U.S. patent application number 14/914861 was filed with the patent office on 2016-09-22 for products and methods for treatment of familial amyotrophic lateral sclerosis.
The applicant listed for this patent is LUDWIG INSTITUTE FOR CANCER RESEARCH, RESEARCH INSTITUTE ATA NATIONWIDE CHILDREN'S HOSPITAL. Invention is credited to Don W. Cleveland, Kevin Foust, Brian K. Kaspar.
Application Number | 20160272976 14/914861 |
Document ID | / |
Family ID | 51494538 |
Filed Date | 2016-09-22 |
United States Patent
Application |
20160272976 |
Kind Code |
A1 |
Kaspar; Brian K. ; et
al. |
September 22, 2016 |
PRODUCTS AND METHODS FOR TREATMENT OF FAMILIAL AMYOTROPHIC LATERAL
SCLEROSIS
Abstract
The present invention relates to RNA-based methods for
inhibiting the expression of the superoxide dismutase 1 (SOD-1)
gene. Recombinant adeno-associated viruses of the invention deliver
DNAs encoding RNAs that knock down the expression of SOD-1. The
methods have application in the treatment of amyotrophic lateral
sclerosis.
Inventors: |
Kaspar; Brian K.; (Columbus,
OH) ; Foust; Kevin; (Columbus, OH) ;
Cleveland; Don W.; (La Jolla, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RESEARCH INSTITUTE ATA NATIONWIDE CHILDREN'S HOSPITAL
LUDWIG INSTITUTE FOR CANCER RESEARCH |
Columbus
Zurich |
OH |
US
CH |
|
|
Family ID: |
51494538 |
Appl. No.: |
14/914861 |
Filed: |
August 26, 2014 |
PCT Filed: |
August 26, 2014 |
PCT NO: |
PCT/US2014/052753 |
371 Date: |
February 26, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61870585 |
Aug 27, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2750/14043
20130101; C12N 15/86 20130101; A61K 9/0019 20130101; A61P 25/28
20180101; C12N 15/1137 20130101; C12N 2310/14 20130101; C12N 7/00
20130101; C12N 2320/32 20130101; C12Y 115/01001 20130101; C12N
2750/14143 20130101; A61K 31/7105 20130101; C12N 2310/531 20130101;
C12N 9/0089 20130101; A61P 25/02 20180101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/7105 20060101 A61K031/7105; A61K 9/00 20060101
A61K009/00; C12N 7/00 20060101 C12N007/00 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0001] This invention was made with government support under U.S.
National Institutes of Health R21-NS067238, NS027036, ROI NS064492
and RC2 NS69476-01. The Government has certain rights in the
invention.
Claims
1. A recombinant adeno-associated virus comprising the superoxide
dismutase 1 (SOD1) shRNA-encoding DNA: TABLE-US-00005 (SEQ ID NO:
1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID NO: 2)
GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3) CTGACTGAAGGCCTGCATGGATT,
(SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ ID NO: 5)
GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ
ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8)
GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ
ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11)
GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ
ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14)
GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA,
(SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 15)
TCATCAATTTCGAGCAGAA, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID
NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT,
or (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT,
wherein the recombinant adeno-associated virus genome lacks rep and
cap genes.
2. A composition comprising the recombinant adeno-associated virus
of claim 1.
3. A method of inhibiting expression of mutant SOD1 in a cell
comprising contacting the cell with a recombinant adeno-associated
virus of claim 1 or the composition of claim 2.
4. A method of delivering the SOD1 shRNA-encoding DNA
GCATCATCAATTTCGAGCAGAAGGAA (SEQ ID NO:1) to a subject in need
thereof, comprising administering to the subject a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
GCATCATCAATTTCGAGCAGAAGGAA (SEQ ID NO:1), wherein the recombinant
adeno-associated virus genome lacks rep and cap genes.
5. A method of delivering the SOD1 shRNA-encoding DNA
GAAGCATTAAAGGACTGACTGAA (SEQ ID NO:2) to a subject in need thereof,
comprising administering to the subject a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
GAAGCATTAAAGGACTGACTGAA (SEQ ID NO:2), wherein the recombinant
adeno-associated virus genome lacks rep and cap genes.
6. A method of delivering the SOD1 shRNA-encoding DNA
CTGACTGAAGGCCTGCATGGATT (SEQ ID NO:3) to a subject in need thereof,
comprising administering to the subject a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
CTGACTGAAGGCCTGCATGGATT (SEQ ID NO:3), wherein the recombinant
adeno-associated virus genome lacks rep and cap genes.
7. A method of delivering the SOD1 shRNA-encoding DNA
CATGGATTCCATGTTCATGA (SEQ ID NO:4) to a subject in need thereof,
comprising administering to the subject a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
CATGGATTCCATGTTCATGA (SEQ ID NO:4), wherein the recombinant
adeno-associated virus genome lacks rep and cap genes.
8. A method of treating amyotrophic lateral sclerosis (ALS)
comprising administering a recombinant adeno-associated virus
comprising the SOD1 shRNA-encoding DNA GCATCATCAATTTCGAGCAGAAGGAA
(SEQ ID NO:1), wherein the recombinant adeno-associated virus
genome lacks rep and cap genes.
9. A method of treating ALS comprising administering a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
GAAGCATTAAAGGACTGACTGAA (SEQ ID NO:2), wherein the recombinant
adeno-associated virus lacks rep and cap genes.
10. A method of treating ALS comprising administering a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
CTGACTGAAGGCCTGCATGGATT (SEQ ID NO:3), wherein the recombinant
adeno-associated virus lacks rep and cap genes.
11. A method of treating ALS comprising administering a recombinant
adeno-associated virus comprising the SOD1 shRNA-encoding DNA
CATGGATTCCATGTTCATGA (SEQ ID NO:4), wherein the recombinant
adeno-associated virus lacks rep and cap genes.
Description
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: 14,350 byte ACII
(Text) file named "47886PCT_SeqListing.txt," created on Aug. 26,
2014.
FIELD OF THE INVENTION
[0003] The present invention relates to RNA-based methods for
inhibiting the expression of the superoxide dismutase 1 (SOD-1)
gene. Recombinant adeno-associated viruses of the invention deliver
DNAs encoding RNAs that knock down the expression of SOD-1. The
methods have application in the treatment of amyotrophic lateral
sclerosis (ALS).
BACKGROUND
[0004] ALS is an adult-onset, rapidly progressive and fatal
neurodegenerative disease, characterized by selective degeneration
of both upper and lower motor neurons. First characterized by
Charcot in 1869, ALS is responsible for one in every 2000 deaths,
affecting nearly 5 out of 100,000 individuals. ALS occurs when
specific nerve cells in the brain and spinal cord that control
voluntary movement degenerate. Within two to five years after
clinical onset, the loss of these motor neurons leads to
progressive atrophy of skeletal muscles, which results in loss of
muscular function resulting in paralysis, speech deficits, and
death due to respiratory failure.
[0005] Most ALS cases have no clear genetic linkage and are
referred to as sporadic, but in 10% of instances disease is
familial with dominant inheritance. Twenty percent of familial
cases are caused by mutations in the enzyme superoxide dismutase 1
(SOD1), with over 140 distinct mutations identified to
date.sup.1,2. Many efforts to identify how mutations alter the
function of SOD1 have produced a consensus view that SOD1 mutants
acquire one or more toxicities, whose nature still remains
controversial.sup.3, but there is clear evidence that a proportion
of mutant SOD1 is misfolded and subsequently aggregates.sup.4,5.
SOD1 aggregates are, in fact, one of the histological hallmarks of
SOD1-related ALS cases.sup.4.
[0006] In the past 20 years, multiple animal models expressing
mutant forms of human SOD1 have been generated. These models
recapitulate the hallmarks of ALS, developing age-dependent motor
axon degeneration and accompanying muscle denervation, glial
inflammation and subsequent motor neuron loss. Selective gene
excision experiments have determined that mutant SOD1 expression
within motor neurons themselves contributes to disease onset and
early disease progression.sup.6, as does mutant synthesis in
NG2.sup.+ cells' that are precursors to oligodendrocytes. However,
mutant SOD1 protein expression in microglia and astrocytes
significantly drives rapid disease progression.sup.6,8, findings
which have lead to the conclusion that ALS pathophysiology is
non-cell autonomous.sup.3.
[0007] Further, astrocytes have been found to be toxic to motor
neurons in multiple in vitro models where mutant forms of human
SOD1 were overexpressed.sup.9-11. A recent study derived astrocytes
from post-mortem spinal cords of ALS patients with or without SOD1
mutations. In all cases, astrocytes from sporadic ALS patients were
as toxic to motor neurons as astrocytes carrying genetic mutations
in SOD1.sup.12. Even more strikingly, reduction of SOD1 in
astrocytes derived from both sporadic and familial ALS patients
decreased astrocyte-derived toxicity that is selective for motor,
but not GABA, neurons. This remarkable finding, along with reports
that misfolded SOD1 inclusions are found in the spinal cords of
familial as well as some sporadic ALS patients.sup.13,14,15, has
provided strong evidence for a pathogenic role of wild-type SOD1 in
sporadic ALS.
[0008] Despite the insights that SOD1 mutant-expressing animal
models have provided for understanding mechanisms involved in motor
neuron degeneration, their utility for the development of
therapeutic approaches has been questioned.sup.16, as no drug with
a reported survival benefit in mutant SOD1.sup.G93A mice has been
effective in clinical trials with sporadic ALS patients. In all but
one case the drugs taken to human trial had been reported only to
extend mutant SOD1 mouse survival when applied presymptomatically,
and even then to provide a survival benefit solely by delaying
disease onset with no benefit in slowing disease progression. The
one exception to this was riluzole, which like the human situation,
modestly extended survival of mutant SOD1.sup.G93A mice and did so
by slowing disease progression.sup.17. Recognizing that success at
human trial will require slowing of disease progression, the SOD1
mutant mice have perfectly predicted the success of riluzole and
the failure of efficacy of each other drug attempted in human
trial. What has been missing are additional therapies that affect
disease progression in these mice.
[0009] Thus, riluzole is the only drug currently approved by the
FDA as a therapy for ALS, providing a modest survival
benefit.sup.21. For the 20% of familial cases caused by mutation in
SOD1, attempts at improving therapy by reducing synthesis of SOD1
have been the focus of multiple therapeutic development approaches.
Antisense oligonucleotides and viral delivered RNA interference
(RNAi) were tested in rat.sup.22 and mouse models.sup.23-25 that
develop fatal paralysis from overexpressing human SOD1.sup.G93A.
Antisense oligonucleotides infused at disease onset produced SOD1
reduction and a modest slowing of disease progression.sup.22.
Direct CSF infusion of antisense oligonucleotides has been tested
clinically.sup.26, leading to encouraging results in terms of
tolerability and safety, but without significant reduction in SOD1
levels at the low dosages utilized. In each of the prior viral
studies.sup.23-25, SOD1 knockdown was achieved before disease onset
by direct injection into the nervous system or taking advantage of
axonal retrograde transport when a virus was injected
intramuscularly.sup.23, 24. These studies led to varying degrees of
success in extending survival or improving motor performance,
depending on the time of treatment as well as level of SOD1
knockdown achieved in the spinal cord. Although these studies
provided important proof of principle, the approaches were far from
being readily translated into clinical strategies. Indeed, there
have been controversial reports surrounding these initial viral
mediated SOD1 suppression studies.sup.23, 24, 27-29.
[0010] Adeno-associated virus (AAV) vectors have been used in a
number of recent clinical trials for treatment of neurological
disorders [Kaplitt et al., Lancet 369: 2097-2105 (2007); Marks et
al., Lancet Neurol 7: 400-408 (2008); Worgall et al., Hum Gene Ther
(2008)].
[0011] AAV is a replication-deficient parvovirus, the
single-stranded DNA genome of which is about 4.7 kb in length
including 145 nucleotide inverted terminal repeat (ITRs). The
nucleotide sequence of the AAV serotype 2 (AAV2) genome is
presented in Srivastava et al., J Virol, 45: 555-564 (1983) as
corrected by Ruffing et al., J Gen Virol, 75: 3385-3392 (1994).
Cis-acting sequences directing viral DNA replication (rep),
encapsidation/packaging and host cell chromosome integration are
contained within the ITRs. Three AAV promoters (named p5, p19, and
p40 for their relative map locations) drive the expression of the
two AAV internal open reading frames encoding rep and cap genes.
The two rep promoters (p5 and p19), coupled with the differential
splicing of the single AAV intron (at nucleotides 2107 and 2227),
result in the production of four rep proteins (rep 78, rep 68, rep
52, and rep 40) from the rep gene. Rep proteins possess multiple
enzymatic properties that are ultimately responsible for
replicating the viral genome. The cap gene is expressed from the
p40 promoter and it encodes the three capsid proteins VP1, VP2, and
VP3. Alternative splicing and non-consensus translational start
sites are responsible for the production of the three related
capsid proteins. A single consensus polyadenylation site is located
at map position 95 of the AAV genome. The life cycle and genetics
of AAV are reviewed in Muzyczka, Current Topics in Microbiology and
Immunology, 158: 97-129 (1992).
[0012] AAV possesses unique features that make it attractive as a
vector for delivering foreign DNA to cells, for example, in gene
therapy. AAV infection of cells in culture is noncytopathic, and
natural infection of humans and other animals is silent and
asymptomatic. Moreover, AAV infects many mammalian cells allowing
the possibility of targeting many different tissues in vivo.
Moreover, AAV transduces slowly dividing and non-dividing cells,
and can persist essentially for the lifetime of those cells as a
transcriptionally active nuclear episome (extrachromosomal
element). The AAV proviral genome is infectious as cloned DNA in
plasmids which makes construction of recombinant genomes feasible.
Furthermore, because the signals directing AAV replication, genome
encapsidation and integration are contained within the ITRs of the
AAV genome, some or all of the internal approximately 4.3 kb of the
genome (encoding replication and structural capsid proteins,
rep-cap) may be replaced with foreign DNA such as a gene cassette
containing a promoter, a DNA of interest and a polyadenylation
signal. The rep and cap proteins may be provided in trans. Another
significant feature of AAV is that it is an extremely stable and
hearty virus. It easily withstands the conditions used to
inactivate adenovirus (56.degree. to 65.degree. C. for several
hours), making cold preservation of AAV less critical. AAV may even
be lyophilized. Finally, AAV-infected cells are not resistant to
superinfection.
[0013] Multiple serotypes of AAV exist and offer varied tissue
tropism. Known serotypes include, for example, AAV1, AAV2, AAV3,
AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAVrh74.
Advances in the delivery of AAV6 and AAV8 have made possible the
transduction by these serotypes of skeletal and cardiac muscle
following simple systemic intravenous or intraperitoneal
injections. See Pacak et al., Circ. Res., 99(4): 3-9 (1006) and
Wang et al., Nature Biotech., 23(3): 321-8 (2005). The use of AAV
to target cell types within the central nervous system has involved
surgical intraparenchymal injection. See, Kaplitt et al., supra;
Marks et al., supra and Worgall et al., supra. Regarding the use of
AAV to target cell types within the nervous system, see
International Publication No. WO 2010/071832. International
Publication Nos. WO 2009/043936 and WO 2009/013290 state they
relate to delivering genes to the central nervous system.
International Publication No. WO 2011/133890 states it relates to
recombinant adeno-associated viruses useful for targeting
transgenes to central nervous system tissue.
[0014] There thus remains a need in the art for methods and
materials for treatment of ALS.
SUMMARY
[0015] The present invention provides products and methods useful
for reducing mutant SOD1 protein levels in subjects in need
thereof. The invention provides AAV-mediated delivery of RNAs
including, but not limited to short hairpin RNAs, to reduce
synthesis of ALS-causing human SOD1 mutants in subjects in need
thereof. Recombinant AAV (rAAV) contemplated by the invention
include, but are not limited to, rAAV9, rAAV2 and rAAVrh74.
Delivery routes contemplated by the invention include, but are not
limited to, systemic delivery and intrathecal delivery. Use of the
methods and products of the invention is indicated, for example, in
treating ALS.
DETAILED DESCRIPTION
[0016] In one aspect, the invention provides rAAV genomes
comprising one or more AAV ITRs flanking a polynucleotide encoding
one or more RNAs (including, but not limited to, small hairpin
RNAs, antisense RNAs and/or microRNAs) that target mutant SOD1
polynucleotides. The examples describe the use of exemplary rAAV
encoding small hairpin RNAs (shRNAs). In the rAAV genomes, the
shRNA-encoding polynucleotide is operatively linked to
transcriptional control DNA, specifically promoter DNA that is
functional in target cells. Commercial providers such as Ambion
Inc. (Austin, Tex.), Darmacon Inc. (Lafayette, Colo.), InvivoGen
(San Diego, Calif.), and Molecular Research Laboratories, LLC
(Herndon, Va.) generate custom inhibitory RNA molecules. In
addition, commercially kits are available to produce custom siRNA
molecules, such as SILENCER.TM. siRNA Construction Kit (Ambion
Inc., Austin, Tex.) or psiRNA System (InvivoGen, San Diego,
Calif.). In some embodiments, the rAAV genome comprises a DNA
encoding a SOD1 shRNA such as:
TABLE-US-00001 (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA, (SEQ ID
NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA
(''shRNA 130'' or ''SOD1 shRNA'' herein), (SEQ ID NO: 5)
GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6) GGTCTGGCCTATAAAGTAGTC, (SEQ
ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ ID NO: 8)
GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9) GCCTGCATGGATTCCATGTTC, (SEQ
ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ ID NO: 11)
GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12) GGAGATAATACAGCAGGCTGT, (SEQ
ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ ID NO: 14)
GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 1) GCATCATCAATTTCGAGCAGAAGGAA,
(SEQ ID NO: 2) GAAGCATTAAAGGACTGACTGAA, (SEQ ID NO: 3)
CTGACTGAAGGCCTGCATGGATT, (SEQ ID NO: 4) CATGGATTCCATGTTCATGA, (SEQ
ID NO: 5) GCATGGATTCCATGTTCATGA, (SEQ ID NO: 6)
GGTCTGGCCTATAAAGTAGTC, (SEQ ID NO: 7) GGGCATCATCAATTTCGAGCA, (SEQ
ID NO: 8) GCATCATCAATTTCGAGCAGA, (SEQ ID NO: 9)
GCCTGCATGGATTCCATGTTC, (SEQ ID NO: 10) GGAGGTCTGGCCTATAAAGTA, (SEQ
ID NO: 11) GATTCCATGTTCATGAGTTTG, (SEQ ID NO: 12)
GGAGATAATACAGCAGGCTGT, (SEQ ID NO: 13) GCTTTAAAGTACCTGTAGTGA, (SEQ
ID NO: 14) GCATTAAAGGACTGACTGAAG, (SEQ ID NO: 15)
TCATCAATTTCGAGCAGAA, (SEQ ID NO: 16) TCGAGCAGAAGGAAAGTAA, (SEQ ID
NO: 17) GCCTGCATGGATTCCATGT, (SEQ ID NO: 18) TCACTCTCAGGAGACCATT,
or (SEQ ID NO: 19) GCTTTAAAGTACCTGTAGT.
[0017] The rAAV genomes of the invention lack AAV rep and cap DNA.
AAV DNA in the rAAV genomes (e.g., ITRs) may be from any AAV
serotype for which a recombinant virus can be derived including,
but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. The
nucleotide sequences of the genomes of the AAV serotypes are known
in the art. For example, the complete genome of AAV-1 is provided
in GenBank Accession No. NC_002077; the complete genome of AAV-2 is
provided in GenBank Accession No. NC_001401 and Srivastava et al.,
J. Virol., 45: 555-564 {1983); the complete genome of AAV-3 is
provided in GenBank Accession No. NC_1829; the complete genome of
AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5
genome is provided in GenBank Accession No. AF085716; the complete
genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at
least portions of AAV-7 and AAV-8 genomes are provided in GenBank
Accession Nos. AX753246 and AX753249, respectively; the AAV-9
genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004);
the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006);
and the AAV-11 genome is provided in Virology, 330(2): 375-383
(2004). The AAVrh74 genome is provided in International Publication
No. WO 2013/078316.
[0018] In another aspect, the invention provides DNA plasmids
comprising rAAV genomes of the invention. The DNA plasmids are
transferred to cells permissible for infection with a helper virus
of AAV (e.g., adenovirus, E1-deleted adenovirus or herpesvirus) for
assembly of the rAAV genome into infectious viral particles.
Techniques to produce rAAV particles, in which an AAV genome to be
packaged, rep and cap genes, and helper virus functions are
provided to a cell are standard in the art. Production of rAAV
requires that the following components are present within a single
cell (denoted herein as a packaging cell): a rAAV genome, AAV rep
and cap genes separate from (i.e., not in) the rAAV genome, and
helper virus functions. The AAV rep and cap genes may be from any
AAV serotype for which recombinant virus can be derived and may be
from a different AAV serotype than the rAAV genome ITRs, including,
but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11. Production of
pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is
incorporated by reference herein in its entirety. In various
embodiments, AAV capsid proteins may be modified to enhance
delivery of the recombinant vector. Modifications to capsid
proteins are generally known in the art. See, for example, US
20050053922 and US 20090202490, the disclosures of which are
incorporated by reference herein in their entirety.
[0019] A method of generating a packaging cell is to create a cell
line that stably expresses all the necessary components for AAV
particle production. For example, a plasmid (or multiple plasmids)
comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and
cap genes separate from the rAAV genome, and a selectable marker,
such as a neomycin resistance gene, are integrated into the genome
of a cell. AAV genomes have been introduced into bacterial plasmids
by procedures such as GC tailing (Samulski et al., 1982, Proc.
Natl. Acad. S6. USA, 79:2077-2081), addition of synthetic linkers
containing restriction endonuclease cleavage sites (Laughlin et
al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation
(Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The
packaging cell line is then infected with a helper virus such as
adenovirus. The advantages of this method are that the cells are
selectable and are suitable for large-scale production of rAAV.
Other examples of suitable methods employ adenovirus or baculovirus
rather than plasmids to introduce rAAV genomes and/or rep and cap
genes into packaging cells.
[0020] General principles of rAAV production are reviewed in, for
example, Carter, 1992, Current Opinions in Biotechnology, 1533-539;
and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol.,
158:97-129). Various approaches are described in Ratschin et al.,
Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad.
Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251
(1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski
et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989,
J. Virol., 63:3822-3828); U.S. Pat. No. 5,173,414; WO 95/13365 and
corresponding U.S. Pat. No. 5,658,776; WO 95/13392; WO 96/17947;
PCT/U598/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298
(PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243
(PCT/FR96/01064); WO 99/11764; Perrin et al. (1995) Vaccine
13:1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615;
Clark et al. (1996) Gene Therapy 3:1124-1132; U.S. Pat. No.
5,786,211; U.S. Pat. No. 5,871,982; and U.S. Pat. No. 6,258,595.
Single-stranded rAAV are specifically contemplated. The foregoing
documents are hereby incorporated by reference in their entirety
herein, with particular emphasis on those sections of the documents
relating to rAAV production.
[0021] The invention thus provides packaging cells that produce
infectious rAAV. In one embodiment packaging cells may be stably
transformed cancer cells such as HeLa cells, 293 cells and PerC.6
cells (a cognate 293 line). In another embodiment, packaging cells
are cells that are not transformed cancer cells such as low passage
293 cells (human fetal kidney cells transformed with E1 of
adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells
(human fetal fibroblasts), Vero cells (monkey kidney cells) and
FRhL-2 cells (rhesus fetal lung cells).
[0022] In still another aspect, the invention provides rAAV (i.e.,
infectious encapsidated rAAV particles) comprising a rAAV genome of
the invention. In some embodiments, the rAAV genome is a
self-complementary genome. The genomes of the rAAV lack AAV rep and
cap DNA, that is, there is no AAV rep or cap DNA between the ITRs
of the genomes. Embodiments include, but are not limited to, the
exemplary rAAV including a genome encoding the SOD1 shRNA named
"AAV-SOD1-shRNA." A sequence including the AAV-SOD1-shRNA genome is
set out below as an inverted sequence from a plasmid used in
production.
TABLE-US-00002 FEATURES Location/Qualifiers misc_feature 662..767
/gene=''mutated ITR'' /SECDrawAs=''Region'' /SECStyleId=1 CDS
complement (901..965) /gene=''SOD shRNA'' /SECDrawAs=''Gene''
/SECStyleId=1 misc_feature complement (966..1064) /gene=''H1''
/SECDrawAs=''Region'' /SECStyleId=1 misc_feature 1224..1503
/gene=''CMV enhancer'' /SECDrawAs=''Region'' /SECStyleId=1
misc_feature 1510..1779 /gene=''B-Actin promoter''
/product=''Chicken'' /SECDrawAs=''Region'' /SECStyleId=1
misc_feature 1845..1875 /gene=''SV40_late_19s_int''
/SECDrawAs=''Region'' /SECStyleId=1 misc_feature 1845..1941
/gene=''modSV40_late_16s_int'' /SECDrawAs=''Region'' /SECStyleId=1
CDS 2015..2734 /gene=''GFP'' /SECDrawAs=''Gene'' /SECStyleId=1
misc_feature 2783..2929 /gene=''BGHpA'' /SECDrawAs=''Region''
/SECStyleId=1 misc_feature 3009..3149 /gene=''ITR''
/SECDrawAs=''Region'' /SECStyleId=1 misc_feature 3983..4843
/gene=''amp r'' /SECDrawAs=''Region'' /SECStyleId=1 misc_feature
4997..5618 /gene=''pBR322 ori'' /SECDrawAs=''Region'' /SECStyleId=1
(SEQ ID NO: 20) 1 gcccaatacg caaaccgcct ctccccgcgc gttggccgat
tcattaatgc agctgattct 61 aacgaggaaa gcacgttata cgtgctcgtc
aaagcaacca tagtacgcgc cctgtagcgg 121 cgcattaagc gcggcgggtg
tggtggttac gcgcagcgtg accgctacac ttgccagcgc 181 cctagcgccc
gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc 241
ccgtcaagct ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct
301 cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt gggccatcgc
cctgatagac 361 ggtttttcgc cctttgacgt tggagtccac gttctttaat
agtggactct tgttccaaac 421 tggaacaaca ctcaacccta tctcggtcta
ttcttttgat ttataaggga ttttgccgat 481 ttcggcctat tggttaaaaa
atgagctgat ttaacaaaaa tttaacgcga attttaacaa 541 aatattaacg
cttacaattt aaatatttgc ttatacaatc ttcctgtttt tggggctttt 601
ctgattatca accggggtac atatgattga catgctagtt ttacgattac cgttcatcgc
661 cctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc
gggcgacctt 721 tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag
ggagtggaat tcacgcgtgg 781 atctgaattc aattcacgcg tggtacctac
actttatgct tccggctcgt atgttgtgtg 841 gaattgtgag cggataacaa
tttcacacag gaaacagcta tgaccatgat tacgccaagc 901 tttccaaaaa
agcatggatt ccatgttcat gatctcttga atcatgaaca tggaatccat 961
ggatccgagt ggtctcatac agaacttata agattcccaa atccaaagac atttcacgtt
1021 tatggtgatt tcccagaaca catagcgaca tgcaaatatg aattcactgg
ccgtcgtttt 1081 acaacgtcgt gactgggaaa accctggcgt tacccaactt
aatcgccttg cagcacatcc 1141 ccctttcgcc agctggcgta atagcgaaga
ggcccgcacc gatcgccctt cccaacagtt 1201 gcgcagcctg tggtacctct
ggtcgttaca taacttacgg taaatggccc gcctggctga 1261 ccgcccaacg
acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca 1321
atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca
1381 gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga
cggtaaatgg 1441 cccgcctggc attatgccca gtacatgacc ttatgggact
ttcctacttg gcagtacatc 1501 tactcgaggc cacgttctgc ttcactctcc
ccatctcccc cccctcccca cccccaattt 1561 tgtatttatt tattttttaa
ttattttgtg cagcgatggg ggcggggggg gggggggggc 1621 gcgcgccagg
cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg 1681
cggcagccaa tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc
1741 ggcggcccta taaaaagcga agcgcgcggc gggcgggagc gggatcagcc
accgcggtgg 1801 cggcctagag tcgacgagga actgaaaaac cagaaagtta
actggtaagt ttagtctttt 1861 tgtcttttat ttcaggtccc ggatccggtg
gtggtgcaaa tcaaagaact gctcctcagt 1921 ggatgttgcc tttacttcta
ggcctgtacg gaagtgttac ttctgctcta aaagctgcgg 1981 aattgtaccc
gcggccgatc caccggtcgc caccatggtg agcaagggcg aggagctgtt 2041
caccggggtg gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc acaagttcag
2101 cgtgtccggc gagggcgagg gcgatgccac ctacggcaag ctgaccctga
agttcatctg 2161 caccaccggc aagctgcccg tgccctggcc caccctcgtg
accaccctga cctacggcgt 2221 gcagtgcttc agccgctacc ccgaccacat
gaagcagcac gacttcttca agtccgccat 2281 gcccgaaggc tacgtccagg
agcgcaccat cttcttcaag gacgacggca actacaagac 2341 ccgcgccgag
gtgaagttcg agggcgacac cctggtgaac cgcatcgagc tgaagggcat 2401
cgacttcaag gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca
2461 caacgtctat atcatggccg acaagcagaa gaacggcatc aaggtgaact
tcaagatccg 2521 ccacaacatc gaggacggca gcgtgcagct cgccgaccac
taccagcaga acacccccat 2581 cggcgacggc cccgtgctgc tgcccgacaa
ccactacctg agcacccagt ccgccctgag 2641 caaagacccc aacgagaagc
gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg 2701 gatcactctc
ggcatggacg agctgtacaa gtaaagcggc catcaagctt atcgataccg 2761
tcgactagag ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt
2821 tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt
cctttcctaa 2881 taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
attctattct ggggggtggg 2941 gtggggcagg acagcaaggg ggaggattgg
gaagacaata gcaggcatgc tggggagaga 3001 tcgatctgag gaacccctag
tgatggagtt ggccactccc tctctgcgcg ctcgctcgct 3061 cactgaggcc
gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg cggcctcagt 3121
gagcgagcga gcgcgcagag agggagtggc cccccccccc ccccccccgg cgattctctt
3181 gtttgctcca gactctcagg caatgacctg atagcctttg tagagacctc
tcaaaaatag 3241 ctaccctctc cggcatgaat ttatcagcta gaacggttga
atatcatatt gatggtgatt 3301 tgactgtctc cggcctttct cacccgtttg
aatctttacc tacacattac tcaggcattg 3361 catttaaaat atatgagggt
tctaaaaatt tttatccttg cgttgaaata aaggcttctc 3421 ccgcaaaagt
attacagggt cataatgttt ttggtacaac cgatttagct ttatgctctg 3481
aggctttatt gcttaatttt gctaattctt tgccttgcct gtatgattta ttggatgttg
3541 gaatcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac
accgcatatg 3601 gtgcactctc agtacaatct gctctgatgc cgcatagtta
agccagcccc gacacccgcc 3661 aacacccgct gacgcgccct gacgggcttg
tctgctcccg gcatccgctt acagacaagc 3721 tgtgaccgtc tccgggagct
gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc 3781 gagacgaaag
ggcctcgtga tacgcctatt tttataggtt aatgtcatga taataatggt 3841
ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt
3901 tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
aaatgcttca 3961 ataatattga aaaaggaaga gtatgagtat tcaacatttc
cgtgtcgccc ttattccctt 4021 ttttgcggca ttttgccttc ctgtttttgc
tcacccagaa acgctggtga aagtaaaaga 4081 tgctgaagat cagttgggtg
cacgagtggg ttacatcgaa ctggatctca acagcggtaa 4141 gatccttgag
agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct 4201
gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat
4261 acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc
atcttacgga 4321 tggcatgaca gtaagagaat tatgcagtgc tgccataacc
atgagtgata acactgcggc 4381 caacttactt ctgacaacga tcggaggacc
gaaggagcta accgcttttt tgcacaacat 4441 gggggatcat gtaactcgcc
ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa 4501 cgacgagcgt
gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac 4561
tggcgaacta cttactctag cttcccggca acaattaata gactggatgg aggcggataa
4621 agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg
ctgataaatc 4681 tggagccggt gagcgtgggt ctcgcggtat cattgcagca
ctggggccag atggtaagcc 4741 ctcccgtatc gtagttatct acacgacggg
gagtcaggca actatggatg aacgaaatag 4801 acagatcgct gagataggtg
cctcactgat taagcattgg taactgtcag accaagttta 4861 ctcatatata
ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa 4921
gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc
4981 gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc
tgcgcgtaat 5041 ctgctgcttg caaacaaaaa aaccaccgct accagcggtg
gtttgtttgc cggatcaaga 5101 gctaccaact ctttttccga aggtaactgg
cttcagcaga gcgcagatac caaatactgt 5161 ccttctagtg tagccgtagt
taggccacca cttcaagaac tctgtagcac cgcctacata 5221 cctcgctctg
ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 5281
cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg
5341 ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat
acctacagcg 5401 tgagctatga gaaagcgcca cgcttcccga agggagaaag
gcggacaggt atccggtaag 5461 cggcagggtc ggaacaggag agcgcacgag
ggagcttcca gggggaaacg cctggtatct 5521 ttatagtcct gtcgggtttc
gccacctctg acttgagcgt cgatttttgt gatgctcgtc
5581 aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt
tcctggcctt 5641 ttgctggcct tttgctcaca tgttctttcc tgcgttatcc
cctgattctg tggataaccg 5701 tattaccgcc tttgagtgag ctgataccgc
tcgccgcagc cgaacgaccg agcgcagcga 5761 gtcagtgagc gaggaagcgg
aagagc
The SOD shRNA nucleotides 901-965 comprise the entire hairpin
sequence including the sense and antisense arms, stem loop and
termination sequence. The sequence in a forward orientation (with
target sequences against SOD1 underlined) is:
TABLE-US-00003 (SEQ ID NO: 21)
5'AATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACG
TGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTC
GGATCCATGGATTCCATGTTCATGATTCAAGAGATCATGAACATGGAATC CATGCTTTTTTGGAAA
3'
[0023] The rAAV of the invention may be purified by methods
standard in the art such as by column chromatography or cesium
chloride gradients. Methods for purifying rAAV vectors from helper
virus are known in the art and include methods disclosed in, for
example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999);
Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Pat.
No. 6,566,118 and WO 98/09657.
[0024] In another aspect, the invention contemplates compositions
comprising rAAV of the present invention. Compositions of the
invention comprise rAAV in a pharmaceutically acceptable carrier.
The compositions may also comprise other ingredients such as
diluents and adjuvants. Acceptable carriers, diluents and adjuvants
are nontoxic to recipients and are preferably inert at the dosages
and concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0025] Titers of rAAV to be administered in methods of the
invention will vary depending, for example, on the particular rAAV,
the mode of administration, the treatment goal, the individual, and
the cell type(s) being targeted, and may be determined by methods
standard in the art. Titers of rAAV may range from about about
1.times.10.sup.2, about 1.times.10.sup.3, about 1.times.10.sup.4,
about 1.times.10.sup.5, about 1.times.10.sup.6, about
1.times.10.sup.7, about 1.times.10.sup.8, about 1.times.10.sup.9,
about 1.times.10.sup.10, about 1.times.10.sup.11, about
1.times.10.sup.12, about 1.times.10.sup.13 to about
1.times.10.sup.14 or more DNase resistant particles (DRP) per ml.
Dosages may also be expressed in units of viral genomes (vg).
Dosages may also vary based on the timing of the administration to
a human. These dosages of rAAV may range from about
1.times.10.sup.4, about 1.times.10.sup.5, about 1.times.10.sup.6,
about 1.times.10.sup.7, about 1.times.10.sup.8, about
1.times.10.sup.9, about 1.times.10.sup.10, about 1.times.10.sup.11,
about 1.times.10.sup.12, about 1.times.10.sup.13, about
1.times.10.sup.14, about 1.times.10.sup.15, about 1.times.10.sup.16
or more viral genomes per kilogram body weight in an adult. For a
neonate, the dosages of rAAV may range from about about
1.times.10.sup.4, about 3.times.10.sup.4, about 1.times.10.sup.5,
about 3.times.10.sup.5, about 1.times.10.sup.6, about
3.times.10.sup.6, about 1.times.10.sup.7, about 3.times.10, about
1.times.10.sup.8, about 3.times.10.sup.8, about 1.times.10.sup.9,
about 3.times.10.sup.9, about 1.times.10.sup.10, about
3.times.10.sup.10, about 1.times.10.sup.11, about
3.times.10.sup.11, about 1.times.10.sup.12, about
3.times.10.sup.12, about 1.times.10.sup.13, about
3.times.10.sup.13, about 1.times.10.sup.14, about
3.times.10.sup.14, about 1.times.10.sup.15, about
3.times.10.sup.15, about 1.times.10.sup.16, about 3.times.10.sup.16
or more viral genomes per kilogram body weight.
[0026] In another aspect, the invention contemplates compositions
comprising rAAV of the present invention. Compositions of the
invention comprise rAAV in a pharmaceutically acceptable carrier.
The compositions may also comprise other ingredients such as
diluents and adjuvants. Acceptable carriers, diluents and adjuvants
are nontoxic to recipients and are preferably inert at the dosages
and concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0027] In still another aspect, the invention provides methods of
transducing a target cell with a rAAV of the invention, in vivo or
in vitro. The in vivo methods comprise the step of administering an
effective dose, or effective multiple doses, of a composition
comprising a rAAV of the invention to a subject, a subject
(including a human being), in need thereof. If the dose is
administered prior to onset/development of a disorder/disease, the
administration is prophylactic. If the dose is administered after
the onset/development of a disorder/disease, the administration is
therapeutic. In embodiments of the invention, an effective dose is
a dose that alleviates (eliminates or reduces) at least one symptom
associated with the disorder/disease state being treated, that
slows or prevents progression to a disorder/disease state, that
slows or prevents progression of a disorder/disease state, that
diminishes the extent of disease, that results in remission
(partial or total) of disease, and/or that prolongs survival. An
example of a disease contemplated for treatment with methods of the
invention is ALS. "Treatment" according to the invention thus
alleviates (eliminates or reduces) at least one symptom associated
with the disorder/disease state being treated (for example, weight
loss is eliminated or reduced by at least 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or greater), that
slows or prevents progression to (onset/development) of a
disorder/disease state, that slows or prevents progression of a
disorder/disease state, that diminishes the extent of disease, that
results in remission (partial or total) of disease, and/or that
prolongs survival. In some embodiments, survival is prolonged by at
least 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or
greater.
[0028] Combination therapies are also contemplated by the
invention. Combination as used herein includes both simultaneous
treatment or sequential treatments. Combinations of methods of the
invention with standard medical treatments (e.g., riluzole) are
specifically contemplated, as are combinations with novel
therapies.
[0029] Administration of an effective dose of the compositions may
be by routes standard in the art including, but not limited to,
systemic intramuscular, parenteral, intravenous, oral, buccal,
nasal, pulmonary, intracranial, intrathecal, intraosseous,
intraocular, rectal, or vaginal. Route(s) of administration and
serotype(s) of AAV components of the rAAV (in particular, the AAV
ITRs and capsid protein) of the invention may be chosen and/or
matched by those skilled in the art taking into account the
infection and/or disease state being treated and the target
cells/tissue(s) that are to express the SOD1 shRNAs. In some
embodiments, the route of administration is systemic. In some,
embodiments the route of administration is intrathecal. In some,
embodiments the route of administration is introcerebroventricular.
In some, embodiments the route of administration is cisterna magna.
In some, embodiments the route of administration is by lumbar
puncture.
[0030] Transduction of cells with rAAV of the invention results in
sustained expression of SOD1 shRNAs. In another aspect, the present
invention thus provides methods of administering/delivering rAAV
which express SOD1 shRNA to a subject, preferably a human being.
The term "transduction" is used to refer to the
administration/delivery of SOD1 shRNAs to a recipient cell either
in vivo or in vitro, via a replication-deficient rAAV of the
invention resulting in expression of a SOD1 shRNA by the recipient
cell.
[0031] Thus, the invention provides methods of administering an
effective dose (or doses, administered essentially simultaneously
or doses given at intervals) of rAAV that encode SOD1 shRNAs to a
subject in need thereof.
[0032] In one aspect, the invention provides methods of delivering
a polynucleotide encoding an shRNA of the invention across the BBB
comprising systemically administering a rAAV with a genome
including the polynucleotide to a subject. In some embodiments, the
rAAV genome is a self complementary genome. In other embodiments,
the rAAV genome is a single-stranded genome. In some embodiments,
the rAAV is a rAAV9. In some embodiments, the rAAV is a rAAV2. In
some embodiments, the rAAV is a rAAVrh74.
[0033] In some embodiments, the methods systemically deliver
polynucleotides across the BBB to the central and/or peripheral
nervous system. Accordingly, a method is provided of delivering a
polynucleotide to the central nervous system comprising
systemically administering a rAAV with a self-complementary genome
including the genome to a subject. In some embodiments, the
polynucleotide is delivered to brain. In some embodiments, the
polynucleotide is delivered to the spinal cord. Also provided is a
method of delivering a polynucleotide to the peripheral nervous
system comprising systemically administering a rAAV with a
self-complementary genome including the polynucleotide to a subject
is provided. In some embodiments, the polynucleotide is delivered
to a lower motor neuron. In some embodiments, the rAAV genome is a
self complementary genome. In other embodiments, the rAAV genome is
a single-stranded genome. In some embodiments, the rAAV is a rAAV9.
In some embodiments, the rAAV is a rAAV2. In some embodiments, the
rAAV is a rAAVrh74.
[0034] In another aspect, the invention provides methods of
delivering a polynucleotide to the central nervous system of a
subject in need thereof comprising intrathecal delivery of rAAV
with a genome including the polynucleotide. In some embodiments,
the rAAV genome is a self complementary genome. In other
embodiments, the rAAV genome is a single-stranded genome. In some
embodiments, the rAAV is a rAAV9. In some embodiments, the rAAV is
a rAAV2. In some embodiments, the rAAV is a rAAVrh74. In some
embodiments, a non-ionic, low-osmolar contrast agent is also
delivered to the subject, for example, iobitridol, iohexol,
iomeprol, iopamidol, iopentol, iopromide, ioversol or ioxilan.
[0035] Embodiments of the invention employ rAAV to deliver
polynucleotides to nerve, glial cells and endothelial cells. In
some embodiments, the nerve cell is a lower motor neuron and/or an
upper motor neuron. In some embodiments, the glial cell is a
microglial cell, an oligodendrocyte and/or an astrocyte. In other
aspects the rAAV is used to deliver a polynucleotide to a Schwann
cell.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIG. 1. AAV9 transduction pattern and persistence in
SOD1.sup.G93A mice. SOD1.sup.G93A mice were injected intravenously
with AAV9-CB-GFP at P1, P21 and euthanized 21 days post injection
(n=3 per time point). Spinal cords were examined for GFP, ChAT
(motor neuron marker) and GFAP (astrocyte marker) expression.
Temporal vein injection of AAV9-CB-GFP at P1 resulted in efficient
transduction of motor neurons and glia in SOD1.sup.G93A mice
(a,f,k,p). Tail vein injection at P21 (b,g,l,q) predominantly
targeted astrocytes with few GFP positive motor neurons. To test
the persistence of transduced cells, AAV9-CB-GFP was intravenously
injected at P1 and P21 in SOD1.sup.G93A animals that were
sacrificed at end stage (.about.P130). Immunofluorescence analysis
of lumbar ventral horn (c,d,h,i,m,n,r,s) demonstrated that GFP
expression was maintained in astrocytes throughout the disease
course. To determine whether SOD1 mediated inflammation and damage
would affect AAV9 transduction, we intravenously injected
SOD1.sup.G93A mice at P85 and harvested their spinal cords at
endstage. There was no difference observed in the transduction
pattern of SOD1.sup.G93A mice treated at P21 or P85. Insets in
(r-t) show co-localization between GFP and GFAP signal. (u)
Quantification of transduced cells in ALS spinal cords (for each
group tissues were analyzed from 3 animals). GFP and ChAT columns
show numbers of cells counted. Bars=100 .mu.m. AAV,
adeno-associated virus; P1, postnatal day 1; P21, postnatal day 21;
P85, postnatal day 85; GFP, green fluorescent protein; ChAT,
choline acetyltransferase; GFAP, glial fibrillary acidic
protein.
[0037] FIG. 2. shRNA constructs show efficient reduction of human
SOD1 protein in vitro and in vivo. (a) Sequence alignments between
human and mouse SOD1 for the regions targeted by the 4 different
shRNA constructs tested. (b) shRNA sequences were cloned into an H1
expression construct and transiently transfected into 293 cells.
Lysates were collected 72 hours post transfection and analyzed by
western blot. (c) Quantification of in vitro suppression of human
SOD1 from three separate transient transfections showed >50%
reduction in SOD1. (d) shRNA 130 was packaged into AAV9 and
injected into SOD1.sup.G93A mice at either P1 or P21. Spinal cords
(n=3 per time point) were harvested three weeks post injection and
analyzed by western blot for human SOD1 protein levels. (e)
Quantification of in vivo suppression of human SOD1 within the
spinal cord of ALS mice. P1 and P21 injected spinal cords showed
60% and 45% reductions in mutant SOD1 protein, respectively. hSOD1,
human superoxide dismutase 1; mSOD1, mouse superoxide dismutase 1;
GAPDH, glyceraldehyde 3 phosphate dehydrogenase.
[0038] FIG. 3. Intravenous delivery of AAV9-SOD1-shRNA improves
survival and motor performance in SOD1.sup.G93A mice. SOD1.sup.G93A
mice received a single intravenous injection of AAV9-SOD1-shRNA at
P1 (n=6, green), P21 (n=9, red) or P85 (n=5, blue). Treated mice
were monitored up to end stage and compared with non-injected
control SOD1.sup.G93A mice (n=15, gray). (a,c) AAV9-SOD1-shRNA
injection into P1 SOD1.sup.G93A mice significantly delayed median
disease onset 39.5 days compared to control animals (uninjected,
103d; P1, 142.5d; p<0.05). Injection in P21 (red) or P85 (blue)
ALS animals had no effect on disease onset (P21, 110d; P85, 105d).
However, AAV9-SOD1-shRNA administered at P1, P21 or P85 all
significantly extended median survival (b,e) (uninjected, 132d; P1,
183.5d P21, 171d; P85, 162d; all comparisons to control
p<0.001). The P21 group had a significant extension in median
disease duration (d) indicating a slowing of disease (uninjected,
29.5d; P1, 41d; P21, 49d; P85, 40d; Wilcoxon Signed Rank Test
p=0.06, 0.01 and 0.12, respectively). (f-h) P1 and P21 treated
animals maintained their weights, had better hind limb grip
strength and rotarod performance when compared to age-matched
controls, indicating treated animals retained muscle tone and motor
function during their prolonged survival. Lines between bars in
(c-e) indicate statistically significant differences. * p<0.05.
P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day
85.
[0039] FIG. 4. Intravenous injection of AAV9-SOD1-shRNA reduces
mutant protein in spinal cords of SOD1.sup.G93A mice. (a-d) Images
of lumbar spinal cord sections from uninjected (a), P1 injected
(b), P21 injected (c) and P85 injected (d) mice were captured with
identical microscope settings to qualitatively show SOD1 levels at
end stage. SOD1 levels inversely correlate with survival. (e-t)
Co-labeling for GFP, ChAT and SOD1 shows that AAV9 transduced motor
neurons had reduced SOD1 expression (arrows) while cells that
lacked GFP maintained high levels of mutant protein (arrowheads).
As described in FIG. 1u, higher MN transduction and corresponding
SOD1 reduction was observed in P1 injected mice (i-l) as compared
to P21 injected (m-p) and P85 injected (q-t) mice. Bar=100 .mu.m.
P1, postnatal day 1; P21, postnatal day 21; P85, postnatal day 85;
SOD1, superoxide dismutase 1; GFP, green fluorescent protein; ChAT,
choline acetyltransferase.
[0040] FIG. 5. AAV9-SOD1-shRNA improves survival and motor
performance in SOD1.sup.G37R mice treated after disease onset. (a)
There was no difference in median disease onset between
AAV9-SOD1-shRNA and control treated mice. (average age at
treatment=215d versus median onset of 194d control and 197d
treated; Log Rank Test p=0.46). (b,f) Median survival of
AAV9-SOD1-shRNA treated SOD1.sup.G37R mice (n=25) was significantly
extended versus control mice (n=21). (control, n=21, 392d; SOD1
shRNA, n=25, 478.5d; Log Rank Test p<0.0001) (c-e) The early
phase of disease was significantly slowed by 73 days in treated
mice as compared to control mice (control, 89d; SOD1 shRNA, 162d;
p<0.0001 Wilcoxon Signed Rank Test) while the late phase of
disease showed a non-significant slowing (control, 63d; SOD1 shRNA,
81d; p=0.14 Wilcoxon Signed Rank Test). Together this amounted to a
66 day increase in median disease duration (control, 173d; SOD1
shRNA, 239d; p<0.0001 Wilcoxon Signed Rank Test). (g) A trend to
improved hind limb grip strength appeared in AAV9-SOD1-shRNA
treated mice compared to control mice.
[0041] FIG. 6. Intravenous injection of AAV9 in adult SOD1.sup.G37R
mice targets astrocytes and motor neurons within the spinal cord.
(a-h) Immunofluorescence analysis revealed neuronal as well as
glial transduction in both AAV9-CB-GFP (a-d) and AAV9-SOD1-shRNA
treated (e-h) mice. (i-p) Human SOD1 levels appeared reduced in
AAV9-SOD1-shRNA treated mice (o) compared with AAV9-GFP treated
mice (k). Bar=100 .mu.m. GFP, green fluorescent protein; ChAT,
choline acetyltransferase; GFAP, glial fibrillary acidic protein;
SOD1, superoxide dismutase 1.
[0042] FIG. 7. Intrathecal infusion of AAV9-SOD1-shRNA in non-human
primates leads to efficient reduction in SOD1 levels. (a) A
myelogram shortly after intrathecal infusion of AAV9-SOD1-shRNA
mixed with contrast shows proper delivery into the subarachnoid
space of a cynomolgus macaque. Arrows show diffusion of the
contrast agent along the entire spinal cord. (b) Lumbar spinal cord
sections from treated monkeys (n=3) were harvested two weeks post
injection and stained for GFP using DAB staining. Sections had
widespread GFP expression throughout the grey and white matter.
(c-e) Immunofluorescence analysis of the lumbar spinal cord
sections showed robust GFP (c) expression within ChAT (d) positive
cells indicating motor neuron transduction (e, merge). (f) Western
blot analysis of the lumbar spinal cords showed significant
reduction in SOD1 levels in AAV9-SOD1-shRNA injected animals as
compared to controls. (g) In vivo quantification of SOD1 knockdown
in monkey lumbar spinal cord homogenate (n=3) showed an 87%
reduction in animals that received AAV9-SOD1-shRNA compared to
uninjected controls. (h) Laser capture microdissection was used to
collect motor neurons or surrounding neuropil from injected and
control lumbar monkey sections. Collected cells were analyzed for
SOD1 levels by qRT-PCR. Motor neurons collected from
AAV9-SOD1-shRNA animals (n=3) had a 95.+-.3% reduction in SOD1 RNA.
Non-neurons had a 66.+-.9% reduction in SOD1 RNA in AAV9-SOD1-shRNA
treated animals. Scale Bars: b=100 .mu.m; e=50 .mu.m. SOD1:
Superoxide dismutase 1.
[0043] FIG. 8. Lumbar intrathecal infusion of AAV9-SOD1-shRNA leads
to efficient transduction of motor neurons and non-neuronal cells
in the cervical, thoracic and lumbar cord resulting in reduction of
SOD1. (a-c) Immunofluorescence analysis of the three segments of
the spinal cord; cervical (a), thoracic (b) and lumbar (c), showed
robust GFP (green) expression within Chat (red) positive cells
indicating motor neuron transduction. (d) GFP+/Chat+ cell counts
show a caudal to rostral gradient of motor neuron transduction
ranging from 85% of transduced cells in the lumbar region to more
than 50% in the cervical region. (e) SOD1 mRNA levels in cervical,
thoracic and lumbar cord section homogenates analyzed by qRT-PCR
show significant reduction in SOD1 transcript, consistently with
motor neuron transduction. SOD1 levels were normalized to
.beta.-actin and AAV9-SOD1-shRNA injected animals were compared to
an AAV9-CB-GFP injected control. Scale bars: (a-c)=50 .mu.m; Error
bars: (d-e)=SD.
[0044] FIG. 9. Design of a clinical SOD1 shRNA construct. (a)
Original AAV SOD1 shRNA construct contains shRNA sequence against
human SOD1 under H1 promoter followed by the expression cassette
for GFP which includes CMV enhancer, CBA promoter, modified SV40
intron, and GFP transgene sequence followed by bGH PolyA
terminator. SOD1 shRNA expression cassette and GFP expression
cassette are flanked by AAV2 ITRs which ensures the packaging of
the complete flanked sequence in AAV9 capsid. (b) In clinical SOD1
shRNA construct, the GFP expression cassette is replaced by a
stuffer element that contains tandem, noncoding sequences from FDA
approved DNA vaccines. ITR: inverted terminal repeats; shRNA, small
hairpin RNA; SOD1, superoxide dismutase 1; CMV, cytomegalo virus
enhancer; CBA, Chicken .beta.-actin promoter; GFP, green
fluorescent protein; bGH pA, bovine growth hormone poly A
terminator.
[0045] FIG. 10. Schematic of clinical SOD1 shRNA construct.
Different restriction sites are placed in the clinical SOD1 shRNA
construct that allow the cloning of multiple shRNA expression
cassettes while maintaining the total distance between the two
ITRs.
[0046] FIG. 11. In vitro transfection of clinical SOD1 shRNA
construct efficiently reduces human SOD1 protein in HEK293 cells.
Representative microscopic fields showing bright-field images of
non-transfected control (a), AAV SOD1 shRNA transfected (b) and
shuttle vector pJet SOD1 shRNA transfected (c,d) HEK 293 cells, 72
hrs post transfection. Corresponding fluorescence images reveal the
lack of GFP fluorescence from pJet SOD1 shRNA transfected HEK 293
cells (g,h) as compared to AAV SOD1 shRNA transfected cells (f).
(i) Western blot analysis of the cell lysates confirms the
efficient knockdown of human SOD1 protein in pJet SOD1 shRNA
transfected cells as compared to the non-transfected control cells.
Immunoblot analysis also confirms removal of GFP transgene from
pJet SOD1 shRNA construct. (j) Quantification of the in vitro
downregulation of SOD1 by pJet SOD1 shRNA. pJet SOD1 shRNA reduces
the protein levels of human SOD1 by almost 50% in HEK293 cells as
compared to control. This reduction is similar to that achieved
with AAV SOD1 shRNA construct.
[0047] FIG. 12. Schematic of cloning strategy for clinical AAV SOD1
shRNA vector. Clinical SOD1 shRNA construct was cloned into AAV CB
MCS vector using Kpn1/SPh1 sites. Kpn1/SPh1 double digest of AAV CB
MCS plasmid results in the release of the complete transgene
expression cassette from this vector which is further replaced with
clinical SOD1 shRNA construct carrying SOD1 shRNA expression
cassette and stuffer sequence.
[0048] FIG. 13. Clinical AAV SOD1 shRNA efficiently reduces human
SOD1 levels in vitro. HEK293 cells were transfected with clinical
AAV SOD1 shRNA plasmid by Calcium phosphate method. Representative
microscopic fields showing brightfield images of non-transfected
control, AAV SOD1 shRNA and Clinical AAV SOD1 shRNA transfected
cells respectively, 72 hrs post-transfection (a-c). Successful
removal of GFP from clinical AAV SOD1 shRNA was confirmed by lack
of GFP expression in Clinical AAV SOD1 shRNA transfected cells
(f,g). (g) Western blot analysis of cell lysates, harvested 72 hrs
post-tranfection confirmed efficient downregulation of SOD1 in
clinical AAV SOD1 shRNA transfected cells as compared to control.
AAV SOD1 shRNA was used as a positive control. (h) Quantification
of the in vitro knockdown of SOD1 by clinical AAV SOD1 shRNA.
[0049] Figure S1. AAV9-shRNA-SOD1 administration is well tolerated
in WT mice. Female and male WT animals were injected with
AAV9-SOD1-shRNA at P1 or P21 and monitored up to 6 months of age.
(a,b) Both male and female treated mice showed steady increase in
body mass as compared to control animals. (c,d) Rotarod performance
and (e,f) hind limb grip strength were not affected by P1 or P21
treatment in both groups as compared to respective controls. n=5
per group. WT, wild type; P1, postnatal day 1; P21, postnatal day
21.
[0050] Figure S2. Hematology and Serum Chemistry of AAV9-SOD1-shRNA
treated WT animals. (a-m) Blood was collected from P1 (green) or
P21 (red) treated and control (gray) WT animals at 150 days of age
for hematology studies. No significant differences were observed
between treated and control animals. (n-w) Serum samples collected
at 180 days of age from the same mice showed no significant
differences in serum chemistry profile. Mean.+-.SEM. n=5 per group.
P1, postnatal day 1; P21, postnatal day 21.
[0051] Figure S3. AAV9-SOD1-shRNA treatment in SOD1.sup.G93A mice
reduces astrogliosis. End stage sections from control and
AAV9-SOD1-shRNA treated animals were harvested and stained for
GFAP, an astrocyte activation marker. P1 (b) and P85 (d) injected
mice showed reduced levels of astrogliosis as compared to control
(a) mice while P21(c) injected mice showed the maximum reduction.
This was consistent with the percent astrocyte transduction
achieved in these mice (FIG. 1u). However, no effect was observed
on microglia reactivity (e-h). Bar=100 .mu.m. P1, postnatal day 1;
P21, postnatal day 21; P85, postnatal day 85.
[0052] Figure S4. Intravenous injection of AAV9-SOD1-shRNA
efficiently reduces levels of mutant SOD1 protein in spinal cords
of SOD1.sup.G37R mice. (a) Following disease onset, AAV9-CB-GFP or
AAV9-SOD1-shRNA was injected in SOD1.sup.G37R mice and spinal cords
were harvested at end stage and analyzed by western blot for human
SOD1 protein levels. (b) Quantification of a) shows suppression of
human SOD1 within the spinal cord of SOD1.sup.G37R mice (n=4 per
group). hSOD1, human superoxide dismutase 1; GAPDH, glyceraldehyde
3 phosphate dehydrogenase.
[0053] Figure S5. shRNA 130 efficiently reduces the levels of
monkey SOD1 in vitro. (a) Sequence alignment of the region targeted
by SOD1 shRNA 130 and a single mismatch with the monkey sequence.
Monkey sequence corresponds to SOD1 sequence from Rhesus monkey (NM
001032804.1), Cynomolgus monkey (sequenced in-house) and African
green monkey. (b) The shRNA 130 expression cassette was cloned into
lentiviral vector and used to infect Cos-7 cells. Lysates were
analyzed 72 hours post infection by qRT PCR for SOD1. shRNA 130
reduced SOD1 transcript levels by 75% in Cos-7 cells.
EXAMPLES
[0054] The present invention is illustrated by the following
examples. While the present invention has been described in terms
of various embodiments and examples, it is understood that
variations and improvements will occur to those skilled in the art.
Therefore, only such limitations as appear in the claims should be
placed on the invention.
Example 1
AAV9 Transduction Pattern and Persistence in SOD1.sup.G93A Mice
[0055] We first evaluated the efficiency of AAV9 transduction in
the SOD1.sup.G93A mouse model that develops fatal paralytic
disease. High copy SOD1.sup.G93A mice were obtained from Jackson
Laboratories (Bar Harbor, Me.) and bred within the Kaspar lab.
Animals were genotyped before the treatment to obtain SOD1.sup.G93A
expressing mice and their wild type littermates. Only female mice
were included in the SOD1.sup.G93A experiments. Animals were
injected intravenously at postnatal day 1 or day 21 (to be referred
to as P1 and P21, respectively) with self-complementary AAV9
expressing GFP from the CMV enhancer/beta-actin (CB) promoter
(AAV9-CB-GFP) (n=3 per group). Three weeks post-injection, animals
were sacrificed, and spinal cords examined for GFP expression
(FIGS. 1a-u).
[0056] All procedures with animals described herein were performed
in accordance with the NIH Guidelines and approved by the Research
Institute at Nationwide Children's Hospital (Columbus, Ohio),
University of California (San Diego, Calif.) or Mannheimer
Foundation (Homestead, Fla.) Institutional Animal Care and Use
Committees.
[0057] Transduction efficiency was high in SOD1.sup.G93A astrocytes
with GFP expressed in 34.+-.2% and 54.+-.3%, respectively, of P1
and P21 injected spinal grey matter astrocytes (defined by
immunoreactivity for GFAP). This efficiency was similar to our
previous report of 64.+-.1% in P21 injected wild type
animals.sup.18. Motor neurons were a prominent cell type transduced
at all levels of the spinal cords of P1 injected SOD1.sup.G93A
animals (62.+-.1%), compared with significantly lower targeting to
motor neurons in P21 injected animals (8.+-.1%).
[0058] Although we have previously reported that transduced
astrocytes in wild type spinal cords persist with continued GFP
accumulation for at least 7 weeks post injection.sup.18, longevity
of mutant SOD1 astrocytes (and their continued synthesis of genes
encoded by the AAV9 episome) during active ALS-like disease was
untested. Therefore, SOD1.sup.G93A mice were injected at P1 and P21
with AAV9-CB-GFP and followed to end-stage (.about.P130, n=3 per
group) (FIGS. 1c,d,h,i,m,n,r,s). Immunofluorescent examination of
the end-stage SOD1.sup.G93A spinal cords from animals injected at
P1 and P21 showed a comparable number of GFP-expressing astrocytes
as were found 21 days after AAV9 injection (P1: 42.+-.2%, P21:
61.+-.2%). These data are consistent with survival of transduced
astrocytes for the duration of disease (.about.110 days post
injection at P21) in SOD1.sup.G93A mice and that AAV9-encoded gene
expression is maintained.
[0059] Further, recognizing that SOD1 mutant mediated damage,
including astrocytic and microglial activation and early changes in
the blood brain barrier develop during disease in mice in SOD1
mutant mice.sup.20, we tested if this damage affected AAV9
transduction. SOD1.sup.G93A mice were injected at P85 with
AAV9-CB-GFP and sacrificed at endstage (n=3) (FIGS. 1e,j,o,t).
Analysis of the spinal cords revealed that the transduction pattern
seen in P85 animals was similar to P21 treated animals with
astrocytes as the predominant cell type transduced at all levels
(51.+-.6% GFP+/GFAP+ cells in lumbar grey matter).
Example 2
Development of an shRNA Sequence Specific for Human SOD1
[0060] To specifically target the human SOD1 mRNA, four shRNA
constructs targeting human SOD1 were generated and obtained from
the Life Technologies design tool. The constructs that had a
minimum of four base mismatches compared to the mouse mRNA sequence
(FIG. 2a). The base numbers for the human sequences shown
correspond to record number CCDS33536.1 in the NCBI CCDS database.
These constructs were cloned in pSilencer 3.1 (Genscript) under the
human H1 promoter and tested in vitro. shRNA 130 along with H1
promoter was further cloned into an AAV vector along with a
reporter GFP under Chicken Beta-Actin promoter to identify the
transduced cells. Human 293 cells were transfected with each
cassette. The HEK-293 cells were maintained in IMDM medium
containing 10% FBS, 1% L-glutamine and 1% penicillin/streptomycin.
Upon reaching .about.60% confluence, cells were transfected with
pSilencer 3.1 containing the shRNAs being tested. Protein lysates
were prepared 72 hours post transfection and analyzed for SOD1
levels by western blot. All four sequences reduced SOD1 protein
levels by >50% (FIGS. 2b,c).
[0061] shRNA130 was selected for further experiments because it
produced the most consistent knockdown across three separate
transfection experiments. It was cloned into a self-complementary
AAV9 vector that also contained a GFP gene whose expression would
identify transduced cells (referred to as AAV9-SOD1-shRNA).
Self-complementary AAV9-SOD1-shRNA was produced by transient
transfection procedures using a double-stranded AAV2-ITR-based
CB-GFP vector, with a plasmid encoding Rep2Cap9 sequence as
previously described along with an adenoviral helper plasmid
pHelper (Stratagene, Santa Clara, Calif.) in 293 cells.sup.18.
[0062] To confirm that the shRNA could suppress accumulation of
human SOD1, SOD1.sup.G93A mice (n=3) were injected intravenously
with AAV9-SOD1-shRNA at either P1 or P21. For neonatal mouse
injections, postnatal day 1-2 SOD1.sup.G93A pups were utilized.
Total volume of 50 .mu.l containing 5.times.10.sup.11 DNAse
resistant viral particles of AAV9-SOD1-shRNA (Virapur LLC, San
Diego, Calif.) was injected via temporal vein as previously
described.sup.18. A correct injection was verified by noting
blanching of the vein. After the injection, pups were returned to
their cage. Animals were euthanized three weeks post injection and
the spinal cords were harvested and analyzed by immunoblotting for
both human (mutant) and murine (wild-type) SOD1 protein. P1 and P21
injected spinal cords showed 60% and 45% reductions in mutant SOD1
protein, respectively (FIGS. 2d,e). Murine SOD1 levels remained
unchanged in response to human SOD1 knockdown.
Example 3
AAV9-SOD1-shRNA is Safe and Well Tolerated in Wild Type Mice
[0063] To determine whether high dose AAV9-SOD1-shRNA would be
safe, normal mice of both sexes were intravenously injected at P1
or P21 (P1=5 males, 5 females at 5.times.10.sup.11vg; P21=5 males,
5 females at 2.times.10.sup.12 vector genomes (vg)) and then
monitored up to 6 months of age. Both P1 and P21 injected mice
showed a steady increase in body mass similar to untreated mice
(Figure S1). Weekly behavioral tests observed no significant
differences between injected and control groups in motor skills
(measured by rotarod) as well as in hind limb grip strength. At 150
and 180 days of age, blood samples were collected. Complete and
differential blood counts of both treated and untreated groups
showed similar blood chemistry parameters (Figure S2). Serum
samples from both groups showed no significant differences in the
levels of alkaline phosphatase, creatinine, blood urea nitrogen,
potassium, sodium and chloride. Finally, all the animals were
sacrificed at the age of 180 days. Histopathological analyses by a
pathologist blinded to treatment group revealed no significant
alterations in the AAV9-SOD1-shRNA treated animals compared to
uninjected controls (data not shown). We conclude that both
administration of AAV9 and sustained shRNA expression were
apparently safe and well tolerated.
Example 4
Extended Survival of SOD1.sup.G93A Mice from AAV9 Mediated
Reduction in Mutant SOD1 Even when Initiated Mid-Disease
[0064] To test the efficacy of AAV9-mediated SOD1 reduction, we
treated cohorts of SOD1.sup.G93A mice with a single intravenous
injection of AAV9-SOD1-shRNA before (P1, 5.times.10.sup.11vg, n=6
and P21, 2.times.10.sup.12 vg, n=9) or after (P85,
3.times.10.sup.12 vg, n=5) onset, recognizing that many astrocytes,
but few motor neurons, would be transduced at the two later time
points. For adult tail vein injections, animals were placed in a
restraint that positioned the mouse tail in a lighted, heated
groove. The tail was swabbed with alcohol then injected
intravenously with AAV9-SOD1-shRNA.
[0065] Onset of disease (measured by weight loss from
denervation-induced muscle atrophy) was significantly delayed by a
median of 39.5 days (FIG. 3a,c; uninjected, 103d; P1, 142.5d;
p<0.05, Wilcoxon Signed Rank Test) in the P1 injected cohort,
but was not affected by either of the later injections (P21, 110d;
P85, 105d). P1 and P21 treated animals maintained their weights,
had better rotarod performance and hind limb grip strength when
compared to age-matched controls, indicating treated animals
maintained muscle tone and motor function during their prolonged
survival (FIGS. 3f-h). Survival was significantly extended by AAV9
injection at all three ages, yielding survival times 30-51.5 days
beyond that of uninjected SOD1.sup.G93A mice (uninjected, 132d; P1,
183.5d; P21, 171d; P85, 162d; Log-Rank Test p=<0.0001, 0.0003
and 0.001, respectively) (FIGS. 3b,e). Defining disease duration as
the time from onset to end-stage revealed that the P21 treatment
group had significantly increased duration, indicative of slowed
disease progression, compared to uninjected controls (uninjected,
29.5d; P21, 49d; Wilcoxon Signed Rank Test p=0.01), with trends
toward slowed progression in animals injected at the other two ages
(P1, 41d; P85, 40d; p=0.06 and 0.12, respectively) (FIG. 3d). The
lower percentage of targeted non-neuronal cells at P1 versus those
targeted at P21 (FIG. 1u) suggests that a minimum number of
non-neuronal cells must be targeted to slow disease progression in
the fast progressive SOD1.sup.G93A model (FIG. 1u).
Example 5
Reduction of Mutant SOD1 in AAV9 Infected Cells in Treated
SOD1.sup.G93A Mice
[0066] Indirect immunofluorescence with an antibody that recognizes
human, but not mouse SOD1, was used to determine accumulated mutant
SOD1 levels in end-stage spinal cords of treated and control mice.
Human SOD1 levels in end-stage spinal cord sections inversely
correlated with increased survival (FIGS. 4a-d). At end-stage, P1
(FIG. 4b), P21 (FIG. 4c) and P85 (FIG. 4d) AAV9-SOD1-shRNA injected
animals had lower levels of mutant SOD1 when compared with
uninjected SOD1.sup.G93A animals (FIG. 4a). SOD1 expression within
transduced motor neurons (identified by GFP and ChAT expressing
cells) was reduced compared to surrounding neurons that had not
been transduced to express viral encoded GFP (FIGS. 4h,l,p,t;
arrows versus arrowheads). Moreover, immunofluorescence imaging of
end-stage spinal cords revealed corresponding reduction in
astrogliosis, but no difference in microgliosis in AAV9-SOD1-shRNA
treated animals versus controls (Figure S3).
Example 6
Therapeutic Slowing of Disease Progression with Peripheral
Injection of AAV9 after Onset
[0067] To determine if AAV9-mediated mutant SOD1 reduction would
slow disease progression, a cohort of SOD1.sup.G37R mice.sup.6 were
injected intravenously with AAV9-SOD1-shRNA after disease onset
(average age at treatment=215d versus median onset of 197d in
treated animals; Log Rank Test p=0.46; FIG. 5a). loxSOD1.sup.G37R
ALS mice, carrying a human mutant SOD1.sup.G37R transgene flanked
by lox p sites under its endogenous promoter, were maintained in as
previously described.sup.37. A combination of AAV9-CB-GFP (n=9) and
uninjected (n=12) littermates were used as controls.
[0068] Post hoc analysis showed no differences between GFP and
uninjected animals, therefore the groups were compiled as "control"
in FIG. 5. Animals were evaluated weekly for body weight and hind
limb grip strength and monitored until end-stage. AAV9-SOD1-shRNA
treatment after disease onset significantly extended median
survival by 86.5 days over control animals (control, n=21, 392d;
SOD1 shRNA, n=25, 478.5d; Log Rank Test p<0.0001). Early disease
duration, defined by the time from peak weight to 10% weight loss,
was significantly slowed (control, 89d; SOD1 shRNA treated mice,
162 days; Wilcoxon Signed Rank Test p<0.01; FIG. 5c). A
continuing trend toward slowing of later disease (10% weight loss
to end stage) was also seen (control, 63d; SOD1 shRNA treated mice,
81d; Wilcoxon Signed Rank Test p=0.1389; FIG. 5d). Overall disease
duration following AAV9-SOD1-shRNA therapy rose to 239d after
disease onset versus 173d in control mice (Wilcoxon Signed Rank
Test p<0.0001; FIG. 5e). Consistent with the slowed progression,
AAV9 therapy maintained grip strength relative to control SOD1
mutant animals (FIG. 5g). The 86.5 day extension in survival
surpassed the 62 day extension seen in transgenic studies that used
astrocyte-specific Cre expression to inactivate the mutant
SOD1.sup.G37R transgene.sup.8, presumably reflecting efficient AAV9
transduction of astrocytes after peripheral delivery and the
possible transduction of other cell types (especially
microglia.sup.6) whose synthesis of mutant SOD1 accelerates disease
progression.
[0069] Histological examination of end-stage SOD1.sup.G37R treated
animals revealed similar levels of intraspinal cell transduction in
animals treated with AAV9-SOD1-shRNA or AAV9-GFP (FIG. 6). GFP
expression was predominantly observed within motor neurons and
astrocytes of both groups, and SOD1 expression was detectably
decreased only in animals that received AAV9-SOD1-shRNA (FIGS.
6k,o). Immunoblotting of whole spinal cord extracts from end stage
SOD1.sup.G37R mice revealed an 80% reduction in hSOD1 protein
levels in AAV9-SOD1-shRNA treated animals compared to controls
(Figure S4).
Example 7
AAV9 Mediated Suppression of SOD1 in Non-Human Primates
[0070] To test whether SOD1 levels could be efficiently lowered
using AAV9 in the non-human primate spinal cord, AAV9 was injected
intrathecally via lumbar puncture. This method was chosen over
systemic delivery to decrease the amount of virus required and to
minimize any effects from reduction of SOD1 in peripheral tissues.
One year old cynomolgus macaques (Macaca fascicularis) with average
body weight of 2 kg were used for this study at the Mannheimer
Foundation. Regular monitoring of overall health and body weight
was performed prior and after the injections to assess the welfare
of the animals.
[0071] Sequencing of cDNA copied from mRNA isolated from African
Green Monkey (COS cells) and the Cynomolgus macaque verified that
the 130 shRNA had a single base mismatch to either sequence (Figure
S5). The 130 shRNA expression cassette was inserted into a
lentiviral vector which was then used to transduce COS cells. Cos-7
cells were maintained in DMEM with 10% FBS and 1%
penicillin/streptomycin. Cells were infected with a lentiviral
vector expressing SOD1 shRNA 130 under the H1 promoter and RFP
under CMV promoter. RNA was extracted from infected and
non-infected cells 72 hours post infection using an RNAeasy Kit
(Qiagen). cDNA was prepared using RT.sup.2 First strand synthesis
kit (SABiosciences). SOD1 transcript levels were analyzed by
qRT-PCR which revealed that the monkey SOD1 mRNA was reduced by
.about.75% in 130 shRNA transduced cells compared to mock
transduced control cells (Figure S5).
[0072] The AAV9-SOD1-shRNA virus (1.times.10.sup.13 vg/kg) was
infused along with contrast agent via lumbar puncture into the
subarachnoid space of three male cynomolgus macaques and one
control subject was injected with AAV9-CB-GFP (1.times.10.sup.13
vg/kg) (FIG. 7a). Each intrathecal injection was performed by
lumbar puncture into the subarachnoid space of the lumbar thecal
sac. AAV9 was resuspended with omnipaque (iohexol), an iodinated
compound routinely used in the clinical setting. Iohexol is used to
validate successful subarachnoid space cannulation and was
administered at a dose of 100 mg/Kg. The subject was placed in the
lateral decubitus position and the posterior midline injection site
at .about.L4/5 level identified (below the conus of the spinal
cord). Under sterile conditions, a spinal needle with stylet was
inserted and subarachnoid cannulation was confirmed with the flow
of clear CSF from the needle. In order to decrease the pressure in
the subarachnoid space, 0.8 ml of CSF was drained, immediately
followed by injection with a mixture containing 0.7 mL iohexol (300
mg/ml formulation) mixed with 2.1 mL of virus (2.8 ml total).
[0073] No side effects from the treatments were identified. Two
weeks post injection, the spinal cords were harvested for analysis
of GFP expression and SOD1 RNA levels. GFP expression was seen
broadly in neuronal and astrocytic cells throughout the grey and
white matter of the lumbar spinal cord, the area closest to the
site of injection (FIGS. 7b-e). Immunoblotting of extracts of
lumbar spinal cord revealed 87% reduction in monkey SOD1 protein
levels (FIGS. 7f,g). Laser capture microdissection was then used to
isolate total RNA from motor neurons as well as from glia in the
nearby neuropil. Analysis by quantitative RT-PCR using primers
specific for monkey SOD1 (and normalized to actin) confirmed a
95.+-.3% knockdown in the motor neuron pool and a 66.+-.9%
knockdown in the neuropil pool when compared to samples from a
control animal (FIG. 7h).
[0074] Next we examined the level of cell transduction throughout
the spinal cord including cervical, thoracic and lumbar segments.
GFP was found to be expressed broadly within all sections analyzed
(FIGS. 8a-c). Motor neuron counts revealed a caudal to rostral
gradient in cell transduction, with the cervical region showing
more than 50% of GFP/Chat+ motor neurons, increasing to 65% in the
thoracic region and reaching a remarkable 80% in the lumbar region
(FIG. 8d). In order to determine the overall level of SOD1
knockdown achieved with this transduction pattern, qRT-PCR for SOD1
was performed on whole section homogenates from cervical, thoracic
and lumbar cord segments. The results confirmed robust SOD1
reduction at all three spinal cord levels, ranging from a 60%
decrease in the cervical segment, a 70% decrease in the thoracic
region and an 88% decrease in the lumbar region (FIG. 8e),
consistent with the proportion of cells transduced in each
region.
DISCUSSION
[0075] The examples above show that intravenous administration of
AAV9-SOD1-shRNA is safe and well tolerated in wild type mice, with
the absence of adverse effects after long-term assessment. Thiss
approach have achieved one of the longest extensions in survival
ever reported in the rapidly progressive SOD1.sup.G93A mouse model
of ALS (increasing survival by 39% when treatment is initiated at
birth). Even more encouraging, markedly slowed disease progression
is seen even when AAV9 therapy to reduce mutant SOD1 synthesis is
applied after disease onset in SOD1.sup.G37R mice, thereby
significantly extending survival. Thus, the vascular delivery
paradigm in mice represents a proof of concept that mutant SOD1
knockdown after disease onset can be beneficial in both rapid and
more slowly progressive models of ALS at clinically relevant points
in disease. Together, these data show that robust targeting and
suppression of SOD1 levels via AAV9-mediated delivery of shRNA is
effective in slowing disease progression in mouse models of ALS,
critically even when treatment is initiated after onset.
[0076] Multiple recent studies have brought forward the hypothesis
that wild-type SOD1 may contribute through misfolding to the
pathogenic mechanism(s) that underlie sporadic ALS through a
pathway similar to that triggered by mutant SOD1.sup.14,30-32.
Included in this body of evidence is our own demonstration that
astrocytes produced from sporadic ALS patients are toxic to
co-cultured motor neurons and that toxicity is alleviated by
siRNA-mediated reduction in wild type SOD1.sup.30. This evidence
creates the potential that a proportion of sporadic ALS patients
could also benefit from an AAV9-mediated SOD1 reduction approach
that we have demonstrated to be effective in slowing disease
progression in mice that develop fatal, ALS-like disease from
expressing ALS-causing mutations in SOD1.
[0077] Finally, for translation of an AAV9-mediated suppression of
SOD1 synthesis to the human setting, we have determined that
infusion directly into the CSF at the lumbar level in a non-human
primate produce substantial SOD1 reduction by targeting both motor
neurons and non-neuronal cells. This outcome provides strong
support for extending these efforts to an adult human by direct
injection into CSF, as previously proposed.sup.33,34, so as to 1)
limit the cost of viral production, 2) reduce the possibility that
chronic suppression of SOD1 in the periphery may have deleterious
consequences, and 3) reduce viral exposure to the peripheral immune
system.sup.33. These data strongly indicate AAV9-SOD1-shRNA as a
treatment for ALS.
Techniques/Methods Used in Examples 1-7
[0078] Perfusion and Tissue Processing.
[0079] Control and treated SOD1.sup.G93A mice were sacrificed at
either 21 days post injection or at endstage for
immunohistochemical analysis. Animals were anesthetized with
xylazene/ketamine cocktail, transcardially perfused with 0.9%
saline, followed by 4% paraformaldehyde. Spinal cords were
harvested, cut into blocks of tissue 5-6 mm in length, and then cut
into 40 .mu.m thick transverse sections on a vibratome (Leica,
Bannockburn, Ill.). Serial sections were kept in a 96-well plate
that contained 4% paraformaldehyde and were stored at 4.degree. C.
End stage loxSOD1.sup.G37R mice were anesthetized using isoflurane
and perfused with 4% paraformaldehyde. Spinal cord segments,
including cervical, thoracic and lumbar segments were dissected.
Following cryoprotection with 20% sucrose/4% paraformaldehyde
overnight, spinal cords were frozen in isopentane at -65.degree.
C., and serial 30 .mu.m coronal sections were collected free
floating using sliding microtome.
[0080] For safety studies, P1, P21 treated and control wild type
mice were sacrificed at 180 days of age. Animals were anesthetized
using xylazene/ketamine cocktail and perfused with 0.9% saline.
Different tissues were removed and stored in 10% buffered formalin.
These tissues were further processed, blocked and mounted for
hematoxilin & eosin staining by the Nationwide Children's
Hospital Morphology Core.
[0081] Cynomolgus monkeys injected with virus were euthanized 2
weeks post injection. Animals were anesthetized with sodium
pentobarbital at the dose of 80-100 mg/kg intravenously and
perfused with saline solution. Brain and spinal cord dissection
were performed immediately and tissues were processed either for
nucleic acid isolation (snap frozen) or post-fixed in 4%
paraformaldehyde and subsequently cryoprotected with 30% sucrose
and frozen in isopentane at -65.degree. C. 12 .mu.m coronal
sections were collected from lumbar cord using a cryostat for free
floating immunostaining.
[0082] Immunohistochemistry. Mouse spinal cords were stained as
floating sections. Tissues were washed three-times for 10 minutes
each in TBS, then blocked in a solution containing 10% donkey
serum, 1% Triton X-100 and 1% penicillin/streptomycin for two hours
at room temperature. All the antibodies were diluted with the
blocking solution. Primary antibodies used were as follows: rabbit
anti-GFP (1:400, Invitrogen, Carlsbad, Calif.), rabbit anti-SOD1
(1:200, Cell signaling, Danvers, Mass.), goat anti-ChAT (1:50
Millipore, Billerica, Mass.), mouse anti-GFAP (1:200, Millipore,
Billerica, Mass.), chicken anti GFAP (1:400, Abcam, Cambridge,
Mass.), and rabbit anti-Ibal (1:400, Wako, Richmond Va.). Tissues
were incubated in primary antibody at 4.degree. C. for 48-72 hours
then washed three times with TBS. After washing, tissues were
incubated for 2 hours at room temperature in the appropriate FITC-,
Cy3-, or Cy5-conjugated secondary antibodies (1:200 Jackson
Immunoresearch, Westgrove, Pa.) and DAPI (1:1000, Invitrogen,
Carlsbad, Calif.). Tissues were then washed three times with TBS,
mounted onto slides then coverslipped with PVA-DABCO. All images
were captured on a Zeiss-laser-scanning confocal microscope.
[0083] For DAB staining, monkey spinal cord sections were washed
three times in TBS, blocked for 2 h at RT in 10% donkey serum and
1% Triton X-100. Sections were then incubated overnight at
4.degree. C. with rabbit anti-GFP primary antibody (1:1000
Invitrogen, Carlsbad, Calif.) diluted in blocking buffer. The
following day, tissues were washed with TBS 3 times, incubated with
biotinylated secondary antibody anti-rabbit (1:200 Jackson
Immunoresearch, Westgrove, Pa.) in blocking buffer for 30 min at
RT, washed 3 times in TBS and incubated for 30 min at RT with ABC
(Vector, Burlingame, Calif.). Sections were then washed for 3 times
in TBS and incubated for 2 min with DAB solution at RT and washed
with distilled water. These were then mounted onto slides and
covered with coverslips in mounting medium. All images were
captured with the Zeiss Axioscope.
[0084] Motor Neuron and Astrocyte Quantification.
[0085] For MN quantification, serial 40 .mu.m thick lumbar spinal
cord sections, each separated by 480 .mu.m, were labeled as
described for GFP and ChAT expression. Stained sections were
serially mounted on slides from rostral to caudal, then
coverslipped. Sections were evaluated using confocal microscopy
(Zeiss) with a 40.times. objective and simultaneous FITC and Cy3
filters. The total number of ChAT positive cells found in the
ventral horns with defined soma was tallied by careful examination
through the entire z-extent of the section. GFP labeled cells were
quantified in the same manner, while checking for co-localization
with ChAT. For astrocyte quantification, as with MNs, serial
sections were stained for GFP, GFAP and then mounted. Using
confocal microscopy with a 63.times. objective and simultaneous
FITC and Cy5 filters, random fields in the ventral horns of lumbar
spinal cord sections from tail vein injected animals were selected.
The total numbers of GFP and GFAP positive cells were counted from
a minimum of at least 24-fields per animal while focusing through
the entire z extent of the section. Spinal cord sections of 3
animals per group were examined for MN and astrocyte
quantification.
[0086] Immunoblot Analysis.
[0087] Spinal cords were harvested from P1, P21 injected and
control SOD1.sup.G93A mice 21 days post injection and from treated
and control monkeys 2 weeks post injection of AAV9-SOD1-shRNA.
Spinal cords were homogenized and protein lysates were prepared
using T-Per (Pierce) with protease inhibitor cocktail. Samples were
resolved on SDS-PAGE according to manufacturer's instructions.
Primary antibodies used were rabbit anti-SOD1 (1:750, Cell
signaling, Danvers, Mass.) mouse anti-SOD1 (1:750, Millipore,
Billerica, Mass.), rabbit anti-SOD1 (1:1000, Abcam, Cambridge,
Mass.), rabbit anti-Actin (1:1000, Abcam, Cambridge, Mass.) and
mouse anti-GAPDH (1:1000, Millipore, Billerica, Mass.). Secondary
antibodies used were anti-rabbit HRP (1:10000-1:50000) and
anti-mouse HRP (1:10000). Densitometric analysis was performed
using Image J software.
[0088] Laser Capture Microdissection.
[0089] 12 .quadrature.m lumbar spinal cord frozen sections were
collected onto PEN membrane slides (Zeiss, Munich, Germany) and
stained with 1% Cresyl violet (Sigma, St. Louis, Mo.) in methanol.
Sections were air dried and stored at -80.degree. C. After thawing,
motor neurons were collected within 30 min from staining using the
laser capture microdissector PALM Robo3 Zeiss) using the following
settings: Cut energy: 48, LPC energy: 20, Cut focus: 80/81, LPC
focus: 1, Position speed: 100, Cut speed: 50. About 500 MNs were
collected per animal. Non-neuronal cells from the ventral horn were
collected from the same sections after collecting the motor
neurons.
[0090] qRT-PCR.
[0091] RNA from laser captured cells or whole spinal cord sections
from the cervical, thoracic and lumbar segments was isolated using
the RNaqueous Micro Kit (Ambion, Grand Island, N.Y.) according to
manufacturer's instructions. RNA was then reverse-transcribed into
cDNA using the RT.sup.2 HT First Strand Kit (SABiosciences,
Valencia, Calif.). 12.5 ng RNA were used in each Q-PCR reaction
using SyBR Green (Invitrogen, Carlsbad, Calif.) to establish the
relative quantity of endogenous monkey SOD1 transcript in animals
who had received the AAV9-SOD1-shRNA compared to animals who had
received only AAV9-GFP. Each sample was run in triplicate and
relative concentration calculated using the ddCt values normalized
to endogenous actin transcript.
[0092] Behavior and Survival Analysis. Treated and control
SOD1.sup.G93A mice were monitored for changes in body mass twice a
week. loxSOD1.sup.G37R mice were weighed on a weekly basis. Motor
coordination was recorded using a rotarod instrument (Columbus
Instruments, Columbus, Ohio). Each weekly session consisted of
three trials on the accelerating rotarod beginning at 5 rpm/min.
The time each mouse remained on the rod was registered. Both
SOD1.sup.G93A and loxSOD1.sup.G37R mice were subjected to weekly
assessment of hindlimb grip strength using a grip strength meter
(Columbus Instruments, Columbus, Ohio). Each weekly session
consisted of 3 (SOD1.sup.G93A mice) or 5 (loxSOD1.sup.G37R mice)
tests per animal. Survival analysis was performed using
Kaplan-Meier survival analysis. End stage was defined as an
artificial death point when animals could no longer "right"
themselves within 30 sec after being placed on its back. Onset and
disease progression were determined from retrospective analysis of
the data. Disease onset is defined as the age at which the animal
reached its peak weight. Disease duration is defined as the time
period between disease onset and end stage. Early disease duration
is the period between peak weight and loss of 10% of body weight
while late disease duration is defined as the period between 10%
loss of body weight until disease end stage. Due to shorter life
span of SOD1.sup.G93A animals, we did not assess the distinction
between the early and late progression.
[0093] For toxicity analysis following injection at P1 or P21,
treated and control WT mice were subjected to behavioral analysis
starting at -30 days of age and monitored up to 6 months. Body mass
was recorded weekly while rotarod performance and hindlimb grip
strength were recorded biweekly.
[0094] Hematology and Serum Studies.
[0095] Blood samples were collected in (K2) EDTA microtainer tubes
(BD) from treated and control WT mice at 150 days of age by
mandibular vein puncture. The same animals were bled at 180 days of
age and blood was collected in serum separator microtainer tubes.
The blood was allowed to clot for an hour and was then centrifuged
at 10,000 rpm for 5 minutes. The clear upper phase (serum) was
collected and frozen at -80.degree. C. Hematological and serum
analysis were conducted by Ani Lytics Inc, Gaithersburg, Md.
[0096] Statistical analysis. All statistical tests were performed
using the GraphPad Prism (San Diego, Calif.) software package.
Kaplan Meier survival analyses were analyzed by the Log Rank Test.
Comparisons of median disease durations and survival times were
analyzed by the Wilcoxon Signed Rank Test.
Example 8
Development of a Clinical SOD1 shRNA Construct
[0097] The AAV SOD1 shRNA vector described in Example 2 carries
shRNA against human SOD1 sequence under the H1 promoter (FIG. 9a).
The same vector also contains a GFP expression cassette which
expresses GFP under a CBA promoter. The other regulatory elements
present in this cassette include CMV enhancer, SV40 intron and bGH
PolyA terminator sequence. We show herein that AAV9 SOD1 shRNA
administration results in efficient SOD1 downregulation along with
robust expression of GFP in vitro as well as in vivo. No
significant alterations were observed after the long term
assessment of wild-type mice administered with AAV9 SOD1 shRNA.
These results suggested that there are no evident off-target
effects due to the long-term expression of SOD1 shRNA as well as
overexpression of GFP. Although we did not find GFP toxicity in our
mice, several reports have shown the adverse effects of GFP
overexpression in vitro and in vivo. Therefore, to eliminate the
possibility of GFP toxicity altogether, the SOD1 shRNA construct of
Example 2 was modified by replacing the GFP expression cassette
with a non-coding stuffer sequence while maintaining the size of
the total DNA construct flanked by the ITRs (FIG. 9b). This is
important as the distance between the two ITR sequences greatly
affects the packaging capacity of the flanked construct into AAV9
capsids[321-324].
[0098] To date, none of the FDA approved stuffer sequences are
readily available. There are, however, several plasmid backbones
that are approved by FDA for the human administration. Small DNA
fragments were picked from these plasmids which do not correspond
to any essential DNA sequences necessary for selection and
replication of the plasmid or the elements of the transcriptional
units. The plasmid backbones are listed in Table 1. The DNA
elements from different plasmids were arranged in tandem to
generate a complete, 1607 bp stuffer sequence (SEQ ID NO: 22).
Finally, a DNA construct containing the SOD1 shRNA expression
cassette, followed by the stuffer sequence was synthesized from
Genscript.
TABLE-US-00004 TABLE 1 Plasmid ClinicalTrials.gov Backbone
Condition Intervention Phase Identifier pVax1 Early Stage Non-Small
Recombinant DNA- 1 NCT00062907 Cell Lung Cancer pVAX/L523S pCDNA3
Chronic Hepatitis B DNA vaccine 1, 2 NCT00536627 pCMVS2.S pUCMV3
Stage III Ovarian pUMVC3-hIGFBP-2 1 NCT01322802 Epithelial Cancer
multi-epitope plasmid Stage III Ovarian DNA vaccine Germ Cell Tumor
Stage IV Ovarian Epithelial Cancer Stage IV Ovarian Germ Cell Tumor
pBK-CMV Prostate Cancer NY-ESO-1 plasmid 1 NCT00199849 Bladder
Cancer DNA Cancer Vaccine Non-Small Cell Lung Cancer Esophageal
Cancer Sarcoma pGA2 HIV Infections pGA2/JS2 Plasmid DNA 1
NCT00043511 Vaccine
[0099] Clinical SOD1 shRNA construct has shRNA against human SOD1
under H1 promoter which is followed by the non-coding stuffer
sequence. This construct is designed in such a way that multiple
shRNA expression cassettes can be added to the final vector by
simultaneous removal of the stuffer sequence. Restriction
endonuclease sites have been added to the stuffer sequence so that
a part of the stuffer can be removed when another shRNA expression
cassette is added (FIG. 10). This simultaneous removal and addition
of DNA sequences would help maintaining the optimal size of the
whole construct between the ITRs (.about.2.0 kb) to achieve
efficient packaging.
[0100] Clinical SOD1 shRNA construct from Genscript was cloned into
pJet1.2 shuttle vector via EcoRV. This parental clone was screened
using various restriction endonucleases designed within the
construct to confirm the correct clone. Kpn1/Sph1 double digestion
of pJet SOD1 shRNA confirmed the presence of the complete construct
(2023 bp) while Xba1 digestion confirmed the presence of SOD1 shRNA
expression cassette (414 bp) and the stuffer element, along with
pJet backbone (3000 bp). EcoRV/Pme1 double digestion also revealed
the presence of stuffer element.
Example 9
Clinical SOD1 shRNA Efficiently Reduces Human SOD1 Protein Levels
In Vitro
[0101] To determine the efficacy of the de novo synthesized SOD1
shRNA construct to downregulate SOD1 levels, HEK293 cells were
transfected with pJet SOD1 shRNA plasmid using Calcium Phosphate
method. AAV SOD1 shRNA plasmid was used as a positive control.
Immunofluorescence analysis of HEK293 cells, 72 hrs post
transfection revealed the lack of native GFP fluorescence from pJet
SOD1 shRNA transfected cells as compared to AAV9 SOD1 shRNA
transfected cells. Immunoblot analysis of cell lysates from these
cells further confirmed the successful replacement of GFP from pJet
SOD1 shRNA plasmid. Importantly, pJet SOD1 shRNA resulted in
efficient downregulation of SOD1 protein levels (>50%), similar
to AAV SOD1 shRNA plasmid. See FIG. 11.
Example 10
Generation of Clinical AAV SOD1 shRNA
[0102] Clinical SOD1 shRNA construct was further cloned into an
AAV.CB.MCS vector using Kpn1/Sph1 sites to generate clinical AAV
SOD1 shRNA plasmid (FIG. 12). AAV.CB.MCS was generated from
AAV.CB.GFP plasmid obtained from merion Scientific by replacing GFP
with a multiple cloning site (MCS). Cloning of clinical SOD1 shRNA
construct at Kpn1/Sph1 sites puts it between the two AAV2 ITRs
which facilitates the packaging of the construct in AAV9 viral
capsids. See FIG. 12.
[0103] Clinical AAV SOD1 shRNA plasmid was screened with
restriction endonucleases to confirm the presence of SOD1 shRNA
expression cassette (Xba1 digest), stuffer sequence (EcoRV/Pme1
double digest) and also intact ITR sequences (Sma1 digest).
Example 11
Clinical AAV SOD1 shRNA Efficiently Reduces Human SOD1 Protein
Levels In Vitro
[0104] Clinical AAV SOD1 shRNA plasmid was transfected in HEK293
cells to determine its knockdown efficiency. Similar to the pJet
SOD1 shRNA plasmid, clinical AAV SOD1 shRNA transfected cells were
devoid of any GFP expression as evident by immunofluorescence (FIG.
13a-f) and immunoblot assay (FIG. 13g). More importantly, clinical
AAV SOD1 shRNA efficiently reduced human SOD1 protein levels in
HEK293 cells by more than 50% (FIG. 13g,h). Altogether, these
results confirmed the successful generation of clinical AAV SOD1
shRNA vector with functional SOD1 shRNA expression cassette and
complete removal of the transgene expression cassette.
DOCUMENTS REFERENCED
[0105] 1. Da Cruz, S. & Cleveland, D. W. Understanding the role
of TDP-43 and FUS/TLS in ALS and beyond. Curr Opin Neurobiol 21,
904-919 (2011). [0106] 2. Rosen, D. R. et al. Mutations in Cu/Zn
superoxide dismutase gene are associated with familial amyotrophic
lateral sclerosis. Nature 362, 59-62 (1993). [0107] 3. Ilieva, H.,
Polymenidou, M. & Cleveland, D. W. Non-cell autonomous toxicity
in neurodegenerative disorders: ALS and beyond. The Journal of cell
biology 187, 761-772 (2009). [0108] 4. Chattopadhyay, M. &
Valentine, J. S. Aggregation of copper-zinc superoxide dismutase in
familial and sporadic ALS. Antioxidants & redox signaling 11,
1603-1614 (2009). [0109] 5. Prudencio, M., Hart, P. J., Borchelt,
D. R. & Andersen, P. M. Variation in aggregation propensities
among ALS-associated variants of SOD1: correlation to human
disease. Human molecular genetics 18, 3217-3226 (2009). [0110] 6.
Boillee, S. et al. Onset and progression in inherited ALS
determined by motor neurons and microglia. Science 312, 1389-1392
(2006). [0111] 7. Kang, S. H. et al. Degeneration and impaired
regeneration of gray matter oligodendrocytes in amyotrophic lateral
sclerosis. Nature neuroscience 16, 571-579 (2013). [0112] 8.
Yamanaka, K. et al. Astrocytes as determinants of disease
progression in inherited amyotrophic lateral sclerosis. Nature
neuroscience 11, 251-253 (2008). [0113] 9. Di Giorgio, F. P.,
Boulting, G. L., Bobrowicz, S. & Eggan, K. C. Human embryonic
stem cell-derived motor neurons are sensitive to the toxic effect
of glial cells carrying an ALS-causing mutation. Cell Stem Cell 3,
637-648 (2008). [0114] 10. Di Giorgio, F. P., Carrasco, M. A.,
Siao, M. C., Maniatis, T. & Eggan, K. Non-cell autonomous
effect of glia on motor neurons in an embryonic stem cell-based ALS
model. Nature neuroscience 10, 608-614 (2007). [0115] 11.
Marchetto, M. C. et al. Non-cell-autonomous effect of human SOD1
G37R astrocytes on motor neurons derived from human embryonic stem
cells. Cell Stem Cell 3, 649-657 (2008). [0116] 12.
Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic
ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828
(2011). [0117] 13. Bosco, D. A. et al. Wild-type and mutant SOD1
share an aberrant conformation and a common pathogenic pathway in
ALS. Nature neuroscience 13, 1396-1403 (2010). [0118] 14.
Pokrishevsky, E. et al. Aberrant localization of FUS and TDP43 is
associated with misfolding of SOD1 in amyotrophic lateral
sclerosis. PloS one 7, e35050 (2012). [0119] 15. Forsberg, K. et
al. Novel antibodies reveal inclusions containing non-native SOD1
in sporadic ALS patients. PLoS One 5, e11552 (2010). [0120] 16.
Aggarwal, S. & Cudkowicz, M. ALS drug development: reflections
from the past and a way forward. Neurotherapeutics: the journal of
the American Society for Experimental Neuro Therapeutics 5, 516-527
(2008). [0121] 17. Gurney, M. E. et al. Benefit of vitamin E,
riluzole, and gabapentin in a transgenic model of familial
amyotrophic lateral sclerosis. Ann Neurol 39, 147-157 (1996).
[0122] 18. Foust, K. D. et al. Intravascular AAV9 preferentially
targets neonatal neurons and adult astrocytes. Nature biotechnology
27, 59-65 (2009). [0123] 19. Duque, S. et al. Intravenous
administration of self-complementary AAV9 enables transgene
delivery to adult motor neurons. Mol Ther 17, 1187-1196 (2009).
[0124] 20. Zhong, Z. et al. ALS-causing SOD1 mutants generate
vascular changes prior to motor neuron degeneration. Nature
neuroscience 11, 420-422 (2008). [0125] 21. Miller, R. G.,
Mitchell, J. D. & Moore, D. H. Riluzole for amyotrophic lateral
sclerosis (ALS)/motor neuron disease (MND). Cochrane Database Syst
Rev 3, CD001447 (2012). [0126] 22. Smith, R. A. et al. Antisense
oligonucleotide therapy for neurodegenerative disease. The Journal
of clinical investigation 116, 2290-2296 (2006). [0127] 23. Raoul,
C. et al. Lentiviral-mediated silencing of SOD1 through RNA
interference retards disease onset and progression in a mouse model
of ALS. Nat Med 11, 423-428 (2005). [0128] 24. Ralph, G. S. et al.
Silencing mutant SOD1 using RNAi protects against neurodegeneration
and extends survival in an ALS model. Nat Med 11, 429-433 (2005).
[0129] 25. Miller, T. M. et al. Virus-delivered small RNA silencing
sustains strength in amyotrophic lateral sclerosis. Annals of
neurology 57, 773-776 (2005). [0130] 26. Miller, T. M. et al. An
antisense oligonucleotide against SOD1 delivered intrathecally for
patients with SOD1 familial amyotrophic lateral sclerosis: a phase
1, randomised, first-in-man study. Lancet neurology 12, 435-442
(2013). [0131] 27. Towne, C., Raoul, C., Schneider, B. L. &
Aebischer, P. Systemic AAV6 delivery mediating RNA interference
against SOD1: neuromuscular transduction does not alter disease
progression in fALS mice. Mol Ther 16, 1018-1025 (2008). [0132] 28.
Towne, C., Setola, V., Schneider, B. L. & Aebischer, P.
Neuroprotection by gene therapy targeting mutant SOD1 in individual
pools of motor neurons does not translate into therapeutic benefit
in fALS mice. Mol Ther 19, 274-283 (2011). [0133] 29. Mandel, R.
J., Lowenstein, P. R. & Byrne, B. J. AAV6-mediated gene
silencing fALS short. Mol Ther 19, 231-233 (2011). [0134] 30.
Synofzik, M. et al. Mutant superoxide dismutase-1 indistinguishable
from wild-type causes ALS. Human molecular genetics 21, 3568-3574
(2012). [0135] 31. Guareschi, S. et al. An over-oxidized form of
superoxide dismutase found in sporadic amyotrophic lateral
sclerosis with bulbar onset shares a toxic mechanism with mutant
SOD1. Proc Natl Acad Sci USA 109, 5074-5079 (2012). [0136] 32.
Haidet-Phillips, A. M. et al. Astrocytes from familial and sporadic
ALS patients are toxic to motor neurons. Nat Biotechnol 29, 824-828
(2011). [0137] 33. Bevan, A. K. et al. Systemic gene delivery in
large species for targeting spinal cord, brain, and peripheral
tissues for pediatric disorders. Mol Ther 19, 1971-1980 (2011).
[0138] 34. Gray, S. J. et al. Preclinical differences of
intravascular AAV9 delivery to neurons and glia: a comparative
study of adult mice and nonhuman primates. Mol Ther 19, 1058-1069
(2011). [0139] 35. Lioy, D. T. et al. A role for glia in the
progression of Rett's syndrome. Nature 475, 497-500 (2011). [0140]
36. Miranda, C. J. et al. Aging brain microenvironment decreases
hippocampal neurogenesis through Wnt-mediated survivin signaling.
Aging Cell 11, 542-552 (2012). [0141] 37. Yamanaka, K. et al.
Mutant SOD1 in cell types other than motor neurons and
oligodendrocytes accelerates onset of disease in ALS mice. Proc
Natl Acad Sci USA 105, 7594-7599 (2008). [0142] All documents
referred to in this application, including priority documents, are
hereby incorporated by reference in their entirety with particular
attention to the content for which they are referred.
Sequence CWU 1
1
22126DNAArtificial SequenceSynthetic Polynucleotide 1gcatcatcaa
tttcgagcag aaggaa 26223DNAArtificial SequenceSynthetic
Polynucleotide 2gaagcattaa aggactgact gaa 23323DNAArtificial
SequenceSynthetic Polynucleotide 3ctgactgaag gcctgcatgg att
23420DNAArtificial SequenceSynthetic Polynucleotide 4catggattcc
atgttcatga 20521DNAArtificial SequenceSynthetic Polynucleotide
5gcatggattc catgttcatg a 21621DNAArtificial SequenceSynthetic
Polynucleotide 6ggtctggcct ataaagtagt c 21721DNAArtificial
SequenceSynthetic Polynucleotide 7gggcatcatc aatttcgagc a
21821DNAArtificial SequenceSynthetic Polynucleotide 8gcatcatcaa
tttcgagcag a 21921DNAArtificial SequenceSynthetic Polynucleotide
9gcctgcatgg attccatgtt c 211021DNAArtificial SequenceSynthetic
Polynucleotide 10ggaggtctgg cctataaagt a 211121DNAArtificial
SequenceSynthetic Polynucleotide 11gattccatgt tcatgagttt g
211221DNAArtificial SequenceSynthetic Polynucleotide 12ggagataata
cagcaggctg t 211321DNAArtificial SequenceSynthetic Polynucleotide
13gctttaaagt acctgtagtg a 211421DNAArtificial SequenceSynthetic
Polynucleotide 14gcattaaagg actgactgaa g 211519DNAArtificial
SequenceSynthetic Polynucleotide 15tcatcaattt cgagcagaa
191619DNAArtificial SequenceSynthetic Polynucleotide 16tcgagcagaa
ggaaagtaa 191719DNAArtificial SequenceSynthetic Polynucleotide
17gcctgcatgg attccatgt 191819DNAArtificial SequenceSynthetic
Polynucleotide 18tcactctcag gagaccatt 191919DNAArtificial
SequenceSynthetic Polynucleotide 19gctttaaagt acctgtagt
19205786DNAArtificial SequenceSynthetic Polynucleotide 20gcccaatacg
caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctgattct 60aacgaggaaa
gcacgttata cgtgctcgtc aaagcaacca tagtacgcgc cctgtagcgg
120cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac
ttgccagcgc 180cctagcgccc gctcctttcg ctttcttccc ttcctttctc
gccacgttcg ccggctttcc 240ccgtcaagct ctaaatcggg ggctcccttt
agggttccga tttagtgctt tacggcacct 300cgaccccaaa aaacttgatt
agggtgatgg ttcacgtagt gggccatcgc cctgatagac 360ggtttttcgc
cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac
420tggaacaaca ctcaacccta tctcggtcta ttcttttgat ttataaggga
ttttgccgat 480ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa
tttaacgcga attttaacaa 540aatattaacg cttacaattt aaatatttgc
ttatacaatc ttcctgtttt tggggctttt 600ctgattatca accggggtac
atatgattga catgctagtt ttacgattac cgttcatcgc 660cctgcgcgct
cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc gggcgacctt
720tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggaat
tcacgcgtgg 780atctgaattc aattcacgcg tggtacctac actttatgct
tccggctcgt atgttgtgtg 840gaattgtgag cggataacaa tttcacacag
gaaacagcta tgaccatgat tacgccaagc 900tttccaaaaa agcatggatt
ccatgttcat gatctcttga atcatgaaca tggaatccat 960ggatccgagt
ggtctcatac agaacttata agattcccaa atccaaagac atttcacgtt
1020tatggtgatt tcccagaaca catagcgaca tgcaaatatg aattcactgg
ccgtcgtttt 1080acaacgtcgt gactgggaaa accctggcgt tacccaactt
aatcgccttg cagcacatcc 1140ccctttcgcc agctggcgta atagcgaaga
ggcccgcacc gatcgccctt cccaacagtt 1200gcgcagcctg tggtacctct
ggtcgttaca taacttacgg taaatggccc gcctggctga 1260ccgcccaacg
acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca
1320atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc
ccacttggca 1380gtacatcaag tgtatcatat gccaagtacg ccccctattg
acgtcaatga cggtaaatgg 1440cccgcctggc attatgccca gtacatgacc
ttatgggact ttcctacttg gcagtacatc 1500tactcgaggc cacgttctgc
ttcactctcc ccatctcccc cccctcccca cccccaattt 1560tgtatttatt
tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc
1620gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg
agaggtgcgg 1680cggcagccaa tcagagcggc gcgctccgaa agtttccttt
tatggcgagg cggcggcggc 1740ggcggcccta taaaaagcga agcgcgcggc
gggcgggagc gggatcagcc accgcggtgg 1800cggcctagag tcgacgagga
actgaaaaac cagaaagtta actggtaagt ttagtctttt 1860tgtcttttat
ttcaggtccc ggatccggtg gtggtgcaaa tcaaagaact gctcctcagt
1920ggatgttgcc tttacttcta ggcctgtacg gaagtgttac ttctgctcta
aaagctgcgg 1980aattgtaccc gcggccgatc caccggtcgc caccatggtg
agcaagggcg aggagctgtt 2040caccggggtg gtgcccatcc tggtcgagct
ggacggcgac gtaaacggcc acaagttcag 2100cgtgtccggc gagggcgagg
gcgatgccac ctacggcaag ctgaccctga agttcatctg 2160caccaccggc
aagctgcccg tgccctggcc caccctcgtg accaccctga cctacggcgt
2220gcagtgcttc agccgctacc ccgaccacat gaagcagcac gacttcttca
agtccgccat 2280gcccgaaggc tacgtccagg agcgcaccat cttcttcaag
gacgacggca actacaagac 2340ccgcgccgag gtgaagttcg agggcgacac
cctggtgaac cgcatcgagc tgaagggcat 2400cgacttcaag gaggacggca
acatcctggg gcacaagctg gagtacaact acaacagcca 2460caacgtctat
atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg
2520ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga
acacccccat 2580cggcgacggc cccgtgctgc tgcccgacaa ccactacctg
agcacccagt ccgccctgag 2640caaagacccc aacgagaagc gcgatcacat
ggtcctgctg gagttcgtga ccgccgccgg 2700gatcactctc ggcatggacg
agctgtacaa gtaaagcggc catcaagctt atcgataccg 2760tcgactagag
ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt
2820tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt
cctttcctaa 2880taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
attctattct ggggggtggg 2940gtggggcagg acagcaaggg ggaggattgg
gaagacaata gcaggcatgc tggggagaga 3000tcgatctgag gaacccctag
tgatggagtt ggccactccc tctctgcgcg ctcgctcgct 3060cactgaggcc
gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg cggcctcagt
3120gagcgagcga gcgcgcagag agggagtggc cccccccccc ccccccccgg
cgattctctt 3180gtttgctcca gactctcagg caatgacctg atagcctttg
tagagacctc tcaaaaatag 3240ctaccctctc cggcatgaat ttatcagcta
gaacggttga atatcatatt gatggtgatt 3300tgactgtctc cggcctttct
cacccgtttg aatctttacc tacacattac tcaggcattg 3360catttaaaat
atatgagggt tctaaaaatt tttatccttg cgttgaaata aaggcttctc
3420ccgcaaaagt attacagggt cataatgttt ttggtacaac cgatttagct
ttatgctctg 3480aggctttatt gcttaatttt gctaattctt tgccttgcct
gtatgattta ttggatgttg 3540gaatcgcctg atgcggtatt ttctccttac
gcatctgtgc ggtatttcac accgcatatg 3600gtgcactctc agtacaatct
gctctgatgc cgcatagtta agccagcccc gacacccgcc 3660aacacccgct
gacgcgccct gacgggcttg tctgctcccg gcatccgctt acagacaagc
3720tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac
cgaaacgcgc 3780gagacgaaag ggcctcgtga tacgcctatt tttataggtt
aatgtcatga taataatggt 3840ttcttagacg tcaggtggca cttttcgggg
aaatgtgcgc ggaaccccta tttgtttatt 3900tttctaaata cattcaaata
tgtatccgct catgagacaa taaccctgat aaatgcttca 3960ataatattga
aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt
4020ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga
aagtaaaaga 4080tgctgaagat cagttgggtg cacgagtggg ttacatcgaa
ctggatctca acagcggtaa 4140gatccttgag agttttcgcc ccgaagaacg
ttttccaatg atgagcactt ttaaagttct 4200gctatgtggc gcggtattat
cccgtattga cgccgggcaa gagcaactcg gtcgccgcat 4260acactattct
cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga
4320tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata
acactgcggc 4380caacttactt ctgacaacga tcggaggacc gaaggagcta
accgcttttt tgcacaacat 4440gggggatcat gtaactcgcc ttgatcgttg
ggaaccggag ctgaatgaag ccataccaaa 4500cgacgagcgt gacaccacga
tgcctgtagc aatggcaaca acgttgcgca aactattaac 4560tggcgaacta
cttactctag cttcccggca acaattaata gactggatgg aggcggataa
4620agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg
ctgataaatc 4680tggagccggt gagcgtgggt ctcgcggtat cattgcagca
ctggggccag atggtaagcc 4740ctcccgtatc gtagttatct acacgacggg
gagtcaggca actatggatg aacgaaatag 4800acagatcgct gagataggtg
cctcactgat taagcattgg taactgtcag accaagttta 4860ctcatatata
ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa
4920gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt
tccactgagc 4980gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat
cctttttttc tgcgcgtaat 5040ctgctgcttg caaacaaaaa aaccaccgct
accagcggtg gtttgtttgc cggatcaaga 5100gctaccaact ctttttccga
aggtaactgg cttcagcaga gcgcagatac caaatactgt 5160ccttctagtg
tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata
5220cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt
cgtgtcttac 5280cgggttggac tcaagacgat agttaccgga taaggcgcag
cggtcgggct gaacgggggg 5340ttcgtgcaca cagcccagct tggagcgaac
gacctacacc gaactgagat acctacagcg 5400tgagctatga gaaagcgcca
cgcttcccga agggagaaag gcggacaggt atccggtaag 5460cggcagggtc
ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct
5520ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt
gatgctcgtc 5580aggggggcgg agcctatgga aaaacgccag caacgcggcc
tttttacggt tcctggcctt 5640ttgctggcct tttgctcaca tgttctttcc
tgcgttatcc cctgattctg tggataaccg 5700tattaccgcc tttgagtgag
ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga 5760gtcagtgagc
gaggaagcgg aagagc 578621164DNAArtificial SequenceSynthetic
Polynucleotide 21aattcatatt tgcatgtcgc tatgtgttct gggaaatcac
cataaacgtg aaatgtcttt 60ggatttggga atcttataag ttctgtatga gaccactcgg
atccatggat tccatgttca 120tgattcaaga gatcatgaac atggaatcca
tgcttttttg gaaa 164221607DNAArtificial SequenceSynthetic
Polynucleotide 22tctagaggct cgagaagata tcaactgcag cttctactgg
gcggttttat ggacagcaag 60cgaaccggaa ttgccagctg gggcgccctc tggtaaggtt
gggaagccct gcaaagtaaa 120ctggatggct ttctcgccgc caaggatctg
atggcgcagg ggatcaagct ctgatcaaga 180gacaggatga ggatcgtttc
gcgttcttga ctcttcgcga tgtacgggcc agatatacgc 240gttgacattg
attattgact agttattaat agtaatcaat tacggggtca ttagttcata
300gcccatatat ggagttccgc ctgcagggac gtcgacggat cgggagatct
cccgatcccc 360tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt
gcgcgagcaa aatttaagct 420acaacaaggc aaggcttgac cgacaattgc
atgaagaatc tgcttagggt taggcgtttt 480gcgctgcttc gcggcgcgcc
ttttaaggca gttattggtg cccttaaacg cctggtgcta 540cgcctgaata
agtgataata agcggatgaa tggcagaaat tcgccggatc tttgtgaagg
600aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt
taaagctcta 660atgtaagcag acagttttat tgttcatgat gatatatttt
tatcttgtgc aatgtaacat 720cagagatttt gagacacaac gtggctttcc
cccccccccc ctagggtggg cgaagaactc 780cagcatgaga tccccgcgct
ggaggatcat ccagccggcg tcccggaaaa cgattccgaa 840gcccaacctt
tcatagaagg cggcggtgga atcgaaatct cgtgatggca ggttgggcgt
900cgcttggtcg gtcatttcga accccagagt cccgctcagg gcgcgccggg
ggggggggcg 960ctgaggtctg cctcgtgaag aaggtgttgc tgactcatac
caggcctgaa tcgccccatc 1020atccagccag aaagtgaggg agccacggtt
gatgagagct ttgttgtagg tggaccagtc 1080ctgcaggagc ataaagtgta
aagcctgggg tgcctaatga gtgagctaac tcacattaat 1140tgcgttgcgc
tcactgcccg ctttccagtc gggaaacctg tcgtgcccgc ccagtctagc
1200tatcgccatg taagcccact gcaagctacc tgctttctct ttgcgcttgc
gttttccctt 1260gtccagatag cccagtagct gacattcatc cggggtcagc
accgtttctg cggactggct 1320ttctacgtgt ctggttcgag gcgggatcag
ccaccgcggt ggcggcctag agtcgacgag 1380gaactgaaaa accagaaagt
taactggcct gtacggaagt gttacttctg ctctaaaagc 1440tgcggaattg
tacccgcggc cgatccaccg gtcgccacca gcggccatca agcacgttat
1500cgataccgtc gactagagct cgctgatcag tggggggtgg ggtggggcag
gacagcaagg 1560gggaggattg ggaagacaat agcagctgca gaagtttaaa cgcatgc
1607
* * * * *