U.S. patent application number 15/072978 was filed with the patent office on 2016-09-08 for methods, cells & organisms.
This patent application is currently assigned to Kymab Limited. The applicant listed for this patent is Kymab Limited. Invention is credited to Hanif Ali, Allan Bradley, E-Chiang Lee.
Application Number | 20160257974 15/072978 |
Document ID | / |
Family ID | 51610392 |
Filed Date | 2016-09-08 |
United States Patent
Application |
20160257974 |
Kind Code |
A1 |
Bradley; Allan ; et
al. |
September 8, 2016 |
Methods, Cells & Organisms
Abstract
The invention relates to an approach for introducing one or more
desired insertions and/or deletions of known sizes into one or more
predefined locations in a nucleic acid (e.g., in a cell or organism
genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (e.g., produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques. The invention also provides sequential
insertion and/or deletions using single- or double-stranded DNA
cutting.
Inventors: |
Bradley; Allan; (Cambridge,
GB) ; Ali; Hanif; (Cambridge, GB) ; Lee;
E-Chiang; (Cambridge, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kymab Limited |
Cambridge |
|
GB |
|
|
Assignee: |
Kymab Limited
Cambridge
GB
|
Family ID: |
51610392 |
Appl. No.: |
15/072978 |
Filed: |
March 17, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/GB2014/052837 |
Sep 18, 2014 |
|
|
|
15072978 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2217/072 20130101;
C12N 15/907 20130101; A01K 2207/15 20130101; A01K 2217/052
20130101; C07K 2317/52 20130101; A01K 67/0278 20130101; C07K
2317/24 20130101; A01K 2267/01 20130101; C12N 2800/80 20130101;
C07K 16/00 20130101; C07K 2317/20 20130101; C12N 15/102 20130101;
C07K 2317/56 20130101; A01K 2227/105 20130101; C12N 2510/04
20130101; C07K 2317/14 20130101; C12N 5/0635 20130101 |
International
Class: |
C12N 15/90 20060101
C12N015/90; C07K 16/00 20060101 C07K016/00; C12N 15/10 20060101
C12N015/10; A01K 67/027 20060101 A01K067/027 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 18, 2013 |
GB |
1316560.0 |
Dec 2, 2013 |
GB |
1321210.5 |
Claims
1. An in vitro method for modifying a genome at a genomic locus of
interest in a mouse ES cell, the method comprising: contacting the
mouse ES cell with: a Cas9 protein; a CRISPR RNA that hybridizes to
a CRISPR target sequence at the genomic locus of interest; a
tracrRNA; and an incoming nucleic acid sequence that is flanked by:
(i) a 5' homology arm that is homologous to a 5' target sequence at
the genomic locus of interest; and (ii) a 3' homolog arm that is
homologous to a 3' target sequence at the genomic locus of
interest; wherein the incoming nucleic acid sequence is at least 20
kb in size; wherein following the contacting step, the genome of
the mouse ES cell is modified to comprise a targeted genetic
modification comprising: deletion of a region of the genomic locus
of interest wherein the deletion is at least 20 kb; and/or
insertion of the insert nucleic acid at the genomic locus of
interest wherein the insertion is at least 20 kb. wherein the
targeted genomic modification comprises insertion of: a. One or
more human antibody heavy chain variable domains; b. One or more
human antibody kappa light chain variable domains; or c. One or
more human antibody lambda light chain variable domains;
2. The method of claim 1, wherein the targeted genomic modification
comprises deletion of one or more mouse antibody heavy chain
variable domains and insertion of one or more human antibody heavy
chain variable domains.
3. The method of claim 1, wherein the targeted genomic modification
comprises deletion of one or more mouse antibody kappa light chain
variable domains and insertion of one or more human antibody kappa
light chain variable domains.
4. The method of claim 1, wherein the targeted genomic modification
comprises deletion of one or more mouse antibody lambda light chain
variable domains and insertion of one or more human antibody lambda
light chain variable domains.
5. The method of claim 1, wherein the targeted genomic modification
comprises an insertion of a transgenic IgH locus comprising a human
variable region comprising human VH, D and JH gene segments.
6. The method of claim 5, wherein the transgenic IgH locus is
targeted to the region between the J4 exon and the C.mu. locus in
the mouse genome IgH locus.
7. The method of claim 5, wherein the transgenic IgH locus is
targeted to the region between the J4 exon and the C.mu. locus in
the mouse genome IgH locus, and wherein the inserted transgenic
human IgH locus comprises, in germline configuration, all of the V,
D and J regions and intervening sequences from a human.
8. The method of claim 5, wherein the transgenic IgH locus is
targeted into mouse chromosome 12 between the end of the mouse J4
region and the E.mu. region.
9. The method of claim 5, wherein the 3' end of the last human J
sequence of the transgenic IgH locus is less than 2 kb from 3' end
of the inserted transgenic IgH locus.
10. The method of claim 5, wherein the 3' end of the last human J
sequence of the transgenic IgH locus is less than 1 kb from 3' end
of the inserted transgenic IgH locus.
11. The method of claim 5, wherein the inserted IgH locus is
operatively connected upstream of (5' of) a mouse constant
region.
12. The method of claim 1, wherein the targeted genomic
modification comprises an insertion of a transgenic Ig.kappa. locus
comprising a human variable region comprising human V.kappa. and
J.kappa. gene segments.
13. The method of claim 12, wherein the human light chain kappa V
and J gene segments are targeted into mouse chromosome 6.
14. The method of claim 12, wherein the human light chain kappa V
and J gene segments are targeted into mouse chromosome 6, and
wherein the inserted human kappa V and J gene segments comprise, in
germline configuration, all of the V and J regions and intervening
sequences from a human.
15. The method of claim 12, wherein the inserted Ig.kappa. locus is
operatively connected upstream of a mouse constant region.
16. The method of claim 1, wherein the targeted genomic
modification comprises an insertion of a transgenic Ig.lamda. locus
comprising a human variable region comprising human V.lamda. and
J.lamda. gene segments.
17. The method of claim 16, wherein the human light chain lambda V
and J gene segments are targeted into mouse chromosome 16.
18. The method of claim 16, wherein the human light chain lambda V
and J gene segments are targeted into mouse chromosome 16, and
wherein the inserted human lambda V and J gene segments comprise,
in germline configuration, all of the V and J regions and
intervening sequences from a human.
19. The method of claim 16, wherein the inserted Ig.lamda. locus is
operatively connected upstream of a mouse constant region.
20. The method of claim 16, wherein the transgenic Ig.lamda. locus
further comprises at least one human C.lamda. region.
21. The method of claim 1 wherein the mouse ES cell is a wild-type
129, C57BL/6N, C57BL/6J, JMS, AB2.1, AB2.2, 129S5, 129S7 or 129Sv
strain.
22. The method of claim 1, wherein the mouse ES cell or its progeny
is developed into a mouse.
23. A mouse obtained by the method of claim 1 or progeny
thereof.
24. A mouse obtained by the method of claim 5 or progeny
thereof.
25. The mouse of claim 24 which is heterozygous for the targeted
genomic modification.
26. The mouse of claim 24 which is homozygous for the targeted
genomic modification.
27. The mouse of claim 24, which further comprises a targeted
modification to insert one or more human antibody kappa light chain
variable domains.
28. The mouse of claim 24, which further comprises a homozygous
targeted modification to insert one or more human antibody kappa
light chain variable domains.
29. An antibody produced by the mouse of claim 23 or its clone or
progeny.
30. A method for producing an antibody comprising immunizing the
mouse of claim 23 or its clone or progeny with an antigen, and
isolating an antibody produced by the mouse.
31. The method of claim 30 further comprising a step of making the
mouse by modifying an ES cell according to claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application under 35
U.S.C. .sctn.120 of co-pending International Application No.
PCT/GB2014/052837 filed Sep. 18, 2014, which designated the U.S.,
and which claims benefit of GB Application No. 1316560.0 filed Sep.
18, 2013, and claims benefit of GB Application No. 1321210.5 filed
Dec. 2, 2013 the contents of each of which are incorporated herein
by reference in their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 15, 2016, is named
K00016-1-Sequence-Listing-069496-086064.txt and is 1,444,445 bytes
in size.
[0003] The inventors have devised an approach for introducing one
or more desired insertions and/or deletions of known sizes into one
or more predefined locations in a nucleic acid (e.g., in a cell or
organism genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (e.g., produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques.
[0004] The inventors have also devised new techniques termed
sequential endonuclease-mediated homology directed recombination
(sEHDR) and sequential Cas-mediated homology directed recombination
(sCHDR).
BACKGROUND
[0005] Certain bacterial and archaea strains have been shown to
contain highly evolved adaptive immune defence systems, CRISPR/Cas
systems, which continually undergo reprogramming to direct
degradation of complementary sequences present within invading
viral or plasmid DNA. Short segments of foreign DNA, called
spacers, are incorporated into the genome between CRISPR repeats,
and serve as a `memory` of past exposures. CRISPR spacers are then
used to recognize and silence exogenous genetic elements in a
manner analogous to RNAi in eukaryotic organisms.
[0006] The Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR) system including the CRISPR associated (Cas)
protein has been reconstituted in vitro by a number of research
groups allowing for the DNA cleavage of almost any DNA template
without the caveat of searching for the right restriction enzyme
cutter. The CRISPR/Cas system also offers a blunt end cleavage
creating a dsDNA or, using mutated Cas versions, a selective single
strand-specific cleavage (see Cong et al., Wang et al. & Mali
et al. cited below).
[0007] Through in vitro studies using Streptococcus pyogenes type
II CRISPR/Cas system it has been shown that the only components
required for efficient CRISPR/Cas-mediated target DNA or genome
modification are a Cas nuclease (e.g., a Cas9 nuclease), CRISPR RNA
(crRNA) and trans-activating crRNA (tracrRNA). The wild-type
mechanism of CRISPR/Cas-mediated DNA cleavage occurs via several
steps. Transcription of the CRISPR array, containing small
fragments (20-30 base-pairs) of the encountered (or target) DNA,
into pre-crRNA, which undergoes maturation through the
hybridisation with tracrRNA via direct repeats of pre-crRNA. The
hybridisation of the pre-crRNA and tracrRNA, known as guide RNA
(gRNA or sgRNA), associates with the Cas nuclease forming a
ribonucleoprotein complex, which mediates conversion of pre-crRNA
into mature crRNA. Mature crRNA:tracrRNA duplex directs Cas9 to the
DNA target consisting of the protospacer and the requisite
protospacer adjacent motif (CRISPR/cas protospacer-adjacent motif;
PAM) via heteroduplex formation between the spacer region of the
crRNA and the protospacer DNA on the host genome. The Cas9 nuclease
mediates cleavage of the target DNA upstream of PAM to create a
double-stranded break within the protospacer or a strand-specific
nick using mutated Cas9 nuclease whereby one DNA strand-specific
cleavage motif is mutated (for example, Cas9 nickase contains a
D10A substitution) (Cong et al.).
[0008] It is worth noting that different strains of Streptococcus
have been isolated which use PAM sequences that are different from
that used by Streptococcus pyogenes Cas9. The latter requires a NGG
PAM sequence. CRISPR/Cas systems (for example, the Csy4
endoribonulcease in Pseudomonas aerognosa (see Shah et al.) have
been described in other prokaryotic species, which recognise a
different PAM sequence (e.g., CCN, TCN, TTC, AWG, CC, NNAGNN, NGG,
NGGNG). It is noteworthy that the Csy4 (also known as Cas6f) has no
sequence homology to Cas9 but the DNA cleavage occurs through a
similar mechanism involving the assembly of a Cas-protein-crRNA
complex that facilitates target DNA recognition leading to specific
DNA cleavage (Haurwitz et al.).
[0009] In vitro-reconstituted type II CRISPR/Cas system has been
adapted and applied in a number of different settings. These
include creating selective gene disruption in single or multiple
genes in ES cells and also single or multiple gene disruption using
a one-step approach using zygotes to generate biallelic mutations
in mice. The speed, accuracy and the efficiency at which this
system could be applied to genome editing in addition to its
multiplexing capability makes this system vastly superior to its
predecessor genome editing technologies namely zinc finger
nucleases (ZFNs), transcription activator-like effector nucleases
(TALENs) and engineered homing meganucleases (Gaj et al. &
Perez-Pinera et al.). These have been successfully used in various
eukaryotic hosts but they all suffer from important limitations;
notably off-target mutagenesis leading to nuclease-related
toxicity, and also the time and cost of developing such engineered
proteins. The CRISPR/Cas system on the other hand is a superior
genome editing system by which mutations can be introduced with
relative ease, simply by designing a single guided RNA
complementary to the protospacer sequence on the target DNA.
[0010] The dsDNA break induced by an endonuclease, such as Cas9, is
subsequently repaired through non-homologous end joining mechanism
(NHEJ), whereby the subsequent DNA repair at the breakpoint
junction is stitched together with different and unpredictable
inserted or deletions (indels) of varying size. This is highly
undesirable when precise nucleic acid or genome editing is
required. However a predefined precise mutation can be generated
using homology directed repair (HDR), e.g., with the inclusion of a
donor oligo or donor DNA fragment. This approach with Cas9 nuclease
has been shown to generate precise predefined mutations but the
efficiency at which this occurs in both alleles is low and mutation
is seen in one of the strands of the dsDNA target (Wang et
al.).
[0011] The CRISPR/Cas system does therefore have some limitations
in its current form. While it may be possible to modify a desired
sequence in one strand of dsDNA, the sequence in the other strand
is often mutated through undesirable NHEJ.
SUMMARY OF THE INVENTION
A First Configuration of the Present Invention Provides:--
[0012] A method of nucleic acid recombination, the method
comprising providing dsDNA comprising first and second strands and
[0013] (a) using nucleic acid cleavage to create 5' and 3' cut ends
in the first strand; [0014] (b) using homologous recombination to
insert a nucleotide sequence between the ends, thereby producing a
modified first strand; thereby producing DNA wherein the first
strand has been modified by said recombination but the second
strand has not been modified; and [0015] (c) optionally replicating
the modified first strand to produce a progeny dsDNA wherein each
strand thereof comprises a copy of the inserted nucleotide
sequence; and isolating the progeny dsDNA.
A Second Configuration of the Present Invention Provides:--
[0016] A method of nucleic acid recombination, the method
comprising [0017] (a) using nucleic acid cleavage to create 5' and
3' cut ends in a single nucleic acid strand; [0018] (b) using
homologous recombination to insert a nucleotide sequence between
the ends, wherein the insert sequence comprises a regulatory
element or encodes all or part of a protein; and [0019] (c)
optionally obtaining the nucleic acid strand modified in step (b)
or a progeny nucleic strand comprising the inserted nucleotide
sequence.
A Third Configuration of the Present Invention Provides:--
[0020] A method of nucleic acid recombination, the method
comprising [0021] (a) using nucleic acid cleavage to create first
and second breaks in a nucleic acid strand, thereby creating 5' and
3' cut ends and a nucleotide sequence between the ends; [0022] (b)
using homologous recombination to delete the nucleotide sequence;
and [0023] (c) optionally obtaining the nucleic acid strand
modified in step (b) or a progeny nucleic strand comprising the
deletion.
A Fourth Configuration of the Present Invention Provides:--
[0024] A method of nucleic acid recombination, the method
comprising providing dsDNA comprising first and second strands and
[0025] (a) using Cas endonuclease-mediated nucleic acid cleavage to
create a cut end in the first strand 3' of a PAM motif; [0026] (b)
using Cas endonuclease-mediated nucleic acid cleavage to create a
cut in the second strand at a position which corresponds to a
position 3' of the cut end of the strand of part (a), which cut is
3' of the PAM motif; [0027] (c) providing a first gRNA which
hybridises with a sequence 5' to the PAM motif in the strand of
part (a) [0028] (d) providing a second gRNA which hybridises with a
sequence 5' to the PAM motif in the strand of part (b)
[0029] wherein the nucleic acid strands of part (a) and part (b)
are repaired to produce a deletion of nucleic acid between the
cuts.
[0030] In aspects of the configurations of the invention there is
provided a method of sequential endonuclease-mediated homology
directed recombination (sEHDR) comprising carrying out the method
of any preceding configuration a first time and carrying out the
method of any preceding configuration a second time. In this way,
the invention enables serial nucleic acid modifications, e.g.,
genome modifications, to be carried out, which may comprise precise
sequence deletions, insertions or combinations of these two or more
times. For example, it is possible to use this aspect of the
invention to "walk along" nucleic acids (e.g., chromosomes in
cells) to make relatively large and precise nucleotide sequence
deletions or insertions. In an embodiment, one or more Cas
endonucleases (e.g., a Cas9 and/or Cys4) is used in a method of
sequential Cas-mediated homology directed recombination
(sCHDR).
[0031] In another aspect, the invention can be described according
to the numbered sentences below:
[0032] 1. A method of nucleic acid recombination, the method
comprising providing dsDNA comprising first and second strands
and
[0033] (a) using nucleic acid cleavage to create 5' and 3' cut ends
in the first strand;
[0034] (b) using homologous recombination to insert a nucleotide
sequence between the ends, thereby producing a modified first
strand; thereby producing DNA wherein the first strand has been
modified by said recombination but the second strand has not been
modified; and
[0035] (c) optionally replicating the modified first strand to
produce a progeny dsDNA wherein each strand thereof comprises a
copy of the inserted nucleotide sequence; and isolating the progeny
dsDNA.
[0036] 2. A method of nucleic acid recombination, the method
comprising
[0037] (a) using nucleic acid cleavage to create 5' and 3' cut ends
in a single nucleic acid strand;
[0038] (b) using homologous recombination to insert a nucleotide
sequence between the ends, wherein the insert sequence comprises a
regulatory element or encodes all or part of a protein; and
[0039] (c) optionally obtaining the nucleic acid strand modified in
step (b) or a progeny nucleic strand comprising the inserted
nucleotide sequence.
[0040] 3. The method of any preceding sentence, wherein the insert
sequence replaces an orthologous or homologous sequence of the
strand.
[0041] 4. The method of any preceding sentence, wherein the insert
nucleotide sequence is at least 10 nucleotides long.
[0042] 5. The method of any preceding sentence, wherein the insert
sequence comprises a site specific recombination site.
[0043] 6. A method of nucleic acid recombination, the method
comprising
[0044] (a) using nucleic acid cleavage to create first and second
breaks in a nucleic acid strand, thereby creating 5' and 3' cut
ends and a nucleotide sequence between the ends;
[0045] (b) using homologous recombination to delete the nucleotide
sequence; and
[0046] (c) optionally obtaining the nucleic acid strand modified in
step (b) or a progeny nucleic strand comprising the deletion.
[0047] 7. The method of sentence 6, wherein the deleted sequence
comprises a regulatory element or encodes all or part of a
protein.
[0048] 8. The method of any preceding sentence, wherein step (c) is
performed by isolating a cell comprising the modified first strand,
or by obtaining a non-human vertebrate in which the method has been
performed or a progeny thereof.
[0049] 9. The method of any preceding sentence, wherein the nucleic
acid strand or the first strand is a DNA strand.
[0050] 10. The method of any preceding sentence wherein the product
of the method comprises a nucleic acid strand comprising a PAM
motif 3' of the insertion or deletion.
[0051] 11. The method of any preceding sentence, wherein step (b)
is performed by carrying out homologous recombination between an
incoming nucleic acid comprising first and second homology arms,
wherein the homology arms are substantially homologous respectively
to a sequence extending 5' from the 5' end and a sequence extending
3' from the 3' end.
[0052] 12. The method of sentence 11, wherein step (b) is performed
by carrying out homologous recombination between an incoming
nucleic acid comprising an insert nucleotide sequence flanked by
the first and second homology arms, wherein the insert nucleotide
sequence is inserted between the 5' and 3' ends.
[0053] 13. The method of sentence 12, wherein the insert is as
recited in any one of sentences 3 to 5 and there is no further
sequence between the homology arms.
[0054] 14. The method of any one of sentences 11 to 13, wherein
each homology arm is at least 20 contiguous nucleotides long.
[0055] 15. The method of any one of sentences 11 to 14, wherein the
first and/or second homology arm comprises a PAM motif.
[0056] 16. The method of any preceding sentence, wherein Cas
endonuclease-mediated cleavage is used in step (a); optionally by
recognition of a GG or NGG PAM motif.
[0057] 17. The method of sentence 16, wherein a nickase is used to
cut in step (a).
[0058] 18. The method of any preceding sentence, wherein the method
is carried out in a cell, e.g. a eukaryotic cell.
[0059] 19. The method of sentence 18, wherein the method is carried
out in a mammalian cell.
[0060] 20. The method of sentence 18, wherein the cell is a rodent
(e.g., mouse) ES cell or zygote.
[0061] 21. The method of any preceding sentence, wherein the method
is carried out in a non-human mammal, e.g. a mouse or rat or
rabbit.
[0062] 22. The method of any preceding sentence, wherein each
cleavage site is flanked by PAM motif (e.g., a NGG or NGGNG
sequence, wherein N is any base and G is a guanine).
[0063] 23. The method of any preceding sentence, wherein the 3' end
is flanked 3' by a PAM motif.
[0064] 24. The method of any preceding sentence, wherein step (a)
is carried out by cleavage in one single strand of dsDNA.
[0065] 25. The method of any preceding sentence, wherein step (a)
is carried out by combining in a cell the nucleic acid strand, a
Cas endonuclease, a crRNA and a tracrRNA (e.g., provided by one or
more gRNAs) for targeting the endonuclease to carry out the
cleavage, and optionally an insert sequence for homologous
recombination with the nucleic acid strand.
[0066] 26. The method of any preceding sentence, wherein step (b)
is performed by carrying out homologous recombination with an
incoming nucleic acid comprising first and second homology arms,
wherein the homology arms are substantially homologous respectively
to a sequence extending 5' from the 5' end and a sequence extending
3' from the 3' end, wherein the second homology arm comprises a PAM
sequence such that homologous recombination between the second
homology arm and the sequence extending 3' from the 3' end produces
a sequence comprising a PAM motif in the product of the method.
[0067] 27. A method of sequential endonuclease-mediated homology
directed recombination (sEHDR) comprising carrying out the method
of any preceding sentence (e.g., when according to sentence 1 using
a nickase to cut a single strand of dsDNA; or when dependent from
sentence 2 or 5 using a nuclease to cut both strands of dsDNA) a
first time and a second time, wherein endonuclease-mediated
cleavage is used in each step (a); wherein the product of the first
time is used for endonuclease-mediated cleavage the second time,
whereby either (i) first and second nucleotide sequences are
deleted the first time and the second times respectively; (ii) a
first nucleotide sequence is deleted the first time and a second
nucleotide sequence is inserted the second time; (iii) a first
nucleotide sequence is inserted the first time and a second
nucleotide sequence is deleted the second time; or (iv) first and
second nucleotide sequences are inserted the first and second times
respectively: optionally wherein the nucleic acid strand
modification the second time is within 20 or less nucleotides of
the nucleic acid strand modification the first time.
[0068] 28. The method of sentence 27, wherein the first time is
carried out according to claim 6, wherein the incoming nucleic acid
comprises no sequence between the first and second homology arms,
wherein sequence between the 5' and 3' ends is deleted by
homologous recombination: and/or the second time is carried out
according to sentence 6, wherein step (b) is performed by carrying
out homologous recombination between an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end, wherein the incoming nucleic acid comprises no sequence
between the first and second homology arms such that sequence
between the 5' and 3' ends is deleted by homologous recombination;
optionally wherein the second arm comprises a PAM motif such that
the product of the second time comprises a PAM motif for use in a
subsequent Cas endonuclease-mediated method according to any one of
sentences 1 to 26.
[0069] 29. The method of sentence 27, wherein the first time is
carried out according to sentence 1 or 2, wherein the incoming
nucleic acid comprises the insert sequence between the first and
second homology arms, wherein the insert sequence is inserted
between the 5' and 3' ends by homologous recombination; and/or the
second time is carried out according to sentence 1 or 2, wherein
step (b) is performed by carrying out homologous recombination
between an incoming nucleic acid comprising first and second
homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the insert
sequence is inserted between the 5' and 3' ends by homologous
recombination: optionally wherein the second arm comprises a PAM
motif such that the product of the second time comprises a PAM
motif for use in a subsequent Cas endonuclease-mediated method
according to any one of sentences 1 to 26.
[0070] 30. The method of sentence 27, wherein one of said first and
second times is carried out as specified in sentence 28 and the
other time is carried out as specified in sentence 29, wherein at
least one sequence deletion and at least one sequence insertion is
performed.
[0071] 31. The method of any preceding sentence, wherein step (a)
is carried out using Cas endonuclease-mediated cleavage and a gRNA
comprising a crRNA and a tracrRNA.
[0072] 32. The method of sentence 25 or 31, wherein the crRNA has
the structure 5'-X-Y-3', wherein X is an RNA nucleotide sequence
(optionally at least 5 nucleotides long) and Y is a crRNA sequence
comprising a nucleotide motif that hybridises with a motif
comprised by the tracrRNA, wherein X is capable of hybridising with
a nucleotide sequence extending 5' from the desired site of the 5'
cut end.
[0073] 33. The method of sentence 25, 31 or 32, wherein Y is
5'-N1UUUUAN2N3GCUA-3' (SEQ ID NO:3), wherein each of N1-3 is a A,
U, C or G and/or the tracrRNA comprises the sequence (in 5' to 3'
orientation) UAGCM1UUAAAAM2 (SEQ ID NO:4), wherein M1 is spacer
nucleotide sequence and M2 is a nucleotide.
[0074] 34. A method of producing a cell or a transgenic non-human
organism, the method comprising [0075] (a) carrying out the method
of any preceding claim to (i) knock out a target nucleotide
sequence in the genome of a first cell and/or (ii) knock in an
insert nucleotide sequence into the genome of a first cell,
optionally wherein the insert sequence replaces a target sequence
in whole or in part at the endogenous location of the target
sequence in the genome; wherein the cell or a progeny thereof can
develop into a non-human organism or cell; and [0076] (b)
developing the cell or progeny into a non-human organism or a
non-human cell.
[0077] 35. The method of sentence 34, wherein the organism or cell
is homozygous for the modification (i) and/or (ii).
[0078] 36. The method of sentence 34 or 35, wherein the cell is an
ES cell, iPS cell, totipotent cell or pluripotent cell.
[0079] 37. The method of any one of sentences 34 to 36, wherein the
cell is a rodent (e.g., a mouse or rat) cell.
[0080] 38. The method of any one of sentences 34 to 37, wherein the
target sequence is an endogenous sequence comprising all or part of
a regulatory element or encoding all or part of a protein.
[0081] 39. The method of any one of sentences 34 to 38, wherein the
insert sequence is a synthetic sequence; or comprises a sequence
encoding all or part of a protein from a species other than the
species from which the first cell is derived; or comprises a
regulatory element from said first species.
[0082] 40. The method of sentence 39, wherein the insert sequence
encodes all or part of a human protein or a human protein subunit
or domain.
[0083] 41. A cell or a non-human organism whose genome comprises a
modification comprising a non-endogenous nucleotide sequence
flanked by endogenous nucleotide sequences, wherein the cell or
organism is obtainable by the method of any one of sentences 24 to
40 and wherein the non-endogenous sequence is flanked 3' by a Cas
PAM motif; wherein the cell is not comprised by a human; and one,
more or all of (a) to (d) applies [0084] (a) the genome is
homozygous for the modification; or comprises the modification at
one allele and is unmodified by Cas-mediated homologous
recombination at the other allele; [0085] (b) the non-endogenous
sequence comprises all or part of a regulatory element or encodes
all or part of a protein; [0086] (c) the non-endogenous sequence is
at least 20 nucleotides long; [0087] (d) the non-endogenous
sequence replaces an orthologous or homologous sequence in the
genome.
[0088] 42. The cell or organism of sentence 41, wherein the
non-endogenous sequence is a human sequence.
[0089] 43. The cell or organism of sentence 41 or 42, wherein the
PAM motif comprises a sequence selected from CCN, TCN, TTC, AWG,
CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA.
[0090] 44. The cell or organism of any one of sentences 41 to 43,
wherein there is a PAM motif no more than 10 nucleotides (e.g., 3
nucleotides) 3' of the non-endogenous sequence.
[0091] 45. The cell or organism of any one of sentences 41 to 44,
wherein the PAM motif is recognised by a Streptococcus Cas9.
[0092] 46. The cell or organism of any one of sentences 41 to 45,
which is a non-human vertebrate cell or a non-human vertebrate that
expresses one or more human antibody heavy chain variable domains
(and optionally no heavy chain variable domains of a non-human
vertebrate species).
[0093] 47. The cell or organism of any one of sentences 41 to 46,
which is a non-human vertebrate cell or a non-human vertebrate that
expresses one or more human antibody kappa light chain variable
domains (and optionally no kappa light chain variable domains of a
non-human vertebrate species).
[0094] 48. The cell or organism of any one of sentences 41 to 47,
which is a non-human vertebrate cell or a non-human vertebrate that
expresses one or more human antibody lambda light chain variable
domains (and optionally no kappa light chain variable domains of a
non-human vertebrate species).
[0095] 49. The cell or organism of any one of sentences 46 to 48,
wherein the non-endogenous sequence encodes a human Fc receptor
protein or subunit or domain thereof (e.g., a human FcRn or
Fc.UPSILON. receptor protein, subunit or domain).
[0096] 50. The cell or organism of any one of sentences 41 to 48,
wherein the non-endogenous sequence comprises one or more human
antibody gene segments, an antibody variable region or an antibody
constant region.
[0097] 51. The cell or organism of any one of sentences 41 to 50,
wherein the insert sequence is a human sequence that replaces or
supplements an orthologous non-human sequence.
[0098] 52. A monoclonal or polyclonal antibody prepared by
immunisation of a vertebrate (e.g., mouse or rat) according to any
one of sentences 41 to 51 with an antigen.
[0099] 53. A method of isolating an antibody that binds a
predetermined antigen, the method comprising
[0100] (a) providing a vertebrate (optionally a mouse or rat)
according to any one of sentences 41 to 51.
[0101] (b) immunising said vertebrate with said antigen;
[0102] (c) removing B lymphocytes from the vertebrate and selecting
one or more B lymphocytes expressing antibodies that bind to the
antigen;
[0103] (d) optionally immortalising said selected B lymphocytes or
progeny thereof, optionally by producing hybridomas therefrom;
and
[0104] (e) isolating an antibody (e.g., and IgG-type antibody)
expressed by the B lymphocytes.
[0105] 54. The method of sentence 53, comprising the step of
isolating from said B lymphocytes nucleic acid encoding said
antibody that binds said antigen; optionally exchanging the heavy
chain constant region nucleotide sequence of the antibody with a
nucleotide sequence encoding a human or humanised heavy chain
constant region and optionally affinity maturing the variable
region of said antibody; and optionally inserting said nucleic acid
into an expression vector and optionally a host.
[0106] 55. The method of sentence 53 or 54, further comprising
making a mutant or derivative of the antibody produced by the
method of claim 53 or 54.
[0107] 56. The use of an isolated, monoclonal or polyclonal
antibody according to sentence 52, or a mutant or derivative
antibody thereof that binds said antigen, in the manufacture of a
composition for use as a medicament.
[0108] 57. The use of an isolated, monoclonal or polyclonal
antibody according to sentence 52, or a mutant or derivative
antibody thereof that binds said antigen for use in medicine.
[0109] 58. A nucleotide sequence encoding an antibody of sentence
52, optionally wherein the nucleotide sequence is part of a
vector.
[0110] 59. A pharmaceutical composition comprising the antibody or
antibodies of sentence 52 and a diluent, excipient or carrier.
[0111] 60. An ES cell, a eukaryotic cell, a mammalian cell, a
non-human animal or a non-human blastocyst comprising an
expressible genomically-integrated nucleotide sequence encoding a
Cas endonuclease.
[0112] 61. The cell, animal or blastocyst of sentence 60, wherein
the endonuclease sequence is constitutively expressible.
[0113] 62. The cell, animal or blastocyst of sentence 60, wherein
the endonuclease sequence is inducibly expressible.
[0114] 63. The cell, animal or blastocyst of sentence 60, 61 or 62,
wherein the endonuclease sequence is expressible in a
tissue-specific or stage-specific manner in the animal or a progeny
thereof, or in a non-human animal that is a progeny of the cell or
blastocyst.
[0115] 64. The cell or animal of sentence 63, wherein the cell is a
non-human embryo cell or the animal is a non-human embryo, wherein
the endonuclease sequence is expressible or expressed in the cell
or embryo.
[0116] 65. The cell of animal sentence 64, wherein the endonuclease
is operatively linked to a promoter selected from the group
consisting of an embryo-specific promoter (e.g., a Nanog promoter,
a Pou5fl promoter or a SoxB promoter).
[0117] 66. The cell, animal or blastocyst of any one of sentences
60 to 65, wherein the Cas endonuclease is at a Rosa 26 locus.
[0118] 67. The cell, animal or blastocyst of any one of sentences
60 to 65, wherein the Cas endonuclease is operably linked to a Rosa
26 promoter.
[0119] 68. The cell, animal or blastocyst of any one of sentences
60 to 63, w5erein the Cas endonuclease sequence is flanked 5' and
3' by transposon elements (e.g., inverted piggyBac terminal
elements) or site-specific recombination sites (e.g., loxP and/or a
mutant lox, e.g., lox2272 or lox511; or frt).
[0120] 69. The cell, animal or blastocyst of sentence 68,
comprising one or more restriction endonuclease sites between the
Cas endonuclease sequence and a transposon element.
[0121] 70. The cell, animal or blastocyst of any one of sentences
60 to 69 comprising one or more gRNAs.
[0122] 71. The cell, animal or blastocyst of sentence 68, 69 or 70,
wherein the gRNA(s) are flanked 5' and 3' by transposon elements
(e.g., inverted piggyBac terminal elements) or site-specific
recombination sites (e.g., loxP and/or a mutant lox, e.g., lox2272
or lox511; or frt).
[0123] 72. Use of the cell, animal or blastocyst of any one of
sentences 60 to 71 in a method according to any one of sentences 1
to 51 or 73.
[0124] 73. A method of nucleic acid recombination, the method
comprising providing dsDNA comprising first and second strands
and
[0125] (a) using Cas endonuclease-mediated nucleic acid cleavage to
create a cut end in the first strand 3' of a PAM motif;
[0126] (b) using Cas endonuclease-mediated nucleic acid cleavage to
create a cut in the second strand at a position which corresponds
to a position 3' of the cut end of the strand of part (a), which
cut is 3' of the PAM motif;
[0127] (c) providing a first gRNA which hybridises with a sequence
5' to the PAM motif in the strand of part (a)
[0128] (d) providing a second gRNA which hybridises with a sequence
5' to the PAM motif in the strand of part (b)
[0129] wherein the nucleic acid strands of part (a) and part (b)
are repaired to produce a deletion of nucleic acid between the
cuts.
[0130] 74. The method of sentence 6, wherein the deleted sequence
comprises a regulatory element or encodes all or part of a
protein.
[0131] 75. The method of sentence 73 or 74, wherein Cas
endonuclease-mediated cleavage is used in step (a) or in step (b)
is by recognition of a GG or NGG PAM motif.
[0132] 76. The method of sentence 75, wherein a nickase is used to
cut in step (a) and/or in step (b).
[0133] 77. The method of sentence 73 or 74 wherein a nuclease is
used to cut in step (a) and/or in step (b).
[0134] 78. The method of any one of sentences 74 to 77, wherein the
method is carried out in a cell, e.g. a eukaryotic cell.
[0135] 79. The method of sentence 78, wherein the method is carried
out in a mammalian cell.
[0136] 80. The method of sentence 78, wherein the cell is a rodent
(e.g., mouse) ES cell or zygote.
[0137] 81. The method of any one of sentences 74 to 80, wherein the
method is carried out in a non-human mammal, e.g. a mouse or rat or
rabbit.
[0138] 82. The method of any one of sentences 74 to 81, wherein
each cleavage site is flanked by PAM motif (e.g., a NGG or NGGNG
sequence, wherein N is any base and G is a guanine).
[0139] 83. Use of a first and second gRNA to target a desired part
of the nucleic acid, defining the region to be deleted, in a method
according to any one of sentences 74 to 82.
BRIEF DESCRIPTION OF THE FIGURES
[0140] FIG. 1A. Precise DNA Insertion in a Predefined Location
(KI): gRNA designed against a predefined location can induce DNA
nick using Cas9 D10A nickase 5' of the PAM sequence (shown as solid
black box). Alternatively, gRNA can be used together with Cas9
wild-type nuclease to induce double-stranded DNA breaks 5' of the
PAM sequence. The addition of a donor oligo or a donor DNA fragment
(single or double stranded) with homology around the breakpoint
region containing any form of DNA alterations including addition of
endogenous or exogenous DNA can be precisely inserted at the
breakpoint junction where the DNA is repaired through HDR.
[0141] FIG. 1B. Precise DNA Insertion in a Predefined Location
(KI): This figure shows a more detailed description of the
mechanism described in FIG. 1A. sgRNA designed against a predefined
location can induce DNA nick using Cas9 D10A nickase 5' of the PAM
sequence (shown as solid black box). Alternatively, sgRNA can be
used together with Cas9 wild-type nuclease to induce
double-stranded DNA breaks 5' of the PAM sequence. The addition of
a donor oligo or a donor DNA fragment (single or double stranded)
with homology arms (HA) around the breakpoint region containing any
form of DNA alterations including addition of endogenous or
exogenous DNA, can be precisely inserted at the breakpoint junction
where the DNA is repaired through HDR
[0142] FIG. 2A. Precise DNA Deletion (KO): gRNAs targeting flanking
region of interest can induce two DNA nicks using Cas9 D10A nickase
in predefine locations containing the desired PAM sequences (shown
as solid black box). Alternatively, gRNAs can be used with Cas9
wild-type nuclease to induce two DSB flanking the region of
interest. Addition of a donor oligo or a donor DNA fragment (single
or double stranded) with homology to region 5' of PAM 1 and 3' of
PAM 2 sequence will guide DNA repair in a precise manner via HDR.
DNA repair via HDR will reduce the risk of indel formation at the
breakpoint junctions and avoid DNA repair through NHEJ and in doing
so, it will delete out the region flanked by the PAM sequence and
carry out DNA repair in a pre-determined and pre-defined
manner.
[0143] FIG. 2B. Precise DNA Deletion (KO): This figure shows a more
detailed description of the mechanism described in FIG. 2A. sgRNAs
targeting flanking region of interest can induce two DNA nicks
using Cas9 D10A nickase in predefine locations containing the
desired PAM sequences (shown as solid black box). Note. The PAMs
can be located in opposite DNA strands as suppose to the example
depicted in the figure where both PAMs are on the same DNA strand.
Alternatively, sgRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of a donor
oligo or a donor DNA fragment (single or double stranded) with
homology to region 5' of PAM 1 and 3' of PAM 2 sequence will guide
DNA repair in a precise manner via HDR. DNA repair via HDR will
reduce the risk of indel formation at the breakpoint junctions and
avoid DNA repair through NHEJ and in doing so, it will delete out
the region flanked by the PAM sequence and carry out DNA repair in
a pre-determined and pre-defined manner.
[0144] FIG. 3A: Precise DNA Deletion and Insertion (KO.fwdarw.KI):
gRNAs targeting flanking region of interest can induce two DNA
nicks using Cas9 D10A nickase in predefine locations containing the
desired PAM sequences (shown as solid black box). Alternatively,
gRNAs can be used with Cas9 wild-type nuclease to induce two DSB
flanking the region of interest. Addition of a donor oligo or a
donor DNA fragment (single or double stranded) with homology to
region 5' of PAM 1 and 3' to PAM 2 with inclusion of additional
endogenous or exogenous DNA, will guide DNA repair in a precise
manner via HDR with the concomitant deletion of the region flanked
by DSB or nick and the insertion of DNA of interest.
[0145] FIG. 3B: Precise DNA Deletion and Insertion (KO.fwdarw.KI):
s This figure shows a more detailed description of the mechanism
described in FIG. 3A. gRNAs targeting flanking region of interest
can induce two DNA nicks using Cas9 D10A nickase in predefine
locations containing the desired PAM sequences (shown as solid
black box). Alternatively, sgRNAs can be used with Cas9 wild-type
nuclease to induce two DSB flanking the region of interest.
Addition of a donor oligo or a donor DNA fragment (single or double
stranded) with homology to region 5' of PAM 1 and 3' to PAM 2 with
inclusion of additional endogenous or exogenous DNA (DNA insert),
will guide DNA repair in a precise manner via HDR with the
concomitant deletion of the region flanked by DSB or nick and the
insertion of DNA of interest. Note. Once again, the PAMs can be
located in opposite DNA strands as suppose to the example depicted
in the figure where both PAMs are on the same DNA strand
[0146] FIG. 4A: Recycling PAM For Sequential Genome Editing
(Deletions): gRNAs targeting flanking region of interest can induce
two DNA nicks using Cas9 D10A nickase in predefine locations
containing the desired PAM sequences (shown as solid black box).
Alternatively, gRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of a donor
oligo or a donor DNA fragment (single or double stranded) with
homology to region 5' of PAM 2 and 3' of PAM 3 will guide DNA
repair in a precise manner via HDR and in doing so, it will delete
out the region between PAM 2 and PAM3. This deletion will retain
PAM 3 and thus acts as a site for carrying out another round of
CRISPR/Cas mediated genome editing. Another PAM site (e.g., PAM 1)
can be used in conjunction with PAM 3 sequence to carry out another
round of deletion as described above. Using this PAM recycling
approach, many rounds of deletions can be performed in a stepwise
deletion fashion, where PAM 3 is recycled after each round. This
approach can be used also for the stepwise addition of endogenous
or exogenous DNA.
[0147] FIG. 4B: Recycling PAM For Sequential Genome Editing
(Deletions): This figure shows a more detailed description of the
mechanism described in FIG. 4B. sgRNAs targeting flanking region of
interest can induce two DNA nicks using Cas9 D10A nickase in
predefine locations containing the desired PAM sequences.
Alternatively, sgRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of a donor
oligo or a donor DNA fragment (single or double stranded) with
homology to region 5' of PAM 1 (clear PAM box) and 3' of PAM 2
(black PAM box) will guide DNA repair in a precise manner via HDR
and in doing so, it will delete out the region between PAM 1 and
PAM 2. PAM sequence together with unique gRNA can be included in
the intruding DNA and targeted back into the site of editing. In
this, PAM 1 sequence for example can be recycled and thus acts as a
site for carrying out another round of CRISPR/Cas mediated genome
editing. Another PAM site (e.g. PAM 3, grey PAM box) can be used in
conjunction with the recycled PAM 1 sequence to carry out another
round of editing (i.e. Insertion) as described above. Using this
PAM recycling approach, many rounds of genome editing can be
performed in a stepwise fashion, where PAM 1 is recycled after each
round. This approach can be used also for the stepwise addition of
endogenous or exogenous DNA.
[0148] FIG. 5A: CRISPR/Cas mediated Lox Insertion to facilitate
RMCE: gRNAs targeting flanking region of interest can induce two
DNA nicks using Cas9 D10A nickase in predefine locations containing
the desired PAM sequences (shown as solid black box).
Alternatively, gRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of two
donor oligos or donor DNA fragments (single or double stranded)
with homology to regions 5' and 3' of each PAM sequence where the
donor DNA contains recombinase recognition sequence (RRS) such as
loxP and lox5171 will guide DNA repair in a precise manner via HDR
with the inclusion of these RRS. The introduced RRS can be used as
a landing pad for inserting any DNA of interest with high
efficiency and precisely using recombinase mediated cassette
exchange (RMCE). The retained PAM 2 site can be recycled for
another round of CRISPR/Cas mediated genome editing for deleting or
inserting DNA of interest. Note, the inserted DNA of interest could
contain selection marker such as PGK-Puro flanked by PiggyBac LTR
to allow for the initial selection and upon successful integration
into DNA of interest, the selection marker can be removed
conveniently by expressing hyperPbase transposase.
[0149] FIG. 5B: CRISPR/Cas mediated Lox Insertion to facilitate
RMCE: This figure shows a more detailed description of the
mechanism described in FIG. 5A. sgRNAs targeting flanking region of
interest can induce two DNA nicks using Cas9 D10A nickase in
predefine locations containing the desired PAM sequences (shown as
solid black box). Alternatively, sgRNAs can be used with Cas9
wild-type nuclease to induce two DSB flanking the region of
interest. Addition of two donor oligos or donor DNA fragments
(single or double stranded) with homology to regions 5' and 3' of
each PAM sequences where the donor DNA contains recombinase
recognition sequence (RRS) such as loxP and lox5171 will guide DNA
repair in a precise manner via HDR with the inclusion of these RRS.
Note. The targeting of the lox sites can be done sequentially or as
a pool in a single step process. The introduced RRS can be used as
a landing pad for inserting any DNA of interest with high
efficiency and precisely using recombinase mediated cassette
exchange (RMCE). As detailed in FIG. 4, the PAM sequence can be
recycled for another round of CRISPR/Cas mediated genome editing
for deleting or inserting DNA of interest. As an option, the
inserted DNA of interest could contain selection marker such as
PGK-Puro flanked by PiggyBac LTR to allow for the initial selection
and upon successful integration into DNA of interest, the selection
marker can be removed conveniently by expressing hyperPbase
transposase.
[0150] FIGS. 6A and 6B: Genome modification to produce
transposon-excisable Cas9 and gRNA
[0151] FIG. 6C: Single copy Cas9 Expression: A landing pad
initially can be targeted into any locus of choice in mouse ES
cells or any other eukaryotic cell line. The landing pad will
typically contain Piggy Bac 5' and 3' LTR, selection marker such as
neo for example floxed and a gene less promoter such as PGK in the
general configuration shown. Targeting is done by homologous
recombination and clones are selected on G418. The next step will
involve RMCE to insert Cas9 linked via a T2A sequence to
Puro-delta-tk with the option to insert single or multiple guide
RNA using the unique restriction sites (RS). The orientation of the
lox sites are positioned in a manner that only once the intruding
DNA containing the Cas9 is inserted into the landing pad, the PGK
promoter on the landing pad can activate the transcription and thus
the expression of the puromycin and via the T2A transcribe and
expression Cas9 production. Using this approach a single stable
expression of Cas9 can be achieved. Following 4-6 days of selection
on puromycin, the entire Cas9 and guide RNA floxed cassette can be
excised using PiggyBac transposase (Pbase) and individual clones
can be analysed for genome editing resulting from the introduced
guide RNA. As an option, a stable bank cell line expressing Cas9
can be generated from which multiple engineered cell lines can be
generated. To do this, only Cas9-T2A-Puro-delta-tk will be inserted
and no gRNA at the stage of RMCE. This will produce a general
single copy Cas9 expressing cell line where its genome can be
edited by transfecting single or multiple gRNA.
[0152] FIG. 7: Schematic representing the gRNA position with
respect to gene X, the structure of the targeting vector and the
oligo pair used for genotyping the resulting targeted clones.
[0153] FIG. 8: A gel image showing the genotyping results following
Cas9 nuclease mediated double stranded DNA break and the subsequent
DNA targeting. The genotyping shows PCR product (880 bp) specific
for the 5' targeted homology arm using oligo pair HAP341/HAP334.
The left hand gels show genotyping data from 96 ES cell clones
transfected with gRNA, human Cas9 nuclease and either a circular
targeting vector (plate 1) or a linear targeting vector (Plate 2).
The right hand side gels shows 96 ES cell clones transfected with
gRNA and either a circular targeting vector (plate 3) or a linear
targeting vector (Plate 4) but with no human Cas9 nuclease. The
percentage of the clones correctly targeted is shown for each
transfection.
[0154] FIG. 9: Schematic showing the position of the gRNAs on a
gene to allow for a define deletion of the region in between the
two gRNA. The oligo pair primer 1 and 2 was used to detect ES
clones containing the specific 55 bp deletion.
[0155] FIG. 10: A 3% agarose gel containing PCR products amplified
from 96 ES clones transfected with gRNA 1 and 2. Primers 1 and 2
was used to amplify around the two gRNA and any clones containing
the define deletion can be seen as a smaller PCR product, which are
highlighted by an asterix.
[0156] FIG. 11: PCR genotyping by amplifying the 5' (top gel) and
3' (bottom gel) targeted homology arms within the Rosa26 gene
located on chromosome 6. Correctly targeted clones yielding PCR
product for both 5' and 3' junctions are marked with an
asterix.
[0157] FIG. 12: Genotyping for the correct insertion of the Cas9
DNA cassette by PCR amplifying the 5' (top gel) and 3' (bottom gel)
arm of the inserted DNA cassette.
[0158] FIG. 13: PCR genotyping by amplifying the region around the
guide RNA and assessing the PCR product for the presence of indels.
Larger indels can be seen directly from the gel as they yielded PCR
product shorter than the expected WT DNA suggesting significant
deletion. For the positive control, genomic DNA from mouse AB2.1
was used to size the corresponding WT PCR product. The negative
control was a no DNA water control.
[0159] FIG. 14: PCR amplification of the region flanking the guide
RNA using DNA extracted from pups following zygote Cas9/guide mRNA
injection for analysing indel formation. Lane 14 shows a gross
deletion in that mouse and those lanes marked with an asterix
indicate these mice contain smaller indels.
[0160] FIG. 15: Summary of the sequencing data from the 8 mice
analysed and the details of the indels detected are shown. The
number refers to the frequency of that particular indel identified
in the clones analysed and the description of the indels are shown
in brackets.
DETAILED DESCRIPTION OF THE INVENTION
[0161] The inventors addressed the need for improved nucleic acid
modification techniques. An example of a technique for nucleic acid
modification is the application of the CRISPR/Cas system. This
system has been shown thus far to be the most advanced genome
editing system available due, inter alia, to its broad application,
the relative speed at which genomes can be edited to create
mutations and its ease of use. The inventors, however, believed
that this technology can be advanced for even broader applications
than are apparent from the state of the art.
[0162] The inventors realised that an important aspect to achieve
this would be to find a way of improving the fidelity of nucleic
acid modifications beyond that contemplated by the CRISPR/Cas
methods known in the art.
[0163] Additionally, the inventors realised that only modest
nucleic acid modifications had been reported to date. It would be
desirable to effect relatively large predefined and precise DNA
deletions or insertions using the CRISPR/Cas system.
[0164] The inventors have devised an approach for introducing one
or more desired insertions and/or deletions of known sizes into one
or more predefined locations in a nucleic acid (e.g., in a cell or
organism genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (e.g., produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques.
[0165] To this end, the invention provides:--
[0166] A method of nucleic acid recombination, the method
comprising providing double stranded DNA (dsDNA) comprising first
and second strands and
(a) using nucleic acid cleavage to create 5' and 3' cut ends in the
first strand; and (b) using homologous recombination to insert a
nucleotide sequence between the ends, thereby producing a modified
first strand; thereby producing DNA wherein the first strand has
been modified by said recombination but the second strand has not
been modified.
[0167] Optionally, the method further comprises replicating the
modified first strand to produce a progeny dsDNA wherein each
strand thereof comprises a copy of the insert nucleotide sequence.
Optionally, the method comprises (c) isolating the progeny dsDNA,
e.g., by obtaining a cell containing said progeny dsDNA.
Replication can be effected, for example in a cell. For example,
steps (a) and (b) are carried out in a cell and the cell is
replicated, wherein the machinery of the cell replicates the
modified first strand, e.g., to produce a dsDNA progeny in which
each strand comprises the modification.
[0168] Optionally, in any configuration, aspect, example or
embodiment of the invention, the modified DNA strand resulting from
step (b) is isolated.
[0169] Optionally, in any configuration, aspect, example or
embodiment of the invention, the method is carried out in vitro.
For example, the method is carried out in a cell or cell population
in vitro.
[0170] Alternatively, optionally, in any configuration, aspect,
example or embodiment of the invention, the method is carried out
to modify the genome of a virus.
[0171] Alternatively, optionally, in any configuration, aspect,
example or embodiment of the invention, the method is carried out
in vivo in an organism. In an example, the organism is a non-human
organism. In an example, it is a plant or an animal or an insect or
a bacterium or a yeast. For example, the method is practised on a
vertebrate (e.g., a human patient or a non-human vertebrate (e.g.,
a bird, e.g., a chicken) or non-human mammal such as a mouse, a rat
or a rabbit).
[0172] Optionally, in any configuration, aspect, example or
embodiment of the invention, the method is a method of cosmetic
treatment of a human or a non-therapeutic, non-surgical,
non-diagnostic method, e.g., practised on a human or a non-human
vertebrate or mammal (e.g., a mouse or a rat).
[0173] The Invention Also Provides:--
[0174] A method of nucleic acid recombination, the method
comprising
(a) using nucleic acid cleavage to create 5' and 3' cut ends in a
single nucleic acid strand; (b) using homologous recombination to
insert a nucleotide sequence between the ends, wherein the insert
sequence comprises a regulatory element or encodes all or part of a
protein; and (c) Optionally obtaining the nucleic acid strand
modified in step (b) or a progeny nucleic strand comprising the
inserted nucleotide sequence, e.g., by obtaining a cell containing
said progeny nucleic acid strand.
[0175] In an example the progeny strand is a product of the
replication of the strand produced by step (b). The progeny strand
is, for example, produced by nucleic acid replication in a cell.
For example, steps (a) and (b) are carried out in a cell and the
cell is replicated, wherein the machinery of the cell replicates
the modified strand produced in step (b), e.g., to produce a dsDNA
progeny in which each strand comprises the modification.
[0176] In an example, the single nucleic acid strand is a DNA or
RNA strand.
[0177] In an example, the regulatory element is a promoter or
enhancer.
[0178] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence is a
plant, animal, vertebrate or mammalian sequence, e.g., a human
sequence. For example, the sequence encodes a complete protein,
polypeptide, peptide, domain or a plurality (e.g. one, two or more)
of any one of these. In an example, the inserted sequence confers a
resistance property to a cell comprising the modified nucleic acid
produced by the method of the invention (e.g., herbicide, viral or
bacterial resistance). In an example, the inserted sequence encodes
an interleukin, receptor (e.g., a cell surface receptor), growth
factor, hormone, antibody (or variable domain or binding site
thereof), antagonist, agonist; e.g., a human version of any of
these. In an example, the inserted sequence is an exon.
[0179] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence
replaces an orthologous or homologous sequence of the strand (e.g.,
the insert is a human sequence that replaces a plant, human or
mouse sequence). For example, the method is carried out in a mouse
or mouse cell (such as an ES cell) and the insert replaces an
orthologous or homologous mouse sequence (e.g., a mouse biological
target protein implicated in disease). For example, the method is
carried out (e.g., in vitro) in a human cell and the insert
replaces an orthologous or homologous human sequence (e.g., a human
biological target protein implicated in disease, e.g., a mutated
form of a sequence is replaced with a different (e.g., wild-type)
human sequence, which may be useful for correcting a gene defect in
the cell. In this embodiment, the cell may be a human ES or iPS or
totipotent or pluripotent stem cell and may be subsequently
introduced into a human patient in a method of gene therapy to
treat and/or prevent a medical disease or condition in the
patient).
[0180] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence is at
least 10 nucleotides long, e.g., at least 20, 30, 40, 50, 60, 70,
80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900
nucleotides, or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.
[0181] Optionally, in any configuration, aspect, example or
embodiment of the invention, the insert sequence comprises a site
specific recombination site, e.g., a lox, frt or rox site. For
example, the site can be a loxP, lox511 or lox2272 site.
[0182] The Invention Also Provides:--
[0183] A method of nucleic acid recombination, the method
comprising
(a) using nucleic acid cleavage to create first and second breaks
in a nucleic acid strand, thereby creating 5' and 3' cut ends and a
nucleotide sequence between the ends; (b) using homologous
recombination to delete the nucleotide sequence; and (c) optionally
obtaining the nucleic acid strand modified in step (b) or a progeny
nucleic strand comprising the deletion.
[0184] In an example, the progeny strand is a product of the
replication of the strand produced by step (b). The progeny strand
is, for example, produced by nucleic acid replication in a cell.
For example, steps (a) and (b) are carried out in a cell and the
cell is replicated, wherein the machinery of the cell replicates
the modified strand produced in step (b), e.g., to produce a dsDNA
progeny in which each strand comprises the modification.
[0185] In an example, the single nucleic acid strand is a DNA or
RNA strand.
[0186] In an example, the deleted sequence comprises a regulatory
element or encodes all or part of a protein. In an embodiment, the
deleted regulatory element is a promoter or enhancer.
[0187] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is a
plant, animal, vertebrate or mammalian sequence, e.g., a human
sequence. For example, the sequence encodes a complete protein,
polypeptide, peptide, domain or a plurality (e.g. one, two or more)
of any one of these. In an example, the deleted sequence encodes an
interleukin, receptor (e.g., a cell surface receptor), growth
factor, hormone, antibody (or variable domain or binding site
thereof), antagonist, agonist; e.g., a non-human version of any of
these. In an example, the deleted sequence is an exon.
[0188] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is
replaced by an orthologous or homologous sequence of a different
species or strain (e.g., a human sequence replaces an orthologous
or homologous plant, human or mouse sequence). For example, the
method is carried out in a mouse or mouse cell and the insert
replaces an orthologous or homologous mouse sequence (e.g., a mouse
biological target protein implicated in disease). For example, the
method is carried out (e.g., in vitro) in a human cell and the
insert replaces an orthologous or homologous human sequence (e.g.,
a human biological target protein implicated in disease, e.g., a
mutated form of a sequence is replaced with a different (e.g.,
wild-type) human sequence, which may be useful for correcting a
gene defect in the cell. In this embodiment, the cell may be a
human ES or iPS or totipotent or pluripotent stem cell and may be
subsequently introduced into a human patient in a method of gene
therapy to treat and/or prevent a medical disease or condition in
the patient).
[0189] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is at
least 10 nucleotides long, e.g., at least 20, 30, 40, 50, 60, 70,
80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900
nucleotides, or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.
[0190] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (c) is performed by isolating a
cell comprising the modified first strand, or by obtaining a
non-human vertebrate in which the method has been performed or a
progeny thereof.
[0191] Optionally, in any configuration, aspect, example or
embodiment of the invention, the product of the method comprises a
nucleic acid strand comprising a PAM motif 3' of the insertion or
deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5,
4 or 3 nucleotides of the insertion or deletion. This is useful to
enable serial insertions and/or deletions according to the method
as explained further below.
[0192] Optionally, in any configuration, aspect, example or
embodiment of the invention, the product of the method comprises a
nucleic acid strand comprising a PAM motif 5' of the insertion or
deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5,
4 or 3 nucleotides of the insertion or deletion. This is useful to
enable serial insertions and/or deletions according to the method
as explained further below.
[0193] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (b) is performed by carrying out
homologous recombination between an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end. The skilled person will be familiar with constructing
vectors and DNA molecules for use in homologous recombination,
including considerations such as homology arm size and sequence and
the inclusion of selection markers between the arms. For example,
the incoming nucleic acid comprises first and second homology arms,
and the insert sequence and an optional selection marker sequence
(e.g., neo nucleotide sequence). The arms may be at least 20, 30,
40, 50, 100 or 150 nucleotides in length, for example. Where
deletion is required, the insert is omitted (although an optional
selection marker sequence may or may not be included between the
arms).
[0194] Thus, in an embodiment of the invention, step (b) is
performed by carrying out homologous recombination between an
incoming nucleic acid comprising an insert nucleotide sequence
flanked by the first and second homology arms, wherein the insert
nucleotide sequence is inserted between the 5' and 3' ends.
[0195] In another embodiment of the invention, the insert is
between the homology arms and there is no further sequence between
the arms.
[0196] In an example, each homology arm is at least 20, 30, 40, 50,
100 or 150 nucleotides long.
[0197] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out using an
endonuclease, e.g., a nickase. Nickases cut in a single strand of
dsDNA only. For example, the endonuclease is an endonuclease of a
CRISPR/Cas system, e.g., a Cas9 or Cys4 endonuclease (e.g., a Cas9
or Cys4 nickase). In an example, the endonuclease recognises a PAM
listed in Table 1 below, for example, the endonuclease is a Cas
endonuclease that recognises a PAM selected from CCN, TCN, TTC,
AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA. In an
example, the Cas endonuclease is a S pyogenes endonuclease, e.g., a
S pyogenes Cas9 endonuclease. In an example, a S. pyogenes PAM
sequence or Streptococcus thermophilus LMD-9 PAM sequence is
used.
[0198] In an example, the endonuclease is a Group 1 Cas
endonuclease. In an example, the endonuclease is a Group 2 Cas
endonuclease. In an example, the endonuclease is a Group 3 Cas
endonuclease. In an example, the endonuclease is a Group 4 Cas
endonuclease. In an example, the endonuclease is a Group 7 Cas
endonuclease. In an example, the endonuclease is a Group 10 Cas
endonuclease.
[0199] In an example, the endonuclease recognises a CRISPR/Cas
Group 1 PAM. In an example, the endonuclease recognises a
CRISPR/Cas Group 2 PAM. In an example, the endonuclease recognises
a CRISPR/Cas Group 3 PAM. In an example, the endonuclease
recognises a CRISPR/Cas Group 4 PAM. In an example, the
endonuclease recognises a CRISPR/Cas Group 7 PAM. In an example,
the endonuclease recognises a CRISPR/Cas Group 10 PAM.
[0200] In an example, Cas endonuclease-mediated cleavage is used in
step (a); optionally by recognition of a GG or NGG PAM motif.
[0201] In an example, the first and/or second homology arm
comprises a PAM motif. This is useful to enable serial insertions
and/or deletions according to the method as explained further
below.
[0202] An example of a suitable nickase is S pyogenes Cas9 D10A
nickase (see Cong et al. and the Examples section below).
[0203] Optionally, in any configuration, aspect, example or
embodiment of the invention, steps (a) and (b) of the method is
carried out in a cell, e.g. a bacterial, yeast, eukaryotic cell,
plant, animal, mammal, vertebrate, non-human animal, rodent, rat,
mouse, rabbit, fish, bird or chicken cell. For example, the cell is
an E coli cell or CHO or HEK293 or Picchia or Saccharomyes cell. In
an example, the cell is a human cell in vitro. In one embodiment,
the cell is an embryonic stem cell (ES cell, e.g., a human or
non-human ES cell, such as a mouse ES cell) or an induced
pluripotent stem cell (iPS cell; e.g., a human, rodent, rat or
mouse iPS cell) or a pluripotent or totipotent cell. Optionally,
the cell is not an embryonic cell, e.g. wherein the cell is not a
human embryonic cell. Optionally, the cell is not a pluripotent or
totipotent cell. In an example, the method is used to produce a
human stem cell for human therapy (e.g., an iPS cell generated from
a cell of a patient for reintroduction into the patient after the
method of the invention has been performed on the cell), wherein
the stem cell comprises a nucleotide sequence or gene sequence
inserted by the method of the invention. The features of the
examples in this paragraph can be combined.
[0204] In an example, the method is carried out in a mammalian
cell. For example, the cell is a human cell in vitro or a non-human
mammalian cell. For example, a non-human (e.g., rodent, rat or
mouse) zygote. For example, a single-cell non-human zygote.
[0205] In an example, the method is carried out in a plant or
non-human mammal, e.g. a rodent, mouse or rat or rabbit, or a
tissue or organ thereof (e.g., in vitro).
[0206] In an example, the 3' or each cleavage site is flanked 3' by
PAM motif (e.g., a motif disclosed herein, such as NGG or NGGNG
sequence, wherein N is any base and G is a guanine). For example,
one or more or all cleavage sites are flanked 3' by the sequence
5'-TGGTG-3'. Unlike dsDNA, the PAM is not absolutely required for
ssDNA binding and cleavage: A single-stranded oligodeoxynucleotide
containing a protospacer with or without a PAM sequence is bound
nearly as well as dsDNA and may be used in the invention wherein a
single strand of DNA is modified. Moreover, in the presence of
Mg.sup.2+ ions, Cas9 cuts ssDNA bound to the crRNA using its HNH
active site independently of PAM.
[0207] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by cleavage in
one single strand of dsDNA or in ssDNA.
[0208] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by combining
in a cell the nucleic acid strand, a Cas endonuclease, a crRNA and
a tracrRNA (e.g., provided by one or more gRNAs) for targeting the
endonuclease to carry out the cleavage, and optionally an insert
sequence for homologous recombination with the nucleic acid strand.
Instead of an insert sequence, one can use an incoming sequence
containing homology arms but no insert sequence, to effect deletion
as described above. In an example, the Cas endonuclease is encoded
by a nucleotide sequence that has been introduced into the cell. In
an example, the gRNA is encoded by a DNA sequence that has been
introduced into the cell.
[0209] In an example, the method is carried out in the presence of
Mg.sup.2+.
[0210] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (b) is performed by carrying out
homologous recombination with an incoming nucleic acid comprising
first and second homology arms, wherein the homology arms are
substantially homologous respectively to a sequence extending 5'
from the 5' end and a sequence extending 3' from the 3' end,
wherein the second homology arm comprises a PAM sequence such that
homologous recombination between the second homology arm and the
sequence extending 3' from the 3' end produces a sequence
comprising a PAM motif in the product of the method. The PAM can be
any PAM sequence disclosed herein, for example. Thus, the method
produces a modified nucleic acid strand comprising a PAM that can
be used for a subsequent nucleic acid modification according to any
configuration, aspect, example or embodiment of the invention,
wherein a Cas endonuclease is used to cut the nucleic acid. This is
useful, for example, for performing sequential
endonuclease-mediated homology directed recombination (sEHDR)
according to the invention, more particularly sCHDR described
below.
Sequential Endonuclease-Mediated Homology Directed Recombination
(sEHDR)
The Invention Further Provides:--
[0211] A method of sequential endonuclease-mediated homology
directed recombination (sEHDR) comprising carrying out the method
of any preceding configuration, aspect, example or embodiment of
the invention a first time and a second time, wherein
endonuclease-mediated cleavage is used in each step (a); wherein
the product of the first time is used for endonuclease-mediated
cleavage the second time, whereby either (i) first and second
nucleotide sequences are deleted the first time and the second
times respectively; (ii) a first nucleotide sequence is deleted the
first time and a second nucleotide sequence is inserted the second
time; (iii) a first nucleotide sequence is inserted the first time
and a second nucleotide sequence is deleted the second time; or
(iv) first and second nucleotide sequences are inserted the first
and second times respectively; optionally wherein the nucleic acid
strand modification the second time is within 20, 10, 5, 4, 3, 2 or
1 or less nucleotides of the nucleic acid strand modification the
first time or directly adjacent to the nucleic acid strand
modification the first time.
[0212] For example, the first and second nucleotide sequences are
inserted so that they are contiguous after the insertion the second
time. Alternatively, the first and second deletions are such that a
contiguous sequence has been deleted after the first and second
deletions have been performed.
[0213] In an embodiment of sEHDR, the invention uses a Cas
endonuclease. Thus, there is provided:--
[0214] A method of sequential Cas-mediated homology directed
recombination (sCHDR) comprising carrying out the method of any
preceding claim a first time and a second time, wherein Cas
endonuclease-mediated cleavage is used in each step (a); wherein
step (b) of the first time is carried out performing homologous
recombination with an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the second
homology arm comprises a PAM sequence such that homologous
recombination between the second homology arm and the sequence
extending 3' from the 3' end produces a sequence comprising a PAM
motif in the product of the method, wherein the PAM motif of the
product of the first time is used for Cas endonuclease-mediated
cleavage the second time, whereby either (i) first and second
nucleotide sequences are deleted the first time and the second
times respectively; (ii) a first nucleotide sequence is deleted the
first time and a second nucleotide sequence is inserted the second
time; (iii) a first nucleotide sequence is inserted the first time
and a second nucleotide sequence is deleted the second time; or
(iv) first and second nucleotide sequences are inserted the first
and second times respectively: optionally wherein the nucleic acid
strand modification the second time is within 20, 10, 5, 4, 3, 2 or
1 or less nucleotides of the nucleic acid strand modification the
first time or directly adjacent to the nucleic acid strand
modification the first time.
[0215] For example, the first and second nucleotide sequences are
inserted so that they are contiguous after the insertion the second
time. Alternatively, the first and second deletions are such that a
contiguous sequence has been deleted after the first and second
deletions have been performed.
[0216] In an embodiment (First Embodiment), the first time is
carried out according to the third configuration of the invention,
wherein the incoming nucleic acid comprises no sequence between the
first and second homology arms, wherein sequence between the 5' and
3' ends is deleted by homologous recombination; and/or the second
time is carried out according to the third configuration of the
invention, wherein step (b) is performed by carrying out homologous
recombination between an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the incoming
nucleic acid comprises no sequence between the first and second
homology arms such that sequence between the 5' and 3' ends is
deleted by homologous recombination; optionally wherein the second
arm comprises a PAM motif such that the product of the second time
comprises a PAM motif for use in a subsequent Cas
endonuclease-mediated method according to any configuration,
aspect, example or embodiment of the invention.
[0217] In an embodiment (Second Embodiment), the first time is
carried out according to the first or second configuration of the
invention, wherein the incoming nucleic acid comprises the insert
sequence between the first and second homology arms, wherein the
insert sequence is inserted between the 5' and 3' ends by
homologous recombination; and/or the second time is carried out
according to the first or second configuration of the invention,
wherein step (b) is performed by carrying out homologous
recombination between an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the insert
sequence is inserted between the 5' and 3' ends by homologous
recombination, optionally wherein the second arm comprises a PAM
motif such that the product of the second time comprises a PAM
motif for use in a subsequent Cas endonuclease-mediated method
according to any configuration, aspect, example or embodiment of
the invention.
[0218] In an example, one of said first and second times is carried
out as specified in the First Embodiment and the other time is
carried out as specified in the Second Embodiment, wherein at least
one sequence deletion and at least one sequence insertion is
performed.
[0219] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by Cas
endonuclease-mediated cleavage using a Cas endonuclease, one or
more crRNAs and a tracrRNA. For example, the method is carried out
in a cell and the crRNA and tracrRNA is introduced into the cell as
RNA molecules. For example, the method is carried out in a zygote
(e.g., a non-human zygote, e.g., a rodent, rat or mouse zygote) and
the crRNA and tracrRNA is injected into zygote. In another
embodiment, the crRNA and tracrRNA are encoded by DNA within a cell
or organism and are transcribed inside the cell (e.g., an ES cell,
e.g., a non-human ES cell, e.g., a rodent, rat or mouse ES cell) or
organism to produce the crRNA and tracrRNA. The organism is, for
example, a non-human animal or plant or bacterium or yeast or
insect. In an embodiment, the tracrRNA is in this way encoded by
DNA but one or more crRNAs are introduced as RNA nucleic acid into
the cell or organism to effect the method of the invention.
[0220] Additionally or alternatively to these examples, the
endonuclease may be introduced as a protein or a vector encoding
the endonuclease may be introduced into the cell or organism to
effect the method of the invention. In another example, the
endonuclease is encoded by DNA that is genomically integrated into
the cell or organism and is transcribed and translated inside the
cell or organism.
[0221] In an example, the method of the invention is carried out in
an ES cell (e.g., a non-human ES cell, e.g., a rodent, rat or mouse
ES cell) that has been pre-engineered to comprise an expressible
genomically-integrated Cas endonuclease sequence (or a vector
carrying this has been include in the cell). It would be possible
to introduce (or encode) a tracrRNA. By introducing a crRNA with a
guiding oligo sequence to target the desired area of the cell
genome, one can then carry out modifications in the cell genome as
per the invention. In an example, a gRNA as described herein is
introduced into the ES cell. The genomically-integrated expressible
Cas endonuclease sequence can, for example, be constitutively
expressed or inducibly expressible. Alternatively or additionally,
the sequence may be expressible in a tissue-specific manner in a
progeny organism (e.g., a rodent) developed using the ES cell.
[0222] The initial ES cell comprising a genomically-integrated
expressible Cas endonuclease sequence can be used, via standard
techniques, to produce a progeny non-human animal that contains the
expressible Cas endonuclease sequence. Thus, the invention
provides:--
[0223] A non-human animal (e.g., a vertebrate, mammal, fish or
bird), animal cell, insect, insect cell, plant or plant cell
comprising a genomically-integrated expressible Cas endonuclease
nucleotide sequence and optionally a tracrRNA and/or a nucleotide
sequence encoding a tracrRNA. The Cas endonuclease is, for example,
Cas9 or Cys4. In an example, the animal, insect or plant genome
comprises a chromosomal DNA sequence flanked by site-specific
recombination sites and/or transposon elements (e.g., piggyBac
transposon repeat elements), wherein the sequence encodes the
endonuclease and optionally one or more gRNAs. As described in the
Examples below, recombinase-mediated cassette exchange (RMCE) can
be used to insert such a sequence. The transposon elements can be
used to excise the sequence from the genome once the endonuclease
has been used to perform recombination. The RMCE and/or
transposon-mediated excision can be performed in a cell (e.g., an
ES cell) that later is used to derive a progeny animal or plant
comprising the desired genomic modification.
[0224] The invention also provides an ES cell derived or derivable
from such an animal, wherein the ES cell comprises a
genomically-integrated expressible Cas endonuclease nucleotide
sequence. In an example, the ES cell is a rodent, e.g., a mouse or
rat ES cell, or is a rabbit, dog, pig, cat, cow, non-human primate,
fish, amphibian or bird ES cell.
[0225] The invention also provides a method of isolating an ES
cell, the method comprising deriving an ES cell from an animal
(e.g., a non-human animal, e.g., a rodent, e.g., a rat or a mouse),
wherein the animal comprises a genomically-integrated expressible
Cas endonuclease nucleotide sequence, as described herein.
[0226] In any of these aspects, instead of an ES cell, the cell may
be an iPS cell or a totipotent or pluripotent cell. Thus, an iPS or
stem cell can be derived from (e.g., a somatic cell of) a human,
engineered in vitro to comprise a genomically-integrated
expressible Cas endonuclease nucleotide sequence and optionally one
or more DNA sequences encoding a tracrRNA or gRNA. The invention,
thus, also relates to such a method and to a human iPS or stem cell
comprising a genomically-integrated expressible Cas endonuclease
nucleotide sequence and optionally one or more DNA sequences
encoding a tracrRNA or gRNA. This cell can be used in a method of
the invention to carry out genome modification (e.g., to correct a
genetic defect, e.g., by replacement of defective sequence with a
desired sequence, optionally with subsequent transposon-mediated
excision of the endonuclease-encoding sequence). After optional
excision of the Cas endonuclease sequence, the iPS cell or stem
cell can be introduced into the donor human (or a different human,
e.g., a genetic relative thereof) to carry out genetic therapy or
prophylaxis. In the alternative, a totipotent or pluripotent human
cell is used and then subsequently developed into human tissue or
an organ or part thereof. This is useful for providing material for
human therapy or prophylaxis or for producing assay materials
(e.g., for implantation into model non-human animals) or for use in
in vitro testing (e.g., of drugs).
[0227] In an example, the method uses a single guided RNA (gRNA or
sgRNA) comprising a crRNA and a tracrRNA. The crRNA comprises an
oligonucleotide sequence ("X" in the structure 5'-X-Y-3' mentioned
below) that is chosen to target a desired part of the nucleic acid
or genome to be modified. The skilled person will be able readily
to select appropriate oligo sequence(s). In an example, the
sequence is from 3 to 100 nucleotides long, e.g., from 3 to 50, 40,
30, 25, 20, 15 or 10 nucleotides long, e.g., from or 5, 10, 15 or
20 to 100 nucleotides long, e.g., from 5, 10, 15 or 20 to 50
nucleotides long.
[0228] For example, the gRNA is a single nucleic acid comprising
both the crRNA and the tracrRNA. An example of a gRNA comprises the
sequence 5'-[oligo]-[UUUUAGAGCUA (S
N1UUUUAN2N3GCUA)]-[LINKER]-[UAGCAAGUUAAAA (SEQ ID NO:2)]-3',
wherein the LINKER comprises a plurality (e.g., 4 or more, e.g., 4,
5 or 6) nucleotides (e.g., 5'-GAAA-3').
[0229] For example, the crRNA has the structure 5'-X-Y-3', wherein
X is an RNA nucleotide sequence (optionally, at least 5 nucleotides
long) and Y is a crRNA sequence comprising a nucleotide motif that
hybridises with a motif comprised by the tracrRNA, wherein X is
capable of hybridising with a nucleotide sequence 5' of the desired
site of the 5' cut end, e.g., extending 5' from the desired site of
the 5' cut.
[0230] In an example, Y is 5'-N1UUUUAN2N3GCUA-3' (SEQ ID NO:3),
wherein each of N1-3 is a A, U, C or G and/or the tracrRNA
comprises the sequence (in 5' to 3' orientation) UAGCM1UUAAAAM2
(SEQ ID NO:4), wherein M1 is spacer nucleotide sequence and M2 is a
nucleotide; e.g., N1-G, N2=G and N3=A. The spacer sequence is,
e.g., 5, 4, 3, 2 or 1 RNA nucleotides in length (e.g., AAG in 5' to
3' orientation). M2 is, for example, an A, U, C or G (e.g., M2 is a
G). In an embodiment, a chimaeric gRNA is used which comprises a
sequence 5'-X-Y-Z-3', wherein X and Y are as defined above and Z is
a tracrRNA comprising the sequence (in 5' to 3' orientation)
UAGCM1UUAAAAM2 (SEQ ID NO:4), wherein M1 is spacer nucleotide
sequence and M2 is a nucleotide. In an example, Z comprises the
sequence 5'-UAGCAAGUUAAAA-3' (SEQ ID NO:2), e.g., Z is
5'-UAGCAAGUUAAAAUAAGGCUAGUCCG-3' (SEQ ID NO:5). In an example, the
gRNA has the sequence:
TABLE-US-00001 (SEQ ID NO: 6)
5'-GUUUUAGAGGUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUA
UCAACUUGAAAAAGUGGCACCGAGUCGGUGC-3'
[0231] When it is desired to use the present invention to insert an
exogenous sequence into the nucleic acid to be modified, the
exogenous sequence can be provided on linear or circular nucleic
acid (e.g., DNA). Typically, the exogenous sequence is flanked by
homology arms that can undergo homologous recombination with
sequences 5' and 3' respectively of the site where the exogenous
sequence is to be inserted. The skilled person is familiar with
choosing homology arms for homologous recombination.
[0232] The invention can be used in a method of producing a
transgenic organism, e.g., any organism recited herein. For
example, the organism can be a non-human organism used as an assay
model to test a pharmaceutical drug or to express an exogenous
protein or a part thereof (e.g., a human protein target knocked-in
into a non-human animal assay organism). In another example, the
invention has been used to knock-out an endogenous sequence (e.g.,
a target protein) in an organism, such as a non-human organism.
This can be useful to assess the effect (phenotype) of the
knock-out and thus to assess potential drug targets or proteins
implicated in disease. In one example, the organism is a non-human
animal (e.g., a vertebrate, mammal, bird, fish, rodent, mouse, rat
or rabbit) in which a human target protein has been knocked-in
using the invention. Optionally, the invention has been used to
knock out an orthologous or homologous endogenous target of the
organism (e.g., an endogenous target sequence has been replaced at
the endogenous position by an orthologous or homologous human
target sequence). In this way, an assay model can be produced for
testing pharmaceutical drugs that act via the human target.
[0233] In an embodiment, the organism is a non-human vertebrate
that expresses human antibody variable regions whose genome
comprises a replacement of an endogenous target with an orthologous
or homologous human sequence. In an example, the method of the
invention is used to produce an Antibody-Generating Vertebrate or
Assay Vertebrate as disclosed in WO2013061078, the disclosure of
which, and specifically including the disclosure of such
Vertebrates, their composition, manufacture and use, is included
specifically herein by reference as though herein reproduced in its
entirety and for providing basis for claims herein.
[0234] The antibodies described herein can be of any format
provided that they comprise human variable regions. For example,
the present invention is applicable to of 4-chain antibodies, where
the antibodies each contain 2 heavy chains and 2 light chains.
Alternatively, the invention can be applied to H2 antibodies (heavy
chain antibodies) bearing human V regions and which are devoid of
CH1 and light chains (equivalent in respects to Camelid H2
antibodies: see, eg, Nature. 1993 Jun. 3; 363(6428):446-8;
Naturally occurring antibodies devoid of light chains,
Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers
C, Songa E B, Bendahman N, Hamers R). These antibodies function to
specifically bind antigen, such antibodies being akin to those
found in the blood of Camelidae (eg, llamas, camels, alpacas). Such
antibodies with human VH pairs can be synthetically produced to
provide therapeutic and prophylactic medicaments (eg, see
WO1994004678, WO2004041862, WO2004041863). Transgenic mice also can
produce such heavy chain antibodies and the in vivo production of
the antibodies allows the mouse's immune system to select for human
VH-VH pairings, sometimes selecting for such pairings in which
mutations have been introduced in vivo by the mouse to accommodate
the pairing (W02010109165A2). Thus, in an embodiment of the present
invention, the heavy chain transgene is devoid of a CH1 gene
segment and the genome comprises no functional antibody light chain
locus. Alternatively, the test antibody is an antibody fragment,
eg, Fab or Fab2, which comprises a constant region and human
variable regions.
[0235] The test antibody is isolated from a first transgenic
non-human vertebrate (eg, a mouse or rat) (Antibody-Generating
Vertebrate) following immunisation with an antigen bearing said
human epitope. The skilled person will be familiar with routine
methods and protocols for immunising with antigen, eg, using prime
and boost immunisation protocols. A suitable protocol is RIMMS (see
Hybridoma 1997 August; 16(4):381-9; "Rapid development of affinity
matured monoclonal antibodies using RIMMS"; Kilpatrick et al). The
Antibody-Generating Vertebrate comprises one or more transgenic
antibody loci encoding said variable regions. Suitable non-human
vertebrates (eg, mice or rats) are known in the art, and by way of
example reference is made to W02011004192, U57501552, U.S. Pat. No.
6,673,986, U56130364, W02009/076464 and U56586251, the disclosures
of which are incorporated herein by reference in their
entirety.
[0236] The transgenic vertebrate has an immune system comprising
proteins encoded by an immune gene repertoire (eg, an endogenous
immune gene repertoire), said immune gene repertoire comprising
said transgenic antibody loci and genes for immune system function
(eg, providing an immune response to immunisation of the
Antibody-Generating Vertebrate to the human target epitope). In one
embodiment, the immune gene repertoire is an endogenous immune gene
repertoire (ie, endogenous to the strain of non-human vertebrate
used). For example, when the Antibody-Generating Vertebrate is a
mouse having a genetic background of a mouse strain or cell
selected from 129, C57B/6N, C57BL/6J, JM8, AB2.1, AB2.2, 12955,
12957 or 1295v, the mouse has an immune gene repertoire provided by
said genetic background and said transgenic antibody loci. Thus,
the skilled person can choose the appropriate starting strain, cell
or species (eg, the same cell line or cells separated by no more
than 5, 4, 3, 2 or 1 generation) for generating both the
Antibody-Generating Vertebrate and Assay Vertebrate, and in doing
so the desired immune gene repertoire is provided for both
Vertebrates. In one embodiment, the immune gene repertoire is that
of a wild-type 129, C57BL/6, B6 or other mouse strain or mouse cell
disclosed herein, with the exception that the mouse genome
comprises a transgenic IgH locus (optionally in homozygous state)
comprising a human variable region (with human VH, D and JH gene
segments) operatively connected upstream of (5' of) a mouse
constant region and optionally endogenous mouse heavy chain
expression is inactive. In an example, the genome also comprises a
transgenic Igk locus (optionally in homozygous state) comprising a
human variable region (with human VK and JK gene segments)
operatively connected upstream of (5' of) a mouse constant region
and optionally endogenous mouse kappa chain expression is inactive.
In an example, the genome also comprises a transgenic IgX locus
(optionally in homozygous state) comprising a human variable region
(with human VX and JX gene segments) operatively connected upstream
of (5' of) a mouse constant region and optionally endogenous mouse
lambda chain expression is inactive. Thus, in one embodiment, the
vertebrate of the invention comprises a wild-type 129, C57BL, B6 or
other mouse strain genome with the exception that mouse heavy chain
(and kappa and/or lambda chain) expression has been inactivated,
the genome comprises said transgenic Ig loci and an endogenous
target knock-out (and optionally also a human target knock-in) as
per the invention. Thus, endogenous regulatory and control
mechanisms and proteins functional to produce and regulate immune
responses in the vertebrate are retained for production of
chimaeric antibody chains having human variable regions in response
to immunisation.
[0237] The method of the invention comprises the step of providing
a second transgenic non-human vertebrate (eg, mouse or rat) (Assay
Vertebrate) that is a modified version of said first transgenic
non-human vertebrate (ie, Antibody-Generating Vertebrate), wherein
the Assay Vertebrate comprises (i) An immune system comprising
substantially the same (or the same) immune gene repertoire as the
Antibody-Generating Vertebrate; (ii) A genome comprising a knock-in
of said human epitope, so that the Assay Vertebrate is capable of
expressing an antigen bearing said human epitope; and (iii)
Optionally wherein said genome has a knock-out of an endogenous
non-human vertebrate epitope that is an orthologue or homologue of
said human epitope, wherein said Assay Vertebrate cannot express an
antigen bearing said endogenous epitope.
[0238] In one aspect, the Antibody-Generating Vertebrate and Assay
Vertebrate genomes comprise said knock-out. This is useful, for
example, when the endogenous orthologue/homologue epitope or target
protein is structurally or epitopically similar to the human target
or epitope. By knocking-out the orthologue/homologue expression,
test antibodies of interest are generated only to the human
epitope/target that is injected into the Antibody-Generating
Vertebrate, and isolation of antibodies that are raised against the
rthologue/homologue (ie, wrong target) is avoided. Advantageously,
this target expression profile is reproduced in the Assay
Vertebrate when the orthologue/homologue is knocked-out in that
model too.
[0239] Thus, in an embodiment, the Antibody-Generating Vertebrate
has a knock-out of the epitope that is an orthologue or homologue
of said human epitope. Additionally or alternatively, in an
embodiment, the Assay Vertebrate has a knock-out of the epitope
that is an orthologue or homologue of said human epitope.
[0240] In one example, the Antibody-Generating Vertebrate comprises
(a) A heavy chain locus comprising one or more human heavy chain V
gene segments, one or more human heavy chain D gene segments and
one or more human heavy chain JH gene segments upstream of an
endogenous non-human vertebrate (eg, endogenous mouse or rat)
constant region (eg, Cmu and/or Cgamma); (b) A kappa light chain
locus comprising one or more human kappa chain V gene segments, and
one or more human kappa chain Jk gene segments upstream of an
endogenous non-human vertebrate (eg, endogenous mouse or rat) kappa
constant region; and optionally (c) A lambda light chain locus
comprising one or more human lambda chain V gene segments, and one
or more human lambda chain JX gene segments upstream of a lambda
constant region; and (d) Wherein the Vertebrate is capable of
producing chimaeric test antibodies following rearrangement of said
loci and immunisation with the human epitope or target.
[0241] Techniques for constructing non-human vertebrates and
vertebrate cells whose genomes comprise a transgene, eg, a
transgenic antibody locus containing human V, J and optionally D
regions are well known in the art. For example, reference is made
to W02011004192, U.S. Pat. No. 7,501,552, U.S. Pat. No. 6,673,986,
U.S. Pat. No. 6,130,364, W02009/076464 and U.S. Pat. No. 6,586,251,
the disclosures of which are incorporated herein by reference in
their entirety.
[0242] In one aspect the transgenic antibody loci comprise human V,
D and/or J coding regions placed under control of the host
regulatory sequences or other (non-human, non-host) sequences. In
one aspect reference to human V, D and/or J coding regions includes
both human introns and exons, or in another aspect simply exons and
no introns, which may be in the form of cDNA.
[0243] The host non-human vertebrate constant region herein is
optionally the endogenous host wild-type constant region located at
the wild type locus, as appropriate for the heavy or light chain.
For example, the human heavy chain DNA is suitably inserted on
mouse chromosome 12, suitably adjacent the mouse heavy chain
constant region, where the vertebrate is a mouse.
[0244] In one optional aspect where the Vertebrate is a mouse, the
insertion of the human antibody gene DNA, such as the human VDJ
region is targeted to the region between the J4 exon and the C.mu.
locus in the mouse genome IgH locus, and in one aspect is inserted
between coordinates 114,667,1090 and 114,665,190, suitably at
coordinate 114,667,091. In one aspect the insertion of the human
antibody DNA, such as the human light chain kappa V . . . 1 is
targeted into mouse chromosome 6 between coordinates 70,673,899 and
70,675,515, suitably at position 70,674,734, or an equivalent
position in the lambda mouse locus on chromosome 16.
[0245] In one aspect the host non-human vertebrate constant region
for forming the chimaeric antibody may be at a different (non
endogenous) chromosomal locus. In this case the inserted human
antibody DNA, such as the human variable VDJ or V. Iregion(s) may
then be inserted into the non-human genome at a site which is
distinct from that of the naturally occurring heavy or light
constant region. The native constant region may be inserted into
the genome, or duplicated within the genome, at a different
chromosomal locus to the native position, such that it is in a
functional arrangement with the human variable region such that
chimaeric antibodies of the invention can still be produced.
[0246] In one aspect the human antibody DNA is inserted at the
endogenous host wild-type constant region located at the wild type
locus between the host constant region and the host VDJ region.
[0247] In one aspect the inserted human IgH VDJ region comprises,
in germline configuration, all of the V, D and J regions and
intervening sequences from a human. Optionally, non-functional V
and/or D and/or J gene segments are omitted. For example, VH which
are inverted or are pseudogenes may be omitted.
[0248] In one aspect 800-1000 kb of the human IgH VDJ region is
inserted into the non-human vertebrate IgH locus, and in one aspect
a 940, 950 or 960 kb fragment is inserted. Suitably this includes
bases 105,400,051 to 106,368,585 from human chromosome 14 (all
coordinates refer to NCBI36 for the human genome, ENSEMBL Release
54 and NCBIM37 for the mouse genome, relating to mouse strain
C57BL/6J).
[0249] In one aspect the inserted IgH human fragment consists of
bases 105,400,051 to 106,368,585 from chromosome 14. In one aspect
the inserted human heavy chain DNA, such as DNA consisting of bases
105,400,051 to 106,368,585 from chromosome 14, is inserted into
mouse chromosome 12 between the end of the mouse J4 region and the
Eli region, suitably between coordinates 114,667,091 and
114,665,190, suitably at coordinate 114,667,091.
[0250] In one aspect the inserted human kappa V.1 region comprises,
in germline configuration, all of the V and J regions and
intervening sequences from a human. Optionally, non-functional V
and/or J gene segments are omitted. Suitably this includes bases
88,940,356 to 89,857,000 from human chromosome 2, suitably
approximately 917 kb. In a further aspect the light chain VJ insert
may comprise only the proximal clusters of V segments and J
segments. Such an insert would be of approximately 473 kb.
[0251] In one aspect the human light chain kappa DNA, such as the
human IgK fragment of bases 88,940,356 to 89,857,000 from human
chromosome 2, is suitably inserted into mouse chromosome 6 between
coordinates 70,673,899 and 70,675,515, suitably at position
70,674,734.
[0252] In one aspect the human lambda V.1 region comprises, in
germline configuration, all of the V and J regions and intervening
sequences from a human. Suitably this includes analogous bases to
those selected for the kappa fragment, from human chromosome 2.
Optionally, non-functional V and/or J gene segments are
omitted.
[0253] All specific human antibody fragments described herein may
vary in length, and may for example be longer or shorter than
defined as above, such as 500 bases, 1 KB, 2K, 3K, 4K, 5 KB, 10 KB,
20 KB, 30 KB, 40 KB or 50 KB or more, which suitably comprise all
or part of the human V(D)J region, whilst preferably retaining the
requirement for the final insert to comprise human genetic material
encoding the complete heavy chain region and light chain region, as
appropriate, as described herein.
[0254] In one aspect the 3' end of the last inserted human antibody
sequence, generally the last human J sequence, is inserted less
than 2 kb, preferably less than 1 KB from the human/non-human
vertebrate (eg, human/mouse or human/rat) join region.
[0255] Optionally, the genome is homozygous at one, or both, or all
three antibody loci (IgH, IgX and Igk).
[0256] In another aspect the genome may be heterozygous at one or
more of the antibody loci, such as heterozygous for DNA encoding a
chimaeric antibody chain and native (host cell) antibody chain. In
one aspect the genome may be heterozygous for DNA capable of
encoding 2 different antibody chains encoded by immunoglobulin
transgenes of the invention, for example, comprising 2 different
chimaeric heavy chains or 2 different chimaeric light chains.
[0257] In one embodiment in any configuration of the invention, the
genome of the Vertebrate has been modified to prevent or reduce the
expression of fully-endogenous antibody. Examples of suitable
techniques for doing this can be found in W02011004192, U.S. Pat.
No. 7,501,552, U.S. Pat. No. 6,673,986, U.S. Pat. No. 6,130,364,
W02009/076464, EP1399559 and U.S. Pat. No. 6,586,251, the
disclosures of which are incorporated herein by reference. In one
embodiment, the non-human vertebrate VDJ region of the endogenous
heavy chain immunoglobulin locus, and optionally VJ region of the
endogenous light chain immunoglobulin loci (lambda and/or kappa
loci), have been inactivated. For example, all or part of the
non-human vertebrate VDJ region is inactivated by inversion in the
endogenous heavy chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. For example, all or part of
the non-human vertebrate VJ region is inactivated by inversion in
the endogenous kappa chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. For example, all or part of
the non-human vertebrate VJ region is inactivated by inversion in
the endogenous lambda chain immunoglobulin locus of the mammal,
optionally with the inverted region being moved upstream or
downstream of the endogenous Ig locus. In one embodiment the
endogenous heavy chain locus is inactivated in this way as is one
or both of the endogenous kappa and lambda loci.
[0258] Additionally or alternatively, the Vertebrate has been
generated in a genetic background which prevents the production of
mature host B and T lymphocytes, optionally a RAG-1-deficient
and/or RAG-2 deficient background. See U55859301 for techniques of
generating RAG-1 deficient animals.
[0259] In one embodiment in any configuration of the invention, the
human V, J and optional D regions are provided by all or part of
the human IgH locus; optionally wherein said all or part of the IgH
locus includes substantially the full human repertoire of IgH V, D
and J regions and intervening sequences.
[0260] A suitable part of the human IgH locus is disclosed in
W02011004192. In one embodiment, the human IgH part includes (or
optionally consists of) bases 105,400,051 to 106,368,585 from human
chromosome 14 (coordinates from NCBI36). Additionally or
alternatively, optionally wherein the vertebrate is a mouse or the
cell is a mouse cell, the human V, J and optional D regions are
inserted into mouse chromosome 12 at a position corresponding to a
position between coordinates 114,667,091 and 114,665,190,
optionally at coordinate 114,667,091 (coordinates from NCBIM37,
relating to mouse strain C57BL/6J).
[0261] In one embodiment of any configuration of a Vertebrate or
cell (line) of the invention the lambdaantibody transgene comprises
all or part of the human IgX locus including at least one human JX
region and at least one human CX region, optionally CA6 and/or CA7.
Optionally, the transgene comprises a plurality of human JX
regions, optionally two or more of JA1, JA2, JA6 and JA7,
optionally all of JA1, JA2, JA6 and JA7. The human lambda
immunoglobulin locus comprises a unique gene architecture composed
of serial J-C clusters. In order to take advantage of this feature,
the invention in optional aspects employs one or more such human
J-C clusters inoperable linkage with the constant region in the
transgene, eg, where the constant region is endogenous to the
non-human vertebrate or non-human vertebrate cell (line). Thus,
optionally the transgene comprises at least one human JrCA cluster,
optionally at least JA7-CA7. The construction of such transgenes is
facilitated by being able to use all or part of the human lambda
locus such that the transgene comprises one or more J-C clusters in
germline configuration, advantageously also including intervening
sequences between clusters and/or between adjacent J and C regions
in the human locus. This preserves any regulatory elements within
the intervening sequences which may be involved in VJ and/or JC
recombination and which may be recognised by AID
(activation-induced deaminase) or AID homologues.
[0262] Optionally, the lambda transgene comprises a human EX
enhancer. Optionally, the kappa transgene comprises a human EK
enhancer. Optionally, the heavy chain transgene comprises a heavy
chain human enhancer.
[0263] In one embodiment of any configuration of the invention the
heavy chain transgene comprises a plurality human IgH V regions, a
plurality of human D regions and a plurality of human J regions,
optionally substantially the full human repertoire of IgH V, D and
J regions.
[0264] In one embodiment of any configuration of the invention, for
the Antibody-Generating Vertebrate and/or Assay Vertebrate:--(i)
the heavy chain transgene comprises substantially the full human
repertoire of IgH V, D and J regions; and (ii) the vertebrate
comprises substantially the full human repertoire of Igk V and J
regions and/or substantially the full human repertoire of IgX V and
J regions.
[0265] In an example, an exogenous regulatory element is knocked-in
using the method. For example, it is knocked-in to replace an
endogenous regulatory element.
[0266] In one aspect, the invention provides a method of producing
a cell or a transgenic non-human organism (e.g., any non-human
organism recited herein), the method comprising:
(a) carrying out the method of any in any configuration, aspect,
example or embodiment of the invention to (i) knock out a target
nucleotide sequence in the genome of a first cell and/or (ii) knock
in an insert nucleotide sequence into the genome of a first cell,
optionally wherein the insert sequence replaces a target sequence
in whole or in part at the endogenous location of the target
sequence in the genome; wherein the cell or a progeny thereof can
develop into a non-human organism or cell; and (b) developing the
cell or progeny into a non-human organism or a non-human cell.
[0267] In an example, the organism or cell is homozygous for the
modification (i) and/or (ii).
[0268] In an example, the cell is an ES cell (such as a mouse ES
cell), iPS cell, totipotent cell or pluripotent cell. In an
example, the cell is a non-human vertebrate cell or a human cell in
vitro. In an example, the cell is a plant, yeast, insect or
bacterial cell.
[0269] In an example, the cell or organism is a rodent (e.g., a
mouse or rat) cell or a rabbit, bird, fish, chicken, non-human
primate, monkey, pig, dog, Camelid, shark, sheep, cow or cat
cell.
[0270] In an example, the target sequence is an endogenous sequence
comprising all or part of a regulatory element or encoding all or
part of a protein.
[0271] In an example, the insert sequence is a synthetic sequence;
or comprises a sequence encoding all or part of a protein from a
species other than the species from which the first cell is
derived; or comprises a regulatory element from said first species.
This is useful to combine genes with new regulatory elements.
[0272] In an example, the insert sequence encodes all or part of a
human protein or a human protein subunit or domain. For example,
the insert sequence encodes a cell membrane protein, secreted
protein, intracellular protein, cytokine, receptor protein (e.g.,
Fc receptor protein, such as FcRn or a Fc.UPSILON. receptor
protein), protein of the human immune system or domain thereof
(e.g., an Ig protein or domain, such as an antibody or TCR protein
or domain, or a MHC protein), a hormone or growth factor.
[0273] The Invention Also Provides:--
[0274] A cell (e.g., an isolated or purified cell, e.g., a cell in
vitro, or any cell disclosed herein) or a non-human organism (e.g.,
any organism disclosed herein, such as a mouse) whose genome
comprises a modification comprising a non-endogenous nucleotide
sequence flanked by endogenous nucleotide sequences, wherein the
cell or organism is obtainable by the method of any configuration,
aspect, example or embodiment of the invention, and wherein the
non-endogenous sequence is flanked 3' and/or 5' by (e.g., within
20, 10, 5, 4, 3, 2 or 1 or less nucleotides of, or directly
adjacent to) a Cas PAM motif; wherein the cell is not comprised by
a human; and one, more or all of (a) to (d) applies (for example,
(a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and
(c); (b) and (d); (c) and (d); (a), (b) and (c); (a), (b) and (d);
(a), (c) and (d); (b), (c) and (d) or all of (a), (b), (c) and
(d)).
(a) the genome is homozygous for the modification; or comprises the
modification at one allele and is unmodified by Cas-mediated
homologous recombination at the other allele; (b) the
non-endogenous sequence comprises all or part of a regulatory
element or encodes all or part of a protein; (c) the non-endogenous
sequence is at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200,
300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1, 2,
3, 5, 10, 20, 50 or 100 kb long: (d) the non-endogenous sequence
replaces an orthologous or homologous sequence in the genome.
[0275] The cell can be a human cell, or included in human tissue
but not part of a human being. For example, the cell is a human
cell in vitro.
[0276] In an example, the non-endogenous sequence is a human
sequence.
[0277] In an example, the PAM motif is any PAM disclosed herein or
comprises a sequence selected from CCN, TCN, TTC, AWG, CC, NNAGNN,
NGGNG GG, NGG, WGG, CWT, CTT and GAA. For example, the motif is a
Cas9 PAM motif. For example, the PAM is NGG. In another example,
the PAM is GG.
[0278] In an example, there is a PAM motif no more than 10
nucleotides (e.g., 3 nucleotides) 3' and/or 5' of the
non-endogenous sequence.
[0279] In an example, the PAM motif is recognised by a
Streptococcus Cas9.
[0280] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody heavy chain variable domains (and optionally no
heavy chain variable domains of a non-human vertebrate species).
For example, the organism is an Antibody-Generating Vertebrate or
Assay Vertebrate disclosed in WO2013061078.
[0281] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody kappa light chain variable domains (and
optionally no kappa light chain variable domains of a non-human
vertebrate species).
[0282] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody lambda light chain variable domains (and
optionally no kappa light chain variable domains of a non-human
vertebrate species).
[0283] In an example, the non-endogenous sequence encodes a human
Fc receptor protein or subunit or domain thereof (e.g., a human
FcRn or Fc.UPSILON. receptor protein, subunit or domain).
[0284] In an example, the non-endogenous sequence comprises one or
more human antibody gene segments, an antibody variable region or
an antibody constant region.
[0285] In an example, the insert sequence is a human sequence that
replaces or supplements an orthologous non-human sequence.
[0286] The Invention Also Provides:--
[0287] A monoclonal or polyclonal antibody prepared by immunisation
of a vertebrate (e.g., mouse or rat) of the invention (or produced
by a method of the invention) with an antigen.
[0288] The Invention Also Provides:--
[0289] A method of isolating an antibody that binds a predetermined
antigen, the method comprising:
(a) providing a vertebrate (optionally a mouse or rat) of the
invention (or produced by a method of the invention); (b)
immunising said vertebrate with said antigen; (c) removing B
lymphocytes from the vertebrate and selecting one or more B
lymphocytes expressing antibodies that bind to the antigen; (d)
optionally immortalising said selected B lymphocytes or progeny
thereof, optionally by producing hybridomas therefrom; and (e)
isolating an antibody (e.g., an IgG-type antibody) expressed by the
B lymphocytes.
[0290] In an example, the method comprises the step of isolating
from said B lymphocytes nucleic acid encoding said antibody that
binds said antigen; optionally exchanging the heavy chain constant
region nucleotide sequence of the antibody with a nucleotide
sequence encoding a human or humanised heavy chain constant region
and optionally affinity maturing the variable region of said
antibody; and optionally inserting said nucleic acid into an
expression vector and optionally a host.
[0291] In an example, the method comprises making a mutant or
derivative of the antibody produced by the method.
[0292] The invention provides the use of an isolated, monoclonal or
polyclonal antibody described herein, or a mutant or derivative
antibody thereof that binds said antigen, in the manufacture of a
composition for use as a medicament.
[0293] The invention provides the use of an isolated, monoclonal or
polyclonal antibody described herein, or a mutant or derivative
antibody thereof that binds said antigen for use in medicine.
[0294] The invention provides a method of treating a patient in
need thereof (e.g., a human patient), comprising administering a
therapeutically effective amount of an isolated, monoclonal or
polyclonal antibody described herein, or a mutant or derivative
antibody thereof which binds an antigen.
[0295] The invention provides a nucleotide sequence encoding an
antibody described herein, optionally wherein the nucleotide
sequence is part of a vector. The invention also provides a host
cell comprising said nucleotide sequence.
[0296] The invention provides a pharmaceutical composition
comprising the antibody or antibodies described herein and a
diluent, excipient or carrier.
[0297] The invention provides an ES cell, a non-human animal or a
non-human blastocyst comprising an expressible
genomically-integrated nucleotide sequence encoding a Cas
endonuclease (e.g., a Cas9 or Cys4) and optionally an expressible
genomically-integrated nucleotide sequence encoding a tracrRNA or a
gRNA. For example, the ES cell is any ES cell type described
herein.
[0298] In an example of the cell, animal or blastocyst, the
endonuclease sequence is constitutively expressible.
[0299] In an example of the cell, animal or blastocyst, the
endonuclease sequence is inducibly expressible.
[0300] In an example of the cell, animal or blastocyst, the
endonuclease sequence is expressible in a tissue-specific manner in
the animal or a progeny thereof, or in a non-human animal that is a
progeny of the cell or blastocyst.
[0301] In an example, the cell, animal or blastocyst comprises one
or more gRNAs or an expressible nucleotide sequence encoding a gRNA
or a plurality of expressible nucleotide sequences each encoding a
different gRNA.
[0302] The invention provides the use of the cell, animal or
blastocyst in a method according to any configuration, aspect,
embodiment or example of the invention.
[0303] An aspect provides an antibody produced by the method of the
invention, optionally for use in medicine, e.g., for treating
and/or preventing (such as in a method of treating and/or
preventing) a medical condition or disease in a patient, e.g., a
human.
[0304] An aspect provides a nucleotide sequence encoding the
antibody of the invention, optionally wherein the nucleotide
sequence is part of a vector. Suitable vectors will be readily
apparent to the skilled person, e.g., a conventional antibody
expression vector comprising the nucleotide sequence together in
operable linkage with one or more expression control elements.
[0305] An aspect provides a pharmaceutical composition comprising
the antibody of the invention and a diluent, excipient or carrier,
optionally wherein the composition is contained in an intravenous
(IV) container (e.g., and IV bag) or a container connected to an IV
syringe.
[0306] An aspect provides the use of the antibody of the invention
in the manufacture of a medicament for the treatment and/or
prophylaxis of a disease or condition in a patient, e.g. a
human.
[0307] In a further aspect, the invention relates to humanised
antibodies and antibody chains produced according to the present
invention, both in chimaeric and fully humanised form, and use of
said antibodies in medicine. The invention also relates to a
pharmaceutical composition comprising such an antibody and a
pharmaceutically acceptable carrier or other excipient.
[0308] Antibody chains containing human sequences, such as
chimaeric human-non human antibody chains, are considered humanised
herein by virtue of the presence of the human protein coding
regions region. Fully human antibodies may be produced starting
from DNA encoding a chimaeric antibody chain of the invention using
standard techniques.
[0309] Methods for the generation of both monoclonal and polyclonal
antibodies are well known in the art, and the present invention
relates to both polyclonal and monoclonal antibodies of chimaeric
or fully humanised antibodies produced in response to antigen
challenge in non-human vertebrates of the present invention.
[0310] In a yet further aspect, chimaeric antibodies or antibody
chains generated in the present invention may be manipulated,
suitably at the DNA level, to generate molecules with antibody-like
properties or structure, such as a human variable region from a
heavy or light chain absent a constant region, for example a domain
antibody; or a human variable region with any constant region from
either heavy or light chain from the same or different species; or
a human variable region with a non-naturally occurring constant
region; or human variable region together with any other fusion
partner. The invention relates to all such chimaeric antibody
derivatives derived from chimaeric antibodies identified according
to the present invention.
[0311] In a further aspect, the invention relates to use of animals
of the present invention in the analysis of the likely effects of
drugs and vaccines in the context of a quasi-human antibody
repertoire.
[0312] The invention also relates to a method for identification or
validation of a drug or vaccine, the method comprising delivering
the vaccine or drug to a mammal of the invention and monitoring one
or more of: the immune response, the safety profile; the effect on
disease.
[0313] The invention also relates to a kit comprising an antibody
or antibody derivative as disclosed herein and either instructions
for use of such antibody or a suitable laboratory reagent, such as
a buffer, antibody detection reagent.
[0314] It will be understood that particular embodiments described
herein are shown by way of illustration and not as limitations of
the invention. The principal features of this invention can be
employed in various embodiments without departing from the scope of
the invention. Those skilled in the art will recognize, or be able
to ascertain using no more than routine study, numerous equivalents
to the specific procedures described herein. Such equivalents are
considered to be within the scope of this invention and are covered
by the claims. All publications and patent applications mentioned
in the specification are indicative of the level of skill of those
skilled in the art to which this invention pertains. All
publications and patent applications are herein incorporated by
reference to the same extent as if each individual publication or
patent application was specifically and individually indicated to
be incorporated by reference. The use of the word "a" or "an" when
used in conjunction with the term "comprising" in the claims and/or
the specification may mean "one," but it is also consistent with
the meaning of "one or more," "at least one," and "one or more than
one." The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0315] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps
[0316] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof is intended to
include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a particular context, also BA, CA, CB, CBA, BCA,
ACB, BAC, or CAB. Continuing with this example, expressly included
are combinations that contain repeats of one or more item or term,
such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
The skilled artisan will understand that typically there is no
limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[0317] Any part of this disclosure may be read in combination with
any other part of the disclosure, unless otherwise apparent from
the context.
[0318] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. All such similar substitutes and modifications apparent
to those skilled in the art are deemed to be within the spirit,
scope and concept of the invention as defined by the appended
claims.
REFERENCES
[0319] 1. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu P
D, Wu X, Jiang W, Marrafflini L A et al: Multiplex genome
engineering using CRISPR/Cas systems. Science 2013,
339(6121):819-823. [0320] 2. Wang H, Yang H, Shivalila C S, Dawlaty
M M, Cheng A W, Zhang F, Jaenisch R: One-step generation of mice
carrying mutations in multiple genes by CRISPR/Cas-mediated genome
engineering. Cell 2013, 153(4):910-918. [0321] 3. Mali P, Yang L,
Esvelt K M, Aach J, Guell M, DiCarlo J E, Norville J E, Church G M:
RNA-guided human genome engineering via Cas9. Science 2013,
339(6121):823-826. [0322] 4. Gaj T, Gersbach C A, Barbas C F, 3rd:
ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.
Trends Biotechnol 2013, 31(7):397-405. [0323] 5. Perez-Pinera P,
Ousterout D G, Gersbach C A: Advances in targeted genome editing.
Curr Opin Chem Biol 2012, 16(3-4):268-277. [0324] 6. Shah S A,
Erdmann S, Mojica F J, Garrett R A: Protospacer recognition motifs:
Mixed identities and functional diversity. RNA Biol 2013, 10(5).
[0325] 7. Haurwitz R E, Sternberg S H, Doudna J A: Csy4 relies on
an unusual catalytic dyad to position and cleave CRISPR RNA. EMBO J
2012, 31(12):2824-2832. [0326] 8. Yusa K, Zhou L, Li M A, Bradley
A, Craig N L: A hyperactive piggyBac transposase for mammalian
applications. Proc Natl Acad Sci USA 2011, 108(4):1531-1536. [0327]
9. Qiao J, Oumard A, Wegloehner W, Bode J: Novel tag-and-exchange
(RMCE) strategies generate master cell clones with predictable and
stable transgene expression properties. J Mol Biol 2009,
390(4):579-594. [0328] 10. Oumard A. Qiao J. Jostock T, Li J, Bode
J: Recommended Method for Chromosome Exploitation: RMCE-based
Cassette-exchange Systems in Animal Cell Biotechnology.
Cytotechnology 2006, 50(1-3):93-108.
[0329] The present invention is described in more detail in the
following non limiting exemplification.
[0330] Some embodiments of the technology described herein can be
defined according to any of the following numbered paragraphs:
[0331] 1. A method of nucleic acid recombination, the method
comprising [0332] (a) using Cas endonuclease-mediated nucleic acid
cleavage to create first and second breaks in a nucleic acid
strand, thereby creating 5' and 3' cut ends and a nucleotide
sequence between the ends; [0333] (b) using homologous
recombination to delete the nucleotide sequence; and [0334] (c)
optionally obtaining the nucleic acid strand modified in step (b)
or a progeny nucleic strand comprising the deletion. [0335] 2. The
method of paragraph 1, wherein the deleted sequence comprises a
regulatory element or encodes all or part of a protein. [0336] 3.
The method of paragraph 2, wherein the deleted sequence comprises a
protein subunit or domain. [0337] 4. The method of any one of
paragraphs 1 to 3, wherein the deletion of step (b) is at least 20
nucleotides long. [0338] 5. The method of paragraph 1, further
comprising a step of inserting a nucleotide sequence between the
cut ends in (a). [0339] 6. The method of paragraph 5, wherein the
insert nucleotide sequence comprises a PAM motif. [0340] 7. The
method of paragraph 5 or paragraph 6, wherein the insert sequence
is at least 10 nucleotides long. [0341] 8. The method of any one of
paragraphs 5 to 7, wherein recombinase recognition sequences are
used to insert the nucleotide sequence, e.g. loxP and/or a mutant
lox, e.g., lox2272 or lox511; or frt. [0342] 9. The method of any
one of paragraphs 5 to 7, wherein homologous recombination is used
to insert the insert nucleotide sequence. [0343] 10. The method of
any one of paragraphs 5 to 9, wherein the method is carried out in
a cell and the insert sequence replaces an orthologous or
homologous sequence in the cell. [0344] 11. The method of any
preceding paragraph, wherein step (c) is performed by isolating a
cell comprising the modified first strand, or by obtaining a
non-human vertebrate in which the method has been performed or a
progeny thereof. [0345] 12. The method of any preceding paragraph,
wherein the nucleic acid strand or the first strand is a DNA
strand. [0346] 13. The method of any preceding paragraph wherein
the product of the method comprises a nucleic acid strand
comprising a PAM motif 3' of the insertion or deletion. [0347] 14.
The method of paragraph 13, wherein the PAM motif is no more than
10 nucleotides 3' of the deletion. [0348] 15. The method of any
preceding paragraph, wherein step (b) is performed by carrying out
homologous recombination between an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end. [0349] 16. The method of paragraph 15, wherein step (b) is
performed by carrying out homologous recombination between an
incoming nucleic acid comprising an insert nucleotide sequence
flanked by the first and second homology arms, wherein the insert
nucleotide sequence is inserted between the 5' and 3' ends. [0350]
17. The method of paragraph 15 or paragraph 16, wherein each
homology arm is at least 20 contiguous nucleotides long. [0351] 18.
The method of any one of paragraphs 15 to 17, wherein the first
and/or second homology arm comprises a recombinase recognition
sequence, such as a PAM motif. [0352] 19. The method of any
preceding paragraph, wherein Cas endonuclease-mediated cleavage is
used in step (a) and is carried out by recognition of a GG or NGG
PAM motif. [0353] 20. The method of paragraph 19, wherein a nickase
is used to cut in step (a), and optionally, wherein the nickase is
a Cas nickase. [0354] 21. The method of any preceding paragraph,
wherein the method is carried out in a cell, e.g. a eukaryotic
cell. [0355] 22. The method of paragraph 21, wherein the method is
carried out in a mammalian cell, e.g. rodent or mouse cell, e.g. a
rodent (e.g., mouse) ES cell or zygote. [0356] 23. The method of
any preceding paragraph, wherein the method is carried out in a
non-human mammal, e.g. a mouse or rat or rabbit. [0357] 24. The
method of any preceding paragraph, wherein each cleavage site is
flanked by PAM motif (e.g., a NGG or NGGNG sequence, wherein N is
any base and G is a guanine). [0358] 25. The method of any
preceding paragraph, wherein the 3' end is flanked 3' by a PAM
motif. [0359] 26. The method of any preceding paragraph, wherein
step (a) is carried out by cleavage in one single strand of dsDNA.
[0360] 27. The method of any preceding paragraph, wherein step (a)
is carried out by combining in a cell the nucleic acid strand, a
Cas endonuclease, a crRNA and a tracrRNA (e.g., provided by one or
more gRNAs) for targeting the endonuclease to carry out the
cleavage, and optionally an insert sequence for homologous
recombination with the nucleic acid strand. [0361] 28. The method
of any preceding paragraph, wherein step (b) is performed by
carrying out homologous recombination with an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end, wherein the second homology arm comprises a PAM sequence
such that homologous recombination between the second homology arm
and the sequence extending 3' from the 3' end produces a sequence
comprising a PAM motif in the product of the method. [0362] 29. A
method of sequential endonuclease-mediated homology directed
recombination (sEHDR) comprising carrying out the method of any
preceding paragraph a first time and a second time, wherein the
product of the first time is used for endonuclease-mediated
cleavage the second time, whereby either (i) first and second
nucleotide sequences are deleted the first time and the second
times respectively; (ii) a first nucleotide sequence is deleted the
first time and a second nucleotide sequence is inserted the second
time; (iii) a first nucleotide sequence is inserted the first time
and a second nucleotide sequence is deleted the second time; or
(iv) first and second nucleotide sequences are inserted the first
and second times respectively; optionally wherein the nucleic acid
strand modification the second time is within 20 or less
nucleotides of the nucleic acid strand modification the first time.
[0363] 30. The method of paragraph 29, wherein the first time is
carried out according to paragraph 1, wherein the incoming nucleic
acid comprises no sequence between the first and second homology
arms, wherein sequence between the 5' and 3' ends is deleted by
homologous recombination; and/or the second time is carried out
according to paragraph 1, wherein step (b) is performed by carrying
out homologous recombination between an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end, wherein the incoming nucleic acid comprises no sequence
between the first and second homology arms such that sequence
between the 5' and 3' ends is deleted by homologous recombination;
optionally wherein the second arm comprises a PAM motif such that
the product of the second time comprises a PAM motif for use in a
subsequent Cas endonuclease-mediated method according to any one of
paragraphs 1 to 28. [0364] 31. The method of any preceding
paragraph, wherein step (a) is carried out using Cas
endonuclease-mediated cleavage and a gRNA comprising a crRNA and a
tracrRNA. [0365] 32. The method of paragraph 27 or 31, wherein the
crRNA has the structure 5'-X-Y-3', wherein X is an RNA nucleotide
sequence (optionally at least 5 nucleotides long) and Y is an RNA
sequence comprising a nucleotide motif that hybridises with a motif
comprised by the tracrRNA, wherein X is capable of hybridising with
a nucleotide sequence extending 5' from the desired site of the 5'
cut end. [0366] 33. The method of paragraph 27, 31 or 32, wherein Y
is 5'-N.sub.1UUUUAN.sub.2N.sub.3GCUA-3', wherein each of N.sub.1-3
is a A, U, C or G and/or the tracrRNA comprises the sequence (in 5'
to 3' orientation) UAGCM.sub.1UUAAAAM.sub.2, wherein M.sub.1 is
spacer nucleotide sequence and M.sub.2 is a nucleotide. [0367] 34.
A method of nucleic acid recombination, the method comprising
providing dsDNA comprising first and second strands and [0368] (a)
using Cas endonuclease-mediated nucleic acid cleavage to create a
cut end in the first strand 3' of a PAM motif; [0369] (b) using Cas
endonuclease-mediated nucleic acid cleavage to create a cut in the
second strand at a position which corresponds to a position 3' of
the cut end of the strand of part (a), which cut is 3' of the PAM
motif; [0370] (c) providing a first gRNA which hybridises with a
sequence 5' to the PAM motif in the strand of part (a) [0371] (d)
providing a second gRNA which hybridises with a sequence 5' to the
PAM motif in the strand of part (b) wherein the nucleic acid
strands of part (a) and part (b) are repaired to produce a deletion
of nucleic acid between the cuts. [0372] 35. A method of producing
a cell or a transgenic non-human organism, the method comprising:
[0373] (a) carrying out the method of any preceding paragraph to
(i) knock out a target nucleotide sequence in the genome of a first
cell and/or (ii) knock in an insert nucleotide sequence into the
genome of a first cell, optionally wherein the insert sequence
replaces a target sequence in whole or in part at the endogenous
location of the target sequence in the genome; wherein the cell or
a progeny thereof can develop into a non-human organism or cell;
and [0374] (b) developing the cell or progeny into a non-human
organism or a non-human cell. [0375] 36. The method of paragraph
35, wherein the organism or cell is homozygous for the modification
(i) and/or (ii). [0376] 37. The method of paragraph 35 or 36,
wherein the cell is an ES cell, iPS cell, totipotent cell or
pluripotent cell, optionally a rodent (e.g., a mouse or rat) cell.
[0377] 38. The method of any one of paragraphs 35 to 37, wherein
the target sequence is an endogenous sequence comprising all or
part of a regulatory element or encoding all or part of a protein.
[0378] 39. The method of any one of paragraphs 35 to 38, wherein
the insert sequence is a synthetic sequence; or comprises a
sequence encoding all or part of a protein from a species other
than the species from which the first cell is derived; or comprises
a regulatory element from said first species. [0379] 40. The method
of paragraph 39, wherein the insert sequence encodes all or part of
a human protein or a human protein subunit or domain. [0380] 41. A
cell or a non-human organism whose genome comprises a modification
comprising a non-endogenous nucleotide sequence flanked by
endogenous nucleotide sequences, wherein the cell or organism is
obtainable by the method of any one of paragraphs 26 to 40 and
wherein the non-endogenous sequence is flanked 3' by a Cas PAM
motif; wherein the cell is not comprised by a human: and one, more
or all of (a) to (d) applies [0381] (a) the genome is homozygous
for the modification; or comprises the modification at one allele
and is unmodified by Cas-mediated homologous recombination at the
other allele; [0382] (b) the non-endogenous sequence comprises all
or part of a regulatory element or encodes all or part of a
protein; [0383] (c) the non-endogenous sequence is at least 20
nucleotides long; [0384] (d) the non-endogenous sequence replaces
an orthologous or homologous sequence in the genome. [0385] 42. The
cell or organism of paragraph 41, wherein the non-endogenous
sequence is a human sequence. [0386] 43. The cell or organism of
paragraph 41 or 42, wherein the PAM motif comprises a sequence
selected from CCN, TCN, TTC, AWG, CC, NNAGNN, NGGNG GG, NGG, WGG,
CWT, CTT and GAA. [0387] 44. The cell or organism of any one of
paragraphs 41 to 43, wherein there is a PAM motif no more than 10
nucleotides (e.g., 3 nucleotides) 3' of the non-endogenous
sequence. [0388] 45. The cell or organism of any one of paragraphs
41 to 44, wherein the PAM motif is recognised by a Streptococcus
Cas9. [0389] 46. The cell or organism of any one of paragraphs 41
to 45, which is a non-human vertebrate cell or a non-human
vertebrate that expresses one or more human antibody heavy chain
variable domains (and optionally no heavy chain variable domains of
a non-human vertebrate species). [0390] 47. The cell or organism of
any one of paragraphs 41 to 46, which is a non-human vertebrate
cell or a non-human vertebrate that expresses one or more human
antibody kappa light chain variable domains (and optionally no
kappa light chain variable domains of a non-human vertebrate
species) or that expresses one or more human antibody lambda light
chain variable domains (and optionally no kappa light chain
variable domains of a non-human vertebrate species). [0391] 48. The
cell or organism of any paragraph 46 or paragraph 47, wherein the
non-endogenous sequence encodes a human Fc receptor protein or
subunit or domain thereof (e.g., a human FcRn or Fc.UPSILON.
receptor protein, subunit or domain). [0392] 49. The cell or
organism of any one of paragraphs 41 to 48, wherein the
non-endogenous sequence comprises one or more human antibody gene
segments, an antibody variable region or an antibody constant
region. [0393] 50. The cell or organism of any one of paragraphs 41
to 49, wherein the insert sequence is a human sequence that
replaces or supplements an orthologous non-human sequence. [0394]
51. A monoclonal or polyclonal antibody prepared by immunisation of
a vertebrate (e.g., mouse or rat) according to any one of
paragraphs 41 to 50 with an antigen. [0395] 52. A method of
isolating an antibody that binds a predetermined antigen, the
method comprising [0396] (a) providing a vertebrate (optionally a
mouse or rat) according to any one of paragraphs 41 to 51; [0397]
(b) immunising said vertebrate with said antigen; [0398] (c)
removing B lymphocytes from the vertebrate and selecting one or
more B lymphocytes expressing antibodies that bind to the antigen;
[0399] (d) optionally immortalising said selected B lymphocytes or
progeny thereof, optionally by producing hybridomas therefrom; and
[0400] (e) isolating an antibody (e.g., and IgG-type antibody)
expressed by the B lymphocytes. [0401] 53. The method of paragraph
52, comprising the step of isolating from said B lymphocytes
nucleic acid encoding said antibody that binds said antigen;
optionally exchanging the heavy chain constant region nucleotide
sequence of the antibody with a nucleotide sequence encoding a
human or humanised heavy chain constant region and optionally
affinity maturing the variable region of said antibody; and
optionally inserting said nucleic acid into an expression vector
and optionally a host.
[0402] 54. The method of paragraph 52 or 53, further comprising
making a mutant or derivative of the antibody produced by the
method of paragraph 52 or 53. [0403] 55. The use of an isolated,
monoclonal or polyclonal antibody according to paragraph 51, or a
mutant or derivative antibody thereof that binds said antigen, in
the manufacture of a composition for use as a medicament. [0404]
56. The use of an isolated, monoclonal or polyclonal antibody
according to paragraph 51, or a mutant or derivative antibody
thereof that binds said antigen for use in medicine. [0405] 57. A
nucleotide sequence encoding an antibody of paragraph 51,
optionally wherein the nucleotide sequence is part of a vector.
[0406] 58. A pharmaceutical composition comprising the antibody or
antibodies of paragraph 51 and a diluent, excipient or carrier.
[0407] 59. An ES cell, a eukaryotic cell, a mammalian cell, a
non-human animal or a non-human blastocyst comprising an
expressible genomically-integrated nucleotide sequence encoding a
Cas endonuclease. [0408] 60. The cell, animal or blastocyst of
paragraph 59, wherein the endonuclease sequence is constitutively
expressible. [0409] 61. The cell, animal or blastocyst of paragraph
59, wherein the endonuclease sequence is inducibly expressible.
[0410] 62. The cell, animal or blastocyst of paragraph 59, 60 or
61, wherein the endonuclease sequence is expressible in a
tissue-specific or stage-specific manner in the animal or a progeny
thereof, or in a non-human animal that is a progeny of the cell or
blastocyst. [0411] 63. The cell or animal of paragraph 62, wherein
the cell is a non-human embryo cell or the animal is a non-human
embryo, wherein the endonuclease sequence is expressible or
expressed in the cell or embryo. [0412] 64. The cell of animal
paragraph 63, wherein the endonuclease is operatively linked to a
promoter selected from the group consisting of an embryo-specific
promoter (e.g., a Nanog promoter, a Pou5fl promoter or a SoxB
promoter). [0413] 65. The cell, animal or blastocyst of any one of
paragraphs 61 to 64, wherein the Cas endonuclease is at a Rosa 26
locus, and is optionally operably linked to a Rosa 26 promoter.
[0414] 66. The cell, animal or blastocyst of any one of paragraphs
59 to 62, wherein the Cas endonuclease sequence is flanked 5' and
3' by transposon elements (e.g., inverted piggyBac terminal
elements) or site-specific recombination sites (e.g., loxP and/or a
mutant lox, e.g., lox2272 or lox511; or frt). [0415] 67. The cell,
animal or blastocyst of paragraph 66, comprising one or more
restriction endonuclease sites between the Cas endonuclease
sequence and a transposon element. [0416] 68. The cell, animal or
blastocyst of any one of paragraphs 59 to 67 comprising one or more
gRNAs. [0417] 69. The cell, animal or blastocyst of paragraph 66,
67 or 68, wherein the gRNA(s) are flanked 5' and 3' by transposon
elements (e.g., inverted piggyBac terminal elements) or
site-specific recombination sites (e.g., loxP and/or a mutant lox,
e.g., lox2272 or lox511; or frt). [0418] 70. Use of the cell,
animal or blastocyst of any one of paragraphs 59 to 69 in a method
according to any one of paragraphs 1 to 50.
EXAMPLES
Example 1
Precise DNA Modifications
[0419] (a) Use of Nickase for HDR
[0420] It has been reported that the Cas9 nuclease can be converted
into a nickase through the substitution of an aspartate to alanine
(D10A) in the RuvCl domain of SpCas9 (Cong et al.). It is
noteworthy that DNA single-stranded breaks are preferentially
repaired through the HDR pathway. The Cas9 D10A nickase, when in a
complex with mature crRNA:tracrRNA, can specifically induce DNA
nicking at a precise location. With this in mind, we propose
extending the application of the CRISPR/Cas system by creating a
nick in a given location in a genome using Cas9 D10A nickase and
then exploiting the HDR pathway for inserting a single-stranded DNA
fragment (endogenous or exogenous) which will contain DNA homology
(typically for recombineering, 50 bp is enough for efficient
recombination) flanking the nicked DNA junction to bring in and
insert a given DNA in a precision location; similar size homology
will be used with the present example (FIG. 1A). Guide RNA (gRNA)
will be design individually per target protospacer sequence or
incorporated into a single CRISPR array encoding for 2 or more
spacer sequences allowing multiplex genome editing from a single
CRSPR array.
(b) Example of Precise DNA Deletion
[0421] To demonstrate precise deletion using Cas9 in association
with gRNA and no targeting vector or donor DNA, we designed two
gRNA within a gene, which were 55 bp apart. The two gRNA were on
opposite DNA strands as shown in FIG. 9.
[0422] Mouse ES cells were transfected with human Cas9 nuclease and
the two gRNAs. The transfection procedure was carried out as
detailed above but the resulting clones were not selected. The
transfected ES clones were genotyped using oligos pair spanning the
two gRNA (Primer 1 & 2) to detect specific 55 bp deletion (FIG.
10).
[0423] Most of the clones did not show the specific 55 bp deletion,
however, clones were clearly identified which contained the defined
deletion. Out of the 384 clones analysed, approximately 4% of the
clones were found to contain the specific 55 bp deletion. Note: Not
all the genotyping data is shown. The clones containing the
specific 55 bp deletion were further analysed by sequencing the PCR
products as a final confirmation (data not shown). Furthermore,
where we saw the specific deletion, we observed both alleles to
contain the specific deletion. These data confirmed that when two
gRNAs are used, a precise and specific deletion can be made without
the requirement for a targeting vector. However we can assume the
efficiency of the define deletion can be greatly enhance using the
two gRNA combination together with a targeting vector or a donor
DNA fragment containing homology arms flanking the intended
deletion region.
(c) Alternative Methodology for Deletion of DNA
[0424] In a separate setting, two gRNA or a single CRISPR array
encoding multiple spacer sequence can be designed flanking a gene
or a region of interest and with the association of Cas9 D10A
nickase, two separate single-stranded breaks can be induced. This,
in association with a single-stranded DNA fragment containing DNA
homology to the 5' breakpoint junction of the first DNA nick, and
DNA homology to the 3' breakpoint junction of the second nick, the
region in between the two single stranded DNA nick can be precisely
deleted (FIG. 2A).
(d) Alternative Methodology for Replacement of DNA
[0425] In an another setting, two separate gRNA or a multiplex
single CRISPR array can be designed flanking a gene or a region of
interest and with the association of Cas9 D10A nickase two separate
single-stranded breaks can be induced. In this case the intruding
single stranded DNA fragment (or double stranded DNA) can contain
DNA sequence from either endogenous or exogenous source containing
sequence for a known gene, regulatory element promoter etc. This
single-stranded DNA fragment (or double stranded DNA) can be
brought together to replace the DNA region of interest flanked by
DNA nick by arming it with DNA homology from the 5' region of the
first nick and 3' region from the second nick (FIG. 3A). Due to the
high efficiency of the CRISPR/Cas system to cleave DNA, the above
proposed strategy will not require introduction of any selection
marker, thus creating exact seamless genome editing in a precise
and defined manner. As an option, a selection marker can be
included flanked by PiggyBac LTRs to allow for the direct selection
of correctly modified clones. Once the correct clones have been
identified, the selection marker can be removed conveniently
through the expression of hyperactive piggyBac transposase (Yusa
K., Zhou L., Li M. A., Bradley A., Craig N. L.: A hyperactive
piggyBac transposase for mammalian applications., Proc. Natl. Acad.
Sci. USA, 2011, 108(4):1531-1536). Furthermore, the above
approaches can be applied to ES cells, mammalian cells, yeast
cells, bacterial cells, plant cells as well as directly performing
in zygotes to expedite the process of homozygeous genome
engineering in record time. It would be also possible to multiplex
this system to generate multiple simultaneous DNA insertions (KI),
deletions (KO) and the sequential deletion and insertion
(KO.fwdarw.KI).
(e) Example of DNA Deletion and Insertion in a Predefined Location
(KO.fwdarw.KI)
[0426] To demonstrate a desired DNA region can be manipulated using
Cas9, a single guide RNA (gRNA) was selected at a desired region
(Exon 1 of gene X) FIG. 7. A targeting vector was also constructed,
which contained approximately 300 bp homology arms (5' and 3' HA)
flanking the gRNA. The homology arms will hybridise exactly in the
defined region and thus delete a 50 bp region, which is intended
for deletion. The targeting vector also allows for the insertion of
any DNA sequence of interest. In this proof of concept experiment,
we included an approximate 1.6 kb PGK-puromycin cassette. The guide
RNA (0.5 ug) together with the targeting vector (1 ug) and Cas9
nuclease vector (1 ug) was transfected into ES cells and 96 clones
were picked after selection on puromycin using the protocol
described above. Note. As a test for targeting efficiency, we
compared linear verses circular targeting vector. Also as a
negative control, we did the same experiment using no Cas9 vector
to compare targeting efficiency via homologous recombination with
and without Cas9 expression.
[0427] All the selected clones were puromycin resistant and the %
clones picked from each of the four transfections were genotyped
using the oligo pair HAP341/HAP334. Correctly targeted clones
yielded an 880 bp PCR product. The resulting genotyping data is
shown in FIG. 8.
[0428] From the genotyping data of this experiment, it can be seen
that Cas9 mediated double stranded DNA break greatly improves
homologous recombination efficiency of the targeting vector as 62%
and 49% of the clones using circular or linear targeting vector
respectively were correctly targeted verse only a single targeted
clone using circular targeting vector when no Cas9 was used. Also
it can be seen from this data that the circular targeting vector
yielded slightly better targeting efficiency than when linear
vector was used but a general conclusion cannot be drawn from this
single experiment but to say, both circular and linear targeting
vector yielded greatly improved targeting efficiency when
associated with Cas9 and a specific guide RNA. This experiment also
demonstrated that using Cas9 to create a define DNA breakage can be
used to delete out a defined DNA region and subsequently insert any
DNA fragment of interest
Example 2
Recycling PAM for Sequential Insertions or Deletions
[0429] In certain settings it may be useful to edit a genome by
chromosome walking. Using any of the three examples outlined above,
it could be possible to carry out sequential genome editing in a
stepwise fashion whereby the PAM sequence used in a previous round
of CRISPR/Cas mediated genome editing, can be re-used to carry out
multiple rounds of genome editing such as deletions, insertions or
the simultaneous deletion and insertion. An example of sequential
deletion whereby the PAM sequence from the previous genome editing
step is recycled is shown in FIG. 4A. Using the PAM recycling
approach, it is possible to carry out sequential insertions as well
as sequential simultaneous deletion and insertion.
[0430] The PAM sequence us recycled through reintroducing it via
homologous recombination and as part of the homology arm. The PAM
sequence can be optionally accompanied by a unique guide-RNA
sequence creating a novel site within the host genome for further
round of genome editing
Example 3
Rapid Insertion of Lox Sites Using CRISPR/Cas System
[0431] Targeting efficiency using conventional homologous
recombination methods in ES cells is low. In a different setting,
the CRISPR/Cas system can be used to rapidly and efficiently
introduce lox sites or other recombinase recognition sequence such
as Frt in a defined location to act as a landing pad for genome
editing using recombinase mediated cassette exchange (RMCE) (Qiao
J., Oumard A., Wegloehner W., Bode J.: Novel tag-and-exchange
(RMCE) strategies generate master cell clones with predictable and
stable transgene expression properties., J. Mol. Biol., 2009,
390(4):579-594; and Oumard A., Qiao J., Jostock T., Li J., Bode J.:
Recommended Method for Chromosome Exploitation: RMCE-based
Cassette-exchange Systems in Animal Cell Biotechnology.,
Cytotechnology 2006, 50(1-3):93-108). Once the lox sites are
introduced into the genome, inversion, deletion or cassette
exchange to delete and introduce DNA fragment varying in size at
this site can be efficiently conducted via expression of Cre
recombinase. An example of CRISPR/Cas mediated lox insertion
followed by RMCE is shown in FIG. 5A. The RMCE step can be used to
invert the region flanked by lox site or to delete this region as
well as to simultaneously delete and insert DNA of interest in this
region. Furthermore, the RMCE step can be adapted for carrying out
multiple sequential rounds of RMCE (sRMCE).
Example 4A
[0432] Reference is made to FIG. 6A. A piggyBac transposon
harbouring a PGK promoter-driven loxP/mutant lox-flanked neo.sup.R
gene is targeted into an ES cell genome by standard homologous
recombination. The targeted clones can be selected by G418. This
provides a landing pad for the following recombinase-mediated
cassette exchange (RMCE). Such an ES clone can be used a parental
cells for any modification further. A cassette containing the
loxP/mutant lox-flanked promoterless Puro.DELTA.TK-T2A-Cas9 and U6
polymerase III promoter-driven guide RNA (gRNA) genes are inserted
into the landing pad through transient cre expression. The gRNA
genes can be one or more than one which target to the same gene or
different genes. The inserted clones can be selected with puromycin
and confirmed by junction PCRs. During the selection, the
expression of Cas9 and gRNAs from the inserted cassette results in
more efficient gene targeting or modification than transient
expression of the Cas9 and gRNA can achieve. Following 4-6 day
selection, the whole modified cassette is excised by the transient
expression of piggyBac transposase (PBase). The final ES cell
clones would not contain any Cas9 or gRNA sequence. The clones with
homozygous modified genes would be confirmed by PCR and
sequence.
[0433] The main feature of this invention is to control the Cas9
and gRNA expression in certain time to be sufficient to generate
efficient targeting rates.
Example 4B
Single Copy Cas9 Expression
[0434] As detailed in example 6, to demonstrate the single and
stable expression of Cas9 from within the chromosome of a cell, we
targeted a landing pad vector into Rosa26 allele on chromosome 6.
DNA homology arms were used to target the landing pad vector in
between exons 2 and 3 of Rosa26. The landing pad vector was
targeted into ES cells using procedure described above. The
transfected ES clones were selected on G418 and genotyped for
correct targeting (FIG. 11) by PCR amplifying the 5' and 3'
homology arm junctions.
[0435] Targeting of the landing pad yielded many targeted ES
clones. A selection of the targeted clones were used to insert a
DNA cassette containing Cas9 nuclease linked to Puro-delta-tk via a
T2A sequence into the targeted landing pad via RMCE, which involved
the expression of Cre recombinase. The corresponding loxP and
lo2272 sites within both the landing pad and the incoming vector
ensured correct orientation of insertion. Since the landing pad
contained a geneless PGK promoter, correct insertion of the
incoming vector DNA containing Cas9, activated expression of
puromycin and thus clones were positively selected on puromycin.
Non-specific targeting of this DNA cassette will not yield
puromycin resistant clones due to the absence of a promoter driving
the transcription of the promoterless puromycin gene in the
inserted DNA cassette. The initial Cas9 vector inserted into the
landing pad did not contain any guide RNA sequence. The puromycin
resistant ES clones were genotyped by PCR for the correct insertion
of Cas9 (FIG. 12).
[0436] As expected owing to the positive selection, most of the
clones genotyped for insertion of the Cas9 vector were correctly
targeted via RMCE based on the PCR genotyping results. Two of the
correct clones (KHK1.6 Z2-24-27 and KHK1.10Z2-25-4 referred to as
positive Z clones) which now contain the single copy Cas9
integrated into the Rosa26 gene as a single copy were used to test
whether the Cas9 expression was sufficient enough to induce Cas9
mediated genome editing. Into the two positive Z clones, guide RNA
against a gene referred to as gene Y was transfected using
procedure described above. Following transfection and expansion of
the resulting ES clones, 36 individual clones were isolated from
each transfection and analysed initially by PCR using oligo
flanking the guide RNA (FIG. 13).
[0437] Most of the clones yielded a PCR product of size equivalent
to the positive control PCR where DNA from mouse AB2.1 ES cells was
used. However, it can be seen clearly that some clones yielded a
PCR product distinctively smaller than that of the positive control
suggesting these clones contain a significant deletion via indel.
To verify this and to check whether the rest of the PCR products
though similar in size to the positive control did not contain
indels, all the PCR products were purified using Qiagen gel
extraction kit and analysed by sequencing. The sequencing data
confirmed significant deletion for those PCR products that yielded
shorter products than the positive control. It also highlighted,
some of the other clones with similar PCR product size to the
positive control to contain indels, which included various
combinations of insertion and deletion (Sequencing data not shown).
Out of the clones analysed, 18% of them contained an indel. These
data clearly demonstrated that a single copy expression of Cas9 can
be used to carry out genome editing and these clones can now be
used as a Cas9 host cells for carrying out a multitude of genome
editing. These ES clones are now being used to generate transgenic
mouse lines whereby we can carry out a one-step genome editing by
injecting only guide mRNA directly into zygotes without the
requirement for transcribing Cas9 mRNA to simplify the one-step
genome editing protocol.
Example 5(A)
Methodology
A: Reconstructing CRISPR/Cas Vector System (Nuclease)
[0438] The CRISPR/Cas genome editing system has been reconstructed
in vitro and exemplified in mouse embryonic stem cells using vector
pX330 containing humanised S. pyogenes (hSpCsn1) (Cong et al.). The
CRISPR/Cas system can be reconstructed as described in Cong et al
using synthetic DNA strings and DNA assembly. In the present
example, the entire DNA assembly would constitute a 6006 bp
fragment containing 45 bp homology to pBlueScript KS+ vector 5' to
the EcoRV cutting site, Human U6 promoter, two BbsI restriction
sites for cloning in the spacer sequence which fuses to a chimeric
guided RNA sequence, chicken beta-actin promoter with 3 FLAG,
nuclear localisation signal (NLS) followed by hSpCsn1 sequence and
another NLS, bGH polyA, inverted terminal repeat sequence and
finally another 45 bp homology to pBlueScript KS+ 3' to the EcoRV
cutting site. This 6006 bp stretch of DNA will be synthesized as 7
individual DNA fragments where each fragment will have a 45 bp
overlap to the adjacent DNA fragment to allow DNA assembly. The DNA
sequence of these fragments is shown below in the order of
assembly
TABLE-US-00002 Fragment 1A (1340 bp) (SEQ ID NO: 7)
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATGAG
GGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT
GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTA
GTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCA
GTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACT
TGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGA
AACACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGT
TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG
GTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG
TCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGG
TACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCA
ACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCC
ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAG
TACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATG
ACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGG
ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCA
TGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCC
CCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTG
CAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGG
GGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAG
CCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGC
GGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCG
CTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGC
CGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGG
CGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAA
GGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTG
GAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGGACCGGTGCCACCA
TGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATT Fragment 2 (852 bp)
(SEQ ID NO: 8) ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGAT
TACAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTC
GGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTG
GACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTAC
AAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCAC
AGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAA
ACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACC
AGACGGAAGAACCGGATCTCTCTATCTGCAAGAGATCTTCAGCAACGA
GATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTT
CCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAA
CATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCA
CCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCT
GATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCT
GATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTT
CATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCAT
CAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAG
CAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAA
GAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGC Fragment 3 (920 bp) (SEQ ID
NO: 9) GGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTG
GGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCC
AAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTG
CTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAG
AACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACC
GAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGAC
GAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAG
CTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGC
TACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAG
TTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTC
GTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGAC
AACGGCAGCATCCCCCACCAGATCCACCTGCGAGAGCTGCACGCCATT
CTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAA
AAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCT
CTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAG
GAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCT
TCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTG
CCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTC
ACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATG AGAAAGCC Fragment
4 (920 bp) (SEQ ID NO: 10)
CGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGC
CTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAA
GACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAA
GAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCG
GTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAA
GGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGA
TATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGA
ACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCA
GCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCT
GATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTT
CCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCA
CGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTC
CGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAG
CCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGA
GCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGA
AATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCG
CGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCA
GATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAA
GCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCA GGAACTGG Fragment
5 (920 bp) (SEQ ID NO: 11)
ACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACA
TCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCT
TTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACA
AGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGA
AGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCC
AGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCG
AACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGC
AGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTA
AGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCC
TGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACA
AAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGA
ACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAA
GCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGA
TCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCT
TCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCA
ACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCG
GGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAG
TGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGA
CAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATA AGCTGATC Fragment
6 (789 bp) (SEQ ID NO: 12)
AGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCC
AGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCC
ACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAG
TCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATG
GAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAG
GGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTAC
TCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCC
GGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTG
AACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCC
GAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTAC
CTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATC
CTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCAC
CGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTT
ACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACC
ACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCC
ACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGAC
CTGTCTCAGCTGGGAGGCGAC Fragment 7 (535 bp) (SEQ ID NO: 13)
GGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAA
AGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAA
GAATTCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCC
AGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAG
GTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
ATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG
ACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGC
GGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCG
CTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGG
GCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGC
AGGGGCGCCTATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAG AGCGGCC
[0439] To reconstruct the CRISPR/Cas system described in Cong et al
the above DNA fragments in addition to EcoRV linearised pBlueScript
KS++ vector will be assembled using Gibson Assembly kit (NEB Cat
No. E5510S). As an alternative approach, the 6006 bp fragment can
be assembled by assembly PCR by mixing molar ratio of the
individual DNA fragments together and using the DNA mixture as PCR
template. The assembled PCR product can then be cloned directly
into pBlueScript vector or a standard cloning vector system such as
a TOPO TA cloning kit (Invitrogen).
B: Reconstructing CRISPR/Cas Vector System (D10A Nickase)
[0440] The D10A nickase version of the CRISPR/Cas system can be
conveniently reconstructed by assembling the above fragments where
fragment 2 is replaced with fragment 2A which contains the D10A
substitution (See sequence below).
TABLE-US-00003 Fragment 2A (852 bp) (SEQ ID NO: 14)
ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGA
TTACAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGG
TCGGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGC
CTGgccATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGA
GTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACC
GGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGC
GGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAG
ATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCA
GCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAA
GAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCAT
CTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCA
CCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCC
GACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCG
GGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACG
TGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTC
GAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCT
GTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCC
AGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCC CTGAGC
[0441] The substituted aspartate to alanine is highlighted in bold
and underlined.
C: Target (Spacer) Sequence Cloning
[0442] The target spacer sequence can be cloned into the above
CRISPR/Cas vector system via the BbsI restriction sites located
upstream of the chimeric guided RNA sequence. The spacer sequence
can be ordered as oligo pairs and annealed together with overhangs
as shown below to allow direct cloning into BbsI linearised
CRISPR/Cas vector using standard molecular biology protocols.
[0443] Sequence of an example oligo pair with spacer sequence:
TABLE-US-00004 (SEQ ID NO: 15) 5'-CACCGNNNNNNNNNNNNNNNNNNN-3' (SEQ
ID NO: 16) 3'-CNNNNNNNNNNNNNNNNNNNCAAA-5'
[0444] The 4 bp overhang sequence underlined is required to be
included in the spacer oligos to facilitate cloning into the BbsI
restriction site in the CRISPR/Cas vector. Using this approach, any
spacer sequence can be conveniently cloned into the CRISPR/Cas
vector.
D: Reconstructing CRISPR/Cas System for One-Step Generation of
Transgenic Animals
[0445] In order to reconstitute a CRISPR/Cas system for one-step
generation of transgenic animal as described in Wang et al. (Wang
H., Yang H., Shivalila C. S., Dawlaty M. M., Cheng A. W., Zhang F.,
Jaenisch R.: One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering., Cell,
2013, 153(4):910-918) where direct embryo injection is used, the
above detailed CRISPR/Cas vector system needs to be modified to
incorporate a T7 polymerase promoter to the Cas9 coding sequence.
In addition, the gRNA needs to be removed and synthetised
separately by annealing oligos or produced synthetically (See below
for an example T7-spacer sequence fused to chimeric guided RNA
sequence-T7-gRNA). Note, ideally the spacer sequence will be
designed in a unique region of a given chromosome to minimise
off-target effect and also the respective protospacer genomic
sequence needs to have a PAM at the 3'-end.
Example T7-gRNA Sequence
TABLE-US-00005 [0446] (SEQ ID NO: 17)
TTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAG
AGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGA
AAAAGTGGCACCGAGTCGGTGCTTTTTT
[0447] The underlined 20 bp of N's depicts the spacer sequence for
a given target DNA.
[0448] To reconstruct the one-step CRISPR/Cas system, the above
detailed DNA fragments (Fragments 2, 3, 4, 5, 6 & 7) can be
assembled together where fragment 1A (containing 45 bp homology to
pBlueScript KS+ vector 5' to the EcoRV restriction site, human U6
promoter. BbsI restriction sites, chimeric guided RNA sequence and
chicken b-actin promoter) is replaced with fragment 1, which only
contains 45 bp homology to pBlueScript KS+ vector and the DNA
sequence for T7 polymerase promoter with 45 bp homology to fragment
2. This will create the nuclease version of the CRISPR/Cas system
for one-step generation of transgenic animals. To create the
nickase version, fragment 2 can be replaced with fragment 2A as
detailed above and then fragments 1, 2A, 3, 4, 5, 6 and 7 can be
assembled together either by Gibson assembly or by assembly
PCR.
TABLE-US-00006 Fragment 1 (111 bp) (SEQ ID NO: 18)
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATAA
TACGACTCACTATAGGGAGAATGGACTATAAGGACCACGACGGAGAC
TACAAGGATCATGATATT
E: Preparation of Oligo/DNA Fragments for HDR-Mediated Repair
[0449] DNA oligos ranging from 15 bp and upwards in excess of
>125 bp will be synthetised through Sigma Custom Oligo synthesis
Service. The oligos can contain any sequence such as a defined
mutation, introduced restriction sites or a sequence of interest
including recombination recognition sequence such as loxP or
derivatives thereof. Frt and derivatives thereof or PiggyBac LTR or
any other transposon elements or regulatory elements including
enhancers, promoter sequence, reporter gene, selection markets and
tags. The oligo design will incorporate DNA homology to the region
where Cas9 mediates double-stranded DNA break or DNA nick. The size
of the homology will range from a few base pairs (2-5 bp) to
upwards and in excess of 80 bp. Larger DNA fragments (>100 bp
ranging up to several kilobases) will be prepared either
synthetically (GeneArt) or by PCR. The DNA fragment will be
synthetised either with or without flanked NLS or only with a
single NLS and either with or without a promoter (e.g. T7
polymerase promoter). The DNA can be prepared as a single stranded
DNA fragment using either the capture biotinylated target DNA
sequence method (Invitrogen: Dynabeads M-270 Streptavidin) or any
other standard and established single stranded DNA preparation
methodology. The single stranded DNA can be prepared for
microinjection by IVT as described above and the mRNA co-injected
with Cas9 mRNA and gRNA. The DNA fragment can also be co-injected
as a double stranded DNA fragment. The DNA fragment will be flanked
by DNA homology to the site where Cas9 mediates double-stranded DNA
break or DNA nick. The DNA homology can range from a few base pairs
(2-5 bp) and up to or in excess of several kilobases. The DNA
fragment can be used to introduce any endogenous or exogenous
DNA.
[0450] HDR-mediated repair can also be done in ES cells following
CRISPR/Cas-mediated DNA cleavage. The above mentioned donor oligo
or DNA fragment can be co-transfected into ES cells along with the
CRISPR/Cas expression vector.
F: Production of Cas9 mRNA and gRNA
[0451] Vector containing the T7 polymerase promoter with the coding
region of humanised Cas9 will be PCR amplified using oligos Cas9-F
and Cas9-R. The T7-Cas9 PCR product can be gel extracted and the
DNA purified using Qiagen gel extraction kit. The purified T7-Cas9
DNA will be used for in vitro transcription (IVT) using mMESSAGE
mMACHINE T7 Ultra Kit (Life Technologies Cat No. AM1345). The
vector containing the T7-gRNA can be PCR amplified using oligos
gRNA-F and gRNA-R and once again the PCR products gel purified. IVT
of the T7-gRNA will be carried out using MEGAshortscript T7 Kit
(Life Technologies Cat No. AM1354) and the gRNA purified using
MEGAclear Kit (Life Technologies Cat No. AM1908) and eluted in
RNase-free water.
TABLE-US-00007 Cas9-F: (SEQ ID NO: 19) TTAATACGACTCACTATAGG Cas9-R:
(SEQ ID NO: 20) GCGAGCTCTAGGAATTCTTAC gRNA-F: (SEQ ID NO: 21)
TTAATACGACTCACTATAGG gRNA-R: (SEQ ID NO: 22)
AAAAAAGCACCGACTCGGTGCCAC
Example 5B
One Step Generation of Transgenic Animals
A: ES Cell Transfection Procedure
[0452] Mouse embryonic stem cells AB2.1 and derivatives of this
line will be used for transfecting the mammalian codon optimised
Cas9 and sgRNA from a single expression vector or from separate
vectors if desired. AB2.1 ES cells will be cultured on a PSNL76/7/4
MEF feeder layer in M-15: Knockout DMEM (Gibco, no pyruvate, high
glucose, 15% FBS, 1.times.GPS, 1.times.BME) with standard ES cell
culturing techniques. Transfection of CRISPR/Cas expression vector
along with the optional addition of a donor oligo or DNA fragment
will be done by electroporation using the Amaxa
4D-Nucleofector.RTM. Protocol (Lonza). A plasmid expressing
PGK-Puro will also be optionally co-transfected to promote
transfection efficiency.
[0453] In one method, after transfection ES cells will be plated
back onto feeder plates and Puromycin (2 .mu.g/ml) will be added 72
hours post transfection for 7 days after which colonies will be
picked and genotyped by PCR. Positive colonies will be further
cultured and expanded on feeder layer and selection markers where
necessary will be excised using a PiggyBac transposon system. This
will be done by electroporation of ES cells with a plasmid
containing HyPbase using the Amaxa 4D-Nucleofector.RTM. Protocol
(Lonza). The ES cell will be plated back onto feeder plates. ES
cells will be passaged 2-3 days post transfection and after a
further 2-3 days the ES cells will be plated out at different cells
densities (1:10, 1:20, 1:100 and 1:300) and FIAU (2 .mu.g/ml)
selection will be added 24 hours after replating. Colonies will be
picked and analysed by PCR genotyping after 7-10 days on selection
media. Positive clones will be further cultured and expanded on
feeder layer and sent for zygote (blastocyst) microinjection.
[0454] In an alternative method, 8 hours prior to transfection ES
cells are seeded at a density of 0.5.times.106 cells using
antibiotic free M-15 Knockout DMEM (Gibco, no pyruvate, high
glucose, 15% FBS, 1.times.L-Glutamine, 1.times.BME) onto 6w feeder
plates. Transient transfection is performed using
Lipofectamine.RTM. LTX Reagent with PLUS.TM. Reagent
(Invitrogen.TM.) by standard protocol. After incubation time
transfection reagents are transferred to feeder plates (cultured in
antibiotic free media), media (M-15) will not be changed on these
plates for at least 24 hours post transfection. 48 hours post
transfection ES cells are trypsinized into a single cell suspension
and a cell count is carried out and cells are plated out at
different cell densities ranging for 100-5000 cells per 10 cm
feeder plate. 24 hours after replating Puro selection at 2 .mu.g/ml
(Puromycin dihydrochloride from Streptomyces alboniger powder,
P8833 Sigma) is applied to the cells for 4 days, after which cells
are cultured again in M-15. Colonies are picked 10-13 days post
transfection.
Method 5C: Microinjection of Mouse Zygotes--Method 1
Materials and Reagents:
[0455] M2 (Sigma M7167) [0456] Embryo Max KSOM (Speciality media
MR-020P-F) [0457] Hyaluronidase (Sigma H4272) [0458] Mineral Oil
(Sigma, M-8410)
Possible Donor Strains:
[0458] [0459] S3F/S3F:KF3/KF3 [0460] S3F/S3F:K4/K4 [0461] S7F/S7F
[0462] K5F/K5F
Preparation of Zygotes and Microinjection:
[0463] The protocol is as described in: A. Nagy Et al. Manipulating
the Mouse Embryo 3rd Edition. Chapter 7, Protocols 7-1, 7-6, 7-10,
7-11. Cold Spring Harbor Laboratory Press.
[0464] In brief: [0465] 1. Zygotes are harvested from E0.5 dpc (day
post-coitum) superovulated female mice. [0466] 2. The zygotes are
incubated in hyaluronidase to disperse cumulus cells. [0467] 3.
Zygotes are collected and transferred to several drops of M2 medium
to rinse off the hyaluronidase solution and debris. Zygotes are
placed into KSOM Media and incubated at 37.degree. C. 5% CO.sub.2
until required. [0468] 4. Zygote quality is assessed and zygotes
with normal morphology are selected for injection, these are placed
in KSOM media and incubated at 37.degree. C. 5% CO.sub.2 until
required.
Microinjection Set Up:
[0469] Injection procedures are performed on a Nikon Eclipse Ti
inverted microscope with Eppendorf micromanipulators and an
Eppendorf femtojet injection system. A slide is prepared by adding
a large drop .about.200 microlitres of M2 into the centre.
Microinjection:
[0470] Place an appropriate number of zygotes onto the slide.
Examine the zygotes and select only those with normal morphology (2
distinct pronuclei are visible). Whilst holding a zygote with a
male pronucleus closest to the injection pipette, carefully push
the injection pipette through the zona pellucida into the
pronucleus, apply injection pressure, the pronucleus should visibly
swell, remove the injection pipette quickly. The injected zygote
can be placed down while the rest are injected.
[0471] At the end of the injection session all viable injected
zygotes should be placed into prepared dishes containing drops of
KSOM and incubated until ready to surgically implant. They are
incubated for 2-3 hours before surgically implanting into pseudo
pregnant females. Pups will be born 21 days later.
Method 5C: Microinjection of Mouse Zygotes--Method 2
Materials and Reagents
[0472] PMSG [0473] hCG [0474] M2 (Sigma M7167) [0475] Embryo Max
KSOM (Specialty media MR-020P-F) [0476] Mineral Oil (Sigma, M-8410)
[0477] Hyluronidase (Sigma H 4272) [0478] 35 mm Falcon Petri dishes
(Fisher 08-757-100A) [0479] Sharp scissors [0480] Sharp watchmakers
forceps
Preparation of Oocytes:
[0480] [0481] 1. Day 0: Give PMSG (5 I.U.) to the females by I. P.
injection. [0482] 2. Day 2: Give hCG (5 I.U.) to the females 48
Hours later by I. P. injection. Mate the females to stud males.
[0483] 3. Day 3: Check plugs, sacrifice plugged female mice by CO2
asphyxiation or cervical dislocation at 0.5 dpc at 8.00 am. [0484]
4. Dissect open the abdomen, locate the ovary and fat pad, dissect
out the oviduct leaving the ovary and fat, trimming the uterine
horn to .about.1 cm, place into a 35 mm Petri dish containing M2 at
room temp. [0485] 5. Place one ovary at a time into a dish
containing hyaluronidase solution in M2 (.about.0.3 mg/ml) at room
temp. View through a stereoscope at 20.times. or 40.times.
magnification. [0486] 6. Use one pair of forceps to grasp the
oviduct and hold it on the bottom of the dish. Use the second pair
of forceps or a 26 g needle to tear the oviduct close to where the
zygotes are located (the ampulla), releasing the clutch of cumulus
cells. [0487] 7. The zygotes should be left in the hyaluronidase
for a few minutes only, after which time the zygotes may become
damaged. If necessary pipette them up and down a few times to help
the release of the zygotes from the cumulus cells. [0488] 8. Use a
mouth pipette to pick up the zygotes and transfer them to a fresh
dish of M2, then transfer through several drops of M2 to rinse off
the hyaluronidase, cumulus cells and debris. Sort through the
zygotes removing any obviously bad ones (fragmented, misshapen, not
fertilized), and place the good ones (two polar bodies should be
visible and any with polar bodies) into equilibrated drops of KSOM+
AA at 37.degree. c. and 5% CO.sub.2, keep incubated until needed.
Place about 50 eggs per drop.
Pronuclear Microinjection
[0488] [0489] 1. Microinjection set up: Injection procedures are
performed on a Nikon Eclipse Ti inverted microscope with Eppendorf
micromanipulators. Prepare a 60 mm petri dish to place injected
zygotes into. Pipette four-six 40 .mu.l drops of KSOM+AA. cover
with oil and place in a 5% CO.sub.2 incubator to equilibrate.
Prepare a cavity slide by making a large (.about.200 .mu.l) drop of
M2 media onto the center of the well, add a small drop of medium on
the left side of the slide, for the holding pipette. [0490] 2.
Microinjection: Ensure that the pressurized injector has been
switched on and is ready to use. Place an appropriate number of
zygotes onto the slide, do not add more zygotes than can be
injected within 20-30 mins. Place the holding pipette into the drop
of M2 on the left of the slide; it will fill using capillary
action, once filled to about the shoulder attach to the
manipulator. Carefully examine the zygotes, making sure that two
pronuclei are visible and morphology is good, discard any that
appear abnormal. To test if the injection needle is open, place the
tip near to but not touching a zygote in the same focal plane.
Apply pressure using the pressurized system, if the zygote moves
the needle is open, if it doesn't the needle is closed. In this
case apply pressure using the "clear` feature, if the tip is still
not open manually break the tip. Carefully "knock" the tip on the
holding pipette and repeat the above test, make sure the tip does
not become too large, if this happens replace the needle and start
again. Place the tip of the holding pipette next to a zygote and
suck it onto the end of the pipette by applying negative pressure.
Focus the microscope to locate the pronuclei, the zygote should be
positioned in such a way that allows injection into the zygote
without hitting the pronuclei, preferably with a gap between the
zona pellucida and the oolema. Bring the tip of the injection
needle into the same focal plane as the zona pellucida. Bring the
injection pipette to the same y-axis position as the zona
pellucida, adjust the height of the needle so the tip appears
completely sharp, without changing the focus. This ensures the
needle will target the zygote exactly. Push the injection pipette
through the zona pellucida, through the cytoplasm towards the back
of the zygote. The needle will create a "bubble" through the
oolema, this needs to be broken, you will see it snap back at which
point remove the needle quickly, you will see the cytoplasm moving
to indicate RNA is flowing from the needle. Cytoplasmic granules
flowing out of the oocytes after removal of the injection pipette
is a clear sign that the zygote will soon lyse. In this case, or if
nuclear/cytoplasmic components are sticking to the injection
pipette, the oocytes should be discarded after injection. If the
zygote appears to be intact and successfully injected, sort this
into a good group. Pick a new zygote for injection. The same
injection pipette can be used as long as it continues to inject
successfully. Switch to a new injection pipette if (a) you cannot
see any cytoplasmic distortion (b) zygotes are lysing one after the
other; (c) the tip of the pipette becomes visibly "dirty" or
nuclear contents stick to the pipette. Once all the zygotes have
been injected, remove them and place them into the equilibrated
KSOM+AA and place them into the incubator at 37.degree. C.
overnight. Only transfer those zygotes that have survived
injection, and cultured to the 2 cell stage. Leave any lysed ones,
and zygotes that have not developed. [0491] 3. Count the total
number injected and record the numbers transferred per
recipient
Results
[0492] To demonstrate the efficient of the one-step generation of
transgenic mice, we used our T7-Cas9 nuclease vector to generate
mRNA via in vitro transcription detailed above. mRNA from the guide
RNA was also produced using in vitro transcription described above.
Before injecting the mRNA mixture into the cytoplasm, oocytes were
prepared from female mice using the protocol detailed above. An
mRNA mixture containing 100 ng/ul Cas9 nuclease mRNA and 50 ng/ul
guide mRNA was injected by microinjection into the cytoplasm as
detailed above. The microinjection is done at the single-cell
stage. Zygotes that survived the injection were cultured to 2 cell
stage, which were then transferred to recipient mice.
[0493] In total, 107 zygotes were injected from which 49 survived
and went to 2 cell stage. These were then transferred to two
recipient female mice. This resulted in 19 pups from 2 litters.
Litter 1 yielded 3 males and 6 females. Litter 2 yielded 4 males
and 6 females. The pups were ear clipped 3 weeks after birth and
DNA was extracted. PCR was carried out using oligos flanking the
gRNA to detect possible indels (FIG. 14).
[0494] PCR amplifying around the guide RNA and separating out the
PCR products on an agarose gel highlighted at least one mouse
contained a large indel in the form of a deletion, whereas other
mice appeared to have smaller indels judging by the sharpness of
the PCR product on the gel. As an initial crude analysis, all the
PCR products were sent for sequencing and those marked with an
asterix (7 mice in total, FIG. 14) yielded mix sequences around the
gRNA further confirming they contain indels. To confirm this, the
PCR products from these 7 mice together with the PCR product from
another mouse which did not yield a mix sequence (PCR product from
lane 19, FIG. 14) were individually cloned into a general cloning
vector. From each individual cloning, 28 clones were picked and
analysed by sequencing. The sequencing confirmed all 7 mice contain
indels and the mice that did not contain any mix sequence contained
no indels. The sequencing data is summarised in FIG. 15.
[0495] The sequencing data confirmed all of the mice analysed
contained indels. It also suggests that using our zygote injection
protocol detailed above and our method for preparing mRNA for Cas9
and guide RNA, Cas9 works efficiently at an early stage and until
the point where cells starts to divide beyond the 2 cell stage
judging by the fact that in all of the mice analysed, no more than
3 types of indels were identified. Out of the 7 mice containing
indels, 3 of them had no detectable WT sequence. The female mouse
(KMKY6.1j) that did not show mix sequence from the initial
sequencing analysis indeed did not contain any indels so it
validates our initial sequencing analysis of the PCR products.
[0496] The male mouse (KMKY5.1c) that showed no WT sequence was
used as a mating partner for the two female mice (KMKY5.1e &
KMKY6.1e) that showed no WT sequence too. The resulting pups from
the two matings yielded 14 pups in total from the first litter.
Following similar sequencing analysis whereby PCR products
amplified from the region around the guide RNA were cloned
individual and several clones were then analysed for the presence
of indels. For each mouse, 24 clones were analysed by sequencing.
The sequencing data from all 14 pups confirmed only two indel
sequences reflecting the two alleles arising from the parental male
and female mouse. This data unequivocally demonstrates that our
one-step genome editing protocol works very efficiently at an early
stage and not beyond the 2 cell stage thus avoiding complex mosaic
indel formation. Using our established protocol, we can carry out
define deletions directly in zygotes or carry out define deletion
followed by insertion to expedite the process of generating
transgenic mice to homozygosity in record time.
Example 6
Single Copy Cas9 Expression in ES Cells
[0497] Reference is made to FIG. 6B. [0498] 1. A landing pad
consisting of a PiggyBac transposon element with the following
features will be targeted into mouse ES cells (e.g., 129-derived ES
cells, such as AB2.1 ES cells: Baylor College of Medicine, Tex.,
USA) and selected for on G418. The PiggyBac transposon element will
contain neomycin resistance gene flanked by loxP and lox2272. It
will also have a geneless PGK promoter. In this example, the
landing pad will be targeted into the introgenic region of Rosa26
gene located on chromosome 6, but it could be targeted elsewhere.
Targeting this landing pad in the Rosa26 gene will provide a
universal ES cell line for precisely inserting any desired DNA
fragment including DNA fragments containing Cas9, mutant Cas9 or
any other gene of interest via RMCE with high efficiency. Targeting
Rosa26 is beneficial since the targeted construct will be inserted
as a single copy (unlike random integration elsewhere) and is
unlikely to produce an unwanted phenotypic effect.
[0499] Note. This landing pad can be inserted into any gene in any
chromosome or indeed in any eukaryotic or mammalian cell line,
e.g., a human, insect, plant, yeast, mouse, rat, rabbit, rodent,
pig, dog, cat, fish, chicken or bird cell line, followed by
generation of the respective transgenic organism expressing
Cas9.
Rosa 26 Locus
[0500] Ubiquitous expression of transgene in mouse embryonic stem
cell can be achieved by gene targeting to the ROSA26 locus (also
known as: gene trap ROSA 26 or Gt(ROSA)26) by homologous
recombination (Ref. (a) and (b) below). The genomic coordinates for
mouse C57BL/6J Rosa26 gene based on Ensemble release 73--September
2013 is: Chromosome 6: 113,067,428-113,077,333; reverse strand.
[0501] The Rosa26 locus can also be used to as a recipient location
to knock-in a transgene. In our example we have use the Rosa26
locus to knock-in the landing pad vector by targeting through
homologous recombination into the intronic region located between
exons 2 and 3 of mouse strain 129-derived embryonic stem cells
using approx. 3.1 kb homology arms. The homology arms were
retrieved by recombineering from a BAC Clone generated from mouse
strain 129. The sequence of the Rosa26 homology arms used for
targeting is given below.
TABLE-US-00008 Sequence of Rosa26 5' homology arm (SEQ ID NO: 23)
CACATTTGGTCCTGCTTGAACATTGCCATGGCTCTTAAAGTCTTAAT
TAAGAATATTAATTGTGTAATTATTGTTTTTCCTCCTTTAGATCATT
CCTTGAGGACAGGACAGTGCTTGTTTAAGGCTATATTTCTGCTGTCT
GAGCAGCAACAGGTCTTCGAGATCAACATGATGTTCATAATCCCAAG
ATGTTGCCATTTATGTTCTCAGAAGCAAGCAGAGGCATGATGGTCAG
TGACAGTAATGTCACTGTGTTAAATGTTGCTATGCAGTTTGGATTTT
TCTAATGTAGTGTAGGTAGAACATATGTGTTCTGTATGAATTAAACT
CTTAAGTTACACCTTGTATAATCCATGCAATGTGTTATGCAATTACC
ATTTTAAGTATTGTAGCTTTCTTTGTATGTGAGGATAAAGGTGTTTG
TCATAAAATGTTTTGAACATTTCCCCAAAGTTCCAAATTATAAAACC
ACAACGTTAGAACTTATTTATGAACAATGGTTGTAGTTTCATGCTTT
TAAAATGCTTAATTATTCAATTAACACCGTTTGTGTTATAATATATA
TAAAACTGACATGTAGAAGTGTTTGTCCAGAACATTTCTTAAATGTA
TACTGTCTTTAGAGAGTTTAATATAGCATGTCTTTTGCAACATACTA
ACTTTTGTGTTGGTGCGAGCAATATTGTGTAGTCATTTTGAAAGGAG
TCATTTCAATGAGTGTCAGATTGTTTTGAATGTTATTGAACATTTTA
AATGCAGACTTGTTCGTGTTTTAGAAAGCAAAACTGTCAGAAGCTTT
GAACTAGAAATTAAAAAGCTGAAGTATTTCAGAAGGGAAATAAGCTA
CTTGCTGTATTAGTTGAAGGAAAGTGTAATAGCTTAGAAAATTTAAA
ACCATATAGTTGTCATTGCTGAATATCTGGCAGATGAAAAGAAATAC
TCAGTGGTTCTTTTGAGCAATATAACAGCTTGTTATATTAAAAATTT
TCCCCACAGATATAAACTCTAATCTATAACTCATAAATGTTACAAAT
GGATGAAGCTTACAAATGTGGCTTGACTTGTCACTGTGCTTGTTTTA
GTTATGTGAAAGTTTGGCAATAAACCTATGTCCTAAATAGTCAAACT
GTGGAATGACTTTTTAATCTATTGGTTTGTCTAGAACAGTTATGTTG
CCATTTGCCCTAATGGTGAAAGAAAAAGTGGGGAGTGCCTTGGCACT
GTTCATTTGTGGTGTGAACCAAAGAGGGGGGCATGCACTTACACTTC
AAACATCCTTTTGAAAGACTGACAAGTTTGGGTCTTCACAGTTGGAA
TTGGGCATCCCTTTTGTCAGGGAGGGAGGGAGGGAGGGAGGCTGGCT
TGTTATGCTGACAAGTGTGATTAAATTCAAACTTTGAGGTAAGTTGG
AGGAACTTGTACATTGTTAGGAGTGTGACAATTTGGACTCTTAATGA
TTTGGTCATACAAAATGAACCTAGACCAACTTCTGGAAGATGTATAT
AATAACTCCATGTTACATTGATTTCACCTGACTAATACTTATCCCTT
ATCAATTAAATACAGAAGATGCCAGCCATCTGGGCCTTTTAACCCAG
AAATTTAGTTTCAAACTCCTAGGTTAGTGTTCTCACTGAGCTACATC
CTGATCTAGTCCTGAAAATAGGACCACCATCACCCCCAAAAAAATCT
CAAATAAGATTTATGCTAGTGTTTCAAAATTTTAGGAATAGGTAAGA
TTAGAAAGTTTTAAATTTTGAGAAATGGCTTCTCTAGAAAGATGTAC
ATAGTGAACACTGAATGGCTCCTAAAGAGCCTAGAAAACTGGTACTG
AGCACACAGGACTGAGAGGTCTTTCTTGAAAAGCATGTATTGCTTTA
CGTGGGTCACAGAAGGCAGGCAGGAAGAACTTGGGCTGAAACTGGTG
TCTTAAGTGGCTAACATCTTCACAACTGATGAGCAAGAACTTTATCC
TGATGCAAAAACCATCCAAACAAACTAAGTGAAAGGTGGCAATGGAT
CCCAGGCTGCTCTAGAGGAGGACTTGACTTCTCATCCCATCACCCAC
ACCAGATAGCTCATAGACTGCCAATTAACACCAGCTTCTAGCCTCCA
CAGGCACCTGCACTGGTACACATAATTTCACACAAACACAGTAAGAA
GCCTTCCACCTGGCATGGTATTGCTTATCTTTAGTTCCCAACACTTG
GGAGGCAGAGGCCAGCCAGGGCTATGTGACAAAAACCTTGTCTAGAG
GAGAAACTTCATAGCTTATTTCCTATTCACGTAACCAGGTTAGCAAA
ATTTACCAGCCAGAGATGAAGCTAACAGTGTCCACTATATTTGTAGT
GTTTTAAGTCAATTTTTTAAATATACTTAATAGAATTAAAGCTATGG
TGAACCAAGTACAAACCTGGTGTATTAACTTGAGAACTTAGCATAAA
AAGTAGTTCATTTGTTCAGTAAATATTAAATGCTTACTGGCAAAGAT
TATGTCAGGAACTTGGTAAATGGTGATGAAACAATCATAGTTGTACA
TCTTGGTTCTGTGATCACCTTGGTTTGAGGTAAAAGTGGTTCCTTTG
ATCAAGGATGGAATTTTAAGTTTATATTCAATCAATAATGTATTATT
TTGTGATTGCAAAATTGCCTATCTAGGGTATAAAACCTTTAAAAATT
TCATAATACCAGTTCATTCTCCAGTTGATCAAGGATGGAATTTTAAG
TTTATATTCAATCAATAATGTATTATTTTGTGATTGCAAAATTGCCT
ATCTAGGGTATAAAACCTTTAAAAATTTCATAATACCAGTTCATTCT
CCAGTTACTAATTCCAAAAAGCCACTGACTATGGTGCCAATGTGGAT
TCTGTTCTCAAAGGAAGGATTGTCTGTGCCCTTTATTCTAATAGAAA
CATCACACTGAAAATCTAAGCTGAAAGAAGCCAGACTTTCCTAAATA
AATAACTTTCCATAAAGCTCAAACAAGGATTACTTTTAGGAGGCACT
GTTAAGGAACTGATAAGTAATGAGGTTACTTATATAATGATAGTCCC
ACAAGACTATCTGAGGAAAAATCAGTACAACTCGAAAACAGAACAAC
CAGCTAGGCAGGAATAACAGGGCTCCCAAGTCAGGAGGTCTATCCAA
CACCCTTTTCTGTTGAGGGCCCCAGACCTACATATTGTATACAAACA
GGGAGGTGGGTGATTTTAACTCTCCTGAGGTAC Sequence of Rosa26 3' homology
arm (SEQ ID NO: 24) CTTGGTAAATCTTTGTCCTGAGTAAGCAGTACAGTGTACAGTTTACA
TTTTCATTTAAAGATACATTAGCTCCCTCTACCCCCTAAGACTGACA
GGCACTTTGGGGGTGGGGAGGGCTTTGGAAAATAACGCTTCCATACA
CTAAAAGAGAAATTTCTTTAATTAGGCTTGTTGGTTCCATACATCTA
CTGGTGTTTCTACTACTTAGTAATATTATAATAGTCACACAAGCATC
TTTGCTCTGTTTAGGTTGTATATTTATTTTAAGGCAGATGATAAAAC
TGTAGATCTTAAGGGATGCTTCTGCTTCTGAGATGATACAAAGAATT
TAGACCATAAAACAGTAGGTTGCACAAGCAATAGAATATGGCCTAAA
GTGTTCTGACACTTAGAAGCCAAGCAGTGTAGGCTTCTTAAGAAATA
CCATTACAATCACCTTGCTAGAAATCAAGCATTCTGGAGTGGTCAAG
CAGTGTAACCTGTACTGTAAGTTACTTTTCTGCTATTTTTCTCCCAA
AGCAAGTTCTTTATGCTGATATTTCCAGTGTTAGGAACTACAAATAT
TAATAAGTTGTCTTCACTCTTTTCTTTACCAAGGAGGGTCTCTTCCT
TCATCTTGATCTGAAGGATGAACAAAGGCTTGAGCAGTGCGCTTTAG
AAGATAAACTGCAGCATGAAGGCCCCCGATGTTCACCCAGACTACAT
GGACCTTTCGCCACACATGTCCCATTCCAGATAAGGCCTGGCACACA
CAAAAAACATAAGTCATTAGGCTACCAGTCTGATTCTAAAACAACCT
AAAATCTTCCCACTTAAATGCTATGGGTGGTGGGTTGGAAAGTTGAC
TCAGAAAATCACTTGCTGTTTTTAGAGAGGATCTGGGTTCAGTTTCT
GATACATTGTGGCTTACAACTATAACTCCAGTTCTAGGGGGTCCATC
CAACATCCTCTTCTGTTGAGGGCACCAAATAAATGTATTGTGTACAA
ACAGGGAGGTGAGTGATTTAACTCTCGTGTATAGTACCTTGGTAAAA
CATTTCTTGTCCTGAGTAAGCAGTACAGCTCTGCCTGTCCCTGGTCT
ACAGACACGGCTCATTTCCCGAAGGCAAGCTGGATAGAGATTCCAAT
TTCTCTTCTTGGATCCCATCCTATAAAAGAAGGTCAAGTTTAATCTA
TTGCAAAAGGTAAATAGGTAGTTTCTTACATGAGACAAGAACAAATC
TTAGGTGTGAAGCAGTCATCTTTTACAGGCCAGAGCCTCTATTCTAT
GCCAATGAAGGAAACTGTTAGTCCAGTGTTATAGAGTTAGTCCAGTG
TATAGTTTTCTATCAGAACACTTTTTTTTTAAACAACTGCAACTTAG
CTTATTGAAGACAAACCACGAGTAGAAATCTGTCCAAGAAGCAAGTG
CTTCTCAGCCTACAATGTGGAATAGGACCATGTAATGGTACAGTGAG
TGAAATGAATTATGGCATGTTTTTCTGACTGAGAAGACAGTACAATA
AAAGGTAAACTCATGGTATTTATTTAAAAAGAATCCAATTTCTACCT
TTTTCCAAATGGCATATCTGTTACAATAATATCCACAGAAGCAGTTC
TCAGTGGGAGGTTGCAGATATCCCACTGAACAGCATCAATGGGCAAA
CCCCAGGTTGTTTTTCTGTGGAGACAAAGGTAAGATATTTCAATATA
TTTTCCCAAGCTAATGAGATGGCTCAGCAAATAATGGTACTGGCCAT
TAAGTCTCATGACCTGAGCTTGATCCTCAGGGACCATGTGGTACAAG
GAGAGACCTAAATCCTTCAGTTGGACTTCAATCTTCTACCCTCATGT
CCACACACAAATAAATACAATAAAAAACATTCTGCAGTCTGAATTTC
TAAAGGTTGTTTTTCTAAAAAGAAATGTTAAAGTAACATAGGAAGAA
ATATGTCCATAACTGAAATACAAGTTTTTTAAATGGTTAAGACTGGT
TTTCAAAGGATGTATGGTTAAGAAAATACCAGGGAAAATGAGCTTAC
ATGTAAAAAAGTGTCTAAAAGGCCAGAGAAATGACCCAGCTGGCAAA
GGTGTCTGCCCTAAGCCAGACAAAAGGAATTTGATTCACAGGAAGAA
GAGACCCAACTCTCACTAGTTATCCTCTGACTTCCACACCATGACAC
AGCTCCATGGCACTCTCAGGCCCCCACACATATACAGATATAAACAG
AAACCTAATCCACCAGCCTTCAGAAGCAAAGCAATTGGAGGATTTAA
ACAGGCCATGGCTACTAATAGAGATAACTGGTAGTTTAAAAGTTATG
GTAATGACTTTCATGCTTCTTTCAACTCATATTGTTCTAAATAATTA
ATTTGGTTTTTCAAGGCAGGGTTTCTCTGTGTAGTTCTGGCTGTCCT
GGAACTCACTCTGTAGACCAGGCTGGCCTTGAACTCAGATCCATCTG
CCTCTGGAATAAGGGCACGTGCGTGCCTTTTCTACATAACAAAACCT
ATACTATAACAAAACCTATACCATACTGTACCGTTTTGGGAAAAGAC
AAAAAATAATGAACAAAAAAGGAGAAATAACATTCCAATAAAGTATG
GAAATGGTAGTTAAATTAATTACAAATGTTTTTCAGTAAATTAGATG
TGACTTCTCATACTGTTCATTTGGCTATAATGATACCACAAAGCACT
GGGGGTGAATAATAATTCCAAGTCAGTAGGGAGAGAGACTTGAAAAG
ATGCAATGCAATCATTGAAGTTAAACTTACCCATCTTTAATCTGGCT
CTTAGTCAATAGAGATGAGATGTTATTTGCTGCTCTGTTCACTGCCA
GTGGGTTATTGTCCCCAGCAATATGGTAACAGTGAGACCACTCAGTA
GCCCCCTATGAGACAGGAGTGTTGGTTAAACATGCCACAAGAGAAAA
GGGAAAAGTCACTATGGCCAACTCTCAGTAACATGGCAATCCGTGCC
ATTCATTTCCTTGCCAGAAATGTCTTCCCTGTTCTTCTGCCTACTGA
ACTTTCACCCACTAGAAATGTGGCTCCAATGTCATCCACTATGACAT
CAATGTCAGCGCTAGAAGCACTTTGCACACCTCTGTTGCTGACTTAG
REFERENCE
[0502] a) Pablo Perez-Pinera, David G. Ousterout, Matthew T. Brown
and Charles A. Gersbach (2012) Gene targeting to the ROSA26 locus
directed by engineered zinc finger nucleases. Nucleic Acids
Research, 2012, Vol. 40, No. 8 3741-3752 [0503] b) Peter
Hohenstein, Joan Slight, Derya Deniz Ozdemir, Sally F Burn, Rachel
Berry and Nicholas D Hastie (2008) High-efficiency Rosa26 knock-in
vector construction for Cre-regulated overexpression and RNAi.
Patho Genelics 2008, 1:3 [0504] 2. A recombinase mediated cassette
exchange (RMCE)-enabled vector containing a promoterless
puromycin-delta-tk with in-frame fusion of T2A at the C-terminus
following by either Cas9 or mutant Cas9 nucleotide sequence and a
series of unique restriction sites flanked by loxP and lox2272 will
allow for the direct targeting of this vector into the landing pad
by Cre-mediated RMCE. As is known, T2A allows ribosomal skipping
during translation. The insertion of the coding sequence of T2A
between two genes results in two products (one gene, one transcript
but two proteins expressed, in this case the Cas9 and selection
marker). ES clones containing the correctly inserted DNA fragment
can be directly selected on puromycin. This approach also
advantageously ensures single copy expression of Cas9 as suppose to
a random integration or transient expression approach. Insertion of
the RMCE enabled vector into the desired locus containing the
landing pad can be selected directly as the PGK promoter in the
landing pad will drive the transcription of the promoterless
Puro-Delta-Tk and Cas9. Since the Puro-delta-Tk is in the same
transcriptional unit as Cas9, ES clones selected on puromycin will
ensure expression of Cas9. [0505] 3. The above strategy allows for
three separate approaches to express the sgRNA designed for
disrupting (mutation through indel formation, deletion or deletion
followed by insertion) gene of interest. [0506] a. The above ES
cell line containing Cas9 can be used for generating transgenic
mice with either constitutively expressed Cas9 or modified for
inducible Cas9 expression or indeed tissue specific Cas9 expression
for example expression of Cas9 at an embryo stage using Nanog-,
Pou5fl- or SoxB promoter-specific Cas9 expression. Such derived
mouse line expressing Cas9 can be used for genome editing in a
streamline fashion whereby in vitro transcribed sgRNA can be easily
injected into embryos obtained from such transgenic mice. This will
enhance the efficiency of generating mouse lines with the desired
homozygous genotype and thus will dramatically reduce the number of
animals required. [0507] b. sgRNA can be transfected directly into
the ES cells expressing Cas9 and thus avoids the requirement for
cloning into the RMCE enabled vector single or multiple sgRNA. This
approach will allow multiple sgRNA to be inserted into the ES cells
simultaneously very rapidly. [0508] c. Multiple sgRNA can be cloned
directly into the multiple cloning site of the RMCE enabled vector
(ie, using a plurality of different restriction endonuclease sites)
to allow single copy expression of the guide-RNA. This approach may
be useful for limiting off-target effects particularly relevant for
those genes with high sequence homology within the genome. [0509]
4. ES cells expressing Cas9 and sgRNA can be selected for directly
on medium containing puromycin. Selection on puromycin for 4-6 days
will allow for the desired location to be mutated or disrupted and
the advantage of manipulating ES cells is that individual clones
can be analysed by PCR followed by sequencing for the desired
mutation. Only correctly mutated ES cell clones can be processed
further whereby inserted DNA element introduced through insertion
of the landing pad and the subsequent insertion of the RMCE vector
can be completely removed leaving the ES cell devoid of any
alteration other than the intended mutation induced by the action
of Cas9 and the sgRNA. This can be done through transiently
expressing PBase transposon followed by selection on FIAU. Removal
of the constitutively expressed Cas9 with only the minimal length
of time required to induce mutation in the presence of sgRNA will
reduce or eliminate the possibility of Cas9 inducing unwanted
mutations. [0510] 5. ES Clones containing the desired mutation can
be injected into blastocyst to generate transgenic mice.
TABLE-US-00009 [0510] TABLE 1 PAM conservation in repeats and
leaders for various CRISPR types (reproduced from Short motif
sequences determine the targets of the prokaryotic CRISPR defence
system F. J. M. Mojica, C. Diez-Villasenor, J. Garcia-Martinez, C.
Almendros Microbiology (2009), 155, 733-740) CRISPR
Genomes{circumflex over ( )} PAM Consensus.sup..dagger.
Leaders.sup..dagger-dbl. Group 1 Mth NGG ATTTCAATCC AGGGCGGATT
CATTTTGGTC ATGGCCAATT TGATTTTAAC Lmo WGG ATTTACATTT CCACTAACTT
CAHAATAAGT CCGCTCTATT ARYTAAAAC Group 2 Eco CWT CGGTTTATCC
TCTAAACATA CCGCTGGCGC TCTAAAAGTA GGGGAACWC Pae CTT CGGTTCATCC
ACTTACCGTA CCACRCMYGT CCTTACCGTA GGGGAACAC Group 3 Spy GAA
ATTTCAATCC TGCGCCAAAT ACTCACCCAT GAAGGGTGAG AC Xan GAA GTTTCAATCC
CCCCCCTTAG ACGCGCCCGT GCCGCCAGCA GAGGRCGCGA C Group 4 She GG
TTTCTAAGCC AATAGCTTAT GCCTGTGCGG TGTAGAATAA CGGTGAAC Pae GG
TTTCTTAGCT TAGCTCCGAA GCCTATACGG TAGACCAAAA CAGTGAAC Ype GG
TTTCTAAGCT GTAAGATAAT GCCTGTGCGG CAGTGAAC Group 7 Sso NGG
CTTTCAATTC TGAGGGTTTA TATAAGAGAT TATC Mse NGG CTTTCAACTC TGATACCTTT
TATAGGAGAT TGAAACTTTT TAAC TGACACTCTT Group 10 Str NGG GTTTTAGAGC
CTCGTAGACT TATGCTGTTT CTCGTAGAAA TGAATGGTCC CAAAAC Lis NGG
GTTTTAGAGC CTCGCAGAAT TATGTTATTT CTCGTAGAAT TGAATGCTAM CAAAAC *
Genomes are abbreviated according to the denominations of the
species or genera carrying the corresponding CRISPR arrays: Mth, M.
thermautrophicus; Lmo, L. monocytogenes; Eco, E. coli; Pae, P.
aeruginosa; Spy, S. pyogenes; Xan, Xanthomonas spp.; She,
Shewanella spp.; Ype, Y. pestis; Sso, S. solfataricus; Mse, M.
sedular; Str, Streptococcus spp.; Lis, Listeria spp.
.sup..dagger.Sequences matching the PAM are underlined.
.sup..dagger-dbl.Representative CRISPR array proximal Leader
sequences. Nucleotides matching the PAM are underlined.
[0511] SEQ ID NOs for the sequences in Table 1 are set out in the
table below.
TABLE-US-00010 CRISPR SEQ SEQ Genomes* PAM Consens.sup..dagger. ID
NO. Leaders.sup..dagger-dbl. ID NO. Group 1 Mth NGG ATTTCAATCC 25
AGGGCGGATT 38 CATTTTGGTC ATGGCCAATT 39 TGATTTTAAC Lmo WGG
ATTTACATTT 26 CCACTAACTT 40 CAHAATAAGT CCGCTCTATT 41 ARYTAAAAC
Group 2 Eco CWT CGGTTTATCC 27 TCTAAACATA 42 CCGCTGGCGC TCTAAAAGTA
43 GGGGAACWC Pac CTT CGGTTCATCC 28 ACTTACCGTA 44 CCACRCMYGT
CCTTACCGTA 45 GGGGAACAC Group 3 Spy GAA ATTTCAATCC 29 TGCGCCAAAT 46
ACTCACCCAT GAAGGGTGAG AC Xan GAA GTTTCAATCC 30 CCCCCCTTAG 47
ACGCGCCCGT GCCGCCAGCA 48 GAGGRCGCGA C Group 4 She GG TTTCTAAGCC 31
AATAGCTTAT 49 GCCTGTGCGG TGTAGAATAA 50 CGGTGAAC Pae GG TTTCTTAGCT
32 TAGCTCCGAA 51 GCCTATACGG TAGACCAAAA 52 CAGTGAAC Ype NGG
TTTCTAAGCT 33 GTAAGATAAT 53 GCCTGTGCGG CAGTGAAC Group 7 Sso NGG
CTTTCAATTC 34 TGAGGGTTTA 54 TATAAGAGAT TATC Mse NGG CTTTCAACTC 35
TGATACCTTT 55 TATAGGAGAT TGAAACTTTT 56 TAAC TGACACTCTT 57 Group 10
Str NGG GTTTTAGAGC 36 CTCGTAGACT 58 TATGCTGTTT CTCGTAGAAA 59
TGAATGGTCC CAAAAC Lis NGG GTTTTAGAGC 37 CTCGCAGAAT 60 TATGTTATTT
CTCGTAGAAT 61 TGAATGCTAM CAAAAC
Table 2: CRISPR-Associated Endonucleases
[0512] [Gene ID numbers refer to genes in the NCBI Gene Database as
at September 2013; all sequence information relating to the gene
IDs below is incorporated herein by reference for possible use in
the present invention]
1. Plav_0099
[0513] CRISPR-associated endonuclease Csn1 family protein
[Parvibaculum lavamentivorans DS-1]
Other Aliases: Plav_0099
[0514] Genomic context: Chromosome Annotation: NC_009719.1 (105795
. . . 108908, complement)
ID: 5454634
SEQ ID NO: 62
2. FTN_0757
[0515] membrane protein [Francisella novicida U112]
Other Aliases: FTN_0757
[0516] Genomic context: Chromosome
Annotation: NC_008601.1 (810052 . . . 814941)
ID: 4548251
SEQ ID NO: 63
3. Cj1523c
[0517] CRISPR-associated protein [Campylobacter jejuni subsp.
jejuni NCTC 11168=ATCC 700819]
Other Aliases: Cj1523c
[0518] Genomic context: Chromosome Annotation: NC_002163.1 (1456880
. . . 1459834, complement)
ID: 905809
SEQ ID NO: 64
[0519] 4. mcrA restriction endonuclease [Bifidobacterium longum
DJO10A]
Other Aliases: BLD_1902
[0520] Genomic context: Chromosome
Annotation: NC_010816.1 (2257993 . . . 2261556)
ID: 6362834
SEQ ID NO: 65
5. MGA_0519
[0521] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum str. R(low)]
Other Aliases: MGA_0519
[0522] Genomic context: Chromosome
Annotation: NC_004829.2 (919248 . . . 923060)
ID: 1089911
SEQ ID NO: 66
6. Emin_0243
[0523] CRISPR-associated endonuclease Csn1 family protein
[Elusimicrobium minutum Pei191]
Other Aliases: Emin_0243
[0524] Genomic context: Chromosome
Annotation: NC_010644.1 (261119 . . . 264706)
ID: 6263045
SEQ ID NO: 67
7. FTW_1427
[0525] CRISPR-associated large protein [Francisella tularensis
subsp. tularensis WY96-3418]
Other Aliases: FTW_1427
[0526] Genomic context: Chromosome Annotation: NC_009257.1 (1332426
. . . 1335803, complement)
ID: 4958852
SEQ ID NO: 68
8. SMA_1444
[0527] CRISPR-associated protein, Csn1 family [Streptococcus
macedonicus ACA-DC 198]
Other Aliases: SMA_1444
[0528] Annotation: NC_016749.1 (1418337 . . . 1421729,
complement)
ID: 11601419
SEQ ID NO: 69
9. SSUST3_1318
[0529] CRISPR-associated protein, Csn1 family [Streptococcus suis
ST3]
Other Aliases: SSUST3_1318
[0530] Genomic context: Chromosome Annotation: NC_015433.1 (1323872
. . . 1327240, complement)
ID: 10491484
SEQ ID NO: 70
[0531] 10. cas5 CRISPR-associated protein, Csn1 family
[Streptococcus gallolyticus UCN34]
Other Aliases: GALLO_1439
[0532] Genomic context: Chromosome Annotation: NC_013798.1 (1511433
. . . 1514825, complement)
ID: 8776949
SEQ ID NO: 71
11. GALLO_1446
[0533] CRISPR-associated protein [Streptococcus gallolyticus
UCN34]
Other Aliases: GALLO_1446
[0534] Genomic context: Chromosome Annotation: NC_013798.1 (1518984
. . . 1523110, complement)
ID: 8776185
SEQ ID NO: 72
[0535] 12. csn1 CRISPR-associated endonuclease Csn1
[Bifidobacterium dentium Bd1]
Other Aliases: BDP_1254
[0536] Genomic context: Chromosome Annotation: NC_013714.1 (1400576
. . . 1403992, complement)
ID: 8692053
SEQ ID NO: 73
13. NMO_0348
[0537] putative CRISPR-associated protein [Neisseria meningitidis
alpha14]
Other Aliases: NMO_0348
[0538] Genomic context: Chromosome Annotation: NC_013016.1 (369547
. . . 372795, complement)
ID: 8221228
SEQ ID NO: 74
[0539] 14. csn1 CRISPR-Associated Protein Csn1 [Streptococcus equi
subsp. zooepidemicus MGCS10565]
Other Aliases: Sez_1330
[0540] Genomic context: Chromosome Annotation: NC_011134.1 (1369339
. . . 1373385, complement)
ID: 6762114
SEQ ID NO: 75
[0541] 15. csn1 CRISPR-associated endonuclease Csn1 family protein
[Streptococcus gordonii str. Challis substr. CH1]
Other Aliases: SGO_1381
[0542] Genomic context: Chromosome Annotation: NC_009785.1 (1426750
. . . 1430160, complement)
ID: 5599802
SEQ ID NO: 76
16. M28_Spy0748
[0543] cytoplasmic protein [Streptococcus pyogenes MGAS6180]
Other Aliases: M28_Spy0748
[0544] Genomic context: Chromosome
Annotation: NC_007296.1 (771231 . . . 775337)
ID: 3573516
SEQ ID NO: 77
[0545] 17. SGGBAA2069_c14690 CRISPR-associated protein
[Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069]
Other Aliases: SGGBAA2069_c14690 Genomic context: Chromosome
Annotation: NC_015215.1 (1520905 . . . 1525017, complement)
ID: 10295470
SEQ ID NO: 78
18. SAR116_2544
[0546] CRISPR-associated protein, Csn1 family [Candidatus
Puniceispirillum marinum IMCC1322]
Other Aliases: SAR116_2544
[0547] Genomic context: Chromosome
Annotation: NC_014010.1 (2748992 . . . 2752099)
ID: 8962895
SEQ ID NO: 79
19. TDE0327
[0548] CRISPR-associated Cas5e [Treponema denticola ATCC 35405]
Other Aliases: TDE0327
[0549] Genomic context: Chromosome
Annotation: NC_002967.9 (361021 . . . 365208)
ID: 2741543
SEQ ID NO: 80
[0550] 20. csn1 CRISPR-associated protein [Streptococcus
pasteurianus ATCC 43144]
Other Aliases: SGPB_1342
[0551] Genomic context: Chromosome Annotation: NC_015600.1 (1400035
. . . 1403427, complement)
ID: 10753339
SEQ ID NO: 81
[0552] 21. cas9 CRISPR-associated protein [Corynebacterium ulcerans
BR-AD22]
Other Aliases: CULC22_00031
[0553] Genomic context: Chromosome Annotation: NC_015683.1 (30419 .
. . 33112, complement)
ID: 10842578
SEQ ID NO: 82
22. MGAS2096_Spy0843
[0554] putative cytoplasmic protein [Streptococcus pyogenes
MGAS2096]
Other Aliases: MGAS2096_Spy0843
[0555] Genomic context: Chromosome
Annotation: NC_008023.1 (813084 . . . 817190)
ID: 4066021
SEQ ID NO: 83
23. MGAS9429_Spy0885
[0556] cytoplasmic protein [Streptococcus pyogenes MGAS9429]
Other Aliases: MGAS9429_Spy0885
[0557] Genomic context: Chromosome
Annotation: NC_008021.1 (852508 . . . 856614)
ID: 4061575
SEQ ID NO: 84
24. AZL_009000
[0558] CRISPR-associated protein, Csn1 family [Azospirillum sp.
B510]
Other Aliases: AZL_009000
[0559] Genomic context: Chromosome Annotation: NC_013854.1 (1019522
. . . 1023028, complement)
ID: 8789261
SEQ ID NO: 85
25. EUBREC_1713
[0560] contains RuvC-like nuclease and HNH-nuclease domains
[Eubacterium rectale ATCC 33656]
Other Aliases: EUBREC 1713
[0561] Other Designations: CRISPR-system related protein Genomic
context: Chromosome
Annotation: NC_012781.1 (1591112 . . . 1594456)
ID: 7963668
SEQ ID NO: 86
26. Alide2_0194
[0562] CRISPR-associated protein, Csn1 family [Alicycliphilus
denitrificans K601]
Other Aliases: Alide2_0194
[0563] Genomic context: Chromosome
Annotation: NC_015422.1 (218107 . . . 221196)
ID: 10481210
SEQ ID NO: 87
27. Alide_0205
[0564] crispr-associated protein, csn1 family [Alicycliphilus
denitrificans BC]
Other Aliases: Alide_0205
[0565] Genomic context: Chromosome
Annotation: NC_014910.1 (228371 . . . 231460)
ID: 10102228
SEQ ID NO: 88
28. STER_1477
[0566] CRISPR-system-like protein [Streptococcus thermophilus
LMD-9]
Other Aliases: STER_1477
[0567] Genomic context: Chromosome Annotation: NC_008532.1 (1379975
. . . 1384141, complement)
ID: 4437923
SEQ ID NO: 89
29. STER_0709
[0568] CRISPR-system-like protein [Streptococcus thermophilus
LMD-9]
Other Aliases: STER_0709
[0569] Genomic context: Chromosome
Annotation: NC_008532.1 (643235 . . . 646600)
ID: 4437391
SEQ ID NO: 90
[0570] 30. cas9 CRISPR-associated protein [Corynebacterium
diphtheriae 241]
Other Aliases: CD241_2102
[0571] Genomic context: Chromosome
Annotation: NC_016782.1 (2245769 . . . 2248399)
ID: 11674395
SEQ ID NO: 91
[0572] 31. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae 241]
Other Aliases: CD241_0034
[0573] Genomic context: Chromosome
Annotation: NC_016782.1 (35063 . . . 38317)
ID: 11672999
SEQ ID NO: 92
32. Corgl_1738
[0574] CRISPR-associated protein, Csn1 family [Coriobacterium
glomerans PW2]
Other Aliases: Corgl_1738
[0575] Genomic context: Chromosome
Annotation: NC_015389.1 (2036091 . . . 2040245)
ID: 10439994
SEQ ID NO: 93
33. Fluta_3147
[0576] CRISPR-associated protein, Csn1 family [Fluviicola taffensis
DSM 16823]
Other Aliases: Fluta_3147
[0577] Genomic context: Chromosome Annotation: NC_015321.1 (3610221
. . . 3614597, complement)
ID: 10398516
SEQ ID NO: 94
34. Acav_0267
[0578] CRISPR-associated protein, Csn1 family [Acidovorax avenae
subsp. avenae ATCC 19860]
Other Aliases: Acav_0267
[0579] Genomic context: Chromosome
Annotation: NC_015138.1 (295839 . . . 298976)
ID: 10305168
SEQ ID NO: 95
35. NAL212_2952
[0580] CRISPR-associated protein, Csn1 family [Nitrosomonas sp.
AL212]
Other Aliases: NAL212_2952
[0581] Genomic context: Chromosome Annotation: NC_015222.1 (2941806
. . . 2944940, complement)
ID: 10299493
SEQ ID NO: 96
36. SpiBuddy_2181
[0582] CRISPR-associated protein, Csn1 family [Sphaerochaeta
globosa str. Buddy]
Other Aliases: SpiBuddy_2181
[0583] Genomic context: Chromosome Annotation: NC_015152.1 (2367952
. . . 2371491, complement)
ID: 10292274
SEQ ID NO: 97
37. Tmz1t_2411
[0584] HNH endonuclease [Thaucra sp. MZ1T]
Other Aliases: Tmzlt_2411
[0585] Genomic context: Plasmid pTha01 Annotation: NC_011667.1
(75253 . . . 76200, complement)
ID: 7094333
SEQ ID NO: 98
38. Gdia_0342
[0586] Csn1 family CRISPR-associated protein [Gluconacetobacter
diazotrophicus PA51]
Other Aliases: Gdia_0342
[0587] Genomic context: Chromosome
Annotation: NC_011365.1 (382737 . . . 385748)
ID: 6973736
SEQ ID NO: 99
39. JJD26997_1875
[0588] CRISPR-associated Cas5e family protein [Campylobacter jejuni
subsp. doylei 269.97]
Other Aliases: JJD26997_1875
[0589] Genomic context: Chromosome Annotation: NC_009707.1 (1656109
. . . 1659063, complement)
ID: 5389688
SEQ ID NO: 100
40. Asuc_0376
[0590] CRISPR-associated endonuclease Csn1 family protein
[Actinobacillus succinogenes 130Z]
Other Aliases: Asuc_0376
[0591] Genomic context: Chromosome
Annotation: NC_009655.1 (431928 . . . 435116)
ID: 5348478
SEQ ID NO: 101
41. Veis_1230
[0592] CRISPR-associated endonuclease Csn1 family protein
[Verminephrobacter eiseniae EF01-2]
Other Aliases: Veis_1230
[0593] Genomic context: Chromosome
Annotation: NC_008786.1 (1365979 . . . 1369185)
ID: 4695198
SEQ ID NO: 102
42. MGAS10270_Spy0886
[0594] putative cytoplasmic protein [Streptococcus pyogenes
MGAS10270]
Other Aliases: MGAS10270_Spy0886
[0595] Genomic context: Chromosome
Annotation: NC_008022.1 (844446 . . . 848552)
ID: 4063984
SEQ ID NO: 103
[0596] 43. gbs0911 hypothetical protein [Streptococcus agalactiae
NEM316] Other Aliases: gbs0911 Genomic context: Chromosome
Annotation: NC_004368.1 (945801 . . . 949946)
ID: 1029893
SEQ ID NO: 104
44. NMA0631
[0597] hypothetical protein [Neisseria meningitidis Z2491]
Other Aliases: NMA0631
[0598] Genomic context: Chromosome Annotation: NC_003116.1 (610868
. . . 614116, complement)
ID: 906626
SEQ ID NO: 105
45. Ccan_14650
[0599] hypothetical protein [Capnocytophaga canimorsus Cc5]
Other Aliases: Ccan_14650
[0600] Genomic context: Chromosome Annotation: NC_015846.1 (1579873
. . . 1584165, complement)
ID: 10980451
SEQ ID NO: 106
46. Ipp0160
[0601] hypothetical protein [Legionella pneumophila str. Paris]
Other Aliases: lpp0160 Genomic context: Chromosome
Annotation: NC_006368.1 (183831 . . . 187949)
ID: 3118625
SEQ ID NO: 107
47. Cbei_2080
[0602] hypothetical protein [Clostridium beijerinckii NCIMB
8052]
Other Aliases: Cbei_2080
[0603] Genomic context: Chromosome
Annotation: NC_009617.1 (2422056 . . . 2423096)
ID: 5296367
SEQ ID NO: 108
48. MMOB0330
[0604] hypothetical protein [Mycoplasma mobile 163K]
Other Aliases: MMOB0330
[0605] Genomic context: Chromosome Annotation: NC_006908.1 (45652 .
. . 49362, complement)
ID: 2807677
SEQ ID NO: 109
49. MGF_5203
[0606] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum str. F]
Other Aliases: MGF_5203
[0607] Genomic context: Chromosome
Annotation: NC_017503.1 (888602 . . . 892411)
ID: 12397088
SEQ ID NO: 110
50. MGAH_0519
[0608] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum str. R(high)]
Other Aliases: MGAH_0519
[0609] Genomic context: Chromosome
Annotation: NC_017502.1 (918476 . . . 922288)
ID: 12395725
SEQ ID NO: 111
51. Smon_1063
[0610] CRISPR-associated protein. Csn1 family [Streptobacillus
moniliformis DSM 12112]
Other Aliases: Smon_1063
[0611] Genomic context: Chromosome Annotation: NC_013515.1 (1159048
. . . 1162827, complement)
ID: 8600791
SEQ ID NO: 112
52. Spy49_0823
[0612] hypothetical protein [Streptococcus pyogenes NZ131]
Other Aliases: Spy49_0823
[0613] Genomic context: Chromosome
Annotation: NC_011375.1 (821210 . . . 825316)
ID: 6985827
SEQ ID NO: 113
53. CSJ_1425
[0614] hypothetical protein [Campylobacter jejuni subsp. jejuni
81116]
Other Aliases: C8J_1425
[0615] Genomic context: Chromosome Annotation: NC_009839.1 (1442672
. . . 1445626, complement)
ID: 5618449
SEQ ID NO: 114
54. FTF0584
[0616] hypothetical protein [Francisella tularensis subsp.
tularensis FSC198]
Other Aliases: FTF0584
[0617] Genomic context: Chromosome
Annotation: NC_008245.1 (601115 . . . 604486)
ID: 4200457
SEQ ID NO: 115
55. FTT_0584
[0618] hypothetical protein [Francisella tularensis subsp.
tularensis SCHU S4]
Other Aliases: FTT_0584
[0619] Genomic context: Chromosome
Annotation: NC_006570.2 (601162 . . . 604533)
ID: 3191177
SEQ ID NO: 116
[0620] 56. csn1 CRISPR-associated protein [Streptococcus
dysgalactiae subsp. equisimilis RE378]
Other Aliases: GGS_1116
[0621] Annotation: NC_018712.1 (1169559 . . . 1173674,
complement)
ID: 13799322
SEQ ID NO: 117
57. SMUGS5_06270
[0622] CRISPR-associated protein csn1 [Streptococcus mutans
GS-5]
Other Aliases: SMUGS5_06270
[0623] Genomic context: Chromosome Annotation: NC_018089.1 (1320641
. . . 1324678, complement)
ID: 13299050
SEQ ID NO: 118
58. Y1U_C1412
[0624] Csn1 [Streptococcus thermophilus MN-ZLW-002]
Other Aliases: Y1U_C1412
[0625] Genomic context: Chromosome Annotation: NC_017927.1 (1376653
. . . 1380819, complement)
ID: 12977193
SEQ ID NO: 119
59. Y1U_C0633
[0626] CRISPR-system-like protein [Streptococcus thermophilus
MN-ZLW-002]
Other Aliases: Y1U_C0633
[0627] Genomic context: Chromosome
Annotation: NC_017927.1 (624274 . . . 627639)
ID: 12975630
SEQ ID NO: 120
60. SALIVA_0715
[0628] CRISPR-associated endonuclease. Csn1 family [Streptococcus
salivarius JIM8777]
Other Aliases: SALIVA 0715
Annotation: NC_017595.1 (708034 . . . 711417)
ID: 12910728
SEQ ID NO: 121
[0629] 61. csn1 CRISPR-associated protein csn1 [Streptococcus
mutans LJ23]
Other Aliases: SMULJ23_0701
Annotation: NC_017768.1 (751695 . . . 755732)
ID: 12898085
SEQ ID NO: 122
62. RIA_1455
[0630] CRISPR-associated protein, SAG0894 [Riemerella anatipestifer
RA-GD]
Other Aliases: RIA_1455
[0631] Genomic context: Chromosome
Annotation: NC_017569.1 (1443996 . . . 1448198)
ID: 12613647
SEQ ID NO: 123
63. STND_0658
[0632] CRISPR-associated endonuclease, Csn1 family [Streptococcus
thermophilus ND03]
Other Aliases: STND_0658
[0633] Genomic context: Chromosome
Annotation: NC_017563.1 (633621 . . . 636986)
ID: 12590813
SEQ ID NO: 124
64. RA0C_1034
[0634] putative BCR [Riemerella anatipestifer ATCC 11845=DSM
15868]
Other Aliases: RA0C_1034
[0635] Genomic context: Chromosome Annotation: NC_017045.1 (1023494
. . . 1026931, complement)
ID: 11996006
SEQ ID NO: 125
65. Sinf_1255
[0636] CRISPR-associated protein. SAG0894 family [Streptococcus
infantarius subsp. infantarius CJ18]
Other Aliases: Sinf_1255
[0637] Genomic context: Chromosome Annotation: NC_016826.1 (1276484
. . . 1280611, complement)
ID: 11877786
SEQ ID NO: 126
66. Nitsa_1472
[0638] CRISPR-associated protein, csn1 family [Nitratifractor
salsuginis DSM 16511]
Other Aliases: Nitsa_1472
[0639] Genomic context: Chromosome
Annotation: NC_014935.1 (1477331 . . . 1480729)
ID: 10148263
SEQ ID NO: 127
67. NLA_17660
[0640] hypothetical protein [Neisseria lactamica 020-06]
Other Aliases: NLA_17660
[0641] Genomic context: Chromosome
Annotation: NC_014752.1 (1890078 . . . 1893326)
ID: 10006697
SEQ ID NO: 128
68. SmuNN2025_0694
[0642] hypothetical protein [Streptococcus mutans NN2025]
Other Aliases: SmuNN2025_0694
[0643] Genomic context: Chromosome
Annotation: NC_013928.1 (737258 . . . 741295)
ID: 8834629
SEQ ID NO: 129
69. SDEG_1231
[0644] hypothetical protein [Streptococcus dysgalactiae subsp.
equisimilis GGS_124]
Other Aliases: SDEG_1231
Chromosome: 1
[0645] Annotation: Chromosome 1NC_012891.1 (1176755 . . . 1180870,
complement)
ID: 8111553
SEQ ID NO: 130
70. NMCC_0397
[0646] hypothetical protein [Neisseria meningitidis 053442]
Other Aliases: NMCC_0397
[0647] Genomic context: Chromosome Annotation: NC_010120.1 (402733
. . . 405981, complement)
ID: 5796426
SEQ ID NO: 131
71. SAK_1017
[0648] hypothetical protein [Streptococcus agalactiae A909]
Other Aliases: SAK_1
[0649] Genomic context: Chromosome
Annotation: NC_007432.1 (980303 . . . 984415)
ID: 3686185
SEQ ID NO: 132
[0650] 72. M5005_Spy_0769 hypothetical protein [Streptococcus
pyogenes MGAS5005] Other Aliases: M5005_Spy_0769 Genomic context:
Chromosome
Annotation: NC_007297.1 (773340 . . . 777446)
ID: 3572134
SEQ ID NO: 133
73. MS53_0582
[0651] hypothetical protein [Mycoplasma synoviae 53]
Other Aliases: MS53_0582
[0652] Genomic context: Chromosome
Annotation: NC_007294.1 (684155 . . . 688099)
ID: 3564051
SEQ ID NO: 134
74. DIP0036
[0653] hypothetical protein [Corynebacterium diphtheriae NCTC
13129]
Other Aliases: DIP0036
[0654] Genomic context: Chromosome
Annotation: NC_002935.2 (34478 . . . 37732)
ID: 2650188
SEQ ID NO: 135
75. WS1613
[0655] hypothetical protein [Wolinella succinogenes DSM 1740]
Other Aliases: WS1613
[0656] Genomic context: Chromosome
Annotation: NC_005090.1 (1525628 . . . 1529857)
ID: 2553552
SEQ ID NO: 136
76. PM1127
[0657] hypothetical protein [Pasteurella multocida subsp. multocida
str. Pm70]
Other Aliases: PM1127
[0658] Genomic context: Chromosome Annotation: NC_002663.1 (1324015
. . . 1327185, complement)
ID: 1244474
SEQ ID NO: 137
77. SPs1176
[0659] hypothetical protein [Streptococcus pyogenes SSI-1]
Other Aliases: SPs1176
[0660] Genomic context: Chromosome Annotation: NC_004606.1 (1149610
. . . 1153716, complement)
ID: 1065374
SEQ ID NO: 138
78. SMU_1405c
[0661] hypothetical protein [Streptococcus mutans UA159]
Other Aliases: SMU_1405c, SMU.1405c
[0662] Genomic context: Chromosome Annotation: NC_004350.2 (1330942
. . . 1334979, complement)
ID: 1028661
SEQ ID NO: 139
[0663] 79. lin2744 hypothetical protein [Listeria innocua
Clip11262] Other Aliases: lin2744 Genomic context: Chromosome
Annotation: NC_003212.1 (2770707 . . . 2774711, complement)
ID: 1131597
SEQ ID NO: 140
[0664] 80. csn1B CRISPR-associated protein [Streptococcus
gallolyticus subsp. gallolyticus ATCC 43143]
Other Aliases: SGGB_1441
[0665] Annotation: NC_017576.1 (1489111 . . . 1493226,
complement)
ID: 12630646
SEQ ID NO: 141
[0666] 81. csn1A CRISPR-associated protein [Streptococcus
gallolyticus subsp. gallolyticus ATCC 43143]
Other Aliases: SGGB_1431
[0667] Annotation: NC_017576.1 (1480439 . . . 1483831,
complement)
ID: 12630636
SEQ ID NO: 142
[0668] 82. cas9 CRISPR-associated protein [Corynebacterium ulcerans
809]
Other Aliases: CULC809_00033
[0669] Genomic context: Chromosome Annotation: NC_017317.1 (30370 .
. . 33063, complement)
ID: 12286148
SEQ ID NO: 143
83. GDI_2123
[0670] hypothetical protein [Gluconacetobacter diazotrophicus
PA15]
Other Aliases: GDI_2123
[0671] Genomic context: Chromosome
Annotation: NC_010125.1 (2177083 . . . 2180235)
ID: 5792482
SEQ ID NO: 144
84. Nham_4054
[0672] hypothetical protein [Nitrobacter hamburgensis X14]
Other Aliases: Nham_4054
[0673] Genomic context: Plasmid 1 Annotation: NC_007959.1 (13284 .
. . 16784, complement)
ID: 4025380
SEQ ID NO: 145
[0674] 85. str0657 hypothetical protein [Streptococcus thermophilus
CNRZ1066] Other Aliases: str0657 Genomic context: Chromosome
Annotation: NC_006449.1 (619189 . . . 622575)
ID: 3165636
SEQ ID NO: 146
[0675] 86. stu0657 hypothetical protein [Streptococcus thermophilus
LMG 18311] Other Aliases: stu0657 Genomic context: Chromosome
Annotation: NC_006448.1 (624007 . . . 627375)
ID: 3165000
SEQ ID NO: 147
87. SpyM3_0677
[0676] hypothetical protein [Streptococcus pyogenes MGAS315]
Other Aliases: SpyM3_0677
[0677] Genomic context: Chromosome
Annotation: NC_004070.1 (743040 . . . 747146)
ID: 1008991
SEQ ID NO: 148
88. HFMG06CAA_5227
[0678] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum CA06_2006.052-5-2P]
Other Aliases: HFMG06CAA_5227
[0679] Genomic context: Chromosome
Annotation: NC_018412.1 (895338 . . . 899147)
ID: 13464859
SEQ ID NO: 149
89. HFMG01WIA_5025
[0680] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum WI01_2001.043-13-2P]
Other Aliases: HFMG01WIA_5025
[0681] Genomic context: Chromosome
Annotation: NC_018410.1 (857648 . . . 861457)
ID: 13463863
SEQ ID NO: 150
90. HFMG01NYA_5169
[0682] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum NY01_2001.047-5-1P]
Other Aliases: HFMG01NYA_5169
[0683] Genomic context: Chromosome
Annotation: NC_018409.1 (883511 . . . 887185)
ID: 13462600
SEQ ID NO: 151
91. HFMG96NC SEQ ID NO: 127
A_5295
[0684] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum NC96_1596-4-2P]
Other Aliases: HFMG96NCA_5295
[0685] Genomic context: Chromosome
Annotation: NC_018408.1 (904664 . . . 908473)
ID: 13462279
SEQ ID NO: 152
92. HFMG95NCA_5107
[0686] Csn1 family CRISPR-associated protein [Mycoplasma
gallisepticum NC95_13295-2-2P]
Other Aliases: HFMG95NCA_5107
[0687] Genomic context: Chromosome
Annotation: NC_018407.1 (871783 . . . 875592)
ID: 13461469
SEQ ID NO: 153
93. MGAS10750_Spy0921
[0688] hypothetical protein [Streptococcus pyogenes MGAS10750]
Other Aliases: MGAS10750_Spy0921
[0689] Genomic context: Chromosome
Annotation: NC_008024.1 (875719 . . . 879834)
ID: 4066656
SEQ ID NO: 154
94. XAC3262
[0690] hypothetical protein [Xanthomonas axonopodis pv. citri str.
306]
Other Aliases: XAC3262
[0691] Genomic context: Chromosome
Annotation: NC_003919.1 (3842310 . . . 3842765)
ID: 1157333
SEQ ID NO: 155
95. SSUST1_1305
[0692] CRISPR-system-like protein [Streptococcus suis ST1]
Other Aliases: SSUST1_1305
[0693] Genomic context: Chromosome Annotation: NC_017950.1 (1293105
. . . 1297250, complement)
ID: 13017849
SEQ ID NO: 156
96. SSUD9_1467
[0694] CRISPR-associated protein, Csn1 family [Streptococcus suis
D9]
Other Aliases: SSUD9_1467
[0695] Genomic context: Chromosome Annotation: NC_017620.1 (1456318
. . . 1459686, complement)
ID: 12718289
SEQ ID NO: 157
97. BBta_3952
[0696] hypothetical protein [Bradyrhizobium sp. BTAi1]
Other Aliases: BBta_3952
[0697] Genomic context: Chromosome Annotation: NC_009485.1 (4149455
. . . 4152649, complement)
ID: 5151538
SEQ ID NO: 158
98. CIY_03670
[0698] CRISPR-associated protein, Csn1 family [Butyrivibrio
fibrisolvens 16/4]
Other Aliases: CIY_03670
[0699] Annotation: NC_021031.1 (309663 . . . 311960,
complement)
ID: 15213189
SEQ ID NO: 159
99. A11Q_912
[0700] CRISPR-associated protein, Csn1 family [Bdellovibrio
exovorus JSS]
Other Aliases: A11Q_912
[0701] Genomic context: Chromosome Annotation: NC_020813.1 (904781
. . . 907864, complement)
ID: 14861475
SEQ ID NO: 160
100. MCYN0850
[0702] Csn1 family CRISPR-associated protein [Mycoplasma cynos
C142]
Other Aliases: MCYN_0850
[0703] Annotation: NC_019949.1 (951497 . . . 955216,
complement)
ID: 14356531
SEQ ID NO: 161
101. SaSA20_0769
[0704] CRISPR-associated protein [Streptococcus agalactiae
SA20-06]
Other Aliases: SaSA20_0769
[0705] Genomic context: Chromosome
Annotation: NC_019048.1 (803597 . . . 807709)
ID: 13908026
SEQ ID NO: 162
[0706] 102. csn1 CRISPR-associated protein, Csn1 family
[Streptococcus pyogenes A20]
Other Aliases: A20_0810
[0707] Genomic context: Chromosome
Annotation: NC_018936.1 (772038 . . . 776144)
ID: 13864445
SEQ ID NO: 163
103. P700755_000291
[0708] CRISPR-associated protein Cas9/Csn1, subtype II
[Psychroflexus torquis ATCC 700755]
Other Aliases: P700755_000291
[0709] Genomic context: Chromosome
Annotation: NC_018721.1 (312899 . . . 317428)
ID: 13804571
SEQ ID NO: 164
104. A911_07335
[0710] CRISPR-associated protein [Campylobacter jejuni subsp.
jejuni PT14]
Other Aliases: A911_07335
[0711] Genomic context: Chromosome Annotation: NC_018709.2 (1450217
. . . 1453180, complement)
ID: 13791138
SEQ ID NO: 165
105. ASU2_02495
[0712] CRISPR-associated endonuclease Csn1 family protein
[Actinobacillus suis H91-0380]
Other Aliases: ASU2_02495
[0713] Genomic context: Chromosome
Annotation: NC_018690.1 (552318 . . . 555482)
ID: 13751600
SEQ ID NO: 166
[0714] 106. csn1 CRISPR-associated protein [Listeria monocytogenes
SLCC2540]
Other Aliases: LMOSLCC2540_2635
[0715] Annotation: NC_018586.1 (2700744 . . . 2704748,
complement)
ID: 13647248
SEQ ID NO: 167
[0716] 107. csn1 CRISPR-associated protein [Listeria monocytogenes
SLCC5850]
Other Aliases: LMOSLCC5850_2605
[0717] Annotation: NC_018592.1 (2646023 . . . 2650027,
complement)
ID: 13626042
SEQ ID NO: 168
[0718] 108. csn1 CRISPR-associated protein [Listeria monocytogenes
serotype 7 str. SLCC2482]
Other Aliases: LMOSLCC2482_2606
[0719] Annotation: NC_018591.1 (2665393 . . . 2669397,
complement)
ID: 13605045
SEQ ID NO: 169
[0720] 109. csn1 CRISPR-associated protein [Listeria monocytogenes
SLCC2755]
Other Aliases: LMOSLCC2755_2607
[0721] Annotation: NC_018587.1 (2694850 . . . 2698854,
complement)
ID: 13599053
SEQ ID NO: 170
110. BN148_1523c
[0722] CRISPR-associated protein [Campylobacter jejuni subsp.
jejuni NCTC 11168-BN148]
Other Aliases: BN148_1523c
[0723] Annotation: NC_018521.1 (1456880 . . . 1459834,
complement)
ID: 13530688
SEQ ID NO: 171
111. Belba_3201
[0724] CRISPR-associated protein Cas9/Csn1, subtype II/NMEMI
[Belliella baltica DSM 15883]
Other Aliases: Belba_3201
[0725] Genomic context: Chromosome Annotation: NC_018010.1 (3445311
. . . 3449369, complement)
ID: 13056967
SEQ ID NO: 172
112. FN3523_1121
[0726] membrane protein [Francisella cf. novicida 3523]
Other Aliases: FN3523_1121
[0727] Genomic context: Chromosome Annotation: NC_017449.1 (1129528
. . . 1134468, complement)
ID: 12924881
SEQ ID NO: 173
[0728] 113. cas9 CRISPR-associated protein Cas9/Csn1, subtype
II/NMEMI [Prevotella intermedia 17]
Other Aliases: PIN17_A0201
Chromosome: II
Annotation: Chromosome IINC_017861.1 (240722 . . . 244864)
ID: 12849954
SEQ ID NO: 174
[0729] 114. csn1 CRISPR-associated protein, Csn1 family
[Streptococcus thermophilus JIM 8232]
Other Aliases: STH8232_0853
Annotation: NC_017581.1 (706443 . . . 709808)
ID: 12637306
SEQ ID NO: 175
115. LMOG_01918
[0730] CRISPR-associated protein [Listeria monocytogenes J0161]
Other Aliases: LMOG_01918
[0731] Genomic context: Chromosome Annotation: NC_017545.1 (2735374
. . . 2739378, complement)
ID: 12557915
SEQ ID NO: 176
116. LMRG_02138
[0732] CRISPR-associated protein [Listeria monocytogenes
10403S]
Other Aliases: LMRG_02138
[0733] Genomic context: Chromosome Annotation: NC_017544.1 (2641981
. . . 2645985, complement)
ID: 12554876
SEQ ID NO: 177
117. CJSA_1443
[0734] putative CRISPR-associated protein [Campylobacter jejuni
subsp. jejuni IA3902]
Other Aliases: CJSA_1443
[0735] Genomic context: Chromosome Annotation: NC_017279.1 (1454273
. . . 1457227, complement)
ID: 12250720
SEQ ID NO: 178
[0736] 118. csn1 CRISPR-associated protein Csn1 [Streptococcus
pyogenes MGAS1882]
Other Aliases: MGAS1882_0792
[0737] Genomic context: Chromosome
Annotation: NC_017053.1 (775696 . . . 779799)
ID: 12014080
SEQ ID NO: 179
[0738] 119. csn1 CRISPR-associated protein Csn1 [Streptococcus
pyogenes MGAS15252]
Other Aliases: MGAS15252_0796
[0739] Genomic context: Chromosome
Annotation: NC_017040.1 (778271 . . . 782374)
ID: 11991096
SEQ ID NO: 180
[0740] 120. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae HC02]
Other Aliases: CDHC02_0036
[0741] Genomic context: Chromosome
Annotation: NC_016802.1 (37125 . . . 40379)
ID: 11739116
SEQ ID NO: 181
[0742] 121. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae C7 (beta)]
Other Aliases: CDC7B_0035
[0743] Genomic context: Chromosome
Annotation: NC_016801.1 (36309 . . . 39563)
ID: 11737358
SEQ ID NO: 182
[0744] 122. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae BH8]
Other Aliases: CDBH8_0038
[0745] Genomic context: Chromosome
Annotation: NC_016800.1 (37261 . . . 40515)
ID: 11735325
SEQ ID NO: 183
[0746] 123. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae 31A]
Other Aliases: CD31A_0036
[0747] Genomic context: Chromosome
Annotation: NC_016799.1 (34597 . . . 37851)
ID: 11731168
SEQ ID NO: 184
[0748] 124. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae VA01]
Other Aliases: CDVA01_0033
[0749] Genomic context: Chromosome
Annotation: NC_016790.1 (34795 . . . 38049)
ID: 11717708
SEQ ID NO: 185
[0750] 125. cas3 CRISPR-associated endonuclease [Corynebacterium
diphtheriae HC01]
Other Aliases: CDHC01_0034
[0751] Genomic context: Chromosome
Annotation: NC_016786.1 (35060 . . . 38314)
ID: 11708318
SEQ ID NO: 186
[0752] 126. cas9 CRISPR-associated protein [Corynebacterium
diphtheriae HC01]
Other Aliases: CDHC01_2103
[0753] Genomic context: Chromosome
Annotation: NC_016786.1 (2246368 . . . 2248998)
ID: 11708126
SEQ ID NO: 187
127. PARA_18570
[0754] hypothetical protein [Haemophilus parainfluenzae T3T1]
Other Aliases: PARA_18570
[0755] Genomic context: Chromosome
Annotation: NC_015964.1 (1913335 . . . 1916493)
ID: 11115627
SEQ ID NO: 188
128. HDN1F_34120
[0756] hypothetical protein [gamma proteobacterium HdN1]
Other Aliases: HDN1F_34120
[0757] Genomic context: Chromosome Annotation: NC_014366.1 (4143336
. . . 4146413, complement)
ID: 9702142
SEQ ID NO: 189
129. SPy_1046
[0758] hypothetical protein [Streptococcus pyogenes M1 GAS]
Other Aliases: SPy_1046
[0759] Genomic context: Chromosome
Annotation: NC_002737.1 (854757 . . . 858863)
ID: 901176
SEQ ID NO: 190
130. GBS222_0765
[0760] Hypothetical protein [Streptococcus agalactiae]
Other Aliases: GBS222_0765
Annotation: NC_021195.1 (810875 . . . 814987)
ID: 15484689
SEQ ID NO: 191
131. NE061598_03330
[0761] hypothetical protein [Francisella tularensis subsp.
tularensis NE061598]
Other Aliases: NE061598_03330
[0762] Genomic context: Chromosome
Annotation: NC_017453.1 (601219 . . . 604590)
ID: 12437259
SEQ ID NO: 192
132. NMV_1993
[0763] hypothetical protein [Neisseria meningitidis 8013]
Other Aliases: NMV_1993
Annotation: NC_017501.1 (1917073 . . . 1920321)
ID: 12393700
SEQ ID NO: 193
[0764] 133. csn1 hypothetical protein [Campylobacter jejuni subsp.
jejuni M1]
Other Aliases: CJM1_1467
[0765] Genomic context: Chromosome Annotation: NC_017280.1 (1433667
. . . 1436252, complement)
ID: 12249021
SEQ ID NO: 194
134. FTU_0629
[0766] hypothetical protein [Francisella tularensis subsp.
tularensis TIGB03]
Other Aliases: FTU_0629
[0767] Genomic context: Chromosome
Annotation: NC_016933.1 (677092 . . . 680463)
ID: 11890131
SEQ ID NO: 195
135. NMAA_0315
[0768] hypothetical protein [Neisseria meningitidis WUE 2594]
Other Aliases: NMAA_0315
[0769] Annotation: NC_017512.1 (377010 . . . 380258,
complement)
ID: 12407849
SEQ ID NO: 1%
136. WS1445
[0770] hypothetical protein [Wolinella succinogenes DSM 1740]
Other Aliases: WS1445
[0771] Genomic context: Chromosome Annotation: NC_005090.1 (1388202
. . . 1391381, complement)
ID: 2554690
SEQ ID NO: 197
137. THITE_2123823
[0772] hypothetical protein [Thielavia terrestris NRRL 8126]
Other Aliases: THITE_2123823
Chromosome: 6
Annotation: Chromosome 6NC_016462.1 (1725696 . . . 1725928)
ID: 11523019
SEQ ID NO: 198
138. XAC29_16635
[0773] hypothetical protein [Xanthomonas axonopodis Xac29-1]
Other Aliases: XAC29_16635
[0774] Genomic context: Chromosome
Annotation: NC_020800.1 (3849847 . . . 3850302)
ID: 14853997
SEQ ID NO: 199
139. M1GAS476_0830
[0775] hypothetical protein [Streptococcus pyogenes M1 476]
Other Aliases: M1GAS476_0830
Chromosome: 1
Annotation: NC_020540.1 (792119 . . . 796225)
ID: 14819166
SEQ ID NO: 200
140. Piso0_000203
[0776] Piso0_000203[Millerozyma farinosa CBS 7064]
Other Aliases: GNLVRS01_PISO0A04202g
[0777] Other Designations: hypothetical protein
Chromosome: A
[0778] Annotation: NC_020226.1 (343553 . . . 343774,
complement)
ID: 14528449
SEQ ID NO: 201
141. G148_0828
[0779] hypothetical protein [Riemerella anatipestifer RA-CH-2]
Other Aliases: G148_0828
[0780] Genomic context: Chromosome
Annotation: NC_020125.1 (865673 . . . 869875)
ID: 14447195
SEQ ID NO: 202
[0781] 142. csn1 hypothetical protein [Streptococcus dysgalactiae
subsp. equisimilis AC-2713]
Other Aliases: SDSE_1207
[0782] Annotation: NC_019042.1 (1134173 . . . 1138288,
complement)
ID: 13901498
SEQ ID NO: 203
143. A964_0899
[0783] hypothetical protein [Streptococcus agalactiae
GD201008-001]
Other Aliases: A964_0899
[0784] Genomic context: Chromosome
Annotation: NC_018646.1 (935164 . . . 939276)
ID: 13681619
SEQ ID NO: 204
144. FNFX1_0762
[0785] hypothetical protein [Francisella cf. novicida Fx1]
Other Aliases: FNFX1_0762
[0786] Genomic context: Chromosome
Annotation: NC_017450.1 (781484 . . . 786373)
ID: 12435564
SEQ ID NO: 205
145. FTV_0545
[0787] hypothetical protein [Francisella tularensis subsp.
tularensis TI0902]
Other Aliases: FTV_0545
[0788] Genomic context: Chromosome
Annotation: NC_016937.1 (601185 . . . 604556)
ID: 11880693
SEQ ID NO: 206
146. FTL_1327
[0789] hypothetical protein [Francisella tularensis subsp.
holarctica LVS]
Other Aliases: FTL_1327
[0790] Genomic context: Chromosome Annotation: NC_007880.1 (1262508
. . . 1263689, complement)
ID: 3952607
SEQ ID NO: 207
147. FTL_1326
[0791] hypothetical protein [Francisella tularensis subsp.
holarctica LVS]
Other Aliases: FTL_1326
[0792] Genomic context: Chromosome Annotation: NC_007880.1 (1261927
. . . 1262403, complement)
ID: 3952606
SEQ ID NO: 208
Sequence CWU 0 SQTB [0793] SEQUENCE LISTING The patent
application contains a lengthy "Sequence Listing" section. A copy
of the "Sequence Listing" is available in electronic form from the
USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160257974A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB [0793] SEQUENCE LISTING The patent application contains a
lengthy "Sequence Listing" section. A copy of the "Sequence
Listing" is available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160257974A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References