U.S. patent application number 15/043713 was filed with the patent office on 2016-09-22 for photoinduced electron transfer (pet) primer for nucleic acid amplification.
This patent application is currently assigned to THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF. The applicant listed for this patent is THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF, THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF. Invention is credited to Vincent Hill, Jothikumar Narayanan.
Application Number | 20160273036 15/043713 |
Document ID | / |
Family ID | 40365372 |
Filed Date | 2016-09-22 |
United States Patent
Application |
20160273036 |
Kind Code |
A1 |
Narayanan; Jothikumar ; et
al. |
September 22, 2016 |
PHOTOINDUCED ELECTRON TRANSFER (PET) PRIMER FOR NUCLEIC ACID
AMPLIFICATION
Abstract
This application provides photoinduced electron transfer (PET)
nucleic acid molecules that can be used detect and amplify nucleic
acid molecules, such as target nucleic acid molecules. These PET
tags can be attached to the 5'-end of a target sequence-specific
primer, thereby generating a PET primer. In particular examples, a
PET tag includes a 5'-labeled nucleotide that can be quenched by at
least two consecutive Gs within the tag sequence, and is unquenched
when the PET tag hybridizes with its complementary nucleic acid
molecule. Also disclosed are methods of using PET primers in
nucleic acid amplification, such as real-time PCR.
Inventors: |
Narayanan; Jothikumar;
(Atlanta, GA) ; Hill; Vincent; (Decatur,
GA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY
THE SECRETARY OF THE DEPARTMENT OF |
Atlanta |
GA |
US |
|
|
Assignee: |
THE GOVERNMENT OF THE UNITED STATES
OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT
OF
Atlanta
GA
|
Family ID: |
40365372 |
Appl. No.: |
15/043713 |
Filed: |
February 15, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12743607 |
May 19, 2010 |
9260746 |
|
|
PCT/US2008/084347 |
Nov 21, 2008 |
|
|
|
15043713 |
|
|
|
|
60989768 |
Nov 21, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6818 20130101;
C12Q 1/6827 20130101; C12Q 2600/156 20130101; C12Q 1/6876 20130101;
C12Q 1/6827 20130101; C12Q 1/6844 20130101; C12Q 2565/1015
20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of making a labeled sequence-specific primer,
comprising: adding a photoinduced electron transfer (PET) tag to a
sequence-specific primer, thereby generating a labeled
sequence-specific primer, wherein the PET tag comprises the nucleic
acid sequence 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ
ID NO: 1), wherein X.sub.1 is a 5'-end labeled nucleotide, wherein
X.sub.2 and X.sub.4 comprise a stem of a stem-loop and are
nucleotide sequences of length a, wherein a is 3 or more
nucleotides and wherein X.sub.2 is at least 60% complementary to
X.sub.4, wherein X.sub.3 comprises a loop of the stem-loop, and
wherein G.sub.x comprises at least two consecutive G nucleotides;
wherein the stem-loop brings the label on the 5'-end-labeled
nucleotide and the at least two consecutive G nucleotides into
proximity, thereby quenching a detectable signal from the
5'-end-labeled nucleotide in the absence of a target nucleic acid
sequence; wherein the sequence-specific primer can hybridize to the
target nucleic acid sequence; wherein the PET tag does not
substantially hybridize to the target nucleic acid sequence
recognized by the sequence-specific primer; and wherein the
detectable signal from the 5'-end-labeled nucleotide is unquenched
when the labeled sequence-specific primer is incorporated into an
amplicon.
2. The method of claim 1, wherein the PET tag comprises the
sequence 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.xX.sub.5(n)-3'
(SEQ ID NO: 2), wherein X.sub.5(n) comprises one or more
nucleotides.
3. The method of claim 1, wherein X.sub.1 is not G.
4. The method of claim 1, wherein X.sub.2 has at least 80%
complementarity to X.sub.4.
5. The method of claim 4, wherein X.sub.2 is 100% complementarity
to X.sub.4.
6. The method of claim 1, wherein X.sub.3 is 3 or more
nucleotides.
7. The method of claim 1, wherein X.sub.3 is a trinucleotide
sequence selected from the group consisting of TAA, ATA, AAT, TTA,
TAT, ATT, TTT and AAA.
8. The method of claim 1, wherein X.sub.3 does not include C or G
nucleotides.
9. The method of claim 1, wherein the label is a fluorophore.
10. The method of claim 1, wherein the PET tag is 12 to 20
nucleotides in length.
11. The method of claim 1, wherein a 5'-end of the
sequence-specific primer is attached to the 3'-end of the PET
tag.
12. A labeled sequence-specific primer generated using the method
of claim 1.
13. A kit comprising: the labeled sequence-specific primer of claim
12; and a buffer.
14. A method of detecting a target nucleic acid molecule
comprising: incubating a sample comprising the target nucleic acid
molecule with a forward primer comprising a sequence homologous to
the target nucleic acid molecule and a reverse primer comprising a
sequence homologous to the target nucleic acid molecule under
conditions sufficient to allow amplification of the target nucleic
acid molecule; amplifying the target nucleic acid molecule using
real-time polymerase chain reaction (PCR), thereby generating a
labeled amplicon; denaturing the labeled amplicon; generating a
melting curve; and detecting a signal from the label, wherein the
forward primer or the reverse primer is linked at its 5'-end to the
3'-end of a photoinduced electron transfer (PET) tag, wherein the
PET tag comprises the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ ID NO: 1),
wherein X.sub.1 is a 5'-end labeled nucleotide, wherein X.sub.2 and
X.sub.4 comprise a stem of a stem-loop and are nucleotide sequences
of length a, wherein a is 3 or more nucleotides and wherein X.sub.2
is at least 60% complementary to X.sub.4, wherein X.sub.3 comprises
a loop of the stem-loop, and wherein G.sub.x comprises at least two
consecutive G nucleotides, wherein the stem-loop brings the label
on the 5'-end-labeled nucleotide and the at least two consecutive G
nucleotides into proximity, thereby quenching a detectable signal
from the 5'-end-labeled nucleotide in the absence of a target
nucleic acid sequence, and wherein the PET tag does not
substantially hybridize to the target nucleic acid sequence
recognized by the forward and reverse primers, and wherein the
detectable signal from the 5'-end-labeled nucleotide is unquenched
when the labeled forward or reverse primer is incorporated into the
labeled amplicon, wherein an increase in signal detected during the
real-time PCR indicates that the target nucleic acid molecule is
present in the sample and wherein no significant increase in signal
detected during the real-time PCR indicates that the target
molecule is not present in the sample, and wherein a single peak
detected during generating the melting curve indicates that the
target nucleic acid molecule is present in the sample and wherein
no single peak detected during generating the melting curve
indicates that the target molecule is not present in the
sample.
15. The method of claim 14, further comprising quantifying the
signal from the label.
16. The method of claim 14, wherein the forward primer is linked at
its 5'-end to the 3'-end portion of the PET tag and wherein the
reverse primer is not linked to the PET tag.
17. The method of claim 14, wherein the reverse primer is linked at
its 5'-end to the 3'-end portion of the PET tag and wherein the
forward primer is not linked to the PET tag.
18. A method of detecting a polymorphism in a target nucleic acid
molecule comprising: incubating a sample comprising the target
nucleic acid molecule with a forward primer and a reverse primer,
wherein the forward primer or the reverse primer is linked at its
5'-end to the 3'-end of a PET tag under conditions sufficient to
allow amplification of the target nucleic acid molecule, thereby
generating a labeled amplicon, wherein the PET tag comprises the
sequence 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ ID
NO: 1), wherein X.sub.1 is a 5'-end labeled nucleotide, wherein
X.sub.2 and X.sub.4 comprise a stem of a stem-loop and are
nucleotide sequences of length a, wherein a is 3 or more
nucleotides and wherein X.sub.2 is at least 60% complementary to
X.sub.4, wherein X.sub.3 comprises a loop of the stem-loop, and
wherein G.sub.x comprises at least two consecutive G nucleotides,
wherein the stem-loop brings the label on the 5'-end-labeled
nucleotide and the at least two consecutive G nucleotides into
proximity, thereby quenching a detectable signal from the
5'-end-labeled nucleotide in the absence of a target nucleic acid
sequence, and wherein the PET nucleic acid sequence does not
substantially hybridize to the target nucleic acid sequence
recognized by the forward and reverse primers, and wherein the
detectable signal from the 5'-end-labeled nucleotide is unquenched
when the labeled forward or reverse primer is incorporated into an
amplicon; and detecting a change in signal from the label while
exposing the labeled amplicon to conditions that permit
denaturation of the amplicon into single-stranded nucleic acid
molecules, wherein the change in signal is directly proportional to
the extent of amplicon denaturation, and wherein differences in the
extent of amplicon denaturation represent a polymorphism in the
target nucleic acid.
19. The method of claim 18, wherein the forward primer is linked at
its 5'-end to the 3'-end of the PET tag and wherein the reverse
primer is not linked to the PET tag.
20. The method of claim 18, wherein the reverse primer is linked at
its 5'-end to the 3'-end of the PET tag and wherein the forward
primer is not linked to the PET tag.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/743,607 filed on May 19, 2010, which is the
U.S. National Stage of International Application No.
PCT/US2008/084347, filed Nov. 21, 2008, which claims the benefit of
the earlier filing date of U.S. Provisional Application No.
60/989,768, filed on Nov. 21, 2007, which are incorporated herein
by reference.
FIELD
[0002] The present disclosure relates to labeled nucleic acid
primers and methods of their use, for example to detect or amplify
a target nucleic acid molecule.
BACKGROUND
[0003] The real-time polymerase chain reaction (PCR) is currently
used as a diagnostic tool in clinical applications, and can be used
to obtain quantitative results. The chemistry of real-time PCR is
based on monitoring fluorescence at every cycle at a set
temperature that facilitates calculating the kinetics of the
product formed and performing melting curve analysis to identify
formation of the specific product. Fluorescence is usually
monitored using an optical device to collect the data at specific
excitation and emission wavelengths for the particular fluorophore
present in the sample.
[0004] One method used to monitor nucleic acid amplification is the
addition of intercalating dyes, such as SYBR Green I dye (Ririe et
al., Anal. Biochem. 245:154-60, 1997) and LCGreen (Wittwer et al.,
Clin. Chem. 49:853-60, 2003) during PCR. During amplification,
these dyes are excited with the appropriate wavelength of light,
inducing fluorescence when the dye intercalates into a DNA double
helix. However, this method does not allow for multiplex
reactions.
[0005] Specificity can be increased by using a labeled
sequence-specific probe. Several of such methods are currently
available for performing real-time PCR, such as TaqMan.RTM. probes
(Lee et al., Nucleic Acids Res. 21:3761-6, 1993); molecular beacons
(Tyagi and Kramer, Nat. Biotechnol. 14:303-8, 1996); self-probing
amplicons (scorpions) (Whitcombe et al., Nat. Biotechnol. 17:804-7,
1999); Amplisensor (Chen et al., Appl. Environ. Microbiol.
64:4210-6, 1998); Amplifluor (Nazarenko et al., Nucleic Acids Res.
25:2516-21, 1997 and U.S. Pat. No. 6,117,635); displacement
hybridization probes (Li et al., Nucleic Acids Res. 30:E5, 2002);
DzyNA-PCR (Todd et al., Clin. Chem. 46:625-30, 2000); fluorescent
restriction enzyme detection (Cairns et al. Biochem. Biophys. Res.
Commun. 318:684-90, 2004); and adjacent hybridization probes
(Wittwer et al., Biotechniques 22:130-1, 134-8, 1997).
[0006] Some currently available labeled primers can have a
secondary structure that is complex and in some instances must be
synthesized using specialized procedures. For example, LUX.TM.
primers (Invitrogen Corp.) are fluorescently labeled on the 3'-end
and have a stem-loop structure that must be denatured for the
primer to work efficiently (especially for reverse transcription).
The design of the LUX.TM. primer is also a time-consuming step,
which requires specific software.
[0007] Several publications disclose probes that contain only one
fluorophore for use in detecting the presence of a particular
nucleic acid [for example see U.S. Pat. No. 6,699,661; U.S. Pat.
No. 6,495,326; and U.S. Pat. No. 6,492,121 (all to Kurane et al.);
U.S. Pat. No. 6,635,427 (Wittwer et al.); Kurata et al. (Nucl.
Acids Res. 29:E34, 2001); Torimura et al. (Analyt. Sci. 17:155-60,
2001); and Crockett et al. (Analyt. Biochem. 290:89-97, 2001)]. In
these examples, the fluorescent signal is either enhanced or
quenched in the presence of the target nucleic acid sequence,
depending on the particular design of the probe. In most cases, the
labeled primer specifically hybridizes to the target nucleic acid
sequence. Similarly, Tam-Chang (Analyt. Biochem. 366:126-130, 2007)
discloses a multi-probe universal reporter system containing a
signal that is enhanced only after sequence-specific hybridization
of one of the probes. Guo and Milewicz (Biotech. Lett. 25:2079-83,
2003) disclose universal fluorescent tag primers labeled on the 5'
end that are not sequence specific. The labeled fluorescent tag
universal primer, in combination with two sequence-specific
primers, are use to amplify a target nucleic acid sequence.
[0008] Yamane (Nucl. Acids Res. 30:E97, 2002) discloses a
MagniProbe that has an internal fluorophore and an internal
intercalator. The fluorescence is quenched by the intercalator in
the absence of a target sequence. Upon hybridization with the
target sequence, the probe emits fluorescence due to the
interference in quenching by intercalation.
[0009] Nazarenko et al. (Nucl. Acids Res. 30:E37, 2002) disclose a
probe with a single fluorophore near the 3' end (but no quencher),
and addition of 5-7 base pairs to the 5' end of the
sequence-specific probe, wherein the signal from the fluorophore is
increased in the presence of the target sequence.
SUMMARY
[0010] The present application relates to novel photoinduced
electron transfer (PET) nucleic acid molecules (also referred to
herein as PET tags). Also provided are methods for using the PET
tags, for example in assessing the progress of PCR, such as real
time PCR, or for assessing the progress of melting duplex DNA, such
as an amplicon. The novel PET tags include a 5'-end-labeled
nucleotide, and can further include a target-specific sequence at
the 3'-end of the PET tag, thereby generating a labeled
sequence-specific primer sequence (also referred to herein as a PET
primer). Thus, methods are provided for generating labeled
sequence-specific primers, by adding or attaching a primer specific
for a target sequence to a labeled PET tag. In the absence of
hybridization of the PET tag to is complementary sequence, the
detectable signal is altered (such as quenched) by at least two
consecutive G nucleotides (or other nucleotides that can permit
quenching of the signal from the 5'-end labeled nucleotide, such as
isoC and isoG) brought into proximity to the label due to a
stem-loop that includes complimentary nucleotide sequences. When
the PET tag hybridizes to its complement sequence (e.g., when
present in an amplicon), the stem-loop becomes linear, thereby
increasing the distance between the label and the at least two
consecutive G nucleotides (or isoC or isoG) and alternating the
signal from the label (such as increasing the detectable
signal).
[0011] In particular examples, the disclosed PET nucleic acid
molecules include a 5'-end-labeled nucleotide, a stem-loop, and at
least two consecutive G nucleotides (or other nucleotides that can
permit quenching of the label on the 5'-end nucleotide, such as
isoC and isoG), wherein the stem-loop includes complimentary
nucleotide sequences in the stem portion, thereby bringing the
label on the 5'-end-labeled nucleotide and the at least two
consecutive G nucleotides into proximity, thereby changing (such as
quenching) a detectable signal from the 5'-end-labeled nucleotide.
A target- or sequence-specific primer can be attached to the 3'-end
of the PET tag. In some examples, the at least two consecutive G
nucleotides adjacent to the stem-loop of the PET tag can be the
first two nucleotides at the 5'-end of the target- or
sequence-specific primer. In some examples, there are one or more
nucleotides (or other spacer) between the sequence-specific primer
and the at least two consecutive G nucleotides of the PET tag, such
as 1-10 nucleotides. When the PET tag hybridizes with its
complementary sequence, the 5'-end-labeled nucleotide is no longer
in close proximity to the at least two consecutive G nucleotides,
thereby changing the detectable signal from the label (such as
increasing the detectable signal).
[0012] In particular examples, a PET tag includes the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ ID NO: 1),
wherein X.sub.1 is the 5'-end labeled nucleotide, wherein X.sub.2
and X.sub.4 include complimentary nucleotide sequences of length a,
wherein X.sub.3 includes the loop of the stem-loop, wherein G.sub.x
includes the at least two consecutive G nucleotides. For example,
the PET tag can include the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.xX.sub.5(n)-3' (SEQ ID
NO: 2), wherein X.sub.5 includes "n" number of nucleotides, for
example n can be zero or more nucleotides (such as one or more
nucleotides, for example 1-5 nucleotides). In some examples,
X.sub.1 is any nucleotide, but in some examples, X.sub.1 is not G.
In particular examples, X.sub.3 is a trinucleotide sequence, such
TAA, ATA, AAT, TTA, TAT, ATT, TTT or AAA. In one example, a PET tag
consists of the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ ID NO: 1) and
has a sequence-specific primer (e.g., a primer that specifically
hybridizes to a target nucleic acid sequence) attached at its
5'-end to G.sub.x. In another example, a PET tag consists of the
sequence 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)-3' (SEQ ID NO: 3)
and has sequence-specific primer (e.g., a primer that specifically
hybridizes to a target nucleic acid sequence) with at least two
consecutive G nucleotides on its 5'-end attached at its 5'-end to
X.sub.4(a) of the PET tag. Such molecules can be referred to as a
labeled sequence-specific primer or a PET primer.
[0013] Although particular exemplary PET tags and primers are
disclosed herein (for example SEQ ID NOS: 1-3, 10-27, 33 and
35-36), the present application is not limited to these particular
sequences.
[0014] The signal from the label changes when the PET tag or primer
is hybridized to its complementary sequence, for example when it
becomes incorporated into an amplicon. The change in the signal can
be an increase or a decrease, for example relative to a signal in
the absence of the complementary sequence. The resulting change in
detectable signal is proportional to the amount of amplicon
produced and therefore occurs only when a complimentary stand is
synthesized. The signal can be detected by a variety of devices,
such as fluorescent microtiter plate readers, spectrofluorometers,
fluorescent imaging systems, and real-time PCR instruments.
[0015] Any label can be used, such as a fluorophore, for example
6-carboxyfluorescein (6-FAM). In particular examples, a label is
one whose signal is significantly decreased in the presence of
guanosine, isoG or isoC, such as the ability to quench
fluorescence. For example, the nucleotide guanosine can quench a
variety of fluorophores, such as 6-FAM. Thus in some examples the
label is one that can be quenched by guanosine.
[0016] Ideally, a PET tag does not recognize and hybridize to a
target nucleic acid sequence in the absence of a sequence-specific
primer attached to the 3'-end of the PET tag. For example, if the
target nucleic acid sequence is a human p53 sequence, the PET tag
does not substantially hybridize to a human p53 sequence. In
particular examples, the PET tag alone does not hybridize with a
target nucleic acid sequence under moderately stringent or highly
stringent hybridization conditions.
[0017] The disclosed PET tags can be used to label any
sequence-specific primer without significantly affecting the
sensitivity of the amplification reaction. Ideally, a
sequence-specific primer specifically recognizes a target nucleic
acid sequence. For example, if the target sequence is a human p53
sequence, the sequence-specific primer can substantially hybridize
to the p53 sequence, but the PET tag does not substantially
hybridize to the p53 sequence. In some examples, a
sequence-specific primer can hybridize with a target nucleic acid
sequence under moderately stringent or highly stringent
hybridization conditions.
[0018] A PET tag can be attached via its 3'-end (e.g., G.sub.x of
SEQ ID NO: 1, X.sub.5(n) of SEQ ID NO: 2, or X.sub.4(a) of SEQ ID
NO: 3) to the 5'-end of a forward primer or a reverse primer
specific for the target nucleic acid sequence of interest, thereby
generating a labeled forward or labeled reverse primer. The
resulting labeled forward or labeled reverse primer can be used to
amplify the appropriate target nucleic acid, for example using
real-time PCR, resulting in the formation of amplicon products. The
method can further include quantifying an amount of target nucleic
acid sequence present in a sample.
[0019] Also provided by the present disclosure are kits that
include one or more PET nucleic acid molecules of the present
disclosure. The kits can further include a ligase to permit joining
of the 3'-end of a PET tag to the 5'-end of a target
sequence-specific forward or reverse primer. In some examples, the
kit includes one or more sequence-specific forward or reverse
primers, such as primers that recognize and can be used to amplify
a target sequence of interest. In a specific example, the
sequence-specific forward or reverse primer hybridizes specifically
to a pathogen's nucleic acid sequence, such as a viral, bacterial,
parasitic, or fungal nucleic acid sequence. In another specific
example, the sequence-specific forward or reverse primer hybridizes
specifically to a human nucleic acid sequence, such as a sequence
associated with a disease (such as cancer or a hereditary
disorder).
[0020] Arrays, such as a DNA microarray, that include one or more
of the disclosed PET nucleic acid molecules are encompassed by this
disclosure. Such arrays can be used to determine whether a desired
target sequence is present, such as in a sample. The disclosed PET
primers can be hybridized to a target nucleic acid sequence
attached to the array (for example resulting in fluorescence). In
other examples, one or more of the disclosed PET tags or primers
are attached to the array.
[0021] The disclosed PET tags, for example when attached to a
sequence that can hybridize to a target sequence (and thereby
producing a PET primer), provide an approach to detect, and in some
examples further quantify, a target nucleic acid. Use of the PET
primers is shown herein to provide a highly sensitive detection
method, which permits detection of small quantities of target
nucleic acid molecule, such as DNA. For example, the present
disclosure provides methods of detecting a target nucleic acid
molecule. The method can include incubating a sample containing
nucleic acids (such as DNA or RNA) with a PET tag which is linked
to a forward or a reverse target sequence specific primer, and with
the corresponding forward or reverse target sequence specific
primer not containing the PET tag. The sample and labeled forward
primer and reverse primer not containing the PET tag, or forward
primer not containing the PET tag and labeled reverse primers are
incubated under conditions sufficient to permit amplification of
the target nucleic acid. A change in signal from the label on the
resulting PET primer is monitored, wherein a change in signal (such
as an increase or decrease in signal), indicates the presence of
the target nucleic acid sequence. In particular examples, both the
forward and reverse target sequence specific primers contain a PET
tag.
[0022] In some examples, the change in signal is monitored during
the amplification reaction, for example in real time as the
amplicons are formed. In other or additional examples, the change
in signal is monitored after the amplification, for example by
exposing the resulting amplicons to increased temperature to
generate a melting curve. Melting curve analysis can be used to
confirm the presence of a target nucleic acid, and can also be used
to distinguish polymorphisms in amplicons.
[0023] Those skilled in the art will appreciate that the disclosed
isolated nucleic acid molecules and methods can be used to amplify
two or more different target nucleic acid molecules (such as at
least 2, at least 3, at least 4, or even at least 5 different
nucleic acid sequences) in the same amplification reaction. In
particular examples, two or more different PET primers, each
containing a different fluorophore, are used. In other examples,
the same PET tag and label are attached to at least two different
sequence-specific primers, wherein the resulting amplicons are
differentiated, for example by using melting curve analysis. In yet
other examples, combinations of the same PET tag sequence and label
or different PET tag sequences and labels are used.
[0024] The foregoing and other objects and features of the
disclosure will become more apparent from the following detailed
description, which proceeds with reference to the accompanying
figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIGS. 1A and B are schematic drawings showing exemplary PET
tags 10 in the non-hybridized configuration.
[0026] FIG. 2 is a schematic drawing showing an exemplary PET tag
10 in the hybridized configuration during or after nucleic acid
amplification (e.g., when part of an amplicon).
[0027] FIGS. 3A and B are schematic drawings showing exemplary PET
tags 10 ligated or synthesized at the 3'-end to the 5'-end of a
sequence-specific primer 30 to generate a labeled sequence-specific
primer (or PET primer) 32 which can be used in the methods
disclosed herein. These drawings generally show the PET primer as
it would look as part of an amplicon.
[0028] FIG. 4 is a graph of the quantitative PET PCR assay.
[0029] FIG. 5 is a logarithmic plot of the PET PCR assay data.
[0030] FIG. 6 is a graph of the TaqMan.TM. comparison assay.
[0031] FIG. 7 is a logarithmic plot of the TaqMan.TM. comparison
assay data.
[0032] FIG. 8 is a graph of a melting curve analysis of the PET PCR
amplification products.
[0033] FIG. 9 is a graph showing an increase in detectable FAM
signal during amplification of a target sequence using PET primers
containing different numbers of Gs at the 3'-end of the PET tag
(1=no Gs, 2=1 G, 3=2 Gs).
[0034] FIGS. 10A and 10B are graphs showing an increase in
detectable (A) FAM and (B) HEX signal during amplification of a
target sequence using (A) FAM-labeled PET tags attached to the
forward primer and (B) HEX-labeled PET tags attached to the reverse
primer. A Cy5.RTM. dye-labeled TaqMan.RTM. probe was used in these
reactions, but the fluorescence data is shown in FIG. 10E.
[0035] FIGS. 10C and 10D are graphs showing an increase in
detectable (C) FAM and (D) HEX signal during amplification of a
target sequence using FAM-labeled PET tags attached to the reverse
primer and (D) HEX-labeled PET tags attached to the forward primer.
A Cy5.RTM. dye-labeled TaqMan.RTM. probe was used in these
reactions, but the fluorescence data is shown in FIG. 10F.
[0036] FIGS. 10E and 10F are graphs showing an increase in
detectable Cy5.RTM. dye signal from TaqMan.RTM. probes during
amplification of a target sequence using the (E) FAM-forward primer
and HEX-reverse primer described in FIGS. 10A and 10B or (F)
HEX-forward primer and FAM-reverse primer described in FIGS. 10C
and 10D.
SEQUENCE LISTING
[0037] The nucleotide sequences of the nucleic acids described
herein are shown using standard letter abbreviations for nucleotide
bases. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand.
[0038] SEQ ID NO: 1 is the nucleic acid sequence for exemplary PET
tag 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3'.
[0039] SEQ ID NO: 2 is the nucleic acid sequence for exemplary PET
tag 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.xX.sub.5(n)-3'.
[0040] SEQ ID NO: 3 is the nucleic acid sequence for exemplary PET
tag 5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)-3'.
[0041] SEQ ID NO: 4 is the nucleic acid sequence for exemplary PET
tag 5'-TAMRA-AGGCGCATAGCGCCTGG-3'.
[0042] SEQ ID NO: 5 is the nucleic acid sequence for the C. parvum
18S ss rRNA sequence-specific reverse primer CryJVR
5'-ATTCCCCGTTACCCGTCA-3'.
[0043] SEQ ID NO: 6 is the nucleic acid sequence for the C. parvum
18S ss rRNA sequence-specific forward primer CryJVF
5'-GGTGACTCATAATAACTTTACGGAT-3'.
[0044] SEQ ID NOS: 7 and 8 are a forward and a reverse primer for
TaqMan.TM. amplification of the C. parvum 18S ss rRNA gene,
respectively.
[0045] SEQ ID NO: 9 is a TaqMan.TM. probe for detection of the
amplified C. parvum 18S ss rRNA gene.
[0046] SEQ ID NOS: 10-27 are exemplary PET tags attached to a
sequence-specific primer for C. parvum 18S ss rRNA
(ACTCATAATAACTTTACGGAT; nucleotides 20-40 of SEQ ID NO: 10). One
skilled in the art will appreciate the PET tag portion of SEQ ID
NOS: 10-27 can be attached to other sequence-specific primers.
[0047] SEQ ID NOS: 28 and 29 are exemplary PET tag sequences.
[0048] SEQ ID NOS: 30-32 are PET primers that include a PET tag
with zero, one or two 3'-end G nucleotides, respectively, attached
to a sequence-specific primer for C. parvum 18S ss rRNA
(ATGACGGGTAACGGGGAAT; SEQ ID NO: 7). One skilled in the art will
appreciate that the PET tag portion can be attached to other
sequence-specific primers.
[0049] SEQ ID NO: 33 is a reverse sequence-specific primer that can
be used in combination with SEQ ID NOS: 30-32 to amplify C. parvum
18S ss rRNA.
[0050] SEQ ID NOS: 34-35 are PET forward and reverse primers,
respectively, that include a sequence-specific primer for C. parvum
18S ss rRNA. One skilled in the art will appreciate the PET tag
portion can be attached to other sequence-specific primers.
[0051] SEQ ID NO: 36 is a Quas670 probe specific for C. parvum 18S
ss rRNA.
[0052] SEQ ID NOS: 37-38 are PET forward and reverse primers,
respectively, that include a sequence-specific primer for C. parvum
18S ss rRNA. One skilled in the art will appreciate the PET tag
portion can be attached to other sequence-specific primers.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
Abbreviations and Terms
[0053] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. The singular forms "a," "an," and "the" refer to one or
more than one, unless the context clearly dictates otherwise. For
example, the term "comprising a nucleic acid molecule" includes
single or plural nucleic acid molecules and is considered
equivalent to the phrase "comprising at least one nucleic acid
molecule." The term "or" refers to a single element of stated
alternative elements or a combination of two or more elements,
unless the context clearly indicates otherwise. As used herein,
"comprises" means "includes." Thus, "comprising A or B," means
"including A, B, or A and B," without excluding additional
elements.
[0054] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting.
[0055] CT: crossing or cycle threshold)
[0056] PCR: polymerase chain reaction
[0057] PET: photoinduced electron transfer
[0058] 3'-end: The end of a nucleic acid molecule that does not
have a nucleotide bound to it 3' of the terminal residue. In some
examples, a PET tag includes two or more G nucleotides at its
3'-end. In some example, a PET tag is covalently linked or
otherwise attached at its 3'-end to the 5'-end of a
sequence-specific primer directed to a target nucleic acid.
[0059] 5'-end: The end of a nucleic acid sequence where the
5'-position of the terminal residue is not bound by a
nucleotide.
[0060] 5'-end labeled nucleotide: The terminal residue at the
5'-end of a nucleic acid molecule possessing a label (such as a
label that is covalently attached) capable of emitting a detectable
signal. The label can be incorporated by enzymatic modification of
the terminal nucleotide after isolation of the nucleic acid
molecule. In particular examples, the label can be a constituent
moiety of a modified nucleotide substrate used in the synthesis of
the nucleic acid molecule. In such examples, the label can be
incorporated into the nucleotide at any position (such as the
.alpha., .beta., or .gamma. phosphate or the sugar) so long as it
does not significantly interfere with polynucleotide synthesis.
[0061] Amplifying a nucleic acid molecule: To increase the number
of copies of a nucleic acid molecule. The resulting amplification
products are called "amplicons." In a particular example, a target
nucleic acid molecule is amplified using the polymerase chain
reaction (PCR) whereby a forward primer and a reverse primer are
incubated with a target nucleic acid sequence under repeated cycles
of DNA denaturation, annealing and primer extension. During primer
extension, the primers are utilized by a DNA polymerase in the
synthesis of a DNA strand complementary to the target nucleic acid.
Thus, each resulting DNA amplicon contains either a newly-extended
forward primer or reverse primer. A primer extension cycle is
completed when the sample incubation conditions are changed to
denature the newly synthesized dsDNA.
[0062] Complementary: Complementary binding occurs when a
nucleotide forms a hydrogen bond to another nucleotide. In one
example, the complementary nucleotides are present on a single
nucleic acid molecule; for example causing this nucleic acid
molecule to form a secondary structure such as a hairpin loop. In
other examples, the complementary nucleotides are present on two
different nucleic acid molecules, such as single-stranded DNA
molecules, for example thereby forming a duplex (e.g.,
double-stranded DNA). Normally, the base adenine (A) is
complementary to thymidine (T) and uracil (U), while cytosine (C)
is complementary to guanine (G). For example, the sequence
5'-ATCG-3' of one portion of a nucleic acid molecule can bond to
3'-TAGC-5' of another portion of the same nucleic acid molecule,
for example to form a section of dsDNA. In this example, the
sequence 5'-ATCG-3' is the reverse complement of 3'-TAGC-5'.
[0063] Nucleic acid molecules can be complementary to each other
even without complete hydrogen-bonding of all bases of each
molecule. For example, hybridization with a complementary nucleic
acid sequence can occur under conditions of differing stringency in
which a complement will bind at some but not all nucleotide
positions. In particular examples disclosed herein, the
complementary sequences comprising a stem-loop structure are
sufficiently complementary to maintain the stem structure even
though one or more base pairs within the stem are
non-complementary.
[0064] Denaturation: The conversion of one or more molecules from a
folded to a linear physical conformation. Denaturation also refers
to the separation of a partially or completely double-stranded
nucleic acid molecule into its single-stranded constituents.
Molecular denaturation can occur upon changes in temperature, salt
concentration, or pH as described in Sambrook et al. (Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 2001) and
Ausubel et al. (In Current Protocols in Molecular Biology, John
Wiley & Sons, New York, 1998).
[0065] In particular examples, dsDNA is denatured into ssDNA during
PCR by elevating the incubation temperature to 94.degree. C. or
greater for at least one minute.
[0066] Detectable Signal: An indicator, such as a detectable
physical quantity from which information can be obtained. In one
example, a label emits a signal capable of detection, such as a
fluorescent signal. When a label is incorporated uniformly into a
group of molecules, the presence of its detectable signal can be
directly correlated with the number of molecules in a given sample.
In some examples the detection of the signal is dependant on the
molecular context within which the signal is found, such as its
proximity to a molecular quencher. In other examples, such as
particular fluorescent signals, the detection of the signal
requires external stimulus (for example, a particular wavelength of
light) for generation of the signal.
[0067] Fluorophore: A chemical compound, which when excited by
exposure to a particular wavelength of light, emits light
(fluoresces), for example at a different wavelength of light.
Exemplary fluorophores include, but are not limited to:
6-carboxyfluorescein (6-FAM.TM. dye); 5-carboxyfluorescein
(5-FAM.TM. dye); boron dipyrromethene difluoride (BODIPY.RTM. dye);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA.TM. dye); acridine,
stilbene, 6-carboxy-fluorescein hexachloride (HEX.TM. dye), TET.TM.
dye (Tetramethyl fluorescein), 6-carboxy-X-rhodamine (ROX.TM. dye),
ALEXA FLUOR.RTM. 488, Texas Red.RTM. dye,
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE.TM. dye),
Cy3.RTM. dye, Cy5.RTM. dye, VIC.RTM. dye (Applied Biosystems), LC
Red 640, LC Red 705, Yakima yellow, as well as derivatives thereof.
Any fluorophore can be used with the PET tags disclosed herein.
[0068] Also encompassed by the term "fluorophore" are luminescent
molecules, which are chemical compounds which do not require
exposure to a particular wavelength of light to fluoresce;
luminescent compounds naturally fluoresce. Therefore, the use of
luminescent signals can eliminate the need for an external source
of electromagnetic radiation, such as a laser.
[0069] A particular type of fluorophore is one whose fluorescence
is quenched in the presence of guanine (G), such as 6-FAM.TM. dye;
5-FAM.TM. dye; HEX.TM. dye; ALEXA FLUOR.RTM. 488; boron
dipyrromethene difluoride (BODIPY.RTM. dye); or
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA.TM. dye). In one
example, fluorescence is quenched in the presence of guanine by at
least 25%, such as at least 50%, at least 75%, at least 80%, or at
least 90%, as compared to an amount of fluorescence in the absence
of guanine (wherein both are in the presence of the appropriate
excitation wavelength of light).
[0070] Hybridization: Hybridization of a nucleic acid occurs when
two complementary nucleic acid molecules undergo an amount of
hydrogen bonding to each other, or two different regions of a
single nucleic acid molecule undergo an amount of hydrogen bonding
to one another. The stringency of hybridization can vary according
to the environmental conditions surrounding the nucleic acids, the
nature of the hybridization method, and the composition and length
of the nucleic acids used. Calculations regarding hybridization
conditions required for attaining particular degrees of stringency
are discussed in Sambrook et al., Molecular Cloning: A Laboratory
Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 2001); and Tijssen, Laboratory Techniques in Biochemistry and
Molecular Biology--Hybridization with Nucleic Acid Probes Part I,
Chapter 2 (Elsevier, New York, 1993). The T.sub.m is the
temperature at which 50% of a given strand of nucleic acid is
hybridized to its complementary strand.
[0071] Increase in signal: To become greater in some way. A
detectable increase is one that can be detected, such as an
increase in the intensity, frequency, or presence of an
electromagnetic signal, such as fluorescence. In particular
examples, the detectable increase can be directly correlated to the
presence of a target nucleic acid molecule and additionally to the
quantity of a target nucleic acid molecule. In other particular
examples, differences in the increase of signal within a population
of molecules are indicative of polymorphisms within that
population.
[0072] Isolated: An "isolated" biological component (such as a
nucleic acid molecule) has been substantially separated, produced
apart from, or purified away from other biological components such
as cells. Nucleic acid molecules which have been "isolated" include
nucleic acids molecules purified by standard purification methods,
as well as those chemically synthesized. Isolated does not require
absolute purity, and can include nucleic acid molecules that are at
least 50% isolated, such as at least 75%, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% or even 100%
isolated.
[0073] Label: An agent capable of detection, for example by
spectrophotometry, flow cytometry, or microscopy. For example, a
label can be attached to a nucleotide, thereby permitting detection
of the nucleotide, such as detection of the nucleic acid molecule
of which the nucleotide is a part of (e.g., a PET tag or PET
primer). Examples of labels include, but are not limited to,
radioactive isotopes, enzyme substrates, co-factors, ligands,
chemiluminescent agents, fluorophores, haptens, enzymes, and
combinations thereof. In some examples the label is one whose
signal can be quenched by two or more G nucleotides. Methods for
labeling and guidance in the choice of labels appropriate for
various purposes are discussed for example in Sambrook et al.
(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.,
2001) and Ausubel et al. (In Current Protocols in Molecular
Biology, John Wiley & Sons, New York, 1998).
[0074] Ligase: An enzyme that can catalyze the joining of two
molecules ("ligation") by forming a new chemical bond. An exemplary
ligase is DNA ligase, which can link two nucleic acid molecules
(e.g., a PET tag and a sequence-specific primer) by forming a
phosphodiester bond between the two molecules.
[0075] Nucleic acid molecule: A deoxyribonucleotide or
ribonucleotide polymer, which can include analogues of natural
nucleotides that hybridize to nucleic acid molecules in a manner
similar to naturally occurring nucleotides. In a particular
example, a nucleic acid molecule is a single-stranded (ss) DNA or
RNA molecule, such as a primer, cDNA, amplicon, or transcription
product. In another particular example, a nucleic acid molecule is
a double-stranded (ds) molecule, such as cellular genomic DNA or
viral genomic RNA.
[0076] Nucleotide: The fundamental unit of nucleic acid molecules.
A nucleotide includes a nitrogen-containing base attached to a
pentose monosaccharide with one, two, or three phosphate groups
attached by ester linkages to the saccharide moiety.
[0077] The major nucleotides of DNA are deoxyadenosine
5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP
or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine
5'-triphosphate (dTTP or T). The major nucleotides of RNA are
adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate
(GTP or G), cytidine 5'-triphosphate (CTP or C) and uridine
5'-triphosphate (UTP or U).
[0078] Nucleotides include those nucleotides containing modified
bases, modified sugar moieties and modified phosphate backbones,
for example as described in U.S. Pat. No. 5,866,336 to Nazarenko et
al. PET tags and sequence-specific primers can include one or more
modified bases, modified sugar moieties or modified phosphate
backbones.
[0079] Examples of modified base moieties which can be used to
modify nucleotides at any position on its structure include, but
are not limited to: 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N-6-sopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid,
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and
2,6-diaminopurine.
[0080] Examples of modified sugar moieties which can be used to
modify nucleotides at any position on its structure include, but
are not limited to: arabinose, 2-fluoroarabinose, xylose, and
hexose, or a modified component of the phosphate backbone, such as
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, or a formacetal or analog thereof.
[0081] In particular examples, a nucleotide can be modified prior
to incorporation into a growing nucleic acid chain so as to possess
a label capable of emitting a detectable signal. Ideally, such
modifications allow for incorporation of the nucleotide into a
growing nucleic acid chain. That is, they do not terminate nucleic
acid synthesis. In other particular examples, a nucleotide is
modified after synthesis of the nucleic acid molecule. An exemplary
nucleotide modification is the covalent attachment of a
fluorophore.
[0082] Polymorphism: A variation in the nucleic acid sequence
within a population of molecules. Polymorphisms may be differences
in consecutive or non-consecutive nucleotides within a particular
sequence. In particular examples, a polymorphism is a difference in
a single base pair. In other examples a polymorphism is 5, 10, 20,
or greater differences in nucleotide identity. In other examples a
polymorphism may be a deletion of sequence, an insertion of
sequence, or an inversion of sequence. Sequence differences in
polymorphic nucleic acids will result in differences in the rate
and temperature at which the polymorphic molecules will denature
from dsDNA to ssDNA and anneal into dsDNA from ssDNA. In one
example, a target sequence can contain one or more polymorphisms,
such as a polymorphism associated with disease.
[0083] Primer: A short nucleic acid molecule, such as an
8-nucleotide long DNA or RNA oligonucleotide. Longer primers can be
about 10, 12, 15, 20, 25, 30 or 50 nucleotides or more in length,
such as 10-75, 10-50, 10-25, 10-20, 10-15, 12-50 or 12-20
nucleotides. Primer extension occurs when a primer is used to
initiate the synthesis of a longer nucleic acid sequence. Primers
can be annealed to a complementary target DNA strand by nucleic
acid hybridization to form a hybrid between the primer and the
target DNA strand. The primer is then extended along the template
target DNA strand by a DNA polymerase enzyme. Forward and reverse
primers can be used for amplification of a nucleic acid sequence,
for example by PCR or other nucleic acid amplification methods.
[0084] Specificity of a primer for a target nucleic acid increases
with the length of complementary sequence possessed by the primer.
Thus, for example, a primer that includes 30 consecutive
complementary nucleotides will anneal to a target sequence with
greater specificity than a corresponding primer of only 15
complementary nucleotides. Thus, to obtain greater specificity,
probes and primers can be selected that include at least 20, 25,
30, 35, 40, 45, 50 or more consecutive complementary nucleotides.
Conversely, a PET tag described herein is a primer that possesses
little or no complementary sequence to a target nucleic acid
molecule, such that it is unable to hybridize to the target
molecule under conditions of moderate or high stringency.
[0085] In particular examples, a 5'-end labeled PET tag can be
covalently attached at its 3'-end to the 5'-end of a
sequence-specific primer.
[0086] Photoinduced Electron Transfer (PET) primer: A PET tag
covalently attached at its 3'-end to a sequence-specific primer,
such that under conditions suitable for nucleic acid amplification,
the hairpin is denatured, moving the 5'-end label out of proximity
from the at least two adjacent G residues, allowing the 5'-end
label to emit a detectable signal.
[0087] Photoinduced Electron Transfer (PET) tag: A short nucleic
acid molecule containing a stem-loop structure, wherein the
stem-loop structure positions a 5'-end label into proximity with at
least two adjacent G residues (e.g., at the 3'-end of the PET tag)
such that the G residues quench a detectable signal from the 5'-end
label. In particular examples a PET tag is at least 10 nucleotides,
at least 12 nucleotides, such as 10-20 nucleotides, for example 12,
13, 14 or 15 nucleotides.
[0088] Proximity: A measure of nearness, for example when a
detectable signal from a label is quenched if the label is in
sufficient proximity to the quencher of that label. In particular
examples, the detectable signal from the 5'-end label of a PET tag
is significantly quenched when placed into proximity with at least
two adjacent G residues.
[0089] Quantifying a nucleic acid molecule: Determining or
measuring a quantity (such as a relative quantity) of a nucleic
acid molecule present, such as the number of amplicons or the
number of nucleic acid molecules present in a sample. In particular
examples, it is determining the relative amount or actual number of
nucleic acid molecules present in a sample.
[0090] Quencher: A molecular species that can reduce a detectable
signal from a label. In particular examples, a quencher can be at
least two consecutive G residues that quench the signal from a
label at the 5'-end of a PET primer or PET tag.
[0091] Quenching a signal: A reduction of detectable signal from a
label, such as a reduction in fluorescence emission. For example,
quenching of a detectable fluorescent signal emitted from a label
at the 5'-end-labeled nucleotide on a PET tag occurs when the
label, through sequence-directed secondary structure, is placed in
sufficient proximity to a quencher (such as at least two
consecutive G residues) that the quencher reduces the detectable
signal from the label on the 5'-end labeled nucleotide.
[0092] Real-time quantitative PCR: A method for detecting and
measuring products generated during each cycle of a PCR, which are
proportionate to the amount of template nucleic acid prior to the
start of PCR. The information obtained, such as an amplification
curve, can be used to quantitate the initial amounts of template
nucleic acid sequence.
[0093] Sample: Biological specimens such as samples containing
biomolecules, for example nucleic acid molecules (e.g., genomic
DNA, cDNA, RNA, or mRNA). Exemplary samples are those containing
cells or cell lysates from a subject, such as those present in
peripheral blood (or a fraction thereof such as serum), urine,
saliva, tissue biopsy, cheek swabs, surgical specimen, fine needle
aspirates, amniocentesis samples and autopsy material.
[0094] Sequence-specific primer: A short nucleic acid molecule
possessing sequence that can substantially hybridize with a target
nucleic acid molecule under moderately stringent or highly
stringent conditions. In particular examples, a sequence-specific
primer is covalently attached at its 5'-end to the 3'-end of a PET
tag can be used to detect the presence of a target nucleic acid
molecule. In other examples, a sequence-specific primer is used for
location-specific amplification of a target nucleic acid molecule
using PCR. In some examples, a sequence-specific primer is at least
8 nucleotides, such as at least 10, at least 15, at least 20
nucleotides, for example 8-50, 8-25, 8-20, 8-15, 10-20, or 12-20
nucleotides.
[0095] Signal: An indicator, such as a detectable physical quantity
from which information can be obtained. In one example, a label
emits a signal capable of detection, such as a fluorescent
signal.
[0096] Stem-loop: As shown in FIGS. 1A and 2, a molecular secondary
structure wherein two portions of a linear molecule (e.g., 20 of
FIG. 2) possess sufficient affinity (e.g., complementarity) to fold
into a double-stranded stem (e.g., 18 of FIGS. 1A and 1B) that is
connected by a single-stranded loop (e.g., 22 of FIGS. 1A and 1B).
A nucleic acid stem-loop is the result of two inverted repeat
sequences connected by three or more nucleotides. In particular
examples, the inverted repeats are less than 100% complementary,
but the overall sequence is sufficiently complementary to maintain
the stem structure.
[0097] Target nucleic acid sequence or molecule: A pre-selected
nucleic acid molecule, for example whose detection or sequence is
desired. The target nucleic acid molecule need not be in a purified
form. Various other biomolecules can also be present with the
target nucleic acid molecule. For example, the target nucleic acid
molecule can be present in a cell or a biological sample (which can
include other nucleic acid molecules and proteins).
[0098] Under conditions sufficient for: A phrase that is used to
describe any environment that permits the desired activity. An
example includes incubating forward and reverse primers with a
sample under conditions sufficient to allow amplification of a
target nucleic acid molecule in the sample. Another particular
example includes conditions sufficient for determining whether the
target nucleic acid molecule is present in a sample, such as a
target nucleic acid molecule containing one or more
polymorphisms.
Photoinduced Electron Transfer (PET) Tags and Primers and Methods
of Making
[0099] Disclosed herein are photoinduced electron transfer (PET)
nucleic acid molecules (referred to herein as PET tags and PET
primers) that can be used in nucleic acid amplification to detect
the presence of a target nucleic acid molecule. The PET tag
sequence is generic and without significant specificity for any
particular nucleic acid sequence. For example, rather than
hybridize specifically to a target nucleic acid, PET tags can be
ligated or synthesized at their 3'-end to a forward and/or reverse
amplification primer that contains significant sequence specificity
for the target nucleic acid molecule. The resulting nucleic acid
(referred to here as a PET primer) can be used to detect a target
nucleic acid molecule.
[0100] Upon incorporation of a PET primer (e.g., one that is
covalently attached to a target-specific sequence) into a
newly-synthesized amplicon, a quenched detectable signal from a
label at the PET primer 5'-end is moved away from quenching
nucleotides contained therein. The signal is thus de-quenched and
detectable, and indicates the presence of the target nucleic acid.
In some examples, the signal can be detected after each
amplification cycle to quantitate the amount of amplified target
nucleic acid in real time, as in real-time PCR or real time RT-PCR.
In other examples, the signal can be detected after amplification
is completed. In other particular examples the signal from the
incorporated PET primer can be used to detect the presence of
nucleotide polymorphisms, for example by monitoring the signal
during amplicon denaturation by methods well known to the art.
Although particular PET tag sequences are provided herein (e.g.,
see Table 2), the disclosure is not limited to these specific
examples.
[0101] FIGS. 1A-B and 2 show an exemplary PET nucleic acid molecule
tag when not hybridized to its complementary sequence (e.g.,
stem-loop structure present), and when hybridized to its
complementary sequence (e.g., stem-loop structure absent) as part
of an amplicon, respectively. The PET tag 10 includes a 5'-end
nucleotide 12 with a label 14 capable of emitting a detectable
signal. The 5'-end label 14 is located at the base of a stem-loop,
the stem 18 of which is formed by two inverted repeats (20, FIG. 2)
of sufficient length and complementary nucleotide sequence to
anneal one to another. Each inverted repeat 20 is separated by
three or more non-complementary nucleotides to form the loop 22 of
the stem-loop. The structure of the stem-loop is such that the
5'-end label 14 is positioned into proximity with at least two
consecutive G nucleotides (or isoC or isoG) 24 located at the
3'-end of the stem-loop structure. The proximity of the G
nucleotides 24 to the 5'-end label 14 quenches the detectable
signal from the label 14. The 3'-end portion of the PET tag 10
follows the at least two consecutive G nucleotides 24. In some
examples, the PET tag includes one or more nucleotides 26 after the
at least two consecutive G nucleotides 24, such as 1-50
nucleotides, such as 1, 2, 3, 4, 5, or 10 nucleotides.
[0102] The 5'-end nucleotide 12 can be any nucleotide that can be
covalently modified to contain a label with a detectable signal. In
particular examples, the 5'-end nucleotide 12 is a T, A, G, or C
nucleotide. In other particular examples, the 5'-end nucleotide 12
is a T, A, or C nucleotide. In other particular examples, the
5'-end nucleotide 12 is any nucleotide except G. In particular
examples, the 5'-end nucleotide 12 is any nucleotide analog that
contains a label 14 that emits a detectable signal.
[0103] The 5'-end label 14 can be any label that is capable of
emitting a detectable signal. In particular examples, the 5'-end
label 14 is a fluorophore. In one example, the fluorophore emits a
fluorescent signal that is quenched when the label is brought into
proximity of the at least two consecutive G nucleotides 24. The
signal can be decreased by any detectable amount, such as at least
10%, at least 30%, at least 50%, at least 70%, at least 90%, or
even 100%. Particular examples of fluorophores that can be used
include, but are not limited to, 6-carboxyfluorescein (6-FAM.TM.
dye); 5-carboxyfluorescein (5-FAM.TM. dye); boron dipyrromethene
difluoride (BODIPY.RTM. dye);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA.TM. dye); ALEXA
FLUOR.RTM. 488; acridine; stilbene; 6-carboxyfluorescein
hexachloride (HEX.TM. dye); TET.TM. dye; ROX.TM. dye; Texas
Red.RTM. dye; JOE.TM. dye; Cy3.RTM. dye; Cy5.RTM. dye; VIC.RTM.
dye; LC Red 640; LC Red 705; Yakima yellow; as well as derivatives
thereof. In another example, the label is not a quencher.
[0104] The 5'-end label 14 can be covalently attached to the PET
tag 10 at any available moiety of the 5'-end nucleotide 12. In
particular examples, the 5'-end label 14 is covalently attached at
the triphosphate of the 5'-end nucleotide 12. In other particular
examples, the 5'-end label 14 is covalently attached at any
available moiety of the nitrogenous base of the 5'-end nucleotide
12. In other particular examples, the 5'-end label 14 is covalently
attached to any available moiety of the sugar component of the
5'-end nucleotide 12. Covalent attachment of the 5'-end label 14 to
the triphosphate, nitrogenous base, or sugar of the 5'-end
nucleotide 12 can be accomplished according to standard methodology
well known in the art as discussed, for example in Sambrook et al.
(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.,
2001) and Ausubel et al. (In Current Protocols in Molecular
Biology, John Wiley & Sons, New York, 1998).
[0105] The 5'-end nucleotide 12 is located at the base of a
stem-loop structure 16. The stem-loop 16 (linear in FIG. 2)
functions to bring the 5'-end label 14 within proximity of the at
least two consecutive G nucleotides 24, which quench the signal
from the label 14. The stem 18 of the stem loop structure 16 is
composed of two lengths of nucleotide sequence 20 (FIG. 2) that are
of sufficient complementarity one to another to stably base pair.
In particular examples, the stem 18 can be composed of two inverted
repeats 20 of 100% complementarity to each other. In other
particular examples, the stem 18 is composed of sequences 20 that
are at least 50%, at least 60%, at least 70%, at least 80%, at
least 90%, or at least 95% complementary to each other. The length
of the stem 18 can be any number of nucleotides, so long as the
stem can be stably maintained under non-denaturing conditions. In
particular examples each of the component sequences portions 20 of
the stem 18 is at least 3, at least 4 at least 5, at least 6, at
least 7, at least 8, or at least 9 nucleotides, such as 3, 4, 5, 6,
7, 8, 9, or 10 nucleotides. In other particular examples each of
the two component sequences 20 of the stem 18 is 10 or more
nucleotides. In some examples, each of the two component sequences
20 of the stem 18 is 3-5 or 3-10 nucleotides.
[0106] The loop 22 of the stem-loop structure 16 connects the two
component sequences 20 of the stem. The loop 22 can be composed of
any number of nucleotides and any sequence such that the stem-loop
structure 16 is maintained in order to quench the detectable signal
from the 5'-end label 14 as described herein. In particular
examples, the loop 22 is 3, 4, 5, or 6 nucleotides. In other
particular examples, the loop 22 is at least 7 nucleotides, such as
7-12 nucleotides. In other particular examples, the loop 22 is at
least 10 nucleotides. In particular examples, the loop 22 can be
any trinucleotide sequence. In other particular examples, the loop
22 does not contain C or G nucleotides. In other particular
examples, the loop 22 can be any trinucleotide sequence that does
not contain C or G nucleotides. In other particular examples, the
loop 22 is TAA, ATA, AAT, TTA, TAT, ATT, TTT, or AAA.
[0107] In particular examples, the PET tag 10 includes at least two
consecutive G nucleotides 24 at the 3'-end of the stem-loop
structure 16. However, in some examples the at least two
consecutive G nucleotides are instead present at the 5'-end of a
sequence-specific primer attached to the 3'-end of the PET tag. One
skilled in the art will appreciate that isoC or isoG can be used
alternatively or in addition to G. The G nucleotides 24 quench the
detectable signal from the 5'-end label 14 when the 5'-end label 14
is brought into proximity with the consecutive G nucleotides 24 by
the stem-loop structure 20 (see FIGS. 1A and B). However, when the
PET tag is hybridized to its complementary sequence (for example
when incorporated into an amplicon), the stem-loop structure 16
linearizes moving the G nucleotides 24 away from proximity to label
14, and thus the G nucleotides 24 cannot significantly quench the
detectable signal from the 5'-end label 14 and the detectable
signal from the label 14 is emitted and can be detected (see FIG.
2). In particular examples, the consecutive G nucleotides 24 can
include 2, 3, 4, 5, or 6 consecutive G nucleotides. In other
particular examples the consecutive G nucleotides 24 include at
least 7 consecutive G nucleotides. As shown in FIG. 2, in a
particular example, the PET tag stem-loop structure 16 is
linearized as a result of its incorporation into a nucleic acid
amplicon.
[0108] As shown in FIG. 1B, the PET tag in some examples includes
additional nucleotides 26 at the 3'-end of the PET tag following
the at least two consecutive G nucleotides 24. For example, the
additional nucleotides 26 can be composed of 0, 1, 2, 3, 4, 5, 8,
10, 15, 20 or more nucleotides, such as at least 8 nucleotides.
[0109] In specific embodiments, the PET tags 10 disclosed herein
can be at least 12 nucleotides in length, such as 12 to 20
nucleotides, for example 12, 13, 14, 15, 16, 17, 18, 19, or 20
nucleotides in length. In other specific examples, the PET tags can
be between 22 and 30 nucleotides long, such as 22, 23, 24, 25, 26,
27, 28, 29, or 30 nucleotides. In other specific examples the PET
tags 10 can be 35, 40, 45, or 50 nucleotides long.
[0110] As shown in FIGS. 3A and 3B, a PET tag 10 can be linked
(e.g., ligated, synthesized, or attached) at its 3'-end to the
5'-end of a sequence-specific primer sequence 30, thereby
generating a labeled sequence-specific primer sequence 32 (also
referred to herein as a PET primer). Such PET primers can be
generated using routine methods, such as by synthesizing a nucleic
acid molecule that includes a PET tag and a sequence-specific
primer, or by ligating a PET tag to a sequence-specific primer. In
some examples, the target-specific primer 30 is added to the PET
tag 10 via the at least two consecutive G nucleotides 24 (FIG. 3A).
In other examples, the target-specific primer 30 is added to the
PET tag 10 via additional nucleotides 26 (FIG. 3B). The labeled
sequence-specific primer 32 (which in some examples is isolated)
can then be used in an amplification reaction, such as a PCR or an
RT-PCR reaction. The sequence-specific primer 30 can recognize a
target nucleic acid of interest, such as a pathogen nucleic acid
sequence, for example a viral, fungal, bacterial, or parasitic DNA
or RNA sequence. In another example, a target nucleic acid
sequence, such as a DNA or RNA sequence, is a nucleic acid sequence
whose expression is altered in response to a disease, such as
cancer. In some examples, the target nucleic acid sequence is one
whose gene expression is to be determined. The sequence-specific
primer 30 can be any length that permits amplification of the
desired nucleic acid molecule. In particular examples, a
sequence-specific primer 30 is at least six nucleotides, such as at
least 9, at least 10, at least 12, at least 15, at least 20, at
least 25, at least 30, at least 35, at least 40, or at least 50
nucleotides. In particular examples the sequence-specific primer is
between 6 and 100, 9 and 50, or 9 and 20 nucleotides.
[0111] In particular examples the PET tag includes the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.x-3' (SEQ ID NO: 1),
wherein X.sub.1 is the 5'-end nucleotide of the PET tag and
includes a detectable label (12, FIGS. 1A and B and FIG. 2),
wherein X.sub.2 and X.sub.4 (20, FIG. 2) include the nucleotide
sequences of length a of sufficient complementarity to form the
stem of the stem-loop structure, wherein X.sub.3 (22, FIGS. 1A and
B and FIG. 2) includes the loop of the stem-loop structure, wherein
G.sub.x (24, FIGS. 1A and B and FIG. 2) includes the at least two
consecutive G nucleotides such as 2, 3, 4, 5, or 6 nucleotides. In
another example, a PET tag includes the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)G.sub.xX.sub.5(n)-3' (SEQ ID
NO: 2), wherein X.sub.5 (26, FIGS. 1B and 3B) is 0 or more
nucleotides such as 0, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or 35
nucleotides. In other embodiments, X.sub.5 is 1 or more
nucleotides. In another example, a PET tag includes the sequence
5'-X.sub.1X.sub.2(a)X.sub.3X.sub.4(a)-3' (SEQ ID NO: 3), wherein
G.sub.x of the PET tag (24, FIGS. 3A and B) is the 5'-nucleotides
of the sequence specific primer 30 instead part of the PET tag
attached to the sequence specific primer 30.
[0112] In particular examples, X.sub.1 is any nucleotide, such as
A, C, T, or G or any modification or nucleotide analog known to a
person skilled in the art. In other examples, X.sub.1 is any
nucleotide except for G, such as A, C, T, or any modification or
nucleotide analog thereof known to a person skilled in the art. In
other examples, X.sub.1 is A, C, or T. In particular examples, a is
3 or more nucleotides such as 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides. In other specific examples, the sequence defined by
X.sub.2(a) and X.sub.4(a) possess at least 50% complementarity to
one another such as at least 50%, 60%, 70%, 80%, or 90% or 95%
complementarity. In other specific examples, the sequences defined
by X.sub.2(a) and X.sub.4(a) are 100% complementary to one another.
In particular examples, X.sub.3 is at least 3 nucleotides such as
3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In other particular
examples, the nucleotides represented by X.sub.3 do not include C
or G. In other particular examples X.sub.3 is a trinucleotide
sequence, for example TAA, ATA, AAT, TTA, TAT, ATT, TTT or AAA.
[0113] In a specific example, the PET tag is
5'-TAMRA-AGGCGCATAGCGCCTGG-3' (SEQ ID NO: 4). One skilled in the
art will appreciate that TAMRA can be replaced with another
fluorophore. Other exemplary PET tags are provided in the examples
below.
Kits
[0114] The present disclosure provides kits that include one or
more PET tags, such as a PET tag ligated or otherwise attached to a
sequence-specific primer. For example, the kit can include one or
more (such as two or more, for example, 2, 3, 4, 5, or 6) labeled
sequence-specific primers that include a PET tag generated using
the methods provided herein.
[0115] In some examples, the kits further include ligase, for
example to permit ligation of a PET tag to the 5' end of a forward
or a reverse target sequence-specific primer, thereby generating a
PET primer.
[0116] In some examples, the kits include one or more forward or
reverse target sequence-specific primers, such as forward and
reverse primers that recognize a specific pathogen or a specific
nucleic acid sequence whose expression is changed in response to a
disorder. For example, the kit can include forward and reverse
primers that can be used to amplify the nucleic acid sequence of a
particular pathogen, such as a viral, bacterial, parasitic, or
fungal target nucleic acid sequence. In one example, the forward
and reverse primers can be used to amplify a particular human
nucleic acid sequence, such target nucleic acid sequences can be
associated with a disease, such as cancer. In some examples, the
PET tag in the kit is already attached to the 5'-end of the forward
or reverse primer. In other examples, the PET tag in the kit is
separate from the forward or reverse primer, and can be ligated to
the forward or reverse primer by a user.
[0117] Kits can also include other reagents, such as those used for
PCR amplification. Examples include buffers, dNTPs, polymerase, and
combinations thereof. In one example, kits include reagents for
detection of a label on the PET tag, such as a chemiluminescent
detection reagent.
[0118] The components of the kit can be present in separate,
labeled containers.
Methods of Nucleic Acid Detection
[0119] The disclosed PET nucleic acid molecules and labeled
sequence-specific primers can be used in any nucleic acid
amplification reaction to determine whether a particular target
nucleic acid sequence is present, such as a DNA or RNA molecule.
For example, methods are disclosed for detecting a target nucleic
acid molecule. In particular examples, the method includes
incubating a sample containing nucleic acids with a PET tag
attached to a forward or a reverse target sequence-specific primer
(referred to herein as a PET primer), and with a corresponding
forward or reverse target sequence-specific primer which does not
contain the PET tag. In other examples, both the forward and the
reverse target sequence contain a PET tag. The PET tag associated
with the sequence-specific forward and reverse primer may be the
same or different. In some examples, the sequences of the PET tag
associated with the sequence-specific forward and reverse primer is
the same, but the label on each is different. As described above,
the 3'-end of the PET tag can be ligated to the 5'-end of the
forward or reverse sequence-specific primer (e.g., see FIGS. 3A and
B).
[0120] In a particular example, the sample, a forward primer
containing a PET tag, and a reverse primer not containing a PET
tag, or a forward primer not containing a PET tag and a reverse
primer containing a PET tag, are incubated under conditions
sufficient to permit amplification of the target nucleic acid. For
example, the reaction can include dNTPs, polymerase, and
MgCl.sub.2.
[0121] Any primer extension amplification method can be used, and
such methods are well known in the art. Particular examples
include, but are not limited to: real-time PCR (for example see
Mackay, Clin. Microbiol. Infect. 10(3):190-212, 2004), Strand
Displacement Amplification (SDA) (for example see Jolley and Nasir,
Comb. Chem. High Throughput Screen. 6(3):235-44, 2003),
self-sustained sequence replication reaction (3SR) (for example see
Mueller et al., Histochem. Cell. Biol. 108(4-5):431-7, 1997),
ligase chain reaction (LCR) (for example see Laffler et al., Ann.
Biol. Clin. (Paris). 51(9): 821-6, 1993), or transcription mediated
amplification (TMA) (for example see Prince et al., J. Viral Hepat.
11(3):236-42, 2004),
[0122] An increase in detectable signal from the label on the
labeled PET primer is monitored, wherein a significant increase in
signal indicates the presence of the target nucleic acid sequence,
and wherein no significant increase in signal indicates that the
target nucleic acid molecule is not present in the sample. The
increase in detectable signal can be monitored by any instrument
that can detect the detectable signal. In particular examples, the
instrument that can detect the detectable signal can be a
spectrophotometer. In other particular examples, the instrument
that can detect the detectable signal can be a real-time PCR
thermocycler. The increase in signal can be compared to a control,
such as a signal present at an earlier time-point, such as prior to
nucleic acid amplification. In some examples, the increase is
relative to a negative control, such as a sample known not to
contain the target DNA or a sample incubated with primers that are
unlabeled. In some examples, the increase is relative to a known
value or range of values expected in the absence of the target
sequence. In comparison to the control signal, the increase can be
at least 10%, at least 20%, at least 30%, at least 40%, at least
50% at least 60%, at least 70%, at least 80%, at least 90%, at
least 100%, at least 200% at least 1000% or greater increase. The
detectable signal increases in a predictable manner that permits
determination of whether or not a target nucleic acid sequence is
present in a sample. In some examples, the increase in detectable
signal allows for quantification of an amount of target nucleic
acid sequence present in a sample.
[0123] For example, when the label is a fluorophore that can be
quenched in a predictable manner by being in proximity to the at
least two consecutive G nucleotides at the 3'-end of the PET tag
(or the first two 5'-nucleotides of the sequence-specific primer),
an increase in fluorescent signal during nucleic acid amplification
indicates the presence of the target nucleic acid sequence in the
sample, while no significant increase in fluorescent signal during
nucleic acid amplification indicates that the target nucleic acid
sequence is not present in the sample.
[0124] In some examples, the increase in signal is monitored during
the amplification reaction, for example in real time as the
amplicons are formed. For example, the detectable signal from the
5'-end label present on the PET tag is quenched when the
amplification primers are freely floating in the nucleic acid
amplification reaction mixture. During nucleic acid amplification,
when the polymerase synthesizes nucleic acid amplicons, the primer,
including the labeled PET tag, is incorporated into the amplicon
and the stem-loop of the PET tag is denatured, removing the 5'-end
label from proximity with the at least two consecutive G
nucleotides (that is, the distance between label and G nucleotides
is increased). Thus, the signal from the label will increase as it
becomes incorporated into the double-stranded amplicon molecule. As
more amplicons are produced during nucleic acid amplification, the
signal of the reaction mixture will increase. The increase in
signal can be monitored using any commercially available system.
This increase in signal permits detection of a target nucleic acid
sequence in the reaction.
[0125] In one example where the label is a fluorophore, the
increase in signal monitored during the amplification reaction is
an increase in fluorescence. The fluorescence of the fluorophore is
quenched when the primers are freely floating in the nucleic acid
amplification reaction mixture. During nucleic acid amplification,
when polymerase synthesizes nucleic acid amplicons, the primer,
including the labeled PET tag, is incorporated into the amplicon.
The fluorescence of the incorporated primer increases several-fold
due to dequenching of the detectable signal by its incorporation
into the double-stranded amplicon molecule and movement out of
proximity with the at least two consecutive Gs in the PET tag. As
more amplicons are produced during nucleic acid amplification, the
overall fluorescence of the reaction mixture increases. The
increase in fluorescence can be measured and observed, for example
by using a commercially available nucleic acid amplification system
capable of measuring fluorescence (such as real-time PCR
thermocyclers). An increase in fluorescent signal indicates the
presence of a target nucleic acid sequence in the reaction.
[0126] Target nucleic acid molecules can be detected after nucleic
acid amplification. For example, the methods can include incubating
a sample containing or thought to contain the target nucleic acid
molecule with a forward primer and a reverse primer that are
specific for the target nucleic acid molecule. Either the forward
primer or the reverse primer is linked at its 5'-end to the 3'-end
of a PET tag under conditions sufficient to allow amplification of
the target nucleic acid molecule (such as real-time PCR
conditions). However, in some examples, both the forward and the
reverse primer are linked at their 5'-ends to the 3'-end of a PET
tag. The amplification results in the generation of labeled
amplicons. Each amplicon is exposed to conditions that permit
denaturation of the amplicon into single-stranded nucleic acid
molecules, and then exposed to conditions that permit
rehybridization of the strands. During each cycle of amplicon
synthesis, the resulting PET primer is incorporated into a
double-stranded nucleic acid molecule, denaturing the stem-loop
structure of the PET tag. This results in an increase in detectable
signal, for example relative to the detectable signal from the
label before the formation of double-stranded DNA. An increase in
signal indicates that the target nucleic acid molecule is present
in the sample, and no significant change in signal indicates that
the target nucleic acid molecule is not present in the sample.
[0127] In particular examples, PET primers can be used to detect
multiple target nucleic acids, for example in a single reaction. In
such examples, a plurality of PET tags can be ligated to the 5'-end
of a plurality of target-specific forward and/or reverse primers.
The 5'-end labels in such examples can be fluorescent labels that
each emit a fluorescent signal at different wavelengths such that
the presence of a plurality of target nucleic acids can be
detected. For example, for target sequence 1, a PET-forward primer
can be labeled with HEX, and for target sequence 2 a PET-forward
primer can be labeled with 6-FAM, such that increase in HEX
indicates the presence of target sequence 1, while an increase in
6-FAM signal indicates the presence of target sequence 2. In
particular examples, the presence of multiple target nucleic acids
can be monitored in real time as in real-time PCR, for example in
one or more amplification reactions.
[0128] In addition to determining whether a particular target
nucleic acid molecule is present, the method can further include
quantifying the target nucleic acid molecule. In one example
quantification includes comparing a signal to a reference value.
Exemplary reference values include an expected amount of signal
from a known amount of nucleic acid.
[0129] In other or additional examples, the change (e.g., increase
or decrease) in signal is monitored after the amplification, for
example by exposing the resulting amplicons to a melting procedure
to denature the double-stranded amplicons. During the denaturation,
a change in signal is detected. The resulting signals, such as
decreasing fluorescence (see FIG. 8), can indicate polymorphisms in
the nucleic acid amplicons. Therefore, melting curve analysis can
be used to confirm the presence of a target nucleic acid sequence,
and can also be used to distinguish polymorphisms in amplicons.
[0130] Samples containing nucleic acid molecules can be obtained
from any appropriate specimen, for instance blood or
blood-fractions (such as serum). Techniques for acquisition of such
samples are well known in the art (for example see Schluger et al.
J. Exp. Med. 176:1327-33, 1992, for the collection of serum
samples). Serum or other blood fractions can be prepared in the
conventional manner. For example, about 200 .mu.L of serum can be
used for the extraction of DNA for use in amplification reactions.
In some examples, RNA is extracted and used in an amplification
reaction (such as reverse-transcriptase PCR). Commercially
available kits can also be used to obtain nucleic acid molecules
from a biological sample prior to amplification.
[0131] Once a sample has been obtained, the sample can be used
directly, concentrated (for example by centrifugation or
filtration), purified, or combinations thereof. In one example, DNA
is prepared from the sample, yielding a nucleotide preparation that
is accessible to, and amenable to, nucleic acid amplification.
Similarly, RNA can be prepared using a commercially available kit
(such as the RNeasy Mini Kit, Qiagen, Valencia, Calif.).
EXAMPLE 1
Comparison of PET Tag to TaqMan.RTM. Primers
[0132] This example describes methods used to compare the
TaqMan.RTM. assay to the method of the present disclosure which
uses the disclosed PET tags and primers. Cryptosporidium parvum was
used as a model system; however one skilled in the art will
appreciate that similar methods can be used to amplify any target
nucleic acid molecule of interest using the disclosed PET nucleic
acid molecules.
[0133] The primers were prepared as follows. Oligonucleotide
primers were synthesized on automated DNA synthesizers (Applied
Biosystems, Foster City Calif.) utilizing standard phosphoramidite
chemistry. The PET tag of SEQ ID NO: 4 does not show any homology
to Cryptosporidium spp. sequences. TAMRA
(NNN'N'-tetramethyl-6-carboxyrhodamine) was added to the 5'-end of
the oligo during synthesis using a C6-TAMRA-dT phosphoramidite
(Glen Research, Sterling Va.) to produce the end labeled primer of
sequence 5'TAMRA-AGGCGCATAGCGCCTGG 3' (SEQ ID NO: 4). For target
specific nucleic acid amplification and detection, the TAMRA-end
labeled PET tag was ligated to the 5'-end of the sequence-specific
reverse primer CryJVR: 5'-ATTCCCCGTTACCCGTCA-3' (SEQ ID NO: 5) to
produce PET-CryJVR. Also used in nucleic acid amplification was
forward primer CryJVF: 5'-GGTGACTCATAATAACTTTACGGAT-3' (SEQ ID NO:
6). Both forward and reverse sequence-specific primers correspond
to C. parvum 18S ss rRNA sequence (GenBank Accession #
AY458612).
[0134] A stock of C. parvum oocysts contained 6.times.10.sup.8
oocysts/mL. The titers of C. parvum oocyts stocks were determined
based on hemocytometer microscopy counts. DNA was extracted using a
standard nucleic acid extraction method and the resulting DNA was
serially diluted and stored at -70.degree. C. until use. Standard
curves were generated using 10.sup.3 to 10.sup.-2 oocysts. For
generation of standard curves, the crossing threshold (CT) (i.e.,
cycle threshold) values were plotted (y-axis) against the logarithm
of the input copy numbers (x-axis). Appropriate negative controls
were included in each run. To assess the log-linear relationship of
the assays, the linear regression and regression coefficients
(R.sup.2) were calculated. The oocyst numbers do not correspond to
the exact number of RNA molecules for 18S, since each oocyst
contains 20 copies of 18S ssrRNA gene.
[0135] Real-time PCR amplification was carried out using the
iCycler iQ4.RTM. platform (Bio-Rad, California, USA) platform. The
reaction mixture contained primers at concentrations of 250 nM of
each forward and reverse primer, 2 .mu.l of DNA, 10 .mu.l of
2.times. QuantiTect.RTM. Probe PCR kit Master Mix (Qiagen,
Valencia, Calif.), and nuclease-free water to a final volume of 20
.mu.l. The amplification reaction consisted of a hot start step at
95.degree. C. for 15 minutes to activate the HotStarTaq.RTM. DNA
polymerase. This was followed by forty five cycles of amplification
including denaturation at 95.degree. C. for 10 seconds and
annealing/extension at 60.degree. C. for 40 seconds. Fluorescence
signals were collected at the end of the annealing step in channel
2 (Excitation 555 nm/Emission 576 nm).
[0136] For the TaqMan.RTM. assay, the primers and probe used are
listed in Table 1. The TaqMan.RTM. probe was labeled with FAM
(6-Carboxy-fluorescein) at the 5'-end and with Black Hole
Quencher.RTM. dye at the 3'-end (CDC Biotechnology Core Facility,
Atlanta, Ga.). Amplifications were carried out using the iCycler
iQ4.RTM. platform (Bio-Rad, California, USA) for a total of 45
cycles. For TaqMan.RTM. PCR, the 20 .mu.l reaction contained 10
.mu.l of 2.times. QuantiTect.RTM. Probe PCR kit Master Mix (Qiagen,
Valencia, Calif.), 2 .mu.l of DNA, and primers and probe at
concentrations of 250 and 100 nM respectively. Prior to
amplification, denaturation was carried out at 95.degree. C. for 15
minutes, followed by 45 PCR cycles at 95.degree. C. (10 seconds)
and annealing/extension at 60.degree. C. for 40 seconds.
Fluorescence signals were collected at the end of the annealing
step in channel 1 (490 nm).
TABLE-US-00001 TABLE 1 Sequences used in the TaqMan .RTM. real-time
PCR assay Primer or probe Sequence (5'-3') Position* SEQ ID No. 18S
ssrRNA* JVAF (forward) ATGACGGGTAACGGGGAAT 100-118 7 JVAR (Reverse)
CCAATTACAAAACCAAAAAGTCC 258-236 8 JVAP (Probe)
FAM-CGCGCCTGCTGCCTTCCTTAGATG-BHQ 161-185 9 *Position based on
GenBank accession #AY458612 for 18S small subunit ribosomal RNA
gene.
[0137] Slopes, regression coefficients, and PCR amplification
efficiency curves for both PET primer and TaqMan.RTM. probe assays
were calculated using iCycler iQ.RTM. software; efficiency (E) was
calculated according to the equation E=10.sup.(-1/slope).
[0138] As shown in FIG. 4, nucleic acid amplification with the
disclosed PET PCR assay demonstrates a dynamic range of detection
from 6000 oocysts to 0.6 oocysts per PCR reaction. As shown in FIG.
5, the logarithmic plot of this data presents the relationship
between the concentration of DNA and CT values. As shown in FIG. 6,
the TaqMan.RTM. assay exhibits similar sensitivity as the PET
primer assay in nucleic acid amplification for a dynamic range of
detection from 6000 oocysts to 0.6 oocysts per PCR reaction.
Likewise, in FIG. 7 the logarithmic plot of this data presents a
similar relationship between the concentration of DNA and CT values
in comparison to the PET PCR assay. In both detection methods the
same level of sensitivity was achieved. A seed level of 0.06
oocysts was not detected by either method.
EXAMPLE 2
Melting Curve Analysis to Detect Polymorphisms
[0139] This example describes methods used to detect polymorphisms
using the disclosed PET tags. Similar methods can be used to detect
any target nucleic acid molecule of interest using the disclosed
PET nucleic acid molecules.
[0140] Melting curve analysis of PET primer assay products was
performed after amplification (as described in Example 1), and
consisted of 1 minute at 95.degree. C., followed by 1 minute at
55.degree. C., and 80 10 second steps with a 0.5.degree. C.
increase in temperature at each step. Threshold values for
threshold cycle determination were generated automatically by the
iCycler iQ.RTM. software.
[0141] Lack of variation in PCR products and the absence of primer
dimers were ascertained from the melt curve profile of the PCR
products. The melting temperature (Tm) for each sample was used to
verify the specificity of the real-time plot. As shown in FIG. 8,
the melting curve analysis for the PET PCR assay of the 18S ssrRNA
gene target at different concentrations (as in Example 1) confirms
the specificity of the PET primers.
EXAMPLE 3
Exemplary PET Tags
[0142] This example provides an additional 18 exemplary PET tags.
Although the primers shown in Table 2 include target-specific
sequences for the C. parvum 18S ssrRNA gene, one skilled in the art
will appreciate that the target-specific portion of SEQ ID NOS:
10-27 (underlined portion in Table 2), can be replaced with other
desired target-specific sequences. That is, the PET tags in Table 2
(non-underlined portion) can be used with other desired
target-specific sequence primers.
[0143] Table 2 shows labeled target-specific sequences that include
a PET tag portion (not underlined) and a target specific portion
(underlined). These primers include different numbers of
nucleotides in the loop (e.g., 16 of FIG. 2) and different numbers
of consecutive Gs (e.g., 24 of FIG. 2). These primers were
evaluated for their ability to amplify a C. parvum 18S ssrRNA
target sequence as described in Example 1 and melting cure analysis
was performed as described in Example 2. The forward primers in
Table 2 were used with reverse primer CryJVR:
5'-ATTCCCCGTTACCCGTCA-3' (SEQ ID NO: 5).
TABLE-US-00002 TABLE 2 Labeled target-specific primers SEQ # nt in
G or C-- Hairpin ID # loop position kcal/mol Sequence*
Amplification melt 10 3 AGG-GG dG -14 AGGCGCGATACGCGCCTGGACTCA Yes
Yes TAATAACTTTACGGAT 11 4 AGG-GG dG -14 AGGCGCGATCACGCGCCTGGACTC
Yes Yes AGG- ATAATAACTTTACGGAT 12 5 GGGG dG -14
AGGCGCGATTCACGCGCCTGGGGA Yes Yes CTCATAATAACTTTACGGAT 13 3 ACCC-GG
dG -14 ACCCGCGATACGCGGGTGGACTCA Yes No TAATAACTTTACGGAT 14 4
ACCC-GG dG -14 ACCCGCGATACCGCGGGTGGACTC Yes No ACCC-
ATAATAACTTTACGGAT 15 5 GGGG dG -14 ACCCGCGATAACCGCGGGTGGGGA Yes No
CTCATAATAACTTTACGGAT 16 3 ACC-GG dG -11 ACCGCGATACGCGGTGGACTCATA
Yes No ATAACTTTACGGAT 17 4 ACC-GG dG -11 ACCGCGATCACGCGGTGGACTCAT
Yes No AATAACTTTACGGAT 18 5 ACC-GG dG -11 ACCGCGATTCACGCGGTGGACTCA
Yes No TAATAACTTTACGGAT 19 3 ACC-GG dG -7 ACCGCATAGCGGTGGACTCATAAT
Yes No AACTTTACGGAT 20 4 ACC-GG dG -7 ACCGCATCAGCGGTGGACTCATAA Yes
No TAACTTTACGGAT 21 5 ACC-GG dG -7 ACCGCATTCAGCGGTGGACTCATA Yes No
ATAACTTTACGGAT 22 3 AGG-GG dG -11 AGGCGCATAGCGCCTGGACTCATA Yes Yes
ATAACTTTACGGAT 23 3 AGG-GG dG -8 AGGCGATACGCCTGGACTCATAAT Yes Yes
AACTTTACGGAT 24 4 AGG-GG dG -11 AGGCGCATCAGCGCCTGGACTCAT Yes Yes
AATAACTTTACGGAT 25 4 AGG-GG dG -8 AGGCGATCACGCCTGGACTCATAA Yes Yes
TAACTTTACGGAT 26 5 AGG-GG dG -11 AGGCGCATTCAGCGCCTGGACTCA Yes Yes
TAATAACTTTACGGAT 27 5 AGG-GG dG -8 AGGCGATTCACGCCTGGACTCATA Yes Yes
ATAACTTTACGGAT *Italicized letters represent the stem-loop portion
of the PET Tag (e.g., 16 of FIG. 2); Gs in bold are overhang
nucleotides (e.g., 24 of FIG. 2); underlined sequence is
complimentary to the target DNA sequence (e.g., 30 of FIG. 3);
primers are labeled with FAM at the 5'-A.
[0144] As shown in Table 2, all of the primers were able to detect
target sequences using amplification. However, primers with 5'-ACC
(instead of 5'-AGG) at the 5'-end can also be used in amplification
of target but did not have the benefit of melting curve analysis.
When the fluorescently labeled 5'-A comes into proximity to GG is
quenched initially and quenching effect reduced when the
complimentary CC's are synthesized. Other parameters that influence
the sensitivity of the assay included delta G (expressed as
-kcal/mol) of the loop and number of nucleotides in loop. In some
examples, at least three nucleotides are required to form the loop
of the stem loop structure. Although the loop size can be
increased, this is generally avoided to reduce production
costs.
EXAMPLE 4
Effect of Additional G Nucleotides on 3'-End of Universal Tag
[0145] This example describes methods used to determine the effect
on fluorescence on changing the number of Gs at the 3'-end of the
PET primer.
[0146] The PET tag
5'-FAM-AGGX.sub.(1)X.sub.(2)X.sub.(3)ATAX.sub.(4)X.sub.(5)X.sub.(6)CCTG(n-
) (SEQ ID NO: 28) was used to alter the number of Gs at G(n) on the
3'-end, wherein X.sub.(1) is complementary to X.sub.(6), X.sub.(2)
is complementary to X.sub.(5), and X.sub.(3) is complementary to
X.sub.(4). In a specific example the PET tag was
5'-FAM-AGGCGCATAGCGCCTX.sub.(1) (SEQ ID NO: 29), wherein X.sub.(1)
is zero to two G residues. The following primers were used:
[0147] #1: No 3'-end Gs, forward PET-tagged sequence specific
primer was
TABLE-US-00003 SEQ ID NO: 30;
5'-FAM-AGGCGCATAGCGCCTATGACGGGTAACGGGGAAT;
[0148] #2--one 3'-end G, forward PET-tagged sequence specific
primer was
TABLE-US-00004 SEQ ID NO: 31;
5'-FAM-AGGCGCATAGCGCCTGATGACGGGTAACGGGGAAT;
and
[0149] #3--two 3'-end Gs, forward PET-tagged sequence specific
primer was
TABLE-US-00005 SEQ ID NO: 32.
5'-FAM-AGGCGCATAGCGCCTGGATGACGGGTAACGGGGAAT;
[0150] The underlined portions of the PET primers are the target
sequence-specific primer sequences (non-underlined portion is the
PET tag). All of these forward PET primers were used with reverse
sequence-specific primer CCAATTACAAAACCAAAAAGTCC (SEQ ID NO: 33) to
amplify C. parvum DNA within the 18S ssrRNA gene as follows.
[0151] The target DNA was detected with the forward and reverse
primers described above. The forward primer was labeled with FAM at
the 5'-end. DNA was extracted from C. parvum oocysts and suspended
in 80 .mu.l Tris EDTA (TE, pH 8.0) buffer. Two microliters of DNA
were added per reaction. The amplification reaction mixture
consisted of Quantifast.RTM. Probe PCR with no ROX vial kit
reaction mixture (cat #204354--Qiagen), FAM-labeled PET forward
primer and reverse primer (0.25 .mu.M each). An aliquot (2 .mu.l)
of the extracted DNA sample was added to the PCR 96 well-plate
containing 18 .mu.l reaction mixture along with appropriate
negative control were included in each experiment. The protocol
took approximately 60 minutes to complete with the following PCR
conditions: hot-start denaturation step at 95.degree. C. for 3
minutes, followed by 45 cycles with a 95.degree. C. denaturation
for 10 seconds, 60.degree. C. annealing for 50 seconds with single
fluorescence acquisition in FAM.TM. dye, HEX.TM. dye and Cy5.RTM.
dye channels on a real-time PCR instrument (7500 Real-time PCR
system). A positive result was recorded for FAM.
[0152] Traces for each of the three reactions with zero 3'-end Gs
(#1), one 3'-end G (#2), or two 3'-end Gs (#3) is shown in FIG. 9.
As shown in FIG. 9, as the number of 3'-end G's increases from zero
to two, the CT value decreases from approximately 38 (curve #1) to
34 (curve #2) to 31 (curve #3). Thus the resulting amplicons can be
detected at an earlier cycle number. Even without a G at the
3'-end, there is still an increase in fluorescence due to the
production of amplicons. This is because during the hairpin folding
stage the fluorescently-labeled nucleotide is sandwiched between
2G's on either side and even if there are no G's on one side, the
two G's on the other side quenches the fluorophore
EXAMPLE 5
Use of PET Primer in a Multiplex Format
[0153] This example describes methods used to demonstrate that PET
primers can be used in multiplex reactions.
[0154] The target DNA was detected with a forward and a reverse
primer labeled either with FAM or HEX at 5'-end, and a specific
probe labeled with Quasar.RTM. 670 dye. DNA was extracted from C.
parvum oocysts then suspended in 80 .mu.l Tris EDTA (TE, pH 8.0)
buffer. Two microliters of DNA were added per reaction. The
amplification reaction mixture consisted of Quantifast.RTM. Probe
PCR kit reaction mixture with no ROX (cat #204354--Qiagen), with
one of the following primer/probe sets:
[0155] #1: FAM-labeled forward primer
TABLE-US-00006 (SEQ ID NO: 34)
5'-FAM-AGGCGGATACCGCCTGGATGACGGGTAACGGGGAAT,
HEX-labeled reverse primer
TABLE-US-00007 (SEQ ID NO: 35)
5'-HEX-AGGCGGATACCGCCTGGCCAATTACAAAACCAAAAAGTCC
(0.25 .mu.M each) and Quas670 probe (0.2 .mu.M)
(Quas670-CGCGCCTGCTGCCTTCCTTAGATG-BHQ3; SEQ ID NO: 36); or
[0156] #2: HEX-labeled forward primer
TABLE-US-00008 (SEQ ID NO: 37)
5'-HEX-AGGCGGATACCGCCTGGATGACGGGTAACGGGGAAT,
FAM-labeled reverse primer
TABLE-US-00009 (SEQ ID NO: 38)
5'-FAM-AGGCGGATACCGCCTGGCCAATTACAAAACCAAAAAGTCC
(0.25 .mu.M each) and Quas670 probe (0.2 .mu.M; SEQ ID NO: 36)
[0157] The underlined portions of the PET primers are the target
sequence-specific primer sequences (non-underlined portion is the
PET tag). An aliquot (2 .mu.l) of the extracted DNA sample was
added to the PCR 96 well-plate containing 18 .mu.l reaction mixture
along with appropriate negative control were included in each
experiment. The protocol took approximately 30 minutes to complete
with the following PCR conditions: hot-start denaturation step at
95.degree. C. for 3 minutes, followed by 45 cycles with a
95.degree. C. denaturation for 10 seconds, 60.degree. C. annealing
for 50 seconds with single fluorescence acquisition in FAM.TM. dye,
HEX.TM. dye and Cy5.RTM. dye channels on a real-time PCR instrument
(7500 Real-time PCR system). A positive result was recorded for
FAM.TM. dye, HEX.TM. dye and Cy5.RTM. dye channels.
[0158] As shown in FIGS. 10A and 10B, amplification of the target
Cryptosporidium sequence was detected using PET forward and reverse
primers labeled with FAM (FIG. 10A) and HEX (FIG. 10B),
respectively, as indicated by an increase in fluorescence over
time. A TaqMan.RTM. probe was included in the PET primer reactions
to demonstrate that signal from a labeled probe could also be
obtained in conjunction with use of the PET primers. Fluorescence
signal from a TaqMan.RTM. probe labeled with Quasar.RTM. 670 dye at
5'-end and BHQ3 at the 3'-end (SEQ ID NO: 36) is shown in FIG. 10E.
Similar PET primer (FIGS. 10C and 10D) and TaqMan.RTM. probe (FIG.
10F) fluorescence results were obtained when the fluorophores were
switched between the forward and reverse primers (FIGS. 10C and
10D).
EXAMPLE 6
Use of PET Tags with an Array
[0159] This example describes methods that can be used to detect
the presence of a nucleic acid molecule using the disclosed PET
tags in combination with an array, such as a microarray.
[0160] In one example, the method includes amplification of a
target nucleic acid sequence using a PET tag attached to the
forward or reverse primer (e.g., see FIGS. 3A and B). The primer
not containing a PET tag can include another label, such as a
fluorophore, such as Cy3.RTM. or Cy5.RTM. dye. For example,
real-time PCR can be performed using a forward primer labeled with
a PET tag using the methods disclosed herein, and a labeled reverse
primer (for example labeled with Cy3.RTM. or Cy5.RTM. dye). The
resulting amplicons can be analyzed using the methods disclosed
herein to determine if the sample analyzed is positive or negative
for the target nucleic acid of interest.
[0161] The resulting PCR products (amplicons) from the positive
reactions can be denatured at 100.degree. C. for 2 minutes and
chilled on ice immediately prior to hybridization to an array
containing one or more nucleic acid sequence targets of interest. A
particular example of such a microarray is a DNA chip. In one
example, the amino group of the target nucleic acid molecule can be
linked at its 5'-end to the surface of the array. If the target
nucleic acid sequence is present on the array, the amplicons
previously generated (which contain at least one detectable label,
such as two detectable labels) will hybridize to the target nucleic
acid on the array. The resulting hybridization will produce an
increase in signal due to the present of the detectable label on
the amplicon. For example, if one of the primers included Cy3.RTM.
dye or Cy5.RTM. dye, the resulting Cy3.RTM. dye or Cy5.RTM. dye
labeled product will produce an increase in fluorescence intensity,
which can be detected and in some examples further quantified.
[0162] Such a method can be used to confirm the positive or
negative results obtained with amplification using a PET tag
disclosed herein.
EXAMPLE 7
Use of Universal Tags with Pyrosequencing
[0163] This example describes methods that can be used to sequence
a nucleic acid molecule using the disclosed PET tags in combination
with pyrosequencing.
[0164] In one example, the method includes amplification of a
target nucleic acid sequence using a PET tag attached to the 5'-end
of a forward or reverse primer. The primer not containing a PET tag
can include biotin at its 5'-end. The labeled forward and reverse
primers are used to amplify a target nucleic acid sequence, for
example by using real-time PCR methods disclosed herein. The
resulting amplicons can be analyzed using the methods disclosed
herein to determine if the sample analyzed is positive or negative
for the target nucleic acid of interest. The resulting amplicons
would contain a detectable biotin label.
[0165] The biotin labeled amplicon is separated after denaturation
and adhesion of the amplicons to streptavidin-coated magnetic
beads. The separated strands are then sequenced using
pyrosequencing with an appropriate sequencing primer, using methods
known in the art (for a review of pyrosequencing see Franca et al.,
Q. Rev. Biophys. 35(2):169-200, 2002).
EXAMPLE 8
Detection of a Nucleic Acid Molecule in a Subject
[0166] This example describes methods to determine if a particular
nucleic acid molecule is present, for example present in a sample
obtained from a subject.
[0167] In one example, the method includes amplification of a
target nucleic acid sequence from a sample using a PET tag attached
to the forward or reverse primer specific for the target nucleic
acid sequence. In one example, the sample is obtained from a
subject infected or suspected of being infected with a pathogen,
such as a virus, bacterium, parasite, fungi, or combinations
thereof. In this example, the target nucleic acid sequence can be a
sequence specific to the pathogen of interest, or a nucleic acid
molecule of the subject whose expression is altered (such as
increased or decreased) in response to the infection, or
combinations thereof.
[0168] In another example, the sample is obtained from a subject
having or suspected of having a disease, such as cancer. In
particular examples, the subject is being treated or has been
treated for the disease, and the method is used to determine the
subject's response to the treatment. In this example, the target
nucleic acid sequence can be a nucleic acid molecule of the subject
whose expression is altered (such as increased or decreased) due to
the disease, a control sequence (such as a sequence that detects
expression of a housekeeping gene), or combinations thereof.
Housekeeping genes are known in the art (for example see Janssens
et al., Mol. Diagn. 8(2):107-13, 2004), and can include
porphobilinogen deaminase (PBGD); mitochondrial ATP synthase 6
(mATPsy6); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Ideally, a housekeeping gene has expression levels that remain
relatively constant in different experimental conditions.
[0169] The primer not containing a PET tag can include another
label, such as a fluorophore, such as Cy3.RTM. dye or Cy5.RTM. dye.
For example, real-time PCR can be performed using a forward primer
labeled with a PET tag using the methods disclosed herein, and an
unlabeled or labeled reverse primer (for example labeled with
Cy3.RTM. dye or Cy5.RTM. dye). The resulting amplicons can be
analyzed using the methods disclosed herein to determine if the
sample analyzed is positive or negative for the target nucleic acid
of interest. If desired, the amplicons can be further analyzed, for
example using an array, to confirm the amplification results. In
some examples, quantification of the target nucleic acid is
performed.
[0170] In view of the many possible embodiments to which the
principles of the disclosure can be applied, it should be
recognized that the illustrated embodiments are only examples of
the disclosure and should not be taken as limiting the scope of the
invention. Rather, the scope of the disclosure is defined by the
following claims. We therefore claim as our invention all that
comes within the scope and spirit of these claims.
Sequence CWU 1
1
3816DNAArtificial Sequenceexemplary PET tag 1nnnngg
627DNAArtificial Sequenceexemplary PET tag 2nnnnggn
734DNAArtificial Sequenceexemplary PET tag 3nnnn 4417DNAArtificial
Sequenceexemplary PET tag 4aggcgcatag cgcctgg 17518DNAArtificial
Sequencereverse primer for amplifying C. parvum 18S ss rRNA
5attccccgtt acccgtca 18625DNAArtificial SequenceC. parvum 18S ss
rRNA sequence-specific forward primer 6ggtgactcat aataacttta cggat
25719DNAArtificial Sequenceforward Taqman primer 7atgacgggta
acggggaat 19823DNAArtificial Sequencereverse Taqman primer
8ccaattacaa aaccaaaaag tcc 23924DNAArtificial SequenceTaqman probe
9cgcgcctgct gccttcctta gatg 241040DNAArtificial Sequenceexemplary
PET primer 10aggcgcgata cgcgcctgga ctcataataa ctttacggat
401141DNAArtificial Sequenceexemplary PET primer 11aggcgcgatc
acgcgcctgg actcataata actttacgga t 411244DNAArtificial
Sequenceexemplary PET primer 12aggcgcgatt cacgcgcctg gggactcata
ataactttac ggat 441340DNAArtificial SequenceExemplary PET primer
13acccgcgata cgcgggtgga ctcataataa ctttacggat 401441DNAArtificial
SequenceExemplary PET primer 14acccgcgata ccgcgggtgg actcataata
actttacgga t 411544DNAArtificial Sequenceexemplary PET primer
15acccgcgata accgcgggtg gggactcata ataactttac ggat
441638DNAArtificial SequenceExemplary PET primer 16accgcgatac
gcggtggact cataataact ttacggat 381739DNAArtificial
SequenceExemplary PET primer 17accgcgatca cgcggtggac tcataataac
tttacggat 391840DNAArtificial SequenceExemplary PET primer
18accgcgattc acgcggtgga ctcataataa ctttacggat 401936DNAArtificial
SequenceExemplary PET primer 19accgcatagc ggtggactca taataacttt
acggat 362037DNAArtificial SequenceExemplary PET primer
20accgcatcag cggtggactc ataataactt tacggat 372138DNAArtificial
SequenceExemplary PET primer 21accgcattca gcggtggact cataataact
ttacggat 382238DNAArtificial SequenceExemplary PET primer
22aggcgcatag cgcctggact cataataact ttacggat 382336DNAArtificial
SequenceExemplary PET primer 23aggcgatacg cctggactca taataacttt
acggat 362439DNAArtificial SequenceExemplary PET primer
24aggcgcatca gcgcctggac tcataataac tttacggat 392537DNAArtificial
SequenceExemplary PET primer 25aggcgatcac gcctggactc ataataactt
tacggat 372640DNAArtificial SequenceExemplary PET primer
26aggcgcattc agcgcctgga ctcataataa ctttacggat 402738DNAArtificial
SequenceExemplary PET primer 27aggcgattca cgcctggact cataataact
ttacggat 382819DNAArtificial SequenceExemplary PET tag 28aggnnnatan
nncctgggg 192917DNAArtificial SequenceExemplary PET tag
29aggcgcatag cgcctnn 173034DNAArtificial SequenceExemplary PET
primer 30aggcgcatag cgcctatgac gggtaacggg gaat 343135DNAArtificial
Sequenceexemplary PET primer 31aggcgcatag cgcctgatga cgggtaacgg
ggaat 353236DNAArtificial SequenceExemplary PET primer 32aggcgcatag
cgcctggatg acgggtaacg gggaat 363323DNAArtificial Sequencereverse
sequence-specific primer 33ccaattacaa aaccaaaaag tcc
233436DNAArtificial SequenceExemplary PET primer 34aggcggatac
cgcctggatg acgggtaacg gggaat 363540DNAArtificial SequenceExemplary
PET primer 35aggcggatac cgcctggcca attacaaaac caaaaagtcc
403624DNAArtificial SequenceTaqman probe 36cgcgcctgct gccttcctta
gatg 243736DNAArtificial SequenceExemplary PET primer 37aggcggatac
cgcctggatg acgggtaacg gggaat 363840DNAArtificial SequenceExemplary
PET primer 38aggcggatac cgcctggcca attacaaaac caaaaagtcc 40
* * * * *