U.S. patent application number 14/493435 was filed with the patent office on 2016-09-08 for hepcidin binding nucleic acids.
The applicant listed for this patent is NOXXON PHARMA AG. Invention is credited to Klaus Buchner, Nicole Dinse, Sven Klussmann, Christian Maasch, Frank Morich, Frank Schwobel, Simone Sell.
Application Number | 20160257958 14/493435 |
Document ID | / |
Family ID | 42374984 |
Filed Date | 2016-09-08 |
United States Patent
Application |
20160257958 |
Kind Code |
A1 |
Sell; Simone ; et
al. |
September 8, 2016 |
Hepcidin Binding Nucleic Acids
Abstract
The present invention is related to a nucleic acid capable of
binding to hepcidin.
Inventors: |
Sell; Simone; (Berlin,
DE) ; Morich; Frank; (Berlin, DE) ; Maasch;
Christian; (Berlin, DE) ; Klussmann; Sven;
(Berlin, DE) ; Dinse; Nicole; (Berlin, DE)
; Buchner; Klaus; (Berlin, DE) ; Schwobel;
Frank; (Berlin, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NOXXON PHARMA AG |
BERLIN |
|
DE |
|
|
Family ID: |
42374984 |
Appl. No.: |
14/493435 |
Filed: |
September 23, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13318144 |
Oct 30, 2011 |
8841431 |
|
|
PCT/EP2010/002659 |
Apr 30, 2010 |
|
|
|
14493435 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/351 20130101;
A61P 27/02 20180101; C12Q 1/6876 20130101; A61P 25/14 20180101;
A61P 39/02 20180101; C12N 2320/30 20130101; G01N 33/5308 20130101;
A61P 25/16 20180101; A61K 31/00 20130101; G01N 2333/575 20130101;
G01N 33/74 20130101; C12N 2310/16 20130101; A61P 27/12 20180101;
C12N 15/115 20130101; A61P 7/06 20180101; A61P 7/00 20180101; G01N
2500/04 20130101; A61P 29/00 20180101; A61P 25/28 20180101; A61P
43/00 20180101 |
International
Class: |
C12N 15/115 20060101
C12N015/115; G01N 33/53 20060101 G01N033/53; C12Q 1/68 20060101
C12Q001/68; G01N 33/74 20060101 G01N033/74 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 30, 2009 |
EP |
09006028.6 |
Jan 22, 2010 |
EP |
10000635.2 |
Claims
1-99. (canceled)
100. An L-nucleic acid that binds hepcidin, wherein the L-nucleic
acid comprises in 5.fwdarw.43' direction a first terminal stretch
of nucleotides, a central stretch of nucleotides and a second
terminal stretch of nucleotides, wherein the central stretch of
nucleotides comprises 5' RKAUGGGAKUAAGUAAAUGAGGRGUWGGAGGAAR 3' [SEQ
II) NO: 182] or 5' RKAUGGGAKAAGUAAAUGAGGRGUWGGAGGAAR 3' [SEQ ID
NO:183], and the first terminal stretch of nucleotides comprises
five to eight nucleotides, and the second terminal stretch of
nucleotides comprises five to eight nucleotides.
101. The L-nucleic acid according to claim 100, wherein the nucleic
acid is an antagonist of hepcidin.
102. The L-nucleic acid according to claim 100, wherein the nucleic
acid is an inhibitor of the hepcidin-ferroportin system.
103. The L-nucleic acid according to claim 100, wherein the central
stretch of nucleotides is essential for binding to hepcidin.
104. The L-nucleic acid according to claim 100, wherein the central
stretch of nucleotides comprises 5'
RKAUGGGAKUAAGUAAAUGAGGRGUUGGAGGAAR 3' [SEQ ID NO:213].
105. The L-nucleic acid according to claim 100, wherein the first
terminal stretch of nucleotides and the second terminal stretch of
nucleotides optionally hybridize with each other to form a
double-stranded structure.
106. The L-nucleic acid molecule according to claim 100, wherein
the first terminal stretch of nucleotides comprises 5
X.sub.1X.sub.2X.sub.3SBSBC3' and the second terminal stretch of
nucleotides comprises 5' GVBVBX.sub.4X.sub.5X.sub.6 3', wherein a)
X.sub.1 is A, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S, X.sub.5 is
C, and X.sub.6; is U or b) X.sub.1 is absent, X.sub.2 is G, X.sub.3
is B, X.sub.4 is S, X.sub.5 is C, and X.sub.6 is U or c) X.sub.1 is
A, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S, X.sub.5 is C, and
X.sub.6 is absent.
107. The L-nucleic acid molecule according to claim 100, wherein
the first terminal stretch of nucleotides comprises 5'
X.sub.1X.sub.2X.sub.3SBSBC3' and the second terminal stretch of
nucleotides comprises 5' GVBVYX.sub.4X.sub.5X.sub.6 3', wherein a)
X.sub.1 is absent, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S,
X.sub.5 is C, and X.sub.6 is absent or b) X.sub.1 is absent,
X.sub.2 is absent, X.sub.3 is B, X.sub.4 is S, X.sub.5 is C, and
X.sub.6 is absent or c) X.sub.1 is absent, X.sub.2 is G, X.sub.3 is
B, X.sub.4 is S, X.sub.5 is absent, and X.sub.6 is absent.
108. The L-nucleic acid molecule according to claim 100, wherein
the first terminal stretch of nucleotides comprises 5'
X.sub.1X.sub.2X.sub.3SBSBC3' and the second terminal stretch of
nucleotides comprises 5' GVBVYX.sub.4X.sub.5X.sub.6 3', wherein
X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is B or absent,
X.sub.4 is S or absent, X.sub.5 is absent, and X.sub.6 is
absent.
109. The L-nucleic acid according to claim 100, wherein the nucleic
acid comprises a nucleic acid sequence according to any one of SEQ
ID NOs:115 to 119, SEQ ID NO:121, SEQ. ID NO:142, SEQ ID NO:144,
SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:151, SEQ ID NO:152, SEQ ID
NO:175 or SEQ ID NO:176.
110. The L-nucleic acid according to claim 100, wherein hepcidin is
selected from the group consisting of human hepcidin-25, human
hepcidin-22, human hepcidin-20, monkey hepcidin-25, monkey
hepcidin-22 and monkey hepcidin-20.
111. The L-nucleic acid according to claim 100, wherein the
L-nucleic acid binds human hepcidin-25.
112. The L-nucleic acid according to claim 100, comprising a
modification group.
113. The nucleic acid according to claim 112, wherein the
modification group is selected from the group consisting of linear
polyethylene glycol (PEG), branched PEG, hydroxyethyl starch (HES),
a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene,
polyoxyamidate and poly (2-hydroxyethyl)-L-glutamine.
114. The L-nucleic acid according to claim 112, wherein the
modification group comprises a straight or branched PEG.
115. The L-nucleic acid according to claim 114, wherein the PEG is
from about 20,000 to about 120,000 Da.
116. The L-nucleic acid according to claim 112, wherein the
modification group is a HES comprising a molecular weight of from
about 10,000 to about 200,000 Da.
117. The L-nucleic acid according to claim 112, wherein the
modification group is coupled to the nucleic acid via a linker.
118. The nucleic acid according, to claim 112, wherein the
modification group is coupled to the 5'-terminal nucleotide and/or
the 3'-terminal nucleotide of the nucleic acid.
119. A pharmaceutical composition comprising the L-nucleic acid of
claim 100 and optionally a further constituent selected from the
group consisting of pharmaceutically acceptable excipients,
pharmaceutically acceptable carriers and pharmaceutically active
agents.
120. A method of treating a disease or condition associated with
hepcidin in a subject suspected of having said disease or
condition, wherein the method comprises exposing the subject to the
L-nucleic acid of claim 100.
121. The method according to claim 120, wherein the disease or
condition is selected from the group consisting of anemia,
hypoferremia, pica, a condition with elevated hepcidin level, a
condition with elevated iron level and a condition with iron
overload.
122. The method according to claim 121, wherein the anemia is
selected from the group consisting of sideroblastic anemia,
hypochromic microcytic anemia, anemia caused by chronic disease
and/or disorder, anemia caused by inflammation, anemia caused by
genetic disorders, anemia caused by acute infections, anemia caused
by mutation in genes of iron and in homeostasis and anemia caused
by cancer treatment.
123. A complex comprising the L-nucleic acid according to claim 100
and hepcidin.
124. A method for detecting hepcidin comprising exposing a sample
suspected of comprising hepcidin with the L-nucleic acid according
to claim 100 and determining presence of complexes of said
L-nucleic acid and hepcidin, wherein presence of complexes
correlates with presence of hepcidin in said sample.
125. A method for identifying an antagonist or an agonist of
hepcidin comprising: providing a candidate antagonist and/or a
candidate agonist of hepcidin, providing the L-nucleic acid
according to claim 100, providing a test system which provides a
signal in the presence of an antagonist and/or an agonist of
hepcidin, and determining whether the candidate antagonist is an
antagonist of hepcidin and/or whether the candidate agonist is an
agonist of hepcidin.
126. A method for the detection of the L-nucleic acid according to
claim 100 in a sample, wherein the method comprises the steps of:
a) providing a sample containing the L-nucleic acid according to
claim 100; b) providing a capture probe, wherein the capture probe
is at least partially complementary to a first part of the
L-nucleic acid according to any one of claim 100, and a detection
probe, wherein the detection probe is at least partially
complementary to a second part of the L-nucleic acid according to
claim 100, or, alternatively, the capture probe is at least
partially complementary to a second part of the L-nucleic acid
according to claim 100 and the detection probe is at least
partially complementary to the first part of the L-nucleic acid
according to claim 100; c) allowing the capture probe and the
detection probe to react either simultaneously or in any order with
the L-nucleic acid according to claim 100 or part thereof to form a
complex; d) optionally detecting Whether or not the capture probe
is hybridized to the L-nucleic acid according to claim 100 provided
in step a); and e) detecting the complex formed in step c)
consisting of the L-nucleic acid according to claim 100 the capture
probe and the detection probe.
Description
[0001] The present invention is related to nucleic acids binding to
hepcidin, and the use thereof for the manufacture of a medicament,
a diagnostic agent, and a detecting agent respectively.
[0002] The primary structure of hepcidin (HEPC-HUMAN, SwissProt
entry P81172) was determined in 2000 (Krause, 2000). Hepcidin was
discovered independently by another group investigating
anti-microbial peptides (Park, 2001). Synonyms of the protein are
liver-expressed antimicrobial peptide (abbreviation: LEAP-1) and
Putative liver tumour regressor (abbreviation: PLTR). Hepcidin is a
cysteine-rich cationic peptide and consists of 25 amino acids
accounting for a molecular weight of 2,790 Dalton. The eight
cysteines form four disulfide bonds and confer a stable, rigid
structure to the molecule.
[0003] The tertiary structure of hepcidin was determined by NMR
analysis (Hunter, 2002). The protein consists of a distorted
beta-sheet with an unusual vicinal disulphide bridge found at the
turn of the hairpin (Hunter, 2002).
[0004] The amino acid sequence of hepcidin from different mammalian
species has generally been well conserved during evolution. Human
hepcidin shares the following percentage of identical amino acids
with hepcidin from: [0005] Macaca mulatta (rhesus monkey) 100%
[0006] Macaca fascularis (cynomolgus monkey) 100% [0007] Sus scrofa
(pig) 84% [0008] Mus musculus (mouse) 76% [0009] Rattus norvegicus
(rat) 68%
[0010] In addition to bioactive hepcidin consisting of 25 amino
acids (also referred to as hepcidin-25) two truncated inactive
variants with 20 and 22 amino acids were identified: hepcidin-20
and hepcidin 22 (Rivera, 2005). All these peptides are generated on
the basis of a 84 amino acid prepropeptide in human and rat and an
83 amino acid prepropeptide in mice (Pigeon, 2001).
[0011] The 84 amino acid hepcidin prepropeptide contains a typical
endoplasmic reticulum targeting 24-amino acid signal peptide that
is removed, and a consensus cleavage site for the prohormone
convertase furin (Valore, 2008). These processing steps generate
the active 25 amino acids peptide hormone, found in blood and
urine.
[0012] Hepcidin is the key signal regulating iron homeostasis. High
levels of human hepcidin result in reduced serum iron levels
whereas low levels result in increased serum iron levels as shown
in hepcidin-deficiency and hepcidin overexpressing mouse models
(Nicolas, 2001; Nicolas, 2002; Nicolas, 2003). In addition,
mutations in the hepcidin gene which result in lack of hepcidin
activity are associated with juvenile hemochromatosis, a severe
iron overload disease (Roetto, 2003). After intraperitoneal
injection of hepcidin a dose dependent and long lasting reduction
in serum iron was observed (Rivera, 2005).
[0013] Iron is an essential element required for growth and
development of all living organisms. Iron content in mammals is
regulated by controlling iron absorption, iron recycling, and
release of iron from cells in which it is stored. Iron is absorbed
predominantly in the duodenum and upper jejunum by enterocytes.
[0014] A feedback mechanism enhances iron adsorption in individuals
who are iron deficient, and reduces iron absorption in individuals
with iron overload. A key compound of this mechanism is the iron
transporter ferroportin which also acts as hepcidin receptor
(Abboud, 2000; Donovan, 2000; McKie, 2000). Ferroportin is a
571-amino acid protein with 90% amino acid sequence identity
between mice, rats, and humans which controls the release of iron
(McKie, 2000). This major iron export protein is located on the
basal membrane of placental syncytiotrophoblasts and enterocytes,
and on the cell surface of macrophages and hepatocytes.
[0015] Hepcidin inhibits iron release from these different cell
types by binding to ferroportin expressed on the above mentioned
cell types and induces its phosphorylation, internalisation,
ubiquitylation and lysosomal degradation thereby reducing
ferroportin mediated release of iron into the blood (Nemeth, 2004;
De Domenico, 2007). As plasma iron continues to be consumed for
haemoglobin synthesis, plasma iron levels decrease and hepcidin
production abates in healthy subjects.
[0016] In situations of acute and chronic systemic inflammation
cytokines induce hepcidin production. Hepcidin gene expression has
been observed to be increased significantly after inflammatory
stimuli, such as infections, which induce the acute phase response
of the innate immune system of vertebrates. In mice hepcidin gene
expression was shown to be upregulated by lipopolysaccharide
(Constante, 2006), turpentine (Nemeth, 2004) and Freund's complete
adjuvant (Frazer, 2004), and adenoviral infections. In humans
hepcidin expression is induced by the inflammatory cytokine
interleukine-6 and LPS (Nemeth, 2004). A strong correlation between
hepcidin expression and anemia of inflammation was also found in
patients with chronic inflammatory diseases, including bacterial,
fungal and viral infections. In all these conditions increased
concentrations of hepcidin inhibit iron efflux from macrophages,
from hepatic storage and from duodenum into plasma. Hypoferremia
develops, and erythropoiesis becomes iron-limited and results in
anaemia under conditions of chronic inflammation (Weiss, 2005;
Weiss, 2008; Andrews, 2008).
[0017] The problem underlying the present invention is to provide a
means which specifically interacts with hepcidin. More
specifically, the problem underlying the present invention is to
provide for a nucleic acid based means which specifically interacts
with hepcidin.
[0018] A further problem underlying the present invention is to
provide a means for the manufacture of a medicament for the
treatment of a human or non-human diseases, whereby the disease is
characterized by hepcidin being either directly or indirectly
involved in the pathogenetic mechanism of such disease.
[0019] A still further problem underlying the present invention is
to provide a means for the manufacture of a diagnostic agent for
the treatment of a disease, whereby the disease is characterized by
hepcidin being either directly or indirectly involved in the
pathogenetic mechanism of such disease.
[0020] These and other problems underlying the present invention
are solved by the subject matter of the attached independent
claims. Preferred embodiments may be taken from the dependent
claims.
[0021] Furthermore, the problem underlying the invention is solved
in a first aspect which is also the first embodiment of the first
aspect by a nucleic acid capable of binding to hepcidin.
[0022] In a second embodiment of the first aspect which is also an
embodiment of the first embodiment of the first aspect, the nucleic
acid is an antagonist of hepcidin.
[0023] In a third embodiment of the first aspect which is also an
embodiment of the first and the second embodiment of the first
aspect, the nucleic acid is an inhibitor of the
hepcidin-ferroportin system.
[0024] In a fourth embodiment of the first aspect which is also an
embodiment of the first, the second and the third embodiment of the
first aspect, the nucleic acid comprises in 5'->3' direction a
first terminal stretch of nucleotides, a central stretch of
nucleotides and a second terminal stretch of nucleotides, wherein
the central stretch of nucleotides comprises 32 to 40 nucleotides,
preferably 32 to 35 nucleotides.
[0025] In a fifth embodiment of the first aspect which is also an
embodiment of the first and the second embodiment of the first
aspect, the nucleic acid comprises in 5'->3' direction a second
terminal stretch of nucleotides, a central stretch of nucleotides
and a first terminal stretch of nucleotides, wherein the central
stretch of nucleotides comprises 32 to 40 nucleotides, preferably
32 to 35 nucleotides.
[0026] In a sixth embodiment of the first aspect which is also an
embodiment of the fourth and the fifth embodiment of the first
aspect, the central stretch of nucleotides is essential for binding
to hepcidin.
[0027] In a seventh embodiment of the first aspect which is also an
embodiment of the fourth, the fifth and the sixth embodiment of the
first aspect, the central stretch of nucleotides comprises a
nucleotide sequence of 5' RKAUGGGAKUAAGUAAAUGAGGRGUWGGAGGAAR 3' or
5' RKAUGGGAKAAGUAAAUGAGGRGUWGGAGGAAR 3'.
[0028] In an eight embodiment of the first aspect which is also an
embodiment of the fourth to seventh embodiment of the first aspect,
the central stretch of nucleotides comprises a nucleotide sequence
of 5' RKAUGGGAKUAAGUAAAUGAGGRGUUGGAGGAAR 3', preferably 5'
GUAUGGGAUUAAGUAAAUGAGGAGUUGGAGGAAG 3'.
[0029] In a ninth embodiment of the first aspect which is also an
embodiment of the seventh and eighth embodiment of the first
aspect, the first terminal stretch of nucleotides and the second
terminal stretch of nucleotides optionally hybridize with each
other, wherein upon hybridization a double-stranded structure is
formed, [0030] the first terminal stretch of nucleotides comprises
five to eight nucleotides, and [0031] the second terminal stretch
of nucleotides comprises five to eight nucleotides.
[0032] In a tenth embodiment of the first aspect which is also an
embodiment of the ninth embodiment of the first aspect, the
double-stranded structure consists of five to eight basepairs.
[0033] In an eleventh embodiment of the first aspect which is also
an embodiment of the seventh to the tenth embodiment of the first
aspect, preferably of the eight to tenth embodiment of the first
aspect the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3SBSBC3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GVBVYX.sub.4X.sub.5X.sub.6 3',
wherein X.sub.1 is A or absent, X.sub.2 is G or absent, X.sub.3 is
B or absent, X.sub.4 is S or absent, X.sub.5 is C or absent, and
X.sub.6 is U or absent.
[0034] In a twelvth embodiment of the first aspect which is also an
embodiment of the seventh to the eleventh embodiment of the first
aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3SBSBC3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GVBVBX.sub.4X.sub.5X.sub.6 3',
wherein [0035] a) X.sub.1 is A, X.sub.2 is G, X.sub.3 is B, X.sub.4
is S, X.sub.5 is C, and X.sub.6 is U or [0036] b) X.sub.1 is
absent, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S, X.sub.5 is C, and
X.sub.6 is U or [0037] c) X.sub.1 is A, X.sub.2 is G, X.sub.3 is B,
X.sub.4 is S, X.sub.5 is C, and X.sub.6 is absent.
[0038] In a 13.sup.th embodiment of the first aspect which is also
an embodiment of the seventh embodiment to the twelvth embodiment
of the first aspect, [0039] a) the first terminal stretch of
nucleotides comprises a nucleotide sequence of 5' AGCGUGUC 3' and
the second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GGUGCGCU 3' or. [0040] b) the first terminal stretch
of nucleotides comprises a nucleotide sequence of 5' AGCGUGUC 3'
and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GGCAUGCU 3' or [0041] c) the first
terminal stretch of nucleotides comprises a nucleotide sequence of
5' AGUGUGUC 3' and the second terminal stretch of nucleotides
comprises a nucleotide sequence of 5' GAUGCGCU 3' or [0042] d) the
first terminal stretch of nucleotides comprises a nucleotide
sequence of 5' AGUGUGUC 3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5' GGCAUGCU 3' or
[0043] e) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' AGCGUGCC 3' and the second terminal
stretch of nucleotides comprises a nucleotide sequence of 5'
GGUGCGCU 3' or [0044] f) the first terminal stretch of nucleotides
comprises a nucleotide sequence of 5' AGCGCGCC 3' and the second
terminal stretch of nucleotides comprises a nucleotide sequence of
5' GGCGCGCU 3'.
[0045] In a 14.sup.th embodiment of the first aspect which is also
an embodiment of the seventh embodiment to the tenth embodiment of
the first aspect, preferably of the eighth to the tenth embodiment,
the first terminal stretch of nucleotides comprises a nucleotide
sequence of 5' X.sub.1X.sub.2X.sub.3SBSBC3' and the second terminal
stretch of nucleotides comprises a nucleotide sequence of 5'
GVBVYX.sub.4X.sub.5X.sub.6 3', wherein [0046] a) X.sub.1 is absent,
X.sub.2 is G, X.sub.3 is B, X.sub.4 is S, X.sub.5 is C, and X.sub.6
is absent or [0047] b) X.sub.1 is absent, X.sub.2 is absent,
X.sub.3 is B, X.sub.4 is S, X.sub.5 is C, and X.sub.6 is absent or
[0048] c) X.sub.1 is absent, X.sub.2 is G, X.sub.3 is B, X.sub.4 is
S, X.sub.5 is absent, and X.sub.6 is absent.
[0049] In a 15.sup.th embodiment of the first aspect which is also
an embodiment of the seventh embodiment to the twelvth and
14.sup.th embodiment of the first aspect, the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5'
X.sub.1X.sub.2X.sub.3SBSBC3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5'
GVBVYX.sub.4X.sub.5X.sub.6 3',
wherein X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is B or
absent, X.sub.4 is S or absent, X.sub.5 is absent, and X.sub.6 is
absent.
[0050] In a 16.sup.th embodiment of the first aspect which is also
an embodiment of the 15.sup.th embodiment of the first aspect,
[0051] a) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GCGCGC 3' and the second terminal stretch
of nucleotides comprises a nucleotide sequence of 5' GCGCGC 3' or
[0052] b) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GGUGUC 3' and the second terminal stretch
of nucleotides comprises a nucleotide sequence of 5' GGCAUC 3' or
[0053] c) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GGCGUC 3' and the second terminal stretch
of nucleotides comprises a nucleotide sequence of 5' GGCGCC 3' or
[0054] d) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GCGCC 3' and the second terminal stretch
of nucleotides comprises a nucleotide sequence of 5' GGCGC 3' or
[0055] e) the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GGCGC 3' and the second terminal stretch
of nucleotides comprises a nucleotide sequence of 5' GCGCC 3'.
[0056] In a 17.sup.th embodiment of the first aspect which is also
an embodiment of the seventh embodiment to the 16.sup.th embodiment
of the first aspect, the nucleic acid comprises a nucleic acid
sequence according to any one of SEQ.ID.Nos. 115 to 119, SEQ.ID.No.
121, SEQ.ID.No. 142, SEQ.ID.No. 144, SEQ.ID.No. 146, SEQ.ID.No.
148, SEQ.ID.No. 151, SEQ.ID.No. 152, SEQ.ID.No. 175 or SEQ.ID.No.
176.
[0057] In an 18.sup.th embodiment of the first aspect which is also
an embodiment of the fourth to the sixth embodiment of the first
aspect, the central stretch of nucleotides comprises a nucleotide
sequence of 5' GRCRGCCGGVGGACACCAUAUACAGACUACKAUA 3' or 5'
GRCRGCCGGARGGACACCAUAUACAGACUACKAUA 3'.
[0058] In a 19.sup.th embodiment of the first aspect which is also
an embodiment of the fourth to the sixth embodiment and the
18.sup.th embodiment of the first aspect, the central stretch of
nucleotides comprises a nucleotide sequence of 5'
GRCRGCCGGGGGACACCAUAUACAGACUACKAUA 3', preferably 5'
GACAGCCGGGGGACACCAUAUACAGACUACGAUA 3'.
[0059] In a 20.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th and 19.sup.th embodiment of the
first aspect, [0060] the first terminal stretch of nucleotides and
the second terminal stretch of nucleotides optionally hybridize
with each other, wherein upon hybridization a double-stranded
structure is formed, [0061] the first terminal stretch of
nucleotides comprises four to seven nucleotides, and [0062] the
second terminal stretch of nucleotides comprises four to seven
nucleotides.
[0063] In a 21.sup.st embodiment of the first aspect which is also
an embodiment of the 20.sup.th embodiment of the first aspect, the
double-stranded structure consists of four to seven basepairs.
[0064] In a 22.sup.nd embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 21.sup.st embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3SBSN 3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' NSVSX.sub.4X.sub.5X.sub.6 3',
wherein X.sub.1 is A or absent, X.sub.2 is G or absent, X.sub.3 is
R or absent, X.sub.4 is Y or absent, X.sub.5 is C or absent,
X.sub.6 is U or absent.
[0065] In a 23.sup.rd embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 22.sup.nd embodiment of the
first aspect, preferably of the 19.sup.th to the 22.sup.nd of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3SBSN 3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' NSVSX.sub.4X.sub.5X.sub.6 3', wherein [0066] a)
X.sub.1 is A, X.sub.2 is G, X.sub.3 is R, X.sub.4 is Y, X.sub.5 is
C, and X.sub.6 is U or [0067] b) X.sub.1 is absent, X.sub.2 is G,
X.sub.3 is R, X.sub.4 is Y, X.sub.5 is C, and X.sub.6 is U or
[0068] c) X.sub.1 is A, X.sub.2 is G, X.sub.3 is R, X.sub.4 is Y,
X.sub.5 is C, and X.sub.6 is absent.
[0069] In a 24.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 23.sup.rd embodiment of the
first aspect, [0070] a) the first terminal stretch of nucleotides
comprises a nucleotide sequence of 5' AGGCUCG 3' and the second
terminal stretch of nucleotides comprises a nucleotide sequence of
5' CGGGCCU 3' or [0071] b) the first terminal stretch of
nucleotides comprises a nucleotide sequence of 5' AGGCCCG 3' and
the second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' CGGGCCU 3' or [0072] c) the first terminal stretch
of nucleotides comprises a nucleotide sequence of 5' AGGCUUG 3' and
the second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' CGAGCCU 3' or [0073] d) the first terminal stretch
of nucleotides comprises a nucleotide sequence of 5' AGACUUG 3' and
the second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' CGAGUCU 3'.
[0074] In a 25.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 22.sup.nd embodiment of the
first aspect, preferably of the 19.sup.th to the 22.sup.nd
embodiment of the first aspect the first terminal stretch of
nucleotides comprises a nucleotide sequence of 5'
X.sub.1X.sub.2X.sub.3SBSN3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5'
NSVSX.sub.4X.sub.5X.sub.6 3', wherein [0075] a) X.sub.1 is absent,
X.sub.2 is G, X.sub.3 is R, X.sub.4 is Y, X.sub.5 is C, and X.sub.6
is absent or [0076] b) X.sub.1 is absent, X.sub.2 is absent,
X.sub.3 is R, X.sub.4 is Y, X.sub.5 is C, and X.sub.6 is absent or
[0077] c) X.sub.1 is absent, X.sub.2 is G, X.sub.3 is R, X.sub.4 is
Y, X.sub.5 is absent, and X.sub.6 is absent.
[0078] In a 26.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 22.sup.nd and 25.sup.th
embodiment of the first aspect,
the first terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GGCUCG 3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5' CGGGCC 3'.
[0079] In a 27.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 22.sup.nd embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3SBSN 3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' NSVSX.sub.4X.sub.5X.sub.6 3',
wherein X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is R or
absent, X.sub.4 is Y or absent, X.sub.5 is absent, and X.sub.6 is
absent.
[0080] In a 28.sup.th embodiment of the first aspect which is also
an embodiment of the 18.sup.th to the 22.sup.nd and 27.sup.th
embodiment of the first aspect,
the first terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GGCCG 3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5' CGGCC 3' or the
first terminal stretch of nucleotides comprises a nucleotide
sequence of 5' GCGCG 3' and the second terminal stretch of
nucleotides comprises a nucleotide sequence of 5' CGCGC 3'.
[0081] In a 29.sup.th embodiment of the first aspect which is also
an embodiment of the first to the sixth and 18.sup.th to the
28.sup.th embodiment of the first aspect, the nucleic acid
comprises a nucleic acid sequence according to any one of
SEQ.ID.Nos. 122 to 126, SEQ.ID.No. 154, SEQ.ID.No. 159, SEQ.ID.No.
163 or SEQ.ID.No. 174.
[0082] In a 30.sup.th embodiment of the first aspect which is also
an embodiment of the fourth to the sixth embodiment of the first
aspect, the central stretch of nucleotides comprises in 5'->3'
direction the following stretches of nucleotides: a Box A, a
linking stretch of nucleotides and a Box B; alternatively, the
central stretch of nucleotides comprises in 5'->3' direction the
following stretches of nucleotides: a Box B, a linking stretch of
nucleotides and a Box A, wherein the Box A comprises a nucleotide
sequence of 5' WAAAGUWGAR 3', the linking stretch of nucleotides
comprises ten to eighteen nucleotides and the Box B comprises a
nucleotide sequence of 5' RGMGUGWKAGUKC 3'.
[0083] In a 31.sup.st embodiment of the first aspect which is also
an embodiment of the 30.sup.th embodiment of the first aspect, the
Box A comprises a nucleotide sequence selected from the group of 5'
UAAAGUAGAG 3', 5' AAAAGUAGAA 3', 5' AAAAGUUGAA 3' and 5'
GGGAUAUAGUGC 3'; preferably Box A comprises 5' UAAAGUAGAG 3'.
[0084] In a 32.sup.nd embodiment of the first aspect which is also
an embodiment of the 30.sup.th on the 31.sup.st embodiment of the
first aspect, the Box B comprises a nucleotide sequence selected
from the group of 5' GGCGUGAUAGUGC 3', 5' GGAGUGUUAGUUC 3', 5'
GGCGUGAGAGUGC 3', 5' AGCGUGAUAGUGC 3' and 5' GGCGUGUUAGUGC 3',
preferably Box B comprises 5' GGCGUGAUAGUGC 3'.
[0085] In a 33.sup.rd embodiment of the first aspect which is also
an embodiment of the 30.sup.th on the 32.sup.nd embodiment of the
first aspect, the linking stretch of nucleotides comprises in
5'->3' direction a first linking substretch of nucleotides, a
second linking substretch of nucleotides and a third linking
substretch of nucleotides, wherein preferably the first linking
substretch of nucleotides and the third linking substretch of
nucleotides optionally hybridize to each other, wherein upon
hybridization a double-stranded structure is formed.
[0086] In a 34.sup.th embodiment of the first aspect which is also
an embodiment of the 33.sup.rd embodiment of the first aspect, the
first linking substretch of nucleotides and the third linking
substretch of nucleotides each and independently from each other
comprise three to six nucleotides.
[0087] In a 35.sup.th embodiment of the first aspect which is also
an embodiment of the 32.sup.nd to the 34.sup.th embodiment of the
first aspect, the double-stranded structure consists of three to
six base pairs.
[0088] In a 36.sup.th embodiment of the first aspect which is also
an embodiment of the 32.sup.nd to the 35.sup.th embodiment of the
first aspect, [0089] a) the first linking substretch of nucleotides
comprises a nucleotide sequence of selected from the group of 5'
GGAC 3', 5' GGAU 3' and 5' GGA 3', and the third linking substretch
of nucleotides comprises a nucleotide sequence of 5' GUCC 3' or
[0090] b) the first linking substretch of nucleotides comprises a
nucleotide sequence of 5' GCAG 3' and the third linking substretch
of nucleotides comprises a nucleotide sequence of 5' CUGC 3' or
[0091] c) the first linking substretch of nucleotides comprises a
nucleotide sequence of 5' GGGC 3' and the third linking substretch
of nucleotides comprises a nucleotide sequence of 5' GCCC 3' or
[0092] d) the first linking substretch of nucleotides comprises a
nucleotide sequence of 5' GAC 3' and the third linking substretch
of nucleotides comprises a nucleotide sequence of 5' GUC 3' or
[0093] e) the first linking substretch of nucleotides comprises a
nucleotide sequence of 5' ACUUGU 3' and the third linking
substretch of nucleotides comprises a nucleotide sequence selected
from the group of 5' GCAAGU 3' and 5' GCAAGC 3' or [0094] f) the
first linking substretch of nucleotides comprises a nucleotide
sequence of 5' UCCAG 3' and the third linking substretch of
nucleotides comprises a nucleotide sequence of 5' CUGGA 3',
preferably the first linking substretch of nucleotides comprises a
nucleotide sequence of 5' GAC 3' and the third linking substretch
of nucleotides comprises a nucleotide sequence of 5' GUC 3'.
[0095] In a 37.sup.th embodiment of the first aspect which is also
an embodiment of the 33.sup.rd to the 36.sup.th embodiment of the
first aspect, the second linking substretch of nucleotides
comprises three to five nucleotides.
[0096] In a 38.sup.th embodiment of the first aspect which is also
an embodiment of the 33.sup.th to the 37.sup.th embodiment of the
first aspect, the second linking substretch of nucleotides
comprises a nucleotide sequence selected from the group of 5' VBAAW
3', 5' AAUW 3' and 5' NBW 3'.
[0097] In a 39.sup.th embodiment of the first aspect which is also
an embodiment of the 38.sup.th embodiment of the first aspect, the
second linking substretch of nucleotides comprises a nucleotide
sequence of 5' VBAAW 3', preferably a nucleotide sequence selected
from the group of 5' CGAAA 3', 5' GCAAU 3,' 5' GUAAU 3' and 5'
AUAAU 3'.
[0098] In a 40.sup.th embodiment of the first aspect which is also
an embodiment of the 38.sup.th embodiment of the first aspect, the
second linking substretch of nucleotides comprises a nucleotide
sequence of 5' AAUW 3', preferably a nucleotide sequence of 5'
AAUU3' or 5' AAUA 3', more preferably 5' AAUA 3'.
[0099] In a 41.sup.st embodiment of the first aspect which is also
an embodiment of the 38.sup.th embodiment the second linking
substretch of nucleotides comprises a nucleotide sequence of 5' NBW
3', preferably selected from the group of 5' CCA 3', 5' CUA 3', 5'
UCA 3', 5' ACA 3', 5' GUU 3', 5' UGA 3' and 5' GUA 3', more
preferably 5' CCA 3', 5' CUA 3', 5' UCA 3', 5' ACA 3' and 5' GUU
3'.
[0100] In a 42.sup.nd embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 41.sup.st embodiment of the
first aspect, the linking stretch of nucleotides comprises a
nucleotide sequence selected from the group of 5' GGACBYAGUCC 3',
5' GGAUACAGUCC 3', 5' GCAGGYAAUCUGC 3', 5' GACAAUWGUC 3', 5'
ACUUGUCGAAAGCAAGYU 3', 5' UCCAGGUUCUGGA 3', 5' GGGCUGAGCCC 3', 5'
GCAGAUAAUCUGC 3' and 5' GGACCAGUCC 3', preferably selected from the
group of 5' GGACCCAGUCC 3', 5' GGACCUAGUCC 3', 5' GGACUCAGUCC 3',
5' GCAGGUAAUCUGC 3', 5' GCAGGCAAUCUGC 3', 5' GACAAUUGUC 3' and 5'
GACAAUAGUC 3'.
[0101] In a 43.sup.rd embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 42.sup.nd embodiment of the
first aspect [0102] the first terminal stretch of nucleotides and
the second terminal stretch of nucleotides optionally hybridize
with each other, wherein upon hybridization a double-stranded
structure is formed, [0103] the first terminal stretch of
nucleotides comprises four to seven nucleotides, and [0104] the
second terminal stretch of nucleotides comprises four to seven
nucleotides.
[0105] In a 44.sup.th embodiment of the first aspect which is also
an embodiment of the 43.sup.rd embodiment of the first aspect, the
double-stranded structure consists of four to seven base pairs.
[0106] In a 45.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 44.sup.th embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3BKBK3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' MVVVX.sub.4X.sub.5X.sub.6 3', wherein X.sub.1 is G
or absent, X.sub.2 is S or absent, X.sub.3 is V or absent, X.sub.4
is B or absent, X.sub.5 is S or absent, X.sub.6 is C or absent.
[0107] In a 46.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 44.sup.th embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3BKBK3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' MVVVX.sub.4X.sub.5X.sub.6 3',
wherein [0108] a) X.sub.1 is G, X.sub.2 is S, X.sub.3 is V, X.sub.4
is B, X.sub.5 is S, and X.sub.6 is C or [0109] b) X.sub.1 is
absent, X.sub.2 is S, X.sub.3 is V, X.sub.4 is B, X.sub.5 is S, and
X.sub.6 is C or [0110] c) X.sub.1 is G, X.sub.2 is 5, X.sub.3 is V,
X.sub.4 is B, X.sub.5 is S, and X.sub.6 is absent.
[0111] In a 47.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 46.sup.th embodiment of the
first aspect, preferably of the 46.sup.th embodiment of the first
aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' GCACUCG 3' and the second terminal
stretch of nucleotides comprises a nucleotide sequence of 5'
CGAGUGC 3'.
[0112] In a 48.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 45.sup.th embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3BKBK3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' MVVVX.sub.4X.sub.5X.sub.6 3',
wherein [0113] a) X.sub.1 is absent, X.sub.2 is S, X.sub.3 is V,
X.sub.4 is B, X.sub.5 is S, and X.sub.6 is absent or [0114] b)
X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is V, X.sub.4 is B,
X.sub.5 is S, and X.sub.6 is absent or [0115] c) X.sub.1 is absent,
X.sub.2 is S, X.sub.3 is V, X.sub.4 is B, X.sub.5 is absent, and
X.sub.6 is absent.
[0116] In a 49.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 45.sup.th and 48.sup.th
embodiment of the first aspect, [0117] a) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCUGUG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CACAGC 3' or [0118] b) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' CGUGUG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CACACG 3' or [0119] c) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' CGUGCU
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' AGCACG 3' or [0120] d) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' CGCGCG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CGCGCG 3' or [0121] e) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCCGUG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CACGCG 3' or [0122] f) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCGGUG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CACCGC 3' or [0123] g) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCUGCG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CGCAGC 3' or [0124] h) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCUGGG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CCCAGC 3' or [0125] i) the first terminal
stretch of nucleotides comprises a nucleotide sequence of 5' GCGGCG
3' and the second terminal stretch of nucleotides comprises a
nucleotide sequence of 5' CGCCGC 3'.
[0126] In a 50.sup.th embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 45.sup.th embodiment of the
first aspect, the first terminal stretch of nucleotides comprises a
nucleotide sequence of 5' X.sub.1X.sub.2X.sub.3BKBK3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' MVVVX.sub.4X.sub.5X.sub.6 3',
wherein X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is V or
absent, X.sub.4 is B or absent, X.sub.5 is absent, and X.sub.6 is
absent.
[0127] In a 51.sup.st embodiment of the first aspect which is also
an embodiment of the 30.sup.th to the 45.sup.th and 50.sup.th
embodiment of the first aspect, the first terminal stretch of
nucleotides comprises a nucleotide sequence of 5' CGUG 3' and the
second terminal stretch of nucleotides comprises a nucleotide
sequence of 5' CACG 3'.
[0128] In a 52.sup.nd embodiment of the first aspect which is also
an embodiment of the first to the sixth and of the 30.sup.th to the
11.sup.st embodiment of the first aspect, the nucleic acid
comprises a nucleic acid sequence according to any one of
SEQ.ID.No. 29, SEQ.ID.No. 33, SEQ.ID.No. 34, SEQ.ID.Nos. 39 to 41,
SEQ.ID.No. 43, SEQ.ID.No. 46, SEQ.ID.Nos 137 to 141 or SEQ.ID.No.
173.
[0129] In a 53.sup.th embodiment of the first aspect which is also
an embodiment of the first to the sixth embodiment of the first
aspect, the nucleic acid comprises a nucleic acid sequence
according to any one of SEQ.ID.Nos 127 to 131.
[0130] In a 54.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 53.sup.rd embodiment of the first
aspect, the nucleic acid is capable of binding to hepcidin, wherein
hepcidin is human hepcidin-25, human hepcidin-22, human
hepcidin-20, monkey hepcidin-25, monkey hepcidin-22, monkey
hepcidin-20, preferably human hepcidin-25.
[0131] In a 55.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 54.sup.th embodiment of the first
aspect, preferably of the 54.sup.th embodiment of the first aspect,
the hepcidin has an amino acid sequence according to SEQ ID No.
1.
[0132] In a 56.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 55.sup.th embodiment of the first
aspect, the nucleic acid comprises a modification group, wherein
excretion rate of the nuceic acid molecule comprising the
modification group from an organism is decreased compared to a
nucleic acid not comprising the modification group.
[0133] In a 57.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 55.sup.th embodiment of the first
aspect, the nucleic acid comprises a modification group, wherein
the nuceic acid molecule comprising the modification group has an
increased retention time in an organism compared to a nucleic acid
not comprising the modification group.
[0134] In a 58.sup.th embodiment of the first aspect which is also
an embodiment of the 56.sup.th and 57.sup.th embodiment of the
first aspect, the modification group is selected from the group
comprising biodegradable and non-biodegradable modifications,
preferably the modification group is selected from the group
comprising of linear poly (ethylene) glycol, branched poly
(ethylene) glycol, hydroxyethyl starch, a peptide, a protein, a
polysaccharide, a sterol, polyoxypropylene, polyoxyamidate, poly
(2-hydroxyethyl)-L-glutamine and polyethylene glycol.
[0135] In a 59.sup.th embodiment of the first aspect which is also
an embodiment of the 58.sup.th embodiment of the first aspect, the
modification group is a PEG moiety consisting of a straight or
branched PEG, wherein the molecular weight of the PEG moiety is
preferably from about 20,000 to about 120,000 Da, more preferably
from about 30,000 to about 80,000 Da and most preferably about
40,000 Da.
[0136] In a 60.sup.th embodiment of the first aspect which is also
an embodiment of the 58.sup.th embodiment of the first aspect, the
modification group is a HES moiety, wherein preferably the
molecular weight of the HES moiety is from about 10,000 to 200,000
Da, more preferably from about 30,000 to 170.000 Da and most
preferably about 150,000 Da.
[0137] In a 61.sup.st embodiment of the first aspect which is also
an embodiment of the 56.sup.th to the 60.sup.th embodiment of the
first aspect, the modification group is coupled to the nucleic acid
via a linker, whereby preferably the linker is a biodegradable
linker.
[0138] In a 62.sup.nd embodiment of the first aspect which is also
an embodiment of the 56.sup.th to the 61.sup.st embodiment of the
first aspect, the modification group is coupled to the 5'-terminal
nucleotide and/or the 3'-terminal nucleotide of the nucleic acid
and/or to a nucleotide of the nucleic acid between the 5'-terminal
nucleotide of the nucleic acid and the 3'-terminal nucleotide of
the nucleic acid.
[0139] In a 63.sup.rd embodiment of the first aspect which is also
an embodiment of the 56.sup.th to the 62.sup.nd embodiment of the
first aspect, the organism is an animal or a human body, preferably
a human body.
[0140] In a 64.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 63.sup.rd embodiment of the first
aspect, the nucleotides of or the nucleotides forming the nucleic
acid are L-nucleotides.
[0141] In a 65.sup.th embodiment of the first aspect which is also
an embodiment of the 1.sup.st to the 64.sup.th embodiment of the
first aspect, the nucleic acid is an L-nucleic acid.
[0142] In a 66.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 65.sup.th embodiment of the first
aspect, the nucleic acid comprises at least one binding moiety
which is capable of binding hepcidin, wherein such binding moiety
consists of L-nucleotides.
[0143] In a 67.sup.th embodiment of the first aspect which is also
an embodiment of the first to the 66.sup.th embodiment of the first
aspect, the nucleic acid is or is suitable for use in a method for
the treatment and/or prevention of a disease.
[0144] The problem underlying the invention is solved in a second
aspect which is also the first embodiment of the second aspect by a
pharmaceutical composition comprising a nucleic acid according to
any embodiment of the first aspect and optionally a further
constituent, wherein the further constituent is selected from the
group comprising pharmaceutically acceptable excipients,
pharmaceutically acceptable carriers and pharmaceutically active
agents.
[0145] In a second embodiment of the second aspect which is also an
embodiment of the first embodiment of the second aspect, the
pharmaceutical composition comprises a nucleic acid according to
any embodiment of the first aspect and a pharmaceutically
acceptable carrier.
[0146] The problem underlying the invention is solved in a third
aspect which is also the first embodiment of the third aspect by
the use of a nucleic acid according to any embodiment of the first
aspect for the manufacture of a medicament.
[0147] In a second embodiment of the third aspect which is also an
embodiment of the first embodiment of the third aspect, the
medicament is for use in human medicine or for use in veterinary
medicine.
[0148] The problem underlying the invention is solved in a fourth
aspect which is also the first embodiment of the fourth aspect by
these of a nucleic acid according to any embodiment of the first
aspect for the manufacture of a diagnostic means.
[0149] In a third embodiment of the third aspect which is also an
embodiment of the first and the second embodiment of the third
aspect, the medicament is for the treatment and/or prevention of
anemia, hypoferremia, pica, conditions with elevated hepcidin
level, conditions with elevated iron level or conditions with iron
overload.
[0150] In a fourth embodiment of the third aspect which is also an
embodiment of the third embodiment of the third aspect, the anemia
is selected from the group consisting of sideroblastic anemia,
hypochromic microcytic anemia, anemia caused by chronic disease
and/or disorder, anemia caused by inflammation, anemia caused by
genetic disorders, anemia caused by acute infections, anemia caused
by mutation in genes of iron metabolism and/or homeostasis, and
anemia caused by cancer treatment.
[0151] In a fifth embodiment of the third aspect which is also an
embodiment of the fourth embodiment of the third aspect, the
chronic disease and/or disorder is selected from the group of
chronic inflammation, cancer, autoimmune disease and/or disorder,
chronic infection, arteriosclerosis, atherosclerosis, and cirrhosis
of the liver.
[0152] In a sixth embodiment of the third aspect which is also an
embodiment of the fifth embodiment of the third aspect, chronic
inflammation is selected from the group of chronic kidney disease,
chronic obstructive pulmonary disease, multiple sclerosis,
osteoarthritis, diabetes, obesity, cerebrovascular disease,
congestive heart disease, congestive heart failure, myocardial
infarction, coronary artery disease, peripheral occlusive arterial
disease, pancreatitis and vasculitis, wherein preferably chronic
kidney disease is selected from the group of renal diseases,
chronic renal failure and chronic kidney failure and wherein
chronic kidney disease is caused by kidney dialysis or kidney
transplantation.
[0153] In a seventh embodiment of the third aspect which is also an
embodiment of the fifth embodiment of the third aspect, autoimmune
disease and/or disorder is selected from the group of rheumatoid
arthritis, irritable bowel syndrome, systemic lupus erythrematosus
and Chrohn's disease.
[0154] In an eighth embodiment of the third aspect which is also an
embodiment of the fifth embodiment of the third aspect, chronic
infection is selected from the group of viral infection, viral
illness, bacterial infection and fungal infections, wherein
preferably the viral infections comprise hepatitis and HIV
infection and the bacterial infections comprise H. pyelori
infection.
[0155] In a ninth embodiment of the third aspect which is also an
embodiment of the first to the fourth embodiment of the third
aspect, anemia caused by inflammation is normocytic to microlytic
and/or characterized by a low reticulocyte production index and/or
increased markers of inflammation.
[0156] In a tenth embodiment of the third aspect which is also an
embodiment of the fourth embodiment of the third aspect, the
genetic disorder is the Castleman disease, Schnitzler's syndrome,
iron refractory iron deficiency anemia (matriptase-2 (TMPRSS6)
mutation, atransferrinemia, congenital dyserythropoietic anemia or
hemoglobinopathies.
[0157] In an eleventh embodiment of the third aspect which is also
an embodiment of the fourth embodiment of the third aspect, the
acute infection is selected from the group of viral infection,
bacterial infection fungal infection, preferably sepsis.
[0158] In a twelfth embodiment of the third aspect which is also an
embodiment of the fifth embodiment of the third aspect, the cancer
is selected from the group of hepatocellular carcinoma, lymphoma,
multiple myeloma, head-and-neck cancer, breast cancer, colarectal
cancer, nonmyeloid cancers, renal cell carcinoma, non-small-cell
lung cancer, tumors and brain tumors.
[0159] In a 13.sup.th embodiment of the third aspect which is also
an embodiment of the third embodiment of the third aspect, the
medicament is for the treatment of conditions with elevated iron
level, whereby the conditions are selected from the group of
ataxia, Friedrich's ataxia, age-related macular degeneration,
age-related cataract, age-related retinal diseases and
neurodegenrative disease, whereby such neurodegenerative disease is
preferably selected from the group comprising Alzheimer's disease,
Parkinson's disease, pantothenate kinase-associated
neurodegeneration, restless leg syndrome and Huntington's
disease.
[0160] In a 14.sup.th embodiment of the third aspect which is also
an embodiment of the third embodiment of the third aspect, the
medicament is for the treatment of iron overload, whereby the
hepcidin plasma level is not elevated.
[0161] In a 15.sup.th embodiment of the third aspect which is also
an embodiment of the 14.sup.th embodiment of the third aspect, iron
overload is selected from the group of transfusional iron overload,
iron intoxication, pulmonary hemosiderosis, osteopenia, insulin
resistance, African iron overload, Hallervordan Spatz disease,
hyperferritinemia, ceruloplasmin deficiency, neonatal
hemochromatosis and red blood cell disorder comprising thalassemia,
alpha thalassemia, thalassemia intermedia, sickle cell disease and
myelodyplastic syndrome.
[0162] In a 16.sup.th embodiment of the third aspect which is also
an embodiment of the twelfth to the 15.sup.th embodiment of the
third aspect, the medicament is used in combination with an iron
chelating compound.
[0163] In a 17.sup.th embodiment of the third aspect which is also
an embodiment of the 16.sup.th embodiment of the third aspect, the
iron chelating compound is selected from the group of curcumin,
deferoxamine, deferasirox and deferiprone.
[0164] In an 18.sup.th embodiment of the third aspect which is also
an embodiment of the first embodiment of the third aspect, the
medicament is used for or is for use in combination with a further
medicament or method of treatment, wherein such medicament or
method of treatment comprises a further pharmaceutically active
compound or the administration of such further pharmaceutically
active compound, wherein such further pharmaceutically active
compound is selected from the group of iron supplements, vitamin
supplements, red cell production stimulators, antibiotics,
anti-inflammatory biologics, suppressors of the immune system,
anti-thrombolytics, statins, vasopressors and inotropic
compounds.
[0165] The problem underlying the invention is solved in a fifth
aspect which is also the first embodiment of the fifth aspect by a
complex comprising a nucleic acid according to any embodiment of
the first aspect and hepcidin, wherein preferably the complex is a
crystalline complex.
[0166] In a second embodiment of the fifth aspect which is also an
embodiment of the first embodiment of the fifth aspect, hepcidin is
selected from the group comprising human hepcidin, monkey hepcidin,
more preferably hepcidin is human hepcidin.
[0167] The problem underlying the invention is solved in a sixth
aspect which is also the first embodiment of the sixth aspect by
the use of a nucleic acid according to any embodiment of the first
aspect for the detection of hepcidin.
[0168] In a second embodiment of the sixth aspect which is also an
embodiment of the first embodiment of the sixth aspect, the
hepcidin is selected from the group comprising human hepcidin,
monkey hepcidin, more preferably hepcidin is human hepcidin.
[0169] The problem underlying the invention is solved in a seventh
aspect which is also the first embodiment of the seventh aspect by
a method for the screening of an antagonist or a agonist of
hepcidin comprising the following steps: [0170] providing a
candidate antagonist and/or a candidate agonist of hepcidin, [0171]
providing a nucleic acid according to any embodiment of the first
aspect, [0172] providing a test system which provides a signal in
the presence of an antagonist and/or an agonist of hepcidin, and
[0173] determining whether the candidate antagonist is an
antagonist of hepcidin and/or whether the candidate agonist is an
agonist of hepcidin.
[0174] In a second embodiment of the seventh aspect which is also
an embodiment of the first embodiment of the seventh aspect, the
hepcidin is selected from the group comprising human hepcidin,
monkey hepcidin, more preferably hepcidin is human hepcidin.
[0175] The problem underlying the invention is solved in an eighth
aspect which is also the first embodiment of the eighth aspect by a
kit for the detection of hepcidin comprising a nucleic acid
according to any embodiment of the first aspect, wherein preferably
the hepcidin is human hepcidin.
[0176] The problem underlying the invention is solved in a ninth
aspect which is also the first embodiment of the ninth aspect by a
method for the detection of the nucleic acid according to any
embodiment of the first aspect in a sample, wherein the method
comprises the steps of: [0177] a) providing a sample containing the
nucleic acid according to the present invention; [0178] b)
providing a capture probe, wherein the capture probe is at least
partially complementary to a first part of the nucleic acid
according to any embodiment of the first aspect, and a detection
probe, wherein the detection probe is at least partially
complementary to a second part of the nucleic acid according to any
embodiment of the first aspect, or, alternatively, the capture
probe is at least partially complementary to a second part of the
nucleic acid according to any embodiment of the first aspect and
the detection probe is at least partially complementary to the
first part of the nucleic acid according to any embodiment of the
first aspect; [0179] c) allowing the capture probe and the
detection probe to react either simultaneously or in any order
sequentially with the nucleic acid according to any embodiment of
the first aspect or part thereof; [0180] d) optionally detecting
whether or not the capture probe is hybridized to the nucleic acid
according to the nucleic acid according to any embodiment of the
first aspect provided in step a); and [0181] e) detecting the
complex formed in step c) consisting of the nucleic acid according
to any embodiment of the first aspect and the capture probe and the
detection probe.
[0182] In a second embodiment of the ninth aspect which is also an
embodiment of the first embodiment of the ninth aspect, the
detection probe comprises a detection means, and/or wherein the
capture probe can be immobilized to a support, preferably a solid
support.
[0183] In a third embodiment of the ninth aspect which is also an
embodiment of the first and second embodiment of the ninth aspect,
any detection probe which is not part of the complex is removed
from the reaction so that in step e) only a detection probe which
is part of the complex, is detected.
[0184] In a fourth embodiment of the ninth aspect which is also an
embodiment of the first, second and third embodiment of the ninth
aspect, step e) comprises the step of comparing the signal
generated by the detection means when the capture probe and the
detection probe are hybridized in the presence of the nucleic acid
according to any embodiment of the first aspect or part thereof,
and in the absence of said nucleic acid or part thereof.
[0185] The features of the nucleic acid according to the present
invention as described herein can be realised in any aspect of the
present invention where the nucleic acid is used, either alone or
in any combination.
[0186] In connection with the present invention, preferably, the
term "providing a sample" is different from and does not comprise a
method of treatment or diagnosis of a human or animal body.
[0187] Human hepcidin-25 is a basic protein having the amino acid
sequence according to SEQ. ID. Nos. 1 and a pI of 8.2.
[0188] The present invention is based on the surprising finding
that it is possible to generate nucleic acids binding specifically
and with high affinity to hepcidin. Such nucleic acids are
preferably also referred to herein as the nucleic acid molecules
according to the present invention, the nucleic acids according to
the present invention, the inventive nucleic acids or the inventive
nucleic acid molecules.
[0189] The finding that short high affinity binding nucleic acids
to human hepcidin could be identified, is insofar surprising as
Eaton et al. (1997) observed that the generation of aptamers, i.e.
D-nucleic acids binding to a target molecule, directed to a basic
protein is in general very difficult because this kind of target
produces a high but non-specific signal-to-noise ratio. This high
signal-to-noise ratio results from the high non-specific affinity
shown by nucleic acids for basic targets such as human
hepcidin.
[0190] As outlined in more detail in the claims and example 1, the
present inventors could more surprisingly identify a number of
different human hepcidin binding nucleic acid molecules, whereby
most of the nucleic acids could be characterised in terms of
stretches of nucleotide which are also referred to herein as Boxes.
The various human hepcidin binding nucleic acid molecules can be
categorised as Type A, Type B and Type C hepcidin binding nucleic
acids based on said Boxes and some additional structural features
and elements, respectively.
[0191] The different types of hepcidin binding nucleic acids
comprise different stretches of nucleotides. Accordingly, the
different types of hepcidin binding nucleic acids show a different
binding behaviour to the different hepcidin peptides. As
demonstrated in the Examples hepcidin binding nucleic acids
according to the present invention bind to human hepcidin-25, human
hepcidin-22, human hepcidin-20, cynomolgus hepcidin-25 and marmoset
hepcidin-25.
[0192] It is to be acknowledged that whenever it is referred herein
to hepcidin, such hepcidin is hepcidin-25, if not indicated to the
contrary.
[0193] It is within the present invention that the nucleic acids
according to the present invention comprise two or more stretches
or part(s) thereof can, in principle, hybridise with each other.
Upon such hybridisation a double-stranded structure is formed. It
will be acknowledged by the ones skilled in the art that such
hybridisation may or may not occur, particularly under in vitro
and/or in vivo conditions. Also, in case of such hybridisation, it
is not necessarily the case that the hybridisation occurs over the
entire length of the two stretches where, at least based on the
rules for base pairing, such hybridisation and thus formation of a
double-stranded structure may, in principle, occur. As preferably
used herein, a double-stranded structure is a part of a nucleic
acid molecule or a structure formed by two or more separate strands
or two spatially separated stretches of a single strand of a
nucleic acid molecule, whereby at least one, preferably two or more
base pairs exist which are base pairing preferably in accordance
with the Watson-Crick base pairing rules. It will also be
acknowledged by the one skilled in the art that other base pairing
such as Hoogsten base pairing may exist in or form such
double-stranded structure. It is also to be acknowledged that the
feature that two stretches hybridize preferably indicates that such
hybridization is assumed to happen due to base complementarity of
the two stretches.
[0194] In a preferred embodiment the term arrangement as used
herein, means the order or sequence of structural or functional
features or elements described herein in connection with the
nucleic acids disclosed herein.
[0195] It will be acknowledged by the person skilled in the art
that the nucleic acids according to the present invention are
capable of binding to hepcidin. Without wishing to be bound by any
theory, the present inventors assume that the hepcidin binding
results from a combination of three-dimensional structural traits
or elements of the claimed nucleic acid molecule, which are caused
by orientation and folding patterns of the primary sequence of
nucleotides forming such traits or elements. It is evident that the
individual trait or element may be formed by various different
individual sequences the degree of variation of which may vary
depending on the three-dimensional structure such element or trait
has to form. The overall binding characteristic of the claimed
nucleic acid results from the interplay of the various elements and
traits, respectively, which ultimately results in the interaction
of the claimed nucleic acid with its target, i. e. hepcidin. Again
without being wished to be bound by any theory, the central stretch
that is characteristic for Type B and Type C hepcidin binding
nucleic acids, and the first stretch Box A and the second stretch
Box B that are characteristic for Type A hepcidin binding nucleic
acids, seem to be important for mediating the binding of the
claimed nucleic acid with hepcidin. Accordingly, the nucleic acids
according to the present invention are suitable for the interaction
with and detection of hepcidin. Also, it will be acknowledged by
the person skilled in the art that the nucleic acids according to
the present invention are antagonists to hepcidin. Because of this
the nucleic acids according to the present invention are suitable
for the treatment and prevention, respectively, of any disease or
condition which is associated with or caused by hepcidin. Such
diseases and conditions may be taken from the prior art which
establishes that hepcidin is involved or associated with said
diseases and conditions, respectively, and which is incoroporated
herein by reference providing the scientific rationale for the
therapeutic and diagnostic use of the nucleic acids according to
the invention.
[0196] It is within the present invention that the nucleic acid
according to the present invention is a nucleic acid molecule.
Insofar the terms nucleic acid and nucleic acid molecule are used
herein in a synonymous manner if not indicated to the contrary. In
one embodiment of the present application the nucleic acid and thus
the nucleic acid molecule comprises a nucleic acid molecule which
is characterized in that all of the consecutive nucleotides forming
the nucleic acid molecule are linked with or connected to each
other by one or more than one covalent bond. More specifically,
each of such nucleotides is linked with or connected to two other
nucleotides, preferably through phosphodiester bonds or other
bonds, forming a stretch of consecutive nucleotides. In such
arrangement, however, the two terminal nucleotides, i.e. preferably
the nucleotide at the 5' end and at the 3' end, are each linked to
a single nucleotide only under the proviso that such arrangement is
a linear and not a circular arrangement and thus a linear rather
than a circular molecule.
[0197] In another embodiment of the present application the nucleic
acid and thus the nucleic acid molecule comprises at least two
groups of consecutive nucleotides, whereby within each group of
consecutive nucleotides each nucleotide is linked with or connected
to two other nucleotides, preferably through phosphodiester bonds
or other bonds, forming a stretch of consecutive nucleotides. In
such arrangement, however, the two terminal nucleotides, i.e.
preferably the nucleotide at the 5' end and at the 3' end, of each
of said at least two groups of consecutive nucleotides are each
linked to a single nucleotide only. In such embodiment, the two
groups of consecutive nucleotides, however, are not linked with or
connected to each other through a covalent bond which links one
nucleotide of one group and one nucleotide of another or the other
group through a covalent bond, preferably a covalent bond formed
between a sugar moiety of one of said two nucleotides and a
phosphor moiety of the other of said two nucleotides or
nucleosides. In an alternative embodiment, the two groups of
consecutive nucleotides, however, are linked with or connected to
each other through a covalent bond which links one nucleotide of
one group and one nucleotide of another or the other group through
a covalent bond, preferably a covalent bond formed between a sugar
moiety of one of said two nucleotides and a phosphor moiety of the
other of said two nucleotides or nucleosides. Preferably, the at
least two groups of consecutive nucleotides are not linked through
any covalent bond. In another preferred embodiment, the at least
two groups are linked through a covalent bond which is different
from a phosphodiester bond. In still another embodiment, the at
least two groups are linked through a covalent bond which is a
phosphodiester bond. Furthermore, preferably, the two groups of
consecutive nucleotides are linked or connected to each other
through a covalent bond whereby the covalent bond is formed between
the nucleotide at the 3'-end of the first of the two groups of
consecutive nucleotides and the nucleotide at the 5'-end of the
second of the two groups of consecutive nucleotides or the covalent
bond is formed between the nucleotide at the 5'-end of the first of
the two groups of consecutive nucleotides and the nucleotide at the
3'-end of the second of the two groups of consecutive
nucleotides.
[0198] The nucleic acids according to the present invention shall
also comprise nucleic acids which are essentially homologous to the
particular sequences disclosed herein. The term substantially
homologous shall preferably be understood such that the homology is
at least 75%, preferably 85%, more preferably 90% and most
preferably more than 95%, 96%, 97%, 98% or 99%.
[0199] The homology between two nucleic acid molecules can be
determined as known to the person skilled in the art. More
specifically, a sequence comparison algorithm may be used for
calculating the percent sequence homology for the test sequence(s)
relative to the reference sequence, based on the designated program
parameters. The test sequence is preferably the sequence or nucleic
acid molecule which is said to be homologous or to be tested
whether it is homologous, and if so, to what extent, to a different
nucleic acid molecule, whereby such different nucleic acid molecule
is also referred to as the reference sequence. In an embodiment,
the reference sequence is a nucleic acid molecule as described
herein, more preferably a nucleic acid molecule having a sequence
according to any one of SEQ.ID.No. 29 to 43, SEQ.ID.No. 45 to 48,
SEQ.ID.No. 110 to 156, SEQ.ID.No. 158 to 176 or SEQ.ID.No. 179 to
181. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman (Smith & Waterman, 1981) by the homology alignment
algorithm of Needleman & Wunsch (Needleman & Wunsch, 1970)
by the search for similarity method of Pearson & Lipman
(Pearson & Lipman, 1988), by computerized implementations of
these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Dr., Madison, Wis.), or by visual inspection.
[0200] One example of an algorithm that is suitable for determining
percent sequence identity is the algorithm used in the basic local
alignment search tool (hereinafter "BLAST"), see, e.g. Altschul et
al (Altschul et al. 1990 and Altschul et al, 1997). Software for
performing BLAST analyses is publicly available through the
National Center for Biotechnology Information (hereinafter "NCBI").
The default parameters used in determining sequence identity using
the software available from NCBI, e.g., BLASTN (for nucleotide
sequences) and BLASTP (for amino acid sequences) are described in
McGinnis et al (McGinnis et al., 2004).
[0201] The term inventive nucleic acid or nucleic acid according to
the (present) invention, whereby both terms are used in an
interchangeable manner, shall also comprise those nucleic acids
comprising the nucleic acids sequences disclosed herein or part
thereof, preferably to the extent that the nucleic acids or said
parts are involved in the binding to human hepcidin. Such nucleic
acid is, in an embodiment, one of the nucleic acid molecules
described herein, or a derivative and/or a metabolite thereof,
whereby such derivative and/or metabolite are preferably a
truncated nucleic acid compared to the nucleic acid molecules
described herein.
[0202] Truncation may be related to either or both of the ends of
the nucleic acids as disclosed herein. Also, truncation may be
related to the inner sequence of nucleotides of the nucleic acid,
i.e. it may be related to the nucleotide(s) between the 5' and the
3' terminal nucleotide, respectively. Moreover, truncation shall
comprise the deletion of as little as a single nucleotide from the
sequence of the nucleic acids disclosed herein. Truncation may also
be related to more than one stretch of the inventive nucleic
acid(s), whereby the stretch can be as little as one nucleotide
long. The binding of a nucleic acid according to the present
invention can be determined by the ones skilled in the art using
routine experiments or by using or adopting a method as described
herein, preferably as described herein in the example part.
[0203] The nucleic acids according to the present invention may be
either D-nucleic acids or L-nucleic acids. Preferably, the
inventive nucleic acids are L-nucleic acids. In addition it is
possible that one or several parts of the nucleic acid are present
as D-nucleic acids or at least one or several parts of the nucleic
acids are L-nucleic acids. The term "part" of the nucleic acids
shall mean as little as one nucleotide. Therefore, in a
particularly preferred embodiment, the nucleic acids according to
the present invention consist of L-nucleotides and comprise at
least one D-nucleotide. Such D-nucleotide is preferably attached to
a part different from the stretches defining the nucleic acids
according to the present invention, preferably those parts thereof,
where an interaction with other parts of the nucleic acid or with
the target, i.e. hepcidin, is involved. Preferably, such
D-nucleotide is attached at a terminus of any of the stretches or
at a terminus of any nucleic acid according to the present
invention, respectively. In a further preferred embodiment, such
D-nucleotides may act as a spacer or a linker, preferably attaching
modifications or modification groups, such as PEG and HES to the
nucleic acids according to the present invention.
[0204] It is also within an embodiment of the present invention
that each and any of the nucleic acid molecules described herein in
their entirety in terms of their nucleic acid sequence(s) are
limited to the particular nucleotide sequence(s). In other words,
the terms "comprising" or "comprise(s)" shall be interpreted in
such embodiment in the meaning of containing or consisting of.
[0205] It is also within the present invention that the nucleic
acids according to the present invention are part of a longer
nucleic acid whereby this longer nucleic acid comprises several
parts whereby at least one such part is a nucleic acid according to
the present invention, or a part thereof. The other part(s) of
these longer nucleic acids can be either one or several D-nucleic
acid(s) or one or several L-nucleic acid(s). Any combination may be
used in connection with the present invention. These other part(s)
of the longer nucleic acid either alone or taken together, either
in their entirety or in a particular combination, can exhibit a
function which is different from binding, preferably from binding
to hepcidin. One possible function is to allow interaction with
other molecules, whereby such other molecules preferably are
different from hepcidin, such as, e.g., for immobilization,
cross-linking, detection or amplification. In a further embodiment
of the present invention the nucleic acids according to the
invention comprise, as individual or combined moieties, several of
the nucleic acids of the present invention. Such nucleic acid
comprising several of the nucleic acids of the present invention is
also encompassed by the term longer nucleic acid.
[0206] L-nucleic acids or L-nucleic acid molecules as used herein
are nucleic acids or nucleic acid molecules consisting of
L-nucleotides, preferably consisting completely of
L-nucleotides.
[0207] D-nucleic acids or D-nucleic acid molecules as used herein
are nucleic acids or nucleic acid molecules consisting of
D-nucleotides, preferably consisting completely of
D-nucleotides.
[0208] Also, if not indicated to the contrary, any nucleotide
sequence is set forth herein in 5'->3' direction.
[0209] As preferably used herein any position of a nucleotide is
determined or referred to relative to the 5' end of a sequence, a
stretch or a substretch. Accordingly, a second nucleotide is the
second nucleotide counted from the 5' end of the sequence, stretch
and substretch, respectively. Also, in accordance therewith, a
penultimate nucleotide is the second nucleotide counted from the 3'
end of a sequence, stretch and substretch, respectively.
[0210] Irrespective of whether the inventive nucleic acid consists
of D-nucleotides, L-nucleotides or a combination of both with the
combination being e.g. a random combination or a defined sequence
of stretches consisting of at least one L-nucleotide and at least
one D-nucleic acid, the nucleic acid may consist of
desoxyribonucleotide(s), ribonucleotide(s) or combinations
thereof.
[0211] Designing the inventive nucleic acids as L-nucleic acids is
advantageous for several reasons. L-nucleic acids are enantiomers
of naturally occurring nucleic acids. D-nucleic acids, however, are
not very stable in aqueous solutions and particularly in biological
systems or biological samples due to the widespread presence of
nucleases. Naturally occurring nucleases, particularly nucleases
from animal cells are not capable of degrading L-nucleic acids.
Because of this the biological half-life of the L-nucleic acid is
significantly increased in such a system, including the animal and
human body. Due to the lacking degradability of L-nucleic acids no
nuclease degradation products are generated and thus no side
effects arising therefrom observed. This aspect delimits the
L-nucleic acids of factually all other compounds which are used in
the therapy of diseases and/or disorders involving the presence of
hepcidin. L-nucleic acids which specifically bind to a target
molecule through a mechanism different from Watson Crick base
pairing, or aptamers which consists partially or completely of
L-nucleotides, particularly with those parts of the aptamer being
involved in the binding of the aptamer to the target molecule, are
also called Spiegelmers. Aptamers as such are known to a person
skilled in the art and are, among others, described in `The Aptamer
Handbook` (eds. Klussmann, 2006).
[0212] It is also within the present invention that the nucleic
acids according to the invention, regardless whether they are
present as D-nucleic acids, L-nucleic acids or D, L-nucleic acids
or whether they are DNA or RNA, may be present as single-stranded
or double-stranded nucleic acids. Typically, the inventive nucleic
acids are single-stranded nucleic acids which exhibit defined
secondary structures due to the primary sequence and may thus also
form tertiary structures. The inventive nucleic acids, however, may
also be double-stranded in the meaning that two strands regardless
whether they are two separate strands or whether they are bound,
preferably covalently, to each other, which are complementary or
partially complementary to each other are hybridised to each
other.
[0213] The inventive nucleic acids may be modified. Such
modifications may be related to a single nucleotide of the nucleic
acid and are well known in the art. Examples for such modification
are described in, among others, Venkatesan (2003); Kusser (2000);
Aurup (1994); Cummins (1995); Eaton (1995); Green (1995); Kawasaki
(1993); Lesnik (1993); and Miller (1993). Such modification can be
a H atom, a F atom or O--CH3 group or NH2-group at the 2' position
of an individual nucleotide which is part of the nucleic acid of
the present invention. Also, the nucleic acid according to the
present invention can comprises at least one LNA nucleotide. In an
embodiment the nucleic acid according to the present invention
consists of LNA nucleotides.
[0214] In an embodiment, the nucleic acids according to the present
invention may be a multipartite nucleic acid. A multipartite
nucleic acid as used herein, is a nucleic acid which consists of at
least two separate nucleic acid strands. These at least two nucleic
acid strands form a functional unit whereby the functional unit is
a ligand to a target molecule. The at least two nucleic acid
strands may be derived from any of the inventive nucleic acids by
either cleaving the nucleic acid molecule to generate two strands
or by synthesising one nucleic acid corresponding to a first part
of the inventive, i.e. overall nucleic acid and another nucleic
acid corresponding to the second part of the overall nucleic acid.
It is to be acknowledged that both the cleavage and the synthesis
may be applied to generate a multipartite nucleic acid where there
are more than two strands as exemplified above. In other words, the
at least two separate nucleic acid strands are typically different
from two strands being complementary and hybridising to each other
although a certain extent of complementarity between said at least
two separate nucleic acid strands may exist and whereby such
complementarity may result in the hybridisation of said separate
strands.
[0215] Finally it is also within the present invention that a fully
closed, i.e. circular structure for the nucleic acids according to
the present invention is realized, i.e. that the nucleic acids
according to the present invention are closed in an embodiment,
preferably through a covalent linkage, whereby more preferably such
covalent linkage is made between the 5' end and the 3' end of the
nucleic acid sequences as disclosed herein or any derivative
thereof.
[0216] A possibility to determine the binding constants of the
nucleic acid molecules according to the present invention is the
use of surface plasmon resonance as described in example 4 which
confirms the above finding that the nucleic acids according to the
present invention exhibit a favourable K.sub.D value range. An
appropriate measure in order to express the intensity of the
binding between the individual nucleic acid molecule and the target
which is in the present case hepcidin, is the so-called K.sub.D
value which as such as well the method for its determination are
known to the one skilled in the art.
[0217] Preferably, the K.sub.D value shown by the nucleic acids
according to the present invention is below 1 .mu.M. A K.sub.D
value of about 1 .mu.M is said to be characteristic for a
non-specific binding of a nucleic acid to a target. As will be
acknowledged by the ones skilled in the art, the K.sub.D value of a
group of compounds such as the nucleic acids according to the
present invention is within a certain range. The above-mentioned
K.sub.D of about 1 .mu.M is a preferred upper limit for the K.sub.D
value. The lower limit for the K.sub.D of target binding nucleic
acids can be as little as about 10 picomolar or can be higher. It
is within the present invention that the K.sub.D values of
individual nucleic acids binding to hepcidin is preferably within
this range. Preferred ranges can be defined by choosing any first
number within this range and any second number within this range.
Preferred upper K.sub.D values are 250 nM and 100 nM, preferred
lower K.sub.D values are 50 nM, 10 nM, 1 nM, 100 pM and 10 pM. The
more preferred upper K.sub.D value is 2.5 nM, the more preferred
lower K.sub.D value is 400 pM.
[0218] The nucleic acid molecules according to the present
invention may have any length provided that they are still able to
bind to the target molecule. It will be acknowledged by a person
skilled in the art that there are preferred lengths for the nucleic
acids according to the present inventions. Typically, the length is
between 15 and 120 nucleotides. It will be acknowledged by the ones
skilled in the art that any integer between 15 and 120 is a
possible length for the nucleic acids according to the present
invention. More preferred ranges for the length of the nucleic
acids according to the present invention are lengths of about 20 to
100 nucleotides, about 20 to 80 nucleotides, about 20 to 60
nucleotides, about 20 to 50 nucleotides and about 30 to 50
nucleotides.
[0219] It is within the present invention that the nucleic acids
disclosed herein comprise a moiety which preferably is a high
molecular weight moiety and/or which preferably allows to modify
the characteristics of the nucleic acid in terms of, among others,
residence time in an animal body, preferably a human body. A
particularly preferred embodiment of such modification is
PEGylation and HESylation of the nucleic acids according to the
present invention. As used herein PEG stands for poly(ethylene
glycole) and HES for hydroxyethly starch. PEGylation as preferably
used herein is the modification of a nucleic acid according to the
present invention whereby such modification consists of a PEG
moiety which is attached to a nucleic acid according to the present
invention. HESylation as preferably used herein is the modification
of a nucleic acid according to the present invention whereby such
modification consists of a HES moiety which is attached to a
nucleic acid according to the present invention. The modifications
such as linear poly (ethylene) glycol, branched poly (ethylene)
glycol, hydroxyethyl starch, a peptide, a protein, a
polysaccharide, a sterol, polyoxypropylene, polyoxyamidate, poly
(2-hydroxyethyl)-L-glutamine and polyethylene glycol as well as the
process of modifying a nucleic acid using such modifications, are
described in European patent application EP 1 306 382, the
disclosure of which is herewith incorporated in its entirety by
reference.
[0220] Preferably, the molecular weight of a modification
consisting of or comprising a high molecular weight moiety is about
from 2,000 to 250,000 Da, preferably 20,000 to 200,000 Da. In the
case of PEG being such high molecular weight moiety the molecular
weight is preferably 20,000 to 120,000 Da, more preferably 40,000
to 80,000 Da. In the case of HES being such high molecular weight
moiety the molecular weight is preferably 20,000 to 200,000 Da,
more preferably 40,000 to 150,000 Da. The process of HES
modification is, e.g., described in German patent application DE 1
2004 006 249.8 the disclosure of which is herewith incorporated in
its entirety by reference.
[0221] It is within the present invention that either of PEG and
HES may be used as either a linear or branched form as further
described in patent applications WO2005/074993 WO2003/035665 and
EP1496076. Such modification can, in principle, be made to the
nucleic acid molecules of the present invention at any position
thereof. Preferably such modification is made either to the
5'-terminal nucleotide, the 3'-terminal nucleotide and/or any
nucleotide between the 5' nucleotide and the 3' nucleotide of the
nucleic acid molecule according to the invention.
[0222] The modification and preferably the PEG and/or HES moiety
can be attached to the nucleic acid molecule of the present
invention either directly or indirectly, preferably through a
linker. It is also within the present invention that the nucleic
acid molecule according to the present invention comprises one or
more modifications, preferably one or more PEG and/or HES moiety.
In an embodiment the individual linker molecule attaches more than
one PEG moiety or HES moiety to a nucleic acid molecule according
to the present invention. The linker used in connection with the
present invention can itself be either linear or branched. This
kind of linkers are known to the ones skilled in the art and are
further described in patent applications WO2005/074993,
WO2003/035665 and EP1496076.
[0223] In a preferred embodiment the linker is a biodegradable
linker. The biodegradable linker allows to modify the
characteristics of the nucleic acid according to the present
invention in terms of, among other, residence time in an animal
body, preferably in a human body, due to release of the
modification from the nucleic acid according to the present
invention. Usage of a biodegradable linker may allow a better
control of the residence time of the nucleic acid according to the
present invention. A preferred embodiment of such biodegradable
linker is a biodegradable linker as described in, but not limited
to, international patent applications WO2006/052790, WO2008/034122,
WO2004/092191 and WO2005/099768.
[0224] It is within the present invention that the modification or
modification group is a biodegradable modification, whereby the
biodegradable modification can be attached to the nucleic acid
molecule of the present invention either directly or indirectly,
preferably through a linker. The biodegradable modification allows
to modify the characteristics of the nucleic acid according to the
present invention in terms of, among other, residence time in an
animal body, preferably in a human body, due to release or
degradation of the modification from the nucleic acid according to
the present invention. Usage of biodegradable modification may
allow a better control of the residence time of the nucleic acid
according to the present invention. A preferred embodiment of such
biodegradable modification is biodegradable as described in, but
not restricted to, international patent applications WO2002/065963,
WO2003/070823, WO2004/113394 and WO2000/41647, preferably in
WO2000/41647, page 18, line 4 to 24.
[0225] Beside the modifications as described above, other
modifications can be used to modify the characteristics of the
nucleic acids according to the present invention, whereby such
other modifications may be selected from the group of proteins,
lipids such as cholesterol and sugar chains such as amylase,
dextran etc.
[0226] Without wishing to be bound by any theory, it seems that by
modifying the nucleic acids according to the present invention with
high molecular weight moiety such as a polymer and more
particularly one or several of the polymers disclosed herein, which
are preferably physiologically acceptable, the excretion kinetic is
changed. More particularly, it seems that due to the increased
molecular weight of such modified inventive nucleic acids and due
to the nucleic acids of the invention not being subject to
metabolism particularly when in the L form, excretion from an
animal body, preferably from a mammalian body and more preferably
from a human body is decreased. As excretion typically occurs via
the kidneys, the present inventors assume that the glomerular
filtration rate of the thus modified nucleic acids is significantly
reduced compared to the nucleic acids not having this kind of high
molecular weight modification which results in an increase in the
residence time in the animal body. In connection therewith it is
particularly noteworthy that, despite such high molecular weight
modification the specificity of the nucleic acids according to the
present invention is not affected in a detrimental manner. Insofar,
the nucleic acids according to the present invention have among
others, the surprising characteristic--which normally cannot be
expected from pharmaceutically active compounds--such that a
pharmaceutical formulation providing for a sustained release is not
necessarily required to provide for a sustained release of the
nucleic acids according to the present invention. Rather the
nucleic acids according to the present invention in their modified
form comprising a high molecular weight moiety, can as such already
be used as a sustained release-formulation as they act, due to
their modification, already as if they were released from a
sustained-release formulation. Insofar, the modification(s) of the
nucleic acid molecules according to the present invention as
disclosed herein and the thus modified nucleic acid molecules
according to the present invention and any composition comprising
the same may provide for a distinct, preferably controlled
pharmacokinetics and biodistribution thereof. This also includes
residence time in circulation and distribution to tissues. Such
modifications are further described in the patent application
WO2003/035665.
[0227] However, it is also within the present invention that the
nucleic acids according to the present invention do not comprise
any modification and particularly no high molecular weight
modification such as PEGylation or HESylation. Such embodiment is
particularly preferred when the nucleic acid according to the
present invention shows preferential distribution to any target
organ or tissue in the body or when a fast clearance of the nucleic
acid according to the present invention from the body after
administration is desired. Nucleic acids according to the present
invention as disclosed herein with a preferential distribution
profile to any target organ or tissue in the body would allow
establishment of effective local concentrations in the target
tissue while keeping systemic concentration of the nucleic acids
low. This would allow the use of low doses which is not only
beneficial from an economic point of view, but also reduces
unnecessary exposure of other tissues to the nucleic acid agent,
thus reducing the potential risk of side effects. Fast clearance of
the nucleic acids according to the present invention from the body
after administration might be desired, among others, in case of in
vivo imaging or specific therapeutic dosing requirements using the
nucleic acids according to the present invention or medicaments
comprising the same.
[0228] The nucleic acids according to the present invention and/or
the antagonists according to the present invention may be used for
or in the generation or manufacture of a medicament or
pharmaceutical composition. Such medicament or a pharmaceutical
composition according to the present invention contains at least
one of the inventive nucleic acids, optionally together with at
least one further pharmaceutically active compound, whereby the
inventive nucleic acid preferably acts as pharmaceutically active
compound itself. Such medicament or pharmaceutical composition
comprises in a preferred embodiment at least a pharmaceutically
acceptable carrier. Such carrier may be, e.g., water, buffer, PBS,
glucose solution, preferably a 5% glucose salt balanced solution,
starch, sugar, gelatine or any other acceptable carrier substance.
Such carriers are generally known to the one skilled in the art. It
will be acknowledged by the person skilled in the art that any
embodiments, use and aspects of or related to the medicament of the
present invention is also applicable to the pharmaceutical
composition of the present invention and vice versa.
[0229] The indication, diseases and disorders for the treatment
and/or prevention of which the nucleic acids, the pharmaceutical
compositions and medicaments each in accordance with or prepared in
accordance with the present invention are used or are intended to
be used, result from the involvement, either direct or indirect, of
hepcidin in the respective pathogenetic mechanism.
[0230] As mentioned in the introductory part, hepcidin is the key
signal regulating iron homeostasis whereas high levels of human
hepcidin result in reduced serum iron levels and low levels result
in increased serum iron levels as shown in hepcidin-deficiency and
hepcidin overexpressing mouse models (Nicolas, 2001; Nicolas, 2002;
Nicolas, 2003).
[0231] As also mentioned herein, binding of hepcidin to ferroportin
results in immediate internalisation of ferroportin and a
subsequent and long lasting decrease of serum iron (Rivera, 2005),
whereby the decrease of serum iron is a cause of anemia. Anemia is
defined as an absolute reduction in the quantity of haemoglobin in
the circulating blood and is often a symptom of a disease
manifested by low haemoglobin and not an isolated diagnosis in
itself. Anemia results from a medical condition that negatively
impairs production and/or lifespan of red blood cells.
Additionally, anemia can be a result of blood loss.
[0232] Therefore and to understand the development of anemia, based
on the underlying mechanism anemia is grouped into three etiologic
categories: [0233] a) decreased red blood cell production, [0234]
b) increased red blood cell destruction, and [0235] c) blood
loss.
[0236] However, the three categories--decreased red blood cell
production, increased red blood cell destruction and blood
loss--are not strictly separated from each other but can occur
concomitantly or independently from each other.
[0237] In many diseases a combination of said mechanisms can lead
to anemia. Thus, neutralisation of hepcidin might be beneficial in
many conditions of anemia.
[0238] As the hepcidin binding nucleic acids according to the
present invention interact with or bind to human hepcidin, a
skilled person will understand that the hepcidin binding nucleic
acids according to the present invention can be used for the
treatment, prevention and/or diagnosis of any disease of humans and
animals as described herein. In connection therewith, it is to be
acknowledged that the nucleic acid molecules according to the
present invention can be used for the treatment and prevention of
any of the diseases, disorders or conditions described herein.
[0239] In the following, and without wishing to be bound by any
theory, the rationale for the use of the nucleic acid molecules
according to the present invention in connection with the various
diseases, disorders and conditions is provided, thus rendering the
claimed therapeutic, preventive and diagnostic applicability of the
nucleic acid molecules according to the present invention
plausible. In order to avoid any unnecessary repetition, it should
be acknowledged that due to the involvement of the
hepcidin--ferroportin interaction as known to a person skilled in
the art and as also outlined herein said interaction may be
addressed by the nucleic acid molecules according to the present
invention such that the claimed therapeutic and/or preventive
effect is achieved.
[0240] Accordingly, diseases and/or disorders and/or diseased
conditions for the treatment and/or prevention of which the
medicament according to the present invention may be used include,
but are not limited to anemia, hypoferremia, pica, conditions with
elevated hepcidin level, conditions with elevated iron level and/or
conditions with iron overload.
[0241] Preferably anemia is selected from the group of
sideroblastic anemia, hypochromic microcytic anemia, anemia caused
by chronic disease and/or disorder, anemia caused by inflammation,
anemia caused by genetic disorders, anemia caused by acute
infections and/or anemia caused by mutation in genes of iron
metabolism and/or homeostasis.
[0242] The various chronic diseases and/or disorders that can cause
anemia are selected from the group of chronic inflammation, cancer,
autoimmune disease and/or autoimmune disorder, chronic infection,
arteriosclerosis, atherosclerosis, and cirrhosis of the liver.
Insofar, anemia which may be treated by a nucleic acid of the
present invention, is an anemia which is caused by or associated
with any one of said various chronic diseases and/or disorders.
Moreover anemia can be one which is caused by cancer treatment,
preferably chemotherapy.
[0243] Subgroups of chronic inflammation are chronic kidney
disease, chronic obstructive pulmonary disease, multiple sclerosis,
osteoarthritis, diabetes, obesity, cerebrovascular disease,
congestive heart disease, congestive heart failure, myocardial
infarction, coronary artery disease, peripheral occlusive arterial
disease, pancreatitis, vasculitis, whereby such chronic kidney
disease comprises renal disease, chronic renal failure, chronic
kidney failure and/or caused by kidney dialysis, or kidney
transplantation.
[0244] Subgroups of cancer are hepatocellular carcinoma, lymphoma,
multiple myeloma, head-and-neck cancer, breast cancer, colarectal
cancer, nonmyeloid cancers, renal cell carcinoma, non-small-cell
lung cancer, tumors and brain tumors.
[0245] Subgroups of autoimmune diseases and/or disorders are
rheumatoid arthritis, irritable bowel syndrome, systemic lupus
erythrematosus and Chrohn's disease.
[0246] Subgroups of chronic infection are viral infections, viral
illness, bacterial infections and fungal infections, whereby the
viral infections comprise, but are not limited to, hepatitis and
HIV infection and the bacterial infections comprise, but are not
limited to, H. pylori infection.
[0247] Anemia caused by inflammation is normocytic to microcytic,
characterised by a low reticulocyte production index, total iron
binding capacity (TIBC) is low or normal. Hepcidin, acute phase
proteins and other markers of inflammation (for example: C-reactive
protein) are increased in the case of anemia caused by
inflammation. Anemia caused by inflammation is also referred to as
anemia by inflammation.
[0248] The various genetic disorders that can cause anemia are
selected from the group of the Castleman disease, Schnitzler's
syndrome, iron refractory iron deficiency anemia (matriptase-2
(TMPRSS6) mutation, atransferrinemia, congenital dyserythropoietic
anemia and hemoglobinopathies
[0249] The various acute infection that can cause anemia are
selected from the group of viral infection, bacterial infection and
fungal infection, whereby viral infection, bacterial infection and
fungal infection individually or in combination with each other can
lead to sepsis.
[0250] The term "conditions with elevated hepcidin level" refers to
a condition in a mammal, preferably a human, wherein the level of
hepcidin in the body is elevated compared to the normal level of
hepcidin for such a mammal, such as an elevated hepcidin serum
level compared to the normal hepcidin serum level for the mammal
(approximately 120 ngL/mL in case of a human being). Elevated serum
hepcidin levels can, among others, be determined by enzyme-linked
immunoassay (commercially available kit by DRG Diagonstics,
Marburg, Germany).
[0251] Accordingly, the patients for which the medicament according
to the present invention may preferably be used include, but are
not limited to patients which are treated with erythropoietin and
other red cell stimulating therapies and preferably show a
hypo-responsiveness to erythropoietin, whereby more preferably the
patients have a chronic kidney disease or suffering from cancer,
whereby cancer is selected from the group of hepatocellular
carcinoma, lymphoma, multiple myeloma, head-and-neck cancer, breast
cancer, colarectal cancer, nonmyeloid cancers, renal cell
carcinoma, non-small-cell lung cancer, tumors and brain tumors.
[0252] In a further embodiment, the medicament according to the
invention comprises a further pharmaceutically active compound.
Such further pharmaceutically active compound is preferably one
that can modulate the activity, concentration or expression of
hepcidin or ferroportin. Such compound is preferably a pro-hepcidin
cleaving protease inhibitor, a pro-hepcidin antibody, a
ferroportin-antagonist such as, e.g. a ferroportin-antibody, a JAK2
inhibitor, GDF15, a BMP modulator, a soluble haemojuvelin or
TGF-beta inhibitor.
[0253] Other further pharmaceutically active compounds which may be
used together with or contained in the medicament comprising a
nucleic acid according to the invention are those that are known
and/or used for treating anemia and/or inflammatory conditions,
whereby the treatment of the inflammatory conditions positively
influences anemia. Such pharmaceutically active compounds are
selected from the group comprising iron supplements, vitamin
supplements, red cell production stimulators, antibiotics,
anti-inflammatory biologics, suppressors of the immune system,
anti-thrombolytics, statins, vasopressors and inotropic
compounds.
[0254] Non-limiting examples of iron supplements are ferrous
sulphate, ferrous gluconate, iron dextran, sodium ferric gluconate,
ferric carboxymaltose, iron-hydroxide polymaltose, iron fumarat,
iron saccharose and iron-hydroxide sucrose.
[0255] Non-limiting examples of vitamin supplements are vitamin C,
folic acid, vitamin B12, vitamin B6 and vitamin D
[0256] Non-limiting examples of red cell production stimulators are
erythropoietin, Epoetin, Darbepoetin, CERA, HIF prolyl-hydroxylase
inhibitors (for example FG-2216 and FG-4592) and other
erythropoiesis stimulating agents.
[0257] Non-limiting examples of antibiotics are aminoglycosides,
beta-lactam antibiotics, eptide antibiotics, gryase inhibitors,
lincosamide, macrolide antibiotics, nitroimidazole derivates,
polypeptide antibiotics, sulfonamides, tetracycline and
trimethoprim.
[0258] Non-limiting examples of anti-inflammatory biologics are
[0259] a) IL-6-receptor antagonists such as, e.g., Tocilizumab or
Atlizumab, [0260] b) TNF-antagonists such as, e.g., Etanercept,
Infliximab, Adalimumab, Certolizumab, [0261] c) IL-1 receptor
antagonists such as, e.g., Anakinra, and [0262] d) CD20 binding
molecules such as, e.g., Rituximab and Ibritumab.
[0263] Non-limiting examples of suppressors of the immune system
are azathioprin, brequinar, calcineurin inhibitors, chlorambucil,
cyclosporin A, deoxyspergualin, leflunomide, methotrexate,
mizoribin, mycophenolate mofetil, rapamycin, tacrolimus and
thalidomide.
[0264] Non-limiting examples of anti-inflammatory agents are PDE4
inhibitors such as roflumilast and corticosteroids such as
prednisolone, methylprednisolone, hydrocortisone, dexamethason,
triamcinolone, betamethasone, effervescent, budesonide, ciclesonide
and fluticasone.
[0265] Non-limiting of anti-thrombolytics are activated human
protein C such as Drotrecogin alfa.
[0266] Non-limiting examples of statins are Atorvastatin,
Cerivastatin, Fluvastatin, Lovastatin, Mevastatin, Pitavastatin,
Pravastatin, Rosuvastatin and Simvastatin.
[0267] Non-limiting examples of vasopressors and/or inotropic
compounds are noradrenalin, vasopressin and dobutamin.
[0268] In addition to situations with elevated hepcidin plasma
level, the nucleic molecules according to the present invention can
also be used to antagonize hepcidin in patients with elevated iron
level and/or conditions with iron overload and non-elevated
hepcidin plasma level. The treatment of such patients with the
nucleic molecules according to the present invention is preferably
done in order to decrease cellular iron concentration, whereby the
treatment is preferably in combination with iron chelating
compounds. The neutralisation of physiological hepcidin by the
nucleic acid according to the present invention protects
ferroportin expression and thereby supports a further iron release
from intracellular stores. Ferroportin protection in combination
with iron chelating compounds eliminates iron via the urin and
reduces the of whole body iron content.
[0269] In medical art, iron overload indicates accumulation of iron
in the body due to any cause. Characteric for iron overload is a
total body content of >5 mg iron in case of man. Iron overload
is also referred to as hemochromatosis.
[0270] The term "conditions with iron overload" refers to a
condition in a mammal, preferably a human, wherein the level of
iron in the mammalian body is elevated compared to the normal level
of iron for such a mammal, such as an elevated iron serum level
compared to the normal iron serum level for the mammal
(approximately 20 .mu.mol/L in case of a human being) or an
increased level of iron in the liver of the mammal as compared to
the normal level of iron in the liver in the mammal. Elevated serum
iron levels can be determined by direct measurement of serum iron
using, among others, a colorimetric assay, by the standard
transferrin saturation assay (which reveals how much iron is bound
to the protein that carries iron in the blood), or by the standard
serum ferritin assay (for example: Ferritin Blood Test ELISA kit
form Calbiotech, USA). For example, transferrin saturation levels
of 45% or higher are usually indicative of abnormally high levels
of iron in the serum. Elevated iron levels in the liver can, among
others, be determined measuring the iron content of the liver from
tissue obtained by a liver biopsy or by imaging technique such as
MRI and/or SQUID. The degree of iron levels in other tissues such
as e.g. brain, heart may also be estimated using these and other
imaging techniques.
[0271] Subgroups of iron overload are transfusional iron overload,
iron intoxication, pulmonary hemosiderosis, osteopenia, insulin
resistense, African iron overload, Hallervordan Spatz disease,
hyperferritinemia, ceruloplasmin deficiency, neonatal
hemochromatosis and red blood cell disorders comprising
thalassemia, alpha thalassemia, thalassemia intermedia, sickle cell
disease and myelodyplastic syndrome.
[0272] Patients suffering from other disorders/disease associated
with elevated iron level should also benefit from a therapy with
the nucleic molecules according to the present invention,
preferably in combination with an iron chelating compound.
Accordingly, disease and/or disorders and/or diseased conditions
for the treatment and/or prevention of which the medicament
according to the present invention may be used include, but are not
limited to disease with elevated iron level, comprising ataxia,
Friedrich's ataxia, age-related macular degeneration, age-related
cataract, age-related retinal diseases and neurodegenrative
disease, whereby such neurodegenrative disease comprises
Alzheimer's disease, Parkinson's disease, pantothenate
kinase-associated neurodegeneration, restless leg syndrome and
Huntington's disease.
[0273] In a further embodiment, the medicament according to the
invention comprises a further pharmaceutically active compound
which is preferably one that can bind iron and removes iron from
tissue or from circulation of an mammalian body and a human body in
particular. Such pharmaceutically active compound is preferably
selected from the group of iron chelating compounds. Combination of
such a compound with a nucleic acid molecule according to the
present invention will further reduce the physiological hepcidin
concentration and thereby reduce cellular iron load.
[0274] Non-limiting examples iron chelating compounds are curcumin,
deferoxamine, deferasirox and deferiprone.
[0275] Finally, the further pharmaceutically active agent may be a
modulator of the iron metabolism and/or iron homeostasis.
Alternatively, or additionally, such further pharmaceutically
active agent is a further, preferably a second species of the
nucleic acids according to the present invention. Alternatively,
the medicament comprises at least one more nucleic acid which binds
to a target molecule different from hepcidin or exhibits a function
which is different from the one of the nucleic acids according to
the present invention. Preferably such at least one more nucleic
acid exhibits a function similar or identical to the one of the one
or several of the further pharmaceutically active compound(s)
disclosed herein.
[0276] It is within the present invention that the medicament
comprising a nucleic acid according to the invention, also referred
to herein as the medicament of the (present) invention, is
alternatively or additionally used, in principle, for the
prevention of any of the disease disclosed in connection with the
use of the medicament for the treatment of said diseases.
Respective markers therefore, i.e. for the respective diseases are
known to the ones skilled in the art. Preferably, the respective
marker is hepcidin.
[0277] In one embodiment of the medicament of the present
invention, such medicament is for use in combination with other
treatments for any of the diseases disclosed herein, particularly
those for which the medicament of the present invention is to be
used.
[0278] "Combination therapy" or "co-therapy" as preferably used
herein, includes the administration of a medicament of the
invention and at least a second agent as part of a treatment
regimen intended to provide a beneficial effect from the co-action
of these therapeutic agents, i. e. the medicament of the present
invention and said second agent. Administration of these
therapeutic agents as or in combination typically is carried out
over a defined time period (usually minutes, hours, days or weeks
depending upon the combination selected).
[0279] "Combination therapy" may, but generally is not, intended to
encompass the administration of two or more of therapeutic agents
as part of separate monotherapy regimens that incidentally and
arbitrarily result in the combinations of the present invention.
"Combination therapy" is intended to embrace administration of
these therapeutic agents in a sequential manner, that is, wherein
each therapeutic agent is administered at a different time, as well
as administration of these therapeutic agents, or at least two of
the therapeutic agents, in a substantially simultaneous manner.
Substantially simultaneous administration can be accomplished, for
example, by administering to a subject a single capsule having a
fixed ratio of each therapeutic agent or in multiple, single
capsules for each of the therapeutic agents.
[0280] Sequential or substantially simultaneous administration of a
therapeutic agent can be effected by any appropriate route
including, but not limited to, topical routes, oral routes,
intravenous routes, intramuscular routes, and direct absorption
through mucous membrane tissues. The therapeutic agents can be
administered by the same route or by different routes. For example,
a first therapeutic agent of a specific combination of
therapeutically effective agents may be administered by injection
while the or an other therapeutic agent of the combination may be
administered topically.
[0281] Alternatively, for example, all therapeutic agents may be
administered topically or all therapeutic agents may be
administered by injection. The sequence in which the therapeutic
agents are administered is not critical unless noted otherwise.
Where the combination therapy further comprises a non-drug
treatment, the non-drug treatment may be conducted at any suitable
time as long as a beneficial effect from the combination of the
therapeutic agents and the non-drug treatment is achieved. For
example, in appropriate cases, the beneficial effect may still be
achieved when the non-drug treatment is temporally stayed, perhaps
by days or even weeks whereas the therapeutic agents are still
administered.
[0282] As outlined in general terms above, the medicament according
to the present invention can be administered, in principle, in any
form known to the ones skilled in the art. A preferred route of
administration is systemic administration, more preferably by
parenteral administration, preferably by injection. Alternatively,
the medicament may be administered locally. Other routes of
administration comprise intramuscular, intraperitoneal,
subcutaneous, per orum, intranasal, intratracheal and pulmonary
with preference given to the route of administration that is the
least invasive while ensuring efficiency.
[0283] Parenteral administration is generally used for
subcutaneous, intramuscular or intravenous injections and
infusions. Additionally, one approach for parenteral administration
employs the implantation of a slow-release or sustained-released
systems, which assures that a constant level of dosage is
maintained and which are well known to the ordinary skill in the
art.
[0284] Furthermore, preferred medicaments of the present invention
can be administered by the intranasal route via topical use of
suitable intranasal vehicles, inhalants, or via transdermal routes,
using those forms of transdermal skin patches well known to those
of ordinary skill in that art. To be administered in the form of a
transdermal delivery system, the dosage administration will
typically be continuous rather than intermittent throughout the
dosage regimen. Other preferred topical preparations include
creams, ointments, lotions, aerosol sprays and gels, wherein the
concentration of active ingredient would typically range from 0.01%
to 15%, w/w or w/v.
[0285] The medicament of the present invention will generally
comprise an amount of the active component(s) effective for the
therapy, including, but not limited to, a nucleic acid molecule of
the present invention, preferably dissolved or dispersed in a
pharmaceutically acceptable medium. Pharmaceutically acceptable
media or carriers include any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents and the like. The use of such media and
agents for pharmaceutical active substances is well known in the
art. Supplementary active ingredients can also be incorporated into
the medicament of the present invention.
[0286] In a further aspect the present invention is related to a
pharmaceutical composition. Such pharmaceutical composition
comprises at least one of the nucleic acids according to the
present invention and preferably a pharmaceutically acceptable
vehicle. Such vehicle can be any vehicle or any binder used and/or
known in the art. More particularly such binder or vehicle is any
binder or vehicle as discussed in connection with the manufacture
of the medicament disclosed herein. In a further embodiment, the
pharmaceutical composition comprises a further pharmaceutically
active agent.
[0287] The preparation of a medicament and a pharmaceutical
composition, respectively, is known to those of skill in the art in
light of the present disclosure. Typically, such compositions may
be prepared as injectables, either as liquid solutions or
suspensions; solid forms suitable for solution in, or suspension
in, liquid prior to injection; as tablets or other solids for oral
administration; as time release capsules; or in any other form
currently used, including eye drops, creams, lotions, salves,
inhalants and the like. The use of sterile formulations, such as
saline-based washes, by surgeons, physicians or health care workers
to treat a particular area in the operating field may also be
particularly useful. Compositions may also be delivered via a
microdevice, microparticles or a sponge.
[0288] In this context, the quantity of active ingredient and
volume of composition to be administered depends on the individual
or the subject to be treated. Specific amounts of active compound
required for administration depend on the judgment of the
practitioner and are peculiar to each individual.
[0289] A minimal volume of a medicament required to disperse the
active compounds is typically utilized. Suitable regimes for
administration are also variable, but would be typified by
initially administering the compound and monitoring the results and
then giving further controlled doses at further intervals.
[0290] For instance, for oral administration in the form of a
tablet or capsule (e.g., a gelatin capsule), the active drug
component, i. e. a nucleic acid molecule according to the present
invention and/or any further pharmaceutically active agent, also
referred to herein as therapeutic agent(s) or active compound(s) in
their entirety, can be combined with an oral, non-toxic,
pharmaceutically acceptable and preferably inert carrier such as
ethanol, glycerol, water and the like. Moreover, when desired or
necessary, suitable binders, lubricants, disintegrating agents, and
coloring agents can also be incorporated into the mixture. Suitable
binders include starch, magnesium aluminum silicate, starch paste,
gelatin, methylcellulose, sodium carboxymethylcellulose and/or
polyvinylpyrrolidone, natural sugars such as glucose or
beta-lactose, corn sweeteners, natural and synthetic gums such as
acacia, tragacanth or sodium alginate, polyethylene glycol, waxes,
and the like. Lubricants used in these dosage forms include sodium
oleate, sodium stearate, magnesium stearate, sodium benzoate,
sodium acetate, sodium chloride, silica, talcum, stearic acid, its
magnesium or calcium salt and/or polyethyleneglycol, and the like.
Disintegrators include, without limitation, starch, methyl
cellulose, agar, bentonite, xanthan gum starches, agar, alginic
acid or its sodium salt, or effervescent mixtures, and the like.
Diluents, include, e.g., lactose, dextrose, sucrose, mannitol,
sorbitol, cellulose and/or glycine.
[0291] The medicament according to the invention can also be
administered in such oral dosage forms as timed release and
sustained release tablets or capsules, pills, powders, granules,
elixirs, tinctures, suspensions, syrups and emulsions.
Suppositories are advantageously prepared from fatty emulsions or
suspensions.
[0292] The pharmaceutical composition or medicament according to
the invention may be sterilized and/or contain adjuvants, such as
preserving, stabilizing, wetting or emulsifying agents, solution
promoters, salts for regulating the osmotic pressure and/or
buffers. In addition, they may also contain other therapeutically
valuable substances. The compositions are prepared according to
conventional mixing, granulating, or coating methods, and typically
contain about 0.1% to 75%, preferably about 1% to 50%, of the
active ingredient.
[0293] Liquid, particularly injectable compositions can, for
example, be prepared by dissolving, dispersing, etc. The active
compound is dissolved in or mixed with a pharmaceutically pure
solvent such as, for example, water, saline, aqueous dextrose,
glycerol, ethanol, and the like, to thereby form an injectable
solution or suspension. Additionally, solid forms suitable for
dissolving in liquid prior to injection can be formulated.
[0294] For solid compositions, excipients include pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharin, talcum, cellulose, glucose, sucrose, magnesium
carbonate, and the like. The active compound defined above, may be
also formulated as suppositories, using for example, polyalkylene
glycols, for example, propylene glycol, as the carrier. In some
embodiments, suppositories are advantageously prepared from fatty
emulsions or suspensions.
[0295] The medicaments and nucleic acid molecules, respectively, of
the present invention can also be administered in the form of
liposome delivery systems, such as small unilamellar vesicles,
large unilamellar vesicles and multilamellar vesicles. Liposomes
can be formed from a variety of phospholipids, containing
cholesterol, stearylamine or phosphatidylcholines. In some
embodiments, a film of lipid components is hydrated with an aqueous
solution of drug to form a lipid layer encapsulating the drug,
which is well known to the ordinary person skilled in the art. For
example, the nucleic acid molecules according to the invention can
be provided as a complex with a lipophilic compound or
non-immunogenic, high molecular weight compound constructed using
methods known in the art. Additionally, liposomes may bear such
nucleic acid molecules on their surface for targeting and carrying
cytotoxic agents internally to mediate cell killing. An example of
nucleic-acid associated complexes is provided in U.S. Pat. No.
6,011,020.
[0296] The medicaments and nucleic acid molecules, respectively, of
the present invention may also be coupled with soluble polymers as
targetable drug carriers. Such polymers can include
polyvinylpyrrolidone, pyran copolymer,
polyhydroxypropyl-methacrylamide-phenol,
polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine
substituted with palmitoyl residues Furthermore, the medicaments
and nucleic acid molecules, respectively, of the present invention
may be coupled to a class of biodegradable polymers useful in
achieving controlled release of a drug, for example, polylactic
acid, polyepsilon capro lactone, polyhydroxy butyric acid,
polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates
and cross-linked or amphipathic block copolymers of hydrogels.
[0297] If desired, the pharmaceutical composition and medicament,
respectively, to be administered may also contain amounts,
typically minor amounts, of non-toxic auxiliary substances such as
wetting or emulsifying agents, pH buffering agents, and other
substances such as for example, sodium acetate, and triethanolamine
oleate.
[0298] The dosage regimen utilizing the nucleic acid molecules and
medicaments, respectively, of the present invention is selected in
accordance with a variety of factors including type, species, age,
weight, sex and medical condition of the patient; the severity of
the condition to be treated; the route of administration; the renal
and hepatic function of the patient; and the particular nucleic
acid according to the invention or salt thereof employed. An
ordinarily skilled physician or veterinarian can readily determine
and prescribe the effective amount of the drug required to prevent,
counter or arrest the progress of the condition.
[0299] Effective plasma levels of the nucleic acid according to the
present invention preferably range from 500 .mu.M to 500 .mu.M in
the treatment of any of the diseases disclosed herein.
[0300] The nucleic acid molecules and medicaments, respectively, of
the present invention may preferably be administered in a single
daily dose, every second or third day, weekly, every second week,
in a single monthly dose or every third month.
[0301] It is within the present invention that the medicament as
described herein constitutes the pharmaceutical composition
disclosed herein.
[0302] In a further aspect the present invention is related to a
method for the treatment of a subject who is in need of such
treatment, whereby the method comprises the administration of a
pharmaceutically effective amount of at least one of the nucleic
acids according to the present invention. In an embodiment, the
subject suffers from a disease or is at risk to develop such
disease, whereby the disease is any one of those disclosed herein,
particularly any one of those diseases disclosed in connection with
the use of any of the nucleic acids according to the present
invention for the manufacture of a medicament.
[0303] It is to be understood that the nucleic acid as well as the
antagonists according to the present invention can be used not only
as a medicament or for the manufacture of a medicament, but also
for cosmetic purposes, particularly with regard to the involvement
of hepcidin in inflamed regional skin lesions. Therefore, a further
condition or disease for the treatment or prevention of which the
nucleic acid, the medicament and/or the pharmaceutical composition
according to the present invention can be used, is inflamed
regional skin lesions.
[0304] As preferably used herein a diagnostic or diagostic agent or
diagnostic means is suitable to detect, either directly or
indirectly, hepcidin, preferably hepcidin as described herein and
more preferably hepcidin as described herein in connection with the
various disorders and diseases described herein. The diagnostic is
suitable for the detection and/or follow-up of any of the disorders
and diseases, respectively, described herein. Such detection is
possible through the binding of the nucleic acids according to the
present invention to hepcidin. Such binding can either directly or
indirectly be detected. The respective methods and means are known
to a person skilled in the art. Among others, the nucleic acids
according to the present invention may comprise a label which
allows the detection of the nucleic acids according to the present
invention, preferably the nucleic acid being bound to hepcidin.
Such a label is preferably selected from the group comprising
radioactive, enzymatic and fluorescent labels. In principle, all
known assays developed for antibodies can be adopted and adapted
for the nucleic acids according to the present invention whereby
the target-binding antibody is substituted to a target-binding
nucleic acid of the present invention. In antibody-assays using
unlabeled target-binding antibodies the detection is preferably
done by a secondary antibody which is modified with radioactive,
enzymatic and fluorescent labels and which binds to the
target-binding antibody at the Fc-fragment of the target-binding
antibody. In case of a nucleic acid, preferably a nucleic acid
according to the present invention, the nucleic acid is modified
with such a label, whereby preferably such a label is selected from
the group comprising biotin, Cy-3 and Cy-5, and such label is
detected by an antibody directed against such label, e.g. an
anti-biotin antibody, an anti-Cy3 antibody or an anti-Cy5 antibody,
or--in the case the label is biotin--the label is detected by
streptavidin or avidin which naturally binds to biotin. Such
antibody, streptavidin or avidin in turn is preferably modified
with a respective label, e.g. a radioactive, enzymatic or
fluorescent label like an secondary antibody allowing its
detection.
[0305] In a further embodiment the nucleic acid molecules according
to the invention are detected or analysed by a second detection
means, wherein the second detection means is a molecular beacon.
The methodology of molecular beacon is known to persons skilled in
the art.
[0306] In brief, nucleic acids probes which are also referred to as
molecular beacons, are a reverse complement to the nucleic acids to
be detected and hybridise because of this to a part or the entirety
of the nucleic acid to be detected. Upon binding to the nucleic
acid to be detected the fluorophoric groups of the molecular beacon
are separated which results in a change of the fluorescence signal,
preferably a change in intensity. This change correlates with the
amount of nucleic acids to be detected.
[0307] It will be acknowledged that the detection of hepcidin using
the nucleic acids according to the present invention will
particularly allow the detection of hepcidin as defined herein.
[0308] In connection with the detection of hepcidin a preferred
method comprises the following steps: [0309] (a) providing a sample
which is to be tested for the presence of hepcidin, [0310] (b)
providing a nucleic acid according to the present invention, [0311]
(c) reacting the sample with the nucleic acid, preferably in a
reaction vessel [0312] whereby step (a) can be performed prior to
step (b), or step (b) can be performed prior to step (a).
[0313] In a preferred embodiment a further step d) is provided,
which consists in detecting whether or not the nucleic acid has
reacted with hepcidin. Preferably, the nucleic acid of step b) is
immobilised to a surface. The surface may be the surface of a
reaction vessel such as a reaction tube, a well of a plate, or the
surface of a device contained in such reaction vessel such as, for
example, a bead. The immobilisation of the nucleic acid to the
surface can be made by any means known to the ones skilled in the
art including, but not limited to, non-covalent or covalent
linkages. Preferably, the linkage is established via a covalent
chemical bond between the surface and the nucleic acid. However, it
is also within the present invention that the nucleic acid is
indirectly immobilised to a surface, whereby such indirect
immobilisation involves the use of a further component or a pair of
interaction partners. Such further component is preferably a
compound which specifically interacts with the nucleic acid to be
immobilised which is also referred to as interaction partner, and
thus mediates the attachment of the nucleic acid to the surface.
The interaction partner is preferably selected from the group
comprising nucleic acids, polypeptides, proteins and antibodies.
Preferably, the interaction partner is an antibody, more preferably
a monoclonal antibody. Alternatively, the interaction partner is a
nucleic acid, preferably a functional nucleic acid. More preferably
such functional nucleic acid is selected from the group comprising
aptamers, spiegelmers, and nucleic acids which are at least
partially complementary to the nucleic acid. In a further
alternative embodiment, the binding of the nucleic acid to the
surface is mediated by a multi-partite interaction partner. Such
multi-partite interaction partner is preferably a pair of
interaction partners or an interaction partner consisting of a
first member and a second member, whereby the first member is
comprised by or attached to the nucleic acid and the second member
is attached to or comprised by the surface. The multi-partite
interaction partner is preferably selected from the group of pairs
of interaction partners comprising biotin and avidin, biotin and
streptavidin, and biotin and neutravidin. Preferably, the first
member of the pair of interaction partners is biotin.
[0314] A preferred result of such method for the dectection of
hepcidin is the formation of an immobilised complex of hepcidin and
the nucleic acid, whereby more preferably said complex is detected.
It is within an embodiment that the hepcidin contained in or as set
free from the complex is detected.
[0315] A respective detection means which is suitable for the
detection of said hepcidin is any detection means which is specific
for hepcidin. A particularly preferred detection means is a
detection means which is selected from the group comprising nucleic
acids, polypeptides, proteins and antibodies.
[0316] The method for the detection of hepcidin according to the
invention also comprises that the sample is removed from the
reaction vessel which has preferably been used to perform step
c).
[0317] The method of the present invention comprises in a further
embodiment also the step of immobilising an interaction partner of
hepcidin on a surface, preferably a surface as defined above,
whereby the interaction partner is defined as herein and preferably
as above in connection with the respective method and more
preferably comprises nucleic acids, polypeptides, proteins and
antibodies in their various embodiments. In this embodiment, a
particularly preferred detection means is a nucleic acid according
to the present invention, whereby such nucleic acid may be labelled
or non-labelled. In case such nucleic acid is labelled the nucleic
acid comprises a detection label. Such detection label can be
directly or indirectly detected. Such detection may also involve
the use of a second detection means which is, preferably, also
selected from the group comprising nucleic acids, polypeptides,
proteins and antibodies in the various embodiments described
herein. Such second detection means is preferably specific for the
nucleic acid according to the present invention and in case the
nucleic acid according to the present invention comprises a
detection label, such second detection means is specific for the
detection label. In a more preferred embodiment, the second
detection means is a molecular beacon. It is also within the
present invention that the second detection means or comprises in a
preferred embodiment a detection label. The detection label,
irrespective of whether it is comprised by the nucleic acid
according to the invention or the second detection means, is
preferably selected from the group comprising biotin, a
bromo-desoxyuridine label, a digoxigenin label, a fluorescence
label, a UV-label, a radio-label, and a chelator molecule.
Particularly preferred combinations are as follows: [0318] the
detection label attached to the nucleic acid according to the
present invention is biotin and the second detection means is an
antibody directed against biotin, or wherein [0319] the detection
label attached to the nucleic acid according to the present
invention is biotin and the second detection means is an avidin or
an avidin carrying molecule, or wherein [0320] the detection label
attached to the nucleic acid according to the present invention is
biotin and the second detection means is a streptavidin or a
stretavidin carrying molecule, or wherein [0321] the detection
label attached to the nucleic acid according to the present
invention is biotin and the second detection means is a neutravidin
or a neutravidin carrying molecule, or wherein [0322] the detection
label attached to the nucleic acid according to the present
invention is a bromo-desoxyuridine and the second detection means
is an antibody directed against bromo-desoxyuridine, or wherein
[0323] the detection label attached to the nucleic acid according
to the present invention is digoxigenin and the second detection
means is an antibody directed against digoxigenin, or wherein
[0324] the detection label attached to the nucleic acid according
to the present invention is a chelator and the second detection
means is a radio-nuclide, whereby it is preferred that said
detection label is attached to the nucleic acid according to the
present invention.
[0325] It is to be acknowledged that these kinds of combination are
also applicable to the embodiment where the nucleic acid according
to the invention is attached to the surface. In such embodiment it
is preferred that the detection label is attached to the second
detection means, i.e. preferably the interaction partner.
[0326] Finally, it is also within the present invention that the
second detection means is detected using a third detection means,
preferably the third detection means is an enzyme, more preferably
an enzyme showing an enzymatic reaction upon reaction with the
second detection means. Alternatively, the third detection means is
a means for detecting radiation, more preferably radiation emitted
by a radio-nuclide which is attached to either the nucleic acid
according to the present invention or the second detection means,
preferably the second detection means. Preferably, the third
detection means is specifically detecting and/or interacting with
the second detection means.
[0327] Also, in the embodiment where an interaction partner of
hepcidin is immobilised on a surface and the nucleic acid according
to the present invention is preferably added to the complex formed
between the interaction partner and the hepcidin, the sample can be
removed from the reaction, more preferably from the reaction vessel
where step c) and/or d) are preformed.
[0328] In an embodiment the nucleic acid according to the present
invention comprises a fluorescence moiety and whereby the
fluorescence of the fluorescence moiety is different upon complex
formation between the nucleic acid and hepcidin on the one hand and
the nucleic acid and free hepcidin on the other.
[0329] In a further embodiment the nucleic acid as used in the
method for detecting hepcidin in accordance with the present
invention is a derivative of the nucleic acid according to the
present invention, whereby the derivative of the nucleic acid
comprises at least one fluorescent derivative of adenosine
replacing adenosine. In a preferred embodiment the fluorescent
derivative of adenosine is ethenoadenosine.
[0330] In a further embodiment the complex consisting of the
derivative of the nucleic acid according to the present invention
and the hepcidin is detected using fluorescence.
[0331] In an embodiment of the method a signal is created in step
(c) or step (d) and preferably the signal is correlated with the
concentration of hepcidin in the sample.
[0332] In a preferred embodiment, the method may be performed in
96-well plates, where components are immobilized in the reaction
vessels as described above and the wells acting as reaction
vessels.
[0333] The inventive nucleic acid may further be used as starting
material for drug design. Basically there are two possible
approaches. One approach is the screening of compound libraries
whereby such compound libraries are preferably low molecular weight
compound libraries. In an embodiment, the screening is a high
throughput screening. Preferably, high throughput screening is the
fast, efficient, trial-and-error evaluation of compounds in a
target-based assay. In best case the assay format of the
target-based assay is based on colorimetric measurement. Libraries
as used in connection therewith are known to the one skilled in the
art.
[0334] Alternatively, the nucleic acid according to the present
invention may be used for rational design of drugs. Preferably,
rational drug design is the design of a pharmaceutical lead
structure. Starting from the 3-dimensional structure of the target
which is typically identified by methods such as X-ray
crystallography or nuclear magnetic resonance spectroscopy,
computer programs are used to search through databases containing
structures of many different chemical compounds. The selection is
done by a computer, the identified compounds can subsequently be
tested in the laboratory.
[0335] The rational design of drugs may start from any of the
nucleic acid according to the present invention and involves a
structure, preferably a three dimensional structure, which is
similar to the structure of the inventive nucleic acids or
identical to the parts of the structure of the inventive nucleic
acids to mediating the binding of the nucleic acid to the target,
i.e. hepcidin. In either a further step or as an alternative step
in the rational design of drugs the preferably three dimensional
structure of those parts of the nucleic acids binding to the
hepcidin are mimicked by chemical groups which are different from
nucleotides and nucleic acids. By this mimicry a compound different
from the nucleic acids according to the invention can be designed.
Such compound is preferably a small molecule or a peptide.
[0336] In case of screening of compound libraries, such as by using
a competitive assay which is known to the ones skilled in the arts,
appropriate hepcidin analogues, hepcidin agonists or hepcidin
antagonists may be found. Such competitive assays may be set up as
follows. The inventive nucleic acid, preferably a spiegelmer which
is a target binding L-nucleic acid, is coupled to a solid phase. In
order to identify hepcidin analogues labelled hepcidin may be added
to the assay. A potential analogue would compete with the hepcidin
molecules binding to the spiegelmer which would go along with a
decrease in the signal obtained by the respective label. Screening
for agonists or antagonists may involve the use of a cell culture
assay as known to the ones skilled in the art.
[0337] The kit according to the present invention may comprise at
least one or several of the inventive nucleic acids. Additionally,
the kit may comprise at least one or several positive or negative
controls. A positive control may, for example, be hepcidin,
particularly the one which is bound by the inventive nucleic acid,
whereby, preferably, the positive control is present in either a
liquid or lyophilised form. A negative control may, e.g., be a
peptide which is defined in terms of biophysical properties similar
to hepcidin, but which is not recognized by the inventive nucleic
acids. Furthermore, said kit may further comprise one or several
buffers. The various ingredients may be contained in the kit in
dried or lyophilised form or may be dissolved or dispersed in a
liquid. The kit may also further comprise one or several containers
which in turn may contain one or several of the ingredients of the
kit. In a still further embodiment, the kit further comprises
instructions or an instruction leaflet which provides to the user
information on how to use the kit and its various ingredients.
[0338] The quantification of the nucleic acid according to the
present invention in several humours, tissues and organs of a human
or non-human body is essential for the assessment of its
pharmacokinetic and pharmacodynamic profile the nucleic acid
according to the present invention. For such purpose, any of the
detection methods disclosed herein or known to a person skilled in
the art using the nucleic acid according to the present invention
may be used. In a further aspect of the present invention a
sandwich hybridisation assay for the detection of the nucleic acid
according to the present invention is provided. In connection with
such sandwich hybridisation assay a capture probe and a detection
probe are used. The capture probe is essentially complementary to a
first part of a nucleic acid according to the present invention and
the detection probe is essentially complementary to a second part
of the nucleic acid according to the present invention. Both,
capture and detection probe, can be formed by DNA nucleotides,
modified DNA nucleotides, modified RNA nucleotides, RNA
nucleotides, LNA nucleotides and/or PNA nucleotides.
[0339] Hence, the capture probe comprises a stretch of nucleotides
which is essentially complementary to the 5'-end of a nucleic acid
according to the present invention, and the detection probe
comprises a stretch of nucleotides which is essentially
complementary to the 3'-end of the nucleic acid according to the
present invention. In this case the capture probe is immobilised to
a surface or matrix via its 5'-end whereby the capture probe can be
immobilised directly at its 5'-end or via a linker between its
5'-end and the surface or matrix. However, in principle the linker
can be linked to each nucleotide of the capture probe. The linker
can be formed by hydrophilic linkers or by D-DNA nucleotides,
modified D-DNA nucleotides, D-RNA nucleotides, modified D-RNA
nucleotides, D-LNA nucleotides, PNA nucleotides, L-RNA nucleotides,
L-DNA nucleotides, modified L-RNA nucleotides, modified L-DNA
nucleotides and/or L-LNA nucleotides as known to a person skilled
in the art.
[0340] Alternatively, the capture probe may comprise a stretch of
nucleotides essentially complementary to the 3'-end of a nucleic
acid according to the present invention and the detection probe
comprise a stretch of nucleotides essentially complementary to the
5'-end of the nucleic acid according to the present invention. In
this case the capture probe is immobilised to a surface or matrix
via its 3'-end whereby the capture probe can be immobilised
directly at its 3'-end or via a linker between its 3'-end and the
surface or matrix. However, in principle, the linker can be linked
to each nucleotide of the stretch of nucleotides that is
essentially complementary to the nucleic acid according to the
present invention. The linker can be formed by hydrophilic linkers
or by D-DNA nucleotides, modified D-DNA nucleotides, D-RNA
nucleotides, modified D-RNA nucleotides, D-LNA nucleotides, PNA
nucleotides, L-RNA nucleotides, L-DNA nucleotides, modified L-RNA
nucleotides, modified L-DNA nucleotides and/or L-LNA nucleotides as
known to a person skilled in the art.
[0341] The number of nucleotides of the capture and detection
probe, respectively, that may hybridise to the nucleic acid
according to the present invention is variable and can be dependent
on the number of nucleotides of the capture probe and/or the
detection probe and/or the nucleic acid according to the present
invention itself. The total number of nucleotides of the capture
probe and of the detection probe that may hybridise to the nucleic
acid according to the present invention should be maximal the
number of nucleotides that are comprised by the nucleic acid
according to the present invention. A minimal number of nucleotides
of typically 2 to 10 nucleotides independently on each of the
detection probe and capture probe should allow hybridisation to the
5'-end or 3'-end, respectively, of the nucleic acid according to
the present invention.
[0342] Moreover the detection probe preferably carries a marker
molecule or a label that can be detected as previously described
herein. The label or marker molecule can in principle be linked to
each nucleotide of the detection probe or each moiety of the
detection probe. Preferably, the label or marker is located at the
5'-end or 3'-end of the detection probe, whereby between the
nucleotides within the detection probe that are complementary to
the nucleic acid according to the present invention, and the label
a linker can be inserted. The linker can be formed by hydrophilic
linkers or by D-DNA nucleotides, modified D-DNA nucleotides, D-RNA
nucleotides, modified D-RNA nucleotides, D-LNA nucleotides, PNA
nucleotides, L-RNA nucleotides, L-DNA nucleotides, modified L-RNA
nucleotides, modified L-DNA nucleotides and/or L-LNA nucleotides as
known to a person skilled in the art.
[0343] In an embodiment of the method for detecting hepcidin, the
detection of the nucleic acid according to the present invention
can be carried out as follows:
[0344] The nucleic acid according to the present invention is
hybridised with one of its ends to a capture probe and with the
other end to a detection probe. Afterwards, unbound detection
probe, i.e. detection probe that is not bound to the nucleic acid
according to the invention, is removed by, e. g., one or several
washing steps. The amount of bound detection probe which preferably
carries a label or marker molecule, can be measured subsequently
as, for example, outlined in more detail in WO/2008/052774 which is
incorporated herein by reference.
[0345] As preferably used herein, the term treatment comprises in a
preferred embodiment additionally or alternatively prevention
and/or follow-up.
[0346] As preferably used herein, the terms disease and disorder
shall be used in an interchangeable manner, if not indicated to the
contrary.
[0347] As used herein, the term comprise is preferably not intended
to limit the subject matter followed or described by such term.
However, in an alternative embodiment the term comprises shall be
understood in the meaning of containing and thus as limiting the
subject matter followed or described by such term.
[0348] The various SEQ.ID. Nos., the chemical nature of the nucleic
acid molecules according to the present invention and the target
molecules hepcidin as used herein, the actual sequence thereof and
the internal reference number is summarized in the following
table.
TABLE-US-00001 Seq.- RNA/ ID Peptide Sequence Internal Reference 1
L-peptide DTHFPICIFCCGC Human hepcidin, CHRSKCGMCCKT human
hepcidin-25 2 L-peptide DTHFPICIFCCGC Hepcidin-25 of CHRSKCGMCCKT
Macaca mulatta (rhesus monkey) 3 L-peptide DTHFPICIFCCGC
Hepcidin-25 of CHRSKCGMCCKT Macaca fascularis (cynomolgus monkey) 4
L-peptide DTHFPICIFCCGC Hepcidin-25 of CRKAICGMCCKT Sus scrofa
(pig) 5 L-peptide DTNFPICIFCCKC Hepcdin-25 of CNNSQCGICCKT Mus
musculus (mouse) 6 L-peptide DTNFPICLFCCKC Hepcidin-25 of
CKNSSCGLCCIT Rattus norvegicus (rat) 7 D-peptide DTHFPICIFCCGC
Biotinylated human CHRSKCGMCCKT- D-hepcidin-25 Biotin 8 L-peptide
ICIFCCGCCHRSK human hepcidin-20 CGMCCKT 9 L-peptide FPICIFCCGCCHR
human hepcidin-22 SKCGMCCKT 10 D-RNA GCACUCGUAAAGU 223-C5-001
AGAGGGACCCAGU CCGGCGUGAUAGU GCCGAGUGC 11 D-RNA GCACUUGUAAAGU
223-B5-001 AGAGGGACCCAGU CCGGCGUGAUAGU GCCGAGUGC 12 D-RNA
GCAUUCGUAAAGU 223-A5-001 AGAGGGACCCAGU CCGGCGUGAUAGU GCCGAGUGC 13
D-RNA GCACUCGUAAAGU 223-A3-001 AGAGGGACCUAGU CCGGCGUGAUAGU
GCCGGGUGC 14 D-RNA GCACUCGUAAAGU 223-F5-001 AGAGGGACCUAGU
CCGGCGUGAUAGU GCCGAGUGC 15 D-RNA GCACUCGUAAAGU 223-G4-001
AGAGGGACUCAGU CCGGCGUGAUAGU GCCGAGUGC 16 D-RNA GCACUCGUAAAGU
223-A4-001 AGAGGGAUACAGU CCGGCGUGAUAGU GACGAGUGC 17 D-RNA
CGUGUGUAAAGUA 229-C2-001 GAGGCAGGUAAUC UGCGGAGUGUUAG UUCCACACG 18
D-RNA CGCGUGUAAAGUA 229-B4-001 GAGGCAGGUAAUC UGCGGAGUGUUAG
UUCCACACG 19 D-RNA CGUGUGUAAAGUA 229-E2-001 GAGGCAGGCAAUC
UGCGGAGUGUUAG UUCCACACG 20 D-RNA CGUGUGUAAAGUA 229-B1-001
GAGGACAAUUGUC GGCGUGAUAGUGC CACACG 21 D-RNA GCUGUGUAAAGUA
229-B1-002 GAGGACAAUUGUC GGCGUGAUAGUGC CACAGC 22 D-RNA
CGUGUGUAAAGUA 229-G1-001 GAGGACAAUAGUC GGCGUGAGAGUGC CACACG 23
D-RNA CGUGAAAAGUAGA 229-C4-001 AACUUGUCGAAAG CAAGUAGCGUGAU
AGUGCCACG 24 D-RNA CGUGCUGGCGUGA 229-D1-001 UAGUGCUCCAGGU
UCUGGAUAAAGUA GAGAGCACG 25 D-RNA CGUGCGAAGGAGU 229-E1-001
GAUAAGUGUUUCU GACUUUCUUCCAG ACUCCCACG 26 D-RNA CACUCGUAAAGUA
223-C5-002 GAGGGACCCAGUC CGGCGUGAUAGUG CCGAGUG 27 D-RNA
CGCGCGUAAAGUA 223-C5-006 GAGGGACCCAGUC CGGCGUGAUAGUG CCGCGCG 28
D-RNA GCGCGUAAAGUAG 223-C5-007 AGGGACCCAGUCC GGCGUGAUAGUGC CGCGC 29
L-RNA GCACUCGUAAAGU 223-C5-001 AGAGGGACCCAGU CCGGCGUGAUAGU
GCCGAGUGC 30 L-RNA GCACUUGUAAAGU 223-B5-001 AGAGGGACCCAGU
CCGGCGUGAUAGU GCCGAGUGC 31 L-RNA GCAUUCGUAAAGU 223-A5-001
AGAGGGACCCAGU CCGGCGUGAUAGU GCCGAGUGC 32 L-RNA GCACUCGUAAAGU
223-A3-001 AGAGGGACCUAGU CCGGCGUGAUAGU GCCGGGUGC 33 L-RNA
GCACUCGUAAAGU 223-F5-001 AGAGGGACCUAGU CCGGCGUGAUAGU GCCGAGUGC 34
L-RNA GCACUCGUAAAGU 223-G4-001 AGAGGGACUCAGU CCGGCGUGAUAGU
GCCGAGUGC 35 L-RNA GCACUCGUAAAGU 223-A4-001 AGAGGGAUACAGU
CCGGCGUGAUAGU GACGAGUGC 36 L-RNA CGUGUGUAAAGUA 229-C2-001
GAGGCAGGUAAUC UGCGGAGUGUUAG UUCCACACG 37 L-RNA CGCGUGUAAAGUA
229-B4-001 GAGGCAGGUAAUC UGCGGAGUGUUAG UUCCACACG 38 L-RNA
CGUGUGUAAAGUA 229-E2-001 GAGGCAGGCAAUC UGCGGAGUGUUAG UUCCACACG 39
L-RNA CGUGUGUAAAGUA 229-B1-001 GAGGACAAUUGUC GGCGUGAUAGUGC CACACG
40 L-RNA GCUGUGUAAAGUA 229-B1-002 GAGGACAAUUGUC GGCGUGAUAGUGC
CACAGC 41 L-RNA CGUGUGUAAAGUA 229-G1-001 GAGGACAAUAGUC
GGCGUGAGAGUGC CACACG 42 L-RNA CGUGAAAAGUAGA 229-C4-001
AACUUGUCGAAAG CAAGUAGCGUGAU AGUGCCACG 43 L-RNA CGUGCUGGCGUGA
229-D1-001 UAGUGCUCCAGGU UCUGGAUAAAGUA GAGAGCACG 44 L-RNA
CGUGCGAAGGAGU 229-E1-001 GAUAAGUGUUUCU GACUUUCUUCCAG ACUCCCACG 45
L-RNA CACUCGUAAAGUA 223-C5-002 GAGGGACCCAGUC CGGCGUGAUAGUG CCGAGUG
46 L-RNA CGCGCGUAAAGUA 223-C5-006 GAGGGACCCAGUC CGGCGUGAUAGUG
CCGCGCG 47 L-RNA GCGCGUAAAGUAG 223-C5-007 AGGGACCCAGUCC
GGCGUGAUAGUGC CGCGC 48 L-RNA 5'-40-kDa-PEG- 223-C5-001-
GCACUCGUAAAGU 5'-PEG AGAGGGACCCAGU CCGGCGUGAUAGU GCCGAGUGC 49 D-RNA
AGGCGUAAAGUAG 238-A1-001 AGGGGCUGAGCCC GGCGUGUUAGUGC CGCCU 50 D-RNA
AGGCGUAAAGUAG 238-E2-001 AGGGACGUAGUCC GGCGUGAUAGUGC CGCCU 51 D-RNA
CGUGUGUAAAGUA 237-A7-001 GAGGCAGAUAAUC UGCGGAGUGUUAG UUCCACACG 52
D-RNA CGUGAAAAGUAGA 236-G2-001 AACUUGUCGAAAG CAAGCAGCGUGAU
AGUGCCACG 53 D-RNA CGUGAAAAGUUGA 236-D1-001 AAUUUGUUGGAAU
CAAGCAGGGAUAU AGUGCCACG 54 D-RNA AGCGUGUCGUAUG 238-D2-001
GGAUAAGUAAAUG AGGAGUUGGAGGA AGGGUGCGCU 55 D-RNA AGCGUGUCGUAUG
238-D4-001 GGAUUAAGUAAAU GAGGAGUUGGAGG AAGGGCAUGCU 56 D-RNA
AGUGUGUCGUAUG 238-H1-001 GGAUAAGUAAAUG AGGGGUUGGAGGA AGGAUGCGCU 57
D-RNA AGUGUGUCAUAUG 238-A2-001 GGAUAAGUAAAUG AGGAGUUGGAGGA
AAGGCAUGCU 58 D-RNA AGCGUGCCGGAUG 238-G2-001 GGAUAAGUAAAUG
AGGAGUUGGAGGA AGGGUGCGCU 59 D-RNA AGCGUGCCGUAUG 238-G4-001
GGAUAAGUAAAUG AGGAGUAGGAGGA AGGGUACGCU 60 D-RNA AGCGCGCCGUAUG
238-G3-001 GGAGAAGUAAAUG AGGAGUUGGAGGA AGGGCGCGCU 61 D-RNA
AGGCUCGGACAGC 238-C4-001 CGGGGGACACCAU AUACAGACUACGA UACGGGCCU 62
D-RNA AGGCUCGGACGGC 238-E3-001 CGGGGGACACCAU AUACAGACUACUA
UACGGGCCU 63 D-RNA AGGCCCGGACAGC 238-F2-001 CGGGGGACACCAU
AUACAGACUACUA UACGGGCCU 64 D-RNA AGGCUUGGGCGGC 238-A4-001
CGGGGGACACCAU AUACAGACUACUA UACGAGCCU 65 D-RNA AGACUUGGGCAGC
238-E1-001 CGGGGGACACCAU AUACAGACUACGA UACGAGUCU 66 D-RNA
CGGGCGCCAUAGA 237-A5-001 CCGUUAUUAAGCA CUGUAACUACCGA ACCGCGCCCG 67
D-RNA CGGGCGCCAUAGA 237-C5-001 CCGUUAACUACAU AACUACCGAACCG UGCCCG
68 D-RNA CGGGCGCUACCGA 236-F2-001 ACCCACUAAAACC AGUGCAUAGACCG
CGCCCG 69 D-RNA CGGGCGCUACCGA 236-G4-001 ACCGUCACGAAGA
CCAUAGACCGCGC CG 70 D-RNA CGAGCGCAACCGA 236-E3-001 ACCUCUACCCAGA
CAUAGACCGCGCC CG 71 D-RNA GCACUCGUAAAGU 223-C5-008 AGAGGGACCAGUC
CGGCGUGAUAGUG CCGAGUGC 72 D-RNA GUGUGUAAAGUAG 229-B1-003
AGGACAAUUGUCG GCGUGAUAGUGCC ACAC 73 D-RNA GCGUGUAAAGUAG 229-B1-004
AGGACAAUUGUCG GCGUGAUAGUGCC ACGC 74 D-RNA GCGCGUAAAGUAG 229-B1-005
AGGACAAUUGUCG GCGUGAUAGUGCC GCGC 75 D-RNA CGUGUGUAAAGUA 229-B1-006
GAGGACAAUUGUC GGCGUGAUAGUGC CACAC 76 D-RNA GCCGUGUAAAGUA 229-B1-007
GAGGACAAUUGUC GGCGUGAUAGUGC CACGGC 77 D-RNA GCGGUGUAAAGUA
229-B1-008 GAGGACAAUUGUC GGCGUGAUAGUGC CACCGC 78 D-RNA
GCUGCGUAAAGUA 229-B1-009 GAGGACAAUUGUC GGCGUGAUAGUGC CGCAGC 79
D-RNA GCUGGGUAAAGUA 229-B1-010 GAGGACAAUUGUC GGCGUGAUAGUGC CCCAGC
80 D-RNA GCGGCGUAAAGUA 229-B1-011 GAGGACAAUUGUC GGCGUGAUAGUGC
CGCCGC 81 D-RNA GCGCGCGUAUGGG 238-D4-002 AUUAAGUAAAUGA
GGAGUUGGAGGAA GGCGCGC 82 D-RNA GCGCGCGUAUGGG 238-D4-003
AUAAGUAAAUGAG GAGUUGGAGGAAG GCGCGC 83 D-RNA GGCGCGUAUGGGA
238-D4-004 UUAAGUAAAUGAG GAGUUGGAGGAAG GCGCC 84 D-RNA GGCGCGUAUGGGA
238-D4-005 UAAGUAAAUGAGG AGUUGGAGGAAGG CGCC 85 D-RNA GGUGUCGUAUGGG
238-D4-006 AUUAAGUAAAUGA GGAGUUGGAGGAA GGGCAUC 86 D-RNA
GGUGUCGUAUGGG 238-D4-007 AUAAGUAAAUGAG GAGUUGGAGGAAG GGCAUC 87
D-RNA GCGCCGUAUGGGA 238-D4-008 UUAAGUAAAUGAG GAGUUGGAGGAAG GGCGC 88
D-RNA GCGCCGUAUGGGA 238-D4-009 UAAGUAAAUGAGG AGUUGGAGGAAGG GCGC 89
D-RNA GGCGCCGUAUGGG 238-D4-010 AUUAAGUAAAUGA GGAGUUGGAGGAA GGGCGCC
90 D-RNA GGCGCCGUAUGGG 238-D4-011 AUAAGUAAAUGAG GAGUUGGAGGAAG
GGCGCC 91 D-RNA GGCGUCGUAUGGG 238-D4-012 AUUAAGUAAAUGA
GGAGUUGGAGGAA GGGCGCC 92 D-RNA GGCGUCGUAUGGG 238-D4-013
AUAAGUAAAUGAG GAGUUGGAGGAAG GGCGCC 93 D-RNA GGCUCGGACAGCC
238-C4-002 GGGGGACACCAUA UACAGACUACGAU ACGGGCC 94 D-RNA
GCUCGGACAGCCG 238-C4-003 GGGGACACCAUAU ACAGACUACGAUA CGGGC 95 D-RNA
CUCGGACAGCCGG 238-C4-004 GGGACACCAUAUA CAGACUACGAUAC GGG 96 D-RNA
GCCCGGACAGCCG 238-C4-005 GGGGACACCAUAU ACAGACUACGAUA CGGGC 97 D-RNA
GGCCGGACAGCCG 238-C4-006 GGGGACACCAUAU ACAGACUACGAUA CGGCC 98 D-RNA
GCGGAGACAGCCG 238-C4-007 GGGGACACCAUAU ACAGACUACGAUA UCCGU 99 D-RNA
AGGCUGACAGCCG 238-C4-008 GGGGACACCAUAU ACAGACUACGAUA GGCCU 100
D-RNA GGCCUGACAGCCG 238-C4-009 GGGGACACCAUAU ACAGACUACGAUA AGGCU
101 D-RNA GCGCGGACAGCCG 238-C4-010 GGGGACACCAUAU ACAGACUACGAUA
CGCGC 102 D-RNA GCCGGACAGCCGG 238-C4-011 GGGACACCAUAUA
CAGACUACGAUAC GGC
103 D-RNA GGCGGACAGCCGG 238-C4-012 GGGACACCAUAUA CAGACUACGAUAC GCC
104 D-RNA GGCCGACAGCCGG 238-C4-013 GGGACACCAUAUA CAGACUACGAUAG GCC
105 D-RNA GCGCGACAGCCGG 238-C4-014 GGGACACCAUAUA CAGACUACGAUAG CGC
106 D-RNA GGCCGGACAGCCG 238-C4-024 GAGGACACCAUAU ACAGACUACGAUA
CGGCC 107 D-RNA GGCCGGACAGCCG 238-C4-025 GCGGACACCAUAU
ACAGACUACGAUA CGGCC 108 D-RNA GGCCGGACAGCCG 238-C4-062
GGAGGACACCAUA UACAGACUACGAU ACGGCC 109 L-RNA 5'UCCAGGUUCUG GA 110
L-RNA AGGCGUAAAGUAG 238-A1-001 AGGGGCUGAGCCC GGCGUGUUAGUGC CGCCU
111 L-RNA AGGCGUAAAGUAG 238-E2-001 AGGGACGUAGUCC GGCGUGAUAGUGC
CGCCU 112 L-RNA CGUGUGUAAAGUA 237-A7-001 GAGGCAGAUAAUC
UGCGGAGUGUUAG UUCCACACG 113 L-RNA CGUGAAAAGUAGA 236-G2-001
AACUUGUCGAAAG CAAGCAGCGUGAU AGUGCCACG 114 L-RNA CGUGAAAAGUUGA
236-D1-001 AAUUUGUUGGAAU CAAGCAGGGAUAU AGUGCCACG 115 L-RNA
AGCGUGUCGUAUG 238-D2-001 GGAUAAGUAAAUG AGGAGUUGGAGGA AGGGUGCGCU 116
L-RNA AGCGUGUCGUAUG 238-D4-001 GGAUUAAGUAAAU GAGGAGUUGGAGG
AAGGGCAUGCU 117 L-RNA AGUGUGUCGUAUG 238-H1-001 GGAUAAGUAAAUG
AGGGGUUGGAGGA AGGAUGCGCU 118 L-RNA AGUGUGUCAUAUG 238-A2-001
GGAUAAGUAAAUG AGGAGUUGGAGGA AAGGCAUGCU 119 L-RNA AGCGUGCCGGAUG
238-G2-001 GGAUAAGUAAAUG AGGAGUUGGAGGA AGGGUGCGCU 120 L-RNA
AGCGUGCCGUAUG 238-G4-001 GGAUAAGUAAAUG AGGAGUAGGAGGA AGGGUACGCU 121
L-RNA AGCGCGCCGUAUG 238-G3-001 GGAGAAGUAAAUG AGGAGUUGGAGGA
AGGGCGCGCU 122 L-RNA AGGCUCGGACAGC 238-C4-001 CGGGGGACACCAU
AUACAGACUACGA UACGGGCCU 123 L-RNA AGGCUCGGACGGC 238-E3-001
CGGGGGACACCAU AUACAGACUACUA UACGGGCCU 124 L-RNA AGGCCCGGACAGC
238-F2-001 CGGGGGACACCAU AUACAGACUACUA UACGGGCCU 125 L-RNA
AGGCUUGGGCGGC 238-A4-001 CGGGGGACACCAU AUACAGACUACUA UACGAGCCU 126
L-RNA AGACUUGGGCAGC 238-E1-001 CGGGGGACACCAU AUACAGACUACGA
UACGAGUCU 127 L-RNA CGGGCGCCAUAGA 237-A5-001 CCGUUAUUAAGCA
CUGUAACUACCGA ACCGCGCCCG 128 L-RNA CGGGCGCCAUAGA 237-C5-001
CCGUUAACUACAU AACUACCGAACCG UGCCCG 129 L-RNA CGGGCGCUACCGA
236-F2-001 ACCCACUAAAACC AGUGCAUAGACCG CGCCCG 130 L-RNA
CGGGCGCUACCGA 236-G4-001 ACCGUCACGAAGA CCAUAGACCGCGC CG 131 L-RNA
CGAGCGCAACCGA 236-E3-001 ACCUCUACCCAGA CAUAGACCGCGCC CG 132 L-RNA
GCACUCGUAAAGU 223-C5-008 AGAGGGACCAGUC CGGCGUGAUAGUG CCGAGUGC 133
L-RNA GUGUGUAAAGUAG 229-B1-003 AGGACAAUUGUCG GCGUGAUAGUGCC ACAC 134
L-RNA GCGUGUAAAGUAG 229-B1-004 AGGACAAUUGUCG GCGUGAUAGUGCC ACGC 135
L-RNA GCGCGUAAAGUAG 229-B1-005 AGGACAAUUGUCG GCGUGAUAGUGCC GCGC 136
L-RNA CGUGUGUAAAGUA 229-B1-006 GAGGACAAUUGUC GGCGUGAUAGUGC CACAC
137 L-RNA GCCGUGUAAAGUA 229-B1-007 GAGGACAAUUGUC GGCGUGAUAGUGC
CACGGC 138 L-RNA GCGGUGUAAAGUA 229-B1-008 GAGGACAAUUGUC
GGCGUGAUAGUGC CACCGC 139 L-RNA GCUGCGUAAAGUA 229-B1-009
GAGGACAAUUGUC GGCGUGAUAGUGC CGCAGC 140 L-RNA GCUGGGUAAAGUA
229-B1-010 GAGGACAAUUGUC GGCGUGAUAGUGC CCCAGC 141 L-RNA
GCGGCGUAAAGUA 229-B1-011 GAGGACAAUUGUC GGCGUGAUAGUGC CGCCGC 142
L-RNA GCGCGCGUAUGGG 238-D4-002 AUUAAGUAAAUGA GGAGUUGGAGGAA GGCGCGC
143 L-RNA GCGCGCGUAUGGG 238-D4-003 AUAAGUAAAUGAG GAGUUGGAGGAAG
GCGCGC 144 L-RNA GGCGCGUAUGGGA 238-D4-004 UUAAGUAAAUGAG
GAGUUGGAGGAAG GCGCC 145 L-RNA GGCGCGUAUGGGA 238-D4-005
UAAGUAAAUGAGG AGUUGGAGGAAGG CGCC 146 L-RNA GGUGUCGUAUGGG 238-D4-006
AUUAAGUAAAUGA GGAGUUGGAGGAA GGGCAUC 147 L-RNA GGUGUCGUAUGGG
238-D4-007 AUAAGUAAAUGAG GAGUUGGAGGAAG GGCAUC 148 L-RNA
GCGCCGUAUGGGA 238-D4-008 UUAAGUAAAUGAG GAGUUGGAGGAAG GGCGC 149
L-RNA GCGCCGUAUGGGA 238-D4-009 UAAGUAAAUGAGG AGUUGGAGGAAGG GCGC 150
L-RNA GGCGCCGUAUGGG 238-D4-010 AUUAAGUAAAUGA GGAGUUGGAGGAA GGGCGCC
151 L-RNA GGCGCCGUAUGGG 238-D4-011 AUAAGUAAAUGAG GAGUUGGAGGAAG
GGCGCC 152 L-RNA GGCGUCGUAUGGG 238-D4-012 AUUAAGUAAAUGA
GGAGUUGGAGGAA GGGCGCC 153 L-RNA GGCGUCGUAUGGG 238-D4-013
AUAAGUAAAUGAG
GAGUUGGAGGAAG GGCGCC 154 L-RNA GGCUCGGACAGCC 238-C4-002
GGGGGACACCAUA UACAGACUACGAU ACGGGCC 155 L-RNA GCUCGGACAGCCG
238-C4-003 GGGGACACCAUAU ACAGACUACGAUA CGGGC 156 L-RNA
CUCGGACAGCCGG 238-C4-004 GGGACACCAUAUA CAGACUACGAUAC GGG 157 L-RNA
5'GACAAUAGUC 158 L-RNA GCCCGGACAGCCG 238-C4-005 GGGGACACCAUAU
ACAGACUACGAUA CGGGC 159 L-RNA GGCCGGACAGCCG 238-C4-006
GGGGACACCAUAU ACAGACUACGAUA CGGCC 160 L-RNA GCGGAGACAGCCG
238-C4-007 GGGGACACCAUAU ACAGACUACGAUA UCCGU 161 L-RNA
AGGCUGACAGCCG 238-C4-008 GGGGACACCAUAU ACAGACUACGAUA GGCCU 162
L-RNA GGCCUGACAGCCG 238-C4-009 GGGGACACCAUAU ACAGACUACGAUA AGGCU
163 L-RNA GCGCGGACAGCCG 238-C4-010 GGGGACACCAUAU ACAGACUACGAUA
CGCGC 164 L-RNA GCCGGACAGCCGG 238-C4-011 GGGACACCAUAUA
CAGACUACGAUAC GGC 165 L-RNA GGCGGACAGCCGG 238-C4-012 GGGACACCAUAUA
CAGACUACGAUAC GCC 166 L-RNA GGCCGACAGCCGG 238-C4-013 GGGACACCAUAUA
CAGACUACGAUAG GCC 167 L-RNA GCGCGACAGCCGG 238-C4-014 GGGACACCAUAUA
CAGACUACGAUAG CGC 168 L-RNA GGCCGGACAGCCG 238-C4-024 GAGGACACCAUAU
ACAGACUACGAUA CGGCC 169 L-RNA GGCCGGACAGCCG 238-C4-025
GCGGACACCAUAU ACAGACUACGAUA CGGCC 170 L-RNA GGCCGGACAGCCG
238-C4-062 GGAGGACACCAUA UACAGACUACGAU ACGGCC 171 L-RNA
5'-NH.sub.2-GCUGUG 229-B1-002- UAAAGUAGAGGAC 5'-Amino AAUUGUCGGCGUG
AUAGUGCCACAGC 172 L-RNA 5'-NH.sub.2-GCACUC 223-05-001-
GUAAAGUAGAGGG 5'-Amino ACCCAGUCCGGCG UGAUAGUGCCGAG UGC 173 L-RNA
5'-PEG-GCUGUG 229-B1-002- UAAAGUAGAGGAC 5'-PEG AAUUGUCGGCGUG
AUAGUGCCACAGC 174 L-RNA 5'-PEG-GGCCGG 238-C4-006- ACAGCCGGGGGAC
5'_PEG ACCAUAUACAGAC UACGAUACGGCC 175 L-RNA 5'-PEG-GCGCGC
238-D4-002- GUAUGGGAUUAAG 5'-PEG UAAAUGAGGAGUU GGAGGAAGGCGCG C 176
L-RNA 5'-PEG-GCGCCG 238-D4-008- UAUGGGAUUAAGU 5'-PEG, AAAUGAGGAGUUG
NOX-H94 GAGGAAGGGCGC 177 L-RNA 5'-CCAUACGGCG 5'CP-
C-C18-C18-NH.sub.2- 11_NOX-H94 178 L-RNA 5'-Biotin-C18- 3'DP-
C18-GCGCCCUUC 13_NOX-H94 CUCC 179 L-RNA 5'-NH.sub.2-GCGCGC
238-D4-002- GUAUGGGAUUAAG 5'-Amino UAAAUGAGGAGUU GGAGGAAGGCGCG C
180 L-RNA 5'-N1-12-GCGC 238-D4-008- CGUAUGGGAUUAA 5'-Amino
GUAAAUGAGGAGU UGGAGGAAGGGCG C 181 L-RNA 5'-NH2-GGCCGG 238-C4-006-
ACAGCCGGGGGAC 5'-Amino ACCAUAUACAGAC UACGAUACGGCC 182 L-RNA 5'
RKAUGGGAKU AAGUAAAUGAGGR GUWGGAGGAAR 183 L-RNA 5' RKAUGGGAKA
AGUAAAUGAGGRG UWGGAGGAAR 184 L-RNA 5' GUAUGGGAUU AAGUAAAUGAGGA
GUUGGAGGAAG 185 L-RNA 5' GRCRGCCGGV GGACACCAUAUAC AGACUACKAUA 186
L-RNA 5' GRCRGCCGGA RGGACACCAUAUA CAGACUACKAUA 187 L-RNA 5'
GACAGCCGGG GGACACCAUAUAC AGACUACGAUA 188 L-RNA 5' WAAAGUWGAR 189
L-RNA 5' RGMGUGWKAG UKC 190 L-RNA 5' GGGCUGAGCC C 191 L-RNA 5'
GCAGAUAAUC UGC 192 L-RNA 5' GGACCAGUCC 193 L-RNA 5' GGACCCAGUC C
194 L-RNA 5' GGACCUAGUC C 195 L-RNA 5' GGACUCAGUC C 196 L-RNA 5'
GCAGGUAAUC UGC 197 L-RNA 5' GCAGGCAAUC UGC 198 L-RNA 5' GACAAUUGUC
199 L-RNA 5' UAAAGUAGAG 200 L-RNA 5' AAAAGUAGAA 201 L-RNA 5'
AAAAGUUGAA 202 L-RNA 5' GGGAUAUAGU GC 203 L-RNA 5' GGCGUGAUAG UGC
204 L-RNA 5' GGAGUGUUAG UUC 205 L-RNA 5' GGCGUGAGAG UGC 206 L-RNA
5' AGCGUGAUAG UGC 207 L-RNA 5' GGCGUGUUAG UGC 208 L-RNA 5'
GGACBYAGUC C 209 L-RNA 5' GGAUACAGUC C 210 L-RNA 5' GCAGGYAAUC UGC
211 L-RNA 5' GACAAUWGUC 212 L-RNA 5' ACUUGUCGAA AGCAAGYU
[0349] The present invention is further illustrated by the figures,
examples and the sequence listing from which further features,
embodiments and advantages may be taken, wherein
[0350] FIGS. 1 and 2 shows an alignment of sequences of Type A
hepcidin binding nucleic acids;
[0351] FIG. 3 shows derivatives of Type A hepcidin binding nucleic
acid 223-C5-001;
[0352] FIG. 4 shows derivatives of Type A hepcidin binding nucleic
acid 229-B1-001;
[0353] FIG. 5 shows an alignment of sequences of Type B hepcidin
binding nucleic acids;
[0354] FIG. 6 shows derivatives of Type B hepcidin binding nucleic
acid 238-D4-001;
[0355] FIG. 7 shows an alignment of sequences of Type C hepcidin
binding nucleic acids;
[0356] FIG. 8 shows derivatives of Type C hepcidin binding nucleic
acid 238-C4-001;
[0357] FIG. 9 shows an alignment of sequences of other hepcidin
binding nucleic acids;
[0358] FIG. 10 shows data regarding the binding of hepcidin binding
nucleic acids 223-C5-001, 229-B1-002, 238-C4-006, 238-D4-001 and
238-D4-008 to human hepcidin-25, cynomolgus hepcidin-25, marmoset
hepcidin-25, mouse hepcidin-25 and rat hepcidin-25;
[0359] FIG. 11 shows data regarding the binding of hepcidin binding
nucleic acids 223-C5-001, 229-B1-002, 238-C4-006, 238-D4-001 and
238-D4-008 to human hepcidin-25, hepcidin-22 and hepcidin-20;
[0360] FIG. 12 shows data regarding the binding of hepcidin binding
nucleic acids 223-C5-001-5'-PEG, 229-B1-002-5'-PEG,
238-C4-006-5'-PEG, 238-D4-002-5'-PEG and 238-D4-008-5'-PEG to human
hepcidin-25;
[0361] FIG. 13 shows Biacore 2000 sensorgram indicating the K.sub.D
value of the aptamer of Type A hepcidin binding nucleic acid
223-C5-001 binding to biotinylated human D-hepcidin-25 at
37.degree. C., whereby the biotinylated human D-hepcidin was
immobilized by strepatavidin coupling procedure on a strepatavidin
conjugated sensor chip at 37.degree. C., represented as response
(RU) over time;
[0362] FIGS. 14 and 15 show the results of the ranking experiments
to compare the hepcidin binding nucleic acids to each other and to
identify the best hepcidin binding nucleic acids, whereby the Type
A hepcidin binding nucleic acid 233-C5-001 was labeled and the
binding of nucleic acid 233-C5-001 to biotinylated human
D-hepcidin-25 at 37.degree. C. was carried out in the presence of
10, 50 or 250 nM non-labeled competitor RNA, the different Type
hepcidin binding nucleic acids, respectively, represented as
binding of 223-C5-001 over concentration of biotinylated human
D-hepcidin-25 (`competitive pull-down assay`)
[0363] FIG. 16 shows Biacore 2000 sensorgram indicating the K.sub.D
value of the aptamer of Type A hepcidin binding nucleic acid
229-B1-001 binding to biotinylated human D-hepcidin-25 at
37.degree. C., whereby the biotinylated human D-hepcidin-25 was
immobilized by strepatavidin coupling procedure on a strepatavidin
conjugated sensor chip at 37.degree. C., represented as response
(RU) over time;
[0364] FIG. 17A/17B show the effect of the Spiegelmers
223-C5-001-5'-PEG, 238-D4-008-5'-Amino and 238-D4-008-5'-PEG
(=NOX-H94) on the effect of human hepcidin-25 on iron-induced
up-regulation of ferroportin, whereby the lysates obtained from
J774.1 cells after stimulation with hepcidin human-25) or
hepcidin-25)+Spiegelmer were separated by SDS-gel electrophoresis
and analysed by Western Blot using an antibody against mouse
ferroportin;
[0365] FIG. 18 shows the effect of the Spiegelmer 223-C5-001-5'-PEG
on hepcidin activity in vivo, whereby the decrease in serum iron
caused by human hepcidin is completely blocked by application of
Spiegelmer 223-05-001-5'-PEG prior to injection of human
hepcidin;
[0366] FIG. 19 shows Biacore 2000 sensorgram indicating the K.sub.D
value of the spiegelmer of hepcidin binding nucleic acid NOX-H94
(=238-D4-008-5'-PEG) binding to biotinylated human L-hepcidin at
37.degree. C., whereby the biotinylated human L-hepcidin was
immobilized by strepatavidin coupling procedure on a strepatavidin
conjugated sensor chip at 37.degree. C., represented as response
(RU) over time;
[0367] FIG. 20 shows the effect of the Spiegelmer NOX-H94
(=238-D4-008-5'-PEG) on hepcidin activity in vivo, whereby the
decrease in serum iron caused by human hepcidin is completely
blocked by application of Spiegelmer NOX-H94 (=238-D4-008-5'-PEG)
prior to injection of human hepcidin;
[0368] FIG. 21 shows the effect of the Spiegelmer NOX-H94
(=238-D4-008-5'-PEG) in an animal model (cynomolgus monkey) for
anaemia of inflammation, whereby IL-6 induces hepcidin secretion
subsequently resulting in anemia in non-human primates; within the
experiment human IL-6 leads a reduction of serum iron concentration
to 27% of the predose value of the vehicle/IL-6 treated monkeys,
the decrease in serum iron is completely blocked by application of
spiegelmer 238-D4-008-5'-PEG prior to injection of human IL-6.
EXAMPLE 1
Nucleic Acids that Bind Human Hepcidin
[0369] Using biotinylated human D-hepcidin-25 as a target, several
nucleic acids that bind to human hepcidin, in particular human
hepcidin-25, human hepcidin-22 and human hepcidin-20, could be
generated: the nucleotide sequences of which are depicted in FIGS.
1 through 9. The nucleic acids were characterized on the aptamer,
i. e. D-nucleic acid level using a direct pull-down assay (Example
3), a competitive pull-down assay (Example 3) and/or surface
plasmon resonance measurement (Example 4) with biotinylated human
D-hepcidin-25 or on the spiegelmer level, i. e. L-nucleic acid with
the natural configuration of human hepcidin-25 (human
L-hepcidin-25), in a competitive pull-down assay (Example 3),
surface plasmon resonance measurement (Example 4), in an in vitro
assay (Example 5) and/or an in vivo assay (Example 6 and 7). The
spiegelmers and aptamers were synthesized as described in Example
2.
[0370] The nucleic acid molecules thus generated exhibit different
sequence motifs, whereby three main types were identified and
defined as Type A, Type B and Type C hepcidin binding nucleic acids
and are depicted in FIGS. 1 through 8.
[0371] For definition of nucleotide sequence motifs, the IUPAC
abbreviations for ambiguous nucleotides are used: [0372] S strong G
or C; [0373] W weak A or U; [0374] R purine G or A; [0375] Y
pyrimidine C or U; [0376] K keto G or U; [0377] M imino A or C;
[0378] B not A C or U or G; [0379] D not C A or G or U; [0380] H
not G A or C or U; [0381] not U A or C or G; [0382] N all A or G or
C or U
[0383] If not indicated to the contrary, any nucleic acid sequence
or sequence of stretches and boxes, respectively, is indicated in
the 5'.fwdarw.3' direction.
1.1 Type A Hepcidin Binding Nucleic Acids
[0384] As depicted in FIG. 1, FIG. 2, FIG. 3 and FIG. 4 the Type A
hepcidin binding nucleic acids comprise one central stretch of
nucleotides, wherein the central stretch of nucleotides comprises
at least two stretches of nucleotides--also referred to herein as
boxes of nucleotides--defining a potential hepcidin binding motif:
the firststretch of nucleotides Box A and the second stretch of
nucleotides Box B.
[0385] The first stretch of nucleotides Box A and the second
stretch of nucleotides Box B are linked to each other by a linking
stretch of nucleotides.
[0386] Within the linking stretch of nucleotides some nucleotides
can hybridize to each other, whereby upon hybridization a
double-stranded structure is formed. However, such hybridization is
not necessarily given in the molecule.
[0387] In general, Type A hepcidin binding nucleic acids comprise
at their 5'-end and the 3'-end terminal stretches of nucleotides:
the first-terminal stretch of nucleotides and the second terminal
stretch of nucleotides. The first terminal stretch of nucleotides
and the second terminal stretch of nucleotides can hybridize to
each other, whereby upon hybridization a double-stranded structure
is formed. However, such hybridization is not necessarily given in
the molecule.
[0388] The five stretches of nucleotides of Type A hepcidin binding
nucleic acids Box A, Box B, linking stretch of nucleotides, first
terminal stretch of nucleotides and second terminal stretch of
nucleotides can be differently arranged to each other: first
terminal stretch of nucleotides--Box A--linking stretch of
nucleotides--Box B--second terminal stretch of nucleotides or first
terminal stretch of nucleotides--Box B--linking stretch of
nucleotides--Box A--second terminal stretch of nucleotides.
[0389] However, the five stretches of nucleotides of Type A
hepcidin binding nucleic acids Box A, Box B, linking stretch of
nucleotides, first terminal stretch of nucleotides and second
terminal stretch of nucleotides can be also arranged to each other
as follows: second terminal stretch of nucleotides--Box A--linking
stretch of nucleotides--Box B--first terminal stretch of
nucleotides or second terminal stretch of nucleotides--Box
B--linking stretch of nucleotides--Box A--first terminal stretch of
nucleotides.
[0390] The sequences of the defined boxes or stretches of
nucleotides may be different between the Type A hepcidin binding
nucleic acids which influences the binding affinity to human
hepcidin, in particular human hepcidin-25. Based on binding
analysis of the different Type A hepcidin binding nucleic acids,
the box A and B and their nucleotide sequences as described in the
following are individually and more preferably in their entirety
essential for binding to human hepcidin, in particular human
hepcidin-25.
[0391] The Type A hepcidin binding nucleic acids according to the
present invention are shown in FIGS. 1 to 4. All of them were
tested as aptamers and/or spiegelmers for their ability to bind
human hepcidin-25, more precisely biotinylated human D-hepcidin-25
and biotinylated human L-hepcidin-24, respectively. The first Type
A hepcidin binding nucleic acid that was characterized for its
binding affinity to human hepcidin-25 is hepcidin binding nucleic
acid 223-05-001. The equilibrium binding constant K.sub.D for human
hepcidin-25 was determined by surface plasmon resonance measurement
(K.sub.D=1.2 nM determined with the aptamer sequence, FIG. 13;
K.sub.D=2.7 nM determined with the spiegelmer sequence, FIG. 11).
In addition to human hepcidin-25, hepcidin binding nucleic acid
223-05-001 binds to human hepcidin-20 with almost the same binding
affinity (FIG. 11).
[0392] The derivatives 223-05-002, 223-05-007 and 223-05-008 of
Type A hepcidin binding nucleic acid 223-05-001 showed reduced
binding affinity in a competitive pull-down assay in comparison to
Type A hepcidin binding nucleic acid 223-05-001 (FIG. 3). Indeed,
hepcidin binding nucleic acid 223-05-006 showed in the same assay
format similar binding to human hepcidin-25 as 223-05-001 (FIG.
3).
[0393] Type A hepcidin binding nucleic acids 223-B5-001,
223-A5-001, 223-A3-001, 223-F5-001, 223-G4-001, 223-A4-001,
229-C2-001, 229-B4-001, 229-E2-001, 229-B1-001 229-G1-001,
229-C4-001, 238-A1-001, 238-E2-001, 237-A7-001, 236-G2-001,
236-D1-001, 229-D1-001 and 229-E1-001 were tested as aptamers in a
competitive pull-down assay vs. Type A hepcidin binding nucleic
acid 223-05-001, whereby at first the binding affinity of the
radioactively labeled aptamer 223-05-001 was determined using the
direct pull-down assay. No competition of the binding of Type A
hepcidin binding nucleic acid 223-05-001 by the nucleic acid
229-E1-001 could be observed (FIGS. 2 and 15). This observation let
assume that nucleic acid 229-E1-001 has no or very low binding
affinity to human hepcidin-25. The Type A hepcidin binding nucleic
acids 223-B5-001, 223-A5-001, 223-A3-001, 223-A4-001, 229-C2-001,
229-B4-001, 229-E2-001, 229-C4-001, 238-A1-001, 238-E2-001,
237-A7-001, 236-G2-001 and 236-D1-001 showed reduced binding
affinity in the competitive pull-down assay in comparison to Type A
hepcidin binding nucleic acid 223-05-001 (FIGS. 1, 14 and 15). Type
A hepcidin binding nucleic acids 223-F5-001, 223-G4-001, 229-G1-001
and 229-D1-001 showed similar binding affinity as 223-05-001 (FIGS.
1, 2, 14 and 15). Better binding affinity for biotinylated human
D-hepcidin-25 could be observed for Type A hepcidin binding nucleic
acid 229-B1-001 (FIGS. 1 and 15). Therefore Type A hepcidin binding
nucleic acid 229-B1-001 was further characterized. The equilibrium
binding constant K.sub.D of Type A hepcidin binding nucleic acid
229-B1-001 was determined by surface plasmon resonance measurement
(K.sub.D=0.5 nM determined with the aptamer sequence, FIG. 16;
K.sub.D=1.25 nM determined with the spiegelmer sequence, data not
shown).
[0394] The derivatives 229-B1-003, 229-B1-004, 229-B1-005 and
229-B1-006 of Type A hepcidin binding nucleic acid 229-B1-001
showed reduced binding affinity in a competitive pull-down assay in
comparison to Type A hepcidin binding nucleic acid 229-B1-001 (FIG.
4). Indeed, Type A hepcidin binding nucleic acids 229-B1-002,
229-B1-007, 229-B1-008, 229-B1-009, 229-B1-010 and 229-B1-011
showed in the same assay format similar binding as or slightly
improved binding to human hepcidin-25 in comparison to 229-B1-001
(FIG. 4).
[0395] Type A hepcidin binding nucleic acid 229-B1-002 was further
characterized. The equilibrium binding constant K.sub.D of Type A
hepcidin binding nucleic acid 229-B1-002 was determined by surface
plasmon resonance measurement (K.sub.D=1.47 nM determined with the
spiegelmer sequence, FIGS. 10 and 11).
[0396] Furthermore the binding specificity/selectivity of Type A
hepcidin binding nucleic acid 229-B1-002 was tested with the
following hepcidin molecules: human hepcidin-25, cynomolgus
hepcidin-25, mouse hepcidin-25, rat hepcidin-25, human hepcidin-22
and human hepcidin-20 (FIGS. 10 and 11). Type A hepcidin binding
nucleic acid 229-B1-002 shows similar binding to human hepcidin-25,
cynomolgus hepcidin-25, human hepcidin-22 and human hepcidin-20 and
no binding to mouse hepcidin-25 and rat hepcidin-25 (FIGS. 10 and
11).
[0397] Except for Type A nucleic acid 229-E1-001, all Type A
hepcidin binding nucleic acids according to the present invention
comprise the first stretch Box A. In Type A hepcidin binding
nucleic acid 229-D1-001 Box A is linked with its 3'-end to the
5'-end of the second terminal stretch (FIG. 2). In all other Type A
hepcidin binding nucleic acids Box A is linked with its 5'-end to
the 3'-end of the first terminal stretch (FIGS. 1 to 4). Type A
hepcidin binding nucleic acids comprising the Box A share the
sequence 5' WAAAGUWGAR 3' for Box A. Beside Type A hepcidin binding
nucleic acids 229-C4-001/236-G2-001 and 236-D1-001 that comprise a
sequence of 5' AAAAGUAGAA 3' and 5' AAAAGUUGAA 3', respectively,
for Box A, the sequence of Box A of all other Type A hepcidin
binding nucleic acids is 5' UAAAGUAGAG 3'.
[0398] Except for Type A hepcidin binding nucleic acid 236-D1-001
(see FIG. 2), all Type A hepcidin binding nucleic acids comprise a
Box B with a sequence of 5' RGMGUGWKAGUKC 3'. Type A hepcidin
binding nucleic acid 236-D1-001 comprise a Box B that is different
from the consensus sequence of Box of the other Type A hepcidin
binding nucleic acids: 5' GGGAUAUAGUGC 3'. Because nucleic acid
229-E1-001 comprising no Box A does not or weakly bind to human
hepcidin-25 as described supra, let assume, that beside Box B Box A
is essential for binding to human hepcidin-25, in particular for
high affinity binding to human hepcidin-25. In Type A hepcidin
binding nucleic acid 229-D1-001 Box B is linked with its 5'-end to
the 3'-end of the first terminal stretch (FIG. 2). In all other
Type A hepcidin binding nucleic acids Box B--except for hepcidin
binding nucleic acid 229-E1-001--is linked with its 3'-end to the
5'-end of the second terminal stretch (FIGS. 1, 3 and 4). Hepcidin
binding nucleic acids with different sequences of Box B showed high
binding affinity to human hepcidin-25: [0399] a) 229-B1-001 and
derivatives, 223-05-001 and derivatives, 223-B5-001, 223-A5-001,
223-A3-001, 223-F5-001, 223-G4-001, 223-A4-001, 238-E2: 5'
GGCGUGAUAGUGC 3'; [0400] b) 229-B4-001,229-C2-001, 229-E2-001: 5'
GGAGUGUUAGUUC 3'; [0401] c) 229-G1-001: 5' GGCGUGAGAGUGC 3'; [0402]
d) 229-C4-001, 236-G2-001: 5' AGCGUGAUAGUGC 3' [0403] e)
238-A1-001: 5' GGCGUGUUAGUGC 3' [0404] f) 236-D1-001: 5'
GGGAUAUAGUGC 3'.
[0405] Hepcidin binding nucleic acids that comprise Box A and Box B
are linked to each other by a linking stretch of nucleotides of 10
to 18 nucleotides. The linking stretch of nucleotides comprises in
5'->3' direction a first linking substretch of nucleotides, a
second linking substretch of nucleotides and a third linking
substretch of nucleotides, whereby preferably the first linking
substretch of nucleotides and the third linking substretch of
nucleotides optionally hybridize to each other, whereby upon
hybridization a double-stranded structure is formed. However, such
hybridization is not necessarily given in the molecule. If the
nucleotides of the first linking substretch of nucleotides and
third linking substretch of nucleotides hybridize to each other
they are forming in between a loop of nucleotides (i.e. the second
substretch) that do not hybridize to each other. The first
substretch of nucleotides and the third substretch of nucleotides
of the linking stretch of nucleotides of hepcidin binding nucleic
acids comprise three (see 229-B1-001 and derivatives, 229-G1-001),
four (see 223-05-001 and derivatives, 223-B5-001, 223-A5-001,
223-A3-001, 223-F5-001, 223-G4-001, 223-A4-001, 229-C2-001,
229-B4-001, 229-E2-001, 238-A1-001, 238-E2-001, 237-A7-001), five
(229-D1-001) or six (229-C4-001, 236-G2-001) nucleotides. Type A
binding nucleic acid 236-D1-001 comprises a linking stretch of
nucleotides of 18 nucleotides, whereby due to the specific sequence
of said linking stretch of nucleotides the linking stretch of
nucleotides can not be classified in a first linking substretch of
nucleotides, a second linking substretch of nucleotides and a third
linking substretch of nucleotides.
[0406] As shown for hepcidin binding nucleic acids 223-05-001 and
derivarives thereof, 223-B5-001, 223-A5-001, 223-A3-001,
223-F5-001, 223-G4-001, 238-E2-001 and 223-A4-001 the first
substretch of the linking stretch of nucleotides comprises the
sequence 5' GGAC 3' or 5' GGAU 3' or 5' GGA 3' and the third
substretch of the linking stretch of nucleotides comprises the
nucleotide sequence of 5' GUCC 3'. Other combinations of the first
and the third substretch of the linking stretch of nucleotides are
[0407] a) 5' GCAG 3' and 5' CUGC 3' (229-C2-001, 229-B4-001,
229-E2-001, 237-A7-001) or [0408] b) 5' GAC 3' and 5' GUC 3'
(229-B1-001 and derivatives thereof, 229-G1-001) or [0409] c) 5'
ACUUGU 3' and 5' GCAAGU 3' (229-C4-001) or [0410] d) 5' ACUUGU 3'
and 5' GCAAGC 3' (236-G2-001) or [0411] e) 5' UCCAG 3' and 5' CUGGA
3' (229-D1-001) or [0412] f) 5' GGGC 3' and 5' GCCC 3'
(238-A1-001).
[0413] As shown in FIGS. 1, 2, 3 and 4 the second substretch of the
linking stretch of nucleotides comprises three to five nucleotides,
whereby the different sequences are very heterogeneous: 5' CGAAA
3', 5' GCAAU 3', 5' GUAAU 3', 5' AAUU 3', 5' AUAAU 3', 5' AAUA 3',
5' CCA 3', 5' CUA 3', 5' UCA 3', 5' ACA 3', 5' GUU 3', 5' UGA 3'
and 5' GUA 3'. The second substretch of the linking stretch of
nucleotides of hepcidin binding nucleic acids can be summarized
into the following generic sequences: 5' VBAAW 3', 5' AAUW 3' or 5'
NBW 3'.
[0414] However, the hepcidin binding nucleic acids with the best
binding affinity comprise the following sequences for the second
substretch of the linking stretch of nucleotides: [0415] a) 5' AAUU
3' (229-B1 and derivatives thereof) [0416] b) 5' CCA 3' (223-05 and
derivatives thereof) [0417] c) 5' CUA 3' (223-F5-001) [0418] d) 5'
UCA 3' (223-G4-001) [0419] e) 5' AAUA 3' (229-G1-001).
[0420] As described supra, the nucleotide sequence of the first and
the third substretch of the linking stretch are related to each
other. Moreover, the nucleotide sequence of the second substretch
of the linking stretch of nucleotides is related to a specific pair
of the first and the third substretch of nucleotides leading to the
following sequences or generic sequences of the linking stretch of
nucleotides of hepcidin binding nucleic acids: [0421] a) 5'
GGACBYAGUCC 3' (223-05-001, 223-05-002, 223-05-006, 223-05-007,
223-B5-001, 223-A5-001, 223-A3-001, 223-F5-001, 223-G4-001,
238-E2-001), preferably 5' GGACCCAGUCC 3', 5' GGACCUAGUCC 3' or 5'
GGACUCAGUCC 3' or 5' GGACGUAGUCC 3', more preferably 5' GGACCCAGUCC
3', 5' GGACCUAGUCC 3' or 5' GGACUCAGUCC 3'; or [0422] b) 5'
GGAUACAGUCC 3' (223-A4-001); or [0423] c) 5' GCAGGYAAUCUGC 3'
(229-C2-001, 229-B4-001, 229-E2-001), preferably 5' GCAGGUAAUCUGC
3' or 5' GCAGGCAAUCUGC 3', more preferably 5' GCAGGUAAUCUGC 3'; or
[0424] d) 5' GACAAUWGUC 3' (229-B1-001 and derivatives 229-G1-001),
preferably 5' GACAAUUGUC 3' or 5' GACAAUAGUC 3'; or [0425] e) 5'
ACUUGUCGAAAGCAAGY 3' (229-C4-001, 236-G2-001); or [0426] f) 5'
UCCAGGUUCUGGA 3' (229-D1-001); or [0427] g) 5' GGGCUGAGCCC 3'
(238-A1-001); or [0428] h) 5' GCAGAUAAUCUGC 3' (237-A7-001); or
[0429] i) 5' GGACCAGUCC 3' (223-05-008).
[0430] As mentioned before, the linking stretch of nucleotides of
Type A binding nucleic acid 236-D1-001 can not be classified in a
first linking substretch of nucleotides, a second linking
substretch of nucleotides and a third linking substretch of
nucleotides. However, the sequence of the linking stretch of
nucleotides of Type A binding nucleic acid 236-D1-001 is 5'
AUUUGUUGGAAUCAAGCA 3'.
[0431] The first and second terminal stretches of nucleotides of
Type A hepcidin binding nucleic acids comprise four (e.g.
229-C4-001), five, (e.g. 223-05-007), six (e.g. 229-B1-001) or
seven (e.g. 223-05-001) nucleotides, whereby the stretches
optionally hybridize with each other, whereby upon hybridization a
double-stranded structure is formed. This double-stranded structure
can consists of four to seven basepairs. However, such
hybridization is not necessarily given in the molecule.
[0432] Combining the first and second terminal stretches of
nucleotides of all tested hepcidin binding nucleic acids the
generic formula for the first terminal stretch of nucleotides and
for the second terminal stretch of nucleotides are 5'
X.sub.1X.sub.2X.sub.3BKBK 3' (first terminal stretch of
nucleotides) and 5' MVVVX.sub.4X.sub.5X.sub.6 3' (second terminal
stretch of nucleotides), whereby
X.sub.1 is G or absent, X.sub.2 is S or absent, X.sub.3 is V or
absent, X.sub.4 is B or absent, X.sub.5 is S or absent, and X.sub.6
is C or absent, preferably [0433] a) X.sub.1 is G, X.sub.2 is S,
X.sub.3 is V, X.sub.4 is B, X.sub.5 is S, and X.sub.6 is C or
[0434] b) X.sub.1 is absent, X.sub.2 is S, X.sub.3 is V, X.sub.4 is
B, X.sub.5 is S, and X.sub.6 is C or [0435] d) X.sub.1 is G,
X.sub.2 is S, X.sub.3 is V, X.sub.4 is B, X.sub.5 is S, and X.sub.6
is absent or [0436] e) X.sub.1 is absent, X.sub.2 is S, X.sub.3 is
V, X.sub.4 is B, X.sub.5 is S, and X.sub.6 is absent or [0437] f)
X.sub.1 is absent, X.sub.2 is absent, X.sub.3 is V, X.sub.4 is B,
X.sub.5 is S, and X.sub.6 is absent or [0438] g) X.sub.1 is absent,
X.sub.2 is S, X.sub.3 is V, X.sub.4 is B, X.sub.5 is absent, and
X.sub.6 is absent or [0439] f) X.sub.1 is absent, X.sub.2 is
absent, X.sub.3 is V or absent, X.sub.4 is B or absent, X.sub.5 is
absent, X.sub.6 is absent.
[0440] However, the hepcidin binding nucleic acids with the best
binding affinity comprise the following combinations of first and
second terminal stretches of nucleotides: [0441] a) 223-05-001,
223-F5-001, 223-G4-001: 5' GCACUCG 3' (first terminal stretch of
nucleotides) and 5' CGAGUGC 3' (second terminal stretch of
nucleotides); [0442] b) 229-B1-002: 5' GCUGUG 3' (first terminal
stretch of nucleotides) and 5' CACAGC 3'(second terminal stretch of
nucleotides); [0443] c) 229-B1-001, 229-G1-001: 5' CGUGUG 3' (first
terminal stretch of nucleotides) and 5' CACACG 3'(second terminal
stretch of nucleotides); [0444] d) 229-D1-001: 5' CGUGCU 3' (first
terminal stretch of nucleotides) and 5' AGCACG 3'(second terminal
stretch of nucleotides); [0445] e) 223-05-006: 5' CGCGCG 3' (first
terminal stretch of nucleotides) and 5' CGCGCG 3'(second terminal
stretch of nucleotides) [0446] f) 229-B1-007: 5' GCCGUG 3' (first
terminal stretch of nucleotides) and 5' CACGGC 3' (second terminal
stretch of nucleotides) [0447] g) 229-B1-008: 5' GCGGUG 3' (first
terminal stretch of nucleotides) and 5' CACCGC 3'(second terminal
stretch of nucleotides) [0448] h) 229-B1-009: 5' GCUGCG 3' (first
terminal stretch of nucleotides) and 5' CGCAGC 3' (second terminal
stretch of nucleotides) [0449] i) 229-B1-010: 5' GCUGGG 3' (first
terminal stretch of nucleotides) and 5' CCCAGC 3' (second terminal
stretch of nucleotides) [0450] j) 229-B1-011: 5' GCGGCG 3' (first
terminal stretch of nucleotides) and 5' CGCCGC 3'(second terminal
stretch of nucleotides).
[0451] In order to prove the functionality of hepcidin binding
nucleic acids as spiegelmers, Type A hepcidin binding nucleic acids
223-05-001 and 229-B1-002 were synthesized as spiegelmers
comprising an Amino-group at its 5'-end. To the amino-modified
spiegelmers 223-C5-001-5'-Amino and 229-B1-002-5'-Amino a 40 kDa
PEG-moiety was coupled leading to Type A hepcidin binding nucleic
acids 223-05-001-5'-PEG and 229-B1-002-5'-PEG. Synthesis and
PEGyation of the spiegelmer is described in Example 2.
[0452] The equilibrium binding constant K.sub.D of spiegelmers
223-05-001-5'-PEG and 229-B1-002 were determined by surface plasmon
resonance measurement (FIG. 12): 223-05-001-5'-PEG: K.sub.D=4.44
nM; 229-B1-002-5'-PEG: K.sub.D=1.92 nM.
[0453] The spiegelmer 223-05-001-5'-PEG was tested to
inhibit/antagonize the function of hepcidin in vitro and in vivo.
As shown in Example 5, Spiegelmer 223-05-001-5'-PEG inhibits the
hepcidin-induced downregulation of ferroportin in vitro. The
applicability for in vivo use of the Spiegelmer 223-05-001-5'-PEG
was tested in an animal model for anaemia of inflammation, wherein
the known properties of human hepcidin-25 to induce a serum iron
decrease was utilized (Example 5).
1.2 Type B Hepcidin Binding Nucleic Acids
[0454] As depicted in FIGS. 5 and 6, the Type B hepcidin binding
nucleic acids comprise one central stretch of nucleotides defining
a potential hepcidin binding motif.
[0455] In general, Type B hepcidin binding nucleic acids comprise
at their 5'-end and the 3'-end terminal stretches of nucleotides:
the first terminal stretch of nucleotides and the second terminal
stretch of nucleotides. The first terminal stretch of nucleotides
and the second terminal stretch of nucleotides can hybridize to
each other, whereby upon hybridization a double-stranded structure
is formed. However, such hybridization is not necessarily given in
the molecule.
[0456] The three stretches of Type B hepcidin binding nucleic acids
the first terminal stretch of nucleotides, the central stretch of
nucleotides and the second terminal stretch of nucleotides can be
differently arranged to each other: first terminal stretch of
nucleotides--central stretch of nucleotides--second terminal
stretch of nucleotides or second terminal stretch of
nucleotides--central stretch of nucleotides--first terminal stretch
of nucleotides.
[0457] The sequences of the defined stretches may be different
between the Type B hepcidin binding nucleic acids which influences
the binding affinity to human hepcidin, in particular human
hepcidin-25. Based on binding analysis of the different hepcidin
binding nucleic acids, the central stretch of nucleotides and its
nucleotide sequences as described in the following is individually
and more preferably in its entirety essential for binding to human
hepcidin-25
[0458] The Type B hepcidin binding nucleic acids according to the
present invention are shown in FIGS. 5 and 6. All of them were
tested as aptamers or spiegelmers for their ability to bind human
hepcidin-25, more precisely biotinylated human D-hepcidin-25 and
biotinylated human L-hepcidin-25, respectively.
[0459] The Type B hepcidin binding nucleic acids 238-D2-001,
238-D4-001, 238-H1-001, 238-A2-001, 238-G2-001, 238-G4-001,
238-G3-001 were tested as aptamers in a competitive pull-down assay
vs. Type A hepcidin binding nucleic acid 229-B1-001. Only Type B
hepcidin binding nucleic acid 238-G4-001 showed reduced binding
affinity in the competitive pull-down assay in comparison to Type A
hepcidin binding nucleic acid 229-B1-001 (FIG. 5).
[0460] Type B hepcidin binding nucleic acids 238-D2-001,
238-D4-001, 238-H1-001, 238-A2-001, 238-G2-001 and 238-G3-001
showed improved binding affinity in comparison to Type A hepcidin
binding nucleic acid 229-B1-001 (FIG. 5). Type B hepcidin binding
nucleic acid 238-D4-001 was further characterized. The equilibrium
binding constant K.sub.D of spiegelmer 238-D4-001 was determined by
surface plasmon resonance measurement (K.sub.D=0.51 nM; FIG.
5).
[0461] The derivatives 238-D4-003, 238-D4-005, 238-D4-007,
238-D4-009, 238-D4-010, 238-D4-011, and 238-D4-013 of Type B
hepcidin binding nucleic acid 238-D4-001 showed reduced binding
affinity in a competitive pull-down assay (or shown by surface
plasmon resonance measurement) in comparison to Type B hepcidin
binding nucleic acid 238-D4-001 (FIG. 6). Indeed, hepcidin binding
nucleic acids 238-D4-002, 238-D4-004, 238-D4-006, 238-D4-008 and
238-D4-012 showed in the same assay format similar binding to human
hepcidin as 238-D4-001 (FIG. 6). The equilibrium binding constant
K.sub.D of spiegelmers 238-D4-002, 238-D4-006 and 238-D4-008 were
determined by surface plasmon resonance measurement. The calculated
equilibrium binding constants of the derivatives of 238-D4-001 are
in same range as shown for 238-D4-001 itself (FIG. 6).
[0462] Furthermore the binding selectivity of Type B hepcidin
binding nucleic acids 238-D4-001 and 238-D4-008 were tested with
the following hepcidin molecules: human hepcidin-25, cynomolgus
hepcidin-25, marmoset hepcidin-25 (only for 238-D4-008), mouse
hepcidin-25, rat hepcidin-25, human hepcidin-22 (not for
238-D4-008) and human hepcidin-20 (FIGS. 10 and 11). Type B
hepcidin binding nucleic acid 238-D4-001 and 238-D4-008 shows
similar binding to human hepcidin-25, human hepcidin-22, human
hepcidin-20 and cynomolgus hepcidin-25, weaker binding to marmoset
hepcidin-25 and no binding to mouse hepcidin-25 and rat
hepcidin-25, (FIGS. 10 and 11).
[0463] The Type B hepcidin binding nucleic acids according to the
present invention share the sequence 5'
RKAUGGGAKUAAGUAAAUGAGGRGUWGGAGGAAR 3' or 5'
RKAUGGGAKAAGUAAAUGAGGRGUWGGAGGAAR 3' for the central stretch of
nucleotides. Type B hepcidin binding nucleic acid 238-D4-001 and
its derivatives that showed the same binding affinity to human
hepcidin-25 share the consensus sequence comprises the sequence 5'
GUAUGGGAUUAAGUAAAUGAGGAGUUGGAGGAAG 3' for the central stretch of
nucleotides.
[0464] The first and second terminal stretches of nucleotides of
Type B hepcidin binding nucleic acids comprise five (238-D4-004,
238-D4-005, 238-D4-008, 238-D4-009), six (238-D4-002, 238-D4-003,
238-D4-006, 238-D4-007, 238-D4-010, 238-D4-011, 238-D4-012,
238-D4-013) or eight (238-D2-001, 238-D4-001, 238-H1-001,
238-A2-001, 238-G2-001, 238-G4-001, 238-G3-001) nucleotides,
whereby the stretches optionally hybridize with each other, whereby
upon hybridization a double-stranded structure is formed. This
double-stranded structure can consists of five to eight basepairs.
However, such hybridization is not necessarily given in the
molecule.
[0465] Combining the first and second terminal stretches of
nucleotides of all tested Type B hepcidin binding nucleic acids the
generic formula for the first terminal stretch of nucleotides and
for the second terminal stretch of nucleotides are 5'
X.sub.1X.sub.2X.sub.3SBSBC3' (first terminal stretch of
nucleotides) and 5' GVBVBX.sub.4X.sub.5X.sub.6 3' (second terminal
stretch of nucleotides), wherein X.sub.1 is A or absent, X.sub.2 is
G or absent, X.sub.3 is B or absent, X.sub.4 is S or absent,
X.sub.5 is C or absent, and X.sub.6 is U or absent,
preferably [0466] a) X.sub.1 is A, X.sub.2 is G, X.sub.3 is B,
X.sub.4 is S, X.sub.5 is C, and X.sub.6 is U or [0467] b) X.sub.1
is absent, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S, X.sub.5 is C,
and X.sub.6 is U or [0468] c) X.sub.1 is A, X.sub.2 is G, X.sub.3
is B, X.sub.4 is S, X.sub.5 is C, and X.sub.6 is absent or [0469]
d) X.sub.1 is absent, X.sub.2 is G, X.sub.3 is B, X.sub.4 is S,
X.sub.5 is C, and X.sub.6 is absent or [0470] e) X.sub.1 is absent,
X.sub.2 is absent, X.sub.3 is B, X.sub.4 is 5, X.sub.5 is C, and
X.sub.6 is absent or [0471] f) X.sub.1 is absent, X.sub.2 is G,
X.sub.3 is B, X.sub.4 is S, X.sub.5 is absent, and X.sub.6 is
absent or [0472] g) X.sub.1 is absent, X.sub.2 is absent, X.sub.3
is B or absent, X.sub.4 is S or absent, X.sub.5 is absent, and
X.sub.6 is absent.
[0473] However, the best binding Type B hepcidin binding nucleic
acids comprise the following combinations of first and second
terminal stretches of nucleotides: [0474] a) 238-D2-001: 5'
AGCGUGUC 3' (first terminal stretch of nucleotides) and 5' GGUGCGCU
3' (second terminal stretch of nucleotides). [0475] b) 238-D4-001:
5' AGCGUGUC 3' (first terminal stretch of nucleotides) and 5'
GGCAUGCU 3' (second terminal stretch of nucleotides). [0476] c)
238-1-11-001: 5' AGUGUGUC 3' (first terminal stretch of
nucleotides) and 5' GAUGCGCU 3' (second terminal stretch of
nucleotides). [0477] d) 238-A2-001: 5' AGUGUGUC 3' (first terminal
stretch of nucleotides) and 5' GGCAUGCU 3' (second terminal stretch
of nucleotides). [0478] e) 238-G2-001: 5' AGCGUGCC 3' (first
terminal stretch of nucleotides) and 5' GGUGCGCU 3' (second
terminal stretch of nucleotides). [0479] f) 238-G3-001: 5' AGCGCGCC
3' (first terminal stretch of nucleotides) and 5' GGCGCGCU 3'
(second terminal stretch of nucleotides). [0480] g) 238-D4-002: 5'
GCGCGC 3' (first terminal stretch of nucleotides) and 5' GCGCGC 3'
(second terminal stretch of nucleotides) [0481] h) 238-D4-006: 5'
GGUGUC 3' (first terminal stretch of nucleotides) and 5' GGCAUC 3'
(second terminal stretch of nucleotides) [0482] i) 238-D4-012: 5'
GGCGUC 3' (first terminal stretch of nucleotides) and 5' GGCGCC 3'
(3'-terminal stretch of nucleotides) [0483] j) 238-D4-008: 5' GCGCC
3' (first terminal stretch of nucleotides) and 5' GGCGC 3' (second
terminal stretch of nucleotides) [0484] k) 238-D4-004: 5' GGCGC 3'
(first terminal stretch of nucleotides) and 5' GCGCC 3' (second
terminal stretch of nucleotides)
[0485] In order to prove the functionality of Type B hepcidin
binding nucleic acids as spiegelmers, hepcidin binding nucleic
acids 238-D4-002 and 238-D4-008 were synthesized as spiegelmer
comprising an Amino-group at its 5'-end. To the amino-modified
spiegelmers 238-D4-002-5'-Amino and 238-D4-008-5'-Amino a 40 kDa
PEG-moiety was coupled leading to hepcidin binding nucleic acids
238-D4-002-5'-PEG and 238-D4-008-5'PEG. Synthesis and PEGyation of
the spiegelmer is described in Example 2.
[0486] The equilibrium binding constant K.sub.D of spiegelmers
238-D4-002-5'-PEG and 238-D4-008-5'-PEG were determined by surface
plasmon resonance measurement (FIG. 12): [0487] 238-D4-002-5'-PEG:
0.53 nM, [0488] 238-D4-008-5'-PEG: 0.64 nM.
[0489] The spiegelmer 238-D4-008-5'-PEG was tested to
inhibit/antagonize the function of hepcidin in vitro and in vivo.
As shown in Example 5, Spiegelmer 238-D4-008-5'-PEG inhibits the
hepcidin-induced downregulation of ferroportin in vitro. The
applicability for in vivo use of the spiegelmer 238-D4-008-5'-PEG
was tested in an animal model for anaemia of inflammation, wherein
the known properties of human hepcidin-25 to induce a serum iron
decrease was utilized (Example 5, FIG. 20). Moreover, Spiegelmer
238-D4-008-5'-PEG was tested in another animal model (cynomolgus
monkey) for anaemia of inflammation, whereby IL-6 induces hepcidin
secretion subsequently resulting in anemia in non-human primates.
Within the experiment human IL-6 leads a reduction of serum iron
concentration (Example 6, FIG. 21).
1.3 Type C Hepcidin Binding Nucleic Acids
[0490] As depicted in FIGS. 7 and 8 the Type C hepcidin binding
nucleic acids comprise one central stretch of nucleotides defining
a potential hepcidin binding motif.
[0491] In general, Type C hepcidin binding nucleic acids comprise
at their Send and the 3'-end terminal stretches: the first terminal
stretch of nucleotides and the second terminal stretch of
nucleotides. The first terminal stretch of nucleotides and the
second terminal stretch of nucleotides can hybridize to each other,
whereby upon hybridization a double-stranded structure is formed.
However, such hybridization is not necessarily given in the
molecule.
[0492] The three stretches of nucleotides of Type C hepcidin
binding nucleic acids first terminal stretch of nucleotides,
central stretch of nucleotides and second terminal stretch of
nucleotides can be differently arranged to each other: first
terminal stretch of nucleotides--central stretch of
nucleotides--second terminal stretch of nucleotides or second
terminal stretch of nucleotides--central stretch of
nucleotides--first terminal stretch of nucleotides.
[0493] The sequences of the defined stretches may be different
between the Type C hepcidin binding nucleic acids which influences
the binding affinity to human hepcidin, in particular
human-hepcidin-25. Based on binding analysis of the different Type
C hepcidin binding nucleic acids, the central stretch of
nucleotides and its nucleotide sequences as described in the
following is individually and more preferably in its entirety
essential for binding to human hepcidin.
[0494] Type C hepcidin binding nucleic acids according to the
present invention are shown in FIGS. 7 and 8. All of them were
tested as aptamers or spiegelmers for their ability to bind human
hepcidin-25, more precisely biotinylated human D-hepcidin-25 and
biotinylated human L-hepcidin-25.
[0495] The Type C hepcidin binding nucleic acids 238-C4-001,
238-E3-001, 238-F2-001, 238-A4-001 and 238-E1-001 were tested as
aptamers in a competitive pull-down assay vs. Type A hepcidin
binding nucleic acid 229-B1-001. The Type C hepcidin binding
nucleic acids showed improved binding affinity in comparison to
Type A hepcidin binding nucleic acid 229-B1-001 (FIG. 7). Type C
hepcidin binding nucleic acid 238-C4-001 was further characterized.
The equilibrium binding constant K.sub.D of the spiegelmer
238-C4-001 was determined by surface plasmon resonance measurement
(K.sub.D=0.9 nM; FIG. 7).
[0496] The derivatives 238-C4-003, 238-C4-004, 238-C4-005,
238-C4-007, 238-C4-008, 238-C4-009, 238-C4-011, 238-C4-012,
238-C4-013, 238-C4-014, 238-C4-024, 238-C4-025 and 238-C4-062 of
Type C hepcidin binding nucleic acid 238-C4-001 showed reduced
binding affinity in a competitive pull-down assay or by plasmon
resonance measurement in comparison to hepcidin binding nucleic
acid 238-C4-001 or 238-C4-006 (FIG. 8). Nucleic acid 238-C4-063
showed no binding to hepcidin. Indeed, hepcidin binding nucleic
acids 238-C4-002, 238-C4-006 and 238-C4-010 showed in the same
assay similar binding to human hepcidin-25 as 238-C4-001 (FIG. 8).
The equilibrium binding constant K.sub.D of Spiegelmers 238-C4-002
and 238-C4-006 were determined by surface plasmon resonance
measurement. The calculated equilibrium binding constants of the
derivatives of 238-C4-001 are in same range as shown for 238-C4-001
itself (FIG. 8).
[0497] Furthermore the binding specificity/selectivity of Type C
hepcidin binding nucleic acid 238-C4-006 was tested with the
following hepcidin molecules: human hepcidin-25, cynomolgus
hepcidin-25, marmoset hepcidin-25, mouse hepcidin-25, rat
hepcidin-25, human hepcidin-22 and human hepcidin-20 (FIGS. 10 and
11). Type C hepcidin binding nucleic acid 238-C4-006 shows similar
binding to human hepcidin-25, human hepcidin-22, human hepcidin-20
and cynomolgus hepcidin-25 and no binding to marmoset hepcidin-25,
mouse hepcidin-25 and rat hepcidin-25 (FIGS. 10 and 11).
[0498] Except for nucleic acid 238-C4-063 that shows no binding to
hepcidin-25, the Type C hepcidin binding nucleic acids according to
the present invention share the sequence 5'
GRCRGCCGGVGGACACCAUAUACAGACUACKAUA 3' or 5'
GRCRGCCGGVAGGACACCAUAUACAGACUACKAUA 3' for the central stretch of
nucleotides. Type C hepcidin binding nucleic acid 238-C4-001 and
its derivatives 238-C4-002, 238-C4-005, 238-C4-010 and Type C
hepcidin binding nucleic acids 238-E3-001, 238-F2-001, 238-A4-001,
238-E1-001 that all showed the same binding affinity share the
consensus sequence 5' GRCRGCCGGGGGACACCAUAUACAGACUACKAUA 3', and
preferably the sequence 5' GACAGCCGGGGGACACCAUAUACAGACUACGAUA
3'.
[0499] The first and second terminal stretches of nucleotides of
Type C hepcidin binding nucleic acids comprise four (238-C4-004,
238-C4-011, 238-C4-012, 238-C4-013, 238-C4-014), five (238-C4-003,
238-C4-005, 238-C4-006, 238-C4-007, 238-C4-008, 238-C4-009,
238-C4-010, 238-C4-024, 238-C4-025, 238-C4-062), six (238-C4-002)
or seven (238-C4-001, 238-E3-001, 238-F2-001, 238-A4-001,
238-E1-001) nucleotides, whereby the stretches optionally hybridize
with each other, whereby upon hybridization a double-stranded
structure is formed. This double-stranded structure can consists of
four to seven basepairs. However, such hybridization is not
necessarily given in the molecule.
[0500] Combining the first and second terminal stretches of
nucleotides of all tested Type C hepcidin binding nucleic acids the
generic formula for the first terminal stretch of nucleotides and
for the second terminal stretch of nucleotides are 5'
X.sub.1X.sub.2X.sub.3SBSN3' (first terminal stretch of nucleotides)
and 5' NSVSX.sub.4X.sub.5X.sub.6 3' (second terminal stretch of
nucleotides), wherein X.sub.1 is A or absent, X.sub.2 is G or
absent, X.sub.3 is R or absent, X.sub.4 is Y or absent, X.sub.5 is
C or absent, X.sub.6 is U or absent,
preferably [0501] a) X.sub.1 is A, X.sub.2 is G, X.sub.3 is R,
X.sub.4 is Y, X.sub.5 is C, and X.sub.6 is U or [0502] b) X.sub.1
is absent, X.sub.2 is G, X.sub.3 is R, X.sub.4 is Y, X.sub.5 is C,
and X.sub.6 is U or [0503] c) X.sub.1 is A, X.sub.2 is G, X.sub.3
is R, X.sub.4 is Y, X.sub.5 is C, and X.sub.6 is absent or [0504]
d) X.sub.1 is absent, X.sub.2 is G, X.sub.3 is R, X.sub.4 is Y,
X.sub.5 is C, and X.sub.6 is absent or [0505] e) X.sub.1 is absent,
X.sub.2 is absent, X.sub.3 is R, X.sub.4 is Y, X.sub.5 is C, and
X.sub.6 is absent or [0506] f) X.sub.1 is absent, X.sub.2 is G,
X.sub.3 is R, X.sub.4 is Y, X.sub.5 is absent, and X.sub.6 is
absent or [0507] g) X.sub.1 is absent, X.sub.2 is absent, X.sub.3
is R or absent, X.sub.4 is Y or absent, X.sub.5 is absent, and
X.sub.6 is absent.
[0508] However, the best binding Type C hepcidin binding nucleic
acids comprise the following combinations of first and 3'-terminal
stretches of nucleotides: [0509] a) 238-C4-001, 238-E3-001: 5'
AGGCUCG 3' (first terminal stretch of nucleotides) and 5' CGGGCCU
3' (second terminal stretch of nucleotides), [0510] b) 238-F2-001:
5' AGGCCCG 3' (first terminal stretch of nucleotides) and 5'
CGGGCCU 3' (second terminal stretch of nucleotides), [0511] c)
238-A4-001: 5' AGGCUUG 3' (first terminal stretch of nucleotides)
and 5' CGAGCCU 3' (second terminal stretch of nucleotides), [0512]
d) 238-E1-001: 5' AGACUUG 3' (first terminal stretch of
nucleotides) and 5' CGAGUCU 3' (second terminal stretch of
nucleotides), [0513] e) 238-C4-002: 5' GGCUCG 3' (first terminal
stretch of nucleotides) and 5' CGGGCC 3' (second terminal stretch
of nucleotides), [0514] f) 238-C4-006: 5' GGCCG 3' (first terminal
stretch of nucleotides) and 5' CGGCC 3' (second terminal stretch of
nucleotides) [0515] g) 238-C4-010: 5' GCGCG 3' (first terminal
stretch of nucleotides) and 5' CGCGC 3' (second terminal stretch of
nucleotides).
[0516] In order to prove the functionality of hepcidin binding
nucleic acids as spiegelmers, hepcidin binding nucleic acid
238-C4-006 was synthesized as spiegelmer comprising an Amino-group
at its 5'-end. To the amino-modified Spiegelmers
238-C4-006-5'-Amino a 40 kDa PEG-moiety was coupled leading to Type
C hepcidin binding nucleic acid 238-C4-006-5'-PEG. Synthesis and
PEGyation of the spiegelmer is described in Example 2.
[0517] The equilibrium binding constant K.sub.D of spiegelmer
238-C4-006-5'-PEG was determined by surface plasmon resonance
measurement (FIG. 12): 0.76 nM.
1.4 Other Hepcidin Binding Nucleic Acids
[0518] As depicted in FIG. 9 other hepcidin binding nucleic acids
that are not related to Type A, B and C hepcidin binding nucleic
acids are shown. The binding affinities of these hepcidin nucleic
acids were determined by Plasmon resonance measurement as well as
by competitive binding experiments vs. Type A hepcidin binding
nucleic acid 229-G1-001. All nucleic acids showed weaker binding
affinity than Type A hepcidin binding nucleic acid 229-G1-001 (FIG.
9).
EXAMPLE 2
Synthesis and Derivatization of Aptamers and Spiegelmers
Small Scale Synthesis
[0519] Aptamers (D-RNA nucleic acids) and spiegelmers (L-RNA
nucleic acids) were produced by solid-phase synthesis with an ABI
394 synthesizer (Applied Biosystems, Foster City, Calif., USA)
using 2'TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie,
1993). rA(N-Bz)-, rC(Ac)-, rG(N-ibu)-, and rU-phosphoramidites in
the D- and L-configuration were purchased from ChemGenes,
Wilmington, Mass. Aptamers and spiegelmers were purified by gel
electrophoresis.
Large Scale Synthesis Plus Modification
[0520] Spiegelmers were produced by solid-phase synthesis with an
AktaPilot100 synthesizer (Amersham Biosciences; General Electric
Healthcare, Freiburg) using 2'TBDMS RNA phosphoramidite chemistry
(Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-,
and L-rU-phosphoramidites were purchased from ChemGenes,
Wilmington, Mass. The 5'-amino-modifier was purchased from American
International Chemicals Inc. (Framingham, Mass., USA). Synthesis of
the unmodified or 5'-Amino-modified spiegelmers were started on
L-riboG, L-riboC, L-riboA or L-riboU modified CPG pore size 1000
.ANG. (Link Technology, Glasgow, UK. For coupling (15 min per
cycle), 0.3 M benzylthiotetrazole (CMS-Chemicals, Abingdon, UK) in
acetonitrile, and 3.5 equivalents of the respective 0.1 M
phosphoramidite solution in acetonitrile was used. An
oxidation-capping cycle was used. Further standard solvents and
reagents for oligonucleotide synthesis were purchased from Biosolve
(Valkenswaard, NL). The spiegelmers were synthesized DMT-ON; after
deprotection, it was purified via preparative RP-HPLC (Wincott et
al., 1995) using Source15RPC medium (Amersham). The 5'DMT-group was
removed with 80% acetic acid (30 min at RT). Subsequently, aqueous
2 M NaOAc solution was added and the spiegelmers was desalted by
tangential-flow filtration using a 5 K regenerated cellulose
membrane (Millipore, Bedford, Mass.).
PEGylation of Spiegelmers
[0521] In order to prolong the spiegelmer's plasma residence time
in vivo, spiegelmers was covalently coupled to a 40 kDa
polyethylene glycol (PEG) moiety at 5'-end.
5'-PEGylation of Spiegelmers
[0522] For PEGylation (for technical details of the method for
PEGylation see European patent application EP 1 306 382), the
purified 5'-amino modified spiegelmers were dissolved in a mixture
of H.sub.2O (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by
mixing citric acid.H.sub.2O [7 g], boric acid [3.54 g], phosphoric
acid [2.26 ml], and 1 M NaOH [343 ml] and adding water to a final
volume of 1 l; pH=8.4 was adjusted with 1 M HCl).
[0523] The pH of the spiegelmer solution was brought to 8.4 with 1
M NaOH. Then, 40 kDa PEG-NHS ester (Jenkem Technology, Allen, Tex.,
USA) was added at 37.degree. C. every 30 min in six portions of
0.25 equivalents until a maximal yield of 75 to 85% was reached.
The pH of the reaction mixture was kept at 8-8.5 with 1 M NaOH
during addition of the PEG-NHS ester.
[0524] The reaction mixture was blended with 4 ml urea solution (8
M), and 4 ml buffer B (0.1 M triethylammonium acetate in H.sub.2O)
and heated to 95.degree. C. for 15 min. The PEGylated Spiegelmer
was then purified by RP-HPLC with Source 15RPC medium (Amersham),
using an acetonitrile gradient (buffer B; buffer C: 0.1 M
triethylammonium acetate in acetonitrile). Excess PEG eluted at 5%
buffer C, PEGylated spiegelmer at 10-15% buffer C. Product
fractions with a purity of >95% (as assessed by HPLC) were
combined and mixed with 40 ml 3 M NaOAC. The PEGylated Spiegelmer
was desalted by tangential-flow filtration (5 K regenerated
cellulose membrane, Millipore, Bedford Mass.).
EXAMPLE 3
Determination of Binding Constants to Hepcidin (Pull-Down
Assay)
Direct Pull-Down Assay
[0525] The affinity of hepcidin binding nucleic acids was measured
as aptamers (D-RNA nucleic acids) to biotinylated human
D-Hepcidin-25 (SEQ.ID.No. 7) in a pull down assay format at
37.degree. C. Aptamers were 5'-phosphate labeled by T4
polynucleotide kinase (Invitrogen, Karlsruhe, Germany) using
[.gamma.-.sup.32P]-labeled ATP (Hartmann Analytic, Braunschweig,
Germany). The specific radioactivity of labeled aptamers was
200,000-800,000 cpm/pmol. Aptamers were incubated after de- and
renaturation at 20 pM concentration at 37.degree. C. in selection
buffer (20 mM Tris-HCl pH 7.4; 137 mM NaCl; 5 mM KCl; 1 mM
MgCl.sub.2; 1 mM CaCl.sub.2; 0.1% [w/vol] Tween-20) together with
varying amounts of biotinylated human D-hepcidin for 2-12 hours in
order to reach equilibrium at low concentrations. Selection buffer
was supplemented with 10 .mu.g/ml human serum albumin
(Sigma-Aldrich, Steinheim, Germany), and 10 .mu.g/ml yeast RNA
(Ambion, Austin, USA) in order to prevent adsorption of binding
partners to surfaces of used plasticware or the immobilization
matrix. The concentration range of biotinylated human D-hepcidin
was set from 32 pM to 500 nM; total reaction volume was 1 ml.
Biotinylated human D-hepcidin and complexes of aptamer and
biotinylated human D-hepcidin were immobilized on 6 .mu.l
NeutrAvidin or Streptavidin Ultralink Plus particles (Thermo
Scientific, Rockford, USA) which had been preequilibrated with
selection buffer and resuspended in a total volume of 12 .mu.l.
Particles were kept in suspension for 30 min at the respective
temperature in a thermomixer. Immobilized radioactivity was
quantitated in a scintillation counter after detaching the
supernatant and appropriate washing. The percentage of binding was
plotted against the concentration of biotinylated human D-hepcidin
and dissociation constants were obtained by using software
algorithms (GRAFIT; Erithacus Software; Surrey U.K.) assuming a 1:1
stoichiometry.
Aptamer Competitive Pull-Down Assay
[0526] In order to compare different aptamers of hepcidin binding
nucleic acids, a competitive ranking assay was performed. For this
purpose the most affine aptamer available was radioactively labeled
(see above) and served as reference. After de- and renaturation it
was incubated at 37.degree. C. with biotinylated human D-hepcidin
in 0.8 ml selection buffer at conditions that resulted in around
5-10% binding to the biotinylated human D-hepcidin-25 after
immobilization on NeutrAvidin agarose or Streptavidin Ultralink
Plus (both from Thermo Scientific) and washing without competition.
An excess of de- and renatured non-labeled D-RNA aptamer variants
was added to different concentrations (e.g. 10, 50 and 250 nM) with
the labeled reference aptamer to parallel binding reactions. The
aptamers to be tested competed with the reference aptamer for
target binding, thus decreasing the binding signal in dependence of
their binding characteristics. The aptamer that was found most
active in this assay could then serve as a new reference for
comparative analysis of further aptamer variants.
Spiegelmer Competitive Pull-Down Assay
[0527] In addition, the competitive pull-down assay was performed
to analyse the affinity of hepcidin binding spiegelmers. For this
purpose spiegelmers binding to biotinylated human L-hepcidin-25
were applied. The addition of two additional guanosine residues in
the D-configuration at the 5'-end of the spiegelmers enabled the
radioactive labeling of the spiegelmers by T4 polynucleotide kinase
(see above). After de- and renaturation the labeled spiegelmer and
a set of 5-fold dilutions ranging from 0.032 to 500 nM of
competitor molecules (such different species of hepcidin, truncated
versions of hepcidin or spiegelmers; see below) were incubated with
a constant amount of biotinylated human L-hepcidin in 0.8 ml
selection buffer at 37.degree. C. for 2-4 hours. The chosen peptide
concentration should cause final binding of approximately 5-10%
radiolabeled Spiegelmer at the lowest competitor concentration. In
one version of the competitive pull-down assay an excess of de- and
renatured non-labeled L-RNA spiegelmer variants served as
competitors, whereas unmodified as well as PEGylated forms were
tested. In another assay approach non-biotinylated L-hepcidin-25
from various species (such as human L-hepcidin-25, cynomolgus
L-hepcidin-25, marmoset L-hepcidin-25 or rat L-hepcidin-25) or
non-biotinylated N-terminal truncated L-hepcidin-20 and
L-hepcidin-22 competed against the biotinylated L-hepcidin for
spiegelmer binding. After immobilization of biotinylated
L-hepcidin-25 and the bound Spiegelmers on 1.5-3 .mu.l Streptavidin
Ultralink Plus matrix (Thermo Scientific, Rockford, USA), washing
and scintillation counting (see above), the normalized percentage
of bound radiolabeled Spiegelmer was plotted against the
corresponding concentration of competitor molecules. The resulting
dissociation constant was calculated employing the GraFit
Software.
EXAMPLE 4
Binding Analysis by Surface Plasmon Resonance Measurement
[0528] The Biacore 2000 instrument (Biacore AB, Uppsala, Sweden)
was used to analyze binding of the aptamers of the hepcidin binding
nucleic acids against biotinylated human D-hepcidin-25 and of the
spiegelmers of the hepcidin binding nucleic acids against
biotinylated human L-hepcidin-20, as well as human, rat and mouse
L-hepcidin 25.
[0529] The instrument was set to a enduring temperature of
37.degree. C. Before the start of each experiment the Biacore was
cleaned using the DESORB method according to the manufacturer's
instructions. After docking a maintenance chip, the instrument was
consecutively primed with DESORB solution 1 (0.5% sodium dodecyl
sulphate, SDS), DESORB solution 2 (50 mM glycine, pH 9.5) and
finally degassed MilliQ water. Subsequently the SANATIZE method was
run with 0.1M NaOC1 and the system was primed afterwards with
MilliQ water.
[0530] The biotinylated human D-hepcidin 25, human L-hepcidin 20,
as well as human, rat and mouse L-hepcidin 25 (all peptides from
BACHEM, custom synthesis) were dissolved in water with 1 mg/ml
fatty-acid free BSA at a concentration of 1 mM in a screw lock vial
and stored at 4.degree. C. until use.
[0531] After docking a sensor chip with a carboxymethylated dextran
matrix (Sensor Chip CM5, GE, BR-1000-14), the Biacore instrument
was primed with MilliQ water followed by HBS-EP buffer (0.01 M
HEPES buffer [pH 7.4], 0.15 M NaCl, with 0.005% Surfactant P20; GE,
BR-1001-88) and equilibrated until a stable baseline was observed.
The flow cells (FCs) were immobilized beginning from flow cell 4 to
flow cell 1 to avoid carry-over of peptides to other flow
cells.
[0532] 100 .mu.l of a 1:1 mixture of 0.4M EDC
(1-ethyl-3-(3-dimethylaminopropyl) carbodiimide in H.sub.2O; GE,
BR-1000-50) and 0.1M NHS (N-hydroxysuccinimide in H.sub.2O; GE,
BR-1000-50) were injected using the QUICKINJECT command at a flow
of 10 .mu.l/min. Activation of the flow cell was monitored by an
increase in RU after NHS/EDC injection (typically 500-600 RU for
CM5 chips).
[0533] Soluble Neutravidin was dissolved in water to a
concentration of 1 mg/ml, diluted in HBS-EP to 50 .mu.g/ml and
subsequently injected using the MANUALINJECT command at a flow of
10 .mu.l/min. The maximal observed amount of covalently immobilized
Neutravidin was about 10.000-15.000 RU. The flow cells were blocked
with a injection 70 .mu.l of 1 M ethanolamine hydrochloride (GE,
BR-1000-50) at a flow of 10 .mu.l/min; typically non-covalently
bound peptide/protein is removed by this procedure. Non-covalently
coupled Neutravidin was removed by an injection of 10-30 .mu.l of a
50 mM NaOH solution. Biotinylated human D-hepcidin 25, human
L-hepcidin 20, as well as human, rat and mouse L-hepcidin 25 was
directly diluted to a final concentration of 10-20 nM in HBS-EP
buffer and vortexed immediately. 1000 .mu.l of this sample was
transferred to O 9 mm glass vial (Glass Vials, O 9 mm, GE,
BR-1002-07) and injected using the MANUALINJECT command at a flow
of 10 .mu.l/min. For binding experiments up to 5000 response units
(RU) of biotinylated human D-hepcidin 25, human L-hepcidin 20, as
well as human, rat and mouse L-hepcidin 25 and for kinetic
evaluations 500-1500 RU were immobilized on the flow cell.
Subsequently the flow cell was washed with 1 M NaCl (Ambion,
Cat.No.AM9759) to avoid carry over of biotinylated human D-hepcidin
25, human L-hepcidin 20, as well as human, rat and mouse L-hepcidin
25 due to unspecific interaction of biotinylated human D-hepcidin
25, human L-hepcidin 20, as well as human, rat and mouse L-hepcidin
25 with the Biacore tubing and other surfaces. FC1 served as
blocked control flow cell.
[0534] Finally all sensor flow cells (beginning from FC1 to FC4)
were blocked by injecting 20 .mu.l of a saturated biotin solution
(Biotin, Sigma-Aldrich B-4501 Lot 68H1373) diluted 1:10 in HBS-EP
buffer at a flow of 20 .mu.l/min. The sensor chip was primed twice
with degased running buffer (20 mM Tris pH 7.4; 150 mM NaCl; 5 mM
KCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2 and 0.1% Tween20) and
equilibrated at 30 .mu.l/min until the baseline appeared
stable.
[0535] Typically for analytical purpose, the aptamers/spiegelmers
of hepcidin binding nucleic acids were diluted in water to a stock
concentration of 100 .mu.M (quantification by UV measurement),
heated up to 95.degree. C. for 30 seconds in a water bath or thermo
mixer and snap cooled on ice to assure a homogenous dissolved
solution.
[0536] Kinetic parameters and dissociation constants were evaluated
by a series of aptamer injections at concentrations of 1000, 500,
250, 125, 62.5, 31.25, 15.63, 7.8, 3.9 and 0 nM diluted in running
buffer. In all experiments, the analysis was performed at
37.degree. C. using the Kinject command defining an association
time of 360 and a dissociation time of 360 seconds at a flow of 30
.mu.l/min. The assay was double referenced, whereas FC1 served as
(blocked) surface control (bulk contribution of each aptamer
concentration) and a series of buffer injections without analyte
determined the bulk contribution of the buffer itself. Data
analysis and calculation of dissociation constants (KD) was done
with the BIAevaluation 3.0 software (BIACORE AB, Uppsala, Sweden)
using the Langmuir 1:1 stochiometric fitting algorithm.
EXAMPLE 5
Inhibition of Human and Mouse Hepcidin-Induced Downregulation of
Ferroportin by Hepcidin-Binding Spiegelmers
Method
[0537] J774.1 cells (mouse monocytes-macrophages, obtained from
DSMZ, Braunschweig) are cultivated at 37.degree. C. and 5% CO.sub.2
in Dulbecco's modified Eagle's medium (DMEM) with Glutamax
(Invitrogen, Karlsruhe, Germany) which contains 10% fetal calf
serum, 100 units/ml penicillin and 100 .mu.g/ml streptomycin. For
the experiments cells were seeded in 12-well plates at a density of
7.3.times.10.sup.5 cells/well (2.times.10.sup.5 cells/cm.sup.2) in
2 ml medium and cultivated for several hours at 37.degree. C. and
5% CO.sub.2. After cell attachment cells were loaded with iron by
addition of 20 .mu.l of a Fe-NTA-solution prepared by mixing 1 part
0.3 M FeCl.sub.3 in H.sub.2O with 2 parts 0.3 M NTA
(nitrilotriacetate) in H.sub.2O followed by 1:10 dilution with
DMEM. Cells are cultivated overnight as described. The next day
stimulation solutions were prepared in DMEM, containing human
hepcidin and when indicated spiegelmer (see below the spiegelmers
that were added) each at 5.times. the intended final concentration
and preincubated at 37.degree. C. for 30 min. 0.5 ml of the
solutions were added to each well of the 12-well plate. After 3
hours stimulation, the medium was removed and the cells were
quickly washed once with 1 ml ice-cold phosphate buffered saline
(PBS). Cells were then scraped off the wells in 1 ml cold PBS and
collected in pre-cooled Eppendorf tubes. After centrifugation for 5
min at 500 g at 4.degree. C. the supernatants were removed and the
pellets resuspended in 75 .mu.l of lysis buffer (Tris/HCl, pH 7.5,
150 mM NaCl, 1 mM EDTA, 1% Triton X-100 and protease-inhibitors
(protease inhibitor cocktail tablets, Roche #11873580001). Cell
suspensions were frozen on dry ice, thawed, thoroughly vortexed and
centrifuged for 10 min at 1000 g at 4.degree. C. The lysate
supernatants were collected and stored at -80.degree. C. until
further analysis. Protein determination was performed using the
bicinchoninic acid method. Lysate amounts containing 20 .mu.g
protein were mixed with 2.times. sample buffer (125 mM Tris/HCl, pH
6.8; 20% glycerol; 4% SDS; 0.02% bromophenolblue) and incubated at
37.degree. C. for 10 mM. Proteins were separated on 10%
SDS-polyacrylamide gels and then transferred by electroblotting
onto HybondECL nitrocellulose or Hybond-P PVDF membranes (GE
Healthcare, Munich, Germany). After blotting, the membranes were
stained with Ponceau-red (0.2% in 3% trichloroacetic acid) for
control of protein loading and transfer. Ferroportin was detected
with a rabbit anti-mouse ferroportin antibody (Alpha Diagnostics,
#MTP11-A) and a anti-rabbit-IgG-HRP-conjugate (New England Biolabs,
Frankfurt a.M., Germany) using LumiGlo.RTM. chemiluminescent
reagent (CellSignaling Technology, Frankfurt a.M., Germany) and
Hyperfilm.TM. ECL chemiluminescence films (GE Healthcare, Munich,
Germany).
Result
[0538] Lysates obtained from J774.1 cells after stimulation with
human hepcidin or hepcidin+the respective spiegelmer were separated
by SDS-gel electrophoresis and analysed by Western Blot using an
antibody against mouse ferroportin.
[0539] Treatment of J774.1 cells with Fe/NTA led to a substantial
up-regulation of ferroportin expression. This effect is
considerably reversed by stimulation of cells with 100 nM human
hepcidin-25 for 3 hours. This hepcidin effect is blocked when
hepcidin was pre-incubated with spiegelmers 226-05-001-5'-PEG,
238-D4-008-5'-Amino and 238-D4-008-5'-PEG (=NOX-H94).
[0540] FIG. 17A: Ferroportin (arrowhead), which is barely
detectable in untreated cells (lane 1), is up-regulated by
treatment with Fe/NTA (lanes 2, 3). 100 nM human hepcidin-25 (HEP)
lead to down regulation of ferroportin (lanes 4, 5) and this effect
can be strongly inhibited by spiegelmer 226-05-001 (C5-PEG)(lanes
6, 7).
[0541] FIG. 17B: Human hepcidin leads to down regulation of
ferroportin in Fe/NTA treated J774.1 cells (lanes 6, 7). This
effect of human hepcidin-25 can be strongly inhibited by spiegelmer
NOX-H94 (lanes 12-15) and by spiegelmer HEP-238-D4-008a, which is
the amino-modified oligonucleotide intermediate of
238-D4-008-5'-PEG (=NOX-H94) (lanes 8-11).
EXAMPLE 6
Activity of a Hepcidin Binding Spiegelmer In Vivo
[0542] The current concept of anemia of chronic diseases is that
hepcidin synthesis and release is stimulated by pro-inflammatory
cytokines, especially IL-6, in hepatocytes. Hepcidin than binds to
the different cell types expressing the iron transporter
ferroportin. This interaction induces an internalisation and a
degradation of the hepcidin-ferroportin complex followed by a serum
iron decrease. A chronic reduction of serum iron negatively impairs
erythropoiesis and finally manifests in anemia. The known property
of human hepcidin-25 to induce a serum iron decrease in mice
(Rivera, 2005) was utilized as a model for anaemia of inflammation.
To test the activity of Spiegelmers in vivo a state of hypoferremia
was induced in C57BL/6 mice with human-hepcidin-25. To characterise
the spiegelmers in this model, animals received a prophylactic
treatment with the Spiegelmer to block the effect of
hu-hepcidin.
Method
[0543] Female C57B1/6 mice (Elevage Janvier, France, six weeks old,
n=6-7 per group) received a single intravenous injection of a
anti-hepcidin spiegelmer (10-20 ml/kg body weight) or vehicle (5%
glucose, 10-20 ml/kg body weight). After thirty minutes synthetic
human hepcidin-25 (Bachem, Weil am Rhein, Germany, Cat No. H-5926)
at a dose of 1-2 mg/kg body weight was injected intraperitoneally
(10 ml/kg body weight). Blood was collected two hours after the
hepcidin injection. Serum and plasma samples were obtained for iron
determination and complete blood count, respectively. For each
animal the serum iron, haemoglobin, hematocrit, white blood cell
count, erythrocyte count, thrombocyte count, mean corpuscular
volume, and mean corpuscular haemoglobin values were
determined.
Results
[0544] Injection of synthetic human--hepcidin-25 leads to a rapid
reduction of serum iron. Two hours after injection the serum iron
concentration was reduced to 56% of the value of the vehicle
treated mice. These in vivo findings are in line with the data
published by Rivera et al. (Ribera et al.), who reported a
reduction to ca. 25% in a very similar experiment with a higher
hepcidin dose. The decrease in serum iron is completely blocked
(98% of control) by application of spiegelmer 223-05-001-5'-PEG
prior to injection of human hepcidin as depicted in FIG. 9. The
same effect was observed with 239-D4-008-5'-PEG as depicted in FIG.
20.
EXAMPLE 7
Activity of a Hepcidin Binding Spiegelmer in Cynomomolgus Monkeys
Stimulated with Human Interleukin-6
[0545] The dominant role of Interleukin-6 (IL-6) in anemia of
chronic diseases was demonstrated with the IL-6 receptor antibody
tocilizumab. Treatment with this antibody showed efficacy in
patients with Castleman disease (Nishimoto, 2008) and also in an
arthritis model in cynomolgus monkeys (Hashizume, 2009). The known
property of IL-6 to induce hepcidin secretion subsequently
resulting in anemia in non-human primates was utilized as another
model for anaemia of inflammation (Asano, 1990; Klug 1994). Instead
of the parameter haemoglobin the serum iron content was selected as
endpoint to show efficacy of anti-hepcidin spiegelmers. A state of
hypoferremia was induced in cynomolgus monkeys with
human-recombinant IL-6. This model was important to show that
anti-hepcidin spiegelmers also bind the endogenous hepcidin, as in
all other experiments a synthetic human hepcidin was used. To test
the activity of spiegelmers in vivo a state of hypoferremia was
induced in cynomolgus monkeys with human-recombinant IL-6. To
characterise the spiegelmers in this model, animals received a
prophylactic treatment with the Spiegelmer to block the effect of
cynomolgus-hepcidin.
Method
[0546] Male cynomolgus monkeys (Roberto C. Hartelust, Tilburg, The
Netherlands) 34 to 38 months old, n=3 per group) received a single
intravenous injection of a anti-hepcidin spiegelmer (1 ml/kg body
weight) or vehicle (5% glucose, 1 ml/kg body weight). After thirty
minutes recombinant human IL-6 (Miltenyi Biotech, Bergisch
Gladbach, Germany) at a dose of 10 .mu.g/kg body weight was
injected sub cutaneously (1 ml/kg body weight). Blood was collected
eight hours after the IL-6 injection. Serum and plasma samples were
obtained for iron determination and complete blood count,
respectively. For each animal the serum iron, haemoglobin,
hematocrit, white blood cell count, erythrocyte count, thrombocyte
count, mean corpuscular volume, and mean corpuscular haemoglobin
values were determined.
Results
[0547] Injection of recombinant human IL-6 leads to a reduction of
serum iron. Eight hours after injection the serum iron
concentration was reduced to 27% of the predose value of the
vehicle/IL-6 treated monkeys. The decrease in serum iron is
completely blocked by application of spiegelmer 238-D4-008-5'-PEG
prior to injection of human IL-6 as depicted in FIG. 21.
REFERENCES
[0548] Abboud S, Haile D J (2000) A novel mammalian iron-regulated
protein involved in intracellular iron metabolism. J Biol Chem
275(26): 19906-19912 [0549] Altschul S F, Gish W, Miller W, Myers E
W, Lipmann D J (1990), Basic local alignment search tool J Mol Biol
215 (3): 403-10. [0550] Altschul S F, Madden T L, Schaffer A A,
Zhang J, Zhang Z, Miller W, Lipman D J (1997). Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucleic Acid Research 25(17):3389-402. [0551] Andrews N C (2008)
Forging a field: the golden age of iron biology. Blood 112(2):
219-230 [0552] Asano S, Okano A, Ozawa K, Nakahata T, Ishibashi T,
Koike K, Kimura H, Tanioka Y, Shibuya A, Hirano T (1990) In vivo
effects of recombinant human interleukin-6 in primates: stimulated
production of platelets. Blood 75(8): 1602-1605 [0553] Constante M,
Jiang W, Wang D, Raymond V A, Bilodeau M, Santos M M (2006)
Distinct requirements for Hfe in basal and induced hepcidin levels
in iron overload and inflammation. Am J Physiol Gastrointest Liver
Physiol 291(2): G229-237 [0554] De Domenico I, Ward D M, Langelier
C, Vaughn M B, Nemeth E, Sundquist W I, Ganz T, Musci G, Kaplan J
(2007) The molecular mechanism of hepcidin-mediated ferroportin
down-regulation. Mol Biol Cell 18(7): 2569-2578 [0555] Donovan A,
Brownlie A, Zhou Y, Shepard J, Pratt S J, Moynihan J, Paw B H,
Drejer A, Barut B, Zapata A, Law T C, Brugnara C, Lux S E, Pinkus G
S, Pinkus J L, Kingsley P D, Palis J, Fleming M D, Andrews N C, Zon
L I (2000) Positional cloning of zebrafish ferroportin1 identifies
a conserved vertebrate iron exporter. Nature 403(6771): 776-781
[0556] Eaton B E et (1995) Chem Biol 2:633 Eaton B E, Gold L, Hicke
B J. Janjic N, Jucker F M, Sebosta D P, Tarasow T M, Willis M C,
Zichi D A (1997) Bioorg Med Chem 5:1087. [0557] Frazer D M, Wilkins
S J, Millard K N, McKie A T, Vulpe C D, Anderson G J (2004)
Increased hepcidin expression and hypoferraemia associated with an
acute phase response are not affected by inactivation of HFE. Br J
Haematol 126(3): 434-436 [0558] Hashizume M, Uchiyama Y, Horai N,
Tomosugi N, Mihara M (2009) Tocilizumab, a humanized
anti-interleukin-6 receptor antibody, improved anemia in monkey
arthritis by suppressing IL-6-induced hepcidin production.
Rheumatol Int July 29, DOI 10.1007/s00296-009-1075-4. [0559] Hunter
H N, Fulton D B, Ganz T, Vogel H J (2002) The solution structure of
human hepcidin, a peptide hormone with antimicrobial activity that
is involved in iron uptake and hereditary hemochromatosis. J Biol
Chem 277(40): 37597-37603 [0560] Klug S, Neubert R, Stahlmann R,
Thiel R, Ryffel B, Car B D, Neubert D (1994) Effects of recombinant
human interleukin 6 (rhIL-6) in marmosets (Callithrix jacchus). 1.
General toxicity and hematological changes. Arch Toxicol 68(10):
619-31 [0561] Klussmann, S. (eds.); The Aptamer Handbook, 1.
Edition--February 2006, Wiley-VCH, Weinheim [0562] Krause A, Neitz
S, Magert H J, Schulz A, Forssmann W G, Schulz-Knappe P, Adermann K
(2000) LEAP-1, a novel highly disulfide-bonded human peptide,
exhibits antimicrobial activity. FEBS Lett 480(2-3): 147-150 [0563]
McKie A T, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret
S, Bomford A, Peters T J, Farzaneh F, Hediger M A, Hentze M W,
Simpson R I (2000) A novel duodenal iron-regulated transporter,
IREG1, implicated in the basolateral transfer of iron to the
circulation. Mol Cell 5(2): 299-309 [0564] Needleman & Wunsch
(1970), A general method applicable to the search for similarities
in the amino acid sequence of two proteins. J Mol Biol 48(3):
443-53. [0565] Nemeth E, Rivera S, Gabayan V, Keller C, Taudorf S,
Pedersen B K, Ganz T (2004a) IL-6 mediates hypoferremia of
inflammation by inducing the synthesis of the iron regulatory
hormone hepcidin. J Clin Invest 113(9): 1271-1276 [0566] Nemeth E,
Tuttle M S, Powelson J, Vaughn M B, Donovan A, Ward D M, Ganz T,
Kaplan J (2004b) Hepcidin regulates cellular iron efflux by binding
to ferroportin and inducing its internalization. Science 306(5704):
2090-2093 [0567] Nicolas G, Bennoun M, Devaux I, Beaumont C,
Grandchamp B, Kahn A, Vaulont S (2001) Lack of hepcidin gene
expression and severe tissue iron overload in upstream stimulatory
factor 2 (USF2) knockout mice. Proc Natl Acad Sci USA 98(15):
8780-8785 [0568] Nicolas G, Bennoun M, Porteu A, Mativet S,
Beaumont C, Grandchamp B, Sirito M, Sawadogo M, Kahn A, Vaulont S
(2002a) Severe iron deficiency anemia in transgenic mice expressing
liver hepcidin. Proc Natl Acad Sci USA 99(7): 4596-4601 [0569]
Nicolas G, Chauvet C, Viatte L, Danan J L, Bigard X, Devaux I,
Beaumont C, Kahn A, Vaulont S (2002b) The gene encoding the iron
regulatory peptide hepcidin is regulated by anemia, hypoxia, and
inflammation. J Clin Invest 110(7): 1037-1044 [0570] Nicolas G,
Viatte L, Lou D Q, Bennoun M, Beaumont C, Kahn A, Andrews N C,
Vaulont S (2003) Constitutive hepcidin expression prevents iron
overload in a mouse model of hemochromatosis. Nat Genet 34(1):
97-101 [0571] Nishimoto N, Terao K, Mima T, Nakahara H, Takagi N,
Kakehi T (2008) Mechanisms and pathologic significances in increase
in serum interleukin-6 (IL-6) and soluble IL-6 receptor after
administration of an anti-IL-6 receptor antibody, tocilizumab, in
patients with rheumatoid arthritis and Castleman disease. Blood
112(10): 3959-3964. [0572] Park C H, Valore E V, Waring A J, Ganz T
(2001) Hepcidin, a urinary antimicrobial peptide synthesized in the
liver. J Biol Chem 276(11): 7806-7810 [0573] Pearson & Lipman
(1988), Improved tools for biological sequence comparison. Proc
Nat. Acad Sci USA 85:2444. [0574] Pigeon C, Ilyin G, Courselaud B,
Leroyer P, Turlin B, Brissot P, Loreal O (2001) A new mouse
liver-specific gene, encoding a protein homologous to human
antimicrobial peptide hepcidin, is overexpressed during iron
overload. J Biol Chem 276(11): 7811-7819 [0575] Rivera S, Nemeth E,
Gabayan V, Lopez M A, Farshidi D, Ganz T (2005) Synthetic hepcidin
causes rapid dose-dependent hypoferremia and is concentrated in
ferroportin-containing organs. Blood 106(6): 2196-2199 [0576]
Roetto A, Papanikolaou G, Politou M, Alberti F, Girelli D,
Christakis J, Loukopoulos D, Camaschella C (2003) Mutant
antimicrobial peptide hepcidin is associated with severe juvenile
hemochromatosis. Nat Genet 33(1): 21-22 [0577] Smith & Waterman
(1981), Adv. Appl. Math. 2:482 [0578] Valore E V, Ganz T (2008)
Posttranslational processing of hepcidin in human hepatocytes is
mediated by the prohormone convertase furin. Blood Cells Mol Dis
40(1): 132-138 [0579] Weiss G (2008) Iron metabolism in the anemia
of chronic disease. Biochim Biophys Acta Weiss G, Goodnough L T
(2005) Anemia of chronic disease. N Engl J Med 352(10):
1011-1023
[0580] The features of the present invention disclosed in the
specification, the claims, the sequence listing and/or the drawings
may both separately and in any combination thereof be material for
realizing the invention in various forms thereof.
Sequence CWU 1
1
218125PRTHomo sapiens 1Asp Thr His Phe Pro Ile Cys Ile Phe Cys Cys
Gly Cys Cys His Arg 1 5 10 15 Ser Lys Cys Gly Met Cys Cys Lys Thr
20 25 225PRTMacaca mulatta 2Asp Thr His Phe Pro Ile Cys Ile Phe Cys
Cys Gly Cys Cys His Arg 1 5 10 15 Ser Lys Cys Gly Met Cys Cys Lys
Thr 20 25 325PRTMacaca fascicularis 3Asp Thr His Phe Pro Ile Cys
Ile Phe Cys Cys Gly Cys Cys His Arg 1 5 10 15 Ser Lys Cys Gly Met
Cys Cys Lys Thr 20 25 425PRTSus scrofa 4Asp Thr His Phe Pro Ile Cys
Ile Phe Cys Cys Gly Cys Cys Arg Lys 1 5 10 15 Ala Ile Cys Gly Met
Cys Cys Lys Thr 20 25 525PRTMus musculus 5Asp Thr Asn Phe Pro Ile
Cys Ile Phe Cys Cys Lys Cys Cys Asn Asn 1 5 10 15 Ser Gln Cys Gly
Ile Cys Cys Lys Thr 20 25 625PRTRattus norvegicus 6Asp Thr Asn Phe
Pro Ile Cys Leu Phe Cys Cys Lys Cys Cys Lys Asn 1 5 10 15 Ser Ser
Cys Gly Leu Cys Cys Ile Thr 20 25 725PRTHomo sapiens 7Asp Thr His
Phe Pro Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg 1 5 10 15 Ser
Lys Cys Gly Met Cys Cys Lys Thr 20 25 820PRTHomo sapiens 8Ile Cys
Ile Phe Cys Cys Gly Cys Cys His Arg Ser Lys Cys Gly Met 1 5 10 15
Cys Cys Lys Thr 20 922PRTHomo sapiens 9Phe Pro Ile Cys Ile Phe Cys
Cys Gly Cys Cys His Arg Ser Lys Cys 1 5 10 15 Gly Met Cys Cys Lys
Thr 20 1048RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10gcacucguaa aguagaggga cccaguccgg
cgugauagug ccgagugc 481148RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 11gcacuuguaa
aguagaggga cccaguccgg cgugauagug ccgagugc 481248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 12gcauucguaa aguagaggga cccaguccgg cgugauagug
ccgagugc 481348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 13gcacucguaa aguagaggga
ccuaguccgg cgugauagug ccgggugc 481448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14gcacucguaa aguagaggga ccuaguccgg cgugauagug
ccgagugc 481548RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 15gcacucguaa aguagaggga
cucaguccgg cgugauagug ccgagugc 481648RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16gcacucguaa aguagaggga uacaguccgg cgugauagug
acgagugc 481748RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 17cguguguaaa guagaggcag
guaaucugcg gaguguuagu uccacacg 481848RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18cgcguguaaa guagaggcag guaaucugcg gaguguuagu
uccacacg 481948RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 19cguguguaaa guagaggcag
gcaaucugcg gaguguuagu uccacacg 482045RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20cguguguaaa guagaggaca auugucggcg ugauagugcc acacg
452145RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 21gcuguguaaa guagaggaca auugucggcg
ugauagugcc acagc 452245RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 22cguguguaaa
guagaggaca auagucggcg ugagagugcc acacg 452348RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23cgugaaaagu agaaacuugu cgaaagcaag uagcgugaua
gugccacg 482448RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 24cgugcuggcg ugauagugcu
ccagguucug gauaaaguag agagcacg 482548RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25cgugcgaagg agugauaagu guuucugacu uucuuccaga
cucccacg 482646RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 26cacucguaaa guagagggac
ccaguccggc gugauagugc cgagug 462746RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27cgcgcguaaa guagagggac ccaguccggc gugauagugc
cgcgcg 462844RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 28gcgcguaaag uagagggacc
caguccggcg ugauagugcc gcgc 442948RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 29gcacucguaa
aguagaggga cccaguccgg cgugauagug ccgagugc 483048RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30gcacuuguaa aguagaggga cccaguccgg cgugauagug
ccgagugc 483148RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 31gcauucguaa aguagaggga
cccaguccgg cgugauagug ccgagugc 483248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32gcacucguaa aguagaggga ccuaguccgg cgugauagug
ccgggugc 483348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 33gcacucguaa aguagaggga
ccuaguccgg cgugauagug ccgagugc 483448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34gcacucguaa aguagaggga cucaguccgg cgugauagug
ccgagugc 483548RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 35gcacucguaa aguagaggga
uacaguccgg cgugauagug acgagugc 483648RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36cguguguaaa guagaggcag guaaucugcg gaguguuagu
uccacacg 483748RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 37cgcguguaaa guagaggcag
guaaucugcg gaguguuagu uccacacg 483848RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38cguguguaaa guagaggcag gcaaucugcg gaguguuagu
uccacacg 483945RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 39cguguguaaa guagaggaca
auugucggcg ugauagugcc acacg 454045RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 40gcuguguaaa
guagaggaca auugucggcg ugauagugcc acagc 454145RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41cguguguaaa guagaggaca auagucggcg ugagagugcc acacg
454248RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 42cgugaaaagu agaaacuugu cgaaagcaag
uagcgugaua gugccacg 484348RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 43cgugcuggcg
ugauagugcu ccagguucug gauaaaguag agagcacg 484448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 44cgugcgaagg agugauaagu guuucugacu uucuuccaga
cucccacg 484546RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 45cacucguaaa guagagggac
ccaguccggc gugauagugc cgagug 464646RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 46cgcgcguaaa guagagggac ccaguccggc gugauagugc
cgcgcg 464744RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 47gcgcguaaag uagagggacc
caguccggcg ugauagugcc gcgc 444848RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 48gcacucguaa
aguagaggga cccaguccgg cgugauagug ccgagugc 484944RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 49aggcguaaag uagaggggcu gagcccggcg uguuagugcc gccu
445044RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50aggcguaaag uagagggacg uaguccggcg
ugauagugcc gccu 445148RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 51cguguguaaa
guagaggcag auaaucugcg gaguguuagu uccacacg 485248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52cgugaaaagu agaaacuugu cgaaagcaag cagcgugaua
gugccacg 485348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 53cgugaaaagu ugaaauuugu
uggaaucaag cagggauaua gugccacg 485449RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 54agcgugucgu augggauaag uaaaugagga guuggaggaa
gggugcgcu 495550RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 55agcgugucgu augggauuaa
guaaaugagg aguuggagga agggcaugcu 505649RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56agugugucgu augggauaag uaaaugaggg guuggaggaa
ggaugcgcu 495749RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 57agugugucau augggauaag
uaaaugagga guuggaggaa aggcaugcu 495849RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 58agcgugccgg augggauaag uaaaugagga guuggaggaa
gggugcgcu 495949RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 59agcgugccgu augggauaag
uaaaugagga guaggaggaa ggguacgcu 496049RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 60agcgcgccgu augggagaag uaaaugagga guuggaggaa
gggcgcgcu 496148RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 61aggcucggac agccggggga
caccauauac agacuacgau acgggccu 486248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 62aggcucggac ggccggggga caccauauac agacuacuau
acgggccu 486348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 63aggcccggac agccggggga
caccauauac agacuacuau acgggccu 486448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 64aggcuugggc ggccggggga caccauauac agacuacuau
acgagccu 486548RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 65agacuugggc agccggggga
caccauauac agacuacgau acgagucu 486649RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 66cgggcgccau agaccguuau uaagcacugu aacuaccgaa
ccgcgcccg 496745RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 67cgggcgccau agaccguuaa
cuacauaacu accgaaccgu gcccg 456845RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 68cgggcgcuac
cgaacccacu aaaaccagug cauagaccgc gcccg 456941RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 69cgggcgcuac cgaaccguca cgaagaccau agaccgcgcc g
417041RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70cgagcgcaac cgaaccucua cccagacaua
gaccgcgccc g 417147RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 71gcacucguaa aguagaggga
ccaguccggc gugauagugc cgagugc 477243RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72guguguaaag uagaggacaa uugucggcgu gauagugcca cac
437343RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 73gcguguaaag uagaggacaa uugucggcgu
gauagugcca cgc 437443RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 74gcgcguaaag
uagaggacaa uugucggcgu gauagugccg cgc 437544RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75cguguguaaa guagaggaca auugucggcg ugauagugcc acac
447645RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 76gccguguaaa guagaggaca auugucggcg
ugauagugcc acggc 457745RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 77gcgguguaaa
guagaggaca auugucggcg ugauagugcc accgc 457845RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78gcugcguaaa guagaggaca auugucggcg ugauagugcc gcagc
457945RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 79gcuggguaaa guagaggaca auugucggcg
ugauagugcc ccagc 458045RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 80gcggcguaaa
guagaggaca auugucggcg ugauagugcc gccgc 458146RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81gcgcgcguau gggauuaagu aaaugaggag uuggaggaag
gcgcgc 468245RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 82gcgcgcguau gggauaagua
aaugaggagu uggaggaagg cgcgc 458344RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 83ggcgcguaug
ggauuaagua aaugaggagu uggaggaagg cgcc 448443RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84ggcgcguaug ggauaaguaa augaggaguu ggaggaaggc gcc
438546RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 85ggugucguau gggauuaagu aaaugaggag
uuggaggaag ggcauc 468645RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 86ggugucguau
gggauaagua aaugaggagu uggaggaagg gcauc 458744RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87gcgccguaug ggauuaagua aaugaggagu uggaggaagg gcgc
448843RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 88gcgccguaug ggauaaguaa augaggaguu
ggaggaaggg cgc 438946RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 89ggcgccguau
gggauuaagu aaaugaggag uuggaggaag ggcgcc 469045RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90ggcgccguau gggauaagua aaugaggagu uggaggaagg gcgcc
459146RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 91ggcgucguau gggauuaagu aaaugaggag
uuggaggaag ggcgcc 469245RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 92ggcgucguau
gggauaagua aaugaggagu uggaggaagg gcgcc 459346RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93ggcucggaca gccgggggac accauauaca gacuacgaua
cgggcc 469444RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 94gcucggacag ccgggggaca
ccauauacag acuacgauac gggc 449542RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 95cucggacagc
cgggggacac cauauacaga cuacgauacg gg 429644RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96gcccggacag ccgggggaca ccauauacag acuacgauac gggc
449744RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 97ggccggacag ccgggggaca ccauauacag
acuacgauac ggcc 449844RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 98gcggagacag
ccgggggaca ccauauacag acuacgauau ccgu 449944RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 99aggcugacag ccgggggaca ccauauacag acuacgauag gccu
4410044RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 100ggccugacag ccgggggaca ccauauacag
acuacgauaa ggcu 4410144RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 101gcgcggacag
ccgggggaca ccauauacag acuacgauac gcgc 4410242RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102gccggacagc cgggggacac cauauacaga cuacgauacg gc
4210342RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 103ggcggacagc
cgggggacac cauauacaga cuacgauacg cc 4210442RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 104ggccgacagc cgggggacac cauauacaga cuacgauagg cc
4210542RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 105gcgcgacagc cgggggacac cauauacaga
cuacgauagc gc 4210644RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 106ggccggacag
ccggaggaca ccauauacag acuacgauac ggcc 4410744RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107ggccggacag ccggcggaca ccauauacag acuacgauac ggcc
4410845RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108ggccggacag ccgggaggac accauauaca
gacuacgaua cggcc 4510913RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 109uccagguucu gga
1311044RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 110aggcguaaag uagaggggcu gagcccggcg
uguuagugcc gccu 4411144RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 111aggcguaaag
uagagggacg uaguccggcg ugauagugcc gccu 4411248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 112cguguguaaa guagaggcag auaaucugcg gaguguuagu
uccacacg 4811348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 113cgugaaaagu agaaacuugu
cgaaagcaag cagcgugaua gugccacg 4811448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 114cgugaaaagu ugaaauuugu uggaaucaag cagggauaua
gugccacg 4811549RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 115agcgugucgu augggauaag
uaaaugagga guuggaggaa gggugcgcu 4911650RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 116agcgugucgu augggauuaa guaaaugagg aguuggagga
agggcaugcu 5011749RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 117agugugucgu augggauaag
uaaaugaggg guuggaggaa ggaugcgcu 4911849RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 118agugugucau augggauaag uaaaugagga guuggaggaa
aggcaugcu 4911949RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 119agcgugccgg augggauaag
uaaaugagga guuggaggaa gggugcgcu 4912049RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 120agcgugccgu augggauaag uaaaugagga guaggaggaa
ggguacgcu 4912149RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 121agcgcgccgu augggagaag
uaaaugagga guuggaggaa gggcgcgcu 4912248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 122aggcucggac agccggggga caccauauac agacuacgau
acgggccu 4812348RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 123aggcucggac ggccggggga
caccauauac agacuacuau acgggccu 4812448RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 124aggcccggac agccggggga caccauauac agacuacuau
acgggccu 4812548RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 125aggcuugggc ggccggggga
caccauauac agacuacuau acgagccu 4812648RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 126agacuugggc agccggggga caccauauac agacuacgau
acgagucu 4812749RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 127cgggcgccau agaccguuau
uaagcacugu aacuaccgaa ccgcgcccg 4912845RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 128cgggcgccau agaccguuaa cuacauaacu accgaaccgu
gcccg 4512945RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 129cgggcgcuac cgaacccacu
aaaaccagug cauagaccgc gcccg 4513041RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 130cgggcgcuac cgaaccguca cgaagaccau agaccgcgcc g
4113141RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131cgagcgcaac cgaaccucua cccagacaua
gaccgcgccc g 4113247RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 132gcacucguaa aguagaggga
ccaguccggc gugauagugc cgagugc 4713343RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 133guguguaaag uagaggacaa uugucggcgu gauagugcca cac
4313443RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134gcguguaaag uagaggacaa uugucggcgu
gauagugcca cgc 4313543RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 135gcgcguaaag
uagaggacaa uugucggcgu gauagugccg cgc 4313644RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 136cguguguaaa guagaggaca auugucggcg ugauagugcc acac
4413745RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137gccguguaaa guagaggaca auugucggcg
ugauagugcc acggc 4513845RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 138gcgguguaaa
guagaggaca auugucggcg ugauagugcc accgc 4513945RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 139gcugcguaaa guagaggaca auugucggcg ugauagugcc
gcagc 4514045RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 140gcuggguaaa guagaggaca
auugucggcg ugauagugcc ccagc 4514145RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 141gcggcguaaa guagaggaca auugucggcg ugauagugcc
gccgc 4514246RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 142gcgcgcguau gggauuaagu
aaaugaggag uuggaggaag gcgcgc 4614345RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 143gcgcgcguau gggauaagua aaugaggagu uggaggaagg
cgcgc 4514444RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 144ggcgcguaug ggauuaagua
aaugaggagu uggaggaagg cgcc 4414543RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 145ggcgcguaug
ggauaaguaa augaggaguu ggaggaaggc gcc 4314646RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 146ggugucguau gggauuaagu aaaugaggag uuggaggaag
ggcauc 4614745RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 147ggugucguau gggauaagua
aaugaggagu uggaggaagg gcauc 4514844RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 148gcgccguaug ggauuaagua aaugaggagu uggaggaagg gcgc
4414943RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149gcgccguaug ggauaaguaa augaggaguu
ggaggaaggg cgc 4315046RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 150ggcgccguau
gggauuaagu aaaugaggag uuggaggaag ggcgcc 4615145RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 151ggcgccguau gggauaagua aaugaggagu uggaggaagg
gcgcc 4515246RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 152ggcgucguau gggauuaagu
aaaugaggag uuggaggaag ggcgcc 4615345RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 153ggcgucguau gggauaagua aaugaggagu uggaggaagg
gcgcc 4515446RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 154ggcucggaca gccgggggac
accauauaca gacuacgaua cgggcc 4615544RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 155gcucggacag ccgggggaca ccauauacag acuacgauac gggc
4415642RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156cucggacagc cgggggacac cauauacaga
cuacgauacg gg 4215710RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 157gacaauaguc
1015844RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158gcccggacag ccgggggaca ccauauacag
acuacgauac gggc 4415944RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 159ggccggacag
ccgggggaca ccauauacag acuacgauac ggcc 4416044RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 160gcggagacag ccgggggaca ccauauacag acuacgauau ccgu
4416144RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161aggcugacag ccgggggaca ccauauacag
acuacgauag gccu 4416244RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 162ggccugacag
ccgggggaca ccauauacag acuacgauaa ggcu 4416344RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 163gcgcggacag ccgggggaca ccauauacag acuacgauac gcgc
4416442RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164gccggacagc cgggggacac cauauacaga
cuacgauacg gc 4216542RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 165ggcggacagc
cgggggacac cauauacaga cuacgauacg cc 4216642RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 166ggccgacagc cgggggacac cauauacaga cuacgauagg cc
4216742RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167gcgcgacagc cgggggacac cauauacaga
cuacgauagc gc 4216844RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 168ggccggacag
ccggaggaca ccauauacag acuacgauac ggcc 4416944RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 169ggccggacag ccggcggaca ccauauacag acuacgauac ggcc
4417045RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170ggccggacag ccgggaggac accauauaca
gacuacgaua cggcc 4517145RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 171gcuguguaaa
guagaggaca auugucggcg ugauagugcc acagc 4517248RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 172gcacucguaa aguagaggga cccaguccgg cgugauagug
ccgagugc 4817345RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 173gcuguguaaa guagaggaca
auugucggcg ugauagugcc acagc 4517444RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 174ggccggacag ccgggggaca ccauauacag acuacgauac ggcc
4417546RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175gcgcgcguau gggauuaagu aaaugaggag
uuggaggaag gcgcgc 4617644RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 176gcgccguaug
ggauuaagua aaugaggagu uggaggaagg gcgc 4417711RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 177ccauacggcg c 1117813RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 178gcgcccuucc ucc 1317946RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 179gcgcgcguau gggauuaagu aaaugaggag uuggaggaag
gcgcgc 4618044RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 180gcgccguaug ggauuaagua
aaugaggagu uggaggaagg gcgc 4418144RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 181ggccggacag
ccgggggaca ccauauacag acuacgauac ggcc 4418234RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 182rkaugggaku aaguaaauga ggrguwggag gaar
3418333RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183rkaugggaka aguaaaugag grguwggagg aar
3318434RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184guaugggauu aaguaaauga ggaguuggag gaag
3418534RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185grcrgccggv ggacaccaua uacagacuac kaua
3418635RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186grcrgccgga rggacaccau auacagacua ckaua
3518734RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187gacagccggg ggacaccaua uacagacuac gaua
3418810RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188waaaguwgar 1018913RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 189rgmgugwkag ukc 1319011RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 190gggcugagcc c 1119113RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 191gcagauaauc ugc 1319210RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 192ggaccagucc 1019311RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 193ggacccaguc c 1119411RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 194ggaccuaguc c 1119511RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 195ggacucaguc c 1119613RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 196gcagguaauc ugc 1319713RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 197gcaggcaauc ugc 1319810RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 198gacaauuguc 1019910RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 199uaaaguagag 1020010RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 200aaaaguagaa 1020110RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 201aaaaguugaa 1020212RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 202gggauauagu gc 1220313RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 203ggcgugauag ugc 1320413RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 204ggaguguuag uuc 1320513RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 205ggcgugagag ugc 1320613RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 206agcgugauag ugc 1320713RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 207ggcguguuag ugc 1320811RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 208ggacbyaguc c 1120911RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 209ggauacaguc c 1121013RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 210gcaggyaauc ugc 1321110RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 211gacaauwguc 1021218RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 212acuugucgaa agcaagyu 1821334RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 213rkaugggaku aaguaaauga ggrguuggag gaar
3421434RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 214grcrgccggg ggacaccaua uacagacuac kaua
3421511RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 215ggacguaguc c 1121617RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 216acuugucgaa agcaagy 1721718RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 217auuuguugga aucaagca 1821835RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 218grcrgccggv aggacaccau auacagacua ckaua 35
* * * * *