U.S. patent application number 14/931667 was filed with the patent office on 2016-09-29 for rna interference suppression of neurodegenerative diseases and methods of use thereof.
This patent application is currently assigned to UNIVERSITY OF IOWA RESEARCH FOUNDATION. The applicant listed for this patent is UNIVERSITY OF IOWA RESEARCH FOUNDATION. Invention is credited to Ryan Boudreau, Beverly L. Davidson, Scott Harper, Qinwen Mao, Henry Paulson, Haibin Xia.
Application Number | 20160281084 14/931667 |
Document ID | / |
Family ID | 46328261 |
Filed Date | 2016-09-29 |
United States Patent
Application |
20160281084 |
Kind Code |
A1 |
Davidson; Beverly L. ; et
al. |
September 29, 2016 |
RNA INTERFERENCE SUPPRESSION OF NEURODEGENERATIVE DISEASES AND
METHODS OF USE THEREOF
Abstract
The present invention is directed to small interfering RNA
molecules (siRNA) targeted against nucleic acid sequence that
encodes huntingtin or ataxin-1, and methods of using these siRNA
molecules.
Inventors: |
Davidson; Beverly L.; (Iowa
City, IA) ; Xia; Haibin; (Iowa City, IA) ;
Mao; Qinwen; (Iowa City, IA) ; Paulson; Henry;
(Iowa City, IA) ; Boudreau; Ryan; (Iowa City,
IA) ; Harper; Scott; (Iowa City, IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF IOWA RESEARCH FOUNDATION |
Iowa City |
IA |
US |
|
|
Assignee: |
UNIVERSITY OF IOWA RESEARCH
FOUNDATION
Iowa City
IA
|
Family ID: |
46328261 |
Appl. No.: |
14/931667 |
Filed: |
November 3, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13920969 |
Jun 18, 2013 |
9260716 |
|
|
14931667 |
|
|
|
|
12963793 |
Dec 9, 2010 |
8481710 |
|
|
13920969 |
|
|
|
|
11597225 |
May 27, 2008 |
|
|
|
PCT/US05/19749 |
Jun 2, 2005 |
|
|
|
12963793 |
|
|
|
|
11048627 |
Jan 31, 2005 |
|
|
|
11597225 |
|
|
|
|
10738642 |
Dec 16, 2003 |
|
|
|
11048627 |
|
|
|
|
10859751 |
Jun 2, 2004 |
|
|
|
10738642 |
|
|
|
|
PCT/US03/16887 |
May 26, 2003 |
|
|
|
10859751 |
|
|
|
|
10430351 |
May 5, 2003 |
|
|
|
PCT/US03/16887 |
|
|
|
|
10322086 |
Dec 17, 2002 |
|
|
|
10430351 |
|
|
|
|
10212322 |
Aug 5, 2002 |
|
|
|
10322086 |
|
|
|
|
PCT/US03/16887 |
May 26, 2003 |
|
|
|
10738642 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/86 20130101;
C12N 2799/025 20130101; C12N 2310/53 20130101; C12N 2310/14
20130101; A61K 38/00 20130101; C12N 2310/531 20130101; C12N 15/113
20130101; Y02A 50/30 20180101; A61K 48/00 20130101; C12N 2799/021
20130101; Y02A 50/465 20180101; A01K 2217/05 20130101; C12N
2310/111 20130101; A61P 25/28 20180101; C12N 2799/022 20130101;
C12N 2750/14143 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 15/86 20060101 C12N015/86 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under grants
NS044494, NS38712, HD44093, DK54759, and NS22920 awarded by the
National Institutes of Health. The Government has certain rights in
the invention.
Claims
1. An isolated RNA duplex comprising a first strand of RNA and a
second strand of RNA, wherein the first strand comprises at least
15 contiguous nucleotides encoded by shSCA1.F10 (SEQ ID NO:102),
shSCA1.F11 (SEQ ID NO:103), SEQ ID NO:59, SEQ ID NO:60, SEQ ID
NO:63, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ
ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82,
SEQ ID NO:84, SEQ ID NO:86, or SEQ ID NO:88, SEQ ID NO:90, SEQ ID
NO:96 through SEQ ID NO:101 or SEQ ID NO:106 through SEQ ID NO:142,
and wherein the second strand is complementary to at least 12
contiguous nucleotides of the first strand.
2. The RNA duplex of claim 1, wherein the duplex is between 15 and
30 base pairs in length.
3. The RNA duplex of claim 1, wherein the duplex is between 19 and
25 base pairs in length.
4. The RNA duplex of claim 1, wherein the first and/or second
strand further comprises an overhang region.
5. The RNA duplex of claim 1, wherein the first and/or second
strand further comprises a 3' overhang region, a 5' overhang
region, or both 3' and 5' overhang regions.
6. The RNA duplex of claim 4, wherein the overhang region is from 1
to 10 nucleotides in length.
7. The RNA duplex of claim 1, wherein the first strand and the
second strand are operably linked by means of an RNA loop strand to
form a hairpin structure comprising a duplex structure and a loop
structure.
8. The RNA duplex of claim 7, wherein the loop structure contains
from 4 to 10 nucleotides.
9. The RNA duplex of claim 7, wherein the loop structure contains
4, 5 or 6 nucleotides.
10. The RNA duplex of claim 7, wherein the loop structure
corresponds to SEQ ID NO:61 or SEQ ID NO:64.
11. An expression cassette comprising a nucleic acid encoding at
least one strand of the RNA duplex of claim 1.
12. The expression cassette of claim 11, further comprising a
promoter.
13. The expression cassette of claim 12, wherein the promoter is a
regulatable promoter.
14. The expression cassette of claim 12, wherein the promoter is a
constitutive promoter.
15. The expression cassette of claim 12, wherein the promoter is a
CMV, RSV, pol II or pol III promoter.
16. The expression cassette of claim 11, wherein the expression
cassette further comprises a polyadenylation signal.
17. The expression cassette of claim 16, wherein the
polyadenylation signal is a synthetic minimal polyadenylation
signal.
18. The expression cassette of claim 11, further comprising a
marker gene.
19. A vector comprising the expression cassette of claim 11.
20-25. (canceled)
26. A method of suppressing the accumulation of huntingtin or
ataxin-1 in a cell comprising introducing a ribonucleic acid (RNA)
of claim 1 into the cell in an amount sufficient to suppress
accumulation of huntingtin or ataxin-1 in the cell.
27-61. (canceled)
Description
CLAIM OF PRIORITY
[0001] This patent application is a continuation of U.S. patent
application Ser. No. 13/920,969 filed on Jun. 18, 2013, which is a
continuation application of U.S. Ser. No. 12/963,793 filed on Dec.
9, 2010, which issued as U.S. Pat. No. 8,481,710, which is a
continuation of U.S. application Ser. No. 11/597,225 filed on May
27, 2008, which is a National Stage application under 35 U.S.C.
.sctn.371 and claims benefit under 35 U.S.C. .sctn.119(a) of
International Application No. PCT/US2005/019749 having an
International Filing Date of Jun. 2, 2005, which is a
continuation-in-part application of U.S. application Ser. No.
11/048,627 filed on Jan. 31, 2005, which is a continuation-in-part
application of U.S. application Ser. No. 10/738,642 filed on Dec.
16, 2003, and is a continuation-in-part application of U.S.
application Ser. No. 10/859,751 filed on Jun. 2, 2004, both of
which are continuation-in-part applications of International PCT
Application No. PCT/US03/16887 filed on May 26, 2003, which is a
continuation-in-part of application U.S. application Ser. No.
10/430,351 filed on May 5, 2003, which is a continuation of U.S.
application Ser. No. 10/322,086 filed on Dec. 17, 2002, which is a
continuation-in-part application of U.S. application Ser. No.
10/212,322, filed Aug. 5, 2002. The instant application claims the
benefit of all the listed applications, which are hereby
incorporated by reference herein in their entireties, including the
drawings.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Feb. 27, 2008, is named 17023_081US1_SL.txt and is 52.3 KB in
size.
BACKGROUND OF THE INVENTION
[0004] Double-stranded RNA (dsRNA) can induce sequence-specific
posttranscriptional gene silencing in many organisms by a process
known as RNA interference (RNAi). However, in mammalian cells,
dsRNA that is 30 base pairs or longer can induce
sequence-nonspecific responses that trigger a shut-down of protein
synthesis. RNA fragments are the sequence-specific mediators of
RNAi. Interference of gene expression by these small interfering
RNA (siRNA) is now recognized as a naturally occurring strategy for
silencing genes in C. elegans, Drosophila, plants, and in mouse
embryonic stem cells, oocytes and early embryos.
SUMMARY OF THE INVENTION
[0005] The dominant polyglutamine expansion diseases, which include
Spinocerebellar ataxia type 1 (SCA1) and Huntington's disease (HD),
are progressive, untreatable neurodegenerative disorders. In
inducible mouse models of SCA1 and HD, repression of mutant allele
expression improves disease phenotypes. Thus, therapies designed to
inhibit disease gene expression would be beneficial. In this study,
the ability of RNA interference (RNAi) to inhibit
polyglutamine-induced neurodegeneration caused by mutant ataxin-1
was evaluated in a mouse model of SCA1. Upon intracerebellar
injection, recombinant AAV vectors expressing shRNAs profoundly
improved motor coordination, restored cerebellar morphology, and
resolved characteristic ataxin-1 inclusions in Purkinje cells of
SCA1 mice. The present invention provides methods of using RNAi in
vivo to treat dominant neurodegenerative diseases. "Treating" as
used herein refers to ameliorating at least one symptom of, curing
and/or preventing the development of a disease or a condition.
[0006] In certain embodiment of the invention, siRNAs are employed
to inhibit expression of a target gene. By "inhibit expression" is
meant to reduce, diminish or suppress expression of a target gene.
Expression of a target gene may be inhibited via "gene silencing."
Gene silencing refers to the suppression of gene expression, e.g.,
transgene, heterologous gene and/or endogenous gene expression,
which may be mediated through processes that affect transcription
and/or through processes that affect post-transcriptional
mechanisms. In some embodiments, gene silencing occurs when siRNA
initiates the degradation of the mRNA transcribed from a gene of
interest in a sequence-specific manner via RNA interference,
thereby preventing translation of the gene's product (for a review,
see Brand, 2002).
[0007] The present invention provides an isolated RNA duplex that
has a first strand of RNA and a second strand of RNA, wherein the
first strand has at least 15 contiguous nucleotides encoded by
shSCA1.F10 (SEQ ID NO:102) or shSCA1.F11 (SEQ ID NO:103), and
wherein the second strand is complementary to at least 12
contiguous nucleotides of the first strand. In one embodiment, the
first strand of RNA is encoded by shSCA1.F10 or by shSCA1.F11. As
used herein the term "encoded by" is used in a broad sense, similar
to the term "comprising" in patent terminology. For example, the
statement "the first strand of RNA is encoded by SEQ ID NO:102"
means that the first strand of RNA sequence corresponds to the RNA
sequence transcribed from the DNA sequence indicated in SEQ ID
NO:102, but may also contain additional nucleotides at either the
3' end or at the 5' end of the RNA molecule.
[0008] The present invention also provides an RNA duplex (under
physiological conditions) having a first strand of RNA and a second
strand of RNA, wherein the first strand has at least 15 contiguous
nucleotides encoded by (a) shHDEx2.1 (5'-AAGAAAGAACTTTCAGCTACC-3',
SEQ ID NO:96)), (b) shHDEx2.2 19 nt (5'-AGAACTTTCAGCTACCAAG-3' (SEQ
ID NO:97)), (c) shHDEx2.2 21 nt (5'-AAAGAACTTTCAGCTACCAAG-3' (SEQ
ID NO:98)), (d) shHDEx3.1 19 nt (5'-TGCCTCAACAAAGTTATCA-3' (SEQ ID
NO:99)), or (e) shHDEx3.1 21 nt (5'-AATGCCTCAACAAAGTTATCA-3' (SEQ
ID NO:100)), (f) siEX58#1 (5'-GAGGAAGAGGAGGAGGCCGAC-3' (SEQ ID
NO:101)), or (g) siEX58#2 (5'-AAGAGGAGGAGGCCGACGCCC-3' (SEQ ID
NO:90)) and wherein the second strand is complementary to at least
12 contiguous nucleotides of the first strand. In further
embodiments, the first strand has at least 15 contiguous
nucleotides encoded by SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:63,
SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID
NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82, SEQ
ID NO:84, SEQ ID NO:86, or SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96
through SEQ ID NO:101 or SEQ ID NO:106 through SEQ ID NO:142, and
wherein the second strand is complementary to at least 12
contiguous nucleotides of the first strand. In one embodiment, the
loop structure corresponds to SEQ ID NO:58. In one embodiment, the
first strand corresponds to SEQ ID NO:56 and the second strand
corresponds to SEQ ID NO:57.
[0009] The reference to siRNAs herein is meant to include shRNAs
and other small RNAs that can or are capable of modulating the
expression of HD gene, for example via RNA interference. Such small
RNAs include without limitation, shRNAs and miroRNAs (miRNAs).
[0010] In certain embodiments, the RNA duplex described above is
between 15 and 30 base pairs in length, such as 19 or 21 base pairs
in length. In certain embodiments, the first and/or second strand
further comprises an overhang, such as a 3' overhang region, a 5'
overhang region, or both 3' and 5' overhang regions. The two
strands of RNA in the siRNA may be completely complementary, or one
or the other of the strands may have an "overhang region" (i.e., a
portion of the RNA that does not bind with the second strand). Such
an overhang region may be from 1 to 10 nucleotides in length.
[0011] In certain embodiments, in the RNA duplex described above,
the first strand and the second strand are operably linked by means
of an RNA loop strand to form a hairpin structure to form a duplex
structure and a loop structure. In certain embodiments, the loop
structure contains from 4 to 10 nucleotides, such as 4, 5 or 6
nucleotides. In certain embodiments, the loop structure corresponds
to SEQ ID NO:61 or SEQ ID NO:64.
[0012] The present invention further provides expression cassettes
containing a nucleic acid encoding at least one strand of the RNA
duplex described above. The expression cassette may further contain
a promoter, such as a regulatable promoter or a constitutive
promoter. Examples of suitable promoters include a CMV, RSV, pol II
or pol III promoter. The expression cassette may further contain a
polyadenylation signal (such as a synthetic minimal polyadenylation
signal) and/or a marker gene.
[0013] The present invention also provides vectors containing the
expression cassettes described above. Examples of appropriate
vectors include adenoviral, lentiviral, adeno-associated viral
(AAV), poliovirus, HSV, or murine Maloney-based viral vectors. In
one embodiment, the vector is an adenoviral vector. In certain
embodiments, a vector may contain two expression cassettes, a first
expression cassette containing a nucleic acid encoding the first
strand of the RNA duplex and a second expression cassette
containing a nucleic acid encoding the second strand of the RNA
duplex.
[0014] The present invention provides cells (such as a mammalian
cell) containing the expression cassette or vectors described
above. The present invention also provides a non-human mammal
containing the expression cassette or vectors described above.
[0015] The present invention provides a method of suppressing the
accumulation of huntingtin or ataxin-1 in a cell by introducing a
ribonucleic acid (RNA) described above into the cell in an amount
sufficient to suppress accumulation of huntingtin or ataxin-1 in
the cell. In certain embodiments, the accumulation of huntingtin or
ataxin-1 is suppressed by at least 10%. The accumulation of
huntingtin or ataxin-1 is suppressed by at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90% 95%, or 99%.
[0016] The present invention provides a method of preventing
cytotoxic effects of mutant huntingtin or ataxin-1 in a cell by
introducing a ribonucleic acid (RNA) described above into the cell
in an amount sufficient to suppress accumulation of huntingtin or
ataxin-1, and wherein the RNA prevents cytotoxic effects of
huntingtin or ataxin-1 in the ocular tissue cell.
[0017] The present invention provides a method to inhibit
expression of a huntingtin or ataxin-1 gene in a cell by
introducing a ribonucleic acid (RNA) described above into the cell
in an amount sufficient to inhibit expression of the huntingtin or
ataxin-1, and wherein the RNA inhibits expression of the huntingtin
or ataxin-1 gene. The huntingtin or ataxin-1 is inhibited by at
least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, or 99%.
[0018] The present invention provides a method to inhibit
expression of a huntingtin or ataxin-1 gene in a mammal (e.g., a
human) by (a) providing a mammal containing a neuronal cell,
wherein the neuronal cell contains the huntingtin or ataxin-1 gene
and the neuronal cell is susceptible to RNA interference, and the
huntingtin or ataxin-1 gene is expressed in the neuronal cell; and
(b) contacting the mammal with a ribonucleic acid (RNA) or a vector
described above, thereby inhibiting expression of the huntingtin or
ataxin-1 gene. In certain embodiments, the accumulation of
huntingtin or ataxin-1 is suppressed by at least 10%. The
huntingtin or ataxin-1 is inhibited by at least 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90% 95%, or 99%. In certain embodiments, the
cell located in vivo in a mammal.
[0019] The present invention provides a viral vector comprising a
promoter and a micro RNA (miRNA) shuttle containing an embedded
siRNA specific for a target sequence. In certain embodiments, the
promoter is an inducible promoter. In certain embodiments, the
vector is an adenoviral, lentiviral, adeno-associated viral (AAV),
poliovirus, HSV, or murine Maloney-based viral vector. In certain
embodiments, the targeted sequence is a sequence associated with a
condition amenable to siRNA therapy, such as a neurodegenerative
disease. An example of neurodegenerative diseases is a
trinucleotide-repeat disease, such as a disease associated with
polyglutamine repeats. These diseases include Huntington's disease
or a spinocerebellar ataxia (SCA). Examples of SCA diseases are
SCA1, SCA2, SCA3, SCA6, SCA7, or SCA17. The target sequence of the
present invention, in certain embodiments, is a sequence encoding
ataxin-1 or huntingtin.
[0020] The present invention provides a method of preventing
cytotoxic effects of neurodegenerative disease in a mammal in need
thereof, by introducing the vector encoding a miRNA described in
the preceding paragraph into a cell in an amount sufficient to
suppress accumulation of a protein associated with the
neurodegenerative disease, and wherein the RNA prevents cytotoxic
effects of neurodegenerative disease.
[0021] The present invention also provides a method to inhibit
expression of a protein associated with the neurodegenerative
disease in a mammal in need thereof, by introducing the vector
encoding a miRNA described above into a cell in an amount
sufficient to inhibit expression of the protein associated with the
neurodegenerative disease, wherein the RNA inhibits expression of
the protein associated with the neurodegenerative disease. The
protein associated with the neurodegenerative disease is inhibited
by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, or
99%.
[0022] This invention relates to compounds, compositions, and
methods useful for modulating Huntington's Disease (also referred
to as huntingtin, htt, or HD) gene expression using short
interfering nucleic acid (siRNA) molecules. This invention also
relates to compounds, compositions, and methods useful for
modulating the expression and activity of other genes involved in
pathways of HD gene expression and/or activity by RNA interference
(RNAi) using small nucleic acid molecules. In particular, the
instant invention features small nucleic acid molecules, such as
short interfering nucleic acid (siRNA), short interfering RNA
(siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short
hairpin RNA (shRNA) molecules and methods used to modulate the
expression HD genes. A siRNA of the instant invention can be
chemically synthesized, expressed from a vector or enzymatically
synthesized.
[0023] In one embodiment, the present invention provides an AAV-1
expressed siRNA comprising an isolated first strand of RNA of 15 to
30 nucleotides in length and an isolated second strand of RNA of 15
to 30 nucleotides in length, wherein the first or second strand
comprises a sequence that is complementary to a nucleotide sequence
encoding a mutant Huntington's Disease protein, wherein at least 12
nucleotides of the first and second strands are complementary to
each other and form a small interfering RNA (siRNA) duplex under
physiological conditions, and wherein the siRNA silences the
expression of the nucleotide sequence encoding the mutant
Huntington's Disease protein in the cell. In one embodiment, the
first or second strand comprises a sequence that is complementary
to both a mutant and wild-type Huntington's disease allele, and the
siRNA silences the expression of the nucleotide sequence encoding
the mutant Huntington's Disease protein and wild-type Huntington's
Disease protein in the cell.
[0024] In one embodiment, the present invention provides an AAV-1
expressed siRNA comprising an isolated first strand of RNA of 15 to
30 nucleotides in length and an isolated second strand of RNA of 15
to 30 nucleotides in length, wherein the first or second strand
comprises a sequence that is complementary to both a nucleotide
sequence encoding a wild-type and mutant Huntington's Disease
protein, wherein at least 12 nucleotides of the first and second
strands are complementary to each other and form a small
interfering RNA (siRNA) duplex under physiological conditions, and
wherein the siRNA silences the expression of the nucleotide
sequence encoding the wild-type and mutant Huntington's Disease
protein in the cell. In one embodiment, an AAV-1 vector of the
invention is a psuedotyped rAAV-1 vector.
[0025] In one embodiment, the present invention provides a
mammalian cell containing an isolated first strand of RNA for
example corresponding to SEQ ID NO:60, SEQ ID NO:63, SEQ ID NO:66,
SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74, SEQ ID
NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ
ID NO:86, or SEQ ID NO:88, and an isolated second strand of RNA of
15 to 30 nucleotides in length, wherein the first strand contains a
sequence that is complementary to a nucleotide sequence encoding a
Huntington's Disease protein (htt), such as wherein at least 12
nucleotides of the first and second strands are complementary to
each other and form a small interfering RNA (siRNA) duplex for
example under physiological conditions, and wherein the siRNA
silences the expression of the Huntington's Disease (HD) gene in
the cell, for example by targeting the cleavage of RNA encoded by
the HD gene or via translational blocking of the HD gene
expression. SEQ ID NO:60 through SEQ ID NO:89 are all represented
herein as DNA sequences. However, as used herein when a claim
indicates an RNA "corresponding to" it is meant the RNA that has
the same sequence as the DNA, except that uracil is substituted for
thymine. For example, SEQ ID NO:61 is 5'-GAAGCTTG-3', and the RNA
corresponding to this sequence is 5'-GAAGCUUG-3' (SEQ ID NO:
58).
[0026] The present invention also provides a mammalian cell
containing an expression cassette encoding an isolated first strand
of RNA corresponding to, for example, SEQ ID NO:56 or SEQ ID NO:57,
and encoding an isolated second strand of RNA of 15 to 30
nucleotides in length, wherein the first or second strand comprises
a sequence that is complementary to a nucleotide sequence encoding
a Huntington's Disease protein (htt), for example wherein at least
12 nucleotides of the first and second strands are complementary to
each other and form a small interfering RNA (siRNA) duplex for
example under physiological conditions, and wherein the siRNA
silences the expression of the Huntington's Disease gene in the
cell, for instance by targeting the cleavage of RNA encoded by the
HD gene or via translational blocking of the HD gene expression.
The expression cassette may further include a promoter, such as a
regulatable promoter or a constitutive promoter. Examples of
suitable promoters include without limitation a pol II promoter
such as cytomegalovirus (CMV), Rous Sarcoma Virus (RSV), pol III
promoters such as U6, and any other pol II or pol III promoter as
is known in the art. The expression cassette may further optionally
include a marker gene, such as a stuffer fragment comprising a
marker gene. The expression cassette may be contained in a vector,
such as an adenoviral, lentiviral, adeno-associated viral (AAV),
poliovirus, HSV, or murine Maloney-based viral vector. In one
embodiment, the first strand corresponds to SEQ ID NO:56 and the
second strand corresponds to SEQ ID NO:57.
[0027] The present invention provides a small interfering RNA
(siRNA) containing a first strand of RNA corresponding to for
example SEQ ID NO:56 or SEQ ID NO:57, and a second strand of RNA of
15 to 30 nucleotides in length, wherein the first or second strand
comprises a sequence that is complementary to a nucleotide sequence
encoding a Huntington's Disease protein (htt), for example wherein
at least 12 nucleotides of the first and second strands are
complementary to each other and form an siRNA duplex under
physiological conditions, wherein the duplex is between 15 and 30
base pairs in length, and wherein the siRNA silences the expression
of the Huntington's Disease gene in the cell, for instance via RNA
interference.
[0028] The present invention provides a method of performing
Huntington's Disease gene silencing in a mammal by administering to
the mammal an expression cassette encoding an isolated first strand
of RNA corresponding to for example SEQ ID NO:56 or SEQ ID NO:57,
and encoding an isolated second strand of RNA of 15 to 30
nucleotides in length, wherein the first or second strand comprises
a sequence that is complementary to a nucleotide sequence encoding
a Huntington's Disease protein (htt), for example wherein at least
12 nucleotides of the first and second strands are complementary to
each other and form a small interfering RNA (siRNA) duplex under
physiological conditions, and wherein the expression of the siRNA
from the expression cassette silences the expression of the
Huntington's Disease gene in the mammal, for instance via RNA
interference.
[0029] The present invention provides an isolated RNA comprising
for example SEQ ID NO:59 that functions in RNA interference to a
sequence encoding a mutant Huntington's Disease protein (htt).
[0030] The present invention provides an isolated RNA duplex
comprising a first strand of RNA corresponding to for example SEQ
ID NO:56 and a second strand of RNA corresponding to for example by
SEQ ID NO:57. The first and/or second strand optionally further
include a 3' overhang region, a 5' overhang region, or both 3' and
5' overhang regions, and the overhang region (or regions) can be
from 1 to 10 nucleotides in length. Further, the first strand and
the second strand can be operably linked by means of an RNA loop
strand to form a hairpin structure comprising a duplex structure
and a loop structure. This loop structure, if present may be from 4
to 10 nucleotides. In one embodiment, the loop structure
corresponds to SEQ ID NO:58 or a portion thereof.
[0031] The present invention provides a vector, such as an AAV
vector, comprising two expression cassettes, a first expression
cassette comprising a nucleic acid encoding the first strand of the
RNA duplex corresponding to for example SEQ ID NO:56 and a second
expression cassette comprising a nucleic acid encoding the second
strand of the RNA duplex corresponding to for example SEQ ID NO:57.
The present invention also provides a cell containing this vector.
In one embodiment, the cell is a mammalian cell.
[0032] The present invention provides a mammalian cell containing
an isolated first strand of RNA of 15 to 30 nucleotides in length,
and an isolated second strand of RNA of 15 to 30 nucleotides in
length, wherein the first strand contains a sequence that is
complementary to for example at least 15 nucleotides of RNA encoded
by a targeted gene of interest (for example the HD gene), wherein
for example at least 12 nucleotides of the first and second strands
are complementary to each other and form a small interfering RNA
(siRNA) duplex for example under physiological conditions, and
wherein the siRNA silences (for example via RNA interference) only
one allele of the targeted gene (for example the mutant allele of
HD gene) in the cell. The duplex of the siRNA may be between 15 and
30 base pairs in length. The two strands of RNA in the siRNA may be
completely complementary, or one or the other of the strands may
have an "overhang region" or a "bulge region" (i.e., a portion of
the RNA that does not bind with the second strand or where a
portion of the RNA sequence is not complementary to the sequence of
the other strand). These overhangs may be at the 3' end or at the
5' region, or at both 3' and 5' ends. Such overhang regions may be
from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) or more
nucleotides in length. The bulge regions may be at the ends or in
the internal regions of the siRNA duplex. Such bulge regions may be
from 1-5 (e.g., 1, 2, 3, 4, 5) or more nucleotides long. Such bulge
regions may be the bulge regions characteristics of miRNAs. In the
present invention, the first and second strand of RNA may be
operably linked together by means of an RNA loop strand to form a
hairpin structure to form a "duplex structure" and a "loop
structure." These loop structures may be from 4 to 10 (e.g., 4, 5,
6, 7, 8, 9, 10) or more nucleotides in length. For example, the
loop structure may be 4, 5 or 6 nucleotides long.
[0033] The present invention also provides a mammalian cell that
contains an expression cassette encoding an isolated first strand
of RNA of 15 to 30 nucleotides in length, and an isolated second
strand of RNA of 15 to 30 nucleotides in length, wherein the first
strand contains a sequence that is complementary to for example at
least 15 contiguous nucleotides of RNA encoded by a targeted gene
of interest (for example the HD gene), wherein for example at least
12 nucleotides of the first and second strands are complementary to
each other and form a small interfering RNA (siRNA) duplex, for
example under physiological conditions, and wherein the siRNA
silences (for example via RNA interference) only one allele of the
targeted gene (for example the mutant allele of HD gene) in the
cell. These expression cassettes may further contain a promoter.
Such promoters can be regulatable promoters or constitutive
promoters. Examples of suitable promoters include a CMV, RSV, pol
II or pol III promoter. The expression cassette may further contain
a polyadenylation signal, such as a synthetic minimal
polyadenylation signal. The expression cassette may further contain
a marker gene. The expression cassette may be contained in a
vector. Examples of appropriate vectors include adenoviral,
lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or
murine Maloney-based viral vectors. In one embodiment, the vector
is an adenoviral vector or an adeno-associated viral vector.
[0034] In the present invention, the alleles of the targeted gene
may differ by seven or fewer nucleotides (e.g., 7, 6, 5, 4, 3, 2 or
1 nucleotides). For example the alleles may differ by only one
nucleotide. Examples of targeted gene transcripts include
transcripts encoding a beta-glucuronidase, TorsinA, Ataxin-3, Tau,
or huntingtin. The targeted genes and gene products (i.e., a
transcript or protein) may be from different species of organisms,
such as a mouse allele or a human allele of a target gene.
[0035] The present invention also provides an isolated RNA duplex
containing a first strand of RNA and a second strand of RNA,
wherein the first strand contains for example at least 15
nucleotides complementary to mutant TorsinA represented for example
by SEQ ID NO:55 (5'-GTAAGCAGAGTGGCTGAGATGACATTTTTCCCCAAAGAG-3'),
and wherein the second strand is complementary to for example at
least 12 contiguous nucleotides of the first strand. In one
embodiment of the invention (mutA-si), the first strand of RNA
corresponds to for example SEQ ID NO:49 and the second strand of
RNA corresponds to for example SEQ ID NO:50. In an alternative
embodiment (mutB-si), the first strand of RNA corresponds to for
example SEQ ID NO:51 and the second strand of RNA corresponds to
for example SEQ ID NO:52. In another embodiment (mutC-si), the
first strand of RNA corresponds to for example SEQ ID NO:53 and
second strand of RNA corresponds to for example SEQ ID NO:54. As
used herein the term "encoded by" means that the DNA sequence is
transcribed into the RNA of interest. This term is used in a broad
sense, similar to the term "comprising" in patent terminology. For
example, the statement "the first strand of RNA is encoded by SEQ
ID NO:49" means that the first strand of RNA sequence corresponds
to the DNA sequence indicated in SEQ ID NO:49, but may also contain
additional nucleotides at either the 3' end or at the 5' end of the
RNA molecule.
[0036] The present invention further provides an RNA duplex
containing a first strand of RNA and a second strand of RNA,
wherein the first strand contains for example at least 15
contiguous nucleotides complementary to mutant Ataxin-3 transcript
encoded by SEQ ID NO:8, and wherein the second strand is
complementary to for example at least 12 contiguous nucleotides of
the first strand. In one embodiment (siC7/8), the first strand of
RNA is encoded by SEQ ID NO:19 and the second strand of RNA is
encoded by SEQ ID NO: 20. In another embodiment (siC10), the first
strand of RNA is encoded by SEQ ID NO:21 and the second strand of
RNA is encoded by SEQ ID NO:22.
[0037] The present invention further provides an RNA duplex
containing a first strand of RNA and a second strand of RNA,
wherein the first strand contains for example at least 15
contiguous nucleotides complementary to mutant Tau transcript for
example encoded by SEQ ID NO:39 (siA9/C12), and wherein the second
strand is complementary to at least 12 contiguous nucleotides of
the first strand. The second strand may be encoded for example by
SEQ ID NO:40.
[0038] The RNA duplexes of the present invention are between 15 and
30 base pairs in length. For example they may be between 19 and 25
base pairs in length or 19-27 base-pairs in length. As discussed
above the first and/or second strand further may optionally
comprise an overhang region. These overhangs may be at the 3' end
or at the 5' overhang region, or at both 3' and 5' ends. Such
overhang regions may be from 1 to 10 nucleotides in length. The RNA
duplex of the present invention may optionally include nucleotide
bulge regions. The bulge regions may be at the ends or in the
internal regions of the siRNA duplex. Such bulge regions may be
from 1-5 nucleotides long. Such bulge regions may be the bulge
regions characteristics of miRNAs. In the present invention, the
first and second strand of RNA may be operably linked together by
means of an RNA loop strand to form a hairpin structure to form a
"duplex structure" and a "loop structure." These loop structures
may be from 4 to 10 nucleotides in length. For example, the loop
structure may be 4, 5 or 6 nucleotides long.
[0039] In the present invention, an expression cassette may contain
a nucleic acid encoding at least one strand of the RNA duplex
described above. Such an expression cassette may further contain a
promoter. The expression cassette may be contained in a vector.
These cassettes and vectors may be contained in a cell, such as a
mammalian cell. A non-human mammal may contain the cassette or
vector. The vector may contain two expression cassettes, the first
expression cassette containing a nucleic acid encoding the first
strand of the RNA duplex, and a second expression cassette
containing a nucleic acid encoding the second strand of the RNA
duplex.
[0040] In one embodiment, the present invention further provides a
method of performing gene silencing in a mammal or mammalian cell
by administering to the mammal an isolated first strand of RNA of
about 15 to about 30 nucleotides (for example 19-27 nucleotides) in
length, and an isolated second strand of RNA of 15 to 30
nucleotides (for example 19-27 nucleotides) in length, wherein the
first strand contains for example at least 15 contiguous
nucleotides complementary to a targeted gene of interest (such as
HD gene), wherein for example at least 12 nucleotides of the first
and second strands are complementary to each other and form a small
interfering RNA (siRNA) duplex for example under physiological
conditions, and wherein the siRNA silences only one or both alleles
of the targeted gene (for example the wild type and mutant alleles
of HD gene) in the mammal or mammalian cell. In one example, the
gene is a beta-glucuronidase gene. The alleles may be
murine-specific and human-specific alleles of beta-glucuronidase.
Examples of gene transcripts include an RNA transcript
complementary to TorsinA, Ataxin-3, huntingtin or Tau. The targeted
gene may be a gene associated with a condition amenable to siRNA
therapy. For example, the condition amenable to siRNA therapy could
be a disabling neurological disorder.
[0041] "Neurological disease" and "neurological disorder" refer to
both hereditary and sporadic conditions that are characterized by
nervous system dysfunction, and which may be associated with
atrophy of the affected central or peripheral nervous system
structures, or loss of function without atrophy. A neurological
disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not
limited to, amyotrophic lateral sclerosis (ALS), hereditary spastic
hemiplegia, primary lateral sclerosis, spinal muscular atrophy,
Kennedy's disease, Alzheimer's disease, Parkinson's disease,
multiple sclerosis, and repeat expansion neurodegenerative
diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat
diseases, e.g., Huntington's disease (HD), spinocerebellar ataxia
(SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17), spinal and bulbar
muscular atrophy (SBMA), dentatorubropallidoluysian atrophy
(DRPLA). An example of a disabling neurological disorder that does
not appear to result in atrophy is DYT1 dystonia. The gene of
interest may encode a ligand for a chemokine involved in the
migration of a cancer cell, or a chemokine receptor.
[0042] The present invention further provides a method of
substantially silencing a target gene of interest or targeted
allele for the gene of interest in order to provide a therapeutic
effect. As used herein the term "substantially silencing" or
"substantially silenced" refers to decreasing, reducing, or
inhibiting the expression of the target gene or target allele by at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85% to 100%. As used herein the term
"therapeutic effect" refers to a change in the associated
abnormalities of the disease state, including pathological and
behavioral deficits; a change in the time to progression of the
disease state; a reduction, lessening, or alteration of a symptom
of the disease; or an improvement in the quality of life of the
person afflicted with the disease. Therapeutic effect can be
measured quantitatively by a physician or qualitatively by a
patient afflicted with the disease state targeted by the siRNA. In
certain embodiments wherein both the mutant and wild type allele
are substantially silenced, the term therapeutic effect defines a
condition in which silencing of the wild type allele's expression
does not have a deleterious or harmful effect on normal functions
such that the patient would not have a therapeutic effect.
[0043] In one embodiment, the present invention further provides a
method of performing allele-specific gene silencing in a mammal by
administering to the mammal an isolated first strand of RNA of 15
to 30 nucleotides in length, and an isolated second strand of RNA
of 15 to 30 nucleotides in length, wherein the first strand
contains for example at least 15 contiguous nucleotides
complementary to a targeted gene of interest, wherein for example
at least 12 nucleotides of the first and second strands are
complementary to each other and form a small interfering RNA
(siRNA) duplex for example under physiological conditions, and
wherein the siRNA silences only one allele of the targeted gene in
the mammal. The alleles of the gene may differ by seven or fewer
base pairs, such as by only one base pair. In one example, the gene
is a beta-glucuronidase gene. The alleles may be murine-specific
and human-specific alleles of beta-glucuronidase. Examples of gene
transcripts include an RNA transcript complementary to TorsinA,
Ataxin-3, huntingtin or Tau. The targeted gene may be a gene
associated with a condition amenable to siRNA therapy. For example,
the condition amenable to siRNA therapy could be a disabling
neurological disorder.
[0044] "Neurological disease" and "neurological disorder" refer to
both hereditary and sporadic conditions that are characterized by
nervous system dysfunction, and which may be associated with
atrophy of the affected central or peripheral nervous system
structures, or loss of function without atrophy. A neurological
disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not
limited to, amyotrophic lateral sclerosis (ALS), hereditary spastic
hemiplegia, primary lateral sclerosis, spinal muscular atrophy,
Kennedy's disease, Alzheimer's disease, Parkinson's disease,
multiple sclerosis, and repeat expansion neurodegenerative
diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat
diseases, e.g., Huntington's disease (HD), spinocerebellar ataxia
(SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17), spinal and bulbar
muscular atrophy (SBMA), dentatorubropallidoluysian atrophy
(DRPLA). An example of a disabling neurological disorder that does
not appear to result in atrophy is DYT1 dystonia. The gene of
interest may encode a ligand for a chemokine involved in the
migration of a cancer cell, or a chemokine receptor.
[0045] In one embodiment, the present invention further provides a
method of substantially silencing both alleles (e.g., both mutant
and wild type alleles) of a target gene. In certain embodiments,
the targeting of both alleles of a gene target of interest can
confer a therapeutic effect by allowing a certain level of
continued expression of the wild-type allele while at the same time
inhibiting expression of the mutant (e.g., disease associated)
allele at a level that provides a therapeutic effect. For example,
a therapeutic effect can be achieved by conferring on the cell the
ability to express siRNA as an expression cassette, wherein the
expression cassette contains a nucleic acid encoding a small
interfering RNA molecule (siRNA) targeted against both alleles, and
wherein the expression of the targeted alleles are silenced at a
level that inhibits, reduces, or prevents the deleterious gain of
function conferred by the mutant allele, but that still allows for
adequate expression of the wild type allele at a level that
maintains the function of the wild type allele. Examples of such
wild type and mutant alleles include without limitation those
associated with polyglutamine diseases such as Huntington's
Disease.
[0046] In one embodiment, the present invention further provides a
method of substantially silencing a target allele while allowing
expression of a wild-type allele by conferring on the cell the
ability to express siRNA as an expression cassette, wherein the
expression cassette contains a nucleic acid encoding a small
interfering RNA molecule (siRNA) targeted against a target allele,
wherein expression from the targeted allele is substantially
silenced but wherein expression of the wild-type allele is not
substantially silenced.
[0047] In one embodiment, the present invention provides a method
of treating a dominantly inherited disease in an allele-specific
manner by administering to a patient in need thereof an expression
cassette, wherein the expression cassette contains a nucleic acid
encoding a small interfering RNA molecule (siRNA) targeted against
a target allele, wherein expression from the target allele is
substantially silenced but wherein expression of the wild-type
allele is not substantially silenced.
[0048] In one embodiment, the present invention provides a method
of treating a dominantly inherited disease by administering to a
patient in need thereof an expression cassette, wherein the
expression cassette contains a nucleic acid encoding a small
interfering RNA molecule (siRNA) targeted against both the mutant
allele and the wild type allele of the target gene, wherein
expression from the mutant allele is substantially silenced at a
level that still allows for expression from the wild type allele to
maintain its function in the patient.
[0049] In one embodiment, the present invention also provides a
method of performing allele-specific gene silencing by
administering an expression cassette containing a pol II promoter
operably-linked to a nucleic acid encoding at least one strand of a
small interfering RNA molecule (siRNA) targeted against a gene of
interest, wherein the siRNA silences only one allele of a gene.
[0050] In one embodiment, the present invention also provides a
method of performing gene silencing by administering an expression
cassette containing a pol II promoter operably-linked to a nucleic
acid encoding at least one strand of a small interfering RNA
molecule (siRNA) targeted against a gene of interest, wherein the
siRNA silences one or both alleles of the gene.
[0051] In one embodiment, the present invention provides a method
of performing allele-specific gene silencing in a mammal by
administering to the mammal a vector containing an expression
cassette, wherein the expression cassette contains a nucleic acid
encoding at least one strand of a small interfering RNA molecule
(siRNA) targeted against a gene of interest, wherein the siRNA
silences only one allele of a gene.
[0052] In one embodiment, the present invention provides a method
of performing gene silencing in a mammal by administering to the
mammal a vector containing an expression cassette, wherein the
expression cassette contains a nucleic acid encoding at least one
strand of a small interfering RNA molecule (siRNA) targeted against
a gene of interest, wherein the siRNA silences one or both alleles
of the gene.
[0053] In one embodiment, the present invention provides a method
of screening of allele-specific siRNA duplexes, involving
contacting a cell containing a predetermined mutant allele with an
siRNA with a known sequence, contacting a cell containing a
wild-type allele with an siRNA with a known sequence, and
determining if the mutant allele is substantially silenced while
the wild-type allele retains substantially normal activity.
[0054] In one embodiment, the present invention provides a method
of screening of specific siRNA duplexes, involving contacting a
cell containing both a predetermined mutant allele and a
predetermined wild-type allele with an siRNA with a known sequence,
and determining if the mutant allele is substantially silenced at a
level that allows the wild-type allele to retain substantially
normal activity.
[0055] In one embodiment, the present invention also provides a
method of screening of allele-specific siRNA duplexes involving
contacting a cell containing a predetermined mutant allele and a
wild-type allele with an siRNA with a known sequence, and
determining if the mutant allele is substantially silenced while
the wild-type allele retains substantially normal activity.
[0056] In one embodiment, the present invention also provides a
method for determining the function of an allele by contacting a
cell containing a predetermined allele with an siRNA with a known
sequence, and determining if the function of the allele is
substantially modified.
[0057] In one embodiment, the present invention further provides a
method for determining the function of an allele by contacting a
cell containing a predetermined mutant allele and a wild-type
allele with an siRNA with a known sequence, and determining if the
function of the allele is substantially modified while the
wild-type allele retains substantially normal function.
[0058] In one embodiment, the invention features a method for
treating or preventing Huntington's Disease in a subject or
organism comprising contacting the subject or organism with a siRNA
of the invention under conditions suitable to modulate the
expression of the HD gene in the subject or organism whereby the
treatment or prevention of Huntington's Disease can be achieved. In
one embodiment, the HD gene target comprises a mutant HD allele
(e.g., an allele comprising a trinucleotide (CAG) repeat
expansion). In one embodiment, the HD gene target comprises both HD
allele (e.g., an allele comprising a trinucleotide (CAG) repeat
expansion and a wild type allele). The siRNA molecule of the
invention can be expressed from vectors as described herein or
otherwise known in the art to target appropriate tissues or cells
in the subject or organism.
[0059] In one embodiment, the invention features a method for
treating or preventing Huntington's Disease in a subject or
organism comprising, contacting the subject or organism with a
siRNA molecule of the invention via local administration to
relevant tissues or cells, such as brain cells and tissues (e.g.,
basal ganglia, striatum, or cortex), for example, by administration
of vectors or expression cassettes of the invention that provide
siRNA molecules of the invention to relevant cells (e.g., basal
ganglia, striatum, or cortex). In one embodiment, the siRNA,
vector, or expression cassette is administered to the subject or
organism by stereotactic or convection enhanced delivery to the
brain. For example, U.S. Pat. No. 5,720,720 provides methods and
devices useful for stereotactic and convection enhanced delivery of
reagents to the brain. Such methods and devices can be readily used
for the delivery of siRNAs, vectors, or expression cassettes of the
invention to a subject or organism, and is incorporated by
reference herein in its entirety. US Patent Application Nos.
2002/0141980; 2002/0114780; and 2002/0187127 all provide methods
and devices useful for stereotactic and convection enhanced
delivery of reagents that can be readily adapted for delivery of
siRNAs, vectors, or expression cassettes of the invention to a
subject or organism, and are incorporated by reference herein in
their entirety. Particular devices that may be useful in delivering
siRNAs, vectors, or expression cassettes of the invention to a
subject or organism are for example described in US Patent
Application No. 2004/0162255, which is incorporated by reference
herein in its entirety. The siRNA molecule of the invention can be
expressed from vectors as described herein or otherwise known in
the art to target appropriate tissues or cells in the subject or
organism.
[0060] In one embodiment, a viral vector of the invention is an AAV
vector. An "AAV" vector refers to an adeno-associated virus, and
may be used to refer to the naturally occurring wild-type virus
itself or derivatives thereof. The term covers all subtypes,
serotypes and pseudotypes, and both naturally occurring and
recombinant forms, except where required otherwise. As used herein,
the term "serotype" refers to an AAV which is identified by and
distinguished from other AAVs based on capsid protein reactivity
with defined antisera, e.g., there are eight known serotypes of
primate AAVs, AAV-1 to AAV-8. For example, serotype AAV-2 is used
to refer to an AAV which contains capsid proteins encoded from the
cap gene of AAV-2 and a genome containing 5' and 3' ITR sequences
from the same AAV-2 serotype. Pseudotyped AAV refers to an AAV that
contains capsid proteins from one serotype and a viral genome
including 5'-3' ITRs of a second serotype. Pseudotyped rAAV would
be expected to have cell surface binding properties of the capsid
serotype and genetic properties consistent with the ITR serotype.
Pseudotyped rAAV are produced using standard techniques described
in the art. As used herein, for example, rAAV1 may be used to refer
an AAV having both capsid proteins and 5'-3' ITRs from the same
serotype or it may refer to an AAV having capsid proteins from
serotype 1 and 5'-3' ITRs from a different AAV serotype, e.g., AAV
serotype 2. For each example illustrated herein the description of
the vector design and production describes the serotype of the
capsid and 5'-3' ITR sequences. The abbreviation "rAAV" refers to
recombinant adeno-associated virus, also referred to as a
recombinant AAV vector (or "rAAV vector").
[0061] An "AAV virus" or "AAV viral particle" refers to a viral
particle composed of at least one AAV capsid protein (preferably by
all of the capsid proteins of a wild-type AAV) and an encapsidated
polynucleotide. If the particle comprises heterologous
polynucleotide (i.e., a polynucleotide other than a wild-type AAV
genome such as a transgene to be delivered to a mammalian cell), it
is typically referred to as "rAAV".
[0062] In one embodiment, the AAV expression vectors are
constructed using known techniques to at least provide as
operatively linked components in the direction of transcription,
control elements including a transcriptional initiation region, the
DNA of interest and a transcriptional termination region. The
control elements are selected to be functional in a mammalian cell.
The resulting construct which contains the operatively linked
components is flanked (5' and 3') with functional AAV ITR
sequences.
[0063] By "adeno-associated virus inverted terminal repeats" or
"AAV ITRs" is meant the art-recognized regions found at each end of
the AAV genome which function together in cis as origins of DNA
replication and as packaging signals for the virus. AAV ITRs,
together with the AAV rep coding region, provide for the efficient
excision and rescue from, and integration of a nucleotide sequence
interposed between two flanking ITRs into a mammalian cell
genome.
[0064] The nucleotide sequences of AAV ITR regions are known. See
for example Kotin, R. M. (1994) Human Gene Therapy 5:793-801;
Berns, K. I. "Parvoviridae and their Replication" in Fundamental
Virology, 2nd Edition, (B. N. Fields and D. M. Knipe, eds.). As
used herein, an "AAV ITR" need not have the wild-type nucleotide
sequence depicted, but may be altered, e.g., by the insertion,
deletion or substitution of nucleotides. Additionally, the AAV ITR
may be derived from any of several AAV serotypes, including without
limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
Furthermore, 5' and 3' ITRs which flank a selected nucleotide
sequence in an AAV vector need not necessarily be identical or
derived from the same AAV serotype or isolate, so long as they
function as intended, i.e., to allow for excision and rescue of the
sequence of interest from a host cell genome or vector, and to
allow integration of the heterologous sequence into the recipient
cell genome when AAV Rep gene products are present in the cell.
[0065] In one embodiment, AAV ITRs can be derived from any of
several AAV serotypes, including without limitation, AAV-1, AAV-2,
AAV-3, AAV-4, AAV-5, AAVX7, etc. Furthermore, 5' and 3' ITRs which
flank a selected nucleotide sequence in an AAV expression vector
need not necessarily be identical or derived from the same AAV
serotype or isolate, so long as they function as intended, i.e., to
allow for excision and rescue of the sequence of interest from a
host cell genome or vector, and to allow integration of the DNA
molecule into the recipient cell genome when AAV Rep gene products
are present in the cell.
[0066] In one embodiment, AAV capsids can be derived from any of
several AAV serotypes, including without limitation, AAV-1, AAV-2,
AAV-3, AAV-4, AAV-5, AAV6, or AAV8, and the AAV ITRS are derived
form AAV serotype 2. Suitable DNA molecules for use in AAV vectors
will be less than about 5 kilobases (kb), less than about 4.5 kb,
less than about 4 kb, less than about 3.5 kb, less than about 3 kb,
less than about 2.5 kb in size and are known in the art Dong, J.-Y.
et al. (Nov. 10, 1996). "Quantitative Analysis of the Packaging
Capacity of Recombinant Adeno-Associated Virus," Human Gene Ther.
7(17):2101-2112 and U.S. Pat. No. 6,596,535 herein incorporated in
its entirety. In some embodiments of the invention the DNA
molecules for use in the AAV vectors will contain multiple copies
of the identical siRNA sequence. As used herein the term multiple
copies of an siRNA sequences means at least 2 copies, at least 3
copies, at least 4 copies, at least 5 copies, at least 6 copies, at
least 7 copies, at least 8 copies, at least 9 copies, and at least
10 copies. In some embodiments the DNA molecules for use in the AAV
vectors will contain multiple siRNA sequences. As used herein the
term multiple=Si RNA sequences means at least 2 siRNA sequences, at
least 3 siRNA sequences, at least 4 siRNA sequences, at least 5
siRNA sequences, at least 6 siRNA sequences, at least 7 siRNA
sequences, at least 8 siRNA sequences, at least 9 siRNA sequences,
and at least 10 siRNA sequences. In some embodiments suitable DNA
vectors of the invention will contain a sequence encoding the siRNA
molecule of the invention and a stuffer fragment. Suitable stuffer
fragments of the invention include sequences known in the art
including without limitation sequences which do not encode an
expressed protein molecule; sequences which encode a normal
cellular protein which would not have deleterious effect on the
cell types in which it was expressed; and sequences which would not
themselves encode a functional siRNA duplex molecule.
[0067] In one embodiment, suitable DNA molecules for use in AAV
vectors will be less than about 5 kilobases (kb) in size and will
include, for example, a stuffer sequence and a sequence encoding a
siRNA molecule of the invention. For example, in order to prevent
any packaging of AAV genomic sequences containing the rep and cap
genes, a plasmid containing the rep and cap DNA fragment may be
modified by the inclusion of a stuffer fragment as is known in the
art into the AAV genome which causes the DNA to exceed the length
for optimal packaging. Thus, the helper fragment is not packaged
into AAV virions. This is a safety feature, ensuring that only a
recombinant AAV vector genome that does not exceed optimal
packaging size is packaged into virions. An AAV helper fragment
that incorporates a stuffer sequence can exceed the wild-type
genome length of 4.6 kb, and lengths above 105% of the wild-type
will generally not be packaged. The stuffer fragment can be derived
from, for example, such non-viral sources as the Lac-Z or
beta-galactosidase gene.
[0068] In one embodiment, the selected nucleotide sequence is
operably linked to control elements that direct the transcription
or expression thereof in the subject in vivo. Such control elements
can comprise control sequences normally associated with the
selected gene. Alternatively, heterologous control sequences can be
employed. Useful heterologous control sequences generally include
those derived from sequences encoding mammalian or viral genes.
Examples include, but are not limited to, the SV40 early promoter,
mouse mammary tumor virus LTR promoter; adenovirus major late
promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a
cytomegalovirus (CMV) promoter such as the CMV immediate early
promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, pol
II promoters, pol III promoters, synthetic promoters, hybrid
promoters, and the like. In addition, sequences derived from
nonviral genes, such as the murine metallothionein gene, will also
find use herein. Such promoter sequences are commercially available
from, e.g., Stratagene (San Diego, Calif.).
[0069] In one embodiment, both heterologous promoters and other
control elements, such as CNS-specific and inducible promoters,
enhancers and the like, will be of particular use. Examples of
heterologous promoters include the CMB promoter. Examples of
CNS-specific promoters include those isolated from the genes from
myelin basic protein (MBP), glial fibrillary acid protein (GFAP),
and neuron specific enolase (NSE). Examples of inducible promoters
include DNA responsive elements for ecdysone, tetracycline, hypoxia
and aufin.
[0070] In one embodiment, the AAV expression vector which harbors
the DNA molecule of interest bounded by AAV ITRs, can be
constructed by directly inserting the selected sequence(s) into an
AAV genome which has had the major AAV open reading frames ("ORFs")
excised therefrom. Other portions of the AAV genome can also be
deleted, so long as a sufficient portion of the ITRs remain to
allow for replication and packaging functions. Such constructs can
be designed using techniques well known in the art. See, e.g., U.S.
Pat. Nos. 5,173,414 and 5,139,941; International Publication Nos.
WO 92/01070 (published Jan. 23, 1992) and WO 93/03769 (published
Mar. 4 1993); Lebkowski et al. (1988) Molec. Cell. Biol.
8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor
Laboratory Press); Carter, B. J. (1992) Current Opinion in
Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in
Microbiol. and Immunol. 158:97-129; Kotin, R. M. (1994) Human Gene
Therapy 5:793-801; Shelling and Smith (1994) Gene Therapy
1:165-169; and Zhou et al. (1994) J. Exp. Med. 179:1867-1875.
[0071] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al., supra. For example, ligations can be accomplished
in 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 33 .mu.g/ml
BSA, 10 mM-50 mM NaCl, and either 40 .mu.M ATP, 0.01-0.02 (Weiss)
units T4 DNA ligase at 0.degree. C. (for "sticky end" ligation) or
1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for
"blunt end" ligation). Intermolecular "sticky end" ligations are
usually performed at 30-100 .mu.g/ml total DNA concentrations
(5-100 nM total end concentration). AAV vectors which contain ITRs
have been described in, e.g., U.S. Pat. No. 5,139,941. In
particular, several AAV vectors are described therein which are
available from the American Type Culture Collection ("ATCC") under
Accession Numbers 53222, 53223, 53224, 53225 and 53226.
[0072] Additionally, chimeric genes can be produced synthetically
to include AAV ITR sequences arranged 5' and 3' of one or more
selected nucleic acid sequences. Preferred codons for expression of
the chimeric gene sequence in mammalian CNS cells can be used. The
complete chimeric sequence is assembled from overlapping
oligonucleotides prepared by standard methods. See, e.g., Edge,
Nature (1981) 292:756; Nambair et al. Science (1984) 223:1299; Jay
et al. J. Biol. Chem. (1984) 259:6311.
[0073] In order to produce rAAV virions, an AAV expression vector
is introduced into a suitable host cell using known techniques,
such as by transfection. A number of transfection techniques are
generally known in the art. See, e.g., Graham et al. (1973)
Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a
laboratory manual, Cold Spring Harbor Laboratories, New York, Davis
et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu
et al. (1981) Gene 13:197. Particularly suitable transfection
methods include calcium phosphate co-precipitation (Graham et al.
(1973) Virol. 52:456-467), direct micro-injection into cultured
cells (Capecchi, M. R. (1980) Cell 22:479-488), electroporation
(Shigekawa et al. (1988) BioTechniques 6:742-751), liposome
mediated gene transfer (Mannino et al. (1988) BioTechniques
6:682-690), lipid-mediated transduction (Felgner et al. (1987)
Proc. Natl. Acad. Sci. USA 84:7413-7417), and nucleic acid delivery
using high-velocity microprojectiles (Klein et al. (1987) Nature
327:70-73).
[0074] In one embodiment, suitable host cells for producing rAAV
virions include microorganisms, yeast cells, insect cells, and
mammalian cells, that can be, or have been, used as recipients of a
heterologous DNA molecule. The term includes the progeny of the
original cell which has been transfected. Thus, a "host cell" as
used herein generally refers to a cell which has been transfected
with an exogenous DNA sequence. Cells from the stable human cell
line, 293 (readily available through, e.g., the American Type
Culture Collection under Accession Number ATCC CRL1573) can be used
in the practice of the present invention. Particularly, the human
cell line 293 is a human embryonic kidney cell line that has been
transformed with adenovirus type-5 DNA fragments (Graham et al.
(1977) J. Gen. Virol. 36:59), and expresses the adenoviral E1a and
E1b genes (Aiello et al. (1979) Virology 94:460). The 293 cell line
is readily transfected, and provides a particularly convenient
platform in which to produce rAAV virions.
[0075] In one embodiment, host cells containing the above-described
AAV expression vectors are rendered capable of providing AAV helper
functions in order to replicate and encapsidate the nucleotide
sequences flanked by the AAV ITRs to produce rAAV virions. AAV
helper functions are generally AAV-derived coding sequences which
can be expressed to provide AAV gene products that, in turn,
function in trans for productive AAV replication. AAV helper
functions are used herein to complement necessary AAV functions
that are missing from the AAV expression vectors. Thus, AAV helper
functions include one, or both of the major AAV ORFs, namely the
rep and cap coding regions, or functional homologues thereof.
[0076] The Rep expression products have been shown to possess many
functions, including, among others: recognition, binding and
nicking of the AAV origin of DNA replication; DNA helicase
activity; and modulation of transcription from AAV (or other
heterologous) promoters. The Cap expression products supply
necessary packaging functions. AAV helper functions are used herein
to complement AAV functions in trans that are missing from AAV
vectors.
[0077] The term "AAV helper construct" refers generally to a
nucleic acid molecule that includes nucleotide sequences providing
AAV functions deleted from an AAV vector which is to be used to
produce a transducing vector for delivery of a nucleotide sequence
of interest. AAV helper constructs are commonly used to provide
transient expression of AAV rep and/or cap genes to complement
missing AAV functions that are necessary for lytic AAV replication;
however, helper constructs lack AAV ITRs and can neither replicate
nor package themselves. AAV helper constructs can be in the form of
a plasmid, phage, transposon, cosmid, virus, or virion. A number of
AAV helper constructs have been described, such as the commonly
used plasmids pAAV/Ad and pIM29+45 which encode both Rep and Cap
expression products. See, e.g., Samulski et al. (1989) J. Virol.
63:3822-3828; and McCarty et al. (1991) J. Virol. 65:2936-2945. A
number of other vectors have been described which encode Rep and/or
Cap expression products. See, e.g., U.S. Pat. No. 5,139,941.
[0078] By "AAV rep coding region" is meant the art-recognized
region of the AAV genome which encodes the replication proteins Rep
78, Rep 68, Rep 52 and Rep 40. These Rep expression products have
been shown to possess many functions, including recognition,
binding and nicking of the AAV origin of DNA replication, DNA
helicase activity and modulation of transcription from AAV (or
other heterologous) promoters. The Rep expression products are
collectively required for replicating the AAV genome. For a
description of the AAV rep coding region, see, e.g., Muzyczka, N.
(1992) Current Topics in Microbiol. and Immunol. 158:97-129; and
Kotin, R. M. (1994) Human Gene Therapy 5:793-801. Suitable
homologues of the AAV rep coding region include the human
herpesvirus 6 (HHV-6) rep gene which is also known to mediate AAV-2
DNA replication (Thomson et al. (1994) Virology 204:304-311).
[0079] By "AAV cap coding region" is meant the art-recognized
region of the AAV genome which encodes the capsid proteins VP1,
VP2, and VP3, or functional homologues thereof. These Cap
expression products supply the packaging functions which are
collectively required for packaging the viral genome. For a
description of the AAV cap coding region, see, e.g., Muzyczka, N.
and Kotin, R. M. (supra).
[0080] In one embodiment, AAV helper functions are introduced into
the host cell by transfecting the host cell with an AAV helper
construct either prior to, or concurrently with, the transfection
of the AAV expression vector. AAV helper constructs are thus used
to provide at least transient expression of AAV rep and/or cap
genes to complement missing AAV functions that are necessary for
productive AAV infection. AAV helper constructs lack AAV ITRs and
can neither replicate nor package themselves. These constructs can
be in the form of a plasmid, phage, transposon, cosmid, virus, or
virion. A number of AAV helper constructs have been described, such
as the commonly used plasmids pAAV/Ad and pIM29+45 which encode
both Rep and Cap expression products. See, e.g., Samulski et al.
(1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol.
65:2936-2945. A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No.
5,139,941.
[0081] In one embodiment, both AAV expression vectors and AAV
helper constructs can be constructed to contain one or more
optional selectable markers. Suitable markers include genes which
confer antibiotic resistance or sensitivity to, impart color to, or
change the antigenic characteristics of those cells which have been
transfected with a nucleic acid construct containing the selectable
marker when the cells are grown in an appropriate selective medium.
Several selectable marker genes that are useful in the practice of
the invention include the hygromycin B resistance gene (encoding
Aminoglycoside phosphotransferase (APH)) that allows selection in
mammalian cells by conferring resistance to G418 (available from
Sigma, St. Louis, Mo.). Other suitable markers are known to those
of skill in the art.
[0082] In one embodiment, the host cell (or packaging cell) is
rendered capable of providing non AAV derived functions, or
"accessory functions," in order to produce rAAV virions. Accessory
functions are non AAV derived viral and/or cellular functions upon
which AAV is dependent for its replication. Thus, accessory
functions include at least those non AAV proteins and RNAs that are
required in AAV replication, including those involved in activation
of AAV gene transcription, stage specific AAV mRNA splicing, AAV
DNA replication, synthesis of Cap expression products and AAV
capsid assembly. Viral-based accessory functions can be derived
from any of the known helper viruses.
[0083] In one embodiment, accessory functions can be introduced
into and then expressed in host cells using methods known to those
of skill in the art. Commonly, accessory functions are provided by
infection of the host cells with an unrelated helper virus. A
number of suitable helper viruses are known, including
adenoviruses; herpesviruses such as herpes simplex virus types 1
and 2; and vaccinia viruses. Nonviral accessory functions will also
find use herein, such as those provided by cell synchronization
using any of various known agents. See, e.g., Buller et al. (1981)
J. Virol. 40:241-247; McPherson et al. (1985) Virology 147:217-222;
Schlehofer et al. (1986) Virology 152:110-117.
[0084] In one embodiment, accessory functions are provided using an
accessory function vector. Accessory function vectors include
nucleotide sequences that provide one or more accessory functions.
An accessory function vector is capable of being introduced into a
suitable host cell in order to support efficient AAV virion
production in the host cell. Accessory function vectors can be in
the form of a plasmid, phage, transposon or cosmid. Accessory
vectors can also be in the form of one or more linearized DNA or
RNA fragments which, when associated with the appropriate control
elements and enzymes, can be transcribed or expressed in a host
cell to provide accessory functions. See, for example,
International Publication No. WO 97/17548, published May 15,
1997.
[0085] In one embodiment, nucleic acid sequences providing the
accessory functions can be obtained from natural sources, such as
from the genome of an adenovirus particle, or constructed using
recombinant or synthetic methods known in the art. In this regard,
adenovirus-derived accessory functions have been widely studied,
and a number of adenovirus genes involved in accessory functions
have been identified and partially characterized. See, e.g.,
Carter, B. J. (1990) "Adeno-Associated Virus Helper Functions," in
CRC Handbook of Parvoviruses, vol. I (P. Tijssen, ed.), and
Muzyczka, N. (1992) Curr. Topics. Microbiol and Immun. 158:97-129.
Specifically, early adenoviral gene regions E1a, E2a, E4, VAI RNA
and, possibly, E1b are thought to participate in the accessory
process. Janik et al. (1981) Proc. Natl. Acad. Sci. USA
78:1925-1929. Herpesvirus-derived accessory functions have been
described. See, e.g., Young et al. (1979) Prog. Med. Virol. 25:113.
Vaccinia virus-derived accessory functions have also been
described. See, e.g., Carter, B. J. (1990), supra., Schlehofer et
al. (1986) Virology 152:110-117.
[0086] In one embodiment, as a consequence of the infection of the
host cell with a helper virus, or transfection of the host cell
with an accessory function vector, accessory functions are
expressed which transactivate the AAV helper construct to produce
AAV Rep and/or Cap proteins. The Rep expression products excise the
recombinant DNA (including the DNA of interest) from the AAV
expression vector. The Rep proteins also serve to duplicate the AAV
genome. The expressed Cap proteins assemble into capsids, and the
recombinant AAV genome is packaged into the capsids. Thus,
productive AAV replication ensues, and the DNA is packaged into
rAAV virions.
[0087] In one embodiment, following recombinant AAV replication,
rAAV virions can be purified from the host cell using a variety of
conventional purification methods, such as CsCl gradients. Further,
if infection is employed to express the accessory functions,
residual helper virus can be inactivated, using known methods. For
example, adenovirus can be inactivated by heating to temperatures
of approximately 60.degrees C. for, e.g., 20 minutes or more. This
treatment effectively inactivates only the helper virus since AAV
is extremely heat stable while the helper adenovirus is heat
labile. The resulting rAAV virions are then ready for use for DNA
delivery to the CNS (e.g., cranial cavity) of the subject.
[0088] Methods of delivery of viral vectors include, but are not
limited to, intra-arterial, intra-muscular, intravenous, intranasal
and oral routes. Generally, rAAV virions may be introduced into
cells of the CNS using either in vivo or in vitro transduction
techniques. If transduced in vitro, the desired recipient cell will
be removed from the subject, transduced with rAAV virions and
reintroduced into the subject. Alternatively, syngeneic or
xenogeneic cells can be used where those cells will not generate an
inappropriate immune response in the subject.
[0089] Suitable methods for the delivery and introduction of
transduced cells into a subject have been described. For example,
cells can be transduced in vitro by combining recombinant AAV
virions with CNS cells e.g., in appropriate media, and screening
for those cells harboring the DNA of interest can be screened using
conventional techniques such as Southern blots and/or PCR, or by
using selectable markers. Transduced cells can then be formulated
into pharmaceutical compositions, described more fully below, and
the composition introduced into the subject by various techniques,
such as by grafting, intramuscular, intravenous, subcutaneous and
intraperitoneal injection.
[0090] In one embodiment, for in vivo delivery, the rAAV virions
are formulated into pharmaceutical compositions and will generally
be administered parenterally, e.g., by intramuscular injection
directly into skeletal or cardiac muscle or by injection into the
CNS.
[0091] In one embodiment, viral vectors of the invention are
delivered to the CNS via convection-enhanced delivery (CED) systems
that can efficiently deliver viral vectors, e.g., AAV, over large
regions of a subject's brain (e.g., striatum and/or cortex). As
described in detail and exemplified below, these methods are
suitable for a variety of viral vectors, for instance AAV vectors
carrying therapeutic genes (e.g., siRNAs).
[0092] Any convection-enhanced delivery device may be appropriate
for delivery of viral vectors. In one embodiment, the device is an
osmotic pump or an infusion pump. Both osmotic and infusion pumps
are commercially available from a variety of suppliers, for example
Alzet Corporation, Hamilton Corporation, Aiza, Inc., Palo Alto,
Calif.). Typically, a viral vector is delivered via CED devices as
follows. A catheter, cannula or other injection device is inserted
into CNS tissue in the chosen subject. In view of the teachings
herein, one of skill in the art could readily determine which
general area of the CNS is an appropriate target. For example, when
delivering AAV vector encoding a therapeutic gene to treat PD, the
striatum is a suitable area of the brain to target. Stereotactic
maps and positioning devices are available, for example from ASI
Instruments, Warren, Mich. Positioning may also be conducted by
using anatomical maps obtained by CT and/or MRI imaging of the
subject's brain to help guide the injection device to the chosen
target. Moreover, because the methods described herein can be
practiced such that relatively large areas of the brain take up the
viral vectors, fewer infusion cannula are needed. Since surgical
complications are related to the number of penetrations, the
methods described herein also serve to reduce the side effects seen
with conventional delivery techniques.
[0093] In one embodiment, pharmaceutical compositions will comprise
sufficient genetic material to produce a therapeutically effective
amount of the siRNA of interest, i.e., an amount sufficient to
reduce or ameliorate symptoms of the disease state in question or
an amount sufficient to confer the desired benefit. The
pharmaceutical compositions will also contain a pharmaceutically
acceptable excipient. Such excipients include any pharmaceutical
agent that does not itself induce the production of antibodies
harmful to the individual receiving the composition, and which may
be administered without undue toxicity. Pharmaceutically
acceptable-excipients include, but are not limited to, sorbitol,
Tween80, and liquids such as water, saline, glycerol and ethanol.
Pharmaceutically acceptable salts can be included therein, for
example, mineral acid salts such as hydrochlorides, hydrobromides,
phosphates, sulfates, and the like; and the salts of organic acids
such as acetates, propionates, malonates, benzoates, and the like.
Additionally, auxiliary substances, such as wetting or emulsifying
agents, pH buffering substances, and the like, may be present in
such vehicles. A thorough discussion of pharmaceutically acceptable
excipients is available in REMINGTON'S PHARMACEUTICAL SCIENCES
(Mack Pub. Co., N.J. 1991).
[0094] As is apparent to those skilled in the art in view of the
teachings of this specification, an effective amount of viral
vector which must be added can be empirically determined.
Administration can be effected in one dose, continuously or
intermittently throughout the course of treatment. Methods of
determining the most effective means and dosages of administration
are well known to those of skill in the art and will vary with the
viral vector, the composition of the therapy, the target cells, and
the subject being treated. Single and multiple administrations can
be carried out with the dose level and pattern being selected by
the treating physician.
[0095] It should be understood that more than one transgene could
be expressed by the delivered viral vector. Alternatively, separate
vectors, each expressing one or more different transgenes, can also
be delivered to the CNS as described herein. Furthermore, it is
also intended that the viral vectors delivered by the methods of
the present invention be combined with other suitable compositions
and therapies.
BRIEF DESCRIPTION OF THE FIGURES
[0096] This patent or application file contains at least one
drawing executed in color. Copies of this patent or patent
application publication with color drawing(s) will be provided by
the Office upon request and payment of the necessary fee.
[0097] FIGS. 1A-J. siRNA expressed from CMV promoter constructs and
in vitro effects. (A) A cartoon of the expression plasmid used for
expression of functional siRNA in cells. The CMV promoter was
modified to allow close juxtaposition of the hairpin to the
transcription initiation site, and a minimal polyadenylation signal
containing cassette was constructed immediately 3' of the MCS
(mCMV, modified CMV; mpA, minipA). (B, C) Fluorescence
photomicrographs of HEK293 cells 72 h after transfection of pEGFPN1
and pCMV.beta.gal (control), or pEGFPN1 and pmCMVsiGFPmpA,
respectively. (D) Northern blot evaluation of transcripts harvested
from pmCMVsiGFPmpA (lanes 3, 4) and pmCMVsi.beta.galmpA (lane 2)
transfected HEK293 cells. Blots were probed with .sup.32P-labeled
sense oligonucleotides. Antisense probes yielded similar results
(not shown). Lane 1, .sup.32P-labeled RNA markers. AdsiGFP infected
cells also possessed appropriately sized transcripts (not shown).
(E) Northern blot for evaluation of target mRNA reduction by siRNA
(upper panel). The internal control GAPDH is shown in the lower
panel. HEK293 cells were transfected with pEGFPN1 and
pmCMVsiGFPmpA, expressing siGFP, or plasmids expressing the control
siRNA as indicated. pCMVeGFPx, which expresses siGFPx, contains a
large poly(A) cassette from SV40 large T and an unmodified CMV
promoter, in contrast to pmCMVsiGFPmpA shown in (A). (F) Western
blot with anti-GFP antibodies of cell lysates harvested 72 h after
transfection with pEGFPN1 and pCMVsiGFPmpA, or pEGFPN1 and
pmCMVsi.beta.glucmpA. (G, H) Fluorescence photomicrographs of
HEK293 cells 72 h after transfection of pEGFPN1 and pCMVsiGFPx, or
pEGFPN1 and pmCMVsi.beta.glucmpA, respectively. (I, J) siRNA
reduces expression from endogenous alleles. Recombinant
adenoviruses were generated from pmCMVsi.beta.glucmpA and
pmCMVsiGFPmpA and purified. HeLa cells were infected with 25
infectious viruses/cell (MOI=25) or mock-infected (control) and
cell lysates harvested 72 h later. (I) Northern blot for
.beta.-glucuronidase mRNA levels in Adsi.beta.gluc and AdsiGFP
transduced cells. GAPDH was used as an internal control for
loading. (J) The concentration of .beta.-glucuronidase activity in
lysates quantified by a fluorometric assay. (Stein 1999).
[0098] FIGS. 2A-C. Viral vectors expressing siRNA reduce expression
from transgenic and endogenous alleles in vivo. Recombinant
adenovirus vectors were prepared from the siGFP and si.beta.gluc
shuttle plasmids described in FIG. 1. (A) Fluorescence microscopy
reveals diminution of eGFP expression in vivo. In addition to the
siRNA sequences in the E1 region of adenovirus, RFP expression
cassettes in E3 facilitate localization of gene transfer.
Representative photomicrographs of eGFP (left), RFP (middle), and
merged images (right) of coronal sections from mice injected with
adenoviruses expressing siGFP (top panels) or si.beta.gluc (bottom
panels) demonstrate siRNA specificity in eGFP transgenic mice
striata after direct brain injection. (B) Full coronal brain
sections (1 mm) harvested from AdsiGFP or Adsi.beta.gluc injected
mice were split into hemisections and both ipsilateral (il) and
contralateral (cl) portions evaluated by western blot using
antibodies to GFP. Actin was used as an internal control for each
sample. (C) Tail vein injection of recombinant adenoviruses
expressing si.beta.gluc directed against mouse .beta.-glucuronidase
(AdsiMu.beta.gluc) reduces endogenous .beta.-glucuronidase RNA as
determined by Northern blot in contrast to control-treated
(Adsi.beta.gal) mice.
[0099] FIGS. 3A-D. siGFP gene transfer reduces Q19-eGFP expression
in cell lines. PC12 cells expressing the polyglutamine repeat Q19
fused to eGFP (eGFP-Q19) under tetracycline repression (A, bottom
left) were washed and dox-free media added to allow eGFP-Q19
expression (A, top left). Adenoviruses were applied at the
indicated multiplicity of infection (MOI) 3 days after dox removal.
(A) eGFP fluorescence 3 days after adenovirus-mediated gene
transfer of Adsi.beta.gluc (top panels) or AdsiGFP (bottom panels).
(B, C) Western blot analysis of cell lysates harvested 3 days after
infection at the indicated MOIs demonstrate a dose-dependent
decrease in GFP-Q19 protein levels. NV, no virus. Top lanes,
eGFP-Q19. Bottom lanes, actin loading controls. (D) Quantitation of
eGFP fluorescence. Data represent mean total area
fluorescence.+-.standard deviation in 4 low power fields/well (3
wells/plate).
[0100] FIGS. 4A-G. siRNA mediated reduction of expanded
polyglutamine protein levels and intracellular aggregates. PC12
cells expressing tet-repressible eGFP-Q80 fusion proteins were
washed to remove doxycycline and adenovirus vectors expressing
siRNA were applied 3 days later. (A-D) Representative punctate eGFP
fluorescence of aggregates in mock-infected cells (A), or those
infected with 100 MOI of Adsi.beta.gluc (B), AdsiGFPx (C) or
Adsi.beta.gal (D). (E) Three days after infection of dox-free
eGFP-Q80 PC12 cells with AdsiGFP, aggregate size and number are
notably reduced. (F) Western blot analysis of eGFP-Q80 aggregates
(arrowhead) and monomer (arrow) following Adsi.beta.gluc or AdsiGFP
infection at the indicated MOIs demonstrates dose dependent
siGFP-mediated reduction of GFP-Q80 protein levels. (G)
Quantification of the total area of fluorescent inclusions measured
in 4 independent fields/well 3 days after virus was applied at the
indicated MOIs. The data are mean.+-.standard deviation.
[0101] FIGS. 5A-B. (A) Allele-specific silencing of mutant
huntingtin by siRNA. PC6-3 cells were co-transfected with plasmids
expressing siRNA specific for the polymorphism encoding the
transcript for mutant huntingtin. (B) The original target for
testing hairpins with putative specificity for the 3 GAG-repeat
disease linked polymorphism, shEx58.1 and shEx58.2. In this
preliminary test, shEx58.1 is best.
[0102] FIGS. 6A-F. Silencing ataxin-1. (A) Cartoon of the ataxin-1
cDNA and regions tested for silencing (lines). The CAG repeat
region is indicated. The most effective hairpins identified, F10
and F11, are bolded. (B) Screening of shSCA1s for ataxin-1
silencing. HEK 293 cells were transfected with shRNA- and
ataxin-1-expressing plasmids (4:1 ratio), and FLAG-tagged ataxin-1
(ataxin-1FLAG) expression was screened by western blot two days
later. Actin was used as a loading control. ShLacZ was included as
a negative hairpin control. Data shown are from U6-expressed
shRNAs. (C) Dose dependent decline in hSCA-1 mRNA as assessed by
Q-RTPCR. HEK 293 cells were transfected with shRNA- and
ataxin-1-expressing plasmids at the ratios indicated, and RNA
isolated 24 hrs later. RNA levels were measured by Q-PCR as
described in the methods. (D) Comparison of mCMV- and U6-expressed
shRNAs in neuronal cells. PC6-3 cells were transfected with
plasmids expressing the indicated shRNAs, and expression of ataxin
assessed 2 days later by western blot. shCAG was targeted to the
CAG repeat region and was used as a positive control for silencing
(E) The loop from miR23 improves silencing from the hU6 promoter.
HEK 293 cells were transfected with plasmids expressing the
indicated hairpins and ataxin-1FLAG, and silencing evaluated 2 days
later by western blot. The loop improves silencing of shSCA1.F10
and shSCA1.F11. (F) shSCA1.F10 and shSCA1.F11 silence mutant (Q82)
ataxin-1. HEK 293 cells were transfected with plasmids expressing
the indicated hairpins, and a plasmid expressing human ataxin-1
with an expanded poly(Q) tract (FLAG-tagged). Silencing of the
human mutant ataxin-1 was assessed by western blot 2 days
later.
[0103] FIGS. 7A-D. AAV vectors for shRNA expression in vivo. (A)
Cartoon of AAV construct. The construct for shSCA.F11mi and shLacZ
expression was similar except that shSCA1.F10mi was replaced with
shSCA.F11mi or shLacZ sequences, respectively. Note that the hrGFP
expression cassette is distinct from the shRNA expression cassette.
(B) AAVshSCA1 with hrGFP reporter leads to extensive transduction
of cerebellar Purkinje cells (Purkinje cell layer denoted by
arrowheads). Wildtype mice were injected with AAVshSCA1.F10mi (left
panel) or injected with saline (right panel) and sacrificed 3 weeks
later to evaluate eGFP expression. g, granule cell layer; m,
molecular layer. Bar=100 .mu.m. (C) shSCA1 and shLacZ transcripts
are expressed in vivo. Wildtype mice were injected with AAVshLacZ
or AAVshSCA1.F10mi, and RNA isolated from cerebella 10 days later.
Northern blots were probed with 32P-labeled oligonucleotides
specific for the antisense strand of the hairpin. L, RNA ladder;
(sizes indicated at left). Lanes, 2 and 3, RNA from AAVshSCA1.F10mi
and AAVshLacZ transduced brains, respectively. The arrowhead
denotes the unprocessed transcript, the arrow the processed siRNA.
(D) Rotarod performance of wildtype (triangles) and SCA1 (squares)
mice treated with shRNA-expressing AAV1s or mock infected, as
indicated in the legend. Mice were injected with virus or saline at
age 7 weeks and re-tested every two weeks (weeks 5, 11, 15, and 21
are shown). From weeks 11-21 significant differences in performance
between AAVshSCA1 and AAVshLacZ treated SCA1 mice were noted
(P<0.001). There were no significant differences between
wildtype mice treated with shLacZ (not shown), shSCA1.F10mi or
saline. For week 5, n=10 and 11 for shSCA1 and shLacZ treated SCA1
mice, respectively; n=6 and 5 for shSCA1 and control treated
age-matched wildtype littermates, respectively. For weeks 7-21,
n=14 and 12 for shSCA1 and shLacZ treated SCA1 mice, respectively;
n=12 and 11 for shSCA1 and control treated age-matched wildtype
littermates, respectively; n=9 for saline injected SCA1 mice. WT
mice given shLacZ were not significantly different than WT mice
treated with saline, shSCA1, or left untreated (data not
shown).
[0104] FIGS. 8A-C. SCA1 neuropathology is improved by shRNAs
directed to ataxin-1. (A) SCA and wildtype mice were injected with
AAVshSCA1.F10mi or AAVshLacZ at week 7, and sacrificed 9 weeks
later for cerebellar pathology. Calbindin immunofluorescence (IF)
(middle panels) and hrGFP expression (top panels) were evaluated.
Merged images (bottom panels) demonstrate that hrGFP+ molecular
layers from AAVshSCA-injected SCA1 mice have calbindin staining
similar to wildtype mice. Panels are representative of 100 or 40
sections evaluated for AAVshSCA1.F10mi-treated SCA1 or wildtype
mice, respectively, and 80 sections from AAVshLacZ-treated mice.
Bar in upper left panel=50 .mu.m and is representative of all
images. (B) The molecular layer width in transduced (solid bars),
and untransduced (open bars) lobules from wildtype and SCA1 mice
was measured. The data demonstrate significant protection following
shSCA1.F10mi therapy. **, P<0.001. Numbers below bars refer to
numbers of sections measured/group. Molecular layer widths from
wildtype mice given AAVs expressing shLacZ or shSCA1.F10mi were
indistinguishable and were pooled for comparison to SCA1 mice
cerebella (designated shRNA). (C) Photomicrographs shown in A, and
FIG. 10, are from the region boxed.
[0105] FIG. 9. Effects of shSCA1.F10mi and shSCA1.F11mi on ataxin-1
expression in mice cerebella. SCA1 transgenic or wildtype mice were
injected with the indicated shRNA-expressing AAVs, and cerebella
harvested 1 week later and processed for hrGFP fluorescence, and
ataxin-1 IF. The top panels are from untreated SCA1 mice. The
arrowheads in the middle and merged panels depict pairs of Purkinje
cells, one transduced (hrGFP+), and one untransduced (hrGFP-),
highlighting the extent of reduction in transgenic ataxin-1(Q82)
expression from mice injected with AAVshSCA1.F10mi and
AAVshSCA1.F11mi, but not AAVshLacZ. Mouse ataxin-1 IF is weak, but
notable, in wildtype mice (lower middle panel), and its expression
is not reduced following shSCA1.F11mi-treatment. Bar=25 .mu.m and
refers to all panels.
[0106] FIGS. 10A-B. RNAi reduces intranuclear inclusions in
transduced cells. (A) Inclusions in transduced (hrGFP+) vs.
untransduced cells. Brains from SCA1 and wildtype mice were
harvested 9 weeks after gene transfer (16 weeks of age) and
processed to evaluate hrGFP fluorescence and ataxin-1 IF. Bar=25
.mu.m and is representative of all images. (B) Higher magnification
of merged hrGFP and ataxin-1 positive cells. There are punctate
ataxin-1 inclusions and robust nuclear staining in untransduced
(Un) or AAVshLacZ transduced SCA1 Purkinje cells (top and bottom,
respectively), but not AAVshSCA1.F10mi transduced ones (middle
panel; see also FIG. 11). Numbers in lower left refer to %
intranuclear inclusion-positive Purkinje cells in .about.400 cells
scored.
[0107] FIG. 11. Reductions in ataxin-1 inclusions in SCA1 mice
requires transduction. Sections from SCA1 mice injected 9 weeks
earlier with AAVshSCA1.F10mi were evaluated for hrGFP expression to
identify transduced cells, and ataxin-1 inclusions using IF, as
described in the Methods and to the legend of FIG. 4. The
photomicrographs demonstrate that ataxin-1 inclusions are noted in
untransduced cells, but not transduced cells, from
AAVshSCA1.F10mi-treated mice Bar=25 .mu.m.
[0108] FIG. 12. PCR method for cloning hairpins. A 79 nt primer is
used with the Ampr template. Pfu and DMSO are used in the
amplification reaction. Products are ligated directly into
pCR-Blunt Topo (Invitrogen) and Kanr resistant colonies picked and
sequenced. Positive clones can be used directly.
[0109] FIG. 13. Reduction of eGFP inclusions after transduction
with 25, 50 or 100 viruses/cell into cultures with pre-formed
aggregates. Note dose-dependent response with shGFP vectors
only.
[0110] FIG. 14. Regulated RNAi. Two Teto2 sequences were placed up-
and downstream of the TATA box of the H1 promoter element
(cartoon). Either control shRNA or shGFP was placed into the
cassette for expression of hairpins. Plasmids expressing GFP and
the hairpin constructs were transfected into a cell line expressing
the TetR (tet-repressor). GFP fluorescence (left panels) or western
blot (right panels) was evaluated in the absence (TetR binding) or
presence (TetR off) of doxycycline.
[0111] FIG. 15. Top, FIV construct. Bottom, AAV construct. Both
express the hrGFP reporter so that transduced cells can be readily
evaluated for shRNA efficacy (as in FIGS. 3 and 4).
[0112] FIGS. 16A-F. RNAi-mediated suppression of expanded CAG
repeat containing genes. Expanded CAG repeats are not direct
targets for preferential inactivation (A), but a linked SNP can be
exploited to generate siRNA that selectively silences mutant
ataxin-3 expression (B-F). (A) Schematic of cDNA encoding
generalized polyQ-fluorescent protein fusions. Bars indicate
regions targeted by siRNAs. HeLa cells co-transfected with Q80-GFP,
Q19-RFP and the indicated siRNA. Nuclei are visualized by DAPI
staining (blue) in merged images. (B) Schematic of human ataxin-3
cDNA with bars indicating regions targeted by siRNAs. The targeted
SNP (G987C) is shown in color. In the displayed siRNAs, red or blue
bars denote C or G respectively. In this Figure,
CAGCAGCAGCAGGGGGACCTATCAGGAC is SEQ ID NO:7, and
CAGCAGCAGCAGCGGGACCTATCAGGAC is SEQ ID NO:8. (C) Quantitation of
fluorescence in Cos-7 cells transfected with wild type or mutant
ataxin-3-GFP expression plasmids and the indicated siRNA.
Fluorescence from cells co-transfected with siMiss was set at one.
Bars depict mean total fluorescence from three independent
experiments +/-standard error of the mean (SEM). (D) Western blot
analysis of cells co-transfected with the indicated ataxin-3
expression plasmids (top) and siRNAs (bottom). Appearance of
aggregated, mutant ataxin-3 in the stacking gel (seen with siMiss
and siG10) is prevented by siRNA inhibition of the mutant allele.
(E) Allele specificity is retained in the simulated heterozygous
state. Western blot analysis of Cos-7 cells cotransfected with
wild-type (atx-3-Q28-GFP) and mutant (atx-Q166) expression plasmids
along with the indicated siRNAs. (Mutant ataxin-3 detected with
1C2, an antibody specific for expanded polyQ, and wild-type
ataxin-3 detected with anti-ataxin-3 antibody.) (F) Western blot of
Cos-7 cells transfected with Atx-3-GFP expression plasmids and
plasmids encoding the indicated shRNA. The negative control
plasmid, phU6-LacZi, encodes siRNA specific for LacZ. Both normal
and mutant protein were detected with anti-ataxin-3 antibody.
Tubulin immunostaining shown as a loading control in panels
(D)-(F).
[0113] FIG. 17. Primer sequences (SEQ ID NOS: 11-40, respectively,
in order of appearance) for in vitro synthesis of siRNAs using T7
polymerase. All primers contain the following T7 promoter sequence
at their 3' ends: 5'-TATAGTGAGTCGTATTA-3' (SEQ ID NO:9). The
following primer was annealed to all oligos to synthesize siRNAs:
5'-TAATACGACTCACTATAG-3' (SEQ ID NO:10).
[0114] FIGS. 18A-B. Inclusion of either two (siC7/8) or three
(siC10) CAG triplets at the 5' end of ataxin-3 siRNA does not
inhibit expression of unrelated CAG repeat containing genes. (A)
Western blot analysis of Cos-7 cells transfected with CAG
repeat-GFP fusion proteins and the indicated siRNA. Immunostaining
with monoclonal anti-GFP antibody (MBL) at 1:1000 dilution. (B)
Western blot analysis of Cos-7 cells transfected with Flag-tagged
ataxin-1-Q30, which is unrelated to ataxin-3, and the indicated
siRNA. Immunostaining with anti-Flag monoclonal antibody (Sigma St.
Louis, Mo.) at 1:1000 dilution. In panels (A) and (B), lysates were
collected 24 hours after transfection. Tubulin immunostaining shown
as a loading control.
[0115] FIGS. 19A-D. shRNA-expressing adenovirus mediates
allele-specific silencing in transiently transfected Cos-7 cells
simulating the heterozygous state. (A) Representative images of
cells cotransfected to express wild type and mutant ataxin-3 and
infected with the indicated adenovirus at 50 multiplicities of
infection (MOI). Atx-3-Q28-GFP (green) is directly visualized and
Atx-3-Q166 (red) is detected by immunofluorescence with 1C2
antibody. Nuclei visualized with DAPI stain in merged images. An
average of 73.1% of cells co-expressed both ataxin-3 proteins with
siMiss. (B) Quantitation of mean fluorescence from 2 independent
experiments performed as in (A). (C) Western blot analysis of
viral-mediated silencing in Cos-7 cells expressing wild type and
mutant ataxin-3 as in (A). Mutant ataxin-3 detected with 1C2
antibody and wild-type human and endogenous primate ataxin-3
detected with anti-ataxin-3 antibody. (D) shRNA-expressing
adenovirus mediates allele-specific silencing in stably transfected
neural cell lines. Differentiated PC12 neural cells expressing wild
type (left) or mutant (right) ataxin-3 were infected with
adenovirus (100 MOI) engineered to express the indicated hairpin
siRNA. Shown are Western blots immunostained for ataxin-3 and GAPDH
as loading control.
[0116] FIGS. 20A-C. Allele-specific siRNA suppression of a missense
Tau mutation. (A) Schematic of human tau cDNA with bars indicating
regions and mutations tested for siRNA suppression. Of these, the
V337M region showed effective suppression and was further studied.
Vertical bars represent microtubule binding repeat elements in Tau.
In the displayed siRNAs, blue and red bars denote A and C
respectively. In this Figure, GTGGCCAGATGGAAGTAAAATC is SEQ ID
NO:35, and GTGGCCAGGTGGAAGTAAAATC is SEQ ID NO:41. (B) Western blot
analysis of cells co-transfected with WT or V337M Tau-EGFP fusion
proteins and the indicated siRNAs. Cells were lysed 24 hr after
transfection and probed with anti-tau antibody. Tubulin
immunostaining is shown as loading control. (C) Quantitation of
fluorescence in Cos-7 cells transfected with wild type tau-EGFP or
mutant V337M tau-EGFP expression plasmids and the indicated siRNAs.
Bars depict mean fluorescence and SEM from three independent
experiments. Fluorescence from cells co-transfected with siMiss was
set at one.
[0117] FIGS. 21A-C. Allele-specific silencing of Tau in cells
simulating the heterozygous state. (A) Representative fluorescent
images of fixed Hela cells co-transfected with flag-tagged WT-Tau
(red), V337M-Tau-GFP (green), and the indicated siRNAs. An average
of 73.7% of cells co-expressed both Tau proteins with siMiss. While
siA9 suppresses both alleles, siA9/C12 selectively decreased
expression of mutant Tau only. Nuclei visualized with DAPI stain in
merged images. (B) Quantitation of mean fluorescence from 2
independent experiments performed as in (A). (C) Western blot
analysis of cells co-transfected with Flag-WT-Tau and
V337M-Tau-EGFP fusion proteins and the indicated siRNAs. Cells were
lysed 24 hr after transfection and probed with anti-tau antibody.
V337M-GFP Tau was differentiated based on reduced electrophoretic
mobility due to the addition of GFP. Tubulin immunostaining is
shown as a loading control.
[0118] FIG. 22. Schematic diagram of allele-specific silencing of
mutant TorsinA by small interfering RNA (siRNA). In the disease
state, wild type and mutant alleles of TOR1A are both transcribed
into mRNA. siRNA with sequence identical to the mutant allele
(deleted of GAG) should bind mutant mRNA selectively and mediate
its degradation by the RNA-induced silencing complex (RISC)
(circle). Wild type mRNA, not recognized by the mutant-specific
siRNA, will remain and continue to be translated into normal
TorsinA. The two adjacent GAG's in wild type TOR1A alleles are
shown as two parallelograms, one of which is deleted in mutant
TOR1A alleles.
[0119] FIG. 23. Design and targeted sequences of siRNAs (SEQ ID
NOS: 42-54, respectively, in order of appearance). Shown are the
relative positions and targeted mRNA sequences for each primer used
in this study. Mis-siRNA (negative control) does not target TA;
com-siRNA targets a sequence present in wild type and mutant TA;
wt-siRNA targets only wild type TA; and three mutant-specific
siRNAs (Mut A, B, C). preferentially target mutant TA. The pair of
GAG codons near the c-terminus of wild type mRNA are shown in
underlined gray and black, with one codon deleted in mutant
mRNA.
[0120] FIGS. 24A-E. siRNA silencing of TAwt and TAmut in Cos-7
cells. (A) Western blot results showing the effect of different
siRNAs on GFP-TAwt expression levels. Robust suppression is
achieved with wt-siRNA and com-siRNA, while the mutant-specific
siRNAs MutA, (B) and (C) have modest or no effect on GFP-TAwt
expression. Tubulin loading controls are also shown. (B) Similar
experiments with cells expressing HA-TAmut, showing significant
suppression by mutant-specific siRNAs and com-siRNA but no
suppression by the wild type-specific siRNA, wt-siRNA. (C)
Quantification of results from at least three separate experiments
as in A and B. (D) Cos-7 cells transfected with GFP-TAwt or
GFP-TAmut and different siRNAs visualized under fluorescence
microscopy (200.times.). Representative fields are shown indicating
allele-specific suppression. (E) Quantification of fluorescence
signal from two different experiments as in D.
[0121] FIGS. 25A-B. Allele-specific silencing by siRNA in the
simulated heterozygous state. Cos-7 cells were cotransfected with
plasmids encoding differentially tagged TAwt and TAmut, together
with the indicated siRNA. (A) Western blot results analysis showing
selective suppression of the targeted allele by wt-siRNA or
mutC-siRNA. (B) Quantification of results from three experiments as
in (A).
[0122] FIGS. 26A-E. RNAi reduces human huntingtin expression in
vitro. (A) RNA sequence of shHD2.1 (SEQ ID NO: 59). The 21
nucleotide antisense strand is cognate to nucleotides 416-436 of
human htt mRNA (Genbank #NM 00211). (B and C) Northern and western
blots demonstrate shHD2.1 mediated reduction of HD-N171-82Q mRNA
and protein expression, 48 h post-transfection of target- and
shRNA-expressing plasmids. GAPDH and actin serve as loading
controls. (D) Western blots show that shHD2.1 inhibits expression
of full-length human huntingtin protein, 48 h post-transfection.
(E) ShHD2.1 induces dose-dependent reduction of human htt mRNA.
Cells were transfected with shLacZ- or shHD2.1-expressing plasmids
in the indicated amounts. Relative htt expression was determined by
quantitative PCR 24 h later. SEQ ID NO:56 is
5'-AAGAAAGAACUUUCAGCUACC-3'. SEQ ID NO:57 is
5'-GGUAGCUGAAAGUUCUUUCUU-3'. SEQ ID NO:58 is 5'-GAAGCUUG-3'. SEQ ID
NO:59 is 5'-AAGAAAGAACUUUCAGCUACCGAAGCUUGGGUAGCUGAAAGUUCUUUCUU
UUUUUU-3'.
[0123] FIGS. 27A-C. AAV.shHD2.1 delivers widespread RNAi expression
to mouse striatum. (A) AAV.shHD2.1 viral vector. ITR, inverted
terminal repeat. (B) Northern blot showing shHD2.1 transcripts are
expressed in vivo. Processed antisense (lower band) and unprocessed
(upper band) shHD2.1 transcripts in three different
AAV.shHD2.1-injected mice. L, ladder; +, positive control oligo.
Blot was probed with radiolabeled sense probe. (C) Typical AAV1
transduction pattern (hrGFP) in mouse brain. CC, corpus callosum;
LV, lateral ventricle.
[0124] FIGS. 28A-E. AAV.shHD2.1 eliminates accumulation of
huntingtin-reactive neuronal inclusions and reduces HD-N171-82Q
mRNA in vivo. (A) Representative photomicrographs show htt-reactive
inclusions (arrows) in HD striatal cells transduced with
AAV.shLacZ-, but not AAV.shHD2.1. Scale bar, 20 .mu.m. (B) Higher
magnification photomicrograph from a (bottom, right) showing lack
of htt-reactive inclusions in cells transduced by AAV.shHD2.1. *
serves as a marker for orientation. Scale bar, 20 .mu.m. (C)
Representative western blot demonstrates decreased HD-N171-82Q
expression in mouse striata transduced with AAV.shHD2.1 compared to
uninjected or AAV.shLacZ-injected striata. Prion protein was used
as a loading control to normalize for tissues expressing the
HD-N171-82Q transgene. (D) AAV.shHD2.1-treated HD mice showed a 55%
average reduction in HD-N171-82Q mRNA compared to AAV.shLacZ or
uninjected HD mice. Data are means+S.E.M. relative to uninjected HD
samples. *, difference from AAV.shHD2.1 samples, p<0.05 (ANOVA).
(E) Mice were injected directly into cerebellum with AAV.shHD2.1 or
AAV.shLacZ. Cerebellar sections confirm that AAV.shHD2.1, but not
AAV.shLacZ, reduces htt immunoreactivity. GCL, granule cell layer;
ML, molecular layer. Scale bar, 100 .mu.m.
[0125] FIGS. 29A-B. AAV.shHD2.1 improves behavioral deficits in
HD-N171-82Q mice. (A) Box plot. Bilateral striatal delivery of
AAV.shHD2.1 improves stride length in HD-N171-82Q mice. HD mice had
significantly shorter stride lengths compared to WT. AAV.shHD2.1
mediated significant gait improvement relative to control-treated
HD mice. *, p<0.0001 (ANOVA, Scheffe post-hoc). (B) Bilateral
striatal delivery of AAV.shHD2.1 significantly improves rotarod
performance in HD-N171-82Q mice. Only AAV.shLacZ-injected and
uninjected HD-N171-82Q declined significantly with time. Data are
means.+-.S.E.M.
[0126] FIG. 30. DNA sequences of huntingtin hairpins (SEQ ID NOS:
60-89). The bases that are underlined indicate changes from the
native huntingtin sequence.
[0127] FIG. 31. PCR method for cloning hairpins. A 79 nt primer is
used with the Ampr template. Pfu and DMSO are used in the
amplification reaction. Products are ligated directly into
pCR-Blunt Topo (Invitrogen) and Kanr resistant colonies picked and
sequenced. Positive clones can be used directly.
[0128] FIG. 32. Reduction of eGFP inclusions after transduction
with 25, 50 or 100 viruses/cell into cultures with pre-formed
aggregates. Note dose-dependent response with shGFP vectors
only.
[0129] FIG. 33. Regulated RNAi. Two Teto2 sequences were placed up-
and downstream of the TATA box of the H1 promoter element
(cartoon). Either control shRNA or shGFP was placed into the
cassette for expression of hairpins. Plasmids expressing GFP and
the hairpin constructs were transfected into a cell line expressing
the TetR (tet-repressor). GFP fluorescence (left panels) or western
blot (right panels) was evaluated in the absence (TetR binding) or
presence (TetR off) of doxycycline.
[0130] FIG. 34. Top, FIV construct. Bottom, AAV construct. Both
express the hrGFP reporter so that transduced cells can be readily
evaluated for shRNA efficacy (as in FIGS. 3 and 4).
[0131] FIGS. 35A-L. siRNA molecules specific for regions of the HD
gene. shHD sequences disclosed as SEQ ID NOS: 106-115, 145,
116-141, 146 and 142, respectively, in order of appearance. Human
and mouse huntington sequences disclosed as SEQ ID NOS: 143 and
144, respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0132] Modulation of gene expression by endogenous, noncoding RNAs
is increasingly appreciated as a mechanism playing a role in
eukaryotic development, maintenance of chromatin structure and
genomic integrity (McManus, 2002). Recently, techniques have been
developed to trigger RNA interference (RNAi) against specific
targets in mammalian cells by introducing exogenously produced or
intracellularly expressed siRNAs (Elbashir, 2001a, 2001b, 2001c;
Brummelkamp, 2002). These methods have proven to be quick,
inexpensive and effective for knockdown experiments in vitro and in
vivo (Elbashir, 2001a, 2001b, 2001c; Brummelkamp, 2002; McCaffrey,
2002; Xia, 2002). The ability to accomplish selective gene
silencing has led to the hypothesis that siRNAs might be employed
to suppress gene expression for therapeutic benefit (Xia, 2002;
Jacque, 2002; Gitlin, 2002).
[0133] RNA interference is now established as an important
biological strategy for gene silencing, but its application to
mammalian cells has been limited by nonspecific inhibitory effects
of long double-stranded RNA on translation. Moreover, delivery of
interfering RNA has largely been limited to administration of RNA
molecules. Hence, such administration must be performed repeatedly
to have any sustained effect. The present inventors have developed
a delivery mechanism that results in specific silencing of targeted
genes through expression of small interfering RNA (siRNA). The
inventors have markedly diminished expression of exogenous and
endogenous genes in vitro and in vivo in brain and liver, and
further apply this novel strategy to a model system of a major
class of neurodegenerative disorders, the polyglutamine diseases,
to show reduced polyglutamine aggregation in cells. This strategy
is generally useful in reducing expression of target genes in order
to model biological processes or to provide therapy for dominant
human diseases.
[0134] Disclosed herein is a strategy that results in substantial
silencing of targeted alleles via siRNA. Use of this strategy
results in markedly diminished in vitro and in vivo expression of
targeted alleles. This strategy is useful in reducing expression of
targeted alleles in order to model biological processes or to
provide therapy for human diseases. For example, this strategy can
be applied to a major class of neurodegenerative disorders, the
polyglutamine diseases, as is demonstrated by the reduction of
polyglutamine aggregation in cells following application of the
strategy. As used herein the term "substantial silencing" means
that the mRNA of the targeted allele is inhibited and/or degraded
by the presence of the introduced siRNA, such that expression of
the targeted allele is reduced by about 10% to 100% as compared to
the level of expression seen when the siRNA is not present.
Generally, when an allele is substantially silenced, it will have
at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least
85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or even 100% reduction expression as compared to when
the siRNA is not present. As used herein the term "substantially
normal activity" means the level of expression of an allele when an
siRNA has not been introduced to a cell.
[0135] Dominantly inherited diseases, including polyQ
neurodegenerative disorders, are ideal candidates for siRNA-based
therapy. The polyQ neurodegenerative disorders include at least
nine inherited disorders caused by CAG repeat expansions that
encode polyQ in the disease protein. PolyQ expansion confers a
dominant toxic property on the mutant protein that is associated
with aberrant accumulation of the disease protein in neurons
(Zoghbi, 2000). All polyQ diseases are progressive, ultimately
fatal disorders that typically begin in adulthood. Huntington
disease (HD) is the best known polyQ disease, but at least seven
hereditary ataxias and one motor neuron disease are also due to CAG
repeat/polyQ expansion. Although the clinical features and patterns
of neuronal degeneration differ among the diseases, increasing
evidence suggests that polyQ diseases share important pathogenic
features. In particular, expansion of the CAG repeat/polyQ domain
confers upon the encoded protein a dominant toxic property. Thus as
a therapeutic strategy, efforts to lower expression of the mutant
gene product prior to cell death could be highly beneficial to
patients.
[0136] Dominantly inherited diseases are ideal candidates for
siRNA-based therapy. To explore the utility of siRNA in inherited
human disorders, the present inventors employed cellular models to
test whether mutant alleles responsible for these
dominantly-inherited human disorders could be specifically
targeted. First, three classes of dominantly inherited, untreatable
neurodegenerative diseases were examined: polyglutamine (polyQ)
neurodegeneration in MJD/SCA3, Huntington's disease and
frontotemporal dementia with parkinsonism linked to chromosome 17
(FTDP-17). Machado-Joseph disease is also known as Spinocerebellar
Ataxia Type 3 (The HUGO official name is MJD). The gene involved is
MJD1, which encodes for the protein ataxin-3 (also called Mjd1p).
Huntington's disease is due to expansion of the CAG repeat motif in
exon 1 of huntingtin. In 38% of patients a polymorphism exists in
exon 58 of the huntingtin gene, allowing for allele specific
targeting. Frontotemporal dementia (sometimes with parkinsonism,
and linked to chromosome 17, so sometimes called FTDP-17) is due to
mutations in the MAPT1 gene that encodes the protein tau.
[0137] The polyQ neurodegenerative disorders include at least nine
diseases caused by CAG repeat expansions that encode polyQ in the
disease protein. PolyQ expansion confers a dominant toxic property
on the mutant protein that is associated with aberrant accumulation
of the disease protein in neurons (Zoghbi, 2000). In FTDP-17, Tau
mutations lead to the formation of neurofibrillary tangles
accompanied by neuronal dysfunction and degeneration (Poorkaj,
1998; Hutton, 1998). The precise mechanisms by which these mutant
proteins cause neuronal injury are unknown, but considerable
evidence suggests that the abnormal proteins themselves initiate
the pathogenic process (Zoghbi, 2000). Accordingly, eliminating
expression of the mutant protein by siRNA or other means slows or
prevents disease (Yamamoto, 2000). However, because many dominant
disease genes also encode essential proteins (e.g. Nasir, 1995)
siRNA-mediated approaches were developed that selectively
inactivate mutant alleles, while allowing continued expression of
the wild type proteins ataxin-3 and huntingtin.
[0138] Second, the dominantly-inherited disorder DYT1 dystonia was
studied. DYT1 dystonia is also known as Torsion dystonia type 1,
and is caused by a GAG deletion in the TOR1A gene encoding torsinA.
DYT1 dystonia is the most common cause of primary generalized
dystonia. DYT1 usually presents in childhood as focal dystonia that
progresses to severe generalized disease (Fahn, 1998; Klein,
2002a). With one possible exception (Leung, 2001; Doheny, 2002;
Klein, 2002), all cases of DYT1 result from a common GAG deletion
in TOR1A, eliminating one of two adjacent glutamic acids near the
C-terminus of the protein TorsinA (TA) (Ozelius, 1997). Although
the precise cellular function of TA is unknown, it seems clear that
mutant TA (TAmut) acts through a dominant-negative or
dominant-toxic mechanism (Breakefield, 2001).
[0139] Several characteristics of DYT1 make it an ideal disease in
which to use siRNA-mediated gene silencing as therapy. Of greatest
importance, the dominant nature of the disease suggests that a
reduction in mutant TA, whatever the precise pathogenic mechanism
proves to be, is helpful. Moreover, the existence of a single
common mutation that deletes a full three nucleotides suggested it
might be feasible to design siRNA that specifically targets the
mutant allele and is applicable to all affected persons. Finally,
there is no effective therapy for DYT1, a relentless and disabling
disease.
[0140] As outlined in the strategy in FIG. 11, the inventors
developed siRNA that would specifically eliminate production of
protein from the mutant allele. By exploiting the three base pair
difference between wild type and mutant alleles, the inventors
successfully silenced expression of the mutant protein (TAmut)
without interfering with expression of the wild type protein
(TAwt). Because TAwt may be an essential protein it is critically
important that efforts be made to silence only the mutant allele.
This allele-specific strategy has obvious therapeutic potential for
DYT1 and represents a novel and powerful research tool with which
to investigate the function of TA and its dysfunction in the
disease state.
[0141] Expansions of poly-glutamine tracts in proteins that are
expressed in the central nervous system can cause neurodegenerative
diseases. Some neurodegenerative diseases are caused by a
(CAG).sub.n repeat that encodes poly-glutamine in a protein include
Huntington disease (HD), spinocerebellar ataxia (SCA1, SCA2, SCA3,
SCA6, SCA7), spinal and bulbar muscular atrophy (SBMA), and
dentatorubropallidoluysian atrophy (DRPLA). In these diseases, the
poly-glutamine expansion in a protein confers a novel toxic
property upon the protein. Studies indicate that the toxic property
is a tendency for the disease protein to misfold and form
aggregates within neurons.
[0142] CAG triplet repeat expansion in exon 1 of Hdh causes
Huntington's disease. Clinical characteristics of HD include
progressive loss of striatal neurons and later, cortical thinning.
Adult patients show choreiform movements, impaired coordination,
progressive dementia and other psychiatric disturbances. The
symptoms of juvenile HD patients include bradykinesia, dystonia and
seizures. HD is a uniformly fatal disease, with death occurring one
to two decades after disease onset.
[0143] The Hdh locus is on chromosome 4, spans 180 kb over 67 exons
and encodes the protein huntingtin (htt). In non-HD individuals,
the CAG repeat region is less than 35 CAG repeats. Expansions of 36
to .about.50 repeats, or greater than .about.50, cause late or
early onset disease, respectively. The inverse correlation of
repeat length with age of disease onset is a common characteristic
of the CAG repeat disorders, and one that is recapitulated in mouse
models. Evidence indicates that HD also may be a dose-dependent
process. For example, in transgenic mouse models of polyQ disease,
phenotypic severity usually correlates with expression levels of
the disease protein, and homozygous transgenic mice develop disease
more rapidly than heterozygous mice. In addition, the very rare
human cases of homozygosity for polyQ disease suggest that disease
severity correlates with the level of disease protein expression,
again supporting the notion that reducing mutant protein expression
would be clinically beneficial.
[0144] The function of htt is not known. It is clear from mouse
models, however, that it is required during gastrulation,
neurogenesis and in postnatal brain. Htt knock-out mice die during
development. Also, removal of htt via Cre recombinase-mediated
excision of a foxed Hdh allele causes progressive postnatal
neurodegeneration. A CAG expansion introduced into the mouse allele
(a knock-in) does not impair neurogenesis unless wildtype htt
expression is reduced from normal levels, suggesting that the
expanded allele does not impair wildtype htt function in
neurogenesis. In adult mice mutant htt causes progressive depletion
of normal htt. Htt is important in vesicle trafficking, NMDA
receptor modulation, and regulation of BDNF transcription, and the
expression of many genes is affected in the CNS of HD mice.
[0145] The therapeutic promise of silencing the mutant gene (and
its toxic property) is best demonstrated in a
tetracycline-regulated mouse model of HD (Yamamoto 2000). When
mutant htt is inducibly expressed in these mice, pathological and
behavioral features of the disease develop over time, including the
characteristic formation of neuronal inclusions and abnormal motor
behavior (Yamamoto 2000, Orr 2000). However, when expression of the
transgene is repressed in affected mice, the pathological and
behavioral features of disease fully resolve (Yamamoto 2000). This
result indicates that if expression of mutant polyQ protein can be
halted, protein clearance mechanisms within neurons can eliminate
the aggregated mutant protein, and possibly normalize mutant
htt-induced changes. It also suggests that gene silencing
approaches may be beneficial even for individuals with fairly
advanced disease.
[0146] One of skill in the art can select additional target sites
for generating siRNA specific for other alleles beyond those
specifically described in the experimental examples. Such
allele-specific siRNAs made be designed using the guidelines
provided by Ambion (Austin, Tex.). Briefly, the target cDNA
sequence is scanned for target sequences that had AA
di-nucleotides. Sense and anti-sense oligonucleotides are generated
to these targets (AA+3' adjacent 19 nucleotides) that contained a
G/C content of 35 to 55%. These sequences are then compared to
others in the human genome database to minimize homology to other
known coding sequences (BLAST search).
[0147] To accomplish intracellular expression of the therapeutic
siRNA, an RNA molecule is constructed containing two complementary
strands or a hairpin sequence (such as a 21-bp hairpin)
representing sequences directed against the gene of interest. The
siRNA, or a nucleic acid encoding the siRNA, is introduced to the
target cell, such as a diseased brain cell. The siRNA reduces
target mRNA and protein expression.
[0148] The construct encoding the therapeutic siRNA is configured
such that the one or more strands of the siRNA are encoded by a
nucleic acid that is immediately contiguous to a promoter. In one
example, the promoter is a pol II promoter. If a pol II promoter is
used in a particular construct, it is selected from readily
available pol II promoters known in the art, depending on whether
regulatable, inducible, tissue or cell-specific expression of the
siRNA is desired. The construct is introduced into the target cell,
allowing for diminished target-gene expression in the cell.
[0149] It was surprising that a pol II promoter would be effective.
While small RNAs with extensive secondary structure are routinely
made from Pol III promoters, there is no a priori reason to assume
that small interfering RNAs could be expressed from pol II
promoters. Pol III promoters terminate in a short stretch of Ts (5
or 6), leaving a very small 3' end and allowing stabilization of
secondary structure. Polymerase II transcription extends well past
the coding and polyadenylation regions, after which the transcript
is cleaved. Two adenylation steps occur, leaving a transcript with
a tail of up to 200 As. This string of As would of course
completely destabilize any small, 21 base pair hairpin. Therefore,
in addition to modifying the promoter to minimize sequences between
the transcription start site and the siRNA sequence (thereby
stabilizing the hairpin), the inventors also extensively modified
the polyadenylation sequence to test if a very short
polyadenylation could occur. The results, which were not predicted
from prior literature, showed that it could.
[0150] The present invention provides an expression cassette
containing an isolated nucleic acid sequence encoding a small
interfering RNA molecule (siRNA) targeted against a gene of
interest. The siRNA may form a hairpin structure that contains a
duplex structure and a loop structure. The loop structure may
contain from 4 to 10 nucleotides, such as 4, 5 or 6 nucleotides.
The duplex is less than 30 nucleotides in length, such as from 19
to 25 nucleotides. The siRNA may further contain an overhang
region. Such an overhang may be a 3' overhang region or a 5'
overhang region. The overhang region may be, for example, from 1 to
6 nucleotides in length. The expression cassette may further
contain a pol II promoter, as described herein. Examples of pol II
promoters include regulatable promoters and constitutive promoters.
For example, the promoter may be a CMV or RSV promoter. The
expression cassette may further contain a polyadenylation signal,
such as a synthetic minimal polyadenylation signal. The nucleic
acid sequence may further contain a marker gene or stuffer
sequences. The expression cassette may be contained in a viral
vector. An appropriate viral vector for use in the present
invention may be an adenoviral, lentiviral, adeno-associated viral
(AAV), poliovirus, herpes simplex virus (HSV) or murine
Maloney-based viral vector. The gene of interest may be a gene
associated with a condition amenable to siRNA therapy. Examples of
such conditions include neurodegenerative diseases, such as a
trinucleotide-repeat disease (e.g., polyglutamine repeat disease).
Examples of these diseases include Huntington's disease or several
spinocerebellar ataxias. Alternatively, the gene of interest may
encode a ligand for a chemokine involved in the migration of a
cancer cell, or a chemokine receptor.
[0151] The present invention also provides an expression cassette
containing an isolated nucleic acid sequence encoding a first
segment, a second segment located immediately 3' of the first
segment, and a third segment located immediately 3' of the second
segment, wherein the first and third segments are each less than 30
base pairs in length and each more than 10 base pairs in length,
and wherein the sequence of the third segment is the complement of
the sequence of the first segment, and wherein the isolated nucleic
acid sequence functions as a small interfering RNA molecule (siRNA)
targeted against a gene of interest. The expression cassette may be
contained in a vector, such as a viral vector.
[0152] The present invention provides a method of reducing the
expression of a gene product in a cell by contacting a cell with an
expression cassette described above. It also provides a method of
treating a patient by administering to the patient a composition of
the expression cassette described above.
[0153] The present invention further provides a method of reducing
the expression of a gene product in a cell by contacting a cell
with an expression cassette containing an isolated nucleic acid
sequence encoding a first segment, a second segment located
immediately 3' of the first segment, and a third segment located
immediately 3' of the second segment, wherein the first and third
segments are each less than 30 base pairs in length and each more
than 10 base pairs in length, and wherein the sequence of the third
segment is the complement of the sequence of the first segment, and
wherein the isolated nucleic acid sequence functions as a small
interfering RNA molecule (siRNA) targeted against a gene of
interest.
[0154] The present method also provides a method of treating a
patient, by administering to the patient a composition containing
an expression cassette, wherein the expression cassette contains an
isolated nucleic acid sequence encoding a first segment, a second
segment located immediately 3' of the first segment, and a third
segment located immediately 3' of the second segment, wherein the
first and third segments are each less than 30 bases in length and
each more than 10 bases in length, and wherein the sequence of the
third segment is the complement of the sequence of the first
segment, and wherein the isolated nucleic acid sequence functions
as a small interfering RNA molecule (siRNA) targeted against a gene
of interest.
[0155] I. Small Interfering RNA (siRNA)
[0156] A "small interfering RNA" or "short interfering RNA" or
"siRNA" or "short hairpin RNA" or "shRNA" is a RNA duplex of
nucleotides that is targeted to a nucleic acid sequence of
interest, for example, ataxin-1 or huntingtin (htt). As used
herein, the term "siRNA" is a generic term that encompasses the
subset of shRNAs. A "RNA duplex" refers to the structure formed by
the complementary pairing between two regions of a RNA molecule.
siRNA is "targeted" to a gene in that the nucleotide sequence of
the duplex portion of the siRNA is complementary to a nucleotide
sequence of the targeted gene. In certain embodiments, the siRNAs
are targeted to the sequence encoding ataxin-1 or huntingtin. In
some embodiments, the length of the duplex of siRNAs is less than
30 base pairs. In some embodiments, the duplex can be 29, 28, 27,
26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or
10 base pairs in length. In some embodiments, the length of the
duplex is 19 to 25 base pairs in length. In certain embodiment, the
length of the duplex is 19 or 21 base pairs in length. The RNA
duplex portion of the siRNA can be part of a hairpin structure. In
addition to the duplex portion, the hairpin structure may contain a
loop portion positioned between the two sequences that form the
duplex. The loop can vary in length. In some embodiments the loop
is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. In
certain embodiments, the loop is 9 nucleotides in length. The
hairpin structure can also contain 3' or 5' overhang portions. In
some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3,
4 or 5 nucleotides in length.
[0157] The siRNA can be encoded by a nucleic acid sequence, and the
nucleic acid sequence can also include a promoter. The nucleic acid
sequence can also include a polyadenylation signal. In some
embodiments, the polyadenylation signal is a synthetic minimal
polyadenylation signal.
[0158] "Knock-down," "knock-down technology" refers to a technique
of gene silencing in which the expression of a target gene is
reduced as compared to the gene expression prior to the
introduction of the siRNA, which can lead to the inhibition of
production of the target gene product. The term "reduced" is used
herein to indicate that the target gene expression is lowered by
1-100%. In other words, the amount of RNA available for translation
into a polypeptide or protein is minimized. For example, the amount
of protein may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90,
95, or 99%. In some embodiments, the expression is reduced by about
90% (i.e., only about 10% of the amount of protein is observed a
cell as compared to a cell where siRNA molecules have not been
administered). Knock-down of gene expression can be directed by the
use of dsRNAs or siRNAs.
[0159] "RNA interference (RNAi)" is the process of
sequence-specific, post-transcriptional gene silencing initiated by
siRNA. During RNAi, siRNA induces degradation of target mRNA with
consequent sequence-specific inhibition of gene expression. RNAi
involving the use of siRNA has been successfully applied to
knockdown the expression of specific genes in plants, D.
melanogaster, C. elegans, trypanosomes, planaria, hydra, and
several vertebrate species including the mouse. For a review of the
mechanisms proposed to mediate RNAi, please refer to Bass et al.,
2001 Elbashir, 2001a, 2001b, 2001c; or Brantl, 2002.
[0160] According to a method of the present invention, the
expression of huntingtin or atxain-1 can be modified via RNAi. For
example, the accumulation of huntingtin or atxain-1 can be
suppressed in a cell. The term "suppressing" refers to the
diminution, reduction or elimination in the number or amount of
transcripts present in a particular cell. For example, the
accumulation of mRNA encoding huntingtin or atxain-1 can be
suppressed in a cell by RNA interference (RNAi), e.g., the gene is
silenced by sequence-specific double-stranded RNA (dsRNA), which is
also called short interfering RNA (siRNA). These siRNAs can be two
separate RNA molecules that have hybridized together, or they may
be a single hairpin wherein two portions of a RNA molecule have
hybridized together to form a duplex.
[0161] A mutant protein refers to the protein encoded by a gene
having a mutation, e.g., a missense or nonsense mutation in one or
both alleles of huntingtin or atxain-1. A mutant huntingtin or
atxain-1 may be disease-causing, i.e., may lead to a disease
associated with the presence of huntingtin or atxain-1 in an animal
having either one or two mutant allele(s).
[0162] The term "gene" is used broadly to refer to any segment of
nucleic acid associated with a biological function. Thus, genes
include coding sequences and/or the regulatory sequences required
for their expression. For example, "gene" refers to a nucleic acid
fragment that expresses mRNA, functional RNA, or specific protein,
including regulatory sequences. "Genes" also include nonexpressed
DNA segments that, for example, form recognition sequences for
other proteins. "Genes" can be obtained from a variety of sources,
including cloning from a source of interest or synthesizing from
known or predicted sequence information, and may include sequences
designed to have desired parameters. An "allele" is one of several
alternative forms of a gene occupying a given locus on a
chromosome.
[0163] The term "nucleic acid" refers to deoxyribonucleic acid
(DNA) or ribonucleic acid (RNA) and polymers thereof in either
single- or double-stranded form, composed of monomers (nucleotides)
containing a sugar, phosphate and a base that is either a purine or
pyrimidine. Unless specifically limited, the term encompasses
nucleic acids containing known analogs of natural nucleotides that
have similar binding properties as the reference nucleic acid and
are metabolized in a manner similar to naturally occurring
nucleotides. Unless otherwise indicated, a particular nucleic acid
sequence also encompasses conservatively modified variants thereof
(e.g., degenerate codon substitutions) and complementary sequences,
as well as the sequence explicitly indicated. Specifically,
degenerate codon substitutions may be achieved by generating
sequences in which the third position of one or more selected (or
all) codons is substituted with mixed-base and/or deoxyinosine
residues. A "nucleic acid fragment" is a portion of a given nucleic
acid molecule.
[0164] A "nucleotide sequence" is a polymer of DNA or RNA that can
be single- or double-stranded, optionally containing synthetic,
non-natural or altered nucleotide bases capable of incorporation
into DNA or RNA polymers.
[0165] The terms "nucleic acid," "nucleic acid molecule," "nucleic
acid fragment," "nucleic acid sequence or segment," or
"polynucleotide" are used interchangeably and may also be used
interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
[0166] The invention encompasses isolated or substantially purified
nucleic acid compositions. In the context of the present invention,
an "isolated" or "purified" DNA molecule or RNA molecule is a DNA
molecule or RNA molecule that exists apart from its native
environment and is therefore not a product of nature. An isolated
DNA molecule or RNA molecule may exist in a purified form or may
exist in a non-native environment such as, for example, a
transgenic host cell. For example, an "isolated" or "purified"
nucleic acid molecule or biologically active portion thereof, is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
In one embodiment, an "isolated" nucleic acid is free of sequences
that naturally flank the nucleic acid (i.e., sequences located at
the 5' and 3' ends of the nucleic acid) in the genomic DNA of the
organism from which the nucleic acid is derived. For example, in
various embodiments, the isolated nucleic acid molecule can contain
less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequences that naturally flank the nucleic acid molecule
in genomic DNA of the cell from which the nucleic acid is derived.
Fragments and variants of the disclosed nucleotide sequences are
also encompassed by the present invention. By "fragment" or
"portion" is meant a full length or less than full length of the
nucleotide sequence.
[0167] "Naturally occurring," "native," or "wild-type" is used to
describe an object that can be found in nature as distinct from
being artificially produced. For example, a protein or nucleotide
sequence present in an organism (including a virus), which can be
isolated from a source in nature and that has not been
intentionally modified by a person in the laboratory, is naturally
occurring.
[0168] A "variant" of a molecule is a sequence that is
substantially similar to the sequence of the native molecule. For
nucleotide sequences, variants include those sequences that,
because of the degeneracy of the genetic code, encode the identical
amino acid sequence of the native protein. Naturally occurring
allelic variants such as these can be identified with the use of
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques. Variant
nucleotide sequences also include synthetically derived nucleotide
sequences, such as those generated, for example, by using
site-directed mutagenesis, which encode the native protein, as well
as those that encode a polypeptide having amino acid substitutions.
Generally, nucleotide sequence variants of the invention will have
at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least
85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, to 98%, sequence identity to the native (endogenous)
nucleotide sequence.
[0169] The term "chimeric" refers to a gene or DNA that contains 1)
DNA sequences, including regulatory and coding sequences that are
not found together in nature or 2) sequences encoding parts of
proteins not naturally adjoined, or 3) parts of promoters that are
not naturally adjoined. Accordingly, a chimeric gene may include
regulatory sequences and coding sequences that are derived from
different sources, or include regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different from that found in nature.
[0170] A "transgene" refers to a gene that has been introduced into
the genome by transformation. Transgenes include, for example, DNA
that is either heterologous or homologous to the DNA of a
particular cell to be transformed. Additionally, transgenes may
include native genes inserted into a non-native organism, or
chimeric genes.
[0171] The term "endogenous gene" refers to a native gene in its
natural location in the genome of an organism.
[0172] A "foreign" gene refers to a gene not normally found in the
host organism that has been introduced by gene transfer.
[0173] The terms "protein," "peptide" and "polypeptide" are used
interchangeably herein.
[0174] "Conservatively modified variations" of a particular nucleic
acid sequence refers to those nucleic acid sequences that encode
identical or essentially identical amino acid sequences. Because of
the degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given polypeptide. For instance,
the codons CGT, CGC, CGA, CGG, AGA and AGG all encode the amino
acid arginine. Thus, at every position where an arginine is
specified by a codon, the codon can be altered to any of the
corresponding codons described without altering the encoded
protein. Such nucleic acid variations are "silent variations,"
which are one species of "conservatively modified variations."
Every nucleic acid sequence described herein that encodes a
polypeptide also describes every possible silent variation, except
where otherwise noted. One of skill in the art will recognize that
each codon in a nucleic acid (except ATG, which is ordinarily the
only codon for methionine) can be modified to yield a functionally
identical molecule by standard techniques. Accordingly, each
"silent variation" of a nucleic acid that encodes a polypeptide is
implicit in each described sequence.
[0175] "Recombinant DNA molecule" is a combination of DNA sequences
that are joined together using recombinant DNA technology and
procedures used to join together DNA sequences as described, for
example, in Sambrook and Russell (2001).
[0176] The terms "heterologous gene", "heterologous DNA sequence",
"exogenous DNA sequence", "heterologous RNA sequence", "exogenous
RNA sequence" or "heterologous nucleic acid" each refer to a
sequence that either originates from a source foreign to the
particular host cell, or is from the same source but is modified
from its original or native form. Thus, a heterologous gene in a
host cell includes a gene that is endogenous to the particular host
cell but has been modified through, for example, the use of DNA
shuffling. The terms also include non-naturally occurring multiple
copies of a naturally occurring DNA or RNA sequence. Thus, the
terms refer to a DNA or RNA segment that is foreign or heterologous
to the cell, or homologous to the cell but in a position within the
host cell nucleic acid in which the element is not ordinarily
found. Exogenous DNA segments are expressed to yield exogenous
polypeptides.
[0177] A "homologous" DNA or RNA sequence is a sequence that is
naturally associated with a host cell into which it is
introduced.
[0178] "Wild-type" refers to the normal gene or organism found in
nature.
[0179] "Genome" refers to the complete genetic material of an
organism.
[0180] A "vector" is defined to include, inter alia, any viral
vector, as well as any plasmid, cosmid, phage or binary vector in
double or single stranded linear or circular form that may or may
not be self transmissible or mobilizable, and that can transform
prokaryotic or eukaryotic host either by integration into the
cellular genome or exist extrachromosomally (e.g., autonomous
replicating plasmid with an origin of replication).
[0181] "Expression cassette" as used herein means a nucleic acid
sequence capable of directing expression of a particular nucleotide
sequence in an appropriate host cell, which may include a promoter
operably linked to the nucleotide sequence of interest that may be
operably linked to termination signals. The coding region usually
codes for a functional RNA of interest, for example an siRNA. The
expression cassette including the nucleotide sequence of interest
may be chimeric. The expression cassette may also be one that is
naturally occurring but has been obtained in a recombinant form
useful for heterologous expression. The expression of the
nucleotide sequence in the expression cassette may be under the
control of a constitutive promoter or of an regulatable promoter
that initiates transcription only when the host cell is exposed to
some particular stimulus. In the case of a multicellular organism,
the promoter can also be specific to a particular tissue or organ
or stage of development.
[0182] Such expression cassettes can include a transcriptional
initiation region linked to a nucleotide sequence of interest. Such
an expression cassette is provided with a plurality of restriction
sites for insertion of the gene of interest to be under the
transcriptional regulation of the regulatory regions. The
expression cassette may additionally contain selectable marker
genes.
[0183] "Coding sequence" refers to a DNA or RNA sequence that codes
for a specific amino acid sequence. It may constitute an
"uninterrupted coding sequence", i.e., lacking an intron, such as
in a cDNA, or it may include one or more introns bounded by
appropriate splice junctions. An "intron" is a sequence of RNA that
is contained in the primary transcript but is removed through
cleavage and re-ligation of the RNA within the cell to create the
mature mRNA that can be translated into a protein.
[0184] The term "open reading frame" (ORF) refers to the sequence
between translation initiation and termination codons of a coding
sequence. The terms "initiation codon" and "termination codon"
refer to a unit of three adjacent nucleotides (a `codon`) in a
coding sequence that specifies initiation and chain termination,
respectively, of protein synthesis (mRNA translation).
[0185] "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme RNA, siRNA, or other RNA that may not be translated but
yet has an effect on at least one cellular process.
[0186] The term "RNA transcript" or "transcript" refers to the
product resulting from RNA polymerase catalyzed transcription of a
DNA sequence. When the RNA transcript is a perfect complementary
copy of the DNA sequence, it is referred to as the primary
transcript or it may be a RNA sequence derived from
posttranscriptional processing of the primary transcript and is
referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the
RNA that is without introns and that can be translated into protein
by the cell. "cDNA" refers to a single- or a double-stranded DNA
that is complementary to and derived from mRNA.
[0187] "Regulatory sequences" are nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences include enhancers,
promoters, translation leader sequences, introns, and
polyadenylation signal sequences. They include natural and
synthetic sequences as well as sequences that may be a combination
of synthetic and natural sequences. As is noted above, the term
"suitable regulatory sequences" is not limited to promoters.
However, some suitable regulatory sequences useful in the present
invention will include, but are not limited to constitutive
promoters, tissue-specific promoters, development-specific
promoters, regulatable promoters and viral promoters.
[0188] "5' non-coding sequence" refers to a nucleotide sequence
located 5' (upstream) to the coding sequence. It is present in the
fully processed mRNA upstream of the initiation codon and may
affect processing of the primary transcript to mRNA, mRNA stability
or translation efficiency (Turner et al., 1995).
[0189] "3' non-coding sequence" refers to nucleotide sequences
located 3' (downstream) to a coding sequence and may include
polyadenylation signal sequences and other sequences encoding
regulatory signals capable of affecting mRNA processing or gene
expression. The polyadenylation signal is usually characterized by
affecting the addition of polyadenylic acid tracts to the 3' end of
the mRNA precursor.
[0190] The term "translation leader sequence" refers to that DNA
sequence portion of a gene between the promoter and coding sequence
that is transcribed into RNA and is present in the fully processed
mRNA upstream (5') of the translation start codon. The translation
leader sequence may affect processing of the primary transcript to
mRNA, mRNA stability or translation efficiency.
[0191] The term "mature" protein refers to a post-translationally
processed polypeptide without its signal peptide. "Precursor"
protein refers to the primary product of translation of an mRNA.
"Signal peptide" refers to the amino terminal extension of a
polypeptide, which is translated in conjunction with the
polypeptide forming a precursor peptide and which is required for
its entrance into the secretory pathway. The term "signal sequence"
refers to a nucleotide sequence that encodes the signal
peptide.
[0192] "Promoter" refers to a nucleotide sequence, usually upstream
(5') to its coding sequence, which directs and/or controls the
expression of the coding sequence by providing the recognition for
RNA polymerase and other factors required for proper transcription.
"Promoter" includes a minimal promoter that is a short DNA sequence
comprised of a TATA-box and other sequences that serve to specify
the site of transcription initiation, to which regulatory elements
are added for control of expression. "Promoter" also refers to a
nucleotide sequence that includes a minimal promoter plus
regulatory elements that is capable of controlling the expression
of a coding sequence or functional RNA. This type of promoter
sequence consists of proximal and more distal upstream elements,
the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a DNA sequence that can stimulate promoter activity
and may be an innate element of the promoter or a heterologous
element inserted to enhance the level or tissue specificity of a
promoter. It is capable of operating in both orientations (normal
or flipped), and is capable of functioning even when moved either
upstream or downstream from the promoter. Both enhancers and other
upstream promoter elements bind sequence-specific DNA-binding
proteins that mediate their effects. Promoters may be derived in
their entirety from a native gene, or be composed of different
elements derived from different promoters found in nature, or even
be comprised of synthetic DNA segments. A promoter may also contain
DNA sequences that are involved in the binding of protein factors
that control the effectiveness of transcription initiation in
response to physiological or developmental conditions. Examples of
promoters that may be used in the present invention include the
mouse U6 RNA promoters, synthetic human H1RNA promoters, SV40, CMV,
RSV, RNA polymerase II and RNA polymerase III promoters.
[0193] The "initiation site" is the position surrounding the first
nucleotide that is part of the transcribed sequence, which is also
defined as position +1. With respect to this site all other
sequences of the gene and its controlling regions are numbered.
Downstream sequences (i.e., further protein encoding sequences in
the 3' direction) are denominated positive, while upstream
sequences (mostly of the controlling regions in the 5' direction)
are denominated negative.
[0194] Promoter elements, particularly a TATA element, that are
inactive or that have greatly reduced promoter activity in the
absence of upstream activation are referred to as "minimal or core
promoters." In the presence of a suitable transcription factor, the
minimal promoter functions to permit transcription. A "minimal or
core promoter" thus consists only of all basal elements needed for
transcription initiation, e.g., a TATA box and/or an initiator.
[0195] "Constitutive expression" refers to expression using a
constitutive or regulated promoter. "Conditional" and "regulated
expression" refer to expression controlled by a regulated
promoter.
[0196] "Operably-linked" refers to the association of nucleic acid
sequences on single nucleic acid fragment so that the function of
one of the sequences is affected by another. For example, a
regulatory DNA sequence is said to be "operably linked to" or
"associated with" a DNA sequence that codes for an RNA or a
polypeptide if the two sequences are situated such that the
regulatory DNA sequence affects expression of the coding DNA
sequence (i.e., that the coding sequence or functional RNA is under
the transcriptional control of the promoter). Coding sequences can
be operably-linked to regulatory sequences in sense or antisense
orientation.
[0197] "Expression" refers to the transcription and/or translation
of an endogenous gene, heterologous gene or nucleic acid segment,
or a transgene in cells. For example, in the case of siRNA
constructs, expression may refer to the transcription of the siRNA
only. In addition, expression refers to the transcription and
stable accumulation of sense (mRNA) or functional RNA. Expression
may also refer to the production of protein.
[0198] "Altered levels" refers to the level of expression in
transgenic cells or organisms that differs from that of normal or
untransformed cells or organisms.
[0199] "Overexpression" refers to the level of expression in
transgenic cells or organisms that exceeds levels of expression in
normal or untransformed cells or organisms.
[0200] "Antisense inhibition" refers to the production of antisense
RNA transcripts capable of suppressing the expression of protein
from an endogenous gene or a transgene.
[0201] "Transcription stop fragment" refers to nucleotide sequences
that contain one or more regulatory signals, such as
polyadenylation signal sequences, capable of terminating
transcription. Examples include the 3' non-regulatory regions of
genes encoding nopaline synthase and the small subunit of ribulose
bisphosphate carboxylase.
[0202] "Translation stop fragment" refers to nucleotide sequences
that contain one or more regulatory signals, such as one or more
termination codons in all three frames, capable of terminating
translation. Insertion of a translation stop fragment adjacent to
or near the initiation codon at the 5' end of the coding sequence
will result in no translation or improper translation. Excision of
the translation stop fragment by site-specific recombination will
leave a site-specific sequence in the coding sequence that does not
interfere with proper translation using the initiation codon.
[0203] The terms "cis-acting sequence" and "cis-acting element"
refer to DNA or RNA sequences whose functions require them to be on
the same molecule. An example of a cis-acting sequence on the
replicon is the viral replication origin.
[0204] The terms "trans-acting sequence" and "trans-acting element"
refer to DNA or RNA sequences whose function does not require them
to be on the same molecule.
[0205] "Chromosomally-integrated" refers to the integration of a
foreign gene or nucleic acid construct into the host DNA by
covalent bonds. Where genes are not "chromosomally integrated" they
may be "transiently expressed." Transient expression of a gene
refers to the expression of a gene that is not integrated into the
host chromosome but functions independently, either as part of an
autonomously replicating plasmid or expression cassette, for
example, or as part of another biological system such as a
virus.
[0206] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence," (b) "comparison window," (c) "sequence
identity," (d) "percentage of sequence identity," and (e)
"substantial identity."
[0207] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0208] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0209] Methods of alignment of sequences for comparison are
well-known in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm.
[0210] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters.
[0211] Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information. This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold. These initial neighborhood word hits act as seeds for
initiating searches to find longer HSPs containing them. The word
hits are then extended in both directions along each sequence for
as far as the cumulative alignment score can be increased.
Cumulative scores are calculated using, for nucleotide sequences,
the parameters M (reward score for a pair of matching residues;
always >0) and N (penalty score for mismatching residues; always
<0). For amino acid sequences, a scoring matrix is used to
calculate the cumulative score. Extension of the word hits in each
direction are halted when the cumulative alignment score falls off
by the quantity X from its maximum achieved value, the cumulative
score goes to zero or below due to the accumulation of one or more
negative-scoring residue alignments, or the end of either sequence
is reached.
[0212] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences. One measure of similarity
provided by the BLAST algorithm is the smallest sum probability
(P(N)), which provides an indication of the probability by which a
match between two nucleotide sequences would occur by chance. For
example, a test nucleic acid sequence is considered similar to a
reference sequence if the smallest sum probability in a comparison
of the test nucleic acid sequence to the reference nucleic acid
sequence is less than about 0.1, more preferably less than about
0.01, and most preferably less than about 0.001.
[0213] To obtain gapped alignments for comparison purposes, Gapped
BLAST (in BLAST 2.0) can be utilized. Alternatively, PSI-BLAST (in
BLAST 2.0) can be used to perform an iterated search that detects
distant relationships between molecules. When utilizing BLAST,
Gapped BLAST, PSI-BLAST, the default parameters of the respective
programs (e.g. BLASTN for nucleotide sequences) can be used. The
BLASTN program (for nucleotide sequences) uses as defaults a
wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100,
M=5, N=-4, and a comparison of both strands. Alignment may also be
performed manually by inspection.
[0214] For purposes of the present invention, comparison of
nucleotide sequences for determination of percent sequence identity
to the promoter sequences disclosed herein is preferably made using
the BlastN program (version 1.4.7 or later) with its default
parameters or any equivalent program. By "equivalent program" is
intended any sequence comparison program that, for any two
sequences in question, generates an alignment having identical
nucleotide matches and an identical percent sequence identity when
compared to the corresponding alignment generated by the preferred
program.
[0215] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid sequences makes reference to a
specified percentage of nucleotides in the two sequences that are
the same when aligned for maximum correspondence over a specified
comparison window, as measured by sequence comparison algorithms or
by visual inspection.
[0216] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0217] (e) The term "substantial identity" of polynucleotide
sequences means that a polynucleotide comprises a sequence that has
at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%,
preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or
89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most
preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity,
compared to a reference sequence using one of the alignment
programs described using standard parameters.
[0218] Another indication that nucleotide sequences are
substantially identical is if two molecules hybridize to each other
under stringent conditions. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength
and pH. However, stringent conditions encompass temperatures in the
range of about 1.degree. C. to about 20.degree. C., depending upon
the desired degree of stringency as otherwise qualified herein.
[0219] For sequence comparison, typically one sequence acts as a
reference sequence to which test sequences are compared. When using
a sequence comparison algorithm, test and reference sequences are
input into a computer, subsequence coordinates are designated if
necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0220] As noted above, another indication that two nucleic acid
sequences are substantially identical is that the two molecules
hybridize to each other under stringent conditions. The phrase
"hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence
under stringent conditions when that sequence is present in a
complex mixture (e.g., total cellular) DNA or RNA. "Bind(s)
substantially" refers to complementary hybridization between a
probe nucleic acid and a target nucleic acid and embraces minor
mismatches that can be accommodated by reducing the stringency of
the hybridization media to achieve the desired detection of the
target nucleic acid sequence.
[0221] "Stringent hybridization conditions" and "stringent
hybridization wash conditions" in the context of nucleic acid
hybridization experiments such as Southern and Northern
hybridizations are sequence dependent, and are different under
different environmental parameters. Longer sequences hybridize
specifically at higher temperatures. The Tm is the temperature
(under defined ionic strength and pH) at which 50% of the target
sequence hybridizes to a perfectly matched probe. Specificity is
typically the function of post-hybridization washes, the critical
factors being the ionic strength and temperature of the final wash
solution. For DNA-DNA hybrids, the Tm can be approximated from the
equation of Meinkoth and Wahl (1984); Tm 81.5.degree. C.+16.6 (log
M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. Tm is reduced by about 1.degree. C. for each
1% of mismatching; thus, Tm, hybridization, and/or wash conditions
can be adjusted to hybridize to sequences of the desired identity.
For example, if sequences with >90% identity are sought, the Tm
can be decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (Tm) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (Tm); moderately
stringent conditions can utilize a hybridization and/or wash at 6,
7, 8, 9, or 10.degree. C. lower than the thermal melting point
(Tm); low stringency conditions can utilize a hybridization and/or
wash at 11, 12, 13, 14, 15, or 20.degree. C. lower than the thermal
melting point (Tm). Using the equation, hybridization and wash
compositions, and desired T, those of ordinary skill will
understand that variations in the stringency of hybridization
and/or wash solutions are inherently described. If the desired
degree of mismatching results in a T of less than 45.degree. C.
(aqueous solution) or 32.degree. C. (formamide solution), it is
preferred to increase the SSC concentration so that a higher
temperature can be used. An extensive guide to the hybridization of
nucleic acids is found in Tijssen (1993). Generally, highly
stringent hybridization and wash conditions are selected to be
about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence at a defined ionic strength and pH.
[0222] An example of highly stringent wash conditions is 0.15 M
NaCl at 72.degree. C. for about 15 minutes. An example of stringent
wash conditions is a 0.2.times.SSC wash at 65.degree. C. for 15
minutes (see, Sambrook and Russell 2001, for a description of SSC
buffer). Often, a high stringency wash is preceded by a low
stringency wash to remove background probe signal. For short
nucleic acid sequences (e.g., about 10 to 50 nucleotides),
stringent conditions typically involve salt concentrations of less
than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion
concentration (or other salts) at pH 7.0 to 8.3, and the
temperature is typically at least about 30.degree. C. Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. In general, a signal to noise ratio of
2.times. (or higher) than that observed for an unrelated probe in
the particular hybridization assay indicates detection of a
specific hybridization. Very stringent conditions are selected to
be equal to the Tm for a particular nucleic acid molecule.
[0223] Very stringent conditions are selected to be equal to the
T.sub.m for a particular probe. An example of stringent conditions
for hybridization of complementary nucleic acids which have more
than 100 complementary residues on a filter in a Southern or
Northern blot is 50% formamide, e.g., hybridization in 50%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C.
[0224] The term "transformation" refers to the transfer of a
nucleic acid fragment into the genome of a host cell, resulting in
genetically stable inheritance. A "host cell" is a cell that has
been transformed, or is capable of transformation, by an exogenous
nucleic acid molecule. Host cells containing the transformed
nucleic acid fragments are referred to as "transgenic" cells.
[0225] "Transformed," "transduced," "transgenic" and "recombinant"
refer to a host cell into which a heterologous nucleic acid
molecule has been introduced. As used herein the term
"transfection" refers to the delivery of DNA into eukaryotic (e.g.,
mammalian) cells. The term "transformation" is used herein to refer
to delivery of DNA into prokaryotic (e.g., E. coli) cells. The term
"transduction" is used herein to refer to infecting cells with
viral particles. The nucleic acid molecule can be stably integrated
into the genome generally known in the art. Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers, partially
mismatched primers, and the like. For example, "transformed,"
"transformant," and "transgenic" cells have been through the
transformation process and contain a foreign gene integrated into
their chromosome. The term "untransformed" refers to normal cells
that have not been through the transformation process.
[0226] "Genetically altered cells" denotes cells which have been
modified by the introduction of recombinant or heterologous nucleic
acids (e.g., one or more DNA constructs or their RNA counterparts)
and further includes the progeny of such cells which retain part or
all of such genetic modification.
[0227] As used herein, the term "derived" or "directed to" with
respect to a nucleotide molecule means that the molecule has
complementary sequence identity to a particular molecule of
interest.
[0228] "Gene silencing" refers to the suppression of gene
expression, e.g., transgene, heterologous gene and/or endogenous
gene expression. Gene silencing may be mediated through processes
that affect transcription and/or through processes that affect
post-transcriptional mechanisms. In some embodiments, gene
silencing occurs when siRNA initiates the degradation of the mRNA
of a gene of interest in a sequence-specific manner via RNA
interference (for a review, see Brantl, 2002). In some embodiments,
gene silencing may be allele-specific. "Allele-specific" gene
silencing refers to the specific silencing of one allele of a
gene.
[0229] "Knock-down," "knock-down technology" refers to a technique
of gene silencing in which the expression of a target gene is
reduced as compared to the gene expression prior to the
introduction of the siRNA, which can lead to the inhibition of
production of the target gene product. The term "reduced" is used
herein to indicate that the target gene expression is lowered by
1-100%. For example, the expression may be reduced by 10, 20, 30,
40, 50, 60, 70, 80, 90, 95, or even 99%. Knock-down of gene
expression can be directed by the use of dsRNAs or siRNAs. For
example, "RNA interference (RNAi)," which can involve the use of
siRNA, has been successfully applied to knockdown the expression of
specific genes in plants, D. melanogaster, C. elegans,
trypanosomes, planaria, hydra, and several vertebrate species
including the mouse. For a review of the mechanisms proposed to
mediate RNAi, please refer to Bass et al., 2001, Elbashir et al.,
2001 or Brantl 2002.
[0230] "RNA interference (RNAi)" is the process of
sequence-specific, post-transcriptional gene silencing initiated by
siRNA. RNAi is seen in a number of organisms such as Drosophila,
nematodes, fungi and plants, and is believed to be involved in
anti-viral defense, modulation of transposon activity, and
regulation of gene expression. During RNAi, siRNA induces
degradation of target mRNA with consequent sequence-specific
inhibition of gene expression.
[0231] A "small interfering" or "short interfering RNA" or siRNA is
a RNA duplex of nucleotides that is targeted to a gene interest. A
"RNA duplex" refers to the structure formed by the complementary
pairing between two regions of a RNA molecule. siRNA is "targeted"
to a gene in that the nucleotide sequence of the duplex portion of
the siRNA is complementary to a nucleotide sequence of the targeted
gene. In some embodiments, the length of the duplex of siRNAs is
less than 30 nucleotides. In some embodiments, the duplex can be
29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13,
12, 11 or 10 nucleotides in length. In some embodiments, the length
of the duplex is 19-25 nucleotides in length. The RNA duplex
portion of the siRNA can be part of a hairpin structure. In
addition to the duplex portion, the hairpin structure may contain a
loop portion positioned between the two sequences that form the
duplex. The loop can vary in length. In some embodiments the loop
is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. The
hairpin structure can also contain 3' or 5' overhang portions. In
some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3,
4 or 5 nucleotides in length. Examples of shRNA specific for
huntingin are encoded by the DNA sequences provided in FIGS. 20A-C.
The "sense" and "antisense" sequences can be used with or without
the loop region indicated to form siRNA molecules. Other loop
regions can be substituted for the examples provided in this chart.
As used herein, the term siRNA is meant to be equivalent to other
terms used to describe nucleic acid molecules that are capable of
mediating sequence specific RNAi, for example, double-stranded RNA
(dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short
interfering oligonucleotide, short interfering nucleic acid,
post-transcriptional gene silencing RNA (ptgsRNA), and others. In
addition, as used herein, the term RNAi is meant to be equivalent
to other terms used to describe sequence specific RNA interference,
such as post transcriptional gene silencing, translational
inhibition, or epigenetic silencing. For example, siRNA molecules
of the invention can be used to epigenetically silence genes at
both the post-transcriptional level or the pre-transcriptional
level. In a non-limiting example, epigenetic modulation of gene
expression by siRNA molecules of the invention can result from
siRNA mediated modification of chromatin structure or methylation
pattern to alter gene expression (see, for example, Verdel et al.,
2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303,
669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al.,
2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297,
2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). In
another non-limiting example, modulation of gene expression by
siRNA molecules of the invention can result from siRNA mediated
cleavage of RNA (either coding or non-coding RNA) via RISC, or
alternately, translational inhibition as is known in the art.
[0232] The siRNA can be encoded by a nucleic acid sequence, and the
nucleic acid sequence can also include a promoter. The nucleic acid
sequence can also include a polyadenylation signal. In some
embodiments, the polyadenylation signal is a synthetic minimal
polyadenylation signal.
[0233] "Treating" as used herein refers to ameliorating at least
one symptom of, curing and/or preventing the development of a
disease or a condition.
[0234] "Neurological disease" and "neurological disorder" refer to
both hereditary and sporadic conditions that are characterized by
nervous system dysfunction, and which may be associated with
atrophy of the affected central or peripheral nervous system
structures, or loss of function without atrophy. A neurological
disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not
limited to, amyotrophic lateral sclerosis (ALS), hereditary spastic
hemiplegia, primary lateral sclerosis, spinal muscular atrophy,
Kennedy's disease, Alzheimer's disease, Parkinson's disease,
multiple sclerosis, and repeat expansion neurodegenerative
diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat
diseases, e.g., Huntington's disease (HD), spinocerebellar ataxia
(SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17), spinal and bulbar
muscular atrophy (SBMA), dentatorubropallidoluysian atrophy
(DRPLA). An example of a neurological disorder that does not appear
to result in atrophy is DYT1 dystonia.
[0235] The siRNAs of the present invention can be generated by any
method known to the art, for example, by in vitro transcription,
recombinantly, or by synthetic means. In one example, the siRNAs
can be generated in vitro by using a recombinant enzyme, such as T7
RNA polymerase, and DNA oligonucleotide templates.
[0236] II. Nucleic Acid Molecules of the Invention
[0237] The terms "isolated and/or purified" refer to in vitro
isolation of a nucleic acid, e.g., a DNA or RNA molecule from its
natural cellular environment, and from association with other
components of the cell, such as nucleic acid or polypeptide, so
that it can be sequenced, replicated, and/or expressed. For
example, "isolated nucleic acid" may be a DNA molecule containing
less than 31 sequential nucleotides that is transcribed into an
siRNA. Such an isolated siRNA may, for example, form a hairpin
structure with a duplex 21 base pairs in length that is
complementary or hybridizes to a sequence in a gene of interest,
and remains stably bound under stringent conditions (as defined by
methods well known in the art, e.g., in Sambrook and Russell,
2001). Thus, the RNA or DNA is "isolated" in that it is free from
at least one contaminating nucleic acid with which it is normally
associated in the natural source of the RNA or DNA and is
preferably substantially free of any other mammalian RNA or DNA.
The phrase "free from at least one contaminating source nucleic
acid with which it is normally associated" includes the case where
the nucleic acid is reintroduced into the source or natural cell
but is in a different chromosomal location or is otherwise flanked
by nucleic acid sequences not normally found in the source cell,
e.g., in a vector or plasmid.
[0238] In addition to a DNA sequence encoding a siRNA, the nucleic
acid molecules of the invention include double-stranded interfering
RNA molecules, which are also useful to inhibit expression of a
target gene.
[0239] As used herein, the term "recombinant nucleic acid", e.g.,
"recombinant DNA sequence or segment" refers to a nucleic acid,
e.g., to DNA, that has been derived or isolated from any
appropriate cellular source, that may be subsequently chemically
altered in vitro, so that its sequence is not naturally occurring,
or corresponds to naturally occurring sequences that are not
positioned as they would be positioned in a genome which has not
been transformed with exogenous DNA. An example of preselected DNA
"derived" from a source, would be a DNA sequence that is identified
as a useful fragment within a given organism, and which is then
chemically synthesized in essentially pure form. An example of such
DNA "isolated" from a source would be a useful DNA sequence that is
excised or removed from said source by chemical means, e.g., by the
use of restriction endonucleases, so that it can be further
manipulated, e.g., amplified, for use in the invention, by the
methodology of genetic engineering.
[0240] Thus, recovery or isolation of a given fragment of DNA from
a restriction digest can employ separation of the digest on
polyacrylamide or agarose gel by electrophoresis, identification of
the fragment of interest by comparison of its mobility versus that
of marker DNA fragments of known molecular weight, removal of the
gel section containing the desired fragment, and separation of the
gel from DNA. Therefore, "recombinant DNA" includes completely
synthetic DNA sequences, semi-synthetic DNA sequences, DNA
sequences isolated from biological sources, and DNA sequences
derived from RNA, as well as mixtures thereof.
[0241] Nucleic acid molecules having base substitutions (i.e.,
variants) are prepared by a variety of methods known in the art.
These methods include, but are not limited to, isolation from a
natural source (in the case of naturally occurring sequence
variants) or preparation by oligonucleotide-mediated (or
site-directed) mutagenesis, PCR mutagenesis, and cassette
mutagenesis of an earlier prepared variant or a non-variant version
of the nucleic acid molecule.
[0242] Oligonucleotide-mediated mutagenesis is a method for
preparing substitution variants. This technique is known in the art
as described by Adelman et al. (1983). Briefly, nucleic acid
encoding a siRNA can be altered by hybridizing an oligonucleotide
encoding the desired mutation to a DNA template, where the template
is the single-stranded form of a plasmid or bacteriophage
containing the unaltered or native gene sequence. After
hybridization, a DNA polymerase is used to synthesize an entire
second complementary strand of the template that will thus
incorporate the oligonucleotide primer, and will code for the
selected alteration in the nucleic acid encoding siRNA. Generally,
oligonucleotides of at least 25 nucleotides in length are used. An
optimal oligonucleotide will have 12 to 15 nucleotides that are
completely complementary to the template on either side of the
nucleotide(s) coding for the mutation. This ensures that the
oligonucleotide will hybridize properly to the single-stranded DNA
template molecule. The oligonucleotides are readily synthesized
using techniques known in the art.
[0243] The DNA template can be generated by those vectors that are
either derived from bacteriophage M13 vectors (the commercially
available M13mp18 and M13mp19 vectors are suitable), or those
vectors that contain a single-stranded phage origin of replication.
Thus, the DNA that is to be mutated may be inserted into one of
these vectors to generate single-stranded template. Production of
the single-stranded template is described in Chapter 3 of Sambrook
and Russell, 2001. Alternatively, single-stranded DNA template may
be generated by denaturing double-stranded plasmid (or other) DNA
using standard techniques.
[0244] For alteration of the native DNA sequence (to generate amino
acid sequence variants, for example), the oligonucleotide is
hybridized to the single-stranded template under suitable
hybridization conditions. A DNA polymerizing enzyme, usually the
Klenow fragment of DNA polymerase I, is then added to synthesize
the complementary strand of the template using the oligonucleotide
as a primer for synthesis. A heteroduplex molecule is thus formed
such that one strand of DNA encodes the mutated form of the DNA,
and the other strand (the original template) encodes the native,
unaltered sequence of the DNA. This heteroduplex molecule is then
transformed into a suitable host cell, usually a prokaryote such as
E. coli JM101. After the cells are grown, they are plated onto
agarose plates and screened using the oligonucleotide primer
radiolabeled with 32-phosphate to identify the bacterial colonies
that contain the mutated DNA. The mutated region is then removed
and placed in an appropriate vector, generally an expression vector
of the type typically employed for transformation of an appropriate
host.
[0245] The method described immediately above may be modified such
that a homoduplex molecule is created wherein both strands of the
plasmid contain the mutations(s). The modifications are as follows:
The single-stranded oligonucleotide is annealed to the
single-stranded template as described above. A mixture of three
deoxyribonucleotides, deoxyriboadenosine (dATP), deoxyriboguanosine
(dGTP), and deoxyribothymidine (dTTP), is combined with a modified
thiodeoxyribocytosine called dCTP-(*S) (which can be obtained from
the Amersham Corporation). This mixture is added to the
template-oligonucleotide complex. Upon addition of DNA polymerase
to this mixture, a strand of DNA identical to the template except
for the mutated bases is generated. In addition, this new strand of
DNA will contain dCTP-(*S) instead of dCTP, which serves to protect
it from restriction endonuclease digestion.
[0246] After the template strand of the double-stranded
heteroduplex is nicked with an appropriate restriction enzyme, the
template strand can be digested with ExoIII nuclease or another
appropriate nuclease past the region that contains the site(s) to
be mutagenized. The reaction is then stopped to leave a molecule
that is only partially single-stranded. A complete double-stranded
DNA homoduplex is then formed using DNA polymerase in the presence
of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase.
This homoduplex molecule can then be transformed into a suitable
host cell such as E. coli JM101.
[0247] There are well-established criteria for designing siRNAs
(see, e.g., Elbashire et al., 2001a, 2001b, 2001c). Details can be
found in the websites of several commercial vendors such as Ambion,
Dharmacon and Oligoengine. However, since the mechanism for siRNAs
suppressing gene expression is not entirely understood and siRNAs
selected from different regions of the same gene do not work as
equally effective, very often a number of siRNAs have to be
generated at the same time in order to compare their
effectiveness.
[0248] III. Expression Cassettes of the Invention
[0249] To prepare expression cassettes, the recombinant DNA
sequence or segment may be circular or linear, double-stranded or
single-stranded. Generally, the DNA sequence or segment is in the
form of chimeric DNA, such as plasmid DNA or a vector that can also
contain coding regions flanked by control sequences that promote
the expression of the recombinant DNA present in the resultant
transformed cell.
[0250] A "chimeric" vector or expression cassette, as used herein,
means a vector or cassette including nucleic acid sequences from at
least two different species, or has a nucleic acid sequence from
the same species that is linked or associated in a manner that does
not occur in the "native" or wild type of the species.
[0251] Aside from recombinant DNA sequences that serve as
transcription units for an RNA transcript, or portions thereof, a
portion of the recombinant DNA may be untranscribed, serving a
regulatory or a structural function. For example, the recombinant
DNA may have a promoter that is active in mammalian cells.
[0252] Other elements functional in the host cells, such as
introns, enhancers, polyadenylation sequences and the like, may
also be a part of the recombinant DNA. Such elements may or may not
be necessary for the function of the DNA, but may provide improved
expression of the DNA by affecting transcription, stability of the
siRNA, or the like. Such elements may be included in the DNA as
desired to obtain the optimal performance of the siRNA in the
cell.
[0253] Control sequences are DNA sequences necessary for the
expression of an operably linked coding sequence in a particular
host organism. The control sequences that are suitable for
prokaryotic cells, for example, include a promoter, and optionally
an operator sequence, and a ribosome binding site. Eukaryotic cells
are known to utilize promoters, polyadenylation signals, and
enhancers.
[0254] Operably linked nucleic acids are nucleic acids placed in a
functional relationship with another nucleic acid sequence. For
example, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence; or a
ribosome binding site is operably linked to a coding sequence if it
is positioned so as to facilitate translation. Generally, operably
linked DNA sequences are DNA sequences that are linked are
contiguous. However, enhancers do not have to be contiguous.
Linking is accomplished by ligation at convenient restriction
sites. If such sites do not exist, the synthetic oligonucleotide
adaptors or linkers are used in accord with conventional
practice.
[0255] The recombinant DNA to be introduced into the cells may
contain either a selectable marker gene or a reporter gene or both
to facilitate identification and selection of expressing cells from
the population of cells sought to be transfected or infected
through viral vectors. In other embodiments, the selectable marker
may be carried on a separate piece of DNA and used in a
co-transfection procedure. Both selectable markers and reporter
genes may be flanked with appropriate regulatory sequences to
enable expression in the host cells. Useful selectable markers are
known in the art and include, for example, antibiotic-resistance
genes, such as neo and the like.
[0256] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. Reporter genes that encode for easily
assayable proteins are well known in the art. In general, a
reporter gene is a gene that is not present in or expressed by the
recipient organism or tissue and that encodes a protein whose
expression is manifested by some easily detectable property, e.g.,
enzymatic activity. For example, reporter genes include the
chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli
and the luciferase gene from firefly Photinus pyralis. Expression
of the reporter gene is assayed at a suitable time after the DNA
has been introduced into the recipient cells.
[0257] The general methods for constructing recombinant DNA that
can transfect target cells are well known to those skilled in the
art, and the same compositions and methods of construction may be
utilized to produce the DNA useful herein. For example, Sambrook
and Russell, infra, provides suitable methods of construction.
[0258] The recombinant DNA can be readily introduced into the host
cells, e.g., mammalian, bacterial, yeast or insect cells by
transfection with an expression vector composed of DNA encoding the
siRNA by any procedure useful for the introduction into a
particular cell, e.g., physical or biological methods, to yield a
cell having the recombinant DNA stably integrated into its genome
or existing as a episomal element, so that the DNA molecules, or
sequences of the present invention are expressed by the host cell.
Preferably, the DNA is introduced into host cells via a vector. The
host cell is preferably of eukaryotic origin, e.g., plant,
mammalian, insect, yeast or fungal sources, but host cells of
non-eukaryotic origin may also be employed.
[0259] Physical methods to introduce a preselected DNA into a host
cell include calcium phosphate precipitation, lipofection, particle
bombardment, microinjection, electroporation, and the like.
Biological methods to introduce the DNA of interest into a host
cell include the use of DNA and RNA viral vectors. For mammalian
gene therapy, as described herein below, it is desirable to use an
efficient means of inserting a copy gene into the host genome.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from poxviruses,
herpes simplex virus I, adenoviruses and adeno-associated viruses,
and the like. See, for example, U.S. Pat. Nos. 5,350,674 and
5,585,362.
[0260] As discussed above, a "transfected", "or "transduced" host
cell or cell line is one in which the genome has been altered or
augmented by the presence of at least one heterologous or
recombinant nucleic acid sequence. The host cells of the present
invention are typically produced by transfection with a DNA
sequence in a plasmid expression vector, a viral expression vector,
or as an isolated linear DNA sequence. The transfected DNA can
become a chromosomally integrated recombinant DNA sequence, which
is composed of sequence encoding the siRNA.
[0261] To confirm the presence of the recombinant DNA sequence in
the host cell, a variety of assays may be performed. Such assays
include, for example, "molecular biological" assays well known to
those of skill in the art, such as Southern and Northern blotting,
RT-PCR and PCR; "biochemical" assays, such as detecting the
presence or absence of a particular peptide, e.g., by immunological
means (ELISAs and Western blots) or by assays described herein to
identify agents falling within the scope of the invention.
[0262] To detect and quantitate RNA produced from introduced
recombinant DNA segments, RT-PCR may be employed. In this
application of PCR, it is first necessary to reverse transcribe RNA
into DNA, using enzymes such as reverse transcriptase, and then
through the use of conventional PCR techniques amplify the DNA. In
most instances PCR techniques, while useful, will not demonstrate
integrity of the RNA product. Further information about the nature
of the RNA product may be obtained by Northern blotting. This
technique demonstrates the presence of an RNA species and gives
information about the integrity of that RNA. The presence or
absence of an RNA species can also be determined using dot or slot
blot Northern hybridizations. These techniques are modifications of
Northern blotting and only demonstrate the presence or absence of
an RNA species.
[0263] While Southern blotting and PCR may be used to detect the
recombinant DNA segment in question, they do not provide
information as to whether the preselected DNA segment is being
expressed. Expression may be evaluated by specifically identifying
the peptide products of the introduced recombinant DNA sequences or
evaluating the phenotypic changes brought about by the expression
of the introduced recombinant DNA segment in the host cell.
[0264] The instant invention provides a cell expression system for
expressing exogenous nucleic acid material in a mammalian
recipient. The expression system, also referred to as a
"genetically modified cell", comprises a cell and an expression
vector for expressing the exogenous nucleic acid material. The
genetically modified cells are suitable for administration to a
mammalian recipient, where they replace the endogenous cells of the
recipient. Thus, the preferred genetically modified cells are
non-immortalized and are non-tumorigenic.
[0265] According to one embodiment, the cells are transfected or
otherwise genetically modified ex vivo. The cells are isolated from
a mammal (preferably a human), nucleic acid introduced (i.e.,
transduced or transfected in vitro) with a vector for expressing a
heterologous (e.g., recombinant) gene encoding the therapeutic
agent, and then administered to a mammalian recipient for delivery
of the therapeutic agent in situ. The mammalian recipient may be a
human and the cells to be modified are autologous cells, i.e., the
cells are isolated from the mammalian recipient.
[0266] According to another embodiment, the cells are transfected
or transduced or otherwise genetically modified in vivo. The cells
from the mammalian recipient are transduced or transfected in vivo
with a vector containing exogenous nucleic acid material for
expressing a heterologous (e.g., recombinant) gene encoding a
therapeutic agent and the therapeutic agent is delivered in
situ.
[0267] As used herein, "exogenous nucleic acid material" refers to
a nucleic acid or an oligonucleotide, either natural or synthetic,
which is not naturally found in the cells; or if it is naturally
found in the cells, is modified from its original or native form.
Thus, "exogenous nucleic acid material" includes, for example, a
non-naturally occurring nucleic acid that can be transcribed into
an anti-sense RNA, a siRNA, as well as a "heterologous gene" (i.e.,
a gene encoding a protein that is not expressed or is expressed at
biologically insignificant levels in a naturally-occurring cell of
the same type). To illustrate, a synthetic or natural gene encoding
human erythropoietin (EPO) would be considered "exogenous nucleic
acid material" with respect to human peritoneal mesothelial cells
since the latter cells do not naturally express EPO. Still another
example of "exogenous nucleic acid material" is the introduction of
only part of a gene to create a recombinant gene, such as combining
an regulatable promoter with an endogenous coding sequence via
homologous recombination.
[0268] IV. Methods for Introducing the Expression Cassettes of the
Invention into Cells
[0269] The condition amenable to gene inhibition therapy may be a
prophylactic process, i.e., a process for preventing disease or an
undesired medical condition. Thus, the instant invention embraces a
system for delivering siRNA that has a prophylactic function (i.e.,
a prophylactic agent) to the mammalian recipient.
[0270] The inhibitory nucleic acid material (e.g., an expression
cassette encoding siRNA directed to a gene of interest) can be
introduced into the cell ex vivo or in vivo by genetic transfer
methods, such as transfection or transduction, to provide a
genetically modified cell. Various expression vectors (i.e.,
vehicles for facilitating delivery of exogenous nucleic acid into a
target cell) are known to one of ordinary skill in the art.
[0271] As used herein, "transfection of cells" refers to the
acquisition by a cell of new nucleic acid material by incorporation
of added DNA. Thus, transfection refers to the insertion of nucleic
acid into a cell using physical or chemical methods. Several
transfection techniques are known to those of ordinary skill in the
art including calcium phosphate DNA co-precipitation, DEAE-dextran,
electroporation, cationic liposome-mediated transfection, tungsten
particle-facilitated microparticle bombardment, and strontium
phosphate DNA co-precipitation.
[0272] In contrast, "transduction of cells" refers to the process
of transferring nucleic acid into a cell using a DNA or RNA virus.
A RNA virus (i.e., a retrovirus) for transferring a nucleic acid
into a cell is referred to herein as a transducing chimeric
retrovirus. Exogenous nucleic acid material contained within the
retrovirus is incorporated into the genome of the transduced cell.
A cell that has been transduced with a chimeric DNA virus (e.g., an
adenovirus carrying a cDNA encoding a therapeutic agent), will not
have the exogenous nucleic acid material incorporated into its
genome but will be capable of expressing the exogenous nucleic acid
material that is retained extrachromosomally within the cell.
[0273] The exogenous nucleic acid material can include the nucleic
acid encoding the siRNA together with a promoter to control
transcription. The promoter characteristically has a specific
nucleotide sequence necessary to initiate transcription. The
exogenous nucleic acid material may further include additional
sequences (i.e., enhancers) required to obtain the desired gene
transcription activity. For the purpose of this discussion an
"enhancer" is simply any non-translated DNA sequence that works
with the coding sequence (in cis) to change the basal transcription
level dictated by the promoter. The exogenous nucleic acid material
may be introduced into the cell genome immediately downstream from
the promoter so that the promoter and coding sequence are
operatively linked so as to permit transcription of the coding
sequence. An expression vector can include an exogenous promoter
element to control transcription of the inserted exogenous gene.
Such exogenous promoters include both constitutive and regulatable
promoters.
[0274] Naturally-occurring constitutive promoters control the
expression of essential cell functions. As a result, a nucleic acid
sequence under the control of a constitutive promoter is expressed
under all conditions of cell growth. Constitutive promoters include
the promoters for the following genes which encode certain
constitutive or "housekeeping" functions: hypoxanthine
phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR),
adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase,
phosphoglycerol mutase, the beta.quadrature.-actin promoter, and
other constitutive promoters known to those of skill in the art. In
addition, many viral promoters function constitutively in
eukaryotic cells. These include: the early and late promoters of
SV40; the long terminal repeats (LTRs) of Moloney Leukemia Virus
and other retroviruses; and the thymidine kinase promoter of Herpes
Simplex Virus, among many others.
[0275] Nucleic acid sequences that are under the control of
regulatable promoters are expressed only or to a greater or lesser
degree in the presence of an inducing or repressing agent, (e.g.,
transcription under control of the metallothionein promoter is
greatly increased in presence of certain metal ions). Regulatable
promoters include responsive elements (REs) that stimulate
transcription when their inducing factors are bound. For example,
there are REs for serum factors, steroid hormones, retinoic acid,
cyclic AMP, and tetracycline and doxycycline. Promoters containing
a particular RE can be chosen in order to obtain an regulatable
response and in some cases, the RE itself may be attached to a
different promoter, thereby conferring regulatability to the
encoded nucleic acid sequence. Thus, by selecting the appropriate
promoter (constitutive versus regulatable; strong versus weak), it
is possible to control both the existence and level of expression
of a nucleic acid sequence in the genetically modified cell. If the
nucleic acid sequence is under the control of an regulatable
promoter, delivery of the therapeutic agent in situ is triggered by
exposing the genetically modified cell in situ to conditions for
permitting transcription of the nucleic acid sequence, e.g., by
intraperitoneal injection of specific inducers of the regulatable
promoters which control transcription of the agent. For example, in
situ expression of a nucleic acid sequence under the control of the
metallothionein promoter in genetically modified cells is enhanced
by contacting the genetically modified cells with a solution
containing the appropriate (i.e., inducing) metal ions in situ.
[0276] Accordingly, the amount of siRNA generated in situ is
regulated by controlling such factors as the nature of the promoter
used to direct transcription of the nucleic acid sequence, (i.e.,
whether the promoter is constitutive or regulatable, strong or
weak) and the number of copies of the exogenous nucleic acid
sequence encoding a siRNA sequence that are in the cell.
[0277] In one embodiment of the present invention, an expression
cassette may contain a pol II promoter that is operably linked to a
nucleic acid sequence encoding a siRNA. Thus, the pol II promoter,
i.e., a RNA polymerase II dependent promoter, initiates the
transcription of the siRNA. In another embodiment, the pol II
promoter is regulatable.
[0278] A pol II promoter may be used in its entirety, or a portion
or fragment of the promoter sequence may be used in which the
portion maintains the promoter activity. As discussed herein, pol
II promoters are known to a skilled person in the art and include
the promoter of any protein-encoding gene, e.g., an endogenously
regulated gene or a constitutively expressed gene. For example, the
promoters of genes regulated by cellular physiological events,
e.g., heat shock, oxygen levels and/or carbon monoxide levels,
e.g., in hypoxia, may be used in the expression cassettes of the
invention. In addition, the promoter of any gene regulated by the
presence of a pharmacological agent, e.g., tetracycline and
derivatives thereof, as well as heavy metal ions and hormones may
be employed in the expression cassettes of the invention. In an
embodiment of the invention, the pol II promoter can be the CMV
promoter or the RSV promoter. In another embodiment, the pol II
promoter is the CMV promoter.
[0279] As discussed above, a pol II promoter of the invention may
be one naturally associated with an endogenously regulated gene or
sequence, as may be obtained by isolating the 5' non-coding
sequences located upstream of the coding segment and/or exon. The
pol II promoter of the expression cassette can be, for example, the
same pol II promoter driving expression of the targeted gene of
interest. Alternatively, the nucleic acid sequence encoding the
siRNA may be placed under the control of a recombinant or
heterologous pol II promoter, which refers to a promoter that is
not normally associated with the targeted gene's natural
environment. Such promoters include promoters isolated from any
eukaryotic cell, and promoters not "naturally occurring," i.e.,
containing different elements of different transcriptional
regulatory regions, and/or mutations that alter expression. In
addition to producing nucleic acid sequences of promoters
synthetically, sequences may be produced using recombinant cloning
and/or nucleic acid amplification technology, including PCR.TM., in
connection with the compositions disclosed herein (see U.S. Pat.
No. 4,683,202, U.S. Pat. No. 5,928,906, each incorporated herein by
reference).
[0280] In one embodiment, a pol II promoter that effectively
directs the expression of the siRNA in the cell type, organelle,
and organism chosen for expression will be employed. Those of
ordinary skill in the art of molecular biology generally know the
use of promoters for protein expression, for example, see Sambrook
and Russell (2001), incorporated herein by reference. The promoters
employed may be constitutive, tissue-specific, inducible, and/or
useful under the appropriate conditions to direct high level
expression of the introduced DNA segment, such as is advantageous
in the large-scale production of recombinant proteins and/or
peptides. The identity of tissue-specific promoters, as well as
assays to characterize their activity, is well known to those of
ordinary skill in the art.
[0281] In addition to at least one promoter and at least one
heterologous nucleic acid sequence encoding the siRNA, the
expression vector may include a selection gene, for example, a
neomycin resistance gene, for facilitating selection of cells that
have been transfected or transduced with the expression vector.
[0282] Cells can also be transfected with two or more expression
vectors, at least one vector containing the nucleic acid
sequence(s) encoding the siRNA(s), the other vector containing a
selection gene. The selection of a suitable promoter, enhancer,
selection gene and/or signal sequence is deemed to be within the
scope of one of ordinary skill in the art without undue
experimentation.
[0283] The following discussion is directed to various utilities of
the instant invention. For example, the instant invention has
utility as an expression system suitable for silencing the
expression of gene(s) of interest.
[0284] The instant invention also provides methods for genetically
modifying cells of a mammalian recipient in vivo. According to one
embodiment, the method comprises introducing an expression vector
for expressing a siRNA sequence in cells of the mammalian recipient
in situ by, for example, injecting the vector into the
recipient.
[0285] V. Delivery Vehicles for the Expression Cassettes of the
Invention
[0286] Delivery of compounds into tissues and across the
blood-brain barrier can be limited by the size and biochemical
properties of the compounds. Currently, efficient delivery of
compounds into cells in vivo can be achieved only when the
molecules are small (usually less than 600 Daltons). Gene transfer
for the correction of inborn errors of metabolism and
neurodegenerative diseases of the central nervous system (CNS), and
for the treatment of cancer has been accomplished with recombinant
adenoviral vectors.
[0287] The selection and optimization of a particular expression
vector for expressing a specific siRNA in a cell can be
accomplished by obtaining the nucleic acid sequence of the siRNA,
possibly with one or more appropriate control regions (e.g.,
promoter, insertion sequence); preparing a vector construct
comprising the vector into which is inserted the nucleic acid
sequence encoding the siRNA; transfecting or transducing cultured
cells in vitro with the vector construct; and determining whether
the siRNA is present in the cultured cells.
[0288] Vectors for cell gene therapy include viruses, such as
replication-deficient viruses (described in detail below).
Exemplary viral vectors are derived from Harvey Sarcoma virus, ROUS
Sarcoma virus, (MPSV), Moloney murine leukemia virus and DNA
viruses (e.g., adenovirus).
[0289] Replication-deficient retroviruses are capable of directing
synthesis of all virion proteins, but are incapable of making
infectious particles. Accordingly, these genetically altered
retroviral expression vectors have general utility for
high-efficiency transduction of nucleic acid sequences in cultured
cells, and specific utility for use in the method of the present
invention. Such retroviruses further have utility for the efficient
transduction of nucleic acid sequences into cells in vivo.
Retroviruses have been used extensively for transferring nucleic
acid material into cells. Protocols for producing
replication-deficient retroviruses (including the steps of
incorporation of exogenous nucleic acid material into a plasmid,
transfection of a packaging cell line with plasmid, production of
recombinant retroviruses by the packaging cell line, collection of
viral particles from tissue culture media, and infection of the
target cells with the viral particles) are well known in the
art.
[0290] An advantage of using retroviruses for gene therapy is that
the viruses insert the nucleic acid sequence encoding the siRNA
into the host cell genome, thereby permitting the nucleic acid
sequence encoding the siRNA to be passed on to the progeny of the
cell when it divides. Promoter sequences in the LTR region have can
enhance expression of an inserted coding sequence in a variety of
cell types. Some disadvantages of using a retrovirus expression
vector are (1) insertional mutagenesis, i.e., the insertion of the
nucleic acid sequence encoding the siRNA into an undesirable
position in the target cell genome which, for example, leads to
unregulated cell growth and (2) the need for target cell
proliferation in order for the nucleic acid sequence encoding the
siRNA carried by the vector to be integrated into the target
genome.
[0291] Another viral candidate useful as an expression vector for
transformation of cells is the adenovirus, a double-stranded DNA
virus. The adenovirus is infective in a wide range of cell types,
including, for example, muscle and endothelial cells. Adenoviruses
(Ad) are double-stranded linear DNA viruses with a 36 kb genome.
Several features of adenovirus have made them useful as transgene
delivery vehicles for therapeutic applications, such as
facilitating in vivo gene delivery. Recombinant adenovirus vectors
have been shown to be capable of efficient in situ gene transfer to
parenchymal cells of various organs, including the lung, brain,
pancreas, gallbladder, and liver. This has allowed the use of these
vectors in methods for treating inherited genetic diseases, such as
cystic fibrosis, where vectors may be delivered to a target organ.
In addition, the ability of the adenovirus vector to accomplish in
situ tumor transduction has allowed the development of a variety of
anticancer gene therapy methods for non-disseminated disease. In
these methods, vector containment favors tumor cell-specific
transduction.
[0292] Like the retrovirus, the adenovirus genome is adaptable for
use as an expression vector for gene therapy, i.e., by removing the
genetic information that controls production of the virus itself.
Because the adenovirus functions in an extrachromosomal fashion,
the recombinant adenovirus does not have the theoretical problem of
insertional mutagenesis.
[0293] Several approaches traditionally have been used to generate
the recombinant adenoviruses. One approach involves direct ligation
of restriction endonuclease fragments containing a nucleic acid
sequence of interest to portions of the adenoviral genome.
Alternatively, the nucleic acid sequence of interest may be
inserted into a defective adenovirus by homologous recombination
results. The desired recombinants are identified by screening
individual plaques generated in a lawn of complementation
cells.
[0294] Most adenovirus vectors are based on the adenovirus type 5
(Ad5) backbone in which an expression cassette containing the
nucleic acid sequence of interest has been introduced in place of
the early region 1 (E1) or early region 3 (E3). Viruses in which E1
has been deleted are defective for replication and are propagated
in human complementation cells (e.g., 293 or 911 cells), which
supply the missing gene E1 and pIX in trans.
[0295] In one embodiment of the present invention, one will desire
to generate siRNA in a brain cell or brain tissue. A suitable
vector for this application is an FIV vector (Brooks et al. (2002);
Alisky et al. (2000a)) or an AAV vector. For example, one may use
AAV5 (Davidson et al. (2000); Alisky et al. (2000a)). Also, one may
apply poliovirus (Bledsoe et al. (2000)) or HSV vectors (Alisky et
al. (2000b)).
[0296] Application of siRNA is generally accomplished by
transfection of synthetic siRNAs, in vitro synthesized RNAs, or
plasmids expressing short hairpin RNAs (shRNAs). More recently,
viruses have been employed for in vitro studies and to generate
transgenic mouse knock-downs of targeted genes (Hannon 2002,
Rubinson 2003, Kunath 2003). Recombinant adenovirus,
adeno-associated virus (AAV) and feline immunodeficiency virus
(FIV) can be used to deliver genes in vitro and in vivo (Alisky
2000, Davidson 2000, Brooks 2000). Each has its own advantages and
disadvantages (Davidson 2003). Adenoviruses are double stranded DNA
viruses with large genomes (36 kb) and have been engineered by my
laboratory and others to accommodate expression cassettes in
distinct regions. We used recombinant adenoviruses expressing
siRNAs to demonstrate successful viral-mediated gene suppression in
brain (Xia 2002).
[0297] Adeno-associated viruses have encapsidated genomes, similar
to Ad, but are smaller in size and packaging capacity (.about.30 nm
vs. .about.100 nm; packaging limit of .about.4.5 kb). AAV contain
single stranded DNA genomes of the + or the - strand. Eight
serotypes of AAV (1-8) have been studied extensively, three of
which have been evaluated in the brain (Davidson 2000, Passini
2003, Skorupa 1999, Frisella 2001, Xiao 1997, During 1998). An
important consideration for the present application is that AAV5
transduces striatal and cortical neurons, and is not associated
with any known pathologies.
[0298] Adeno associated virus (AAV) is a small nonpathogenic virus
of the parvoviridae family (for review see Muzyczka, N. 1992. Curr
Top Microbiol Immunol 158: 97-129; see also U.S. Pat. No.
6,468,524). AAV is distinct from the other members of this family
by its dependence upon a helper virus for replication. In the
absence of a helper virus, AAV may integrate in a locus specific
manner into the q arm of chromosome 19 (Kotin et al., (1990) Proc.
Natl. Acad. Sci. (USA) 87: 2211-2215). The approximately 5 kb
genome of AAV consists of one segment of single stranded DNA of
either plus or minus polarity. The ends of the genome are short
inverted terminal repeats which can fold into hairpin structures
and serve as the origin of viral DNA replication. Physically, the
parvovirus virion is non-enveloped and its icosohedral capsid is
approximately 20 nm in diameter.
[0299] To-date seven serologically distinct AAVs have been
identified and five have been isolated from humans or primates and
are referred to as AAV types 1-5 (Arella et al Handbook of
Parvoviruses. Vol. 1. ed. P. Tijssen. Boca Raton, Fla., CRC Press,
1990). The most extensively studied of these isolates is AAV type 2
(AAV2). The genome of AAV2 is 4680 nucleotides in length and
contains two open reading frames (ORFs). The left ORF encodes the
non-structural Rep proteins, Rep40, Rep 52, Rep68 and Rep 78, which
are involved in regulation of replication and transcription in
addition to the production of single-stranded progeny genomes.
Furthermore, two of the Rep proteins have been associated with the
possible integration of AAV genomes into a region of the q arm of
human chromosome 19. Rep68/78 have also been shown to possess NTP
binding activity as well as DNA and RNA helicase activities. The
Rep proteins possess a nuclear localization signal as well as
several potential phosphorylation sites. Mutation of one of these
kinase sites resulted in a loss of replication activity.
[0300] The ends of the genome are short inverted terminal repeats
which have the potential to fold into T-shaped hairpin structures
that serve as the origin of viral DNA replication. Within the ITR
region two elements have been described which are central to the
function of the ITR, a GAGC repeat motif and the terminal
resolution site (trs). The repeat motif has been shown to bind Rep
when the ITR is in either a linear or hairpin conformation. This
binding serves to position Rep68/78 for cleavage at the trs which
occurs in a site- and strand-specific manner. In addition to their
role in replication, these two elements appear to be central to
viral integration. Contained within the chromosome 19 integration
locus is a Rep binding site with an adjacent trs. These elements
have been shown to be functional and necessary for locus specific
integration.
[0301] The AAV2 virion is a non-enveloped, icosohedral particle
approximately 25 nm in diameter, consisting of three related
proteins referred to as VPI, 2 and 3. The right ORF encodes the
capsid proteins, VP1, VP2, and VP3. These proteins are found in a
ratio of 1:1:10 respectively and are all derived from the
right-hand ORF. The capsid proteins differ from each other by the
use of alternative splicing and an unusual start codon. Deletion
analysis has shown that removal or alteration of VP1 which is
translated from an alternatively spliced message results in a
reduced yield of infections particles. Mutations within the VP3
coding region result in the failure to produce any single-stranded
progeny DNA or infectious particles.
[0302] The following features of AAV have made it an attractive
vector for gene transfer. AAV vectors have been shown in vitro to
stably integrate into the cellular genome; possess a broad host
range; transduce both dividing and non dividing cells in vitro and
in vivo and maintain high levels of expression of the transduced
genes. Viral particles are heat stable, resistant to solvents,
detergents, changes in pH, temperature, and can be concentrated on
CsCl gradients. Integration of AAV provirus is not associated with
any long term negative effects on cell growth or differentiation.
The ITRs have been shown to be the only cis elements required for
replication, packaging and integration and may contain some
promoter activities.
[0303] Further provided by this invention are chimeric viruses
where AAV can be combined with herpes virus, herpes virus
amplicons, baculovirus or other viruses to achieve a desired
tropism associated with another virus. For example, the AAV4 ITRs
could be inserted in the herpes virus and cells could be infected.
Post-infection, the ITRs of AAV4 could be acted on by AAV4 rep
provided in the system or in a separate vehicle to rescue AAV4 from
the genome. Therefore, the cellular tropism of the herpes simplex
virus can be combined with AAV4 rep mediated targeted integration.
Other viruses that could be utilized to construct chimeric viruses
include lentivirus, retrovirus, pseudotyped retroviral vectors, and
adenoviral vectors.
[0304] Also provided by this invention are variant AAV vectors. For
example, the sequence of a native AAV, such as AAV5, can be
modified at individual nucleotides. The present invention includes
native and mutant AAV vectors. The present invention further
includes all AAV serotypes.
[0305] FIV is an enveloped virus with a strong safety profile in
humans; individuals bitten or scratched by FIV-infected cats do not
seroconvert and have not been reported to show any signs of
disease. Like AAV, FIV provides lasting transgene expression in
mouse and nonhuman primate neurons (Brooks 2002, Lotery 2002), and
transduction can be directed to different cell types by
pseudotyping, the process of exchanging the viruses native envelope
for an envelope from another virus (Kang 2002, Stein 2001).
[0306] Thus, as will be apparent to one of ordinary skill in the
art, a variety of suitable viral expression vectors are available
for transferring exogenous nucleic acid material into cells. The
selection of an appropriate expression vector to express a
therapeutic agent for a particular condition amenable to gene
silencing therapy and the optimization of the conditions for
insertion of the selected expression vector into the cell, are
within the scope of one of ordinary skill in the art without the
need for undue experimentation.
[0307] In another embodiment, the expression vector is in the form
of a plasmid, which is transferred into the target cells by one of
a variety of methods: physical (e.g., microinjection,
electroporation, scrape loading, microparticle bombardment) or by
cellular uptake as a chemical complex (e.g., calcium or strontium
co-precipitation, complexation with lipid, complexation with
ligand). Several commercial products are available for cationic
liposome complexation including Lipofectin.TM. (Gibco-BRL,
Gaithersburg, Md.) and Transfectam.TM. (ProMega, Madison, Wis.).
However, the efficiency of transfection by these methods is highly
dependent on the nature of the target cell and accordingly, the
conditions for optimal transfection of nucleic acids into cells
using the above-mentioned procedures must be optimized. Such
optimization is within the scope of one of ordinary skill in the
art without the need for undue experimentation.
[0308] VI. Diseases and Conditions Amendable to the Methods of the
Invention
[0309] In the certain embodiments of the present invention, a
mammalian recipient to an expression cassette of the invention has
a condition that is amenable to gene silencing therapy. As used
herein, "gene silencing therapy" refers to administration to the
recipient exogenous nucleic acid material encoding a therapeutic
siRNA and subsequent expression of the administered nucleic acid
material in situ. Thus, the phrase "condition amenable to siRNA
therapy" embraces conditions such as genetic diseases (i.e., a
disease condition that is attributable to one or more gene
defects), acquired pathologies (i.e., a pathological condition that
is not attributable to an inborn defect), cancers,
neurodegenerative diseases, e.g., trinucleotide repeat disorders,
and prophylactic processes (i.e., prevention of a disease or of an
undesired medical condition). A gene "associated with a condition"
is a gene that is either the cause, or is part of the cause, of the
condition to be treated. Examples of such genes include genes
associated with a neurodegenerative disease (e.g., a
trinucleotide-repeat disease such as a disease associated with
polyglutamine repeats, Huntington's disease, and several
spinocerebellar ataxias), and genes encoding ligands for chemokines
involved in the migration of a cancer cells, or chemokine receptor.
Also siRNA expressed from viral vectors may be used for in vivo
antiviral therapy using the vector systems described.
[0310] Accordingly, as used herein, the term "therapeutic siRNA"
refers to any siRNA that has a beneficial effect on the recipient.
Thus, "therapeutic siRNA" embraces both therapeutic and
prophylactic siRNA.
[0311] Differences between alleles that are amenable to targeting
by siRNA include disease-causing mutations as well as polymorphisms
that are not themselves mutations, but may be linked to a mutation
or associated with a predisposition to a disease state. An example
of a targetable polymorphism that is not itself a mutation is the
polymorphism in exon 58 associated with Huntington's disease.
[0312] Single nucleotide polymorphisms comprise most of the genetic
diversity between humans. The major risk factor for developing
Alzheimer's disease is the presence of a particular polymorphism in
the apolipoprotein E gene.
[0313] Single nucleotide polymorphisms comprise most of the genetic
diversity between humans, and that many disease genes, including
the HD gene in Huntington's disease, contain numerous single
nucleotide or multiple nucleotide polymorphisms that could be
separately targeted in one allele vs. the other. The major risk
factor for developing Alzheimer's disease is the presence of a
particular polymorphism in the apolipoprotein E gene.
[0314] A. Gene Defects
[0315] A number of diseases caused by gene defects have been
identified. For example, this strategy can be applied to a major
class of disabling neurological disorders. For example this
strategy can be applied to the polyglutamine diseases, as is
demonstrated by the reduction of polyglutamine aggregation in cells
following application of the strategy. The neurodegenerative
disease may be a trinucleotide-repeat disease, such as a disease
associated with polyglutamine repeats, including Huntington's
disease, and several spinocerebellar ataxias. Additionally, this
strategy can be applied to a non-degenerative neurological
disorder, such as DYT1 dystonia.
[0316] B. Acquired Pathologies
[0317] As used herein, "acquired pathology" refers to a disease or
syndrome manifested by an abnormal physiological, biochemical,
cellular, structural, or molecular biological state. For example,
the disease could be a viral disease, such as hepatitis or
AIDS.
[0318] C. Cancers
[0319] The condition amenable to gene silencing therapy
alternatively can be a genetic disorder or an acquired pathology
that is manifested by abnormal cell proliferation, e.g., cancer.
According to this embodiment, the instant invention is useful for
silencing a gene involved in neoplastic activity. The present
invention can also be used to inhibit overexpression of one or
several genes. The present invention can be used to treat
neuroblastoma, medulloblastoma, or glioblastoma.
[0320] VII. Dosages, Formulations and Routes of Administration of
the Agents of the Invention
[0321] The agents of the invention are preferably administered so
as to result in a reduction in at least one symptom associated with
a disease. The amount administered will vary depending on various
factors including, but not limited to, the composition chosen, the
particular disease, the weight, the physical condition, and the age
of the mammal, and whether prevention or treatment is to be
achieved. Such factors can be readily determined by the clinician
employing animal models or other test systems, which are well known
to the art.
[0322] Administration of siRNA may be accomplished through the
administration of the nucleic acid molecule encoding the siRNA
(see, for example, Felgner et al., U.S. Pat. No. 5,580,859, Pardoll
et al. 1995; Stevenson et al. 1995; Moiling 1997; Donnelly et al.
1995; Yang et al. II; Abdallah et al. 1995). Pharmaceutical
formulations, dosages and routes of administration for nucleic
acids are generally disclosed, for example, in Felgner et al.,
supra.
[0323] The present invention envisions treating a disease, for
example, a neurodegenerative disease, in a mammal by the
administration of an agent, e.g., a nucleic acid composition, an
expression vector, or a viral particle of the invention.
Administration of the therapeutic agents in accordance with the
present invention may be continuous or intermittent, depending, for
example, upon the recipient's physiological condition, whether the
purpose of the administration is therapeutic or prophylactic, and
other factors known to skilled practitioners. The administration of
the agents of the invention may be essentially continuous over a
preselected period of time or may be in a series of spaced doses.
Both local and systemic administration is contemplated.
[0324] One or more suitable unit dosage forms having the
therapeutic agent(s) of the invention, which, as discussed below,
may optionally be formulated for sustained release (for example
using microencapsulation, see WO 94/07529, and U.S. Pat. No.
4,962,091 the disclosures of which are incorporated by reference
herein), can be administered by a variety of routes including
parenteral, including by intravenous and intramuscular routes, as
well as by direct injection into the diseased tissue. For example,
the therapeutic agent may be directly injected into the brain.
Alternatively the therapeutic agent may be introduced intrathecally
for brain and spinal cord conditions. In another example, the
therapeutic agent may be introduced intramuscularly for viruses
that traffic back to affected neurons from muscle, such as AAV,
lentivirus and adenovirus. The formulations may, where appropriate,
be conveniently presented in discrete unit dosage forms and may be
prepared by any of the methods well known to pharmacy. Such methods
may include the step of bringing into association the therapeutic
agent with liquid carriers, solid matrices, semi-solid carriers,
finely divided solid carriers or combinations thereof, and then, if
necessary, introducing or shaping the product into the desired
delivery system.
[0325] When the therapeutic agents of the invention are prepared
for administration, they are preferably combined with a
pharmaceutically acceptable carrier, diluent or excipient to form a
pharmaceutical formulation, or unit dosage form. The total active
ingredients in such formulations include from 0.1 to 99.9% by
weight of the formulation. A "pharmaceutically acceptable" is a
carrier, diluent, excipient, and/or salt that is compatible with
the other ingredients of the formulation, and not deleterious to
the recipient thereof. The active ingredient for administration may
be present as a powder or as granules, as a solution, a suspension
or an emulsion.
[0326] Pharmaceutical formulations containing the therapeutic
agents of the invention can be prepared by procedures known in the
art using well known and readily available ingredients. The
therapeutic agents of the invention can also be formulated as
solutions appropriate for parenteral administration, for instance
by intramuscular, subcutaneous or intravenous routes.
[0327] The pharmaceutical formulations of the therapeutic agents of
the invention can also take the form of an aqueous or anhydrous
solution or dispersion, or alternatively the form of an emulsion or
suspension.
[0328] Thus, the therapeutic agent may be formulated for parenteral
administration (e.g., by injection, for example, bolus injection or
continuous infusion) and may be presented in unit dose form in
ampules, pre-filled syringes, small volume infusion containers or
in multi-dose containers with an added preservative. The active
ingredients may take such forms as suspensions, solutions, or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredients may be in powder form,
obtained by aseptic isolation of sterile solid or by lyophilization
from solution, for constitution with a suitable vehicle, e.g.,
sterile, pyrogen-free water, before use.
[0329] It will be appreciated that the unit content of active
ingredient or ingredients contained in an individual aerosol dose
of each dosage form need not in itself constitute an effective
amount for treating the particular indication or disease since the
necessary effective amount can be reached by administration of a
plurality of dosage units. Moreover, the effective amount may be
achieved using less than the dose in the dosage form, either
individually, or in a series of administrations.
[0330] The pharmaceutical formulations of the present invention may
include, as optional ingredients, pharmaceutically acceptable
carriers, diluents, solubilizing or emulsifying agents, and salts
of the type that are well-known in the art. Specific non-limiting
examples of the carriers and/or diluents that are useful in the
pharmaceutical formulations of the present invention include water
and physiologically acceptable buffered saline solutions such as
phosphate buffered saline solutions pH 7.0-8.0. saline solutions
and water.
[0331] The invention will now be illustrated by the following
non-limiting Examples.
Example 1
siRNA-Mediated Silencing of Genes Using Viral Vectors
[0332] In this Example, it is shown that genes can be silenced in
an allele-specific manner. It is also demonstrated that
viral-mediated delivery of siRNA can specifically reduce expression
of targeted genes in various cell types, both in vitro and in vivo.
This strategy was then applied to reduce expression of a neurotoxic
polyglutamine disease protein. The ability of viral vectors to
transduce cells efficiently in vivo, coupled with the efficacy of
virally expressed siRNA shown here, extends the application of
siRNA to viral-based therapies and in vivo targeting experiments
that aim to define the function of specific genes.
Experimental Protocols
[0333] Generation of the Expression Cassettes and Viral
Vectors.
[0334] The modified CMV (mCMV) promoter was made by PCR
amplification of CMV by primers
5'-AAGGTACCAGATCTTAGTTATTAATAGTAATCAATTACGG-3' (SEQ ID NO:1) and
5'-GAATCGATGCATGCCTCGAGACGGTTCACTAAACCAGCTCTGC-3' (SEQ ID NO:2)
with peGFPN1 plasmid (purchased from Clontech, Inc) as template.
The mCMV product was cloned into the KpnI and ClaI sites of the
adenoviral shuttle vector pAd5KnpA, and was named pmCMVknpA. To
construct the minimal polyA cassette, the oligonucleotides,
5'-CTAGAACTAGTAATAAAGGATCCTTTATTTTCATTGGATCCGTGTGTTGGTTT
TTTGTGTGCGGCCGCG-3' (SEQ ID NO:3) and
5'-TCGACGCGGCCGCACACAAAAAACCAACACACGGATCC
AATGAAAATAAAGGATCCTTTATTACTAGTT-3' (SEQ ID NO:4), were used. The
oligonucleotides contain SpeI and SalI sites at the 5' and 3' ends,
respectively. The synthesized polyA cassette was ligated into SpeI,
SalI digested pmCMVKnpA. The resultant shuttle plasmid, pmCMVmpA
was used for construction of head-to-head 21 bp hairpins of eGFP
(bp 418 to 438), human .beta.-glucuronidase (bp 649 to 669), mouse
.beta.-glucuronidase (bp 646 to 666) or E. coli
.beta.-galactosidase (bp 1152-1172). The eGFP hairpins were also
cloned into the Ad shuttle plasmid containing the commercially
available CMV promoter and polyA cassette from SV40 large T antigen
(pCMVsiGFPx). Shuttle plasmids were co-transfected into HEK293
cells along with the adenovirus backbones for generation of
full-length Ad genomes. Viruses were harvested 6-10 days after
transfection and amplified and purified as described (Anderson
2000).
[0335] Northern Blotting.
[0336] Total RNA was isolated from HEK293 cells transfected by
plasmids or infected by adenoviruses using TRIZOL.RTM. Reagent
(Invitrogen.TM. Life Technologies, Carlsbad, Calif.) according to
the manufacturer's instruction. RNAs (30 .mu.g) were separated by
electrophoresis on 15% (wt/vol) polyacrylamide-urea gels to detect
transcripts, or on 1% agarose-formaldehyde gel for target mRNAs
analysis. RNAs were transferred by electroblotting onto hybond N+
membrane (Amersham Pharmacia Biotech). Blots were probed with
.sup.32P-labeled sense (5'-CACAAGCTGGAGTACAACTAC-3' (SEQ ID NO:5))
or antisense (5'-GTACTTGTACTCCAGCTTTGTG-3' (SEQ ID NO:6))
oligonucleotides at 37.degree. C. for 3 h for evaluation of siRNA
transcripts, or probed for target mRNAs at 42.degree. C. overnight.
Blots were washed using standard methods and exposed to film
overnight. In vitro studies were performed in triplicate with a
minimum of two repeats.
[0337] In Vivo Studies and Tissue Analyses.
[0338] Mice were injected into the tail vein (n=10 per group) or
into the brain (n=6 per group) as described previously (Stein 1999)
with the virus doses indicated. Animals were sacrificed at the
noted times and tissues harvested and sections or tissue lysates
evaluated for .beta.-glucuronidase expression, eGFP fluorescence,
or .beta.-galactosidase activity using established methods (Xia
2001). Total RNA was harvested from transduced liver using the
methods described above.
[0339] Cell Lines.
[0340] PC12 tet off cell lines (Clontech Inc., Palo Alto, Calif.)
were stably transfected with a tetracycline regulatable plasmid
into which was cloned GFPQ19 or GFPQ80 (Chai 1999a). For GFP-Q80,
clones were selected and clone 29 chosen for regulatable properties
and inclusion formation. For GFP-Q19 clone 15 was selected for
uniformity of GFP expression following gene expression induction.
In all studies 1.5 .mu.g/ml dox was used to repress transcription.
All experiments were done in triplicate and were repeated 4
times.
Results and Discussion
[0341] To accomplish intracellular expression of siRNA, a 21-bp
hairpin representing sequences directed against eGFP was
constructed, and its ability to reduce target gene expression in
mammalian cells using two distinct constructs was tested.
Initially, the siRNA hairpin targeted against eGFP was placed under
the control of the CMV promoter and contained a full-length SV-40
polyadenylation (polyA) cassette (pCMVsiGFPx). In the second
construct, the hairpin was juxtaposed almost immediate to the CMV
transcription start site (within 6 bp) and was followed by a
synthetic, minimal polyA cassette (FIG. 1A, pmCMVsiGFPmpA)
(Experimental Protocols), because we reasoned that functional siRNA
would require minimal to no overhangs (Caplan 2001; Nykanen 2001).
Co-transfection of pmCMVsiGFPmpA with pEGFPN1 (Clontech Inc) into
HEK293 cells markedly reduced eGFP fluorescence (FIG. 1C).
pmCMVsiGFPmpA transfection led to the production of an
approximately 63 bp RNA specific for eGFP (FIG. 1D), consistent
with the predicted size of the siGFP hairpin-containing transcript.
Reduction of target mRNA and eGFP protein expression was noted in
pmCMVsiGFPmpA-transfected cells only (FIG. 1E, F). In contrast,
eGFP RNA, protein and fluorescence levels remained unchanged in
cells transfected with pEGFPN1 and pCMVsiGFPx (FIG. 1E, G), pEGFPN1
and pCMVsi.beta.glucmpA (FIG. 1E, F, H), or pEGFPN1 and
pCMVsi.beta.galmpA, the latter expressing siRNA against E. coli
.beta.-galactosidase (FIG. 1E). These data demonstrate the
specificity of the expressed siRNAs.
[0342] Constructs identical to pmCMVsiGFPmpA except that a spacer
of 9, 12 and 21 nucleotides was present between the transcription
start site and the 21 bp hairpin were also tested. In each case,
there was no silencing of eGFP expression (data not shown).
Together the results indicate that the spacing of the hairpin
immediate to the promoter can be important for functional target
reduction, a fact supported by recent studies in MCF-7 cells
(Brummelkamp 2002).
[0343] Recombinant adenoviruses were generated from the siGFP
(pmCMVsiGFPmpA) and si.beta.gluc (pmCMVsi.beta.glucmpA) plasmids
(Xia 2001; Anderson 2000) to test the hypothesis that virally
expressed siRNA allows for diminished gene expression of endogenous
targets in vitro and in vivo. HeLa cells are of human origin and
contain moderate levels of the soluble lysosomal enzyme
.beta.-glucuronidase. Infection of HeLa cells with viruses
expressing si.beta.gluc caused a specific reduction in human
.beta.-glucuronidase mRNA (FIG. 1I) leading to a 60% decrease in
.beta.-glucuronidase activity relative to siGFP or control cells
(FIG. 1J). Optimization of siRNA sequences using methods to refine
target mRNA accessible sequences (Lee 2002) could improve further
the diminution of .beta.-glucuronidase transcript and protein
levels.
[0344] The results in FIG. 1A-J are consistent with earlier work
demonstrating the ability of synthetic 21-bp double stranded RNAs
to reduce expression of target genes in mammalian cells following
transfection, with the important difference that in the present
studies the siRNA was synthesized intracellularly from readily
available promoter constructs. The data support the utility of
regulatable, tissue or cell-specific promoters for expression of
siRNA when suitably modified for close juxtaposition of the hairpin
to the transcriptional start site and inclusion of the minimal
polyA sequence containing cassette (see, Methods above).
[0345] To evaluate the ability of virally expressed siRNA to
diminish target-gene expression in adult mouse tissues in vivo,
transgenic mice expressing eGFP (Okabe 1997) were injected into the
striatal region of the brain with 1.times.10.sup.7 infectious units
of recombinant adenovirus vectors expressing siGFP or control
si.beta.gluc. Viruses also contained a dsRed expression cassette in
a distant region of the virus for unequivocal localization of the
injection site. Brain sections evaluated 5 days after injection by
fluorescence (FIG. 2A) or western blot assay (FIG. 2B) demonstrated
reduced eGFP expression. Decreased eGFP expression was confined to
the injected hemisphere (FIG. 2B). The in vivo reduction is
promising, particularly since transgenically expressed eGFP is a
stable protein, making complete reduction in this short time frame
unlikely. Moreover, evaluation of eGFP levels was done 5 days after
injection, when inflammatory changes induced by the adenovirus
vector likely enhance transgenic eGFP expression from the CMV
enhancer (Ooboshi 1997).
[0346] It was next tested whether virus mediated siRNA could
decrease expression from endogenous alleles in vivo. Its ability to
decrease .beta.-glucuronidase activity in the murine liver, where
endogenous levels of this relatively stable protein are high, was
evaluated. Mice were injected via the tail vein with a construct
expressing murine-specific si.beta.gluc (AdsiMu.beta.gluc), or the
control viruses Adsi.beta.gluc (specific for human
.beta.-glucuronidase) or Adsi.beta.gal. Adenoviruses injected into
the tail vein transduced hepatocytes as shown previously (Stein
1999). Liver tissue harvested 3 days later showed specific
reduction of target .beta.-glucuronidase RNA in AdsiMu.beta.gluc
treated mice only (FIG. 2C). Fluorometric enzyme assay of liver
lysates confirmed these results, with a 12% decrease in activity
from liver harvested from AdsiMu.beta.gluc injected mice relative
to Adsi.beta.gal and Adsi.beta.gluc treated ones (p<0.01; n=10).
Interestingly, sequence differences between the murine and human
siRNA constructs are limited, with 14 of 21 bp being identical.
These results confirm the specificity of virus mediated siRNA, and
indicate that allele-specific applications are possible. Together,
the data are the first to demonstrate the utility of siRNA to
diminish target gene expression in brain and liver tissue in vivo,
and establish that allele-specific silencing in vivo is possible
with siRNA.
[0347] One powerful therapeutic application of siRNA is to reduce
expression of toxic gene products in dominantly inherited diseases
such as the polyglutamine (polyQ) neurodegenerative disorders
(Margolis 2001). The molecular basis of polyQ diseases is a novel
toxic property conferred upon the mutant protein by polyQ
expansion. This toxic property is associated with disease protein
aggregation. The ability of virally expressed siRNA to diminish
expanded polyQ protein expression in neural PC-12 clonal cell lines
was evaluated. Lines were developed that express
tetracycline-repressible eGFP-polyglutamine fusion proteins with
normal or expanded glutamine of 19 (eGFP-Q19) and 80 (eGFP-Q80)
repeats, respectively. Differentiated, eGFP-Q19-expressing PC12
neural cells infected with recombinant adenovirus expressing siGFP
demonstrated a specific and dose-dependent decrease in eGFP-Q19
fluorescence (FIG. 3A, C) and protein levels (FIG. 3B). Application
of Adsi.beta.gluc as a control had no effect (FIG. 3A-C).
Quantitative image analysis of eGFP fluorescence demonstrated that
siGFP reduced GFPQ19 expression by greater than 96% and 93% for 100
and 50 MOI respectively, relative to control siRNA (FIG. 3C). The
multiplicity of infection (MOI) of 100 required to achieve maximal
inhibition of eGFP-Q19 expression results largely from the
inability of PC12 cells to be infected by adenovirus-based vectors.
This barrier can be overcome using AAV- or lentivirus-based
expression systems (Davidson 2000; Brooks 2002).
[0348] To test the impact of siRNA on the size and number of
aggregates formed in eGFP-Q80 expressing cells, differentiated
PC-12/eGFP-Q80 neural cells were infected with AdsiGFP or
Adsi.beta.gluc 3 days after doxycycline removal to induce GFP-Q80
expression. Cells were evaluated 3 days later. In mock-infected
control cells (FIG. 4A), aggregates were very large 6 days after
induction as reported by others (Chai 1999a; Moulder 1999). Large
aggregates were also seen in cells infected with Adsi.beta.gluc
(FIG. 4B), AdsiGFPx, (FIG. 4C, siRNA expressed from the normal CMV
promoter and containing the SV40 large T antigen polyadenylation
cassette), or Adsi.beta.gal (FIG. 4D). In contrast, polyQ aggregate
formation was significantly reduced in AdsiGFP infected cells (FIG.
4E), with fewer and smaller inclusions and more diffuse eGFP
fluorescence. AdsiGFP-mediated reduction in aggregated and
monomeric GFP-Q80 was verified by Western blot analysis (FIG. 4F),
and quantitation of cellular fluorescence (FIG. 4G). AdsiGFP caused
a dramatic and specific, dose-dependent reduction in eGFP-Q80
expression (FIG. 4F, G).
[0349] It was found that transcripts expressed from the modified
CMV promoter and containing the minimal polyA cassette were capable
of reducing gene expression in both plasmid and viral vector
systems (FIGS. 1-4). The placement of the hairpin immediate to the
transcription start site and use of the minimal polyadenylation
cassette was of critical importance. In plants and Drosophila, RNA
interference is initiated by the ATP-dependent, processive cleavage
of long dsRNA into 21-25 bp double-stranded siRNA, followed by
incorporation of siRNA into a RNA-induced silencing complex that
recognizes and cleaves the target (Nykanen 2001; Zamore 2000;
Bernstein 2001; Hamilton 1999; Hammond 2000). Viral vectors
expressing siRNA are useful in determining if similar mechanisms
are involved in target RNA cleavage in mammalian cells in vivo.
[0350] In summary, these data demonstrate that siRNA expressed from
viral vectors in vitro and in vivo specifically reduce expression
of stably expressed plasmids in cells, and endogenous transgenic
targets in mice. Importantly, the application of virally expressed
siRNA to various target alleles in different cells and tissues in
vitro and in vivo was demonstrated. Finally, the results show that
it is possible to reduce polyglutamine protein levels in neurons,
which is the cause of at least nine inherited neurodegenerative
diseases, with a corresponding decrease in disease protein
aggregation. The ability of viral vectors based on adeno-associated
virus (Davidson 2000) and lentiviruses (Brooks 2002) to efficiently
transduce cells in the CNS, coupled with the effectiveness of
virally-expressed siRNA demonstrated here, extends the application
of siRNA to viral-based therapies and to basic research, including
inhibiting novel ESTs to define gene function.
Example 2
siRNA Specific for Huntingtin's Disease
[0351] The present inventors have developed huntingtin siRNA
focused on two targets. One is non-allele specific (siHDexon2), the
other is targeted to the exon 58 codon deletion, the only known
common intragenic polymorphism in linkage dysequilibrium with the
disease mutation (Ambrose et al, 1994). Specifically, 92% of wild
type huntingtin alleles have four GAGs in exon 58, while 38% of HD
patients have 3 GAGs in exon 58. To assess a siRNA targeted to the
intragenic polymorphism, PC6-3 cells were transfected with a
full-length huntingtin containing the exon 58 deletion.
Specifically, PC6-3 rat pheochromocytoma cells were co-transfected
with CMV-human Htt (37Qs) and U6 siRNA hairpin plasmids. Cell
extracts were harvested 24 hours later and western blots were
performed using 15 .mu.g total protein extract. Primary antibody
was an anti-huntingtin monoclonal antibody (MAB2166, Chemicon) that
reacts with human, monkey, rat and mouse Htt proteins.
[0352] As seen in FIGS. 5A-B, the siRNA lead to silencing of the
disease allele. As a positive control, a non-allele specific siRNA
targeted to exon 2 of the huntingtin gene was used. siRNA directed
against GFP was used as a negative control. It was noted that
siEx58#2 functional. The sequence for siEX58#2 is the following:
5'-AAGAGGAGGAGGCCGACGCCC-3' (SEQ ID NO:90). siEX58#1 was only
minimally functional.
Example 3
siRNA Specific for SCA1
[0353] Spinocerebellar ataxia type 1 (SCA1) is a dominantly
inherited, progressive neurodegenerative disease caused by an
expanded polyglutamine tract in ataxin-1. SCA1 is one of at least
nine neurodegenerative diseases caused by polyglutamine expansion,
which includes Huntington's disease (HD) and several other ataxias
(Orr 1993, Zoghbi 1995). SCA1 is characterized by progressive
ataxia, cerebellar atrophy, and loss of cerebellar Purkinje cells
and brainstem neurons. A feature common to all polyglutamine
diseases, and many other neurodegenerative diseases, is the
formation of intracellular aggregates containing the disease
protein, molecular chaperones, and components of the
ubiquitin-proteasome pathway (Orr 1993, Zoghbi 1995). In SCA1, as
in many other polyQ diseases, the inclusions are intranuclear
(Skinner 1997).
[0354] Disease allele expansion ranges from 44 to 82 glutamines in
SCA1, with repeat length inversely correlated to age of disease
onset (Zoghbi 1995). Work in Drosophila models and transgenic mice
demonstrate that the expansion confers a toxic gain of function on
ataxin-1 (Fernandez-Funez 2000, Burright 1995, Klement 1998).
Recent work has also shown that phosphorylation of serine 776 of
ataxin-1 by AKT, but not nuclear aggregation, is required for SCA1
pathogenesis (Emamian 2003, Chen 2003). Together, work in these
model organisms has identified manipulation of molecular
chaperones, or inhibition of AKT phosphorylation of ataxin-1, as
potential therapeutic routes (Fernandez-Funez 2000, Emamian 2003,
Cummings 1998). As yet, however, there is no effective therapy for
SCA1 or the other dominant neurodegenerative diseases caused by
polyglutamine expansion.
[0355] Inhibition of mutant allele expression provides a direct
approach to SCA1 therapy. In past years, antisense- or
ribozyme-based techniques held promise in culture systems, but
proved difficult to translate to animal models. More recently, gene
silencing through RNA interference (RNAi) has emerged as a powerful
method to reduce target gene expression in cell culture and,
importantly, in brain (Caplen 2002, Miller 2003, Xia 2002, Davidson
2004). In the present experiments, the inventors tested whether the
introduction of viral vectors expressing short hairpin RNAs
(shRNAs) directed against the transgenic human mutant ataxin-1 gene
would reduce pathology and ataxia in a mouse SCA1 model.
[0356] Vector construction and in vitro screening. Different target
sites (F1 to F11) were made based on the 2.4 kb human ataxin-1 ORF
(gene accession number: X79204). Sites were as follows: F1, by
144-64; F2 bp 576-96; F3, by 679-99; F4, 1334-54; F5, by 490-510;
F6, by 2250-70; F7, by 18-38; F8, by 863-82; F9, by 1876-96; F10,
bp 574-94; F11, by 670-90. E. coli .beta.-galactosidase (bp
1152-1172) was used as control shRNA. Hairpins with loops
5'-ACTAGT-3' (SEQ ID NO:104), or 5'-CTTCCTGTCA-3' (SEQ ID NO:105)
from mir23, were cloned into vectors containing the human U6
promoter, or the modified CMV promoter, by a two-step method as
previously described (Xia 2002).
[0357] Flag-tagged ataxin-1 with normal (30Q) or expanded (82Q)
polyglutamine regions were cloned into the AAV shuttle plasmid for
testing hairpin silencing. Plasmids expressing hairpins and
plasmids expressing ataxin-1 were co-transfected into HEK 293 cells
or PC6-3 cells (4:1 ratio, hairpin to target), and cells lysed 48
to 72 h later. Western blots with anti-Flag were done to assess
ataxin-1 levels. Actin was used a loading control.
[0358] Quantitative RT-PCR. HEK293 cells were transfected
(Lipofectamine-2000, Invitrogen) with shLacZ, shScaI.F10 (571-592,
ScaI-shSCA1.F10, 5'-GGACACAAGGCTGAGCAGCAG-3' (SEQ ID NO:102)), or
shScaI.F11 (595-615, HScal-shSCA1.F11,
5'-CAGCAGCACCTCAGCAGGGCTGCAGGATTAGTCAACCACCTCAGCAGGGCT-3' (SEQ ID
NO:103)) and a human ScaI expression plasmid in 2:1, 4:1, or 8:1
molar ratios of shRNA:ScaI. RNA was harvested 24 hours
post-transfection using Trizol reagent (Invitrogen). Following
DNase treatment (DNA-free, Ambion), random-primed, first-strand
cDNA was generated from 1 mg total RNA (Taqman Reverse
Transcription Reagents, Applied Biosystems) according to the
manufacturer's protocol. cDNA was diluted four-fold and then used
as template for real-time PCR. Taqman Assays were performed on an
ABI Prism 7000 Sequence Detection System using Taqman 2X Universal
PCR Master Mix (Applied Biosystems) and Applied Biosystems
Assays-on-Demand Taqman primers/probe sets specific for human ScaI
and mammalian rRNA. Relative gene expression was determined using
the relative standard curve method (Applied Biosystems User
Bulletin #2). Human ScaI expression levels were normalized to rRNA
levels and all samples were calibrated to the shLacZ 8:1
sample.
[0359] AAV vectors. pAAVshLacZ and pAAVshSCA1 contain human U6
driven hairpins and CMV-hrGFP-SV40 polyA expression cassettes
cloned between two AAV2 ITR sequences. Flanking the AAV provirus
are left and right arm sequences from the Baculovirus Autographa
californica, which are used to generate recombinant Bacmid DNA
through homologous recombination in E. coli. Recombinant
Baculovirus were generated as described in the Bac-to-Bac
Baculovirus Expression System (InVitrogen), and AAV virus was
purified as described in Urabe et al (Urabe 2002). AAV titers were
determined by DNA slot blot using an hrGFP-specific radiolabeled
probe.
[0360] AAV injections. Injections into cerebella were as described
by Alisky et al. (Alisky 2000), except that injections were
administered 1 mm lateral to the midline, with a total of 3 .mu.l
injected into three separate sites. Transduction was targeted to
midline lobules IV/V, with transduction spreading
anterior-posterior to lobules III and VI, respectively. Virus
titers were .about.1.times.1012 vector genomes/ml as assessed by
Q-PCR.
[0361] Northern Analysis. Total RNA was isolated using TRIZOL.RTM.
Reagent (InVitrogen.TM. Life Technologies, Carlsbad, Calif.)
according to the manufacturer's instructions. RNAs (30 mg) were
separated by electrophoresis on 15% (wt/vol) polyacrylamide-urea
gels to detect transcripts. RNAs were transferred by
electroblotting onto Hybond N+ membranes (Amersham Pharmacia
Biotech). Blots were probed with 32P-labeled sense oligonucleotides
at 36.degree. C. for 3 h for evaluation of transcripts. Blots were
washed in 2.times.SSC twice for 15 min at 36.degree. C. and exposed
to film overnight (Miyagishi 2002).
[0362] Immunohistochemistry and quantitation. Mice were perfused
and fixed overnight with 4% paraformaldehyde in 0.2M phosphate
buffer (pH 7.4). Tissues were cryoprotected by immersion in 25%
sucrose and frozen in O.C.T. compound (Sakura Finetek U.S.A. Inc,
Torrance, Calif.). Sagittal cryostat sections (10 um) were cut and
mounted onto gelatin-coated slides. For calbindin staining, no
unmasking procedure was used. Ataxin-1 staining was done as
described (Skinner 1997). Sections were analyzed using a Leica DM
RBE and images acquired with a SPOT RT camera and associated
software (Diagnostics Instruments, Sterling Heights, Mich.).
Measurement of molecular layer thickness and quantitation of
Purkinje cells were done using BioQuant system software (R & M
Biometrics, Nashville, Tenn.) (Williams 1988).
[0363] Rotarod analysis. The Rotarod (Ugo Basile Biological
Research Apparatus, model 7650) was used for these studies.
Five-week-old mice were habituated on the rotarod for 4 min, and
then tested for 4 consecutive days, 4 trials per day (.about.30
minutes rest between trial). Mice were retested two weeks after
intracerebellar injection, and every two weeks until sacrifice at
16 wks. Additional groups of animals were tested out to 20 weeks.
For each trial, the rod was accelerated from 4 to 40 rpm over 5
min, then maintained at 40 rpm until trial completion. Latency to
fall (or if they hung on or rotated for two consecutive rotations
without running) was recorded for each mouse. Any mouse remaining
on the apparatus for 500 sec. was removed and scored as 500
sec.
Results
[0364] Optimization of Ataxin-1-Targeting shRNAs
[0365] To accomplish RNAi for ataxin-1, the inventors developed
short hairpins (shRNA) directed to the human 2.4 kb ataxin-1 cDNA
for primary screening in vitro. Short hairpin RNA
(shRNA)-expressing plasmids were co-transfected into HEK 293 cells
with ataxin-1 (FLAG-tagged) expression plasmids. Candidate hairpin
sequences expressed from pol III (human U6; hU6) and pol II
(modified CMV; mCMV) (Xia 2002) promoters were tested. The initial
screen of hairpins directed against ataxin-1 sequences dispersed
along the ataxin-1 cDNA (FIG. 6A) was unsuccessful regardless of
promoter (0 of 4 tested). An expanded evaluation identified two
constructs (shSCA1.F10 and shSCA1.F11; 2 of 7 tested) that reduced
RNA levels up to 80% and ataxin-1 protein levels by 50-60% (FIG.
6B, 6C). Q-PCR analysis showed that shSCA1.F10- and
shSCA1.F11-mediated silencing of the ataxin-1 transcript was dose
dependent (FIG. 6C). To determine if shSCA1s were functional in
neural cells the inventors used PC6-3 cells, a PC-12 cell
derivative that displays more uniform neuronal phenotypes (Pittman
1993). PC6-3 cells were transfected with AAV shuttle vectors
expressing shSCA1.F10, shSCA1.F11, or control shRNAs, and silencing
of ataxin-1 expression was assessed by western blot. Interestingly,
mCMV-expressed shSCA1.F11 appeared more efficient than the same
construct expressed from the hU6 promoter (FIG. 6D).
[0366] A recent study by Kawasaki and colleagues (Kawasaki 2003)
suggested that one caveat of Pol III-based promoters for expressing
shRNAs is inefficient export of transcripts to the cytoplasm.
Replacement of the loop structure of their shRNAs with those
derived from endogenously expressed miRNAs improved nuclear export
and gene silencing (Kawasaki 2003). To test if similar
modifications improved Pol III-directed expression of shRNAs for
ataxin-1 silencing, the loops of hairpins from shSCA1.F10 and
shSCA1.F11, (originally 5'-ACTAGT-3' (SEQ ID NO:104)), were
replaced with the loop from miR23 (5'-CTTCCTGTCA-3' (SEQ ID
NO:105); designated F10mi). While there was no effect of the miRNA
loop on CMV-shRNA-based silencing (not shown), miR23 loops improved
the silencing activity of Pol III-expressed shSCA1.F10 and
shSCA1.F11 against normal human ataxin-1 (FIG. 6E) and importantly,
human ataxin-1 with an 82Q expansion (FIG. 6F).
[0367] Effects of shSCA1 on Motor Coordination in SCA1 Transgenic
Mice
[0368] The inventors next generated recombinant adeno-associated
virus serotype 1 (AAV1) expressing shSCA1.F10mi and shSCA1.F11mi to
evaluate hairpin efficacy in the transgenic mouse model of SCA1
(denoted AAVshSCA1.F10mi or AAVshSCA1.F11mi). The virus was also
engineered to express the hrGFP reporter for detection of
transduced cells (FIG. 7A). In SCA1 mice, transgenic human disease
allele (ataxin-1-Q82) expression is confined to the cerebellar
Purkinje cells by PCP-2, a Purkinje cell-specific promoter
(Burright 1995, Clark 1997). Thus the inventors initially tested
AAV1's ability to transduce Purkinje cells, since its transduction
profile in cerebella was unknown. As shown in FIG. 7B, AAVshSCA1
readily transduces Purkinje cells. Northern blot of RNA harvested
from cerebella 10 days after viral injection also showed that
shRNAs are expressed in vivo (FIG. 7C). The fast expression
kinetics from AAV1 is similar to AAV serotype 5, which also shows
tropism for Purkinje cells (Alisky 2000).
[0369] Heterozygous SCA1 transgenic mice display many of the
characteristics of human SCA1, including progressive ataxia,
Purkinje cell degeneration, and thinning of cerebellar molecular
layers. The rotarod test for motor performance is a valid indicator
of the progressive ataxia; proper foot placement in response to a
changing environment (i.e., the rotating rod) challenges the
cerebellum. To determine the effects of AAVshSCA1, or AAVs
expressing control hairpins (AAVshLacZ), on the ataxic phenotype,
mice were analyzed for baseline rotarod performance, followed by
injection at 7 weeks of age with shRNA-expressing viruses into
midline cerebellar lobules. Rotorod analyses were repeated every
two weeks until sacrifice. Mock-transduced animals (saline
injection) were also assessed. The data in FIG. 7D demonstrate that
transduction with viruses expressing shSCA1.F10mi, but not shLacZ,
significantly improves SCA1 mice motor performance. Also of note is
the observation that expression of shSCA1.F10mi did not negatively
affect the rotarod performance of wildtype mice, indicating that
intracellular expression of shRNAs is not overtly toxic to Purkinje
cells.
[0370] Improved Neuropathology in shSCA1-Expressing Purkinje
Cells
[0371] The inventors next tested if the improved rotarod
performance was attributable to improvements in neuropathology. The
progressive pathological changes in SCA1 transgenic mice have been
well characterized, and include intranuclear inclusions of
ataxin-1, Purkinje cell dendritic pruning, Purkinje cell loss and
concomitant thinning of the cerebellar molecular layer (Burright
1995).
[0372] Cerebellar lobules from SCA1 and wildtype mice injected with
AAVshLacZ or AAVshSCA1 were evaluated for hrGFP expression and
calbindin staining to assess if shSCA1 reduced the progressive
thinning of the molecular layer in SCA1 transgenic mice. FIG. 8A
shows representative sections from virus-injected mice cerebella.
The juxtaposition of untransduced regions (hrGFP-) to transduced
ones (hrGFP+) allowed for direct comparisons of the effects of
shSCA1. Calbindin staining remained robust in hrGFP+ molecular
layers from SCA1 transgenic mice treated with AAVshSCA1, but was
notably diminished in untransduced areas. HrGFP+ molecular layers
from SCA1 transgenic mice injected with AAVshLacZ showed reduced
calbindin staining, indistinguishable from untransduced layers. In
wildtype mice injected with AAVshSCA1 (FIG. 8A), AAVshLacZ or
saline (not shown), calbindin staining was uniform in all regions
examined. The data show that shSCA1-mediated improvements are
confined to transduced neurons.
[0373] Molecular layer widths were quantified in wildtype mice and
SCA1 transgenic mice treated with AAV. FIG. 8B confirms the
morphological observation that expression of shRNAs did not affect
the molecular layers of wildtype mice. The data also show that
molecular layer widths in hrGFP+ regions from shSCA1-treated SCA1
mice (162 .mu.m.+-.16) are indistinguishable from wildtype controls
(untransduced, 158 .mu.m.+-.20; AAVshSCA1 treated, 156
.mu.m.+-.20), in contrast to the markedly thinned molecular layer
in SCA1 mice given AAVshLacZ (109 .mu.m+12), or mock injected (109
.mu.m.+-.11).
[0374] The inventors next determined the effects of AAVshSCA1 on
human ataxin-1 expression and the formation of ataxin-1 nuclear
inclusions. In cerebella from SCA1 mice harvested 1 week after
injection of AAVshSCA1.F10 or AAVshSCA1.F11, ataxin-1
immuno-reactivity was markedly reduced in transduced (hrGFP+)
relative to non-transduced (GFP-) cells (FIG. 9). There was no
effect of transduction on ataxin-1 levels in mock or AAVshLacZ
treated SCA1 mice.
[0375] Prior work in the Orr and Zoghbi laboratories (Clark 1997)
established that mutant ataxin-1 forms single intranuclear
inclusions in .about.50% of Purkinje cells at 16 weeks of age. In
tissues from SCA1 mice harvested 9 weeks after injection of saline
or AAVshLacZ, ataxin-1 immunofluorescence (IF) was robust and
present throughout Purkinje cell nuclei. The inventors found
punctate intranuclear inclusions in 49% of cells (FIG. 10A left
panels; FIG. 10B top panel), independent of their transduction
status. In contrast, transduced (hrGFP+) cells from AAVshSCA1
treated mice displayed greatly diminished ataxin-1 nuclear
staining, with complete resolution of inclusions in transduced
cells (FIGS. 10A, 10B and FIG. 11).
[0376] Discussion
[0377] The present results demonstrate in vivo efficacy of RNAi and
support the utility of RNAi gene therapy for SCA1 and other
polyglutamine neurodegenerative diseases. In the SCA1 mouse model,
cerebellar delivery of AAV1 vectors expressing ataxin-1-targeting
shRNAs reduced ataxin-1 expression in Purkinje cells, improved
motor performance and normalized the cerebellar pathology in
transduced regions. In these studies, the inventors directed
delivery to midline cerebellar lobules because of their importance
in axial and gait coordination in mammals. In tissues harvested 9
weeks after injection, the inventors found near 100% transduction
of targeted lobules, with a transduction efficiency of 5-10% of all
cerebellar Purkinje cells. This supports that directed correction
could have a major impact on human disease characteristics.
[0378] SCA1 mice show progressive neurodegenerative disease similar
to SCA1 patients. In recent work using an inducible mouse model of
SCA1, reversal of disease phenotypes was more difficult as the
disease progressed, suggesting that earlier treatments will be more
beneficial (Zu 2004). In the inducible SCA1 model, inhibition of
mutant ataxin-1 expression at week 12 led to rotarod performance
improvements.
[0379] The intranuclear, ataxin-1 inclusions are characteristic of
SCA1 patient brain tissue and SCA1 mice cerebellar Purkinje cells
(Burright 1995). The inventors found complete resolution of
inclusions in transduced cells, which correlated with improved
neuropathology. In the inducible SCA1 model, inclusions resolved
several days after inhibition of mutant allele expression. AAV1
expressed shRNAs reduced mutant ataxin-1 expression as early as one
week after introduction of vector, indicating that shSCA1-mediated
inhibition of ataxin-1 (Q82) expression could improve
disease-associated neuropathological changes almost immediately
after gene transfer.
[0380] In the inventors' initial in vitro screen, it was difficult
to identify effective shRNAs for ataxin-1 silencing. The two
functional shRNAs discovered by the inventors flanked the CAG
repeat region. The generalizability of this finding was tested in
studies targeting a mutant huntingtin and found that the CAG-repeat
expansion in huntingtin did not confer accessibility to RNAi.
Interestingly, shRNAs shSca1.F10 and shSCA.F11 adhere less well to
the model criteria (Reynolds 2004) than those that did not reduce
ataxin-1 expression. This suggests the potential requirement for
screening many hairpins (perhaps up to 20) prior to identifying one
suitably potent for gene silencing.
[0381] Heterozygous SCA1 mice provide a tool for allele-specific
silencing of the disease gene; SCA1 mice retain two wildtype
ataxin-1 genes in addition to the human disease transgene. In SCA1
patients, however, shSCA1 would target both the disease and the
wildtype allele. For SCA1 this may not be problematic because
ataxin-1 knock out mice do not display cerebellar or brainstem
pathology and have only mild ataxia measured by rotarod
performance. Moreover, shRNAs probably do not reduce mRNA and
protein levels to zero. The significant but non-ablative reduction
of ataxin-1 would enable cellular machinery to `catch up` with
existent inclusions.
[0382] In summary, the inventors have shown that RNAi therapy can
dramatically improve cellular and behavioral characteristics in a
mouse model of a human dominant neurodegenerative disease, SCA1.
The present findings have relevance to other polyglutamine-repeat
disorders including Huntington's disease, and neurodegenerative
disorders such as Alzheimer's disease, where inhibiting expression
of a disease-linked protein would directly protect, or even
reverse, disease phenotypes.
Example 4
Huntington's Disease (HD)
[0383] Huntington's disease (HD) is one of several dominant
neurodegenerative diseases that result from a similar toxic gain of
function mutation in the disease protein: expansion of a
polyglutamine (polyQ)-encoding tract. It is well established that
for HD and other polyglutamine diseases, the length of the
expansion correlates inversely with age of disease onset. Animal
models for HD have provided important clues as to how mutant
huntingtin (htt) induces pathogenesis. Currently, no
neuroprotective treatment exists for HD. RNA interference has
emerged as a leading candidate approach to reduce expression of
disease genes by targeting the encoding mRNA for degradation.
[0384] As discussed in Example 3 above, short hairpin RNAs (shRNAs)
were generated that significantly inhibited human htt expression in
cell lines. Importantly, the shRNAs were designed to target
sequences present in HD transgenic mouse models. The present
studies test the efficacy of the shRNAs in HD mouse models by
determining if inclusions and other pathological and behavioral
characteristics that are representative of HD can be inhibited or
reversed. In a transgenic model of inducible HD, pathology and
behavior improved when mutant gene expression was turned off. These
experiments show that RNAi can prevent or reverse disease.
[0385] Although the effect of partial reduction of wildtype htt in
adult neurons is unknown, it is advantageous to target only mutant
htt for degradation, if possible. One polymorphism in linkage
disequilibrium with HD has been identified in the coding sequence
for htt, and others are currently being investigated. Disease
allele-specific RNAi are designed using approaches that led to
allele specific silencing for other neurogenetic disease models.
This would allow directed silencing of the mutant, disease-causing
expanded allele, leaving the normal allele intact.
[0386] Constitutive expression of shRNA can prevent the
neuropathological and behavioral phenotypes in a mouse model of
Spinocerebellar Ataxia type I, a related polyQ disease. However,
the constitutive expression of shRNA may not be necessary,
particularly for pathologies that take many years to develop but
may be cleared in a few weeks or months. For this reason, and to
reduce long-term effects that may arise if nonspecific silencing or
activation of interferon responses is noted, controlled expression
may be very important. In order to regulate RNAi for disease
application, doxycycline-responsive vectors have been developed for
controlled silencing in vitro.
[0387] HD researchers benefit from a wealth of animal models
including six transgenic and four knock-in mouse models (Bates
2003). Expression is from the endogenous human promoter, and the
CAG expansion in the R6 lines ranges from 110 to approximately 150
CAGs. The R6/2 line is the most extensively studied line from this
work. R6/2 mice show aggressive degenerative disease, with age of
symptom onset at 8-12 weeks, and death occurring at 10 to 13 weeks.
Neuronal intranuclear inclusions, a hallmark of HD patient brain,
appear in the striatum and cortex of the R6/2 mouse (Meade
2002).
[0388] Adding two additional exons to the transgene and restricting
expression via the prion promoter led to an HD mouse model
displaying important HD characteristics but with less aggressive
disease progression (Shilling 1999, Shilling 2001). The Borchelt
model, N171-82Q, has greater than wildtype levels of RNA, but
reduced amounts of mutant protein relative to endogenous htt.
N171-82Q mice show normal development for the first 1-2 months,
followed by failure to gain weight, progressive incoordination,
hypokinesis and tremors. There are statistically significant
differences in the rotarod test, alterations in gait, and hindlimb
clasping. Mice show neuritic pathology characteristic of human HD.
Unlike the Bates model, there is limited neuronal loss.
[0389] Detloff and colleagues created a mouse knock-in model with
an extension of the endogenous mouse CAG repeat to approximately
150 CAGs. This model, the CHL2 line, shows more aggressive
phenotypes than prior mouse knock-in models containing few repeats
(Lin 2001). Measurable neurological deficits include clasping, gait
abnormalities, nuclear inclusions and astrogliosis.
[0390] The present studies utilize the well-characterized Borchelt
mouse model (N171-82Q, line 81), and the Detloff knock-in model,
the CHL2 line. The initial targets for htt silencing were focused
on sequences present in the N171-82Q transgene (exons 1-3). The use
of this model was advantageous in the preliminary shRNA development
because the RNAi search could focus on only the amino-terminal
encoding sequences rather than the full length 14 kb mRNA. FIG. 12
depicts the one-step cloning approach used to screen hairpins
(Harper 2004). No effective shRNAs were found in exon 1, but
several designed against exon 2, denoted shHDEx2.1
(5'-AAGAAAGAACTTTCAGCTACC-3', SEQ ID NO:96), shHDEx2.2 19 nt
(5'-AGAACTTTCAGCTACCAAG-3' (SEQ ID NO:97)), or shHDEx2.2 21 nt
5'-AAAGAACTTTCAGCTACCAAG-3' (SEQ ID NO:98)) and exon 3 (shHDEx3.1
19 nt 5'-TGCCTCAACAAAGTTATCA-3' (SEQ ID NO:99) or shHDEx3.1 21 nt
5'-AATGCCTCAACAAAGTTATCA-3' (SEQ ID NO:100)) sequences were
effective. In co-transfection experiments with shRNA expressing
plasmids and the N171-82Q transcript target, shHDEx2.1 reduced
N171-Q82 transcript levels by 80%, and protein expression by
60%.
[0391] In transient transfection assays shHDex2.1 did not silence a
construct spanning exons 1-3 of mouse htt containing a 79 CAG
repeat expansion, the mouse equivalent of N171-82Q. Next shHDEx2
into NIH 3T3 cells were transfected to confirm that endogenous
mouse htt, which is expressed in NIH 3T3 cells, would not be
reduced. Surprisingly, shHDEx2.1 and shHDEx3.1 silenced full-length
mouse htt. In contrast, shHDEx2.2 silenced only the human N171-82Q
transgene.
[0392] Yamamoto and colleagues and others have demonstrated that
preformed inclusions can resolve (Yamamoto 2000). To test if RNAi
could also reduce preformed aggregates, the inventors used a
neuronal cell line, which, upon induction of Q80-eGFP expression,
showed robust inclusion formation (Xia 2002). Cells laden with
aggregates were mock-transduced, or transduced with recombinant
virus expressing control shRNA, or shRNAs directed against GFP. The
inventors found dramatic reduction in aggregates as assessed by
fluorescence. Quantification showed dose dependent effects (FIG.
13) that were corroborated by western blot (Xia 2002).
[0393] As indicated in Example 1 above, viral vectors expressing
siRNAs can mediate gene silencing in the CNS (Xia 2002). Also, as
indicated in Example 3 above, these studies were extended to the
mouse model of spinocerebellar ataxia type 1 (SCA1). The data are
important as they demonstrate that shRNA is efficacious in the CNS
of a mouse model of human neurodegenerative disease. The data also
support that shRNA expression in brain is not detrimental to
neuronal survival.
[0394] shRNAs can Target the Exon 58 Polymorphism.
[0395] As described in Example 2 above, a polymorphism in htt exon
58 is in linkage disequilibrium with HD (Ambrose 1994). Thirty
eight percent of the HD population possesses a 3-GAG repeat in exon
58, in contrast to the 4-GAG repeat found in 92% of non-HD
patients. The polymorphism likely has no affect on htt, but it
provides a target for directing gene silencing to the disease
allele. As indicated in Example 2 above, in experiments to test if
allele-specific silencing for HD was possible, plasmids were
generated that expressed shRNAs that were specific for the exon 58
polymorphism. The exon 58 3-GAG-targeting shRNAs were
functional.
[0396] Developing Vectors for Control of RNAi In Vivo.
[0397] As demonstrated above, shRNA expressed from viral vectors is
effective at directing gene silencing in brain. Also, viral vectors
expressing shSCA1 inhibited neurodegeneration in the SCA1 mouse
model. ShRNA expression was constitutive in both instances.
However, constitutive expression may not be necessary, and could
exacerbate any noted nonspecific effects. The present inventors
have developed and tested several doxycycline-regulated constructs.
The construct depicted in FIG. 14 showed strong suppression of
target gene (GFP) expression after addition of doxycycline and RNAi
induction.
[0398] RNAi can Protect, and/or Reverse, the Neuropathology in
Mouse Models of Human Huntington's Disease
[0399] Two distinct but complimentary mouse models are used, the
N171-82Q transgenic and CHL2 knock-in mice. The former express a
truncated NH2-terminal fragment of human htt comprising exons 1-3
with an 82Q-repeat expansion. The knock-in expresses a mutant mouse
allele with a repeat size of .about.150. Neither shows significant
striatal or cortical cell loss. Both therefore are suitable models
for the early stages of HD. They also possess similarities in mid-
and end-stage neuropathological phenotypes including inclusions,
gliosis, and motor and behavioral deficits that will permit
comparison and validation. On the other hand, the differences
inherent in the two models provide unique opportunities for
addressing distinct questions regarding RNAi therapy. For example,
N171-82Q transgenic mice have relatively early disease onset. Thus
efficacy can be assessed within a few months, in contrast to 9
months or more in the CHL2 line. Because the data showed that
shHDEx2.2 targets the human transgene and not mouse HD, evaluate
disease-allele specific silencing in N171-82Q mice is evaluated. In
contrast, the CHL2 knock-in is important for testing how reducing
expression of both the mutant and wildtype alleles impacts on the
HD phenotype. Finally, both models should be investigated because
any therapy for HD should be validated in two relevant disease
models.
[0400] siRNA Against Human Htt Protects Against Inclusion Formation
in N171-82Q Mice
[0401] The data show that it is possible to silence the human
N171-82Q transgene in vitro, and work in reporter mice and SCA1
mouse models demonstrated efficacy of RNAi in vivo in brain.
shHDEx2.2 constructs, expressed from two vector systems with
well-established efficacy profiles in CNS, are now tested for their
capacity to reduce mutant transgenic allele expression in vivo.
Further, the impact of shHDEx2.2 on inclusion formation is
assessed. Inclusions may not be pathogenic themselves, but they are
an important hallmark of HD and their presence and abundance
correlates with severity of disease in many studies.
[0402] Recombinant feline immunodeficiency virus (FIV) and
adeno-associated virus (AAV) expressing shHDs are injected into
N171-82Q. The levels of shHDs expressed from FIV and AAV are
evaluated, as is the ability to reduce htt mRNA and protein levels
in brain, and subsequently affect inclusion formation.
[0403] Mice.
[0404] N171-82Q mice developed by Borchelt and colleagues are used
for these experiments (Shilling 1999, Shilling 2001). The colony
was set up from breeders purchased from Jackson Laboratories
(N171-82Q, line 81) and are maintained as described (Shilling 1999,
Shilling 2001). F1 pups are genotyped by PCR off tail DNA, obtained
when tagging weaned litters.
[0405] IC2 and EM48 have been used previously to evaluate N171-82Q
transgene expression levels in brain by immuno-histochemistry (IHC)
and western blot (Zhou 2003, Trottier 1995). EM48 is an antibody
raised against a GST-NH2 terminal fragment of htt that detects both
ubiquitinated and non-ubiquitinated htt-aggregates (Li 2000), and
the IC2 antibody recognizes long polyglutamine tracts (Trottier
1995). By 4 weeks N171-82Q mice show diffuse EM48-positive staining
in striata, hippocampus, cerebellar granule cells, and cortical
layers IV and V (Shilling 1999, Shilling 2001). The present
experiments focus on the striatum and cortex because they are the
major sites of pathology in human HD. TUNEL positivity and GFAP
immunoreactivity are also significant in striatal sections
harvested from 3 month old N171-82Q mice (Yu 2003). At 4 months,
punctate nuclear and cytoplasmic immunoreactivity is also seen (Yu
2003).
[0406] Viruses.
[0407] It is difficult to directly compare the two viruses under
study at equivalent doses; FIV is enveloped and can be concentrated
and purified, at best, to titers of 5.times.10.sup.8 infectious
units/ml (iu/ml). FIV pseudotyped with the vesicular stomatitus
glycoprotein (VSVg) are used because of its tropism for neurons in
the striatum (Brooks 2002). In contrast, AAV is encapsidated and
can be concentrated and purified to titers ranging from
1.times.10.sup.9 to 1.times.10.sup.11 iu/ml, with 1.times.10.sup.10
titers on average. AAV serotype 5 is used because it is tropic for
neurons in striatum and cortex, our target brain regions. Also, it
diffuses widely from the injection site (Alisky 2000, Davidson
2000). Ten-fold dilutions of FIV and AAV generally results in a
greater than 10-fold drop in transduction efficiency, making
comparisons at equal titers, and dose escalation studies,
unreasonable. Thus, both viruses are tested at the highest titers
routinely available to get a fair assessment of their capacities
for efficacy in N171-82Q mice. All viruses express the humanized
Renilla reniformis green fluorescent protein (hrGFP) reporter
transgene in addition to the snRNA sequence (FIG. 15). This
provides the unique opportunity to look at individual, transduced
cells, and to compare pathological improvements in transduced vs.
untransduced cells.
[0408] Injections.
[0409] Mice are placed into a David Kopf frame for injections. Mice
are injected into the striatum (5 microliters; 100 nl/min) and the
cortex (3 microliters; 75 nl/min) using a Hamilton syringe and
programmable Harvard pump. The somatosensory cortex is targeted
from a burr hole at -1.5 mm from Bregma, and 1.5 mm lateral. Depth
is 0.5 mm. The striatum is targeted through a separate burr hole at
+1.1 mm from Bregma, 1.5 mm lateral and 2 mm deep. Only the right
side of the brain is injected, allowing the left hemisphere to be
used as a control for transgene expression levels and presence or
absence of inclusions.
[0410] Briefly, groups of 4 week-old mice heterozygous for the
N171-82Q transgene and their age-matched wildtype littermates are
injected with FIV (FIV groups are VSVg.FIV.shHDEx2.2,
VSVg.FIVshlacZ, VSVg.hrGFP, saline) or AAV (AAV groups are
AAV5.shHDEx2.2, AAV5shlacZ, AAV5hrGFP, saline) (n=18/group;
staggered injections because of the size of the experiment). [Names
of shHDEx2.2 and shlacZ expressing viruses have been shortened from
shlacZ.hrGFP, for example, to make it easier to read--but all
vectors express hrGFP as reporter.] Nine mice/group are sacrificed
at 12 weeks of age to assess the extent of transduction (eGFP
fluorescence; viral copy number/brain region), shRNA expression
(northern for shRNAs, and inhibition of expression of the
transgenic allele (QPCR and western blot). The remaining groups are
sacrificed at 5 months of age. This experimental set up is repeated
(to n=6/group) to confirm results and test inter-experiment
variability.
[0411] All mice in all groups are weighed bi-weekly (every other
week) after initial weekly measurements. N171-82Q mice show normal
weight gain up to approximately 6 weeks, after which there are
significant differences with their wildtype littermates.
[0412] PCR Analyses.
[0413] Brains are harvested from mice sacrificed at 12 weeks of
age, and grossly evaluated for GFP expression to confirm
transduction. The cortex and striatum from each hemisphere is
dissected separately, snap frozen in liquid N2, pulverized with a
mortar and pestle, and resuspended in Trizol (Gibco BRL). Separate
aliquots are used for Q-RTPCR for N171-82Q transgenes and DNA PCR
for viral genomes. A coefficient of correlation is determined for
transgene silencing relative to viral genomes for both vector
systems, for the regions analyzed and compared to contralateral
striata and mice injected with control vectors or saline.
[0414] The RNA harvested is used to evaluate activation of
interferon-responsive genes. Bridges et al (Bridges 2003) and Sledz
and colleagues (Sledz 2003) found activation of 2'S' oligo(A)
polymerase (OAS) in cell culture with siRNAs and shRNAs, the latter
expressed from lentivirus vectors. Gene expression changes are
assessed using QPCR for OAS, Stat1, interferon-inducible
transmembrane proteins 1 and 2 and protein kinase R (PKR). PKR
activation is an initial trigger of the signaling cascade of the
interferon response.
[0415] Protein Analyses.
[0416] A second set of 3 brains/group are harvested for protein
analysis. Regions of brains are micro dissected as described above,
and after pulverization are resuspended in extraction buffer (50 mM
Tris, pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 1
mM BetaME, 1.times. complete protease inhibitor cocktail) for
analysis by western blot. HrGFP expression are evaluated and
correlated to diminished levels of soluble N171-82Q using anti-GFP
and antibodies to the NH2-terminal region of htt (EM48) or the
polyglutamine tract (IC2).
[0417] Histology.
[0418] Histology is done on the remaining animals. Mice are
perfused with 2% paraformaldehyde in PBS, brains blocked to remove
the cerebellum, post-fixed ON, and then cryoprotected in 30%
sucrose. Full coronal sections (40 .mu.m) of the entire cerebrum
are obtained using a Microtome (American Products Co #860 equipped
with a Super Histo Freeze freezing stage). Briefly, every section
is collected, and sections 1-6 are placed into 6 successive wells
of a 24-well plate. Every 400 microns, two sections each of 10
microns are collected for Nissl and H&E staining. The process
is repeated.
[0419] EM-48 immuno-staining reveals diffuse nuclear accumulations
in N171-82Q mice as early as 4 weeks of age. In 6 mo. old mice
inclusions are extensive (Shilling 2001). The increase in
cytoplasmic and nuclear EM48 immuno-reactivity, and in EM48
immuno-reactive inclusions over time allow quantitative comparisons
between transduced and untransduced cells. Again, control values
are obtained from mice injected with shlacZ-expressing vectors,
saline injected mice, and wt mice. The contralateral region is used
as another control, with care taken to keep in mind the possibility
of retrograde and anterograde transport of virus from the injection
site.
[0420] Quantitation of nuclear inclusions is done using
BioQuant.TM. software in conjunction with a Leitz DM RBE upright
microscope equipped with a motorized stage (Applied Scientific
Instruments). Briefly, floating sections are stained with anti-NeuN
(AMCA secondary) and EM48 antibodies (rhodamine secondary) followed
by mounting onto slides. The regions to be analyzed are outlined,
and threshold levels for EM48 immunoreactivity set using sections
from control injected mice. A minimum of 50 hrGFP-positive and
hrGFP negative neurons cells are evaluated per slide (5
slides/mouse), and inclusion intensity measured (arbitrary units).
This is done for both striata and cortices. To quantitate
cytoplasmic inclusions, the striatum is outlined and total EM48
aggregate density measured. Threshold values are again done using
control hemispheres and control injected mice.
[0421] Additional wells of sections are stained with anti-GFAP,
anti-neurofilament, and the lectin GSA to assay for viral or
viral+hairpin induced gliosis, neuritic changes, and microglial
activation, respectively. GFAP-stained brain sections from N171-82Q
mice show gliosis by 4 months (Yu 1998), although earlier time
points have not been reported.
[0422] Stereology.
[0423] In a separate experiment on N171-82Q mice and wt mice,
unbiased stereology using BioQuant.TM. software is done to assess
transduction efficiency. Stereology allows for an unbiased
assessment of efficiency of transduction (number of cells
transduced/input). AAV5 (AAV5hrGFP, AAV5shHD.hrGFP) and FIV
(VSVg.FIVhrGFP, VSVg.FIVshHD.hrGFP) transduction efficiency is
compared in the striatum and somatosensory cortex in HD and
wildtype mice, with n=5 each. Mice are harvested at 12 and 20
weeks. The cerebrum is sectioned in its entirety and stored at
-20.degree. C. until analysis. Briefly, six weeks after gene
transfer with VSVg.FIVhrGFP (n=3) or AAV5hrGFP (n=3), every section
of an HD mouse cerebrum is mounted and an initial assessment of the
required numbers of sections and grid and dissector size done using
the coefficient of error (as determined by Martheron's quadratic
approximation formula) as a guide.
[0424] The 171-82Q HD mouse model has important neuropathological
and behavioral characteristics relevant to HD. Onset of disease
occurs earlier than HD knock-in or YAC transgenic models, allowing
an initial, important assessment of the protective effects of RNAi
on the development of neuropathology and dysfunctional behavior,
without incurring extensive long term housing costs. Admittedly,
disease onset is slower and less aggressive than the R6/2 mice
created by Bates and colleagues (Mangiarini 1996), but the R6/2
line is difficult to maintain and disease is so severe that it may
be less applicable and less predicative of efficacy in clinical
trials.
[0425] N171-82Q mice (n=6/group) and age-matched littermates
(n=6/group) are be weighed twice a month from 4 wks on, and
baseline rotarod tests performed at 5 and 7 weeks of age. Numbers
of mice per group are as described in Schilling et al (Shilling
1999) in which statistically significant differences between
N171-82Q and wildtype littermates were described. At 7 weeks of age
(after testing is complete), AAV (AAVshHDEx2.2, AAVshlacZ,
AAVhrGFP, saline) or FIV (FIVshEx2.2, FIVshlacZ, FIVhrGFP, saline)
is injected bilaterally into the striatum and cortex. Rotarod tests
are repeated at 3-week intervals starting at age 9 weeks, until
sacrifice at 6 months. The clasping behavior is assessed monthly
starting at 3 months.
[0426] Behavioral Testing.
[0427] N171-82Q mice are given four behavioral tests, all of which
are standard assays for progressive disease in HD mouse models. The
tests allow comparisons of behavioral changes resulting from RNAi
to those incurred in HD mouse models given other experimental
therapies. For example, HD mice given cystamine or creatine therapy
showed delayed impairments in rotarod performance, and in some
cases delayed weight loss (Ferrante 2000, Dedeoglu 2002, Dedeogu
2003) In addition to the rotarod, which is used to assay for motor
performance and general neurological dysfunction, the activity
monitor allows assessment of the documented progressive
hypoactivity in N171-82Q mice. The beam analysis is a second test
of motor performance that has also been used in HD mice models
(Carter 1999). Clasping, a phenotype of generalized neurological
dysfunction, is straightforward and takes little time. Clasping
phenotypes were corrected in R. Hen's transgenic mice possessing an
inducible mutant htt.
[0428] Accelerated Rotarod.
[0429] N171-82Q and age-matched littermates are habituated to the
rotarod at week 4, and 4 trials per day for 4 days done on week 5
and 7, and every 3 weeks hence using previously described assays
(Shilling 1999, Clark 1997) in use in the lab. Briefly, 10 min
trials are run on an Economex rotarod (Columbus Instruments) set to
accelerate from 4 to 40 rpm over the course of the assay. Latency
to fall is recorded and averages/group determined and plotted.
Based on prior work (Shilling 1999) 6 mice will give sufficient
power to assess significance.
[0430] Clasping Behavior.
[0431] Normal mice splay their limbs when suspended, but mice with
neurological deficits can exhibit the opposite, with fore and hind
limbs crunched into the abdomen (clasping). All mice are suspended
and scored for clasping monthly. The clasp must be maintained for
at least 30 sec. to be scored positive.
[0432] Activity Monitor.
[0433] Most HD models demonstrate hypokinetic behavior,
particularly later in the disease process. This can be measured in
several ways. One of the simplest methods is to monitor home cage
activity with an infrared sensor (AB-system 4.0, Neurosci Co.,
LTD). Measurements are taken over 3 days with one day prior
habituation to the testing cage (standard 12-hour light/dark
cycle). Activity monitoring is done at 12, 17, and 20 and 23 weeks
of age.
[0434] Beam Walking.
[0435] N171Q-82Q and age matched littermates are assayed for motor
performance and coordination using a series of successively more
difficult beams en route to an enclosed safety platform. The assay
is as described by Carter et al (Carter 1999). Briefly, 1
meter-length beams of 28, 17 or 11 mm diameter are placed 50 cm
above the bench surface. A support stand and the enclosed goal box
flank the ends. Mice are trained on the 11 mm beam at 6 weeks of
age over 4 days, with 3 trials per day. If mice can traverse the
beam in <20 sec. trials are initiated. A trial is then run on
each beam, largest to smallest, with a 60 sec cutoff/beam and one
minute rest between beams. A second trial is run and the mean
scores of the two trials evaluated.
[0436] RNAi cannot replace neurons; it only has the potential to
protect non-diseased neurons, or inhibit further progression of
disease at a point prior to cell death. N171-82Q mice do not show
noticeable cellular loss, and is therefore an excellent model of
early HD in humans. The general methodology is the similar to that
described above, except that the viruses are injected at 4 months,
when N171-82Q mice have measurable behavioral dysfunction and
inclusions. Animals are sacrificed at end stage disease or at 8
months, whichever comes first. Histology, RNA and protein in
harvested brains are analyzed as described above.
[0437] It is important to confirm the biological effects of virally
expressed shHDs in a second mouse model, as it is with any therapy.
The Detloff knock-in mouse (the CHL2 line, also notated as
HdhCAGQ150) is used as a second model of early HD disease
phenotypes. These mice have a CAG expansion of approximately 150
units, causing brain pathologies similar to HD including gliosis
and neural inclusions in the cortex and striatum. They also show
progressive motor dysfunction and other behavioral manifestations
including rotarod deficits, clasping, gait abnormalities and
hypoactivity.
[0438] Heterozygous CHL2 mice express the mutant and wildtype
allele at roughly equivalent levels, and shRNAs directed against
mouse HD silence both transcripts. shmHDEx2.1 causes reductions in
gene expression, but not complete silencing. Disease severity in
mouse models is dependent on mutant htt levels and CAG repeat
length.
[0439] The inventors created shmHDEx2 (shRNA for murine HD)
directed against a region in mouse exon 2 that reduces expression
of the full-length mouse Hdh transcript in vitro. Transduction of
neurons with shmHDEx2-expressing viruses, and its impacts on
neuropathological progression, behavioral dysfunction and the
appearance of EM48 immuno-reactive inclusions in CHL2 mice is
tested. shmHD- or shlacZ-expressing vectors in CHL2 and wildtype
brain is tested. In this experiment, virus is injected into the
striatum of wt or CHL2 mice (10/group) using the coordinates
described above, at 3 months of age. Two months later mice are
sacrificed and brains removed and processed for RNA (n=5/group) and
protein (n=5).
[0440] A second study tests the vectors in the Detloff model.
Briefly, 15 mice per group are injected into the striatum and
cortex at 3 months of age with AAV (AAVshmHD, AAVshlacZ, AAVhrGFP,
saline) or FIV (VSVg.FIV.shmHD, VSVg.FIVshlacZ, VSVg.FIVhrGFP,
saline) expressing the transgenes indicated. To assess the impact
of RNAi, activity performed. The mice are sacrificed at 16-18
months of age and five brains/group are processed for histology and
sections banked in 24-well tissue culture plates. The remaining
brains are processed for RNA (n=6) and protein analysis (n=5).
Northern blots or western blots are required to analyze wildtype
and mutant htt expression because the only distinguishing
characteristic is size.
[0441] Development of Effective Allele-Specific siRNAs
[0442] Mutant htt leads to a toxic gain of function, and inhibiting
expression of the mutant allele has a profound impact on disease
(Yamamoto 2000). Also, selectively targeting the disease allele
would be desirable if non-disease allele silencing is deleterious.
At the present time, there is one documented disease linked
polymorphism in exon 58 (Lin 2001). Most non-HD individuals have 4
GAGs in Hdh exon 58 while 38% of HD patients have 3 GAGs. As
described above, RNAi can be accomplished against the 3-GAG
repeat.
[0443] Prior work by the inventors showed the importance of using
full-length targets for testing putative shRNAs. In some cases,
shRNAs would work against truncated, but not full-length targets,
or vice-versa. Thus, it is imperative that testable, full-length
constructs are made to confirm allele-specific silencing. The V5
and FLAG tags provide epitopes to evaluate silencing at the mRNA
and protein levels. This is important as putative shRNAs may behave
as miRNAs, leading to inhibition of expression but not message
degradation.
[0444] Designing the siRNAs.
[0445] Methods are known for designing siRNAs (Miller 2003,
Gonzalez-Alegre 2003, Xia 2002, Kao 2003). Information is also know
about the importance of maintaining flexibility at the 5' end of
the antisense strand for loading of the appropriate antisense
sequence into the RISC complex (Khvorova 2003 Schwarz 2003). DNA
sequences are generated by PCR. This method allows the rapid
generation of many candidate shRNAs, and it is significantly
cheaper than buying shRNAs. Also, the inserts can be cloned readily
into our vector shuttle plasmids for generation of virus. The
reverse primer is a long oligonucleotide encoding the antisense
sequence, the loop, the sense sequence, and a portion of the human
U6 promoter. The forward primer is specific to the template in the
PCR reaction. PCR products are cloned directly into pTOPO blunt
from InVitrogen, plasmids transformed into DH5a, and bacteria
plated onto Kanr plates (the PCR template is Ampr). Kanr clones are
picked and sequenced. Sequencing is done with an extended `hot
start` to allow effective read-through of the hairpin. Correct
clones are transfected into cells along with plasmids expressing
the target or control sequence (HttEx58.GAG3V5 and
HttEx58.GAG4FLAG, respectively) and silencing evaluated by western
blot. Reductions in target mRNA levels are assayed by Q-RTPCR. The
control for western loading is neomycin phosphotransferase or
hrGFP, which are expressed in the target-containing plasmids and
provide excellent internal controls for transfection efficiency.
The control for Q-RTPCR is HPRT.
[0446] Cell lines expressing targets with the identified
polymorphism or control wildtype sequences are created. Target gene
expression are under control of an inducible promoter. PC6-3, Tet
repressor (TetR+) cells, a PC-12 derivative with a uniform neuronal
phenotype (Xia 2002) are used. PC6-3 cells are transfected with
plasmids expressing HDEx58.GAG3V5 (contains neo marker) and
HDEx58GAG4FLG (contains puro marker), and G418+/puromycin+ positive
clones selected and characterized for transcript levels and htt-V5
or htt-Flag protein levels.
[0447] FIV vectors expressing the allele specific shRNAs are
generated and used to test silencing in the inducible cell lines.
FIV vectors infect most epithelial and neuronal cell lines with
high efficiency and are therefore useful for this purpose. They
also efficiently infect PC6-3 cells. AAV vectors are currently less
effective in in vitro screening because of poor transduction
efficiency in many cultured cell lines.
[0448] Cells are transduced with 1 to 50 infectious units/cell in
24-well dishes, 3 days after induction of mutant gene expression.
Cells are harvested 72 h after infection and the effects on
HDEx58.GAG3V5 or HDEx58GAG4FLG expression monitored.
Example 5
Micro RNAi-Therapy for Polyglutamine Disease
[0449] Post-transcriptional gene silencing occurs when double
stranded RNA (dsRNA) is introduced or naturally expressed in cells.
RNA interference (RNAi) has been described in plants (quelling),
nematodes, and Drosophila. This process serves at least two roles,
one as an innate defense mechanism, and another developmental
(Waterhouse 2001 Fire 1999, Lau 2001, Lagos-Quintana 2001, Lee
2001). RNAi may regulate developmental expression of genes via the
processing of small, temporally expressed RNAs, also called
microRNAs (Knight 2001, Grishok 2001). Harnessing a cell's ability
to respond specifically to small dsRNAs for target mRNA degradation
has been a major advance, allowing rapid evaluation of gene
function (Gonczy 2000, Fire 1998, Kennerdell 1998, Hannon 2002, Shi
2003, Sui 2002).
[0450] Most eukaryotes encode a substantial number of small
noncoding RNAs termed micro RNAs (miRNAs) (Zeng 2003, Tijsterman
2004, Lee 2004, Pham 2004). mir-30 is a 22-nucleotide human miRNA
that can be naturally processed from a longer transcript bearing
the proposed miR-30 stem-loop precursor. mir-30 can translationally
inhibit an mRNA-bearing artificial target sites. The mir-30
precursor stem can be substituted with a heterologous stem, which
can be processed to yield novel miRNAs and can block the expression
of endogenous mRNAs.
[0451] Huntington's disease (HD) and Spinocerebellar ataxia type I
(SCA1) are two of a class of dominant, neurodegenerative diseases
caused by a polyglutamine (polyQ) expansion. The mutation confers a
toxic gain of function to the protein, with polyQ length predictive
of age of onset and disease severity. There is no curative or
preventative therapy for HD or SCA1, supporting the investigation
of novel strategies. As described above, the inventors showed that
gene silencing by RNA interference (RNAi) can be achieved in vitro
and in vivo by expressing short hairpin RNAs (shRNAs) specific for
mRNAs encoding ataxin-1 or huntingtin. Currently, strong,
constitutive polIII promoters (U6 and H1) are used to express
shRNAs, which are subsequently processed into functional small
interfering RNAs (siRNAs). However, strong, constitutive expression
of shRNAs may be inappropriate for diseases that take several
decades to manifest. Moreover, high-level expression may be
unnecessary for sustained benefit, and in some systems may induce a
non-specific interferon response leading to global shut-down of
gene expression. The inventors therefore generated polII-expressed
microRNAs (miRNAs) as siRNA shuttles as an alternative strategy.
Due to their endogenous nature, miRNA backbones may prevent the
induction of the interferon response.
[0452] Using human mir-30 as a template, miRNA shuttles were
designed that upon processing by dicer released siRNAs specific for
ataxin-1. Briefly, the constructs were made by cloning a promoter
(such as an inducible promoter) and an miRNA shuttle containing an
embedded siRNA specific for a target sequence (such as ataxin-1)
into a viral vector. By cloning the construct into a viral vector,
the construct can be effectively introduced in vivo using the
methods described in the Examples above. Constructs containing
polII-expressed miRNA shuttles with embedded ataxin-1-specific
siRNAs were co-transfected into cells with GFP-tagged ataxin-1, and
gene silencing was assessed by fluorescence microscopy and western
analysis. Dramatic arid dose-dependent gene silencing relative to
non-specific miRNAs carrying control siRNAs was observed. This
polII-based expression system exploits the structure of known
miRNAs and supports tissue-specific as well as inducible siRNA
expression, and thus, serves as a unique and powerful alternative
to dominant neurodegenerative disease therapy by RNAi.
[0453] Briefly, the constructs were made by cloning a promoter
(such as an inducible promoter) and an miRNA shuttle containing an
embedded siRNA specific for a target sequence (such as ataxin-1)
into a viral vector. By cloning the construct into a viral vector,
the construct can be effectively introduced in vivo using the
methods described in the Examples above.
Example 6
siRNA Suppression of Genes Involved in MJD/SCA3 and FTDP-17
[0454] Modulation of gene expression by endogenous, noncoding RNAs
is increasingly appreciated to play a role in eukaryotic
development, maintenance of chromatin structure and genomic
integrity. Recently, techniques have been developed to trigger RNA
interference (RNAi) against specific targets in mammalian cells by
introducing exogenously produced or intracellularly expressed
siRNAs. These methods have proven to be quick, inexpensive and
effective for knockdown experiments in vitro and in vivo. The
ability to accomplish selective gene silencing has led to the
hypothesis that siRNAs might be employed to suppress gene
expression for therapeutic benefit.
[0455] Dominantly inherited diseases are ideal candidates for
siRNA-based therapy. To explore the utility of siRNA in inherited
human disorders, the inventors employed cellular models to test
whether we could target mutant alleles causing two classes of
dominantly inherited, untreatable neurodegenerative diseases:
polyglutamine (polyQ) neurodegeneration in MJD/SCA3 and
frontotemporal dementia with parkinsonism linked to chromosome 17
(FTDP-17). The polyQ neurodegenerative disorders consist of at
least nine diseases caused by CAG repeat expansions that encode
polyQ in the disease protein. PolyQ expansion confers a dominant
toxic property on the mutant protein that is associated with
aberrant accumulation of the disease protein in neurons. In
FTDP-17, Tau mutations lead to the formation of neurofibrillary
tangles accompanied by neuronal dysfunction and degeneration. The
precise mechanisms by which these mutant proteins cause neuronal
injury are unknown, but considerable evidence suggests that the
abnormal proteins themselves initiate the pathogenic process.
Accordingly, eliminating expression of the mutant protein by siRNA
or other means should, in principle, slow or even prevent disease.
However, because many dominant disease genes may also encode
essential proteins, the inventors sought to develop siRNA-mediated
approaches that selectively inactivate mutant alleles while
allowing continued expression of the wild type protein.
[0456] Methods
[0457] siRNA Synthesis.
[0458] In vitro siRNA synthesis was previously described (Donze
2000). Reactions were performed with desalted DNA oligonucleotides
(IDT Coralville, Iowa) and the AmpliScribeT7 High Yield
Transcription Kit (Epicentre Madison, Wis.). Yield was determined
by absorbance at 260 nm. Annealed siRNAs were assessed for double
stranded character by agarose gel (1% w/v) electrophoresis and
ethidium bromide staining. Note that for all siRNAs generated in
this study the most 5' nucleotide in the targeted cDNA sequence is
referred to as position 1 and each subsequent nucleotide is
numbered in ascending order from 5' to 3'.
[0459] Plasmid Construction.
[0460] The human ataxin-3 cDNA was expanded to 166 CAG's by PCR
(Laccone 1999). PCR products were digested at BamHI and KpnI sites
introduced during PCR and ligated into BglII and KpnI sites of
pEGFP-N1 (Clontech) resulting in full-length expanded ataxin-3
fused to the N-terminus of EGFP. Untagged Ataxin-3-Q166 was
constructed by ligating a PpuMI-NotI ataxin-3 fragment (3' of the
CAG repeat) into Ataxin-3-Q166-GFP cut with PpuMI and NotI to
remove EGFP and replace the normal ataxin-3 stop codon.
Ataxin-3-Q28-GFP was generated as above from pcDNA3.1-ataxin-3-Q28.
Constructs were sequence verified to ensure that no PCR mutations
were present. Expression was verified by Western blot with
anti-ataxin-3 (Paulson 1997) and GFP antibodies (MBL). The
construct encoding a flag tagged, 352 residue tau isoform was
previously described (Leger 1994). The pEGFP-tau plasmid was
constructed by ligating the human tau cDNA into pEGFP-C2 (Clontech)
and encodes tau with EGFP fused to the amino terminus. The
pEGFP-tauV337M plasmid was derived using site-directed mutagenesis
(QuikChange Kit, Stratagene) of the pEFGP-tau plasmid.
[0461] Cell Culture and Transfections.
[0462] Culture of Cos-7 and HeLa cells has been described (Chai
1999b). Transfections with plasmids and siRNA were performed using
Lipofectamine Plus (LifeTechnologies) according to the
manufacturer's instructions. For ataxin-3 expression 1.5 .mu.g
plasmid was transfected with 5 .mu.g in vitro synthesized siRNAs.
For Tau experiments 1 .mu.g plasmid was transfected with 2.5 .mu.g
siRNA. For expression of hairpin siRNA from the phU6 constructs, 1
.mu.g ataxin-3 expression plasmid was transfected with 4 .mu.g
phU6-siC10i or phU6-siG10i. Cos-7 cells infected with
siRNA-expressing adenovirus were transfected with 0.5 .mu.g of each
expression plasmid.
[0463] Stably transfected, doxycycline-inducible cell lines were
generated in a subclone of PC12 cells, PC6-3, because of its strong
neural differentiation properties (Pittman 19938). A PC6-3 clone
stably expressing Tet repressor plasmid (provided by S. Strack,
Univ. of Iowa), was transfected with pcDNA5/TO-ataxin-3(Q28) or
pcDNA5/TO-ataxin-3(Q166) (Invitrogen). After selection in
hygromycin, clones were characterized by Western blot and
immunofluorescence. Two clones, PC6-3-ataxin3(Q28)#33 and
PC6-3-ataxin3(Q166)#41, were chosen because of their tightly
inducible, robust expression of ataxin-3.
[0464] siRNA Plasmid and Viral Production.
[0465] Plasmids expressing ataxin-3 shRNAs were generated by
insertion of head-to-head 21 bp hairpins in phU6 that corresponded
to siC10 and siG10 (Xia 2002).
[0466] Recombinant adenovirus expressing ataxin-3 specific shRNA
were generated from phU6-C10i (encoding C10 hairpin siRNA) and
phU6si-G10i (encoding G10 hairpin siRNA) as previously described
(Xia 2002, Anderson 2000).
[0467] Western Blotting and Immunofluorescence.
[0468] Cos-7 cells expressing ataxin-3 were harvested 24-48 hours
after transfection (Chai 1999b). Stably transfected, inducible cell
lines were harvested 72 hours after infection with adenovirus.
Lysates were assessed for ataxin-3 expression by Western blot
analysis as previously described (Chai 1999b), using polyclonal
rabbit anti-ataxin-3 antisera at a 1:15,000 dilution or 1C2
antibody specific for expanded polyQ tracts (Trottier 1995) at a
1:2,500 dilution. Cells expressing Tau were harvested 24 hours
after transfection. Protein was detected with an affinity purified
polyclonal antibody to a human tau peptide (residues 12-24) at a
1:500 dilution. Anti-alpha-tubulin mouse monoclonal antibody (Sigma
St. Louis, Mo.) was used at a 1:10,000 dilution and GAPDH mouse
monoclonal antibody (Sigma St. Louis, Mo.) was used at a 1:1,000
dilution.
[0469] Immunofluorescence for ataxin-3 (Chai 1999b) was carried out
using 1C2 antibody (Chemicon International Temecula, Calif.) at
1:1,000 dilution 48 hours after transfection. Flag-tagged, wild
type tau was detected using mouse monoclonal antibody (Sigma St.
Louis, Mo.) at 1:1,000 dilution 24 hours after transfection. Both
proteins were detected with rhodamine conjugated secondary antibody
at a 1:1,000 dilution.
[0470] Fluorescent Imaging and Quantification.
[0471] Fixed samples were observed with a Zeiss Axioplan
fluorescence microscope. Digital images were collected on separate
red, green and blue fluorescence channels using a SPOT digital
camera. Images were assembled and overlaid using Adobe Photoshop
6.0. Live cell images were collected with a Kodak MDS 290 digital
camera mounted to an Olympus (Tokyo, Japan) CK40 inverted
microscope. Fluorescence was quantitated by collecting 3
non-overlapping images per well at low power (10.times.). Pixel
count and intensity for each image was determined using Bioquant
Nova Prime software (BIOQUANT Image Analysis Corporation).
Background was subtracted by quantitation of images from cells of
equivalent density under identical fluorescent illumination. Mock
transfected cells were used to assess background fluorescence for
all experiments and were stained with appropriate primary and
secondary antibodies for simulated heterozygous experiments.
Average fluorescence is reported from 2 to 3 independent
experiments. The mean of 2 to 3 independent experiments for cells
transfected with the indicated expression plasmid and siMiss was
set at one. Errors bars depict variation between experiments as
standard error of the mean. In simulated heterozygous experiments,
a blinded observer scored cells with a positive fluorescence signal
for expression of wild type, mutant or both proteins in random
fields at high power for two independent experiments. More than 100
cells were scored in each experiment and reported as number of
cells with co-expression divided by total number of transfected
cells.
[0472] Results
[0473] Direct Silencing of Expanded Alleles.
[0474] The inventors first attempted suppression of mutant polyQ
expression using siRNA complementary to the CAG repeat and
immediately adjacent sequences to determine if the expanded repeat
differentially altered the susceptibility of the mutant allele to
siRNA inhibition (FIG. 17). HeLa cells were transfected with
various in vitro synthesized siRNAs (Danze 2002) and plasmids
encoding normal or expanded polyQ fused to red or green fluorescent
protein, respectively (Q19-RFP and Q80-GFP) (FIG. 16A). In negative
control cells transfected with Q80-GFP, Q19-RFP and a mistargeted
siRNA (siMiss), Q80-GFP formed aggregates (Onodera 1997) which
recruited the normally diffuse Q19-RFP (FIG. 16A). When the
experiment was performed with siRNA targeted to GFP as a positive
control for allele specific silencing, Q80-GFP expression was
nearly abolished while Q19-RFP continued to be expressed as a
diffusely distributed protein (FIG. 16A). When Q19-RFP and Q80-GFP
were co-transfected with siRNA directly targeting the CAG repeat
(siCAG) (FIG. 16A) or an immediately adjacent 5' region (data not
shown), expression of both proteins was efficiently suppressed.
[0475] To test whether siRNA could selectively silence expression
of a full-length polyQ disease protein, siRNAs were designed that
target the transcript encoding ataxin-3, the disease protein in
Machado-Joseph Disease, also known as Spinocerebellar Ataxia Type 3
(MJD/SCA3) (Zoghbi 2000) (FIG. 16B). In transfected cells, siRNA
directed against three separate regions--the CAG repeat, a distant
5' site, or a site just 5' to the CAG repeat (siN'CAG)--resulted in
efficient, but not allele-specific, suppression of ataxin-3
containing normal or expanded repeats (data not shown). Consistent
with an earlier study using longer dsRNA (Caplen 2002) the present
results show that expanded CAG repeats and adjacent sequences,
while accessible to RNAi, may not be preferential targets for
silencing.
[0476] Allele-Specific Silencing of the Mutant PolyQ Gene in
MJD/SCA3.
[0477] In further efforts to selectively inactivate the mutant
allele the inventors took advantage of a SNP in the MJD1 gene, a G
to C transition immediately 3' to the CAG repeat (G987C) (FIG.
16B). This SNP is in linkage disequilibrium with the
disease-causing expansion, in most families segregating perfectly
with the disease allele. Worldwide, 70% of disease chromosomes
carry the C variant (Gaspar 2001). The present ataxin-3 expression
cassettes, which were generated from patients (Paulson 1997),
contain the C variant in all expanded ataxin-3 constructs and the G
variant in all normal ataxin-3 constructs. To test whether this G-C
mismatch could be distinguished by siRNA, siRNAs were designed that
included the last 2 CAG triplets of the repeat followed by the C
variant at position 7 (siC7) (FIG. 17 and FIG. 16B), resulting in a
perfect match only for expanded alleles. Despite the presence of a
single mismatch to the wild type allele, siC7 strongly inhibited
expression of both alleles (FIG. 16C,D). A second G-C mismatch was
then introduced at position 8 such that the siRNA contained two
mismatches as compared to wild type and only one mismatch as
compared to mutant alleles (siC7/8). The siC7/8 siRNA effectively
suppressed mutant ataxin-3 expression, reducing total fluorescence
to an average 8.6% of control levels, with only modest effects on
wild type ataxin-3 (average 75.2% of control). siC7/8 also nearly
eliminated the accumulation of aggregated mutant ataxin-3, a
pathological hallmark of disease (Chan 2000) (FIG. 16D).
[0478] To optimize differential suppression, siRNAs were designed
containing a more centrally placed mismatch. Because the center of
the antisense strand directs cleavage of target mRNA in the RNA
Induced Silencing Complex (RISC) complex (Elbashir 2001c), it was
reasoned that central mismatches might more efficiently
discriminate between wild type and mutant alleles. siRNAs were
designed that place the C of the SNP at position 10 (siC10),
preceded by the final three triplets in the CAG repeat (FIG. 17 and
FIG. 16B). In transfected cells, siC10 caused allele-specific
suppression of the mutant protein (FIG. 16C,D). Fluorescence from
expanded Atx-3-Q166-GFP was dramatically reduced (7.4% of control
levels), while fluorescence of Atx-3-Q28-GFP showed minimal change
(93.6% of control; FIG. 16C,D). Conversely, siRNA engineered to
suppress only the wild type allele (siG10) inhibited wild type
expression with little effect on expression of the mutant allele
(FIG. 16C,D). Inclusion of three CAG repeats at the 5' end of the
siRNA did not inhibit expression of Q19-GFP, Q80-GFP, or
full-length ataxin-1-Q30 proteins that are each encoded by CAG
repeat containing transcripts (FIG. 18A-B).
[0479] In the disease state, normal and mutant alleles are
simultaneously expressed. In plants and worms, activation of RNAi
against one transcript results in the spread of silencing signals
to other targets due to RNA-dependent RNA polymerase (RDRP)
activity primed by the introduced RNA (Fire 1998, Tang 2003).
Although spreading has not been detected in mammalian cells and
RDRP activity is not required for effective siRNA inhibition (Chiu
2002, Schwarz 2002, Martinez 2002), most studies have used
cell-free systems in which a mammalian RDRP could have been
inactivated. If triggering the mammalian RNAi pathway against one
allele activates cellular mechanisms that also silence the other
allele, then siRNA applications might be limited to non-essential
genes. To test this possibility, the heterozygous state was
simulated by co-transfecting Atx-3-Q28-GFP and Atx-3-Q166 and
analyzing suppression by Western blot. As shown in FIG. 16E each
siRNA retained the specificity observed in separate transfections:
siC7 inhibited both alleles, siG10 inhibited only the wild type
allele, and siC7/8 and siC10 inhibited only mutant allele
expression.
[0480] Effective siRNA therapy for late onset disease will likely
require sustained intracellular expression of the siRNA.
Accordingly, the present experiments were extended to two
intracellular methods of siRNA production and delivery: expression
plasmids and recombinant virus (Brummelkamp 2002, Xia 2002).
Plasmids were constructed expressing siG10 or siC10 siRNA from the
human U6 promoter as a hairpin transcript that is processed
intracellularly to produce siRNA (Brummelkamp 2002, Xia 2002). When
co-transfected with ataxin-3-GFP expression plasmids, phU6-G10i and
phU6-C10i-siRNA plasmids specifically suppressed wild type or
mutant ataxin-3 expression, respectively (FIG. 16F).
[0481] This result encouraged the inventors to engineer recombinant
adenoviral vectors expressing allele-specific siRNA (Xia 2002).
Viral-mediated suppression was tested in Cos-7 cells transiently
transfected with both Atx-3-Q28-GFP and Atx-3-Q166 to simulate the
heterozygous state. Cos-7 cells infected with adenovirus encoding
siG10, siC10 or negative control siRNA (Ad-G10i, Ad-C10i, and
Ad-LacZi respectively) exhibited allele-specific silencing of wild
type ataxin-3 expression with Ad-G10i and of mutant ataxin-3 with
Ad-C10i (FIG. 19A,B,C). Quantitation of fluorescence (FIG. 19B)
showed that Ad-G10i reduced wild type ataxin-3 to 5.4% of control
levels while mutant ataxin-3 expression remained unchanged.
Conversely, Ad-C10i reduced mutant ataxin-3 fluorescence levels to
8.8% of control and retained 97.4% of wild type signal. These
results were confirmed by Western blot where it was further
observed that Ad-G10i virus decreased endogenous (primate) ataxin-3
while Ad-C10i did not (FIG. 19C).
[0482] Viral mediated suppression was also assessed in
differentiated PC12 neural cell lines that inducibly express normal
(Q28) or expanded (Q166) mutant ataxin-3. Following infection with
Ad-G10i, Ad-C10i, or Ad-LacZi, differentiated neural cells were
placed in doxycycline for three days to induce maximal expression
of ataxin-3. Western blot analysis of cell lysates confirmed that
the Ad-G10i virus suppressed only wild type ataxin-3, Ad-C10i virus
suppressed only mutant ataxin-3, and Ad-LacZi had no effect on
either normal or mutant ataxin-3 expression (FIG. 19D). Thus, siRNA
retains its efficacy and selectivity across different modes of
production and delivery to achieve allele-specific silencing of
ataxin-3.
[0483] Allele-Specific Silencing of a Missense Tau Mutation.
[0484] The preceding results indicate that, for DNA repeat
mutations in which the repeat itself does not present an effective
target, an associated SNP can be exploited to achieve
allele-specific silencing. To test whether siRNA works equally well
to silence disease-causing mutations directly, the inventors
targeted missense Tau mutations that cause FTDP-17 (Poorkaj 1998,
Hutton 1998). A series of 21-24 nt siRNAs were generated in vitro
against four missense FTDP-17 mutations: G272V, P301L, V337M, and
R406W (FIG. 17 and FIG. 20A). In each case the point mutation was
placed centrally, near the likely cleavage site in the RISC complex
(position 9, 10 or 11) (Laccone 1999). A fifth siRNA designed to
target a 5' sequence in all Tau transcripts was also tested. To
screen for siRNA-mediated suppression, the inventors co-transfected
GFP fusions of mutant and wild type Tau isoforms together with
siRNA into Cos-7 cells. Of the five targeted sites, the inventors
obtained robust suppression with siRNA corresponding to V337M (FIG.
17 and FIG. 20A) (Poorkaj 1998, Hutton 1998), and thus focused
further analysis on this mutation. The V337M mutation is a G to A
base change in the first position of the codon (GTG to ATG), and
the corresponding V337M siRNA contains the A missense change at
position 9 (siA9). This intended V337M-specific siRNA
preferentially silenced the mutant allele but also caused
significant suppression of wild type Tau (FIG. 20B,C).
[0485] Based on the success of this approach with ataxin-3, the
inventors designed two additional siRNAs that contained the V337M
(G to A) mutation at position 9 as well as a second introduced G-C
mismatch immediately 5' to the mutation (siA9/C8) or three
nucleotides 3' to the mutation (siA9/C12), such that the siRNA now
contained two mismatches to the wild type but only one to the
mutant allele. This strategy resulted in further preferential
inactivation of the mutant allele. One siRNA, siA9/C12, showed
strong selectivity for the mutant tau allele, reducing fluorescence
to 12.7% of control levels without detectable loss of wild type Tau
(FIG. 20B,C). Next, we simulated the heterozygous state by
co-transfecting V337M-GFP and flag-tagged WT-Tau expression
plasmids (FIG. 21A, B, C). In co-transfected HeLa cells, siA9/C12
silenced the mutant allele (16.7% of control levels) with minimal
alteration of wild type expression assessed by fluorescence (FIG.
21A) and Western blot (FIG. 21B). In addition, siA9 and siA9/C8
displayed better allele discrimination than we had observed in
separate transfections, but continued to suppress both wild type
and mutant tau expression (FIG. 21A,B,C).
Discussion
[0486] Despite the rapidly growing siRNA literature, questions
remain concerning the design and application of siRNA both as a
research tool and a therapeutic strategy. The present study,
demonstrating allele-specific silencing of dominant disease genes,
sheds light on important aspects of both applications.
[0487] Because many disease genes encode essential proteins,
development of strategies to exclusively inactivate mutant alleles
is important for the general application of siRNA to dominant
diseases. The present results for two unrelated disease genes
demonstrate that in mammalian cells it is possible to silence a
single disease allele without activating pathways analogous to
those found in plants and worms that result in the spread of
silencing signals (Fire 1998, Tang 2003).
[0488] In summary, siRNA can be engineered to silence expression of
disease alleles differing from wild type alleles by as little as a
single nucleotide. This approach can directly target missense
mutations, as in frontotemporal dementia, or associated SNPs, as in
MJD/SCA3. The present stepwise strategy for optimizing
allele-specific targeting extends the utility of siRNA to a wide
range of dominant diseases in which the disease gene normally plays
an important or essential role. One such example is the
polyglutamine disease, Huntington disease (HD), in which normal HD
protein levels are developmentally essential (Nasir 1995). The
availability of mouse models for many dominant disorders, including
MJD/SCA3 (Cemal 2002), HD (Lin 2001), and FTDP-17 (Tanemura 2002),
allows for the in vivo testing of siRNA-based therapy for these and
other human diseases.
Example 7
Therapy for DYT1 Dystonia
Allele-Specific Silencing of Mutant TorsinA
[0489] DYT1 dystonia is the most common cause of primary
generalized dystonia. A dominantly inherited disorder, DYT1 usually
presents in childhood as focal dystonia that progresses to severe
generalized disease. With one possible exception, all cases of DYT1
result from a common GAG deletion in TOR1A, eliminating one of two
adjacent glutamic acids near the C-terminus of the protein TorsinA
(TA). Although the precise cellular function of TA is unknown, it
seems clear that mutant TA (TAmut) acts through a dominant-negative
or dominant-toxic mechanism. The dominant nature of the genetic
defect in DYT1 dystonia suggests that efforts to silence expression
of TAmut should have potential therapeutic benefit.
[0490] Several characteristics of DYT1 make it an ideal disease in
which to explore siRNA-mediated gene silencing as potential
therapy. Of greatest importance, the dominant nature of the disease
suggests that a reduction in mutant TA, whatever the precise
pathogenic mechanism proves to be, will be helpful. Moreover, the
existence of a single common mutation that deletes a full three
nucleotides suggests it may be feasible to design siRNA that will
specifically target the mutant allele and will be applicable to all
affected persons. Finally, there is no effective therapy for DYT1,
a relentless and disabling disease. Thus, any therapeutic approach
with promise needs to be explored. Because TAwt may be an essential
protein, however, it is critically important that efforts be made
to silence only the mutant allele.
[0491] In the studies reported here, the inventors explored the
utility of siRNA for DYT1. As outlined in the strategy in FIG. 22,
the inventors sought to develop siRNA that would specifically
eliminate production of protein from the mutant allele. By
exploiting the three base pair difference between wild type and
mutant alleles, the inventors successfully silenced expression of
TAmut without interfering with expression of the wild type protein
(TAwt).
[0492] Methods
[0493] siRNA Design and Synthesis
[0494] Small-interfering RNA duplexes were synthesized in vitro
according to a previously described protocol (Donze 2002), using
AmpliScribeT7 High Yield Transcription Kit (Epicentre Technologies)
and desalted DNA oligonucleotides (IDT). siRNAs were designed to
target different regions of human TA transcript: 1) an upstream
sequence common to both TAwt and TAmut (com-siRNA); 2) the area
corresponding to the mutation with either the wild type sequence
(wt-siRNA) or the mutant sequence positioned at three different
places (mutA-siRNA, mutB-siRNA, mutC-siRNA); and 3) a negative
control siRNA containing an irrelevant sequence that does not
target any region of TA (mis-siRNA). The design of the primers and
targeted sequences are shown schematically in FIG. 23. After in
vitro synthesis, the double stranded structure of the resultant RNA
was confirmed in 1.5% agarose gels and RNA concentration determined
with a SmartSpect 3000 UV Spectrophotometer (BioRad).
[0495] Plasmids
[0496] pcDNA3 containing TAwt or TAmut cDNA were kindly provided by
Xandra Breakefield (Mass General Hospital, Boston, Mass.). This
construct was produced by cloning the entire coding sequences of
human TorsinA (1-332), both wild-type and mutant (GAG deleted),
into the mammalian expression vector, pcDNA3 (Clontech, Palo Alto,
Calif.). Using PCR based strategies, an N-terminal hemagglutinin
(HA) epitope tag was inserted into both constructs. pEGFP-C3-TAwt
was kindly provided by Pullanipally Shashidharan (Mt Sinai Medical
School, NY). This construct was made by inserting the full-length
coding sequence of wild-type TorsinA into the EcoRI and BamHI
restriction sites of the vector pEGFP-C3 (Clontech). This resulted
in a fusion protein including eGFP, three "stuffer" amino acids and
the 331 amino acids of TorsinA. HA-tagged TAmut was inserted into
the ApaI and SalI restriction sites of pEGFP-C1 vector (Clontech),
resulting in a GFP-HA-TAmut construct.
[0497] Cell Culture and Transfections
[0498] Methods for cell culture of Cos-7 have been described
previously (Chai 1999b). Transfections with DNA plasmids and siRNA
were performed using Lipofectamine Plus (LifeTechnologies)
according to the manufacturer's instructions in six or 12 well
plates with cells at 70-90% confluence. For single plasmid
transfection, 1 .mu.g of plasmid was transfected with 5 .mu.g of
siRNA. For double plasmid transfection, 0.75 .mu.g of each plasmid
was transfected with 3.75 .mu.g of siRNA.
[0499] Western Blotting and Fluorescence Microscopy.
[0500] Cells were harvested 36 to 48 hours after transfection and
lysates were assessed for TA expression by Western Blot analysis
(WB) as previously described (Chai 1999b). The antibody used to
detect TA was polyclonal rabbit antiserum generated against a
TA-maltose binding protein fusion protein (kindly provided by
Xandra Breakefield) at a 1:500 dilution. Additional antibodies used
in the experiments described here are the anti-HA mouse monoclonal
antibody 12CA5 (Roche) at 1:1,000 dilution, monoclonal mouse
anti-GFP antibody (MBL) at 1:1,000 dilution, and for loading
controls, anti .alpha.-tubulin mouse monoclonal antibody (Sigma) at
1:20,000 dilution.
[0501] Fluorescence visualization of fixed cells expressing
GFP-tagged TA was performed with a Zeiss Axioplan fluorescence
microscope. Nuclei were visualized by staining with 5 .mu.g/ml DAPI
at room temperature for 10 minutes. Digital images were collected
on separate red, green and blue fluorescence channels using a
Diagnostics SPOT digital camera. Live cell images were collected
with a Kodak MDS 290 digital camera mounted on an Olympus CK40
inverted microscope equipped for GFP fluorescence and phase
contrast microscopy. Digitized images were assembled using Adobe
Photoshop 6.0.
[0502] Western Blot and Fluorescence Quantification.
[0503] For quantification of WB signal, blots were scanned with a
Hewlett Packard ScanJet 5100C scanner. The pixel count and
intensity of bands corresponding to TA and .alpha.-tubulin were
measured and the background signal subtracted using Scion Image
software (Scion Corporation). Using the .alpha.-tubulin signal from
control lanes as an internal reference, the TA signals were
normalized based on the amount of protein loaded per lane and the
result was expressed as percentage of TA signal in the control
lane. Fluorescence quantification was determined by collecting
three non-overlapping images per well at low power (10.times.), and
assessing the pixel count and intensity for each image with
Bioquant Nova Prime software (BIOQUANT Image Analysis Corporation).
Background fluorescence, which was subtracted from experimental
images, was determined by quantification of fluorescence images of
untransfected cells at equivalent confluence, taken under identical
illumination and exposure settings.
[0504] Results
[0505] Expression of Tagged TorsinA Constructs.
[0506] To test whether allele-specific silencing could be applied
to DYT1, a way to differentiate TAwt and TAmut proteins needed to
be developed. Because TAwt and TAmut display identical mobility on
gels and no isoform-specific antibodies are available,
amino-terminal epitope-tagged TA constructs and GFP-TA fusion
proteins were generated that would allow distinguishing TAwt and
TAmut. The use of GFP-TA fusion proteins also facilitated the
ability to screen siRNA suppression because it allowed
visualization of TA levels in living cells over time.
[0507] In transfected Cos-7 cells, epitope-tagged TA and GFP-TA
fusion protein expression was confirmed by using the appropriate
anti-epitope and anti-TA antibodies. Fluorescence microscopy in
living cells showed that GFP-TAwt and GFP-TAmut fusion proteins
were expressed diffusely in the cell, primarily in the cytoplasm,
although perinuclear inclusions were also seen. It is important to
note that these construct were designed to express reporter
proteins in order to assess allele-specific RNA interference rather
than to study TA function. The N-terminal epitope and GFP domains
likely disrupt the normal signal peptide-mediated translocation of
TA into the lumen of the endoplasmic reticulum, where TA is thought
to function. Thus, while these constructs facilitated expression
analysis in the studies described here, they are of limited utility
for studying TA function.
[0508] Silencing TorsinA with siRNA.
[0509] Various siRNAs were designed to test the hypothesis that
siRNA-mediated suppression of TA expression could be achieved in an
allele-specific manner (FIG. 23). Because siRNA can display
exquisite sequence specificity, the three base pair difference
between mutant and wild type TOR1A alleles might be sufficient to
permit the design of siRNA that preferentially recognizes mRNA
derived from the mutant allele. Two siRNAs were initially designed
to target TAmut (mutA-siRNA and mutB-siRNA) and one to target TAwt
(wt-siRNA). In addition, a positive control siRNA was designed to
silence both alleles (com-siRNA) and a negative control siRNA of
irrelevant sequence (mis-siRNA) was designed. Cos-7 cells were
first cotransfected with siRNA and plasmids encoding either
GFP-TAwt or untagged TAwt at a siRNA to plasmid ratio of 5:1. With
wt-siRNA, potent silencing of TAwt expression was observed to less
than 1% of control levels, based on western blot analysis of cell
lysates (FIGS. 24A and 24C). With com-siRNA, TAwt expression was
suppressed to .about.30% of control levels. In contrast, mutA-siRNA
did not suppress TAwt and mutB-siRNA suppressed TAwt expression
only modestly. These results demonstrate robust suppression of TAwt
expression by wild type-specific siRNA but not mutant-specific
siRNA.
[0510] To assess suppression of TAmut, the same siRNAs were
cotransfected with plasmids encoding untagged or HA-tagged TAmut.
With mutA-siRNA or mutB-siRNA, marked, though somewhat variable,
suppression of TAmut expression was observed as assessed by western
blot analysis of protein levels (FIGS. 24B and 24C). With
com-siRNA, suppression of TAmut expression was observed similar to
what was observed with TAwt expression. In contrast, wt-siRNA did
not suppress expression of TAmut. Thus differential suppression of
TAmut expression was observed by allele-specific siRNA in precisely
the manner anticipated by the inventors.
[0511] To achieve even more robust silencing of TAmut, a third
siRNA was engineered to target TAmut (mutC-siRNA, FIG. 23).
MutC-siRNA places the GAG deletion more centrally in the siRNA
duplex. Because the central portion of the antisense strand of
siRNA guides mRNA cleavage, it was reasoned that placing the GAG
deletion more centrally might enhance specific suppression of
TAmut. As shown in FIGS. 24A-E, mutC-siRNA suppressed TAmut
expression more specifically and robustly than the other mut-siRNAs
tested. In transfected cells, mutC-siRNA suppressed TAmut to less
than 0.5% of control levels, and had no effect on the expression of
TAwt.
[0512] To confirm allele-specific suppression by wt-siRNA and
mutC-siRNA, respectively, the inventors cotransfected cells with
GFP-TAwt or GFP-TAmut together with mis-siRNA, wt-siRNA or
mutC-siRNA. Levels of TA expression were assessed 24 and 48 hours
later by GFP fluorescence, and quantified the fluorescence signal
from multiple images was quantified. The results (FIGS. 24D and
24E) confirmed the earlier western blots results in showing potent,
specific silencing of TAwt and TAmut by wt-siRNA and mutC-siRNA,
respectively, in cultured mammalian cells.
[0513] Allele-Specific Silencing in Simulated Heterozygous
State.
[0514] In DYT1, both the mutant and wild type alleles are
expressed. Once the efficacy of siRNA silencing was established,
the inventors sought to confirm siRNA specificity for the targeted
allele in cells that mimic the heterozygous state of DYT1. In
plants and Caenorhabditis elegans, RNA-dependent RNA polymerase
activity primed by introduction of exogenous RNA can result in the
spread of silencing signals along the entire length of the targeted
mRNA (Fire 1998, Tang 2003). No evidence for such a mechanism has
been discovered in mammalian cells (Schwarz 2002, Chiu 2002).
Nonetheless it remained possible that silencing of the mutant
allele might activate cellular processes that would also inhibit
expression from the wild type allele. To address this possibility,
Cos-7 cells were cotransfected with both GFP-TAwt and HA-TAmut, and
suppression by mis-siRNA, wt-siRNA or mutC-siRNA was assessed. As
shown in FIGS. 25A-B, potent and specific silencing of the targeted
allele (either TAmut or TAwt) to levels less than 1% of controls
was observed, with only slight suppression in the levels of the
non-targeted protein. Thus, in cells expressing mutant and wild
type forms of the protein, siRNA can suppress TAmut while sparing
expression of TAwt.
[0515] Discussion
[0516] In this study the inventors succeeded in generating siRNA
that specifically and robustly suppresses mutant TA, the defective
protein responsible for the most common form of primary generalized
dystonia. The results have several implications for the treatment
of DYT1 dystonia. First and foremost, the suppression achieved was
remarkably allele-specific, even in cells simulating the
heterozygous state. In other words, efficient suppression of mutant
TA occurred without significant reduction in wild type TA.
Homozygous TA knockout mice die shortly after birth, while the
heterozygous mice are normal (Goodchild 2002), suggesting an
essential function for TA. Thus, therapy for DYT1 needs to
eliminate the dominant negative or dominant toxic properties of the
mutant protein while sustaining expression of the normal allele in
order to prevent the deleterious consequences of loss of TA
function. Selective siRNA-mediated suppression of the mutant allele
fulfills these criteria without requiring detailed knowledge of the
pathogenic mechanism.
[0517] An appealing feature of the present siRNA therapy is
applicable to all individuals afflicted with DYT1. Except for one
unusual case (Leung 2001, Doheny 2002, Klein 2002b), all persons
with DYT1 have the same (GAG) deletion mutation (Ozelius 1997,
Ozelius 1999). This obviates the need to design individually
tailored siRNAs. In addition, the fact that the DYT1 mutation
results in a full three base pair difference from the wild type
allele suggests that siRNA easily distinguishes mRNA derived from
normal and mutant TOR1A alleles.
[0518] It is important to recognize that DYT1 is not a fully
penetrant disease (Fahn 1998, Klein 2002a). Even when expressed
maximally, mutant TA causes significant neurological dysfunction
less than 50% of the time. Thus, even partial reduction of mutant
TA levels might be sufficient to lower its pathological brain
activity below a clinically detectable threshold. In addition, the
DYT1 mutation almost always manifests before age 25, suggesting
that TAmut expression during a critical developmental window is
required for symptom onset. This raises the possibility that
suppressing TAmut expression during development might be sufficient
to prevent symptoms throughout life. Finally, unlike many other
inherited movement disorders DYT1 is not characterized by
progressive neurodegeneration. The clinical phenotype must result
primarily from neuronal dysfunction rather than neuronal cell death
(Hornykiewicz 1986, Walker 2002, Augood 2002, Augood 1999). This
suggests the potential reversibility of DYT1 by suppressing TAmut
expression in overtly symptomatic persons.
Example 8
RNA Interference Improves Motor and Neuropathological Abnormalities
in a Huntington's Disease Mouse Model
[0519] Huntington's disease (HD) is one of nine dominant
neurodegenerative diseases resulting from polyglutamine repeat
expansions (CAG codon, Q) in exon 1 of HD, leading to a toxic gain
of function on the protein huntingtin (htt) (The Huntington's
Disease Collaborative Research Group (1993) Cell 72, 971-83;
Gusella et al., (2000) Nat Rev Neurosci 1, 109-15). Hallmark HD
characteristics include cognitive and behavioral disturbance,
involuntary movements (chorea), neuronal inclusions, and striatal
and cortical neurodegeneration (Gusella et al., (2000) Nat Rev
Neurosci 1, 109-15). Htt alleles containing greater than 35 CAG
repeats generally cause HD, with age-at-onset correlating inversely
with expansion length, a common characteristic of the polyglutamine
repeat disorders. The disease usually develops in mid-life, but
juvenile-onset cases can occur with CAG repeat lengths greater than
60. Death typically occurs 10-15 years after symptom onset.
Currently, no preventative treatment exists for HD.
[0520] Therapies aimed at delaying disease progression have been
tested in HD animal models. For example, beneficial effects have
been reported in animals treated with substances that increase
transcription of neuroprotective genes (histone deacetylase)
(Ferrante et al., (2003) J Neurosci 23, 9418-27); prevent apoptosis
(caspase inhibitors)(Ona et al., (1999) Nature 399, 263-7); enhance
energy metabolism (coenzyme Q/remacemide, creatine) (Ferrante et
al., (2002) J Neurosci 22, 1592-9; Andreassen et al., (2001)
Neurobiol Dis 8, 479-91); and inhibit the formation of
polyglutamine aggregates (trehalose, Congo red, cystamine) (Tanaka
et al., (2004) Nat Med 10, 148-54; Karpuj et al., (2002) Nat Med 8,
143-9; Sanchez et al., (2003) Nature 421, 373-9). These approaches
target downstream and possibly indirect effects of disease allele
expression. In contrast, no therapies have been described that
directly reduce mutant huntingtin gene expression, thereby
targeting the fundamental, underlying pathological insult.
[0521] The therapeutic promise of silencing mutant htt expression
was demonstrated in a tetracycline-regulated mouse model of HD
(Yamamoto et al., (2000) Cell 101, 57-66). When mutant htt was
inducibly expressed, pathological and behavioral features of the
disease developed, including the characteristic neuronal inclusions
and abnormal motor behavior. Upon repression of transgene
expression in affected mice, pathological and behavioral features
resolved. Thus, reduction of htt expression using RNAi may allow
protein clearance mechanisms within neurons to normalize mutant
htt-induced changes. We hypothesize that directly inhibiting the
expression of mutant htt will slow or prevent HD-associated symptom
onset in a relevant animal model.
[0522] Screening of putative therapies for HD has benefited from
the existence of several HD mouse models (Beal et al., (2004) Nat
Rev Neurosci 5, 373-84; Levine et al., (2004) Trends Neurosci 27,
691-7). HD-like phenotypes are displayed in knock-in mice (Lin et
al., (2001) Hum Mol Genet 10, 137-44; Menalled et al., (2003) J
Comp Neurol 465, 11-26), drug-induced models (McBride et al.,
(2004) J Comp Neurol 475, 211-9) and transgenic mice expressing
full-length mutant huntingtin (e.g. YAC-transgenic mice) (Hodgson
et al., (1999) Neuron 23, 181-92; Slow et al., (2003) Hum Mol Genet
12, 1555-67; Reddy et al., (1998) Nat Genet 20, 198-202) or an
N-terminal fragment of htt (Yamamoto et al., (2000) Cell 101,
57-66; Mangiarini et al., (1996) Cell 87(3), 493-506; Schilling et
al., (1999) Hum Mol Genet 8(3), 397-407). Mice expressing truncated
N-terminal fragments of huntingtin have been valuable for
proof-of-principle evaluation of therapies because they show
rapidly progressive motor abnormalities and striatal
neuropathology, phenotypes which do not develop or develop very
late in knock-in or YAC transgenic mice. Mice expressing truncated
forms of huntingtin thus replicate more severe forms of the
disease. The present inventors tested if RNA interference (RNAi)
induced by short hairpin RNAs (shRNAs) (Dykxhoorn et al., (2003)
Nat Rev Mol Cell Biol 4, 457-67) could reduce expression of mutant
htt and improve HD-associated abnormalities in a transgenic mouse
model of HD. It was found that RNAi directed against mutant human
huntingtin (htt) reduced htt mRNA and protein expression in cell
culture and in HD mouse brain. It is important to note that htt
gene silencing improved behavioral and neuropathological
abnormalities associated with HD.
Materials and Methods
[0523] Plasmids and Adeno-Associated Virus (AAV) Construction.
[0524] Myc-tagged HD-N171-82Q was expressed from a pCMV-HD-N171-82Q
plasmid (Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). PCR
(Pfu polymerase, Stratagene) was used to amplify the U6 promoter
along with shRNAs targeting human huntingtin (shHD2.1; FIG. 26A),
eGFP (shGFP) (Xia et al., (2002) Nat Biotechnol 20, 1006-1010); or
E. coli .beta.-galactosidase (bp 1152-1172; shLacZ). PCR products
were cloned, verified by sequencing and inserted into
pAAV.CMV.hrGFP, which contains AAV-2 ITRs, a CMV-hrGFP-SV40 polyA
reporter cassette, and sequences used for homologous recombination
into baculovirus (Urabe et al., (2002) Hum Gene Ther 13,
1935-1943). Recombinant AAV serotype 1 capsid vectors were
generated as described (Urabe et al., (2002) Hum Gene Ther 13,
1935-1943). AAV titers were determined by quantitative PCR and/or
DNA slot blot and were 5.times.10.sup.12 vector genomes/ml.
[0525] Animals.
[0526] All animal studies were approved by the University of Iowa
Animal Care and Use Committee. HD-N171-82Q mice were purchased from
Jackson Laboratories, Inc. (Schilling et al., (1999) Hum Mol Genet
8(3), 397-407; Schilling et al., (2001) Neurobiol Dis 8, 405-18)
and maintained on a B6C3F1/J background. Heterozygous and
age-matched wildtype littermates were used for the experiments, as
indicated.
[0527] Northern Blots.
[0528] HEK293 cells were transfected (Lipofectamine-2000;
Invitrogen) with pCMV-HD-N171-82Q and plasmids expressing shHD2.1,
shGFP, or shLacZ at shRNA:target ratios of 8:1. Forty-eight hours
post-transfection, RNA was harvested (Trizol Reagent; Invitrogen)
and 10 .quadrature.g were assessed northern blot (NorthernMax;
Ambion) using probes to human htt or human GAPDH. Band intensities
were quantified using a phosphorimager (Storm 860 instrument and
ImageQuant v1.2 software, Molecular Dynamics).
[0529] For in vivo studies, total RNA was isolated from
hrGFP-positive striata. Thirty .mu.g RNA was run on 15%
polyacrylamide-urea gels, transferred to Hybond N+ membranes
(Amersham Pharmacia), then probed with .sup.32P-labeled sense
oligonucleotides at 36.degree. C. for 3 h, washed in 2.times.SSC
(36.degree. C.), and exposed to film.
[0530] Western Blots.
[0531] HEK293 cells were transfected as described with shHD2.1 or
shGFP singly or in combination with pCMV-HD-N171-82Q. Forty-eight
hours later, cells were lysed to recover total protein. Western
blots were incubated with anti-myc (1:5,000; Invitrogen), anti
full-length human htt (1:5,000; MAB2166; Chemicon), or anti-human
.beta.-actin (1:5,000; Clone AC-15; Sigma) followed by HRP-coupled
goat anti-mouse or goat anti-rabbit secondary antibodies (1:20,000
and 1:100,000, respectively; Jackson Immunochemicals). Blots were
developed using ECL-Plus reagents (Amersham Biosciences). For
evaluation of transduced brain, 3 week old mice were injected as
described and protein was harvested from striata 2 weeks later.
Twenty-five .mu.g were run on SDS-PAGE gels as described,
transferred to nitrocellulose, then probed with antibodies to
detect human htt (1:500, mEM48; Gift from X. J. Li) and mouse prion
protein (1:40,000; Chemicon International). Secondary antibody
incubations were performed as described above.
[0532] Quantitative RT-PCR
[0533] In Vitro shRNA Dose Response.
[0534] HEK293 cells were transfected with 0 (mock), 10, 100, or
1000 ng of shLacZ or shHD2.1 and RNA was harvested 24 h later.
Following DNase treatment (DNA-Free, Ambion), random-primed, first
strand cDNA was generated from 500 ng total RNA (Taqman.TM. Reverse
Transcription Reagents, Applied Biosystems) according to
manufacturer's protocol. Taqman.TM. Assays were performed on an ABI
Prism 7000 Sequence Detection System using Taqman.TM. 2X Universal
PCR Master Mix (Applied Biosystems) and Taqman.TM. primers/probe
sets specific for human htt and mammalian rRNA (Applied
Biosystems). Relative gene expression was determined using the
relative standard curve method.
[0535] In Vivo Huntingtin mRNA Expression.
[0536] Striata were dissected from 5.5 month old mice, snap frozen
in liquid nitrogen, and pulverized. cDNA was generated as described
above. Relative gene expression was assayed using Taqman.TM.
primers/probe sets specific for human htt and mammalian rRNA or
Assays-By-Design Taqman.TM. primers/probes specific for mouse
huntingtin (mHdh; Applied Biosystems). All values were calibrated
to contralateral, uninjected striata. For human huntingtin
detection; shHD2.1 samples, n=8 striata; shLacZ, n=7; uninjected,
n=4. For mouse Hdh detection; injected HD samples, n=4; uninjected
samples n=2.
[0537] AAV Injections
[0538] All animal procedures were pre-approved by the University of
Iowa Animal Care and Use Committee. AAV Injections were performed
in 4 week old mice using the following parameters (coordinates are
reported with respect to the bregma): Striatal: 0.5 mm anterior,
2.5 mm lateral, 2.5 mm depth, 5 .mu.l/site, 250 nl/min infusion
rate. Cerebellar: 0.1 mm depth, 1 .mu.l/site, 250 nl/min infusion
rate.
Behavioral Analysis
[0539] Stride Length Measurements.
[0540] Mice injected bilaterally at 4 weeks of age were analyzed at
4 months of age. Analyses were performed as described previously
(Carter et al., (1999) J Neurosci 19, 3248) with some
modifications. Specifically, mice were allowed to walk across a
paper-lined chamber measuring 100 cm long, 10 cm wide, with 10 cm
high walls into an enclosed box. Mice were given one practice run
and were then tested three times to produce three separate
footprint tracings, totaling 42 measurements each for front and
rear footprints per mouse. Measurements were averaged and data
presented as box plots. ANOVA with Scheffe's post-hoc test was
performed to determine statistical significance. Uninjected mice,
n=4; injected WT, n=3; injected N171-82Q, n=6 mice.
[0541] Rotarod Performance Test.
[0542] Two separate experimental cohorts of mice were injected at 4
weeks of age and tested on the rotarod (Model 7650, Ugo Basile
Biological Research Apparatus) at 10 and 18 weeks of age as
previously described (Xia et al., (2004) Nat Med 10, 816-820). Data
from trials 2-4 for each day are presented as means.+-.S.E.M.
Uninjected WT, n=6; shLacZ WT, n=5, shHD2.1 WT, n=6; uninjected
N171-82Q, n=5; shLacZ N171-82Q, n=10; shHD2.1 N171-82Q, n=11).
Reported values are means.+-.S.E.M.
[0543] Immunofluorescence
[0544] Forty .mu.m free-floating coronal sections were stained with
mEM48 antibody (1:500; 24 h, 4.degree. C.), followed by Alexa-568
labeled goat anti-mouse secondary antibody (1:200; 4 h, room temp;
Molecular Probes). Sections were mounted onto slides, covered in
Gel/Mount (Biomeda Corp) and images were captured using fluorescent
microscopy (Leica DM RBE or Zeiss confocal) equipped with a
CCD-camera (SPOT RT, Diagnostics Instruments).
Results
[0545] shHD2.1 Reduces Human Huntingtin Expression In Vitro
[0546] In vitro screening was used to identify effective shRNAs
directed against a CMV-promoter transcribed HD-N171-82Q mRNA, which
is identical to the pathogenic truncated huntingtin fragment
transgene present in HD-N171-82Q mice (Schilling et al., (1999) Hum
Mol Genet 8(3), 397-407). Hairpin constructs targeting sequences in
human exons 1-3 were evaluated by co-transfection. One htt-targeted
shRNA, shHD2.1 (FIG. 26A), reduced HD-N171-82Q mRNA and protein
levels by .about.85 and .about.55% respectively, relative to
control shRNA treated samples (FIG. 26B, C). Interestingly, none of
the shRNAs tested that targeted exon 1 were functional under these
conditions and in this system. Additional siRNAs can be screened as
described herein to identify functional siRNAs targeting exon 1 of
the HD gene.
[0547] To test if shHD2.1 could silence endogenous full-length
human htt expression, HEK 293 cells were transfected with plasmids
expressing shHD2.1 or shGFP. ShHD2.1, but not control shRNAs,
directed gene silencing of endogenous htt mRNA and protein (FIGS.
26D, E). This system can be readily used to screen additional
siRNAs targeting the HD gene.
[0548] Expression of shRNA in Mouse Brain
[0549] Next, the inventors tested U6 promoter-transcribed shHD2.1
expression in vivo and determined its effects on HD-associated
symptoms in mice. This pol III dependent promoter has not
previously been evaluated in striata for sustained expression in
vivo, although shRNAs have been expressed in brain using either the
pol II-dependent CMV promoter in striatum (Xia et al., (2002) Nat
Biotechnol 20, 1006-1010) or the H1 promoter in cerebellar
degeneration models (Xia et al., (2004) Nat Med 10, 816-820). U6
promoter-driven shHD2.1, and the control hairpin shLacZ, were
cloned into adeno-associated virus (AAV) shuttle plasmids that
contained a separate CMV-humanized Renilla green fluorescent
protein (hrGFP) reporter cassette (FIG. 27A). High-titer AAV1
particles (AAV.shHD2.1 and AAV.shLacZ), which have broad neuronal
tropism, were generated (Urabe et al., (2002) Hum Gene Ther 13,
1935-1943), and hairpin expression was assessed after injection
into mouse striatum. The N171-82Q mouse model was used because
shHD2.1 targets sequences in exon 2, precluding use of the R6/2
transgenic model, which expresses only exon 1 of the HD gene. As
shown in FIG. 27B, precursor and processed shRNAs (.about.50 nt and
21 nt, respectively) were expressed three weeks after transduction,
indicating sustained expression and appropriate processing of
shRNAs in the striatum. Analysis of coronal brain sections from
injected mice showed widespread transduction (FIG. 27C; hrGFP
fluorescence) up to 5 months post-injection.
AAV.shHD2.1 Reduces HD-N171-82Q Expression In Vivo
[0550] The inventors next investigated the effects of RNAi on the
characteristic HD-associated neuronal inclusions and HD-N171-82Q
mRNA levels in vivo. Tissues were harvested from end-stage
HD-N171-82Q mice (.about.5.5 months of age) because striatal
inclusions are less robust at earlier ages in this model. In
striata from HD-N171-82Q mice injected with AAV.shHD2.1,
htt-reactive inclusions were absent in transduced cells compared to
untransduced regions (FIG. 28A, lower panels; FIG. 28B).
Conversely, abundant inclusions were detected in transduced regions
from AAV.shLacZ-injected HD mice (FIG. 28A, upper panels). No
inclusions were observed in WT mice (data not shown). In addition,
western analysis revealed that soluble HD-N171-82Q monomer was
decreased in mouse striata transduced with AAV.shHD2.1 compared to
uninjected or AAV.shLacZ-injected controls (FIG. 28C). The
reduction in protein levels detected by immunohistochemistry and
western blot was due to decreased transgene expression. HD-N171-82Q
mRNA was reduced 51% to 55% in AAV.shHD2.1-injected HD mice
relative to AAV.shLacZ-injected or uninjected HD mice (FIG. 28D).
AAV.shHD2.1 and AAV.shLacZ had no effect on endogenous mouse htt
expression (Avg. mHDH expression: Uninjected HD, 1.00.+-.0.09;
Uninjected WT, 1.13.+-.0.04; AAV.shLacZ injected HD, 1.10.+-.0.08;
AAV.shHD2.1 injected HD, 1.08.+-.0.05).
[0551] Neuronal inclusions in HD-N171-82Q striata are variable.
Inclusions may be present in as few as 10% and up to 50% of all
striatal neurons in different end-stage HD-N171-82Q mice (Schilling
et al., (1999) Hum Mol Genet 8(3), 397-407). In contrast, robust
and widespread EM48-positive inclusions are present in cerebellar
granule cells by .about.3 months of age [(Schilling et al., (1999)
Hum Mol Genet 8(3), 397-407) and FIG. 28A-E], and cerebellar
HD-N171-82Q mRNA levels are .about.8 fold higher relative to
striatum (QPCR, data not shown). This high-level cerebellar
expression is partially attributable to the transcriptional profile
of the prion promoter driving HD-N171-82Q transgene expression
(Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). Cerebellar
inclusions are not typically found in brains of adult-onset HD
patients. However, cerebellar pathology has been reported in
juvenile onset HD cases, which are the most severe forms of the
disease, and interestingly, in Hdh140 knock-in mice as early as 4
months of age (Menalled et al., (2003) J Comp Neurol 465, 11-26;
Nance et al., (2001) Ment Retard Dev Disabil Res Rev 7, 153-7;
Fennema--et al., (2004) Neurology 63, 989-95; Seneca et al., (2004)
Eur J Pediatr.; Byers et al., (1973) Neurology 23, 561-9; Wheeler
et al., (2002) Hum Mol Genet 11, 633-40). The abundant inclusions
in HD-N171-82Q cerebellar neurons provide a second target for
assessing the effects of AAV.shHD2.1 on target protein levels.
Direct cerebellar injections were done into a separate cohort of
mice, and HD-N171-82Q expression examined by immunofluorescence.
Together the data show that AAV.shHD2.1, but not control
AAV.shLacZ, reduces mutant htt expression and prevents formation of
the disease-associated neuronal inclusions.
Striatal Delivery of AAV.shHD2.1 Improves Established Behavioral
Phenotypes
[0552] The effects of shRNA treatment on established behavioral
deficits and animal weight were tested. RNAi directed to striatum
did not normalize the notable weight differences between
HD-N171-82Q and WT mice (shHD2.1-injected, 22.7.+-.3.8 g; shLacZ,
22.6.+-.2.8 g; compared to age-matched wild-type mice (shHD2.1,
26.3.+-.0.4; shLacZ, 27.3.+-.5.8), confirming that intracerebral
injection confines RNAi therapy to the site of application
(Schilling et al., (1999) Hum Mol Genet 8(3), 397-407; Xia et al.,
(2004) Nat Med 10, 816-820). However, significant improvements in
stride length measurements and rotarod deficits were noted.
[0553] Stride length and rotarod tests were performed on uninjected
mice, and mice injected bilaterally into striatum with AAVshHD2.1
or AAVshLacZ. As shown in FIG. 29A, HD-N171-82Q mice display
significantly shorter stride lengths than those of wild-type (WT)
mice, consistent with prior work (Menalled et al., (2003) J Comp
Neurol 465, 11-26; Carter et al., (1999) J Neurosci 19, 3248;
Wheeler et al., (2002) Hum Mol Genet 11, 633-40). Gait deficits in
AAV.shHD2.1-treated HD-N171-82Q mice were significantly improved
compared to AAV.shLacZ-treated (improvements for front and rear
strides, 13 and 15%, respectively; p<0.0001) and uninjected
HD-N171-82Q mice (front and rear strides, 14 and 18%, respectively;
p<0.0001). Gait improvements did not fully resolve, as all
HD-N171-82Q groups remained significantly different than their
age-matched WT littermates. There was no effect of AAV.shLacZ or
AAV.shHD2.1 expression on stride lengths of WT mice.
[0554] The accelerating rotarod test was used to confirm the
beneficial behavioral effects of RNAi targeted to the mutant human
HD allele (Schilling et al., (1999) Hum Mol Genet 8(3), 397-407).
Mice were left uninjected, or were injected bilaterally into the
striatum with AAV.shLacZ or AAV.shHD2.1 at 4 weeks of age, followed
by rotarod analyses at 10- and 18-weeks of age (FIG. 29B). By 10
weeks, uninjected and AAV.shLacZ-injected HD mice show impaired
performance relative to all other groups, and continued to
demonstrate significantly reduced performance over the course of
the study (p<0.05 relative to all other groups). It is important
to note that HD mice treated with AAVshHD2.1 showed dramatic
behavioral improvements relative to control-treated HD mice
(p<0.0008) (FIG. 29B). AAV.shLacZ-treated HD mice showed a 22%
decline (p<0.005; ANOVA), while AAV.shHD2.1-treated HD mice
displayed a modest, non-significant 3% drop in rotarod performance
between 10 and 18 weeks of age. There was a partial normalization
of rotarod deficits in HD mice injected with AAV.shHD2.1 compared
to WT mice that was consistent with the gait analyses.
[0555] The inventors found no decline in stride length or rotarod
performance between WT mice left untreated, or those injected with
shRNA-expressing AAVs (FIG. 29A,B). However, at 10 weeks, there was
a dramatic difference in rotarod performance between uninjected WT
and all groups of injected WT mice, which resolved by 18 weeks of
age. These data suggest that there was some detrimental effect of
direct brain injection on rotarod performance from which the mice
recovered over time. These data suggest that RNAi expression in
mammalian brain had no overt negative impact on motor behavior
(FIG. 29A,B).
Discussion
[0556] The inventors have shown that motor and neuropathological
abnormalities in a relevant HD mouse model are significantly
improved by reducing striatal expression of a pathogenic huntingtin
allele using AAV1-delivered shRNA. The inventors have previously
shown that RNAi can improve neuropathology and behavioral deficits
in a mouse model of spino-cerebellar ataxia type 1 (SCA1) (Xia et
al., (2004) Nat Med 10, 816-820), a dominant neurodegenerative
disorder that affects a population of neurons distinct from those
degenerating in HD.
[0557] The shHD2.1 hairpin sequence reduced huntingtin expression
in vitro and in vivo, and it is important to note, the present
northern blot data suggest that the processed active guide strand
was protected by RISC in vivo. The activity of the shRNAs could be
improved using recently described rules for optimal shRNA design
(Reynolds et al., (2004) Nat Biotechnol 22, 326-30; Schwarz et al.,
(2003) Cell 115, 199-208; Khvorova et al., (2003) Cell 115, 505;
Ui-Tei et al., (2004) Nucleic Acids Res 32, 936-48).
[0558] Prior work demonstrated an essential role for huntingtin in
embryogenesis and postnatal neurogenesis (Nasir et al., (1995) Cell
81, 811-23; Duyao et al., (1995) Science 269, 407-10; White et al.,
(1997) Nat Genet 17, 404-10; Dragatsis et al., (2000) Nat Genet 26,
300-6). However the effect of partial reduction of normal
huntingtin expression in adult, post-mitotic neurons in vivo is
unknown. In the current study, shHD2.1 reduced expression of a
mutant, disease-causing human htt transgene, but had no effect on
normal mouse huntingtin expression due to sequence differences
between mouse and human genes. In HD patients, shHD2.1 would be
expected to reduce expression of both the mutant and normal
huntingtin alleles. The present data show that HD-like symptoms can
be improved by even a partial reduction of mutant htt expression,
suggesting that complete elimination of mutant allele expression
may not be required.
[0559] In summary, the inventors have shown that RNAi can
dramatically improve HD-associated abnormalities, including
pathological and behavioral deficits, in a HD mouse model.
Example 9
Huntington's Disease (HD)
[0560] Huntington's disease (HD) is one of several dominant
neurodegenerative diseases that result from a similar toxic gain of
function mutation in the disease protein: expansion of a
polyglutamine (polyQ)-encoding tract. It is well established that
for HD and other polyglutamine diseases, the length of the
expansion correlates inversely with age of disease onset. Animal
models for HD have provided important clues as to how mutant
huntingtin (htt) induces pathogenesis. Currently, no
neuroprotective treatment exists for HD. RNA interference has
emerged as a leading candidate approach to reduce expression of
disease genes by targeting the encoding mRNA for degradation.
[0561] Short hairpin RNAs (shRNAs) were generated that
significantly inhibited human htt expression in cell lines.
Importantly, the shRNAs were designed to target sequences present
in HD transgenic mouse models. The present studies test the
efficacy of the shRNAs in HD mouse models by determining if
inclusions and other pathological and behavioral characteristics
that are representative of HD can be inhibited or reversed. In a
transgenic model of inducible HD, pathology and behavior improved
when mutant gene expression was turned off. These experiments show
that RNAi can prevent or reverse disease.
[0562] Although the effect of partial reduction of wildtype htt in
adult neurons is unknown, it is advantageous to target only mutant
htt for degradation, if possible. One polymorphism in linkage
disequilibrium with HD has been identified in the coding sequence
for htt, and others are currently being investigated. Disease
allele-specific RNAi are designed using approaches that led to
allele specific silencing for other neurogenetic disease models.
This would allow directed silencing of the mutant, disease-causing
expanded allele, leaving the normal allele intact.
[0563] Constitutive expression of shRNA can prevent the
neuropathological and behavioral phenotypes in a mouse model of
Spinocerebellar Ataxia type I, a related polyQ disease. However,
the constitutive expression of shRNA may not be necessary,
particularly for pathologies that take many years to develop but
may be cleared in a few weeks or months. For this reason, and to
reduce long-term effects that may arise if nonspecific silencing or
activation of interferon responses is noted, controlled expression
may be very important. In order to regulate RNAi for disease
application, doxycycline-responsive vectors have been developed for
controlled silencing in vitro.
[0564] HD researchers benefit from a wealth of animal models
including six transgenic and four knock-in mouse models (Bates
2003). Expression is from the endogenous human promoter, and the
CAG expansion in the R6 lines ranges from 110 to approximately 150
CAGs. The R6/2 line is the most extensively studied line from this
work. R6/2 mice show aggressive degenerative disease, with age of
symptom onset at 8-12 weeks, and death occurring at 10 to 13 weeks.
Neuronal intranuclear inclusions, a hallmark of HD patient brain,
appear in the striatum and cortex of the R6/2 mouse (Meade
2002).
[0565] Adding two additional exons to the transgene and restricting
expression via the prion promoter led to an HD mouse model
displaying important HD characteristics but with less aggressive
disease progression (Shilling 1999, Shilling 2001). The Borchelt
model, N171-82Q, has greater than wildtype levels of RNA, but
reduced amounts of mutant protein relative to endogenous htt.
N171-82Q mice show normal development for the first 1-2 months,
followed by failure to gain weight, progressive incoordination,
hypokinesis and tremors. There are statistically significant
differences in the rotarod test, alterations in gait, and hindlimb
clasping. Mice show neuritic pathology characteristic of human HD.
Unlike the Bates model, there is limited neuronal loss.
[0566] Detloff and colleagues created a mouse knock-in model with
an extension of the endogenous mouse CAG repeat to approximately
150 CAGs. This model, the CHL2 line, shows more aggressive
phenotypes than prior mouse knock-in models containing few repeats
(Lin 2001). Measurable neurological deficits include clasping, gait
abnormalities, nuclear inclusions and astrogliosis.
[0567] The present studies utilize the well-characterized Borchelt
mouse model (N171-82Q, line 81), and the Detloff knock-in model,
the CHL2 line. The initial targets for htt silencing were focused
on sequences present in the N171-82Q transgene (exons 1-3). The use
of this model was advantageous in the preliminary shRNA development
because the RNAi search could focus on only the amino-terminal
encoding sequences rather than the full length 14 kb mRNA. FIG. 31
depicts the one-step cloning approach used to screen hairpins
(Harper 2004). No effective shRNAs were found in exon 1, but
several designed against exon 2, denoted shHDEx2.1
(5'-AAGAAAGAACTTTCAGCTACC-3', SEQ ID NO:91), shHDEx2.2 19 nt
(5'-AGAACTTTCAGCTACCAAG-3' (SEQ ID NO:92)), or shHDEx2.2 21 nt
5'-AAAGAACTTTCAGCTACCAAG-3' (SEQ ID NO:93)) and exon 3 (shHDEx3.1
19 nt 5'-TGCCTCAACAAAGTTATCA-3' (SEQ ID NO:94) or shHDEx3.1 21 nt
5'-AATGCCTCAACAAAGTTATCA-3' (SEQ ID NO:95)) sequences were
effective. In co-transfection experiments with shRNA expressing
plasmids and the N171-82Q transcript target, shHDEx2.1 reduced
N171-Q82 transcript levels by 80%, and protein expression by
60%.
[0568] In transient transfection assays shHDex2.1 did not silence a
construct spanning exons 1-3 of mouse htt containing a 79 CAG
repeat expansion, the mouse equivalent of N171-82Q. Next shHDEx2
into NIH 3T3 cells were transfected to confirm that endogenous
mouse htt, which is expressed in NIH 3T3 cells, would not be
reduced. Surprisingly, shHDEx2.1 and shHDEx3.1 silenced full-length
mouse htt. In contrast, shHDEx2.2 silenced only the human N171-82Q
transgene.
[0569] Yamamoto and colleagues and others have demonstrated that
preformed inclusions can resolve (Yamamoto 2000). To test if RNAi
could also reduce preformed aggregates, the inventors used a
neuronal cell line, which, upon induction of Q80-eGFP expression,
showed robust inclusion formation (Xia 2002). Cells laden with
aggregates were mock-transduced, or transduced with recombinant
virus expressing control shRNA, or shRNAs directed against GFP. The
inventors found dramatic reduction in aggregates as assessed by
fluorescence. Quantification showed dose dependent effects (FIG.
32) that were corroborated by western blot (Xia 2002).
[0570] As indicated in Example 1 above, viral vectors expressing
siRNAs can mediate gene silencing in the CNS (Xia 2002). Also,
these studies were extended to the mouse model of spinocerebellar
ataxia type 1 (SCA1). The data are important as they demonstrate
that shRNA is efficacious in the CNS of a mouse model of human
neurodegenerative disease. The data also support that shRNA
expression in brain is not detrimental to neuronal survival.
[0571] shRNAs can Target the Exon 58 Polymorphism.
[0572] As described in Example 4 above, a polymorphism in htt exon
58 is in linkage disequilibrium with HD (Ambrose 1994). Thirty
eight percent of the HD population possesses a 3-GAG repeat in exon
58, in contrast to the 4-GAG repeat found in 92% of non-HD
patients. The polymorphism likely has no affect on htt, but it
provides a target for directing gene silencing to the disease
allele. As indicated in Example 4 above, in experiments to test if
allele-specific silencing for HD was possible, plasmids were
generated that expressed shRNAs that were specific for the exon 58
polymorphism. The exon 58 3-GAG-targeting shRNAs were
functional.
[0573] Developing Vectors for Control of RNAi In Vivo.
[0574] As demonstrated above, shRNA expressed from viral vectors is
effective at directing gene silencing in brain. Also, viral vectors
expressing shSCA1 inhibited neurodegeneration in the SCA1 mouse
model. ShRNA expression was constitutive in both instances.
However, constitutive expression may not be necessary, and could
exacerbate any noted nonspecific effects. The present inventors
have developed and tested several doxycycline-regulated constructs.
The construct depicted in FIG. 33 showed strong suppression of
target gene (GFP) expression after addition of doxycycline and RNAi
induction.
[0575] RNAi can Protect, and/or Reverse, the Neuropathology in
Mouse Models of Human Huntington's Disease
[0576] Two distinct but complimentary mouse models are used, the
N171-82Q transgenic and CHL2 knock-in mice. The former express a
truncated NH2-terminal fragment of human htt comprising exons 1-3
with an 82Q-repeat expansion. The knock-in expresses a mutant mouse
allele with a repeat size of .about.150. Neither shows significant
striatal or cortical cell loss. Both therefore are suitable models
for the early stages of HD. They also possess similarities in mid-
and end-stage neuropathological phenotypes including inclusions,
gliosis, and motor and behavioral deficits that will permit
comparison and validation. On the other hand, the differences
inherent in the two models provide unique opportunities for
addressing distinct questions regarding RNAi therapy. For example,
N171-82Q transgenic mice have relatively early disease onset. Thus
efficacy can be assessed within a few months, in contrast to 9
months or more in the CHL2 line. Because the data showed that
shHDEx2.2 targets the human transgene and not mouse HD, evaluate
disease-allele specific silencing in N171-82Q mice is evaluated. In
contrast, the CHL2 knock-in is important for testing how reducing
expression of both the mutant and wildtype alleles impacts on the
HD phenotype. Finally, both models should be investigated because
any therapy for HD should be validated in two relevant disease
models.
[0577] siRNA Against Human Htt Protects Against Inclusion Formation
in N171-82Q Mice
[0578] The data show that it is possible to silence the human
N171-82Q transgene in vitro, and work in reporter mice and SCA1
mouse models demonstrated efficacy of RNAi in vivo in brain.
shHDEx2.2 constructs, expressed from two vector systems with
well-established efficacy profiles in CNS, are now tested for their
capacity to reduce mutant transgenic allele expression in vivo.
Further, the impact of shHDEx2.2 on inclusion formation is
assessed. Inclusions may not be pathogenic themselves, but they are
an important hallmark of HD and their presence and abundance
correlates with severity of disease in many studies.
[0579] Recombinant feline immunodeficiency virus (FIV) and
adeno-associated virus (AAV) expressing shHDs are injected into
N171-82Q. The levels of shHDs expressed from FIV and AAV are
evaluated, as is the ability to reduce htt mRNA and protein levels
in brain, and subsequently affect inclusion formation.
[0580] Mice.
[0581] N171-82Q mice developed by Borchelt and colleagues are used
for these experiments (Shilling 1999, Shilling 2001). The colony
was set up from breeders purchased from Jackson Laboratories
(N171-82Q, line 81) and are maintained as described (Shilling 1999,
Shilling 2001). F1 pups are genotyped by PCR off tail DNA, obtained
when tagging weaned litters.
[0582] IC2 and EM48 have been used previously to evaluate N171-82Q
transgene expression levels in brain by immuno-histochemistry
(II-IC) and western blot (Zhou 2003, Trottier 1995). EM48 is an
antibody raised against a GST-NH2 terminal fragment of htt that
detects both ubiquitinated and non-ubiquitinated htt-aggregates (Li
2000), and the IC2 antibody recognizes long polyglutamine tracts
(Trottier 1995). By 4 weeks N171-82Q mice show diffuse
EM48-positive staining in striata, hippocampus, cerebellar granule
cells, and cortical layers IV and V (Shilling 1999, Shilling 2001).
The present experiments focus on the striatum and cortex because
they are the major sites of pathology in human HD. TUNEL positivity
and GFAP immunoreactivity are also significant in striatal sections
harvested from 3 month old N171-82Q mice (Yu 2003). At 4 months,
punctate nuclear and cytoplasmic immunoreactivity is also seen (Yu
2003).
[0583] Viruses.
[0584] It is difficult to directly compare the two viruses under
study at equivalent doses; FIV is enveloped and can be concentrated
and purified, at best, to titers of 5.times.10.sup.8 infectious
units/ml (iu/ml). FIV pseudotyped with the vesicular stomatitus
glycoprotein (VSVg) are used because of its tropism for neurons in
the striatum (Brooks 2002). In contrast, AAV is encapsidated and
can be concentrated and purified to titers ranging from
1.times.10.sup.9 to 1.times.10.sup.11 iu/ml, with 1.times.10.sup.10
titers on average. AAV serotype 5 is used because it is tropic for
neurons in striatum and cortex, our target brain regions. Other
serotypes of AAV, such as AAV-1 may also be used to neurons in
striatum and cortex. Also, it diffuses widely from the injection
site (Alisky 2000, Davidson 2000). Ten-fold dilutions of FIV and
AAV generally results in a greater than 10-fold drop in
transduction efficiency, making comparisons at equal titers, and
dose escalation studies, unreasonable. Thus, both viruses are
tested at the highest titers routinely available to get a fair
assessment of their capacities for efficacy in N171-82Q mice. All
viruses express the humanized Renilla reniformis green fluorescent
protein (hrGFP) reporter transgene in addition to the shRNA
sequence (FIG. 34). This provides the unique opportunity to look at
individual, transduced cells, and to compare pathological
improvements in transduced vs. untransduced cells.
[0585] Injections.
[0586] Mice are placed into a David Kopf frame for injections. Mice
are injected into the striatum (5 microliters; 100 nl/min) and the
cortex (3 microliters; 75 nl/min) using a Hamilton syringe and
programmable Harvard pump. The somatosensory cortex is targeted
from a burr hole at -1.5 mm from Bregma, and 1.5 mm lateral. Depth
is 0.5 mm. The striatum is targeted through a separate burr hole at
+1.1 mm from Bregma, 1.5 mm lateral and 2 mm deep. Only the right
side of the brain is injected, allowing the left hemisphere to be
used as a control for transgene expression levels and presence or
absence of inclusions.
[0587] Briefly, groups of 4 week-old mice heterozygous for the
N171-82Q transgene and their age-matched wildtype littermates are
injected with FIV (FIV groups are VSVg.FIV.shHDEx2.2,
VSVg.FIVshlacZ, VSVg.hrGFP, saline) or AAV (AAV groups are
AAV5.shHDEx2.2, AAV5shlacZ, AAV5hrGFP, saline) (n=18/group;
staggered injections because of the size of the experiment). Names
of shHDEx2.2 and shlacZ expressing viruses have been shortened from
shlacZ.hrGFP, for example, to make it easier to read, but all
vectors express hrGFP as reporter. Nine mice/group are sacrificed
at 12 weeks of age to assess the extent of transduction (eGFP
fluorescence; viral copy number/brain region), shRNA expression
(northern for shRNAs, and inhibition of expression of the
transgenic allele (QPCR and western blot). The remaining groups are
sacrificed at 5 months of age. This experimental set up is repeated
(to n=6/group) to confirm results and test inter-experiment
variability.
[0588] All mice in all groups are weighed bi-weekly (every other
week) after initial weekly measurements. N171-82Q mice show normal
weight gain up to approximately 6 weeks, after which there are
significant differences with their wildtype littermates.
[0589] PCR Analyses.
[0590] Brains are harvested from mice sacrificed at 12 weeks of
age, and grossly evaluated for GFP expression to confirm
transduction. The cortex and striatum from each hemisphere is
dissected separately, snap frozen in liquid N2, pulverized with a
mortar and pestle, and resuspended in Trizol (Gibco BRL). Separate
aliquots are used for Q-RTPCR for N171-82Q transgenes and DNA PCR
for viral genomes. A coefficient of correlation is determined for
transgene silencing relative to viral genomes for both vector
systems, for the regions analyzed and compared to contralateral
striata and mice injected with control vectors or saline.
[0591] The RNA harvested is used to evaluate activation of
interferon-responsive genes. Bridges et al (Bridges 2003) and Sledz
and colleagues (Sledz 2003) found activation of 2'5' oligo(A)
polymerase (OAS) in cell culture with siRNAs and shRNAs, the latter
expressed from lentivirus vectors. Gene expression changes are
assessed using QPCR for OAS, Stat1, interferon-inducible
transmembrane proteins 1 and 2 and protein kinase R (PKR). PKR
activation is an initial trigger of the signaling cascade of the
interferon response.
[0592] Protein Analyses.
[0593] A second set of 3 brains/group are harvested for protein
analysis. Regions of brains are micro dissected as described above,
and after pulverization are resuspended in extraction buffer (50 mM
Tris, pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 1
mM BetaME, 1.times. complete protease inhibitor cocktail) for
analysis by western blot. HrGFP expression are evaluated and
correlated to diminished levels of soluble N171-82Q using anti-GFP
and antibodies to the NH2-terminal region of htt (EM48) or the
polyglutamine tract (IC2).
[0594] Histology.
[0595] Histology is done on the remaining animals. Mice are
perfused with 2% paraformaldehyde in PBS, brains blocked to remove
the cerebellum, post-fixed ON, and then cryoprotected in 30%
sucrose. Full coronal sections (40 .mu.m) of the entire cerebrum
are obtained using a Microtome (American Products Co #860 equipped
with a Super Histo Freeze freezing stage). Briefly, every section
is collected, and sections 1-6 are placed into 6 successive wells
of a 24-well plate. Every 400 microns, two sections each of 10
microns are collected for Nissl and H&E staining. The process
is repeated.
[0596] EM-48 immuno-staining reveals diffuse nuclear accumulations
in N171-82Q mice as early as 4 weeks of age. In 6 mo. old mice
inclusions are extensive (Shilling 2001). The increase in
cytoplasmic and nuclear EM48 immuno-reactivity, and in EM48
immuno-reactive inclusions over time allow quantitative comparisons
between transduced and untransduced cells. Again, control values
are obtained from mice injected with shlacZ-expressing vectors,
saline injected mice, and wt mice. The contralateral region is used
as another control, with care taken to keep in mind the possibility
of retrograde and anterograde transport of virus from the injection
site.
[0597] Quantitation of nuclear inclusions is done using
BioQuant.TM. software in conjunction with a Leitz DM RBE upright
microscope equipped with a motorized stage (Applied Scientific
Instruments). Briefly, floating sections are stained with anti-NeuN
(AMCA secondary) and EM48 antibodies (rhodamine secondary) followed
by mounting onto slides. The regions to be analyzed are outlined,
and threshold levels for EM48 immunoreactivity set using sections
from control injected mice. A minimum of 50 hrGFP-positive and
hrGFP negative neurons cells are evaluated per slide (5
slides/mouse), and inclusion intensity measured (arbitrary units).
This is done for both striata and cortices. To quantitate
cytoplasmic inclusions, the striatum is outlined and total EM48
aggregate density measured. Threshold values are again done using
control hemispheres and control injected mice.
[0598] Additional wells of sections are stained with anti-GFAP,
anti-neurofilament, and the lectin GSA to assay for viral or
viral+hairpin induced gliosis, neuritic changes, and microglial
activation, respectively. GFAP-stained brain sections from N171-82Q
mice show gliosis by 4 months (Yu 1998), although earlier time
points have not been reported.
[0599] Stereology.
[0600] In a separate experiment on N171-82Q mice and wt mice,
unbiased stereology using BioQuant.TM. software is done to assess
transduction efficiency. Stereology allows for an unbiased
assessment of efficiency of transduction (number of cells
transduced/input). AAV5 (AAV5hrGFP, AAV5shHD.hrGFP) and FIV
(VSVg.FIVhrGFP, VSVg.FIVshHD.hrGFP) transduction efficiency is
compared in the striatum and somatosensory cortex in HD and
wildtype mice, with n=5 each. Mice are harvested at 12 and 20
weeks. The cerebrum is sectioned in its entirety and stored at
-20.degree. C. until analysis. Briefly, six weeks after gene
transfer with VSVg.FIVhrGFP (n=3) or AAV5hrGFP (n=3), every section
of an HD mouse cerebrum is mounted and an initial assessment of the
required numbers of sections and grid and dissector size done using
the coefficient of error (as determined by Martheron's quadratic
approximation formula) as a guide.
[0601] The 171-82Q HD mouse model has important neuropathological
and behavioral characteristics relevant to HD. Onset of disease
occurs earlier than HD knock-in or YAC transgenic models, allowing
an initial, important assessment of the protective effects of RNAi
on the development of neuropathology and dysfunctional behavior,
without incurring extensive long term housing costs. Admittedly,
disease onset is slower and less aggressive than the R6/2 mice
created by Bates and colleagues (Mangiarini 1996), but the R6/2
line is difficult to maintain and disease is so severe that it may
be less applicable and less predicative of efficacy in clinical
trials.
[0602] N171-82Q mice (n=6/group) and age-matched littermates
(n=6/group) are be weighed twice a month from 4 wks on, and
baseline rotarod tests performed at 5 and 7 weeks of age. Numbers
of mice per group are as described in Schilling et al (Shilling
1999) in which statistically significant differences between
N171-82Q and wildtype littermates were described. At 7 weeks of age
(after testing is complete), AAV (AAVshHDEx2.2, AAVshlacZ,
AAVhrGFP, saline) or FIV (FIVshEx2.2, FIVshlacZ, FIVhrGFP, saline)
is injected bilaterally into the striatum and cortex. Rotarod tests
are repeated at 3-week intervals starting at age 9 weeks, until
sacrifice at 6 months. The clasping behavior is assessed monthly
starting at 3 months.
[0603] Behavioral Testing.
[0604] N171-82Q mice are given four behavioral tests, all of which
are standard assays for progressive disease in HD mouse models. The
tests allow comparisons of behavioral changes resulting from RNAi
to those incurred in HD mouse models given other experimental
therapies. For example, HD mice given cystamine or creatine therapy
showed delayed impairments in rotarod performance, and in some
cases delayed weight loss (Ferrante 2000, Dedeoglu 2002, Dedeogu
2003) In addition to the rotarod, which is used to assay for motor
performance and general neurological dysfunction, the activity
monitor allows assessment of the documented progressive
hypoactivity in N171-82Q mice. The beam analysis is a second test
of motor performance that has also been used in HD mice models
(Carter 1999). Clasping, a phenotype of generalized neurological
dysfunction, is straightforward and takes little time. Clasping
phenotypes were corrected in R. Hen's transgenic mice possessing an
inducible mutant htt.
[0605] Accelerated Rotarod.
[0606] N171-82Q and age-matched littermates are habituated to the
rotarod at week 4, and 4 trials per day for 4 days done on week 5
and 7, and every 3 weeks hence using previously described assays
(Shilling 1999, Clark 1997) in use in the lab. Briefly, 10 min
trials are run on an Economex rotarod (Columbus Instruments) set to
accelerate from 4 to 40 rpm over the course of the assay. Latency
to fall is recorded and averages/group determined and plotted.
Based on prior work (Shilling 1999) 6 mice will give sufficient
power to assess significance.
[0607] Clasping Behavior.
[0608] Normal mice splay their limbs when suspended, but mice with
neurological deficits can exhibit the opposite, with fore and hind
limbs crunched into the abdomen (clasping). All mice are suspended
and scored for clasping monthly. The clasp must be maintained for
at least 30 sec. to be scored positive.
[0609] Activity Monitor.
[0610] Most HD models demonstrate hypokinetic behavior,
particularly later in the disease process. This can be measured in
several ways. One of the simplest methods is to monitor home cage
activity with an infrared sensor (AB-system 4.0, Neurosci Co.,
LTD). Measurements are taken over 3 days with one day prior
habituation to the testing cage (standard 12-hour light/dark
cycle). Activity monitoring is done at 12, 17, and 20 and 23 weeks
of age.
[0611] Beam Walking.
[0612] N171Q-82Q and age matched littermates are assayed for motor
performance and coordination using a series of successively more
difficult beams en route to an enclosed safety platform. The assay
is as described by Carter et al (Carter 1999). Briefly, 1
meter-length beams of 28, 17 or 11 mm diameter are placed 50 cm
above the bench surface. A support stand and the enclosed goal box
flank the ends. Mice are trained on the 11 mm beam at 6 weeks of
age over 4 days, with 3 trials per day. If mice can traverse the
beam in <20 sec. trials are initiated. A trial is then run on
each beam, largest to smallest, with a 60 sec cutoff/beam and one
minute rest between beams. A second trial is run and the mean
scores of the two trials evaluated.
[0613] RNAi cannot replace neurons; it only has the potential to
protect non-diseased neurons, or inhibit further progression of
disease at a point prior to cell death. N171-82Q mice do not show
noticeable cellular loss, and is therefore an excellent model of
early HD in humans. The general methodology is the similar to that
described above, except that the viruses are injected at 4 months,
when N171-82Q mice have measurable behavioral dysfunction and
inclusions. Animals are sacrificed at end stage disease or at 8
months, whichever comes first. Histology, RNA and protein in
harvested brains are analyzed as described above.
[0614] It is important to confirm the biological effects of virally
expressed shHDs in a second mouse model, as it is with any therapy.
The Detloff knock-in mouse (the CHL2 line, also notated as
HdhCAGQ150) is used as a second model of early HD disease
phenotypes. These mice have a CAG expansion of approximately 150
units, causing brain pathologies similar to HD including gliosis
and neural inclusions in the cortex and striatum. They also show
progressive motor dysfunction and other behavioral manifestations
including rotarod deficits, clasping, gait abnormalities and
hypoactivity.
[0615] Heterozygous CHL2 mice express the mutant and wildtype
allele at roughly equivalent levels, and shRNAs directed against
mouse HD silence both transcripts. shmHDEx2.1 causes reductions in
gene expression, but not complete silencing. Disease severity in
mouse models is dependent on mutant htt levels and CAG repeat
length.
[0616] The inventors created shmHDEx2 (shRNA for murine HD)
directed against a region in mouse exon 2 that reduces expression
of the full-length mouse Hdh transcript in vitro. Transduction of
neurons with shmHDEx2-expressing viruses, and its impacts on
neuropathological progression, behavioral dysfunction and the
appearance of EM48 immuno-reactive inclusions in CHL2 mice is
tested. shmHD- or shlacZ-expressing vectors in CHL2 and wildtype
brain is tested. In this experiment, virus is injected into the
striatum of wt or CHL2 mice (10/group) using the coordinates
described above, at 3 months of age. Two months later mice are
sacrificed and brains removed and processed for RNA (n=5/group) and
protein (n=5).
[0617] A second study tests the vectors in the Detloff model.
Briefly, 15 mice per group are injected into the striatum and
cortex at 3 months of age with AAV (AAVshmHD, AAVshlacZ, AAVhrGFP,
saline) or FIV (VSVg.FIV.shmHD, VSVg.FIVshlacZ, VSVg.FIVhrGFP,
saline) expressing the transgenes indicated. To assess the impact
of RNAi, activity performed. The mice are sacrificed at 16-18
months of age and five brains/group are processed for histology and
sections banked in 24-well tissue culture plates. The remaining
brains are processed for RNA (n=6) and protein analysis (n=5).
Northern blots or western blots are required to analyze wildtype
and mutant htt expression because the only distinguishing
characteristic is size.
[0618] Development of Effective Allele-Specific siRNAs
[0619] Mutant htt leads to a toxic gain of function, and inhibiting
expression of the mutant allele has a profound impact on disease
(Yamamoto 2000). Also, selectively targeting the disease allele
would be desirable if non-disease allele silencing is deleterious.
At the present time, there is one documented disease linked
polymorphism in exon 58 (Lin 2001). Most non-HD individuals have 4
GAGs in Hdh exon 58 while 38% of HD patients have 3 GAGs. As
described above, RNAi can be accomplished against the 3-GAG
repeat.
[0620] Prior work by the inventors showed the importance of using
full-length targets for testing putative shRNAs. In some cases,
shRNAs would work against truncated, but not full-length targets,
or vice-versa. Thus, it is imperative that testable, full-length
constructs are made to confirm allele-specific silencing. The V5
and FLAG tags provide epitopes to evaluate silencing at the mRNA
and protein levels. This is important as putative shRNAs may behave
as miRNAs, leading to inhibition of expression but not message
degradation.
[0621] Designing the siRNAs.
[0622] Methods are known for designing siRNAs (Miller 2003,
Gonzalez-Alegre 2003, Xia 2002, Kao 2003). Information is also know
about the importance of maintaining flexibility at the 5' end of
the antisense strand for loading of the appropriate antisense
sequence into the RISC complex (Khvorova 2003 Schwarz 2003). DNA
sequences are generated by PCR. This method allows the rapid
generation of many candidate shRNAs, and it is significantly
cheaper than buying shRNAs. Also, the inserts can be cloned readily
into our vector shuttle plasmids for generation of virus. The
reverse primer is a long oligonucleotide encoding the antisense
sequence, the loop, the sense sequence, and a portion of the human
U6 promoter. The forward primer is specific to the template in the
PCR reaction. PCR products are cloned directly into pTOPO blunt
from InVitrogen, plasmids transformed into DH5a, and bacteria
plated onto Kanr plates (the PCR template is Ampr). Kanr clones are
picked and sequenced. Sequencing is done with an extended `hot
start` to allow effective read-through of the hairpin. Correct
clones are transfected into cells along with plasmids expressing
the target or control sequence (HttEx58.GAG3V5 and
HttEx58.GAG4FLAG, respectively) and silencing evaluated by western
blot. Reductions in target mRNA levels are assayed by Q-RTPCR. The
control for western loading is neomycin phosphotransferase or
hrGFP, which are expressed in the target-containing plasmids and
provide excellent internal controls for transfection efficiency.
The control for Q-RTPCR is HPRT.
[0623] Cell lines expressing targets with the identified
polymorphism or control wildtype sequences are created. Target gene
expression are under control of an inducible promoter. PC6-3, Tet
repressor (TetR+) cells, a PC-12 derivative with a uniform neuronal
phenotype (Xia 2002) are used. PC6-3 cells are transfected with
plasmids expressing HDEx58.GAG3V5 (contains neo marker) and
HDEx58GAG4FLG (contains puro marker), and G418+/puromycin+ positive
clones selected and characterized for transcript levels and htt-V5
or htt-Flag protein levels.
[0624] FIV vectors expressing the allele specific shRNAs are
generated and used to test silencing in the inducible cell lines.
FIV vectors infect most epithelial and neuronal cell lines with
high efficiency and are therefore useful for this purpose. They
also efficiently infect PC6-3 cells. AAV vectors are currently less
effective in in vitro screening because of poor transduction
efficiency in many cultured cell lines.
[0625] Cells are transduced with 1 to 50 infectious units/cell in
24-well dishes, 3 days after induction of mutant gene expression.
Cells are harvested 72 h after infection and the effects on
HDEx58.GAG3V5 or HDEx58GAG4FLG expression monitored.
Example 10
Micro RNAi-Therapy for Polyglutamine Disease
[0626] Post-transcriptional gene silencing occurs when double
stranded RNA (dsRNA) is introduced or naturally expressed in cells.
RNA interference (RNAi) has been described in plants (quelling),
nematodes, and Drosophila. This process serves at least two roles,
one as an innate defense mechanism, and another developmental
(Waterhouse 2001 Fire 1999, Lau 2001, Lagos-Quintana 2001, Lee
2001). RNAi may regulate developmental expression of genes via the
processing of small, temporally expressed RNAs, also called
microRNAs (Knight 2001, Grishok 2001). Harnessing a cell's ability
to respond specifically to small dsRNAs for target mRNA degradation
has been a major advance, allowing rapid evaluation of gene
function (Gonczy 2000, Fire 1998, Kennerdell 1998, Hannon 2002, Shi
2003, Sui 2002).
[0627] Most eukaryotes encode a substantial number of small
noncoding RNAs termed micro RNAs (miRNAs) (Zeng 2003, Tijsterman
2004, Lee 2004, Pham 2004). mir-30 is a 22-nucleotide human miRNA
that can be naturally processed from a longer transcript bearing
the proposed miR-30 stem-loop precursor. mir-30 can translationally
inhibit an mRNA-bearing artificial target sites. The mir-30
precursor stem can be substituted with a heterologous stem, which
can be processed to yield novel miRNAs and can block the expression
of endogenous mRNAs.
[0628] Huntington's disease (HD) and Spinocerebellar ataxia type I
(SCA1) are two of a class of dominant, neurodegenerative diseases
caused by a polyglutamine (polyQ) expansion. The mutation confers a
toxic gain of function to the protein, with polyQ length predictive
of age of onset and disease severity. There is no curative or
preventative therapy for HD or SCA1, supporting the investigation
of novel strategies. As described above, the inventors showed that
gene silencing by RNA interference (RNAi) can be achieved in vitro
and in vivo by expressing short hairpin RNAs (shRNAs) specific for
mRNAs encoding ataxin-1 or huntingtin. Currently, strong,
constitutive polIII promoters (U6 and H1) are used to express
shRNAs, which are subsequently processed into functional small
interfering RNAs (siRNAs). However, strong, constitutive expression
of shRNAs may be inappropriate for diseases that take several
decades to manifest. Moreover, high-level expression may be
unnecessary for sustained benefit, and in some systems may induce a
non-specific interferon response leading to global shut-down of
gene expression. The inventors therefore generated polII-expressed
microRNAs (miRNAs) as siRNA shuttles as an alternative strategy.
Due to their endogenous nature, miRNA backbones may prevent the
induction of the interferon response.
[0629] Using human mir-30 as a template, miRNA shuttles were
designed that upon processing by dicer released siRNAs specific for
ataxin-1. Briefly, the constructs were made by cloning a promoter
(such as an inducible promoter) and an miRNA shuttle containing an
embedded siRNA specific for a target sequence (such as ataxin-1)
into a viral vector. By cloning the construct into a viral vector,
the construct can be effectively introduced in vivo using the
methods described in the Examples above. Constructs containing
polII-expressed miRNA shuttles with embedded ataxin-1-specific
siRNAs were co-transfected into cells with GFP-tagged ataxin-1, and
gene silencing was assessed by fluorescence microscopy and western
analysis. Dramatic arid dose-dependent gene silencing relative to
non-specific miRNAs carrying control siRNAs was observed. This
polII-based expression system exploits the structure of known
miRNAs and supports tissue-specific as well as inducible siRNA
expression, and thus, serves as a unique and powerful alternative
to dominant neurodegenerative disease therapy by RNAi.
[0630] Briefly, the constructs were made by cloning a promoter
(such as an inducible promoter) and an miRNA shuttle containing an
embedded siRNA specific for a target sequence (such as ataxin-1)
into a viral vector. By cloning the construct into a viral vector,
the construct can be effectively introduced in vivo using the
methods described in the Examples above.
Example 11
Huntington's Disease (HD)
[0631] Subsequent to the experiments described in Example 9 above,
the inventors have made additional siRNA molecules specific for
regions of the HD gene (FIG. 35A-L). All of these sequences have
been tested, and were found to be effective in RNA
interference.
[0632] shHD1.1=SEQ ID NO: 106
[0633] shHD1.2=SEQ ID NO: 107
[0634] shHD1.3=SEQ ID NO: 108
[0635] shHD1.4=SEQ ID NO: 109
[0636] shHD1.5=SEQ ID NO: 110
[0637] shHD1.6=SEQ ID NO: 111
[0638] shHD1.7=SEQ ID NO: 112
[0639] shHD1.8=SEQ ID NO: 113
[0640] shHD1.9=SEQ ID NO: 114
[0641] shHD2.1=SEQ ID NO: 115
[0642] shHD2.2=SEQ ID NO: 145
[0643] shHD2.3=SEQ ID NO: 116
[0644] shHD2.4=SEQ ID NO: 117
[0645] shHD2.5=SEQ ID NO: 118
[0646] shHD2.6=SEQ ID NO: 119
[0647] shHD3.1=SEQ ID NO: 120
[0648] shHD3.2=SEQ ID NO: 121
[0649] shHD4.1=SEQ ID NO: 122
[0650] shHD8.1=SEQ ID NO: 123
[0651] shHD8.2=SEQ ID NO: 124
[0652] shHD12.1=SEQ ID NO: 125
[0653] shHD17.1=SEQ ID NO: 126
[0654] shHD17.2=SEQ ID NO: 127
[0655] shHD22.1=SEQ ID NO: 128
[0656] shHD28.1=SEQ ID NO: 129
[0657] shHD30.1=SEQ ID NO: 130
[0658] shHD32.1=SEQ ID NO: 131
[0659] shHD34.1=SEQ ID NO: 132
[0660] shHD34.2=SEQ ID NO: 133
[0661] shHD35.1=SEQ ID NO: 134
[0662] shHD37.1=SEQ ID NO: 135
[0663] shHD38.1=SEQ ID NO: 136
[0664] shHD38.2=SEQ ID NO: 137
[0665] shHD40.1=SEQ ID NO: 138
[0666] shHD42.1=SEQ ID NO: 139
[0667] shHD42.2=SEQ ID NO: 140
[0668] shHD58.1=SEQ ID NO: 141
[0669] shHD58.2=SEQ ID NO: 146
[0670] shHD63.1=SEQ ID NO: 142
[0671] The normal human huntingtin gene is SEQ ID NO:143, and the
corresponding normal mouse huntingin gene is SEQ ID NO:144.
[0672] A particular nucleic acid sequence also encompasses
variants. A variant of a molecule is a sequence that is
substantially similar to the sequence of the native molecule. For
nucleotide sequences, variants include those sequences that,
because of the degeneracy of the genetic code, encode the identical
amino acid sequence of the native protein. The sequences listed
above also encompass nucleic acids containing known analogs of
natural nucleotides that have similar binding properties as the
reference nucleic acid and are metabolized in a manner similar to
naturally occurring nucleotides. The present invention encompasses
nucleic acid sequences wherein at least 12 of the nucleotides the
same as in the sequences provided, but wherein the remaining
nucleotides may be replaced with other nucleotides.
[0673] All publications, patents and patent applications are
incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details described
herein may be varied considerably without departing from the basic
principles of the invention.
CITATIONS
[0674] Adelman et al., DNA, 2, 183 (1983). [0675] Alisky et al.,
Hum Gen Ther, 11, 2315 (2000b). [0676] Alisky et al., NeuroReport,
11, 2669 (2000a). [0677] Altschul et al., JMB, 215, 403 (1990).
[0678] Altschul et al., Nucleic Acids Res. 25, 3389 (1997). [0679]
Ambrose et al., Somat Cell Mol Genet. 20, 27-38 (1994) [0680]
Anderson et al., Gene Ther., 7(12), 1034-8 (2000). [0681] Andreason
and Evans, Biotechniques, 6, 650 (1988). [0682] Augood et al.,
Neurology, 59, 445-8 (2002). [0683] Augood et al., Ann Neurol., 46,
761-769 (1999). [0684] Bass, Nature, 411, 428 (2001). [0685] Batzer
et al., Nucl. Acids Res., 19, 508 (1991). [0686] Baulcombe, Plant
Mol. Biol., 32, 79 (1996). [0687] Bates et al., Curr Opin Neurol
16:465-470, 2003. [0688] Behr et al., Proc. Natl. Acad. Sci. USA,
86, 6982 (1989). [0689] Bernstein et al., Nature, 409, 363 (2001).
[0690] Bledsoe et al., NatBiot, 18, 964 (2000). [0691] Brantl,
Biochemica and Biophysica Acta, 1575, 15 (2002). [0692] Brash et
al., Molec. Cell. Biol., 7, 2031 (1987). [0693] Breakefield et al.,
Neuron, 31, 9-12 (2001). [0694] Bridge et al., Nat Genet
34:263-264, 2003. [0695] Brooks et al., Proc. Natl. Acad. Sci.
U.S.A., 99, 6216 (2002). [0696] Brummelkamp, T. R. et al., Science
296:550-553 (2002). [0697] Burright, E. N. et al., Cell, 82,
937-948 (1995) [0698] Capecchi, Cell, 22, 479 (1980). [0699] Caplan
et al., Proc. Natl. Acad. Sci. U.S.A., 98, 9742 (2001). [0700]
Caplen et al., Hum. Mol. Genet., 11(2), 175-84 (2002). [0701]
Carter et al., J Neurosci 19:3248, 1999. [0702] Cemal et al., Hum.
Mol. Genet., 11(9), 1075-94 (2002). [0703] Chai et al., Hum. Mol.
Genet., 8, 673-682 (1999b). [0704] Chai et al., J. Neurosci., 19,
10338 (1999). [0705] Chan et al., Hum Mol Genet., 9(19), 2811-20
(2000). [0706] Chen, H. K. et al., Cell, 113, 457-68 (2003) [0707]
Chiu and Rana, Mol. Cell., 10(3), 549-61 (2002). [0708] Clark, H.
B. et al., J. Neurosci., 17(19), 7385-7395 (1997) [0709] Cogoni et
al., Antonie Van Leeuwenhoek, 65, 205 (1994). [0710] Corpet et al.,
Nucl. Acids Res., 16, 10881 (1988). [0711] Crea et al., Proc. Natl.
Acad. Sci. U.S.A., 75, 5765 (1978). [0712] Cullen, Nat. Immunol.,
3, 597-9 (2002). [0713] Cummings, C. J. et al., Nat. Genet., 19(2),
148-154 (1998) [0714] Davidson et al., Proc. Natl. Acad. Sci.
U.S.A., 97, 3428 (2000). [0715] Davidson, B. L. et al., The Lancet
Neurol., 3, 145-149 (2004) [0716] Davidson et al., Nat Rev Neurosci
4:353-364, 2003. [0717] Dayhoff et al., Atlas of Protein Sequence
and Structure (Natl. Biomed. Res. Found. 1978) [0718] Dedeoglu et
al., J Neurochem 85:1359-1367, 2003. [0719] Dedeoglu et al., J
Neurosci 22:8942-8950, 2002. [0720] Doheny et al., Neurology, 59,
1244-1246 (2002). [0721] Donze and Picard, Nucleic Acids Res.,
30(10) (2002). [0722] During et al., Gene Ther 5:820-827, 1998.
[0723] Elbashir et al., EMBO J., 20(23), 6877-88 (2001c). [0724]
Elbashir et al., Genes and Development, 15, 188 (2001). [0725]
Elbashir et al., Nature, 411, 494 (2001). [0726] Emamian, E. S. et
al., Neuron, 38, 375-87 (2003) [0727] Fahn et al., Adv. Neurol.,
78, 1-10 (1998). [0728] Felgner et al., Proc. Natl. Acad. Sci., 84,
7413 (1987). [0729] Fernandez-Funez, P. et al., Nature, 408,
101-106 (2000) [0730] Ferrante et al., J Neurosci 20:4389-4397,
2000. [0731] Fire et al., Nature, 391(6669), 806-11 (1998). [0732]
Fire A. Trends Genet 15(9):358-363, 1999 [0733] Frisella et al.,
Mol Ther 3(3):351-358, 2001. [0734] Gaspar et al., Am. J. Hum.
Genet., 68(2), 523-8 (2001). [0735] Gelfand, PCR Strategies,
Academic Press (1995). [0736] Gitlin et al., Nature, 418(6896),
430-4 (2002). [0737] Goeddel et al., Nucleic Acids Res., 8, 4057
(1980). [0738] Gonczy et al., Nature 408:331-336, 2000. [0739]
Gonzalez-Alegre et al., Nat Genet 3:219-223, 1993. [0740] Goodchild
et al., Mov. Disord., 17(5), 958, Abstract (2002). [0741] Grishok
et al., Cell 106:23-34, 2001. [0742] Hamilton and Baulcombe,
Science, 286, 950 (1999). [0743] Hammond et al., Nature, 404, 293
(2000). [0744] Hannon G J. Nature 418:244-251, 2002. [0745] Harper
et al., Meth Mol Biol. In Press 2004 [0746] Hewett et al., Hum.
Mol. Gen., 9, 1403-1413 (2000). [0747] Higgins et al., CABIOS, 5,
151 (1989). [0748] Higgins et al., Gene, 73, 237 (1988). [0749]
Hilberg et al., Proc. Natl. Acad. Sci. USA, 84, 5232 (1987). [0750]
Holland et al., Proc. Natl. Acad. Sci. USA, 84, 8662 (1987). [0751]
Hornykiewicz et al., N. Engl. J. Med., 315, 347-353 (1986). [0752]
Huang et al., CABIOS, 8, 155 (1992). [0753] Hutton et al., Nature,
393, 702-705 (1998). [0754] Innis and Gelfand, PCR Methods Manual,
Academic Press (1999). [0755] Innis et al., PCR Protocols, Academic
Press (1995). [0756] Jacque et al., Nature, 418(6896), 435-8
(2002). [0757] Johnston, Nature, 346, 776 (1990). [0758] Kang et
al., J Virol 76:9378-9388, 2002. [0759] Karlin and Altschul, Proc.
Natl. Acad. Sci. USA, 87, 2264 (1990). [0760] Karlin and Altschul,
Proc. Natl. Acad. Sci. USA, 90, 5873 (1993) [0761] Kennerdell and
Carthew, Cell, 95, 1017 (1998). [0762] Kao et al., J Biol Chem
2003. [0763] Kawasaki, H., et al., Nucleic Acids Res, 31, 981-7
(2003) [0764] Khvorova, A., et al., Cell, 115, 505 (2003) [0765]
Kitabwalla and Ruprecht, N. Engl. J. Med., 347, 1364-1367 (2002).
[0766] Klein et al., Ann. Neurol., 52, 675-679 (2002). [0767] Klein
et al., Curr. Opin. Neurol., 4, 491-7 (2002). [0768] Klement, I. A.
et al., Cell, 95, 41-53 (1998) [0769] Knight et al., Science
293:2269-2271, 2001. [0770] Konakova et al., Arch. Neurol., 58,
921-927 (2001). [0771] Krichevsky and Kosik, Proc. Natl. Acad. Sci.
U.S.A., 99(18), 11926-9 (2002). [0772] Kriegler, M. Gene Transfer
and Expression, A Laboratory Manual, W.H. Freeman Co, New York,
(1990). [0773] Kunath et al., Nat Biotechnol 21:559-561, 2003.
[0774] Kunkel et al., Meth. Enzymol., 154, 367 (1987). [0775]
Kunkel, Proc. Natl. Acad. Sci. USA, 82, 488 (1985). [0776] Kustedjo
et al., J. Biol. Chem., 275, 27933-27939 (2000). [0777] Laccone et
al., Hum. Mutat., 13(6), 497-502 (1999). [0778] Lagos-Quintana et
al., Science 294:853-858, 2001. [0779] Lai et al., Proc. Natl.
Acad. Sci. USA, 86, 10006 (1989). [0780] Larrick, J. W. and Burck,
K. L., Gene Therapy. Application of Molecular Biology, Elsevier
Science Publishing Co., Inc., New York, p. 71-104 (1991). [0781]
Lau et al., Science 294:858-862, 2001. [0782] Lawn et al., Nucleic
Acids Res., 9, 6103 (1981). [0783] Lee, N. S., et al., Nat.
Biotechnol. 19:500-505 (2002). [0784] Lee et al., Science
294:862-864, 2001. [0785] Lee et al., Cell, 117, 69-81 (2004)
[0786] Leger et al., J. Cell. Sci., 107, 3403-12 (1994). [0787]
Leung et al., Neurogenetics, 3, 133-43 (2001). [0788] Li et al.,
Nat Genet 25:385-389, 2000. [0789] Lin et al., Hum. Mol. Genet.,
10(2), 137-44 (2001). [0790] Loeffler et al., J. Neurochem., 54,
1812 (1990). [0791] Lotery et al., Hum Gene Ther 13:689-696, 2002.
[0792] Mangiarini et al., Cell 87(3):493-506, 1996. [0793] Manche
et al., Mol. Cell Biol., 12, 5238 (1992). [0794] Margolis and Ross,
Trends Mol. Med., 7, 479 (2001). [0795] Martinez et al., Cell,
110(5), 563-74 (2002). [0796] McCaffrey et al., Nature, 418(6893),
38-9 (2002). [0797] McManus and Sharp, Nat. Rev. Genet. 3(10),
737-47 (2002). [0798] Meade et al., J Comp Neurol 449:241-269,
2002. [0799] Meinkoth and Wahl, Anal. Biochem., 138, 267 (1984).
[0800] Methods in Molecular Biology, 7, Gene Transfer and
Expression Protocols, Ed. E. J. Murray, Humana Press (1991). [0801]
Miller, et al., Mol. Cell. Biol., 10, 4239 (1990). [0802] Miller,
V. M. et al., PNAS USA, 100, 7195-200 (2003) [0803] Minks et al.,
J. Biol. Chem., 254, 10180 (1979). [0804] Miyagishi, M. &
Taira, K. Nat. Biotechnol. 19:497-500 (2002). [0805] Moulder et
al., J. Neurosci., 19, 705 (1999). [0806] Murray, E. J., ed.
Methods in Molecular Biology, Vol. 7, Humana Press Inc., Clifton,
N.J., (1991). [0807] Myers and Miller, CABIOS, 4, 11 (1988). [0808]
Nasir et al., Cell, 81, 811-823 (1995). [0809] Needleman and
Wunsch, JMB, 48, 443 (1970). [0810] Nykanen et al., Cell, 107, 309
(2001). [0811] Ogura and Wilkinson, Genes Cells, 6, 575-97 (2001).
[0812] Ohtsuka et al., JBC, 260, 2605 (1985). [0813] Okabe et al.,
FEBS Lett., 407, 313 (1997). [0814] Ooboshi et al., Arterioscler.
Thromb. Vasc. Biol., 17, 1786 (1997). [0815] Orr et al., Nat.
Genet. 4, 221-226 (1993) [0816] Orr et al., Cell 101:1-4, 2000.
[0817] Ozelius et al., Genomics, 62, 377-84 (1999). [0818] Ozelius
et al., Nature Genetics, 17, 40-48 (1997). [0819] Passini et al., J
Virol 77:7034-7040, 2003. [0820] Paul, C. P., et al., Nat.
Biotechnol. 19:505-508 (2002). [0821] Paulson et al., Ann. Neurol.,
41(4), 453-62 (1997). [0822] Pearson and Lipman, Proc. Natl. Acad.
Sci. USA, 85, 2444 (1988). [0823] Pearson et al., Meth. Mol. Biol.,
24, 307 (1994). [0824] Pham et al., Cell, 117:83-94 (2004) [0825]
Pittman et al., J. Neurosci., 13(9), 3669-80 (1993). [0826]
Plasterk et al., Cell, 117, 1-4 (2004) [0827] Poorkaj et al., Ann.
Neurol., 43, 815-825 (1998). [0828] Quantin, B., et al., Proc.
Natl. Acad. Sci. USA, 89, 2581 (1992). [0829] Reynolds, A. et al.,
Nat. Biotechnol., 22, 326-30 (2004) [0830] Rosenfeld, M. A., et
al., Science, 252, 431 (1991). [0831] Rossolini et al., Mol. Cell.
Probes, 8, 91 (1994). [0832] Rubinson et al., Nat Genet 33:401-406,
2003. [0833] Sambrook and Russell, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press Cold Spring Harbor,
N.Y. (2001). [0834] Scharfmann et al., Proc. Natl. Acad. Sci. USA,
88, 4626 (1991). [0835] Schilling et al., Hum Mol Genet
8(3):397-407, 1999. [0836] Schilling et al., Neurobiol Dis
8:405-418, 2001. [0837] Schwarz et al., Mol. Cell., 10(3), 537-48
(2002). [0838] Shi Y, Trends Genet 19:9-12, 2003. [0839] Shipley et
al., J. Biol. Chem., 268, 12193 (1993). [0840] Skinner, P. J. et
al., Nature, 389, 971-234 (1997) [0841] Skorupa et al., Exp Neurol
160:17-27, 1999. [0842] Sledz et al., Nat Cell Biol 5:834-839,
2003. [0843] Smith et al., Adv. Appl. Math., 2, 482 (1981). [0844]
Stein et al., J. Virol., 73, 3424 (1999). [0845] Stein et al., Mol
Ther 3(6):850-856, 2001. [0846] Stein et al., RNA, 9(2), 187-192
(2003). [0847] Sui et al., PNAS USA 99(8):5515-5520, 2002. [0848]
Svoboda et al., Development, 127, 4147 (2000). [0849] Tanemura et
al., J. Neurosci., 22(1), 133-41 (2002). [0850] Tang et al., Genes
Dev., 17(1), 49-63 (2003). [0851] Ternin, H., "Retrovirus vectors
for gene transfer", in Gene Transfer, Kucherlapati R, Ed., pp
149-187, Plenum, (1986). [0852] Tijssen, Laboratory Techniques in
Biochemistry and Molecular Biology Hybridization with Nucleic Acid
Probes, part I chapter 2 "Overview of principles of hybridization
and the strategy of nucleic acid probe assays" Elsevier, New York
(1993). [0853] Timmons and Fire, Nature, 395, 854 (1998). [0854]
Trottier et al., Nature, 378(6555), 403-6 (1995). [0855] Turner et
al., Mol. Biotech., 3, 225 (1995). [0856] Tuschl, Nat. Biotechnol.,
20, 446-8 (2002). [0857] Urabe, M., et al., Hum. Gene Ther., 13,
1935-1943 (2002) [0858] Valerio et al., Gene, 84, 419 (1989).
[0859] Viera et al., Meth. Enzymol., 153, 3 (1987). [0860] Walker
and Gaastra, Techniques in Mol. Biol. (MacMillan Publishing Co.
(1983). [0861] Walker et al., Neurology, 58, 120-4 (2002). [0862]
Waterhouse et al., Proc. Natl. Acad. Sci. U.S.A., 95, 13959 (1998).
[0863] Waterhouse et al., Nature 411:834-842, 2001. [0864] Wianny
and Zernicka-Goetz, Nat. Cell Biol., 2, 70 (2000). [0865] Williams,
R. W. et al., J. Comp. Neurol., 278, 344-52 (1988) [0866] Xia et
al., Nat. Biotechnol., 19, 640 (2001). [0867] Xia et al., Nat.
Biotechnol., 20(10), 1006-10 (2002). [0868] Xiao et al., Exp Neurol
144:113-124, 1997. [0869] Yamamoto et al., Cell, 101(1), 57-66
(2000). [0870] Yang et al., Mol. Cell Biol., 21, 7807 (2001).
[0871] Yu et al., Proc. Natl. Acad. Sci., 99, 6047-6052 (2002).
[0872] Yu et al., J Neurosci 23:2193-2202, 2003. [0873] Zamore et
al., Cell, 101, 25 (2000). [0874] Zeng et al., RNA, 9:112-123
(2003) [0875] Zhou et al., J Cell Biol 163:109-118, 2003. [0876]
Zoghbi and Orr, Annu. Rev. Neurosci., 23, 217-47 (2000). [0877]
Zoghbi et al., Semin Cell Biol., 6, 29-35 (1995) [0878] Zu, T. et
al., In Preparation (2004)
Sequence CWU 1
1
146140DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1aaggtaccag atcttagtta ttaatagtaa tcaattacgg
40243DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2gaatcgatgc atgcctcgag acggttcact aaaccagctc tgc
43369DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3ctagaactag taataaagga tcctttattt
tcattggatc cgtgtgttgg ttttttgtgt 60gcggccgcg 69469DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4tcgacgcggc cgcacacaaa aaaccaacac acggatccaa
tgaaaataaa ggatccttta 60ttactagtt 69521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5cacaagctgg agtacaacta c 21622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6gtacttgtac tccagctttg tg 22728DNAHomo sapiens
7cagcagcagc agggggacct atcaggac 28828DNAHomo sapiens 8cagcagcagc
agcgggacct atcaggac 28917DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 9tatagtgagt cgtatta
171018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10taatacgact cactatag 181122DNAHomo sapiens
11cggcaagctg cgcatgaagt tc 221222DNAHomo sapiens 12atgaacttca
tgctcagctt gc 221322DNAHomo sapiens 13atgaacttca gggtcagctt gc
221422DNAHomo sapiens 14cggcaagctg accctgaagt tc 221522DNAHomo
sapiens 15cagcagcggg acctatcagg ac 221622DNAHomo sapiens
16ctgtcctgat aggtcccgct gc 221720DNAHomo sapiens 17cagcagcagg
gggacctatc 201820DNAHomo sapiens 18ctgataggtc cccctgctgc
201922DNAHomo sapiens 19cagcagccgg acctatcagg ac 222022DNAHomo
sapiens 20ctgtcctgat aggtccggct gc 222120DNAHomo sapiens
21cagcagcagc gggacctatc 202220DNAHomo sapiens 22ctgataggtc
ccgctgctgc 202321DNAHomo sapiens 23ttgaaaaaca gcagcaaaag c
212421DNAHomo sapiens 24ctgcttttgc tgctgttttt c 212522DNAHomo
sapiens 25cagcagcagc agcagcagca gc 222622DNAHomo sapiens
26ctgctgctgc tgctgctgct gc 222722DNAHomo sapiens 27tcgaagtgat
ggaagatcac gc 222822DNAHomo sapiens 28cagcgtgatc ttccatcact tc
222922DNAHomo sapiens 29cagccgggag tcgggaaggt gc 223022DNAHomo
sapiens 30ctgcaccttc ccgactcccg gc 223124DNAHomo sapiens
31acgtcctcgg cggcggcagt gtgc 243224DNAHomo sapiens 32ttgcacactg
ccgcctccgc ggac 243321DNAHomo sapiens 33acgtctccat ggcatctcag c
213421DNAHomo sapiens 34ttgctgagat gccatggaga c 213522DNAHomo
sapiens 35gtggccagat ggaagtaaaa tc 223622DNAHomo sapiens
36cagattttac ttccatctgg cc 223722DNAHomo sapiens 37gtggccacat
ggaagtaaaa tc 223822DNAHomo sapiens 38cagattttac ttccatgtgg cc
223922DNAHomo sapiens 39gtggccagat gcaagtaaaa tc 224022DNAHomo
sapiens 40cagattttac ttgcatctgg cc 224122DNAHomo sapiens
41gtggccaggt ggaagtaaaa tc 224222DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 42atgaacttca tgctcagctt gc 224322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 43cggcaagctg agcatgaagt tc
224422DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 44cagtggcttc
tggcacagca gc 224522DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
45aagctgctgt gccagaagcc ac 224642DNAHomo sapiens 46gtaagcagag
tggctgagga gatgacattt ttccccaaag ag 424721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 47cagagtggct gaggagatga c
214821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 48gtgtcatctc
ctcagccact c 214918DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
49cagagtggct gagatgac 185018DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 50atgtcatctc agccactc 185120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 51ctgagatgac atttttcccc 205220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 52ttggggaaaa atgtcatctc
205323DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 53gagtggctga
gatgacattt ttc 235423DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 54gggaaaaatg tcatctcagc cac 235539DNAHomo sapiens
55gtaagcagag tggctgagat gacatttttc cccaaagag 395621RNAHomo sapiens
56aagaaagaac uuucagcuac c 215721RNAHomo sapiens 57gguagcugaa
aguucuuucu u 21588RNAHomo sapiens 58gaagcuug 85956RNAHomo sapiens
59aagaaagaac uuucagcuac cgaagcuugg guagcugaaa guucuuucuu uuuuuu
566021DNAHomo sapiens 60aagaaagaac tttcagctac c 21618DNAHomo
sapiens 61gaagcttg 86221DNAHomo sapiens 62ggtagctgaa agttctttct t
216319DNAHomo sapiens 63agaactttca gctaccaag 196410DNAHomo sapiens
64cttcctgtca 106521DNAHomo sapiens 65cttggtagct gaaagttctt t
216619DNAHomo sapiens 66tgcctcaaca aagttatca 196721DNAHomo sapiens
67tgataacttt gttgaggcat t 216821DNAHomo sapiens 68cagcttgtcc
aggtttatga a 216921DNAHomo sapiens 69ttcataaacc tggacaagct g
217021DNAHomo sapiens 70gaccgtgtga atcattgtct a 217121DNAHomo
sapiens 71tagacaatga ttcacacggt c 217221DNAHomo sapiens
72tggcacagtc tgtcagaaat t 217321DNAHomo sapiens 73aatttctgac
agactgtgcc a 217421DNAHomo sapiens 74ctggaatgtt ccggagaatc a
217521DNAHomo sapiens 75tgattctccg gaacattcca g 217621DNAHomo
sapiens 76ttctcttctg tgattatgtc t 217721DNAHomo sapiens
77agacataatc acagaagaga a 217821DNAHomo sapiens 78gtccaccccc
tccatcattt a 217921DNAHomo sapiens 79taaatgatgg agggggtgga c
218021DNAHomo sapiens 80aagaaagacc gtgtgaatca t 218121DNAHomo
sapiens 81atgattcaca cggtctttct t 218221DNAHomo sapiens
82gggcatcgct atggaactgt t 218321DNAHomo sapiens 83aacagttcca
tagcgatgcc c 218421DNAHomo sapiens 84gccgctgcac cgaccaaaga a
218521DNAHomo sapiens 85ttctttggtc ggtgcagcgg c 218621DNAHomo
sapiens 86gaccctggaa aagctgatga a 218721DNAHomo sapiens
87ttcatcagct tttccagggt c 218821DNAHomo sapiens 88agctttgatg
gattctaatc t 218921DNAHomo sapiens 89agattagaat ccatcaaagc t
219021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 90aagaggagga
ggccgacgcc c 219121DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
91aagaaagaac tttcagctac c 219219DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 92agaactttca gctaccaag 199321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 93aaagaacttt cagctaccaa g
219419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 94tgcctcaaca
aagttatca 199521DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
95aatgcctcaa caaagttatc a 219621DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 96aagaaagaac tttcagctac c 219719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 97agaactttca gctaccaag
199821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 98aaagaacttt
cagctaccaa g 219919DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
99tgcctcaaca aagttatca 1910021DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 100aatgcctcaa caaagttatc a 2110121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 101gaggaagagg aggaggccga c
2110221DNAHomo sapiens 102ggacacaagg ctgagcagca g 2110351DNAHomo
sapiens 103cagcagcacc tcagcagggc tgcaggatta gtcaaccacc tcagcagggc t
511046DNAHomo sapiens 104actagt 610510DNAHomo sapiens 105cttcctgtca
1010621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 106gccagtaggc
tccaagtctt c 2110721DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
107caggaagccg tcatggcaac c 2110821DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 108aaccctggaa aagctgatga a 2110921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 109aaaagctgat gaaggctttc g
2111022DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 110aagtcgtttc
agcagcaaca gc 2211121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 111aacagcagca gcagccaccg c 2111221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 112tcaaccccct cagccgccgc c
2111321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 113agaggaaccg
ctgcaccgac c 2111421DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
114accgctgcac cgaccaaaga a 2111521DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 115ggaactctca gccaccaaga a 2111621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 116aagaaagacc gtgtgaatca t
2111721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 117gaccgtgtga
atcattgtct a 2111821DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
118gtctaacaat atgtgaaaac a 2111921DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 119tggcacagtc tctcagaaat t 2112021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 120gggcatcgct atggaactgt t
2112121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 121agtgcctcaa
caaagtcatc a 2112221DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
122agctttgatg gattctaatc t 2112321DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 123cagcagcagg tcaaggacac a 2112421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 124cagcttgtcc aggtttatga a
2112521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 125cctgccatgg
acctgaatga t 2112622DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
126catcttgaac tacatcgatc at 2212720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 127aactacatcg atcatggaga
2012821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 128ccaaggacaa
gctgatccag t 2112921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 129caaactgcat gatgtcctga a
2113021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 130ggatacctga
aatcctgctt t 2113121DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
131cgtgcagata agaatgctat t 2113221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 132aagtgggcca gttcagggaa t 2113321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 133gttcagggaa tcagaggcaa t
2113421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 134catcatggcc
agtggaagga a 2113521DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
135cagcagtgcc acaaggagaa t 2113621DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 136tgaagccctt ggagtgttaa a 2113721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 137agcccttgga gtgttaaata c
2113821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 138ctggaatgtt
ccggagaatc a 2113921DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
139gaatgtgcaa tagagaaata g 2114021DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA oligonucleotide transcribing
siRNA 140ttctcttctg tgattatgtc t 2114124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA
oligonucleotide transcribing siRNA 141gatgaggaag aagaggaaga aagt
2414221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 142gtccaccccc
tccatcattt a 211439493DNAHomo sapiens 143gctgccggga cgggtccaag
atggacggcc gctcaggttc tgcttttacc tgcggcccag 60cgccgcgagt cggcccgagg
cctccgggga ctgccgtgcc gggcgggaga ccgccatggc 120gaccctggaa
aagctgatga aggccttcga gtccctcaag tccttccagc agcaacagcc
180gccaccgccg ccgccgccgc cgccgcctcc tcagcttcct cagccgccgc
cgcaggcaca 240gccgctgctg cctcagccgc agccgccccc gccgccgccc
ccgccgccac ccggcccggc 300tgtggctgag gagccgctgc accgaccaaa
gaaagaactt tcagctacca agaaagaccg 360tgtgaatcat tgtctgacaa
tatgtgaaaa catagtggca cagtctgtca gaaattctcc 420agaatttcag
aaacttctgg gcatcgctat ggaacttttt ctgctgtgca gtgatgacgc
480agagtcagat gtcaggatgg tggctgacga atgcctcaac aaagttatca
aagctttgat 540ggattctaat cttccaaggt tacagctcga gctctataag
gaaattaaaa agaatggtgc 600ccctcggagt ttgcgtgctg ccctgtggag
gtttgctgag ctggctcacc tggttcggcc 660tcagaaatgc aggccttacc
tggtgaacct tctgccgtgc ctgactcgaa caagcaagag 720acccgaagaa
tcagtccagg agaccttggc tgcagctgtt cccaaaatta tggcttcttt
780tggcaatttt gcaaatgaca atgaaattaa ggttttgtta aaggccttca
tagcgaacct 840gaagtcaagc tcccccacca ttcggcggac agcggctgga
tcagcagtga gcatctgcca 900gcactcaaga aggacacaat atttctatag
ttggctacta aatgtgctct taggcttact 960cgttcctgtc gaggatgaac
actccactct gctgattctt ggcgtgctgc tcaccctgag 1020gtatttggtg
cccttgctgc agcagcaggt caaggacaca agcctgaaag gcagcttcgg
1080agtgacaagg aaagaaatgg aagtctctcc ttctgcagag cagcttgtcc
aggtttatga 1140actgacgtta catcatacac agcaccaaga ccacaatgtt
gtgaccggag ccctggagct 1200gttgcagcag ctcttcagaa cgcctccacc
cgagcttctg caaaccctga ccgcagtcgg 1260gggcattggg cagctcaccg
ctgctaagga ggagtctggt ggccgaagcc gtagtgggag 1320tattgtggaa
cttatagctg gagggggttc ctcatgcagc cctgtccttt caagaaaaca
1380aaaaggcaaa gtgctcttag gagaagaaga agccttggag gatgactctg
aatcgagatc 1440ggatgtcagc agctctgcct taacagcctc agtgaaggat
gagatcagtg gagagctggc 1500tgcttcttca ggggtttcca ctccagggtc
agcaggtcat gacatcatca cagaacagcc 1560acggtcacag cacacactgc
aggcggactc agtggatctg gccagctgtg acttgacaag 1620ctctgccact
gatggggatg aggaggatat cttgagccac agctccagcc aggtcagcgc
1680cgtcccatct gaccctgcca tggacctgaa tgatgggacc caggcctcgt
cgcccatcag 1740cgacagctcc cagaccacca ccgaagggcc tgattcagct
gttacccctt cagacagttc 1800tgaaattgtg ttagacggta ccgacaacca
gtatttgggc ctgcagattg gacagcccca 1860ggatgaagat gaggaagcca
caggtattct tcctgatgaa gcctcggagg ccttcaggaa 1920ctcttccatg
gcccttcaac aggcacattt attgaaaaac atgagtcact gcaggcagcc
1980ttctgacagc agtgttgata aatttgtgtt gagagatgaa gctactgaac
cgggtgatca 2040agaaaacaag ccttgccgca tcaaaggtga cattggacag
tccactgatg atgactctgc 2100acctcttgtc cattgtgtcc gccttttatc
tgcttcgttt ttgctaacag ggggaaaaaa 2160tgtgctggtt ccggacaggg
atgtgagggt cagcgtgaag gccctggccc tcagctgtgt 2220gggagcagct
gtggccctcc acccggaatc tttcttcagc aaactctata aagttcctct
2280tgacaccacg gaataccctg aggaacagta tgtctcagac atcttgaact
acatcgatca 2340tggagaccca caggttcgag gagccactgc cattctctgt
gggaccctca tctgctccat 2400cctcagcagg tcccgcttcc acgtgggaga
ttggatgggc accattagaa ccctcacagg 2460aaatacattt tctttggcgg
attgcattcc tttgctgcgg aaaacactga aggatgagtc 2520ttctgttact
tgcaagttag cttgtacagc tgtgaggaac tgtgtcatga gtctctgcag
2580cagcagctac agtgagttag gactgcagct gatcatcgat gtgctgactc
tgaggaacag 2640ttcctattgg ctggtgagga cagagcttct ggaaaccctt
gcagagattg acttcaggct 2700ggtgagcttt ttggaggcaa aagcagaaaa
cttacacaga ggggctcatc attatacagg 2760gcttttaaaa ctgcaagaac
gagtgctcaa taatgttgtc atccatttgc ttggagatga 2820agaccccagg
gtgcgacatg ttgccgcagc atcactaatt aggcttgtcc caaagctgtt
2880ttataaatgt gaccaaggac aagctgatcc agtagtggcc gtggcaagag
atcaaagcag 2940tgtttacctg aaacttctca tgcatgagac gcagcctcca
tctcatttct ccgtcagcac 3000aataaccaga atatatagag gctataacct
actaccaagc ataacagacg tcactatgga 3060aaataacctt tcaagagtta
ttgcagcagt ttctcatgaa ctaatcacat caaccaccag 3120agcactcaca
tttggatgct gtgaagcttt gtgtcttctt tccactgcct tcccagtttg
3180catttggagt ttaggttggc actgtggagt gcctccactg agtgcctcag
atgagtctag 3240gaagagctgt accgttggga tggccacaat gattctgacc
ctgctctcgt cagcttggtt 3300cccattggat ctctcagccc atcaagatgc
tttgattttg gccggaaact tgcttgcagc 3360cagtgctccc aaatctctga
gaagttcatg ggcctctgaa gaagaagcca acccagcagc 3420caccaagcaa
gaggaggtct ggccagccct gggggaccgg gccctggtgc ccatggtgga
3480gcagctcttc tctcacctgc tgaaggtgat taacatttgt gcccacgtcc
tggatgacgt 3540ggctcctgga cccgcaataa aggcagcctt gccttctcta
acaaaccccc cttctctaag 3600tcccatccga cgaaagggga aggagaaaga
accaggagaa caagcatctg taccgttgag 3660tcccaagaaa ggcagtgagg
ccagtgcagc ttctagacaa tctgatacct caggtcctgt 3720tacaacaagt
aaatcctcat cactggggag tttctatcat cttccttcat acctcaaact
3780gcatgatgtc ctgaaagcta cacacgctaa ctacaaggtc acgctggatc
ttcagaacag 3840cacggaaaag tttggagggt ttctccgctc agccttggat
gttctttctc agatactaga 3900gctggccaca ctgcaggaca ttgggaagtg
tgttgaagag atcctaggat acctgaaatc 3960ctgctttagt cgagaaccaa
tgatggcaac tgtttgtgtt caacaattgt tgaagactct 4020ctttggcaca
aacttggcct cccagtttga tggcttatct tccaacccca gcaagtcaca
4080aggccgagca cagcgccttg gctcctccag tgtgaggcca ggcttgtacc
actactgctt 4140catggccccg tacacccact tcacccaggc cctcgctgac
gccagcctga ggaacatggt 4200gcaggcggag caggagaacg acacctcggg
atggtttgat gtcctccaga aagtgtctac 4260ccagttgaag acaaacctca
cgagtgtcac aaagaaccgt gcagataaga atgctattca 4320taatcacatt
cgtttgtttg aacctcttgt tataaaagct ttaaaacagt acacgactac
4380aacatgtgtg cagttacaga agcaggtttt agatttgctg gcgcagctgg
ttcagttacg 4440ggttaattac tgtcttctgg attcagatca ggtgtttatt
ggctttgtat tgaaacagtt 4500tgaatacatt gaagtgggcc agttcaggga
atcagaggca atcattccaa acatcttttt 4560cttcttggta ttactatctt
atgaacgcta tcattcaaaa cagatcattg gaattcctaa 4620aatcattcag
ctctgtgatg gcatcatggc cagtggaagg aaggctgtga cacatgccat
4680accggctctg cagcccatag tccacgacct ctttgtatta agaggaacaa
ataaagctga 4740tgcaggaaaa gagcttgaaa cccaaaaaga ggtggtggtg
tcaatgttac tgagactcat 4800ccagtaccat caggtgttgg agatgttcat
tcttgtcctg cagcagtgcc acaaggagaa 4860tgaagacaag tggaagcgac
tgtctcgaca gatagctgac atcatcctcc caatgttagc 4920caaacagcag
atgcacattg actctcatga agcccttgga gtgttaaata cattatttga
4980gattttggcc ccttcctccc tccgtccggt agacatgctt ttacggagta
tgttcgtcac 5040tccaaacaca atggcgtccg tgagcactgt tcaactgtgg
atatcgggaa ttctggccat 5100tttgagggtt ctgatttccc agtcaactga
agatattgtt ctttctcgta ttcaggagct 5160ctccttctct ccgtatttaa
tctcctgtac agtaattaat aggttaagag atggggacag 5220tacttcaacg
ctagaagaac acagtgaagg gaaacaaata aagaatttgc cagaagaaac
5280attttcaagg tttctattac aactggttgg tattctttta gaagacattg
ttacaaaaca 5340gctgaaggtg gaaatgagtg agcagcaaca tactttctat
tgccaggaac taggcacact 5400gctaatgtgt ctgatccaca tcttcaagtc
tggaatgttc cggagaatca cagcagctgc 5460cactaggctg ttccgcagtg
atggctgtgg cggcagtttc tacaccctgg acagcttgaa 5520cttgcgggct
cgttccatga tcaccaccca cccggccctg gtgctgctct ggtgtcagat
5580actgctgctt gtcaaccaca ccgactaccg ctggtgggca gaagtgcagc
agaccccgaa 5640aagacacagt ctgtccagca caaagttact tagtccccag
atgtctggag aagaggagga 5700ttctgacttg gcagccaaac ttggaatgtg
caatagagaa atagtacgaa gaggggctct 5760cattctcttc tgtgattatg
tctgtcagaa cctccatgac tccgagcact taacgtggct 5820cattgtaaat
cacattcaag atctgatcag cctttcccac gagcctccag tacaggactt
5880catcagtgcc gttcatcgga actctgctgc cagcggcctg ttcatccagg
caattcagtc 5940tcgttgtgaa aacctttcaa ctccaaccat gctgaagaaa
actcttcagt gcttggaggg 6000gatccatctc agccagtcgg gagctgtgct
cacgctgtat gtggacaggc ttctgtgcac 6060ccctttccgt gtgctggctc
gcatggtcga catccttgct tgtcgccggg tagaaatgct 6120tctggctgca
aatttacaga gcagcatggc ccagttgcca atggaagaac tcaacagaat
6180ccaggaatac cttcagagca gcgggctcgc tcagagacac caaaggctct
attccctgct 6240ggacaggttt cgtctctcca ccatgcaaga ctcacttagt
ccctctcctc cagtctcttc 6300ccacccgctg gacggggatg ggcacgtgtc
actggaaaca gtgagtccgg acaaagactg 6360gtacgttcat cttgtcaaat
cccagtgttg gaccaggtca gattctgcac tgctggaagg 6420tgcagagctg
gtgaatcgga ttcctgctga agatatgaat gccttcatga tgaactcgga
6480gttcaaccta agcctgctag ctccatgctt aagcctaggg atgagtgaaa
tttctggtgg 6540ccagaagagt gccctttttg aagcagcccg tgaggtgact
ctggcccgtg tgagcggcac 6600cgtgcagcag ctccctgctg tccatcatgt
cttccagccc gagctgcctg cagagccggc 6660ggcctactgg agcaagttga
atgatctgtt tggggatgct gcactgtatc agtccctgcc 6720cactctggcc
cgggccctgg cacagtacct ggtggtggtc tccaaactgc ccagtcattt
6780gcaccttcct cctgagaaag agaaggacat tgtgaaattc gtggtggcaa
cccttgaggc 6840cctgtcctgg catttgatcc atgagcagat cccgctgagt
ctggatctcc aggcagggct 6900ggactgctgc tgcctggccc tgcagctgcc
tggcctctgg agcgtggtct cctccacaga 6960gtttgtgacc cacgcctgct
ccctcatcta ctgtgtgcac ttcatcctgg aggccgttgc 7020agtgcagcct
ggagagcagc ttcttagtcc agaaagaagg acaaataccc caaaagccat
7080cagcgaggag gaggaggaag tagatccaaa cacacagaat cctaagtata
tcactgcagc 7140ctgtgagatg gtggcagaaa tggtggagtc tctgcagtcg
gtgttggcct tgggtcataa 7200aaggaatagc ggcgtgccgg cgtttctcac
gccattgcta aggaacatca tcatcagcct 7260ggcccgcctg ccccttgtca
acagctacac acgtgtgccc ccactggtgt ggaagcttgg 7320atggtcaccc
aaaccgggag gggattttgg cacagcattc cctgagatcc ccgtggagtt
7380cctccaggaa aaggaagtct ttaaggagtt catctaccgc atcaacacac
taggctggac 7440cagtcgtact cagtttgaag aaacttgggc caccctcctt
ggtgtcctgg tgacgcagcc 7500cctcgtgatg gagcaggagg agagcccacc
agaagaagac acagagagga cccagatcaa 7560cgtcctggcc gtgcaggcca
tcacctcact ggtgctcagt gcaatgactg tgcctgtggc 7620cggcaaccca
gctgtaagct gcttggagca gcagccccgg aacaagcctc tgaaagctct
7680cgacaccagg tttgggagga agctgagcat tatcagaggg attgtggagc
aagagattca 7740agcaatggtt tcaaagagag agaatattgc cacccatcat
ttatatcagg catgggatcc 7800tgtcccttct ctgtctccgg ctactacagg
tgccctcatc agccacgaga agctgctgct 7860acagatcaac cccgagcggg
agctggggag catgagctac aaactcggcc aggtgtccat 7920acactccgtg
tggctgggga acagcatcac acccctgagg gaggaggaat gggacgagga
7980agaggaggag gaggccgacg cccctgcacc ttcgtcacca cccacgtctc
cagtcaactc 8040caggaaacac cgggctggag ttgacatcca ctcctgttcg
cagtttttgc ttgagttgta 8100cagccgctgg atcctgccgt ccagctcagc
caggaggacc ccggccatcc tgatcagtga 8160ggtggtcaga tcccttctag
tggtctcaga cttgttcacc gagcgcaacc agtttgagct 8220gatgtatgtg
acgctgacag aactgcgaag ggtgcaccct tcagaagacg agatcctcgc
8280tcagtacctg gtgcctgcca cctgcaaggc agctgccgtc cttgggatgg
acaaggccgt 8340ggcggagcct gtcagccgcc tgctggagag cacgctcagg
agcagccacc tgcccagcag 8400ggttggagcc ctgcacggcg tcctctatgt
gctggagtgc gacctgctgg acgacactgc 8460caagcagctc atcccggtca
tcagcgacta tctcctctcc aacctgaaag ggatcgccca 8520ctgcgtgaac
attcacagcc agcagcacgt actggtcatg tgtgccactg cgttttacct
8580cattgagaac tatcctctgg acgtagggcc ggaattttca gcatcaataa
tacagatgtg 8640tggggtgatg ctgtctggaa gtgaggagtc caccccctcc
atcatttacc actgtgccct 8700cagaggcctg gagcgcctcc tgctctctga
gcagctctcc cgcctggatg cagaatcgct 8760ggtcaagctg agtgtggaca
gagtgaacgt gcacagcccg caccgggcca tggcggctct 8820gggcctgatg
ctcacctgca tgtacacagg aaaggagaaa gtcagtccgg gtagaacttc
8880agaccctaat cctgcagccc ccgacagcga gtcagtgatt gttgctatgg
agcgggtatc 8940tgttcttttt gataggatca ggaaaggctt tccttgtgaa
gccagagtgg tggccaggat 9000cctgccccag tttctagacg acttcttccc
accccaggac atcatgaaca aagtcatcgg 9060agagtttctg tccaaccagc
agccataccc ccagttcatg gccaccgtgg tgtataaggt 9120gtttcagact
ctgcacagca ccgggcagtc gtccatggtc cgggactggg tcatgctgtc
9180cctctccaac ttcacgcaga gggccccggt cgccatggcc acgtggagcc
tctcctgctt 9240ctttgtcagc gcgtccacca gcccgtgggt cgcggcgatc
ctcccacatg tcatcagcag 9300gatgggcaag ctggagcagg tggacgtgaa
ccttttctgc ctggtcgcca cagacttcta 9360cagacaccag atagaggagg
agctcgaccg cagggccttc cagtctgtgc ttgaggtggt 9420tgcagcccca
ggaagcccat atcaccggct gctgacttgt ttacgaaatg tccacaaggt
9480caccacctgc tga 94931449998DNAMus musculusmodified_base(9800)a,
c, t, g, unknown or other 144cccattcatt gccttgctgc taagtggcgc
cgcgtagtgc cagtaggctc caagtcttca 60gggtctgtcc catcgggcag gaagccgtca
tggcaaccct ggaaaagctg atgaaggctt 120tcgagtcgct caagtcgttt
cagcagcaac agcagcagca gccaccgccg cagccgccgc 180caccgccgcc
gccgcctccg cctcaacccc ctcagccgcc gcctcagggg cagccgccgc
240cgccaccacc gccgctgcca ggtccggcag aggaaccgct gcaccgacca
aagaaggaac 300tctcagccac caagaaagac cgtgtgaatc attgtctaac
aatatgtgaa aacattgtgg 360cacagtctct cagaaattct ccagaatttc
agaaactctt gggcatcgct atggaactgt 420ttctgctgtg cagtgacgat
gcggagtcag atgtcagaat ggtggctgat gagtgcctca 480acaaagtcat
caaagctttg atggattcta atcttccaag gctacagtta gaactctata
540aggaaattaa aaagaatggt gctcctcgaa gtttgcgtgc tgccctgtgg
aggtttgctg 600agctggctca cctggttcga cctcagaagt gcaggcctta
cctggtgaat cttcttccat 660gcctgacccg aacaagcaaa agaccggagg
aatcagttca ggagaccttg gctgcagctg 720ttcctaaaat tatggcttct
tttggcaatt tcgcaaatga caatgaaatt aaggttctgt 780tgaaagcttt
catagcaaat ctgaagtcaa gctctcccac cgtgcggcgg acagcagccg
840gctcagccgt gagcatctgc caacattcta ggaggacaca gtacttctac
aactggctcc 900ttaatgtcct cctaggtctg ctggttccca tggaagaaga
gcactccact ctcctgatcc 960tcggtgtgtt gctcacattg aggtgtctag
tgcccttgct ccagcagcag gtcaaggaca 1020caagtctaaa aggcagcttt
ggggtgacac ggaaagaaat ggaagtctct ccttctacag 1080agcagcttgt
ccaggtttat gaactgactt tgcatcatac tcagcaccaa gaccacaatg
1140tggtgacagg ggcactggag ctcctgcagc agctcttccg tacccctcca
cctgaactcc 1200tgcaagcact gaccacacca ggagggcttg ggcagctcac
tctggttcaa gaagaggccc 1260ggggccgagg ccgcagcggg agcatcgtgg
agcttttagc tggagggggt tcctcgtgca 1320gccctgtcct ctcaagaaag
cagaaaggca aagtgctctt aggagaggaa gaagccttgg 1380aagatgactc
ggagtccaga tcagatgtca gcagctcagc ctttgcagcc tctgtgaaga
1440gtgagattgg tggagagctc gctgcttctt caggtgtttc cactcctggt
tctgttggtc 1500acgacatcat cactgagcag cctagatccc agcacacact
tcaagcagac tctgtggatt 1560tgtccggctg tgacctgacc agtgctgcta
ctgatgggga tgaggaggac atcttgagcc 1620acagctccag ccagttcagt
gctgtcccat ccgaccctgc catggacctg aatgatggga 1680cccaggcctc
ctcacccatc agtgacagtt ctcagaccac cactgaagga cctgattcag
1740ctgtgactcc ttcggacagt tctgaaattg tgttagatgg tgccgatagc
cagtatttag 1800gcatgcagat aggacagcca caggaggacg atgaggaggg
agctgcaggt gttctttctg 1860gtgaagtctc agatgttttc agaaactctt
ctctggccct tcaacaggca cacttgttgg 1920aaagaatggg ccatagcagg
cagccttccg acagcagtat agataagtat gtaacaagag 1980atgaggttgc
tgaagccagt gatccagaaa gcaagccttg ccgaatcaaa ggtgacatag
2040gacagcctaa tgatgatgat tctgctcctc tggtacattg tgtccgtctt
ttatctgctt 2100cctttttgtt aactggtgaa aagaaagcac tggttccaga
cagagacgtg agagtcagtg 2160tgaaggccct ggccctcagc tgcattggtg
cggctgtggc ccttcatcca gagtcgttct 2220tcagcagact gtacaaagta
cctcttaata ccacggaaag tactgaggaa cagtatgttt 2280ctgacatctt
gaactacatc gatcatggag acccacaggt ccgaggagct actgccattc
2340tctgtgggac ccttgtctac tccatcctca gtaggtcccg tctccgtgtt
ggtgagtggc 2400tgggcaacat cagaaccctg acaggaaata cattttctct
ggtggactgc attcctttac 2460tgcagaaaac gttgaaggat gaatcttctg
ttacttgcaa gttggcttgt acagctgtga 2520ggcactgtgt cctgagtctt
tgcagcagca gctacagtga cttgggatta caactgctta 2580ttgatatgct
gcctctgaag aacagctcct actggctggt gaggaccgaa ctgctggaca
2640ctctggcaga gattgacttc aggctcgtga gttttttgga ggcaaaagca
gaaagtttac 2700accgaggggc tcatcattat acagggtttc taaaactaca
agaacgagta ctcaataatg 2760tggtcattta tttgcttgga gatgaagacc
ccagggttcg acatgttgct gcaacatcat 2820taacaaggct tgtcccaaag
ctgttttaca agtgtgacca aggacaagct gatccagttg 2880tggctgtagc
gagggatcag agcagtgtct acctgaagct cctcatgcat gagacccagc
2940caccatcaca cttttctgtc agcaccatca ccagaatcta tagaggctat
agcttactgc 3000caagtataac agatgtcacc atggaaaaca atctctcaag
agttgttgcc gcagtttctc 3060atgaactcat tacgtcaaca acacgggcac
tcacatttgg atgctgtgaa gccttgtgtc 3120ttctctcagc agcctttcca
gtttgcactt ggagtttagg atggcactgt ggagtgcccc 3180cactgagtgc
ctctgatgag tccaggaaga gctgcactgt tgggatggcc tccatgattc
3240tcaccttgct ttcatcagct tggttcccac tggatctctc agcccatcag
gatgccttga 3300ttttggctgg aaacttgcta gcagcgagtg cccccaagtc
tctgagaagt tcatggacct 3360ctgaagaaga agccaactca gcagccacca
gacaggagga aatctggcct gctctggggg 3420atcggactct agtgcccttg
gtggagcagc ttttctccca cctgctgaag gtgatcaata 3480tctgtgctca
tgtcttggac gatgtgactc ctggaccagc aatcaaggca gccttgcctt
3540ctctaacaaa ccccccttct ctaagtccta ttcgacggaa agggaaggag
aaagaacctg 3600gagaacaagc ttctactcca atgagtccca agaaagttgg
tgaggccagt gcagcctctc 3660gacaatcaga cacctcagga cctgtcacag
caagtaaatc atcctcactg gggagtttct 3720accatctccc ctcctacctc
aaactgcatg atgtcctgaa agccactcac gccaactata 3780aggtcacctt
agatcttcag aacagcactg aaaagtttgg ggggttcctg cgctctgcct
3840tggacgtcct ttctcagatt ctagagctgg cgacactgca ggacattgga
aagtgtgttg 3900aagaggtcct tggatacctg aaatcctgct ttagtcgaga
accaatgatg gcaactgtct 3960gtgtgcagca gctattgaag actctctttg
ggacaaactt agcctcacag tttgatggct 4020tatcttccaa ccccagcaag
tctcagtgcc gagctcagcg ccttggctct tcaagtgtga 4080ggcccggctt
atatcactac tgcttcatgg caccatacac gcacttcaca caggccttgg
4140ctgacgcaag cctgaggaac atggtgcagg cggagcagga gcgtgatgcc
tcggggtggt 4200ttgatgtact ccagaaagtg tctgcccaat tgaagacgaa
cctaacaagc gtcacaaaga 4260accgtgcaga taagaatgct attcataatc
acattaggtt atttgagcct cttgttataa 4320aagcattgaa gcagtacacc
acgacaacat ctgtacaatt gcagaagcag gttttggatt 4380tgctggcaca
gctggttcag ctacgggtca attactgtct actggattca gaccaggtgt
4440tcatcgggtt tgtgctgaag cagtttgagt acattgaagt gggccagttc
agggaatcag 4500aggcaattat tccaaatata tttttcttcc tggtattact
gtcttatgag cgctaccatt 4560caaaacagat cattggaatt cctaaaatca
tccagctgtg tgatggcatc atggccagtg 4620gaaggaaggc cgttacacat
gctatacctg ctctgcagcc cattgtccat gacctctttg 4680tgttacgagg
aacaaataaa gctgatgcag ggaaagagct tgagacacag aaggaggtgg
4740tggtctccat gctgttacga ctcatccagt accatcaggt gctggagatg
ttcatccttg 4800tcctgcagca gtgccacaag gagaatgagg acaagtggaa
acggctctct cggcaggtcg 4860cagacatcat cctgcccatg ttggccaagc
agcagatgca tattgactct catgaagccc 4920ttggagtgtt aaataccttg
tttgagattt tggctccttc ctccctacgt cctgtggaca 4980tgcttttgcg
gagtatgttc atcactccaa gcacaatggc atctgtaagc actgtgcagc
5040tgtggatatc tggaatcctc gccattctga gggttctcat ttcccagtca
accgaggaca 5100ttgttctttg tcgtattcag gagctctcct tctctccaca
cttgctctcc tgtccagtga 5160ttaacaggtt aaggggtgga ggcggtaatg
taacactagg agaatgcagc gaagggaaac 5220aaaagagttt gccagaagat
acattctcaa ggtttctttt acagctggtt ggtattcttc 5280tagaagacat
cgttacaaaa cagctcaaag tggacatgag tgaacagcag catacgttct
5340actgccaaga gctaggcaca ctgctcatgt gtctgatcca catattcaaa
tctggaatgt 5400tccggagaat cacagcagct gccactagac tcttcaccag
tgatggctgt gaaggcagct 5460tctatactct agagagcctg aatgcacggg
tccgatccat ggtgcccacg cacccagccc 5520tggtactgct ctggtgtcag
atcctacttc tcatcaacca cactgaccac cggtggtggg 5580cagaggtgca
gcagacaccc aagagacaca gtctgtcctg cacgaagtca cttaaccccc
5640agaagtctgg cgaagaggag gattctggct cggcagctca gctgggaatg
tgcaatagag 5700aaatagtgcg aagaggggcc cttattctct tctgtgatta
tgtctgtcag aatctccatg 5760actcagaaca cttaacatgg ctcattgtga
atcacattca agatctgatc agcttgtctc 5820atgagcctcc agtacaagac
tttattagtg ccattcatcg taattctgca gctagtggtc 5880tttttatcca
ggcaattcag tctcgctgtg aaaatctttc aacgccaacc actctgaaga
5940aaacacttca gtgcttggaa ggcatccatc tcagccagtc tggtgctgtg
ctcacactat 6000atgtggacag gctcctgggc acccccttcc gtgcgctggc
tcgcatggtc gacaccctgg 6060cctgtcgccg ggtagaaatg cttttggctg
caaatttaca gagcagcatg gcccagttgc 6120cagaggagga actaaacaga
atccaagaac acctccagaa cagtgggctt gcacaaagac 6180accaaaggct
ctattcactg ctggacagat tccgactctc tactgtgcag gactcactta
6240gccccttgcc cccagtcact tcccacccac tggatgggga tgggcacaca
tctctggaaa 6300cagtgagtcc agacaaagac tggtacctcc agcttgtcag
atcccagtgt tggaccagat 6360cagattctgc actgctggaa ggtgcagagc
tggtcaaccg tatccctgct gaagatatga 6420atgacttcat gatgagctcg
gagttcaacc taagcctttt ggctccctgt ttaagccttg 6480gcatgagcga
gattgctaat ggccaaaaga gtcccctctt tgaagcagcc cgtggggtga
6540ttctgaaccg ggtgaccagt gttgttcagc agcttcctgc tgtccatcaa
gtcttccagc 6600ccttcctgcc tatagagccc acggcctact ggaacaagtt
gaatgatctg cttggtgata 6660ccacatcata ccagtctctg accatacttg
cccgtgccct ggcacagtac ctggtggtgc 6720tctccaaagt gcctgctcat
ttgcaccttc ctcctgagaa ggagggggac acggtgaagt 6780ttgtggtaat
gacagttgag gccctgtcat ggcatttgat ccatgagcag atcccactga
6840gtctggacct ccaagccggg ctagactgct gctgcctggc actacaggtg
cctggcctct 6900ggggggtgct gtcctcccca gagtacgtga ctcatgcctg
ctccctcatc cattgtgtgc 6960gattcatcct ggaagccatt gcagtacaac
ctggagacca gcttctcggt cctgaaagca 7020ggtcacatac tccaagagct
gtcagaaagg aggaagtaga ctcagatata caaaacctca 7080gtcatgtcac
ttcggcctgc gagatggtgg cagacatggt ggaatccctg cagtcagtgc
7140tggccttggg ccacaagagg aacagcaccc tgccttcatt tctcacagct
gtgctgaaga 7200acattgttat cagtctggcc cgactccccc tagttaacag
ctatactcgt gtgcctcctc 7260tggtatggaa actcgggtgg tcacccaagc
ctggagggga ttttggcaca gtgtttcctg 7320agatccctgt agagttcctc
caggagaagg agatcctcaa ggagttcatc taccgcatca 7380acaccctagg
gtggaccaat cgtacccagt tcgaagaaac ttgggccacc ctccttggtg
7440tcctggtgac tcagcccctg gtgatggaac aggaagagag cccaccagag
gaagacacag 7500aaagaaccca gatccatgtc ctggctgtgc aggccatcac
ctctctagtg ctcagtgcaa 7560tgaccgtgcc tgtggctggc aatccagctg
taagctgctt ggagcaacag ccccggaaca 7620agccactgaa ggctctcgat
accagatttg gaagaaagct gagcatgatc agagggattg 7680tagaacaaga
aatccaagag atggtttccc agagagagaa tactgccact caccattctc
7740accaggcgtg ggatcctgtc ccttctctgt taccagctac tacaggtgct
cttatcagcc 7800atgacaagct gctgctgcag atcaacccag agcgggagcc
aggcaacatg agctacaagc 7860tgggccaggt gtccatacac tccgtgtggc
tgggaaataa catcacaccc ctgagagagg 7920aggaatggga tgaggaagaa
gaggaagaaa gtgatgtccc tgcaccaacg tcaccacctg 7980tgtctccagt
caattccaga aaacaccgtg ccggggttga tattcactcc tgttcgcagt
8040ttctgcttga attgtacagc cgatggatcc tgccatccag tgcagccaga
aggacccccg 8100tcatcctgat cagtgaagtg gttcgatctc ttcttgtagt
gtcagactta ttcaccgaac 8160gtacccagtt tgaaatgatg tatctgacgc
tgacagaact acggagagtg cacccttcag 8220aagatgagat cctcattcag
tacctggtgc ctgccacctg taaggcagct gctgtccttg 8280gaatggacaa
aactgtggca gagccagtca gccgcctact ggagagcaca ctgaggagca
8340gccacctgcc cagccagatc ggagccctgc acggcatcct ctatgtgttg
gagtgtgacc 8400tcttggatga cactgcaaag cagctcattc cagttgttag
tgactatctg ctgtccaacc 8460tcaaaggaat agcccactgc gtgaacattc
acagccagca gcatgtgctg gtaatgtgtg 8520ccactgcttt ctacctgatg
gaaaactacc ctctggatgt gggaccagaa ttttcagcat 8580ctgtgataca
gatgtgtgga gtaatgctgt ctggaagtga ggagtccacc ccctccatca
8640tttaccactg tgccctccgg ggtctggagc ggctcctgct gtctgagcag
ctatctcggc 8700tagacacaga gtccttggtc aagctaagtg tggacagagt
gaatgtacaa agcccacaca 8760gggccatggc agccctaggc ctgatgctca
cctgcatgta cacaggaaag gaaaaagcca 8820gtccaggcag agcttctgac
cccagccctg ctacacctga cagcgagtct gtgattgtag 8880ctatggagcg
agtgtctgtt ctctttgata ggatccgcaa gggatttccc tgtgaagcca
8940gggttgtggc aaggatcctg cctcagttcc tagatgactt ctttccacct
caagatgtca 9000tgaacaaagt cattggagag ttcctgtcca atcagcagcc
atacccacag ttcatggcca 9060ctgtagttta caaggttttt cagactctgc
acagtgctgg gcagtcatcc atggtccggg 9120actgggtcat gctgtccctg
tccaacttca cacaaagaac tccagttgcc atggccatgt 9180ggagcctctc
ctgcttcctt gttagcgcat ctaccagccc atgggtttct gcgatccttc
9240cacatgtcat cagcaggatg ggcaaactgg aacaggtgga tgtgaacctt
ttctgcctgg 9300ttgccacaga cttctacaga caccagatag aggaggaatt
cgaccgcagg gctttccagt 9360ctgtgtttga ggtggtggct gcaccaggaa
gtccatacca caggctgctt gcttgtttgc 9420aaaatgttca caaggtcacc
acctgctgag tagtgcctgt gggacaaaag gctgaaagaa 9480ggcagctgct
ggggcctgag cctccaggag cctgctccaa gcttctgctg gggctgcctt
9540ggccgtgcag gcttcacttg tgtcaagtgg acagccaggc aatggcagga
gtgctttgca 9600atgagggcta tgcagggaac atgcactatg ttggggttga
gcctgagtcc tgggtcctgg 9660cctcgctgca gctggtgaca gtgctaggtt
gaccaggtgt ttgtcttttt cctagtgttc 9720ccctggccat agtcgccagg
ttgcagctgc cctggtatgt ggatcagaag tcctagctcc 9780tgccagatgg
ttctgagccn gcctgctcca ctgggctgga gagctccctc ccacatttac
9840ccagtaggca tacctgccac accagtgtct ggacacaaat gaatggtgtg
tggggctggg 9900aactggggct gccaggtgtc cagcaccatt ttcctttctg
tgttttcttc tcaggagtta 9960aaatttaatt atatcagtaa agagattaat tttaatgt
999814521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA oligonucleotide transcribing siRNA 145aagaaggaac
tctcagccac c 2114624DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA oligonucleotide transcribing siRNA
146aagaagagga agaaagtgat gtcc 24
* * * * *