U.S. patent application number 14/880082 was filed with the patent office on 2016-09-15 for compositions and methods for silencing ebola virus gene expression.
The applicant listed for this patent is PROTIVA BIOTHERAPEUTICS, INC., TRUSTEES OF BOSTON UNIVERSITY, UNITED STATES ARMY MEDICAL RESEARCH AND MATERIEL COMMAND. Invention is credited to THOMAS W. GEISBERT, Lisa E. Hensley, Adam Judge, Amy C.H. Lee, Ian MacLachlan, Marjorie Robbins, Vandana Sood.
Application Number | 20160264971 14/880082 |
Document ID | / |
Family ID | 43048898 |
Filed Date | 2016-09-15 |
United States Patent
Application |
20160264971 |
Kind Code |
A1 |
GEISBERT; THOMAS W. ; et
al. |
September 15, 2016 |
COMPOSITIONS AND METHODS FOR SILENCING EBOLA VIRUS GENE
EXPRESSION
Abstract
The present invention provides compositions comprising
therapeutic nucleic acids (e.g., interfering RNA such as siRNA)
that target Ebola virus (EBOV) gene expression and methods of using
such compositions to silence EBOV gene expression. More
particularly, the invention provides unmodified and chemically
modified interfering RNA which silence EBOV gene expression and
methods of use thereof, e.g., for preventing or treating EBOV
infections caused by one or more EBOV species such as Zaire EBOV.
The invention also provides serum-stable nucleic acid-lipid
particles comprising one or more interfering RNA molecules, a
cationic lipid, and a non-cationic lipid, which can further
comprise a conjugated lipid that inhibits aggregation of particles.
Methods of silencing EBOV gene expression by administering one or
more interfering RNA molecules to a mammalian subject are also
provided.
Inventors: |
GEISBERT; THOMAS W.;
(Albany, TX) ; Lee; Amy C.H.; (Burnaby, CA)
; Robbins; Marjorie; (Vancouver, CA) ; Sood;
Vandana; (Vancouver, CA) ; Judge; Adam;
(Vancouver, CA) ; Hensley; Lisa E.; (Frederick,
MD) ; MacLachlan; Ian; (Mission, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PROTIVA BIOTHERAPEUTICS, INC.
TRUSTEES OF BOSTON UNIVERSITY
UNITED STATES ARMY MEDICAL RESEARCH AND MATERIEL COMMAND |
Burnaby
Boston
Frederick |
MA
MD |
CA
US
US |
|
|
Family ID: |
43048898 |
Appl. No.: |
14/880082 |
Filed: |
October 9, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14229675 |
Mar 28, 2014 |
9187748 |
|
|
14880082 |
|
|
|
|
12840225 |
Jul 20, 2010 |
8716464 |
|
|
14229675 |
|
|
|
|
61226959 |
Jul 20, 2009 |
|
|
|
61286741 |
Dec 15, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2760/14111
20130101; C12N 2320/31 20130101; C12N 2330/51 20130101; A61P 31/12
20180101; A61K 31/713 20130101; C12N 2310/14 20130101; C12N
2310/321 20130101; C12N 2310/11 20130101; C12N 15/1131 20130101;
A61K 9/127 20130101; C12N 2310/3521 20130101; A61K 9/1271 20130101;
C12N 2310/321 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/713 20060101 A61K031/713 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] This invention was made with Government support under
Project No. 04-4-7J-012, awarded by the Defense Threat Reduction
Agency. The Government has certain rights in this invention.
Claims
1. A composition comprising at least two interfering RNA selected
from the group consisting of: (a) a first interfering RNA that
silences Ebola virus L-pol expression, wherein the first
interfering RNA comprises an antisense strand comprising the
following sequence: 5'-UUUAUAUACAGCUUCGUAC-3'; (b) a second
interfering RNA that silences Ebola virus VP24 expression, wherein
the second interfering RNA comprises an antisense strand comprising
the following sequence: 5'-UUUGCAUUCGUGUCGAGGA-3'; and (c) a third
interfering RNA that silences Ebola virus VP35 expression, wherein
the third interfering RNA comprises an antisense strand comprising
the following sequence: 5'-AUGAUGUCCAAUGAGUUGC-3'.
2. The composition of claim 1, wherein the composition comprises
the first and second interfering RNA, the first and third
interfering RNA, the second and third interfering RNA, or the
first, second, and third interfering RNA.
3. The composition of claim 1, wherein the first interfering RNA
comprises an siRNA.
4. The composition of claim 1, wherein the second interfering RNA
comprises an siRNA.
5. The composition of claim 1, wherein the third interfering RNA
comprises an siRNA.
6. The composition of claim 3, wherein the siRNA comprises a
double-stranded region of about 19 to about 25 nucleotides in
length.
7. The composition of claim 6, wherein one or more of the
nucleotides in the double-stranded region of the siRNA comprise
modified nucleotides.
8. The composition of claim 7, wherein the modified nucleotides
comprise 2'-O-methyl (2'OMe) nucleotides.
9. The composition of claim 8, wherein the 2'OMe nucleotides
comprise at least one, two, three, four, five, six, seven, eight,
nine, ten, or eleven 2'OMe-guanosine nucleotides, 2'OMe-uridine
nucleotides, or mixtures thereof.
10. The composition of claim 7, wherein less than about 50% of the
nucleotides in the double-stranded region comprise modified
nucleotides.
11. The composition of claim 3, wherein the siRNA comprises a 3'
overhang in one or both strands of the siRNA.
12. The composition of claim 11, wherein one or more of the
nucleotides in the 3' overhang of one or both strands comprise
modified nucleotides.
13. The composition of claim 12, wherein the modified nucleotides
comprise 2'-O-methyl (2'OMe) nucleotides.
14. The composition of claim 13, wherein the 2'OMe nucleotides
comprise at least one, two, three, or four 2'OMe-guanosine
nucleotides, 2'OMe-uridine nucleotides, or mixtures thereof.
15. The composition of claim 1, wherein the first interfering RNA
further comprises a sense strand comprising the following sequence:
5'-GUACGAAGCUGUAUAUAAA-3'.
16. The composition of claim 15, wherein the antisense strand
comprises a 5'-TT-3' overhang and the sense strand comprises a
5'-TT-3' overhang.
17. The composition of claim 1, wherein the first interfering RNA
comprises an antisense strand comprising one of the antisense
strand sequences set forth in Table 2.
18. The composition of claim 1, wherein the first interfering RNA
comprises an antisense strand comprising at least 15 contiguous
nucleotides of one of the antisense strand sequences set forth in
Table 2.
19. The composition of claim 1, wherein the first interfering RNA
comprises an antisense strand comprising nucleotides 1-19 of one of
the antisense strand sequences set forth in Table 2.
20. The composition of claim 1, wherein the first interfering RNA
further comprises a sense strand comprising one of the sense strand
sequences set forth in Table 1.
21-88. (canceled)
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 14/229,675, filed Mar. 28, 2014, which
application is a continuation of Ser. No. 12/840,225, filed Jul.
20, 2010, issued as U.S. Pat. No. 8,716,464 on May 6, 2014, which
claims priority to U.S. Provisional Application No. 61/226,959,
filed Jul. 20, 2009, and U.S. Provisional Application No.
61/286,741, filed Dec. 15, 2009, the disclosures of all of which
are hereby incorporated by reference in their entireties for all
purposes.
REFERENCE TO A SEQUENCE LISTING
[0003] The Sequence Listing written in file
086399-009840US-0960639_SequenceListing.txt, created on May 25,
2016, 35,546 bytes, machine format IBM-PC, MS-Windows operating
system, is hereby incorporated by reference in its entirety for all
purposes.
BACKGROUND OF THE INVENTION
[0004] Filoviruses (e.g., Ebola virus (EBOV) and Marburg virus
(MARV)) are among the most lethal and destructive viruses. They
cause severe, often fatal viral hemorraghic fevers in humans and
nonhuman primates (e.g., monkeys, gorillas, and chimpanzees).
Filoviruses are of particular concern as possible biological
weapons since they have the potential for aerosol dissemination and
weaponization.
[0005] The incubation period for Filovirus infection ranges from 2
to 21 days. The onset of illness is abrupt and is characterized by
high fever, headaches, joint and muscle aches, sore throat,
fatigue, diarrhea, vomiting, and stomach pain. A rash, red eyes,
hiccups and internal and external bleeding may be seen in some
patients. Within one week of becoming infected with the virus, most
patients experience chest pains and multiple organ failure, go into
shock, and die. Some patients also experience blindness and
extensive bleeding before dying.
[0006] Filoviridae are a family of RNA viruses. Two members of the
Filoviridae family have been identified: EBOV and MARV. There is
one identified strain of MARV and four identified subtypes (i.e.,
strains) of EBOV: Ebola-Zaire, Ebola-Sudan, Ebola-Ivory Coast
(i.e., Ebola-Tai), and Ebola-Reston. The exact origin, locations,
and natural habitat of Filoviridae are unknown. However, on the
basis of available evidence and the nature of similar viruses, it
is postulated that Filoviridae are zoonotic (i.e., animal-borne)
and are normally maintained in an animal host that is native to the
African continent.
[0007] For more than 30 years, EBOV has been associated with
periodic episodes of hemorrhagic fever in Central Africa that
produce severe disease in infected patients. Mortality rates in
outbreaks have ranged from 50% for the Sudan species of EBOV
(SEBOV) to up to 90% for the Zaire species of EBOV (ZEBOV) (Sanchez
et al., Filoviridae: Marburg and Ebola Viruses, in Fields Virology
(eds. Knipe, D. M. & Howley, P. M.) 1409-1448 (Lippincott
Williams & Wilkins, Philadelphia)). An outbreak late in 2007
caused by an apparently new species of EBOV in Uganda resulted in a
fatality rate of about 25% (Towner et al., PLoS Pathog., 4:e1000212
(2008)). ZEBOV has also decimated populations of wild apes in this
same region of Africa (Walsh et al., Nature, 422:611-614
(2003)).
[0008] Prevention and treatment of EBOV infections presents many
challenges. In fact, there are no vaccines or postexposure
treatment modalities available for preventing or managing EBOV
infections. Patients instead receive supportive therapy, i.e.,
electrolyte and fluid balancing, oxygen, blood pressure
maintenance, and treatment for any secondary infections.
[0009] Thus, there is a need for compositions and methods for
treating and preventing EBOV infections, e.g., by specifically
modulating EBOV gene expression. The present invention addresses
these and other needs.
BRIEF SUMMARY OF THE INVENTION
[0010] The present invention provides compositions comprising
therapeutic nucleic acids (e.g., interfering RNA such as siRNA)
that target Ebola virus (EBOV) gene expression and methods of using
such compositions to silence EBOV gene expression. More
particularly, the invention provides unmodified and chemically
modified interfering RNA (e.g., siRNA) which silence EBOV gene
expression and methods of use thereof, e.g., for preventing or
treating EBOV infections caused by one or more EBOV species such as
Zaire EBOV. The invention also provides serum-stable nucleic
acid-lipid particles (e.g., SNALP) comprising interfering RNA
(e.g., siRNA), a cationic lipid, and a non-cationic lipid, which
can further comprise a conjugated lipid that inhibits aggregation
of particles. Methods of silencing EBOV gene expression by
administering interfering RNA (e.g., siRNA) to a mammalian subject
are also provided.
[0011] As explained herein, it has surprisingly been found that the
SNALP formulations of the present invention containing a
combination of interfering RNA (e.g., siRNA) molecules targeting at
least two or all three of the EBOV L-pol, VP24, and VP35 genes were
capable of providing complete postexposure protection of nonhuman
primates against a lethal EBOV challenge. In particular
embodiments, the SNALP formulations described herein comprising a
cocktail of interfering RNAs (e.g., siRNAs) targeting any
combination of at least two (or all three) of the EBOV L-pol, VP24,
and VP35 genes demonstrate an increased potency (i.e., increased
silencing activity) and/or an increased tolerability (e.g., a more
favorable toxicity profile), e.g., when compared to other nucleic
acid-lipid particle compositions previously described.
[0012] In one aspect, the present invention provides interfering
RNA molecules such as siRNA that target EBOV L-polymerase (L-pol),
VP24, VP30, VP35, VP40, nucleoprotein (NP), and/or glycoprotein
(GP) expression. The interfering RNA (e.g., siRNA) molecules of the
invention are capable of inactivating EBOV and/or inhibiting the
replication of EBOV in vitro or in vivo.
[0013] In certain embodiments, the interfering RNA comprises at
least one or a cocktail (e.g., at least two, three, four, five,
six, seven, eight, nine, ten, or more) of unmodified and/or
modified interfering RNA (e.g., siRNA) sequences that silence EBOV
gene expression. In some instances, the cocktail of interfering RNA
(e.g., siRNA) molecules may comprise sequences which target the
same region of the EBOV genome. In other instances, the cocktail of
interfering RNA (e.g., siRNA) molecules may comprise sequences
which target different regions of the EBOV genome. In further
instances, the cocktail of interfering RNA (e.g., siRNA) molecules
may comprise sequences which target different EBOV species or
subtypes. In certain instances, one or more (e.g., at least two,
three, four, five, six, seven, eight, nine, ten, or more) modified
interfering RNA (e.g., siRNA) that silence EBOV gene expression are
present in a cocktail with one or more (e.g., at least two, three,
four, five, six, seven, eight, nine, ten, or more) unmodified
interfering RNA (e.g., siRNA) sequences that silence EBOV gene
expression.
[0014] In some embodiments, the invention comprises an interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression, wherein the
interfering RNA (e.g., siRNA) comprises an antisense strand
comprising the following sequence: 5'-UUUAUAUACAGCUUCGUAC-3'_(SEQ
ID NO:59). In other embodiments, the invention comprises an
interfering RNA (e.g., siRNA) that silences EBOV VP24 expression,
wherein the interfering RNA (e.g., siRNA) comprises an antisense
strand comprising the following sequence:
5'-UUUGCAUUCGUGUCGAGGA-3'_(SEQ ID NO:60). In yet other embodiments,
the invention comprises an interfering RNA (e.g., siRNA) that
silences EBOV VP35 expression, wherein the interfering RNA (e.g.,
siRNA) comprises an antisense strand comprising the following
sequence: 5'-AUGAUGUCCAAUGAGUUGC-3' (SEQ ID NO:61). The interfering
RNA (e.g., siRNA) may comprise at least one, two, three, four,
five, six, seven, eight, nine, ten, or more modified nucleotides
such as 2'OMe nucleotides, e.g., in the sense and/or antisense
strand of the double-stranded region and optionally in one or both
3' overhangs if present.
[0015] In certain instances, the present invention provides a
composition comprising a cocktail of two or all three of the EBOV
L-pol, VP24, and VP35 interfering RNA (e.g., siRNA) molecules
described herein. In other instances, the present invention
provides a composition comprising a cocktail of one, two, or all
three of these interfering RNA (e.g., siRNA) molecules, in
combination with other interfering RNA (e.g., siRNA) molecules
which target the same or different regions of the EBOV genome.
[0016] In particular embodiments, the present invention provides a
composition comprising a cocktail of at least two interfering RNA
molecules (e.g., siRNA molecules) targeting EBOV gene expression
selected from the group consisting of: [0017] (a) a first
interfering RNA that silences EBOV L-pol expression, comprising the
following antisense strand sequence: 5'-UUUAUAUACAGCUUCGUAC-3'_(SEQ
ID NO:59); [0018] (b) a second interfering RNA that silences EBOV
VP24 expression, comprising the following antisense strand
sequence: 5'-UUUGCAUUCGUGUCGAGGA-3' (SEQ ID NO:60); and [0019] (c)
a third interfering RNA that silences EBOV VP35 expression,
comprising the following antisense strand sequence:
5'-AUGAUGUCCAAUGAGUUGC-3' (SEQ ID NO:61).
[0020] Each of the interfering RNA (e.g., siRNA) sequences present
in the cocktail may independently comprise at least one, two,
three, four, five, six, seven, eight, nine, ten, or more modified
nucleotides such as 2'OMe nucleotides, e.g., in the sense and/or
antisense strand of the double-stranded region. Preferably, uridine
and/or guanosine nucleotides in one or more of the interfering RNA
(e.g., siRNA) sequences present in the cocktail are modified with
2'OMe nucleotides. In particular embodiments, each of the
interfering RNA (e.g., siRNA) sequences present in the cocktail
comprises at least one 2'OMe-uridine nucleotide and at least one
2'OMe-guanosine nucleotide in the sense and/or antisense
strands.
[0021] In some embodiments, each of the interfering RNA (e.g.,
siRNA) sequences present in the compositions of the invention may
independently comprise a 3' overhang of at least 1, 2, 3, or 4
nucleotides in one or both strands of the interfering RNA or may
comprise at least one blunt end. In certain instances, the 3'
overhangs in one or both strands of the interfering RNA each
independently comprise at least 1, 2, 3, or 4 of any combination of
modified and unmodified deoxythymidine (dT) nucleotides, at least
1, 2, 3, or 4 of any combination of modified (e.g., 2'OMe) and
unmodified uridine (U) ribonucleotides, or at least 1, 2, 3, or 4
of any combination of modified (e.g., 2'OMe) and unmodified
ribonucleotides having complementarity to the target sequence (3'
overhang in the antisense strand) or the complementary strand
thereof (3' overhang in the sense strand).
[0022] In further embodiments, the present invention provides a
composition comprising at least one or a cocktail (e.g., at least
two, three, four, five, six, seven, eight, nine, ten, or more) of
interfering RNAs (e.g., siRNAs) comprising sense and/or antisense
sequences set forth in Tables 1-6 and/or interfering RNA (e.g.,
siRNA) duplexes set forth in Tables 11 and 12. In particular
embodiments, the present invention provides a composition
comprising a cocktail of at least two or all three of the EK-1,
VP24-1160, and VP35-855 interfering RNAs (e.g., siRNAs) described
herein. In certain embodiments, at least one, two, or all of three
of these interfering RNAs (e.g., siRNAs) are chemically modified
(e.g., 2'OMe-modified). In some preferred embodiments, the present
invention provides a composition comprising a cocktail of at least
two or all three of the modified EK-1, VP24-1160, and VP35-855
interfering RNA (e.g., siRNA) molecules described herein.
[0023] The present invention also provides a pharmaceutical
composition comprising one or a cocktail of interfering RNA (e.g.,
siRNA) molecules that target EBOV gene expression and a
pharmaceutically acceptable carrier.
[0024] In another aspect, the present invention provides a nucleic
acid-lipid particle that targets EBOV gene expression. The nucleic
acid-lipid particle typically comprises one or more unmodified
and/or modified interfering RNA (e.g., siRNA) that silence EBOV
gene expression, a cationic lipid, and a non-cationic lipid. In
certain instances, the nucleic acid-lipid particle further
comprises a conjugated lipid that inhibits aggregation of
particles. In preferred embodiments, the nucleic acid-lipid
particle comprises one or more unmodified and/or modified
interfering RNA (e.g., siRNA) that silence EBOV gene expression, a
cationic lipid, a non-cationic lipid, and a conjugated lipid that
inhibits aggregation of particles.
[0025] In some embodiments, the nucleic acid-lipid particles
comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the sense and/or
antisense sequences set forth in Tables 1-6. In preferred
embodiments, the nucleic acid-lipid particles comprise a cocktail
of two or all three of the modified EK-1, VP24-1160, and VP35-855
siRNAs described herein (see, e.g., Tables 11-12 for exemplary
modified EK-1 and VP35-855 siRNA duplexes).
[0026] In other embodiments, the cocktail of interfering RNAs
(e.g., siRNAs) is fully encapsulated in the nucleic acid-lipid
particle (e.g., SNALP). The interfering RNAs (e.g., siRNAs) may be
co-encapsulated in the same nucleic acid-lipid particle, or each
interfering RNA (e.g., siRNA) species present in the cocktail may
be encapsulated in its own nucleic acid-lipid particle. The
interfering RNA (e.g., siRNA) cocktail may be formulated in the
nucleic acid-lipid particles (e.g., SNALP) using a mixture of
individual interfering RNAs at identical, similar, or different
concentrations. In one particular embodiment, a cocktail of two or
three interfering RNAs may be formulated as a 1:1 mixture or as a
1:1:1 mixture of each interfering RNA species, respectively.
[0027] The nucleic acid-lipid particles of the present invention
(e.g., SNALP) are useful for the therapeutic delivery of
interfering RNA (e.g., siRNA) molecules that silence EBOV gene
expression. In some embodiments, at least one or a cocktail of two,
three, or more of the interfering RNA (e.g., siRNA) molecules
described herein are formulated into nucleic acid-lipid particles,
and the particles are administered to a mammal (e.g., a rodent such
as a mouse or a primate such as a human, chimpanzee, or monkey)
requiring such treatment. In certain instances, a therapeutically
effective amount of the nucleic acid-lipid particle (e.g., SNALP)
can be administered to the mammal, e.g., for preventing or treating
EBOV infections caused by one or more EBOV species such as Zaire
EBOV. The nucleic acid-lipid particles of the present invention are
particularly useful for targeting cells, tissues, or organs
infected and/or susceptible of being infected with EBOV, such as,
for example, reticuloendothelial cells, fibroblast cells,
endothelial cells, and/or platelets cells. Administration of the
nucleic acid-lipid particle can be by any route known in the art,
such as, e.g., oral, intranasal, intravenous, intraperitoneal,
intramuscular, intra-articular, intralesional, intratracheal,
subcutaneous, or intradermal. In particular embodiments, the
nucleic acid-lipid particles (e.g., SNALP) are administered
systemically, e.g., via enteral or parenteral routes of
administration.
[0028] The present invention further provides pharmaceutical
compositions comprising the nucleic acid-lipid particles described
herein and a pharmaceutically acceptable carrier.
[0029] In yet another aspect, the interfering RNA (e.g., siRNA)
molecules described herein are used in methods for silencing EBOV
gene expression. In particular, it is an object of the present
invention to provide in vitro and in vivo methods for inactivating
EBOV and/or inhibiting the replication of EBOV to treat EBOV
infections in a mammal by downregulating or silencing the
transcription and/or translation of one or more EBOV genes. In
certain embodiments, the present invention provides a method for
introducing at least one or a cocktail of two, three, or more
interfering RNA (e.g., siRNA) molecules capable of silencing EBOV
gene expression (e.g., viral RNA and/or protein levels) into a cell
by contacting the cell with the interfering RNA (e.g., siRNA)
molecules described herein, e.g., formulated in a lipid particle
such as a nucleic acid-lipid particle (e.g., SNALP). In another
embodiment, the present invention provides a method for in vivo
delivery of at least one or a cocktail of two, three, or more
interfering RNA (e.g., siRNA) molecules capable of silencing EBOV
gene expression by administering to a mammal the interfering RNA
(e.g., siRNA) molecules described herein, e.g., formulated in a
lipid particle such as a nucleic acid-lipid particle (e.g., SNALP).
Administration of the interfering RNAs (e.g., siRNAs) can be by any
route known in the art, such as, e.g., oral, intranasal,
intravenous, intraperitoneal, intramuscular, intra-articular,
intralesional, intratracheal, subcutaneous, or intradermal. In some
embodiments, the nucleic acid-lipid particles (e.g., SNALP) are
administered systemically, e.g., via enteral or parenteral routes
of administration.
[0030] In certain embodiments, the mammal has an EBOV infection,
e.g., a Zaire EBOV infection. In certain other embodiments,
silencing of EBOV sequences that encode genes associated with viral
infection and/or survival can conveniently be used in combination
with the administration of conventional agents used to treat or
ameliorate the viral condition or any of the symptoms associated
therewith.
[0031] In certain other embodiments, the present invention provides
a method for treating a mammal infected with EBOV (e.g., Zaire
EBOV) comprising administering to the mammal at least one or a
cocktail of two, three, or more of the interfering RNA (e.g.,
siRNA) molecules described herein, e.g., formulated in a lipid
particle such as a nucleic acid-lipid particle. In some
embodiments, the present invention provides a method for
inactivating EBOV (e.g., Zaire EBOV) comprising administering to
the mammal at least one or a cocktail of two, three, or more of the
interfering RNA (e.g., siRNA) molecules described herein, e.g.,
formulated in a lipid particle such as a nucleic acid-lipid
particle. In other embodiments, the present invention provides a
method for inhibiting the replication of EBOV (e.g., Zaire EBOV)
comprising administering to the mammal at least one or a cocktail
of two, three, or more of the interfering RNA (e.g., siRNA)
molecules described herein, e.g., formulated in a lipid particle
such as a nucleic acid-lipid particle. In further embodiments, a
mammal such as a human infected with EBOV may be administered at
least one or a cocktail of two, three, or more of the interfering
RNA (e.g., siRNA) molecules described herein, e.g., formulated in a
lipid particle such as a nucleic acid-lipid particle, wherein the
interfering RNA (e.g., siRNA) molecules target sequences that are
conserved between two, three, or four EBOV subtypes or species.
[0032] Other objects, features, and advantages of the present
invention will be apparent to one of skill in the art from the
following detailed description and figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIGS. 1A-B illustrate the identification of lead VP24-1160
and VP35-855 siRNAs targeting VP24 and VP35 of ZEBOV using a
nonviral plasmid-based expression system. HepG2 cells were
transfected with 0.75 .mu.g of psiCHECK2 plasmid expressing (1A)
ZEBOV-p24 or (1B) ZEBOV-p35 in the presence of (1A)
SNALP-formulated VP24-775, -978, -1160, or a nonspecific negative
control siRNA at 1.25, 2.5, 5, 10, 20, or 40 nM, or (1B)
SNALP-formulated VP35-219, -349, -687, -855, or a nonspecific
negative control siRNA at 0.8, 4, or 20 nM. Data shown are the
Renilla luciferase RLU signal normalized to the firefly luciferase
RLU expressed as percent gene expression relative to a plasmid-only
(0 nM siRNA) control treatment 48 h after start of transfection.
Error bars represent standard deviation of triplicate tissue
culture wells.
[0034] FIGS. 2A-C illustrate that modified ZEBOV siRNAs show
similar activity to unmodified ZEBOV siRNAs. HepG2 cells were
transfected using Lipofectamine 2000 complexed with (2A) 0.75 .mu.g
of ZEBOV-p24 expressing psiCHECK2 plasmid in the presence of
VP24-1160 or VP24-1160-mod or a non-targeting negative control
siRNA at 1.25, 2.5, 5, 10, 20, or 40 nM, or (2B) 0.75 .mu.g of
ZEBOV-p35 expressing psiCHECK2 plasmid in the presence of
VP35-855-mod or a non-targeting negative control siRNA at 1.25,
2.5, 5, 10, 20, or 40 nM, or (2C) 0.75 .mu.g of ZEBOV-L-pol
expressing psiCHECK2 plasmid in the presence of EK-1-mod or a
non-targeting negative control siRNA at 1.25, 2.5, 5, 10, 20, or 40
nM. Data shown are the Renilla luciferase RLU normalized to the
firefly luciferase RLU expressed as percent gene expression
relative to a plasmid-only (0 nM siRNA) control 48 h after start of
transfection. Error bars represent standard deviation of triplicate
tissue culture wells.
[0035] FIGS. 3A-C illustrate that modified ZEBOV and Luc siRNAs
cause no IFN-.alpha. or IL-6 protein or IFIT1 mRNA induction in
vivo in mice. IFN-.alpha. and IL-6 protein and IFIT1 mRNA induction
by SNALP-formulated Luc, Luc-mod, or ZEBOV cocktail (containing
EK-1 mod, VP24-1160-mod, and VP35-855-mod siRNAs) in mice.
SNALP-formulated siRNAs were injected i.v. at 5 mg/kg and plasma
and livers harvested 4 h after treatment. Native (unmodified) Luc
SNALP induced (3A) IFN-.alpha. and (3B) IL-6 protein in plasma and
(3C) IFIT1 mRNA in liver, whereas no IFN-.alpha. or IL-6 or IFIT1
mRNA induction was detected in mice treated with SNALP containing
2'OMe-modified siRNA (Mean.+-.SD, n=4 animals, lower limit of
quantitation for IFN-.alpha. or IL-6 protein via ELISA was 15.6
pg/mL).
[0036] FIG. 4 illustrates that modified ZEBOV and Luc siRNAs show
no IFN-.alpha. induction in human PBMC cultures, whereas unmodified
versions induce significant IFN-.alpha.. IFN-.alpha. induction by
SNALP-formulated Luc, Luc-mod, EK-1, EK-1 mod, VP24-1160,
VP24-1160-mod, VP35-855, or VP35-855-mod siRNA in human PBMC
cultures. Native (unmodified) or 2'OMe-modified siRNA were cultured
with PBMC for 24 h at 100, 200, or 400 nM. Native Luc, EK-1,
VP24-1160, and VP35-855 siRNA induced strong IFN-.alpha. in culture
supernatants, whereas no IFN-.alpha. was detected in response to
the 2'OMe-modified siRNAs (Mean.+-.SD, n=3 culture wells, lower
limit of quantitation=15.6 pg/mL).
[0037] FIGS. 5A-B illustrate the rapid amplification of cDNA ends
(RACE)-PCR of small interfering RNA (siRNA)-mediated cleavage of
Zaire Ebola virus (ZEBOV) L polymerase, virion protein (VP24), and
VP35 mRNAs in ZEBOV-infected Vero E6 cells. (5A) SNALPs containing
ZEBOV siRNAs substantially reduced ZEBOV produced in supernatants
of Vero E6 cells 48 h after infection. (5B) 5'RACE assays showing
specific mRNA cleavage for the ZEBOV L-pol, VP24, and VP35 mRNAs in
vitro on Vero E6 cells 24 hours after transfection with SNALP
followed by ZEBOV infection. Vero E6 cells were treated with either
EK-1-mod, VP24-1160-mod, VP35-855-mod, ZEBOV cocktail, or Luc mod
SNALP or PBS and then 16 hours later infected with ZEBOV followed
24 hours later by lysis in Trizol. Total mRNA was examined for
specific cleavage of the L-pol, VP24, or VP35 mRNAs via the
respective siRNAs or the cocktail by performing a 5'RACE assay
using specific primers designed for each RACE PCR product. The
order of samples for each RACE PCR shown in the gel are (i) PBS,
(ii) single gene-specific siRNA in SNALP (either EK-1-mod,
VP24-1160-mod, or VP35-855-mod), (iii) ZEBOV cocktail SNALP, and
(iv) Luc mod SNALP. Lanes 1 and 17 are the 100 bp ladder, lanes 2-5
are EK-1 RACE PCR, lanes 7-10 are VP24-1160 RACE, and lanes 12-15
are VP35-855 RACE. The predicted RACE PCR product for EK-1 and
VP24-1160 RACE is 282 bp, while VP35-855 is 205 bp. Samples were
processed from two separate transfections with similar results.
[0038] FIGS. 6A-B illustrate Kaplan-Meier survival curves for
ZEBOV-infected rhesus macaques treated after challenge with a
cocktail of anti-ZEBOV siRNAs targeting L-pol, VP24, and VP35. (6A)
Animals treated 30 minutes and on days 1, 3, and 5 after ZEBOV
challenge. (6B) Animals treated 30 minutes and on days 1, 2, 3, 4,
5, and 6 after ZEBOV challenge.
[0039] FIG. 7 illustrates that CD34+ cord blood cells which
differentiated into CD14+ monocytes show uptake of FITC-labelled
siRNA SNALP into cells of the reticuloendothelial system. Uptake of
SNALP containing FITC-labeled Luc mod siRNA by CD11c-, CD11b-,
CD14-, and CD34-positive cells following 4 hour incubation at a
concentration of 150 nM SNALP. Results are expressed as the percent
of cells positive for uptake as determined by flow cytometry.
[0040] FIGS. 8A-B illustrate the effect of daily administration of
stable nucleic acid-lipid particles (SNALPs) containing Zaire Ebola
virus (ZEBOV) small interfering RNAs on activities of alanine
aminotransferase (ALT), aspartate aminotransferase (AST), and
sorbitol dehydrogenase (8A), and blood cell counts (8B) in
mice.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0041] Ebolavirus (EBOV) causes severe and often fatal hemorrhagic
fever in humans and nonhuman primates. There are no vaccines or
drugs approved for human use and no postexposure treatment has
completely protected nonhuman primates from the most lethal EBOV
species, Zaire ebolavirus (ZEBOV). It has been shown that siRNAs
targeting the ZEBOV RNA polymerase L protein (L-pol) formulated in
stable nucleic-acid-lipid particles (SNALP) completely protected
guinea pigs when administered shortly after a lethal ZEBOV
challenge (Geisbert et al., J. Infect. Dis., 193:1650-1657 (2006)).
Although rodent models of ZEBOV infection are useful for screening
prospective countermeasures, it is desirable to use more stringent
nonhuman primate models to predict efficacy. Example 1 provided
herein describes an evaluation of the protective efficacy of a
combination ("cocktail") of modified nonimmunostimulatory siRNAs
targeting sequences of viral mRNAs encoding ZEBOV proteins in
rhesus macaques. In particular, a cocktail of siRNA molecules
targeting the ZEBOV L-pol, viral protein (VP) 24, and VP35 genes
were formulated in SNALP. This cocktail of multiple siRNAs enables
the targeting of potential RNAi escape mutants. As a result, by
targeting three different viral gene products, the virus is
inactivated in three different areas of its life cycle. Two
different postexposure regimens were evaluated. In one study
employing four postexposure treatments of the pooled anti-ZEBOV
siRNAs, 66% of rhesus monkeys were protected from lethal ZEBOV
infection, while in a second study employing seven postexposure
treatments, 100% of macaques were protected from lethal ZEBOV
challenge. Thus, Example 1 illustrates the applicability of RNAi as
an effective postexposure treatment strategy for combating EBOV
infections in humans.
II. Definitions
[0042] As used herein, the following terms have the meanings
ascribed to them unless specified otherwise.
[0043] The term "Filovirus" or "Filoviridae" refers to
single-stranded negative sense RNA viruses that typically infect
primates. Filoviruses are able to multiply in virtually all cell
types. The Filovirus antigens and virions are found primarily in
fibroblasts and interstitium of an infected individual. There are
two identified genera of Filoviruses: the Ebola virus (EBOV; four
species) and the Marburg virus (MARV). The virions (viral
particles) are characteristically shaped as long, cylindrical,
filamentous particles which may be straight, curved, coiled, or
found in a "6" or "U" shaped configuration. They are occasionally
branched and the particles vary greatly in length, but the diameter
(about 80 nm) is consistent. The Filovirus genome comprises seven
genes that encode 4 virion structural proteins (VP30, VP35,
nucleoprotein (NP), and a polymerase protein (L-pol)) and 3
membrane-associated proteins (VP40, glycoprotein (GP), and
VP24).
[0044] The term "interfering RNA" or "RNAi" or "interfering RNA
sequence" as used herein includes single-stranded RNA (e.g., mature
miRNA, ssRNAi oligonucleotides, ssDNAi oligonucleotides),
double-stranded RNA (i.e., duplex RNA such as siRNA,
Dicer-substrate dsRNA, shRNA, aiRNA, or pre-miRNA), a DNA-RNA
hybrid (see, e.g., PCT Publication No. WO 2004/078941), or a
DNA-DNA hybrid (see, e.g., PCT Publication No. WO 2004/104199) that
is capable of reducing or inhibiting the expression of a target
gene or sequence (e.g., by mediating the degradation or inhibiting
the translation of mRNAs which are complementary to the interfering
RNA sequence) when the interfering RNA is in the same cell as the
target gene or sequence. Interfering RNA thus refers to the
single-stranded RNA that is complementary to a target mRNA sequence
or to the double-stranded RNA formed by two complementary strands
or by a single, self-complementary strand. Interfering RNA may have
substantial or complete identity to the target gene or sequence, or
may comprise a region of mismatch (i.e., a mismatch motif). The
sequence of the interfering RNA can correspond to the full-length
target gene, or a subsequence thereof. Preferably, the interfering
RNA molecules are chemically synthesized. The disclosures of each
of the above patent documents are herein incorporated by reference
in their entirety for all purposes.
[0045] Interfering RNA includes "small-interfering RNA" or "siRNA,"
e.g., interfering RNA of about 15-60, 15-50, or 15-40 (duplex)
nucleotides in length, more typically about 15-30, 15-25, or 19-25
(duplex) nucleotides in length, and is preferably about 20-24,
21-22, or 21-23 (duplex) nucleotides in length (e.g., each
complementary sequence of the double-stranded siRNA is 15-60,
15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length,
preferably about 20-24, 21-22, or 21-23 nucleotides in length, and
the double-stranded siRNA is about 15-60, 15-50, 15-40, 15-30,
15-25, or 19-25 base pairs in length, preferably about 18-22,
19-20, or 19-21 base pairs in length). siRNA duplexes may comprise
3' overhangs of about 1 to about 4 nucleotides or about 2 to about
3 nucleotides and 5' phosphate termini. Examples of siRNA include,
without limitation, a double-stranded polynucleotide molecule
assembled from two separate stranded molecules, wherein one strand
is the sense strand and the other is the complementary antisense
strand; a double-stranded polynucleotide molecule assembled from a
single stranded molecule, where the sense and antisense regions are
linked by a nucleic acid-based or non-nucleic acid-based linker; a
double-stranded polynucleotide molecule with a hairpin secondary
structure having self-complementary sense and antisense regions;
and a circular single-stranded polynucleotide molecule with two or
more loop structures and a stem having self-complementary sense and
antisense regions, where the circular polynucleotide can be
processed in vivo or in vitro to generate an active double-stranded
siRNA molecule. As used herein, the term "siRNA" includes RNA-RNA
duplexes as well as DNA-RNA hybrids (see, e.g., PCT Publication No.
WO 2004/078941).
[0046] Preferably, siRNA are chemically synthesized. siRNA can also
be generated by cleavage of longer dsRNA (e.g., dsRNA greater than
about 25 nucleotides in length) with the E. coli RNase III or
Dicer. These enzymes process the dsRNA into biologically active
siRNA (see, e.g., Yang et al., Proc. Natl. Acad. Sci. USA,
99:9942-9947 (2002); Calegari et al., Proc. Natl. Acad. Sci. USA,
99:14236 (2002); Byrom et al., Ambion TechNotes, 10(1):4-6 (2003);
Kawasaki et al., Nucleic Acids Res., 31:981-987 (2003); Knight et
al., Science, 293:2269-2271 (2001); and Robertson et al., J. Biol.
Chem., 243:82 (1968)). Preferably, dsRNA are at least 50
nucleotides to about 100, 200, 300, 400, or 500 nucleotides in
length. A dsRNA may be as long as 1000, 1500, 2000, 5000
nucleotides in length, or longer. The dsRNA can encode for an
entire gene transcript or a partial gene transcript. In certain
instances, siRNA may be encoded by a plasmid (e.g., transcribed as
sequences that automatically fold into duplexes with hairpin
loops).
[0047] As used herein, the term "mismatch motif" or "mismatch
region" refers to a portion of an interfering RNA (e.g., siRNA)
sequence that does not have 100% complementarity to its target
sequence. An interfering RNA may have at least one, two, three,
four, five, six, or more mismatch regions. The mismatch regions may
be contiguous or may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, or more nucleotides. The mismatch motifs or regions may
comprise a single nucleotide or may comprise two, three, four,
five, or more nucleotides.
[0048] The phrase "inhibiting expression of a target gene" refers
to the ability of an interfering RNA (e.g., siRNA) of the invention
to silence, reduce, or inhibit the expression of a target gene
(e.g., EBOV L-pol, VP24, VP30, VP35, VP40, NP, GP, or combinations
thereof). To examine the extent of gene silencing, a test sample
(e.g., a sample of cells in culture expressing the target gene) or
a test mammal (e.g., a mammal such as a human or an animal model
such as a rodent (e.g., mouse) or a non-human primate (e.g.,
monkey) model) is contacted with an interfering RNA (e.g., siRNA)
that silences, reduces, or inhibits expression of the target gene.
Expression of the target gene in the test sample or test animal is
compared to expression of the target gene in a control sample
(e.g., a sample of cells in culture expressing the target gene) or
a control mammal (e.g., a mammal such as a human or an animal model
such as a rodent (e.g., mouse) or non-human primate (e.g., monkey)
model) that is not contacted with or administered the interfering
RNA (e.g., siRNA). The expression of the target gene in a control
sample or a control mammal may be assigned a value of 100%. In
particular embodiments, silencing, inhibition, or reduction of
expression of a target gene is achieved when the level of target
gene expression in the test sample or the test mammal relative to
the level of target gene expression in the control sample or the
control mammal is about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%,
55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. In
other words, the interfering RNAs (e.g., siRNAs) of the present
invention are capable of silencing, reducing, or inhibiting the
expression of a target gene (e.g., EBOV L-pol, VP24, VP30, VP35,
VP40, NP, GP, or combinations thereof) by at least about 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, or 100% in a test sample or a test mammal
relative to the level of target gene expression in a control sample
or a control mammal not contacted with or administered the
interfering RNA. Suitable assays for determining the level of
target gene expression include, without limitation, examination of
protein or mRNA levels using techniques known to those of skill in
the art, such as, e.g., dot blots, Northern blots, in situ
hybridization, ELISA, immunoprecipitation, enzyme function, as well
as phenotypic assays known to those of skill in the art.
[0049] An "effective amount" or "therapeutically effective amount"
of a therapeutic nucleic acid such as an interfering RNA is an
amount sufficient to produce the desired effect, e.g., an
inhibition of expression of a target sequence in comparison to the
normal expression level detected in the absence of an interfering
RNA. Inhibition of expression of a target gene or target sequence
is achieved when the value obtained with an interfering RNA
relative to the control is about 95%, 90%, 85%, 80%, 75%, 70%, 65%,
60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%.
Suitable assays for measuring expression of a target gene or target
sequence include, e.g., examination of protein or RNA levels using
techniques known to those of skill in the art such as dot blots,
northern blots, in situ hybridization, ELISA, immunoprecipitation,
enzyme function, as well as phenotypic assays known to those of
skill in the art.
[0050] By "decrease," "decreasing," "reduce," or "reducing" of an
immune response by an interfering RNA is intended to mean a
detectable decrease of an immune response to a given interfering
RNA (e.g., a modified interfering RNA). The amount of decrease of
an immune response by a modified interfering RNA may be determined
relative to the level of an immune response in the presence of an
unmodified interfering RNA. A detectable decrease can be about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 100%, or more lower than the immune
response detected in the presence of the unmodified interfering
RNA. A decrease in the immune response to interfering RNA is
typically measured by a decrease in cytokine production (e.g.,
IFN.gamma., IFN.alpha., TNF.alpha., IL-6, IL-8, or IL-12) by a
responder cell in vitro or a decrease in cytokine production in the
sera of a mammalian subject after administration of the interfering
RNA.
[0051] As used herein, the term "responder cell" refers to a cell,
preferably a mammalian cell, that produces a detectable immune
response when contacted with an immunostimulatory interfering RNA
such as an unmodified siRNA. Exemplary responder cells include,
e.g., dendritic cells, macrophages, peripheral blood mononuclear
cells (PBMCs), splenocytes, and the like. Detectable immune
responses include, e.g., production of cytokines or growth factors
such as TNF-.alpha., IFN-.alpha., IFN-.gamma., IL-1, IL-2, IL-3,
IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, TGF, and combinations
thereof. Detectable immune responses also include, e.g., induction
of interferon-induced protein with tetratricopeptide repeats 1
(IFIT1) mRNA.
[0052] "Substantial identity" refers to a sequence that hybridizes
to a reference sequence under stringent conditions, or to a
sequence that has a specified percent identity over a specified
region of a reference sequence.
[0053] The phrase "stringent hybridization conditions" refers to
conditions under which a nucleic acid will hybridize to its target
sequence, typically in a complex mixture of nucleic acids, but to
no other sequences. Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Probes, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be about 5-10.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength pH. The T.sub.m is the temperature (under
defined ionic strength, pH, and nucleic concentration) at which 50%
of the probes complementary to the target hybridize to the target
sequence at equilibrium (as the target sequences are present in
excess, at T.sub.m, 50% of the probes are occupied at equilibrium).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide. For selective or specific
hybridization, a positive signal is at least two times background,
preferably 10 times background hybridization.
[0054] Exemplary stringent hybridization conditions can be as
follows: 50% formamide, 5.times.SSC, and 1% SDS, incubating at
42.degree. C., or, 5.times.SSC, 1% SDS, incubating at 65.degree.
C., with wash in 0.2.times.SSC, and 0.1% SDS at 65.degree. C. For
PCR, a temperature of about 36.degree. C. is typical for low
stringency amplification, although annealing temperatures may vary
between about 32.degree. C. and 48.degree. C. depending on primer
length. For high stringency PCR amplification, a temperature of
about 62.degree. C. is typical, although high stringency annealing
temperatures can range from about 50.degree. C. to about 65.degree.
C., depending on the primer length and specificity. Typical cycle
conditions for both high and low stringency amplifications include
a denaturation phase of 90.degree. C.-95.degree. C. for 30 sec.-2
min., an annealing phase lasting 30 sec.-2 min., and an extension
phase of about 72.degree. C. for 1-2 min. Protocols and guidelines
for low and high stringency amplification reactions are provided,
e.g., in Innis et al., PCR Protocols, A Guide to Methods and
Applications, Academic Press, Inc. N.Y. (1990).
[0055] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides which they encode are substantially identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency. Additional guidelines
for determining hybridization parameters are provided in numerous
references, e.g., Current Protocols in Molecular Biology, Ausubel
et al., eds.
[0056] The terms "substantially identical" or "substantial
identity," in the context of two or more nucleic acids, refer to
two or more sequences or subsequences that are the same or have a
specified percentage of nucleotides that are the same (i.e., at
least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%,
90%, or 95% identity over a specified region), when compared and
aligned for maximum correspondence over a comparison window, or
designated region as measured using one of the following sequence
comparison algorithms or by manual alignment and visual inspection.
This definition, when the context indicates, also refers
analogously to the complement of a sequence. Preferably, the
substantial identity exists over a region that is at least about 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in
length.
[0057] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identities for the
test sequences relative to the reference sequence, based on the
program parameters.
[0058] A "comparison window," as used herein, includes reference to
a segment of any one of a number of contiguous positions selected
from the group consisting of from about 5 to about 60, usually
about 10 to about 45, more usually about 15 to about 30, in which a
sequence may be compared to a reference sequence of the same number
of contiguous positions after the two sequences are optimally
aligned. Methods of alignment of sequences for comparison are well
known in the art. Optimal alignment of sequences for comparison can
be conducted, e.g., by the local homology algorithm of Smith and
Waterman, Adv. Appl. Math., 2:482 (1981), by the homology alignment
algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970), by
the search for similarity method of Pearson and Lipman, Proc. Natl.
Acad. Sci. USA, 85:2444 (1988), by computerized implementations of
these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Dr., Madison, Wis.), or by manual alignment and visual inspection
(see, e.g., Current Protocols in Molecular Biology, Ausubel et al.,
eds. (1995 supplement)).
[0059] Non-limiting examples of algorithms that are suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res., 25:3389-3402 (1977) and Altschul et al.,
J. Mol. Biol., 215:403-410 (1990), respectively. BLAST and BLAST
2.0 are used, with the parameters described herein, to determine
percent sequence identity for the nucleic acids of the invention.
Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). Another example is a global
alignment algorithm for determining percent sequence identiy such
as the Needleman-Wunsch algorithm for aligning protein or
nucleotide (e.g., RNA) sequences.
[0060] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin and
Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5787 (1993)). One
measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide sequences
would occur by chance. For example, a nucleic acid is considered
similar to a reference sequence if the smallest sum probability in
a comparison of the test nucleic acid to the reference nucleic acid
is less than about 0.2, more preferably less than about 0.01, and
most preferably less than about 0.001.
[0061] The term "nucleic acid" as used herein refers to a polymer
containing at least two deoxyribonucleotides or ribonucleotides in
either single- or double-stranded form and includes DNA, RNA, and
hybrids thereof. DNA may be in the form of, e.g., antisense
molecules, plasmid DNA, DNA-DNA duplexes, pre-condensed DNA, PCR
products, vectors (P1, PAC, BAC, YAC, artificial chromosomes),
expression cassettes, chimeric sequences, chromosomal DNA, or
derivatives and combinations of these groups. RNA may be in the
form of small interfering RNA (siRNA), Dicer-substrate dsRNA, small
hairpin RNA (shRNA), asymmetrical interfering RNA (aiRNA), microRNA
(miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations
thereof. Nucleic acids include nucleic acids containing known
nucleotide analogs or modified backbone residues or linkages, which
are synthetic, naturally occurring, and non-naturally occurring,
and which have similar binding properties as the reference nucleic
acid. Examples of such analogs include, without limitation,
phosphorothioates, phosphoramidates, methyl phosphonates,
chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and
peptide-nucleic acids (PNAs). Unless specifically limited, the term
encompasses nucleic acids containing known analogues of natural
nucleotides that have similar binding properties as the reference
nucleic acid. Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions), alleles,
orthologs, SNPs, and complementary sequences as well as the
sequence explicitly indicated. Specifically, degenerate codon
substitutions may be achieved by generating sequences in which the
third position of one or more selected (or all) codons is
substituted with mixed-base and/or deoxyinosine residues (Batzer et
al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol.
Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes,
8:91-98 (1994)). "Nucleotides" contain a sugar deoxyribose (DNA) or
ribose (RNA), a base, and a phosphate group. Nucleotides are linked
together through the phosphate groups. "Bases" include purines and
pyrimidines, which further include natural compounds adenine,
thymine, guanine, cytosine, uracil, inosine, and natural analogs,
and synthetic derivatives of purines and pyrimidines, which
include, but are not limited to, modifications which place new
reactive groups such as, but not limited to, amines, alcohols,
thiols, carboxylates, and alkylhalides.
[0062] The term "gene" refers to a nucleic acid (e.g., DNA or RNA)
sequence that comprises partial length or entire length coding
sequences necessary for the production of a polypeptide or
precursor polypeptide.
[0063] "Gene product," as used herein, refers to a product of a
gene such as an RNA transcript or a polypeptide.
[0064] The term "lipid" refers to a group of organic compounds that
include, but are not limited to, esters of fatty acids and are
characterized by being insoluble in water, but soluble in many
organic solvents. They are usually divided into at least three
classes: (1) "simple lipids," which include fats and oils as well
as waxes; (2) "compound lipids," which include phospholipids and
glycolipids; and (3) "derived lipids" such as steroids.
[0065] The term "lipid particle" includes a lipid formulation that
can be used to deliver a therapeutic nucleic acid (e.g.,
interfering RNA) to a target site of interest (e.g., cell, tissue,
organ, and the like). In preferred embodiments, the lipid particle
of the invention is a nucleic acid-lipid particle, which is
typically formed from a cationic lipid, a non-cationic lipid, and
optionally a conjugated lipid that prevents aggregation of the
particle. In other preferred embodiments, the therapeutic nucleic
acid (e.g., interfering RNA) may be encapsulated in the lipid
portion of the particle, thereby protecting it from enzymatic
degradation.
[0066] As used herein, the term "SNALP" refers to a stable nucleic
acid-lipid particle. A SNALP represents a particle made from lipids
(e.g., a cationic lipid, a non-cationic lipid, and optionally a
conjugated lipid that prevents aggregation of the particle),
wherein the nucleic acid (e.g., an interfering RNA) is fully
encapsulated within the lipid. In certain instances, SNALP are
extremely useful for systemic applications, as they can exhibit
extended circulation lifetimes following intravenous (i.v.)
injection, they can accumulate at distal sites (e.g., sites
physically separated from the administration site), and they can
mediate silencing of target gene expression at these distal sites.
The nucleic acid may be complexed with a condensing agent and
encapsulated within a SNALP as set forth in PCT Publication No. WO
00/03683, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0067] The lipid particles of the invention (e.g., SNALP) typically
have a mean diameter of from about 30 nm to about 150 nm, from
about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from
about 60 nm to about 130 nm, from about 70 nm to about 110 nm, from
about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from
about 90 nm to about 100 nm, from about 70 to about 90 nm, from
about 80 nm to about 90 nm, from about 70 nm to about 80 nm, or
about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70
nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115
nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and
are substantially non-toxic. In addition, nucleic acids, when
present in the lipid particles of the present invention, are
resistant in aqueous solution to degradation with a nuclease.
Nucleic acid-lipid particles and their method of preparation are
disclosed in, e.g., U.S. Patent Publication Nos. 20040142025 and
20070042031, the disclosures of which are herein incorporated by
reference in their entirety for all purposes.
[0068] As used herein, "lipid encapsulated" can refer to a lipid
particle that provides a therapeutic nucleic acid, such as an
interfering RNA (e.g., siRNA), with full encapsulation, partial
encapsulation, or both. In a preferred embodiment, the nucleic acid
(e.g., interfering RNA) is fully encapsulated in the lipid particle
(e.g., to form a SNALP or other nucleic acid-lipid particle).
[0069] The term "lipid conjugate" refers to a conjugated lipid that
inhibits aggregation of lipid particles. Such lipid conjugates
include, but are not limited to, PEG-lipid conjugates such as,
e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates),
PEG coupled to diacylglycerols (e.g., PEG-DAG conjugates), PEG
coupled to cholesterol, PEG coupled to phosphatidylethanolamines,
and PEG conjugated to ceramides (see, e.g., U.S. Pat. No.
5,885,613), cationic PEG lipids, polyoxazoline (POZ)-lipid
conjugates (e.g., POZ-DAA conjugates; see, e.g., U.S. Provisional
Application No. 61/294,828, filed Jan. 13, 2010, and U.S.
Provisional Application No. 61/295,140, filed Jan. 14, 2010),
polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures
thereof. Additional examples of POZ-lipid conjugates are described
in PCT Publication No. WO 2010/006282. PEG or POZ can be conjugated
directly to the lipid or may be linked to the lipid via a linker
moiety. Any linker moiety suitable for coupling the PEG or the POZ
to a lipid can be used including, e.g., non-ester containing linker
moieties and ester-containing linker moieties. In certain preferred
embodiments, non-ester containing linker moieties, such as amides
or carbamates, are used. The disclosures of each of the above
patent documents are herein incorporated by reference in their
entirety for all purposes.
[0070] The term "amphipathic lipid" refers, in part, to any
suitable material wherein the hydrophobic portion of the lipid
material orients into a hydrophobic phase, while the hydrophilic
portion orients toward the aqueous phase. Hydrophilic
characteristics derive from the presence of polar or charged groups
such as carbohydrates, phosphate, carboxylic, sulfato, amino,
sulfhydryl, nitro, hydroxyl, and other like groups. Hydrophobicity
can be conferred by the inclusion of apolar groups that include,
but are not limited to, long-chain saturated and unsaturated
aliphatic hydrocarbon groups and such groups substituted by one or
more aromatic, cycloaliphatic, or heterocyclic group(s). Examples
of amphipathic compounds include, but are not limited to,
phospholipids, aminolipids, and sphingolipids.
[0071] Representative examples of phospholipids include, but are
not limited to, phosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, phosphatidic acid,
palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine,
lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine,
dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and
dilinoleoylphosphatidylcholine. Other compounds lacking in
phosphorus, such as sphingolipid, glycosphingolipid families,
diacylglycerols, and .beta.-acyloxyacids, are also within the group
designated as amphipathic lipids. Additionally, the amphipathic
lipids described above can be mixed with other lipids including
triglycerides and sterols.
[0072] The term "neutral lipid" refers to any of a number of lipid
species that exist either in an uncharged or neutral zwitterionic
form at a selected pH. At physiological pH, such lipids include,
for example, diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
cholesterol, cerebrosides, and diacylglycerols.
[0073] The term "non-cationic lipid" refers to any amphipathic
lipid as well as any other neutral lipid or anionic lipid.
[0074] The term "anionic lipid" refers to any lipid that is
negatively charged at physiological pH. These lipids include, but
are not limited to, phosphatidylglycerols, cardiolipins,
diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl
phosphatidylethanolamines, N-succinyl phosphatidylethanolamines,
N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,
palmitoyloleyolphosphatidylglycerol (POPG), and other anionic
modifying groups joined to neutral lipids.
[0075] The term "hydrophobic lipid" refers to compounds having
apolar groups that include, but are not limited to, long-chain
saturated and unsaturated aliphatic hydrocarbon groups and such
groups optionally substituted by one or more aromatic,
cycloaliphatic, or heterocyclic group(s). Suitable examples
include, but are not limited to, diacylglycerol, dialkylglycerol,
N--N-dialkylamino, 1,2-diacyloxy-3-aminopropane, and
1,2-dialkyl-3-aminopropane.
[0076] The term "fusogenic" refers to the ability of a lipid
particle, such as a SNALP, to fuse with the membranes of a cell.
The membranes can be either the plasma membrane or membranes
surrounding organelles, e.g., endosome, nucleus, etc.
[0077] As used herein, the term "aqueous solution" refers to a
composition comprising in whole, or in part, water.
[0078] As used herein, the term "organic lipid solution" refers to
a composition comprising in whole, or in part, an organic solvent
having a lipid.
[0079] "Distal site," as used herein, refers to a physically
separated site, which is not limited to an adjacent capillary bed,
but includes sites broadly distributed throughout an organism.
[0080] "Serum-stable" in relation to nucleic acid-lipid particles
such as SNALP means that the particle is not significantly degraded
after exposure to a serum or nuclease assay that would
significantly degrade free DNA or RNA. Suitable assays include, for
example, a standard serum assay, a DNAse assay, or an RNAse
assay.
[0081] "Systemic delivery," as used herein, refers to delivery of
lipid particles that leads to a broad biodistribution of an active
agent such as an interfering RNA (e.g., siRNA) within an organism.
Some techniques of administration can lead to the systemic delivery
of certain agents, but not others. Systemic delivery means that a
useful, preferably therapeutic, amount of an agent is exposed to
most parts of the body. To obtain broad biodistribution generally
requires a blood lifetime such that the agent is not rapidly
degraded or cleared (such as by first pass organs (liver, lung,
etc.) or by rapid, nonspecific cell binding) before reaching a
disease site distal to the site of administration. Systemic
delivery of lipid particles can be by any means known in the art
including, for example, intravenous, subcutaneous, and
intraperitoneal. In a preferred embodiment, systemic delivery of
lipid particles is by intravenous delivery.
[0082] "Local delivery," as used herein, refers to delivery of an
active agent such as an interfering RNA (e.g., siRNA) directly to a
target site within an organism. For example, an agent can be
locally delivered by direct injection into a disease site, other
target site, or a target organ such as the liver, heart, pancreas,
kidney, and the like.
[0083] The term "mammal" refers to any mammalian species such as a
human, mouse, rat, dog, cat, hamster, guinea pig, rabbit,
livestock, and the like.
[0084] The term "reticuloendothelial system" or "RES" refers to the
part of the immune system that contains reticuloendothelial cells,
including the phagocytic cells located in reticular connective
tissue such as monocytes and macrophages. These cells typically
accumulate in lymph nodes and the spleen. The Kupffer cells of the
liver and tissue histiocytes are also part of the RES. The RES is
divided into primary and secondary lymphoid organs. Primary
("central") lymphoid organs are the sites where the cells of the
RES are produced. The cells of the RES are produced in the bone
marrow. The thymus is also included as it is the required site for
T cell maturation. Secondary ("peripheral") lymphoid organs are the
sites where the cells of the RES function. This includes the lymph
nodes, tonsils, spleen, and "MALT" (mucosa-associated lymphoid
tissue). MALT is further divided into "GALT" (gut-associated
lymphoid tissue) and "BALT" (bronchus-associated lymphoid tissue).
The Kupffer cells of the liver act as part of this system, but are
not organized into a tissue; rather, they are dispersed throughout
the liver sinusoids. The microglia of the central nervous system
(CNS) can be considered a part of the RES. They are scavenger cells
that proliferate in response to CNS injury.
III. Description of the Embodiments
[0085] The present invention provides therapeutic nucleic acids
such as interfering RNA that target Ebola virus (EBOV) gene
expression, lipid particles comprising one or more (e.g., a
cocktail) of the therapeutic nucleic acids, methods of making the
lipid particles, and methods of delivering and/or administering the
lipid particles (e.g., for the prevention or treatment of EBOV
infections).
[0086] In one aspect, the present invention provides interfering
RNA molecules that target EBOV L-pol, VP24, VP30, VP35, VP40, NP,
and/or GP expression. Non-limiting examples of interfering RNA
molecules include siRNA, Dicer-substrate dsRNA, shRNA, aiRNA,
miRNA, and mixtures thereof. In preferred embodiments, the present
invention provides compositions comprising a combination (e.g., a
cocktail, pool, or mixture) of siRNAs that target multiple genes
(e.g., at least two, three, four, five, six, or all seven of the
genes) in the EBOV genome. The interfering RNA (e.g., siRNA)
molecules of the invention are capable of inactivating EBOV and/or
inhibiting the replication of EBOV in vitro or in vivo.
[0087] In some embodiments, the interfering RNA (e.g., siRNA)
comprises a sense strand and a complementary antisense strand. In
certain embodiments, the sense strand comprises or consists of a
sequence that is at least about 80%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to
the target sequence or a portion thereof. In certain other
embodiments, the sense strand comprises or consists of at least
about 15 contiguous nucleotides (e.g., at least about 15, 16, 17,
18, or 19 contiguous nucleotides) of a sequence that is identical
to the target sequence or a portion thereof. In preferred
embodiments, the interfering RNA (e.g., siRNA) comprising such a
sense strand sequence is capable of mediating target-specific RNAi
(e.g., silencing EBOV L-pol, VP24, VP30, VP35, VP40, NP, and/or GP
expression).
[0088] In other embodiments, the antisense strand comprises or
consists of a sequence that is at least about 80%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%
complementary to the target sequence or a portion thereof. In
certain other embodiments, the antisense strand comprises or
consists of at least about 15 contiguous nucleotides (e.g., at
least about 15, 16, 17, 18, or 19 contiguous nucleotides) of a
sequence that is complementary to the target sequence or a portion
thereof. In further embodiments, the antisense strand comprises or
consists of a sequence that specifically hybridizes to the target
sequence or a portion thereof. In preferred embodiments, the
interfering RNA (e.g., siRNA) comprising such an antisense strand
sequence is capable of mediating target-specific RNAi (e.g.,
silencing EBOV L-pol, VP24, VP30, VP35, VP40, NP, and/or GP
expression).
[0089] In particular embodiments, the present invention provides a
composition comprising a cocktail of at least two interfering RNA
molecules (e.g., siRNA molecules) targeting EBOV gene expression
selected from the group consisting of: [0090] (a) a first
interfering RNA that silences EBOV L-pol expression, comprising the
following antisense strand sequence: 5'-UUUAUAUACAGCUUCGUAC-3'_(SEQ
ID NO:59); [0091] (b) a second interfering RNA that silences EBOV
VP24 expression, comprising the following antisense strand
sequence: 5'-UUUGCAUUCGUGUCGAGGA-3' (SEQ ID NO:60); and [0092] (c)
a third interfering RNA that silences EBOV VP35 expression,
comprising the following antisense strand sequence:
5'-AUGAUGUCCAAUGAGUUGC-3' (SEQ ID NO:61).
[0093] The compositions of the present invention may comprise any
pairwise combination of the first, second, and third interfering
RNA (e.g., siRNA) molecules, or may comprise all three of the
first, second, and third interfering RNAs (e.g., siRNAs). In some
embodiments, the composition comprises the first and second
interfering RNAs (e.g., siRNAs) targeting EBOV L-pol and VP24
expression. In other embodiments, the composition comprises the
first and third interfering RNAs (e.g., siRNAs) targeting EBOV
L-pol and VP35 expression. In yet other embodiments, the
composition comprises the second and third interfering RNAs (e.g.,
siRNAs) targeting EBOV VP24 and VP35 expression. In further
embodiments, the composition comprises the first, second, and third
(i.e., all three) interfering RNAs (e.g., siRNAs) targeting EBOV
L-pol, VP24, and VP35 expression.
[0094] In some embodiments, one, two, or all three of the first,
second, and third interfering RNAs (e.g., siRNAs) comprise a sense
strand and a complementary antisense strand, and each of the first,
second, and third interfering RNAs (e.g., siRNAs) independently
comprises a double-stranded region of about 15 to about 60
nucleotides in length (e.g., about 15-60, 15-30, 15-25, 19-30,
19-25, 20-60, 20-55, 20-50, 20-45, 20-40, 20-35, 20-30, 20-25,
21-30, 21-29, 22-30, 22-29, 22-28, 23-30, 23-28, 24-30, 24-28,
25-60, 25-55, 25-50, 25-45, 25-40, 25-35, or 25-30 nucleotides in
length, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length). In
other embodiments, one, two, or all three of the first, second, and
third interfering RNAs are chemically synthesized.
[0095] In certain embodiments, each of the first, second, and third
interfering RNAs (e.g., siRNAs) may independently comprise at least
one, two, three, four, five, six, seven, eight, nine, ten, or more
modified nucleotides such as 2'OMe nucleotides, e.g., in the sense
and/or antisense strand of the double-stranded region of the
interfering RNA. Preferably, uridine and/or guanosine nucleotides
in the interfering RNA are modified with 2'OMe nucleotides. In
certain instances, the interfering RNA contains 2'OMe nucleotides
in both the sense and antisense strands and comprises at least one
2'OMe-uridine nucleotide and at least one 2'OMe-guanosine
nucleotide in the double-stranded region. In some embodiments, the
sense and/or antisense strand of the interfering RNA may further
comprise modified (e.g., 2'OMe-modified) adenosine and/or modified
(e.g., 2'OMe-modified) cytosine nucleotides, e.g., in the
double-stranded region of the interfering RNA.
[0096] In some embodiments, the sense and/or antisense strand
sequences may comprise at least one, two, three, four, five, six,
seven, eight, nine, ten, or more modified nucleotides such as 2'OMe
nucleotides. In certain embodiments, the sense and/or antisense
strand sequences may each independently comprise or consist of a
modified (e.g., 2'OMe) and/or unmodified 3' overhang of 1, 2, 3, or
4 nucleotides, or one or both ends of the double-stranded molecule
may be blunt-ended.
[0097] One of skill in the art will understand that unmodified
sense and/or antisense strand sequences can be modified in
accordance with the selective modification patterns described
herein (e.g., at selective uridine and/or guanosine nucleotides,
and optionally at adenosine and/or cytosine nucleotides, within the
RNA duplex), and screened for RNAi activity as well as immune
stimulation, such that the degree of chemical modifications
introduced into the interfering RNA molecule strikes a balance
between reduction or abrogation of the immunostimulatory properties
of the interfering RNA and retention of RNAi activity.
[0098] In particular embodiments, each of the first, second, and
third interfering RNAs (e.g., siRNAs) may independently comprise a
3' overhang of 1, 2, 3, or 4 nucleotides in one or both strands. In
certain instances, the interfering RNA may contain at least one
blunt end. In particular embodiments, the 3' overhangs in one or
both strands of the interfering RNA (e.g., siRNA) may each
independently comprise 1, 2, 3, or 4 modified and/or unmodified
deoxythymidine ("t" or "dT") nucleotides, 1, 2, 3, or 4 modified
(e.g., 2'OMe) and/or unmodified uridine ("U") ribonucleotides, or
1, 2, 3, or 4 modified (e.g., 2'OMe) and/or unmodified
ribonucleotides or deoxyribonucleotides having complementarity to
the target sequence or the complementary strand thereof.
[0099] In another embodiment, the compositions of the present
invention comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more additional
unmodified and/or modified interfering RNA (e.g., siRNA) sequences
that target EBOV L-pol, VP24, VP30, VP35, VP40, NP, and/or GP
expression. The additional interfering RNA (e.g., siRNA) molecules
may comprise sequences which are directed to the same region or
domain (e.g., a "hot spot") and/or to different regions or domains
of one or more target genes. In certain instances, at least about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, or more additional unmodified and/or modified interfering RNA
(e.g., siRNA) sequences that target EBOV L-pol, VP24, and/or VP35
are included in the compositions of the present invention. In
particular embodiments, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more (e.g., all) of
the additional interfering RNA (e.g., siRNA) sequences are
chemically modified (e.g., 2'OMe-modified) as described herein.
[0100] In some embodiments, the first interfering RNA (e.g., siRNA)
further comprises a sense strand comprising the following sequence:
5'-GUACGAAGCUGUAUAUAAA-3' (SEQ ID NO:62). In some aspects of these
embodiments, the first interfering RNA (e.g., siRNA) comprises at
least one 2'OMe nucleotide, e.g., at least one 2'OMe-guanosine
and/or 2'OMe-uridine nucleotide. In certain instances, the first
interfering RNA comprises an antisense strand comprising at least
one, at least two, at least three, at least four, at least five, at
least six, at least seven, or more 2'OMe nucleotides, e.g.,
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In certain other
instances, the first interfering RNA comprises a sense strand
comprising at least one, at least two, at least three, at least
four, at least five, at least six, at least seven, or more 2'OMe
nucleotides, e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides. In further instances, the antisense strand and/or
sense strand may further comprise at least one, at least two, at
least three, at least four, at least five, at least six, at least
seven, or more 2'OMe-adenosine and/or 2'OMe-cytosine
nucleotides.
[0101] In particular embodiments, from about 20%-40%, 25%-40%,
30%-40%, 20%-35%, 25%-35%, 20%-30%, 25%-30%, 26%-34%, 27%-33%,
28%-32%, or about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%,
30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40% of the
nucleotides in the double-stranded region of the first interfering
RNA (e.g., siRNA) comprise modified nucleotides such as, e.g.,
2'OMe nucleotides (e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides).
[0102] In certain embodiments, the first interfering RNA (e.g.,
siRNA) of the invention comprises a 3' overhang in one or both
strands of the interfering RNA. In one particular embodiment, the
antisense strand comprises a 5'-dTdT-3' (i.e., 5'-TT-3') overhang
or a 5'-AA-3' overhang and the sense strand comprises a 5'-dTdT-3'
(i.e., 5'-TT-3') overhang or a 5'-UU-3' overhang. In certain
instances, the 3' overhangs on one or both strands of the
interfering RNA (e.g., siRNA) comprise at least one 2'OMe
nucleotide, e.g., at least one 2'OMe-guanosine and/or 2'OMe-uridine
nucleotide. In other embodiments, the 3' overhangs on one or both
strands of the interfering RNA (e.g., siRNA) comprise 1-4
deoxythymidine (dT) nucleotides, 1-4 modified and/or unmodified
uridine (U) ribonucleotides, or 1-2 additional ribonucleotides
having complementarity to the target sequence or the complementary
strand thereof.
[0103] In In some embodiments, the first interfering RNA (e.g.,
siRNA) that silences EBOV L-pol expression comprises one of the
following sense strand sequences set forth in Table 1, wherein the
underlined nucleotides are 2'OMe nucleotides.
TABLE-US-00001 TABLE 1 (SEQ ID NOS: 1-3) Name Sense Strand Sequence
S-1 5'-GUACGAAGCUGUAUAUAAATT-3' S-2 5'-GUACGAAGCUGUAUAUAAATT-3' S-3
5'-GUACGAAGCUGUAUAUAAATT-3'
[0104] In other embodiments, the first interfering RNA (e.g.,
siRNA) that silences EBOV L-pol expression comprises one of the
following antisense strand sequences set forth in Table 2, wherein
the underlined nucleotides are 2'OMe nucleotides.
TABLE-US-00002 TABLE 2 (SEQ ID NOS: 4-9) Name Antisense Strand
Sequence AS-1 5'-UUUAUAUACAGCUUCGUACTT-3' AS-2
5'-UUUAUAUACAGCUUCGUACTT-3' AS-3 5'-UUUAUAUACAGCUUCGUACTT-3' AS-4
5'-UUUAUAUACAGCUUCGUACTT-3' AS-5 5'-UUUAUAUACAGCUUCGUACTT-3' AS-6
5'-UUUAUAUACAGCUUCGUACTT-3'
[0105] In one preferred embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression comprises: an
antisense strand comprising the sequence 5-'-UUUAUAUACAGCUUCGUAC-3'
(SEQ ID NO:59) and at least one, two, three, four, five, six,
seven, or more 2'OMe nucleotides, e.g., at least one, two, three,
four, five, six, seven, or more 2'OMe-guanosine and/or
2'OMe-uridine nucleotides; and a sense strand comprising the
sequence 5'-GUACGAAGCUGUAUAUAAA-3' (SEQ ID NO:62) and at least one,
two, three, four, five, six, seven, or more 2'OMe nucleotides,
e.g., at least one, two, three, four, five, six, seven, or more
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In another
preferred embodiment, the first interfering RNA (e.g., siRNA) that
silences EBOV L-pol expression comprises: a sense strand comprising
nucleotides 1-19 of any one of S-1 to S-3 set forth in Table 1; and
an antisense strand comprising nucleotides 1-19 of any one of AS-1
to AS-6 set forth in Table 2. In a particularly preferred
embodiment, the first interfering RNA (e.g., siRNA) that silences
EBOV L-pol expression consists of: a sense strand selected from any
one of S-1 to S-3 set forth in Table 1; and an antisense strand
selected from any one of AS-1 to AS-6 set forth in Table 2. In
additional embodiments, the sense strand and/or antisense strand of
the first interfering RNA (e.g., siRNA) may further comprise at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'OMe-adenosine and/or
2'OMe-cytosine nucleotides.
[0106] In particular embodiments, the compositions of the present
invention comprise the first interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
1 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 2 (or nucleotides 1-19 thereof) in
combination with (1) the second interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
3 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 4 (or nucleotides 1-19 thereof), (2)
the third interfering RNA (e.g., siRNA) comprising any one of the
sense strand sequences set forth in Table 5 (or nucleotides 1-19
thereof) and any one of the antisense strand sequences set forth in
Table 6 (or nucleotides 1-19 thereof), or (3) both the second and
third interfering RNA (e.g., siRNA) described in (1) and (2).
[0107] In one particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00003 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 4) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-1" or "EK-1 S1/AS1"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0108] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00004 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 5) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-2" or "EK-1 S1/AS2"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0109] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00005 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 6) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-3" or "EK-1 S1/AS3"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0110] In still yet another particular embodiment, the first
interfering RNA (e.g., siRNA) that silences EBOV L-pol expression
consists of the following sense and antisense strand sequences:
TABLE-US-00006 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 7) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-4" or "EK-1 S1/AS4"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0111] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00007 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 8) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-5" or "EK-1 S1/AS5"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0112] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00008 (SEQ ID NO: 1) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 9) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-1+AS-6" or "EK-1 S1/AS6"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0113] In still yet another particular embodiment, the first
interfering RNA (e.g., siRNA) that silences EBOV L-pol expression
consists of the following sense and antisense strand sequences:
TABLE-US-00009 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 4) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-1" or "EK-1 S2/AS1"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0114] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00010 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 5) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-2" or "EK-1 S2/AS2"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0115] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00011 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 6) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-3" or "EK-1 S2/AS3"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0116] In still yet another particular embodiment, the first
interfering RNA (e.g., siRNA) that silences EBOV L-pol expression
consists of the following sense and antisense strand sequences:
TABLE-US-00012 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 7) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-4" or "EK-1 S2/AS4"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0117] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00013 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 8) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-5" or "EK-1 S2/AS5"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0118] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00014 (SEQ ID NO: 2) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 9) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-2+AS-6" or "EK-1 S2/AS6"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0119] In still yet another particular embodiment, the first
interfering RNA (e.g., siRNA) that silences EBOV L-pol expression
consists of the following sense and antisense strand sequences:
TABLE-US-00015 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 4) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-1" or "EK-1 S3/AS1"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0120] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00016 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 5) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-2" or "EK-1 S3/AS2"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0121] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00017 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 6) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-3" or "EK-1 S3/AS3"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0122] In still yet another particular embodiment, the first
interfering RNA (e.g., siRNA) that silences EBOV L-pol expression
consists of the following sense and antisense strand sequences:
TABLE-US-00018 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 7) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-4" or "EK-1 S3/AS4"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0123] In another particular embodiment, the first interfering RNA
(e.g., siRNA) that silences EBOV L-pol expression consists of the
following sense and antisense strand sequences:
TABLE-US-00019 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 8) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-5" or "EK-1 S3/AS5"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0124] In yet another particular embodiment, the first interfering
RNA (e.g., siRNA) that silences EBOV L-pol expression consists of
the following sense and antisense strand sequences:
TABLE-US-00020 (SEQ ID NO: 3) 5'-GUACGAAGCUGUAUAUAAATT-3' (SEQ ID
NO: 9) 3'-TTCAUGCUUCGACAUAUAUUU-5',
("S-3+AS-6" or "EK-1 S3/AS6"), wherein the bolded and underlined
nucleotides are 2'OMe nucleotides.
[0125] In some embodiments, the second interfering RNA (e.g.,
siRNA) further comprises a sense strand comprising the following
sequence: 5'-UCCUCGACACGAAUGCAAA-3'. In some aspects of these
embodiments, the second interfering RNA (e.g., siRNA) comprises at
least one 2'OMe nucleotide, e.g., at least one 2'OMe-guanosine
and/or 2'OMe-uridine nucleotide. In certain instances, the second
interfering RNA comprises an antisense strand comprising at least
one, at least two, at least three, at least four, at least five, at
least six, at least seven, or more 2'OMe nucleotides, e.g.,
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In certain other
instances, the second interfering RNA comprises a sense strand
comprising at least one, at least two, at least three, at least
four, at least five, at least six, at least seven, or more 2'OMe
nucleotides, e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides. In further instances, the antisense strand and/or
sense strand may further comprise at least one, at least two, at
least three, at least four, at least five, at least six, at least
seven, or more 2'OMe-adenosine and/or 2'OMe-cytosine
nucleotides.
[0126] In particular embodiments, from about 20%-40%, 25%-40%,
30%-40%, 20%-35%, 25%-35%, 20%-30%, 25%-30%, 26%-34%, 27%-33%,
28%-32%, or about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%,
30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40% of the
nucleotides in the double-stranded region of the second interfering
RNA (e.g., siRNA) comprise modified nucleotides such as, e.g.,
2'OMe nucleotides (e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides).
[0127] In certain embodiments, the second interfering RNA (e.g.,
siRNA) of the invention comprises a 3' overhang in one or both
strands of the interfering RNA. In one particular embodiment, the
antisense strand comprises a 5'-dTdT-3' (i.e., 5'-TT-3') overhang
or a 5'-UC-3' overhang and the sense strand comprises a 5'-dTdT-3'
(i.e., 5'-TT-3') overhang or a 5'-GU-3' overhang. In certain
instances, the 3' overhangs on one or both strands of the
interfering RNA (e.g., siRNA) comprise at least one 2'OMe
nucleotide, e.g., at least one 2'OMe-guanosine and/or 2'OMe-uridine
nucleotide. In other embodiments, the 3' overhangs on one or both
strands of the interfering RNA (e.g., siRNA) comprise 1-4
deoxythymidine (dT) nucleotides, 1-4 modified and/or unmodified
uridine (U) ribonucleotides, or 1-2 additional ribonucleotides
having complementarity to the target sequence or the complementary
strand thereof.
[0128] In some embodiments, the second interfering RNA (e.g.,
siRNA) that silences EBOV VP24 expression comprises a modified
sense strand having the following sequence:
5'-UCCUCGACACGAAUGCAAA-3' (SEQ ID NO:63), wherein the underlined
nucleotides indicate potential sites for the introduction of
modified nucleotides such as 2'OMe nucleotides. As such, in certain
instances, any one or a combination of 2, 3, 4, 5, or all 6 of the
underlined nucleotides in the sense strand can be modified, e.g.,
2'OMe modified. In certain other instances, the sense strand may
further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or
13 modified adenosine and/or cytosine nucleotides, e.g.,
2'OMe-adenosine and/or 2'OMe-cytosine nucleotides. In further
instances, the sense strand may comprise a 5'-GU-3' overhang,
wherein any one or both of the nucleotides in the overhang can be
modified, e.g., 2'OMe modified.
[0129] In one particular embodiment, the sense strand of the second
interfering RNA (e.g., siRNA) comprises the following sequence:
5'-UCCUCGACACGAAUGCAAA-3' (SEQ ID NO:10), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides. In certain instances,
the sense strand may further comprise 2'OMe-adenosine and/or
2'OMe-cytosine nucleotides. In certain other instances, the sense
strand may comprise a 5'-GU-3' overhang, wherein any one or both of
the nucleotides in the overhang can be modified, e.g., 2'OMe
modified. Table 3 below sets forth exemplary sense strand sequences
for the second interfering RNA (e.g., siRNA) that silences EBOV
VP24 expression, wherein the underlined nucleotides are 2'OMe
nucleotides.
TABLE-US-00021 TABLE 3 (SEQ ID NOS: 10-16)
5'-UCCUCGACACGAAUGCAAAGU-3' 5'-UCCUCGACACGAAUGCAAAGU-3'
5'-UCCUCGACACGAAUGCAAAGU-3' 5'-UCCUCGACACGAAUGCAAAGU-3'
5'-UCCUCGACACGAAUGCAAAGU-3' 5'-UCCUCGACACGAAUGCAAAGU-3'
5'-UCCUCGACACGAAUGCAAAGU-3'
[0130] In other embodiments, the second interfering RNA (e.g.,
siRNA) that silences EBOV VP24 expression comprises a modified
antisense strand having the following sequence:
5'-UUUGCAUUCGUGUCGAGGA-3' (SEQ ID NO:64), wherein the underlined
nucleotides indicate potential sites for the introduction of
modified nucleotides such as 2'OMe nucleotides. As such, in certain
instances, any one or a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, or all 13 of the underlined nucleotides in the antisense
strand can be modified, e.g., 2'OMe modified. In certain other
instances, the antisense strand may further comprise at least 1, 2,
3, 4, 5, or 6 modified adenosine and/or cytosine nucleotides, e.g.,
2'OMe-adenosine and/or 2'OMe-cytosine nucleotides. In further
instances, the antisense strand may comprise a 5'-UC-3' overhang,
wherein any one or both of the nucleotides in the overhang can be
modified, e.g., 2'OMe modified.
[0131] In one particular embodiment, the antisense strand of the
second interfering RNA (e.g., siRNA) comprises the following
sequence: 5'-UUUGCAUUCGUGUCGAGGA-3' (SEQ ID NO:65), wherein the
bolded and underlined nucleotides are 2'OMe nucleotides. In certain
instances, the antisense strand may further comprise
2'OMe-adenosine and/or 2'OMe-cytosine nucleotides. In certain other
instances, the antisense strand may comprise a 5'-UC-3' overhang,
wherein any one or both of the nucleotides in the overhang can be
modified, e.g., 2'OMe modified. Table 4 below sets forth exemplary
antisense strand sequences for the second interfering RNA (e.g.,
siRNA) that silences EBOV VP24 expression, wherein the underlined
nucleotides are 2'OMe nucleotides.
TABLE-US-00022 TABLE 4 (SEQ ID NOS: 17-24)
5'-UUUGCAUUCGUGUCGAGGAUC-3' 5'-UUUGCAUUCGUGUCGAGGAUC-3'
5'-UUUGCAUUCGUGUCGAGGAUC-3' 5'-UUUGCAUUCGUGUCGAGGAUC-3'
5'-UUUGCAUUCGUGUCGAGGAUC-3' 5'-UUUGCAUUCGUGUCGAGGAUC-3'
5'-UUUGCAUUCGUGUCGAGGAUC-3' 5'-UUUGCAUUCGUGUCGAGGAUC-3'
[0132] In one preferred embodiment, the second interfering RNA
(e.g., siRNA) that silences EBOV VP24 expression comprises: an
antisense strand comprising the sequence 5'-UUUGCAUUCGUGUCGAGGA-3'
(SEQ ID NO:66) and at least one, two, three, four, five, six,
seven, or more 2'OMe nucleotides, e.g., at least one, two, three,
four, five, six, seven, or more 2'OMe-guanosine and/or
2'OMe-uridine nucleotides; and a sense strand comprising the
sequence 5'-UCCUCGACACGAAUGCAAAGU-3' (SEQ ID NO:67) and at least
one, two, three, four, five, six, seven, or more 2'OMe nucleotides,
e.g., at least one, two, three, four, five, six, seven, or more
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In another
preferred embodiment, the second interfering RNA (e.g., siRNA) that
silences EBOV VP24 expression comprises: a sense strand comprising
nucleotides 1-19 of any one of the sense strand sequences set forth
in Table 3; and an antisense strand comprising nucleotides 1-19 of
any one of the antisense strand sequences set forth in Table 4. In
a particularly preferred embodiment, the second interfering RNA
(e.g., siRNA) that silences EBOV VP24 expression consists of: a
sense strand selected from any one of the sense strand sequences
set forth in Table 3; and an antisense strand selected from any one
of the antisense strand sequences set forth in Table 4. In
additional embodiments, the sense strand and/or antisense strand of
the second interfering RNA (e.g., siRNA) molecule may further
comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13
2'OMe-adenosine and/or 2'OMe-cytosine nucleotides.
[0133] In particular embodiments, the compositions of the present
invention comprise the second interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
3 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 4 (or nucleotides 1-19 thereof) in
combination with (1) the first interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
1 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 2 (or nucleotides 1-19 thereof), (2)
the third interfering RNA (e.g., siRNA) comprising any one of the
sense strand sequences set forth in Table 5 (or nucleotides 1-19
thereof) and any one of the antisense strand sequences set forth in
Table 6 (or nucleotides 1-19 thereof), or (3) both the first and
third interfering RNA (e.g., siRNA) described in (1) and (2).
[0134] In one particular embodiment, the second interfering RNA
(e.g., siRNA) that silences EBOV VP24 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00023 (SEQ ID NO: 68) 5'-UCCUCGACACGAAUGCAAAGU-3' (SEQ ID
NO: 17) 3'-CUAGGAGCUGUGCUUACGUUU-5',
("VP24-1160 mod"), wherein the bolded and underlined nucleotides
are 2'OMe nucleotides.
[0135] In some embodiments, the third interfering RNA (e.g., siRNA)
further comprises a sense strand comprising the following sequence:
5'-GCAACUCAUUGGACAUCAU-3' (SEQ ID NO:69). In some aspects of these
embodiments, the third interfering RNA (e.g., siRNA) comprises at
least one 2'OMe nucleotide, e.g., at least one 2'OMe-guanosine
and/or 2'OMe-uridine nucleotide. In certain instances, the third
interfering RNA comprises an antisense strand comprising at least
one, at least two, at least three, at least four, at least five, at
least six, at least seven, or more 2'OMe nucleotides, e.g.,
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In certain other
instances, the third interfering RNA comprises a sense strand
comprising at least one, at least two, at least three, at least
four, at least five, at least six, at least seven, or more 2'OMe
nucleotides, e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides. In further instances, the antisense strand and/or
sense strand may further comprise at least one, at least two, at
least three, at least four, at least five, at least six, at least
seven, or more 2'OMe-adenosine and/or 2'OMe-cytosine
nucleotides.
[0136] In particular embodiments, from about 20%-40%, 25%-40%,
30%-40%, 20%-35%, 25%-35%, 20%-30%, 25%-30%, 26%-34%, 27%-33%,
28%-32%, or about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%,
30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40% of the
nucleotides in the double-stranded region of the third interfering
RNA (e.g., siRNA) comprise modified nucleotides such as, e.g.,
2'OMe nucleotides (e.g., 2'OMe-guanosine and/or 2'OMe-uridine
nucleotides).
[0137] In certain embodiments, the third interfering RNA (e.g.,
siRNA) of the invention comprises a 3' overhang in one or both
strands of the interfering RNA. In one particular embodiment, the
antisense strand comprises a 5'-dTdT-3' (i.e., 5'-TT-3') overhang
or a 5'-UA-3' overhang and the sense strand comprises a 5'-dTdT-3'
(i.e., 5'-TT-3') overhang or a 5'-UC-3' overhang. In certain
instances, the 3' overhangs on one or both strands of the
interfering RNA (e.g., siRNA) comprise at least one 2'OMe
nucleotide, e.g., at least one 2'OMe-guanosine and/or 2'OMe-uridine
nucleotide. In other embodiments, the 3' overhangs on one or both
strands of the interfering RNA (e.g., siRNA) comprise 1-4
deoxythymidine (dT) nucleotides, 1-4 modified and/or unmodified
uridine (U) ribonucleotides, or 1-2 additional ribonucleotides
having complementarity to the target sequence or the complementary
strand thereof.
[0138] In some embodiments, the third interfering RNA (e.g., siRNA)
that silences EBOV VP35 expression comprises one of the following
sense strand sequences set forth in Table 5, wherein the underlined
nucleotides are 2'OMe nucleotides.
TABLE-US-00024 TABLE 5 (SEQ ID NOS: 25-27) Name Sense Strand
Sequence S-1 5'-GCAACUCAUUGGACAUCAUUC-3' S-2
5'-GCAACUCAUUGGACAUCAUUC-3' S-3 5'-GCAACUCAUUGGACAUCAUUC-3'
[0139] In other embodiments, the third interfering RNA (e.g.,
siRNA) that silences EBOV VP35 expression comprises one of the
following antisense strand sequences set forth in Table 6, wherein
the underlined nucleotides are 2'OMe nucleotides.
TABLE-US-00025 TABLE 6 (SEQ ID NOS: 28-32) Name Antisense Strand
Sequence AS-1 5'-AUGAUGUCCAAUGAGUUGCUA-3' AS-2
5'-AUGAUGUCCAAUGAGUUGCUA-3' AS-3 5'-AUGAUGUCCAAUGAGUUGCUA-3' AS-4
5'-AUGAUGUCCAAUGAGUUGCUA-3' AS-5 5'-AUGAUGUCCAAUGAGUUGCUA-3'
[0140] In one preferred embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression comprises: an
antisense strand comprising the sequence 5'-AUGAUGUCCAAUGAGUUGC-3'
(SEQ ID NO:70) and at least one, two, three, four, five, six,
seven, or more 2'OMe nucleotides, e.g., at least one, two, three,
four, five, six, seven, or more 2'OMe-guanosine and/or
2'OMe-uridine nucleotides; and a sense strand comprising the
sequence 5'-GCAACUCAUUGGACAUCAU-3' (SEQ ID NO:71) and at least one,
two, three, four, five, six, seven, or more 2'OMe nucleotides,
e.g., at least one, two, three, four, five, six, seven, or more
2'OMe-guanosine and/or 2'OMe-uridine nucleotides. In another
preferred embodiment, the third interfering RNA (e.g., siRNA) that
silences EBOV VP35 expression comprises: a sense strand comprising
nucleotides 1-19 of any one of S-1 to S-3 set forth in Table 5; and
an antisense strand comprising nucleotides 1-19 of any one of AS-1
to AS-5 set forth in Table 6. In a particularly preferred
embodiment, the third interfering RNA (e.g., siRNA) that silences
EBOV VP35 expression consists of: a sense strand selected from any
one of S-1 to S-3 set forth in Table 5; and an antisense strand
selected from any one of AS-1 to AS-5 set forth in Table 6. In
additional embodiments, the sense strand and/or antisense strand of
the third interfering RNA (e.g., siRNA) may further comprise at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 2'OMe-adenosine and/or
2'OMe-cytosine nucleotides.
[0141] In particular embodiments, the compositions of the present
invention comprise the third interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
5 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 6 (or nucleotides 1-19 thereof) in
combination with (1) the first interfering RNA (e.g., siRNA)
comprising any one of the sense strand sequences set forth in Table
1 (or nucleotides 1-19 thereof) and any one of the antisense strand
sequences set forth in Table 2 (or nucleotides 1-19 thereof), (2)
the second interfering RNA (e.g., siRNA) comprising any one of the
sense strand sequences set forth in Table 3 (or nucleotides 1-19
thereof) and any one of the antisense strand sequences set forth in
Table 4 (or nucleotides 1-19 thereof), or (3) both the first and
second interfering RNA (e.g., siRNA) molecules described in (1) and
(2).
[0142] In one particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00026 (SEQ ID NO: 25) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 28) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-1+AS-1" or "VP35-855 S1/AS1"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0143] In another particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00027 (SEQ ID NO: 25) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 29) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-1+AS-2" or "VP35-855 S1/AS2"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0144] In yet another particular embodiment, the third interfering
RNA (e.g., siRNA) that silences EBOV VP35 expression consists of
the following sense and antisense strand sequences:
TABLE-US-00028 (SEQ ID NO: 25) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 30) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-1+AS-3" or "VP35-855 S1/AS3"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0145] In still yet another particular embodiment, the third
interfering RNA (e.g., siRNA) that silences EBOV VP35 expression
consists of the following sense and antisense strand sequences:
TABLE-US-00029 (SEQ ID NO: 25) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 31) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-1+AS-4" or "VP35-855 S1/AS4"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0146] In another particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00030 (SEQ ID NO: 25) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 32) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-1+AS-5" or "VP35-855 S1/AS5"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0147] In yet another particular embodiment, the third interfering
RNA (e.g., siRNA) that silences EBOV VP35 expression consists of
the following sense and antisense strand sequences:
TABLE-US-00031 (SEQ ID NO: 26) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 28) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-2+AS-1" or "VP35-855 S2/AS1"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0148] In still yet another particular embodiment, the third
interfering RNA (e.g., siRNA) that silences EBOV VP35 expression
consists of the following sense and antisense strand sequences:
TABLE-US-00032 (SEQ ID NO: 26) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 29) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-2+AS-2" or "VP35-855 S2/AS2"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0149] In another particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00033 (SEQ ID NO: 26) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 30) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-2+AS-3" or "VP35-855 S2/AS3"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0150] In yet another particular embodiment, the third interfering
RNA (e.g., siRNA) that silences EBOV VP35 expression consists of
the following sense and antisense strand sequences:
TABLE-US-00034 (SEQ ID NO: 26) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 31) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-2+AS-4" or "VP35-855 S2/AS4"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0151] In still yet another particular embodiment, the third
interfering RNA (e.g., siRNA) that silences EBOV VP35 expression
consists of the following sense and antisense strand sequences:
TABLE-US-00035 (SEQ ID NO: 26) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 32) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-2+AS-5" or "VP35-855 S2/AS5"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0152] In another particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00036 (SEQ ID NO: 27) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 28) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-3+AS-1" or "VP35-855 S3/AS1"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0153] In yet another particular embodiment, the third interfering
RNA (e.g., siRNA) that silences EBOV VP35 expression consists of
the following sense and antisense strand sequences:
TABLE-US-00037 (SEQ ID NO: 27) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 29) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-3+AS-2" or "VP35-855 S3/AS2"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0154] In still yet another particular embodiment, the third
interfering RNA (e.g., siRNA) that silences EBOV VP35 expression
consists of the following sense and antisense strand sequences:
TABLE-US-00038 (SEQ ID NO: 27) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 30) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-3+AS-3" or "VP35-855 S3/AS3"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0155] In another particular embodiment, the third interfering RNA
(e.g., siRNA) that silences EBOV VP35 expression consists of the
following sense and antisense strand sequences:
TABLE-US-00039 (SEQ ID NO: 27) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 31) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-3+AS-4" or "VP35-855 S3/AS4"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0156] In yet another particular embodiment, the third interfering
RNA (e.g., siRNA) that silences EBOV VP35 expression consists of
the following sense and antisense strand sequences:
TABLE-US-00040 (SEQ ID NO: 27) 5'-GCAACUCAUUGGACAUCAUUC-3' (SEQ ID
NO: 32) 3'-AUCGUUGAGUAACCUGUAGUA-5',
("S-3+AS-5" or "VP35-855 S3/AS5"), wherein the bolded and
underlined nucleotides are 2'OMe nucleotides.
[0157] In particular embodiments, the present invention provides a
composition comprising a cocktail (e.g., at least two, three, four,
five, six, seven, eight, nine, ten, or more) of siRNAs comprising
different double-stranded siRNA sequences based upon mix-and-match
annealing of the modified siRNA sequences set forth in Tables 1-6
(e.g., mix-and-match annealing of sequences in Tables 1 and 2,
mix-and-match annealing of sequences in Tables 3 and 4; and/or
mix-and-match annealing of sequences in Tables 5 and 6). In some
embodiments, the present invention provides a composition
comprising one of the double-stranded EK-1 siRNAs set forth in
Table 11 in combination with one of the double-stranded VP35-855
siRNAs set forth in Table 12. In one aspect of this embodiment, the
composition further comprises a double-stranded VP24-1160 siRNA
comprising a sense strand sequence set forth in Table 3 and an
antisense strand sequence set forth in Table 4.
[0158] In other embodiments, the present invention provides a
composition comprising at least one or a cocktail of at least two
siRNAs selected from unmodified and/or modified EK-1, VP24-1160,
and VP35-855 siRNAs. In certain instances, at least one, two, or
all three of these EK-1, VP24-1160, and VP35-855 siRNA sequences
are chemically modified (e.g., 2'OMe-modified). In preferred
embodiments, the present invention provides a composition
comprising a cocktail of at least two or all three of the siRNAs
selected from modified EK-1, VP24-1160, and VP35-855 siRNAs as
described herein.
[0159] The present invention also provides a pharmaceutical
composition comprising a cocktail of interfering RNA (e.g., siRNA)
molecules that target EBOV gene expression (e.g., silence two or
all three of L-pol, VP24, and VP35) and a pharmaceutically
acceptable carrier.
[0160] In another aspect, the present invention provides a nucleic
acid-lipid particle (e.g., SNALP) that targets EBOV gene
expression. The nucleic acid-lipid particle (e.g., SNALP) typically
comprises a cocktail of interfering RNA (e.g., siRNA) molecules
that silences multiple EBOV genes (e.g., silences two or all three
of the EBOV L-pol, VP24, and VP35 genes), a cationic lipid, and a
non-cationic lipid. In certain instances, the nucleic acid-lipid
particle (e.g., SNALP) further comprises a conjugated lipid that
inhibits aggregation of particles. Preferably, the nucleic
acid-lipid particle (e.g., SNALP) comprises a cocktail of
unmodified and/or modified interfering RNA (e.g., siRNA) molecules
that silences at least two, three, or more EBOV genes, a cationic
lipid, a non-cationic lipid, and a conjugated lipid that inhibits
aggregation of particles. In one particular embodiment, the nucleic
acid-lipid particle (e.g., SNALP) comprises a cocktail of any
combination of at least two or all three of the first, second, and
third interfering RNA (e.g., siRNA) described above, a cationic
lipid, a non-cationic lipid, and a conjugated lipid that inhibits
aggregation of particles. In preferred embodiments, the nucleic
acid-lipid particle (e.g., SNALP) comprises a cocktail of at least
two or all three interfering RNAs (e.g., siRNAs) selected from
modified EK-1, VP24-1160, and VP35-855 interfering RNAs (e.g.,
siRNAs).
[0161] In some embodiments, the interfering RNAs (e.g., siRNAs) of
the present invention are fully encapsulated in the nucleic
acid-lipid particle (e.g., SNALP). With respect to formulations
comprising an interfering RNA cocktail, the different types of
interfering RNA species present in the cocktail (e.g., interfering
RNA compounds with different sequences) may be co-encapsulated in
the same particle, or each type of interfering RNA species present
in the cocktail may be encapsulated in a separate particle. The
interfering RNA cocktail may be formulated in the particles
described herein using a mixture of two or more individual
interfering RNAs (each having a unique sequence) at identical,
similar, or different concentrations or molar ratios. In one
embodiment, a cocktail of interfering RNAs (corresponding to a
plurality of interfering RNAs with different sequences) is
formulated using identical, similar, or different concentrations or
molar ratios of each interfering RNA species, and the different
types of interfering RNAs are co-encapsulated in the same particle.
In another embodiment, each type of interfering RNA species present
in the cocktail is encapsulated in different particles at
identical, similar, or different interfering RNA concentrations or
molar ratios, and the particles thus formed (each containing a
different interfering RNA payload) are administered separately
(e.g., at different times in accordance with a therapeutic
regimen), or are combined and administered together as a single
unit dose (e.g., with a pharmaceutically acceptable carrier). In
one particular embodiment, a cocktail of two interfering RNAs
(e.g., siRNAs) may be formulated as a 1:1 mixture of each
interfering RNA species. In another particular embodiment, a
cocktail of three interfering RNAs (e.g., siRNAs) may be formulated
as a 1:1:1 mixture of each interfering RNA species. The particles
described herein are serum-stable, are resistant to nuclease
degradation, and are substantially non-toxic to mammals such as
humans.
[0162] The cationic lipid in the nucleic acid-lipid particles of
the present invention (e.g., SNALP) may comprise, e.g., one or more
cationic lipids of Formula I-XVI described herein or any other
cationic lipid species. In one particular embodiment, the cationic
lipid comprises 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA),
2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane
(DLin-K-C2-DMA),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
salts thereof, or a mixture thereof.
[0163] The non-cationic lipid in the nucleic acid-lipid particles
of the present invention (e.g., SNALP) may comprise, e.g., one or
more anionic lipids and/or neutral lipids. In some embodiments, the
non-cationic lipid comprises one of the following neutral lipid
components: (1) a mixture of a phospholipid and cholesterol or a
derivative thereof (2) cholesterol or a derivative thereof or (3) a
phospholipid. In certain preferred embodiments, the phospholipid
comprises dipalmitoylphosphatidylcholine (DPPC),
distearoylphosphatidylcholine (DSPC), or a mixture thereof. In a
particularly preferred embodiment, the non-cationic lipid is a
mixture of DPPC and cholesterol.
[0164] The lipid conjugate in the nucleic acid-lipid particles of
the invention (e.g., SNALP) inhibits aggregation of particles and
may comprise, e.g., one or more of the lipid conjugates described
herein. In one particular embodiment, the lipid conjugate comprises
a PEG-lipid conjugate. Examples of PEG-lipid conjugates include,
but are not limited to, PEG-DAG conjugates, PEG-DAA conjugates, and
mixtures thereof. In certain embodiments, the PEG-DAA conjugate in
the lipid particle may comprise a PEG-didecyloxypropyl (C.sub.10)
conjugate, a PEG-dilauryloxypropyl (C.sub.12) conjugate, a
PEG-dimyristyloxypropyl (C.sub.14) conjugate, a
PEG-dipalmityloxypropyl (C.sub.16) conjugate, a
PEG-distearyloxypropyl (C.sub.18) conjugate, or mixtures thereof.
In another embodiment, the lipid conjugate comprises a POZ-lipid
conjugate such as a POZ-DAA conjugate.
[0165] In some embodiments, the present invention provides nucleic
acid-lipid particles (e.g., SNALP) comprising: (a) a cocktail of
interfering RNAs (e.g., siRNAs) (e.g., two or three siRNAs each
independently targeting EBOV L-pol, VP24, or VP35); (b) one or more
cationic lipids (e.g., cationic lipids of Formula I-XVI) or salts
thereof comprising from about 50 mol % to about 85 mol % of the
total lipid present in the particle; (c) one or more non-cationic
lipids comprising from about 13 mol % to about 49.5 mol % of the
total lipid present in the particle; and (d) one or more conjugated
lipids that inhibit aggregation of particles comprising from about
0.5 mol % to about 2 mol % of the total lipid present in the
particle.
[0166] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) a cocktail of interfering RNAs (e.g.,
siRNAs) (e.g., two or three siRNAs each independently targeting
EBOV L-pol, VP24, or VP35); (b) a cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof comprising from about 52
mol % to about 62 mol % of the total lipid present in the particle;
(c) a mixture of a phospholipid and cholesterol or a derivative
thereof comprising from about 36 mol % to about 47 mol % of the
total lipid present in the particle; and (d) a PEG-lipid conjugate
comprising from about 1 mol % to about 2 mol % of the total lipid
present in the particle. This embodiment of nucleic acid-lipid
particle is generally referred to herein as the "1:57" formulation.
In one particular embodiment, the 1:57 formulation is a
four-component system comprising about 1.4 mol % PEG-lipid
conjugate (e.g., PEG2000-C-DMA), about 57.1 mol % cationic lipid
(e.g., cationic lipid of Formula I-XVI) or a salt thereof, about
7.1 mol % DPPC (or DSPC), and about 34.3 mol % cholesterol (or
derivative thereof).
[0167] In another aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) a cocktail of interfering RNAs (e.g.,
siRNAs) (e.g., two or three siRNAs each independently targeting
EBOV L-pol, VP24, or VP35); (b) a cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof comprising from about
56.5 mol % to about 66.5 mol % of the total lipid present in the
particle; (c) cholesterol or a derivative thereof comprising from
about 31.5 mol % to about 42.5 mol % of the total lipid present in
the particle; and (d) a PEG-lipid conjugate comprising from about 1
mol % to about 2 mol % of the total lipid present in the particle.
This embodiment of nucleic acid-lipid particle is generally
referred to herein as the "1:62" formulation. In one particular
embodiment, the 1:62 formulation is a three-component system which
is phospholipid-free and comprises about 1.5 mol % PEG-lipid
conjugate (e.g., PEG2000-C-DMA), about 61.5 mol % cationic lipid
(e.g., cationic lipid of Formula I-XVI) or a salt thereof, and
about 36.9 mol % cholesterol (or derivative thereof).
[0168] Additional embodiments related to the 1:57 and 1:62
formulations are described in PCT Publication No. WO 09/127060 and
U.S. application Ser. No. 12/794,701, filed Jun. 4, 2010, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes.
[0169] In other embodiments, the present invention provides nucleic
acid-lipid particles (e.g., SNALP) comprising: (a) a cocktail of
interfering RNAs (e.g., siRNAs) (e.g., two or three siRNAs each
independently targeting EBOV L-pol, VP24, or VP35); (b) one or more
cationic lipids (e.g., cationic lipids of Formula I-XVI) or salts
thereof comprising from about 2 mol % to about 50 mol % of the
total lipid present in the particle; (c) one or more non-cationic
lipids comprising from about 5 mol % to about 90 mol % of the total
lipid present in the particle; and (d) one or more conjugated
lipids that inhibit aggregation of particles comprising from about
0.5 mol % to about 20 mol % of the total lipid present in the
particle.
[0170] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) a cocktail of interfering RNAs (e.g.,
siRNAs) (e.g., two or three siRNAs each independently targeting
EBOV L-pol, VP24, or VP35); (b) a cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof comprising from about 30
mol % to about 50 mol % of the total lipid present in the particle;
(c) a mixture of a phospholipid and cholesterol or a derivative
thereof comprising from about 47 mol % to about 69 mol % of the
total lipid present in the particle; and (d) a PEG-lipid conjugate
comprising from about 1 mol % to about 3 mol % of the total lipid
present in the particle. This embodiment of nucleic acid-lipid
particle is generally referred to herein as the "2:40" formulation.
In one particular embodiment, the 2:40 formulation is a
four-component system which comprises about 2 mol % PEG-lipid
conjugate (e.g., PEG2000-C-DMA), about 40 mol % cationic lipid
(e.g., cationic lipid of Formula I-XVI) or a salt thereof, about 10
mol % DPPC (or DSPC), and about 48 mol % cholesterol (or derivative
thereof).
[0171] In further embodiments, the present invention provides
nucleic acid-lipid particles (e.g., SNALP) comprising: (a) a
cocktail of interfering RNAs (e.g., siRNAs) (e.g., two or three
siRNAs each independently targeting EBOV L-pol, VP24, or VP35); (b)
one or more cationic lipids (e.g., cationic lipids of Formula
I-XVI) or salts thereof comprising from about 50 mol % to about 65
mol % of the total lipid present in the particle; (c) one or more
non-cationic lipids comprising from about 25 mol % to about 45 mol
% of the total lipid present in the particle; and (d) one or more
conjugated lipids that inhibit aggregation of particles comprising
from about 5 mol % to about 10 mol % of the total lipid present in
the particle.
[0172] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) a cocktail of interfering RNAs (e.g.,
siRNAs) (e.g., two or three siRNAs each independently targeting
EBOV L-pol, VP24, or VP35); (b) a cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof comprising from about 50
mol % to about 60 mol % of the total lipid present in the particle;
(c) a mixture of a phospholipid and cholesterol or a derivative
thereof comprising from about 35 mol % to about 45 mol % of the
total lipid present in the particle; and (d) a PEG-lipid conjugate
comprising from about 5 mol % to about 10 mol % of the total lipid
present in the particle. This embodiment of nucleic acid-lipid
particle is generally referred to herein as the "7:54" formulation.
In certain instances, the non-cationic lipid mixture in the 7:54
formulation comprises: (i) a phospholipid of from about 5 mol % to
about 10 mol % of the total lipid present in the particle; and (ii)
cholesterol or a derivative thereof of from about 25 mol % to about
35 mol % of the total lipid present in the particle. In one
particular embodiment, the 7:54 formulation is a four-component
system comprising about 7 mol % PEG-lipid conjugate (e.g.,
PEG750-C-DMA), about 54 mol % cationic lipid (e.g., cationic lipid
of Formula I-XVI) or a salt thereof, about 7 mol % DPPC (or DSPC),
and about 32 mol % cholesterol (or derivative thereof).
[0173] In another aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) a cocktail of interfering RNAs (e.g.,
siRNAs) (e.g., two or three siRNAs each independently targeting
EBOV L-pol, VP24, or VP35); (b) a cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof comprising from about 55
mol % to about 65 mol % of the total lipid present in the particle;
(c) cholesterol or a derivative thereof comprising from about 30
mol % to about 40 mol % of the total lipid present in the particle;
and (d) a PEG-lipid conjugate comprising from about 5 mol % to
about 10 mol % of the total lipid present in the particle. This
embodiment of nucleic acid-lipid particle is generally referred to
herein as the "7:58" formulation. In one particular embodiment, the
7:58 formulation is a three-component system which is
phospholipid-free and comprises about 7 mol % PEG-lipid conjugate
(e.g., PEG750-C-DMA), about 58 mol % cationic lipid (e.g., cationic
lipid of Formula I-XVI) or a salt thereof, and about 35 mol %
cholesterol (or derivative thereof).
[0174] Additional embodiments related to the 7:54 and 7:58
formulations are described in U.S. application Ser. No. 12/828,189,
filed Jun. 30, 2010, the disclosure of which is herein incorporated
by reference in its entirety for all purposes.
[0175] The present invention also provides pharmaceutical
compositions comprising a nucleic acid-lipid particle such as a
SNALP and a pharmaceutically acceptable carrier.
[0176] The nucleic acid-lipid particles of the invention are useful
for the therapeutic delivery of interfering RNA (e.g., siRNA)
molecules that silence EBOV gene expression. In some embodiments, a
cocktail of interfering RNAs (e.g., siRNAs) (e.g., two or three
siRNAs each independently targeting EBOV L-pol, VP24, or VP35) are
formulated into nucleic acid-lipid particles, and the particles are
administered to a mammal (e.g., a human) requiring such treatment.
In certain instances, a therapeutically effective amount of the
nucleic acid-lipid particle can be administered to the mammal,
e.g., for treating, preventing, reducing the risk of developing,
and/or delaying the onset of EBOV infections caused by one or more
EBOV species such as Zaire EBOV.
[0177] In some embodiments, the interfering RNA (e.g., siRNA)
molecules described herein are used in methods for silencing EBOV
gene expression, e.g., in a cell such as a reticuloendothelial cell
(e.g., monocyte or macrophage), fibroblast cell, endothelial cell,
and/or platelet cell. In particular, it is an object of the present
invention to provide in vitro and in vivo methods for inactivating
EBOV and/or inhibiting the replication of EBOV to treat EBOV
infections in a mammal by downregulating or silencing the
transcription and/or translation of multiple (e.g., two, three,
four, five, or more) EBOV genes. In certain embodiments, the
present invention provides a method for introducing a cocktail of
interfering RNAs (e.g., siRNAs) (e.g., two or three siRNAs each
independently targeting EBOV L-pol, VP24, or VP35) capable of
silencing EBOV expression (e.g., viral RNA and/or protein levels)
into a cell by contacting the cell with a nucleic acid-lipid
particle described herein (e.g., SNALP). In one particular
embodiment, the cell is a reticuloendothelial cell (e.g., monocyte
or macrophage), fibroblast cell, endothelial cell, or platelet
cell. In another embodiment, the present invention provides a
method for the in vivo delivery of a cocktail of interfering RNAs
(e.g., siRNAs) (e.g., two or three siRNAs each independently
targeting EBOV L-pol, VP24, or VP35) to a cell, tissue, or organ
infected and/or susceptible of being infected with EBOV by
administering to a mammal (e.g., human) a nucleic acid-lipid
particle described herein (e.g., a SNALP formulation).
[0178] The nucleic acid-lipid particles of the invention (e.g.,
SNALP) are particularly useful for targeting cells (e.g.,
reticuloendothelial cells, fibroblast cells, endothelial cells,
and/or platelets cells), tissues, or organs infected and/or
susceptible of being infected with EBOV. Administration of the
nucleic acid-lipid particle can be by any route known in the art,
such as, e.g., oral, intranasal, intravenous, intraperitoneal,
intramuscular, intra-articular, intralesional, intratracheal,
subcutaneous, or intradermal. In particular embodiments, the
nucleic acid-lipid particles (e.g., SNALP) are administered
systemically, e.g., via enteral or parenteral routes of
administration.
[0179] In certain aspects, the present invention provides methods
for silencing EBOV gene expression in a mammal (e.g., human) in
need thereof, the method comprising administering to the mammal a
therapeutically effective amount of a nucleic acid-lipid particle
described herein (e.g., a SNALP formulation) comprising a cocktail
of interfering RNAs (e.g., siRNAs) (e.g., two or three siRNAs each
independently targeting the EBOV L-pol, VP24, or VP35 genes). In
some embodiments, administration of nucleic acid-lipid particles
comprising a cocktail of interfering RNAs (e.g., siRNAs) reduces
EBOV viral RNA levels by at least about 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or
100% (or any range therein) relative to EBOV viral RNA levels
detected in the absence of the interfering RNA (e.g., buffer
control or irrelevant non-EBOV targeting interfering RNA control).
In other embodiments, administration of nucleic acid-lipid
particles comprising one or more EBOV-targeting interfering RNAs
reduces EBOV viral RNA levels for at least about 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or
100 days or more (or any range therein) relative to a negative
control such as, e.g., a buffer control or an irrelevant non-EBOV
targeting interfering RNA control. In preferred embodiments, the
EBOV-targeting interfering RNA (e.g., siRNA) molecules comprise a
cocktail of at least two or all three interfering RNAs selected
from the modified EK-1, VP24-1160, and VP35-855 interfering RNAs
described herein.
[0180] In other aspects, the present invention provides methods for
treating, preventing, reducing the risk or likelihood of developing
(e.g., reducing the susceptibility to), delaying the onset of,
and/or ameliorating one or more symptoms associated with an EBOV
infection in a mammal (e.g., human) in need thereof, the method
comprising administering to the mammal a therapeutically effective
amount of a nucleic acid-lipid particle (e.g., a SNALP formulation)
comprising a cocktail of interfering RNAs (e.g., siRNAs) (e.g., two
or three siRNAs each independently targeting the EBOV L-pol, VP24,
or VP35 genes). In preferred embodiments, the EBOV-targeting
interfering RNAs (e.g., siRNAs) comprise a cocktail of at least two
or all three interfering RNAs selected from the modified EK-1,
VP24-1160, and VP35-855 interfering RNAs described herein.
[0181] In further aspects, the present invention provides methods
for treating, preventing, reducing the risk or likelihood of
developing (e.g., reducing the susceptibility to), delaying the
onset of, and/or ameliorating one or more symptoms associated with
hemorrhagic fever, the method comprising administering to the
mammal a therapeutically effective amount of a nucleic acid-lipid
particle (e.g., a SNALP formulation) comprising a cocktail of
interfering RNAs (e.g., siRNAs) (e.g., two or three siRNAs each
independently targeting the EBOV L-pol, VP24, or VP35 genes). In
preferred embodiments, the EBOV-targeting interfering RNAs (e.g.,
siRNAs) comprise a cocktail of at least two or all three
interfering RNAs selected from the modified EK-1, VP24-1160, and
VP35-855 interfering RNAs described herein.
[0182] In further aspects, the present invention provides a method
for inactivating EBOV and/or inhibiting the replication of EBOV in
a mammal (e.g., human) in need thereof (e.g., a mammal with an EBOV
infection), the method comprising administering to the mammal a
therapeutically effective amount of a nucleic acid-lipid particle
(e.g., a SNALP formulation) comprising a cocktail of interfering
RNAs (e.g., siRNAs) (e.g., two or three siRNAs each independently
targeting the EBOV L-pol, VP24, or VP35 genes). In some
embodiments, administration of nucleic acid-lipid particles (e.g.,
SNALP) comprising a cocktail of EBOV-targeting interfering RNAs
lowers, reduces, or decreases EBOV viral load or titer by at least
about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any range therein)
relative to the EBOV viral load or titer detected in the absence of
the interfering RNA (e.g., buffer control or irrelevant non-EBOV
targeting interfering RNA control). In preferred embodiments, the
EBOV-targeting interfering RNAs (e.g., siRNAs) comprise a cocktail
of at least two or all three interfering RNAs selected from the
modified EK-1, VP24-1160, and VP35-855 interfering RNAs described
herein.
[0183] In certain embodiments, the mammal has an EBOV infection,
e.g., a Zaire EBOV infection. In certain other embodiments,
silencing of EBOV sequences that encode genes associated with viral
infection and/or survival can conveniently be used in combination
with the administration of conventional agents used to treat or
ameliorate the viral condition or any of the symptoms associated
therewith.
[0184] Examples of anti-viral drugs include, but are not limited
to, abacavir, aciclovir, acyclovir, adefovir, amantadine,
amprenavir, arbidol, atazanavir, atripla, cidofovir, combivir,
darunavir, delavirdine, didanosine, docosanol, edoxudine,
efavirenz, emtricitabine, enfuvirtide, entecavir, entry inhibitors,
famciclovir, fixed dose combinations, fomivirsen, fosamprenavir,
foscarnet, fosfonet, fusion inhibitors, ganciclovir, ibacitabine,
imunovir, idoxuridine, imiquimod, indinavir, inosine, integrase
inhibitors, interferon type III (e.g., IFN-.lamda. molecules such
as IFN-.lamda.1, IFN-.lamda.2, and IFN-.lamda.3), interferon type
II (e.g., IFN-.gamma.), interferon type I (e.g., IFN-.alpha. such
as PEGylated IFN-.alpha., IFN-.beta., IFN-.kappa., IFN-.delta.,
IFN-.epsilon., IFN-.tau., IFN-.omega., and IFN-.zeta., interferon,
lamivudine, lopinavir, loviride, MK-0518, maraviroc, moroxydine,
nelfinavir, nevirapine, nexavir, nucleoside analogues, oseltamivir,
penciclovir, peramivir, pleconaril, podophyllotoxin, protease
inhibitors, reverse transcriptase inhibitors, ribavirin,
rimantadine, ritonavir, saquinavir, stavudine, synergistic
enhancers, tenofovir, tenofovir disoproxil, tipranavir,
trifluridine, trizivir, tromantadine, truvada, valaciclovir,
valganciclovir, vicriviroc, vidarabine, viramidine, zalcitabine,
zanamivir, zidovudine, pharmaceutically acceptable salts thereof,
stereoisomers thereof, derivatives thereof, analogs thereof, and
mixtures thereof.
[0185] As non-limiting examples, the dose of one or more nucleic
acid-lipid particles can be administered about 0.1, 0.2, 0.3, 0.4,
0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or about 1, 2, 3,
4, 5, 6, 7, 8, 9, or 10 weeks, or about 1, 2, 3, 4, 5, or 6 months,
or any interval thereof, after EBOV (e.g., Zaire EBOV) infection.
In one particular embodiment, more than one dose of nucleic
acid-lipid particles containing an siRNA cocktail can be
administered at different times following EBOV infection. In
certain instances, the EBOV-infected mammal can be treated with a
second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth,
or more dose of the same or different nucleic acid-lipid particles
containing an EBOV siRNA cocktail. In another embodiment, the
EBOV-infected mammal can be treated with a daily dose of the same
or different particles containing a cocktail of EBOV siRNA and
assessed for a reduction in EBOV viremia and/or severity of
clinical symptoms of EBOV infection. In some embodiments, a mammal
susceptible to being infected with EBOV may be pretreated with one
or more doses of nucleic acid-lipid particles containing an siRNA
cocktail described herein as a prophylactic measure for preventing
an EBOV infection.
IV. Therapeutic Nucleic Acids
[0186] The term "nucleic acid" includes any oligonucleotide or
polynucleotide, with fragments containing up to 60 nucleotides
generally termed oligonucleotides, and longer fragments termed
polynucleotides. In particular embodiments, oligonucletoides of the
invention are from about 15 to about 60 nucleotides in length. In
some embodiments, nucleic acid is associated with a carrier system
such as the lipid particles described herein. In certain
embodiments, the nucleic acid is fully encapsulated in the lipid
particle. Nucleic acid may be administered alone in the lipid
particles of the invention, or in combination (e.g.,
co-administered) with lipid particles comprising peptides,
polypeptides, or small molecules such as conventional drugs.
[0187] In the context of this invention, the terms "polynucleotide"
and "oligonucleotide" refer to a polymer or oligomer of nucleotide
or nucleoside monomers consisting of naturally-occurring bases,
sugars and intersugar (backbone) linkages. The terms
"polynucleotide" and "oligonucleotide" also include polymers or
oligomers comprising non-naturally occurring monomers, or portions
thereof, which function similarly. Such modified or substituted
oligonucleotides are often preferred over native forms because of
properties such as, for example, enhanced cellular uptake, reduced
immunogenicity, and increased stability in the presence of
nucleases.
[0188] Oligonucleotides are generally classified as
deoxyribooligonucleotides or ribooligonucleotides. A
deoxyribooligonucleotide consists of a 5-carbon sugar called
deoxyribose joined covalently to phosphate at the 5' and 3' carbons
of this sugar to form an alternating, unbranched polymer. A
ribooligonucleotide consists of a similar repeating structure where
the 5-carbon sugar is ribose.
[0189] The nucleic acid according to this invention includes any
form of nucleic acid that is known. The nucleic acids used herein
can be single-stranded DNA or RNA, or double-stranded DNA or RNA,
or DNA-RNA hybrids. Examples of double-stranded DNA are described
herein and include, e.g., structural genes, genes including control
and termination regions, and self-replicating systems such as viral
or plasmid DNA. Examples of double-stranded RNA are described
herein and include, e.g., siRNA and other RNAi agents such as
Dicer-substrate dsRNA, shRNA, aiRNA, and pre-miRNA. Single-stranded
nucleic acids include, e.g., antisense oligonucleotides, ribozymes,
mature miRNA, and triplex-forming oligonucleotides. In further
embodiments, the nucleic acids are double-stranded DNA. Examples of
double-stranded DNA include, e.g., DNA-DNA hybrids comprising a DNA
sense strand and a DNA antisense strand as described in PCT
Publication No. WO 2004/104199, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0190] Nucleic acids of the invention may be of various lengths,
generally dependent upon the particular form of nucleic acid. For
example, in particular embodiments, plasmids or genes may be from
about 1,000 to about 100,000 nucleotide residues in length. In
particular embodiments, oligonucleotides may range from about 10 to
about 100 nucleotides in length. In various related embodiments,
oligonucleotides, both single-stranded, double-stranded, and
triple-stranded, may range in length from about 10 to about 60
nucleotides, from about 15 to about 60 nucleotides, from about 20
to about 50 nucleotides, from about 15 to about 30 nucleotides, or
from about 20 to about 30 nucleotides in length.
[0191] In particular embodiments, an oligonucleotide (or a strand
thereof) of the invention specifically hybridizes to or is
complementary to a target polynucleotide sequence. The terms
"specifically hybridizable" and "complementary" as used herein
indicate a sufficient degree of complementarity such that stable
and specific binding occurs between the DNA or RNA target and the
oligonucleotide. It is understood that an oligonucleotide need not
be 100% complementary to its target nucleic acid sequence to be
specifically hybridizable. In preferred embodiments, an
oligonucleotide is specifically hybridizable when binding of the
oligonucleotide to the target sequence interferes with the normal
function of the target sequence to cause a loss of utility or
expression therefrom, and there is a sufficient degree of
complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which
specific binding is desired, i.e., under physiological conditions
in the case of in vivo assays or therapeutic treatment, or, in the
case of in vitro assays, under conditions in which the assays are
conducted. Thus, the oligonucleotide may include 1, 2, 3, or more
base substitutions as compared to the region of a gene or mRNA
sequence that it is targeting or to which it specifically
hybridizes.
[0192] A. siRNA
[0193] The unmodified and modified siRNA molecules of the invention
are capable of silencing EBOV gene expression, e.g., to inhibit
EBOV replication and/or to inactivate EBOV. Each strand of the
siRNA duplex is typically about 15 to about 60 nucleotides in
length, preferably about 15 to about 30 nucleotides in length. In
certain embodiments, the siRNA comprises at least one modified
nucleotide. The modified siRNA is generally less immunostimulatory
than a corresponding unmodified siRNA sequence and retains RNAi
activity against the target gene of interest. In some embodiments,
the modified siRNA contains at least one 2'OMe purine or pyrimidine
nucleotide such as a 2'OMe-guanosine, 2'OMe-uridine,
2'OMe-adenosine, and/or 2'OMe-cytosine nucleotide. The modified
nucleotides can be present in one strand (i.e., sense or antisense)
or both strands of the siRNA. In some preferred embodiments, one or
more of the uridine and/or guanosine nucleotides are modified
(e.g., 2'OMe-modified) in one strand (i.e., sense or antisense) or
both strands of the siRNA. In these embodiments, the modified siRNA
can further comprise one or more modified (e.g., 2'OMe-modified)
adenosine and/or modified (e.g., 2'OMe-modified) cytosine
nucleotides. In other preferred embodiments, only uridine and/or
guanosine nucleotides are modified (e.g., 2'OMe-modified) in one
strand (i.e., sense or antisense) or both strands of the siRNA. The
siRNA sequences may have overhangs (e.g., 3' or 5' overhangs as
described in Elbashir et al., Genes Dev., 15:188 (2001) or Nykanen
et al., Cell, 107:309 (2001)), or may lack overhangs (i.e., have
blunt ends).
[0194] In particular embodiments, the selective incorporation of
modified nucleotides such as 2'OMe uridine and/or guanosine
nucleotides into the double-stranded region of either or both
strands of the siRNA reduces or completely abrogates the immune
response to that siRNA molecule. In certain instances, the
immunostimulatory properties of specific siRNA sequences and their
ability to silence gene expression can be balanced or optimized by
the introduction of minimal and selective 2'OMe modifications
within the double-stranded region of the siRNA duplex. This can be
achieved at therapeutically viable siRNA doses without cytokine
induction, toxicity, and off-target effects associated with the use
of unmodified siRNA.
[0195] The modified siRNA generally comprises from about 1% to
about 100% (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) modified nucleotides in
the double-stranded region of the siRNA duplex. In certain
embodiments, one, two, three, four, five, six, seven, eight, nine,
ten, or more of the nucleotides in the double-stranded region of
the siRNA comprise modified nucleotides. In certain other
embodiments, some or all of the modified nucleotides in the
double-stranded region of the siRNA are 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, or more nucleotides apart from each other. In one preferred
embodiment, none of the modified nucleotides in the double-stranded
region of the siRNA are adjacent to each other (e.g., there is a
gap of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unmodified
nucleotides between each modified nucleotide).
[0196] In some embodiments, less than about 50% (e.g., less than
about 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%,
37%, or 36%, preferably less than about 35%, 34%, 33%, 32%, 31%, or
30%) of the nucleotides in the double-stranded region of the siRNA
comprise modified (e.g., 2'OMe) nucleotides. In one aspect of these
embodiments, less than about 50% of the uridine and/or guanosine
nucleotides in the double-stranded region of one or both strands of
the siRNA are selectively (e.g., only) modified. In another aspect
of these embodiments, less than about 50% of the nucleotides in the
double-stranded region of the siRNA comprise 2'OMe nucleotides,
wherein the siRNA comprises 2'OMe nucleotides in both strands of
the siRNA, wherein the siRNA comprises at least one 2'OMe-guanosine
nucleotide and at least one 2'OMe-uridine nucleotide, and wherein
2'OMe-guanosine nucleotides and 2'OMe-uridine nucleotides are the
only 2'OMe nucleotides present in the double-stranded region. In
yet another aspect of these embodiments, less than about 50% of the
nucleotides in the double-stranded region of the siRNA comprise
2'OMe nucleotides, wherein the siRNA comprises 2'OMe nucleotides in
both strands of the modified siRNA, wherein the siRNA comprises
2'OMe nucleotides selected from the group consisting of
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides,
2'OMe-adenosine nucleotides, and mixtures thereof, and wherein the
siRNA does not comprise 2'OMe-cytosine nucleotides in the
double-stranded region. In a further aspect of these embodiments,
less than about 50% of the nucleotides in the double-stranded
region of the siRNA comprise 2'OMe nucleotides, wherein the siRNA
comprises 2'OMe nucleotides in both strands of the siRNA, wherein
the siRNA comprises at least one 2'OMe-guanosine nucleotide and at
least one 2'OMe-uridine nucleotide, and wherein the siRNA does not
comprise 2'OMe-cytosine nucleotides in the double-stranded region.
In another aspect of these embodiments, less than about 50% of the
nucleotides in the double-stranded region of the siRNA comprise
2'OMe nucleotides, wherein the siRNA comprises 2'OMe nucleotides in
both strands of the modified siRNA, wherein the siRNA comprises
2'OMe nucleotides selected from the group consisting of
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides,
2'OMe-adenosine nucleotides, and mixtures thereof, and wherein the
2'OMe nucleotides in the double-stranded region are not adjacent to
each other.
[0197] In other embodiments, from about 1% to about 50% (e.g., from
about 5%-50%, 10%-50%, 15%-50%, 20%-50%, 25%-50%, 30%-50%, 35%-50%,
40%-50%, 45%-50%, 5%-45%, 10%-45%, 15%-45%, 20%-45%, 25%-45%,
30%-45%, 35%-45%, 40%-45%, 5%-40%, 10%-40%, 15%-40%, 20%-40%,
25%-40%, 25%-39%, 25%-38%, 25%-37%, 25%-36%, 26%-39%, 26%-38%,
26%-37%, 26%-36%, 27%-39%, 27%-38%, 27%-37%, 27%-36%, 28%-39%,
28%-38%, 28%-37%, 28%-36%, 29%-39%, 29%-38%, 29%-37%, 29%-36%,
30%-40%, 30%-39%, 30%-38%, 30%-37%, 30%-36%, 31%-39%, 31%-38%,
31%-37%, 31%-36%, 32%-39%, 32%-38%, 32%-37%, 32%-36%, 33%-39%,
33%-38%, 33%-37%, 33%-36%, 34%-39%, 34%-38%, 34%-37%, 34%-36%,
35%-40%, 5%-35%, 10%-35%, 15%-35%, 20%-35%, 21%-35%, 22%-35%,
23%-35%, 24%-35%, 25%-35%, 26%-35%, 27%-35%, 28%-35%, 29%-35%,
30%-35%, 31%-35%, 32%-35%, 33%-35%, 34%-35%, 30%-34%, 31%-34%,
32%-34%, 33%-34%, 30%-33%, 31%-33%, 32%-33%, 30%-32%, 31%-32%,
25%-34%, 25%-33%, 25%-32%, 25%-31%, 26%-34%, 26%-33%, 26%-32%,
26%-31%, 27%-34%, 27%-33%, 27%-32%, 27%-31%, 28%-34%, 28%-33%,
28%-32%, 28%-31%, 29%-34%, 29%-33%, 29%-32%, 29%-31%, 5%-30%,
10%-30%, 15%-30%, 20%-34%, 20%-33%, 20%-32%, 20%-31%, 20%-30%,
21%-30%, 22%-30%, 23%-30%, 24%-30%, 25%-30%, 25%-29%, 25%-28%,
25%-27%, 25%-26%, 26%-30%, 26%-29%, 26%-28%, 26%-27%, 27%-30%,
27%-29%, 27%-28%, 28%-30%, 28%-29%, 29%-30%, 5%-25%, 10%-25%,
15%-25%, 20%-29%, 20%-28%, 20%-27%, 20%-26%, 20%-25%, 5%-20%,
10%-20%, 15%-20%, 5%-15%, 10%-15%, or 5%-10%) of the nucleotides in
the double-stranded region of the siRNA comprise modified
nucleotides. In one aspect of these embodiments, from about 1% to
about 50% of the uridine and/or guanosine nucleotides in the
double-stranded region of one or both strands of the siRNA are
selectively (e.g., only) modified. In another aspect of these
embodiments, from about 1% to about 50% of the nucleotides in the
double-stranded region of the siRNA comprise 2'OMe nucleotides,
wherein the siRNA comprises 2'OMe nucleotides in both strands of
the siRNA, wherein the siRNA comprises at least one 2'OMe-guanosine
nucleotide and at least one 2'OMe-uridine nucleotide, and wherein
2'OMe-guanosine nucleotides and 2'OMe-uridine nucleotides are the
only 2'OMe nucleotides present in the double-stranded region. In
yet another aspect of these embodiments, from about 1% to about 50%
of the nucleotides in the double-stranded region of the siRNA
comprise 2'OMe nucleotides, wherein the siRNA comprises 2'OMe
nucleotides in both strands of the modified siRNA, wherein the
siRNA comprises 2'OMe nucleotides selected from the group
consisting of 2'OMe-guanosine nucleotides, 2'OMe-uridine
nucleotides, 2'OMe-adenosine nucleotides, and mixtures thereof, and
wherein the siRNA does not comprise 2'OMe-cytosine nucleotides in
the double-stranded region. In a further aspect of these
embodiments, from about 1% to about 50% of the nucleotides in the
double-stranded region of the siRNA comprise 2'OMe nucleotides,
wherein the siRNA comprises 2'OMe nucleotides in both strands of
the siRNA, wherein the siRNA comprises at least one 2'OMe-guanosine
nucleotide and at least one 2'OMe-uridine nucleotide, and wherein
the siRNA does not comprise 2'OMe-cytosine nucleotides in the
double-stranded region. In another aspect of these embodiments,
from about 1% to about 50% of the nucleotides in the
double-stranded region of the siRNA comprise 2'OMe nucleotides,
wherein the siRNA comprises 2'OMe nucleotides in both strands of
the modified siRNA, wherein the siRNA comprises 2'OMe nucleotides
selected from the group consisting of 2'OMe-guanosine nucleotides,
2'OMe-uridine nucleotides, 2'OMe-adenosine nucleotides, and
mixtures thereof, and wherein the 2'OMe nucleotides in the
double-stranded region are not adjacent to each other.
[0198] In certain embodiments, the siRNA molecules of the present
invention comprise an asymmetric siRNA duplex as described in PCT
Publication No. WO 2004/078941, which comprises a double-stranded
region consisting of a DNA sense strand and an RNA antisense strand
(e.g., a DNA-RNA hybrid), wherein a blocking agent is located on
the siRNA duplex. In some instances, the asymmetric siRNA duplex
can be chemically modified as described herein. Other non-limiting
examples of asymmetric siRNA duplexes are described in PCT
Publication No. WO 2006/074108, which discloses self-protected
oligonucleotides comprising a region having a sequence
complementary to one, two, three, or more same or different target
mRNA sequences (e.g., multivalent siRNAs) and one or more
self-complementary regions. Yet other non-limiting examples of
asymmetric siRNA duplexes are described in PCT Publication No. WO
2009/076321, which discloses self-forming asymmetric precursor
polynucleotides comprising a targeting region comprising a
polynucleotide sequence complementary to a region of one, two,
three, or more same or different target mRNA sequences (e.g.,
multivalent siRNAs); a first self-complementary region; and a
second self-complementary region, wherein the first and second
self-complementary regions are located one at each end of the
targeting region and both self-complementary regions form stem-loop
structures, wherein the first self-complementary region is capable
of being cleaved by a RNase III endoribonuclease that is not a
class IV DICER endoribonuclease, and wherein both
self-complementary regions comprise a nucleotide sequence that is
complementary to a region of the target gene sequence, but wherein
a portion of the target sequence present in the targeting region
does not have a complementary sequence in either of the
self-complementary regions. The disclosures of each of the above
patent documents are herein incorporated by reference in their
entirety for all purposes.
[0199] Additional ranges, percentages, and patterns of
modifications that may be introduced into siRNA are described in
U.S. Patent Publication No. 20070135372, the disclosure of which is
herein incorporated by reference in its entirety for all
purposes.
[0200] 1. Selection of siRNA Sequences
[0201] Suitable siRNA sequences can be identified using any means
known in the art. Typically, the methods described in Elbashir et
al., Nature, 411:494-498 (2001) and Elbashir et al., EMBO J.,
20:6877-6888 (2001) are combined with rational design rules set
forth in Reynolds et al., Nature Biotech., 22(3):326-330
(2004).
[0202] As a non-limiting example, the nucleotide sequence 3' of the
AUG start codon of a transcript from the target gene of interest
may be scanned for dinucleotide sequences (e.g., AA, NA, CC, GG, or
UU, wherein N=C, G, or U) (see, e.g., Elbashir et al., EMBO J.
20:6877-6888 (2001)). The nucleotides immediately 3' to the
dinucleotide sequences are identified as potential siRNA sequences
(i.e., a target sequence or a sense strand sequence). Typically,
the 19, 21, 23, 25, 27, 29, 31, 33, 35, or more nucleotides
immediately 3' to the dinucleotide sequences are identified as
potential siRNA sequences. In some embodiments, the dinucleotide
sequence is an AA or NA sequence and the 19 nucleotides immediately
3' to the AA or NA dinucleotide are identified as potential siRNA
sequences. siRNA sequences are usually spaced at different
positions along the length of the target gene. To further enhance
silencing efficiency of the siRNA sequences, potential siRNA
sequences may be analyzed to identify sites that do not contain
regions of homology to other coding sequences, e.g., in the target
cell or organism. For example, a suitable siRNA sequence of about
21 base pairs typically will not have more than 16-17 contiguous
base pairs of homology to coding sequences in the target cell or
organism. If the siRNA sequences are to be expressed from an RNA
Pol III promoter, siRNA sequences lacking more than 4 contiguous
A's or T's are selected.
[0203] Once a potential siRNA sequence has been identified, a
complementary sequence (i.e., an antisense strand sequence) can be
designed. A potential siRNA sequence can also be analyzed using a
variety of criteria known in the art. For example, to enhance their
silencing efficiency, the siRNA sequences may be analyzed by a
rational design algorithm to identify sequences that have one or
more of the following features: (1) G/C content of about 25% to
about 60% G/C; (2) at least 3 A/Us at positions 15-19 of the sense
strand; (3) no internal repeats; (4) an A at position 19 of the
sense strand; (5) an A at position 3 of the sense strand; (6) a U
at position 10 of the sense strand; (7) no G/C at position 19 of
the sense strand; and (8) no G at position 13 of the sense strand.
siRNA design tools that incorporate algorithms that assign suitable
values of each of these features and are useful for selection of
siRNA can be found at, e.g.,
http://ihome.ust.hk/.about.bokcmho/siRNA/siRNA.html. One of skill
in the art will appreciate that sequences with one or more of the
foregoing characteristics may be selected for further analysis and
testing as potential siRNA sequences.
[0204] Additionally, potential siRNA sequences with one or more of
the following criteria can often be eliminated as siRNA: (1)
sequences comprising a stretch of 4 or more of the same base in a
row; (2) sequences comprising homopolymers of Gs (i.e., to reduce
possible non-specific effects due to structural characteristics of
these polymers; (3) sequences comprising triple base motifs (e.g.,
GGG, CCC, AAA, or TTT); (4) sequences comprising stretches of 7 or
more G/Cs in a row; and (5) sequences comprising direct repeats of
4 or more bases within the candidates resulting in internal
fold-back structures. However, one of skill in the art will
appreciate that sequences with one or more of the foregoing
characteristics may still be selected for further analysis and
testing as potential siRNA sequences.
[0205] In some embodiments, potential siRNA sequences may be
further analyzed based on siRNA duplex asymmetry as described in,
e.g., Khvorova et al., Cell, 115:209-216 (2003); and Schwarz et
al., Cell, 115:199-208 (2003). In other embodiments, potential
siRNA sequences may be further analyzed based on secondary
structure at the target site as described in, e.g., Luo et al.,
Biophys. Res. Commun., 318:303-310 (2004). For example, secondary
structure at the target site can be modeled using the Mfold
algorithm (available at http://mfold.burnetedu.au/rna_form) to
select siRNA sequences which favor accessibility at the target site
where less secondary structure in the form of base-pairing and
stem-loops is present.
[0206] Once a potential siRNA sequence has been identified, the
sequence can be analyzed for the presence of any immunostimulatory
properties, e.g., using an in vitro cytokine assay or an in vivo
animal model. Motifs in the sense and/or antisense strand of the
siRNA sequence such as GU-rich motifs (e.g., 5'-GU-3', 5'-UGU-3',
5'-GUGU-3', 5'-UGUGU-3', etc.) can also provide an indication of
whether the sequence may be immunostimulatory. Once an siRNA
molecule is found to be immunostimulatory, it can then be modified
to decrease its immunostimulatory properties as described herein.
As a non-limiting example, an siRNA sequence can be contacted with
a mammalian responder cell under conditions such that the cell
produces a detectable immune response to determine whether the
siRNA is an immunostimulatory or a non-immunostimulatory siRNA. The
mammalian responder cell may be from a naive mammal (i.e., a mammal
that has not previously been in contact with the gene product of
the siRNA sequence). The mammalian responder cell may be, e.g., a
peripheral blood mononuclear cell (PBMC), a macrophage, and the
like. The detectable immune response may comprise production of a
cytokine or growth factor such as, e.g., TNF-.alpha., IFN-.alpha.,
IFN-.beta., IFN-.gamma., IL-6, IL-8, IL-12, or a combination
thereof. An siRNA molecule identified as being immunostimulatory
can then be modified to decrease its immunostimulatory properties
by replacing at least one of the nucleotides on the sense and/or
antisense strand with modified nucleotides. For example, less than
about 30% (e.g., less than about 30%, 25%, 20%, 15%, 10%, or 5%) of
the nucleotides in the double-stranded region of the siRNA duplex
can be replaced with modified nucleotides such as 2'OMe
nucleotides. The modified siRNA can then be contacted with a
mammalian responder cell as described above to confirm that its
immunostimulatory properties have been reduced or abrogated.
[0207] Suitable in vitro assays for detecting an immune response
include, but are not limited to, the double monoclonal antibody
sandwich immunoassay technique of David et al. (U.S. Pat. No.
4,376,110); monoclonal-polyclonal antibody sandwich assays (Wide et
al., in Kirkham and Hunter, eds., Radioimmunoassay Methods, E. and
S. Livingstone, Edinburgh (1970)); the "Western blot" method of
Gordon et al. (U.S. Pat. No. 4,452,901); immunoprecipitation of
labeled ligand (Brown et al., J. Biol. Chem., 255:4980-4983
(1980)); enzyme-linked immunosorbent assays (ELISA) as described,
for example, by Raines et al., J. Biol. Chem., 257:5154-5160
(1982); immunocytochemical techniques, including the use of
fluorochromes (Brooks et al., Clin. Exp. Immunol., 39:477 (1980));
and neutralization of activity (Bowen-Pope et al., Proc. Natl.
Acad. Sci. USA, 81:2396-2400 (1984)). In addition to the
immunoassays described above, a number of other immunoassays are
available, including those described in U.S. Pat. Nos. 3,817,827;
3,850,752; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074;
and 4,098,876. The disclosures of these references are herein
incorporated by reference in their entirety for all purposes.
[0208] A non-limiting example of an in vivo model for detecting an
immune response includes an in vivo mouse cytokine induction assay
as described in, e.g., Judge et al., Mol. Ther., 13:494-505 (2006).
In certain embodiments, the assay that can be performed as follows:
(1) siRNA can be administered by standard intravenous injection in
the lateral tail vein; (2) blood can be collected by cardiac
puncture about 6 hours after administration and processed as plasma
for cytokine analysis; and (3) cytokines can be quantified using
sandwich ELISA kits according to the manufacturer's instructions
(e.g., mouse and human IFN-.alpha. (PBL Biomedical; Piscataway,
N.J.); human IL-6 and TNF-.alpha. (eBioscience; San Diego, Calif.);
and mouse IL-6, TNF-.alpha., and IFN-.gamma. (BD Biosciences; San
Diego, Calif.)).
[0209] Monoclonal antibodies that specifically bind cytokines and
growth factors are commercially available from multiple sources and
can be generated using methods known in the art (see, e.g., Kohler
et al., Nature, 256: 495-497 (1975) and Harlow and Lane,
ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publication,
New York (1999)). Generation of monoclonal antibodies has been
previously described and can be accomplished by any means known in
the art (Buhring et al., in Hybridoma, Vol. 10, No. 1, pp. 77-78
(1991)). In some methods, the monoclonal antibody is labeled (e.g.,
with any composition detectable by spectroscopic, photochemical,
biochemical, electrical, optical, or chemical means) to facilitate
detection.
[0210] 2. Generating siRNA Molecules
[0211] siRNA can be provided in several forms including, e.g., as
one or more isolated small-interfering RNA (siRNA) duplexes, as
longer double-stranded RNA (dsRNA), or as siRNA or dsRNA
transcribed from a transcriptional cassette in a DNA plasmid. In
some embodiments, siRNA may be produced enzymatically or by
partial/total organic synthesis, and modified ribonucleotides can
be introduced by in vitro enzymatic or organic synthesis. In
certain instances, each strand is prepared chemically. Methods of
synthesizing RNA molecules are known in the art, e.g., the chemical
synthesis methods as described in Verma and Eckstein (1998) or as
described herein.
[0212] An RNA population can be used to provide long precursor
RNAs, or long precursor RNAs that have substantial or complete
identity to a selected target sequence can be used to make the
siRNA. The RNAs can be isolated from cells or tissue, synthesized,
and/or cloned according to methods well known to those of skill in
the art. The RNA can be a mixed population (obtained from cells or
tissue, transcribed from cDNA, subtracted, selected, etc.), or can
represent a single target sequence. RNA can be naturally occurring
(e.g., isolated from tissue or cell samples), synthesized in vitro
(e.g., using T7 or SP6 polymerase and PCR products or a cloned
cDNA), or chemically synthesized.
[0213] To form a long dsRNA, for synthetic RNAs, the complement is
also transcribed in vitro and hybridized to form a dsRNA. If a
naturally occurring RNA population is used, the RNA complements are
also provided (e.g., to form dsRNA for digestion by E. coli RNAse
III or Dicer), e.g., by transcribing cDNAs corresponding to the RNA
population, or by using RNA polymerases. The precursor RNAs are
then hybridized to form double stranded RNAs for digestion. The
dsRNAs can be directly administered to a subject or can be digested
in vitro prior to administration.
[0214] Methods for isolating RNA, synthesizing RNA, hybridizing
nucleic acids, making and screening cDNA libraries, and performing
PCR are well known in the art (see, e.g., Gubler and Hoffman, Gene,
25:263-269 (1983); Sambrook et al., supra; Ausubel et al., supra),
as are PCR methods (see, U.S. Pat. Nos. 4,683,195 and 4,683,202;
PCR Protocols: A Guide to Methods and Applications (Innis et al.,
eds, 1990)). Expression libraries are also well known to those of
skill in the art. Additional basic texts disclosing the general
methods of use in this invention include Sambrook et al., Molecular
Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene
Transfer and Expression: A Laboratory Manual (1990); and Current
Protocols in Molecular Biology (Ausubel et al., eds., 1994). The
disclosures of these references are herein incorporated by
reference in their entirety for all purposes.
[0215] Preferably, siRNA are chemically synthesized. The
oligonucleotides that comprise the siRNA molecules of the invention
can be synthesized using any of a variety of techniques known in
the art, such as those described in Usman et al., J. Am. Chem.
Soc., 109:7845 (1987); Scaringe et al., Nucl. Acids Res., 18:5433
(1990); Wincott et al., Nucl. Acids Res., 23:2677-2684 (1995); and
Wincott et al., Methods Mol. Bio., 74:59 (1997). The synthesis of
oligonucleotides makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end and
phosphoramidites at the 3'-end. As a non-limiting example, small
scale syntheses can be conducted on an Applied Biosystems
synthesizer using a 0.2 wino' scale protocol. Alternatively,
syntheses at the 0.2 .mu.mol scale can be performed on a 96-well
plate synthesizer from Protogene (Palo Alto, Calif.). However, a
larger or smaller scale of synthesis is also within the scope of
this invention. Suitable reagents for oligonucleotide synthesis,
methods for RNA deprotection, and methods for RNA purification are
known to those of skill in the art.
[0216] siRNA molecules can also be synthesized via a tandem
synthesis technique, wherein both strands are synthesized as a
single continuous oligonucleotide fragment or strand separated by a
cleavable linker that is subsequently cleaved to provide separate
fragments or strands that hybridize to form the siRNA duplex. The
linker can be a polynucleotide linker or a non-nucleotide linker.
The tandem synthesis of siRNA can be readily adapted to both
multiwell/multiplate synthesis platforms as well as large scale
synthesis platforms employing batch reactors, synthesis columns,
and the like. Alternatively, siRNA molecules can be assembled from
two distinct oligonucleotides, wherein one oligonucleotide
comprises the sense strand and the other comprises the antisense
strand of the siRNA. For example, each strand can be synthesized
separately and joined together by hybridization or ligation
following synthesis and/or deprotection. In certain other
instances, siRNA molecules can be synthesized as a single
continuous oligonucleotide fragment, where the self-complementary
sense and antisense regions hybridize to form an siRNA duplex
having hairpin secondary structure.
[0217] 3. Modifying siRNA Sequences
[0218] In certain aspects, siRNA molecules comprise a duplex having
two strands and at least one modified nucleotide in the
double-stranded region, wherein each strand is about 15 to about 60
nucleotides in length. Advantageously, the modified siRNA is less
immunostimulatory than a corresponding unmodified siRNA sequence,
but retains the capability of silencing the expression of a target
sequence. In preferred embodiments, the degree of chemical
modifications introduced into the siRNA molecule strikes a balance
between reduction or abrogation of the immunostimulatory properties
of the siRNA and retention of RNAi activity. As a non-limiting
example, an siRNA molecule that targets a gene of interest can be
minimally modified (e.g., less than about 30%, 25%, 20%, 15%, 10%,
or 5% modified) at selective uridine and/or guanosine nucleotides
within the siRNA duplex to eliminate the immune response generated
by the siRNA while retaining its capability to silence target gene
expression.
[0219] Examples of modified nucleotides suitable for use in the
invention include, but are not limited to, ribonucleotides having a
2'-O-methyl (2'OMe), 2'-deoxy-2'-fluoro (2'F), 2'-deoxy,
5-C-methyl, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, 2'-amino, or
2'-C-allyl group. Modified nucleotides having a Northern
conformation such as those described in, e.g., Saenger, Principles
of Nucleic Acid Structure, Springer-Verlag Ed. (1984), are also
suitable for use in siRNA molecules. Such modified nucleotides
include, without limitation, locked nucleic acid (LNA) nucleotides
(e.g., 2'-0, 4'-C-methylene-(D-ribofuranosyl) nucleotides),
2'-O-(2-methoxyethyl) (MOE) nucleotides, 2'-methyl-thio-ethyl
nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides,
2'-deoxy-2'-chloro (2'Cl) nucleotides, and 2'-azido nucleotides. In
certain instances, the siRNA molecules described herein include one
or more G-clamp nucleotides. A G-clamp nucleotide refers to a
modified cytosine analog wherein the modifications confer the
ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a
complementary guanine nucleotide within a duplex (see, e.g., Lin et
al., J. Am. Chem. Soc., 120:8531-8532 (1998)). In addition,
nucleotides having a nucleotide base analog such as, for example,
C-phenyl, C-naphthyl, other aromatic derivatives, inosine, azole
carboxamides, and nitroazole derivatives such as 3-nitropyrrole,
4-nitroindole, 5-nitroindole, and 6-nitroindole (see, e.g., Loakes,
Nucl. Acids Res., 29:2437-2447 (2001)) can be incorporated into
siRNA molecules.
[0220] In certain embodiments, siRNA molecules may further comprise
one or more chemical modifications such as terminal cap moieties,
phosphate backbone modifications, and the like. Examples of
terminal cap moieties include, without limitation, inverted deoxy
abasic residues, glyceryl modifications, 4',5'-methylene
nucleotides, 1-(.beta.-D-erythrofuranosyl) nucleotides, 4'-thio
nucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol
nucleotides, L-nucleotides, .alpha.-nucleotides, modified base
nucleotides, threo-pentofuranosyl nucleotides, acyclic 3',4'-seco
nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic
3,5-dihydroxypentyl nucleotides, 3'-3'-inverted nucleotide
moieties, 3'-3'-inverted abasic moieties, 3'-2'-inverted nucleotide
moieties, 3'-2'-inverted abasic moieties, 5'-5'-inverted nucleotide
moieties, 5'-5'-inverted abasic moieties, 3'-5'-inverted deoxy
abasic moieties, 5'-amino-alkyl phosphate, 1,3-diamino-2-propyl
phosphate, 3-aminopropyl phosphate, 6-aminohexyl phosphate,
1,2-aminododecyl phosphate, hydroxypropyl phosphate, 1,4-butanediol
phosphate, 3'-phosphoramidate, 5'-phosphoramidate, hexylphosphate,
aminohexyl phosphate, 3'-phosphate, 5'-amino, 3'-phosphorothioate,
5'-phosphorothioate, phosphorodithioate, and bridging or
non-bridging methylphosphonate or 5'-mercapto moieties (see, e.g.,
U.S. Pat. No. 5,998,203; Beaucage et al., Tetrahedron 49:1925
(1993)). Non-limiting examples of phosphate backbone modifications
(i.e., resulting in modified internucleotide linkages) include
phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate, carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and alkylsilyl substitutions (see,
e.g., Hunziker et al., Nucleic Acid Analogues: Synthesis and
Properties, in Modern Synthetic Methods, VCH, 331-417 (1995);
Mesmaeker et al., Novel Backbone Replacements for Oligonucleotides,
in Carbohydrate Modifications in Antisense Research, ACS, 24-39
(1994)). Such chemical modifications can occur at the 5'-end and/or
3'-end of the sense strand, antisense strand, or both strands of
the siRNA. The disclosures of these references are herein
incorporated by reference in their entirety for all purposes.
[0221] In some embodiments, the sense and/or antisense strand of
the siRNA molecule can further comprise a 3'-terminal overhang
having about 1 to about 4 (e.g., 1, 2, 3, or 4) 2'-deoxy
ribonucleotides, modified (e.g., 2'OMe) and/or unmodified uridine
ribonucleotides, and/or any other combination of modified (e.g.,
2'OMe) and unmodified nucleotides.
[0222] Additional examples of modified nucleotides and types of
chemical modifications that can be introduced into siRNA molecules
are described, e.g., in UK Patent No. GB 2,397,818 B and U.S.
Patent Publication Nos. 20040192626, 20050282188, and 20070135372,
the disclosures of which are herein incorporated by reference in
their entirety for all purposes.
[0223] The siRNA molecules described herein can optionally comprise
one or more non-nucleotides in one or both strands of the siRNA. As
used herein, the term "non-nucleotide" refers to any group or
compound that can be incorporated into a nucleic acid chain in the
place of one or more nucleotide units, including sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their activity. The group or compound is abasic in that it does not
contain a commonly recognized nucleotide base such as adenosine,
guanine, cytosine, uracil, or thymine and therefore lacks a base at
the 1'-position.
[0224] In other embodiments, chemical modification of the siRNA
comprises attaching a conjugate to the siRNA molecule. The
conjugate can be attached at the 5' and/or 3'-end of the sense
and/or antisense strand of the siRNA via a covalent attachment such
as, e.g., a biodegradable linker. The conjugate can also be
attached to the siRNA, e.g., through a carbamate group or other
linking group (see, e.g., U.S. Patent Publication Nos. 20050074771,
20050043219, and 20050158727). In certain instances, the conjugate
is a molecule that facilitates the delivery of the siRNA into a
cell. Examples of conjugate molecules suitable for attachment to
siRNA include, without limitation, steroids such as cholesterol,
glycols such as polyethylene glycol (PEG), human serum albumin
(HSA), fatty acids, carotenoids, terpenes, bile acids, folates
(e.g., folic acid, folate analogs and derivatives thereof), sugars
(e.g., galactose, galactosamine, N-acetyl galactosamine, glucose,
mannose, fructose, fucose, etc.), phospholipids, peptides, ligands
for cellular receptors capable of mediating cellular uptake, and
combinations thereof (see, e.g., U.S. Patent Publication Nos.
20030130186, 20040110296, and 20040249178; U.S. Pat. No.
6,753,423). Other examples include the lipophilic moiety, vitamin,
polymer, peptide, protein, nucleic acid, small molecule,
oligosaccharide, carbohydrate cluster, intercalator, minor groove
binder, cleaving agent, and cross-linking agent conjugate molecules
described in U.S. Patent Publication Nos. 20050119470 and
20050107325. Yet other examples include the 2'-O-alkyl amine,
2'-O-alkoxyalkyl amine, polyamine, C5-cationic modified pyrimidine,
cationic peptide, guanidinium group, amidininium group, cationic
amino acid conjugate molecules described in U.S. Patent Publication
No. 20050153337. Additional examples include the hydrophobic group,
membrane active compound, cell penetrating compound, cell targeting
signal, interaction modifier, and steric stabilizer conjugate
molecules described in U.S. Patent Publication No. 20040167090.
Further examples include the conjugate molecules described in U.S.
Patent Publication No. 20050239739. The type of conjugate used and
the extent of conjugation to the siRNA molecule can be evaluated
for improved pharmacokinetic profiles, bioavailability, and/or
stability of the siRNA while retaining RNAi activity. As such, one
skilled in the art can screen siRNA molecules having various
conjugates attached thereto to identify ones having improved
properties and full RNAi activity using any of a variety of
well-known in vitro cell culture or in vivo animal models. The
disclosures of the above-described patent documents are herein
incorporated by reference in their entirety for all purposes.
[0225] 4. Target Genes
[0226] The siRNA molecules of the invention can be used to
downregulate or silence the translation (i.e., expression) of one
or more EBOV genes of interest, such as L-pol, VP24, VP30, VP35,
VP40, nucleoprotein (NP), glycoprotein (GP), or combinations
thereof. In particular embodiments, the present invention provides
a cocktail of siRNA molecules that silences the expression of at
least two of the following genes: EBOV L-pol, EBOV VP24, and/or
EBOV VP35 (e.g., the siRNA cocktail targets L-pol+VP35, L-pol+VP24,
VP24+VP35, or L-pol+VP24+VP35). In some embodiments, the cocktail
of siRNA molecules is fully encapsulated in a lipid particle such
as a nucleic acid-lipid particle (e.g., SNALP). The siRNA molecules
may be co-encapsulated in the same lipid particle, or each siRNA
species present in the cocktail may be formulated in separate
particles. As described herein, it has been unexpectedly found that
the nucleic acid-lipid particles of the present invention (i.e.,
SNALP formulations) containing a cocktail of siRNA molecules as
disclosed herein show increased potency (i.e., increased silencing)
and/or increased tolerability (e.g., decreased toxicity) when
targeting one or more EBOV genes of interest, when compared to
other nucleic acid-lipid particle compositions previously
described.
[0227] The EBOV genome comprises seven genes that encode 4 virion
structural proteins (VP30, VP35, NP, and L-pol) and 3
membrane-associated proteins (VP40, GP, and VP24). The GP gene is
found fourth from the 3' end of the 7 linearly arranged genes. The
NP, VP30, VP35, and L-pol genes are required for viral replication
and RNA translation. Complete genome sequences for EBOV are set
forth in, e.g., Genbank Accession Nos. NC_002549; AY769362;
NC_006432; NC_004161; AY729654; AY354458; AY142960; AB050936;
AF522874; AF499101; AF272001; and AF086833. EBOV VP24 sequences are
set forth in, e.g., Genbank Accession Nos. U77385 and AY058897.
EBOV L-pol sequences are set forth in, e.g., Genbank Accession No.
X67110. EBOV VP40 sequences are set forth in, e.g., Genbank
Accession No. AY058896. EBOV NP sequences are set forth in, e.g.,
Genbank Accession No. AY058895. EBOV GP sequences are set forth in,
e.g., Genbank Accession No. AY058898; Sanchez et al., Virus Res.,
29: 215-240 (1993); Will et al., J. Virol., 67: 1203-1210 (1993);
Volchkov et al., FEBS Lett., 305:181-184 (1992); and U.S. Pat. No.
6,713,069. Additional EBOV sequences are set forth in, e.g.,
Genbank Accession Nos. L11365 and X61274. Non-limiting examples of
siRNA molecules targeting EBOV nucleic acid sequences are set forth
herein as well as in U.S. Patent Publication No. 20070135370 and
Geisbert et al., J. Infect. Dis., 193:1650-7 (2006), the
disclosures of which are herein incorporated by reference in their
entirety for all purposes.
[0228] In certain embodiments, the compositions of the present
invention further comprise one or more siRNA molecules that
downregulate or silence the translation (i.e., expression) of one
or more additional genes associated with viral infection and
survival.
[0229] Examples of additional genes associated with viral infection
and survival include those expressed by a host (e.g., a host factor
such as tissue factor (TF)) or a virus in order to bind, enter, and
replicate in a cell. Of particular interest are viral sequences
associated with chronic viral diseases. Additional viral sequences
of particular interest include sequences of other Filoviruses such
as Marburg virus (see, e.g., Geisbert et al., J. Infect. Dis.,
193:1650-1657 (2006)) and Arenaviruses such as Lassa virus, Junin
virus, Machupo virus, Guanarito virus, and Sabia virus (Buchmeier
et al., Arenaviridae: the viruses and their replication, In: FIELDS
VIROLOGY, Knipe et al. (eds.), 4th ed., Lippincott-Raven,
Philadelphia, (2001)).
[0230] Complete genome sequences for Marburg virus are set forth
in, e.g., Genbank Accession Nos. NC_001608; AY430365; AY430366; and
AY358025. Marburg virus GP sequences are set forth in, e.g.,
Genbank Accession Nos. AF005734; AF005733; and AF005732. Marburg
virus VP35 sequences are set forth in, e.g., Genbank Accession Nos.
AF005731 and AF005730. Additional Marburg virus sequences are set
forth in, e.g., Genbank Accession Nos. X64406; Z29337; AF005735;
and Z12132. Non-limiting examples of siRNA molecules targeting
Marburg virus nucleic acid sequences include those described in
U.S. Patent Publication No. 20070135370, the disclosure of which is
herein incorporated by reference in its entirety for all
purposes.
[0231] Exemplary Arenavirus nucleic acid sequences that can be
silenced include, but are not limited to, nucleic acid sequences
encoding nucleoprotein (NP), glycoprotein (GP), L-polymerase (L),
and Z protein (Z). Complete genome sequences for Lassa virus are
set forth in, e.g., Genbank Accession Nos. NC_004296 (LASV segment
S) and NC_004297 (LASV segment L). Non-limiting examples of siRNA
molecules targeting Lassa virus nucleic acid sequences include
those described in U.S. Provisional Application No. 61/319,855,
filed Mar. 31, 2010, the disclosure of which is herein incorporated
by reference in its entirety for all purposes.
[0232] Exemplary host nucleic acid sequences that can be silenced
include, but are not limited to, nucleic acid sequences encoding
host factors such as tissue factor (TF) that are known to play a
role in the pathogenisis of hemorrhagic fever viruses. The mRNA
sequence of TF is set forth in Genbank Accession No. NM_001993.
Those of skill in the art will appreciate that TF is also known as
F3, coagulation factor III, thromboplastin, and CD142. Non-limiting
examples of siRNA molecules targeting TF nucleic acid sequences
include those described in U.S. Provisional Application No.
61/319,855, filed Mar. 31, 2010, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0233] In addition to its utility in silencing the expression of
any of the above-described EBOV genes and/or other viral-associated
genes for therapeutic purposes, the siRNA described herein are also
useful in research and development applications as well as
diagnostic, prophylactic, prognostic, clinical, and other
healthcare applications. As a non-limiting example, the siRNA can
be used in target validation studies directed at testing whether a
gene of interest has the potential to be a therapeutic target. The
siRNA can also be used in target identification studies aimed at
discovering genes as potential therapeutic targets.
[0234] 5. Exemplary siRNA Embodiments
[0235] In some embodiments, each strand of the siRNA molecule
comprises from about 15 to about 60 nucleotides in length (e.g.,
about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in
length, or 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
nucleotides in length). In one particular embodiment, the siRNA is
chemically synthesized. The siRNA molecules of the invention are
capable of silencing the expression of a target sequence in vitro
and/or in vivo.
[0236] In other embodiments, the siRNA comprises at least one
modified nucleotide. In certain embodiments, the siRNA comprises
one, two, three, four, five, six, seven, eight, nine, ten, or more
modified nucleotides in the double-stranded region. In particular
embodiments, less than about 50% (e.g., less than about 50%, 45%,
40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%) of the nucleotides in the
double-stranded region of the siRNA comprise modified nucleotides.
In preferred embodiments, from about 1% to about 50% (e.g., from
about 5%-50%, 10%-50%, 15%-50%, 20%-50%, 25%-50%, 30%-50%, 35%-50%,
40%-50%, 45%-50%, 5%-45%, 10%-45%, 15%-45%, 20%-45%, 25%-45%,
30%-45%, 35%-45%, 40%-45%, 5%-40%, 10%-40%, 15%-40%, 20%-40%,
25%-40%, 30%-40%, 35%-40%, 5%-35%, 10%-35%, 15%-35%, 20%-35%,
25%-35%, 30%-35%, 5%-30%, 10%-30%, 15%-30%, 20%-30%, 25%-30%,
5%-25%, 10%-25%, 15%-25%, 20%-25%, 5%-20%, 10%-20%, 15%-20%,
5%-15%, 10%-15%, or 5%-10%) of the nucleotides in the
double-stranded region of the siRNA comprise modified
nucleotides.
[0237] In further embodiments, the siRNA comprises modified
nucleotides including, but not limited to, 2'-O-methyl (2'OMe)
nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy
nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked
nucleic acid (LNA) nucleotides, and mixtures thereof. In preferred
embodiments, the siRNA comprises 2'OMe nucleotides (e.g., 2'OMe
purine and/or pyrimidine nucleotides) such as, e.g.,
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides,
2'OMe-adenosine nucleotides, 2'OMe-cytosine nucleotides, or
mixtures thereof. In one particular embodiment, the siRNA comprises
at least one 2'OMe-guanosine nucleotide, 2'OMe-uridine nucleotide,
or mixtures thereof. In certain instances, the siRNA does not
comprise 2'OMe-cytosine nucleotides. In other embodiments, the
siRNA comprises a hairpin loop structure.
[0238] In certain embodiments, the siRNA comprises modified
nucleotides in one strand (i.e., sense or antisense) or both
strands of the double-stranded region of the siRNA molecule.
Preferably, uridine and/or guanosine nucleotides are modified at
selective positions in the double-stranded region of the siRNA
duplex. With regard to uridine nucleotide modifications, at least
one, two, three, four, five, six, or more of the uridine
nucleotides in the sense and/or antisense strand can be a modified
uridine nucleotide such as a 2'OMe-uridine nucleotide. In some
embodiments, every uridine nucleotide in the sense and/or antisense
strand is a 2'OMe-uridine nucleotide. With regard to guanosine
nucleotide modifications, at least one, two, three, four, five,
six, or more of the guanosine nucleotides in the sense and/or
antisense strand can be a modified guanosine nucleotide such as a
2'OMe-guanosine nucleotide. In some embodiments, every guanosine
nucleotide in the sense and/or antisense strand is a
2'OMe-guanosine nucleotide.
[0239] In certain embodiments, at least one, two, three, four,
five, six, seven, or more 5'-GU-3' motifs in an siRNA sequence may
be modified, e.g., by introducing mismatches to eliminate the
5'-GU-3' motifs and/or by introducing modified nucleotides such as
2'OMe nucleotides. The 5'-GU-3' motif can be in the sense strand,
the antisense strand, or both strands of the siRNA sequence. The
5'-GU-3' motifs may be adjacent to each other or, alternatively,
they may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or
more nucleotides.
[0240] In some embodiments, a modified siRNA molecule is less
immunostimulatory than a corresponding unmodified siRNA sequence.
In such embodiments, the modified siRNA molecule with reduced
immunostimulatory properties advantageously retains RNAi activity
against the target sequence. In another embodiment, the
immunostimulatory properties of the modified siRNA molecule and its
ability to silence target gene expression can be balanced or
optimized by the introduction of minimal and selective 2'OMe
modifications within the siRNA sequence such as, e.g., within the
double-stranded region of the siRNA duplex. In certain instances,
the modified siRNA is at least about 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% less
immunostimulatory than the corresponding unmodified siRNA. It will
be readily apparent to those of skill in the art that the
immunostimulatory properties of the modified siRNA molecule and the
corresponding unmodified siRNA molecule can be determined by, for
example, measuring INF-.alpha. and/or IL-6 levels from about two to
about twelve hours after systemic administration in a mammal or
transfection of a mammalian responder cell using an appropriate
lipid-based delivery system (such as the SNALP delivery system
disclosed herein).
[0241] In other embodiments, a modified siRNA molecule has an
IC.sub.50 (i.e., half-maximal inhibitory concentration) less than
or equal to ten-fold that of the corresponding unmodified siRNA
(i.e., the modified siRNA has an IC.sub.50 that is less than or
equal to ten-times the IC.sub.50 of the corresponding unmodified
siRNA). In other embodiments, the modified siRNA has an IC.sub.50
less than or equal to three-fold that of the corresponding
unmodified siRNA sequence. In yet other embodiments, the modified
siRNA has an IC.sub.50 less than or equal to two-fold that of the
corresponding unmodified siRNA. It will be readily apparent to
those of skill in the art that a dose-response curve can be
generated and the IC.sub.50 values for the modified siRNA and the
corresponding unmodified siRNA can be readily determined using
methods known to those of skill in the art.
[0242] In another embodiment, an unmodified or modified siRNA
molecule is capable of silencing at least about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the
expression of the target sequence relative to a negative control
(e.g., buffer only, an siRNA sequence that targets a different
gene, a scrambled siRNA sequence, etc.).
[0243] In yet another embodiment, a modified siRNA molecule is
capable of silencing at least about 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%,
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the expression of the
target sequence relative to the corresponding unmodified siRNA
sequence.
[0244] In some embodiments, the siRNA molecule does not comprise
phosphate backbone modifications, e.g., in the sense and/or
antisense strand of the double-stranded region. In other
embodiments, the siRNA comprises one, two, three, four, or more
phosphate backbone modifications, e.g., in the sense and/or
antisense strand of the double-stranded region. In preferred
embodiments, the siRNA does not comprise phosphate backbone
modifications.
[0245] In further embodiments, the siRNA does not comprise 2'-deoxy
nucleotides, e.g., in the sense and/or antisense strand of the
double-stranded region. In yet further embodiments, the siRNA
comprises one, two, three, four, or more 2'-deoxy nucleotides,
e.g., in the sense and/or antisense strand of the double-stranded
region. In preferred embodiments, the siRNA does not comprise
2'-deoxy nucleotides.
[0246] In certain instances, the nucleotide at the 3'-end of the
double-stranded region in the sense and/or antisense strand is not
a modified nucleotide. In certain other instances, the nucleotides
near the 3'-end (e.g., within one, two, three, or four nucleotides
of the 3'-end) of the double-stranded region in the sense and/or
antisense strand are not modified nucleotides.
[0247] The siRNA molecules described herein may have 3' overhangs
of one, two, three, four, or more nucleotides on one or both sides
of the double-stranded region, or may lack overhangs (i.e., have
blunt ends) on one or both sides of the double-stranded region. In
certain embodiments, the 3' overhang on the sense and/or antisense
strand independently comprises one, two, three, four, or more
modified nucleotides such as 2'OMe nucleotides and/or any other
modified nucleotide described herein or known in the art.
[0248] In particular embodiments, siRNAs targeting EBOV RNA are
administered using a carrier system such as a nucleic acid-lipid
particle. In a preferred embodiment, the nucleic acid-lipid
particle comprises: (a) a combination of siRNA molecules targeting
at least two (or all three) of the following genes: EBOV L-pol,
EBOV VP24, and/or EBOV VP35; (b) a cationic lipid of Formula I-XVI
or a salt thereof; and (c) a non-cationic lipid (e.g., DPPC, DSPC,
DSPE, and/or cholesterol). In certain instances, the nucleic
acid-lipid particle may further comprise a conjugated lipid that
prevents aggregation of particles (e.g., PEG-DAA).
[0249] B. Dicer-Substrate dsRNA
[0250] As used herein, the term "Dicer-substrate dsRNA" or
"precursor RNAi molecule" is intended to include any precursor
molecule that is processed in vivo by Dicer to produce an active
siRNA which is incorporated into the RISC complex for RNA
interference of a target gene.
[0251] In one embodiment, the Dicer-substrate dsRNA has a length
sufficient such that it is processed by Dicer to produce an siRNA.
According to this embodiment, the Dicer-substrate dsRNA comprises
(i) a first oligonucleotide sequence (also termed the sense strand)
that is between about 25 and about 60 nucleotides in length (e.g.,
about 25-60, 25-55, 25-50, 25-45, 25-40, 25-35, or 25-30
nucleotides in length), preferably between about 25 and about 30
nucleotides in length (e.g., 25, 26, 27, 28, 29, or 30 nucleotides
in length), and (ii) a second oligonucleotide sequence (also termed
the antisense strand) that anneals to the first sequence under
biological conditions, such as the conditions found in the
cytoplasm of a cell. The second oligonucleotide sequence may be
between about 25 and about 60 nucleotides in length (e.g., about
25-60, 25-55, 25-50, 25-45, 25-40, 25-35, or 25-30 nucleotides in
length), and is preferably between about 25 and about 30
nucleotides in length (e.g., 25, 26, 27, 28, 29, or 30 nucleotides
in length). In addition, a region of one of the sequences,
particularly of the antisense strand, of the Dicer-substrate dsRNA
has a sequence length of at least about 19 nucleotides, for
example, from about 19 to about 60 nucleotides (e.g., about 19-60,
19-55, 19-50, 19-45, 19-40, 19-35, 19-30, or 19-25 nucleotides),
preferably from about 19 to about 23 nucleotides (e.g., 19, 20, 21,
22, or 23 nucleotides) that are sufficiently complementary to a
nucleotide sequence of the RNA produced from the target gene to
trigger an RNAi response.
[0252] In a second embodiment, the Dicer-substrate dsRNA has
several properties which enhance its processing by Dicer. According
to this embodiment, the dsRNA has a length sufficient such that it
is processed by Dicer to produce an siRNA and has at least one of
the following properties: (i) the dsRNA is asymmetric, e.g., has a
3'-overhang on the antisense strand; and/or (ii) the dsRNA has a
modified 3'-end on the sense strand to direct orientation of Dicer
binding and processing of the dsRNA to an active siRNA. According
to this latter embodiment, the sense strand comprises from about 22
to about 28 nucleotides and the antisense strand comprises from
about 24 to about 30 nucleotides.
[0253] In one embodiment, the Dicer-substrate dsRNA has an overhang
on the 3'-end of the antisense strand. In another embodiment, the
sense strand is modified for Dicer binding and processing by
suitable modifiers located at the 3'-end of the sense strand.
Suitable modifiers include nucleotides such as
deoxyribonucleotides, acyclonucleotides, and the like, and
sterically hindered molecules such as fluorescent molecules and the
like. When nucleotide modifiers are used, they replace
ribonucleotides in the dsRNA such that the length of the dsRNA does
not change. In another embodiment, the Dicer-substrate dsRNA has an
overhang on the 3'-end of the antisense strand and the sense strand
is modified for Dicer processing. In another embodiment, the 5'-end
of the sense strand has a phosphate. In another embodiment, the
5'-end of the antisense strand has a phosphate. In another
embodiment, the antisense strand or the sense strand or both
strands have one or more 2'-O-methyl (2'OMe) modified nucleotides.
In another embodiment, the antisense strand contains 2'OMe modified
nucleotides. In another embodiment, the antisense stand contains a
3'-overhang that is comprised of 2'OMe modified nucleotides. The
antisense strand could also include additional 2'OMe modified
nucleotides. The sense and antisense strands anneal under
biological conditions, such as the conditions found in the
cytoplasm of a cell. In addition, a region of one of the sequences,
particularly of the antisense strand, of the Dicer-substrate dsRNA
has a sequence length of at least about 19 nucleotides, wherein
these nucleotides are in the 21-nucleotide region adjacent to the
3'-end of the antisense strand and are sufficiently complementary
to a nucleotide sequence of the RNA produced from the target gene.
Further, in accordance with this embodiment, the Dicer-substrate
dsRNA may also have one or more of the following additional
properties: (a) the antisense strand has a right shift from the
typical 21-mer (i.e., the antisense strand includes nucleotides on
the right side of the molecule when compared to the typical
21-mer); (b) the strands may not be completely complementary, i.e.,
the strands may contain simple mismatch pairings; and (c) base
modifications such as locked nucleic acid(s) may be included in the
5'-end of the sense strand.
[0254] In a third embodiment, the sense strand comprises from about
25 to about 28 nucleotides (e.g., 25, 26, 27, or 28 nucleotides),
wherein the 2 nucleotides on the 3'-end of the sense strand are
deoxyribonucleotides. The sense strand contains a phosphate at the
5'-end. The antisense strand comprises from about 26 to about 30
nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides) and contains
a 3'-overhang of 1-4 nucleotides. The nucleotides comprising the
3'-overhang are modified with 2'OMe modified ribonucleotides. The
antisense strand contains alternating 2'OMe modified nucleotides
beginning at the first monomer of the antisense strand adjacent to
the 3'-overhang, and extending 15-19 nucleotides from the first
monomer adjacent to the 3'-overhang. For example, for a
27-nucleotide antisense strand and counting the first base at the
5'-end of the antisense strand as position number 1, 2'OMe
modifications would be placed at bases 9, 11, 13, 15, 17, 19, 21,
23, 25, 26, and 27. In one embodiment, the Dicer-substrate dsRNA
has the following structure:
TABLE-US-00041 5'-pXXXXXXXXXXXXXXXXXXXXXXXDD-3'
3'-YXXXXXXXXXXXXXXXXXXXXXXXXXp-5'
wherein "X"=RNA, "p"=a phosphate group, "X"=2'OMe RNA, "Y" is an
overhang domain comprised of 1, 2, 3, or 4 RNA monomers that are
optionally 2'OMe RNA monomers, and "D"=DNA. The top strand is the
sense strand, and the bottom strand is the antisense strand.
[0255] In a fourth embodiment, the Dicer-substrate dsRNA has
several properties which enhance its processing by Dicer. According
to this embodiment, the dsRNA has a length sufficient such that it
is processed by Dicer to produce an siRNA and at least one of the
following properties: (i) the dsRNA is asymmetric, e.g., has a
3'-overhang on the sense strand; and (ii) the dsRNA has a modified
3'-end on the antisense strand to direct orientation of Dicer
binding and processing of the dsRNA to an active siRNA. According
to this embodiment, the sense strand comprises from about 24 to
about 30 nucleotides (e.g., 24, 25, 26, 27, 28, 29, or 30
nucleotides) and the antisense strand comprises from about 22 to
about 28 nucleotides (e.g., 22, 23, 24, 25, 26, 27, or 28
nucleotides). In one embodiment, the Dicer-substrate dsRNA has an
overhang on the 3'-end of the sense strand. In another embodiment,
the antisense strand is modified for Dicer binding and processing
by suitable modifiers located at the 3'-end of the antisense
strand. Suitable modifiers include nucleotides such as
deoxyribonucleotides, acyclonucleotides, and the like, and
sterically hindered molecules such as fluorescent molecules and the
like. When nucleotide modifiers are used, they replace
ribonucleotides in the dsRNA such that the length of the dsRNA does
not change. In another embodiment, the dsRNA has an overhang on the
3'-end of the sense strand and the antisense strand is modified for
Dicer processing. In one embodiment, the antisense strand has a
5'-phosphate. The sense and antisense strands anneal under
biological conditions, such as the conditions found in the
cytoplasm of a cell. In addition, a region of one of the sequences,
particularly of the antisense strand, of the dsRNA has a sequence
length of at least 19 nucleotides, wherein these nucleotides are
adjacent to the 3'-end of antisense strand and are sufficiently
complementary to a nucleotide sequence of the RNA produced from the
target gene. Further, in accordance with this embodiment, the
Dicer-substrate dsRNA may also have one or more of the following
additional properties: (a) the antisense strand has a left shift
from the typical 21-mer (i.e., the antisense strand includes
nucleotides on the left side of the molecule when compared to the
typical 21-mer); and (b) the strands may not be completely
complementary, i.e., the strands may contain simple mismatch
pairings.
[0256] In a preferred embodiment, the Dicer-substrate dsRNA has an
asymmetric structure, with the sense strand having a 25-base pair
length, and the antisense strand having a 27-base pair length with
a 2 base 3'-overhang. In certain instances, this dsRNA having an
asymmetric structure further contains 2 deoxynucleotides at the
3'-end of the sense strand in place of two of the ribonucleotides.
In certain other instances, this dsRNA having an asymmetric
structure further contains 2'OMe modifications at positions 9, 11,
13, 15, 17, 19, 21, 23, and 25 of the antisense strand (wherein the
first base at the 5'-end of the antisense strand is position 1). In
certain additional instances, this dsRNA having an asymmetric
structure further contains a 3'-overhang on the antisense strand
comprising 1, 2, 3, or 4 2'OMe nucleotides (e.g., a 3'-overhang of
2'OMe nucleotides at positions 26 and 27 on the antisense
strand).
[0257] In another embodiment, Dicer-substrate dsRNAs may be
designed by first selecting an antisense strand siRNA sequence
having a length of at least 19 nucleotides. In some instances, the
antisense siRNA is modified to include about 5 to about 11
ribonucleotides on the 5'-end to provide a length of about 24 to
about 30 nucleotides. When the antisense strand has a length of 21
nucleotides, 3-9, preferably 4-7, or more preferably 6 nucleotides
may be added on the 5'-end. Although the added ribonucleotides may
be complementary to the target gene sequence, full complementarity
between the target sequence and the antisense siRNA is not
required. That is, the resultant antisense siRNA is sufficiently
complementary with the target sequence. A sense strand is then
produced that has about 22 to about 28 nucleotides. The sense
strand is substantially complementary with the antisense strand to
anneal to the antisense strand under biological conditions. In one
embodiment, the sense strand is synthesized to contain a modified
3'-end to direct Dicer processing of the antisense strand. In
another embodiment, the antisense strand of the dsRNA has a
3'-overhang. In a further embodiment, the sense strand is
synthesized to contain a modified 3'-end for Dicer binding and
processing and the antisense strand of the dsRNA has a
3'-overhang.
[0258] In a related embodiment, the antisense siRNA may be modified
to include about 1 to about 9 ribonucleotides on the 5'-end to
provide a length of about 22 to about 28 nucleotides. When the
antisense strand has a length of 21 nucleotides, 1-7, preferably
2-5, or more preferably 4 ribonucleotides may be added on the
3'-end. The added ribonucleotides may have any sequence. Although
the added ribonucleotides may be complementary to the target gene
sequence, full complementarity between the target sequence and the
antisense siRNA is not required. That is, the resultant antisense
siRNA is sufficiently complementary with the target sequence. A
sense strand is then produced that has about 24 to about 30
nucleotides. The sense strand is substantially complementary with
the antisense strand to anneal to the antisense strand under
biological conditions. In one embodiment, the antisense strand is
synthesized to contain a modified 3'-end to direct Dicer
processing. In another embodiment, the sense strand of the dsRNA
has a 3'-overhang. In a further embodiment, the antisense strand is
synthesized to contain a modified 3'-end for Dicer binding and
processing and the sense strand of the dsRNA has a 3'-overhang.
[0259] Suitable Dicer-substrate dsRNA sequences can be identified,
synthesized, and modified using any means known in the art for
designing, synthesizing, and modifying siRNA sequences. In certain
embodiments, Dicer-substrate dsRNAs may silence one or more EBOV
genes of interest, and preferably silence the expression of any
combination of at least two of the EBOV L-pol, VP24, and VP35
genes. In particular embodiments, Dicer-substrate dsRNAs targeting
EBOV RNA are administered using a carrier system such as a nucleic
acid-lipid particle (e.g., SNALP). In a preferred embodiment, the
nucleic acid-lipid particle comprises: (a) a combination of
Dicer-substrate dsRNA molecules targeting at least two (or all
three) of the following genes: EBOV L-pol, EBOV VP24, and/or EBOV
VP35; (b) a cationic lipid of Formula I-XVI or a salt thereof; and
(c) a non-cationic lipid (e.g., DPPC, DSPC, DSPE, and/or
cholesterol). In certain instances, the nucleic acid-lipid particle
may further comprise a conjugated lipid that prevents aggregation
of particles (e.g., PEG-DAA).
[0260] Additional embodiments related to the Dicer-substrate dsRNAs
of the invention, as well as methods of designing and synthesizing
such dsRNAs, are described in U.S. Patent Publication Nos.
20050244858, 20050277610, and 20070265220, and U.S. application
Ser. No. 12/794,701, filed Jun. 4, 2010, the disclosures of which
are herein incorporated by reference in their entirety for all
purposes.
[0261] C. Small Hairpin RNA (shRNA)
[0262] A "small hairpin RNA" or "short hairpin RNA" or "shRNA"
includes a short RNA sequence that makes a tight hairpin turn that
can be used to silence gene expression via RNA interference. The
shRNAs of the invention may be chemically synthesized or
transcribed from a transcriptional cassette in a DNA plasmid. The
shRNA hairpin structure is cleaved by the cellular machinery into
siRNA, which is then bound to the RNA-induced silencing complex
(RISC).
[0263] The shRNAs of the invention are typically about 15-60,
15-50, or 15-40 (duplex) nucleotides in length, more typically
about 15-30, 15-25, or 19-25 (duplex) nucleotides in length, and
are preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in
length (e.g., each complementary sequence of the double-stranded
shRNA is 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in
length, preferably about 20-24, 21-22, or 21-23 nucleotides in
length, and the double-stranded shRNA is about 15-60, 15-50, 15-40,
15-30, 15-25, or 19-25 base pairs in length, preferably about
18-22, 19-20, or 19-21 base pairs in length). shRNA duplexes may
comprise 3' overhangs of about 1 to about 4 nucleotides or about 2
to about 3 nucleotides on the antisense strand and/or 5'-phosphate
termini on the sense strand. In some embodiments, the shRNA
comprises a sense strand and/or antisense strand sequence of from
about 15 to about 60 nucleotides in length (e.g., about 15-60,
15-55, 15-50, 15-45, 15-40, 15-35, 15-30, or 15-25 nucleotides in
length), preferably from about 19 to about 40 nucleotides in length
(e.g., about 19-40, 19-35, 19-30, or 19-25 nucleotides in length),
more preferably from about 19 to about 23 nucleotides in length
(e.g., 19, 20, 21, 22, or 23 nucleotides in length).
[0264] Non-limiting examples of shRNA include a double-stranded
polynucleotide molecule assembled from a single-stranded molecule,
where the sense and antisense regions are linked by a nucleic
acid-based or non-nucleic acid-based linker; and a double-stranded
polynucleotide molecule with a hairpin secondary structure having
self-complementary sense and antisense regions. In preferred
embodiments, the sense and antisense strands of the shRNA are
linked by a loop structure comprising from about 1 to about 25
nucleotides, from about 2 to about 20 nucleotides, from about 4 to
about 15 nucleotides, from about 5 to about 12 nucleotides, or 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, or more nucleotides.
[0265] Additional shRNA sequences include, but are not limited to,
asymmetric shRNA precursor polynucleotides such as those described
in PCT Publication Nos. WO 2006/074108 and WO 2009/076321, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes. For example, PCT Publication No. WO
2006/074108 discloses self-protected oligonucleotides comprising a
region having a sequence complementary to one, two, three, or more
same or different target mRNA sequences (e.g., multivalent shRNAs)
and one or more self-complementary regions. Similarly, PCT
Publication No. WO 2009/076321 discloses self-forming asymmetric
precursor polynucleotides comprising a targeting region comprising
a polynucleotide sequence complementary to a region of one, two,
three, or more same or different target mRNA sequences (e.g.,
multivalent shRNAs); a first self-complementary region; and a
second self-complementary region, wherein the first and second
self-complementary regions are located one at each end of the
targeting region and both self-complementary regions form stem-loop
structures, wherein the first self-complementary region is capable
of being cleaved by a RNase III endoribonuclease that is not a
class IV DICER endoribonuclease, and wherein both
self-complementary regions comprise a nucleotide sequence that is
complementary to a region of the target gene sequence, but wherein
a portion of the target sequence present in the targeting region
does not have a complementary sequence in either of the
self-complementary regions.
[0266] Suitable shRNA sequences can be identified, synthesized, and
modified using any means known in the art for designing,
synthesizing, and modifying siRNA sequences. In certain
embodiments, shRNAs may silence one or more EBOV genes of interest,
and preferably silence the expression of any combination of at
least two of the EBOV L-pol, VP24, and VP35 genes. In particular
embodiments, shRNAs targeting EBOV RNA are administered using a
carrier system such as a nucleic acid-lipid particle (e.g., SNALP).
In a preferred embodiment, the nucleic acid-lipid particle
comprises: (a) a combination of shRNA molecules targeting at least
two (or all three) of the following genes: EBOV L-pol, EBOV VP24,
and/or EBOV VP35; (b) a cationic lipid of Formula I-XVI or a salt
thereof; and (c) a non-cationic lipid (e.g., DPPC, DSPC, DSPE,
and/or cholesterol). In certain instances, the nucleic acid-lipid
particle may further comprise a conjugated lipid that prevents
aggregation of particles (e.g., PEG-DAA).
[0267] Additional embodiments related to the shRNAs of the
invention, as well as methods of designing and synthesizing such
shRNAs, are described in U.S. patent application Ser. No.
12/794,701, filed Jun. 4, 2010, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0268] D. aiRNA
[0269] Like siRNA, asymmetrical interfering RNA (aiRNA) can recruit
the RNA-induced silencing complex (RISC) and lead to effective
silencing of a variety of genes in mammalian cells by mediating
sequence-specific cleavage of the target sequence between
nucleotide 10 and 11 relative to the 5' end of the antisense strand
(Sun et al., Nat. Biotech., 26:1379-1382 (2008)). Typically, an
aiRNA molecule comprises a short RNA duplex having a sense strand
and an antisense strand, wherein the duplex contains overhangs at
the 3' and 5' ends of the antisense strand. The aiRNA is generally
asymmetric because the sense strand is shorter on both ends when
compared to the complementary antisense strand. In some aspects,
aiRNA molecules may be designed, synthesized, and annealed under
conditions similar to those used for siRNA molecules. As a
non-limiting example, aiRNA sequences may be selected and generated
using the methods described above for selecting siRNA
sequences.
[0270] In another embodiment, aiRNA duplexes of various lengths
(e.g., about 10-25, 12-20, 12-19, 12-18, 13-17, or 14-17 base
pairs, more typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 base
pairs) may be designed with overhangs at the 3' and 5' ends of the
antisense strand to target an mRNA of interest. In certain
instances, the sense strand of the aiRNA molecule is about 10-25,
12-20, 12-19, 12-18, 13-17, or 14-17 nucleotides in length, more
typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in
length. In certain other instances, the antisense strand of the
aiRNA molecule is about 15-60, 15-50, or 15-40 nucleotides in
length, more typically about 15-30, 15-25, or 19-25 nucleotides in
length, and is preferably about 20-24, 21-22, or 21-23 nucleotides
in length.
[0271] In some embodiments, the 5' antisense overhang contains one,
two, three, four, or more nontargeting nucleotides (e.g., "AA",
"UU", "dTdT", etc.). In other embodiments, the 3' antisense
overhang contains one, two, three, four, or more nontargeting
nucleotides (e.g., "AA", "UU", "dTdT", etc.). In certain aspects,
the aiRNA molecules described herein may comprise one or more
modified nucleotides, e.g., in the double-stranded (duplex) region
and/or in the antisense overhangs. As a non-limiting example, aiRNA
sequences may comprise one or more of the modified nucleotides
described above for siRNA sequences. In a preferred embodiment, the
aiRNA molecule comprises 2'OMe nucleotides such as, for example,
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, or mixtures
thereof.
[0272] In certain embodiments, aiRNA molecules may comprise an
antisense strand which corresponds to the antisense strand of an
siRNA molecule, e.g., one of the siRNA molecules described herein.
In other embodiments, aiRNA molecules may be used to silence one or
more EBOV genes of interest, and preferably silence the expression
of any combination of at least two of the EBOV L-pol, VP24, and
VP35 genes.
[0273] In particular embodiments, aiRNAs targeting EBOV RNA are
administered using a carrier system such as a nucleic acid-lipid
particle (e.g., SNALP). In preferred embodiments, the nucleic
acid-lipid particle comprises: (a) a combination of aiRNA molecules
targeting at least two (or all three) of the following genes: EBOV
L-pol, EBOV VP24, and/or EBOV VP35; (b) a cationic lipid of Formula
I-XVI or a salt thereof and (c) a non-cationic lipid (e.g., DPPC,
DSPC, DSPE, and/or cholesterol). In certain instances, the nucleic
acid-lipid particle may further comprise a conjugated lipid that
prevents aggregation of particles (e.g., PEG-DAA).
[0274] Suitable aiRNA sequences can be identified, synthesized, and
modified using any means known in the art for designing,
synthesizing, and modifying siRNA sequences. Additional embodiments
related to the aiRNA molecules of the invention are described in
U.S. Patent Publication No. 20090291131 and PCT Publication No. WO
09/127060, the disclosures of which are herein incorporated by
reference in their entirety for all purposes.
[0275] E. miRNA
[0276] Generally, microRNAs (miRNA) are single-stranded RNA
molecules of about 21-23 nucleotides in length which regulate gene
expression. miRNAs are encoded by genes from whose DNA they are
transcribed, but miRNAs are not translated into protein (non-coding
RNA); instead, each primary transcript (a pri-miRNA) is processed
into a short stem-loop structure called a pre-miRNA and finally
into a functional mature miRNA. Mature miRNA molecules are either
partially or completely complementary to one or more messenger RNA
(mRNA) molecules, and their main function is to downregulate gene
expression. The identification of miRNA molecules is described,
e.g., in Lagos-Quintana et al., Science, 294:853-858; Lau et al.,
Science, 294:858-862; and Lee et al., Science, 294:862-864.
[0277] The genes encoding miRNA are much longer than the processed
mature miRNA molecule. miRNA are first transcribed as primary
transcripts or pri-miRNA with a cap and poly-A tail and processed
to short, .about.70-nucleotide stem-loop structures known as
pre-miRNA in the cell nucleus. This processing is performed in
animals by a protein complex known as the Microprocessor complex,
consisting of the nuclease Drosha and the double-stranded RNA
binding protein Pasha (Denli et al., Nature, 432:231-235 (2004)).
These pre-miRNA are then processed to mature miRNA in the cytoplasm
by interaction with the endonuclease Dicer, which also initiates
the formation of the RNA-induced silencing complex (RISC)
(Bernstein et al., Nature, 409:363-366 (2001). Either the sense
strand or antisense strand of DNA can function as templates to give
rise to miRNA.
[0278] When Dicer cleaves the pre-miRNA stem-loop, two
complementary short RNA molecules are formed, but only one is
integrated into the RISC complex. This strand is known as the guide
strand and is selected by the argonaute protein, the catalytically
active RNase in the RISC complex, on the basis of the stability of
the 5' end (Preall et al., Curr. Biol., 16:530-535 (2006)). The
remaining strand, known as the anti-guide or passenger strand, is
degraded as a RISC complex substrate (Gregory et al., Cell,
123:631-640 (2005)). After integration into the active RISC
complex, miRNAs base pair with their complementary mRNA molecules
and induce target mRNA degradation and/or translational
silencing.
[0279] Mammalian miRNA molecules are usually complementary to a
site in the 3' UTR of the target mRNA sequence. In certain
instances, the annealing of the miRNA to the target mRNA inhibits
protein translation by blocking the protein translation machinery.
In certain other instances, the annealing of the miRNA to the
target mRNA facilitates the cleavage and degradation of the target
mRNA through a process similar to RNA interference (RNAi). miRNA
may also target methylation of genomic sites which correspond to
targeted mRNA. Generally, miRNA function in association with a
complement of proteins collectively termed the miRNP.
[0280] In certain aspects, the miRNA molecules described herein are
about 15-100, 15-90, 15-80, 15-75, 15-70, 15-60, 15-50, or 15-40
nucleotides in length, more typically about 15-30, 15-25, or 19-25
nucleotides in length, and are preferably about 20-24, 21-22, or
21-23 nucleotides in length. In certain other aspects, miRNA
molecules may comprise one or more modified nucleotides. As a
non-limiting example, miRNA sequences may comprise one or more of
the modified nucleotides described above for siRNA sequences. In a
preferred embodiment, the miRNA molecule comprises 2'OMe
nucleotides such as, for example, 2'OMe-guanosine nucleotides,
2'OMe-uridine nucleotides, or mixtures thereof.
[0281] In some embodiments, miRNA molecules may be used to silence
one or more EBOV genes of interest, and preferably silence the
expression of any combination of at least two of the EBOV L-pol,
VP24, and VP35 genes. In particular embodiments, miRNAs are
administered using a carrier system such as a nucleic acid-lipid
particle (e.g., SNALP). In a preferred embodiment, the nucleic
acid-lipid particle comprises: (a) a combination of miRNA molecules
targeting at least two (or all three) of the following genes: EBOV
L-pol, EBOV VP24, and/or EBOV VP35; (b) a cationic lipid of Formula
I-XVI or a salt thereof; and (c) a non-cationic lipid (e.g., DPPC,
DSPC, DSPE, and/or cholesterol). In certain instances, the nucleic
acid-lipid particle may further comprise a conjugated lipid that
prevents aggregation of particles (e.g., PEG-DAA).
[0282] In other embodiments, one or more agents that block the
activity of an miRNA targeting EBOV RNA are administered using a
lipid particle of the invention (e.g., a nucleic acid-lipid
particle such as SNALP). Examples of blocking agents include, but
are not limited to, steric blocking oligonucleotides, locked
nucleic acid oligonucleotides, and Morpholino oligonucleotides.
Such blocking agents may bind directly to the miRNA or to the miRNA
binding site on the target RNA.
[0283] Additional embodiments related to the miRNA molecules of the
invention are described in U.S. Patent Publication No. 20090291131
and PCT Publication No. WO 09/127060, the disclosures of which are
herein incorporated by reference in their entirety for all
purposes.
V. Lipid Particles
[0284] In certain aspects, the present invention provides lipid
particles comprising one or more therapeutic nucleic acids (e.g.,
interfering RNA such as siRNA) and one or more cationic (amino)
lipids or salts thereof. In some embodiments, the lipid particles
of the invention further comprise one or more non-cationic lipids.
In other embodiments, the lipid particles further comprise one or
more conjugated lipids capable of reducing or inhibiting particle
aggregation.
[0285] Lipid particles include, but are not limited to, lipid
vesicles such as liposomes. As used herein, a lipid vesicle
includes a structure having lipid-containing membranes enclosing an
aqueous interior. In particular embodiments, lipid vesicles
comprising one or more of the cationic lipids described herein are
used to encapsulate nucleic acids within the lipid vesicles. In
other embodiments, lipid vesicles comprising one or more of the
cationic lipids described herein are complexed with nucleic acids
to form lipoplexes.
[0286] The lipid particles of the invention preferably comprise a
therapeutic nucleic acid such as an interfering RNA (e.g., siRNA),
a cationic lipid, a non-cationic lipid, and a conjugated lipid that
inhibits aggregation of particles. In some embodiments, the
therapeutic nucleic acid is fully encapsulated within the lipid
portion of the lipid particle such that the therapeutic nucleic
acid in the lipid particle is resistant in aqueous solution to
enzymatic degradation, e.g., by a nuclease. In other embodiments,
the lipid particles described herein are substantially non-toxic to
mammals such as humans. The lipid particles of the invention
typically have a mean diameter of from about 30 nm to about 150 nm,
from about 40 nm to about 150 nm, from about 50 nm to about 150 nm,
from about 60 nm to about 130 nm, from about 70 nm to about 110 nm,
or from about 70 to about 90 nm. The lipid particles of the
invention also typically have a lipid:nucleic acid ratio (mass/mass
ratio) of from about 1:1 to about 100:1, from about 1:1 to about
50:1, from about 2:1 to about 25:1, from about 3:1 to about 20:1,
from about 5:1 to about 15:1, or from about 5:1 to about 10:1.
[0287] In preferred embodiments, the lipid particles of the
invention are serum-stable nucleic acid-lipid particles (SNALP)
which comprise an interfering RNA (e.g., dsRNA such as siRNA,
Dicer-substrate dsRNA, shRNA, aiRNA, and/or miRNA), a cationic
lipid (e.g., one or more cationic lipids of Formula I-XVI or salts
thereof as set forth herein), a non-cationic lipid (e.g., mixtures
of one or more phospholipids and cholesterol), and a conjugated
lipid that inhibits aggregation of the particles (e.g., one or more
PEG-lipid conjugates). The SNALP may comprise at least 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more unmodified and/or modified interfering
RNA molecules (e.g., siRNA) that target the EBOV genome and
optionally target additional genes associated with viral infection
and survival. Nucleic acid-lipid particles and their method of
preparation are described in, e.g., U.S. Pat. Nos. 5,753,613;
5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745; and
6,320,017; and PCT Publication No. WO 96/40964, the disclosures of
which are each herein incorporated by reference in their entirety
for all purposes.
[0288] In the nucleic acid-lipid particles of the invention, the
nucleic acid may be fully encapsulated within the lipid portion of
the particle, thereby protecting the nucleic acid from nuclease
degradation. In preferred embodiments, a SNALP comprising a nucleic
acid such as an interfering RNA is fully encapsulated within the
lipid portion of the particle, thereby protecting the nucleic acid
from nuclease degradation. In certain instances, the nucleic acid
in the SNALP is not substantially degraded after exposure of the
particle to a nuclease at 37.degree. C. for at least about 20, 30,
45, or 60 minutes. In certain other instances, the nucleic acid in
the SNALP is not substantially degraded after incubation of the
particle in serum at 37.degree. C. for at least about 30, 45, or 60
minutes or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16,
18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours. In other
embodiments, the nucleic acid is complexed with the lipid portion
of the particle. One of the benefits of the formulations of the
present invention is that the nucleic acid-lipid particle
compositions are substantially non-toxic to mammals such as
humans.
[0289] The term "fully encapsulated" indicates that the nucleic
acid in the nucleic acid-lipid particle is not significantly
degraded after exposure to serum or a nuclease assay that would
significantly degrade free DNA or RNA. In a fully encapsulated
system, preferably less than about 25% of the nucleic acid in the
particle is degraded in a treatment that would normally degrade
100% of free nucleic acid, more preferably less than about 10%, and
most preferably less than about 5% of the nucleic acid in the
particle is degraded. "Fully encapsulated" also indicates that the
nucleic acid-lipid particles are serum-stable, that is, that they
do not rapidly decompose into their component parts upon in vivo
administration.
[0290] In the context of nucleic acids, full encapsulation may be
determined by performing a membrane-impermeable fluorescent dye
exclusion assay, which uses a dye that has enhanced fluorescence
when associated with nucleic acid. Specific dyes such as
OliGreen.RTM. and RiboGreen.RTM. (Invitrogen Corp.; Carlsbad,
Calif.) are available for the quantitative determination of plasmid
DNA, single-stranded deoxyribonucleotides, and/or single- or
double-stranded ribonucleotides. Encapsulation is determined by
adding the dye to a liposomal formulation, measuring the resulting
fluorescence, and comparing it to the fluorescence observed upon
addition of a small amount of nonionic detergent.
Detergent-mediated disruption of the liposomal bilayer releases the
encapsulated nucleic acid, allowing it to interact with the
membrane-impermeable dye. Nucleic acid encapsulation may be
calculated as E=(I.sub.O-1)/I.sub.O, where I and I.sub.O refer to
the fluorescence intensities before and after the addition of
detergent (see, Wheeler et al., Gene Ther., 6:271-281 (1999)).
[0291] In other embodiments, the present invention provides a
nucleic acid-lipid particle (e.g., SNALP) composition comprising a
plurality of nucleic acid-lipid particles.
[0292] In some instances, the SNALP composition comprises nucleic
acid that is fully encapsulated within the lipid portion of the
particles, such that from about 30% to about 100%, from about 40%
to about 100%, from about 50% to about 100%, from about 60% to
about 100%, from about 70% to about 100%, from about 80% to about
100%, from about 90% to about 100%, from about 30% to about 95%,
from about 40% to about 95%, from about 50% to about 95%, from
about 60% to about 95%, from about 70% to about 95%, from about 80%
to about 95%, from about 85% to about 95%, from about 90% to about
95%, from about 30% to about 90%, from about 40% to about 90%, from
about 50% to about 90%, from about 60% to about 90%, from about 70%
to about 90%, from about 80% to about 90%, or at least about 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (or any fraction thereof
or range therein) of the particles have the nucleic acid
encapsulated therein.
[0293] In other instances, the SNALP composition comprises nucleic
acid that is fully encapsulated within the lipid portion of the
particles, such that from about 30% to about 100%, from about 40%
to about 100%, from about 50% to about 100%, from about 60% to
about 100%, from about 70% to about 100%, from about 80% to about
100%, from about 90% to about 100%, from about 30% to about 95%,
from about 40% to about 95%, from about 50% to about 95%, from
about 60% to about 95%, from about 70% to about 95%, from about 80%
to about 95%, from about 85% to about 95%, from about 90% to about
95%, from about 30% to about 90%, from about 40% to about 90%, from
about 50% to about 90%, from about 60% to about 90%, from about 70%
to about 90%, from about 80% to about 90%, or at least about 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (or any fraction thereof
or range therein) of the input nucleic acid is encapsulated in the
particles.
[0294] Depending on the intended use of the lipid particles of the
invention, the proportions of the components can be varied and the
delivery efficiency of a particular formulation can be measured
using, e.g., an endosomal release parameter (ERP) assay.
[0295] In particular embodiments, the present invention provides a
lipid particle (e.g., SNALP) composition comprising a plurality of
lipid particles described herein and an antioxidant. In certain
instances, the antioxidant in the lipid particle composition
reduces, prevents, and/or inhibits the degradation of a cationic
lipid present in the lipid particle. In instances wherein the
active agent is a therapeutic nucleic acid such as an interfering
RNA (e.g., siRNA), the antioxidant in the lipid particle
composition reduces, prevents, and/or inhibits the degradation of
the nucleic acid payload, e.g., by reducing, preventing, and/or
inhibiting the formation of adducts between the nucleic acid and
the cationic lipid. Non-limiting examples of antioxidants include
hydrophilic antioxidants such as chelating agents (e.g., metal
chelators such as ethylenediaminetetraacetic acid (EDTA), citrate,
and the like), lipophilic antioxidants (e.g., vitamin E isomers,
polyphenols, and the like), salts thereof; and mixtures thereof. If
needed, the antioxidant is typically present in an amount
sufficient to prevent, inhibit, and/or reduce the degradation of
the cationic lipid and/or active agent present in the particle,
e.g., at least about 20 mM EDTA or a salt thereof, or at least
about 100 mM citrate or a salt thereof. An antioxidant such as EDTA
and/or citrate may be included at any step or at multiple steps in
the lipid particle formation process described in Section VI (e.g.,
prior to, during, and/or after lipid particle formation).
[0296] Additional embodiments related to methods of preventing the
degradation of cationic lipids and/or active agents (e.g.,
therapeutic nucleic acids) present in lipid particles, compositions
comprising lipid particles stabilized by these methods, methods of
making these lipid particles, and methods of delivering and/or
administering these lipid particles are described in U.S.
Provisional Application No. 61/265,671, entitled "SNALP
Formulations Containing Antioxidants," filed Dec. 1, 2009, the
disclosure of which is herein incorporated by reference in its
entirety for all purposes.
[0297] A. Cationic Lipids
[0298] Any of a variety of cationic lipids or salts thereof may be
used in the lipid particles of the present invention (e.g., SNALP),
either alone or in combination with one or more other cationic
lipid species or non-cationic lipid species. In particular
embodiments, one or more of the cationic lipids of Formula I-XVI or
salts thereof as set forth herein may be used in the lipid
particles of the present invention (e.g., SNALP), either alone or
in combination with one or more other cationic lipid species or
non-cationic lipid species. The cationic lipids include the (R)
and/or (S) enantiomers thereof.
[0299] In some embodiments, the cationic lipid comprises a racemic
mixture. In other embodiments, the cationic lipid comprises a
mixture of one or more diastereomers. In certain embodiments, the
cationic lipid is enriched in one enantiomer, such that the
cationic lipid comprises at least about 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, or 95% enantiomeric excess. In certain other
embodiments, the cationic lipid is enriched in one diastereomer,
such that the cationic lipid comprises at least about 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, or 95% diastereomeric excess. In
certain additional embodiments, the cationic lipid is chirally pure
(e.g., comprises a single optical isomer). In further embodiments,
the cationic lipid is enriched in one optical isomer (e.g., an
optically active isomer), such that the cationic lipid comprises at
least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% isomeric
excess. The present invention provides the synthesis of the
cationic lipids of Formulas I-XVI as a racemic mixture or in
optically pure form.
[0300] The terms "cationic lipid" and "amino lipid" are used
interchangeably herein to include those lipids and salts thereof
having one, two, three, or more fatty acid or fatty alkyl chains
and a pH-titratable amino head group (e.g., an alkylamino or
dialkylamino head group). The cationic lipid is typically
protonated (i.e., positively charged) at a pH below the pK.sub.a of
the cationic lipid and is substantially neutral at a pH above the
pK.sub.a. The cationic lipids of the invention may also be termed
titratable cationic lipids.
[0301] The term "salts" includes any anionic and cationic complex,
such as the complex formed between a cationic lipid disclosed
herein and one or more anions. Non-limiting examples of anions
include inorganic and organic anions, e.g., hydride, fluoride,
chloride, bromide, iodide, oxalate (e.g., hemioxalate), phosphate,
phosphonate, hydrogen phosphate, dihydrogen phosphate, oxide,
carbonate, bicarbonate, nitrate, nitrite, nitride, bisulfate,
sulfide, sulfite, bisulfate, sulfate, thiosulfate, hydrogen
sulfate, borate, formate, acetate, benzoate, citrate, tartrate,
lactate, acrylate, polyacrylate, fumarate, maleate, itaconate,
glycolate, gluconate, malate, mandelate, tiglate, ascorbate,
salicylate, polymethacrylate, perchlorate, chlorate, chlorite,
hypochlorite, bromate, hypobromite, iodate, an alkylsulfonate, an
arylsulfonate, arsenate, arsenite, chromate, dichromate, cyanide,
cyanate, thiocyanate, hydroxide, peroxide, permanganate, and
mixtures thereof. In particular embodiments, the salts of the
cationic lipids disclosed herein are crystalline salts.
[0302] The term "alkyl" includes a straight chain or branched,
noncyclic or cyclic, saturated aliphatic hydrocarbon containing
from 1 to 24 carbon atoms. Representative saturated straight chain
alkyls include, but are not limited to, methyl, ethyl, n-propyl,
n-butyl, n-pentyl, n-hexyl, and the like, while saturated branched
alkyls include, without limitation, isopropyl, sec-butyl, isobutyl,
tert-butyl, isopentyl, and the like. Representative saturated
cyclic alkyls include, but are not limited to, cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, and the like, while
unsaturated cyclic alkyls include, without limitation,
cyclopentenyl, cyclohexenyl, and the like.
[0303] The term "alkenyl" includes an alkyl, as defined above,
containing at least one double bond between adjacent carbon atoms.
Alkenyls include both cis and trans isomers. Representative
straight chain and branched alkenyls include, but are not limited
to, ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl,
1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl,
2,3-dimethyl-2-butenyl, and the like.
[0304] The term "alkynyl" includes any alkyl or alkenyl, as defined
above, which additionally contains at least one triple bond between
adjacent carbons. Representative straight chain and branched
alkynyls include, without limitation, acetylenyl, propynyl,
1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl,
and the like.
[0305] The term "acyl" includes any alkyl, alkenyl, or alkynyl
wherein the carbon at the point of attachment is substituted with
an oxo group, as defined below. The following are non-limiting
examples of acyl groups: --C(.dbd.O)alkyl, --C(.dbd.O)alkenyl, and
--C(.dbd.O)alkynyl.
[0306] The term "heterocycle" includes a 5- to 7-membered
monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which
is either saturated, unsaturated, or aromatic, and which contains
from 1 or 2 heteroatoms independently selected from nitrogen,
oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms
may be optionally oxidized, and the nitrogen heteroatom may be
optionally quaternized, including bicyclic rings in which any of
the above heterocycles are fused to a benzene ring. The heterocycle
may be attached via any heteroatom or carbon atom. Heterocycles
include, but are not limited to, heteroaryls as defined below, as
well as morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl,
piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl,
tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl,
tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl,
tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl,
and the like.
[0307] The terms "optionally substituted alkyl", "optionally
substituted alkenyl", "optionally substituted alkynyl", "optionally
substituted acyl", and "optionally substituted heterocycle" mean
that, when substituted, at least one hydrogen atom is replaced with
a substituent. In the case of an oxo substituent (.dbd.O), two
hydrogen atoms are replaced. In this regard, substituents include,
but are not limited to, oxo, halogen, heterocycle, --CN,
--OR.sup.x, --NR.sup.xR.sup.y, --NR.sup.xC(.dbd.O)R.sup.y,
--NR.sup.xSO.sub.2R.sup.y, --C(.dbd.O)R.sup.x, --C(.dbd.O)OR.sup.x,
--C(.dbd.O)NR.sup.xR.sup.y, --SO.sub.nR.sup.x, and
--SO.sub.nNR.sup.xR.sup.y, wherein n is 0, 1, or 2, R.sup.x and
R.sup.y are the same or different and are independently hydrogen,
alkyl, or heterocycle, and each of the alkyl and heterocycle
substituents may be further substituted with one or more of oxo,
halogen, --OH, --CN, alkyl, --OR', heterocycle, --NR.sup.xR.sup.y,
--NR.sup.xC(.dbd.O)R.sup.y, --NR.sup.xSO.sub.2R.sup.y,
--C(.dbd.O)Rx, --C(.dbd.O)OR.sup.x, --C(.dbd.O)NR.sup.xR.sup.y,
--SO.sub.nR.sup.x, and --SO.sub.nNR.sup.xR.sup.y. The term
"optionally substituted," when used before a list of substituents,
means that each of the substituents in the list may be optionally
substituted as described herein.
[0308] The term "halogen" includes fluoro, chloro, bromo, and
iodo.
[0309] In one aspect, cationic lipids of Formula I having the
following structure (or salts thereof) are useful in the present
invention:
##STR00001##
wherein R.sup.1 and R.sup.2 are either the same or different and
are independently hydrogen (H) or an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; [0310] R.sup.3 is either absent
or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; [0311] R.sup.4 and R.sup.5 are either the same or
different and are independently an optionally substituted
C.sub.10-C.sub.24 alkyl, C.sub.10-C.sub.24 alkenyl,
C.sub.10-C.sub.24 alkynyl, or C.sub.10-C.sub.24 acyl, wherein at
least one of R.sup.4 and R.sup.5 comprises at least two sites of
unsaturation; and [0312] n is 0, 1, 2, 3, or 4.
[0313] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In one preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In other preferred
embodiments, n is 1 or 2. In other embodiments, R.sup.3 is absent
when the pH is above the pK.sub.a of the cationic lipid and R.sup.3
is hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.24, C.sub.12-C.sub.22, C.sub.12-C.sub.20,
C.sub.14-C.sub.24, C.sub.14-C.sub.22, C.sub.14-C.sub.20,
C.sub.16-C.sub.24, C.sub.16-C.sub.22, or C.sub.16-C.sub.20 alkyl,
alkenyl, alkynyl, or acyl group (i.e., C.sub.12, C.sub.13,
C.sub.14, C.sub.15, C.sub.16, C.sub.17, C.sub.18, C.sub.19,
C.sub.20, C.sub.21, C.sub.22, C.sub.23, or C.sub.24 alkyl, alkenyl,
alkynyl, or acyl group). In certain embodiments, at least one or
both R.sup.4 and R.sup.5 independently comprises at least 2, 3, 4,
5, or 6 sites of unsaturation (e.g., 2, 3, 4, 5, 6, 2-3, 2-4, 2-5,
or 2-6 sites of unsaturation).
[0314] In certain instances, R.sup.4 and R.sup.5 may independently
comprise a dodecadienyl moiety, a tetradecadienyl moiety, a
hexadecadienyl moiety, an octadecadienyl moiety, an icosadienyl
moiety, a dodecatrienyl moiety, a tetradectrienyl moiety, a
hexadecatrienyl moiety, an octadecatrienyl moiety, an icosatrienyl
moiety, or an acyl derivative thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, etc.). In some instances, the octadecadienyl
moiety is a linoleyl moiety. In particular embodiments, R.sup.4 and
R.sup.5 are both linoleyl moieties. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linolenyl moieties or .gamma.-linolenyl moieties. In certain
instances, R.sup.4 and R.sup.5 are different, e.g., R.sup.4 is a
tetradectrienyl (C.sub.14) and R.sup.5 is linoleyl (C.sub.18). In a
preferred embodiment, the cationic lipid of Formula I is
symmetrical, i.e., R.sup.4 and R.sup.5 are both the same. In
further embodiments, the double bonds present in one or both
R.sup.4 and R.sup.5 may be in the cis and/or trans
configuration.
[0315] In some groups of embodiments to the cationic lipids of
Formula I, R.sup.4 and R.sup.5 are either the same or different and
are independently selected from the group consisting of:
##STR00002##
[0316] In particular embodiments, the cationic lipid of Formula I
comprises 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), or mixtures
thereof.
[0317] In some embodiments, the cationic lipid of Formula I forms a
salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula I is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0318] In another aspect, cationic lipids of Formula II having the
following structure (or salts thereof) are useful in the present
invention:
##STR00003##
wherein R.sup.1 and R.sup.2 are independently selected and are H or
C.sub.1-C.sub.3 alkyls, R.sup.3 and R.sup.4 are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms, and at least one of R.sup.3 and R.sup.4 comprises at
least two sites of unsaturation. In certain instances, R.sup.3 and
R.sup.4 are both the same, i.e., R.sup.3 and R.sup.4 are both
linoleyl (C.sub.18), etc. In certain other instances, R.sup.3 and
R.sup.4 are different, i.e., R.sup.3 is tetradectrienyl (C.sub.14)
and R.sup.4 is linoleyl (C.sub.18). In a preferred embodiment, the
cationic lipid of Formula II is symmetrical, i.e., R.sup.3 and
R.sup.4 are both the same. In another preferred embodiment, both
R.sup.3 and R.sup.4 comprise at least two sites of unsaturation. In
some embodiments, R.sup.3 and R.sup.4 are independently selected
from the group consisting of dodecadienyl, tetradecadienyl,
hexadecadienyl, linoleyl, and icosadienyl. In a preferred
embodiment, R.sup.3 and R.sup.4 are both linoleyl. In some
embodiments, R.sup.3 and R.sup.4 comprise at least three sites of
unsaturation and are independently selected from, e.g.,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl.
[0319] In some embodiments, the cationic lipid of Formula II forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula II is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0320] The synthesis of cationic lipids such as DLinDMA and
DLenDMA, as well as additional cationic lipids falling within the
scope of Formulas I and II, is described in U.S. Patent Publication
No. 20060083780, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0321] In yet another aspect, cationic lipids of Formula III having
the following structure (or salts thereof) are useful in the
present invention:
##STR00004##
wherein R.sup.1 and R.sup.2 are either the same or different and
are independently an optionally substituted C.sub.12-C.sub.24
alkyl, C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl; R.sup.3 and R.sup.4 are either the same or
different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.3 and R.sup.4 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms chosen from nitrogen and oxygen; R.sup.5 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; m, n, and p are either the same or different and
are independently either 0, 1, or 2, with the proviso that m, n,
and p are not simultaneously 0; q is 0, 1, 2, 3, or 4; and Y and Z
are either the same or different and are independently O, S, or
NH.
[0322] In some embodiments, R.sup.3 and R.sup.4 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.3 and R.sup.4 are both methyl groups. In one embodiment, q is
1 or 2. In another embodiment, q is 1-2, 1-3, 1-4, 2-3, or 2-4. In
further embodiments, R.sup.5 is absent when the pH is above the
pK.sub.a of the cationic lipid and R.sup.5 is hydrogen when the pH
is below the pK.sub.a of the cationic lipid such that the amino
head group is protonated. In an alternative embodiment, R.sup.5 is
an optionally substituted C.sub.1-C.sub.4 alkyl to provide a
quaternary amine. In additional embodiments, Y and Z are both
0.
[0323] In other embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.12-C.sub.24, C.sub.12-C.sub.22,
C.sub.12-C.sub.20, C.sub.14-C.sub.24, C.sub.14-C.sub.22,
C.sub.14-C.sub.20, C.sub.16-C.sub.24, C.sub.16-C.sub.22, or
C.sub.16-C.sub.20 alkyl, alkenyl, alkynyl, or acyl group (i.e.,
C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17,
C.sub.18, C.sub.19, C.sub.20, C.sub.21, C.sub.22, C.sub.23, or
C.sub.24 alkyl, alkenyl, alkynyl, or acyl group). In certain
embodiments, at least one or both R.sup.1 and R.sup.2 independently
comprises at least 1, 2, 3, 4, 5, or 6 sites of unsaturation (e.g.,
1-2, 1-3, 1-4, 1-5, 1-6, 2-3, 2-4, 2-5, or 2-6 sites of
unsaturation) or a substituted alkyl or acyl group. In certain
instances, the unsaturated side-chain may comprise a myristoleyl
moiety, a palmitoleyl moiety, an oleyl moiety, a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, or an acyl
derivative thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, etc.). In some instances, the octadecadienyl
moiety is a linoleyl moiety. In particular embodiments, R.sup.1 and
R.sup.2 are both linoleyl moieties. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.1 and R.sup.2 are both
linolenyl moieties or .gamma.-linolenyl moieties.
[0324] In embodiments where one or both R.sup.1 and R.sup.2
independently comprises at least 1, 2, 3, 4, 5, or 6 sites of
unsaturation, the double bonds present in one or both R.sup.1 and
R.sup.2 may be in the cis and/or trans configuration. In certain
instances, R.sup.1 and R.sup.2 are both the same, e.g., R.sup.1 and
R.sup.2 are both linoleyl (C.sub.18) moieties, etc. In certain
other instances, R.sup.1 and R.sup.2 are different, e.g., R.sup.1
is a tetradectrienyl (C.sub.14) moiety and R.sup.2 is a linoleyl
(C.sub.18) moiety. In a preferred embodiment, the cationic lipid of
Formula III is symmetrical, i.e., R.sup.1 and R.sup.2 are both the
same. In another preferred embodiment, at least one or both R.sup.1
and R.sup.2 comprises at least two sites of unsaturation (e.g., 2,
3, 4, 5, 6, 2-3, 2-4, 2-5, or 2-6 sites of unsaturation).
[0325] In embodiments where one or both R.sup.1 and R.sup.2
independently comprises a branched alkyl or acyl group (e.g., a
substituted alkyl or acyl group), the branched alkyl or acyl group
may comprise a C.sub.12-C.sub.24 alkyl or acyl having at least 1-6
(e.g., 1, 2, 3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl
substituents. In particular embodiments, the branched alkyl or acyl
group comprises a C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl or
acyl with 1-6 (e.g., 1, 2, 3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g.,
methyl, ethyl, propyl, or butyl) substituents. In some embodiments,
the branched alkyl group comprises a phytanyl
(3,7,11,15-tetramethyl-hexadecanyl) moiety and the branched acyl
group comprises a phytanoyl (3,7,11,15-tetramethyl-hexadecanoyl)
moiety. In particular embodiments, R.sup.1 and R.sup.2 are both
phytanyl moieties.
[0326] In some groups of embodiments to the cationic lipids of
Formula III, R.sup.1 and R.sup.2 are either the same or different
and are independently selected from the group consisting of:
##STR00005##
[0327] In certain embodiments, cationic lipids falling within the
scope of Formula III include, but are not limited to, the
following: 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-11,31-dioxolane
(DLin-K-C2-DMA; "XTC2" or "C2K"),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dilinoleyl-4-(3-dimethylaminopropyl)[1,3]-dioxolane
(DLin-K-C3-DMA; "C3K"),
2,2-dilinoleyl-4-(4-dimethylaminobutyl)[1,3]-dioxolane
(DLin-K-C4-DMA; "C4K"),
2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA),
2,2-dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ),
2,2-dioleoyl-4-dimethylaminomethyl-[1,3]-dioxolane (DO-K-DMA),
2,2-distearoyl-4-dimethylaminomethyl-[1,3]-dioxolane (DS-K-DMA),
2,2-dilinoleyl-4-N-morpholino-[1,3]-dioxolane (DLin-K-MA),
2,2-Dilinoleyl-4-trimethylamino-[1,3]-dioxolane chloride
(DLin-K-TMA.Cl),
2,2-dilinoleyl-4,5-bis(dimethylaminomethyl)-[1,3]-dioxolane
(DLin-K.sup.2- DMA),
2,2-dilinoleyl-4-methylpiperzine-[1,3]-dioxolane
(D-Lin-K-N-methylpiperzine), DLen-C2K-DMA, .gamma.-DLen-C2K-DMA,
DPan-C2K-DMA, DPan-C3K-DMA, or mixtures thereof. In preferred
embodiments, the cationic lipid of Formula III comprises
DLin-K-C2-DMA and/or DLin-K-DMA.
[0328] In some embodiments, the cationic lipids of Formula III form
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula III is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0329] The synthesis of cationic lipids such as DLin-K-C2-DMA,
DLin-K-C3-DMA, DLin-K-C4-DMA, DLin-K6-DMA, DLin-K-MPZ, DO-K-DMA,
DS-K-DMA, DLin-K-MA, DLin-K-TMA.Cl, DLin-K.sup.2-DMA,
D-Lin-K-N-methylpiperzine, as well as additional cationic lipids,
is described in PCT Publication No. WO 2010/042877, the disclosure
of which is incorporated herein by reference in its entirety for
all purposes.
[0330] The synthesis of cationic lipids such as DLin-K-DMA, as well
as additional cationic lipids, is described in PCT Publication No.
WO 09/086558, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0331] In a preferred embodiment, cationic lipids of Formula IV
having the following structure (or salts thereof) are useful in the
present invention:
##STR00006##
wherein R.sup.1 and R.sup.2 are either the same or different and
are independently an optionally substituted C.sub.12-C.sub.24
alkyl, C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl; R.sup.3 and R.sup.4 are either the same or
different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.3 and R.sup.4 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms chosen from nitrogen and oxygen; R.sup.5 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; m, n, and p are either the same or different and
are independently either 0, 1, or 2, with the proviso that m, n,
and p are not simultaneously 0; and Y and Z are either the same or
different and are independently O, S, or NH.
[0332] In some embodiments, R.sup.3 and R.sup.4 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.3 and R.sup.4 are both methyl groups. In further embodiments,
R.sup.5 is absent when the pH is above the pK.sub.a of the cationic
lipid and R.sup.5 is hydrogen when the pH is below the pK.sub.a of
the cationic lipid such that the amino head group is protonated. In
an alternative embodiment, R.sup.5 is an optionally substituted
C.sub.1-C.sub.4 alkyl to provide a quaternary amine. In additional
embodiments, Y and Z are both O.
[0333] In other embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.12-C.sub.24, C.sub.12-C.sub.22,
C.sub.12-C.sub.20, C.sub.14-C.sub.24, C.sub.14-C.sub.22,
C.sub.14-C.sub.20, C.sub.16-C.sub.24, C.sub.16-C.sub.22, or
C.sub.16-C.sub.20 alkyl, alkenyl, alkynyl, or acyl group (i.e.,
C.sub.12, C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17,
C.sub.18, C.sub.19, C.sub.20, C.sub.21, C.sub.22, C.sub.23, or
C.sub.24 alkyl, alkenyl, alkynyl, or acyl group). In certain
embodiments, at least one or both R.sup.1 and R.sup.2 independently
comprises at least 1, 2, 3, 4, 5, or 6 sites of unsaturation (e.g.,
1-2, 1-3, 1-4, 1-5, 1-6, 2-3, 2-4, 2-5, or 2-6 sites of
unsaturation) or a substituted alkyl or acyl group. In certain
instances, the unsaturated side-chain may comprise a myristoleyl
moiety, a palmitoleyl moiety, an oleyl moiety, a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, or an acyl
derivative thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, etc.). In some instances, the octadecadienyl
moiety is a linoleyl moiety. In particular embodiments, R.sup.1 and
R.sup.2 are both linoleyl moieties. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.1 and R.sup.2 are both
linolenyl moieties or .gamma.-linolenyl moieties.
[0334] In embodiments where one or both R.sup.1 and R.sup.2
independently comprises at least 1, 2, 3, 4, 5, or 6 sites of
unsaturation, the double bonds present in one or both R.sup.1 and
R.sup.2 may be in the cis and/or trans configuration. In certain
instances, R.sup.1 and R.sup.2 are both the same, e.g., R.sup.1 and
R.sup.2 are both linoleyl (C.sub.18) moieties, etc. In certain
other instances, R.sup.1 and R.sup.2 are different, e.g., R.sup.1
is a tetradectrienyl (C.sub.14) moiety and R.sup.2 is a linoleyl
(C.sub.18) moiety. In a preferred embodiment, the cationic lipid of
Formula IV is symmetrical, i.e., R.sup.1 and R.sup.2 are both the
same. In another preferred embodiment, at least one or both R.sup.1
and R.sup.2 comprises at least two sites of unsaturation (e.g., 2,
3, 4, 5, 6, 2-3, 2-4, 2-5, or 2-6 sites of unsaturation).
[0335] In embodiments where one or both R.sup.1 and R.sup.2
independently comprises a branched alkyl or acyl group (e.g., a
substituted alkyl or acyl group), the branched alkyl or acyl group
may comprise a C.sub.12-C.sub.24 alkyl or acyl having at least 1-6
(e.g., 1, 2, 3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl
substituents. In particular embodiments, the branched alkyl or acyl
group comprises a C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl or
acyl with 1-6 (e.g., 1, 2, 3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g.,
methyl, ethyl, propyl, or butyl) substituents. In some embodiments,
the branched alkyl group comprises a phytanyl
(3,7,11,15-tetramethyl-hexadecanyl) moiety and the branched acyl
group comprises a phytanoyl (3,7,11,15-tetramethyl-hexadecanoyl)
moiety. In particular embodiments, R.sup.1 and R.sup.2 are both
phytanyl moieties.
[0336] In some groups of embodiments to the cationic lipids of
Formula IV, R.sup.1 and R.sup.2 are either the same or different
and are independently selected from the group consisting of:
##STR00007##
[0337] In certain embodiments, cationic lipids falling within the
scope of Formula IV include, but are not limited to, the following:
2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]dioxolane
(DLin-K-C2-DMA; "XTC2" or "C2K"), DLen-C2K-DMA,
.gamma.-DLen-C2K-DMA, DPan-C2K-DMA, or mixtures thereof. In
preferred embodiments, the cationic lipid of Formula IV comprises
DLin-K-C2-DMA.
[0338] In some embodiments, the cationic lipids of Formula IV form
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula IV is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0339] The synthesis of DLin-K-C2-DMA (C2K) is described in PCT
Publication No. WO 2010/042877, the disclosure of which is
incorporated herein by reference in its entirety for all
purposes.
[0340] In a further aspect, cationic lipids of Formula V having the
following structure are useful in the present invention:
##STR00008##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either absent or present and when
present are either the same or different and are independently an
optionally substituted C.sub.1-C.sub.10 alkyl or C.sub.2-C.sub.10
alkenyl; and n is 0, 1, 2, 3, or 4.
[0341] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, R.sup.4 and R.sup.5 are both butyl groups. In yet
another preferred embodiment, n is 1. In other embodiments, R.sup.3
is absent when the pH is above the pK.sub.a of the cationic lipid
and R.sup.3 is hydrogen when the pH is below the pK.sub.a of the
cationic lipid such that the amino head group is protonated. In an
alternative embodiment, R.sup.3 is an optionally substituted
C.sub.1-C.sub.4 alkyl to provide a quaternary amine. In further
embodiments, R.sup.4 and R.sup.5 are independently an optionally
substituted C.sub.2-C.sub.6 or C.sub.2-C.sub.4 alkyl or
C.sub.2-C.sub.6 or C.sub.2-C.sub.4 alkenyl.
[0342] In an alternative embodiment, the cationic lipid of Formula
V comprises ester linkages between the amino head group and one or
both of the alkyl chains. In some embodiments, the cationic lipid
of Formula V forms a salt (preferably a crystalline salt) with one
or more anions. In one particular embodiment, the cationic lipid of
Formula V is the oxalate (e.g., hemioxalate) salt thereof, which is
preferably a crystalline salt.
[0343] Although each of the alkyl chains in Formula V contains cis
double bonds at positions 6, 9, and 12 (i.e.,
cis,cis,cis-.DELTA..sup.6, .DELTA..sup.9, .DELTA..sup.12), in an
alternative embodiment, one, two, or three of these double bonds in
one or both alkyl chains may be in the trans configuration.
[0344] In a particularly preferred embodiment, the cationic lipid
of Formula V has the structure:
##STR00009##
[0345] In another aspect, cationic lipids of Formula VI having the
following structure are useful in the present invention:
##STR00010##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.12-C.sub.24 alkyl,
C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl, wherein at least one of R.sup.4 and R.sup.5
comprises at least three sites of unsaturation or a substituted
C.sub.12-C.sub.24 alkyl; m, n, and p are either the same or
different and are independently either 0, 1, or 2, with the proviso
that m, n, and p are not simultaneously 0; q is 0, 1, 2, 3, or 4;
and Y and Z are either the same or different and are independently
O, S, or NH.
[0346] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, q is 2. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0347] In embodiments where at least one of R.sup.4 and R.sup.5
comprises a branched alkyl group (e.g., a substituted
C.sub.12-C.sub.24 alkyl group), the branched alkyl group may
comprise a C.sub.12-C.sub.24 alkyl having at least 1-6 (e.g., 1, 2,
3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl substituents. In
particular embodiments, the branched alkyl group comprises a
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl with 1-6 (e.g., 1, 2,
3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl, ethyl, propyl, or
butyl) substituents. Preferably, the branched alkyl group comprises
a phytanyl (3,7,11,15-tetramethyl-hexadecanyl) moiety. In other
preferred embodiments, R.sup.4 and R.sup.5 are both phytanyl
moieties.
[0348] In alternative embodiments, at least one of R.sup.4 and
R.sup.5 comprises a branched acyl group (e.g., a substituted
C.sub.12-C.sub.24 acyl group). In certain instances, the branched
acyl group may comprise a C.sub.12-C.sub.24 acyl having at least
1-6 (e.g., 1, 2, 3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl
substituents. In particular embodiments, the branched acyl group
comprises a C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl with 1-6
(e.g., 1, 2, 3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl,
ethyl, propyl, or butyl) substituents. Preferably, the branched
acyl group comprises a phytanoyl
(3,7,11,15-tetramethyl-hexadecanoyl) moiety.
[0349] In embodiments where at least one of R.sup.4 and R.sup.5
comprises at least three sites of unsaturation, the double bonds
present in one or both alkyl chains may be in the cis and/or trans
configuration. In some embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a phytanyl
moiety, as well as acyl derivatives thereof (e.g., linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In certain instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In preferred embodiments, R.sup.4 and R.sup.5 are both
linolenyl moieties or .gamma.-linolenyl moieties. In particular
embodiments, R.sup.4 and R.sup.5 independently comprise a backbone
of from about 16 to about 22 carbon atoms, and one or both of
R.sup.4 and R.sup.5 independently comprise at least three, four,
five, or six sites of unsaturation.
[0350] In some embodiments, the cationic lipid of Formula VI forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula VI is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0351] In a particularly preferred embodiment, the cationic lipid
of Formula VI has a structure selected from the group consisting
of:
##STR00011##
[0352] In yet another aspect, cationic lipids of Formula VII having
the following structure are useful in the present invention:
##STR00012##
or salts thereof, wherein: R.sup.1 and R.sup.2 are joined to form
an optionally substituted heterocyclic ring of 4 to 6 carbon atoms
and 1 or 2 heteroatoms selected from the group consisting of
nitrogen (N), oxygen (O), and mixtures thereof; R.sup.3 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; R.sup.4 and R.sup.5 are either the same or
different and are independently an optionally substituted
C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl; and n is 0,
1, 2, 3, or 4.
[0353] In some embodiments, R.sup.1 and R.sup.2 are joined to form
a heterocyclic ring of 5 carbon atoms and 1 nitrogen atom. In
certain instances, the heterocyclic ring is substituted with a
substituent such as a hydroxyl group at the ortho, meta, and/or
para positions. In a preferred embodiment, n is 1. In other
embodiments, R.sup.3 is absent when the pH is above the pK.sub.a of
the cationic lipid and R.sup.3 is hydrogen when the pH is below the
pK.sub.a of the cationic lipid such that the amino head group is
protonated. In an alternative embodiment, R.sup.3 is an optionally
substituted C.sub.1-C.sub.4 alkyl to provide a quaternary amine. In
further embodiments, R.sup.4 and R.sup.5 are independently an
optionally substituted C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkenyl,
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkynyl, or
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0354] In certain embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linoleyl moieties, linolenyl moieties, .gamma.-linolenyl moieties,
or phytanyl moieties.
[0355] In some embodiments, the cationic lipid of Formula VII forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula VII is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0356] In a particularly preferred embodiment, the cationic lipid
of Formula VII has a structure selected from the group consisting
of:
##STR00013##
[0357] In still yet another aspect, cationic lipids of Formula VIII
having the following structure are useful in the present
invention:
##STR00014##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.12-C.sub.24 alkyl,
C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl; and n is 2, 3, or 4.
[0358] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, n is 2. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0359] In certain embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linoleyl moieties, linolenyl moieties, .gamma.-linolenyl moieties,
or phytanyl moieties.
[0360] In some embodiments, the cationic lipid of Formula VIII
forms a salt (preferably a crystalline salt) with one or more
anions. In one particular embodiment, the cationic lipid of Formula
VIII is the oxalate (e.g., hemioxalate) salt thereof, which is
preferably a crystalline salt.
[0361] In a particularly preferred embodiment, the cationic lipid
of Formula VIII has a structure selected from the group consisting
of:
##STR00015##
[0362] In another aspect, cationic lipids of Formula IX having the
following structure are useful in the present invention:
##STR00016##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are different and are independently an
optionally substituted C.sub.1-C.sub.24 alkyl, C.sub.2-C.sub.24
alkenyl, C.sub.2-C.sub.24 alkynyl, or C.sub.1-C.sub.24 acyl; and n
is 0, 1, 2, 3, or 4.
[0363] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, n is 1. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are different and are independently an
optionally substituted C.sub.4-C.sub.20 alkyl, C.sub.4-C.sub.20
alkenyl, C.sub.4-C.sub.20 alkynyl, or C.sub.4-C.sub.20 acyl.
[0364] In some embodiments, R.sup.4 is an optionally substituted
C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl, and R.sup.5
is an optionally substituted C.sub.4-C.sub.10 alkyl,
C.sub.4-C.sub.10 alkenyl, C.sub.4-C.sub.10 alkynyl, or
C.sub.4-C.sub.10 acyl. In certain instances, R.sup.4 is an
optionally substituted C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkenyl,
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkynyl, or
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl, and R.sup.5 is an
optionally substituted C.sub.4-C.sub.8 or C.sub.6 alkyl,
C.sub.4-C.sub.8 or C.sub.6 alkenyl, C.sub.4-C.sub.8 or C.sub.6
alkynyl, or C.sub.4-C.sub.8 or C.sub.6 acyl.
[0365] In other embodiments, R.sup.4 is an optionally substituted
C.sub.4-C.sub.10 alkyl, C.sub.4-C.sub.10 alkenyl, C.sub.4-C.sub.10
alkynyl, or C.sub.4-C.sub.10 acyl, and R.sup.5 is an optionally
substituted C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl. In certain
instances, R.sup.4 is an optionally substituted C.sub.4-C.sub.8 or
C.sub.6 alkyl, C.sub.4-C.sub.8 or C.sub.6 alkenyl, C.sub.4-C.sub.8
or C.sub.6 alkynyl, or C.sub.4-C.sub.8 or C.sub.6 acyl, and R.sup.5
is an optionally substituted C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkenyl,
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkynyl, or
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0366] In particular embodiments, R.sup.4 is a linoleyl moiety, and
R.sup.5 is a C.sub.6 alkyl moiety, a C.sub.6 alkenyl moiety, an
octadecyl moiety, an oleyl moiety, a linolenyl moiety, a
.gamma.-linolenyl moiety, or a phytanyl moiety. In other
embodiments, one of R.sup.4 or R.sup.5 is a phytanyl moiety.
[0367] In some embodiments, the cationic lipid of Formula IX forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula IX is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0368] In a particularly preferred embodiment, the cationic lipid
of Formula IX is an asymmetric lipid having a structure selected
from the group consisting of:
##STR00017##
[0369] In yet another aspect, cationic lipids of Formula X having
the following structure are useful in the present invention:
##STR00018##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.12-C.sub.24 alkyl,
C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl, wherein at least one of R.sup.4 and R.sup.5
comprises at least four sites of unsaturation or a substituted
C.sub.12-C.sub.24 alkyl; and n is 0, 1, 2, 3, or 4.
[0370] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, n is 1. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0371] In embodiments where at least one of R.sup.4 and R.sup.5
comprises a branched alkyl group (e.g., a substituted
C.sub.12-C.sub.24 alkyl group), the branched alkyl group may
comprise a C.sub.12-C.sub.24 alkyl having at least 1-6 (e.g., 1, 2,
3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl substituents. In
particular embodiments, the branched alkyl group comprises a
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl with 1-6 (e.g., 1, 2,
3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl, ethyl, propyl, or
butyl) substituents. Preferably, the branched alkyl group comprises
a phytanyl (3,7,11,15-tetramethyl-hexadecanyl) moiety.
[0372] In alternative embodiments, at least one of R.sup.4 and
R.sup.5 comprises a branched acyl group (e.g., a substituted
C.sub.12-C.sub.24 acyl group). In certain instances, the branched
acyl group may comprise a C.sub.12-C.sub.24 acyl having at least
1-6 (e.g., 1, 2, 3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl
substituents. In particular embodiments, the branched acyl group
comprises a C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl with 1-6
(e.g., 1, 2, 3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl,
ethyl, propyl, or butyl) substituents. Preferably, the branched
acyl group comprises a phytanoyl
(3,7,11,15-tetramethyl-hexadecanoyl) moiety.
[0373] In embodiments where at least one of R.sup.4 and R.sup.5
comprises at least four sites of unsaturation, the double bonds
present in one or both alkyl chains may be in the cis and/or trans
configuration. In a particular embodiment, R.sup.4 and R.sup.5
independently comprise four, five, or six sites of unsaturation. In
some instances, R.sup.4 comprises four, five, or six sites of
unsaturation and R.sup.5 comprises zero, one, two, three, four,
five, or six sites of unsaturation. In other instances, R.sup.4
comprises zero, one, two, three, four, five, or six sites of
unsaturation and R.sup.5 comprises four, five, or six sites of
unsaturation. In a preferred embodiment, both R.sup.4 and R.sup.5
comprise four, five, or six sites of unsaturation. In particular
embodiments, R.sup.4 and R.sup.5 independently comprise a backbone
of from about 18 to about 24 carbon atoms, and one or both of
R.sup.4 and R.sup.5 independently comprise at least four, five, or
six sites of unsaturation.
[0374] In some embodiments, the cationic lipid of Formula X forms a
salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula X is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0375] In a particularly preferred embodiment, the cationic lipid
of Formula X has a structure selected from the group consisting
of:
##STR00019##
[0376] In still yet another aspect, cationic lipids of Formula XI
having the following structure are useful in the present
invention:
##STR00020##
or salts thereof, wherein: R.sup.1 is hydrogen (H) or
--(CH.sub.2).sub.q--NR.sup.6R.sup.7R.sup.8, wherein: R.sup.6 and
R.sup.7 are either the same or different and are independently an
optionally substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6
alkenyl, or C.sub.2-C.sub.6 alkynyl, or R.sup.6 and R.sup.7 may
join to form an optionally substituted heterocyclic ring of 4 to 6
carbon atoms and 1 or 2 heteroatoms selected from the group
consisting of nitrogen (N), oxygen (O), and mixtures thereof;
R.sup.8 is either absent or is hydrogen (H) or a C.sub.1-C.sub.6
alkyl to provide a quaternary amine; and q is 0, 1, 2, 3, or 4;
R.sup.2 is an optionally substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6 alkynyl; R.sup.3 is
either absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to
provide a quaternary amine; R.sup.4 and R.sup.5 are either the same
or different and are independently an optionally substituted
C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl; and n is 0,
1, 2, 3, or 4.
[0377] In some embodiments, R.sup.2 is an optionally substituted
C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4 alkenyl, or C.sub.2-C.sub.4
alkynyl. In other embodiments, R.sup.3 is absent when the pH is
above the pK.sub.a of the cationic lipid and R.sup.3 is hydrogen
when the pH is below the pK.sub.a of the cationic lipid such that
the amino head group is protonated. In an alternative embodiment,
R.sup.3 is an optionally substituted C.sub.1-C.sub.4 alkyl to
provide a quaternary amine. In certain embodiments, R.sup.4 and
R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0378] In further embodiments, R.sup.6 and R.sup.7 are
independently an optionally substituted C.sub.1-C.sub.4 alkyl,
C.sub.2-C.sub.4 alkenyl, or C.sub.2-C.sub.4 alkynyl. In other
embodiments, R.sup.8 is absent when the pH is above the pK.sub.a of
the cationic lipid and R.sup.8 is hydrogen when the pH is below the
pK.sub.a of the cationic lipid such that the amino head group is
protonated. In an alternative embodiment, R.sup.8 is an optionally
substituted C.sub.1-C.sub.4 alkyl to provide a quaternary
amine.
[0379] In a preferred embodiment, R.sup.1 is hydrogen and R.sup.2
is an ethyl group. In another preferred embodiment, R.sup.6 and
R.sup.7 are both methyl groups. In certain instances, n is 1. In
certain other instances, q is 1.
[0380] In certain embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linoleyl moieties, linolenyl moieties, .gamma.-linolenyl moieties,
or phytanyl moieties.
[0381] In some embodiments, the cationic lipid of Formula XI forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula XI is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0382] In a particularly preferred embodiment, the cationic lipid
of Formula XI has a structure selected from the group consisting
of:
##STR00021##
[0383] In another aspect, cationic lipids of Formula XII having the
following structure are useful in the present invention:
##STR00022##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4, R.sup.5, and R.sup.6 are either the same or
different and are independently an optionally substituted
C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl; and n is 0,
1, 2, 3, or 4.
[0384] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, n is 1. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4, R.sup.5, and R.sup.6 are independently an optionally
substituted C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl,
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20
or C.sub.14-C.sub.22 alkynyl, or C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 acyl.
[0385] In certain embodiments, R.sup.4, R.sup.5, and R.sup.6 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4, R.sup.5, and R.sup.6
are all linoleyl moieties, linolenyl moieties, .gamma.-linolenyl
moieties, or phytanyl moieties.
[0386] In some embodiments, the cationic lipid of Formula XII forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula XII is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0387] In a particularly preferred embodiment, the cationic lipid
of Formula XII has a structure selected from the group consisting
of:
##STR00023##
[0388] In yet another aspect, cationic lipids of Formula XIII
having the following structure are useful in the present
invention:
##STR00024##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.12-C.sub.24 alkyl,
C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl; q is 0, 1, 2, 3, or 4; and Y and Z are
either the same or different and are independently O, S, or NH,
wherein if q is 1, R.sup.1 and R.sup.2 are both methyl groups,
R.sup.4 and R.sup.5 are both linoleyl moieties, and Y and Z are
both 0, then the alkylamino group is attached to one of the two
carbons adjacent to Y or Z (i.e., at the `4` or `6` position of the
6-membered ring).
[0389] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, q is 2. In a particular embodiments, Y and Z are both
oxygen (O). In other embodiments, R.sup.3 is absent when the pH is
above the pK.sub.a of the cationic lipid and R.sup.3 is hydrogen
when the pH is below the pK.sub.a of the cationic lipid such that
the amino head group is protonated. In an alternative embodiment,
R.sup.3 is an optionally substituted C.sub.1-C.sub.4 alkyl to
provide a quaternary amine. In further embodiments, R.sup.4 and
R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0390] In other embodiments, R.sup.4 and R.sup.5 are independently
selected from the group consisting of a dodecadienyl moiety, a
tetradecadienyl moiety, a hexadecadienyl moiety, an octadecadienyl
moiety, an icosadienyl moiety, a dodecatrienyl moiety, a
tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linoleyl moieties, linolenyl moieties, .gamma.-linolenyl moieties,
or phytanyl moieties.
[0391] The alkylamino head group of Formula XIII may be attached to
the `4` or `5` position of the 6-membered ring as shown below in an
exemplary embodiment wherein R.sup.1 and R.sup.2 are both methyl
groups:
##STR00025##
[0392] In further embodiments, the 6-membered ring of Formula XIII
may be substituted with 1, 2, 3, 4, or 5 independently selected
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, C.sub.1-C.sub.6 alkoxyl, or hydroxyl substituents. In one
particular embodiment, the 6-membered ring is substituted with 1,
2, 3, 4, or 5 independently selected C.sub.1-C.sub.4 alkyl (e.g.,
methyl, ethyl, propyl, or butyl) substituents. An exemplary
embodiment of a cationic lipid of Formula XIII having a substituted
6-membered ring (methyl group attached to the `4` position) and
wherein R.sup.1 and R.sup.2 are both methyl groups is shown
below:
##STR00026##
[0393] In particular embodiments, the cationic lipids of Formula
XIII may be synthesized using 2-hydroxymethyl-1,4-butanediol and
1,3,5-pentanetriol (or 3-methyl-1,3,5-pentanetriol) as starting
materials.
[0394] In some embodiments, the cationic lipid of Formula XIII
forms a salt (preferably a crystalline salt) with one or more
anions. In one particular embodiment, the cationic lipid of Formula
XIII is the oxalate (e.g., hemioxalate) salt thereof, which is
preferably a crystalline salt.
[0395] In a particularly preferred embodiment, the cationic lipid
of Formula XIII has the structure:
##STR00027##
[0396] In still yet another aspect, the present invention provides
a cationic lipid of Formula XIV having the following structure:
##STR00028##
or salts thereof, wherein: R.sup.1 and R.sup.2 are either the same
or different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof; R.sup.3 is either absent or is
hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.12-C.sub.24 alkyl,
C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl, wherein at least one of R.sup.4 and R.sup.5
comprises at least one site of unsaturation in the trans (E)
configuration; m, n, and p are either the same or different and are
independently either 0, 1, or 2, with the proviso that m, n, and p
are not simultaneously 0; q is 0, 1, 2, 3, or 4; and Y and Z are
either the same or different and are independently O, S, or NH.
[0397] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, q is 2. In other embodiments, R.sup.3 is absent when
the pH is above the pK.sub.a of the cationic lipid and R.sup.3 is
hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0398] In certain embodiments, at least one of R.sup.4 and R.sup.5
further comprises one, two, three, four, five, six, or more sites
of unsaturation in the cis and/or trans configuration. In some
instances, R.sup.4 and R.sup.5 are independently selected from any
of the substituted or unsubstituted alkyl or acyl groups described
herein, wherein at least one or both of R.sup.4 and R.sup.5
comprises at least one, two, three, four, five, or six sites of
unsaturation in the trans configuration. In one particular
embodiment, R.sup.4 and R.sup.5 independently comprise a backbone
of from about 12 to about 22 carbon atoms (e.g., 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, or 22 carbon atoms), and one or both of
R.sup.4 and R.sup.5 independently comprise at least one, two,
three, four, five, or six sites of unsaturation in the trans
configuration. In some preferred embodiments, at least one of
R.sup.4 and R.sup.5 comprises an (E)-heptadeceyl moiety. In other
preferred embodiments, R.sup.4 and R.sup.5 are both
(E)-8-heptadeceyl moieties.
[0399] In some embodiments, the cationic lipid of Formula XIV forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula XIV is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0400] In a particularly preferred embodiment, the cationic lipid
of Formula XIV has the structure:
##STR00029##
[0401] In another aspect, the present invention provides a cationic
lipid of Formula XV having the following structure:
##STR00030##
[0402] or salts thereof, wherein: R.sup.1 and R.sup.2 are joined to
form an optionally substituted heterocyclic ring of 4 to 6 carbon
atoms and 1 or 2 heteroatoms selected from the group consisting of
nitrogen (N), oxygen (O), and mixtures thereof; R.sup.3 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; R.sup.4 and R.sup.5 are either the same or
different and are independently an optionally substituted
C.sub.12-C.sub.24 alkyl, C.sub.12-C.sub.24 alkenyl,
C.sub.12-C.sub.24 alkynyl, or C.sub.12-C.sub.24 acyl; m, n, and p
are either the same or different and are independently either 0, 1,
or 2, with the proviso that m, n, and p are not simultaneously 0; q
is 0, 1, 2, 3, or 4; and Y and Z are either the same or different
and are independently O, S, or NH.
[0403] In some embodiments, R.sup.1 and R.sup.2 are joined to form
a heterocyclic ring of 5 carbon atoms and 1 nitrogen atom. In
certain instances, the heterocyclic ring is substituted with a
substituent such as a hydroxyl group at the ortho, meta, and/or
para positions. In a preferred embodiment, q is 2. In other
embodiments, R.sup.3 is absent when the pH is above the pK.sub.a of
the cationic lipid and R.sup.3 is hydrogen when the pH is below the
pK.sub.a of the cationic lipid such that the amino head group is
protonated. In an alternative embodiment, R.sup.3 is an optionally
substituted C.sub.1-C.sub.4 alkyl to provide a quaternary amine. In
further embodiments, R.sup.4 and R.sup.5 are independently an
optionally substituted C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkenyl,
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkynyl, or
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl.
[0404] In certain embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, and a branched
alkyl group as described above (e.g., a phytanyl moiety), as well
as acyl derivatives thereof (e.g., linoleoyl, linolenoyl,
.gamma.-linolenoyl, phytanoyl, etc.). In some instances, the
octadecadienyl moiety is a linoleyl moiety. In other instances, the
octadecatrienyl moiety is a linolenyl moiety or a .gamma.-linolenyl
moiety. In particular embodiments, R.sup.4 and R.sup.5 are both
linoleyl moieties, linolenyl moieties, .gamma.-linolenyl moieties,
or phytanyl moieties.
[0405] In some embodiments, the cationic lipid of Formula XV forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula XV is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0406] In a particularly preferred embodiment, the cationic lipid
of Formula XV has the structure:
##STR00031##
[0407] In yet another aspect, the present invention provides a
cationic lipid of Formula XVI having the following structure:
##STR00032##
or salts thereof, wherein: [0408] R.sup.1 and R.sup.2 are either
the same or different and are independently an optionally
substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or
C.sub.2-C.sub.6 alkynyl, or R.sup.1 and R.sup.2 may join to form an
optionally substituted heterocyclic ring of 4 to 6 carbon atoms and
1 or 2 heteroatoms selected from the group consisting of nitrogen
(N), oxygen (O), and mixtures thereof; [0409] R.sup.3 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; [0410] R.sup.4 and R.sup.5 are either the same or
different and are independently a substituted C.sub.12-C.sub.24
alkyl; and [0411] n is 0, 1, 2, 3, or 4.
[0412] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In one particular
embodiment, n is 1. In another particular embodiment, n is 2. In
other embodiments, R.sup.3 is absent when the pH is above the
pK.sub.a of the cationic lipid and R.sup.3 is hydrogen when the pH
is below the pK.sub.a of the cationic lipid such that the amino
head group is protonated. In an alternative embodiment, R.sup.3 is
an optionally substituted C.sub.1-C.sub.4 alkyl to provide a
quaternary amine.
[0413] In embodiments where at least one of R.sup.4 and R.sup.5
comprises a branched alkyl group (e.g., a substituted
C.sub.12-C.sub.24 alkyl group), the branched alkyl group may
comprise a C.sub.12-C.sub.24 alkyl having at least 1-6 (e.g., 1, 2,
3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl substituents. In
particular embodiments, the branched alkyl group comprises a
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl with 1-6 (e.g., 1, 2,
3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl, ethyl, propyl, or
butyl) substituents. Preferably, the branched alkyl group comprises
a phytanyl (3,7,11,15-tetramethyl-hexadecanyl) moiety. In
particular embodiments, R.sup.4 and R.sup.5 are both phytanyl
moieties.
[0414] In alternative embodiments, at least one of R.sup.4 and
R.sup.5 comprises a branched acyl group (e.g., a substituted
C.sub.12-C.sub.24 acyl group). In certain instances, the branched
acyl group may comprise a C.sub.12-C.sub.24 acyl having at least
1-6 (e.g., 1, 2, 3, 4, 5, 6, or more) C.sub.1-C.sub.6 alkyl
substituents. In particular embodiments, the branched acyl group
comprises a C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl with 1-6
(e.g., 1, 2, 3, 4, 5, 6) C.sub.1-C.sub.4 alkyl (e.g., methyl,
ethyl, propyl, or butyl) substituents. Preferably, the branched
acyl group comprises a phytanoyl
(3,7,11,15-tetramethyl-hexadecanoyl) moiety. In particular
embodiments, R.sup.4 and R.sup.5 are both phytanoyl moieties.
[0415] In some embodiments, the cationic lipid of Formula XVI forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula XVI is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0416] In a particularly preferred embodiment, the cationic lipid
of Formula XVI has a structure selected from the group consisting
of:
##STR00033##
[0417] The synthesis of cationic lipids of Formulas V-XVI is
described herein and in PCT Application No. PCT/CA2010/001029
entitled "Improved Cationic Lipids and Methods for the Delivery of
Therapeutic Agents," filed Jun. 30, 2010, bearing Attorney Docket
No. 020801-009420PC, the disclosure of which is herein incorporated
by reference in its entirety for all purposes.
[0418] Other cationic lipids or salts thereof which may be included
in the lipid particles of the present invention include, but are
not limited to, 1,2-dioeylcarbamoyloxy-3-dimethylaminopropane
(DO-C-DAP), 1,2-dimyristoleoyl-3-dimethylaminopropane (DMDAP),
1,2-dioleoyl-3-trimethylaminopropane chloride (DOTAP.Cl),
dilinoleylmethyl-3-dimethylaminopropionate (DLin-M-K-DMA; also
known as DLin-M-DMA), N,N-dioleyl-N,N-dimethylammonium chloride
(DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA),
1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA),
N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
(DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1--
2'-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),
1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP),
1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride
salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane
(DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP),
3-(N,N-dioleylamino)-1,2-propanedio (DOAP),
1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), and mixtures thereof.
[0419] Additional cationic lipids or salts thereof which may be
included in the lipid particles of the present invention include,
without limitation, cationic lipids such as
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino) butanoate (DLin-M-C3-DMA or "MC3") and certain
analogs thereof as described in U.S. Provisional Patent Application
No. 61/334,104, entitled "Novel Cationic Lipids and Methods of Use
Thereof," filed May 12, 2010, and PCT Publication Nos. WO
2010/054401, WO 2010/054405, WO 2010/054406, and WO 2010/054384,
the disclosures of which are herein incorporated by reference in
their entirety for all purposes.
[0420] The synthesis of cationic lipids such as DO-C-DAP, DMDAP,
DOTAP.Cl, DLin-M-K-DMA, as well as additional cationic lipids, is
described in PCT Publication No. WO 2010/042877, the disclosure of
which is incorporated herein by reference in its entirety for all
purposes.
[0421] The synthesis of cationic lipids such as DLin-C-DAP,
DLinDAC, DLinMA, DLinDAP, DLin-S-DMA, DLin-2-DMAP, DLinTMA.Cl,
DLinTAP.Cl, DLinMPZ, DLinAP, DOAP, and DLin-EG-DMA, as well as
additional cationic lipids, is described in PCT Publication No. WO
09/086558, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0422] The synthesis of cationic lipids such as CLinDMA, as well as
additional cationic lipids, is described in U.S. Patent Publication
No. 20060240554, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0423] The synthesis of a number of other cationic lipids and
related analogs has been described in U.S. Pat. Nos. 5,208,036;
5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT
Publication No. WO 96/10390, the disclosures of which are each
herein incorporated by reference in their entirety for all
purposes. Additionally, a number of commercial preparations of
cationic lipids can be used, such as, e.g., LIPOFECTIN.RTM.
(including DOTMA and DOPE, available from GIBCO/BRL);
LIPOFECTAMINE.RTM. (including DOSPA and DOPE, available from
GIBCO/BRL); and TRANSFECTAM.RTM. (including DOGS, available from
Promega Corp.).
[0424] In some embodiments, the cationic lipid comprises from about
45 mol % to about 90 mol %, from about 45 mol % to about 85 mol %,
from about 45 mol % to about 80 mol %, from about 45 mol % to about
75 mol %, from about 45 mol % to about 70 mol %, from about 45 mol
% to about 65 mol %, from about 45 mol % to about 60 mol %, from
about 45 mol % to about 55 mol %, from about 50 mol % to about 90
mol %, from about 50 mol % to about 85 mol %, from about 50 mol %
to about 80 mol %, from about 50 mol % to about 75 mol %, from
about 50 mol % to about 70 mol %, from about 50 mol % to about 65
mol %, from about 50 mol % to about 60 mol %, from about 55 mol %
to about 65 mol % or from about 55 mol % to about 70 mol % (or any
fraction thereof or range therein) of the total lipid present in
the particle.
[0425] In certain preferred embodiments, the cationic lipid
comprises from about 50 mol % to about 58 mol %, from about 51 mol
% to about 59 mol %, from about 51 mol % to about 58 mol %, from
about 51 mol % to about 57 mol %, from about 52 mol % to about 58
mol %, from about 52 mol % to about 57 mol %, from about 52 mol %
to about 56 mol %, or from about 53 mol % to about 55 mol % (or any
fraction thereof or range therein) of the total lipid present in
the particle. In particular embodiments, the cationic lipid
comprises about 50 mol %, 51 mol %, 52 mol %, 53 mol %, 54 mol %,
55 mol %, 56 mol %, 57 mol %, 58 mol %, 59 mol %, 60 mol %, 61 mol
%, 62 mol %, 63 mol %, 64 mol %, or 65 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle. In certain other embodiments, the cationic lipid
comprises (at least) about 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,
76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 mol %
(or any fraction thereof or range therein) of the total lipid
present in the particle.
[0426] In additional embodiments, the cationic lipid comprises from
about 2 mol % to about 60 mol %, from about 5 mol % to about 50 mol
%, from about 10 mol % to about 50 mol %, from about 20 mol % to
about 50 mol %, from about 20 mol % to about 40 mol %, from about
30 mol % to about 40 mol %, or about 40 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle.
[0427] Additional percentages and ranges of cationic lipids
suitable for use in the lipid particles of the present invention
are described in PCT Publication No. WO 09/127060, U.S. application
Ser. No. 12/794,701, filed Jun. 4, 2010, and U.S. application Ser.
No. 12/828,189, filed Jun. 30, 2010, the disclosures of which are
herein incorporated by reference in their entirety for all
purposes.
[0428] It should be understood that the percentage of cationic
lipid present in the lipid particles of the invention is a target
amount, and that the actual amount of cationic lipid present in the
formulation may vary, for example, by .+-.5 mol %. For example, in
the 1:57 lipid particle (e.g., SNALP) formulation, the target
amount of cationic lipid is 57.1 mol %, but the actual amount of
cationic lipid may be .+-.5 mol %, .+-.4 mol %, .+-.3 mol %, .+-.2
mol %, .+-.1 mol %, .+-.0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %,
or .+-.0.1 mol % of that target amount, with the balance of the
formulation being made up of other lipid components (adding up to
100 mol % of total lipids present in the particle). Similarly, in
the 7:54 lipid particle (e.g., SNALP) formulation, the target
amount of cationic lipid is 54.06 mol %, but the actual amount of
cationic lipid may be .+-.5 mol %, .+-.4 mol %, .+-.3 mol %, .+-.2
mol %, .+-.1 mol %, 0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or
.+-.0.1 mol % of that target amount, with the balance of the
formulation being made up of other lipid components (adding up to
100 mol % of total lipids present in the particle).
[0429] B. Non-Cationic Lipids
[0430] The non-cationic lipids used in the lipid particles of the
invention (e.g., SNALP) can be any of a variety of neutral
uncharged, zwitterionic, or anionic lipids capable of producing a
stable complex.
[0431] Non-limiting examples of non-cationic lipids include
phospholipids such as lecithin, phosphatidylethanolamine,
lysolecithin, lysophosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM),
cephalin, cardiolipin, phosphatidic acid, cerebrosides,
dicetylphosphate, distearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoyl-phosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
palmitoyloleyol-phosphatidylglycerol (POPG),
dioleoylphosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dimyristoyl-phosphatidylethanolamine (DMPE),
distearoyl-phosphatidylethanolamine (DSPE),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine,
dielaidoyl-phosphatidylethanolamine (DEPE),
stearoyloleoyl-phosphatidylethanolamine (SOPE),
lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and
mixtures thereof. Other diacylphosphatidylcholine and
diacylphosphatidylethanolamine phospholipids can also be used. The
acyl groups in these lipids are preferably acyl groups derived from
fatty acids having C.sub.10-C.sub.24 carbon chains, e.g., lauroyl,
myristoyl, palmitoyl, stearoyl, or oleoyl.
[0432] Additional examples of non-cationic lipids include sterols
such as cholesterol and derivatives thereof. Non-limiting examples
of cholesterol derivatives include polar analogues such as
5.alpha.-cholestanol, 5.beta.-coprostanol,
cholesteryl-(2'-hydroxy)-ethyl ether,
cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol;
non-polar analogues such as 5.alpha.-cholestane, cholestenone,
5.alpha.-cholestanone, 5.beta.-cholestanone, and cholesteryl
decanoate; and mixtures thereof. In preferred embodiments, the
cholesterol derivative is a polar analogue such as
cholesteryl-(4'-hydroxy)-butyl ether. The synthesis of
cholesteryl-(2'-hydroxy)-ethyl ether is described in PCT
Publication No. WO 09/127060, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0433] In some embodiments, the non-cationic lipid present in the
lipid particles (e.g., SNALP) comprises or consists of a mixture of
one or more phospholipids and cholesterol or a derivative thereof.
In other embodiments, the non-cationic lipid present in the lipid
particles (e.g., SNALP) comprises or consists of one or more
phospholipids, e.g., a cholesterol-free lipid particle formulation.
In yet other embodiments, the non-cationic lipid present in the
lipid particles (e.g., SNALP) comprises or consists of cholesterol
or a derivative thereof, e.g., a phospholipid-free lipid particle
formulation.
[0434] Other examples of non-cationic lipids suitable for use in
the present invention include nonphosphorous containing lipids such
as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl
palmitate, glycerolricinoleate, hexadecyl stereate, isopropyl
myristate, amphoteric acrylic polymers, triethanolamine-lauryl
sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and
the like.
[0435] In some embodiments, the non-cationic lipid comprises from
about 10 mol % to about 60 mol %, from about 20 mol % to about 55
mol %, from about 20 mol % to about 45 mol %, from about 20 mol %
to about 40 mol %, from about 25 mol % to about 50 mol %, from
about 25 mol % to about 45 mol %, from about 30 mol % to about 50
mol %, from about 30 mol % to about 45 mol %, from about 30 mol %
to about 40 mol %, from about 35 mol % to about 45 mol %, from
about 37 mol % to about 42 mol %, or about 35 mol %, 36 mol %, 37
mol %, 38 mol %, 39 mol %, 40 mol %, 41 mol %, 42 mol %, 43 mol %,
44 mol %, or 45 mol % (or any fraction thereof or range therein) of
the total lipid present in the particle.
[0436] In embodiments where the lipid particles contain a mixture
of phospholipid and cholesterol or a cholesterol derivative, the
mixture may comprise up to about 40 mol %, 45 mol %, 50 mol %, 55
mol %, or 60 mol % of the total lipid present in the particle.
[0437] In some embodiments, the phospholipid component in the
mixture may comprise from about 2 mol % to about 20 mol %, from
about 2 mol % to about 15 mol %, from about 2 mol % to about 12 mol
%, from about 4 mol % to about 15 mol %, or from about 4 mol % to
about 10 mol % (or any fraction thereof or range therein) of the
total lipid present in the particle. In certain preferred
embodiments, the phospholipid component in the mixture comprises
from about 5 mol % to about 10 mol %, from about 5 mol % to about 9
mol %, from about 5 mol % to about 8 mol %, from about 6 mol % to
about 9 mol %, from about 6 mol % to about 8 mol %, or about 5 mol
%, 6 mol %, 7 mol %, 8 mol %, 9 mol %, or 10 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle. As a non-limiting example, a 1:57 lipid particle
formulation comprising a mixture of phospholipid and cholesterol
may comprise a phospholipid such as DPPC or DSPC at about 7 mol %
(or any fraction thereof), e.g., in a mixture with cholesterol or a
cholesterol derivative at about 34 mol % (or any fraction thereof)
of the total lipid present in the particle. As another non-limiting
example, a 7:54 lipid particle formulation comprising a mixture of
phospholipid and cholesterol may comprise a phospholipid such as
DPPC or DSPC at about 7 mol % (or any fraction thereof), e.g., in a
mixture with cholesterol or a cholesterol derivative at about 32
mol % (or any fraction thereof) of the total lipid present in the
particle.
[0438] In other embodiments, the cholesterol component in the
mixture may comprise from about 25 mol % to about 45 mol %, from
about 25 mol % to about 40 mol %, from about 30 mol % to about 45
mol %, from about 30 mol % to about 40 mol %, from about 27 mol %
to about 37 mol %, from about 25 mol % to about 30 mol %, or from
about 35 mol % to about 40 mol % (or any fraction thereof or range
therein) of the total lipid present in the particle. In certain
preferred embodiments, the cholesterol component in the mixture
comprises from about 25 mol % to about 35 mol %, from about 27 mol
% to about 35 mol %, from about 29 mol % to about 35 mol %, from
about 30 mol % to about 35 mol %, from about 30 mol % to about 34
mol %, from about 31 mol % to about 33 mol %, or about 30 mol %, 31
mol %, 32 mol %, 33 mol %, 34 mol %, or 35 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle. In other embodiments, the cholesterol component in the
mixture comprises about 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45
mol % (or any fraction thereof or range therein) of the total lipid
present in the particle. Typically, a 1:57 lipid particle
formulation comprising a mixture of phospholipid and cholesterol
may comprise cholesterol or a cholesterol derivative at about 34
mol % (or any fraction thereof), e.g., in a mixture with a
phospholipid such as DPPC or DSPC at about 7 mol % (or any fraction
thereof) of the total lipid present in the particle. Typically, a
7:54 lipid particle formulation comprising a mixture of
phospholipid and cholesterol may comprise cholesterol or a
cholesterol derivative at about 32 mol % (or any fraction thereof),
e.g., in a mixture with a phospholipid such as DPPC or DSPC at
about 7 mol % (or any fraction thereof) of the total lipid present
in the particle.
[0439] In embodiments where the lipid particles are
phospholipid-free, the cholesterol or derivative thereof may
comprise up to about 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol
%, 50 mol %, 55 mol %, or 60 mol % of the total lipid present in
the particle.
[0440] In some embodiments, the cholesterol or derivative thereof
in the phospholipid-free lipid particle formulation may comprise
from about 25 mol % to about 45 mol %, from about 25 mol % to about
40 mol %, from about 30 mol % to about 45 mol %, from about 30 mol
% to about 40 mol %, from about 31 mol % to about 39 mol %, from
about 32 mol % to about 38 mol %, from about 33 mol % to about 37
mol %, from about 35 mol % to about 45 mol %, from about 30 mol %
to about 35 mol %, from about 35 mol % to about 40 mol %, or about
30 mol %, 31 mol %, 32 mol %, 33 mol %, 34 mol %, 35 mol %, 36 mol
%, 37 mol %, 38 mol %, 39 mol %, 40 mol %, 41 mol %, 42 mol %, 43
mol %, 44 mol %, or 45 mol % (or any fraction thereof or range
therein) of the total lipid present in the particle. As a
non-limiting example, a 1:62 lipid particle formulation may
comprise cholesterol at about 37 mol % (or any fraction thereof) of
the total lipid present in the particle. As another non-limiting
example, a 7:58 lipid particle formulation may comprise cholesterol
at about 35 mol % (or any fraction thereof) of the total lipid
present in the particle.
[0441] In other embodiments, the non-cationic lipid comprises from
about 5 mol % to about 90 mol %, from about 10 mol % to about 85
mol %, from about 20 mol % to about 80 mol %, about 10 mol % (e.g.,
phospholipid only), or about 60 mol % (e.g., phospholipid and
cholesterol or derivative thereof) (or any fraction thereof or
range therein) of the total lipid present in the particle.
[0442] Additional percentages and ranges of non-cationic lipids
suitable for use in the lipid particles of the present invention
are described in PCT Publication No. WO 09/127060, U.S. application
Ser. No. 12/794,701, filed Jun. 4, 2010, and U.S. application Ser.
No. 12/828,189, filed Jun. 30, 2010, the disclosures of which are
herein incorporated by reference in their entirety for all
purposes.
[0443] It should be understood that the percentage of non-cationic
lipid present in the lipid particles of the invention is a target
amount, and that the actual amount of non-cationic lipid present in
the formulation may vary, for example, by .+-.5 mol %. For example,
in the 1:57 lipid particle (e.g., SNALP) formulation, the target
amount of phospholipid is 7.1 mol % and the target amount of
cholesterol is 34.3 mol %, but the actual amount of phospholipid
may be .+-.2 mol %, .+-.1.5 mol %, .+-.1 mol %, .+-.0.75 mol %,
.+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol % of that target
amount, and the actual amount of cholesterol may be .+-.3 mol %,
.+-.2 mol %, .+-.1 mol %, .+-.0.75 mol %, .+-.0.5 mol %, .+-.0.25
mol %, or .+-.0.1 mol % of that target amount, with the balance of
the formulation being made up of other lipid components (adding up
to 100 mol % of total lipids present in the particle). Similarly,
in the 7:54 lipid particle (e.g., SNALP) formulation, the target
amount of phospholipid is 6.75 mol % and the target amount of
cholesterol is 32.43 mol %, but the actual amount of phospholipid
may be .+-.2 mol %, 1.5 mol %, 1 mol %, 0.75 mol %, 0.5 mol %, 0.25
mol %, or .+-.0.1 mol % of that target amount, and the actual
amount of cholesterol may be .+-.3 mol %, .+-.2 mol %, .+-.1 mol %,
.+-.0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol % of
that target amount, with the balance of the formulation being made
up of other lipid components (adding up to 100 mol % of total
lipids present in the particle).
[0444] C. Lipid Conjugates
[0445] In addition to cationic and non-cationic lipids, the lipid
particles of the invention (e.g., SNALP) may further comprise a
lipid conjugate. The conjugated lipid is useful in that it prevents
the aggregation of particles. Suitable conjugated lipids include,
but are not limited to, PEG-lipid conjugates, POZ-lipid conjugates,
ATTA-lipid conjugates, cationic-polymer-lipid conjugates (CPLs),
and mixtures thereof. In certain embodiments, the particles
comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate
together with a CPL.
[0446] In a preferred embodiment, the lipid conjugate is a
PEG-lipid. Examples of PEG-lipids include, but are not limited to,
PEG coupled to dialkyloxypropyls (PEG-DAA) as described in, e.g.,
PCT Publication No. WO 05/026372, PEG coupled to diacylglycerol
(PEG-DAG) as described in, e.g., U.S. Patent Publication Nos.
20030077829 and 2005008689, PEG coupled to phospholipids such as
phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides as
described in, e.g., U.S. Pat. No. 5,885,613, PEG conjugated to
cholesterol or a derivative thereof, and mixtures thereof. The
disclosures of these patent documents are herein incorporated by
reference in their entirety for all purposes.
[0447] Additional PEG-lipids suitable for use in the invention
include, without limitation,
mPEG2000-1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG). The
synthesis of PEG-C-DOMG is described in PCT Publication No. WO
09/086558, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. Yet additional suitable
PEG-lipid conjugates include, without limitation,
1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbam-
oyl-.omega.-methyl-poly(ethylene glycol) (2KPEG-DMG). The synthesis
of 2KPEG-DMG is described in U.S. Pat. No. 7,404,969, the
disclosure of which is herein incorporated by reference in its
entirety for all purposes.
[0448] PEG is a linear, water-soluble polymer of ethylene PEG
repeating units with two terminal hydroxyl groups. PEGs are
classified by their molecular weights; for example, PEG 2000 has an
average molecular weight of about 2,000 daltons, and PEG 5000 has
an average molecular weight of about 5,000 daltons. PEGs are
commercially available from Sigma Chemical Co. and other companies
and include, but are not limited to, the following:
monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene
glycol-succinate (MePEG-S), monomethoxypolyethylene
glycol-succinimidyl succinate (MePEG-S-NHS),
monomethoxypolyethylene glycol-amine (MePEG-NH.sub.2),
monomethoxypolyethylene glycol-tresylate (MePEG-TRES),
monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG-IM), as
well as such compounds containing a terminal hydroxyl group instead
of a terminal methoxy group (e.g., HO-PEG-S, HO-PEG-S--NHS,
HO-PEG-NH.sub.2, etc.). Other PEGs such as those described in U.S.
Pat. Nos. 6,774,180 and 7,053,150 (e.g., mPEG (20 KDa)amine) are
also useful for preparing the PEG-lipid conjugates of the present
invention. The disclosures of these patents are herein incorporated
by reference in their entirety for all purposes. In addition,
monomethoxypolyethyleneglycol-acetic acid (MePEG-CH.sub.2COOH) is
particularly useful for preparing PEG-lipid conjugates including,
e.g., PEG-DAA conjugates.
[0449] The PEG moiety of the PEG-lipid conjugates described herein
may comprise an average molecular weight ranging from about 550
daltons to about 10,000 daltons. In certain instances, the PEG
moiety has an average molecular weight of from about 750 daltons to
about 5,000 daltons (e.g., from about 1,000 daltons to about 5,000
daltons, from about 1,500 daltons to about 3,000 daltons, from
about 750 daltons to about 3,000 daltons, from about 750 daltons to
about 2,000 daltons, etc.). In other instances, the PEG moiety has
an average molecular weight of from about 550 daltons to about 1000
daltons, from about 250 daltons to about 1000 daltons, from about
400 daltons to about 1000 daltons, from about 600 daltons to about
900 daltons, from about 700 daltons to about 800 daltons, or about
200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800,
850, 900, 950, or 1000 daltons. In preferred embodiments, the PEG
moiety has an average molecular weight of about 2,000 daltons or
about 750 daltons.
[0450] In certain instances, the PEG can be optionally substituted
by an alkyl, alkoxy, acyl, or aryl group. The PEG can be conjugated
directly to the lipid or may be linked to the lipid via a linker
moiety. Any linker moiety suitable for coupling the PEG to a lipid
can be used including, e.g., non-ester containing linker moieties
and ester-containing linker moieties. In a preferred embodiment,
the linker moiety is a non-ester containing linker moiety. As used
herein, the term "non-ester containing linker moiety" refers to a
linker moiety that does not contain a carboxylic ester bond
(--OC(O)--). Suitable non-ester containing linker moieties include,
but are not limited to, amido (--C(O)NH--), amino (--NR--),
carbonyl (--C(O)--), carbamate (--NHC(O)O--), urea (--NHC(O)NH--),
disulphide (--S--S--), ether (--O--), succinyl
(--(O)CCH.sub.2CH.sub.2C(O)--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, as well as
combinations thereof (such as a linker containing both a carbamate
linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0451] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof. Phosphatidylethanolamines having a variety of
acyl chain groups of varying chain lengths and degrees of
saturation can be conjugated to PEG to form the lipid conjugate.
Such phosphatidylethanolamines are commercially available, or can
be isolated or synthesized using conventional techniques known to
those of skilled in the art. Phosphatidyl-ethanolamines containing
saturated or unsaturated fatty acids with carbon chain lengths in
the range of C.sub.10 to C.sub.20 are preferred.
Phosphatidylethanolamines with mono- or diunsaturated fatty acids
and mixtures of saturated and unsaturated fatty acids can also be
used. Suitable phosphatidylethanolamines include, but are not
limited to, dimyristoyl-phosphatidylethanolamine (DMPE),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dioleoylphosphatidylethanolamine (DOPE), and
distearoyl-phosphatidylethanolamine (DSPE).
[0452] The term "ATTA" or "polyamide" includes, without limitation,
compounds described in U.S. Pat. Nos. 6,320,017 and 6,586,559, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes. These compounds include a compound
having the formula:
##STR00034##
wherein R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0453] The term "diacylglycerol" or "DAG" includes a compound
having 2 fatty acyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons bonded to the 1- and
2-position of glycerol by ester linkages. The acyl groups can be
saturated or have varying degrees of unsaturation. Suitable acyl
groups include, but are not limited to, lauroyl (C.sub.12),
myristoyl (C.sub.14), palmitoyl (C.sub.16), stearoyl (C.sub.18),
and icosoyl (C.sub.20). In preferred embodiments, R.sup.1 and
R.sup.2 are the same, i.e., R.sup.1 and R.sup.2 are both myristoyl
(i.e., dimyristoyl), R.sup.1 and R.sup.2 are both stearoyl (i.e.,
distearoyl), etc. Diacylglycerols have the following general
formula:
##STR00035##
[0454] The term "dialkyloxypropyl" or "DAA" includes a compound
having 2 alkyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons. The alkyl groups can be
saturated or have varying degrees of unsaturation.
Dialkyloxypropyls have the following general formula:
##STR00036##
[0455] In a preferred embodiment, the PEG-lipid is a PEG-DAA
conjugate having the following formula:
##STR00037##
wherein R.sup.1 and R.sup.2 are independently selected and are
long-chain alkyl groups having from about 10 to about 22 carbon
atoms; PEG is a polyethyleneglycol; and L is a non-ester containing
linker moiety or an ester containing linker moiety as described
above. The long-chain alkyl groups can be saturated or unsaturated.
Suitable alkyl groups include, but are not limited to, decyl
(C.sub.10), lauryl (C.sub.12), myristyl (C.sub.14), palmityl
(C.sub.16), stearyl (C.sub.18), and icosyl (C20). In preferred
embodiments, R.sup.1 and R.sup.2 are the same, i.e., R.sup.1 and
R.sup.2 are both myristyl (i.e., dimyristyl), R.sup.1 and R.sup.2
are both stearyl (i.e., distearyl), etc.
[0456] In Formula XX above, the PEG has an average molecular weight
ranging from about 550 daltons to about 10,000 daltons. In certain
instances, the PEG has an average molecular weight of from about
750 daltons to about 5,000 daltons (e.g., from about 1,000 daltons
to about 5,000 daltons, from about 1,500 daltons to about 3,000
daltons, from about 750 daltons to about 3,000 daltons, from about
750 daltons to about 2,000 daltons, etc.). In other instances, the
PEG moiety has an average molecular weight of from about 550
daltons to about 1000 daltons, from about 250 daltons to about 1000
daltons, from about 400 daltons to about 1000 daltons, from about
600 daltons to about 900 daltons, from about 700 daltons to about
800 daltons, or about 200, 250, 300, 350, 400, 450, 500, 550, 600,
650, 700, 750, 800, 850, 900, 950, or 1000 daltons. In preferred
embodiments, the PEG has an average molecular weight of about 2,000
daltons or about 750 daltons. The PEG can be optionally substituted
with alkyl, alkoxy, acyl, or aryl groups. In certain embodiments,
the terminal hydroxyl group is substituted with a methoxy or methyl
group.
[0457] In a preferred embodiment, "L" is a non-ester containing
linker moiety. Suitable non-ester containing linkers include, but
are not limited to, an amido linker moiety, an amino linker moiety,
a carbonyl linker moiety, a carbamate linker moiety, a urea linker
moiety, an ether linker moiety, a disulphide linker moiety, a
succinamidyl linker moiety, and combinations thereof. In a
preferred embodiment, the non-ester containing linker moiety is a
carbamate linker moiety (i.e., a PEG-C-DAA conjugate). In another
preferred embodiment, the non-ester containing linker moiety is an
amido linker moiety (i.e., a PEG-A-DAA conjugate). In yet another
preferred embodiment, the non-ester containing linker moiety is a
succinamidyl linker moiety (i.e., a PEG-S-DAA conjugate).
[0458] In particular embodiments, the PEG-lipid conjugate is
selected from:
##STR00038##
[0459] The PEG-DAA conjugates are synthesized using standard
techniques and reagents known to those of skill in the art. It will
be recognized that the PEG-DAA conjugates will contain various
amide, amine, ether, thio, carbamate, and urea linkages. Those of
skill in the art will recognize that methods and reagents for
forming these bonds are well known and readily available. See,
e.g., March, ADVANCED ORGANIC CHEMISTRY (Wiley 1992); Larock,
COMPREHENSIVE ORGANIC TRANSFORMATIONS (VCH 1989); and Furniss,
VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY, 5th ed. (Longman
1989). It will also be appreciated that any functional groups
present may require protection and deprotection at different points
in the synthesis of the PEG-DAA conjugates. Those of skill in the
art will recognize that such techniques are well known. See, e.g.,
Green and Wuts, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS (Wiley
1991).
[0460] Preferably, the PEG-DAA conjugate is a PEG-didecyloxypropyl
(C.sub.10) conjugate, a PEG-dilauryloxypropyl (C.sub.12) conjugate,
a PEG-dimyristyloxypropyl (C.sub.14) conjugate, a
PEG-dipalmityloxypropyl (C.sub.16) conjugate, or a
PEG-distearyloxypropyl (C.sub.18) conjugate. In these embodiments,
the PEG preferably has an average molecular weight of about 750 or
about 2,000 daltons. In one particularly preferred embodiment, the
PEG-lipid conjugate comprises PEG2000-C-DMA, wherein the "2000"
denotes the average molecular weight of the PEG, the "C" denotes a
carbamate linker moiety, and the "DMA" denotes dimyristyloxypropyl.
In another particularly preferred embodiment, the PEG-lipid
conjugate comprises PEG750-C-DMA, wherein the "750" denotes the
average molecular weight of the PEG, the "C" denotes a carbamate
linker moiety, and the "DMA" denotes dimyristyloxypropyl. In
particular embodiments, the terminal hydroxyl group of the PEG is
substituted with a methyl group. Those of skill in the art will
readily appreciate that other dialkyloxypropyls can be used in the
PEG-DAA conjugates of the present invention.
[0461] In addition to the foregoing, it will be readily apparent to
those of skill in the art that other hydrophilic polymers can be
used in place of PEG. Examples of suitable polymers that can be
used in place of PEG include, but are not limited to,
polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyl methacrylamide, polymethacrylamide and
polydimethylacrylamide, polylactic acid, polyglycolic acid, and
derivatized celluloses such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0462] In addition to the foregoing components, the lipid particles
(e.g., SNALP) of the present invention can further comprise
cationic poly(ethylene glycol) (PEG) lipids or CPLs (see, e.g.,
Chen et al., Bioconj. Chem., 11:433-437 (2000); U.S. Pat. No.
6,852,334; PCT Publication No. WO 00/62813, the disclosures of
which are herein incorporated by reference in their entirety for
all purposes).
[0463] Suitable CPLs include compounds of Formula XXI:
A-W--Y (XXI),
wherein A, W, and Y are as described below.
[0464] With reference to Formula XXI, "A" is a lipid moiety such as
an amphipathic lipid, a neutral lipid, or a hydrophobic lipid that
acts as a lipid anchor. Suitable lipid examples include, but are
not limited to, diacylglycerolyls, dialkylglycerolyls,
N--N-dialkylaminos, 1,2-diacyloxy-3-aminopropanes, and
1,2-dialkyl-3-aminopropanes.
[0465] "W" is a polymer or an oligomer such as a hydrophilic
polymer or oligomer. Preferably, the hydrophilic polymer is a
biocompatable polymer that is nonimmunogenic or possesses low
inherent immunogenicity. Alternatively, the hydrophilic polymer can
be weakly antigenic if used with appropriate adjuvants. Suitable
nonimmunogenic polymers include, but are not limited to, PEG,
polyamides, polylactic acid, polyglycolic acid, polylactic
acid/polyglycolic acid copolymers, and combinations thereof. In a
preferred embodiment, the polymer has a molecular weight of from
about 250 to about 7,000 daltons.
[0466] "Y" is a polycationic moiety. The term polycationic moiety
refers to a compound, derivative, or functional group having a
positive charge, preferably at least 2 positive charges at a
selected pH, preferably physiological pH. Suitable polycationic
moieties include basic amino acids and their derivatives such as
arginine, asparagine, glutamine, lysine, and histidine; spermine;
spermidine; cationic dendrimers; polyamines; polyamine sugars; and
amino polysaccharides. The polycationic moieties can be linear,
such as linear tetralysine, branched or dendrimeric in structure.
Polycationic moieties have between about 2 to about 15 positive
charges, preferably between about 2 to about 12 positive charges,
and more preferably between about 2 to about 8 positive charges at
selected pH values. The selection of which polycationic moiety to
employ may be determined by the type of particle application which
is desired.
[0467] The charges on the polycationic moieties can be either
distributed around the entire particle moiety, or alternatively,
they can be a discrete concentration of charge density in one
particular area of the particle moiety e.g., a charge spike. If the
charge density is distributed on the particle, the charge density
can be equally distributed or unequally distributed. All variations
of charge distribution of the polycationic moiety are encompassed
by the present invention.
[0468] The lipid "A" and the nonimmunogenic polymer "W" can be
attached by various methods and preferably by covalent attachment.
Methods known to those of skill in the art can be used for the
covalent attachment of "A" and "W." Suitable linkages include, but
are not limited to, amide, amine, carboxyl, carbonate, carbamate,
ester, and hydrazone linkages. It will be apparent to those skilled
in the art that "A" and "W" must have complementary functional
groups to effectuate the linkage. The reaction of these two groups,
one on the lipid and the other on the polymer, will provide the
desired linkage. For example, when the lipid is a diacylglycerol
and the terminal hydroxyl is activated, for instance with NHS and
DCC, to form an active ester, and is then reacted with a polymer
which contains an amino group, such as with a polyamide (see, e.g.,
U.S. Pat. Nos. 6,320,017 and 6,586,559, the disclosures of which
are herein incorporated by reference in their entirety for all
purposes), an amide bond will form between the two groups.
[0469] In certain instances, the polycationic moiety can have a
ligand attached, such as a targeting ligand or a chelating moiety
for complexing calcium. Preferably, after the ligand is attached,
the cationic moiety maintains a positive charge. In certain
instances, the ligand that is attached has a positive charge.
Suitable ligands include, but are not limited to, a compound or
device with a reactive functional group and include lipids,
amphipathic lipids, carrier compounds, bioaffinity compounds,
biomaterials, biopolymers, biomedical devices, analytically
detectable compounds, therapeutically active compounds, enzymes,
peptides, proteins, antibodies, immune stimulators, radiolabels,
fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides,
liposomes, virosomes, micelles, immunoglobulins, functional groups,
other targeting moieties, or toxins.
[0470] In some embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0.1 mol % to about 2 mol %, from about 0.5 mol
% to about 2 mol %, from about 1 mol % to about 2 mol %, from about
0.6 mol % to about 1.9 mol %, from about 0.7 mol % to about 1.8 mol
%, from about 0.8 mol % to about 1.7 mol %, from about 0.9 mol % to
about 1.6 mol %, from about 0.9 mol % to about 1.8 mol %, from
about 1 mol % to about 1.8 mol %, from about 1 mol % to about 1.7
mol %, from about 1.2 mol % to about 1.8 mol %, from about 1.2 mol
% to about 1.7 mol %, from about 1.3 mol % to about 1.6 mol %, from
about 1.4 mol % to about 1.5 mol %, or about 1, 1.1, 1.2, 1.3, 1.4,
1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol % (or any fraction thereof or
range therein) of the total lipid present in the particle.
[0471] In other embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0 mol % to about 20 mol %, from about 0.5 mol
% to about 20 mol %, from about 2 mol % to about 20 mol %, from
about 1.5 mol % to about 18 mol %, from about 2 mol % to about 15
mol %, from about 4 mol % to about 15 mol %, from about 2 mol % to
about 12 mol %, from about 5 mol % to about 12 mol %, or about 2
mol % (or any fraction thereof or range therein) of the total lipid
present in the particle.
[0472] In further embodiments, the lipid conjugate (e.g.,
PEG-lipid) comprises from about 4 mol % to about 10 mol %, from
about 5 mol % to about 10 mol %, from about 5 mol % to about 9 mol
%, from about 5 mol % to about 8 mol %, from about 6 mol % to about
9 mol %, from about 6 mol % to about 8 mol %, or about 5 mol %, 6
mol %, 7 mol %, 8 mol %, 9 mol %, or 10 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle.
[0473] Additional examples, percentages, and/or ranges of lipid
conjugates suitable for use in the lipid particles of the invention
are described in PCT Publication No. WO 09/127060, U.S. application
Ser. No. 12/794,701, filed Jun. 4, 2010, U.S. application Ser. No.
12/828,189, filed Jun. 30, 2010, U.S. Provisional Application No.
61/294,828, filed Jan. 13, 2010, U.S. Provisional Application No.
61/295,140, filed Jan. 14, 2010, and PCT Publication No. WO
2010/006282, the disclosures of which are herein incorporated by
reference in their entirety for all purposes.
[0474] It should be understood that the percentage of lipid
conjugate (e.g., PEG-lipid) present in the lipid particles of the
invention is a target amount, and that the actual amount of lipid
conjugate present in the formulation may vary, for example, by
.+-.2 mol %. For example, in the 1:57 lipid particle (e.g., SNALP)
formulation, the target amount of lipid conjugate is 1.4 mol %, but
the actual amount of lipid conjugate may be .+-.0.5 mol %, .+-.0.4
mol %, .+-.0.3 mol %, .+-.0.2 mol %, .+-.0.1 mol %, or .+-.0.05 mol
% of that target amount, with the balance of the formulation being
made up of other lipid components (adding up to 100 mol % of total
lipids present in the particle). Similarly, in the 7:54 lipid
particle (e.g., SNALP) formulation, the target amount of lipid
conjugate is 6.76 mol %, but the actual amount of lipid conjugate
may be .+-.2 mol %, .+-.1.5 mol %, .+-.1 mol %, .+-.0.75 mol %,
.+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol % of that target
amount, with the balance of the formulation being made up of other
lipid components (adding up to 100 mol % of total lipids present in
the particle).
[0475] One of ordinary skill in the art will appreciate that the
concentration of the lipid conjugate can be varied depending on the
lipid conjugate employed and the rate at which the lipid particle
is to become fusogenic.
[0476] By controlling the composition and concentration of the
lipid conjugate, one can control the rate at which the lipid
conjugate exchanges out of the lipid particle and, in turn, the
rate at which the lipid particle becomes fusogenic. For instance,
when a PEG-DAA conjugate is used as the lipid conjugate, the rate
at which the lipid particle becomes fusogenic can be varied, for
example, by varying the concentration of the lipid conjugate, by
varying the molecular weight of the PEG, or by varying the chain
length and degree of saturation of the alkyl groups on the PEG-DAA
conjugate. In addition, other variables including, for example, pH,
temperature, ionic strength, etc. can be used to vary and/or
control the rate at which the lipid particle becomes fusogenic.
Other methods which can be used to control the rate at which the
lipid particle becomes fusogenic will become apparent to those of
skill in the art upon reading this disclosure. Also, by controlling
the composition and concentration of the lipid conjugate, one can
control the lipid particle (e.g., SNALP) size.
VI. Preparation of Lipid Particles
[0477] The lipid particles of the present invention, e.g., SNALP,
in which a nucleic acid such as an interfering RNA (e.g., siRNA) is
entrapped within the lipid portion of the particle and is protected
from degradation, can be formed by any method known in the art
including, but not limited to, a continuous mixing method, a direct
dilution process, and an in-line dilution process.
[0478] In particular embodiments, the cationic lipids may comprise
one or more lipids of Formulas I-XVI or salts thereof, alone or in
combination with other cationic lipid species. In other
embodiments, the non-cationic lipids may comprise one or more
lipids including egg sphingomyelin (ESM),
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), 1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC),
dipalmitoyl-phosphatidylcholine (DPPC),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, 14:0 PE
(1,2-dimyristoyl-phosphatidylethanolamine (DMPE)), 16:0 PE
(1,2-dipalmitoyl-phosphatidylethanolamine (DPPE)), 18:0 PE
(1,2-distearoyl-phosphatidylethanolamine (DSPE)), 18:1 PE
(1,2-dioleoyl-phosphatidylethanolamine (DOPE)), 18:1 trans PE
(1,2-dielaidoyl-phosphatidylethanolamine (DEPE)), 18:0-18:1 PE
(1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE)), 16:0-18:1 PE
(1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE)),
polyethylene glycol-based polymers (e.g., PEG 2000, PEG 5000,
PEG-modified diacylglycerols, or PEG-modified dialkyloxypropyls),
cholesterol, derivatives thereof, or combinations thereof.
[0479] In certain embodiments, the present invention provides
nucleic acid-lipid particles (e.g., SNALP) produced via a
continuous mixing method, e.g., a process that includes providing
an aqueous solution comprising a nucleic acid (e.g., interfering
RNA) in a first reservoir, providing an organic lipid solution in a
second reservoir (wherein the lipids present in the organic lipid
solution are solubilized in an organic solvent, e.g., a lower
alkanol such as ethanol), and mixing the aqueous solution with the
organic lipid solution such that the organic lipid solution mixes
with the aqueous solution so as to substantially instantaneously
produce a lipid vesicle (e.g., liposome) encapsulating the nucleic
acid within the lipid vesicle. This process and the apparatus for
carrying out this process are described in detail in U.S. Patent
Publication No. 20040142025, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0480] The action of continuously introducing lipid and buffer
solutions into a mixing environment, such as in a mixing chamber,
causes a continuous dilution of the lipid solution with the buffer
solution, thereby producing a lipid vesicle substantially
instantaneously upon mixing. As used herein, the phrase
"continuously diluting a lipid solution with a buffer solution"
(and variations) generally means that the lipid solution is diluted
sufficiently rapidly in a hydration process with sufficient force
to effectuate vesicle generation. By mixing the aqueous solution
comprising a nucleic acid with the organic lipid solution, the
organic lipid solution undergoes a continuous stepwise dilution in
the presence of the buffer solution (i.e., aqueous solution) to
produce a nucleic acid-lipid particle.
[0481] The nucleic acid-lipid particles formed using the continuous
mixing method typically have a size of from about 30 nm to about
150 nm, from about 40 nm to about 150 nm, from about 50 nm to about
150 nm, from about 60 nm to about 130 nm, from about 70 nm to about
110 nm, from about 70 nm to about 100 nm, from about 80 nm to about
100 nm, from about 90 nm to about 100 nm, from about 70 to about 90
nm, from about 80 nm to about 90 nm, from about 70 nm to about 80
nm, less than about 120 nm, 110 nm, 100 nm, 90 nm, or 80 nm, or
about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70
nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115
nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm (or
any fraction thereof or range therein). The particles thus formed
do not aggregate and are optionally sized to achieve a uniform
particle size.
[0482] In another embodiment, the present invention provides
nucleic acid-lipid particles (e.g., SNALP) produced via a direct
dilution process that includes forming a lipid vesicle (e.g.,
liposome) solution and immediately and directly introducing the
lipid vesicle solution into a collection vessel containing a
controlled amount of dilution buffer. In preferred aspects, the
collection vessel includes one or more elements configured to stir
the contents of the collection vessel to facilitate dilution. In
one aspect, the amount of dilution buffer present in the collection
vessel is substantially equal to the volume of lipid vesicle
solution introduced thereto. As a non-limiting example, a lipid
vesicle solution in 45% ethanol when introduced into the collection
vessel containing an equal volume of dilution buffer will
advantageously yield smaller particles.
[0483] In yet another embodiment, the present invention provides
nucleic acid-lipid particles (e.g., SNALP) produced via an in-line
dilution process in which a third reservoir containing dilution
buffer is fluidly coupled to a second mixing region. In this
embodiment, the lipid vesicle (e.g., liposome) solution formed in a
first mixing region is immediately and directly mixed with dilution
buffer in the second mixing region. In preferred aspects, the
second mixing region includes a T-connector arranged so that the
lipid vesicle solution and the dilution buffer flows meet as
opposing 180.degree. flows; however, connectors providing shallower
angles can be used, e.g., from about 27.degree. to about
180.degree. (e.g., about 90.degree.). A pump mechanism delivers a
controllable flow of buffer to the second mixing region. In one
aspect, the flow rate of dilution buffer provided to the second
mixing region is controlled to be substantially equal to the flow
rate of lipid vesicle solution introduced thereto from the first
mixing region. This embodiment advantageously allows for more
control of the flow of dilution buffer mixing with the lipid
vesicle solution in the second mixing region, and therefore also
the concentration of lipid vesicle solution in buffer throughout
the second mixing process. Such control of the dilution buffer flow
rate advantageously allows for small particle size formation at
reduced concentrations.
[0484] These processes and the apparatuses for carrying out these
direct dilution and in-line dilution processes are described in
detail in U.S. Patent Publication No. 20070042031, the disclosure
of which is herein incorporated by reference in its entirety for
all purposes.
[0485] The nucleic acid-lipid particles formed using the direct
dilution and in-line dilution processes typically have a size of
from about 30 nm to about 150 nm, from about 40 nm to about 150 nm,
from about 50 nm to about 150 nm, from about 60 nm to about 130 nm,
from about 70 nm to about 110 nm, from about 70 nm to about 100 nm,
from about 80 nm to about 100 nm, from about 90 nm to about 100 nm,
from about 70 to about 90 nm, from about 80 nm to about 90 nm, from
about 70 nm to about 80 nm, less than about 120 nm, 110 nm, 100 nm,
90 nm, or 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm,
60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105
nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm,
or 150 nm (or any fraction thereof or range therein). The particles
thus formed do not aggregate and are optionally sized to achieve a
uniform particle size.
[0486] If needed, the lipid particles of the invention (e.g.,
SNALP) can be sized by any of the methods available for sizing
liposomes. The sizing may be conducted in order to achieve a
desired size range and relatively narrow distribution of particle
sizes.
[0487] Several techniques are available for sizing the particles to
a desired size. One sizing method, used for liposomes and equally
applicable to the present particles, is described in U.S. Pat. No.
4,737,323, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. Sonicating a particle
suspension either by bath or probe sonication produces a
progressive size reduction down to particles of less than about 50
nm in size. Homogenization is another method which relies on
shearing energy to fragment larger particles into smaller ones. In
a typical homogenization procedure, particles are recirculated
through a standard emulsion homogenizer until selected particle
sizes, typically between about 60 and about 80 nm, are observed. In
both methods, the particle size distribution can be monitored by
conventional laser-beam particle size discrimination, or QELS.
[0488] Extrusion of the particles through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane is also an
effective method for reducing particle sizes to a relatively
well-defined size distribution. Typically, the suspension is cycled
through the membrane one or more times until the desired particle
size distribution is achieved. The particles may be extruded
through successively smaller-pore membranes, to achieve a gradual
reduction in size.
[0489] In some embodiments, the nucleic acids present in the
particles are precondensed as described in, e.g., U.S. patent
application Ser. No. 09/744,103, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0490] In other embodiments, the methods may further comprise
adding non-lipid polycations which are useful to effect the
lipofection of cells using the present compositions. Examples of
suitable non-lipid polycations include, hexadimethrine bromide
(sold under the brand name POLYBRENE.RTM., from Aldrich Chemical
Co., Milwaukee, Wis., USA) or other salts of hexadimethrine. Other
suitable polycations include, for example, salts of
poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine,
polyallylamine, and polyethyleneimine. Addition of these salts is
preferably after the particles have been formed.
[0491] In some embodiments, the nucleic acid to lipid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle (e.g.,
SNALP) will range from about 0.01 to about 0.2, from about 0.05 to
about 0.2, from about 0.02 to about 0.1, from about 0.03 to about
0.1, or from about 0.01 to about 0.08. The ratio of the starting
materials (input) also falls within this range. In other
embodiments, the particle preparation uses about 400 .mu.g nucleic
acid per 10 mg total lipid or a nucleic acid to lipid mass ratio of
about 0.01 to about 0.08 and, more preferably, about 0.04, which
corresponds to 1.25 mg of total lipid per 50 .mu.g of nucleic acid.
In other preferred embodiments, the particle has a nucleic
acid:lipid mass ratio of about 0.08.
[0492] In other embodiments, the lipid to nucleic acid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle (e.g.,
SNALP) will range from about 1 (1:1) to about 100 (100:1), from
about 5 (5:1) to about 100 (100:1), from about 1 (1:1) to about 50
(50:1), from about 2 (2:1) to about 50 (50:1), from about 3 (3:1)
to about 50 (50:1), from about 4 (4:1) to about 50 (50:1), from
about 5 (5:1) to about 50 (50:1), from about 1 (1:1) to about 25
(25:1), from about 2 (2:1) to about 25 (25:1), from about 3 (3:1)
to about 25 (25:1), from about 4 (4:1) to about 25 (25:1), from
about 5 (5:1) to about 25 (25:1), from about 5 (5:1) to about 20
(20:1), from about 5 (5:1) to about 15 (15:1), from about 5 (5:1)
to about 10 (10:1), or about 5 (5:1), 6 (6:1), 7 (7:1), 8 (8:1), 9
(9:1), 10 (10:1), 11 (11:1), 12 (12:1), 13 (13:1), 14 (14:1), 15
(15:1), 16 (16:1), 17 (17:1), 18 (18:1), 19 (19:1), 20 (20:1), 21
(21:1), 22 (22:1), 23 (23:1), 24 (24:1), or 25 (25:1), or any
fraction thereof or range therein. The ratio of the starting
materials (input) also falls within this range.
[0493] As previously discussed, the conjugated lipid may further
include a CPL. A variety of general methods for making SNALP-CPLs
(CPL-containing SNALP) are discussed herein. Two general techniques
include the "post-insertion" technique, that is, insertion of a CPL
into, for example, a pre-formed SNALP, and the "standard"
technique, wherein the CPL is included in the lipid mixture during,
for example, the SNALP formation steps. The post-insertion
technique results in SNALP having CPLs mainly in the external face
of the SNALP bilayer membrane, whereas standard techniques provide
SNALP having CPLs on both internal and external faces. The method
is especially useful for vesicles made from phospholipids (which
can contain cholesterol) and also for vesicles containing
PEG-lipids (such as PEG-DAAs and PEG-DAGs). Methods of making
SNALP-CPLs are taught, for example, in U.S. Pat. Nos. 5,705,385;
6,586,410; 5,981,501; 6,534,484; and 6,852,334; U.S. Patent
Publication No. 20020072121; and PCT Publication No. WO 00/62813,
the disclosures of which are herein incorporated by reference in
their entirety for all purposes.
VII. Kits
[0494] The present invention also provides lipid particles (e.g.,
SNALP) in kit form. In some embodiments, the kit comprises a
container which is compartmentalized for holding the various
elements of the lipid particles (e.g., the active agents or
therapeutic agents such as nucleic acids and the individual lipid
components of the particles). Preferably, the kit comprises a
container (e.g., a vial or ampoule) which holds the lipid particles
of the invention (e.g., SNALP), wherein the particles are produced
by one of the processes set forth herein. In certain embodiments,
the kit may further comprise an endosomal membrane destabilizer
(e.g., calcium ions). The kit typically contains the particle
compositions of the invention, either as a suspension in a
pharmaceutically acceptable carrier or in dehydrated form, with
instructions for their rehydration (if lyophilized) and
administration.
[0495] As explained herein, it has surprisingly been found that the
SNALP formulations of the present invention containing a
combination of siRNA molecules targeting at least two or all three
of the EBOV L-pol, VP24, and VP35 genes were capable of providing
complete postexposure protection of nonhuman primates against a
lethal EBOV challenge. In certain embodiments, the SNALP
formulations of the present invention comprising a cocktail of
siRNAs targeting any combination of at least two (or all three) of
the EBOV L-pol, VP24, and VP35 genes demonstrate an increased
potency (i.e., increased silencing activity) and an increased
tolerability (e.g., a more favorable toxicity profile), e.g., when
compared to other nucleic acid-lipid particle compositions
previously described. In preferred embodiments, the kits of the
invention comprise these lipid particles, wherein the particles are
present in a container as a suspension or in dehydrated form. Such
kits are particularly advantageous for use in providing effective
postexposure treatment strategies for combating EBOV
infections.
[0496] In certain instances, it may be desirable to have a
targeting moiety attached to the surface of the lipid particle to
further enhance the targeting of the particle. Methods of attaching
targeting moieties (e.g., antibodies, proteins, etc.) to lipids
(such as those used in the present particles) are known to those of
skill in the art.
VIII. Administration of Lipid Particles
[0497] Once formed, the lipid particles of the invention (e.g.,
SNALP) are particularly useful for introducing interfering RNA
(e.g., siRNA) targeting one or more EBOV genes (such as L-pol,
VP24, VP30, VP35, VP40, NP, GP, or combinations thereof) into
cells. As noted, it has surprisingly been found that the SNALP
formulations of the present invention containing a pool of siRNA
molecules targeting at least two or all three of the EBOV L-pol,
VP24, and VP35 genes unexpectedly provided complete postexposure
protection against a lethal EBOV challenge in a nonhuman primate
model. Accordingly, the present invention also provides methods for
introducing one or more interfering RNA (e.g., siRNA) into a cell
infected by EBOV. EBOV is capable of infecting and replicating in
virtually all cell types. In particular embodiments, the
interfering RNA is introduced into reticuloendothelial cells (such
as, e.g., macrophages, monocytes, etc.) as well as other cell
types, including fibroblasts, endothelial cells (such as those
lining the interior surface of blood vessels), and/or platelet
cells infected with EBOV. The methods may be carried out in vitro
or in vivo by first forming the particles as described above and
then contacting the particles with the cells for a period of time
sufficient for delivery of the interfering RNA to the cells to
occur.
[0498] The lipid particles of the invention (e.g., SNALP) can be
adsorbed to almost any cell type with which they are mixed or
contacted. Once adsorbed, the particles can either be endocytosed
by a portion of the cells, exchange lipids with cell membranes, or
fuse with the cells. Transfer or incorporation of the nucleic acid
(e.g., interfering RNA) portion of the particle can take place via
any one of these pathways. In particular, when fusion takes place,
the particle membrane is integrated into the cell membrane and the
contents of the particle combine with the intracellular fluid.
[0499] The lipid particles of the invention (e.g., SNALP) can be
administered either alone or in a mixture with a pharmaceutically
acceptable carrier (e.g., physiological saline or phosphate buffer)
selected in accordance with the route of administration and
standard pharmaceutical practice. Generally, normal buffered saline
(e.g., 135-150 mM NaCl) will be employed as the pharmaceutically
acceptable carrier. Other suitable carriers include, e.g., water,
buffered water, 0.4% saline, 0.3% glycine, and the like, including
glycoproteins for enhanced stability, such as albumin, lipoprotein,
globulin, etc. Additional suitable carriers are described in, e.g.,
REMINGTON'S PHARMACEUTICAL SCIENCES, Mack Publishing Company,
Philadelphia, Pa., 17th ed. (1985). As used herein, "carrier"
includes any and all solvents, dispersion media, vehicles,
coatings, diluents, antibacterial and antifungal agents, isotonic
and absorption delaying agents, buffers, carrier solutions,
suspensions, colloids, and the like. The phrase "pharmaceutically
acceptable" refers to molecular entities and compositions that do
not produce an allergic or similar untoward reaction when
administered to a human.
[0500] The pharmaceutically acceptable carrier is generally added
following lipid particle formation. Thus, after the lipid particle
(e.g., SNALP) is formed, the particle can be diluted into
pharmaceutically acceptable carriers such as normal buffered
saline.
[0501] The concentration of particles in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.05%,
usually at or at least about 2 to 5%, to as much as about 10 to 90%
by weight, and will be selected primarily by fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected. For example, the concentration may be
increased to lower the fluid load associated with treatment. This
may be particularly desirable in patients having
atherosclerosis-associated congestive heart failure or severe
hypertension. Alternatively, particles composed of irritating
lipids may be diluted to low concentrations to lessen inflammation
at the site of administration.
[0502] The pharmaceutical compositions of the present invention may
be sterilized by conventional, well-known sterilization techniques.
Aqueous solutions can be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions can contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, and calcium chloride.
Additionally, the particle suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as alphatocopherol, and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0503] In some embodiments, the lipid particles of the invention
(e.g., SNALP) are particularly useful in methods for the
therapeutic delivery of one or more nucleic acids comprising an
interfering RNA sequence (e.g., siRNA). In particular, it is an
object of this invention to provide in vitro and in vivo methods
for treatment of EBOV infections in a mammal (e.g., a rodent such
as a mouse or a primate such as a human, chimpanzee, or monkey) by
downregulating or silencing the transcription and/or translation of
one or more target nucleic acid sequences or genes of interest
(such as EBOV L-pol, VP24, VP30, VP35, VP40, NP, GP, or
combinations thereof). As a non-limiting example, the methods of
the invention are useful for the in vivo delivery of interfering
RNA (e.g., siRNA) to EBOV-infected cells of a mammalian subject for
the treatment of an EBOV infection. In certain embodiments, the
EBOV infection is associated with expression and/or overexpression
of an EBOV gene and expression or overexpression of the gene is
reduced by the interfering RNA (e.g., siRNA). In certain other
embodiments, a therapeutically effective amount of the lipid
particle may be administered to the mammal. In some instances, one,
two, three, or more interfering RNA molecules (e.g., siRNA) are
formulated into a SNALP, and the particles are administered to
patients requiring such treatment. In other instances, cells are
removed from a patient, the interfering RNA is delivered in vitro
(e.g., using a SNALP described herein), and the cells are
reinjected into the patient.
[0504] A. In Vivo Administration
[0505] Systemic delivery for in vivo therapy, e.g., delivery of a
therapeutic nucleic acid to a distal target cell via body systems
such as the circulation, has been achieved using nucleic acid-lipid
particles such as those described in PCT Publication Nos. WO
05/007196, WO 05/121348, WO 05/120152, and WO 04/002453, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes. The present invention also provides
fully encapsulated lipid particles that protect the nucleic acid
from nuclease degradation in serum, are non-immunogenic, are small
in size, and are suitable for repeat dosing.
[0506] For in vivo administration, administration can be in any
manner known in the art, e.g., by injection, oral administration,
inhalation (e.g., intransal or intratracheal), transdermal
application, or rectal administration. Administration can be
accomplished via single or divided doses. The pharmaceutical
compositions can be administered parenterally, i.e.,
intraarticularly, intravenously, intraperitoneally, subcutaneously,
or intramuscularly. In some embodiments, the pharmaceutical
compositions are administered intravenously or intraperitoneally by
a bolus injection (see, e.g., U.S. Pat. No. 5,286,634).
Intracellular nucleic acid delivery has also been discussed in
Straubringer et al., Methods Enzymol., 101:512 (1983); Mannino et
al., Biotechniques, 6:682 (1988); Nicolau et al., Crit. Rev. Ther.
Drug Carrier Syst., 6:239 (1989); and Behr, Acc. Chem. Res., 26:274
(1993). Still other methods of administering lipid-based
therapeutics are described in, for example, U.S. Pat. Nos.
3,993,754; 4,145,410; 4,235,871; 4,224,179; 4,522,803; and
4,588,578. The lipid particles can be administered by direct
injection at the site of disease or by injection at a site distal
from the site of disease (see, e.g., Culver, HUMAN GENE THERAPY,
MaryAnn Liebert, Inc., Publishers, New York. pp. 70-71(1994)). The
disclosures of the above-described references are herein
incorporated by reference in their entirety for all purposes.
[0507] In embodiments where the lipid particles of the present
invention (e.g., SNALP) are administered intravenously, at least
about 5%, 10%, 15%, 20%, or 25% of the total injected dose of the
particles is present in plasma about 8, 12, 24, 36, or 48 hours
after injection. In other embodiments, more than about 20%, 30%,
40% and as much as about 60%, 70% or 80% of the total injected dose
of the lipid particles is present in plasma about 8, 12, 24, 36, or
48 hours after injection. In certain instances, more than about 10%
of a plurality of the particles is present in the plasma of a
mammal about 1 hour after administration. In certain other
instances, the presence of the lipid particles is detectable at
least about 1 hour after administration of the particle. In some
embodiments, the presence of a therapeutic nucleic acid such as an
interfering RNA molecule is detectable in cells (e.g.,
EBOV-infected cells) at about 8, 12, 24, 36, 48, 60, 72 or 96 hours
after administration. In other embodiments, downregulation of
expression of a target sequence, such as an EBOV sequence, by an
interfering RNA (e.g., siRNA) is detectable at about 8, 12, 24, 36,
48, 60, 72 or 96 hours after administration. In yet other
embodiments, downregulation of expression of a target sequence,
such as an EBOV sequence, by an interfering RNA (e.g., siRNA)
occurs preferentially in EBOV-infected cells and/or cells capable
of being infected by EBOV. In further embodiments, the presence or
effect of an interfering RNA (e.g., siRNA) in cells at a site
proximal or distal to the site of administration is detectable at
about 12, 24, 48, 72, or 96 hours, or at about 6, 8, 10, 12, 14,
16, 18, 19, 20, 22, 24, 26, or 28 days after administration. In
additional embodiments, the lipid particles (e.g., SNALP) of the
present invention are administered parenterally or
intraperitoneally.
[0508] The compositions of the present invention, either alone or
in combination with other suitable components, can be made into
aerosol formulations (i.e., they can be "nebulized") to be
administered via inhalation (e.g., intranasally or intratracheally)
(see, Brigham et al., Am. J. Sci., 298:278 (1989)). Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0509] In certain embodiments, the pharmaceutical compositions may
be delivered by intranasal sprays, inhalation, and/or other aerosol
delivery vehicles. Methods for delivering nucleic acid compositions
directly to the lungs via nasal aerosol sprays have been described,
e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212. Likewise, the
delivery of drugs using intranasal microparticle resins and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871) are
also well-known in the pharmaceutical arts. Similarly, transmucosal
drug delivery in the form of a polytetrafluoroetheylene support
matrix is described in U.S. Pat. No. 5,780,045. The disclosures of
the above-described patents are herein incorporated by reference in
their entirety for all purposes.
[0510] Formulations suitable for parenteral administration, such
as, for example, by intraarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions are preferably administered, for
example, by intravenous infusion, orally, topically,
intraperitoneally, intravesically, or intrathecally.
[0511] Generally, when administered intravenously, the lipid
particle formulations are formulated with a suitable pharmaceutical
carrier. Many pharmaceutically acceptable carriers may be employed
in the compositions and methods of the present invention. Suitable
formulations for use in the present invention are found, for
example, in REMINGTON'S PHARMACEUTICAL SCIENCES, Mack Publishing
Company, Philadelphia, Pa., 17th ed. (1985). A variety of aqueous
carriers may be used, for example, water, buffered water, 0.4%
saline, 0.3% glycine, and the like, and may include glycoproteins
for enhanced stability, such as albumin, lipoprotein, globulin,
etc. Generally, normal buffered saline (135-150 mM NaCl) will be
employed as the pharmaceutically acceptable carrier, but other
suitable carriers will suffice. These compositions can be
sterilized by conventional liposomal sterilization techniques, such
as filtration. The compositions may contain pharmaceutically
acceptable auxiliary substances as required to approximate
physiological conditions, such as pH adjusting and buffering
agents, tonicity adjusting agents, wetting agents and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium
chloride, calcium chloride, sorbitan monolaurate, triethanolamine
oleate, etc. These compositions can be sterilized using the
techniques referred to above or, alternatively, they can be
produced under sterile conditions. The resulting aqueous solutions
may be packaged for use or filtered under aseptic conditions and
lyophilized, the lyophilized preparation being combined with a
sterile aqueous solution prior to administration.
[0512] In certain applications, the lipid particles disclosed
herein may be delivered via oral administration to the individual.
The particles may be incorporated with excipients and used in the
form of ingestible tablets, buccal tablets, troches, capsules,
pills, lozenges, elixirs, mouthwash, suspensions, oral sprays,
syrups, wafers, and the like (see, e.g., U.S. Pat. Nos. 5,641,515,
5,580,579, and 5,792,451, the disclosures of which are herein
incorporated by reference in their entirety for all purposes).
These oral dosage forms may also contain the following: binders,
gelatin; excipients, lubricants, and/or flavoring agents. When the
unit dosage form is a capsule, it may contain, in addition to the
materials described above, a liquid carrier. Various other
materials may be present as coatings or to otherwise modify the
physical form of the dosage unit. Of course, any material used in
preparing any unit dosage form should be pharmaceutically pure and
substantially non-toxic in the amounts employed.
[0513] Typically, these oral formulations may contain at least
about 0.1% of the lipid particles or more, although the percentage
of the particles may, of course, be varied and may conveniently be
between about 1% or 2% and about 60% or 70% or more of the weight
or volume of the total formulation. Naturally, the amount of
particles in each therapeutically useful composition may be
prepared is such a way that a suitable dosage will be obtained in
any given unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0514] Formulations suitable for oral administration can consist
of: (a) liquid solutions, such as an effective amount of a packaged
therapeutic nucleic acid (e.g., interfering RNA) suspended in
diluents such as water, saline, or PEG 400; (b) capsules, sachets,
or tablets, each containing a predetermined amount of a therapeutic
nucleic acid (e.g., interfering RNA), as liquids, solids, granules,
or gelatin; (c) suspensions in an appropriate liquid; and (d)
suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise a therapeutic
nucleic acid (e.g., interfering RNA) in a flavor, e.g., sucrose, as
well as pastilles comprising the therapeutic nucleic acid in an
inert base, such as gelatin and glycerin or sucrose and acacia
emulsions, gels, and the like containing, in addition to the
therapeutic nucleic acid, carriers known in the art.
[0515] In another example of their use, lipid particles can be
incorporated into a broad range of topical dosage forms. For
instance, a suspension containing nucleic acid-lipid particles such
as SNALP can be formulated and administered as gels, oils,
emulsions, topical creams, pastes, ointments, lotions, foams,
mousses, and the like.
[0516] When preparing pharmaceutical preparations of the lipid
particles of the invention, it is preferable to use quantities of
the particles which have been purified to reduce or eliminate empty
particles or particles with therapeutic agents such as nucleic acid
associated with the external surface.
[0517] The methods of the present invention may be practiced in a
variety of hosts. Preferred hosts include mammalian species, such
as primates (e.g., humans and chimpanzees as well as other nonhuman
primates), canines, felines, equines, bovines, ovines, caprines,
rodents (e.g., rats and mice), lagomorphs, and swine.
[0518] The amount of particles administered will depend upon the
ratio of therapeutic nucleic acid (e.g., interfering RNA) to lipid,
the particular therapeutic nucleic acid used, the disease or
disorder being treated, the age, weight, and condition of the
patient, and the judgment of the clinician, but will generally be
between about 0.01 and about 50 mg per kilogram of body weight,
preferably between about 0.1 and about 5 mg/kg of body weight, or
about 10.sup.8-10.sup.10 particles per administration (e.g.,
injection).
[0519] B. In Vitro Administration
[0520] For in vitro applications, the delivery of therapeutic
nucleic acids (e.g., interfering RNA) can be to any cell grown in
culture, whether of plant or animal origin, vertebrate or
invertebrate, and of any tissue or type. In preferred embodiments,
the cells are animal cells, more preferably mammalian cells, and
most preferably human cells.
[0521] Contact between the cells and the lipid particles, when
carried out in vitro, takes place in a biologically compatible
medium. The concentration of particles varies widely depending on
the particular application, but is generally between about 1
.mu.mol and about 10 mmol. Treatment of the cells with the lipid
particles is generally carried out at physiological temperatures
(about 37.degree. C.) for periods of time of from about 1 to 48
hours, preferably of from about 2 to 4 hours.
[0522] In one group of preferred embodiments, a lipid particle
suspension is added to 60-80% confluent plated cells having a cell
density of from about 10.sup.3 to about 10.sup.5 cells/ml, more
preferably about 2.times.10.sup.4 cells/ml. The concentration of
the suspension added to the cells is preferably of from about 0.01
to 0.2 .mu.g/ml, more preferably about 0.1 .mu.g/ml.
[0523] To the extent that tissue culture of cells may be required,
it is well-known in the art. For example, Freshney, Culture of
Animal Cells, a Manual of Basic Technique, 3rd Ed., Wiley-Liss, New
York (1994), Kuchler et al., Biochemical Methods in Cell Culture
and Virology, Dowden, Hutchinson and Ross, Inc. (1977), and the
references cited therein provide a general guide to the culture of
cells. Cultured cell systems often will be in the form of
monolayers of cells, although cell suspensions are also used.
[0524] Using an Endosomal Release Parameter (ERP) assay, the
delivery efficiency of the SNALP or other lipid particle of the
invention can be optimized. An ERP assay is described in detail in
U.S. Patent Publication No. 20030077829, the disclosure of which is
herein incorporated by reference in its entirety for all purposes.
More particularly, the purpose of an ERP assay is to distinguish
the effect of various cationic lipids and helper lipid components
of SNALP or other lipid particle based on their relative effect on
binding/uptake or fusion with/destabilization of the endosomal
membrane. This assay allows one to determine quantitatively how
each component of the SNALP or other lipid particle affects
delivery efficiency, thereby optimizing the SNALP or other lipid
particle. Usually, an ERP assay measures expression of a reporter
protein (e.g., luciferase, .beta.-galactosidase, green fluorescent
protein (GFP), etc.), and in some instances, a SNALP formulation
optimized for an expression plasmid will also be appropriate for
encapsulating an interfering RNA. In other instances, an ERP assay
can be adapted to measure downregulation of transcription or
translation of a target sequence in the presence or absence of an
interfering RNA (e.g., siRNA). By comparing the ERPs for each of
the various SNALP or other lipid particles, one can readily
determine the optimized system, e.g., the SNALP or other lipid
particle that has the greatest uptake in the cell.
[0525] C. Cells for Delivery of Lipid Particles
[0526] The compositions and methods of the present invention are
particularly well suited for treating EBOV infections by targeting,
e.g., EBOV gene expression in vivo. The present invention can be
practiced on a wide variety of cell types from any vertebrate
species, including mammals, such as, e.g, canines, felines,
equines, bovines, ovines, caprines, rodents (e.g., mice, rats, and
guinea pigs), lagomorphs, swine, and primates (e.g. monkeys,
chimpanzees, and humans). Suitable cells include, but are not
limited to, any cell infected with EBOV or capable of becoming
infected with EBOV, such as, e.g., reticuloendothelial cells (e.g.,
monocytes, macrophages, Kupffer cells, tissue histiocytes, etc.),
fibroblast cells, endothelial cells, platelet cells, and the
like.
[0527] D. Detection of Lipid Particles
[0528] In some embodiments, the lipid particles of the present
invention (e.g., SNALP) are detectable in the subject at about 1,
2, 3, 4, 5, 6, 7, 8 or more hours. In other embodiments, the lipid
particles of the present invention (e.g., SNALP) are detectable in
the subject at about 8, 12, 24, 48, 60, 72, or 96 hours, or about
6, 8, 10, 12, 14, 16, 18, 19, 22, 24, 25, or 28 days after
administration of the particles. The presence of the particles can
be detected in the cells, tissues, or other biological samples from
the subject. The particles may be detected, e.g., by direct
detection of the particles, detection of a therapeutic nucleic acid
such as an interfering RNA (e.g., siRNA) sequence, detection of the
target sequence of interest (i.e., by detecting expression or
reduced expression of the sequence of interest), detection of a
compound modulated by an EBOV protein (e.g., interferon), detection
of viral load in the subject, or a combination thereof.
[0529] 1. Detection of Particles
[0530] Lipid particles of the invention such as SNALP can be
detected using any method known in the art. For example, a label
can be coupled directly or indirectly to a component of the lipid
particle using methods well-known in the art. A wide variety of
labels can be used, with the choice of label depending on
sensitivity required, ease of conjugation with the lipid particle
component, stability requirements, and available instrumentation
and disposal provisions. Suitable labels include, but are not
limited to, spectral labels such as fluorescent dyes (e.g.,
fluorescein and derivatives, such as fluorescein isothiocyanate
(FITC) and Oregon Green.TM.; rhodamine and derivatives such Texas
red, tetrarhodimine isothiocynate (TRITC), etc., digoxigenin,
biotin, phycoerythrin, AMCA, CyDyes.TM., and the like; radiolabels
such as .sup.3H, .sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P,
etc.; enzymes such as horse radish peroxidase, alkaline
phosphatase, etc.; spectral colorimetric labels such as colloidal
gold or colored glass or plastic beads such as polystyrene,
polypropylene, latex, etc. The label can be detected using any
means known in the art.
[0531] 2. Detection of Nucleic Acids
[0532] Nucleic acids (e.g., interfering RNA) are detected and
quantified herein by any of a number of means well-known to those
of skill in the art. The detection of nucleic acids may proceed by
well-known methods such as Southern analysis, Northern analysis,
gel electrophoresis, PCR, radiolabeling, scintillation counting,
and affinity chromatography. Additional analytic biochemical
methods such as spectrophotometry, radiography, electrophoresis,
capillary electrophoresis, high performance liquid chromatography
(HPLC), thin layer chromatography (TLC), and hyperdiffusion
chromatography may also be employed.
[0533] The selection of a nucleic acid hybridization format is not
critical. A variety of nucleic acid hybridization formats are known
to those skilled in the art. For example, common formats include
sandwich assays and competition or displacement assays.
Hybridization techniques are generally described in, e.g., "Nucleic
Acid Hybridization, A Practical Approach," Eds. Hames and Higgins,
IRL Press (1985).
[0534] The sensitivity of the hybridization assays may be enhanced
through the use of a nucleic acid amplification system which
multiplies the target nucleic acid being detected. In vitro
amplification techniques suitable for amplifying sequences for use
as molecular probes or for generating nucleic acid fragments for
subsequent subcloning are known. Examples of techniques sufficient
to direct persons of skill through such in vitro amplification
methods, including the polymerase chain reaction (PCR), the ligase
chain reaction (LCR), Q.beta.-replicase amplification, and other
RNA polymerase mediated techniques (e.g., NASBA.TM.) are found in
Sambrook et al., In Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press (2000); and Ausubel et al., SHORT
PROTOCOLS IN MOLECULAR BIOLOGY, eds., Current Protocols, Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc. (2002);
as well as U.S. Pat. No. 4,683,202; PCR Protocols, A Guide to
Methods and Applications (Innis et al. eds.) Academic Press Inc.
San Diego, Calif. (1990); Arnheim & Levinson (Oct. 1, 1990),
C&EN 36; The Journal Of NIH Research, 3:81 (1991); Kwoh et al.,
Proc. Natl. Acad. Sci. USA, 86:1173 (1989); Guatelli et al., Proc.
Natl. Acad. Sci. USA, 87:1874 (1990); Lomeli et al., J. Clin.
Chem., 35:1826 (1989); Landegren et al., Science, 241:1077 (1988);
Van Brunt, Biotechnology, 8:291 (1990); Wu and Wallace, Gene, 4:560
(1989); Barringer et al., Gene, 89:117 (1990); and Sooknanan and
Malek, Biotechnology, 13:563 (1995). Improved methods of cloning in
vitro amplified nucleic acids are described in U.S. Pat. No.
5,426,039. Other methods described in the art are the nucleic acid
sequence based amplification (NASBA.TM., Cangene, Mississauga,
Ontario) and Q.beta.-replicase systems. These systems can be used
to directly identify mutants where the PCR or LCR primers are
designed to be extended or ligated only when a select sequence is
present. Alternatively, the select sequences can be generally
amplified using, for example, nonspecific PCR primers and the
amplified target region later probed for a specific sequence
indicative of a mutation. The disclosures of the above-described
references are herein incorporated by reference in their entirety
for all purposes.
[0535] Nucleic acids for use as probes, e.g., in in vitro
amplification methods, for use as gene probes, or as inhibitor
components are typically synthesized chemically according to the
solid phase phosphoramidite triester method described by Beaucage
et al., Tetrahedron Letts., 22:1859 1862 (1981), e.g., using an
automated synthesizer, as described in Needham VanDevanter et al.,
Nucleic Acids Res., 12:6159 (1984). Purification of
polynucleotides, where necessary, is typically performed by either
native acrylamide gel electrophoresis or by anion exchange HPLC as
described in Pearson et al., J. Chrom., 255:137 149 (1983). The
sequence of the synthetic polynucleotides can be verified using the
chemical degradation method of Maxam and Gilbert (1980) in Grossman
and Moldave (eds.) Academic Press, New York, Methods in Enzymology,
65:499.
[0536] An alternative means for determining the level of
transcription is in situ hybridization. In situ hybridization
assays are well-known and are generally described in Angerer et
al., Methods Enzymol., 152:649 (1987). In an in situ hybridization
assay, cells are fixed to a solid support, typically a glass slide.
If DNA is to be probed, the cells are denatured with heat or
alkali. The cells are then contacted with a hybridization solution
at a moderate temperature to permit annealing of specific probes
that are labeled. The probes are preferably labeled with
radioisotopes or fluorescent reporters.
[0537] 3. Detection of Ebola Virus Load
[0538] EBOV load can be detected using any means known in the art.
Typically, EBOV load is detected in a biological sample from the
subject. For example, viral load in the subject's blood can be
detected by measuring EBOV antigens using an immunoassay such as an
ELISA (see, e.g., Meissner et al., Virology, 300:236-43 (2002); and
Ksiazek et al., J. Clin. Microbiol., 30:947-950 (1992)). Viral load
can also be detected by amplifying EBOV nucleic acids (see, e.g.,
Drosten et al., J. Clin. Microbiol., 40: 2323-2330 (2002)) or by
conventional plaque assay using monolayers of Vero or Vero E6 cells
(see, e.g., Jahrling, Filoviruses and Arenaviruses, In Manual of
Clinical Microbiology, Eds. Baron, Pfaller, Tenover, and Yolken,
ASM Press, Washington, D.C. (1999)).
IX. Examples
[0539] The present invention will be described in greater detail by
way of specific examples. The following examples are offered for
illustrative purposes, and are not intended to limit the invention
in any manner. Those of skill in the art will readily recognize a
variety of noncritical parameters which can be changed or modified
to yield essentially the same results.
Example 1
Postexposure Protection of Nonhuman Primates Against a Lethal Ebola
Virus Challenge by RNA Interference
[0540] For more than 30 years, EBOV has been associated with
periodic episodes of hemorrhagic fever in Central Africa that
produce severe disease in infected patients. Mortality rates in
outbreaks have ranged from 50% for the Sudan species of EBOV
(SEBOV) to up to 90% for the Zaire species of EBOV (ZEBOV) (2). An
outbreak late in 2007 caused by an apparently new species of EBOV
in Uganda resulted in a fatality rate of about 25% (3).
[0541] EBOV particles contain an approximately 19-kb noninfectious
RNA genome that encodes seven structural proteins and one
nonstructural protein with the following gene order: 3' leader,
nucleoprotein (NP), virion protein (VP) 35 (VP35), VP40,
glycoprotein (GP), VP30, VP24, polymerase L protein (L-pol), and 5'
trailer (4). Four of these proteins are associated with the viral
genomic RNA in the ribonucleoprotein complex: NP, VP30, VP35, and
L-pol. The L-pol and VP35 proteins together comprise the polymerase
complex that is responsible for transcribing and replicating the
EBOV genome. The L-pol protein provides the RNA-dependent RNA
polymerase activity of the complex. The L-pol protein offers an
ideal target for antiviral approaches not only because suppression
should lead to a nearly total loss of all RNA synthesis, but also
because of the absence of similar proteins in mammalian cells. In
addition to the L-pol protein, the VP24 and VP35 proteins are also
promising targets for antiviral interventions as both have been
shown to have inhibitory effects on the host type I interferon
(IFN) response. Specifically, VP35 was shown to function as a type
I IFN antagonist (5-7) by blocking IFN regulatory factor (IRF)-3
activation and possibly preventing transcription of IFN-.beta. (6).
VP24 expression was shown to interfere with type I IFN signaling
(8) and mutations in VP24 have been linked to adaptation of ZEBOV
to produce a lethal infection in mice (8) and guinea pigs (9).
[0542] While there are no vaccines or postexposure treatment
modalities available for preventing or managing EBOV infections,
remarkable progress has been made over the last few years in
developing candidate preventive vaccines that can protect nonhuman
primates against EBOV (10-17). However, progress in developing
antiviral drugs and other postexposure interventions has been much
slower. In a previous study, an siRNA targeting the ZEBOV L-pol
gene (designated "EK-1") was identified that inhibited the
replication of ZEBOV in vitro and completely protected
ZEBOV-infected guinea pigs (1). Although EK-1 was highly effective,
a cocktail approach was selected for the present study using three
siRNAs, one targeting each of the L-pol (i.e., EK-1), VP24, and
VP35 genes. This cocktail of multiple siRNAs enables the targeting
of potential RNAi escape mutants. The use of multiple siRNAs for
targeting potential RNAi escape mutants has been shown for HIV-1
and polio (18). By targeting three different viral gene products,
the Ebola virus is inactivated in three different areas of its life
cycle.
[0543] Lead siRNAs to VP24 (i.e., VP24-1160) and VP35 (i.e.,
VP35-855) were identified using a nonviral plasmid-based expression
system. Non-saturating concentrations of siRNA were used in this
system so that relative differences in siRNA potency could be
determined. FIG. 1 shows that VP24-1160 was the most efficacious
siRNA targeting ZEBOV VP24, while VP35-855 had the best efficacy
against ZEBOV VP35. EK-1, VP24-1160, and VP35-855 were selected as
siRNA components of the ZEBOV SNALP cocktail. These lead siRNAs
were selectively modified by substituting 2'O-methyl (2'OMe)
guanosine and/or uridines in the sense and antisense strands to
eliminate immune stimulatory capacity of the siRNA in SNALP
(19-21). The RNAi activity of the modified siRNAs was then
confirmed in vitro using the plasmid-based system. In particular,
modified VP24-1160 siRNA showed similar efficacy to unmodified
VP24-1160 siRNA in reducing VP24 gene expression (FIG. 2). Modified
VP35-855 siRNA and modified EK-1 siRNA also maintained significant
efficacy against VP35 and L polymerase-expressing plasmids,
respectively (FIG. 2).
[0544] It is important to ensure that formulated siRNA do not
activate an immune stimulatory response, as these responses can
have significant antiviral activity (32). The immune stimulatory
activity of ZEBOV SNALP was tested in vivo in mice (19). FIG. 3
shows that IFN-.alpha. and IL-6 were not induced in plasma of mice
4 h after injection of ZEBOV SNALP at 5 mg total siRNA per kg body
weight. A positive control, chemically unmodified Luc SNALP,
induced high levels of both proteins in plasma. A more sensitive
measure of localized IFN production is IFN-induced protein with
tetratricopeptide repeats (IFIT1) mRNA in the liver (19).
QuantiGene branched DNA analysis of liver IFIT1 mRNA 4 h after
injection of SNALP showed no significant differences from the PBS
negative control for the 2'OMe-modified Luc or ZEBOV cocktail
SNALP, whereas the unmodified Luc SNALP induced significant levels
of IFIT1 mRNA (1180-fold over PBS treatment) (FIG. 3).
[0545] The immune stimulatory activity of ZEBOV SNALP on human
peripheral blood mononuclear cell (PBMC) cultures was also tested.
As shown in FIG. 4, native (chemically unmodified) Luc, EK-1,
VP24-1160, and VP35-855 siRNAs induced strong IFN-.alpha. in
culture supernatants even at 100 nM concentrations, whereas no
IFN-.alpha. could be detected following exposure to the
2'OMe-modified versions at up to 400 nM. These data show that 2'OMe
modification of bases in the sense and antisense strand of these
siRNAs was sufficient to eliminate measurable IFN-.alpha.
production in human immune cells. Taken together, these data
indicate that any differences observed in survival between the Luc
mod and ZEBOV SNALP-treated animals are due to RNAi rather than
non-specific stimulation of the innate immune system.
[0546] FIG. 5A shows that SNALPs containing ZEBOV siRNAs
substantially reduced ZEBOV produced in supernatants of Vero E6
cells 48 h after infection. To determine whether L-pol, VP35, and
VP24 mRNA are cleaved by the specific mechanism of RNAi, 5' RACE
(Rapid Amplification of cDNA Ends) was performed on total RNA from
Vero E6 cells treated with SNALP followed by ZEBOV infection. FIG.
5B shows that EK-1-mod, VP35-855-mod, and VP24-1160-mod all induced
specific mRNA cleavage only for their target mRNA in cells treated
with SNALP containing either siRNA alone (FIG. 5B, lanes 3, 8, and
13), whereas all three RACE bands can be seen in cells treated with
ZEBOV cocktail SNALP (FIG. 5B, lanes 4, 9, and 14), producing the
specific RACE PCR product of the correct size. No RACE PCR products
of the appropriate size were observed for PBS (FIG. 5B, lanes 2, 7,
and 12) or Luc mod (FIG. 5B, lanes 5, 10, and 15) SNALP-treated
cells, further showing the specificity of the RACE results. The
RACE PCR products were sequenced and found to correspond to the
specific predicted cleavage site of their respective siRNA,
confirming the specific mechanism of RNAi.
[0547] The protective efficacy of the lead anti-ZEBOV siRNAs was
determined in an established rhesus macaque model of ZEBOV HF (22).
Importantly, this is a rapid and uniformly lethal model (death in
26 of 26 rhesus macaques challenged with the same ZEBOV seed stock
by the same dose and route as in the current study) where animals
typically succumb 6-10 days after challenge. A combination of
modified siRNAs targeting the ZEBOV L-pol gene (EK-1 mod), VP24
(VP24-1160-mod), and VP35 (VP35-855-mod) were formulated in SNALP.
One group of three rhesus monkeys was treated 30 minutes after a
lethal ZEBOV challenge with the pooled siRNAs (2 mg/kg total
siRNA/dose), and again at the same dose on days 1, 3, and 5 after
ZEBOV challenge (four treatments), while a control animal received
no treatment. All four animals developed clinical symptoms
consistent with ZEBOV HF by day 6 (Table 7). The control animal
succumbed to ZEBOV infection before blood collection on day 6 (FIG.
6A). One treated animal (Subject 3) developed a high ZEBOV viremia
at day 6 (Table 8) and succumbed on day 10 (FIG. 6A). ZEBOV was
detected in the plasma of one of the remaining treated animals
(Subject 2) at day 6, but was not detected in the plasma of the
other remaining treated animal (Subject 1) (Table 8). Both of these
animals (Subjects 1 and 2) survived.
[0548] The question of whether increasing the frequency of
treatments could improve outcome was then studied. In this
subsequent study, four rhesus monkeys were treated 30 minutes after
a lethal ZEBOV challenge with the pool of anti-ZEBOV siRNAs at 2
mg/kg/dose and again daily at this dose on days 1 through 6 after
ZEBOV challenge (seven treatments), while a control animal was
treated in parallel with an equal dose of nonspecific modified
siRNA (Luc mod) in SNALP. This treatment regimen proved more
effective, as clinical symptoms of ZEBOV infection in the
specifically treated macaques were less severe (Table 7). The Luc
mod SNALP-treated control animal succumbed on day 10, while all
four animals receiving the pooled anti-ZEBOV siRNAs survived (FIG.
6B). ZEBOV was detected in the plasma of the control animal on days
3, 6, and 10 (Table 8). Low levels of ZEBOV were detected in the
plasma of all four ZEBOV siRNA treated macaques on day 6 and one of
these animals at day 10 (Subject 6), but ZEBOV was not detected in
any of these animals at day 14 (Table 8). It has been shown that
ZEBOV-infected rhesus monkeys succumb when viremia levels on days 6
to 10 after exposure exceed 4.5 log 10 pfu/ml, while animals
survive when levels fail to reach this level. Peak viremia in
surviving siRNA-treated macaques in this study never exceeded 2.4
log 10 pfu/ml (Table 8).
[0549] Clinical assessments also demonstrated that this aggressive
SNALP treatment regimen was well tolerated with only minor changes
in liver enzyme levels (alanine aminotransferase (ALT)<2-fold,
aspartate aminotransferase (AST)<6-fold increase), potentially
related to viral infection. All six animals that survived ZEBOV
challenge (two from the initial study and four from the second
study) were healthy on day 40 and were euthanized on days
40-43.
TABLE-US-00042 TABLE 7 Clinical findings in rhesus monkeys infected
with ZEBOV and given postexposure treatment with anti-ZEBOV siRNAs
(Subjects 1-3, 4-7), a nonspecific siRNA (Control 2), or no
treatment (Control 1). Animal Treatment Days 1-35 after ZEBOV
challenge Day of death Subject 1 Anti-ZEBOV siRNAs Anorexia (7-9),
Lymphopenia (6) Survived 30 min, days 1,3,5
AST.uparw..uparw..uparw. (10) Subject 2 Anti-ZEBOV siRNAs Fever
(6), Mild rash (8, 11, 12), Moderate rash (9, 10), Survived 30 min,
days 1,3,5 Depression (7-11), Anorexia (7-11), Diarrhea (12),
Lymphopenia (6, 14), Thrombocytopenia (6) ALP.uparw. (10),
ALT.uparw. (10), AST.uparw. (6), AST.uparw..uparw..uparw. (10),
GGT.uparw..uparw..uparw. (10) Subject 3 Anti-ZEBOV siRNAs Mild rash
(6-10), Depression (6-10), Anorexia (6-10), Day 10 30 min, days
1,3,5 Bleeding at venipuncture site (10), Recumbency (10),
Thrombocytopenia (6) ALP.uparw. (6), ALP.uparw..uparw..uparw. (10),
ALT.uparw..uparw. (10), AST.uparw. (3), AST.uparw..uparw..uparw.
(6, 10), BUN.uparw..uparw..uparw. (10), CRE.uparw..uparw..uparw.
(10), GGT.uparw..uparw..uparw. (10) Control 1 None Mild rash (5),
Anorexia (5), Depression (5) Day 6 Subject 4 Anti-ZEBOV siRNAs
Thrombocytopenia (6, 10) Survived 30 min, days 1-6
AST.uparw..uparw. (6) Subject 5 Anti-ZEBOV siRNAs
AST.uparw..uparw..uparw. (6), AST.uparw. (10) Survived 30 min, days
1-6 Subject 6 Anti-ZEBOV siRNAs Fever (10), Lymphopenia (6),
Survived 30 min, days 1-6 Thrombocytopenia (6, 10, 14) AST.uparw.
(10) Subject 7 Anti-ZEBOV siRNAs Fever (10), Lymphopenia (6),
Thrombocytopenia (6) Survived 30 min, days 1-6
AST.uparw..uparw..uparw. (10) Control 2 Nonspecific siRNA Fever
(6), Recumbency (10), Day 10 30 min, days 1-6 Thrombocytopenia (6)
ALT.uparw. (6), ALT.uparw..uparw..uparw. (10),
AST.uparw..uparw..uparw. (6, 10), BUN.uparw..uparw..uparw. (10),
CRE.uparw. (10) Fever is defined as a temperature more than
2.5.degree. F. over baseline or at least 1.5.degree. F. over
baseline and .gtoreq.103.5.degree. F. Mild rash: focal areas of
petechiae covering less than 10% of the skin; Moderate rash: areas
of petechiae covering between 10% and 40% of the skin; severe rash:
areas of petechiae and/or echymosis covering more than 40% of the
skin. Lymphopenia and thrombocytopenia defined by .gtoreq.35% drop
in numbers of lymphocytes and platelets, respectively. Alkaline
phosphatase (ALP), alanine aminotransferase (ALT), aspartate
aminotransferase (AST), gamma-glutamyltransferase (GGT), blood urea
nitrogen (BUN), creatinine (CRE) .uparw. = 2-3 fold increase;
.uparw..uparw. = 4-5 fold increase; .uparw..uparw..uparw. = >5
fold increase Days after filovirus challenge are shown in
parentheses ( )
TABLE-US-00043 TABLE 8 Plasma viral load in rhesus monkeys infected
with ZEBOV and given postexposure treatment with anti-ZEBOV siRNAs
(Subjects 1-3, 4-7), a nonspecific siRNA (Control 2), or no
treatment (Control 1). Animal Plasma viral load No. Treatment Day 3
Day 6 Day 10 Day 14 Subject 1 Anti-ZEBOV siRNAs 0* 0 0 0 30 min,
days 1,3,5 Subject 2 Anti-ZEBOV siRNAs 0 0 2.2 0 30 min, days 1,3,5
Subject 3 Anti-ZEBOV siRNAs 0 3.7 6.8 30 min, days 1,3,5 Control
None 0 1** Subject 4 Anti-ZEBOV siRNAs 0 2.0 0 0 30 min, days 1-6
Subject 5 Anti-ZEBOV siRNAs 0 2.4 0 0 30 min, days 1-6 Subject 6
Anti-ZEBOV siRNAs 0 2.0 2.1 0 30 min, days 1-6 Subject 7 Anti-ZEBOV
siRNAs 0 2.1 0 0 30 min, days 1-6 Control 2 Nonspecific siRNA 0 4.1
6.7 30 min, days 1-6 *Log10 plaque-forming units (pfu) of ZEBOV per
ml of plasma **Control 1 was found dead on day 6 and no blood was
collected for viral load
[0550] RNAi represents a promising new approach for combating human
diseases, including those caused by bacterial and viral pathogens.
Indeed, RNAi has been employed in cell culture systems and rodents
to inhibit the replication of a number of pathogens that cause
disease in humans. However, only two studies have examined the
utility of RNAi as an effective therapeutic modality in nonhuman
primate models of human infectious diseases. One study showed that
siRNAs inhibited the replication of GB virus B in a nonlethal
marmoset surrogate model of human hepatitis C (23), while a second
study showed that siRNAs against SARS coronavirus inhibited SARS
coronavirus replication in a nonlethal rhesus monkey model (24).
However, both of these studies used unmodified, accordingly immune
stimulatory, siRNA, potentially confounding the interpretation of
these results. To date, there has been no evaluation of the utility
of RNAi as a postexposure treatment in a lethal model of a human
infectious disease in nonhuman primates. This example shows that
siRNAs against ZEBOV inhibited replication of ZEBOV and completely
protected rhesus monkeys against death.
[0551] As noted above, the development of treatments for EBOV HF
has been slow and no previous candidate treatment has shown
complete protection against ZEBOV HF in nonhuman primates. Some
measure of success has been achieved using approaches that mitigate
the coagulation disorders that characterize EBOV infection (25,26).
Recently, 50% of nonhuman primates were protected against ZEBOV by
administering a live-attenuated recombinant vesicular stomatitis
virus vaccine vector expressing the ZEBOV GP shortly after a high
dose ZEBOV challenge (27). Several new postexposure treatment
approaches based on siRNA (1) and antisense oligomers (28,29) have
shown promising results in rodent models, but there have been no
reports of either treatment strategy being evaluated after EBOV
challenge in nonhuman primates, which more faithfully reproduce
human EBOV infections (2,22). While RNAi-mediated treatment
strategies show potential for combating EBOV infections, systemic
administration of synthetically manufactured siRNA duplexes can
activate the innate immune response, inducing high levels of
inflammatory cytokines such as tumor necrosis factor-alpha,
interleukin (IL)-6, and IFNs, particularly IFN-alpha (IFN-.alpha.),
which may contribute to the observed antiviral activity in vivo
(30-32). Off-target effects can be toxic to the host and also
confound interpretation of results. This SNALP formulation enters
cells of the reticuloendothelial system as shown by uptake of
fluorescent SNALP into Kupffer cells in the murine liver and in 53%
of CD14+ monocytes from human cord blood CD34+ cell culture (FIG.
7). These data show that SNALP can be taken up by the
reticuloendothelial cell population relevant to EBOV infection. It
is imperative that siRNA be modified to prevent immune activation
in vivo (19). When tested in vitro on human PBMC and in vivo in
mice, the ZEBOV cocktail was nonimmunostimulatory to the limit of
sensitivity of the assays used. These data and the 5'RACE PCR data
indicate that the observed antiviral effects in nonhuman primates
are the result of specific RNAi in reticuloendothelial cells and
not due to immunostimulation or other off-target effects.
[0552] In the tolerability studies, activities of alanine
aminotransferase (ALT), aspartate aminotransferase (AST), and
sorbitol dehydrogenase remained unchanged 48 h after the mice were
given the final dose of SNALPs containing ZEBOV siRNAs, even at the
highest cumulative dose (FIG. 8A). Complete blood cell and
differential counts were also unaffected at the doses tested in the
mice (FIG. 8B).
[0553] The rhesus macaque model employed in these studies
represents a worse-case scenario such as an accidental needle-stick
exposure of a laboratory worker or first responder to a high
infectious dose of ZEBOV as has occurred several times over the
past 5 years (33-35). ZEBOV infection of humans normally progresses
slower than ZEBOV infection of macaques, with case fatality rates
in humans ranging from 70-90% (2), indicating that the therapeutic
window may be larger than in experimentally infected macaques.
Nonetheless, anti-ZEBOV siRNA treatment can be beneficial if
administered at the onset of symptoms or at a pre-symptomatic stage
of the disease course. The results described herein demonstrate a
significant advance in treating ZEBOV infections of nonhuman
primates over previously described postexposure methods.
Methods
[0554] siRNA Design and In Vitro siRNA Screening Using psiCHECK2
Dual Luciferase Assay in HepG2 Cells.
[0555] siRNAs were designed to target individual regions of the
ZEBOV L-pol, VP24, or VP35 genes following the Tuschl siRNA user
guide as previously described. The siRNA duplexes were chemically
synthesized by Dharmacon Inc. (Chicago, Ill.) or Integrated DNA
Technologies BVBA (Leuven, Belgium). EK-1 siRNA targeting the L-pol
gene of ZEBOV was previously described (1). VP24-1160 and VP35-855
siRNAs targeting the VP24 and VP35 genes of ZEBOV were identified
by screening in vitro for reduction of either the ZEBOV VP24 or
ZEBOV VP35 viral transgene expressed under the control of the SV40
promoter in the psiCHECK2 dual-luciferase plasmid system (Promega,
Madison, Wis.) in HepG2 cells. Briefly, 10.mu.l of Lipofectamine
2000 (LF2000) complexes containing 0.75 .mu.g of plasmid and
10.mu.l of siRNA at various concentrations were added to a 96-well
plate followed by 80.mu.l of HepG2 cells (15,000 cells/well). 48 h
after transfection, cells were lysed. The dual-luciferase reporter
assay system (Promega) and a Berthold luminometer were used to
measure both Renilla luciferase (fused to either the ZEBOV-VP24 or
ZEBOV-VP35 transgene) and firefly luciferase signals. The Renilla
luciferase signal was normalized to the firefly luciferase signal
and expressed as percent gene expression relative to a plasmid-only
control assigned a value of 100%. Sequences of siRNAs are shown in
Table 9.
TABLE-US-00044 TABLE 9 Sequences of siRNAs targeting the ZEBOV VP24
and VP35 genes. SEQ Sense SEQ Target or Strand ID Antisense Strand
ID siRNA Sequence (5'.fwdarw.3') NO. Sequence (5'.fwdarw.3') NO.
VP24-775 GCUGAUUGACCAGUCUUUG 33 CAAAGACUGGUCAAUCAGC 34 VP24-978
ACGGAUUGUUGAGCAGUAU 35 AUACUGCUCAACAAUCCGU 36 VP24-1160
UCCUCGACACGAAUGCAAA 37 UUUGCAUUCGUGUCGAGGA 38 VP24-1160-
UCCUCGACACGAAUGCAAA 39 UUUGCAUUCGUGUCGAGGA 40 mod Luc
GAUUAUGUCCGGUUAUGUA 41 UACAUAACCGGACAUAAUC 42 VP35-219
GCGACAUCUUCUGUGAUAU 43 AUAUCACAGAAGAUGUCGC 44 VP35-349
GGAGGUAGUACAAACAUUG 45 CAAUGUUUGUACUACCUCC 46 VP35-687
GGGAGGCAUUCAACAAUCU 47 AGAUUGUUGAAUGCCUCCCU 48 VP35-855
GCAACUCAUUGGACAUCAU 49 AUGAUGUCCAAUGAGUUGC 50 2'OMe nucleotides are
indicated in bold and underlined. 3'-overhangs are indicated in
bold and italicized. The 3'-overhangs on one or both strands of the
siRNA molecule may alternatively comprise 1-4 deoxythymidine (dT)
nucleotides, 1-4 modified and/or unmodified uridine (U)
ribonucleotides, or 1-4 modified and/or unmodified ribonucleotides
having complementarity to the target sequence or the complementary
strand thereof.
[0556] ZEBOV Infection of Vero E6 Cells.
[0557] Vero E6 cells were plated at 1.times.10.sup.5 cells/ml (2
ml/well of a 6 well plate) and 24 h later treated with 50 nM of
SNALP containing either EK-1-mod, VP24-1160-mod, VP35-855-mod, or
ZEBOV cocktail (EK-1-mod, VP24-1160-mod, and VP35-855-mod in 1:1:1
ratio) or Luc mod SNALP for 16 h followed by infection with 1.0 MOI
of ZEBOV virus. Twenty-four hours after virus infection, cell
monolayers were lysed with Trizol Reagent (Invitrogen) for total
RNA isolation and 5'RACE assays.
[0558] Quantitative RT-PCR.
[0559] Viral RNA was purified using the Qiagen QIAmp viral RNA mini
kit (Qiagen, Valencia, Calif., USA) according to the manufacturer's
protocol. One-step quantitative real-time RT-PCR reactions were
done on a LightCycler 480 (Roche, Indianapolis, Ind., USA) in 20
.mu.L volumes with 5 .mu.L of purified RNA and the Superscript III
One-Step RT-PCR System (Invitrogen). Primers (forward
5'-CGGACCTGGTTTGGTTGTG-3'_(SEQ ID NO:73); reverse
5'-GCTGCAGTGTCGCATCTGA-3' (SEQ ID NO:74)) and TaqMan probe
(6-carboxyfluorescein-5'-CCCTTGCCACAATCT-minor groove binder
nonfluorescent quencher-3' (SEQ ID NO:74)) from Applied Biosystems
(Foster City, Calif., USA) were specific for the ZEBOV glycoprotein
gene. Cycling conditions were reverse transcription at 50.degree.
C. for 20 min, and initial denaturation at 95.degree. C. for 5 min;
followed by 45 cycles of denaturation at 95.degree. C. for 5 s, and
annealing, synthesis, and single acquisition at 60.degree. C. for
20 s; and final cooling at 40.degree. C. for 30 s. Absolute
quantification of viral gene expression was based on a viral RNA
standard by use of the LC480 software (version 1.50).
[0560] 5'RACE Assays.
[0561] Total RNA was extracted from cell lysates following the
Trizol method as described by the manufacturer. Total RNA (3.6
.mu.g) was ligated to 0.52 .mu.g of the GeneRacer RNA oligo adaptor
(5'-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3' (SEQ ID NO:75))
according to the GeneRacer Kit (Invitrogen) without prior
treatment. Ligated RNA was reverse transcribed using a
gene-specific primer, either to the L-pol (EK-1 GSP:
5'-TTTGTGATTCGTCCTTTTGCAGT-3' (SEQ ID NO:76)), VP24 (VP24-1160 GSP
5'-AGCAATTCTATGATGTTGTCTTGGA-3' (SEQ ID NO:77)), or VP35 (VP35-855
GSP 5'-CATCACTTTTGGTTTGGGTTACTT-3' (SEQ ID NO:78)). To detect
cleavage products, PCR was performed using primers, designed
according to the Invitrogen GeneRacer manual, complementary to the
RNA adaptor (GR5: 5-CGACTGGAGCACGAGGACACTGA-3' (SEQ ID NO:79)) and
either L-pol mRNA to detect EK-1 cleavage (EK-1 Rev2:
5'-TGAGATGGTTTTGGTGTGGCATCT-3' (SEQ ID NO:80)), VP24 mRNA to detect
VP24-1160 cleavage (VP24-1160 Rev2: 5'-CCTGGTTTTTGTAAGGGTGTCAACT-3'
(SEQ ID NO:81)), or VP35 mRNA to detect VP35-855 cleavage (VP35-855
Rev2: 5'-TTTCTGGCAAGCTCGGGGAATGT-3' (SEQ ID NO:82)). Amplification
products were resolved by agarose gel electrophoresis using 2%
Agarose 1000/TBE gels (Invitrogen) and visualized by ethidium
bromide staining. The identity of specific PCR products was
confirmed by direct sequencing of the excised bands using a primer
from within the GeneRacer sequence (GR5 5':
5'-ACTGGAGCACGAGGACAC-3' (SEQ ID NO:83)) and a primer downstream of
either the EK-1 cleavage site (EK-1 3'seq:
5'-AGCCATAACATACCCTCAGT-3' (SEQ ID NO:84)), VP24-1160 cleavage site
(VP24-1160 3'seq: 5'-ATGAAAGCAGAGATGTCAAG-3' (SEQ ID NO:85)), or
VP35-855 cleavage site (VP35-855 3'seq: 5'-ATTAGGGCACATTGAGGAG-3'
(SEQ ID NO:86)).
[0562] In Vitro Immune Stimulation Assays.
[0563] Human PBMC were isolated from whole blood from healthy
donors by a standard Ficoll-Hypaque density centrifugation
technique. Immune stimulation assays were performed as previously
described (21). In brief, PBMC were resuspended in RPMI 1640 media
supplemented with 10% FBS and plated in 96 well plates at
2.5.times.10.sup.5 cells/well. SNALP-formulated siRNAs were
immediately added to cells and cultured for 24 h. IFN-.alpha. was
measured in culture supernatants by ELISA (PBL Biomedical
Piscataway, N.J.).
[0564] Differentiation and SNALP Uptake in CD34+Cells from Cord
Blood.
[0565] Human cord blood stem cells (Stem Cell Technologies,
Vancouver, BC) were cultured for 5 days in Iscove's Modified
Dulbecco's Media (IMDM) with Glutamax (Invitrogen, Carlsbad,
Calif.), 20% BIT 9500 serum substitute (Stem Cell Technologies,
Vancouver, BC), 40 .mu.g/ml human LDL (Calbiochem), 55 .mu.M
.beta.-mercaptoethanol, 100 ng/ml each of hFlt3L and hSCF and 10
ng/ml hTPO (Peprotech, Rocky Hill, N.J.). Cells were given fresh
media every 3 days. To prime cells for differentiation, on day 6
cells were supplemented with 20 ng/ml each of rhIL-3 and rhIL-6
(R&D Systems, Minneapolis, Minn.). At day 10, cells were
differentiated into dendritic cells and monocytes by the further
addition of 50 ng/ml of rhM-CSF and 20 ng/ml rhGM-CSF
(Peprotech).
[0566] Fully differentiated CD34 cells were incubated with 150 nM
FITC labelled Luc mod modified SNALP for 4 hrs after which cells
were harvested, washed in 2% FBS in PBS and stained with
fluorescently labelled antibodies (BD Biosciences) against cell
phenotype markers (CD11c, CD11b, CD14, and CD34). Cell uptake by
phenotype was acquired and analyzed on a 3 laser, 8 color LSRII
using FACSDiva software V 6.0.
[0567] Mouse Studies.
[0568] Animal studies were completed in accordance with the
Canadian Council on Animal Care guidelines following approval by
the local Animal Care and Use Committee at Tekmira Pharmaceuticals.
Six to eight-week-old female CD1 ICR mice were subjected to a one
week quarantine and acclimation period prior to use. SNALP were
administered by standard intravenous injection in the lateral tail
vein in 0.2 mL PBS. To measure in vivo cytokine induction, blood
was collected by cardiac puncture 4 h after siRNA administration
and processed as plasma for cytokine analysis. Liver tissues were
also collected into RNALater solution (Sigma Aldrich Co.; St Louis,
Mo.) for IFIT1 mRNA analysis.
[0569] Cytokine ELISA.
[0570] All cytokines were quantified using sandwich ELISA kits
according to the manufacturer's instructions. These were mouse
IFN-.alpha. (PBL Biomedical; Piscataway, N.J.), and mouse IL-6
(eBioscience; San Diego, Calif.).
[0571] Measurement of IFIT1 mRNA in Mouse Liver.
[0572] Livers of mice were homogenized in Tissue and Lysis Solution
(EpiCentre Biotechnologies; Madison, Wis.) containing 50 mg/ml
proteinase K (EpiCentre) in a Fastprep tissue homogenizer using the
Lysis Matrix A tubes containing garnet sand and 1 bead (MP
Biomedicals). Tissues were homogenized three times at a speed of
5.5 for 15 sec each followed by incubation in a 65.degree. C. water
bath for 15 min and centrifugation for 5 min at 16,000.times.g at
16.degree. C. The QuantiGene branched DNA assay (Affymetrix) was
performed as per the manufacturer's instructions (Quantigene 1.0
Manual) to determine induction of IFIT1 mRNA relative to the house
keeping gene GAPDH in liver lysates. The IFIT1 probe set was
specific to mouse IFIT1 (positions 4-499, NM_008331) and the GAPDH
probe set was specific to mouse GAPDH (positions 9-319, NM_008084).
Data is shown as the ratio of IFIT1 relative light units (RLU) to
GAPDH RLU.
[0573] siRNAs Used in Nonhuman Primate Studies.
[0574] siRNAs used for nonhuman primate studies were selected based
on RNAi activity assays and immunostimulatory studies. The siRNA
duplexes were chemically synthesized by Dharmacon Inc. or
Integrated DNA Technologies BVBA (Leuven, Belgium). Sequences used
in the nonhuman primate studies are shown in Table 10. The ZEBOV
siRNA cocktail was a 1:1:1 mixture (by mass) of the EK-1-mod,
VP24-1160-mod, and VP35-855-mod siRNAs.
TABLE-US-00045 TABLE 10 Sequences of siRNAs targeting the ZEBOV
L-pol, VP24, and VP35 genes. SEQ Sense SEQ Target or Strand ID
Antisense Strand ID siRNA Sequence (5'.fwdarw.3') NO. Sequence
(5'.fwdarw.3') NO. Luc GAUUAUGUCCGGUUAUGUA 41 UACAUAACCGGACAUAAUC
42 Luc-mod GAUUAUGUCCGGUUAUGUA 51 UACAUAACCGGACAUAAUC 52 EK-1
GUACGAAGCUGUAUAUAAA 53 UUUAUAUACAGCUUCGUAC 54 EK-1-mod
GUACGAAGCUGUAUAUAAA 55 UUUAUAUACAGCUUCGUAC 56 VP24-1160
UCCUCGACACGAAUGCAAA 37 UUUGCAUUCGUGUCGAGGA 38 VP24-1160-mod
UCCUCGACACGAAUGCAAA 39 UUUGCAUUCGUGUCGAGGA 40 VP35-855
GCAACUCAUUGGACAUCAU 49 AUGAUGUCCAAUGAGUUGC 50 VP35-855-mod
GCAACUCAUUGGACAUCAU 57 AUGAUGUCCAAUGAGUUGC 58 2'OMe nucleotides are
indicated in bold and underlined. 3'-overhangs are indicated in
bold and italicized. The 3'-overhangs on one or both strands of the
siRNA molecule may alternatively comprise 1-4 deoxythymidine (dT)
nucleotides, 1-4 modified and/or unmodified uridine (U)
ribonucleotides, or 1-4 modified and/or unmodified ribonucleotides
having complementarity to the target sequence or the complementary
strand thereof.
[0575] Lipid Encapsulation of siRNA.
[0576] siRNA were encapsulated by the process of spontaneous
vesicle formation reported by Jeffs and colleagues (36). ZEBOV
siRNA were formulated as a cocktail in the same lipid particle.
SNALP were comprised of synthetic cholesterol (Sigma, St. Louis,
Mo.), the phospholipid DPPC (dipalmitoylphosphatidylcholine; Avanti
Polar Lipids, Alabaster, Ala.), the PEG-lipid PEG-C-DMA
(3-N-[(.omega.-methoxy poly(ethylene
glycol)2000)carbamoyl]-1,2-dimyrestyloxy-propylamine) (37), and the
cationic lipid DLinDMA
(1,2-dilinoleyloxy-3-N,N-dimethylaminopropane) (37). The resulting
SNALP were dialyzed in PBS and filter sterilized through a 0.2
.mu.m filter before use. Particle sizes ranged from 81 to 85 nm
(for example, the average size of ZEBOV SNALP particles used in the
first nonhuman primate was 81.7 nm) and typically 90-95% of the
siRNA was encapsulated within these lipid particles. Particle size
is consistent batch to batch with a tight size and polydispersity
within each batch. Endotoxin is less than 3 EU/ml for all batches.
No sample aggregation is observed as shown through particle size
testing.
[0577] Rhesus Macaques.
[0578] Nine healthy, Filovirus-seronegative rhesus macaques (Macaca
mulatta) of Chinese origin (5-8 kg) were used for these studies.
Four animals were employed in study 1 and 5 animals were employed
in study 2. Hickman, Leonard, Broviac Central Venous Catheters
(BARD Access Systems; Salt Lake City, Utah) were placed into the
lumen of the jugular vein of each animal and advanced so that the
tip lay in the superior vena cava above the right atrium. The
catheters were tunneled subcutaneously from the cervical surgery
site over the right shoulder and to the point in the center of the
back. After closure of the last skin incision, monkeys were placed
in Lomir primate jackets (Lomir Biomedical Inc.; Malone, N.Y.),
returned to their cages, and tethered. A continuous i.v. infusion
of saline at a rate of 2 ml/h was provided using a basic single
syringe KDS100 infusion pump (KDS Scientific; Holliston, Mass.).
Seven days after insertion of the catheters and placement in Lomir
primate jackets, animals were inoculated intramuscularly (i.m.)
with 1000 pfu of ZEBOV (Kikwit strain). In the first study
employing four macaques, the pool of SNALP-formulated anti-ZEBOV
siRNAs (2 mg/kg) was administered to three of the macaques by bolus
i.v. infusion 30 minutes after the ZEBOV challenge, while the
control animal received no treatment. The three animals received
additional treatments of the SNALP-formulated anti-ZEBOV siRNAs on
days 1, 3, and 5 after the ZEBOV challenge. In the second study
employing five macaques, the pool of SNALP-formulated anti-ZEBOV
siRNAs was administered to four of the macaques by bolus i.v.
infusion 30 minutes after the ZEBOV challenge, while the control
animal received an equal dose of SNALP-formulated nonspecific
siRNAs. The animals received additional treatments of the
SNALP-formulated anti-ZEBOV siRNAs or the SNALP-formulated
nonspecific siRNA (control) on days 1, 2, 3, 4, 5, and 6 after the
ZEBOV challenge. Animals were given physical exams and blood was
collected at the time of challenge and on days 3, 6, 10, 14, 22,
and 40-43 after Filovirus challenge.
[0579] Animal studies performed in BSL-4 biocontainment at USAMRIID
were approved by the USAMRIID Laboratory Animal Use Committee.
Animal research was conducted in compliance with the Animal Welfare
Act and other Federal statutes and regulations relating to animals
and experiments involving animals and adheres to the principles
stated in the Guide for the Care and Use of Laboratory Animals,
National Research Council, 1996. The facilities used are fully
accredited by the Association for Assessment and Accreditation of
Laboratory Animal Care International.
[0580] Hematology and Serum Biochemistry.
[0581] Total white blood cell counts, white blood cell
differentials, red blood cell counts, platelet counts, hematocrit
values, total hemoglobin, mean cell volume, mean corpuscular
volume, and mean corpuscular hemoglobin concentration were
determined from blood samples collected in tubes containing EDTA,
by using a laser-based hematologic Analyzer (Coulter Electronics;
Hialeah, Fla., USA). The white blood cell differentials were
performed manually on Wright-stained blood smears. Serum samples
were tested for concentrations of albumin (ALB), amylase (AMY),
alanine aminotransferase (ALT), aspartate aminotransferase (AST),
alkaline phosphatase (ALP), gamma-glutamyltransferase (GGT),
glucose (GLU), cholesterol (CHOL), total protein (TP), total
bilirubin (TBIL), blood urea nitrogen (BUN), and creatinine (CRE)
by using a Piccolo Point-Of-Care Blood Analyzer (Abaxis; Sunnyvale,
Calif., USA).
[0582] Virus Detection by Plaque Assay.
[0583] Virus titration was performed by conventional plaque assay
on Vero E6 cells from cell culture fluids of blood collected from
rhesus monkeys as previously described (38).
REFERENCES
[0584] 1. Geisbert, T. W. et al. Postexposure protection of guinea
pigs against a lethal Ebola virus challenge is conferred by RNA
interference. J. Infect. Dis. 193, 1650-1657 (2006). [0585] 2.
Sanchez, A., Geisbert, T. W. & Feldmann, H. Filoviridae:
Marburg and Ebola Viruses. in Fields Virology (eds. Knipe, D. M.
& Howley, P. M.) 1409-1448 (Lippincott Williams & Wilkins,
Philadelphia). [0586] 3. Towner, J. S. et al. Newly discovered
Ebola virus associated with hemorrhagic fever outbreak in Uganda.
PLoS Pathog. 4, e1000212 (2008). [0587] 4. Sanchez, A., Kiley, M.
P., Holloway, B. P. & Auperin, D. D. Sequence analysis of the
Ebola virus genome: organization, genetic elements, and comparison
with the genome of Marburg virus. Virus Res. 29, 215-240 (1993).
[0588] 5. Basler, C. F. et al. The Ebola virus VP35 protein
functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
97, 12289-12294 (2000). [0589] 6. Basler, C. F. et al. The Ebola
virus VP35 protein inhibits activation of interferon regulatory
factor 3. J. Virol. 77, 7945-7956 (2003). [0590] 7. Basler, C. F.
and Palese, P. Modulation of innate immunity by filoviruses. in
Ebola and Marburg viruses: molecular and cellular biology (eds.
Klenk, H. D. & Feldmann, H) (Horizon Bioscience, Norfolk, U K,
2004). [0591] 8. Ebihara, H. et al. Molecular determinants of Ebola
virus virulence in mice. PLoS Pathog. 2, e73 (2006). [0592] 9.
Volchkov, V. E., Chepurnov, A. A., Volchkova. V. A., Ternovoj. V.
A. & Klenk, H. D. Molecular characterization of guinea
pig-adapted variants of Ebola virus. Virology 277, 147-155 (2000).
[0593] 10. Sullivan, N. J., Sanchez, A., Rollin, P. E., Yang, Z. Y.
& and G. J. Nabel. Development of a preventive vaccine for
Ebola virus infection in primates. Nature 408, 605-609 (2000).
[0594] 11. Sullivan, N. J. et al. Accelerated vaccination for Ebola
virus haemorrhagic fever in non-human primates. Nature 424, 681-684
(2003). [0595] 12. Jones, S. M. et al. Live attenuated recombinant
vaccine protects nonhuman primates against Ebola and Marburg
viruses. Nat. Med. 11, 786-790 (2005). [0596] 13. Sullivan, N. J.
et al. Immune protection of nonhuman primates against Ebola virus
with single low-dose adenovirus vectors encoding modified GPs. PLoS
Med. 3, e177 (2006). [0597] 14. Bukreyev, A. et al. Successful
topical respiratory tract immunization of primates against Ebola
virus. J. Virol. 81, 6379-88 (2007). [0598] 15. Warfield, K. L.,
Swenson, D. L., Olinger, G. G., Kalina, W. V., Aman, M. J. &
Bavari, S. 2007. Ebola virus-like particle-based vaccine protects
nonhuman primates against lethal Ebola virus challenge. J. Infect.
Dis. 196 Suppl 2, S430-437 (2007). [0599] 16. Geisbert, T. W. et
al. Vesicular stomatitis virus-based vaccines protect nonhuman
primates against aerosol challenge with Ebola and Marburg viruses.
Vaccine 26, 6894-6900 (2008). [0600] 17. Swenson, D. L. et al.
Complete protection of nonhuman primates against multi-strain Ebola
and Marburg virus infections. Clin. Vaccine Immunol. 15, 460-467
(2008). [0601] 18. Grimm, D. & Kay, M. Combinatorial RNAi: A
winning strategy for the race against evolving targets? Mol. Ther.
15, 878-888 (2007). [0602] 19. Robbins, M. A., Judge, A. D. &
MacLachlan, I. siRNA and innate immunity. Oligonucleotides 19,
89-101 (2009). [0603] 20. Judge, A. et al. Confirming the
RNAi-mediated mechanism of action of siRNA-based cancer
therapeutics in mice. J. Clin. Invest. 119, 661-673 (2009). [0604]
21. Judge, A. D., Bola, G., Lee, A. C. H. & MacLachlan, I.
Design of noninflammatory synthetic siRNA mediating potent gene
silencing in vivo. Mol. Ther. 13, 494-505 (2006). [0605] 22.
Geisbert, T. W., Jahrling, P. B., Larsen, T., Davis, K. J. &
Hensley, L. E. Filovirus Pathogenesis in Nonhuman Primates. in
Ebola and Marburg Viruses: Molecular and Cellular Biology (eds.
Klenk, H. D. & Feldmann, H.) 203-238 (Horizon Bioscience,
Norfolk, UK, 2004). [0606] 23. Yokota, T. et al. Efficient
regulation of viral replication by siRNA in a non-human primate
surrogate model for hepatitis C. Biochem. Biophys. Res. Commun.
361, 294-300 (2007). [0607] 24. Tang, Q., Li, B., Woodle, M. &
Lu, P. Y. Application if siRNA against SARS in the rhesus macaque
model. Methods Mol. Biol. 442, 139-158 (2008). [0608] 25. Geisbert,
T. W. et al. Treatment of Ebola virus infection with a recombinant
inhibitor of factor VIIa/tissue factor: a study in rhesus monkeys.
Lancet 362, 1953-1958 (2003). [0609] 26. Hensley, L. E. et al.
Recombinant human activated protein C for the postexposure
treatment of Ebola hemorrhagic fever. J. Infect. Dis. 196 Suppl 2,
S390-S399 (2007). [0610] 27. Feldmann, H. et al. Effective
post-exposure treatment of Ebola infection. PLoS Pathog. 3, e2
(2007). [0611] 28. Enterlein, S. et al. VP35 knockdown inhibits
Ebola virus amplification and protects against lethal infection in
mice. Antimicrob. Agents Chemother. 50, 984-993 (2006). [0612] 29.
Warfield, K. L. et al. Gene-specific countermeasures against Ebola
virus based on antisense phosphorodiamidate morpholino oligomers.
PLoS Pathog. 2, e1 (2006). [0613] 30. Hornung, V, et al.
Sequence-specific potent induction of IFN-alpha by short
interfering RNA in plasmacytoid dendritic cells through TLR7. Nat.
Med. 11, 263-270 (2005). [0614] 31. Judge, A. D., Sood, V., Shaw,
J. R., Fang, D., McClintock, K. & MacLachlan, I.
Sequence-dependent stimulation of the mammalian innate immune
response by synthetic siRNA. Nat. Biotechnol. 23, 457-462 (2005).
[0615] 32. Robbins, M, et al. Misinterpreting the therapeutic
effects of siRNA caused by immune stimulation. Hum. Gene Ther. 19,
991-999 (2008). [0616] 33. Kortepeter, M. G., et al. Managing
potential laboratory exposure to Ebola virus by using a patient
biocontainment care unit. Emerg. Infect. Dis. 14, 881-887 (2008).
[0617] 34. International Society for Infectious Diseases. Ebola
virus, needlestick injury--Germany: (Hamburg). Archive number
20090317.1084 [0618] 35. International Society for Infectious
Diseases. Ebola, lab accident death--Russia (Siberia). Archive
number 20040522.1377 [0619] 36. Jeffs, L. B., Palmer, L. R.,
Ambegia, E. G., Giesbrecht, C., Ewanick, S. & MacLachlan, I. A
scalable, extrusion-free method for efficient liposomal
encapsulation of plasmid DNA. Pharm. Res. 22, 362-372 (2005).
[0620] 37. Heyes, J., Palmer, L., Bremner, K. & MacLachlan, I.
Cationic lipid saturation influences intracellular delivery of
encapsulated nucleic acids. J. Control Release 107, 276-287 (2005).
[0621] 38. Jahrling, P. B. et al. Evaluation of immune globulin and
recombinant interferon .alpha.-2b for treatment of experimental
Ebola virus infections. J. Infect. Dis. 179 Suppl 1, S224-S234
(1999).
Example 2
Characterization of Inflammatory Response to SNALP Formulations in
Human Whole Blood
[0622] Inflammatory response to SNALPs containing one or more
interfering RNAs (e.g., siRNAs) targeting one or more genes of
interest such as one, two, or all three of the EBOV L-pol, VP24,
and VP35 genes can be evaluated by measuring cytokine induction ex
vivo in whole blood samples taken from human subjects. In certain
instances, the SNALPs can contain either no siRNA payload ("empty")
or an siRNA payload comprising one or a pool of siRNAs. The siRNAs
tested can include, e.g., any of the EBOV siRNA molecules described
herein, whether alone or in combination (e.g., L-pol+VP35 siRNAs,
L-pol+VP24 siRNAs, VP24+VP35 siRNAs, or L-pol+VP24+VP35 siRNAs).
Briefly, fresh blood is isolated, immediately diluted 1:1 with 0.9%
saline solution, and plated 0.45 mL/well into 48 well tissue
culture treated plates. SNALPs are diluted in formulation PBS and
added to the plated blood samples at a concentration of either 300
nM or 1200 nM. After 24 hours, the plates are centrifuged at 1200
rpm for 20 minutes and the supernatant (plasma) is collected.
Cytokine induction (e.g., TNF.alpha., IL-8, etc.) can be measured
by ELISA and/or Cytometric Bead Array.
[0623] In particular embodiments, increasing the number of
selective 2'OMe modifications to an siRNA sequence (e.g., 2'OMe
modifications at G's and/or U's in the double-stranded and/or 3'
overhang regions of the siRNA sequence) can decrease the
immunostimulatory response to the siRNA.
Example 3
In Vitro and In Vivo Activity Screen of Modified EBOV siRNAs in
SNALP Formulations
[0624] EBOV L-pol siRNAs of the same nucleotide sequence were
modified to incorporate an increasing number and alternate patterns
of 2'OMe nucleotides. 307 different sense strands (S-1 to S-307)
and 331 different antisense strands (AS-1 to AS-331) were designed
(see, Tables 1-2). EBOV L-pol double-stranded siRNAs were generated
by mix and match annealing of all possible combinations of sense
strands and antisense strands. The number of modifications for
double-stranded L-pol siRNAs ranged from 5 to 11 2'OMe nucleotides
in the double-stranded region. In certain embodiments, the pattern
of modification can include 2'OMe-modified nucleotides in the 3'
overhang of one or both strands of the siRNA, such that the number
of modifications is further increased in the entire siRNA molecule.
Table 11 shows exemplary modified double-stranded L-pol siRNAs that
resulted from the mix and match annealing of sense strands S-1 to
S-3 with antisense strands AS-1 to AS-6.
TABLE-US-00046 TABLE 11 EBOV L-pol % 2'OMe- % Modified siRNA siRNA
Sequence (SEQ ID NO:) Modified in DS Region EK-1 S1/AS1
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 5/42 = 11.9% 5/38 = 13.2%
3'-TTCAUGCUUCGACAUAUAUUU-5' (4) EK-1 S1/AS2
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 6/42 = 14.3% 6/38 = 15.8%
3'-TTCAUGCUUCGACAUAUAUUU-5' (5) EK-1 S1/AS3
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 6/42 = 14.3% 6/38 = 15.8%
3'-TTCAUGCUUCGACAUAUAUUU-5' (6) EK-1 S1/AS4
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 6/42 = 14.3% 6/38 = 15.8%
3'-TTCAUGCUUCGACAUAUAUUU-5' (7) EK-1 S1/AS5
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 7/42 = 16.7% 7/38 = 18.4%
3'-TTCAUGCUUCGACAUAUAUUU-5' (8) EK-1 S1/AS6
5'-GUACGAAGCUGUAUAUAAATT-3' (1) 6/42 = 14.3% 6/38 = 15.8%
3'-TTCAUGCUUCGACAUAUAUUU-5' (9) EK-1 S2/AS1
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 9/42 = 21.4% 9/38 = 23.7%
3'-TTCAUGCUUCGACAUAUAUUU-5' (4) EK-1 S2/AS2
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 10/42 = 23.8% 10/38 = 26.3%
3'-TTCAUGCUUCGACAUAUAUUU-5' (5) EK-1 S2/AS3
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 10/42 = 23.8% 10/38 = 26.3%
3'-TTCAUGCUUCGACAUAUAUUU-5' (6) EK-1 S2/AS4
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 10/42 = 23.8% 10/38 = 26.3%
3'-TTCAUGCUUCGACAUAUAUUU-5' (7) EK-1 S2/AS5
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 11/42 = 26.2% 11/38 = 28.9%
3'-TTCAUGCUUCGACAUAUAUUU-5' (8) EK-1 S2/AS6
5'-GUACGAAGCUGUAUAUAAATT-3' (2) 10/42 = 23.8% 10/38 = 26.3%
3'-TTCAUGCUUCGACAUAUAUUU-5' (9) EK-1 S3/AS1
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 6/42 = 14.3% 6/38 = 15.8%
3'-TTCAUGCUUCGACAUAUAUUU-5' (4) EK-1 S3/AS2
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 7/42 = 16.7% 7/38 = 18.4%
3'-TTCAUGCUUCGACAUAUAUUU-5' (5) EK-1 S3/AS3
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 7/42 = 16.7% 7/38 = 18.4%
3'-TTCAUGCUUCGACAUAUAUUU-5' (6) EK-1 S3/AS4
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 7/42 = 16.7% 7/38 = 18.4%
3'-TTCAUGCUUCGACAUAUAUUU-5' (7) EK-1 S3/AS5
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 8/42 = 19% 8/38 = 21.1%
3'-TTCAUGCUUCGACAUAUAUUU-5' (8) EK-1 S3/AS6
5'-GUACGAAGCUGUAUAUAAATT-3' (3) 7/42 = 16.7% 7/38 = 18.4%
3'-TTCAUGCUUCGACAUAUAUUU-5' (9)
[0625] EBOV VP35 siRNAs of the same nucleotide sequence were
modified to incorporate an increasing number and alternate patterns
of 2'OMe nucleotides. 37 different sense strands (S-1 to S-37) and
50 different antisense strands (AS-1 to AS-50) were designed (see,
Tables 5-6). EBOV VP35 double-stranded siRNAs were generated by mix
and match annealing of all possible combinations of sense strands
and antisense strands. The number of modifications for
double-stranded VP35 siRNAs ranged from 6 to 11 2'OMe nucleotides
in the double-stranded region. In certain embodiments, the pattern
of modification included 2'OMe-modified nucleotides in the 3'
overhang of one or both strands of the siRNA, such that the number
of modifications was further increased in the entire siRNA
molecule. Table 12 shows exemplary modified double-stranded VP35
siRNAs that resulted from the mix and match annealing of sense
strands S-1 to S-3 with antisense strands AS-1 to AS-5.
TABLE-US-00047 TABLE 12 EBOV VP35 % 2'OMe- % Modified siRNA siRNA
Sequence (SEQ ID NO:) Modified in DS Region VP35-855 S1/AS1
5'-GCAACUCAUUGGACAUCAUUC-3' (25) 6/42 = 14.3% 6/38 = 15.8%
3'-AUCGUUGAGUAACCUGUAGUA-5' (28) VP35-855 S1/AS2
5'-GCAACUCAUUGGACAUCAUUC-3' (25) 7/42 = 16.7% 6/38 = 15.8%
3'-AUCGUUGAGUAACCUGUAGUA-5' (29) VP35-855 S1/AS3
5'-GCAACUCAUUGGACAUCAUUC-3' (25) 8/42 = 19% 7/38 = 18.4%
3'-AUCGUUGAGUAACCUGUAGUA-5' (30) VP35-855 S1/AS4
5'-GCAACUCAUUGGACAUCAUUC-3' (25) 8/42 = 19% 7/38 = 18.4%
3'-AUCGUUGAGUAACCUGUAGUA-5' (31) VP35-855 S1/AS5
5'-GCAACUCAUUGGACAUCAUUC-3' (25) 9/42 = 21.4% 8/38 = 21.1%
3'-AUCGUUGAGUAACCUGUAGUA-5' (32) VP35-855 S2/AS1
5'-GCAACUCAUUGGACAUCAUUC-3' (26) 10/42 = 23.8% 9/38 = 23.7%
3'-AUCGUUGAGUAACCUGUAGUA-5' (28) VP35-855 S2/AS2
5'-GCAACUCAUUGGACAUCAUUC-3' (26) 11/42 = 26.2% 9/38 = 23.7%
3'-AUCGUUGAGUAACCUGUAGUA-5' (29) VP35-855 S2/AS3
5'-GCAACUCAUUGGACAUCAUUC-3' (26) 12/42 = 28.6% 10/38 = 26.3%
3'-AUCGUUGAGUAACCUGUAGUA-5' (30) VP35-855 S2/AS4
5'-GCAACUCAUUGGACAUCAUUC-3' (26) 12/42 = 28.6% 10/38 = 26.3%
3'-AUCGUUGAGUAACCUGUAGUA-5' (31) VP35-855 S2/AS5
5'-GCAACUCAUUGGACAUCAUUC-3' (26) 13/42 = 31% 11/38 = 28.9%
3'-AUCGUUGAGUAACCUGUAGUA-5' (32) VP35-855 S3/AS1
5'-GCAACUCAUUGGACAUCAUUC-3' (27) 8/42 = 19% 7/38 = 18.4%
3'-AUCGUUGAGUAACCUGUAGUA-5' (28) VP35-855 S3/AS2
5'-GCAACUCAUUGGACAUCAUUC-3' (27) 9/42 = 21.4% 7/38 = 18.4%
3'-AUCGUUGAGUAACCUGUAGUA-5' (29) VP35-855 S3/AS3
5'-GCAACUCAUUGGACAUCAUUC-3' (27) 10/42 = 23.8% 8/38 = 21.1%
3'-AUCGUUGAGUAACCUGUAGUA-5' (30) VP35-855 S3/AS4
5'-GCAACUCAUUGGACAUCAUUC-3' (27) 10/42 = 23.8% 8/38 = 21.1%
3'-AUCGUUGAGUAACCUGUAGUA-5' (31) VP35-855 S3/AS5
5'-GCAACUCAUUGGACAUCAUUC-3' (27) 11/42 = 26.2% 9/38 = 23.7%
3'-AUCGUUGAGUAACCUGUAGUA-5' (32)
[0626] In certain embodiments, EBOV L-pol and VP35 siRNA duplexes
can be prepared and tested in vitro and in vivo as follows: (1)
siRNA sense strand (e.g., at 2.times.1 mol scale) and antisense
strand (e.g., at 1.times.1 mol scale) sequences are synthesized;
(2) the sense and antisense sequences are hydrated in RNA buffer
to, e.g., 5 mg/ml, and quantitated at OD260 using a nanodrop; (3)
the sense and antisense sequences (e.g., 600 .mu.g of each) are
annealed and formulated into SNALP as described herein (e.g., as a
1:57 SNALP using a syringe press method) at, e.g., a 250 .mu.g
scale, and tested on human whole blood for immunostimulation as
described, e.g., in Example 2 above; (4) non-immunostimulatory
siRNAs are formulated into SNALP (e.g., as a 1:57 SNALP formulation
using a pH loading method) and tested on cells such as Vero E6
cells against ZEBOV as described, e.g., in Example 1 above; and (5)
lead modified siRNAs are scaled up (e.g., at a 500 mg scale) and
tested in vivo in an animal model such as monkeys for assessment of
non-human primate (NHP) efficacy as described, e.g., in Example 1
above.
[0627] In particular embodiments, increasing the number of
selective 2'OMe modifications to the siRNA sequence (e.g., 2'OMe
modifications at G's and/or U's in the double-stranded and/or 3'
overhang regions of the siRNA sequence) does not decrease activity,
and in some cases increases silencing activity.
Example 4
Synthesis of 1,2-Di-.gamma.-Linolenyloxy-N,N-Dimethylaminopropane
(.gamma.-DLenDMA)
[0628] .gamma.-DLenDMA having the structure shown below was
synthesized as described below.
##STR00039##
[0629] A 250 mL round bottom flask was charged with
3-(dimethylamino)-1,2-propanediol (0.8 g, 6.7 mmol),
tetrabutylammonium hydrogen sulphate (1 g), gamma linolenyl
mesylate (cis-6,9,12-octadecatriene sulphonic acid) (5 g, 14.6
mmol), and 30 mL toluene. After stirring for 15 minutes, the
reaction was cooled to 0-5.degree. C. A solution of 40% sodium
hydroxide (15 mL) was added slowly. The reaction was left to stir
for approximately 48 hours. An additional 15 mL of toluene was then
added to the reaction vessel, along with 40% sodium hydroxide (15
mL). After the reaction was stirred for an additional 12 hours,
water (50 mL) and isopropyl acetate (50 mL) were added and stirred
for 15 minutes. The mixture was then transferred to a 500 mL
separatory funnel and allowed to separate. The lower aqueous phase
was run off and the organic phase was washed with saturated sodium
chloride (2.times.50 mL). Since the aqueous and organic phases
resulting from the saturated sodium chloride washes could not be
completely separated after 20 minutes, the lower aqueous phase
(slightly yellow) was run off and back extracted with chloroform
(.about.45 mL). The organic phase was dried with MgSO.sub.4,
filtered, and the solvent evaporated.
[0630] The crude product, an orange liquid, was purified on column
chromatography using silica gel (60 g) with 0-3% methanol gradient
in dichloromethane to yield 3.19 g. The product was further
purified via column chromatography on silica gel (50 g) with 10-30%
ethyl acetate gradient in hexanes to yield 1.26 g pure product.
Example 5
Synthesis of 1,2-Diphytanyloxy-3-(N,N-dimethyl)-propylamine
(DPanDMA)
[0631] DPanDMA having the structure shown below was synthesized as
described below.
##STR00040##
Step 1: Synthesis of Phytanol
##STR00041##
[0633] Phytol (21.0 g, 70.8 mmol), ethanol (180 mL) and a stir bar
were added to a 500 mL round bottom flask. Raney Nickel 2800 (as
purchased, a 50% by weight solution in water if used as purchased,
Nickel>89% metal present) (6.8 g, 51.5 mmol) was added, and the
flask sealed and flushed with hydrogen. A 12'' needle was used to
bubble hydrogen through the solution for 10 minutes. The reaction
was stirred for 5 days, using a balloon as a hydrogen reservoir.
Hydrogen was also bubbled through the reaction mixture at 24 h and
48 h, 5 minutes each time. The metal catalyst was then removed by
filtering through Celite. The ethanolic solution was concentrated,
and 200 mL of DCM added to the resulting oil. The solution was
washed with water (2.times.100 mL), dried over MgSO.sub.4, and
concentrated. TLC indicated formation of the phytanol product,
yield 20.0 g.
Step 2: Synthesis of Phytanyl Mesylate
##STR00042##
[0635] Phytanol (20.0 g, 66.7 mmol), triethylamine (18.6 mL, 133
mmol), and a stir bar were added to a 1000 mL round bottom flask.
The flask was sealed and flushed with nitrogen. Anhydrous DCM (250
mL) was added, and the mixture cooled to -15.degree. C. (ice and
NaCl). Mesyl Chloride (10.4 mL, 133 mmol) was added slowly via
syringe over a 30 minute period, and the reaction stirred at
-15.degree. C. for a further 1.5 hours. At this point TLC showed
that the starting material had been used up. The solution was
diluted with DCM (250 mL) and washed with saturated NaHCO.sub.3
(2.times.200 mL). The organic phase was then dried (MgSO.sub.4),
filtered, and concentrated (rotovap). The crude product was
purified by column chromatography. Yield: 21.5 g, 85.7%.
Step 3: Synthesis of DPanDMA
[0636] Sodium hydride (2.5 g, 100 mmol) was added to a 250 mL round
bottom flask, along with benzene (40 mL) and a stir bar. In a 50 mL
beaker, a solution was made from the
N,N-Dimethyl-3-aminopropane-1,2-diol (1.42 g, 12 mmol) and benzene
(60 mL). This was added to the reaction vessel and the reaction
stirred for 10 minutes (effervescence). Phytanyl Mesylate (10.52 g,
28 mmol) was added and the flask fitted with a condenser, flushed
with nitrogen, and heated to reflux. After 18 hours, the flask was
removed from the heat and allowed to cool. The volume was made up
to 200 mL with benzene. EtOH was added slowly to quench unreacted
sodium hydride. Once quenching was complete, the reaction mixture
was washed twice with EtOH/H.sub.2O, in a ratio to the benzene of
1:1:0.6 benzene:water:ethanol. The aqueous phases were combined and
extracted with CHCl.sub.3 (2.times.100 mL). Finally, the organic
phase was dried (MgSO.sub.4), filtered, and concentrated (rotovap).
Purifcation by column chromatography yielded DPanDMA as a pale
yellow oil (6.1 g, 8.97 mmol, 74.7%).
Example 6
Synthesis of Cationic Lipids of the TLinDMA Family
[0637] The following diagram provides a general scheme for
synthesizing members of the C(n)-TLinDMA family of cationic
lipids:
##STR00043##
[0638] TLinDMA
(1-(2,3-linoleyloxypropoxy)-2-(linoleyloxy)-(N,N-dimethyl)-propyl-3-amine-
) (Compound III) was synthesized as follows:
Synthesis of Compound I
[0639] A 1000 ml round bottom flask was charged with epibromohydrin
(5 g, 37 mmol), glycerol (10 g, 110 mmol), a stir bar and then
flushed with nitrogen. Anhydrous chloroform (350 mL) was added via
cannula, followed by BF.sub.3.Et.sub.2O (0.5 mL, 3.7 mmol) and
refluxed for 3 hours under nitrogen. The reaction mixture was
cooled and subsequently stirred at room temperature overnight. Upon
completion of the reaction, the reaction mixture was concentrated
and the crude product (15 g) was purified via column chromatography
using silica gel (150 g).
Synthesis of Compound II
[0640] A 500 mL round bottom flask was charged with Compound I (3.8
g, 17 mmol) and a stir bar. After flushing with nitrogen,
dimethylamine in a 2.0 M methyl alcohol solution (170 mL) was added
via cannula. The resulting mixture was stirred at room temperature
for 48 hours. The progress of the reaction was monitored using TLC.
The crude product was used without further purification.
Synthesis of TLinDMA (Compound III)
[0641] A 100 mL round bottom flask was charged with a stir bar, NaH
(0.6 g, 24 mmol), and 25 mL benzene. Subsequently, Compound II (0.4
g, 2 mmol) was added followed immediately by linoleyl methane
sulfonate (2.8 g, 8 mmol). The reaction was flushed with nitrogen
and refluxed overnight. Progress of the reaction was monitored via
TLC. The reaction mixture was transferred to a 250 mL separatory
funnel and diluted with benzene to a final volume of 50 mL. The
reaction was quenched with ethanol (30 mL) and then washed with
water (50 mL). The lower aqueous phase was run off and the reaction
mixture was washed again with ethanol (30 mL) and water (50 mL).
The organic phase was dried with MgSO.sub.4, filtered, and solvent
removed. The crude product (2.3 g) was purified via column
chromatography on silica gel (60 g) with 0-3% methanol gradient in
dichloromethane.
[0642] C2-TLinDMA (Compound VII) was synthesized as follows:
Synthesis of Compound IV
##STR00044##
[0644] A solution of 4-bromo-1-butene (11.5 g, 85 mmol) in
CH.sub.2Cl.sub.2 (anh., 120 ml) was prepared under nitrogen in a
1000 ml RBF with a magnetic stirrer. In a separate flask, a
solution of 3-chloroperbenzoic acid (77%, MW 173, 44.05 g, 196
mmol) in CH.sub.2Cl.sub.2 (anh., 250 ml) prepared and added to the
reaction mixture by canulla. The reaction was stirred for 3 days,
and then concentrated. The product (oil/white solid mixture) was
re-dissolved in THF (300 mL) and a solution of 4% sodium dithionite
(180 mL) added to remove excess peracid. The mixture (now cloudy)
was stirred for 20 minutes and then EtOAc (750 mL) added. The
mixture was transferred to a separating funnel and the organic was
washed with water (100 mL), sat. NaHCO.sub.3 (2.times.300 mL,
EFFERVESCENCE), water again (300 mL) and brine (300 mL). The
solution was concentrated and the product purified by
chromatography.
Synthesis of Compound V
##STR00045##
[0646] A 250 ml round bottom flask was charged with Compound IV
(1.3 g, 9 mmol), glycerol (2.5 g, 27 mmol), a stir bar and then
flushed with nitrogen. Anhydrous chloroform (100 mL) was added via
cannula, followed by BF.sub.3.Et.sub.2O (0.15 mL, 1.1 mmol) and
refluxed for 3 hours under nitrogen. The reaction mixture was
subsequently stirred at room temperature overnight.
Synthesis of Compound VI
##STR00046##
[0648] A 50 mL round bottom flask was charged with Compound V (0.3
g, 1.2 mmol) and a stir bar. After flushing with nitrogen,
dimethylamine in a 2.0 M methyl alcohol solution (25 mL) was added
via syringe. The resulting mixture was stirred at room temperature
for 48 hours. The progress of the reaction was monitored using
t.l.c. The reaction mixture was concentrated and the crude product
used without further purification.
Synthesis of C2-TLinDMA (Compound VII)
##STR00047##
[0650] A 100 mL round bottom flask was charged with a stir bar, NaH
(0.6 g, 24 mmol), and 25 mL benzene. Compound VI (0.37 g, 1.8 mmol)
was added followed immediately by linoleyl methane sulfonate (2.8
g, 8 mmol). The reaction was refluxed overnight and progress of the
reaction was monitored via t.l.c. The reaction mixture was
transferred to a 250 mL separatory funnel and diluted with benzene
to a final volume of 50 mL. The reaction was quenched with ethanol
(30 mL) and then washed with water (50 mL). The lower aqueous phase
was run off and the reaction mixture washed again with ethanol (30
mL) and water (50 mL). The organic phase was dried with MgSO.sub.4,
filtered, and solvent removed. The crude product, 2.5 g, was
purified using column chromatography on silica gel (60 g), eluted
with 0-3% methanol gradient in DCM.
[0651] C3-TLinDMA (Compound XI) was synthesized as follows:
Synthesis of Compound VIII
##STR00048##
[0653] A solution of 5-bromo-1-pentene (85 mmol) in
CH.sub.2Cl.sub.2 (anh., 120 ml) is prepared under nitrogen in a
1000 ml RBF with a magnetic stirrer. In a separate flask, a
solution of 3-chloroperbenzoic acid (77%, MW 173, 44.05 g, 196
mmol) in CH.sub.2Cl.sub.2 (anh., 250 ml) is prepared and added to
the reaction mixture by canulla. The reaction is stirred for 3
days, and then concentrated. The product (oil/white solid mixture)
is re-dissolved in THF (300 mL) and a solution of 4% sodium
dithionite (180 mL) added to remove excess peracid. The mixture
(now cloudy) is stirred for 20 minutes and then EtOAc (750 mL)
added. The mixture is transferred to a separating funnel and the
organic is washed with water (100 mL), sat. NaHCO.sub.3
(2.times.300 mL, EFFERVESCENCE), water again (300 mL) and brine
(300 mL). The solution is concentrated and the product purified by
chromatography.
Synthesis of Compound IX
##STR00049##
[0655] A 250 ml round bottom flask is charged with Compound VIII
(1.3 g, 9 mmol), glycerol (2.5 g, 27 mmol), a stir bar and then
flushed with nitrogen. Anhydrous chloroform (100 mL) is added via
cannula, followed by BF.sub.3.Et.sub.2O (0.15 mL, 1.1 mmol) and
refluxed for 3 hours under nitrogen. The reaction mixture is
subsequently stirred at room temperature overnight.
Synthesis of Compound X
##STR00050##
[0657] A 50 mL round bottom flask is charged with Compound IX (0.3
g, 1.2 mmol) and a stir bar. After flushing with nitrogen,
dimethylamine in a 2.0 M methyl alcohol solution (25 mL) is added
via syringe. The resulting mixture is stirred at room temperature
for 48 hours. The progress of the reaction is monitored using
t.l.c. The reaction mixture is concentrated and the crude product
used without further purification.
Synthesis of C3-TLinDMA (Compound XI)
##STR00051##
[0659] A 100 mL round bottom flask is charged with a stir bar, NaH
(0.6 g, 24 mmol), and 25 mL benzene. Compound X (0.37 g, 1.8 mmol)
is added followed immediately by linoleyl methane sulfonate (2.8 g,
8 mmol). The reaction is refluxed overnight and progress of the
reaction monitored via t.l.c. The reaction mixture is transferred
to a 250 mL separatory funnel and diluted with benzene to a final
volume of 50 mL. The reaction is quenched with ethanol (30 mL) and
then washed with water (50 mL). The lower aqueous phase is run off
and the reaction mixture washed again with ethanol (30 mL) and
water (50 mL). The organic phase is dried with MgSO.sub.4,
filtered, and solvent removed. The crude product, 2.5 g, is
purified using column chromatography on silica gel (60 g), eluted
with 0-3% methanol gradient in DCM.
Example 7
Synthesis of Novel C2 Lipids
[0660] Novel C2 lipids (Compounds V-VII) having the structures
shown below were synthesized as shown in the following schematic
diagram.
##STR00052##
Step 1: Synthesis of
4-(2-Methanesulfonylethyl)-2,2-dimethyl-1,3-dioxolane (Compound
I)
##STR00053##
[0662] 4-(2-Hydroxylethyl)-2,2-dimethyl-1,3-dioxolane (25 g, 170
mmol), triethylamine (55.9 mL, 400 mmol), and a stir bar were added
to a 1000 mL round bottom flask. The flask was sealed and flushed
with nitrogen. Anhydrous DCM (600 mL) was added, and the mixture
cooled to approx -5.degree. C. (ice and NaCl). Mesyl chloride (19.9
mL, 255 mmol, 1.5 eq) was added slowly via syringe over a 60 minute
period, and the reaction stirred at -5.degree. C. for a further 1.5
hours. At this point TLC showed that the starting material had been
consumed. The solution was diluted with DCM (350 mL), divided into
two (.about.500 mL) portions, and each portion worked up as
follows: the solution was transferred to a 1000-mL separating
funnel and washed with saturated NaHCO.sub.3 (2.times.200 mL). The
organic phase was then dried (MgSO.sub.4), filtered, and
concentrated (rotovap). The crude product was purified by column
chromatography. Final yield: 32.0 g, 84.1%.
Step 2: Synthesis of 4-(2-Bromoethyl)-2,2-dimethyl-1,3-dioxolane
(Compound II)
##STR00054##
[0664] Magnesium bromide etherate (40 g, 130 mmol) and a stir bar
were added to a 2000 mL round bottom flask and flushed with
nitrogen. A solution of
4-(2-methanesulfonylethyl)-2,2-dimethyl-1,3-dioxolane (I) (17.5 g,
78 mmol) in anhydrous diethyl ether (900 mL) was added via canulla,
and the suspension stirred overnight. The ether was first decanted
into a beaker. Water (200 mL) and ether (300 mL) were added to the
precipitate and stirred for 5 minutes. The precipitate was
dissolved, and the ether phase was then collected and added to the
ether solution from the reaction. The organic phase was then
washed, concentrated to about 500 mL, washed with water, dried over
anhydrous Mg.sub.2SO.sub.4, filtered, and concentrated to yield a
yellow oil (16.0 g). This was purified by flash chromatography to
yield 10.6 g of product (50.7 mmol, 65%).
Step 3: Synthesis of 4-Bromobutane-1,2-diol (Compound III)
##STR00055##
[0666] 4-(2-Bromoethyl)-2,2-dimethyl-1,3-dioxolane (II) (9 g, 43
mmol) was added to a 500 mL RBF with a stirbar. 100 mL of
MeOH:H.sub.2O:HCl in a ratio of (60:20:5) were added. After 30
minutes, sat. NaHCO.sub.3 (.about.75 mL) was added (effervescence),
until pH paper indicated solution was basic. At this point the
mixture was slightly cloudy. Ether (300 mL) was added (while
stirring) and the cloudiness disappeared. The reaction mixture was
transferred to a 1000 mL sep funnel and the 2 phases separated. The
extraction of the aqueous phase was repeated two more times
(2.times.300 mL ether). Organics were combined, dried over
MgSO.sub.4 and concentrated to yield a colorless oil (7.0 g), which
was purified by column chromatography.
Step 4: Synthesis of 4-(Dimethylamino)-1,2-butanediol (Compound
IV)
##STR00056##
[0668] 4-Bromobutane-1,2-diol (III) (1 g, 6.0 mmol) was added to a
50 mL RBF with a stir bar, sealed, and flushed with nitrogen. 30 mL
of Dimethylamine (2.0M solution in MeOH) was delivered by canulla
and the reaction stirred overnight. TLC indicated all the starting
material had disappeared. The solvent (and DMA) were removed by
evaporation and the crude product used without further
purification.
Synthesis of 1,2-Dilinoleyloxy-(N,N-dimethyl)-butyl-4-amine
(C2-DLinDMA) (Compound V)
##STR00057##
[0670] 4-(Dimethylamino)-1,2-butanediol (IV) (1.3 g, 3.4 mmol),
linoleyl mesylate (2.0 g, 5.8 mmol), tetrabutylammonium hydrogen
sulphate (0.5 g, 1.5 mmol), toluene (30 mL), and a stir bar were
added to a 100 mL RBF. 30 mL of 40% NaOH was made and added to the
reaction mixture. The resulting mixture was stirred at room
temperature, under nitrogen for 60 hours. Deionized water (50 mL)
and isopropyl acetate (50 mL) were added and the mixture stirred
vigorously for a further 10-15 min. The mixture was transferred to
a 250 mL separating funnel and allowed to separate and the aqueous
phase removed. The organic phase was washed twice with water
(2.times.30 mL) using MeOH to aid the separation, and the organic
phase was dried (MgSO.sub.4), filtered, and concentrated to obtain
a dark yellow oil. The oil was purified by column
chromatography.
Synthesis of 1,2-Diphytanyloxy-(N,N-dimethyl)-butyl-4-amine
(C2-DPanDMA) (Compound VI)
##STR00058##
[0672] Sodium hydride (360 mg, 15 mmol), benzene (40 mL), and a
stir bar were added to a 50 mL round bottom flask.
4-(Dimethylamino)-1,2-butanediol (IV) (200 mg, 1.5 mmol) was added
and the reaction stirred for 10 minutes (effervescence). Phytanyl
Mesylate (1.07 g, 2.92 mmol) was then added and the flask fitted
with a condenser, flushed with nitrogen, and heated to reflux.
After 18 hours, the flask was allowed to cool to room temperature.
The volume was made up to 40 mL with benzene. EtOH was added slowly
to quench unreacted sodium hydride. Once quenching was complete,
the reaction mixture was washed twice with an EtOH/H.sub.2O, in a
ratio to the benzene of 1:1:0.6 benzene:water:ethanol. The aqueous
washes were combined and extracted with CHCl.sub.3 (2.times.20 mL).
Finally, the organics were combined, dried (MgSO.sub.4), filtered,
and concentrated (rotovap). Purification by column chromatography
yielded a pale yellow oil (250 mg, 0.145 mmol, 25%).
Synthesis of 1,2-Dilinoleoyloxy-(N,N-dimethyl)-butyl-4-amine
(C2-DLinDAP) (Compound VII)
##STR00059##
[0674] A flask containing 4-(Dimethylamino)-1,2-butanediol (IV)
(crude, 266 mg, 2 mmol (max)), TEA (0.84 mL, 6 mmol), and DMAP (24
mg, 0.2 mmol) was flushed with nitrogen before the addition of
anhydrous CH.sub.2Cl.sub.2 (50 ml). Linoleoyl chloride (1.2 g, 4
mmol) was added and the solution stirred overnight. The solution
was rinsed into a 250 mL separatory funnel with DCM (.about.70 mL)
and washed with water (2.times.50 mL). The organic was dried
(MgSO.sub.4), concentrated, and purified by chromatography.
Example 8
Synthesis of Novel Phytanyl Cationic Lipids
[0675] DPan-C2K-DMA, DPan-C1K6-DMA, and DPan-C3K-DMA having the
structures shown below were synthesized as shown in the following
schematic diagram.
Synthesis of Phytanol
##STR00060##
[0677] Phytol (21.0 g, 70.8 mmol), ethanol (180 mL) and a stir bar
were added to a 500 mL round bottom flask. Raney Nickel 2800 (as
purchased, a 50% by weight solution in water if used as purchased,
Nickel>89% metal present) (6.8 g, 51.5 mmol) was added, and the
flask sealed and flushed with hydrogen. A 12'' needle was used to
bubble hydrogen through the solution for 10 minutes. The reaction
was stirred for 5 days, using a balloon as a hydrogen reservoir.
Hydrogen was also bubbled through the reaction mixture at 24 h and
48 h, 5 minutes each time. The metal catalyst was then removed by
filtering through Celite. The ethanolic solution was concentrated,
and 200 mL of DCM added to the resulting oil. The solution was
washed with water (2.times.100 mL), dried over MgSO.sub.4, and
concentrated. TLC indicated formation of the phytanol product,
yield 20.0 g.
Synthesis of Phytanyl Mesylate
##STR00061##
[0679] Phytanol (20.0 g, 66.7 mmol), triethylamine (18.6 mL, 133
mmol) and a stir bar were added to a 1000 mL round bottom flask.
The flask was sealed and flushed with nitrogen. Anhydrous DCM (250
mL) was added, and the mixture cooled to -15.degree. C. (Ice and
NaCl). Mesyl Chloride (10.4 mL, 133 mmol) was added slowly via
syringe over a 30 minute period, and the reaction stirred at
-15.degree. C. for a further 1.5 hours. At this point TLC showed
that the starting material had been used up. The solution was
diluted with DCM (250 mL) and washed with saturated NaHCO.sub.3
(2.times.200 mL). The organic phase was then dried (MgSO.sub.4),
filtered and concentrated (rotovap). The crude product was purified
by column chromatography. Yield 21.5 g, 85.7%.
Synthesis of Phytanyl Bromide
##STR00062##
[0681] Magnesium bromide etherate (17 g, 55 mmol) and a stir bar
were added to a 500 mL round bottom flask. The flask was sealed and
flushed with nitrogen and anhydrous diethyl ether (200 mL) added
via cannula. A solution of phytanyl mesylate (10.9 g, 28.9 mmol
(FW=377)) in anhydrous ether (50 mL) was also added via canulla,
and the suspension stirred overnight. The following morning a
precipitate had formed on the side of the flask. Chilled water (200
mL) was added (ppte dissolved) and the mixture transferred to a
1000-mL separating funnel. After shaking, the organic phase was
separated. The aqueous phase was then extracted with ether
(2.times.150 mL) and all ether phases combined. The ether phase was
washed with water (2.times.150 mL), brine (150 mL) and dried over
anhydrous Mg.sub.2SO.sub.4. The solution was filtered,
concentrated, and purified by flash chromatography. Final yield 9.5
g (26.3 mmol, 91.1%).
Synthesis of Compound A
##STR00063##
[0683] Magnesium turnings (720 mg, 30 mmol), a crystal of iodine,
and a stirbar were added to a 500 mL round-bottom flask. The flask
was flushed with nitrogen and anhydrous diethyl ether (200 mL)
added via cannula. A solution of phytanyl bromide (9.5 g, 26.3
mmol) in anhydrous ether (20 mL) was added and the resulting cloudy
mixture refluxed overnight. The mixture was cooled to RT and,
without removing the subaseal or condenser, ethyl formate (2.2 g,
2.41 mL, 30 mmol) added via syringe and 12'' needle. The addition
was made dropwise, directly into the reaction mixture, and the
cloudy suspension again stirred overnight. R.M. was transferred to
a 500-mL sep. funnel with ether (50 mL), and washed with 10%
H.sub.2SO.sub.4 (100 mL--the cloudy R.M. now clarified upon
shaking), water (2.times.100 mL) and brine. The organic was dried
over anhydrous Mg.sub.2SO.sub.4, filtered, and concentrated. Yield
(crude) was 8 g. TLC indicated that the majority of product was the
diphytanylmethyl formate, which was purified by chromatography
(0-6% ether in hexane).
Synthesis of Compound B
##STR00064##
[0685] The purified formate (A) (5.5 g, 8.86 mmol) was then
transferred to a 1000 mL round bottom flask with stirbar and 90%
EtOH (500 mL) and KOH (2.0 g, 35.7 mmol) added. The reaction
mixture was clear, and was stirred overnight. The following day the
mixture was concentrated by rotovap to 50% of its volume and then
poured into 200 mL of 5% HCl. The aqueous phase was extracted with
ether (3.times.100 mL). The combined ether extracts were washed
with water (3.times.200 mL), dried (MgSO.sub.4), and concentrated.
TLC (DCM) revealed reaction to have gone cleanly to completion, and
the product (5.5 g, 100%) was used without further
purification.
Synthesis of Compound C
##STR00065##
[0687] To a mixture of Compound B (5.5 g, 9.3 mmol), pyridinium
chlorochromate (PCC) (5.5 g, 25.5 mmol) and anhydrous sodium
carbonate (0.6 g, 5.66 mmol) in DCM were added. The resulting
suspension was stirred for 1 h, but TLC indicated still some
starting material (SM) remaining. The suspension was stirred
another hour, and appeared to have progressed slightly, but not to
completion. Further PCC (1.0 g) and sodium carbonate (0.2 g) were
added and the reaction stirred overnight. Reaction had now gone to
completion. Ether (300 mL) was then added to the mixture and the
resulting brown suspension filtered through a pad of silica (300
mL), washing the pad with ether (3.times.100 mL). The ether phases
were combined, concentrated, and purified to yield 5.0 g (90%) of
ketone.
Synthesis of Compound D
##STR00066##
[0689] A 100 mL round bottom flask was charged with Compound C (1.4
g, 2.4 mmol), 1, 2, 4-butanetriol (0.51 g, 4.8 mmol), pyridinium
p-toluenesulfonate (0.06 g, 0.24 mmol), and a stir bar. The
reaction vessel was flushed with nitrogen and anhydrous toluene (30
mL) added via cannula. The flask was equipped with a Dean-Stark
tube and condenser and flushed with nitrogen. The reaction was
refluxed under nitrogen overnight and progress of the reaction
monitored via TLC. After refluxing for three hours, reaction
solution deposited in the Dean-Stark tube was removed via syringe
(20 mL) and the reaction vessel immediately replenished with fresh
toluene (20 mL). This was repeated every hour, for a total of three
times, and then left to reflux mildly overnight. After cooling to
room temperature, the reaction mixture was transferred to a 250 mL
separatory funnel with toluene (2.times.5 mL), washed with 5%
aqueous Na.sub.2CO.sub.3 (2.times.50 mL), water (50 mL), and dried
over MgSO.sub.4. Evaporation of the solvent gave 1.67 g of crude
product which was purified via column chromatography on silica gel
(50 g) using dichloromethane as eluent. Yield: 1.4 g, 2.06 mmol,
86%.
Synthesis of Compound E
##STR00067##
[0691] A 100 mL round bottom flask was charged with Compound D (1.4
g, 2.06 mmol) and a stir bar. The vessel was flushed with nitrogen
and DCM (25 mL) added. Subsequently, triethylamine (0.72 g, 7.1
mmol, 0.99 mL) was added via syringe and the resulting solution
cooled to -15.degree. C. (NaCl, ice). In a separate 50 mL round
bottom flask, a solution of methanesulfonic anhydride (0.74 g, 4.1
mmol) and DCM (20 mL) was prepared. This solution was added drop
wise to the above solution over a 30 minute period. The reaction
vessel was maintained at -15.degree. C. The reaction mixture was
stirred at room temperature overnight and monitored via TLC. The
reaction mixture was then diluted with DCM (25 mL), and washed with
NaHCO.sub.3 (2.times.30 mL), then dried over anhydrous MgSO.sub.4.
The crude product (1.7 g) was used in the next step without further
purification.
Synthesis of DPan-C2K-DMA
##STR00068##
[0693] A 500 mL round bottom flask was charged with crude Compound
E (1.7 g, 2.5 mmol) and a stir bar. The reaction vessel was flushed
with nitrogen and dimethylamine in THF (2.0 M, 65 mL) subsequently
added via syringe. The resulting mixture was stirred for three days
at room temperature. The reaction was concentrated and the crude
product purified by column chromatography using silica gel (40 g)
with a gradient of 0-5% methanol in dichloromethane.
Synthesis of Compound F
##STR00069##
[0695] A 100 mL round bottom flask was charged with Compound C (1.2
g, 2.1 mmol), 2-hydroxymethyl-1, 3-propanediol (0.45 g, 4.2 mmol),
pyridinium p-toluenesulfonate (0.05 g, 0.21 mmol), and a stir bar.
The reaction vessel was flushed with nitrogen and anhydrous toluene
(45 mL) subsequently added via cannula. The flask was equipped with
a Dean-Stark tube and condenser and flushed with nitrogen. The
reaction was refluxed under nitrogen overnight and progress of the
reaction monitored via TLC. After refluxing for three hours,
reaction solution deposited in the Dean-Stark tube was removed via
syringe (20 mL) and the reaction vessel immediately replenished
with fresh toluene (20 mL). This was repeated every hour, for a
total of three times, and then left to reflux mildly overnight.
After cooling to room temperature, the reaction mixture was
transferred to a 250 mL separatory funnel with toluene (2.times.5
mL), washed with 5% aqueous Na.sub.2CO.sub.3 (2.times.50 mL), water
(50 mL), and dried over MgSO.sub.4. Evaporation of the solvent gave
1.44 g of crude product which was then purified via column
chromatography on silica gel (35 g) with 0-3% methanol gradient in
dichloromethane.
Synthesis of Compound G
##STR00070##
[0697] A 250 mL round bottom flask was charged with Compound F (1.2
g, 1.8 mmol) and a stir bar. The vessel was flushed with nitrogen
and DCM (25 mL) added. Subsequently, triethylamine (0.62 g, 6.1
mmol, 0.85 mL) was added via syringe and the resulting solution
cooled to -15.degree. C. (NaCl, ice). In a separate 50 mL round
bottom flask, a solution of methanesulfonic anhydride (0.67 g, 3.7
mmol) and DCM (20 mL) was prepared. This solution was added drop
wise to the above solution over a 30 minute period. The reaction
vessel was maintained at -15.degree. C. during the addition. The
reaction mixture was stirred at room temperature overnight and
monitored via TLC. The reaction mixture was then diluted with DCM
(25 mL) and washed with NaHCO.sub.3 (2.times.30 mL), then dried
over anhydrous MgSO.sub.4. The crude product (1.6 g) was used in
the following step without further purification.
Synthesis of DPan-C1K6-DMA
##STR00071##
[0699] A 250 mL round bottom flask was charged with crude Compound
G (1.6 g, 2.1 mmol) and a stir bar. The reaction vessel was flushed
with nitrogen and dimethylamine in THF (2.0 M, 60 mL) subsequently
added via syringe. The resulting mixture was stirred for six days
at room temperature. After solvent was evaporated, the crude
product was purified using column chromatography on silica gel (30
g) with 0-30% ethyl acetate gradient in hexanes.
Synthesis of Compound H
##STR00072##
[0701] A 50 mL round bottom flask was charged with
(R)-.gamma.-hydroxymethyl-.gamma.-butyrolactone (1.0 g, 8.6 mmol),
flushed with nitrogen, and sealed with a rubber septum. Anhydrous
THF (40 mL) was subsequently added via syringe. The
(R)-.gamma.-hydroxymethyl-.gamma.-butyrolactone solution was then
added drop wise under nitrogen to a prepared solution containing
LiAlH.sub.4 (3.5 g, 92 mmol) in 160 mL anhydrous THF. During the
addition, the reaction vessel was maintained at 0.degree. C. The
resulting suspension was stirred at room temperature overnight. The
reaction mixture was cooled to 0.degree. C. and brine (10-22 mL)
added very slowly using a Pasteur pipette. The mixture was stirred
under nitrogen at room temperature overnight. The white solid was
filtered and washed with THF (3.times.25 mL). The organics were
combined and concentrated. After solvent was removed, the crude
product seemed to contain water along with an oily residue;
therefore, the crude product was azeotroped within ethanol (100 mL)
resulting in a yellow oil. The crude product (0.45 g) was used in
the next step without further purification.
Synthesis of Compound I
##STR00073##
[0703] A 100 mL round bottom flask was charged with Compound C (1.0
g, 1.8 mmol), Compound H (crude, 0.450 g, 3.6 mmol), pyridinium
p-toluenesulfonate (0.05 g, 0.24 mmol), and a stir bar. The
reaction vessel was flushed with nitrogen and anhydrous toluene (45
mL) subsequently added via cannula. The flask was equipped with a
Dean-Stark tube and condenser and flushed with nitrogen. The
reaction was refluxed under nitrogen overnight and progress of
reaction monitored via TLC. After refluxing for three hours,
reaction solution deposited in the Dean-Stark tube was removed via
syringe (20 mL) and the reaction vessel immediately replenished
with fresh toluene (20 mL). This was repeated every hour, for a
total of five times, and then left to reflux mildly overnight.
After cooling to room temperature, the reaction mixture was
transferred to a 250 mL separatory funnel with toluene (2.times.5
mL), washed with 5% aqueous Na.sub.2CO.sub.3 (2.times.50 mL), water
(50 mL), and dried over MgSO.sub.4. Evaporation of the solvent gave
1.13 g of crude product which was then purified via column
chromatography on silica gel (30 g) using dichloromethane as
eluent. Yield, 1.0 g.
Synthesis of Compound J
##STR00074##
[0705] A 250 mL round bottom flask was charged with Compound I (1.0
g, 1.44 mmol) and a stir bar. The vessel was flushed with nitrogen
and DCM (25 mL) added. Subsequently, triethylamine (0.51 g, 5 mmol,
and 0.7 mL) was added via syringe and the resulting solution cooled
to -15.degree. C. (NaCl, ice). In a separate 50 mL round bottom
flask, a solution of methanesulfonic anhydride (0.54 g, 3.0 mmol)
and anhydrous DCM (20 mL) was prepared. This solution was added
drop wise to the above solution over a 30 minute period. The
reaction vessel was maintained at -15.degree. C. The reaction
mixture was stirred at room temperature overnight and monitored via
TLC. The reaction mixture was then diluted with DCM (25 mL) and
washed with NaHCO.sub.3 (2.times.30 mL), then dried over anhydrous
MgSO.sub.4. The crude product (1.2 g) was used in the next step
without further purification.
Synthesis of DPan-C3K-DMA
##STR00075##
[0707] A 100 mL round bottom flask was charged with crude Compound
J (1.2 g, 1.6 mmol) and a stir bar. The reaction vessel was flushed
with nitrogen and dimethylamine in THF (2.0 M, 45 mL) subsequently
added via syringe. The resulting mixture was stirred for four days
at room temperature. After solvent was evaporated, the crude
product was purified using column chromatography on silica gel (30
g) with 0-30% ethyl acetate gradient in hexanes.
Example 9
Synthesis of DLen-C2K-DMA
[0708] DLen-C2K-DMA having the structure shown below was
synthesized as shown in the following schematic diagram.
##STR00076##
Synthesis of Dilinolenyl Ketone
##STR00077##
[0710] To a 1000 mL RBF containing a solution of dilinolenyl
methanol (6.0 g, 11.4 mmol) in anh. DCM (200 mL) was added
pyridinium chlorochromate (7.39 g, 34.2 mmol), anh. sodium
carbonate (1.0 g, 5.66 mmol) and a stirbar. The resulting
suspension was stirred under nitrogen at RT for 3 h, after which
time TLC indicated all SM to have been consumed. Ether (300 mL) was
then added to the mixture and the resulting brown suspension
filtered through a pad of silica (300 mL), washing the pad with
ether (3.times.100 mL). The ether phases were combined,
concentrated and purified to yield 4.2 g (8.0 mmol, 70%) of the
ketone.
Synthesis of Linolenyl Ketal
##STR00078##
[0712] A 100 mL RBF was charged with dilinolenyl ketone (4.2 g, 8.2
mmol), 1,2,4-butanetriol (3.4 g, 32 mmol), PPTS (200 mg, 0.8 mmol)
and a stir bar. The flask was flushed with nitrogen and anhydrous
toluene (60 mL) added. The reaction vessel was fitted with a Dean
Stark tube and condenser and brought to reflux and the reaction was
left overnight. After cooling to room temperature, the reaction
mixture diluted with toluene (50 mL), and washed with 5% aq.
Na.sub.2CO.sub.3 (2.times.50 mL), water (50 mL), dried (MgSO.sub.4)
and purified by chromatography to yield 3.0 g (4.9 mmol, 59%) of
the ketal.
Mesylate Formation:
##STR00079##
[0714] A 250 mL RBF was charged with the linolenyl ketal (3.0 g,
4.9 mmol), TEA (2.2 mL, 15.6 mmol) and a stir bar. The flask was
flushed with nitrogen, anh. DCM (20 mL) added, and the solution
cooled to -15.degree. C. In a separate 50 mL flask, a solution of
MsCl (9.7 mmol, 2 eqv.) in anhydrous DCM (30 mL) was prepared, then
transferred to the reaction vessel by syringe over 20 minutes. The
reaction was stirred for 90 minutes at -15.degree. C., at which
point starting material had been consumed. The reaction mixture was
diluted with a further 50 mL of DCM, washed with NaHCO.sub.3
(2.times.50 mL), dried (MgSO.sub.4) and purified by chromatography.
Final yield 3.1 g, 4.5 mmol, 92%.
Synthesis of DLen-C2K-DMA
##STR00080##
[0716] A 250 mL RBF was charged with the mesylate (3.0 g, 4.35
mmol), isopropanol (25 mL) and a stir bar. The flask was flushed
with nitrogen, sealed, and a 2.0 M solution of dimethylamine in
methanol (120 mL) added via canulla. The reaction was stirred at
room temperature for 3 days. The solution was concentrated and
purified by chromatography. Final yield 2.49 g, 3.9 mmol, 90%.
Example 10
Synthesis of .gamma.-DLen-C2K-DMA
[0717] .gamma.-DLen-C2K-DMA having the structure shown below was
synthesized as shown in the following schematic diagram.
##STR00081##
Synthesis of Di-.gamma.-Linolenyl Ketone
##STR00082##
[0719] To a 1000 mL RBF containing a solution of
di-.gamma.-linolenyl methanol (6.0 g, 11.4 mmol) in anh. DCM (200
mL) was added pyridinium chlorochromate (7.39 g, 34.2 mmol), anh.
sodium carbonate (1.0 g, 5.66 mmol) and a stirbar. The resulting
suspension was stirred under nitrogen at RT for 3 h, after which
time TLC indicated all SM to have been consumed. Ether (300 mL) was
then added to the mixture and the resulting brown suspension
filtered through a pad of silica (300 mL), washing the pad with
ether (3.times.100 mL). The ether phases were combined,
concentrated and purified to yield 5.5 g (10.5 mmol, 92%) of
ketone.
Synthesis of .gamma.-Linolenyl Ketal
##STR00083##
[0721] A 100 mL RBF was charged with di-.gamma.-linolenyl ketone
(2.14 g, 4.1 mmol), 1,2,4-butanetriol (1.7 g, 16.0 mmol), PPTS (100
mg, 0.4 mmol) and a stir bar. The flask was flushed with nitrogen
and anhydrous toluene (30 mL) added. The reaction vessel was fitted
with a Dean Stark tube and condenser and brought to reflux and the
reaction was left overnight. After cooling to room temperature, the
reaction mixture was washed with 5% aq. Na.sub.2CO.sub.3
(2.times.50 mL), water (50 mL), dried (MgSO.sub.4) and purified by
chromatography to yield 1.34 g (2.2 mmol, 53%) of the ketal.
Mesylate Formation:
##STR00084##
[0723] A 250 mL RBF was charged with the .gamma.-linolenyl ketal
(1.34 g, 2.19 mmol), TEA (1 mL, 7.1 mmol) and a stir bar. The flask
was flushed with nitrogen, anh. DCM (10 mL) added, and the solution
cooled to -15.degree. C. In a separate 50 mL flask, a solution of
MsCl (342 .mu.L, 4.4 mmol, 2 eqv.) in anhydrous DCM (15 mL) was
prepared, then transferred to the reaction vessel by syringe over
20 minutes. The reaction was stirred for 90 minutes at -15.degree.
C., at which point starting material had been consumed. The
reaction mixture was diluted with a further 50 mL of DCM, washed
with NaHCO.sub.3 (2.times.50 mL), dried (MgSO.sub.4) and purified
by chromatography. Final yield 1.31 g, 1.90 mmol, 87%.
Synthesis of .gamma.-DLen-C2K-DMA
##STR00085##
[0725] A 250 mL RBF was charged with the mesylate (1.31 g, 1.9
mmol), isopropanol (10 mL) and a stir bar. The flask was flushed
with nitrogen, sealed, and a 2.0 M solution of dimethylamine in
methanol (60 mL) added via canulla. The reaction was stirred at
room temperature for 3 days. The solution was concentrated and
purified by chromatography. Final yield 1.1 g, 1.72 mmol, 91%.
[0726] It is to be understood that the above description is
intended to be illustrative and not restrictive. Many embodiments
will be apparent to those of skill in the art upon reading the
above description. The scope of the invention should, therefore, be
determined not with reference to the above description, but should
instead be determined with reference to the appended claims, along
with the full scope of equivalents to which such claims are
entitled. The disclosures of all articles and references, including
patent applications, patents, PCT publications, and Genbank
Accession Nos., are incorporated herein by reference for all
purposes.
Sequence CWU 1
1
86121DNAArtificial Sequencesynthetic first interfering RNA (siRNA)
sense strand S-1 for Ebola virus polymerase L (L-pol) 1gnacgaagcu
nuauanaaat t 21221DNAArtificial Sequencesynthetic first interfering
RNA (siRNA) sense strand S-2 for Ebola virus polymerase L (L-pol)
2gnacnaagcn nnananaaat t 21321DNAArtificial Sequencesynthetic first
interfering RNA (siRNA) sense strand S-3 for Ebola virus polymerase
L (L-pol) 3gnacgaagcu nuananaaat t 21421DNAArtificial
Sequencesynthetic first interfering RNA (siRNA) antisense strand
AS-1 for Ebola virus polymerase L (L-pol) 4uuuanauaca gcuucgnact t
21521DNAArtificial Sequencesynthetic first interfering RNA (siRNA)
antisense strand AS-2 for Ebola virus polymerase L (L-pol)
5uuuanauaca gcuncgnact t 21621DNAArtificial Sequencesynthetic first
interfering RNA (siRNA) antisense strand AS-3 for Ebola virus
polymerase L (L-pol) 6uuuanauaca gcnucgnact t 21721DNAArtificial
Sequencesynthetic first interfering RNA (siRNA) antisense strand
AS-4 for Ebola virus polymerase L (L-pol) 7uuuanauaca ncuucgnact t
21821DNAArtificial Sequencesynthetic first interfering RNA (siRNA)
antisense strand AS-5 for Ebola virus polymerase L (L-pol)
8unuanauaca gcnucgnact t 21921DNAArtificial Sequencesynthetic first
interfering RNA (siRNA) antisense strand AS-6 for Ebola virus
polymerase L (L-pol) 9uunanauaca gcuucgnact t 211021RNAArtificial
Sequencesynthetic second interfering RNA (siRNA) sense strand for
Ebola virus virion protein 24 (VP24) 10uccncgacac gaangcaaag u
211121RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) sense strand for Ebola virus virion protein 24 (VP24)
11uccncgacac gaangcaaan u 211221RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) sense strand for Ebola virus virion
protein 24 (VP24) 12uccncgacac gaangcaaag n 211321RNAArtificial
Sequencesynthetic second interfering RNA (siRNA) sense strand for
Ebola virus virion protein 24 (VP24) 13uccncgacac gaangcaaan n
211421RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) sense strand for Ebola virus virion protein 24 (VP24)
14nccncgacac gaangcaaag u 211521RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) sense strand for Ebola virus virion
protein 24 (VP24) 15nccncgacac gaangcaaan u 211621RNAArtificial
Sequencesynthetic second interfering RNA (siRNA) sense strand for
Ebola virus virion protein 24 (VP24) 16nccncgacac gaangcaaag n
211721RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) antisense strand for Ebola virus virion protein 24 (VP24)
17uungcauucg ugucnagnau c 211821RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 24 (VP24) 18uungcauucg ugucnagnan c
211921RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) antisense strand for Ebola virus virion protein 24 (VP24)
19unugcauncg ugncgaggau c 212021RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 24 (VP24) 20unugcauncg ugncgaggan c
212121RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) antisense strand for Ebola virus virion protein 24 (VP24)
21nungcauucg ugncgaggau c 212221RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 24 (VP24) 22nungcauucg ugncgaggan c
212321RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) antisense strand for Ebola virus virion protein 24 (VP24)
23unugcanucg ngucgaggau c 212421RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 24 (VP24) 24unugcanucg ngucgaggan c
212521RNAArtificial Sequencesynthetic third interfering RNA (siRNA)
sense strand for Ebola virus virion protein 35 (VP35) 25gcaacncauu
gnacancauu c 212621RNAArtificial Sequencesynthetic third
interfering RNA (siRNA) sense strand for Ebola virus virion protein
35 (VP35) 26ncaacncaun gnacancann c 212721RNAArtificial
Sequencesynthetic third interfering RNA (siRNA) sense strand for
Ebola virus virion protein 35 (VP35) 27gcaacncaun gnacancaun c
212821RNAArtificial Sequencesynthetic third interfering RNA (siRNA)
antisense strand for Ebola virus virion protein 35 (VP35)
28augaunucca auganungcu a 212921RNAArtificial Sequencesynthetic
third interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 35 (VP35) 29augaunucca auganungcn a
213021RNAArtificial Sequencesynthetic third interfering RNA (siRNA)
antisense strand for Ebola virus virion protein 35 (VP35)
30angaunucca auganungcn a 213121RNAArtificial Sequencesynthetic
third interfering RNA (siRNA) antisense strand for Ebola virus
virion protein 35 (VP35) 31augaunucca anganungcn a
213221RNAArtificial Sequencesynthetic third interfering RNA (siRNA)
antisense strand for Ebola virus virion protein 35 (VP35)
32angaunucca anganungcn a 213321RNAArtificial Sequencesynthetic
siRNA target or sense strand for Ebola virus virion protein 24
(VP24-775) 33gcugauugac cagucuuuga u 213421RNAArtificial
Sequencesynthetic siRNA antisense strand for Ebola virus virion
protein 24 (VP24-775) 34caaagacugg ucaaucagcu g 213521RNAArtificial
Sequencesynthetic siRNA target or sense strand for Ebola virus
virion protein 24 (VP24-978) 35acggauuguu gagcaguauu g
213621RNAArtificial Sequencesynthetic siRNA antisense strand for
Ebola virus virion protein 24 (VP24-978) 36auacugcuca acaauccguu g
213721RNAArtificial Sequencesynthetic siRNA target or sense strand
for Ebola virus virion protein 24 (VP24-1160) 37uccucgacac
gaaugcaaag u 213821RNAArtificial Sequencesynthetic siRNA antisense
strand for Ebola virus virion protein 24 (VP24-1160) 38uuugcauucg
ugucgaggau c 213921RNAArtificial Sequencesynthetic siRNA target or
sense strand for Ebola virus virion protein 24 (VP24-1160-mod)
39uccncgacac gaangcaaag u 214021RNAArtificial Sequencesynthetic
siRNA antisense strand for Ebola virus virion protein 24
(VP24-1160-mod) 40uungcauucg ugucnagnau c 214121RNAArtificial
Sequencesynthetic siRNA target or sense strand for Renilla firefly
luciferase (Luc) 41gauuaugucc gguuauguaa a 214221RNAArtificial
Sequencesynthetic siRNA antisense strand for Renilla firefly
luciferase (Luc) 42uacauaaccg gacauaauca u 214321RNAArtificial
Sequencesynthetic siRNA target or sense strand for Ebola virus
virion protein 35 (VP35-219) 43gcgacaucuu cugugauauu g
214421RNAArtificial Sequencesynthetic siRNA antisense strand for
Ebola virus virion protein 35 (VP35-219) 44auaucacaga agaugucgcu u
214521DNAArtificial Sequencesynthetic siRNA target or sense strand
for Ebola virus virion protein 35 (VP35-349) 45ggagguagua
caaacauugt t 214621DNAArtificial Sequencesynthetic siRNA antisense
strand for Ebola virus virion protein 35 (VP35-349) 46caauguuugu
acuaccucct t 214721RNAArtificial Sequencesynthetic siRNA target or
sense strand for Ebola virus virion protein 35 (VP35-687)
47gggaggcauu caacaaucua g 214821RNAArtificial Sequencesynthetic
siRNA antisense strand for Ebola virus virion protein 35 (VP35-687)
48agauuguuga augccucccu a 214921RNAArtificial Sequencesynthetic
siRNA target or sense strand for Ebola virus virion protein 35
(VP35-855) 49gcaacucauu ggacaucauu c 215021RNAArtificial
Sequencesynthetic siRNA antisense strand for Ebola virus virion
protein 35 (VP35-855) 50augaugucca augaguugcu a 215121RNAArtificial
Sequencesynthetic siRNA target or sense strand for Renilla firefly
luciferase (Luc-mod) 51gannangncc ggnnangnaa a 215221RNAArtificial
Sequencesynthetic siRNA antisense strand for Renilla firefly
luciferase (Luc-mod) 52uacanaaccg gacanaanca u 215321RNAArtificial
Sequencesynthetic siRNA target or sense strand for Ebola virus
polymerase L (L-pol) EK-1 53guacgaagcu guauauaaau u
215421RNAArtificial Sequencesynthetic siRNA antisense strand for
Ebola virus polymerase L (L-pol) EK-1 54uuuauauaca gcuucguaca a
215521RNAArtificial Sequencesynthetic siRNA target or sense strand
for Ebola virus polymerase L (L-pol) EK-1-mod 55gnacgaagcu
nuauanaaau u 215621RNAArtificial Sequencesynthetic siRNA antisense
strand for Ebola virus polymerase L (L-pol) EK-1-mod 56uuuanauaca
gcuucgnaca a 215721RNAArtificial Sequencesynthetic siRNA target or
sense strand for Ebola virus virion protein 35 (VP35-855-mod)
57gcaacncauu gnacancauu c 215821RNAArtificial Sequencesynthetic
siRNA antisense strand for Ebola virus virion protein 35
(VP35-855-mod) 58augaunucca auganungcu a 215919RNAArtificial
Sequencesynthetic siRNA antisense strand for Ebola virus polymerase
L (L-pol) 59uuuauauaca gcuucguac 196019RNAArtificial
Sequencesynthetic siRNA antisense strand for Ebola virus virion
protein 24 (VP24) 60uuugcauucg ugucgagga 196119RNAArtificial
Sequencesynthetic siRNA antisense strand for Ebola virus virion
protein 35 (VP35) 61augaugucca augaguugc 196219RNAArtificial
Sequencesynthetic first interfering RNA (siRNA) sense strand for
Ebola virus polymerase L (L-pol) 62guacgaagcu guauauaaa
196319RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) modified sense strand for Ebola virus virion protein 24
(VP24) 63nccncnacac naanncaaa 196419RNAArtificial Sequencesynthetic
second interfering RNA (siRNA) modified antisense strand for Ebola
virus virion protein 24 (VP24) 64nnnncanncn nnncnanna
196519RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) antisense strand for Ebola virus virion protein 24 (VP24)
65uungcauucg ugucnagna 196619RNAArtificial Sequencesynthetic second
interfering RNA (siRNA) antisense strand for Ebola virus virion
protein 24 (VP24) 66uuugcauucg ugucgagga 196721RNAArtificial
Sequencesynthetic second interfering RNA (siRNA) sense strand for
Ebola virus virion protein 24 (VP24) 67uccucgacac gaaugcaaag u
216821RNAArtificial Sequencesynthetic second interfering RNA
(siRNA) sense strand for Ebola virus virion protein 24 (VP24-1160
mod) 68uccncgacac gaangcaaag u 216919RNAArtificial
Sequencesynthetic third interfering RNA (siRNA) sense strand for
Ebola virus virion protein 35 (VP35) 69gcaacucauu ggacaucau
197019RNAArtificial Sequencesynthetic third interfering RNA (siRNA)
antisense strand for Ebola virus virion protein 35 (VP35)
70augaugucca augaguugc 197119RNAArtificial Sequencesynthetic third
interfering RNA (siRNA) sense strand for Ebola virus virion protein
35 (VP35) 71gcaacucauu ggacaucau 197219DNAArtificial
Sequencesynthetic quantitative real-time PCR (RT-PCR) forward
primer for Zaire species of Ebola virus (ZEBOV) glycoprotein gene
72cggacctggt ttggttgtg 197319DNAArtificial Sequencesynthetic
quantitative real-time PCR (RT-PCR) reverse primer for Zaire
species of Ebola virus (ZEBOV) glycoprotein gene 73gctgcagtgt
cgcatctga 197415DNAArtificial Sequencesynthetic quantitative
real-time PCR (RT-PCR) TaqMan probe for Zaire species of Ebola
virus (ZEBOV) glycoprotein gene 74cccttgccac aatct
157544RNAArtificial Sequencesynthetic GeneRacer RNA oligo adaptor
75cgacuggagc acgaggacac ugacauggac ugaaggagua gaaa
447623DNAArtificial Sequencesynthetic Ebola virus polymerase L
(L-pol) gene-specific primer EK-1 GSP 76tttgtgattc gtccttttgc agt
237725DNAArtificial Sequencesynthetic Ebola virus virion protein 24
(VP24) gene-specific primer VP24-1160 GSP 77agcaattcta tgatgttgtc
ttgga 257824DNAArtificial Sequencesynthetic Ebola virus virion
protein 35 (VP35) gene-specific primer VP35-855 GSP 78catcactttt
ggtttgggtt actt 247923DNAArtificial Sequencesynthetic RNA adaptor
GR5 79cgactggagc acgaggacac tga 238024DNAArtificial
Sequencesynthetic PCR primer EK-1 Rev2 for Ebola virus polymerase L
(L-pol) 80tgagatggtt ttggtgtggc atct 248125DNAArtificial
Sequencesynthetic PCR primer VP24-1160 Rev2 for Ebola virus virion
protein 24 (VP24) 81cctggttttt gtaagggtgt caact 258223DNAArtificial
Sequencesynthetic PCR primer VP35-855 Rev2 for Ebola virus virion
protein 35 (VP35) 82tttctggcaa gctcggggaa tgt 238318DNAArtificial
Sequencesynthetic sequencing primer from within GeneRacer GR5
sequence 83actggagcac gaggacac 188420DNAArtificial
Sequencesynthetic EK-1 3'seq primer 84agccataaca taccctcagt
208520DNAArtificial Sequencesynthetic VP24-1160 3'seq primer
85atgaaagcag agatgtcaag 208619DNAArtificial Sequencesynthetic
VP35-855 3'seq primer 86attagggcac attgaggag 19
* * * * *
References