U.S. patent application number 14/864356 was filed with the patent office on 2016-09-01 for therapeutic compounds.
This patent application is currently assigned to UNIVERSITY OF IOWA RESEARCH FOUNDATION. The applicant listed for this patent is UNIVERSITY OF IOWA FOUNDATION. Invention is credited to Ryan L. Boudreau, Beverly L. Davidson.
Application Number | 20160251653 14/864356 |
Document ID | / |
Family ID | 46638993 |
Filed Date | 2016-09-01 |
United States Patent
Application |
20160251653 |
Kind Code |
A1 |
Davidson; Beverly L. ; et
al. |
September 1, 2016 |
THERAPEUTIC COMPOUNDS
Abstract
The present invention is directed to RNA interference (RNAi)
molecules targeted against a Huntington's disease nucleic acid
sequence, and methods of using these RNAi molecules to treat
Huntington's disease.
Inventors: |
Davidson; Beverly L.; (Iowa
City, IA) ; Boudreau; Ryan L.; (Iowa City,
IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF IOWA FOUNDATION |
Iowa City |
IA |
US |
|
|
Assignee: |
UNIVERSITY OF IOWA RESEARCH
FOUNDATION
Iowa City
IA
|
Family ID: |
46638993 |
Appl. No.: |
14/864356 |
Filed: |
September 24, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13985023 |
Aug 12, 2013 |
9181544 |
|
|
PCT/US12/24904 |
Feb 13, 2012 |
|
|
|
14864356 |
|
|
|
|
61442218 |
Feb 12, 2011 |
|
|
|
61522632 |
Aug 11, 2011 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C12N 2750/14143
20130101; A61P 25/14 20180101; C12N 2320/53 20130101; C12N 2330/51
20130101; C12N 15/111 20130101; C12N 7/00 20130101; C12N 15/113
20130101; C12N 2320/30 20130101; A61K 48/00 20130101; C12N 15/11
20130101; C12N 2310/141 20130101; C12N 2310/531 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 7/00 20060101 C12N007/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention was made with Government support under
NS-50210, NS-068099, and DK-54759 awarded by the National
Institutes of Health. The government has certain rights in the
invention.
Claims
1-72. (canceled)
73. A nucleic acid encoding an artificial primary miRNA transcript
(pri-miRNA) comprising, in order of position, a 5'-flanking region,
wherein the 5'-flanking region comprises a 5'-bulge sequence
positioned upstream from a 5'-joining sequence; a non-guide region,
wherein the 5'-joining sequence is contiguously linked to the
non-guide region; a loop region; a guide region; and a 3'-flanking
region, wherein the guide region comprises a sequence at least 80%
identical to cgaccaugcgagccagca (miHDS.1 guide. SEQ ID NO:7) and
the non-guide region is at least 80% complementary to the guide
region.
74. The nucleic acid of claim 73, wherein the guide region consists
of 18-30 nucleotides.
75. The nucleic acid of claim 73, wherein the 5' joining sequence
consists of 5-8 nucleotides.
76. The nucleic acid of claim 73, wherein the 5'-bulge sequence
consists of 1-10 nucleotides.
77. The nucleic acid of claim 73, wherein the 5'-flanking region
further comprises a 5'-spacer sequence positioned upstream from the
5'-bulge sequence.
78. The nucleic acid of claim 77, wherein the 5'-spacer sequence
consists of 10-12 nucleotides.
79. The nucleic acid of claim 77, further comprising a 5'-upstream
sequence positioned upstream from the 5'-spacer sequence.
80. The nucleic acid of claim 79, wherein the 5'-upstream sequence
consists of 30-2000 nucleotides.
81. The nucleic acid of claim 73, wherein the 3'-flanking region
comprises a 3'-joining sequence contiguously linked to the guide
region.
82. The nucleic acid of claim 81, wherein the 3'-joining sequence
consists of 5-8 nucleotides.
83. The nucleic acid of claim 81, wherein the 3'-joining sequence
is at least about 85% complementary to the 5'-joining sequence.
84. The nucleic acid of claim 81, further comprising a 3'-bulge
sequence positioned downstream from the 3'-joining sequence.
85. The nucleic acid of claim 84, wherein the 3'-bulge sequence
consists of 1-10 nucleotides.
86. The nucleic acid of claim 84, further comprising a 3'-spacer
sequence positioned downstream from the 3'-bulge sequence.
87. The nucleic acid of claim 86, wherein the 3'-spacer sequence
consists of 10-12 nucleotides.
88. The nucleic acid of claim 86, further comprising a
3'-downstream sequence positioned downstream from the 3'-spacer
sequence.
89. The nucleic acid of claim 88, wherein the 3'-downstream
sequence is about 30-2000 nucleotides in length.
90. The nucleic acid of claim 73, wherein the loop region is from
15-25 nucleotides in length.
91. An expression cassette comprising a promoter contiguously
linked to the nucleic acid of claim 73.
92. A vector comprising the expression cassette of claim 91.
93. The vector of claim 90, wherein the vector is an
adeno-associated virus (AAV) vector.
94. The vector of claim 93, wherein the AAV is AAV1, AAV2, AAV4,
AAV5, or AAV2/1.
95. An isolated microRNA molecule comprising the nucleic acid of
claim 73.
96. A method of inducing RNA interference comprising administering
to a subject an effective amount of the nucleic acid of claim
73.
97. A method of treating a subject with Huntington's Disease,
comprising administering to the subject the nucleic acid of claim
73 so as to treat the Huntington's Disease.
Description
CLAIM OF PRIORITY
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/985,023, filed on Aug. 12, 2013, which is a
U.S. National Phase Application of International Patent Application
No. PCT/US2012/024904, filed on Feb. 13, 2012, which claims
priority to U.S. Provisional Application No. 61/442,218, filed on
Feb. 12, 2011 and U.S. Provisional Application No. 61/522,632,
filed on Aug. 11, 2011. These applications are incorporated by
reference herein.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, is
named 17023.113US1_SL.txt and is 51,200 bytes in size.
BACKGROUND OF THE INVENTION
[0004] RNAi directs sequence-specific gene silencing by
double-stranded RNA (dsRNA) which is processed into functional
small inhibitory RNAs (.about.21nt). In nature, RNAi for regulation
of gene expression occurs primarily via small RNAs known as
microRNAs (miRNAs). Mature microRNAs (.about.19-25 nts) are
processed from larger primary miRNA transcripts (pri-miRNAs) which
contain stem-loop regions. Via a series of processing events
catalyzed by the ribonucleases, Drosha and Dicer, the miRNA duplex
region is liberated and a single strand (the antisense "guide"
strand) is then incorporated into the RNA Induced Silencing Complex
(RISC), thus generating a functional complex capable of
base-pairing with and silencing target transcripts. The mode of
target repression primarily depends upon the degree of
complementarity; transcript cleavage typically requires a
high-degree of base-pairing, whereas translational repression and
mRNA destabilization occurs when small RNAs bind imperfectly to
target transcripts (most often in the 3' UTR). Indeed for the
latter, short stretches of complementarity--as little as 6 bp--may
be sufficient to cause gene silencing.
SUMMARY OF THE INVENTION
[0005] The present invention provides an isolated miRNA shuttle
vector that expresses a therapeutic siRNA with limited off target
toxicity. In certain embodiments, embedding an siRNA that exhibits
off target toxicity in the context of an miRNA shuttle vector of
the present invention limits the off target toxicity of the siRNA.
In certain embodiments, the miRNA shuttle vector expresses a
therapeutic siRNA in the brain with limited off target toxicity. In
certain embodiments, the miRNA shuttle vector expresses a
therapeutic siRNA in the striatum with limited off target toxicity.
In certain embodiments, the miRNA shuttle vector expresses a
therapeutic siRNA in the cerebrum with limited off target
toxicity.
[0006] The present invention provides an isolated nucleic acid
encoding a primary transcript (pri-miRNA) including, in order of
position, a 5'-flanking region, a non-guide (passenger) region, a
loop region, a guide region, and a 3'-flanking region, wherein the
guide region is at least 90% identical to CGACCAUGCGAGCCAGCA
(miHDS.1 guide, SEQ ID NO:7), AGUCGCUGAUGACCGGGA (miHDS.2 guide,
SEQ ID NO:8) or ACGUCGUAAACAAGAGGA (miHDS.5 guide, SEQ ID NO:9) and
the non-guide region is at least 80% complementary to the guide
region. In certain embodiments, the 5'-flanking region is
contiguously linked to the non-guide region, the loop region is
positioned between the non-guide region and the guide region, and
the guide region is contiguously linked to the 3'-flanking region.
As used herein, the term "siRNA guide region" is a single-stranded
sequence of RNA that is complementary to a target sequence. As used
herein, the term "siRNA non-guide region" is a single-stranded
sequence of RNA that is complementary to the "siRNA guide region."
Thus, under the proper conditions, the siRNA guide region and the
siRNA non-guide region associate to form an RNA duplex. As used
herein, all nucleic acid sequences are listed, as is customary, in
a 5' to 3' direction.
[0007] In certain embodiments, the non-guide region is about 15-30
nucleotides in length, and is about 70-100% complementary to the
guide region, which is about 15-30 nucleotides in length. In
certain embodiments, the guide region is at least 90% identical to
CGACCAUGCGAGCCAGCA (miHDS.1 guide, SEQ ID NO:7), AGUCGCUGAUGACCGGGA
(miHDS.2 guide, SEQ ID NO:8) or ACGUCGUAAACAAGAGGA (miHDS.5 guide,
SEQ ID NO:9) and the non-guide region is at least 80% complementary
to the guide region.
[0008] In certain embodiments, the 5'-flanking region contains a
5'-joining sequence contiguously linked to the non-guide region. As
used herein, the term "joining site" or a "joining sequence" is a
short nucleic acid sequence of less than 60 nucleotides that
connects two other nucleic acid sequences. In certain embodiments,
the joining site is of a length of any integer between 4 and 50,
inclusive. In certain embodiments, the 5'-joining sequence consists
of 5-8 nucleotides (e.g., consists of 6 nucleotides). In certain
embodiments, the 5'-joining sequence encodes GUGAGCGA (SEQ ID
NO:12) or GUGAGCGC (SEQ ID NO:13).
[0009] In certain embodiments, the 5'-flanking region further
comprises a 5'-bulge sequence positioned upstream from the
5'-joining sequence. As used herein, the term "bulge sequence" is a
region of nucleic acid that is non-complementary to the nucleic
acid opposite it in a duplex. For example, a duplex will contain a
region of complementary nucleic acids, then a region of
non-complementary nucleic acids, followed by a second region of
complementary nucleic acids. The regions of complementary nucleic
acids will bind to each other, whereas the central
non-complementary region will not bind, thereby forming a "bulge."
In certain embodiments the two strands of nucleic acid positioned
between the two complementary regions will be of different lengths,
thereby forming a "bulge." In certain embodiments, the 5'-bulge
sequence will contain from 2 to 15 nucleotides. In certain
embodiments, the 5'-bulge sequence consists of about 1-10
nucleotides. In certain embodiments, the 5'-bulge sequence encodes
UAAACUCGA (SEQ ID NO:14). In certain embodiments, the 5'-bulge
sequence has from 0-50% complementarity to the 3'-bulge sequence.
The XhoI restriction site is CTCGAG (SEQ ID NO:15) (with "T" being
"U" in RNA form in this and all other sequences listed herein).
[0010] In certain embodiments, the 5'-flanking region further
contains a 5'-spacer sequence positioned upstream from the 5'-bulge
sequence. In certain embodiments, the 5'-spacer sequence consists
of 9-12 nucleotides, such as 10-12 nucleotides. In certain
embodiments, the 5'-spacer sequence has from 60-100%
complementarity to a 3'-spacer sequence. In certain embodiments,
the 5'-bulge sequence comprises a cloning site, such as an XhoI
site. In certain embodiments, the 5'-spacer sequence is UGGUACCGUU
(SEQ ID NO:16).
[0011] In certain embodiments, the 5'-flanking region further
contains a 5'-upstream sequence positioned upstream from the
5'-spacer sequence. In certain embodiments, the 5'-upstream
sequence is about 5-5000 nucleotides in length, such as 30-2000
nucleotides in length.
[0012] In certain embodiments, the 3'-flanking region contains a
3'-joining sequence contiguously linked to the guide region. In
certain embodiments, the joining site is of a length of any integer
between 4 and 50, inclusive. In certain embodiments, the 3'-joining
sequence consists of 5-8 nucleotides, (e.g., consists of 6
nucleotides). In certain embodiments, the 3'-joining sequence is at
least about 85% complementary to a 5'-joining sequence. In certain
embodiments, the 3'-joining sequence encodes CGCYUAC (SEQ ID
NO:17), wherein Y is C or U. In certain embodiments, the 3'-joining
sequence encodes CGCCUAC (SEQ ID NO:18).
[0013] In certain embodiments, the 3'-flanking region further
comprises a 3'-bulge sequence positioned downstream from the
3'-joining sequence. In certain embodiments, the 3'-bulge sequence
comprises a cloning site, such as a SpeI/XbaI site or a SpeI site.
The SpeI/XbaI site is encoded by CTCAGA (SEQ ID NO:19), and the
SpeI site is encoded by CTCAGT (SEQ ID NO:20). In certain
embodiments, the 3'-bulge sequence consists of about 1-15
nucleotides (such as 2-15 nucleotides or 1-10 nucleotides). In
certain embodiments, the 3'-bulge sequence encodes UAG (SEQ ID NO:
32). In certain embodiments, the 5'-bulge sequence is complementary
to the 3'-bulge sequence at only one nucleotide at each end of the
sequence.
[0014] In certain embodiments, the 3'-flanking region further
contains a 3'-spacer sequence positioned downstream from the
3'-bulge sequence. In certain embodiments, the 3'-spacer sequence
consists of 9-12 nucleotides, such as 10-12 nucleotides. In certain
embodiments, the 3'-spacer sequence is AGCGGCCGCCA (SEQ ID NO:21).
In certain embodiments, the 3'-spacer sequence is at least about
70% complementary to a 5'-spacer sequence.
[0015] In certain embodiments, the 3'-flanking region further
contains a 3'-downstream sequence positioned downstream from the
3'-spacer sequence. In certain embodiments, a 5'-upstream sequence
does not significantly pair with the 3'-downstream sequence. As
used herein, the term "does not significantly pair with" means that
the two strands are less than 20% homologous. In certain
embodiments, the 3'-downstream sequence is about 5-5000 nucleotides
in length, such as 30-2000 nucleotides in length.
[0016] In certain embodiments, the loop region is from 4-20
nucleotides in length, such as 15-19 nucleotides in length. From
0-50% of the loop region can be complementary to another portion of
the loop region. As used herein, the term "loop region" is a
sequence that joins two complementary strands of nucleic acid. In
certain embodiments, 1-3 nucleotides of the loop region are
immediately contiguous to the complementary strands of nucleic acid
may be complementary to the last 1-3 nucleotides of the loop
region. For example, the first two nucleic acids in the loop region
may be complementary to the last two nucleotides of the loop
region. In certain embodiments, the loop region is 17 nucleotides
in length. In certain embodiments, the loop region encodes
CUNNNNNNNNNNNNNNNGG (SEQ ID NO:22) or CCNNNNNNNNNNNNNNNGG (SEQ ID
NO:23). In certain embodiments, the loop region encodes
CUGUGAAGCCACAGAUGGG (SEQ ID NO:24) or CCGUGAAGCCACAGAUGGG (SEQ ID
NO:25).
[0017] The present invention further provides an RNA encoded by
nucleic acid described herein.
[0018] The present invention further provides an expression
cassette containing a promoter contiguously linked to a nucleic
acid described herein. In certain embodiments, the promoter is a
polII or a polIII promoter, such as a U6 promoter (e.g., a mouse U6
promoter). In certain embodiments, the expression cassette further
contains a marker gene. In certain embodiments, the promoter is a
polII promoter. In certain embodiments, the promoter is a
tissue-specific promoter. In certain embodiments, the promoter is
an inducible promoter. In certain embodiments, the promoter is a
polIII promoter.
[0019] The present invention provides a vector containing an
expression cassette described herein. In certain embodiments, the
vector is an adeno-associated virus (AAV) vector.
[0020] The present invention provides a non-human animal comprising
the nucleic acid, the expression cassette, or the vector described
herein.
[0021] The present invention provides an isolated nucleic acid
between 80-4000 nucleotides in length comprising (or consisting of)
an miHDS.1 guide GUCGACCAUGCGAGCCAGCAC (SEQ ID NO:4); an miHDS.2
guide AUAGUCGCUGAUGACCGGGAU (SEQ ID NO:5); an miHDS.5 guide
UUACGUCGUAAACAAGAGGAA (SEQ ID NO:6); an miHDS.1
CUCGAGUGAGCGAUGCUGGCUCGCAUGGUCGAUACUGUAAAGCCACAGAUGGG
UGUCGACCAUGCGAGCCAGCACCGCCUACUAGA (SEQ ID NO:1),
GCGUUUAGUGAACCGUCAGAUGGUACCGUUUAAACUCGAGUGAGCGAUGCUG
GCUCGCAUGGUCGAUACUGUAAAGCCACAGAUGGGUGUCGACCAUGCGAGCCA
GCACCGCCUACUAGAGCGGCCGCCACAGCGGGGAGAUCCAGACAUGAUAAGAU ACAUU (SEQ ID
NO:10), or CUCGAGUGAGCGAUGCUGGCUCGCAUGGUCGAUACUGUAAAGCCACAGAUGGG
UGUCGACCAUGCGAGCCAGCACCGCCUACUAGA (SEQ ID NO:33); an miHDS.2
CUCGAGUGAGCGCUCCCGGUCAUCAGCGACUAUUCCGUAAAGCCACAGAUGGG
GAUAGUCGCUGAUGACCGGGAUCGCCUACUAG (SEQ ID NO:2) or
GCGUUUAGUGAACCGUCAGAUGGUACCGUUUAAACUCGAGUGAGCGCUCCCGG
UCAUCAGCGACUAUUCCGUAAAGCCACAGAUGGGGAUAGUCGCUGAUGACCGG
GAUCGCCUACUAGAGCGGCCGCCACAGCGGGGAGAUCCAGACAUGAUAAGAUA CAUU (SEQ ID
NO:11); or an miHDS.5
CUCGAGUGAGCGCUCCUCUUGUUUACGACGUGAUCUGUAAAGCCACAGAUGGG
AUUACGUCGUAAACAAGAGGAACGCCUACUAGU (SEQ ID NO:3).
[0022] The present invention provides an isolated RNA duplex
comprising a guide region of nucleic acid and a non-guide region of
nucleic acid, wherein the guide region is at least 90% identical to
CGACCAUGCGAGCCAGCA (miHDS.1 guide, SEQ ID NO:7), AGUCGCUGAUGACCGGGA
(miHDS.2 guide, SEQ ID NO:8) or ACGUCGUAAACAAGAGGA (miHDS.5 guide,
SEQ ID NO:9) and the non-guide region is at least 80% complementary
to the guide region. In certain embodiments, the isolated RNA
duplex is between 19-30 base pairs in length. Certain embodiments
include an expression cassette encoding the isolated nucleic acid
described above. In certain embodiments the expression cassette
further comprises a marker gene.
[0023] The present invention provides method of inducing RNA
interference by administering to a subject a nucleic acid, an
expression cassette, a vector, or a composition described
herein.
[0024] The present invention provides a vector containing a U6
promoter operably linked to a nucleic acid encoding an miRNA. The
predicted transcription start sites of constructs of the present
invention are different from those used by researchers in the past.
In certain embodiments of the present invention, the U6miRNA has an
extended 5' end. If the 5' end is truncated to resemble the
previous CMV-based strategy, silencing efficacy is severely
reduced. The present invention also provides improved flanking
sequences that show improved efficacy over natural miR-30 flanking
sequences. The use of the present miRNA strategy appears to
alleviate toxicity associated with traditional shRNA approaches.
The miRNA strategy does not generally generate excessive amounts of
RNAi as do U6shRNA approaches.
[0025] As used herein the term "stem sequence" is a sequence that
is complementary to another sequence in the same molecule, where
the two complementary strands anneal to form a duplex (e.g., the
non-guide and guide regions). The duplex that is formed may be
fully complementary, or may be less than fully complementary, such
as 99%, 98%, 97%, 96%, 95,%, 94%, 93%, 92%, 91%, 90%, 89%, 88%,
87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, or 70% complementary
to each other. Further, in certain embodiments, one strand may
contain more nucleotides than the other strand, allowing the
formation of a side loop.
[0026] The present invention also provides vectors containing the
expression cassettes described herein. Examples of appropriate
vectors include adenoviral, lentiviral, adeno-associated viral
(AAV), poliovirus, herpes simplex virus (HSV), or murine
Maloney-based viral vectors. In one embodiment, the vector is an
adeno-associated virus vector. These cassettes and vectors may be
contained in a cell, such as a mammalian cell. A non-human mammal
may contain the cassette or vector.
[0027] The present invention provides cells (such as a mammalian
cell) containing the nucleic acid molecules, expression cassettes
or vectors described herein. The present invention also provides a
non-human mammal containing the nucleic acid molecules, expression
cassettes or vectors described herein.
[0028] The present invention provides a nucleic acid, an expression
cassette, a vector, or a composition as described herein for use in
therapy, such as for treating a neurodegenerative disease.
[0029] The present invention provides an isolated RNAi molecule
having a microRNA having an overhang at the 3' end. In certain
embodiments, the overhang is a 2 to 5-nucleotide repeat. In certain
embodiments, the overhang is a UU (SEQ ID NO:26), UUU (SEQ ID
NO:27), UUUU (SEQ ID NO:28), CUU (SEQ ID NO:29), CUUU (SEQ ID
NO:30) or CUUUU (SEQ ID NO:31) sequence. In certain embodiments,
the microRNA is a naturally-occurring microRNA. In certain
embodiments, microRNA is an artificial microRNA. In certain
embodiments, the RNAi molecule produces a decreased level of
off-target toxicity.
[0030] The present invention provides a method of inducing
low-toxicity RNA interference by administering to a subject a
nucleic acid, an expression cassette, a vector, or a composition as
described herein. In certain embodiments, the expression cassette
contains a polII promoter.
[0031] The present invention provides a method of inducing
low-toxicity RNA interference by administering to a subject an
expression cassette encoding a polII promoter operably linked to a
nucleic acid encoding a miRNA. In certain embodiments, the miRNA
comprises a 2- or 3-nucleotide 5' or 3'-overhang. In certain
embodiments, the miRNA comprises a 2-nucleotide 3'-overhang. In
certain embodiments, the miRNA is an artificial miRNA.
[0032] The present invention provides a method of treating a
subject with a Huntington's Disease by administering to the subject
a nucleic acid, an expression cassette, a vector, or a composition
as described herein so as to treat the Huntington's Disease.
[0033] The present invention provides a method of suppressing the
accumulation of huntingtin in a cell by introducing nucleic acid
molecules (e.g., a ribonucleic acid (RNA)) described herein into
the cell in an amount sufficient to suppress accumulation of
huntingtin in the cell. In certain embodiments, the accumulation of
huntingtin is suppressed by at least 10%. In certain embodiments,
the accumulation of huntingtin is suppressed by at least 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, or 99%. In certain
embodiments, the suppression of the accumulation of the protein is
in an amount sufficient to cause a therapeutic effect, e.g., to
reduce the formation of tangles.
[0034] The present invention provides a method of preventing
cytotoxic effects of mutant huntingtin in a cell by introducing
nucleic acid molecules (e.g., a ribonucleic acid (RNA)) described
herein into the cell in an amount sufficient to suppress
accumulation of huntingtin. In certain embodiments, the nucleic
acid molecules prevents cytotoxic effects of huntingtin, e.g., in a
neuronal cell.
[0035] The present invention provides a method to inhibit
expression of a huntingtin gene in a cell by introducing a nucleic
acid molecule (e.g., a ribonucleic acid (RNA)) described herein
into the cell in an amount sufficient to inhibit expression of the
huntingtin, and wherein the RNA inhibits expression of the
huntingtin gene. In certain embodiments, the huntingtin is
inhibited by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%
95%, or 99%.
[0036] The present invention provides a method to inhibit
expression of a huntingtin gene in a mammal (e.g., a human or a
non-human mammal) by (a) providing a mammal containing a neuronal
cell, wherein the neuronal cell contains the huntingtin gene and
the neuronal cell is susceptible to RNA interference, and the
huntingtin gene is expressed in the neuronal cell; and (b)
contacting the mammal with a ribonucleic acid (RNA) or a vector
described herein, thereby inhibiting expression of the huntingtin
gene. In certain embodiments, the accumulation of huntingtin is
suppressed by at least 10%. In certain embodiments, the huntingtin
is inhibited by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90% 95%, or 99%. In certain embodiments, the cell is located in
vivo in a mammal.
[0037] The present invention provides a viral vector comprising a
promoter and a micro RNA (miRNA) shuttle containing an embedded
siRNA specific for a target sequence. In certain embodiments, the
promoter is an inducible promoter. In certain embodiments, the
vector is an adenoviral, lentiviral, adeno-associated viral (AAV),
poliovirus, HSV, or murine Maloney-based viral vector. In certain
embodiments, the targeted sequence is a sequence associated with
Huntington's Disease. The target sequence, in certain embodiments,
is a sequence encoding huntingtin.
[0038] The present invention provides a method of preventing
cytotoxic effects of neurodegenerative disease in a mammal in need
thereof, by introducing the vector encoding a miRNA described
herein into a cell in an amount sufficient to suppress accumulation
of a protein associated with Huntington's Disease, and wherein the
RNA prevents cytotoxic effects of Huntington's Disease (also
referred to as HD, and the protein involved is huntingtin, also
called htt).
[0039] The present invention also provides a method to inhibit
expression of a protein associated with Huntington's Disease in a
mammal in need thereof, by introducing the vector encoding a miRNA
described herein into a cell in an amount sufficient to inhibit
expression of the huntingtin protein, wherein the RNA inhibits
expression of the huntingtin protein. The huntingtin protein is
inhibited by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%
95%, or 99%.
[0040] This invention relates to compounds, compositions, and
methods useful for modulating Huntington's Disease gene expression
using short interfering nucleic acid (siRNA) molecules. This
invention also relates to compounds, compositions, and methods
useful for modulating the expression and activity of other genes
involved in pathways of HD gene expression and/or activity by RNA
interference (RNAi) using small nucleic acid molecules. In
particular, the instant invention features small nucleic acid
molecules, such as short interfering nucleic acid (siNA), short
interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA
(miRNA), and short hairpin RNA (shRNA) molecules and methods used
to modulate the expression HD genes. A siRNA molecule of the
instant invention can be, e.g., chemically synthesized, expressed
from a vector or enzymatically synthesized.
[0041] As used herein when a claim indicates an RNA "corresponding
to" it is meant the RNA that has the same sequence as the DNA,
except that uracil is substituted for thymine.
[0042] The present invention further provides a method of
substantially silencing a target gene of interest or targeted
allele for the gene of interest in order to provide a therapeutic
effect. As used herein the term "substantially silencing" or
"substantially silenced" refers to decreasing, reducing, or
inhibiting the expression of the target gene or target allele by at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85% to 100%. As used herein the term
"therapeutic effect" refers to a change in the associated
abnormalities of the disease state, including pathological and
behavioral deficits; a change in the time to progression of the
disease state; a reduction, lessening, or alteration of a symptom
of the disease; or an improvement in the quality of life of the
person afflicted with the disease. Therapeutic effects can be
measured quantitatively by a physician or qualitatively by a
patient afflicted with the disease state targeted by the siRNA. In
certain embodiments wherein both the mutant and wild type allele
are substantially silenced, the term therapeutic effect defines a
condition in which silencing of the wild type allele's expression
does not have a deleterious or harmful effect on normal functions
such that the patient would not have a therapeutic effect.
[0043] In one embodiment, the invention features a method for
treating or preventing Huntington's Disease in a subject or
organism comprising contacting the subject or organism with a siRNA
of the invention under conditions suitable to modulate the
expression of the HD gene in the subject or organism whereby the
treatment or prevention of Huntington's Disease can be achieved. In
one embodiment, the HD gene target comprises both HD allele (e.g.,
an allele comprising a trinucleotide (CAG) repeat expansion and a
wild type allele). The siRNA molecule of the invention can be
expressed from vectors as described herein or otherwise known in
the art to target appropriate tissues or cells in the subject or
organism.
[0044] In one embodiment, the invention features a method for
treating or preventing Huntington's Disease in a subject or
organism comprising, contacting the subject or organism with a
siRNA molecule of the invention via local administration to
relevant tissues or cells, such as brain cells and tissues (e.g.,
basal ganglia, striatum, or cortex), for example, by administration
of vectors or expression cassettes of the invention that provide
siRNA molecules of the invention to relevant cells (e.g., basal
ganglia, striatum, or cortex). In one embodiment, the siRNA,
vector, or expression cassette is administered to the subject or
organism by stereotactic or convection enhanced delivery to the
brain. For example, U.S. Pat. No. 5,720,720 provides methods and
devices useful for stereotactic and convection enhanced delivery of
reagents to the brain. Such methods and devices can be readily used
for the delivery of siRNAs, vectors, or expression cassettes of the
invention to a subject or organism, and is U.S. Pat. No. 5,720,720
is incorporated by reference herein in its entirety. US Patent
Application Nos. 2002/0141980; 2002/0114780; and 2002/0187127 all
provide methods and devices useful for stereotactic and convection
enhanced delivery of reagents that can be readily adapted for
delivery of siRNAs, vectors, or expression cassettes of the
invention to a subject or organism, and are incorporated by
reference herein in their entirety. Particular devices that may be
useful in delivering siRNAs, vectors, or expression cassettes of
the invention to a subject or organism are for example described in
US Patent Application No. 2004/0162255, which is incorporated by
reference herein in its entirety. The siRNA molecule of the
invention can be expressed from vectors as described herein or
otherwise known in the art to target appropriate tissues or cells
in the subject or organism.
[0045] Methods of delivery of viral vectors include, but are not
limited to, intra-arterial, intra-muscular, intravenous, intranasal
and oral routes. Generally, AAV virions may be introduced into
cells of the CNS using either in vivo or in vitro transduction
techniques. If transduced in vitro, the desired recipient cell will
be removed from the subject, transduced with AAV virions and
reintroduced into the subject. Alternatively, syngeneic or
xenogeneic cells can be used where those cells will not generate an
inappropriate immune response in the subject.
[0046] Suitable methods for the delivery and introduction of
transduced cells into a subject have been described. For example,
cells can be transduced in vitro by combining recombinant AAV
virions with CNS cells e.g., in appropriate media, and screening
for those cells harboring the DNA of interest can be screened using
conventional techniques such as Southern blots and/or PCR, or by
using selectable markers. Transduced cells can then be formulated
into pharmaceutical compositions, described more fully below, and
the composition introduced into the subject by various techniques,
such as by grafting, intramuscular, intravenous, subcutaneous and
intraperitoneal injection.
[0047] In one embodiment, for in vivo delivery, AAV virions are
formulated into pharmaceutical compositions and will generally be
administered parenterally, e.g., by intramuscular injection
directly into skeletal or cardiac muscle or by injection into the
CNS.
[0048] In one embodiment, viral vectors of the invention are
delivered to the CNS via convection-enhanced delivery (CED) systems
that can efficiently deliver viral vectors, e.g., AAV, over large
regions of a subject's brain (e.g., striatum and/or cortex). As
described in detail and exemplified below, these methods are
suitable for a variety of viral vectors, for instance AAV vectors
carrying therapeutic genes (e.g., siRNAs).
[0049] Any convection-enhanced delivery device may be appropriate
for delivery of viral vectors. In one embodiment, the device is an
osmotic pump or an infusion pump. Both osmotic and infusion pumps
are commercially available from a variety of suppliers, for example
Alzet Corporation, Hamilton Corporation, Aiza, Inc., Palo Alto,
Calif.). Typically, a viral vector is delivered via CED devices as
follows. A catheter, cannula or other injection device is inserted
into CNS tissue in the chosen subject. In view of the teachings
herein, one of skill in the art could readily determine which
general area of the CNS is an appropriate target. For example, when
delivering AAV vector encoding a therapeutic gene to treat HD, the
striatum is a suitable area of the brain to target. Stereotactic
maps and positioning devices are available, for example from ASI
Instruments, Warren, Mich. Positioning may also be conducted by
using anatomical maps obtained by CT and/or MRI imaging of the
subject's brain to help guide the injection device to the chosen
target. Moreover, because the methods described herein can be
practiced such that relatively large areas of the brain take up the
viral vectors, fewer infusion cannula are needed. Since surgical
complications are related to the number of penetrations, the
methods described herein also serve to reduce the side effects seen
with conventional delivery techniques.
[0050] In one embodiment, pharmaceutical compositions will comprise
sufficient genetic material to produce a therapeutically effective
amount of the siRNA of interest, i.e., an amount sufficient to
reduce or ameliorate symptoms of the disease state in question or
an amount sufficient to confer the desired benefit. The
pharmaceutical compositions may also contain a pharmaceutically
acceptable excipient. Such excipients include any pharmaceutical
agent that does not itself induce the production of antibodies
harmful to the individual receiving the composition, and which may
be administered without undue toxicity. Pharmaceutically acceptable
excipients include, but are not limited to, sorbitol, Tween80, and
liquids such as water, saline, glycerol and ethanol.
Pharmaceutically acceptable salts can be included therein, for
example, mineral acid salts such as hydrochlorides, hydrobromides,
phosphates, sulfates, and the like; and the salts of organic acids
such as acetates, propionates, malonates, benzoates, and the like.
Additionally, auxiliary substances, such as wetting or emulsifying
agents, pH buffering substances, and the like, may be present in
such vehicles. A thorough discussion of pharmaceutically acceptable
excipients is available in REMINGTON'S PHARMACEUTICAL SCIENCES
(Mack Pub. Co., N.J. 1991).
[0051] As is apparent to those skilled in the art in view of the
teachings of this specification, an effective amount of viral
vector which must be added can be empirically determined.
Administration can be effected in one dose, continuously or
intermittently throughout the course of treatment. Methods of
determining the most effective means and dosages of administration
are well known to those of skill in the art and will vary with the
viral vector, the composition of the therapy, the target cells, and
the subject being treated. Single and multiple administrations can
be carried out with the dose level and pattern being selected by
the treating physician.
[0052] It should be understood that more than one transgene could
be expressed by the delivered viral vector. Alternatively, separate
vectors, each expressing one or more different transgenes, can also
be delivered to the CNS as described herein. Furthermore, it is
also intended that the viral vectors delivered by the methods of
the present invention be combined with other suitable compositions
and therapies.
[0053] The present invention further provides an miRNA or shRNA, an
expression cassette and/or a vector as described herein for use in
medical treatment or diagnosis.
[0054] The present invention provides the use of an miRNA or shRNA,
an expression cassette and/or a vector as described herein to
prepare a medicament useful for treating a condition amenable to
RNAi in an animal, e.g., useful for treating Huntington's
Disease.
[0055] The present invention also provides a nucleic acid,
expression cassette, vector, or composition of the invention for
use in therapy.
[0056] The present invention also provides a nucleic acid,
expression cassette, vector, or composition of the invention for
treating, e.g., for use in the prophylactic or therapeutic
treatment of, Huntington's Disease.
BRIEF DESCRIPTION OF THE FIGURES
[0057] FIG. 1. The artificial miRNA, miSCR, causes neurotoxicity in
mouse brain. Wild-type mice were injected into the striatum with
AAV-GFP (expresses GFP only) or AAV-miSCR-GFP (expresses both the
artificial miRNA and GFP), and histological analyses were performed
on brains harvested at 6 months post-treatment. Photomicrographs
representing GFP autofluorescence and immunohistochemical staining
of IbaI-positive microglia are shown. Scale bars=200 and 50 .mu.m
for 10.times. and 40.times. images respectively.
[0058] FIG. 2. Overview of seed-related off-targeting: mechanism
and probabilities. (a) Diagram depicting the expression and
processing of an artificial miRNA (SEQ ID NO: 203) to produce the
mature siRNA duplex (SEQ ID NOs: 204 and 205, respectively, in
order of appearance). The antisense guide strand is loaded into
RISC and may direct on-target silencing (intended) (SEQ ID NOs: 205
and 206, respectively, in order of appearance) and off-target
silencing (unintended) (SEQ ID NOs: 205 and 207, respectively, in
order of appearance). (b) Cartoon highlighting the relationship
between the frequencies of seed complement binding sites in the
3'-UTRome and the off-targeting potential for siRNAs. (c) The
number of human mRNA 3'-UTRs containing a given hexamer was
determined for all of the 4096 possible hexamers and a binned
distribution is shown. The probabilities that randomly selected
siRNAs targeting human coding sequence (CDS) will contain seed
complements in a given range (white and grey shading) are also
presented. For example, there is only a 10% chance that a randomly
selected siRNA contains a seed complement for a hexamer present in
.about.1500 human 3'-UTRs or less. Note: the sequences tested in
this manuscript are placed above their respective ranges.
[0059] FIG. 3. Selection and screening of htt-targeting siRNAs with
low off-targeting potentials. (a) Schematic outlining the selection
of "safe" seed siRNAs with proper strand-biasing. FIG. 3a discloses
SEQ ID NOs: 208-210, respectively, in order of appearance. (b)
Plasmids expressing artificial miRNAs, harboring the indicated
siRNA sequences, were transfected into HEK293 cells, and QPCR
analysis was performed 24 h later to measure endogenous htt mRNA
levels. U6 (promoter-only) and HD2.4 (a previously published htt
RNAi sequence) serve as the negative and positive controls
respectively. Results are shown as mean.+-.SEM (N=6, * indicates
P<0.001, relative to U6).
[0060] FIG. 4. Evaluation of microarray data for htt silencing and
off-targeting. HEK293 cells were transfected with U6 promoter-only
or U6-driven artificial miRNA expression plasmids (n=4 for each
treatment), and RNA was harvested 72 h later for microarray
analysis. Two-way ANOVA was performed to detect differentially
expressed genes among the treatment groups. (a) Htt mRNA levels
determined by microarray (grey bars) were consistent with those
measured by QPCR (black bars) using the same RNA samples. (b)
Hierarchical clustering and heat-maps were generated using
differentially expressed genes (P<0.0001, 825 genes) to
visualize the relationships among the treatment groups.
Interestingly, all of the "safe" seed sequences are more related to
U6 than the remaining sequences predicted to have higher
off-targeting potentials (boundary marked by white line). (c)
Hierarchical clustering and heat-maps were generated using
differentially expressed genes (P<0.01, 992 genes) to visualize
the relationships among the treatment groups. The impact of seed
sequence on gene expression can be appreciated by the clustering of
8.2 and 8.2 mis which share the same seed. Notably, the predicted
low off-targeting sequences (Safe, HDS1 and HDS2) are more similar
to U6, and have smaller off-targeting signatures compared to both
2.4 and 8.2. Seed-related off-targeting was evaluated by cumulative
distribution (d) and motif discovery (e) analyses. (d) Cumulative
distribution plots for gene expression values are shown for
transcripts containing (1 site or 2+ sites) or lacking (baseline)
3'-UTR seed complement binding sites for the indicated sequence and
strand. A shift to the left indicates an increased likelihood of
being down-regulated. AS=antisense, S=sense. KS-test P-values are
shown; N.S.=no statistical significance (P>0.1). (e) Motif
discovery analyses identified an enrichment of seed complement
binding sites in the 3'-UTRs of down-regulated genes (>1.1-fold)
unique to each treatment. Shown here are the examples of 8.2-124a
(SEQ ID NO: 212) and Terror (SEQ ID NO: 211); similar data for the
remaining sequences supports that each mediates detectable
seed-related off-targeting to some degree (see FIG. 6 below).
[0061] FIG. 5. Silencing efficacy and safety of HDS sequences in
mouse brain. Wild-type mice were injected into the striatum with
AAV viruses co-expressing artificial miRNAs and GFP. (a) At 3 weeks
post-injection, GFP-positive striata were harvested and QPCR
analysis was performed to measure endogenous mouse Htt mRNA levels.
Results are shown as mean.+-.SEM (n.gtoreq.3, * indicates P=0.001,
relative to uninjected striata). (b) Brains from additional cohorts
of injected mice were harvested at 6 months post-injection and
histological analyses were performed to assess neurotoxicity.
Photomicrographs representing GFP autofluorescence and
immunohistochemical staining of IbaI-positive microglia are shown.
Scale bars=200 and 50 .mu.m for 10.times. and 40.times. images
respectively.
[0062] FIG. 6. Evaluation of microarray data for off-targeting.
Seed-related off-targeting was evaluated by cumulative distribution
(a) and motif discovery (b) analyses. (a) Cumulative distribution
plots for gene expression values are shown for transcripts
containing (1 site or 2+ sites) or lacking (baseline) 3'-UTR seed
complement binding sites for the indicated sequence and strand. A
shift to the left indicates an increased likelihood of being
down-regulated. AS=antisense. KS-test P-values are shown; N.S.=no
statistical significance (P>0.1). (b) Motif discovery analyses
identified an enrichment of seed complement binding sites in the
3'-UTRs of down-regulated genes (>1.1-fold) unique to each
treatment (SEQ ID NOs: 210 and 213-217, respectively, in order of
appearance).
[0063] FIG. 7. Full-length sequences and structures for
pri-miHDS.1. FIG. 7 discloses SEQ ID NOs: 10, 218, 219 and 210,
respectively, in order of appearance.
[0064] FIG. 8. Full-length sequences and structures for
pri-miHDS.2. FIG. 8 discloses SEQ ID NOs: 11, 220, 221 and 213,
respectively, in order of appearance.
DETAILED DESCRIPTION OF THE INVENTION
[0065] RNA Interference (RNAi) is a process of gene regulation
mediated by small dsRNAs. RNAi is used as a common biological tool
to study gene function, and is under investigation as a therapeutic
to treat various diseases. RNAi delivery or expression can be
through the administration of exogenous siRNAs (transient gene
silencing) or through the administration of vectors expressing
stem-loop RNAs (persistent gene silencing). The absolute
specificity of RNAi is questionable. Issues that must be addressed
include cellular responses to dsRNA (IFN-b, PKR, OAS1) and
off-target effects due to saturation of RNAi machinery or via
partial complementarity with unintended mRNAs. There is an on-going
need for optimizing RNAi vectors and potentially developing
tissue-specific and regulated expression strategies
[0066] The use of RNAi as a therapeutic is dependant upon the
elucidation of several factors including i) the delivery and
persistence of the RNAi construct for effective silencing of the
target gene sequence; ii) the design of the siRNA in order to
achieve effective knock down or gene suppression of the target
sequence, and iii) the optimal siRNA expression system (shRNA or
miRNA) for delivery of the therapeutic siRNA. While many studies
have evaluated the use of RNAi delivered as chemically synthesized
oligonucleotide structures, for many clinical conditions and
disease states such as Huntington's Disease, it is believed that to
achieve therapeutic benefit there is a need for long term and or
persistent high level expression of the therapeutic siRNA as
achieved by endogenous production of expressed siRNA. To date,
shRNA- and artificial miRNA-based strategies have been compared
with conflicting results. The therapeutic utility of expressed RNAi
is unresolved due to safety concerns as a result of off target
toxicity arising from cellular responses to dsRNA (IFN-b, PKR,
OAS1), saturation of RNAi machinery or silencing of off targets via
partial complementarity with unintended mRNAs. Thus, there is an
on-going need for optimizing expressed RNAi vectors that are safe
and effective.
[0067] shRNAs are comprised of stem-loop structures which are
designed to contain a 5' flanking region, siRNA region segments, a
loop region, a 3' siRNA region and a 3' flanking region. Most RNAi
expression strategies have utilized short-hairpin RNAs (shRNAs)
driven by strong polIII-based promoters. Many shRNAs have
demonstrated effective knock down of the target sequences in vitro
as well as in vivo, however, some shRNAs which demonstrated
effective knock down of the target gene were also found to have
toxicity in vivo. A recently discovered alternative approach is the
use of artificial miRNAs (pri-miRNA scaffolds shuttling siRNA
sequences) as RNAi vectors. Artificial miRNAs more naturally
resemble endogenous RNAi substrates and are more amenable to Pol-II
transcription (e.g., allowing tissue-specific expression of RNAi)
and polycistronic strategies (e.g., allowing delivery of multiple
siRNA sequences). To date the efficacy of miRNA based vector
systems compared to shRNA has been confounded by conflicting
results. Importantly, the question of off-target toxicity produced
by the two systems has not been evaluated.
[0068] An important consideration for development of expressed
siRNA is the concept of "dosing" the host cell with the expressed
siRNA construct. "Dosing" for an expressed siRNA in the context of
the present invention refers to and can be dependant on the
delivery vehicle (e.g., viral or nonviral), the relative amounts or
concentration of the delivery vehicle, and the strength and
specificity of the promoter utilized to drive the expression of the
siRNA sequence.
[0069] The inventors have developed artificial miRNA shuttle
vectors that incorporate the stem loop sequences contained in
shRNAs within modifications of a naturally occurring human microRNA
30 sequence or mi30 sequence that serve to shuttle these small
interfering RNA (siRNA) sequences. See, e.g., PCT Publication WO
2008/150897, which is incorporated by reference herein.
[0070] MicroRNA Shuttles for RNAi
[0071] miRNAs are small cellular RNAs (.about.22nt) that are
processed from precursor stem loop transcripts. Known miRNA stem
loops can be modified to contain RNAi sequences specific for genes
of interest. miRNA molecules can be preferable over shRNA molecules
because miRNAs are endogenously expressed. Therefore, miRNA
molecules are unlikely to induce dsRNA-responsive interferon
pathways, they are processed more efficiently than shRNAs, and they
have been shown to silence 80% more effectively.
[0072] Also, the promoter roles are different for miRNA molecules
as compared to shRNA molecules. Tissue-specific, inducible
expression of shRNAs involves truncation of polII promoters to the
transcription start site. In contrast, miRNAs can be expressed from
any polII promoter because the transcription start and stop sites
can be relatively arbitrary.
[0073] Treatment of Huntington's Disease
[0074] The dominant polyglutamine expansion diseases, which include
Spinocerebellar ataxia type 1 (SCA1) and Huntington's disease (HD),
are progressive, untreatable neurodegenerative disorders. In
inducible mouse models HD, repression of mutant allele expression
improves disease phenotypes. Thus, therapies designed to inhibit
disease gene expression would be beneficial. The present invention
provides methods of using RNAi in vivo to treat Huntington's
Disease. "Treating" as used herein refers to ameliorating at least
one symptom of, curing and/or preventing the development of a
disease or a condition.
[0075] In certain embodiment of the invention, RNAi molecules are
employed to inhibit expression of a target gene. By "inhibit
expression" is meant to reduce, diminish or suppress expression of
a target gene. Expression of a target gene may be inhibited via
"gene silencing." Gene silencing refers to the suppression of gene
expression, e.g., transgene, heterologous gene and/or endogenous
gene expression, which may be mediated through processes that
affect transcription and/or through processes that affect
post-transcriptional mechanisms. In some embodiments, gene
silencing occurs when an RNAi molecule initiates the inhibition or
degradation of the mRNA transcribed from a gene of interest in a
sequence-specific manner via RNA interference, thereby preventing
translation of the gene's product.
[0076] The reference to siRNAs herein is meant to include shRNAs
and other small RNAs that can or are capable of modulating the
expression of a targeted gene, e.g., the HD gene, for example via
RNA interference. Such small RNAs include without limitation,
shRNAs and miroRNAs (miRNAs).
[0077] Disclosed herein is a strategy that results in substantial
silencing of targeted genes via RNAi. Use of this strategy results
in markedly diminished in vitro and in vivo expression of targeted
genes. This strategy is useful in reducing expression of targeted
genes in order to model biological processes or to provide therapy
for human diseases. For example, this strategy can be applied to
Huntington's Disease. As used herein the term "substantial
silencing" means that the mRNA of the targeted gene is inhibited
and/or degraded by the presence of the introduced siRNA, such that
expression of the targeted gene is reduced by about 10% to 100% as
compared to the level of expression seen when the siRNA is not
present. Generally, when an gene is substantially silenced, it will
have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at
least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99% or even 100% reduction expression as compared to
when the siRNA is not present. As used herein the term
"substantially normal activity" means the level of expression of a
gene when an siRNA has not been introduced to a cell.
[0078] Huntington disease (HD) is a strong candidate for
siRNA-based therapy. HD is caused by CAG repeat expansions that
encode polyQ in the disease protein. PolyQ expansion confers a
dominant toxic property on the mutant protein that is associated
with aberrant accumulation of the disease protein in neurons. HD is
progressive, ultimately fatal disorders that typically begin in
adulthood. Expansion of the CAG repeat/polyQ domain confers upon
the encoded protein a dominant toxic property. Thus, as a
therapeutic strategy, efforts to lower expression of the mutant
gene product prior to cell death could be highly beneficial to
patients.
[0079] RNA Interference (RNAi) Molecules
[0080] An "RNA interference," "RNAi," "small interfering RNA" or
"short interfering RNA" or "siRNA" or "short hairpin RNA" or
"shRNA" molecule, or "miRNA" is a RNA duplex of nucleotides that is
targeted to a nucleic acid sequence of interest, for example,
huntingtin (htt). As used herein, the term "siRNA" is a generic
term that encompasses the subset of shRNAs and miRNAs. An "RNA
duplex" refers to the structure formed by the complementary pairing
between two regions of a RNA molecule. siRNA is "targeted" to a
gene in that the nucleotide sequence of the duplex portion of the
siRNA is complementary to a nucleotide sequence of the targeted
gene. In certain embodiments, the siRNAs are targeted to the
sequence encoding ataxin-1 or huntingtin. In some embodiments, the
length of the duplex of siRNAs is less than 30 base pairs. In some
embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21,
20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 base pairs in length.
In some embodiments, the length of the duplex is 19 to 25 base
pairs in length. In certain embodiment, the length of the duplex is
19 or 21 base pairs in length. The RNA duplex portion of the siRNA
can be part of a hairpin structure. In addition to the duplex
portion, the hairpin structure may contain a loop portion
positioned between the two sequences that form the duplex. The loop
can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25
nucleotides in length. In certain embodiments, the loop is 18
nucleotides in length. The hairpin structure can also contain 3'
and/or 5' overhang portions. In some embodiments, the overhang is a
3' and/or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in
length.
[0081] The transcriptional unit of a "shRNA" is comprised of sense
and antisense sequences connected by a loop of unpaired
nucleotides. shRNAs are exported from the nucleus by Exportin-5,
and once in the cytoplasm, are processed by Dicer to generate
functional siRNAs. "miRNAs" stem-loops are comprised of sense and
antisense sequences connected by a loop of unpaired nucleotides
typically expressed as part of larger primary transcripts
(pri-miRNAs), which are excised by the Drosha-DGCR8 complex
generating intermediates known as pre-miRNAs, which are
subsequently exported from the nucleus by Exportin-5, and once in
the cytoplasm, are processed by Dicer to generate functional
siRNAs. "Artificial miRNA" or an "artificial miRNA shuttle vector,"
as used herein interchangably, refers to a primary miRNA transcript
that has had a region of the duplex stem loop (at least about 9-20
nucleotides) which is excised via Drosha and Dicer processing
replaced with the siRNA sequences for the target gene while
retaining the structural elements within the stem loop necessary
for effective Drosha processing. The term "artificial" arises from
the fact the flanking sequences (.about.35 nucleotides upstream and
.about.40 nucleotides downstream) arise from restriction enzyme
sites within the multiple cloning site of the siRNA. As used herein
the term "miRNA" encompasses both the naturally occurring miRNA
sequences as well as artificially generated miRNA shuttle
vectors.
[0082] The siRNA can be encoded by a nucleic acid sequence, and the
nucleic acid sequence can also include a promoter. The nucleic acid
sequence can also include a polyadenylation signal. In some
embodiments, the polyadenylation signal is a synthetic minimal
polyadenylation signal or a sequence of six Ts.
[0083] "Off-target toxicity" refers to deleterious, undesirable, or
unintended phenotypic changes of a host cell that expresses or
contains an siRNA. Off-target toxicity may result in loss of
desirable function, gain of non-desirable function, or even death
at the cellular or organismal level. Off-target toxicity may occur
immediately upon expression of the siRNA or may occur gradually
over time. Off-target toxicity may occur as a direct result of the
expression siRNA or may occur as a result of induction of host
immune response to the cell expressing the siRNA. Without wishing
to be bound by theory, off-target toxicity is postulated to arise
from high levels or overabundance of RNAi substrates within the
cell. These overabundant or overexpressed RNAi substrates,
including without limitation pre- or pri RNAi substrates as well as
overabundant mature antisense-RNAs, may compete for endogenous RNAi
machinery, thus disrupting natural miRNA biogenesis and function.
Off-target toxicity may also arise from an increased likelihood of
silencing of unintended mRNAs (i.e., off-target) due to partial
complementarity of the sequence. Off target toxicity may also occur
from improper strand biasing of a non-guide region such that there
is preferential loading of the non-guide region over the targeted
or guide region of the RNAi. Off-target toxicity may also arise
from stimulation of cellular responses to dsRNAs which include
dsRNA (IFN-b, PKR, OAS1). "Decreased off target toxicity" refers to
a decrease, reduction, abrogation or attenuation in off target
toxicity such that the therapeutic effect is more beneficial to the
host than the toxicity is limiting or detrimental as measured by an
improved duration or quality of life or an improved sign or symptom
of a disease or condition being targeted by the siRNA. "Limited off
target toxicity" or "low off target toxicity" is used to refer to
an unintended undesirable phenotypic changes to a cell or organism,
whether detectable or not, that does not preclude or outweigh or
limit the therapeutic benefit to the host treated with the siRNA
and may be considered a "side effect" of the therapy. Decreased or
limited off target toxicity may be determined or inferred by
comparing the in vitro analysis such as Northern blot or QPCR for
the levels of siRNA substrates or the in vivo effects comparing an
equivalent shRNA vector to the miRNA shuttle vector of the present
invention.
[0084] "Knock-down," "knock-down technology" refers to a technique
of gene silencing in which the expression of a target gene is
reduced as compared to the gene expression prior to the
introduction of the siRNA, which can lead to the inhibition of
production of the target gene product. The term "reduced" is used
herein to indicate that the target gene expression is lowered by
1-100%. In other words, the amount of RNA available for translation
into a polypeptide or protein is minimized. For example, the amount
of protein may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90,
95, or 99%. In some embodiments, the expression is reduced by about
90% (i.e., only about 10% of the amount of protein is observed a
cell as compared to a cell where siRNA molecules have not been
administered). Knock-down of gene expression can be directed by the
use of dsRNAs or siRNAs.
[0085] "RNA interference (RNAi)" is the process of
sequence-specific, post-transcriptional gene silencing initiated by
siRNA. During RNAi, siRNA induces degradation of target mRNA with
consequent sequence-specific inhibition of gene expression.
[0086] According to a method of the present invention, the
expression of huntingtin can be modified via RNAi. For example, the
accumulation of huntingtin can be suppressed in a cell. The term
"suppressing" refers to the diminution, reduction or elimination in
the number or amount of transcripts present in a particular cell.
For example, the accumulation of mRNA encoding huntingtin can be
suppressed in a cell by RNA interference (RNAi), e.g., the gene is
silenced by sequence-specific double-stranded RNA (dsRNA), which is
also called short interfering RNA (siRNA). These siRNAs can be two
separate RNA molecules that have hybridized together, or they may
be a single hairpin wherein two portions of a RNA molecule have
hybridized together to form a duplex.
[0087] A mutant protein refers to the protein encoded by a gene
having a mutation, e.g., a missense or nonsense mutation in
huntingtin. A mutant huntingtin may be disease-causing, i.e., may
lead to a disease associated with the presence of huntingtin in an
animal having either one or two mutant allele(s).
[0088] The term "gene" is used broadly to refer to any segment of
nucleic acid associated with a biological function. Thus, genes
include coding sequences and/or the regulatory sequences required
for their expression. For example, "gene" refers to a nucleic acid
fragment that expresses mRNA, functional RNA, or specific protein,
including regulatory sequences. "Genes" also include nonexpressed
DNA segments that, for example, form recognition sequences for
other proteins. "Genes" can be obtained from a variety of sources,
including cloning from a source of interest or synthesizing from
known or predicted sequence information, and may include sequences
designed to have desired parameters. An "allele" is one of several
alternative forms of a gene occupying a given locus on a
chromosome.
[0089] The term "nucleic acid" refers to deoxyribonucleic acid
(DNA) or ribonucleic acid (RNA) and polymers thereof in either
single- or double-stranded form, composed of monomers (nucleotides)
containing a sugar, phosphate and a base that is either a purine or
pyrimidine. Unless specifically limited, the term encompasses
nucleic acids containing known analogs of natural nucleotides that
have similar binding properties as the reference nucleic acid and
are metabolized in a manner similar to naturally occurring
nucleotides. Unless otherwise indicated, a particular nucleic acid
sequence also encompasses conservatively modified variants thereof
(e.g., degenerate codon substitutions) and complementary sequences,
as well as the sequence explicitly indicated. Specifically,
degenerate codon substitutions may be achieved by generating
sequences in which the third position of one or more selected (or
all) codons is substituted with mixed-base and/or deoxyinosine
residues. A "nucleic acid fragment" is a portion of a given nucleic
acid molecule.
[0090] A "nucleotide sequence" is a polymer of DNA or RNA that can
be single-stranded or double-stranded, optionally containing
synthetic, non-natural or altered nucleotide bases capable of
incorporation into DNA or RNA polymers.
[0091] The terms "nucleic acid," "nucleic acid molecule," "nucleic
acid fragment," "nucleic acid sequence or segment," or
"polynucleotide" are used interchangeably and may also be used
interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
[0092] The invention encompasses isolated or substantially purified
nucleic acid nucleic acid molecules and compositions containing
those molecules. In the context of the present invention, an
"isolated" or "purified" DNA molecule or RNA molecule is a DNA
molecule or RNA molecule that exists apart from its native
environment and is therefore not a product of nature. An isolated
DNA molecule or RNA molecule may exist in a purified form or may
exist in a non-native environment such as, for example, a
transgenic host cell. For example, an "isolated" or "purified"
nucleic acid molecule or biologically active portion thereof, is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
In one embodiment, an "isolated" nucleic acid is free of sequences
that naturally flank the nucleic acid (i.e., sequences located at
the 5' and 3' ends of the nucleic acid) in the genomic DNA of the
organism from which the nucleic acid is derived. For example, in
various embodiments, the isolated nucleic acid molecule can contain
less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequences that naturally flank the nucleic acid molecule
in genomic DNA of the cell from which the nucleic acid is derived.
Fragments and variants of the disclosed nucleotide sequences are
also encompassed by the present invention. By "fragment" or
"portion" is meant a full length or less than full length of the
nucleotide sequence.
[0093] "Naturally occurring," "native," or "wild-type" is used to
describe an object that can be found in nature as distinct from
being artificially produced. For example, a protein or nucleotide
sequence present in an organism (including a virus), which can be
isolated from a source in nature and that has not been
intentionally modified by a person in the laboratory, is naturally
occurring.
[0094] A "variant" of a molecule is a sequence that is
substantially similar to the sequence of the native molecule. For
nucleotide sequences, variants include those sequences that,
because of the degeneracy of the genetic code, encode the identical
amino acid sequence of the native protein. Naturally occurring
allelic variants such as these can be identified with the use of
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques. Variant
nucleotide sequences also include synthetically derived nucleotide
sequences, such as those generated, for example, by using
site-directed mutagenesis, which encode the native protein, as well
as those that encode a polypeptide having amino acid substitutions.
Generally, nucleotide sequence variants of the invention will have
at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least
85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, to 98%, sequence identity to the native (endogenous)
nucleotide sequence.
[0095] A "transgene" refers to a gene that has been introduced into
the genome by transformation. Transgenes include, for example, DNA
that is either heterologous or homologous to the DNA of a
particular cell to be transformed. Additionally, transgenes may
include native genes inserted into a non-native organism, or
chimeric genes.
[0096] The term "endogenous gene" refers to a native gene in its
natural location in the genome of an organism.
[0097] The terms "protein," "peptide" and "polypeptide" are used
interchangeably herein.
[0098] "Wild-type" refers to the normal gene or organism found in
nature.
[0099] "Genome" refers to the complete genetic material of an
organism.
[0100] A "vector" is defined to include, inter alia, any viral
vector, as well as any plasmid, cosmid, phage or binary vector in
double or single stranded linear or circular form that may or may
not be self transmissible or mobilisable, and that can transform
prokaryotic or eukaryotic host either by integration into the
cellular genome or exist extrachromosomally (e.g., autonomous
replicating plasmid with an origin of replication).
[0101] "Expression cassette" as used herein means a nucleic acid
sequence capable of directing expression of a particular nucleotide
sequence in an appropriate host cell, which may include a promoter
operably linked to the nucleotide sequence of interest that may be
operably linked to termination signals. The coding region usually
codes for a functional RNA of interest, for example an siRNA. The
expression cassette including the nucleotide sequence of interest
may be chimeric. The expression cassette may also be one that is
naturally occurring but has been obtained in a recombinant form
useful for heterologous expression. The expression of the
nucleotide sequence in the expression cassette may be under the
control of a constitutive promoter or of a regulatable promoter
that initiates transcription only when the host cell is exposed to
some particular stimulus. In the case of a multicellular organism,
the promoter can also be specific to a particular tissue or organ
or stage of development.
[0102] Such expression cassettes can include a transcriptional
initiation region linked to a nucleotide sequence of interest. Such
an expression cassette is provided with a plurality of restriction
sites for insertion of the gene of interest to be under the
transcriptional regulation of the regulatory regions. The
expression cassette may additionally contain selectable marker
genes.
[0103] "Coding sequence" refers to a DNA or RNA sequence that codes
for a specific amino acid sequence. It may constitute an
"uninterrupted coding sequence," i.e., lacking an intron, such as
in a cDNA, or it may include one or more introns bounded by
appropriate splice junctions. An "intron" is a sequence of RNA that
is contained in the primary transcript but is removed through
cleavage and re-ligation of the RNA within the cell to create the
mature mRNA that can be translated into a protein.
[0104] The term "open reading frame" (ORF) refers to the sequence
between translation initiation and termination codons of a coding
sequence. The terms "initiation codon" and "termination codon"
refer to a unit of three adjacent nucleotides (a `codon`) in a
coding sequence that specifies initiation and chain termination,
respectively, of protein synthesis (mRNA translation).
[0105] "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme RNA, siRNA, or other RNA that may not be translated but
yet has an effect on at least one cellular process.
[0106] The term "RNA transcript" or "transcript" refers to the
product resulting from RNA polymerase catalyzed transcription of a
DNA sequence. When the RNA transcript is a perfect complementary
copy of the DNA sequence, it is referred to as the primary
transcript or it may be a RNA sequence derived from
posttranscriptional processing of the primary transcript and is
referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the
RNA that is without introns and that can be translated into protein
by the cell.
[0107] "cDNA" refers to a single- or a double-stranded DNA that is
complementary to and derived from mRNA.
[0108] "Regulatory sequences" are nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences include enhancers,
promoters, translation leader sequences, introns, and
polyadenylation signal sequences. They include natural and
synthetic sequences as well as sequences that may be a combination
of synthetic and natural sequences. As is noted herein, the term
"suitable regulatory sequences" is not limited to promoters.
However, some suitable regulatory sequences useful in the present
invention will include, but are not limited to constitutive
promoters, tissue-specific promoters, development-specific
promoters, regulatable promoters and viral promoters.
[0109] "5' non-coding sequence" refers to a nucleotide sequence
located 5' (upstream) to the coding sequence. It is present in the
fully processed mRNA upstream of the initiation codon and may
affect processing of the primary transcript to mRNA, mRNA stability
or translation efficiency.
[0110] "3' non-coding sequence" refers to nucleotide sequences
located 3' (downstream) to a coding sequence and may include
polyadenylation signal sequences and other sequences encoding
regulatory signals capable of affecting mRNA processing or gene
expression. The polyadenylation signal is usually characterized by
affecting the addition of polyadenylic acid tracts to the 3' end of
the mRNA precursor.
[0111] The term "translation leader sequence" refers to that DNA
sequence portion of a gene between the promoter and coding sequence
that is transcribed into RNA and is present in the fully processed
mRNA upstream (5') of the translation start codon. The translation
leader sequence may affect processing of the primary transcript to
mRNA, mRNA stability or translation efficiency.
[0112] The term "mature" protein refers to a post-translationally
processed polypeptide without its signal peptide. "Precursor"
protein refers to the primary product of translation of an mRNA.
"Signal peptide" refers to the amino terminal extension of a
polypeptide, which is translated in conjunction with the
polypeptide forming a precursor peptide and which is required for
its entrance into the secretory pathway. The term "signal sequence"
refers to a nucleotide sequence that encodes the signal
peptide.
[0113] "Promoter" refers to a nucleotide sequence, usually upstream
(5') to its coding sequence, which directs and/or controls the
expression of the coding sequence by providing the recognition for
RNA polymerase and other factors required for proper transcription.
"Promoter" includes a minimal promoter that is a short DNA sequence
comprised of a TATA-box and other sequences that serve to specify
the site of transcription initiation, to which regulatory elements
are added for control of expression. "Promoter" also refers to a
nucleotide sequence that includes a minimal promoter plus
regulatory elements that is capable of controlling the expression
of a coding sequence or functional RNA. This type of promoter
sequence consists of proximal and more distal upstream elements,
the latter elements often referred to as enhancers. Accordingly, an
"enhancer" is a DNA sequence that can stimulate promoter activity
and may be an innate element of the promoter or a heterologous
element inserted to enhance the level or tissue specificity of a
promoter. It is capable of operating in both orientations (normal
or flipped), and is capable of functioning even when moved either
upstream or downstream from the promoter. Both enhancers and other
upstream promoter elements bind sequence-specific DNA-binding
proteins that mediate their effects. Promoters may be derived in
their entirety from a native gene, or be composed of different
elements derived from different promoters found in nature, or even
be comprised of synthetic DNA segments. A promoter may also contain
DNA sequences that are involved in the binding of protein factors
that control the effectiveness of transcription initiation in
response to physiological or developmental conditions. Examples of
promoters that may be used in the present invention include the
mouse U6 RNA promoters, synthetic human H1RNA promoters, SV40, CMV,
RSV, RNA polymerase II and RNA polymerase III promoters.
[0114] The "initiation site" is the position surrounding the first
nucleotide that is part of the transcribed sequence, which is also
defined as position +1. With respect to this site all other
sequences of the gene and its controlling regions are numbered.
Downstream sequences (i.e., further protein encoding sequences in
the 3' direction) are denominated positive, while upstream
sequences (mostly of the controlling regions in the 5' direction)
are denominated negative.
[0115] Promoter elements, particularly a TATA element, that are
inactive or that have greatly reduced promoter activity in the
absence of upstream activation are referred to as "minimal or core
promoters." In the presence of a suitable transcription factor, the
minimal promoter functions to permit transcription. A "minimal or
core promoter" thus consists only of all basal elements needed for
transcription initiation, e.g., a TATA box and/or an initiator.
[0116] "Constitutive expression" refers to expression using a
constitutive or regulated promoter. "Conditional" and "regulated
expression" refer to expression controlled by a regulated
promoter.
[0117] "Operably-linked" refers to the association of nucleic acid
sequences on single nucleic acid fragment so that the function of
one of the sequences is affected by another. For example, a
regulatory DNA sequence is said to be "operably linked to" or
"associated with" a DNA sequence that codes for an RNA or a
polypeptide if the two sequences are situated such that the
regulatory DNA sequence affects expression of the coding DNA
sequence (i.e., that the coding sequence or functional RNA is under
the transcriptional control of the promoter). Coding sequences can
be operably-linked to regulatory sequences in sense or antisense
orientation.
[0118] "Expression" refers to the transcription and/or translation
of an endogenous gene, heterologous gene or nucleic acid segment,
or a transgene in cells. For example, in the case of siRNA
constructs, expression may refer to the transcription of the siRNA
only. In addition, expression refers to the transcription and
stable accumulation of sense (mRNA) or functional RNA. Expression
may also refer to the production of protein.
[0119] "Altered levels" refers to the level of expression in
transgenic cells or organisms that differs from that of normal or
untransformed cells or organisms.
[0120] "Overexpression" refers to the level of expression in
transgenic cells or organisms that exceeds levels of expression in
normal or untransformed cells or organisms.
[0121] "Antisense inhibition" refers to the production of antisense
RNA transcripts capable of suppressing the expression of protein
from an endogenous gene or a transgene.
[0122] "Transcription stop fragment" refers to nucleotide sequences
that contain one or more regulatory signals, such as
polyadenylation signal sequences, capable of terminating
transcription. Examples include the 3' non-regulatory regions of
genes encoding nopaline synthase and the small subunit of ribulose
bisphosphate carboxylase.
[0123] "Translation stop fragment" refers to nucleotide sequences
that contain one or more regulatory signals, such as one or more
termination codons in all three frames, capable of terminating
translation. Insertion of a translation stop fragment adjacent to
or near the initiation codon at the 5' end of the coding sequence
will result in no translation or improper translation. Excision of
the translation stop fragment by site-specific recombination will
leave a site-specific sequence in the coding sequence that does not
interfere with proper translation using the initiation codon.
[0124] The terms "cis-acting sequence" and "cis-acting element"
refer to DNA or RNA sequences whose functions require them to be on
the same molecule. An example of a cis-acting sequence on the
replicon is the viral replication origin.
[0125] The terms "trans-acting sequence" and "trans-acting element"
refer to DNA or RNA sequences whose function does not require them
to be on the same molecule.
[0126] "Chromosomally-integrated" refers to the integration of a
foreign gene or nucleic acid construct into the host DNA by
covalent bonds. Where genes are not "chromosomally integrated" they
may be "transiently expressed." Transient expression of a gene
refers to the expression of a gene that is not integrated into the
host chromosome but functions independently, either as part of an
autonomously replicating plasmid or expression cassette, for
example, or as part of another biological system such as a
virus.
[0127] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence," (b) "comparison window," (c) "sequence
identity," (d) "percentage of sequence identity," and (e)
"substantial identity."
[0128] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0129] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0130] Methods of alignment of sequences for comparison are
well-known in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm.
[0131] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters.
[0132] Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information. This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold. These initial neighborhood word hits act as seeds for
initiating searches to find longer HSPs containing them. The word
hits are then extended in both directions along each sequence for
as far as the cumulative alignment score can be increased.
Cumulative scores are calculated using, for nucleotide sequences,
the parameters M (reward score for a pair of matching residues;
always>0) and N (penalty score for mismatching residues;
always<0). For amino acid sequences, a scoring matrix is used to
calculate the cumulative score. Extension of the word hits in each
direction are halted when the cumulative alignment score falls off
by the quantity X from its maximum achieved value, the cumulative
score goes to zero or below due to the accumulation of one or more
negative-scoring residue alignments, or the end of either sequence
is reached.
[0133] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences. One measure of similarity
provided by the BLAST algorithm is the smallest sum probability
(P(N)), which provides an indication of the probability by which a
match between two nucleotide sequences would occur by chance. For
example, a test nucleic acid sequence is considered similar to a
reference sequence if the smallest sum probability in a comparison
of the test nucleic acid sequence to the reference nucleic acid
sequence is less than about 0.1, more preferably less than about
0.01, and most preferably less than about 0.001.
[0134] To obtain gapped alignments for comparison purposes, Gapped
BLAST (in BLAST 2.0) can be utilized. Alternatively, PSI-BLAST (in
BLAST 2.0) can be used to perform an iterated search that detects
distant relationships between molecules. When utilizing BLAST,
Gapped BLAST, PSI-BLAST, the default parameters of the respective
programs (e.g. BLASTN for nucleotide sequences) can be used. The
BLASTN program (for nucleotide sequences) uses as defaults a
wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100,
M=5, N=-4, and a comparison of both strands. Alignment may also be
performed manually by inspection.
[0135] For purposes of the present invention, comparison of
nucleotide sequences for determination of percent sequence identity
to the promoter sequences disclosed herein is preferably made using
the BlastN program (version 1.4.7 or later) with its default
parameters or any equivalent program. By "equivalent program" is
intended any sequence comparison program that, for any two
sequences in question, generates an alignment having identical
nucleotide matches and an identical percent sequence identity when
compared to the corresponding alignment generated by the preferred
program.
[0136] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid sequences makes reference to a
specified percentage of nucleotides in the two sequences that are
the same when aligned for maximum correspondence over a specified
comparison window, as measured by sequence comparison algorithms or
by visual inspection.
[0137] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0138] (e) The term "substantial identity" of polynucleotide
sequences means that a polynucleotide comprises a sequence that has
at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%,
preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or
89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most
preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity,
compared to a reference sequence using one of the alignment
programs described using standard parameters.
[0139] Another indication that nucleotide sequences are
substantially identical is if two molecules hybridize to each other
under stringent conditions. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength
and pH. However, stringent conditions encompass temperatures in the
range of about 1.degree. C. to about 20.degree. C., depending upon
the desired degree of stringency as otherwise qualified herein.
[0140] For sequence comparison, typically one sequence acts as a
reference sequence to which test sequences are compared. When using
a sequence comparison algorithm, test and reference sequences are
input into a computer, subsequence coordinates are designated if
necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0141] As noted herein, another indication that two nucleic acid
sequences are substantially identical is that the two molecules
hybridize to each other under stringent conditions. The phrase
"hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence
under stringent conditions when that sequence is present in a
complex mixture (e.g., total cellular) DNA or RNA. "Bind(s)
substantially" refers to complementary hybridization between a
probe nucleic acid and a target nucleic acid and embraces minor
mismatches that can be accommodated by reducing the stringency of
the hybridization media to achieve the desired detection of the
target nucleic acid sequence.
[0142] "Stringent hybridization conditions" and "stringent
hybridization wash conditions" in the context of nucleic acid
hybridization experiments such as Southern and Northern
hybridizations are sequence dependent, and are different under
different environmental parameters. Longer sequences hybridize
specifically at higher temperatures. The Tm is the temperature
(under defined ionic strength and pH) at which 50% of the target
sequence hybridizes to a perfectly matched probe. Specificity is
typically the function of post-hybridization washes, the critical
factors being the ionic strength and temperature of the final wash
solution. For DNA-DNA hybrids, the Tm can be approximated from the
equation: Tm 81.5.degree. C.+16.6 (log M)+0.41 (% GC)-0.61 (%
form)-500/L; where M is the molarity of monovalent cations, % GC is
the percentage of guanosine and cytosine nucleotides in the DNA, %
form is the percentage of formamide in the hybridization solution,
and L is the length of the hybrid in base pairs. Tm is reduced by
about 1.degree. C. for each 1% of mismatching; thus, Tm,
hybridization, and/or wash conditions can be adjusted to hybridize
to sequences of the desired identity. For example, if sequences
with >90% identity are sought, the Tm can be decreased
10.degree. C. Generally, stringent conditions are selected to be
about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence and its complement at a defined ionic
strength and pH. However, severely stringent conditions can utilize
a hybridization and/or wash at 1, 2, 3, or 4.degree. C. lower than
the thermal melting point (Tm); moderately stringent conditions can
utilize a hybridization and/or wash at 6, 7, 8, 9, or 10.degree. C.
lower than the thermal melting point (Tm); low stringency
conditions can utilize a hybridization and/or wash at 11, 12, 13,
14, 15, or 20.degree. C. lower than the thermal melting point (Tm).
Using the equation, hybridization and wash compositions, and
desired T, those of ordinary skill will understand that variations
in the stringency of hybridization and/or wash solutions are
inherently described. If the desired degree of mismatching results
in a T of less than 45.degree. C. (aqueous solution) or 32.degree.
C. (formamide solution), it is preferred to increase the SSC
concentration so that a higher temperature can be used. Generally,
highly stringent hybridization and wash conditions are selected to
be about 5.degree. C. lower than the thermal melting point (Tm) for
the specific sequence at a defined ionic strength and pH.
[0143] An example of highly stringent wash conditions is 0.15 M
NaCl at 72.degree. C. for about 15 minutes. An example of stringent
wash conditions is a 0.2.times.SSC wash at 65.degree. C. for 15
minutes (see, Sambrook and Russell 2001, for a description of SSC
buffer). Often, a high stringency wash is preceded by a low
stringency wash to remove background probe signal. For short
nucleic acid sequences (e.g., about 10 to 50 nucleotides),
stringent conditions typically involve salt concentrations of less
than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion
concentration (or other salts) at pH 7.0 to 8.3, and the
temperature is typically at least about 30.degree. C. Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. In general, a signal to noise ratio of
2.times. (or higher) than that observed for an unrelated probe in
the particular hybridization assay indicates detection of a
specific hybridization. Very stringent conditions are selected to
be equal to the Tm for a particular nucleic acid molecule.
[0144] Very stringent conditions are selected to be equal to the
T.sub.m for a particular probe. An example of stringent conditions
for hybridization of complementary nucleic acids which have more
than 100 complementary residues on a filter in a Southern or
Northern blot is 50% formamide, e.g., hybridization in 50%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C.
[0145] The term "transformation" refers to the transfer of a
nucleic acid fragment into the genome of a host cell, resulting in
genetically stable inheritance. A "host cell" is a cell that has
been transformed, or is capable of transformation, by an exogenous
nucleic acid molecule. Host cells containing the transformed
nucleic acid fragments are referred to as "transgenic" cells.
[0146] "Transformed," "transduced," "transgenic" and "recombinant"
refer to a host cell into which a heterologous nucleic acid
molecule has been introduced. As used herein the term
"transfection" refers to the delivery of DNA into eukaryotic (e.g.,
mammalian) cells. The term "transformation" is used herein to refer
to delivery of DNA into prokaryotic (e.g., E. coli) cells. The term
"transduction" is used herein to refer to infecting cells with
viral particles. The nucleic acid molecule can be stably integrated
into the genome generally known in the art. Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers, partially
mismatched primers, and the like. For example, "transformed,"
"transformant," and "transgenic" cells have been through the
transformation process and contain a foreign gene integrated into
their chromosome. The term "untransformed" refers to normal cells
that have not been through the transformation process.
[0147] "Genetically altered cells" denotes cells which have been
modified by the introduction of recombinant or heterologous nucleic
acids (e.g., one or more DNA constructs or their RNA counterparts)
and further includes the progeny of such cells which retain part or
all of such genetic modification.
[0148] As used herein, the term "derived" or "directed to" with
respect to a nucleotide molecule means that the molecule has
complementary sequence identity to a particular molecule of
interest.
[0149] The siRNAs of the present invention can be generated by any
method known to the art, for example, by in vitro transcription,
recombinantly, or by synthetic means. In one example, the siRNAs
can be generated in vitro by using a recombinant enzyme, such as T7
RNA polymerase, and DNA oligonucleotide templates.
[0150] Nucleic Acid Molecules of the Invention
[0151] The terms "isolated and/or purified" refer to in vitro
isolation of a nucleic acid, e.g., a DNA or RNA molecule from its
natural cellular environment, and from association with other
components of the cell, such as nucleic acid or polypeptide, so
that it can be sequenced, replicated, and/or expressed. The RNA or
DNA is "isolated" in that it is free from at least one
contaminating nucleic acid with which it is normally associated in
the natural source of the RNA or DNA and is preferably
substantially free of any other mammalian RNA or DNA. The phrase
"free from at least one contaminating source nucleic acid with
which it is normally associated" includes the case where the
nucleic acid is reintroduced into the source or natural cell but is
in a different chromosomal location or is otherwise flanked by
nucleic acid sequences not normally found in the source cell, e.g.,
in a vector or plasmid.
[0152] In addition to a DNA sequence encoding a siRNA, the nucleic
acid molecules of the invention include double-stranded interfering
RNA molecules, which are also useful to inhibit expression of a
target gene.
[0153] As used herein, the term "recombinant nucleic acid", e.g.,
"recombinant DNA sequence or segment" refers to a nucleic acid,
e.g., to DNA, that has been derived or isolated from any
appropriate cellular source, that may be subsequently chemically
altered in vitro, so that its sequence is not naturally occurring,
or corresponds to naturally occurring sequences that are not
positioned as they would be positioned in a genome which has not
been transformed with exogenous DNA. An example of preselected DNA
"derived" from a source would be a DNA sequence that is identified
as a useful fragment within a given organism, and which is then
chemically synthesized in essentially pure form. An example of such
DNA "isolated" from a source would be a useful DNA sequence that is
excised or removed from a source by chemical means, e.g., by the
use of restriction endonucleases, so that it can be further
manipulated, e.g., amplified, for use in the invention, by the
methodology of genetic engineering. "Recombinant DNA" includes
completely synthetic DNA sequences, semi-synthetic DNA sequences,
DNA sequences isolated from biological sources, and DNA sequences
derived from RNA, as well as mixtures thereof.
[0154] Expression Cassettes of the Invention
[0155] To prepare expression cassettes, the recombinant DNA
sequence or segment may be circular or linear, double-stranded or
single-stranded. Generally, the DNA sequence or segment is in the
form of chimeric DNA, such as plasmid DNA or a vector that can also
contain coding regions flanked by control sequences that promote
the expression of the recombinant DNA present in the resultant
transformed cell.
[0156] A "chimeric" vector or expression cassette, as used herein,
means a vector or cassette including nucleic acid sequences from at
least two different species, or has a nucleic acid sequence from
the same species that is linked or associated in a manner that does
not occur in the "native" or wild type of the species.
[0157] Aside from recombinant DNA sequences that serve as
transcription units for an RNA transcript, or portions thereof, a
portion of the recombinant DNA may be untranscribed, serving a
regulatory or a structural function. For example, the recombinant
DNA may have a promoter that is active in mammalian cells.
[0158] Other elements functional in the host cells, such as
introns, enhancers, polyadenylation sequences and the like, may
also be a part of the recombinant DNA. Such elements may or may not
be necessary for the function of the DNA, but may provide improved
expression of the DNA by affecting transcription, stability of the
siRNA, or the like. Such elements may be included in the DNA as
desired to obtain the optimal performance of the siRNA in the
cell.
[0159] Control sequences are DNA sequences necessary for the
expression of an operably linked coding sequence in a particular
host organism. The control sequences that are suitable for
prokaryotic cells, for example, include a promoter, and optionally
an operator sequence, and a ribosome binding site. Eukaryotic cells
are known to utilize promoters, polyadenylation signals, and
enhancers.
[0160] Operably linked nucleic acids are nucleic acids placed in a
functional relationship with another nucleic acid sequence. For
example, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence; or a
ribosome binding site is operably linked to a coding sequence if it
is positioned so as to facilitate translation. Generally, operably
linked DNA sequences are DNA sequences that are linked are
contiguous. However, enhancers do not have to be contiguous.
Linking is accomplished by ligation at convenient restriction
sites. If such sites do not exist, the synthetic oligonucleotide
adaptors or linkers are used in accord with conventional
practice.
[0161] The recombinant DNA to be introduced into the cells may
contain either a selectable marker gene or a reporter gene or both
to facilitate identification and selection of expressing cells from
the population of cells sought to be transfected or infected
through viral vectors. In other embodiments, the selectable marker
may be carried on a separate piece of DNA and used in a
co-transfection procedure. Both selectable markers and reporter
genes may be flanked with appropriate regulatory sequences to
enable expression in the host cells. Useful selectable markers are
known in the art and include, for example, antibiotic-resistance
genes, such as neo and the like.
[0162] Reporter genes are used for identifying potentially
transfected cells and for evaluating the functionality of
regulatory sequences. Reporter genes that encode for easily
assayable proteins are well known in the art. In general, a
reporter gene is a gene that is not present in or expressed by the
recipient organism or tissue and that encodes a protein whose
expression is manifested by some easily detectable property, e.g.,
enzymatic activity. For example, reporter genes include the
chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli
and the luciferase gene from firefly Photinus pyralis. Expression
of the reporter gene is assayed at a suitable time after the DNA
has been introduced into the recipient cells.
[0163] The general methods for constructing recombinant DNA that
can transfect target cells are well known to those skilled in the
art, and the same compositions and methods of construction may be
utilized to produce the DNA useful herein.
[0164] The recombinant DNA can be readily introduced into the host
cells, e.g., mammalian, bacterial, yeast or insect cells by
transfection with an expression vector composed of DNA encoding the
siRNA by any procedure useful for the introduction into a
particular cell, e.g., physical or biological methods, to yield a
cell having the recombinant DNA stably integrated into its genome
or existing as a episomal element, so that the DNA molecules, or
sequences of the present invention are expressed by the host cell.
Preferably, the DNA is introduced into host cells via a vector. The
host cell is preferably of eukaryotic origin, e.g., plant,
mammalian, insect, yeast or fungal sources, but host cells of
non-eukaryotic origin may also be employed.
[0165] Physical methods to introduce a preselected DNA into a host
cell include calcium phosphate precipitation, lipofection, particle
bombardment, microinjection, electroporation, and the like.
Biological methods to introduce the DNA of interest into a host
cell include the use of DNA and RNA viral vectors. For mammalian
gene therapy, as described herein below, it is desirable to use an
efficient means of inserting a copy gene into the host genome.
Viral vectors, and especially retroviral vectors, have become the
most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from poxviruses,
herpes simplex virus I, adenoviruses and adeno-associated viruses,
and the like. See, for example, U.S. Pat. Nos. 5,350,674 and
5,585,362.
[0166] As discussed herein, a "transfected" "or "transduced" host
cell or cell line is one in which the genome has been altered or
augmented by the presence of at least one heterologous or
recombinant nucleic acid sequence. The host cells of the present
invention are typically produced by transfection with a DNA
sequence in a plasmid expression vector, a viral expression vector,
or as an isolated linear DNA sequence. The transfected DNA can
become a chromosomally integrated recombinant DNA sequence, which
is composed of sequence encoding the siRNA.
[0167] To confirm the presence of the recombinant DNA sequence in
the host cell, a variety of assays may be performed. Such assays
include, for example, "molecular biological" assays well known to
those of skill in the art, such as Southern and Northern blotting,
RT-PCR and PCR; "biochemical" assays, such as detecting the
presence or absence of a particular peptide, e.g., by immunological
means (ELISAs and Western blots) or by assays described herein to
identify agents falling within the scope of the invention.
[0168] To detect and quantitate RNA produced from introduced
recombinant DNA segments, RT-PCR may be employed. In this
application of PCR, it is first necessary to reverse transcribe RNA
into DNA, using enzymes such as reverse transcriptase, and then
through the use of conventional PCR techniques amplify the DNA. In
most instances PCR techniques, while useful, will not demonstrate
integrity of the RNA product. Further information about the nature
of the RNA product may be obtained by Northern blotting. This
technique demonstrates the presence of an RNA species and gives
information about the integrity of that RNA. The presence or
absence of an RNA species can also be determined using dot or slot
blot Northern hybridizations. These techniques are modifications of
Northern blotting and only demonstrate the presence or absence of
an RNA species.
[0169] While Southern blotting and PCR may be used to detect the
recombinant DNA segment in question, they do not provide
information as to whether the preselected DNA segment is being
expressed. Expression may be evaluated by specifically identifying
the peptide products of the introduced recombinant DNA sequences or
evaluating the phenotypic changes brought about by the expression
of the introduced recombinant DNA segment in the host cell.
[0170] The instant invention provides a cell expression system for
expressing exogenous nucleic acid material in a mammalian
recipient. The expression system, also referred to as a
"genetically modified cell," comprises a cell and an expression
vector for expressing the exogenous nucleic acid material. The
genetically modified cells are suitable for administration to a
mammalian recipient, where they replace the endogenous cells of the
recipient. Thus, the preferred genetically modified cells are
non-immortalized and are non-tumorigenic.
[0171] According to one embodiment, the cells are transfected or
otherwise genetically modified ex vivo. The cells are isolated from
a mammal (preferably a human), nucleic acid introduced (i.e.,
transduced or transfected in vitro) with a vector for expressing a
heterologous (e.g., recombinant) gene encoding the therapeutic
agent, and then administered to a mammalian recipient for delivery
of the therapeutic agent in situ. The mammalian recipient may be a
human and the cells to be modified are autologous cells, i.e., the
cells are isolated from the mammalian recipient.
[0172] According to another embodiment, the cells are transfected
or transduced or otherwise genetically modified in vivo. The cells
from the mammalian recipient are transduced or transfected in vivo
with a vector containing exogenous nucleic acid material for
expressing a heterologous (e.g., recombinant) gene encoding a
therapeutic agent and the therapeutic agent is delivered in
situ.
[0173] As used herein, "exogenous nucleic acid material" refers to
a nucleic acid or an oligonucleotide, either natural or synthetic,
which is not naturally found in the cells; or if it is naturally
found in the cells, is modified from its original or native form.
Thus, "exogenous nucleic acid material" includes, for example, a
non-naturally occurring nucleic acid that can be transcribed into
an anti-sense RNA, a siRNA, as well as a "heterologous gene" (i.e.,
a gene encoding a protein that is not expressed or is expressed at
biologically insignificant levels in a naturally-occurring cell of
the same type). To illustrate, a synthetic or natural gene encoding
human erythropoietin (EPO) would be considered "exogenous nucleic
acid material" with respect to human peritoneal mesothelial cells
since the latter cells do not naturally express EPO. Still another
example of "exogenous nucleic acid material" is the introduction of
only part of a gene to create a recombinant gene, such as combining
an regulatable promoter with an endogenous coding sequence via
homologous recombination.
[0174] The condition amenable to gene inhibition therapy may be a
prophylactic process, i.e., a process for preventing disease or an
undesired medical condition. Thus, the instant invention embraces a
system for delivering siRNA that has a prophylactic function (i.e.,
a prophylactic agent) to the mammalian recipient.
[0175] Methods for Introducing the Expression Cassettes of the
Invention into Cells
[0176] The inhibitory nucleic acid material (e.g., an expression
cassette encoding siRNA directed to a gene of interest) can be
introduced into the cell ex vivo or in vivo by genetic transfer
methods, such as transfection or transduction, to provide a
genetically modified cell. Various expression vectors (i.e.,
vehicles for facilitating delivery of exogenous nucleic acid into a
target cell) are known to one of ordinary skill in the art.
[0177] As used herein, "transfection of cells" refers to the
acquisition by a cell of new nucleic acid material by incorporation
of added DNA. Thus, transfection refers to the insertion of nucleic
acid into a cell using physical or chemical methods. Several
transfection techniques are known to those of ordinary skill in the
art including calcium phosphate DNA co-precipitation, DEAE-dextran,
electroporation, cationic liposome-mediated transfection, tungsten
particle-facilitated microparticle bombardment, and strontium
phosphate DNA co-precipitation.
[0178] In contrast, "transduction of cells" refers to the process
of transferring nucleic acid into a cell using a DNA or RNA virus.
A RNA virus (i.e., a retrovirus) for transferring a nucleic acid
into a cell is referred to herein as a transducing chimeric
retrovirus. Exogenous nucleic acid material contained within the
retrovirus is incorporated into the genome of the transduced cell.
A cell that has been transduced with a chimeric DNA virus (e.g., an
adenovirus carrying a cDNA encoding a therapeutic agent), will not
have the exogenous nucleic acid material incorporated into its
genome but will be capable of expressing the exogenous nucleic acid
material that is retained extrachromosomally within the cell.
[0179] The exogenous nucleic acid material can include the nucleic
acid encoding the siRNA together with a promoter to control
transcription. The promoter characteristically has a specific
nucleotide sequence necessary to initiate transcription. The
exogenous nucleic acid material may further include additional
sequences (i.e., enhancers) required to obtain the desired gene
transcription activity. For the purpose of this discussion an
"enhancer" is simply any non-translated DNA sequence that works
with the coding sequence (in cis) to change the basal transcription
level dictated by the promoter. The exogenous nucleic acid material
may be introduced into the cell genome immediately downstream from
the promoter so that the promoter and coding sequence are
operatively linked so as to permit transcription of the coding
sequence. An expression vector can include an exogenous promoter
element to control transcription of the inserted exogenous gene.
Such exogenous promoters include both constitutive and regulatable
promoters.
[0180] Naturally-occurring constitutive promoters control the
expression of essential cell functions. As a result, a nucleic acid
sequence under the control of a constitutive promoter is expressed
under all conditions of cell growth. Constitutive promoters include
the promoters for the following genes which encode certain
constitutive or "housekeeping" functions: hypoxanthine
phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR),
adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase,
phosphoglycerol mutase, the beta-actin promoter, and other
constitutive promoters known to those of skill in the art. In
addition, many viral promoters function constitutively in
eukaryotic cells. These include: the early and late promoters of
SV40; the long terminal repeats (LTRs) of Moloney Leukemia Virus
and other retroviruses; and the thymidine kinase promoter of Herpes
Simplex Virus, among many others.
[0181] Nucleic acid sequences that are under the control of
regulatable promoters are expressed only or to a greater or lesser
degree in the presence of an inducing or repressing agent, (e.g.,
transcription under control of the metallothionein promoter is
greatly increased in presence of certain metal ions). Regulatable
promoters include responsive elements (REs) that stimulate
transcription when their inducing factors are bound. For example,
there are REs for serum factors, steroid hormones, retinoic acid,
cyclic AMP, and tetracycline and doxycycline. Promoters containing
a particular RE can be chosen in order to obtain an regulatable
response and in some cases, the RE itself may be attached to a
different promoter, thereby conferring regulatability to the
encoded nucleic acid sequence. Thus, by selecting the appropriate
promoter (constitutive versus regulatable; strong versus weak), it
is possible to control both the existence and level of expression
of a nucleic acid sequence in the genetically modified cell. If the
nucleic acid sequence is under the control of an regulatable
promoter, delivery of the therapeutic agent in situ is triggered by
exposing the genetically modified cell in situ to conditions for
permitting transcription of the nucleic acid sequence, e.g., by
intraperitoneal injection of specific inducers of the regulatable
promoters which control transcription of the agent. For example, in
situ expression of a nucleic acid sequence under the control of the
metallothionein promoter in genetically modified cells is enhanced
by contacting the genetically modified cells with a solution
containing the appropriate (i.e., inducing) metal ions in situ.
[0182] Accordingly, the amount of siRNA generated in situ is
regulated by controlling such factors as the nature of the promoter
used to direct transcription of the nucleic acid sequence, (i.e.,
whether the promoter is constitutive or regulatable, strong or
weak) and the number of copies of the exogenous nucleic acid
sequence encoding a siRNA sequence that are in the cell.
[0183] In addition to at least one promoter and at least one
heterologous nucleic acid sequence encoding the siRNA, the
expression vector may include a selection gene, for example, a
neomycin resistance gene, for facilitating selection of cells that
have been transfected or transduced with the expression vector.
[0184] Cells can also be transfected with two or more expression
vectors, at least one vector containing the nucleic acid
sequence(s) encoding the siRNA(s), the other vector containing a
selection gene. The selection of a suitable promoter, enhancer,
selection gene, and/or signal sequence is deemed to be within the
scope of one of ordinary skill in the art without undue
experimentation.
[0185] The following discussion is directed to various utilities of
the instant invention. For example, the instant invention has
utility as an expression system suitable for silencing the
expression of gene(s) of interest.
[0186] The instant invention also provides methods for genetically
modifying cells of a mammalian recipient in vivo. According to one
embodiment, the method comprises introducing an expression vector
for expressing a siRNA sequence in cells of the mammalian recipient
in situ by, for example, injecting the vector into the
recipient.
[0187] Delivery Vehicles for the Expression Cassettes of the
Invention
[0188] Delivery of compounds into tissues and across the
blood-brain barrier can be limited by the size and biochemical
properties of the compounds. Currently, efficient delivery of
compounds into cells in vivo can be achieved only when the
molecules are small (usually less than 600 Daltons). Gene transfer
for the correction of inborn errors of metabolism and
neurodegenerative diseases of the central nervous system (CNS), and
for the treatment of cancer has been accomplished with recombinant
adenoviral vectors.
[0189] The selection and optimization of a particular expression
vector for expressing a specific siRNA in a cell can be
accomplished by obtaining the nucleic acid sequence of the siRNA,
possibly with one or more appropriate control regions (e.g.,
promoter, insertion sequence); preparing a vector construct
comprising the vector into which is inserted the nucleic acid
sequence encoding the siRNA; transfecting or transducing cultured
cells in vitro with the vector construct; and determining whether
the siRNA is present in the cultured cells.
[0190] Vectors for cell gene therapy include viruses, such as
replication-deficient viruses (described in detail below).
Exemplary viral vectors are derived from Harvey Sarcoma virus, ROUS
Sarcoma virus, (MPSV), Moloney murine leukemia virus and DNA
viruses (e.g., adenovirus).
[0191] Replication-deficient retroviruses are capable of directing
synthesis of all virion proteins, but are incapable of making
infectious particles. Accordingly, these genetically altered
retroviral expression vectors have general utility for
high-efficiency transduction of nucleic acid sequences in cultured
cells, and specific utility for use in the method of the present
invention. Such retroviruses further have utility for the efficient
transduction of nucleic acid sequences into cells in vivo.
Retroviruses have been used extensively for transferring nucleic
acid material into cells. Protocols for producing
replication-deficient retroviruses (including the steps of
incorporation of exogenous nucleic acid material into a plasmid,
transfection of a packaging cell line with plasmid, production of
recombinant retroviruses by the packaging cell line, collection of
viral particles from tissue culture media, and infection of the
target cells with the viral particles) are well known in the
art.
[0192] An advantage of using retroviruses for gene therapy is that
the viruses insert the nucleic acid sequence encoding the siRNA
into the host cell genome, thereby permitting the nucleic acid
sequence encoding the siRNA to be passed on to the progeny of the
cell when it divides. Promoter sequences in the LTR region have can
enhance expression of an inserted coding sequence in a variety of
cell types. Some disadvantages of using a retrovirus expression
vector are (1) insertional mutagenesis, i.e., the insertion of the
nucleic acid sequence encoding the siRNA into an undesirable
position in the target cell genome which, for example, leads to
unregulated cell growth and (2) the need for target cell
proliferation in order for the nucleic acid sequence encoding the
siRNA carried by the vector to be integrated into the target
genome.
[0193] Another viral candidate useful as an expression vector for
transformation of cells is the adenovirus, a double-stranded DNA
virus. The adenovirus is infective in a wide range of cell types,
including, for example, muscle and endothelial cells.
[0194] Adenoviruses (Ad) are double-stranded linear DNA viruses
with a 36 kb genome. Several features of adenovirus have made them
useful as transgene delivery vehicles for therapeutic applications,
such as facilitating in vivo gene delivery. Recombinant adenovirus
vectors have been shown to be capable of efficient in situ gene
transfer to parenchymal cells of various organs, including the
lung, brain, pancreas, gallbladder, and liver. This has allowed the
use of these vectors in methods for treating inherited genetic
diseases, such as cystic fibrosis, where vectors may be delivered
to a target organ. In addition, the ability of the adenovirus
vector to accomplish in situ tumor transduction has allowed the
development of a variety of anticancer gene therapy methods for
non-disseminated disease. In these methods, vector containment
favors tumor cell-specific transduction.
[0195] Like the retrovirus, the adenovirus genome is adaptable for
use as an expression vector for gene therapy, i.e., by removing the
genetic information that controls production of the virus itself.
Because the adenovirus functions in an extrachromosomal fashion,
the recombinant adenovirus does not have the theoretical problem of
insertional mutagenesis.
[0196] Several approaches traditionally have been used to generate
the recombinant adenoviruses. One approach involves direct ligation
of restriction endonuclease fragments containing a nucleic acid
sequence of interest to portions of the adenoviral genome.
Alternatively, the nucleic acid sequence of interest may be
inserted into a defective adenovirus by homologous recombination
results. The desired recombinants are identified by screening
individual plaques generated in a lawn of complementation
cells.
[0197] Most adenovirus vectors are based on the adenovirus type 5
(Ad5) backbone in which an expression cassette containing the
nucleic acid sequence of interest has been introduced in place of
the early region 1 (E1) or early region 3 (E3). Viruses in which E1
has been deleted are defective for replication and are propagated
in human complementation cells (e.g., 293 or 911 cells), which
supply the missing gene E1 and pIX in trans.
[0198] In one embodiment of the present invention, one will desire
to generate siRNA in a brain cell or brain tissue. A suitable
vector for this application is an FIV vector or an AAV vector. For
example, one may use AAV5. Also, one may apply poliovirus or HSV
vectors.
[0199] Application of siRNA is generally accomplished by
transfection of synthetic siRNAs, in vitro synthesized RNAs, or
plasmids expressing shRNAs or miRNAs. More recently, viruses have
been employed for in vitro studies and to generate transgenic mouse
knock-downs of targeted genes. Recombinant adenovirus,
adeno-associated virus (AAV) and feline immunodeficiency virus
(FIV) can be used to deliver genes in vitro and in vivo. Each has
its own advantages and disadvantages. Adenoviruses are double
stranded DNA viruses with large genomes (36 kb) and have been
engineered by my laboratory and others to accommodate expression
cassettes in distinct regions.
[0200] Adeno-associated viruses have encapsidated genomes, similar
to Ad, but are smaller in size and packaging capacity (.about.30 nm
vs. .about.100 nm; packaging limit of .about.4.5 kb). AAV contain
single stranded DNA genomes of the + or the - strand. Eight
serotypes of AAV (1-8) have been studied extensively, three of
which have been evaluated in the brain. An important consideration
for the present application is that AAV5 transduces striatal and
cortical neurons, and is not associated with any known
pathologies.
[0201] Adeno associated virus (AAV) is a small nonpathogenic virus
of the parvoviridae family. AAV is distinct from the other members
of this family by its dependence upon a helper virus for
replication. In the absence of a helper virus, AAV may integrate in
a locus specific manner into the q-arm of chromosome 19. The
approximately 5 kb genome of AAV consists of one segment of single
stranded DNA of either plus or minus polarity. The ends of the
genome are short inverted terminal repeats which can fold into
hairpin structures and serve as the origin of viral DNA
replication. Physically, the parvovirus virion is non-enveloped and
its icosohedral capsid is approximately 20 nm in diameter.
[0202] Further provided by this invention are chimeric viruses
where AAV can be combined with herpes virus, herpes virus
amplicons, baculovirus or other viruses to achieve a desired
tropism associated with another virus. For example, the AAV4 ITRs
could be inserted in the herpes virus and cells could be infected.
Post-infection, the ITRs of AAV4 could be acted on by AAV4 rep
provided in the system or in a separate vehicle to rescue AAV4 from
the genome. Therefore, the cellular tropism of the herpes simplex
virus can be combined with AAV4 rep mediated targeted integration.
Other viruses that could be utilized to construct chimeric viruses
include lentivirus, retrovirus, pseudotyped retroviral vectors, and
adenoviral vectors.
[0203] Also provided by this invention are variant AAV vectors. For
example, the sequence of a native AAV, such as AAV5, can be
modified at individual nucleotides. The present invention includes
native and mutant AAV vectors. The present invention further
includes all AAV serotypes.
[0204] FIV is an enveloped virus with a strong safety profile in
humans; individuals bitten or scratched by FIV-infected cats do not
seroconvert and have not been reported to show any signs of
disease. Like AAV, FIV provides lasting transgene expression in
mouse and nonhuman primate neurons, and transduction can be
directed to different cell types by pseudotyping, the process of
exchanging the virus's native envelope for an envelope from another
virus.
[0205] Thus, as will be apparent to one of ordinary skill in the
art, a variety of suitable viral expression vectors are available
for transferring exogenous nucleic acid material into cells. The
selection of an appropriate expression vector to express a
therapeutic agent for a particular condition amenable to gene
silencing therapy and the optimization of the conditions for
insertion of the selected expression vector into the cell, are
within the scope of one of ordinary skill in the art without the
need for undue experimentation.
[0206] In another embodiment, the expression vector is in the form
of a plasmid, which is transferred into the target cells by one of
a variety of methods: physical (e.g., microinjection,
electroporation, scrape loading, microparticle bombardment) or by
cellular uptake as a chemical complex (e.g., calcium or strontium
co-precipitation, complexation with lipid, complexation with
ligand). Several commercial products are available for cationic
liposome complexation including Lipofectin.TM. (Gibco-BRL,
Gaithersburg, Md.) and Transfectam.TM. (Promega.RTM., Madison,
Wis.). However, the efficiency of transfection by these methods is
highly dependent on the nature of the target cell and accordingly,
the conditions for optimal transfection of nucleic acids into cells
using the herein-mentioned procedures must be optimized. Such
optimization is within the scope of one of ordinary skill in the
art without the need for undue experimentation.
[0207] Dosages, Formulations and Routes of Administration of the
Agents of the Invention
[0208] The agents of the invention are preferably administered so
as to result in a reduction in at least one symptom associated with
a disease. The amount administered will vary depending on various
factors including, but not limited to, the composition chosen, the
particular disease, the weight, the physical condition, and the age
of the mammal, and whether prevention or treatment is to be
achieved. Such factors can be readily determined by the clinician
employing animal models or other test systems, which are well known
to the art. As used herein, the term "therapeutic siRNA" refers to
any siRNA that has a beneficial effect on the recipient. Thus,
"therapeutic siRNA" embraces both therapeutic and prophylactic
siRNA.
[0209] Administration of siRNA may be accomplished through the
administration of the nucleic acid molecule encoding the siRNA.
Pharmaceutical formulations, dosages and routes of administration
for nucleic acids are generally known.
[0210] The present invention envisions treating Huntington's
disease in a mammal by the administration of an agent, e.g., a
nucleic acid composition, an expression vector, or a viral particle
of the invention. Administration of the therapeutic agents in
accordance with the present invention may be continuous or
intermittent, depending, for example, upon the recipient's
physiological condition, whether the purpose of the administration
is therapeutic or prophylactic, and other factors known to skilled
practitioners. The administration of the agents of the invention
may be essentially continuous over a preselected period of time or
may be in a series of spaced doses. Both local and systemic
administration is contemplated.
[0211] One or more suitable unit dosage forms having the
therapeutic agent(s) of the invention, which, as discussed below,
may optionally be formulated for sustained release (for example
using microencapsulation, see WO 94/07529, and U.S. Pat. No.
4,962,091 the disclosures of which are incorporated by reference
herein), can be administered by a variety of routes including
parenteral, including by intravenous and intramuscular routes, as
well as by direct injection into the diseased tissue. For example,
the therapeutic agent may be directly injected into the brain.
Alternatively the therapeutic agent may be introduced intrathecally
for brain and spinal cord conditions. In another example, the
therapeutic agent may be introduced intramuscularly for viruses
that traffic back to affected neurons from muscle, such as AAV,
lentivirus and adenovirus. The formulations may, where appropriate,
be conveniently presented in discrete unit dosage forms and may be
prepared by any of the methods well known to pharmacy. Such methods
may include the step of bringing into association the therapeutic
agent with liquid carriers, solid matrices, semi-solid carriers,
finely divided solid carriers or combinations thereof, and then, if
necessary, introducing or shaping the product into the desired
delivery system.
[0212] When the therapeutic agents of the invention are prepared
for administration, they are preferably combined with a
pharmaceutically acceptable carrier, diluent or excipient to form a
pharmaceutical formulation, or unit dosage form. The total active
ingredients in such formulations include from 0.1 to 99.9% by
weight of the formulation. A "pharmaceutically acceptable" is a
carrier, diluent, excipient, and/or salt that is compatible with
the other ingredients of the formulation, and not deleterious to
the recipient thereof. The active ingredient for administration may
be present as a powder or as granules, as a solution, a suspension
or an emulsion.
[0213] Pharmaceutical formulations containing the therapeutic
agents of the invention can be prepared by procedures known in the
art using well known and readily available ingredients. The
therapeutic agents of the invention can also be formulated as
solutions appropriate for parenteral administration, for instance
by intramuscular, subcutaneous or intravenous routes.
[0214] The pharmaceutical formulations of the therapeutic agents of
the invention can also take the form of an aqueous or anhydrous
solution or dispersion, or alternatively the form of an emulsion or
suspension.
[0215] Thus, the therapeutic agent may be formulated for parenteral
administration (e.g., by injection, for example, bolus injection or
continuous infusion) and may be presented in unit dose form in
ampules, pre-filled syringes, small volume infusion containers or
in multi-dose containers with an added preservative. The active
ingredients may take such forms as suspensions, solutions, or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredients may be in powder form,
obtained by aseptic isolation of sterile solid or by lyophilization
from solution, for constitution with a suitable vehicle, e.g.,
sterile, pyrogen-free water, before use.
[0216] It will be appreciated that the unit content of active
ingredient or ingredients contained in an individual aerosol dose
of each dosage form need not in itself constitute an effective
amount for treating the particular indication or disease since the
necessary effective amount can be reached by administration of a
plurality of dosage units. Moreover, the effective amount may be
achieved using less than the dose in the dosage form, either
individually, or in a series of administrations.
[0217] The pharmaceutical formulations of the present invention may
include, as optional ingredients, pharmaceutically acceptable
carriers, diluents, solubilizing or emulsifying agents, and salts
of the type that are well-known in the art. Specific non-limiting
examples of the carriers and/or diluents that are useful in the
pharmaceutical formulations of the present invention include water
and physiologically acceptable buffered saline solutions such as
phosphate buffered saline solutions pH 7.0-8.0. saline solutions
and water.
[0218] The invention will now be illustrated by the following
non-limiting Example.
Example 1
Rational Design of Therapeutic siRNAs: Minimizing Off-Targeting
Potential to Improve the Safety of RNAi Therapy for Huntington's
Disease
[0219] RNA interference (RNAi) provides an approach for the
treatment of many human diseases. However, the safety of RNAi-based
therapies can be hampered by the ability of small inhibitory RNAs
(siRNAs) to bind to unintended mRNAs and reduce their expression,
an effect known as off-target gene silencing. Off-targeting
primarily occurs when the seed region (nucleotides 2-8 of the small
RNA) pairs with sequences in 3'-UTRs of unintended mRNAs and
directs translational repression and destabilization of those
transcripts. To date, most therapeutic RNAi sequences are selected
primarily for gene silencing efficacy, and later evaluated for
safety. Here, in designing siRNAs to treat Huntington's disease
(HD), a dominant neurodegenerative disorder, we prioritized
selection of sequences with minimal off-targeting potentials (i.e.
those with a scarcity of seed complements within all known human
3'-UTRs). We identified new promising therapeutic candidate
sequences which show potent silencing in cell culture and mouse
brain. Furthermore, we present microarray data demonstrating that
off-targeting is significantly minimized by using siRNAs that
contain "safe" seeds, an important strategy to consider during
pre-clinical development of RNAi-based therapeutics.
[0220] RNAi directs sequence-specific gene silencing by
double-stranded RNA (dsRNA) which is processed into functional
small inhibitory RNAs (.about.21nt). In nature, RNAi for gene
regulation occurs primarily via small RNAs known as microRNAs
(miRNAs). Mature microRNAs (.about.19-25 nts) are processed from
larger primary miRNA transcripts (pri-miRNAs) which contain
stem-loop regions. Via a series of processing events catalyzed by
the ribonucleases, Drosha and Dicer, the miRNA duplex region is
liberated, and a single strand (the antisense "guide" strand) is
then incorporated into the RNA Induced Silencing Complex (RISC),
thus generating a functional complex capable of base-pairing with
and silencing transcripts by various means depending on the degree
of complementarity. A high-degree of base-pairing causes target
transcript cleavage, whereas imperfect binding (typically to
transcript 3'-UTRs) induces the canonical miRNA-based repression
mechanism resulting in translational repression and mRNA
destabilization. Indeed for the latter, pairing via the seed region
with as few as 6-7 bp may be sufficient to trigger silencing.
[0221] Elucidating the mechanisms involved in endogenous miRNA
biogenesis and gene silencing has enabled scientists to devise
strategies to co-opt the cellular RNAi machinery and direct
silencing of virtually any gene of interest using siRNAs,
short-hairpin RNAs (shRNAs), and artificial miRNAs; the latter two
represent expressed stem-loop transcripts which release siRNAs upon
processing. siRNAs are generally designed with the guide strand
exhibiting perfect complementarity to the intended mRNA target to
promote cleavage. This potent gene silencing approach has become a
powerful molecular tool to study gene function and is being
developed as a therapeutic strategy to suppress disease-causing
genes. The utility of siRNA-based technologies as biological or
clinical interventions is largely limited by our abilities to
design effective and specific inhibitory RNAs and to introduce them
into target cells or tissues. A major consideration for gene
silencing applications is specificity, and there is mounting
evidence supporting that siRNAs bind to and repress unintended
mRNAs, an effect known as off-target silencing. Off-targeting
primarily occurs when the seed region pairs with 3'-UTR sequences
in mRNAs and directs translational repression and destabilization
of those transcripts. Recent data supports that seed-based
off-targeting may induce toxic phenotypes. It has been observed
that the magnitude of siRNA off-targeting is directly related to
the frequency of seed complements (hexamers) present in the
3'-UTRome. By evaluating subsets of siRNAs with differing
off-targeting potentials (low, medium and high; predicted based on
hexamer distributions in human 3'-UTRs), they discovered that
siRNAs in the low subset had significantly diminished off-target
signatures (based on microarray data) and less adverse effects on
cell viability as compared to siRNAs in the medium and high
subsets. These observations established the importance of
considering seed complement hexamer distributions as a key
criterion for designing highly specific siRNAs, and some siRNA
design tools have since incorporated seed-specificity guidelines
into their algorithms. However, most publically available
algorithms remain strongly biased for gene silencing efficacy over
specificity, and thus, very few candidate siRNAs actually contain
seeds with low off-targeting potentials. This is revealed in a
literature survey of siRNAs under therapeutic development; only 7
of 80 recently published siRNAs with therapeutic relevance (Table
6) could be classified into the low off-targeting subgroup. This is
problematic as siRNAs move into early-stage clinical trials. While
potency-based design is rational, current publicly available tools
identify only a fraction of the functional siRNAs for a given
target transcript, and often times, highly functional siRNAs do not
satisfy several design rules. For these reasons, and in the
interest of improving the safety profile of therapeutic RNAi, the
inventors hypothesized that a siRNA design scheme prioritizing
specificity yet promoting efficacy would yield candidate siRNA
sequences with minimal off-targeting potential and a robust
capacity for potent gene silencing.
[0222] Results
[0223] Some Artificial miRNAs Induce Sequence-Specific Toxicity
[0224] Previous studies from our laboratory and others' have
demonstrated the potential of RNAi therapeutics for treating
Huntington's disease (HD), a dominant neurodegenerative disease
caused by a CAG repeat expansion which confers a toxic
gain-of-function to the resulting huntingtin (htt) protein. In
several rodent models for HD, viral-based expression of RNAi
hairpins targeting mutant htt mRNA in brain reduced transcript and
protein levels by .about.50-70%, improving behavioral and
neuropathological phenotypes. Following these proof-of-concept
successes, the inventors initiated studies to evaluate and optimize
the safety of RNAi-based therapeutics. The inventors compared the
silencing efficacy and safety of shRNA and artificial miRNA
expression vectors in vitro and in vivo. The inventors found that
shRNAs are more potent but induce toxicity in cell cultures and in
mouse brain, whereas artificial miRNAs are expressed at tolerably
lower levels and display better safety profiles while maintaining
potent gene silencing. Since this discovery, the inventors have
tested several artificial miRNA sequences in mouse brain using
recombinant adeno-associated viruses (AAV serotype 2/1) for
delivery, and in some instances, have observed sequence-dependent
toxicity. For example, one artificial miRNA targeting htt
(miHD-Ex1) caused a high incidence of seizures and morbidity in
treated mice (data not shown); of note, this toxic phenotype was
not a consequence of htt knockdown, as it has been previously
reported that silencing endogenous htt in mouse brain is tolerated.
In another instance, a non-targeted artificial miRNA (miSCR, a
scrambled control) induced evident neurotoxicity as indicated by
increased staining for Iba1, a marker for resting and reactive
microgila, in treated regions of the striatum (FIG. 1). Together,
these data suggest that although artificial miRNAs show improved
safety over shRNAs, sequence-dependent toxicity remains a concern.
The inventors therefore explored supplemental means to improve
safety by employing a rational siRNA design scheme intended to
minimize the probability for off-target silencing.
[0225] Selection and Screening of Htt-Targeting siRNAs with Low
Off-Targeting Potentials
[0226] The siRNA toxicity potentials have been correlated with seed
complement frequencies in the human 3'-UTRome (Anderson, E. M., A.
Birmingham, S. Baskerville, A. Reynolds, E. Maksimova, D. Leake, et
al. (2008). Experimental validation of the importance of seed
complement frequency to siRNA specificity. RNA 14(5):853-61). Here,
the inventors estimated the number of potential off-target
transcripts (POTs) for each hexamer by determining the number of
human RefSeq 3'-UTRs containing a specified hexamer (out of the
4096 possible). Similar to the previous findings, the majority of
hexamers are present in .about.4000 3'-UTRs or more, and
interestingly, there is an unexplainable peak (containing 1135
hexamers) in the distribution. These latter hexamers are present in
less than 2000 3'-UTRs (FIG. 2c). Since siRNAs are typically
designed to target coding regions, we determined the probability of
finding these relatively rare hexamers in human RefSeq coding
exons. This was .about.14%, suggesting that 1 in 7-8 randomly
designed siRNAs would contain these rare hexamers in the seed
region. To improve upon this nominal probability, low frequency
hexamers may first be located within target transcript sequence and
subsequently used as a foundation for designing siRNAs with minimal
off-targeting potentials. For example, the inventors scanned the
human htt coding sequence for low frequency hexamers, and with each
instance, examined the nearby context to determine whether the
siRNA containing the hexamer seed complement would satisfy two
criteria: (1) faithful loading of the intended antisense guide
strand and (2) GC-content between 20-70% (FIG. 3a). Not only do
these attributes represent the most prominent determinants of siRNA
potency, but proper loading of the antisense guide strand is
mandated to mitigate potential off-targeting mediated by the sense
"passenger" strand. Strand-loading is dictated by the thermodynamic
properties present at the siRNA duplex ends, with guide strand
loading encouraged by weak pairing (A/G-U) at the 5' end and strong
G-C binding at the opposing terminus (FIG. 3a). Of note, the
inventors apply this principle to the terminal two base-pairs at
each end and take advantage of weak G-U wobble pairing to impart
instability at the 5' end of the antisense strand when applicable.
Finally, the inventors select siRNAs based on a fairly liberal
range of GC-content (20-70%) which supports a suitable potential
for efficient silencing (>80%), as determined by our evaluation
of large-scale knock-down data for 2431 randomly designed siRNAs
targeting 31 unique mRNAs (data not shown). As with most siRNA
design algorithms, candidate siRNA sequences satisfying the above
criteria are subjected to BLAST to evaluate the potential for
off-target cleavage events mediated by near-perfect complementarity
to unintended mRNAs (for BLAST parameters, see Birmingham, A., E.
Anderson, K. Sullivan, A. Reynolds, Q. Boese, D. Leake, et al.
(2007). A protocol for designing siRNAs with high functionality and
specificity. Nat Protoc 2(9):2068-78)).
[0227] Using the inventors' siRNA design criteria (low POTs seed,
strand-biasing, and GC-content), the inventors initially identified
eight htt-targeting candidate sequences for further testing. We
embedded the siRNA sequences into the context of the inventors'
U6-driven artificial miRNA-based expression vectors (FIG. 2a) and
screened them for gene silencing against endogenous htt in HEK293
cells (FIG. 3b). The inventors observed two candidates (HDS1 and
HDS2, Tables 3 and 4, and FIGS. 7 and 8) that effectively silence
htt mRNA (.about.50%, relative to control). Notably, this magnitude
of in vitro silencing against endogenous htt is comparable to the
levels achieved by other htt RNAi sequences (including HD2.4) that
previously showed therapeutic efficacy in HD mouse models (Harper,
S. Q., P. D. Staber, X. He, S. L. Eliason, I. Martins, Q. Mao, et
al. (2005). RNA interference improves motor and neuropathological
abnormalities in a Huntington's disease mouse model. Proceedings of
the National Academy of Sciences, USA 102(16):5820-5825;
Rodriguez-Lebron, E., E. M. Denovan-Wright, K. Nash, A. S. Lewin,
and R. J. Mandel (2005). Intrastriatal rAAV-mediated delivery of
anti-huntingtin shRNAs induces partial reversal of disease
progression in R6/1 Huntington's disease transgenic mice. Mol Ther
12(4):618-633; Boudreau, R. L., J. L. McBride, I. Martins, S. Shen,
Y. Xing, B. J. Carter, et al. (2009). Nonallele-specific silencing
of mutant and wild-type huntingtin demonstrates therapeutic
efficacy in Huntington's disease mice. Mol Ther 17(6):1053-63).
[0228] Microarray Analyses of Seed-Related Off-Targeting
[0229] To validate the low off-targeting potential of these
effective sequences (HDS1 and HDS2) and the inventors' siRNA design
scheme, the inventors performed microarray analysis to assess
seed-related off-target gene silencing. The inventors included
several RNAi constructs which target human htt and various control
sequences to help discern off-target gene silencing from gene
expression changes that result from suppressing htt (Table 1). Of
note, all sequences used were designed to promote proper loading of
the antisense strand to avoid the confounding potential of
off-targeting mediated by the passenger strand. The htt-silencing
group consisted of HDS1, HDS2, HD2.4 and HD8.2; the latter two were
previously designed without regard for the seed sequence and have
>4500 POTs each (FIG. 2c). The control group (i.e.
non-htt-targeting) consisted of several sequences (8.2 mis,
8.2-124a, Terror, and Safe), each designed to serve a unique
purpose (Table 1). 8.2 mis contains the same seed as HD8.2 but has
central mismatches to prevent htt silencing, while 8.2-124a and
Terror are HD8.2 scrambled sequences which respectively contain a
seed mimic of miR-124a (a naturally occurring and highly conserved
miRNA) and a seed with high off-targeting potential (i.e.
complements a highly abundant hexamer in the human 3'-UTRome). Of
note, 8.2-124a was included as a control for detecting seed-related
off-targeting within the microarray data and to underscore the
prospective concern of designing siRNAs (scrambled controls or
on-target sequences) such that they unintentionally contain
naturally occurring miRNA seeds. Finally, the Safe construct
contains an arbitrary sequence designed to have low off-targeting
potential based on 3'-UTR hexamer frequencies. Together, these
constructs provide a wide-range of off-targeting potentials and
address problems that can inadvertently arise when including
scrambled sequences as controls in RNAi experiments, a commonly
used practice.
[0230] The inventors carried out transcriptional profiling in
cultured HEK293 cells 72 h after transfection with RNAi expression
plasmids (N=4 per construct). Initially, gene expression changes
were detected by performing ANOVA statistical analysis using all
treatments included in the study. As anticipated, htt was
consistently among the most significantly down-regulated
transcripts in samples treated with htt-targeting RNAi sequences
(P<5e-11, relative to U6), and these microarray data were
corroborated by QPCR evaluation of htt mRNA levels in the same RNA
samples (FIG. 4a). Next, the inventors performed hierarchical
clustering using differentially expressed genes within the dataset
(P<0.0001, 827 genes) to measure the relatedness among the
various treatments. These include gene expression changes which
occur as a result of knocking down endogenous htt in addition to
sequence-specific off-targeting events. Notably, we observed a
closer relationship between the low off-targeting potential
sequences (Safe, HDS1 and HDS2) and the U6 promoter-only control as
compared to the remaining sequences, which were designed either
blindly (HD2.4 and HD8.2) or intentionally with mid-to-high
off-targeting potentials (8.2-124a and Terror). These clustering
results support a clear association between off-targeting potential
and impact on the transcriptional profile (FIG. 4b), corroborating
the Anderson et al. observations (Anderson, E. M., A. Birmingham,
S. Baskerville, A. Reynolds, E. Maksimova, D. Leake, et al. (2008).
Experimental validation of the importance of seed complement
frequency to siRNA specificity. RNA 14(5):853-61). In addition,
these data substantiate that changes related to off-targeting are
more robust than those resulting from htt silencing. Visualization
of the complementing heatmap made obvious the overwhelming amount
of off-targeting caused by Terror and, to a slightly lesser degree,
8.2-124a (FIG. 4b). The overlap between these sequences is likely
due to their seed similarity (Table 1), and subsequent analyses
confirmed that much of this off-targeting was seed-related. For the
sequences with low-to-mid off-targeting potentials, the
relationship between off-targeting potentials and gene expression
profiles was better visualized by removing the Terror and 8.2-124a
samples from the ANOVA analysis and repeating hierarchical
clustering of differentially expressed genes (P<0.01, 985 genes)
(FIG. 4c). With this approach, the heat maps showed gene
suppression signatures that were unique to each of these sequences,
with the exception of HD8.2 and 8.2 mis. As previously noted, these
constructs share the same seed sequence, and this evident overlap
affirms that much of the observed gene expression changes are
seed-related, rather than caused by htt knockdown. In addition,
this example highlights the benefit of designing on-target and
control siRNA sequences that share the same seed. This preserves
off-targeting between the two sequences and is therefore beneficial
when applying RNAi-based tools to study gene function or validate
drug targets.
[0231] The inventors next assessed whether the observed gene
expression changes could be explained by seed-mediated gene
silencing. Cumulative distribution analyses of gene expression
levels indicated that transcripts containing seed binding sites for
the antisense strand in their 3'-UTR had a much higher probability
of being down-regulated (i.e. curve shifting left) (FIG. 4d, top
and FIG. 6), and the degree of down-regulation was dependent upon
the number of binding sites present, consistent with previous
reports characterizing miRNA seed-mediated silencing of target
transcripts. The inventors also performed cumulative fraction
analyses to detect seed-related gene silencing caused by the
passenger strand; in this case, the presence of 3'-UTR binding
sites had little to no detectable influence on gene expression,
supporting that the current vector design (i.e. two strong G-C
base-pairs at the sense 5' and two weak A/G-U base-pairs at the
sense 3') promotes proper strand-biasing (FIG. 4d, bottom). As a
complementary approach to detect seed-related gene silencing
events, the inventors performed motif discovery analyses using
3'-UTR sequences of down-regulated transcripts unique to each
treatment group. In all instances, the inventors found significant
enrichment of motifs complementary to the respective seed sequences
in the uniquely down-regulated transcript 3'-UTRs relative to a
background 3'-UTR dataset consisting of all known human 3'-UTRs
(FIG. 4e and FIG. 6b). These data confirm that seed-related
off-target gene silencing is present in the datasets for all RNAi
sequences tested. Upon further evaluation, the inventors estimated
the number of seed-related off-targets for each RNAi sequence by
identifying transcripts that were down-regulated (1.1-fold,
P<0.05, relative to U6) and contain the relevant seed
complements in their 3'-UTR (Table 2). This analysis revealed that
using the present "safe" seed design method, HDS1 and HDS2 show
nearly a log improvement in minimizing seed-related off-targeting,
as compared to previous lead candidates, HD2.4 and HD8.2.
[0232] In Vivo Silencing and Safety of HDS Sequences
[0233] Having identified that HDS1 and HDS2 have substantially
fewer seed-related off-targets, the inventors next tested these
sequences for silencing and safety in vivo in mouse brain. The
inventors intrastriatally injected AAV1-miHDS1, AAV1-miHDS2 or
AAV1-miSafe (control) into two cohorts of wild-type mice. Of note,
HDS1 exhibits full complementarity to mouse, rhesus and human htt
sequences, making it an attractive candidate for preclinical
testing. HDS2 only targets human htt, with mismatches to the
corresponding mouse and rhesus target sequences. At three weeks
post-injection, the inventors performed QPCR analyses to evaluate
gene silencing efficacy in striatal tissue harvested from the first
cohort of animals and observed significant htt mRNA knockdown
(.about.60%) in mice treated with AAV1-miHDS1, relative to
uninjected and AAV1-miSafe-treated mice (FIG. 5a). Notably,
previous reports from the inventors' laboratory and others'
demonstrate that .about.60% silencing of striatal htt transcripts
in HD mouse models markedly reduces protein levels, resulting in
appreciable therapeutic efficacy. The second cohort of mice was
sacrificed at six months post-injection to evaluate long-term
vector tolerability. Staining for Iba1, a marker for resting and
reactive microgila, showed no evidence for neurotoxicity in
transduced regions of the striata, relative to nearby untransduced
tissue (FIG. 5b; refer to FIG. 1 for comparison to miSCR, a toxic
sequence with high off-targeting potential). These results are
encouraging considering that HD2.4, previously shown to be
therapeutically efficacious in short term studies, caused modest
but still detectable increases in Iba1 staining in both wild-type
and HD mice. Furthermore, the data corroborate previous reports
demonstrating that reducing wild-type htt mRNA levels by .about.60%
in mouse striatum does not induce overt neurotoxicity.
DISCUSSION
[0234] Although the absolute specificity and safety of RNAi
approaches remains questionable, recent advances in understanding
RNAi-induced toxicities (e.g. pathway saturation and off-targeting)
are facilitating researchers in devising strategies to limit these
adverse events. For example, the discovery that high-level shRNA
expression causes lethality in mice (Grimm, D., K. L. Streetz, C.
L. Jopling, T. A. Storm, K. Pandey, C. R. Davis, et al. (2006).
Fatality in mice due to oversaturation of cellular microRNA/short
hairpin RNA pathways. Nature 441(7092):537-41) prompted us to test
alternative hairpin-based vectors (e.g. artificial miRNAs) for
their capacity to limit the production of RNAi substrates following
viral-based delivery in vivo, thus resulting in improved
tolerability. Furthermore, Anderson et al recently evaluated the
impact of 3'-UTR seed complement frequencies on siRNA off-targeting
potentials, using a set of randomly designed siRNA sequences
targeting a variety of genes (Anderson, E. M., A. Birmingham, S.
Baskerville, A. Reynolds, E. Maksimova, D. Leake, et al. (2008).
Experimental validation of the importance of seed complement
frequency to siRNA specificity. RNA 14(5):853-61). Low
off-targeting potential siRNAs were found to exhibit higher
specificity as per mRNA profiling, lower toxicity and fewer false
positives in phenotypic screens. The authors proposed that siRNAs
with low seed complement frequencies improve the accuracy of RNAi
screens to study gene function or validate drug targets. Here, the
inventors took advantage of these findings to deliberately design
therapeutic siRNAs with low off-targeting potentials, as a means to
promote safety in pre-clinical development of RNAi therapy for HD.
The inventors identified two candidates (HDS1 and HDS2) which
effectively silence human htt mRNA, induce minimal seed-related
off-targeting and are well-tolerated in mouse brain long-term.
[0235] Although the inventors' work was initially undertaken to
develop siRNAs with low off-targeting potentials, a similar
strategy may be employed to intentionally design siRNAs with high
off-targeting capacities (e.g. Terror sequence) for use as
anti-tumor agents. This approach may deter tumor escape by more
broadly disrupting essential cellular pathways, as compared to
delivering siRNAs targeting specific oncogenes.
[0236] Researchers using RNAi triggers in basic and translational
research often employ scrambled sequences as controls. The present
work highlights the importance of carefully designing control
siRNAs, with attention to putative seed sequences that can
inadvertently induce considerable off-target silencing via
miRNA-based mechanisms. Here, the inventors intentionally
introduced either a known miRNA seed (8.2-124a) or a seed with high
off-targeting potential (Terror) into scrambled siRNA sequences. As
expected, both induced significant seed-related alterations in
transcriptional profiles, when compared to our control vector
(Safe) designed to exhibit low off-targeting potential.
Furthermore, we describe and test the design of a "same seed"
control vector (8.2 mis). This approach resulted in significant
preservation of off-targeting relative to the corresponding
on-target sequence (HD8.2). These data encourage the use of "same
seed" controls in future RNAi experiments.
[0237] There are several key considerations which apply to "safe"
seed siRNA design. First, low off-targeting potential does not
necessarily mean non-toxic, as off-target identity remains a
crucial influence on tolerability. The inventors' improved ability
to accurately identify high probability off-targets allows us to
better select lead candidate siRNAs, particularly when several low
off-targeting sequences are available for a given target sequence.
Second, observed safety in pre-clinical toxicity studies in either
rodents or non-human primates may not ensure success in humans, as
differences in 3'-UTR sequences creates off-targeting profiles
unique to each species (Burchard, J., A. L. Jackson, V. Malkov, R.
H. Needham, Y. Tan, S. R. Bartz, et al. (2009). MicroRNA-like
off-target transcript regulation by siRNAs is species specific. Rna
15(2):308-15). It is important to note, that although off-target
identities may be species-specific, the off-targeting potentials
for each hexamer remain highly consistent, as hexamer frequencies
among several species (e.g. mouse, rhesus and human) show minimal
variability (data not shown). Third, locating these rare hexamers
may be difficult in small target transcripts, and thus other means
to limit off-targeting may be necessary. For instance, several
reports have demonstrated that certain chemical modifications to
the seed nucleotides significantly reduce off-targeting from
chemically synthesized siRNAs (Jackson, A. L., J. Burchard, D.
Leake, A. Reynolds, J. Schelter, J. Guo, et al. (2006).
Position-specific chemical modification of siRNAs reduces
"off-target" transcript silencing. RNA 12(7):1197-205; Bramsen, J.
B., M. M. Pakula, T. B. Hansen, C. Bus, N. Langkjaer, D. Odadzic,
et al. (2010). A screen of chemical modifications identifies
position-specific modification by UNA to most potently reduce siRNA
off-target effects. Nucleic Acids Res 38(17):5761-73; Vaish, N., F.
Chen, S. Seth, K. Fosnaugh, Y. Liu, R. Adami, et al. (2011).
Improved specificity of gene silencing by siRNAs containing
unlocked nucleobase analogs. Nucleic Acids Res 39(5):1823-32). The
prospect of combining "safe" seed design with chemical
modifications serves as a provocative strategy to develop synthetic
siRNAs with very high specificity. However, for expressed RNAi,
chemical modifications are not applicable, thus "safe" seed design
provides the primary means to limit off-targeting for these
hairpin-based vectors.
[0238] In summary, "safe" seed siRNA design has significant
implications for therapeutic development which may result in
substantial time- and cost-saving opportunities. Traditional small
molecules are initially screened for efficacy and later tested for
safety, since predicting potential side effects remains a challenge
due to the complex nature of small molecule interactions. By
contrast, the inventors' ability to predict off-targeting (derived
from base-pairing) for oligonucleotide-based drugs provides a
unique opportunity to prioritize safety during drug development and
subsequently screen for efficacy.
[0239] Materials & Methods
[0240] Plasmids and Viral Vectors
[0241] The plasmids expressing mouse U6-driven artificial miRNAs
were cloned as previously described using the DNA oligonucleotides
listed in Table 5 (Boudreau, R. L., A. Mas Monteys, and B. L.
Davidson (2008). Minimizing variables among hairpin-based RNAi
vectors reveals the potency of shRNAs. RNA 14:1834-1844). For AAV
production, artificial miRNA expression cassettes were cloned into
pFBGR-derived plasmids which co-express CMV-driven GFP (Boudreau,
R. L., I. Martins, and B. L. Davidson (2009). Artificial MicroRNAs
as siRNA Shuttles: Improved Safety as Compared to shRNAs In vitro
and In vivo. Mol Ther 17(1):169-17).
[0242] Recombinant AAV serotype 2/1 vectors (AAV1-GFP, AAV1-miSCR,
AAV1-miHDS1, and AAV1-miHDS2 were generated by the University of
Iowa Vector Core facility as previously described (Urabe, M., C.
Ding, and R. M. Kotin (2002). Insect cells as a factory to produce
adeno-associated virus type 2 vectors. Hum Gene Ther
13(16):1935-1943). Viruses were initially purified using an
iodixanol gradient (15-60% w/v) and subjected to additional
purification via ion exchange using MustangQ Acrodisc membranes
(Pall Corporation, East Hills, N.Y.). AAV1 vectors were resuspended
in Formulation Buffer 18 (HyClone, Logan, Utah), and titers (viral
genomes per ml) were determined by QPCR.
[0243] AAV Injections and Brain Tissue Isolation
[0244] All animal protocols were approved by the University of Iowa
Animal Care and Use Committee. Wildtype FVB mice were injected with
AAV1 vectors as previously reported (Harper, S. Q., P. D. Staber,
X. He, S. L. Eliason, I. Martins, Q. Mao, et al. (2005). RNA
interference improves motor and neuropathological abnormalities in
a Huntington's disease mouse model. Proceedings of the National
Academy of Sciences, USA 102(16):5820-5825; McBride, J. L., R. L.
Boudreau, S. Q. Harper, P. D. Staber, A. M. Monteys, I. Martins, et
al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in
the brain: Implications for the therapeutic development of RNAi.
Proc Natl Acad Sci USA 105(15):5868-73). For all studies, unless
indicated otherwise, mice were injected bilaterally into the
striatum (coordinates: 0.86 mm rostral to bregma, .+-.1.8 mm
lateral to midline, 3.5 mm ventral to the skull surface) with 4 ul
of AAV1 virus (at .about.1.times.10.sup.12 viral genomes/ml). Mice
used in histological analyses were anesthetized with a
ketamine/xylazine mix and transcardially perfused with 20 ml of
0.9% cold saline, followed by 20 ml of 4% paraformaldehyde in 0.1M
PO.sub.4 buffer. Mice were decapitated, and the brains were removed
and post-fixed overnight in 4% paraformaldehyde. Brains were stored
in a 30% sucrose solution at 4.degree. C. until cut on a sliding
knife microtome at 40 .mu.m thickness and stored at -20.degree. C.
in a cryoprotectant solution. Mice used for QPCR analyses were
perfused with 20 ml of 0.9% cold saline. Brains were removed and
sectioned into 1 mm thick coronal slices using a brain matrix
(Roboz, Gaithersburg, Md.). Tissue punches were taken from the
striatum using a tissue core (1.4 mm in diameter) and triterated in
50 ul of TRIzol (Invitrogen, Carlsbad, Calif.). RNA was isolated
from striatal punches using 1 ml of TRIzol.
[0245] Immunohistochemical Analyses
[0246] Free-floating, coronal brain sections (40 .mu.m thick) were
processed for immunohistochemical visualization of microglia
(anti-Iba1, 1:1000, WAKO, Richmond, Va.). All staining procedures
were carried out as previously described (McBride, J. L., R. L.
Boudreau, S. Q. Harper, P. D. Staber, A. M. Monteys, I. Martins, et
al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in
the brain: Implications for the therapeutic development of RNAi.
Proc Natl Acad Sci USA 105(15):5868-73), using goat anti-rabbit IgG
secondary antibody (1:200) and Vectastain ABC-peroxidase reagent
(both from Vector Laboratories, Burlingame, Calif.). Stained or
unstained (the latter for visualization of GFP autofluorescence)
sections were mounted onto Superfrost Plus slides (Fisher
Scientific, Pittsburgh, Pa.) and coverslipped with Gelmount
(Biomeda, Foster City, Calif.) or Vectashield (Vector
Laboratories). Images were captured using an Olympus BX60 light
microscope and DP70 digital camera, along with Olympus DP
Controller software (Olympus, Melville, N.Y.).
[0247] Hexamer Distribution Analyses
[0248] All human RefSeq IDs, official gene symbols, and coding and
3'-UTR sequences (Hg19, GRCH37) were obtained and only sequences
with NM_* pre-fixes were used for analysis. For 3'-UTR sequences,
the non-overlapping frequency of each individual hexamer (4096
possible) was counted to determine the number of 3'-UTRs containing
a given hexamer. Non-overlapping sites were considered to account
for actual binding site availability. For coding sequence, the
total hexamer frequencies were determined, allowing overlapping
hexamers, to estimate the probability of selecting siRNA sequences
containing the specified hexamer. For genes with variants (i.e.
same official gene symbol but different accession number), the
maximum count for each hexamer was used.
[0249] Cell Culture and Transfection
[0250] For the HDS screen, HEK293 cells were grown in 24-well
plates in growth media containing 10% fetal bovine serum (FBS) and
transfected in quadruplicate with 400 ng of plasmid using
Lipofectamine 2000 (Invitrogen) by adding the lipid:DNA complexes
directly to the growth media. Total RNA was isolated at 24 h
post-transfection using 1 ml of Trizol. For microarray studies,
HEK293 cells were grown in 12-well plates in growth media (10% FBS)
and transfected with 1 ug of plasmid under serum-free conditions.
Lipid:DNA complexes were removed 3 h later and replaced with growth
media (5% FBS). At 72 h (microarray) post-transfection, total RNA
was isolated using 1 ml of TRIzol.
[0251] Quantitative Real-Time PCR (QPCR)
[0252] Random-primed first-strand cDNA synthesis was performed
using 500 ng total RNA (High Capacity cDNA Reverse Transcription
Kit; Applied Biosystems, Foster City, Calif.) per manufacturer's
protocol. Assays were performed on a sequence detection system
using primers/probe sets specific for human htt and GAPDH or mouse
htt and beta-actin (Prism 7900HT and TaqMan 2.times. Universal
Master Mix; Applied Biosystems). Relative gene expression was
determined using the .DELTA..DELTA.C.sub.T method, normalizing to
either GAPDH or beta-actin mRNA levels.
[0253] Microarray Analyses
[0254] Microarray analysis was done with assistance from the
University of Iowa DNA Facility (Iowa City, Iowa). Fifty nanograms
of total RNA template were used to produce amplified cDNA using the
Ovation Biotin RNA Amplification System, v2 (NuGEN Technologies)
following the manufacturer's protocol. Amplified cDNA product was
purified with DNA Clean and Concentrator-25 (Zymo Research). 3.75
.mu.g of amplified cDNA were processed using the FL-Ovation cDNA
Biotin Module v2 (NuGEN Technologies, San Carlos, Calif.) to
produce biotin labeled antisense cDNA in 50- to 100 bp fragments.
Following denaturation at 99.degree. C. for 2 min, fragmented,
labeled cDNA were combined with hybridization control oligomer (b2)
and control cRNAs (BioB, BioC, BioD, and CreX) in hybridization
buffer and hybridized to the HuGene 1.0ST GeneChip (Affymetrix,
Santa Clara, Calif.) capable of detecting more than 28,000 genes.
Following an 18 hour incubation at 45.degree. C., the arrays were
washed, stained with streptavidinphycoerythrin (Molecular Probes),
and then amplified with an anti-streptavidin antibody (Vector
Laboratories) using the Fluidics Station 450 (Affymetrix). Arrays
were scanned with the Affymetrix Model 3000 scanner and data
collected using GeneChip operating software (GCOS) v1.4. Each
sample and hybridization underwent a quality control evaluation,
including percentage of probe sets reliably detecting between 40
and 60% present call and 3'-5' ratio of the GAPDH gene less than
3.
[0255] Partek Genomics Suite (Partek GS, Saint Louis, Mo.) was used
to preprocess, normalize and analyze microarray data. Affymetrix
array raw fluorescence intensity measures of gene expression were
normalized and quantified using robust multi-array analysis (RMA).
To identify differentially expressed genes among the nine treatment
groups (N=4 each, Table 1), the inventors employed two-way ANOVA
(variables: scan date and treatment) since arrays were processed in
groups of four (one replicate per treatment in each group).
Pair-wise contrasts between groups of interest were performed when
indicated. Principal component and hierarchical clustering analyses
were used to visualize differential gene expression.
[0256] Cumulative Distribution Analyses
[0257] 3'-UTR sequences for all RefSeq mRNAs on the HuGene 1.0 ST
chip were obtained, and the number of non-overlapping seed
complement binding sites (octamers) per 3'-UTR for each of the
indicated inhibitory RNAs was determined. Three possible octamers
for each artificial miRNA were considered to account for
flexibility in Drosha and Dicer cleavage (Table 5). Transcripts
were parsed into groups depending on the number of seed complements
in their 3'-UTR (no sites, 1 site, 2+ sites), and cumulative
distributions of gene expression values (Log 2 fold-change,
relative to U6) were plotted. Two-sample Kolmogorov-Smirnov (KS)
tests were performed to evaluate the statistical significance of
distributional deviations relative to baseline (no sites).
[0258] Motif Discovery
[0259] The Venn diagram feature on Partek GS was used to create
lists of uniquely down-regulated genes (1.1-fold, P<0.05 or
1.2-fold, P<0.01, relative to U6) for each treatment, taking
into account htt silencing (e.g. HDS1, HDS2, HD2.4 and HD8.2 were
included in one Venn diagram, and Safe, Terror, 8.2 mis and
8.2-124a were included in another). Ensembl Gene IDs were obtained
using the Gene ID Conversion Tool at the David Bioinformatics
Resources web-server (Huang da, W., B. T. Sherman, Q. Tan, J. R.
Collins, W. G. Alvord, J. Roayaei, et al. (2007). The DAVID Gene
Functional Classification Tool: a novel biological module-centric
algorithm to functionally analyze large gene lists. Genome Biol
8(9):R183). Ensemble Gene IDs were subjected to target set analysis
using the Amadeus Motif Discovery Platform (Allegro Software
Package) to identify 8mers enriched in the target set 3'-UTRs,
relative the provided human 3'-UTR background dataset (Halperin,
Y., C. Linhart, I. Ulitsky, and R. Shamir (2009). Allegro:
analyzing expression and sequence in concert to discover regulatory
programs. Nucleic Acids Res 37(5):1566-79). Amadeus blindly
identified an enrichment of seed complement motifs for each RNAi
sequence tested, and the lowest p-values for the relevant motifs
were reported.
TABLE-US-00001 TABLE 1 Microarray constructs. Off-Targeting Targets
8mer Potential Purpose/Design Construct HTT? Seed (# of OTs*)
Rationale U6 promoter No N/A N/A Normalizing control mHDS1 Yes
GUCGACCA Low New lead candidate (495) containing safe seed miHDS2
Yes AUAGUCGC Low New lead candidate (1227) containing safe seed
miHD2.4 Yes UAGACAAU Mid Previous candidate (4688) selected at
random miHD8.2 Yes AUAAACCU Mid Previous candidate (5041) selected
at random mi8.2mis No AUAAACCU Mid "Same seed" control (5041) for
8.2 sequence mi8.2-124a No UAAGGCAC Mid-High Scrambled 8.2 sequence
(5519) containing miR-124a seed miTerror No AAGGCAGA High Scrambled
8.2 sequence (7218) containing toxic seeds miSafe No AAACGCGU Low
Random sequence with (662) minimal off-targeting *Average number of
transcripts containing seed hexamer complements. Three possible
hexamers were considered for each 8mer seed to account for
flexibility in Drosha/Dicer processing.
TABLE-US-00002 TABLE 2 Off-target summary. Sequence # of
Off-targets* Avg. Fold .DELTA. HD8.2 79 -1.17 HD2.4 73 -1.17 HDS1 7
-1.27 HDS2 12 -1.17 Safe 9 -1.18 Terror 450 -1.26 (*Down-regulated
genes with 8mer seed complement in 3'-UTR)
TABLE-US-00003 TABLE 3 miHDS sequences that effectively silence
endogenous htt mRNA in HEK293 cells (human-derived) Predicted
Predicted Silencing antisense Specificity Artificial Pri-miRNA RNA
Human Rhesus Mouse miRNA Sequence sequence #1 (exon) (exon) (exon)
miHDS.1 5'...cucgagu 5'- Yes Yes Yes gagcgaugcugg gucgaccaugcg (44)
(51) (44) cucgcauggucg agccagcac-3' auacuguaaagc SEQ ID NO: 4
cacagaugggug ucgaccaugcga gccagcaccgcc uacuaga...3' SEQ ID NO: 1
miHDS.2 5'...cucgagu 5'- Yes No No gagcgcucccgg auagucgcugau (61)
ucaucagcgacu gaccgggau-3' auuccguaaagc SEQ ID NO: 5 cacagaugggga
uagucgcugaug accgggaucgcc uacuaga...3' SEQ ID NO: 2 miHDS.5
5'...cucgagu 5'- Yes No No gagcgcuccucu uuacgucguaaa (3'UTR-
uguuuacgacgu caagaggaa-3' long) gaucuguaaagc SEQ ID NO: 6
cacagaugggau uacgucguaaac aagaggaacgcc uacuagu...3' SEQ ID NO:
3
TABLE-US-00004 TABLE 4 miHDS sequences that effectively silence
endogenous htt mRNA in HEK293 cells (human-derived) Artificial
miRNA Full-length Pri-miRNA Sequence miHDS.1
5'-GCGUUUAGUGAACCGUCAGAUGGUACCGUUU
AAACUCGAGUGAGCGAUGCUGGCUCGCAUGGUCG
AUACUGUAAAGCCACAGAUGGGUGUCGACCAUGC
GAGCCAGCACCGCCUACUAGAGCGGCCGCCACAG
CGGGGAGAUCCAGACAUGAUAAGAUACAUU-3' SEQ ID NO: 10 miHDS.2
5'-GCGUUUAGUGAACCGUCAGAUGGUACCGUUU
AAACUCGAGUGAGCGCUCCCGGUCAUCAGCGACU
AUUCCGUAAAGCCACAGAUGGGGAUAGUCGCUGA
UGACCGGGAUCGCCUACUAGAGOGGCCGCCACAG
CGGGGAGAUCCAGACAUGAUAAGAUACAUU-3' SEQ ID NO: 11 Pri-
5'-CUCGAGUGAGCGAUGCUGGCUCGCAUGGUCG miHDS.1
AUACUGUAAAGCCACAGAUGGGUGUCGACCAUGC GAGCCAGCACCGCCUACUAGA-3' SEQ ID
NO: 33
TABLE-US-00005 TABLE 5 Artificial miRNA Sequences (SEQ ID Nos:
75-119, respectively, in order of appearance) miHDS1 ##STR00001##
Oligo 1: aaaactcgagtgagcgatgctggctcgcatggtcgatactgtaaagccacagatggg
Oligo 2: aaaaactagtaggcggtgctggctcgcatggtcgacacccatctgtggctttacag
Cumulative Distribution Antisense Seed Complements: ATGGTCGA,
TGGTCGAC, GGTCGACA miHDS2 ##STR00002## Oligo 1:
aaaactcgagtgagcgctcccggtcatcagcgactattccgtaaagccacagatgg Oligo 2:
aaaaactagtaggcgatcccggtcatcagcgactatccccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: AGCGACTA, GCGACTAT,
CGACTATC miHDS3 ##STR00003## Oligo 1:
aaaactcgagtgagcggtgcttctttgtcagcgcgtttccgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgctgcttctttgtcagcgcgtcccccatctgtggctttacag miHDS4
##STR00004## Oligo 1:
aaaactcgagtgagcgacggggcagcaggagcggtagactgtaaagccacagatggg Oligo 2:
aaaaactagtaggcggcggggcagcaggagcggtaaacccatctgtggctttacag miHDS5
##STR00005## Oligo 1:
aaaactcgagtgagcgctcctcttgtttacgacgtgatctgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgttcctcttgtttacgacgtaatcccatctgtggctttacag miHDS6
##STR00006## Oligo 1:
aaaactcgagtgagcgcgggatgtagagaggcgttagtctgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgtgggatgtagagaggcgttaatcccatctgtggctttacag miHDS7
##STR00007## Oligo 1:
aaaactcgagtgagcgccccttggaatgcatatcgttgctgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgtcccttggaatgcatatcgctacccatctgtggctttacag miHDS8
##STR00008## Oligo 1:
aaaactcgagtgagcgcacgtggacctgcctacggaggccgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgaacgtggacctgcctacggaaacccatctgtggctttacag miHD2.4
##STR00009## Oligo 1:
aaaactcgagtgagcgcaccgtgtgaatcattgtctaactgtgaagccacagatggg Oligo 2:
aaaaactagtaggcgtaccgtgtgaatcattgtctaacccatctgtggctttacag Cumulative
Distribution Anitsense Seed Complements: CATTGTCT, ATTGTCTA,
TTGTCTAA miHD8.2 ##STR00010## Oligo 1:
aaaactcgagtgagcgaagcagcttgtccaggtttatgctgtgaagccacagatggg Oligo 2:
aaaaactagtaggcggagcagcttgtccaggtttatacccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: CAGGTTTA, AGGTTTAT,
GGTTTATA mi8.2mis ##STR00011## Oligo 1:
aaaactcgagtgagcgaagcagctgtgttaggtttatgctgtgaagccacagatggg Oligo 2:
aaaaactagtaggcggagcagctgtgttaggtttatacccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: TAGGTTTA, AGGTTTAT,
GGTTTATA mi8.2-124a ##STR00012## Oligo 1:
aaaactcgagtgagcgaagctgtagctatgtgccttagctgtgaagccacagatggg Oligo 2:
aaaaactagtaggcggagctgtagctatgtgccttaacccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: TGTGCCTT, GTGCCTTA,
TGCCTTAA miTerror ##STR00013## Oligo 1:
aaaactcgagtgagcgcagcaggagttattctgccttactgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgtagcaggagttattctgccttacccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: TTCTGCCT, TCTGCCTT,
CTGCCTTA miSafe ##STR00014## Oligo 1:
aaaactcgagtgagcgcagcgaacgacttacgcgtttactgtaaagccacagatggg Oligo 2:
aaaaactagtaggcgtagcgaacgacttacgcgtttacccatctgtggctttacag Cumulative
Distribution Antisense Seed Complements: TACGCGTT, ACGCGTTT,
CGCGTTTA miSCR ##STR00015## Oligo 1:
aaaactcgagtgagcgcaccatcgaaccgtcagagttactgtgaagccacagatggg Oligo 2:
aaaaactagtaggcgtaccatcgaaccgtcagagttacccatctgtggctttacag
TABLE-US-00006 TABLE 6 siRNA Literature Survey Antisense Sequence
2-7 3-8 (SEQ ID NOs: 120-199, SC SC respectively, in order 2-7 Seed
3-8 Seed # of # of of appearance) Complement Complement OTs OTs
Target Reference TTCGATCTGTAGCAGCAGCTT GATCGA AGATCG 629 1104 HTT
[1] GATCCGACTCACCAATACC TCGGAT GTCGGA 651 617 bcl-xl [2]
TTCCGAATAAACTCCAGGCTT TTCGGA ATTCGG 937 704 PCSK9 [3]
ACGTAAACAAAGGACGTCC TTTACG GTTTAC 995 4054 HBV [4]
AACGTTAGCTTCACCAACATT TAACGT CTAACG 1112 668 c-myc [5]
TAACGTAACAGTCGTAAGA TACGTT TTACGT 1193 1220 bim [6]
ACAGCGAGTTAGATAAAGC TCGCTG CTCGCT 1505 1671 c-myc [7]
CACACGGGCACAGACTTCCAA CCGTGT CCCGTG 2017 2023 HTT [1]
AGGTGTATCTCCTAGACACTT TACACC ATACAC 2330 3366 PCSK9 [3]
TGTGCTACGTTCTACGAG TAGCAC GTAGCA 2828 3383 HCV [8]
TGTGGACAAAGTCTCTTCC GTCCAC TGTCCA 2930 4899 Livin [9]
TGATGTCATAGATTGGACT GACATC TGACAT 3143 5012 CCR5 [10]
TCTGATCTGTAGCAGCAGCTT GATCAG AGATCA 3261 4214 HTT [1]
GGTAAGTGGCCATCCAAGC ACTTAC CACTTA 3268 4049 bcl-xl [2]
CGAGTTAGATAAAGCCCCG TAACTC CTAACT 3319 3265 c-myc [7]
TTAACCTAATCTCCTCCCC AGGTTA TAGGTT 3323 3480 HBV [4]
TGATGATGGTGCGCAGACC ATCATC CATCAT 3496 4415 HBV [4]
TATAGAGAGAGAGAGAAGA CTCTAT TCTCTA 3586 5271 K6a [11]
TTGATCCGGAGGTAGGTCTTT GGATCA CGGATC 3593 859 PLK1 [12]
TTGGTATTCAGTGTGATGA ATACCA AATACC 3636 3304 APOB [13]
TTACTCTCAAACTTTCCTC AGAGTA GAGAGT 3768 3885 XIAP [9]
TATTGTAATGGGCTCTGTC TACAAT TTACAA 4118 5055 E6/E7 [14]
TGCCTTGGCAAACTTTCTT CAAGGC CCAAGG 4247 5408 EGFR1 [15]
ACCAATTTATGCCTACAGC AATTGG AAATTG 4273 6322 HBV [4]
TTTGCTCTGTAGCAGCAGCTT GAGCAA AGAGCA 4298 5604 HTT [1]
CCAATCTCAAAGTCATCAA AGATTG GAGATT 4391 4652 AuRkb [15]
TAGTTATTCAGGAAGTCTA ATAACT AATAAC 4421 4198 APOB [13]
AATCAAGTAGATCCTCCTCC CTTGAT ACTTGA 4458 5308 AuRkb [15]
TGCATCTCCTTGTCTACGC AGATGC GAGATG 4488 5464 bcl-xl [2]
TCAAGCTCTGCAAACCAGA AGCTTG GAGCTT 4547 4427 CCR5 [10]
ATGATGATGGTGCGCAGAC TCATCA ATCATC 4561 3496 HBV [4]
TCTTCTAGCGTTGAAGTACTG TAGAAG CTAGAA 4583 4684 HTT [1]
TCTTCTAGCGTTGAATTACTG TAGAAG CTAGAA 4583 4684 HTT [1]
GAATTGTTGCTGGTTGCACTC ACAATT AACAAT 4647 4904 EGFR1 [15]
TAGGACTAGTCACTTGTGC AGTCCT TAGTCC 4652 2822 K6a [11]
TATAATGCTCAGCCTCAGA CATTAT GCATTA 4672 3567 K6a [11]
TTTGATTTGTAGCAGCAGCTT AATCAA AAATCA 4735 6429 HTT [1]
TTTTATCTGTAGCAGCAGCTT GATAAA AGATAA 4785 4877 HTT [1]
GAGTCTCTTGTTCCGAAGC GAGACT AGAGAC 4790 5151 VEGF [16]
TATCACTCTATTCTGTCTC AGTGAT GAGTGA 4846 4396 Survivin [9]
TCACCTTCAAACTATGTCC AAGGTG GAAGGT 4852 4063 XIAP [9]
ATTGTCTTCAGGTCTTCAGTT AGACAA AAGACA 4855 5748 KSP [12]
GCACTCCAGGGCTTCATCG GGAGTG TGGAGT 4944 5515 VEGF [16]
AAGCCCCGAAAACCGGCTT GGGGCT CGGGGC 5090 2013 c-myc [7]
TTGTCCAGGAAGTCCTCAAGTCT TGGACA CTGGAC 5201 4750 PKN3 [17]
CCAAGGCTCTAGGTGGTCA GCCTTG AGCCTT 5235 5726 bcl-xl [2]
GCACCACTAGTTGGTTGTC GTGGTG AGTGGT 5363 4425 TNFa [18]
TCATCTCAGCCACTCTGCTTT GAGATG TGAGAT 5464 5351 DYT1 [19]
GTCATCTCAGCCACTCTGCTT AGATGA GAGATG 5535 5464 DYT1 [19]
AATGCAGTATACTTCCTGA CTGCAT ACTGCA 5549 6053 HIV [10]
CACAATGGCACAGACTTCCAA CATTGT CCATTG 5565 4226 HTT [1]
CACAATGGCGCAGACTTCCAA CATTGT CCATTG 5565 4226 HTT [1]
TCTCCTCAGCCACTCTGCTTT GAGGAG TGAGGA 5692 5714 DYT1 [19]
CTCCTCAGCCACTCTGCTTTT TGAGGA CTGAGG 5714 6646 DYT1 [19]
TTCCTCAAATTCTTTCTTC TGAGGA TTGAGG 5714 5047 Survivin [9]
TTGTACATCATAGGACTAG TGTACA ATGTAC 5725 4158 K6a [11]
TTGTCTTTGAGATCCATGC AAGACA AAAGAC 5748 5347 TNFa [18]
TCAGCCCACACACAGTGCTTTG GGGCTG TGGGCT 5938 5481 ID2 [20]
TAACAAGCCAGAGTTGGTC CTTGTT GCTTGT 6008 4183 MAP4K4 [18]
TTCCAGAATTGATACTGACTT TCTGGA TTCTGG 6027 6482 CCR5 [21]
TTTCCCTTGGCCACTTCTG AGGGAA AAGGGA 6352 5684 MAP4K4 [18]
AAGCAGAGTTCAAAAGCCCTT TCTGCT CTCTGC 6576 6743 bcr-abl [22]
TTGGGGATAGGCTGTCGCC TCCCCA ATCCCC 6591 3615 HCV [23]
ATCTTCAATAGACACATCGGC TGAAGA TTGAAG 6618 5729 SOD1 [24]
TTCCCCAGCTCTCCCAGGC TGGGGA CTGGGG 6649 6671 CCR5 [10]
TTCCCCAAACCTGAAGCTC TGGGGA TTGGGG 6649 6070 HIV [10]
TTCTTCTCATTTCGACACC AGAAGA GAGAAG 6650 6048 CCR5 [10]
GTCCTGGATGATGATGTTC CCAGGA TCCAGG 6819 5883 VEGF [16]
ATTTCAGGAATTGTTAAAG CTGAAA CCTGAA 6935 5757 APOB [13]
CTTTCAGACTGGACCTCTC CTGAAA TCTGAA 6935 6689 Livin [9]
ACTGAGGAGTCTCTTGATCTT CCTCAG TCCTCA 6986 5833 CD4 [21]
AAGCAAAACAGGTCTAGAATT TTTGCT TTTTGC 7110 6603 PCSK9 [3]
CCCTCCCTCCGTTCTTTTT GGGAGG AGGGAG 7153 6058 c-myc [7]
GTTGTTTGCAGCTCTGTGC AAACAA CAAACA 7213 5301 E6/E7 [14]
ATTCTCTCTGACTCCTCTC AGAGAA GAGAGA 7338 5454 CCR5 [10]
TAATACAAAGACCTTTAAC TGTATT TTGTAT 7651 6954 HBV [4]
TATTTAAGGAGGGTGATCTTT TTAAAT CTTAAA 7880 6154 PLK1 [12]
AAGAAATCATGAACACCGC ATTTCT GATTTC 8000 4935 ID2 [20]
TAAACAAAGGACGTCCCGC TTGTTT TTTGTT 8980 8926 HBV [4]
AATTTTTCAAAGTTCCAAT AAAAAT GAAAAA 9678 8159 APOB [13]
REFERENCES CITED IN TABLE 6
[0260] 1. Pfister, et al. (2009). Five siRNAs targeting three SNPs
may provide therapy for three-quarters of Huntington's disease
patients. Curr Biol 19(9):774-8. [0261] 2. Mu, et al. (2009).
Systemic delivery of siRNA specific to tumor mediated by
atelocollagen: combined therapy using siRNA targeting Bcl-xL and
cisplatin against prostate cancer. Int J Cancer 125(12):2978-90.
[0262] 3. Frank-Kamenetsky, et al. (2008). Therapeutic RNAi
targeting PCSK9 acutely lowers plasma cholesterol in rodents and
LDL cholesterol in nonhuman primates. Proc Natl Acad Sci USA
105(33):11915-20. [0263] 4. Carmona, et al. (2009). Controlling HBV
replication in vivo by intravenous administration of triggered
PEGylated siRNA-nanoparticles. Mol Pharm 6(3):706-17. [0264] 5.
Chen, Y., J. J. Wu, and L. Huang (2010). Nanoparticles targeted
with NGR motif deliver c-myc siRNA and doxorubicin for anticancer
therapy. Mol Ther 18(4):828-34. [0265] 6. Schwulst, et al. (2008).
Bim siRNA decreases lymphocyte apoptosis and improves survival in
sepsis. Shock 30(2):127-34. [0266] 7. Napoli, et al. (2009).
Promoter-specific transcriptional interference and c-myc gene
silencing by siRNAs in human cells. Embo J 28(12):1708-19. [0267]
8. Yokota, et al. (2007). Efficient regulation of viral replication
by siRNA in a non-human primate surrogate model for hepatitis C.
Biochem Biophys Res Commun 361(2):294-300. [0268] 9. Yang, et al.
(2010). Therapeutic potential of siRNA-mediated combined knockdown
of the L4P genes (Livin, XIAP, and Survivin) on human bladder
cancer T24 cells. Acta Biochim Biophys Sin (Shanghai) 42(2):137-44.
[0269] 10. Ehsani, et al. (2010). Rational design of micro-RNA-like
bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5. Mol
Ther 18(4):796-802. [0270] 11. Smith, et al. (2008). Development of
therapeutic siRNAs for pachyonychia congenita. J Invest Dermatol
128(1):50-8. [0271] 12. Judge, et al. (2009). Confirming the
RNAi-mediated mechanism of action of siRNA-based cancer
therapeutics in mice. J Clin Invest 119(3):661-73. [0272] 13.
Burchard, J., A. L. Jackson, V. Malkov, R. H. Needham, Y. Tan, S.
R. Bartz, et al. (2009). MicroRNA-like off-target transcript
regulation by siRNAs is species specific. Rna 15(2):308-15. [0273]
14. Jonson, et al. (2008). Gene silencing with siRNA targeting
E6/E7 as a therapeutic intervention in a mouse model of cervical
cancer. Gynecol Oncol 111(2):356-64. [0274] 15. Addepalli, et al.
(2010). RNAi-mediated knockdown of AURKB and EGFR shows enhanced
therapeutic efficacy in prostate tumor regression. Gene Ther
17(3):352-9. [0275] 16. Li, S. D., S. Chono, and L. Huang (2008).
Efficient oncogene silencing and metastasis inhibition via systemic
delivery of siRNA. Mol Ther 16(5):942-6. [0276] 17. Aleku, et al.
(2008). Atu027, a liposomal small interfering RNA formulation
targeting protein kinase N3, inhibits cancer progression. Cancer
Res 68(23):9788-98. [0277] 18. Aouadi, et al. (2009). Orally
delivered siRNA targeting macrophage Map4k4 suppresses systemic
inflammation. Nature 458(7242):1180-4. [0278] 19. Hewett, et al.
(2008). siRNA knock-down of mutant torsinA restores processing
through secretory pathway in DYT1 dystonia cells. Hum Mol Genet
17(10):1436-45. [0279] 20. Gray, et al. (2008). Therapeutic
targeting of Id2 reduces growth of human colorectal carcinoma in
the murine liver. Oncogene 27(57):7192-200. [0280] 21. Kim, et al.
(2010). RNAi-mediated CCR5 silencing by LFA-1-targeted
nanoparticles prevents HIV infection in BLT mice. Mol Ther
18(2):370-6. [0281] 22. Koldehoff, et al. (2007). Therapeutic
application of small interfering RNA directed against bcr-abl
transcripts to a patient with imatinib-resistant chronic myeloid
leukaemia. Clin Exp Med 7(2):47-55. [0282] 23. Kim, et al. (2009).
Targeted delivery of siRNA against hepatitis C virus by
apolipoprotein A-I-bound cationic liposomes. J Hepatol
50(3):479-88. [0283] 24. Wang, et al. (2008). Therapeutic gene
silencing delivered by a chemically modified small interfering RNA
against mutant SOD1 slows amyotrophic lateral sclerosis
progression. J Biol Chem 283(23):15845-52.
Example 2
Therapeutic siRNAs
[0284] Using the method described in Example 1 above, additional
"safe seed" sequences were determined for the target genes
indicated in Table 7 below.
TABLE-US-00007 TABLE 7 Target ID NO. Gene Human Target site SEQ ID
NO HDS1 HTT GTCGTGGCTCGCATGGTCGAT SEQ ID NO: 34 HDS2 HTT
ATCCCGGTCATCAGCGACTAT SEQ ID NO: 35 HDS3 HTT CTGCTTCTTTGTCAGCGCGTC
SEQ ID NO: 36 HDS4 HTT GCGGGGCAGCAGGAGCGGTAG SEQ ID NO: 37 HDS5 HTT
TTCCTCTTGTTTACGACGTGA SEQ ID NO: 38 HDS6 HTT TGGGATGTAGAGAGGCGTTAG
SEQ ID NO: 39 HDS7 HTT TCCCTTGGAATGCATATCGCT SEQ ID NO: 40 HDS8 HTT
AACGTGGACCTGCCTACGGAG SEQ ID NO: 41 HDS9 HTT AGGGACAGTACTTCAACGCTA
SEQ ID NO: 42 HDS10 HTT TGGGGACAGTACTTCAACGCT SEQ ID NO: 43 HDS11
HTT AAGGAGTTCATCTACCGCATC SEQ ID NO: 44 HDS12 HTT
GAGCTGGCTCACCTGGTTCGG SEQ ID NO: 45 HDS13 HTT CTGCCCCAGTTTCTAGACGAC
SEQ ID NO: 46 HDS14 HTT TGCCCCAGTTTCTAGACGACT SEQ ID NO: 47 HDS15
HTT GCCCCAGTTTCTAGACGACTT SEQ ID NO: 48 HDS16 HTT
CCCCAGTTTCTAGACGACTTC SEQ ID NO: 49 HDS17 HTT CAGCTACCAAGAAAGACCGTG
SEQ ID NO: 50 HDS18 HTT CTGCTGTGCAGTGATGACGCA SEQ ID NO: 51 HDS19
HTT ATGGAGACCCACAGGTTCGAG SEQ ID NO: 52 HDS20 HTT
TTCCGTGTGCTGGCTCGCATG SEQ ID NO: 53 HD521 HTT TCCGTGTGCTGGCTCGCATGG
SEQ ID NO: 54 HDS22 HTT CTGGCTCGCATGGTCGACATC SEQ ID NO: 55 HDS23
HTT CACCCTTCAGAAGACGAGATC SEQ ID NO: 56 HDS24 HTT
AACCTTTTCTGCCTGGTCGCC SEQ ID NO: 57 HDS25 HTT GAGGATGACTCTGAATCGAGA
SEQ ID NO: 58 HDS26 HTT CCGGACAAAGACTGGTACGTT SEQ ID NO: 59 SCA1.S1
ATXN1 AAGCAACGACCTGAAGATCGA SEQ ID NO: 60 SCA1.S2 ATXN1
CTGGAGAAGTCAGAAGACGAA SEQ ID NO: 61 SCA1.S3 ATXN1
AACCAAGAGCGGAGCAACGAA SEQ ID NO: 62 SCA7.S1 ATXN7
ACGGGACAGAATTGGACGAAA SEQ ID NO: 63 SCA7.S2 ATXN7
GTGGAAAAGATTCATCCGAAA SEQ ID NO: 64 SCA7.S3 ATXN7
CAGGGTAGAAGAAAACGATTT SEQ ID NO: 65 SCA7.S4 ATXN7
CGGCTCAGGAAAGAAACGCAA SEQ ID NO: 66 SCA2.S1 ATXN2
CCCCACATGGCCCACGTACCT SEQ ID NO: 67 SCA2.S2 ATXN2
ATCCAACTGCCCATGCGCCAA SEQ ID NO: 68 SCA2.S3 ATXN2
CGCCAATGATGCTAATGACGA SEQ ID NO: 69 SCA2.S4 ATXN2
CAGCCCATTCCAGTCTCGACA SEQ ID NO: 70 SCA2.S5 ATXN2
ACCCCACATGGCCCACGTACC SEQ ID NO: 71 SCA2.S6 ATXN2
AGCCCATTCCAGTCTCGACAA SEQ ID NO: 72 SCA2.S7 ATXN2
TCCCAATGATATGTTTCGATA SEQ ID NO: 73 SCA2.S8 ATXN2
TCCCAATGATATGTTTCGATA SEQ ID NO: 74
Example 3
Preclinical Safety of RNAi-Mediated HTT Suppression in the Rhesus
Macaque as a Potential Therapy for Huntington's
[0285] To date, a therapy for Huntington's disease (HD), a genetic,
neurodegenerative disorder, remains elusive. HD is characterized by
cell loss in the basal ganglia, with particular damage to the
putamen, an area of the brain responsible for initiating and
refining motor movements. Consequently, patients exhibit a
hyperkinetic movement disorder. RNA interference (RNAi) offers
therapeutic potential for this disorder by reducing the expression
of HTT, the disease-causing gene. We have previously demonstrated
that partial suppression of both wild-type and mutant HTT in the
striatum prevents behavioral and neuropathological abnormalities in
rodent models of HD. However, given the role of HTT in various
cellular processes, it remains unknown whether a partial
suppression of both alleles will be safe in mammals whose
neurophysiology, basal ganglia anatomy, and behavioral repertoire
more closely resembles that of a human. Here, we investigate
whether a partial reduction of HTT in the normal non-human primate
putamen is safe. We demonstrate that a 45% reduction of rhesus HTT
expression in the mid- and caudal putamen does not induce motor
deficits, neuronal degeneration, astrogliosis, or an immune
response. Together, these data suggest that partial suppression of
wild-type HTT expression is well tolerated in the primate putamen
and further supports RNAi as a therapy for HD.
[0286] Huntington's disease (HD) is a fatal, dominantly inherited,
neurodegenerative disorder caused by an expanded trinucleotide
(CAG) mutation in the HTT gene on chromosome 4. The encoded
protein, mutant huntingtin (mHTT), contains an expanded
polyglutamine stretch at the N-terminus, conferring a toxic gain of
function. Over time, mHTT induces the formation of inclusions,
cellular dysfunction, and neurodegeneration throughout the basal
ganglia and overlaying cortex. Cell loss in HD is accompanied with
upregulation of reactive astrocytes (astrogliosis) and activation
of microglia, the resident immune cells of the brain. Although cell
loss is observed in multiple brain regions, neuropathology is most
pronounced in the medium-sized spiny neurons of the putamen and the
caudate, regions of the brain which are critical for the initiation
and refinement of motor programs, procedural learning, and various
aspects of cognitive function. Accordingly, HD patients are
afflicted with involuntary hyperkinetic movements of the torso,
arms, legs, and face (known as chorea) with concomitant gait and
coordination difficulties, working memory deficits, and a variety
of emotional disturbances.
[0287] To date, HD remains incurable. While several therapies have
shown promise in rodent models of the disease, including glutamate
antagonists, bioenergetic supplements, caspase inhibitors,
antihistaminergic agents (HORIZON trial) and fetal tissue
transplantation, none have made a significant impact on disease
prevention or extension of life span when evaluated in clinical
trials. As a result, current treatment strategies are primarily
aimed at palliative care to treat disease symptoms and improve
end-stage quality of life measures. With the elucidation of the
causative HD mutation in 1993, therapies can now be tailored toward
reducing expression of the deleterious gene itself, which may have
a higher clinical impact compared to strategies aimed at targeting
downstream consequences of mHTT.
[0288] Recently, it has become clear that endogenous, small
microRNAs (miRNAs) play a vital role in regulating the expression
of genes during development, throughout adulthood and can
contribute to disease states. Endogenous miRNA machinery can be
co-opted and used to suppress genes of interest. Exogenous
expression of engineered miRNAs as triggers for RNA interference
(RNAi) confers a robust decrease in gene expression and has been
investigated as a therapeutic tool to silence expression of disease
alleles. Inarguably, the preferred mechanism to treat HD would be
to specifically target the mutant allele while leaving the normal
allele intact. As a proof-of-principle, the benefit of
allele-specific silencing has been demonstrated by our laboratory
members and others in rodent models of HD, wherein inhibitory RNAs
were designed to silence the human mHTT transgene and not
endogenous mouse Htt. (Huang, et al. (2007). High-capacity
adenoviral vector-mediated reduction of huntingtin aggregate load
in vitro and in vivo. Hum Gene Ther 18: 303-311; Franich et al.
(2008). AAV vector-mediated RNAi of mutant huntingtin expression is
neuroprotective in a novel genetic rat model of Huntington's
disease. Mol Ther 16: 947-956; Harper et al. (2005). RNA
interference improves motor and neuropathological abnormalities in
a Huntington's disease mouse model. Proc Natl Acad Sci USA 102:
5820-5825) Additionally, several single nucleotide polymorphisms
(SNPs) that differentiate up to 80% of diseased and normal alleles
have been identified in the human population. (Pfister, et al.
(2009). Five siRNAs targeting three SNPs may provide therapy for
three-quarters of Huntington's disease patients. Curr Biol 19:
774-778) However, the utility of these SNPs for RNAi-based
silencing strategies have not been tested in vivo and importantly,
will be unusable for a significant number of HD patients.
[0289] Thus, an alternative strategy is to partially reduce
expression of both the mutant and normal allele in regions of the
brain most affected by the disease, a therapy that would be
applicable to all HD patients. Because normal HTT has been found to
play a functional role in the adult brain, with proposed roles in
mediating transcription and axonal transport, nonallele-specific
RNAi treatment for HD must demonstrate therapeutic benefit of
reducing the mutant allele, as well as the safety and tolerability
of partially suppressing the normal allele. Over the past
half-decade, we have used recombinant adeno-associated viral
vectors (rAAV) to deliver RNAi silencing constructs to the striatum
and showed that a 60% reduction of human mHTT and endogenous
wild-type mouse Htt was well tolerated and prevented motor and
neuropathological deficits in transgenic mouse models of HD.
Additionally, lentiviral delivery of inhibitory RNAs in a rat model
of HD conferred a 35% knockdown of Htt gene expression (both mutant
and wild-type alleles) and was safe and beneficial (both
neuroanatomical and behavioral benefits) out to 9 months after
injection. Furthermore, heterozygous Htt knockout mice are
phenotypically normal, and humans with only one copy of HTT (50%
reduction of normal HTT production) show no abnormal behavioral
deficits, suggesting that nonallele-specific reduction of HTT
expression may be safe.
[0290] While findings from rodent models are encouraging, it is
essential to evaluate the safety of partial HTT suppression in an
animal that more closely resembles humans with regards to the size,
anatomy, and neurophysiology of its basal ganglia as well as its
behavioral capabilities prior to RNAi evaluation in human HD
patients. Therefore, in this study, we assessed the safety of
reduced HTT expression in the rhesus macaque putamen. We
demonstrate a partial, sustained HTT reduction in the putamen
without the development of abnormal motor phenotypes, altered
circadian behavior, fine motor skill deficits, neuronal loss,
gliosis, or an immune response, thus bringing RNAi closer to the
clinic as a potential therapy for HD.
[0291] Results
[0292] AAV2/1 Distribution and HTT Suppression in the Putamen
[0293] A sequence that silences mouse, rhesus, and human HTT and a
control sequence were cloned into an artificial miRNA backbone
based on miR-30 and subsequently cloned into AAV, serotype 1,
vectors. (Boudreau, R L, Monteys, A M and Davidson, B L (2008).
Minimizing variables among hairpin-based RNAi vectors reveals the
potency of shRNAs. RNA 14: 1834-1844) Expression of the HD-specific
miRNA (miHDS1) and the control miRNA (miCONT) was driven by a mouse
U6 promoter. Enhanced GFP (eGFP) was driven from a cytomegalovirus
(CMV) promoter to allow for assessment of vector distribution
following injection into the putamen. Both miHDS1 (targeting a
sequence in exon 52 of rhesus HTT mRNA) and miCONT (a control
miRNA) were designed using "safe seed" guidelines to optimize
safety and minimize potential off-target gene silencing.
[0294] Prior to in vivo assessment in the rhesus macaque putamen,
we first verified HTT mRNA suppression by in vitro transfection of
AAV shuttle plasmids expressing miHDS I, miCONT, or eGFP in human
HEK293 cells as well as rhesus primary fibroblasts generated at the
Oregon National Primate Research Center (50% and 32% reduction of
relative HTT/18S mRNA expression, respectively). Additionally, 60%
silencing of striatal Htt mRNA expression, without toxicity, was
verified 4 weeks following injection of AAV2/1-miHDS1 injections
into both wild-type and BACHD transgenic mice.
[0295] Following verification of effective HTT mRNA suppression in
vitro and in mice, eleven rhesus macaques received bilateral,
MRI-guided stereotaxic injections of either AAV2/1-miHDS1eGFP
(therapeutic miRNA, n=4), AAV2/1-miCONT-eGFP (control miRNA, n=4)
or AAV-eGFP (viral vector control, n=3) into the commissural and
postcommissural putamen (posterior half of the entire putamen).
Animals were assessed prior to and for six weeks postsurgery on a
variety of general behavior and motor skill assays and euthanized
for molecular (tissue punches taken from the left hemisphere) and
histological analyses (immuno-stained sections through the right
hemisphere). Putamen samples transduced with AAV2/1 (2.times.4 mm)
were obtained from the left hemisphere of unfixed, coronal brain
slabs at necropsy. Quantitative polymerase chain reaction (QPCR)
using primers flanking the miHDS1 targeting site in exon 52
demonstrated a significant reduction of rhesus HTT mRNA transcripts
(45%, P<0.01) following injection with AAV1-miHDS1 compared to
AAV-eGFP control-treated putamen. We have previously demonstrated,
in separate experiments, that similar levels of silencing of either
mutant human or wild-type Htt transcripts in mouse striatum cause
marked reductions in the respective proteins. (McBride et al.
(2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the
brain: implications for the therapeutic development of RNAi. Proc
Natl Acad Sci USA 105: 5868-5873; Boudreau et al. (2009).
Nonallele-specific silencing of mutant and wild-type huntingtin
demonstrates therapeutic efficacy in Huntington's disease mice. Mol
Ther 17: 1053-1063) eGFP immunohistochemistry was conducted to
assess viral vector distribution throughout the basal ganglia.
eGFP-positive cells were observed throughout the mid- and posterior
putamen, indicating accurate needle placements during surgery.
Immunofluorescence staining, using eGFP fluorescence as a
reference, demonstrated AAV2/1 transduction in dopamine- and
cAMP-regulated neuronal phosphoprotein (DARPP-32)-positive medium
spiny projection neurons, choline acetyltransferase (ChAT)-positive
large, cholinergic interneurons, and glial fibrillary acid protein
(GFAP)-positive astrocytes throughout the putamen. eGFP-positive
cells did not co-localize with IBA-1-stained microglia. In addition
to eGFP-positive neurons, astrocytes and fibers observed in the
putamen, eGFP-positive cell bodies, and fibers were also seen in
other regions of the basal ganglia which receive projections from
and project to the putamen. These include the internal and external
segments of the globus pallidus), the subthalamic nucleus (fibers
only), and the substantia nigra pars reticulata. eGFP expression in
the cortex was limited to the needle tracts, suggesting that AAV2/1
was not transported anterogradily and retrogradily to the cortex,
as was observed in other regions.
[0296] Unbiased stereology was employed to quantify the area
fraction of putamen containing eGFP-positive cells and fibers using
serial sections stained with anti-eGFP antibody. Results
demonstrated an area fraction of eGFP-positive cells in the
commissural and postcommissural putamen of 30.+-.2.0% for
AAV-eGFPinjected animals, 29.+-.3.0% for AAV-miCONT-injected
animals, and 30.+-.3.0% for AAV-miHDS1 animals with no significant
differences between groups (P>0.05). Additionally,
quantification of the estimated volume of putamen containing
eGFP-positive cells and fibers was performed. The mean estimated
volume of transduced putamen was 1.0e11.+-.1.7e10 .mu.m.sup.3 for
AAVGFP-injected animals, 8.5e10.+-.5.6e9 .mu.m.sup.3 for AAV-miCONT
injected animals, and 9.9e10.+-.1.6e10 .mu.m.sup.3 for AAV-miHDS1
animals. No significant difference in volume was found between
treatment groups (P>0.05). A three-dimensional model of
AAV2/1-transduced putamen (right hemisphere only) was created for
each animal using Stereo Investigator software. The 3D rendering
allows for the visualization of the three injection sites as well
as the spread of vector following surgery. The anterior-posterior
(A-P) distribution of eGFP-positive cells, a one-dimensional
measure of AAV2/1 distribution from rostral to caudal, was
determined from one hemisphere of each of the eleven
AAV2/1-injected animals. The mean A-P distribution for transduced
putamen was 10.0.+-.1.0 mm for AAV-GFP-injected animals,
9.5e10.+-.1.0 mm for AAV-miCONT animals, and 9.5.+-.0.58 mm for
AAV-miHDS1 animals with no significant differences in spread
between groups (Table 8, P>0.05).
TABLE-US-00008 TABLE 8 Measurement of anterior-posterior spread of
eGFP-positive regions of the putamen in individual animals injected
with AAV2/1-eGFP (n = 3), AAV-miHds1 (n = 4), or AAV2/1-micont (n =
4) Animal Id Group AP spread (mm) Rh24522 AAV2/1-eGFP 10.0 Rh24906
AAV2/1-eGFP 9.0 Rh25433 AAV2/1-eGFP 11.0 Mean .+-. SD 10 .+-. 1.0
Rh24277 AAV2/1-miHDS1 10.0 Rh24353 AAV2/1-miHDS1 9.0 Rh24530
AAV2/1-miHDS1 9.0 Rh25300 AAV2/1-miHDS1 10.0 Mean .+-. SD 9.5 .+-.
0.58 Rh24377 AAV2/1-miCONT 9.0 Rh25150 AAV2/1-miCONT 11.0 Rh25388
AAV2/1-miCONT 9.0 Rh25416 AAV2/1-miCONT 9.0 Mean .+-. SD 9.5 .+-.
1.0
[0297] HTT Suppression does not Induce Motor Skill Deficits
[0298] To assess whether partial HTT suppression in the putamen, a
region of the brain heavily involved in initiating, executing, and
refining motor movement, induces motor perturbations, a variety of
behavioral assays were used to evaluate the monkeys prior to and
for six weeks following surgery. We chose behavioral assays that
allowed for the detection of changes in whole body movements in the
homecage over 24-hour spans, more specific coordinated movements of
the arms and legs and learned tasks requiring higher levels of
dexterity of the forearms and digits.
[0299] To collect daytime and nighttime homecage activity, animals
were fitted with nylon or aluminum collars that housed an enclosed
Actical accelerometer. All monkeys wore activity collars for 3
weeks prior to surgery. The Actical monitor contains an
omnidirectional sensor that integrates the speed and distance of
acceleration and produces an electrical current that varies in
magnitude depending on a change in acceleration. The monitors were
programmed to store the total number of activity counts during each
1-minute epoch. For daytime activity, a repeated measures ANOVA
failed to detect significant differences between treatment groups,
F (2,64)=0.17, P=0.84, suggesting that a partial reduction of HIT
in the commissural and postcommissural putamen does not alter
general homecage activity levels compared to controls. A
significant effect was indicated for time, F (8, 64)=2.4,
P<0.05, and Holms-Sidak pairwise comparisons showed that daytime
activity during the week immediately following surgery (+1) was
significantly less than the activity exhibited during week -2
(P<0.001) or week +5 (P<0.001), likely owing to a small
decrease in overall daytime activity while animals recovered from
surgery. No group differences were observed (P=0.45). Likewise, for
night time homecage activity, a repeated measures ANOVA indicated
no significant differences between treatment groups F (2,64)=0.189,
P=0.83, nor over time F (8,64)=1.43, P=0.20. Similarly, no
interaction was indicated (P=0.64). In addition to overall
circadian homecage activity, body weight from each animal was
recorded at surgery and at necropsy, and no decrease in weight was
detected in any animal (P>0.05).
[0300] Potential changes in fine motor skills of left and right
forelimbs and digits were assessed using the Lifesaver test of
manual dexterity originally described by Bachevalier et al. (1991,
Agen monkeys exhibit behavioral deficits indicative of widespread
cerebral dysfunction. Neurobiol Aging 12: 99-111) and further
modified by Gash and colleagues (1999, An automated movement
assessment panel for upper limb motor functions in rhesus monkeys
and humans. J. Neurosci Methods, 89: 111-117). Animals were
transported from their homecage to a Wisconsin General Testing
Apparatus in a separate behavioral room and trained to remove hard,
round treats from a straight medal rod (straight post). For the
straight post, animals were assessed 2 weeks prior to surgery to
collect baseline data and weekly for 6 weeks after surgery (two
trials per forelimb each day, twice a week). No statistical
difference was detected in the latencies to remove stimuli from
posts between the right and left hands. Consequently, the right and
left hand data were collapsed, and averages were used for all
analyses. A repeated measures, two-way ANOVA indicated a
significant main effect of time over the testing trials, F (6,
48)=27.5, P<0.0001, indicating that animals from all treatment
groups removed the treat from the post with shorter latencies
(faster performance) as the study progressed. By contrast, no
significant effects were found between the treatment groups, F
(2,48)=0.07, P=0.99, nor for an interaction (P=0.55), indicating
that AAV-miHDS1-treated animals performed with the same speeds as
animals from both control groups. For the Lifesaver task using the
question mark shaped post, animals received no training prior to
surgery so that we could assess each animal's ability to learn a
new and more difficult task (procedural learning) following
AAV-miHDS1 injection into the putamen. Beginning 2 weeks following
surgery and each week thereafter, latencies to successfully remove
each treat off the question mark shaped post were recorded (two
trials per forelimb each day, twice a week). A repeated measures
two-way ANOVA failed to indicate significant differences between
groups, F (2,28)=0.573, P=0.58, or over testing trials, F
(4,28)=0.61, P=0.652 nor for an interaction (P=0.93). These data
show that animals from all treatment groups were able to complete
the question mark post task with equal speed and that HTT
suppression did not alter the ability of the AAV-HDS1-treated
animals to (1) learn a new behavioral task or (2) exhibit fine
motor skills on a difficult task compared to controls.
[0301] Additionally, we developed a non-human primate-specific,
preclinical motor rating scale (MRS) that was modified from the
Unified Huntington's Disease Rating Scale used for evaluating motor
performance in HD patients. We designed the MRS to specifically
assess putamen-based behavioral phenotypes in monkeys including
horizontal and vertical ocular pursuit, treat retrieval with both
forelimbs, ability to bear weight on both hindlimbs, posture,
balance, and startle response. In addition, the scale includes
negative motor phenotypes seen in HD or cases of putamen
dysfunction including bradykinesia (slowness of movement), dystonia
(involuntary, sustained muscle contraction), and chorea
(involuntary, hyperkinetic movement) of each limb and trunk.
Possible scores ranged from 0 (normal phenotype) to 3 (severely
abnormal phenotype) for a total of 72 possible points. Animals were
rated by three, independent observers blind to treatment group and
familiar with nonhuman primate behavioral repertoires; inter-rater
reliability was 100%. All animals were evaluated in their homecage
and were rated once prior to surgery and each week thereafter for
the duration of the study. Kruskal-Wallis statistical analysis
revealed a significant difference between the three treatment
groups (H(2)=9.30, P=0.010). However, this difference is due to one
AAVmiCONT-injected animal that exhibited a very mild but
progressive dystonia in one hind leg (animal 25150). A Dunn's
pairwise comparison shows no difference between AAV-miHDS1-injected
animals compared to AAV-eGFP-injected controls, demonstrating that
a partial HTT suppression in the mid- and posterior putamen did not
alter normal putamen-based behavior nor induce diseased phenotypes
commonly seen with neuronal dysfunction or degeneration in the
putamen.
[0302] HTT Suppression does not Cause Neuronal Degeneration,
Gliosis, or Inflammation
[0303] To address whether HTT reduction in cells of the putamen
caused neuronal degeneration, we evaluated potential neurotoxicity
by immunohistochemical staining for eGFP to identify transduced
regions of the putamen, NeuN (neuronal marker), GFAP (astrocytic
marker), and Iba1 (microglial marker). Coronal brain section were
stained using standard DAB immunohistochemistry, and adjacent
sections were compared for signs of neuron loss, increases in
astrocyte proliferation (reactive astrocyosis) or increases in
reactive microglia in AAV-miHDS1-treated monkeys compared to
controls. Compared to AAV-eGFP- and AAV-miCONT-injected controls,
AAV-miHDS1-injected animals showed no loss of NeuN-positive neurons
in the putamen. Cresyl violet (Nissl) staining of adjacent coronal
brain section s further supported a lack of neuronal loss. To
assess whether partial HTT suppression was associated with cellular
dysfunction, in contrast to frank neuronal loss, we performed QPCR
analysis for DARPP-32, a highly expressed protein in GABA-ergic
projection neurons of the putamen. DARPP-32 is a key mediator in
numerous signal transduction cascades, and its downregulation has
been reported in cases of medium spiny neuronal dysfunction in the
absence of NeuN downregulation. Consequently, DARPP-32 is a valid
and reliable readout of neuronal function in the putamen. QPCR
analysis of transduced regions of the putamen found no significant
decrease of DARPP-32 mRNA expression in monkeys injected with
AAV-miHDS1 compared to controls (P>0.05).
[0304] Coronal stained sections from all treatment groups showed a
mild increase in GFAP-positive astrocytes in transduced regions,
likely due to the injection itself and not a reduction in HTT since
equal astrocytosis was observed in all groups. IBA-1-stained
sections from animals in each group showed no increases in
activated microglia, except for within the injection tracts, likely
due to physical perturbation of parenchyma by the needle. To
further assess inflammation, expression of the pro-inflammatory
cytokines interleukin 1-.beta. (IL1-.beta.) and tumor necrosis
factor-.alpha. (TNF-.alpha.) was measured from transduced regions.
Both of these cytokines are upregulated and released from
astrocytes and microglia in response to distressed, neighboring
neurons in the brain. QPCR analysis showed no significant increases
in IL1-.beta. (P>0.05) or TNF-.alpha. (P>0.05) in
AAV-miHDS1-treated monkeys compared to AAVeGFP control animals.
Interestingly, monkeys injected with AAV-miCONT showed a
significant decrease in TNF-alpha expression compared to both
AAV-eGFP-(P<0.05) and AAV-miHDS1-(P<0.05) animals.
[0305] Lack of Peripheral Immune Response Following AAV1-miRNA
Delivery to the Putamen
[0306] Previous studies have shown that peripheral T cells
infiltrate the brain following injury or infection. Thus, in
addition to assaying for local inflammatory and immune responses in
the putamen, cell-mediated and humoral responses were evaluated to
determine whether AAV-mediated suppression of HTT induced
peripheral immune responses. Relative CD4 and CD8 mRNA expression
levels were determined by QPCR to address whether AAV suppression
of HTT induced infiltration of peripheral helper or cytotoxic T
cells, respectively. No significant differences were seen between
groups in either CD4 or CD8 mRNA expression in transduced putamen
samples (P>0.05). Also, no inflammatory infiltrates were noted
on Nissl-stained sections from treated animals. To test if anti-AAV
antibodies were induced after injection, an in vitro neutralizing
antibody (Nab) assay was performed on serum collected from each
animal immediately prior to surgery and at necropsy (6 weeks after
injection). HuH7 cells were infected with AAV2/1 expressing LacZ in
the presence of serial dilutions of rhesus serum. The transduction
assay showed that the cohort of rhesus macaques used for this study
displayed varying levels of neutralizing antibodies to AAV2/1 in
their serum prior to surgery ranging from undetectable titers
(<1:5) to the highest titer of 1:160. Four of the 11 animals
showed increases in AAV2/1 Nab levels at necropsy but these
increases were minor (two- to fourfold). Neither presurgical Nab
levels nor the fold change in Nab expression from presurgery to
necropsy correlated with levels of eGFP expression in the putamen
(Pearson's correlation, r=-0.24, P=0.49 and Spearman correlation
(r=0.01, P=0.9, respectively).
DISCUSSION
[0307] Here, we present novel data showing that a partial reduction
of HTT expression in the rhesus macaque putamen is well tolerated
out to 6 weeks after injection. We used a multifaceted approach to
assess the ability of RNAi to reduce HTT and address whether such
suppression would induce behavioral or neuropathological
consequences by combining assays of gross and fine motor skills
with postmortem immunohistochemical, stereological, and molecular
analyses of neuronal, glial, and immune profiles. Our silencing
construct, miHDS1, was designed such that the target mRNA sequence
displays homology to rodent, rhesus macaque, and human HTT.
Therefore, HTT reduction and tolerability can be seamlessly
evaluated in transgenic mice and non-human primates. Importantly,
the same sequence evaluated preclinically may be utilized to
evaluate safety of HTT suppression in a phase 1 clinical trial.
[0308] The selection of our injection sites in the mid- and
posterior putamen was based upon the primate putamen's functional
rostral-caudal gradient. Lesions of the posterior aspect of the
putamen with excitotoxins or lentiviral-mediated delivery of
mutated Htt elicit hyperactivity, choreiform movements,
stereotypes, and/or dyskinetic movements of the limbs (either
spontaneously or following apomorphine administration).
Correspondingly, we have previously observed motor dysfunction
detected via the Lifesaver assay and MRS following moderate
neuronal loss in the mid- and posterior putamen (unpublished
results from our laboratory). By contrast, lesions of the anterior
putamen fail to produce similar dyskinesias. These disparate
effects correspond with the inputs to the mid- and posterior
putamen from the primary sensorimotor cortices including the
premotor and supplementary motor areas as well as the primary motor
area. By contrast, the anterior primate putamen receives cortical
inputs from the frontal association areas, the dorsolateral
prefrontal cortices, and the pre-supplementary motor area.
Consequently, to assess the tolerability of partial HTT suppression
in the mid- and posterior putamen, we employed three behavior tests
that assess putamen-associated behaviors. First, to assess
potential changes in general activity, we continually assessed
homecage activity over the duration of the experiment using
omnidirectional activity monitors placed in collars on the animals.
No differences in daytime or nighttime activity were found between
groups.
[0309] In an effort to detect more subtle abnormalities of limb
use, muscle tone, eye movements, posture or balance, we devised a
MRS based upon the clinical Unified Huntington Disease Motor Rating
Scale. Our rubric assessed 24 discrete behaviors and revealed that
10 of the 11 animals showed no behavior anomalies. One
AAV-miCONT-injected control animal (no. 25150) displayed a mild
dystonia in his left leg. The increased muscle tone in the leg was
noted on day 12 subsequent to surgery and may be the result of
trauma, infection from the surgical procedure or a perturbation in
the putamen due to the injection itself.
[0310] To challenge the functional integrity of the mid- and
posterior putamen and its circuits, all animals were trained to
perform the Lifesaver task. The task requires the animals to
rapidly perform a sequence of muscle movements in the arm, hand,
and fingers to obtain a reinforcer. For the straight post task,
animals were trained for 21 days prior to the initiation of the
experiment in an effort to increase animals' efficiency, skill, and
speed of performance. Evidence suggests that over-learned
sequential hand movements require the functional integrity of the
posterior sensorimotor putamen in monkeys and in humans. Consistent
with homecage activity and motor ratings, there were no differences
in the performance of the straight post task between the HDS1
animals and the controls, again supporting the notion that
knockdown of normal HTT in the mid- and posterior putamen does not
significantly diminish the functional integrity of its
circuits.
[0311] In contrast to the posterior regions, the anterior and
mid-levels of the putamen are known to play an essential role in
learning new hand movement sequences. Whereas our intraputamen
injections did not cover the entire anterior putamen, eGFP
transfection was observed in sections .about.3 mm rostral to the
anterior commissure. Thus, to assess the potential disruption of a
procedural learning circuit, we presented a novel question
mark-shaped post 2 weeks following surgery. Despite never being
trained on the distinctively shaped post, all groups successfully
learned to perform the task at equal rates, suggesting that the
relevant putamen circuits were functionally intact. Thus,
consistent with homecage activity and motor rating data, partial
knockdown of endogenous HTT in the mid- and posterior putamen did
not diminish the execution of a previously learned motor task nor
impair the acquisition of novel manual dexterity task.
[0312] We observed robust eGFP expression in both neurons and
astrocytes throughout the commissural and postcommissural putamen
following injection of each construct. Here, AAV2/1 transduced both
DARPP-32-positive medium spiny projection neurons and ChAT-positive
large, aspiny interneurons. While medium spiny neurons show the
most dramatic cell loss in HD, the large cholinergic neurons are
also affected by mHTT. Cholinergic interneurons exhibit decreased
levels of ChAT and decreased levels of acetylcholine release in
transgenic mouse models of HD as well as HD patients. In contrast
to the findings presented here, and by other groups (Dodiya, et al.
(2010). Differential transduction following basal ganglia
administration of distinct pseudotyped AAV capsid serotypes in
nonhuman primates. Mol Ther 18: 579-587) using eGFP as a reporter
gene, primarily astrocytic transduction was seen following
injection of AAV2/1 expressing humanized renilla GFP (hrGFP) into
the cynomolgus macaque putamen. (Hadaczek, et al. (2009).
Transduction of nonhuman primate brain with adeno-associated virus
serotype 1: vector trafficking and immune response. Hum Gene Ther
20: 225-237.) Additionally, a robust anti-hrGFP antibody response
was also observed, along with CD4.sup.+ lymphocyte infiltration and
local microglial responses, suggesting that hrGFP may be less well
tolerated in the non-human primate putamen compared to eGFP.
[0313] Our finding that AAV2/1 transduces astrocytes, as well as
neurons, in the putamen may provide additional benefit in animal
models of the disease and in HD patients. While most therapeutic
strategies for HD have targeted vulnerable neurons, a growing body
of evidence has demonstrated that astrocytes also contain
mHTT-positive inclusion bodies. Astrocytes expressing mHTT contain
fewer glutamate transporters and are less capable of protecting
against glutamate-mediated excitotoxicity. Additionally, Bradford
and colleagues demonstrated that double transgenic HD mouse models
expressing truncated mHTT in both neurons and glia exhibit more
severe neurological symptoms than mice expressing mHtt in neurons
alone (Bradford, et al. (2010). Mutant huntingtin in glial cells
exacerbates neurological symptoms of Huntington disease mice. J
Biol Chem 285: 10653-10661). Thus, partially suppressing HTT in
both neurons and glia may have a more robust clinical impact.
[0314] eGFP-positive neurons and fibers, but not glia, were also
found in the internal and external globus pallidus as well as the
substantia nigra pars reticulata, indicating retrograde and
anterograde transport of the vector, respectively. eGFP-positive
fibers only were seen in the subthalamic nucleus. These findings
may have important clinical implications for HD as these regions of
the basal ganglia also undergo mHTT-induced cell loss and gliosis.
Injections into a single brain region (putamen) may have the
capability of therapeutically targeting multiple vulnerable brain
regions. Specifically, transduced neurons in the globus pallidus
and substantia nigra should also express HTT-specific miRNAs and
may therefore be amenable to RNAi therapy. Ongoing analyses in our
laboratory are currently investigating the levels of miRNA
expression and concomitant levels of HTT mRNA suppression in these
brain regions.
[0315] Our immunohistochemical and molecular results demonstrate a
significant 45% decrease in HTT, a level of suppression which has
shown therapeutic benefit in mouse models of HD without inducing
toxicity (targeting both mutant and wild-type alleles). This level
of suppression did not induce NeuN-positive cell loss or
downregulate DARPP-32 expression. We detected a very mild
upregulation of GFAP-positive astrocytes in transduced regions of
the putamen. Because astrogliosis was detected in animals from all
three groups, it was not due to a reduction in Htt expression in
neighboring neurons. Rather, the mild astrogliosis was likely due
to the injection itself. Because brains were evaluated at 6 weeks
after injection, this low level of gliosis would be predicted to
decrease over time. Importantly, we saw no upregulation in reactive
microglia or pro-inflammatory cytokine expression which would be
predicted to increase if HTT reduction induced neural toxicity.
[0316] Recombinant AAV gene transfer to the intact CNS has been
shown to elicit a minimal T cell-mediated response without a
salient plasma cell-mediated immune response in preclinical animal
studies. Additionally, encouraging findings from recent early-stage
gene therapy clinical trials for Canavan's Disease (CD),
Parkinson's Disease (PD), and Leber's congenital amaurosis (LCA)
wherein AAV, serotype 2, was directly injected into the brain
parenchyma (CD, PD) or the retina (LCA), demonstrated only mild
increases in Nab levels after injection with no signs of
inflammation or adverse neurological events. The results here
further support these findings and demonstrate that although
monkeys had a range of preexisting, circulating Nab levels prior to
surgery (from undetectable up to 1:160), there was no major
increase in Nab levels (two- to fourfold maximum) 6 weeks after
injection. Moreover, despite the minor increase in Nab levels in
4/11 animals, there was no correlation of Nab levels with the area
fraction of GFP.sup.+ cells in the putamen. Interestingly, the
presence of preexisting Nab titers at the upper range of what we
report has been shown to substantially abrogate gene expression
following systemic, intravascular injection of varying serotypes of
AAV to target either brain or peripheral tissues. Our data are
encouraging and suggest that even though NHPs and humans have
natural circulating antibodies to AAV2/1, as well as other
serotypes, a preexisting antibody load, at least up to the values
reported here, will not limit gene transfer and should not be an
exclusion criteria for clinical trials involving direct brain
injections.
[0317] In summary, our results in the rhesus macaque brain further
support and extend previous experiments in rodents demonstrating
the safety and efficacy of a nonallele-specific HTT reduction.
These findings, along with the well-established safety profile of
rAAV in early phase clinical trials for a variety of neurological
disorders, underscore the potential of viral-mediated RNAi as a
therapy for HD.
[0318] Materials and Methods
[0319] Animals.
[0320] Eleven normal adult rhesus macaques of Indian origin (male,
7-10 kg) were utilized in this study. All monkeys were maintained
one per cage on a 12-hour on/12-hour off lighting schedule with ad
libitum access to food and water. All experimental procedures were
performed according to Oregon National Primate Research Center and
Oregon Health and Science University Institutional Animal Care and
Use Committee and Institutional Biosafety Committee approved
protocols.
[0321] RNAi Constructs and Viral Vector Production.
[0322] All siRNAs were generated using an algorithm developed to
reduce the off-targeting potential of the antisense sequences. (See
Example 1 above) siRNA sequences targeting either a sequence in
exon 52 of mouse, rhesus, and human huntingtin or a control siRNA
were embedded into an artificial miRNA scaffold comparable to human
miR-30 to generate miHDS1 (pri:
5'-AGUGAGCGAUGCUGGCUCGCAUGGUCGAUACUGUAAAGCCACAGAUGGGUGU
CGACCAUGCGAGCCAGCACCGCCUACU-3', predicted antisense sequence in
bold, nucleotides 5-83 of SEQ ID NO: 33) or miCONT (pri:
5'-AGUGAGCGCAGCGAAC
GACUUACGCGUUUACUGUAAAGCCACAGAUGGGUAAACGCGUAAGUCGUUCG CUACGCCUACU
(SEQ ID NO: 200), predicted antisense sequence in bold). Artificial
miRNA stem loops were cloned into a mouse U6 expression vector, and
the expression cassettes were subsequently cloned into
pFBGR-derived plasmids which coexpress CMV-driven GFP. Shuttle
plasmids (pAAVmiHDSI-GFP and pAAVmiCONT-GFP) contain the respective
transcriptional units which are flanked at each end by AAV serotype
2 145-bp inverted terminal repeat sequences. rAAV production was
performed using the Baculovirus AAV System. (Smith, R H, Levy, J R
and Kotin, R M (2009). A simplified baculovirus-AAV expression
vector system coupled with one-step affinity purification yields
high-titer rAAV stocks from insect cells. Mol Ther 17: 1888-1896.)
Sf9 insect cells were infected with a baculovirus expressing AAV
rep2, AAV cap 1, and adenovirus helper proteins and a second
baculovirus expressing the miRNA and eGFP flanked by the AAV2
ITR's. The cell lysate was run through an iodixanol gradient
(15%-60% wt/vol), and the iodixanol fraction containing the rAAV
particles was further purified using a Mustang-Q ion exchange
filter membrane. rAAV particle titer was determined by QPCR and
FACS analysis. Vectors were generated by the Gene Transfer Vector
Core at the University of Iowa and sent to the Oregon National
Primate Research Center for injections. Twelve hours before
surgery, all viral vector preps were dialyzed against Formulation
Buffer 18 (Hyclone) to remove salts (3 total hours of dialysis) and
diluted to a final titer of 1e12 vg/ml.
[0323] Magnetic Resonance Imaging and Stereotaxic Surgery.
[0324] Immediately prior to surgery, animals were anesthetized with
Ketamine HCL (10 mg/kg), transported to the MRI, intubated and
maintained on 1% isoflurane vaporized in oxygen for the duration of
the scan. Animals were placed into an MRI-compatible, stereotaxic
surgical frame; a T1-weighted magnetic resonance image (MRI) was
conducted to obtain surgical coordinates (Siemens 3.0 T Trio MR
unit). After scanning, animals were taken directly into the
operating room and prepped for sterile surgery. Each animal
received three microinjections per hemisphere (six injections
total): the first 1 mm rostral to the anterior commissure (12
.mu.l) and the two remaining injections (12 .mu.l and 10 .mu.l,
respectively) spaced 3 and 6 mm caudal to the first injection.
Animals were injected with 1e12 vg/ml of either AAV2/1-miHDS1-eGFP
(n=4), AAV2/1-miCONT-eGFP (n=4) or AAV2/1-eGFP (n=4) at a rate of 1
.mu.l/minute, and the needle was left in place for an additional 5
minutes to allow the injectate to diffuse from the needle tip.
After microinjections were completed, the skull opening was filled
with gelfoam and the incision closed.
[0325] Behavioral Analysis
[0326] General homecage activity: All animals were fitted with
either nylon or aluminum collars (Primate Products) with Actical
accelerometers (Respironics) mounted onto the frame. Each Actical
monitor contained an omnidirectional sensor that integrated the
speed and distance of whole body acceleration and produced an
electrical current that varies in magnitude depending on a change
in acceleration. The monitor was programmed to store the total
number of activity counts for each 1-minute epoch. Animals wore
activity collars 24 hours a day, 7 days a week for 3 weeks prior to
surgery and each week thereafter for the duration of the study.
[0327] MRS: Three independent observes, blinded to group identity,
assessed homecage behavior weekly. Twenty-four separate
putamen-associated behaviors were rated including horizontal and
vertical ocular pursuit, treat retrieval with both forelimbs,
ability to bear weight on both hindlimbs, posture, balance, startle
response and bradykinesias, dystonias and choreas of each limb and
trunk. A score of 0 indicated a normal phenotype while a score of 3
indicated severely abnormal phenotypic movements. All animals were
evaluated on the MRS prior to surgery to obtain baseline scores and
once per week for the duration of the study.
[0328] Lifesaver test: Animals were trained to thread edible, hard
treats from a straight metal rod (straight post) and then tested on
their ability to remove treats from the straight post and a
question mark-shaped post. All manual dexterity tasks were
presented in a Wisconsin general testing apparatus (WGTA) and the
latency to successfully retrieve the treat was measured separately
for the left and right forelimbs. Animals were trained for 21 days
on the straight post. Then, 2 weeks of baseline data were collected
on the straight post only. Two weeks following surgery, animals
were tested twice per week on both the straight post and the
question mark-shaped post. On testing days, each animal was placed
into the WGTA and their movements recorded on digital video. Each
hand was tested two times with a time limit of 5 seconds for the
straight post and 10 seconds for the question mark post to complete
the task. The latency to remove each treat was assessed via Sony
PMB software with millisecond measuring capability at a later
time.
[0329] Necropsy and Tissue Processing.
[0330] Six weeks after surgery, animals were sedated with Ketamine
and then deeply anesthetized with sodium pentobarbital followed by
exsanguination. Brains were perfused through the ascending carotid
artery with 2 l of 0.9% saline, removed from the skull, placed into
an ice-cold, steel brain matrix and blocked into 4-mm-thick slabs
in the coronal plane. Tissue punches used for molecular analyses
were obtained from each animal's left hemisphere of the transduced
putamen (slabs were placed under the fluorescent scope to verify
eGFP-fluorescing regions) and immediately frozen in liquid nitrogen
to preserve DNA, RNA, and protein. Slabs were subsequently
postfixed in 4% paraformaldehyde for histological analyses.
[0331] Quantitative Real-Time PCR.
[0332] RNA was isolated from tissue punches taken from
eGFP-positive putamen using the Qiagen RNeasy kit, as per the
manufacturer's instructions, and reverse transcribed with random
primers and Multiscribe reverse transcriptase (Applied Biosystems,
Carlsbad, Calif.). Relative gene expression was assessed via QPCR
by using TaqMan primer/probe sets for DARPP-32 (Hs00259967_m1), CD4
(Rh02621720_m1), CD8 (Rh02839719_m1), IL1-.beta.(Rh02621711_m1), or
TNF-.alpha.(Rh02789784). All values were quantified by using the
.DELTA..DELTA.CT method (normalizing to 18S) and calibrated to
AAV-GFP-injected putamen. Primers for rhesus HTT mRNA
quantification were designed to flank the miHDS1 binding site in
Exon 52 using Primer Express (Applied Biosystems): Forward:
5'-CGGGAGCT GTGCTCACGT-3' (SEQ ID NO: 201), Reverse: 5'-CATTTCTACC
CGGCGACAAG-3' (SEQ ID NO:202)), and expression was assessed using
SYBR Green detection. At the conclusion, dissociation curve
(melting curve) analysis was performed to confirm specific
amplification.
[0333] Immunohistochemical Analyses.
[0334] 40-.mu.m-thick, free-floating coronal brain sections were
processed for immunohistochemical visualization of eGFP expression
(eGFP, 1:000, Invitrogen), neurons (NeuN, 1:1000, Millipore),
reactive astrocytes (GFAP, 1:2000, DAKO), or microglia (Iba1,
1:1,000; WAKO) by using the biotin-labeled antibody procedure.
Following endogenous peroxidase inhibition and washes, tissues were
blocked for 1 hour in 5% donkey serum, and primary antibody
incubations were carried out for 24 hours at room temperature.
Sections were incubated in donkey anti-rabbit or anti-mouse
biotinylated IgG secondary antibodies (1:200; Vector Laboratories,
Burlingame, Calif.) for 1 h at room temperature. In all staining
procedures, deletion of the primary antibody served as a control.
Sections were mounted onto gelatin-coated slides and coverslipped
with Cytoseal 60 (Thermo Scientific, Waltham, Mass.). Images were
captured by using an Olympus BX51 light microscope and DP72 digital
color camera, along with an Olympus DP Controller software.
[0335] Immunofluorescence Analyses.
[0336] 40-.mu.m-thick, free-floating coronal brain sections were
processed for immunofluorescent visualization of medium spiny
projection neurons (DARPP-32, 1:25, Cell Signaling, Danvers,
Mass.), large cholinergic neurons (ChAT, 1:500, Millipore,
Billerica, Mass.), reactive astrocytes (GFAP, 1:1000, DAKO,
Carpinteria, Calif.), or microglia (Iba1, 1:500; WAKO, Richmond,
Va.). Following washes, tissues were blocked for 1 hour in 5%
donkey serum, and primary antibody incubations were carried out for
24 hours at room temperature. Sections were incubated in donkey
anti-rabbit or anti-goat Alexa-546 conjugated secondary antibodies
(1:500; Invitrogen, Carlsbad, Calif.) for 1 hour at room
temperature. Sections were mounted onto gelatin-coated slides and
coverslipped with Slowfade Gold anti-fade mounting media containing
DAPI (Invitrogen). Images were captured at .times.20 magnification
using a Leica SP5 confocal microscope.
[0337] Stereological Determination of Vector Distribution.
[0338] The Area Fraction Fractionator (Microbrightfield) was used
to quantify the fraction of eGFPpositive cells in the putamen
(right hemisphere only). Every 12th coronal section (1/2 series,
40-.mu.m-thick sections) through the putamen containing GFP.sup.+
cells was selected for analysis. The putamen was outlined under
.times.2 magnification, and a rectangular lattice of points was
overlaid. One marker was used to select points that fell within the
region of interest (putamen), and a second marker was used to
select points that fell within the subregion of interest (contained
GFP-positive cells). The counting frame area was 1000.times.1000
.mu.m, XY placement was 1600.times.1600 .mu.m, and grid spacing was
120 .mu.m. The area fraction estimation of GFP.sup.+ cells in the
putamen was determined by dividing the area of GFP.sup.+ cells by
the area of the putamen and estimates provided were averaged from
all sections quantified. A 3D reconstruction of the eGFP-transduced
putamen was created using StereoInvestigator software by aligning
contours from each section from the rostral to caudal putamen and
placing skins over each. The anterior to posterior spread of eGFP
transduction was determined by locating the most rostral and caudal
sections through the putamen containing GFP and using a combined
MRI and histology atlas of the rhesus monkey brain (Saleem and
Logothetis) to identify the distance between the two (1 mm
resolution).
[0339] Neutralizing Antibody Assay.
[0340] Whole blood was collected in red top Vacutainer Serum Tubes
(BD) from animals prior to surgery and at necropsy, serum was
collected following centrifugation at 2500 rpm for 20 minutes and
stored at -80.degree. C. until analysis. Serum was sent to the
Immunology Core at the University of Pennsylvania for analyzing
AAV2/1 antibody levels via an in vitro transduction assay. A 96
well plate was seeded with Huh7 cells and infected with AAV2/1-LacZ
and serial dilutions of pre- and postsurgery rhesus serum. Values
reported are the serum dilution at which relative luminescence
units (RLUs) were reduced by 50% compared to virus control wells
(no serum sample). The lower limit of detection was a 1/5 dilution,
and anti-AAV2/1 rabbit serum was used at a positive control.
[0341] Statistical Analysis.
[0342] All statistical analyses were performed by using SigmaStat
statistical software (SYSTAT). QPCR analyses for HTT, DARPP-32,
CD4, CD8, IL1-.beta., and TNF-.alpha. expression, as well as Area
Fraction Fractionator analyses, were performed by using a one-way
ANOVA. Upon a significant effect, Bonferroni post hoc analyses were
performed to assess for significant differences between individual
groups. For homecage activity and Lifesaver test analyses, a
two-way, repeated measures ANOVA using group and time as variables
was run to determine differences between groups or over time. Post
hoc analyses were performed when statistically significant
differences were detected. For MRS analyses, a Kruskal-Wallis test
was run followed by a Dunn's pairwise comparison to detect
differences between groups. Correlational data between the area
fraction of GFP in the putamen and presurgical Nab levels were
determined using a Pearson's correlation for parametric data.
Correlational data between the area fraction of GFP in the putamen
and the fold change of Nab titers pre- and postsurgery were
determined using a Spearman correlation for nonparametric data. In
all cases, P<0.05 was considered significant.
[0343] All publications, patents and patent applications are
incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details described
herein may be varied considerably without departing from the basic
principles of the invention.
[0344] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention are to be
construed to cover both the singular and the plural, unless
otherwise indicated herein or clearly contradicted by context. The
terms "comprising," "having," "including," and "containing" are to
be construed as open-ended terms (i.e., meaning "including, but not
limited to") unless otherwise noted. Recitation of ranges of values
herein are merely intended to serve as a shorthand method of
referring individually to each separate value falling within the
range, unless otherwise indicated herein, and each separate value
is incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0345] Embodiments of this invention are described herein,
including the best mode known to the inventors for carrying out the
invention. Variations of those embodiments may become apparent to
those of ordinary skill in the art upon reading the foregoing
description. The inventors expect skilled artisans to employ such
variations as appropriate, and the inventors intend for the
invention to be practiced otherwise than as specifically described
herein. Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
Sequence CWU 1
1
221186RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1cucgagugag cgaugcuggc ucgcaugguc
gauacuguaa agccacagau gggugucgac 60caugcgagcc agcaccgccu acuaga
86286RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2cucgagugag cgcucccggu caucagcgac
uauuccguaa agccacagau ggggauaguc 60gcugaugacc gggaucgccu acuaga
86386RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3cucgagugag cgcuccucuu guuuacgacg
ugaucuguaa agccacagau gggauuacgu 60cguaaacaag aggaacgccu acuagu
86421RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4gucgaccaug cgagccagca c
21521RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5auagucgcug augaccggga u
21621RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6uuacgucgua aacaagagga a
21718RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7cgaccaugcg agccagca 18818RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8agucgcugau gaccggga 18918RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9acgucguaaa caagagga 1810163RNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
10gcguuuagug aaccgucaga ugguaccguu uaaacucgag ugagcgaugc uggcucgcau
60ggucgauacu guaaagccac agaugggugu cgaccaugcg agccagcacc gccuacuaga
120gcggccgcca cagcggggag auccagacau gauaagauac auu
16311163RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 11gcguuuagug aaccgucaga ugguaccguu
uaaacucgag ugagcgcucc cggucaucag 60cgacuauucc guaaagccac agauggggau
agucgcugau gaccgggauc gccuacuaga 120gcggccgcca cagcggggag
auccagacau gauaagauac auu 163128RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 12gugagcga
8138RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13gugagcgc 8149RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14uaaacucga 9156DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 15ctcgag
61610RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16ugguaccguu 10177RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17cgcyuac 7187RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 18cgccuac
7196DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19ctcaga 6206DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20ctcagt 62111DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 21agcggccgcc a
112219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22cunnnnnnnn nnnnnnngg
192319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23ccnnnnnnnn nnnnnnngg
192419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 24cugugaagcc acagauggg
192519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25ccgugaagcc acagauggg 19262RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26uu 2273RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 27uuu
3284RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 28uuuu 4293RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 29cuu 3304RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 30cuuu
4315RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 31cuuuu 5323RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32uag 33386RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 33cucgagugag
cgaugcuggc ucgcaugguc gauacuguaa agccacagau gggugucgac 60caugcgagcc
agcaccgccu acuaga 863421DNAHomo sapiens 34gtcgtggctc gcatggtcga t
213521DNAHomo sapiens 35atcccggtca tcagcgacta t 213621DNAHomo
sapiens 36ctgcttcttt gtcagcgcgt c 213721DNAHomo sapiens
37gcggggcagc aggagcggta g 213821DNAHomo sapiens 38ttcctcttgt
ttacgacgtg a 213921DNAHomo sapiens 39tgggatgtag agaggcgtta g
214021DNAHomo sapiens 40tcccttggaa tgcatatcgc t 214121DNAHomo
sapiens 41aacgtggacc tgcctacgga g 214221DNAHomo sapiens
42agggacagta cttcaacgct a 214321DNAHomo sapiens 43tggggacagt
acttcaacgc t 214421DNAHomo sapiens 44aaggagttca tctaccgcat c
214521DNAHomo sapiens 45gagctggctc acctggttcg g 214621DNAHomo
sapiens 46ctgccccagt ttctagacga c 214721DNAHomo sapiens
47tgccccagtt tctagacgac t 214821DNAHomo sapiens 48gccccagttt
ctagacgact t 214921DNAHomo sapiens 49ccccagtttc tagacgactt c
215021DNAHomo sapiens 50cagctaccaa gaaagaccgt g 215121DNAHomo
sapiens 51ctgctgtgca gtgatgacgc a 215221DNAHomo sapiens
52atggagaccc acaggttcga g 215321DNAHomo sapiens 53ttccgtgtgc
tggctcgcat g 215421DNAHomo sapiens 54tccgtgtgct ggctcgcatg g
215521DNAHomo sapiens 55ctggctcgca tggtcgacat c 215621DNAHomo
sapiens 56cacccttcag aagacgagat c 215721DNAHomo sapiens
57aaccttttct gcctggtcgc c 215821DNAHomo sapiens 58gaggatgact
ctgaatcgag a 215921DNAHomo sapiens 59ccggacaaag actggtacgt t
216021DNAHomo sapiens 60aagcaacgac ctgaagatcg a 216121DNAHomo
sapiens 61ctggagaagt cagaagacga a 216221DNAHomo sapiens
62aaccaagagc ggagcaacga a 216321DNAHomo sapiens 63acgggacaga
attggacgaa a 216421DNAHomo sapiens 64gtggaaaaga ttcatccgaa a
216521DNAHomo sapiens 65cagggtagaa gaaaacgatt t 216621DNAHomo
sapiens 66cggctcagga aagaaacgca a 216721DNAHomo sapiens
67ccccacatgg cccacgtacc t 216821DNAHomo sapiens 68atccaactgc
ccatgcgcca a 216921DNAHomo sapiens 69cgccaatgat gctaatgacg a
217021DNAHomo sapiens 70cagcccattc cagtctcgac a 217121DNAHomo
sapiens 71accccacatg gcccacgtac c 217221DNAHomo sapiens
72agcccattcc agtctcgaca a 217321DNAHomo sapiens 73tcccaatgat
atgtttcgat a 217421DNAHomo sapiens 74tcccaatgat atgtttcgat a
217579RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 75agugagcgau gcuggcucgc auggucgaua
cuguaaagcc acagaugggu gucgaccaug 60cgagccagca ccgccuacu
797657DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 76aaaactcgag tgagcgatgc tggctcgcat
ggtcgatact gtaaagccac agatggg 577756DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77aaaaactagt aggcggtgct ggctcgcatg gtcgacaccc
atctgtggct ttacag 567879RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 78agugagcgcu
cccggucauc agcgacuauu ccguaaagcc acagaugggg auagucgcug 60augaccggga
ucgccuacu 797957DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 79aaaactcgag tgagcgctcc
cggtcatcag cgactattcc gtaaagccac agatggg 578056DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80aaaaactagt aggcgatccc ggtcatcagc gactatcccc
atctgtggct ttacag 568179DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 81agugagcggu
gcuucuuugu cagcgcguuu ccguaaagcc acagaugggg gacgcgctga 60caaagaagca
gcgccuacu 798257DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 82aaaactcgag tgagcggtgc
ttctttgtca gcgcgtttcc gtaaagccac agatggg 578356DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83aaaaactagt aggcgctgct tctttgtcag cgcgtccccc
atctgtggct ttacag 568479RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 84agugagcgac
ggggcagcag gagcgguaga cuguaaagcc acagaugggu uuaccgcucc 60ugcugccccg
ccgccuacu 798557DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 85aaaactcgag tgagcgacgg
ggcagcagga gcggtagact gtaaagccac agatggg 578656DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86aaaaactagt aggcggcggg gcagcaggag cggtaaaccc
atctgtggct ttacag 568779RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 87agugagcgcu
ccucuuguuu acgacgugau cuguaaagcc acagauggga uuacgucgua 60aacaagagga
acgccuacu 798857DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 88aaaactcgag tgagcgctcc
tcttgtttac gacgtgatct gtaaagccac agatggg 578956DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89aaaaactagt aggcgttcct cttgtttacg acgtaatccc
atctgtggct ttacag 569079RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 90agugagcgcg
ggauguagag aggcguuagu cuguaaagcc acagauggga uuaacgccuc 60ucuacauccc
acgccuacu 799157DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 91aaaactcgag tgagcgcggg
atgtagagag gcgttagtct gtaaagccac agatggg 579256DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92aaaaactagt aggcgtggga tgtagagagg cgttaatccc
atctgtggct ttacag 569379RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 93agugagcgcc
ccuuggaaug cauaucguug cuguaaagcc acagaugggu agcgauaugc 60auuccaaggg
acgccuacu 799457DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 94aaaactcgag tgagcgcccc
ttggaatgca tatcgttgct gtaaagccac agatggg 579556DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95aaaaactagt aggcgtccct tggaatgcat atcgctaccc
atctgtggct ttacag 569679RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 96agugagcgca
cguggaccug ccuacggagg ccguaaagcc acagaugggu uuccguaggc 60agguccacgu
ucgccuacu 799757DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 97aaaactcgag tgagcgcacg
tggacctgcc tacggaggcc gtaaagccac agatggg 579856DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98aaaaactagt aggcgaacgt ggacctgcct acggaaaccc
atctgtggct ttacag 569979RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 99agugagcgca
ccgugugaau cauugucuaa cuguaaagcc acagaugggu uagacaauga 60uucacacggu
acgccuacu 7910057DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 100aaaactcgag tgagcgcacc
gtgtgaatca ttgtctaact gtgaagccac agatggg 5710156DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101aaaaactagt aggcgtaccg tgtgaatcat tgtctaaccc
atctgtggct ttacag 5610279RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 102agugagcgaa
gcagcuuguc cagguuuaug cuguaaagcc acagaugggu auaaaccugg 60acaagcugcu
ccgccuacu 7910357DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 103aaaactcgag tgagcgaagc
agcttgtcca ggtttatgct gtgaagccac agatggg 5710456DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 104aaaaactagt aggcggagca gcttgtccag gtttataccc
atctgtggct ttacag 5610579RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 105agugagcgaa
gcagcugugu uagguuuaug cuguaaagcc acagaugggu auaaaccuaa 60cacagcugcu
ccgccuacu 7910657DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 106aaaactcgag tgagcgaagc
agctgtgtta ggtttatgct gtgaagccac agatggg 5710756DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107aaaaactagt aggcggagca gctgtgttag gtttataccc
atctgtggct ttacag 5610879RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 108agugagcgaa
gcuguagcua ugugccuuag cuguaaagcc acagaugggu uaaggcacau 60agcuacagcu
ccgccuacu 7910957DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 109aaaactcgag tgagcgaagc
tgtagctatg tgccttagct gtgaagccac agatggg 5711056DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 110aaaaactagt aggcggagct gtagctatgt gccttaaccc
atctgtggct ttacag 5611179RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 111agugagcgca
gcaggaguua uucugccuua cuguaaagcc acagaugggu aaggcagaau 60aacuccugcu
acgccuacu 7911257DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 112aaaactcgag tgagcgcagc
aggagttatt ctgccttact gtaaagccac agatggg 5711356DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 113aaaaactagt aggcgtagca ggagttattc tgccttaccc
atctgtggct ttacag 5611479RNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotide 114agugagcgca gcgaacgacu uacgcguuua cuguaaagcc
acagaugggu aaacgcguaa 60gucguucgcu acgccuacu 7911557DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 115aaaactcgag tgagcgcagc gaacgactta cgcgtttact
gtaaagccac agatggg 5711656DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 116aaaaactagt
aggcgtagcg aacgacttac gcgtttaccc atctgtggct ttacag
5611779RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117agugagcgca ccaucgaacc gucagaguua
cuguaaagcc acagaugggu aacucugacg 60guucgauggu acgccuacu
7911857DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118aaaactcgag tgagcgcacc atcgaaccgt
cagagttact gtgaagccac agatggg 5711956DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 119aaaaactagt aggcgtacca tcgaaccgtc agagttaccc
atctgtggct ttacag 5612021DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 120ttcgatctgt
agcagcagct t 2112119DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 121gatccgactc accaatacc
1912221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122ttccgaataa actccaggct t
2112319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123acgtaaacaa aggacgtcc
1912421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124aacgttagct tcaccaacat t
2112519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125taacgtaaca gtcgtaaga
1912619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126acagcgagtt agataaagc
1912721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127cacacgggca cagacttcca a
2112821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128aggtgtatct cctagacact t
2112918DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129tgtgctacgt tctacgag
1813019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130tgtggacaaa gtctcttcc
1913119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131tgatgtcata gattggact
1913221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132tctgatctgt agcagcagct t
2113319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 133ggtaagtggc catccaagc
1913419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134cgagttagat aaagccccg
1913519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 135ttaacctaat ctcctcccc
1913619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 136tgatgatggt gcgcagacc
1913719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137tatagagaga gagagaaga
1913821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138ttgatccgga ggtaggtctt t
2113919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139ttggtattca gtgtgatga
1914019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 140ttactctcaa actttcctc
1914119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141tattgtaatg ggctctgtc
1914219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142tgccttggca aactttctt
1914319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 143accaatttat gcctacagc
1914421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144tttgctctgt agcagcagct t
2114519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 145ccaatctcaa agtcatcaa
1914619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 146tagttattca ggaagtcta
1914720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 147aatcaagtag atcctcctcc
2014819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148tgcatctcct tgtctacgc
1914919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149tcaagctctg caaaccaga
1915019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 150atgatgatgg tgcgcagac
1915121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 151tcttctagcg ttgaagtact g
2115221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152tcttctagcg ttgaattact g
2115321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 153gaattgttgc tggttgcact c
2115419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 154taggactagt cacttgtgc
1915519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 155tataatgctc agcctcaga
1915621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156tttgatttgt agcagcagct t
2115721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 157ttttatctgt agcagcagct t
2115819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158gagtctcttg ttccgaagc
1915919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159tatcactcta ttctgtctc
1916019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 160tcaccttcaa actatgtcc
1916121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161attgtcttca ggtcttcagt t
2116219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 162gcactccagg gcttcatcg
1916319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 163aagccccgaa aaccggctt
1916423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164ttgtccagga agtcctcaag tct
2316519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 165ccaaggctct aggtggtca
1916619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 166gcaccactag ttggttgtc
1916721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167tcatctcagc cactctgctt t
2116821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 168gtcatctcag ccactctgct t
2116919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169aatgcagtat acttcctga
1917021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170cacaatggca cagacttcca a
2117121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 171cacaatggcg cagacttcca a
2117221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 172tctcctcagc cactctgctt t
2117321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 173ctcctcagcc actctgcttt t
2117419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174ttcctcaaat tctttcttc
1917519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175ttgtacatca taggactag
1917619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 176ttgtctttga gatccatgc
1917722DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 177tcagcccaca cacagtgctt tg
2217819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178taacaagcca gagttggtc
1917921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 179ttccagaatt gatactgact t
2118019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 180tttcccttgg ccacttctg
1918121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 181aagcagagtt caaaagccct t
2118219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 182ttggggatag gctgtcgcc
1918321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183atcttcaata gacacatcgg c
2118419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184ttccccagct ctcccaggc
1918519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185ttccccaaac ctgaagctc
1918619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186ttcttctcat ttcgacacc
1918719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187gtcctggatg atgatgttc
1918819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188atttcaggaa ttgttaaag
1918919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189ctttcagact ggacctctc
1919021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190actgaggagt ctcttgatct t
2119121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191aagcaaaaca ggtctagaat t
2119219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192ccctccctcc gttcttttt
1919319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193gttgtttgca gctctgtgc
1919419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194attctctctg actcctctc
1919519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195taatacaaag acctttaac
1919621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196tatttaagga gggtgatctt t
2119719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197aagaaatcat gaacaccgc
1919819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198taaacaaagg acgtcccgc
1919919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199aatttttcaa agttccaat
1920079RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200agugagcgca gcgaacgacu uacgcguuua
cuguaaagcc acagaugggu aaacgcguaa 60gucguucgcu acgccuacu
7920118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 201cgggagctgt gctcacgt 1820220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
202catttctacc cggcgacaag 2020385RNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 203nnnagcgagc
gcagcgaacg acuuacgcgu uuacuguaaa gccacagaug ggcaaacgcg 60uaagucguuc
gcuucgccua cunnn 8520421RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 204gcgaacgacu
uacgcguuua c 2120521RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 205aaacgcguaa gucguucgcu u
2120629RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 206nnnaagcgaa cgacuuacgc guuuacnnn
2920729RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 207nnncagccua cacgagacgc guuuacnnn
2920826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208tgtgctggct cgcatggtcg acatcc
2620922RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 209gcuggcucgc auggucgaua nn
2221022RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 210ugucgaccau gcgagccagc ac
2221122RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 211uaaggcagaa uaacuccugc ua
2221222RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 212uuaaggcaca uagcuacagc uc
2221322RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 213gauagucgcu
gaugaccggg au 2221422RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 214uuagacaaug
auucacacgg ua 2221522RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 215uauaaaccug
gacaagcugc uc 2221622RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 216uauaaaccua
acacagcugc uc 2221722RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 217uaaacgcgua
agucguucgc ua 2221861RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 218gcuggcucgc
auggucgaua cuguaaagcc acagaugggu gucgaccaug cgagccagca 60c
6121922RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219gcuggcucgc auggucgaua cu
2222061RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220cccggucauc agcgacuauu ccguaaagcc
acagaugggg auagucgcug augaccggga 60u 6122122RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 221cccggucauc agcgacuauu cc 22
* * * * *