U.S. patent application number 15/164716 was filed with the patent office on 2016-09-08 for excision of transgenes in genetically modified organisms.
The applicant listed for this patent is Dow AgroSciences LLC. Invention is credited to Joseph F. Petolino, Sean Russell.
Application Number | 20160257967 15/164716 |
Document ID | / |
Family ID | 44307617 |
Filed Date | 2016-09-08 |
United States Patent
Application |
20160257967 |
Kind Code |
A1 |
Russell; Sean ; et
al. |
September 8, 2016 |
EXCISION OF TRANSGENES IN GENETICALLY MODIFIED ORGANISMS
Abstract
A method for deleting a region of DNA in a plant. In some
embodiments, the method comprises transforming a plant with a
nucleic acid molecule, wherein the nucleic acid molecule encodes
one or more zinc finger nuclease(s) (ZFNs) operably linked to one
or more tissue-specific promoter(s), e.g., a pollen-specific
promoter. Methods include excising native genes in a plant.
Accordingly, in some embodiments, ZFNs are engineered that
recognize sequences that flank native plant genes. In further
embodiments, ZFNs are expressed under the control of developmental
stage-specific promoters, such that, for example, nucleic acid
sequences are specifically excised in plants during relatively late
stages of development. Nucleic acid molecules useful for carrying
out disclosed methods and plants produced by the methods are
included.
Inventors: |
Russell; Sean;
(Indianapolis, IN) ; Petolino; Joseph F.;
(Zionsville, IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dow AgroSciences LLC |
Indianapolis |
IN |
US |
|
|
Family ID: |
44307617 |
Appl. No.: |
15/164716 |
Filed: |
May 25, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13011666 |
Jan 21, 2011 |
|
|
|
15164716 |
|
|
|
|
61297628 |
Jan 22, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/8241 20130101;
C12N 15/8213 20130101; C12N 9/22 20130101; C12N 15/8265 20130101;
A01H 1/02 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; A01H 1/02 20060101 A01H001/02 |
Claims
1. A method for segregating a first polynucleotide fragment from a
second polynucleotide fragment within a genome of a plant cell,
wherein the first polynucleotide fragment and the second
polynucleotide fragment are located in close proximity on a single
chromosome, the method comprising the steps of: (a) providing the
plant cell comprising the first polynucleotide fragment and the
second polynucleotide fragment located in close proximity on the
single chromosome, the plant cell further comprising at least a
second chromosome, wherein the first and second chromosomes are
homologous or homeologous chromosomes of each other; (b)
introducing a site specific nuclease into the genome of the plant
cell; (c) producing a double strand break in the first chromosome,
wherein the double strand break in the first chromosome is
introduced between the first polynucleotide fragment and the second
polynucleotide fragment; (d) producing a double strand break in the
second chromosome, wherein the double strand break in the second
chromosome is introduced between the first polynucleotide fragment
and the second polynucleotide fragment; and (e) obtaining a progeny
plant comprising a modified genome, wherein the first
polynucleotide fragment and the second polynucleotide fragment
segregate from one another.
2. The method of claim 1, wherein the site specific nuclease
comprises a zinc finger nuclease, a TALEN nuclease, a CRISPR-Cas9
nuclease, a meganuclease, or a leucine zipper nuclease.
3. The method of claim 1, wherein the site specific nuclease is
delivered to the plant cell by intra-genomic recombination or via
direct delivery.
4. A plant produced by the method of claim 1.
5. The plant of claim 4, wherein the plant is a transgenic
plant.
6. A plant part, fruit or seed obtained from the plant of claim
4.
7. A method to segregate a first polynucleotide fragment from a
second polynucleotide fragment within the genome of a progeny
plant, the method comprising the steps of: (a) providing a plant
cell comprising the first polynucleotide fragment and the second
polynucleotide fragment located in close proximity on a single
chromosome, the plant cell further comprising at least a second
chromosome, wherein the chromosomes are homologous or homeologous
chromosomes of each other; (b) creating a double strand break in
the first and second chromosome, wherein the double strand break in
the homologous or homeologous chromosomes is introduced between the
first polynucleotide fragment and the second polynucleotide
fragment; (c) segregating the first polynucleotide fragment from
the second polynucleotide fragment located in close proximity on
the single chromosome of the plant cell; and (d) producing a
progeny plant that does not contain the first polynucleotide
fragment within the genome of the progeny plant.
8. The method of claim 7, wherein the double strand break is
produced by a site specific nuclease.
9. The method of claim 8, wherein the site specific nuclease
comprises a zinc finger nuclease, a TALEN nuclease, a CRISPR-Cas9
nuclease, a meganuclease, or a leucine zipper nuclease.
10. The method of claim 8, wherein the site specific nuclease is
delivered to the plant cell by intra-genomic recombination or via
direct delivery.
11. A plant produced by the method of claim 7.
12. The plant of claim 11, wherein the plant is a transgenic
plant.
13. A plant part, fruit or seed obtained from the plant of claim
11.
14. A method for segregating the inheritance of a first transgene
from a second transgene in a progeny plant, the method comprising
the steps of: (a) crossing a first parent plant with a second
parent plant; (b) producing a double strand break between the first
transgene and the second transgene; and (c) obtaining the progeny
plant.
15. The method of claim 14, further comprising screening the
progeny plant for segregation of the first transgene from the
second transgene in the progeny plant.
16. The method of claim 14, wherein the double strand break is
produced by a site specific nuclease.
17. The method of claim 16, wherein the site specific nuclease
comprises a zinc finger nuclease, a TALEN nuclease, a CRISPR-Cas9
nuclease, a meganuclease, or a leucine zipper nuclease.
18. The method of claim 16, wherein the site specific nuclease is
delivered to the plant by intra-genomic recombination or via direct
delivery.
19. A plant produced by the method of claim 14.
20. The plant of claim 19, wherein the plant is a transgenic
plant.
21. A plant part, fruit or seed obtained from the plant of claim
19.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/011,666 filed Jan. 21, 2011 which claims
the benefit of U.S. Provisional Patent Application Ser. No.
61/297,628, filed Jan. 22, 2010, the disclosure of each are hereby
incorporated herein in their entirety by this reference.
FIELD OF THE INVENTION
[0002] The invention generally relates to compositions and methods
for generating transgenic plants. In certain embodiments, the
transgenic plants comprise one or more transgenes of interest. In
certain embodiments, excision of transgene(s) is directed in pollen
and/or seed, such that the pollen and/or seed produced by a
transgenic plant of the invention is substantially free of
transgene(s). In some embodiments, transgenic plants of the
invention are useful, for example, in achieving bioconfinement of
transgene(s) of interest in the transgenic plant. In other
embodiments, the excision of the transgene is directed to a
specific expression cassette, such as a selectable marker, such
that only this expression cassette is removed from the transgenic
plant and/or progeny of the transgenic plant.
BACKGROUND
[0003] Many plants are genetically transformed with genes from
other species to introduce desirable traits, such as to improve
agricultural value through, e.g., improving nutritional value
quality, increasing yield, conferring pest or disease resistance,
increasing drought and stress tolerance, improving horticultural
qualities such as pigmentation and growth, and/or imparting
herbicide resistance; enabling the production of industrially
useful compounds and/or materials from the plant; and/or enabling
the production of pharmaceuticals. The introduction of cloned genes
into plant cells and recovery of stable fertile transgenic plants
can be used to make such modifications of a plant, and has allowed
desirable traits or qualities of interest to be incorporated into
plants via genetic engineering (e.g., crop improvement). In these
methods, foreign DNA is typically introduced into the nuclear or
plastid DNA of the eukaryotic plant cell, followed by isolation of
cells containing the foreign DNA integrated into the cell's DNA, to
produce stably transformed plant cells.
[0004] One drawback that arises regarding the use of transgenic
plants is the possibility of transgene escape to wild species and
non-transformed species. These traits can increase the risk of
outcrossing, persistence, and introgression of transgenes into an
adjacent population. The escape of transgenes from genetically
modified (GM) crops usually occurs through gene flow, mainly by
cross-pollination (Lu (2003) Eviron. Biosafety Res. 2:3-8), but may
also occur through introgression. Stewart Jr. et al. (2003) Nat.
Reviews Gen. 4:806-17. Crop-to-crop gene flow will result in
contamination of non-GM varieties, affecting the strategic
deployment of transgenic and non-transgenic crop varieties in a
given agricultural system. Significant contamination of non-GM
crops with transgenic material poses difficulties in international
trade because of legal restrictions on imports of transgenic
products by many countries. Crop-to-crop gene flow can cause
stacking of transgenes in hybrids that may potentially become
volunteer weeds if the transgenes impart multiple resistance (e.g.,
to herbicides, pests, and/or diseases). Additionally, crop-to-crop
gene flow will lead to transgene escape into weedy populations or
related wild species, which may pose serious weed problems and
other ecological risks if the transgenes persist and establish in
the weedy/wild populations through sexual reproduction and/or
vegetative propagation. This is a particular concern when escaped
genes enhance the ecological fitness of the weedy/wild species.
Introgression of a crop transgene occurs in steps involving several
successive hybrid generations. Introgression is a dynamic process
that may take many years and generations before the transgene is
fixed in the genetic background of a receiving species and, thus,
presents difficulties of detection and monitoring. However, if
selection is strong and/or population size is small, fixation of an
introgressed gene may occur rapidly.
[0005] Containment of a specific expression cassette within
genetically modified plants, especially a selectable marker
expression cassette, is an elusive goal. Selectable marker genes
are usually antibiotic resistant or herbicide tolerant genes, but
may include reporter genes (i.e., .beta.-glucuronirase (Graham et
al. (1989) Plant Cell Tiss. Org. 20(1):35-39). Selectable makers
which are co-transferred into the genome of a plant provide a
selective advantage and allow for the identification of stably
transformed transgenic plants. The availability of functional
selectable maker genes which can be used for the transformation of
plants is somewhat limited. A review of the published scientific
literature on transgenic crop plants reveals that the most widely
used selective agents for antibiotic resistance are for kanamycin
(encoded by the neomycin phosphotransferase type II gene (Bevan et
al. (1983) Nature 304:184-187)) or hygromycin (encoded by the
hygromycin phosphotransferase gene (Waldron et al., Plant Mol.
Biol. 5:103-108)), and herbicide tolerance is phosphinothricin
resistance (encoded by the pat (Wohlleben et al. (1988) Gene
70:25-37) or bar genes (DeBlock et al. (1987), EMBO J. 6
(9):2513-2518)). See, Sundar et al. (2008) J. Plant Physiol.
165:1698-1716. Given the limited number of selectable marker genes
and the common use of a sub-set of these traits, a solution that
allows for the excision and re-use of selectable markers within a
transgenic plant would obviate the need for additional selectable
makers in subsequent rounds of gene transfer or gene stacking into
the same plant. Moreover, the ability to excise a selectable marker
could overcome unintended changes to the plant transcriptome that
are caused by the expression of the marker (Abdeen et al. (2009)
Plant Biotechnol. J. 7(3):211-218).
[0006] Current strategies to prevent or minimize gene flow between
GM crops and other species and varieties include: (1) physical
isolation of the transgenic crop; (2) chloroplast engineering of
transgenes; (3) co-engineering of a mitigation gene along with the
transgene; (4) genetic use restriction technologies (GURTs); (5)
CRE/loxP and FLP/FRTrecombinase-mediated gene deletion. See, e.g.,
Lee and Natesan (2006) TRENDS Biotech. 24(3): 109-14; Lu (2003),
supra; and Luo et al. (2007), Plant Biotech. J. 5:263-74; and (6)
meganuclease-mediated gene deletion. See, e.g., U.S. patent
application Ser. No. 11/910,515; and U.S. patent application Ser.
No. 12/600,902.
[0007] CRE, FLP, and R recombinases have been exploited for the
excision of unwanted genetic material from plants. Hare and Chua
(2002) Nat. Biotech. 20:575-80. Luo et al. (2007), supra, reported
a pollen- and seed-specific "GM-gene-deletor" system, wherein use
of loxP-FRT fusion sequences as recognition sites for excision of
transgenes by CRE or FLP recombinase led to deletion of transgenes
from pollen, or from both pollen and seed, of transgenic tobacco
plants. All these site-specific recombinase systems shown to
function in plants are members of the integrase family. These
systems have been chosen for use, at least in part, due to the fact
that other recombinases may require ancillary proteins and more
complex recognition sites that may confer topological restraints on
recombination efficiencies. Id. These systems have several
significant drawbacks: integrase-type recombinases may also
recognize "pseudo-sequences," which may be highly divergent from a
specific target sequence and, therefore, lead to unwanted
non-specific DNA deletions; and excision of a target sequence
leaves a residual recognition sequence that may be sites of
chromosomal rearrangements upon subsequent exposure to the
recombinase, or activate gene silencing mechanisms. Id. Moreover,
these systems are further constrained as a functional recombinase
must be present and expressed in one of the parent plants, the
presence of which requires additional strategies for deletion
within pollen and/or seed. Despite these limitations, the CRE/loxP
system is recognized as the most suitable strategy for optimization
of gene deletion in plants. Id.
[0008] Custom-designed zinc finger nucleases (ZFNs) are proteins
designed to deliver a targeted site-specific double-strand break in
DNA, with subsequent recombination of the cleaved ends. ZFNs
combine the non-specific cleavage domain of FokI restriction
endonuclease with zinc finger DNA-binding proteins. See, e.g.,
Huang et al. (1996) J. Protein Chem. 15:481-9; Kim et al. (1997)
Proc. Natl. Acad. Sci. USA 94:3616-20; Kim et al. (1996) Proc.
Natl. Acad. Sci. USA 93:1156-60; Kim et al. (1994) Proc. Natl. Acad
Sci. USA 91:883-7; Kim et al. (1997b) Proc. Natl. Acad Sci. USA
94:12875-9; Kim et al. (1997c) Gene 203:43-9; Kim et al. (1998)
Biol. Chem. 379:489-95; Nahon and Raveh (1998) Nucleic Acids Res.
26:1233-9; Smith et al. (1999) Nucleic Acids Res. 27:674-81.
Individual zinc finger motifs can be designed to target and bind to
a large range of DNA sites. Cys2His2 zinc finger proteins bind DNA
by inserting an .alpha.-helix into the major groove of the double
helix. Recognition of DNA by zinc fingers is modular: each finger
contacts primarily three consecutive base pairs in the target, and
a few key residues in the protein mediate recognition. It has been
shown that FokI restriction endonuclease must dimerize via the
nuclease domain in order to cleave DNA, inducing a double-strand
break. Similarly, ZFNs also require dimerization of the nuclease
domain in order to cut DNA. Mani et al. (2005) Biochem. Biophys.
Res. Commun. 334:1191-7; Smith et al. (2000) Nucleic Acids Res.
28:3361-9. Dimerization of the ZFN is facilitated by two adjacent,
oppositely oriented binding sites. Id. In addition, double strand
breaks caused by zinc finger nucleases are resolved by the plants
DNA repair machinery via either nonhomologous end joining (NHEJ) or
homology directed repair (HDR), thereby resulting in plants which
are free of residual recognition sequences.
SUMMARY OF THE DISCLOSURE
[0009] According to an embodiment of the invention, a method for
deleting a region of DNA in a plant wherein a viable plant
containing a genomic DNA, the genomic DNA comprising the region of
DNA, is provided; and a zinc finger nuclease, engineered to cleave
the genomic DNA at a recognition sequence, is expressed or
introduced in the viable plant containing the genomic DNA; thereby
resulting in cleavage of the genomic DNA at recognition sequences
resulting in the excision of the genomic DNA, wherein the region of
DNA is absent from the genomic DNA.
[0010] In another embodiment, a method for deleting a region of DNA
in a plant includes providing a first viable plant containing a
genomic DNA, the genomic DNA comprising the region of DNA and a
first recognition sequence flanking the 3' end and a second
recognition sequence flanking the 5' end of the region of DNA. A
second viable plant containing a genomic DNA is provided, the
genomic DNA comprising a DNA encoding a zinc finger nuclease
engineered to cleave the genomic DNA at the recognition sequences.
The first and second viable plants are crossed such that F.sub.1
seed is produced on either the first or the second viable plant. A
resultant F1 plant containing a genomic DNA is grown, wherein the
region of DNA is absent from the genomic DNA. In certain
embodiments, the first recognition sequence and the second
recognition sequence can be identical.
[0011] In a particular embodiment, an isolated nucleic acid
molecule includes: a first nucleic acid sequence recognized by a
zinc finger nuclease; a gene of interest; and a second nucleic acid
sequence recognized by a zinc finger nuclease, wherein the gene of
interest is flanked by the first and second nucleic acid sequences
recognized by a zinc finger nuclease. In another embodiment, the
first recognition sequence and the second recognition sequence can
be flanked by homologous sequences. In yet another embodiment, a
method of producing a transgenic plant includes transforming a
plant cell or plant tissue with the isolated nucleic acid molecule
and regenerating a whole plant.
[0012] In an additional embodiment, a method for reducing the
transmission of a gene of interest to other plants includes
crossing the whole plant with a plant regenerated from a plant cell
or tissue transformed with an isolated nucleic acid molecule
comprising a pollen-specific promoter operably linked to a zinc
finger nuclease, wherein the gene of interest is specifically
excised in pollen of the progeny resulting from the cross. The
progeny resulting from the cross are cultivated. In such
embodiment, an isolated nucleic acid molecule includes a promoter
and a nucleic acid sequence encoding a zinc finger nuclease,
wherein the promoter is operably linked to the nucleic acid
sequence encoding the zinc finger nuclease and the method of
producing a transgenic plant that includes transforming a plant
cell or plant tissue with the isolated nucleic acid molecule and
regenerating a whole plant.
[0013] In an embodiment, a method for deleting a region of DNA in a
plant containing a nucleic acid molecule including: a first nucleic
acid sequence recognized by a zinc finger nuclease; a selectable
marker gene expression cassette; and a second nucleic acid sequence
recognized by a zinc finger nuclease, wherein the selectable marker
is flanked by the first and second nucleic acid sequences
recognized by a zinc finger nuclease. In another embodiment, the
first recognition sequence and the second recognition sequence are
flanked by homologous sequences. Additionally, a zinc finger
nuclease, engineered to cleave the genomic DNA at a recognition
sequence, is expressed or introduced in the viable plant cell;
thereby resulting in cleavage of the genomic DNA at recognition
sequences resulting in the excision of the genomic DNA, wherein the
selectable marker is absent from the genomic DNA.
[0014] In another embodiment, each half of the zinc finger nuclease
monomer is expressed separately and when paired in conjunction with
one another form a functional complex. For example, a plant
transcription unit which expresses one zinc finger nuclease monomer
(consisting of a zinc finger binding motif operably linked to the
FokI endonuclease) is stably integrated into one parent, P1, and a
plant transcription unit which expresses a second monomer is stably
integrated into a second parent, P2. The sexual cross of
P1.times.P2 results in progeny plants which contain both zinc
finger monomers. The resulting zinc finger nuclease dimer is
capable of binding to a zinc finger binding site and forming a
complex which has cleavage activity. Given that the FokI
endonuclease is active as a dimer (Bitinaite et al. (1998) Proc.
Natl. Acad. Sci. USA 95:10,570-10,575), the cleavage activity is
only capable of occurring within progeny which contain both
functionally expressing monomers.
[0015] In another embodiment, the excision by a zinc finger
nuclease at a recognition sequence results in the formation of a
cleavage junction, which is free of a residual recognition
sequence. The cleavage junction may not be bound and cleaved by the
original zinc finger nuclease(s). Additionally, the cleavage
junction can be the result of non-homologous end joining (NHEJ) or
the result of homology directed repair between two homologous
regions of DNA which are located upstream of the 5' recognition
sequence and downstream of the 3' recognition sequence or the
result of another undescribed DNA repair mechanism. A homologous
sequence can be placed outside binding sites so that after
cleavage, homology directed repair can occur. This is an
improvement over recombinase systems, which always leave behind a
remnant of the site used to get the excision.
[0016] In yet another embodiment, a method of excising a native
gene of interest in a plant includes transforming a plant cell or
tissue comprising a gene of interest with an isolated nucleic acid
molecule comprising a nucleic acid sequence encoding a zinc finger
nuclease or an isolated protein sequence which encodes a zinc
finger nuclease, wherein the zinc finger nuclease recognizes a
nucleic acid sequence flanking the native gene of interest and the
native gene of interest is specifically excised. A whole plant is
then regenerated. In an alternative embodiment, endogenous gene
excision can be accomplished by crossing a plant expressing a zinc
finger nuclease with a target plant.
BRIEF DESCRIPTION OF THE FIGURES
[0017] FIG. 1 includes the plasmid map for plasmid pDAS5380.
[0018] FIG. 2 includes the plasmid map for plasmid pDAS5381.
[0019] FIG. 3a is a schematic diagram and restriction map of the
T-DNA insert. FIG. 3b includes several panels depicting T.sub.0
Southern blot analysis used to identify events which contained full
length intact PTUs from plasmid pDAS5380 according to an embodiment
of the invention. The T.sub.0 Southern blot analysis image used
restriction enzymes MfeI and NsiI to digest the pDAS5380 events,
showing intact T-DNA inserts by co-hybridization of GUS and
PAT.
[0020] FIG. 4A is a schematic diagram and restriction map of the
T-DNA insert. FIG. 4b includes several panels depicting T.sub.0
Southern blot analysis used to identify events which contained full
length intact PTUs from plasmid pDAS5381 according to an embodiment
of the invention. The T.sub.0 Southern blot analysis image used
restriction enzymes MfeI and NsiI to digest the pDAS5381 events,
showing intact T-DNA inserts by hybridization of HptII.
[0021] FIG. 5 includes Southern blot analysis of a select group of
events that are representative of a larger sample according to an
embodiment of the invention. These samples were selected to
illustrate the excised fragment (i.e., the lower molecular
fragment), the non-excised fragment (i.e., the higher molecular
weight fragment), and the chimeric events which contained both the
excised and non-excised fragments. In addition, controls of the
wild-type genomic DNA and 100 pg of the pDAS5380 plasmid were
included. This data correlated with the GUS expression data. Events
that did not stain positive via histochemical staining for GUS did
not contain a full-length, intact GUS PTU expression cassette.
[0022] FIG. 6 includes the image of an agarose gel containing PCR
amplified fragments of the genomic DNA samples used in the Southern
blot experiments according to an embodiment of the invention. These
PCR amplicons illustrate the excised fragment (i.e., the lower
molecular weight fragment), the non-excised fragment (i.e., the
higher molecular weight fragment), and the chimeric events which
contained both the excised and non-excised fragments. In addition,
controls of the wild T.sub.0 plants are included; the larger intact
GUS PTU expression cassette was amplified in these reactions.
Negative controls where wild-type genomic DNA and no DNA (H.sub.2O)
were used for the PCR reactions are also included. This data
correlated with the GUS expression data and the Southern blot
data.
[0023] FIGS. 7a and 7b include an alignment of sequence analysis of
the 2.4 kb band showing deletion of the GUS expression cassette
according to an embodiment of the invention. The bold sequence
indicates the At Actin Promoter and MAR gene elements. CCR5 binding
sites are identified with underlining and italics. Although
multiple amplicons were generated and sequenced per event, only one
amplicon was aligned in the Figures.
[0024] FIG. 8 includes PCR analysis of F.sub.2 progenies of
"Intact" F.sub.1 hybrids according to an embodiment of the
invention.
[0025] FIG. 9 includes Southern analysis of F.sub.2 progenies of
"Intact" F.sub.1 hybrids according to an embodiment of the
invention.
[0026] FIG. 10 includes PCR analysis of F.sub.2 progenies of
"Excised" F.sub.1 hybrids according to an embodiment of the
invention.
[0027] FIG. 11 includes Southern analysis of F.sub.2 progenies of
"Excised" F.sub.1 hybrids according to an embodiment of the
invention.
[0028] FIG. 12 includes PCR analysis of F.sub.2 progenies of
"Chimeric" F.sub.1 hybrids according to an embodiment of the
invention.
[0029] FIG. 13 includes Southern analysis of F.sub.2 progenies of
"Chimeric" F.sub.1 hybrids according to an embodiment of the
invention.
SEQUENCE LISTING
[0030] The nucleic acid sequences listed in the accompanying
sequence listing are shown using standard letter abbreviations for
nucleotide bases. Only one strand of each nucleic acid sequence is
shown, but the complementary strand is understood as being included
by any reference to the displayed strand. In the accompanying
sequence listing:
[0031] SEQ ID NO:1 shows a CCR5 ZFN binding site.
[0032] SEQ ID NO:2 shows a CCR5 Zinc Finger Nuclease gene
sequence.
[0033] SEQ ID NO:3 shows a TQPATS primer.
[0034] SEQ ID NO:4 shows a TQPATA primer.
[0035] SEQ ID NO:5 shows a TQPATFQ primer.
[0036] SEQ ID NO:6 shows a TQPALS primer.
[0037] SEQ ID NO:7 shows a TQPALA primer.
[0038] SEQ ID NO:8 shows a TQPALFQ primer.
[0039] SEQ ID NO:9 shows a HPT2S primer.
[0040] SEQ ID NO: 10 shows a HPT2A primer.
[0041] SEQ ID NO: 11 shows a HPTFQ primer.
[0042] SEQ ID NO: 12 shows a Fok1_UPL_F primer.
[0043] SEQ ID NO:13 shows a Fok1_UPL_R primer.
[0044] SEQ ID NO: 14 shows a BY2ACT89S primer.
[0045] SEQ ID NO:15 shows a BY2ACT89A primer.
[0046] SEQ ID NO: 16 shows a forward PCR primer for PTU PCR
analysis.
[0047] SEQ ID NO: 17 shows a reverse PCR primer for PTU PCR
analysis.
[0048] SEQ ID NO: 18 shows a BYACTFQ primer.
DETAILED DESCRIPTION
[0049] Disclosed herein is a method to excise genes from specific
plant tissue in genetically modified organisms. In some
embodiments, one or more ZFNs (zinc finger nuclease) are used to
remove transgenes from specific plant tissue as a means of reducing
gene flow into non-GM crops. In some embodiments, the transgene
that is removed is a selectable marker gene cassette. In certain
embodiments, the specific plant tissue is pollen.
[0050] In some embodiments, one or more ZFNs may be operably linked
to different tissue-specific promoters. In these and further
embodiments, one of the one or more ZFNs operably linked to a
tissue-specific promoter may be transformed into one parent plant
line, and another of the one or more ZFNs operably linked to a
different tissue-specific promoter may be transformed into a second
parent plant line. A cross between the parental lines containing
each of the one or more ZFNs can produce an F.sub.1 line that
contains a functional ZFN that cleaves DNA at a recognition
sequence. The recognition sequences may flank transgenes in the DNA
of the plant.
[0051] Tissue-specific gene excision may be achieved by operable
linkage of tissue-specific plant promoters to ZFNs. In some
embodiments, operable linkage of a tissue-specific promoter to one
or more ZFNs leads to tissue-specific expression of the one or more
ZFNs, thereby excising the ZFNs, selectable markers, and/or any
genes or nucleic acid sequences located between the recognition
sequences in the specific tissue.
[0052] In particular embodiments, one or more ZFNs are expressed
within the same plant. ZFNs may be operably linked to promoters
that drive expression of the ZFNs during later developmental stages
of a plant. In these and other embodiments, one or more functional
ZFNs may cleave specific recognition sequences that flank one or
more transgene(s), thereby removing the one or more transgenes from
plant tissue during later stages of plant development.
ABBREVIATIONS
[0053] GM Genetically modified
[0054] PTU Plant transcription unit
[0055] ZF Zinc finger
[0056] ZFN Zinc finger nuclease
[0057] ZFP Zinc finger protein
TERMS
[0058] Gene expression: The process by which the coded information
of a nucleic acid transcriptional unit (including, e.g., genomic
DNA or cDNA) is converted into an operational, non-operational, or
structural part of a cell, often including the synthesis of a
protein. Gene expression can be influenced by external signals; for
example, exposure of a cell, tissue, or organism to an agent that
increases or decreases gene expression. Expression of a gene can
also be regulated anywhere in the pathway from DNA to RNA to
protein. Regulation of gene expression occurs, for example, through
controls acting on transcription, translation, RNA transport and
processing, degradation of intermediary molecules such as mRNA, or
through activation, inactivation, compartmentalization, or
degradation of specific protein molecules after they have been
made, or by combinations thereof. Gene expression can be measured
at the RNA level or the protein level by any method known in the
art, including, without limitation, Northern blot, RT-PCR, Western
blot, or in vitro, in situ, or in vivo protein activity
assay(s).
[0059] Hybridization: Oligonucleotides and their analogs hybridize
by hydrogen bonding, which includes Watson-Crick, Hoogsteen or
reversed Hoogsteen hydrogen bonding, between complementary bases.
Generally, nucleic acid molecules consist of nitrogenous bases that
are either pyrimidines (cytosine (C), uracil (U), and thymine (T))
or purines (adenine (A) and guanine (G)). These nitrogenous bases
form hydrogen bonds between a pyrimidine and a purine, and the
bonding of the pyrimidine to the purine is referred to as "base
pairing." More specifically, A will hydrogen bond to T or U, and G
will bond to C. "Complementary" refers to the base pairing that
occurs between two distinct nucleic acid sequences or two distinct
regions of the same nucleic acid sequence.
[0060] "Specifically hybridizable" and "specifically complementary"
are terms that indicate a sufficient degree of complementarity such
that stable and specific binding occurs between the oligonucleotide
and the DNA or RNA target. The oligonucleotide need not be 100%
complementary to its target sequence to be specifically
hybridizable. An oligonucleotide is specifically hybridizable when
binding of the oligonucleotide to the target DNA or RNA molecule
interferes with the normal function of the target DNA or RNA, and
there is sufficient degree of complementarity to avoid non-specific
binding of the oligonucleotide to non-target sequences under
conditions where specific binding is desired, for example under
physiological conditions in the case of in vivo assays or systems.
Such binding is referred to as specific hybridization.
[0061] Hybridization conditions resulting in particular degrees of
stringency will vary depending upon the nature of the hybridization
method of choice and the composition and length of the hybridizing
nucleic acid sequences. Generally, the temperature of hybridization
and the ionic strength (especially the Na.sup.+ and/or Mg.sup.2+
concentration) of the hybridization buffer will contribute to the
stringency of hybridization, though wash times also influence
stringency. Calculations regarding hybridization conditions
required for attaining particular degrees of stringency are
discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory
Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989, chs. 9 and 11.
[0062] For purposes of the present disclosure, "stringent
conditions" encompass conditions under which hybridization will
occur if there is less than 25% mismatch between the hybridization
molecule and the target sequence. "Stringent conditions" can be
further defined into particular levels of stringency. Thus, as used
herein, "moderate stringency" conditions are those under which
molecules with more than 25% mismatch will not hybridize;
conditions of "medium stringency" are those under which molecules
with more than 15% mismatch will not hybridize, and conditions of
"high stringency" are those under which sequence with more than 10%
mismatch will not hybridize. Conditions of "very high stringency"
are those under which sequences with more than 6% mismatch will not
hybridize.
[0063] In particular embodiments, stringent conditions are
hybridization at 65.degree. C., followed by sequential washes at
65.degree. C. with 0.1.times.SSC/0.1% SDS for 40 minutes.
[0064] Isolated: An "isolated" biological component (such as a
nucleic acid or protein) has been substantially separated, produced
apart from, or purified away from other biological components in
the cell of the organism in which the component naturally occurs,
i.e., other chromosomal and extra-chromosomal DNA and RNA, and
proteins. Nucleic acid molecules and proteins that have been
"isolated" include nucleic acid molecules and proteins purified by
standard purification methods. The term also embraces nucleic acids
and proteins prepared by recombinant expression in a host cell, as
well as chemically synthesized nucleic acid molecules, proteins,
and peptides.
[0065] Nucleic acid molecule: A polymeric form of nucleotides,
which can include both sense and anti-sense strands of RNA, cDNA,
genomic DNA, and synthetic forms and mixed polymers of the above. A
nucleotide refers to a ribonucleotide, deoxynucleotide, or a
modified form of either type of nucleotide. A "nucleic acid
molecule" as used herein is synonymous with "nucleic acid" and
"polynucleotide." The term includes single- and double-stranded
forms of DNA. A nucleic acid molecule can include either or both
naturally occurring and modified nucleotides linked together by
naturally occurring and/or non-naturally occurring nucleotide
linkages.
[0066] Nucleic acid molecules may be modified chemically or
biochemically, or may contain non-natural or derivatized nucleotide
bases, as will be readily appreciated by those of skill in the art.
Such modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides
with an analog, internucleotide modifications, such as uncharged
linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoramidates, carbamates, etc.), charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), pendent moieties
(e.g., peptides), intercalators (e.g., acridine, psoralen, etc.),
chelators, alkylators, and modified linkages (e.g., alpha anomeric
nucleic acids, etc.). The term "nucleic acid molecule" also
includes any topological conformation, including single-stranded,
double-stranded, partially duplexed, triplexed, hairpinned,
circular, and padlocked conformations.
[0067] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is in a functional relationship with the second
nucleic acid sequence. For instance, a promoter is operably linked
with a coding sequence when the promoter affects the transcription
or expression of the coding sequence. When recombinantly produced,
operably linked nucleic acid sequences are generally contiguous
and, where necessary to join two protein-coding regions, in the
same reading frame. However, elements need not be contiguous to be
operably linked.
[0068] Promoter: A region of DNA that generally is located upstream
(towards the 5' region of a gene) that is needed for transcription.
Promoters permit the proper activation or repression of the gene
which they control. A promoter contains specific sequences that are
recognized by transcription factors. These factors bind to the
promoter DNA sequences and result in the recruitment of RNA
polymerase, the enzyme that synthesizes the RNA from the coding
region of the gene. In some embodiments, tissue-specific promoters
are used in methods of the invention, e.g., a pollen-specific
promoter. A tissue-specific promoter is a DNA sequence that directs
a higher level of transcription of an associated gene in the tissue
for which the promoter is specific relative to the other tissues of
the organism. Examples of tissue-specific promoters include
tapetum-specific promoters; anther-specific promoters;
pollen-specific promoters (see, e.g., U.S. Pat. No. 7,141,424, and
International PCT Publication No. WO 99/042587); ovule-specific
promoters; (see, e.g., U.S. Patent Application No. 2001/047525 A1);
fruit-specific promoters (See, e.g., U.S. Pat. Nos. 4,943,674, and
5,753,475); and seed-specific promoters (see, e.g., U.S. Pat. Nos.
5,420,034, and 5,608,152). In some embodiments, developmental
stage-specific promoters are used in methods of the invention,
e.g., a promoter active at a later stage in development.
[0069] Transformed: A virus or vector "transforms" or "transduces"
a cell when it transfers nucleic acid molecules into the cell. A
cell is "transformed" by a nucleic acid molecule transduced into
the cell when the nucleic acid molecule becomes stably replicated
by the cell, either by incorporation of the nucleic acid molecule
into the cellular genome, or by episomal replication. As used
herein, the term "transformation" encompasses all techniques by
which a nucleic acid molecule can be introduced into such a cell.
Examples include, but are not limited to, transfection with viral
vectors, transformation with plasmid vectors, electroporation
(Fromm et al. (1986) Nature 319:791-3), lipofection (Felgner et al.
(1987) Proc. Natl. Acad. Sci. USA 84:7413-7), microinjection
(Mueller et al. (1978) Cell 15:579-85), Agrobacterium-mediated
transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA
80:4803-7), direct DNA uptake, and microprojectile bombardment
(Klein et al. (1987) Nature 327:70).
[0070] Transgene: An exogenous nucleic acid sequence. In one
example, a transgene is a gene sequence (e.g., a
herbicide-resistance gene), a gene encoding an industrially or
pharmaceutically useful compound, or a gene encoding a desirable
agricultural trait. In yet another example, the transgene is an
antisense nucleic acid sequence, wherein expression of the
antisense nucleic acid sequence inhibits expression of a target
nucleic acid sequence. A transgene may contain regulatory sequences
operably linked to the transgene (e.g., a promoter).
[0071] Vector: A nucleic acid molecule as introduced into a cell,
thereby producing a transformed cell. A vector can include nucleic
acid sequences that permit it to replicate in the host cell, such
as an origin of replication. Examples include, but are not limited
to, a plasmid, cosmid, bacteriophage, or virus that carries
exogenous DNA into a cell. A vector can also include one or more
genes, antisense molecules, and/or selectable marker genes and
other genetic elements known in the art. A vector can transduce,
transform, or infect a cell, thereby causing the cell to express
the nucleic acid molecules and/or proteins encoded by the vector. A
vector optionally includes materials to aid in achieving entry of
the nucleic acid molecule into the cell (e.g., a liposome, protein
coding, etc.).
Zn-Finger Nuclease-Mediated Excision of Transgenes from Plants
[0072] Disclosed herein are methods for producing a plant having
decreased transgene escape, as well as plants produced by such
methods, and plant materials derived therefrom, e.g., seeds. In one
embodiment, the method comprises contacting a plant with a vector,
wherein the vector includes one or more zinc finger nuclease(s)
(ZFNs) operably linked to one or more tissue-specific promoter(s)
(e.g., a pollen-specific promoter). Expression of this vector
results in the production of the ZFN(s) in the specific tissue
wherein its operably linked promoter is active. The ZFN(s) may be
designed or engineered to recognize a cleavage sequence that flanks
a nucleic acid sequence, the excision of which is desired.
Production of the ZFN(s), then, in the specific tissue wherein the
promoter is active, results in excision of the nucleic acid
sequence between the cleavage sequences recognized by the ZFN(s),
thereby producing a nucleic acid sequence that contains a cleavage
junction that is free of a residual recognition sequence.
[0073] In another embodiment, the method comprises: contacting a
plant with a vector, wherein the vector includes one or more ZFN(s)
operably linked to a tissue-specific promoter; a gene of interest;
optionally one or more regulatory element(s) that may be operably
linked to the gene of interest; and one or more cleavage sequences
recognized by the ZFN(s) flanking the gene of interest and the one
or more regulatory element(s). Expression of this vector results in
the production of the ZFN(s) in the specific tissue wherein its
operably linked promoter is active. Production of the ZFN(s), then,
in the specific tissue wherein the promoter is active results in
excision of the nucleic acid sequence between the cleavage
sequences recognized by the ZFN(s), which includes the gene of
interest and, optionally, the one or more regulatory
element(s).
[0074] In further embodiments, the method comprises contacting a
plant with a vector, wherein the vector includes one or more zinc
finger nuclease(s) (ZFNs) operably linked to one or more
promoter(s) active at a particular period of plant development
(e.g., a promoter that drives expression at a relatively late stage
of development). Expression of this vector results in the
production of the ZFN(s) during the specific period of development
wherein its operably linked promoter is active. The ZFN(s) may be
designed or engineered to recognize a cleavage sequence that flanks
a nucleic acid sequence, the excision of which is desired.
Production of the ZFN(s) at the developmental stage wherein the
promoter is active, results in excision of the nucleic acid
sequence between the cleavage sequences recognized by the
ZFN(s).
[0075] In still further embodiments, the method comprises:
contacting a plant with a vector, wherein the vector includes one
or more ZFN(s) operably linked to a promoter active at a particular
period of plant development; a gene of interest; optionally one or
more regulatory element(s) that may be operably linked to the gene
of interest; and one or more cleavage sequences recognized by the
ZFN(s) flanking the gene of interest and the one or more regulatory
element(s). Expression of this vector results in the production of
the ZFN(s) during the specific period of development wherein its
operably linked promoter is active. Production of the ZFN(s) during
the specific period of development wherein its operably linked
promoter is active, results in excision of the nucleic acid
sequence between the cleavage sequences recognized by the ZFN(s),
which includes the gene of interest and the one or more regulatory
element(s).
ZFN Nucleases
[0076] In particular embodiments, ZFNs are expressed from nucleic
acid molecules in transformed plants to direct the excision of
nucleic acid sequences in the transformed plants. ZFNs may be used
that target a recognition sequence engineered to flank a particular
nucleic acid sequence (e.g., a transgene, gene of interest, or
selectable marker gene) or ZFNs may be designed to target a
naturally occurring nucleic acid sequence flanking a particular
nucleic acid sequence to be excised. The exquisite flexibility and
specificity of the ZFN system provides a level of control
previously unachievable by known recombinase-mediated gene excision
strategies.
[0077] Recognition specificities of ZFNs can be easily manipulated
experimentally. Wu et al. (2007) Cell. Mol. Life Sci. 64:2933-44.
Randomization of the codons for zinc finger recognition residues
allows the selection of new fingers that have high affinity for
arbitrarily chosen DNA sequences. Furthermore, zinc fingers are
natural DNA-binding molecules, and engineered zinc fingers have
been shown to act on their designed targets in living cells. Thus,
nucleases based on zinc fingers are targetable to specific but
arbitrary recognition sites.
[0078] The requirement for dimerization of cleavage domains of
chimeric zinc finger nucleases imparts a high level of sequence
specificity. Since each set of three fingers binds nine consecutive
base pairs, two chimeric nucleases effectively demand an 18 bp
target if each zinc finger domain has perfect specificity. Any
given sequence of this length is predicted to be unique within a
single genome (assuming approximately 10.sup.9 bp). Bibikova et al.
(2001) Mol. Cell. Biol. 21(1):289-97; Wu et al. (2007), supra.
Furthermore, additional fingers provide enhanced specificity,
Beerli et al. (1998) Proc. Natl. Acad. Sci. USA 95:14628-33; Kim
and Pabo (1998) Proc. Natl. Acad. Sci. USA 95:2812-7; Liu et al.
(1997) Proc. Natl. Acad. Sci. USA 94:5525-30, so the number of zinc
fingers in each DNA-binding domain may be increased to provide even
further specificity. For example, specificity may be further
increased by using a pair of 4-finger ZFNs that recognize a 24 bp
sequence. Urnov et al. (2005) Nature 435:646-51.
[0079] Key amino acids in ZFNs, at positions -1, 2, 3, and 6
relative to the start of the ca-helix, contribute most of the
specific interactions by the zinc finger motifs. Pavletich and Pabo
(1991) Science 252:809-17; Shi and Berg (1995) Chem. Biol. 2:83-9.
These amino acids can be changed, while maintaining the remaining
amino acids as a consensus backbone, to generate ZFPs with
different and/or novel sequence specificities. See, e.g., Choo and
Klug (1994) Proc. Natl. Acad. Sci. USA 91:11163-7; Desjarlais and
Berg (1992) Proc. Natl. Acad. Sci. USA 89:7345-9; Desjarlais and
Berg (1993) Proc. Natl. Acad. Sci. USA 90:2256-60; Greisman and
Pabo (1997) Science 275:657-61; Isalan et al. (1998) Biochemistry
37:12026-33; Jamieson et al. (1994) Biochemistry 33:5689-95; Rebar
and Pabo (1994) Science 263:671-3; Segal et al. (1999) Proc. Natl.
Acad. Sci. USA 96:2758-63; Wolfe et al. (1999) J. Mol. Biol.
285:1917-34; Wu et al. (1995) Proc. Natl. Acad. Sci. USA 92:344-8.
Moreover, at least two 3-finger ZFNs with different sequence
specificities can be designed, such that they collaborate to
produce cleavage. Smith et al. (2000), supra.
[0080] Design and selection approaches for constructing a ZFN of
the invention may begin by determining one or more appropriate ZF
motifs to recognize a specific nucleic acid sequence.
Alternatively, a ZFN that recognizes a specific nucleic acid
sequence may be used to construct a nucleic acid molecule
comprising the specific nucleic acid sequence (e.g., wherein the
specific nucleic acid sequence flanks a gene of interest) and other
elements as needed. Design and various selection approaches for
ZFPs, including the phage display method, have been reviewed. Mani
et al. (2005), supra; Durai et al. (2005) Nucleic Acids Res.
33:5978-90; Isalan et al. (2001) Nat. Biotechnol. 19:656-60;
Kandavelou et al. (2005) Nat. Biotechnol. 23:686-87; Pabo et al.
(2001) Annu. Rev. Biochem. 70:313-40; Segal et al. (2003)
Biochemistry 42:2137-48. Any design and/or selection approach known
in the art may be used to arrive at a ZFN for use in embodiments of
the present invention. For example, cell-based selection strategies
using bacterial one-hybrid and two-hybrid systems may be used to
produce highly specific ZFPs. Durai et al. (2006) Comb. Chem. High
Throughput Screen. 9:301-11; Hurt et al. (2003) Proc. Natl. Acad.
Sci. USA 100:12271-6; Joung et al. (2000) Proc. Natl. Acad. Sci.
USA 97:7382-7. Highly specific ZFPs can also be obtained by
directed domain shuffling and cell-based selection, which offers a
general approach for optimizing multi-finger ZFPs. Hurt et al.
(2003), supra.
[0081] A wealth of data based on design and phage display
methodologies is available for ZF modules that specifically
recognize 5' GNN 3' and 5' ANN 3' triplets, and to a lesser extent,
the ZF motif preferences for 5' CNN 3' and 5' TNN 3' triplets are
known. See, e.g., Durai et al. (2005), supra; Dreier et al. (2001)
J. Biol. Chem. 276:29466-78; Dreier et al. (2005) J. Biol. Chem.
280:35588-97; Dreier et al. (2000) J. Mol. Biol. 303:489-502; Liu
et al. (2002) J Biol. Chem. 277:3850-6. Currently, two Web-based ZF
design software packages are available (e.g., at
zincfingertools.org). The foregoing renders nearly all genes
encoded in a genome amenable to ZFN-mediated gene targeting. Katada
and Komiyama (2009) Chembiochem. 10(8):1279-88.
[0082] In particular embodiments, a ZFN is used that binds the HIV
co-receptor CCR5. Perez et al. (2008) Nat. Biotechnol. 26:808-16.
This ZFN is termed the "CCR5 ZFN." In particular embodiments, the
CCR5 ZFN coding region comprises: the opaque-2 nuclear localization
sequence (Maddaloni et al. (1989) Nucleic Acids Res. 17(18):7532);
the r162yl11 zinc finger binding domain, the FokI nuclease domain
(Looney et al. (1989) Gene 80:193-208); a T2A stutter sequence
(Mattion et al. (1996) J. Virol. 70:8124-7) derived from the Thesoa
assigna virus; a second opaque-2 nuclear localization sequence, the
168FA vE zinc finger binding domain; and a second FokI nuclease
domain.
Nucleic Acid Molecules
[0083] In some embodiments, the method includes crossing a first
plant having one or more genes of interest (which may confer a
desirable trait or phenotype), such as two or more genes of
interest, with a second plant. The second plant may also have one
or more genes of interest. The first plant may include a vector,
wherein the vector includes a promoter operably linked to one or
more gene(s) of interest. The promoter may be a constitutive or
inducible promoter. The nucleic acid sequence encoding a gene(s) of
interest may be flanked by ZFN recognition sites. Optionally, the
promoter operably linked to the gene(s) of interest, and any
additional nucleic acid sequences (e.g., regulatory sequences), may
also be flanked by ZFN recognition sites. The second plant may
include another vector, which may include a tissue-specific or
development-specific promoter operably linked to a nucleic acid
sequence encoding a ZFN. The vectors may be stably integrated into
the genomes of both plants. After crossing the first and second
plants, the tissue-specific or development-specific promoter
specifically drives the expression of the ZFN in the resulting
progeny of such a cross. Expression of the ZFN in these progeny
leads to excision of nucleic acid sequences flanked by the ZFN
recognition sites, thereby reducing or eliminating the gene of
interest, and optionally additional sequences (such as selectable
marker genes) in specific tissues and/or stages of development of
the progeny. In some embodiments, the ZFN recognition sites may be
further flanked by homologous nucleic acid sequences to further
promote homologous DNA recombination.
[0084] A gene of interest will typically be operably linked to one
or more plant promoter(s) driving expression of the gene in an
amount sufficient to confer a desired trait or phenotype. Promoters
suitable for this and other uses are well known in the art.
Non-limiting examples describing such promoters include U.S. Pat.
No. 6,437,217 (maize RS81 promoter); U.S. Pat. No. 5,641,876 (rice
actin promoter); U.S. Pat. No. 6,426,446 (maize RS324 promoter);
U.S. Pat. No. 6,429,362 (maize PR-1 promoter); U.S. Pat. No.
6,232,526 (maize A3 promoter); U.S. Pat. No. 6,177,611
(constitutive maize promoters); U.S. Pat. Nos. 5,322,938,
5,352,605, 5,359,142, and 5,530,196 (35S promoter); U.S. Pat. No.
6,433,252 (maize L3 oleosin promoter); U.S. Pat. No. 6,429,357
(rice actin 2 promoter, and rice actin 2 intron); U.S. Pat. No.
5,837,848 (root-specific promoter); U.S. Pat. No. 6,294,714
(light-inducible promoters); U.S. Pat. No. 6,140,078
(salt-inducible promoters); U.S. Pat. No. 6,252,138
(pathogen-inducible promoters); U.S. Pat. No. 6,175,060
(phosphorous deficiency-inducible promoters); U.S. Pat. No.
6,388,170 (bidirectional promoters); U.S. Pat. No. 6,635,806
(gamma-coixin promoter); and U.S. patent application Ser. No.
09/757,089 (maize chloroplast aldolase promoter). Additional
promoters include the nopaline synthase (NOS) promoter (Ebert et
al. (1987) Proc. Natl. Acad. Sci. USA 84(16):5745-9); the octopine
synthase (OCS) promoter (which is carried on tumor-inducing
plasmids of Agrobacterium tumefaciens); the caulimovirus promoters
such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton et
al. (1987) Plant Mol. Biol. 9:315-24); the CaMV 35S promoter (Odell
et al. (1985) Nature 313:810-2; the figwort mosaic virus
35S-promoter (Walker et al. (1987) Proc. Natl. Acad. Sci. USA
84(19):6624-8); the sucrose synthase promoter (Yang and Russell
(1990) Proc. Natl. Acad. Sci. USA 87:4144-8); the R gene complex
promoter (Chandler et al. (1989) Plant Cell 1:1175-83); the
chlorophyll a/b binding protein gene promoter; CaMV35S (U.S. Pat.
Nos. 5,322,938, 5,352,605, 5,359,142, and 5,530,196); FMV35S (U.S.
Pat. Nos. 6,051,753, and 5,378,619); a PC1SV promoter (U.S. Pat.
No. 5,850,019); the SCP1 promoter (U.S. Pat. No. 6,677,503); and
AGRtu.nos promoters (GenBank Accession No. V00087; Depicker et al.
(1982) J. Mol. Appl. Genet. 1:561-73; Bevan et al. (1983) Nature
304:184-7), and the like.
[0085] Additional genetic elements that may optionally be operably
linked to a gene of interest include sequences coding for transit
peptides. For example, incorporation of a suitable chloroplast
transit peptide, such as the A. thaliana EPSPS CTP (Klee et al.
(1987) Mol. Gen. Genet. 210:437-42), and the Petunia hybrida EPSPS
CTP (della-Cioppa et al. (1986) Proc. Natl. Acad. Sci. USA
83:6873-7) has been shown to target heterologous EPSPS protein
sequences to chloroplasts in transgenic plants. Dicamba
monooxygenase (DMO) may also be targeted to chloroplasts, as
described in International PCT Publication No. WO 2008/105890.
[0086] Additional genetic elements that may optionally be operably
linked to a gene of interest also include 5' UTRs located between a
promoter sequence and a coding sequence that function as a
translation leader sequence. The translation leader sequence is
present in the fully processed mRNA upstream of the translation
start sequence. The translation leader sequence may affect
processing of the primary transcript to mRNA, mRNA stability,
and/or translation efficiency. Examples of translation leader
sequences include maize and petunia heat shock protein leaders
(U.S. Pat. No. 5,362,865), plant virus coat protein leaders, plant
rubisco leaders, and others. See, e.g., Turner and Foster (1995)
Molecular Biotech. 3(3):225-36. Non-limiting examples of 5' UTRs
include GmHsp (U.S. Pat. No. 5,659,122); PhDnaK (U.S. Pat. No.
5,362,865); AtAnt1; TEV (Carrington and Freed (1990) J. Virol.
64:1590-7); and AGRtunos (GenBank Accession No. V00087; and Bevan
et al. (1983) Nature 304:184-7).
[0087] Additional genetic elements that may optionally be operably
linked to a gene of interest also include 3' non-translated
sequences, 3' transcription termination regions, or
poly-adenylation regions. These are genetic elements located
downstream of a polynucleotide molecule, and include
polynucleotides that provide polyadenylation signal, and/or other
regulatory signals capable of affecting transcription, mRNA
processing, or gene expression. The polyadenylation signal
functions in plants to cause the addition of polyadenylate
nucleotides to the 3' end of the mRNA precursor. The
polyadenylation sequence can be derived from the natural gene, from
a variety of plant genes, or from T-DNA genes. A non-limiting
example of a 3' transcription termination region is the nopaline
synthase 3' region (nos 3'; Fraley et al. (1983) Proc. Natl. Acad.
Sci. USA 80:4803-7). An example of the use of different 3'
nontranslated regions is provided in Ingelbrecht et al., (1989)
Plant Cell 1:671-80. Non-limiting examples of polyadenylation
signals include one from a Pisum sativum RbcS2 gene (Ps.RbcS2-E9;
Coruzzi et al. (1984) EMBO J. 3:1671-9) and AGRtu.nos (GenBank
Accession No. E01312).
Plant Transformation
[0088] Any of the techniques known in the art for introduction of
transgenes into plants may be used to produce a transformed plant
according to the invention. Suitable methods for transformation of
plants are believed to include virtually any method by which DNA
can be introduced into a cell, such as: by electroporation as
illustrated in U.S. Pat. No. 5,384,253; by microprojectile
bombardment, as illustrated in U.S. Pat. Nos. 5,015,580, 5,550,318,
5,538,880, 6,160,208, 6,399,861, and 6,403,865; by
Agrobacterium-mediated transformation as illustrated in U.S. Pat.
Nos. 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301; and
by protoplast transformation, as set forth in U.S. Pat. No.
5,508,184, etc. Through the application of techniques such as
these, the cells of virtually any plant species may be stably
transformed, and these cells may be developed into transgenic
plants by techniques known to those of skill in the art. Techniques
that may be particularly useful in the context of cotton
transformation are disclosed in U.S. Pat. Nos. 5,846,797,
5,159,135, 5,004,863, and 6,624,344; techniques for transforming
Brassica plants in particular are disclosed, for example, in U.S.
Pat. No. 5,750,871; techniques for transforming soybean are
disclosed, for example, in U.S. Pat. No. 6,384,301; and techniques
for transforming corn are disclosed, for example, in U.S. Pat. No.
7,060,876, U.S. Pat. No. 5,591,616, and International PCT
Publication WO 95/06722.
[0089] After effecting delivery of exogenous DNA to recipient
cells, the next steps generally concern identifying the transformed
cells for further culturing and plant regeneration. In order to
improve the ability to identify transformants, one may desire to
employ a selectable or screenable marker gene with the
transformation vector used to generate the transformant. In this
case, the potentially transformed cell population can be assayed by
exposing the cells to a selective agent or agents, or the cells can
be screened for the desired marker gene trait.
[0090] Cells that survive the exposure to the selective agent, or
cells that have been scored positive in a screening assay, may be
cultured in media that supports regeneration of plants. In some
embodiments, any suitable plant tissue culture media (e.g., MS and
N6 media) may be modified by including further substances, such as
growth regulators. Tissue may be maintained on a basic media with
growth regulators until sufficient tissue is available to begin
plant regeneration efforts, or following repeated rounds of manual
selection, until the morphology of the tissue is suitable for
regeneration (e.g., at least 2 weeks), then transferred to media
conducive to shoot formation. Cultures are transferred periodically
until sufficient shoot formation has occurred. Once shoots are
formed, they are transferred to media conducive to root formation.
Once sufficient roots are formed, plants can be transferred to soil
for further growth and maturity.
[0091] To confirm the presence of a gene of interest (e.g., a
transgene) in the regenerating plants, a variety of assays may be
performed. Such assays include, for example: molecular biological
assays, such as Southern and Northern blotting and PCR; biochemical
assays, such as detecting the presence of a protein product, e.g.,
by immunological means (ELISA and/or Western blots) or by enzymatic
function; plant part assays, such as leaf or root assays; and
analysis of the phenotype of the whole regenerated plant.
Cultivation and Use of Transgenic Plants
[0092] A plant exhibiting nucleic acid excision according to the
present invention may have one or more desirable traits, such as
two or more desirable traits. Such traits can include, for example:
resistance to insects and other pests and disease-causing agents;
tolerances to herbicides; enhanced stability, yield, or shelf-life;
environmental tolerances; pharmaceutical production; industrial
product production; and nutritional enhancements. The desirable
traits may be conferred by genes flanked by nucleic acid sequence
recognized by ZFN(s) expressed in the plant exhibiting the
desirable traits, such that expression of the ZFN(s) in the plant
decreases or eliminates transmission of the trait, through
containment of its underlying gene, to other plants or subsequent
generations of the plant. Thus, in one embodiment, the desired
trait can be due to the presence of a transgene(s) in the plant,
which may be flanked by ZFN recognition sequences. In an additional
embodiment, the desirable trait can be obtained through
conventional breeding, which trait may be conferred by one or more
genes flanked by ZFN recognition sequences.
[0093] A plant exhibiting nucleic acid excision according to the
invention may be any plant capable of being transformed with a
nucleic acid molecule of the invention. Accordingly, the plant may
be a dicot or monocot. Non-limiting examples of dicotyledonous
plants usable in the present methods include alfalfa, beans,
broccoli, cabbage, carrot, cauliflower, celery, Chinese cabbage,
cotton, cucumber, eggplant, lettuce, melon, pea, pepper, peanut,
potato, pumpkin, radish, rapeseed, spinach, soybean, squash,
sugarbeet, sunflower, tobacco, tomato, and watermelon. Non-limiting
examples of monocotyledonous plants usable in the present methods
include corn, onion, rice, sorghum, wheat, rye, millet, sugarcane,
oat, triticale, switchgrass, and turfgrass.
[0094] Plants exhibiting nucleic acid excision according to the
invention may be used or cultivated in any manner, wherein
transmission of the excised nucleic acid sequence to other plants
is undesirable. Accordingly, GM plants that have been engineered
to, inter alia, have one or more desired traits, may be transformed
with nucleic acid molecules according to the invention, and cropped
and cultivated by any method known to those of skill in the
art.
EXAMPLES
[0095] The following examples are included to illustrate
embodiments of the invention. It will be appreciated by those of
skill in the art that the techniques disclosed in the Examples
represent techniques discovered by the inventors to function well
in the practice of the invention. However, those of skill in the
art will, in light of the present disclosure, can appreciate that
many changes can be made in the specific embodiments which are
disclosed and still obtain a like or similar result without
departing from the scope of the invention. More specifically, it
will be apparent that certain agents that are both chemically and
physiologically related may be substituted for the agents described
herein, while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the scope of the
invention as defined by the appended Claims.
Example I
Plasmid Design and Construction
[0096] A target construct containing a target reporter gene
expression cassette flanked by zinc finger binding sites (pDAS5380)
and an excision construct containing a zinc finger nuclease gene
expression cassette (pDAS5381) were designed and constructed. The
constructs were designed to be transformed separately into tobacco.
Target reporter gene excision was carried out by crossing the two
tobacco lines, wherein a functional zinc finger nuclease recognized
the zinc finger binding sites flanking the target reporter gene
cassette and cleaved the genomic DNA. Crossing the plant lines
containing the target reporter gene construct with the plant line
containing the excision construct resulted in the removal/deletion
of the reporter gene from the plant genome.
[0097] Construction and Design of Target Construct pDAS5380.
[0098] pDAS5380 (FIG. 1) was constructed as a binary plasmid
vector. This construct contains the following plant transcription
unit (PTU) expression cassettes and genetic elements: RB7 MAR
((Matrix Attachment Region (Thompson et al. (1997) WO9727207))::
CCR5 binding site repeated 4.times. (Perez et al. (2008) Nat.
Biotechnol. 26:808-16):: AtuORF1 3' UTR (Agrobacterium tumefaciens
open reading frame-1, 3' untranslated region (Huang et al. (1990)
J. Bacteriol. 172:1814-22))/GUS (.beta.-D-glucuronidase (Jefferson
(1989) Nature 342:837-8))/AtUbi10 (Arabidopsis thaliana
ubiquitin-10 promoter (Callis et al. (1990) J. Biol. Chem.
265:12486-93)):: CCR5 Binding Site repeated 4.times.:: AtAct2 (A.
thaliana actin-2 promoter (An et al. (1996) Plant J.
10:107-21))/Turbo GFP (turbo-green fluorescence protein (Evdokimov
et al. (2006) EMBO Rep. 7(10): 1006-12))/Atu ORF23 3' UTR (A.
tumefaciens open reading frame-23, 3' untranslated region (Gelvin
et al. (1987) EP222493)):: AtUbi10/PAT (phosphinothricin acetyl
transferase (Wohlleben et al. (1988) Gene 70:25-37))/Atu ORF1 3'
UTR. The GUS PTU expression cassette was placed in trans to the GFP
and PAT PTU expression cassettes. In addition, the GUS PTU
expression cassette was flanked by CCR5 zinc finger nuclease
binding sites. This sequence (SEQ ID NO: 1) was repeated 4.times.
directly upstream and downstream of the GUS PTU expression
cassette. The locations of the zinc finger binding sites are
identified in FIG. 1 as "CCR5 BINDING SITE." These sites are
recognized and bound by the zinc finger nuclease protein encoded by
excisor construct, pDAS5381. The assembly of this binary vector was
completed using standard molecular biology techniques. The final
plasmid was confirmed via restriction enzyme digestion and DNA
sequencing.
[0099] Construction and Design of Excisor Construct, pDAS5381.
[0100] A binary plasmid containing a zinc finger nuclease gene that
was specifically designed to bind the CCR5 binding site (SEQ ID
NO:2) was designed and constructed as described in Perez et al.,
(2008) Nature Biotechnol. 26:808-16. pDAS5381 (FIG. 2) contains the
following PTU expression cassettes: CsVMV (Cassava Vein Mosaic
Virus promoter (Verdaguer et al. (1996) Plant Mol. Biol.
31:1129-39))/CCR5 zinc finger nuclease coding region (containing:
the opaque-2 nuclear localization sequence (Maddaloni et al. (1989)
Nucleic Acids Res. 17(18):7532); the r162y11 zinc finger binding
domain; the FokI nuclease domain (Looney et al. (1989) Gene
80:193-208); a T2A stutter sequence (Mattion et al. (1996) J.
Virol. 70:8124-7) derived from the Thesoa assigna virus; a second
opaque-2 nuclear localization sequence; the 168GA vE zinc finger
binding domain; and a second FokI nuclease domain)/Atu ORF23 3'
UTR:: AtUbi3 promoter (A. thaliana ubiquitin-3 promoter (Callis et
al. (1995) Genetics 139(2):921-39))/HPTII (hygromycin
phosphotransferase II (Gritz et al. (1983) Gene
25(2-3):179-88))/Atu ORF24 3' UTR (A. tumefaciens open reading
frame-24, 3' untranslated region (Gelvin et al. (1987) EP222493)).
The assembly of this binary vector was completed using standard
molecular biology techniques. The final plasmid was confirmed via
restriction enzyme digestion and DNA sequencing.
Example II
Agrobacterium-Mediated Plant Transformation
[0101] Transformation of Agrobacterium with pDAS5380 and
pDAS5381.
[0102] Electrocompetent A. tumefaciens (strain LBA4404) cells were
obtained from Invitrogen (Carlsbad, Calif.) and transformed using
an electroporation method adapted from Weigel and Glazebrook (2002)
"How to Transform Arabidopsis," in Arabidopsis: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., U.S.A. Transformed colonies were obtained on yeast extract
peptone media (YEP) containing spectinomycin (50 .mu.g/mL) and
streptomycin (125 .mu.g/mL) and confirmed via restriction enzyme
digestion. Clones which exhibited the correct restriction enzyme
banding patterns were stored as glycerol stocks at -80.degree.
C.
[0103] Agrobacterium-Mediated Transformation of Nicotiana
tabacum.
[0104] Tobacco (cv. Petit Havana) leaf discs were transformed using
A. tumefaciens (strain LBA4404) containing pDAS5381 and pDAS5380.
Single colonies of Agrobacterium containing these plasmids were
inoculated into 4 mL of YEP containing spectinomycin (50 .mu.g/mL)
and streptomycin (125 .mu.g/mL) and incubated overnight at
28.degree. C. on a shaker at 190 rpm. The 4 mL seed culture was
subsequently used to inoculate a 25 mL culture of YEP media
containing spectinomycin (50 .mu.g/mL) and streptomycin (125
.mu.g/mL) grown in a 125 mL baffled Erlenmeyer flask. This culture
was incubated at 28.degree. C. shaking at 190 rpm until it reached
an OD.sub.600 of .about.1.2. Ten mL of Agrobacterium suspension was
placed into sterile 60.times.20 mm Petri dishes.
[0105] Twenty-five freshly cut leaf discs (0.5 cm.sup.2) cut from
plants aseptically grown on MS medium (Phytotechnology Labs,
Shawnee Mission, Kans., #M524) with 30 g/L sucrose in
PhytaTrays.TM. (Sigma, St. Louis, Mo.) were soaked in 10 mL of
overnight culture of Agrobacterium for a few minutes, blotted dry
on sterile filter paper, and then placed onto the same medium with
the addition of 1 mg/L indoleacetic acid and 1 mg/L benzyamino
purine. Following 48 hours of co-cultivation, leaf discs
co-cultivated with Agrobacterium harboring pDAS5380 were
transferred to the same medium with 5 mg/L Basta.RTM. and 250 mg/L
cephotaxime. Leaf discs co-cultivated with Agrobacterium harboring
pDAS5381 were transferred to the same medium with 10 mg/L
hygromycin and 250 mg/L cephotaxime. After 3 weeks, individual
T.sub.0 plantlets were transferred to either MS medium with 10 mg/L
Basta.RTM. and 250 mg/L cephotaxime for pDAS5380, or with 10 mg/L
hygromycin and 250 mg/L cephotaxime for pDAS5381, an additional 3
weeks prior to transplanting to soil and transfer to the
greenhouse.
[0106] Copy Number, Full Length PTU and Expression Analysis of
T.sub.0 Plants.
[0107] Copy Number Assay.
[0108] Invader.RTM. and hydrolysis probe assays were performed to
screen samples of Basta.RTM.-resistant plants to identify those
that contained single copy integration of the T-DNA in pDAS5380 and
pDAS5381. Detailed analysis was conducted using primers and probes
specific to gene expression cassettes. Single copy events were
identified for additional analysis.
[0109] Tissue samples were collected in 96-well plates and
lyophilized for 2 days. Tissue maceration was performed with a
Kleco.TM. tissue pulverizer and tungsten beads (Visalia, Calif.).
Following tissue maceration, the genomic DNA was isolated in
high-throughput format using the DNeasy 96 Plant kit.TM. (Qiagen,
Germantown, Md.) according to the manufacturer's suggested
protocol. Genomic DNA was quantified by Quant-IT Pico Green DNA
assay kit.TM. (Molecular Probes, Invitrogen, Carlsbad, Calif.).
Quantified genomic DNA was adjusted to 9 ng/.mu.L for the
Invader.RTM. assay or to 5 ng/.mu.L for the hydrolysis probe assay
using a Biorobot3000.TM. automated liquid handler (Qiagen,
Germantown, Md.).
[0110] Custom Invader.RTM. assays were developed for PAT gene
analysis in tobacco by Hologic (Madison, Wis.). The genomic DNA
samples (7.5 .mu.L at 9 ng/.mu.L) were first denatured in 96-well
plate format by incubation at 95.degree. C. for 10 minutes and then
cooled on ice. Next, 7.5 .mu.L of master mix (3 .mu.L of probe mix
for pat and an internal reference gene (phenylalanine ammonium
lyase (palA); GenBank ID: AB008199), 3.5 .mu.L Cleavase.RTM. XI
FRET mix, and 1 .mu.L of Cleavase.RTM. XI Enzyme/MgCl.sub.2
solution) were added to each well and the samples were overlaid
with mineral oil. Plates were sealed and incubated at 63.degree. C.
for 1 hour in a BioRad Tetrad.RTM. thermocycler. Plates were cooled
to ambient temperature before being read on a fluorescence plate
reader. All plates contained 1 copy, 2 copy and 4 copy standards as
well as wild-type control samples and blank wells containing no
sample. Readings were collected for both FAM (.lamda. 485-528 nm)
and RED (.lamda. 560-620 nm) channels, and from these the fold over
zero (i.e., background) for each channel was determined for each
sample by the sample raw signal divided by no template raw signal.
From this data, a standard curve was constructed and the best fit
determined by linear regression analysis. Using the parameters
identified from this fit, the apparent pat copy number was then
estimated for each sample.
[0111] Transgene copy number determination by hydrolysis probe
assay, analogous to TaqMan.RTM. assay, was performed by real-time
PCR using the LightCycler.RTM.480 system (Roche Applied Science,
Indianapolis, Ind.). Assays were designed for HPTII, PAT and the
internal reference gene phenylalanine ammonium lyase (palA) using
LightCycler.RTM. Probe Design Software 2.0. For amplification,
LightCycler.RTM.480 Probes Master mix (Roche Applied Science,
Indianapolis, Ind.) was prepared at 1.times. final concentration in
a 10 .mu.L volume multiplex reaction containing 0.4 .mu.M of each
primer and 0.2 .mu.M of each probe (Table 1). A two-step
amplification reaction was performed with an extension at
58.degree. C. for 38 seconds with fluorescence acquisition. All
samples were run in triplicate and the averaged Cycle threshold
(Ct) values were used for analysis of each sample. Analysis of real
time PCR data was performed using LightCycler.RTM. software release
1.5 using the relative quant module and is based on the
.DELTA..DELTA.Ct method. For this, a sample of genomic DNA from a
single copy calibrator and known 2 copy check were included in each
run (identical to those used for Invader.RTM. assays above).
TABLE-US-00001 TABLE 1 Primer and probe Information for hydrolysis
probe assay of PAT, HPTII, and internal reference (palA). Primer
Name Sequence Detection TQPATS SEQ ID NO: 3; 5'
ACAAGAGTGGATTGATGATCTA GAGAGGT 3' TQPATA SEQ ID NO: 4; 5'
CTTTGATGCCTATGTGACACGT AAACAGT 3' TQPATFQ SEQ ID NO: 5; Cy5 5'
CY5-GGTGTTGTGGCTGGTATT GCTTACGCTGG-BHQ2 3' TQPALS SEQ ID NO: 6; 5'
TACTATGACTTGATGTTGTGTG GTGACTGA 3' TQPALA SEQ ID NO: 7; 5'
GAGCGGTCTAAATTCCGACCCT TATTTC 3' TQPALFQ SEQ ID NO: 8; 6FAM 5'
6FAM-AAACGATGGCAGGAGTG CCCTTTTTCTATCAAT-BHQ1 3' HPT2S SEQ ID NO: 9;
5' ACACTACATGGCGTGATTT 3' HPT2A SEQ ID NO: 10; 5'
AGCATCAGCTCATCGAGA 3' HPTFQ SEQ ID NO: 11; Cy5 5'
Cy5/ACTGTGATGGACGACACC G/3BHQ2/ 3'
[0112] Full Length PTU Assay Via Southern Blot Analysis.
[0113] Southern blot analysis was used to establish the integration
pattern of the inserted DNA fragment and identify pDAS5380 and
pDAS5381 events which contained a full length PTU. Data were
generated to demonstrate the integration and integrity of the
transgenes inserted into the tobacco genome. Southern blot data was
used to identify simple integration of an intact copy of the T-DNA
from pDAS5380 and pDAS5381. Detailed Southern blot analysis was
conducted using probes specific to gene expression cassettes. The
hybridization of these probes with genomic DNA that had been
digested with specific restriction enzymes identified genomic DNA
fragments of molecular weights, the patterns of which could be
analyzed to identify events for advancement to T.sub.1. These
analyses also showed that the plasmid fragment had been inserted
into tobacco genomic DNA without rearrangements of the PTU.
[0114] Tissue samples were collected in 50 mL conical tubes (Fisher
Scientific, Pittsburgh, Pa.) and lyophilized for 2 days. Tissue
maceration was performed with a paint mixer tissue pulverizer and
tungsten beads. Following tissue maceration, the genomic DNA was
isolated using the DNeasy.TM. Plant Maxi Kit (Qiagen, Germantown,
Md.) according to manufacturer suggested protocol. Purified genomic
DNA was precipitated and resuspended in 500 .mu.L TE buffer. The
genomic DNA was further purified using the Qiagen Genomic Tips.TM.
kit. Genomic DNA was quantified by Quant-IT Pico Green.TM. DNA
assay kit (Molecular Probes, Invitrogen, Carlsbad, Calif.).
Quantified genomic DNA was adjusted to 8 .mu.g in a consistent
volume.
[0115] For each sample, 8 .mu.g of genomic DNA was thoroughly
digested with the restriction enzymes MfeI and NsiI (New England
Biolabs, Beverley, Mass.). Samples were incubated at 37.degree. C.
overnight. The digested DNA was concentrated by precipitation with
Quick Precipitation Solution.TM. (Edge Biosystems, Gaithersburg,
Md.) according to the manufacturer's suggested protocol. The
genomic DNA was then resuspended in 25 .mu.L of water at 65.degree.
C. for 1 hour. Resuspended samples were loaded onto a 0.8% agarose
gel prepared in 1.times.TAE and electrophoresed overnight at 1.1
V/cm in 1.times.TAE buffer. The gel was sequentially subjected to
denaturation (0.2 M NaOH/0.6 M NaCl) for 30 minutes, and
neutralization (0.5 M Tris-HCl (pH 7.5)/1.5 M NaCl) for 30
minutes.
[0116] Transfer of DNA fragments was performed by passively wicking
20.times.SSC solutions overnight through the gel onto treated
Immobilon.TM. NY+ transfer membrane (Millipore, Billerica, Mass.)
by using a chromatography paper wick and paper towels. Following
transfer, the membrane was briefly washed with 2.times.SSC,
cross-linked with the Stratalinker.TM. 1800 (Stratagene, LaJolla,
Calif.), and vacuum baked at 80.degree. C. for 3 hours.
[0117] Blots were incubated with pre-hybridization solution
(Perfect Hyb plus.TM., Sigma, St. Louis, Mo.) for 1 hour at
65.degree. C. in glass roller bottles using a model 400
hybridization incubator (Robbins Scientific, Sunnyvale, Calif.).
Probes were prepared from a PCR fragment containing the entire
coding sequence. The PCR amplicon was purified using QIAEX II.TM.
gel extraction kit and labeled with .alpha..sup.32P-dCTP via the
Random RT Prime IT.TM. labeling kit (Stratagene, La Jolla, Calif.).
Blots were hybridized overnight at 65.degree. C. with denatured
probe added directly to hybridization buffer to approximately 2
million counts per blot per mL. Following hybridization, blots were
sequentially washed at 65.degree. C. with 0.1.times.SSC/0.1% SDS
for 40 minutes. Finally, the blots were exposed to chemiluminescent
film (Roche Diagnostics, Indianapolis, Ind.) and imaged using a
Molecular Dynamics Storm 860.TM. imaging system.
[0118] Expected and observed fragment sizes with a particular
digest and probe, based on the known restriction enzyme sites of
the pDAS5380 or pDAS5381 fragment, are indicated in FIGS. 3 and 4.
The Southern blot analyses completed in this study were used to
identify events that contained full-length intact PTUs from
plasmids pDAS5380 or pDAS5381 that were inserted into the tobacco
genome (FIGS. 3 and 4, respectively).
[0119] GUS Expression Assay.
[0120] To test whether the pDAS5380 transgenic plants contained a
functional GUS PTU expression cassette, leaf samples were harvested
and stained histochemically for GUS expression. Leaf discs
(.about.0.25 cm.sup.2) were cut and placed in a 24-well tray (1
leaf disc per well) containing 250 .mu.L of GUS assay solution
(Jefferson (1989) Nature 342:837-8). The 24-well dish was wrapped
with Nescofilm.RTM. (Fisher Scientific, Pittsburgh, Pa.) and
incubated at 37.degree. C. for 24 hours. After 24 hours, the GUS
assay solution was removed from each well and replaced with 250
.mu.L of 100% ethanol. The dish was wrapped with Nescofilm.RTM. and
incubated at room temperature for 2-3 hours. The ethanol was
removed and replaced with fresh ethanol. The leaf discs were then
viewed under a dissecting microscope. Leaf discs which were stained
blue were scored as containing a functional GUS PTU expression
cassette.
[0121] GFP Expression Assay.
[0122] Tobacco leaf samples were analyzed for GFP expression using
ELISA. Plates were coated with a purified rabbit anti-GFP antibody
overnight at 4.degree. C. The day of analysis, plates were blocked
with 0.5% BSA in PBST. Duplicated leaf samples were extracted by
bead beating frozen leaf pieces with 2 stainless steel beads in a
Kleco.TM. tissue grinder for 3 minutes at maximum speed. The
samples were centrifuged at 3000 rcf for 10 minutes and the
supernatants collected. Extract samples were loaded onto ELISA
plates at 1:5 and 1:50 dilutions. An E. coli recombinant GFP
standard curve was run on each plate with concentrations from 12.5
ng/mL to 0.195 ng/mL. The standards and samples were incubated on
the ELISA plates for 1 hour. Plates were washed and a horseradish
peroxidase conjugated rabbit anti-GFP antibody was added. Following
1 hour incubation, the plates were washed and substrate was added.
Color was allowed to develop before stopping the reaction with
H.sub.2SO.sub.4. Absorbance was read on a plate reader at 450 nm
with a 650 nm reference filter. A quadratic standard curve was
generated by fitting concentration of the E. coli standard against
OD. Concentrations of unknown samples were determined by linear
regression.
[0123] Selection of T.sub.0 Plants for Target T.sub.1
Production.
[0124] A total of 68 Basta.RTM.-resistant, GUS+/GFP+ plants were
regenerated and 38 plants were found to have 1-2 transgene copies
based on PAT Invader.RTM. assay. Southern analysis identified 14
single-copy events, of which 8 displayed bands consistent with
intact PAT, GUS and GFP PTUs. Three pDAS5380 events displaying
single copy, full length PTU, and expressing GUS and GFP,
pDAS5380-3, pDAS5380-18 and pDAS5380-46, were self-pollination to
produce T.sub.1 seed.
[0125] FokI Expression Assay.
[0126] Quantitative Real-Time PCR (qRT-PCR) was used to quantify
the mRNA expression of the zinc finger nuclease in T.sub.0 tobacco
plants transformed with pDAS5381. The assay was developed to
quantify the relative FokI mRNA expression from tobacco leaf
samples by normalizing these levels against mRNA expression from
input mRNA. The normalization of the FokI mRNA against total mRNA
permits comparison of FokI expression between different samples,
and can be used to identify events that appear to be highly
expressing. The relative ZFN expression is listed in Table 1.1.
TABLE-US-00002 TABLE 1.1 Quantification of mRNA expression of the
zinc finger nuclease in T.sub.0 tobacco plants transformed with
pDAS5381. * qRT-PCR for Fok1 mRNA normalized to total RNA. Mean of
4 replicate samples. Relative ZFN Standard T0 Event Expression*
Deviation % CV pDAS5381-14 3.21 1.56 36.0 pDAS5381-18 41.30 1.56
3.8 pDAS5381-30 8.39 0.86 10.3 pDAS5381-39 17.70 1.92 10.8
pDAS5381-49 47.55 1.79 3.8 pDAS5381-54 4.45 0.57 12.8 pDAS5381-56
11.73 2.5 21.3
[0127] Leaf material from T.sub.0 tobacco plants that had been
transformed with pDAS5381 was collected and placed on ice. Total
RNA was isolated using Qiagen's RNeasy.RTM. Plant Mini Kit (Qiagen,
Germantown, Md.). Total mRNA was treated with RNase-free DNase per
the manufacturer's recommendation to remove any contaminating DNA
that might amplify during quantitative RT-PCR. First strand
synthesis was set up according to the Superscript III.TM. Reverse
Transcriptase Enzyme (Invitrogen, Carlsbad, Calif.) manufacturer's
instructions and primed using random hexamers. The synthesized cDNA
strands were diluted in water at ratios of 1:10 and 1:50. Each
aliquot was stored at -20.degree. C.
[0128] The qRT-PCR reaction was completed as follows: forward
primer Fok1_UPL_F (SEQ ID NO: 12), reverse primer Fok1_UPL_R (SEQ
ID NO: 13), probe UPL#130 (cat #04693663001, Roche, Indianapolis,
Ind.), 1.times.LC480 Probes Master Buffer (Roche Diagnostic,
Indianapolis, Ind.), and 1.5 .mu.L of synthesized cDNA in a 15
.mu.L reaction. Serial dilutions of the synthesized cDNA were made
and assayed in repetition. The cocktail was amplified using
LightCycler.RTM. 480 Probes Master kit #04707494001 (Roche
Diagnostics, Indianapolis, Ind.). A 96-well microplate was
demarcated and labeled, 13.5 .mu.L of master mix was added per
well. A sealing foil was gently attached to the microplate. The
plate was centrifuged for 1 minute at 3,000 rpm in a Qiagen
microplate centrifuge. The sealing foil was removed and 1.5 .mu.L
of thawed, diluted synthesized cDNA strands were added. A foil seal
was firmly affixed to the plate and centrifuged as previously
described. A PCR program was run as follows: i) activate 95.degree.
C. for 5 minutes; ii) denature 95.degree. C. for 10 sec
(@4.8.degree. C./sec); iii) anneal/extend 60.degree. C. for 25 sec
(@2.5.degree. C./sec); iv) acquire 72.degree. C. for 1 sec
(@4.8.degree. C./sec); steps ii-iv were repeated 45 more times; vi)
cool to 38.degree. C. for 5 sec.
[0129] A qRT-PCR assay for quantifying the mRNA expression of the
internal reference gene was completed as another method to
normalize the zinc finger nuclease mRNA expression. The actin
qRT-PCR reaction was completed as follows: forward primer BY2ACT89S
(SEQ ID NO: 14), reverse primer BY2ACT89A (SEQ ID NO: 15), probe
BYACTFQ (SEQ ID NO:18), 1.times.LC480 Probes Master Buffer, and 2.0
.mu.L of synthesized cDNA, in a 10 .mu.L reaction. Serial dilutions
of the synthesized cDNA were made and assayed in repetition. In
addition, 2 .mu.L of plasmid DNA copy number standards were added
to separate wells in a dilution series from lowest to highest
concentrations, and these standards were compared to the actin cDNA
(synthesized from total mRNA) to quantify the copy number. Actin
DNA copy number standard series were made by cloning the target
amplicon into a pCR2.1 plasmid (Invitrogen, Carlsbad, Calif.), and
making a dilution series, prepared in dilution buffer (10 mM
Tris-HCl [pH 8.0], 100 .mu.g/mL yeast tRNA), for quantifying the
copy number. The cocktail was amplified using LightCycler.RTM. 480
Probes Master kit #04707494001 (Roche Diagnostics, USA). A 96-well
microplate was demarcated and labeled, and 8.0 .mu.L of master mix
was added per well. A sealing foil was gently attached to the
microplate. The plate was centrifuged for 1 minute at 3,000 rpm in
a Qiagen microplate centrifuge. The sealing foil was removed, and
2.0 .mu.L of thawed, diluted synthesized cDNA strands or plasmid
DNA were added. A foil seal was firmly affixed to the plate and
centrifuged as previously described. A PCR program was run as
follows: i) activate 95.degree. C. for 10 minutes; ii) denature
95.degree. C. for 10 sec (@4.8.degree. C./sec); iii) anneal/extend
56.degree. C. for 40 sec (@2.5.degree. C./sec); iv) acquire
72.degree. C. for 1 sec (@4.8.degree. C./sec); steps ii-iv were
repeated 45 more times; vi) cool to 38.degree. C. for 5 sec.
[0130] Selection of T.sub.0 Plants for Excisor T.sub.1
Production.
[0131] A total of 54 hygromycin-resistant plants were regenerated,
and 34 plants were found to have 1-2 transgene copies based on
hydrolysis probe assay. Southern analysis identified 12 single-copy
events of which 7 displayed bands consistent with intact HPT and
ZFN PTUs. T.sub.0 pDAS5381 events displaying single copy transgene,
full length PTU, and expressing FokI, pDAS5381-18, pDAS5381-49 and
pDAS5381-56, were self-pollination to produce T.sub.1 seed.
Example III
Generation and Selection of T.sub.1 Plants
[0132] Selfing of T.sub.0 Plants to Produce Homozygous T.sub.1
Plants.
[0133] The following T.sub.0 plant events: pDAS5380-3; pDAS5380-18;
pDAS5380-46; pDAS5381-18; pDAS5381-49; and pDAS5381-56 were grown
to maturity and self-fertilized to produce T.sub.1 seed. Following
germination, T.sub.1 plants that were homozygous for the pDAS5380
and pDAS5381 constructs were used for transgene deletion. According
to Mendelian inheritance, crossing the pDAS5381 homozygous single
copy T.sub.1 plants with the pDAS5380 homozygous single copy
T.sub.1 plants produce an F.sub.1 population containing a
heterozygous single copy of both the pDAS5381 and pDAS5380
constructs. The progeny of this cross was expected to contain one
copy of the GUS reporter gene. As such, an F.sub.1 plant not
expressing GUS indicates that the GUS PTU expression cassette has
been excised.
[0134] T.sub.0 plants were grown under a 16:8-hour photoperiod,
with daytime and nighttime temperature between 22-24.degree. C.
When the primary flowering stem began to elongate and form flower
buds, the entire plant was covered with a selfing bag to prevent
outcrossing. Seeds derived from self-pollination were harvested
about eight weeks after transplanting. The seed from the
self-fertilized plants was collected and sewn into soil. The
resulting T.sub.1 populations were grown in the greenhouse under
the conditions described above.
[0135] Molecular Screening of T.sub.1 Plants.
[0136] Zygosity Assay.
[0137] An assay to quantify the zygosity of the T.sub.1 plants was
completed using the hydrolysis probe method described, supra (Copy
Number Assay). The analysis of real time PCR data was performed and
the number of transgene copies contained in the T.sub.1 plants was
determined by comparison to a copy number control. For this, a
sample of genomic DNA from the parent T.sub.0 plant which was
previously shown to contain a single copy calibrator was included.
Homozygous pDAS5380 and pDAS5381 T.sub.1 plants were
identified.
[0138] GUS Expression Assay.
[0139] It was important to identify expressing events for
advancement to the crossing experiments. The pDAS5380 T.sub.1
plants were assayed using the protocol described, supra (GUS
Expression Assay). The pDAS5380 plants which were selected as
homozygous for the pDAS5380 construct from the zygosity assay,
supra, were tested. All of the plants stained blue.
[0140] GFP Expression Assay.
[0141] The pDAS5380 T.sub.1 plants were assayed using the protocol
described, supra (GFP Expression Assay). The pDAS5380 plants which
were selected as homozygous for the pDAS5380 construct from the
zygosity assay, supra, were tested. All of the tested plants were
positive for GFP expression.
[0142] FokI Expression Assay.
[0143] Quantitative Real-Time PCR (qRT-PCR) was used to quantify
the mRNA expression of the zinc finger nuclease in homozygous
pDAS5381 T.sub.1 tobacco plants transformed with pDAS5381. The
protocols described, supra (FokI Expression Assay), were used for
the screening of T.sub.1 plants to confirm that the zinc finger
nuclease was expressing, and to identify the events which would
produce robust quantities of zinc finger nuclease for excising the
GUS PTU expression cassette.
[0144] Selection of T.sub.1 Plants.
[0145] T.sub.1 pDAS5380 events were screened for zygosity and
expression of GUS and GFP. T.sub.1 pDAS5381 events were screened
for zygosity and expression of FokI. Based on these results,
T.sub.1 events were selected for crossing. These events were
identified as optimal, as they were homozygous, single copy, full
length, transgene-expressing events. In addition, sibling-null
pDAS5381 plants were retained for use as controls. These events do
not contain the zinc finger nuclease PTU expression cassette. The
transgene was not inherited by these T.sub.1 plants as a result of
transgene segregation. The selected events were grown to maturity
and crossed to produce F.sub.1 plants to test transgene excision
via the zinc finger nuclease. The crossing strategy is set forth
below.
[0146] Crossing of the Homozygous T.sub.1 Plants for Producing an
F.sub.1.
[0147] Selected pDAS5380 plants were crossed with select pDAS5381
plants. In addition, reciprocal crosses were made so that parents
were both male and female (Table 2). The plants were crossed by
hand; pollen from the anthers of a mature male parent was
introduced to the stigma of the mature female parent. Plants ready
for crossing were removed from the other plants to reduce the
likelihood that unintended pollen would fertilize the female
tobacco plants. Female plants were emasculated (anthers removed
prior to dehiscence) using forceps .about.15-30 minutes prior to
being pollinated by the male flower. Flowers were selected for
emasculation by observing the anthers and the flower color. Newly
opened flowers were bright pink around the edges and the anthers
were still closed. Flowers containing anthers which were opened or
partially opened were not used. Multiple flowers from a stem of the
tobacco plant were emasculated and fertilized. The additional
flowers on the stem (e.g., already fertilized pods, old flowers,
very young buds, etc.) were removed with forceps to ensure that the
only pods to form on the branch were from controlled crosses. The
branch was labeled with a pollination tag listing the cross made,
how many crosses were made, and the pollination date. The anthers
from the male parent were totally removed from the male plant using
forceps, and used to fertilize the emasculated female. The
dehiscing male anthers were rubbed onto the sticky receptive female
stigma until the stigma was coated with pollen. The stigma was
coated several times to reduce the chance of any unintended pollen
having access to pollinate the female stigma. The seed from the
fertilized plants was collected and sewn into soil. The resulting
F.sub.2 progeny plants were grown in the greenhouse under the
conditions described above.
TABLE-US-00003 TABLE 2 Crossing experiment matrix. Excisor Events
Target Events 5381-18 5381-49 5381-56 5380-03 5381-18-17 .times.
5381-49-16 .times. 5381-56-5 .times. 5380-3-6 5380-3-12 5380-3-21
5380-18 5381-18-22 .times. 5381-49-16 .times. 5381-56-37 .times.
5380-18-17 5380-18-22 5380-18-22 5380-46 5381-18-17 .times.
5381-49-10 .times. 5381-56-5 .times. 5380-46-15 5380-46-15
5380-46-15 Null Events 5381-56-12 .times. 5381-56-12 .times.
5381-56-12 .times. 5380-3-10 and 5380-3-10 and 5380-3-10 and
5380-25-10 5380-25-10 5380-25-10
Example IV
Analysis of F.sub.1 Plants for ZFN-Mediated Transgene Deletion
[0148] GUS Assay.
[0149] The F.sub.1 plants were tested for GUS expression by
histochemically staining leaf material. The GUS screen was a
preliminary test to identify events which had undergone
ZFN-mediated transgene deletion. The results of the GUS screen were
not intended to be conclusive, but rather an indicator to identify
plants for further molecular analysis. The F.sub.1 plants were
assayed using the protocol described, supra (GUS Expression Assay).
The results are listed in Table 3.
TABLE-US-00004 TABLE 3 GUS expression in F1 hybrids. Target Events
5380-03 5380-18 5380-46 Excisor Reciprocal Plants Plants Plants
Events Cross Assayed GUS- % Assayed GUS- % Assayed GUS- % 5381-18
479 15 3.1 490 3 0.6 450 7 1.6 459 44 9.6 480 21 4.4 -- -- --
5381-49 -- -- -- 452 157 34.7 474 32 6.8 465 67 14.4 467 17 3.6 485
69 14.2 5381-56 437 4 0.9 476 0 0 465 3 0.7 -- -- -- 470 7 1.5 450
3 0.7 NULL -- -- -- 441 8 1.8 453 11 2.4 -- -- -- 446 4 0.9 490 11
2.2
[0150] Southern Blot Analysis.
[0151] Southern blot analysis was used to provide molecular
characterization of the excision of the GUS PTU expression cassette
by the zinc finger nuclease. This data demonstrated the excision of
the GUS PTU expression cassette in a sub-set of events, the
non-excision of the GUS PTU expression cassette in another sub-set
of events, and a sub-set of chimeric events which contained both
excised and non-excised GUS PTU expression cassette. Detailed
Southern blot analysis was conducted using a probe specific to the
GFP PTU expression cassette. The hybridization of the probe with
genomic DNA that had been digested with specific restriction
enzymes identified DNA fragments of specific molecular weights.
These patterns could be analyzed to identify events that contained
an excised GUS PTU expression cassette, contained an intact GUS PTU
expression cassette, or were chimeric and contained both the
excised and intact GUS PTU expression cassette.
[0152] A restriction digest was completed for 10 .mu.g of each
sample in 1.times. Buffer 4 and 100 Units of NdeI (New England
BioLabs, Ipswich, Mass.) in a final volume of 350 .mu.L for a
10-fold over-digestion. Samples were incubated at 37.degree. C.
overnight. The digested DNA was concentrated by re-precipitation
with Quick Precipitation Solution.TM. (Edge Biosystems,
Gaithersburg, Md.) according to the manufacturer's suggested
protocol. Recovered digest was resuspended in 30 .mu.L of 1.times.
loading buffer and incubated at 65.degree. C. for 30 minutes.
Resuspended samples were loaded onto a 0.8% agarose gel prepared in
1.times.TAE (0.8M Tris-acetate [pH 8.0]/0.04 mM EDTA) and
electrophoresed overnight at 1.1 V/cm in 1.times.TAE buffer. The
gel was sequentially subjected to denaturation (0.2 M NaOH/0.6 M
NaCl) for 30 minutes, and neutralization (0.5 M Tris-HCl [pH
7.5]/1.5 M NaCl) for 30 minutes. Transfer of DNA fragments was
performed by passively wicking 20.times.SSC solution overnight
through the gel onto treated Immobilon.TM. NY+ (Millipore,
Billerica, Mass.) by using a chromatography paper wick and paper
towels. Following transfer, the membrane was briefly washed with
2.times.SSC, cross-linked with the Stratalinker.TM. 1800
(Stratagene, La Jolla, Calif.), and vacuum baked at 80.degree. C.
for 3 hours. Blots were incubated with prehybridization solution
for 1 hour at 65.degree. C. in glass roller bottles using a
hybridization incubator. Probe was prepared from PCR fragment
containing the gfp coding sequence that was purified using a Qiagen
gel extraction kit and labeled with 50 .mu.Ci of
.alpha..sup.32P-dCTP using a labeling kit. Blots were hybridized
overnight at 65.degree. C. with denatured probe added directly to
hybridization buffer to approximately 2 million counts per blot per
mL. Following hybridization, blots were sequentially washed at
65.degree. C. with 0.1.times.SSC/0.1% SDS for 40 minutes. Blots
were exposed using phosphor imager screen and imaged using a
Molecular Dynamics Storm 860.TM. imaging system. The results of the
blots are shown in FIG. 5.
[0153] Plant Transcription Unit PCR Analysis.
[0154] PCR reactions were performed to characterize the excision of
the GUS PTU expression cassette. Primers were designed which bound
to the MAR sequence and the ORF 23 3' UTR sequence (the 3' UTR for
the GFP PTU expression cassette). This PCR amplicon spans the GUS
PTU expression cassette region which is expected to be excised. As
such, the use of these PCR primers can detect events in which the
GUS PTU expression cassette was excised, events in which no
excision occurred, and chimeric events in which the GUS PTU
expression cassette was not uniformly removed within the event.
Amplification of a 6.7 kb fragment indicates that there is no
excision, whereas amplification of a 2.4 kb fragment suggests that
the GUS PTU expression cassette had been excised. Amplicons
containing fragments of both sizes indicate that the GUS PTU
expression cassette was not completely removed.
[0155] Genomic DNA was isolated from tobacco leaf tissue using the
DNeasy.TM. Plant Maxi kit, and quantified using the Quant-IT.TM.
Pico Green DNA assay kit as described, supra. Plant Transcription
Unit PCR (PTU PCR) was performed using a Tetrad2.TM. thermocycler
(BioRad, Hercules, Calif.). Oligonucleotide primers were designed
to amplify the PTU using VectorNTI.TM. Software. For amplification,
Ex Taq Polymerase.TM. (TaKara, Otsu, Shiga, Japan) was prepared at
1.times. final concentration in a 25 .mu.L volume singleplex
reaction containing 1.2 .mu.M of each primer (SEQ ID NOs:16 and
17), 0.2 mM dNTP, 2% DMSO, 1.25 units of TAQ using 4 ng of gDNA
template. A three-step amplification reaction was performed as
follows; 3 minute initial denaturation at 94.degree. C. and 33
cycles of 30 seconds of 94.degree. C., 6 minutes of 65.5.degree.
C., 30 seconds of 72.degree. C., with a final extension at
72.degree. C. for 10 minutes. An aliquot of the PCR product was run
on a 1% gel with ethidium bromide using a 1Kb+ marker (Invitrogen,
Carlsbad, Calif.) to determine product size. Results of the PTU PCR
reactions are shown in FIG. 6.
[0156] Sequencing of PTU PCR Products.
[0157] The 2.4 kb bands from the PTU PCR reactions were excised
from the gel and DNA was purified using the Qiagen Qiaex II.TM. gel
extraction kit (Qiagen, Germantown, Md.). The purified fragments
were ligated into the pCR2.1 TOPO-TA.TM. cloning vector
(Invitrogen, Carlsbad, Calif.). Presence of a cloned PCR amplicon
within the pCR2.1 vector was confirmed via restriction enzyme
digestion. Clones containing the amplified bands were sequenced.
The sequences of the junction resulting from the removal of the GUS
PTU expression cassette are listed in FIGS. 7a and 7b. The entire
PTU expression cassette was removed. The only sequences remaining
are rearranged zinc finger binding sites which flanked the GUS PTU
expression cassette. In addition, several PCR amplicons contained
deletions which extended into the Actin 2 promoter of the GFP PTU
expression cassette.
[0158] Restriction Enzyme Analysis of 6.7 kb Band.
[0159] The PCR amplicons of the larger 6.7 kb band were analyzed
via restriction enzyme digestion. These fragments were digested
with EcoRI, and with NcoI/SacI restriction enzymes (New England
Biolabs, Ipswich, Mass.). The sizes of the resulting bands were
analyzed to confirm that the amplified fragments spanned the
non-excised pDAS5380 transgene genomic insert.
[0160] Self-Fertilization of F.sub.1 Plants to Produce F.sub.2
Progenies.
[0161] A representative group of the F.sub.1 plants described above
were self-fertilized to produce F.sub.2 progenies. Table 5 lists
the plants that were selected and their F.sub.1 phenotype and
genotype. Selected F.sub.1 plants were grown in a greenhouse under
a 16:8-hour photoperiod, with daytime and nighttime temperature
between 22-24.degree. C. When the primary flowering stem began to
elongate and form flower buds, the entire plant was covered with a
selfing bag to prevent out-crossing. Seeds derived from
self-pollination were harvested about eight weeks after
transplanting. The seed from the self-fertilized plants was
collected and sewn into soil. The resulting F.sub.2 populations
were grown in the greenhouse under the conditions described above.
The F.sub.2 plants were analyzed for further transgene deletion and
heritability of the deletion which had been characterized within
F.sub.1 plants.
Example V
Generation and Selection of T.sub.1 Plants
[0162] Analysis of F.sub.2 Progenies for Transgene and Heritability
of Deletion.
[0163] GUS Analysis.
[0164] The F.sub.2 plants were tested for GUS expression by
histochemical staining of leaf material. The plants were assayed
using the protocol described, supra (GUS Expression Assay). The
results are listed in Table 5. The GUS expression data from the
F.sub.2 plants were as expected. The F.sub.1 plants that were
identified as containing an excised GUS PTU expression cassette
produced F.sub.2 plants that were 100% GUS negative, as confirmed
by histochemical staining. The absence of the GUS expression within
these F.sub.2 plants confirms the F.sub.1 data, which suggests that
the GUS PTU expression cassette was excised via zinc finger
nuclease-mediated transgene deletion. Moreover, this data
exemplifies the heritability of the deleted transgene into a
subsequent generation.
[0165] The sibling-null control plants expressed GUS in about 75%
of the F.sub.2 generation. The remaining plants (about 25%) in
which GUS was not detected via histochemical staining were
expected. The GUS PTU expression cassette is expected to segregate
within the F.sub.2 population at the expected 3:1 ratio. The
chimeric events which contained both excised and non-excised GUS
PTU expression cassettes in the F.sub.1 segregated within the
F.sub.2. The majority of the plants expressed GUS.
TABLE-US-00005 TABLE 5 GUS expression in the F2 progenies. F1
Molec- Cross ular/Phenotypic # Plants # # # Cross Identity
Characterization Assayed GUS + GUS - 95 5380-46-1-15 .times.
Excised/GUS- 405 0 405 5381-49-1-10-003 307 5381-49-1-10 .times.
Excised/GUS- 480 0 480 5380-46-1-15.018 180 5380-3-1-6 .times.
Excised/GUS- 445 0 445 5381-18-1-17.002 83 5380-46-1-15 .times.
Excised/GUS- 375 0 375 5381-49-1-10-015 77 5380-46-1-15 .times.
Excised/GUS- 427 0 427 5381-49-1-10-021 310 5381-49-1-10 .times.
Excised/GUS- 442 0 442 5380-46-1-15.015 265 5381-49-1-16 .times.
Excised/GUS- 471 0 471 5380-3-1-12.017 93 5380-46-1-15 .times.
Excised/GUS- 386 0 386 381-49-1-10-005 4 5380-18-1-22 .times.
Intact/GUS+ 473 356 117 5381-49-1-14(null).017 (null) 214
5381-56-1-6(null) .times. Intact/GUS+ 480 377 102 5380-46-1-23.010
(null) 292 5381-49-1-14(null) .times. Intact/GUS+ 481 370 111
5380-18-1-22.013 (null) 189 5380-46-1-15 .times. Intact/GUS+ 456
345 111 5381-56-1-5.001 335 5381-18-1-17 .times. Chimeric/GUS+ 449
326 123 5380-46-1-15.011 350 5381-18-1-17 .times. Chimeric/GUS+ 457
342 114 5380-18-1-22.020 331 5381-18-1-17 .times. Chimeric/GUS+ 452
347 104 5380-46-1-15.016 53 54380-46-1-15 .times. Chimeric/GUS+ 470
359 109 5381-18-1-17.014
[0166] Green Flourescent Protein ELISA Analysis.
[0167] Selected F.sub.2 plants were tested for GFP expression by
ELISA using the protocol described, supra (GFP Expression Assay).
GFP expression data from the F.sub.2 plants were as expected. The
F.sub.1 plants expressed GFP in about 75% of the F.sub.2
generation. The remaining plants (about 25%) in which GFP was not
detected via ELISA was expected. The GFP PTU expression cassette is
expected to segregate within the F.sub.2 population at the expected
3:1 ratio. The chimeric events which contained both excised and
non-excised GFP PTU expression cassettes in the F.sub.1 segregated
within the F.sub.2. The majority of the plants expressed GFP.
[0168] PCR, Southern Blot, and GFP Analysis of F.sub.2
Progenies.
[0169] Sixteen plants from three of the crosses listed in Table 5
(representing excised, intact, and chimeric progenies) were kept
for further molecular analysis. These sixteen plants consisted of
eight plants that were GUS positive and eight plants that were GUS
negative for the sibling null control and chimeric plants. The
protocols described, supra (Southern Blot Analysis; and Plant
Transcription Unit PCR Analysis), were repeated with genomic DNA
from the F.sub.2 plants. Selected F.sub.2 plants were tested for
GFP expression by ELISA using the protocol described, supra (GFP
Expression Assay). The molecular data confirm that plants which did
not express GUS do not contain the intact GUS PTU expression
cassette. GFP expression segregated as expected. The results are
summarized in FIGS. 8-13.
[0170] While a number of exemplary aspects and embodiments have
been discussed above, those of skill in the art will recognize
certain modifications, permutations, additions and sub-combinations
thereof. It is therefore intended that the following appended
claims and claims hereafter introduced are interpreted to include
all such modifications, permutations, additions and
sub-combinations as are within their true spirit and scope.
[0171] All references, including publications, patents, and patent
applications, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein. The references discussed herein are
provided solely for their disclosure prior to the filing date of
the present application. Nothing herein is to be construed as an
admission that the inventors are not entitled to antedate such
disclosure by virtue of prior invention.
Sequence CWU 1
1
18133DNAArtificial SequenceCCR5 ZFN binding site 1tggtcatcct
catcctgata aactgcaaaa ggc 3322139DNAArtificial SequenceCCR5 Zinc
Finger Nuclease gene sequence 2atggctccaa ggaagaggaa ggagtctaac
agggagtcag ctaggaggtc aaggtacagg 60aaggtgggta tccacggggt acccgccgct
atggccgaga ggcccttcca gtgtcgaatc 120tgcatgcgta acttcagtga
ccgctccaac ctgtcccgcc acatccgcac ccacacaggc 180gagaagcctt
ttgcctgtga catttgtggg aggaagtttg ccatctcctc caacctgaac
240tcccatacca agatacacac gggatctcag aagcccttcc agtgtcgaat
ctgcatgcgt 300aacttcagtc gctccgacaa cctggcccgc cacatccgca
cccacacagg cgagaagcct 360tttgcctgtg acatttgtgg gaggaagttt
gccacctccg gcaacctgac ccgccacgcc 420cagcgctgcg gcggcctgcg
gggatcccaa cttgtgaaat cagaattgga agagaaaaag 480tctgagctta
gacacaaatt gaagtacgtt ccacatgaat atatcgaact tatcgagatt
540gctaggaact caacacagga cagaattttg gagatgaagg ttatggagtt
ctttatgaaa 600gtgtacggat ataggggaaa gcaccttggt ggttctagga
aacctgatgg tgcaatctac 660actgtgggat cacctattga ctatggtgtt
atcgtggata caaaggcata ctctggtgga 720tacaatttgc caatcggaca
agctgacgaa atggagagat atgttgaaga gaaccaaact 780agaaacaaac
atcttaatcc aaatgaatgg tggaaggtgt atccttcatc tgttacagag
840ttcaaattcc tttttgtgtc tggacacttt aagggtaact acaaagcaca
gcttactagg 900ttgaaccata ttacaaattg caatggtgct gtgttgtcag
ttgaagagct tttgatcgga 960ggtgaaatga ttaaggcagg aacacttact
ttggaggaag ttagaagaaa attcaacaac 1020ggtgaaatca attttagatc
tggcggcgga gagggcagag gaagtcttct aacatgcggt 1080gacgtggagg
agaatcccgg ccctaggatg gctccaagga agaggaagga gtctaacagg
1140gagtcagcta ggaggtcaag gtacaggaag gtgggtatcc acggggtacc
cgccgctatg 1200gccgagaggc ccttccagtg tcggatctgc atgcggaact
tcagcaggag cgacaacctg 1260agcgtacaca tccgcaccca cacaggcgag
aagccttttg cctgtgacat ttgtgggagg 1320aaatttgccc agaaaatcaa
cctccaggtc cacaccaaga tccacaccgg agagaagccc 1380tttcagtgca
gaatctgcat gagaaacttc tcccggtccg acgtgctgag cgagcacatt
1440aggacccaca ccggggagaa acccttcgcc tgcgacatct gtggccgcaa
atttgcccag 1500cgcaaccacc ggacaacaca cgcccagcgc tgcggcggcc
tgcggggatc ccaacttgtg 1560aaatcagaat tggaagagaa aaagtctgag
cttagacaca aattgaagta cgttccacat 1620gaatatatcg aacttatcga
gattgctagg aactcaacac aggacagaat tttggagatg 1680aaggttatgg
agttctttat gaaagtgtac ggatataggg gaaagcacct tggtggttct
1740aggaaacctg atggtgcaat ctacactgtg ggatcaccta ttgactatgg
tgttatcgtg 1800gatacaaagg catactctgg tggatacaat ttgccaatcg
gacaagctga cgaaatgcag 1860agatatgtta aagagaacca aactagaaac
aaacatatta atccaaatga atggtggaag 1920gtgtatcctt catctgttac
agagttcaaa ttcctttttg tgtctggaca ctttaagggt 1980aactacaaag
cacagcttac taggttgaac cataagacaa attgcaatgg tgctgtgttg
2040tcagttgaag agcttttgat cggaggtgaa atgattaagg caggaacact
tactttggag 2100gaagttagaa gaaaattcaa caacggtgaa atcaatttt
2139329DNAArtificial SequenceTQPATS primer 3acaagagtgg attgatgatc
tagagaggt 29429DNAArtificial SequenceTQPATA primer 4ctttgatgcc
tatgtgacac gtaaacagt 29529DNAArtificial SequenceTQPATFQ primer
5ggtgttgtgg ctggtattgc ttacgctgg 29630DNAArtificial SequenceTQPALS
primer 6tactatgact tgatgttgtg tggtgactga 30728DNAArtificial
SequenceTQPALA primer 7gagcggtcta aattccgacc cttatttc
28833DNAArtificial SequenceTQPALFQ primer 8aaacgatggc aggagtgccc
tttttctatc aat 33919DNAArtificial SequenceHPT2S primer 9acactacatg
gcgtgattt 191018DNAArtificial SequenceHPT2A primer 10agcatcagct
catcgaga 181119DNAArtificial SequenceHPTFQ primer 11actgtgatgg
acgacaccg 191221DNAArtificial SequenceFok1_UPL_F primer
12tgaatggtgg aaggtgtatc c 211325DNAArtificial SequenceFok1_UPL_R
primer 13aagctgtgct ttgtagttac cctta 251421DNAArtificial
SequenceBY2ACT89S primer 14cccagatcat gtttgagacc t
211521DNAArtificial SequenceBY2ACT89A primer 15ggaagcgcat
atccctcata g 211624DNAArtificial SequenceForward PCR primer for PTU
PCR analysis 16tgggctgaat tgaagacatg ctcc 241722DNAArtificial
SequenceReverse PCR primer for PTU PCR analysis 17tctgaaaata
gtggccaccg ct 221828DNAArtificial SequenceBYACTFQ primer
18ctagtggtcg tactactggt attgtgct 28
* * * * *