Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products

Abstract

The present invention is a method for the biosynthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. These final products include, but are not limited to: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids. Specifically, the present invention relates to the regular/modified/synthetic gene(s) of select enzymes are processed and inserted into an expression system (vector, cosmid, BAC, YAC, phage, etc.) to produce modified hosts. The modified host is then optimized for efficient production and yield via manipulation, silencing, and amplifying inserted or other genes in the host, leading to an efficient system for product.

Description

RELATED APPLICATIONS

[0001] The present application claims the benefit of priority to U.S. Provisional Patent Application Ser. No. 62/145,430, entitled "A Novel Method for the Cheap, Efficient, and Effective Production of Pharmaceutical and Therapeutic API's, Intermediate, and Final Products", filed Apr. 9, 2015, and currently co-pending.

FIELD OF THE INVENTION

[0002] The present invention is in the technical field of large scale production of pharmaceutical and supplemental products for various common illnesses, medical conditions, and general industrial use. More particularly, the present invention is in the technical field of bio-synthesis of cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids; compounds found in cannabis sativa, along with various combinations and specialized formulations which are beneficial in ailments ranging from cancer to glaucoma. The final product(s) can be an intermediate or a compound of interest. The core concept of the invention is based on the idea of cheaper and more efficient production, along with novel products and applications.

BACKGROUND OF THE INVENTION

[0003] Cannabinoids from cannabis have been used for thousands of years for treatment of various ailments and conditions in many different cultures around the world. However, most of various types of cannabinoids in cannabis are at a very low concentration in the plant. Therefore, most patients/users never get a threshold dosage for any kind of relief from anything other than tetrahydrocannabinolic acid (THC/A), cannabinolic-acid (CBD/A), and cannabinol (CBN). There are a few strains or concentrates available that have a rare cannabinoid, but are usually very highly concentrated in tetrahydrocannabinol (THC) or cannabidiol (CBD) to have any pronounced effect by the rare cannabinoid.

[0004] In other words, the pharmaceutical industry has not tapped into the real potential of the cannabis plant. With time, more research is being conducted into the different kinds of cannabinoids and their medicinal applications. Researchers are finding that many of the other cannabinoids also have unique medicinal properties.

SUMMARY OF THE INVENTION

[0005] Biosynthesis of important molecules can be used for therapeutic applications, bulk substance production, intermediate API biosynthesis, and various other novel formulations and applications for such substances, as known to those skilled in the art. Many biological molecules can be changed/converted into molecules of importance by using enzymes and other processes. This process can be utilized by employing methods for transforming a range of starting materials into final products to be used in pharmaceuticals and supplements as active ingredients, or donating a significant portion of their structure to the final active ingredients. The final products can also be used in other industries and applications, such as food, beverage, and other goods production. For example, table sugar, starch, and cellulose can be converted to glucose, creating a molecule that can readily be utilized by any organism as an energy source. Therefore, depending on the specific compound(s) being manufactured, and the kind(s) of starting materials available, along with the host and production technique(s) any kind of host engineering, various expression systems and methods, and varying materials, a spectrum of different methods and products is possible.

[0006] The advantages of the present invention include, without limitation, creation of hundreds of compounds from readily available biological molecules that can be produced and harvested from virtually all known sources of plants and other energy producing organisms. Since sugar producing plants and organisms, biomass, and carbon based industrial waste products are very abundant, our "raw material" will be very cheap and easy to obtain anywhere in the world. After scaling up the given methods, hundreds of compounds with medicinal properties can be produced at a very low cost, allowing the widespread distribution and aiding of millions of people.

[0007] Another advantage is that there is no need or use of growing any illegal plants. For example, no marijuana, poppy, or other plant production is necessary. This is advantageous as it will lead to drastically cutting down the production, consumption, and trafficking of many unregulated substances.

[0008] The most important advantage of the present invention is that we can make and use many compounds that are virtually so low in concentration in the cannabis plant, that there is no effect in using cannabis if we are only after the therapeutic effects of these compounds. For example, patients using marijuana can only benefit from tetrahydrocannabinolic acic (THCA), THC, cannabidiolic acid (CBDA), CBD, CBN, and a few other compound class families, as the concentrations of the other compounds is so low that it has no effect. This invention will allow the production of hundreds of compounds in pure form, leading to many new medical discoveries and applications.

BRIEF DESCRIPTION OF THE FIGURES

[0009] The nature, objects, and advantages of the present invention will become more apparent to those skilled in the art after considering the following detailed description in connection with the accompanying figures, in which like reference numerals designate like parts throughout, and wherein:

[0010] FIG. 1 is a diagram of the pathway for the biosynthesis of all molecules of interest via the conversion of starting materials to glucose and then to final products;

[0011] FIG. 2 is a diagram of the pathway for the biosynthesis of cannabinoids;

[0012] FIG. 3 is a diagram of the pathway for the biosynthesis of stilbenoids;

[0013] FIG. 4 is a diagram of the pathway for the biosynthesis of phenylpropanoids and flavonoids;

[0014] FIG. 5 is a diagram of the pathway for the biosynthesis of phenolic amides and ligananamides;

[0015] FIG. 6 is a diagram of the pathway for the biosynthesis of spermidine alkaloids;

[0016] FIG. 7 is a diagram of the combined biosynthetic pathways of FIGS. 1-6; and

[0017] FIG. 8 is diagram of the genetic modification of certain genes for higher product yield in Saccharomyces cerevisiae yeast.

DETAILED DESCRIPTION OF THE INVENTION

[0018] The present invention is a method for the biosynthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. These final products include, but are not limited to: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids (collectively, "final products").

DEFINITIONS, TERMS, ELEMENTS

[0019] The following are a list of terms and their definitions: [0020] Genetic engineering: targeted manipulation of a cell's genetic information [0021] Rational Metabolic Engineering: engineering of enzymes, transporters, or regulatory proteins based on available information about enzymes, pathways, and their regulation. [0022] Evolutionary engineering: encompasses all methods for empirical strain improvement (mutagenesis [natural or induced] and recombination and/or shuffling of genes, pathways, and even whole cells; usually performed in cycles or sequentially [0023] Cannabinoids: compounds that are terpenophenolic with 22 carbons (21 carbons for neutral forms), found in cannabis [0024] Terpenoids: also known as isoprenoids, class of organic compounds [0025] Stilbenoids: hydroxylated derivatives of stilbene [0026] Flavonoids/phenylpropanoids: compounds derived from or using phenylalanine as a precursor [0027] Lignanamides/phenolic amides: compounds produced through tyramine pathways [0028] Spermidine alkaloids: compounds produced through glutamic acid pathways [0029] Starting material/reactant/excipient: compounds used for the initial step of biosynthesis, which are cheap and readily available [0030] Intermediate: products that are formed within the biosynthesis pathways, which can further be processed to make final products, or can, themselves, be utilized as a final product [0031] Final product/product/end product/compounds of interest: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids [0032] In-vivo: inside the cell [0033] In-vitro: outside the cell [0034] BAC: bacterial artificial chromosome, carrier of DNA of interest into host [0035] YAC: yeast artificial chromosome, carrier of DNA of interest into host [0036] Vector/cosmid/phage: carrier of DNA of interest into host

Starting Materials

[0037] All biological organisms produce organic molecules that are processed in many different processes in the organism. The present invention utilizes starting materials that are either: [0038] 1) Readily available and relatively pure [0039] 2) Cheap to produce or buy [0040] 3) Easily modified (via enzymes, catalysts, or other methods)

[0041] Based on the above criteria, there are multiple groups and families of compounds that would fit one or all three of the above criteria. These groups and families of compounds include, but are not limited to: ligno-cellulosic biomass, forest biomass, energy/food production waste, commonly available sugar-based substrates, food and feed grains.

[0042] Sugars and metabolic intermediates from cellular processes can be used as starting materials. Sugars can be found in abundance in many substances, including, but not limited to the following: rice, soya/rape, cereals (maize), wheat, beans, sugar beet (sugar cane), plant biomass (wood), grasses, and various other sources. Starch, cellulose, fructose, ethanol, and saccharose in the aforementioned substances can be enzymatically converted to glucose, which, after filtration and purification steps, can be used as a raw material for the final products.

[0043] Subsequent steps can also be performed on the lignocellulose, which further makes hemicellulose and cellulose, both which make glucose. An advantage of this method is that there are by-products generated which can be sold as raw material to make hydrocarbons, biogas, and other fuel sources. Whole crops or parts of crops, or waste matter from crop products can be used and incorporated into this system, yielding an "eco-friendly" facility. Products made from these raw materials can use any of the starting materials listed in Table 2.

[0044] Within the realm of readily available non-biomass/crop bulk material, HFCS (high fructose corn syrup) is a cost effective syrup made with fruit sources that contains anywhere from 30-90% fructose, along with some other sugars. Plants that make molasses, HFCS, and other sugars can be genetically modified to enhance the production of sugar, leading to better yields of starting material from the crop. Other products from these plants can also be incorporated into compounds of interest production via slight system modification. Biodiesel, ethanol, glycerol, lactic acid, whey and glucose are a few others. These work due to the fact that any of these products can be converted into starting material for our own purposes using enzymatic or physiochemical tools.

[0045] Plants also have their own innate levels of metabolites that can be harvested into the process from a plant biomass source. Processes can be crafted that utilize most of the metabolites and biomass for API production giving the maximum efficiency and usability per amount of starting material used. (Enzyme combinations or chambers that utilize most intermediates, sugars, oils, etc. in each biomass load).

[0046] Biorefineries can be custom designed that cater to specific raw material (plant biomass for harvesting lignocellulose which is further processed and refined into a simple carbohydrate used in the API manufacturing processes). During certain steps throughout the process, thermochemical and other processing can be used for higher efficiencies which are not possible with biochemical processing alone.

[0047] Another group of cheap starting materials is agricultural residue, grass, aquatic biomass, and water hyacinth. Products such as oils and alcohols can be made with these bulk materials. These materials can be converted enzymatically and chemically into starting materials that can readily by injected into our API production system.

[0048] Specifically, biorefineries can be designed to be extremely efficient, using all parts of the raw material. For example, concerning plant biomass, the biomass can be step-wise processed so we are able to harvest all individual components. The first step can be using solvent to extract terpenes, alkaloids, etc. Other methods can be used to extract steroids, triglycerides, and other valuable metabolites. Finally the biomass can be treated with cellulases to give glucose, which is one of the primary raw materials of choice.

Production Roadmap Summary

[0049] The present invention is a method that covers the bio-synthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. Information related to the starting materials were detailed in the previous section.

[0050] Most sugars and related compounds can be inter-changed using various enzyme systems. For example, we can convert glucose to fructose using Fructose 6-Phosphate (F-6-P) as an intermediate.

[0051] Apart from starting materials, we can either: [0052] 1) Make enzymes via vectors in bacteria (e.g. E. coli) or yeast (e.g. S. cerevisiae), extract enzymes, and create in vitro models for making cannabinoids. [0053] 2) Make enzymes via protein synthesizing systems (Protein Synth. Robot, Cell Free Expression Systems, etc.) [0054] 3) Make final products (compounds of interest) in bacteria or yeast via vectors, plasmids, cosmids, mRNA, various RNA, etc; feed them substrate and purify product. [0055] 4) Genetically engineer strains of bacteria and yeast that specialize in cannabinoid production, or intermediate production, or substrate production, etc. [0056] 5) Use organic chemistry for certain parts of the above processes. [0057] 6) Use various plant starting material for large quantities of substrates or intermediates. [0058] 7) Genetically engineer various plants to produce cannabinoids. (e.g. Tomatoes or celery that naturally produce cannabinoids, or algae that produces cannabinoids) [0059] 8) Using bioengineered or unengineered C. sativa or any other plant/algae cell lines for enzyme/substrate/intermediates/product(s) production. [0060] 9) Protein engineering on the various proteins involved in the processes; engineering will enhance the functionality, ruggedness, and efficiency of the enzymes, and altering them into a novel protein, one not found to be covered in any of the above prior art patents. [0061] 10) Genetically engineer various plant species to produce higher yielding raw material (sugars) to be used in production of the products. A possibility is to have an indoor/grow for different plants to be used as raw material producers.

[0062] After the final product is made, a purification system will filter and concentrate the target molecules. Examples include large scale filtration systems such as chromatography. Once a pure product, we can utilize liquid solutions, caps, sprays, and other delivery systems.

[0063] As many of these final products are made, their applications can be seen from glaucoma to cancer, or general well-being. Certain cofactors can be combined with certain final products for more efficacy against specific medical conditions (e.g. combine certain vitamins or other therapeutic compounds with certain compounds of interest). We can also make final products that have certain combinations of compounds of interest with other cofactors as well (e.g. combine THCA/CBDANitamin C, or CBDVA/CBD). This patent covers all the products above and also ones discovered in the future based on the same principles and methods.

DETAILED DESCRIPTION OF THE FIGURES

[0064] Referring now to the invention in more detail, in FIG. 1 there is shown a family of sugars and other common derivatives. Along each arrow for each reaction, the number denotes a specific enzyme that catalyzes the reaction. Starting with any sugar in Figurel (list of starting materials in Table 1), we can convert it to glucose to incorporate it into the reaction using the appropriate enzyme, as known to those skilled in the art. An unlimited number of ways are possible when dealing with any starting material, as described above. Enzymes needed for each kind of substrate can be made in vivo or in vitro just as we will be doing for the enzymes in the final product or intermediate production. The final sugar that enters our mechanism will be either glucose or fructose. Through the glycolysis pathway, the sugar will be converted into Acetyl-CoA with the addition of ATP and CoA (shown in FIG. 1). From this point on, the intermediate can follow a variety of paths that can lead to hundreds of products. There are many alternative ways of doing this. We can use the DOX, MEP or MVA pathways to get IPP and DMAPP, which give us GPP and NPP. For a reaction with Olivetolic Acid or Divarinolic Acid, we get many cannabinoids as final products.

[0065] The generalized pathway for the production of cannabinoids once the starting material is converted to glucose is the following, using appropriate enzymes as known by those skilled in the art: [0066] Glucose.fwdarw.Fructose.fwdarw.F-6-P.fwdarw.FI:6BP.fwdarw.3-P-Glyceraldeh- yde.fwdarw.1,3-BPG.fwdarw.3PGA.fwdarw.2-PGA.fwdarw.PEP.fwdarw.Pyruvate.fwd- arw.Acetyl-CoA.fwdarw.Acetoacetyl CoA.fwdarw.HMG-CoA.fwdarw.MVA.fwdarw.Mevalonic Acid.fwdarw.Mevalonate-5-P.fwdarw.Mevalonate-5-PP.fwdarw.Isopentyl-5-PP.f- wdarw.Dimethylallyl-PP.fwdarw.NPP/GPP.fwdarw.GPP

[0067] This general pathway is outlined in FIG. 1. From this point on, the pathway can utilize Olivetolic Acid or Divarinolic Acid with GPP, yielding CBGA or CBGVA, which can further yield other cannabinoids, as shown in FIG. 2.

[0068] The pathways for stilbenoids, phenylpropanoids, and flavonoids work in a similar fashion. Phenylalanine is generated from sugars, which is then further processed into other compounds using enzymes to final compounds, as shown in FIG. 3 and FIG. 4.

[0069] Phenolic amides and lignanamide pathways are derived from tyramine molecules reacting with other compounds, as shown in FIG. 5. Tyramine can also be synthesized in our cells of interest as most living organisms contain the pathway to synthesize tyramine on their own. Same is the case for spermidine alkaloid production, as most cells already produce glutamic acid, which can be further processed by enzymes into the final components, as shown in FIG. 6.

[0070] FIG. 7 is the total pathway overview, showing how all the different classes of compounds can be made, and the general paths they take for being biosynthesized in the cell.

Overview of Procedure

[0071] A general scheme of the work flow is as follows: [0072] 1) Regular/modified/synthetic gene(s) of select enzymes are processed and inserted into an expression system (vector, cosmid, BAC, YAC, phage, etc.) to produce modified hosts. [0073] 2) Mod host is then optimized for efficient production and yield via manipulation, silencing, and amplifying inserted or other genes in the host, leading to an efficient system for product. It is important to remember that every organism is different, and to get a specific compound each optimization will also be different. [0074] 3) Mod host can produce enzymes and final products/intermediates, or be further modified using host engineering techniques. (Host engineering Can also be performed before insertion of exp. System) [0075] 4) Mod and engineering hosts produce products and intermediates. [0076] 5) Product is purified and can be further modified/processed.

[0077] In Table 1, different final products are listed along with possible uses. This list is by no means exhaustive, and as such this patent covers any molecules that are made this way. Table 2 lists all possible starting materials that can be utilized for a cheap and efficient biosynthesis.

[0078] In more detail, referring to the inter-conversion of sugars, we employ enzymes readily available in the market. Pure enzyme stock can be diluted and added to a solution with the substrates. Once the reaction is complete, we can filter out the enzyme via dialysis tubing, by precipitation out of the solution, chromatography, or other industrial methods for filtration and purification. Each step in FIGS. 1 to 7 will give work with this strategy, leading us up to the final products or key intermediate molecules. Certain steps in the process can be worked on by using chemical and physical methods as well. For example, prenylation of certain compounds can be done outside the cell, as it may be advantageous to do so since unprenylated compounds are also high value compounds. Small batches can be prenylated accordingly to demand via a chemical process.

[0079] There are also commercially available cell free expression systems, which are able to produce proteins without the need of any host. With appropriate optimization steps, it is possible to get a cheap and efficient process for production of these compounds using identified starting molecules.

Application Techniques

[0080] Referring to bacterial, yeast, plant, and algae incorporation of genes, there are a number of strategies that can be applied to achieve this. We can: [0081] 1) Add genes for 1-10 enzymes in various commercially available vectors, cosmids, plasmids, etc. Only need 1-10 enzymes added, as others are already built in most living organisms. For example, glycolysis pathway and related enzymes are already present in most hosts. [0082] 2) Bioengineer genes for better yield and suitability in the host. [0083] 3) Bioengineer strains of bacteria and yeast that are specialized in producing important molecules. Many metabolic strategies exist, with identification by appropriate screening methods: [0084] 1) Rational metabolic engineering: engineering pathways using available information [0085] 2) Evolutionary engineering: using random genetic perturbations and/or mutations (via random mutagenesis in whole genome and/or parts) [0086] 3) Transposon mutagenesis & gene overexpression libraries: overexpression and/or deletion of single or multiple genes; [0087] 4) Global transcription machinery engineering: basal transcription factors mutagenesis causing a global reprogramming of gene transcription and/or translation [0088] One strategy is to suppress any pathway that is not essential to our goals or the survival of the host.

[0089] Another is to enhance our key pathways, or mixing and matching the two methods. The second strategy is through rapid directed evolution, possible by producing many generations so eventually we get a generation of host that has evolved with our genes/functions of interest. [0090] 4) Bioengineer custom basic life forms that are specifically making our products, using another organism or using synthetic/modifications. Components from other hosts and system to make a custom organism. [0091] 5) Bioengineer bacteria and yeast to have enzyme genes in their chromosomes, and make intermediates or final products inside the host. The product of this process can further be modified. [0092] 6) Propagate various colonies of organisms which co-exist symbiotically, with the first making our starting material after utilizing a precursor, and the other colonies making our final product. This process can also be incorporated into an ecosystem type setup of different chambers, each holding different organisms that use specific parts of the raw material to produce intermediates or final products that can be modified post-manufacturing.

[0093] Referring to the extraction of enzymes once they have been produced in the host, there are many ways to isolate and purify our enzymes. Many organisms have the ability to excrete proteins, which can be collected much easier than cell lysis, as known by those skilled in the art. This technique is the preferred method.

[0094] Another method is to lyse the host culture and purify with traditional biochemistry methods (gels, centrifugation, ammonium sulfate precipitation, etc.), use a specialized nickel column with a prep HPLC (need to add a HIS tag to our proteins; remove HIS tag after purification), etc.

Example

Bacterial

[0095] Bacteria (E. Coli, etc.) are inserted with exp. system giving us a modified host. The mod host can either be further processed or it can generate products. Products/intermediates are made in the host, and may be either enzymes that are further extracted and used in vitro, or we add substrates into the bacterial culture so they use the enzymes produced in them to make the substrate. Either way (protein or prod production), purification is carried out to get final products, or intermediates that can be further processed in vitro to give final products. Throughout this procedure, host engineering can be carried out at any step of any process to get better yields.

Example 2

Plants

[0096] Plant tissue can be used as a starting material to get a tissue culture going. Appropriate expression vectors/systems carry our interest genes into the cells. Alternatively, cell engineering can lead to many combinations that may have similar or different outcomes. The culture can be grown into full plants, and products are ingested by consuming the plants (e.g. tomatoes with certain cannabinoids produced within, etc.). The second way uses the cell culture in a synthetic environment to produce final products/intermediates. Finally, product is purified and used.

Example 3

Algae

[0097] Algae are modified with the usual techniques used for host engineering. Once completed, the mod host can be embedded into a system similar to biofuel production from algae. Using sunlight and some nutrients, the algae produces final products/intermediates, which is appropriately filtered from the bulk. Other products generated can be further processed to get biofuels or other important compounds that can readily be sold in the market.

Example 4

Fungi

[0098] Fungi modified with the techniques can: [0099] 1) Use plastic to produce final products/intermediates. Plastic needs to be processed and broken down into components before being used in this process via chemical and biological processes, known by those skilled in the art. [0100] 2) Clean up waste, whilst producing final products/intermediates at the same time. [0101] 3) Produce beer and wine with fungi that also makes final prod/intermediates. Beer and wine will contain our compounds of interest. [0102] 4) Use fungi cultures to produce compounds of interest. [0103] 5) Genes for s. cerevisiae strains to be modified for better yields of final products: [0104] tHMGR [0105] upc2-1 (allows higher uptake of exogenous sterol five-fold from medium) [0106] ERG genes (ERG6, ERG2, ERG3, ERG1, ERG11, ERG24, ERG25, ERG9, ERG10, ERG13, ERG12, ERGS, ERG19, ERG20) [0107] HMGR1 and HMGR2 [0108] IDI genes [0109] Gal80p [0110] DPP1, ADH2, and ALD6 genes [0111] FPP/GPP synthase (chose avian FPP synthase as it exhibits higher catalytic turnover rates and lower Kms for substrates than other prenyltransferases)

[0112] Manipulation, deletion, overexpression, and other modifications to the genes listed above will produce strains that are highly efficient for the production of our compounds of interest. These strains have an exogenous sterol uptake, as the internal sterol pathway has been disabled by manipulations so that all the carbon flux can be directed toward the production of our compounds of interest. Example of genetic pathway regulation in yeast is shown in FIG. 8.

[0113] Our initial strategy in S. Cerevisiae was to increase the carbon flux of our pathways of interest, while decreasing or eliminating pathways that led carbon flux away from our pathways as well. We also focused on exogenous sterol uptake for higher production and secretion levels, cell permeability for more efficient and cheaper production, along with focusing the pathways on utilizing the cheapest sugars. Dynamic control over ergosterol regulation can increase yields as well. Overall result is a strain that is has increased yield many fold, while making the overall production more stable and cheaper. [0114] 1) Perform EMS mutagenesis on yeast strains (BY4741, BY4742, CEN.PK, CEN.PK2, EPY300) to get colonies with a SUE (sterol uptake exogenous) mutation. This enables us to provide exogenous sterol to the yeast while cancelling out the gene that diverts carbon flux towards ergosterol, thereby increasing total carbon flux. Without the SUE mutation, the cell diverts lots of carbon flux toward manufacturing sterols, thereby diverting the pools of intermediates away from our compounds and interest leading to very low yields. [0115] 2) Perform ERG1 and ERG9 gene knockouts. ERG1 knockout stops the activity of conversion of squalene to squalene epoxide, thereby complementing the SUE mutation and allowing higher uptake of exogenous ergosterol, while ERG9 knockout takes out the cells ability to divert carbon flux towards other metabolites. [0116] 3) On some lines, we can perform a DPP1 knockout. DPP1 knockout ensures that FPP/GPP are not converted to FOH, thereby blocking the pathway towards FOH products in the cell. [0117] 4) Perform ERG2, ERG3, or ERG6 mutations in different cell lines, while performing upregulation mutation on upc2-1 gene (general transcription factor) on all three lines. This helps increase cell membrane permeability for better excretion of our compounds without the need for cell lysis and having the ability to use two-phase or continuous fermentation. This also allows the cells to uptake more fatty acids, thereby increasing the yield many fold. [0118] 5) Overexpression of ERG10, ERG13, HMGR1/2 or tHMGR, ERG12, ERG8, IDI11, HFA1 genes in yeast inserted via vectors. By overexpression of these genes, we are amplifying the enzymes of the MVA pathway from the sugars to our compounds, thereby amplifying the intermediates and final products. [0119] 6) Modification of avian and/or salmonella ERG20 gene encoded FPP synthase (ERG20p). Some cells lines can also be modified using the Erg20p(F96C) mutations. This allows for higher Kms and increased catalytic turnover compared to endogenous GPP synthase, while the engineering itself allows for production of GPP. [0120] 7) Gal80p gene deletion so we do not need to use galactose sugar when inducing promoter expression. This is important since others have used galactose promoters, which need expensive galactose sugars for production. By deleting this gene, the cells bypass the need for galactose to express enzymes, leading to cheaper and more efficient biosynthesis. [0121] 8) Adding ADH2p promoter to induce strong transcription under conditions with low glucose. This promoter is more efficient than the GAL promoter, and has best results while using non-glucose sugars (ethanol, fructose, etc.) which are cheaper. [0122] 9) On some lines, we also overexpress ADH2 and ALD6 genes, along with overexpression of an acetyl-CoA C-acetyltransferase to increase efficiency of the system, while also gaining the ability to convert ethanol to acetate efficiently. [0123] 10) Adding and overexpressing enzymes for the production of CBDA (OS-OAC fusion enzyme, CsPti, CBDA Synthase), constructed in a single vector. These enzymes are codon optimized. [0124] 11) Grow colonies while adding free fatty acids, and hexanoic acid (for THCA, CBDA, CBGA, CBCA) or butyric acid (for THCVA, CBDVA, CBGVA, CBCVA). [0125] 12) For production of THCA/THCVA, use THCA synthase in step 10 instead of CBDA synthase. For production of CBGA/CBGVA, follow step 10 but don't use CBDA synthase in vector construct. For production of CBCA/CBCVA, use CBC synthase in step 10 instead.

[0126] Our strategy for Pichia pastoris (Pichia Pink 1, 2, 3 from Invitrogen) yeast was similar to S. Cerevisiae, except for the following differences: [0127] 1) Each enzyme, vector, and primer were optimized for insertion into pichia cells instead of s. cerevisiae. [0128] 2) Methanol is used to supplement cells in addition to free fatty acid, hexanoic acid, and butyric acid, thereby reducing the total cost of production many fold, while eliminating any contamination issues from other species. [0129] 3) No EMS mutagenesis is performed. [0130] 4) Knockouts of pep4 (encoding Proteinase A), prb1 (encoding Proteinase B), and YPS1 genes are also introduced. These knockouts allow for the integration of high copy plasmids leading to higher yields. [0131] 5) Steps 7, 8, and 9 from the S. cerevisiae strategy above are not to be performed in pichia cells.

Example 5

Cell Free Expression Systems

[0132] Vectors are introduced into cell free expression systems, and make either enzymes or intermediate/final products. Further processing or steps are needed to get purified final products.

Procedures

EMS Mutagensis (S. Cere.; BY4741, BY4742, CEN.PK, CEN.Pk2, BY300)

[0133] 1) Cells incubated overnight @30 C in 5 mL TPD medium while shaking @200 rpm to establish 200 mL YPD shake flask culture. [0134] 2) When OD600 of yeast culture reaches 1.0, cells are spun down by centrifugation (12 mins at 4,000 g), washed twice with 20 mL 0.1M sodium phosphate buffer, pH7.0. [0135] 3) Cells concentrated by centrifugation again, re-suspended in 1 mL 0.1M sodium phosphate buffer, transferred to 30 mL FALCON tubes, treated with 300 uL EMS (1.2 g/mL). [0136] 4) Cells are incubated at 30 C for 1 hr while shaking. [0137] 5) Stop mutagenesis by adding 8 mL of sterile 5% sodium thiosulfate to yeast cells. [0138] 6) Cells are pelleted, washed with 8 mL sterile water, concentrated by centrifugation, re-suspended in 1 mL sterile water and 100 uL aliquots plated into YPD-NCS agar plate (YPD+50 mg/L each of cholesterol, nystatin, sqalestatin, and 2% Bacto-agar). [0139] 7) In some instances, washed cells were resuspended in 1 mL YPDE liquid media for overnight recovery before plating to YPD-NCS agar medium. [0140] 8) Incubate cultures for up to two weeks at 30 C until distinct colonies are visible.

Bacteria & Yeast Culturing

[0140] [0141] 1) Grown using standard culture practices. [0142] 2) YPD media without selection consisted of 1% Bacto-yeast extract, 2% Bacto-peptone, and 2% glucose. [0143] 3) Add 40 mg/L ergosterol to YPD media to get YPDE media. [0144] 4) Add 40 mg/L each of nystatin, cholesterol, and squalestatin to YPD media to get TPDNCS media. [0145] 5) Add 40 mg/L each of ergosterol and squalestatin to YPD media to get YPDSE media. [0146] 6) Prepare minimal media, SCE (pH5.3), by adding 0.67% Bacto-yeast nitrogen base (without amino acids), 2% dextrose, 0.6% succinic acid, 0.14% Sigma yeast dropout soln (-his, -leu, -ura, -trp), uracil (300 mg/L), L-tryptophan (150 mg/L), L-histidine (250 mg/L), L-methionine (200 mg/L), L-leucine (I g/L), and 40 mg/L of ergosterol. [0147] 7) Cholesterol and ergosterol stocks are 10 mg/mL in 50% Triton X-100, 50% ethanol and kept at -20 C. [0148] 8) Selection media prepared similarly except without supplementation of media with indicated reagent based on the yeast auxotrophic markers. [0149] 9) All solid media plates are prepared with 2% Bacto-agar.

Yeast Transformation & Culture Performance

[0149] [0150] 1) Used FROZEN-EZ Yeast Transformation II Kit from Zymo Research, Orange, CA, according to manufacturer's recommendations. [0151] 2) lug of plasmid was used per transformation, followed by selection on agar plates of SCE medium lacking specified amino acids for auxotrophic markers, or YPDE containing 300 mg/L hygromycin B for screening erg9 knockout at 30 C. [0152] 3) Colonies are picked and used to start 3 mL cultures in minimal media to characterize their terpene production capabilities. (6 days incubation at 30 C while shaking) [0153] 4) Best cultures are chosen to move further, using 30 mL shake flask cultures. [0154] 5) Cultures are grown to saturation in minimal media, inoculated into 30 mL SCE media and 1 mL aliquots are taken out daily for 15 days. [0155] 6) Cell growth is monitored via change in optical density at 600 nm every two days using dilutions at later stages of growth. [0156] 7) Production of terpenes is determined via testing.

ERG9 Knockout Mutations

[0156] [0157] 1) Primers ERG9PS1 and ERG9-250downS2 used to amplify hygromycin resistance gene, hphNT1, from the pFA6-hph-NT1 vector. [0158] 2) Simulataneously add 42 bp nucleotide sequences homologous to regions surrounding ERG9 gene in yeast genome. [0159] 3) Purified PCR fragment is transformed into various cell lines identified in phase 2 with the ability to accumulate farnesol and selected on YPDE plates containing 300 mg/L hygromycin. [0160] 4) Independent single colonies are picked for ergosterol dependent test, PCR confirmation of recombination with hphF and ERG9 450DWR primer. [0161] 5) Farnesol production analysis done by GC-MS/LC-MS.

ERG1 Knockout Mutations

[0161] [0162] 1) Primers ERG1F and ERG1R used to amplify the sqalene epoxidase synthase ERG1 gene by using Takara high fidelity Primerstar taq polymerase. [0163] 2) Obtained PCR fragment is gel purified, A tailed and ligated into the pGEM-Teasy vector. [0164] 3) Obtained vector is used as template to run second PCR with primers Erg1-splitF and EGR1-splitR to obtain PCR fragment with deletion of 8916 bp CDS in the middle, yet containing 310 bp at 5' end region and 291 bp at 3' end region of ERG1 gene which are the target homologous recombination sequence for ERG1 knockout. [0165] 4) After digestion with BamHI, self-ligation, and transformation to DH5alpha competent cells, resulting vector is pGEM-ERG1-split. [0166] 5) Padh-Kanmx4-Tcyc-LoxP antibiotic selection marker cassette is constructed by assembly PCR of three fragments. [0167] 6) Padh promoter is PCR amplified with Padh-loxP-ManHIF and Padh-Kanmx4R primers using Yep352 vector as a template. [0168] 7) Kanmx4 selection gene is PCR amplified using Padh-kanmx4F and Tcyc-kanmx4R primers using PYM-N14 plasmid as a template. [0169] 8) Tcyc terminator was PCR amplified with Padh-loxP-BamHIF and Padh-Kanmx4R primers using Pesc vector as a template. [0170] 9) 3 PCR fragments containing homologous regions with each other were gel purified and 250 ng of each fragment were mixed together to serve as template for the secondary assembly PCR reaction to yield pAdh-Kanmx4-Tcyc-LoxP cassette. [0171] 10) Cassette is digested and inserted into pGEM-ERG1-split vector, and used as template to run PCR with ERG1F and ERG1R to get PCR fragment used to generate cell lines. [0172] 11) Pgpd-tHMGR-Tadh fragment was amplified from Pesc-Gpd-leu-tHMGR vector with primers GPD-BamHIP and Tadh-XholIR. [0173] 12) Insert fragment into pGEM-ERG1-split vector containing kanmx4 cassette. [0174] 13) Use construct as template to amplify with ERG1F and EGR1R primers to gain the fragment for building slightly different cell lines, which include integration of one copy of tHMGR into the ERG1 gene.

TABLE-US-00001 [0174] Primer name Primer Sequence ERG9pS1 GTACATTTCATAGCCCATCTTCAACAACAATACCGACTTACCCGTACG (SEQ ID NO 1) CTGCAGGTCGAC ERG9 250dwS2 CAGATTGACGGAGAGAGGGCCACATTGTTTGTCGGAATAAATCGAT (SEQ ID NO 2) GAATTCGAGCTCG Hph F ATGGGTAAAAAGCCTGAACTCA (SEQ ID NO 3) Hph R TTATTCCTTTGCCCTCGGACGAG (SEQ ID NO 4) ERG9 450dwR AGATGCTAGTCAATGGCAGAAG (SEQ ID NO 5) WEG9p300upF TGCTTACACAGAGTGAACCTGC (SEQ ID NO 6) ERG9 300R CTCGTGGAAGTGACGCAAC (SEQ ID NO 7) pGPD-BAMHI F cgGGATCCagtttatcattatcaatactcgcc (SEQ ID NO 8) pGPD-NotIR gggGCGGCCGCgagctcagtttatcattatc (SEQ ID NO 9) tHMGR-NotIF GGGGCGGCCGCAAAACAATGTTGTCACGACTTTTCCGTATGC (SEQ ID NO 10) tHMGR-SpeIR GACTAGTTCAAGCTGACTTCTTGGTGCACGTTCCTTG (SEQ ID NO 11) ERG1F ATGTCTGCTGTTAACGTTGCACCTG (SEQ ID NO 12) ERG1R TTAACCAATCAACTCACCAAAC (SEQ ID NO 13) ERG1-split F CGGGATCCCTCGAG TTGTTCGCTGCTGACAGCGATAAC (SEQ ID NO 14) ERG1-splitR CGGGATCCGCTAGCGGTACCACATGGGTCCTTTATATTGACACG (SEQ ID NO 15) ERG1 90up F ATCAGAACAATTGTCCAGTATTG (SEQ ID NO 16) ERG1100dwR AATGTACTATACAAGCCTTCC (SEQ ID NO 17) bSQS-NotIF GGGGCGGCCGCAAAACAATGGGGATGCTTCGCTGGGGAGT (SEQ ID NO 18) bSQS-SpeIR GACTAGTTTAGCTCCTCAATTCGTCAAAGGT (SEQ ID NO 19) Cre-NotIF GGGGCGGCCGCAAAACAATGGACATGTTCAGGGATCGCCAGG (SEQ ID NO 20) Cre-SpeIR GACTAGTCTAATCGCCATCTTCCAGCAGGCG (SEQ ID NO 21) Padb-Loxp- CGGGATCCATAACTTCGTATAGCATACATTATACGAAGTTATGTGGAA BamHIF TATTTCGGATAT (SEQ ID NO 22) Padh-Kanmx4F GCATACAATCAACTAAGCTAAGCTAAAACAATGGGTAAGGAAAAGACT (SEQ ID NO 23) CACGTTTC Padh-Hanmx4R GAAACGTGAGTCTTTTCCTTACCCATTGTTTTAGCTTAGCTTAGTTGA (SEQ ID NO 24) TTGTATGC Kanmx4-TcycF CATTTGATGCTCGATGAGTTTTTCTAAATCCGCTCTAACCGAAAAGGA (SEQ ID NO 25) AGGAG Kanmx4-TcycR CTCCTTCCTTTTCGGTTAGAGCGGATTTAGAAAAACTCATCGAGCATC (SEQ ID NO 26) AAATG Tcyc-LoxP-NheIR GGGGCTAGCATAACTTCGTATAATGTATGCTATACGAAGTTATCTTCG (SEQ ID NO 27) AGCGTCCCAAAA Gpd-GamHIF CGGGATCCAGTTTATCATTATCAATACTCG (SEQ ID NO 28) Tadh-XohI GGGCTCGAG GAGCGACCTCATGCTATACCTG (SEQ ID NO 29) Kanmx4R TTAGAAAAACTCATCGAGCATC (SEQ ID NO 30)

Expression of Enzymes for Cannabinoid Production

OLS 5' FWD

SEQ ID NO 31

Length: 55

Type: DNA

Organism: Artificial Sequence

Notes: Primer

TABLE-US-00002 [0175] Gcatagcaatctaatctaagtttaaa atgaatcatttgagagcagaa gggcctgc

CB 5' FWD

SEQ ID NO 32

Length: 56

Type: DNA

Organism: Artificial Sequence

Notes: Primer

TABLE-US-00003 [0176] caccagaacttagtttcgacggataaa atggaaaccggtttgtcctcgg tttgcac

All REV

SEQ ID NO 33

Length: 58

Type: DNA

Organism: Artificial Sequence

Notes: Primer

TABLE-US-00004 [0177] cataactaattacatgatttaaccTAAACATCAGATTCAATAGAGCCGCC TCCACTG

Backbone|CBGA synthase|Flexible spacer|CBD synthase|target peptide

SEQ ID NO 34

Length:

Type: DNA

[0178] Organism: artificial sequence Notes: Codon optimized

TABLE-US-00005 1 ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct 61 ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata 121 gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga 181 cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg 241 aaggctttaa tttgcggccc ctcacctgca cgcaaaatag gataattata ctctatttct 301 caacaagtaa ttggttgttt ggccgagcgg tctaaggcgc ctgattcaag aaatatcttg 361 accgcagtta actgtgggaa tactcaggta tcgtaagatg caagagttcg aatctcttag 421 caaccattat ttttttcctc aacataacga gaacacacag gggcgctatc gcacagaatc 481 aaattcgatg actggaaatt ttttgttaat ttcagaggtc gcctgacgca tatacctttt 541 tcaactgaaa aattgggaga aaaaggaaag gtgagagcgc cggaaccggc ttttcatata 601 gaatagagaa gcgttcatga ctaaatgctt gcatcacaat acttgaagtt gacaatatta 661 tttaaggacc tattgttttt tccaataggt ggttagcaat cgtcttactt tctaactttt 721 cttacctttt acatttcagc aatatatata tatatatttc aaggatatac cattctaatg 781 tctgccccta agaagatcgt cgttttgcca ggtgaccacg ttggtcaaga aatcacagcc 841 gaagccatta aggttcttaa agctatttct gatgttcgtt ccaatgtcaa gttcgatttc 901 gaaaatcatt taattggtgg tgctgctatc gatgctacag gtgttccact tccagatgag 961 gcgctggaag cctccaagaa ggctgatgcc gttttgttag gtgctgtggg tggtcctaaa 1021 tggggtaccg gtagtgttag acctgaacaa ggtttactaa aaatccgtaa agaacttcaa 1081 ttgtacgcca acttaagacc atgtaacttt gcatccgact ctcttttaga cttatctcca 1141 atcaagccac aatttgctaa aggtactgac ttcgttgttg tcagagaatt agtgggaggt 1201 atttactttg gtaagagaaa ggaagatgat ggtgatggtg tcgcttggga tagtgaacaa 1261 tacaccgttc cagaagtgca aagaatcaca agaatggccg ctttcatggc cctacaacat 1321 gagccaccat tgcctatttg gtccttggat aaagctaatg ttttggcctc ttcaagatta 1381 tggagaaaaa ctgtggagga aaccatcaag aacgaattcc ctacattgaa ggttcaacat 1441 caattgattg attctgccgc catgatccta gttaagaacc caacccacct aaatggtatt 1501 ataatcacca gcaacatgtt tggtgatatc atctccgatg aagcctccgt tatcccaggt 1561 tccttgggtt tgttgccatc tgcgtccttg gcctctttgc cagacaagaa caccgcattt 1621 ggtttgtacg aaccatgcca cggttctgct ccagatttgc caaagaataa ggtcaaccct 1681 atcgccacta tcttgtctgc tgcaatgatg ttgaaattgt cattgaactt gcctgaagaa 1741 ggtaaggcca ttgaagatgc agttaaaaag gttttggatg caggcatcag aactggtgat 1801 ttaggtggtt ccaacagtac caccgaagtc ggtgatgctg tcgccgaaga agttaagaaa 1861 atccttgctt aaaaagattc tcttttttta tgatatttgt acataaactt tataaatgaa 1921 attcataata gaaacgacac gaaattacaa aatggaatat gttcataggg taacgctatg 1981 atccaatatc aaaggaaatg atagcattga aggatgagac taatccaatt gaggagtggc 2041 agcatataga acagctaaag ggtagtgctg aaggaagcat acgatacccc gcatggaatg 2101 ggataatatc acaggaggta ctagactacc tttcatccta cataaataga cgcatataag 2161 tacgcattta agcataaaca cgcactatgc cgttcttctc atgtatatat atatacaggc 2221 aacacgcaga tataggtgcg acgtgaacag tgagctgtat gtgcgcagct cgcgttgcat 2281 tttcggaagc gctcgtttCc ggaaacgctt tgaagttcct attccgaagt tcctattctc 2341 tagaaagtat aggaacttca gagcgctttt gaaaaccaaa agcgctctga agtcgcactt 2401 tcaaaaaacc aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt 2461 ccacaaacat tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata 2521 acctacccat ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt 2581 atgtttatct ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag 2641 tgaatcgaaa acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat 2701 agaagaaacc gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt 2761 tcacaaagta tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga 2821 aaaaatgcac ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt 2881 tttatggaag agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt 2941 gcaaaaagtt atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa 3001 gatgctttgt tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta 3061 tagattcttt gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag 3121 ctcagattct ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg 3181 aagcacagat tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa 3241 tgcagctcag attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa 3301 aatgaagcac agatgcttcg ttcaggtggc acttttcggg gaaatgtgcg cggaacccct 3361 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 3421 tattggtcag aattggttaa ttggttgtaa cactgacccc tatttgttta tttttctaaa 3481 tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt 3541 gaaaaaggaa gaatatgagc catattcaac gggaaacgtc gaggccgcga ttaaattcca 3601 acatggatgc tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg 3661 cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca 3721 aaggtagcgt tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat 3781 ttatgccact tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca 3841 ccactgcgat ccccggaaaa acagcgttcc aggtattaga agaatatcct gattcaggtg 3901 aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt gcactcgatt cctgtttgta 3961 attgtccttt taacagcgat cgcgtatttc gcctcgctca ggcgcaatca cgaatgaata 4021 acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag 4081 tctggaaaga aatgcataaa cttttgccat tctcaccgga ttcagtcgtc actcatggtg 4141 atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg 4201 gacgagtcgg aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg 4261 agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata 4321 tgaataaatt gcaatttcat ttgatgctcg atgagttttt ctaactcatg accaaaatcc 4381 cttaacgtga gttacgcgcg cgtcgttcca ctgagcgtca gaccccgtag aaaagatcaa 4441 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 4501 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 4561 aactggcttc agcagagcgc agataccaaa tactgttctt ctagtgtagc cgtagttagc 4621 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 4681 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 4741 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 4801 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 4861 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 4921 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 4981 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 5041 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 5101 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 5161 taccgctcgg ggtcgtgcag gtagtttatc attatcaata ctcgccattt caaagaatac 5221 gtaaataatt aatagtagtg attttcctaa ctttatttag tcaaaaaatt agccttttaa 5281 ttctgctgta acccgtacat gcccaaaata gggggcgggt tacacagaat atataacatc 5341 gtaggtgtct gggtgaacag tttattcctg gcatccacta aatataatgg agcccgctCt 5401 ttaagctggc atccagaaaa aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa 5461 ccatcagttc ataggtccat tctcttagcg caactacaga gaacaggggc acaaacaggc 5521 aaaaaacggg cacaacctca atggagtgat gcaaccagcc tggagtaaat gatgacacaa 5581 ggcaattgac ccacgcatgt atctatctca ttttcttaca ccttctatta ccttctgctc 5641 tctctgattt ggaaaaagct gaaaaaaaag gttgaaacca gttccctgaa attattcccc 5701 tacttgacta ataagtatat aaagacggta ggtattgatt gtaattctgt aaatctattt 5761 cttaaacttc ttaaattcta cttttatagt tagtcttttt tttagtttta aaacaccaga 5821 acttagtttc gacggataaa atggaaaccg gtttgtcctc ggtttgcact ttctccttcc 5881 aaacaaacta tcatacactc ctgaacccgc acaataacaa tcccaaaact tccctgctgt 5941 gttataggca cccaaagaca ccaatcaaat actcctacaa taactttcca tctaagcatt 6001 gtagcacaaa aagtttccat ttgcaaaata agtgttccga atctctgtcc atcgccaaaa 6061 attccattag ggctgccact actaatcaaa ctgaaccacc agagtctgat aatcattctg 6121 tcgccacaaa gattctgaat tttgggaagg cttgttggaa gttacaaaga ccatatacaa 6181 ttattgcctt tacctcttgt gcctgtggtt tatttggtaa ggaactgttg cataatacaa 6241 atttaatatc ttggtcattg atggaaacgt tcaaagcatt ttttttctta gtcgctatcc 6301 tttgtattgc ttctttcacc accactatca accagattta cgacttacat attgacagaa 6361 ttaacaagcc agatttgcca ctggcttcgg gcgagatttc cgtcaatact gcctggatca 6421 tggaaacttc tattattgtt gccttgtttg gattgataat caccataaaa atggaaacta 6481 agggtggtcc attgtatatt ttcggttact gttttggtat cttcgggggc atcgtctact 6541 ctgttcctcc attcagatgg aaacaaaatc cttccacagc attccttttg aacttcctgg 6601 cgcacattat aaccaacttt actttttatt atgcctccag agccgccctg gggctgccct 6661 ttgaattacg cccctccttt acatttttac tggccttcat ggagaccaag tccatggaga 6721 ctggttctgc tctcgcgttg atcaaagatg cttccgatgt ggaaggtgac accaaatttg 6781 gtatatccac tttggccagc aagtatggtt ccaggaattt gaccctattt tgttctggta 6841 tcgtgctgct gtcttatgtt gcagccatct tggctggcat catttggcca caggctttca 6901 attcaaatgt tatggagacg ctgctctcgc atgctatttt ggcattttgg ttgattctac 6961 agacaagaga ttttgcttta accaattatg acccagaagc tggtagaaga ttttacgaat 7021 ttatggaaac atggaaatta tactatgctg aatatttagt gtacgttttc attgggggcg 7081 gctccagcgc cggcggcggc tcttctgcgg gcggttggtc tcatccacaa tttgagaaag 7141 gtgggtcgtc tggcggcggc agcgggggcg ggtccggcgg ggggagcggc ggtatgaaat 7201 gttcgacctt ctctttttgg tttgtctgta aaataatttt ttttttcttc agctttaaca 7261 ttcaaaccag cattgcaaat ccaagagaaa atttcttgaa atgcttttca caatatatcc 7321 ccaataatgc tactaacttg aagctagttt atactcaaaa caaccctttg tacatgtccg 7381 tgctcaactc caccattcac aacctaagat tcacttcaga cactacccca aaaccattag 7441 ttattgtgac accttctcac gtttcacata tccaaggtac tattttatgc tccaagaagg

7501 tcggcctgca aattagaact agatctggag gtcatgattc agaaggaatg tcttacatct 7561 ctcaagttcc atttgtgatt gtcgatttaa gaaatatgag gagcattaag atcgatgttc 7621 actcccaaac ggcatgggtt gaagccggtg ccaccttggg cgaagtttac tactgggtca 7631 acgagaagaa tgaaaactta tcactagccg caggttattg tccaactgtt tgtgctggtg 7741 gccatttcgg aggcggcggc tacggtcctc taatgagaaa ctacggctta gctgctgaca 7801 atatcatcga cgctcacttg gttaacgttc atggtaaagt tttagataga aaatctatgg 7861 gtgaggatct tttctgggct ttgagaggtg gcggcgcaga atcatttggc attatcgttg 7921 cttggaagat cagattggtg gctgtcccca agtctacaat gttttctgtg aagaaaatta 7981 tggaaatcca tgaattggtc aaactggtga ataaatggca aaacatagct tacaagtacg 8041 ataaagactt gctgttaatg acacatttta ttaccaggaa catcactgat aaccaaggca 8101 agaacaagac tgcaattcat acttattttt cctccgtttt tttgggtggt gtcgactccc 8161 tcgtggatct gatgaataaa tcattccctg aactaggtat taaaaaaacc gattgtagac 8221 aattgagttg gattgatacc atcatattct acagtggtgt tgttaattat gatactgaca 8281 acttcaacaa agaaatactg ctggaccgtt ccgccggcca gaatggtgct tttaaaatca 8341 agttggatta tgtgaaaaag cctattccag aatccgtatt tgttcaaata ttggaaaagc 8401 tgtatgaaga agacattggt gcaggcatgt acgctcttta tccttatggc ggcataatgg 8461 atgaaatttc tgaaagtgcc attcctttcc cacatagggc cgggatcctg tacgagttat 8521 ggtacatttg ttcatgggaa aagcaagaag ataatgaaaa acatttaaat tggataagaa 8581 atatttataa ttttatgact ccatacgtct ccaaaaaccc acgcctggca tatttgaatt 8641 acagagacct ggatattggc atcaatgatc ctaaaaaccc aaataattac actcaggcaa 8701 gaatatgggg tgaaaaatat ttcggcaaaa attttgatag gctggtcaag gttaaaacac 8761 tggttgatcc aaacaatttc tttagaaacg aacaatctat cccacctctg cctagacata 8821 gacacggcgg tggaagcagt ggaggcggct ctattgaatc tgatgtttaa tga

[0179] Backbone|OLS|Flexible spacer|OAC|target peptide

SEQ ID NO 35

Length:

Type: DNA

[0180] Organism: artificial sequence Notes: Codon optimized

TABLE-US-00006 1 ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct 61 ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata 121 gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga 181 cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg 241 aaggctttaa tttgcggccc ctcacctgca cgcaaaaagc ttttcaattc aattcatcat 301 ttttttttta ttcttttttt tgatttcggt ttctttgaaa tttttttgat tcggtaatct 361 ccgaacagaa ggaagaacga aggaaggagc acagacttag attggtatat atacgcatat 421 gtagtgttga agaaacatga aattgcccag tattcttaac ccaactgcac agaacaaaaa 481 ccagcaggaa acgaagataa atcatgtcga aagctacata taaggaacgt gctgctactc 541 atcctagtcc tgttgctgcc aagctattta atatcatgca cgaaaagcaa acaaacttgt 601 gtgcttcatt ggatgttcgt accaccaagg aattactgga gttagttgaa gcattaggtc 661 ccaaaatttg tttactaaaa acacatgtgg atatcttgac tgatttttcc atggagggca 721 cagttaagcc gctaaaggca ttatccgcca agtacaattt tttactcttc gaagatagaa 781 aatttgctga cattggtaat acagtcaaat tgcagtactc tgcgggtgta tacagaatag 841 cagaatgggc agacattacg aatgcacacg gtgtggtggg cccaggtatt gttagcggtt 901 tgaagcaggc ggcagaagaa gtaacaaagg aacctagagg ccttttgatg ttagcagaat 961 tgtcatgcaa gggctcccta tctactggag aatatactaa gggtactgtt gacattgcga 1021 aaagcgacaa agattttgtt atcggcttta ttgctcaaag agacatgggt ggaagagatg 1081 aaggttacga ttggttgatt atgacacccg gtgtgggttt agatgacaag ggagatgcat 1141 tgggtcaaca gtatagaacc gtggatgatg ttgtctctac aggatctgac attattattg 1201 ttggaagagg actatttgca aagggaaggg atgctaaggt agagggtgaa cgttacagaa 1261 aagcaggctg ggaagcatat ttgagaagat gcggccagca aaactaaaaa actgtattat 1321 aagtaaatgc atgtatacta aactcacaaa ttagagcttc aatttaatta tatcagttat 1381 tacccacgct atgatccaat atcaaaggaa atgatagcat tgaaggatga gactaatcca 1441 attgaggagt ggcagcatat agaacagcta aagggtagtg ctgaaggaag catacgatac 1501 cccgcatgga atgggataat atcacaggag gtactagact acctttcatc ctacataaat 1561 agacgcatat aagtacgcat ttaagcataa acacgcacta tgccgttctt ctcatgtata 1621 tatatataca ggcaacacgc agatataggt gcgacgtgaa cagtgagctg tatgtgcgca 1681 gctcgcgttg cattttcgga agcgctcgtt ttcggaaacg ctttgaagtt cctattccga 1741 agttcctatt ctctagaaag tataggaact tcagagcgct tttgaaaacc aaaagcgctc 1801 tgaagtcgca ctttcaaaaa accaaaaacg caccggactg taacgagcta ctaaaatatt 1861 gcgaataccg cttccacaaa cattgctcaa aagtatctct ttgctatata tctctgtgct 1921 atatccctat ataacctacc catccacctt tcgctccttg aacttgcatc taaactcgac 1981 ctctacattt tttatgttta tctctagtat tactctttag acaaaaaaat tgtagtaaga 2041 actattcata gagtgaatcg aaaacaatac gaaaatgtaa acatttccta tacgtagtat 2101 atagagacaa aatagaagaa accgttcata attttctgac caatgaagaa tcatcaacgc 2161 tatcactttc tgttcacaaa gtatgcgcaa tccacatcgg tatagaatat aatcggggat 2221 gcctttatct tgaaaaaatg cacccgcagc ttcgctagta atcagtaaac gcgggaagtg 2281 gagtcaggct ttttttatgg aagagaaaat agacaccaaa gtagccttct tctaacctta 2341 acggacctac agtgcaaaaa gttatcaaga gactgcatta tagagcgcac aaaggagaaa 2401 aaaagtaatc taagatgctt tgttagaaaa atagogctct cgggatgcat ttttgtagaa 2461 caaaaaagaa gtatagattc tttgttggta aaatagcgct ctcgcgttgc atttctgttc 2521 tgtaaaaatg cagctcagat tctttgtttg aaaaattagc gctctcgcgt tgcatttttg 2581 ttttacaaaa atgaagcaca gattcttcgt tggtaaaata gcgctttcgc gttgcatttc 2641 tgttctgtaa aaatgcagct cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat 2701 ttttgttcta caaaatgaag cacagatgct tcgttcaggt ggcacttttc ggggaaatgt 2761 gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag 2621 acaataaccc tgatattggt cagaattggt taattggttg taacactgac ccctatttgt 2881 ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 2941 cttcaataat attgaaaaag gaagaatatg agtattcaac atttccgtgt cgcccttatt 3001 cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta 3061 aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc 3121 ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa 3131 gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc 3241 cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt 3301 acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact 3361 gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac 3421 aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata 3481 ccaaacgacg agcgtgacac cacgatgcct gtagcgatgg caacaacgtt gcgcaaacta 3541 ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg 3601 gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat 3661 aaatccggag ccggtgagcg tggttctcgc ggtatcatcg cagcgctggg gccagatggt 3721 aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga 3781 aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact catgaccaaa 3841 atcccttaac gtgagttacg cgcgcgtcgt tccactgagc gtcagacccc gtagaaaaga 3901 tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 3961 aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 4021 aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg tagccgtagt 4081 tagcccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 4141 taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 4201 agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 4261 tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 4321 cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 4381 agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 4441 gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 4501 aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca 4561 tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag 4621 ctgataccgc tcggggtcgt gcaggtatag cttcaaaatg tttctactcc ttttttactc 4681 ttccagattt tctcggactc cgcgcatcgc cgtaccactt caaaacaccc aagcacagca 4741 tactaaattt cccctctttc ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg 4801 gaaaagaaaa aagtgaccgc ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt 4861 ttatcacgtt tctttttctt gaaaattttt ttttttgatt tttttctctt tcgatgacct 4921 cccattgata tttaagttaa taaacggact tcaatctctc aagtttcagt ttcatttttc 4981 ttgttctatt acaacttttt ttacttcttg ctcattagaa agaaagcata gcaatctaat 5041 ctaagtttaa aatgaatcat ttgagagcag aagggcctgc ttccgtgctg gctattggta 5101 ccgccaatcc agaaaatatc ctgctgcagg acgaattccc agattactat tttagggtca 5161 ccaaatctga acatatgaca caattgaaag agaaattcag aaagatttgt gacaagtcca 5221 tgattaggaa aagaaattgt tttttgaatg aagaacactt gaagcaaaat cctcgcctgg 5281 tggagcatga aatgcaaact ttggatgcta gacaagacat gttggtggtg gaagttccaa 5341 agctggggaa ggatgcctgt gccaaggcca ttaaagaatg gggccaacca aaatccaaaa 5401 ttacccacct gattttcacc tccgcctcca ccactgatat gccaggtgca gactatcatt 5461 gtgctaaatt gttgggtttg tccccctccg tgaagagagt tatgatgtat caattaggtt 5521 gttatggcgg cggcaccgtt ctgagaattg ccaaagacat tgctgaaaac aataaaggtg 5581 cgcgcgtttt ggctgtttgt tgtgatatta tggcatgttt atttagaggt ccaagtgaaa 5641 gtgacttgga attgctagtg ggccaggcca tatttggtga tggtgccgct gctgtgatcg 5701 ttggtgctga gcctgatgaa tctgtcggtg aaagaccaat ttttgaactg gtttccactg 5761 gtcaaaccat tttgccaaat tcagaaggta ctattggcgg ccatatcaga gaagctggtt 5821 taatctttga tttgcacaag gatgtcccaa tgttaatttc caataatatt gaaaaatgtt 5881 tgatcgaagc atttaccccc atcggtattt ctgattggaa ttccatcttc tggattacac 5941 atcctggcgg taaagctatc ttagataaag ttgaggagaa gttgcattta aagtctgaca 6001 aatttgttga ttcaagacat gtcctgtctg agcacggtaa tatgtcttcc tcgaccgtct 6061 tgtttgtcat ggatgagttg aggaagaggt ccctggaaga aggcaagagc accaccggtg 6121 acggttttga gtggggggtc ctctttggat ttgggccagg cctgaccgta gaaagggttg 6181 ttgtccgctc ggtgccaatc aaatatggtg gggggtccag cgccggtggc gggagctccg 6241 cgggcggttg gtctcaccca caatttgaaa agggtggcag cagcggcggc ggctctggcg 6301 gaggctccgg cgggggctcg gggggtatgg ctgtcaagca tctgatcgtg ctgaagttca 6361 aagatgaaat tactgaagcc caaaaggagg aatttttcaa gacatatgtt aatttggtta 6421 acatcattcc agcaatgaaa gatgtttatt ggggtaagga cgttactcaa aaaaataagg 6481 aagagggtta cactcatatt gttgaagtca ctttcgaatc cgtcgaaaca attcaagatt 6541 atattattca tccagctcat gttgggtttg gcgatgtgta cagatcattt tgggaaaaat 6601 tattgatttt tgactacaca ccaagaaaag gcggtggaag cagtggaggc ggctctattg 6661 aatctgatgt ttaatag

Overexpression of ERG8, HFA1, ERG 10, ERG13, tHMGR, HMGR, ERG12, ERG8, IDI Genes (for Higher Levels of Intermediates) Same process as expression of Synthase expression, but with 3 copies expressed in yeast cells. Backbone|GGPS1|2a protease|HMG-CoA reductase|flexible spacer|IDI1

SEQ ID NO 36

Length:

Type: DNA

[0181] Organsm: artificial sequence Notes: Codon optimized

TABLE-US-00007 1 atggagaaga ctcaagaaac agtccaaaga attcttctag aaccctataa atacttactt 61 cagttaccag gtaaacaagt gagaaccaaa ctttcacagg catttaatca ttggctgaaa 121 gttccagagg acaagctaca gattattatt gaagtgacag aaatgttgca taatgccagt 181 ttactcatcg atgatattga agacaactca aaactccgac gtggctttcc agtggcccac 241 agcatctatg gaatcccatc tgtcatcaat tctgccaatt acgtgtattt ccttggcttg 301 gagaaagtct taacccttga tcacccagat gcagtgaagc tttttacccg ccagcttttg 361 gaactccatc agggacaagg cctagatatt tactggaggg ataattacac ttgtcccact 421 gaagaagaat ataaagctat ggtgctgcag aaaacaggtg gactgtttgg attagcagta 481 ggtctcatgc agttgttctc tgattacaaa gaagatttaa aaccgctact taatacactt 541 gggctctttt tccaaattag ggatgattat gctaatctac actccaaaga atatagtgaa 601 aacaaaagtt tttgtgaaga tctgacagag ggaaagttct catttcctac tattcatgct 661 atttggtcaa ggcctgaaag cacccaggtg cagaatatct tgcgccagag aacagaaaac 721 atagatataa aaaaatactg tgtacattat cttgaggatg taggttcttt tgaatacact 761 cgtaataccc ttaaagagct tgaagctaaa gcctataaac agattgatgc acgtggtggg 841 aaccctgagc tagtagcctt agtaaaacac ttaagtaaga tgttcaaaga agaaaatgaa 901 ggcggttctg gcagcggaga gggcagagga agtcttctaa catgcggtga cgtggaggag 961 aatcccggcc ctaggtctgg cagcggagag ggcagaggaa gtcttctaac atgcggtgac 1021 gtggaggaga atcccggccc taggacacaa aagaaagtcc cagacaattg ttgtagacgt 1081 gaacctatgc tggtcagaaa taaccagaaa tgtgattcag tagaggaaga gacagggata 1141 aaccgagaaa gaaaagttga ggttataaaa cccttagtgg ctgaaacaga taccccaaac 1201 agagctacat ttgtggttgg taactcctcc ttactcgata cttcatcagt actggtgaca 1261 caggaacctg aaattgaact tcccagggaa cctcggccta atgaagaatg tctacagata 1321 cttgggaatg cagagaaagg tgcaaaattc cttagtgatg ctgagatcat ccagttagtc 1351 aatgctaagc atatcccagc ctacaagttg gaaactctga tggaaactca tgagcgtggt 1441 gtatctattc gccgacagtt actttccaag aagctttcag aaccttcttc tctccagtac 1501 ctaccttaca gggattataa ttactccttg gtgatgggag cttgttgtga gaatgttatt 1561 ggatatatgc ccatccctgt tggagtggca ggaccccttt gcttagatga aaaagaattt 1621 caggttccaa tggcaacaac agaaggttgt cttgtggcca gcaccaatag aggctgcaga 1681 gcaataggtc ttggtggagg tgccagcagc cgagtccttg cagaCgggat gactcgtggc 1741 ccagttgtgc gtcttccacg tgcttgtgac tctgcagaag tgaaagcctg gctcgaaaca 1801 tctgaagggt tcgcagtgat aaaggaggca tttgacagca ctagcagatt tgcacgtcta 1861 cagaaacttc atacaagtat agctggacgc aacctttata tccgtttcca gtccaggtca 1921 ggggatgcca tggggatgaa catgatttca aagggtacag agaaagcact ttcaaaactt 1981 cacgagtatt tccctgaaat gcagattcta gccgttagtg gtaactattg tactgacaag 2041 aaacctgctg ctataaattg gatagaggga agaggaaaat ctgttgtttg tgaagctgtc 2101 attccagcca aggttgtcag agaagtatta aagactacca cagaggctat gattgaggtc 2161 aacattaaca agaatttagt gggctctgcc atggctggga gcataggagg ctacaacgcc 2221 catgcagcaa acattgtcac cgccatctac attgcctgtg gacaggatgc agcacagaat 2281 gttggtagtt caaactgtat tactttaatg gaagcaagtg gtcccacaaa tgaagattta 2341 tatatcagct gcaccatgcc atctatagag ataggaacgg tgggtggtgg gaccaaccta 2401 ctacctcagc aagcctgttt gcagatgcta ggtgttcaag gagcatgcaa agataatcct 2461 ggggaaaatg cccggcagct tgcccgaatt gtgtgtggga ccgtaatggc tggggaattg 2521 tcacttatgg cagcattggc agcaggacat cttgtcaaaa gtcacatgat tcacaacagg 2581 tcgaagatca atttacaaga cctccaagga gcttgcacca agaagacagc cggctcagga 2641 ggttcttcag gactggaagt gctgtttcag ggcccgggtg gatctggcat gatgcctgaa 2701 ataaacacta accacctcga caagcaacag gttcaactcc tggcagagat gtgtatcctt 2761 attgatgaaa atgacaataa aattggagct gagaccaaga agaattgtca cctgaacgag 2821 aacattgaga aaggattatt gcatcgagct tttagtgtct tcttattcaa caccgaaaat 2881 aagcttctgc tacagcaaag atcagatgct aagattacct ttccaggttg ttttacgaat 2941 acgtgttgta gtcatccatt aagcaatcca gccgagcttg aggaaagtga cgcccttgga 3001 gtgaggcgag cagcacagag acggctgaaa gctgagctag gaattccctt ggaagaggtt 3061 cctccagaag aaattaatta tttaacacga attcactaca aagctcagtc tgatggtatc 3121 tggggtgaac atgaaattga ttacattttg ttggtgagga agaatgtaac tttgaatcca 3181 gatcccaatg agattaaaag ctattgttat gtgtcaaagg aagaactaaa agaacttctg 3241 aaaaaagcag ccagtggtga aattaagata acgccatggt ttaaaattat tgcagcgact 3301 tttctcttta aatggtggga taacttaaat catttgaatc agtttgttga ccatgagaaa 3361 atatacagaa tg

ERG2, ERG3, and ERG6 mutations/deletions for increased membrane permeability

[0182] Same process as ERG9 knockout, but targeting ERG2, ERG3, and ERG6 genes.

ERG20p Modification

[0183] We experimented with a few types of ERG20 genes, (avian, salmon entrica, and human). Currently we are still trying to see which is the best by engineering the ERG20p gene into a FPP synthase, thereby creating a new enzyme that can create GPP instead at high rates.

Gal80p Deletion/Mutation for not Needing Expensive Galactose to Induce Promoter

[0184] Induce mutation in Gal80 gene by site directed mutagenesis.

Using ADH2p (Glucose Repressible Promoter) Induces Strong Transcription with No Glucose, Better than GAL Promoter

[0185] Same process as Gal80p deletion.

Overexpression of ADH2 and ALD6 (Ethanol to Acetate), as Well as Overexpression of an Acetyl-CoA C-Acetyltransferase

[0186] Same process as IDI and HMGR overexpression, but with genes for ADH2 and ALD6.

Tables

[0187] Below is a table of various cannabinoids, along with their structure and variants and main pharmacological characteristics as well as a table listing potential starting materials.

TABLE-US-00008 TABLE 1 Compounds Pharmacological Characteristics Cannabinoids (FIG. 1 and 2) Cannabigerolic acid (CBGA) Antibiotic (1) Cannabigerolic acid monomethylether (CBGAM) Cannabigerol (CBG) Antibiotic, antifungal, anti-inflammatory, analgesic (1) Partial agonist at CB1/CB2 receptors (2) Cannabigerovarinic acid (CBGVA) Cannabigerovarin (CBGV) Cannabichromenic acid (CBCA) Cannabichromene (CBC) Anti-inflammatory, antibiotic, antifungal, analgesic (1) Cannabichromevarinic acid (CBCVA) Cannabichromevarin (CBCV) Cannabidiolic acid (CBDA) Antibiotic Cannabidiol (CBD) Anxiolytic, antipsychotic, analgesic, anti-inflammatory, antioxidant, antispasmodic (1) Ant schizophrenic, antiepileptic, sleep-promoting, anti-oxidizing, anti-inflammatory, immunomodulation properties (2) Cannabidiol monomethylether (CBDM) Cannabidiol-C4 (CBD-C4) Cannabidivarinic acid (CBDVA) Cannabidivarin (CBDV) Cannabidiorcol (CBD-C1) Tetrahydrocannabinolic acid A (THCA-A) Tetrahydrocannabinolic acid B (THCA-B) Delta-9-tetrahydrocannabinol Euphoriant, analgesic, anti- (THC) inflammatory, antioxidant, antiemetic (1) Delta-9-tetrahydrocannabinolic acid-C4 (THCA-C4) Delta-9-tetrahydrocannabinol-C4 (THC-C4) Delta-8-tetrahydrocannabivarin Exhibit in vitro pharma (D8-THCV) properties similar to THCV, and both can antagonize THC; behave as agonists or antagonists in dose dependent manner (2) Delta-9-tetrahydrocannabivarinic acid (THCVA) Delta-9-tetrahydrocannabivarin Analgesic, euphoriant (1) (THCV) Strong antagonist of anandamide (due to interactions with non- CB1/2 receptors), neuromodulator (in animal and human organs), some affects due to interaction with non CB1/CB2 receptors (2) Delta-9-tetrahydrocannabiorcolic acid (THCA-C1) Delta-9-tetrahydrocannabiorcol (THC-C1) Delta-7-cis-iso- tetrahydrocannabivarin (D7-THCV) Delta-8- tetrahydrocannabinolic acid (D8-THCA) Delta-8-tetrahydrocannabinol Similar to THC (1) (D8-THC) Several 1-O-methyl- and 1-deoxy-delta-8- THC analogs have high CB2 receptor affinity[JWH133, JWH359, trans- (6aR,10aR)-3-(1,1- dimethylhexyl)-1-O- methyl-delta-8-THC]; antiemetic effects similar to THC (2) Cannabicyclolic acid (CBLA) Cannabicyclol (CBL) Cannabicyclovarin (CBLV) Cannabielsoic acid A (CBEA-A) Cannabielsoic acid B (CBEA-B) Cannabielsoin (CBE) Cannabinolic acid (CBNA) Cannabinol (CBN) Sedative, antibiotic, anticonvulsant, anti- inflammatory (1) Cannabinol methylether (CBNM) Cannabinol-C4 (CBN-C4) Cannabivarin (CBV) Cannabinol-C2 (CBN-C2) Cannabinol-C1 (CBN-C1) Cannabinodiol (CBND) Cannabinodivarin (CBVD) Cannabitriol (CBT) 10-Ethoxy-9-hydroxy- delta-6a-tetrahydrocannabinol 8,9-Dihydroxy-delta-6a- tetrahydrocannabinol Cannabitriolvarin (CBTV) Ethoxy-cannabitriolvarin (CBTVE) Dehydrocannabifuran (DCBF) Cannabifuran (CBF) Cannabichromanon (CBCN) Cannabicitran (CBT) 10-oxo-delta-6a- tetrahydrocannabinol (OTHC) Delta-9-cis- tetrahydrocannabinol (Cis-THC) 3,4,5,6-Tetrahydro-7-hydroxy- alpha-alpha-2-trimethyl-9-n- propyl-2,6-methano-2H-1- benzoxocin-5-methanol (OH-iso-HHCV) Cannabiripsol (CBR) Trihydroxy-delta-9- tetrahydrocannabinol (triOH-THC) Terpeses/Terpenoids Beta-Myrcene Analgesic, anti-inflammatory, antibiotic, antimutagenic d-Limonene Immune potentiator, antidepressant, antimutagenic Linalool Sedative, antidepressant, anxiolytic, immune potentiator Trans-Ocimene Beta-Pinene Alpha-Pinene Anti-inflammatory, bronchodilator, stimulant, antibiotic, antineoplastic, AChE inhibitor Beta-Caryophyllene Anti-inflammatory, cytoprotective, antimalarial, CB2 agonist Delta-3-Carene Pulegone AChE inhibitor, sedative, Trans-gamma-Bisabolene antipyretic Trans-alpha-Farnesene Beta-Fenchol Beta-Phellandrene Alpha-Humulene Guajol Alpha-Gualene Alpha-Eudesmol Terpinolene Alpha-Selinene Alpha-Terpineol Sedative, antibiotic, AChE inhibitor, antioxidant, antimalarial Fenchone Camphene Cis-Sabinene hydrate Cis-Ocimene Beta-Eudesmol Beta-Selinene Alpha-trans-Bergamolene Gamma-Eudesmol Borneol Cis-beta-Farnescene Gamma-Curcumene Cis-gamma-Bisabolene Alpha-Thujene Epi-alpha-Bisabolol Ipsdienol Alpha-Yiangene Beta-Elemene Alpha-cis-Bergamontene Gamma-Muurolene Alpha-Cadinene Alpha-Longipinene Caryophyllene oxide Spermidine Alkaloids (FIG. 6) (+)-Cannabisativine Palustridine Palustrine Spermidine Anhydrocannabisativine Phenolic Amides and Lignanamides (FIG. 5) N-trans-Feruloyltyramine N-p-Coumaroyltyramine N-trans-Caffeoyltyramine Grossamide Cannabisin-A Cannabisin-B Cannabisin-C Cannabisin-D Cannabisin-E Cannabisin-F Cannabisin-G Phenylpropanoids and Flavonoids (FIG. 4) Apigenin Luteolin Kaempferol Quercetin Orientin Vitexin Cannflavin A Inhibit prostaglandin E2 in human rheumatoid synovial cells Cannflavin B Inhibit prostaglandin E2 in human rheumatoid synovial cells Stilbenoids (FIG. 3) Cannabispiran Isocannabispiran Cannabistilbene-IIa Cannabistilbene-IIb Cannithrene-1 Cannithrene-2 Acetyl cannabispirol Alpha-cannabisporanol Canniprene Cannabispirone

TABLE-US-00009 TABLE 2 (Starting Materials) Sugar based concentrates (High Hemicellulose Glycerol Fructose Corn Syrup, Molasses) Glucose Xylose Whey Sucrose Methanol Biodiesel Cellulose Lactic Acid Citrate Ethanol Lignin Fructose Succinic Acid Arabinose Biofuels Biomass Saccharose Starch based products Agricultural residue Water hyacinth Aquatic biomass

Sequence CWU 1

1

36160DNAArtificial SequencePrimer 1gtacatttca tagcccatct tcaacaacaa taccgactta cccgtacgct gcaggtcgac 60260DNAArtificial SequencePrimer 2cagattgacg gagagagggc cacattgttt gtcggcaata aatcgatgaa ttcgagctcg 60322DNAArtificial SequencePrimer 3atgggtaaaa agcctgaact ca 22423DNAArtificial SequencePrimer 4ttattccttt gccctcggac gag 23522DNAArtificial SequencePimer 5agatgctagt caatggcaga ag 22622DNAArtificial SequencePimer 6tgcttacaca gagtgaacct gc 22719DNAArtificial SequencePrimer 7ctcgtggaag tgacgcaac 19832DNAArtificial SequencePrimer 8cgggatccag tttatcatta tcaatactcg cc 32931DNAArtificial SequencePrimer 9ggggcggccg cgagctcagt ttatcattat c 311042DNAArtificial SequencePrimer 10ggggcggccg caaaacaatg ttgtcacgac ttttccgtat gc 421137DNAArtificial SequencePrimer 11gactagttca agctgacttc ttggtgcacg ttccttg 371225DNAArtificial SequencePrimer 12atgtctgctg ttaacgttgc acctg 251322DNAArtificial SequencePrimer 13ttaaccaatc aactcaccaa ac 221438DNAArtificial SequencePrimer 14cgggatccct cgagttgttc gctgctgaca gcgataac 381544DNAArtificial SequencePrimer 15cgggatccgc tagcggtacc acatgggtcc tttatattga cacg 441623DNAArtificial SequencePrimer 16atcagaacaa ttgtccagta ttg 231721DNAArtificial SequencePrimer 17aatgtactat acaagccttc c 211840DNAArtificial SequencePrimer 18ggggcggccg caaaacaatg gggatgcttc gctggggagt 401931DNAArtificial SequencePrimer 19gactagttta gctcctcaat tcgtcaaagg t 312042DNAArtificial SequencePrimer 20ggggcggccg caaaacaatg gacatgttca gggatcgcca gg 422131DNAArtificial SequencePrimer 21gactagtcta atcgccatct tccagcaggc g 312260DNAArtificial SequencePrimer 22cgggatccat aacttcgtat agcatacatt atacgaagtt atgtggaata tttcggatat 602356DNAArtificial SequencePrimer 23gcatacaatc aactaagcta agctaaaaca atgggtaagg aaaagactca cgtttc 562456DNAArtificial SequencePrimer 24gaaacgtgag tcttttcctt acccattgtt ttagcttagc ttagttgatt gtatgc 562553DNAArtificial SequencePrimer 25catttgatgc tcgatgagtt tttctaaatc cgctctaacc gaaaaggaag gag 532653DNAArtificial SequencePrimer 26ctccttcctt ttcggttaga gcggatttag aaaaactcat cgagcatcaa atg 532760DNAArtificial SequencePrimer 27ggggctagca taacttcgta taatgtatgc tatacgaagt tatcttcgag cgtcccaaaa 602830DNAArtificial SequencePrimer 28cgggatccag tttatcatta tcaatactcg 302931DNAArtificial SequencePrimer 29gggctcgagg agcgacctca tgctatacct g 313022DNAArtificial SequencePrimer 30ttagaaaaac tcatcgagca tc 223155DNAArtificial SequencePrimer, OLS 5' FWD 31gcatagcaat ctaatctaag tttaaaatga atcatttgag agcagaaggg cctgc 553256DNAArtificial SequencePrimer, CB 5' FWD 32caccagaact tagtttcgac ggataaaatg gaaaccggtt tgtcctcggt ttgcac 563358DNAArtificial SequencePrimer, ALL REV 33cataactaat tacatgattt aaccttaaac atcagattca atagagccgc ctccactg 58348933DNAArtificial SequenceCodon Optimized 34ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct 60ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct 120ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata 180gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga 240cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg 300aaggctttaa tttgcggccc ctcacctgca cgcaaaatag gataattata ctctatttct 360caacaagtaa ttggttgttt ggccgagcgg tctaaggcgc ctgattcaag aaatatcttg 420accgcagtta actgtgggaa tactcaggta tcgtaagatg caagagttcg aatctcttag 480caaccattat ttttttcctc aacataacga gaacacacag gggcgctatc gcacagaatc 540aaattcgatg actggaaatt ttttgttaat ttcagaggtc gcctgacgca tatacctttt 600tcaactgaaa aattgggaga aaaaggaaag gtgagagcgc cggaaccggc ttttcatata 660gaatagagaa gcgttcatga ctaaatgctt gcatcacaat acttgaagtt gacaatatta 720tttaaggacc tattgttttt tccaataggt ggttagcaat cgtcttactt tctaactttt 780cttacctttt acatttcagc aatatatata tatatatttc aaggatatac cattctaatg 840tctgccccta agaagatcgt cgttttgcca ggtgaccacg ttggtcaaga aatcacagcc 900gaagccatta aggttcttaa agctatttct gatgttcgtt ccaatgtcaa gttcgatttc 960gaaaatcatt taattggtgg tgctgctatc gatgctacag gtgttccact tccagatgag 1020gcgctggaag cctccaagaa ggctgatgcc gttttgttag gtgctgtggg tggtcctaaa 1080tggggtaccg gtagtgttag acctgaacaa ggtttactaa aaatccgtaa agaacttcaa 1140ttgtacgcca acttaagacc atgtaacttt gcatccgact ctcttttaga cttatctcca 1200atcaagccac aatttgctaa aggtactgac ttcgttgttg tcagagaatt agtgggaggt 1260atttactttg gtaagagaaa ggaagatgat ggtgatggtg tcgcttggga tagtgaacaa 1320tacaccgttc cagaagtgca aagaatcaca agaatggccg ctttcatggc cctacaacat 1380gagccaccat tgcctatttg gtccttggat aaagctaatg ttttggcctc ttcaagatta 1440tggagaaaaa ctgtggagga aaccatcaag aacgaattcc ctacattgaa ggttcaacat 1500caattgattg attctgccgc catgatccta gttaagaacc caacccacct aaatggtatt 1560ataatcacca gcaacatgtt tggtgatatc atctccgatg aagcctccgt tatcccaggt 1620tccttgggtt tgttgccatc tgcgtccttg gcctctttgc cagacaagaa caccgcattt 1680ggtttgtacg aaccatgcca cggttctgct ccagatttgc caaagaataa ggtcaaccct 1740atcgccacta tcttgtctgc tgcaatgatg ttgaaattgt cattgaactt gcctgaagaa 1800ggtaaggcca ttgaagatgc agttaaaaag gttttggatg caggcatcag aactggtgat 1860ttaggtggtt ccaacagtac caccgaagtc ggtgatgctg tcgccgaaga agttaagaaa 1920atccttgctt aaaaagattc tcttttttta tgatatttgt acataaactt tataaatgaa 1980attcataata gaaacgacac gaaattacaa aatggaatat gttcataggg taacgctatg 2040atccaatatc aaaggaaatg atagcattga aggatgagac taatccaatt gaggagtggc 2100agcatataga acagctaaag ggtagtgctg aaggaagcat acgatacccc gcatggaatg 2160ggataatatc acaggaggta ctagactacc tttcatccta cataaataga cgcatataag 2220tacgcattta agcataaaca cgcactatgc cgttcttctc atgtatatat atatacaggc 2280aacacgcaga tataggtgcg acgtgaacag tgagctgtat gtgcgcagct cgcgttgcat 2340tttcggaagc gctcgttttc ggaaacgctt tgaagttcct attccgaagt tcctattctc 2400tagaaagtat aggaacttca gagcgctttt gaaaaccaaa agcgctctga agtcgcactt 2460tcaaaaaacc aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt 2520ccacaaacat tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata 2580acctacccat ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt 2640atgtttatct ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag 2700tgaatcgaaa acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat 2760agaagaaacc gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt 2820tcacaaagta tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga 2880aaaaatgcac ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt 2940tttatggaag agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt 3000gcaaaaagtt atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa 3060gatgctttgt tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta 3120tagattcttt gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag 3180ctcagattct ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg 3240aagcacagat tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa 3300tgcagctcag attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa 3360aatgaagcac agatgcttcg ttcaggtggc acttttcggg gaaatgtgcg cggaacccct 3420atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 3480tattggtcag aattggttaa ttggttgtaa cactgacccc tatttgttta tttttctaaa 3540tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt 3600gaaaaaggaa gaatatgagc catattcaac gggaaacgtc gaggccgcga ttaaattcca 3660acatggatgc tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg 3720cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca 3780aaggtagcgt tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat 3840ttatgccact tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca 3900ccactgcgat ccccggaaaa acagcgttcc aggtattaga agaatatcct gattcaggtg 3960aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt gcactcgatt cctgtttgta 4020attgtccttt taacagcgat cgcgtatttc gcctcgctca ggcgcaatca cgaatgaata 4080acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag 4140tctggaaaga aatgcataaa cttttgccat tctcaccgga ttcagtcgtc actcatggtg 4200atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg 4260gacgagtcgg aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg 4320agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata 4380tgaataaatt gcaatttcat ttgatgctcg atgagttttt ctaactcatg accaaaatcc 4440cttaacgtga gttacgcgcg cgtcgttcca ctgagcgtca gaccccgtag aaaagatcaa 4500aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 4560accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 4620aactggcttc agcagagcgc agataccaaa tactgttctt ctagtgtagc cgtagttagc 4680ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 4740agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 4800accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 4860gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 4920tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 4980cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 5040cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 5100cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 5160ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 5220taccgctcgg ggtcgtgcag gtagtttatc attatcaata ctcgccattt caaagaatac 5280gtaaataatt aatagtagtg attttcctaa ctttatttag tcaaaaaatt agccttttaa 5340ttctgctgta acccgtacat gcccaaaata gggggcgggt tacacagaat atataacatc 5400gtaggtgtct gggtgaacag tttattcctg gcatccacta aatataatgg agcccgcttt 5460ttaagctggc atccagaaaa aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa 5520ccatcagttc ataggtccat tctcttagcg caactacaga gaacaggggc acaaacaggc 5580aaaaaacggg cacaacctca atggagtgat gcaaccagcc tggagtaaat gatgacacaa 5640ggcaattgac ccacgcatgt atctatctca ttttcttaca ccttctatta ccttctgctc 5700tctctgattt ggaaaaagct gaaaaaaaag gttgaaacca gttccctgaa attattcccc 5760tacttgacta ataagtatat aaagacggta ggtattgatt gtaattctgt aaatctattt 5820cttaaacttc ttaaattcta cttttatagt tagtcttttt tttagtttta aaacaccaga 5880acttagtttc gacggataaa atggaaaccg gtttgtcctc ggtttgcact ttctccttcc 5940aaacaaacta tcatacactc ctgaacccgc acaataacaa tcccaaaact tccctgctgt 6000gttataggca cccaaagaca ccaatcaaat actcctacaa taactttcca tctaagcatt 6060gtagcacaaa aagtttccat ttgcaaaata agtgttccga atctctgtcc atcgccaaaa 6120attccattag ggctgccact actaatcaaa ctgaaccacc agagtctgat aatcattctg 6180tcgccacaaa gattctgaat tttgggaagg cttgttggaa gttacaaaga ccatatacaa 6240ttattgcctt tacctcttgt gcctgtggtt tatttggtaa ggaactgttg cataatacaa 6300atttaatatc ttggtcattg atggaaacgt tcaaagcatt ttttttctta gtcgctatcc 6360tttgtattgc ttctttcacc accactatca accagattta cgacttacat attgacagaa 6420ttaacaagcc agatttgcca ctggcttcgg gcgagatttc cgtcaatact gcctggatca 6480tggaaacttc tattattgtt gccttgtttg gattgataat caccataaaa atggaaacta 6540agggtggtcc attgtatatt ttcggttact gttttggtat cttcgggggc atcgtctact 6600ctgttcctcc attcagatgg aaacaaaatc cttccacagc attccttttg aacttcctgg 6660cgcacattat aaccaacttt actttttatt atgcctccag agccgccctg gggctgccct 6720ttgaattacg cccctccttt acatttttac tggccttcat ggagaccaag tccatggaga 6780ctggttctgc tctcgcgttg atcaaagatg cttccgatgt ggaaggtgac accaaatttg 6840gtatatccac tttggccagc aagtatggtt ccaggaattt gaccctattt tgttctggta 6900tcgtgctgct gtcttatgtt gcagccatct tggctggcat catttggcca caggctttca 6960attcaaatgt tatggagacg ctgctctcgc atgctatttt ggcattttgg ttgattctac 7020agacaagaga ttttgcttta accaattatg acccagaagc tggtagaaga ttttacgaat 7080ttatggaaac atggaaatta tactatgctg aatatttagt gtacgttttc attgggggcg 7140gctccagcgc cggcggcggc tcttctgcgg gcggttggtc tcatccacaa tttgagaaag 7200gtgggtcgtc tggcggcggc agcgggggcg ggtccggcgg ggggagcggc ggtatgaaat 7260gttcgacctt ctctttttgg tttgtctgta aaataatttt ttttttcttc agctttaaca 7320ttcaaaccag cattgcaaat ccaagagaaa atttcttgaa atgcttttca caatatatcc 7380ccaataatgc tactaacttg aagctagttt atactcaaaa caaccctttg tacatgtccg 7440tgctcaactc caccattcac aacctaagat tcacttcaga cactacccca aaaccattag 7500ttattgtgac accttctcac gtttcacata tccaaggtac tattttatgc tccaagaagg 7560tcggcctgca aattagaact agatctggag gtcatgattc agaaggaatg tcttacatct 7620ctcaagttcc atttgtgatt gtcgatttaa gaaatatgag gagcattaag atcgatgttc 7680actcccaaac ggcatgggtt gaagccggtg ccaccttggg cgaagtttac tactgggtca 7740acgagaagaa tgaaaactta tcactagccg caggttattg tccaactgtt tgtgctggtg 7800gccatttcgg aggcggcggc tacggtcctc taatgagaaa ctacggctta gctgctgaca 7860atatcatcga cgctcacttg gttaacgttc atggtaaagt tttagataga aaatctatgg 7920gtgaggatct tttctgggct ttgagaggtg gcggcgcaga atcatttggc attatcgttg 7980cttggaagat cagattggtg gctgtcccca agtctacaat gttttctgtg aagaaaatta 8040tggaaatcca tgaattggtc aaactggtga ataaatggca aaacatagct tacaagtacg 8100ataaagactt gctgttaatg acacatttta ttaccaggaa catcactgat aaccaaggca 8160agaacaagac tgcaattcat acttattttt cctccgtttt tttgggtggt gtcgactccc 8220tcgtggatct gatgaataaa tcattccctg aactaggtat taaaaaaacc gattgtagac 8280aattgagttg gattgatacc atcatattct acagtggtgt tgttaattat gatactgaca 8340acttcaacaa agaaatactg ctggaccgtt ccgccggcca gaatggtgct tttaaaatca 8400agttggatta tgtgaaaaag cctattccag aatccgtatt tgttcaaata ttggaaaagc 8460tgtatgaaga agacattggt gcaggcatgt acgctcttta tccttatggc ggcataatgg 8520atgaaatttc tgaaagtgcc attcctttcc cacatagggc cgggatcctg tacgagttat 8580ggtacatttg ttcatgggaa aagcaagaag ataatgaaaa acatttaaat tggataagaa 8640atatttataa ttttatgact ccatacgtct ccaaaaaccc acgcctggca tatttgaatt 8700acagagacct ggatattggc atcaatgatc ctaaaaaccc aaataattac actcaggcaa 8760gaatatgggg tgaaaaatat ttcggcaaaa attttgatag gctggtcaag gttaaaacac 8820tggttgatcc aaacaatttc tttagaaacg aacaatctat cccacctctg cctagacata 8880gacacggcgg tggaagcagt ggaggcggct ctattgaatc tgatgtttaa tga 8933356677DNAArtificial SequenceCondon Optimized 35ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct 60ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata 120gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga 180cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg 240aaggctttaa tttgcggccc ctcacctgca cgcaaaaagc ttttcaattc aattcatcat 300ttttttttta ttcttttttt tgatttcggt ttctttgaaa tttttttgat tcggtaatct 360ccgaacagaa ggaagaacga aggaaggagc acagacttag attggtatat atacgcatat 420gtagtgttga agaaacatga aattgcccag tattcttaac ccaactgcac agaacaaaaa 480ccagcaggaa acgaagataa atcatgtcga aagctacata taaggaacgt gctgctactc 540atcctagtcc tgttgctgcc aagctattta atatcatgca cgaaaagcaa acaaacttgt 600gtgcttcatt ggatgttcgt accaccaagg aattactgga gttagttgaa gcattaggtc 660ccaaaatttg tttactaaaa acacatgtgg atatcttgac tgatttttcc atggagggca 720cagttaagcc gctaaaggca ttatccgcca agtacaattt tttactcttc gaagatagaa 780aatttgctga cattggtaat acagtcaaat tgcagtactc tgcgggtgta tacagaatag 840cagaatgggc agacattacg aatgcacacg gtgtggtggg cccaggtatt gttagcggtt 900tgaagcaggc ggcagaagaa gtaacaaagg aacctagagg ccttttgatg ttagcagaat 960tgtcatgcaa gggctcccta tctactggag aatatactaa gggtactgtt gacattgcga 1020aaagcgacaa agattttgtt atcggcttta ttgctcaaag agacatgggt ggaagagatg 1080aaggttacga ttggttgatt atgacacccg gtgtgggttt agatgacaag ggagatgcat 1140tgggtcaaca gtatagaacc gtggatgatg ttgtctctac aggatctgac attattattg 1200ttggaagagg actatttgca aagggaaggg atgctaaggt agagggtgaa cgttacagaa 1260aagcaggctg ggaagcatat ttgagaagat gcggccagca aaactaaaaa actgtattat 1320aagtaaatgc atgtatacta aactcacaaa ttagagcttc aatttaatta tatcagttat 1380tacccacgct atgatccaat atcaaaggaa atgatagcat tgaaggatga gactaatcca 1440attgaggagt ggcagcatat agaacagcta aagggtagtg ctgaaggaag catacgatac 1500cccgcatgga atgggataat atcacaggag gtactagact acctttcatc ctacataaat 1560agacgcatat aagtacgcat ttaagcataa acacgcacta tgccgttctt ctcatgtata 1620tatatataca ggcaacacgc agatataggt gcgacgtgaa cagtgagctg tatgtgcgca 1680gctcgcgttg cattttcgga agcgctcgtt ttcggaaacg ctttgaagtt cctattccga 1740agttcctatt ctctagaaag tataggaact tcagagcgct tttgaaaacc aaaagcgctc 1800tgaagtcgca ctttcaaaaa accaaaaacg caccggactg taacgagcta ctaaaatatt 1860gcgaataccg cttccacaaa cattgctcaa aagtatctct ttgctatata tctctgtgct 1920atatccctat ataacctacc catccacctt tcgctccttg aacttgcatc taaactcgac 1980ctctacattt tttatgttta tctctagtat tactctttag acaaaaaaat tgtagtaaga 2040actattcata gagtgaatcg aaaacaatac gaaaatgtaa acatttccta tacgtagtat 2100atagagacaa aatagaagaa accgttcata attttctgac caatgaagaa tcatcaacgc 2160tatcactttc tgttcacaaa gtatgcgcaa tccacatcgg tatagaatat aatcggggat 2220gcctttatct tgaaaaaatg cacccgcagc ttcgctagta atcagtaaac gcgggaagtg 2280gagtcaggct ttttttatgg aagagaaaat agacaccaaa gtagccttct tctaacctta 2340acggacctac agtgcaaaaa gttatcaaga gactgcatta tagagcgcac aaaggagaaa 2400aaaagtaatc taagatgctt tgttagaaaa atagcgctct cgggatgcat ttttgtagaa 2460caaaaaagaa gtatagattc tttgttggta aaatagcgct ctcgcgttgc atttctgttc 2520tgtaaaaatg cagctcagat tctttgtttg aaaaattagc gctctcgcgt tgcatttttg 2580ttttacaaaa atgaagcaca gattcttcgt tggtaaaata gcgctttcgc gttgcatttc 2640tgttctgtaa aaatgcagct cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat 2700ttttgttcta caaaatgaag cacagatgct tcgttcaggt ggcacttttc ggggaaatgt 2760gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag 2820acaataaccc tgatattggt cagaattggt taattggttg taacactgac ccctatttgt 2880ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 2940cttcaataat attgaaaaag gaagaatatg agtattcaac atttccgtgt cgcccttatt 3000cccttttttg cggcattttg ccttcctgtt tttgctcacc

cagaaacgct ggtgaaagta 3060aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc 3120ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa 3180gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc 3240cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt 3300acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact 3360gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac 3420aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata 3480ccaaacgacg agcgtgacac cacgatgcct gtagcgatgg caacaacgtt gcgcaaacta 3540ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg 3600gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat 3660aaatccggag ccggtgagcg tggttctcgc ggtatcatcg cagcgctggg gccagatggt 3720aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga 3780aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact catgaccaaa 3840atcccttaac gtgagttacg cgcgcgtcgt tccactgagc gtcagacccc gtagaaaaga 3900tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 3960aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 4020aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg tagccgtagt 4080tagcccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 4140taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 4200agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 4260tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 4320cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 4380agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 4440gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 4500aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca 4560tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag 4620ctgataccgc tcggggtcgt gcaggtatag cttcaaaatg tttctactcc ttttttactc 4680ttccagattt tctcggactc cgcgcatcgc cgtaccactt caaaacaccc aagcacagca 4740tactaaattt cccctctttc ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg 4800gaaaagaaaa aagtgaccgc ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt 4860ttatcacgtt tctttttctt gaaaattttt ttttttgatt tttttctctt tcgatgacct 4920cccattgata tttaagttaa taaacggact tcaatttctc aagtttcagt ttcatttttc 4980ttgttctatt acaacttttt ttacttcttg ctcattagaa agaaagcata gcaatctaat 5040ctaagtttaa aatgaatcat ttgagagcag aagggcctgc ttccgtgctg gctattggta 5100ccgccaatcc agaaaatatc ctgctgcagg acgaattccc agattactat tttagggtca 5160ccaaatctga acatatgaca caattgaaag agaaattcag aaagatttgt gacaagtcca 5220tgattaggaa aagaaattgt tttttgaatg aagaacactt gaagcaaaat cctcgcctgg 5280tggagcatga aatgcaaact ttggatgcta gacaagacat gttggtggtg gaagttccaa 5340agctggggaa ggatgcctgt gccaaggcca ttaaagaatg gggccaacca aaatccaaaa 5400ttacccacct gattttcacc tccgcctcca ccactgatat gccaggtgca gactatcatt 5460gtgctaaatt gttgggtttg tccccctccg tgaagagagt tatgatgtat caattaggtt 5520gttatggcgg cggcaccgtt ctgagaattg ccaaagacat tgctgaaaac aataaaggtg 5580cgcgcgtttt ggctgtttgt tgtgatatta tggcatgttt atttagaggt ccaagtgaaa 5640gtgacttgga attgctagtg ggccaggcca tatttggtga tggtgccgct gctgtgatcg 5700ttggtgctga gcctgatgaa tctgtcggtg aaagaccaat ttttgaactg gtttccactg 5760gtcaaaccat tttgccaaat tcagaaggta ctattggcgg ccatatcaga gaagctggtt 5820taatctttga tttgcacaag gatgtcccaa tgttaatttc caataatatt gaaaaatgtt 5880tgatcgaagc atttaccccc atcggtattt ctgattggaa ttccatcttc tggattacac 5940atcctggcgg taaagctatc ttagataaag ttgaggagaa gttgcattta aagtctgaca 6000aatttgttga ttcaagacat gtcctgtctg agcacggtaa tatgtcttcc tcgaccgtct 6060tgtttgtcat ggatgagttg aggaagaggt ccctggaaga aggcaagagc accaccggtg 6120acggttttga gtggggggtc ctctttggat ttgggccagg cctgaccgta gaaagggttg 6180ttgtccgctc ggtgccaatc aaatatggtg gggggtccag cgccggtggc gggagctccg 6240cgggcggttg gtctcaccca caatttgaaa agggtggcag cagcggcggc ggctctggcg 6300gaggctccgg cgggggctcg gggggtatgg ctgtcaagca tctgatcgtg ctgaagttca 6360aagatgaaat tactgaagcc caaaaggagg aatttttcaa gacatatgtt aatttggtta 6420acatcattcc agcaatgaaa gatgtttatt ggggtaagga cgttactcaa aaaaataagg 6480aagagggtta cactcatatt gttgaagtca ctttcgaatc cgtcgaaaca attcaagatt 6540atattattca tccagctcat gttgggtttg gcgatgtgta cagatcattt tgggaaaaat 6600tattgatttt tgactacaca ccaagaaaag gcggtggaag cagtggaggc ggctctattg 6660aatctgatgt ttaatag 6677363372DNAArtificial SequenceCodon Optimized 36atggagaaga ctcaagaaac agtccaaaga attcttctag aaccctataa atacttactt 60cagttaccag gtaaacaagt gagaaccaaa ctttcacagg catttaatca ttggctgaaa 120gttccagagg acaagctaca gattattatt gaagtgacag aaatgttgca taatgccagt 180ttactcatcg atgatattga agacaactca aaactccgac gtggctttcc agtggcccac 240agcatctatg gaatcccatc tgtcatcaat tctgccaatt acgtgtattt ccttggcttg 300gagaaagtct taacccttga tcacccagat gcagtgaagc tttttacccg ccagcttttg 360gaactccatc agggacaagg cctagatatt tactggaggg ataattacac ttgtcccact 420gaagaagaat ataaagctat ggtgctgcag aaaacaggtg gactgtttgg attagcagta 480ggtctcatgc agttgttctc tgattacaaa gaagatttaa aaccgctact taatacactt 540gggctctttt tccaaattag ggatgattat gctaatctac actccaaaga atatagtgaa 600aacaaaagtt tttgtgaaga tctgacagag ggaaagttct catttcctac tattcatgct 660atttggtcaa ggcctgaaag cacccaggtg cagaatatct tgcgccagag aacagaaaac 720atagatataa aaaaatactg tgtacattat cttgaggatg taggttcttt tgaatacact 780cgtaataccc ttaaagagct tgaagctaaa gcctataaac agattgatgc acgtggtggg 840aaccctgagc tagtagcctt agtaaaacac ttaagtaaga tgttcaaaga agaaaatgaa 900ggcggttctg gcagcggaga gggcagagga agtcttctaa catgcggtga cgtggaggag 960aatcccggcc ctaggtctgg cagcggagag ggcagaggaa gtcttctaac atgcggtgac 1020gtggaggaga atcccggccc taggacacaa aagaaagtcc cagacaattg ttgtagacgt 1080gaacctatgc tggtcagaaa taaccagaaa tgtgattcag tagaggaaga gacagggata 1140aaccgagaaa gaaaagttga ggttataaaa cccttagtgg ctgaaacaga taccccaaac 1200agagctacat ttgtggttgg taactcctcc ttactcgata cttcatcagt actggtgaca 1260caggaacctg aaattgaact tcccagggaa cctcggccta atgaagaatg tctacagata 1320cttgggaatg cagagaaagg tgcaaaattc cttagtgatg ctgagatcat ccagttagtc 1380aatgctaagc atatcccagc ctacaagttg gaaactctga tggaaactca tgagcgtggt 1440gtatctattc gccgacagtt actttccaag aagctttcag aaccttcttc tctccagtac 1500ctaccttaca gggattataa ttactccttg gtgatgggag cttgttgtga gaatgttatt 1560ggatatatgc ccatccctgt tggagtggca ggaccccttt gcttagatga aaaagaattt 1620caggttccaa tggcaacaac agaaggttgt cttgtggcca gcaccaatag aggctgcaga 1680gcaataggtc ttggtggagg tgccagcagc cgagtccttg cagatgggat gactcgtggc 1740ccagttgtgc gtcttccacg tgcttgtgac tctgcagaag tgaaagcctg gctcgaaaca 1800tctgaagggt tcgcagtgat aaaggaggca tttgacagca ctagcagatt tgcacgtcta 1860cagaaacttc atacaagtat agctggacgc aacctttata tccgtttcca gtccaggtca 1920ggggatgcca tggggatgaa catgatttca aagggtacag agaaagcact ttcaaaactt 1980cacgagtatt tccctgaaat gcagattcta gccgttagtg gtaactattg tactgacaag 2040aaacctgctg ctataaattg gatagaggga agaggaaaat ctgttgtttg tgaagctgtc 2100attccagcca aggttgtcag agaagtatta aagactacca cagaggctat gattgaggtc 2160aacattaaca agaatttagt gggctctgcc atggctggga gcataggagg ctacaacgcc 2220catgcagcaa acattgtcac cgccatctac attgcctgtg gacaggatgc agcacagaat 2280gttggtagtt caaactgtat tactttaatg gaagcaagtg gtcccacaaa tgaagattta 2340tatatcagct gcaccatgcc atctatagag ataggaacgg tgggtggtgg gaccaaccta 2400ctacctcagc aagcctgttt gcagatgcta ggtgttcaag gagcatgcaa agataatcct 2460ggggaaaatg cccggcagct tgcccgaatt gtgtgtggga ccgtaatggc tggggaattg 2520tcacttatgg cagcattggc agcaggacat cttgtcaaaa gtcacatgat tcacaacagg 2580tcgaagatca atttacaaga cctccaagga gcttgcacca agaagacagc cggctcagga 2640ggttcttcag gactggaagt gctgtttcag ggcccgggtg gatctggcat gatgcctgaa 2700ataaacacta accacctcga caagcaacag gttcaactcc tggcagagat gtgtatcctt 2760attgatgaaa atgacaataa aattggagct gagaccaaga agaattgtca cctgaacgag 2820aacattgaga aaggattatt gcatcgagct tttagtgtct tcttattcaa caccgaaaat 2880aagcttctgc tacagcaaag atcagatgct aagattacct ttccaggttg ttttacgaat 2940acgtgttgta gtcatccatt aagcaatcca gccgagcttg aggaaagtga cgcccttgga 3000gtgaggcgag cagcacagag acggctgaaa gctgagctag gaattccctt ggaagaggtt 3060cctccagaag aaattaatta tttaacacga attcactaca aagctcagtc tgatggtatc 3120tggggtgaac atgaaattga ttacattttg ttggtgagga agaatgtaac tttgaatcca 3180gatcccaatg agattaaaag ctattgttat gtgtcaaagg aagaactaaa agaacttctg 3240aaaaaagcag ccagtggtga aattaagata acgccatggt ttaaaattat tgcagcgact 3300tttctcttta aatggtggga taacttaaat catttgaatc agtttgttga ccatgagaaa 3360atatacagaa tg 3372

Claims

1) Process of biosynthesis of compounds of interest (Table 1); using a cheap and readily available starting materials in any organism or cell-free expression system (Table 2).

2) Process of genetically engineering micro-organisms that produce compounds of interest in large/industrial-scale quantities.

3) Process of altering genes in organisms to allow better yields for compounds of interest.

4) Process of genetically engineering food plants that are optimized for production of compounds of interest.

5) Using s. cerevisaie, e coli, p. pastorisis, n. crassa, s. pombe, r. palmatum, c. longa, o. sativa, a. arborescens, a. terrus, c. sativa, s. griseus, s. erythera, s. coelicolor, s. toxytruini, s. cellulosum, p. floresceus, a. orientalis, s. livedans, a. vinelandii, b. subtilis, m. tuberculosis, m. xanthus, a. oryzae, a. niger, r. palmatum, h. serrata, r. rubra, l. erythrhizon, l. acetobutylicum, c. utilis, a. niger, c. glutamicum, b. spp., and other large-scale biotechnology organisms to biosynthesize a total pathway using cheap and readily available starting materials to make our compounds of interest.

6) Process of claims 1 to 5, wherein the products are those listed in table 1.

7) Process of claims 1 to 6, wherein the starting materials are those listed in table 2.

8) Process of claims 1 to 7, wherein certain steps are performed outside or inside an organism or cell free expression system using various techniques, while other steps may use biosynthesis techniques.

9) Producing compositions (e.g. tinctures, balms, capsules, tablets, concentrates, edibles, topicals) that use claims 1 to 8, whether they are classified as pharmaceuticals or not.

10) Producing compositions that contain combinations of certain compounds for certain therapeutic and non-therapeutic applications, as listed in table 1.

11) To claim 10, compositions that have added cofactors for better efficacy, absorption, etc, for our compounds of interest. These include terpenes, sequiterpenes, vitamins, and other cofactors.

12) cDNA sequences of enzymes and organisms in the pathways and processes listed in FIGS. 1-7 for biosynthesis of compounds of interest using cheap and readily available starting materials, including mRNA's, tRNA's, vectors, and other genetic coding molecules needed for process of claims 1 to 8.

13) A method for the efficient and cheap biosynthesis of CBGA, THCA, CBDA, CBCA, CBDVA, THCVA, CBGVA, and CBCVA utilizing manipulation of any ERG, IDI, gal80p, upc2-1, HMGR, tHMGR, ALD6, DPP1, and ADH2 genes that result in exogenous sterol mutations for the uptake of exogenous sterols, more permeable cell membrane for easy inward flow of exogenous materials while easy outward flow of our compounds of interest, and carbon flux manipulation and blocking of other pathways for many fold higher yields in S. Cerevisiae and P. Pastoris.