U.S. patent application number 15/061626 was filed with the patent office on 2016-09-08 for human fibrolamellar hepatocellular carcinomas (hfl-hccs).
This patent application is currently assigned to University of North Carolina at Chapel Hill. The applicant listed for this patent is University of North Carolina at Chapel Hill. Invention is credited to Timothy Anh-Hieu DINH, Tsunekazu OIKAWA, Lola M. REID, Praveen SETHUPATHY, Eliane WAUTHIER.
Application Number | 20160257937 15/061626 |
Document ID | / |
Family ID | 56849566 |
Filed Date | 2016-09-08 |
United States Patent
Application |
20160257937 |
Kind Code |
A1 |
WAUTHIER; Eliane ; et
al. |
September 8, 2016 |
HUMAN FIBROLAMELLAR HEPATOCELLULAR CARCINOMAS (hFL-HCCS)
Abstract
The present disclosure provides a model of human fibrolamellar
hepatocellular carcinoma (FL-HCC) cells maintained as a
transplantable tumor line in a host and a method to establish a
transplantable human FL-HCC tumor line. Methods of ex vivo cultures
of the FL-HCC are provided. Methods of diagnosing and treating
FL-HCC tumors are also provided.
Inventors: |
WAUTHIER; Eliane; (Chapel
Hill, NC) ; OIKAWA; Tsunekazu; (Chapel Hill, NC)
; DINH; Timothy Anh-Hieu; (Chapel Hill, NC) ;
SETHUPATHY; Praveen; (Chapel Hill, NC) ; REID; Lola
M.; (Chapel Hill, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of North Carolina at Chapel Hill |
Chapel Hill |
NC |
US |
|
|
Assignee: |
University of North Carolina at
Chapel Hill
Chapel Hill
NC
|
Family ID: |
56849566 |
Appl. No.: |
15/061626 |
Filed: |
March 4, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62129668 |
Mar 6, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2207/12 20130101;
A61P 35/00 20180101; C12Q 2600/158 20130101; C12Q 1/6886 20130101;
A01K 2227/105 20130101; G01N 33/5067 20130101; C12Y 305/01098
20130101; A01K 67/0271 20130101; C12N 5/0693 20130101; G01N
33/57438 20130101 |
International
Class: |
C12N 5/09 20060101
C12N005/09; A61K 38/50 20060101 A61K038/50; A61K 38/17 20060101
A61K038/17; C12Q 1/68 20060101 C12Q001/68; G01N 33/50 20060101
G01N033/50 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under
federal NIH grant ROODK091318-02, awarded by the National
Institutes of Health. The government has certain rights in the
invention.
Claims
1. A transplantable tumor line of human fibrolamellar
hepatocellular carcinoma (hFL-HCC) cells maintained in a non-human
animal.
2. The transplantable tumor line of claim 1, wherein the non-human
animal is a NOD scid gamma (NSG) mouse.
3. The transplantable tumor line of claim 1, wherein the hFL-HCC
cells are derived from a tumor removed from the liver, from the
biliary tree, from a subcutaneous tumor or from an intraperitoneal
(ascites) tumor.
4. The transplantable tumor line of claim 1, wherein the tumor line
comprises hFL-HCC cells and mesenchymal cells of the non-human
animal.
5. The transplantable tumor line of claim 1, wherein at least 50%
of the hFL-HCC cells in the transplantable tumor are cancer stem
cells.
6. The transplantable tumor line of claim 1, wherein the hFL-HCC
cells express the fusion transcript DNAJB1-PRKACA.
7. The transplantable tumor line of claim 1, wherein the hFL-HCC
cells overexpress at least one C10orf128, CA12, CREB3L1, GALNTL6,
IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2,
SLC16A14, TMEM163, or TNRC6C relative to a control sample.
8. The transplantable tumor line of claim 7, wherein the control
sample is selected from the group consisting of hepatocellular
carcinomas (HCCs), hepatoblastomas, cholangiocarcinomas (CCAs),
pancreatic cancer, biliary tree stem cells, hepatic stem cells,
hepatoblasts, pancreatic stem cells, hepatic, pancreatic committed
progenitors, and normal mature hepatic or pancreatic cells.
9. A tissue sample obtained from the tumor line of claim 1.
10. A population of hFL-HCC cells isolated from the tumor line of
claim 1.
11. The population of claim 10, wherein the hFL-HCC cells are
cultured on tissue culture plastic or on or in hyaluronans.
12. The composition of claim 11, wherein the hFL-HCC cells are
cultured in cells in serum-free medium.
13. The composition of claim 12, wherein the serum-free medium is
Kubota's Medium.
14. The composition of claim 12, wherein the serum-free medium
further contains hyaluronans, HGF and/or VEGF.
15. A method of determining whether a patient has fibrolamellar
hepatocellular carcinoma (FL-HCC), comprising: (a) measuring gene
expression levels of at least one of C10orf128, CA12, CREB3L1,
GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2,
RPS6KA2, SLC16A14, TMEM163, and TNRC6C; and (b) comparing the gene
expression profile to one or more control samples.
16. The method of claim 15, wherein overexpression of C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to
the control sample is associated with presence of FL-HCC.
17. The method of claim 16, wherein overexpression of PCSK1, CA12,
NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the
control sample is associated with presence of FL-HCC.
18. The method of claim 16, wherein overexpression of C10orf128,
OAT, PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C relative
to the control sample is associated with presence of FL-HCC.
19. The method of claim 15, wherein the control sample is selected
from the tumor cells from hepatocellular carcinomas (HCCs),
hepatoblastomas, cholangiocarcinomas (CCAs) and/or pancreatic
cancers or selected from normal cells consisting of biliary tree
stem cells, hepatic stem cells, hepatoblasts, pancreatic stem
cells, hepatic or pancreatic committed progenitors, and normal
mature hepatic or pancreatic cells.
20. A method of treating a patient determined to have hFL-HCC by
administering to the patient an effective amount of at least one
therapeutic that decreases expression of at least one of C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
21. The method of claim 20, wherein the at least one therapeutic is
selected from the group consisting of a small molecule, RNA
interference, a locked nucleic acid (LNA), an immunotherapy, a
hedgehog signaling inhibitor, a histone deacetylase inhibitor, a
protein kinase inhibitor, and a regulator of substrate targets of
PRKACA.
22. A method for drug screening, comprising (a) introducing a
candidate drug to cultured hFL-HCC cells that are in the form of
monolayers, hydrogels, spheroids or organoids, and (b) monitoring
the effect of the candidate drug on the cultured hFL-HCC cells.
23. A transplantable tumor cell line comprising human fibrolamellar
hepatocellular carcinoma (hFL-HCC) cells, which can be maintained
in a non-human animal.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This application claims priority from U.S. Provisional
Application 62/129,668, filed Mar. 6, 2015, incorporated herein by
reference in its entirety.
BACKGROUND
[0003] Human fibrolamellar hepatocellular carcinomas (hFL-HCCs) are
rare cancers accounting for less than .about.5% of all liver
cancers and unique in being found primarily in children to young
adults without evidence of fibrosis or cirrhosis. The
epidemiological factors are unknown, as are causes of increases in
occurrence in hFL-HCCs over the past 60 years. These malignances
are currently treatable only by surgery, as all tested forms of
chemotherapy and external radiation therapy have proven
ineffective. Even surgery is ineffective if the hFL-HCC tumor has
metastasized. In addition, molecular mechanisms of hFL-HCCs have
been difficult to study, since investigations have had to be
conducted on freshly isolated tissue or paraffin sections-samples
that are difficult to obtain. Therefore, a need exists for in vivo
models of hFL-HCCs, such as transplantable tumor lines, and/or in
vitro models of hFL-HCCs, such as cell lines or spheroid cultures,
for use in defining the disease as well as identifying novel
strategies for treating hFL-HCCs.
SUMMARY
[0004] Aspects of the disclosure relate to transplantable tumor
lines of human fibrolamellar hepatocellular carcinoma (hFL-HCC)
cells maintained in a non-human animal. In some aspects, the
transplantable tumor line comprises hFL-HCC cells and mesenchymal
cells from a non-human host. Also disclosed is a composition
comprising hFL-HCC cells and an amount of non-human mesenchymal
cells effective to sustain the viability of said hFL-HCC cells.
[0005] Other aspects of the disclosure provide cell cultures
comprising hFL-HCC cells in a serum-free medium.
[0006] Further aspects provide methods for establishing a hFL-HCC
tumor line comprising: (a) obtaining a hFL-HCC tumor from a patient
with a FL-HCC; (b) preparing a tumor cell suspension from the
FL-HCC tumor; (c) culturing the tumor cell suspension under
restrictive conditions that select for cancer stem cells to obtain
a population of culture-selected cancer stem cells; and (d)
transplanting culture-selected cells into an immunocompromised,
non-human animal.
[0007] Aspects of the disclosure also relate to methods for
maintaining a hFL-HCC transplantable tumor line comprising: (a)
obtaining hFL-HCC cells from a xenografted tumor of a first
immunocompromised non-human animal; (b) dispersing the hFL-HCC
cells into a cell suspension by enzymatic or mechanical methods;
and (c) transplanting dispersed hFL-HCC cells into a second
immunocompromised, non-human animal.
[0008] Additional aspects provide methods for culturing hFL-HCC
cells comprising: (a) separating hFL-HCC cells of a xenografted
tumor from non-human cells; (b) suspending the separated hFL-HCC
cells in a serum-free medium; and (c) plating the hFL-HCC cells
onto or into a culture substratum to obtain plated hFL-HCC
cells.
[0009] Additional aspects provide methods for culturing hFL-HCC
cells comprising: (a) separating hFL-HCC cells of a xenografted
tumor from non-human cells; (b) suspending the separated hFL-HCC
cells in a serum-free medium; and (c) allowing the cells to form
floating aggregates (e.g. spheroids or organoids) in a culture
medium.
[0010] In some aspects herein provided are methods for drug
screening, comprising (a) introducing a candidate drug to cultured
hFL-HCC cells that are in the form of monolayers, hydrogels,
spheroids, or organoids and (b) monitoring the effect of the
candidate drug on the cultured hFL-HCC cells.
[0011] In some aspects herein provided are methods for drug
testing, comprising (a) administering a candidate drug to a
non-human animal carrying a transplantable hFL-HCC tumor and (b)
monitoring the effect of the candidate drug on the xenotransplanted
hFL-HCC tumor.
[0012] In some aspects herein provided are methods for suppressing
the growth of hFL-HCC cells, comprising treating the hFL-HCC cells
with a drug, an immunotherapy, or an inhibitor to a specific
signaling pathway. Non-limiting examples include a hedgehog
signaling pathway inhibitor, a histone deacetylase inhibitor and/or
an inhibitor to one or more protein kinases. Some specific examples
include, inhibitor of CA12 such as Acetazolamide, and/or anti-sense
oligonucleotides to SLC16A14 to minimize its effects conferring
drug resistance, which is relevant to hFL-HCC, a cancer that is
highly chemo- and drug-resistant.
[0013] Further aspects provide methods for treating hFL-HCC in a
patient in need thereof, comprising administering to the patient an
effective amount of drug, with immunotherapy, with an inhibitor to
a specific signaling pathway. Non-limiting examples include a
hedgehog signaling pathway inhibitor, a histone deacetylase
inhibitor and/or an inhibitor to one or more protein kinases.
[0014] In yet other aspects herein provided are methods of
determining whether a patient has fibrolamellar hepatocellular
carcinoma (FL-HCC), comprising: (a) measuring gene expression
levels of at least one of C10orf128, CA12, CREB3L1, GALNTL6, IRF4,
ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14,
TMEM163, and TNRC6C; and (b) comparing the gene expression profile
to one or more control samples.
[0015] In yet other aspects herein provided are methods of
determining whether a patient has fibrolamellar hepatocellular
carcinoma (FL-HCC), comprising: (a) measuring gene expression
levels of at least one or more genes of a set of genes found to
constitute a genetic signature for hFL-HCCs and that include
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C from a
sample collected from a patient suspected of having a biliary tree
or liver tumor; and (d) comparing the gene expression profile to
one or more control samples, wherein the sample collected from the
patient has histological features typical for FL-HCC and/or
expresses the DNAJB1-PRKACA fusion gene.
[0016] In yet other aspects herein provided are methods of treating
a patient determined to have hFL-HCC by administering to the
patient an effective amount of at least one therapeutic that
decreases expression of at least one gene in a set found to be a
genetic signature for hFL-HCCs and that include C10orf128, CA12,
CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1,
PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
[0017] In yet other aspects herein provided are methods of treating
a patient determined to have hFL-HCC by administering to the
patient an effective amount of an immunotherapy.
[0018] In yet other aspects herein provided are methods of treating
a patient determined to have hFL-HCC by administering to the
patient an effective amount of at least one therapeutic that
regulates PRKACA or SRC network hubs.
[0019] In yet other aspects herein provided are methods of treating
a patient determined to have hFL-HCC by administering to the
patient an effective amount of at least one therapeutic that
regulates substrate targets of the kinase PRKACA (Protein kinase A
catalytic subunit alpha).
[0020] In another aspect are provided compositions of isolated
hFL-HCC cells wherein the hFL-HCC cell expresses at least one
marker selected from the group consisting of C10orf128, CA12,
CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1,
PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C.
[0021] In yet other aspects, are provided herein, populations of
isolated hFL-HCC cells wherein the hFL-HCC cell expresses a marker
selected from the group consisting of C10orf128, CA12, CREB3L1,
GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2,
RPS6KA2, SLC16A14, TMEM163, and TNRC6C.
[0022] In still yet other aspects provided herein are compositions
comprising isolated hFL-HCC cells wherein the hFL-HCC cell
expresses a marker selected from the group consisting of C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C and a
carrier.
[0023] One embodiment of the disclosure described herein relates to
a specific transplantable human tumor line, TU-2010, consisting of
hFL-HCC tumor cells and large numbers (>50% of the cells in the
tumor) of mesenchymal cells of the non-human host.
[0024] In some embodiments, the non-human animal is
immunocompromised. In some embodiments, the non-human animal is a
mouse, for example, a NOD scid gamma (NSG) mouse.
[0025] In some embodiments, the hFL-HCC cells are derived from
liver, from biliary tree, from a subcutaneous or intraperitoneal
tumor, for example, ascites tumor cells.
[0026] In some embodiments, the tumor line comprises hFL-HCC cells
and mesenchymal cells of the non-human animal. In some embodiments,
at least 50% of the hFL-HCC cells in the transplantable tumor are
cancer stem cells.
[0027] In some embodiments, the hFL-HCC cells express the fusion
transcript DNAJB1-PRKACA. In other embodiments, the hFL-HCC cells
substantially do not express HDAC9 or express a lower level of
HDAC9 as compared to a human non-FL-HCC cell control sample.
[0028] In some embodiments, the hFL-HCC cells express one or more
markers of endodermal transcription factors selected from the group
consisting of SOX9, SOX17, PDX1, FOXA1, and NGN3.
[0029] In some embodiments, the hFL-HCC cells express one or more
markers of pluripotency genes selected from the group consisting of
OCT4, SOX2, NANOG, KLF4, SALL4 and KLF5.
[0030] In some embodiments, the hFL-HCC cells express one or more
markers of other stem cell genes selected from the group consisting
of CD44, SALL4, TROP-2, BMI-1, sonic hedgehog (SHH), LGR5, NCAM,
and KRT20.
[0031] In some embodiments, the hFL-HCC cells express one or more
hepatic markers selected from the group consisting of CK8, CK18,
CK19, DCLK1, HepPar-1, albumin, alpha-fetoprotein, and CD68.
[0032] In some embodiments, the hFL-HCC cells express one or more
pancreatic markers selected from PDX1, NGN3, PCSK1, insulin,
glucagon, amylase, and mucin (MUC).
[0033] In some embodiments, the hFL-HCC cells express high levels
of aryl hydrocarbon receptors (AHR).
[0034] In some embodiments, the hFL-HCC cells express biomarkers of
malignancy such as AGR2 and/or high levels of extracellular
matrix-degrading enzymes and/or aberrations in the regulation of
p53.
[0035] In some embodiments, the hFL-HCC cells have aberrant or lack
of expression of one or more histone deacetylase (HDAC) genes.
[0036] In some embodiments, the tumor is a xenotransplanted,
subcutaneous or intraperitoneal tumor.
[0037] In some embodiments, at least 30% of the hFL-HCC cells are
cancer stem cells (CSCs). In other embodiments, at least 50% of the
hFL-HCC cells are CSCs. In yet other embodiments, at least 65% of
the hFL-HCC cells are CSCs. In still other embodiments, at least
51% of the cells in the cell culture are hFL-HCC cells.
[0038] In some embodiments, provided herein is a tissue sample
obtained from the tumor line of any one of the above
embodiments.
[0039] In some embodiments, the serum-free medium is Kubota's
Medium. In some embodiments, the serum-free medium contains
hyaluronans, HGF and/or VEGF.
[0040] In some embodiments, at least a portion of the hFL-HCC cells
are in aggregates (e.g. spheroids) of hFL-HCC cells. In other
embodiments, at least a portion of the hFL-HCC cells are in
organoids comprised of hFL-HCCs and associated mesenchymal cells
(e.g. endothelia, stellate cells, stromal cells).
[0041] In some embodiments, the hFL-HCC tumor is obtained as an
ascites fluid or as a solid tumor from the subject.
[0042] In some embodiments, the tumor cell suspension from the
hFL-HCC tumor are cultured on tissue culture plastic, on
hyaluronans, or in hyaluronan hydrogels.
[0043] In some embodiments, the tumor cell suspension from the
hFL-HCC tumor are cultured in serum-free Kubota's Medium.
[0044] In some embodiments, the methods provided herein comprise
transplanting subcutaneously or intraperitoneally the
culture-selected cancer stem cells from the hFL-HCC cells into the
immunocompromised non-human animal.
[0045] In some embodiments, the methods provided herein comprise
transplanting about 10.sup.2 to about 10.sup.7 culture-selected
cancer stem cells from the hFL-HCC tumor into the
immunocompromised, non-human animal.
[0046] In some embodiments, the methods provided herein further
comprise monitoring the immunocompromised, non-human animal for
tumor formation for about 2 to about 9 months
[0047] In some embodiments, the methods provided herein further
comprise transplanting subcutaneously or intraperitoneally the
hFL-HCC tumor into the second immunocompromised, non-human
animal.
[0048] In some embodiments, the methods provided herein comprise
separating hFL-HCC cells from non-human cells by immunoselection,
for example, magnetic immunoselection.
[0049] In some embodiments, the culture substratum is tissue
culture plastic, a 2D monolayer or 3D hydrogel of a purified
extracellular matrix component. In some embodiments, the purified
extracellular matrix component is selected from the group
consisting of hyaluronan, a collagen, an adhesion molecule, and an
extract enriched in extracellular matrix. In some embodiments, the
adhesion molecule is laminin. In other embodiments, the extract
enriched in extracellular matrix is a biomatrix scaffold or
Matrigel. In some embodiments, the matrix scaffold is prepared by
protocols for decellularized tissue. In other embodiments, the
matrix scaffold is prepared from high salt decellularization
protocols, such as biomatrix scaffolds.
[0050] In some embodiments, the plated hFL-HCC cells are kept in
suspension and allowed to form aggregates, for example, spheroids
(only the hFL-HCC cells) or organoids (mixtures of hFL-HCC cells
and mesenchymal cells (endothelia, stellate cells, stromal
cells).
[0051] In some embodiments, the hedgehog signaling pathway
inhibitor comprises GDC-0449.
[0052] In some embodiments, the histone deacetylase inhibitor
comprises suberoylanilide hydroxamic acid (SAHA) and/or suberic
bis-hydroxamic acid (SBHA).
[0053] In some embodiments, overexpression of C10orf128, CA12,
CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1,
PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the
control sample is associated with presence of hFL-HCC. In some
embodiments, overexpression of PCSK1, CA12, NOVA1, SLC16A14,
TNRC6C, TMEM163, and RPS6KA2 relative to the control sample is
associated with presence of hFL-HCC. In other embodiments,
overexpression of C10orf128, OAT, PAK3, PCSK1, PHACTR2, SLC16A14,
TMEM163, and TNRC6C relative to the control sample is associated
with presence of hFL-HCC. In some embodiments, the hFL-HCC also
expresses the fusion gene DNAJB1-PRKACA.
[0054] In some embodiments, the control sample is selected from the
group consisting of hepatocellular carcinomas (HCCs),
hepatoblastomas, cholangiocarcinomas (CCAs), pancreatic cancers,
other types of cancers as well as normal cells that include biliary
tree stem cells, hepatic stem cells, hepatoblasts, pancreatic stem
cells, hepatic or pancreatic committed progenitors, and mature
liver or pancreatic cells.
[0055] In some embodiments, the at least one therapeutic is
selected from the group consisting of a small molecule, RNA
interference, and a locked nucleic acid (LNA). Alternatively, at
least one therapeutic is selected from a form of immunotherapy.
[0056] These and other features, together with the organization and
manner of operation thereof, will become apparent from the
following detailed description when taken in conjunction with the
accompanying drawings.
ABBREVIATIONS AND TERMINOLOGY
[0057] Acronyms for cell populations are preceded by a small letter
to indicate the species: m=murine; h=human. ABCG2 (or CDw338),
ATP-binding cassette sub-family G member 2 that confers drug
resistance; Acetazolamide, an inhibitor of carbonic anhydrases;
AFP, .alpha.-fetoprotein; ALB, albumin; Basal Media, buffers
comprised of amino acids, minerals, sugars, lipids, vitamins and
other nutrients in a composition mimicking interstitial fluid and
used for cell culture; BMi-1, B lymphoma Mo-MLV insertion region 1
homolog that is an oncogene conferring the ability of
self-replication of cells; BTSCs, biliary tree stem cells; CAJ2,
carbonic anhydrase 12, a zinc metallo enzyme; Clorf128, Chromosome
10 open reading frame 128; CCA, cholangiocarcinoma; CD, common
determinant; CD13, alanine aminopeptidase; CD44, hyaluronan
receptors; CD133, prominin; CFTR, cystic fibrosis transmembrane
conductance regulator; CK, cytokeratin protein; CREB3L1, the cAMP
responsive element binding protein 3-like 1; CSCs, cancer stem
cells; CXCR4, CXC-chemokine receptor 4 (also called fusin or
CD184); EGF, epidermal growth factor; EpCAM, epithelial cell
adhesion molecule; FBS, fetal bovine serum; FGF, fibroblast growth
factor; FLC, fibrolamellar carcinoma (synonym=FL-HCC, fibrolamellar
hepatocellular carcinoma); GALNT6, polypeptide
N-acetyl-galactos-aminyl-transferase-like 6 that participates in
0-glycan biosynthesis; GDC-0449, inhibitor of hedgehog signaling
pathway via hedgehog surface receptors (PTCH, SMO); HDAC, histone
deacetylase; HDM, a serum-free medium comprised of basal media and
a defined mix of purified hormones, growth factors and nutrients
tailored for a specific cell or biological process; HDM-C, a
hormonally defined medium for cholangiocytes; HDM-H, a hormonally
defined medium for hepatocytes; HDM-P, a hormonally defined medium
for pancreatic islets; hFL-HCC, human fibrolamellar hepatocellular
carcinoma; HBs, hepatoblasts; HCC, hepatocellular carcinoma; HGF,
hepatocyte growth factor; HpSCs, hepatic stem cells; IRF4,
Interferon regulatory factor 4. Transcriptional activator; ITPRIP,
inositol 1,4,5-trisphosphate receptor-interacting protein; KCNE4:
Potassium voltage-gated channel subfamily E, member 4 modulates the
multimeric channel complex. KM, Kubota's Medium, a serum-free,
hormonally defined medium designed for endodermal stem/progenitors;
KRT, cytokeratin gene; LGR5, Leucine-rich repeat-containing
G-protein coupled receptor 5 that binds to R-spondin; NANOG, a
transcription factor critically involved with self-renewal; NCAM,
neural cell adhesion molecule; NOVA-1, Neuro-oncological ventral
antigen 1NSG, nod scid gamma (species of immunocompromised mouse);
OAT, ornithine aminotransferase; ORGANOID, floating aggregate of
cells comprised of both epithelia and mesenchymal cells; PAK3,
Serine/threonine-protein kinase PAK 3; PCSK1, proprotein convertase
1 involved in processing of hormones; PDX1, pancreatic and duodenal
homeobox 1; PBGs, peribiliary glands, stem cell niches for biliary
tree stem cells; PDX, patient-derived xenograft; PHACTR2,
phosphatase and actin regulator 2; RPS6KA2 Ribosomal protein S6
kinase alpha-2; SBHA, suberic bis-hydroxamic acid; SAHA,
suberoylanilide hydroxamic acid (potent, reversible class I and II
HDAC inhibitor); SALL4, Sal-like protein 4; SLC16A14: membrane
channel for solute carrier family 16 (monocarboxylic acid
transporters), member 14; SOX, Sry-related HMG box; SPHEROID,
floating aggregate of cells that are only one cell type; TCGA, The
Cancer Genome Atlas; TEM, transmission electron microscopy; TMA,
tissue microarrays; TMEM163, Transmembrane protein 163 involved in
zinc transport and homeostasis; TNRC6C, Trinucleotide
repeat-containing gene 6C protein involved in gene regulation;
TROP-2, tumor-associated calcium signal transducer 2; VEGF,
vascular endothelial cell growth factor.
BRIEF DESCRIPTION OF THE DRAWINGS
[0058] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the Office
upon request and payment of necessary fee.
[0059] FIG. 1 shows the analysis of human FL-HCCs compared to
normal adult livers using tissue microarrays (TMAs) and
immunohistochemistry (IHC) assays. (a) Hematoxylin/eosin stained
paraffin sections of TMAs. (b, c) Representative IHC assays on
sections from the original blocks of normal adult liver versus
hFL-HCC tumors. (d) Complete results of IHC assays. Additional
details are given in FIG. 7. The scale bar is 50 .mu.m (a), 25
.mu.m (b-c).
[0060] FIG. 2 shows the characterization and tumorigenicity of the
transplantable human FL-HCC tumor line, TU-2010. (a, b)
Hematoxylin/eosin stained sections of the original solid tumor
found in the liver. (c, d) Subcutaneous tumor generated in NSG
mice. (e) Intraperitoneal transplants. (f) Histology of the centers
(1) versus perimeters (2) of the subcutaneous tumor at low and high
magnifications. Histology and IHC assays on the original hFL-HCC
cells from the ascites tumor of TU-2010 are given in FIG. 9a. The
scale bar=25 .mu.m. (g) Proportion of human tumor cells to host
cells in subcutaneous tumors. Flow cytometric analyses of tumors
dispersed into single cell suspensions indicated that the cell
suspensions were over 50% and up to 70% host cells. Shown is one in
which the cell suspension was comprised of 53.5% murine mesenchymal
cells and the remainder are human tumor cells. By negatively
sorting for cells positive for H-2K.sup.d, the enrichment of the
human tumor cells reached above 95% routinely. (h) Proportion of
human tumor cells to host cells in intraperitoneal tumors of
TU-2010. With intraperitoneal transplantation the passaging can be
done every about 8 weeks. Flow cytometry contrasting side scatter
(SCC) versus expression of H-2K.sup.d in hFL-HCCs derived from the
ascites cells from the peritoneum of mice. The murine ascites fluid
and the cells bound to the serosal surfaces comprise about 3.5%
tumor cells and over 96% host cells indicating the extraordinary
extent of desmoplastic response with intraperitoneal transplants.
(i) Limiting dilution tumorigenicity assays of hFL-HCCs from
TU-2010. The original tumor sample includes 4 liters of ascites
tumor cells that were centrifuged, plated onto culture plastic and
in serum-free Kubota's Medium (KM) for several weeks. Phase images
of the original cultures are given in FIGS. 4a and 4b (see also
FIG. 10). Culture selection for endodermal stem/progenitors was
performed. The tumors from the initial passage appeared in about 5
months. Subsequently tumors appeared by about 3 months if about
10.sup.6 to 10.sup.7 tumor cells were transplanted in KM
supplemented with hyaluronans, HGF and VEGF. At passage 8, the
tumor cells were dispersed, and the host mesenchymal cells depleted
by sorting negatively for cells positive for H-2K.sup.d. The
purified hFL-HCC cells were transplanted subcutaneously at cell
numbers from 10.sup.2 to 10.sup.6. At all concentrations from
10.sup.5 cells and higher tumors formed in 100% of the mice by 3
months; at 10.sup.3-10.sup.4 cells, all formed tumors within 4-5
months. At 100 cells, one tumor formed at 5 months; one at 6
months; and one by 9 months.
[0061] FIG. 3 shows the results of IHC and flow cytometric assays
on the xenotransplantable tumor line, TU-2010. (a) Representative
FACS characterizations of sorted hFL-HCC cells (cell suspensions
depleted of murine host cells) from TU-2010. LGR5.sup.+ cells
accounted for 68.9% of the cells in the tumors. Other antigens that
were expressed by a significant percentage of the cells from
TU-2010 included CD44, the hyaluronan receptor (61.4%); CD49f
(25.4%); Signal transducer CD24 (32.9%); CD13, alanine
aminopeptidase (12.5%); c-KIT (12.0%); E-cadherin (12.0%); and
oncostatin M receptor (OSMR) (10.7%). Other antigens found
routinely in a smaller percentage of cells included CXCR4, also
called fusin or CD184 (4.8%), EpCAM (4.3%), CD133, also called
prominin (2.3%), TROP-2 (1.4%); and ICAM intercellular adhesion
molecule (0.5%). (b) The hFL-HCCs of TU-2010 were depleted of
murine cells and sorted for LGR5.sup.+ cells by flow cytometry. Of
these, only 1.1% were also EpCAM.sup.+. (c) IHC assay on the sorted
LGR5.sup.+ cells demonstrated strong expression of LGR5 and an
absence of EpCAM. (d, e, f, g) Paraffin sections (5 m) from hFL-HCC
tumors (subcutaneous) were prepared and subjected to IHC assays for
an array of antigens. Of those shown, all were positive with the
exceptions of EpCAM, alpha-fetoprotein (AFP), and MUC6. The survey
comprised assays for endodermal stem/progenitor transcription
factors and markers: SOX17, SOX9, CD44, LGR5, CK7 and CK19 (d);
pluripotency genes and genes indicative of self-replication: NANOG,
OCT4, KLF4, SOX2, BMI1 and SALL4 (e); hepatic and other markers:
SHH, EpCAM (essentially negative), CD68, HepPar-1, CK18, AFP
(negative) (f); and pancreatic/endocrine markers: PDX1, NGN3, and
MUC6 (negative), which was strongly expressed (g). CD68 is a marker
identified previously as routinely found in hFL-HCC cells.
Additional assays and controls are given in FIG. 9b. The scale bar
is 25 Lm for all Figure panels.
[0062] FIG. 4 shows analysis of monolayer cultures of hFL-HCC cells
from TU-2010. (a) Suspensions of hFL-HCC cells from TU-2010 were
plated onto culture plastic and in serum-free KM. The cells
transiently attached and formed star-like cells (see also FIG. 11).
(b) Subsequently, the cells became loosely attached to the dish and
retained attachment to each other via E-cadherin linkages such that
they formed floating cell chains ("catena"). (c) If plated with KM
supplemented with 2-5% FBS during the seeding phase and then
converted to serum-free KM, the cells were able to remain attached
to the dishes for longer and formed colonies that were irregular
and with extensions in diverse directions; they transitioned into
aggregates/spheroids that eventually floated into the medium. (d)
IHC of these colonies indicated that they were uniformly positive
for stem cell traits such as LGR5 or NANOG. (e) The aggregates, but
not monolayer cells, expressed low levels of EpCAM and
cytokeratin19. Depletion of the host (murine) cells enabled hFL-HCC
cells to form colonies at single cell seeding densities and that
grew into colonies within 2 weeks. After 2 weeks, these cells
morphologically resemble the cultures of the original ascites
cells. The scale bar is 100 .mu.m (a-e). (f) Using assays comparing
invasion through filters coated with a basement membrane matrix
versus uncoated filters, 100% of the hFL-HCCs from TU-2010 were
able to invade compared to less than about 70% of Huh7 cells, a
liver cancer cell line. (g) A screen of drug effects on monolayer
cultures indicated that the hedgehog inhibitor, GDC-0449, had
effects at 4 .mu.M and especially at 20 .mu.M to suppress survival
and proliferation of hFL-HCC cells. Histone deacetylase (HDAC)
inhibitors were more potent: SBHA at 10 .mu.M and 20 .mu.M and
especially SAHA at 2 .mu.M and 10 .mu.M, had strong inhibitory
effects on hFL-HCC cell survival and growth. Data are expressed as
the mean.+-.SD (**p<0.01,*p<0.05).
[0063] FIG. 5 shows analysis of spheroid cultures of the hFL-HCC
cells from TU-2010. Plating the hFL-HCC tumor cells from TU-2010 in
serum-free conditions on low attachment plates, and especially
after depletion of the murine cells, resulted in spheroid
formation. (a) The spheroids that formed from freshly isolated
hFL-HCC cells from TU-2010 and that were depleted of murine cells
(1.sup.st spheroids) were sustainable in culture for months and
were able to be passaged to form secondary spheroids (2.sup.nd
spheroids). The scale bar is 100 .mu.m. (b, c) Transmission
electron micrographs (TEM) of the spheroids from TU-2010 (see also
FIGS. 11 and 12) indicate cell aggregates with some cell adhesion
mechanisms; large numbers of secretory vesicles with electron-dense
granules; partially formed ducts; and a wealth of mitochondria with
aberrant cristae. The scale bar is 1 .mu.m. (d) The HDAC inhibitors
and GDC-0449 were far more effective at strongly suppressing
hFL-HCC survival and growth of the spheroid cultures than when the
cells were in monolayer cultures. Data are expressed as mean.+-.SD
(**p<0.01). (e) KM resulted in maintenance of stemness in the
cells. The differentiation media comprised serum-free hormonally
defined medium (HDM) tailored for lineage restriction of normal
hBTSCs to hepatocytes (HDM-H), cholangiocytes (HDM-C) or pancreatic
islets (HDM-P). These media were able to partially differentiate
the hFL-HCCs from TU-2010; full maturation was not achieved due to
the matrix-degrading enzymes produced by the tumor cells, which
induced rapid dissolution (within hours) of every matrix substratum
tested. The morphology of the colonies in KM versus the several
differentiation media are shown. The changes occurred were
transient, as the cells transitioned rapidly towards spheroid
formation. (f) During the few days when morphological changes were
observed, there was an increase in expression of some markers
associated with maturation to an adult fate. The example shown is
CFTR, a trait of maturing or mature cholangiocytes. The scale bar
is 100 .mu.m. (g) qRT-PCR assays showed that stem cell traits
(NANOG, POU5F1, SOX2, PROM1) were suppressed in all the HDM.
Surprisingly, so were KRT18 and PDX1 and to a lesser extent KRT7.
CD44 was partially suppressed in HDM-H and HDM-C but strongly
suppressed by HDM-P; LGR5 was suppressed in HDM-H and HDM-C but not
in HDM-P; TACSTD1 (EpCAM), KRT19, and CFTR were modestly suppressed
in HDM-H and HDM-P, but EpCAM and especially CFTR were actually
elevated in HDM-C, and KRT19 was not affected. Data are expressed
as mean.+-.SD (**p<0.01, *p<0.05).
[0064] FIG. 6 shows the results of global gene expression analysis
by RNA-seq. (a) A correlation heat map of gene expression profiles
from RNA sequencing of adult hepatocytes (hAHEPs), biliary tree
stem cells (hBTSCs), hepatoblasts (hHBs), and hepatic stem cells
(hHpSCs) each from three different donors, as well as fibrolamellar
hepatocellular carcinoma (hFL-HCC) from four tumors in different
passaged lines of the transplantable tumor line, TU-2010. The tumor
cells from TU-2010 were depleted of host (murine) cells before
being analyzed by RNA-seq. Values between 0 and 1 shown in each box
correspond to the median pair-wise Pearson correlation coefficient.
All genes with an average normalized expected count >50 across
all samples were included in the analysis (n=14,394). (b, c)
Results of hierarchical clustering analysis based on Euclidian
distance of gene expression profiles across the different
categories of cells using either the 10,000 most highly expressed
genes (b) or the 248 genes significantly differentially expressed
between hBTSCs and hHpSCs (c). For both (b) and (c), only genes
with an average normalized expected count >50 in at least one
cell category were considered. (d) Histograms of representative
genes with distinct expression patterns in hFL-HCCs are shown.
These genes include anterior gradient homolog 2 (AGR2), found
expressed in other hFL-HCCs; Kruppel-like factors (KLF4 and KLF5),
critical regulators of stemness; WNT7B, a member of the WNT
("wingless-related integration site") family of genes;
doublecortin-like-kinase-1 (DCLK1), a marker of intestinal tumor
stem cells; cytokeratin 20 (KRT20), found in intestinal and
pancreatic cancers; MET, which encodes for the HGF receptor; aryl
hydrocarbon receptors (AHR), which can trigger malignant
transformation of stem cells upon binding to dioxins and related
agonists; and histone deacetylase isoform 9 (HDAC9), which
regulates chromatin accessibility. (e) Sashimi plot of RNA-seq read
coverage and splice/fusion junctions (shown as arcs) for the fusion
gene, DNAJB1-PRKACA, found only in the cells of the hFL-HCC
transplantable tumor line. Solid peaks depict reads per kilobase
per million reads mapped (RPKM). The fusion junction joins part of
exon 2 of DNAJB1 with the start of exon 2 of PRKACA. The four
replicate samples of hFL-HCC tumors had 89, 139, 91, and 59 reads,
respectively, that spanned the fusion junction. The fusion gene is
not present in normal hBTSCs, hHpSCs, hHBs, or hAHEPs.
[0065] FIG. 7 shows the results of IHC assays on paraffin sections
of the original blocks. The IHC assays on paraffin sections of
hFL-HCCs from 9 donors indicated that all are positive for sonic
hedgehog (SHH) and, of those assayed, all were also positive for
HepPar-1. The majority of the tumors (7/9) were positive for SOX9
and PDX1, and 4/9 for BMI1. There were two distinct patterns of
expression comprised of 1) ones in which most were positive for a
given antigen (e.g. HepPar1, SHH, and SOX9) but with heterogeneous
levels of expression or 2) a pattern in which a percentage of the
cells were positive (at least 20%) and the remainder negative (e.g.
PDX1 and BMI1).
[0066] FIG. 8 shows the results of IHC assays on the TMA samples of
18 hFL-HCCs versus 19 normal livers. (a) Tissue microarrays (TMAs)
of normal human liver versus (b) a human fibrolamellar
hepatocellular carcinomas (hFL-HCC). (c) Table with summary of the
number of positive versus negative assays on the TMA samples. *With
SALL4 staining, some paraffin sections were lost due to the buffer
conditions used for antigen retrieval. The scale bar=25 .mu.m.
[0067] FIG. 9 shows the results of IHC assays of the original tumor
(ascites) versus the xenotransplantable tumor, TU-2010. (a)
Cytology and IHC assays on cytospun ascites tumor cells. Cytology
revealed small aggregates of tumor cells with large pleomorphic
nuclei and some forming partial ductular structures. The IHC assays
on TU-2010 indicated strong positivity for endodermal stemness
markers (SOX17, SOX9, PDX1, SALL4, and BMI1), hepatic markers
(HepPar-1, CK7 and CK19), and CD68. The scale bar=50 .mu.m. (b)
Additional IHC assays of the xenotransplantable tumor. In addition
to the assays shown in FIG. 3, other markers found to be strongly
positive included E-cadherin, NCAM, two forms of multidrug
resistance genes (MDR1 and ABCG2), syndecan1 (heparan sulfate
proteoglycan-1 or HS-PG-1), and VCAM-1. Controls for the IHC assays
are also provided. The scale bar=25 .mu.m.
[0068] FIG. 10 shows images of monolayer cultures of the original
(a) hFL-HCC cells versus the (b) xenotransplanted tumors of
TU-2010. These are of unsorted cells and, therefore, a mixture of
host (murine) mesenchymal cells and the tumor cells. The scale
bar=100 .mu.m.
[0069] FIG. 11 shows TEM images of hFL-HCC spheroids from TU-2010
plated and maintained in serum-free KM. (a) Tumor cells displayed
numerous microvilli at their apical pole and tight junctions
(arrow) at cell to cell contact, meaning the tumor cells could
still polarize. Cells were rich in rough endoplasmic reticulum
(RER) and Golgi apparatus (G). (b) At their apical pole, tumor
cells had numerous secretory vesicles containing electron-dense
(white arrows) or not electron-dense (asterisks) granules. Note the
presence of microvilli. (c, d, e) Tumor cells were connected with
tunneling nanotubes (TNT: dark arrows in c); Filopodia-like
protrusions, which proceed TNT formation, were present and
established physical contact with neighboring cells (arrows in d
and e). The scale bar correlates with different lengths in the
different images: The scale bar=200 nm (a), 1 .mu.m (b-e).
[0070] FIG. 12 shows TEM images of hFL-HCC spheroids from TU-2010
plated and maintained in serum-free KM. (a, b) Cells were
especially rich in mitochondria (oncocytic condition) with numerous
pleomorphic, irregularly shaped, non-lucent mitochondria with
irregular cristae disorganization. G=Golgi apparatus. (c, d) Nuclei
presented dispersed chromatin and large nucleoli implicating
production of secretory proteins. The scale bar=200 nm (a-b), 1
.mu.m (c-d).
[0071] FIG. 13 shows the results of hierarchical clustering
analysis. All samples were clustered based on the expression
profiles of genes significantly differentially expressed between
hBTSCs and hHpSCs (n=248). The hFL-HCCs from TU-2010 clustered
closest to hBTSCs and furthest from hHpSCs. The hHBs and hAHEPs
clustered more closely with hHpSCs than hFL-HCCs from TU-2010 and
hBTSCs. Euclidean distance was used as the clustering metric.
[0072] FIG. 14 shows expression data for representative cell type
marker genes. RNA-seq normalized expected count data shown across
all cell types for genes that have previously been reported as
markers of stem cells/progenitors (SOX9, FOXL1, CD44, ITGA6
(CD49f), and ITGB1 (CD29), hepatocytes (DLK1, AFP, HNF4A, CPS1, and
APOB), biliary tree (KRT7, ITGB4 and ONECUT2), and pancreas (PDX1
and PCSK1). Error bars represent standard error of the mean.
[0073] FIG. 15 shows expression data for genes in the hedgehog
signaling pathway. Log.sub.2 relative expression value shown across
all cell types for genes in the hedgehog signaling pathway. Error
bars represent standard error of the mean.
[0074] FIG. 16 shows expression data for genes encoding histone
deacetylases. Log.sub.2 relative expression value shown across all
cell types for genes that code for histone deacetylases. Histone
deacetylase 9 (HDAC9) is lost entirely in hFL-HCCs. Error bars
represent standard error of the mean.
[0075] FIG. 17 shows the results of pathway enrichment analysis.
Results of ingenuity pathway analysis (IPA) are shown for genes
significantly differentially expressed between hFL-HCCs from
TU-2010 and hBTSCs, hFL-HCCs and hHpSCs, and hBTSCs and hHpSCs.
[0076] FIG. 18 shows images of normal peribiliary glands. The
biliary tree is replete with peribiliary glands found throughout
the duct wall (intramural glands) and others attached by tethers to
the bile duct surface (extramural glands). Those within the duct
wall contain cells of varying phenotypic traits that are found to
be in a pattern indicating a maturational lineage. (a)
Hematoxylin/eosin stained section of biliary tree and showing the
peribiliary glands. (b) Radial axis of maturation lineage of
biliary tree cells. The most primitive biliary tree stem cells
(stage 1-hBTSCs) are located deep within the walls of the bile
ducts and near the fibromuscular layer. These cells do not express
LGR5 or EpCAM but do express pluripotency genes (e.g. OCT4, SOX2,
KLF4, NANOG) and endodermal stem cell markers (e.g. SOX9, SOX17,
PDX1). As one moves towards the lumen of the bile duct, the cells
lose the stem cell traits and gradually acquire mature cell traits.
At intermediate stages in this process, the cells acquire LGR5
(stage-2-hBTSCs) and then EpCAM (stage-3-hBTSCs). At the lumen, no
stem cell traits are found but instead only markers of mature
cells. If near the liver, those markers are hepatic; if near the
pancreas, the markers are pancreatic; if in-between, the markers
are those of bile ducts. (c) Sonic hedgehog expression in
stage-3-hBTSCs. The scale bar=100 .mu.m.
[0077] FIG. 19 shows images of cultures of normal biliary tree stem
cells. Cultures of stage 2 of stage-3-hBTSC stages are achievable
by plating onto culture plastic (or hyaluronans) and in serum-free
Kubota's Medium. These conditions have not yet proven successful
for stage-1-hBTSCs. Stage-2-hBTSCs form colonies of cells that are
undulating and highly motile (a). They remain so in the
cholangiocyte hormonally defined medium (HDM-C) as shown in (b).
They do not express EpCAM (or CK19) on the cells within the centers
of the colonies but have slightly larger cells at the perimeters of
the colonies and that do express these traits (albeit muted
relative to that seen in the stage-3-hBTSC colonies). (c)
stage-3-hBTSCs form carpet-like colonies in which every cell
expresses EpCAM (and also CK19). (d) The stage 2 and 3 colonies and
the intermediates between them all express sonic hedgehog. The
scale bar=50 .mu.m.
[0078] FIG. 20 shows a chart of known biliary tree stem cell
populations and their lineage connections and the probable normal
counterpart to the hFL-HCC tumor cells from the transplantable
tumor line, TU-2010.
[0079] FIG. 21 shows hierarchical clustering based on RNA
expression of 163 genes differentially expressed between FL-HCC
tumor cells (FLC) and both hepatocellular carcinoma (HCC) and
cholangiocarcinoma (CCA) uniquely clusters FLC samples.
[0080] FIG. 22 shows RNA expression within a 16 gene subset of the
163 differentially expressed genes most uniquely distinguishes FLC
from HCC and CCA as well as non-tumor liver (Liver) and
cholangiocytes (Chol).
[0081] FIG. 23 shows validation of the most uniquely expressed 16
genes in FLC in an independent FLC cohort (Simon). Primary tissues
shown above include The Cancer Genome Atlas (TCGA) FLC (FLC),
validation FLC set (Simon FLC), TCGA HCC, TCGA CCA, TCGA non-tumor
liver (Liver), validation set non-tumor liver (Simon Liver) and
TCGA non-tumor cholangiocytes (Chol).
[0082] FIG. 24 depicts RNA expression within a 16 gene subset of
the FLC gene signature distinguishes purified FLC tumor cells from
biliary tree stem cells, the likely cell type of origin, and other
cell types within the liver. Cell types shown are purified FLC
tumor cells from a patient-derived xenograft (FLC PDX), biliary
tree stem cells (BTSC), hepatic stem cells (HpSC), hepatoblasts
(HB), and adult hepatocytes (AHEP).
[0083] FIG. 25 depicts RNA expression within a 16 gene subset of
the FLC gene signature distinguishes FLC from 23 other tumor
types.
[0084] FIG. 26 summarizes Gene Ontology Molecular Function Analysis
results of the 165 hFL-HCC gene signature showing enrichment in
kinase activity, growth factor binding, and cyclic adenosine
monophosphate (cAMP) binding.
[0085] FIG. 27 depicts Kinase Enrichment Analysis results of the
165 hFL-HCC gene signature showing enrichment in substrate targets
of Protein kinase A catalytic subunit alpha (PRKACA)
[0086] FIG. 28 summarizes the results from Protein-Protein
Interaction (PPI) Hub Protein analysis and shows PRKACA and sarcoma
(SRC) gene may function as network hubs in hFL-HCCs.
DETAILED DESCRIPTION
[0087] Fibrolamellar carcinomas (FLCs), also referred to as
fibrolamellar hepatocellular carcinomas (FL-HCC), occur primarily
in children and young adults without evidence of any chronic
disease. FLCs were recognized only recently, within the last
approximately 45 years, but now account for approximately 1-5% of
liver cancers worldwide. The epidemiological factors remain
unknown. To date, FLCs are treatable only by surgery, which however
is unproductive if there is metastatic disease at the time of
diagnosis. Other forms of therapy, such as chemo- and external
radiation therapies, or specific drugs commonly used for
hepatocellular carcinomas (HCCs), have proven ineffective for FLCs.
The average time to death post-diagnosis for FLC patients is only
about 18 months. This disclosure is related to tools for studying
the disease (e.g., a transplantable tumor line), including drug
screening and testing, as well as methods of suppressing the growth
of fibrolamellar hepatocellular carcinomas (FL-HCC).
[0088] Embodiments according to the present disclosure will be
described more fully hereinafter. Aspects of the disclosure may,
however, be embodied in different forms and should not be construed
as limited to the embodiments set forth herein. Rather, these
embodiments are provided so that this disclosure will be thorough
and complete, and will fully convey the scope of the invention to
those skilled in the art. The terminology used in the description
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting.
[0089] Unless otherwise defined, all terms (including technical and
scientific terms) used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs. It will be further understood that terms, such
as those defined in commonly used dictionaries, should be
interpreted as having a meaning that is consistent with their
meaning in the context of the present application and relevant art
and should not be interpreted in an idealized or overly formal
sense unless expressly so defined herein. While not explicitly
defined by below, such terms should be interpreted according to
their common meaning.
[0090] The terminology used in the description herein is for the
purpose of describing particular embodiments only and is not
intended to be limiting of the invention. All publications, patent
applications, patents and other references mentioned herein are
incorporated by reference in their entirety.
[0091] The practice of the present technology will employ, unless
otherwise indicated, conventional techniques of tissue culture,
immunology, molecular biology, microbiology, cell biology, and
recombinant DNA, which are within the skill of the art. See, e.g.,
Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory
Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current
Protocols in Molecular Biology; the series Methods in Enzymology
(Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A
Practical Approach (IRL Press at Oxford University Press);
MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and
Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005)
Culture of Animal Cells: A Manual of Basic Technique, 5th edition;
Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195;
Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson
(1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984)
Transcription and Translation; Immobilized Cells and Enzymes (IRL
Press (1986)); Perbal (1984) A Practical Guide to Molecular
Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for
Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed.
(2003) Gene Transfer and Expression in Mammalian Cells; Mayer and
Walker eds. (1987) Immunochemical Methods in Cell and Molecular
Biology (Academic Press, London); and Herzenberg et al. eds (1996)
Weir's Handbook of Experimental Immunology.
[0092] Unless the context indicates otherwise, it is specifically
intended that the various features of the invention described
herein can be used in any combination. Moreover, the disclosure
also contemplates that in some embodiments, any feature or
combination of features set forth herein can be excluded or
omitted. To illustrate, if the specification states that a complex
comprises components A, B and C, it is specifically intended that
any of A, B or C, or a combination thereof, can be omitted and
disclaimed singularly or in any combination.
[0093] All numerical designations, e.g., pH, temperature, time,
concentration, and molecular weight, including ranges, are
approximations which are varied (+) or (-) by increments of 1.0 or
0.1, as appropriate, or alternatively by a variation of +/-15%, or
alternatively 10%, or alternatively 5%, or alternatively 2%. It is
to be understood, although not always explicitly stated, that all
numerical designations are preceded by the term "about". It is to
be understood that such range format is used for convenience and
brevity and should be understood flexibly to include numerical
values explicitly specified as limits of a range, but also to
include all individual numerical values or sub-ranges encompassed
within that range as if each numerical value and sub-range is
explicitly specified. For example, a ratio in the range of about 1
to about 200 should be understood to include the explicitly recited
limits of about 1 and about 200, but also to include individual
ratios such as about 2, about 3, and about 4, and sub-ranges such
as about 10 to about 50, about 20 to about 100, and so forth. It
also is to be understood, although not always explicitly stated,
that the reagents described herein are merely exemplary and that
equivalents of such are known in the art.
DEFINITIONS
[0094] As used herein, the singular terms "a," "an," and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to a cell can include
multiple cells unless the context clearly dictates otherwise.
[0095] The term "about," as used herein when referring to a
measurable value such as an amount or concentration (e.g., the
percentage of collagen in the total proteins in the biomatrix
scaffold) and the like, is meant to encompass variations of 20%,
10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0096] The terms or "acceptable," "effective," or "sufficient" when
used to describe the selection of any components, ranges, dose
forms, etc. disclosed herein intend that said component, range,
dose form, etc. is suitable for the disclosed purpose.
[0097] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0098] As used herein, the term "aggregates" refer to a plurality
of cells that are amassed together. The aggregates may vary in both
size and shape or may be substantially uniform in size and/or
shape. The cell aggregates used herein can be of various shapes,
such as, for example, a sphere, a cylinder (preferably with equal
height and diameter), or rod-like among others. Although other
shaped aggregates may be used, in one embodiment of the disclosure,
it is generally preferable that the cell aggregates be spherical or
cylindrical. If the aggregates are comprised of only one cell type,
they are referred to as "spheroids; if they are a mixture of
multiple cell types (e.g. epithelia and mesenchymal cells), they
are referred to as "organoids." In addition, the term "spheroid"
indicates a floating aggregate of cells all being the same cell
type (e.g. an aggregate from a cell line); an "organoid" is a
floating aggregate of cells comprised of multiple cell types, an
epithelial cell and its mesenchymal partner cells, typically an
endothelial cell and a stromal cell. The cells can be
stem/progenitors of these categories of cells or can be mature
cells.
[0099] As used herein, the term "cell" refers to a eukaryotic cell.
In some embodiments, this cell is of animal origin and can be a
stem cell or a somatic cell. The term "population of cells" refers
to a group of one or more cells of the same or different cell type
with the same or different origin. In some embodiments, this
population of cells may be derived from a cell line; in some
embodiments, this population of cells may be derived from a sample
of organ or tissue.
[0100] The term "biliary tree stem cells" refers to stem cells
found throughout the biliary tree with the ability to transition
into committed hepatic and/or pancreatic progenitor cells. They are
found in both the extramural glands--tethered to the surface of the
bile ducts--and the intramural glands--within the bile duct walls.
The generic biomarkers for the biliary tree stem cells (hBTSCs)
include pluripotency genes (e.g. OCT4, SOX2, NANOG, SALL4, KLF4,
KLF5); one or another of the isoforms (standard or variant) of
CD44, the hyaluronan receptors; CXCR4; cytokeratins 8 and 18. There
are 3 stages identified so far: stage 1 hBTSCs: expresses sodium
iodide symporter, CXCR4 but not LGR5 or EpCAM; stage 2 hBTSCs
express less of NIS but gain expression of LGR5 but not EpCAM;
stage 3 hBTSCs (found in the gallbladder, in the large intrahepatic
bile ducts and hepato-pancreatic common duct) expresses LGR5 and
EpCAM and is a precursor to the hepatic stem cells (in the liver)
and to the pancreatic stem cells (in the hepato-pancreatic common
duct.
[0101] As used herein the term "cancer stem cells" refers to the
cells found within solid tumors or hematological cancers that
possess characteristics associated with normal stem cells,
specifically the ability to self-replicate and to be multipotent,
that is give rise to multiple cell types.
[0102] The term "hepatic stem cells" refers to stem cells found in
the canals of Hering, intrahepatic bile ductules, connecting the
ends of the biliary tree to the liver and retaining the ability to
self-replicate and be multipotent. The biomarkers for these cells
include epithelial cell adhesion molecule (EpCAM) found in the
cytoplasm and at the plasma membrane, neural cell adhesion molecule
(NCAM), very low levels (if any) of albumin, an absence of
alpha-fetoprotein (AFP), an absence of P450 A7, an absence of
secretin receptor (SR). Hepatic stem cells and hepatoblasts express
cytokeratins 8 and 18 and 19.
[0103] The term "hepatoblasts" refers to bipotent hepatic cells
that can give rise to hepatocytic and cholangiocytic lineages, that
have an extraordinary ability to proliferate (that is expand) but
with less ability to self-replicate than is observed in hepatic
stem cells. These cells are characterized by a biomarker profile
that overlaps with but is distinct from hepatic stem cells,
expressing EpCAM primarily at the plasma membrane, intercellular
adhesion molecule (ICAM-1) but not NCAM, P450A7, cytokeratin 7,
secretin receptor, albumin, high levels of AFP, and minimal (if
any) pluripotency genes.
[0104] As used herein the term "committed progenitor" refers to a
unipotent progenitor cell that gives rise to a single cell type,
e.g. a committed hepatocytic progenitor cell (usually recognized by
expression of albumin, AFP, glycogen, ICAM-1, various enzymes
involved with glycogen synthesis) gives rise to hepatocytes and a
committed biliary (or cholangiocytic) progenitor (recognized by
expression of EpCAM, cytokeratins 7 and 19, aquaporins, CFTR, and
membrane pumps associated with management of bile) gives rise to
cholangiocytes.
[0105] As used herein, the term "comprising" is intended to mean
that the compositions and methods include the recited elements, but
do not exclude others. As used herein, the transitional phrase
"consisting essentially of" (and grammatical variants) is to be
interpreted as encompassing the recited materials or steps "and
those that do not materially affect the basic and novel
characteristic(s)" of the recited embodiment. See, In re Herz, 537
F.2d 549, 551-52, 190 U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in
the original); see also MPEP .sctn.2111.03. Thus, the term
"consisting essentially of" as used herein should not be
interpreted as equivalent to "comprising." "Consisting of" shall
mean excluding more than trace elements of other ingredients and
substantial method steps for administering the compositions
disclosed herein. Aspects defined by each of these transition terms
are within the scope of the present disclosure.
[0106] The term "culture" or "cell culture" means the maintenance
of cells in an artificial, in vitro environment. A "cell culture
system" is used herein to refer to culture conditions in which a
population of cells may be grown as monolayers or in suspension
(spheroids, organoids).
[0107] "Culture medium" is used herein to refer to a nutrient
solution for the culturing, growth, or proliferation of cells.
Culture medium may be characterized by functional properties such
as, but not limited to, the ability to maintain cells in a
particular state (e.g. a pluripotent state, a quiescent state,
etc.), to mature cells--in some instances, specifically, to promote
the differentiation of progenitor cells into cells of a particular
lineage. Non-limiting examples of culture media are Kubota's
medium, a medium designed for endodermal stem/progenitors, a
hormonally defined medium (HDM) designed to drive the
stem/progenitors either to hepatocytes (HDM-H), to cholangiocytes
(HDM-C), or to pancreatic islets (HDM-P), which are further defined
herein below. In some embodiments the medium may be a "seeding
medium" used to present or introduce cells into a given
environment. In other embodiments, the medium may be a
"differentiation medium" used to facilitate the differentiation of
cells. Such media are comprised of a "basal medium" or a mixture of
nutrients, minerals, amino acids, sugars, lipids, and trace
elements and supplemented either with serum (serum supplemented
media or SSM) or with a defined mix of purified hormones, growth
factors and nutrients (HDM) and used for maintenance of cells ex
vivo. As used herein, "HDM-H" is an HDM used in combination with
substrata of type IV collagen and laminin to drive the
differentiation of endodermal stem/progenitors to mature
hepatocytes. "HDM-C," as used herein, refers to an HDM used in
combination with substrata of type I/III collagen and fibronectin
and designed to drive the differentiation of endodermal
stem/progenitors to mature cholangiocytes. "HDM-P" is an HDM used
in combination with substrata of type IV collagen and laminin to
drive the differentiation of endodermal stem/progenitors to a
mature pancreatic islet fate. Basal media are buffers comprised of
amino acids, sugars, lipids, vitamins, minerals, salts, and various
nutrients in compositions that mimic the chemical constituents of
interstitial fluid around cells. Basal media are the starting
points for buffers used for cell cultures. In addition, cell
culture media are usually comprised of basal media supplemented
with a small percentage (typically 2-10%) serum to provide
requisite signaling molecules (hormones, growth factors) needed to
drive a biological process (e.g. proliferation, differentiation).
Although the serum can be autologous to the cell types used in
cultures, it is most commonly serum from animals routinely
slaughtered for agricultural or food purposes such as serum from
cows, sheep, goats, horses, etc. Serum is also used to inactivate
enzymes that are part of tissue dissociation processes.
[0108] The terms "equivalent" or "biological equivalent" are used
interchangeably when referring to a particular molecule,
biological, or cellular material and intend those having minimal
homology while still maintaining desired structure or
functionality.
[0109] As used herein, the term "expression" refers to the process
by which polynucleotides are transcribed into mRNA and/or the
process by which the transcribed mRNA is subsequently being
translated into peptides, polypeptides, or proteins. If the
polynucleotide is derived from genomic DNA, expression may include
splicing of the mRNA in a eukaryotic cell. The expression level of
a gene may be determined by measuring the amount of mRNA or protein
in a cell or tissue sample. Further, the expression level of
multiple genes can be determined to establish an expression profile
for a particular sample. As used herein, the term "lower level" in
reference to expression level refers to an amount in a cancer cell
that is less than the amount in a non-cancer control sample.
[0110] Exemplary growth factors include, but are not limited to,
epidermal growth factors (EGFs), fibroblast growth factors (FGFs),
hepatocyte growth factors (HGFs), insulin-like growth factors
(IGFs), transforming growth factors (TGFs), nerve growth factors
(NGFs), neurotrophic factors, interleukins, leukemia inhibitory
factors (LIFs), vascular endothelial cell growth factors (VEGFs),
platelet-derived growth factors (PDGFs), stem cell factor (SCFs),
colony stimulating factors (CSFs), GM-CSFs, erythropoietin,
thrombopoietin, heparin binding growth factors, IGF binding
proteins, placental growth factors, Wnt signals.
[0111] As used herein, the term "functional" may be used to modify
any molecule, biological, or cellular material to intend that it
accomplishes a particular, specified effect.
[0112] The term "gene" as used herein is meant to broadly include
any nucleic acid sequence transcribed into an RNA molecule, whether
the RNA is coding (e.g., mRNA) or non-coding (e.g., ncRNA).
[0113] As used herein, the term "hyaluronan," or "hyaluronic acid,"
refers to a polymer of a uronic acid and an aminosugar [1-3]
composed of a disaccharide unit of glucosamine and gluronic acid
linked by .beta.1-4, .beta.1-3 bonds and salts thereof. Thus, the
term hyaluronan refers to both natural and synthetic
hyaluronan.
[0114] As used herein, the term "immunocompromised" in reference to
an animal is one with an impaired immune system such that it is
incapable of fully reacting immunologically to pathogens. Those
skilled in the art will recognize that this may be due to a genetic
disorder, disease process, irradiation or drugs, such as
corticosteroids or immunosuppressive agents, given to treat a
disorder that inhibits immune function. Examples of drugs that
suppress the immune system are methotrexate, cyclophosphamide,
6-mercaptopurine, vincristine, and the like. Suitable
immunocompromised animals for use in the practice of the present
disclosure are the athymic nude mouse, SCID mouse, SCID/NOD, NOD
scid gamma (NSG), BNX immunodeficient mouse, and the like, In one
preferred embodiment, the host will be immunocompromised if the
transplant of hFL-HCC cells is allogeneic or xenogeneic
[0115] The term "isolated" as used herein refers to molecules or
biologicals or cellular materials being substantially free from
other materials.
[0116] "Kubota's medium" as used herein refers to any basal medium
containing no copper, low calcium (<0.5 mM), insulin,
transferrin/Fe, free fatty acids bound to purified albumin and,
optionally, also high density lipoprotein. Kubota's Medium or its
equivalent is serum-free and contains only purified and defined mix
of hormones, growth factors, and nutrients. In certain embodiments,
the medium is comprised of a serum-free basal medium (e.g., RPMI
1640 or DME/F12) containing no copper, low calcium (<0.5 mM) and
supplemented with insulin (5 .mu.g/mL), transferrin/Fe (5
.mu.g/mL), high density lipoprotein (10 .mu.g/mL), selenium (10-10
M), zinc (10 12 M), nicotinamide (5 .mu.g/mL), and a mixture of
purified free fatty acids bound to a form of purified albumin.
Non-limiting, exemplary methods for the preparation of this media
have been published elsewhere, e.g., Kubota H, Reid L M,
Proceedings of the National Academy of Sciences (USA) 2000;
97:12132-12137, the disclosure of which is incorporated herein in
its entirety by reference.
[0117] The term "mesenchymal cell" refer to cells of the
mesenchyme. These are loose cells embedded in a mesh of proteins
and fluid (i.e. extracellular matrix). Mesenchyme gives rise to
most of the body's connective tissues.
[0118] The terms "nucleic acid," "polynucleotide," and
"oligonucleotide" are used interchangeably and refer to a polymeric
form of nucleotides of any length, either deoxyribonucleotides or
ribonucleotides or analogs thereof. Polynucleotides can have any
three dimensional structure and may perform any function, known or
unknown. The following are non-limiting examples of
polynucleotides: a gene or gene fragment (for example, a probe,
primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA),
transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant
polynucleotides, branched polynucleotides, plasmids, vectors,
isolated DNA of any sequence, isolated RNA of any sequence, nucleic
acid probes and primers.
[0119] A polynucleotide can comprise modified nucleotides, such as
methylated nucleotides and nucleotide analogs. If present,
modifications to the nucleotide structure can be imparted before or
after assembly of the polynucleotide. The sequence of nucleotides
can be interrupted by non-nucleotide components. A polynucleotide
can be further modified after polymerization, such as by
conjugation with a labeling component. The term also refers to both
double and single stranded molecules. Unless otherwise specified or
required, any aspect of this technology that is a polynucleotide
encompasses both the double stranded form and each of two
complementary single stranded forms known or predicted to make up
the double stranded form.
[0120] The term "protein", "peptide" and "polypeptide" are used
interchangeably and in their broadest sense to refer to a compound
of two or more subunit amino acids, amino acid analogs or
peptidomimetics. The subunits may be linked by peptide bonds. In
another aspect, the subunit may be linked by other bonds, e.g.,
ester, ether, etc. A protein or peptide must contain at least two
amino acids and no limitation is placed on the maximum number of
amino acids which may comprise a protein's or peptide's sequence.
As used herein the term "amino acid" refers to either natural
and/or unnatural or synthetic amino acids, including glycine and
both the D and L optical isomers, amino acid analogs and
peptidomimetics.
[0121] As used herein, the term "subject" and "patient" are used
interchangeably and are intended to mean any animal. In some
embodiments, the subject may be a mammal. In further embodiments,
the subject may be a human or non-human animal (e.g. a mouse or
rat).
[0122] As used herein, the terms "substantially," "substantial,"
and "about" are used to describe and account for small variations.
When used in conjunction with an event or circumstance, the terms
can refer to instances in which the event or circumstance occurs
precisely as well as instances in which the event or circumstance
occurs to a close approximation. For example, the terms can refer
to less than or equal to .+-.10%, such as less than or equal to
.+-.5%, less than or equal to .+-.4%, less than or equal to .+-.3%,
less than or equal to .+-.2%, less than or equal to .+-.1%, less
than or equal to .+-.0.5%, less than or equal to .+-.0.1%, or less
than or equal to .+-.0.05%. In addition, when a cancer cell is said
to "substantially not express" a particular gene, this refers to
less than or equal to .+-.10% (or more preferably less than or
equal to .+-.5%) as compared to a non-cancer cell.
[0123] The term "transplantable" in reference to a tumor line
refers to a tumor grown in a laboratory animal. The term
"xenotransplantable" is one that has or will be transplanted
between members of different species, for example, a human tumor
that is transplantable into a mouse. A tumor from a donor animal
(e.g. a human) is removed and often prepared into a single-cell
suspension and administered to the host/recipient animal (e.g. a
mouse). Some tumors must be propagated by transplanting small
pieces of tumor or minced tumor material.
[0124] As used herein, "treating" or "treatment" of a disease in a
subject refers to (1) preventing the symptoms or disease from
occurring in a subject that is predisposed or does not yet display
symptoms of the disease; (2) inhibiting the disease or arresting
its development; or (3) ameliorating or causing regression of the
disease or the symptoms of the disease. As understood in the art,
"treatment" is an approach for obtaining beneficial or desired
results, including clinical results. For the purposes of the
present technology, beneficial or desired results can include one
or more, but are not limited to, alleviation or amelioration of one
or more symptoms, diminishment of extent of a condition (including
a disease), stabilized (i.e., not worsening) state of a condition
(including disease), delay or slowing of condition (including
disease), progression, amelioration or palliation of the condition
(including disease), states and remission (whether partial or
total), whether detectable or undetectable.
[0125] Many embodiments described herein relate to a non-human
animal that is immunocompromised and able to be transplanted with
human tumor cells without immunologically rejecting the human
cells. Such a host is used for establishment of a transplantable
human fibrolamellar hepatocellular carcinoma (hFL-HCC) tumor line
such as TU-2010, a non-human, immunocompromised animal carrying a
transplantable human tumor of fibrolamellar hepatocellular
carcinoma cells; the tumor line is called TU-2010.
[0126] The immunocompromised animal can be, for example, devoid of
T cells, devoid of B cells, lacking functional NK cells, and/or
deficient in cytokine signaling. In some embodiments, the non-human
animal is an immunocompromised mouse. The immunocompromised mouse
can be, for example, a NOD scid gamma mouse (or NOD.
Cg-Prkdc.sup.scid Il2rg.sup.tm1Wj1/SzJ).
[0127] In some embodiments, the xenotransplanted tumor in the
non-human animal is a subcutaneous tumor. In some embodiments, the
xenotransplanted tumor in the non-human animal is an
intraperitoneal tumor, an ascites. The xenotransplanted tumor, once
depleted of the host cells, can comprise, for example,
approximately 10.sup.6 to 10.sup.7 hFL-HCC cells/gram
[0128] The hFL-HCC tumor line, TU-2010, is unusually rich in cancer
stem cells. Whereas hepatocellular carcinomas (HCCs) are comprised
typically of .about.0.5-3% cancer stem cells, and
cholangiocarcinomas (CCAs) are comprised typically of .about.10%
cancer stem cells, the transplantable tumor line, TU-2010, is
comprised of more than 60% cancer stem cells, a finding indicating
the uniqueness of the TU-2010 tumor line.
[0129] The transplantable tumor line, TU-2010, is further comprised
of a large percentage of mesenchymal cells derived from the host,
the immunocompromised, non-human animal. The mesenchymal cells can
comprise, for example, precursors to stellate cells, endothelial
cells, stromal cells or pericytes. The non-human mesenchymal cells
can account for 50% or more of the tumors transplanted
subcutaneously and over 90% of those transplanted
intraperitoneally.
[0130] The hFL-HCC cells of the TU-2010 transplantable tumor line
express a fusion transcript DNAJB1-PRKACA that has been found in
the majority (.about.70%) of human FL-HCC tumors.
[0131] The hFL-HCC cells of the TU-2010 transplantable tumor line
do not express HDAC9.
[0132] The hFL-HCC cells of the TU-2010 transplantable tumor line
express LGR5 but substantially do not express or express negligible
level of epithelial cell adhesion molecule (EpCAM)
[0133] Human fibrolamellar hepatocellular carcinomas, including the
cells in TU-2010, have phenotypic traits indicative of an origin
from one or another of the biliary tree stem cell (hBTSC)
populations. These include expression of one or more of the
following markers: [0134] endodermal stem/progenitor transcription
factors (SOX9, SOX17, PDX1, FOXA1) [0135] one or more stem cell
genes such as the hyaluronan receptors (CD44), SALL4, LGR5, TROP-2,
prominin (CD133), and Sonic Hedgehog (SHH) [0136] one or more
pluripotency genes and genes indicative of self-replication
selected from NANOG, OCT4, KLF4, KLF5, SOX2, BMI1, AGR2 and SALL4.
[0137] one or more hepatic markers selected from CK7, CK18, CK19,
CD68, DCLK1, HepPar-1, and KRT20 (KRT20 is found also in the
epithelial cells of the intestine) [0138] one or more
pancreatic/endocrine markers such as PDX1, NGN3, PCSK1.
[0139] Fibrolamellar hepatocellular carcinomas, including the
FL-HCCs in TU-2010, express various markers indicative of
malignancy. The TU-2010 line expresses high levels of anterior
gradient protein 2 homolog (AGR-2), associated with the down
regulation of the phosphoprotein, P53, a tumor suppressor, and it
secretes large amounts of enzymes that degrade extracellular matrix
components. These findings are relevant to regulation of p53.
[0140] The hFL-HCC tumors, including the cells of the TU-2010 tumor
line, express high levels of the aryl hydrocarbon receptor (AHR)
implicating a possible pathogenic and oncogenic process involving
dioxins or dioxin-like molecules.
[0141] The hFL-HCC tumors have aberrations or loss of expression of
one (or more) histone deacetylases. For example the TU-2010 tumor
line's cells have a lack of expression of HDAC 9, a member of a
family of histone deacetylases involved in epigenetic repression
and involved in regulation of transcription, development and cell
cycle. HDAC 9 serves deacetylation of lysine residues on the
N-terminal part of certain core histones (H2A, H2B, H3 and H4).
[0142] The non-human host used for transplantable human tumors,
such as the transplantable human tumor line, TU-2010, is, of
necessity, an immunocompromised host since the transplants are
xenogeneic. The immunocompromised host can be, for example, devoid
of T cells, devoid of B cells, lacking functional NK cells, and/or
deficient in cytokine signaling. In some embodiments, the non-human
host is an immunocompromised mouse. The immunocompromised mouse can
be, for example, a NOD scid gamma (NSG) mouse.
[0143] The tumor cells of the transplantable tumor line can be
transplanted subcutaneously or intraperitoneally in the non-human
host.
[0144] The hFL-HCC tumors are rich in cancer stem cells. TU-2010
transplantable tumor line is particularly rich in human cancer stem
cells. Whereas hepatocellular carcinomas (HCCs) are comprised
typically of .about.0.5-3% cancer stem cells, and
cholangiocarcinomas (CCAs) are typically .about.10.sup.% cancer
stem cells, the TU-2010 transplantable tumor line is more than 60%
cancer stem cells.
[0145] The hFL-HCCs can be highly desmoplastic, meaning that the
tumor cells elicit a strong reaction from mesenchymal cells located
near to the tumor cells. The TU-2010 tumor line is representative
of this ability of hFL-HCCs to elicit desmoplastic responses; it
comprises a mixture of hFL-HCC cells and a large percentage of host
(i.e. murine) mesenchymal cells that can comprise, for example,
precursors to stellate cells and endothelial cells. The host
mesenchymal cells can account for over half of the cells of the
tumor in subcutaneous tumors and over 90% of them in
intraperitoneal tumors
[0146] The human FL-HCC cells of the tumor line, TU-2010, express
the fusion transcript DNAJB1-PRKACA, found in .about.80% of FL-HCC
tumors.
[0147] The cells of the human transplantable tumor line, TU-2010,
express LGR5 but substantially do not express or express negligible
levels of EpCAM.
[0148] In some embodiments, the human FL-HCC cells of the tumor
line, TU-2010, express one or more markers indicative of an origin
in one or another of the biliary tree stem cell subpopulations.
These include one or more of the following biomarkers: [0149]
endodermal stem/progenitor transcription factors (SOX9, SOX17,
PDX1, FOXA1), [0150] stem cell genes such as the hyaluronan
receptors (CD44), LGR5, TROP-2, prominin (CD133), and Sonic
Hedgehog (SHH) [0151] one or more pluripotency genes and genes
indicative of self-replication selected from NANOG, OCT4, KLF4,
KLF5, SOX2, BMI1, and SALL4 [0152] one or more hepatic markers
selected from CK7, CK18, CK19, CD68, DCLK1, and HepPar-1, and KRT20
(also found in the epithelial cells of the intestine) [0153] one or
more pancreatic/endocrine markers such as PDX1, NGN3, PCSK1.
[0154] The human FL-HCC cells, such as occurs in the TU-2010 tumor
line, express biomarkers of malignancy. These include high levels
of the anterior gradient protein 2 homolog (AGR-2), associated with
the down regulation of the phosphoprotein, p53, a tumor suppressor
and/or secrete high levels of enzymes that degrade extracellular
matrix components.
[0155] The human FL-HCC cells, such as those of the TU-2010 tumor
line and in primary FL-HCCs, express high levels of the aryl
hydrocarbon receptor (AHR) implicating a possible
pathogenic/oncogenic process involving dioxins or dioxin-like
molecules as contributing to the development of the TU-2010 tumor
cells and other FL-HCCs.
[0156] Human FL-HCCs have aberrations in or loss of expression of
one or another of the histone deacetylase genes, a family of genes
involved in regulation of transcription, development and the cell
cycle through enzymatic removal of acetyl groups from histones. For
example, the TU-2010 tumor line's cells have a lack of expression
of HDAC9, HDAC 9 is involved in deacetylation of lysine residues on
the N-terminal part of certain core histones (e.g. H2A, H2B3, H3
and H4). HDAC9 is low in primary FL-HCC tumors and also in HCCs as
well.
[0157] Further embodiments relate to a tissue sample obtained from
the tumor line.
[0158] hFL-HCC Cell Cultures.
[0159] Many embodiments described herein also relate to a cell
culture comprising human FL-HCC cells. Ideally the hFL-HCCs are
maintained in culture in a serum-free medium. In some embodiments,
the serum-free medium is Kubota's Medium, one that culture selects
for endodermal stem/progenitors and is non-permissive for cells at
later maturational lineage stages.
[0160] Kubota's Medium is a wholly defined medium originally
designed for rodent hepatoblasts and later found effective also
human hepatoblasts (hHBs), human hepatic stem cells (hHpSCs), human
biliary tree stem cells (hBTSCs), human pancreatic stem cells and
for human hepatic and pancreatic progenitors. In some embodiments,
Kubota's Medium comprises any basal medium (e.g., RPMI 1640 or
DMEM-F12) with no copper, low calcium (e.g., 0.3 mM),
.about.10.sup.-9 M selenium, .about.0.1% bovine serum albumin or
human serum albumin (highly purified and fatty acid free),
.about.4.5 mM nicotinamide, .about.0.1 nM zinc sulfate
heptahydrate, .about.10.sup.-8 M hydrocortisone, .about.5 .mu.g/ml
transferrin/Fe, .about.5 .mu.g/ml insulin, .about.10 .mu.g/ml high
density lipoprotein, and a mixture of purified free fatty acids
that are added after binding them to purified serum albumin. The
free fatty acid mixture consists of .about.100 mM each of palmitic
acid, palmitoleic acid, oleic acid, linoleic acid, linolenic acid,
and stearic acid
[0161] In some embodiments used for maintaining the cells as stem
cells, the serum-free medium is further supplemented with
hyaluronans or substrata of hyaluronans are used.
[0162] In some embodiments when the cells are being differentiated
towards an adult fate, the serum-free hormonally defined medium is
comprised of Kubota's Medium is further supplemented with at least
one growth factor or cytokine. The growth factor can be, for
example, epidermal growth factor (EGF), hepatocyte growth factor
(HGF) fibroblast growth factor (FGF) and/or vascular endothelial
cell growth factor (VEGF).
[0163] In some embodiments as when the cells are being
differentiated towards a hepatocyte fate, the serum-free hormonally
defined medium is comprised of Kubota's Medium is further
supplemented with: calcium to a level of .about.0.6 mM;
.about.10.sup.-12M copper; EGF (.about.10 ng/ml); bFGF (.about.20
ng/ml); tri-iodothyronine or T3 (.about.10.sup.-9M); glucagon (7
.mu.g/L), galactose (2 .mu.g/L), oncostatin M (.about.10 ng/ml);
and HGF (.about.20 ng/ml). For more optimal differentiation to an
hepatocyte fate, this HDM is used in combination with embedding the
cells into a mixture of type IV collagen, laminin, and
hyaluronans.
[0164] In some embodiments as when the cells are being
differentiated towards a cholangiocyte fate, the serum-free
hormonally defined medium is comprised of Kubota's Medium that is
further supplemented with: calcium to a level of .about.0.6 mM;
.about.10.sup.-12M copper; bFGF (.about.20 ng/ml); T3
(.about.10.sup.-9M); VEGF (20 ng/ml) and HGF (10 ng/ml). For more
optimal differentiation to a cholangiocyte fate, this HDM-C is used
in combination with embedding the cells into a mix of type I
collagen and hyaluronans.
[0165] In some embodiments as when the cells are being
differentiated towards a pancreatic islet fate, the serum-free
hormonally defined medium is comprised of Kubota's Medium is
prepared without hydrocortisone and then further supplemented with:
calcium to a level of .about.0.6 mM; .about.10.sup.-12 M copper;
bFGF (.about.20 ng/ml); B27 (.about.2%), ascorbic acid (.about.0.1
mM), cyclopamine (.about.0.25 .mu.M), retinoic acid (.about.1
.mu.M); furthermore, the bFGF is used for the first 4 days and then
is replaced with exendin-4 (50 ng/ml) and HGF (20 ng/ml) for the
remainder of the time. For more optimal differentiation to a
pancreatic islet fate, this HDM-P is used in combination with
embedding cells into a mix of type IV collagen, laminin, and
hyaluronans
[0166] In some embodiments, the cultures are primary cultures of
the dispersed tumor and so are a mix of the hFL-HCCs and the host
(e.g. murine) mesenchymal cells.
[0167] In some embodiments, the human cells can be purified by
immune-selection from the tumor cell suspensions such that the
cultures are predominantly (>90%) the human FL-HCC cells.
[0168] In some embodiments, the human FL-HCC cells of the cell
cultures are rich in cancer stem cells. If the host (e.g. murine)
mesenchymal cells have been depleted by immune-selection
technologies, the hFL-HCCs are dominant (>90% of the cells in
culture) and comprised of cancer stem cells that are over 50% and
up to 70% of the human cells in the cultures.
[0169] In some embodiments, the human FL-HCC cells are plated onto
a culture substratum such as plastic; in some, the substratum can
be a purified form of a matrix component (e.g. hyaluronan, a
collagen, an adhesion molecule such as laminin); in some, the
substratum can be a complex extracellular matrix extract such as a
biomatrix scaffold or Matrigel.
[0170] In some embodiments, the human FL-HCC cells of the cell
culture can be established as spheroids or organoids, floating
aggregates of cells. In other embodiments, the hFL-HCC cells of the
cell culture are in the form of monolayers.
Methods for Establishing and Maintaining hFL-HCC Tumor Lines
[0171] In some embodiments, the hFL-HCC cells are obtained from an
ascites fluid; in some embodiments, the hFL-HCC cells are obtained
from a solid tumor from a patient suffering from the disease. To
establish a tumor line, the tumor cells must first be culture
selected for the cancer stem/progenitors present in the tumor. The
culture selection makes use of restrictive conditions that are not
permissive for other lineage stages of cells other than the ones
desired. The method comprises culturing cells obtained from the
ascites fluid or from the solid tumor with a wholly defined,
serum-free media (e.g., Kubota's Medium), designed to culture
select endodermal stem/progenitor cells (such as the cancer stem
cells in the human FL-HCC tumors).
[0172] Many embodiments described herein also relate to a method
for obtaining a human FL-HCC tumor line, comprising isolating human
FL-HCC cells from a human subject suffering from FL-HCC; culture
selecting the cancer stem/progenitor cell population(s) under
conditions permissive for the cancer stem cells but not for the
later maturational lineage stages of cells; and then transplanting
them into an immunocompromised, non-human animal. The
immunocompromised non-human animal can be, for example, an
immunocompromised mouse such as NOD scid gamma (NSG) mouse.
[0173] In some embodiments, the hFL-HCC cells isolated from the
human subject are transplanted subcutaneously into the
immunocompromised non-human animal. In some embodiments, the
hFL-HCC cells isolated from the human subject are transplanted
intraperitoneally into the immunocompromised non-human animal.
[0174] In some embodiments, the method comprises transplanting from
10 to 10.sup.8 hFL-HCC cells, or about 10.sup.2 to 10.sup.7 hFL-HCC
cells, or about 10.sup.2 to 10.sup.3 hFL-HCC cells, or about
10.sup.3 to 10.sup.4 hFL-HCC cells, or about 10.sup.4 to 10.sup.5
hFL-HCC cells, or about 10.sup.5 to 10.sup.6 hFL-HCC cells, or
about 10.sup.6 to 10.sup.7 hFL-HCC cells, into the
immunocompromised non-human animal. In some embodiments, the method
comprises monitoring the immunocompromised non-human animal for
tumor formation for 2 to 9 months. Depending on the number of cells
transplanted (with more transplanted cells correlating with more
rapid tumor formation), for example, formation of a xenografted
human tumor can occur in about 2-3 months (with transplantation of
over 10.sup.6 cells), and ranging to 7-9 months (with
transplantation of 10-100 cells).
[0175] Many embodiments described herein also relate to a method
for maintaining a human FL-HCC tumor line, comprising obtaining
human FL-HCC cells from a first passaged xenografted tumor,
dispersing the cells by enzymatic or mechanical methods into a cell
suspension, and transplanting the human FL-HCC cells into a second
immunocompromised non-human animal. The first and second
immunocompromised non-human animals can be, for example,
immunocompromised mice such as NOD scid gamma mice.
[0176] In some embodiments, the method comprises culturing cells
obtained from the xenografted tumor with a serum-free medium (e.g.,
Kubota's Medium) to culture select human FL-HCC cells. In some
embodiments, the serum-free medium is supplemented with
hyaluronans. In some embodiments, the serum-free medium is
supplemented with one or more growth factors. The growth factors
can be, for example, HGF, FGF, EGF, and/or VEGF.
[0177] In some embodiments, the human FL-HCC cells obtained from
the first immunocompromised non-human animal are transplanted
subcutaneously into the second immunocompromised non-human animal.
In some embodiments, the human FL-HCC cells obtained from the first
immunocompromised non-human animal are transplanted
intraperitoneally into the second immunocompromised non-human
animal.
Method for Culturing hFL-HCC Cells
[0178] Many embodiments described herein also relate to a method
for culturing human FL-HCC cells, comprising separating human
FL-HCC cells of a xenografted tumor from non-human cells,
suspending the separated human FL-HCC cells in a serum-free medium
(e.g., Kubota's Medium), and plating the hFL-HCC cells onto culture
plastic, or onto a purified matrix component (e.g. hyaluronan, a
collagen, an adhesion molecule such as laminin) or into/onto a
complex extracellular matrix extract (e.g. biomatrix scaffolds,
Matrigel).
[0179] In some embodiments, the human FL-HCC cells of the
xenografted tumor are separated from non-human cells (e.g. murine
mesenchymal cells) by magnetic immuno-selection or by an equivalent
immune-selection technology (e.g. flow cytometry) or any technology
that distinguishes human from non-human cells.
[0180] In some embodiments, the culture substratum comprises a
culture plastic. In some embodiments, the culture substratum
comprises a monolayer coating or a 3-dimensional form (e.g.
hydrogel) of a purified extracellular matrix component (e.g.
hyaluronan, a collagen, an adhesion molecule such as laminin), a
mix of one or more of the matrix component, or an extract enriched
in extracellular matrix (e.g. biomatrix scaffolds, Matrigel).
[0181] In some embodiments, the human FL-HCC cells are suspended in
the medium and aggregation of the cells occurs to form spheroids if
only the hFL-HCC are part of the aggregates or organoids if the
aggregates contain hFL-HCC and other cell types (e.g. vascular or
mesenchymal cells). In some embodiments, the plated hFL-HCC cells
form monolayers.
Method for Drug Screening and Testing
[0182] Many embodiments described herein also relate to a method
for drug screening, comprising contacting a candidate drug with
cultured hFL-HCC cells, and monitoring the effect(s) of the
candidate drug on the cultured hFL-HCC cells.
[0183] In some embodiments, the cultured hFL-HCC cells are in the
form of floating aggregates of cells, spheroids or organoids.
[0184] Many embodiments described herein also relate to a method
for drug testing, comprising administering a candidate drug to a
non-human animal that has been transplanted with a tumor containing
human FL-HCC cells, and monitoring the effect of the candidate drug
on the xenotransplanted tumor.
[0185] Many embodiments described herein also relate to a method
for suppressing the growth of human FL-HCC cells, comprising
treating the hFL-HCC cells with a hedgehog signaling pathway
inhibitor and/or a histone deacetylase inhibitor and/or some other
candidate drug.
[0186] In some embodiments, the method comprises treating the human
FL-HCC cells with a hedgehog signaling pathway inhibitor (e.g.,
GDC-0449). In some embodiments, the method comprises treating the
human FL-HCC cells with a histone deacetylase inhibitor (e.g., SAHA
or SBHA).
[0187] Many embodiments described herein also relate to a method
for treating FL-HCC in a human patient, comprising administering to
the patient an effective amount of a hedgehog signaling pathway
inhibitor and/or a histone deacetylase inhibitor.
[0188] In some embodiments, the method comprises administering to
the patient an effective amount of a hedgehog signaling pathway
inhibitor (e.g., GDC-0449). In some embodiments, the method
comprises administering to the patient an effective amount of a
histone deacetylase inhibitor (e.g., SAHA or SBHA).
Method for Diagnosis of hFL-HCCs
[0189] At present, the only biomarker identified for .about.80% of
human FL-HCCs is the fusion gene, DNAJB1-PRKACA. Histologically,
the tumor is recognizable as aggregates of large polygonal cells
with abundant eosinophilic cytoplasm, large, vesiculated nuclei and
large nucleoli; the tumor cells are nestled within bands of stroma.
In addition to the fusion gene and the distinctive histological
traits, one can identify hFL-HCCs by phenotypic traits typical of
biliary tree stem cells. These hFL-HCC tumors are hypothesized to
derive from one or another of the biliary tree stem cell
subpopulations that constitute the native stem cells and
progenitors for both liver and pancreas. [0190] Recognition of the
origins of hFL-HCCs from hBTSC subpopulations is indicated by the
expression of: [0191] one or more endodermal transcription factors
(e.g. SOX9, SOX17, PDX1, FOXA1) [0192] one or more pluripotency
genes and genes indicative of self-replication (e.g. NANOG, OCT4,
KLF4, KLF5, SOX2, BMI1, TROP-2, and SALL4) and evidence for
multipotency [0193] one or more hepatic markers (e.g.
alpha-fetoprotein, albumin, CK7, CK18, CK19, CD68, DCLK1, and
HepPar-1), and KRT20 (also found in the epithelial cells of the
intestine) [0194] one or more pancreatic/endocrine markers (e.g.
PDX1, NGN3, PCSK1, insulin, glucagon, amylase, MUC or mucin).
[0195] Recognition of malignancy in hFL-HCCs is indicated by:
[0196] Expression of high levels of anterior gradient protein 2
homolog (AGR-2), associated with the down regulation of the
phosphoprotein, p53, a tumor suppressor. [0197] Release of high
levels of enzymes that degrade and dissolve extracellular matrix
(e.g. heparanase, matrix metalloproteinases-MMPs) [0198] Aberrant
regulation of p53, a tumor suppressor [0199] Recognition of factors
contributing to the pathogenic/oncogenic process in hFL-HCCs is
indicated by: high levels of the aryl hydrocarbon receptor (AHR)
implicating a possible contribution of dioxins or dioxin-like
molecules in the aetiology of hFL-HCCs [0200] Recognition of key
genes that are affected in hFL-HCCs is indicated by: aberrations in
or absence of one or more histone deacetylases (HDAC), enzymes
critically associated with regulation of transcription,
development, cell proliferation, and the cell cycle.
[0201] In addition, the human FL-HCC tumors will have biomarkers of
malignancy. Some of the biomarkers indicative of malignancy include
high levels of expression of AGR2, over-production of
matrix-degrading enzymes (e.g. heparanase, matrix
metalloproteinases or MMPs), very high levels of AHR and aberrant
levels of one or another HDAC gene and/or aberrations in the
regulation of p53, a tumor suppressor.
[0202] In some embodiment, the method further comprises culturing
cells obtained from an ascites fluid or solid tumor derived from a
human subject and subjecting it to culture conditions that are
wholly serum-free and in a medium (e.g., Kubota's Medium), designed
for culture selection of endodermal cancer stem/progenitors and
then detecting the formation of spheroids or organoids.
Methods for Determining Whether a Patient has FL-HCC and Treating a
Patient Diagnosed with FL-HCC
[0203] In one aspect is provided a method of determining whether a
patient has fibrolamellar hepatocellular carcinoma (FL-HCC),
comprising: (a) measuring gene expression levels of at least one of
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C; and
(b) comparing the gene expression level to one or more control
samples.
[0204] In some embodiments, overexpression of C10orf128, CA12,
CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1,
PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the
control sample is associated with presence of FL-HCC. On the other
hand, a lack of increased expression of C10orf128, CA12, CREB3L1,
GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2,
RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative to the control sample
indicates that the patient is not likely to have FL-HCC.
[0205] In other embodiments, overexpression of PCSK1, CA12, NOVA1,
SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control
sample is associated with presence of FL-HCC. On the other hand, a
lack of increased expression of PCSK1, CA12, NOVA1, SLC16A14,
TNRC6C, TMEM163, and RPS6KA2 relative to the control sample
indicates that the patient is not likely to have FL-HCC.
[0206] In yet other embodiments, overexpression of C10orf128, OAT,
PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C relative to the
control sample is associated with presence of FL-HCC. On the other
hand, a lack of increased expression of PCSK1, CA12, NOVA1,
SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative to the control
sample indicates that the patient is not likely to have FL-HCC.
[0207] In some embodiments, the control sample is selected from the
group consisting of hepatocellular carcinomas (HCCs),
cholangiocarcinomas (CCAs), normal liver cells, and normal
cholangiocytes.
[0208] As used herein, the term "overexpression" refers to the
level of mRNA and/or protein of a specific, for example, C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C, expressed in
a suspected tumor cell of a sample collected from a patient being
elevated in comparison to the level as measured in a control
sample. The mRNA and/or protein expression level may be determined
by a number of techniques known in the art including, but not
limited to, quantitative RT-PCR, western blotting,
immunohistochemistry, and suitable derivatives of the above.
[0209] In some embodiments, the gene expression of PCSK1 and at
least one additional gene selected from the group consisting of
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C is measured.
In another embodiment, the gene expression of PCSK1 and at least
one additional gene selected from the group consisting of
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C is
overexpressed.
[0210] In some embodiments, at least two, at least three, at least
four, at least five, at least six, at least seven or all eight of
genes C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4,
NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 and
TNRC6C are measured. In some embodiments, at least two, at least
three, at least four, at least five, at least six, at least seven
or all eight of genes C10orf128, CA12, CREB3L1, GALNTL6, IRF4,
ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14,
TMEM163 and TNRC6C are overexpressed. In some embodiments, any one
of the listed genes is expressly excluded from the genetic
signature of hFL-HCC.
[0211] In one aspect is provided a method of treating a patient
determined to have FL-HCC by administering to the patient an
effective amount of at least one therapeutic that decreases
expression of at least one of C10orf128, CA12, CREB3L1, GALNTL6,
IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3, PCSK1, PHACTR2, RPS6KA2,
SLC16A14, TMEM163, or TNRC6C.
[0212] In some embodiments, the at least one therapeutic is
selected from the group consisting of a small molecule, RNA
interference, and a locked nucleic acid (LNA). In other
embodiments, the at least one therapeutic is an immunotherapy.
[0213] In one aspect is provided a method of treating a patient
determined to have hFL-HCC by administering to the patient an
effective amount of at least one therapeutic that regulates PRKACA
or SRC network hubs.
[0214] In another aspect is provided method of treating a patient
determined to have hFL-HCC by administering to the patient an
effective amount of at least one therapeutic that regulates
substrate targets of the kinase PRKACA (Protein kinase A catalytic
subunit alpha) or carbonic anhydrases.
Working Examples
[0215] Human fibrolamellar hepatocellular carcinomas (hFL-HCCs) are
rare liver cancers occurring in young people, have an unknown
aetiology, and are currently treatable only by surgery.
Immunohistochemistry (IHC) of 9 hFL-HCCs and tissue microarrays of
18 FL-HCCs indicated robust expression of endodermal
stem/progenitor markers (SOX9, PDX1, SOX17, sonic hedgehog--SHH,
SALL4, OCT4).
[0216] A first-ever, transplantable hFL-HCC tumor line, TU-2010,
established in immunocompromised mice, proved rich in cancer stem
cells, indicated functionally by spheroid/organoid formation,
limiting dilution tumorigenicity, and culture; by flow cytometric
and IHC evidence of pluripotency (e.g. KLF4, OCT4, NANOG) and
endodermal stem/progenitor markers (e.g., LGR5, SOX9, PDX1, CD44,
SHH); and effects of differentiation media on these traits.
Transcriptomic analyses revealed a global expression profile for
human FL-HCCs indicating their derivation from biliary tree stem
cells, stem cell precursors to liver and pancreas. A recurrent
fusion gene unique to hFL-HCCs, DNAJB1-PRKACA, was confirmed. In
vitro studies and phenotypic traits suggest hedgehog proteins and
histone deacetylases to be therapeutic targets. Oikawa et al.
(2015) Nature Communications 6:8070, incorporated by reference in
its entirety.
Materials and Methods
[0217] 1.1. Paraffin Sections of Normal Livers Versus hFL-HCCs.
[0218] Sections (5 .mu.m) prepared from the original paraffin
blocks of 9 hFL-HCC tumors and ones from Tissue MicroArrays (TMAs)
of 19 normal adult livers and 18 hFL-HCC patients were obtained
from Memorial Sloan Kettering Cancer Center (MSKCC, New York City,
N.Y.) and used for IHC assays. They were obtained with approval of
the IRB at MSKCC. Handling of all the samples fully met compliance
and privacy requirements as per HIPAA laws.
[0219] 1.2. Original Fibrolamellar Hepatocellular Carcinoma
(hFL-HCC) Used to Establish the Tumor Line, TU-2010.
[0220] A male patient, age 25, presented in August 2008 to
Greenwich Hospital (Yale/New Haven Hospital, Greenwich, Conn.) with
acute swelling of his right lower leg. During the initial
evaluations, he was found to have an extensive venous thrombus
extending from his right ankle into his inferior vena cava. A CT of
his chest/abdomen/pelvis revealed multiple small pulmonary emboli
and a large mass in his left liver with evidence of metastatic
disease in the perihepatic lymph nodes, omentum and peritoneum. He
had a venous filter inserted above the thrombus, was started on
anticoagulation and transferred to MSKCC for further studies and
therapy. The patient underwent a liver biopsy resulting in a
pathologic diagnosis of hepatocellular carcinoma (HCC) and
subsequently had an extensive debulking procedure which included a
left hepatic lobectomy and debulking of periotoneal and omental
nodules. Macroscopically, the peritoneal and omentum nodules proved
to be tumors and histologically revealed tumor tissue consistent
with a diagnosis of hFL-HCC. Surgical pathology revealed tumor
cells positive for HepPar1 and cytokeratin 7 (CK7). Analyses of EMA
(epithelial membrane antigen) and AFP (t-fetoprotein) were not
conclusive and neither were tissues stained for reticulin, iron, or
PAS-3.
[0221] A summary of the characterization of the original tumor by
the pathologists at Memorial Sloan Kettering Cancer Center (MSKCC)
is given in Table 1. A later round of biopsies resulted in similar
pathology reports. These included cytology on pleural fluid found
replete with tumor cells, which also had a pathology consistent
with a diagnosis of FL-HCC.
TABLE-US-00001 TABLE 1 Summary of findings on the original hFL-HCC
tumor used to establish the TU-2010 transplantable tumor line.
(patient data from Memorial Sloan Kettering Cancer Center-MSKCC)**
Staining Intensity (% cells Staining) or Gene Expression BIOMARKERS
ASSAYS Change Comments Ribonucleotide IHC 2 + (80%) Certain drugs,
such as reductase subunit M1 gemcitabine, are of little benefit
(RRM1) due to high expression of RRM1 Breast Cancer IHC 2 + (75%)
Obviates usefulness of cisplatin Resistant Protein and carboplatin
(BCRP) Secreted Protein Acidic IHC 2 + (35%) Nab-paclitaxel and
Rich in Cysteine (SPARC) SPARC Microarray Increased (3.51)
Nab-paclitaxel Multidrug Resistance IHC 2 + (30%) Minimal effects
expected with associated Protein 1 etoposide, vincristine (MRP1)
ABCC1 Microarray Increased (3.03) Minimal benefit with Paclitaxel,
Topotecan Her2/Neu IHC 2 + (10%) and 1 + FISH analyses were done,
and 60 (30%) interphase nuclei were examined; the ratio of HER2/neu
signals to chromosome 17 signals was 1.63 to 1 indicating no
amplification of this gene HIF1A Microarray Increased (10.66)
Agents associated with clinical benefits include sorafenib,
sunitinib, bevacizumab PDGFRB Microarray Increased (2.3) Agents
associated with clinical benefits include sorafenib, sunitinib,
imatinib TOP2B Microarray Increased (4.55) Beneficial agents
include doxorubicin, epirubicin, liposomal doxorubicin ADA
Microarray Increased (4.05) Beneficial agents include pentostatin
Estrogen receptor, Negative Classic hormone therapies are not
progesterone receptor, logical for use with the tumor androgen
receptor **Approval for the research studies on the tumor and on
the patient was given by the IRB at MSKCC (New York City, NY), and
compliance with HIPAA regulations was met.
[0222] The patient was subsequently treated with various oncoloytic
agents including sorafenib, doxorubicin, gemcitabine, cisplatinum,
5-FU, bevacizumab, and thalidomide with limited or no response. In
September of 2009 after showing progressive enlargement in the
perihepatic and retroperitoneal nodes, recurrent disease in the
liver, and increasing size of omental and peritoneal nodules, the
patient returned to MSKCC to obtain further tissue for tumor
sensitivity studies and debulking. Biopsies were taken, but his
disease was too extensive for debulking. Paclitaxel and thalidomide
were then started based on sensitivity studies but was poorly
tolerated with continued disease progression, so treatment was
stopped. After 4 months it was realized that he had widely
disseminated disease especially in the ascites fluid. In early
February 2010, a palliative paracentesis was done for massive
ascites, and approximately 5 liters of fluid were removed and
transferred to several researchers, including those in the UNC
research lab, in hopes that studies on the tumor might identify
alternate treatments. A week later the patient passed away
peacefully.
[0223] 1.3. Ascites Fluid.
[0224] Four liters of ascites fluid were received at UNC within 10
hours of removal from the patient. The cells were centrifuged and
pooled, yielding about 2.times.10.sup.7 cells, and plated on
plastic or other substrata (laminin, hyaluronans, types I, III or
IV collagens) in serum-free Kubota's Medium (KM) prepared in either
RPMI 1640 or in DMEM-F12 and presented as two-dimensional (2D)
monolayers or three-dimensional (3D) hydrogels. Serum-free Kubota's
Medium (KM) has been found to select for endodermal stem cells and
progenitors and is not permissive for survival of mature cells.
Culture selection for tumor cells with stem cell properties was
done in monolayer (2D) cultures and did best on plastic and in KM
in DMEM-F12. Those in 3-D hydrogels behaved similarly in KM
prepared in either DMEM-F12 or RPMI 1640, grew more slowly, and, in
parallel, caused dissolution of hydrogels by hFL-HCC's considerable
enzyme secretions that degrade extracellular matrix. This culture
selection process proved successful for establishment of the
transplantable tumor line as clarified in further details
below.
[0225] 1.4. Culture Conditions.
[0226] All media were sterile-filtered (0.22-.mu.m filter) and kept
in the dark at 4.degree. C. before use. Hyaluronans were obtained
from Glycosan Biosciences (Salt Lake City, Utah; now part of
Biotime, Alameda, Calif.). Type III and IV collagens and laminin
were obtained from Becton Dickinson (Research Triangle Park,
N.C.).
[0227] 1.5. Kubota's Medium.
[0228] (KM) is a serum-free medium designed originally for rodent
hepatoblasts and then found effective also for human hepatoblasts,
hepatic stem cells (hHpSCs), biliary tree stem cells (hBTSCs), and
for pancreatic progenitors. It contains any basal medium (here
being RPMI 1640) with no copper, low calcium (0.3 mM), 10.sup.-9 M
selenium, 0.1% BSA, 4.5 mM nicotinamide, 0.1 nM zinc sulfate
heptahydrate, 10.sup.-8 M hydrocortisone, 5 .mu.g/ml
transferrin/Fe, 5 .mu.g/ml insulin, 10 .mu.g/ml high density
lipoprotein, and a mixture of purified free fatty acids that are
added after binding to purified human serum albumin. Kubota's
Medium is available commercially from PhoenixSongs Biologicals
(Branford, Conn.).
[0229] 1.6. Hormonally Defined Media (HDM).
[0230] Supplements can be added to KM to generate a serum-free,
hormonally defined medium (HDM) that will facilitate
differentiation of the normal hepatic or biliary tree stem cells to
specific adult fates. These include supplementation with calcium to
achieve at or above 0.6 mM concentration, 1 nM tri-iodothyronine
(T3), 10.sup.-12 M copper, 10 nM of hydrocortisone and 20 ng/ml of
basic fibroblast growth factor (bFGF). The medium conditions over
and above these needed to selectively yield hepatocytes (HDM-H)
versus cholangiocytes (HDM-C) versus pancreatic islets (HDM-P)
are:
(1) HDM-H: supplementation further with 7 .mu.g/L glucagon, 2
.mu.g/L galactose, 10 ng/ml epidermal growth factor (EGF) and 20
ng/ml hepatocyte growth factor (HGF). (2) HDM-C: supplementation
further with 20 ng/ml vascular endothelial cell growth factor
(VEGF) 165 and 10 ng/ml HGF. (3) HDM-P: prepared without
glucocorticoids and further supplemented with 1% B27, 0.1 mM
ascorbic acid, 0.25 .mu.M cyclopamine, 1 .mu.M retinoic acid, 20
ng/ml of FGF-7 for 4 days, then changed with one supplemented with
50 ng/ml exendin-4 and 20 ng/ml of HGF for 6 more days of
induction.
[0231] 1.7. Tissue Sourcing of Normal Tissue.
[0232] Adult, normal, human biliary tissues were dissected from
intact livers and pancreases obtained but not used for
transplantation into a patient. They were obtained through organ
donation programs via United Network for Organ Sharing (UNOS).
Those used for these studies were considered normal with no
evidence of disease processes. Informed consent was obtained from
next of kin for use of the tissues for research purposes, protocols
received Institutional Review Board approval, and processing was
compliant with Good Manufacturing Practice. The research protocol
was reviewed and approved by the Institutional Review Board for
Human Research Studies at the University of North Carolina at
Chapel Hill, N.C., USA.
[0233] 1.8. Animals.
[0234] In preliminary studies, immunocompromised mice of several
species (e.g. athymic nudes, SCID/NODs, NSGs) were obtained from
suppliers or were obtained from breeding colonies on the UNC campus
and used as hosts for the human FL-HCC cells. The findings were
most successful with NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wj1/SzJ.
These are known commonly as NOD scid gamma or NSGs. These mice are
devoid of T or B cells, lack functional NK cells and are deficient
in cytokine signaling. The strain combines the features of the
NOD/ShiLtJ (Stock Number 001976) background, the severe combined
immune deficiency mutation (scid, which is caused by a spontaneous
mutation in the Prkdc gene), and the IL2 receptor gamma chain
deficiency. The animals were maintained in the quarters maintained
by the Division of Laboratory Animals (DLAM). Procedures were
performed according to protocols approved by the UNC School of
Medicine at Chapel Hill IACUC. All species were inbred and housed
in UNC's DLAM sterile facility in micro-isolated autoclaved cages
with free access to autoclaved water and radiation sterilized
food.
[0235] 1.9. Transplantation of the Human FL-HCC Cells.
[0236] Efforts to establish a tumor line by transplanting the
original ascites tumor cells immediately after removal from the
patient were not successful. Rather, success was achieved with
cells that survived and so were culture selected in serum-free
Kubota's Medium (KM) and on culture plastic or on a substratum of
hyaluronans. The culture-selected tumor cells were transplanted and
yielded tumors after an initial passage of more than 6 months in
the NSG mice. Thereafter, xenografted established tumors passaged
by mincing tumor in KM supplemented with 1% hyaluronans
(uncross-linked) and further supplemented with 50 ng/ml each of HGF
and VEGF. The tumor mince (approximately 20 mgs) in the KM+1%
hyaluronans+growth factors was injected subcutaneously into mice.
The tumor mince form tumors in the absence of hyaluronans and
growth factors but do so more slowly and will not yield tumors at
all in some mice. Consistent, reproducible tumor formation occurred
with the use of the supplements. If transplanted intraperitoneally,
the tumor cells spread onto the serosal surfaces throughout the
peritoneum and also onto the liver and pancreas.
[0237] Tissue processing of the human FL-HCC tumors to generate
cell suspensions for ex vivo studies was conducted in RPMI 1640
supplemented with 0.1% bovine serum albumin, 1 nM selenium and
antibiotics. Enzymatic processing buffer contained 600 U/ml type IV
collagenase and 0.3 mg/ml deoxyribonuclease at 32.degree. C. with
frequent agitation for 15-20 min. Enriched suspensions were pressed
through a 75 gauge mesh and spun at 1200 RPM for 5 min before
re-suspension. Estimated cell viability by trypan blue exclusion
was routinely higher than 95%.
[0238] 1.10. Magnetic Immunoselection of Cells.
[0239] Human tumor cells were isolated from xenografted tumors.
Negative sorting was done using EasySep magnetic bead
immunoselection using the magnetic cups and beads (StemCell
Technologies, Vancouver, Canada) and according to the manufacturer
instructions. Briefly the dissociated cells were washed in
phosphate-buffered saline (PBS) with 3% fetal bovine serum (FBS)
(staining medium) were treated with FcR blocking antibody and
incubated with a cocktail of biotin-conjugated anti-mouse antibody
against lineage cells (Miltenyi Biotec Inc, Auburn, Calif.), and
with biotin-conjugated anti-mouse-MHC class I (H-2K.sup.d) (clone;
SF1-1.1) and -CD31 (clone; MEC13.3) antibodies (BD Biosciences, San
Jose, Calif.) at room temperature for 15 min.
[0240] Cells were incubated with biotin selection cocktail for 15
min, and then incubated with magnetic nanoparticles at room
temperature for 10 min. The cups were magnetized, and cells or
clumps of cells bound to the walls of the cup; those not bound (the
human cells) were collected into a separate container. The cells
bound to the cups were the mouse cells that were discarded. The
human cells were suspended in KM and then plated.
[0241] The cells were plated onto culture plastic or on or in
hyaluronan hydrogels (some of them supplemented with type III or IV
collagen or laminin) and provided with serum-free KM. For the
initial plating, the medium was supplemented with 2-5% FBS
(HyClone, Waltham, Mass.). After a few hours, the medium was
changed to the serum-free version, and this was used for all
subsequent medium changes.
[0242] For the cultures of xenografted tumors, the human cells were
sorted by immunoselection away from the murine (host) mesenchymal
cells and then were plated in serum-free KM from the outset.
[0243] 1.11. Immunocytochemistry and Immunohistochemistry.
[0244] For immunofluorescent staining, 5 .mu.m frozen sections or
cultured cells were fixed with 4% paraformaldehyde (PFA) for 20 min
at room temperature, rinsed with PBS, blocked with 10% goat serum
in PBS for 2 hours, and rinsed. Fixed cells were incubated with
primary antibodies at 4.degree. C. for 14 hours, washed, incubated
for 1 hour with labeled isotype-specific secondary antibodies,
washed, counterstained with 4',6-diamidino-2-phenylindole (DAPI)
for visualization of cell nuclei and viewed using Leica DMIRB
inverted microscope (Leica, Houston, Tex.) or a Zeiss ApoTome
Axiovert 200M (Carl Zeiss Inc, Thornwood, N.Y.).
[0245] For immunohistochemistry (IHC), the tissues were fixed in 4%
PFA overnight and stored in 70% ethanol. They were embedded in
paraffin and cut into 5-.mu.m sections. After deparaffinization,
antigen retrieval was performed with sodium citrate buffer (pH 6.0)
or ethylenediaminetetraacetic acid (EDTA) buffer (pH 8.0) in a
steamer for 20 min. Endogenous peroxidases were blocked by
incubation for 15 min in 3% H.sub.2O.sub.2. After blocking, primary
antibodies reacted against human but not mouse cells and were
applied at 4.degree. C. overnight. M.O.M immunodetection kit
(Vector Laboratories, Burlingame, Calif.) was used for detecting
primary mouse anti-human antibodies on mouse xenotransplant FL-HCC
tumor to avoid the inability of the anti-mouse secondary antibody
to endogenous mouse immunoglobulins in the tissue. Sections were
incubated for 30 min at room temperature with ImmPRESS
peroxidase-micropolymer staining kits and 3,3'-diaminobenzidine
substrate (Vector Laboratories). Sections were lightly
counterstained with hematoxylin. Antibodies used are listed in
Table 2. Control images are given in FIG. 9.
TABLE-US-00002 TABLE 2 Antibodies for Immunohistochemistry Man-
Reac- Re- Antibody Species Isotype ufacture tivity trieval ABCG2
Mouse IgG2a Millipore H CB AFP Mouse IgG2a SIGMA H, D, P CB but not
M BMI1 Rabbit IgG Abcam H CB CD44 Mouse IgG2a Abcam H CB CD68 Mouse
IgG3 DAKO H CB CK7 Mouse IgG1 DAKO H CB CK18 Mouse IgG1 DAKO H CB
CK19 Mouse IgG2a Abcam H CB E-cadherin Mouse IgG2b Abcam H CB EpCAM
Mouse IgG1 Cell H CB Signaling HepPar-1 Mouse IgG1 DAKO H CB KLF4
Rabbit IgG NOVUS H CB LGR5 Rabbit IgG NOVUS H CB MDR-1 Mouse IgG2a
Abcam H EDTA MUC6 Mouse IgG1 Santa Cruz H CB NANOG Mouse IgG1 Cell
H EDTA Signaling NCAM Mouse IgG1 DAKO H CB NGN3 Rabbit IgG NOVUS H
EDTA OCT4 Rabbit IgG Cell H EDTA Signaling PDX1 Rabbit IgG NOVUS H
CB SALL4 Mouse IgG1 Abcam H EDTA SHH Rabbit IgG Millipore H CB SOX2
Rabbit IgG Cell H CB Signaling SOX9 Rabbit IgG1 SIGMA H CB SOX17
Mouse IgG1 Abcam H CB SYNDECAN- Goat IgG R&D H CB 1 (HS-PG-1)
VCAM-1 Mouse IgG1 Santa Cruz H CB H = human, D = dog, M = mouse, P
= pig, R = rat.
[0246] 1.13. Flow Cytometric Analyses.
[0247] The dissociated cells were incubated at 4.degree. C. for 30
min with fluorescein isothiocyanate (FITC)- or biotin-conjugated
anti-mouse-MHC class I (against H-2K.sup.d) (clone; 34-1-2S)
(eBioscience, San Diego, Calif.) and anti-human antibodies (see
Table 3) for cell surface markers. For biotinylated antibody,
allophycocyanin (APC)-streptavidin (BD Biosciences, San Jose,
Calif.) was used for visualization. The cells were washed with
staining medium before analysis. For the intracellular staining of
LGR5, the cells were incubated with antibodies against the cell
surface antigens as usual, and then, were fixed with 4% PFA/PBS at
4.degree. C. for 20 min. After washing with staining medium, the
cells were resuspended in permeabilization buffer (PBS with 1% FCS,
0.1% sodium azide, and 0.1% saponin) with PE-conjugated anti-LGR5
antibody at 4.degree. C. for 30 min. Antibodies used are listed in
Table 3. The labeled cells were washed with permeabilization buffer
and then analyzed by FACSCalibur.TM.. (BD Biosciences, San Jose,
Calif.).
TABLE-US-00003 TABLE 3 Antibodies for Flow Cytometric Analyses Name
Clone Host/isotype Manufacture APC-CD13 WM15 Mouse IgG1 eBioscience
PE-CD24 ML5 Mouse IgG2a BD Biosciences FITC-CD29 (Integrin .beta.1)
TS2/16 Mouse IgG1 eBioscience APC-CD44 BJ18 Mouse IgG1 BioLegend
FITC-CD49f (Integrin .alpha.6) GoH3 Rat IgG2a BD Biosciences
FITC-CD54 (ICAM) HA54 Mouse IgG1 BioLegend APC-CD56 (NCAM) MEM-188
Mouse IgG2a Abcam FITC-CD90 (THY-1) 5E10 Mouse IgG1 eBioscience
APC-CD117 (c-KIT) YB5.B8 Mouse IgG1 BD Biosciences APC-CD133/1
AC133 Mouse IgG1 Miltenyi Biotec APC-CD184 (CXCR4) 12G5 Mouse IgG2a
eBioscience APC-CD324 (E-cadherin) 67A4 Mouse IgG1 Miltenyi Biotec
FITC-CD326 (EpCAM) VU-1D9 Mouse IgG1 Stem Cell Technologies
PE-TROP-2 77220 Mouse IgG2a R&D PE-LGR5 2A2 Mouse IgG1 Origene
APC, allophycocyanin; PE, R-phycoerythrin; FITC, fluorescein
isothiocyanate.
[0248] 1.14. Differentiation Assays.
[0249] 1.times.10.sup.5 hFL-HCC cells, depleted of host mesenchymal
cells by magnetic sorting, were seeded into each well of a 12-well
plate coated with 5 .mu.g/cm.sup.2 hyaluronan and cultured with
KM+2% FBS for overnight. After 16-20 hours, the cells were
incubated for 7 days with either serum-free KM (as the
undifferentiated control) or with serum-free HDM-H, HDM-C or HDM-P.
After a total of 7 days culture, cells were harvested for analyses
of gene expression.
[0250] 1.15. Invasion Assay.
[0251] Invasion activity of the cells was analyzed using CultreCoat
96 Well BME-Coated Cell Invasion Optimization Assay Kit (TREVIGEN,
Gaithersburg, Md.) according to manufacturer's protocol. The
hFL-HCC, depleted of host mesenchymal cells by magnetic sorting, or
the human hepatocellular carcinoma cell line, Huh7 cells, were
cultured with serum-free medium for starvation. After 20 hours of
serum starvation, cells were collected. Then 2.5.times.10.sup.4
cells were resuspended in 25 .mu.l of serum-free Kubota's Medium
(hFL-HCC) or serum-free DMEM (HuH7), and seeded into each well of a
96-well culture plates (top chambers). A total of 150 .mu.l of each
culture medium+10% FBS were added to the bottom chambers, and cells
were cultured for 24 hours. After washing, cells were dissociated
and fluorescently labeled with Cell Dissociation Solution/Calcein
AM. After incubation at 37.degree. C. for 1 hour, top chambers were
removed and the absorbance at 485 nm excitation, 520 nm emission
was measured.
[0252] 1.16. Quantitative Reverse Transcription and Polymerase
Chain Reactions (qRT-PCR).
[0253] Total RNA was extracted from the cells using RNeasy Micro
Kit or RNeasy Mini Kit (Qiagen GmbH, Valencia, Calif.).
First-strand cDNA synthesized using the Primescript 1st strand cDNA
synthesis kit (Takara, Otsu, Japan) was used as a template for PCR
amplification. Quantitative analyses of mRNA levels were performed
using Power SYBR Green PCR Master Mix with Applied Biosystems 7500
Real-Time PCR System (Applied Biosystems, Foster City, Calif.). The
primers were annealed at 50.degree. C. for 2 min and 95.degree. C.
for 10 min, followed by 40 cycles of 95.degree. C. (15 s) and
60.degree. C. (1 min). Expression of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) was used as a control standard. Primer
sequences are listed in Table 4.
TABLE-US-00004 TABLE 4 Primers for qRT-PCR Product GenBank Name F/R
Primer Sequence length Accession CD44 F TGCCGCTTTGCAGGTGTAT 66
NM_000610.3 R GGCCTCCGTCCGAGAGA CDH1 F TCACAGTCACTGACACCAACGA 67
NM_004360 R GGCACCTGACCCTTGTACGT CFTR F AAAAGGCCAGCGTTGTCTCC 170
NM_000492.3 R TGAAGCCAGCTCTCTATCCCA KRT7 F TGCTGCCTACATGAGCAAGGT 99
NM_005556.3 R TCTGTCAACTCCGTCTCATTGAG KRT18 F GCCCGCTACGCCCTACA 57
NM_000224.2 R TGACTCAAGGTGCAGCAGGAT KRT19 F CCGCGACTACAGCCACTACT 97
NM_002276.4 R GTCGATCTGCAGGACAATCC LGR5 F GAGGATCTGGTGAGCCTGAGAA
151 NM_001277227.1 R CATAAGTGATGCTGGAGCTGGTAA NANOG F
AAATCTAAGAGGTGGCAGAAAAACA 60 NM_024865.2 R CTTCTGCGTCACACCATTGC
PDX1 F CCCATGGATGAAGTCTACC 262 NM_000209.3 R GTCCTCCTCCTTTTTCCAC
POU5F1 F GAGAGGCAACCTGGAGAATTTG 58 NM_001173531.1 R
GATCTGCTGCAGTGTGGGTTT PROM1 F TCCACAGAAATTTACCTACATTGG 77
NM_001145851.1 R CAGCAGAGAGCAGATGACCA SOX2 F
AAATGGGAGGGGTGCAAAAGAGGAG 112 NM_003106.3 R
CAGCTGTCATTTGCTGTGGGTGATG TACSTD1 F GACTTTTGCCGCAGCTCAGGAAG 135
NM_002354.1 R GCCAGCTTTGAGCAAATGACAGTATTTTG GAPDH F
AAGGTGAAGGTCGGAGTCAA 108 NM_002046.3 R AATGAAGGGGTCATTGATGG
[0254] 1.17. Cell Proliferation and Chemo-Resistance Assays.
[0255] For cell proliferation assays, 3.times.10.sup.4 hFL-HCC
cells of TU-2010 were depleted of host mesenchymal cells by
magnetic sorting of xenotransplantable tumor cell suspension and
then were seeded into each well of a 96-well plate and cultured
overnight with Kubota's Medium+5% FBS. After 16-20 hours, the
specific hedgehog inhibitor Vismodegib (GDC-0449) (Selleckchem Bio,
Houston, Tex.) or the histone deacetylase (HDAC) inhibitors,
suberic bis-hydroxamic acid (SBHA) or suberoylanilide hydroxamic
acid (SAHA) (SIGMA, St. Louis, Mo.) were added for 3 days. Cell
proliferation was evaluated using the Cell Proliferation Reagent
WST-1 (Roche Applied Science, Mannheim, Germany). After incubation
at 37.degree. C. for 2 hours, the absorbance at 450 nm was
measured.
[0256] 1.18. Spheroid Formation Assays.
[0257] For spheroid formation assays, 1.times.10.sup.4 hFL-HCC
cells of TU-2010, depleted of host mesenchymal cells by magnetic
sorting, were seeded into each well of a 6-well plate coated with
Ultra-Low Attachment surface (Corning, Lowell, Mass.) and cultured
with serum-free Kubota's Medium in the presence (or absence) of the
specific hedgehog inhibitor Vismodegib (GDC-0449) or the HDAC
inhibitors, SBHA or SAHA. For secondary spheroid formation assays,
the 1st spheroids were collected, subsequently dissociated with
NeuroCult Chemical Dissociation Kit (STEMCELL Technologies). Cell
suspension was centrifuged at 700 rpm 10 min and resuspended with
KM. After 2 weeks, the number of spheroids (100 .mu.m>) were
counted.
[0258] 1.19. Transmission Electron Microscopy.
[0259] The hFL-HCC spheroids of Tu-210 were fixed with 3%
glutaraldehyde in 0.15M sodium phosphate buffer, pH 7.4, for 1 hour
at room temperature and stored at 4.degree. C. until processed.
Following three rinses with 0.15 M sodium phosphate buffer, pH 7.4,
the samples were post-fixed for 1 hour with 1% osmium
tetroxide/1.25% potassium ferrocyanide/0.15M sodium phosphate
buffer, pH 7.4, followed by rinses in deionized water. The
spheroids were dehydrated using increasing concentrations of
ethanol (30%, 50%, 75%, 100%, 100%, 10 min each) and 2 changes of
propylene oxide (15 min each). Following infiltration overnight in
a 1:1 mixture of propylene oxide/Polybed 812 epoxy resin
(Polysciences, Inc.) and 24 hours in 100% resin for 24 hours, the
spheroids were embedded in fresh Polybed 812 epoxy resin. The
spheroids were sectioned transversely at 70 nm using a diamond
knife and a Leica Ultracut UCT microtome (Leica Microsystems,
Wetzlar, Germany). Ultrathin sections were mounted on 200 mesh
copper grids and stained with 4% aqueous uranyl acetate and
Reynolds' lead citrate. The grids were observed at 80 kV using a
LEO EM910 transmission electron microscope (Carl Zeiss SMT, LLC).
Digital images were taken using a Gatan Orius SC 1000 CCD Camera
with DigitalMicrograph 3.11.0 software (Gatan, Inc., Pleasantan,
Calif.).
[0260] 1.20. RNA-Sequencing and Gene Expression Analysis.
[0261] RNA was purified using Qiagen RNeasy Kit from human adult
hepatocytes, hepatoblasts, hepatic stem cells, and biliary tree
stem cells, each from three different donors, as well as four
FL-HCC tumor samples of passaged TU-2010. In addition, RNA was
purified from three cancer stem cell populations of the liver from
tumors that are presumptive transformants of: (1) HpSCs, giving
rise to hepatocellular carcinoma (HCC); (2) late stage
(EpCAM.sup.+) BTSCs, giving rise to cholangiocarcinoma (CCA); and
(3) primitive BTSCs (EpCAM.sup.-, CD44.sup.+), giving rise to
fibrolamellar carcinoma (FLC). RNA integrity (RIN) analysis was
performed using an Agilent 2000 Bioanalyzer. cDNA libraries were
generated using the Illumina TruSeq Stranded mRNA preparation kit
and sequenced on the Illumina HiSeq 2500 platform. Two samples were
sequenced per lane, occupying a total of 8 lanes for all of the
samples (one flow cell). Quality control analysis was completed
using FastQC, mapping of sequence reads to the human genome (hg19)
was performed with MapSplice2 using default parameters, transcript
quantification was carried out by RSEM analysis, and DESeq was used
to normalize gene expression and identify differentially expressed
genes. MapSplice2 was also used to detect candidate fusion
transcripts. Fusion calls were based on the depth and complexity of
reads spanning candidate fusion junctions. Gene expression profiles
were compared using Pearson's correlation analysis and hierarchical
clustering was performed in R. Pathway enrichment analysis was
performed with the Ingenuity Pathway Analysis (IPA) software.
[0262] Genes were determined to be differentially expressed between
cancer types if they had >50 average normalized counts in at
least one tumor type, exhibited >2-fold change, and had an
adjusted p-value <0.05. Within the 163 genes found to be
significantly differentially expressed in FLC compared to HCC or
CCA, 16 genes were further identified for which the expression
level in all FLC samples was greater than the expression level in
95% of HCC and 95% of CCA samples. The expression of these 16 genes
was compared between a FLC patient-derived xenograft (PDX) model
and normal biliary tree stem cells that were previously sequenced
as described above. For RNA-seq analysis across 24 different tumor
types, pre-processed RNA-seq data were downloaded from TCGA and
plotted in R.
[0263] 1.21. Normal Human Biliary Tree Stem Cells (hBTSCs).
[0264] The biliary tree contains stem cell niches, peribiliary
glands (PBGs), mucinous glands scattered as intramural PBGs within
the walls of the bile ducts and also found as extramural PBGs that
are tethered to the bile ducts. The phenotypes of the cells within
the PBGs can be relatively homogeneous in some sites (e.g.
hepato-pancreatic common duct and intrahepatic, large bile ducts)
and quite heterogeneous in other sites (e.g. cystic duct, common
duct, hepatic duct). The pattern of phenotypic traits of the PBG
cells was found to implicate maturational lineages in a radial axis
from the fibromuscular layer within the duct walls to the lumen of
the bile ducts and in a proximal (duodenum)-to-distal axis from the
duodenum to either liver or pancreas.
[0265] The PBGs deepest within the bile ducts and near the
fibromuscular layer contain the most primitive stem cells, those
that co-express transcription factors for both liver and pancreas
(e.g. SOX 17, PDX1) and that also co-express multiple pluripotency
genes (e.g. OCT4, SOX2, KLF4, NANOG). These cells do not express
epithelial cell adhesion molecule (EpCAM) or even LGR5. These are
referred to as stage 1 biliary tree stem cells (hBTSCs) They
transition to PBGs with cells expressing LGR5 (stage 2 hBTSCs) and
then to ones positive for both LGR5 and EpCAM (stage 3 hBTSCs)
found at levels that are intermediate within the bile ducts. With
transition to the luminal surface of the ducts, there is
acquisition of cells with mature phenotypic markers. If the ducts
are near or within the liver, the mature markers are those for
liver; if they are within the hepato-pancreatic common duct, the
mature markers are pancreatic.
[0266] 1.22. Cultures of Normal hBTSCs.
[0267] The stage 1 hBTSCs have not yet been successfully cultured
under the conditions tested. These have yet to be observed in
culture under the conditions used. Two stages of hBTSCs that have
been observed under the conditions used are stage 2 and 3 hBTSCs.
See FIGS. 18 to 20. The stage 3-hBTSC colonies strongly express
both LGR5 and EpCAM in every cell and form colonies of relatively
uniform, cuboidal shaped cells that are tightly bound to each
other. They are distinct from stage 2-hBTSCs that are undulating,
swirling cells that can form extensions, are highly motile and have
variable connections with neighboring cells. These colonies
strongly express LGR5 throughout all of the cells, but are devoid
of EpCAM expression on the interior of the colonies and yet express
it at their edges in cells that are slightly larger and more
differentiated. Treatment of the stage 2 hBTSC colonies with any of
several different growth factors (e.g. EGF, HGF) or with laminin
results in rapid transition to stage 3 hBTSCs with activation of
expression of EpCAM throughout the colony. The net results indicate
that the stage 2-hBTSCs [LGR5+, EpCAM-negative cells], are
precursors of the stage 3-hBTSCs (LGR5+, EpCAM+].
[0268] A summary of phenotypic traits of biliary tree stem cells
versus hepatic stem cells is given in Table 5. They indicate that
the lineages of biliary tree stem cells are precursors of hepatic
and pancreatic stem cells and are assumed to contribute to
organogenesis of liver versus pancreas. A chart of the lineage
stages identified is given in FIG. 20. The cells in the hFL-HCC
tumor line, TU-2010, are most closely similar to the stage
2-hBTSCs.
TABLE-US-00005 TAABLE 5 Phenotypic Profile of Normal Stem Cells in
Liver and Biliary Tree and of Pancreatic Committed Progenitors
Versus Human Fibrolamellar Hepatocellular Carcinoma Cells (hFL-HCC)
of the TU-2010 tumor line Liver Pancreas Committed hHpSCs
Progenitors (in Canals hBTSC Subpopulations (in Pancreatic hFL-HCC
Cells Property of Hering) (in peribiliary glands) Duct Glands) of
TU-2010 Endodermal SOX 9, SOX 9, SOX 9, SOX 9, PDX1, LGR5 SOX 9,
SOX17, markers LGR5, SOX17 SOX17, PDX1 PDX1, LGR5, HNF4A, LGR5 PDX1
LGR5 FOXL1, HNF4A FOXL1 FOXL1 FOXL1 FOXL1 HNF4A HNF4A HNF4A Markers
of CK 8 and 18, CK 7 and 19, E-cadherin Epithelia Cell NCAM, NCAM,
NCAM NCAM, EpCAM+ NCAM, VCAM, Adhesion EpCAM + EpCAM EpCAM EpCAM
EpCAM .+-. Molecules ITGB1 (CD29) + - + (negligible) ITGA6 (CD49f),
ITGB4, ITGA6 (CD49f), ITGB1 (CD29) ITGB4, ITGB1 (CD29) Pluri- OCT4,
KLF4/KLF5, NANOG, None KLF4/KLF5, potency SALL4, OCT4, SALL4,
TROP-2, OCT4, Genes NANOG BMI1 NANOG, SALL4,BMI1 Other Stem CXCR4,
CXCR4, CD133; and None CD133, Sonic Cell CD133, Hedgehog proteins
(Indian Hedghog, ALDH Markers Hedgehog and Sonic), ALDH proteins
(Indian, Sonic), ALDH Protein Laminin, Laminin, Oncostatin M Fetal
islets: Laminin, Matrix type III receptor collagens IV, V,
Oncostatin M components collagen, VI, Laminin, receptor, CD68
Receptors Oncostatin Nidogen, elastin, M receptor fetal acinar
cells: fibrillar collagens, fibronectin GAGs/PGs Minimally
Hyaluronans, CD44. Hyaluronans, Hyaluronans, sulfated CD44, fetal
islets CD44, CS-PGs, have syndecans Syndecan-1 (HS- Hyaluronans
(HS-PG-1 and 3), PG-1) glypicans, fetal acinar cells have CS-PGs
Liver- Albumin +/-, KRT7, HNF4A None AFP-, HNF4A specific AFP-,
HepPar-1+; traits HNF4A, KRT7 HepPar1+, KRT7, DLK1 Pancreatic- PDX1
PDX1 PDX1, PDX1, NGN3, PDX1, KRT20, specific ISL1, MAFA, MUC6, NGN3
traits NGN3 Nkx6, PTF1a, GLUT2 Multidrug MDR-1, ABCG2 None MDR-1
resistance ABCG2 genes
[0269] Experimental Results.
[0270] Endodermal Stem/Progenitor Markers were Expressed in
hFL-HCCs.
[0271] Sections from original blocks of 9 hFL-HCC tumors from
Memorial Sloan Kettering Cancer Center (MSKCC) were subjected to
IHC assays (FIGS. 1 and 7). All sections assayed were positive for
HepPar-1 and SHH. Positive expression was also observed in 7/9 for
SOX9 and PDX1 and 4/9 for BMI1.
[0272] Tissue microarrays (FIG. 8) from Memorial Sloan Kettering
Cancer Center (MSKCC) provided additional evidence from primary
tumors. Whereas stem/progenitor traits were not observed in any of
the 19 normal livers, all hFL-HCCs were positive for multiple
stemness markers: SOX9 (12/18), SOX17 (8/18), OCT4 (7/18), SALL4
(3/6), SHH (18/18), and PDX1 (13/18).
[0273] A Transplantable hFL-HCC Tumor Line, TU-2010, was
Established Successfully by Use of Culture-Selected Endodermal
Stem/Progenitors.
[0274] A young, male patient was diagnosed with FL-HCC and was
subjected to liver surgery and chemotherapies, all of which proved
unsuccessful (Table 1). Within 2 years, the tumor had metastasized
and generated ascites tumor cells. Approximately 5 liters of
ascites fluid were removed from the patient. Cells from one liter
were immediately transplanted into immune-compromised mice, but no
tumors formed. Cells from the remaining 4 liters were subjected to
culture selection in Kubota's Medium (KM) for endodermal
stem/progenitors, and 2.times.10.sup.7 cells were transplanted into
nod scid gamma (NSG) mice. Tumor formation occurred after >6
months.
[0275] Passaging of hFL-HCC of TU-2010 was Stabilized by
Supplements and Occurred with Different Kinetics in Subcutaneous
Versus Intraperitoneal Sites.
[0276] Tumors were passaged every 3-5 months and stabilized at
about 3 months with transplantation of about 10.sup.6 cells in KM
supplemented with 1 mg/ml hyaluronans and with 50 ng/ml each of
hepatocyte growth factor (HGF) and vascular endothelial cell growth
factor (VEGF) (FIG. 2). The passageable, subcutaneous tumors were
nodular and difficult to mince. If transplanted intraperitoneally
(FIGS. 2e and 2h), ascites tumors formed, requiring passaging every
about 8 weeks and giving rise to nodules on serosal surfaces
throughout the peritoneum and on liver and pancreas.
[0277] Histology of Xenografted Tumor Cells of TU-2010 Matched that
of the Original Tumor.
[0278] The histology of the original tumor (FIG. 2a-2b) and of the
ascites tumor cells (FIG. 9a) versus those of xenografts (FIG.
3d-3g and FIG. 9b) revealed differences between the tumor centers
(FIGS. 2d1 and 2f1) and their perimeters (FIGS. 2d2 and 2f2), sites
at which tumors interfaced with host tissues. Tumor centers
demonstrated histology similar to that of the original tumor with
large polygonal cells, abundant eosinophilic cytoplasm, large,
vesiculated nuclei and large nucleoli. By contrast, the histology
at tumor perimeters comprised incomplete ductular structures with
partially stabilized lumens and with features similar to those of
intrahepatic, mixed-type cholangiocarcinomas (CCs) with ductular
areas.
[0279] The FL-HCC Tumors of TU-2010 were Comprised Primarily of
Host Cells.
[0280] Mesenchymal cells within tumors were a mix of precursors to
stellate cells (desmin.sup.+, alpha-smooth muscle actin.sup.+) and
endothelia (CD31.sup.+) and comprised, on average, 55-70% of cell
suspensions from subcutaneous tumors and >95% of those from
intraperitoneal tumors (FIG. 2g). Enrichment of hFL-HCCs to
.gtoreq.95% (FIG. 2h) was achieved by negative sorting using
magnetic bead immunoselection to eliminate murine cells, ones
positive for H-2K.sup.d (FIG. 2g). Tumors contained, on average,
about 8.times.10.sup.6 hFL-HCC cells/gm of tumor.
[0281] Expression of Stem/Progenitor Markers in TU-2010 Cells was
Confirmed by Flow Cytometry.
[0282] Immunoselected hFL-HCCs, depleted of murine cells, were
characterized by multiparametric flow cytometry (FIG. 3a-3b). The
majority of cells were positive for LGR5 (68.9%) and CD44 (61.4%);
a significant percentage were positive for CD29 (43.7%), CD24
(32.9%), CD49f (25.4%), CD13 (12.5%), E-cadherin (12.0%), c-KIT
(12.0%) and oncostatin M receptor-OSMR (10.7%). A low but
consistent percentage of cells were positive for NCAM (3.7%), EpCAM
(4.3%), CXCR4 (4.8%), CD133 (2.3%), TROP-2 (1.4%) and ICAM (0.5%).
A small percentage (1.1%) of LGR5+ cells were positive for
EpCAM.
[0283] The hFL-HCCs of TU-2010 were Rich in Cancer Stem Cells
(CSCs) as Indicated Functionally by Limiting Dilution
Tumorigenicity Assays.
[0284] Cell suspensions were depleted of murine cells and
transplanted subcutaneously into NSG mice in tumorigenicity assays
from 100 to 10.sup.6 cells and monitored for up to 8 months for
tumors. Transplantation of 10.sup.5 or more cells resulted in 100%
of the mice developing tumors within about 3 months;
10.sup.3-10.sup.4 cells within 5-6 months; and 100 cells in all
mice but requiring up to 9 months (FIG. 2i).
[0285] Xenografted hFL-HCCs of TU-2010 Expressed Endodermal
Stem/Progenitor Markers that Collectively Suggest Derivation from
Biliary Tree Stem Cells (hBTSCs).
[0286] Sections of xenografted hFL-HCCs were subjected to IHC
assays (FIG. 3d-3g and FIG. 9b) and the findings compared to those
from original tumor cells (FIG. 9a). The hFL-HCCs were positive for
CD68, a previously observed feature of hFL-HCCs; stem/progenitor
markers (SOX17,SOX9,LGR5,SHH,NCAM,BMI1); pluripotency traits
(NANOG, OCT4, KLF4, SOX2, SALL4); some hepatic markers
(HepPar-1,CK7,CK19,CK18); and pancreatic markers (PDX1). They were
essentially negative for albumin, alpha-fetoprotein (AFP), MUC6,
and weakly positive for EpCAM (FIG. 3f). The markers were
suggestive of highly aggressive tumors.
[0287] Other markers (FIG. 9b) in TU-2010 cells included some
multidrug resistance genes and matrix components that facilitate
cell survival and growth: E-cadherin; syndecan-1 (HS-PG1);
hyaluronan receptors (CD44); and vascular cell adhesion molecule-1
(VCAM-1). The cells did not express hemopoietic (CD34, CD45),
stellate (CD146) or endothelial cell antigens (CD31). Negative
controls are shown in FIG. 9b. A summary of in situ analyses of
hFL-HCC cells as well as normal human hepatic stem cells (hHpSCs),
hepatoblasts (hHBs) and hBTSCs is provided in Table 5 and in FIGS.
18-20. The hFL-HCC tumor most closely resembled stage-2-hBTSCs
(FIG. 20).
[0288] The hFL-HCC Cells of TU-2010 in Culture Behaved Similarly to
Normal hBTSCs.
[0289] That hFL-HCC cells derive from stage-2-hBTSCs was supported
further by their behavior in monolayer (FIGS. 4 and 10) and in
spheroid cultures (FIGS. 5, 11 and 12). In monolayer cultures, the
original hFL-HCCs attached and formed star-like cells (FIGS. 4a and
10), but transitioned rapidly into cells loosely attached and
connected to floating cell chains (FIG. 4b), with cells bound to
each other via E-cadherin linkages.
[0290] If plated overnight with 2-5% fetal bovine serum (FBS) and
then switched to serum-free KM (FIG. 4c-4d) or if depleted of
murine cells and plated in KM (FIG. 4e), hFL-HCC colonies remained
attached, spread and formed colonies strongly expressing
pluripotency genes (e.g., NANOG) and stem/progenitor markers (e.g.,
CD44, LGR5). In vitro invasion assays (FIG. 4f) indicated the
invasive properties of hFL-HCCs were greater than Huh7, a human
liver cancer cell line, correlating with the invasive potential of
hFL-HCCs in vivo, especially with intraperitoneal transplants.
[0291] Colony morphologies of hFL-HCCs of TU-2010 were similar to
those of stage-2-hBTSCs (FIGS. 18 and 19)--motile cells formed
partially ductular structures and were negative for EpCAM in colony
centers but transitioned to weak EpCAM expression at colony
perimeters.
[0292] Assays for drug effects on monolayer cultures (FIG. 4g) of
TU-2010 cells indicated that the hedgehog signaling pathway
inhibitor, GDC-0449, at 4 .mu.M and especially at 20 .mu.M, and two
histone deacetylase (HDAC) inhibitors, SBHA (Suberic bis-hydroxamic
acid) at 10 .mu.M and 50 .mu.M and SAHA (suberoylanilide hydroxamic
acid) at 2 .mu.M and 10 .mu.M, strongly inhibited hFL-HCC cell
growth.
[0293] TU-2010 Spheroids, Indicative of Self-Replicative Ability
and, Therefore, of CSCs, Formed in KM.
[0294] Spheroid formation required that serum-free KM be used
throughout, including for plating of cells; spheroids proved able
to be passaged for months (FIG. 5a). Transmission electron
microscopy (TEM) of spheroids in KM (FIGS. 5b, 11 and 12) revealed
tumor cells with microvilli at their apical poles, indicating
ability to polarize. Cells were rich in rough endoplasmic reticulum
(RER) and Golgi (G), with numerous secretory vesicles containing
electron-dense granules typically associated with neuroendocrine
traits (e.g. chromogranin) such as occurs in pancreatic tumors.
Nuclei contained dispersed chromatin and large nucleoli,
implicating high production of secretory proteins. Cells were rich
in pleomorphic, irregularly-shaped, non-lucent mitochondria with
irregular disorganized cristae. Cells in spheroids proved even more
sensitive to inhibition by drugs (SAHA, SBHA, GDC-0449) than in
monolayers (FIG. 5d).
[0295] Differentiation Media, Used to Lineage Restrict Normal
hBTSCs to Adult Fates, Caused hFL-HCCs of TU-2010 to Lose Stemness
Traits.
[0296] Serum-free, hormonally defined media (HDM), established
previously for lineage restriction of hBTSCs to hepatocytes
(HDM-H), cholangiocytes (HDM-C) or pancreatic islets (HDM-P), were
used to differentiate hFL-HCCs. Cells were monitored for
morphological (FIG. 5e) and IHC changes (FIG. 5f) and were assayed
by qRT-PCR (FIG. 5g) for stemness (e.g., NANOG, POU5F1, SOX2) and
mature markers (e.g., CFTR). Peak levels of stemness traits
occurred in KM, whereas those markers were significantly suppressed
in all three HDM. In HDM-C, there was an increase in CFTR mRNA and
protein (FIG. 5f). CFTR is found in normal stem cells but increases
in levels during maturation to cholangiocytes. Higher levels of
differentiation were blocked by hFL-HCCs production of
matrix-degrading factors.
[0297] Transcriptomic Analyses Revealed that hFL-HCCs of TU-2010
Most Closely Resemble hBTSCs.
[0298] Paired-end high-throughput RNA sequencing was conducted in
purified populations of adult human hepatocytes (hAHEPs), hHBs,
hHpSCs, and hBTSCs, each from three different donors, as well as
four hFL-HCCs from different passaged lines of the transplantable
tumor (FIG. 6). An average of about 200 million paired-end reads
per sample were obtained, of which an average of about 87% mapped
uniquely to the human genome. Gene expression profiles were
strongly correlated among samples within each category (average
Pearson's r.sup.2=0.98 for the hFL-HCC preparations; 0.88 for hHBs
and hBTSCs; and 0.81 for hHpSCs) (FIG. 6a). The high correlation
among the hFL-HCC samples indicated remarkable stability of gene
expression throughout four years of passaging in mice.
Cross-category comparisons revealed that gene expression profiles
of hFL-HCCs were most strongly correlated with those of hBTSCs
(FIG. 6a). This finding was further supported by results of
hierarchical clustering analyses, showing that hFL-HCCs are more
closely related to hBTSCs than hHpSCs, hHBs, or hAHEPs (FIGS. 6b-6c
and 13).
[0299] Unique features of hFL-HCCs of TU-2010 (FIG. 6d) included
high expression of AGR2; DCLK1; and KRT20, all found in endodermal
cancers, particularly of intestine; KLF4/5, critical regulators of
stemness; and AHR, shown to trigger malignant transformation of
stem cells upon binding to dioxins and related agonists.
Interestingly, HDAC9, which is most highly expressed in hBTSCs, is
missing altogether in hFL-HCCs and has been linked to tumor
suppressive activity through effects on p53.
[0300] Expression data are shown for representative
stem/progenitor, hepatocytic, biliary, and pancreatic genes (FIG.
14), components of the hedgehog signaling pathway (FIG. 15), and
HDAC genes (FIG. 16). Results of pathway enrichment analysis for
genes differentially expressed in hFL-HCCs compared to hHpSCs or
hBTSCs are shown in FIG. 17.
[0301] Finally, RNA-seq data were further analyzed using MapSplice2
and detected with high confidence a recurrent fusion transcript
unique to hFL-HCCs, DNAJB1-PRKACA, for which Sashimi plots are
shown in FIG. 6e. This chimera was identified previously in hFL-HCC
tumors, and was demonstrate to be uniquely expressed in hFL-HCCs
and not in normal stem cells or adult hepatocytes.
[0302] Transcriptomic Analyses Revealed Unique Molecular Signature
of hFL-HCCs and Candidate Therapeutic Targets.
[0303] To further examine the molecular characteristics of
hFL-HCCs, the The Cancer Genome Atlas (TCGA) liver cancer database
was mined for hFL-HCCs. Based on the presence of DNAJB1-PRKACA
and/or classic histological features, 7 hFL-HCC samples were
identified, four of which were incorrectly annotated by TCGA as
HCCs. The gene expression profiles of these 7 hFL-HCCs clustered
most closely with each other and were clearly distinct from HCCs
(n=262) and CCAs (n=36). Expression levels of previously suggested
RNA markers of hFL-HCC were analyzed (e.g. AGR2, KRT7, and NTS),
and it was found that, with the exception of PCSK1 and
DNAJB1-PRKACA, none appear to uniquely mark hFL-HCC relative to
HCCs, CCAs, normal livers (n=50), or normal cholangiocytes (n=9)
and thus may not be clinically actionable (Data not shown).
[0304] Therefore, a comprehensive transcriptomic analysis was
performed and identified a suite of 165 genes that were
significantly altered in hFL-HCCs relative to HCCs and CCAs (FIG.
21). Furthermore, all of the hFL-HCC samples exhibited greater
expression than 95% of the HCC and CCA samples for the 16 genes
(FIG. 22). The elevated expression of the 16 genes, were further
validated in an independent hFL-HCC sample (set of hFL-HCC samples
(originally described by Dr. Sanford Simon, Rockefeller University,
NYC) and non-tumor liver and non-tumor cholangiocytes (FIG. 23).
Among these, the following 7 genes were the most unique to FLC:
PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 (FIG.
22). None of these except PCSK1 have been reported previously as
hFL-HCC markers. In addition 8 genes (C10orf128, OAT, PAK3, PCSK1,
PHACTR2, SLC16A14, TMEM163, and TNR6C) have a greater average of
expression in hFL-HCCs as compared to 23 other tumor types from
different tissue (FIG. 25). To determine which, if any, of these
genes are the strongest candidates for drivers of FLC tumor
progression, expression levels in the hFL-HCC tumor model was
compared with its presumptive normal counterpart, BTSCs.
Surprisingly, all 7 were elevated in the tumor model relative to
hBTSCs, and 5 genes were significantly altered (FIG. 24). In
addition, genes that are differentially expressed in hFL-HCCs
relative to hBTSCs are significantly enriched for predicted target
sites of several microRNAs (miRNAs), including miR-10b, which has
been implicated in tumorigenesis and the maintenance of CSCs.
Quantitative PCR analysis revealed that miR-10b was significantly
up-regulated (.about.17-fold, P=0.03) in hFL-HCCs compared to BTSCs
whereas a control miRNA, one not implicated in cancer stem cell
maintenance, miR-33a, was unaltered (Data not shown). Together,
these data suggest novel markers and drivers of cancer stem cells
in hFL-HCCs.
[0305] Gene Ontology Molecular Function Analysis to Identify
Network Hub Proteins for Targeted hFL-HCC Therapeutics
[0306] Identifying the protein networks involved in the molecular
signature of hFL-HCCs could not only help it providing potential
mechanisms of action but could also help to identify additional
candidate therapeutic targets. It is contemplated that by
controlling "upstream" or "downstream" targets of the genes of the
hFL-HCC signature, one may be able to better treat hFL-HCC.
[0307] Gene ontology molecular function analyses were performed and
revealed that the 165 hFL-HCC specific genes are enriched in kinase
activity, growth factor binding, and cAMP (cyclic adenosine
monophosphate) binding, suggesting potential mechanisms of action.
FIG. 26. In addition, Kinase Enrichment Analysis results of the 165
hFL-HCC gene signature showed enrichment in substrate targets of
Protein kinase A catalytic subunit alpha (PRKACA). These substrate
targets include, for example, tyrosine kinase with
immunoglobulin-like and EGF-like domains 1 (TIE1); G
protein-coupled receptor kinase 1 (GRK1); kinase insert domain
receptor (KDR); sarcoma (SRC) (gene); casein kinase 2 subunit alpha
(CSNK2A2); protein kinase c alpha (PRKCA); mitogen-activated
protein kinase 14 (MAPK14); cyclin-dependent kinase 1 (CDK1); and
epidermal growth factor receptor (EGFR). FIG. 27.
[0308] Protein-Protein Interaction (PPI) Hub Protein analysis
showed PRKACA and sarcoma (SRC) gene may function as network hubs
in hFL-HCCs. Additional proteins in these hubs include, for
example, tyrosine kinase with immunoglobulin-like and EGF-like
domains 1 (TIE1); G protein-coupled receptor kinase 1 (GRK1);
catenin beta-1 (CTNNB1); caveolin-1 (CAV1); protein kinase c alpha
(PRKCA); protein tyrosine phosphotase, non-receptor type 11
(PTPN11); Src homology 2 domain containing transforming protein 1
(SHC1); phospholipase C, gamma 1 (PLCG1); V-crk avian sarcoma virus
CT10 oncogene homolog (CRK); and phosphoinositide-3-kinase,
regulatory subunit 1 (PIK3R1). FIG. 28
DISCUSSION
[0309] Phenotypic properties of hFL-HCCs, rare liver cancers,
derive in part from their richness in CSCs (over 60% in the
transplantable tumor line) and their origins from hBTSCs,
precursors to liver and pancreas. These findings provide
clarifications for hFL-HCCs' hepatic, cholangiocytic, and endocrine
markers, as well as intestinal traits, and for why the 5-year
survival is only 45%, the overall mortality is 60%, and half the
patients have metastases at the point of diagnosis.
[0310] The hFL-HCCs have increased in frequency from an
unrecognized liver cancer in the 1970s to about 5% of all liver
cancers today. As yet, there is no explanation for this increase.
Nor is it understood why patients are primarily children to young
adults, and more rarely, middle-aged adults, with no prior history
of liver disease. The findings of remarkably high levels of AHR
receptors in hFL-HCCs and in hBTSCs, in combination with prior
report that dioxins preferentially affect stem cells, provides
clues about the possible aetiological factors of hFL-HCCs. AHR
agonists emerged as environmental factors from the plastic
industries since World War II, correlating with increased incidence
of hFL-HCCs.
[0311] The properties of hFL-HCCs implicate origins from biliary
tree stem cells, precursors to liver and pancreas and located in
peribiliary glands (PBGs) and in crypts at the base of villi within
gallbladders. Lineage tracing studies in mammals and zebra fish
indicate that the biliary tree is a major reservoir of
stem/progenitors contributing to liver organogenesis and, as
determined recently, pancreatic organogenesis.
[0312] Early stages of malignant transformation of hBTSCs within
PBGs have been described. PBGs replete with EpCAM-negative hBTSCs
are found in PBGs near the fibromuscular layers throughout the
biliary tree, including in the large intrahepatic bile ducts.
[0313] IHCs and histology provided evidence for the relationship of
hFL-HCCs to endodermal stem/progenitors. Histology demonstrated the
typical bands of stroma surrounding clumps of large tumor cells
having prominent nuclei and aberrations in mitochondria.
Co-expression was found for stem/progenitor markers (NANOG, OCT4,
SALL4, SHH) and endodermal transcription factors (SOX9, SOX17). The
hFL-HCCs expressed some hepatic traits (e.g., HNF4, HepPar-1), and
the remainder expressed pancreatic traits (e.g., PDX1, PCSK1) or
both.
[0314] More extensive analyses were made possible by establishment
of the first-ever model of hFL-HCCs, TU-2010, a transplantable
tumor line maintained in NSG mice. Prior efforts to produce hFL-HCC
tumor lines (or cell lines) failed, including those with the
ascites tumor cells able to generate a tumor line for these
studies. Success proved dependent on culture selection in Kubota's
Medium, a serum-free medium designed for endodermal
stem/progenitors and not permissive for survival of later
maturational lineage stages. The speed of passaging was enhanced
with supplements, particularly hyaluronans, HGF and VEGF.
[0315] Striking features of the transplantable tumor line, TU-2010,
were its desmoplastic traits. Although high levels of tumor stroma
occur in HCCs and in CCAs, the transplantable hFL-HCC line, TU-2010
generated subcutaneous tumors comprised of 55-70% host stroma and
intraperitoneal ones with more than 95% host stroma.
Immunoselection to remove host cells resulted in tumor cells
readily cultured as spheroids and with phenotypic traits
consistently expressed even after years of passaging in NSG mice
(FIG. 6a). Tumor stroma produced paracrine signals (matrix and
soluble signals), which are important in tumor progression and
metastasis.
[0316] Phenotypic analyses of hFL-HCCs from TU-2010, after removal
of host cells, were consistent with those from primary tumors and
indicated a relationship to hBTSCs. The tumor line, TU-2010, is
strikingly rich in cancer stem cells (CSCs; >65% CSCs based on
proportion of LGR5+ cells), a unique finding given that the average
percentage of CSCs in HCCs is about 0.5-3%, and that in CCAs is
about 10-20%. The richness of CSCs in hFL-HCCs was demonstrated
functionally by their ability to form tumors in 100% of the mice
with as few as 100 cells and by the relative ease with which they
formed spheroids or organoids in culture.
[0317] The TEM studies on the spheroids from TU-2010 revealed many
noteworthy features, but perhaps the most striking were the
electron-dense granules and the extraordinary numbers of
mitochondria with abnormal cristae, a condition typical of certain
cancers. This suggests that the mitochondria generated ATP by
oxidative phosphorylation and made the cells tolerant of hypoxia.
An oncocytic condition with such pleomorphic mitochondria is not
known to be associated with HCCs but with pancreatic cancers. The
secretory granules could contain factors responsible for the
ability of hFL-HCCs to dissolve every type of matrix tested as
substratum.
[0318] The strongest evidence of hBTSCs as the origins of hFL-HCCs
derives from RNA-seq studies, which includes analyses of genes
across successive lineage stages from hBTSCs to hHpSCs to hHBs to
adult hepatocytes. The global transcriptome-wide analyses indicate
that hFL-HCCs from TU-2010 much more closely resemble hBTSCs than
the other lineage stages analyzed. Also, the RNA-seq analyses
independently confirmed that hFL-HCCs uniquely express the
DNAJB1-PRKACA chimera, a fusion gene coupling the catalytic site of
protein kinase A (PKA) and a heat shock protein, resulting in
stable activation of PKA.
[0319] Genetic analyses have identified unique patterns of
claudins, tricellin, CD68, and other biomarkers, ones distinct from
those in other liver cancers. Earlier studies also indicated that
hFL-HCCs have Mosaic G-protein alpha-subunit (GNAS)-activating
mutations, characterized by STAT3 activation, EGF receptor levels
higher than in other types of hepatic tumors, and no K-RAS
mutations.
[0320] The resistance of hFL-HCCs to chemotherapies is predictable,
given the cells' expression of multidrug resistance genes. Their
renowned aggressiveness in patients and in immune-compromised hosts
correlates with expression of multiple genes, including adhesion
molecules (E-cadherin, VCAM-1), matrix receptors (CD44), and
syndecan-1 (HS-PG), known for binding FGFs, VEGFs, and other growth
factors and presenting them as potent mitogens.
[0321] The findings that HDAC and hedgehog inhibitors are potent
suppressors of growth and survival of hFL-HCCs from TU-2010
indicate new therapeutic options. Similar effects were previously
observed with hedgehog inhibitors on normal stem cells, a finding
complemented by parallels in expression of hedgehog genes in
hFL-HCC versus hBTSCs. By contrast, expression patterns of HDAC
genes are distinct in hFL-HCCs versus other parenchymal lineage
stages. An intriguing finding is the complete loss of HDAC9 in
hFL-HCC.
[0322] The TU-2010 tumor's richness in CSCs, the probable origins
from biliary tree stem cells, the finding that AHR agonists could
be etiological factors in the cancer, and the transplantable tumor
line described herein offer novel diagnostic and therapeutic
options, ones much needed for this devastating liver cancer.
[0323] The discovery of unique molecular signatures for hFL-HCCs
will aid in early detection and identification of appropriate
therapeutic regimens. In addition to conventional treatment
options, these findings suggest several novel candidate therapeutic
options. In particular, small molecule inhibitors of CA12 may be
used to suppress cancer growth and are currently in preclinical
development. In addition, because aberrant miR-10b regulatory
activity may contribute to hFL-HCCs pathogenesis, miR-10b and its
target genes may be candidate therapeutic targets. Locked nucleic
acids (LNAs) may also be useful for potent inhibition of miRNAs and
other genes. LNAs have been developed for both research and
therapeutic use. Finally, immunotherapies may be novel candidate
therapeutics for treating hFL-HCCs.
[0324] In the foregoing description, it will be readily apparent to
one skilled in the art that varying substitutions and modifications
may be made to the invention disclosed herein without departing
from the scope and spirit of the invention. The invention
illustratively described herein suitably may be practiced in the
absence of any element or elements, limitation or limitations,
which is not specifically disclosed herein. The terms and
expressions which have been employed are used as terms of
description and not of limitation, and there is no intention that
in the use of such terms and expressions of excluding any
equivalents of the features shown and described or portions
thereof, but it is recognized that various modifications are
possible within the scope of the invention. Thus, it should be
understood that although the present invention has been illustrated
by specific embodiments and optional features, modification and/or
variation of the concepts herein disclosed may be resorted to by
those skilled in the art, and that such modifications and
variations are considered to be within the scopes of this
invention.
[0325] Para. A. A transplantable tumor line of human fibrolamellar
hepatocellular carcinoma (hFL-HCC) cells maintained in a non-human
animal.
[0326] Para. B. The transplantable tumor line of Para A, wherein
the non-human animal is immunocompromised.
[0327] Para. C. The transplantable tumor line of Paras. A or B,
wherein the non-human animal is a mouse.
[0328] Para. D. The transplantable tumor line of any one Paras.
A-C, wherein the non-human animal is a NOD scid gamma (NSG)
mouse.
[0329] Para. E. The transplantable tumor line any one Paras. A-D,
wherein the hFL-HCC cells are derived from a tumor removed from the
liver, from the biliary tree, from a subcutaneous tumor or from an
intraperitoneal (ascites) tumor.
[0330] Para. F. The transplantable tumor line of any one of Paras
A-E, wherein the tumor line comprises hFL-HCC cells and mesenchymal
cells of the non-human animal.
[0331] Para. G. The transplantable tumor line of any one Paras.
A-F, wherein at least 50% of the hFL-HCC cells in the
transplantable tumor are cancer stem cells.
[0332] Para. H. The transplantable tumor line of any one of Paras.
A-G, where the mesenchymal cells are derived from the non-human
animal.
[0333] Para. I. The transplantable tumor line of any one of Paras.
A-H, wherein the human FL-HCC cells express the fusion transcript
DNAJB1-PRKACA.
[0334] Para. J. The transplantable tumor of any one of Paras. A-I,
wherein the hFL-HCC cells substantially do not express HDAC9 or
express a lower level of HDAC9 as compared to a human non-FL-HCC
cell control sample.
[0335] Para. K. The transplantable tumor line of any one of Paras.
A-J, wherein the hFL-HCC cells express one or more markers of
endodermal transcription factors selected from the group consisting
of SOX9, SOX17, PDX1, FOXA1, and NGN3.
[0336] Para. L. The transplantable tumor line of any one of Paras.
A-K, wherein the hFL-HCC cells express one or more markers of
pluripotency genes selected from the group consisting of OCT4,
SOX2, NANOG, SALL4, KLF4, and KLF5.
[0337] Para. M. The transplantable tumor of any one of Paras. A-L,
wherein the hFL-HCC cells express one or more markers of other stem
cell genes selected from the group consisting of CD44, SALL4,
TROP-2, BMI-1, sonic hedgehog (SHH), LGR5, NCAM, and KRT20.
[0338] Para. N. The transplantable tumor line of any one of Paras.
A-M, wherein the hFL-HCC cells express one or more hepatic markers
selected from the group consisting of CK8, CK18, CK19, DCLK1,
HepPar-1, albumin, alpha-fetoprotein, and CD68.
[0339] Para. O. The transplantable tumor line of any one of Paras.
A-N, wherein the hFL-HCC cells express one or more pancreatic
markers selected from PDX1, PCSK1, NGN3, insulin, glucagon,
amylase, and mucin (MUC).
[0340] Para. P. The transplantable tumor line of any one of Paras.
A-O, wherein the hFL-HCC cells express high levels of aryl
hydrocarbon receptors (AHR).
[0341] Para. Q. The transplantable tumor line of any one of Paras.
A-P, wherein the hFL-HCC cells express biomarkers of malignancy
such as AGR2 and/or high levels of extracellular matrix-degrading
enzymes and/or aberrations in the regulation of p53.
[0342] Para. R. The transplantable tumor line of any one of Paras.
A-Q, wherein the hFL-HCC cells have aberrant or lack of expression
of one or more histone deacetylase (HDAC) genes.
[0343] Para. S. A transplantable tumor line comprising human FL-HCC
(hFL-HCC) cells and mesenchymal cells from a non-human host.
[0344] Para. T. The tumor line of Para. S, wherein the non-human
host is an immunocompromised mouse.
[0345] Para. U. The tumor line of Para. S or T, wherein the
non-human host is a NOD scid gamma mouse
[0346] Para. V. The tumor line of Para. S, which is a
xenotransplanted, subcutaneous or intraperitoneal tumor.
[0347] Para. W. The tumor line of Para. S, wherein at least 30% of
the hFL-HCC cells are cancer stem cells
[0348] Para. X. The tumor line of Para. S, wherein at least 50% of
the hFL-HCC cells are cancer stem cells.
[0349] Para. Y. The tumor line of Para. S, wherein at least 65% of
the hFL-HCC cells are cancer stem cells.
[0350] Para. Z. The tumor line of any one of Paras. S-Y, wherein
the hFL-HCC cells express the fusion transcript DNAJB1-PRKACA.
[0351] Para. AA. The tumor line of any one of Paras. S-Z, wherein
the hFL-HCC cells substantially do not express or express low
levels of HDAC9 or express a lower level of HDAC9 as compared to a
human non-FL-HCC cell control sample.
[0352] Para. AB. The tumor line of any one of Paras. S-AA, wherein
the hFL-HCC cells express one or more markers of endodermal
transcription factors selected from the group consisting of SOX9,
SOX17, PDX1, FOXA1, and NGN3.
[0353] Para. AC. The tumor line of any one of Paras. S-AB, wherein
the hFL-HCC cells express one or more markers of pluripotency genes
selected from the group consisting of OCT4, SOX2, NANOG, SALL4,
KLF4, and KLF5.
[0354] Para. AD. The tumor line of any one of Paras. S-AC, wherein
the hFL-HCC cells express one or more markers of other stem cell
genes selected from the group consisting of CD44, SALL4, TROP-2,
BMI-1, sonic hedgehog (SHH), LGR5, NCAM, and KRT20.
[0355] Para. AE. The tumor line of any one of Paras. S-AD, wherein
the human FL-HCC cells express one or more hepatic markers selected
from the group consisting of CK7, CK8, CK18, CK19, DCLK1, HepPar-1,
albumin, alpha-fetoprotein, and CD68.
[0356] Para. AF. The tumor line of any one of Paras. S-AE, wherein
the hFL-HCC cells express one or more pancreatic markers selected
from the group consisting of PDX1, PCSK1, NGN3, insulin, glucagon,
amylase, and mucin (MUC).
[0357] Para. AG. The tumor line of any one of Paras. S-AF, wherein
the hFL-HCC cells express high levels of aryl hydrocarbon receptors
(AHR).
[0358] Para. AH. The tumor line of any one of Paras. S-AG, wherein
the hFL-HCC cells express biomarkers of malignancy such as AGR2
and/or high levels of extracellular matrix-degrading enzymes.
[0359] Para. AI. The tumor line of any one of Paras. S-AH, wherein
the human FL-HCC cells have aberrant or lack of expression of one
or more histone deacetylase (HDAC) genes.
[0360] Para. AJ. A tissue sample obtained from the tumor line of
any one of Paras. R-AI.
[0361] Para. AK. A cell culture comprising hFL-HCC cells in a
serum-free medium.
[0362] Para. AL. The cell culture of Para. AK, wherein the
serum-free medium is Kubota's Medium.
[0363] Para. AM. The cell culture of Para. AK or AL, wherein the
serum-free medium contains hyaluronans, HGF and/or VEGF.
[0364] Para. AN. The cell culture of any one of Paras. AK-AM,
wherein at least 51% of the cells in the cell culture are hFL-HCC
cells.
[0365] Para. AO. The cell culture of any one of Paras. AK-AN,
wherein at least 50% of the hFL-HCC cells in the cell culture are
cancer stem cells.
[0366] Para. AP. The cell culture of any one of Paras. AK-AO,
wherein at least a portion of the hFL-HCC cells are in aggregates
of hFL-HCC cells.
[0367] Para. AQ. The cell culture of any one of Paras. AK-AP,
wherein the hFL-HCC cells express fusion transcript
DNAJB1-PRKACA.
[0368] Para. AR. The cell culture of any one of Paras. AK-AQ,
wherein the hFL-HCC cells substantially do not express HDAC9 or
express a lower level of HDAC9 as compared to a human non-FL-HCC
cell control sample.
[0369] Para. AS. The cell culture of any one of Paras. AK-AR,
wherein the hFL-HCC cells express one or more endodermal
transcription factors selected from the group consisting of SOX9,
SOX17, PDX1, and NGN3.
[0370] Para. AT. The cell culture of any one of Paras. AK-AS,
wherein the hFL-HCC cells express one or more pluripotency genes
selected from the group consisting of SOX2, NANOG, SALL4, OCT4,
KLF4, and KLF5.
[0371] Para. AU. The cell culture of any one of Paras. AK-AT,
wherein the hFL-HCC cells express one or more stem cell genes
selected from TROP-2, SALL4, BMI-1, LGR5, sonic hedgehog (SHH),
NCAM.
[0372] Para. AV. The cell culture of any one of Paras. AK-AU,
wherein the hFL-HCC cells express one or more hepatic markers
selected from the group consisting of CK7, CK8, CK18 CK19,
HepPar-1, albumin, alpha-fetoprotein, LGR5, and CD68.
[0373] Para. AW. The cell culture of any one of Paras. AK-AV,
wherein the hFL-HCC cells express one or more pancreatic markers
selected from the group consisting of PDX1, NGN3, PCSK1, insulin,
glucagon, amylase, and mucin (MUC).
[0374] Para. AX. A method for establishing a hFL-HCC tumor line
comprising: (a) obtaining a human FL-HCC tumor from a patient with
hFL-HCC; (b) preparing a tumor cell suspension from the hFL-HCC
tumor; (c) culturing the tumor cell suspension under restrictive
conditions that select for cancer stem cells to obtain a population
of culture-selected cancer stem cells; and (d) transplanting
culture-selected cells into an immunocompromised, non-human
animal
[0375] Para. AY. The method of Para. AX, in which the hFL-HCC tumor
is obtained as an ascites fluid or as a solid tumor from the
subject.
[0376] Para. AZ. The method of Para. AX or AY, wherein the tumor
cell suspension from the hFL-HCC tumor are cultured on tissue
culture plastic or on or in hyaluronans.
[0377] Para. BA. The method of any one of Paras. AX-AZ, wherein the
tumor cell suspension from the hFL-HCC tumor are cultured in
serum-free Kubota's Medium.
[0378] Para. BB. The method of any one of Paras. AX-BA, comprising
at step (d) transplanting subcutaneously or intraperitoneally the
culture-selected cancer stem cells from the hFL-HCC cells into the
immunocompromised non-human animal.
[0379] Para. BC. The method of any one of Paras. AX-BB, comprising
at step (d) transplanting about 10.sup.2 to about 10.sup.7
culture-selected cancer stem cells from the hFL-HCC tumor into the
immunocompromised, non-human animal.
[0380] Para. BD. The method of any one of Paras. AX-BC, further
comprising after step (d) monitoring the immunocompromised,
non-human animal for tumor formation for about 2 to about 9
months.
[0381] Para. BE. A method for maintaining a hFL-HCC transplantable
tumor line comprising: (a) obtaining hFL-HCC cells from a
xenografted tumor of a maintained in an immunocompromised non-human
animal, (b) dispersing the hFL-HCC cells into a cell suspension by
enzymatic and/or mechanical methods, and (c) transplanting
dispersed hFL-HCC cells into a second immunocompromised, non-human
animal.
[0382] Para. BF. The method of Para. BE, comprising culturing the
hFL-HCC cells in serum-free medium.
[0383] Para. BG. The method of Para. BF, wherein the serum-free
medium is Kubota's Medium.
[0384] Para. BH. The method of Para. BE, wherein the serum-free
medium further contains hyaluronans, HGF and/or VEGF.
[0385] Para. BI. The method of any one of Paras. BE-BH comprising,
at step (c) transplanting subcutaneously or intraperitoneally the
hFL-HCC tumor into the second immunocompromised, non-human
animal.
[0386] Para. BJ. A method for culturing hFL-HCC cells comprising:
(a) separating hFL-HCC cells of a xenografted tumor from non-human
cells; (b) suspending the separated hFL-HCC cells in a serum-free
medium, and (c) plating the hFL-HCC cells as monolayers onto or
into a culture substratum to obtain plated hFL-HCC cells or
allowing the cells to form floating aggregates.
[0387] Para. BK. The method of Para. BJ, comprising at step (c)
separating hFL-HCC cells from non-human cells by magnetic
immunoselection.
[0388] Para. BL. The method of Para. BJ, wherein the culture
substratum is a tissue culture plastic, a surface coated with a
purified extracellular matrix component or with an extract enriched
in extracellular matrix, a 3D hydrogel of a purified extracellular
matrix component, or a suspension.
[0389] Para. BM. The method of Para. BL, wherein the purified
extracellular matrix component is selected from the group
consisting of hyaluronan, a collagen, an adhesion molecule, and an
extract enriched in extracellular matrix.
[0390] Para. BN. The method of Para. BM, wherein the adhesion
molecule is laminin.
[0391] Para. BO. The method of Para. BM, wherein the extract
enriched in extracellular matrix is a matrix scaffold, a biomatrix
scaffold, or Matrigel.
[0392] Para. BP. The method of Para. BJ, wherein the plated hFL-HCC
cells are kept in suspension and allowed to form aggregates.
[0393] Para. BQ. A method for drug screening, comprising (a)
introducing a candidate drug to cultured hFL-HCC cells that are in
the form of monolayers, hydrogels, spheroids or organoids, and (b)
monitoring the effect of the candidate drug on the cultured hFL-HCC
cells.
[0394] Para. BR. A method for drug testing, comprising (a)
administering a candidate drug to a non-human animal carrying a
transplanted hFL-HCC tumor and (b) monitoring the effect of the
candidate drug on the xenotransplanted hFL-HCC tumor.
[0395] Para. BS. A method for suppressing the growth of hFL-HCC
cells, comprising treating the hFL-HCC cells with a hedgehog
signaling inhibitor, a histone deacetylase inhibitor, a protein
kinase inhibitor, and/or an inhibitor of a gene overexpressed in
hFL-HCC cells.
[0396] Para. BT. The method of Para. BS, wherein the hedgehog
signaling pathway inhibitor comprises GDC-0449.
[0397] Para. BU. The method of Para. BS, wherein the histone
deacetylase inhibitor comprises suberoylanilide hydroxamic acid
(SAHA) and/or suberic bis-hydroxamic acid (SBHA)
[0398] Para. BV. A method for treating hFL-HCC in a patient in need
thereof, comprising administering to the patient an effective
amount of a hedgehog signaling pathway inhibitor, a histone
deacetylase inhibitor, a protein kinase inhibitor, and/or an
inhibitor of a gene overexpressed in hFL-HCC cells.
[0399] Para. BW. The method of Para. BV, wherein the hedgehog
signaling pathway inhibitor comprises GDC-0449
[0400] Para. BX. The method of Para. BX, wherein the histone
deacetylase inhibitor comprises SAHA and/or SBHA.
[0401] Para. BY. A method of determining whether a patient has
fibrolamellar hepatocellular carcinoma (FL-HCC), comprising: (a)
measuring gene expression levels of at least one of C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C; and (b)
comparing the gene expression profile to one or more control
samples.
[0402] Para. BZ. The method of Para. BY, wherein overexpression of
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163 or TNRC6C relative
to the control sample is associated with presence of FL-HCC.
[0403] Para. CA. The method of Para. BZ, wherein overexpression of
PCSK1, CA12, NOVA1, SLC16A14, TNRC6C, TMEM163, and RPS6KA2 relative
to the control sample is associated with presence of FL-HCC.
[0404] Para. CB. The method of Para. BZ, wherein overexpression of
C10orf128, OAT, PAK3, PCSK1, PHACTR2, SLC16A14, TMEM163, and TNRC6C
relative to the control sample is associated with presence of
FL-HCC.
[0405] Para. CC. The method of any one of Paras. BZ-CB, wherein the
control sample is selected from the tumor cells from hepatocellular
carcinomas (HCCs), hepatoblastomas, cholangiocarcinomas (CCAs)
and/or pancreatic cancers or selected from normal cells consisting
of biliary tree stem cells, hepatic stem cells, hepatoblasts,
pancreatic stem cells, hepatic or pancreatic committed progenitors,
and normal mature hepatic or pancreatic cells.
[0406] Para. CD. A method of treating a patient determined to have
hFL-HCC by administering to the patient an effective amount of at
least one therapeutic that decreases expression of at least one of
C10orf128, CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT,
PAK3, PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, or TNRC6C.
[0407] Para. CE. The method of Para. CD, wherein the at least one
therapeutic is selected from the group consisting of a small
molecule, RNA interference, and a locked nucleic acid (LNA).
[0408] Para. CF. A method of treating a patient determined to have
hFL-HCC by administering to the patient an effective amount of an
immunotherapy.
[0409] Para. CG. A method of treating a patient determined to have
hFL-HCC by administering to the patient an effective amount of at
least one therapeutic that regulates PRKACA or SRC network
hubs.
[0410] Para. CH. A method of treating a patient determined to have
hFL-HCC by administering to the patient an effective amount of at
least one therapeutic that regulates substrate targets of the
kinase PRKACA (Protein kinase A catalytic subunit alpha).
[0411] Para. CI. An isolated hFL-HCC cell wherein the hFL-HCC cell
expresses a marker selected from the group consisting of C10orf128,
CA12, CREB3L1, GALNTL6, IRF4, ITPRIP, KCNE4, NOVA1, OAT, PAK3,
PCSK1, PHACTR2, RPS6KA2, SLC16A14, TMEM163, and TNRC6C.
[0412] Para. CJ. A population of isolated hFL-HCC cells of Para.
CI.
[0413] Para. CK. A composition comprising an isolated hFL-HCC cell
of Para. CI or CJ and a carrier.
[0414] Para. CL. The composition of any one of Paras. CI-CK,
wherein the hFL-HCC cells are obtained from ascites fluid or a
solid tumor.
[0415] Para. CM. The composition of any one of Paras. CI-CL,
wherein the hFL-HCC cells are cultured on tissue culture plastic or
on or in hyaluronans.
[0416] Para. CN. The composition of any one of Paras. CI-CM,
wherein the hFL-HCC cells are cultured in cells in serum-free
medium.
[0417] Para. CO. The composition of any one of Paras. CI-CN,
wherein the serum-free medium is Kubota's Medium.
[0418] Para. CP. The composition of Paras. CI-CO, wherein the
serum-free medium further contains hyaluronans, HGF and/or
VEGF.
[0419] Para. CQ. The composition of any one of Paras. CI-CP,
further comprising purified extracellular matrix component.
[0420] Para. CR. The composition of Para. CQ, wherein the purified
extracellular matrix component is selected from the group
consisting of hyaluronan, a collagen, an adhesion molecule, and an
extract enriched in extracellular matrix.
[0421] Para. CS. The composition of Para. CR, wherein the adhesion
molecule is laminin.
[0422] Para. CT. The composition of Para. CR, wherein the extract
enriched in extracellular matrix is a matrix scaffold, a biomatrix
scaffold, or Matrigel.
[0423] Para. CU. A transplantable tumor cell line comprising human
fibrolamellar hepatocellular carcinoma (hFL-HCC) cells, which can
be maintained in a non-human animal.
Sequence CWU 1
1
28119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tgccgctttg caggtgtat 19217DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2ggcctccgtc cgagaga 17322DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3tcacagtcac tgacaccaac ga
22420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4ggcacctgac ccttgtacgt 20520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5aaaaggccag cgttgtctcc 20621DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6tgaagccagc tctctatccc a
21721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7tgctgcctac atgagcaagg t 21823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8tctgtcaact ccgtctcatt gag 23917DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 9gcccgctacg ccctaca
171021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10tgactcaagg tgcagcagga t 211120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11ccgcgactac agccactact 201220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12gtcgatctgc aggacaatcc
201322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13gaggatctgg tgagcctgag aa 221424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14cataagtgat gctggagctg gtaa 241525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15aaatctaaga ggtggcagaa aaaca 251620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16cttctgcgtc acaccattgc 201719DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 17cccatggatg aagtctacc
191819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18gtcctcctcc tttttccac 191922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19gagaggcaac ctggagaatt tg 222021DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 20gatctgctgc agtgtgggtt t
212124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21tccacagaaa tttacctaca ttgg 242220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22cagcagagag cagatgacca 202325DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 23aaatgggagg ggtgcaaaag aggag
252425DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24cagctgtcat ttgctgtggg tgatg 252523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25gacttttgcc gcagctcagg aag 232629DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 26gccagctttg agcaaatgac
agtattttg 292720DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 27aaggtgaagg tcggagtcaa
202820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 28aatgaagggg tcattgatgg 20
* * * * *