
immediately or after storage at room temperature for 48 hours.
Sample 1 contained EDTA as sole anticoagulant and no further
additive, samples 2 to 4 contained citrate (11.7 mM)/citric acid
(2.1 mM), NaH.sub.2PO.sub.4 (2.1 mM), Dextrose (20.1 mM;
Dextrose=D-glucose), Adenine (0.24 mM) as stabilizer. Sample 3 was
additionally supplemented with the mitochondria targeted
antioxidant SS-31 (1 .mu.M), sample 4 with glutathione (0.75 mM).
Nucleated cells were enriched by erythrocytes lysis and processed
as described in Example 1.
[0061] The result is shown in FIG. 2. Further to the results of
Example 1, antioxidants also showed their positive effect in
citrate anticoagulated blood. FIG. 2 illustrates the detection of
MDA-MB-468 cells spiked into blood samples after storage for 48
hours at room temperature. Depicted is the percentage of MDA-MB-468
cells detected by immunodetection with fluorescent Anti-CK5/8
antibodies.
Example 3
Preservation of DNA
[0062] Blood samples from 3 healthy individuals in EDTA or EDTA
mixed with glutatione (325 mM), SKQ1 (100 .mu.M), and
Pefabloc.RTM.SC (100 mM), also referred to as "Stabilizer 3", were
spiked with Karpas 422 cells in final concentrations of 200,000
spiked cells per ml blood. The samples were stored at ambient
temperature. Karpas cells are a B-cell non-Hodgkin's lymphoma (NHL)
cell line bearing both t(14; 18) and t(4; 11) chromosomal
translocations. The t(14; 18) translocation was selected as a
marker to distinguish the DNA originating from Karpas cells from
the DNA originating from normal, i.e. t(14; 18) translocation-free
blood cells.
[0063] Immediately after sample set up and following an incubation
at room temperature for 48 hours, nucleated cells were enriched by
erythrocyte lysis. Aliquots of 350 .mu.l sample were mixed with
1,000 .mu.l of lysis buffer (80 mM NH.sub.4Cl, 10 mM Hepes buffer,
0.1 mM EDTA) and incubated for 10 min at room temperature. After
centrifugation at 300.times.g for 15 min, the supernatant was
removed and the pellet was resuspended in 1,000 .mu.l of lysis
buffer. After centrifugation at 300.times.g for 15 min, the
supernatant was removed and the pellet was resuspended in 1,000
.mu.l of PBS. The cells were sedimented by centrifugation at
300.times.g for 15 min. The pellet was resuspended in PBS and the
DNA isolated with High Pure Template Preparation Kit (Roche Applied
Science, Cat. 11 796 828 001) according to the protocol recommended
by the manufacturer. The DNA was eluted with 100 .mu.l elution
buffer from the HighPure columns.
[0064] Aliquots of 5 .mu.l DNA from each sample were used in 20
.mu.l PCR reactions, in triplicates. Amplification was performed
with Lightcycler 480 Probes Master (Roche Applied Science Cat. No.
04707494001) in a LightCycler 480 instrument with an initial
denaturation at 95.degree. C. for 10 min, 50 cycles with 95.degree.
C. for 10 sec, 60.degree. C. for 60 sec. The primer and probe
sequences used were: t(14/18) forward primer acctgaggagacggtgac
(SEQ ID NO:1); t(14/18) reverse primer tggggttttgacctttagaga (SEQ
ID NO:2); t(14/18)-FAM detection probe
6FAM-ctctgggtgggtctgtgttgaaaca-BHQ2 (sequence is SEQ ID NO:3).
[0065] The differences in crossing points (term definition see
Example 4) caused by storage of the samples at room temperature for
48 hours are shown in FIG. 3. There was no significant degradation
of DNA in both conditions tested. In the presence of Stabilizer 3
however, reduced sample-to-sample variation was observed, and also
a reduction of intra-assay variation.
Example 4
Preservation of RNA
[0066] Blood samples from breast cancer patients containing
circulating tumor cells were collected either in citrate (11.7
mM)/citric acid (2.1 mM), NaH.sub.2PO.sub.4 (2.1 mM), Dextrose
(20.1 mM), Adenine (0.24 mM) and SkQ1 (100 nM), designated as
"Stabilizer 4", or in CellSave (Veridex Cell Save Preservative
tube, Cat. No. 7900005). Samples #59, #60, #62, #63, #58 were
stored for 48 hours at room temperature, samples #55, #56 and #57
were stored for 72 hours at room temperature. Nucleated cells were
enriched by erythrocyte lysis. Aliquots of 350 .mu.l blood sample
was mixed with 1,000 .mu.l of lysis buffer (80 mM NH.sub.4Cl, 10 mM
Hepes, 0.1 mM EDTA) incubated for 10 min at room temperature,
centrifuged for 15 min at 300.times.g, washed with 1,000 .mu.l of
lysis buffer, centrifuged at 300.times.g for 15 min. The pellet war
dissolved in 200 .mu.l of PBS and RNA isolated from these cells
with High Pure RNA Isolation Kit from Roche Applied Science, Cat.
No. 11828665001. The columns were eluted with 56 .mu.l of elution
buffer. 2 .mu.l aliquots from the isolated RNAs was reverse
transcribed using the Transcriptor first strand cDNA Synthesis kit
(Roche Applied Science, Cat. No. 04897030001) in reaction volumes
of 20 .mu.l. Aliquots of 5 .mu.l cDNA were amplified with the
LightCycler 480 Probes Master in a LightCycler 480 instrument. The
primers and probes that were used are described in Table 1.
TABLE-US-00001 TABLE 1 RNA target forward primer reverse primer
detection probe E- 5'-GGT TAA GCA CAA 5'-CAC CTG ACC CTT 5'-CAC AGT
CAC TGA Cadherin CAG CAA CA-3'; GTA CGT-3'; CAC CAA CGA TAA SEQ ID
NO: 4 SEQ ID NO: 5 TCC TCC GA-3' SEQ ID NO: 6.sctn. cMyc 5'-CCC CTG
GTG 5'-CTC ATC TTC TTG 5'-ACA CCG CCC ACC CTC CAT GAG GA-3'; TTC
CTC CTC AGA-3'; ACC AGC AGC G-3' SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID
NO: 9.sctn. EpCam 5'-GTT TGC GGA 5'-AGG ATT CAC CTT 5'-TGA GAA TAA
TGT CTG CAC TTC AG-3'; TAA CAT CTT TTT-3'; TAT CAC TAT TGA SEQ ID
NO: 10 SEQ ID NO: 11 TCT-3' SEQ ID NO: 12.sctn. muc 1 5'-ATT TCT
GAA 5'-TGG CAC ATC ACT 5'-ATT AAG TTC AGG ATG TTT TTG CAG CAC GCT
GA-3'; CCA GGA TCT GTG G-3' ATT TA-3'; SEQ ID NO: 14 SEQ ID NO:
15.sctn. SEQ ID NO: 13 cyclin 5'-CCG TCC ATG 5'-GAA GAC CTC CTC
5'-TCT GTT CCT CGC CGG AAG ATC-3' CTC GCA CT-3' AGA CCT CCA GCA-3'
SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18$ CAV1 5'-ACA GCC CAG GGA
5'-GGA TGG GAA CGG Roche Applied Science, AAC CTC-3' TGT AGA GA-3'
Universal ProbeLibrary SEQ ID NO: 19 SEQ ID NO: 20 probe: # 42 CK18
5'-TGA TGA CAC CAA 5'-GGC TTG TAG GCC Roche Applied Science, TAT
CAC ACG A-3' TTT TAC TTC C-3' Universal ProbeLibrary SEQ ID NO: 21
SEQ ID NO: 22 probe: #78, cat. no. 04689011001 PPIA Roche Applied
Science, Universal ProbeLibrary Human PPIA Gene Assay, Cat. No.:
05189268001 TBP Roche Applied Science, Universal ProbeLibrary Human
TBP Gene Assay, Cat no: 05189268001 beta2m Roche Applied Science,
Universal ProbeLibrary Human .beta.2M Gene Assay, Cat. No.:
05189390001 GAPDH Roche Applied Science, Universal ProbeLibrary
Human GAPD Gene Assay, Cat. No.: 05190541001 .sctn.includes 5' FAM
label, and 3'-BHQ2 label $includes 5' FAM label, and 3'-TAMRA
label
[0067] Real-time PCR including RT (=reverse transcription)-PCR use
the linearity of DNA amplification to determine absolute or
relative amounts of a known sequence in a sample. By using a
fluorescent reporter in the reaction, DNA generation is monitored
at each cycle of PCR. When the DNA is in the log linear phase of
amplification, the amount of fluorescence increases above the
background. The amplification cycle during which the fluorescence
becomes measurable against background is called the threshold cycle
or "crossing point".
[0068] Results are shown in Tables 2a-2d. In each section (2a-2d)
the first line indicates the sample number and the respective
storage time at room temperature. The second line specifies the
type of stabilizer reagent. RT-PCR was performed in duplicates,
indicated as "Test A" and "Test B". The numbers in the table are
the crossing points obtained after real-time RT-PCR. "neg"
indicates negative results.
TABLE-US-00002 TABLE 2a sample # 59 (48 h) sample # 60 (48 h)
Stabilizer 4 CellSave Stabilizer 4 CellSave RNA target Test A Test
B Test A Test B Test A Test B Test A Test B E_Cadherin 34.17 34.49
neg neg 31.62 31.42 neg neg cMyc 28.29 27.92 38.57 neg 28.49 28.12
38.19 37.11 EpCam 38.84 40.82 neg neg 36.07 34.97 neg neg muc 1
35.08 35.1 neg neg 34.94 34.65 neg neg cyclin 36.32 37.12 neg neg
34.81 34.81 neg neg CAV 37.08 36 neg neg 36.71 36.16 neg neg ck18
32.98 33.14 neg neg 31.53 31.57 42.01 neg PPIA 23.2 23.17 35.95
35.67 21.34 21.03 31.83 33.14 TBP 31.13 31.1 neg neg 29.91 29.65
neg neg beta2m 20.02 19.98 36.73 36.29 19.09 18.8 34.78 34.67 GAPDH
23.83 23.74 37.85 36.76 22.54 22.56 35.02 35.12
TABLE-US-00003 TABLE 2b sample # 62 (48 h) sample # 63 (48 h)
Stabilizer 4 CellSave Stabilizer 4 CellSave RNA target Test A Test
B Test A Test B Test A Test B Test A Test B E_Cadherin 33.34 33.24
neg neg 31.89 32.5 neg neg cMyc 28.47 28.45 neg 35.96 26.79 26.81
35.93 35.82 EpCam 38.52 38.36 neg neg 39.09 37.92 neg neg muc 1
34.56 34.23 neg neg 32.85 32.66 neg neg cyclin 35.84 36.2 neg neg
34.02 34.08 40.97 neg CAV 37.28 36.5 neg neg neg neg neg neg ck18
33.61 33.63 neg neg 31.71 31.46 42.48 neg PPIA 23.63 23.35 35.67
34.84 21.79 21.74 33.54 32.49 TBP 31.84 30.71 neg neg 29.48 29.25
neg neg beta2m 20.77 20.54 35.98 35.32 19.93 19.68 35.58 35.19
GAPDH 24.71 24.67 38.54 37.51 23.33 23.11 35.94 35.48
TABLE-US-00004 TABLE 2c sample # 55 (72 h) sample # 56 (72 h)
Stabilizer 4 CellSave Stabilizer 4 CellSave RNA target Test A Test
B Test A Test B Test A Test B Test A Test B E_Cadherin 32.61 32.22
neg neg 36.15 35.12 neg neg cMyc 29.34 29.26 37.92 37 30.47 30.3
neg neg EpCam 37.75 38.21 neg neg 40.55 39.1 neg neg muc 1 34.92
35.19 neg neg 35.93 36.21 neg neg cyclin 36.37 36.67 neg neg 37.82
37.2 neg neg CAV neg neg neg neg 38.04 neg neg neg ck18 32.16 32.14
45 neg 33.21 33.02 neg 45 PPIA 21.88 21.76 34.46 34.35 23 22.96
35.53 34.66 TBP 30.43 30.25 neg neg 31.94 31.84 neg neg beta2m
22.07 21.88 36 35.55 22.13 21.96 37.05 37.3 GAPDH 24.18 23.98 37.78
36.55 24.54 24.61 neg 39.92
TABLE-US-00005 TABLE 2d sample # 57 (72 h) sample # 58 (48 h)
Stabilizer 4 CellSave Stabilizer 4 CellSave RNA target Test A Test
B Test A Test B Test A Test B Test A Test B E_Cadherin 35.33 35.44
neg neg 34.2 34.05 neg neg cMyc 29.74 29.33 38.05 38.27 27.8 27.67
38.84 38.06 EpCam 38.67 40.03 neg neg 40.72 37.68 neg neg muc 1
35.63 35.15 neg neg 34.5 34.79 neg neg cyclin 37.04 36.93 neg neg
35.58 35.37 neg neg CAV neg 37.65 neg neg neg 36.87 neg neg ck18
33.33 33.29 neg neg 32.58 32.51 neg 42.45 PPIA 23.51 23.32 35.02
35.52 22.66 22.58 35.78 35.02 TBP 31.3 30.99 neg 40.82 31.1 30.88
neg neg beta2m 22.07 21.87 39.52 neg 20.59 20.3 36.73 37.8 GAPDH
24.64 24.21 38.44 neg 23.95 23.89 39.15 38.82
[0069] The RNA molecules indicated above are known to be specific
for certain types of circulating tumor cells. Thus, the RNAs coding
for E-Cadherin, EpCam, Muc 1, cyclin, CAV and CK18 surprisingly
remained detectable in the samples preserved with Stabilizer 4. The
cMyc RNA which was also expressed in leukocytes was detectable with
the stabilizer reagent CellSave as well, but with a strong shift in
crossing points. This indicated that the respective RNA level was
decreased by several orders of magnitude.
[0070] The housekeeping gene RNAs PPIA, TBP, beta2m and GAPDH used
as controls were detectable in all samples. The samples stabilized
with CellSave however showed very high crossing points and
therefore very low RNA levels.
[0071] This example shows that RNA in blood samples stored for 48
hours or 72 hours can be preserved in the Stabilizer 4 reagent.
Example 5
Quantification of RNA from Cells Isolated after 72 h Sample
Storage
[0072] MDA-MB-468 cells were spiked into blood samples obtained
from two healthy individuals at 14.4.times.10.sup.6 cells/ml. From
each donor four samples were prepared. Sample 1 and 2 contained
EDTA as anticoagulant only and no additive, sample 3 and 4 were
stabilized with citrate (11.7 mM), citric acid (2.1 mM),
NaH.sub.2PO.sub.4 (2.1 mM), Dextrose (20.1 mM), Adenine (0.24 mM),
Pefabloc.RTM. SC (0.25 mM), SS-31 (1 .mu.M) and acetylsalicylic
acid (1 mM) as stabilizer ("Stabilizer 5"). Aliquots from these
samples were processed immediately after set up, other aliquots
were processed after storage at room temperature for 72 hours.
MDA-MB-468 cells were isolated from blood by capturing with
BreastSelectBeads from Adnagen Cat. No.: T1-508 with 1,000 .mu.l
aliquots of sample material according to the protocol recommended
by the manufacturer.
[0073] The bead captured purified cells were resuspended in 1,000
.mu.l PBS. With 200 .mu.l aliquots RNA was isolated using the MagNA
Pure LC DNA Isolation Kit--Large volume Cat No 03310515001 using
the Program "DNA LV Blood_20_200" and an elution volume of 100
.mu.l.
[0074] The RNA was transcribed into cDNA using Transcriptor First
Strand cDNA Synthesis Kit Cat. No: 04897030001 in reactions of 70
.mu.l volume, each reaction containing 12.5 .mu.l of isolated
nucleic acid. PCR was performed with the with the LightCycler 480
Probes Master in a LightCycler 480 instrument in 20 .mu.l reactions
containing 5 .mu.l of the cDNA samples. Initial denaturation was
for 10 min at 95.degree. C., 50 cycles with 10 seconds denaturation
at 95.degree. C. and annealing/elongation at 58.degree. C. for 1
min. Detection format: Dual color hydrolysis Probe UPL (Universal
Probe Library, Roche Diagnostics GmbH Mannheim, Germany) probe as
indicated below. Table 3 describes the primer/probes for the
RNA/DNA targets analysed.
[0075] To quantify the changes in expression level of the RNA
target tested, the relative quantification method of Livak and
Schmittgen was used (Livak K. J. and Schmittgen T. D., Methods
2001, 25(4) 402-408). In order to provide a reference for
normalization of the RNA values obtained, the GCK target was
amplified from the DNA present in the total nucleic acid
preparation.
[0076] FIG. 4 show a strong decline in RNA levels from cells
isolated from blood stored in EDTA. When the cells were isolated
from blood stored in Stabilizer 5, very little influence on the RNA
was observed. The expression pattern was only slightly affected
during storage.
TABLE-US-00006 TABLE 3 Target Template forward primer reverse
primer detection probe E- RNA 5'-GGT TAA GCA 5'-CAC CTG ACC 5'-CAC
AGT CAC TGA Cadherin CAA CAG CAA CA- CTT GTA CGT-3' CAC CAA CGA TAA
3- SEQ ID NO: 24 TCC TCC GA-3' SEQ ID NO: 23 SEQ ID NO: 25.sctn.
EGFR RNA 5'-CAG GAC CAA 5'-CAC ATC TCC 5'-TGC AGT CGT CAG GCA ACA
TGG-3' ATC ACT TAT CTC CCT GAA CAT AAC SEQ ID NO: 26 CTT-3' ATC
CTT-3' SEQ ID NO: 27 SEQ ID NO: 28.sctn. cMyc RNA 5'-CCC CTG GTG
5'-CTC ATC TTC 5'-ACA CCG CCC ACC CTC CAT GAG GA- TTG TTC CTC CTC
ACC AGC AGC G-3' 3' AGA-3' SEQ ID NO: 31.sctn. SEQ ID NO: 29 SEQ ID
NO: 30 CK19 RNA 5'-CGG GAC AAG 5'-CGT ACT GAT 5'-ACC AAG TTT GAG
ATT CTT GGT GC-3' TTC CTC CTC ATG- ACG GAA CAG GC-3' SEQ ID NO: 32
3' SEQ ID NO: 34.sctn. SEQ ID NO: 33 EpCam RNA 5'-GTT TGC GGA
5'-AGG ATT CAC 5'-TGA GAA TAA TGT CTG CAC TTC AG- CTT TAA CAT CTT
TAT CAC TAT TGA 3' TTT-3' TCT G-3' SEQ ID NO: 35 SEQ ID NO: 36 SEQ
ID NO: 37.sctn. Muc 1 RNA 5'-ATT TCT GAA 5'-TGG CAC ATC 5'-ATT AAG
TTC AGG ATG TTT TTG CAG ACT CAC GCT GA- CCA GGA TCT GTG G- ATT
TA-3' 3' 3' SEQ ID NO: 38 SEQ ID NO: 39 SEQ ID NO: 40.sctn. SBEM
RNA 5'-TCT CTG CCC 5'-TTG GGT AAA 5'-TAT CCA GCT ACT AGA ATC CGA
C-3' ACT GGA ATG TCT GGT CCT GCT GA-3' SEQ ID NO: 41 T-3' SEQ ID
NO: 43.sctn. SEQ ID NO: 42 Cyclin D1 RNA 5'-CCG TCC ATG 5'-GAA GAC
CTC 5'-TCT GTT CCT CGC CGG AAG ATC-3' CTC CTC GCA CT-3' AGA CCT CCA
GCA-3' SEQ ID NO: 44 SEQ ID NO: 45 SEQ ID NO: 46$ CAV1 RNA 5'-ACA
GCC CAG 5'-GGA TGG GAA Roche Applied Science, GGA AAC CTC-3' CGG
TGT AGA GA- Universal ProbeLibrary SEQ ID NO: 47 3' probe: # 42 SEQ
ID NO: 48 CK18 RNA 5'-TGA TGA CAC 5'-GGC TTG TAG Roche Applied
Science, CAA TAT CAC ACG GCC TTT TAC TTC Universal ProbeLibrary
A-3' C-3' probe: SEQ ID NO: 49 SEQ ID NO: 50 #78, cat. no.
04689011001 VEGFR RNA 5'-TTC CTG ACC 5'-GGT CCC TGT 5'-AAG TGG CTA
AGG TTG GAG CAT CTC GGA TAC ACT T-3' GCA TGG AGT TCT A-3' SEQ ID
NO: 52 TGG CAT-3' SEQ ID NO: 51 SEQ ID NO: 53.sctn. PPIA RNA Roche
Applied Science, Universal ProbeLibrary Human PPIA Gene Assay, Cat.
No.: 05189268001 GAPDH RNA Roche Applied Science, Universal
ProbeLibrary Human GAPD Gene Assay, Cat. No.: 05190541001 PBGD DNA
5'GGC TCT TTC TGT 5'-CCA CAC TCT 5'-TTA CCA AGG AGC CCG GC-3' CCT
ATC TTT ACT- TTG AAC ATG CCC SEQ ID NO: 54 3' TGG AGA-3' SEQ ID NO:
55 SEQ ID NO: 56.sctn. GCK DNA 5'CTT TCC TGT GAG 5'GCA GAG TTC
5'-CAG AAG GCA GAT GCA CGA AGA-3' CTC TGG GGT-3' GAG GGG AGG CAC
SEQ ID NO: 57 SEQ ID NO: 58 AGG-3' SEQ ID NO: 59.sctn.
.sctn.includes 5' FAM label, and 3'-BHQ2 label $includes 5' FAM
label, and 3'-TAMRA label
Example 6
Isolation of Viable Cells after Sample Storage for 48 Hours
[0077] MDA-MB-468 cells were spiked into blood samples obtained
from healthy individuals to result in a final concentration of
300,000 spiked cells/ml blood. The samples were processed either
immediately or after storage at room temperature for 48 hours.
Sample 1 contained EDTA as anticoagulant only and no further
additive, sample 2 contained citrate (11.7 mM)/citric acid (2.1
mM), NaH.sub.2PO.sub.4 (2.1 mM), Dextrose (20.1 mM), Adenine (0.24
mM), Pefabloc.RTM. SC (0.25 mM), SS-31 (1 .mu.M) and
acetylsalicylic acid (1 mM) as stabilizer ("Stabilizer 5", see
Example 5).
[0078] Immediately after sample set up and 48 hours later nucleated
cells were enriched by erythrocyte lysis. Aliquots of 1 ml blood
were mixed with 4 ml of lysis buffer (80 mM NH.sub.4Cl, 10 mM Hepes
buffer, 0.1 mM EDTA) and incubated for 10 min at room temperature.
After centrifugation at 200.times.g for 15 min, the supernatant was
removed and the pellet was resuspended in 2 ml of PBS/3 mM EDTA.
The cells were sedimented by centrifugation at 200.times.g for 15
min. The supernatant was removed and the cell pellets resuspended
in 300 .mu.l of PBS supplemented with 2 mM EDTA and 0.5% BSA.
[0079] From these samples the MDA-MB-468 cells were isolated using
CD326 (EpCAM) Microparticles from Miltenyi (Cat No 130-061-101), MS
columns and the MACS separator system (Milteny Cat. Nos.
130-042-201, 130-042-102) making use of the protocol recommended by
the manufacturer.
[0080] The enriched cells were suspended in 300 .mu.l of RPMI
medium.
[0081] The viability of the cells was tested with the Trypan blue
exclusion method. 10 .mu.l of each sample was mixed with 10 .mu.l
of Trypan blue (Sigma-Aldrich T8154). The number of MDA-MB-468
cells excluding the dye was counted in a Neubauer chamber. The
yield of viable cells was calculated using the cell number spiked
into the blood samples as 100%.
[0082] Table 4 shows the results obtained with blood samples from
two donors. Stabilizer 5 can preserve a significant number of
cells. When just EDTA is used as a stabilizing agent the cell
viability is negatively affected, to a surprisingly significant
extent.
TABLE-US-00007 TABLE 4 Percentage of isolated viable cells
Anticoagulant/ after storage for 48 h, erythrocyte Donor Stabilizer
lysis and immunomagnetic enrichment #1 EDTA 16 #1 Stabilizer 5 44
#2 EDTA 9 #2 Stabilizer 5 46
Example 7
Cells Isolated from Stabilized Blood are Culturable
[0083] MDA-MB-468 cells treated and isolated as described in
Example 6 were seeded into the wells of an E-Plate 96-well device
(Roche Applied Science, Cat. No. 06472451001, Roche Diagnostics
GmbH Mannheim, Germany) for the Real-Time Cell Analyzer (RTCA) MP
(xCELLigence system). 50 .mu.l aliquots of cells were seeded into
wells containing 50 .mu.l of RPMI medium. Duplicates were used for
analysis. The E-Plate was incubated over night at 37.degree. C. in
an incubator to allow attachment of MDA-MB-468 cells to the bottom
of the E-Plate. In order to remove contaminating blood derived
cells the medium was removed and cells attached to the culture
plate were washed 3 times with PBS. 150 .mu.l of fresh RPMI medium
was added per well and the E-Plate transferred to the Real-Time
Cell Analyzer. Cell index was measured once per hour for 101
hours.
[0084] The result is shown in FIG. 5. Cell growth can be observed
with cells isolated from blood stored for 48 hours in stabilizer
described in this invention.
[0085] A comparison was made with cells stabilized with EDTA, only.
As it turned out, the cells isolated from blood stored with just
EDTA for 48 hours are not culturable anymore.
Sequence CWU 1
1
59118DNAArtificial Sequenceoligonucleotide 1acctgaggag acggtgac
18221DNAArtificial Sequenceoligonucleotide 2tggggttttg acctttagag a
21325DNAArtificial Sequenceoligonucleotide 3ctctgggtgg gtctgtgttg
aaaca 25420DNAArtificial Sequenceoligonucleotide 4ggttaagcac
aacagcaaca 20518DNAArtificial Sequenceoligonucleotide 5cacctgaccc
ttgtacgt 18632DNAArtificial Sequenceoligonucleotide 6cacagtcact
gacaccaacg ataatcctcc ga 32720DNAArtificial Sequenceoligonucleotide
7cccctggtgc tccatgagga 20824DNAArtificial Sequenceoligonucleotide
8ctcatcttct tgttcctcct caga 24922DNAArtificial
Sequenceoligonucleotide 9acaccgccca ccaccagcag cg
221020DNAArtificial Sequenceoligonucleotide 10gtttgcggac tgcacttcag
201124DNAArtificial Sequenceoligonucleotide 11aggattcacc tttaacatct
tttt 241227DNAArtificial Sequenceoligonucleotide 12tgagaataat
gttatcacta ttgatct 271326DNAArtificial Sequenceoligonucleotide
13atttctgaaa tgtttttgca gattta 261420DNAArtificial
Sequenceoligonucleotide 14tggcacatca ctcacgctga 201525DNAArtificial
Sequenceoligonucleotide 15attaagttca ggccaggatc tgtgg
251618DNAArtificial Sequenceoligonucleotide 16ccgtccatgc ggaagatc
181720DNAArtificial Sequenceoligonucleotide 17gaagacctcc tcctcgcact
201824DNAArtificial Sequenceoligonucleotide 18tctgttcctc gcagacctcc
agca 241918DNAArtificial Sequenceoligonucleotide 19acagcccagg
gaaacctc 182020DNAArtificial Sequenceoligonucleotide 20ggatgggaac
ggtgtagaga 202122DNAArtificial Sequenceoligonucleotide 21tgatgacacc
aatatcacac ga 222222DNAArtificial Sequenceoligonucleotide
22ggcttgtagg ccttttactt cc 222320DNAArtificial
Sequenceoligonucleotide 23ggttaagcac aacagcaaca 202418DNAArtificial
Sequenceoligonucleotide 24cacctgaccc ttgtacgt 182532DNAArtificial
Sequenceoligonucleotide 25cacagtcact gacaccaacg ataatcctcc ga
322618DNAArtificial Sequenceoligonucleotide 26caggaccaag caacatgg
182724DNAArtificial Sequenceoligonucleotide 27cacatctcca tcacttatct
cctt 242830DNAArtificial Sequenceoligonucleotide 28tgcagtcgtc
agcctgaaca taacatcctt 302920DNAArtificial Sequenceoligonucleotide
29cccctggtgc tccatgagga 203024DNAArtificial Sequenceoligonucleotide
30ctcatcttct tgttcctcct caga 243122DNAArtificial
Sequenceoligonucleotide 31acaccgccca ccaccagcag cg
223220DNAArtificial Sequenceoligonucleotide 32cgggacaaga ttcttggtgc
203321DNAArtificial Sequenceoligonucleotide 33cgtactgatt tcctcctcat
g 213423DNAArtificial Sequenceoligonucleotide 34accaagtttg
agacggaaca ggc 233520DNAArtificial Sequenceoligonucleotide
35gtttgcggac tgcacttcag 203624DNAArtificial Sequenceoligonucleotide
36aggattcacc tttaacatct tttt 243728DNAArtificial
Sequenceoligonucleotide 37tgagaataat gttatcacta ttgatctg
283826DNAArtificial Sequenceoligonucleotide 38atttctgaaa tgtttttgca
gattta 263920DNAArtificial Sequenceoligonucleotide 39tggcacatca
ctcacgctga 204025DNAArtificial Sequenceoligonucleotide 40attaagttca
ggccaggatc tgtgg 254119DNAArtificial Sequenceoligonucleotide
41tctctgccca gaatccgac 194222DNAArtificial Sequenceoligonucleotide
42ttgggtaaaa ctggaatgtc tt 224323DNAArtificial
Sequenceoligonucleotide 43tatccagcta ctggtcctgc tga
234418DNAArtificial Sequenceoligonucleotide 44ccgtccatgc ggaagatc
184520DNAArtificial Sequenceoligonucleotide 45gaagacctcc tcctcgcact
204624DNAArtificial Sequenceoligonucleotide 46tctgttcctc gcagacctcc
agca 244718DNAArtificial Sequenceoligonucleotide 47acagcccagg
gaaacctc 184820DNAArtificial Sequenceoligonucleotide 48ggatgggaac
ggtgtagaga 204922DNAArtificial Sequenceoligonucleotide 49tgatgacacc
aatatcacac ga 225022DNAArtificial Sequenceoligonucleotide
50ggcttgtagg ccttttactt cc 225122DNAArtificial
Sequenceoligonucleotide 51ttcctgacct tggagcatct ca
225219DNAArtificial Sequenceoligonucleotide 52ggtccctgtg gatacactt
195330DNAArtificial Sequenceoligonucleotide 53aagtggctaa gggcatggag
ttcttggcat 305417DNAArtificial Sequenceoligonucleotide 54ggctctttct
gtccggc 175521DNAArtificial Sequenceoligonucleotide 55ccacactctc
ctatctttac t 215630DNAArtificial Sequenceoligonucleotide
56ttaccaagga gcttgaacat gccctggaga 305721DNAArtificial
Sequenceoligonucleotide 57ctttcctgtg aggcacgaag a
215818DNAArtificial Sequenceoligonucleotide 58gcagagttcc tctggggt
185927DNAArtificial Sequenceoligonucleotide 59cagaaggcag atgaggggag
gcacagg 27
* * * * *