U.S. patent application number 15/032011 was filed with the patent office on 2016-09-22 for nucleic acid probe with single fluorophore label bound to internal cytosine for use in loop mediated isothermal amplification.
The applicant listed for this patent is MAST GROUP LIMITED. Invention is credited to Elizabeth Ann GILLIES, Sajid JAVED, Monika Iwona SUWARA.
Application Number | 20160273029 15/032011 |
Document ID | / |
Family ID | 49767396 |
Filed Date | 2016-09-22 |
United States Patent
Application |
20160273029 |
Kind Code |
A1 |
SUWARA; Monika Iwona ; et
al. |
September 22, 2016 |
NUCLEIC ACID PROBE WITH SINGLE FLUOROPHORE LABEL BOUND TO INTERNAL
CYTOSINE FOR USE IN LOOP MEDIATED ISOTHERMAL AMPLIFICATION
Abstract
The disclosure relates to novel probes for use in LAMP detection
methods. The probes contain a single fluorophore label bound to an
internal cytosine residue of the probe. The probes are particularly
useful in the detection of chlamydia and gonorrhea infections in a
patient.
Inventors: |
SUWARA; Monika Iwona;
(Waterloo, Merseyside, GB) ; JAVED; Sajid;
(Macclesfield, Cheshire, GB) ; GILLIES; Elizabeth
Ann; (Horwich, Bolton, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MAST GROUP LIMITED |
Bootle, Liverpool Merseyside |
|
GB |
|
|
Family ID: |
49767396 |
Appl. No.: |
15/032011 |
Filed: |
October 30, 2014 |
PCT Filed: |
October 30, 2014 |
PCT NO: |
PCT/GB2014/053238 |
371 Date: |
April 25, 2016 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6825 20130101;
C12Q 2531/101 20130101; C12Q 1/6816 20130101; C12Q 2531/119
20130101; C12Q 2565/107 20130101; C12Q 1/6844 20130101; C12Q
2563/107 20130101; C12Q 2600/16 20130101; C12Q 1/689 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 30, 2013 |
GB |
1319180.4 |
Claims
1. A probe for isothermal nucleic acid amplification comprising an
oligonucleotide probe sequence complementary to a region of a
target nucleic acid sequence, wherein said oligonucleotide probe
sequence has only one fluorophore label and which label is bound to
an internal cytosine base and wherein said oligonucleotide probe
sequence does not have a 3' end terminator.
2. The probe of claim 1, wherein the cytosine base is substantially
centrally disposed along the oligonucleotide's length except for
positions 1-3 at the 3' end and position 1 at the 5' end.
3. The probe of claim 1, wherein the oligonucleotide probe sequence
is a DNA sequence and the target nucleic acid sequence is a DNA
sequence.
4. The probe of claim 1, wherein the fluorophore comprises any one
or more selected from the group consisting of: FAM, JOE, TET, HEX,
TAMRA, ROX, ALEXA and ATTO.
5. The probe of claim 1, comprising the following sequence: 5' Xn
C*Xm 3' wherein n is >1, m>3, X is nucleotide base; and * is
fluorophore.
6. The probe of claim 5, wherein the nucleotide base is selected
from the group consisting of A, T, C and G, n is more than 1 to 20
or less and m is more than 3 to 20 or less.
7. The probe of claim 1, comprising one or more of the following
sequences: SEQ ID NO: 2: TAAGATAAC[C-FAM]CCGCACGTG (CT PB1-FAM
internal), SEQ ID NO: 4: GCGAACATA [C-ALEXA546] CAGCTATGATCAA (GC
porA7-joe loopF), or SEQ ID NO: 5: ATGTTCA [C-JOE] CATGGCGGAG (GC
glnA7-ALEXA546 loopB).
8. The probe of claim 1, wherein the target nucleic acid is from a
micro-organism, fungi, yeast or virus.
9. The probe of claim 1, wherein the probe is configured to be used
in loop-mediated isothermal nucleic acid amplification.
10. A method of detecting a target nucleic acid sequence in a
sample, the method comprising: amplifying a target nucleic acid in
the sample to provide an amplified nucleic acid; probing the
amplified nucleic acid with a probe as claimed in claim 1; and
detecting the presence of the target nucleic acid, wherein an
increases in fluorescence of the probe indicates the presence of
the target nucleic acid in the sample.
11. The method of claim 10, wherein the target nucleic acid is from
a micro-organism, fungi, yeast or virus.
12. The method of claim 10, wherein the target nucleic acid is from
Chlamydia trachomatis or Neisseria gonorrhoeae.
13. A method of diagnosing Chlamydia and/or Gonorrhea infection in
a patient, the method comprising providing a sample derived from
the patient; adding one or more probes of claim 1 to the sample;
and detecting the presence of a nucleic acid derived from Chlamydia
trachomatis and/or Neisseria gonorrhoeae, wherein an increase in
the fluorescence of the probe indicates the presence of a Chlamydia
trachomatis and/or Neisseria gonorrhoeae infection.
14. The method of claim 13, wherein a single type of probe specific
for a nucleic acid from either Chlamydia trachomatis or Neisseria
gonorrhoeae is added to the sample.
15. The method of claim 13, wherein at least two different probes
are added to the sample wherein a first probe is labelled with a
first fluorescent label and is specific for probing Chlamydia
trachomatis nucleic acid and a second probe is labelled with a
different fluorescent label to the first probe and is specific for
probing Neisseria gonorrhoeae nucleic acid.
16. The method of claim 10, wherein the probes are provided in a
buffer system comprising dNTPs at a concentration of from 1-10 mM,
one or more salts at a concentration of each salt of from 2-20 mM,
Tris pH8.8 at a concentration of from 10-100 mM, Trehalose at a
concentration of from 10-100 mM, BST polymerase at an amount of
from 1 U-12 U and 0.01%-1% 1,2 propanediol.
17. The method of claim 16, wherein the one or more salts are
selected from the group consisting of KCl, (NH.sub.4).sub.2SO.sub.4
and MgSO.sub.4.
18. A kit for detecting a target nucleic acid comprising a probe as
claimed in claim 1, a loop-mediated isothermal amplification
reagent a buffer, an enzyme, dNTPs and one or more loop-mediated
isothermal amplification primers.
19. The kit of claim 18, further comprising a positive and negative
control.
20. The kit of claim 18, wherein the reagent buffer comprises dNTPs
at a concentration of from 1-10 mM, one or more salts at a
concentration of from 2-20 mM, Tris pH8.8 at a concentration of
from 10-100 mM, Trehalose at a concentration of from 10-100 mM, BST
polymerase at an amount of from 1 U-12 U and 0.01%-1% 1,2
propanediol.
21. The kit of claim 20, wherein the one or more salts are selected
from the group consisting of KCl, (NH.sub.4).sub.2SO.sub.4 and
MgSO.sub.4.
22. The probe of claim 4, wherein the fluorophore is FAM, Joe or
Alexa546.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a probe for the detection
of a nucleic acid, a method using said probe and a kit of parts.
Preferably the probe of the invention is useful in a method for the
detection of nucleic acids derived from Chlamydia trachomatis
and/or Neisseria gonorrhoeae and may be used in the diagnosis of
Chlamydia and/or Gonorrhoea infections.
REFERENCE TO SEQUENCE LISTING
[0002] A Sequence Listing submitted as an ASCII text file via
EFS-Web is hereby incorporated by reference in accordance with 35
U.S.C. .sctn.1.52(e). The name of the ASCII text file for the
Sequence Listing is 23109675_1. TXT, the date of creation of the
ASCII text file is Apr. 12, 2016, and the size of the ASCII text
file is 17.3 KB.
BACKGROUND OF THE INVENTION
[0003] Nucleic acid amplification is one of the most valuable tools
in the life sciences field, including application-oriented fields
such as clinical medicine, in which diagnosis of infectious
diseases, genetic disorders and genetic traits is particularly
benefited. In addition to the widely used PCR-based detection
(Saiki R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T.,
Erlich, H. A. and Arnheim, N. (1985) Science, 230, 1350-1354),
several amplification methods have been invented. Examples include
nucleic acid sequence-based amplification (NASBA), self-sustained
sequence replication (3SR) and loop-mediated isothermal
amplification (LAMP). PCR uses heat denaturation of double-stranded
DNA products to promote the next round of DNA synthesis. 3SR and
NASBA eliminate heat denaturation by using a set of transcription
and reverse transcription reactions to amplify the target
sequence.
[0004] These methods can amplify target nucleic acids to a similar
magnitude, all with a detection limit of less than 10 copies and
within an hour or so. They require either a precision instrument
for amplification or an elaborate method for detection of the
amplified products due to poor specificity of target sequence
selection. Despite the simplicity and the obtainable magnitude of
amplification, the requirement for a high precision thermal cycler
in PCR prevents this powerful method from being widely used, such
as in private clinics as a routine diagnostic tool. In contrast,
LAMP is a method that can amplify a few copies of DNA to over 100
in less than an hour under isothermal conditions and with greater
specificity.
[0005] As with other molecular-probe based technologies identified
above, loop-mediated isothermal amplification (LAMP) assays can be
used to detect the presence of specific microorganisms in a sample.
However, the detection methods are based on direct visual
detection, turbidity or via a non-specific DNA intercalating dye.
Direct visual measurement is end point measurement and is unable to
provide real time analysis. Turbidity and non-specific
intercalating dyes do provide real time analysis of amplification
which occurs however this is non-specific i.e. all amplification is
detected whether this is true positive amplification or false
amplification due to mis-priming, cross specificity.
SUMMARY OF THE INVENTION
[0006] In accordance with a first aspect of the present invention
there is provided a probe for isothermal nucleic acid amplification
comprising an oligonucleotide probe sequence complementary to a
region of a target nucleic acid sequence, wherein said
oligonucleotide probe sequence has only one fluorophore ligand and
which ligand is bound to an internal cytosine base and wherein said
oligonucleotide probe sequence does not have a 3' end
terminator.
[0007] In a preferred embodiment to oligonucleotide probe sequence
is a DNA sequence and the target nucleic acid sequence is a DNA
sequence.
[0008] Preferably, fluorescence increases to indicate the presence
of the target nucleic acid in a sample.
[0009] The cytosine base is preferably substantially centrally
disposed along the oligonucleotide's length. There are particular
benefits associated with labeling the probe internally at a
cytosine base. The specificity of the DNA product amplified in an
isothermal reaction may be confirmed using a melt curve analysis.
However due to a large number of product variants generated in this
reaction and a low resolution of melt curve analysis, using
intercalating dyes like V13, it is very difficult to distinguish
between specific and unspecific DNA products generated under
isothermal conditions. Commonly used probes such as TaqMan.RTM.
probe are not compatible with LAMP technology due to the strand
displacement activity of BST polymerase. The probe of the invention
is elongated and becomes incorporated into a DNA product during
isothermal amplification, which allows for performing a melt curve
analysis on the generated product. In the probe of the invention,
the fluorophore is conjugated to an internal cytosine complementary
to guanine in the antisense strand. Guanine affects the excitation
state of many fluorophores resulting in a formation of unique melt
curve signatures and allows distinguishing between specific and
unspecific products generated under isothermal conditions.
[0010] The oligonucleotide does not contain a ddNTP at its 3' end
which enables incorporation of the labelled oligonucleotide into
the amplicon. Thus, the 3' end of the probe is not "blocked".
[0011] The fluorophore may comprise any one or more selected from
the following: FAM, JOE, TET, HEX, TAMRA, ROX, ALEXA and ATTO.
[0012] The probe may comprise the following sequence:
5' Xn C*Xm 3'
[0013] Where n is >1, m is >3, X is nucleotide base; and * is
a fluorophore. Preferably, the nucleotide base is selected from A,
T, C and G. Preferably, n is more than 1 to 20 or less, more
preferably more than 1 to 10 or less. Preferably, m is more than 3
to 20 or less, more preferably more than 3 to 10 or less. It is
contemplated that all combinations of lengths of probe covered by
the possible number of nucleotides that n or m make take by the
preceding ranges are disclosed.
[0014] Preferably, the probe may comprise a sequence selected from
any one of the following sequences:
TABLE-US-00001 SEQ ID NO. 2: TAAGATAAC[C-FAM]CCGCACGTG (CT PB1-FAM
internal) SEQ ID NO. 4: GCGAACATA [C-ALEXA546] CAGCTATGATCAA (GC
porA7- joe loopF) or SEQ ID NO. 5: ATGTTCA [C-JOE] CATGGCGGAG (GC
glnA7-ALEXA546 loopB).
[0015] The fluorescence is preferably increased when the
oligonucleotide is incorporated into the target nucleic acid
sequence which results in a change in the configuration of the
amplicon-probe complex leading to an alteration of the fluorophore
excitation state.
[0016] The cytosine bound to the fluorophore ligand is not disposed
at or proximate to the 5' or 3' end. More preferably it is not
disposed in the first 3 bases from either the 5' or 3' end.
Preferably the cytosine bound to the fluorophore is disposed at the
middle base of the probe.
[0017] In accordance with a further aspect of the present
invention, there is provided an isothermal nucleic acid
amplification probe as described hereinabove.
[0018] In accordance with a further aspect of the present
invention, there is provided a loop-mediated isothermal
amplification probe as described above.
[0019] Methods and compositions for determining at least one target
nucleic acid in a mixture of nucleic acids generally employ a
probe, a hybridizing reagent, and one or more phosphate
bond-forming enzymes associated with any required nucleotide
triphosphates to form a nucleic acid chain.
[0020] These methods usually involve amplification, such as
including the use of a promoter in conjunction with a RNA
polymerase, a restriction site where only one strand is cleaved and
is then displaced by extension with a DNA polymerase, or a circular
hybridizing reagent, where concatenated repeats are produced.
Detection of the amplified nucleic acid may take many forms but
preferably via a fluorophore.
[0021] In accordance with a further aspect of the present
invention, there is provided a method of detecting a target nucleic
acid in a sample comprising:
a. amplifying a target nucleic acid in the sample to provide an
amplified nucleic acid; b. probing the amplified nucleic acid with
a probe as described hereinabove; and c. detecting the presence of
a single or multiple target nucleic acids.
[0022] The target nucleic acid may be that from a micro-organism,
fungi, yeast, virus, human, animal, plant etc. The target nucleic
acid for LAMP is known to enable LAMP primers and appropriately
specific probes to be synthesised. Thus, the presence or absence of
said micro-organism, fungi, yeast, virus, human, animal or plant in
a sample can be determined. Preferably the target nucleic acid is
from Chlamydia trachomatis or Neisseria gonorrhoeae.
[0023] Preferably, fluorescence increases to indicate the presence
of the target nucleic acid in a sample.
[0024] The process is isothermal, and allows for amplification in a
single stage or sequential stages in a single vessel, where all of
the reagents are compatible.
[0025] In a further aspect, the present invention provides a method
of diagnosing Chlamydia and/or Gonorrhea in a patient, comprising
[0026] providing a sample derived from the patient; [0027] adding
one or more probes of the present invention to the sample; and
[0028] detecting the presence of a nucleic acid derived from
Chlamydia trachomatis and/or Neisseria gonorrhoeae wherein an
increase in the fluorescence of the probe indicates the presence of
a Chlamydia trachomatis and/or Neisseria gonorrhoeae infection.
[0029] The sample may be treated by routine methods to enable the
probe to bind with any target nucleotide present in the sample.
Such treatment may include centrifuging and lysing the sample to
release any target nucleic from the infecting microorganism.
[0030] In one embodiment, a single type of probe specific for a
nucleic acid from either Chlamydia trachomatis or Neisseria
gonorrhoeae is used in the method such that either only Chlamydia
trachomatis or only Neisseria gonorrhoeae is detected in the
sample.
[0031] In a preferred embodiment, at least two different probes are
added to the sample wherein a first probe is labelled with a first
fluorescent label and is specific for probing Chlamydia trachomatis
nucleic acid and a second probe is labelled with a different
fluorescent label to the first probe and is specific for probing
Neisseria gonorrhoeae nucleic acid. In this embodiment, it is
possible to simultaneously detect a Chlamydia and a Gonorrhea
infection in a single sample derived from a patient.
[0032] In one aspect of the method of the invention, the sample
from the patient may be a blood sample, urine sample, serum sample
or saliva sample.
[0033] In accordance with a further aspect of the present invention
there is provided a kit comprising a probe as described
hereinabove, LAMP reaction buffer containing a polymerase enzyme,
dNTPS and LAMP primers for the target.
[0034] In one embodiment a positive and negative control may be
included in the kit. The reagents may be presented as wet reagents
or in lyophilised form.
[0035] The buffer used in the method or kit of the invention
comprises dNTPs at a concentration of from 1-10 mM, one or more
salts at a concentration of from 2-20 mM, Tris pH8.8 at a
concentration of from 10-100 mM, Trehalose at a concentration of
from 10-100 mM, BST polymerase at an amount of from 1 U-12 U and
0.01%-1% 1,2 propanediol.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIG. 1 is a schematic of DNA probe of the invention.
[0037] FIGS. 2A to 2F shows amplification plots generated with the
CT PB1 (FIG. 2A and FIG. 2D), GC glnA7 (FIG. 2B and FIG. 2E) and GC
porA7 (FIG. 2C and FIG. 2F) primers in V6.21 buffer containing V13
(FIGS. 2A, 2B and 2C) or V6.21p buffer without V13 dye (FIGS. 2D,
2E and 2F).
[0038] FIGS. 3A and 3B are melt curve analyses of LAMP products
generated with CT PB1 primers in the presence of CT PB1 internal
probe conjugated with FAM. 100 pg per reaction of ATTC CT DNA
standard was used as a positive control. A--normalized reporter
plot, B--derivative reporter plot.
[0039] FIGS. 4A and B are melt curve analyses of LAMP product
generated with GC glnA7 primers in the presence of GC glnA7 loop
probe conjugated with JOE.
[0040] FIGS. 5A and 5B are melt curve analyses of LAMP product
generated with GC porA7 primers in the presence of GC porA7 loop
probe conjugated with ALEXA546. 100 pg per reaction of ATTC GC DNA
standard was used as a positive control.
[0041] FIGS. 6A to 6D show the results of a test to confirm the DNA
product specificity with a probe of the invention in loop mediated
isothermal amplification.
[0042] FIG. 7 shows amplification plots generated with CT PB1
primers in V6.21 buffer containing V13 or V6.21p buffer without V13
dye but in the presence of CT PB1 terminal probe (complementary to
loop region) with an internal C conjugated with FAM and 3'
terminator (3'ddC).
[0043] FIGS. 8A and 8B shows the amplification plots generated in
V6.21p buffer containing ROX in the presence of CT PB1 primers and
CT PB1 terminal probe with an internal cytosine conjugated with FAM
(FIG. 8A), and universal primers and 3'UP probe with 3' terminal
cytosine conjugated with FAM (FIG. 8B).
[0044] FIGS. 9A to 9C show the amplification plots generated with
CT PB1 primers in V6.21p buffer without V13 in the presence of CT
PB1 internal probe with an internal C conjugated with FAM and a
reference dye (ROX).
[0045] FIGS. 10A to 10C show the validation of CT PB1-FAM probe
specificity. FIG. 10A shows amplification plots generated with CT
PB1-FAM probe in the presence of CT DNA and CT primers.
[0046] FIGS. 11A and 11B shows the validation of CT PB1-FAM probe
against APTIMA CT assay.
[0047] FIGS. 12A and 12B show the amplification plots generated in
CT/GC multiplex with CT PB1-FAM+GC porA7-Alexa546 probes.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION
Abbreviations
[0048] CT--Chlamydia trachomatis GC--Neisseria gonorrhoeae
GlnA7--Glutamine synthetase PorA7--porin protein A7 LAMP--loop
mediated isothermal amplification PCR--polymerase chain
reaction.
[0049] The present invention will now be described, by way of
example only, with reference to the following examples and
figures.
LAMP Reaction
[0050] V13 based detection of the target CT and GT DNA by LAMP was
performed using LAMP V6.21 reaction buffer developed by the
Applicant. Probe based detection of the target DNA was performed in
V6.21p (without V13). The LAMP primer concentrations were as
follows: CT PB1-0.8 .mu.M FIP & BIP primer, 0.2 .mu.M F3 &
B3 and 0.4 .mu.M Loop primers, GC porA7 and GC glnA7--2 .mu.M FIP
& BIP primer, 0.25 .mu.M F3 & B3 and 0.5 .mu.M Loop
primers. All probes were used at a final concentration of 0.625
.mu.M. LAMP reactions were run for 60 mins at a constant
temperature of 63 C using AB17500 real-time PCR machine. Readouts
of the fluorescent signal were obtained in SybrGreen/FAM, Joe or
Cy3 channel as appropriate.
Probe Sequences
TABLE-US-00002 [0051] SEQ ID NO. 1: GTGCACGC[C-FAM]CCAATAGAAT SEQ
ID NO. 2: TAAGATAAC[C-FAM]CCGCACGTG (CT PB1-FAM internal) SEQ ID
NO. 3: TCGAGCAA[C-FAM]CGCTGTGAC[ddC] (CT PB1-FAM terminal) SEQ ID
NO. 4: GCGAACATA [C-ALEXA546] CAGCTATGATCAA (GC porA7- joe loopF)
SEQ ID NO. 5: ATGTTCA [C-JOE] CATGGCGGAG (GC glnA7-ALEXA546 loopB)
or SEQ ID NO. 6: CCA GGG TAT CTA ATC CTG TTT G [C-FAM].
Target Sequences
[0052] The target DNA sequences used in the Examples are
TABLE-US-00003 SEQ ID No. 7: Chlamydia trachomatis G/SotonG1
plasmid pSotonG1 complete sequence (GenBank: HE603235.1) 1
tttgcaactc ttggtggtag actttgcaac tcttggtggt agactttgca actcttggtg
61 gtagacttgg tcataatgga cttttgttaa aaaatttctt aaaatcttag
agctccgatt 121 ttgaatagct ttggttaaga aaatgggctc gatggctttc
cataaaagta gattgttctt 181 aacttttggg gacgcgtcgg aaatttggtt
atctacttta tctcatctaa ctagaaaaaa 241 ttatgcgtct gggattaact
ttcttgtttc tttagagatt ctggatttat cggaaacctt 301 gataaaggct
atttctcttg accacagcga atctttgttt aaaatcaagt ctctagatgt 361
ttttaatgga aaagtcgttt cagaggcctc taaacaggct agagcggcat gctacatatc
421 tttcacaaag tttttgtata gattgaccaa gggatatatt aaacccgcta
ttccattgaa 481 agattttgga aacactacat tttttaaaat ccgagacaaa
atcaaaacag aatcgatttc 541 taagcaggaa tggacagttt tttttgaagc
gctccggata gtgaattata gagactattt 601 aatcggtaaa ttgattgtac
aagggatccg taagttagac gaaattttgt ctttgcgcac 661 agacgatcta
ttttttgcat ccaatcagat ttcctttcgc attaaaaaaa gacagaataa 721
agaaaccaaa attctaatca catttcctat cagcttaatg gaagagttgc aaaaatacac
781 ttgtgggaga aatgggagag tatttgtttc taaaataggg attcctgtaa
caacaagtca 841 ggttgcgcat aattttaggc ttgcagagtt ccatagtgct
atgaaaataa aaattactcc 901 cagagtactt cgtgcaagcg ctttgattca
tttaaagcaa ataggattaa aagatgagga 961 aatcatgcgt atttcctgtc
tctcatcgag acaaagtgtg tgttcttatt gttctgggga 1021 agaggtaagt
cctctagtac aaacacccac aatattgtga tataattaaa attatattca 1081
tattctgttg ccagaaaaaa cacctttagg ctatattaga gccatcttct ttgaagcgtt
1141 gtcttctcga gaggatttat cgtacgcaaa tatcatcttt gcggttgcgt
gtcccgtgac 1201 cttcattatg tcggagtctg agcaccctag gcgtttgtac
tccgtcacag cggttgctcg 1261 aagcacgtgc ggggttatct taaaagggat
tgcagcttgt agtcctgctt gagagaacgt 1321 gcgggcgatt tgccttaacc
ccaccatttt tccggagcga gttacgaaga caaaacctct 1381 tcgttgaccg
atgtactctt gtagaaagtg cataaacttc tgaggataag ttataataat 1441
cctcttttct gtctgacggt tcttaagctg ggagaaagaa atggtagctt gttggaaaca
1501 aatctgacta atctccaagc ttaagacttc agaggagcgt ttacctcctt
ggagcattgt 1561 ctgggcgatc aaccaatccc gggcgttgat tttttttagc
tcttttagga aggatgctgt 1621 ttgcaaactg ttcatcgcat ccgtttttac
tatttccctg gttttaaaaa atgttcgact 1681 attttcttgt ttagaaggtt
gcgctatagc gactattcct tgagtcatcc tgtttaggaa 1741 tcttgttaag
gaaatatagc ttgctgctcg aacttgttta gtaccttcgg tccaagaagt 1801
cttggcagag gaaacttttt taatcgcatc taggattaga ttatgattta aaagggaaaa
1861 ctcttgcaga ttcatatcca aagacaatag accaatcttt tctaaagaca
aaaaagatcc 1921 tcgatatgat ctacaagtat gtttgttgag tgatgcggtc
caatgcataa taacttcgaa 1981 taaggagaag cttttcatgc gtttccaata
ggattcttgg cgaattttta aaacttcctg 2041 ataagacttt tcgctatatt
ctaacgacat ttcttgctgc aaagataaaa tccctttacc 2101 catgaaatcc
ctcgtgatat aacctatccg caaaatgtcc tgattagtga aataatcagg 2161
ttgttaacag gatagcacgc tcggtatttt tttatataaa catgaaaact cgttccgaaa
2221 tagaaaatcg catgcaagat atcgagtatg cgttgttagg taaagctctg
atatttgaag 2281 actctactga gtatattctg aggcagcttg ctaattatga
gtttaagtgt tcccatcata 2341 aaaacatatt catagtattt aaatacttaa
aagacaatgg attacctata actgtagact 2401 cggcttggga agagcttttg
cggcgtcgta tcaaagatat ggacaaatcg tatctcgggt 2461 taatgttgca
tgatgcttta tcaaatgaca agcttagatc cgtttctcat acggttttcc 2521
tcgatgattt gagcgtgtgt agcgctgaag aaaatttgag caatttcatt ttccgctcgt
2581 ttaatgagta caatgaaaat ccattgcgta gatctccgtt tctattgctt
gagcgtataa 2641 agggaaggct tgatagtgct atagcaaaga ctttttctat
tcgcagcgct agaggccggt 2701 ctatttatga tatattctca cagtcagaaa
ttggagtgct ggctcgtata aaaaaaagac 2761 gagcagcgtt ctctgagaat
caaaattctt tctttgatgg cttcccaaca ggatacaagg 2821 atattgatga
taaaggagtt atcttagcta aaggtaattt cgtgattata gcagctaggc 2881
catctatagg gaaaacagct ttagctatag acatggcgat aaatcttgcg gttactcaac
2941 agcgtagagt tggtttccta tctctagaaa tgagcgcagg tcaaattgtt
gagcggattg 3001 ttgctaattt aacaggaata tctggtgaaa aattacaaag
aggggatctc tctaaagaag 3061 aattattccg agtggaagaa gctggagaaa
cagttagaga atcacatttt tatatctgca 3121 gtgatagtca gtataagctt
aatttaatcg cgaatcagat ccggttgctg agaaaagaag 3181 atcgagtaga
cgtaatattt atcgattact tgcagttgat caactcatcg gttggagaaa 3241
atcgtcaaaa tgaaatagca gatatatcta gaaccttaag aggtttagcc tcagagctaa
3301 acattcctat agtttgttta tcccaactat ctagaaaagt tgaggataga
gcaaataaag 3361 ttcccatgct ttcagatttg cgagacagcg gtcaaataga
gcaagacgca gatgtgattt 3421 tgtttatcaa taggaaggaa tcgtcttcta
attgtgagat aactgttggg aaaaatagac 3481 atggatcggt tttctcttcg
gtattacatt tcgatccaaa aattagtaaa ttctccgcta 3541 ttaaaaaagt
atggtaaatt atagtaactg ccacttcatc aaaagtccta tccaccttga 3601
aaatcagaag tttggaagaa gacctggtca atctattaag atatctccca aattggctca
3661 aaatgggatg gtagaagtta taggtcttga ttttctttca tctcattacc
atgcattagc 3721 agctatccaa agattactga ccgcaacgaa ttacaagggg
aacacaaaag gggttgtttt 3781 atccagagaa tcaaatagtt ttcaatttga
aggatggata ccaagaatcc gttttacaaa 3841 aactgaattc ttagaggctt
atggagttaa gcggtataaa acatccagaa ataagtatga 3901 gtttagtgga
aaagaagctg aaactgcttt agaagccttg taccatttag gacatcaacc 3961
gtttttaata gtggcaacta gaactcgatg gactaatgga acacaaatag tagaccgtta
4021 ccaaactctt tctccgatca ttaggattta cgaaggatgg gaaggtttaa
ctgacgaaga 4081 aaatatagat atagacttaa caccttttaa ttcaccatct
acacggaaac ataaaggatt 4141 cgttgtagag ccatgtccta tcttggtaga
tcaaatagaa tcctactttg taatcaagcc 4201 tgcaaatgta taccaagaaa
taaaaatgcg tttcccaaac gcatcaaagt atgcttacac 4261 atttatcgac
tgggtgatta cagcagctgc gaaaaagaga cgaaaattaa ctaaggataa 4321
ttcttggcca gaaaacttgt tattaaacgt taacgttaaa agtcttgcat atattttaag
4381 gatgaatcgg tacatctgta caaggaactg gaaaaaaatc gagttagcta
tcgataaatg 4441 tatagaaatc gccattcagc ttggctggtt atctagaaga
aaacgcattg aatttctgga 4501 ttcttctaaa ctctctaaaa aagaaattct
atatctaaat aaagagcgct ttgaagaaat 4561 aactaagaaa tctaaagaac
aaatggaaca agaatctatt aattaatagc aggcttgaaa 4621 ctaaaaacct
aatttattta aagctcaaaa taaaaaagag ttttaaaatg ggaaattctg 4681
gtttttattt gtataacact gaaaactgcg tctttgctga taatatcaaa gttgggcaaa
4741 tgacagagcc gctcaaggac cagcaaataa tccttgggac aaaatcaaca
cctgtcgcag 4801 ccaaaatgac agcttctgat ggaatatctt taacagtctc
caataattca tcaaccaatg 4861 cttctattac aattggtttg gatgcggaaa
aagcttacca gcttattcta gaaaagttgg 4921 gaaatcaaat tcttgatgga
attgctgata ctattgttga tagtacagtc caagatattt 4981 tagacaaaat
cacaacagac ccttctctag gtttgttgaa agcttttaac aactttccaa 5041
tcactaataa aattcaatgc aacgggttat tcactcccag taacattgaa actttattag
5101 gaggaactga aataggaaaa ttcacagtca cacccaaaag ctctgggagc
atgttcttag 5161 tctcagcaga tattattgca tcaagaatgg aaggcggcgt
tgttctagct ttggtacgag 5221 aaggtgattc taagccctgc gcgattagtt
atggatactc atcaggcgtt cctaatttat 5281 gtagtctaag aaccagcatt
actaatacag gattgactcc aacaacgtat tcattacgtg 5341 taggcggttt
agaaagcggt gtggtatggg ttaatgccct ttctaatggc aatgatattt 5401
taggaataac aaatacttct aatgtatctt ttttggaagt aatacctcaa acaaacgctt
5461 aaacaatttt tattggattt ttcttatagg ttttatattt agagaaaaca
gttcgaatta 5521 cggggtttgt tatgcaaaat aaaagaaaag tgagggacga
ttttattaaa attgttaaag 5581 atgtgaaaaa agatttcccc gaattagacc
taaaaatacg agtaaacaag gaaaaagtaa 5641 ctttcttaaa ttctccctta
gaactctacc ataaaagtgt ctcactaatt ctaggactgc 5701 ttcaacaaat
agaaaactct ttaggattat tcccagactc tcctgttctt gaaaaattag 5761
aggataacag tttaaagcta aaaaaggctt tgattatgct tatcttgtct agaaaagaca
5821 tgttttccaa ggctgaatag acaacttact ctaacgttgg agttgatttg
cacaccttag 5881 ttttttgctc ttttaaggga ggaactggaa aaacaacact
ttctctaaac gtgggatgca 5941 acttggccca atttttaggg aaaaaagtgt
tacttgctga cctagacccg caatccaatt 6001 tatcttctgg attgggggct
agtgtcagaa ataaccaaaa aggcttgcac gacatagtat 6061 acaaatcaaa
cgatttaaaa tcaatcattt gcgaaacaaa aaaagatagt gtggacctaa 6121
ttcctgcatc atttttatcc gaacagttta gagaattgga tattcataga ggacctagta
6181 acaacttaaa gttatttctg aatgagtact gcgctccttt ttatgacatc
tgcataatag 6241 acactccacc tagcctagga gggttaacga aagaagcttt
tgttgcagga gacaaattaa 6301 ttgcttgttt aactccagaa cctttttcta
ttctagggtt acaaaagata cgtgaattct 6361 taagttcggt cggaaaacct
gaagaagaac acattcttgg aatagctttg tctttttggg 6421 atgatcgtaa
ctcgactaac caaatgtata tagacattat cgagtctatt tacaaaaaca 6481
agcttttttc aacaaaaatt cgtcgagata tttctctcag ccgttctctt cttaaagaag
6541 attctgtagc taatgtctat ccaaattcta gggccgcaga agatattctg
aagttaacgc 6601 atgaaatagc aaatattttg catatcgaat atgaacgaga
ttactctcag aggacaacgt 6661 gaacaaacta aaaaaagaag cggatgtctt
ttttaaaaaa aatcaaactg ccgcttctct 6721 agattttaag aagacacttc
cttccattga actattctca gcaactttga attctgagga 6781 aagtcagagt
ttggatcgat tatttttatc agagtcccaa aactattcgg atgaagaatt 6841
ttatcaagaa gacatcctag cggtaaaact gcttactggt cagataaaat ccatacagaa
6901 gcaacacgta cttcttttag gagaaaaaat ctataatgct agaaaaatcc
tgagtaagga 6961 tcacttctcc tcaacaactt tttcatcttg gatagagtta
gtttttagaa ctaagtcttc 7021 tgcttacaat gctcttgcat attacgagct
ttttataaac ctccccaacc aaactctaca 7081 aaaagagttt caatcgatcc
cctataaatc cgcatatatt ttggccgcta gaaaaggcga 7141 tttaaaaacc
aaggtcgatg tgatagggaa agtatgtgga atgtcgaact catcggcgat 7201
aagggtgttg gatcaatttc ttccttcatc tagaaacaaa gacgttagag aaacgataga
7261 taagtctgat ttagagaaga atcgccaatt atctgatttc ttaatagaga
tacttcgcat 7321 catatgttcc ggagtttctt tgtcctccta taacgaaaat
cttctacaac agctttttga 7381 actttttaag caaaagagct gatcctccgt
cagctcatat atatatttat tatatatata
7441 tttatttagg gatttgattt tacgagagag a SEQ ID No. 8: Neisseria
gonorrhoeae partial porA gene for class 1 outer membrane protein,
isolate GC3 (GenBank: HE681886.1) 1 gccggcggcg gcgcgacccg
ttggggcaat agggaatcct ttgtcggctt ggcaggcgaa 61 ttcggcacgc
tgcgcgccgg ccgcgttgcg aatcagtttg acgatgccag ccaagccatt 121
gatccttggg acagcaacaa tgatgtggct tcgcaattgg gtattttcaa acgccacgac
181 gatatgccgg tttccgtacg ctacgactcc ccggactttt ccggtttcag
cggcagcgtc 241 caattcgttc cggctcaaaa cagcaagtcc gcctatacgc
cggctcattg gactactgtg 301 tataacacta acggtactac tactactttc
gttccggctg ttgtcggcaa gcccggatcg 361 gatgtgtatt atgccggtct
gaattacaaa aatggcggtt ttgccgggaa ctatgccttt 421 aaatatgcga
gacacgccaa tgtcggacgt aatgcttttg agttgttctt gctcggcagt 481
gggagtgatg aagccaaagg taccgatccc ttgaaaaacc atcaggtaca ccgcctgacg
541 ggcggctatg gggaaggcgg cttgaatctc gccttggcgg ctcagttgga
tttgtctgaa 601 aatgccgaca aaaccaaaaa cagtacgacc gaaattgccg
ccactgcttc ctaccgcttc 661 ggtaatacag tcccgcgcat cagctatgcc
catggtttcg actttgtcga acgcagtcag 721 aaacgcgaac ataccagcta tga SEQ
ID No. 9: Neisseria gonorrhoeae glutamine synthetase (glnA) gene,
glnA-14 allele, partial cds (GenBank: AF520262.1) 1 cccgctttgt
cgatttgcgc ttcaccgata ccaaaggcaa gcagcaccac tttaccgtgc 61
ctgcgcgcat cgtgttggaa gaccccgaag agtggtttga aaacggaccg gcgtttgacg
121 gctcgtccat cggcggctgg aaaggcattg aggcttccga tatgcagctg
cgtcccgatg 181 cgtccacagc cttcgtcgat cctttttatg atgatgttac
cgtcgtcatt acctgcgacg 241 tcatcgaccc tgccgacggt cagggttacg
accgcgaccc gcgctccatc gcacgccgcg 301 ccgaagccta tttgaaatct
tccggtatcg gcgacaccgc ctatttcggc cccgaacccg 361 aattcttcgt
cttcgacggc gtagaatttg aaaccgacat gcacaaaacc cgttacgaaa 421
tcacgtccga aagcggcgcg tgggcaagcg gcctgcatat ggacggtcaa aacaccggcc
481 accgccccgc cgtcaaaggc ggctacgcgc ccgtcgcgcc gattgactgc
ggtcaagatt 541 tgcgctccgc catggtgaac attttggaag gactcggcat
cgaagtcgaa gtccaccaca 601 gcgaagtcgg taccggcagc caaatggaaa
tcggcacccg tttcgccact ttggtcaaac 661 gcgccgacca aacccaagat
atgaaatacg tcatccaaaa cgttgcccac aatttcggca 721 aaaccgccac
ctttatgccc aaaccgatta tgggcgacaa cggcagcggt atgcacgtcc 781
accaatccat ttggaaagac ggtcaaaacc tgttcgcagg cgacggctat gccggtttgt
841 ccgataccgc gctctactac atcggcggca tcatcaaaca cgccaaagcc
ctgaacgcga 901 ttaccaatcc gtccaccaac tcctacaaac gcctcgtgcc
gcactttgaa gcaccgacca 961 aattggccta ttccgccaaa aaccgttccg
cttccatccg tatcccgtct gtgaacagca 1021 gcaaggcgcg ccgcatcgaa
gcgcgtttcc ccgacccgac cgccaacccg tatttggcat 1081 ttgccgccct
gctgatggcc ggtttggacg gcattcaaaa caaaatccat ccgggcgacc 1141
ctgccgataa aaacctgtac gacctgccgc cggaagaaga cgcgctcgtc ccgaccgtct
1201 gcgcttcttt ggaagaagca cttgccgccc tcaaggtcga ccacgaattc
ctgctgcgcg 1261 gcggcgtgtt cagcaaagac tggatcgaca gctacatcgc
ctttaaagag gaagatgtcc 1321 gccgcatccg tatggcgccg cacccgctgg
aatttg
[0053] The primer sequences used in the LAMP reaction are as
follows:
CT Plasmid
TABLE-US-00004 [0054] (SEQ ID No. 10) F3 TCTACAAGAGTACATCGGTCA (SEQ
ID No. 11) B3 TGAAGCGTTGTCTTCTCG (SEQ ID No. 12) FIP
GCAGCTTGTAGTCCTGCTTGAGTCTTCGTAACTCGCTCC (SEQ ID No. 13) BIP
TCGAGCAACCGCTGTGACCCTTCATTATGTCGGAGTCTG (SEQ ID No. 14) LF1
CGGGCGATTTGCCTTAAC (SEQ ID No. 15) LB1 TACAAACGCCTAGGGTGC
GC porA7
TABLE-US-00005 (SEQ ID No. 16) F3 ACCAAAAACAGTACGACCGA (SEQ ID No.
17) B3 AAGTGCGCTTGGAAAAATCG (SEQ ID No. 18)
FIPATGGGCATAGCTGATGCGCGAATTGCCGCCACTGCTTC (SEQ ID No. 19) BIP
TCGACTTTGTCGAACGCAGTCAAATCGACACCGGCGATGA (SEQ ID No. 20) LoopF1
GCGAACATACCAGCTATGATCAA
GC glnA7
TABLE-US-00006 (SEQ ID No. 21) F3 TCATATCTTGGGTTTGGTCG (SEQ ID No.
22) B3 CTGCATATGGACGGTCAAA (SEQ ID No. 23) FiP
CGAAGTCCACCACAGCGAATTTGACCAAAGTGGCGAA (SEQ ID No. 24) BiP
CTTCGATGCCGAGTCCTTCCGATTGACTGCGGTCAAGAT (SEQ ID No. 25) LF
CAAATGGAAATCGGCACCC (SEQ ID No. 26) LB ATGTTCACCATGGCGGAG
Buffer
[0055] The Applicant has developed a buffer system for use with the
probes of the invention and is designated V6.21 (or V6.21p without
V13 dye present) in the following Examples. The concentrations of
the buffer components are after buffer reconstitution:
V6.21
[0056] 4-10 mM dNTP's, 10 mM salt, 30 mM Tris pH8.8, 30 mM
Trehalose, 1-8 U Bst polymerase, Dye and 0.05% propanediol.
V6.21p
[0057] 4-10 mM dNTP's, 10 mM salt, 30 mM Tris pH8.8, 30 mM
Trehalose, 1-8 U Bst polymerase, and 0.05% propanediol.
PCR
[0058] CT/GC detection in clinical samples by real-time PCR was
performed using APTIMA CT/GC multiplex (Gen-Probe) according to the
manufacturer's instructions.
Agarose Gel Electrophoresis
[0059] DNA electrophoresis was conducted in 1% agarose gel
1.times.TAE buffer at 100V. LAMP DNA products were vitalized with
GelRed (Invitrogen) with transilluminator.
[0060] V6.21 and V6.21p buffer were developed by the Applicant.
LAMP primers were obtained from Eurofins. Fluorophore-labelled
oligonucleotides were purchased from Integrated DNA technologies.
Tris buffer, agarose gel and PCR grade water were purchased from
Sigma. CT and GC DNA standards were obtained from ATCC.
FIGURES
[0061] FIG. 1 is a schematic of DNA probe of the invention. The
probe consists of an oligonucleotide with an internal cytosine
conjugated with a defined fluorophore. The probe may be
complementary to the internal region of the amplicon flanked by Flp
and Blp primers or it may be a modified LoopF or LoopB primer
internally labeled with a fluorophore.
Example 1
[0062] FIGS. 2A to 2F shows amplification plots generated with the
CT PB1 (FIG. 2A and FIG. 2D), GC glnA7 (FIG. 2B and FIG. 2E) and GC
porA7 (FIG. 2C and FIG. 2F) primers in V6.21 buffer containing V13
(FIGS. 2A, 2B and 2C) or V6.21p buffer without V13 dye (FIGS. 2D,
2E and 2F). The target sequences shown in SEQ ID NOs. 7 to 9 with
CT PB1 internal probe conjugated with FAM, GC glnA7 loop probe
conjugated with Joe and GC porA7 loop probe conjugated with
Alexa546 respectively. All reactions were performed for 60 mins at
a constant temperature of 63 C with AB17500 machine.
Example 2
[0063] FIGS. 3A and 3B are melt curve analyses of LAMP products
generated with CT PB1 primers in the presence of CT PB1 internal
probe conjugated with FAM. 100 pg per reaction of ATTC CT DNA
standard was used as a positive control. A--normalized reporter
plot, B--derivative reporter plot. Melt curve plots were generated
based on the readouts in FAM channel with AB17500 machine.
Example 3
[0064] FIGS. 4A and B are melt curve analyses of LAMP product
generated with GC glnA7 primers in the presence of GC glnA7 loop
probe conjugated with JOE. 100 pg per reaction of ATTC GC DNA
standard was used as a positive control. FIG. 4A shows a normalized
reporter plot and FIG. 4B shows a derivative reporter plot. Melt
curve plots were generated based on the readouts in JOE channel
with AB17500 machine.
Example 4
[0065] FIGS. 5A and 5B are melt curve analyses of LAMP product
generated with GC porA7 primers in the presence of GC porA7 loop
probe conjugated with ALEXA546. 100 pg per reaction of ATTC GC DNA
standard was used as a positive control. FIG. 5A shows a normalized
reporter plot, FIG. 4B shows a derivative reporter plot. Melt curve
plots were generated based on the readouts in Cy3 channel with
AB17500 machine.
Example 5
[0066] FIGS. 6A to 6D show the results of a test to confirm the DNA
product specificity with a probe of the invention in loop mediated
isothermal amplification. The late amplification time of the false
positives (more than 30 mins after the lowest target DNA
concentration detectable in the LAMP reaction (100 fg GC DNA)
indicates that the unspecific amplification may be a result of
primer dimer formation. The standard melt curve analysis does not
allow to distinguish between the specific and unspecific product in
this LAMP reaction, but the unspecific product may be recognized
with the probe of the invention. GC DNA was amplified with GC porA7
primers and visualized with V13 dye or GC porA7-ALEXA546 probe as
appropriate.
Example 6
[0067] FIG. 7 shows the amplification plots generated with CT PB1
primers in V6.21 buffer containing V13 or V6.21p buffer without V13
dye but in the presence of CT PB1 terminal probe (complementary to
loop region) with an internal C conjugated with FAM and 3'
terminator (3'ddC). Despite a successful amplification of the
target DNA confirmed by excitation of the V13 dye in the control
reaction, CT PB1 probe with 3' terminator did not generate a
positive signal.
Example 7
[0068] FIGS. 8A and 8B shows the amplification plots generated in
V6.21p buffer containing ROX in the presence of CT PB1 primers and
CT PB1 terminal probe with an internal cytosine conjugated with FAM
(FIG. 8A), and universal primers and 3'UP probe with 3' terminal
cytosine conjugated with FAM (FIG. 8B). The first line represents
signals generated by ROX, and the second line corresponds to the
signal generated in the FAM channel. Binding of the probe with an
internally labeled C to the target DNA results in FAM excitation.
Binding of the probe with a 3' end C labeled to the target does not
alter the FAM excitation state.
Example 8
[0069] FIGS. 9A to 9C show the amplification plots generated with
CT PB1 primers in V6.21p buffer without V13 in the presence of CT
PB1 internal probe with an internal C conjugated with FAM and a
reference dye (ROX). FIG. 9A show raw data, readouts from the FAM
channel in the first line and from the ROX channel in a second
line. FIG. 9B shows amplification plots (generated in FAM channel)
normalized to ROX. FIG. 9C shows derivative reporter melt curve
plots.
Example 9
[0070] FIGS. 10A to 10C show the validation of CT PB1-FAM probe
specificity. FIG. 10A shows amplification plots generated with CT
PB1-FAM probe in the presence of CT DNA and CT primers. As a
control, two sets of reactions were performed where unspecific
genes, GC glnA7 and GC porA7 were amplified with the corresponding
LAMP primers in the presence of CT PB1-FAM probe. In V6.21p buffer
the amplification plots in the presence of CT PB1 probe in the FAM
channel were generated only when CT DNA was present in the reaction
and no signal was generated when unspecific genes (GC glnA7 and GC
porA7) were amplified. No signal was also generated when an
unspecific probe was used in a reaction where CT DNA was amplified
with CT primers. FIG. 10C shows data obtained in an analogous
experiment but conducted in V6.21 buffer containing an
intercalating dye V31. FIG. 10C shows DNA products generated in the
experiment described in FIG. 10A.
Example 10
[0071] FIGS. 11A and 11B shows the validation of CT PB1-FAM probe
against APTIMA CT assay. Fifty clinical samples confirmed to be
positive (n=29) (FIG. 11A) or negative (n=21) (FIG. 11B) for CT
were tested in V6.21p buffer with CT PB1-FAM probe. Out of 50
samples 24 tested negative (FIG. 11A) and 26 tested positive (FIG.
11B) for CT with CT PB1-FAM probe. There was 86% agreement between
the Aptima and CT PB-FAM tests.
Example 11
[0072] FIGS. 12A and 12B show the amplification plots generated in
CT/GC multiplex with CT PB1-FAM+GC porA7-Alexa546 probes. CT and GC
DNA was amplified in separate reactions or in conjugation in V6.21p
buffer in the presence of CT PB1-FAM and GC porA7-Alexa546 probes.
The readouts were taken in Cy3 (FIG. 12A) and FAM (FIG. 12B)
channels. The experiment revealed that two DNA targets may be
amplified and detected in a simultaneous reaction with FAM and
Alexa546 labeled probes and that there was no cross reactivity
between CT PB1 and GC porA7 primers and probes.
Example 12
[0073] Table1 shows a comparison between V13 LAMP for CT and GC,
CT/GC Aptima and CT/GC multiplex (CT PB1-FAM+GC porA7-Alexa546).
DNA extracted from 136 clinical samples was tested with CT/GC
Aptima multiplex, CT PB1 and GC porA7 primers in V6.21 buffer
containing V13 or in a multiplex reaction in v6.21p buffer in the
presence of CT PB1 and GC porA7 primers and CT PB1-FAM and GC
porA7-Alexa546 probes. In a control experiment the samples were
also tested in a simplex reaction with GC glnA7-joe probe. The
table shows the agreement scores between the tests.
TABLE-US-00007 TABLE 1 Comparison between V13-based LAMP for CT and
GC, CT/GC Aptima multiplex and CT/GC MAST multiplex (CT PB1-FAM +
GC porA7-Alexa546). (Test on 136 clinical samples) Tests compared
Agreement score CT LAMP vs CT PB1-FAM in multiplex 92% GC LAMP vs.
GC porA7-Alexa546 in multiplex 94% CT in multiplex vs CT Aptima 83%
GC in multiplex vs GC Aptima 86%
Sequence CWU 1
1
26119DNAArtificial Sequenceprobe 1gtgcacgccc caatagaat
19219DNAArtificial Sequenceprobe 2taagataacc ccgcacgtg
19318DNAArtificial Sequenceprobe 3tcgagcaacc gctgtgac
18423DNAArtificial Sequenceprobe 4gcgaacatac cagctatgat caa
23518DNAArtificial Sequenceprobe 5atgttcacca tggcggag
18623DNAArtificial Sequenceprobe 6ccagggtatc taatcctgtt tgc
2377471DNAChlamydia trachomatis 7tttgcaactc ttggtggtag actttgcaac
tcttggtggt agactttgca actcttggtg 60gtagacttgg tcataatgga cttttgttaa
aaaatttctt aaaatcttag agctccgatt 120ttgaatagct ttggttaaga
aaatgggctc gatggctttc cataaaagta gattgttctt 180aacttttggg
gacgcgtcgg aaatttggtt atctacttta tctcatctaa ctagaaaaaa
240ttatgcgtct gggattaact ttcttgtttc tttagagatt ctggatttat
cggaaacctt 300gataaaggct atttctcttg accacagcga atctttgttt
aaaatcaagt ctctagatgt 360ttttaatgga aaagtcgttt cagaggcctc
taaacaggct agagcggcat gctacatatc 420tttcacaaag tttttgtata
gattgaccaa gggatatatt aaacccgcta ttccattgaa 480agattttgga
aacactacat tttttaaaat ccgagacaaa atcaaaacag aatcgatttc
540taagcaggaa tggacagttt tttttgaagc gctccggata gtgaattata
gagactattt 600aatcggtaaa ttgattgtac aagggatccg taagttagac
gaaattttgt ctttgcgcac 660agacgatcta ttttttgcat ccaatcagat
ttcctttcgc attaaaaaaa gacagaataa 720agaaaccaaa attctaatca
catttcctat cagcttaatg gaagagttgc aaaaatacac 780ttgtgggaga
aatgggagag tatttgtttc taaaataggg attcctgtaa caacaagtca
840ggttgcgcat aattttaggc ttgcagagtt ccatagtgct atgaaaataa
aaattactcc 900cagagtactt cgtgcaagcg ctttgattca tttaaagcaa
ataggattaa aagatgagga 960aatcatgcgt atttcctgtc tctcatcgag
acaaagtgtg tgttcttatt gttctgggga 1020agaggtaagt cctctagtac
aaacacccac aatattgtga tataattaaa attatattca 1080tattctgttg
ccagaaaaaa cacctttagg ctatattaga gccatcttct ttgaagcgtt
1140gtcttctcga gaggatttat cgtacgcaaa tatcatcttt gcggttgcgt
gtcccgtgac 1200cttcattatg tcggagtctg agcaccctag gcgtttgtac
tccgtcacag cggttgctcg 1260aagcacgtgc ggggttatct taaaagggat
tgcagcttgt agtcctgctt gagagaacgt 1320gcgggcgatt tgccttaacc
ccaccatttt tccggagcga gttacgaaga caaaacctct 1380tcgttgaccg
atgtactctt gtagaaagtg cataaacttc tgaggataag ttataataat
1440cctcttttct gtctgacggt tcttaagctg ggagaaagaa atggtagctt
gttggaaaca 1500aatctgacta atctccaagc ttaagacttc agaggagcgt
ttacctcctt ggagcattgt 1560ctgggcgatc aaccaatccc gggcgttgat
tttttttagc tcttttagga aggatgctgt 1620ttgcaaactg ttcatcgcat
ccgtttttac tatttccctg gttttaaaaa atgttcgact 1680attttcttgt
ttagaaggtt gcgctatagc gactattcct tgagtcatcc tgtttaggaa
1740tcttgttaag gaaatatagc ttgctgctcg aacttgttta gtaccttcgg
tccaagaagt 1800cttggcagag gaaacttttt taatcgcatc taggattaga
ttatgattta aaagggaaaa 1860ctcttgcaga ttcatatcca aagacaatag
accaatcttt tctaaagaca aaaaagatcc 1920tcgatatgat ctacaagtat
gtttgttgag tgatgcggtc caatgcataa taacttcgaa 1980taaggagaag
cttttcatgc gtttccaata ggattcttgg cgaattttta aaacttcctg
2040ataagacttt tcgctatatt ctaacgacat ttcttgctgc aaagataaaa
tccctttacc 2100catgaaatcc ctcgtgatat aacctatccg caaaatgtcc
tgattagtga aataatcagg 2160ttgttaacag gatagcacgc tcggtatttt
tttatataaa catgaaaact cgttccgaaa 2220tagaaaatcg catgcaagat
atcgagtatg cgttgttagg taaagctctg atatttgaag 2280actctactga
gtatattctg aggcagcttg ctaattatga gtttaagtgt tcccatcata
2340aaaacatatt catagtattt aaatacttaa aagacaatgg attacctata
actgtagact 2400cggcttggga agagcttttg cggcgtcgta tcaaagatat
ggacaaatcg tatctcgggt 2460taatgttgca tgatgcttta tcaaatgaca
agcttagatc cgtttctcat acggttttcc 2520tcgatgattt gagcgtgtgt
agcgctgaag aaaatttgag caatttcatt ttccgctcgt 2580ttaatgagta
caatgaaaat ccattgcgta gatctccgtt tctattgctt gagcgtataa
2640agggaaggct tgatagtgct atagcaaaga ctttttctat tcgcagcgct
agaggccggt 2700ctatttatga tatattctca cagtcagaaa ttggagtgct
ggctcgtata aaaaaaagac 2760gagcagcgtt ctctgagaat caaaattctt
tctttgatgg cttcccaaca ggatacaagg 2820atattgatga taaaggagtt
atcttagcta aaggtaattt cgtgattata gcagctaggc 2880catctatagg
gaaaacagct ttagctatag acatggcgat aaatcttgcg gttactcaac
2940agcgtagagt tggtttccta tctctagaaa tgagcgcagg tcaaattgtt
gagcggattg 3000ttgctaattt aacaggaata tctggtgaaa aattacaaag
aggggatctc tctaaagaag 3060aattattccg agtggaagaa gctggagaaa
cagttagaga atcacatttt tatatctgca 3120gtgatagtca gtataagctt
aatttaatcg cgaatcagat ccggttgctg agaaaagaag 3180atcgagtaga
cgtaatattt atcgattact tgcagttgat caactcatcg gttggagaaa
3240atcgtcaaaa tgaaatagca gatatatcta gaaccttaag aggtttagcc
tcagagctaa 3300acattcctat agtttgttta tcccaactat ctagaaaagt
tgaggataga gcaaataaag 3360ttcccatgct ttcagatttg cgagacagcg
gtcaaataga gcaagacgca gatgtgattt 3420tgtttatcaa taggaaggaa
tcgtcttcta attgtgagat aactgttggg aaaaatagac 3480atggatcggt
tttctcttcg gtattacatt tcgatccaaa aattagtaaa ttctccgcta
3540ttaaaaaagt atggtaaatt atagtaactg ccacttcatc aaaagtccta
tccaccttga 3600aaatcagaag tttggaagaa gacctggtca atctattaag
atatctccca aattggctca 3660aaatgggatg gtagaagtta taggtcttga
ttttctttca tctcattacc atgcattagc 3720agctatccaa agattactga
ccgcaacgaa ttacaagggg aacacaaaag gggttgtttt 3780atccagagaa
tcaaatagtt ttcaatttga aggatggata ccaagaatcc gttttacaaa
3840aactgaattc ttagaggctt atggagttaa gcggtataaa acatccagaa
ataagtatga 3900gtttagtgga aaagaagctg aaactgcttt agaagccttg
taccatttag gacatcaacc 3960gtttttaata gtggcaacta gaactcgatg
gactaatgga acacaaatag tagaccgtta 4020ccaaactctt tctccgatca
ttaggattta cgaaggatgg gaaggtttaa ctgacgaaga 4080aaatatagat
atagacttaa caccttttaa ttcaccatct acacggaaac ataaaggatt
4140cgttgtagag ccatgtccta tcttggtaga tcaaatagaa tcctactttg
taatcaagcc 4200tgcaaatgta taccaagaaa taaaaatgcg tttcccaaac
gcatcaaagt atgcttacac 4260atttatcgac tgggtgatta cagcagctgc
gaaaaagaga cgaaaattaa ctaaggataa 4320ttcttggcca gaaaacttgt
tattaaacgt taacgttaaa agtcttgcat atattttaag 4380gatgaatcgg
tacatctgta caaggaactg gaaaaaaatc gagttagcta tcgataaatg
4440tatagaaatc gccattcagc ttggctggtt atctagaaga aaacgcattg
aatttctgga 4500ttcttctaaa ctctctaaaa aagaaattct atatctaaat
aaagagcgct ttgaagaaat 4560aactaagaaa tctaaagaac aaatggaaca
agaatctatt aattaatagc aggcttgaaa 4620ctaaaaacct aatttattta
aagctcaaaa taaaaaagag ttttaaaatg ggaaattctg 4680gtttttattt
gtataacact gaaaactgcg tctttgctga taatatcaaa gttgggcaaa
4740tgacagagcc gctcaaggac cagcaaataa tccttgggac aaaatcaaca
cctgtcgcag 4800ccaaaatgac agcttctgat ggaatatctt taacagtctc
caataattca tcaaccaatg 4860cttctattac aattggtttg gatgcggaaa
aagcttacca gcttattcta gaaaagttgg 4920gaaatcaaat tcttgatgga
attgctgata ctattgttga tagtacagtc caagatattt 4980tagacaaaat
cacaacagac ccttctctag gtttgttgaa agcttttaac aactttccaa
5040tcactaataa aattcaatgc aacgggttat tcactcccag taacattgaa
actttattag 5100gaggaactga aataggaaaa ttcacagtca cacccaaaag
ctctgggagc atgttcttag 5160tctcagcaga tattattgca tcaagaatgg
aaggcggcgt tgttctagct ttggtacgag 5220aaggtgattc taagccctgc
gcgattagtt atggatactc atcaggcgtt cctaatttat 5280gtagtctaag
aaccagcatt actaatacag gattgactcc aacaacgtat tcattacgtg
5340taggcggttt agaaagcggt gtggtatggg ttaatgccct ttctaatggc
aatgatattt 5400taggaataac aaatacttct aatgtatctt ttttggaagt
aatacctcaa acaaacgctt 5460aaacaatttt tattggattt ttcttatagg
ttttatattt agagaaaaca gttcgaatta 5520cggggtttgt tatgcaaaat
aaaagaaaag tgagggacga ttttattaaa attgttaaag 5580atgtgaaaaa
agatttcccc gaattagacc taaaaatacg agtaaacaag gaaaaagtaa
5640ctttcttaaa ttctccctta gaactctacc ataaaagtgt ctcactaatt
ctaggactgc 5700ttcaacaaat agaaaactct ttaggattat tcccagactc
tcctgttctt gaaaaattag 5760aggataacag tttaaagcta aaaaaggctt
tgattatgct tatcttgtct agaaaagaca 5820tgttttccaa ggctgaatag
acaacttact ctaacgttgg agttgatttg cacaccttag 5880ttttttgctc
ttttaaggga ggaactggaa aaacaacact ttctctaaac gtgggatgca
5940acttggccca atttttaggg aaaaaagtgt tacttgctga cctagacccg
caatccaatt 6000tatcttctgg attgggggct agtgtcagaa ataaccaaaa
aggcttgcac gacatagtat 6060acaaatcaaa cgatttaaaa tcaatcattt
gcgaaacaaa aaaagatagt gtggacctaa 6120ttcctgcatc atttttatcc
gaacagttta gagaattgga tattcataga ggacctagta 6180acaacttaaa
gttatttctg aatgagtact gcgctccttt ttatgacatc tgcataatag
6240acactccacc tagcctagga gggttaacga aagaagcttt tgttgcagga
gacaaattaa 6300ttgcttgttt aactccagaa cctttttcta ttctagggtt
acaaaagata cgtgaattct 6360taagttcggt cggaaaacct gaagaagaac
acattcttgg aatagctttg tctttttggg 6420atgatcgtaa ctcgactaac
caaatgtata tagacattat cgagtctatt tacaaaaaca 6480agcttttttc
aacaaaaatt cgtcgagata tttctctcag ccgttctctt cttaaagaag
6540attctgtagc taatgtctat ccaaattcta gggccgcaga agatattctg
aagttaacgc 6600atgaaatagc aaatattttg catatcgaat atgaacgaga
ttactctcag aggacaacgt 6660gaacaaacta aaaaaagaag cggatgtctt
ttttaaaaaa aatcaaactg ccgcttctct 6720agattttaag aagacacttc
cttccattga actattctca gcaactttga attctgagga 6780aagtcagagt
ttggatcgat tatttttatc agagtcccaa aactattcgg atgaagaatt
6840ttatcaagaa gacatcctag cggtaaaact gcttactggt cagataaaat
ccatacagaa 6900gcaacacgta cttcttttag gagaaaaaat ctataatgct
agaaaaatcc tgagtaagga 6960tcacttctcc tcaacaactt tttcatcttg
gatagagtta gtttttagaa ctaagtcttc 7020tgcttacaat gctcttgcat
attacgagct ttttataaac ctccccaacc aaactctaca 7080aaaagagttt
caatcgatcc cctataaatc cgcatatatt ttggccgcta gaaaaggcga
7140tttaaaaacc aaggtcgatg tgatagggaa agtatgtgga atgtcgaact
catcggcgat 7200aagggtgttg gatcaatttc ttccttcatc tagaaacaaa
gacgttagag aaacgataga 7260taagtctgat ttagagaaga atcgccaatt
atctgatttc ttaatagaga tacttcgcat 7320catatgttcc ggagtttctt
tgtcctccta taacgaaaat cttctacaac agctttttga 7380actttttaag
caaaagagct gatcctccgt cagctcatat atatatttat tatatatata
7440tttatttagg gatttgattt tacgagagag a 74718743DNANeisseria
gonorrhoeae 8gccggcggcg gcgcgacccg ttggggcaat agggaatcct ttgtcggctt
ggcaggcgaa 60ttcggcacgc tgcgcgccgg ccgcgttgcg aatcagtttg acgatgccag
ccaagccatt 120gatccttggg acagcaacaa tgatgtggct tcgcaattgg
gtattttcaa acgccacgac 180gatatgccgg tttccgtacg ctacgactcc
ccggactttt ccggtttcag cggcagcgtc 240caattcgttc cggctcaaaa
cagcaagtcc gcctatacgc cggctcattg gactactgtg 300tataacacta
acggtactac tactactttc gttccggctg ttgtcggcaa gcccggatcg
360gatgtgtatt atgccggtct gaattacaaa aatggcggtt ttgccgggaa
ctatgccttt 420aaatatgcga gacacgccaa tgtcggacgt aatgcttttg
agttgttctt gctcggcagt 480gggagtgatg aagccaaagg taccgatccc
ttgaaaaacc atcaggtaca ccgcctgacg 540ggcggctatg gggaaggcgg
cttgaatctc gccttggcgg ctcagttgga tttgtctgaa 600aatgccgaca
aaaccaaaaa cagtacgacc gaaattgccg ccactgcttc ctaccgcttc
660ggtaatacag tcccgcgcat cagctatgcc catggtttcg actttgtcga
acgcagtcag 720aaacgcgaac ataccagcta tga 74391356DNANeisseria
gonorrhoeae 9cccgctttgt cgatttgcgc ttcaccgata ccaaaggcaa gcagcaccac
tttaccgtgc 60ctgcgcgcat cgtgttggaa gaccccgaag agtggtttga aaacggaccg
gcgtttgacg 120gctcgtccat cggcggctgg aaaggcattg aggcttccga
tatgcagctg cgtcccgatg 180cgtccacagc cttcgtcgat cctttttatg
atgatgttac cgtcgtcatt acctgcgacg 240tcatcgaccc tgccgacggt
cagggttacg accgcgaccc gcgctccatc gcacgccgcg 300ccgaagccta
tttgaaatct tccggtatcg gcgacaccgc ctatttcggc cccgaacccg
360aattcttcgt cttcgacggc gtagaatttg aaaccgacat gcacaaaacc
cgttacgaaa 420tcacgtccga aagcggcgcg tgggcaagcg gcctgcatat
ggacggtcaa aacaccggcc 480accgccccgc cgtcaaaggc ggctacgcgc
ccgtcgcgcc gattgactgc ggtcaagatt 540tgcgctccgc catggtgaac
attttggaag gactcggcat cgaagtcgaa gtccaccaca 600gcgaagtcgg
taccggcagc caaatggaaa tcggcacccg tttcgccact ttggtcaaac
660gcgccgacca aacccaagat atgaaatacg tcatccaaaa cgttgcccac
aatttcggca 720aaaccgccac ctttatgccc aaaccgatta tgggcgacaa
cggcagcggt atgcacgtcc 780accaatccat ttggaaagac ggtcaaaacc
tgttcgcagg cgacggctat gccggtttgt 840ccgataccgc gctctactac
atcggcggca tcatcaaaca cgccaaagcc ctgaacgcga 900ttaccaatcc
gtccaccaac tcctacaaac gcctcgtgcc gcactttgaa gcaccgacca
960aattggccta ttccgccaaa aaccgttccg cttccatccg tatcccgtct
gtgaacagca 1020gcaaggcgcg ccgcatcgaa gcgcgtttcc ccgacccgac
cgccaacccg tatttggcat 1080ttgccgccct gctgatggcc ggtttggacg
gcattcaaaa caaaatccat ccgggcgacc 1140ctgccgataa aaacctgtac
gacctgccgc cggaagaaga cgcgctcgtc ccgaccgtct 1200gcgcttcttt
ggaagaagca cttgccgccc tcaaggtcga ccacgaattc ctgctgcgcg
1260gcggcgtgtt cagcaaagac tggatcgaca gctacatcgc ctttaaagag
gaagatgtcc 1320gccgcatccg tatggcgccg cacccgctgg aatttg
13561021DNAArtificial Sequenceprimer 10tctacaagag tacatcggtc a
211118DNAArtificial Sequenceprimer 11tgaagcgttg tcttctcg
181239DNAArtificial Sequenceprimer 12gcagcttgta gtcctgcttg
agtcttcgta actcgctcc 391339DNAArtificial Sequenceprimer
13tcgagcaacc gctgtgaccc ttcattatgt cggagtctg 391418DNAArtificial
Sequenceprimer 14cgggcgattt gccttaac 181518DNAArtificial
Sequenceprimer 15tacaaacgcc tagggtgc 181620DNAArtificial
Sequenceprimer 16accaaaaaca gtacgaccga 201720DNAArtificial
Sequenceprimer 17aagtgcgctt ggaaaaatcg 201838DNAArtificial
Sequenceprimer 18atgggcatag ctgatgcgcg aattgccgcc actgcttc
381940DNAArtificial Sequenceprimer 19tcgactttgt cgaacgcagt
caaatcgaca ccggcgatga 402023DNAArtificial Sequenceprimer
20gcgaacatac cagctatgat caa 232120DNAArtificial Sequenceprimer
21tcatatcttg ggtttggtcg 202219DNAArtificial Sequenceprimer
22ctgcatatgg acggtcaaa 192337DNAArtificial Sequenceprimer
23cgaagtccac cacagcgaat ttgaccaaag tggcgaa 372439DNAArtificial
Sequenceprimer 24cttcgatgcc gagtccttcc gattgactgc ggtcaagat
392519DNAArtificial Sequenceprimer 25caaatggaaa tcggcaccc
192618DNAArtificial Sequenceprimer 26atgttcacca tggcggag 18
* * * * *