U.S. patent application number 15/177244 was filed with the patent office on 2016-09-29 for antisense composition and method for treating muscle atrophy.
The applicant listed for this patent is Sarepta Therapeutics, Inc.. Invention is credited to Patrick L. Iversen, Alan P. Timmins, Dwight D. Weller.
Application Number | 20160281092 15/177244 |
Document ID | / |
Family ID | 36793777 |
Filed Date | 2016-09-29 |
United States Patent
Application |
20160281092 |
Kind Code |
A1 |
Iversen; Patrick L. ; et
al. |
September 29, 2016 |
ANTISENSE COMPOSITION AND METHOD FOR TREATING MUSCLE ATROPHY
Abstract
A method and compound for treating skeletal muscle mass
deficiency in a human subject are disclosed. The composition is an
oligomer of morpholino subunits and phosphorus-containing
intersubunit linkages joining a morpholino nitrogen of one subunit
to a 5' exocyclic carbon of an adjacent subunit, contains between
10-40 nucleotide bases, has a base sequence effective to hybridize
to an expression-sensitive region of processed or preprocessed
human myostatin RNA transcript, identified, in its processed form,
by SEQ ID NO:6, and is capable of uptake by target muscle cells in
the subject. In practicing the method, the compound is administered
in an amount and at a dosage schedule to produce an overall
reduction in the level of serum myostatin measured in the patient,
and preferably to bring the myostatin level within the a range
determined for normal, healthy individuals.
Inventors: |
Iversen; Patrick L.;
(Corvallis, OR) ; Weller; Dwight D.; (Corvalis,
OR) ; Timmins; Alan P.; (Sherwood, OR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sarepta Therapeutics, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
36793777 |
Appl. No.: |
15/177244 |
Filed: |
June 8, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14323349 |
Jul 3, 2014 |
|
|
|
15177244 |
|
|
|
|
12983798 |
Jan 3, 2011 |
8785410 |
|
|
14323349 |
|
|
|
|
11433724 |
May 11, 2006 |
7888012 |
|
|
12983798 |
|
|
|
|
PCT/US06/04797 |
Feb 9, 2006 |
|
|
|
11433724 |
|
|
|
|
60651574 |
Feb 9, 2005 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1136 20130101;
A61K 31/675 20130101; Y10T 436/143333 20150115; C12N 2310/3233
20130101; C12N 2310/3145 20130101; C12N 2320/30 20130101; C12N
2310/3513 20130101; C12N 2310/31 20130101; C07K 7/08 20130101; C07H
21/00 20130101; C12Q 2600/158 20130101; A61K 47/645 20170801; A61P
21/00 20180101; C12Q 1/6876 20130101; C12N 2310/11 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 47/48 20060101 A61K047/48; A61K 31/675 20060101
A61K031/675 |
Claims
1. An antisense morpholino oligonucleotide of 15-40 bases
comprising a base sequence that is complementary to at least 12
contiguous bases of SEQ ID NO:6, wherein the antisense morpholino
oligonucleotide inhibits the expression of human myostatin in a
cell.
2. The antisense morpholino oligonucleotide of claim 1, wherein the
antisense morpholino oligonucleotide comprises
phosphorus-containing intersubunit linkages, in accordance with the
structure: ##STR00002## where Y.sub.1, .dbd.O, Z.dbd.O, Pj is a
purine or pyrimidine base-pairing moiety effective to bind, by
base-specific hydrogen bonding, to a base in a polynucleotide, and
X is alkyl, alkoxy, thioalkoxy, amino or alkyl amino, or
dialkylamino.
3. The antisense morpholino oligonucleotide of claim 1, wherein the
antisense morpholino oligonucleotide is conjugated to an
arginine-rich peptide.
4. The antisense morpholino oligonucleotide of claim 1, wherein at
least 2 and no more than half of the total number of
phosphorus-containing intersubunit linkages are positively charged
at physiological pH.
5. The antisense morpholino oligonucleotide of claim 4, wherein the
antisense morpholino oligonucleotide comprises
phosphorus-containing intersubunit linkages, in accordance with the
structure: ##STR00003## where Y.sub.1.dbd.O, Z.dbd.O, Pj is a
purine or pyrimidine base-pairing moiety effective to bind, by
base-specific hydrogen bonding, to a base in a polynucleotide, and
X for the uncharged linkages is alkyl, alkoxy, thioalkoxy, or an
alkyl amino of the form NR.sub.2, where each R is independently
hydrogen or methyl, and for the positively charged linkages, X is
1-piperazine.
6. The antisense morpholino oligonucleotide of claim 3, wherein the
arginine rich peptide has one of the sequences identified as SEQ ID
NOS: 7-9.
7. The antisense morpholino oligonucleotide of claim 3, wherein the
arginine-rich peptide is covalently coupled at its C terminus to
the 5' end of the antisense morpholino oligonucleotide.
8. The antisense morpholino oligonucleotide of claim 1, wherein the
base sequence is complementary to at least 12 contiguous bases of
SEQ ID NO:10, and formation of the heteroduplex in step (c) is
effective to block translation of said processed transcript.
9. The antisense morpholino oligonucleotide of claim 8, wherein the
base sequence is SEQ ID NO: 1.
10. The antisense morpholino oligonucleotide of claim 1, wherein
the base sequence is complementary to at least 12 contiguous bases
of a splice site in a preprocessed human myostatin transcript.
11. The antisense morpholino oligonucleotide of claim 10, wherein
the splice site in the preprocessed myostatin transcript has a
sequence selected from the group consisting of: SEQ ID NOS:
11-14.
12. The antisense morpholino oligonucleotide of claim 11, wherein
the base sequence is selected from the group consisting of: SEQ ID
NOS: 2-5.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. Ser. No. 14/323,349
filed on Jul. 3, 2014, now U.S. Patent Publication No. 2015/0119316
entitled "ANTISENSE COMPOSITION AND METHOD FOR TREATING MUSCLE
ATROPHY." U.S. Ser. No. 14/323,349 is a continuation of U.S. Ser.
No. 12/983,798 filed on Jan. 3, 2011, now U.S. Pat. No. 8,785,410
entitled "ANTISENSE COMPOSITION AND METHOD FOR TREATING MUSCLE
ATROPHY." U.S. Ser. No. 12/983,798 is a continuation of U.S. Ser.
No. 11/433,724 filed on May 11, 2006, now U.S. Pat. No. 7,888,012
entitled "ANTISENSE COMPOSITION AND METHOD FOR TREATING MUSCLE
ATROPHY." U.S. Ser. No. 11/433,724 is a continuation-in-part of PCT
Patent Application No. PCT/US06/04797 filed on Feb. 9, 2006, now
WIPO Publication No. WO 2006/086667 entitled "ANTISENSE COMPOSITION
AND METHOD FOR TREATING MUSCLE ATROPHY." PCT Patent Application No.
PCT/US06/04797 claims priority to and the benefit of U.S.
Provisional Patent Application No. 60/651,574 filed on Feb. 9, 2005
and entitled "ANTISENSE COMPOSITION AND METHOD FOR TREATING MUSCLE
ATROPHY." The entire contents of all the foregoing patents and
applications are incorporated herein by reference.
SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
67463.00837_SequenceListing.txt. The text file is about 7 KB, was
created on Jun. 8, 2016, and is being submitted electronically via
EFS-Web.
FIELD OF THE INVENTION
[0003] This invention relates to compounds and methods for treating
muscle-wasting disease conditions, and additionally, for impacting
muscle tissue development in mammalian subjects.
REFERENCES
[0004] Agrawal, S., S. H. Mayrand, et al. (1990). "Site-specific
excision from RNA by RNase H and mixed-phosphate-backbone
oligodeoxynucleotides." Proc Natl Acad Sci USA 87(4): 1401-5.
[0005] Bennett, M. R. and S. M. Schwartz (1995). "Antisense therapy
for angioplasty restenosis. Some critical considerations."
Circulation 92(7): 1981-93. [0006] Blommers, M. J., U. Pieles, et
al. (1994). "An approach to the structure determination of nucleic
acid analogues hybridized to RNA. NMR studies of a duplex between
2'-OMe RNA and an oligonucleotide containing a single amide
backbone modification." Nucleic Acids Res 22(20): 4187-94. [0007]
Bonham, M. A., S. Brown, et al. (1995). "An assessment of the
antisense properties of RNase H-competent and steric-blocking
oligomers." Nucleic Acids Res 23(7): 1197-203. [0008] Boudvillain,
M., M. Guerin, et al. (1997). "Transplatin-modified
oligo(2'-O-methyl ribonucleotide)s: a new tool for selective
modulation of gene expression." Biochemistry 36(10): 2925-31.
[0009] Cross, C. W., J. S. Rice, et al. (1997). "Solution structure
of an RNA.times.DNA hybrid duplex containing a 3'-thioformacetal
linker and an RNA A-tract." Biochemistry 36(14): 4096-107. [0010]
Dagle, J. M., J. L. Littig, et al. (2000). "Targeted elimination of
zygotic messages in Xenopus laevis embryos by modified
oligonucleotides possessing terminal cationic linkages." Nucleic
Acids Res 28(10): 2153-7. [0011] Ding, D., S. M. Grayaznov, et al.
(1996). "An oligodeoxyribonucleotide N3'-->P5' phosphoramidate
duplex forms an A-type helix in solution." Nucleic Acids Res 24(2):
354-60. [0012] Egholm, M., O. Buchardt, et al. (1993). "PNA
hybridizes to complementary oligonucleotides obeying the
Watson-Crick hydrogen-bonding rules." Nature 365(6446): 566-8.
[0013] Felgner, P. L., T. R. Gadek, et al. (1987). "Lipofection: a
highly efficient, lipid-mediated DNA-transfection procedure." Proc
Natl Acad Sci USA 84(21): 7413-7. [0014] Gait, M. J., A. S. Jones,
et al. (1974). "Synthetic-analogues of polynucleotides XII.
Synthesis of thymidine derivatives containing an oxyacetamido- or
an oxyformamido-linkage instead of a phosphodiester group." J Chem
Soc [Perkin 1] 0(14): 1684-6. [0015] Gee, J. E., I. Robbins, et al.
(1998). "Assessment of high-affinity hybridization, RNase H
cleavage, and covalent linkage in translation arrest by antisense
oligonucleotides." Antisense Nucleic Acid Drug Dev 8(2): 103-11.
[0016] Gonzalez-Cadavid, N. F., W. E. Taylor, et al. (1998).
"Organization of the human myostatin gene and expression in healthy
men and HIV-infected men with muscle wasting." PNAS 95(25):
14938-14943. [0017] Hudziak, R. M., J. Summerton, et al. (2000).
"Anti-proliferative effects of steric blocking phosphorodiamidate
morpholino antisense agents directed against c-myc." Antisense
Nucleic Acid Drug Dev 10(3): 163-76. [0018] Kirk, S., et al.,
"Myostatin regulation during skeletal muscle regulation, J. Cell
Physiology, 2000, 184(3): 356-363. [0019] Lappalainen, K., A.
Urtti, et al. (1994). "Cationic liposomes improve stability and
intracellular delivery of antisense oligonucleotides into CaSki
cells." Biochim Biophys Acta 1196(2): 201-8. [0020] Lesnikowski, Z.
J., M. Jaworska, et al. (1990). "Octa(thymidine
methanephosphonates) of partially defined stereochemistry:
synthesis and effect of chirality at phosphorus on binding to
pentadecadeoxyriboadenylic acid." Nucleic Acids Res 18(8): 2109-15.
[0021] Lou, X., K. L. Garrett, et al. (2001). "Synthetic hydrogels
as carriers in antisense therapy: preliminary evaluation of an
oligodeoxynucleotide covalent conjugate with a copolymer of
1-vinyl-2-pyrrolidinone and 2-hydroxy-ethyl methacrylate." J
Biomater Appl 15(4): 307-20. [0022] McPherron, A. C., A. M. Lawler,
et al. (1997). "Regulation of skeletal muscle mass in mice by a new
TGF-beta superfamily member." Nature 387(6628): 83-90. [0023]
McPherron, A. C. and S.-J. Lee (1997). "Double muscling in cattle
due to mutations in the myostatin gene." PNAS 94(23): 12457-12461.
[0024] Mertes, M. P. and E. A. Coats (1969). "Synthesis of
carbonate analogs of dinucleosides. 3'-Thymidinyl 5'-thymidinyl
carbonate, 3'-thymidinyl 5'-(5-fluoro-2'-deoxyuridinyl) carbonate,
and 3'-(5-fluoro-2'-deoxyuridinyl) 5'-thymidinyl carbonate." J Med
Chem 12(1): 154-7. [0025] Schulte, J. N., et al. "Effects of
resistance training on the rate of muscle protein synthesis in
frail elderly people, Int. J. Sport Nutrition and Exercise Metab,
2001, 11 Supp, pp 111-118. [0026] Stein, D., E., et al. (1997). "A
specificity comparison of four antisense types: morpholino,
2'-O-methyl RNA, DNA, and phosphorothioate DNA." Antisense Nucleic
Acid Drug Dev 7(3): 151-7. [0027] Toulme, J. J., R. L. Tinevez, et
al. (1996). "Targeting RNA structures by antisense
oligonucleotides." Biochimie 78(7): 663-73. [0028] Wallace, J. I.
and R. S. Schwartz (2002). "Epidemiology of weight loss in humans
with special reference to wasting in the elderly." Int J Cardiol
85(1): 15-21. [0029] Williams, A. S., J. P. Camilleri, et al.
(1996). "A single intra-articular injection of liposomally
conjugated methotrexate suppresses joint inflammation in rat
antigen-induced arthritis." Br J Rheumatol 35(8): 719-24. [0030]
Yarasheski, K. E., et al., Serum myostatin-immunoreactive protein
is increased in 60-92 year old women and men with muscle wasting,"
J. Nutrition, Health, Aging, 2002, 6(5):343-348. [0031] Zimmers, T.
A., M. V. Davies, et al. (2002). "Induction of Cachexia in Mice by
Systemically Administered Myostatin." Science 296(5572):
1486-1488.
BACKGROUND OF THE INVENTION
[0032] Myostatin, or growth/differentiation factor 8 (GDF-8),
belongs to the transforming growth factor-.beta. (TGF-.beta.)
superfamily (McPherron, Lawler et al. 1997). The human myostatin
gene has been cloned (Gonzalez-Cadavid, Taylor et al. 1998), and it
has been reported that myostatin is largely expressed in human
skeletal muscle and plays an essential role in negatively
regulating the growth and development of skeletal muscle
(Gonzalez-Cadavid, Taylor et al. 1998).
[0033] Knock-out mice provided the first evidence that myostatin
plays a key role in negatively regulating muscle development
(McPherron, Lawler et al. 1997). The myostatin null mice were
normal except that they were significantly larger than wild-type
mice and had a large and widespread increase in skeletal muscle
mass. Furthermore, it was also determined that two breeds of
cattle, with the heritable characteristic of increased muscle mass,
have mutations in the myostatin coding sequence (McPherron and Lee
1997). Furthermore, the serum and intramuscular concentrations of
myostatin are increased in HIV-infected men with muscle wasting
compared with healthy men (Gonzalez-Cadavid, Taylor et al. 1998).
These data support the role of myostatin as a negative regulator of
skeletal muscle growth in adult men and as a contributor to muscle
wasting in HIV-infected men.
[0034] Heretofore, methods for treating muscle-wasting conditions
and/or enhancing muscle mass in mammals by manipulating myostatin
levels have been proposed. For example, U.S. Pat. Nos. 6,103,466
and 6,617,440, and U.S. published patent application 20030074680 A1
disclose methods for inhibiting levels of expressed myostatin by
administering to a human or animal subject, an antisense compound
against the myostatin transcript. To date, there is no evidence
that such approaches have succeeded or would succeed as disclosed,
or how one would select and monitor subjects for and during
treatment. There is thus a need for a treatment method for
effectively treating muscle wasting as a result of a condition such
as paralysis or disease state such as, for example, aging, acquired
immune deficiency syndrome, multiple sclerosis, and cancer. There
is also a need for an antisense agent that can effectively
accumulate in target muscle cells, e.g., with oral administration,
and inhibit myostatin expression in muscle cells.
[0035] Methods for enhancing muscle mass in meat-bearing animals,
by administering anti-myostatin antisense agents, have also been
proposed. However, to date such approaches have not proven
practical because of poor uptake of the agents and/or inability to
administer the agents orally. It would thus be desirable to provide
an agent that could be supplied orally, e.g., in animal feed, to
enhance muscle mass in meat-bearing animals.
SUMMARY OF THE INVENTION
[0036] The invention includes, in one aspect, an antisense
composition for use in increasing skeletal muscle mass in a human
subject. The composition includes a substantially uncharged
antisense compound (i) composed of morpholino subunits and
phosphorus-containing intersubunit linkages joining a morpholino
nitrogen of one subunit to a 5' exocyclic carbon of an adjacent
subunit; (ii) capable of uptake by target muscle cells in the
subject; (iii) containing between 10-40 nucleotide bases; and (iv)
having a base sequence effective to hybridize to an
expression-sensitive region of processed or preprocessed human
myostatin RNA transcript, identified, in its processed form, by SEQ
ID NO:6.
[0037] The morpholino subunits in the compound may be joined by
phosphorodiamidate linkages, in accordance with the structure:
##STR00001##
[0038] where Y1=O, Z.dbd.O, Pj is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide, and X is alkyl, alkoxy,
thioalkoxy, amino or alkyl amino, including dialkylamino, e.g.,
where X.dbd.NR2, each R is independently hydrogen or methyl. The
compound may be composed of morpholino subunits linked with the
uncharged linkages described above interspersed with linkages that
are positively charged at physiological pH. The total number of
positively charged linkages is between 2 and no more than half of
the total number of linkages. The positively charged linkages have
the structure above, where X is 1-piperazine.
[0039] The antisense compound in the composition may be conjugated
to an arginine-rich polypeptide effective to promote uptake of the
compound into target muscle cells. An exemplary arginine rich
peptide has one of the sequences identified as SEQ ID NOS:7-9. The
arginine-rich peptide may be covalently coupled at its C terminus
to the 5' end of the antisense compound. Where the antisense
compound is effective to hybridize to a target region at or
adjacent the start site of the processed human myostatin
transcript, the compound has a base sequence that is complementary
to a target region containing at least 12 contiguous bases in a
processed human myostatin transcript identified by SEQ ID NO:10,
and formation of the heteroduplex in step (c) is effective to block
translation of said processed transcript. An exemplary antisense
sequence includes the base sequence identified by the sequence SEQ
ID NO:1.
[0040] Where the antisense compound is effective to hybridize to a
splice site of preprocessed human myostatin transcript, it has a
base sequence that is complementary to at least 12 contiguous bases
of a splice site in a preprocessed human myostatin transcript, and
formation of the heteroduplex in step (c) is effective to block
processing of a preprocessed myostatin transcript to produce a
full-length, processed myostatin transcript. The splice site in the
preprocessed myostatin transcript may have one of the sequences
identified as SEQ ID NOS: 11-14. Exemplary antisense sequences are
those identified by SEQ ID NOS: 2-5.
[0041] In another aspect, the invention includes a method for
treating loss of skeletal muscle mass in a human subject. The steps
in the method entail (a) measuring blood or tissue levels of
myostatin in the subject, (b) administering to the subject, a
myostatin-expression-inhibiting amount of the antisense composition
described above, (c) by this administering, forming within target
muscle cells in the subject, a base-paired heteroduplex structure
composed of human myostatin RNA transcript and the antisense
compound and having a Tm of dissociation of at least 45.degree. C.,
thereby inhibiting expression of myostatin in said cells, (d) at a
selected time following administering the antisense compound,
measuring a blood or tissue level of myostatin in the subject, and
(e) repeating the administering, using the myostatin levels
measured in (d) to adjust the dose or dosing schedule of the amount
of antisense compound administered, if necessary, so as to reduce
measured levels of myostatin over those initially measured and
maintain such levels of myostatin measured in step (d) within a
range determined for normal, healthy individuals.
[0042] In one general embodiment, the myostatin value measured in
step (a) is above a selected threshold for normal healthy people.
The administering and measuring steps are preferably carried out
over a selected period of at least 2 weeks. The administering may
be by oral route.
[0043] Also forming part of the invention is a method of measuring
myostatin expression levels in a mammalian subject, by (a)
administering to the subject, a myostatin-expression-inhibiting
amount of the substantially uncharged antisense compound of the
type described above, (b) within about 8-72 hours following the
administering, analyzing a body-fluid sample obtained from the
subject for the presence of a heteroduplex composed of the
antisense compound and a complementary region of said myostatin RNA
transcript, to determine the concentration of transcript in said
sample.
[0044] Also disclosed is a feed composition for a meat-producing
animal, composed of a feed substance, and mixed therewith, a
substantially uncharged antisense compound of the type described
above.
[0045] These and other objects and features of the invention will
become more fully apparent when the following detailed description
is read in conjunction with the accompanying figures and
examples.
BRIEF DESCRIPTION OF THE FIGURES
[0046] FIGS. 1A-D show several preferred morpholino-type subunits
having 5-atom (FIG. 1A), six-atom (FIG. 1B) and seven-atom (FIGS.
1C and D) linking groups suitable for forming polymers.
[0047] FIGS. 2A-D show the repeating subunit segment of exemplary
uncharged, morpholino oligonucleotides having phosphorus-containing
linkages, designated FIG. 2A through 2D, constructed using subunits
A-D, respectively, of FIG. 1. FIG. 2E is another example of an
uncharged linkage type in an oligonucleotide analog. FIG. 2F is an
example of a preferred charged, cationic linkage.
[0048] FIG. 3 shows the synthetic steps to produce subunits used to
produce +PMO containing the (1-piperazino) phosphinylideneoxy
cationic linkage as shown in FIG. 2F.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0049] The terms below, as used herein, have the following
meanings, unless indicated otherwise.
[0050] The terms "antisense oligonucleotides," "antisense
oligomer," and "antisense compound" are used interchangeably and
refer to a compound having a sequence of nucleotide bases and a
subunit-to-subunit backbone that allows the antisense oligomer to
hybridize to a target sequence in RNA by Watson-Crick base pairing,
to form an RNA:oligomer heteroduplex within the target sequence.
The antisense oligonucleotide includes a sequence of purine and
pyrimidine heterocyclic bases, supported by a backbone, which are
effective to hydrogen-bond to corresponding, contiguous bases in a
target nucleic acid sequence. The backbone is composed of subunit
backbone moieties supporting the purine and pyrimidine heterocyclic
bases at positions that allow such hydrogen bonding. These backbone
moieties are cyclic moieties of 5 to 7 atoms in length, linked
together by phosphorous-containing linkages one to three atoms
long.
[0051] A substantially uncharged, phosphorus containing backbone in
an oligonucleotide analog is one in which a majority of the subunit
linkages, e.g., between 50-100%, are uncharged at physiological pH,
and contain a single phosphorous atom. The analog contains between
12 and 40 subunits, typically about 15-25 subunits, and preferably
about 18 to 25 subunits. The analog may have exact sequence
complementarity to the target sequence or near complementarity, as
defined below.
[0052] A "subunit" of an oligonucleotide analog refers to one
nucleotide (or nucleotide analog) unit of the analog. The term may
refer to the nucleotide unit with or without the attached
intersubunit linkage, although, when referring to a "charged
subunit", the charge typically resides within the intersubunit
linkage (e.g. a phosphate or phosphorothioate linkage). A
"morpholino" oligonucleotide refers to a polymeric molecule having
a backbone which supports bases capable of hydrogen bonding to
typical polynucleotides, wherein the polymer lacks a pentose sugar
backbone moiety, and more specifically a ribose backbone linked by
phosphodiester bonds which is typical of nucleotides and
nucleosides, but instead contains a ring nitrogen with coupling
through the ring nitrogen. A preferred "morpholino" oligonucleotide
is composed of morpholino subunit structures of the form shown in
FIG. 1A-1D, where (i) the structures are linked together by
phosphorous-containing linkages, one to three atoms long, joining
the morpholino nitrogen of one subunit to the 5' exocyclic carbon
of an adjacent subunit, and (ii) Pi and Pj are purine or pyrimidine
base-pairing moieties effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide. Exemplary structures for
antisense oligonucleotides for use in the invention include the
morpholino subunit types shown in FIGS. 1A-1D, with the uncharged,
phosphorous-containing linkages shown in FIGS. 2A-2D. The purine or
pyrimidine base-pairing moiety is typically adenine, cytosine,
guanine, uracil, thymine or inosine. The synthesis, structures, and
binding characteristics of morpholino oligomers are detailed in
U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506,
5,166,315, 5,521,063, and 5,506,337, all of which are incorporated
herein by reference.
[0053] A preferred morpholino oligomer is a
phosphorodiamidate-linked morpholino oligomer, referred to herein
as a PMO. Such oligomers are composed of morpholino subunit
structures such as shown in FIG. 2B, where X.dbd.NH2, NHR, or NR2
(where R is lower alkyl, preferably methyl), Y.dbd.O, and Z.dbd.O,
and Pi and Pj are purine or pyrimidine base-pairing moieties
effective to bind, by base-specific hydrogen bonding, to a base in
a polynucleotide, as seen in FIG. 2E. Also preferred are morpholino
oligomers where the phosphordiamidate linkages are uncharged
linkages as shown in FIG. 2E interspersed with cationic linkages as
shown in FIG. 2F where, in FIG. 2B, X=1-piperazino. In another FIG.
2B embodiment, X=lower alkoxy, such as methoxy or ethoxy, Y.dbd.NH
or NR, where R is lower alkyl, and Z.dbd.O.
[0054] As used herein, an oligonucleotide or antisense oligomer
"specifically hybridizes" to a target polynucleotide if the
oligomer hybridizes to the target under physiological conditions,
with a thermal melting point (Tm) substantially greater than
37.degree. C., preferably at least 45.degree. C., and typically
50.degree. C.-80.degree. C. or higher. Such hybridization
preferably corresponds to stringent hybridization conditions,
selected to be about 10.degree. C., and preferably about 50.degree.
C. lower than the Tm for the specific sequence at a defined ionic
strength and pH. At a given ionic strength and pH, the Tm is the
temperature at which 50% of a target sequence hybridizes to a
complementary polynucleotide.
[0055] Polynucleotides are described as "complementary" to one
another when hybridization occurs in an antiparallel configuration
between two single-stranded polynucleotides. A double-stranded
polynucleotide can be "complementary" to another polynucleotide, if
hybridization can occur between one of the strands of the first
polynucleotide and the second. Complementarity (the degree that one
polynucleotide is complementary with another) is quantifiable in
terms of the proportion of bases in opposing strands that are
expected to form hydrogen bonds with each other, according to
generally accepted base-pairing rules. An antisense compound may be
complementary to a target region of a target transcript even if the
two bases sequences are not 100% complementary, as long as the
heteroduplex structure formed between the compound and transcript
has the desired Tm stability.
[0056] As used herein the term "analog" with reference to an
oligomer means a substance possessing both structural and chemical
properties similar to those of the reference oligomer.
[0057] As used herein, a first sequence is an "antisense sequence"
or "targeting sequence" with respect to a second sequence or
"target sequence" if a polynucleotide whose sequence is the first
sequence specifically binds to, or specifically hybridizes with,
the second polynucleotide sequence under physiological
conditions.
[0058] As used herein, "effective amount" relative to an antisense
oligomer refers to the amount of antisense oligomer administered to
a subject, either as a single dose or as part of a series of doses
that are effective to inhibit expression of a selected target
nucleic acid sequence.
[0059] As used herein, an "expression-sensitive region" of a
processed or preprocessed mRNA transcript refers to either (i) a
region including or adjacent the AUG start site of a processed
transcript, where formation of an antisense-transcript heteroduplex
is effective to inhibit translation of the transcript or (ii) a
region including or adjacent a donor or acceptor splice site
junction in a preprocessed transcript, where formation of an
antisense-transcript heteroduplex is effective to inhibit formation
of a full-length processed transcript, either because one or more
exons that would normally be included in the transcript have been
deleted or because the transcript has been truncated at the target
splice site.
[0060] An agent is "actively taken up by mammalian cells" when the
agent can enter the cell by a mechanism other than passive
diffusion across the cell membrane. The agent may be transported,
for example, by "active transport", referring to transport of
agents across a mammalian cell membrane by e.g. an ATP-dependent
transport mechanism, or by "facilitated transport", referring to
transport of antisense agents across the cell membrane by a
transport mechanism that requires binding of the agent to a
transport protein, which then facilitates passage of the bound
agent across the membrane. For both active and facilitated
transport, the oligonucleotide compound has a substantially
uncharged backbone, as defined below. In addition, the analog may
be conjugated, e.g., at its 5' or 3' end, to an arginine rich
peptide, e.g., the HIV TAT protein, or polyarginine, to facilitate
transport into the target host cell, as discussed below.
[0061] As used herein, the term "myostatin antisense oligomer"
refers to a nuclease-resistant phosphorus-linked morpholino
antisense oligomer having high affinity for (i.e., which
"specifically hybridizes to") a complementary or near-complementary
human myostatin nucleic acid sequence.
[0062] As used herein "treatment" of an individual or a cell is any
type of intervention used in an attempt to alter the natural course
of the individual or cell. Treatment includes, but is not limited
to, administration of e.g., a pharmaceutical composition, and may
be performed either prophylactically, or subsequent to the
initiation of a pathologic event or contact with an etiologic
agent.
II. Antisense Composition for Use in Practicing the Invention
Antisense Compound
[0063] Antisense compounds in accordance with the present invention
are substantially uncharged antisense compounds (i) composed of
morpholino subunits and phosphorus-containing intersubunit linkages
joining a morpholino nitrogen of one subunit to a 5' exocyclic
carbon of an adjacent subunit; (ii) capable of uptake by target
muscle cells in the subject; (iii) containing between 10-40
nucleotide bases; (iv) having a base sequence effective to
hybridize to an expression-sensitive region of processed or
preprocessed human myostatin RNA transcript, identified, in its
processed form, by SEQ ID NO:6; to form a heteroduplex complex
having a Tm substantially greater than 37.degree. C., preferably at
least 45.degree. C., and (vi) nuclease resistance.
[0064] In addition, the antisense compound may have the capability
for active or facilitated transport as evidenced by (i) competitive
binding with a phosphorothioate antisense oligomer, and/or (ii) the
ability to transport a detectable reporter into target cells.
[0065] Candidate antisense oligomers may be evaluated, according to
well known methods, for acute and chronic cellular toxicity, such
as the effect on protein and DNA synthesis as measured via
incorporation of 3H-leucine and 3H-thymidine, respectively. In
addition, various control oligonucleotides, e.g., control
oligonucleotides such as sense, nonsense or scrambled antisense
sequences, or sequences containing mismatched bases, in order to
confirm the specificity of binding of candidate antisense
oligomers. The outcome of such tests is important in discerning
specific effects of antisense inhibition of gene expression from
indiscriminate suppression. Accordingly, sequences may be modified
as needed to limit non-specific binding of antisense oligomers to
non-target nucleic acid sequences.
[0066] Heteroduplex formation. The effectiveness of a given
antisense compound in forming a heteroduplex with the target mRNA
may be determined by screening methods known in the art. For
example, the oligomer is incubated in a cell culture containing an
mRNA preferentially expressed in activated lymphocytes, and the
effect on the target mRNA is evaluated by monitoring the presence
or absence of (1) heteroduplex formation with the target sequence
and non-target sequences using procedures known to those of skill
in the art, (2) the amount of the target mRNA expressed by
activated lymphocytes, as determined by standard techniques such as
RT-PCR or Northern blot, (3) the amount of protein transcribed from
the target mRNA, as determined by standard techniques such as ELISA
or Western blotting. (See, for example, (Pari, Field et al. 1995;
Anderson, Fox et al. 1996).
[0067] Uptake into cells. A second test measures cell transport, by
examining the ability of the test compound to transport a labeled
reporter, e.g., a fluorescence reporter, into cells, e.g., cultured
myocytes. The cells are incubated in the presence of labeled test
compound, added at a final concentration between about 10-300 nM.
After incubation for 30-120 minutes, the cells are examined, e.g.,
by microscopy or FACS analysis, for intracellular label. The
presence of significant intracellular label is evidence that the
test compound is transported by facilitated or active
transport.
[0068] In one embodiment of the invention, uptake into cells is
enhanced by administering the antisense compound in combination
with an arginine-rich peptide linked to the 5' or 3' end of the
antisense oligomer. The peptide is typically 8-16 amino acids and
consists of a mixture of arginine, and other amino acids including
phenylalanine and cysteine, as discussed further below.
[0069] RNAse resistance. Two general mechanisms have been proposed
to account for inhibition of expression by antisense
oligonucleotides (Agrawal, Mayrand et al. 1990; Bonham, Brown et
al. 1995; Boudvillain, Guerin et al. 1997). In the first, a
heteroduplex formed between the oligonucleotide and the viral RNA
acts as a substrate for RNaseH, leading to cleavage of the RNA.
Oligonucleotides belonging, or proposed to belong, to this class
include phosphorothioates, phosphotriesters, and phosphodiesters
(unmodified "natural" oligonucleotides). Such compounds expose the
RNA in an oligomer:RNA duplex structure to hydrolysis by RNaseH,
and therefore loss of function.
[0070] A second class of oligonucleotide analogs, termed "steric
blockers" or, alternatively, "RNaseH inactive" or "RNaseH
resistant", have not been observed to act as a substrate for
RNaseH, and act by sterically blocking target RNA nucleocytoplasmic
transport, splicing, translation, or replication. This class
includes methylphosphonates (Toulme, Tinevez et al. 1996),
morpholino oligonucleotides, peptide nucleic acids (PNA's), certain
2'-O-allyl or 2'-O-alkyl modified oligonucleotides (Bonham, Brown
et al. 1995), and N3'.fwdarw.P5' phosphoramidates (Ding, Grayaznov
et al. 1996; Gee, Robbins et al. 1998).
[0071] A test oligomer can be assayed for its RNaseH resistance by
forming an RNA:oligomer duplex with the test compound, then
incubating the duplex with RNaseH under a standard assay
conditions, as described (Stein, Foster et al. 1997). After
exposure to RNaseH, the presence or absence of intact duplex can be
monitored by gel electrophoresis or mass spectrometry.
[0072] In vivo uptake. In accordance with another aspect of the
invention, there is provided a simple, rapid test for confirming
that a given antisense oligomer type provides the required
characteristics noted above, namely, high Tm, ability to be
actively taken up by the host cells, and substantial resistance to
RNaseH. This method is based on the discovery that a properly
designed antisense compound will form a stable heteroduplex with
the complementary portion of the RNA target when administered to a
mammalian subject, and the heteroduplex subsequently appears in the
urine (or other body fluid). Details of this method are also given
in co-owned U.S. Pat. No. 6,365,351 for "Non-Invasive Method for
Detecting Target RNA," the disclosure of which is incorporated
herein by reference.
[0073] Briefly, a test morpholino oligomer having an uncharged
phosphorus-containing backbone to be evaluated, and having a base
sequence targeted against a known myostatin RNA sequence (not
necessarily an expression-sensitive region of the RNA transcript),
is injected into a mammalian subject. Several hours (typically
8-72) after administration, the urine is assayed for the presence
of the antisense-RNA heteroduplex. If heteroduplex is detected, the
backbone is suitable for use in the antisense oligomers of the
present invention.
[0074] The test oligomer may be labeled, e.g. by a fluorescent or a
radioactive tag, to facilitate subsequent analyses, if it is
appropriate for the mammalian subject. The assay can be in any
suitable solid-phase or fluid format. Generally, a solid-phase
assay involves first binding the heteroduplex analyte to a
solid-phase support, e.g., particles or a polymer or test-strip
substrate, and detecting the presence/amount of heteroduplex bound.
In a fluid-phase assay, the analyte sample is typically pretreated
to remove interfering sample components. If the oligomer is
labeled, the presence of the heteroduplex is confirmed by detecting
the label tags. For non-labeled compounds, the heteroduplex may be
detected by immunoassay if in solid phase format or by mass
spectroscopy or other known methods if in solution or suspension
format.
[0075] Structural features. As detailed above, the antisense
oligomer has a base sequence directed to a targeted portion of a
cellular gene, preferably the region at or adjacent the start codon
or a processed transcript or a region at or adjacent a splice site
junction of the myostatin mRNA or preprocessed transcript. In
addition, the oligomer is able to effectively inhibit expression of
the targeted gene when administered to a host cell, e.g. in a
mammalian subject. This requirement is met when the oligomer
compound (a) has the ability to be taken up by muscle cells, and
(b) once taken up, form a duplex with the target RNA with a Tm
greater than about 45.degree. C., preferably greater than
50.degree. C.
[0076] The ability to be taken up selectively by activated immune
cells requires, in part, that the oligomer backbone be
substantially uncharged. The ability of the oligomer to form a
stable duplex with the target RNA will depend on the oligomer
backbone, the length and degree of complementarity of the antisense
oligomer with respect to the target, the ratio of G:C to A:T base
matches, and the positions of any mismatched bases. The ability of
the antisense oligomer to resist cellular nucleases promotes
survival and ultimate delivery of the agent to the cell
cytoplasm.
[0077] Antisense oligonucleotides of 15-20 bases are generally long
enough to have one complementary sequence in the mammalian genome.
In addition, antisense compounds having a length of at least 12,
typically at least 15 nucleotides in length hybridize well with
their target mRNA. Due to their hydrophobicity, antisense
oligonucleotides tend to interact well with phospholipid membranes,
and it has been suggested that following the interaction with the
cellular plasma membrane, oligonucleotides are actively transported
into living cells (Loke, Stein et al. 1989; Yakubov, Deeva et al.
1989; Anderson, Xiong et al. 1999).
[0078] Morpholino oligonucleotides, particularly phosphoramidate-
or phosphorodiamidate-linked morpholino oligonucleotides have been
shown to have high binding affinities for complementary or
near-complementary nucleic acids. Morpholino oligomers also exhibit
little or no non-specific antisense activity, afford good water
solubility, are immune to nucleases, and are designed to have low
production costs (Summerton and Weller 1997).
[0079] Morpholino oligonucleotides (including antisense oligomers)
are detailed, for example, in co-owned U.S. Pat. Nos. 5,698,685,
5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185,444, 5,521,063,
and 5,506,337, all of which are expressly incorporated by reference
herein
[0080] As noted above, the antisense oligomers for use in
practicing the invention are composed of morpholino subunits of the
form shown in the above cited patents, where (i) the morpholino
groups are linked together by uncharged phosphorus-containing
linkages, one to three atoms long, joining the morpholino nitrogen
of one subunit to the 5' exocyclic carbon of an adjacent subunit,
and (ii) the base attached to the morpholino group is a purine or
pyrimidine base-pairing moiety effective to bind, by base-specific
hydrogen bonding, to a base in a polynucleotide. The purine or
pyrimidine base-pairing moiety is typically adenine, cytosine,
guanine, uracil or thymine. Preparation of such oligomers is
described in detail in U.S. Pat. No. 5,185,444 (Summerton et al.,
1993), which is hereby incorporated by reference in its entirety.
As shown in this reference, several types of nonionic linkages may
be used to construct a morpholino backbone.
[0081] Exemplary subunit structures for antisense oligonucleotides
of the invention include the morpholino subunit types shown in
FIGS. 1A-D, each linked by an uncharged, phosphorous-containing
subunit linkage, as shown in FIGS. 2A-2D, respectively. In these
figures, the X moiety pendant from the phosphorous may be any of
the following: fluorine; an alkyl or substituted alkyl; an alkoxy
or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or,
an unsubstituted, monosubstituted, or disubstituted nitrogen,
including cyclic structures. Alkyl, alkoxy and thioalkoxy
preferably include 1-6 carbon atoms, and more preferably 1-4 carbon
atoms. Monosubstituted or disubstituted nitrogen preferably refers
to lower alkyl substitution, and the cyclic structures are
preferably 5- to 7-membered nitrogen heterocycles optionally
containing 1-2 additional heteroatoms selected from oxygen,
nitrogen, and sulfur. Z is sulfur or oxygen, and is preferably
oxygen.
[0082] FIG. 1A shows a phosphorous-containing linkage which forms
the five atom repeating-unit backbone shown in FIG. 2A, where the
morpholino rings are linked by a 1-atom phosphoamide linkage.
Subunit B in FIG. 1B is designed for 6-atom repeating-unit
backbones, as shown in FIG. 2B. In FIG. 1B, the atom Y linking the
5' morpholino carbon to the phosphorous group may be sulfur,
nitrogen, carbon or, preferably, oxygen. The X moiety pendant from
the phosphorous may be any of the following: fluorine; an alkyl or
substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or
substituted thioalkoxy; or, an unsubstituted, monosubstituted, or
disubstituted nitrogen, including cyclic structures. Z is sulfur or
oxygen, and is preferably oxygen. Particularly preferred morpholino
oligonucleotides include those composed of morpholino subunit
structures of the form shown in FIG. 2B, where X is an amine or
alkyl amine of the form X.dbd.NR2, where R is independently H or
CH3, that is where X.dbd.NH2, X.dbd.NHCH3 or X.dbd.N(CH3)2,
Y.dbd.O, and Z.dbd.O.
[0083] Subunits C-D in FIGS. 1C-D are designed for 7-atom
unit-length backbones as shown for structures in FIGS. 2C and D. In
Structure C, the X moiety is as in Structure B, and the moiety Y
may be methylene, sulfur, or preferably oxygen. In Structure D, the
X and Y moieties are as in Structure B. In all subunits depicted in
FIGS. 1 and 2, each Pi and Pj is a purine or pyrimidine
base-pairing moiety effective to bind, by base-specific hydrogen
bonding, to a base in a polynucleotide, and is preferably selected
from adenine, cytosine, guanine and uracil.
[0084] As noted above, the substantially uncharged oligomer may
advantageously include a limited number of charged linkages, e.g.
up to about 1 per every 5 uncharged linkages. In the case of the
morpholino oligomers, such a charged linkage may be a linkage as
represented by any of FIGS. 2A-D, preferably FIG. 2B, where X is
oxide (--O--) or sulfide (--S--).
[0085] Also shown is a cationic linkage in FIG. 2F wherein the
nitrogen pendant to the phosphate atom in the linkage of FIG. 2E is
replaced with a 1-piperazino structure. The method for synthesizing
the 1-piperazino group linkages is described below with respect to
FIG. 3.
[0086] Preferred Antisense Targets. In the method and composition
of the invention, the antisense oligomer is designed to hybridize
to an expression-sensitive region of the myostatin nucleic acid
sequence, under physiological conditions with a Tm substantially
greater than 37.degree. C., e.g., at least 50.degree. C. and
preferably 60.degree. C. to 80.degree. C. The antisense compound is
designed to have high-binding affinity to the nucleic acid and may
be 100% complementary to the myostatin target sequence or may
include mismatches, e.g., to accommodate allelic variants, as long
as the heteroduplex formed between the oligomer and myostatin
target sequence is sufficiently stable to withstand the action of
cellular nucleases and other modes of degradation during its
transit from cell to body fluid. Mismatches, if present, are less
destabilizing toward the end regions of the hybrid duplex than in
the middle. The number of mismatches allowed will depend on the
length of the oligomer, the percentage of G:C base pair in the
duplex and the position of the mismatch(es) in the duplex,
according to well understood principles of duplex stability.
[0087] Although such an antisense oligomer is not necessarily 100%
complementary to the myostatin target sequence, it is effective to
stably and specifically bind to the target sequence such that
expression of myostatin is modulated. The appropriate length of the
oligomer to allow stable, effective binding combined with good
specificity is about 840 nucleotide base units, and preferably
about 12-25 nucleotides. Oligomer bases that allow degenerate base
pairing with target bases are also contemplated, assuming base-pair
specificity with the target is maintained.
[0088] In one preferred approach, the target for modulation of gene
expression using the antisense methods of the present invention
comprises a sequence spanning or adjacent to the mRNA translational
start codon for myostatin. In an alternative preferred approach, a
splice acceptor or donor region of preprocessed myostatin mRNA is
targeted. It will be understood that other regions of myostatin
mRNA may be targeted, including one or more of, an initiator or
promoter site, an intron or exon junction site, a 3'-untranslated
region, and a 5'-untranslated region. It will be further understood
that both spliced and unspliced RNA may serve as the template for
design of antisense oligomers for use in the methods of the
invention (See, e.g., Hudziak, Summerton et al. 2000).
[0089] Table 1 below lists exemplary target regions in the human
myostatin gene (SEQ ID NOS:10-14). The translational start site
target (MSTN-AUG) covers a region from -28 to +24 relative to the A
residue of the ATG start codon (shown in bold). The Nucleotide
Region (Nct. Region) is relative to a human bacterial artificial
chromosome sequence (GenBank Accession No. AC073120) that contains
the myostatin gene. For the splice donor (SD) and splice acceptor
(SA) targets the splice site is indicated within the sequence with
"I". The specific target regions for the antisense oligomers listed
in Table 2 are contained within the target sequences shown in Table
1 and are exemplary. It is fully anticipated that alternative
antisense oligomers that target different sequences within those
shown in Table 1 would function to effectively decrease the
expression of the myostatin gene.
TABLE-US-00001 TABLE 1 Human Myostatin Target Regions SEQ Nct.
Region ID Name Target Sequence (5' to 3') (AC073120) NO MSTN-
GAAAAAAGATTATATTGATTTTAAAA 29692-29743 10 AUG
TCATGCAAAAACTGCAACTCTGTGTT MSTN- ACAATCATTACCATGCCTACAGAGT/
29318-29367 11 SD1 GTAAGTAGTCCTATTAGTGTATATC MSTN-
CTTTTCTTTTCTTATTCATTTATAG/ 27530-27579 12 SA2
CTGATTTTCTAATGCAAGTGGATGG MSTN- CCCAGGACCAGGAGAAGATGGGCTG/
27156-27205 13 SD2 GTAAGTGATAACTGAAAATAACATT MSTN-
TGATTGTTCTTTCCTTTTCAAACAG/ 24733-24782 14 SA3
AATCCGTTTTTAGAGGTCAAGGTAA
[0090] Exemplary antisense oligomers to myostatin and their targets
are provided in Table 2, below. The complement to the myostatin
translational start codon is indicated in bold.
TABLE-US-00002 TABLE 2 Exemplary Myostatin Antisense Oligomers
Antisense Oligomer SEQ (5' to 3') Targeting Target GenBank ID Name
Sequence Ncts. Acc. # NO. MSTN-AUG GAGTTGCAGTTTTTGCATG 133-151
AF104922 1 MSTN-SD1 ACTCTGTAGGCATGGTAATG 487-506 AF104922 2
MSTN-SD2 CAGCCCATCTTCTCCTGG 730-747 AF104922 3 MSTN-SA2
CACTTGCATTAGAAAATCAG 507-526 AF104922 4 MSTN-SA3
CTTGACCTCTAAAAACGGATT 881-901 AF104922 5
[0091] In exemplary embodiments of the invention, the antisense
oligomer is a PMO containing the sequences presented as SEQ ID
NOS:1-5.
[0092] Oligomers as long as 40 bases may be suitable, where at
least a minimum number of bases, e.g., 12 bases, are complementary
to the target sequence. In general, however, facilitated or active
uptake in cells is optimized at oligomer lengths less than about
30, preferably less than 25. For PMO oligomers, described further
below, an optimum balance of binding stability and uptake generally
occurs at lengths of 15-22 bases. The effectiveness of a given
antisense oligomer molecule in forming a heteroduplex with the
target RNA may be determined by screening methods known in the art.
For example, the oligomer is incubated a cell culture expressing
myostatin and the effect on the target RNA is evaluated by
monitoring the presence or absence of (1) heteroduplex formation
with the target sequence and non-target sequences using procedures
known to those of skill in the art, (2) the amount of myostatin
mRNA, as determined by standard techniques such as RT-PCR or
Northern blot, or (3) the amount of myostatin protein, as
determined by standard techniques such as ELISA or immunoblot (e.g.
Western blot).
[0093] The antisense activity of the oligomer may be enhanced by
using a mixture of uncharged and cationic phosphorodiamidate
linkages as shown in FIGS. 2G and 2F. The total number of cationic
linkages in the oligomer can vary from 1 to 10, and be interspersed
throughout the oligomer. Preferably the number of charged linkages
is at least 2 and no more than half the total backbone linkages,
e.g., between 2-8 positively charged linkages, and preferably each
charged linkages is separated along the backbone by at least one,
preferably at least two uncharged linkages. The antisense activity
of various oligomers can be measured in vitro by fusing the
oligomer target region to the 5' end a reporter gene (e.g. firefly
luciferase) and then measuring the inhibition of translation of the
fusion gene mRNA transcripts in cell free translation assays. The
inhibitory properties of oligomers containing a mixture of
uncharged and cationic linkages can be enhanced between,
approximately, five to 100 fold in cell free translation
assays.
III. Treatment of Muscle Wasting
[0094] The invention provides methods for treatment of muscle
wasting with an antisense oligonucleotide directed against a
nucleic acid sequence encoding myostatin, and is based on the
discovery that a stable, substantially uncharged phosphorus-linked
morpholino antisense compound, characterized by high Tm, capable of
active or facilitated transport into cells, and capable of binding
with high affinity to a complementary or near-complementary
myostatin nucleic acid sequence, can be administered to a human
subject or patient and inhibit expression of myostatin by muscle
cells resulting in increased of muscle growth.
[0095] In vivo administration of a myostatin antisense oligomer to
a subject using the methods described herein can result in an
improved muscle mass for the patient, with the extent improvement
dependent upon dose and frequency of myostatin antisense oligomer
administration and the general condition of the subject.
[0096] In preferred applications of the method the subject is a
human patient diagnosed as having degenerated or reduced muscle
mass secondary to a primary indication or disease state such as
cancer, acquired immune deficiency syndrome (AIDS) or muscular
dystrophy. The patient may also be one who does not have a muscle
wasting disease but be in need of maintaining or increasing muscle
mass and tone to offset normal loss of muscle mass as one ages, or
muscle loss due to an extended period of inactivity.
[0097] As a first step in the treatment method, the patient is
tested for myostatin levels, typically using a standard assay for
measuring serum myostatin levels. See, for example, Yarasheski, et
al., Schulte et al., and Kirk, et al. for methods and reagents for
measuring serum myostatin-immunoreactive levels. If the measured
levels are above a selected threshold level for normal average
individuals, and typically more than 10-20% above the selected
threshold, or if the patient otherwise presents with obvious muscle
wasting, the patient is a candidate for the treatment method.
Normal threshold values may be determined for normal healthy
individuals within a certain gender and/or age bracket, e.g., men
in the 20-35 years old age group, but more typically, values for
normal patients in the same category as the test patients are
preferred, except for very elderly patients, e.g., above age 70.
Alternatively, levels of myostatin transcript may be determined
using the heteroduplex detection method described below.
[0098] In another embodiment, the treatment is applied to patients
who are likely candidates for loss of muscle, e.g., those who are
subject to extended periods of inactivity, even though measured
levels of myostatin may be within a normal range.
Treatment Regimens
[0099] After identifying the patient as a treatment candidate, the
patient is administered an amount of the antisense compound
effective to raise measured myostatin levels over a suitable
response period, e.g., 1-3 days following administration of the
antisense compound.
[0100] In accordance with the invention, effective delivery of an
oligomer antisense to a human subject may include, but is not
limited to, various systemic routes, including oral and parenteral
routes, e.g., intravenous (IV), subcutaneous, intraperitoneal (IP),
and intramuscular; as well as inhalation and transdermal delivery.
It is appreciated that any methods effective to deliver a myostatin
antisense oligomer to into the bloodstream of a subject are also
contemplated. Transdermal delivery of antisense oligomers may be
accomplished by use of a pharmaceutically acceptable carrier
adapted for e.g., topical administration. One example of morpholino
oligomer delivery is described in PCT patent application WO
97/40854, incorporated herein by reference.
[0101] In one preferred embodiment, the oligomer is a
phosphorodiamidate morpholino oligomer (PMO), contained in a
pharmaceutically acceptable carrier, and delivered orally. In a
further aspect of this embodiment, a morpholino myostatin antisense
oligonucleotide is administered at regular intervals for a short
time period, e.g., daily for two weeks or less. However, in some
cases the antisense oligomer is administered intermittently over a
longer period of time.
[0102] Typically, one or more doses of antisense oligomer are
administered, generally at regular intervals for a period of about
one to two weeks. Preferred doses for oral administration are from
about 1 mg oligomer/patient to about 100 mg oligomer/patient (based
on an adult weight of 70 kg). In some cases, doses of greater than
100 mg oligomer/patient may be necessary. For IV administration,
the preferred doses are from about 0.5 mg oligomer/patient to about
10 mg oligomer/patient (based on an adult weight of 70 kg). The
antisense compound is generally administered in an amount
sufficient to result in a peak blood concentration of at least
200-400 nM antisense oligomer. Greater or lesser amounts of
oligonucleotide may be administered as required and maintenance
doses may be lower.
[0103] At regular intervals during the treatment method, e.g., 1-3
days following administration of the antisense compound, the
patient is monitored for changes in myostatin levels, e.g., serum
myostatin-immunoreactive protein. The dose of antisense compound
administered to the patient should be such as to reduce measured
myostatin level over the initially measured level. Typically a
decrease in measured myostatin level of at least 10-20% over
initial levels is desired. If the initial measured levels were
above a selected threshold for normal healthy individuals, the dose
of antisense compound is preferably adjusted to bring the myostatin
level within this normal range, and the treatment is continued, as
needed to maintain myostatin levels within this range. Diagnosis
and monitoring of muscle wasting generally involves monitoring
weight loss due to increased skeletal muscle breakdown (Wallace and
Schwartz 2002). Such methods may be qualitative or
quantitative.
[0104] In some cases, the treatment regimen will include further
intervention such as radiation therapy, immunotherapy and/or
additional chemotherapy. Such treatment may occur prior to, during
or subsequent to administration of the chemotherapeutic agent and
myostatin antisense oligomer.
Materials and Methods
Phosphorodiamidate Morpholino Oligomers
[0105] PMO were synthesized and purified at AVI BioPharma, Inc.
(Corvallis, Oreg.) as previously described (Geller, Deere et al.
2003, Summerton and Weller, 1997), dissolved in water, filtered
through a 0.2 .mu.M membrane (HT Tuffryn.TM., Gelman Sciences,
Inc., Ann Arbor, Mich.), and stored at 4.degree. C. Exemplary
sequences of PMO used are shown in Table 2. The concentration of
PMO was determined spectrophotometrically by measuring the
absorbance at 260 nm and calculating the molarity using the
appropriate extinction coefficient.
[0106] A schematic of a synthetic pathway that can be used to make
morpholino subunits containing a (1 piperazino) phosphinylideneoxy
linkage is shown in FIG. 3; further experimental detail for a
representative synthesis is provided in Materials and Methods,
below. As shown in the Figure, reaction of piperazine and trityl
chloride gave trityl piperazine (1a), which was isolated as the
succinate salt. Reaction with ethyl trifluoroacetate (1b) in the
presence of a weak base (such as diisopropylethylamine or DIEA)
provided 1-trifluoroacetyl-4-trityl piperazine (2), which was
immediately reacted with HCl to provide the salt (3) in good yield.
Introduction of the dichlorophosphoryl moiety was performed with
phosphorus oxychloride in toluene.
[0107] The acid chloride (4) is reacted with morpholino subunits
(moN), which may be prepared as described in U.S. Pat. No.
5,185,444 or in Summerton and Weller, 1997 (cited above), to
provide the activated subunits (5,6,7). Suitable protecting groups
are used for the nucleoside bases, where necessary; for example,
benzoyl for adenine and cytosine, isobutyryl for guanine, and
pivaloylmethyl for inosine. The subunits containing the (1
piperazino) phosphinylideneoxy linkage can be incorporated into the
existing PMO synthesis protocol, as described, for example in
Summerton and Weller (1997), without modification.
[0108] The various embodiments described above can be combined to
provide further embodiments. All of the U.S. patents, U.S. patent
application publications, U.S. patent applications, foreign
patents, foreign patent applications and non-patent publications
referred to in this specification and/or listed in the Application
Data Sheet are incorporated herein by reference, in their entirety.
Aspects of the embodiments can be modified, if necessary to employ
concepts of the various patents, applications and publications to
provide yet further embodiments.
[0109] Although the invention has been described with reference to
particular embodiments and applications, it will be appreciated
that various changes and modifications may be made without
departing from the invention.
Sequence CWU 1
1
14119DNAArtificial Sequencesynthetic antisense oligomer 1gagttgcagt
ttttgcatg 19220DNAArtificial Sequencesynthetic antisense oligomer
2actctgtagg catggtaatg 20318DNAArtificial Sequencesynthetic
antisense oligomer 3cagcccatct tctcctgg 18420DNAArtificial
Sequencesynthetic antisense oligomer 4cacttgcatt agaaaatcag
20521DNAArtificial Sequencesynthetic antisense oligomer 5cttgacctct
aaaaacggat t 2162823DNAHomo sapiens 6agattcactg gtgtggcaag
ttgtctctca gactgtacat gcattaaaat tttgcttggc 60attactcaaa agcaaaagaa
aagtaaaagg aagaaacaag aacaagaaaa aagattatat 120tgattttaaa
atcatgcaaa aactgcaact ctgtgtttat atttacctgt ttatgctgat
180tgttgctggt ccagtggatc taaatgagaa cagtgagcaa aaagaaaatg
tggaaaaaga 240ggggctgtgt aatgcatgta cttggagaca aaacactaaa
tcttcaagaa tagaagccat 300taagatacaa atcctcagta aacttcgtct
ggaaacagct cctaacatca gcaaagatgt 360tataagacaa cttttaccca
aagctcctcc actccgggaa ctgattgatc agtatgatgt 420ccagagggat
gacagcagcg atggctcttt ggaagatgac gattatcacg ctacaacgga
480aacaatcatt accatgccta cagagtctga ttttctaatg caagtggatg
gaaaacccaa 540atgttgcttc tttaaattta gctctaaaat acaatacaat
aaagtagtaa aggcccaact 600atggatatat ttgagacccg tcgagactcc
tacaacagtg tttgtgcaaa tcctgagact 660catcaaacct atgaaagacg
gtacaaggta tactggaatc cgatctctga aacttgacat 720gaacccaggc
actggtattt ggcagagcat tgatgtgaag acagtgttgc aaaattggct
780caaacaacct gaatccaact taggcattga aataaaagct ttagatgaga
atggtcatga 840tcttgctgta accttcccag gaccaggaga agatgggctg
aatccgtttt tagaggtcaa 900ggtaacagac acaccaaaaa gatccagaag
ggattttggt cttgactgtg atgagcactc 960aacagaatca cgatgctgtc
gttaccctct aactgtggat tttgaagctt ttggatggga 1020ttggattatc
gctcctaaaa gatataaggc caattactgc tctggagagt gtgaatttgt
1080atttttacaa aaatatcctc atactcatct ggtacaccaa gcaaacccca
gaggttcagc 1140aggcccttgc tgtactccca caaagatgtc tccaattaat
atgctatatt ttaatggcaa 1200agaacaaata atatatggga aaattccagc
gatggtagta gaccgctgtg ggtgctcatg 1260agatttatat taagcgttca
taacttccta aaacatggaa ggttttcccc tcaacaattt 1320tgaagctgtg
aaattaagta ccacaggcta taggcctaga gtatgctaca gtcacttaag
1380cataagctac agtatgtaaa ctaaaagggg gaatatatgc aatggttggc
atttaaccat 1440ccaaacaaat catacaagaa agttttatga tttccagagt
ttttgagcta gaaggagatc 1500aaattacatt tatgttccta tatattacaa
catcggcgag gaaatgaaag cgattctcct 1560tgagttctga tgaattaaag
gagtatgctt taaagtctat ttctttaaag ttttgtttaa 1620tatttacaga
aaaatccaca tacagtattg gtaaaatgca ggattgttat ataccatcat
1680tcgaatcatc cttaaacact tgaatttata ttgtatggta gtatacttgg
taagataaaa 1740ttccacaaaa atagggatgg tgcagcatat gcaatttcca
ttcctattat aattgacaca 1800gtacattaac aatccatgcc aacggtgcta
atacgatagg ctgaatgtct gaggctacca 1860ggtttatcac ataaaaaaca
ttcagtaaaa tagtaagttt ctcttttctt caggggcatt 1920ttcctacacc
tccaaatgag gaatggattt tctttaatgt aagaagaatc atttttctag
1980aggttggctt tcaattctgt agcatacttg gagaaactgc attatcttaa
aaggcagtca 2040aatggtgttt gtttttatca aaatgtcaaa ataacatact
tggagaagta tgtaattttg 2100tctttggaaa attacaacac tgcctttgca
acactgcagt ttttatggta aaataataga 2160aatgatcgac tctatcaata
ttgtataaaa agactgaaac aatgcattta tataatatgt 2220atacaatatt
gttttgtaaa taagtgtctc cttttttatt tactttggta tatttttaca
2280ctaaggacat ttcaaattaa gtactaaggc acaaagacat gtcatgcatc
acagaaaagc 2340aactacttat atttcagagc aaattagcag attaaatagt
ggtcttaaaa ctccatatgt 2400taatgattag atggttatat tacaatcatt
ttatattttt ttacatgatt aacattcact 2460tatggattca tgatggctgt
ataaagtgaa tttgaaattt caatggttta ctgtcattgt 2520gtttaaatct
caacgttcca ttattttaat acttgcaaaa acattactaa gtataccaaa
2580ataattgact ctattatctg aaatgaagaa taaactgatg ctatctcaac
aataactgtt 2640acttttattt tataatttga taatgaatat atttctgcat
ttatttactt ctgttttgta 2700aattgggatt ttgttaatca aatttattgt
actatgacta aatgaaatta tttcttacat 2760ctaatttgta gaaacagtat
aagttatatt aaagtgtttt cacatttttt tgaaagacaa 2820aaa
2823712PRTArtificial Sequencesynthetic transport protein 7Arg Arg
Arg Arg Arg Arg Arg Arg Arg Phe Phe Cys1 5 10812PRTArtificial
Sequencesynthetic transport protein 8Arg Arg Arg Arg Arg Phe Phe
Arg Arg Arg Arg Cys1 5 10912PRTArtificial Sequencesynthetic
transport protein 9Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg1
5 101052DNAHomo sapiens 10gaaaaaagat tatattgatt ttaaaatcat
gcaaaaactg caactctgtg tt 521150DNAHomo sapiens 11acaatcatta
ccatgcctac agagtgtaag tagtcctatt agtgtatatc 501250DNAHomo sapiens
12cttttctttt cttattcatt tatagctgat tttctaatgc aagtggatgg
501350DNAHomo sapiens 13cccaggacca ggagaagatg ggctggtaag tgataactga
aaataacatt 501450DNAHomo sapiens 14tgattgttct ttccttttca aacagaatcc
gtttttagag gtcaaggtaa 50
* * * * *